2 Ci3
ISSN 0753-4973
AILTES
INTERNATIONAL JOURNAL OF BATRACHOLOGY
-5 JUN ON
May 2001 Volume 19, N° 1
Source : MNHIN, Paris
ISSCA
International Society for the Study
and Conservation of Amphibians
(International Society of Batrachology)
SEAT
Laboratoire des Reptiles et Amphibiens, Muséum national d'Histoire naturelle, 25 rue Cuvier, 75005
Paris, France. — Tel.: (33).(0)1.40.79.34.87. - Fax: (33).(0)1.40.79.34.88. - E-mail:
[email protected].
BOARD
President: W. Ronald HEYER (Washington, USA).
General Secretary: Alain DuBois (Paris, France).
Deputy Secretary: Annemarie OHLER (Paris, France).
Treasurer: Jean-Louis DENIAUD (Paris, France).
Deputy Treasurer: Rafael DE S4 (Richmond, USA).
Councillors: C. Kenneth Dopp, Jr. (Gainesville, USA); Britta GriLLirscH (Wien, Austria); Julio Mario
Hovos (Bogotä, Colombia): Thierry LODÉ (Angers, France) ; Jon LOMAN (Lund, Sweden); Alain
PAGANO (Angers, France); Stephen J. RICHARDS (Adelaide, Autralia).
TARIFF FOR 2001
INDIVIDUALS
[Regular 2001 subscription to Alytes (volume 19) + ISSCA + Circalytes | 300FF/60$/46 E]
Student 2001 subscription to Alytes (volume 19) + ISSCA + Circalytes 150 FF/30$/23€
:gifthalf-pricesubscription of one year for acolleagueof yourchoice: Halfof price above
Regular 2001 subscription to Alpes (volume 19) alone 280 FF 756 8744€
Student 2001 subscription to Apres (volume 19) alone 140 FF/28$/22€
Back issues of Alyres: any single issue T0FF/14S/11€
Back issues of Alpes: any complete volume (4 issues) 225 FF/45$/35€
Back issues of A/ytes: complete set of volumes 1 to 18 (1982-2000) 3240 FF / 648 $/494€
Regular five-year (2001-2005, volumes 19 to 23) individual subscription to A/ytes +
ISSCA + Circalytes 1500 FF / 300 $/229€
1
Regular five-year (2001-2005. volumes 1910 23) individualsubscriptionto A/ytes 1120 FF/224$/171 €
SrEciaL orrer: five-year (2001-2005, volumes 19 to 23) individual subscription to A/ytes + ISSCA + Cir-
calytes, with complete set of back issues of Alytes(1982-2000, volumes 1 to 18) 3500 FF/700$/534 €)
Life individual subscription to 4/ytes from 2000 on 5600 FF/1120 $/854€
Life individual subscription to A/ytes + ISSCA + Circalytes from 2000 on 7000 FF / 1400 $ / 1067 €
Patron individual subscription to A/ytes from 2000 on 11200 FF / 2240 $ / 1708 €
or more
Patron individual subscription to Alytes + ISSCA + Circalytes from 2000 on: 14000 FF / 2800 $/2135 €
or more
Important notice: from 1996 on, any new life or patron à
complete collection of back issues of Aytes from the first
ividual subscriber to A/ytes is offered a free
ue (February 1982) until the start of her/his
subscription.
INSTITUTIONS
2001 subscription to Alytes (volume 19) + ISSCA + Circalytes 600 FF / 120 $/92
2001 subscription to Alytes (volume 19) alone _ 560 FF/112$/88€
Back issues Of A/ytes: any single issue 140 FF/28$/22€
ny complete volume (4 issues) 450 FF / 90 $/ 70 €
omplete set volumes 1 10 18 6480 FF / 1296 $ /988 €
ve-year (2001-2005, volumes 19 to 23) subscription to Alytes + ISSCA + Circalytes.
Alytes (1982-2000, volumes 1 10 18) 3500 FF / 700 $ / 534 €
Circalytes às the internal information bulletin of ISSCA. Back issues of this bulletin are also available:
prices can be provided upon request by our Secretariat.
MODES OF PAYMENT
— In French Frances or in Euros, by cheques drawn on a French bank payable to “ISSCA”, sent to our
ddress above).
nes or in Euros, by direct postal transfer to our postal account: “ISSCA'”, Nr. 1-398-1 L,
s mode of payment, add 15 FF or 2.30 € to your payment for postal charges at our end.
by cheques payable to “ISSCA”, sent 10 Rafael O. DE S4, Associate Professor.
Department of Biology, University of Richmond, Richmond, VA 23173, USA (e-mail.
[email protected]: fax: (804)289-8233). Source : MNHN, Paris
secretariat (
Bibliothèque Centrale Muséum
Ml
AIVTES
3 3001 00135917 2
INTERNATIONAL JOURNAL OF BATRACHOLOGY
May 2001 Volume 19, N° 1
Alytes, 2001, 19 (1): 1.
Editorial
Alain DuBois
Laboratoire des Reptiles et Amphibiens,
Muséum national d'Histoire naturelle,
25 rue Cuvier, 75005 Paris, France
Following the workshop on “Declining amphibian populations — a global phenomenon?” held in Irvine (California,
USA) on 19-20 February 1990 (see Wake et al., 1991) and the subsequent foundation of the Declining Amphibian
Population Task Force (DAPTF), the study of amphibian population declines and of their causes has become a major
research field (see review in ALrORD & RicHaRDs, 1999). The scientific literature dealing with these questions has been
dispersed in various periodicals. The quarterly journal Froglog, published by DAPTF, regularly provides reviews and
bibliographic lists regarding this field of research. Until now, the journal Alytes has seldom been used as an outlet for the
publication of such reports. This is unfortunate, as Alytes is the only journal in the world entirely dedicated to the
publication of scientific works dealing with amphibians, and as the International Society for the Study and Conservation
of Amphibians (ISSCA), the non-profit association that publishes this journal, has among its statutory aims “to
contribute, on a world scale (... to the conservation of Amphibians and to that of their environment” (ANONYMOUS,
1994: 62). In order to call attention to the possibility of publishing papers dealing with amphibian declining populations,
and, more generally, with all problems related with the conservation biology of amphibians, the ISSCA Board has
decided to create a third position of Editor for the journal, that of Conservation Editor. Stephen J. Richards (Adelaide,
Australia) has agreed 10 take on this responsibility. AÏl amphibian biologists working on questions related to the
conservation of amphibians, to declining populations, their causes and possible remedies, are warmly invited to submit
their manuscripts to Steve. From now on, manuscripis intended for Alyres can be submitted to three different editors,
who will care for their submission to referees, for correspondence with the authors and for the final decision regarding
them:
— Alain Dubois (Laboratoire des Reptiles et Amphibiens, Muséum National d'Histoire Naturelle, 25 rue Cuvier,
75005 Paris, France; <
[email protected]>), for any paper dealing with amphibian morphology, anatomy, systematics,
biogeography, evolution, genetics, anomalies or developmental biology:
— Thierry Lodé (Laboratoire d'Ecologie animale, Université d'Angers, 2 boulevard Lavoisier, 49045 Angers Cedex,
France; <
[email protected]>) for any paper dealing with amphibian population genetics, ecology, ethology or
life history;
Stephen J. Richards (Vertebrates Department, South Australian Museum, North Terrace, Adelaide, S.A. 5000,
Australia; <Richards
[email protected]>) for any paper dealing with declining amphibian populations, amphib-
jan pathology, and more generally with all matters related to amphibian conservation biology.
Another recent decision of the ISSCA Board has bx larity in the publication of Alytes. From
now on, and for an undetermined number of years, the journal will be published as two double (or one single and one
es per year, at fixed dates, in May and November. This schedule will be maintained irrespective of the number
of papers and pages accepted for publication at these dates. The result will be that some issues (like this one) will be
somewhat thin, while others (like next one) will be much thicker: despite this, all effort will be made to provide subscribers
and readers with our usual number of 200 pages or more per year. Hopefully, this change in the publication schedule of
the journal will be appreciated by our subscribk m now on. it will be possible 10 foresee the dates of publication of
the journal, instead of receiving it suddenly at unexpected dates. Our readers are welcome to let us know their feelings
about these new changes in our journal. just before it reaches the age of 20!
LITERATURE CITED
CA. Circalh
nes: a proble
6 (6): 49-84
in applied ecology. Ann. Rer. Ecol. Syst...
Anonymous, 1994. - Statutes
ALFORD, R.A. & RICHARDS, S,
30: 133-165
Wake, D. B. Morowrtz, H. 1. BLAUSTEIN, A. BRaDrORD, D. BURY, R. B., CALDWELL, J., CoRN, P. $., DUROIS, A.
Hart, J, Hayes, M. INGER, Ra NETTMANN, H-K., RAND, A. S. SuIrH, D. Tvisr, M. & Vtt, L.. 1991.
Declining'amphibian populations = globg} phenomenon? Findings and recommendations. Altes 9 (1): 33-42
nd Internal Regulations of
. 1999. - Global amphibian de
Source : MNHN, Paris
Alytes, 2001, 19 (1): 2-4.
A replacement name
for Rana (Paa) rara Dubois & Matsui, 1983
(Amphibia, Anura, Ranidae, Raninae)
Alain Dugois*, Masafumi MATSsUI** & Annemarie OHLER*
* Laboratoire des Reptiles et Amphibiens, Muséum national d'Histoire naturelle,
25 rue Cuvier, 75005 Paris, France
** Graduate School of Human and Environmental Studies,
Kyoto University, Sakyo, Kyoto 606-8501, Japan
A replacement name is proposed for the frog species Rana (Paa) rara
Dubois & Matsui, 1983 from north-western Nepal, as the latter name
proves to be a junior primary homonym of Rana danubina rara E. Fraas,
1903, a name given to a fossil frog species from the Miocene of Germany.
A lectotype is designated here for the latter taxon.
Dugois & MaïTsui (1983: 895) described a new frog species from Rara lake in north-
western Nepal under the name Rana (Paa) rara. DUBoIs (1992: 320) raised the subgenus Paa
Dubois, 1976 to the rank of genus, with three subgenera, and recognized this species as Paa
(Paa) rara (Dubois & Matsui, 1983).
This name, however, cannot be conserved for this species, as it is a junior primary
homonym in the genus Rana, being preoccupied by the name Rana danubina var. rara E.
Fraas, 1903. The history of the latter name, however, is a little complicated, and deserves some
discussion.
In à paper dealing with the Miocene fossil fauna of Steinheim am Albruch (48°41°N,
10°03'E; Baden-Württemberg, Germany), Oscar FRAAS (1870: 291) mentioned once the new
name Rana rara, but without providing any information about this species: as rightly
remarked by SANCHIZ (1998: 142), this name is therefore a nomen nudum, without nomen-
clatural status. According to this later author, this name was based on a tibio-fibula, still kept
in the collection of the Staatliches Museum für Naturkunde of Stuttgart under number
SMNS 80207, and which “probably belongs to a small mammal (R. Bôttcher, in litt., 1995)”.
More than thirty years later, E. FRAAS (1903) described in detail a complete articulated
fossil frog skeleton from the Miocene of Steinheim, for which, instead of coining a new name,
he used the name rara proposed by his father, but as a subspecific name, using the combination
Rana danubina var. rara. SANCHIZ (1998: 130) stated that, in this combination, the specific
epithet danubina was an “unwarranted spelling change” for the specific name Rana danu-
biana, proposed by MEYER (1858: 203), but this does not tell us whether this epithet h:
not, a status in nomenclature (see e.g. DuBois, 1987, 2000). Actually, the spelling danubina
Source : MNHN, Paris
Duois, MATSUI & OHLER 3
introduced by MEYER (1860: 142), who used it consistently in his text and figure legend, so that
we regard it as an unjustified emendation of danubiana, therefore a name having an indepen-
dent status in nomenclature and its own author and date (i. e., MEYER, 1860).
As for the epithet rara, E. FRAAS (1903: 105-106) borrowed it to his father’s work (where
it applied to an isolated tibio-fibula), but used it to name the new complete skeleton collected
by A. Pharion in 1902, and also applied it with some doubts to a third specimen from
Steinheim, a radio-ulna found by C. Joos. He provided (E. FRAAS, 1903: 107-108) a very
detailed description of the complete skeleton, with measurements. Earlier in the paper (E.
FRAAS, 1903: 105), he had also given a photograph of this fossil that clearly shows a frog. As
rightly commented by SANCHIZ (1998: 130), by providing a description, E. FRAAS (1903) gave
for the first time a nomenclatural status to the epithet rara, as Rana danubina rara E. Fraas,
1903.
Because he assumed that only one specimen was involved, SANCHIZ (1998: 130) stated
that the “holotype” of this nominal species was the complete articulated skeleton found by A.
Pharion in Steinheim, still kept in Stuttgart under number SMNS 11354, and that should be
referred to the “Rana (ridibunda) group” (SANCHIZ, 1998: 130), i.e. to the subgenus Rana
(Pelophylax) (Dusois & OnLER, 1995). However, E. FRAAS (1903) never used the terms
“holotype” or “type” for this skeleton, and his use of the name Rana rara proposed by his
father suggests that the name Rana danubina rara must be considered based on at least two
syntypes, the original isolated tibio-fibula and the new articulated skeleton; whether or not it
was also based on the third specimen, the isolated radio-ulna, is more open to discussion, but
the inclusion of the original bone (implied by the use of the name rara) suggests that it was
also the case for this second isolated bone. Because both isolated bones are of doubtful
taxonomic allocation (and possibly not frogs), it is important for the future allocation of the
name rara to designate a lectotype among these two (or three) syntypes. To stabilize definitely
the status of this name, we hereby designate the articulated skeleton, SMNS 11354, as
lectotype of Rana danubina rara E. Fraas, 1903. This name was considered by SANCHIZ (1998:
130) as a junior subjective synonym of Rana danubiana Meyer, 1858, a name based on an
incomplete articulated frog skeleton from the Miocene of Günzburg (48°27°N, 10°16'E;
Bayern, Germany), that was “presumably destroyed in 1944” (SANCHIZ, 1998: 130). Stabili-
Zation of the nomenclatural status of the latter name (considered as a “nomen dubium” by
Sancuiz, 1998) would require the discovery and designation as neotype of another specimen
from Günzburg and from the same stratigraphic level as the lost holotype, which is not the
case of the lectotype of Rana danubina rara (see SCHLEICH, 1981).
To the best of our knowledge, after E. FRAAS’S (1903) paper, his name rara was
mentioned only twice in the literature: by KUHN (1938: 16), as Rana danubiana var. rara, and
by SaNCHIZ (1998: 130), as a junior subjective synonym of Rana danubiana Meyer, 1858. A
neotype designation would stabilize definitively this synonymy. Nevertheless, even if the name
Rana danubina rara disappeared definitely from scientific literature as a permanent junior
synonym, this would have no bearing on the nomenclatural availability of this name (for more
details, see DuBois, 2000), and the epithet rara E. Fraas, 1903 will always remain available and
will preoccupy the use of the same epithet in the nominal genus Rana.
As a matter of fact, according to Articles 57 and 60 of the Code (ANONYMOUS, 1999), a
junior primary homonym “is permanently invalid” and must be replaced. As the name Rana
Source : MNHN, Paris
4 ALYTES 19 (1)
(Paa) rara Dubois & Matsui, 1983 is not known to have a synonym, we have to provide a
nomen novum (new replacement name) for the Paa species. Therefore we propose the nomen
novum Paa (Paa) rarica for the species described by Dugois & MaTsuI (1983). The adjective
rarica means “from Rara”, “living in Rara”, and refers to the type-locality of the species,
Rara lake (Rara Daha; 29931°N, 82°05°E; 2990 m; Jumla Province; Nepal), which until now
remains the only known locality of occurrence of the species.
ACKNOWLEDGEMENTS
For bibliographic advice, information, and comments on an earlier draft of this paper, we are pleased
to thank France de Lapparent de Broin (Paris, France), Borja Sanchiz (Madrid, Spain), Miguel Vences
(Paris, France) and an anonymous reviewer.
LITERATURE CITED
ANONYMOUS [International Commission on Zoological Nomenclature], 1999. — International code of
zoological nomenclature. Fourth edition. London, International Trust for zoological Nomencla-
ture: i-xxix + 1-306.
Dumois, A., 1987. - Again on the nomenclature of frogs. A/yres, 6 (1-2): 27-55.
_— 1992. - Notes sur la classification des Ranidae (Amphibiens, Anoures). Bull. Soc. linn. Lyon, 61 (10):
305-352.
ss 2000. - Synonymies and related lists in zoology: general proposals, with examples in herpetology.
Dumerilia, 4 (2): 33-98.
Dumoïs, A. & MATSUI, M. 1983. - À new species of frog (genus Rana, subgenus Paa) from western Nepal
(Amphibia: Anura). Copeia, 1983: 895-901.
Dumois, A. & OHLER, A., 1995. — Frogs of the subgenus Pelophylax (Amphibia, Anura, genus Rana): a
catalogue of available and valid scientific names, with comments on name-bearing types, complete
synonymies, proposed common names, and maps showing all type localities. Zool. Polon., (1994),
39 (3-4): 139-204.
FRAAS, E., 1903. - Rana danubina H. v. Meyer var. rara O. Fraas aus der Obermiocän von Steinheim.
Jahresheften des Vereins für vaterländische Naturkunde in Württemberg, 89: 105-110.
FRAAS, O., 1870. - Die Fauna von Steinheim. Mit Rücksicht auf die miocänen Säugethier- und Vogel-
reste des Steinheimer Beckens. Jahreshefte des Vereins für vaterländische Naturkunde in Württem-
berg, 26: 145-306, pl. 4-13.
KUHN, O., 1938. — Anura. /n: O. KUHN, Fossilium catalogus, 1, Animalia, Pars 84, Stegocephalia
(Labyrinthodontiis exclusis), Urodela, Anura, Nr. 3, Anura, The Hague, Junk: 1-26.
MEYER, H. v., 1858. - [Untitled report.] Neues Jahrbuch Mineralogie Geognosie Geologie Petrefakten-
07.
Gebilden Deutschland’s. Palacontographica, Beiträge zur Naturges-
el, 7 (8): 123-182.
Sancuiz, B. 1998. - Salientia. Zn: P. WELLNHOrER (ed), Handbuch der Paläoherpetologie, Teil 4,
München, Friedrich Pf ii + 1-275.
Scuueicn, H. H., 1981. -Jungtertiäre Schildkrôten Süddeutschlands unter besonderer Berücksichtigung
der Fundstelle Sandelzhausen. Cour Forsch. Senckenberg, 48: 1-372
Corresponding editor: Miguel VENCES.
© ISSCA 2001
Source : MNHN, Paris
Alytes, 2001, 19 (1): 5-28. 5
Systematics of Fejervarva limnocharis
(Gravenhorst, 1829)
(Amphibia, Anura, Ranidae)
and related species.
2. Morphological and molecular variation
in frogs from the Greater Sunda Islands
(Sumatra, Java, Borneo)
with the definition of two species
Michael VerrH*, Joachim KosucH*, Annemarie OHLER** & Alain DUBOIS**
* Institut für Zoologie, Jniversität,
bt. Okologie, Johannes Gutenberg
r. 21, 55099 Mainz, Germany
** Laboratoire des Reptiles et Amphibiens, Muséum national d'Histoire naturelle,
25 rue Cuvier, 75005 Paris, France
Frogs of the species Fejervarva limnocharis and related species are
among the most common in Southeast Asia. We studied 52 individuals from
eight populations of the Great Sunda Islands by means of allozyme electro-
phoresis, mtDNA sequencing and morphometry. Patterns of variation of all
characters among populations were congruent in separating one Javanese
population from all other populations (Java, Sumatra, Borneo) as a distinct
species. The frequencies of four distinct mid-dorsal stripe showed no
distinct geographic pattern. Morphometric analysis unambiguously permits
assignment of the name Rana limnocharis Gravenhorst, 1829 to the
widespread form that occurs in Java, Sumatra and Borneo. The two taxa
recognised in this study occur in sympatry in Java. As the taxon known only
from Java lacks a name, we describe and name it.
ABBREVIATIONS
FMNH Field Museum of Natural History, Chicago, USA.
MNHN Muséum National d'Histoire Naturelle, Paris, France.
RMNH Nationaal Natuurhistorisch Museum, Leiden, Netherlands.
ZFMK Zoologisches Forschungsinstitut und Museum Alexander Koenig, Bonn,
Germany.
Source : MNHN, Paris
6 ALYTES 19 (1)
INTRODUCTION
Description of existing biodiversity is one of the main goals of conservation biology.
Especially in the tropics very little is known about the real number of species and our
knowledge on intraspecific variability of tropical animal and plant species is even lower. The
Amphibia of most parts of the Oriental faunal region have been poorly studied until now
(INGER, 1999). This holds especially for the Greater Sunda Islands, although two reviews of its
batrachofauna were recently published (MANTHEY & GROSSMANN, 1997; INGER & STUEBING,
1997). Within the last decades, many new species have been described from these islands based
on morphological traits (e.g., INGER, 1989; INGER & GriTis, 1983; INGER & STUEBING, 1991,
1997). However, the few biochemical studies on Southeast Asian anurans have made apparent
that a great amount of cryptic variation is present within species (e.g., INGER et al., 1974;
DonxELLAN et al., 1989; KosuCH et al., 1997; Topa et al., 1998a).
The ranid genus Fejervarya Bolkay, 1915 is distributed throughout Southeast Asia
(Dusois & OHLER, 2000). These species show substantial morphological and colour variation
over their distribution range. In Nepal, studies of mating calls showed the co-existence of four
species (Dugois, 1975). In their study on genetic divergence among Southeast Asian Rana
limnocharis, Top et al. (1997, 1998a-b) discovered genetic divergence and sympatric cryptic
species in this group without morphological differentiation.
The present study focuses on the variation within frogs known as Fejervarya limnocharis
(Gravenhorst, 1829) in the Greater Sunda Islands, a group of frogs that are known to be
abundant in areas of intensive human activities (INGER, 1966; INGER & STUEBING, 1989;
MANTHEY & GROSSMANN, 1997). To describe the pattern of variation in this common frog
group we compared the within- and between-island variability of molecular and morpholog-
ical traits.
The nomenclatural situation in this group of frogs was presented in detail in part 1 of this
series of papers (DuBois & OHLER, 2000). Generic classification follows Dumois (1992),
slightly modified by phylogenetic data of DNA analysis (MARMAYOU et al., 2000). In order to
formalise the systematic position of the different forms of Fejervarya found in our genetic
analysis, we linked molecular data to morphometric data. This allows us to cross-reference old
names based on museum specimens with results of modern molecular population studies.
MATERIAL AND METHODS
Frogs were collected from six natural populations or bought from local fish markets of
Java (J), Sumatra (S) and Kalimantan (K), the latter being the Indonesian part of Borneo (fig.
D: 11 (4 specimens, FMNH 256721-256724), swampy meadow along the road between Bogor
and Parung; J2 (11 specimens, FMNH 256725-256733, MNHN 1997.4916, ZMFK 68867),
paddy field at Chianjur; KI (2 specimens, FMNH 256734-256735), fish market at Pontianak:
K3 (12 specimens, FMNH 256736-256747), paddy field at the village Desa Lape; SI (13
specimens, FMNH 256749-256761), fish market at Medan: S2 (2 specimens, FMNH 256762-
256763), paddy field and small brook at village Sidikalang: SS (5 specimens, FMNH 256764-
Source : MNHN, Paris
VEITH, KOSUCH, OHLER & DuBoIs 7
Borneo
Sumatra
Fig, 1. - Sample localities of Fejervarya on the Great Sunda Islands, Indonesia (* refers to the sample
locality 3/4 of Toba et al., 1998u).
256768), frogs collected by inhabitants at a small village about 10 km SE Tapaktuan; S6 (3
specimens, FMNH 256769-256771), frogs collected by inhabitants of the village Desa Seleu-
Kat near Tapaktuan. In the molecular analyses we used the ranids Fejervarya cancrivora
(Gravenhorst, 1829) (Kalimantan, Borneo), Rana temporaria Linnaeus, 1758 (Germany) and
Rana catesbeiana Shaw, 1802 (from a frog farm at Java) as outgroups.
A specimen from the collection of Heinrich Kuhl from Java (RMNH 4287), designated
as neotype of Rana limnocharis Gravenhorst, 1829 by Dugois & OHLER (2000), was included
in a discriminant analysis for nomenclatural decisions.
Sex of all specimens was determined either by presence of secondary sexual characters or
by observation of gonads through small lateral or ventral incision on the frogs (most of the
frogs were ventrally opened because of tissue dissection in the field).
ALLOZYME ELECTROPHORESIS
Pieces of fresh muscle and liver were dissected and stored in liquid nitrogen. Frogs were
preserved for determination and morphometry in 70 % alcohol after pre-fixation in 10 %
formaldehyde.
Source : MNHN, Paris
8 ALYTES 19 (1)
Allozyme electrophoresis was carried out on muscle and liver homogenates on cellulose
acetate gels (RICHARDSON et al., 1986). Twelve enzyme systems providing information on 15
presumptive gene loci were stained according to HEBERT & BEATON (1986). Gels were run in
three different buffer systems: tris-glycine, pH 8.5 [acon-1 and -2 (E.C. 4.1.1.3), fum (E.C.
4.2.1.2), aat-1 and -2 (E.C. 2.6.1.1), mdh (E.C. 1.1.1.37), pépoiyeu (EC. 3.4.1), pgm (E.C.
54.22) and tpi (E.C. 5.3.1.1)], tris-citrate, pH 7.0 [idh-1 and -2 (E.C. 1.1.1.42), me (E.C.
1.1.1.40) and mpi (E.C. 5.3.1.8)] and phosphate, pH 8.0 [44h (E.C. 1.1.1.27) and pk (E.C.
2.7.1.40)]. Average expected heterozygosity (H,) and mean number of polymorphic loci (P)
were calculated as population characteristics using the computer program G-STAT (SiGis-
MUND, 1993). Ners (1972) standard genetic distance estimates and UPGMA cluster analysis
were calculated using the program NTSYS (RouLr, 1990).
DNA-SEQUENCING
DNA was extracted from frozen muscle tissue using the standard phenol-chloroform
protocol of SAMBROOK et al. (1989). Double-stranded PCR amplification was performed in
50 ul reactions containing 1 unit of Tag polymerase, 5 yl of 10 X reaction buffer (Bochringer),
250 ymol each of dGTP, dATP, dT TP and dCTP, 20 pmol each of light- and heavy-strand
primers and 1 yl of mtDNA extract. The primers 16Sa-L and 16Sb-H (KoCHER et al., 1980)
amplified a double-stranded DNA segment of 560 bp of the mitochondrial 168 ribosomal
RNA gene. Thermal cycling was carried out in a programmable heating block (Perkin Elmer
Gene Amp PCR System 9600) for 35 cycles (initial denaturation step of 90 s at 94°C,
denaturation for 45 s at 94°C, primer annealing for 45 s at 55°C and extension for 90 s at 72°C).
PCR products were purified with a PCR purification kit (QuiaQuickspin) and directly
sequenced with a sequenase kit (Amersham) using only primer 16Sa-L. The products of the
sequencing reaction were resolved by the automatic sequencer 377 of Applied Biosystems.
After sequence alignment with CLUSTAL-W (HiGGiNs & SHARP, 1993), the alignment
was adjusted manually. The aligned 390 bp sequence corresponds to nucleotides 4039-4429 in
the Xenopus laevis mitochondrial genome (RoE et al., 1985). Phylogenetic relationships were
determined using maximum parsimony (PAUP, version 3.1.1; SWOFFoRD, 1993) and maxi-
mum likelihood approaches (PHYLIP, version 3.5c; FELSENSTEIN, 1993). For maximum
parsimony analysis, 1000 bootstrap replicates were run to test for confidence in the topology
of the phylogenetic trees (FELSE: IN, 1985).
Sequences have the GenBank accession numbers AF346810-AF346811, and the EMBL
accession numbers AJ292014-A7292023.
MORPHOMETRY
Twenty-seven measurements of 39 adult specimens were taken with a slide caliper to
0.1 mm precision or for measurements smaller than 5 mm with an ocular micrometer to the
nearest 0.01 mm (app. 1). To control for isometry, all measurements were divided by snout-
vent length (SVL), expressed as per thousands of SVL, or transformed into the Neperian
logarithm. Male and female specimens were grouped after their homogeneity was established
Source : MNHN, Paris
VEITH, KOSUCH, OHLER & DUBOIS 9
(OHLeR, 1996). For morphometrical analyses we used SPSS statistical programs for personal
computers (NoRUSIS, 1992).
Morphological analysis should test if genetically close populations from different islands
are also morphologically homogenous and, conversely, if the two genetically differentiated
species can be distinguished by their morphology. Non-parametric Kruskal-Wallis test was
performed to measure morphological variation in Fejervarya specimens of different islands.
Differentiation between genetically distinct samples was tested using non-parametrie Mann-
Whitney U test.
Discriminant analysis
Groups obtained by the molecular analyses were subjected to a discriminant analysis
(Norusis, 1992). The measurement data for the female neotype of Rana limnocharis were
incorporated into the analysis after the production of the original discriminant function
model based on all other data, following examples of nomenclatural clarification using this
approach (HEYER, 1994; Ouer, 1999; OnLer & Dugois, 1999).
Colour patterns
Frogs of the genus Fejervarya are known to frequently have mid-dorsal stripes, which are
an interesting character for evolutionary biology studies (see e.g. MILSTEAD et al., 1974;
Dugois, 1980). Heritability studies by MoriWwakI (1953) and MoHaNTY & DurrA (1999)
suggested that presence or absence of a dorsal line in Fejervarya is coded by two alleles of
a single locus. The allele for the striped phenotype appears to be dominant over that for
the unstriped one. However, MoriWaki (1953) and others (e.g., SHiBATA, 1988) only
discriminated between two phenotypes (striped and unstriped). DuBois (1977) and MOHANTY
& Durra (1999) distinguished between three phenotypes: a pattern showing no line at all, a
pattern showing a fine line and a third pattern showing a wide stripe. The patterns are not
distributed equally in the four different species of Fejervarpa from Nepal which can be
distinguished by their mating calls: whereas Æ teraiensis (Dubois, 1984) and Æ pierrei
(Dubois, 1975) show all three different patterns, hadrensis (Annandale, 1919) does not
show the wide stripe phenotype, and all Æ nepalensis (Dubois, 1975) specimens have mid-
dorsal stripes (DuBois, 1977).
Four mid-dorsal patterns can be recognised in the Fejervarya specimens that we studied
(fig. 2): (1) no mid-dorsal line or stripe: (2) a fine clear mid-dorsal line alone present: (3) a wide
mid-dorsal stripe alone present; (4) both a fine line and a wide stripe present, superimposed.
Presence and absence of both kinds of lines as well as frequency of combination of the two
lines and their distribution among populations were noted, and their pattern of variation was
studied using Kruskal-Wallis test.
Source : MNHN, Paris
OT
(D 61 SHLATV
Fig. 2.—(a) Holotype of Fejervarva iskandari, MNHN 1997.4916, from Chianjur, Java, phenotype no line/no stripe, 168 haplotype J2-C: (b) Fejervarya
limnocharis from Desa Lape, Bornco. phenotype line/stripe, 16S haplotype K3-A; (c) Fejervarva limnocharis from Tapaktuan 2, Sumatra, phenotype
line/no stripe, 16S haplotype S5-A. Drawings by Käthe Rehbinder, Mainz.
Source : MNHN, Paris
VerrH, KosuCH, OHLER & DUBoIS 11
RESULTS
ALLOZYME VARIATION
Of the 15 allozyme loci studied, five were monomorphic (fun, idh-1, idh-2, me, pk) within
and between the Fejervarya samples. Acon-1, acon-2 and /dh were monomorphie within
populations, but exhibited a fixed allelic difference in population J2 relative to all other
populations (app. 2). Between populations J1 and J2 further allelic differences appeared to be
fixed at the loci aat-2, mpi and pep. Thus, these two geographically closely related populations
did not share alleles at six out of 15 loci.
Intra-populational genetic variability (4,) was lowest in the Sumatran samples with the
exception of sample S1 from the Medan fish market. This was the only sample that showed
significant genotype deviations from Hardy-Weinberg expectation at two loci (mpi and pep; P
< 0.05) due to a lack of heterozygous specimens, indicating a mix-up of different populations.
Sample S5 was completely monomorphic. Three to six loci were polymorphic in the Javanese
and Borneo samples, even though sample sizes were in some cases lower than for S5.
NErs (1972) standard genetic distance between populations ranged from 0.004 between
SI and S2 and 0.337 between J2 and SS (tab. 1). Population J2 was the genetically most
distinct. It was separated even from the geographically close population J1 by a relatively high
genetic distance estimate of 0.316. The Borneo and Sumatra populations formed distinct
clusters in the UPGMA phenogram (fig. 3).
MTDNA SEQUENCE DIVERGENCE
We sequenced 390 bp of the mitochondrial 16$ rRNA gene from 52 individuals of
Fejervarva and from the three outgroup species. One hundred twenty seven bp positions were
variable. Samples of Fejervarya comprised nine different haplotypes (tab. 2) with 60 sites being
variable among them. Fifty-two of these variable sites were parsimonious informative, 49 of
which supported the monophyly of either of the two main haplotype lineages.
The average substitution rate between the haplotypes of population J2 and the remaining
populations from Java, Sumatra and Borneo was 0.135. This is only about 0.02 less than
between either of the two Fejervarya forms and FE cancrivora, thus suggesting the differenti-
ation of J2 from the other Fejervarya limnocharis populations as distinct species.
The maximum parsimony and maximum likelihood trees produced exactly the same
topology with two rather homogeneous but well differentiated groups of Fejervarya mito-
chondrial 16S haplotypes (tab. 3). Bootstrap support in the maximum parsimony tree was
100 % for both clades (fig. 4) which we subsequently name JT and J2. No further significant
topology was found within the two clades.
Source : MNHN, Paris
12 ALYTES 19 (1)
Table 1. - NEI°s (1972) standard genetic distance estimates between 9 samples of Fejervarya
from Java (J), Kalimantan (K) and Sumatra (S). See text (Material and methods) for
details on localities. Sample Kc belongs to the species Fejervarya cancrivora.
Table 2. — Variable bp positions of a partial sequence of the mitochondrial 168-rRNA gene of nine
Fejervarya and three outgroup taxa haplotypes.
00000000000000000011111111111111111122222222222222222222222222222222
11244555666778888800444688888999999900000000111111111222222222233333
580074673586725678143574145781346789012346780123467890123456 78912356
Fejarvarya J2-B CGCATAGGACECCACCTCTOGTACCATAGACCAATCAACACACTATOTAATTCTTTCTECCCCGCTTT
Fejervarya J2-A von
Fejervarya J2-C
Fejervarya J1-A
Fejervarya J1-B
Fejervarya K1-A
Fejervarya K3-A
Fejervarya S5-A
rejervarya S6-A hu *;
F. cancrivora Ke T..C.TAR...T.G...TC.T.C...CGA..TT.G.CC.T.C.CCCAA.
Rana temporaria -A.C.. .ACTC. TG. TAT. TCA.GTCCC.CT.GTG.CC-T. . .CC.TA.CACAAGAGAT.
Rana catesbeiana .A.CC.A.TIC. .G.TATC.T. . .TTCTACT. .TG.CC-T-TA. .A. . TCACAAGAAA .
+++ TA... .GACT.G.CT. .TCT. .C.ATACC. .
++. TA... .GACT.G.CT. . TCT. .C.ARACC.
GACT.G.CT. . TCT. .C.AAACC. .
GACT.G.CT..TCT. .C.AAACC. .
GACT.G.CT..TCT. .C.AAACC. .
22222222222222222222233333333333333333333333333333332333333
35566777788888899999900001111112233333334444444445555566678
838690139124568235678078923478959012678901234567814 78901800
Fejervarya J2-B GTAACATT- CGCGTCA- TA -ACCAAGCCCGCGCGACTTGACGTTTTTTITAATATTCAC
Fejervarya J2-A .............. re SU RE
Fejervarya J2-C
Fejervarya J1-A
Fejervarya J1-B
Fejervarya K1-A
Fejervarya K3-A
Fejervarya S5-A
+C.C.CT.TTA. ATT. A
+C.C.CT.TTA. AIT. A.
:C:C.CT.TTA. .ATIT.A.
++... CT. TTA. AIT. A.
Fejervarya S6-A st CIC CÉSTTAS ART A)
F. cancrivora Kc LATE TR COCO. «0e 4 Tuer
Rana temporaria AG.T.T.ACTA.AAT-CA.C...,T.A.A. . .TACT-
Rana catesbeiana AG.TTTAA.TA.AAT-CA.C..T.C.ATAC. .TACTC.A.
ÉCEEEER
Source : MNHN, Paris
VEITH, KOSUCH, OHLER & DUBOIS 13
Table 3. - Average substitution rate between samples of the two Fejervarya lineages J1 and
J2 and three outgroup taxa; transitions and transversions were weighted equally; gaps
treated as fifth base.
132 lineage | F cancrivora | R. temporaria
J1 lineage (J/K/S) | 0.006 + 0.004
J2 lineage 0.135 + 0.004 | 0.006 + 0.003
Æ. cancrivora 0.160 + 0.001 | 0.155 + 0.001 F
R. temporaria 0.219 + 0.002 | 0.229 + 0.001 0.210 à
R. catesbeiana 0.209 + 0.002 | 0.212 + 0.002 0.192 0.112
ARR ITEENAS
MORPHOMETRIC VARIATION
For all measurements and ratios, the mean, standard deviation and minimum and
maximum values are given for adult specimens of Fejervarya separating samples by sex and
geographical origin (app. 3). Comparisons of adult individuals using the Kruskal-Wallis test
(tab. 4) show significant differences in the frogs from the three islands in the ratios which all
concern head shape (head length, distance between anterior border of eyes, distance between
posterior border of eyes, internarial distance). Fejervarya from Java have significantly shorter
heads and more pointed snouts than the frogs from Sumatra and Borneo. Frogs from Sumatra
are significantly distinct in having a greater distance between posterior border of eyes (app. 3,
tab. 4).
Dorsal pattern
In the populations we studied, 32.1 % of the specimens have no mid-dorsal stripe, a fine
mid-dorsal line is present in 57.6 % of all specimens examined, a wide stripe in 30.5 % of the
specimens, and the combined fine-wide striped phenotype was observed in 15.3 % of the
specimens (tab. 5).
1 line and FE females have a combination of both
0181, 4 = 3, P < 0.001). Neither males nor females differ
in a significant manner from the overall distribution of dorsal pattern (chi-square test: males,
5.7635, df = 3, P > 0.05; females, .1466, df = 3, P > 0.05).
The different populations can be put in three groups: a series of populations showing no
wide stripe phenotypes (group 1 in table 5); a population from Sumatra showing no narrow
line pattern (group 3 in table 5); and a group of populations showing all four patterns (group
2 in table 5). Statistical test shows heterogeneity of phenotype ibution for the wide stripe
pattern between populations studied (Kruskal-Wallis tes! 38, df = 7, P < 0.01).
Distribution between populations for narrow line pattern is not statistically heterogeneous
(Kruskal-Wallis test: ;? = 12.05, df = 7, P > 0.05). The population from Chianjur is in the
More males lack a mid-dor:
Source : MNHN, Paris
14 ALYTES 19 (1)
Neïs (1972) standard genetic distance
0.32 0.24 0.16 0.08 0.00
J2
Fig. 3.— UPGMA phenogram of Ners (1972) standard genetic distances between the Fejervarya samples
(allozyme data); the tree is rooted by the outgroup Féjervarya cancrivorar the cophenetic value is 0.99.
same dorsal pattern group as the population from Desa Lape (Borneo) and the population
from Medan (Sumatra). The two Javanese populations are not in the same dorsal pattern
group.
In conclusion, populations of Fejervarya from the Sunda Islands show statistically
significant variation of dorsal colour patterns, but this variation is not congruent with
allozyme or mtDNA variation as shown in this study.
To which population does the name Rana limnocharis Gravenhorst, 1829 apply?
The name-bearing type provides the objective standard of reference by which the
application of the name it bears is determined (ANONYMOUS, 1999: Article 61.a). Generally,
taxa have been described using morphological methods, and new techniques are rarely
applicable to dead museum specimens. Systematics is, however, a largely historical science, as
new results are added to previous knowledge. One scope of modern science therefore is to
define methods to find quantifiable links between historical museum specimens (especially
type-specimens) and new material studied by modern methods.
Multivariate statistics have been used to refer single type-specimens to biologically
defined populations (HEYER, 1994; OHLer, 1996, 1999; OnLer & DuBois,1999). This also
applies to the case of the two Fejervarva lineages here defined by allozyme and DNA data.
The historical specimen of Heinrich Kuhl, who first collected the species Rana limnocha-
ris, Was a judicious choice for a neotype (see DuBois & OHLER, 2000). In order to find out to
Source : MNHN, Paris
VEITH, KoSUCH, OHLER & DUBOIS
15
Table 4. - Comparison by Kruskal Wallis test of snout-vent length (SL) and of ratios of measurements in adult
specimens of Féjervarva from different origins. For each sample, minimum and maximum values, mean
and standard deviation are given. df, degree of freedom: », sample size; P, probability; *, significance
level P < 0.05.
EL/SVL
EN/SVL
FLL/SVL
FOL/SVL
FTL/SVL
HAL/SVL
HL/SVL
HW/SVL
IBE/SVL
IFE/SVL
IMT/SVL
IN/SVL
/SVL
MBE /SVL
MFE/SVL
MN/SVL
svL
TEL/SVL
TL/S
TYD/SVL
WI/SVL
WIL/SVL
WIF/SVI
96-117
1084 106
86—91
8842.55
196-221
2094 126
496-554
5234292
303-324
3164116
176-221
1994225
329-375
3564241
342-360
3504 9.34
210-246
2324188
129-145
1384 8.60
44-56
504626
66-69
684 1.58
96-126
1084 154
140-154
145481
221-255
2374175
306-326
3144107
444-552
4844 5.91
114-130
1234 7.97
489-532
504 4 23.9
63-66
654 1.86
35-40
372245
73-102
834165
75-87
824591
55-79
644127
86-108
964112
97-129
1124 8.59
80-101
914545
191-227
2154912
490 563
5334204
292-338
3194144
173-219
1974 132
369-448
3884178
332-365
3474103
208 249
2254115
135-162
1472 8.87
45-57
514321
68-79
734313
103-123
1164495
137-171
1494110
226-294
2494160
310-393
3304192
32.6- 59.0
486 à 836
102-130
1184 6.76
475-537
142171
58-69
634333
32-44
394332
63-92
774826
65-88
7747.39
40-75
604897
74-100
874869
109— 126
1154 4.60
81-95
894 4.70
207-230
2214 6.80
465-560
5304241
273-344
3194168
180-223
2034 12.0
363-416
3914145
319-367
3482133
217-273
2384148
141-173
1564 10.1
46-57
5143.49
66-85
7544.69
108 125
1184538
135-193
1584 173
229-279
2524147
304-373
3354162
362-542
46.1 + 6.06
105-135
1234784
465-534
5084 16.9
59-73
6644.05
27-49
402474
52-97
784122
63-92
794878
46-79
#= 2.010
P=0366 ns
5259
P-0072ns
= 0.576
P-0750ns
0.407
P-08I6ns
Le 1.601
P= 0449 ns
1 = 6.849
P0033*
2 = 0268
P= 0875 ns
1 = 6.668
P=0.036
= 8.680
P-0013
L=0.542
P=0762
= 7739
P=0021*
2.148
P 20.342
1 = 2.840
P=0242ns
#=1.746
P=0418ns
= 5.330
P= 0.069 ns
11458
P-0A82ns
ané
P-O121ns
1772
04I2ns
A = 5454
0065 ns
1.408
0.495
0207
10902 n
#< 1083
P = 0.582
022
F-02895 ns
2713
0258 ns
Source
MNHN, Paris
16 ALYTES 19 (1)
fee
100 J2-3B
J2-C
r— J1-A
Fr J1-B
K1-A
F K3-A
+ S5-A
— S6-A
100 Fresnes —— À. temporaria
R. catesbeiana
Fig. 4. - Maximum parsimony tree of 390 bp of the mitochondrial 16-rRNA gene of nine Fejervarya
haplotypes. Tree length is 202 steps (one shortest tree only); bootstrap values > 50 % for 1000 replicates
are indicated.
£ 0
s
6
4 Brio 2
Neotpe
F3 rom imnocheris
2 Our
BE popuatious
is #80 64 418 32 16 00 16 32 48
Discriminant fanion scores
- Stacked histogram of discriminant function for specimens of population J2 and other popula-
of Fejervarya from Sunda Islands. The neotype RMNH 4287 of Rana limnocharis Gravenhorst,
1829 was included into this analysis without a priori group membership.
Source : MNHN, Paris
VEITH, KosUCH, OHLER & DUBoIS 17
Table 5. — Coloration pattern of dorsum in Fejervarya from Sunda Islands. Frequency distribution
of phenotypes of mid-dorsal line and alleles supposed present in populations studied. n,
allele wild narrow line; N, allele narrow line; w, allele wild wide line; W, allele wide line
Proposed phenotypical groups: 1, line absent or narrow line present (wide line never
observed); 2, line absent or fine and/or wide line present (all 4 phenotypes observed); 3, line
absent or wide line present (fine line never observed)
Alleles
Sample (sample size) | Line absent| Fincline | Widetine | Feand ue À png
in genotype
1 Bogor (4) 2 0 0 mn N/w 1
S2 Sidikalang (2) 1 [ 0 0 n,N/w 1
$5 Tapaktuan (5) 2 3 0 0 nN/w 1
$6 Desa Scleutkat (3) 2. [ 0 0 n,N/w 1
S1 Medan (13) [ 10 0 2. [nN/wwl 2
32 Chianjur (11) 5 3 [ 2 [aN/mwW| 2
K3 Desa Lape (13) 2 2 6 3 InN/wwW| 2
KI Pontianak (2) 0 0 2 0 n/w,W 3
which genetically defined lineage (population J2 or the other populations from Sunda Islands)
this name applies, a discriminant analysis was performed and subsequently applied to the
neotype of Rana limnocharis. The analysis clearly classes the neotype with lineage J1 and not
with the specimens from population J2 (tab. 6, fig. 5). This indicates that the name Rana
limnocharis Gravenhorst, 1829 should apply to the widely distributed taxon occurring in Java,
Sumatra and Borneo, and that a new name should be created for the species from population
32. As no other name is available for this taxon (see DuBois & OHLER, 2000), we describe it as
a new species. The morphological comparison of adult males of the new species and
Fejervarya limnocharis is summarised in table 7.
Fejervarya iskandari sp. nov.
Diagnosis. - Medium sized Fejervarya With a relatively wide head and interorbital distance,
small tympanum, short eye length, short forearms, short inner toes and small inner metatarsal
tubercles.
Description of holotype. - MNHN 19974916, adult male (fig. 2a), from paddy field at
Chianjur (Java) (6°12'S, 107°08'E).
(A) Size and general aspect. — (1) Specimen of rather small size (SVL 40.4 mm), body
moderately stout.
Source : MNHN, Paris
18
ALYTES 19 (1)
Table 6. — Results of canonical discriminant analysis between genetically determinated
specimens of Fejervarya.
À. Statistical significance.
Wilks Lambda
Chi-square de
EEE
B. Standardiscd canonical discriminant function coefficients.
em
186131
= 3.16796
138762
—0.52334
= 644177
—0.01355
= 11.188090
=1.91388
= 3.850940
2.55580
188979
—0.99019
— 0.29879
325966
5.56794
488480
421029
121313
726577
231338
193537
0.69464
0.54972
186954
— 0.75687
€. Classification success.
Actual group
Lejervarva iskandari
— 0,96165
Predicted group
E iskandari
5 (100 %)
F linmocharis
0
Lejervarva limnocharis
0
33 (100%)
Neotype of Rana limnocharis (ungrouped)
0
100%)
Source : MNHN, Paris
VerrH, KosucH, OHLer & Dugois
19
Table 7. - Comparison of adult males of Fejervarya iskandari sp. nov. and Fejervarya
limnocharis (Gravenhorst, 1829) by Mann-Whitney U test. n, sample size; P,
probability; U, Mann-Whitney U, ns, significance level P > 0.0:
P<0.01
EL/SVL
106 + 2.89
F. limnocharis
ne
120 + 687
Mann-Wbitney
Utest
U=0
**, significance level
102 - 109 12-129 _| P=00045 +
DELA DENT Tai
FRE 88-09 82— 101 P= 0.568 ns
209 26.12 2225436 U-0
AÉANT 199 -215 218-230 | P-0.0045%
SHITTIG | 53621267 U= 14
FOBASVE 489-557 522 - 557 5698 ne
FEIIA4T | 24e 817 U= 16
RASE 308-337 315-397 | P-08075»
ADS | 2034154 U=n
HALPSVES 200-224 19-223 | P=02912n
FSHIZIS | 39722356 U=17
HEIBNE 374-416 375-447 | P-09353n
EEE EEE D=7
1SVL
RUE 337-367 340-354 | P-0.0882n
DES | 22164 Ua
ISBVL 232-245 221-273 | P-04649n
1221067 | 1972782 PEN
ME 141-162 144-166 | P-0.5698 ns
DEENT] 50228 U=i
LE NE 43-48 46-53 P= 0.0526 ns
TALT6T HEZKE DE
NÉSYE 72-76 miss P= 0.687 ns
par T0 10.1 T9 39 EU
FTLISVL 96-124 13-124 | P-00882ns
ÉEES RENE U=T
JE/
Lis 50-56 46-55 LP 0.0882 ns
re 16322035 | 13341410 U= 12
MÉRIRE 138-188 14-171 378 ns
: 255198 | 25521962 16
MER 234-275 237-294 | P=0.8075 ns
RE HOLI9O7 | 33912519 T=16
MOPSVE 318-360 320-393 | P-08075m
pr ELENTE LAN DEEE] EN
NE 404-427 326-467 | _P=0.5691 ns
| DTENIET 13249 US
THE 111-136 18-132 | P-06847n
Are AL T7ST | 30741276 U=S
$ 468-511 488-523 | P-01229m
: GTE 287 CEE LE
DSL 63-70 59-73 P=0.5698 ns
mas 532293 381429 U=T
L'HSNE 31-38 32-43 P= 0.0882 ns
TENTE CHERS SIL 67 U=T
UEW/SVL 76-88 87-100 | P-00882ns
Far F4 106 ROLE
WAFLEE 69-08 61-97
7621299 SIL #2
64-96 69-92 P=0378 ns
red CENT GI 110€ D
Wit/SVL 47-80 46-79 P= 06847 ns
DE F2 1208 DATE I] = 10
TES 76106 82-99 P-02232 ns
Source : MNHN, Paris
20 ALYTES 19 (1)
(B) Head. — (2) Head of medium size, longer (HL 15.4 mm) than wide (HW 14.4 mm;
MN 13.1 mm; MFE 9.5 mm; MBE 5.9 mm), convex. (3) Snout pointed, protruding, its length
(SL 7.90 mm) much longer than horizontal diameter of eye (EL 4.34 mm). (4) Canthus
rostralis rounded, loreal region very concave, vertical. (5) Interorbital space flat, smaller (UE
2.27 mm) than upper eyelid (UEW 3.57 mm) and internarial distance (IN 2.92 mm); distance
between front of eyes (IFE 5.7 mm) about half of distance between back of eyes (IBE
9.5 mm). (6) Nostrils oval with flap of skin laterally, closer to tip of snout (NS 3.55 mm) than
to eye (EN 4.02 mm). (7) Pupil rounded. (8) Tympanum (TYD 2.72 mm) distinct, rounded,
more than half of eye diameter; tympanum-eye distance (TYE 1.30 mm) about half its
diameter. (9) Pineal ocellus present, between anterior border of eyes. (10) Vomerine ridge
present, bearing few small teeth, between choanae, with an angle of 45° to body axis, less close
to choanae than from each other, longer than distance between them. (11) Tongue large,
rounded, emarginate. (12) Supratympanic fold distinct, from eye to shoulder. (13) Parotoid
glands absent. (14) Cephalic ridges absent. (15) Co-ossified skin absent.
(C) Forelimbs. — (16) Arm short, rather thin (FLL 8.7 mm), as long as hand (HAL
8.7 mm), not enlarged. (17) Fingers I, III and IV long, finger II short, all thin (TFL 5.32 mm).
(18) Relative length of fingers, shortest to longest: II < IV < I < II. (19) Tips of fingers
pointed. (20) Finger II with dermal fringe; webbing absent. (21) Subarticular tubercles
prominent, rounded, single, all present. (22) Prepollex oval, prominent; two oval, distinct
palmar tubercles; supernumerary tubercles absent.
(D) Hindlimbs. — (23) Shank three times longer (TL 20.6 mm) than wide (TW 6.0 mm),
longer than thigh (FL 18.8 mm), but shorter than distance from base of internal metatarsal
tubercle to tip of toe IV (FOL 22.5 mm). (24) Toes long, thin; toe IV long (FTL 13.6 mm), more
than one third of distance from base of tarsus to tip of toe IV (TFOL 29.6 mm). (25) Relative
length of toes, shortest to longest: 1 < II < V < III < IV. (26) Tips of toes pointed. (27) Webbing
moderate:11-2111-21111-22/31V21/3-1 V(WTF 4.28 mm; WFF 3.95 mm; WI 3.89 mm;
WI13.24 mm; MTTF 9.7 mm; MTFF 10.3 mm; TFTF 9.5 mm; FFTF 10.0 mm). (28) Dermal
fringe along toe V present, from tip of toe to base of metatarsus, well developed. (29)
Subarticular tubercles prominent, oval, simple, all present. (30) Inner metatarsal tubercle
long, very prominent, its length (IMT 1.94 mm) less than 2.5 times in length of toe I (ITL
4.60 mm). (31) Inner tarsal ridge well developed, along distal half of tarsus. (32) Outer
metatarsal tubercle prominent; supernumerary tubercles absent; tarsal tubercle absent.
(E) Skin. — (33) Dorsal and lateral parts of head and body: snout smooth; between the
eyes and side of head with few, flat glandular warts: back with glandular folds and glandular
warts between them: flanks with glandular warts. (34) Latero-dorsal folds absent. (35) Dorsal
parts of limbs: forelimbs smooth; shank, thigh and tarsus with glandular warts. (36) Ventral
parts of head, body and limbs: throat, chest and belly smooth: thigh with glandular warts. (37)
No macroglands.
(F) Coloration in alcohol. - (38) Dorsal and lateral parts of head and body: brown with
blackish paired spots: shoulder spots indistinct; four brown spots on each side of upper lip.
(39) Dorsal parts of limbs: forelimb, thigh, shank and foot light brown with dark bands:
tof thigh with brown and whitish marbling. (40) Ventral parts of head, body and
chest, belly and thigh cream white; throat cream white with grey W-shaped pattern:
margin of throat white with large brown spots.
Source : MNHN, Paris
VerrH, KosuCH, OHLER & DUBOIS 21
(G) Male sexual characters. - (41) Nuptial spines in one single patch on prepollex and
finger L; numerous, indistinct, cream coloured spines. (42) Vocal sacs as greyish, folded skin on
the two sides of the throat; slit-like openings in rather anterior part of mouth floor. (43) Fine
horny spinules on the anterior border of the throat.
(H) Part of the 16$ rRNA sequence that corresponds to the nucleotides 3994-4554 of
Xenopus laevis (ROE et al., 1985). — (44) (EMBL AJ292018) TCTTGTTTTTTCATAA
GAGGTCCAGCCTGCCCAGTGACACAATTAAAGGCCGCGGTACCCTGACCGTG
CGAAGGTAGCATAATAACTTGTTCTTTAAATGGGGACTAGCATGAACGGCAC
CACGAAGGCCTCACTGTCTCCTTTTTCCAATCAGTGAAACTGATCTCCCCGTG
AAGAAGCGGGGATGATAATATAAGACGAGAAGACCCCATGGAGCTTTAAACC
CAATAAGCAACCCTAATCAACACAACTCATCTAAATTCTTTETCCCCCTGCTTT
TTGGTTTTAGGTTGGGGTGACCACGGAGTAAAACATATCCTCCACGACGTAC
GGATTAACCCTTATCCAAGAGCCACCGCTCTAAGAATCGACAAATTGACGTTT
TTTGATCCAATATATTGATCAACGAACCAAGTTACCCTGGGGATAACAGCGCA
ATCCATTTTTAGAGCCCCTATCGACGAATGGGTTTACGACCTCGATGTTGGAT
CAGGGTACCCAAGTGGTGCAGCCGCTACTAATGGTTTGTTTGTTCAACAATT
AAAACCCTACGTGATCTGAGTTC.
Paratopotypes. - FMNH 256725-256733, 3 adult males, 1 adult female, 5 juvenile males;
ZFMK 68867, adult male. Same collection data.
Etymology.— The new species is dedicated to Djoko Iskandar, herpetologist from Indonesia.
DISCUSSION
Fejervarya iskandari sp. nov. and Fejervarya limnocharis (Gravenhorst, 1829) from Java
clearly represent two genetically distinct lineages. Their Nei D values calculated from allo-
zyme data (average: 0.314) falls within the interspecific range known from other ranids (e.g.,
1978; NisHioKA & SUMIDA, 1990; MENSI et al., 1992; ARANO et al., 1993; BEERLI et al.
H, 1996). However, the observed morphological variation between the genetically
well differentiated lineages F. iskandari and F limnocharis is slightly more pronounced than
among members of the other populations, as estimated by the number of significantly distinct
measurements. Therefore these two forms are clearly a pair of sibling species that are
morphologically scarcely distinct from one another, but show substantial genetic differentia-
tion. In addition, a comparison of our allozyme data with those of the samples 3 and 4 of
Topa et al. (19984) reveals that their samples fit almost perfectly with our analysis: in nine out
of eleven loci which were analysed in both studies the results are identical, one locus shows
similar allele frequencies and only in one locus the results are different. Discrepancies in the
results may have been caused by using different protocols in the two laboratories (see VEITH,
1994 for further examples). Therefore the new species includes specimens from the Javanese
populations of Chianjur and Malingping (sample 4 in Toba et al., 1998a). It is genctically well
defined, but morphologically very similar to Æ limmocharis. Distribution ranges of Æ iskan-
dari and EF. limnocharis overlap at l between Malingping and Chianjur over a distance of
ca. 130 km. Syntopy was shown for a paddy field near Malingping, Java (TODA et al., 19984),
confirming species status of Æ éskandari.
Source : MNHN, Paris
22 ALYTES 19 (1)
Discriminant analysis of morphometric data resolves the nomenclatural relevance of the
observed genetic divergence. The name Rana limnocharis Gravenhorst, 1829 applies to a
taxon widely distributed in the Sunda Islands. As there is no indication of genetic or
morphological differentiation of the frogs from Borneo island, the name Rana wasl Annan-
dale, 1917 (based on a holotype from Kuching, Sarawak, Malaysia, on this island) is here
considered a junior subjective synonym of Rana limnocharis (see DuBois & OHLER, 2000), but
remains available for further systematic decisions, should Bornean Fejervarya prove hetero-
geneous.
RÉSUMÉ
Les grenouilles de l'espèce Fejervarya limnocharis et d'espèces voisines de celle-ci sont
parmi les plus communes en Asie du Sud-Est. Nous avons étudié 52 spécimens de huit
populations des Iles de la Sonde par les méthodes de l’électrophorèse d’allozymes, du
séquençage d'ADN mitochondrial et de la morphométrie. Les patrons de variation de tous les
caractères entre les populations se montrent congruents pour séparer une population de Java
de toutes les autres populations (Java, Sumatra, Bornéo) et considérer qu'elle appartient à une
espèce distincte. Les fréquences des quatre phénotypes observés concernant la présence et la
largeur d’une ligne médio-dorsale dans les populations examinées ne permettent pas de
dégager de claire corrélation avec les caractères moléculaires et morphométriques. Notre
analyse morphométrique permet d’attribuer sans ambiguïté le nom Rana limnocharis Gra-
venhorst, 1829 à l’espèce à vaste répartition qui se trouve à Java, Sumatra et Bornéo. Les deux
taxa vivant en sympatrie, nous donnons un nom nouveau, Fejervarya iskandari, à la popula-
tion de Chianjur, Java.
ACKNOWLEDGEMENTS
to thank R. Feldmann for his help in the field and K. Rehbinder for her outstanding
study was supported by the “German Science Foundation (DFG)", grant Nr. SE 506/5-1
and by the “German Bundesamt für Naturschutz (BIN)”, grant Nr. Vw-534 11-5/02, The morphometric
work was part of the programme of MESR 2586 “Systématique et évolution des vertébrés tétrapodes”
This is publication Nr. 01-36 of PPF “Faune et flore du sud-est asiatique” (Nr. 00 EUVE & TIAN,
2001).
LITERATURE CITED
ANONYMOUS, 1999, — Jnternational code of zoological nomenclature. Fourth edition. London, Internatio-
nal Trust for Zoological Nomenclature: i-xxix + 1-306.
ARANO, B.. ESTEBAN, M. & HERRERO, P., 1993. - Evolutionary divergence of the Iberian brown frogs. Ann.
Sci. nat. Zool. Paris, V4: 49-57.
Source : MNHN, Paris
VEITH, KOSUCH, OnLer & DUBoIs 23
B£ERLI, P., HOTZ, H. & UZZELL, T., 1996. - Geologically dated sea barriers calibrate a protein clock for
Aegean water frogs. Evolution, 50: 1676-1687.
Case, S.M., 1978. - Biochemical systematics of members of the genus Rana native to western North
America. Syst. Zool., 27: 299-311.
DEUvE, T. & Tia, M.-Y., 2001. — Zolinopatrobus nanlingensis n. gen., n. sp., de la Chine méridionale,
premier représentant d’une sous-tribu nouvelle parmi les Trechidae Patrobinae (Coleoptera,
Caraboidea). Bull. Soc. ent. France, in press.
DONNELLAN, S$. C., ADAMS, M. & APLIN, K. P., 1989. — A biochemical and morphological study of Rana
(Anura: Ranidae) from the Chimbu Province, Papua New Guinea. Herpetologica, 45: 336-343.
Dusois, A., 1975. - Un nouveau complexe d'espèces jumelles distinguées par le chant: les grenouilles du
Népal voisines de Rana limnocharis Boie (Amphibiens, Anoures). C. r Acad. Sci, (D), 281:
1717-1720.
_— 1977. - Les problèmes de l'espèce chez les amphibiens anoures. Mém. Soc. zool. France, 39: 161-284.
= 1980. - Populations, polymorphisme et adaptation: quelques exemples chez les amphibiens anoures.
An: R. BARBAULT, P. BLANDIN & J.-A. MEYER (ed.), Recherches d'écologie théorique — Les stratégies
adaptative, Paris, Maloine: 141-158.
1992. — Notes sur la classification des Ranidae (Amphibiens Anoures). Bull. Soc. linn. Lyon, 61:
305-352.
Duoïs, A. & OuLrr, À. 2000. - Systematics of Fejervarya linnocharis (Gravenhorst, 1829) (Amphibia,
Anura, Ranidae) and related species. 1. Nomenclatural status and types specimens of the nominal
species Rana limnocharis Gravenhorst, 1829. Alytes, 18 (1-2):
FELSENSTENN, J,, 1985. - Confidence limits on phylogenies: an approach Me bootstrap. Evolution, 39:
783-791.
_— 1993. — PHYLIP: Phylogenetic Inference Package, version 3.5c. Seattle, Univ. of Washington, Dep.
Genetics.
GRAVENHORST, J. L. C., 1829. — Deliciae Musei Zoologici Vratislaviensis. Fasciculus primus, continens
Chelonios et Batrachiae. Lipsiae, Sumptibus Leopoldi Vossii: i-xiv + 1-106, pl. 1-17.
HEBerT, P. D. N. & BEATON, M. L., 1986. — Merhodologies for allozyme analysis using cellulose acetate
electrophoresis. Beaumont, TX, Helena Laboratories: à
Hever, W.R., 1994. - Variation within the Leprodactylus podicipinus-wagneri complex of frogs (Amphi-
bia: Leptodactylidae). Smithsonian Contrib. Zool., 546: i-iv+1-124.
HiGGis, D. G. & Suarr, P. M., 1993. - CLUSTAL W: a package for performing multiple sequence
alignment on a microcomputer. Cubios, 5: 151-153.
INGER, R. F,, 1966. - The systematics and zoogeography of the Amphibia of Borneo. Fieldiana: Zool., 52:
1-402.
---- 1989. - Four new species of frogs from Borneo. Malayan Nature J., 42: 229-243.
---- 1999. - Distribution of amphibians in Southern Asia and adjacent islands. Zn: W. E. DUELLMAN (ed.),
Patterns of distribution of amphibians — A global perspective, Baltimore & London, The John
Hopkins University Press: 445-471.
INGER, R. EF. & Grimis, P À., 1983. - Variation in Bornean frogs of the Amolops jerboa species group, with
description of two new species. Fieldiana: Zool., 19: 1-13.
INGER, R. F. & STUEBING, R. B., 1989. — Frogs of Sabah. Sabah Parks Publication Nr. 10.
== 1991. - New species of frogs of the genus Leprobrachella Smith (Anura: Pelobatidae) with a key to the
species from Borneo. Raffles Bull. Zool., 39: 99-103.
- 1997. — 4 field guide 10 the frogs of Borneo. Borneo, Natural History Publications: 1-205.
INGER, R. F., Voris, H. K. & Voris, H. H., 1974. - Genetic variation and population ecology of some
Southeast Asian frogs of the genera Bufo and Rana. Biochem. Genet., 12: 121-145.
KOCHER, T. D., THOMAS, W. K., MEYER, A. EDWARDS, S. V., PAÂBO, S., VILLABLANCA, FE. X. & WILSON,
C., 1989. - Dynamics of mitochondrial DNA evolution in mammals: amplification and
equencing with conserved primers. Proc. nat. Acad. Sci. USA, 86: 6196-6200.
L, A. & VerrH, M. 1997. - Genetic and morphological variation in Limmonectes
limnocharis (Gravenhorst, 1829) from the Great Sunda Islands (Sumatra, Java, Borneo). /n: Z.
), Abstracts of the Third World Congress of Herpetology 1997: 249.
U. & GROSSMANN, W., 1997. Amphibien und Reptilien Südostasiens. Münster, Natur und Tier:
1-512
Source : MNHN, Paris
24 ALYTES 19 (1)
MaRMAYOU, J., DUBoïs, À., OuLer, A., PASQUET, E. & TILLIER, A., 2000. - Phylogenetic relationships in
the Ranidae. Independent origin of direct development in the genera Taylorana and Philautus. C.
r. Acad. Sci., Sci. Vie, 323: 287-297.
MENSI, P., LATTES, A., MARCARIO, B., SALVIDIO, $., GrAcOMO, C. & BALLETTO, E., 1992. - Taxonomy and
evolution of European brown frogs. Zool. J. Linn. Soc., 104: 293-311.
Mursrean, W. W. RAND, A. $. & Srewarr, M. M., 1974.- Polymorphism in cricket frogs: an hypothesis.
Evolution, 28: 489-491.
MOHANTY, A. K. & DurrA,S. K. ,1999. - Biological notes on Limnonectes limnocharis (Anura: Ranidae)
in India, Russ. J. Herp., 6: 33-44.
MorIWaki, T., 19 The inheritance of the dorso-median stripe in Rana limnocharis Wiegmann. J Sci.
Hiroshima Univ., (B), div.1, 14: 159-164.
Neï, M., 1972. - Genetic distance between populations. Am. Nar., 106: 283-293.
NismiokA, M. & SumiDa, M., 1990. — Differentiation of Rana limnocharis and two allied species
elucidated by electrophoretic analyses. Lab. amphibian Biol., Hiroshima Univ., 10: 125-154.
Norusis, M. J., 1992. SPSS for Windows. Professional Statistics. Release 5. Chicago, SPSS Inc.
1-348.
OuLER, A., 1996. — Systematics, morphometrics and biogeography of the genus Aubria (Ranidae,
Pyxicephalinae). Alytes, 13: 141-166.
— 1999. — The identity of Dendrobatorana Ahl, 1927 (Amphibia, Ranoïdea). Mit. Mus. Naturkd.
Berlin, 75: 37-45.
OuLer, À. & DuBoïs, A., 1999. - The identity of Elachyglossa gyldenstolpei Andersson, 1916 (Amphibia.
Ranidae) with a discussion of some aspects of statistical support to taxonomy. Zoo!. scripta, 28:
269-279.
RICHARDSON, B. J., BAVERSTOCK, P. R. & ADams, M., 1986. — Allozyme electrophoresis. A handbook for
animal systematics and population structure. Sydney, Academic Press.
ROE, B. A., DIN-Pow, M., WiLsON, R. K. & WONG, JF. 1985. - The complete nucleotide sequence of the
Xenopus laevis mitochondrial genome. J. biol. Chem., 260: 9759-9774.
Roue, FE J, 1990. - NTSYS: Numerical Taxonomy and Multivariate Analysis System, version 1.60. New
York, Setauket.
SAMBROOK, J., FRITSCH, E. F. & MANIATIS, T., 1989. — Molecular cloning: a laboratory manual. Cold
Spring Harbor Laboratory Press: 1-729.
SHIBATA, Y., 1988. — Mid-dorsal stripe type of a frog, Rana limnocharis, in northwestern
Kyushu, Japan (Amphibia: Ranidae). Shizenshi-Kenkyu occ. Pap. Osaka Mus. nat. Hist.,
69-71.
SIGISMUND, H. R., 1993. — G-STAT, version 3. Munich.
SworroRD, D. L., 1993. - PAUP: Phylogenetic Analysis Using Parsimony, version 3.1.1. Computer
program distributed by the Illinois Natural History Survey, Champaign, Illinois.
Top, M., Matsut, M., NisHiDa M. & OrA, H., 19984. - Genetic divergence among Southeast and East
Asian populations of Rana limnocharis (Amphibia: Anura), with special reference to sympatrie
c species in Java. Zool. Sci., 15: 607-613.
sHiDA, M., MaTsUI, M., FU, W.G. & OrA, H., 1997. - Allozyme variation among East Asian
populations of the Indian rice frog, Rana limnocharis (Amphibia: Anura). Biochem. Syst. Ecol., 25:
143-159.
Toba, M., NisHiDA, M. MaTsUI, M., LUE, K.-Y. & OTA, H., 1998b. - Genetic variation in the Indian rice
frog, Rana limnocharis (Amphibia: Anura), in Taiwan, as revealed by allozyme data. Herpetolo-
gica, 54 (1):73-82.
Vera, M. 1994. - Morphological, molecular and life history variation in Salamandra salamandra (L.).
. GREVEN & B. THIESMEIER (ed.), Biology of Salamandra and Mertensiella, Mertensiella, 4:
355-398.
—— 1996. - Molecular markers and species delimitation: examples from the European batrachofauna.
Amplhibia-Reptilia, 17: 303-314.
i-xii] +
Corresponding editor: W. Ronald HEYER.
© ISSCA 2001
Source : MNHN, Paris
VEITH, KosuCH, OHLEr & Dumois 25
Appendix 1. — List of morphometric measurements of Fejervarya specimens used in this
study.
Measurement
EL eye length
EN distance from front of eye to nostril
FFTF webbing measured from maximum incurvation between toes IV and V to tip
of toe IV
FLL length of arm from elbow to base of outer palmar tubercle
FOL length of foot from proximal border of inner metatarsal tubercle to tip oftoe
IV
FTL length of fourth toe from basal border of proximal subarticular tubercle to
tip of toe IV
HAL length of hand from base of outer palmar tubercle to tip of finger III
HL head length from mandibular articulation to tip of snout
HW head width
IBE distance between posterior borders of eyes
IFE distance between anterior borders of eyes
IMT length of inner metatarsal tubercle
IN internarial distance
ITL inner toe length from distal border of inner metatarsal tubercle to tip of toe I
MBE distance from mandibular articulation to posterior border of eye
MFE distance from mandibular articulation to anterior border of eye
MN [distance from mandibular articulation to nostril
MTFF webbing measured from distal border of inner metatarsal tubercle to
maximum incurvation between toes IV and V
MTTF webbing measured from distal border of inner metatarsal tubercle to
maximum incurvation between toes III and TV
SVL snout-vent length
TFL length of finger from basal border of proximal subarticular tubercle to tip of
finger LIL
TETE webbing measured from maximum incurvation between toes IT and IV to
tip of toe IV
TL length of tibia from tibio-metatarsal articulation to knee
maximum tympanum diameter
tympanum-eye distance
Source : MNHN, Paris
Appendix 2. — Allele frequencies, average expected heterozygosity (4) and polymorphism (P) at 15 presumptive enzyme loci in 9 samples of
Fejervarya from Java (1), Kalimantan (K) and Sumatra (S). See text (Material and methods) for details on localities. Sample Ke belongs to
the species Féjervarya cancrivora
Sample pl mA KI K3 ST s2 ss s6 Ke
15 6 3 25
a a a
b ] b ©
a a | a a
AAT-1 a (0.05) b (0.04 e © € (0.02)
€ (0.90) € (0.96) £ (0.98)
d (0.05)
AAT-2 a b a (025) a 0.70) a a a a c
b (0.75) b (0.30)
IDH-1 a a a a a a a a D
IDH-2 a a a a a a a a à (0.96)
b (0.04)
LDH a b a a a a a a c
MDH a (0.87) a © © (0.56) D (0.09) cO25) d € (0.50) e
b(0.13) d (0.04) € (0.50) d(0.75) d (0.50)
d (0.41)
ME a a a a a a a a b
MPI d b (0.59) a (0.25) a (0.25) b(0.35) b b b b (0.60)
<(041) € (0.50) b (0.45) d (0.65) £(0.14)
€ (0.25) d (0.25) 2(0.26)
e (0.05)
PEP (Gly- | b(0.37) a b b a(G.15) b b b b
Leu) c(063) | b (0.85)
PGM a | a a a (0.84) a (0.88) a a a €
b (0.16) b (0.12)
PK a a a a a a a a b
TPI b(0.87) b (0.95) a (0.25) a (0.05) b b b b b
c@13) | c(005) b (0.50) b (0.95)
| c (0.25)
H. CS TS O1 015 01 002 0 00 004
P 02 0.2 0.2 04 0.26 0.06 0 0.06 0.2
97
(D 61 SALATV
Source : MNHN, Paris
VEITH, KOSUCH, OHLER & DUBOIS
27
Appendix 3. - Morphometrical data for adult specimens of Fejervarya samples from Sunda Islands. Mean,
standard deviation, minimum and maximum values are given for all samples.
1 76-106 LL 0-7 I
Desa Seleukat | — Desa Laÿ : Modan
| en ets) an | dm | Peer [en | di
ar w [ pas
DR ME SR. REX NETINE
IE SE SRUNES: IE MEME
Pr SES SRE: SE EN E
TES SE: SRE: SEEN EE:
mont ES [AUS us [Me mn | mm |
mn [SE un [M | m | = [ve
TUE SET SNME: SE MERE ME:
CIE SE SES SE ME EL:
TIR SE SE: SN METRE
MTS | “sas os _ es se # ri
men RS D Don [le | e [49
mn [en [ue un fn | |
CARE Fe. 52 in 46 50 rs
aan [SEE | ue [ET me | w [2
ES IE- NME SN MEME:
TIR ES SRE SM ME
ou TRE DE ne [US me | ee [4%
msn [D Qu [M Qu | un |
TIRE SE ET EE:
nossu. | GS s ou G ss es
rene [ne fon [ls Je [eu
re g =. a & S ve x = pese 1 = #7 Be
| wu/svr. an rs 70 un. 50 55 Lo
Source : MNHN, Paris
28 ALYTES 19 (1)
Appendix 3. - Continued.
Sidikalang Tapaktuan | DesaSeleukat | Desa Lape Pontiak | p je épars
(Sumatra) (Sumatra) (Sumatra) | (Kalimantan) | (Kalimantan) ne
1 female 4 females 2 females 8 females 2 females re
mn un | Se Ne | eo | uw
ersw | #0 | Wu | mn | S-% oi
FuL/svL | 206 uen (de 196
mate [é| #7 CARE
TIME: HE HE: EH
DE NE HE SE AE IE
PIRE AE NE AE: EE
a nl PLUS |
TIMES SES SE SET EEE
men ( ue | Me | De | one | We |
RENSVE # Pres 5 Re - “2-5
ment mn és | ue [|
manf ue [ses us [e | =
met ns | 2 [ie | 9e [eu]
mnt un | PS | es [ie | US |
TRE METIERS SET SEL UE
TIME SE: SEE HR
mm [me Jensen] l
ma] ue [AN DURS LES [EU | 10
men) un |] D | ee | M | mn
TE, = T 2335 DE2SS Das A 436 ra
UEW/SVL 83 mean pee Hs 93 LEA 0 88
mem] a | ee us | te | vue
men] ne [US een | | dx
ment [ue [es (Hs
Source : MNHN, Paris
Alytes, 2001, 19 (1): 29-44. 29
Un nouveau Leptopelis
de la zone forestière camerounaise
(Amphibia, Anura, Hyperoliidae)
Jean-Louis AMIET
48 rue des Souchères,
26110 Nyons, France
A new species of Leptopelis from southern Cameroon is described. It is
readily distinguishable by its dorsal pattern, transversely striped except a
trapezium-shaped cephalic blotch, very rounded canthus rostralis, immacu-
late ventrum and characteristic nuptial call. The distribution of this rare
species is traced, mainly from aural records, and information on its
etho-ecology - including the “phonocenosis” to which it participates - is
given.
Hormis une analyse de ses appels sous la dénomination de “Leptopelis sp. 2° (AMIET &
Scmorz, 1974), l'espèce décrite ici n’a jamais été mentionnée dans la littérature batracholo-
gique concernant le Cameroun, et plus généralement l'Afrique centrale (PERRET, 1966:
LAURENT, 1973; ScHIOTZ, 1999). Sa découverte illustre bien l’utilité, voire la nécessité, de la
prospection acoustique en forêt équatoriale: c’est l'audition de vocalisations non identifiables
qui a permis de capturer le premier individu en 1972, et les 14 autres spécimens (sauf l’unique
femelle) ont aussi été pris grâce à un repérage acoustique préalable. Contrairement à Lepto-
pelis omissus Amiet, 1991, la nouvelle espèce n’a été relevée que dans de rares localités de la
zone forestière, et les sites d’activité vocale, étroitement circonscrits, ne regroupent que
quelques mâles. Il n°y a donc rien d'étonnant à ce que l'espèce, pourtant facile à reconnaître,
soit restée inconnue jusqu'ici.
L'holotype et la moitié des paratypes sont déposés au Muséum national d'Histoire
naturelle de Paris (numéros précédés par le sigle MNHN), les autres sont actuellement dans la
collection de l’auteur (sigle JLA). Les indications relatives au sexe et à l’origine des spécimens
étudiés sont regroupées dans le tableau 1.
Pour alléger le texte, les noms des auteurs et les dates de création des espèces citées sont
mentionnés ci-après (ordre alphabétique): Afrixalus paradorsalis Perret, 1960; Alexteroon
obstetricans (Ah, 1931); Amnirana albolabris (Hallowell, 1856); Amnirana amnicola (Perret,
1977); Astylosternus batesi (Boulenger, 1900); Bufo gracilipes Boulenger, 1900; Bufo tuberosus
Günther, 1859; Cardioglossa escalerae Boulenger, 1903; Cardioglossa gracilis Boulenger, 1900;
Cardioglossa gratiosa Amiet, 1972; Cardioglossa leucomystax (Boulenger, 1903); Chiromantis
rufescens (Günther, 1868); Conraua crassipes (Buchholz & Peters, 1875); Dimorphognathus
Source : MNHN, Paris
30 ALYTES 19 (1)
Tableau 1. - Leptopelis zebra: références et origine du matériel étudié. JLA, numéros de collection de
l'auteur, MNHN, numéros des spécimens déposés au Muséum national d'Histoire naturelle de Paris.
Sexe: M, mâle: F, femelle. L'holotype est signalé par un astérisque.
MNHN Sexe! Localité Coordonnées Altitude Date
£ M | Ototomo | 11°17Ex3°40'N| env. 720 m | 18.11.72
DS M IST Ex 3°40'N | env. 720 m | 30.VI.72
_2000.2712 | M 1I917'E x 3°40'N | env. 720m | 7.174
_2000.2713 | M 11917Ex3°40'N | env. 720m | 141.74
L M | 11917'E x 3°40'N | env. 720 m | 14.1.74
_2000.2714| M | Awae |11°51'Ex3°53N| env. 700m | 241.74
93* |2000.2715*| M | Ototomo |11°17Ex3°40'N| env. 720 m | 23.VI.75
| 2000.2716| M | Ototomo |11°17Ex3°40°N| env. 720 m | 8.VIL75
__ | M} Ototomo |11°17'Ex3°40'N | env. 720 m | 8.VIL75
M | Kala-Afomo | 1122'E x 3°50° N | env. 740 m | 10.VIL78
| M | Kala-Afomo | 11°22'E x 3°50'N | env. 740 m | 10.VIL78 |
ji _M | Kala-Afomo | 11°22'E x 3°50' N | env. 740 m | 10.VIL78
_| 20002717 | M | Kala-Afomo | 11°22'E x 3°50' N | env. 740 m | 10.VIL78
2000.2718| F | Kala-Afomo | 11°22'E x 3°50' N | env. 740 m | 10.VIL78 |
2000.2719 | M | Kala-Afomo | 11°22'E x 3°50' N | env. 740 m 12.1.79
africanus (Hallowell, 1857); Hyperolius endjami Amiet, 1980; Hyperolius kuligae Mertens,
1940; Hyperolius ocellatus Günther, 1859; Hyperolius platyceps (Boulenger, 1900); Leptopelis
il, 1856); Leptopelis boulengeri (Werner, 1898); Leptopelis brevirostris (Werner,
1898); Leptopelis calcaratus (Boulenger, 1906); Leptopelis millsoni (Boulenger, 1894); Lepto-
pelis modestus (Werner, 1898); Leptopelis notatus (Buchholz & Peters, 1875); Leptopelis
ocellatus (Mocquard, 1902); Leptopelis omissus Amiet, 1991; Leptopelis rufus (Reichenow,
1874); Opisthothylax immaculatus (Boulenger, 1903); Prychadena aequiplicata (Werner, 1898).
Leptopelis zebra n. sp.
Matériel étudié.
Holotype. - Mäle MNHN 2000.2715 (ex JLA 75.293) de la Réserve forestière d'Oto-
tomo, à environ 30 km SSW de Yaoundé, 11°17°E, 3°40°N, 720 m d'altitude, forêt dense de
bas-fond, 23.VL.75. Mensurations et proportions: voir tableaux 2 et 3. Livrée dorsale (en
alcool) bien contrastée, avec une douzaine de bandes brunes transverses sur fond beige: voir
fig. 3.
Source : MNHN, Paris
AMIET 31
Tableau 2. - Quelques mensurations (en dixièmes de mm) chez Lepropelis zebra. L'holotype est signalé
par un astérisque, L, longueur du corps, mesurée du bout du museau à l'entrejambe; T, largeur de la
tête derrière les yeux; C, longueur de la cuisse, de l’entrejambe au genou: J, longueur de la jambe, de
la saillie du genou à celle du talon: P, longueur du pied, du talon à l'extrémité de l’orteil IV; œ,
diamètre de l'œil entre les angles palpébraux; ty, plus grand diamètre du tympan; on, distance
œil-narine, Valeurs maximales en grasses, valeurs minimales en italiques.
72.134 : 375 | 190 | 195 | 270 | 165 | 54 | 39
72466 | _330 | 165 | 175 | 235 | 135 | 43 | 33
74.003 |2000.2712 | 335 | 180 | 185 | 250 | 150 | 51 | 37 | 35
| 74.005 | 2000.2713 | 185 | 235 | 150 | 54 | 33
| 74.006 | 170 | 230 | 135 | 50 | 37
74.016 |2000.2714 | 29. | 165 | 200 | 125
[75.293* |2000.2715*| 345 | 195 | 180 | 260 | 160
| 75.297 |2000.2716| 360 | 180 | 180 | 240 | 150
325 | 185 | 180 | 225 | 135
300 | 165 | 165 | 220 | 140 52
330 | 170 | 185 | 230 | 150 36
Lu _[ 180 | 175 | 240 | 150 35
2000.2717 170 | 225 | 150 | 37
20002719 | 350 185 | 250 | 155 | 50 | 3
moyenne | 133571/176.43| 178,21 123643| 146,43] 50,14 | 35.36 | 35,57
23,19 | 10,27 | 8,68 | 17,59 | 10,99 | 3.98 | 3
écart-type
Femelle
78.180 |2000.2718| 450 | 245 | 235 | 335 | 190 | 55 40 43
Paratypes. — Treize mâles et une femelle; localités d'origine et dates de capture: voir
tableau 1.
Autre matériel. — 51 diapositives, 3 enregistrements sonores.
Diagnose. — Lepropelis sylvicole de taille médiocre, bien caractérisé par: (1) son canthus
rostralis très à rée dorsale constituée d’une macule céphalique
trapézoïdale et de ban nsverses sur un fond plus clair; (3) sa face ventrale immaculée, de
teinte saumon-orangé sur le vivant: (4) ses vocalisations. L. rufus et L. millsoni peuvent avoir
Source : MNHN, Paris
3 ALYTES 19 (1)
Tableau 3. - Quelques rapports morphométriques chez Leptopelis zebra. L'holotype est signalé par un
astérisque. Abréviations: voir la légende du tableau 2. Valeurs maximales en grasses, valeurs
minimales en italiques.
CE —
MNHN CL JL PL TL on/œ ty/œ
50,67 | 52 | 72 | 44 | 7407 | 722
: 50 | 53,03 | 7121 | 40,97 | 70,06 | 76,74
03 |2000.2712| 53,73 | 55,22 | 74,63 | 4478 | 68.62 | 72.54
| 2000.2713 | 50 | 52,86 | 67,14 | 42,86 | 7407 | 61.11
54,84 | 74,19 | 43,55 | 64 74
24 | 55,93 | 678 | 4237 | 7333 | 62,22
52.17 | 75,36 | 4638 | 72,22 | 70,34
50 | 66,67 | 41,67 | 72,72 | 709
5538 | 69.23 | 41,54 | 7142 | 67,34
74.016 | 2000.2714
75.293* |2000.2715*
75.297 | 2000.2716
78.176 1] 55 73,33 46,67 69,56 71,73
78.177 | 56,06 | 697 | 4545 | 72 | 72 |
78.178 | 50 48,61 | 66.67 | 41,67 | 79,06 | 67.27 |
78.179 | 2000.2717| 50,75 | 50,75 | 67,16 | 44.78 | 80,43 | 73,91
79.001 | 2000.2719| 52.86 | 52.86 | 71,43 | 44,29 | 72 76
moyenne 52,65 | 53,19 70,47 | 43,64 | 73.04 | 70,59
écart-type 16.74 16,80 22,74 14,05 23.82 26.46
Femelle
78.180 | 2000.2718] 54,44 | 52,22 | 74,44 | 42,22 | 72.73 | 22,63
un patron dorsal similaire mais se distinguent aisément de L. zebra par leur bande interocu-
laire étroite et subrectiligne et par la présence d'au moins quelques macules ventrales foncées.
Etymologie. - Allusion aux bandes transversales qui ornent le pelage du zèbre (latin =ebra).
Habitus, proportions, membres, tégument. — Les tableaux 2 et 3 donnent les principales
ations et proportions relatives aux 14 mâles récoltés, adultes puisque vocalement
s. Avec une longueur museau-anus variant de 29,5 à 37,5 mm (moyenne 33,5 mm), ces
mâles ont une taille médiocre par rapport à celle des autre: forestières c: ï
mais cependant un peu supérieure à celle de L. omissus (29, mm, moyenne 32 mm) et,
surtout, de L. modestus (26 à 28,5 mm, moyenne 27 mm). L'habitus peut être qualifié de
est modérément dilatée, sa largeur repré-
ans disproportions apparentes. La tê
Source : MNHN, Paris
AMIET 33
sentant de 41 à 46 % environ de la longueur totale, et les membres postérieurs sont relative-
ment courts pour une espèce à mœurs très arboricoles.
Le museau est court, la distance œil-narine représentant environ les trois-quarts du
diamètre oculaire (moyenne 73 %); il est fortement déclive à son extrémité qui, vue de dessus,
a un aspect tronqué ou en arc très arrondi; les narines, peu saillantes, sont largement écartées,
l'espace internasal représentant environ 80 % de l’espace interorbitaire. Un caractère impor-
tant de l'espèce est l’atténuation des canthus, plus arrondis que chez les autres Leptopelis
forestiers et passant à des lores faiblement obliques et à peine concaves. Les yeux sont gros et
saillants, le diamètre interpalpébral mesurant de 4,3 à 5,5 mm (moyenne 5 mm). Ce diamètre
est supérieur à la distance œil-narine (3,2 à 4 mm, moyenne 3,5 mm) et à celui du tympan (2,8
à 3,9 mm, moyenne 3,5 mm). Ce dernier est circulaire, contigu à l’œil et saillant vers le bas,
au-dessus de la commissure buccale; il est entouré plus ou moins complètement par un fin
rebord granuleux.
La main (fig. 1), du repli cutané du poignet à l'extrémité du doigt III, est un peu plus
longue que l’avant-bras (d’un cinquième environ). Les doigts sont relativement courts et
larges, impression accentuée par les replis cutanés qui les bordent jusqu'aux disques adhésifs
terminaux. Ces derniers sont aussi larges ou un peu plus larges que longs aux doigts II, III et
IV, celui du doigt I étant un peu plus long que large, proportions qui se retrouvent chez la
plupart des Leptopelis arboricoles. Il y a un tubercule sous-articulaire sous les doigts I et IT,
deux sous les doigts III et IV; ces tubercules sont très saillants, en particulier les tubercules
distaux des doigts III et IV, en forme d’épaisses lames bifides:; le tubercule proximal du doigt
IV est, comme chez d’autres Leptopelis, un peu décalé vers le bord externe du doigt. La paume
porte de grosses granulations irrégulières, qui s'étendent sur la base des doigts. Entre les doigts
Let IL, la membrane interdigitale est étroite, guère plus large que la frange cutanée des doigts;
elle est plus étendue entre les doigts II et IT et, surtout, IT et IV, où son bord libre se situe au
niveau de la mi-distance entre les tubercules proximaux et distaux de ces derniers; elle porte,
sur sa face inférieure, des verrucosités semblables à celles de la paume, mais plus petites.
Des mensurations effectuées à titre comparatif sur des spécimens de L. omissus, L.
calcaratus, L. modestus et L. aubryi ont montré que le membre postérieur est relativement plus
court que chez toutes ces espèces, y compris, mais de peu, la dernière, La jambe est légèrement
plus longue que la cuisse, chacune représentant un peu plus de la moitié de la longueur
museau-anus (tableau 3). Le pied (fig. 1) ne présente pas de caractère particulier, et ressemble
beaucoup à celui de L. omissus (AMIET, 1991). Les orteils sont largement rebordés, les disques
adhésifs à peu près a longs que larges aux orteils II, III et V: celui de l’orteil I est un peu
plus long que large et celui de l'orteil IV un peu plus large que long. Les tubercules
sous-articulaires sont très saillants, les plus développés de forme conique, et ont la même
répartition que chez les autres espèces du genre: un aux orteils I et IT, deux aux orteils IT et V
et trois à l’orteil IV; le tubercule distal de ce dernier est plus ou moins dédoublé, ce caractère
étant variable suivant les individus. La palmure pédieuse est assez étendue: entre les orteils III
et IVet IV et V, sa partie la plus concave arrive au niveau du tubereule sous-articulaire médian
de l’orteil IV: elle est plus profondément échancrée entre les orteils Let II et IT et III. Le
tubercule métatarsien interne est bien développé, à peu près aussi long que l'orteil au-delà du
tubercule sous-articulaire: il est bien saillant, assez comprimé mais avec une arête obtuse. Il y
a des petites excroissances plantaires, mais elles sont moins prononcées que sous la main.
Source : MNHN, Paris
34 ALYTES 19 (1)
Fig. 1. — Face plantaire du pied et face palmaire de la main chez Lepropelis zebra.
Sur le dessus de la tête, du dos et des membres, le tégument est très finement et densément
granuleux, ce qui lui donne un aspect mat; sur les flancs, les granulations deviennent plus
grosses et plus inégales. Sur la face ventrale, il est opaque, réticulé-granulé, les granulations
étant plus grosses dans les régions pectorale et abdominale que dans la région gulaire. Chezles
mâles, près de la racine des bras, deux petites plages circulaires de 3 mm de diamètre environ,
d'aspect lisse mais en fait finement poreuses, correspondent aux glandes pectorales. Sous les
cuisses, la peau est en partie transparente, avec des petits polygones opaques d'aspect
pavimenteux. La tranche externe des avant-bras et des pieds est soulignée par un net repli
cutané, s'étendant jusqu'à l’extrémité du doigt et de l’orteil externes.
Pigmentation. — La teinte de fond de la face dorsale (fig. 2) varie du mastic au beige clair ou au
fauve, avec le plus souvent une chaude nuance orangée sans équivalent chez les autres
Leptopelis camerounais. Le dessin (fig. 3), très caractéristique, est constitué par des bandes
transversales brun clair, assez régulières, se succédant depuis le dessus du museau jusqu'à la
région lombaire: ces barres sont plus ou moins nombreuses et étroites suivant les individus.
Sur la tête, une épaisse barre interoculaire constitue la base d’un trapèze ou d’un triangle à
sommet orienté vers l'arrière: il s'agit en fait de la macule céphalique, présente chez de
nombreuses autres espèces de Leptopelis, mais ici largement évidée dans sa partie centrale.
Source : MNHN, Paris
AMIET 35
2.- Mâles de Leptopelis zebra: (a) Ototomo, 18.11.72; (b) Ototomo, 7.1.74 (ILA 74.005); (c) Kala,
10.VIL.78 (ILA 78.176): la coloration rouge des orteils et des doigts n’est visible que chez certains
individus; (d) Ototomo, 18.11.72 (JLA 72.134): livrée diurne à dessin imperceptible: (e) Ototomo,
7.1.74 (ILA 74.006): chez cet individu en livrée diurne le dessin est atténué, mais la fine granulation
gumentaire et les points noirs, présents chez certains individus, sont plus apparents: (f) Awaë,
2411.74 (ILA 74.016): malgré la surexposition de la région gulaire, une teinte verte reste visible sur les
côtés de la gorge: (g) Ototomo, 18.11.72 (72.134): f à forte suffusion saumonée, de
l'individu figuré en (d)
Source : MNHN, Paris
36 ALYTES 19 (1)
Fig. 3. - Variation du patron dorsal de Lepropelis zebra, dessins à la chambre claire schématisés, Les
numéros sont ceux de la collection de l’auteur (voir tableau 1). H, holotype (ILA 75.293 = MNHN
2000.2715).
Source : MNHN, Paris
AMIET 37
Cette ornementation céphalique est un caractère discriminant important par rapport à L.
rufus et L. millsoni, dont le dessin dorsal peut être aussi, assez souvent, formé de bandes
transverses: chez ces derniers, il n’y a pas de macule céphalique mais uniquement une bande
interoculaire étroite, très régulière et indépendante des autres éléments du patron dorsal. De
plus, chez L. rufus et L. millsoni, les fascies dorsales sont souvent réunies par des anastomoses
médio-dorsales et circonscrites par un liséré foncé plus apparent que chez Z. zebra.
Le dessus des avant-bras et des jambes est aussi orné de bandes transversales, dont la
densité et la largeur reproduisent celles du dos, avec les mêmes variations individuelles.
Comme chez de nombreuses espèces de Leptopelis, il peut y avoir quelques petits points
blancs ou, plus souvent, noirs (fig. 2b, e), correspondant à des granulations un peu plus
grosses, dispersés sur le dos et le dessus des jambes, mais pas sur la tête. Il n’y a aucune trace
de pigmentation verte chez les 15 spécimens étud
L’ornementation latérale est très sobre. Les côtés de la tête ne montrent ni pigmentation
sombre sub-canthale, ni macule blanche sous-oculaire, contrairement à de nombreuses autres
espèces de Leptopelis. Les flancs sont unis, de la même teinte que le dos mais plus clairs, ou
tout au plus mouchetés de brun (fig. 2a). La coloration de l'œil n’en est que mieux mise en
valeur, l'iris, d’un cuivreux doré, étant surmonté d’une bande d’un rouge sang (fig. 2a-d),
beaucoup plus soutenu que chez les autres espèces camerounaises ayant la même pigmenta-
tion oculaire (L. millsoni, L. modestus, L. omissus et certains L. aubryi). Dans la région
postérieure, une macule foncée périanale, surmontée d’un étroit liséré blanc, est reprise au
niveau des talons et se poursuit en une bande irrégulière sous le bord externe du tarse: cette
ornementation n’a rien de particulier et se retrouve chez presque tous les Lepropelis camerou-
nais.
La description précédente concerne des individus à livrée contrastée, se développant sous
une forte hygrométrie et une faible luminosité. Dans des conditions inverses, le contraste
s’atténue, au point que les bandes dorsales peuvent devenir difficilement perceptibles (fig.
2d-e).
Le dessous des régions gulaire, pectorale et abdominale est remarquable par sa pigmen-
tation unie, sans aucune trace de maculation. La gorge est blanche, mais peut présenter une
teinte turquoise chez certains individus (fig. 2f), orangée chez d’autres (fig. 2g). Ces différences
ne paraissent pas individuelles, mais plutôt liées aux conditions ambiantes: mes notes de
terrain mentionnent, à plusieurs reprises, que la couleur vert turquoise de la gorge ne se voit
que la nuit, pendant le chant, alors que les photos d'individus fortement éclairés au préalable,
faites en laboratoire, ne montrent pas cette coloration. La poitrine et l'abdomen sont blancs
ou lavés d’orangé. Le dessous des mains, des pieds et des cuisses est toujours coloré de
saumon, pouvant tirer sur le rouge clair ou l'orangé. Le dessous des cuisses est très caracté-
ristique, avec des granulations plates polygonales d’un blanc opaque ressortant sur le reste du
tégument, transparent et vivement coloré. Le même contraste s’observe pour le pli cutané
bordant les membres antérieurs et postérieurs, lui aussi de teinte blanche. Assez paradoxale-
ment, le dessous du tarse est, sur son bord externe, fortement pigmenté de brun, coloration qui
se poursuit le long du cinquième orteil.
ace ventrale est blanchâtre, les Zones transparentes devenant opa-
animal
En alcool, toute la f
ques. Sur la face supérieure, le patron à bandes transversales reste visible, du moins
a été fixé en livrée contre
Source : MNHN, Paris
38 ALYTES 19 (1)
NE SET IT
Æ l i
Leptopelis zebra HE .
NIGERIA
GUINEE
EQUATORIALE GABON CONGO
RCA
Fig. 4. — Carte du Cameroun au sud du 8° parallèle montrant les carrés (de 10 minutes sexagésimales de
côté) où la présence de l'espèce a été relevée. En trait plein: courbe de niveau de 600 m; en tireté: limite
nord de la forêt dense continue.
Distribution géographique. - Comme le montre la carte de la fig. 4, tramée en carrés de 10 mn
de côté (pour la méthode de cartographie, voir AMIET, 1983), la présence de l'espèce a été
relevée dans une quinzaine de carrés seulement, ce qui est très inférieur aux chiffres atteints
par la plupart des autres Leptopelis sylvicoles (L. omissus 122; L. calcaratus 91; L. brevirostris
83; L. boulengeri 65; L. millsoni 54; L. ocellatus 51: L. rufus: 46). L'aire de l'espèce englobe le
centre et l’est du Cameroun, avec une limite nord coïncidant apparemment avec celle de la
forêt dense et une limite ouest constituée par le rebord du Plateau sud-camerounais. Les
prospections dans la plaine littorale et l’ouest du Cameroun ont été assez denses pour qu'on
puisse considérer l'absence de L. =ebra dans ces régions comme établie. En revanche, les
grandes lacunes dans l’est et le sud-est du territoire sont probablement dues à un manque de
prospections aux périodes favorables. D'autres Anoures camerounais ont une distribution
Source : MNHN, Paris
AMIET 39
semblable (par exemple Hyperolius platyceps, Leptopelis ocellatus et Cardioglossa escalerae),
paraissant correspondre à un aréotype “congolais” (AMIET, 1983).
Ecologie en période de reproduction. — Les sites où ont été entendus les mâles de L. zebra
présentaient plusieurs caractéristiques communes: (1) localisation dans des vallées plates,
parcourues par de petites rivières forestières à cours lent, sur fond de sable, gravier et feuilles
mortes; (2) substrat parsemé, en saison pluvieuse, de trous d’eau ou de flaques, sans être
franchement marécageux: au moins en grande saison sèche, ces collections d’eau sont taries:
(3) végétation dense, enchevêtrée, où l’abondance des lianes et les discontinuités de la canopée
évoquent souvent des formations secondaires âgées.
Les postes de chant, fournis par des branchettes ou des lianes, se situent nettement
plus haut que pour les autres Leptopelis forestiers, L. omissus compris. Leur hauteur, difficile
à estimer dans un sous-bois dense, a souvent paru atteindre la dizaine de mètres. Cette
situation élevée n’est cependant pas obligatoire, comme l’a montré l'“expérience naturelle”
suivante.
Le site de Kala-Afomo, où quelques mâles appelaient à chaque saison de reproduction à
proximité d’une petite mare tapissée de feuilles mortes, a été profondément transformé par un
défrichement effectué fin 1977. Les grands arbres ont été abattus, et seuls ont subsisté à
proximité de la mare des arbustes, des grandes herbacées et des masses de lianes privées de
leurs supports. Les mâles de L. zebra se sont alors établis dans cette végétation broussailleuse
proche de la mare, émettant leurs appels à seulement 2 ou 3 m du sol, ce qui a permis d'en
capturer plusieurs, auxquels s’est ajoutée la seule femelle connue de l'espèce. La croissance de
la végétation, rapide dans ce type de milieu, a entraîné, au fil des saisons, une remontée des
postes de chant.
Vocalisations. Cycle annuel d'activité vocale. - Les appels se distinguent facilement de ceux des
autres Leptopelis camerounais. Ils consistent en 3 ou 4 notes, d’une durée de 0,2 s et séparées
par des intervalles d'environ I s, qui pourraient être transcrites par des “hon”’ assez graves; la
dernière note est plus sonore que les précédentes. Ce type d'appel est le plus souvent émis mais,
sporadiquement, il peut y avoir des notes plus courtes, “konk”” à tonalité nasale et grave. Un
sonagramme a été publié sous la dénomination “ Leptopelis sp. 2” (Amrer & ScHioTz, 1974)
mais il est en partie obscurci par une épaisse bande de bruit de fond. Il permet cependant de
constater le faible niveau de la fréquence dominante.
Trois localités de la région de Yaoundé ont permis de suivre le cycle d'activité vocale de
l'espèce: Ototomo (janvier 1972 à décembre 1975), Kala-Afomo (janvier 1973 à décembre
1984) et Nkoladjap-Ekombitié (janvier 1976 à décembre 1984). Le tableau 4 donne le détail
des relevés acoustiques mensuels effectués dans ces localités, ainsi que le nombre de relevés au
cours desquels l'espèce a été entendue (il n’y a pas eu de sorties en août et pendant la première
quinzaine de septembre).
Ce tableau permet de constater qu'il y a deux périodes d'activité vocale, séparées par des
phases durant lesquelles l'espèce est totalement silencieuse. L'une va de décembre à mars et
l’autre comprend au moins juin et juillet. Il faut toutefois préciser qu'une analyse plus fine des
dates des relevés montre que l'espèce a été notée une seule fois avant la mi-décembre et jamais
au-delà du 7 mars, ce qui ramène à une période d'activité d’un peu moins de trois mois. De
même, l'espèce n’a été entendue qu'une seule fois (très peu active) un 12 juin, les autres relevés
Source : MNHN, Paris
40 ALYTES 19 (1)
Tableau 4. - Activité vocale de Leptopelis zebra dans trois localités de la région de Yaoundé. NR, nombre
de relevés acoustiques effectués (les tirets correspondent à des mois où aucun relevé n’a été effectué):
RZ, relevés au cours desquels L. zebra a été entendu.
Jan Fév Mar Avr Mai Jun Jul Aou Sep Oct Nov Déc
Ototomo NR|5 6 4 4 4 3 4 - - - 4
LR PNR RASE et , ne Anse à
Kala-Afomo NR|12 11 11 12 12 12 13 - 13 13 13
[= RU #6 2"Bh ue Verrine
Nkoladjap/ NR| 9 9 9 9 8 8 8 - 10 9 9
Ekombitié RZ:|NSR 3 22 See
Total NR|26 26 24 25 24 23 25 - 23 22 26 26
RZ|20 13 5 4 17 - 8
du même mois se situant après le 20; la lacune de prospection en août ne permet pas de savoir
quand s'achève cette seconde période, mais il est probable que les dernières émissions sonores
ont lieu début septembre. Les autres relevés effectués dans des localités proches de Yaoundé
coïncident aussi avec ces deux périodes. En revanche, plus à l’est, dans le domaine de la forêt
mésophile ou de la forêt congolaise, il semble y avoir un décalage des périodes d’activité car
l'espèce a été entendue fin-mars à Mintom (13°17°E) et à Mayang (13°56'E) et jusqu'aux 5-6
avril à Sandja (12°47°E).
Comme le montrent les graphiques de la figure 5, il y a une étroite corrélation entre les
périodes d'activité vocale et les deux saisons sèches ca istiques des climats équatoriaux.
Il faut cependant remarquer que: (1) la petite saison sèche (juillet-août) ne s'accompagne pas
d’une baisse marquée de l’hygrométrie et peut même, certaines années, être quasi virtuelle: (2)
le commencement de la grande saison sèche peut varier, dans la région concernée, du début à
la fin du mois de novembre. Or ces variations ne se répercutent pas sur les phases d'activité
vocale de L. zebra, ce qui laisse supposer que celle-ci n’est pas induite par les conditions
propres aux saisons sèches.
Plusieurs autres espèces forestières, surtout des Lepropelis et des Cardioglossa (AMIET,
1989), ont un cycle semblable, mais celui de Z. =ebra est remarquable par le fort “resserre-
ment” des périodes d'activité vocale. Ce phénomène est probablement en relation avec les
faibles effectifs des mâles actifs dans un site donné: les relevés acoustiques ont souvent reposé
sur l’audition de 3 ou 4 mâles seulement, alors que, simultanément, les autres espèces de
Leptopelis, L. omissus en particulier, étaient représentées par des dizaines de mâles actifs. À
l'extrême, certaines saisons de reproduction ont donné l'impression d'être “’sautées”, aucun
mâle n'ayant été entendu dans un site et à une date propices. C’est ce qui explique que dans le
tableau 4, même lors des meilleurs mois, les relevés positifs ne représentent pas la totalité des
relevés effectués.
Source : MNHN, Paris
AMIET 41
100
Jan Fév Mar Avr Mai Jun Jui Aou Sep Oct Nov Déc
Moyennes mensuelles de précipitations à Yaoundé |
20
Fig. 5. — Cycle d'activité vocale de Leptopelis zebra dans trois localités de la région de Yaoundé
{explications dans le texte), comparé au cycle annuel des précipitations. Les données pluviométri-
ques, exprimées en pourcentage du total annuel moyen pour une période de 30 ans (1597 mm), sont
empruntées à SUCHEL (1972
Espèces compagnes de L. zebra en période d'activité vocale. - Le tableau 5 regroupe toutes les
espèces d'Anoures entendues lors de 61 relevés auditifs durant lesquels l’activité vocale de L.
zebra a été constatée. Pour chacune des localités suivies (les mêmes que ci-dessus), les relevés
de grande et de petite che ont été distingués. Les relevés effectués à Ototomo en 1972
n'ont pas été retenus car, à l'époque, toutes les espèces ne pouvaient être identifiées auditive-
ment. Le rapport du nombre de relevés où une espèce a été entendue au nombre de relevés où
l'activité de L. zebra a été notée a été exprimé en pourcentage, pour faciliter les comparaisons.
aisOn $
Source : MNHN, Paris
4
ALYTES 19 (1)
Tableau 5. - Anoures participant à la même phonocénose que Lepropelis zebra. Explications dans le texte.
NT, nombre total de relevés où une espèce a été entendue. Groupes: À, développement en eau
stagnante B, développement en eau stagnante renouvelée (proximité d’un cours d’eau); C, dévelop-
pement en eau courante.
F Ototomo | Ototomo | Kala Af. | Kala Af. [Nkol./Ek.| Nkol/Ek.
Gde. S. | Pet, S. s. |Gde. $. s| Pet, S. s.]Gde. $. s| Pet, S. [NT
(8) _| (5) {19) |} (11) CON SCES S
Poste de chant sur | | |
la végétation | | |
Groupe A | | |
Le. omissus 62,5 80 947 | 100 100 | 100 |55
Le.calcaratus 75 | #0 73.7 | 91 692 | 80 |47
Le. boulengeri 625 | 60 63,1 | 54,4 53,8 6 | 36
Le. notatus 25 | 40 421 | 364 100 | 100 |34
Hy. ocellatus 50 | 60 737 | 727 307 | 20 |3
Le. ocellatus 89,5 | 72,7 te | MS 27
Le. aubryi 62,5 100 CESR 3 20 |17
Af paradorsalis 105 | 89 | 1
Hy. plaryceps 12,5 2 | 307 | 40 |7
Hy. endjami - | 364 | 4
Ch. rufescens 125 | 40 52 | - | 4
Le. modestus | ÉOSA NE, 51 3
Hy. kuligae | | 154 | - 2
Groupe B | |
Le. rufus 375 | - 684 | 364 | 20
Le. millsoni | | 61,5 | 60 |ii
Groupe C | | |
Op.immaculatus | 62,5 | 60 842 | 100 46 | so |45
Al obstetricans 50 60 | ET Tee | ME 8
Poste de chant au | &:
sol | |
Groupe À | | |
Am. albolabris - | 4 158 | - 385 | 60 |13
Pi.aequiplicata 37,5 | 20 | 4
Groupe B |
Di. africanus 25 | 100 91 154 40 |39
Am. amnicola 316 | 91 77 r 8
Groupe C |
Ca.gratiosa 50 80 79 | 100 100 100 |52
Ca.escalerae 100 | 80 84,2 82 37
Co. crassipes 37,5 40 63,1 54,5 23 20 |27
Ca. gracilis 37,5 60 158 | 100 23 80 |27
As. batesi 12.5 20 58 63,6 23 20 |24
Ca. leucomystax 75 100 31,6 54,5 23
Bu. gracilipes 25 | 36,8 36.4 13
(eu tuberosus 36,8 ï 154 # 9
Source : MNHN, Paris
AMIET 43
On constate que près d’une dizaine d'espèces accompagnent fidèlement L. zebra, quelles
que soient la localité et la saison considérées, puisqu'elles se retrouvent dans plus de 50 % des
relevés: Leptopelis omissus (55 relevés sur 61), Cardioglossa gratiosa (52), Leptopelis calcaratus
(47), Opisthothylax immaculatus (45), Dimorphognathus africanus (39), Cardioglossa escalerae
(37), Leptopelis boulengeri (36), L. notatus (34) et Hyperolius ocellatus (34).
D'autres espèces sont plus souvent notées en même temps que L. zebra lors d’une des
deux saisons sèches. Par exemple, Curdioglossa gracilis est plus fréquente en petite saison
sèche. En effet, l’activité vocale de cette espèce, plus “opportuniste” que les autres Cardio-
glossa sylvicoles, débute aux premières pluies de fin février et connaît seulement un ralentis-
sement en petite saison sèche, en relation peut-être avec le maintien d’un degré hygrométrique
plus élevé qu’en grande saison sèche.
On remarquera aussi que certaines espèces n’accompagnent L. zebra que dans certaines
localités, probablement en raison de particularités environnementales présentées par ces
dernières. C’est ainsi que les bas-fonds de Nkoladjap-Ekombitié, parcourus par de petites
rivières à cours lent, sur fond finement sableux, susceptibles de tarir en grande saison sèche (et
même en petite), conviennent à Leptopelis millsoni, mais pas à Cardioglossa escalerae (qui
recherche pourtant, en période de reproduction, des substrats sableux).
On pourrait qualifier de “phonocénoses” les ensembles d'espèces qui exercent leur
activité vocale, et donc reproductrice, pendant la même période de l’année et dans des sites
présentant des caractéristiques écologiques similaires. Ces ensembles ne sont, à proprement
parler, ni des peuplements, ni des communautés, ni des associations, ni des synusies. Ils
méritent néanmoins d’être décrits car ils constituent de bons indicateurs de certaines combi-
naisons de facteurs écologiques, en ayant de plus le grand avantage d'intégrer la dimension
temporelle. Dans le cas présent, il faut cependant remarquer que le tableau 5 ne donne qu'une
image incomplète de la phonocénose à laquelle participe L. zebra, car il ne tient pas compte:
(1) des relevés effectués dans les mêmes sites et aux mêmes saisons mais où L. zebra n’a pas été
noté; (2) des relevés effectués dans les mêmes sites mais à d’autres saisons (ils permettraient de
mettre en évidence l’évolution de la phonocénose au cours de l’année); (3) des relevés effectués
dans d’autres milieux (qui permettraient de définir les phonocénoses de façon comparative, en
mettant en évidence des espèces “caractéristiques” et/ou constantes). Tel quel, le tableau 5
représente cependant une esquisse significative de la phonocénose à laquelle participe L.
cebra.
RÉSUMÉ
Une nouvelle espèce de Leptopelis provenant du Cameroun méridional est décrite. Elle
est facilement reconnaissable par son patron dorsal, constitué de bandes transverses sauf une
macule céphalique trapézoïdale, son canthus très arrondi, sa face ventrale dépourvue de
maculation et son appel nuptial caractéristique. Les limites de répartition de cette rare espèce
sont définies, surtout à partir de relevés auditifs, et des informations sont fournies sur son
étho-écologie, y compris la *phonocénose” à laquelle elle participe.
Source : MNHN, Paris
44 ALYTES 19 (1)
REMERCIEMENTS
Tous mes remerciements vont à Annemarie Ohler, Alain Dubois et Arme Schiotz pour la lecture du
manuscrit et les informations et suggestions qu'ils m'ont communiquées.
RÉFÉRENCES BIBLIOGRAPHIQUES
, 1983. — Un essai de cartographie des Anoures du Cameroun, A/yies, 2 (4): 124-146.
—— 1989. — Quelques aspects de la biologie des Amphibiens Anoures du Cameroun. Ann. biol., 28 (2):
73-136.
— 1991. — Un Leptopelis méconnu de la faune forestière camerounaise (Amphibia, Anura, Hyperolii-
dac). Alpes, 9 (4): 89-102.
Ave, J.-L. & Scmiorz, À. 1974. - Voix d’Amphibiens camerounais. III. Hyperoliinae: genre Lepropelis.
‘Ann. Fac. Sci. Cameroun, 17: 131-163.
LAURENT, R., 1973. - Le genre Lepropelis Günther au Zaire (Salientia). Ann. Mus. r Afr cent., Sci. zool.,
202: 1-62.
Perker, J-L., 1966. - Les Amphibiens du Cameroun. Zool. Jb. Spst., 8: 289-464.
Scmiorz, À. 1999. Treefrogs of Africa. Chimaira, Frankfurt am Main
SucHez, J-B., 1972. - La répartition des pluies et les régimes pluviométriques au Cameroun. Travaux et
documents de géographie tropicale, C.E.G.E.T., C.N.R.S, n° 5: 1-287.
Corresponding editor: Alain DuBois.
© ISSCA 2001
Source : MNHN, Paris
Alytes, 2001, 19 (1): 45-52. 45
Local variation in Rana temporaria
egg and clutch size
adaptations to pond drying?
Jon LOMAN
Department of Animal Ecology,
Lund University, 223 62 Lund, Sweden
Egg and clutch size variation among populations of common frogs
(Rana temporaria) were studied in 14 ponds in Sweden. Also two secon-
dary indices, clutch mass and allocation tactics (egg size*/clutch size) were
studied. For all four characters there was a pond-wise correlation between
the values across the two study years. Al characters differed among ponds
and all but allocation tactics differed between years. At least part of this
variation must be environmental. The ponds were classified as permanent
or temporary. The latter dried completely in some years, g all tadpoles.
Pond type affected all characters except egg size. Thus, clutches in shallow
ponds were smaller, lighter and, correcting for clutch mass, had larger eggs
(from the allocation tactics index). 1 suggest that this variation may be
adaptive.
INTRODUCTION
character variation is a trait of all non-endemic animal populations. In common
frogs (Rana temporaria), JoLY (1991) and RYsEr (1996) found differences in body size among
local populations. My study is concerned with two other life history characters that are well
covered by frog studies, namely clutch and egg size (GiBBoNs & MCCARTHY, 1986; BERVEN,
1988: TEJEDO, 1992; SEMLITSCH & SCHMIEDHAUSEN, 1994). However most studies are con-
cerned with within-population variation and how this is related to individual strategies
(exceptions being JoLY, 1991, and MARTIN & Miaup, 1999). This is also the approach taken
in a number of theoretical studies and reviews of life history theory (SMirH & FRETWELL,
1974; Rorr, 1992; EBerT, 1993). The models can be used to compare optimal trait expression
in different localities (CUNNINGTON & BROOKS, 2000).
Loc.
The question posed in the present study is: does population variation in egg and clutch
size characters exist in the study area and is this related to pond hydroperiod? Pond hydrope-
riod is studied because it has a profound effect on the survival of common frog tadpoles in the
study ponds (LOMAN, 1996) as well as in other areas (COOKkE, 1985; KUTENKOV & PANARIN,
1995). So, in temporary ponds fast developing tadpoles are at an obvious advantage. For some
frogs (Bombina orientalis: PARICHY & KAPLAN, 1995; Rana sylvatica: BERVEN & CHADRA,
Source : MNHN, Paris
46 ALYTES 19 (1)
1988), it has been shown that large eggs hatch into fast developing tadpoles. The same
correlation has already been found for Rana temporaria in the present study area (unpubl.).
This makes it particularly interesting to study if there is a relation between pond hydroperiod
and egg size, one of the response variables studied here.
One reason local character variation is important to study is this. Basically, the variation
may be genetic and/or due to direct environmental effects. If the variation has a genetic basis
and is adaptive, this is a factor that must be taken into consideration in conservation work.
Translocating individuals in order to increase diminishing populations may lead to “ecologi-
cal outbreeding depression” (SCHIERUP & CHRISTIANSEN, 1996; LARDNER, 2000). This is the
case if the introduced genotype is not adapted to the new environment.
METHODS
The study is based on measurements on eggs and spawn clumps collected in the field and
on field measurements of the length of the source pond hydroperiod.
During the breeding seasons of 1993 and 1994, spawn clumps were sampled in 14 ponds.
All ponds were sampled in both years. The ponds are located in the central and southwestern
part of Skäne, the southernmost province of Sweden. The southwesternmost ponds are in the
vicinity of Lund, 40 km from the northeasternmost. The study ponds were classified as
permanent or temporary. Temporary ponds were those eight that in some years dried out
before or during the time the tadpoles metamorphosed. During the six years 1992-1997, when
the ponds were monitored during the time of metamorphosis, this happened 2, 2, 2, 2, 5, 5,5
and 6 times. The six permanent ponds always contained enough water for the entire period of
tadpole life and metamorphosis. The number of spawn clumps laid in the ponds (average of
1993 and 1994) was between 19 and 310 in the temporary and between 16 and 160 in the
permanent ponds.
From each pond I collected data on 6 to 22 spawn clumps. Each spawn clump was
weighed and a sample of approximately 10 g was collected. The clump was then immediately
returned to the pond. The sample was weighed at the pond and brought to the laboratory
where the number of eggs in the sample was counted. This information was used to estimate
“clutch size” (total number of eggs in the clump). The egg diameter (egg proper, excluding
jelly) was measured with calipers in a sample of 15 eggs from each clump and the mean value
was used as measure of “egg size”. Because the ponds were visited every 5 days, I could age the
spawn. Only spawn aged one to four days was used.
Two secondary indices were computed. Clutch volume was computed as the average egg
volume times clutch size. “Allocation tactics index” was computed as average egg diameter”
divided by clutch size. A large value of tactics means that a female, relative to other females
that make the same total investment (same clutch mass), is more inclined to put her effort in
large eggs but a smaller clutch.
Source : MNHN, Paris
LOMAN 47
Table 1. — Pearson correlation test between 1993 and 1994 values for the four indexes studied.
Measurements are defined in the methods section. All tests are based on 14 ponds. The P
values are one-tailed probabilities. A one-tailed test was used as any, hypothetical, negative
correlations a priori would have been discarded as non sensical
Index
Egg size
Clutch size 0.820 < 0.001
Clutch mass index
Allocation tactics index
Table 2. — Average clutch and pond values for permanent and temporary ponds. Egg size is diameter
(mm), clutch size is number of eggs per clutch and clutch volume is total volume of eggs (cc)
Allocation tactics is an index that is explained in the methods. x, mean; s, standard deviation;
n, sample size.
Pond type Egg size |Clutch size] ie Poe
1929 6.96 0.0040
Permanent s 0.12 347 1.30 0.0010
n 6 6 6 6
x 1.87 1464 5.26 0.0052
Temporary s 0.066 289 151 0.0009
8 8
RESULTS
For all four characters (egg size, clutch size, clutch mass index and allocation tactics
index), there was a significant correlation between the average value for a pond in 1993 and
that in 1994 (tab. 1, fig. 1).
1 also tested the independent effects of year, pond and pond type (permanent or
temporary) on the four characters. Egg size was larger in 1994 than in 1993. It differed
significantly among ponds but there was no effect of pond type (tab. 2-3, fig. 1). Clutch size
was significantly larger in 1994 than in 1993 and it differed significantly among ponds.
De that were deposited in permanent ponds were larger than those in temporary ones
(tab. 2-3, fig. 1). Clutch mass index showed the same pattern as elutch size; higher mass in
1994, a significant effect of pond and on average a higher mass for clutches in permanent
ponds (tab. 2-3, fig. 1). The allocation tactics index differed significantly among ponds but not
Source : MNHN, Paris
1994
Egg size (mm) Ciutch size (N)
1994
1998
Cluich voiume (c.c.) Allocation tactics index
25 — 77" —7— OO07 p—— 5 —— 5 — #7 —
| / À
0.006! <<
| | |
| ë |
| _ |
| |
: |
| Ze |
— 0. 09e! A LE ——
6 7 10 0002 0004 0.006 0.008 0.010
1993 1993
Fig. 1. - Relation between egg and clutch characters in 1993 and 1994. Permanent ponds are indicated
with open circles and temporary ones with filled circles. The dashed line represents equal 1993 and
1994 values. A positive slope of the fitted linear regression (the unbroken line) indicates constancy in
pond characteristics over years.
La
(D 61 SALATV
Source : MNHN, Paris
LOMAN 49
Table 3. — Effects from pond (individual pond, nested under pond hydroperiod), pond type
(hydroperiod permanent or temporary) and year on egg and clutch characters, tested with a
3-way ANOVA. The interaction Pond*Year was tested but not found significant and
removed for the definite test. Data are individual clutch measurements.
Egg size |Clutehsize| Cteh | Alocation
df 11:224 11:221 11:221
Pond F 6.73 7.93 6.59
Ed < 0.001 < 0.001 < 0.001 < 0.001
df 1:222 1:224 1:221 1:221 |
Type F 0.015 43.0 22.7 28.3
P 0.90 < 0.001 < 0.001 < 0.001
df 1222 1:224 1:221 1:221
Year F 6.86 16.22 22.0 1.46
A 0.009 < 0.001 < 0.001 0.23
years. The value was higher for temporary ponds than for permanent ones (tab. 2-3, fig. 1).
This means that when correcting for the fact that females breeding in temporary ponds put
less effort (a lower clutch mass index) altogether into breeding, they were more inclined to
invest in larger eggs.
DISCUSSION
Indeed, there were differences in the four egg and clutch characters studied among
populations breeding in different ponds. In previous studies, MARTIN & MIAUD (1999) and
JoLy (1991) have detected differences in female size among neighbouring populations. In the
Joly study, there were also differences in egg and clutch size between two populations. Because
these variables have been shown to be correlated to female size within populations (HÔNIG,
1966; GisBons & MCCaRTHY, 1986; Jo, 1991; RySER, 1996), it may well be that egg size
variation between populations, both in the Joly study and in the present one, is a direct effect
of among-population variation in female size. In the MARTIN & MIAUD (1998) study, the
variation in egg size among populations was weak, despite among-population differences in
female size.
Egg size, clutch size and clutch mass index varied between the two years. This was
especially clear for clutch size; in all ponds but two were 1994 clutches larger than 1993
clutches. Also for egg size was the average pond value larger in 1994. This pond wide year
suggests that weather factors are involved but, with only two years available for analysis,
itis not possible to analyze which factors are crucial. Because the eggs are gradually formed
during the preceding summer, there are numerous possibilities. Rainfall and temperature
Source : MNHN, Paris
50 ALYTES 19 (1)
during any combination of months up to a year before spawning may potentially be involved.
Again, because female size affects the clutch and egg size variables, between-year variation in
female size may partly be the proximate cause, as suggested by BERVEN (1988) in a study of
Rana sylvatica. Whatever the exact cues, this shows an environmental effect on egg and clutch
size, either directly or indirectly through effects on female size.
Although there was a between-year variation, there was a significant year to year
correlation among ponds (tab. 1); some ponds had consistently small eggs and clutches. This
stresses the pond specificity. This was also manifest as a significant pond effect (tab. 3) on all
variables. The pond effect was partly an effect of pond hydroperiod but note that it was still
present when accounting for all effects of hydroperiod (as both factors were included in the
ANOVA). These effects may be directly or indirectly (through effects on female size) due to
variation in the environment and feeding conditions surrounding the ponds.
Genetic differences have been detected in allozyme studies between close populations of
frogs (Rana temporaria: RER & Seirz, 1990; REGNAUT, 1997; LARDNER, 2000; Bufo calamita:
SinscH, 1992). Also, frog species with a biology similar to that of Rana temporaria have been
shown to exhibit natal pond fidelity: this includes Bufo bufo (HEUSSER, 1966; READING et al.,
1991) and Rana sylvatica (BERVEN & GRUDZIEN, 1990). In a study of Rana sylvatica, BERVEN
(1988) has shown that population differences in clutch hand egg size may have a genetic basis.
Is it possible that the variation found in this study is due to microevolution? The design does
not allow any definite conclusions. However, if microevolution is involved, one would expect
the observed variation to be adaptive.
Was the effect of pond hydroperiod on the clutch mass index, parental investment,
adaptive? Yes, possibly. The investment was less in shallow ponds. This means less stress on the
female and possibly a higher survival with a better possibility to breed more times (MADSEN &
SHINE, 2000). In shallow ponds, where breeding fails completely in some dry years, this means
a higher likelihood of at least some surviving offspring during a life-time. Actually, life history
theory predicts that iteroparous tendencies should be favoured in unpredictable environments
(RoFF, 1992).
Itis also possible to find an adaptive effect of the variation in the allocation tacties. Given
a fixed total investment (clutch mass), it is reasonable that it is more important to invest in
large eggs (hatching into fast developing tadpoles) in temporary than in permanent ponds.
Large eggs may hatch into tadpoles that develop faster than those hatched from small eggs
(BERVEN & CHADRA, 1988; ParICHY & KAPLAN, 1992), thus decreasing the risk of total loss of
recruits in a dry summer when the pond may dry early.
Itis surprising that there was no effect of pond hydroperiod directly on egg size (tab. 3).
This effect could also be predicted for the same reasons I use above to argue an adaptive
explanation for variation in allocation tactics index. However, egg size may (regardless of
pond hydroperiod) be affected by female size (HGNIG, 1966, Giggons & MCCARTHY, 1986:
RYSER, 1996). For this variable I have no data for the present ponds and thus I cannot control
for it. If female size is not related to pond hydroperiod, such a correlation may mask possible
effects of pond hydroperiod on egg size. However, the use of allocation tacties index is a
method to control for variation in clutch mass, which means it may in turn control for some of
the variation in female size (and other female characters that affect total clutch investment).
Source : MNHN, Paris
LOMAN sl
If the patterns recorded are indeed adaptive, it is easier to see this as an outcome of a
direct, selected genetic effect than as a reaction norm (STEARNS & KOELLA, 1986; SCHLICHTING
& PiGLiucci, 1998) or phenotypic plasticity. This means that females in all study populations
may share the same genotype but this codes for different egg and clutch size strategies under
the actual conditions present in the different ponds. This would lead to transgenerational
phenotypic plasticity (MoussEAU & Fox, 1998). However, eggs are formed during the summer
preceding breeding (JORGENSEN, 1981), far ahead of the females’ arrival to the breeding
pond. Although complicated pathways based on breeding site fidelity are possible, such
explanations seem far fetched.
To sum up, the variation recorded must at least in part be due to environmental effects.
The fact that some of the variation was adaptive in ways predicted by life history theory
suggests that microevolution was also involved. No direct proof for this is however available.
Further studies to reveal the nature of between-pond variation in these characters need to use
frogs originating in different ponds and raised in a “common garden” (FAUTH, 1998) from egg
to maturity. Comparing the traits of their spawn should provide the necessary evidence.
If local adaptions are indeed involved, this also means that translocating frogs affects the
genetic make-up of local target populations. In principle, this could have adverse effects
(STORFER, 1999). However, the fact that evolution may have occurred in response to such a
“fine grained” habitat variable as pond hydroperiod also means that this evolution may
proceed quite quickly. Thus the progeny of translocated individuals are likely to adapt
quickly, provided a sufficient genetical basis is provided (LARDNER, 2000).
ACKNOWLEDGEMENTS
The study was done with support from the Swedish Council for Forestry and Agricultural Research.
Bjôrn Lardner and Bodil Enoksson helped me measure the eggs. Bjôm Lardner’s and Linus Svensson's
comments improved the presentation
LITERATURE CITED
BERVEN, K. A., 1982. - The genetic basis of altitudinal variation in the wood frog Rana sylratica. 1. An
experimental analysis of life history traits. Evolution, 36: 962-983.
—— 1988. — Factors affecting variation in reproductive traits within a population of wood frogs Rana
vatica. Copeia, 1988: 605-615.
Ex, K. A. & CHaDraA, B. G. 1988. - The relationship among egg size density and food level on larval
development in the wood frog Rana svlvatica. Oecologia, 75: 67-72.
BERVEN, K. À. & GRUDZIEN, T. A., 1990. — Dispersal in the wood frog (Rana sylvatica): implications for
genetic population structure. Evolution, 44: 2047-2056.
CookE, A. S.. 1985. - The deposition and fate of spawn clumps of the common frog Rana temporaria at
a site in Cambridgeshire 1971-1983. Biol. Conserr., 32: 165-187.
NGTON, D. C. & BROOKS, R. J. 2000, - Optimal egg size theory: does predation by fish affect eggsize
in Ambystoma maculatum. J Herp., 34: 46-53.
EBerT, D., 1993. - The trade-off between offspring size and number in Daphnia magna: the influence of
genetic, environmental and maternal effects. Arch. Hydrobiol., suppl., 90: 453-473.
FauTH, JL. 1998. — Investigating geographical variation in interspecific interactions using common garden
experiments, Jn: W. J. RESETARITS, Jr. & J. BERNARDO (ed.), Experimental ecology — Issues and
perspectives, New York, Oxford Univ. Press: 394-415
Gi8BoNs, M. M. & MCCARTHY, T. K., 1986. - The reproductive output of frogs Rana temporaria (L.) with
particular reference to body size and age. Z Zool.. 209:579-593.
BTL. DU |
MUSÉ UM
PARC
+
CUN
Source : MNHN, Paris
52 ALYTES 19 (1)
HEUSSER, H., 1968. — Die Lebenweise der Erdkrôte Bufo bufo (L.). Rev. suisse Zool., 75: 927-982.
HÔNIG, J., 1966 . — Über Eizahlen von Rana temporaria. Salamandra, 2: 70-72.
JoLv, P, 1991. - Variation in size and fecundity between neighbouring populations in the common frog
Rana temporaria. Alytes, 9: 79-88.
JORGENSEN, C. B., 1981. - Ovarian cycles in a temperate zone frog, Rana temporaria, with special reference
to factors determining number and size of eggs. J Zool., 195: 449-458.
KING, E. G. & KAPLAN, R. H., 1997. - Estimating ovum size in amphibians: eggsize increases diflerently
among species during carly development. Z Herp., 31: 299-302.
KUTENKOV, À. P. & PANARIN, À. E., 1995. - Ecology and status of populations of the common frog (Rana
temporaria) and the moor frog (Rana arvalis) in northwestern Russia, with notes on their distribu-
tion in Fennoscandia. /n: S. L. KuzMIN, C. K. Dopn & M. M. PiKkULIK (ed.), Amphibian
populations of CIS, Moscow, Pennsoft: 64-71.
LARDNER, B., 2000. - Phenotypic plasticity and local adaptions in tadpoles. Lund, Department of Ecology:
1-30.
LOWAN, J., 1996. — Overvakningsprogram fôr brungrodor i Skäne. Rapport frän Mi
Malmôhus län, 7: 1-47.
R., 2000. — Energy versus risk: cost of reproduction in free-ranging pythons in
Austr. J. Ecol., 6: 670-675.
MARTIN, R. & MiauD, C., 1999. — Reproductive investment and duration of embryonic development in
the common frog Rana temporaria. In: C. MiAUD & R. GUYÉTANT, Current studies in herpetology,
Le Bourget du Lac, SEH: 309-313.
MoussEau, T. A. & Fox, S. W., 1998. - The adaptive significance of maternal effects. Trends Ecol. Evol.,
13: 403-407.
PARICHY, D. M. & KaPLAN, R. H., 1995. - Maternal investment and developmental plasticity: functional
consequences for locomotor performance of hatchling frog larvae. Funet. Ecol., 4: 606-617.
READING, C. J., LOMAN, I. & MADSEN, T., 1991. - Breeding pond fidelity in the common toad, Bufo bufo.
J. Zool., 225: 201-211.
REGNAUT, $., 1997. — Population structure of the moor frog (Rana arvalis) in a Baltic sea archipelago.
Lund University, Dept. anim, Ecol.: 1-18.
Re, W. & Serrz, À., 1990. - The influence of land use on the genetic structure of populations of the
common frog Rana temporaria. Biol. Conserv., 54: 239-249.
ROFF, D. A., 1992. — The evolution of life histories. Theory and analysis. New York, Chapman & Hall:
1-535.
RYSER, J., 1996. - Comparative life histories of a low- and a high-elevation population of the common
frog Rana temporaria. Amphibia-Reptilia, V7: 183-195.
Soeur, M. H. & CHRISTIANSEN, F. B., 1996. — Inbreeding depression and outbreeding depression in
plants. Heredity, 77: 461-468.
SCHLICHTING, C. D. & PiGLiuccr, M., 1998. — Phenotypic evolution. A reaction norm perspective.
Sunderland, Mass., Sinauer Ass. Inc.: 1-387.
SEMLITSCH, R. D. & SCHMIEDHAUSEN, S., 1994. — Parental contributions to variation in hatchlin:
its relationship to growth and metamorphosis in tadpoles of Rana lessonae and Rana
Copeia, 1994: 406-412.
Sixsen, U., 1992. - Structure and dynamics of a natterjack population (Bufo calamita). Oecologia, 9:
489-499.
SuirH, C. & FRETWELL, L., 1974, — The optimal balance between size and number of offspring. Amer.
Nat., 108: 499-506.
Srarxs, $. C. & KoëLLA, J C., 1986. — The evolution of phenotypic plasticity in life-history traits:
predictions of reaction norms for age and size at maturity. Evolution, 40: 893-913.
STORFER, A., 1999. - Gene flow and endangered species translocations: a topic revisited. Biol. Conserr.,
87: 173-180.
Tekno, M. 1992. - Absense of trade-off between the size and number of offspring in the natterjack toad
(Bufo calamita). Oecologia, 90: 294-296.
rvakningen à
e and
sculenta.
Corresponding editor: Thierry LoDÉ.
© ISSCA 2001
Source : MNHN, Paris
ANTES
International Journal of Batrachology
published by ISSCA
EDITORIAL BOARD
Chief Editor: Alain Durois (Laboratoire des Reptiles et Amphibiens, Muséum national d'Histoire naturelle, 25
rue Cuvier, 75005 Paris, France; <
[email protected]>).
Deputy Editor: Thierry LODÉ (Laboratoire d'Écologie animale, Université d'Angers, 2 boulevard Lavoisier,
49045 Angers Cedex, France; <
[email protected]>).
Conservation Editor: Stephen J, RICHARDS (Vertebrates Department, South Australian Museum, North Terrace,
Adelaide, S.A. 5000, Australia; <
[email protected]>).
Editorial Board: Franco ANDREONE (Torino, Italy); Lauren E. BROWN (Normal, USA); Janalee P. CALDWELL
(Norman, USA); Ulisses CARAMASCHI (Rio de Janeiro, Brazil); Günter GOLLMANN (Wien, Austria); Tim
HaLLiDaY (Milton Keynes, United Kingdom); W. Ronald HEVER (Washington, USA); Esteban O. LAVILLA
(Tucumän, Argentina); Karen R. Lips (Canton, USA); Masafumi Maïsut (Kyoto, Japan): Donald F.
MCALPINE (Saint John, Canada): John C. PoyNToN (London, England).
Technical Editorial Team (Paris, France): Alain Duois (texts); Roger BOUR (tables); Annemarie OHLer (figures).
Book Review Editor: Annemarie OHLER (Paris, France).
SHORT GUIDE FOR AUTHORS
(for more detailed Instructions 10 Authors, see Alytes, 1997, 14: 175-200)
Alytes publishes original papers in English, French or Spanish, in any discipline dealing with amphibians.
Beside articles and notes reporting results of original research, consideration is given for publication Lo synthetic
review articles, book reviews, comments and replies, and to papers based upon original high quality illustrations
(such as colour or black and white photographs), showing beautiful or rare species, interesting behaviour, etc.
The title should be followed by the name(s) and address(es) of the author(s). The text should be typewritten
or printed double-spaced on one side of the paper. The manuscript should be organized as follows: English
abstract, introduction, material and methods, results, discussion, conclusion, French or Spanish abstract,
acknowledgements, literature cited, appendix.
Figures and tables should be mentioned in the text as follows: fig. 4 or tab, 4. Figures should not exceed 16
x 24 em. The size of the lettering should ensure its legibility after reduction. The legends of figures and tables
should be assembled on a separate sheet. Each figure should be numbered using a pencil.
References in the text are to be written in capital letters (BOURRET, 1942; GRAF & POLLS PELAZ, 1989; INGER
et al., 1974). References in the Literature Cited section should be presented as follows:
BOURRET, R., 1942. - Les batraciens de l'Indochine. Hanoï, Institut Océanographique de l’Indochine: i-x + 1-547,
LL
pl.
GRAF, 1.-D. & PoLLs PELAZ, M. 1989. - Evolutionary genetics of the Rana esculenta complex. In: R. M. DAWLEY
&J. P. BoGarT (ed.), Evolution and ecology of unisexual vertebrates, Albany, The New York State Museum:
289-302.
IxGER, R. F., Voris, H.K. & Voris, H. H., 1974. - Genetic variation and population ecology of some Southeast
Asian frogs of the genera Bufo and Rana. Biochem. Genet., 12: 121-145.
Manuscripts should be submitted in triplicate either to Alain Dusois (address above) if dealing with
amphibian morphology, anatomy, systematics, biogeography, evolution, genetics, anomalies or developmental
biology, or to Thierry LODÉ (address above) if dealing with amphibian population genetics, ecology, ethology or
life history, or to Stephen J. RICHARDS (address above) if dealing with conservation biology, including declining
amphibian populations or pathology. Acceptance for publication will be decided by the editors following review
by at least two referees.
If possible, after acceptance, a copy of the final manuscript on a floppy disk (3 % or 5 /4) should be sent 10
the Chief Editor. We welcome the following formats of text processing: (1) preferably, MS Word (1.1 to 6.0, DOS
or Windows), WordPerfect (4.1 to 5.1, DOS or Windows) or WordStar (3.3 to 7.0): (2) less preferably, formated
DOS (ASCII) or DOS-formated MS Word for the Macintosh (on a 3 V4 high density 1.44 Mo floppy disk only).
Page charges are requested only from authors having institutional support for this purpose. The publication of
colour photographs is charged. For each published paper, 25 free reprints are offered by ISSCA to the author(s).
Additional reprints may be purchased.
Published with the support of AALRAM
(Association des Amis du Laboratoire des Reptiles et Amphibiens
du Muséum National d'Histoire Naturelle, Paris, France).
Directeur de la Publication: Alain Dusors.
Numéro de Commission Paritaire: 64851.
© ISSCA 2001
Source : MNHN, Paris
Alytes, 2001, 19 (1): 1-52.
Contents
Alain DuBois
Editorial ..
Alain Dugois, Masafumi MATsUI & Annemarie OHLER
A replacement name for Rana (Paa) rara Dubois & Matsui, 1983
(Amphibia, Anura, Ranidae, Raninae) ..............................0 2-4
Michael VrITH, Joachim KosUCH, Annemarie OHLER & Alain DuBois
Systematics of Fejervarya limnocharis (Gravenhorst, 1829)
(Amphibia, Anura, Ranidae) and related species.
2. Morphological and molecular variation in frogs
from the Greater Sunda Islands (Sumatra, Java, Borneo)
with the definition of two species .....,................,.... 5-28
Jean-Louis AMIET
Un nouveau Leptopelis de la zone forestière camerounaise
(Amphibia, Anura, Hyperoliidae) 44:42. 29-44
Jon LOMAN
Local variation in Rana temporaria egg and clutch size:
adaptations to pond drying? .......:..1...000.020 Re 45-52
Alytes is printed on acid-free paper.
Alytes is indexed in Biosis, Cambridge Scientific Abstracts, Current Awareness in Biological
Sciences, Pascal, Referativny Zhurnal and The Zoological Record.
Imprimerie F. Paillart, Abbeville, France.
Dépôt légal: 2° trimestre 2001.
© ISSCA 2001
Source : MNHN, Paris