10
Biodiversity
www.biodiversityjournal.com
Journal
ISSN 2039-0394 (Print Edition)
ISSN 2039-0408 (Online Edition)
MARCH 2013, 4 (1): 1-260
with the support of
ba
X ▲ f
FOR NATURALISTIC RESEARCH
AND ENVIRONMENTAL STUDIES
Channa lucius (Cuvier, 1831) - Rayong, Thailand
Upper: Dwarf snakehead, Channel cf. gachua (Hamilton,
1822) Petchaburi, West Thailand
Lower:Striped snakehead, Channel striata (Bloch, 1 793)
Rayong, East Thailand
Photos by Ekkapan Ubonrach
Biodiversity of Snakehcads genus Channel Scopoli 1777 in Thailand. The family
Channidae comprises more than 30 species of freshwater fishes (Snakeheads) and two extant
genera, Parachanna Teugels et Daget, 1984 (Africa), and Channa Scopoli, 1777 (Asia:
South Asia to the Far East). In Thailand, the genus Channa includes 6 species, C. Indus
(Cuvier, 1831), C. marulius (Hamilton, 1 822), C. melasoma { Blcckcr, 1851), C. micropeltes
(Cuvier, 1 83 1 ), C. striata (Bloch, 1 793) and C ef. gachua (Hamilton, 1 822). However, many
of them still have an unclear taxonomic status, especially the populations of Mekong Basin.
Snakeheads can be found mostly in all regions of Thailand, except for Black snakehead (C.
melasoma) that occurs only in the southern part of the country. Their habitat embraces head
water streams and mainstreams or flood areas such as canals, rice fields, swamps or still
waters. Some species, i.c. Black snakehead (C. melasoma). Giant snakehead (C. micropeltes)
and Striped snakehead (C. striata ), can also live in peat swamps or acidic waters. Dwarf
snakehead (C cf. gachua) can be found only in mountain-stream ecosystem; moreover, all
snakeheads can live in waters with low oxygen levels thanks to supra-branchial organs in
circulatory system which can enable fish to air-breathing. This ability can be helpful for
hibernating underground during the dry season. Snakeheads, in Thailand, occur all year
round but reproduction period is only in rainy or flood season. Striped snakehead (C.
striata ), Blotched snakehead (C. Indus), Bullseye snakehead (C. marulius). Black
snakehead (C melasoma) and Giant snakehead (C. micropeltes) show nesting behavior prior
to breeding time. Fish use caudal fin to swing or waving on aquatic plants to build the nest, but
nesting patterns are different in each species: eggs are laid into the nest and one parent or both
will take care of them to the juvenile stage. Only Dwarf snakehead (C. cf. gachua) has a
mouth-brooding behavior. Snakeheads are top-level predators, including also cannibalism.
Sltthi Kulabtong, Save wild life volunteer Thailand, Wangnoi District, Ayuttaya Province
13170, Thailand; e-mail: kulabtong201 [email protected]
Ekkapan Ubonrach, 5/1 Watpapradoo Road, Tapradoo Subdistrict, Muang District, Rayong
Province 2 1 000, Thailand; e-mail: [email protected]
Biodiversity Journal, 2013, 4 (1): 3-104
Monograph
Catalogue of the spiders (Arachnida Araneae) of Sardinia
Paolo Pantini 1 *, Antonio Sassu 2 & Giuseppe Serra 3
'Museo civico di Scienze Naturali “E. Caffi”. Piazza Cittadella, 10 - 24129, Bergamo (BG), Italy; e-mail: [email protected]
2 Via Europa, 59 - 09070, Bonarcado (OR), Italy; e-mail: [email protected]
3 CNR, Istituto per lo Studio degli Ecosistemi - sede di Sassari. Traversa La Crucca, 3 - 07100, Sassari-Li Punti (SS), Italy; e-mail:
[email protected]
^Corresponding author
ABSTRACT This catalogue summarizes and critically reviews araneological knowledge about Sardinian
fauna. 140 publications from 1868 to 2012 were considered and about 4800 specimens be-
longing to 254 species were directly examined. The list report 495 species belonging to 229
genera divided into 43 families. For each species, literature, chorotype, regional distribution,
and, where possible, habitats are indicated. Among the listed species Philodromus bosmansi
Muster et Thaler, 2004 (Philodromidae) is new for Europe and the family of Prodidomidae
with the species Zimirina brevipes Perez et Blasco, 1986 is new for Italy. Also Setaphis par-
vula (Lucas, 1846) (Gnaphosidae), Centromerus succinus (Simon, 1884) and Hybocoptus
corrugis (O. P.-Cambridge, 1875) (Linyphiidae) are new records for the Italian fauna and
further 37 species are new for Sardinia. The genitalia of Phrurolithus corsicus (Simon, 1878),
Zimirina brevipes, Drassodes luteomicans (Simon, 1878) and Zelotes dentatidens Simon,
1914 are illustrated.
KEY WORDS biodiversity; distribution; endemic species.
Received 05.04.2012; accepted 30.11.2012; printed 30.03.2013
INTRODUCTION
The knowledge of biodiversity of an area means
to how much and what taxa live in it. This informa-
tion is crucial in order to realize an appropriate pro-
tection and management of the territory or also
further in-depth ecological and biological research.
Italy was the first country in Europe to organize
a census of its national fauna publishing a Checklist
between 1993 and 1995 (Minelli, Ruffo & La Posta,
1993-1995). With the aim of better quantifying the
faunistic resources of our country and to check their
distribution throughout the territory, between 2001
and 2005 following the CKmap project in which the
specialists compiled three tables for each species:
1) a species-index card including taxonomic, choro-
logical and ecological data such as habitat, food,
conservation status and indicator value; 2) a distri-
bution-table including all species records with co-
ordinates added by a simplified software method,
localities were automatically geo-referenced in the
UTM grid (10 x 10 km grid cells); 3) a reference-
table storing the list of literature sources and col-
lections examined. (Ruffo & Stoch, 2005; Letardi
& Pantaleoni, 2007).
Despite this effort, our knowledge of Italian
fauna is still far from complete, especially if we
consider invertebrates (Ruffo & Vigna Taglianti,
2002). Among these, spiders are a particularly in-
teresting group, rich in species, many of which are
endemic. Information about the ecology and distri-
bution of Araneae in Italy is still sketchy and frag-
mentary, often limited to some families, spread
across a large number of publications, few of which
4
P. Pantini, A. Sassu & G. Serra
give us a unified picture of the situation in smaller
or larger areas of our peninsula. A recent analysis
of the state of knowledge on Italian araneofauna
(Pantini, in press) demonstrated how much effort is
still needed to reach a satisfactory level. From 1995
to 2012, 238 scientific publications with data re-
garding Italian spider fauna was published. Overall
1200 species are mentioned, 229 of which were new
for Italy. This means an increase of 17,4% compared
to the Checklist (Pesarini, 1 994), bringing the num-
ber of Italian spiders above 1600. In this period of
time, 61 new species have been described from
specimens coming from Italy, among which, as far
as we know, 52 are endemic or sub-endemic. The
publications examined can be classified into 5 diffe-
rent groups: faunal (40%), taxonomic (26%), ecolo-
gical (17%), bio-speleological (10%) and various
(7%). Re- garding faunal aspects, some works
must be mentioned which analyze Italian spider
fauna, both as a whole (Trotta, 2005; Pantini & Isaia,
2008) and in some regions such as Alto Adige (No-
flatscher, 1996), Valle d’ Aosta (Isaia, 2005), Pied-
mont and Lombardy (Isaia et al., 2007) and Veneto
(Ballarin et al., 2011). However, a great part of the
southern regions of our country are still almost unex-
plored, or at least little is known about them.
With the publication of this catalogue, we
summarize and critically review the araneological
knowledge regarding Sardinia, an extremely inter-
esting Italian region from a faunal and bio-geogra-
phical point of view, grouping into one text a large
amount of data from literature and from an analysis
of a vast quantity of new material.
ARANEOLOGICAL RESEARCH IN SARDINIA
In 1868, Giovanni Canestrini and Pietro Pavesi
published “Araneidi italiani”, the first, and even
now, only catalogue of Italian spiders. The two au-
thors, who we can consider the fathers of Italian
arachnology, introduce the work with a long and le-
arned analysis of the literature and authors who,
from Pliny the Elder onwards, had anything to do
with Italian araneofauna. There then follows the ac-
tual catalogue which reports for every species ob-
served its regional distribution (based mostly on
material collected or studied by the authors) and its
bibliographical reference. The catalogue reports
only three species in Sardinia: Argiope bruennichi
(Scopoli, 1772), Latrodectus tredecimguttatus
(Rossi, 1790), and Eresus ruficapdlus C.L. Koch,
1 846. Even in the updated version in 1 870, the data
about Sardinia does not change, while on the whole,
data referring to 41 families and 327 species of spi-
der was reported. The records, as we can see from
the map in figure 1 , were concentrated mostly in the
north of Italy where the two authors lived and wor-
ked. At the time Canestrini (bom and raised in Val
di Non, Trento) was a Professor at the University
of Modena while Pavesi (bom in Pavia) was a tea-
cher at Lugano High School. Sardinia and most of
southern Italy were much less known except Cam-
pania (where Prof. Panceri worked) and Sicily.
However, the first studies on Sardinian araneo-
fauna, with the description of Zelotes sardus (sub
Prothesima sardd) a new species of Gnaphosidae,
were made by Canestrini (1873; 1876). Later Pavesi
(1876; 1878) published two papers on the collec-
tions deriving from the cmises of the “Violante”, he
listed a total of 22 species mostly from the small is-
lands surrounding Sardinia. Successively Magretti
(1878; 1880) published accounts of two zoological
excursions in Sardinia, in which he cites 1 8 species
of spiders (Table 1) while De Carlini (1885) in his “Ar-
tropodi dell’Isola di San Pietro” reports 19 species.
But the first consistent set of data is due to the na-
turalistic Sardinian explorations of Achille Costa
(1882; 1983; 1984; 1985; 1986) who reports 135
species in his “Notizie ed osservazioni sulla geo-
fauna sarda” (Table 1).
In the first years of the 20th century the most
complete contribution on Sardinian spiders was
published by Gameri (1902). In his “Contribuzione
alia fauna sarda”, the author reports a long list of
species, as many as 235, arising partly from biblio-
graphical research and partly from material from Sar-
dinia preserved in the University of Pavia. Fifty years
follow with a complete absence of publications about
Sardinian fauna, only some works by Gozo (1908)
and by Simon (1914; 1926; 1929; 1932) report sparse
data. In the second half of the 20th century there was
new interest: Roewer (1953, 1956) published on Sar-
dinian cave-dwelling arachnids and Krauss (1955)
on the spiders of Corsica, Sardinia and Elba. The lat-
ter reports 51 species, of which 16 are new to the is-
land, while Dresco (1956) described Tegenaria
henroti. The work of Paolo Marcello Brignoli de-
serves, as usual, special attention. He published as
many as 22 works in which he reports a large
Catalogue of the spiders (Arachnida Araneae) of Sardinia
5
Figure 1. Number of spider species reported in Italy by Canestrini & Pavesi (1870) divided into regions.
amount of original data about Sardinia. In particu-
lar, we remember his contributions on Onoopidae
(Brignoli, 1967a), on Leptonetidae (Brignoli,
1967b; 1969) and on cave dwellers (Brignoli,
1974), dedicated specifically to Sardinian fauna.
From the 1970s on, bio-speleological research car-
ried out on the island also led to the publication of
several works. In particular, regarding spider fauna,
we should mention the contributions of Thermes
(1972) and Puddu & Pirotta (1974) with the “Cata-
logo sistematico ragionato della fauna cavemicola
della Sardegna”. Another important contribution is
that of Giuseppe Grafitti, a tireless researcher and
great expert on the hypogean fauna of the island
(see Table 1).
Papers on Sardinian spiders over the last twenty
years are relatively scarce and is almost exclusively
the result of faunal or taxonomic contributions:
6
P. Pantini, A. Sassu & G. Serra
Citations
Species
cited
(n.)
New
species
(n.)
1
Canestrini & Pavesi, 1868
3
3
2a
Canestrini & Pavesi, 1870
3
2b
Canestrini, 1873
3
2
2c
Canestrini, 1876
5
2
3
Pavesi, 1876
16
15
4
Magretti, 1878
1
5
Pavesi, 1878
9
7
6
Magretti, 1880
17
11
7a
Costa, 1882
8
3
7b
Costa, 1883
1
1
8
Costa, 1884
56
38
9
Simon, 1884
2
2
10
Costa, 1885
73
65
11
de Carlini, 1885
18
2
12
Costa, 1886
3
3
13
Garneri, 1902
229
107
14
Gozo, 1908
4
2
15
Simon, 1914
4
2
16
Simon, 1926
1
17
Simon, 1929
2
18
Simon, 1932
5
3
19
Roewer, 1953
9
6
20
Krauss, 1955
50
16
21
Dresco, 1956
1
1
22
Roewer, 1956
5
2
23
Grasshoff, 1959
3
2
24
Lugetti & Tongiorgi, 1965
3
2
25
Alicata, 1966
2
2
26
Tongiorgi, 1966
3
2
27
Brignoli, 1967a
5
5
28
Brignoli, 1967b
2
29
Altara, 1968
1
30
Cerruti, 1968
16
31
Brignoli, 1969a
3
32
Brignoli, 1969b
1
33
Brignoli, 1969c
2
34
Dresco & Hubert, 1969
6
2
35
Helsdingen, 1969
1
1
36
Lugetti & Tongiorgi, 1969
1
37
Argiolas et al., 1970
6
1
38
Puddu, 1970
6
2
39
Brignoli, 1971a
5
1
40
Brignoli, 1971b
4
1
41
Brignoli, 1971c
11
3
42
Puddu, 1971
3
43
Bartolo et al., 1972
1
44
Casale, 1972
2
45
Sannaetal., 1972
3
46
Thermes, 1972
16
3
47
Bartolo et al., 1973
2
48
Brignoli, 1973
1
1
49
Wunderlich, 1973
1
1
50
Baum, 1974
1
51
Brignoli, 1974
6
52
Puddu & Pirodda, 1974
11
53
Tongiorgi, 1974
1
1
54
Brignoli, 1975
4
1
57
Brignoli, 1976a
2
58
Brignoli, 1976b
1
59
Brignoli, 1977
7
1
60
Brignoli & Gaddini, 1979
2
1
61
Brignoli, 1979a
1
1
62
Brignoli, 1979b
1
1
63
Brignoli, 1979c
14
64
Brignoli, 1979d
15
6
65
Grafitti, 1979
1
66
Brignoli, 1980
2
2
67
Puddu, 1980
3
68
Brignoli, 1982
1
69
Cannas, 1972 [1982]
2
70
Grasshoff, 1983
1
71
Loerbroks, 1983
1
72
Puddu, 1983
1
73
Brignoli & Murphy, 1984
1
74
Brignoli, 1984
2
1
continuec
Table 1 . List of publications where data on Sardinian ara-
neofauna is present. For each article, the number of species
mentioned and the new reports for Sardinia are indicated.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
7
Citations
Species
cited
(n.)
New
species
(n.)
75
Grafitti, 1984
1
76
Grimm, 1985
4
1
77
Grimm, 1986
2
1
78
Hansen, 1986
2
1
79
Deeleman-Reinhold &
Deeleman, 1988
1
80
Tongiorgi & Sola, 1991
1
81
Platnick & Di Franco, 1 992
1
1
82
Grafitti, 1993
1
83
Pons, 1993
12
1
84
Pesarini, 1994
225
5
85
Buchar & Thaler, 1995
1
1
86
Wunderlich, 1995a
1
1
87
Wunderlich, 1995b
13
10
88
Wunderlich, 1995c
1
89
Wunderlich, 1995d
2
1
90
Wunderlich, 1995e
1
1
91
Fontana et ah, 1996
2
1
92
Knoflach, 1996
1
93
Bosmans, 1997
4
1
94
Arno et al., 1998
32
10
95
Thaler & Knoflach, 1998
1
96
Bosmans & Van Keer, 1 999
7
4
98
Gasparo, 1999
1
99
Knoflach, 1999
1
100
Metzner, 1999
3
1
101
Knoflach & Thaler, 2000
1
1
102
Pesarini, 2000
1
103
Grafitti, 2001
1
104
Muccedda et al.,2002
2
105
Grafitti, 2003
2
106
Casale et ah, 2004
1
107
Knoflach & Pfaller, 2004
2
1
108
Knoflach, 2004
3
3
109
Logunov, 2004
1
110
Muster & Thaler, 2004
3
111
Senglet, 2004
4
2
112
Thaler & Knoflach, 2004
3
113
Thaler et al., 2004
1
114
Grill et al, 2005
21
3
115
Hansen, 2005
19
3
116
Helsdingen, 2005
24
10
117
Buchar et al.,2006
3
1
118
Burger et al., 2006
1
119
Lana et al., 2006
2
120
Logunov & Azarkina, 2006
1
121
Grafitti, 2007a
4
122
Grafitti, 2007b
2
123
Muster et al., 2007
3
124
Bolzem et al., 2008
5
1
125
Bosmans, 2008
1
1
126
Grafitti & Merella, 2008
4
127
Lorn et al., 2008
71
19
128
Amedo et al., 2009
2
2
129
Colombo & Manunza, 2009
1
1
130
Knoflach et al., 2009
4
131
Muster, 2009
2
132
Pantini & Sassu, 2009
64
8
133
Trotta, 2009
30
4
134
Marras et al., 2011
1
1
135
Tanasevitch, 20 1 1
4
1
136
Wunderlich, 20 1 1
1
137
Senglet, 20 1 1
2
1
138
Di Pompeo et al., 2011
76
7
139
Trotta, 2011
3
3
140
Kulczycki et al., 2012
1
1
Total
1417
453
Collection of Bergamo
Museum (MBG)
144
21
Collection ofCNR-lSE
Sassari (ISE)
216
21
Collection of Cagliari
University (UCA)
9
Total
369
42
Table 1 (continued). List of publications where data on Sar-
dinian araneofauna is present. For each article, the number
of species mentioned and the new reports for Sardinia are in-
dicated.
8
P. Pantini, A. Sassu & G. Serra
Tongiorgi & Sola (1991) report the presence of
Pardosa gefsana in Sardinia, Wunderlich (1995a,
1995b) describes a new species of Thomisidae and
carries out a bio-geographical analysis on Sardo-
Corsican araneofauna. Amo et al. (1998) analyze
the spiders on lime trees of a small tree-lined town
in Sassari. Grill et al. (2005) publish an ecological
work on butterflies, spiders and plants in different
environments, van Helsdingen (2005) reports data
on some collections he made on the island, Bolzem
et al. (2008) report interesting data about Tegenaria
and Malthonica, Lom et al. (2008) list the species
of spider collected in Sardinian hazelnut orchards,
Amedo et al. (2009) describe two new species of
Dysdera, Colombo & Manunza (2009) report the
first sighting of Cyrtarachne ixoides, Pantini &
Sassu (2009) and Trotta (2009) report data on the
spiders of the islands surrounding Sardinia, Di
Pompeo et al. (2011) report the presence of Argiope
trifasciata in Sardinia and Marras et al. (2011) ana-
lyze the influence of the exclusion of ants on the
quantity of four groups of generalist predators, in-
cluding spiders, in a citms orchard. Trotta (2011)
supplies some faunal data on Sardinian spiders and
Kulczycki et al. (2012) report the first sighting of
Steatoda nobilis. In figure 2 the growth in arane-
logical knowledge in Sardinia from 1868 to today
is reported.
Finally, we must point out that in the checklist
of the species of Italian fauna, each species indi-
cates whether it is present in Sardinia. Pesarini
(1994) reported 229 species on the island, some of
which were very probably based on new material
as they had not been cited previously. A final
source that reports general data on the araneofauna
of Sardinia is “Fauna Europaea” (Helsdingen,
2012) which reports 353 species for Sardinia.
Research on araneofauna in Sardinia over the
last 20 years does not stop with that listed above.
In fact, from the early 1990s a working group from
the Institute of Ecosystem Study (ISE-CNR) in
Sassari has been involved in faunal studies of vari-
ous natural and anthropized ecosystems (Fresi et
al, 2002). This activity has allowed them to collect
a considerable quantity of spiders. The collected
material, only a small part of which has been
published, is the principal source of unpublished
material presented in this catalogue.
MATERIALS AND METHODS
In order to create the catalogue which covers a
time period from 1868 to 2012, 140 publications
were examined. The starting point is in 1 868 when
Canestrini and Pavesi published “Araneidi italiani”,
the first catalogue of Italian spiders. The catalogue
was then updated in 1870 by the same authors. For
the bibliography included between 1870 and 1939
the first volume of the “Bibliographia Araneorum”
by Pierre Bonnet (1945) was consulted, while for
later publications, accurate research was carried out
into their bibliographical sources. The complete list
of publications consulted is in table 1 . The works are
listed in chronological order indicating the number
of the species and the new sightings for the region.
A fair number of species are reported in the cata-
logue exclusively thanks to sightings made over a
century ago and which therefore require further
confirmation. However, this problem is often over-
come for the most common species through a series
of successive citations.
To avoid an excessive amount of data, each
time that it was possible the citations of other cita-
tions were excluded, reporting only records based
on the direct examination of the specimens except
for the data from the checklist by Pesarini (1994)
and from Garneri’s catalogue (1902). Excluded
from the catalogue are: nomina dubia, species in-
quirendae, citations where the author expresses
doubt about the identification and the few species
whose nomenclature was not easily identifiable
under current nomenclature. When adequate con-
firmation was missing, the subspecies were
grouped with the nominal species. The taxa or the
citations excluded from the catalogue are still com-
mented on in the notes relating to their respective
families. Nomenclature follows the “The World
Spider Catalog, Version 12.5” by Norman Platnick
(2012), which was referred to also for synonymy.
An asterisk next to the name indicates that the
species was reported for the first time in Sardinia.
Our research included data from literature and re-
ports from approximately 1900 notifications regar-
ding 254 species deriving from the study of new
material kept in the collections of the ISE-CNR at
its Sassari headquarters, at the Civic Natural
Science Museum “E. Caffi” of Bergamo (MBG)
and the University of Cagliari (UCA).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
9
year
Figure 2. The growth in aranelogical knowledge in Sardinia from 1869 to today.
Most of this new material was collected over 20
years of faunal studies carried out by the ISE-CNR
in Sardinia. First of all they were concerned with the
arthropod fauna of the olive grove ecosystem in
1992-1994 and in vineyards in 1994-1996, both in
North Sardinia. Studies continued on urban tree-lined
avenues of the city of Sassari between 1993 and 1996
(Arno et al., 1998). Other collections/observations
were carried out in mixed fruit orchards (pomaceous,
drupaceous) of the Province of Sassari in 1997-1998
and in a forest of cork oak in North-East Sardinia in
1999-2000. In 2003-2004 research was carried out
on the araneofauna of the island of Asinara Pantini
& Sassu (2009) and continued in Central Sardinia on
the peaks of the Gennargentu Range (2006-2007)
and in different mountainous fruit orchard ecosys-
tems such as the hazelnut in 2004-2006 (Lorn et al.,
2008) and the cheny and walnut in 2007-2008. Fi-
nally, recently systematic sampling was carried out
in the disused mining area of Montevecchio-Ingur-
tosu in South-West Sardinia (2009). The analysis of
this material (over 7000 adult specimens) has al-
lowed us to confirm the presence of a large quantity
of species, to widen the area of their distribution and
to identify new species for Sardinia.
For each species examined, the following infor-
mation is supplied:
i) Chorotype. Referring to the works of Vigna
Taglianti et al. (1992, 1999) each species is assigned
a chorotype with the purpose of precisely defining
its distribution. For the assigning of chorological
categories, several specialist works were consulted
relating to the genera or to the single species in
question. In addition, the following websites were
used: Fauna Europaea [http://www.faunaeur.org/]
(Helsdingen, 2011), Araneae Spiders of Europe
[http://www.araneae.unibe.ch] (Nentwig et al., 2011),
Biodiversity of Russia [http://www.zin.ru/BioDiv/ara-
nei.asp]. Sometimes limited knowledge about the
distribution of some species made it difficult to at-
tribute a chorotype. In this case, the chorotype is
followed by a question mark. For subspecies, the
chorotype of the nominal species is indicated in
square brackets.
ii) References. In this field the publications in
which the species has been cited for Sardinia are
listed. A reference number has been assigned to
each work in increasing order starting from the old-
est ones (Tab. 1). Works containing citations of data
which was previously published have been ex-
cluded while specimens seen again personally by
the authors in revision works were considered. Next
to the publication, the original identification of the
species is indicated if different from the present one.
10
P. Pantini, A. Sassu & G. Serra
iii) Province. In order to have an idea of the di-
stribution of the araneological collections in Sardi-
nia, the province where each item was found is
included. In cases where the bibliography indicates
only the region, a definite province has not been at-
tributed and this data is shown by a hyphen. If the
area indicated is on the border between provinces,
these are indicated and separated by a bar. The cur-
rent eight Sardinian provinces have been conside-
red: Cagliari, Carbonia-Iglesias, Medio Campidano,
Nuoro, Ogliastra, Olbia-Tempio, Oristano and Sas-
sari (Fig. 3). The list of boroughs (APPENDIX 1)
belonging to the new provinces is available on- lin e
at the link: http://www.biodiversityjoumal.com/pdf/
4%281%29_3-104_appendix.pdf and for each of
these the original province it belonged to is mentio-
ned (Cagliari Oristano, Nuoro and Sassari).
iv) Habitat. When indicated in literature, for each
species the environment where specimens were col-
lected is reported. This information is listed in al-
phabetical order including in brackets the number
of the publication it was taken from.
v) Examined material. The following is indicated
for the new checked material: province, borough (in
underlined characters) in which the specimens were
sampled, number and sex of each specimen. Where
possible we also indicated: location, altitude (m asl),
habitat, date of sampling and the capturing technique
(pitfall traps etc.), if different from direct collection.
Figure 3. Number of species reported for
each province.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
11
LIST OF SPECIES
Family CTENIZIDAE
Cteniza brevidens (Doleschall, 1871)
Chorotype. Tyrrhenian endemic.
References. (10) Costa, 1885 (sub Aepicepha-
lus brevidens ); (13) Gameri, 1902 (sub Aepicepha-
lus brevidens)', (84) Pesarini, 1994 (sub
Aepycephalus brevidens ).
Provinces. (84); Oristano (10, 13).
Remarks. Cited only for Sicily (Ausserer, 1871)
and Sardinia. Species insufficently described, most
probably, should be named Aepicephalus sp. (fam.
Cyrtaucheniidae). Mediterranean Cytaucheniidae
are easily confused with Cteniza (all large stocky
black spiders). Aepychephalus has been incorrectly
synonymized with Cyrtauchenius by Raven 1985.
Aepicephalus is common in SW Italy (Campania,
Basilicata, Calabria) and in both Sicily and Sardi-
nia. Probably there are several different species of
Aepicephalus in Italy and the Sardinian species then
would be a new and as yet undescribed species;
hence Aepicephalus sp. (Decae A. pers. comm.).
Cteniza moggridgei O.P.-Cambridge, 1874
Chorotype. Mediterranean.
References. (139) Trotta, 2011.
Province. Carbonia-Iglesias (139).
Cteniza sauvagesi (Rossi, 1788)
Chorotype. Tyrrhenian endemic.
References. (3) Pavesi, 1876 (sub C. Sauvagii);
(6) Magretti, 1880 (sub C. sauvagei); (7a) Costa,
1882 (sub Migale fodiens); (8) Costa, 1884 (sub
My gale fodiens); (13) Gameri, 1902 (sub Nemesia
fodiens).
Province. (8); Cagliari (6, 7a); Carbonia-Igle-
sias (3, 6); Oristano/Nuoro (13).
Family NEMESIIDAE
Nemesia fertoni Simon, 1914
Chorotype. Sardo-Corsican endemic.
References. (15) Simon, 1914; (84) Pesarini,
1994; (132) Pantini & Sassu, 2009.
Provinces. (84); Sassari (15, 132).
Nemesia kahmanni Kraus, 1955
Chorotype. Sardinian endemic.
References. (20) Krauss, 1955; (84) Pesarini,
1994.
Provinces. (84); Sassari (20).
Nemesia maculatipes Ausserer, 1871
Chorotype. W-Mediterranean.
References. (13) Garneri, 1902; (15) Simon,
1914; (132) Pantini & Sassu, 2009.
Provinces. (15); Carbonia-Iglesias (13); Sassari
(132).
Remarks. This probably is a good species and
endemic to Sardinia. The idea that it is widely
spread in the western Mediterranean is incorrect
(Decae & Di Franco 2005).
Nemesia meridionalis (Costa, 1835)
Chorotype. W-Mediterranean.
References. (13) Gameri, 1902; (84) Pesarini,
1994 (sub N. badia).
Province. (84); Carbonia-Iglesias (13).
Remarks on family Nemesiidae. A revision of
the Sardinian Nemesia fauna (and also the Corsican
Nemesia fauna) is badly needed. A check of type ma-
terial, and the analysis of topotypical material is ne-
cessary. Regarding our poor state of knowledge of
the genus Nemesia in the Mediterranean area see
Decae & Di Franco (2005: 133). Nemesia africana
was cited by Gameri (1902) and Pesarini (1994). It
is very unlikely that this species really occurs in Sar-
dinia. The species itself is insufficiently described to
make a diagnosis without checking possible type ma-
terial (Decae A. pers. comm.). It is not reported in
the catalogue. The citations of N. caementaria (Ma-
gretti, 1880; Gameri, 1902 (sub N. coementaria); Pe-
sarini, 1994), N. cellicola (Pesarini, 1994) and N.
manderstjernae (Gameri, 1902; Pesarini, 1994) are
based on misidentifications (Decae A. pers. comm.)
and so they are not reported in the catalogue.
12
P. Pantini, A. Sassu & G. Serra
Family FILISTATIDAE
Filistata insidiatrix (Forskal, 1775)
Chorotype. Mediterranean.
References. (6) Magretti, 1880 (sub F. testa-
cea ); (10) Costa, 1885 (sub F. testacea ); (13) Gar-
neri, 1902 (sub F. testacea ); (42) Puddu,1971 (sub
Filistrata insidiatrix ); (45) Sanna et al., 1972; (68)
Brignoli, 1982; (83) Pons, 1993; (84) Pesarini,
1994; (94) Amo et al., 1998; (133) Trotta, 2009.
Province. (13, 84); Cagliari (42); Carbonia-
Iglesias (6, 45, 133); Nuoro (68, 83); Olbia-Tempio
(68); Sassari (10, 94, ined.).
Habitat. Avenue of lime trees (94); hypogean
habitat (42, 45, 83).
Examined material. OLBIA-TEMPIO: Olbia .
Isola Tavolara, 1 juv. 24.11.1966, 1 juv. 25.IV. 1966
leg. Gmppo Isole C.N.R. (MBG).
*Pritha nana (Simon, 1868)
Chorotype. Mediterranean.
Habitat. Garrigue (ined.); mining landfills co-
vered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining land-
fills covered by pioneer vegetation 1 male 5-
19.V.2009, 3 males 19.V-4.VI.2009, 3 males, 1
female 29.VI-14.VII.2009, 3 males 4-16.VI.2009,
2 males 16-29.VI.2009, 1 female 14-28.VII.2009
(ISE); m 200, garrigue, 3 males 19.V-4.VI.2009, 2
males 29.VI-14.VII.2009, 2 males 16-29.VI.2009,
2 males 4-16.VI.2009 (ISE), 2 males 4-16.VI.2009,
1 female 14-28.VII.2009 (MBG), 1 male 14-
28.VII.2009 (ISE) (all pitfall traps and leg. Sassu
A., Verdinelli M.). Guspini . Montevecchio, Picca-
linna, m 235, garrigue, pitfall traps, 1 male 15-
30.VI.2009 leg. Sassu A., Verdinelli M. (ISE).
Family SICARIDAE
Loxosceles rufescens (Dufour, 1820)
Chorotype. Cosmopolitan.
References. (6) Magretti, 1880 (subL. erythro-
cephala ); (10) Costa, 1885; (13) Garneri, 1902 (sub
L. erytrocephala ); (31) Brignoli, 1969a; (32) Bri-
gnoli, 1969b; (34) Dresco & Hubert, 1969; (46)
Thermes, 1972; (57) Brignoli, 1976a; (84) Pesarini,
1994; (126) Grafitti & Merella, 2008; (133) Trotta,
2009; (139) Trotta, 2011.
Province. (84); Cagliari (10, 13, 31, 32, 46, 57,
139); Carbonia-Iglesias (6, 13, 46, 126, 133, 139);
Medio Campidano (139, ined.); Nuoro (31, 34);
Olbia-Tempio (31, 32, 133); Oristano (ined.); Sas-
sari (6, 13, 57, 133, ined.).
Habitat. Hypogean habitat (31, 34, 46, 126);
orchard (ined.); garrigue (ined.); inside house
(ined.); mediterranean maquis (ined.); mining land-
fills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediter-
ranean maquis, 1 male and 1 female 19.V-
4. VI. 2009, 1 male 16-29.VI.2009, 1 female 14-
28.VII.2009 (ISE); m 170, mining landfills
covered by pioneer plants, 1 female 5-19. V.2009,
1 male 19.V-4.VI.2009, 1 male and 1 female 4-
16.VI.2009, 2 males 16-29.VI.2009, 6 males and
1 female 29.VI-14.VII.2009 (ISE), 2 males 4-
16. VI. 2009 (MBG), 1 male, 2 females and 1 juv.
14-28.VII.2009, 2 males 28.VII-10.VIII.2009, 2
males and 1 female 6-20.X.2009 (ISE); m 200,
garrigue, 2 males and 3 females 19.V-4.VI.2009
(MBG), 1 male and 1 female 19.V-4.VI.2009, 1
male 4- 16. VI. 2009, 3 males and 1 female 14-
28.VII.2009 (ISE), 1 male 28.VII-10.VIII.2009
(MBG), 1 male 28.VII-10.VIII.2009, 1 male
25.VIII-8.IX.2009, 1 male 10-25.VIII.2009 (ISE)
(all pitfall traps and leg. Sassu A., Verdinelli M.).
Guspini . Montevecchio, Piccalinna, m 225, mi-
ning landfills covered by pioneer plants, 1 female
5-18. V.2009, 1 male 30.VI-13.VII.2009, 2 males
3-15. VI. 2009 (ISE); m 235, garrigue, 1 male
18.V-3.VI.2009 (ISE), 1 female 15-30.VI.2009
(MBG), 1 male 15-30.VI.2009, 1 male 13-
27.VII.2009 (ISE), 1 female 13-27.VII.2009
(MBG), 1 male 6-20.X.2009 (ISE) (all pitfall
traps and leg. Sassu A., Verdinelli M.).
OLBIA-TEMPIO: Olbia . Isola Molara, 1 female
25.11.1966; near little church, 1 female 3. XI. 1965;
Isola Tavolara, 24.11.1966 (MBG) (all leg. Gruppo
Isole C.N.R.).
ORISTANO: Bonarcado . inside house, 1 juv
5.1.2009 leg. Sassu A. (ISE).
SASSARI: Sorso, Pianu Mannu, Nali farm, or-
chard, pitfall traps, 1 male 24-3 l.VII. 1997 leg. 1st.
Ent. SS (ISE).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
13
Family SCYTODIDAE
Scytodes thoracica (Latreille, 1802)
Chorotype. Flolarctic.
References. (13) Gameri, 1902; (31) Brignoli,
1969a; (84) Pesarini, 1994; (94) Amo et al., 1998.
Province. (84); Cagliari (ined.); Carbonia-Igle-
sias (13, 31); Olbia-Tempio (31); Oristano (ined.);
Sassari (94, ined.).
Habitat. Avenue of lime trees (94); inside house
(ined.); pinewood (ined.).
Examined material. CAGLIARI: Pula . Pixina
Manna, m 140, pinewood, emergence cages, 1 fe-
male 25.V.2009 leg. 1st. Ent. SS (ISE).
ORISTANO: Bonarcado . inside house, 1 female
5.1.2009 leg. SassuA. (ISE).
OLBIA-TEMPIO: Olbia . Isola Molara, 2 fema-
les 25.11.1966 leg. Valle A., Bianchi R. (MBG).
Scytodes velutina Heineken et Lowe, 1832
Chorotype. Mediterranean.
References. (13) Gameri, 1902 (sub S. delica-
tula ); (31) Brignoli, 1969a (sub S. delicatula ); (57)
Brignoli, 1976a; (133) Trotta, 2009.
Province. Cagliari (13); Carbonia-Iglesias (31);
Medio Campidano (ined.); Nuoro (31, 57); Olbia-
Tempio (133); Sassari (ined.).
Habitat. Garrigue (ined.); mediterranean maquis
(ined.); mining landfills covered by pioneer plants
(ined.); vineyard (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 female 28.VII-10.VIII.2009, 2 males 10-
25.VIII.2009 (MBG); m 170, mining landfills cov-
ered by pioneer plants, 1 male and 1 juv.
5- 19.V.2009, 6 males 19.V-4.VI.2009, 2 males and
1 juv. 16-29. VI. 2009, 4 males 4- 16. VI. 2009, 1 male
29. VI- 14. VII. 2009, 2 males and 3 females 14-
28. VII.2009, 2 males and 1 females 28. VII-
10.VIII.2009, 2 females 8-22.IX.2009, 2 males
6- 20.X.2009 (ISE); m 200, garrigue, 4 males 19.V-
4. VI. 2009, 1 male 5-19.V.2009, 1 male 16-
29. VI.2009, 2 males 29.VI-14.VII.2009, 1 male
14-28.VII.2009 (ISE) (all pitfall traps and leg. Sassu
A., Verdinelli M.). Guspini . Montevecchio, Picca-
linna, m 225, mining landfills covered by pioneer
plants, 2 males 15-30.VI.2009, 6 males and 1 female
3-15.VI.2009, 1 male30.VI-13.VII.2009, 1 male and
1 female 13-27. VII. 2009, 2 males and 1 female
27.VII-10.VIII.2009, 1 female 10-25.VIII.2009
(ISE); m 235, garrigue, 1 male 18.V-3.VI.2009, 1
male 3-15.VI.2009 (ISE), 1 male and 1 female
30.VI-13.VII.2009 (MBG), 1 female 15-30.VI.2009,
2 males 27.VII-10.VIII.2009 (ISE), 1 female 13-
27.VII.2009 (MBG), 1 male 10-25.VIII.2009 (ISE);
m 260, mediterranean maquis, 1 male and 1 juv. 5-
18.V.2009, 4 males, 1 female and 1 juv. 18.V-
3.VI.2009, 3 males and 1 female, 30.VI-13.VII.2009,
2 males and 1 female 15-30.VI.2009, 5 males and 1
female 3-15.VI.2009, 1 male27.VII-10.VIII.2009, 1
male, 2 females and 1 juv 13-27.VII.2009, 1 male
and 1 female 13-27.VII.2009, 1 male 25.VIII-
8.IX.2009, 2 females 10-25.VIII.2009 (ISE), 1 male
and 1 female 22.IX-6.X.2009 (MBG), 1 male and 1
female 22.IX-6.X.2009 (ISE) (all pitfall traps and
leg. SassuA., Verdinelli M.).
SASSARI: Torralba . vineyard. 1 male l.VII. 1995,
leg. 1st. Ent. SS (ISE).
Family LEPTONETIDAE
Leptoneta insularis Roewer, 1953
Chorotype. Sard ini an endemic.
References. (19) Roewer, 1953; (28) Brignoli,
1967b; (30) Cerruti, 1968; (84) Pesarini, 1994.
Province. (84); Sassari (19, 28, 30).
Habitat. Hypogean habitat (19, 28, 30).
Leptoneta patrizii Roewer, 1953
Chorotype. Sardinian endemic.
References. (19) Roewer, 1953; (30) Cerruti,
1968; (41) Brignoli, 1971c; (51) Brignoli, 1974;
(84) Pesarini, 1994.
Province. (84); Carbonia-Iglesias (19, 30, 41, 51).
Habitat. Hypogean habitat (19, 30, 41, 51).
Leptoneta serbariuana Roewer, 1953
Chorotype. Sardinian endemic.
References. (19) Roewer, 1953; (29) Altara,
1968; (30) Cerruti, 1968; (33) Brignoli, 1969c; (38)
Puddu, 1970; (52) Puddu & Pirodda, 1974; (84)
Pesarini, 1994.
14
P. Pantini, A. Sassu & G. Serra
Province. (84); Carbonia-Iglesias (19, 30);
Ogliastra (29, 33, 38, 52).
Habitat. Hypogean habitat (19, 29, 30, 33,
38, 52).
Leptoneta taramellii Roewer, 1956
Chorotype. Sardinian endemic.
References. (22) Roewer, 1956; (84) Pesarini,
1994.
Province. (84); Nuoro (22).
Habitat. Hypogean habitat (22).
Paraleptoneta spinimana (Simon, 1884)
Chorotype. W-Mediterranean.
References. (19) Roewer, 1953 (sub P. fagei );
(28) Brignoli, 1967b (sub P. pasquinii ); (30) Cer-
ruti, 1968 (sub P. fagei); (33) Brignoli, 1969c (sub
P fagei); (41) Brignoli, 1971c (sub P. spinimana
fagei); (52) Puddu & Pirodda, 1974 (sub Segrea
sardiniensis); (64) Brignoli, 1979d; (67)
Puddu, 1980; (84) Pesarini, 1994; (121) Grafitti,
2007a (sub Segrea sardiniensis).
Province. (84); Cagliari (33, 41); Cagliari/Nuoro
(67); Carbonia-Iglesias (28, 33, 41, 52, 64); Oglia-
stra (64); Sassari (19, 30, 121).
Habitat. Hypogean habitat (19, 28, 30, 33, 41,
52, 64, 67, 121).
Family PHOLCIDAE
Holocnemus pluchei (Scopoli, 1763)
Chorotype. Mediterranean.
References. (3) Pavesi, 1876 (sub Pholcus ri-
vulatus); (13) Gameri, 1902 (sub H. rivulatus); (20)
Krauss, 1955 (sub H. pulchii); (40) Brignoli, 1971b;
(54) Brignoli, 1975; (84) Pesarini, 1994.
Province. (20, 84); Cagliari (13, 54); Carbonia-
Iglesias (3, 13, 40, 54); Nuoro (40); Olbia-Tempio
(54); Sassari (40, 54).
Pholcus opilionoides (Schrank, 1781)
Chorotype. Holarctic.
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (84); Cagliari (13).
Pholcus phalangioides (Fuesslin, 1775)
Chorotype. Cosmopolitan.
References. (5) Pavesi, 1878; (6) Magretti,
1880; (10) Costa, 1885; (13) Gameri, 1902; (14)
Gozo, 1908; (19) Roewer, 1953; (22) Roewer,
1956; (30) Cerruti, 1968; (34) Dresco & Hubert,
1969; (37) Argiolas et al., 1970; (38) Puddu, 1970;
(40) Brignoli, 1971b; (41) Brignoli, 1971c; (44) Ca-
sale, 1972; (46) Thermes, 1972; (47) Bartolo et al.,
1973; (51) Brignoli, 1974; (64) Brignoli, 1979d;
(83) Pons, 1993; (84) Pesarini, 1994; (105) Grafitti,
2003; (121) Grafitti, 2007a; (122) Grafitti, 2007b;
(126) Grafitti & Merella, 2008.
Province. (84); Cagliari (6, 10, 13, 14, 37, 40,
46, 64); Carbonia-Iglesias (14, 19, 30, 40, 41, 46,
47, 64, 83, 105, 126); Nuoro (22, 34, 41, 44, 51, 83);
Ogliastra (38, 64); Olbia-Tempio (5, 13, 40, ined.);
Oristano (64, 122); Sassari (51, 64, 83, 121, ined.).
Habitat. Hypogean habitat (14, 19, 22, 30, 34,
37, 38, 40, 41, 44, 46, 47, 51, 64, 83, 105, 121, 126,
ined.); inside house (ined.).
Examined material. OLBIA-TEMPIO: Olbia .
Isola Molara, 3 females 25.11.1966 leg. Valle A.
(MBG); Isola Tavolara, Grotta del Papa, 1 female
26.11.1966 leg. Gmppo Isole C.N.R. (MBG).
SASSARI: Sassari . inside house, 1 female
2.X.2007 leg. Sassu A. (ISE).
Psilochorus simoni (Berland, 1911)
Chorotype. European.
References. (64) Brignoli, 1979d.
Province. Cagliari (64).
Habitat. Hypogean habitat (64).
Spermophora senoculata (Duges, 1836)
Chorotype. Holarctic.
References. (34) Dresco & Hubert, 1969; (37)
Argiolas et al., 1970; (40) Brignoli, 1971b; (45) Sanna
et al., 1972; (64) Brignoli, 1979d; (84) Pesarini, 1994.
Province. (84); Cagliari (37); Carbonia-Iglesias
(45, 64); Nuoro (34, 40).
Habitat. Hypogean habitat (34, 37, 45, 64).
Spermophorides baunei Wunderlich, 1995
Chorotype. Sardinian endemic.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
15
References. (87) Wunderlich, 1995b.
Province. Nuoro/Ogliastra (87); Ogliastra (87).
Habitat. Under stones (87).
Spermophorides elevata (Simon, 1873)
Chorotype. Tyrrhenian endemic.
References. (40) Brignoli, 1971b (sub Spermo-
phora elevata).
Province. Cagliari (40); Carbonia-Iglesias (40);
Medio Campidano (40); Nuoro (40); Olbia-Tempio
(40, ined.); Sassari (40).
Examined material. OLBIA-TEMPIO: Olbia .
Isola Molarotto, 1 juv. 25.11.1966 (MBG); Isola Ta-
volara, 1 male 5.XI.1965 (MBG) (all leg. Gruppo
Isole C.N.R.).
Family SEGESTRIDAE
Ariadna brignolii Wunderlich, 2011
Chorotype. Tyrrhenian endemic.
References. (136) Wunderlich, 2011.
Province. Medio-Campidano (136).
Remarks. The citation is based only on female
specimens and requires further confirmation.
Segestria bavarica C.L. Koch, 1843
Chorotype. Palearctic.
References. (127) Lorn et al., 2008.
Province. (127); Nuoro (ined.).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Tiana . m 522,
hazelnut-orchard, bark traps, 1 juv 19-27.' VII. 2005
(ISE), 1 juv 31.VIII-7.IX.2005 (MBG) (all leg.
I.S.E.).
Segestria florentina (Rossi, 1790)
Chorotype. European.
References. (8) Costa, 1884; (13) Garneri,
1902; (58) Brignoli, 1976b; (84) Pesarini, 1994;
(94) Arno et al., 1998; (132) Pantini & Sassu, 2009.
Province. (84); Cagliari (58); Carbonia-Iglesias
(58); Nuoro (8, 13); Olbia-Tempio (8, 13); Sassari
(8, 94, 132, ined.).
Habitat. Avenue of lime trees (94).
Examined material. SASSARI: Sassari .
Giordano, m 40, 1 female 6. III. 2009, leg. Molinu
A. (ISE).
Segestria senoculata (Linnaeus, 1758)
Chorotype. Palearctic.
References. (13) Garneri, 1902; (94) Arno et
al., 1998; (127) Lorn et al., 2008.
Province. (127); Cagliari (13); Nuoro (ined.);
Sassari (94).
Habitat. Avenue of lime trees (94); hazelnut-
orchard (127, ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, bark traps, 1 juv. 1-
8. VI. 2005 (ISE), 1 juv. 1-8.VI.2005 (MBG), 1 juv.
14-19.VII.2005 (MBG), 1 juv. 19-27.VII.2005
(MBG), 1 juv. 10-17.VIII.2005 (MBG), 1 juv. 10-
17.VIII.2005 (ISE), 1 male 13-20.X.2004 (MBG)
(all leg. I.S.E.).
Remarks on family Segestridae. Wunderlich
(2011) illustrates the complex nomenclature and taxo-
nomic issues to do with the genus Ariadna Audouin,
1 826 in the Mediterranean. He claims that A. insi-
diatrix is a species limitated to North Africa, ther-
fore the citation of this species in Sardinia by Trotta
(2009) refers very probably to another taxon,
maybe A. brignolii. While awaiting further data
about the distribution of this genus, it was thought
better not to include A. insidiatrix in the catalogue.
Family DYSDERIDAE
Dysdera ancora Grasshoff, 1959
Chorotype. Tyrrhenian endemic.
References. (23) Grasshoff, 1959; (84) Pesa-
rini, 1994.
Province. (84); Cagliari (23); Medio Campi-
dano (23); Oristano (23).
Remarks. It would be necessary to re-examine
Grasshoff’s material in order to define the real iden-
tity of the species. (Gasparo F. pers. comm.).
16
P. Pantini, A. Sassu & G. Serra
Dysdera crocata C.L. Koch, 1838
Chorotype. Cosmopolitan.
References. (3) Pavesi, 1876 (sub D. crocota );
(4) Magretti, 1878 (sub D. crocota ); (6) Magretti,
1880 (sub D. crocota ); (10) Costa, 1885; (13) Gar-
neri, 1902 (sub D. crocota ); (20) Krauss, 1955; (23)
Grasshoff, 1959; (79) Deeleman-Reinhold & Dee-
leman, 1988; (84) Pesarini, 1994.
Province. (13, 20, 23, 84); Cagliari (6, 13, 23,
79); Carbonia-Iglesias (3, 6, 13, 23); Medio-Cam-
pidano (ined.); Nuoro (ined.); Oristano (4, 6, 13,
23); Sassari (6, 10, 13, ined.).
Habitat. Cherry-orchard (ined.); orchard
(ined.); river (23); mediterranean maquis (ined.);
hazelnut-orchard (ined.); near a cave (23); under Ju-
mp erus sp. (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, pitfall traps, 1 female 29.VI-14.VII.2009
leg. Sassu A., Verdinelli M. (ISE). Guspini . Mon-
tevecchio, Piccalinna, m 260, mediterranean ma-
quis, pitfall traps, 1 female 30.VI-13.VII.2009 leg.
Sassu A., Verdinelli M. (ISE).
NUORO: Belvi, Antonitzo, m 683, cherry-
orchard, 2 males 11-18.IV.2007, 2 males 18-
26.IV.2007, 4 males 16-23.V.2007, 3 males and 3
females 2 1-28. VI. 2007, 1 male and 1 female 17-
24.VII.2007, 1 female 24-30.VIII.2007 (ISE); Su
Enazzu, m 550, hazelnut-orchard, 4 males and 2 fe-
males 27. VII-8. VIII. 2006, 1 male and 1 female 13-
27.VII.2006 (MBG), 3 males 13-27.VII.2006 (ISE),
1 male 8-24. VIII. 2006, 1 male and 2 females 21. IX-
5.X. 2006, 1 female 31.X-21.XI.2006, 1 male 5-
16.X.2006, 1 female 21.XI.2006-8.I.2007, 1 male
21.II-19.III.2007 (MBG), 4 males 19.III-26.IV.2007
(MBG), 1 female 26.IV-30.V.2007 (ISE), 1 male
and 1 juv. 30.V-4.VII.2007 (MBG) (all pitfall traps
and leg. I.S.E.).
SASSARI: Sorso, Pianu Mannu, Nali farm, or-
chard, pitfall traps, 1 male and 1 female 24-
3 l.VII. 1997 leg. 1st. Ent. SS (ISE).
Dysdera jana Gasparo et Arnedo, 2009
Chorotype. Sardinian endemic.
References. (128) Arnedo et al., 2009.
Province. Nuoro (128).
Habitat. Under Pinus (128); under Quercus
ilex (128).
Dysdera shardana Opatova et Arnedo, 2009
Chorotype. Sardinian endemic.
References. (23) Grasshoff, 1959 (sub Dysdera
kollari misidentification) (128) Arnedo et al., 2009.
Province. Cagliari (128); Nuoro (128, ined.);
Oristano (23, 128); Sassari (23).
Habitat. Castaneus and Quercus suber forest
(127); dry, open Quercus forest (127); mixed Pinus
and Quercus forest (127); old crops and open forest
Quercus and Rubus (127); open Quercus forest
w/mosses (127); Quercus pubescens forest (127);
under Quercus ilex (127); walnut- orchard (ined.).
Examined material. NUORO: Tonara. Su Az-
zime, m 682, walnut-orchard, pitfall traps, 1 male
11-18.IV.2007, 1 male 16-23.V.2007 (MBG) (all
leg. I.S.E.).
Dysdera ventricosa Grasshoff, 1959
Chorotype. Tyrrhenian endemic.
References. (23) Grasshoff, 1959; (84) Pesa-
rini, 1994.
Province. (84); Cagliari (23).
Remarks. A species to re-examine. From Gra-
sshoff’s drawing it is unclear how the “bulb” is
formed, which seems to lack all the apical structures
typical of the genus Dysdera. The holotype could
be a defective specimen (Gasparo F. pers. comm.).
Harpactea alicatai Brignoli, 1979
Chorotype. Sardinian endemic.
References. (62) Brignoli, 1979b; (84) Pesa-
rini, 1994.
Province. (84); Sassari (62).
Harpactea gennargentu Wunderlich, 1995
Chorotype. Sardinian endemic.
References. (87) Wunderlich, 1995b.
Province. Nuoro (ined.); Nuoro/Ogliastra (87).
Habitat. Hazelnut-orchard (ined.); alder grove
(ined.); under Juniperus sp. (ined.); under stones in
a forest (87).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
17
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1
male 30.V-4.VII.2007 (ISE), 6 males 30.V-
4. VII. 2007 (MBG) (all leg. I.S.E.). Desulo . Gen-
nargentu, mountain refuge, m 1500, under
Juniperus sp., 1 female 11 -25. VII. 2006 (ISE),
alder-grove, 1 female 23.VIII-5.IX.2006, 1 female
19.IX-3.X.2006, 3 males and 1 female 10-
24.V.2007 (ISE) (all pitfall traps and leg. Fiori F.).
Fonni, Gennargentu, mountain refuge, m 1550,
under Juniperus sp., pitfall traps, 1 male 5-
19.VI.2007 leg. Fiori F. (ISE).
Harpactea nuragica Alicata, 1966
Chorotype. Sardinian endemic.
References. (25) Alicata, 1966; (84) Pesarini,
1994.
Province. (84); Medio-Campidano (ined.);
Nuoro (25).
Habitat. Quercus ilex forest, under stones (25);
mediterranean maquis (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, pitfall traps, 2 males 7-21.IV.2009, 2 males
19.V-4.VI.2009, 1 male 5-19.V.2009 leg. Sassu A.,
Verdinelli M. (ISE). Guspini . Montevecchio, Pic-
calinna, m 260, mediterranean maquis, pitfall traps,
2 males 21.IV-5.V.2009, 2 males 7-21.IV.2009 leg.
Sassu A., Verdinelli M. (ISE).
Harpactea sardoa Alicata, 1966
Chorotype. Tyrrhenian endemic.
References. (25) Alicata, 1966; (84) Pesarini,
1994.
Province. (84); Nuoro (25, ined.).
Habitat. Cherry-orchard (ined.); Quercus ilex
forest (25); walnut-orchard (ined.).
Examined material. NUORO: Belvi . Anto-
nitzo, m 683, cherry-orchard, 1 male 18-26.IV.2007
(ISE); Canale e' Figu, m 576, walnut-orchard, 1
male 16-23.V.2007 (ISE); Mannaritzo, m 706,
cherry-orchard, 1 male 11-18.IV.2007, 3 males 18-
26.IV.2007 (ISE) (all pitfall traps and leg. I.S.E.).
Tonara, Su Azzime, m 682, walnut-orchard, pitfall
traps, 1 male 18-26.IV.2007, 1 male 16-23.V.2007
leg. I.S.E. (ISE).
Parachtes inaequipes (Simon, 1882)
Chorotype. Sardo-Corsican endemic.
References. (54) Brignoli, 1975; (84) Pesarini,
1994.
Provinces. (84); Olbia-Tempio (54); Sassari
(54).
Parachtes limbarae (Kraus, 1955)
Chorotype. Sardinian endemic.
References. (20) Krauss, 1955 (sub Harpacto-
crates limbarae ); (84) Pesarini, 1994.
Province. (84); Medio Campidano (ined.);
Nuoro (ined.); Sassari (20).
Habitat. Cherry-orchard (ined.); mediterranean
maquis (ined.); hazelnut-orchard (ined.); alder-
grove (ined.).
Examined material. MEDIO CAMPIDANO:
Guspini . Montevecchio, Piccalinna, m 260, medi-
terranean maquis, pitfall traps, 1 male 5-18.V.2009
(MBG), 2 males 5-18.V.2009, 1 male 13-
27.VII.2009 (ISE) (all leg. Sassu A., Verdinelli M.).
NUORO: Belvi . Antonitzo, m 683, cherry-or-
chard, 1 male 11-18.1.2008 (ISE); Su Enazzu, m
550, hazelnut-orchard, 1 male 21. II- 19. III. 2007
(ISE) (all pitfall traps and leg. I.S.E.). Desulo . Gen-
nargentu, mountain refuge, m 1500, alder-grove,
pitfall traps, 1 female and 3 males 10-24.V.2007 leg.
Fiori F. (ISE). Fonni . Gennargentu, mountain re-
fuge, m 1550, alder-grove, pitfall traps, 2 males 5-
19.VI.2007 leg. Fiori F. (ISE).
Sardostalita patrizii (Roewer, 1956)
Chorotype. Sardinian endemic.
References. (22) Roewer, 1956 (sub Stalita pa-
trizii); (30) Cerruti, 1968 (sub Stalita patrizii ); (84)
Pesarini, 1994; (98) Gasparo, 1999; (103) Grafitti,
2001; (106) Casale et al., 2004.
Province. (84); Nuoro (22, 30, 98); Ogliastra
(98, 103, 106).
Habitat. Hypogean habitat (22, 30, 98, 103, 106).
Remarks on family Dysderidae. Citations of
Dysdera erythrina (Costa, 1885; Gameri, 1902) and
D. nicaeensis (Roewer, 1953; Cerruti, 1968) are
18
P. Pantini, A. Sassu & G. Serra
considered unreliable (Gasparo F. pers. comm.) and
therefore excluded from the catalogue.
Family OONOPIDAE
Oonops placidus corsicus Dalmas, 1916
Chorotype. W-Mediterranean (?).
References. (27) Brignoli, 1967a; (54) Bri-
gnoli, 1975; (84) Pesarini, 1994 (sub O. placidus).
Provinces. (84); Nuoro (27); Oristano (27, 54);
Sassari (27).
Remarks. Pesarini (1994) cites only O. placidus
in the checklist without indicating the subspecies.
In Sardinia only the subspecies corsicus is cited.
Orchestina pavesii (Simon, 1873)
Chorotype. Mediterranean.
References. (27) Brignoli, 1967a; (54) Bri-
gnoli, 1975; (84) Pesarini, 1994.
Province. (84); Sassari (27, 54, ined.).
Habitat. Olive-grove (ined.).
Examined material. SASSARI: Sassari . Lu
Buttangaru, olive-grove, chemical knockdown, 1
male 20.X.2008 leg. 1st. Ent. SS (MBG).
Orchestina setosa Dalmas, 1916
Chorotype. W-Mediterranean (?).
References. (27) Brignoli, 1967a.
Province. Sassari (27).
Orchestina simoni Dalmas, 1916
Chorotype. S-European.
References. (27) Brignoli, 1967a.
Province. Sassari (27).
Silhouettella loricatula (Roewer, 1942)
Chorotype. Turano-Europeo-Mediterranean.
References. (27) Brignoli, 1967a (sub Dysde-
rina loricatula ); (84) Pesarini, 1994 (sub Dysde-
rina loricata); (118) Burger et al., 2006; (133)
Trotta, 2009.
PROVINCE: (84); Cagliari (133); Carbonia-
Iglesias (133); Medio Campidano (27, ined.);
Nuoro (27, 118); Olbia-Tempio (133); Sassari (27,
ined.).
Habitat. Garrigue (ined.); mediterranean maquis
(ined.); mining landfills covered by pioneer plants
(ined.); vineyard (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 female 16-29.VI.2009, 3 females 14-
28.VII.2009, 1 female 8-22.IX.2009 (ISE); m 170,
mining landfills covered by pioneer plants, 1 female
5-19.V.2009 (ISE) (all pitfall traps and leg. Sassu A.,
Verdinelli M.). Guspini . Montevecchio, Piccalinna,
m 235, garrigue, 1 female 13-27.VII.2009 (ISE); m
260, mediterranean maquis, 1 female 13-27.VII.2009
(MBG), 1 female 22.IX-6.X.2009 (ISE) (all pitfall
traps and leg. Sassu A., Verdinelli M.).
SASSARI: Torralba . vineyard, 1 female
29.IV. 1995 leg. 1st. Ent. SS (ISE).
Family PALPIMANIDAE
Palpimanus gibbulus Dufour, 1820
Chorotype. Mediterranean.
References. (8) Costa, 1884; (13) Gameri,
1902; (20) Krauss, 1955; (84) Pesarini, 1994; (133)
Trotta, 2009; (139) Trotta, 2011.
Province. (84); Cagliari (8, 13, ined.); Carbo-
nia-Iglesias (13, 133); Medio Campidano (139,
ined.); Sassari (20).
Habitat. Garrigue (ined.); pinewood (ined.);
mining landfills covered by pioneer plants (ined.).
Examined material. CAGLIARI: Pula . Pixina
Manna, m 140, pinewood, emergence cages, 1 fe-
male 29.IV.2009, 1 male, 2 females, 1 juv
25.V.2009 leg. 1st. Ent. SS (ISE).
MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-
cauli, m 170, mining landfills covered by pioneer
plants, 1 male 21.IV-5.V.2009, 1 male4-16.VI.2009
(ISE); m 200, garrigue, 1 male 19.V-4.VI.2009
(MBG), 1 female 25.VIII-8.IX.2009 (ISE) (all pit-
fall traps and leg. Sassu A., Verdinelli M.). Guspini .
Montevecchio, Piccalinna, m 235, garni gue, pitfall
traps, 1 female 18.V-3.VI.2009 (MBG), 1 male
18.V-3.VI.2009, 1 male 3-15.VI.2009 (ISE) (all leg.
Sassu A., Verdinelli M.).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
19
Family MIMETIDAE
Ero aphana (Walckenaer, 1802)
Chorotype. European.
References. (13) Gameri, 1902; (112) Thaler
& Knoflach, 2004; (113) Thaler et al., 2004.
Province. Cagliari (13); Ogliastra (112, 113);
Oristano (ined.); Sassari (ined.).
Habitat. Orchard (ined.); olive-grove (ined.);
vineyard (ined.).
Examined material. ORISTANO: Cabras .
Sinis, at sea level, 1 male 20.IV.2003 leg. Pantini
R, Magnati F. (MBG).
SASSARI: Sorso, Pianu Mannu, Nali farm,
olive-grove, 1 female 25.VI.1993 (ISE); orchard, 1
female 26. VI. 1997 (ISE) (all beating tray and leg. 1st.
Ent. SS). Torralba . vineyard, 1 female 17.VI.1995
leg. 1st. Ent. SS (ISE).
Ero tuberculata (De Geer, 1778)
Chorotype. Palearctic.
References. (12) Costa, 1886; (13) Garneri,
1902; (127) Lorn et al., 2008.
Province. (13, 127); Cagliari (ined.); Medio
Campidano (12); Nuoro (ined.); Sassari (ined.).
Habitat. Citrus-grove (ined.); marshland (12);
hazelnut-orchard (127, ined.); vineyard (ined.).
Examined material. CAGLIARI: Uta, S'Appas-
siu, Agris farm, citrus-grove, beating tray, 1 female
23.X. 2000 leg. CRAS (ISE).
NUORO: Belyi, Su Ajone, m 585, hazelnut-
orchard, bark traps, 1 female 21-29.IX.2005 leg.
I.S.E. (ISE). Tiana, m 522, hazelnut-orchard, beat-
ing tray, 1 female 21.IX.2005 leg. I.S.E. (ISE).
SASSARI: Torralba . vineyard, 1 female
15.X. 1994 leg. 1st. Ent. SS (ISE).
Mimetus laevigatus (Keyserling, 1863)
Chorotype. Centralasiatic-Mediterranean.
References. (13) Garneri, 1902 (sub M. inter-
fector Simon, 1881 misidentification).
Province. Cagliari (13).
Family ERESIDAE
Eresus kollari Rossi, 1 846
Chorotype. Sibero-European.
References. (7a) Costa, 1882 (sub E. quatuor-
guttatus ); (8) Costa, 1884 (sub E. quatuorguttatus );
(13) Gameri, 1902 (sub Eresus cinnaberinus ) (Ere-
sus cinnaberinus).
Province. Nuoro/Ogliastra (7a, 8, 13); Ogliastra
(ined.).
Examined material. OGLIASTRA: Arzana .
near Punta La Marmora, 1 male 1 .X.2007 leg. Mar-
rosu M. (ISE).
Eresus ruficapillus C.L. Koch, 1846
Chorotype. S-European.
References. (1) Canestrini & Pavesi, 1868; (2a)
Canestrini & Pavesi, 1870; (8) Costa, 1884; (13)
Gameri, 1902.
Provinces. (1, 2a); Nuoro/Ogliastra (8); Oglia-
stra (13).
Habitat. Under stones (8).
Family OECOBIIDAE
Oecobius maculatus Simon, 1870
Chorotype. Turano-Mediterranean.
References. (90) Wunderlich, 1995e; (116)
Helsdingen, 2005.
Province. Medio Campidano (ined.); Nuoro
(90, 116); Ogliastra (116); Sassari (90).
Habitat. Garrigue (ined.); inside house (116);
under stones (90); mining landfills covered by pio-
neer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining land-
fills covered by pioneer plants, 4 males and 1 fe-
male 19.V-4.VI.2009, 4 males 4-16.VI.2009, 1
female 16-29.VI.2009, 3 males and 1 female
28.VII-10.VIII.2009, 4 males and 1 female 10-
25.VIII.2009 (ISE), 1 female 25.VIII-8.IX.2009
(MBG); m 200, garrigue, 1 female 4-16.VI.2009, 1
male 28.VII-10.VIII.2009 (ISE) (all pitfall traps and
leg. Sassu A., Verdinelli M.). Guspini . Montevec-
chio, Piccalinna, m 225, mining landfills covered
by pioneer plants, pitfall traps, 3 males 5-
18.V.2009, 12 males and 1 female 18.V-3.VI.2009,
3 males and 2 females 15-30. VI. 2009 (ISE), 6
males 3- 15. VI. 2009 (MBG), 1 male and 1 female
30.VI-13.VII.2009, 10 males, 2 females and 1 juv.
3-15.VI.2009, 6 males, 2 females and 3 juv. 13-
27.VII.2009, 14 males and 5 females 27.VII-
20
P. Pantini, A. Sassu & G. Serra
10.VIII.2009, 2 males and 1 female 10-
25.VIII.2009, 2 females 25.VIII-8.IX.2009 (ISE),
1 male and 4 females 10-25.VIII.2009 (MBG) (all
leg. Sassu A., Verdinelli M.).
Oecobius navus Blackwall, 1859
Chorotype. Cosmopolitan.
References. (37) Argiolas et al., 1970 (sub O. an-
nulipes ); (46) Thermes, 1972 (sub O. annulipes ); (50)
Baum, 1974 (sub O. annulipes ); (52) Puddu & Pi-
rodda, 1974 (sub O. annulipes ); (94) Arno et al., 1998
(sub O. annulipes ); (132) Pantini & Sassu, 2009.
Provinces. Cagliari (37, 46, 52); Medio Cam-
pidano (ined.); Nuoro (50); Sassari (94, 132).
Habitat. Avenue of lime trees (94); hypogean
habitat (37, 46, 52); garrigue (ined.); mediterra-
nean maquis (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediter-
ranean maquis, pitfall traps, 1 male 19.V-
4. VI. 2009 (ISE), 1 male and 1 female, 16-
29.VI.2009 (MBG), 4 males 29.VI-14.VII.2009,
6 males 4-16.VI.2009, 2 males 16-29.VI.2009
(ISE), 1 male 14-28.VII.2009 (MBG), 1 female
14-28.VII.2009 (ISE) (all leg. Sassu A., Verdinelli
M.). Guspini . Montevecchio, Piccalinna, m 235,
garrigue, pitfall traps, 1 male 18.V-3.VI.2009 leg.
Sassu A., Verdinelli M. (ISE).
Uroctea durandi (Latreille, 1809)
Chorotype. Mediterranean.
References. (13) Gameri, 1902.
Province. Nuoro/Ogliastra (13).
Family ULOBORIDAE
Hyptiotes paradoxus (C.L. Koch, 1834)
Chorotype. Palearctic.
References. (127) Lom et al., 2008.
Province. (127); Nuoro (ined.); Sassari (ined.).
Habitat. Hazelnut-orchard (127, ined.); olive-
grove (ined.); vineyard (ined.).
Examined material. NUORO: Tiana . m 522,
hazelnut-orchard, beating tray, 1 male 7.IX.2005
leg. I.S.E. (ISE).
SASSARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 1 male 13.X.2009, 1 female
20.X.2009 leg. 1st. Ent. SS (ISE). Torralba . vine-
yard, beating tray, 1 female 30.IX.1995 leg. 1st.
Ent. SS (ISE).
Polenecia producta (Simon, 1873)
Chorotype. Mediterranean.
References. (61) Brignoli, 1979a.
Provinces. Olbia-Tempio (61).
Uloborus plumipes Lucas, 1 846
Chorotype. Mediterranean.
References. (46) Thermes, 1972; (52) Puddu
& Pirodda, 1974; (83) Pons, 1993.
Province. Cagliari (46, 52, ined.); Nuoro (83);
Sassari (83, ined.).
Habitat. Hypogean habitat (46, 52, 83).
Examined material. CAGLIARI: Domus de
Maria . Punta su Pisu, m 14, 2 males, 2 females,
XII. 2006 leg. Ruzzante (MBG).
SASSARI: Sorso, Platamona, at sea level, 1 fe-
male 4.VIII.1994 leg. 1st. Ent. SS (ISE).
Uloborus walckenaerius Latreille, 1806
Chorotype. Palearctic.
References. (8) Costa, 1884; (13) Gameri,
1902; (127) Lom et al., 2008.
Province. (127); Nuoro (ined.); Olbia-Tempio
(8, 13); Sassari (ined.).
Habitat. Hazelnut-orchard (127, ined.); vine-
yard (ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, beating tray, 1 female
10.VIII.2005 leg. I.S.E. (ISE).
SASSARI: Sassari . Platamona, at sea level, 1
male, 22.V.2008 leg. Sassu A. (ISE). Torralba . vine-
yard, beating tray, 1 female 6.VIII.1994 leg. 1st.
Ent. SS (ISE).
Family NESTICIDAE
Nesticus eremita Simon, 1879
Chorotype. S-European.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
21
References. (38) Puddu, 1970; (64) Brignoli,
1979d; (83) Pons, 1993; (104) Muccedda et al.,
2002; (139) Trotta, 2011.
Province. Cagliari (64); Ogliastra (38); Sassari
(83, 104, 139, ined.).
Habitat. Hypogean habitat (38, 64, 83, 104,
ined.).
Examined material. SASSARI: Cossoine . cave
Sa Ucca e Mammuscone, 1 female 22.VII.1993 leg.
Giachino P.M. (MBG).
Family THERIDIIDAE
Anelosimus pulchellus (Walckenaer, 1802)
Chorotype. European.
References. (10) Costa, 1885 (sub Theridion
pulchellum).
Province. Cagliari (10); Sassari (ined.).
Examined material. SASSARI: Sassari . Plata-
mona, at sea level, 1 male and 1 female 22.V.2008
leg. Sassu A. (ISE).
Anelosimus vittatus (C.L. Koch, 1836)
Chorotype. European.
References. (10) Costa, 1885 (sub Theridion
vittatum ); (67) Puddu, 1980; (116) Helsdingen,
2005; (127) Lorn et al., 2008.
Province. (127); Cagliari/Nuoro (67); Nuoro
(116, ined.); Olbia-Tempio (ined.); Oristano (10);
Sassari (ined.).
Habitat. Hypogean habitat (67); orchard (ined.);
hazelnut-orchard (127, ined.); olive-grove (ined.);
grassland (ined.); forest of Quercus suber (ined.).
Examined material. NUORO: Belyi, Su Ajone,
m 585, hazelnut-orchard, beating tray, 1 male
1. VI. 2005 leg. I.S.E. (ISE). Bolotana . Badde e'Sa-
lighes, m 850, grassland, 2 males 27.V.2006 leg.
Sassu A. (ISE). Tiana . m 522, hazelnut-orchard,
beating tray, 1 female 19.V.2005 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Budduso . near Nuraghe Lo-
elle, forest of Quercus suber, beating tray, 1 male
and 1 female 24.V.1999 leg. 1st. Ent. SS (ISE).
SASSARI: Sorso, Pianu Mannu, Nali farm,
olive-grove, 1 male and 1 female 21.V.1993 (ISE);
olive-grove, beating tray, 1 female 9.VI.1993, 1 fe-
male 18.VI.1993 (ISE); orchard, beating tray, 1
male 27.V.1998 (ISE) (all leg. 1st. Ent. SS).
Argyrodes argyrodes (Walckenaer, 1 842)
Chorotype. Mediterranean.
References. (3) Pavesi, 1876 (sub A. gibbosa );
(11) de Carlini, 1885 (sub A. gibbosus ); (13) Gar-
neri, 1902; (84) Pesarini, 1994.
Province. (84); Cagliari (3, 13); Carbonia-Igle-
sias (3, 11, 13); Sassari (ined.).
Habitat. Olive-grove (ined.).
Examined material. SASSARI: Alghero . Ma-
muntanas, olive-grove, chemical knockdown, 1
male 7.IX.2009 leg. 1st. Ent. SS (ISE).
Asagena phalerata (Panzer, 1801)
Chorotype. Palearctic.
References. (13) Gameri, 1902; (92) Knoflach,
1996 (sub Steatoda phalerata).
Province. (13); Nuoro/Ogliastra (13); Ogliastra
(92).
Crustulina scabripes Simon, 1881
Chorotype. Mediterranean.
References. (133) Trotta, 2009.
Province. Olbia-Tempio (133).
Cryptachaea riparia (Blackwall, 1 834)
Chorotype. Palearctic.
References. (10) Costa, 1885 (sub Theridion ri-
parium).
Province. Cagliari (10).
*Dipoena coracina (C.L. Koch, 1837)
Chorotype. European.
Habitat. Vineyard (ined.).
Examined material. SASSARI: Torralba . vine-
yard, 1 female 28.X.1995 leg. 1st. Ent. SS (ISE).
Dipoena melanogaster (C.L. Koch, 1837)
Chorotype. European.
References. (127) Lorn et al., 2008.
22
P. Pantini, A. Sassu & G. Serra
Province. (127); Nuoro (ined.).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Tiana . m 522,
hazelnut-orchard, beating tray, 1 male and 1 female
19.V.2005 leg. I.S.E. (ISE).
Dipoena torva (Thorell, 1875)
Chorotype. Holarctic.
References. (94) Arno et al., 1998.
Province. Sassari (94).
Habitat. Avenue of lime trees (94).
Enoplognatha afrodite Hippa et Oksala, 1983
Chorotype. S-European.
References. (96) Bosnians & Van Keer, 1999;
(102) Pesarini, 2000; (127) Lorn et al., 2008.
Province. (127); Carbonia-Iglesias (102);
Nuoro (ined.); Olbia-Tempio (96).
Habitat. Hazelnut-orchard (127, ined.); park
area (96); Quercus suber forest (96).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, beating tray, 1 female
16.VI.2005 leg. I.S.E. (MBG).
Enoplognatha gemina Bosmans et Van Keer, 1999
Chorotype. Mediterranean.
References. (96) Bosmans & Van Keer, 1999.
Province. Ogliastra (96); Olbia-Tempio (96);
Oristano (96); Nuoro (ined.).
Habitat. Stones (96); stones in grassland (96);
under stones (96).
Examined material. NUORO: Gavoi . S'eremu
e sa mela, m 1000, 1 male 30.XII.2006 leg. Mulas
A. (MBG).
Enoplognatha latimana Hippa et Oksala, 1982
Chorotype. Palearctic.
References. (108) Knoflach, 2004.
Provinces. Ogliastra (108).
Enoplognatha mandibularis (Lucas, 1 846)
Chorotype. Sibero-European.
References. (10) Costa, 1885; (13) Garneri,
1902; (88) Wunderlich, 1995c (sub E. nigrocin-
cta ); (96) Bosmans & Van Keer, 1999; (132) Pan-
tini & Sassu, 2009; (133) Trotta, 2009; (139)
Trotta, 2011.
Provinces. Cagliari (13); Carbonia-Iglesias
(139); Nuoro (96); Ogliastra (88, 96); Olbia-Tempio
(133); Oristano (10, 13); Sassari (132).
Habitat. In a stream (88); under stones (96).
Enoplognatha nigromarginata (Lucas, 1846)
Chorotype. W-Mediterranean.
References. (13) Gameri, 1902; (96) Bosmans
& Van Keer, 1999.
Province. Cagliari (13); Ogliastra (96).
Habitat. Stones along rivulet (96).
Enoplognatha ovata (Clerck, 1757)
Chorotype. Holarctic.
References. (8) Costa, 1884 (sub Theridion li-
neatum ); (13) Gameri, 1902 (sub Theridion linea-
tum ); (84) Pesarini, 1994; (127) Lom et al., 2008.
Provinces. - (84, 127); Cagliari (13); Nuoro (8,
13, ined.); Ogliastra (13).
Habitat. Hazelnut-orchard (127, ined.); walnut-
orchard (ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, beating tray, 1 male and 3
juv. 16.VI.2005, 6 males, 4 females and 3 juv.
29.VI.2005 (MBG), 2 males and 1 female
13.VII.2005 (ISE), 2 males, 1 female and 1 juv.
13.VII.2005, 2 males and 8 juv. 16.VI.2005, 2 males,
3 females and 2 juv. 29.VI.2005 (MBG), 1 male and
2 females 29.VI.2005 (ISE), 1 female 7.IX.2005, 1
female 21.IX.2005 (MBG) (all leg. I.S.E.). Tonara .
Su Azzime, m 682, walnut-orchard, pitfall traps, 1
female 17-24.VIII.2007 leg. I.S.E. (ISE).
Enoplognatha testae ea Simon, 1884
Chorotype. Holarctic.
References. (66) Brignoli, 1980 (sub Robertas
arganoi n.sp.); (84) Pesarini, 1994 (sub Robertus
arganoi ); (96) Bosmans & Van Keer, 1999.
Province. (84); Ogliastra (66); Olbia-Tempio
(96); Oristano (96).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
23
Habitat. Hypogean habitat (66); stones along
cliff (96).
Enoplognatha thoracica (Hahn, 1833)
Chorotype. Holarctic.
References. (96) Bosnians & Van Keer, 1999.
Province. Nuoro (96, ined.); Ogliastra (96);
Olbia-Tempio (96).
Habitat. Along a river (96); cherry-orchard
(ined.); in Quercus suber forest (96); walnut-
orchard (ined.); under stones (96).
Examined material. NUORO: Belyi, Antonitzo,
m 683, cherry-orchard, 1 male 21-28.VI.2007 (ISE);
Canale e' Figu, m 576, walnut-orchard, 1 female 24-
30.VIII.2007 (ISE) (all pitfall traps and leg. I.S.E.).
Tonara . Su Azzime, m 682, walnut-orchard, pitfall
traps, 1 female 17-24.VII.2007 leg. I.S.E. (ISE).
Enoplognatha verae Bosmans et Van Keer, 1999
Chorotype. Mediterranean.
References. (96) Bosmans & Van Keer, 1999;
(133) Trotta, 2009.
Province. Carbonia-Iglesias (133); Medio
Campidano (96); Oristano (96).
Habitat. Under stone near cost (96).
Episinus algiricus Lucas, 1 846
Chorotype. W-Mediterranean.
References. (101) Knoflach & Thaler, 2000;
(130) Knoflach et al., 2009.
Province. Carbonia-Iglesias (101); Ogliastra
(130); Sassari (ined.).
Habitat. From Quercus (130); inside house
(ined.); in oak forest with rocky, bare ground (130);
pasture plateau, beating from Cistus (130).
Examined material. SASSARI: Sassari . Li
Punti, inside house, 1 male 31.V.2010 (MBG).
Episinus maculipes Cavanna, 1876
Chorotype. S-European.
References. (108) Knoflach, 2004; (130) Kno-
flach et al., 2009; (132) Pantini & Sassu, 2009.
Provinces. Ogliastra (108, 130); Sassari (132).
Habitat. From scrub and oak (130).
Episinus theridioides Simon, 1873
Chorotype. W-Mediterranean.
References. (15) Simon, 1914 (sub Plocamis
theridioides ).
Province. Sassari (15).
Episinus truncatus Latreille, 1809
Chorotype. European.
References. (8) Costa, 1884; (13) Gameri,
1902; (84) Pesarini, 1994.
Province. (84); Cagliari (13); Nuoro (8, 13);
Ogliastra (13); Oristano (8, 13).
Euryopis episinoides (Walckenaer, 1 847)
Chorotype. Mediterranean.
References. (2c) Canestrini, 1876 (sub Theri-
dium acuminatum)-, (10) Costa, 1885 (sub E. acu-
minata ); (13) Garneri, 1902 (sub E. acuminata );
(84) Pesarini, 1994 (sub E. acuminata)-, (94) Amo
et al., 1998 (sub E. tarsalis); (132) Pantini & Sassu,
2009; (133) Trotta, 2009.
Province. (2c, 84); Cagliari (ined.); Nuoro (10,
ined.); Olbia-Tempio (133); Oristano (13); Sassari
(10, 94, 132, ined.).
Habitat, citms-grove (ined.); avenue of lime trees
(94); cherry-orchard (ined.); orchard (ined.); walnut-
orchard (ined.); olive-grove (ined.); pinewood (ined.);
vineyard (ined.).
Examined material. CAGLIARI: Pula . Pixina
Manna, m 140, pinewood, emergence cages, 1 fe-
male, 21.IV.2009, leg. 1st. Ent. SS (ISE). Uta, S’Ap-
passiu, Agris farm, citms-grove, beating tray, 1
female 23.XI.2000 leg. CRAS (ISE).
NUORO: Belyi, Antonitzo, m 683, cherry-or-
chard, bark traps, 1 female 24-30.VIII.2007 (ISE);
Canale e' Figu, m 576, walnut-orchard, bark traps, 1
female 27.IX-4.X.2007 (ISE); Mannaritzo, m 706,
cherry-orchard, pitfall traps, 1 female 16-23.V.2007,
1 female 17-24.VII.2007 (ISE); bark traps, 2 females
24-30.VIII.2007 (ISE) (all leg. I.S.E.).
SASSARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 1 female 21. VIII. 2009, 3
males and 3 females 6.VIII.2009, 1 male
24
P. Pantini, A. Sassu & G. Serra
30.IX.2009, 1 female, 13.X.2009 leg. 1st. Ent. SS
(ISE). Sassari, Gioscari, olive-grove, chemical
knockdown, 9 males and 2 females 6.VIII.2008, 1
female 20.VIII.2008, 1 male 4.IX.2008 (ISE); Lu
Buttangaru, olive-grove, 1 male 30.IX.2008, 3 males
13. X. 2008, 1 male 29.IX.2009 leg. 1st. Ent. SS
(ISE); Li Punti, Baldinca, m 110, 1 male
14. VII.2008 leg. Pantaleoni R.A. (ISE). Sorso,
Pianu Mannu, Nali farm, orchard, pitfall traps, 1 fe-
male 26.VI-2. VII. 1997; orchard, bark traps, 1 male
24-3 l.VII. 1997 leg. 1st. Ent. SS (ISE). Torralba .
vineyard, 1 female 23.IV. 1994, 1 male 21.V.1994,
1 male 25.VI.1994, 1 male 15.VII.1995, 1 female
19.VIII.1995, 1 female 12.VIII.1995 leg. 1st. Ent.
SS (ISE).
Kochiura aulica (C.L. Koch, 1838)
Chorotype. Turano-Mediterranean.
References. (10) Costa, 1885 (sub Theridion
aulicum ); (11) de Carlini, 1885 (sub Theridion au-
licum); (13) Gameri, 1902 (sub Theridion aulicum)-,
(84) Pesarini, 1994 (sub Anelosimus aulicus ); (94)
Amo et al., 1998 (sub Anelosimus aulicus ); (114)
Grill et al., 2005 (sub Anelosimus aulicus ); (133)
Trotta, 2009; (134) Marras et al., 2011.
Provinces. (84, 114, 134); Cagliari (13, ined.);
Carbonia-Iglesias (11, 13); Nuoro/Ogliastra (13);
Ogliastra (13); Olbia-Tempio (10, 133); Oristano
(13); Sassari (94, ined.).
Habitat. Citrus-grove (ined.); avenue of lime
trees (94); orchard (134); olive-grove (ined.); shurb-
lands and trees, agricultural land (114); vineyard
(ined.).
Examined material. CAGLIARI: Uta, S’Ap-
passiu, Agris farm, citrus-grove, beating tray, 1
male 19.VI.2000 leg. CRAS (ISE).
OLBIA-TEMPIO: Olbia . Isola Tavolara - peni-
solotto, 23.IV. 1966 leg. Gruppo Isole C.N.R.
(MBG).
SASSARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 1 female 7. IX. 2009, 1 male
27.X.2009, 1 male and 1 female 7.X.2009, 2 males
6.X.2009 (ISE). Sassari . Gioscari, olive-grove, 1 fe-
male 21. VIII. 2009, Lu Buttangam, olive-grove,
chemical knockdown, 1 male 20.X.2008 leg. 1st.
Ent. SS. Sorso . Pianu Mannu, Nali farm, olive-
grove, 1 female 21. IX. 1992, leg. 1st. Ent. SS (ISE).
Torralba . vineyard, 1 male 16.VII.1994 leg. 1st. Ent.
SS (ISE).
Latrodectus tredecimguttatus (Rossi, 1790)
Chorotype. Centralasiatic-Mediterranean.
References. (1) Canestrini & Pavesi, 1868 (sub
Latrodectes malmignathus ); (2a) Canestrini & Pa-
vesi, 1870 (sub Latrodectes malmignathus ); (6) Ma-
gretti, 1880 (sub L. 13 guttatus ); (8) Costa, 1884 (L.
tredecimguttatus, Ross var. lugubris, L.); (13) Gar-
neri, 1902; (84) Pesarini, 1994; (133) Trotta, 2009.
Province. (1, 2a, 84); Cagliari (8, 13); Carbo-
nia-Iglesias (13); Medio Campidano (6); Olbia-
Tempio (8, 13); Sassari (8, 13, 133, ined.).
Habitat. Under stones (8).
Examined material. SASSARI: Ozieri . Chili-
vani, 1 female 18.XI.1981 leg. Meloni (MBG).
Neottiura bimaculata (Linnaeus, 1767)
Chorotype. Holarctic.
References. (10) Costa, 1885 (sub Theridion
bimaculatum Var. pellucidum ); (84) Pesarini, 1994.
Province. (84); Olbia-Tempio (10).
Neottiura herbigrada (Simon, 1873)
Chorotype. Mediterranean.
References. (116) Helsdingen, 2005.
Province. Ogliastra (116).
Habitat. Wasteland plot (116).
Neottiura uncinata (Lucas, 1 846)
Chorotype. Mediterranean.
References. (12) Costa, 1886 (sub Theridion
uncinatum); (99) Knoflach, 1999.
Province. Cagliari (12); Medio Campidano
(12); Oristano (99); Sassari (ined.).
Habitat. Wetland (12); in grassland near lagoon
(99); pinewood (ined.); vineyard (ined.).
Examined material. SASSARI: Alghero .
Pinewood Maria Pia, pinewood, 1 male 4.V.2008
leg. Cesaroni C. (ISE). Sassari . Li Punti, Baldinca,
m 110, 1 male 23.V.2008 (MBG). Torralba . vine-
yard, 1 female 18.VI.1994 leg. 1st. Ent. SS (ISE).
Paidiscura pallens (Blackwall, 1834)
Chorotype. Sibero-European.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
25
References. (127) Lorn et al., 2008.
Province. (127); Nuoro (ined.); Sassari
(ined.).
Habitat. Hazelnut-orchard (127, ined.); olive-
grove (ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, beating tray, 8 females
19.V.2005, 4 males and 14 females 4.V.2005, 1 fe-
male 29.VI.2005 (MBG), 5 females 1.VI.2005
(ISE), 2 females 1.VI.2005, 2 females 16.VI.2005,
3 males and 9 females 4.V.2005, 1 female
16.VI.2005, 2 females 1.VI.2005, 1 female
27.VII.2005 (MBG) (all leg. I.S.E.). Tiana. m 522,
hazelnut-orchard, beating tray, 1 female 4.V.2005
(MBG), 1 male and 1 female 19.V.2005 (ISE), 1
male and 1 female 19.V.2005, 1 male 16.VI.2005
(MBG) (all leg. I.S.E.).
SASSARI: Sorso, PianuMannu, Nali farm, olive-
grove, 1 male and 2 females 6.V.1993, 1 male and 1
female 18.III.1994, 2 males and 1 juv. 4.III.1994;
olive-grove, beating tray, 2 males 17.III.1993, 12
males, 3 females and 3 juv. 29.III.1993, 14 males, 14
females and 6 juv. 6.IV.1993, 1 female 9.VII.1993
(ISE) (all leg. 1st. Ent. SS).
Parasteatoda lunata (Clerck, 1757)
Chorotype. Palearctic.
References. (107) Knoflach & Pfaller, 2004
(sub Achaearanea lunata)', (127) Lorn et al., 2008
(sub Achaearanea lunata).
Provinces. (127); Nuoro (107, ined.).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, beating tray, 2 females,
16.VI.2005 leg. I.S.E. (ISE).
Parasteatoda tepidariorum (C.L. Koch, 1841)
Chorotype. Cosmopolitan.
References. (19) Roewer, 1953 (sub Theridion
tepidariorum)', (30) Cerruti, 1968 (sub Theridion te-
pidariorum).
Provinces. Sassari (19, 30).
Habitat. Hypogean habitat (19, 30).
Pholcomma gibbum (Westring, 1851)
Chorotype. European.
References. (13) Gameri, 1902; (51) Brignoli,
1974.
Province. Cagliari (13); Carbonia-Iglesias (51).
Habitat. Hypogean habitat (51).
Phylloneta impressa (L. Koch, 1881)
Chorotype. Holarctic.
References. (108) Knoflach, 2004 (sub Theri-
dion impressum); (127) Lorn et al., 2008 (sub The-
ridion impressum); (139) Trotta, 2011.
Province. (127); Carbonia-Iglesias (139); Nuoro
(ined.); Ogliastra (108); Olbia-Tempio (ined.).
Habitat. Hazelnut-orchard (127, ined.); forest
of Quercus suber (ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-
male 29.VI.2005 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Budduso . near Nuraghe Lo-
elle, forest of Quercus suber, beating tray, 1 male
28.VI.1999 leg. 1st. Ent. SS (ISE).
Phylloneta sisyphia (Clerck, 1757)
Chorotype. Palearctic.
References. (8) Costa, 1884 (sub Theridion
sisyphium); (13) Garneri, 1902 (sub Theridion si-
syphium).
Provinces. Cagliari (13); Nuoro (8, 13); Ori-
stano (13).
Platnickia tincta (Walckenaer, 1 802)
Chorotype. Holarctic.
References. (10) Costa, 1885 (sub Theridion
tincutm); (13) Garneri, 1902 (sub Theridion tin-
ctum); (127) Lorn et al., 2008 (sub Keijia tincta)',
(132) Pantini & Sassu, 2009 (sub Keijia tincta)',
(139) Trotta, 2011.
Province. (127); Cagliari (13); Carbonia-Igle-
sias (139); Nuoro (ined.); Olbia-Tempio (ined.);
Oristano (10); Sassari (132, ined.).
Habitat. Hazelnut-orchard (127, ined.); olive-
grove (ined.); forest of Quercus suber (ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1
male 16.VI.2005, 1 female 29.VI.2005 leg. I.S.E.
26
P. Pantini, A. Sassu & G. Serra
(MBG). Tiana, m 522, hazelnut-orchard, beating tray,
1 male and 2 females, 16.VI.2005 (MBG), 1 male
1.VL2005, 1 female 10.VIII.2005 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Budduso . nearNuraghe Loelle,
forest of Quercus suber, beating tray, 1 female
24.V.1999, 1 male 28.VI.1999, leg. 1st. Ent. SS (ISE).
S AS SARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 1 male 6. VIII. 2009 leg. 1st.
Ent. SS (ISE). Sassari . Platamona, at sea level, 1
male and 1 female, 22.V.2008 leg. Sassu A. (ISE).
Sorso, Pianu Mannu, Nali farm, olive-grove, 1 male
and 1 female 6.V.1993, 1 male 9.VII.1993 (ISE);
olive-grove, beating tray, 1 male, 1 female and 2
juv. 15.III.1993, 2 females and 1 juv. 29.IV. 1993, 2
males, 3 females and 11 juv. 25.VI.1993, 5 males
and 4 females 18.VI.1993, 2 females and 2 juv.
22.VII.1993, 3 females and 18 juv. 1.VII.1993, 2
males, 5 females and 3 juv. 9.VII.1993, 2 males
30. VII.1993, 1 male 12.VIII.1993, 1 female
26.VIII.1993 (ISE) (all leg. 1st. Ent. SS).
*Rhomphaea nasica (Simon, 1873)
Chorotype. Mediterranean.
Habitat. Citrus-grove (ined.); olive-grove (ined.)
Examined material. CAGLIARI: Uta, S’Appas-
siu, Agris farm, citrus-grove, beating tray, 1 male
31. VII.2000, 1 juv. 21.IX.2000 leg. CRAS (ISE).
SASSARI: Sorso . Pianu Mannu, Nali farm,
olive-grove, beating tray, 1 male 15.VII.1993 leg.
1st. Ent. SS (ISE).
Robertus arundineti (O.P.-Cambridge, 1871)
Chorotype. Palearctic.
References. (66) Brignoli, 1980; (84) Pesa-
rini, 1994.
Province. (84); Ogliastra (66).
Habitat. Hypogean habitat (66).
Ruborridion musivum (Simon, 1873)
Chorotype. Mediterranean.
References. (10) Costa, 1885 (sub Theridion
musivum)-, (107) Knoflach & Pfaller, 2004 (sub
Theridion musivum); (127) Lorn et al., 2008 (sub
Theridion musivum); (130) Knoflach et al., 2009
(sub Theridion musivum).
Province. (127); Cagliari (130); Carbonia-Igle-
sias (130); Nuoro (ined.); Ogliastra (107, 130); Ori-
stano (130); Sassari (10).
Habitat. Hazelnut-orchard (127, ined.); pasture
plateau, beating from Cistus sp. (130).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, beating tray, 1 male
16.VI.2005 leg. I.S.E. (ISE).
Sardinion blackwalli (O.P.-Cambridge, 1871)
Chorotype. European.
References. (86) Wunderlich, 1995a (sub S.
perplexum); (87) Wunderlich, 1995b (sub Sardini-
dion perplexum).
Province. (87); Ogliastra (86); Sassari (ined.).
Habitat. On a tree (86); orchard (ined.).
Examined material. SASSARI: Sorso . Pianu
Mannu, Nali farm, orchard, beating tray, 1 female
3 l.VII. 1997, 1 male 2.VII.1997 leg. 1st. Ent. SS
(ISE).
Simitidion simile (C.L. Koch, 1836)
Chorotype. Holarctic.
References. (13) Gameri, 1902 (sub Therodion
simile); (114) Grill et al., 2005; (116) Helsdingen,
2005; (127) Lorn et al., 2008.
Province. (114, 127); Cagliari (ined.); Nuoro
(116, ined.); Ogliastra (13); Olbia-Tempio (ined.);
Sassari (ined.).
Habitat. Citrus-grove (ined.); low shurbs, shur-
blands and trees, agricultural land (114); hazelnut-
orchard (127, ined.); pinewood (ined.); forest of
Quercus suber (ined.).
Examined material. CAGLIARI: Uta . S’Ap-
passiu, Agris farm, citrus-grove, beating tray, 1 fe-
male 19.VI.2000 leg. CRAS (ISE).
NUORO: Belvi . Su Ajone, m 585, hazelnut-or-
chard, 1 male 19.V.2005, 1 female 1.VI.2005 (ISE);
Su Enazzu, m 550, hazelnut-orchard, 1 male
1.VI.2005 (MBG) (all beating tray and leg. I.S.E.).
OLBIA-TEMPIO: Budduso , near Nuraghe Lo-
elle, forest of Quercus suber, beating tray, 1 female
31.V.1999 leg. 1st. Ent. SS (ISE). Tempio . Curado-
reddu, m 580, pinewood, emergence cages, 1 fe-
male 15.V.2009 leg. 1st. Ent. SS (ISE).
SASSARI: Bonnannaro . Cannisones, 1 male
28.V.2002 leg. Nuvoli T. (ISE).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
27
Steatoda albomaculata (De Geer, 1778)
Chorotype. Cosmopolitan.
References. (8) Costa, 1884 (sub Lithyphantes
corollatus ); (13) Gameri, 1902 (sub Lithyphantes
corollatus ); (84) Pesarini, 1994.
Province. (13, 84); Cagliari (13); Nuoro/Ogliastra
(8, 13).
Habitat. Under stones (8).
Steatoda grossa (C.L. Koch, 1838)
Chorotype. Cosmopolitan.
References. (13) Gameri, 1902 (sub Teutana
grossa ); (34) Dresco & Hubert, 1969 (sub Teutana
grossa ); (42) Puddu,1971 (sub Teutana grossa );
(51) Brignoli, 1974; (64) Brignoli, 1979d; (83)
Pons, 1993; (133) Trotta, 2009; (139) Trotta, 2011.
Province. Cagliari (13, 42); Carbonia-Iglesias
(64, 133, 139); Nuoro (34, 83); Olbia-Tempio
(133); Oristano (133); Sassari (51, 83, ined.).
Habitat. Hypogean habitat (34, 42, 51, 64, 83);
inside house (ined.).
Examined material. SASSARI: Alghero . inside
house, 1 female 18.1.2000, 1 male 25.III.2000 leg.
Pantaleoni R.A. (ISE). Sassari . inside house, 1 fe-
male 23.1.2007 (ISE).
Steatoda nobilis (Thorell, 1875)
Chorotype. W-Mediterranean (?).
References. (140) Kulczycki et al., 2012.
Province. Cagliari (140); Olbia-Tempio (140);
Sassari (140, ined).
Habitat. Inside house (ined.).
Examined material. SASSARI: Alghero . inside
house, 1 male 6.1.2009 leg. Pantaleoni R.A. (ISE).
Sassari . Giordano, m 40, 1 female 21.IV.2004, 1 fe-
male 15.11.2009 leg. Molinu A. (ISE).
Steatoda paykulliana (Walckenaer, 1805)
Chorotype. Centralasiatic-European.
References. (5) Pavesi, 1878 (sub Lithyphantes
paykullianus ); (6) Magretti, 1880 (sub Lityphantes
paykullianus ); (7a) Costa, 1882 (sub Phrurolithus
hamatus ); (8) Costa, 1884 (sub Phrurolitus hama-
tus ); (13) Gameri, 1902 (sub Lithyphantes paykul-
lianus ); (84) Pesarini, 1994; (132) Pantini & Sassu,
2009; (133) Trotta, 2009; (139) Trotta, 2011.
Province. (13, 84); Cagliari (6, 13); Carbonia-
Iglesias (6, 13, 139); Medio Campidano (6); Oglia-
stra (13); Olbia-Tempio (5, 7a, 8, 13); Oristano (6,
13); Oristano/Nuoro (6); Sassari (6, 13, 132, 133).
Steatoda triangulosa (Walckenaer, 1 802)
Chorotype. Cosmopolitan.
References. (10) Costa, 1885 (sub Teutana
triangulosa ); (13) Gameri, 1902 (sub Teutana trian-
gulosa ); (37) Argiolas et al., 1970 (sub Teutana
triangulosa ).
Province. Cagliari (13, 37); Nuoro/Ogliastra
(13); Oristano (10, 13); Sassari (ined.).
Habitat. Hypogean habitat (37); in house (ined.).
Examined material. SASSARI: Sassari . in
house, Dept, of Plant Protection, 1 female
4.IV.2004 leg. Sassu A. (ISE).
Theridion familiar e O.P.-Cambridge, 1871
Chorotype. European.
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (84); Cagliari (13).
Theridion genistae Simon, 1873
Chorotype. W-Mediterranean.
References. (127) Lorn et al., 2008; (130) Kno-
flach et al., 2009.
Province. (127); Nuoro (ined.); Ogliastra (130).
Habitat. In oak forest (130); hazelnut-orchard
(127, ined.).
Examined material. NUORO: Belyi, Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1
male 1.VI.2005 leg. I.S.E. (ISE).
* Theridion hannoniae Denis, 1944
Chorotype. European.
Habitat, garrigue (ined.); mining landfills cov-
ered by pioneer plants (ined.); olive-grove (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining land-
fills covered by pioneer plants, 1 female 19.V-
28
P. Pantini, A. Sassu & G. Serra
4.VI.2009; m 200, garrigue, 1 male 4-16.VI.2009,
1 male 25.VIII-8.IX.2009 (ISE) (all pitfall traps and
leg. Sassu A., Verdinelli M.). Guspini . Montevec-
chio, Piccalinna, m 225, mining landfills covered
by pioneer plants, 1 male 18.V-3.VI.2009, 1 male
15-30.VI.2009; m 235, garrigue, 1 male 25. VIII-
8.IX.2009 (ISE) (all pitfall traps and leg. Sassu A.,
Verdinelli M.).
S AS SARI: Sassari . Gioscari, olive-grove, chemical
knockdown, 1 male 4.IX.2009 leg. 1st. Ent. SS (ISE).
Theridion malagaense Wunderlich, 2011
Chorotype. W-Mediterranean.
References. (136) Wunderlich, 2011.
Province. Sassari (136).
Theridion melanurum Hahn, 1831
Chorotype. Holarctic.
References. (13) Gameri, 1902 (sub T. denti-
culatum).
Province. (13); Sassari (ined.).
Habitat. Olive-grove (ined.).
Examined material. SASSARI: Sorso, Pianu
Mannu, Nali farm, olive-grove, beating tray, 1 fe-
male 18.VI.1993 leg. 1st. Ent. SS (ISE).
Theridion mystaceum L. Koch, 1870
Chorotype. Asiatic-European.
References. (94) Arno et al., 1998; (116) Hel-
sdingen, 2005; (127) Lorn et al., 2008.
Province. (127); Cagliari (ined.); Nuoro (ined.);
Ogliastra (116); Olbia-Tempio (ined.); Sassari (94).
Habitat. Citrus-grove (ined.); avenue of lime
trees (94); inside house (116); hazelnut-orchard
(127, ined.); pinewood (ined.); forest of Quercus
suber (ined.).
Examined material. CAGLIARI: Pula . Pixina
Manna, m 140, pinewood, emergence cages, 2
males, 16.IV.2009, 1 male 29.IV.2009, 1 female
25.V.2009 leg. 1st. Ent. SS (ISE). Uta, S’Appassiu,
Agris farm, citrus-grove, beating tray, 1 female
19.VI.2000, 1 female 10.VII.2000 leg. CRAS (ISE).
NUORO: Belyi, Su Ajone, m 585, hazelnut-or-
chard, beating tray, 1 female 19.V.2005 (MBG), 1
female 4.V.2005 (ISE) (all leg. I.S.E.).
OLBIA-TEMPIO: Budduso . near Nuraghe Lo-
elle, forest of Quercus suber, beating tray, 1 male,
24.V.1999, leg. 1st. Ent. SS (ISE).
Theridion nasutum Wunderlich, 1995
Chorotype. Sardinian endemic.
References. (87) Wunderlich, 1995b.
Province. Nuoro/Ogliastra (87); Ogliastra (87).
Habitat. Shrubs (87); under stones (87); under
the bark (87).
Theridion pinastri L. Koch, 1872
Chorotype. Palearctic.
References. (127) Lorn et al., 2008.
Province. (127); Nuoro (ined.); Olbia-Tempio
(ined.); Sassari (ined.).
Habitat. Hazelnut-orchard (127, ined.); olive-
grove (ined.); forest of Quercus suber (ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, beating tray, 1 male
29.VI.2005 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Budduso . near Nuraghe Lo-
elle, forest of Quercus suber, beating tray, 1 female
31. V.l 999, 1 male and 1 female 21. VI. 1999 leg. 1st.
Ent. SS (ISE).
SASSARI: Sorso . Pianu Mannu, Nali farm,
olive-grove, 1 female 9 .VI. 1993 (ISE), olive-grove,
beating tray, 1 male and 1 female 9.VI.1993, 2
males and 1 female, 18.VI.1993 leg. 1st. Ent. SS
(ISE) (all leg. 1st. Ent. SS).
Theridion varians Hahn, 1833
Chorotype. Holarctic.
References. (12) Costa, 1886 (sub T. rusticum)-,
(13) Garneri, 1902; (127) Lorn et al., 2008.
Province. (127); Cagliari (13, ined.); Medio
Campidano (12); Nuoro (ined.); Ogliastra (13);
Sassari (ined.).
Habitat. Citrus-grove (ined.); wetland (12); or-
chard (ined.); hazelnut-orchard (127, ined.); olive-
grove (ined.).
Examined material. CAGLIARI: Uta, S’Appas-
siu, Agris farm, citrus-grove, beating tray, 13 fe-
males 19.VI.2000, 11 females 29.VI.2000, 2 females
31.VII.2000, 9 females 10.VII.2000, 1 female
20.VII.2000, 1 female 11.IX.2000 leg. CRAS (ISE).
NUORO: Belvi . Su Ajone, m 585, hazelnut-or-
Catalogue of the spiders (Arachnida Araneae) of Sardinia
29
chard, beating tray, 2 males 16. VI. 2005, 2 males
13.VII.2005 (MBG), hazelnut-orchard, bark traps,
1 female 5-10.VIII.2005 (ISE); Su Enazzu, m 550,
hazelnut-orchard, beating tray, 4 females 16.VI.2005,
1 female 29.VI.2005, 1 female 27.VII.2005 (MBG)
(all leg. I.S.E.). Tiana . m 522, hazelnut-orchard, beat-
ing tray, 1 male and 1 female 16.VI.2005 (ISE), 1 fe-
males 13.VII.2005 (MBG) (all leg. I.S.E.).
SASSARI: Sorso, Pianu Mannu, Nali farm,
olive-grove, 4 males 3.VI.1993, orchard, 1 male
and 2 females 27.V.1998 (ISE) (all beating tray and
leg. 1st. Ent. SS).
Family MYSMENIDAE
Mysmenella jobi (Kraus, 1967)
Chorotype. Palearctic.
References. (127) Lorn et al., 2008.
Province. (127); Nuoro (ined.).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Belvh Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1
male 19.V.2005 leg. I.S.E. (ISE).
Family LINYPHIIDAE
Acartauchenius sardiniensis Wunderlich, 1995
Chorotype. Sardinian endemic.
References. (87) Wunderlich, 1995b.
Province. Ogliastra (87).
Habitat. Under stones (87).
Araeoncus longiusculus (O.P.-Cambridge, 1875)
Chorotype. Sardo-Corsican endemic.
References. (87) Wunderlich, 1995b; (132)
Pantini & Sassu, 2009.
Province. Nuoro (ined.); Ogliastra (87); Sas-
sari (132).
Habitat. Cherry-orchard (ined.).
Examined material. NUORO: Belvi . Antonitzo,
m 683, cherry-orchard, 1 male 16-23.V.2007 (ISE);
Mannaritzo, m 706, cherry-orchard, 1 male 18-
26.IV.2007 (ISE) (all pitfall traps and leg. I.S.E.).
Bolyphantes nigropictus Simon, 1884
Chorotype. W-Mediterranean.
References. (9) Simon, 1884; (13) Gameri,
1902; (17) Simon, 1929.
Province. (17); Sassari (9, 13).
Centromerus bonaeviae Brignoli, 1979
Chorotype. Sardinian endemic.
References. (64) Brignoli, 1979d; (84) Pesa-
rini, 1994.
Province. (84); Carbonia-Iglesias (64).
Habitat. Hypogean habitat (64).
Centromerus puddui Brignoli, 1979
Chorotype. Sardinian endemic.
References. (64) Brignoli, 1979d; (84) Pesa-
rini, 1994.
Province. (64, 84).
Habitat. Hypogean habitat (64).
* Centromerus subalpinus Lessert, 1907
Chorotype. S-European.
Habitat. Hazelnut-orchard (ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1
male 30.V-4.VII.2007 leg. I.S.E. (MBG).
* Centromerus succinus (Simon, 1884)
Chorotype. W-Mediterranean.
Habitat. Hazelnut-orchard (ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-
male, 8-24.VIII.2006, leg. I.S.E. (MBG).
Remarks. This data represents the first record
for Italian fauna.
Cresmatoneta eleonorae (Costa, 1883)
Chorotype. Sardinian endemic.
References. (7b) Costa, 1883 (sub Formicina
eleonorae)', (8) Costa, 1884 (sub Formicina Eleo-
norae); (13) Gameri, 1902 (sub Formicina eleono-
rae); (84) Pesarini, 1994.
30
P. Pantini, A. Sassu & G. Serra
Provinces. (84); Sassari (7b, 8, 13).
Remarks. Species described from a female in
1883 and never found since. The validity of the
species requires further confirmation.
Cresmatoneta mutinensis (Canestrini, 1868)
Chorotype. Asiatic-European.
References. (127) Lorn et al., 2008.
Province. (127); Nuoro (ined.); Sassari (ined.).
Habitat. Hazelnut-orchard (127, ined.); olive-
grove (ined.).
Examined material. NUORO: Belvh Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1
male, 4.X.2005 leg. I.S.E. (ISE).
SASSARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 1 male and 4 females,
6.VIII.2009, 1 female 7.X.2009 leg. 1st. Ent. SS (ISE).
Diplocephalus graecus (O.P. -Cambridge, 1872)
Chorotype. Mediterranean.
References. (127) Lorn et al., 2008; (132) Pan-
tini & Sassu, 2009.
Province. (127); Cagliari (ined.); Medio Campi-
dano (ined.); Nuoro (ined.); Sassari (132, ined.).
Habitat. Citrus-grove (ined.); cherry-orchard
(ined.); garrigue (ined.); hazelnut- orchard (127,
ined.); olive-grove (ined.); under Juniperus sp.
(ined.); mining landfills covered by pioneer plants
(ined.).
Examined material. CAGLIARI: Uta, S’Ap-
passiu, Agris farm, citrus-grove, beating tray, 1
male, 2.XI.2000, 1 female, 13.XI.2000, 1 male
4.XII.2000, leg. CRAS (ISE).
MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-
cauli, m 170, mining landfills covered by pioneer
plants, 1 male 2 1 .IV-5 . V.2009, 1 female 6-20.X.2009;
m 200, garrigue, 1 male 19.V-4.VI.2009 (ISE) (all pit-
fall traps and leg. Sassu A., Verdinelli M.). Guspini .
Montevecchio, Piccalinna, m 225, mining landfills
covered by pioneer plants, 1 male 6-20.X.2009 (ISE);
m 235, garrigue, 1 female 6-20.X.2009 (MBG) (all
pitfall haps and leg. Sassu A., Verdinelli M.).
NUORO: Belvh Antonitzo, m 683, cherry-or-
chard, pitfall traps, 1 male 11-18.IV.2007 (ISE);
Mannaritzo, m 706, cherry-orchard, pitfall traps, 1
male and 1 female, 16-23.V.2007 (ISE); Su Ajone,
m 585, hazelnut-orchard, beating tray, 1 male
1.VI.2005 (MBG); Su Enazzu, m 550, hazelnut-or-
chard, pitfall traps, 1 male 26.IV-30.V.2007 (MBG),
1 male and 1 female, 30.V-4.VII.2007 (ISE) (all leg.
I.S.E.). Fonni . Gennargentu, mountain refuge, m
1550, under Juniperus sp., pitfall traps, 1 male
19. VI-1.VII.2007, leg. Fiori F. (ISE).
SASSARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 1 male 30.IX.2009, 2 females
20. X.2009, 1 female 13.X.2009, 1 female 27.X.2009
leg. 1st. Ent. SS (ISE). Sorso . Pianu Mannu, Nali
farm, olive-grove, beating tray, 2 males and 2 fe-
males 13.V.1993 leg. 1st. Ent. SS (ISE).
*Diplostyla concolor (Wider, 1834)
Chorotype. Holarctic.
Habitat. Hazelnut-orchard (ined.).
Examined material. NUORO: Belyi, Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-
male 13-27.VII.2006 (MBG), 1 female 24.VIII-
5. IX. 2006 (ISE) 1 female 24.VIII-5.IX.2006
(MBG), 1 male 19.III-26.IV.2007 leg. I.S.E. (ISE).
Entelecara acuminata (Wider, 1834)
Chorotype. Holarctic.
References. (127) Lorn et al., 2008.
Province. (127); Nuoro (ined.).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Belvh Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-
male, 19.V.2005, 1 female 1.VI.2005 (MBG), 1 fe-
male 29.VI.2005 (ISE), 1 female 27.VII.2005
(MBG) (all leg. I.S.E.).
Erigone dentipalpis (Wider, 1 834)
Chorotype. Holarctic.
References. (132) Pantini & Sassu, 2009.
Province. Medio-Campidano (ined.); Nuoro
(ined.); Sassari (132).
Habitat. Cherry-orchard (ined.); hazelnut-
orchard (ined.); mining landfills covered by pioneer
plants (ined.).
Examined material. MEDIO CAMPIDANO:
Guspini. Montevecchio, Piccalinna, m 225, mining
landfills covered by pioneer plants, pitfall traps, 1
male 21. IV-5 .V.2009, 1 female 18.V-3.VI.2009 leg.
Sassu A., Verdinelli M. (ISE).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
31
NUORO: Belvi, Mannaritzo, m 706, cherry-or-
chard, 1 female 11-18.IV.2007 (ISE); SuEnazzu, m
550, hazelnut-orchard, 1 male 13-27. VII. 2006
(MBG), 3 males 30.V-4.VII.2007, 3 males 30.V-
4.VII.2007 (MBG) (all pitfall traps and leg. I.S.E.).
Frontinellina frutetorum (C.L. Koch, 1834)
Chorotype. Sibero-European.
References. (10) Costa, 1885 (sub Linyphia fru-
tetorum ); (13) Gameri, 1902 (sub Linyphia f rut eto-
rum ); (116) Helsdingen, 2005; (139) Trotta, 2011.
Province. (10); Cagliari (13); Carbonia-Iglesias
(139); Nuoro (116); Ogliastra (13).
Habitat. Shurbs and lower branches of trees
(116).
Gnathonarium dentatum (Wider, 1834)
Chorotype. Palearctic.
Reference. (135) Tanasevitch, 2011.
Province. Oristano (135).
Gonatium biimpressum Simon, 1884
Chorotype. Tyrrhenian endemic.
References. (13) Gameri, 1902; (16) Simon,
1926; (84) Pesarini, 1994.
Province. (84); Sassari (13, 16).
Gonatium nemorivagum (O. P.-Cambridge, 1875)
Chorotype. Mediterranean.
References. (10) Costa, 1885 (sub G. nemo-
rivaga).
Province. Nuoro (10).
*Hybocoptus corrugis (O.P.-Cambridge, 1875)
Chorotype. S-European.
Habitat. Forest of Quercus suber (ined.).
Examined material. OLBIA-TEMPIO: Budduso .
near Nuraghe Loelle, forest of Quercus suber, beat-
ing tray, 1 male 20.XI.1999 leg. 1st. Ent. SS (ISE).
Remarks. This data represents the first record
for Italian fauna.
Incestophantes crucifer (Menge, 1866)
Chorotype. Sibero-European.
References. (13) Garneri, 1902 (sub Lepty-
phantes crucifer ).
Province. (13); Cagliari (13).
Lepthyphantes eleonorae Wunderlich, 1995
Chorotype. Sardinian endemic.
References. (87) Wunderlich, 1995b.
Province. (87); Ogliastra (87).
Habitat. Under stones along a stream (87).
Lepthyphantes minutus (Blackwall, 1833)
Chorotype. Holarctic.
References. (139) Trotta, 2011.
Province. Carbonia-Iglesias (139).
Lepthyphantes paoloi Wunderlich, 1995
Chorotype. Sardinian endemic.
References. (87) Wunderlich, 1995b.
Province. Nuoro/Ogliastra (87); Ogliastra (87);
Olbia-Tempio (87).
Habitat. Under stones along a stream (87).
Lepthyphantes sardous Gozo, 1908
Chorotype. Sardinian endemic.
References. (14) Gozo, 1908 (sub L. sardoa
Gozo, 1908); (30) Cermti, 1968 (sub L. sardoa );
(84) Pesarini, 1994; (119) Lana et al., 2006.
Province. (84); Ogliastra (14, 30, 119).
Habitat. Hypogean habitat (14, 30, 119).
Lessertia dentichelis (Simon, 1884)
Chorotype. Cosmopolitan.
References. (41) Brignoli, 1971c; (52) Puddu
& Pirodda, 1974; (84) Pesarini, 1994.
Province. (84); Sassari (41, 52).
Habitat. Hypogean habitat (41, 52).
Linyphia hortensis Sundevall, 1830
Chorotype. Palearctic.
32
P. Pantini, A. Sassu & G. Serra
References. (7a) Costa, 1882 (sub L. praten-
sis ); (8) Costa, 1884 (sub L. pratensis).
Province. Sassari (7a, 8).
Linyphia triangularis (Clerck, 1757)
Chorotype. Palearctic.
References. (10) Costa, 1885; (13) Garneri,
1902 (sub L. montana) ; (139) Trotta, 2011.
Province. Carbonia-Iglesias (139); Medio
Campidano (139); Nuoro (10, 139); Nuoro/Oglia-
stra (13); Ogliastra (13, 139); Sassari (ined.).
Habitat. Olive-grove (ined.).
Examined material. SASSARI: Alghero . Ma-
muntanas, olive-grove, chemical knockdown, 1 male
27.X.2009 leg. 1st. Ent. SS (ISE). Sassari . Gioscari,
olive-grove, 1 male 13.X.2009 leg. 1st. Ent. SS (ISE).
Maso gallicus Simon, 1894
Chorotype. European.
References. (116) Helsdingen, 2005.
Province. Nuoro (116).
Habitat. Grassland along the mouth of the
river (116).
Mecopisthes millidgei Wunderlich, 1995
Chorotype. Sardinian endemic.
References. (87) Wunderlich, 1995b; (94)
Amo et al., 1998 (sub M. silus )
Province. Ogliastra (87); Sassari (94).
Habitat. Under stones (87); avenue of lime
trees (94).
Remarks. After re-examination of the material
on M. silus from Amo et al. (1998) it was attributed
to M. millidgei.
*Meioneta mollis (O.P.-Cambridge, 1871)
Chorotype. Asiatic-European.
Habitat. Hazelnut-orchard (ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-
male 27.VII-8.VIII.2006 (ISE), 1 male, 8.1-
21.11.2007, 4 males 30.V-4.VII.2007 (MBG), 3
males 30.V-4.VII.2007 (ISE) (all leg. I.S.E.).
Meioneta pseudorurestris Wunderlich, 1980
Chorotype. S-European.
References. (87) Wunderlich, 1995b (sub Agy-
neta pseudorurestris ); (132) Pantini & Sassu, 2009;
(134) Marras et al., 2011.
Province. (134); Cagliari (ined.); Medio Cam-
pidano (ined.); Nuoro (ined.); Ogliastra (87); Sas-
sari (132, ined.).
Habitat. Citrus-grove (ined.); cherry-orchard
(ined.); orchard (134); garrigue (ined.); mediter-
ranean maquis (ined.); hazelnut-orchard (ined.);
walnut- orchard (ined.); olive-grove (ined.); under
Juniperus sp. (ined.); under stones (87); mining
landfills covered by pioneer plants (ined.).
Examined material. CAGLIARI: Uta, S’Ap-
passiu, Agris farm, citrus-grove, beating tray, 1
male 29. VI. 2000, 1 male and 1 female 19.VI.2000,
1 male 10.VII.2000 leg. CRAS (ISE).
MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-
cauli, m 120, mediterranean maquis, 2 males lb-
29. VI. 2009; m 170, mining landfills covered by
pioneer plants, 1 female 19.V-4.VI.2009; m 200,
garrigue, 2 males and 3 females 19.V-4.VI.2009, 1
male 5-19.V.2009 (ISE), 1 male and 1 female 19.V-
4. VI. 2009 (MBG), 1 female 6-20.X.2009 (ISE) (all
pitfall traps and leg. Sassu A., Verdinelli M.). Gu-
spini. Montevecchio, Piccalinna, m 235, garrigue,
pitfall traps, 2 males 18.V-3.VI.2009, leg. Sassu A.,
Verdinelli M. (ISE).
NUORO: Belvi . Antonitzo, m 683, cherry-or-
chard, 3 females 18-26. IV.2007, 1 male 16-
23.V.2007, 1 female 11-18.1.2008 (ISE); Canale e'
Figu, m 576, walnut-orchard, 1 female 26. IV-
4.V.2007, 1 female 16-23.V.2007, 1 female 21-
28.VI.2007, 1 female 17-24.VII.2007 (ISE);
Mannaritzo, m 706, cherry-orchard, 1 male 16-
23.V.2007, 1 male 4-11.X.2007, 2 males and 1 fe-
male, 19-26.XI.2007, 1 female 11-18.1.2008 (ISE);
Su Enazzu, m 550, hazelnut-orchard, 1 male 30.V-
4. VII. 2007 (ISE) (all pitfall traps and leg. I.S.E.).
Desulo . Gennargentu, mountain refuge, m 1500,
under Juniperus sp., pitfall traps, 1 male 17. VI-
1.VII.2007, leg. Fiori F. (ISE). Tonara . Su Azzime,
m 682, walnut- orchard, pitfall traps, 1 male, 18-
26.IV.2007, 1 male 16-23.V.2007 leg. I.S.E. (ISE).
SASSARI: Sassari . Gioscari, olive-grove, che-
mical knockdown, 1 female 22.IX.2008, 1 female
14.X.2008 leg. 1st. Ent. SS (ISE).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
33
*Micrargus subaequalis (Westring, 1851)
Chorotype. Asiatic-European.
Habitat. Under Juniperus sp. (ined.).
Examined material. NUORO: Fonni . Gennar-
gentu, mountain refuge, m 1550, under Juniperus
sp., pitfall traps, 1 male 5- 19. VI. 2007 leg. Fiori
F. (MBG).
Microctenonyx subitaneus (O.P.-Cambridge, 1875)
CHOROTYPE.Holarctic.
References. (46) Thermes, 1972 (sub A ulaco-
cyba subitanea ); (52) Puddu & Pirodda, 1974 (sub
Aulacocyba subitanea ); (67) Puddu, 1980 (sub Au-
lacocyba subitanea ); (84) Pesarini, 1994; (94) Amo
et al., 1998; (104) Muccedda et al.,2002 (sub Aula-
cocyba subitanea ); (132) Pantini & Sassu, 2009;
(135) Tanasevitch, 201 1.
Province. (84); Cagliari (135); Cagliari/Nuoro
(67); Carbonia-Iglesias (46, 52); Nuoro (ined.); Sas-
sari (94, 104, 132, ined.).
Habitat. Avenue of lime trees (94); hypogean
habitat (46, 52, 67, 104); cherry-orchard (ined.);
hazelnut-orchard (ined.); walnut-orchard (ined.);
olive-grove (ined.).
Examined material. NUORO: Belvi . Anto-
nitzo, m 683, cherry-orchard, 1 male 18-
26.IV.2007, 8 male 19-26.XI.2007, 2 males
22-29.11.2008 (ISE); Canale e' Figu, m 576, wal-
nut-orchard, 2 males 11-18.1.2008 (ISE); Manna-
ritzo, m 706, cherry-orchard, 1 male 11-18.IV.2007,
1 male 18-26.IV.2007, 1 male 16-23.V.2007, 1 male
19-26.XI.2007 (ISE); Su Enazzu, m 550, hazel-
nut-orchard, 1 male 24.VIII-5.IX.2006, 2 females
30.V-4.VII.2007 (MBG), 1 male, 1 female 30.V-
4. VII. 2007 (ISE) (all pitfall traps and leg. I.S.E.).
Tonara, Su Azzime, m 682, walnut-orchard, pitfall
traps, 1 male 19-26.XI.2007 leg. I.S.E. (ISE).
S AS SARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 1 male 6. VIII. 2009 leg. 1st.
Ent. SS (ISE). Sorso, Pianu Mannu, Nali farm,
olive-grove, beating tray, 1 female 29.III.1993 leg.
1st. Ent. SS (ISE).
Microlinyphia pusilla (Sundevall, 1830)
Chorotype. Holarctic.
References. (8) Costa, 1884 (sub Linyphia pu-
silla ); (13) Gameri, 1902 (sub Linyphia pusilla).
Province. (8); Cagliari (13); Carbonia-Iglesias
(13); Sassari (13).
*Nematogmus sanguinolentus (Walckenaer, 1841)
Chorotype. Palearctic.
Habitat. Olive-grove (ined.).
Examined material. SASSARI: Sassari . Lu
Buttangam, olive-grove, chemical knockdown, 1
male 13.X.2008 leg. 1st. Ent. SS (MBG).
Neriene clathrata (Sundevall, 1830)
Chorotype. Holarctic.
References. (35) Helsdingen, 1969.
Province. Sassari (35).
Neriene furtiva (O.P.-Cambridge, 1871)
Chorotype. European.
References. (116) Helsdingen, 2005.
Province. Ogliastra (116).
Habitat. In shurbs along a little stram (116).
Ouedia rufithorax (Simon, 1881)
Chorotype. W-Mediterranean.
References. (132) Pantini & Sassu, 2009.
Province. Sassari (132, ined.).
Habitat. Olive-grove (ined.).
Examined material. SASSARI: Alghero . Ma-
muntanas, olive-grove, chemical knockdown, 1 fe-
male 20.X.2009, 2 males 27.X.2009, 1 male
7.X.2009 leg. 1st. Ent. SS (ISE).
Palliduphantes angustiformis (Simon, 1884)
Chorotype. Sardo-Corsican endemic.
References. (9) Simon, 1884; (13) Gameri,
1902; (17) Simon, 1929; (41) Brignoli, 1971c; (52)
Puddu & Pirodda, 1974; (64) Brignoli, 1979d; (84)
Pesarini, 1994 (all sub Leptyphantes angustiformis );
(132) Pantini & Sassu, 2009; (139) Trotta, 2011.
Province. (17); (84); Carbonia-Iglesias (41, 52,
64, 139); Medio Campidano (ined.); Nuoro (ined.);
Sassari (9, 13, 64, 132, ined.).
Habitat. Hypogean habitat (41, 52, 64); cherry-
orchard (ined.); garrigue (ined.); mediterranean
34
P. Pantini, A. Sassu & G. Serra
maquis (ined.); hazelnut- orchard (ined.); walnut-
orchard (ined.); alder-grove (ined.); mining land-
fills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 male and 2 females 19.V-4.VI.2009
(MBG), 2 females 29.VI-14.VII.2009, 1 female 4-
16.VI.2009, 1 female 22.IX-6.X.2009, 1 male 6-
20.X.2009; m 170, mining landfills covered by
pioneer plants, 1 female 22.IX-6.X.2009 (ISE) (all
pitfall traps and leg. Sassu A., Verdinelli M.). Guspini .
Montevecchio, Piccalinna, m 225, mining landfills
covered by pioneer plants, 1 female 5-18.V.2009, 1
male 8-22.IX.2009, 1 male 6-20.X.2009, m 235; gar-
rigue, 2 femals 22.IX-6.X.2009; m 260, mediter-
ranean maquis, 1 female 21.IV-5.V.2009, 3 females
18.V-3.VI.2009, 2 females 5-18.V.2009, 1 female 15-
30.VI.2009, 1 male, 1 female 13-27.VII.2009, 1 fe-
male 22.IX-6.X.2009 (ISE) (all pitfall traps and leg.
Sassu A., Verdinelli M.).
NUORO: Belvi, Antonitzo, m 683, cherry-or-
chard, 1 male and 2 females 16-23.V.2007 (ISE);
Canale e' Figu, m 576, walnut-orchard, pitfall traps,
4 females 16-23.V.2007, 1 female 19-26.XI.2007
(ISE); Mannaritzo, m 706, cherry-orchard, 3 females
16-23.V.2007, 2 males and 1 female 21-28.VI.2007,
1 female 4-1 1.X.2007, 1 male 19-26.XI.2007 (ISE);
Su Enazzu, m 550, hazelnut-orchard, 1 female
27.VII-8.VIII.2006, 1 female 8-24.VIII.2006, 1
male 21.IX-5.X.2006, 1 female 8.1-2 1 .11.2007, 1
male and 3 females 30.V-4.VII.2007 (MBG), 1 male
and 2 females 30.V-4.VII.2007 (ISE) (all pitfall
traps and leg. I.S.E.). Fonni . Gennargentu, mountain
refuge, m 1550, alder-grove, pitfall traps, 1 female
5-19.VI.2007 leg. Fiori F. (ISE). Tonara . Su Azzime,
m 682, walnut-orchard, pitfall traps, 2 males 11-
18.IV.2007, 1 male, 3 females 21-28.VI.2007, 2
males and 1 female 24-30. VIII. 2007, 1 male 19-
26.XI.2007, 1 female 1 1 .1- 1 8.1.2008, 1 female 22-
29.11.2008 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Olbia . Isola Molarotto, 1 fe-
male 23.III. 1966 leg. Gmppo Isole C.N.R. (MBG).
Pelecopsis bucephala (O.P. -Cambridge, 1875)
Chorotype. W-Mediterranean.
References. (116) Helsdingen, 2005.
Province. Ogliastra (116).
Habitat. Wasteland plot (116).
Pelecopsis elongata (Wider, 1834)
Chorotype. European.
References. (127) Lorn et al., 2008.
Province. (127); Nuoro (ined.).
Habitat. Cherry-orchard (ined.); hazelnut-or-
chard (127, ined.); walnut-orchard (ined.).
Examined material. NUORO: Belvi . Anto-
nitzd, m 683, cheny-orchard, bark traps, 1 female
4.X-26.XI.2007 (ISE); Canale e' Figu, m 576, wal-
nut-orchard, bark traps, 1 female 19-26.XI.2007, 1
female 11-18.1.2008 (ISE); Su Ajone, m 585, hazel-
nut-orchard, beating tray, 1 female 4.V.2005 (ISE);
Su Enazzu, m 550, hazelnut-orchard, pitfall traps,
1 male 21.IX.2006-8.I.2007 (ISE) (all leg. I.S.E.).
Tonara . Su Azzime, m 682, walnut- orchard, bark
traps, 1 female 18-26. IV.2007, 1 female 11-
18.IV.2007 leg. I.S.E. (ISE).
Pelecopsis inedita (O.P.-Cambridge, 1875)
Chorotype. Mediterranean.
References. (127) Lorn et al., 2008; (132) Pan-
tini & Sassu, 2009.
Province. (127); Cagliari (ined.); Nuoro (ined.);
Sassari (132, ined.).
Habitat. Citrus-grove (ined.); cherry- orchard
(ined.); hazelnut-orchard (127, ined.); olive-grove
(ined.); pinewood (ined.).
Examined material. CAGLIARI: Uta, S’Ap-
passiu, Agris farm, citrus-grove, beating tray, 1 fe-
male 23.XI.2000, 2 males 4.XII.2000 leg. CRAS
(ISE).
NUORO: Belvi . Antonitzo, m 683, cherry-or-
chard, 1 male 19-26.XI.2007 (ISE); Mannaritzo, m
706, cherry- orchard, 2 males and 3 females, 18-
26.IV.2007, 4 males, 4 females 16-23.V.2007, 1
male and 2 females 16-23.V.2007, 2 females 21-
28.VI.2007 (ISE); Su Enazzu, m 550, hazelnut-or-
chard, 1 male 21.II-19.III.2007 (ISE), 1 male
21. 11-19. III. 2007 (MBG) (all pitfall traps and leg.
I.S.E.). Tiana, m 522, hazelnut-orchard, beating
tray, 1 female 4.V.2005 leg. I.S.E. (ISE).
SASSARI: Alghero . Porto Conte, m 35, pine-
wood, emergence cages, 1 female 13.IV.2009, 2 fe-
males 15.V.2009, leg. 1st. Ent. SS (ISE);
Mamuntanas, olive-grove, chemical knockdown, 1
female 21. VIII. 2009, 2 males and 1 female
Catalogue of the spiders (Arachnida Araneae) of Sardinia
35
6.IX.2009, 1 female 7.IX.2009, 1 male and 3 fe-
males 30.IX.2009 leg. 1st. Ent. SS (ISE).
Pelecopsis mengei (Simon, 1884)
Chorotype. Palearctic.
References. (132) Pantini & Sassu, 2009.
Province. Sassari (132, ined.).
Habitat. Orchard (ined.).
Examined material. SASSARI: Sorso, Pianu
Mannu, Nali farm, orchard, pitfall traps, 1 male and
1 female 1 1-1 8.III. 1998 leg. 1st. Ent. SS (ISE).
Pityohyphantes phrygianus (C.L. Koch, 1836)
Chorotype. Asiatic-European.
References. (10) Costa, 1885 (sub Linyphia
phrygiana ).
Province. Carbonia-Iglesias (10); Sassari (10).
*Pocadicnemis juncea Locket et Millidge, 1953
Chorotype. Asiatic-European.
Habitat. Hazelnut-orchard (ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1
male 30.V-4.VII.2007 leg. I.S.E. (ISE).
Porrhomma convexum (Westring, 1851)
Chorotype. Palearctic.
References. (64) Brignoli, 1979d.
Province. Nuoro (64).
Habitat. Hypogean habitat (64).
Prinerigone vagans (Audouin, 1826)
Chorotype. Palearctic.
References. (13) Garneri, 1902 (sub Erigone
vagans ); (84) Pesarini, 1994 (sub Erigone vagans ).
Province. (84); Cagliari (ined.); Medio-Campi-
dano (ined.); Nuoro (ined.); Ogliastra (13).
Habitat. Citrus-grove (ined.); hazelnut-orchard
(ined.); alder-grove (ined.); mining landfills cov-
ered by pioneer plants (ined.).
Examined material. CAGLIARI: Uta, S’Ap-
passiu, Agris farm, citrus-grove, beating tray, 1
male 14.XII.2000 leg. CRAS (ISE).
MEDIO CAMPIDANO: Guspini . Montevec-
chio, Piccalinna, m 225, mining landfills covered
by pioneer plants, pitfall traps, 1 male 18.V-
3.VI.2009 leg. Sassu A., Verdinelli M. (ISE).
NUORO: Belvi . Su Enazzu, m 550, hazelnut-
orchard, pitfall traps, 3 males 30.V-4. VII. 2007
(MBG), 2 males 30.V-4.VII.2007 (ISE) (all leg.
I.S.E. ). Fonni, Gennargentu, mountain refuge, m
1550, alder-grove, pitfall traps, 1 male 19. VI-
1. VII. 2007 leg. Fiori F. (ISE).
Sintula retroversus (O.P.- Cambridge, 1875)
Chorotype. Turano-European.
References. (64) Brignoli, 1979d.
Province. Nuoro (ined.); Ogliastra (64); Olbia-
Tempio (ined.).
Habitat. Hypogean habitat (64); cherry-or-
chard (ined.); hazelnut-orchard (ined.); walnut-or-
chard (ined.).
Examined material. NUORO: Belvi . Antonitzo,
m683, cherry-orchard, 2 males 19-26.XI.2007, 1 fe-
male 22-29.11.2008 (ISE); Canale e' Figu, m 576,
walnut- orchard, 1 male 26.XI-3.XII.2007, 1 male
19-26.XI.2007, 1 male 1 1 .1- 1 8.1.2008, 1 male 22-
29.11.2008 (ISE); Mannaritzo, m 706, cherry-or-
chard, 1 female 11-18.IV.2007 (ISE); Su Enazzu, m
550, hazelnut-orchard, 1 female 21. II- 19. III. 2007
(ISE) (all pitfall traps and leg. I.S.E.). Tonara, Su
Azzime, m 682, walnut-orchard, pitfall traps, 3
males 19-26.XI.2007 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Monte Limbara, Punta Bali-
steri, m 1310, 1 female 10.XII.2004 leg. Lodovici
O., Pantini P. (MBG).
*Syedra nigrotibialis Simon, 1884
Chorotype. Tyrrhenian endemic.
Habitat. Walnut-orchard (ined.); under Junipe-
rus sp. (ined.).
Examined material. NUORO: Belvi . Canale e'
Figu, m 576, walnut-orchard, 1 female 21-
28.VI.2007, 1 female 17-24.VII.2007 leg. I.S.E.
(MBG). Desulo, Gennargentu, mountain refuge, m
1500, alder-grove, 1 female 17-23.VIII.2006 (ISE);
under Juniperus sp., 2 females 2- 17. VIII. 2006
(ISE), 1 male 9-15.1.2007 (MBG) (all pitfall traps
and leg. Fiori F.).
36
P. Pantini, A. Sassu & G. Serra
Tenuiphantes flavipes (Blackwall, 1854)
Chorotype. Palearctic.
References. (127) Lorn et al., 2008.
Province. (127); Nuoro (ined.).
Habitat. Cherry-orchard (ined.); hazelnut-or-
chard (127, ined.); under Juniperus sp. (ined.).
Examined material. NUORO: Belvh Anto-
nitzo, m 683, cherry-orchard, pitfall traps, 1 male
16-23.V.2007 leg. I.S.E. (MBG); SuEnazzu, m 550,
hazelnut-orchard, beating tray, 1 male 4. V.2005 leg.
I.S.E. (ISE). Desulo, Gennargentu, mountain re-
fuge, m 1500, under Juniperus sp., pitfall traps, 1
female 10-24.V.2007 leg. Fiori F. (ISE).
Tenuiphantes herbicola (Simon, 1884)
Chorotype. Mediterranean.
References. (132) Pantini & Sassu, 2009.
Province. Medio Campidano (ined.); Nuoro
(ined.); Sassari (132).
Habitat. Mediterranean maquis (ined.); hazel-
nut-orchard (ined.); walnut- orchard (ined.); alder-
grove (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, pitfall traps, 1 male and 1 female 7-
21.IV.2009 (MBG), 2 females 21.IV-5.V.2009, 2
females 7-21.IV.2009, 1 female 5-19.V.2009, 2
males, 3 females and 1 juv. 19.V-4.VI.2009, 1 fe-
male 4-16.VI.2009, 2 females 16-29.VI.2009, 1
female 29.VI-14.VII.2009, 1 female 28.VII-
10.VIII.2009, 1 male 10-25.VIII.2009, 1 female
22.IX-6.X.2009, 1 male and 1 female 8-22.IX.2009
leg. Sassu A., Verdinelli M. (ISE). Guspini . Monte-
vecchio, Piccalinna, m 260, mediterranean maquis,
pitfall traps, 2 females 7-21.IV.2009, 2 females
18. V-3.VI.2009, 1 male and 1 female 15-
30.VI.2009, 3 females 30.VI-13.VII.2009, 2 males
8-22.IX.2009, 2 females 22.IX-6.X.2009 leg. Sassu
A., Verdinelli M. (ISE).
NUORO: Belvh Su Enazzu, m 550, hazelnut-or-
chard, pitfall traps, 1 female 5-16.X.2006 (ISE), 1
female 8.1-21. 11.2007 (MBG) (all leg. I.S.E.).
Fonni, Gennargentu, mountain refuge, m 1550,
alder- grove, pitfall traps, 1 female 19. VII-
2. VIII. 2006, 1 female 17-30.VIII.2006, 1 female
19. VI-1.VII.2007 leg. Fiori F. (ISE). Tonara . Su Az-
zime, m 682, walnut-orchard, pitfall traps, 1 female
11-18.1.2008 leg. I.S.E. (ISE).
Tenuiphantes mengei (Kulczynski, 1887)
Chorotype. Palearctic.
References. (114) Grill et al., 2005 (sub Lep-
thyphantes mengei).
Province. (114).
Habitat. Low shurbs (114).
Tenuiphantes tenebricola (Wider, 1834)
Chorotype. Sibero-European.
References. (13) Garneri, 1902 (sub Lepty-
phantes tenebricola).
Province. Cagliari (13).
Tenuiphantes tenuis (Blackwall, 1852)
Chorotype. Turano-European.
References. (94) Amo et al., 1998 (sub Lepthy-
phantes tenuis); (127) Lom et al., 2008; (132) Pan-
tini & Sassu, 2009.
Province. (127); Cagliari (ined.); Medio-Cam-
pidano (ined.); Nuoro (ined.); Olbia-Tempio (ined.);
Sassari (94, 132, ined.).
Habitat. Citrus-grove (ined.); avenue of lime
trees (94); cherry-orchard (ined.); orchard (ined.);
mediterranean maquis (ined.); hazelnut-orchard
(127, ined.); walnut- orchard (ined.); olive-grove
(ined.); alder-grove (ined.); under Juniperus (ined.);
forest of Quercus suber (ined.); vineyard (ined.).
Examined material. CAGLIARI: Uta, S’Appas-
siu, Agris farm, citms-grove, beating tray, 2 females
19.VI.2000, 1 male 10.VII.2000 leg. GRAS (ISE).
MEDIO CAMPIDANO: Guspini . Monte vecchio,
Piccalinna, m 260, mediterranean maquis, pitfall
traps, 1 female 30. VI-13. VII.2009, 1 male 15-
30.VI.2009, 2 females 3-15.VI.2009 leg. Sassu A.,
Verdinelli M. (ISE).
NUORO: Belyi, Antonitzo, m 683, cherry-or-
chard, pitfall traps, 1 female 18-26.IV.2007, 1 male
and 1 female 11-18.IV.2007, 1 female 16-23.V.2007
(ISE); Canale e' Figu, m 576, walnut-orchard, pitfall
traps, 1 female 27.IX-4.X.2007 (ISE); Mannaritzo, m
706, cherry-orchard, pitfall traps, 2 males and 1 fe-
male 16-23.V.2007 (ISE); Su Ajone, m 585, hazelnut-
orchard, beating tray, 1 female 19. V.2005, 2 females
29.VI.2005, 1 female 16.VI.2005 (MBG); SuEnazzu,
m 550, hazelnut-orchard, beating tray, 1 female and
Catalogue of the spiders (Arachnida Araneae) of Sardinia
37
2 juv. 16.VI.2005, 3 females and 1 juv. 29.VI.2005
(MBG); hazelnut-orchard, pitfall traps, 1 female
27.VII-8.VIII.2006, 1 female 8-24.VIII.2006, 1 fe-
male 24. VIII-5.IX.2006, 1 female 21.IX-5.X.2006, 2
females 8. 1-21. 11.2007, 1 male and 2 females 21.11-
19.III.2007, 1 male and 1 female 19.III-26.IV.2007,
4 females 26.IV-30.V.2007, 3 males, 13 females and
1 juv. 30.V-4.VII.2007, 4 females and 1 juv. 30.V-
4. VII. 2007 (ISE) (all leg. I.S.E.). Desulo . Gennar-
gentu, mountain refuge, m 1500, under Juniperus sp.,
3 males and 1 female 10-24.V.2007, alder-grove, 1
male and 2 females 10-24.V.2007 (ISE) (all pitfall
traps and leg. Fiori F.). Fonni . Gennargentu, mountain
refuge, m 1550, alder-grove, 1 female, 30. VIII-
12.IX.2006, 11 males and 1 female 5-19.VI.2007, 2
males and 1 female 19.VI-1.VII.2007 (ISE), under
Juniperus sp., 1 female, 2-17.VIII.2006, 3 males and
3 females 5-19.VI.2007, 4 males and 2 females
19.VI-1.VII.2007 (ISE) (all pitfall traps and leg. Fiori
F.). Tiana, m 522, hazelnut-orchard, beating tray, 1
male 16.VI.2005 leg. I.S.E. (ISE). Tonara . Su Az-
zime, m 682, walnut-orchard, pitfall traps, 1 female
11-18.IV.2007, 1 male and 2 females 21-28.VI.2007,
1 female 24-30.VIII.2007, 1 male 17.VIII.2007-
24.VIII.2007, 1 female 19-26.XI.2007, 1 female 22-
29.11.2008 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Budduso . near Nuraghe Lo-
elle, forest of Quercus suber, beating tray, 1 male
31.V.1999, 1 female 28.VI.1999 leg. 1st. Ent. SS
(ISE)._Otbia, Isola Tavolara, macchia alta Nord, 1
female 4.XI.1965 leg. Gruppo Isole C.N.R. (MBG).
S AS SARI: Sassari . Gioscari, olive-grove, che-
mical knockdown, 2 females 22. IX. 2008 leg. 1st.
Ent. SS (ISE). Sorso, Pianu Mannu, Nali farm,
olive-grove, beating tray, 1 female 13.V.1993 (ISE);
orchard, beating tray, 1 female 18.III.1998 (ISE);
orchard, pitfall traps, 2 males 1 1- 1 8.III. 1 998 (ISE)
(all leg. Ist.Ent.SS). Torralba . vineyard, 1 mal,
l.VII. 1995 leg. 1st. Ent. SS (ISE).
Tenuiphantes zimmermanni (Bertaku, 1884)
Chorotype. European.
References. (139) Trotta, 2011.
Province. Carbonia-Iglesias (139).
Tiso vagans (Blackwall, 1834)
Chorotype. European.
References. (127) Lorn et al., 2008.
Province. (127); Nuoro (ined.).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Belvi, Su Enazzu,
m 550, hazelnut-orchard, beating tray, 1 female
4.V.2005 (MBG); m 550, hazelnut-orchard, pitfall
traps, 4 females 13-27.VII.2006 (ISE), 1 female
27.VII-8.VIII.2006, 5 females 13-27.VII.2006, 1
male and 1 female, 24.VIII-5.IX.2006, 1 female 8-
24. VIII. 2006, 2 males and 2 females 16-31.X.2006
(MBG), 2 males 16-31.X.2006 (ISE), 1 female 5-
16.X.2006, 1 male and 2 females 2 1. XI. 2006-
8.1.2007, 9 males and 1 female, 8. 1-21. 11.2007, 9
males 21.II-19.III.2007, 3 females 19.III-26.IV.2007,
6 males and 2 females, 26.IV-30. V.2007, 3 males and
51 females 30.V-4.VII.2007 (MBG) (all leg. I.S.E.).
Typhochrestus sardus Bosmans, 2008
Chorotype. Sardinian endemic.
References. (125) Bosmans, 2008.
Province. Cagliari (125).
Habitat. In litter (125).
*Walckenaeria antica (Wider, 1834)
Chorotype. Asiatic-European.
Habitat. Hazelnut-orchard (ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-
male 27.VII-8.VIII.2006 (MBG), 1 female 30.V-
4. VII. 2007 (ISE) (all leg. I.S.E.).
*Walckenaeria stylifrons (O.P. -Cambridge, 1875)
Chorotype. S-European.
Habitat. Cherry-orchard (ined.).
Examined material. NUORO: Belvi . Anto-
nitzo, m 683, cherry-orchard, pitfall traps, 1 male
22-29.11.2008 leg. I.S.E. (ISE).
Family TETRAGNATHIDAE
Meta bourneti Simon, 1922
Chorotype. European.
References. (34) Dresco & Hubert, 1969; (41)
38
P. Pantini, A. Sassu & G. Serra
Brignoli, 1971c; (45) Sanna et al., 1972; (46) Ther-
mes, 1972; (64) Brignoli, 1979d; (69) Cannas,
1972; (84) Pesarini, 1994; (105) Grafitti, 2003;
(119) Lana et al., 2006; (121) Grafitti, 2007a; (122)
Grafitti, 2007b; (126) Grafitti & Merella, 2008.
Province. (84); Cagliari (46, 69); Carbonia-
Iglesias (41, 45, 46, 64, 105, 119, 126); Nuoro (34,
41); Ogliastra (34, 46); Oristano (122); Sassari (41,
121, ined.).
Habitat. Hypogean habitat (34, 41, 45, 46, 64,
69, 105, 119, 121, 126).
Examined material. SASSARI: Sassari . La
Corte, 1 female 23.XI.2003 (ISE).
Meta menardi (Latreille, 1804)
Chorotype. Palearctic.
References. (38) Puddu, 1970.
Province. Ogliastra (38).
Habitat. Hypogean habitat (38).
Metellina mengei (Blackwall, 1870)
Chorotype. European.
References. (64) Brignoli, 1979d (sub Meta
mengei)', (139) Trotta, 2011.
Province. Carbonia-Iglesias (64, 139).
Habitat. Hypogean habitat (64).
Metellina merianae (Scopoli, 1763)
Chorotype. European.
References. (8) Costa, 1884 (sub Meta meria-
nae ); (13) Gameri, 1902 (sub Meta Merianae)', (14)
Gozo, 1908 (sub Meta merianae)', (19) Roewer,
1953 (sub Meta merianae)', (22) Roewer, 1956 (sub
Meta merianae)', (30) Cerruti, 1968 (sub Meta me-
rianae)', (34) Dresco & Hubert, 1969 (sub Meta
merianae)', (38) Puddu, 1970 (sub Meta merianae)',
(41) Brignoli, 1971c (sub Meta merianae)', (44)
Casale, 1972 (sub Meta merianae)', (46) Thermes,
1972 (sub Meta merianae)', (47) Bartolo et al.,
1973 (sub Meta merianae)', (64) Brignoli, 1979d
(sub Meta merianae)', (65) Grafitti, 1979 (sub Meta
merianae ); (69) Cannas, 1972 (sub Meta boumeti
merianae)', (75) Grafitti, 1984 (sub Meta meria-
nae)', (82) Grafitti, 1993 (sub Meta merianae)', (83)
Pons, 1993 (sub Meta merianae)', (84) Pesarini,
1994 (sub Meta merianae)', (121) Grafitti, 2007a
(sub Meta merianae)', (126) Grafitti & Merella,
2008; (139) Trotta, 2011.
Province. (13, 84); Cagliari (13, 46, 69); Carbo-
nia-Iglesias (14, 41, 46, 47, 64, 83, 126, 139); Nuoro
(22, 34, 41, 44, 64, 83); Ogliastra (13, 38, 41, 46);
Sassari (8, 13, 14, 19, 30, 41, 65, 75, 82, 121, 139).
Habitat. Hypogean habitat (14, 19, 22, 30, 34,
38, 41, 44, 46, 47, 64, 65, 69, 75, 82, 83, 121, 126).
Examined material. NUORO: Dorgali . Cave
Su Anzu, 1 male VII. 1983 leg. Giachino P.M.
(MBG).
Metellina segmentata (Clerck, 1757)
Chorotype. Holarctic.
References. (8) Costa, 1884 (sub Meta segmen-
tata)', (13) Garneri, 1902 (sub Meta segmentata)',
(19) Roewer, 1953 (sub Meta segmentata); (30) Cer-
ruti, 1968 (sub Meta segmentata); (46) Thermes,
1972 (sub Meta segmentata); (84) Pesarini, 1994
(sub Meta segmentata); (127) Lom et al., 2008.
Province. (84, 127); Cagliari (8, 13); Nuoro
(ined.); Ogliastra (46); Sassari (19, 30, ined.).
Habitat. Hypogean habitat (19, 30, 46); hazel-
nut-orchard (127, ined.); olive-grove (ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, beating tray, 1 female,
21.IX.2005 (MBG), 1 female, 21.IX.2005 (ISE) (all
leg. I.S.E.). Tiana, m 522, hazelnut- orchard, beating
tray, 1 male 4.X.2005 leg. I.S.E. (ISE).
SASSARI: Sorso . Pianu Mannu, Nali farm,
olive-grove, beating tray, 1 male 18.III.1994 leg. 1st.
Ent. SS (ISE).
Pachygnatha clercki Sundevall, 1 823
Chorotype. Holarctic.
References. (10) Costa, 1885; (13) Gameri, 1902.
Province. Cagliari (13); Oristano (10); Sassari (10).
Pachygnatha degeeri Sundevall, 1830
Chorotype. Palearctic.
References. (10) Costa, 1885.
Province. Nuoro (ined.); Sassari (10, ined.).
Habitat. Hazelnut-orchard (ined.).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
39
Examined material. NUORO: Belyi, Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 3 fe-
males 13-27.VII.2006, 1 male and 3 females,
24. VIII-5.IX.2006, 2 males 8-24.Vm.2006, 1 fe-
male 5-16.X.2006, 1 female 8.I-21.II.2007 (MBG),
1 male and 3 females, 21 .11-1 9.III.2007 (ISE), 1
male and 2 females, 21.II-19.III.2007, 1 male and 2
juv. 19.III-26.IV.2007, 3 females 26.IV-30.V.2007,
2 females 30.V-4.VI.2007 (MBG) (all leg. I.S.E.).
OLBIA-TEMPIO: Olbia . Isola Molara, 1 male
13.VI.1967 leg. Gruppo Isole C.N.R. (MBG).
Tetragnatha externa (Linnaeus, 1758)
Chorotype. Holarctic.
References. (6) Magretti, 1880; (7a) Costa,
1882; (8) Costa, 1884; (13) Gameri, 1902; (84) Pe-
sarini, 1994; (133) Trotta, 2009.
Province. (84); Cagliari (13); Ogliastra (13);
Olbia-Tempio (133); Oristano (6, 13); Orista-
no/Nuoro (7a, 8).
Tetragnatha intermedia Kulczynski, 1891
Chorotype. S-European.
References. (136) Wunderlich, 2011.
Province. (136); Cagliari (ined.); Sassari (ined.).
Habitat. Between rocks (136); citrus -grove
(ined.); orchard (ined.); olive-grove (ined.).
Examined material. CAGLIARI: Uta, S’Ap-
passiu, Agris farm, citrus-grove, 1 male 21.IX.2005
leg. CRAS (MBG).
SASSARI: Sorso, Pianu Mannu, Nali farm,
olive-grove, 1 male 21. V. 1993 (ISE); olive-grove,
beating tray, 1 male 18.VI.1993, 4 males, 1 female
and 1 juv. 3. VI. 1993, 3 males and 2 juv.
25. VI.1993, 1 male and 1 female, 9.VII.1993, 1
male 26.VIII.1993, 1 male and 6 juv. 6.VIII.1993,
1 male 19.VIII.1993 (ISE); orchard, beating tray, 1
male 3 l.VII. 1997 (ISE) (all leg. 1st. Ent. SS).
Tetragnatha montana Simon, 1874
Chorotype. Palearctic.
References. (13) Gameri, 1902; (127) Lom et
al., 2008.
Province. (127); Cagliari (13); Nuoro (ined.);
Ogliastra (13); Olbia-Tempio (ined.); Oristano (13);
Sassari (ined.).
Habitat. Hazelnut-orchard (127, ined.); olive-
grove (ined.).
Examined material. NUORO: Belvi . Scala Ce-
rasia, m 660, 1 male, 1 female 21.V.2008 leg. Pan-
taleoni R.A. (ISE); Su Ajone, m 585,
hazelnut-orchard, beating tray, 1 male 29.VI.2005
(ISE), 1 male and 8 juv. 29.VI.2005 (MBG), 1 fe-
male 1. VI. 2005 leg. I.S.E. (ISE) (all leg I.S.E.).
OLBIA-TEMPIO: Telti . Rio Almiddina, 1 male
20.V.2008 leg. Sassu A. (ISE).
SASSARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 2 males and 1 juv. 6. VIII.2008,
2 males 21.VIII.2009 leg. 1st. Ent. SS (ISE).
Tetragnatha nitens (Audouin, 1 826)
Chorotype. Cosmopolitan.
References. (13) Garneri, 1902; (84) Pesa-
rini, 1994.
Province. (84); Cagliari (13); Carbonia-Iglesias
(13); Ogliastra (13).
Remarks on family Tetragnathidae. Tetra-
gnatha chrysochlora (Audouin, 1 826) cited by de
Carlini (1885) and Garneri (1902) is an unknown
species in our fauna, the citations should be linked
to one of the cited species.
FAMILY ARANEIDAE
Aculepeira armida (Audouin, 1 826)
Chorotype. Asiatic-European.
References. (10) Costa, 1885 (sub Epeira ar-
mida); (11) de Carlini, 1885 (sub Epeira armida );
(13) Garneri, 1902 (sub Epeira armida); (63) Bri-
gnoli, 1979c; (84) Pesarini, 1994.
Province. (63, 84); Carbonia-Iglesias (11, 13);
Oristano (10); Sassari (ined.).
Examined material. SASSARI: Sassari . Monte
Bianchinu, 1 female 24.VI.2008 leg. Cossu S. (ISE).
Aculepeira ceropegia (Walckenaer, 1802)
Chorotype. Palearctic.
References. (10) Costa, 1885 (sub Epeira ce-
ropegia); (63) Brignoli, 1979c; (84) Pesarini, 1994.
40
P. Pantini, A. Sassu & G. Serra
Province. (10, 63, 84); Nuoro (ined.).
Habitat. Grassland (ined.).
Examined material. NUORO: Bolotana . Badde
'e Salighes, m 850, grassland, 1 male and 3 females
27.V.2006 leg. Sassu A. (ISE).
Agalenatea redii (Scopoli, 1763)
Chorotype. Palearctic.
References. (10) Costa, 1885 (sub Epeira
Redii); (11) de Carlini, 1885 (sub Epeira redii); (13)
Garneri, 1902 (sub Epeira Redii); (63) Brignoli,
1979c; (84) Pesarini, 1994; (132) Pantini & Sassu,
2009; (139) Trotta, 2011.
Province. (84); Cagliari (10, 13, 63); Carbonia-
Iglesias (11, 13, 139); Medio Campidano (139);
Ogliastra (13, 63, 139); Olbia-Tempio (ined.); Ori-
stano (10, 13); Sassari (132).
Examined material. OLBIA-TEMPIO: Olbia .
Isola Tavolara, high plateau, 1 male 27.IV. 1966 leg.
Gruppo Isole CNR (MBG).
Araneus diadematus Clerck, 1757
Chorotype. Holarctic.
References. (8) Costa, 1884 (sub Epeira dia-
demata); (13) Garneri, 1902 (sub Epeira diade-
mata); (63) Brignoli, 1979c; (84) Pesarini, 1994;
(139) Trotta, 2011.
Province. (8, 84); Cagliari (13); Carbonia-Igle-
sias (139); Ogliastra (63); Sassari (ined.).
Habitat. Vineyard (ined.).
Examined material. SASSARI: Sorso . Lu Tu-
varaggiu, m 25, 1 female 24.XI.2009 leg. Lorn L.
(ISE). Torralba . vineyard, 1 male 15.X.1994 leg. 1st.
Ent. SS (ISE).
* Araneus marmoreus Clerck, 1757
Chorotype. Holarctic.
Habitat. Orchard (ined.).
Examined material. SASSARI: Sorso . Pianu
Mannu, Nali farm, orchard, beating tray, 1 male
26.VI.1997 leg. 1st. Ent. SS (ISE).
* Araneus quadratus Clerck, 1757
Chorotype. Palearctic.
Examined material. NUORO: Belyi, Scala
Cerasia, m 660, 1 male 28.VIII.2000 leg. Molinu
A. (ISE).
Araniella alpica (L. Koch, 1869)
Chorotype. European.
References. (13) Garneri, 1902 (sub Epeira al-
pica); (84) Pesarini, 1994.
Province. (84); Ogliastra (13).
Araniella cucurbitina (Clerck, 1757)
Chorotype. Palearctic.
References. (8) Costa, 1884 (sub Epeira cur-
cubitina); (13) Garneri, 1902 (sub Epeira cucurbi-
tina); (84) Pesarini, 1994; (114) Grill et al., 2005;
(127) Lorn et al., 2008; (139) Trotta, 2011.
Province. (84, 114, 127); Carbonia-Iglesias (13,
139); Nuoro (8, 13, ined.); Ogliastra (13); Olbia-
Tempio (8, 13); Oristano (8, 13); Sassari (ined.).
Habitat. Low shurbs, grass and shurbland,
shurblands and trees (114); hazelnut-orchard (127,
ined.); grassland (ined.); vineyard (ined.).
Examined material. NUORO: Belvi, Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-
male 1. VI. 2005, 1 male 16.VI.2005 (ISE), 1 male
16.VI.2005 (MBG) (all leg. I.S.E.). Bolotana .
Badde e'Salighes, m 850, grassland, 1 male
27.V.2007 leg. Sassu A. (ISE). Tiana . m 522, hazel-
nut-orchard, beating tray, 1 male 16. VI. 2005, 1
male 1. VI. 2005, 1 female 29. VI. 2005, 1 female
27.VII.2005 leg. I.S.E. (MBG).
SASSARI: Torralba . vineyard, 1 female
8. VII. 1995 leg. 1st. Ent. SS (ISE).
Argiope bruennichi (Scopoli, 1772)
Chorotype. Palearctic.
References. (1) Canestrini & Pavesi, 1868
(sub Nephila fas data); (2a) Canestrini & Pavesi,
1870 (sub Nephila fas data); (3) Pavesi, 1876;
(13) Garneri, 1902; (84) Pesarini, 1994; (133)
Trotta, 2009.
Province. (1, 2a, 84); Cagliari (3, 13); Olbia-
Tempio (133); Oristano (13); Sassari (ined.).
Examined material. SASSARI: Sassari . 1 fe-
male 30.IX.2008 leg. Cabula P. (ISE).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
41
Argiope lobata (Pallas, 1772)
Chorotype. Palearctic.
References. (3) Pavesi, 1876; (5) Pavesi, 1878;
(8) Costa, 1884; (13) Gameri, 1902; (84) Pesarini,
1994; (114) Grill etal., 2005.
Province. (8, 84, 114); Cagliari (13); Carbonia-
Iglesias (3, 13); Nuoro (ined.); Olbia-Tempio (5, 13).
Habitat. Agricultural land (114).
Examined material. NUORO: Siniscola . Monte
Albo, cant, di S. Anna, m 600, 1 female
27.VII.1999 leg. Fontana P. (MBG).
Argiope trifasciata (Forskal, 1775)
Chorotype. Subcosmopolitan.
References. (138) Di Pompeo et al., 2011.
Province. Cagliari (138).
Habitat. Costal areas (138).
Cercidia prominens (Westring, 1851)
Chorotype. Holarctic.
References. (13) Garneri, 1902; (84) Pesa-
rini, 1994.
Province. (84); Cagliari (13).
Cyclosa conica (Pallas, 1772)
Chorotype. Holarctic.
References. (8) Costa, 1884; (13) Garneri,
1902; (84) Pesarini, 1994; (127) Fora et al., 2008.
Province. (84, 127); Cagliari (13); Nuoro
(ined.); Oristano (8, 13).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-
male 4.V.2005 leg. I.S.E. (ISE).
Cyclosa insulana (Costa, 1834)
Chorotype. Afrotropico-Indo-Mediterranean.
References. (3) Pavesi, 1876; (5) Pavesi, 1878
(sub Cyrtophora or Cyclosa insulana)', (7a) Costa,
1882 (sub Epeira insulana ); (8) Costa, 1884 sub Ci-
closa insulana (tritub erco lata Fuc.); (13) Gameri,
1902; (84) Pesarini, 1994; (114) Grill et al., 2005.
Province. (84, 114); Cagliari (3, 13); Carbonia-
Iglesias (7a, 8, 13); Olbia-Tempio (5); Oristano (8,
13); Sassari (ined.).
Habitat. Agricultural land (114); olive-grove
(ined.); on marsh plants (8).
Examined material. SASSARI: Sassari . Gio-
scari, olive-grove, chemical knockdown, 1 female
4.IX.2008, 1 male 6.VIII.2009 leg. 1st. Ent. SS (ISE).
Cyclosa oculata (Walckenaer, 1802)
Chorotype. Asiatic-European.
References. (134) Marras et al., 2011.
Province. (134); Cagliari (ined.).
Habitat. Citms-grove (ined.); orchard (134).
Examined material. CAGLIARI: Uta . S’Ap-
passiu, Agris farm, citms-grove, beating tray, 1 fe-
male, 19. VI. 2000, 2 males and 1 female,
29.VI.2000, 5 males and 4 females 20.VII.2000, 6
males and 1 female 10. VII. 2000, 1 male and 1 fe-
male, 31.VII.2000, 1 female 31.VIII.2000, 2 fe-
males 10. VIII. 2000, 3 males and 1 female
21.VIII.2000, 1 male 21.IX.2000, 1 female
11. IX. 2000, 2 females 4. X. 2000, 1 female
12. X.2000, leg. CRAS (ISE).
Cyclosa sierrae Simon, 1870
Chorotype. Mediterranean.
References. (13) Gameri, 1902; (84) Pesarini,
1994; (139) Trotta, 2011.
Province. (84); Cagliari (13); Carbonia-Iglesias
(139).
Cyrtarachne ixoides (Simon, 1870)
Chorotype. Mediterranean.
References. (129) Colombo & Manunza, 2009.
Province. Cagliari (ined.); Sassari (129, ined.).
Habitat. Citms-grove (ined.); bushes and hed-
ges inside a private garden (129); orchard (ined.);
olive-grove (ined.).
Examined material. CAGLIARI: Uta . S’Ap-
passiu, Agris farm, citms-grove, beating tray, 1 iuv
13. XI.2000 leg. CRAS (ISE).
SASSARI: Sorso, Pianu Mannu, Nali farm,
olive-grove, 1 male l.VII. 1993, 1 male 22.VII.1993
42
P. Pantini, A. Sassu & G. Serra
(ISE); orchard, 1 female 27.V.1998 (ISE) (all bea-
ting tray and leg. 1st. Ent. SS).
Cyrtophora citric ola (Forskal, 1775)
Chorotype. Afrotropico-Indo-Mediterranean.
References. (3) Pavesi, 1876; (7a) Costa, 1882
(sub Epeira cajetana ); (8) Costa, 1884 (sub C.
opuntiae ); (11) de Carlini, 1885; (13) Gameri, 1902
(sub Cyrtaphora citricola ); (84) Pesarini, 1994.
Province. (13, 84); Cagliari (8, 13, ined.); Car-
bonia-Iglesias (3, 11, 13); Oristano (7a, 8, 13).
Habitat. On agaves (8).
Examined material. CAGLIARI: Villasimius .
around the village, 1 female 25.VI.2010 leg. Zuc-
chelli D. (MBG).
Gibbaranea bituberculata (Walckenaer, 1802)
Chorotype. Palearctic.
References. (8) Costa, 1884 (sub Epeira dro-
medaria ); (13) Gameri, 1902 (sub Epeira drome-
daria ); (63) Brignoli, 1979c; (84) Pesarini, 1994;
(139) Trotta, 2011.
Province. (8, 63, 84); Cagliari (13); Carbonia-
Iglesias (139); Ogliastra (13).
Gibbaranea gibbosa (Walckenaer, 1 802)
Chorotype. European.
References. (10) Costa, 1885 (sub Epeira gib-
bosa); (84) Pesarini, 1994; (132) Pantini & Sassu,
2009; (139) Trotta, 2011.
Province. (84); Carbonia-Iglesias (139); Nuoro
(10); Sassari (132).
Gibbaranea omodea (Thorell, 1870)
Chorotype. Sibero-European.
References. (139) Trotta, 2011.
Province. Carbonia-Iglesias (139).
Hypsosinga albovittata (Westring, 1851)
Chorotype. Sibero-European.
References. (10) Costa, 1885 (sub Singa albo-
vittata); (84) Pesarini, 1994.
Province. (84); Oristano (10).
Hypsosinga pygmaea (Sundevall, 1831)
Chorotype. Holarctic.
References. (10) Costa, 1885 (sub Singa pyg-
maea); (84) Pesarini, 1994.
Province. (84); Cagliari (10); Oristano (10).
Hypsosinga sanguinea (C.L. Koch, 1844)
Chorotype. Palearctic.
References. (10) Costa, 1885 (sub Singa san-
guinea).
Province. Carbonia-Iglesias (10).
Larinioides cornutus (Clerck, 1757)
Chorotype. Holarctic.
References. (8) Costa, 1884 (sub Epeira cor-
nuta); (13) Gameri, 1902 (sub Epeira cornuta); (84)
Pesarini, 1994; (139) Trotta, 2011.
Province. (84); Cagliari (8, 13); Oristano (139).
Larinioides patagiatus (Clerck, 1757)
Chorotype. Holarctic.
References. (10) Costa, 1885 (sub Epeira pa-
tagiata ( dumetorum hbn.).); (13) Gameri, 1902 (sub
Epeira patagiata); (84) Pesarini, 1994.
Province. (84); Cagliari (13); Oristano (10, 13).
Larinioides suspicax (O.P. -Cambridge, 1876)
Chorotype. European.
References. (70) Grasshoff, 1983 (sub L. fo-
lium); (116) Helsdingen, 2005.
Province. Nuoro (116); Olbia-Tempio (70).
Habitat. In the centre of the city (116).
Leviellus kochi (Thorell, 1870)
Chorotype. S-European.
References.(41) Brignoli, 1971c (sub Zygiella
kochi); (46) Thermes, 1972 (sub Zygiella kochi);
(52) Puddu & Pirodda, 1974 (sub Zygiella kochi);
(63) Brignoli, 1979c (sub Zygiella kochi); (83)
Pons, 1993 (sub Zygiella kochi); (84) Pesarini, 1994
(sub Zygiella kochi).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
43
Province. (63, 84); Carbonia-Iglesias (41, 46,
52, 83).
Habitat. Hypogean habitat (41, 46, 52, 83).
Mangora acalypha (Walckenaer, 1802)
Chorotype. Palearctic.
References. (10) Costa, 1885 (sub Epeira aca-
lypha ); (13) Gameri, 1902 (sub Epeira acalypha );
(63) Brignoli, 1979c; (84) Pesarini, 1994; (114) Grill
et al., 2005; (127) Lorn et al., 2008; (132) Pantini &
Sassu, 2009; (133) Trotta, 2009; (139) Trotta, 2011.
Province. (84, 114, 127); Cagliari (13, 63); Car-
bonia-Iglesias (10, 13, 139); Medio Campidano
(139); Nuoro (10, 63, ined.); Ogliastra (13, 63);
Olbia-Tempio (10, 133); Oristano (10, 63); Sassari
(63, 132, ined.).
Habitat. Grass and shurbland, shurblands and
trees, agricultural land (114); hazelnut-orchard
(127, ined.).
Examined material. NUORO: Tiana . m 522,
hazelnut-orchard, beating tray, 1 female 16.VI.2005,
1 male 1.VI.2005 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Olbia . Isola Tavolara, macchia
alta, 2 males, 2 females and 11 juv. 24.IV. 1966 leg.
Gruppo Isole CNR (MBG).
SASSARI: Sassari . Platamona, at sea level, 1
male and 1 female 22.V.2008 leg. Sassu A. (ISE).
Neoscona adianta (Walckenaer, 1802)
Chorotype. Palearctic.
References. (5) Pavesi, 1878 (sub Epeira
adianta)', (8) Costa, 1884 (sub Epeira adianta)', (13)
Gameri, 1902 (sub Epeira adianta)', (63) Brignoli,
1979c; (84) Pesarini, 1994; (114) Grill et al., 2005;
(132) Pantini & Sassu, 2009; (139) Trotta, 2011.
Province. (84, 114); Cagliari (13, 63); Carbo-
nia-Iglesias (13, 139); Medio Campidano (139);
Nuoro (63, 139); Ogliastra (63); Olbia-Tempio (5,
13, ined.); Oristano (13, 63); Oristano/Nuoro (8);
Sassari (63, 132, ined.).
Habitat. Low shurbs, grass and shurbland
(114); vineyard (ined.).
Examined material. OLBIA-TEMPIO: Telti . Rio
Almiddina, 1 male 20. V.2008 leg. Sassu A. (ISE).
SASSARI: Torralba . vineyard, 2 juv.
21.V.1994, 1 female and 1 juv. 4.VI.1994, 1 fe-
male 17.VI.1995, 1 male 24.VI.1995 leg. 1st. Ent.
SS (ISE).
Neoscona subfusca (C.L. Koch, 1837)
Chorotype. Turano-European.
References. (10) Costa, 1885 (sub Epeira dal-
matica); (63) Brignoli, 1979c (sub " Araneus " sub-
fuscus); (127) Lom etal., 2008; (139) Trotta, 2011.
Province. (63, 127); Cagliari (10); Carbonia-
Iglesias (139); Nuoro (139, ined.); Olbia-Tempio
(ined.); Sassari (ined.).
Habitat. Hazelnut-orchard (127, ined.); olive-
grove (ined.); forest of Quercus suber (ined.); vine-
yard (ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, beating tray, 1 male
13.VII.2005, leg. I.S.E. (ISE).
OLBIA-TEMPIO: Budduso . near Nuraghe Loelle,
forest of Quercus suber, beating tray, 1 female
16.VII.1999, leg. 1st. Ent. SS (ISE).
SASSARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 1 male, 13.X.2009, leg. 1st.
Ent. SS (ISE). Sorso, Pianu Mannu, Nali farm,
olive-grove, beating tray, 1 male 25.VI.1993, 1 male
l.VII. 1993 leg. 1st. Ent. SS (ISE). Torralba . vine-
yard, 1 female 16.VII.1994, 1 male 2.VII.1994, 1
male 15.VII.1995, leg. 1st. Ent. SS (ISE); vineyard,
beating tray, 1 male 6.VIII.1994 leg. Pirisi (ISE).
Parazygiella montana (C.L. Koch, 1834)
Chorotype. S -European.
References. (13) Gameri, 1902 (sub Zilla Mon-
tana)', (63) Brignoli, 1979c (sub Zygiella Montana)',
(84) Pesarini, 1994 (sub Zygiella Montana).
Province. (63, 84); Nuoro/Ogliastra (13).
Singa hamata (Clerck, 1757)
Chorotype. Palearctic.
References. (13) Gameri, 1902; (63) Brignoli,
1979c; (84) Pesarini, 1994.
Province. (63, 84); Cagliari (13); Carbonia-
Iglesias (13).
Zilla diodia (Walckenaer, 1 802)
Chorotype. Sibero-European.
44
P. Pantini, A. Sassu & G. Serra
References. (10) Costa, 1885 (sub Epeira dioi-
dia ); (13) Gameri, 1902 (sub Epeira diodia ); (63)
Brignoli, 1979c; (84) Pesarini, 1994; (114) Grill et
al., 2005; (127) Lorn et al., 2008.
Province. (84, 114, 127); Cagliari (13, 63); Car-
bonia-Iglesias (10, 13); Nuoro (ined.); Ogliastra
(13); Olbia-Tempio (10); Sassari (ined.).
Habitat. Orchard (ined.); low shrubs (14); ha-
zelnut-orchard (127, ined.).
Examined material. NUORO: Belvh Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1
male 19.V.2005 leg. I.S.E. (ISE).
SASSARI: Sassari . Platamona, at sea level, 1 fe-
male 22.V.2008 leg. Sassu A. (ISE). Sorso . Pianu
Mannu, Nali farm, orchard, beating tray, 1 male
22.IV. 1998 leg. 1st. Ent. SS (ISE).
Zygiella atrica (C.L. Koch, 1845)
Chorotype. European.
References. (10) Costa, 1885 (sub Zilla atrica)-,
(11) de Carlini, 1885 (sub Zilla atrica ); (13) Gar-
neri, 1902 (sub Zilla atrica ); (63) Brignoli, 1979c;
(84) Pesarini, 1994.
Province. (63, 84); Cagliari (10); Carbonia-
Iglesias (11, 13); Ogliastra (13).
Zygiella x-notata (Clerck, 1757)
Chorotype. Holarctic.
References. (13) Gameri, 1902 (sub Zilla x-no-
tata); (41) Brignoli, 1971c; (46) Thermes, 1972;
(63) Brignoli, 1979c; (72) Puddu,1983; (83) Pons,
1993; (84) Pesarini, 1994; (94) Amo et al., 1998;
(127) Lorn et al., 2008; (132) Pantini & Sassu,
2009; (139) Trotta, 2011.
Province. (63, 84, 127); Cagliari (ined.); Car-
bonia-Iglesias (41, 139); Medio Campidano (139);
Nuoro (ined.); Ogliastra (13, 46, 72); Sassari (83,
94, 132, ined.).
Habitat. Citrus-grove (ined.); avenue of lime
trees (94); hypogean habitat (41, 46, 72, 83);
cherry-orchard (ined.); orchard (ined.); inside house
(ined.); in orto (ined.); hazelnut-orchard (127,
ined.); olive-grove (ined.); vineyard (ined.).
Examined material. CAGLIARI: Uta, S’Appas-
siu, Agris farm, citms-grove, beating tray, 2 males
31.VIII.2000, 1 male and 1 female 21.IX.2000, 4 fe-
males 4.X.2000, 1 female 12.X.2000, 6 females
23.X.2000, 1 female 2.XI.2000, 2 females
23.XI.2000, 2 females 4.XII.2000 leg. CRAS (ISE).
NUORO: Belvh Antonitzo, m 683, cherry-or-
chard, 1 female 4.X-26.XI.2007, 1 female 22-
29.11.2008 (ISE); Su Enazzu, m 550,
hazelnut-orchard, 1 female 8- 15. XI. 2004 (MBG)
(all in bark traps and leg. I.S.E.). Tiana . m 522,
hazelnut-orchard, beating tray, 1 female
21.IX.2005, 1 male 4.X.2005, leg. I.S.E. (ISE).
SASSARI: Alghero . inside house, 1 male
21. XII. 1999 leg. Pantaleoni R.A. (ISE); Mamunta-
nas, olive-grove, chemical knockdown, 1 male
6.IX.2009, 1 male 7.X.2009 leg. 1st. Ent. SS (ISE).
OsUo, in a vegetable garden, 1 male 20.X.1999
(ISE). Sassari . Li Punti, Baldinca, m 110, inside
house, 1 female 23.V.2008 leg. Sassu A. (ISE); Lu
Buttangam, olive-grove, chemical knockdown, 1
male 29.IX.2009 leg. 1st. Ent. SS (ISE). Sorso .
Pianu Mannu, Nali farm, orchard, bark traps, 1 fe-
male 2-9.XII.1997 leg. 1st. Ent. SS (ISE). Torralba .
vineyard, 1 male 9.IX.1995, 1 female 7.X.1995 leg.
1st. Ent. SS (ISE); vineyard, beating tray, 2 males
30.IX.1995 leg. Pirisi (ISE).
Remarks on family Araneidae. Sing a ausse-
reri Thorell, 1873 cited by Costa (1884, sub S. ru-
fula ); Garneri (1902, sub S. rufula ); Brignoli
(1979c, sub Hypsosinga aussereri ) e Pesarini (1994,
sub Hypsosinga aussereri) was considered a species
inquirenda by Thaler & Knoflach (2003) and the-
refore excluded from the catalogue. Singa simo-
niana Costa, 1885 described by Costa in the
Campidano Cagliari area is a species inquirenda
(Brignoli, 1979: 27) and therefore excluded from
the catalogue.
Family LYCOSIDAE
Allocosa oculata (Simon, 1876)
Chorotype. W-Mediterranean.
References. (13) Garneri, 1902 (sub Lycosa
oculata).
Province. Oristano (13).
Alopecosa accentuata (Latreille, 1817)
Chorotype. Sibero-European.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
45
References. (13) Gameri, 1902 (sub Lycosa ac-
centuata ); (84) Pesarini, 1994.
Province. (84); Nuoro/Ogliastra (13).
Alopecosa albofasciata (Brulle, 1832)
Chorotype. Turano-Mediterranean.
References. (10) Costa, 1885 [sub Lycosa al-
bofasciata (sagittata K.)]; (13) Gameri, 1902 (sub
Lycosa albofasciata ); (20) Krauss, 1955 (sub Xero-
lycosa albofasciata)', (36) Lugetti & Tongiorgi,
1969; (84) Pesarini, 1994; (132) Pantini & Sassu,
2009; (139) Trotta, 2011.
Province. - (20, 84); Cagliari (10, 13, 36); Car-
bonia-Iglesias (10, 13, 139); Medio-Campidano
(ined.); Nuoro (36, ined.); Nuoro/Ogliastra (36);
Ogliastra (13); Olbia-Tempio (36); Sassari (36, 132).
Habitat. Cherry-orchard (ined.); garrigue
(ined.); mediterranean maquis (ined.); hazelnut-or-
chard (ined.); walnut-orchard (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 male 19.V-4.VI.2009. (ISE); m200, gar-
rigue, 1 male 5-19.V.2009 (ISE) (all pitfall traps
and leg. Sassu A., Verdinelli M.). Guspini . Monte-
vecchio, Piccalinna, m 235, garrigue, pitfall traps,
2 males 21.IV-5.V.2009, 3 males 5-18.V.2009, 1
male and 1 female 18.V-3.VI.2009 leg. Sassu A.,
Verdinelli M. (ISE).
NUORO: Belvi, Antonitzo, m 683, cherry-or-
chard, 1 male 16-23.V.2007 (ISE); Canale e' Figu,
m 576, walnut-orchard, 1 male 26.IV-4.V.2007, 4
males and 1 female 16-23.V.2007, 2 females 21-
28.VI.2007 (ISE); Mannaritzo, m 706, cherry-or-
chard, 3 males and 3 females 18-26.IV.2007, 4
males and 6 females 11-18.IV.2007, 11 males 16-
23.V.2007 (ISE); Su Enazzu, m 550, hazelnut-or-
chard, 6 males and 2 females 19.III-26.IV.2007
(MBG), 2 males and 1 female, 19.III-26.IV.2007
(ISE), 17 males and 1 female, 30.V-4.VII.2007
(MBG) (all pitfall traps and leg. I.S.E.). Tonara, Su
Azzime, m 682, walnut-orchard, pitfall traps, 3
males 16-23.V.2007 leg. I.S.E. (ISE).
Alopecosa fabrilis (Clerck, 1757)
Chorotype. Palearctic.
References. (13) Gameri, 1902 (sub Lycosa fa-
brilis)', (84) Pesarini, 1994.
Province. (84); Cagliari (13); Nuoro (ined.);
Ogliastra (13); Oristano (13).
Habitat. Under Juniperus sp. (ined.).
Examined material. NUORO: Fonni . Gennar-
gentu, mountain refuge, m 1550, under Juniperus
sp., pitfall traps, 1 male 26.IX-10.X.2006 leg.
Fiori F. (ISE).
Alopecosa laciniosa (Simon, 1876)
Chorotype. W-Mediterranean.
References. (13) Gameri, 1902 (sub Lycosa la-
ciniosa)', (84) Pesarini, 1994.
Province. (84); Cagliari (13).
Remarks. The presence of this species in Italy
requires further confirmation as stated by Lugetti &
Tongiorgi (1969: 76).
Alopecosa pulverulenta (Clerck, 1757)
Chorotype. Palearctic.
References. (6) Magretti, 1880 (sub Tarentula
pulverulenta)', (10) Costa, 1885 [sub Lycosa pulve-
rulenta ( cuineata , K.)]; (13) Gameri, 1902 (sub Ly-
cosa pulverulenta)', (84) Pesarini, 1994.
Province. (84); Cagliari (10); Carbonia-Iglesias
(13); Ogliastra (13); Oristano (6, 13).
Arctosa cinerea (Fabricius, 1777)
Chorotype. Palearctic.
References. (8) Costa, 1884 (sub Lycosa cine-
rea); (13) Garneri, 1902 (sub Lycosa cinerea); (20)
Krauss, 1955; (84) Pesarini, 1994; (132) Pantini &
Sassu, 2009.
Province. (8, 20, 84); Cagliari (13); Carbonia-
Iglesias (13); Ogliastra (13); Oristano (13); Sas-
sari (132).
Habitat. Common on the banks of rivers (8).
Arctosa fulvolineata (Lucas, 1846)
Chorotype. European-Mediterranean.
References. (84) Pesarini, 1994.
Province. (84).
Arctosa lacustris (Simon, 1876)
Chorotype. S-European.
46
P. Pantini, A. Sassu & G. Serra
References. (24) Lugetti & Tongiorgi, 1965;
(84) Pesarini, 1994; (139) Trotta, 2011.
Province. (84); Cagliari (24); Medio Campi-
dano (139).
Arctosa leopardus (Sundevall, 1833)
Chorotype. Asiatic-European.
References. (10) Costa, 1885 (sub Lycosa leo-
pardus ); (13) Gameri, 1902 (sub Lycosa leopar-
dus); (20) Krauss, 1955 (sub Megarctosa
leopardus); (24) Lugetti & Tongiorgi, 1965; (84)
Pesarini, 1994.
Province. (20, 24, 84); Cagliari (13);
Cagliari/Oristano (13); Carbonia-Iglesias (10);
Ogliastra (13).
Arctosa perita (Latreille, 1799)
Chorotype. Holarctic.
References. (13) Gameri, 1902 (sub Lycosa pe-
rita); (84) Pesarini, 1994; (117) Buchar et al., 2006.
Province. (84); Cagliari (13); Carbonia-Iglesias
(13); Ogliastra (13); Olbia-Tempio (117).
Arctosa personata (L. Koch, 1872)
Chorotype. Mediterranean.
References. (10) Costa, 1885 (sub Lycosa per-
sonata).
Province. Cagliari (10); Sassari (10).
Arctosa similis Schenkel, 1938
Chorotype. Mediterranean.
References. (117) Buchar et al., 2006; (132)
Pantini & Sassu, 2009; (139) Trotta, 2011.
Province. Cagliari (117); Carbonia-Iglesias
(139); Sassari (132).
Habitat. Riverbank with gravel (117).
Arctosa variana C.L. Koch, 1847
Chorotype. Turano-Mediterranean.
References. (24) Lugetti & Tongiorgi, 1965;
(24) Lugetti & Tongiorgi, 1965 (sub A. perita
latitorax); (84) Pesarini, 1994; (117) Buchar et
al., 2006.
Province. (24, 84); Cagliari (24); Medio Cam-
pidano (117).
Habitat. On muddy shore (117).
Aulonia albimana (Walckenaer, 1805)
Chorotype. European.
References. (13) Gameri, 1902.
Province. Nuoro/Ogliastra (13).
Hogna radiata (Latreille, 1817)
Chorotype. Centralasiatic-European.
References. (3) Pavesi, 1876 (sub Tarentula ra-
diata var. liguriensis); (8) Costa, 1884 (sub Lycosa
radiata); (11) de Carlini, 1885 (sub Tarentula ra-
diata); (13) Gameri, 1902 (sub Lycosa balearica);
(20) Krauss, 1955; (41) Brignoli, 1971c (sub Lycosa
radiata); (84) Pesarini, 1994; (132) Pantini &
Sassu, 2009; (133) Trotta, 2009.
Province. (20, 84); Cagliari (13); Carbonia-
Iglesias (3, 11, 13); Medio-Campidano (ined.);
Nuoro (8, 13, ined.); Olbia-Tempio (13, 41); Ori-
stano (13); Sassari (132, 133, ined.).
Habitat. Hypogean habitat (41); cherry-orchard
(ined.); garrigue (ined.); mediterranean maquis
(ined.); hazelnut- orchard (ined.); walnut- orchard
(ined.); under Juniperus sp. (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 male and 1 female 28.VII-10.VIII.2009,
1 male 10-25. VIII. 2009 (ISE); m 200, garrigue, 1
female 10-25. VIII. 2009 (ISE) (all pitfall traps and
leg. Sassu A., Verdinelli M.). Guspini . Montevec-
chio, Piccalinna, m 235, garrigue, pitfall traps, 1
male 25.VIII-8.IX.2009, 3 males 10-25.VIII.2009
leg. Sassu A., Verdinelli M. (ISE).
NUORO: Belvi, Canale e' Figu, m 576, walnut-
orchard, 1 male 24-30.VIII.2007 (ISE); Mannaritzo,
m 706, cherry-orchard, 1 male 24-30. VIII. 2007
(ISE); Su Enazzu, m 550, hazelnut-orchard, 2 fe-
males 27.VII-8.VIII.2006 (ISE), 1 male, 13-
27.VII.2006, 1 male 27.VII-8.VIII.2006, 2 males
8-24.VIII.2006 (MBG) (all pitfall traps and leg.
I.S.E.). Fonni . Gennargentu, mountain refuge, m
1550, under Juniperus sp., pitfall traps, 1 male
19.VII-2.VIII.2006 leg. Fiori F. (ISE). Tonara . Su
Azzime, m 682, walnut-orchard, pitfall traps, 1 male
and 1 female, 17-24.VII.2007, leg. I.S.E. (ISE).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
47
OLBIA-TEMPIO: Olbia . Isola Tavolara, 1 fe-
male 24.11.1966 leg. Gruppo Isole C.N.R. (MBG).
Lycosa narbonensis Walckenaer, 1806
Chorotype. Mediterranean.
References. (13) Gameri, 1902; (46) Thermes,
1972.
Province. Ogliastra (46); Sassari (13).
Habitat. Hypogean habitat (46).
Pardos a cribrata Simon, 1876
Chorotype. S-European.
References. (26) Tongiorgi, 1966; (84) Pesa-
rini, 1994.
Province. (26, 84).
Pardosa gefsana Roewer, 1959
Chorotype. W-Mediterranean.
References. (26) Tongiorgi, 1966 (sub P. nae-
via ); (80) Tongiorgi & Sola, 1991 (sub P. nigrister-
nis ); (84) Pesarini, 1994.
Province. (84); Cagliari (80); Medio Campi-
dano (26); Oristano (80).
Habitat. Edge of brackish pond (80); salt
marshes (80).
Remarks. The citation of P. naevia around the
Guspini area (Tongiorgi, 1966) is later corrected in
P nigristernis (Tongiorgi & Sola, 1991: 241). Pe-
sarini reports P. naevia in his Checklist maybe be-
cause he was not aware of the publication or maybe
deceived by a printing error. On page 241 Tongiorgi
& Sola’s article states in fact: “A revision of the Ital-
ian Wolf Spiders of the Genus Pardosa by Ton-
giorgi (1966) had assigned, with reserve, three
female specimens of a species collected in Sardinia
to Pardosa naevia . . . thus, our specimens are now
more correctly assigned to the closely related Par-
dosa naevia Denis, 1966 (figure 1).” It seems evident
(even from the subtitle of the figure) that it is actually
assigned to P nigristernis later synonimised with P
gefsana (Alderweireldt & Jocque, 1992)
Pardosa hortensis (Thorell, 1872)
Chorotype. Palearctic.
References. (6) Magretti, 1880 (sub Lycosa
hortensis)', (13) Gameri, 1902.
Province. Cagliari (13); Medio Campidano (6);
Nuoro (ined.); Oristano (6, 13).
Habitat. Alder-grove (ined.); under Juniperus
sp. (ined.).
Examined material. NUORO: Desulo . Gennar-
gentu, mountain refuge, m 1500, alder-grove, pitfall
traps, 2 males 11-25.VII.2006 leg. Fiori F. (ISE).
Fonni . Gennargentu, mountain refuge, m 1550,
under Juniperus sp., pitfall traps, 1 male 19. VI-
1. VII. 2007 leg. Fiori F. (ISE).
Pardosa nigra (C.L. Koch, 1834)
Chorotype. European.
References. (13) Gameri, 1902.
Province. Nuoro/Ogliastra (13).
Pardosa occidentalis Simon, 1881
Chorotype. W-Mediterranean.
References. (53) Tongiorgi, 1974.
Province. Medio Campidano (53).
Pardosa prativaga (L. Koch, 1870)
Chorotype. Sibero-European.
References. (13) Gameri, 1902 (sub P.fervida).
Province. Cagliari (13); Nuoro (ined.).
Habitat. Hazelnut-orchard (ined.).
Examined material. NUORO: Belyi, Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1
male 19.III-26.IV.2007 leg. I.S.E. (ISE).
Pardosa proxima (C.L. Koch, 1847)
Chorotype. Sibero-European.
References. (5) Pavesi, 1878 (sub Lycosa pro-
ximo ); (8) Costa, 1884; (13) Gameri, 1902; (20)
Krauss, 1955; (84) Pesarini, 1994; (132) Pantini &
Sassu, 2009.
Province. (20, 84); Cagliari (8, 13); Carbonia-
Iglesias (13); Medio-Campidano (ined.); Nuoro
(ined.); Olbia-Tempio (5, 13); Sassari (132).
Habitat. Cherry- orchard (ined.); garrigue
(ined.); hazelnut- orchard (ined.); walnut- orchard
(ined.); alder-grove (ined.).
48
P. Pantini, A. Sassu & G. Serra
Examined material. MEDIO CAMPIDANO:
Guspini . Montevecchio, Piccalinna, m 235, gar-
rigue, pitfall traps, 1 male and 1 female 18.V-
3. VI. 2009 leg. Sassu A., Verdinelli M. (ISE).
NUORO: Belyi, Antonitzo, m 683, cherry-or-
chard, 2 males and 2 females, 11-18.IV.2007 (ISE);
Canale e' Figu, m 576, walnut-orchard, 1 female
17-24.VII.2007 (ISE); Mannaritzo, m 706, cherry-
orchard, 1 female 11-18.IV.2007, 6 males and 4 fe-
males 2 1-28. VI. 2007, 3 males and 1 female,
17-24.VII.2007, 1 male 24-30. VIII.2007, 6 males
and 3 females 22-29.11.2008 (ISE); Su Enazzu, m
550, hazelnut-orchard, 3 females 27. VII-
8. VIII. 2006, 1 male and 4 females, 13-
27.VII.2006, 5 males 21.II-19.III.2007, 1 male and
1 female, 19.III-26.IV.2007, 1 male and 3 females,
26.IV-30.V.2007, 1 female 30.V-4.VII.2007
(MBG), 2 males and 3 females, 30.V-4.VII.2007
(ISE) (all pitfall traps and leg. I.S.E.). Fonni, Gen-
nargentu, mountain refuge, m 1550, alder-grove,
pitfall traps, 1 female 19.VII-2.VIII.2006, 1 female
17-30.VIII.2006 leg. Fiori F. (ISE).
Remarks. P. proxima is easily confused with
the similar species P. vlijmi known in France and
recently found in Northern Italy. The separation of
the two species is very clear when considering
courtship displays while from a morphological
point of view, only the males are identifiable (Isaia
in litteris). While awaiting the results of current re-
search, all specimens examined have been assigned
to P. proxima.
Pardosa pullata (Clerck, 1757)
Chorotype. Sibero-European.
References. (13) Gameri, 1902.
Province. Ogliastra (13).
Pardosa tatarica (Thorell, 1875)
Chorotype. Palearctic.
References. (13) Gameri, 1902 (sub P. strigil-
lata ); (26) Tongiorgi, 1966 (sub P. strigillata ); (84)
Pesarini, 1994 (sub Pardosa strigillata).
Province. (84); Cagliari (13, 26); Carbonia-
Iglesias (13); Ogliastra (13); Sassari (26).
Remarks. Buchar & Thaler (2002: 446) consi-
der this species and P. strigillata as synonyms of P.
atomaria.
Pirata knorri (Scopoli, 1763)
Chorotype. Palearctic.
References. (13) Gameri, 1902.
Province. Ogliastra (13).
Pirata latitans (Blackwall, 1841)
Chorotype. European.
References. (13) Garneri, 1902; (139) Trotta,
2011.
Province. Carbonia-Iglesias (139); Nuoro
(ined.); Ogliastra (13).
Habitat. Hazelnut-orchard (ined.).
Examined material. NUORO: Belvi, Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1
male 30.V-4.VII.2007 leg. I.S.E. (ISE).
Pirata piraticus (Clerck, 1757)
Chorotype. Holarctic.
References. (10) Costa, 1885; (13) Gameri,
1902; (20) Krauss, 1955 (sub P. piratica); (139)
Trotta, 2011.
Province. Cagliari (ined.); Carbonia-Iglesias
(13, 139); Oristano (10); Sassari (20).
Examined material. CAGLIARI: Pula , m 715, 1
female 18.VIII.2006 leg. Ruzzante Wilkin J. (MBG).
Pirata piscatorius (Clerck, 1757)
Chorotype. Sibero-European.
References. (10) Costa, 1885; (13) Gameri,
1902.
Province. Cagliari (13); Carbonia-Iglesias (10);
Oristano (13).
*Pirata tenuitarsis Simon, 1876
Chorotype. Asiatic-European.
Habitat. Alder-grove (ined.).
Examined material. NUORO: Desulo, Gennar-
gentu, mountain refuge, m 1500, alder-grove, pitfall
traps, 2 females 11-25.VII.2006, 1 female 25. VII-
9.VIII.2006 leg. Fiori F. (ISE). Fonni . Gennargentu,
mountain refuge, m 1550, alder-grove, pitfall traps,
1 female 17-30.VIII.2006, 1 female 2-17. VIII.2006,
3 males 19.VI-1.VII.2007 leg. Fiori F. (ISE).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
49
Trochosa hispanica Simon, 1870
Chorotype. Turano-Mediterranean.
References. (13) Gameri, 1902 (sub Lycosa ca-
liginosa ); (20) Krauss, 1955; (84) Pesarini, 1994.
Province. (20, 84); Carbonia-Iglesias (13);
Nuoro (ined.).
Habitat. Cherry-orchard (ined.); hazelnut-or-
chard (ined.).
Examined material. NUORO: Belvl Antonitzo,
m683, cherry-orchard, 1 male 11-18.IV.2007, 1 male
18-26.IV.2007 (ISE); Su Enazzu, m 550, hazelnut-or-
chard, 3 males, 1 female and 1 juv. 24.VIII-5.IX.2006
(MBG), 2 males 8-24. VIII.2006 (ISE), 3 males, 1 fe-
male and 1 juv. 5-21.IX.2006, 4 males and 1 juv.
21.IX-5.X.2006, 1 male and 1 female 5-16.X.2006, 1
male 16-31.X.2006, 1 male 21.II-19.III.2007, 71
males and 2 females 19.III-26.IV.2007, 26 males
26.IV-30.V.2007 (MBG), 13 males and 1 female
30.V-4.VII.2007 (ISE), 86 males 30.V-4.VII.2007
(MBG) (all pitfall traps and leg. I.S.E.).
Trochosa ruricola (De Geer, 1778)
Chorotype. Holarctic.
References. (13) Gameri, 1902 (sub Lycosa ru-
ricola).
Province. Cagliari (13); Nuoro/Ogliastra (13);
Oristano (13).
Trochosa terricola Thorell, 1856
Chorotype. Holarctic.
References. (13) Garneri, 1902 (sub Lycosa
terricola ).
Province. Cagliari (13); Cagliari/Oristano (13);
Ogliastra (13).
Xerolycosa nemoralis (Westring, 1861)
Chorotype. Palearctic.
References. (13) Gameri, 1902 (sub Lycosa ne-
moralis).
Province. Cagliari (13); Cagliari/Oristano (13);
Ogliastra (13).
Remarks on family Lycosidae. Pardosa agri-
cola (Thorell, 1856) is cited in Sardinia by Gameri
(1902). The presence of this species in Italy is very
doubtful, Tongiorgi (1966: 284) has never seen Ita-
lian specimens of this species and there have not
been recent reports. It is possible that old reports are
due to mistaken identification of other species of
Pardosa of the monticola group. It was decided
therefore not to include this species in the catalogue.
Family PISAURIDAE
Dolomedes plantarius (Clerck, 1757)
Chorotype. Sibero-European.
References. (20) Krauss, 1955 (sub D. clercki);
(84) Pesarini, 1994.
Province. (84); Sassari (20).
Pisaura mirabilis (Clerck, 1757)
Chorotype. Asiatic-European.
References. (8) Costa, 1884 (sub Ocyale mira-
bilis); (13) Garneri, 1902 (sub Ocyale mirabilis);
(20) Krauss, 1955; (59) Brignoli, 1977; (74) Bri-
gnoli, 1984 (sub "Form A"); (84) Pesarini, 1994;
(127) Lorn et al., 2008; (139) Trotta, 2011.
Province. (13, 20, 84, 127); Cagliari (59, 74);
Carbonia-Iglesias (59, 139); Medio Campidano (59,
139); Nuoro (59, ined.); Ogliastra (59); Olbia-Tem-
pio (59); Oristano/Nuoro (8); Sassari (59, ined.).
Habitat. Orchard (ined.); hazelnut-orchard
(127, ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-
male 16.VI.2005 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Loiri-Porto San Paolo . Porto
S. Paolo, 1 juv. 27.XI.1966 leg. Gruppo Isole
C.N.R. (MBG). Olbia . Isola Tavolara, 1 juv.
24.IV. 1966 leg. Gmppo Isole C.N.R. (MBG).
SASSARI: Sorso, Pianu Mannu, Nali farm, or-
chard, pitfall traps, 1 male 15-22.IV. 1998 leg. 1st.
Ent. SS (ISE).
Pisaura quadrilineata (Lucas, 1838)
Chorotype. Mediterranean.
References. (74) Brignoli, 1984 (sub "Form
D"); (84) Pesarini, 1994 (sub P. maderiana); (132)
Pantini & Sassu, 2009.
Province. (84); Ogliastra (74); Sassari (132).
50
P. Pantini, A. Sassu & G. Serra
Family OXYOPIDAE
Oxyopes heterophthalmus (Latreille, 1804)
Chorotype. Palearctic.
References. (8) Costa, 1884; (11) de Carlini,
1885; (13) Gameri, 1902; (59) Brignoli, 1977; (84)
Pesarini, 1994; (114) Grill et al., 2005; (132) Pantini
& Sassu, 2009; (139) Trotta, 2011.
Province. (8, 84, 114); Cagliari (13); Carbonia-
Iglesias (11, 13, 139); Medio Campidano (139);
Ogliastra (13); Olbia-Tempio (59); Oristano (13);
Sassari (132, ined.).
Habitat. Low shurbs, shurblands and trees, agri-
cultural land (114).
Examined material. OLBIA-TEMPIO: Loiri-
Porto San Paolo . Porto S. Paolo, 2 males 1.V.1964
leg. Gruppo Isole C.N.R. (MBG).
Oxyopes lineatus Latreille, 1806
Chorotype. Turano-European.
References. (8) Costa, 1884; (13) Garneri,
1902; (84) Pesarini, 1994.
Province. (8, 84); Cagliari (13); Nuoro (ined.).
Habitat. Hazelnut-orchard (ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-
male 27.VII-8.VIIL2006 leg. I.S.E. (ISE).
Oxyopes nigripalpis Kulczynski, 1891
Chorotype. Mediterranean.
References. (127) Lorn et al., 2008; (139)
Trotta, 2011.
Province. (127); Carbonia-Iglesias (139);
Nuoro (ined.); Sassari (ined.).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, beating tray, 2 fe-
males 27.VII.2005 leg. I.S.E. (ISE).
SASSARI: Sassari . Platamona, at sea level, 1
male 22.V.2008 leg. Sassu A. (ISE).
Family ZOROPSIDAE
Zoropsis media Simon, 1878
Chorotype. W-Mediterranean.
References. (13) Gameri, 1902.
Province. Cagliari (13).
Zoropsis spinimana (Dufour, 1 820)
Chorotype. Mediterranean.
References. (8) Costa, 1884 (sub Z. ocreata );
(13) Gameri, 1902 (sub Z. ocreata ); (84) Pesarini,
1994; (94) Arno et al., 1998; (95) Thaler & Kno-
flach, 1998; (127) Lorn et al., 2008; (133) Trotta,
2009; (139) Trotta, 2011.
Province. (84, 127); Cagliari (13, 139); Carbo-
nia-Iglesias (13, 139); Medio-Campidano (ined.);
Nuoro (95, ined.); Olbia-Tempio (133); Oristano (8,
13); Sassari (94, ined.).
Habitat. Avenue of lime trees (94); orchard
(ined.); inside house (ined.); mediterranean maquis
(ined.); hazelnut-orchard (127, ined.).
Examined material. MEDIO CAMPIDANO:
Guspini . Montevecchio, Piccalinna, m 260, mediter-
ranean maquis, pitfall traps, 1 male 21.IV-5.V.2009,
1 male and 2 females 18.V-3.VI.2009, 1 female 15-
30.VI.2009 leg. Sassu A., Verdinelli M. (ISE).
NUORO: Belvi . Su Ajone, m 585, hazelnut-or-
chard, bark traps, 1 female 16-23. VI. 2005, 1 juv.
14.VII.2005, 1 female 21-29.IX.2005, 1 female
29.IX-6.X.2005 (MBG), 1 male 29.IX-6.X.2005
(ISE), 2 males 6-12.X.2005. (MBG) (all leg. I.S.E.).
Tiana, m 522, hazelnut- orchard, bark traps, 1 fe-
male 17-26.VIII.2005 leg. I.S.E. (ISE).
SASSARI: Sassari . inside house, 1 male,
6. II. 2008, 1 female 1.2004 leg. Sassu A. (ISE).
Sorso . Pianu Mannu, Nali farm, orchard, bark
traps, 1 male and 1 female 24.XI-2.XII. 1997 leg.
1st. Ent. SS (ISE).
Family ZORIDAE
*Zor« manicata Simon, 1878
Chorotype. Europeo-Mediterranean.
Habitat. Walnut-orchard (ined.).
Examined material. NUORO: Belvi . Canale e’
Figu, m 576, walnut-orchard, pitfall traps, 1 male
26.IV-4.V.2007 leg. I.S.E. (ISE).
Zora spinimana (Sundevall, 1833)
Chorotype. Palearctic.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
51
References. (20) Krauss, 1955.
Province. (20).
Family AGELENIDAE
Agelena labyrinthica (Clerck, 1757)
Chorotype. Palearctic.
References. (8) Costa, 1884; (13) Garneri,
1902; (20) Krauss, 1955; (84) Pesarini, 1994; (139)
Trotta, 2011.
Province. (20, 84); Cagliari (13); Carbonia-
Iglesias (13, 139); Oristano (8, 13).
Allagelena gracilens (C.L. Koch, 1841)
Chorotype. Sibero-European.
Reeerences. (13) Garneri, 1902 (sub Agelena
similis ); (84) Pesarini, 1994.
Province. (84); Cagliari (13).
Aterigena soriculata (Simon, 1873)
Chorotype. Sardo-Corsican endemic.
References. (13) Garneri, 1902 (sub Tegenaria
soriculata ); (84) Pesarini, 1994 (sub Tegenaria so-
riculata).
Province. (13, 84); Nuoro/Ogliastra (13); Sas-
sari (20).
Remarks. The presence in Sardinia of this species
is doubtful, the citation by Krauss (1955) concerns
T. parietina (Bolzem et al., 20: 776).
Lycosoides coarctata (Dufour, 1831)
Chorotype. Mediterranean.
References. (3) Pavesi, 1876 (sub Textrix coar-
ctata ); (6) Magretti, 1880 (sub Textrix coarctata );
(10) Costa, 1885 (sub Textrix coarctata)', (11) de
Carlini, 1885 (sub Textrix coactata ); (13) Garneri,
1902 (sub Textrix Coarctata)', (20) Krauss, 1955
(sub Textrix Coarctata)', (37) Argiolas et al., 1970
(sub Textrix coarctata)', (59) Brignoli, 1977 (sub
Textrix coarctata)', (84) Pesarini, 1994; (132) Pan-
tini & Sassu, 2009.
Province. (84); Cagliari (6, 13, 37, 59, ined.);
Carbonia-Iglesias (3, 6, 11, 13, 59); Medio Campi-
dano (ined.); Olbia-Tempio (59); Oristano (10, 13,
ined.); Sassari (6, 13, 20, 59, 132, ined.).
Habitat. Hypogean habitat (20, 37); orchard
(ined.); garrigue (ined.); garden (ined.); inside
house (ined.); mining landfills covered by pioneer
plants (ined.).
Examined material. CAGLIARI: Domus de
Maria . Punta su Pisu, m 14, 2 males and 2 females
XII. 2006 leg. Ruzzante (MBG).
MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-
cauli, m 170, mining landfills covered by pioneer
plants, 2 males 6-20.X.2009 (ISE); m 200, garrigue,
1 male 6-20.X.2009 (MBG) (all pitfall traps and
leg. Sassu A., Verdinelli M.).
ORISTANO: Bonarcado . residential area, m 283,
garden, 1 male 25.X.2008 leg. Sassu A. (ISE).
OLBIA-TEMPIO: Olbia . Isola Molara, 8 female
25.11.1966, 1 female, 20.IV. 1966, 11 females,
25. XI.1966 (MBG); Isola Tavolara, 2 females,
26. XI.1966 (MBG) (all leg. Gruppo Isole C.N.R.).
SASSARI: Alghero . 1 male, leg. Pantaleoni R.A.
(ISE). Ozieri, 1 female 21. III. 1978 leg. Bianchi R.,
Moretti G. (MBG). Sassari . inside house, 1 male
9.X.2007 leg. Cesaroni C. (ISE). Sorso . Pianu
Mannu, Nali farm, orchard, pitfall traps, 1 male 20-
27. X. 1997 (ISE); orchard, bark traps, 1 female 2-
9.XII.1997 (ISE) (all leg. 1st. Ent. SS).
Malthonica campestris (C.L. Koch, 1834)
Chorotype. European.
References. (13) Garneri, 1902 (sub Tegenaria
campestris)', (84) Pesarini, 1994 (sub Tegenaria
campestris).
Province. (84); Nuoro/Ogliastra (13).
Malthonica dalmatica (Kulczynski, 1906)
Chorotype. Turano-European-Mediterranean.
References. (20) Krauss, 1955 (sub Tegenaria
pagana)', (39) Brignoli, 1971a (sub Tegenaria dre-
scoi); (84) Pesarini, 1994 (sub Tegenaria drescoi);
(87) Wunderlich, 1995b (sub Tegenaria henroti);
(124) Bolzem et al., 2008.
Province. (84); Nuoro (ined.); Ogliastra (87,
124); Sassari (20, 39, 124).
Habitat. Hypogean habitat (20, 39, 124); hazel-
nut-orchard (ined.).
Examined material. NUORO: Belvi . Su
52
P. Pantini, A. Sassu & G. Serra
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1
male 10-31.X.2006 leg. I.S.E. (ISE).
Malthonica eleonorae Brignoli, 1974
Chorotype. Sardinian endemic.
References. (39) Brignoli, 1971a (sub Tegena-
ria henroti ); (51) Brignoli, 1974 (sub Tegenaria
eleonorae ); (59) Brignoli, 1977 (sub Tegenaria
eleonorae)', (83) Pons, 1993 (sub Tegenaria elea-
norae); (84) Pesarini, 1994 (sub Tegenaria eleono-
rae ); (124) Bolzem et al., 2008.
Province. (84); Carbonia-Iglesias (39, 51, 59,
83, 124); Ogliastra (59, 124).
Habitat. Hypogean habitat (39, 51, 83, 124).
Malthonica pagana (C.L. Koch, 1840)
Chorotype. Subcosmopolitan.
References. (6) Magretti, 1880 (sub Tegenaria
pagana)', (13) Garneri, 1902 (sub Tegenaria pa-
gana)', (30) Cerruti, 1968 (sub Tegenaria pagana)',
(39) Brignoli, 1971a (sub Tegenaria pagana)', (59)
Brignoli, 1977 (sub Tegenaria pagana)', (84) Pesa-
rini, 1994 (sub Tegenaria pagana).
Province. (84); Cagliari (6, 13, 39, 59); Sassari
(30, 39).
Habitat. Hypogean habitat (30, 39).
Malthonica sardoa Brignoli, 1977
Chorotype. Sardinian endemic.
References. (59) Brignoli, 1977; (83) Pons,
1993; (84) Pesarini, 1994; (124) Bolzern et al.,
2008.
Province. (124); (84); Carbonia-Iglesias (59,
124); Medio Campidano (ined.); Nuoro (59, 83, 124,
ined.); Olbia-Tempio (59, 124); Oristano (59, 124).
Habitat. Hypogean habitat (83, 124); garrigue
(ined.); mediterranean maquis (ined.); walnut-or-
chard (ined.); open Quercus forest with mosses
(124); Quercus pubescens, humid (124); under Ju-
niperus sp. (ined.); mining landfills covered by pio-
neer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 female 19.V-4.VI.2009, 1 female 4-
16.VI.2009, 1 female 14-28.VII.2009, 2 females
28.VII-10.VIII.2009 (ISE); m 170, mining landfills
covered by pioneer plants, 1 female 19.V-4.VI.2009
(ISE); m 200, garrigue, 1 female 5-19.V.2009 (ISE),
1 female 19.V-4.VI.2009 (MBG) (all pitfall traps
and leg. Sassu A., Verdinelli M.). Guspini . Monte-
vecchio, Piccalinna, m 225, mining landfills cove-
red by pioneer plants, 1 female 15-30. VI. 2009
(ISE); m235, garrigue, 1 female 18.V-3.VI.2009, 2
females 30.VI-13.VII.2009 (ISE); m 260, mediter-
ranean maquis, 1 female 30.VI-13.VII.2009 (ISE),
1 female 13-27. VII. 2009 (MBG) (all pitfall traps
and leg. Sassu A., Verdinelli M.).
NUORO: Fonni . Gennargentu, mountain refuge,
m 1550, under Juniperus sp., pitfall traps, 1 female
19.VI-1.VII.2007 leg. Fiori F. (ISE). Tonara . Su Az-
zime, m 682, walnut-orchard, pitfall traps 2 males
22-29.11.2008 leg. I.S.E. (ISE).
Malthonica sicana Brignoli, 1976
Chorotype. Tyrrhenian endemic.
References. (124) Bolzem et al., 2008.
Province. Oristano (124).
Habitat. Open Quercus forest, rich leaf litter
(124); Quercus forest open, not wet (124).
Tegenaria agrestis (Walckenaer, 1802)
Chorotype. Holarctic.
References. (14) Gozo, 1908; (59) Brignoli,
1977; (84) Pesarini, 1994.
Province. (84); Carbonia-Iglesias (14); Sassari
(59).
Habitat. Hypogean habitat (14).
Tegenaria armigera Simon, 1873
Chorotype. Sardo-Corsican endemic.
References. (19) Roewer, 1953; (30) Cerruti,
1968; (39) Brignoli, 1971a; (84) Pesarini, 1994.
Province. (84); Ogliastra (39); Sassari (19, 30).
Habitat. Hypogean habitat (19, 30, 39).
Tegenaria domestica (Clerck, 1757)
Chorotype. Cosmopolitan.
References. (8) Costa, 1884; (13) Gameri,
1902; (30) Cerruti, 1968; (84) Pesarini, 1994.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
53
Province. (84); Cagliari (13); Nuoro (30); Sas-
sari (8, 13).
Habitat. Hypogean habitat (30).
Tegenaria henroti Dresco, 1956
Chorotype. Sardinian endemic.
References. (21) Dresco, 1956; (22) Roewer,
1956 sub T. domestica (Clerck, 1757); (30) Cerruti,
1968; (51) Brignoli, 1974; (52) Puddu & Pirodda,
1974; (83) Pons, 1993; (84) Pesarini, 1994; (124)
Bolzern et al., 2008.
Province. (124); (84); Carbonia-Iglesias (52);
Nuoro (21, 22, 30, 51, 83, 124); Ogliastra (124).
Habitat. Hypogean habitat (21, 22, 30, 51, 52,
83, 124).
Tegenaria parietina (Fourcroy, 1785)
Chorotype. Subcosmopolitan.
References. (13) Garneri, 1902; (20) Krauss,
1955; (37) Argiolas et al., 1970; (38) Puddu, 1970;
(39) Brignoli, 1971a; (42) Puddu, 1971; (43) Bartolo
et al., 1972; (46) Thermes, 1972; (84) Pesarini,
1994; (139) Trotta, 2011.
Province. (84); Cagliari (13, 37, 42, 46); Car-
bonia-Iglesias (39, 43); Medio Campidano (139);
Ogliastra (38); Olbia-Tempio (20); Sassari (39).
Habitat. Hypogean habitat (37, 38, 39, 42, 43, 46).
Textrix caudata L. Koch, 1872
Chorotype. S-European.
References. (5) Pavesi, 1878 (sub T. violan-
tis ); (13) Garneri, 1902 (sub T. violantis ); (84) Pe-
sarini, 1994.
Province. (84); Cagliari (ined.); Medio Campi-
dano (ined.); Olbia-Tempio (5, 13).
Habitat. Mediterranean maquis (ined.).
Examined material. CAGLIARI: Pula, Is Can-
noneris, m 715, 1 female 18. VIII. 2006 leg. Ruz-
zante -Wilkins (MBG).
MEDIO CAMPIDANO: Guspini . Montevecchio,
Piccalinna, m 260, mediterranean maquis, pitfall
traps, 2 males 18.V-3.VI.2009 (MBG), 2 males
18.V-3.VI.2009, 6 males and 1 female 3-
15.VI.2009 (ISE), 3 males 3-15.VI.2009, 3 males
30.VI-13.VII.2009 (MBG), 5 males and 1 female
15-30. VI. 2009 (ISE), 2 males and 1 female 15-
30.VI.2009 (MBG), 6 males and 2 females 30.VI-
13.VII.2009, 1 female 27.VII-10.VIII.2009 (ISE),
1 male 13-27.VII.2009 (MBG), 1 male 13-
27.VII.2009 (ISE) (all leg. Sassu A., Verdinelli M.).
Textrix denticulata (Olivier, 1789)
Chorotype. European.
References. (13) Garneri, 1902; (84) Pesarini,
1994.
Province. (84); Nuoro/Ogliastra (13); Ogliastra
(13).
* Textrix pinicola Simon, 1875
Chorotype. W-Mediterranean.
Habitat. Mediterranean maquis (ined.).
Examined material. MEDIO CAMPIDANO:
Guspini . Montevecchio, Piccalinna, m 260, mediter-
ranean maquis, pitfall traps, 1 male 18.V-3.VI.2009
(ISE), 1 male 18.V-3.VI.2009 (MBG), 4 males 15-
30.VI.2009, 15 males 3-15.VI.2009 (ISE), 7 males
15-30.VI.2009, 1 male 15-30.VI.2009 (MBG), 7
males 30.VI-13.VII.2009 (ISE), 3 males 3-
15.VI.2009, 1 male 13-27.VII.2009 (MBG) (all leg.
Sassu A., Verdinelli M.).
Family HAHNIIDAE
Hahnia Candida Simon, 1875
Chorotype. European.
References. (48) Brignoli, 1973.
Province. Nuoro (48), Medio Campidano
(ined.).
Habitat. Mining landfills covered by pioneer
plants (ined.).
Examined material. MEDIO CAMPIDANO: Gu-
spini . Montevecchio, Piccalinna, m 260, mining land-
fills covered by pioneer plants, pitfall traps, 1 female
21.IV-5.V.2009 leg. Sassu A., Verdinelli M. (MBG).
Family DICTYNIDAE
Argenna patula (Simon, 1 874)
Chorotype. Palearctic.
54
P. Pantini, A. Sassu & G. Serra
References. (132) Pantini & Sassu, 2009.
Province. Sassari (132).
Dictyna arundinacea (Linnaeus, 1758)
Chorotype. Holarctic.
References. (13) Gameri, 1902.
Province. Ogliastra (13); Oristano (13).
Dictyna civica (Lucas, 1850)
Chorotype. Holarctic.
References. (94) Arno et al., 1998 (sub Brigit-
tea civica).
Province. Olbia-Tempio (ined.); Sassari (94).
Habitat. Avenue of lime trees (94); forest of
Quercus suber (ined.).
Examined material. OLBIA-TEMPIO: Bud-
duso, near Nuraghe Loelle, forest of Quercus
suber, beating tray, 2 females 7.VI.1999 leg. 1st.
Ent. SS (ISE).
Dictyna latens (Fabricius, 1775)
Chorotype. Sibero-European.
References. (13) Gameri, 1902.
Province. Cagliari (13); Sassari (ined.).
Habitat. Olive-grove (ined.).
Examined material. SASSARI: Sorso, Pianu
Mannu, Nali farm, olive-grove, beating tray, 1 fe-
male 29.IV. 1993 leg. 1st. Ent. SS (ISE).
Lathys humilis (Blackwall, 1855)
Chorotype. Palearctic.
References. (94) Arno et al., 1998; (127) Lom
et al., 2008.
Province. (127); Nuoro (ined.); Olbia-Tempio
(ined.); Sassari (94).
Habitat. Avenue of lime trees (94); cherry-or-
chard (ined.); hazelnut-orchard (127, ined.); forest
of Quercus suber (ined.).
Examined material. NUORO: Belyi, Antonitzd,
m 683, cherry-orchard, 1 female, 11-18.IV.2007
(ISE); Su Ajone, m 585, hazelnut-orchard, 1 female
25.V-1.VI.2005 (ISE); SuEnazzu, m 550, hazelnut-
orchard, 1 female 13-20.X.2004 (ISE) (all bark traps
and leg. I.S.E.).
OLBIA-TEMPIO: Budduso . near Nuraghe Lo-
elle, forest of Quercus suber, beating tray, 1 female
24.V.1999 leg. 1st. Ent. SS (ISE).
Marilynia bicolor (Simon, 1870)
Chorotype. Centralasiatic-European.
References. (116) Helsdingen, 2005.
Province. Ogliastra (116).
Habitat. In debris on the sandydeposits at the
mouth of the Rio Girasole (116).
Nigma puella (Simon, 1870)
Chorotype. European.
References. (10) Costa, 1885 (sub Dictyna
puella)', (13) Gameri, 1902 (sub Dictyna puella)',
(116) Helsdingen, 2005; (127) Lom et al., 2008.
Province. (127); Cagliari (10, 13); Nuoro (116,
ined.); Ogliastra (116); Olbia-Tempio (ined.); Ori-
stano (ined.); Sassari (ined.).
Habitat. In shurbs along a little stream (116);
hazelnut-orchard (127, ined.); olive-grove (ined.);
forest of Quercus suber (ined.); vineyard (ined.).
Examined material. NUORO: Belyi, Su Ajone,
m 585, hazelnut-orchard, 1 male 16.VI.2005 (MBG),
1 female 13.VII.2005 (ISE); Su Enazzu, m 550, ha-
zelnut-orchard, beating tray, 1 male 19.V.2005 (ISE),
3 males and 1 female, 19.V.2005 leg. I.S.E. (MBG)
(all beating tray and leg. I.S.E.). Tiana . m 522, ha-
zelnut-orchard, beating tray, 1 male 19.V.2005, 4
males and 2 females, 1.VI.2005, 1 female,
13.VII.2005, 1 female and 1 juv., 26.VIII.2005 leg.
I.S.E. (MBG).
OLBIA-TEMPIO: Budduso . near Nuraghe Lo-
elle, forest of Quercus suber, beating tray, 1 female,
31.V.1999, 1 male 24.V.1999 leg. 1st. Ent. SS (ISE).
ORISTANO: Fondorgianus . Tirso river, m 35, 1
male 22.IV.2003 leg. Pantini P., Magnati F. (MBG).
SASSARI: Bonnannaro . Cannisones, 2 males
17.V.2002, 2 males 28.V.2002 leg. Nuvoli T.
(ISE). Sorso . Pianu Mannu, Nali farm, olive-
grove, 1 female 23.III.1993 leg. 1st. Ent. SS (ISE).
Torralba . vineyard, 1 female 27. V. 1995 leg. 1st.
Ent. SS (ISE).
Nigma walckenaeri (Roewer, 1951)
Chorotype. European.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
55
References. (10) Costa, 1885 (sub Dictyna viri-
dissima ); (13) Gameri, 1902 (sub Dictyna vividis-
sima ); (94) Amo et al, 1998; (116) Helsdingen, 2005.
Province. Cagliari (13, ined.); Nuoro (10);
Ogliastra (116); Sassari (94, ined.).
Habitat. Citrus-grove (ined.); avenue of lime
trees (94); on trees lining a street (ined.); in the val-
ley of the rio (116).
Examined material. CAGLIARI: Uta, S’Ap-
passiu, Agris farm, citrus-grove, beating tray, 1
male 2.XI.2000, 5 males 13. XI. 2000, 1 male and 1
female 4.XII.2000 leg. CRAS (ISE).
SASSARI: Sassari . on trees lining a street, 1 fe-
male 29.IX.1994 leg. 1st. Ent. SS (ISE).
Family AMAUROBIIDAE
Amaurobius erberi (Keyserling, 1863)
Chorotype. European.
References. (41) Brignoli, 1971c; (52) Puddu
& Pirodda, 1974; (139) Trotta, 2011.
Province. Carbonia-Iglesias (41, 52, 139); Sas-
sari (ined.).
Habitat. Hypogean habitat (41, 52); orchard
(ined.).
Examined material. SASSARI: Sorso, Pianu
Mannu, Nali farm, orchard, bark traps, 1 female
20-27. X.1997 leg. 1st. Ent. SS (ISE).
Amaurobius fenestralis (Strom, 1768)
Chorotype. European.
References. (13) Gameri, 1902.
Province. Cagliari (13); Oristano (13).
Amaurobius fer ox (Walckenaer, 1830)
Chorotype. Holarctic.
References. (13) Gameri, 1902.
Province. Sassari (13).
Family TITANOECIDAE
Nurscia albomaculata (Lucas, 1 846)
Chorotype. Turano-European.
References. (10) Costa, 1885 (sub Titanoeca
albomaculata)', (13) Gameri, 1902 (sub Titanoeca
albo-maculata ); (84) Pesarini, 1994 (sub Titanoeca
albomaculata ); (94) Arno et al., 1998 (sub Tita-
noeca albomaculata)', (133) Trotta, 2009.
Province. (84); Cagliari (13); Nuoro (ined.);
Ogliastra (13); Olbia-Tempio (10, 133); Oristano
(13); Sassari (94, ined.).
Habitat. Avenue of lime trees (94); cherry-or-
chard (ined.); orchard (ined.).
Examined material. NUORO: Belyi, Antonitzo,
m 683, cherry-orchard, pitfall traps, 1 male, 1 female,
17-24.VII.2007, leg. I.S.E. (ISE).
SASSARI: Sorso . Pianu Mannu, Nali farm, or-
chard, pitfall traps, 1 male 26.VI-2.VII. 1997 leg. 1st.
Ent. SS (ISE).
Family MITURGIDAE
Cheiracanthium angulitarse Simon, 1878
Chorotype. S-European.
References. (132) Pantini & Sassu, 2009.
Province. Olbia-Tempio (ined.); Sassari (132).
Examined material. OLBIA-TEMPIO: Olbia .
Murta Maria, light trap, 1 male 17.V.1994 leg. Co-
motti G., Pantini P. (MBG).
Cheiracanthium mildei L. Koch, 1 864
Chorotype. Holarctic.
References. (10) Costa, 1885; (13) Gameri,
1902; (94) Amo etal., 1998; (116) Helsdingen, 2005;
(132) Pantini & Sassu, 2009; (139) Trotta, 2011.
Province, (ined.); Cagliari (13, ined.); Carbo-
nia-Iglesias (139); Medio-Campidano (139, ined.);
Nuoro (10); Ogliastra (116); Oristano (10, ined.);
Sassari (94, 132, ined.).
Habitat. Citrus-grove (ined.); avenue of lime
trees (94); orchard (ined.); inside house (ined.);
mediterranean maquis (ined.); olive-grove (ined.);
vineyard (ined.); wasteland plot (116).
Examined material. CAGLIARI: Uta . SAp-
passiu, Agris farm, citrus-grove, beating tray, 3
males 19.VI.2000, 1 male and 1 female 29.VI.2000,
2 males 20.VII.2000, 1 female 31.VII.2000, 1 fe-
male 10.VIII.2000 leg. CRAS (ISE).
MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-
56
P. Pantini, A. Sassu & G. Serra
cauli, m 120, mediterranean maquis, pitfall traps, 1
female 14-28.VII.2009, 1 female 10-25.VIII.2009
leg. Sassu A., Verdinelli M. (ISE). Guspini . Monte-
vecchio, Piccalinna, m 260, mediterranean maquis,
pitfall traps, 1 male 15-30. VI.2009 leg. Sassu A.,
Verdinelli M. (ISE).
ORISTANO: Bonarcado . inside house, 1 female
6. VI. 2007 leg. Sassu M. (ISE).
SASSARI: Sorso, Pianu Mannu, Nali farm,
olive-grove, 1 male 21.V.1993 (ISE); olive-grove,
beating tray, 2 males and 2 females 9.VII.1993, 1
male 1.VII.1993, 1 female 22.VII.1993, 1 female
26.VIII.1993 (ISE); orchard, bark traps, 1 female
10-17.VII.1997 (ISE); orchard, beating tray, 1 male
20.X. 1997 (ISE) (all leg. Ist.Ent.SS). Torralba . vine-
yard, 1 female 13.V.1995, 1 male 24.V.1995, 1 male
24.VI.1995 leg. 1st. Ent. SS (ISE).
Cheiracanthium pelasgicum (C.L. Koch, 1837)
Chorotype. Turano-European.
References. (10) Costa, 1885; (13) Gameri, 1902.
Province. Ogliastra (13); Oristano (10).
Cheiracanthium pennyi O. P.-Cambridge, 1873
Chorotype. Palearctic.
References. (116) Helsdingen, 2005.
Province. Ogliastra (116).
Habitat. Wasteland plot (116).
Cheiracanthium punctorium (Villers, 1789)
Chorotype. Turano-European.
References. (13) Gameri, 1902 (sub Chiracan-
thiun nutrix).
Province. Cagliari (13); Nuoro/Ogliastra (13).
Cheiracanthium seidlitzi L. Koch, 1864
Chorotype. Centralasiatic-Mediterranean.
References. (10) Costa, 1885; (13) Garneri,
1902; (18) Simon, 1932; (84) Pesarini, 1994.
Province. (18, 84); Cagliari (13); Oristano (10).
Cheiracanthium striolatum Simon, 1878
Chorotype. W-Mediterranean.
References. (10) Costa, 1885; (114) Grill et
al., 2005.
Province. (114); Cagliari (10).
Habitat. Shurblands and trees (114).
Family ANYPHAENIDAE
Anyphaena accentuata (Walckenaer, 1 802)
Chorotype. Turano-European.
References. (8) Costa, 1884; (13) Gameri,
1902; (84) Pesarini, 1994; (127) Lorn et al., 2008.
Province. (84, 127); Nuoro (8, 13, ined.).
Habitat. Cherry-orchard (ined.); hazelnut-or-
chard (127, ined.).
Examined material. NUORO: Belvl Manna-
ritzd, m 706, cherry-orchard, bark traps, 1 male 18-
26.IV.2007 (ISE); Su Ajone, m 585,
hazelnut-orchard, beating tray, 9 males, 2 females
and 1 juv. 4.V.2005 (MBG), 1 male 1 female,
4.V.2005, 1 male and 2 females 19.V.2005 (ISE), 5
females, 19.V.2005, 1 male 1.VI.2005 (MBG); Su
Enazzu, m 550, hazelnut-orchard, bark traps, 1 fe-
male 15-22. III. 2005, 1 female 27.IV-4.V.2005, 1 fe-
male 4-11.V.2005 (MBG); m 550, hazelnut-orchard,
beating tray, 2 males and 2 females 4.V.2005, 2
males, 5 females and 1 juv. 19.V.2005, 1 female and
2 juv. 16.VI.2005, 3 females 1.VI.2005, 1 female
29.VI.2005, 2 females and 40 juv. 10.VIII.2005
(MBG) (all leg. 1st. Ent. SS).
Anyphaena sabina L. Koch, 1 866
Chorotype. Turano-European.
References. (13) Gameri, 1902; (84) Pesarini,
1994; (94) Amo et al., 1998; (127) Lom et al., 2008;
(132) Pantini & Sassu, 2009; (139) Trotta, 2011.
Province. (84, 127); Cagliari (13, 139); Carbo-
nia-Iglesias (139); Medio-Campidano (139, ined.);
Nuoro (ined.); Oristano (ined.); Sassari (94, 132,
ined.).
Habitat. Avenue of lime trees (94); orchard
(ined.); mediterranean maquis (ined.); hazelnut-or-
chard (127, ined.); olive-grove (ined.); artichoke
field (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, pitfall traps, 1 male 19.V-4.VI.2009 leg.
Sassu A., Verdinelli M. (ISE). Guspini . Montevec-
chio, Piccalinna, m 260, mediterranean maquis, pit-
Catalogue of the spiders (Arachnida Araneae) of Sardinia
57
fall traps, 1 female 15-30.VI.2009 leg. Sassu A.,
Verdinelli M. (ISE).
NUORO: Belvi . Su Enazzu, m 550, hazelnut-or-
chard, beating tray, 1 female 4.V.2005 leg. I.S.E.
(MBG). Tiana . m 522, hazelnut- orchard, beating
tray, 1 female 4. V.2005 (MBG), 1 female 1.VI.2005
(ISE); hazelnut-orchard, bark traps, 1 female 4-
11. V.2005 (MBG) (all leg. 1st. Ent. SS).
ORISTANO: Bosa, artichoke field, 1 female
4.III.2009 leg. Padiglia P. (ISE).
OLBIA-TEMPIO: Olbia . Isola Tavolara, peniso-
lotto, 1 male 23.IV. 1966 leg. Gruppo Isole C.N.R.
(MBG).
S AS SARI: Sorso, Pianu Mannu, Nali farm,
olive-grove, beating tray, 1 male, 23.III.1993 (ISE),
olive-grove, 1 female 6.V.1993 (ISE); orchard, beat-
ing tray, 1 male and 1 female 22.IV. 1998 (ISE) (all
leg. 1st. Ent. SS).
Family LIOCRANIDAE
*Agraecina lineata (Simon, 1878)
Chorotype. W-Mediterranean.
Habitat. Garrigue (ined.).
Examined material. MEDIO CAMPIDANO:
Guspini . Montevecchio, Piccalinna, m 235, garri-
gue, pitfall traps, 1 male 18.V-3.VI.2009, 1 male 3-
15.VI.2009 (ISE), 1 male 30.VI-13.VII.2009
(MBG), 1 male 15-30.VI.2009 leg. Sassu A., Ver-
dinelli M. (ISE).
Agroeca annulipes Simon, 1878
Chorotype. W-Mediterranean.
References. (18) Simon, 1932.
Province. (18).
Agroeca inopina O.P.- Cambridge, 1886
CHOROTYPE.European.
References. (139) Trotta, 2011.
Province. Carbonia-Iglesias (139); Nuoro (ined.).
Habitat. Alder-grove (ined.); cherry-orchard
(ined.); hazelnut-orchard (ined.); under Juniperus
sp. (ined.); walnut-orchard (ined.).
Examined material. NUORO: Belvi . Anto-
nitzo, m 683, cherry-orchard, 1 female 16-
23.V.2007, 1 female 21-28.VI.2007, 1 male 11-
18.1.2008 (ISE); Canale e' Figu, m 576, walnut-or-
chard, 1 female 21-28.VI.2007 (ISE); Mannaritzo,
m 706, cherry-orchard, 1 male 19-26.XI.2007
(ISE); Su Enazzu, m 550, hazelnut-orchard, 1 fe-
male 13-27.VII.2006, 1 female 27.VII-8.VIII.2006,
4 juv. 8-24.VIII.2006, 6 males 24.VIII-5.IX.2006, 1
male and 1 female 5-21.IX.2006, 7 males and 1 fe-
male 21. IX-5.X.2006, 2 males 5-16.X.2006, 3 males
31.X-21.XI.2006 (MBG), 1 male and 1 female 5-
16. X.2006 (ISE), 3 males 16-31.X.2006, 4 males and
1 female, 21.XI.2006-8.I.2007 (MBG), 1 male and
1 female 21.XI.2006-8.I.2007 (ISE), 1 female 8.1-
21.11.2007, 1 female 21.II-19.III.2007, 2 females
19.III-26.IV.2007, 3 females 26.IV-30.V.2007, 3 fe-
males 30.V-4.VII.2007 (MBG) (all pitfall traps and
leg. I.S.E.). Desulo, Gennargentu, mountain refuge,
m 1500, under Juniperus sp., 2 males 19.IX-
3.X.2006 (ISE); alder-grove, 1 male, 5-19.IX.2006,
1 male, 3-17.X.2006 (ISE) (all pitfall traps and leg.
Fiori F.). Fonni . Gennargentu, mountain refuge, m
1550, alder-grove, 1 female, 19.VII-2.VIII.2006, 1
male, 17-30.VIII.2006, 6 males and 2 females 2-
17. VIII.2006, 14 males and 1 female 30. VIII-
12.IX.2006, 11 males 12-26.IX.2006, 1 female
29.XI.2006-9.I.2007 (ISE); under Juniperus sp. 1
male 17-30.VIII.2006, 3 males 30.VIII-12.IX.2006,
2 females 15-29.XI.2006, 1 female 5-19.VI.2007
(ISE) (all pitfall traps and leg. Fiori F.). Tonara, Su
Azzime, m 682, walnut-orchard, pitfall traps, 1 fe-
male 11-18.IV.2007, 1 male 4-11.X.2007, 1 male 19-
26.XI.2007, 1 male 11-18.1.2008 leg. I.S.E. (ISE).
Cybaeodes sardus Platnick et Di Franco, 1992
Chorotype. Sardinian endemic.
References. (81) Platnick & Di Franco, 1992.
Province. Oristano (81).
Liocranum giersbergi Kraus, 1955
Chorotype. Sardinian endemic.
References. (20) Krauss, 1955; (46) Thermes,
1972; (52) Puddu & Pirodda, 1974; (60) Brignoli &
Gaddini, 1979; (64) Brignoli, 1979d; (84) Pesarini,
1994; (87) Wunderlich, 1995b; (127) Lorn et al.,
2008; (139) Trotta, 2011.
Province. (84, 127); Cagliari (46, 52, 139,
ined.); Carbonia-Iglesias (139); Medio Campidano
(139, ined.); Nuoro (60, 64, ined.); Nuoro/Ogliastra
(87); Ogliastra (87); Sassari (20).
58
P. Pantini, A. Sassu & G. Serra
Habitat. Hypogean habitat (46, 52, 64);
cherry-orchard (ined.); mediterranean maquis
(ined.); hazelnut-orchard (127, ined.); walnut-or-
chard (ined.); under the bark (87).
Examined material. CAGLIARI: Pula . Is Can-
noneris, m 715, 1 female 18. VIII. 2006, 1 female
1. XII. 2006 leg. Ruzzante-Wilkins (MBG).
MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-
cauli, m 120, mediterranean maquis, pitfall traps, 1
male 19.V-4.VI.2009, 1 male 4-16.VI.2009 (ISE), 1
male 16-29.VI.2009, 2 females 29.VI-14.VII.2009
(MBG), 1 female 16-29.VI.2009, 1 female 29.VI-
14.VII.2009, 1 female 14-28.VII.2009, 1 male 8-
22.IX.2009, 1 male 6-20.X.2009 (ISE) (all leg.
Sassu A., Verdinelli M.). Guspini . Montevecchio,
Piccalinna, m 260, mediterranean maquis, pitfall
traps, 1 female 7-21.IV.2009, 3 females 5-
18.V.2009, 2 females 30.VI-13.VII.2009, 2 females
15-30.VI.2009, 1 female 13-27.VII.2009 (ISE), 1
male 22.IX-6.X.2009 (MBG), 1 male 8-22.IX.2009,
1 male, 1 female 22.IX-6.X.2009, 1 male 6-
20.X.2009 (ISE) (all leg. Sassu A., Verdinelli M.).
NUORO: Belvi, Mannaritzo, m 706, cherry-or-
chard, pitfall traps, 1 female 17-24. VII. 2007 leg.
I.S.E. (ISE). Tiana. m 522, hazelnut-orchard, bark
traps, 1 female 11-18.V.2005 leg. I.S.E. (ISE). To-
nara, light trap, 1 male 8.IX.2006 leg. Fiori F. (ISE);
Su Azzime, m 682, walnut-orchard, pitfall traps, 1
female 17-24.VIII.2007 leg. I.S.E. (ISE).
Liocranum rupicola (Walckenaer, 1830)
Chorotype. European.
References. (13) Gameri, 1902; (77) Grimm,
1986; (139) Trotta, 2011.
Province. (13); Nuoro (77); Ogliastra (139).
Habitat. Under bark (77).
Mesiotelus tenuissimus (L. Koch, 1866)
Chorotype. Mediterranean.
References. (20) Krauss, 1955; (84) Pesarini,
1994.
Province. (84); Sassari (20).
Scotina celans (Blackwall, 1841)
Chorotype. European.
References. (139) Trotta, 2011.
Province. Carbonia-Iglesias (139); Nuoro
(ined.).
Habitat. Hazelnut-orchard (ined.); walnut-or-
chard (ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1
male 30.X-21.XI.2006 leg. I.S.E. (MBG). Tonara .
Su Azzime, m 682, walnut-orchard, 1 male 22-
29.11.2008 leg. I.S.E. (MBG).
Family CLUBIONIDAE
Clubiona comta C.L. Koch, 1839
Chorotype. European.
References. (127) Loru et al., 2008; (139)
Trotta, 2011.
Province. (127); Carbonia-Iglesias (139); Medio
Campidano (ined.); Nuoro (ined.); Sassari (ined.).
Habitat. Orchard (ined.); garrigue (ined.); ha-
zelnut-orchard (127, ined.); walnut- orchard (ined.).
Examined material. MEDIO CAMPIDANO:
Guspini . Montevecchio, Piccalinna, m 235, gar-
rigue, pitfall traps, 1 female 30.VI-13.VII.2009 leg.
Sassu A., Verdinelli M. (ISE).
NUORO: Belvi . Canale e' Figu, m 576, walnut-
orchard, 2 females 28.V-4.VI.2007 (ISE); Su
Enazzu, m 550, hazelnut-orchard, 1 female, 27.IV-
4.V.2005 1 female 4-11.V.2005, 1 female 7-
14.VII.2005, 1 female 14-21. IX.2005 (ISE) (all
bark traps and leg. I.S.E.).
SASSARI: Sorso . Pianu Mannu, Nali farm, or-
chard, pitfall traps, 1 female 24-3 l.VII. 1997 leg.
1st. Ent. SS (ISE).
Clubiona genevensis L. Koch, 1866
Chorotype. Palearctic.
References. (94) Arno et al., 1998.
Province. Sassari (94).
Habitat. Avenue of lime trees (94).
Clubiona leucaspis Simon, 1932
Chorotype. S-European.
References. (127) Loru et al., 2008; (139)
Trotta, 2011.
Province. (127); Cagliari (ined.); Carbonia-
Catalogue of the spiders (Arachnida Araneae) of Sardinia
59
Iglesias (139); Nuoro (ined.); Olbia-Tempio (ined.);
Sassari (ined.).
Habitat. Citrus-grove (ined.); cherry-orchard
(ined.); orchard (ined.); hazelnut-orchard (127,
ined.); walnut-orchard (ined.); olive-grove (ined.);
pine wood (ined.); forest of Quercus suber (ined.);
vineyard (ined.).
Examined material. CAGLIARI: Uta, S’Ap-
passiu, Agris farm, citrus-grove, beating tray, 1 fe-
male 29.VI.2000, 1 female 10.VII.2000, 1 female
20.VII.2000 leg. CRAS (ISE).
NUORO: Belyi, Antonitzo, m 683, cherry-or-
chard, bark traps, 5 males, 11-18.IV.2007, 4 fe-
males, 16-24.V.2007, 1 female, 21-28.VI.2007
(ISE); Canale e' Figu, m 576, walnut-orchard,
bark traps, 1 female, 26.IV-4.V.2007, 2 females 17-
24. VII.2007, 1 male 19-26.XI.2007 (ISE); Manna-
ritzo, m 706, cherry-orchard, bark traps, 6 males and
1 female 18-26.IV.2007, 3 females 16-23.V.2007, 4
males 1 1 .1-1 8.1.2008, 1 male 22-29.11.2008 (ISE);
Su Ajone, m 585, hazelnut-orchard, bark traps, 1
male 27.IV-4.V.2005 (ISE), 1 female 4-11.V.2005,
3 females 25.V-1.VI.2005 (MBG), 1 female 25. V-
1. VI. 2005 (ISE) 2 females 14-19. VII.2005 (MBG);
Su Ajone, m 585, hazelnut-orchard, beating tray, 1
female 1.VI.2005, 1 female, 19.V.2005 (MBG); Su
Enazzu, m 550, hazelnut-orchard, bark traps, 1 fe-
male 13-20.X.2004, 3 females 8-15.XI.2004, 1 male
27.IV-4.V.2005, 1 female 25. V-1.VI.2005, 2 females
18-25.V.2005, 1 female, 29.VI-6.VII.2005, 1 female
16-23.VI.2005, 2 females 1-8.VI.2005 (MBG); ha-
zelnut-orchard, beating tray, 1 male, 3 females and
1 juv. 19.V.2005, 1 female 1.VI.2005 (MBG) (all
leg. I.S.E.). Tiana, m 522, hazelnut-orchard, bark
traps, 1 male 27.IV-4.V.2005, 2 females 18-
25. V.2005, 4 females 11-18.V.2005, 1 male and 3 fe-
males, 4-11.V.2005, 1 female 6-12.X.2005 leg.
I.S.E. (MBG). Tonara, Su Azzime, m 682, walnut-
orchard, bark traps, 1 female 11-18.IV.2007, 1 fe-
male 16-23.V.2007 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Budduso . near Nuraghe Lo-
elle, forest of Quercus suber , beating tray, 1 female
24.V.1999 leg. 1st. Ent. SS (ISE).
SASSARI: Alghero . Porto Conte, m 35, pine-
wood, emergence cages, 1 female, 1 3. IV.2009 leg. 1st.
Ent. SS (ISE). Sorso, Pianu Mannu, Nali farm, olive-
grove, beating tray, 1 female 29.III.1993, 1 male and
1 female 21. IV. 1993 (ISE); olive-grove, 1 female
18.VI.1993 (ISE); orchard, bark traps, 1 male 2-
9.XII.1997 (ISE) (all leg. I.S.E.). Torralba . vineyard,
1 female 23.IV. 1994, 1 female 18.VI.1994, 1 male
and 3 juv. 19.XI.1994, 3 males 12.XI.1994, 1 female
and 9 juv. 26.VIII.1995, 1 male 21.X.1995 leg. 1st.
Ent. SS (ISE).
Clubiona neglecta O.P.- Cambridge, 1862
Chorotype. Palearctic.
References. (10) Costa, 1885.
Province. Nuoro (10).
Clubiona pallidula (Clerck, 1757)
Chorotype. Holarctic.
References. (13) Gameri, 1902.
Province. Nuoro/Ogliastra (13).
Clubiona phragmitis C.L. Koch, 1843
Chorotype. Palearctic.
References. (8) Costa, 1884; (13) Gameri, 1902.
Province. (13); Olbia-Tempio (8).
Clubiona subsultans Thorell, 1875
Chorotype. Palearctic.
References. (13) Gameri, 1902 (sub C. erratica ).
Province. Cagliari (13).
Clubiona terrestris Westring, 1851
Chorotype. European.
References. (127) Lom et al., 2008.
Province. (127); Nuoro (ined.).
HABiTAT.Hazelnut-orchard (127, ined.).
Examined material. NUORO: Belvl Su Ajone,
m 585, hazelnut-orchard, bark traps, 1 female,
27.IV-4.V.2005, 1 male 1-8.VI.2005, 1 female 17-
26.VIII.2005, 1 female 5-10.VIII.2005 (ISE), 1 fe-
male 20-27. X. 2004, 1 female 6-13.X.2004 leg.
I.S.E. (MBG).
Clubiona vegeta Simon, 1918
Chorotype. S-European.
References. (116) Helsdingen, 2005; (132)
Pantini & Sassu, 2009.
Province. Ogliastra (116); Sassari (132).
Habitat. Wasteland plot (116).
60
P. Pantini, A. Sassu & G. Serra
Family CORINNIDAE
Cetonana laticeps (Canestrini, 1868)
Chorotype. European-Mediterranean.
References. (77) Grimm, 1986 (sub Ceto lati-
ceps ); (84) Pesarini, 1994 (sub Ceto laticeps ).
Province. (84); Nuoro (77, ined.).
FIabitat. Walnut-orchard (ined.).
Examined material. NUORO: Tonara . Su Az-
zime, m 682, walnut- orchard, bark traps, 1 female
11-18.IV.2007 leg. I.S.E. (ISE).
Liophrurillus flavitarsis (Lucas, 1 846)
Chorotype. W-Mediterranean.
References. (60) Brignoli & Gaddini, 1979
(sub Phrurolitus flavitarsis); (84) Pesarini, 1994
(sub Phrurolitus flavitarsis); (139) Trotta, 2011.
Province. (84); Cagliari (60, ined.); Carbonia-
Iglesias (139); Medio Campidano (60, ined.);
Olbia-Tempio (139); Nuoro (60, ined.); Oristano
(60); Sassari (60, 139).
Habitat. Cherry-orchard (ined.); garrigue
(ined.); mediterranean maquis (ined.); hazelnut-or-
chard (ined.); walnut-orchard (ined.); mining land-
fills covered by pioneer plants (ined.).
Examined material. CARBONIA-IGLESIAS:
Gonnesa . 1 male 24.IV.2003 leg. Ferrario E. (MBG).
MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-
cauli, m 120, mediterranean maquis, 1 male 21.IV-
5.V.2009, 1 female, 19.V-4.VI.2009, 2 males
5-19.V.2009, 1 female, 29.VI-14.VII.2009 (ISE); m
170, mining landfills covered by pioneer plants, 1 fe-
male 5-19.V.2009 (ISE); m 200, garrigue, 2 males
21 .IV-5.V.2009 (ISE) (all pitfall traps and leg. Sassu
A., Verdinelli M.). Guspini . Montevecchio, Picca-
linna, m 235, garrigue, 2 males 7-21.IV.2009, 2
males, 21.IV-5.V.2009, 3 males and 1 female 5-
18.V.2009, 1 male and 1 female, 18.V-3.VI.2009
(ISE); m 260, mediterranean maquis, 5 males and 1
female 21.IV-5.V.2009, 18 males and 3 females 5-
18.V.2009, 6 males and 14 females 18.V-3.VI.2009,
6 females 3-15.VI.2009, 1 female 15-30.VI.2009, 1
female 30.VI-13.VII.2009 (ISE) (all pitfall traps and
leg. Sassu A., Verdinelli M.).
NUORO: Belyi, Antonitzo, m 683, cherry-or-
chard, 17 males 18-26.IV.2007, 1 male 11-
18.IV.2007, 2 males and 4 females 16-23.V.2007, 1
male, 1 female 21-28.VI.2007 (ISE); Canale e'
Figu, m 576, walnut-orchard, 2 females 16-
23. V.2007, 4 females, 21-28.VI.2007, 1 female 17-
24. VII.2007 (ISE); Mannaritzo, m 706,
cheny-orchard, 6 males and 1 female 18-26.IV.2007,
12 males and 1 female 1 1-18.IV.2007, 1 male and 13
females 16-23.V.2007, 5 females 21-28.VI.2007, 2
females 17-24.VII.2007 (ISE); Su Enazzu, m 550,
hazelnut-orchard, 1 male and 16 females 27. VII-
8. VIII. 2006 (MBG), 13 female 13-27.VII.2006
(ISE), 15 female 13-27.VII.2006, 2 females and 1
juv. 8-24.VIII.2006, 1 juv. 31.X-21.XI.2006, 3 juv.
16-31.X.2006, 1 juv. 8.1-21. 11.2007, 1 female 19.III-
26.IV.2007, 5 males and 13 females 30.V-4.VII.2007
(MBG), 1 male 30.V-4.VII.2007 (ISE) (all pitfall
traps and leg. I.S.E.). Tonara . Su Azzime, m 682,
walnut-orchard, pitfall traps, 1 male and 1 female 18-
26.IV.2007, 2 males and 2 females 16-23.V.2007, 2
females 21-28.VI.2007 leg. I.S.E. (ISE).
Phrurolithus corsicus (Simon, 1878)
Chorotype. S-European.
References. (116) Helsdingen, 2005.
Province. Nuoro (116, ined.).
Habitat. At the margin of a field with stones
and shurbs (116); under Juniperus sp. (ined.).
Examined material. NUORO: Desulo . Gennar-
gentu, mountain refuge, m 1500, under Juniperus
sp., pitfall traps, 1 female 10-24.V.2007 leg. Fiori
F. (MBG). Fonni . Gennargentu, mountain refuge,
m 1550, under Juniperus sp., pitfall traps, 2 males
5-19.VI.2007 leg. Fiori F. (MBG).
Remarks. The male palp of P. corsicus is illu-
strated in figures 4-5.
Trachelas minor O.P.-Cambridge, 1872
Chorotype. W-Palearctic.
References. (116) Helsdingen, 2005.
Province. Nuoro (116).
Habitat. In grassland along the mouth of the
river (116).
Family ZODARIIDAE
Selamia reticulata (Simon, 1870)
Chorotype. W-Mediterranean.
References. (133) Trotta, 2009.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
61
Figures 4, 5. Phrurolithus corsicus (Simon, 1878) - Fonni (NU) Gennargentu m 1550, 5-19.VI.2007 leg. Fiori F. (scale
0.2 mm): (4) retrolateral view of left male pedipalp; (5) ventral view of left male pedipalp.
Province. Carbonia-Iglesias (133); Oristano
(ined.).
Examined material. ORISTANO: San Vero
Milis, Mandriola, 1 female 28.V.2005 leg. Mulas
A. (UCA).
Zodarion elegans (Simon, 1873)
Chorotype. S-European.
References. (13) Gameri, 1902 (sub Enyo ele-
gans ); (84) Pesarini, 1994; (93) Bosnians, 1997;
(112) Thaler & Knoflach, 2004; (132) Pantini &
Sassu, 2009; (139) Trotta, 2011.
Province. (84); Cagliari (13); Carbonia-Iglesias
(13, 93, 139); Medio Campidano (ined.); Nuoro
(93, ined.); Ogliastra (112); Oristano (ined.); Sassari
(132, ined.).
Habitat. Cherry-orchard (ined.); orchard
(ined.); garrigue (ined.); mediterranean maquis
(ined.); hazelnut- orchard (ined.); walnut-orchard
(ined.); mining landfills covered by pioneer
plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 female 14-28. VII.2009, 1 female 19.V-
4. VI. 2009, 1 male 5-19.V.2009 (ISE); m 170, mi-
ning landfills covered by pioneer plants, 1 female
29.VI-14.VII.2009, 1 male and 1 female 16-
29.VI.2009, 1 female 4-16.VI.2009, 2 males and 5
females 28. VII- 10. VIII. 2009, 2 males and 2 fema-
les 14-28.VII.2009, 1 female 10-25.VIII.2009, 1
female 25.VIII-8.IX.2009 (ISE), m 200, garrigue,
3 males 19.V-4.VI.2009, 2 females 16-29.VI.2009,
3 males and 1 female 14-28.VII.2009, 5 males and
5 females 28.VII-10.VIII.2009, 1 male 10-
25.VIII.2009 (ISE) (all pitfall traps and leg. Sassu
A., Verdinelli M.). Guspini . Montevecchio, Picca-
linna, m 225, mining landfills covered by pioneer
plants, 2 males, 13-27. VII.2009 (ISE); m 235, gar-
rigue, 1 female and 5 juv. 21.IV-5.V.2009, 17 males
and 6 juv. 5-18.V.2009, 30 males, 5 females and 1
juv. 18.V-3.VI.2009, 2 females 15-30.VI.2009, 1
male and 7 females 30. VI- 13. VII.2009, 5 males and
1 female 3- 15. VI. 2009, 32 males and 39 females
13-27.VII.2009, 33 males and 27 females 27.VII-
10.VIII.2009, 5 males and 16 females 10-
25.VIII.2009, 5 females 25.VIII-8.IX.2009 (ISE),
62
P. Pantini, A. Sassu & G. Serra
16 males and 23 females 10-25.VIII.2009 (MBG),
4 females 8-22.IX.2009 (ISE) (all pitfall traps and
leg. Sassu A., Verdinelli M.).
NUORO: Belvi . Antonitzd, m 683, cherry-or-
chard, 1 female 16-23.V.2007, 6 males 21-
28.VI.2007, 1 male 17-24.VII.2007, 1 female
27.IX-4.X.2007 (ISE); Canale e' Figu, m 576, wal-
nut-orchard, 1 female, 16-23.V.2007, 3 males and
2 females 21-28.VI.2007, 1 female 24-30.VIII.2007
(ISE), Su Enazzu, m 550, hazelnut-orchard, 1 fe-
male 27.VII-8.VIII.2006, 1 male 8-24.VIII.2006
(ISE) (all pitfall traps and leg. I.S.E.).
S AS SARI: Sorso, Pianu Mannu, Nali farm, or-
chard, pitfall traps, 2 males, 1 female and 1 juv. 24-
3 l.VII. 1997 leg. 1st. Ent. SS (ISE).
ORISTANO: Cabras, Isola Mai di Ventre, 1
male, 1 female, IV.2006, leg. Mulas A. (UCA).
*Zodarion gallicum (Simon, 1873)
Chorotype. S-European.
Habitat. Mediterranean maquis (ined.).
Examined material. MEDIO CAMPIDANO:
Guspini . Montevecchio, Piccalinna, m 260, mediter-
ranean maquis, pitfall traps, 1 female 30. VI-
13.VII.2009 leg. Sassu A., Verdinelli M. (MBG).
Zodarion italicum (Canestrini, 1868)
Chorotype. European.
References. (13) Gameri, 1902 (sub Enyo italica).
Province. Cagliari (13).
Zodarion nigriceps (Simon, 1873)
Chorotype. Sardo-Corsican endemic.
References. (3) Pavesi, 1876 (sub Enyo nigri-
ceps); (13) Garneri, 1902 (sub Enyo nigriceps);
(15) Simon, 1914; (84) Pesarini, 1994; (93) Bo-
snians, 1997.
Province. (15, 84); Cagliari (13); Carbonia-
Iglesias (3, 13); Nuoro (ined.); Ogliastra (13, 93);
Oristano (93).
Habitat. Cherry-orchard (ined.); walnut-or-
chard (ined.); under Juniperus sp. (ined.).
Examined material. NUORO: Belvi . Anto-
nitzo, m 683, cherry-orchard, 6 male, 1 female 16-
23.V.2007, 1 male and 1 female 21-28.VI.2007, 1
male 27.IX-4.X.2007 (ISE); Canale e' Figu, m 576,
walnut-orchard, 1 male 21-28.VI.2007 (ISE); Man-
naritzo, m 706, cherry-orchard, 1 male 18-
26.IV.2007, 1 female 16-23.V.2007, 2 males
2 1-28. VI. 2007 (ISE) (all pitfall traps and leg.
1.5. E.). Desulo . Gennargentu, mountain refuge, m
1500, under Juniperus sp., pitfall traps, 1 male 9-
23.VIII.2006 leg. Fiori F. (ISE). Tonara, Su Azzime,
m 682, walnut-orchard, pitfall traps, 1 male 18-
26.IV.2007, 1 male 16-23.V.2007, 2 males and 3 fe-
males 21-28.VI.2007, 2 males 24-30. VIII.2007 leg.
1.5. E. (ISE).
Zodarion ruffoi Caporiacco, 1951
Chorotype. Italian endemic.
References. (93) Bosmans, 1997.
Province. Medio Campidano (ined.); Nuoro
(ined.); Ogliastra (93).
Habitat. Garrigue (ined.); mediterranean maquis
(ined.); under Juniperus sp. (ined.); mining landfills
covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 male 4-16.VI.2009 (MBG); m 200, gar-
rigue, 1 female 14-28.VII.2009 (MBG) (all pitfall
traps and leg. Sassu A., Verdinelli M.). Guspini .
Montevecchio, Piccalinna, m 225, mining landfills
covered by pioneer plants, 1 female 10-25.VIII.2009
(MBG); m 235, garrigue, 16 males 5-18.V.2009, 1
female 6-20.X.2009 (MBG) (all pitfall traps and leg.
Sassu A., Verdinelli M.).
NUORO: Fonni . Gennargentu, mountain refuge,
m 1550, under Juniperus sp., pitfall traps, 1 male
5-19.VI.2007 leg. Fiori F. (ISE).
Zodarion sardum Bosmans, 1997
Chorotype. Sardinian endemic.
References. (49) Wunderlich, 1973 (sub Zoda-
rion (?) vicinum); (93) Bosmans, 1997.
Province. (49, 93).
Family PRODIDOMIDAE
*Zimirina brevipes Perez et Blasco, 1986
Chorotype. W-Mediterranean.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
63
Habitat. Mining landfills covered by pioneer
plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining landfills
covered by pioneer plants, pitfall traps, 1 female
19.V-4.VI.2009 leg. Sassu A., Verdinelli M. (MBG).
Remarks, a new record for Italy of this family
and this species known only from Southern Spain.
The epigynum is illustrated in figure 6.
Family GNAPHOSIDAE
Aphantaulax cincta (L. Koch, 1866)
Chorotype. Europeo-Mediterranean.
References. (76) Grimm, 1985; (84) Pesarini,
1994; (127) Lorn et al., 2008; (139) Trotta, 2011.
Province. (84, 127); Carbonia-Iglesias (139);
Nuoro (ined.); Olbia-Tempio (76).
Habitat. Hazelnut-orchard (127, ined.); sand-
strand (76).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, bark traps, 1 female 4-
1 1 . V.2005 leg. I.S.E. (ISE). Tiana . m 522, hazelnut-
orchard, beating tray, 1 female 19. V.2005, 1 male
16.VI.2005 leg. I.S.E. (ISE).
Aphantaulax trifasciata (O.P. -Cambridge, 1872)
Chorotype. Palearctic.
References. (8) Costa, 1884 (sub A. seminiger );
(13) Garneri, 1902 (sub A. semi-niger ); (76) Grimm,
1985 (sub A. seminigra ); (84) Pesarini, 1994 (sub A.
seminigra ); (132) Pantini & Sassu, 2009.
Province. (84); Cagliari (8, 13); Medio-Campi-
dano (ined.); Nuoro (8, 13, 76, ined.); Olbia-Tempio
(8, 13); Sassari (8, 13, 132, ined.).
Habitat. Garrigue (ined.); inside house (ined.);
grassland (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 200, garrigue, pit-
fall traps, 1 male 5-19.V.2009 leg. Sassu A., Ver-
dinelli M. (ISE).
NUORO: Bolotana . Badde e'Salighes, m 850,
grassland, 1 male 27.V.2007 leg. Sassu A. (ISE).
SASSARI: Sassari . Li Punti, Baldinca, m 110,
inside house, 1 male 2.VII.2008 leg. Cossu S. (ISE).
Figure 6. Zimirina brevipes Perez & Blasco, 1986 - epigyne,
ventral view (scale 0.1 mm), Arbus (VS), Ingurtosu, Nara-
cauli m 120, 4.VI.2009 leg. Sassu A., Verdinelli M.
Drassodes lapidosus (Walckenaer, 1 802)
Chorotype. Palearctic.
References. (5) Pavesi, 1878 (sub Drassus la-
pidicola); (8) Costa, 1884 (sub Drassus lapidosus)',
(13) Garneri, 1902 (sub Drassus lapidosus)', (20)
Krauss, 1955; (84) Pesarini, 1994; (127) Lorn et al.,
2008; (132) Pantini & Sassu, 2009; (133) Trotta,
2009; (139) Trotta, 2011.
Province. (20, 84, 127); Cagliari (13); Carbo-
nia-Iglesias (139); Medio Campidano (ined.); Nuoro
(8, 13, ined.); Nuoro/Ogliastra (13); Olbia-Tempio
(5, 8, 13, 133); Oristano (ined.); Sassari (132, 133).
Habitat. Cherry-orchard (ined.); hazelnut-or-
chard (127, ined.); alder-grove (ined.); under Juni-
perus sp. (ined.); mining landfills covered by
pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining landfills
covered by pioneer plants, pitfall traps, 1 male 5-
19.V.2009 (MBG), 1 male 5-19.V.2009 (ISE) (all
leg. Sassu A., Verdinelli M.). Guspini . Montevec-
chio, Piccalinna, m 225, mining landfills covered by
pioneer plants, pitfall traps, 1 male 21.IV-5.V.2009
(ISE), 2 males 18.V-3.VI.2009 (MBG), 1 male 3-
15.VI.2009 (ISE) (all leg. Sassu A., Verdinelli M.).
NUORO: Belvi . Mannaritzo, m 706, cherry-or-
chard, pitfall traps, 1 male 16-23.V.2007, 1 female
64
P. Pantini, A. Sassu & G. Serra
17-24.VII.2007 (ISE); SuEnazzu, m 550, hazelnut-
orchard, bark traps, 1 male 18-25.V.2005, 1 female
14-19.VII.2005 (ISE) (all leg. I.S.E.). Desulo . Gen-
nargentu, mountain refuge, m 1500, alder-grove,
bark traps, 1 female 25. VI-2. VII. 2007 leg. Fiori F.
(ISE). Fonni, Gennargentu, mountain refuge, m
1550, alder-grove, 1 female 19.VII-2.VIII.2006, 1
female 19.VI-1.VII.2007 (ISE); under Juniperus sp.,
2 females 5-19.VI.2007 (ISE) (all pitfall traps and
leg. Fiori F.). Ohena, Cedrino lake, m 80, light trap,
1 male 20.V.1994 leg. Pantini P., Valle M. (MBG).
ORISTANO: Cabras, Isola Mai di Ventre, 3
males 1 female 14-18. IV.2006 leg. Mulas A. (UCA).
*Drassodes luteomicans (Simon, 1878)
Chorotype. S-European.
Habitat. Garrigue (ined.); mediterranean ma-
quis (ined.); mining landfills covered by pioneer
plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 male 16-29.VI.2009 1, 1 female 4-
16. VI. 2009 (MBG); m 170, mining landfills covered
by pioneer plants, 1 female 21. IV-5.V.2009, 1 female
28.VII-10.VIII.2009 (MBG); m 200, garrigue, 1 fe-
male 19.V-4.VI.2009, 1 female 29.VI-14.VII.2009,
1 female 6-20.X.2009 (ISE) (all pitfall traps and leg.
Sassu A., Verdinelli M.). Guspini . Montevecchio,
Piccalinna, m 260, mediterranean maquis, pitfall
traps, 1 female 18.V-3.VI.2009 (ISE), 1 female 3-
15.VI.2009 (MBG) (all leg. Sassu A., Verdinelli M.).
Remarks. The male palp, the epigynum and the
vulva of this species are illustrated in figures 7-11.
Drassodes lutescens (C.L. Koch, 1839)
Chorotype. Turano-European-Mediterranean.
References. (13) Gameri, 1902 (sub Drassus
lutescens ); (20) Krauss, 1955; (84) Pesarini, 1994;
(139) Trotta, 2011.
Province. (20, 84); Carbonia-Iglesias (139); Medio
Campidano (ined.); Nuoro (ined.); Nuoro/Ogliastra
(13); Ogliastra (13); Oristano (ined.).
Habitat. Garrigue (ined.); mediterranean ma-
quis (ined.); alder-grove (ined.); under Juniperus
sp. (ined.); mining landfills covered by pioneer
plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 male 5-19.V.2009, 1 male 29. VI-
14.VII.2009, 1 male, 14-28.VII.2009 (ISE); m 170,
mining landfills covered by pioneer plants, 1 male
and 1 female 21.IV-5.V.2009, 1 male 7-21.IV.2009
(ISE); m 200, garrigue, 1 male 21.IV-5.V.2009, 2
males 7-21.IV.2009, 3 males and 2 females 19.V-
4. VI.2009 (ISE), 3 males and 3 females 5-19.V.2009
(MBG), 1 male 5-19.V.2009 (ISE) (all pitfall traps
and leg. Sassu A., Verdinelli M.). Guspini . Monte-
vecchio, Piccalinna, m 225, mining landfills covered
by pioneer plants, pitfall traps, 1 female 21.IV-
5. V.2009, 1 male 18.V-3.VI.2009, 1 female 15-
30.VI.2009, 1 male 18.V-3.VI.2009 leg. Sassu A.,
Verdinelli M. (ISE).
NUORO: Desulo . Gennargentu, mountain refuge,
m 1500, alder-grove, bark traps, 1 female 29. VIII-
5.IX.2006, 1 female and 1 juv. 26.IX-3.X.2006, 3
females 13-19.IX.2006, 1 male and 1 female 24. IV-
1.V.2007 leg. Fiori F. (ISE). Fonni . Gennargentu,
mountain refuge, m 1550, alder-grove, pitfall traps,
1 female 17-30.VIII.2006 (ISE); alder-grove, bark
traps, 1 female 24.IV-1.V.2007 (ISE); under Junipe-
rus sp., pitfall traps, 1 female 19.VI-1.VII.2007, 2
males 5-19.VI.2007 (ISE) (all leg. Fiori F.).
ORISTANO: Cabras . Isola Mai di Ventre, 1 male,
2 females 12-21.11.2005, 5 females 17.IV.2006 leg.
Mulas A. (UCA).
Drassodes rubidus (Simon, 1878)
Chorotype. W-Mediterranean.
References. (13) Garneri, 1902 (sub Drassus
rubidus ); (84) Pesarini, 1994.
Province. (84); Carbonia-Iglesias (13); Nuoro/
Ogliastra (13); Ogliastra (13).
Drassodex hispanus (L. Koch, 1 866)
Chorotype. European.
References. (13) Garneri, 1902 (sub Drassus
hispanus ); (84) Pesarini, 1994 (sub Drassodes hi-
spanus).
Province. (84); Cagliari (13).
Drassodex hypocrita (Simon, 1878)
Chorotype. European.
References. (13) Garneri, 1902 (sub Drassus
hypocrita).
Province. Ogliastra (13).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
65
Figures 7-9. Drassodes luteomicans (Simon, 1878), Ingurtosu, Naracauli, m 120, 16-29.VI.2009 leg. Sassu A., Verdinelli
M. (scale 0.5 mm): (7) retrolateral view of left male pedipalp; (8) ventral view of left male pedipalp; (9) chelicerae, posterior
view. Figures 10-11. D. luteomicans (Simon, 1878), Ingurtosu, Naracauli, m 170, 28.VII-10.VIII.2009 leg. Sassu A., Ver-
dinelli M. (scale 0.2 mm): (10) epigyne, ventral view; (11) vulva, ventral view.
Gnaphosa alacris Simon, 1878
Chorotype. Mediterranean.
References. (13) Gameri, 1902.
Province. Medio Campidano (ined.); Nuoro
(ined.); Ogliastra (13); Sassari (ined.).
Habitat. Orchard (ined.); garrigue (ined.); wal-
nut-orchard (ined.); mining landfills covered by
pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining
landfills covered by pioneer plants, 1 male 4-
16. VI. 2009, 1 male and 3 females 29. VI-
14.VII.2009 (ISE), 1 female 16-29.VI.2009
(MBG), 1 female 28.VII-10.VIII.2009 (ISE); m
200, garrigue, 1 male 29.VI-14.VII.2009 (ISE)
(all pitfall traps and leg. Sassu A., Verdinelli M.).
Guspini . Montevecchio, Piccalinna, m 225, mining
landfills covered by pioneer plants, 1 male 13-
27.VII.2009, 1 female 27.VII-10.VIII.2009, 1 male
8-22.IX.2009 (ISE); m 235, garrigue, 1 male 13-
27.VII.2009 (MBG) (all pitfall traps and leg. Sassu
A., Verdinelli M.).
NUORO: Belvi . Canale e' Figu, m 576, walnut-
orchard, pitfall traps, 1 male 17-24. VII. 2007 leg.
I.S.E. (ISE).
SASSARI: Sorso, Pianu Mannu, Nali farm, or-
chard, pitfall traps, 1 female 26.VI-2.VII. 1997 leg.
1st. Ent. SS (ISE).
Gnaphosa bicolor (Hahn, 1833)
Chorotype. Sibero-European.
References. (13) Gameri, 1902.
Province. Cagliari (13); Nuoro/Ogliastra (13).
66
P. Pantini, A. Sassu & G. Serra
Gnaphosa lucifuga (Walckenaer, 1802)
Chorotype. Palearctic.
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (84); Cagliari (13); Carbonia-Igle-
sias (13).
Gnaphosa lugubris (C.L. Koch, 1839)
Chorotype. Sibero-European.
References. (13) Gameri, 1902.
Province. Cagliari (13).
Haplodrassus dalmatensis (L. Koch, 1866)
Chorotype. Palearctic.
References. (13) Gameri, 1902 (sub Drassus
minus cuius); (20) Krauss, 1955; (116) Helsdingen,
2005; (132) Pantini & Sassu, 2009.
Province. (20); Cagliari (13); Medio Campi-
dano (ined.); Ogliastra (116); Sassari (132).
Habitat. Garrigue (ined.); in coastal drift on the
shore (116); mining landfills covered by pioneer
plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining land-
fills covered by pioneer plants, pitfall traps, 1 male
7-21.IV.2009, 2 males and 1 female 21.IV-5.V.2009
(ISE), 2 males and 1 female 5-19.V.2009 (MBG), 2
females 5-19.V.2009, 1 female 16-29.VI.2009, 2
males 7-21.IV.2009 (ISE) (all leg. Sassu A., Verdi-
nelli M.). Guspini . Montevecchio, Piccalinna, m
225, mining landfills covered by pioneer plants, 1
male 7-21.IV.2009, 2 males and 3 females 21.IV-
5.V.2009, 3 females 18.V-3.VI.2009, 1 male and 1
female 5-18.V.2009, 2 females 15-30.VI.2009
(ISE); m 235, garrigue, 2 males 18.V-3.VI.2009 (all
pitfall traps and leg. Sassu A., Verdinelli M.).
Haplodrassus macellinus (Thorell, 1871)
Chorotype. Mediterranean.
References. (11) de Carlini, 1885 (sub Drassus
macellinus ); (13) Gameri, 1902 (sub Drassus ma-
cellinus); (20) Krauss, 1955; (84) Pesarini, 1994.
Province. (84); Carbonia-Iglesias (11, 13); Sas-
sari (20).
Haplodrassus severus (C.L. Koch, 1839)
Chorotype. Mediterranean.
References. (10) Costa, 1885 (sub Drassus se-
verus); (20) Krauss, 1955; (30) Cerruti, 1968; (84)
Pesarini, 1994; (132) Pantini & Sassu, 2009.
Province. (20, 30, 84); Cagliari (10); Nuoro
(ined.); Sassari (132).
Habitat. Hypogean habitat (30).
Examined material. NUORO: Gavoi . S'eremu
e sa mela, m 1000, 1 male 13.VI.2006 leg. Mulas
A. (UCA).
Haplodrassus signifer (C.L. Koch, 1839)
Chorotype. Holarctic.
References. (6) Magretti, 1880 (sub Drassus
troglodytes); (8) Costa, 1884 (sub Drassus troglo-
dytes); (13) Gameri, 1902 (sub Drassus troglody-
tes); (20) Krauss, 1955; (84) Pesarini, 1994; (116)
Helsdingen, 2005; (133) Trotta, 2009.
Province. (20, 84); Cagliari (13); Carbonia-
Iglesias (6); Nuoro (116, ined.); Nuoro/Ogliastra (8,
13); Olbia-Tempio (133).
Habitat. At the margin of a field with stones and
shurbs (116); cherry-orchard (ined.).
Examined material. NUORO: Belyi, Manna-
ritzo, m 706, cherry-orchard, pitfall traps, 1 female
18-26.IV.2007 leg. I.S.E. (ISE).
*Leptodrassus femineus (Simon, 1873)
Chorotype. W-Mediterranean.
Habitat. Garrigue (ined.); mining landfills co-
vered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Guspini . Montevecchio, Piccalinna, m 225, mining
landfills covered by pioneer plants, 1 female
27.VII-10.VIII.2009 (ISE); m 235, garrigue, 1 fe-
male 25.VIII-8.IX.2009 (ISE) (all pitfall traps and
leg. Sassu A., Verdinelli M.).
*Micaria albovittata (Lucas, 1 846)
Chorotype. Palearctic.
Habitat. Under Juniperus sp. (ined.); walnut-
orchard (ined.).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
67
Examined material. NUORO: Fonni . Gennar-
gentu, mountain refuge, m 1550, under Juniperus sp.,
pitfall traps, 1 male 19.VI-1.VII.2007 leg. Fiori F.
(ISE). Tonara, Su Azzime, m 682, walnut-orchard,
pitfall traps, 1 female 21-28.VI.2007 leg. I.S.E. (ISE).
Micaria coarctata (Lucas, 1 846)
Chorotype. Centralasiatic-Mediterranean.
References. (8) Costa, 1884 (sub M. smarag-
dula ); (13) Gameri, 1902 (sub M. smaragdula ).
Province. Medio Campidano (ined.); Nuoro
(ined.); Sassari (8, 13).
Habitat. Cherry-orchard (ined.); garrigue (ined.);
mining landfills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining landfills
covered by pioneer plants, 1 female 29. VI-
14.VII.2009, 1 male 4-16.VI.2009 (ISE); m 200,
garrigue, 1 male 16-29.VI.2009 (ISE) (all pitfall
traps and leg. Sassu A., Verdinelli M.). Guspini .
Montevecchio, Piccalinna, m 235, garrigue, pitfall
traps, 1 male 15-30.VI.2009 (ISE), 1 male 15-
30.VI.2009 (MBG) (all leg. Sassu A., Verdinelli M.).
NUORO: Belvi, Antonitzo, m 683, cherry-or-
chard, pitfall traps, 1 female 17-24. VII. 2007 leg.
I.S.E. (ISE).
* Micaria cyrnea Brignoli, 1983
Chorotype. Mediterranean.
Habitat. Forest of Quercus suber (ined.); wal-
nut-orchard (ined.).
Examined material. NUORO: Belvi . Canale e'
Figu, m 576, walnut- orchard, bark traps, 1 male
26.IV-4.V.2007 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Budduso . near Nuraghe Lo-
elle, forest of Quercus suber , beating tray, 1 female,
24. V. 1999, leg. 1st. Ent. SS (ISE).
Micaria pulicaria (Sundevall, 1831)
Chorotype. Holarctic.
References. (13) Gameri, 1902.
Province. Cagliari (13).
Nomisia aussereri (L. Koch, 1872)
Chorotype. Palearctic.
References. (20) Krauss, 1955; (76) Grimm,
1985; (84) Pesarini, 1994.
Province. (76, 84); Nuoro (76); Sassari (20).
Nomisia exornata (C.L. Koch, 1839)
Chorotype. Turano-European.
References. (13) Gameri, 1902 (sub Pythonissa
exornata)', (76) Grimm, 1985; (84) Pesarini, 1994.
Province. (13, 84); Cagliari (13); Carbonia-
Iglesias (76); Medio Campidano (ined.); Nuoro
(ined.); Nuoro/Ogliastra (13).
Habitat. Road verge (6); garrigue (ined.); mediter-
ranean maquis (ined.); walnut-orchard (ined.); mi-
ning landfills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 male 4- 16. VI. 2009, 1 female 10-
25. VIII. 2009 (ISE); m 170, mining landfills cov-
ered by pioneer plants, 8 males, 3 females and 2 juv.
19.V-4.VI.2009 (ISE), 1 male and 1 female 4-
16.VI.2009 (MBG), 7 males and 2 females 4-
16.VI.2009, 4 females 16-29.VI.2009, 3 females
29.VI-14.VII.2009 (ISE); m 200, garrigue, 6 males
and 2 females 19.V-4.VI.2009, 1 female 29. VI-
14. VII.2009, 2 males 4-16.VI.2009 (ISE) (all pit-
fall traps and leg. Sassu A., Verdinelli M.). Guspini .
Montevecchio, Piccalinna, m 225, mining landfills
covered by pioneer plants, 1 female 30. VI-
13.VII.2009, 1 male 3-15.VI.2009 (ISE); m 235,
garrigue, pitfall traps, 3 males 18.V-3.VI.2009 (ISE)
(all pitfall traps and leg. Sassu A., Verdinelli M.).
NUORO: Belvi . Canale e' Figu, m 576, walnut-
orchard, pitfall traps, 2 males 2 1-28. VI. 2007 leg.
I.S.E. (ISE).
* Nomisia recepta (Pavesi, 1880)
Chorotype. W-Mediterranean.
Habitat. Garrigue (ined.); mediterranean maquis
(ined.); mining landfills covered by pioneer plants
(ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 1 female 14-28. VII.2009 (ISE), m 170; mi-
ning landfills covered by pioneer plants, 1 male 4-
16.VI.2009, 1 male 16-29.VI.2009, 4 females
29. VI- 14. VII.2009, 1 female 14-28.VII.2009, 2 fe-
males 10-25. VIII. 2009 (ISE); m 200, garrigue, 2
68
P. Pantini, A. Sassu & G. Serra
males and 1 female, 19.V-4.VI.2009, 2 males and 1
female 16-29.VI.2009, 2 females 14-28.VII.2009,
1 female 10-25.VIII.2009 (ISE) (all pitfall traps and
leg. Sassu A., Verdinelli M.). Guspini . Montevec-
chio, Piccalinna, m 225, mining landfills covered
by pioneer plants, 1 male 3-15.VI.2009 (ISE); m
260, mediterranean maquis, 1 male 18.V-3.VI.2009,
1 female 15-30.VI.2009, 1 male, 30.VI-
13.VII.2009, 1 male 3-15.VI.2009 (ISE), 1 male
and 1 female 15-30.VI.2009 (MBG), 1 female 13-
27.VII.2009, 1 female 27.VII-10.VIII.2009, 1 fe-
male 10-25. VIII. 2009 (ISE) (all pitfall traps and
leg. Sassu A., Verdinelli M.).
*Phaeocedus braccatus (L. Koch, 1866)
Chorotype. Palearctic.
Habitat. Mining landfills covered by pioneer
plants (ined.).
Examined material. MEDIO CAMPIDANO:
Guspini . Montevecchio, Piccalinna, m 225, mining
landfills covered by pioneer plants, pitfall traps, 1 fe-
male 3-15.VI.2009 leg. Sassu A., Verdinelli M. (ISE).
Poecilochroa albomaculata (Lucas, 1 846)
Chorotype. W-Mediterranean.
References. (13) Garneri, 1902 (sub Poecilo-
chroa picta ); (84) Pesarini, 1994.
Province. (84); Cagliari (13); Ogliastra (13);
Oristano (13).
Scotophaeus blackwalli (Thorell, 1871)
Chorotype. Subcosmopolitan.
References. (94) Amo et al., 1998; (127) Lom
et al., 2008.
Province. (127); Cagliari (ined.); Medio-Cam-
pidano (ined.); Nuoro (ined.); Olbia-Tempio (ined.);
Sassari (94, ined.).
Habitat. Citrus-grove (ined.); avenue of lime
trees (94); orchard (ined.); mediterranean maquis
(ined.); hazelnut-orchard (127, ined.); pinewood
(ined.); forest of Quercus suber (ined.).
Examined material. CAGLIARI: Pula . Pixina
Manna, m 140, pinewood, emergence cages, 1 male,
30.VI.2009 leg. 1st. Ent. SS (ISE). Uta, S’Appassiu,
Agris farm, citms-grove, beating tray, 1 female
23.X.2000, 1 female, 2.XI.2000 leg. CRAS (ISE).
MEDIO CAMPIDANO: Guspini . Montevecchio,
Piccalinna, m 260, mediterranean maquis, pitfall
traps, 1 male, 18.V-3.VI.2009, leg. Sassu A., Ver-
dinelli M. (ISE).
NUORO: Belvi, Su Enazzu, m 550, hazelnut-or-
chard, bark traps, 1 female 25.V-1.VI.2005 leg.
I.S.E. (ISE).
OLBIA-TEMPIO: Budduso . near Nuraghe Lo-
elle, forest of Quercus suber , beating tray, 1 female
31.V.1999 leg. 1st. Ent. SS (ISE).
SASSARI: Sorso . Pianu Mannu, Nali farm, or-
chard, bark traps, 1 male and 1 female 24-
3 l.VII. 1997 leg. 1st. Ent. SS (ISE).
Scotophaeus scutulatus (L. Koch, 1866)
Chorotype. Sibero-European.
References. (133) Trotta, 2009.
Province. Cagliari (ined.); Nuoro (ined.);
Olbia-Tempio (133); Oristano (ined.); Sassari
(ined.).
Habitat. Citms-grove (ined.); on trees lining a
street (ined.); orchard (ined.); hazelnut-orchard
(ined.).
Examined material. CAGLIARI: Uta, S’Appas-
siu, Agris farm, citms-grove, beating tray, 1 female,
2.XI.2000, 1 female 13.XI.2000 leg. CRAS (ISE).
NUORO: Belvi . Su Enazzu, m 550, hazelnut-or-
chard, bark traps, 1 female 20-27. X.2004 leg. I.S.E.
(ISE). Gavoi, 1 male 14.IX.2009 leg. Mulas A.
(UCA).
ORISTANO: San Vero Milis . Mandriola, 1 fe-
male 29.V.2005, 1 female 21.VIII.2008 leg. Mulas
A. (UCA).
SASSARI: Alghero . inside house, at sea level, 1
male 31. IX. 1998 leg. Pantaleoni R.A. (ISE). Sas-
sari . m 522, on trees lining a street, bark traps, 1 fe-
male 10.XI.1993 leg. 1st. Ent. SS (ISE). Sorso .
Pianu Mannu, Nali farm, orchard, bark traps, 1
male, 18-25.IX.1997, 1 female 24.XI-2.XII. 1997
leg. 1st. Ent. SS (ISE).
Scotophaeus validus (Lucas, 1 846)
Chorotype. Mediterranean.
References. (20) Krauss, 1955; (84) Pesarini,
1994; (127) Lom et al., 2008.
Province. (20, 84, 127); Nuoro (ined.).
Habitat. Hazelnut-orchard (127, ined.).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
69
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, bark traps, 1 fe-
male 29.IX-6.X.2005 leg. I.S.E. (ISE).
Setaphis carmeli (O.P.-Cambridge, 1872)
Chorotype. Mediterranean.
References. (2b) Canestrini, 1873 (sub Mela-
nophora latipes ); (11) de Carlini, 1885 (sub Pro-
sthesima latipes ); (13) Gameri, 1902 (sub
Prosthesima latipes and sub Prosthesima brachia-
lis, n. sp.); (20) Krauss, 1955 (sub Zelotes carmeli)',
(84) Pesarini, 1994 (sub Zelotes carmeli ).
Province. (20, 2b, 84); Carbonia-Iglesias (11,
13); Medio Campidano (ined.); Nuoro (ined.);
Ogliastra (13).
Habitat. Cheny-orchard (ined.); garrigue (ined.);
hazelnut-orchard (ined.); walnut-orchard (ined.);
mining landfills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining lan-
dfills covered by pioneer plants, 1 male 21.IV-
5.V.2009 (ISE), 1 male 5-19.V.2009 (MBG), 1
male, 5-19.V.2009 (ISE); m 200, garrigue, 1 male
and 1 female, 19.V-4.VI.2009 (ISE) (all pitfall traps
and leg. Sassu A., Verdinelli M.). Guspini . Monte-
vecchio, Piccalinna, m 235, garrigue, pitfall traps,
4 males, 5-18.V.2009 (ISE), 1 female, 18.V-
3. VI. 2009. (MBG), 1 female, 30.VI-13.VII.2009
(ISE) (all leg. Sassu A., Verdinelli M.).
NUORO: Belvi, Antonitzo, m 683, cherry-or-
chard, 1 male 21-28.VI.2007 (ISE); Canale e' Figu,
m 576, walnut-orchard, 1 male and 1 female 16-
23.V.2007, 2 females 21-28.VI.2007 (ISE); Manna-
ritzo, m 706, cherry-orchard, 1 male 18-26.IV.2007,
4 males 16-23.V.2007, 2 males and 1 female 21-
28.VI.2007 (ISE); Su Enazzu, m 550, hazelnut-or-
chard, 1 female 27.VII-8.VIII.2006, 2 females
13-27.VII.2006 (MBG), 3 females 13-27.VII.2006
(ISE), 1 female 8-24.VIII.2006 (MBG) (all pitfall
traps and leg. I.S.E.).
* Setaphis parvula (Lucas, 1846)
Chorotype. W-Mediterranean.
Habitat. Garrigue (ined.); mining landfills cov-
ered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus, Ingurtosu, Naracauli, m 170, mining land-
fills covered by pioneer plants, 1 male 19.V-
4. VI. 2009 (MBG), 1 male 5-19.V.2009 (ISE); m
200, garrigue, 1 male 19.V-4.VI.2009 (ISE) (all pit-
fall traps and leg. Sassu A., Verdinelli M.).
Remarks. This data represents the first record
for Italian fauna.
Trachyzelotes barbatus (L. Koch, 1866)
Chorotype. Holarctic.
References. (10) Costa, 1885 (sub Prosthesima
barb at a).
Province. Carbonia-Iglesias (10); Medio Cam-
pidano (ined.); Nuoro (ined.).
Habitat. Cherry-orchard (ined.); garrigue (ined.);
mining landfills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining land-
fills covered by pioneer plants, 1 male 19.V-
4. VI. 2009 (MBG), m 200; garrigue, 1 male
21.IV-5.V.2009, 5 males 5-19.V.2009, 1 male and
1 female 19.V-4.VI.2009, 1 female 4-16.VI.2009
(ISE) (all pitfall traps and leg. Sassu A., Verdinelli
M.). Guspini . Montevecchio, Piccalinna, m 235,
garrigue, pitfall traps, 1 male 21.IV-5.V.2009, 1
male 18.V-3.VI.2009 (ISE), 1 male and 3 females,
30.VI-13.VII.2009 (MBG), 2 females 30.VI-
13.VII.2009, 2 males 3-15.VI.2009, 2 males and
1 female 15-30.VI.2009, 3 females 27. VII-
10.VIII.2009, 1 female 13-27.VII.2009, 1 male 6-
20.X.2009 (ISE) (all leg. Sassu A., Verdinelli M.).
NUORO: Belvi . Antonitzo, m 683, cherry-or-
chard, 1 male, 17-24.VII.2007 (ISE); Mannaritzo,
m 706, cherry-orchard, 1 male 2 1-28. VI. 2007
(ISE) (all pitfall traps and leg. I.S.E.).
Trachyzelotes f us cipes (L. Koch, 1866)
Chorotype. Centralasiatic-European.
References. (13) Garneri, 1902 (sub Prosthe-
sima fus cipes).
Province. Cagliari (13).
* Trachyzelotes pedestris (C.L. Koch, 1837)
Chorotype. European.
Habitat. Orchard (ined.).
Examined material. S AS SARI: Sorso . Pianu
Mannu, Nali farm, orchard, pitfall traps, 1 male and
70
P. Pantini, A. Sassu & G. Serra
1 female, 26.VI-2.VII. 1997, 1 male 10-17.VII.1997,
1 male 11-19.VI.1998 leg. 1st. Ent. SS (ISE).
Urozelotes rusticus (L. Koch, 1872)
Chorotype. Cosmopolitan.
References. (10) Costa, 1885 (sub Prosthesima
rustica).
Province. Cagliari (10).
*Zelotes dentatidens Simon, 1914
Chorotype. W-Mediterranean.
Habitat. Mining landfills covered by pioneer
plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining
landfills covered by pioneer plants, pitfall traps,
2 females 5-19.V.2009, 1 female 19.V-4.VI.2009
(ISE), 1 male and 1 female 19.V-4.VI.2009 (MBG),
1 male and 1 female 4- 16. VI. 2009, 2 females 16-
29.VI.2009 (ISE) (all leg. Sassu A., Verdinelli M.).
Guspini . Montevecchio, Piccalinna, m 225, mining
landfills covered by pioneer plants, pitfall traps, 1
male 21.IV-5.V.2009, 1 male 5-18.V.2009. (MBG),
1 male and 2 females, 18.V-3.VI.2009, 3 females
30.VI-13.VII.2009, 1 male and 3 females 15-
30.VI.2009 (ISE), 2 females 30.VI-13.VII.2009
(MBG), 1 male and 1 female 3-15.VI.2009 (ISE),
1 male and 2 females 3-15.VI.2009 (MBG), 2 fe-
males 27.VII-10.VIII.2009 (ISE), 1 female 13-
27.VII.2009, 1 female 25.VIII-8.IX.2009 (MBG),
1 female 10-25.VIII.2009 (ISE) (all leg. Sassu A.,
Verdinelli M.).
Remarks. The epigynum and the male palp of
this species are illustrated in figures 12, 13.
*Zelotes egregius Simon, 1914
Chorotype. W-Mediterranean.
Habitat. Under Juniperus sp. (ined.).
Examined material. NUORO: Desulo . Gennar-
gentu, mountain refuge, m 1500, under Juniperus
sp., pitfall traps, 1 male 23.VIII-5.IX.2006 leg. Fiori
F. (ISE). Fonni . Gennargentu, mountain refuge, m
1550, under Juniperus sp., pitfall traps, 1 male 2-
17.VIII.2006 leg. Fiori F. (ISE).
Figures 12, 13. Zelotes dentatidens Simon, 1914 (scale 0.2 mm): (12) epigyne, ventral view, Guspini (VS), Montevecchio,
Piccalinna m 225, 3-15.VI.2009 leg. Sassu A., Verdinelli M.; (13) ventral view of left male pedipalp, Arbus (VS), Ingurtosu,
Naracauli m 120, 19.V-4.VI.2009 leg. Sassu A., Verdinelli M.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
71
Zelotes femellus (L. Koch, 1866)
Chorotype. S-European.
References. (20) Krauss, 1955; (111) Senglet,
2004.
Province. (20); Cagliari (111); Nuoro (ined.);
Ogliastra (111); Olbia-Tempio (111); Sassari (111).
Habitat. Hazelnut-orchard (ined.); walnut-or-
chard (ined.).
Examined material. NUORO: Belvi . Canale e'
Figu, m 576, walnut-orchard, 3 males, 27. IX-
4.X.2007 (ISE), Su Enazzu, m 550, hazelnut-or-
chard, 1 male, 21.IX-5.X.2006 (ISE) (all pitfall
traps and leg. I.S.E.). Gavoi, S'eremu e sa mela, m
1000, 1 female 10.V.2005, 1 female 16.11.2006, 1
female 13.III.2006, 1 female 18.IX.2006 leg.
Mulas A. (UCA).
Zelotes fuscorufus (Simon, 1878)
Chorotype. W-Mediterranean.
References. (Ill) Senglet, 2004; (139) Trotta,
2011.
Province. Medio Campidano (ined.); Oristano
(111); Sassari (111, 139).
Habitat. Dry litter on sand (111); dry litter,
barks (111); garrigue (ined.); mediterranean maquis
(ined.); mining landfills covered by pioneer plants
(ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, 2 males, 16-29.VI.2009, 3 males and 1 fe-
male 29.VI-14.VII.2009, 2 females 28.VII-
10.VIII.2009, 1 male and 2 females, 14-28.VII.2009,
1 female 10-25.VIII.2009, 1 female 25. VIII-
8.IX.2009 (ISE); m 170, mining landfills covered by
pioneer plants, 1 female 16-29. VI. 2009, 1 female
29. VI-14.VII.2009, 1 male and 2 females 14-
28.VII.2009 (ISE); m 200, garrigue, 1 female 29.VI-
14.VII.2009 (ISE), 1 female 28.VII-10.VIII.2009
(MBG), 1 female 14-28.VII.2009 (ISE) (all pitfall
traps and leg. Sassu A., Verdinelli M.). Guspini .
Montevecchio, Piccalinna, m 225, mining landfills
covered by pioneer plants, 2 males and 2 females
30. VI-13.VII.2009, 1 male 15-30.VI.2009, 2 fema-
les 27.VII-10.VIII.2009, 1 male and 1 female 13-
27.VII.2009 (ISE); m 235, garrigue, 1 female
13-27. VII. 2009 (ISE); m 260, mediterranean ma-
quis, 3 males 15-30.VI.2009 (ISE), 1 female 30.VI-
13.VII.2009 (MBG), 1 male 3-15.VI.2009 (ISE), 2
males 3-15.VI.2009 (MBG), 1 female 30.VI-
13. VII.2009, 4 females 13-27.VII.2009, 1 female
27. VII-10.VIII.2009 (ISE) (all pitfall traps and leg.
Sassu A., Verdinelli M.).
Zelotes nilicola (O.P. -Cambridge, 1874)
Chorotype. Holarctic.
References. (132) Pantini & Sassu, 2009.
Province. Medio-Campidano (ined.); Nuoro
(ined.); Sassari (132, ined.).
Habitat. Cherry-orchard (ined.); orchard (ined.);
walnut-orchard (ined.); mining landfills covered by
pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining landfills
covered by pioneer plants, pitfall traps, 2 females
29.VI-14.VII.2009 leg. Sassu A., Verdinelli M. (ISE).
NUORO: Belvi . Canale e' Figu, m 576, walnut-
orchard, 1 male and 3 females 21-28.VI.2007, 2 fe-
males 17-24. VII. 2007 (ISE); Mannaritzo, m 706,
cherry-orchard, 1 male 21-28.VI.2007 (ISE) (all pit-
fall traps and leg. I.S.E.).
SASSARI: Sorso . Pianu Mannu, Nali farm, or-
chard, pitfall traps, 1 male 26.VI-2.VII. 1997 leg.
1st. Ent. SS (ISE).
Zelotes ruscinensis Simon, 1914
Chorotype. W-Mediterranean.
References. (Ill) Senglet, 2004; (139) Trotta,
2011.
Province. Carbonia-Iglesias (139); Medio
Campidano (ined.); Oristano (ined.); Sassari (111).
Habitat. Garrigue (ined.); mining landfills co-
vered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining landfills
covered by pioneer plants, 1 male 16-29.VI.2009,
12 males 29.VI-14.VII.2009, 7 females 28.VII-
10.VIII.2009, 7 males and 1 female, 14-
28. VII.2009, 2 females 10-25.VIII.2009 (ISE), 2
females 10-25.VIII.2009 (MBG), 2 females 25. VIII-
8.IX.2009, 1 female 8-22.IX.2009 (ISE); m 200,
garrigue, 23 males 29.VI-14.VII.2009, 1 male 16-
29. VI.2009 (ISE), 5 males and 1 female, 29.VI-
14. VII. 2009 (MBG), 1 male and 20 females
28.VII-10.VIII.2009, 22 males and 11 females 14-
72
P. Pantini, A. Sassu & G. Serra
28.VII.2009, 7 females 25.VIII-8.IX.2009, 13 fe-
males 10-25.VIII.2009, 1 female 22.IX-6.X.2009
(ISE) (all pitfall traps and leg. Sassu A., Verdinelli
M.). Guspini . Montevecchio, Piccalinna, m 225, mi-
ning landfills covered by pioneer plants, 1 male
30.VI-13.VII.2009 (ISE); m 235, garrigue, 2 males
15-30.VI.2009, 9 males 30.VI-13.VII.2009, 4 males
and 6 females, 27.VII-10.VIII.2009, 14 males and 5
females 13-27.VII.2009 (ISE), 3 females 10-
25.VIII.2009 (MBG), 8 females 10-25.VIII.2009, 2
females 25.VIII-8.IX.2009, 2 females 22. IX-
6. X.2009, 4 females 8-22.IX.2009 (ISE) (all pitfall
traps and leg. Sassu A., Verdinelli M.).
ORISTANO: San Vero Milis . Mandriola, 1 male
7. VIII. 2004; Spinarbas 1 male 1.VII.2004 leg.
MulasA. (UCA).
Zelotes sardus (Canestrini, 1873)
Chorotype. Tyrrhenian endemic.
References. (2b) Canestrini, 1873 (sub Prosthe-
sima sarda ); (2c) Canestrini, 1876 (sub Prosthesima
sarda); (3) Pavesi, 1876 (sub Prosthesima sarda);
(13) Gameri, 1902 (sub Prosthesima sarda); (73)
Brignoli & Muiphy, 1984; (84) Pesarini, 1994; (111)
Senglet, 2004; (133) Trotta, 2009; (139) Trotta, 2011.
Province. (13, 2b, 2c, 84); Cagliari (13, 73);
Carbonia-Iglesias (3, 13, 139); Medio Campidano
(73, ined.); Nuoro (73, 111, ined.); Nuoro/Ogliastra
(13); Ogliastra (13, 111); Olbia-Tempio (73, 133);
Oristano (13, 111, ined.); Sassari (73, 111, ined.).
Habitat. Cherry- orchard (ined.); garrigue
(ined.); mediterranean maquis (ined.); walnut-or-
chard (ined.); under Juniperus sp. (ined.); mining
landfills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining landfills
covered by pioneer plants, 1 female 2 1 .IV-5 . V.2009,
1 female 19.V-4.VI.2009, 2 males 25.VIII-
8.IX.2009, 2 males 8-22.IX.2009, 1 male and 1 fe-
male 22.IX-6.X.2009 (ISE); m 200, garrigue, 5
females 21. IV-5. V.2009, 3 females 19.V-4.VI.2009,
2 females 5-19.V.2009, 1 female 16-29.VI.2009, 1
female 14-28.VII.2009, 1 male 25.VIII-8.IX.2009,
3 males 8-22.IX.2009, 7 males 22.IX-6.X.2009, 5
males 6-20.X.2009 (ISE) (all pitfall traps and leg.
Sassu A., Verdinelli M.). Guspini . Montevecchio,
Piccalinna, m 225, mining landfills covered by pio-
neer plants, 2 females 21. IV-5 .V.2009, 2 females 5-
18. V.2009, 1 female 18.V-3.VI.2009, 2 females 15-
30.VI.2009, 1 male 10-25.VIII.2009, 2 males
25.VIII-8.IX.2009, 1 male 6-20.X.2009 (ISE); m
235, garrigue, 4 females 21. IV-5. V.2009, 2 females
5-18. V.2009, 1 female 3-15.VI.2009, 2 males 10-
25.VIII.2009, 14 males 25.VIII-8.IX.2009, 10 males
and 1 female 8-22. IX. 2009, 6 males 22. IX-
6.X.2009, 1 male and 1 female 6-20.X.2009 (ISE);
m 260, mediterranean maquis, 1 female 3-
15.VI.2009 (ISE) (all pitfall traps and leg. Sassu A.,
Verdinelli M.).
NUORO: Belyi, Antonitzo, m 683, cherry-or-
chard, 4 males 24-30.VIII.2007, 2 males 27.IX-
4.X.2007 (ISE); Canale e' Figu, m 576,
walnut-orchard, 1 male 24-30.VIII.2007 (ISE); Man-
naritzo, m 706, cherry-orchard, 1 female 11-
18.IV.2007, 1 female 16-23.V.2007, 2 males
24-30. VIII.2007, 2 males 4-11.X.2007 (all pitfall
traps and leg. I.S.E.). Desulo, Gennargentu, mountain
refuge, m 1500, under Juniperus sp., pitfall traps, 1
male 11-25.VII.2006, 1 male 25.VII-9.VIII.2006
leg. Fiori F. (ISE). Fonni . Gennargentu, mountain re-
fuge, m 1550, under Juniperus sp., pitfall traps, 1
male 19.VII-2.VIII.2006, 3 males 2-17.VIII.2006, 1
female 5-19.VI.2007, leg. Fiori F. (ISE). Siniscola .
Monte Albo, on the road to Lula, m 800, pitfall traps,
1 female 1 9-26.1 V.2003, leg. Pantini P, Magnati F.
(MBG). Tonara, Su Azzime, m 682, walnut-orchard,
pitfall traps, 2 females 16-23.V.2007, 1 female 21-
28.VI.2007, 1 female 17-24.VII.2007, 1 female 24-
30.VIII.2007, 1 female 4-1 1.X.2007 leg. I.S.E. (ISE).
OLBIA-TEMPIO: Olbia . Isola Molarotto, 1 fe-
male 18.V.1966 leg. Gruppo Isole C.N.R. (MBG).
ORISTANO: Cabras, Isola Mai di Ventre, 5 fe-
males 17-18.IV.2006 leg. MulasA. (UCA).
Zelotes tenuis (L. Koch, 1866)
Chorotype. Holarctic.
References. (133) Trotta, 2009; (137) Senglet,
2011.
Province. Cagliari (137); Medio- Campidano
(ined.); Nuoro (137, ined.); Ogliastra (137); Olbia-
Tempio (133); Sassari (137).
Habitat. Cherry-orchard (ined.); dam leaf litter
(137); lagoon (137); hazelnut-orchard (ined.); wal-
nut-orchard (ined.); under Juncus (137); mining
landfills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Catalogue of the spiders (Arachnida Araneae) of Sardinia
73
Guspini , Montevecchio, Piccalinna, m 225, mining
landfills covered by pioneer plants, pitfall traps, 2
females 30.VI-13.VII.2009, 3 males and 2 females
15-30.VI.2009, 1 male 3-15.VI.2009, 2 females 13-
27.VII.2009 leg. Sassu A., Verdinelli M. (ISE).
NUORO: Belvi, Antonitzo, m 683, cherry-or-
chard, 4 males 2 1-28. VI. 2007, 1 female 17-
24.VII.2007 (ISE); Canale e' Figu, m 576,
walnut-orchard, 2 males 21-28.VI.2007, 2 males and
1 female 17-24.VII.2007, 1 female 24-30. VIII.2007
(ISE); Mannaritzo, m 706, cherry-orchard, 1 female
21-28.VI.2007 (ISE); Su Enazzu, m 550, hazelnut-
orchard, 1 female 27. VII-8. VIII. 2006, 1 male and 1
female 13-27.VII.2006 (MBG), 1 male and 1 female
13-27.VII.2006 (ISE), 1 female 8-24.VIII.2006
(MBG) (all pitfall traps and leg. I.S.E.).
Family SPARASSIDAE
Micrommata ligurina (C.L. Koch, 1845)
Chorotype. Mediterranean.
References. (6) Magretti, 1880; (10) Costa,
1885; (13) Garneri, 1902; (20) Krauss, 1955; (84)
Pesarini, 1994; (114) Grill et al., 2005; (139)
Trotta, 2011.
Province. (20, 84, 114); Cagliari (13); Carbo-
nia-Iglesias (6, 13, 139); Nuoro (ined.); Ogliastra
(13); Oristano (10).
Habitat. Grass and shurbland (114); walnut-or-
chard (ined.).
Examined material. NUORO: Tonara, Su Az-
zime, m 682, walnut-orchard, pitfall traps, 1 male
18-26.IV.2007 leg. I.S.E. (ISE).
Micrommata virescens (Clerck, 1757)
Chorotype. Palearctic.
References. (6) Magretti, 1880; (10) Costa,
1885; (13) Gameri, 1902; (84) Pesarini, 1994; (132)
Pantini & Sassu, 2009.
Province. (10, 84); Oristano (13); Orista-
no/Nuoro (6); Sassari (13, 132).
Olios argelasius (Walckenaer, 1805)
Chorotype. Mediterranean.
References. (8) Costa, 1884 (sub O. spongitar-
sis ); (13) Gameri, 1902 (sub Sparassus spongitar-
tis ); (127) Lom et al., 2008; (132) Pantini & Sassu,
2009; (139) Trotta, 2011.
Province. (127); Cagliari (13, ined.); Carbonia-
Iglesias (139); Medio Campidano (139, ined.);
Nuoro (8); Oristano (8, ined.); Sassari (132).
Habitat. Citms-grove (ined.); mediterranean
maquis (ined.); hazelnut-orchard (127).
Examined material. CAGLIARI: Domus de
Maria . Punta su Pisu, m 14, 1 male and 1 female
XII. 2006 leg. Ruzzante-Wilkins J. (MBG). Uta,
S’Appassiu, Agris farm, citms-grove, beating tray,
1 female, 29.VI.2000, 1 female 10.VIII.2000, 1 fe-
male 1. IX. 2000, 2 males 21. IX. 2000, 1 female
12.X.2000, 1 male 4.X.2000, 1 female 2.XI.2000,
1 female 13.XI.2000 leg. CRAS (ISE).
MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-
cauli, m 120, mediterranean maquis, pitfall traps, 1
male 21.IV-5.V.2009 leg. Sassu A., Verdinelli M.
(ISE). Guspini . Montevecchio, Piccalinna, m 260,
mediterranean maquis, pitfall traps, 1 male 3-
15.VI.2009 leg. Sassu A., Verdinelli M. (ISE).
ORISTANO: Cabras . San Giovanni in Sinis, 1
male, 26.IV.2003, leg. Pantini P., Magnati F. (MBG).
Family PHILODROMIDAE
Philodromus aureolus (Clerck, 1757)
Chorotype. Palearctic.
References. (8) Costa, 1884; (13) Gameri,
1902; (84) Pesarini, 1994; (110) Muster & Thaler,
2004; (139) Trotta, 2011.
Province. (84); Cagliari (13); Carbonia-Igle-
sias (13, 139); Nuoro (8, 13); Ogliastra (13, 110).
Philodromus bistigma Simon, 1870
Chorotype. Mediterranean.
References. (10) Costa, 1885; (13) Gameri,
1902; (123) Muster et al., 2007; (132) Pantini &
Sassu, 2009.
Province. Cagliari (13, 123, ined.); Medio-
Campidano (ined.); Nuoro (123, ined.);
Nuoro/Ogliastra (123); Ogliastra (13, 123); Ori-
stano (10, 123); Sassari (132, ined.).
Habitat. Cherry-orchard (ined.); mediterranean
maquis (ined.); hazelnut-orchard (ined.).
74
P. Pantini, A. Sassu & G. Serra
Examined material. CAGLIARI: Pula . Is Can-
noneris, m 715, 1 female, 18.VIII.2006, leg. Ruz-
zante-Wilkins (MBG).
MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-
cauli, m 120, mediterranean maquis, pitfall traps, 1
male 4-16.VI.2009 leg. Sassu A., Verdinelli M. (ISE).
NUORO: Belvi, Mannaritzo, m 706, cherry-or-
chard, 1 female 21-28.VI.2007 (ISE); Su Enazzu,
m 550, hazelnut-orchard, 1 female 27. VII-
8. VIII. 2006, 1 male 30.V-4.VII.2007 (MBG), 2
males and 1 female 30.V-4.VII.2007 (ISE) (all pit-
fall traps and leg. I.S.E.).
S AS SARI: Olmedo . Pulpazos, Perlina farm, 1
male 8.V.2008 leg. R.A. Pantaleoni (ISE).
Philodromus blanckei (Wunderlich, 1995)
Chorotype. Sardinian endemic.
References. (87) Wunderlich, 1995b (sub Ar-
tanes blanckei)', (131) Muster, 2009.
Province. Nuoro (131, ined.); Ogliastra (87,
131); Olbia-Tempio (131); Oristano (131).
Habitat. Under the bark (87), hazelnut-orchard
(ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-
male 4.V.2005 leg. I.S.E. (MBG).
* Philodromus bosmansi Muster & Thaler, 2004
Chorotype. W-Mediterranean.
Habitat. Citrus-grove (ined.).
Examined material. CAGLIARI: Uta, S’Ap-
passiu, Agris farm, citrus-grove, beating tray, 1 fe-
male 29.VI.2000 leg. CRAS (MBG).
Remarks. This data represents the first record
of this species for Italian and European fauna.
Philodromus buchari Kubcova, 2004
Chorotype. S-European.
References. (132) Pantini & Sassu, 2009.
Province. Sassari (132, ined.).
Examined material. SASSARI: Sassari . Li
Punti, Baldinca, m 110, 1 male 15. VI. 2008 leg.
Sassu A. (MBG).
* Philodromus buxi Simon, 1884
Chorotype. Sibero-European.
Habitat. Alder- grove (ined.).
Examined material. NUORO: Desulo, Gen-
nargentu, mountain refuge, m 1500, alder-grove,
bark traps, 3 females 25.VI-2.VII.2007 leg. Fiori
F. (ISE).
Philodromus dispar Walckenaer, 1 826
Chorotype. Holarctic.
References. (13) Gameri, 1902; (139) Trotta, 2011.
Province. Cagliari (13); Carbonia-Iglesias(139).
Philodromus emarginatus (Schrank, 1 803)
Chorotype. Palearctic.
References. (13) Gameri, 1902.
Province. (13); Ogliastra (13).
Philodromus fuscolimbatus Lucas, 1846
Chorotype. Mediterranean.
References. (10) Costa, 1885 (sub P. constel-
latus).
Province. Carbonia-Iglesias (10); Olbia-Tem-
pio (10).
Philodromus glaucinus Simon, 1870
Chorotype. European.
References. (10) Costa, 1885; (11) de Carlini,
1885; (13) Gameri, 1902; (123) Muster et al., 2007.
Province. Cagliari (13); Carbonia-Iglesias (10,
11, 13); Medio Campidano (123); Oristano (13);
Sassari (123).
Philodromus histrio (Latreille, 1819)
Chorotype. Holarctic.
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (13, 84); Sassari (ined.).
Habitat. Orchard (ined.).
Examined material. SASSARI: Sorso, Pianu
Mannu, Nali farm, orchard, bark traps, 1 male and
1 female 20-27.V.1998 leg. 1st. Ent. SS (ISE).
Philodromus lividus Simon, 1875
Chorotype. Mediterranean.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
75
References. (10) Costa, 1885; (13) Garneri,
1902; (110) Muster & Thaler, 2004; (114) Grill et
al., 2005; (127) Lorn et al., 2008; (132) Pantini &
Sassu, 2009; (139) Trotta, 2011.
Province. (114, 127); Cagliari (13, 110); Car-
bonia-Iglesias (10, 13, 139); Nuoro (ined.); Oglia-
stra (13, 110); Sassari (132, ined.).
Habitat. Low shurbs, grass and shurbland,
shurblands and trees (114); hazelnut-orchard (127,
ined.); olive-grove (ined.).
Examined material. NUORO: Belvh Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1
male 29.VI.2005 leg. I.S.E. (MBG). Tiana . m 522,
hazelnut- orchard, beating tray, 1 male and 1 juv.
29. VI. 2005, 1 female and 2 juv. 16. VI. 2005 leg.
I.S.E. (ISE).
SASSARI: Sorso, Pianu Mannu, Nali farm,
olive -grove, beating tray, 1 male 3 .VI. 1993 leg. 1st.
Ent. SS (ISE).
Philodromus margaritatus (Clerck, 1757)
Chorotype. Palearctic.
References. (2c) Canestrini, 1876 (sub P. ele-
gans ); (131) Muster, 2009; (139) Trotta, 2011.
Province. (2c); Medio Campidano (139);
Nuoro (131).
Remarks. For the correct assignment of Cane-
strini’s citation (1876) see Muster (2009: 149).
Philodromus praedatus O.P. -Cambridge, 1871
Chorotype. Sibero-European.
References. (94) Arno et al., 1998; (110) Mu-
ster & Thaler, 2004; (132) Pantini & Sassu, 2009.
Province. Medio-Campidano (ined.); Nuoro
(110); Ogliastra (110); Sassari (94, 132, ined.).
Habitat. Avenue of lime trees (94); orchard
(ined.); mediterranean maquis (ined.); vineyard
(ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 120, mediterranean
maquis, pitfall traps, 1 male, 16-29. VI. 2009, leg.
Sassu A., Verdinelli M. (ISE).
SASSARI: Sorso . Pianu Mannu, Nali farm, or-
chard, beating tray, 1 female 17.VII.1997 leg. 1st.
Ent. SS (ISE). Torralba . vineyard, 1 male and 1 fe-
male 24.V.1999 leg. 1st. Ent. SS (ISE).
Philodromus pulchellus Lucas, 1 846
Chorotype. Mediterranean.
References. (2c) Canestrini, 1876; (13) Gameri,
1902; (84) Pesarini, 1994; (123) Muster et al., 2007;
(127) Lorn et al., 2008; (132) Pantini & Sassu, 2009.
Province. (84, 127); Cagliari (2c, 13); Medio
Campidano (123); Nuoro (123, ined.); Olbia-Tem-
pio (123); Oristano (123); Sassari (123, 132).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Tiana . m 522,
hazelnut-orchard, beating tray, 1 male 16.VI.2005
leg. I.S.E. (ISE).
Philodromus rufus Walckenaer, 1 826
Chorotype. Holarctic.
References. (94) Arno et al., 1998; (127) Lorn
et al., 2008.
Province. (127); Nuoro (ined.); Sassari (94,
ined.).
Habitat. Avenue of lime trees (94); orchard
(ined.); hazelnut-orchard (127, ined.); olive-grove
(ined.); vineyard (ined.).
Examined material. NUORO: Belvi, Su
Enazzu, m 550, hazelnut-orchard, beating tray, 2 fe-
males 1. VI. 2005 leg. I.S.E. (MBG). Tiana . m 522,
hazelnut-orchard, beating tray, 1 female 1.VI.2005
leg. I.S.E. (ISE).
SASSARI: Sorso . Pianu Mannu, Nali farm, olive-
grove, 1 male 29.IV. 1993 (ISE); olive-grove, beating
tray, 1 female 21.V.1993, 2 females and 4 juv.
25. VI.1993 (ISE); orchard, beating tray, 1 female
26. VI.1997 (ISE) (all leg. 1st. Ent. SS). Torralba . vine-
yard, 1 female 18.VI.1994, 1 female 15.VII.1995, 1
male and 1 female 24.V.1999 leg. 1st. Ent. SS (ISE).
Thanatus formicinus (Clerck, 1757)
Chorotype. Holarctic.
References. (13) Gameri, 1902.
Province. (13).
Thanatus oblongiusculus (Lucas, 1 846)
Chorotype. Sibero-European.
References. (10) Costa, 1885 (sub T. oblongiu-
sculus ); (84) Pesarini, 1994 (sub Paratibellus
oblongiusculus).
76
P. Pantini, A. Sassu & G. Serra
Province. (84); Cagliari (10).
Thanatus vulgaris Simon, 1870
Chorotype. Holarctic.
References. (8) Costa, 1884; (13) Gameri, 1902;
(84) Pesarini, 1994; (132) Pantini & Sassu, 2009.
Province. (84); Cagliari (13); Medio-Campi-
dano (ined.); Ogliastra (13); Sassari (8, 13, 132).
Habitat. Under stones on the beach (8); mining
landfills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining landfills
covered by pioneer plants, pitfall traps, 2 males,
19.V-4.VI.2009, 1 female 29.VI-14.VII.2009, 1 fe-
male 4-16.VI.2009 leg. Sassu A., Verdinelli M. (ISE).
Tibellus oblongus (Walckenaer, 1802)
Chorotype. Holarctic.
References. (10) Costa, 1885; (13) Garneri,
1902.
Province. Cagliari (10, 13); Oristano (13); Sas-
sari (10).
Family THOMISIDAE
Cozyptila blackwalli (Simon, 1875)
Chorotype. Sibero-European.
References. (13) Gameri, 1902 (sub Oxyptila
blackwalli ); (84) Pesarini, 1994 (sub Ozyptila
blackwalli Simon, 1875).
Province. (84); Cagliari (13); Sassari (ined.).
Habitat. Olive-grove (ined.).
Examined material. SASSARI: Sorso, Pianu
Mannu, Nali farm, olive-grove, beating tray, 1 fe-
male l.VII. 1993 leg. 1st. Ent. SS (ISE).
Diaea dorsata (Fabricius, 1777)
Chorotype. Sibero-European.
References. (13) Garneri, 1902.
Province. Cagliari (13).
Heriaeus hirtus (Latreille, 1819)
Chorotype. European.
References. (10) Costa, 1885 (sub H. hirsutus );
(11) de Carlini, 1885 (sub Misumena savignyi ); (13)
Gameri, 1902 (sub H. savignyi ); (20) Krauss, 1955;
(71) Loerbroks, 1983; (84) Pesarini, 1994.
Province. (20, 84); Cagliari (13); Carbonia-
Iglesias (11, 13); Nuoro (10, 71).
Misumena vatia (Clerclc, 1757)
Chorotype. Holarctic.
References. (11) de Carlini, 1885; (13) Gameri,
1902; (84) Pesarini, 1994; (127) Lorn et al., 2008.
Province. (84, 127); Carbonia-Iglesias (11, 13).
Habitat. Hazelnut-orchard (127).
Monaeses paradoxus (Lucas, 1 846)
Chorotype. S-European.
References. (114) Grill et al., 2005.
Province. (114).
Habitat. Agricultural land (114).
Ozyptila atomaria (Panzer, 1801)
Chorotype. Palearctic.
References. (13) Gameri, 1902 (sub Oxyptila
horticola ); (84) Pesarini, 1994.
Province. (84); Cagliari (13).
Ozyptila bicuspis Simon, 1932
Chorotype. W-Mediterranean.
References. (116) Helsdingen, 2005.
Province. Nuoro (116).
Habitat. Grassland along the mouth of the river
(116).
Ozyptila brevipes (Hahn, 1 826)
Chorotype. Sibero-European.
References. (13) Gameri, 1902 (sub Oxyptila
brevipes ); (84) Pesarini, 1994.
Province. (84); Cagliari (13); Oristano (13).
Ozyptila confluens (C.L. Koch, 1845)
Chorotype. S-European.
References. (3) Pavesi, 1876 (sub Oxyptila gut-
Catalogue of the spiders (Arachnida Araneae) of Sardinia
77
tulata ); (13) Gameri, 1902 (sub Oxyptila grata); (20)
Krauss, 1955; (84) Pesarini, 1994; (132) Pantini &
Sassu, 2009; (133) Trotta, 2009; (139) Trotta, 2011.
Province. (20, 84); Carbonia-Iglesias (139);
Medio Campidano (139, ined.); Nuoro (ined.); Olbia-
Tempio (3, 133); Oristano (13); Sassari (132, 133).
Habitat. Cheny-orchard (ined.); garrigue (ined.);
hazelnut-orchard (ined.); walnut-orchard (ined.);
minning landfills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining lan-
dfills covered by pioneer plants, 3 males 6-
20.X.2009 (ISE); m 200, garrigue, 2 males,
22.IX-6.X.2009 (ISE), 2 males and 1 female 6-
20.X.2009 (MBG), 1 male and 3 females 6-
20.X.2009 (ISE) (all pitfall traps and leg. Sassu A.,
Verdinelli M.). Guspini . Montevecchio, Piccalinna,
m 235, garrigue, pitfall traps, 5 males 22. IX-
6.X. 2009, 5 males 6-20.X.2009 (ISE), 2 males and
1 female 6-20.X.2009 (MBG) (all leg. Sassu A.,
Verdinelli M.).
NUORO: Belvi, Antonitzo, m 683, cherry-or-
chard, 2 males 24-30.VIII.2007, 1 male 27.IX-
4.X. 2007 (ISE); Canale e' Figu, m 576,
walnut-orchard, 1 female 26.IV-4.V.2007 (ISE); Su
Enazzu, m 550, hazelnut-orchard, 1 male 24.VIII-
5. IX. 2006 (MBG), 2 males 21.IX-5.X.2006 1. (ISE)
(all pitfall traps and eg. I.S.E.). Tonara, Su Azzime,
m 682, walnut-orchard, pitfall traps, 1 female 17-
24.VII.2007, 2 males 4-11.X.2007 leg. I.S.E. (ISE).
Ozyptila pauxilla (Simon, 1870)
Chorotype. W-Mediterranean.
References. (139) Trotta, 2011.
Province. Carbonia-Iglesias (139).
Ozyptila praticola (C.L. Koch, 1837)
Chorotype. Holarctic.
References. (13) Gameri, 1902.
Province. Cagliari (13).
*Ozyptila sanctuaria (O.P. -Cambridge, 1871)
Chorotype. European.
Habitat. Cherry-orchard (ined.); garrigue
(ined.); mining landfills covered by pioneer plants
(ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining land-
fills covered by pioneer plants, pitfall traps, 1 fe-
male 6-20.X.2009 leg. Sassu A., Verdinelli M.
(ISE). Guspini . Montevecchio, Piccalinna, m 225,
mining landfills covered by pioneer plants, 1 female
5-18.V.2009 (ISE); m 235, garrigue, 1 female 15-
30.VI.2009, 5 males 6-20.X.2009 (ISE) (all pitfall
traps and leg. Sassu A., Verdinelli M.).
NUORO: Belvi . Mannaritzo, m 706, cherry-or-
chard, pitfall traps, 1 male 19-26.XI.2007 leg. I.S.E.
(ISE).
Pistius truncatus (Pallas, 1772)
Chorotype. Sibero-European.
References. (85) Buchar & Thaler, 1995; (127)
Lom et al., 2008.
Province. (127); Nuoro (85); Olbia-Tempio
(ined.).
Habitat. Hazelnut-orchard (127); forest of
Quercus suber (ined.).
Examined material. OLBIA-TEMPIO: Bud-
duso, near Nuraghe Loelle, forest of Quercus suber,
beating tray, 1 female 24.V.1999 leg. 1st. Ent. SS
(ISE). Telti . Rio Almiddina, 1 male 20.V.2008 leg.
Sassu A. (ISE).
Runcinia grammica (C.L. Koch, 1837)
Chorotype. Subcosmopolitan.
References. (8) Costa, 1884 (sub R. lateralis );
(11) de Carlini, 1885 (sub R. lateralis); (13) Gar-
neri, 1902 (sub R. lateralis); (84) Pesarini, 1994
(sub R. lateralis); (114) Grill et al., 2005 (sub R. la-
teralis); (139) Trotta, 2011.
Province. (84, 114); Cagliari (8, 13); Carbonia-
Iglesias (11, 13, 139); Sassari (ined.).
Habitat. Shurblands and trees, agricultural land
(114); vineyard (ined.).
Examined material. SASSARI: Torralba . vine-
yard, 1 female 30. VII. 1994 leg. 1st. Ent. SS (ISE).
Synema globosum (Fabricius, 1775)
Chorotype. Palearctic.
References. (8) Costa, 1884 (sub S. globosa);
(11) de Carlini, 1885 (sub Diaea globosa); (13) Gar-
neri, 1902 (sub S. globosa); (20) Krauss, 1955; (46)
78
P. Pantini, A. Sassu & G. Serra
Themies, 1972; (84) Pesarini, 1994; (94) Amo et al.,
1998 (sub Synaema globosum ); (112) Thaler & Kno-
flach, 2004; (114) Grill et al., 2005; (127) Lora et
al., 2008; (132) Pantini & Sassu, 2009 (sub Synaema
globosum)', (133) Trotta, 2009; (139) Trotta, 2011.
Province. (13, 20, 84, 114, 127); Cagliari (139);
Carbonia-Iglesias (11, 46, 139); Medio Campidano
(139); Nuoro (ined.); Ogliastra (112, 139); Olbia-
Tempio (133, ined.); Oristano/Nuoro (8); Sassari
(94, 132, 133, ined.).
Habitat. Avenue of lime trees (94); hypogean
habitat (46); low shurbs, grass and shurbland,
shurblands and trees (114); hazelnut-orchard (127,
ined.); grassland (ined.); vineyard (ined.).
Examined material. NUORO: Belyi, Su
Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-
male 19.V.2005 leg. I.S.E. (MBG). Bolotana . Badde
e'Salighes, m 850, grassland, 1 female 27.V.2007
leg. Sassu A. (ISE).
OLBIA-TEMPIO: Telth Rio Almiddina, 1 male
20.V.2008 leg. Sassu A. (ISE).
SASSARI: Sassari . Platamona, at sea level, 1
male and 1 female 22. V.2008 leg. Sassu A. (ISE).
Torralba . vineyard, 1 male 28.V.1994 leg. 1st. Ent.
SS (ISE).
Thomisus onustus Walckenaer, 1805
Chorotype. Palearctic.
References. (8) Costa, 1884; (11) de Carlini,
1885; (13) Garneri, 1902 (sub T. albus Nomina
dubia); (20) Krauss, 1955; (84) Pesarini, 1994; (94)
Amo et al., 1998; (114) Grill et al., 2005; (132) Pan-
tini & Sassu, 2009.
Province. (13, 20, 84, 114); Carbonia-Iglesias
(11); Oristano/Nuoro (8); Sassari (94, 132, ined.).
Habitat. Avenue of lime trees (94); shurblands
and trees (114); vineyard (ined.).
Examined material. SASSARI: Sassari . Plata-
mona, at sea level, 2 males and 1 female 22. V.2008
leg. Sassu A. (ISE). Torralba . vineyard, 1 male
17.VI.1995 leg. 1st. Ent. SS (ISE).
Tmarus piochardi (Simon, 1866)
Chorotype. W-Mediterranean.
References. (114) Grill et al., 2005.
Province. (114).
Habitat. Shurblands and trees (114).
Tmarus staintoni (O.P.-Cambridge, 1873)
Chorotype. W-Mediterranean.
References. (127) Lora et al., 2008.
Province. (127); Cagliari (ined.); Nuoro (ined.);
Sassari (ined.).
Habitat. Orchard (ined.); hazelnut-orchard
(127, ined.); olive-grove (ined.).
Examined material. CAGLIARI: Pula . Is Can-
noneris, m 715, 1 female 18. VIII. 2006 leg. Ruz-
zante- Wilkins (MBG).
NUORO: Tiana . m 522, hazelnut-orchard, bea-
ting tray, 1 female 1. VI. 2005 (MBG), 1 female
29.VI.2005 (ISE) (all leg. I.S.E.).
SASSARI: Alghero . Mamuntanas, olivegrove,
chemical knockdown, 1 male 6.VIII.2009 (MBG),
1 male and 1 female 27. VIII. 2009, 2 females,
7.IX.2009 (ISE), 2 females, 3.X.2009 (MBG), 2 fe-
males 27.X.2009 (ISE) all leg. 1st. Ent. SS. Sassari .
Lu Buttangara, olive-grove, 3 females 30.IX.2008
leg. 1st. Ent. SS (ISE). Sorso . Pianu Mannu, Nali
farm, olive-grove, 1 female, 9.VII.1993, 1 female
6.VIII.1993 (ISE); orchard, 1 female 26.VI.1997
(ISE) (all beating tray and leg. 1st. Ent. SS).
Xysticus acerbus Thorell, 1872
Chorotype. Sibero-European.
References. (10) Costa, 1885.
Province. Cagliari (10); Nuoro (10, ined.).
Habitat. Cherry-orchard (ined.); hazelnut-or-
chard (ined.).
Examined material. NUORO: Belvi . Manna-
ritzo, m 706, cherry-orchard, 1 male 11-18.IV.2007
(ISE); Su Enazzu, m 550, hazelnut-orchard, 1 male
26.IV-30.V.2007 (ISE) (all pitfall traps and leg.
I.S.E.).
Xysticus audax (Schrank, 1803)
Chorotype. Palearctic.
References. (13) Garneri, 1902 (sub X. pini);
(84) Pesarini, 1994.
Province. (84); Cagliari (13); Ogliastra (13).
Xysticus bifasciatus C.L. Koch, 1837
Chorotype. Palearctic.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
79
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (84); Cagliari (13).
Xysticus bliteus (Simon, 1875)
Chorotype. Mediterranean.
References. (5) Pavesi, 1878; (13) Garneri,
1902; (84) Pesarini, 1994 (sub Ozyptila bliteo );
(132) Pantini & Sassu, 2009.
Province. (84); Medio Campidano (ined.);
Olbia-Tempio (5, 13); Sassari (132).
Habitat. Mining landfills covered by pioneer
plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining land-
fills covered by pioneer plants, pitfall traps, 2
males, 22.IX-6.X.2009 (ISE) 1 male 22.IX-
6.X.2009 (MBG), 1 male and 1 juv. 8-22.IX.2009
(ISE) (all leg. Sassu A., Verdinelli M.).
Xysticus bufo (Dufour, 1 820)
Chorotype. Mediterranean.
References. (3) Pavesi, 1876 (sub Oxyptila albi-
mana ); (13) Gameri, 1902 (sub Oxyptila bufo ); (84)
Pesarini, 1994; (89) Wunderlich, 1995d (sub Psam-
mitis bufo); (133) Trotta, 2009; (139) Trotta, 2011.
Province. (84); Cagliari (13); Carbonia-Iglesias
(3, 13, 133, 139); Medio Campidano (ined.); Nuoro
(ined.); Sassari (89, ined.).
Habitat. Cherry-orchard (ined.); garrigue
(ined.); olive-grove (ined.); mining landfills cov-
ered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining lan-
dfills covered by pioneer plants, pitfall traps, 1
male, 22.IX-6.X.2009, leg. Sassu A., Verdinelli M.
(MBG). Guspini . Montevecchio, Piccalinna, m
235, garrigue, pitfall traps, 1 male 22. IX-
6.X. 2009, 1 male 6-20.X.2009 leg. Sassu A., Ver-
dinelli M. (ISE).
NUORO: Belvi, Mannaritzd, m 706, cherry-or-
chard, pitfall traps, 1 male 4-11.X.2007 leg. I.S.E.
(ISE). Gavoi . S'eremu e sa mela, m 1000, 1 female
30.XII.2006 leg. Mulas A. (MBG).
SASSARI: Alghero . Mamuntanas, olivegrove,
chemical knockdown, 1 male 13.X.2009 leg. 1st.
Ent. SS (ISE). Sassari . Lu Buttangam, olive-grove,
chemical knockdown, 1 male 29. IX. 2008 leg. 1st.
Ent. SS (ISE).
Xysticus caperatus Simon, 1875
Chorotype. Mediterranean.
References. (10) Costa, 1885; (84) Pesarini,
1994.
Province. (84); Olbia-Tempio (10).
Xysticus cor Canestrini, 1873
Chorotype. S -European.
References. (2b) Canestrini, 1873; (2c) Cane-
strini, 1876; (13) Gameri, 1902; (18) Simon, 1932;
(84) Pesarini, 1994.
Province. (2b, 2c, 13, 18, 84).
Xysticus cristatus (Clerck, 1757)
Chorotype. Palearctic.
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (84); Cagliari (13).
*Xysticus erraticus (Blackwall, 1834)
Chorotype. European.
Habitat. Hazelnut-orchard (ined.); alder-grove
(ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-
male 30.V-4.VII.2007 leg. I.S.E. (ISE). Fonni . Gen-
nargentu, mountain refuge, m 1550, alder-grove,
pitfall traps, 1 female 26.IX-10.X.2006, 7 males and
2 females 5-19.VI.2007, 1 male 19.VI-1.VII.2007
leg. Fiori F. (ISE).
Xysticus graecus C.L. Koch, 1837
Chorotype. Turano-European.
References. (84) Pesarini, 1994; (139) Trotta,
2011.
Province. (84); Nuoro (139).
Xysticus grallator Simon, 1932
Chorotype. Sardo-Corsican endemic.
80
P. Pantini, A. Sassu & G. Serra
References. (20) Krauss, 1955; (84) Pesarini,
1994; (139) Trotta, 2011.
Province. (84); Medio Campidano (139);
Olbia-Tempio (20).
*Xysticus ibex Simon, 1875
Chorotype. Centro-European.
Habitat. Orchard (ined.).
Examined material. S AS SARI: Sorso, Pianu
Mannu, Nali farm, orchard, pitfall traps, 1 male 10-
18.11.1998 leg. 1st. Ent. SS (ISE).
Xysticus kochi Thorell, 1872
Chorotype. Sibero-European.
References. (8) Costa, 1884; (13) Garneri,
1902; (20) Krauss, 1955; (84) Pesarini, 1994; (127)
Lorn et al., 2008.
Province. (20, 84, 127); Cagliari (8, 13); Nuoro
(8, 13, ined.); Oristano (13); Sassari (ined.).
Habitat. Cherry-orchard (ined.); orchard
(ined.); hazelnut-orchard (127, ined.).
Examined material. NUORO: Belyi, Manna-
ritzo, m 706, cherry- orchard, pitfall traps, 1 male
18-26.IV.2007, 2 males 16-23.V.2007 (ISE); Su
Ajone, m 585, hazelnut-orchard, beating tray, 1 fe-
male and 6 juv. 29. VI. 2005 (MBG), 1 female and 2
juv. E VI. 2005 (ISE) (all leg. I.S.E.).
OLBIA-TEMPIO: Olbia . Isola Molara, 2 fe-
males 25.11.1966 (MBG); Isola Tavolara, 1 female
24.11.1966 (MBG) (all leg. Gruppo Isole C.N.R.).
SASSARI: Sorso . Pianu Mannu, Nali farm, or-
chard, pitfall traps, 1 male 15-22.IV. 1998 leg. 1st.
Ent. SS (ISE).
Xysticus lanio C.L. Koch, 1835
Chorotype. Sibero-European.
References. (8) Costa, 1884; (13) Garneri,
1902; (84) Pesarini, 1994; (127) Lorn et al., 2008;
(139) Trotta, 2011.
Province. (8, 13, 84, 127); Carbonia-Iglesias
(139); Nuoro (ined.).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Belyi, Su
Ajone, m 585, hazelnut-orchard, 1 male and 1 juv.
19.V.2005 (MBG), 1 male and 2 juv. 1.VI.2005,
1 female and 2 juv. 29. VI. 2005 (ISE), 1 male
1. VI. 2005 (MBG); Su Enazzu, m 550, hazelnut-
orchard, 2 females and 1 juv. 16. VI. 2005 (MBG)
(all beating tray and leg. I.S.E.). Fonni, Talesso,
1 male 21.V.2008 leg. Pantaleoni R.A. and Lorn
L. (ISE).
Xysticus luctuosus (Blackwall, 1836)
Chorotype. Holarctic.
References. (46) Thermes, 1972; (84) Pesarini,
1994.
Province. (84); Cagliari (46).
Habitat. Hypogean habitat (46).
Xysticus nubilus Simon, 1875
Chorotype. Mediterranean.
References. (18) Simon, 1932; (20) Krauss,
1955; (84) Pesarini, 1994.
Province. (18, 20, 84).
Xysticus parallelus Simon, 1873
Chorotype. Sardo-Corsican endemic.
References. (18) Simon, 1932.
Province. (18).
Xysticus sardiniensis (Wunderlich, 1995)
Chorotype. Sardinian endemic.
References. (8 9) Wunderlich, 1995d (sub
Psammitis sardiniensis).
Province. Nuoro (89).
Family SALTICIDAE
Aelurillus monardi (Lucas, 1 846)
Chorotype. Mediterranean.
References. (13) Garneri, 1902 (sub A. Mo-
nardi); (84) Pesarini, 1994; (115) Hansen, 2005;
(132) Pantini & Sassu, 2009.
Province. (84); Cagliari (13); Carbonia-Iglesias
(13); Nuoro (115); Olbia-Tempio (115); Sassari
(115, 132).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
81
Aelurillus v-insignitus (Clerck, 1757)
Chorotype. Palearctic.
References. (13) Gameri, 1902 (sub Aelurops
insignita ); (84) Pesarini, 1994.
Province. (13, 84).
Asianellus festivus (C.L. Koch, 1834)
Chorotype. Palearctic.
References. (13) Garneri, 1902 (sub Aelu-
rops j estiva)', (84) Pesarini, 1994 (sub Aelurillus
festivus).
Province. (84); Cagliari (13).
Ballus armadillo (Simon, 1871)
Chorotype. W-Mediterranean.
References. (13) Gameri, 1902; (84) Pesarini,
1994; (127) Lom etal., 2008.
Province. (84, 127); Carbonia-Iglesias (13);
Nuoro (ined.).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, 1 female 19.V.2005 (ISE),
1 female 29.VI.2005, 1 female 27.VII.2005 (MBG);
Su Enazzu, m 550, hazelnut-orchard, 1 female
19.V.2005 (ISE), 1 female 19.V.2005 (MBG) (all
beating tray and leg. I.S.E.).
Ballus chalybeius (Walckenaer, 1802)
Chorotype. European.
References. (13) Gameri, 1902 (sub B. depres-
sus); (84) Pesarini, 1994 (sub B. depressusf, (115)
Hansen, 2005 (sub B. depressusf, (127) Lom et al.,
2008; (132) Pantini & Sassu, 2009.
Province. (84, 127); Nuoro (ined.); Ogliastra
(13); Sassari (115, 132, ined.).
Habitat. Hazelnut-orchard (127, ined.); olive-
grove (ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, beating tray, 1 female
1. VI. 2005 leg. I.S.E. (ISE).
SASSARI: Sorso, Pianu Mannu, Nali farm,
olive-grove, beating tray, 1 female l.VII. 1993 leg.
1st. Ent. SS (ISE).
Bianor albobimaculatus (Lucas, 1 846)
Chorotype. Afrotropico-Indo-Mediterranean.
References. (8) Costa, 1884 (sub Eris albobi-
maculata ); (13) Gameri, 1902 (sub Eris albo-bima-
culata); (20) Krauss, 1955; (84) Pesarini, 1994; (91)
Fontana et al., 1996; (115) Hansen, 2005.
Province. (20, 84, 91); Cagliari (8, 13); Nuoro
(115).
Habitat. Damp area (91).
Carrhotus xanthogramma (Latreille, 1819)
Chorotype. Palearctic.
References. (115) Hansen, 2005; (127) Lom et
al., 2008.
Province. (127); Cagliari (115); Nuoro (ined.).
Habitat. Hazelnut-orchard (127, ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut- orchard, 1 male 1.VI.2005 (ISE);
Su Enazzu, m 550, hazelnut-orchard, 1 male and 2
females 19.V.2005 (MBG) (all beating tray and leg.
I.S.E. ). Tiana, m 522, hazelnut-orchard, beating
tray, 1 female 4.V.2005 (MBG), 1 female 19.V.2005
(ISE) (all leg. I.S.E.).
Chalcoscirtus infimus (Simon, 1868)
Chorotype. Turano-European.
References. (115) Hansen, 2005; (116) Hel-
sdingen, 2005; (132) Pantini & Sassu, 2009.
Province. Medio Campidano (ined.); Nuoro
(116, ined.); Ogliastra (115, 116); Olbia-Tempio
(ined.); Oristano (ined.); Sassari (132, ined.).
Habitat. Coastal dunes (ined.); garrigue (ined.);
in drift (116); walnut- orchard (ined.); forest of
Quercus suber (ined.); vineyard (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 200, garrigue, pitfall
traps, 1 male 5-19.V.2009, 1 female 4-16.VI.2009
leg. Sassu A., Verdinelli M. (MBG).
NUORO: Belvi . Canale e' Figu, m 576, walnut-
orchard, 1 male, 21-28.VI.2007, leg. I.S.E. (MBG).
ORISTANO: Cabras . Sinis, at sea level, coastal
dunes, 4 males 20.IV.2003 leg. Pantini P, Magnati
F. (MBG).
OLBIA-TEMPIO: Budduso . near Nuraghe Loelle,
forest of Quercus suber, beating tray, 1 male
24.V.1999, leg. 1st. Ent. SS (ISE).
82
P. Pantini, A. Sassu & G. Serra
SASSARI: Torralba . vineyard, 1 male 6.V.1995,
1 female 20.V.1995 leg. 1st. Ent. SS (ISE).
Cyrba algerina (Lucas, 1846)
Chorotype. Afrotropico-Indo-Mediterranean.
References. (13) Gameri, 1902; (84) Pesarini,
1994; (115) Hansen, 2005; (139) Trotta, 2011.
Province. (84); Cagliari (115, 139); Nuoro
(ined.); Oristano (13); Sassari (115, ined.).
Examined material. NUORO: Dorgali . Cala Si-
sine, 1 male 21.IV.2003 leg. Ferrario E. (MBG).
SASSARI: Sassari . Li Punti, Baldinca, m 110, 1
male 23.V.2008 leg. Sassu A. (ISE).
*Dendryphantes hastatus (Clerck, 1757)
Chorotype. Sibero-European.
Examined material. SASSARI: Sassari, Plata-
mona, at sea level, 2 females, 22.V.2008, leg. Sassu
A. (ISE).
Euophrys frontalis (Walckenaer, 1802)
Chorotype. Palearctic.
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (84); Olbia-Tempio (13).
Euophrys gambosa (Simon, 1868)
Chorotype. Mediterranean.
References. (83) Pons, 1993; (116) Helsdin-
gen, 2005; (132) Pantini & Sassu, 2009.
Province. Medio Campidano (ined.); Nuoro
(83, 116); Sassari (132, ined.).
Habitat. Hypogean habitat (83); orchard
(ined.); garrigue (ined.); grassland along the mouth
of the river (116); olive-grove (ined.); mining land-
fills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining land-
fills covered by pioneer plants, pitfall traps, 1 male
19.V-4.VI.2009 leg. Sassu A., Verdinelli M.
(MBG). Guspini . Montevecchio, Piccalinna, m 225,
mining landfills covered by pioneer plants, 1 male
3-15.VI.2009 (MBG); m 235, garrigue, 1 male
18.V-3.VI.2009, 2 males 3-15.VI.2009 (MBG) (all
pitfall traps and leg. Sassu A., Verdinelli M.).
SASSARI: Sassari . Gioscari, olive-grove, che-
mical knockdown, 2 males and 1 female 14.X.2008,
leg. 1st. Ent. SS (ISE). Sorso . Pianu Mannu, Nali
farm, orchard, beating tray, 1 male 16.V.1997 leg.
1st. Ent. SS (ISE).
* Euophrys herbigrada (Simon, 1871)
Chorotype. European.
Habitat. Walnut-orchard (ined.).
Examined material. NUORO: Belvi . Canale e'
Figu, m 576, walnut-orchard, 1 male 16-23.V.2007,
1 female 28.VI-24.VII.2007, 1 female 24.VII-
30.VIII.2007 (MBG) (all pitfall traps and leg. I.S.E.).
Tonara . Su Azzime, m 682, walnut-orchard, 1 female
23.V-28.VI.2007, 1 female 24.VII-30.VIII.2007
(MBG) (all pitfall traps and leg. I.S.E.).
Euophrys rufibarbis (Simon, 1 868)
Chorotype. Centralasiatic-European-Mediter-
ranean.
References. (3) Pavesi, 1876; (13) Garneri,
1902; (84) Pesarini, 1994.
Province. (84); Cagliari (13); Carbonia-Iglesias
(3, 13); Medio Campidano (ined.).
Habitat. Garrigue (ined.); mining landfills cov-
ered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining land-
fills covered by pioneer plants, pitfall traps, 1 male
22.IX-6.X.2009, 1 male 6-20.X.2009 leg. Sassu A.,
Verdinelli M. (MBG). Guspini . Montevecchio, Pic-
calinna, m 235, garrigue, pitfall traps, 1 female 15-
30.VI.2009 leg. Sassu A., Verdinelli M. (MBG).
Euophrys sulphurea (L. Koch, 1867)
Chorotype. E-Mediterranean.
References. (10) Costa, 1885; (84) Pesarini,
1994.
Province. (84); Nuoro (ined.); Olbia-Tempio
(10); Sassari (ined.).
Habitat. Olive-grove (ined.); walnut- orchard
(ined.).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
83
Examined material. NUORO: Belvi . Canale e'
Figu, m 576, walnut-orchard, pitfall traps, 1 male
16-23.V.2007 leg. I.S.E. (MBG).
S AS SARI: Sassari . Gioscari, olive-grove, che-
mical knockdown, 1 female 6. VIII. 2008 leg. 1st.
Ent. SS (MBG).
Euophrys terrestris (Simon, 1871)
Chorotype. Mediterranean.
References. (6) Magretti, 1880 (sub Attus ter-
restris ); (13) Gameri, 1902; (84) Pesarini, 1994.
Province. (84); Nuoro (13); Oristano/Nuoro (6);
Sassari (13).
Evarcha falcata (Clerck, 1757)
Chorotype. Palearctic.
References. (13) Gameri, 1902 (sub Hasarius
falcatus ); (84) Pesarini, 1994.
Province. (84); Cagliari (13).
Evarcha jucunda (Lucas, 1 846)
Chorotype. Mediterranean.
References. (8) Costa, 1884 (sub Hasarius ju-
cundus ); (13) Gameri, 1902 (sub Hasarius jucun-
dus ); (20) Krauss, 1955; (84) Pesarini, 1994; (114)
Grill et al., 2005; (115) Hansen, 2005; (127) Lorn
et al., 2008; (139) Trotta, 2011.
Province. (84, 114, 127); Cagliari (115, ined.);
Carbonia-Iglesias (139); Nuoro (8, 13, 115, ined.);
Ogliastra (13); Olbia-Tempio (20, 115); Sassari
(ined.).
Habitat. Citrus-grove (ined.); cherry- orchard
(ined.); hazelnut-orchard (127, ined.); olive-grove
(ined.); shurblands and trees (114); vineyard (ined.).
Examined material. CAGLIARI: Uta, S’Ap-
passiu, Agris farm, citms-grove, beating tray, 1 fe-
male 11. IX. 2000, 1 male 23. X. 2000, 1 female
13.XI.2000 leg. CRAS (ISE).
NUORO: Belvi . Mannaritzd, m 706, cherry-or-
chard, 1 male and 1 female 16-23.V.2007 (ISE); Su
Enazzu, m 550, hazelnut-orchard, 1 male 5-
21.IX.2006 (ISE) (all pitfall traps and leg. I.S.E.).
Tiana, m 522, hazelnut-orchard, beating tray, 1 male
19.V.2005 leg. I.S.E. (ISE).
SASSARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 1 male 6.VIII.2009, 1 male
30.IX.2009, 1 male 7.X.2009 leg. 1st. Ent. SS (ISE).
Torralba . vineyard, 1 male and 1 female 23. VII. 1994,
1 female 1.X.1994, 1 female 29.VII.1995, 1 male
22.VII.1995, 1 male and 1 female 23.IX.1995 leg. 1st.
Ent. SS (ISE).
Heliophanus apiatus Simon, 1868
Chorotype. S-European.
References. (20) Krauss, 1955; (46) Thermes,
1972; (84) Pesarini, 1994; (94) Arno et al., 1998;
(115) Hansen, 2005; (127) Lorn et al., 2008; (132)
Pantini & Sassu, 2009; (139) Trotta, 2011.
Province. (84, 127); Cagliari (46, 139); Carbo-
nia-Iglesias (139); Medio Campidano (139); Nuoro
(ined.); Ogliastra (115); Olbia-Tempio (115); Sas-
sari (20, 94, 132, ined.).
Habitat. Avenue of lime trees (94); hypogean
habitat (46); cherry-orchard (ined.); orchard (ined.);
hazelnut-orchard (127, ined.); walnut- orchard
(ined.); olive-grove (ined.); vineyard (ined.).
Examined material. NUORO: Belvi . Antonitzo,
m683, cheny-orchard, 1 male 11-18.IV.2007, 1 male
27.IX-4.X.2007 (ISE); Canale e' Figu, m 576, wal-
nut-orchard, 1 male 22-29.11.2008 (ISE); Manna-
ritzd, m 706, cherry-orchard, 2 males 18-26.IV.2007
(ISE); Su Ajone, m 585, hazelnut-orchard, 1 female
19-27. VII. 2005 (ISE) (all in bark traps and leg.
I.S.E.). Tonara . Su Azzime, m 682, walnut-orchard,
bark traps, 1 male 18-26.IV.2007 leg. I.S.E. (ISE).
SASSARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 1 male 7.X.2009 leg. 1st. Ent.
SS (ISE). Sorso . Pianu Mannu, Nali farm, orchard,
bark traps, 1 female 26.VI-2.VII. 1997, 1 male 2-
9.XII.1997 leg. 1st. Ent. SS (ISE). Torralba . vine-
yard, 1 male 14.V.1994, 2 females 4.VI.1994, 1
female and 4 juv. 9.VII.1994, 1 male and 1 juv.
24.IX.1994, 1 female 6.V.1995, 1 male 17.VI.1995,
1 female l.VII. 1995, 4 males and 6 juv.
26.VIII.1995, 1 female 5.VIII.1995, 4 males 12
juv., 9.IX.1995, 1 male and 15 juv., 2.IX.1995, 2
males and 10 juv. 16.IX.1995, 10 males and 4 juv.
30.IX.1995, 8 males and 2 juv. 23.IX.1995, 13
males, 1 female and 3 juv. 7.X.1995, 1 male and 1
juv. 14.X.1995 leg. 1st. Ent. SS (ISE).
Heliophanus auratus C.L. Koch, 1835
Chorotype. Asiatic-European.
84
P. Pantini, A. Sassu & G. Serra
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (84); Oristano (13).
Heliophanus cupreus (Walckenaer, 1802)
Chorotype. Sibero-European.
References. (10) Costa, 1885; (13) Gameri,
1902; (20) Krauss, 1955; (30) Cerruti, 1968; (84)
Pesarini, 1994; (115) Hansen, 2005; (127) Lom et
al., 2008.
Province. (84, 127); Cagliari (13, 30); Nuoro
(ined.); Ogliastra (115); Oristano (10); Sassari (20).
Habitat. Hypogean habitat (20, 30); hazelnut-
orchard (127, ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, beating tray, 1 male
4.V.2005 (ISE), 1 male 29.VI.2005 (MBG); Su
Enazzu, m 550, hazelnut- orchard, bark traps, 1 fe-
male, 16-23.VI.2005 (MBG), 1 female 16-
23.VI.2005 (ISE) (all leg. I.S.E.). Tiana . m 522,
hazelnut-orchard, beating tray, 1 female 19.V.2005,
1 female 1.VI.2005 leg. I.S.E. (MBG).
Heliophanus flavipes (Hahn, 1832)
Chorotype. Palearctic.
References. (13) Gameri, 1902; (84) Pesarini,
1994; (115) Hansen, 2005.
Province. (84); Cagliari (13); Nuoro/Ogliastra
(13); Ogliastra (13); Olbia-Tempio (115).
Heliophanus kochii Simon, 1868
Chorotype. European-Mediterranean.
References. (13) Gameri, 1902; (84) Pesarini,
1994; (109) Logunov, 2004; (114) Grill et al., 2005;
(133) Trotta, 2009; (139) Trotta, 2011.
Province. (84, 114); Cagliari (13); Carbonia-
Iglesias (13, 139); Medio Campidano (139); Oglia-
stra (13); Olbia-Tempio (109, 133); Sassari (ined.).
Habitat. Shurblands and trees (114).
Examined material. OLBIA-TEMPIO: Olbia .
Murta Maria, 1 female 28.VI.1993 leg. Gusmini
(MBG).
Heliophanus melinus L. Koch, 1867
Chorotype. Centralasiatic-European.
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (84); Cagliari (13); Oristano (13).
Heliophanus rufithorax Simon, 1868
Chorotype. Mediterranean.
References. (10) Costa, 1885; (84) Pesarini,
1994; (115) Hansen, 2005.
Province. (10, 84); Cagliari (ined.); Nuoro
(115, ined.); Ogliastra (115); Olbia-Tempio (115);
Sassari (115, ined.).
Habitat. Walnut-orchard (ined.); pinewood
(ined.); vineyard (ined.).
Examined material. CAGLIARI: Pula . Pixina
Manna, m 140, pinewood, emergence cages, 1
male 21.IV.2009, 1 female 25.V.2009 leg. 1st. Ent.
SS (ISE).
NUORO: Belvi . Canale e' Figu, m 576, walnut-
orchard, pitfall traps, 1 female 2 1-28. VI. 2007 leg.
I.S.E. (ISE).
SASSARI: Torralba . vineyard, 1 male 24.VI.1995
leg. 1st. Ent. SS (ISE).
Heliophanus tribulosus Simon, 1868
Chorotype. Sibero-European.
References. (78) Hansen, 1986.
Province. (78).
Icius congener Simon, 1871
Chorotype. W-Mediterranean.
References. (20) Krauss, 1955 (sub I. nebulo-
sus); (84) Pesarini, 1994.
Province. (20, 84).
Icius hamatus (C.L. Koch, 1846)
Chorotype. Mediterranean.
References. (10) Costa, 1885 (sub I. striatus );
(13) Gameri, 1902 (sub I. striatus ); (78) Hansen,
1986; (84) Pesarini, 1994; (94) Arno et al., 1998;
(115) Hansen, 2005; (127) Lom et al., 2008; (134);
Marras et al., 2011.
Province. (78, 84, 127, 134); Cagliari (13,
ined.); Nuoro (ined.); Oristano (10); Sassari (94,
115, ined.).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
85
Habitat. Citrus-grove (ined.); avenue of lime
trees (94); cherry- orchard (ined.); orchard (134,
ined.); hazelnut-orchard (127, ined.); walnut-or-
chard (ined.); olive-grove (ined.); alder-grove
(ined.); vineyard (ined.).
Examined material. CAGLIARI: Uta, S’Ap-
passiu, Agris farm, citrus-grove, beating tray, 2
males and 5 females 19.VI.2000, 1 male and 3 fe-
males, 29.VI.2000, 2 females 3 1.VII.2000, 5 fe-
males 20.VII.2000, 2 males and 6 females
31.VIII.2000, 3 females 10.VIII.2000, 2 females
21.VIII.2000, 3 males and 2 females 21.IX.2000, 1
male and 1 female 1 1 .IX.2000, 1 female 20.X.2000,
3 males and 5 females 23.X.2000, 3 males and 3 fe-
males 12.X.2000, 1 male and 2 females 4.X.2000,
1 male and 1 female 2.XI.2000, 1 male 23.XI.2000,
1 female 4.XII.2000 leg. CRAS (ISE).
NUORO: Belvi, Mannaritzo, m 706, cherry-or-
chard, bark traps, 1 male 18-26.IV.2007, 1 male
and 1 female 4-11.X.2007 (ISE); Su Ajone, m 585,
hazelnut-orchard, beating tray, 1 male 1.VI.2005
(ISE); Su Enazzu, m 550, hazelnut-orchard, bark
traps, 1 female 29.IX-6.X.2005 (MBG) (all leg.
I.S.E.). Fonni, Gennargentu, mountain refuge, m
1550, alder-grove, bark traps, 1 male 25. VII-
2. VIII. 2006 leg. Fiori F. (ISE). Tiana . m 522, hazel-
nut-orchard, bark traps, 1 female 11-18.V.2005
(MBG), 1 female 23-29.VI.2005 (ISE), 2 females
23-29.VI.2005, 1 male 8-16.VI.2005 (MBG), 1 male
8-16.VI.2005 (ISE), 1 female 27. VII-5.VIII.2005, 1
female 19-27.VII.2005, 1 female 10-17.VIII.2005,
1 female 5-10.VIII.2005, 1 male 29.IX-6.X.2005, 1
female 6-12.X.2005 (MBG) (all leg. I.S.E.). Tonara .
Su Azzime, m 682, walnut-orchard, bark traps, 1
male 4-11.X.2007 leg. I.S.E. (ISE).
S AS SARI: Sorso, Pianu Mannu, Nali farm,
olive-grove, beating tray, 1 male, 29.III.1993, 1
male, 1 female and 8 juv. 29.IV. 1993, 1 male
3. VI. 1993, 1 male and 2 females 25.VI.1993, 1
male, 2 females and 3 juv. 9.VII.1993, 2 males, 1
female and 7 juv. 16.IX.1993, 1 male 9. IX. 1993, 1
male, 1 female and 23 juv. 2.IX.1993, 1 male and 1
juv. 11. XI. 1993 (ISE), olive-grove, 1 male and 1 fe-
male 6.V.1993 (ISE); orchard, bark traps, 2 males
24.XI-2.XII. 1997 (ISE); orchard, 1 female
2.XII.1997 (ISE) (all leg. 1st. Ent. SS). Torralba .
vineyard, 1 male and 1 juv. 14.V.1994, 1 male, 2 fe-
males and 8 juv. 9.VII.1994, 1 male, 1 female and
1 juv. 3.VI.1995, 3 males and 1 female 24.VI.1995,
1 female 29.VII.1995, 1 male 22.VII.1995, 1 male
15.VII.1995, 1 male and 2 females 8.VII.1995, 1
female and 23 juv. 26. VIII. 1995, 1 male, 2 females
and 17 juv. 16.IX.1995, 1 male and 18 juv.
2.IX.1995, 1 male and 14 juv. 14.X.1995, 2 males
and 2 females 7.X.1995, 2 males, 2 females and 7
juv. 21.X. 1995 (ISE); vineyard, beating tray, 1 fe-
male 6.VIII.1994, 1 male and 11 juv. 10.IX.1994
(ISE) (all leg. 1st. Ent. SS).
Icius subinermis Simon, 1937
Chorotype. Mediterranean.
References. (8) Costa, 1884 (sub I. Notebilis );
(13) Gameri, 1902 (sub I. Notebilis ); (20) Krauss,
1955 (sub I. Notebilis ); (84) Pesarini, 1994.
Province. (84); Nuoro (8, 13, ined.); Sassari (20).
Examined material. NUORO: Dorgali. on the
pathway to Su Gorroppu, m 200, 1 female
23.IV.2003 leg. Pantini P, Magnati F. (MBG).
Leptorchestes mutilloides (Lucas, 1846)
Chorotype. Mediterranean.
References. (20) Krauss, 1955; (84) Pesarini,
1994; (115) Hansen, 2005.
Province. (84); Sassari (20, 115).
Macaroeris nidicolens (Walckenaer, 1802)
Chorotype. S-European.
References. (10) Costa, 1885 (sub Dendry-
phantes nidicolens)-, (84) Pesarini, 1994 (sub Eris
nidicolens ); (132) Pantini & Sassu, 2009.
Province. (84); Olbia-Tempio (10, ined.); Sas-
sari (132, ined.).
Habitat. Olive-grove (ined.).
Examined material. OLBIA-TEMPIO: Telti . Rio
Almiddina, 1 male 20.V.2008 leg. Sassu A. (ISE).
SASSARI: Alghero . Mamuntanas, olive-grove,
chemical knockdown, 1 female 6.IX.2009 leg. 1st.
Ent. SS (ISE). Sorso . Pianu Mannu, Nali farm,
olive-grove, beating tray, 1 female 22.VII.1993 leg.
1st. Ent. SS (ISE).
Marpissa muscosa (Clerck, 1757)
Chorotype. Sibero-European.
References. (13) Gameri, 1902; (84) Pesarini,
1994; (127) Lom et al., 2008.
86
P. Pantini, A. Sassu & G. Serra
Province. (84, 127); Carbonia-Iglesias (13);
Nuoro (ined.).
Habitat. Hazelnut-orchard (127, ined.); wal-
nut-orchard (ined.).
Examined material. NUORO: Belvi . Su
Enazzu, m 550, hazelnut-orchard, bark traps, 5
males, 5 females and 16 juv. 6-13.X.2004, 2 males
13-20.X.2004, 1 male, 2 females and 1 juv. 20-
27.X.2004, 2 males, 1 female and 7 juv. 15-
22. III. 2005 leg. I.S.E. (MBG). Tonara . Su Azzime,
m 682, walnut-orchard, bark traps, 1 female 24-
30.VIII.2007 leg. I.S.E. (ISE).
Marpissa pomatia (Walckenaer, 1802)
Chorotype. Palearctic.
References.(13) Gameri, 1902; (84) Pesarini,
1994.
Province. (84); Cagliari (13).
Mendoza canestrinii (Ninnii, 1868)
Chorotype. Palearctic.
References. (10) Costa, 1885 (sub Hyctia Ca-
nestrinii ); (13) Gameri, 1902 (sub Hyctia Canestri-
nii ); (84) Pesarini, 1994 (sub Mithion canestrinii ).
Province. (13, 84); Oristano (10).
Menemerus semilimbatus (Hahn, 1 829)
Chorotype. Holarctic.
References. (10) Costa, 1885 (subM. semilim-
bactus ); (11) de Carlini, 1885; (13) Gameri, 1902;
(84) Pesarini, 1994; (94) Amo et al., 1998.
Province. (84); Cagliari (13); Carbonia-Iglesias
(11, 13); Nuoro (10); Ogliastra (13); Sassari (94).
Habitat. Avenue of lime trees (94).
Mogrus frontosus (Simon, 1871)
Chorotype. Sardo-Corsican endemic.
References. (84) Pesarini, 1994.
Province. (84).
Remarks. Species known in Corse, Pesarini re-
cords it in his checklist without supplying any other
information, its presence in Sardinia needs further
confirmation.
Myrmarachne formicaria (De Geer, 1778)
Chorotype. Palearctic.
References. (13) Garneri, 1902 (sub Salticus
formicarius ); (84) Pesarini, 1994; (139) Trotta,
2011.
Province. (13, 84); Carbonia-Iglesias (139).
Neaetha membrosa (Simon, 1868)
Chorotype. S -European.
References. (20) Krauss, 1955 (sub N. mem-
branosa ); (84) Pesarini, 1994.
Province. (84); Medio Campidano (ined.);
Nuoro (ined.); Olbia-Tempio (20).
Habitat. Cherry-orchard (ined.); mining land-
fills covered by pioneer plants (ined.).
Examined material. MEDIO CAMPIDANO:
Arbus . Ingurtosu, Naracauli, m 170, mining land-
fills covered by pioneer plants, pitfall traps, 1 fe-
male 4-16.VI.2009, 1 female 29.VI-14.VII.2009
leg. Sassu A., Verdinelli M. (MBG). Guspini . Mon-
tevecchio, Piccalinna, m 225, mining landfills cov-
ered by pioneer plants, pitfall traps, 1 male
18.V-3.VI.2009, 1 male 3-15.VI.2009 leg. Sassu A.,
Verdinelli M. (MBG).
NUORO: Belvi . Mannaritzo, m 706, cherry-or-
chard, pitfall traps, 1 female 2 1-28. VI. 2007 leg.
I.S.E. (ISE).
Pellenes arciger (Walckenaer, 1837)
Chorotype. S-European.
References. (10) Costa, 1885 (sub P. arcige-
rus ); (13) Gameri, 1902 (sub P. arcigerus ); (84) Pe-
sarini, 1994; (100) Metzner, 1999.
Province. (84); Cagliari (10); Nuoro (10);
Ogliastra (13, 100); Sassari (ined.).
Habitat. Olive-grove (ined.); Strand (100).
Examined material. SASSARI: Sassari . Gio-
scari, olive-grove, 1 male 20.VIII.2009 (MBG); Lu
Buttangam, olive-grove, 2 males 29.IX.2009, 1 fe-
male 13.X. 2009 (MBG) (all chemical knockdown
and leg. 1st. Ent. SS).
Pellenes geniculatus (Simon, 1868)
Chorotype. Centralasiatic-Mediterranean.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
87
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (84); Cagliari (13).
Pellenes nigrociliatus (Simon, 1875)
Chorotype. Palearctic.
References. (91) Fontana et al., 1996.
Province. Olbia-Tempio (91).
Philaeus chrysops (Poda, 1761)
Chorotype. Palearctic.
References. (10) Costa, 1885; (13) Garneri,
1902; (84) Pesarini, 1994; (115) Hansen, 2005.
Province. (84); Cagliari (13, 115); Nuoro (10);
Oristano (10).
Phlegra bresnieri (Lucas, 1 846)
Chorotype. Afrotropico-Mediterranean.
References. (7a) Costa, 1882 (sub Attus bre-
snieri ); (8) Costa, 1884 [sub P. (Attus) Bresnieri ];
(13) Gameri, 1902; (20) Krauss, 1955; (84) Pesa-
rini, 1994; (100) Metzner, 1999; (115) Hansen,
2005; (120) Logunov & Azarkina, 2006; (132) Pan-
tini & Sassu, 2009.
Province. (20, 84); Cagliari (8, 13); Medio
Campidano (120); Nuoro (ined.); Ogliastra (100,
115); Oristano (7a, 8, 13, 120); Sassari (132, ined.).
Habitat. Cultivated land, olive and almond
trees, with grass Euphorbia and Cirsium (under
Granite rocks) (120); marshy grassland with Cir-
sium (under stone) (120); walnut-orchard (ined.);
olive trees with grass, sheep pasture and slightly
moist grass (120); olive-grove (ined.); stony pas-
tures with stonewalls, Rubus fruticosus, Juniperus
communis (120); Strand (100).
Examined material. NUORO: Tonara, Su Az-
zime, m 682, walnut-orchard, pitfall traps, 1 female
16-23.V.2007 leg. I.S.E. (ISE).
SASSARI: Sassari . Gioscari, olive-grove, 1 male
22.IX.2008 1 (MBG); Lu Buttangam, olive-grove,
3 males and 1 female 29. IX. 2009 (MBG) (all che-
mical knockdown and leg. 1st. Ent. SS).
Phlegra lineata (C.L. Koch, 1846)
Chorotype. Mediterranean.
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (13, 84).
Plexippus paykulli (Audouin, 1826)
Chorotype. Subcosmopolitan.
References. (13) Gameri, 1902 (sub Hasarius
Paykulli ); (84) Pesarini, 1994.
Province. (84); Cagliari (13); Oristano (13).
Pseudeuophrys erratica (Walckenaer, 1 826)
Chorotype. Holarctic.
References. (13) Gameri, 1902 (sub Euophrys
erratica)', (84) Pesarini, 1994 (sub Euophrys erra-
tica ); (127) Lom et al., 2008.
Province. (84, 127); Cagliari (13); Nuoro
(ined.); Ogliastra (13).
Habitat. Hazelnut-orchard (127); walnut-or-
chard (ined.); alder-grove (ined.).
Examined material. NUORO: Fonni . Gennar-
gentu, mountain refuge, m 1550, alder-grove,
bark traps, 1 female 27-4. X. 2006 leg. Fiori F.
(ISE). Tonara . Su Azzime, m 682, walnut-orchard,
bark traps, 1 female 16-23. V.2007 leg. I.S.E. (ISE).
* Pseudeuophrys nebrodensis Alicata et Can-
tarella, 2000
Chorotype. Tyrrhenian endemic.
Habitat. Alder-grove (ined.); hazelnut-orchard
(ined.); under Juniperus sp. (ined.).
Examined material. NUORO: Belvi . Su Ajone,
m 585, hazelnut-orchard, bark traps, 1 female 18-
25.V.2005, 1 female 23-29.VI.2005, 2 females 1-
8. VI. 2005, 1 female 8-16.VI.2005, 1 female
19-27.VII.2005 leg. I.S.E. (MBG). Desulo . Gennar-
gentu, mountain refuge, m 1500, alder- grove, bark
traps, 2 females and 1 juv. 26.IX-3.X.2006, 1 fe-
male 5-13.IX.2006, 2 females 3-10.X.2006 (ISE);
under Juniperus sp., pitfall traps, 1 male 10-
24. V.2007 (ISE) (all leg. Fiori F.).
Pseudeuophrys vafra (Blackwall, 1867)
Chorotype. European-mediterranean.
References. (100) Metzner, 1999; (115) Han-
sen, 2005; (116) Helsdingen, 2005.
88
P. Pantini, A. Sassu & G. Serra
Province. Medio Campidano (ined.); Nuoro
(116, ined.); Ogliastra (100, 115, 116).
Habitat. Inside house (116); mediterranean
maquis (ined.); walnut-orchard (ined.); Strand (100).
Examined material. MEDIO CAMPIDANO:
Guspini . Montevecchio, Piccalinna, m 260, mediter-
ranean maquis, pitfall traps, 2 males 15-30.VI.2009,
2 females 13-27.VII.2009 leg. Sassu A., Verdinelli
M. (MBG).
NUORO: Belyi, Canale e' Figu, m 576, walnut-
orchard, 1 female 17-24.VII.2007 leg. I.S.E. (MBG).
Pseudicius encarpatus (Walckenaer, 1 802)
Chorotype. European.
References. (84) Pesarini, 1994; (94) Arno et
al., 1998; (127) Lorn et al., 2008.
Province. (84, 127); Nuoro (ined.); Sassari (94,
ined.).
Habitat. Avenue of lime trees (94); cherry-or-
chard (ined.); orchard (ined.); hazelnut- orchard
(127); olive-grove (ined.).
Examined material. NUORO: Belvi . Anto-
nitzo, m 683, cherry-orchard, 1 female 17-
24.VII.2007 (ISE); Mannaritzo, m 706,
cherry-orchard, 1 female 4-11.X.2007 (ISE) (all in
bark traps and leg. I.S.E.).
SASSARI: Sorso, Pianu Mannu, Nali farm,
olive-grove, beating tray, 1 male l.VII. 1993 (ISE);
orchard, bark traps, 1 female 24-3 l.VII. 1997, 1
male and 1 juv. 11-19.VI.1998 (ISE) (all leg. 1st.
Ent. SS).
Saitis barbipes (Simon, 1868)
Chorotype. Mediterranean.
References. (115) Hansen, 2005.
Province. Sassari (115, ined.).
Examined material. SASSARI: Sassari . Li
Punti, Baldinca, m 110, 1 male 15. VI. 2008 leg.
Sassu A. (ISE).
Salticus conjonctus (Simon, 1868)
Chorotype. S-European.
References. (20) Krauss, 1955; (84) Pesarini,
1994; (115) Hansen, 2005.
Province. (20, 84); Olbia-Tempio (115).
Salticus mutabilis (Lucas, 1846)
Chorotype. Turano-European.
References. (13) Garneri, 1902 (sub Callie-
thera mutabilis ); (84) Pesarini, 1994; (94) Amo et
al., 1998; (115) Hansen, 2005; (132) Pantini &
Sassu, 2009; (133) Trotta, 2009.
Province. (84); Cagliari (13); Carbonia-Iglesias
(133, ined.); Ogliastra (115); Oristano (ined.), Sas-
sari (94, 115, 132, ined.).
Habitat. Avenue of lime trees (94); orchard
(ined.); olive-grove (ined.); vineyard (ined.).
Examined material. CARBONIA-IGLESIAS:
Sant’Antioco . 1 male 25.IV.2003 leg. Ferrario E.
(MBG).
ORISTANO: Cabras, San Giovanni in Sinis, 2
males and 1 juv. 26.IV.2003 leg Pantini P., Magnati
F. (MBG).
SASSARI: Sorso . Pianu Mannu, Nali farm,
olive-grove, beating tray, 1 male 9.VI.1993 (ISE);
orchard, bark traps, 1 male 15-22.IV. 1998, 1 female
11-19.VI.1998 (ISE) (all leg. 1st. Ent. SS). Torralba .
vineyard, 1 female 17.VI.1995 leg. 1st. Ent. SS (ISE).
Salticus scenicus (Clerck, 1757)
Chorotype. Holarctic.
References. (6) Magretti, 1880 (sub Epible-
mum scenicum ); (8) Costa, 1884 (sub Callethera
scenica ); (13) Garneri, 1902 (sub Calliethera sce-
nica ); (84) Pesarini, 1994.
Province. (8, 84); Oristano (6, 13).
Habitat. Common inside houses (8).
Salticus zebraneus (C.L. Koch, 1837)
Chorotype. Palearctic.
References. (94) Arno et al., 1998.
Province. Nuoro (ined.); Sassari (94).
Habitat. Avenue of lime trees (94); cherry-or-
chard (ined.).
Examined material. NUORO: Belvi . Anto-
nitzo, m 683, cherry-orchard, bark traps, 1 male 21-
28.VI.2007 leg. I.S.E. (ISE).
Sitticus pubescens (Fabricius, 1775)
Chorotype. Holarctic.
References. (84) Pesarini, 1994.
Province. (84).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
89
Synageles albotrimaculatus (Lucas, 1846)
Chorotype. W-Mediterranean.
References. (13) Gameri, 1902; (84) Pesarini,
1994.
Province. (84); Carbonia-Iglesias (13); Sassari
(ined.).
Habitat. Vineyard (ined.).
Examined material. SASSARI: Torralba . vine-
yard, 1 female 24.VI.1995, 1 female 3.VI.1995 leg.
1st. Ent. SS (ISE).
Synageles Venator (Lucas, 1836)
Chorotype. Palearctic.
References. (10) Costa, 1885; (84) Pesarini,
1994.
Province. (84); Cagliari (10).
*Talavera aequipes (O.P -Cambridge, 1871)
Chorotype. Palearctic.
Habitat. Orchard (ined.).
Examined material. SASSARI: Sorso, Pianu
Mannu, Nali farm, orchard, pitfall traps, 1 female
24-3 l.VII. 1997 leg. 1st. Ent. SS (ISE).
Thyene imperialis (Rossi, 1 846)
Chorotype. Indo-Mediterranean.
References. (8) Costa, 1884 (sub Thya impe-
rialis ); (13) Gameri, 1902; (20) Krauss, 1955; (84)
Pesarini, 1994; (114) Grill et al., 2005.
Province. (84, 114); Cagliari (8, 13); Olbia-
Tempio (20).
Habitat. Agricultural land (114).
Yllenus univittatus (Simon, 1871)
Chorotype. European (?).
References. (10) Costa, 1885; (84) Pesarini,
1994;
Province. (84); Cagliari (10)
Remarks. Species known only in France, Pesa-
rini records it in his checklist probably on the basis
of Costa’s old citation (1885), its presence in Sar-
dinia needs further confirmation.
CONSIDERATIONS ABOUT SARDINIAN
ARANEOFAUNA
In this work, 495 species are reported (30.6% of
those known in Italy) which belong to 229 genera
divided into 43 families. Among these, the Philo-
dromidae Philodromus bosmansi is reported for the
first time in Europe, while the following are re-
ported for the first time in Italy: the Gnaphosidae
Setaphis parvula, the Linyphiidae Centromerus
succinus and Hybocoptus corrugis and the Prodi-
domidae Zimirina brevipes. For the latter species
and for its family, this is the first sighting in Italy.
As well as these 6 species, a further 37 species are
reported for the first time in Sardinia (Table 2).
Regarding distribution (Fig. 3), Cagliari, Sas-
sari and Nuoro are the provinces with the highest
number of species reported. In the Cagliari area,
the 218 species reported are related to 50 publica-
tions, however most of the data are linked to the old
works of Gameri (1902) and Costa (1884, 1885).
No specific studies have been carried out in the pro-
vince of Cagliari but among the most recent contri-
butions which report data about Sardinian
araneofauna, those by Argiolas et al. (1970), Thermes
(1972) and Trotta (2011) deserve a mention. A good
number of species were also reported on the basis of
newly examined material. Regarding the province of
Sassari (52 publications, 213 species) and the pro-
vince of Nuoro (46 publications, 212 species),
newly examined material from studies in olive
groves, vineyards and fruit orchards in the Sassari
area and from studies in the mountainous environ-
ment of the Nuoro area was cmcial. It was collected
by the Sassari section of the ISE and is published
in this catalogue. For the Sassari province we can
also mention the analysis of tree spiders collected
in a tree-lined street in Sassari (Arno et al., 1998)
and the study of the spiders on the Island of Asinara
(Pantini & Sassu, 2009). We know less about the
other provinces: for Carbonia-Iglesias (39 publica-
tions, 141 species) Trotta’s recent contribution
(2011) is important as well as data from old publi-
cations; for Ogliastra area (43 publications, 133
species) contributions by Gameri ( 1 902) and Hel-
sdingen (2005) are useful; the newly examined ma-
terial from studies in cork-oak forests and Trotta’s
publication (2009) on the islands around Sardinia
are important for Olbia-Tempio province (32 publi-
cations, 103 species); for Medio Campidano (16 pu-
90
P. Pantini, A. Sassu & G. Serra
Family and species
ZODARIIDAE
Zodarion gallicum
PRODIDOMIDAE
Zimirina brevipes *
GNAPHOS1DAE
Drassodes luteomicans
Leptodrassus femineus
Micaria albovittata
Micaria cyrnea
Nomisia recepta
Plmeocedus braccatus
Setaphis parvula *
Trachyzelotes pedestris
Zelotes dentatidens
Zelotes egregius
PHILODROMIDAE
Philodromus bosmansi *
Philo dromus buxi
THOMISIDAE
Ozyptila sanctuaria
Xysticus erratic us
Xysticus ibex
SALTICIDAE
Dendryphantes hastatus
Euophrys herbigrada
Pseudeuophrys nebrodensis
Talavera aequipes
Family and species
FILISTAT1DAE
Pritha nana
THERIDIIDAE
Dipoena coracina
Rhomphaea nasica
Theridion hannoniae
LINYPHIIDAE
Centromerus subalpinus
Centromerus succinus *
Diplostyla concolor
Hybocoptus corrugis *
Meioneta mollis
Micrargus subaequalis
Nematogmus sanguinolentus
Pocadicnemis juncea
Syedra nigrotibialis
Walckenaeria antica
Walckenaeria stylifrons
ARANEIDAE
Araneus marmoreus
Araneus quadratus
LYCOS1DAE
Pirata tenuitarsis
ZORIDAE
Zora manicata
AGELENIDAE
Textrix pinicola
LIOCRANIDAE
Agraecina lineata
Table 2. List of the species which appear to be newly re-
ported for Sardinian araneofauna. Marked with an asterisk
are those newly reported for Italy.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
91
blications, 101 species) the outstanding new material
examined from studies in a disused mining area and
Trotta’s recent contribution (2011) are fundamental
while for the province of Oristano (30 publications;
Chorotype
n. sp.
%
Cosmopolitan
12
2,40
Subcosmopolitan
6
1,20
Holarctic
59
11,90
Widely spread in the Palearctic Region
171
34,50
Paleartic
85
17,20
W-Paleartic
1
0,20
Asiatic-European
13
2,60
Sibero-European
34
6,90
Centralasiatic-Europeo-Mediterranean
1
0,20
Centralasiatic-European
5
1,00
Centralasiatic-Mediterranean
5
1,00
Turano-Europeo-Mediterranean
3
0,60
Turano-European
13
2,60
Turano-Mediterranean
5
1,00
Europeo-Mediterranean
6
1,20
Table 3. List of chorotypes for
100 species) reports mostly come from old works.
The chorotypes of the species discovered are
listed in table 3 and reproduced, in uniform groups
in figure 14. Together with a small percentage of
European
84
17,00
European
51
10,30
Centraleuropean
1
0,20
S-European
32
6,50
Mediterranean
109
22,00
Mediterranean
60
12,10
W-Mediterranean
43
8,70
Afrotropicals
6
1,20
Afrotropico-Indo-Mediterranean
4
0,80
Afrotropico-Mediterranean
1
0,20
Indo-Mediterranean
1
0,20
Endemic
54
10,90
Italian endemic
1
0,20
Tyrrhenian endemic
12
2,40
Sardo-Corsican endemic
10
2,00
Sardinian endemic
31
6,30
species present in Sardinia.
Endemic
10,9%
Cosmopolitan
3,6%
Afrotropicals
1 , 2 %
European
17,0%
Figure 14. Chorological spectrum of Sardinian araneofauna.
92
P. Pantini, A. Sassu & G. Serra
Cosmopolitan or Sub-cosmopolitan species, more
than half of the species present in the Region have
a wide distribution divided into: prevalently Pale-
arctic species (41 .3%), Holartic and a small amount
of Afro-Tropical elements. The rest of them are di-
vided into Mediterranean (20.8%) and Southern Eu-
ropean (6.5%) elements. There is a remarkable
number of endemic species (10.9%) which involves
54 species. In figures 15-18 the Sardinian distribu-
tions of 38 of the 41 Sardinian and Sardo-Corsican
endemism are shown (only Zodarion sardum, Mo-
grus frontosus and Xysticus parallelus are generic
cited for Sardinia and no indicates localities)
while the distribution of the remaining 13 ende-
mic species can be found in table 4.
CONCLUSIONS
It is possible that during our bibliographical re-
search, some publications have been overlooked,
however we believe that the data presented provides
us with a detailed and updated view of what is
known about Sardinian araneofauna. Examination
of the material kept at the Museum of Bergamo and
that collected and kept at the Institute of Ecosystem
Study in Sassari has allowed us to insert a lot of
new data into the catalogue: as well as the 43 new
species reported on the island, we were able to con-
firm the presence of 21 1 other species in the region
and provide new information about their distribu-
tion throughout Sardinia.
The analysis of this material has also allowed
us to detect several species which were difficult
to attribute and can probably be considered as
new taxa belonging to the following genera: Har-
pactea, Rhode, Zodarion, Cybaeodes, Haplodras-
sus and Zelotes. Finally, the genitalia of
Phrurolithus corsicus, Zimirina brevipes, Dras-
sodes luteomicans and Zelotes dentatidens are il-
lustrated (Figs. 4-13).
The level of knowledge about the araneological
fauna of Sardinia can surely still be greatly im-
proved. Compared with other Northern Italian re-
gions (Table 5) such as Alto Adige (Noflatscher,
1996), Piedmont and Lombardy (Isaia et al., 2007)
and Veneto (Ballarin et al. 2011), which have re-
cently been the object of similar catalogues, Sardinia
Species
Distribution
Ariadna brignoli
Described from Lazio (Isola di
Ponza), cited from Sardinia and
Sicily only for female specimens
Cteniza brevidens
Tyrrhenian endemic (see also the
remark on page 11)
Cteniza sauvagesi
Tyrrhenian endemic
Spermophorides
elevata
Tyrrhenian endemic
Dysdera ancora
Sardinia and Sicily
Dysdera ventricosa
Sardinia and Sicily. Only known
from its original description
Harpactea sardoa
Sardinia and Lazio
Gonatium
biimpressum
Rare species known from Sardi-
nia, Corse (Bonifacio) and Lazio
(Isola di Ponza)
Syedra nigrotibialis
Rare species known from Sardi-
nia, Corse and Lazio
Maltlionica sicana
Sardinia and Sicily
Zodarion rujfoi
Sardinia and Apulia (Isole Tre-
miti)
Zelotes sardus
Sardinia and Tuscany (Isola di
Capraia)
Pseudeuophrys
nebrodensis
Sardinia and Sicily
Table 4. Distribution of the endemic species which are not
exclusive to the Sardinian-Corsican area.
Italian Region
Families (n.)
Species (n.)
Veneto
44
738
Lombardy
39
679
Alto Adige
35
606
Piedmont
43
546
Valle d’Aosta
29
261
Sardinia
43
495
Table 5. Number of species and families known in some
Italian regions.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
93
O Nemesia fertoni
□ Nemesia kahmanni
O Dysdera Jana
□ Dysdera shardana
V'.
□ liarpactea alien mi O Harpactea gennatgenru
A Parachies inaeqmpes O Sardostalita patrizii
id liarpactea nuragica
O Parachres limbarae
Figure 15. Distribution of Sardinian and Sardo-Corsican endemism of the family Nemesiidae (top left) and Dysderiidae
(top right, down left, down right).
94
P. Pantini, A. Sassu & G. Serra
O Leptoneta patrizii A Lepton era in sit laris
□ Leptoneta serhonriana 'Ct Leptoneta taramelli
O Spermophorides baunei
O Cybaeodes sordus O Zodarion tu'griceps
□ Llocramm giersbeigl
Figure 16. Distribution of some Sardinian and Sardo-Corsican endemism of the family Leptonetidae (top left), Pholcidae
(top right), Liocranidae (down left) and Zodaridae (down right) ( Zodarion sardum is not reported because is generic cited
for Sardinia and no indicates localities).
Catalogue of the spiders (Arachnida Araneae) of Sardinia
95
• Aten gen a soriCUl&tQ □ Tegenaria armigera
O Malthonica eleonorae & Tegenaria hen roti
A Malthonica sardoa
O Lepthyphantes eleonorae A Lepthyphantes sardous
□ Lepthyphantes paoloi iX Palliditphantes angitstiformis
A Centivmerus boneviae
'id Ceatromerus pudditi
O Acartauchenius sardiniensis O Cresmatoneta eleonorae A TyphocrestUS $ardn$
□ Araeoncus longin$cnln$ □ Mecopistes miUidgei
Figure 17. Distribution Sardinian and Sardo-Corsican endemism of the family Agelenidae (top left) and Linyphiidae (top
right, down left, down right).
96
P. Pantini, A. Sassu & G. Serra
O Theridion nasutum
O Philodromus blanckei □ Xystictts sardiniensis
A Xysticus gt a I la tor
Figure 18. Distribution of some Sardinian and Sardo-Corsican endemism of the family Theridiidae (left) and Philodro-
midae plus Thomisidae (right) ( Xysticus parallelus is not reported because is generic cited for Sardinia and no indicates
localities).
appears to be the region with the fewest species. In
our opinion, this situation is not due to the paleo-
bio-geographical events and/or environmental
characteristics of the island but to a lack of speci-
fic research, which is demonstrated by the absence
of several species with a wide distribution. On this
topic, it is interesting to make a comparison with
the fauna of nearby Corsica (Table 6). In fact, the
number of species in the Sardinian-Corsican area
totals 700 species and the number present on each
island is nearly the same, but actually the simila-
rity between the two faunas is not very high (So-
rensen’s index of similarity = 0.63).
On the whole, what strikes us most is the
lack of research into the araneocenosis of the
main Sardinian environments carried out with
adequate timings and methods. Most of the data
comes from general faunal or taxonomic publi-
cation, many of which are now outdated. To
prove this, there are 94 species, slightly less
than 20% of the total, whose latest citation
comes from Garneri (1902) or previously, a
good 110 or more years ago. We hope therefore
that further research into Sardinian araneofauna
will allow us to update and complete this cata-
logue.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
97
Family
Sardi-
nian
species
(n.)
Corsi-
can
species
(n.)
Shared
species
(n.)
Total
Ctenizidae
3
1
1
3
Nemesiidae
4
7
3
8
Filistatidae
2
2
2
2
Sicaridae
1
1
1
1
Scytodidae
2
2
2
2
Leptonetidae
5
1
0
6
Pholcidae
7
6
4
9
Segestriidae
4
4
2
6
Dysderidae
12
12
2
22
Oonopidae
5
5
2
8
Palpimanidae
1
0
0
1
Mimetidae
3
5
3
5
Eresidae
2
1
1
2
Oecobiidae
3
2
2
3
Uloboridae
4
4
4
4
Nesticidae
1
1
1
1
Theridiidae
54
59
41
72
Theridio somatidae
0
1
0
1
Mysmenidae
1
1
0
2
Linyphiidae
58
81
31
108
Tetragnathidae
11
11
9
13
Araneidae
36
31
24
43
Lycosidae
35
31
21
45
Pisauridae
3
2
1
4
Family
Sardi-
nian
species
(n.)
Corsi-
can
species
(n.)
Shared
species
(n.)
Total
Oxyopidae
3
2
2
3
Zoropsidae
2
1
1
2
Zoridae
2
4
1
5
Agelenidae
18
16
10
24
Hahniidae
1
1
0
2
Dictynidae
8
5
3
10
Amaurobiidae
3
4
2
5
Titanoecidae
1
2
1
2
Miturgidae
7
8
6
9
Anyphaenidae
2
2
2
2
Liocranidae
8
8
6
10
Clubionidae
9
9
5
13
Corinnidae
4
5
4
5
Zodariidae
7
8
4
11
Prodidomidae
1
0
0
1
Gnaphosidae
43
48
32
59
Sparassidae
3
3
3
3
Philodromidae
20
20
15
25
Thomisidae
36
34
21
49
Salticidae
60
71
44
87
TOTAL
495
522
319
698
Table 6. Comparison between Sardinian and Corsican ara-
neofauna. The data for Corsican fauna comes from “Fauna
Europaea” (Helsdingen, 2011).
98
P. Pantini, A. Sassu & G. Serra
ACKNOWLEDGEMENTS
The authors wish to thank Roberto A. Pantaleoni
for pressing and encouraging us even during the
most critical drafting phases of the catalogue, for
his patience and for allowing us to examine the vast
amount of material of the ISE Institute.
We would also like to thank Fulvio Gasparo and
Arthur Decae for their valuable advice. Thanks also
go to Aldo Mulas, Gianpaolo Ruzzante and Paolo
Fontana for their collected material. Heartfelt
thanks to Elena Pelizzoli for her illustrations and
Emanuele Biggi for the cover photos.
Our thanks also go to Marcello Verdinelli,
Maria Feonarda Fadda, Laura Loru, Alessandro
Molinu, Francesca Fiori, Piera Marras and Tiziana
Nuvoli who, together with the staff of the ISE and
the Department of Plant Protection of the Univer-
sity of Sassari contributed greatly to the collection
of new material.
REFERENCES
Alicata P., 1966. Le Harpactea (Araneae, Dysderidae)
della fauna italiana e considerazioni sulla loro ori-
gine. Atti dell'Accademia Gioenia di Scienze Natu-
rali, 18: 190-221.
Alderweireldt M. & Jocque R., 1992. A review of the ne-
bulosa- group of Pardosa Koch 1847 in Africa, a
complex with some highly variable species (Araneae
Lycosidae). Tropical Zoology, 5: 73-113.
Altara E., 1968. Ricerche biologiche in Sardegna. Sotto-
terra, Rivista del Gruppo speleologico bolognese CAI
e Speleo Club Bologna Esagono ENAL, 7: 23-27.
Argiolas M., Bartolo G. & Puddu S., 1970. II Monte del
Castello di Quirra e le sue grotte. Ed. Tipografia
I.B.S., Cagliari, 56 pp.
Arnedo M.A., Gasparo F. & Opatova V., 2009. Systema-
tics and phylogeography of the Dysdera erythrina
species complex (Araneae, Dysderidae) in Sardinia.
ZooKeys, 16: 319-345.
Arno C., Luciano P. & Pantaleoni R.A., 1998. La tasso-
cenosi a ragni sui tigli di un'alberata cittadina a Sas-
sari. In: Bologna M.A., Carpaneto G.M. & Cignini
B. (eds.) 1998, Atti 1° Convegno Nazionale sulla
Fauna Urbana. Roma, 12 aprile 1997. Fratelli Pa-
lombi editori, Roma, 87-89.
Ausserer A., 1871. Beitrage zur Kenntniss der Arachni-
den-Familie der Territelariae Thorell (Mygalidae
Autor). Verhandlungen zoologisch-botanische Gesel-
lschaft in Wien, 21:11 7-224.
Ballarin F., Pantini P. & Hansen H., 2011. Catalogo ra-
gionato dei ragni (Arachnida, Araneae) del Veneto.
Memorie del Museo Civico di Storia Naturale di Ve-
rona - 2. Serie. Sezione Scienze della Vita 21, 151 pp.
Bonnet P, 1945. Bibliographia araneorum; analyse me-
thodique de toute la litterature araneologique
jusqu‘en 1939. Douladore, Tolouse, 1: 832 pp.
Bartolo G., Bmscu E. & Dore M., 1973. Sa Fossa de Per-
d’e Cerbu. A cura dello Speleo Club di Cagliari. Ed.
Fossataro, Cagliari, 20 pp.
Bartolo G., Dore M. & Trincas G., 1972. Sa Fossa de su
Fenu Trainu (Terza voragine della Sardegna). A cura
dello Speleo Club di Cagliari. Ed. Fossataro, Cagliari,
39 pp.
Baum S., 1974. Zum "Cribellaten-Problem": Die Geni-
talstrukturen der Oecobiinae und Urocteinae
(Arach.: Aran.: Oecobiidae). Abhandlungen des Na-
turwissenschaftlichen Vereins in Hamburg, 16
(N.F.): 101-153.
Bolzern A., Hanggi A. & Burckhardt D., 2008. Funnel
web spiders from Sardinia: Taxonomical notes on
some Tegenaria and Malthonica spp. (Araneae: Age-
lenidae). Revue suisse de Zoologie, 115: 759-778.
Bosmans R., 1997. Revision of the genus Zodarion
Walckenaer, 1833, part II. Western and Central Eu-
rope, including Italy (Araneae: Zodariidae). Bulle-
tin of the British Arachnological Society, 10:
265-294.
Bosmans R., 2008. Anew contribution to the knowledge
of the genus Typhochrestus Simon in Europe and
North Africa (Araneae: Linyphiidae). Revista Iberica
de Arachnologia, 16: 83-92.
Bosmans R. & Van Keer J., 1999. The genus Enoplogna-
tha Pavesi, 1880 in the mediterranean region (Ara-
neae: Theridiidae). Bulletin of the British
Arachnological Society, 11: 209-241.
Brignoli P.M., 1967a. Oonopidae di Sardegna e Puglie
(Araneae). Rendiconti dell'Istituto lombardo di
Scienze e Lettere (B), 101: 360-368.
Brignoli P.M., 1967b. Su alcuni Leptonetidae della Sar-
degna (Araneae). Rendiconti dell'Istituto lombardo
di Scienze e Lettere (B), 101: 352-359.
Brignoli P.M., 1969a. Note sugli Scytodidae d'ltalia e
Malta (Araneae). Fragmenta Entomologica, 6: 121-
166.
Brignoli P.M., 1969b. Osservazioni su alcuni casi di ri-
generazione delle zampe in Loxosceles rufescens
(Doufur) (Araneae, Scytodidae). Fragmenta Entomo-
logica, 6: 115-119.
Brignoli P.M., 1969c. Secondo contributo alia cono-
scenza dei Leptonetidae della Sardegna (Araneae).
Archivio Zoologico italiano, 54: 11-31.
Brignoli P.M., 1971a. Contributo alia conoscenza degli
Agelenidae italiani (Araneae). Fragmenta entomolo-
gica, 8: 57-142.
Brignoli P.M., 1971b. Note sui Pholcidae d'ltalia. Frag-
menta Entomologica, 7: 79-101.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
99
Brignoli P.M., 1971c. Note sui ragni cavemicoli italiani.
Fragmenta Entomologica, 7: 121-229.
Brignoli P.M., 1973. Ragni d'ltalia XX. Note sugli Hah-
niidae (Araneae). Fragmenta Entomologica, 8: 265-
274.
Brignoli P.M., 1974. Ragni d'ltalia XXI. Settimo contri-
bute alia conoscenza dei ragni cavernicoli di Sarde-
gna e descrizione di una nuova specie di Corsica
(Araneae). Revue suisse de Zoologie, 81: 387-395.
Brignoli P.M., 1975. Ragni d'ltalia XXIII. Nuovi dati su
alcuni Haplogynae. Bollettino della Societa Entomo-
logica Italiana, 107: 170-178.
Brignoli P.M., 1976a. Beitrage zur Kenntnis der Scyto-
didae (Araneae). Revue suisse de Zoologie, 83: 125-
191.
Brignoli P.M., 1976b. Ragni d'ltalia XXIV. Note sulla
morfologia dei genitali intemi dei Segestridae e cenni
sulle specie italiane (Araneae). Fragmenta Entomo-
logica, 12: 19-62.
Brignoli P.M., 1977. Ragni d'ltalia XXVII. Nuovi dati su
Agelenidae, Argyronetidae, Hahniidae, Oxyopidae e
Pisauridae, cavemicoli ed epigei (Araneae). Quaderni
del Museo di Speleologia "V. Rivera" L'Aquila, 2:3-
118.
Brignoli P.M., 1979a. Contribution a la connaissance des
Uloboridae palearctiques (Araneae). Revue Arachno-
logique, 2: 275-282.
Brignoli P.M., 1979b. Ragni d'ltalia XXIX. Dysderidae
nuovi o interessanti. Bollettino della Societa Ento-
mologica Italiana, 111: 17-26.
Brignoli P.M., 1979c. Ragni d'ltalia XXX. Nuovi dati
corologici ed ecologici su alcune specie di araneidae.
(Araneae). Fragmenta Entomologica, 15: 17-41.
Brignoli P.M., 1979d. Ragni d'ltalia XXXI. Specie ca-
vernicole nuove o interessanti (Araneae). Quaderni
del Museo di Speleologia "V. Rivera" L'Aquila, 10:
3-48.
Brignoli P.M., 1980. Ragni d'ltalia XXXIII. II genere Ro-
bertus (Araneae, Theridiidae). Fragmenta Entomolo-
gica, 15:259-265.
Brignoli P.M., 1982. Contribution a la connaissance des
Filistatidae paleartiques (Araneae). Revue Arachno-
logique, 4: 65-75.
Brignoli P.M., 1984. Zur Problematik der mediterranen
Pisaura - Arten (Arachnida, Araneae, Pisauridae).
Zoologischer Anzeiger, Jena, 213 (1/2): 33-43.
Brignoli P.M. & Gaddini A., 1979. Nuovi dati su alcuni
Anyphenidae, Liocranidae e Gnaphosidae italiani
(Araneae). Bollettino dell'Associazione Romana di
Entomologia, 34: 10-15.
Brignoli P.M. & Murphy J., 1984. Nuovi dati su alcuni
Gnaphosidae italiani (Araneae). Bollettino dell'As-
sociazione Romana di Entomologia, 38 (1983): 1-4.
Buchar J., Knoflach B. & Thaler K., 2006. On the iden-
tity of Arctosa variana C.L. Koch and Arctosa similis
Schenkel, with notes on related species (Araneae: Ly-
cosidae). Bulletin of the British Arachnological So-
ciety, 13: 329-336.
Buchar J. & Thaler K., 1995. Zur Variation der Kopula-
tionsorgane von Pistius truncatus (Pallas) (Araneida,
Thomisidae) in Mitteleuropa. Linzer biologische Bei-
trage, 27: 653-663.
Burger M., Graber W., Michalik P. & Kropf C., 2006. Sil-
houettella loricatula (Arachnida, Araneae, Oonopi-
dae): A Haplogyne Spider With Complex Female
Genitalia. Journal of Morphology, 267: 663-677.
Canestrini G. & Pavesi P., 1868. Araneidi italiani. Atti
della Societa Italiana di Scienze Naturali, 11: 738-872.
Canestrini G. & Pavesi P., 1870. Catalogo sistematico
degli Araneidi italiani. Archivio per la Zoologia,
l'Anatomia e la Fisiologia, 2: 1-44.
Canestrini G., 1873. Nuove specie italiane di Aracnidi.
Atti della Societa Veneto-Trentina di Scienze Natu-
rali, 2: 45-52.
Canestrini G., 1876. Osservazione aracnologiche. Atti
della Societa Veneto-Trentina di Scienze Naturali, 3:
206-232.
Cannas V.M., 1982. Visioni di un paesaggio carsico. Sa-
dali. Storia e aspetti naturali del suo territorio. Ettore
Gasperini ed., Cagliari, 46-49.
Casale A., 1972. Visione d'insieme del complesso ecolo-
gico e faunistico della Grotta del Bue Marino (Cala
Gonone, Dorgali, NU). Bollettino della Societa Sarda
di Scienze Naturali, 10: 111-136.
Casale A., Grafitti G. & Onnis C., 2004. Sardaphae-
nops adelphus, il nuovo coleottero ipogeo dedicato
a tutti gli speleologi sardi. Antheo, Bolletino
Gruppo speleo-archeologico Giovanni Spano, Ca-
gliari, 8: 30-36.
Cermti M., 1968. Materiali per un primo elenco degli Ar-
tropodi speleobii della Sardegna. Fragmenta Entomo-
logica, 5: 207-257.
Colombo M. & Manunza B., 2009. First record of Cyr-
tarachne ixoides (Simon, 1870) (Araneae: Araneidae)
from Sardinia. Revista Iberica de Aracnologia, 17:
67-70.
Costa A., 1882. Notizie ed osservazioni sulla geofauna
sarda - Memoria Prima. Atti della Reale Accademia
delle Scienze Fisiche e Matematiche di Napoli, 9:
1-42.
Costa A., 1883. Notizie ed osservazioni sulla geofauna
sarda - Memoria Seconda. Atti della Reale Accade-
mia delle Scienze Fisiche e Matematiche di Napoli,
1 serie 2: 1-109.
Costa A., 1884. Notizie ed osservazioni sulla geofauna
sarda - Memoria Terza. Atti della Reale Accademia
delle Scienze Fisiche e Matematiche di Napoli, 1
serie 2: 1-64.
Costa A., 1885. Notizie ed osservazioni sulla geofauna
sarda - Memoria Quarta. Atti della Reale Accademia
100
P. Pantini, A. Sassu & G. Serra
delle Scienze Fisiche e Matematiche di Napoli, 1
serie 2: 1-31.
Costa A., 1886. Notizie ed osservazioni sulla geofauna
sarda - Memoria Quinta. Atti della Reale Accademia
delle Scienze Fisiche e Matematiche di Napoli, 2
serie 2: 1-24.
de Carlini A., 1885. Artropodi dell'isola di S. Pietro. Bol-
lettino della Societa Entomologica Italiana, 17: 192-
196.
Decae A.E. & Di Franco F., 2005. Nemesia sanzoi Fage,
1917 (Araneae, Nemesiidae): first description of the
male and some additional information on the fe-
male, distribution and biology of the species. Bul-
letin of the British Arachnological Society, 13:
133-137.
Deeleman-Reinhold C.L. & Deeleman P.R., 1988. Revision
des Dysderinae (Araneae, Dysderidae), les especes me-
diterraneennes occidentales exceptees. Tijdschrift voor
Entomologie, 131: 141-269.
Di Pompeo P., Kulczycki A., Legittimo C.M. & Simeon
E., 2011. New records for Europe: Argiope trifasciata
(Forsskal, 1775) from Italy and Malta (Araneae, Ara-
neidae). Bulletin of the British Arachnological So-
ciety, 15: 205-208.
Dresco E., 1956. Tegenaria henroti, espece nouvelle des
grottes de Sardaigne. Fragmenta Entomologica, 6:
167-181.
Dresco E. & Hubert M., 1969. Araneae Speluncarum Ita-
liae I. Fragmenta Entomologica, 2: 115-119.
Fontana R., Cantarella T., Sala L. & Tongiorgi P., 1996.
Acolletion of Italian salticids (Araneae), mainly from
the Tuscan-Emilian Apennines. Revue suisse de Zoo-
logie, hors serie: 211-222.
Fresi G., Amo C. & Pantaleoni R. A., 2002. 1 Ragni negli
ecosistemi: prime ricerche in Sardegna. Notiziario
Forestale, Cagliari, 20: 30-33.
Garneri G.A., 1902. Contribuzione alia fauna sarda.
Aracnidi. Bollettino della Societa Zoologica italiana,
serie 2, 3: 57-103.
Gasparo F., 1999. Ridescrizione di Stalita patrizii Rower,
1956, specie tipo del nuovo genere Sardostalita (Ara
Dysderidae). Bollettino del Museo regionale di
Scienze naturali di Torino, 16: 59-76.
Gozo A., 1908. Gli Aracnidi di caveme italiane. Bollettino
della Societa Entomologica Italiana, 38: 109-139.
Grafitti G., 1979. Primi dati sulla fauna di Sa Ucca de Su
Tintirriolu. Bollettino del Gmppo speleologico Sas-
sarese, 5: 32-37.
Grafitti G., 1984. Ricerche faunistiche nelle grotte di
Monte Majore. Bollettino del Gmppo speleologico
Sassarese, 8: 36-44.
Grafitti G., 1993. La fauna della Grotta Sa Rocca Ulari
(Bomtta, Prov. di Sassari). Bollettino del Gmppo spe-
leologico Sassarese, 14: 17-27.
Grafitti G., 2001. Note speleofaunistiche. In: De Waele
J., Onnis C. & Robin Y. 2001. Lovettecannas, dove
le dolomie incontrano i graniti. Speleologia, Rivista
della Societa speleologica Italiana, 45: 26-29.
Grafitti G., 2003. Ricerche faunistiche nella Grotta Is
Zuddas (Santadi-Sardegna sud-occidentale). Sarde-
gna Speleologica, 20: 64-68.
Grafitti G., 2007a. La fauna cavernicola. In: Mucedda
M. & Grafitti G. (eds.) 2007. Le grotte di Bonu
Ighinu nel Comune di Mara. Ed. Segnavia, Sassari,
65-75.
Grafitti G., 2007b. La fauna delle grotte. In: Piras V. (ed.)
2007. Gmttas e Pelciones. Grotte e caverne di terra e
di mare della Planargia e del Montiferm occidentale.
Geologia, geomorfologia, biologia. Ed. Grafiche Edi-
toriali Solinas, Nuoro, 219-227.
Grafitti G. & Merella G., 2008. Ricerche faunistiche in
grotte del Sulcis - Iglesiente. Atti del XX Congresso
Nazionale di Speleologia, Iglesias 27-30 aprile 2007.
Memorie dell’Istituto Italiano di Speleologia, serie
11,21: 83-95.
Grasshoff M., 1959. Dysdera- Arten von Inseln des Mit-
telmeergebietes (Arach., Araneae). Senckenbergiana
biologica, 40: 209-220.
Grasshoff M., 1983. Larinioides Caporiacco 1934, der
korrekte Name fur die sogennante Araneus cornu-
to-Gruppe. Senckenbergiana biologica, 64: 225-
229.
Grill A., Knoflach B., Cleary D.F.R. & Kati V., 2005.
Butterfly, spider, and plant communities in different
land-use types in Sardinia, Italy. Biodiversity and
Conservation, 14: 1281-1300.
Grimm U., 1985. Die Gnaphosidae Mitteleuropas (Ara-
chnida, Araneae). Abhandlungen des Naturwissen-
schaftlichen Vereins in Hamburg, 26 (NF): 5-318.
Grimm U., 1986. Die Clubionidae Mitteleuropas: Corin-
ninae und Liocraninae (Arachnida, Araneae). Abhan-
dlungen des Naturwissenschaftlichen Vereins in
Hamburg, 27 (NF): 3-91.
Hansen H., 1985. Contribute alia conoscenza dei Salti-
cidae italiani (Arachnida: Araneae). Bollettino del
Museo civico di Storia naturale di Venezia, 34(1983):
241-322.
Hansen H., 1986. Die salticidae der coll. Canestrini (Ara-
chnidae: Araneae). Lavori - Societa Veneziana di
Scienze Naturali, 11: 97-120.
Hansen H., 2005. Arachnida Araneae Salticidae + CD-
ROM. In: Ruffo S. & Stoch F. (eds) 2005, Checklist
e distribuzione della fauna italiana. Memorie del
Museo civico di Storia naturale di Verona, 2 Serie,
Sezione Scienze della Vita, 16: 77-78.
Helsdingen P.J. van, 1969. A reclassification of the spe-
cies of Linyphia Latreille based on the functioning of
the genitalia (Araneida, Linyphiidae), I. Zoologische
Verhandelingen, 105: 3-303.
Helsdingen P.J. van, 2005. New spider species records
for Sardinia (Arachnida: Araneae). Nieuwsbrief SPI-
NED, 20: 13-20.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
101
Helsdingen P.J. van, 2012. Araneae. In: Fauna Europaea,
Database European spiders and their distribution - Di-
stribution - Version 2012.1, http://www.faunaeur.org.
Isaia M., 2005. Check-list delle specie di ragni (Ara-
chnida, Araneae) della Val d’ Aosta con una nuova se-
gnalazione per la fauna Italiana. Revue Valdotaine
d’Histoire Naturelle, 59:25-43.
Isaia M., Pantini P., Beikes S. & Badino G., 2007. Cata-
logo ragionato dei ragni (Arachnida, Araneae) del
Piemonte e della Lombardia. Memorie dell’Associa-
zione naturalistica piemontese, 9, 161 pp.
Knoflach B., 1996. Die Arten der Steatoda phalerata-
Gruppe in Europa (Arachnida: Araneae, Theridiidae).
Mitteilungen der Schweizerischen Entomologischen
Gesellschaft - Bulletin de la Societe Entomologique
Suisse, 69: 377-404.
Knoflach B., 1999. The comb-footed spider genera Neot-
tiura and Coleosoma in Europe (Araneae, Theridiidae).
Mitteilungen der Schweizerischen entomologischen
Gesellschaft - Bulletin de la Societe Entomologique
Suisse, 72: 341-371.
Knoflach B., 2004. Diversity in the copulatory behaviour
of comb-footed spiders (Araneae, Theridiidae). De-
nisia 12, zugleich Kataloge der OO. Landesmuseen,
Neue Serie 14: 161-256.
Knoflach B. & Pfaller K., 2004. Kugelspinnen - eine Ein-
fuhrung (Araneae, Theridiidae). Denisia 12, zugleich
Kataloge der OO. Landesmuseen, Neue Serie 14:
111-160.
Knoflach B., Rollard C. & Thaler K., 2009. Notes on Me-
diterranean Theridiidae (Araneae) - II. ZooKeys, 16:
227-264.
Knoflach B. & Thaler K., 2000. Notes on the mediterra-
nean Theridiidae (Araneae). I. Memorie della Societa
Entomologica Italiana, 78: 411-442.
Krauss O., 1955. Spinnen von Korsika, Sardinien und
Elba (Arach., Araneae). Senckenbergiana biologica,
36 (5/6): 371-394.
Kulczycki A., Legittimo C.M., Simeon E. & Di Pom-
peo P., 2012. New records of Steatoda nobilis (Tho-
rell, 1875) (Araneae, Theridiidae), an introduced
species on the Italian mainland and in Sardinia.
Bulletin of the British Arachnological Society, 15:
269-272.
Lana E., Casale A., Giachino P.M. & Grafitti G., 2006.
Attivita biospeleologica anni 2004-2005. Grotte, Bol-
lettino del Gruppo speleologico piemontese CAI-
UGET, Torino, (49) 145: 38-47.
Letardi A. & Pantaleoni R.A., 2007. Survey towards an
inventory of Italian Neuropterida. In: Pantaleoni
R.A., Letardi A. & Corazza C. (ed). Proceedings of
the IX International Symposium on Neuropterology,
Ferrara 20-23 June 2005 [with a Tribute to Maria Ma-
tilde Principi], Annali del Museo civico di Storia na-
turale di Ferrara, 8: 87-93.
Loerbroks A., 1983. Revision der Krabbenspinnen-Gat-
tung Heriaeus Simon (Arachnida: Araneae: Thomi-
sidae). Verhandlungen des Naturwissenschaftlichen
Vereins in Hamburg, 26 (NF): 85-139.
Logunov D., 2004. Notes on the collection of Salticidae
(Araneae) from the Museum of Natural History "En-
rico Gaffi" in Bergamo, Italy. Revista Iberica de
Aracnologia, 9: 271-275.
Logunov D. & Azarkina G.N., 2006. New species and
records of Phlegm from Africa (Araneae, Salticidae).
Revue suisse de Zoologie, 113: 727-746.
Lorn L., Marras P.M., Guidone L., Sassu A., Verdinelli
M., Tavella L. & Pantaleoni R.A., 2008. Importanza
dei predatori generalisti in noccioleti piemontesi e
sardi. In: Scortichini M. (ed.) 2008. La corilicoltura
biologica in Italia. Ed. CRA Centro di Ricerca per la
Frutticoltura, Roma, 111-136.
Lugetti G. & Tongiorgi P., 1965. Revisione delle specie
italiane dei generi Arctosa C.L. Koch e Tricca
Simon con note su una Acantholycosa delle Alpi
Giulie (Araneae, Lycosidae). Redia, 49 (1964-
1965): 165-229.
Lugetti G. & Tongiorgi P., 1969. Ricerche sul genere Alo-
pecosa Simon (Araneae, Lycosidae). Atti della So-
cieta Toscana di Scienze Naturali Memorie, serie B
76: 1-100.
Magretti P., 1878. Rapporto su di un'escursione nella Sar-
degna compiuta nel dicembre 1877. Atti della Societa
Italiana di Scienze Naturali, 21: 451-463.
Magretti P., 1880. Una seconda escursione zoologica al-
fisola di Sardegna. Atti della Societa Italiana di
Scienze Naturali, 23: 18-41.
Marras P.M., Lorn L., Sassu A., Sanna F. & Pantaleoni
R.A., 2011. Influence of ant-exclusion on generalist
predators in a citrus orchard. IOBC/wprs Bulletin Vol
62, 2011: 345-350.
Metzner H., 1999. Die Springspinnen (Araneae, Saltici-
dae) Griechenlands. Andrias, 14: 3-279.
Minelli A., Ruffo S. & La Posta S. (eds.), 1993-1995.
Checklist delle specie della fauna italiana. Edizioni
Calderini, Bologna.
Muccedda M., Grafitti G. & Dore G., 2002. Grotte della
provincia di Sassari. La Celere Editrice, Alghero:
208 pp.
Muster C., 2009. Phylogenetic relationships within Phi-
lodromidae, with a taxonomic revision of Philodro-
mus subgenus Artanes in the western Palearctic
(Arachnida: Araneae). Invertebrate Systematics, 23:
135-169.
Muster C., Bosmans R. & Thaler K., 2007. The Philo-
dromus pulchellus- group in the Mediterranean: taxo-
nomic revision, phylogenetic analysis and
biogeography (Araneae: Philodromidae). Inverte-
brate Systematics, 21: 39-72.
Muster C. & Thaler K., 2004. New species and records
of Mediterranean Philodromidae (Arachnida, Ara-
102
P. Pantini, A. Sassu & G. Serra
neae): I. Philodromus aureolus group. Denisia, 14:
305-326.
Nentwig W., Blick T., Gloor D., Hanggi A. & Kropf C.,
2011. Araneae Spiders of Europe, Version 6.2011.
Web site at http://www.araneae.unibe.ch/
Noflatscher M.T., 1996. Aranei - Spinnen, Webspinnen.
In: Hellrigl K. (ed.) 1996, Die Tierwelt Sudtirols. Ve-
ro ffentlichungen des Naturmuseums Sudtirol, Bozen,
211-228.
Pantini P., in press. Italian araneofauna: the state of our
knowledge. XXXVIII Congresso della Societa Ita-
liana di Biogeografia. Biogeographia vol. XXXI.
Pantini P. & Isaia M., 2008. New records for the Italian
spider fauna (Arachnida, Araneae). Arthropoda Se-
lecta, 17: 133-144.
Pantini P. & Sassu A., 2009. I ragni dell’Isola dell’Asi-
nara (Sardegna NW) (Arachnida, Araneae). Annali
del Museo civico di storia naturale di Genova, 100:
619-647.
Pavesi R, 1876. Le prime crociere del Violante, coman-
dato dal Capitano-Armatore Enrico d' Albertis. Risul-
tati aracnologici. Annali del Museo civico di storia
naturale di Genova, 8: 407-451.
Pavesi R, 1878. Nuovi risultati aracnologici delle Cro-
ciere del "Violante". Aggiunto un catalogo sistema-
tico degli Aracnidi di Grecia. Annali del Museo
civico di storia naturale di Genova, 11: 337-396.
Pesarini C., 1994. Arachnida Araneae. In: Minelli A.,
Ruffo S. & La Posta S. (eds.) 1994. Checklist delle
specie della fauna italiana. Edizioni Calderini, Bolo-
gna, 23, 1-42.
Pesarini C., 2000. Contributo alia conoscenza della fauna
araneologica italiana (Araneae). Memorie della So-
cieta Entomologica Italiana, 78: 379-393.
Platnick N.I., 2012. The world spider catalog, version
12.5. American Museum of Natural History, online
at http://research.amnh.org/iz/spiders/catalog. DOI:
10.5531/db.iz.0001.
Platnick N.I. & Di Franco F., 1992. On the relationships
of the spider genus Cybaeodes (Araneae, Dionycha).
American Museum Novitates, 3053: 1-9.
Pons G., 1993. Noves dades sobre biospeleologia de Sar-
denya: (Arachnida, Araneae). Endins (Palma de Mal-
lorca), 19: 43-47.
Puddu S., 1970. La fauna. In: Bartolo G. & Di Paola A.
1970. Ussassai. Gairo. Osini. Attuali conoscenze spe-
leologiche. A cura dello Speleo Club di Cagliari. Ed.
Sarda Fossataro, Cagliari, 79-93.
Puddu S., 1971. La fauna. In: Bartolo G. & Ferrara R.
197 1 . II Promontorio di S. Elia e le sue grotte. A cura
dello Speleo Club di Cagliari. Ed. Sarda Fossataro,
Cagliari, 67-68.
Puddu S., 1980. La fauna. In: Bartolo G., Dore M. &
Lecis A. 1980. Is Angurtidorgius (La cavita piu vasta
della Sardegna). A cura dello Speleo Club Cagliari.
Ed. GIA, Cagliari, 41-56.
Puddu S., 1983. Attuali conoscenze speleofaunistiche. In:
Bartolo G., Coroneo M. & Lecis A. (eds.) 1983. Su
Marmori (Perla di Ulassai). A cura dello Speleo Club
Cagliari. Ed. Guido Bartolo, Cagliari, 33-40.
Puddu S. & Pirodda G., 1974. Catalogo sistematico ra-
gionato della fauna cavernicola della Sardegna. Ren-
diconti del Seminario della Facolta di Scienze
delTUniversita di Cagliari, 43 (3-4), (1973): 151-205.
Raven R.J., 1985. The spider infraorder Mygalomor-
phae (Araneae): Cladistics and systematics. Bulletin
of the American Museum of Natural History, 182:
1-180.
Roewer C.F., 1953. Cavernicole Arachniden aus Sardi-
nien. Notes biospeleologiques, 8: 39-49.
Roewer C.F., 1956. Cavernicole Arachniden aus Sardi-
nien. II. Fragmenta Entomologica, 2 (9): 97-104.
Ruffo S. & Stoch F., 2005. Checklist e distribuzione della
fauna italiana. Memorie del Museo Civico di Storia
Naturale di Verona, 2a serie, Sezione Scienze della
Vita, 16, 307 pp.
Ruffo S. & Vigna Taglianti A., 2002. Generalita sulla
fauna italiana. In: Minelli A., Chemini C., Argano R.
& Ruffo S. (eds) 2002, La fauna in Italia, Touring
Editore, Milano e Ministero dell’Ambiente e della
Tutela del Territorio, Roma, 24-28.
Sanna B., Puddu S. & Bartolo G., 1972. Su Mannau. Ed.
Fossataro, Cagliari, 97-114.
Senglet A., 2004. Copulatory mechanism in Zelotes,
Drassyllus and Trachyzelotes (Araneae, Gnaphosi-
dae), with additional faunistic and taxonomic data on
Southwest Europe. Mitteilungen der Schweizerischen
entomologischen Gesellschaft - Bulletin de la Societe
Entomologique Suisse, 77: 87-119.
Senglet A., 2011. New species in the Zelotes tenuis-gxovep
and new or little known species in other Zelotes
groups (Gnaphosidae, Araneae). Revue suisse de
Zoologie, 118: 513-559.
Simon E., 1884. Les arachnides de France. La famille des
Theridionidae (suite). Paris, Enciclopedie Roret, L.
Mulo, tomo 5 (2 parte), 180-420.
Simon E., 1914. Les arachnides de France. Synopsis ge-
nerate et catalogue des especes frangaises de l'ordre
des Araneae. Paris, Enciclopedie Roret, L. Mulo,
tomo 6 (1 parte), 1-308.
Simon E., 1926. Les arachnides de France. Synopsis ge-
nerate et catalogue des especes frangaises de l'ordre
des Araneae (suite). Paris, Enciclopedie Roret, L.
Mulo, tomo 6 (2 parte), 309-532.
Simon E., 1929. Les arachnides de France. Synopsis ge-
nerate et catalogue des especes frangaises de l'ordre
des Araneae (suite). Paris, Enciclopedie Roret, L.
Mulo, tomo 6 (3 parte), 533-772.
Simon E., 1932. Les arachnides de France. Synopsis ge-
nerate et catalogue des especes frangaises de l'ordre
des Araneae (suite). Paris, Enciclopedie Roret, L.
Mulo, tomo 6 (4 parte), 773-978.
Catalogue of the spiders (Arachnida Araneae) of Sardinia
103
Tanasevitch A.V., 2011. On linyphiid spiders (Araneae)
from the Eastern and Central Mediterranean kept at
the Museum d’histoire naturelle, Geneva. Revue
suisse de Zoologie, Geneve, 118: 49-91.
Thaler K. & Knoflach B., 1998. Zoropsis spinimana (Du-
four), eine fur Osterreich neue Adventivart (Araneae,
Zoropsidae). Berichte des Naturwissenschaftlich-Me-
dizinischen Vereins in Innsbruck, 85: 173-185.
Thaler K. & Knoflach B., 2003. Zur Faunistik der Spin-
nen (Araneae) von Osterreich: Orbiculariae p.p.
(Araneidae, Tetragnathidae, Theridiosomatidae,
Uloboridae). Linzer biologische Beitrage, 35: 613-
655.
Thaler K. & Knoflach B., 2004. Fauna Austriaca: Web-
spinnen - zur Einfuhrung (Arachnida, Araneae). De-
nisia 12, zugleich Kataloge der OO. Eandesmuseen,
Neue Serie 14: 357-380.
Thaler K., van Harten A. & Knoflach B., 2004. Pirate
spiders of the genus Em C.E. Koch from southern
Europe, Yemen, and Ivory Coast, with two new spe-
cies (Arachnida, Araneae, Mimetidae). Denisia, 13:
359-398.
Thermes G., 1972. Primo contributo alia conoscenza
della fauna araneologica della Sardegna (Fauna ipo-
gea ed epigea). Bollettino della Societa Sarda di
Scienze Naturali, 11: 29-48.
Tongiorgi P., 1966. Italian Wolf Spiders of the Genus
Pardosa (Araneae, Lycosidae). Bulletin of the Mu-
seum of Comparative Zoology, 134: 275-334.
Tongiorgi P., 1974. Some notes on Pardosa occidental is
Simon (Araneae, Lycosidae). Bulletin of the British
Arachnological Society, 3: 62-63.
Tongiorgi P. & Sola C., 1991. Pardosa nigristemis Denis,
1966. A North African component of the Italian and
Spanish arachnofauna. XHIe Colloque Europeen
d’Arachnologie Neuchatel 2-6 sept. 1991, Bulletin de
la Societe neuchateloise des Sciences Naturelles, 116:
241-244.
Trotta A., 2005. Introduzione ai Ragni italiani (Arachnida
Araneae). Memorie della Societa Entomologica Ita-
liana, 83: 3-178.
Trotta A., 2009. Ricerche zoologiche della nave oceano-
grafica “Minerva” (C.N.R.) sidle isole circumsarde.
XXXII. Araneae. Annali del Museo Civico di Storia
Naturale "Giacomo Doria", 100: 481-500.
Trotta A., 2011. Second contribution to the knowledge
of the spiders of Sardinia (Arachnida, Araneae). In:
Nardi G., Whitmore D., Bardiani M., Birtele D.,
Mason F., Spada I. & Cerretti P. (eds) 2011. Biodi-
versity of Marganai and Montimannu (Sardinia). Re-
search in the framework of the ICP Forest network.
Conservazione Habitat Invertebrati, 5: 137-161.
Vigna Taglianti A., Audisio P.A., Belfiore C., Biondi M.,
Bologna M.A., Carpaneto G.M., De Biase A., De Fe-
lici S., Piattella E., Racheli T., Zapparoli M. & Zoia
S., 1992. Riflessioni di gruppo sui corotipi fondamen-
tali della fauna W-Paleartica ed in particolare italiana.
Biogeographia, 16: 159-179.
Vigna Taglianti A., Audisio P.A., Biondi M., Bologna
M.A., Carpaneto G.M., De Biase A., Fattorini S.,
Piattella E., Sindaco R.,Venchi A. & Zapparoli M.,
1999. A proposal for a chorotype classification of the
Near East fauna in the framework of the Western Pa-
leartic region. Biogeographia, 20: 31-59.
Wunderlich J., 1973. Beschreibung einiger bisher unbe-
kannter Arten der Gattung Zodarion Walckenaer aus
Siideuropa (Arachnida: Araneae: Zodariidae). Sen-
ckenbergiana biologica, 54: 171-176.
Wunderlich J., 1995a. Sardinion perplexum n. gen. n. sp.,
eine bisher unbekannte Spinnenart von Sardinien
(Arachnida: Araneae: Theridiidae). Beitrage zur Ara-
neologie, 4 (1994): 687-690.
Wunderlich J., 1995b. Zur kenntnis der Endemiten, zur
evolution und zur Biogegraphie der Spinnen Corsi-
cas und Sardiniens, mit neubeschreibungen (Ara-
chnida: Araneae). Beitrage zur Araneologie, 4
(1994): 353-383.
Wunderlich J., 1995c. Zur kenntnis mediterraner Arten
der Gattung Enoplognatha Pavesi 1880, mit einer
neubeschreibung (Arachnida: Araneae: Theridiidae).
Beitrage zur Araneologie, 4 (1994): 703-713.
Wunderlich J., 1995d. Zur kenntnis West-Palaarktischer
Arten der Gattungen Psammitis Menge 1875, Xysti-
cus C.L. Koch 1835 und Ozyptila Simon 1864 (Ara-
chnida: Araneae: Thomisidae). Beitrage zur
Araneologie, 4 (1994): 749-774.
Wunderlich J., 1995e. Zur taxonomie und Biogeogra-
phie der Arten der Gattung Oecobius Lucas 1846,
mit neubeschreibungen aus der mediterraneis und
von der arabischen Halbinsel (Arachnida: Araneae:
Oecobiidae). Beitrage zur Araneologie, 4 (1994):
585-608.
Wunderlich J., 2011. Extant and fossil spiders (Araneae).
Beitrage zur Areneologie, 6: 1-640.
104
P. Pantini, A. Sassu & G. Serra
INDEX
Family Tetragnathidae
37
Family Araneidae
39
Family Lycosidae
44
ABSTRACT
3
Family Pisauridae
49
Family Oxyopidae
50
INTRODUCTION
3
Family Zoropsidae
50
Family Zoridae
50
ARANEOLOGICAL RESEARCH
Family Agelenidae
51
IN SARDINIA
4
Family Hahniidae
53
Family Dictynidae
53
MATERIALS AND METHODS
8
Family Amaurobiidae
55
Family Titanoecidae
55
LIST OF SPECIES
11
Family Miturgidae
55
Family Anyphaenidae
56
Family Ctenizidae
11
Family Liocranidae
57
Family Nemesiidae
11
Family Clubionidae
58
Family Filistatidae
12
Family Corinnidae
60
Family Sicariidae
12
Family Zodariidae
60
Family Scytodidae
13
Family Prodidomidae
62
Family Leptonetidae
13
Family Gnaphosidae
63
Family Pholcidae
14
Family Sparassidae
73
Family Segestriidae
15
Family Philodromidae
73
Family Dysderidae
15
Family Thomisidae
76
Family Oonopidae
18
Family Salticidae
80
Family Palpimanidae
18
Family Mimetidae
19
CONSIDERATIONS ABOUT
Family Eresidae
19
SARDINIAN ARANEOFAUNA
89
Family Oecobiidae
19
Family Uloboridae
20
CONCLUSIONS
92
Family Nesticidae
20
Family Theridiidae
21
ACKNOWLEDGEMENTS
98
Family Mysmenidae
29
Family Linyphiidae
29
REFERENCES
98
APPENDIX 1. List of municipalities of the current eight Sardinian provinces. For each
borough the belonging historical province when different from the current is indicated
in brackets. Historical provinces (until 2005) are: Cagliari (CA), Nuoro (NU), Oristano
(OR) and Sassari (SS).
CAGLIARI (CA)
Armungia
Assemini
Ballao
Barrali
Burcei
Cagliari
Capoterra
Castiadas
Decimomannu
Decimoputzu
Dolianova
Domus De Maria
Donori
Ehnas
Escalaplano (NU)
Escolca (NU)
Esterzili (NU)
Gergei (NU)
Gesico
Goni
Guamaggiore
Guasila
Isili NU
Mandas
Maracalagonis
Monastir
Monserrato
Muravera
Nuragus (NU)
Nurallao (NU)
Nuraminis
Nurri (NU)
Orroli (NU)
Ortacesus
Pimentel
Pula
Quartu Sant'Elena
Quartucciu
Sadali(NU)
Samatzai
San Basilio
San Nicolo Gerrei
San Sperate
San Vito
Sant Andrea Frius
Sarroch
Selargius
Selegas
Senorbi
Serdiana
Serri (NU)
Sestu
Settimo San Pietro
Seulo (NU)
Siliqua
Silius
Sinnai
Siurgus Donigala
Soleminis
Suelli
Teulada
Ussana
Uta
Vallermosa
Villa San Pietro
Villanovatulo (NU)
Villaputzu
Villasalto
Villasimius
Villasor
Villaspeeiosa
CARBON I A-IGLESIAS (Cl)
Buggerru(CA)
Calasetta(CA)
Carbonia(CA)
Carloforte(CA)
Domusnovas(CA)
Fluminimaggiore(CA)
Giba(CA)
Gonnesa(CA)
Iglesias(CA)
Masainas(CA)
Musei(CA)
Narcao(CA)
Nuxis(CA)
Perdaxius(CA)
Piscinas(CA)
Portoscuso(CA)
San Giovanni Suergiu(CA)
SantAnna Arresi(CA)
SantAntioco(CA)
Santadi(CA)
Tratalias(CA)
Villamassargia(CA)
V illaperuccio(C A)
MEDIO CAMPIDANO (VS)
Arbus (CA)
Barumini (CA)
Collinas (CA)
Furtei (CA)
Genuri (CA)
Gesturi (CA)
Gonnosfanadiga (CA)
Guspini (CA)
Las Plassas (CA)
Lunamatrona (CA)
Pabillonis (CA)
Pauli Arbarei (CA)
Samassi (CA)
San Gavino Monreale (CA)
Sanluri (CA)
Sardara (CA)
Segariu (CA)
Serramanna CA
Serrenti (CA)
Setzu (CA)
Siddi (CA)
Tuili (CA)
Turri (CA)
Ussaramanna (CA)
Villacidro (CA)
Villamar (CA)
Villanovaforru (CA)
Villanovafranca (CA)
NUORO (NU)
Aritzo
Atzara
Austis
Belvi
Birori
Bitti
Bolotana
Borore
Bortigali
Desulo
Dorgali
Dualchi
Fonni
Gadoni
Galtelli
Gavoi
Irgoli
Lei
Loculi
Lode
Lodine
Lula
Macomer
Mamoiada
Meana Sardo
Noragugume
Nuoro
Oliena
Ollolai
Olzai
Onani
Onifai
Oniferi
Orani
Orgosolo
Orosei
Orotelli
Ortueri
Orune
Osidda
Ottana
Ovodda
Posada
Sarule
Silanus
Sindia
Siniscola
Sorgono
Teti
Tiana
Tonara
Torpe
OGLIASTRA (OG)
Arzana(NU)
Barisardo(NU)
Baunei(NU)
Cardedu(NU)
Elini(NU)
Gairo(NU)
Girasole(NU)
Ilbono(NU)
Jerzu(NU)
Lanusei(NU)
Loceri(NU)
Lotzorai(NLJ)
Osini(NU)
Perdasdefogu(NU)
Seui(NU)
Talana(NU)
Tertenia(NU)
Tortoli(NU)
Triei(NU)
Ulassai(NU)
Urzulei(NU)
Ussassai(NU)
Villagrande Strisaili(NU)
OLBIA-TEMPIO (OT)
Aggius (SS)
Aglientu (SS)
Ala Dei Sardi (SS)
Arzachena (SS)
Badesi (SS)
Berchidda (SS)
Bortigiadas (SS)
Budduso (SS)
Budoni (NU)
Calangianus (SS)
Golfo Aranci (SS)
La Maddalena (SS)
Loiri Porto San Paolo (SS)
Luogosanto (SS)
Luras (SS)
Monti (SS)
Olbia (SS)
Oschiri (SS)
Padru (SS)
Palau (SS)
San Teodoro (NU)
Sant’ Antonio di Gallura (SS)
Santa Teresa di Gallura (SS)
Telti (SS)
Tempio Pausania (SS)
Trinita d’Agultu- Vignola (SS)
ORISTANO (OR)
Abbasanta
Aidomaggiore
Albagiara
Ales
Allai
Arborea
Ardauli
Assolo
Asuni
Baradili
Baratili San Pietro
Baressa
Bauladu
Bidoni
Bonarcado
Boroneddu
Bosa
Busachi
Cabras
Cuglieri
Curcuris
Flussio (NU)
Fordongianus
Genoni (NU)
Ghilarza
Gonnoscodina
Gonnosno
Gonnostramatza
Laconi (NU)
Magomadas (NU)
Marrubiu
Masullas
Milis
Modolo (NU)
Mogorella
Mogoro
Montresta (NU)
Morgongiori
Narbolia
Neoneli
Norbello
Nughedu Santa Vittoria
Nurachi
Nureci
Ollastra Simaxis
Oristano
Palmas Arborea
Pau
Pauli latino
Pompu
Riola Sardo
Ruinas
Sagama (NU)
Samugheo
San Nicolo d'Arcidano
San Vero Milis
Sant'Antonio Ruinas
Santa Giusta
Santulussurgiu
Scano di Montiferro
Sedilo
Seneghe
Senis
Sennariolo
Siamaggiore
Siamanna
Siapiccia
Simala
Simaxis
Sini
Siris
Soddi
Solamssa
Sorradile
Suni (NU)
Tadasuni
Terralba
Tinnura (NU)
Tramatza
Tresnuraghes
Ula Tirso
Uras
Usellus
Villa Verde
Villanova Truschedu
Villaurbana
Zeddiani
Zerfaliu
SASSARI (SS)
Alghero
Anela
Ardara
Banari
Benetutti
Bessude
Bonnannaro
Bono
Bonorva
Borutta
Bottidda
Bultei
Bulzi
Burgos
Cargeghe
Castelsardo
Cheremule
Chiaramonti
Codrongianos
Cossoine
Erula
Esporlatu
Florinas
Giave
Illorai
Ittireddu
Ittiri
Laerru
Mara
Martis
Monteleone Rocca Doria
Mores
Muros
Nughedu Di San Nicolo
Nule
Nulvi
Olmedo
Osilo
Ossi
Ozieri
Padria
Pattada
Perfugas
Ploaghe
Porto Torres
Pozzomaggiore
Putifigari
Romana
Santa Maria Coghinas
Sassari
Sedini
Semestene
Sennori
Siligo
Sorso
Stintino
Tergu
Thiesi
Tissi
Torralba
Tula
Uri
Usini
Valledoria
Viddalba
Villanova Monteleone
Biodiversity Journal, 2013, 4 (1): 105-110
Diversity and distribution of seaweeds in the Muttom coastal
waters, south-west coast of India
Cosman Domettila',Thankappan Sarasabai Shynin Brintha 1 , Selvamony Sukumaran 2 & Solomon Jeeva
i*
'Department of Botany, Scott Christian College (Autonomous), Nagercoil - 629 003, Kanyakumari, Tamilnadu, India; e-mail:
[email protected]
department of Botany, Nesamony Memorial Christian College, Marthandam - 629 165, Tamilnadu, India
* Corresponding author
ABSTRACT Seaweeds are found in the coastal region between high and low tide, and in the sub-tidal
region up to a depth where 0.01% photosynthetic light is available. Plant pigments, light,
exposure, depth, temperature, tides and the characteristics of the shore combine to create
different environments that determine the distribution and variety of seaweeds. The present
study was conducted at Muttom, formed of different inter-tidal rock shores with rich algal
vegetation. During the study period (January to December 20 1 1 ), a total of 3 8 species of sea-
weeds were recorded. Among them, Ulva fasciata and U. lactuca (green algae); Sargassum
wightii, S. duplicata and Padina tetrastomatica (brown algae); Gracilaria corticata and G.
pygmaea (red algae), were present throughout the study period.
KEY WORDS Diversity; Muttom; Seaweeds; South West Coast of India.
Received 13.08.2012; accepted 09.12.2012; printed 30.03.2013
INTRODUCTION
In the vast ocean realm, several forms of life,
starting from unicellular to multi-cellular flourish,
multiply and disintegrate. It is believed that the first
living cell that appeared on the planet Earth emer-
ged from the ocean. In all its forms, Life has deve-
loped from the growth of mono-cellular algae
(Dhargalkar & Pereira, 2005). It was estimated that
about 90% of the species of marine plants are algae
and about 40% of the global photosynthesis is con-
tributed from algae (Andersen, 1992).
Seaweeds, known as macroalgae, are among the
most important primary producers and act as ecolo-
gical engineers on rocky coasts of the world's oceans.
They are primary producers, shelter, nursery
grounds and food sources for marine organisms.
Seaweeds are not only of high ecological, but also
of great economic importance. Dried thalli are di-
rectly used as human and animal food and also as
fertilizer. Extracted seaweed substances are used as
stabilizers and stiffeners in food industry, cosme-
tics, pharmaceutical industry, and biotechnology
(Jeeva & Kimba, 2009; Wiencke & Bischof, 2012).
Recent research has pointed to new opportunities,
particularly in the field of medicine, associated with
bioactive molecules extracted from seaweeds (Baby
et al., 2012; Jeeva et al., 2012). Moreover, due to
their habitats and biology, seaweeds are relatively
easy to observe, manipulate and measure. There-
fore, they have been widely used as model orga-
nisms for studying biogeographic patterns and
testing various ecological theories, both in intertidal
and subtidal habitats (Murray & Littler, 1984; Bol-
ton et al., 2004; Prathep, 2005).
India has a vast coastline of more than 7000 km,
which harbours a large diversity of marine algal
species (Sahoo et al., 2003). The seaweed flora of
106
C. Domettila,T.S. Shynin Brintha, S. Sukumaran & S.Jeeva
Figures 1-6. Seaweeds from Muttom coastal waters of southwest coast of India. Fig. 1 : Caulerpa racemosa. Fig. 2: Gracilaria
fergusonii. Fig. 3: Gracilaria pygmaea. Fig. 4: Hypnea musciformis. Fig. 5: Padina pavonica. Fig. 6: Sargassum duplication.
Diversity and distribution of seaweeds in the Muttom coastal waters, south-west coast of India
107
INDIA
INDIA ^
Tamil Nadu
Muttom coast
Indian Ocean
Figure 7. Map showing the study site: Muttom coastal waters, south-west coast of India.
India is highly diversified and comprises mostly of
tropical species, but boreal, temperate and subtro-
pical elements have also been reported. 1153 taxa
of marine algae, including forms and varieties be-
longing to 27 1 genera have been enumerated till
date from the Indian waters. Many of the rocky
beaches, mudflats, estuaries, coral reefs and lagoons
along the Indian coast provide ideal habitats for the
growth of seaweeds (Rao & Mantri, 2006); rich sea-
weed beds occur around Visakhapatnam in the ea-
stern coast, Mahabalipuram, Gulf of Mannar,
Timchendur, Tuticorin, Kanyakumari and Kerala in
the southern coast; Veraval and Gulf of Kutch in
the western coast; Andaman and Nicobar Islands
and Lakshadweep (Kaliaperumal & Pandian, 1984;
Selvaraj & Selvaraj, 1997; Sahoo, 2001; James et
al., 2004; Manilal et al., 2009; Christobel & Jeeva,
2009; Paul & Raja, 2011; Jeeva et al., 2012; Satheesh
& Wesley, 2012).
Southwest coast of India is a unique marine
habitat infested with diverse seaweeds. In recent
years, only a few investigations have been carried
out on various applications and uses of macroalgae
in Kanyakumari district (Bai et al., 2007; Christo-
bel, 2008; Christobel et al., 2011; Jeeva et al.,
2012). However, more studies on various aspects of
macroalgae are still needed, especially, on diversity
and species ric hn ess. Such information could pro-
vide a baseline for future more complex ecological
studies and coastal management, as well as applied
aspects of the uses of seaweed. Therefore, the pre-
sent study was initiated to explore the richness of
seaweeds in Muttom coastal waters of southwest
coast of India.
MATERIALS AND METHODS
The present study was carried out at Muttom
coast in southwest coast of India (Fig. 7), in the Ara-
bian Sea. Muttom sports a beautiful and tidy beach
with rocky shores showing an astonishing biodiver-
sity. Huge rocks standing at either sides of the beach
give it a pristine look. Since the shore is usually no
108
C. Domettila,T.S. Shynin Brintha, S. Sukumaran & S.Jeeva
No
BOTANICAL NAME
PHYLUM
CLASS
FAMILY
1
Amphiroa anceps (Lamarck) Decaisne
Rhodophyta
Florideophyceae
Corallinaceae
2
Asparagopsis taxiformis (Delile) Trevisan de Saint-Leon
Rhodophyta
Florideophyceae
B onnemai soniac e a e
3
Caulerpa peltata J.V.Lamouroux
Chlorophyta
Bryopsidophyceae
Caulerpaceae
4
Caulerpa racemosa (Forsskal) C. Agardh (Fig. 1)
Chlorophyta
Bryopsidophyceae
Caulerpaceae
5
Caulerpa scalpelliformis (R. Brown ex Turner) C.Agardh
Chlorophyta
Bryopsidophyceae
Caulerpaceae
6
Centroceras clavulatum ( C. Agardh) Montagne
Rhodophyta
Florideophyceae
Ceramiaceae
7
Ceratodictyon variablile (C. Agardh) R. E. Norris
Rhodophyta
Florideophyceae
Lomentariaceae
8
Chaetomorpha antennina (Bory de Saint- Vincent) Kutzing
Chlorophyta
Ulvophyceae
Cladophoraceae
9
Chnoospora implexa C. Agardh
Ochrophyta
Phaeophyceae
S cyto siphonaceae
10
Chondrophycus ceylanicus (C. Agardh) M.J.Wynne,
Serio, Cormaci et G. Fumari
Rhodophyta
Florideophyceae
Rhodomelaceae
11
Dictyota bartayresiana J. V. Lamouroux
Ochrophyta
Phaeophyceae
Dictyotaceae
12
Dictyota ciliata C. Agardh
Ochrophyta
Phaeophyceae
Dictyotaceae
13
Dictyota dichotoma (Hudson) J. V. Lamouroux
Ochrophyta
Phaeophyceae
Dictyotaceae
14
Enantiocladia prolifer a Falkenberg
Rhodophyta
Florideophyceae
Rhodomelaceae
15
Gelidiella indica Sreenivasa Rao
Rhodophyta
Florideophyceae
Gelidiellaceae
16
Gelidium pusillum (Stackhouse) Le Jolis
Rhodophyta
Florideophyceae
Gelidiaceae
17
Gracilaria corticata (C. Agardh) C. Agardh
Rhodophyta
Florideophyceae
Gracilariaceae
18
Gracilaria fergusonii C. Agardh (Fig. 2)
Rhodophyta
Florideophyceae
Gracilariaceae
19
Gracilaria foliifera (Forsskal) Borgesen
Rhodophyta
Florideophyceae
Gracilariaceae
20
Gracilaria pygmaea Borgesen (Fig. 3)
Rhodophyta
Florideophyceae
Gracilariaceae
21
Grateloupia lithophila Borgesen
Rhodophyta
Florideophyceae
Halymeniaceae
22
Hypnea musciformis (Wulfen) J. V. Lamouroux (Fig. 4)
Rhodophyta
Florideophyceae
Cystocloniaceae
23
Hypnea valentiae (Turner) Montagne
Rhodophyta
Florideophyceae
Cystocloniaceae
24
Laurencia poitei (J. V. Lamouroux) M. A. Howe
Rhodophyta
Florideophyceae
Rhodomelaceae
25
Neurymenia fraxinifolia (Mertens ex Turner) C. Agardh
Rhodophyta
Florideophyceae
Rhodomelaceae
26
Padiiia pavonica (Linnaeus) Thivv (Fig. 5)
Ochrophyta
Phaeophyceae
Dictyotaceae
27
Padina tetrastomatica Hauck
Ochrophyta
Phaeophyceae
Dictyotaceae
28
Palisada flagellifera (C. Agardh) K.W.Nam
Rhodophyta
Florideophyceae
Rhodomelaceae
29
Portieria hornemannii (Lyngbye) R C. Silva
Rhodophyta
Florideophyceae
Rhizophyllidaceae
30
Sargassum duplication (C. Agardh) C. Agardh (Fig. 6)
Ochrophyta
Phaeophyceae
Sargassaceae
31
Sargassum linearifolium (Turner) C. Agardh
Ochrophyta
Phaeophyceae
Sargassaceae
32
Sargassum poly cy stum C. Agardh
Ochrophyta
Phaeophyceae
Sargassaceae
33
Sargassum swartzii C. Agardh
Ochrophyta
Phaeophyceae
Sargassaceae
34
Sargassum wightii Greville ex C. Agardh
Ochrophyta
Phaeophyceae
Sargassaceae
35
Trichosolen mucronatus (Borgesen) W. R. Taylor
Chlorophyta
Bryopsidophyceae
Bryopsidaceae
36
Ulva fasciata S. G. Gray
Chlorophyta
Ulvophyceae
Ulvaceae
37
Ulva lactuca Linnaeus
Chlorophyta
Ulvophyceae
Ulvaceae
38
Ulva reticulata Forsskal
Chlorophyta
Ulvophyceae
Ulvaceae
Table 1 . List of species found in the study area with their scientific names, class and family.
Diversity and distribution of seaweeds in the Muttom coastal waters, south-west coast of India
109
■ Bryopsidophyceae
■ Florideophyceae
■ Phaeophyceae
■ Ulvophyceae
Of the 38 species, 19 were from the class of Flo-
rideophyceae (50%), 11 species from Phaeophyceae
(28.9%), while the remaining eight species from
Bryopsidophyceae and Ulvophyceae (10% and
11% each) (Fig. 8). Finally, the seaweeds observed
in the present study are similar to those reported
from the nearby Kudankulam coast (Satheesh &
Wesley, 2012); and the very high richness of sea-
weeds species in Muttom coastal waters may be due
to the presence of intertidal rocky reefs.
Figure 8. Class-wise distribution percentage of species ri-
chness in the study area.
crowded, it is an excellent spot for tourists to enjoy
its beauty.
Field surveys were undertaken in the selected
sampling stations of the Muttom coast over a period
of twelve months from January to December 2011.
The algal samples were collected in every season
during the study period by detaching a portion
from the seaweed bed, keeping it in polythene bags
with fresh seawater, transporting to the laboratory
and fixing in 4% formaldeyde for further studies.
The seaweeds were identified using the taxonomic
keys provided by Srinivasan (1969; 1973), and the
nomenclature was updated using Appeltans et al.
(2012) and Guiry & Guiry (2012).
RESULTS AND DISCUSSION
Taxonomically, a total of 38 taxa belonging to
3 phyla (Chlorophyta, Ochrophyta and Rhodo-
phyta), 4 classes (Bryopsidaceae, Florideophy-
ceae, Phaeophyceae and Ulvophyceae), 23 genera
and 1 8 families were inventoried in the Muttom
coastal waters (Table 1). Among the 18 families,
Dictyotaceae, Rhodomelaceae and Sargassaceae
were the most richest ones (5 species each), fol-
lowed by Gracilariaceae (4 species), Caulerpaceae
and Ulvaceae (3 species each) and Cystoclonia-
ceae (2 species), whereas the remaining families
(Bonnemaisoniaceae, Bryopsidaceae, Ceramia-
ceae, Cladophoraceae, Corallinaceae, Gelidiaceae,
Gelidiellaceae, Halymeniaceae, Lomentariaceae,
Rhozophyllidaceae and Scytosiphonaceae) were
monospecific.
ACKNOWLEDGEMENTS
The authors are thankful to Dr. P. Charles, Head,
Department of Botany, Scott Christian College (Au-
tonomous), Nagercoil for providing necessary faci-
lities and encouragement.
REFERENCES
Andersen R. A., 1992. Diversity of eukaryotic algae. Bio-
diversity and Conservation, 1: 267-292.
Appeltans W., Bouchet P., Boxshall, G.A., De Broyer, C.,
de Voogd, N.J., Gordon, D.P., Hoeksema, B. W., Hor-
ton, T., Kennedy, M., Mees, J., Poore, G.C.B., Read,
G., Stohr, S., Walter, T.C. & Costello, M.J. (Eds.),
2012. World Register of Marine Species.
http://www.marinespecies.org.
Baby V.A., Appavoo M.R. & Huxley V.A.J., 2012. Anti-
bacterial effects of Ulva faciata extracts on nosoco-
mial pathogen Pseudomonas aeruginosa. Journal of
Basic and Applied Biology, 5: 204-208.
Bai N.R., Banu N.L., Prakash J.W. & Goldi S.J., 2007.
Effects of Asparagopsis taxiformis extract on the
Growth and Yield of Phaseolus aureus. Journal of
Basic and Applied Biology, 1: 6-11.
Bolton J.J., Leliaert F., De Clerk O., Anderson R.J., Ste-
genga H., Engledow H.E. & Coppejans, E., 2004.
Where is the western limit of the tropical Indian
Ocean seaweed flora? An analysis of intertidal sea-
weed biogeography on the east coast of South Africa.
Marine Biology, 144: 51-59.
Christobel G.J., 2008. Effect of seaweed ( Sargassum wi-
ghtii L.) on the germination and growth of green
gram {Phaseolus aureus L.). Journal of Basic and
Applied Biology, 2: 105-108.
Christobel G.J. & Jeeva S., 2009. The diversity and di-
stribution of the seaweeds of Manavalakurichi, south
west coast of India. In: Abstracts of the National Se-
minar on Marine Resources: Sustainable Utilization
and Conservation, Organized by Department of Plant
110
C. Domettila,T.S. Shynin Brintha, S. Sukumaran & S.Jeeva
Biology and Biotechnology, St. Mary’s College,
Thoothukudi, p. 37.
Christobel G.J., Lipton A.P., Aishwarya M.S., Sarika
A.R. & Udayakumar A., 2011. Antibacterial activity
of aqueous extract from selected macroalgae of sou-
thwest coast of India. Seaweed Research and Utili-
zation, 33: 67-75.
Dhargalkar V.K. & Pereira N., 2005. Seaweeds: promi-
sing plants of the millennium. Science and Culture,
71: 60-66.
Guiry M.D. & Guiry G.M., 2012. Algaebase. World-wide
electronic publication, National University of Ireland,
Galway, http://algaebase.org
James J.E., Kumar R.A.S. & Raj A.D.S., 2004. Marine
algal flora from some localities of south east coast of
Tamilnadu. Seaweed Research and Utilization, 26:
33-39.
Jeeva S. & Kiruba S., 2009. Bioremediating and biome-
diating potential of seaweeds. In: Abstracts of the Na-
tional Seminar on Marine Resources: Sustainable
Utilization and Conservation, Organized by Depar-
tment of Plant Biology and Biotechnology, St. Mary’s
College, Thoothukudi, p. 38.
Jeeva S., Johnson M., Domettila C., Babu A. & Mahesh
M., 2012. Preliminary phytochemical studies on
some selected seaweeds from Gulf of Mannar, India.
Asian Pacific Journal of Tropical Biomedicine, 2
(SI): S30-S33.
Kaliaperumal N. & Pandian G., 1984. Marine algal flora
from some localities of south Tamilnadu coast. Jour-
nal of the Marine Biological Association of India, 26:
159-164.
Manilal A., Sujith S., Kiran G.S., Selvin J., Shakir C.,
Gandhimathi R. & Panikkar M.V.N., 2009. Biopoten-
tials of seaweeds collected from southwest coast of
India. Journal of Marine Science and Technology, 17:
67-73.
Murray S.N. & Littler M.M., 1984. Analysis of seaweed
communities in a disturbed rocky intertidal environ-
ment near Whites Point, Los Angeles, Calif., U.S.A.
Hydrobiologia, 116/117: 374-382.
Paul J.J.P. & Raja D.P, 2011. Studies on the distribution
of seaweed resources in Kanyakumari region, the
south east coast of Tamilnadu. Journal of Basic and
Applied Biology, 5: 246-251.
Prathep A., 2005. Spatial and temporal variations in di-
versity and percentage cover of macroalgae at Siri-
nart marine national park, Phuket provine, Thailand.
Science Asia, 31: 225-233.
Rao P.V.S. & Mantri V.A., 2006. Indian seaweed resour-
ces and sustainable utilization: scenario at the dawn
of a new century. Current Science, 91: 161-174.
Sahoo D., 2001. Seaweeds of Indian coast. A.P.H. Publi-
shing Corporation, New Delhi, 283 pp.
Sahoo D., Sahu N. & Sahoo D., 2003. A critical survey
of seaweed diversity of Chilika lake, India. Algae, 18:
1 - 12 .
Satheesh S. & Wesley S.G., 2012. Diversity and distri-
bution of seaweeds in the Kudankulam coastal wa-
ters, south-eastern coast of India. Biodiversity
Journal, 3: 79-84.
Selvaraj R. & Selvaraj R., 1997. Distribution and diver-
sity of seaweeds in Tiruchendur and Idianthakarai.
Seaweed Research and Utilization, 19: 115-123.
Srinivasan K.S., 1969. Phycologia Indica, Vol. I. Bota-
nical Survey of India, Culcutta, 52 pp.
Srinivasan K.S., 1973. Phycologia Indica, Vol. II. Bota-
nical Survey of India, Culcutta, 60 pp.
Wiencke C. & Bischof K. (Eds.), 2012. Seaweed Bio-
logy. Springer- Verlag, Berlin, Heidelberg.
Biodiversity Journal, 2013, 4 (1): 111-116
Assessment of existing mangrove plantation along Kuwait
coastline
Laila Almulla*, Narayana Bhat, Binson Thomas, Lekha Rajesh, Sasni AN & Preetha George
Aridland Agriculture and Greenery Department, Kuwait Institute for Scientific Research, Kuwait
■"Corresponding author: [email protected]
ABSTRACT A survey was conducted to study the quantitative and qualitative assessment of the existing
mangrove plantations of Kuwait and their chances of settlement and development in this
area. The study suggests that the Kuwait coastline has many good potential sites for man-
groves, however the fast developmental activities and human interference pose a threat to
their existence. These sites should be properly protected and designed to better assess the
growth and development of mangrove plantations.
KEY WORDS Avicennia marina', anaerobic condition; marine ecosystems; marine fauna; pneumatophores.
Received 22.8.2012; accepted 2.12.2012; printed 30.03.2013
INTRODUCTION
Avicennia marina (Forsk.) Vierh are salt-tolerant
halophytic mangrove trees that grow in intertidal
zones and form habitats for many marine species.
Mangrove communities have always been regarded
as an important component of renewable natural re-
sources in coastal regions. As coastal and marine
resources are of significant importance to Kuwait,
any improvement in the coastal vegetation would
significantly enhance the ecological and economic
sustainability of such resources.
The fact that mangroves previously existed in
Kuwait, and the fact that the prevailing climatic and
soil conditions in the northern part of Kuwait are
comparable with those of mangrove-growing areas
in Bahrain and Saudi Arabia (Subandar et al., 2001),
support the expectation that Kuwait could establish
mangrove plantations to rehabilitate its coastal envi-
ronment. Previous research efforts at the Kuwait In-
stitute for Scientific Research (KISR) clearly
established technical and environmental feasibility
of growing mangroves successfully in Kuwait (Abu
El-Nil, 1994; Abu El-Nil et al., 2001; Bhat et al.,
2002, 2003, 2004, 2007).
It has been reported that extensive intertidal
planting of mangroves could produce fertile nursery
grounds, and increase yields of fish species and ma-
rine fauna (Bhat et al., 2007; Al-Nafisi et al., 2009).
The Kuwait bay experienced a massive fish kill du-
ring August and September 2001, due to bacteria
Streptococcus agalactiae (Gilbert et al., 2002), re-
sulted in poor water quality and hypoxic condition
due to high rate of fish decomposition affecting the
mangrove plantations in the coastal area.
Mangrove plantations along coastal areas are
beneficial to scale down the impact of the natural
disasters like tsunamis, storm and erosion. The root
systems of mangroves slow down wave energy of
tidal water and the sediments carried by the tides
are deposited here enriching environment for ma-
rine species. Hence, mangrove communities play a
great role in maintaining biodiversity. They consti-
tute an important component of the renewable na-
tural vegetative resources of the coastal zones in
many tropical and subtropical parts of the world.
112
L.Almulla, N.R. Bhat, B.M. Thomas, L. Rajesh, S.Ali & P. George
Figure 1. Young healthy mangrove plant. Figure 2. Full-grown mangrove plant flowering profusely. Figure 3. Progressive
drying in an established mangrove plantation. Figure 4. Measuring the height and canopy spread of an existing mangrove
plant. Figure 5. Counting the leaves of an existing mangrove plant. Figure 6. Established mangrove plantation with profuse
pneumatophores.
Assessment of existing mangrove plantation along Kuwait coastline
113
Figure 7. Close up view of healthy pneumatophores.
They are the most prominent salt-tolerant fo-
rest trees of intertidal regions; they grow in saline,
anoxic soils under conditions characterized by a
combination of high temperature and irradiance
(Stewart & Popp, 1987; Medina, 1999). The man-
groves have become the center of discussions in
many coastal, environmental and pollution issues.
As part of a greenery program, mangrove planta-
tions being highly salt-tolerant, offer best chance
for enhancing greenery along Kuwait’s coastline
depending on the natural high-low tide of seawater
(Bhat et al., 2002).
KISR has been involved in research on man-
groves since 1992. Over the past several years,
KISR has perfected techniques of mass propaga-
tion, hardening and growing mangrove plants
(Avicennia marina ) under Kuwait's environmental
conditions. It has successfully established expe-
rimental plantations along Kuwait's coastline, and
demonstrated the positive impacts of mangrove
plantations in coastal and marine ecosystems
(Bhat et al., 2002, 2007; Bhat & Suleiman, 2004;
Al-Nafisi et al., 2009).
The study as a part of the Biodiversity of Ter-
restrial Ecosystems Program, was implemented
by the Aridland Agriculture and Greenery Depar-
tment (AAD) of Kuwait Institute for scientific re-
search (KISR) to evaluate the status of existing
mangrove plantations at different locations along
the coastal bay.
MATERIALS AND METHODS
A survey was conducted by the project team
along the coastline of Kuwait in November 2011,
to locate and enumerate the existing mangrove
plantations. Seven mangrove plantations were iden-
tified during that survey and the field evaluation of
the existing mangrove plantations along Kuwait
Bay was assessed (Fig.l). The main objective was
to study the growth of the nearly 15-y-old man-
grove plants amidst the man-made adversities and
vagaries of nature present in Kuwait.
Those seven plantations were identified, and
then assessed qualitatively and quantitatively to
evaluate their physical and physiological status
(Fig. 2). Each plantation was provided with an iden-
tification code, and the GPS coordinates were re-
corded for future reference. Each mangrove
plantation was subdivided into smaller groups to fa-
cilitate access and to ensure accurate observations.
Each plantation was assessed visually for the pa-
rameters like plant mortality, dieback, leaf scorching,
branching, pneumatophores presence, establi-
shment, and rated on a scale from zero to five.
The total score was computed to assess the overall
performance of the plantation. Quantitative evalua-
tion included number of trees, average number of
leaves of apical shoot one-foot length, maximum
plant height, plantation height, canopy spread and
number of pneumatophores per square foot (Figs.
3-7).
RESULTS AND DISCUSSION
Mangrove plantations were found to thrive best
in fine-textured soils composed of muddy clay
loam. To a great extent, the height and frequency
of tides determine the texture and composition of
soils in coastal sites. Only those sites where tides
regularly cover the entire area were found ideal for
mangrove plantation. Mangrove plantations cannot
be established in every available site or vacant mud-
flat, as site and environmental conditions largely
determine the successful establishment, producti-
vity and sustainability of mangrove ecosystems.
The quantitative observations recorded to assess
the existing mangrove plantations are presented in
114
L.Almulla, N.R. Bhat, B.M. Thomas, L. Rajesh, S.Ali & P. George
Site
Code
GPS Coordinates
No. of
Tree
Group
No.
of
Trees
Average
No.of
Leaves/
Shoot
MP-1
29° 20’ 11.6" N
47°54' 17.0” E
8
96
80.0
MP-2
29° 20' 00.2" N
47°54' 09.1" E
5
21
61.0
MP-3
29° 20’ 03.1" N
47 °54' 07.0" E
14
29
50.0
MP-4
29° 19' 02.0" N
47° 51’ 40.7" E
7
100
39.9
MP-5
29° 19' 02.1 "N
47° 51' 03.0" E
1
4
48.0
MP-6
29° 19’ 09.9" N
47° 50’ 14.0" E
2
225
39.5
MP-7
29° 35' 58.3" N
48° 09' 21.9" E
1
13
32.0
Table 1. Quantitative assessment of mangrove {Avicennia
marina ) plantations in Kuwait- January 2012.
Site
Code
Max.
Plant
Height
(m)
Average
Plantation
Height
(m)
Canopy
Spread
(m 2 )
Pneu-
mato-
phore
(No./ Ft 2 )
MP-1
3.8
1.88
600.0
30.0
MP-2
7.4
3.50
489.0
30.4
MP-3
4.5
2.35
647.0
16.4
MP-4
4.0
1.80
571.2
15.1
MP-5
4.0
2.00
68.8
52.0
MP-6
4.0
2.50
577.8
63.5
MP-7
3.5
1.70
90.0
32.0
Physiological Expression
Site code
Mortality
Dieback
Leaf
Scorching
Branches
MP-1
High
High
Moderate
High
MP-2
Moderate
Moderate
Low
Moderate
MP-3
Nil
Moderate
Moderate
Moderate
MP-4
Low
Low
Low
Moderate
MP-5
Low
Moderate
Moderate
Moderate
MP-6
High
High
High
Moderate
MP-7
High
High
Moderate
Moderate
Table 3. Qualitative assessment of physiological expression
of existing mangrove plantations in Kuwait- January 2012.
Pneumatophores
Site code
Establis-
hment
Presence
Health
Total
Score
(Max 50)
MP-1
Excellent
Moderate
Good
34
MP-2
Very Good
Moderate
Fair
33
MP-3
Good
High
Good
37
MP-4
Excellent
Moderate
Fair
37
MP-5
Poor
High
Fair
29
MP-6
Good
Profuse
Very Good
31
MP-7
Fair
Moderate
Good
26
Table 2. Vegetative assessment of mangrove ( Avicennia
marina ) plantations in Kuwait- January 2012.
Table 4. Qualitative assessment of existing mangrove
plantations in Kuwait- January 2012.
Assessment of existing mangrove plantation along Kuwait coastline
115
tables 1 and 2, respectively. Based on the quantita-
tive data on Tables 3 and 4 among the seven plan-
tations identified, two plantations had above
average establishment, scoring 37 points out of 50;
whereas three plantations had average performance
and establishment despite no active management
or protection. Two plantations exhibited below
average establishment, scoring below 30.
The study revealed that few sites along Kuwait
Bay appear to have excellent establishment of man-
grove plantation. These areas were found to have
periodical flushing of tidal water and not contami-
nated by any human activities. The major reasons
for poor performance of established mangrove plan-
tations were due to lack of proper management and
the lack of favourable atmosphere for the healthy
growth of pneumatophores. Fast developemental
activities along the coastal area pose severe threat
to mangrove plantations in the existing areas. The
textural composition, salinity of the surface layer and
occurrence of anaerobic condition play a major role
in the establishment and growth of mangrove see-
dlings (Bhat & Suleiman, 2004). Many researchers
have reported that rapid and poorly planned coa-
stal development programs have contributed to
the destruction of suitable habitats for mangrove
and its disappearance from Kuwait (Abu El-Nil et
al., 2001). Salinity has been recognized as a critical
factor in regulating survival growth, regeneration
and zonation in mangrove species (Semeniuk,
1983).
The satisfactory establishment in most of the
existing mangrove plantations, despite the harsh cli-
matic conditions supports the idea for further large-
scale establishment of mangrove plantations in
Kuwait. This finding needs to be confirmed through
evaluation of the physical and chemical properties
of the soils. Providing good habitat and proper ma-
nagement can provide good mangrove plantations
along Kuwait coastline.
ACKNOWLEDGEMENTS
The authors would like to thank the Kuwait In-
stitute for Scientific Research (KISR) for con-
tinued interest in and encouragement of the scien-
tific research.
REFERENCES
Abu El-Nil M., 1994. Mangrove introduction along Ku-
waits’s seashore. Proceedings of the Workshop on the
Use of Sea Water in Irrigation. Kuwait Institute for
Scientific Research, Kuwait, pp. 68-101.
Abu El-Nil M., Al-Sabah L., Al-Menaie H., Hussain J.,
Al-Melhem S., Al-Mattar S. & Al-Ajeel A., 2001. In-
troduction of mangroves to the coastline of Kuwait.
In: Bhat N.R., Taha F.K. & Nasser A. Y. (Eds.). Man-
grove Ecosystems: Natural Distribution, Biology and
Management. Kuwait Institute for Scientific Rese-
arch, pp. 181-194.
Al-Nafisi R. S., Al-Gharib A., Gharib I. & Bhat N.R.,
2009. Positive impacts of mangrove plantations on
Kuwait's coastal environment. European Journal of
Scientific Research, 26: 510-521.
Bhat N.R. & Suleiman M.K., 2004. Classification of soils
supporting mangrove plantation in Kuwait. Archives
of Agronomy and Soil Science, 50: 535-551.
Bhat N.R., Al-Menaie H. & Shahid S.A., 2002. Esta-
blishment of mangrove plantations for protection
and enrichment of Kuwait coastlines. Proceedings
of the International Symposium on Mangroves and
Salt Marsh Ecosystems. Environmental Research
and Wildlife Development Agency, Abu Dhabi,
UAE.
BhatN.R., Al-Nasser A., Suleiman M.K. &Al-MullaL.,
2003. Growing Mangroves for Enrichment of Kuwai-
t's Coastline: Guidelines and Recommendations. Ku-
wait: Kuwait Institute for Scientific Research,
Kuwait, 25 pp.
Bhat N.R., Al-Nasser A., Suleiman M.K. & Al-Mulla
L. , 2007. Growing Mangroves for Enrichment of
Kuwait's Coastline: Guidelines and Recommenda-
tions. 2nd ed. Kuwait: Kuwait Institute for Scientific
Research.
Bhat N.R., Al-Ali E. H., Suleiman M.K., Al-Menaie H.,
Al-Mulla L., Christopher A. & Ferrin J., 2004. Use
of hydrophilic polymers and mulches for water con-
servation in greenery projects in Kuwait. Kuwait In-
stitute for Scientific Research, Report No. KISR
7287, Kuwait.
Gilbert P.M., Landsberg J.H., Evans. J.J., Al-Sarawi
M. A., Faraj M., Al-Jarallah M.A., Haywood A.,
Ibrahem S., Klesius P., Powell C. & Shoemaker C.,
2002. A fish kill of massive proportion in Kuwait
Bay, Arabian Gulf, 2001: the roles of bacterial di-
sease, harmful algae, and eutrophication. Harmful
Algae 1: 215-231.
Medina E., 1999. Mangrove physiology: the challenge
of salt, heat, and light stress under recurrent flooding.
In: Yanez-Arancibia A. & Lara-Dominguez A. L.
(Eds.). Ecosistemas de Manglar en America Tropical.
116
L.Almulla, N.R. Bhat, B.M. Thomas, L. Rajesh, S.Ali & P. George
Instituto de Ecologia. A.C. UICN/ORMA, Costa
Rica, NOAA/NMFS Silver Spring MD USA, pp.
109-126.
Semeniuk V., 1983. Mangrove distribution in Northwe-
stern Australia in relationship to regional and local
freshwater seepages. Vegetatio, 53: 11-31.
Stewart G.R. & Popp M., 1987. The ecophysiology of
mangroves. In: R.M. Crawford (Ed.). Plant life in
aquatic and amphibious habitats. Academic Press,
London, 333-345 pp.
Subandar A., Alhazeem S. & Alsaffar A.H., 2001. Man-
grove planting scheme in Kuwait: An evaluation and
advantages. In: Bhat N.R., Taha F.K. & Nasser A. Y.
(Eds.). Mangrove Ecosystems: Natural Distribution,
Biology and Management. Kuwait Institute for
Scientific Research, pp. 219-234.
Biodiversity Journal, 2013, 4 (1): 117-124
Breeding biology of Eleonora’s Falcon, Fa/co eleonorae Gene,
1 839 (Accipitriformes Falconidae), in Northeast Algeria at
Serigina Island
SalahTelailia 1 , Menouar Saheb 2 , Lamia Boutabia 1 , Mourad-Abdelkrim Bensouilah 3 & Moussa Houhamdi 4 *
1 Dcpartcmcnt d’ Agronomie, Universite d’El-Tarf, Algerie
2 Departement de Biologie, Faculte des Sciences, Universite d’Oum El-Bouaghi, Algerie
’Departement des Sciences de la mer, Faculte des Sciences, Universite d’Annaba, Algerie
4 Departement des Sciences de la Nature et de la Vie, Faculte SNV-STU, Universite 8 Mai 1945 de Guelma, Algerie; email:
[email protected]
"■Corresponding author
ABSTRACT The Eleonora’s Falcon, Falco eleonorae Gene, 1 839 (Accipitriformes Falconidae), is a long
migrant and a seabird of conservation concern. After discovering the Serigina colony in
Northeast Algeria, data on laying period, reproductive success, and nestling growth were
collected. A total of 18 nests were located and surveyed during the breeding season of 2006.
The species started to lay eggs in late July and the majority of nests contained 3 eggs. There
was no variation in the mean eggs volume and weight between different clutches. The mean
clutch size was 2.39 ± 0.78 eggs and the hatching success was 53.5%. Productivity per nest
was 0.39 ± 0.40 chick, lower than previous published works. Inclement weather and avian
predation was thought to be the main sources of chicks’ mortality. Nestling growth for both
body mass and wing span fitted a linear fashion during the first 25 days in nestling life. The
accelerated chick growth suggested food availability and high parental provisioning. Finally,
we think that Algerian’s coast could support other large colonies that should be discovered,
surveyed, and conserved.
KEY WORDS Breeding biology; breeding success; Eleonora’s Falcon; marine bird; nestling.
Received 06.09.2012; accepted 06.12.2012; printed 30.03.2013
INTRODUCTION
The global breeding population of the Eleo-
nora’s Falcon, Falco eleonorae Gene, 1839 (Acci-
pitriformes Falconidae), was recently updated by
Dimalexis et al. (2008) giving a number of more
than 13,500 pairs over the Mediterranean region,
Atlantic Morocco, and the Canary Islands. This
long migrant raptor covers a distance of more than
9,000 km from its breeding areas to its wintering
ground mainly in Madagascar by crossing the
whole African continent including the Sahara (Del-
gado & Quilis, 1990; Gschweng et al., 2008;
Fopez-Fopez et al., 2009; Fopez-Fopez et al.,
2010). Although the main global breeding popula-
tion occurs in Greece (Dimalexis et al., 2008), sub-
stantial and probably underestimated proportion
also nests in North Africa.
In Tunisia, most breeding pairs reproduce in the
Galite Archipelago, North of the country off coast
(Hamrouni, 2007). Breeding records in Algerian co-
lonies have been started in the mid twentieth cen-
tury (Faferrere & Mayaud, 1960), followed by
subsequent counts made mainly in islands near
Skikda (East coast) and the Habibas Islands (West
coast) but the numbers recorded have never excee-
118
S.Telailia, M. Saheb, L. Boutabia, M.-A. Bensouilah & M. Houhamdi
Figure 1. Map presenting the study site: Serigina island, Northeast Algeria.
Figures 2-4. Serigina island
Breeding biology of Eleonora’s Falcon, Falco eleonorae Gene, 1839, in Northeast Algeria at Serigina Island
119
ded 50 breeding pairs (Le Fur, 1975; Michelot &
Laurent, 1988; Michelot & Laurent, 1993; Rguibi et
al., 2012). In Morocco, the breeding range is restric-
ted to two colonies (Essaouira’s islands and Sale’s
sea cliff) situated on the Atlantic coast (Walter, 1979;
Bergier, 1987; Thevenot et al., 2003). However, se-
veral coastal islands of the three countries hosting
eventual suitable breeding habitats remain still unex-
plored. Most works have focused on the diet and mi-
gration of the species (Walter, 1979; Delgado &
Quilis, 1990; Gschweng et al., 2008; Lopez-Lopez
et al., 2009; Diaz-Portero et al., 2009). Breeding bio-
logy and ecology were also well studied in different
geographic areas within the species breeding range;
however, reproductive parameters of Algerian co-
lonies have never been investigated.
This study was conducted on an Eleonora’s Fal-
con colony in the Algerian East coast (Figs. 1-4)
and provides the first contribution on its breeding
biology in the country.
MATERIALS AND METHODS
Study area
Serigina is a 2.4 ha island situated in Northeast
Algeria (36°56’ N, 6°53’ E), 700 m from the coast
of Skikda. Sparse vegetation dominated by shrubs
Chamaerops humilis L., Opuntia ficus-indica (L.)
Mill., 1768 and grasses Malva veneta (Mill.) Sol-
dano, Banfi et Galasso, 2005, Melilotus sp., Carpo-
brotus acinaciformis (L.) L. Bolus, 1927 covers its
southern half while is absent in the north. A li-
ghthouse of 20 m height occupies the center of the
island. In addition to the Eleonora’s Falcon, Yellow-
legged Gull, Larus michahellis Naumann, 1840,
and Cory's Shearwater, Calonectris diomedea (Sco-
poli, 1769), were also nesting at the island.
Data collection and analysis
We started to visit weekly the island in early
July 2006 and checked for potential egg laying. In
the breeding season we also collected weekly data
from each Eleonora’s falcon nest encountered in the
Serigina Island. Nests were marked by fixing small
numbered flags on the ground near the nest.
After being individually marked using perma-
nent markers, eggs lengths and breadths were mea-
sured with a Vernier calliper to the nearest 0.1 mm
and their weights were measured using a Pesola
spring balance to the nearest 1 g. Chicks were also
marked by non-toxic permanent markers (Kaihon-
gyu model KH8012) using coloration codes. Nests
Figure 5. Frequency distribution of clutch sizes of the Eleonora’s Falcon in the Serigina island.
120
S.Telailia, M. Saheb, L. Boutabia, M.-A. Bensouilah & M. Houhamdi
Age
Figure 6. Growth of (a) body weight and (b) wing span of
Eleonora’s Falcon nestlings.
were checked weekly and the number of eggs was
counted and surveyed for hatching and fledging in
order to calculate the clutch size, hatching success
(the proportion of eggs that hatched to chicks) and the
number of chicks surviving to 15 days. Mortality and
losses of eggs and chicks were also recorded. From
hatching, we measured the wing span length and
weight of nestlings weekly until the age of 25 days.
At this age, chicks became usually very mobile
and aggressive which made their capture difficult.
We estimated chick age based on their appearance.
Growth curves were developed for the two morpho-
Mean ± S.D
N
Egg length (mm)
42.57 ± 1.62
43
Egg breath (mm)
33.48 ± 1.12
43
Egg volume (cm 3 )
24.38 ±2.14
43
Egg weight (g)
25.67 ±2.37
43
Table 1. Egg dimensions of Eleonora’s Falcon breeding at
Serigina island.
N
Success (%)
Eggs laid
43
/
Eggs hatched
23
53.5
Chicks that survived to
25 days
17
39.5
Table 2. Reproductive success parameters of Eleonora’s
Falcon breeding at Serigina island.
Mean
Intercept
r 2
P
N
Body
mass (g)
18.82
35.41
0.96
<0.0001
17
Wing
span len-
gth (cm)
2.80
12.00
0.94
<0.0001
17
Table 3. Growth rate of Eleonora’s Falcon in Serigina island.
metrics recorded for nestling Eleonora’s Falcon. All
growth data were modeled with the linear function
by Kuusela & Solonen (1984):
Y = at ± b
where Y is a morphometric trait (body mass or wing
span length), t the nestling’s age in days, and a and
b the linear growth parameters. The latter coeffi-
cients were calculated using least squares linear re-
gressions of body measurements.
We put values of 350 g as the adult body mass
(Newton, 2009) to determine the age when did
nestlings reach adult size. In contrast, young ne-
Breeding biology of Eleonora’s Falcon, Falco eleonorae Gene, 1839, in Northeast Algeria at Serigina Island
121
stlings do not have fully developed feathers as
adults, thus a comparison between them could be
highly biased. Statistical analyses were carried out
using SPSS (2009) with values reported as mean ±
S.D. and p < 0.05 used as significance level. When
data did not conform to a normal distribution, we
used non-parametric tests.
RESULTS
Breeding parameters
Table 1 summarizes data of eggs measurements
at the Serigina island. After the calculation of the
mean egg volume and weight for each nest containing
more than one egg, we found that there was no si-
gnificant difference between the mean eggs volume
and mean eggs weight of different clutches (Kru-
skal- Wallis: f = 1.598, df = 2, P = 0.45; ANOVA:
F = 0.882, df = 2, P = 0.417 respectively).
The laying period of Eleonora’s Falco was quite
long and it lasted 34 days from July 24 (the first
egg laid) to August 27. The mean and median egg-
laying time was August 7 and 15, respectively. Egg
hatching started on 21 st August and ended on Octo-
ber 8. Two thirds (67%) of clutches hatched in the
three first weeks of the hatching period showing a
peak on September 4. The frequency distribution of
clutch sizes is showed in Figure 5. The mean clutch
size was 2.39 ± 0.78 eggs (N = 18 nests). More
than half (53.5%) of clutches contained 3 eggs, all
clutches ranging from 1 to 3 eggs. A substantial pro-
portion of nests (38.8%) have failed to hatch a single
egg and 4 cases of nest desertion were found du-
ring the study period. Eggs hatched asynchronou-
sly within a clutch and the total hatching success
was 53.5% (Table 2). The percentage survivorship
(to 15 days) from eggs was 39.5% while percentage
survivorship from hatch was 74 % (n = 18 clutches).
The mean net productivity per nest (up to fifteen
days of age) was 0.39 ± 0.40 (n = 18 clutches).
9
Figure 7. Serigina island: a nest of Eleonora’s Falcon containing 3 eggs. Figure 8. Young chicks of Eleonora’s Falcon
(7 days). Figure 9. A feathered chick of Eleonora’s Falcon (28 days).
122
S.Telailia, M. Saheb, L. Boutabia, M.-A. Bensouilah & M. Houhamdi
Growth of nestlings
We obtained growth curves of 1 7 nestlings from
1 1 broods for the body mass and wing span length
respectively (Figs. 6 a, b). Linear growth parame-
ters of both traits are presented in Table 3.
Mean body mass of Eleonora’s Falcon nestlings
at day 0 was 22.9 ± 4.25 g (n = 8) corresponding to
6.5% of the adult mass, while mean wing span
length was 10.1 ± 0.33 cm (n = 4) which represents
8.4% of the adult wing span. Usually, chicks be-
came very mobile and hard to capture when they
reached the age of 20 days and the older nestling
captured had an age of 25 days.
Nestlings reached 50% of the adult wing span
length at the age of 1 6 days and half of adult body
mass at 4 days of age. Also, chicks have never
reached 100% of wing span length before fledging
but they exceeded 1 00% of adult mass at the age of
15 days and attained 143% at 22 days of age.
DISCUSSION
Little is known about the breeding biology and
distribution of Eleonora’s Falcon in North Africa,
and new data on egg laying phenology, growth rates
and breeding success are important to shed light on
the life-history strategies and conservation needs of
this long migrant bird. The Serigina island carried
about 20 breeding pairs which is more or less simi-
lar to others yet reported in Algeria (Laferrere &
Mayaud, 1960; Le Fur, 1975; Michelot & Laurent,
1988; Michelot & Laurent, 1993). We suppose that
this is not consistent with an actual population
growth but rather with an early underestimation of
the actual breeding population due to the lack of
monitoring scheme. This work constitutes the first
contribution on the breeding biology of the Eleono-
ra’s Falcon in Algeria (Figs. 7-9).
Eleonora’s Falcon is known to be one of the latest
breeder birds in the Mediterranean region. In late
June, Eleonora’s Falcon has started to arrive and
displayed courtship behaviors. The laying period
of the Serigina colony initiated on July 24 and
lasted until August 27. Considering previous
works on the species, our study showed a slightly
later first laying date and a quite longer laying pe-
riod as observed by Wink & Ristow (2000).
Vaughan (1961) made a synthesis on the egg-la-
ying of different colonies in the species breeding
range and concluded that the laying period begins at
July 15-20 and continues to early August. Moreover,
Badami (1998) observed a similar laying date (July
22) in South West Sardinia in the breeding seasons
of 1993 and 1994 but the laying ended in early Au-
gust. In the same way, hatching period was similar
to that observed by Badami (1998). However, we
believe that comparisons should consider population
density and island occupancy phenology when deal-
ing with laying and hatching periods.
Our data of egg dimensions were veiy similar to
those given by Wink et al. (1985). We found that
there was no significant difference in egg size be-
tween eggs of different clutches which also was the
case for the Common Kestrel, Falco tinnunculus
Linnaeus 1758, breeding in Finland (Valkama et al.,
2002). Since the colony was situated next to one of
the main flyways of passerine migration (birds that
cross the Mediterranean through Sardinia) which is
the principal prey during the species breeding sea-
son, the absence of egg size variation could be ex-
plained by food availability.
In addition, we could expect that there were
small variations in the females’ age in the study co-
lony or also that the laying period was quite short
(compared to other Falcon species) to produce a si-
gnificant effect on eggs’ dimensions. Both of these
factors are known to be correlated with egg size in
many species of birds (Shanawany, 1987; Williams,
1994; Goth & Evans, 2004).
The mean clutch size was similar to that re-
ported by Badami (1998) in South-west Sardinia,
Mayol (1977) in Balearic Islands, and Wink & Ri-
stow (2000) in South Aegean Sea. The majority of
nests contained 3 eggs as observed in Morocco
(Walter, 1979) and South-west Sardinia (Badami,
1998). We did not observe any nest containing
more than 3 eggs during this study but the species
was recorded to lay 4 or even 5 eggs per clutch in
other colonies (Vaughan, 1961; Walter, 1979; Ba-
dami, 1998). The breeding success was very low,
less than 1 chick per nest, such as has been observed
in South-west Sardinia colony during the breeding
season of 1994 (Badami, 1998). We think that mor-
tality of young resulted primarily from climatic fac-
tors (exposition to sun and heavy winds) but, most
likely, it might be due to sibling aggression and can-
nibalism of the oldest chick towards younger ones.
Breeding biology of Eleonora’s Falcon, Falco eleonorae Gene, 1839, in Northeast Algeria at Serigina Island
123
Regarding nestling growth, both body mass and
wing span showed a linear growth from hatching
to the age of 25 days. Similarly, Walter (1979)
found the same curve fashion for body mass du-
ring the same period of nestling life, but leveled
off and reached the asymptote just after. We did not
find this trend because we were only able to survey
nestlings until the age of 25 days but we may expect
the same result for the Serigina chicks. The rapid
growth in the first month of nestlings’ life probably
reflects a high performance of parental care re-
garding food provisioning. When we regularly chec-
ked the Eleonora’s Falcon nests, we noted, from dead
birds or pieces of bodies like feathers and wings near
nests, that the Robin, Erithacus rubecula (Linnaeus,
1758), was the principal prey of the species.
Serigina island represents an interesting breed-
ing site carrying a substantial number of Eleonora’s
Falcon breeding pairs and and is one of the most
important in Algeria. Improvement in monitoring
scheme is necessary to reveal the exact status of
the species and set an effective national conserva-
tion plan.
ACKNOWLEDGMENTS
We are grateful to Smain Berramdane, Riad
Nedjah, Abdelnour Bouchekeur and Ala Rehahli for
field assistance.
REFERENCES
Badami A., 1998. Breeding biology and conservation of
the Eleonora’s Falcon Falco eleonorae in south-west
Sardinia, Italy. In: Chancellor R.D., Meyburg B.-U.
& J.J. Ferrero (Eds.). Holarctic Birds of Prey. Tow-
cester: Adenex-WWGBP, pp. 149-156.
Bergier P., 1987. Fes rapaces diumes du Maroc. Statut,
repartition et ecologie. Annales du Centre d'Etude sur
les Ecosystemes de Provence (C.E.E.P.). Aix en Pro-
vence 3: 160 pp.
Delgado G. & Quilis V., 1990. New data concerning the
migration of Eleonora’s Falcon Falco eleonorae.
Ringing and Migration, 11: 111-112.
Diaz-Portero M.A., Ramos J.J., de la Rocha, J.L.P., Jodar
P.A., Alvarez B., Mancera J.A., Delgado G. & Ron-
don J.L., 2009. Observations of Eleonora’s Falcon
Falco eleonorae at Oukaimeden (High Atlas, Mo-
rocco). Go-South Bulletin, 6: 128-129.
Dimalexis A., Xirouchakis S., Portolou D., Latsoudis P.,
Karris G., Fric J., Georgiakakis P., Barboutis C.,
Bourdakis S., Ivovic M., Kominos T. & Kakalis E.,
2008. The status of Eleonora’s Falcon ( Falco eleono-
rae) in Greece. Journal of Ornithology, 149: 23-30.
Goth A. & Evans C.S., 2004. Egg size predicts motor per-
formance and postnatal weight gain of Australian
brush-turkey ( Alectura lathami ) hatchlings. Canadian
Journal of Zoology, 82: 972-979.
Gschweng M., Kalko E.K.V., Querner U., Fiedler W. &
Berthold P., 2008. All across Africa: highly individual
migration routes of Eleonora’s Falcon. Proceedings
of the Royal Society B, 275: 2887-2896.
Hamrouni H., 2007. La migration du faucon concolore
( Falco concolor) et du faucon d’Eleonore ( Falco
eleonorae) en Tunisie. Ostrich, 78: 333-335.
Kuusela S. & Solonen T., 1984. The growth of Krestrel
nestlings in southern Finland. Annales Zoologici Fen-
nici, 2 1 : 309-312.
LaFerrere M. & Mayaud N., 1960. Le faucon d’Eleo-
nore Falco eleonorae nicheur en Algerie. Alauda,
28: 68-69.
Le Fur R., 1 975. Notes sur l’avifaune Algerienne. Alauda
49 : 295-299.
Lopez-Lopez P., Liminana R., Mellone U. & Urios V.,
2010. From the Mediterranean Sea to Madagascar:
Are there ecological barriers for the long-distance mi-
grant Eleonora’s Falcon? Landscape Ecology, 25:
803-813.
Lopez-Lopez P., Limirana R. & Urios V., 2009. Autumn
migration of Eleonora’s Falcon Falco eleonorae trac-
ked bay satellite telemetry. Zoological Studies, 48:
485-491.
Mayol J., 1996. El halcon de Eleonora ( Falco eleonorae ):
situacion de la especie y de su conocimiento. In: Bio-
logia y Conservacion de las Rapaces Mediterraneas,
Proceedings of the VI Congress on biology and con-
servation of Mediterranean raptors, Palma de Mal-
lorca, 22-25 September 1994. Muntaner J and Mayol
J (Eds.). Monografia n° 4, SEO/BirdLife, Madrid, pp.
117-125.
Michelot J.L. & Laurent L., 1988. Observations estivales
d’oiseaux marins en mer Mediterraneenne occiden-
tale. L'Oiseau et la Revue Frangaise d'Ornithologie,
58: 18-27.
Michelot J.L. & Laurent L., 1993. Observations estivales
d’oiseaux marins sur les plages Algeriennes et Ma-
rocaines. Le Bievre, 31: 109-117.
Rguibi H., Qninba A. & Benjoussa A., 2012, Eleonora’s
Falcon, Falco eleonorae , Updated state of knowledge
and conservation of the nesting populations of the
Mediterranean Small Islands, 19 pp. DOI:
http://www.initiative-pim.org/sites/default/files/fi-
chier/documents/Falco%20Eleonorae Final_%20En-
glish.pdf
Ristow D. & Wink M., 1985. Breeding success and con-
servation management of Eleonora’s Falcon. ICBP
Technical Publication No. 5: 147-152.
124
S.Telailia, M. Saheb, L. Boutabia, M.-A. Bensouilah & M. Houhamdi
Shanawany M.M., 1987. Hatching weight in relation to
egg weight in domestic birds. Poultry Science, 43:
107-115.
Thevenot M., Vernon J.D.R. & Bergier P., 2003. The
birds of Morocco. British Ornithologist Union Chec-
klist Series no. 20. Tring, U.K. British Ornithologists'
Union (BOU Checklist No. 16), 295 pp.
Valkama J., Korpimaki E., Wiehn J. & Pakkanen T.,
2002. Inter-clutch egg size variation in kestrels
Falco tinnunculus : seasonal decline under fluctua-
ting food conditions. Journal of Avian Biology, 33:
426-432.
Vaughan R., 1961. Falco eleonorae. Ibis, 103:114-128.
Walter H., 1979. Eleonora's Falcon: adaptations to prey
and habitat in a social raptor. University of Chicago
Press, Chicago and London. 410 pp.
Williams T.D., 1994. Intraspecific variation in egg size
and egg composition in birds: effects on offspring fit-
ness. Biological Reviews of the Cambridge Philoso-
phical Society, 68: 35-59.
Wink M. & Ristow D., 2000. Biology and molecular ge-
netics of Eleonora’s Falcon Falco eleonorae, a colo-
nial raptor of Mediterranean islands. In: Chancellor
R.D. & Meyburg B-U (Eds.). Raptors at risk. World
Working Group on Birds of Prey. Hancock House,
Surrey, pp. 653-668.
Wink M., Ristow D. & Wink C., 1985. Biology of Eleo-
nora's Falcon (Falco eleonorae)'. 1. Variability of
clutch sizes, egg dimensions and egg coloring. Raptor
Research, 19: 8-14.
Biodiversity Journal, 2013, 4 (1): 125-128
Gavilea araucana (Phil.) M.N. Correa: first record of an orchid
for Chile on Sphagnum peatland in Magallanes
Erwin Dominguez* & Nelson Bahamonde
Institute) de Investigaciones Agropecuarias, INIA-CRI, Kampenaike, Casilla 277, Punta Arenas, Chile
* Corresponding author: [email protected]
ABSTRACT We report the first historical record of the orchid Gavilea araucana (Phil.) M.N., for a Spha-
gnum peatland in Chile, close to Torres del Paine National Park. Moreover, a brief description
of the peatland and information about associated flora are provided.
KEY WORDS Southern Patagonia; Sphagnum moss; peatland.
Received 22.09.2012; accepted 24.01.2013; printed 30.03.2013
INTRODUCTION
In Chile the Orchidaceae family comprises 52
species distributed from the Andean highlands to
the Cape Horn (Novoa et al., 2006). The Magal-
lanes region has a diversity of orchids represented
by 1 1 species. Chilean orchids occupy diverse habi-
tats, such as deciduous and evergreen forest, scrub
and also the Patagonian steppe (Dominguez,
2003; 2010; 2012), but there are no reports of it
in Sphagnum peatlands (Pisano, 1977; Moore,
1983; Pisano, 1983; Roig & Roig, 2004; Kleine-
becker et al., 2010; Iturraspe, 2010). However,
there have been at least five species reported for
North America ( Arethusa hulbosa L., Colopogon
tuberosus (L.) Britton, Pogonia ophiglossoides
(L.) Ker. Gawl., Platanthera blephariglottis
(Willd.) Lindl. and P. clavellata (Michaux) Luer.)
growing in Sphagnum peatbogs (Boland & Scott,
1992; Brown & Scott, 1997; Davis, 2011; Laro-
che, 2011). P. blephariglottis is considered a bio-
indicator of the ecological integrity of peatlands
because the abundance of this orchid is negatively
affected by anthropogenic disturbances (Laroche,
2011 ).
Sphagnum L. is a genus of between 1510 and
3500 species of mosses (Bryophyta Sphagnopsida
Sphagnaceae) commonly called peat moss. Spha-
gnum peatlands are freshwater wetlands with a par-
ticular biodiversity and play an important influence
on the subantarctic water cycle (Iturraspe, 2010), in
addition to contributing to global carbon storage
(Grootjans et al., 2010) through slow production and
accumulation of organic matter as peat. These wet-
lands are mainly distributed in the northern hemi-
sphere. While only 4% of peatlands are located in
South America, mainly in Chile and Argentina (Diaz
et al., 2008; Landiy et al., 2010), they constitute habi-
tats for rare and endemic species (Charman, 2002).
Peatlands in Southern Chile are distributed from the
Region de Los Rios to the Region de Magallanes y
Antartica Chilena, covering approximately
10,684,000 hectares (Pliscoff & Luebert, 2006) and
2.74 million hectars in Magallanes (Ruiz & Doberti,
2005), representing the largest deposit and sink of
terrestrial carbon in the Southern Hemisphere.
There are several historical studies in pristine
peatlands in Chile, but none have reported the
presence of orchids (Skottsberg, 1909; Roivainen,
1954; Pisano, 1977; Moore, 1983; Boelclce et al.,
1985). Recent studies in the regions of Los Rios and
Los Lagos, have given new contributions to the
knowledge of the region’s flora succession and hy-
drology of peatlands, but in that research the
126
Erwin Dominguez & Nelson Bahamonde
presence of orchids is not reported (San Martin et
al., 1999; Diaz et al., 2008; Teneb et al., 2008). The
same results are evident for studies in the Region
de Magallanes and the Provincia de Tierra del
Fuego Argentina (Henriquez, 2004; Roig & Roig,
2004; Roig et al., 2004; Teneb & Dollenz, 2004;
Kleinebecker, 2007; Larrain, 2011).
This paper presents the findings of an orchid po-
pulation, located in a Sphagnum peatland, and its
habitat description and distribution in order to pro-
vide information about biodiversity of these wet-
lands in Southern Chile.
Study site
The study site is located 20 km far from the Par-
que Nacional Torres del Paine (PNTP) in the muni-
cipality of Torres del Paine, provincia de Ultima
Esperanza, Region de Magallanes y Antartica Chi-
lena (51° 16' 18.69"S - 72° 51' 56.41" W). With an
area of approximately 5 hectares, it is surrounded
by four lagoons, the largest of which is the Lago
Toro (202 km 2 ) (Fig. 1). In particular, the peatland
called “the Frog” is characterized by (1) an om-
brotrophic Sphagnum peatbog; (2) a transitional
zone with Pilgerodendrum uviferum; and (3) a
minerotrophic zone in the margins, surrounded by
Patagonian Subantarctic Forest dominated by No-
thofagus betuloides (Gajardo, 1994).
MATERIALS AND METHODS
ARGENTINA
IRuerto
b Laguna Cristobal
Ilk t til t;
JL * l . ''4
Laguna el Pul le p
tevTlv "c#beraEISapo
CHILE
Figure 1 . Geographical location of the Gavilea araucana fin-
ding in a Sphagnum peatland in the Magallanes Region, Chile.
Fieldwork was carried out in December 2011.
For quantitative sampling, plots of 0.25 m 2 were ar-
ranged every 5 meters along a 250 m transect, across
the largest longitude (maximum longitude) over the
center of the peatland. Forty quadrants were evalu-
ated and the taxonomic determination for orchids fol-
lowed Correa (1969) and Novoa et al. (2006).
RESULTS AND DISCUSSION
Gavilea araucana is a terrestrial orchid, erect up
to 70 cm in height. Leaves lanceolate, acute. Inflo-
rescences lax, up to 8 pale yellow to whitish flowers.
Bracts lanceolate, acute, slightly surpassing the
ovary. Dorsal sepal 18 x 5 mm, oval-lanceolate,
acute. Lateral sepals up to 27 x 6 mm, oval-lanceo-
late, with thin caudicule up to 12 mm. Petals with va-
ricose veins, at base. Labellum 3-lobed, lateral lobes
forming an obtuse angle with the central lob, noto-
rious rounded veins, apical margin slightly sinuose,
central lob elongated, more or less triangular, with
veins cross over by few flakes with thicken mar-
gins, margin laciniate or merlon-shaped. Column 5
to 6 mm, with 2 folds at the contact place with the
labellum. Fruits capsules, globose and cylindrical.
Flowering in December, fruiting in December and
January. For the Region de Magallanes, its presence
has been cited in the Torres del Paine National Park
and the Milodon Cave Natural Monument (Domin-
guez, 2003; 2010) in clear forest sites, usually on
the banks of Great Lakes.
This orchid has also been found in small popula-
tions in sites affected by forest fires at the Lago
Pehoe areas and on the slopes of Mount Ferrier (Do-
minguez, 2012). This population of five G. arau-
cana individuals with flowers, located in a
Gavilea araucana (Phil.) M.N. Correa: first record of an orchid for Chile on Sphagnum peatland in Magallanes 127
Figure 2. Gavilea araucana in inflorescence and vegetative state in a Sphagnum peatland in the Magallanes Region,
Chile (Photo Erwin Dominguez, 2008).
Sphagnum peatbog next to Torres del Paine National
Park, represents the first record for Chile (Fig. 2).
The orchids are growing from the Sphagnum carpet
(lawns and humock) reaching between 0.25 to 0.5
m tall. Several herbaceous species are coexisting
under the Sphagnum magellanicum Brid domina-
tion, including Cortaderia egmontiana (Roem. &
Schult.) M. Lyle ex Connor, Senecio trifurcatus (G.
Forst.) Less, Symphyotrichum vahlii (Gaudich.) GL
Nesom., Hypochaeris arenaria Gaudich, Marsip-
pospermum grandiflorum (Lf) Hook., Tetroncium
magellanicum Willd., and the carnivorous plant
Drosera uniflora Willd. Rhizomatous species such
as Myrteola nummularia (Poir.) O. Berg and Nano-
dea muscosa Banks ex C.F. Gaertn. with other
woody plants such as Empetrum rubrum Vahl ex
Willd and Nothofagus antarctica (G. Forst.) Oerst
were also present. In these environments S. magel-
lanicum represents 70% coverage, and grows as
hummock-lawns shape with at least a two-meter
peat depth and a shallow water table. This finding
may provide new information about habitat types
for an orchid not previously described for the rest
of the country. Research on peatlands in Chile are
mostly focused on flora descriptions, but this is not
an adequate characterization of these ecosystems,
and further studies are required to describe and
quantify the Sphagnum peatland flora. Therefore,
the results of these studies would not show the cur-
rent state of the structure and floristic composition
of peatlands, at least for the Region de Magallanes.
ACKNOWLEDGEMENTS
Authors wish to thank Juan Larrain B. who as-
sisted in the fieldwork. This work was funded by
the Program: Bases ambientales, juridicas, comer-
ciales para el desarrollo sustentable de las turberas
en Magallanes. FONDEMACODE: 501548-20.
REFERENCES
Boland T. & Scott P.J., 1992. Ecological aspects of Are-
thusa bulbosa, Calopogon tuberosus and Pogonia
ophioglossoides (Orchidaceae) in eastern Newfoun-
dland. II. Partitioning of the microhabitat. Rhodora,
94: 374-380.
Brown C.J. & Scott P.J., 1997. Environmental parameters
influencing the distribution of Platanthera blephari-
glottis and Platanthera clavellata (Orchidaceae) in
peatlands on the Avalon Peninsula, Newfoundland.
Canadian Journal of Botany, 75: 974-980.
Boelcke O., Moore D.M. & Roig F.A. (Eds.), 1985. Tran-
secta Botanica de la Patagonia Austral. Consejo Na-
cional de Investigacion Cientifica y Tecnica
(Argentina). Buenos Aires. XXVIII, 733 pp.
128
Erwin Dominguez & Nelson Bahamonde
Charman D.J., 2002. Peatlands and environmental
change. Wiley, Chichester, 312 pp.
Correa M.M., 1969. Chloraea, genero sudamericano de
Orchidaceae. Darwiniana, 15: 374-500.
Davis T., 2011. Pennsylvania Natural Heritage Program.
Sphagnum - Beak-rush Peatland Factsheet. Online at:
http://www.naturalheritage.state.pa.us/CommSum-
mary.aspx?= 160 12 Accessed on September 10, 2012.
Dominguez E., 2003. Catalogo de orquideas del Parque
Nacional Torres del Paine. Chloris Chilensis Ano 7.
N° 1. http://www.chlorischile.cl.
Dominguez E., 2010. Diversity des orchidees du Monu-
ment Naturel Cueva del Milodon, Magellan (Chili).
Richardiana, 11: 34-54.
Dominguez E., 2012. Flora Nativa Torres del Paine. San-
tiago, Ocho Libros Editores, Primera edicion, 343 pp.
Diaz, F., Larrain J., Zegers G. & Tapia C., 2008. Carac-
terizacion floristica e hidrologica de turberas de la
Isla Grande de Chiloe, Chile. Revista Chilena de Hi-
storia Natural, 81: 455-468.
Gajardo R., 1994. La Vegetacion Natural de Chile: Cla-
sificacion y distribucion geografica. Editorial Uni-
versitaria. Santiago, 165 pp.
Grootjans A., Iturraspe R., Lanting A., Fritz C. & Joosten
H., 2010. Ecohydrological features of some contra-
sting mires in Tierra del Fuego, Argentina. Mires &
Peat, 6: 1-15.
Henriquez J.M., 2004. Estado de la turba esfagnosa en
Magallanes. In: Blanco D. & de la Baize V. (Eds.).
Los turbales de la Patagonia - Bases para su inventa-
rio y conservacion de su biodiversidad. Wetlands in-
temacional (Buenos Aires) Publication 19: 93-104.
Iturraspe R., 2010. Las turberas de Tierra del Fuego y el
cambio climatico global. Fundacion Humedales / We-
tlands International. Buenos Aires, Argentina, 26 pp.
Kleinebecker T., Holzel N. & Vogel A., 2007. Gradients
of continentality and moisture in South Patagonian
ombro trophic peatland vegetation. Folia Geobota-
nica, 42: 363-382.
Kleinebecker T., Holzel N. & Vogel A., 2010. Patterns
and gradients of diversity in South Patagonian om-
brotrophic peat bogs. Austral Ecology, 35: 1-12.
Landry J., Bahamonde N., Garcia Huidobro J., Tapia C.
& Rochefort L., 2010. Canadian peatland restoration
framework: A Restoration experience in Chilean peat
bogs. Peatlands Interntional, 2: 50-53.
Laroche V., 2011. Platanthera blephariglottis: une
espece indicatrice de l'integrite ecologique des tour-
bieres ombrotrophes au Quebec. Memoire presente a
la Faculte des arts et sciences en vue de Tobtention
du grade de M. Sc. en sciences biologiques. Univer-
sity de Montreal, 53 pp.
Larrain J., 20 1 1 . Caracterizacion floristica de turberas de
la Region de Magallanes, Chile. Informe Tecnico.
INIA-Kampenaike, 12 pp.
Novoa P., Espejo J., Cistemas M., Rubio M. & Domin-
guez E., 2006. Guia de Campo de las Orquideas Chi-
lenas. Edicion Corporacion Chilena de la Madera,
CORMA, Concepcion, Chile, 120 pp.
Moore D.M., 1983. Flora of Tierra del Fuego. Anthony
Nelson, Oswestry, England, 338 pp.
Pisano E., 1977. Fitogeografia de Fuego-Patagonia chi-
lena. I. Comunidades vegetales entre las latitudes
52° y 56°. Anales del instituto de la Patagonia, 8:
121-250.
Pisano E., 1983. The Magellanic Complex Tundra. In:
Gore A.J.P. (Ed.). Mires, swamps, bog, fen and moor,
B Regional studies. (Ecosistems of the world 4B),
Amsterdam, 295-329.
Pliscoff P. & LuebertF., 2006. Ecosistemas terrestres. In:
Biodiversidad de Chile: Patrimonio y desafios. Comi-
sion Nacional del Medio Ambiente, Santiago, 74-87.
Roig C. & Roig F., 2004. Consideraciones generales. In:
Blanco D. & de la Baize V. (Eds.). Los turbales de la
Patagonia - Bases para su inventario y conservacion
de su biodiversidad. Wetlands internacional (Buenos
Aires) Publication 19: 5-21.
Roig, C., Roig F. & Martinez Carretero E., 2004. Ventana
5: Tolhuin, provincia de Tierra del Fuego (Anexo II-
E). In: Blanco D. & de la Baize V. (eds.). Los turbales
de la Patagonia - Bases para su inventario y conser-
vacion de su biodiversidad. Wetlands internacional
(Buenos Aires) Publication 19: 55-61.
Roivainen H., 1954. Studien uber die Moore Feuerlands.
Annales Botanici Societatis Zoologicae Botanicae
Fennicae Vanamo, 28: 1-205.
Ruiz J. & Doberti M., 2005. Catastro y caracterizacion de
los turbales de Magallanes. Programa Fondema.Co-
digo BIPN°20 19640 1-0, 123 pp.
San Martin C., Ramirez C. & Figueroa H., 1999. Analisis
multivariable de la vegetacion de un complejo de tur-
beras de la Cordillera Pelada (Valdivia, Chile). Laza-
roa, 20: 95-106.
Skottsberg C., 1909. Pflanzen Physiognomische beoba-
chtungen aus dem Feuerlande. Wissenschaftliche Er-
gebnisse der Schwedischen Siidpolar-Expedition
1901-1903. Stockholm, 63 pp. + 4 Plates.
Teneb E. & Dollenz O., 2004. Distribucion espacial de la
flora vascular, la humedad y el pH en un turbal de esfa-
gno ( Sphagnum magellanicum Brid.), Magallanes,
Chile. Anales del instituto de la Patagonia, 32: 5-12.
Teneb E., Gomez P. & Gonzalez M., 2008. Observacio-
nes sobre la flora y vegetacion de dos turberas en la
Region de Aisen, Patagonia Chilena. Gayana Bota-
nica, 65: 229-232.
Biodiversity Journal, 2013, 4 (1): 129-134
A new species of false spider crab of the genus Elamena H.
Milne Edwards, 1 837 from Upper Gulf of Thailand (Decapoda
Hymenosomatidae)
Sitthi Kulabtong 1 *, Sawika Kunlapapuk 2 & Suvijak Sottiyothin 3
'Save wildlife volunteer Thailand, Wangnoi District, Ayuttaya Province 13170, Thailand; e-mail: kulabtong201 [email protected]
2 Aquatic Animal Production Technology Program, Faculty of An imal Sciences and Agricultural Technology, Silpakom University, Phet-
chaburi IT campus, Sampraya, Cha-am, Phetchaburi, 76120 Thailand; e-mail: [email protected]
3 358/6 Sukumvit Rd. Paknum Subdistrict, Muang District, Samutprakan Province, Thailand; e-mail: [email protected]
‘ Corresponding author
ABSTRACT A new species of false spider crab (Decapoda Hymenosomatidae), Elamena soonthronkitti
n. sp. from Upper Gulf of Thailand, is described. This species is distinguished from other
species of the genus Elamena H. Milne Edwards, 1837 by the combination of the following
characters: carapace longer than broad; dorsal surface smooth with deep gastrocardiac, cer-
vical and thoracic grooves; rostrum truncated; no ventral rostral keel; abdomen octagonal
with the tip rounded; chelipeds palm plump; both fingers equal or slightly shorter than palm
with small setae; dactylus of the third ambulatory legs with no subterminal teeth. Biological
features and current distribution of the new species and comparative notes are also reported.
KEY WORDS Elamena', Decapoda; Hymenosomatidae; Bangpu; Thailand.
Received 4.11.2012; accepted 22.12.2012; printed 30.03.2013
INTRODUCTION
The false spider crab family Hymenosomatidae
is different from other crabs in many characters:
the 4 pairs of ambulatory legs are longer (i.e. spi-
der-like) than in other crabs, abdominal segments
and telson are clearly different from other bra-
chyuran crabs (Lucas, 1980; Dudgeon, 1999). Ge-
nerally speaking, crabs are wildly distributed and
comprise more than 100 species worldwide
(Chuang & Ng, 1994; Naruse et al., 2008). In
Southeast Asia more than 1 0 species are recorded;
in Thailand there are 4 species (Kemp, 1917;
Niyanetr, 1980; Chuang & Ng, 1994; Ng &
Chuang, 1996) including:
Hymenicoides naiyanetri (Chuang et Ng, 1991)
Elamena magna Ng et Chuang, 1996
Halicarcinus coralicola (Rathbun, 1909)
Neorhynchoplax exigue (Kemp, 1917)
In a survey project involving two of the authors
(KSi and SS) in Bangpu mangrove area, Samutpra-
kan Province, Upper Gulf of Thailand (Figs. 1-2)
carried out during November-December 2010, we
found two specimens of false spider crab which
were reported by us, at that time, as Hymenicoides
cf. naiyanetri (Sottiyothin, & Kulabtong, 2011; Ku-
labtong & Sottiyothin, 2012).
Subsequently, a re-examination of those speci-
mens, carried out by KSi and KSa revealed that
they belong to a new species of the genus Elamena
H. Milne Edwards, 1837 which is described in the
present paper.
ACRONYMS AND ABBRE VATION S . Refe-
rence Collection of Aquatic Ecology, Silpakorn
130
S. Kulabtong, S. Kunlapapuk & S. Sottiyothin
University, Phetchaburi IT campus = RAESUP; Su-
vijak Sottiyothin = SS; Sawika Kunlapapuk = KSa;
Sitthi Kulabtong = KSi
RESULTS
Order DEC APOD A Latreille, 1802
Family HYMENOSOMATIDAE Macleay, 1838
Elamena soonthronkitti n. sp.
Hymenicoides cf. naiyanetri; Kulabtong & Sottiyo-
thin, 2012 (Samutprakan Province, Thailand)
Examined material. Holotypus male, RAESUP
132: Bangpu mangrove area, Bangpu Mai Subdi-
strict, Muang District, Samutprakan Province,
Upper Gulf of Thailand, 29.XII.2010, legit Sitthi
Kulabtong and Suvijak Sottiyothin (Fig. 3); Para-
typus female, RAESUP 133, 1 specimen, same data
of holotypus.
Description of Holotypus. The carapace of
this species is vase-like and longer than broad.
Dorsal surface slightly concave, smooth with deep
gastrocardiac, cervical and thoracic grooves, all
branching. Rostrum unilobate, tmncated, no ventral
rostral keel. The eyes can be seen from the dorsal
view (Figs. 4-6). Abdomen is octagonal and the tip
is rounded (Fig. 11). Third maxillipeds cover almost
three-quarters of the mouth area; ischium shorter
than merus in outer lateral margins; carpus longer
than propodus and dactyl; long setae on inner lateral
margins of merus, propodus and dactyl; exopod lon-
ger than ischium and merus, with a long flagellum
on the tip (Fig. 7). Chelipeds slightly larger than
ambulatory legs; short setae along chelipeds;
palm plump; immovable finger larger than mova-
ble finger; both fingers with 4-5 serrated-like teeth;
both fingers equal or slightly shorter than palm with
small setae; tips of both fingers slightly hooked-like
(Fig. 9). Ambulatory legs very long and slender;
small setae along the legs; tip of legs hooked-like.
Dactylus of the third ambulatory legs with no sub-
terminal teeth (Fig. 10).
Coloration in fresh specimen is light yellow,
transparent along the body, legs and chelipeds. The
carapace shows a clear dark V-shaped strip and
many small brown dots (Fig. 3).
Figures 1, 2. Bangpu mangrove area, Samutprakan
Province, Upper Gulf of Thailand.
Variability. Males (Figs. 3-11) differ from fe-
males by the abdomen shape and size (narrower in
males) (Figs. 11-12).
Etymology. The specific name refers to Yana-
nan Soonthronkit, Rajamangala University of Te-
chnology Tawan-ok: Chantaburi Campus, Thailand,
who was the first teacher of taxonomy and aquatic
ecology of KSi.
Biology and Distribution. E. soonthronkitti
n. sp. was found only in the rocky shore ecosystem
of Bangpu mangrove area, Upper Gulf of Thailand.
This crab lives under the rocks and its habitat is
A new species of false spider crab of the genus Elamena H. Milne Edwards, 1 837 from Upper Gulf of Thailand 131
characterized by large rocks and a sandy mud bot-
tom. In this area tidal fluctuations and salinity
change frequently during all day. In the flood tide,
these organisms move up to the rocky dam, whereas
they reach the shore only in the neap tide, thus re-
vealing, in our opinion, poor swimming skills. In the
same area, we falso found many snapping shrimps
(Decapoda Alpheidae) living under the large rocks
too, known only from Bangpu mangrove area, Sa-
mutprakan Province, Upper Gulf of Thailand.
Comparative notes, hi Southeast Asia, 7 species
of false spider crabs belonging to the genus Ela-
mena H. Milne Edwards, 1837 were recorded by
Chuang & Ng (1991, 1994) and Ng & Chuang
(1996) namely E. cristatipes Gravely, 1927 from
India and Malay Peninsula, E. globosa Chuang et
Ng, 1991 from Singapore, E. mendosa Chuang et
Ng, 1991 from Malaysia and Singapore, E. simpli-
denta Ng et Chuang, 1996 from Indonesia, E. sun-
daica Ng et Chuang, 1 996 from Indonesia, E. cf.
Figure 3. Holotypus of Elamena soonthronkitti n. sp. from Upper Gulf of Thailand.
132
S. Kulabtong, S. Kunlapapuk & S. Sottiyothin
Figures 4-12 Elamena soonthronkitti n. sp. Fig. 4: carapace. Fig. 5: dorsal view of rostrum. Fig. 6: ventral view of
rostrum. Fig. 7: third maxilliped. Fig. 8: flagellum of antenna. Fig. 9: cheliped. Fig. 10: third ambulatory leg.
Fig. 1 1 : abdomen of male. Fig. 12: abdomen of female.
A new species of genus Elamena H. Milne Edwards, 1837 false spider crab from Upper Gulf of Thailand
133
truncata (Stimpson, 1858) from Indonesia and Viet-
nam and E. magna Ng et Chuang, 1996 which was
the only one found in Thailand.
Particularly, E. soonthronkitti n. sp. is clearly
different from E. magna in many characters: cara-
pace is vase-like and rostrum truncated (in E.
magna both carapace and rostrum are triangular);
dorsal surface with deep gastrocardiac, cervical and
thoracic grooves (in E. magna dorsal surface with-
out grooves); dactylus of the third ambulatory legs
with no subterminal teeth (in E. magna with 2 sub-
terminal teeth); chelipeds plump (in if magna slen-
der and elongate); fingers of chelipeds equal or
slightly shorter than palm (in E. magna longer than
palm); abdomen octagonal (in E. magna triangular)
(Ng & Chuang, 1996).
E. soonthronkitti n. sp. is different from E. cri-
statipes in many characters: rostrum truncated (in
E. cristatipes is rounded); dorsal surface with deep
gastrocardiac, cervical and thoracic grooves (in E.
cristatipes the cervical and thoracic grooves do not
reach the anterolateral and posterolateral margins);
rostrum with no ventral rostral keel (in E. cristati-
pes one rectangular ventral keel); long setae on
inner lateral margins of merus (short setae in E. cri-
statipes ); fingers of chelipeds equal or slightly
shorter than palm (in E. cristatipes much shorter
than palm); dactylus of the third ambulatory legs
with no subterminal teeth (in E. cristatipes with 1
subterminal tooth); abdomen octagonal (in E. cri-
statipes is triangular) (Ng & Chuang, 1996).
E. soonthronkitti n. sp. is different from E. glo-
bosa in many characters: rostrum truncated (in E.
globosa is triangular); dactylus of the third ambu-
latory legs with no subterminal teeth (in E. globosa
with 3 subterminal teeth); abdomen octagonal (in
E. globosa is triangular) (Chuang & Ng, 1991).
E. soonthronkitti n. sp. is clearly different from
other species of the genus Elamena of Indonesia by
the combination of the following characters: cara-
pace is longer than broad (in E. simplidenta and E.
sundaica is broader than long); rostrum with no
ventral rostral keel (in E. simplidenta and E. sun-
daica with keel); dactylus of the third ambulatory
legs with no subterminal teeth (E. simplidenta with
one subterminal tooh and E. sundaica with 2 sub-
terminal teeth) (Ng & Chuang, 1996).
E. soonthronkitti n. sp. differs from E. mendosa
in many characters: rostrum tmncated (in E. men-
dosa is triangular); dorsal surface with deep gastro-
cardiac, cervical and thoracic grooves (no distinct
grooves in E. mendosa)', chelipeds plump (slender
and elongate in E. mendosa ); dactylus of the third
ambulatory legs with no subterminal teeth (in E.
mendosa 2 subterminal teeth); abdomen octagonal
(in E. mendosa is triangular) (Chuang & Ng, 1991).
E. cf. truncata from Indonesia and Vietnam, still
has an unclear taxonomic status. E. soonthronkitti
n. sp. is different from this taxon in many charac-
ters: chelipeds plump (in E. cf. truncata slender and
elongate); dactylus of the third ambulatory legs
with no subterminal teeth (in E. cf. truncata 2 sub-
terminal teeth) (Ng & Chuang, 1996).
ACKNOWLEDGEMENTS
The authors are grateful to reviewers for review-
ing this manuscript. A special thank to Miss Jun-
thima Chatngern, who helped collecting the
specimens employed in this study (based on the Sur-
vey project in Bangpu mangrove area, Upper Gulf
of Thailand). We also wish to thank the Bangpu Na-
ture Education Centre for supporting the survey
project.
REFERENCES
Chuang C.T.N. & Ng P.K.L., 1991. Preliminary descrip-
tions of one new genus and three new species of hy-
menosomatid crabs from Southeast Asia (Crustacea:
Decapoda: Brachyura). The Raffles Bulletin of Zoo-
logy, 39: 363-368.
Chuang C.T.N. & Ng P.K.L., 1994. The ecology and bio-
logy of Southeast Asian false spider crabs (Crustacea:
Decapoda: Brachyura: Hymenosomatidae). Hydro-
biologia, 285: 85-92.
Dudgeon D., 1999. Tropical Asian stream: zoobenthos,
ecology and conservation. Hong Kong University
Press, Hong Kong, 830 pp.
Kemp S., 1917. Notes on Crustacea Decapoda in the
Indian Museum: Hymenosomidae. Records of the In-
dian Museum, 13: 243-279.
Kulabtong S. & Sottiyothin S., 2012. False spider crabs
(Hymenosomatidae) in Thailand. Journal of Faculty
of Animal Science and Agricultural Technology Sil-
pakorn University, 3: 1-6.
Lucas J.S., 1980. Spider crabs of the family Hymenoso-
matidae (Crustacea; Brachyura) with particular refe-
rence to Australian species: systematics and biology.
Records of the Australian Museum, 33: 148-247.
134
S. Kulabtong, S. Kunlapapuk & S. Sottiyothin
Narase T., Ng P.K.L. & Guinot D., 2008. Two new ge-
nera and two new species of troglobitic false spider
crabs (Crustacea: Decapoda: Brachyura: Hymenoso-
matidae) from Indonesia, with notes on Cancrocaeca
Ng, 1991. Zootaxa, 1739: 21-40.
Ng P.K. L. & Chuang C.T.N., 1996. The Hymenosoma-
tidae (Crustacea: Decapoda: Brachyura) of Southeast
Asia, with note on other species. The Raffles Bulletin
of Zoology, Supplement No. 3, p. 82.
Niyanetr P., 1980. Crustacean fauna of Thailand (Deca-
poda and Stomatopoda). Department of biology, Fac.
Sci., Chulalongkom Univ., 196 pp.
Sottiyothin S. & Kulabtong S., 2011. Species diversity
of blackish mollusk in Bang-poo Mangrove, Samut-
prakarn Province. Veridian e-Joumal Silpakorn Uni-
versity, 4: 911-916.
Biodiversity Journal, 2013, 4 (1): 135-178
Monograph
Contribution to the knowledge of the freshwater algae of
Sierra Leone (Tropical West Africa): diatoms from Loma
Mountains and Bumbuna Falls, the Northern Province
Silvia Alfinito 1 * & Horst Lange- Be rtalot 2
'Department of Environmental Biology, Sapienza, University of Rome. 00185 Rome, Italy
2 Institut far Okologie, Evolution, Diversitat, Goethe-Universitat und Forschungsinstitut Senckenberg D-60439 Frankfort am Main,
Germany
*Corresponding author, e-mail: [email protected]
ABSTRACT The freshwater flora of Sierra Leone, in particular the northern province, is still poorly in-
vestigated. We describe here the diatoms found in small pools in two locations of the northern
province: Peak Bintimani (Loma Mountains) and Bumbuna Falls. Altogether 65 taxa, be-
longing to 31 genera are described. About 32 dubious Holarctic taxa, suspected to be new to
science, are noted as “cf. ”, expecting a differential diagnosis later on after further SEM ob-
servations. This is the case of very interesting taxa belonging to the genera Eunotia, Luticola,
Frustulia and Brachysira.
KEY WORDS Diatoms; Bacillariophyceae; tropical freshwaters; Sierra Leone; West Africa.
Received 05.11.2012; accepted 13.01.2013; printed 30.03.2013
INTRODUCTION
The freshwater diatom flora of Tropical West
Africa is still poorly investigated, the most com-
prehensive papers being those of Zanon (1941,
French West Africa), Foged (1966, Ghana; 1986,
Gambia), Compere (1991, Senegal) and Compere
& Riaux-Gobin (2009, Guinea).
In Sierra Leone, the most significant studies are
those of Carter & Denny (1982; 1987; 1992) in
which many new species were described. Fumanti
et al. (1990), Fumanti (1994) and Alfinito et al.
(1994) have published some contributions on the
diatom flora of three locations in the Western Area.
The Northern Province, where the samples object
of this study were collected, is also rather poorly re-
searched: Molder (1962), Sula Hills, few scattered
samples; Mazzoni (1986) River Dankale; Alfinito
et al. (1989), pond near Kania; Carter & Denny
(1992), Lake Sonfon.
In this paper, we describe the diatoms found in
two locations of the Northern Province: Peak Bin-
timani (Loma Mountains) and Bumbuna Falls,
River Seli.
MATERIALS AND METHODS
Study area
Sierra Leone is a small country located in the
south western part of West Africa, bordered by Gui-
nea, Liberia and the Atlantic Ocean. It is divided
into four geographical regions: the Northern Pro-
vince, Eastern Province, Southern Province and the
Western Area. Sierra Leone has a tropical climate,
136
Silvia Alfinito & Horst Lange-Bertalot
with a wet season from May to October and a dry
season from November to April.
The Northern Province, in which the samples,
object of this study, were collected, is composed of
interior plateaux and mountains which rise to form
Tingi Hills and Loma Mountains. The Loma
Mountains Forest Reserve covers approximately
396 km 2 and is the largest montane forest in Sierra
Leone. Peak Bintimani (1945 m a.s.l.) is the high-
est in West Africa.
Bumbuna Falls are just few kilometers from the
city of Bumbuna (Tonkolili District). About 2,5 km
downstream of Bumbuna Falls is located the Bum-
buna dam, the first Sierra Leone hydropower dam,
in the valley of the Sula Mountains.
Materials
Samplings were carried out in November 1984,
just at the beginning of the rainy season, by Prof.
Walter Rossi. The first sample was collected on the
NE slope of Peak Bintimani, Loma Mountains,
about 1650 m a.s.l. in very small pools formed by
tuft of grass on granitic rock (some images of the
sampling area are shown in Alfinito, 2011); the
pools were very rich in filamentous green algae,
mosses and in higher plants characteristic of these
swampy areas, such as Utricularia pubes cens
Smith, Utricularia micropetala Smith v. macrokei-
los P. Taylor and Drosera pilosa Exell et Laundon.
The second sample comes from Bumbuna Falls,
River Seli and was collected in small but relatively
deep pools formed in large granitic rocks emerging
from the dried river.
The material was treated with a mix of sul-
phuric and nitric acid and rinsed several times with
distilled water. The cleaned material was mounted
in Hyrax for light microscope (LM) studies with a
Zeiss Axioscope. For scanning electron microscope
(SEM) investigations, the material was coated with
gold and observed with a Cambridge 250 Scanning
Electron Microscope.
Terminology used in this paper follows that sug-
gested by Anonymous (1975), Krammer & Lange-
Bertalot (1986; 1988; 1991a; 1991b; 2000) and
Round et al. (1990). The classification follows Si-
monsen (1979), Round et al. (1990) and Krammer
& Lange-Bertalot (2000).
For each taxon a reference to the author we fol-
lowed for identification, valve dimensions, striae
density and other LM or SEM characteristics are
given, together with the distribution in Sierra
Leone.
RESULTS
Taxonomic account
B ACILLARIOPHY CEAE
CENTRALES
Familia TH AL AS S IO S IRACE AE Lebour, 1930
emend. Hasle, 1973
Aulacoseira Thwaites, 1848
Aulacoseira granulata (Ehr.) Simonsen v. valida
(Hustedt) Simonsen, 1979
Simonsen (1987) PL 278: 1-4
Description. Diameter 14-18 pm; 8-9 rows of
areolae in 10 pm; 8-10 elliptic areolae in 10 pm
(Fig. 1).
Distribution. Bumbuna Falls, Peak Bintimani,
quite frequent. New record for Sierra Leone.
Cyclotella (Kiitz.) Brebisson, 1838
Cyclotella meneghiniana Kiitzing, 1 844
Krammer & Lange-Bertalot (1991a) PI. 44: 1-10
Synonym: Cyclotella kuetzingiana Thwaites, 1 848
Description. Diameter 17-19 pm; 8-9 striae in
10 pm (Figs. 4-6).
Distribution. Bumbuna Falls, rare. Other
records: Sula Hills (Molder, 1962); River Jong
(Carter & Denny, 1982); River Dankale (Mazzoni,
1986, sub C. kuetzingiana Thwaites); Bathurst Falls
(Fumanti, 1994).
Fam. MELOSIRACEAE Kiitzing, 1844
Orthoseira Thwaites, 1849
Orthoseira roeseana (Rabenh.) O’Meara, 1876
Krammer & Lange-Bertalot (1991) PI. 10: 1-11
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
137
Synonym: Melosira roeseana Rabenhorst, 1852
Description. Diameter 12-30 |am; 15-18 striae
in 10 |am (Figs. 2-3).
Distribution. Bumbuna Falls, common. Other
records, sub Melosira roeseana Rabenhorst: Sula
Hills (Molder, 1962); River Jong (Carter & Denny,
1982); Lake Sonfon (Carter & Denny, 1992).
PENNALES
Familia F RAGIL ARI ACE AE Hustedt, 1930
Fragilaria Lyngbye, 1819
Fragilaria cf. javanica Hustedt, 1938
Metzeltin & Lange-Bertalot (1998) PL 1: 1-6;
Simonsen (1987) PI. 322: 1-6
Description. Length 47 gm; breadth 4.5 gm; c.
22 striae in 10 gm (Fig. 13).
Distribution. Bumbuna Falls, only one speci-
men observed.
Remarks, the only observed specimen is very
very close to Hustedt’ s taxon, unless the presence
of marginal spines. The species Fragilaria telum,
described by Carter in Carter & Denny (1987) for
Lake Mabesi, Sierra Leone, is clearly related to F.
javanica Hustedt, but lacks the marginal spines. As
far as we know, F. telum was no more reported.
Later on Metzeltin & Lange-Bertalot (1998) found
F. javanica Hustedt in a spring stream near Santos
(Brazil) and the specimens shown in their PI. 1 :
1-6 have no marginal spines. A more detailed ana-
lysis of the original material, involving SEM com-
parison, should be required in order to fully
understand the taxonomical identity of both taxa.
Ctenophora (Grunow) Williams et Round, 1986
Ctenophora pulchella (Ralfs ex Kiitzing) Williams
et Round, 1986
Hofmann et al. (2011) PI. 4: 13-17
Synonym: Synedra pulchella Ralfs ex Kiitzing, 1 844
Description. Length 45-70 gm; breadth 5-5.5
gm; 15-16 striae in 10 gm (Figs. 7-9).
Distribution. Bumbuna Falls, quite common.
Other records, sub Synedra pulchella Ralfs ex Kiit-
zing: Sula Hills (Molder, 1962); Lake Mabesi (Car-
ter & Denny, 1987); Lake Sonfon, Lake Mabesi
(Carter & Denny, 1992).
Staurosira Ehrenberg, 1843
Staurosira cf. longirostris (Frenguelli) Metzeltin,
Lange-Bertalot et Garcia-Rodriguez, 2005
Sar et al. (2009) p. 152 fig. 21
Metzeltin et al. (2005) PL 13:4-13
Description. Length 15-18 gm; breadth 8-8.5
gm (Fig. 11).
Distribution. Peak Bintimani, rare.
Remarks, this species, described by Fren-
guelli (1941) from the coastal lagoon of Mar Chi-
quita (Argentina), was reported also by Metzeltin
et al. (2005) for Rio de la Plata and Laguna Merin
(Uruguay).
Staurosira construens Ehrenberg, 1 843
Hofmann et al. (2011) Pl. 10: 1-6
Synonym: Fragilaria construens (Ehr.) Grunow,
1862
Description. Length 10-12 gm; breadth 6 gm;
c. 12 striae in 10 gm (Fig. 10).
Distribution. Bumbuna Falls, rare. Other
records, sub Fragilaria construens (Ehr.) Grunow:
Sula Hills (Molder, 1962); River Jong (Carter &
Denny, 1982); Lake Mabesi, Lake Mape (Carter &
Denny, 1987).
Staurosira venter (Ehr.) Grunow in Pantocsek,
1889
Hofmann et al. (2011) Pl. 10: 18-24
Synonym: Fragilaria construens Ehr. v. construens
f. venter (Ehr.) Hustedt, 1957
Description, length 6-7 gm; breadth 5-6 gm;
12-14 striae in 10 gm (Fig. 12).
Distribution. Bumbuna Falls, rare. Other
records: Lake Sonfon (Carter & Denny, 1992) sub
138
Silvia Alfinito & Horst Lange-Bertalot
Fragilaria construens Ehr. v. construens f. venter
(Ehr.) Hustedt.
Ulnaria (Nitzsch) Compere, 2001
Ulnaria cf. ulna (Nitzsch) Compere, 2001
Synonym: Synedra ulna (Nitzsch) Ehrenberg, 1832
Description. Length 57-60 pm; breadth 5-6
pm; c. 11 striae in 10 pm (Fig. 14).
Distribution. Bumbuna Falls, quite common.
Records for U. ulna sensu lato, sub Synedra ulna
(Nitzsch) Ehrenberg: Sula Hills (Molder, 1962);
River Danlcale (Mazzoni, 1986); Lake Sonfon (Car-
ter & Denny, 1992).
Remarks. Krammer & Lange-Bertalot (1991)
and Hofmann et al. (2011) regard this taxon as a
“sippenkomplex” that needs further thorough stud-
ies. Our specimens bear some resemblance to Sy-
nedra ulna (Nitzsch) Ehrenberg f. impressa (Hust.)
Hustedt, 1957 as reported in Simonsen (1987) PI.
54 fig. 3.
Familia EUNOTIACEAE Kiitzing, 1944
Actinella F. W. Lewis, 1863
Actinella brasiliensis Grunow in Van Heurck, 1881
Metzeltin & Lange-Bertalot (2007) PL 35: 1-7
Description. Length 77-140 pm; breadth 6-8.5
pm; 12-17 striae in 10 pm (Figs. 36-39; Figs 40-
41; Fig. 51).
Distribution. Bumbuna Falls, rare; Peak Binti-
mani, quite common. Other records: River Jong (Car-
ter & Denny, 1982); Lake Mape, Lake Mabesi, River
Waanje (Carter & Denny, 1987); Guma Dam (Fu-
manti et al., 1990); Lake Sonfon, Lake Popei (Carter
& Denny, 1992); Bathurst Falls (Fumanti, 1994).
Eunotia Ehrenberg, 1837
Eunotia cf. crassula Metzeltin et Lange-Bertalot,
1998
Description. Length 50-78 pm; breadth 8-11
pm; c. 14 striae in 10 pm (Figs. 42-46).
Distribution. Peak Bintimani, quite frequent.
Eunotia cf. crista-galli Cleve, 1891 and cf. tecta
Krasske, 1939
Description. Length 29-33 pm; breadth 7-8
pm; 15-16 striae in 10 pm (Figs. 16-17).
Distribution. Bumbuna Falls, rare; Peak Bin-
timani, rare. Records for E. crista-galli Cleve: Ba-
thurst Falls (Fumanti, 1994); records for E. tecta
Krasske: Lake Sonfon (Carter & Denny, 1992).
Remarks. Both of the cf. are hardly similar.
Eunotia cf. minor (Kiitz.) Grunow in Van Heurck,
1881
Synonym: : E. pectinalis (Kiitz.) Rabenh. v. minor
(Kiitz.) Rabenhorst, 1864
E. pectinalis (Kiitz.) Rabenh. v. minor (Kiitz.) Ra-
benh. f. impressa (Ehr.) Hustedt, 1930
Description. Length 22-42 pm; breadth 3.5-5
pm; 12-14 striae in 10 pm (Figs. 25-26).
Distribution. Bumbuna Falls, quite common;
Peak Bintimani, rare. Records for Eunotia minor
(Kiitz.) Grunow in Van Heurck (sub E. pectinalis
(Kiitz.) Rabenh. v. minor (Kiitz.) Rabenhorst, 1864
and E. pectinalis (Kiitz.) Rabenh. v. minor (Kiitz.)
Rabenh. f. impressa (Ehr.) Hustedt): Sula Hills
(Molder, 1962); River Jong (Carter & Denny,
1982); River Dankale (Mazzoni, 1986); Lake Popei
(Carter & Denny, 1992).
Eunotia naegelii Migula in Thome, 1907
Krammer & Lange-Bertalot (1991) PI. 140: 1-6
Synonym: E. alpina (Nageli) Hustedt in Schmidt et
al., 1913
Description. Length 32-68 pm; breadth 2-2.5
pm; 25-28 striae in 10 pm (Figs. 28-34).
Distribution. Peak Bintimani, common. Other
records: Sula Hills (Molder, 1962), River Jong
(Carter & Denny, 1982), Lake Mape (Carter &
Denny, 1987) and Lake Popei (Carter & Denny,
1992) sub E. alpina (Nageli) Hustedt in Schmidt et
al., 1913; Bathurst Falls (Fumanti, 1994).
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
139
Eunotia rabenhorstiana (Grunow) Hustedt, 1 949
Metzeltin & Lange -Bertalot (1998) PL 10: 1-13
Description. Length 63-87 gm; breadth 7-8
gm; 16-17 striae in 10 gm (Fig. 35).
Distribution. Bumbuna Falls, rare. New record
for Sierra Leone.
Eunotia rabenhorstii Cleve et Grunow v. triodon
Grunow in Van Heurck, 1881
Metzeltin et al. (2005) PL 20: 1-7
Description, length 33-35 gm; breadth 7 gm;
16-17 striae in 10 gm (Fig. 15).
Distribution. Bumbuna Falls, rare. New record
for Sierra Leone.
Eunotia rhomboidea Hustedt, 1950
Simonsen (1987) Pl. 546: 3-8
Lange-Bertalot et al. (2011) PL 42: 1-8; PL 43: 12-14
Metzeltin & Lange-Bertalot (2002) PL 9: 1-4
Description. Length 8-18 gm; breadth 2-4.5
gm; 18-24 striae in 10 gm and c. 40 areolae in 10
gm(Figs. 18-24).
Distribution. Bumbuna Falls, Peak Bintimani,
frequent. Other records: River Jong (Carter &
Denny, 1982); Lake Sonfon (Carter & Denny,
1992); Bathurst Falls (Fumanti, 1994).
Eunotia vumbae Cholnoky, 1954
Cholnoky (1954) Figs. 54-58
Description. Length 15 gm; breadth 4 gm;
more than 20 striae in 10 gm (Fig. 27).
Distribution. Bumbuna Falls, only one speci-
men observed. New record for Sierra Leone.
Familia ACHNANTHACEAE Kiitzing, 1844
Achnanthes Bory, 1822
Achnanthes inflata (Kiitzing) Grunow in Cleve &
Grunow, 1880
Krammer & Lange-Bertalot (1991) PL 2: 9-10
Description. Length 35-64 gm, breadth 10-16
gm; c. 12 striae in 10 gm in both valvae (Figs. 62-
64).
Distribution. Bumbuna Falls, quite rare. Other
records: Kangari Sula (Molder, 1962); River Dan-
kale (Mazzoni, 1986).
Familia ACHNANTHIDIACEAE D. G. Mann
1990
Achnanthidium KAtzing , 1844
Achnanthidium subhudsonis (Hustedt) Kobayasi
in Kobayasi et al., 2006
Simonsen (1987) Pl. 68: 1-9
Description, length 18-26 gm, breadth 4-5 gm;
striae in the raphe valve 18-20 in 10 gm and in the
rapheless valve 22-23 in 10 gm (Figs. 52-57; Figs.
58-59).
Distribution. Bumbuna Falls, frequent. New
record for Sierra Leone.
Achnanthidium taiaense (Carter in Carter &
Denny) J. Taylor, Morales et Ector, 2011
Lange-Bertalot & Krammer (1989) PL 67: 25-28
(Holotypus, BM 78107, Sierra Leone)
Description. Length 14-16 gm; breadth 3 gm;
more than 30 striae in 10 gm in the raphe valve and
more than 40 in 10 gm in the rapheless valve (Figs.
47-50).
Distribution. Bumbuna Falls, rare. Other re-
cords: River Jong (Carter & Denny, 1982); Lake
Mape, River Waanje, River Malen (Carter &
Denny, 1987); Guma Dam (Fumanti et al., 1990);
Lake Sonfon (Carter & Denny, 1992); Bathurst
Falls (Fumanti, 1994).
Remarks. Carter in Carter & Denny (1982) de-
scribed this species from the River Jong, Sierra
Leone (as Achnanthes taiaensis).
Fam. COCCONEIDACEAE Kiitzing, 1844
Cocconeis Ehrenberg, 1838
140
Silvia Alfinito & Horst Lange-Bertalot
Cocconeis pediculus Ehrenberg, 1838
Krammer & Lange-Bertalot (1991b) PL 57:1-4
Description. Length 26-28 jam; breadth 22-23
pm; striae in the raphe valve c. 18 in 10 pm; puncta
20-22 in 10 pm; striae in the rapheless valve about
18 in 10 pm; puncta elongated, c. 10 in 10 pm
(Fig. 60).
Distribution. Bumbuna Palls, rare. Other
records: River Jong (Carter & Denny, 1982); Lake
Sonfon, Lake Popei (Carter & Denny, 1992).
Cocconeis placentula Ehrenberg, 1938
Krammer & Lange-Bertalot (1991b) PI. 51: 1-5
Description. Length 20 pm; breadth 13 pm; c.
25 striae in 10 pm in the raphe valve (Pig. 61).
Distribution. Bumbuna Palls, only one valve
found. Other records: Sula Hills (Molder, 1962);
River Jong (Carter & Denny, 1982); Lake Sonfon,
Lake Popei (Carter & Denny, 1992).
Pamilia BRACHYSIRACEAE D. G. Mann, 1990
Brachysira (Kiitzing) Round et Mann, 1981
Brachysira cf. brebissonii Ross in Hartley, 1986
Synonym: Anomoeoneis brachysira (Breb.) Gru-
now in Cleve, 1895
Synonym: A. serians (Breb.) Cleve v. brachysira
(Breb.) Cleve in Cleve et Moller, 1882
Description. Length 20-24 pm; breadth 6-7
pm; 35-40 striae in 10 pm (Figs. 68-74; Pig. 75).
Distribution. Bumbuna Palls, Peak Bintimani,
quite frequent. Records for A. brachysira (Breb.)
Grunow sensu lato: Sula Hills (Molder, 1962);
River Jong (Carter & Denny, 1982); Lake Mabesi
(Carter & Denny, 1987); Kania (Alfinito et al.,
1989); Guma Dam (Pumanti et al., 1990); Lake
Sonfon (Carter & Denny, 1992); Bathurst Palls (Pu-
manti, 1994).
Brachysira cf. metzeltinii Lange-Bertalot in Lange-
Bertalot & Moser, 1994
Description. Length 35-36 pm; breadth 6-6.5
pm; c. 28 striae in 10 pm (Figs. 76-78).
Distribution. Peak Bintimani, rare.
Brachysira cf. wygaschii Lange-Bertalot in Lange-
Bertalot & Moser, 1994
Description. Length 39-45 pm; breadth 9-10
pm; 22-24 striae in 10 pm. Compare Lange-Berta-
lot & Moser (1994, Pig. 13: 1-11).
Distribution. Bumbuna Palls, Peak Bintimani,
quite frequent (Figs. 79-83).
Pamilia CYMBELLACEAE Greville, 1833
Cymbella C. Agardh, 1830
Cymbella kappii (Cholnoky) Cholnoky, 1956
Krammer (2002) PL 52: 1-15
Description. Length 28-32 pm; breadth 8-9
pm; 14 striae and c. 24 puncta in 10 pm (Figs. 92-
95).
Distribution. Bumbuna Palls, quite common.
New record for Sierra Leone.
Encyonema Kiitzing, 1833
Encyonema cf. auerswaldii Rabenhorst, 1853
Description. Length 13-30 pm; breadth 6-10
pm; 11-14 striae and c. 24 puncta in 10 pm (Figs.
98-101).
Distribution. Bumbuna Palls, Peak Bintimani,
frequent.
Encyonema cf. javanicum (Hustedt) D. G. Mann,
1990
Synonym: Cymbella javanica Hustedt, 1938
Description. Length 18 pm; breadth 6 pm; c.
10 striae in 10 pm (Pig. 102).
Distribution. Bumbuna Palls, only one speci-
men observed. Records for E. javanicum (Hustedt)
D. G. Mann: River Jong (Carter & Denny, 1982)
sub Cymbella javanica Hustedt, 1938.
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
141
Encyonema neogracile Krammer var. tenuipun-
ctata Krammer, 1997
Krammer (1997) PL 85: 1-6
Description. Length 50-55 pm; breadth 7 pm;
14 striae and 30-32 puncta in 10 pm (Fig. 97).
Distribution. Bumbuna Falls, rare. New record
for Sierra Leone.
Encyonema neomesianum Krammer, 1997
Krammer (1997) PL 40: 6-9
Description. Length 32-36 pm; breadth 9-9.5
pm; 9-10 striae in 10 pm (Fig. 96).
Distribution. Peak Bintimani, rare. New record
for Sierra Leone.
Encyonema cf. subelginense Krammer, 1997
Description. Length 24 pm; breadth 8 pm; c.
10 striae and 25-26 puncta in 10 pm (Fig. 105).
Distribution. Bumbuna Falls, only one speci-
men observed.
Encyonema cf. ventricosum (Ag.) Grunow in
Schmidt et al., 1885
Morphotype 3 in Krammer (1997) Pl. 6: 14-18
Description. Length 15 pm; breadth 4.5 pm; c.
14 striae in 10 pm (Fig. 104).
Distribution. Bumbuna Falls, only one speci-
men observed.
Remarks. Very often in the literature more or
less similar taxa are errouneously identified as E.
ventricosum such as, for instance, Encyonema sp. 4
in Kulikowskiy et al., 2012 PL 8: 6-7).
Encyonopsis Krammer, 1997
Encyonopsis cf. schubartii (Hustedt) Krammer,
1997
Description. Length 19-22.5 pm; breadth 5-5.5
pm; 11-12 striae in 10 pm (Fig. 103).
Distribution. Bumbuna Falls, rare.
Familia AMPHIPLEURACEAE Grunow, 1862
Frustulia Rabenhorst, 1853
Frustulia cf. crassinervia (Breb.) Lange-Bertalot
et Krammer in Lange-Bertalot & Metzeltin, 1996
Lange-Bertalot & Metzeltin (1996) PL 38: 7-9
Synonym: F. rhomboides (Ehr.) De Toni v. crassi-
nervia (Breb.) Ross, 1947
Description. Length 58-60 pm; breadth 16 pm;
striae very fine, c. 35 in 10 pm (Figs. 115-118).
Distribution. Peak Bintimani, frequent; Bum-
buna Falls, quite common. Other records for F.
crassinervia (Breb.) Lange-Bertalot et Krammer:
Bathurst Falls (Fumanti, 1994) sub F. rhomboides
(Ehr.) de Toni v. crassinervia (Breb.) Ross.
Frustulia cf. saxonica Rabenhorst, 1853
Lange-Bertalot & Metzeltin (1996) PL 39: 10 from
Julma Olkky (Finland)
Synonym: F. rhomboides (Ehr.) De Toni v. saxonica
(Rabenh.) Pfitzer, 1872
Description. Length 69-70.5 pm; breadth 15
pm; c. 27 striae in 10 pm and 24-25 areolae in 10
pm (Figs. 111-114).
Distribution. Peak Bintimani, Bumbuna Falls,
quite frequent. Other records for F. saxonica Raben-
horst, sub F. rhomboides (Ehr.) de Toni v. saxonica
(Rabenh.) Pfitzer: Sula Hills (Molder, 1962); Guma
Dam (Fumanti et al., 1990); Bathurst Falls (Fu-
manti, 1994).
Frustulia cf. undosa Metzeltin et Lange-Bertalot,
1998
Metzeltin & Lange-Bertalot (1998) PL 116: 14-18
Description. Length 34-43 pm; breadth 8-9 pm;
striae very fine, difficult to count by LM, c. 40 in
10 pm; 50-52 areolae in 10 pm (Figs. 119-123;
Figs. 124-126).
Distribution. Peak Bintimani, Bumbuna Falls,
quite frequent.
142
Silvia Alfinito & Horst Lange-Bertalot
Familia GOMPHONEMATACEAE Kiitzing, 1844
Gomphonema Ehrenberg, 1832
Gomphonema pseudoaugur Lange-Bertalot, 1979
Krammer & Lange-Bertalot (1986) PL 159: 1-4
Description. Length 15-25 gm; breadth 5. 5-7. 5
gm, c. 13-14 striae in 10 gm (Figs. 109-110) .
Distribution. Bumbuna Falls, quite common.
New record for Sierra Leone.
Gomphonema cf. lagenula Kiitzing, 1 844
Synonym: Gomphonema parvulum Kiitz. v. lage-
nula (Kiitz.) Frenguelli, 1923
Description. Length 22-29 gm; breadth 6-8.5
gm; 14-16 striae in 10 gm (Fig. 108).
Distribution. Bumbuna Falls, quite common.
Records for G. lagenula , sub G. parvulum Kiitz. v.
lagenula (Kiitz.) Frenguelli: River Jong (Carter &
Denny, 1982); River Dankale (Mazzoni, 1986);
River Waanje (Carter & Denny, 1987).
Familia CATENULACEAE Mereschkowsky, 1902
Halamphora (Cleve) Levkov, 2009
Halamphora veneta (Kiitz.) Levkov, 2009
Hofmann et al. (2011) PL 92: 20-25
Synonym: Amphora veneta Kiitzing, 1 844
Description. Length 20 gm; breadth 4 gm; c.
24 striae in 10 gm (Fig. 106).
Distribution. Bumbuna Falls, only one speci-
men observed. Other records (sub Amphora veneta
Kiitzing): Lake Sonfon (Carter & Denny, 1992);
York (Alfinito et al., 1994).
FAMILY NOT DESIGNATED
Kobayasiella Lange-Bertalot, 1999
Kobayasiella cf. subtilissima (Cleve) Lange-Berta-
lot, 1999
Synonym: Navicula subtilissima Cleve, 1891
Description. Length 31-38 gm; breadth 4.5-5
gm. Striae very delicate, difficult to resolve by LM
(Fig. 107).
Distribution. Peak Bintimani, not common.
Other records for Kobayasella subtilissima (Cleve)
Lange-Bertalot (sub Navicula subtilissima Cleve):
Sula Hills (Molder, 1962); River Jong (Carter &
Denny, 1982); Lake Mape, Lake Mabesi (Carter &
Denny, 1987); Kania (Alfinito et al., 1989); Guma
Dam (Fumanti et al., 1990); Bathurst Falls (Fu-
manti, 1994).
Familia DIADESMIDIACEAE D. G. Mann, 1990
Luticola D. G. Mann in Round et al., 1990
Luticola aequatorialis (Heiden) Lange-Bertalot et
Ohtsuka in Ohtsuka, 2002
Simonsen (1992) PL 56: 8-11
Rumrich et al. (2000) PL 61: 15
Description. Length 16-17 gm; breadth 6.5-7
gm; c. 14 striae in 10 gm (Fig. 131).
Distribution. Bumbuna Falls, rare. First record
for Sierra Leone.
Luticola muticoides (Hustedt) D. G. Mann in
Round et al., 1990
Rumrich et al. (2000) PL 62: 9-12
Synonym: Navicula muticoides Hustedt, 1949
Description. Length 17-18 gm; breadth 8-8.5
gm; 30-32 striae in 10 gm (Figs. 129-130).
Distribution. Peak Bintimani, Bumbuna Falls,
rare. Other records (sub Navicula muticoides Hu-
stedt): Sula Hills (Molder, 1962); River Jong (Car-
ter & Denny, 1982); Lake Mabesi (Carter & Denny,
1987); Guma Dam (Fumanti et al., 1990); Lake
Sonfon, Lake Popei (Carter & Denny, 1992); York
(Alfinito et al., 1994).
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
143
Luticola cf. mutica (Kiitz.) D. G. Mann in Round
et al., 1990
Synonym: Navicula mutica Kiitzing, 1 844
Description. Length 26-31 jam; breadth 8-8.5
gm; 20-22 striae in 10 gm (Fig. 132).
Distribution. Peak Bintimani, Bumbuna Falls,
rare. Other records for L. mutica (Kiitz.) D. G.
Mann (sub Navicula mutica Kiitz.): Sula Hills
(Molder, 1962); River Dankale (Mazzoni, 1986);
Lake Mabesi (Carter & Denny, 1987); Guma Dam
(Fumanti et al., 1990); Lake Sonfon, Lake Popei
(Carter & Denny, 1992).
Luticola cf. muticopsis (Van Heurck) D. G. Mann
in Round et al., 1990
Synonym: Navicula muticopsis Van Heurck, 1909
Description. Length 24-25 gm; breadth 9 gm,
19-20 striae in 10 gm (Figs. 127-128).
Distribution. Peak Bintimani, very rare. Other
records for L. muticopsis (Van Heurck) D. G. Mann:
Kania (Alfmito et al., 1989) sub Navicula muticop-
sis Van Heurck.
Remarks. Luticola muticopsis s. str. is known
from Antarctic and sub- Antarctic regions, not from
tropical zones. Other similar taxa are L. ventricosa
(Kiitzing) D. G. Mann in Round et al., 1990 and L.
ventriconfusa Lange-Bertalot in Lange-Bertalot et
al., 2003, both from Europe and possessing lower
size dimensions (Lange-Bertalot et al., 2003, pp.
72-74, PL 73). The just two specimens observed are
very similar to Luticola species cf. muticopsis in
Rumrich et al. (2000), PI. 61: 9-12.
Luticola cf. terminata (Hustedt) Johansen in Johan-
sen et al., 2004
Description. Length 43-45 gm; breadth 9-9.5
gm; c. 20 striae in 10 gm at the centre and 24-25
towards the apices (Fig. 134).
Distribution. Bumbuna Falls, rare.
Familia MASTOGLOIACEAE Mereschkowsky,
1903
Mastogloia Thwaites in W. Smith, 1856
Mastogloia cf. smithii Thwaites in W. Smith, 1856
Description. Length 37-39 gm; breadth 8-8.5
gm; c. 20 striae in 10 gm (Figs. 139-140).
Distribution. Bumbuna Falls, rare.
Remarks. This is very probably not a homoge-
neous taxon; the common concepts are much too
broad, it needs a fundamental revision.
Familia NEIDI ACE AE Mereschkowsky, 1903
Neidium Pfitzer, 1871
Neidium cf. hercynicum Mayer, 1915 v. hercyni-
cum f. subrostratum Wallace in Reimer, 1959
Description. Length 32-33 gm; breadth 7.5-8
gm; 25-27 striae in 10 gm (Figs. 135-136).
Distribution. Bumbuna Falls, rare. Records for
N. hercynicum Mayer f. subrostratum Wallace:
River Waanje (Carter & Denny, 1987).
FAMILY NOT DESIGNATED
Nupela Vyverman et Compere, 1991
Nupela cf. encyonopsis Metzeltin et Lange-Berta-
lot, 1998
Metzeltin & Lange-Bertalot (1998) PI. 72: 35-37
Description. Length 17 gm; breadth 4 gm;
striae too fine to be resolved by LM (Fig. 67).
Distribution. Bumbuna Falls.
Remarks. As only one specimen was observed,
we were not able to carry out SEM examination.
Nupela cf. vyvermanii Moser, Lange-Bertalot et
Metzeltin, 1998
Moser etal. (1998) PI. 31 : 7-10
Description. Length 14-15 gm; breadth 4-5
gm; c. 30 striae in 10 gm (Figs. 65-66).
144
Silvia Alfinito & Horst Lange-Bertalot
Distribution. Bumbuna Falls, rare.
Remarks. Very rare, only two specimens obser-
ved, SEM examination is needed.
Familia PINNULARIACEAE D. G. Mann, 1990
Pinnularia Ehrenberg, 1843
Pinnularia borealis Ehrenberg, 1 843
Krammer (2000) PI. 7: 6-13
Description. Length 31-32 pm ; breadth 8 pm;
c. 6 striae in 10 pm (Fig. 146).
Distribution. Bumbuna Falls, rare. Other
records: River Dankale (Mazzoni, 1986).
Pinnularia cf. borealis Ehrenberg, 1 843
Description. Length 37-38 pm; breadth 6-7
pm; c. 5 striae in 10 pm (Figs. 147-149).
Distribution. Bumbuna Falls, only two speci-
mens observed.
Pinnularia divergens W. Smith, 1853 v. divergens
sensu lato
Description. Length 50-72 pm; breadth 10-12
pm; c. 10 striae in 10 pm (Fig. 137).
Distribution. Bumbuna Falls, not rare. Other
records: Sula Hills (Molder, 1962); Lake Mabesi
(Carter & Denny, 1987); Lake Popei (Carter &
Denny, 1992).
Pinnularia cf. gibbiformis Krammer, 1992
Description. Length 82 pm; breadth 8,5 pm; c.
11 striae in 10 pm (Fig. 138).
Distribution. Bumbuna Falls, only one speci-
men observed.
Pinnularia cf. graciloides Hustedt, 1937
Description. Length 52-69 pm; breadth 8-10
pm; 12-13 striae in 10 pm (Figs. 141-144; Figs.
150-151; Figs. 152-153).
Distribution. Bumbuna Falls, not common.
Records for P. graciloides Hustedt: Sula Hills
(Molder, 1962); River Jong (Carter & Denny,
1982); Lake Popei (Carter & Denny, 1992).
Pinnularia graphica Carter in Carter & Denny,
1992
Carter & Denny (1992) PL 8: 5
Description. Length 39-50 pm; breadth 5-7
pm; 12-14 striae in 10 pm (Figs. 154-155; Figs.
156-159).
Distribution. Bumbuna Falls, common; Peak
Bintimani, rare. Other records: Lake Sonfon (Carter
& Denny, 1992).
Remarks. Carter in Carter & Denny (1992) de-
scribed this species from a stream entering Lake
Sonfon in S.E. Sector.
Pinnularia cf. stricta Hustedt, 1937
Description. Length 23-27 pm; breadth 5-5.5
pm; 15-16 striae in 10 pm (Fig. 133).
Distribution. Bumbuna Falls, rare.
Familia RHOICOSPHENIACEAE Chen et Zhu,
1983
Rhoicosphenia Grunow, 1860
Rhoicosphenia abbreviata (Agardh) Lange-Berta-
lot, 1980
Krammer & Lange-Bertalot (1986) PI. 91: 20-28
Synonym: R. curvata (Kiitz.) Grunow in Raben-
horst, 1864
Description. Length 26-29 pm. Only seen in
girdle view (Figs. 166-167).
Distribution. Bumbuna Falls, rare. Other
records sub R. curvata (Kiitz.) Grunow: Sula Hills
(Molder, 1962); River Jong (Carter & Denny,
1982); Lake Mabesi (Carter & Denny, 1987).
Familia STAURONEIDACEAE D. G. Mann, 1990
Stauroneis Ehrenberg, 1843
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
145
Stauroneis legumen sensu auct. nonnull, non
S. legumen (Ehr.) Kiitzing, 1 844
Description. Length 52 jam; breadth 13 (am; c.
28 striae in 10 |am (Fig. 145).
Distribution. Only one specimen observed in
Bumbuna Falls samples. Other records for S. legu-
men (Ehr.) Kiitzing: Lake Mabesi (Carter & Denny,
1987).
Stauroneis resoluta Moser, Lange-Bertalot et
Metzeltin, 1998
Moser et al. (1998) PI. 31: 15; PI. 32: 1-6.
Metzeltin & Lange-Bertalot (2002) PI. 46: 6-7
Description. Length 30-35 pm; breadth 7.5-8
pm; c. 28 striae in 10 pm (Figs. 160-165; Figs. 168-
169).
Distribution. Bumbuna Falls, not common.
New record for Sierra Leone.
Remarks. The size range is slightly higher than
that mentioned by Moser et al. (1998).
Familia BACILLAR! ACE AE Ehrenberg, 1840
Nitzschia Hassall 1845
Nitzschia cf. microcephala Grunow in Van Heurck,
1881
Description. Length 11-12 pm; breadth 2.5-3
pm; c. 18 fibulae in 10 pm (Figs. 170-171).
Distribution. Bumbuna Falls, rare. Records for
N. microcephala Grunow in Van Heurck: Sula Hills
(Molder, 1962).
Familia RHOPALODIACEAE (Karsten) Topa-
chevskyi et Oksiyuk, 1 960
Synonym: Epithemiaceae sensu Karsten in Engler
& Prantl, 1928
Epithemia Brebisson ex Kiitzing, 1844
Epithemia adnata (Kiitz.) Brebisson, 1838
Hofmann et al. (2011) PL 119: 5-9
Synonym: Epithemia zebra (Ehr.) Kiitzing, 1 844
Description. Length 49-50 pm; breadth 8-10
pm; striae 13-15 in 10 pm and 3. 5 -4. 5 transapical
ribs in 10 pm (Fig. 173).
Distribution. Bumbuna Falls, rare. Other
records: Lake Sonfon (Carter & Denny, 1992)
sub Epithemia zebra (Ehr.) Kiitzing.
Epithemia sorex Kiitzing, 1 844
Hofmann et al. (2011) PL 121: 1-7
Description. Length 30 pm; breadth 8.5 pm; c.
14 striae in 10 pm and c. 8 transapical ribs in 10 pm
(Fig. 172).
Distribution. Bumbuna Falls, only one speci-
men observed. New record for Sierra Leone.
Familia SURIRELLACEAE Kiitzing, 1844
Stenopterobia Brebisson ex Van Heurck, 1896
Stenopterobia cf. delicatissima (Lewis) Brebisson
ex Van Heurck, 1896
Krammer & Lange-Bertalot (1988) PL 174: 1-12
Metzeltin & Lange-Bertalot (2002) PL 86: 3-4
Synonym: Surirella delicatissima Lewis, 1864
Description. Length 38-76 pm; breadth 4-5
pm; c. 28-30 striae in 10 pm (Figs. 174-177; Figs.
178-180).
Distribution. Peak Bintimani, rare; Bumbuna
Falls, quite frequent. Other records: Kangari Sula
(Molder, 1962), River Jong (Carter & Denny,
1982), Carter & Denny, 1987 (without localities),
Guma Dam (Fumanti et al., 1990), Lake Sonfon,
Lake Popei (Carter & Denny, 1992) sub Surirella
delicatissima Lewis; Bathurst Falls (Fumanti,
1994).
Surirella Turpin, 1828
Surirella linearis W. Smith, 1853 v. constricta
Grunow, 1862
146
Silvia Alfinito & Horst Lange-Bertalot
Huber-Pestalozzi (1942) Fig. 602 c
Description. Length 71-73 pm; breadth 16-17
pm; c. 25-26 alar canals in 100 gm (Figs. 181-183;
Figs. 184-185).
Distribution. Bumbuna Falls, not common.
Other records: Kangari Sula (Molder, 1962); River
Jong (Carter & Denny, 1982); River Dankale (Maz-
zoni, 1986); Lake Mabesi (Carter & Denny, 1987);
Lake Sonfon (Carter & Denny, 1992).
Remarks. It is not unlikely that this African
population is heterospecific vs. holarctic S. linea-
ris (compare Werum & Lange-Bertalot, 2004, Pis.
98-99).
TAXONOMICAL AND BIOGEOGRAPHIC
CONCLUSION
During the present study a total of 65 taxa, be-
loging to 31 genera, were identified. Of these, 12
are reported for the first time in Sierra Leone. Con-
sidering the two sites, Bumbuna Falls is signifi-
cantly richer, with 58 taxa, while diversity in the
samples from Peak Bintimani is much lower, with
only 22 Taxa. Numerous dubious holarctic taxa,
marked with cf. that need further SEM observa-
tions, are very probably new to science.
It is a matter of fact that in tropical regions not
only the vascular plants but likewise the diatom
flora of higher mountains differs fundamentally
from that of plains and lower to medium altitude
mountain ranges. This was shown for instance for
the Neotropics in a strict sense in comparison to the
High Andes (Metzeltin & Lange-Bertalot, 1998;
2007; Rumrich et al., 2000). In West Africa, be-
longing to the Paleotropics, the situation is as yet
less well known. In particular a critical analysis of
diatom records for the highlands is necessary here.
Checklists of various authors (Woodhead & Tweed,
1958; Alfinito, 2011) record numerous taxa com-
monly known from Holartic regions of Eurasia and
North America, together with a minor number of
geographically restricted West African taxa which
were described during later decades of the 20th
century, mainly by Carter & Denny (1982; 1987;
1992). Some others have been noted which were
described originally from subtropical areas of South
Africa by Cholnoky (e.g. 1957; 1958; 1960; 1962;
1966). Whilst occurrence of African indigenous
taxa is widely incontestable mainly identifications
as Holarctic species appear doubtful and need a
critical revision. Since description of new taxa is
not the aim of this preliminary paper such dubious
Holarctic species, suspected to be new to science,
are noted here as “cf.” (species to compare to) ex-
pecting a differential diagnosis later on. Appropriate
examples are the illustrated species (LM and SEM)
of the genera Frustulia and Brachysira that roughly
resemble “prominent” Holarctic species concerning
valve outlines and size dimensions but clearly differ
when the entire set of morphological characters is
compared (see Figs. 65-91 and 111-126).
Without doubt, cosmopolitan taxa do exist, par-
ticularly in intermittently dry/wet habitats as rock-
pools. Common examples are Orthoseira roeseana,
Achnanthes inflata , Pinnularia borealis sensu lato,
Luticola spp. or halophilous taxa like Ctenophora
pulchella. Moreover, the true identity of rarely oc-
curring Epithemia adnata , E. sorex or Cocconeis
pediculus is barely questionable. However, a ma-
jority of the frequent and / or abundant diatoms is
as yet unknown; many may represent “elements”
either of the tropical African flora or of the
Paleotropics more generally, both insufficiently in-
vestigated up to recently. Frustulia cf. undosa
(Figs. 119 - 126) appears rather closely related to
that Neotropical taxon. It is an example among
few other ones which shows more or less resem-
blance to “sister taxa” from the Neotropics. Cym-
bella kappii, originally widespread only in Africa
could be observed later on likewise in a lake of
Bosnia, the Balkans (Krammer, 2002, p. 71).
Actinella brasiliensis may serve as an example
for a Pantropical taxon of the Eunotiaceae but it has
to be taken into consideration that a heterogeneous
species complex is concerned in this case including
the questionable variety sierra-leonensis Woodhead
et Tweed, 1957.
The majority of the observed Eunotia species of
the investigated montaneous areas of Sierra Leone
seem to be undescribed from elsewhere. They may
represent endemicities of tropical Africa or prove
as more widespread taxa of the Paleotropics, pro-
vided that more detailed knowledge can be achieved
in the future from this, specifically for diatoms,
widely neglected plant realm.
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
147
Figures 1-13. LM: xl500. Fig. 1: Aulacoseira granulata v. valida. Figs. 2, 3: Orthoseira roeseana. Figs. 4-6: Cyclotella me-
neghiniana. Figs. 5, 6: idem, SEM, valve outside (5: scale bar = 2 gm; 6: scale bar = 1 gm). Figs. 7-9: Ctenophora pulchella.
Fig. 10: Staurosira construens. Fig. 11: Staurosira cf. longirostris. Fig. 12: Staurosira venter. Fig. 13: Fragilaria cf. javanica.
148
Silvia Alfinito & Horst Lange-Bertalot
Figures 14-27. LM: xl500; SEM: Figs. 22-24 scale bar = 2 gm. Fig. 14: Ulnaria cf. ulna. Fig. 15: Eunotia rabenhorstii v.
triodon. Figs. 16, 17: E. cf. cristagalli and cf. tecta. Figs. 18-24: E. rhomboidea (Figs. 22, 23 valve outside; Fig. 24 valve
inside). Figs. 25-26: E. cf. minor. Fig. 27: E. vumbae.
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
149
Figures 28-35. LM: xl500. SEM: Fig. 32 scale bar = 2 gm; Fig. 34 scale bar = 5 gm; Fig. 33 scale bar = 1 gm. Figs. 28-
34: Eunotia naegelii (Figs. 32, 34 valve inside; Fig. 33 valve outside). Fig. 35: E. rabenhorstiana.
150
Silvia Alfinito & Horst Lange-Bertalot
Figures 36-39. LM: Fig. 36 xlOOO; Fig. 37 xl500; SEM: Fig. 38 scale bar = 10 gm; Fig. 39 scale bar= 5 gm. Figs. 36-
39: Actinella brasiliensis (Figs. 38, 39 valve outside).
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
151
Figures 40, 41 . Actinella brasiliensis, valve outside, SEM, scale bar = 5 jim.
152
Silvia Alfinito & Horst Lange-Bertalot
Figures 42-51. LM: xl500; SEM: scale bar = 2 pm. Figs. 42-46: Eunotia cf. crassula. Figs. 47, 48: Achnanthidium taia-
ense. Figs. 49, 50, idem, possible post-initial cell. Fig. 51 : Actinella brasiliensis, valve inside.
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
153
Figures 52-57. LM: xl500; SEM: Fig 55 scale bar = 5 pm; Fig. 56 scale bar = 2 pm; Fig. 57 scale bar = 1 |im. Figs. 52-
57: Achnanthidium subhudsonis. Fig. 55: rapheless valve outside. Figs. 56-57: raphe valve outside.
154
Silvia Alfinito & Horst Lange-Bertalot
Figures 58-64. LM: xl500; SEM: Fig. 58 scale bar = 2 pm; Fig. 59 scale bar = 1 pm; Fig. 64 scale bar = 5 gm. Figs. 58,
59: Achnanthidium subhudsonis (Fig. 58: rapheless valve outside; Fig. 59: raphe valve outside). Fig. 60: Cocconeis pediculus.
Fig. 61: Cocconeis placentula. Figs. 62-64: Achnanthes inflata. (Fig. 64: rapheless valve inside).
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
155
Figures 65-74. LM: xl500; SEM: scale bar = 5 |im. Figs. 65, 66: Nupela cf. vyvermanii. Fig. 67: Nupela cf. encyonopsis.
Figs. 68-74: Brachysira cf. brebissonii (Figs. 72-74: valve outside).
156
Silvia Alfinito & Horst Lange-Bertalot
77
Figures 75-78. LM: xl500; SEM: scale bar = 5 |im. Fig. 75: Brachysira cf. brebissonii, valve inside. Figs. 76-78: Bra-
chysira cf. metzeltinii (Fig. 78: valve inside).
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
157
Figures 79-83. LM:xl500; SEM: scale bar = 10 gm. Figs. 79-83: Brachysira cf. wygaschii (Fig. 83: valve outside)
158
Silvia Alfinito & Horst Lange-Bertalot
84-86
Figures 84-86. SEM: Fig. 84 scale bar =10 gm; Fig. 85 scale bar = 2 (am; Fig. 86 scale bar = 1 jam. Figs. 84-86: Brachy-
sira cf. wygaschii, valve outside.
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
159
Figures 87-88. SEM: Fig. 87 scale bar = 5 |im; Fig. 88 scale bar = 2 |im. Figs. 87, 88: Brachysira cf. wygaschii, valve
outside.
160
Silvia Alfinito & Horst Lange-Bertalot
Figures 89-91. SEM: Fig. 89 scale bar = 5 |im; Figs. 90, 91 scale bar = 2 gm. Figs. 89-91: Brachysira cf. wygaschii,
valve inside.
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
161
Figures 92-110. LM: xl500. Figs. 92-95: Cymbella kappii. Fig. 96: Encyonema neomesianum. Fig. 97: E. neogracile var.
tenuipunctata. Figs. 98-101: E. cf. auerswaldii. Fig. 102: E. cf. javanicum. Fig. 103: Encyonopsis cf. schubartii. Fig. 104:
Encyonema cf. ventricosum. Fig. 105: Encyonema cf. subelginense. Fig. 106: Elalamphora veneta. Fig. 107: Kobayasiella
cf. subtilissima. Fig. 108: Gomphonema cf. lagenula. Figs. 109-110: G. pseudo augur.
162
Silvia Alfinito & Horst Lange-Bertalot
Figures 111-114. LM: xl500; SEM: Fig. 1 12 scale bar = 10 jam; Fig. 113 scale bar = 5 gm; Fig. 114 scale bar = 2 gm.
Figs. 111-114: Frustulia cf. saxonica (Figs. 112-114: valve outside).
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
163
Figures 115-118. LM:xl500; SEM: Fig.
lia cf.
116 scale bar = 10 gm; Figs. 117, 1 1 8 scale bar = 2 gm. Figs. 115-118: Frustu-
crassinervia (Figs. 116-118: valve inside).
164
Silvia Alfinito & Horst Lange-Bertalot
Figures 119-123. LM: xl500; SEM: Fig. 121 scale bar = 10 jim; Figs. 122, 123 scale bar = 2 |im. Figs. 119-123: Frustu-
lia cf. undosa (Figs. 121-123: valve inside).
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
165
Figures 124-126. SEM: Fig. 124 scale bar = 5 gm; Figs. 125, 126 scale bar = 2 gm. Figs. 124-126: Frustulia cf. undosa,
valve outside.
166
Silvia Alfinito & Horst Lange-Bertalot
Figs. 127-140. LM: xl500. Figs. 127, 128: Luticola cf. muticopsis. Figs. 129, 130: Luticola muticoides. Fig. 131: L. ae-
quatorialis. Fig. 132: L. cf. mutica. Fig. 133: Pinnularia cf. stricta. Fig. 134: Luticola cf. terminata. Figs. 135, 136: Neidium
cf. hercynicum v. hercynicum f. subrostratum. Fig. 137: Pinnularia divergens v. divergens sensu lato. Fig. 138: P. cf. gibbi-
formis. Figs. 139, 140: Mastogloia cf. smithii.
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
167
Figures 141-149. LM: xl500. Figs. 141-144: Pinnularia cf. graciloides. Fig. 145: Stauroneis legumen sensu auct. non-
null., non S. legumen (Ehr.) Kiitzing, 1844. Fig. 146: Pinnularia borealis. Figs. 147-149: P. cf. borealis.
168
Silvia Alfinito & Horst Lange-Bertalot
Figures 150, 151. SEM: Fig. 150 scale bar =10 |im; Fig. 151 scale bar = 2 |im. Figs. 150, 151: Pinnularia cf. graciloi-
des , valve outside.
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
169
Figures 152-155. LM: xl500; SEM: Figs. 152, 153 scale bar = 2 gm; Fig. 155 scale bar = 10 gm. Figs. 152, 153: Pinnu-
laria cf. graciloides, valve outside. Figs. 154, 155: P. graphica (Fig. 155: valve outside).
170
Silvia Alfinito & Horst Lange-Bertalot
Figures 156-159. SEM: Figs 156, 158, 159 scale bar = 2 |im; Fig.
phica (Figs. 156-158: valve outside;
157 scale bar = 1 |im. Figs. 156-159: Pinnularia gra-
Fig. 159: valve inside).
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
171
Figures 164-167. LM: xl500; SEM: Fig. 163 scale bar = 10 |im; Figs. 164, 165 scale bar = 1 |im. Figs. 160-165: Stauro-
neis resoluta (Figs. 163, 164: valve outside; Fig. 165: valve inside). Figs. 166, 167: Rhoicosphenia abbreviata.
172
Silvia Alfinito & Horst Lange-Bertalot
Figures 168, 173. LM: xl500; SEM: Fig. 168 scale bar = 2 gm; Fig. 169 scale bar = 5 |im. Figs. 168, 169: Stauroneis re-
soluta (Fig. 168: valve outside; Fig. 169: valve inside). Figs. 170, 171: Nitzschia cf. microcephala. Fig. 172: Epithemia
sorex. Fig. 173: E. adnata.
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
173
Figures 174-177. LM: xl500; SEM: Fig. 176: scale bar 5 |im; Fig. 177: scale bar = 2 |im. Figs. 174-177: Stenopterobia
cf. delicatissima (Fig. 176 left: valve outside; Fig. 176 right: valve inside; Fig. 177: valve inside).
174
Silvia Alfinito & Horst Lange-Bertalot
Figures 178-180. SEM: Fig. 178: scale bar = 2 |im; Figs. 179, 180: scale bar = l|im. Figs. 178-180: Stenopterobia cf. de-
licatissima (Figs. 178, 179: valve outside; Fig. 180 valve inside).
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
175
Figures 181-183. LM: xl500; SEM: Fig. 182: scale bar = 10 jim; Fig. 183: scale bar = 2 gm. Figs. 181-183: Surirella li-
nearis v. constricta; Figs. 182, 183: valve outside.
176
Silvia Alfinito & Horst Lange-Bertalot
Figures 184-185. SEM. Fig. 184. scale bar = 20 |im; Fig. 185: scale bar = 5 |im. Figs. 184, 185: Surirella linearis v. con-
strict a, valve outside.
Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls
177
REFERENCES
Alfmito S., 20 1 1 . A check list of the freshwater algal flora
of Sierra Leone, Tropical West Africa. I. Cyanophy-
ceae to Conjugatophyceae (exclusive of Bacillario-
phyceae). Biodiversity Journal, 2: 121-144.
Alfinito S., Fumanti B. & Ricci S., 1989. Freshwater
algae from Kania (Sierra Leone, West Tropical
Africa). Ri vista di Idrobiologia, 28: 167-178.
Alfinito S., Fumanti B. & Ricci S., 1994. Diatoms from
York, Sierra Leone (West Africa). Quademi Accade-
mia Nazionale dei Lincei, 267: 65-79.
Anonymous, 1975. Proposals for a standardization of
diatom terminology and diagnoses. Beihefte zur
Nova Hedwigia, 53: 323-354.
Carter J.R. & Denny P., 1982. Freshwater algae of Sierra
Leone IV. Bacillariophyceae; Part (i) diatoms from
the river Jong (Taia) at Njala. Beihefte zur Nova
Hedwigia, 73: 281-331.
Carter J.R. & Denny P, 1987. Freshwater algae of Sierra
Leone IV. Bacillariophyceae; Part (ii) diatoms from
the coastal region of the southern province. Nova
Hedwigia, 44: 229-275.
Carter J.R. & Denny P, 1992. Freshwater algae of Sierra
Leone IV. Bacillariophyceae; Part (iii) diatoms from
the lake Sonfon region and from Lake Popei. Nova
Hedwigia, 54: 159-211.
Cholnoky B.J., 1954. Diatomeen aus Sud-Rhodesien.
Portugaliae Acta Biologica (B), 4: 197-226.
Cholnoky B.J., 1957. Beitrage zur Kenntnis der Sudafri-
kanischen Diatomeenflora. Portugaliae Acta Biolo-
gica (B), 6: 53-93.
Cholnoky B.J., 1958. Beitrage zur Kenntnis der Sudafri-
kanischen Diatomeenflora II. Einige Gewasser im
Waterberg-Gebiet, Transvaal. Portugaliae Acta Bio-
logica (B), 6: 99-160.
Cholnoky B.J., 1960. Beitrage zur Kenntnis der Diato-
meenflora von Natal. Nova Hedwigia, 2: 1-128.
Cholnoky B.J., 1962. Beitrage zur Kenntnis der Sudafri-
kanischen Diatomeenflora III. Diatomeen aus der
Kaap-Provinz. Revista de Biologia, 3: 1-80.
Cholnoky B.J., 1966. Die Diatomeen im Unterlaufe des
Okawango-Flusses. Nova Hedwigia Beihefte, 21:
1 - 120 .
Compere P, 1991. Contribution a F etude des algues du
Senegal. 1. Algues du lac de Guiers et du Bas-Sene-
gal. Bulletin du Jardin Botanique Nationale de Bel-
gique, 61: 171-267.
Compere P. & Riaux-Gobin C., 2009. Diatomees de quel-
ques biotopes marins, saumatres et dulgaquicoles de
Guinee (Afrique occidentale). Systematics and Geo-
graphy of Plants, 79: 33-66.
Foged N., 1966. Freshwater diatoms from Ghana. Bio-
logiske Skrifter Det Kongelige Danske Videnskaber-
nes Selskab, 15: 1-169 + 25 Pis.
Foged N., 1986. Diatoms in Gambia. Bibliotheca Diato-
mologia, 12: 1-153.
Frenguelli J., 1941. XVI Contribucion al conocimiento
de las diatomeas argentinas. Diatomeas del Rio de la
Plata. Revista del Museo de la Plata (n.s.) 3, Botanica
15: 213- 334.
Fumanti B., 1994. Freshwater algae from Sierra Leone:
diatoms from Bathurst Falls (Western Area). Qua-
derni Accademia Nazionale dei Lincei, 267: 51-64.
Fumanti B., Ricci S. & Alfinito S., 1990. Freshwater algae
from Sierra Leone: Diatoms from Guma Valley. Qua-
derni Accademia Nazionale dei Lincei, 265: 27-47.
Hofmann G., Werum M. & Lange-Bertalot H., 2011. Dia-
tomeen im Siisswasser-Benthos von Mitteleuropa. A.
R.G. Gantner Verlag K.G., 908 pp.
Huber-Pestalozzi G., 1942. Das Phytoplankton des Siis-
swassers, Systematik und Biologie. 2 Teil, 2 Halfte,
Diatomeen. In: Die Binnengewasser, Band 16: 367-
549. Schweizerbarf sche Verlagsbuchhandlung.
Stuttgart.
Krammer K., 1997. Die cymbelloiden Diatomeen. Eine
Monographic der weltweit bekannten Taxa. Teil 1 .
Allgemeines un Encyonema Part. Bibliotheca Diato-
mologica, 36: 1-382.
Krammer K., 2000. The genus Pinnularia. Diatoms of
Europe, 1: 1-703.
Krammer K., 2002. Cymbella. Diatoms of Europe 3: 1-584.
Krammer K. & Lange-Bertalot H., 1986. Bacillariophy-
ceae. 1. Teil: Naviculaceae. In: Ettl H., Gerloff J., Hey-
nig H. & Mollenhaurer D. (Eds.), Susswasserflora von
Mitteleuropa, Band 2/1. VEB G. Fischer. Jena. 876 pp.
Krammer K. & Lange-Bertalot H., 1988. Bacillariophy-
ceae. 2. Teil: Bacillariaceae, Epithemiaceae, Surirel-
laceae. In: Ettl H., Gerloff J., Heynig H. &
Mollenhaurer D. (Eds.), Susswasserflora von Mitte-
leuropa, Band 2/2. VEB G. Fischer. Jena, 596 pp.
Krammer K. & Lange-Bertalot H., 1991a. Bacillariophy-
ceae. 3. Teil: Centrales, Fragilariaceae, Eunotiaceae.
In: Ettl H., Gerloff J., Heynig H. & Mollenhaurer D.,
Susswasserflora von Mitteleuropa, Band 2/3. VEB G.
Fischer. Jena, 576 pp.
Krammer K. & Lange-Bertalot H., 1991b. Bacillariophy-
ceae. 4. Teil: Achnanthaceae, Kritische Erganzungen
zu Navicula (Lineolatae) und Gomphonema Gesam-
tliteraturverzeichnis Teil 1-4. In: Ettl H., Gerloff J.,
Heynig H. & Mollenhaurer D. (Eds.), Susswasserflora
von Mitteleuropa, Band 2/4. VEB G. Fischer. Jena,
437 pp.
Krammer K. & Lange-Bertalot H., 2000. Bacillariophy-
ceae. Part 5: English and French translation of the
keys. In: Biidel B., Gartner G., Krienitz L. & Lo-
khorst G.M. (Eds.), Susswasserflora von Mitteleu-
ropa, Band 2/5. Spektrum Akademischer Verlag
Heidelberg. Berlin.
178
Silvia Alfinito & Horst Lange-Bertalot
Kulikovskiy M., Lange-Bertalot H., Metzeltin D. & Wit-
kowski A., 2012. Lake Baikal: hotspot of endemic
diatoms. Iconographia Diatomologica, 23: 1-607.
Lange-Bertalot H. & Krammer K., 1989. Achnanthes
eine Monographic der Gattung. Bibliotheca Diato-
mologica, 18: 1-393.
Lange-Bertalot H. & Metzeltin D., 1996. Indicators of
Oligotrophy. 800 taxa representative of three ecolo-
gically distinct lake types. Iconographia Diatomolo-
gica, 2: 1-390.
Lange-Bertalot H. & Moser G., 1994. Brachysira. Mo-
nographic der Gattung. Bibliotheca Diatomologica,
29: 1-212.
Lange-Bertalot H., Bak M. & Witkowski A., 2011. Eu-
notia and related genera. Diatoms of Europe, 6: 1-
908.
Lange-Bertalot EL, Cavacini P., Tagliaventi N. & Alfinito
S., 2003. Diatoms of Sardinia. Rare an 76 new spe-
cies in rock pools and other ephemeral waters. Ico-
nographia Diatomologica, 12: 1-438.
Mazzoni A., 1986. Freshwater diatoms from Dankale
River (Sierra Leone). Quaderni Accademia Nazionale
dei Lincei, 260: 105-119.
Metzeltin D. & Lange-Bertalot EL, 1998. Tropical Dia-
toms of South America I. About 700 predominantly
rarely known or new taxa representative of the neo-
tropical flora. Iconographia Diatomologica, 5: 1-695.
Metzeltin D. & Lange-Bertalot H., 2002. Diatoms from
the “Island Continent’ ’ Madagascar. Iconographia
Diatomologica, 11: 1-286.
Metzeltin D. & Lange-Bertalot EL, 2007. Tropical Dia-
toms of South America II. Special remarks on bio-
geographic disjunction. Iconographia Diatomologica,
18: 1-877.
Metzeltin D., Lange-Bertalot H. & Garcia-Rodriguez F.,
2005. Diatoms of Uruguay, compared with other taxa
from South America and elsewhere. Iconographia
Diatomologica, 15: 1-736.
Molder K., 1962. Diatomeen aus den Gebirgen Sula und
Kangari in Sierra Leone, Westafrika. Bulletin de la
Commission Geologique de Finlande, 198: 7-48.
Moser G., Lange-Bertalot H. & Metzeltin D., 1998. Insel
der Endemiten. Geobotanisches Phanomen Neukale-
donien. Bibliotheca Diatomologica, 38: 1-464.
Reichardt E., 1999. Zur Revision der Gattung Gompho-
nema. Die Arten um G. affine/ ins igne, G. angusta-
tum/micropus, G. acuminatum sowie gomphonemoide
Diatomeen aus dem Oberoligozan in Bohmen. Icono-
graphia Diatomologica, 8: 1-203.
Round F., Crawford R. & Mann D., 1990. The Diatoms.
Biology & morphology of the genera. Cambridge
University Press, 747 pp.
Rumrich U., Lange-Bertalot H. & Rumrich M., 2000.
Diatoms of the Andes. From Venezuela to Patago-
nia/Tierra del Fuego. Iconographia Diatomologica, 9:
1-673.
Sar E., Sala S., Sunesen I., Henninger M. & Montastruc
M., 2009. Catalogue of the genera, species, and in-
fraspecific taxa erected by J. Frenguelli. Diatom Mo-
nograph, 10: 419 pp.
Simonsen R., 1979. The diatom system: ideas on phylo-
geny. Bacillaria, 2: 9-71.
Simonsen R., 1987. Atlas and Catalogue of the Diatom
Types of Friedrich Hustedt. Vol. I, II, III. J. Cramer,
Berlin, Stuttgart. 525 pp. + 772 pis.
Simonsen R., 1992. The diatom types of Heinrich Heiden
in Heiden & Kolbe, 1928. Bibliotheca Diatomolo-
gica, 24: 1-100 + 86 plates.
Werum M. & Lange-Bertalot H., 2004. Diatoms in
Springs from Central Europe and elsewhere under the
influence of hydrogeology and anthropogenic im-
pacts. Iconographia Diatomologica 13: 1-479.
WoodheadN. & Tweed R.D., 1958. A check list of tropi-
cal West African Algae. Hydrobiologia, 11: 299-395.
Zanon V., 1941. Diatomee delT Africa Occidentale Fran-
cese. Commentationes Pontificia Academia Scientia-
rum, 5: 1-60.
Biodiversity Journal, 2013, 4 (1): 179-182
Ascalaphus festivus (Rambur, 1 842) in Sardinia, a new genus of
Ascalaphidae for Europe (Neuroptera)
Roberto A. Pantaleoni 1,2 *, Davide Badano 1,2,6 , Ulrike Aspock 3 ’ 4 & Horst Aspock 5
1 Istituto per lo Studio degli Ecosistemi, Consiglio Nazionale delle Ricerche (ISE-CNR), Traversa la Crucca 3, Regione Baldinca,
07100 Li Punti (SS), Italy; e-mail: r.pantaleoni@ise. cm.it
2 Dipartimento di Agraria, Entomologia, Universita degli Studi di Sassari, Via Enrico de Nicola, 07100 Sassari, Italy; e-mail:
[email protected]
3 Natural History Museum, Vienna, Entomology, Burgring 7, A-1010 Vienna, Austria; e-mail: ulrike. [email protected]. at
4 University of Vienna, Department of Integrative Zoology, Althanstr. 14, A-1090 Vienna, Austria
institute of Specific Prophylaxis and Tropical Medicine, Medical Parasitology, Medical University of Vienna, Kinderspitalgasse
15, A-1095 Vienna, Austria; e-mail: [email protected]
6 Actual address: [email protected]
’Corresponding author
ABSTRACT Ascalaphus festivus (Rambur, 1 842), a widespread polytypic species in Africa and Middle
East, was collected for the first time in southern Sardinia in the 1990s in two independent oc-
casions. Subsequent specific surveys proved the existence of a stable breeding population in
at least one coastal locality of Sardinia, thus allowing to fully consider this genus a member
of the European fauna.
KEY WORDS Faunistic; Biogeography; Mediterranean; Owl-flies.
Received 6.11.2012; accepted 18.1.2013; printed 30.03.2013
The European Ascalaphidae are usually con-
sidered to be well known, at least from a faunistic
point of view (Aspock H. et al., 1980). Therefore it
was very unexpected when several years ago three
of us (R.A.R, H.A., and U.A.) independently and
almost simultaneously received two specimens of a
species belonging to the genus Ascalaphus Fabri-
cius, 1775, collected in two localities (su Feraxi:
Muravera and Porto Pino: Sant’ Anna Arresi) in Sar-
dinia (Italy) (Fig. 1). V. Haeseler found a specimen
in Porto Pino in 1994 which he gave to H.A. a few
years later. Moreover, a second specimen, commu-
nicated to R.A.P., was collected near Muravera in
1999 during a sampling carried out by a team of or-
thopterists led by Paolo Fontana (then University
of Padua). These were the first records of Asca-
laphus in Europe. Due to the importance of the
findings, extensive and accurate field research was
repeatedly performed in su Feraxi: Muravera be-
tween 1999 and 2004 by R.A.P. and in 2005 by
R.A.P., H.A. & U.A., although no other specimen
of this interesting species was further observed in
this locality. Instead a specific survey conducted in
2005 in Porto Pino, successfully verified the actual
presence of this owl-fly in Southern Sardinia.
In the following years, 2007 and 2009 respec-
tively, subsequent field research conducted in the
same area confirmed again the existence of a stable
breeding population in Sardinia and dismissed the
hypothesis of the arrival of single specimens there
by wind dispersal from Tunisia, where the genus is
known (Aspock H. et al., 2001; Giisten, 2003).
In both the Sardinian sites, the owl-flies were
observed in coastal salt-marshes in back dunal en-
180
R.A. Pantaleoni, D. Badano, U. Aspock & H. Aspock
vironment with luxuriant Juncus vegetation. Almost
all the specimens were collected with an entomolo-
gical net; light trapping does not seem to be parti-
cularly effective on this species.
List of known specimens from Sardinia
DATA LABELS
ITALY: S-Sardinien, 15 km W Teluada:
Salz-wiesen bei Pto. Pino, 24.9.1994, Haeseler, 1
female (H. Aspock & U. Aspock coll.); Stagno d.
Leraxi-S // 8-VIII-1999-2 // UTM 05515/43529 //
leg. R. Kleukers, 1 female (R. A. Pantaleoni coll.);
S. A. Arresi: Porto Pino (CA) // 25.VIII.2005 R.
A. Pantaleoni legit, 1 female (R. A. Pantaleoni
coll.); Italia, Sardinia, Porto Pino, SAR 05/5,
25.8.2005, A. Molinuleg., 1 female (NHM Vienna
coll.); Italia, Sardinia, Porto Pino, SAR 05/5,
25.8.2005, A. Molinu leg. 1 male (H. Aspock &
U. Aspock coll.); S. A. Arresi: Porto Pino (CA) //
alia luce (at light) 29.VIII.2005 A. Sassu legit, 1
male (R. A. Pantaleoni coll.); Sardegna, Porto
Pino, 29. VIII. 2005, A. Molinu leg. 1 male (H.
Aspock & U. Aspock coll.); S. A. Arresi: Porto
Pino (CA) // retroduna (back dune) 30. VIII. 2005
A. Molinu legit, 1 male (R. A. Pantaleoni coll.);
Italia, Sardinia, Porto Pino, SAR 05/ 6, 26.8. -30.8.
2005, H. & U. Aspock leg., 2 males (H. Aspock &
U. Aspock coll, and NHM Vienna coll.) Sant’ Anna
Arresi: Porto Pino (CA) // 28.VIII.2007 A. Molinu
legit, 1 male 1 female (R. A. Pantaleoni coll.);
IT - SARDEGNA - Sant’ Anna Arresi: Porto Pino
// 2. IX. 2009 R. A. Pantaleoni, D. Badano, A. Le-
tardi legit, 1 female (D. Badano coll.).
According to the present sense, the genus Asca-
laphus comprises over fifteen species from Africa
and Asia, five of which are reported from North
Africa and Middle East in areas still included in the
Western Palearctic biogeographic region (Aspock
H. et al., 2001). However, this taxon is in need of
revision and it is possible that a split into different
genera will necessarily result. In any case, the
genus was previously unknown from the Northern
coasts of the Mediterranean Sea. The Sardinian spe-
cimens coincide largely with A. festivus (Rambur,
1842) (Fig. 2), a polytypic species reported from al-
most all of the African continent, including Mada-
gascar, the Middle East (Israel, Saudi Arabia and
Oman) and the Cape Verde Islands. Nevertheless,
the exact distribution of this species now appears
to be uncertain and in need of confirmation due to
the complex taxonomic history of this taxon. Origi-
nally, van der Weele (1907; 1909) considered it a
single, very variable and widespread species, after-
wards Kimmins (1949) demonstrated the presence
of several, previously confused, related African
species; this was also confirmed by Tjeder (1980)
and Prost (2011).
For definite clarification, a revision of A. festi-
vus in the present sense from various ecologically
different areas is necessary. The Sardinian popula-
tions are apparently confined to salt-marshes with
Juncus vegetation (Fig. 3), while in Africa it is
mainly recorded in savannah-like biotopes. The
species is very difficult to detect in the field: the
adults are present for few weeks at the end of sum-
mer and are markedly crepuscular, being observed
only for a brief period during sunset, moreover
they are seldom attracted to light. Exceptionally the
specimen collected in Muravera was observed
flying with two other individuals at midday with a
very hot and dark cloudy weather (Fontana, pers.
comm.). It is worth noting that these reports repre-
sent the most remarkable discovery of the Euro-
pean Ascalaphidae since the description of
Bubopsis andromache Aspock U., Aspock H. et
Holzel, 1979 and the rediscovery of Puer macula-
tus (Olivier, 1789) in the 1980s (Aspock U. &
Aspock H., 1987).
ACKNOWLEDGEMENTS
Grateful thanks to Prof. Dr. Volker Haeseler
(University Oldenburg, Germany), Dr. Roy Kleu-
kers (European Invertebrate Survey - The Nether-
lands / Naturalis Biodiversity Center Leiden,
Holland), Dr. Baudewijn Ode (Amsterdam, Hol-
land) and Dr. Paolo Fontana (Fondazione Edmund
Mach, Casalino di Pergine Valsugana, Italy) who
found the first two specimens and initiated field
work and the clarification of the occurrence of
Ascalaphus in Europe several years later. Special
thanks are due to Alessandro Molinu, Antonio
Sassu and Agostino Letardi for their participation
in the field research, Bruno Michel for interesting
discussions on African Ascalaphidae and Andre
Prost for precious suggestions. Finally we thank Dr.
John Plant (Vienna) for the linguistic improvement.
Ascalaphus festivus (Rambur, 1842) in Sardinia, a new genus of Ascalaphidae for Europe (Neuroptera)
181
L’ESTATK 2009
VIII i.'CMom; sarim
Cultura
In roostwalsili
I sonza terra
di Salgado
Alla ricerca
dell’ Ascalaphus
Gli entomotogi setaedano Porto Pino dopo
I'awRlamenlo di un msetto afroasiatico
mai sbarcato prima in Europa
Jntarno dai bosdto del Genrwgentu safcano
fuori due edeotteri sconosdub
Gli esperti: negli ullimi diea anni
in Sardegna sono stati scopeft,
annualmente, in media died insetti nuovi
mai pcima desoirt e nominaji dagli
studiosi, e c> ancora lanto da esplorare
Figures 1-4. Ascalaphus festivus (Rambur, 1842). Fig. 1: Localities of Sardinia (Italy) where the species has been recorded:
Porto Pino, Sant’Anna Arresi (south-west coast) and su Feraxi, Muravera (east coast). Fig. 2: Habitus of a male specimen
(Porto Pino, Sant’Anna Arresi, Sardinia, Italy), photo Davide Badano/ISE CNR. Fig. 3: Female specimen resting on a
Juncus twig in its natural environment, a coastal salt marsh, at sunset (Porto Pino, Sant’Anna Arresi, Sardinia, Italy), photo
Alessandro Molinu/ISE CNR. Fig. 4: Local newspaper (L’Unione Sarda, Cagliari) reporting the presence of the species in
Southern Sardinia, published on occasion of the 2009 expedition conducted by R. A. Pantaleoni, D. Badano and A. Letardi.
182
R.A. Pantaleoni, D. Badano, U. Aspock & H. Aspock
Notice
The finding of Ascalaphus in Sardinia was the
subject of an official press release of the National
Research Council (CNR) picked up by some major
Italian news-agencies in October 2005. As a result,
the news appeared many times in newspapers (Fig.
4), magazines and web (Pantaleoni, 2005). The first
scientific communication on this topic was a poster
exposed during the XI International Symposium on
Neuropterology in 2011 mentioned in the index of
the “Book of Abstracts” and in few cases cited as
Pantaleoni et al. (2011). However, this note is the
first complete, technical article published on the
presence of Ascalaphus in Sardinia.
REFERENCES
Aspock H., Aspock U. & Holzel H., 1980. Die Neurop-
teren Europas. Eine zusammenfassende Darstellung
der Systematik, Okologie und Chorologie der Neu-
ropteroidea (Megaloptera, Raphidioptera, Planipen-
nia) Europas. Goecke & Evers, Krefeld, Germany,
495+355 pp.
Aspock H., Holzel H. & Aspock U., 2001 . Kommentier-
ter Katalog der Neuropterida (Insecta: Raphidioptera,
Megaloptera, Neuroptera) der Westpalaarktis. Deni-
sia, 2: 1-606.
Aspock U. & Aspock H., 1987. Wiederentdeckung von
Puer maculatus (Olivier) in Europa (Neuropteroi-
dea: Planipennia: Ascalaphidae). Zeitschrift der Ar-
beitsgemeinschaft Osterreichischer Entomologen,
39: 5-11.
Glisten R., 2003. A checklist and new species records of
Neuropterida (Insecta) for Tunisia. Kaupia: Darm-
stadter Beitrage zur Naturgeschichte, 12: 129-149.
Kimmins D. E., 1949. Notes on Ascalaphidae in the Bri-
tish Museum collections, with descriptions of new
species. Annals and Magazine of Natural History,
(12)2: 1-29.
Pantaleoni R.A., 2005. Nuovi Insetti di Sardegna. Scien-
zaonline, 23(3) http://www.scienzaonline.com/zoo-
logia/nuovi-insetti-sardegna.html [now unavailable].
Pantaleoni R.A., Badano D., Aspock U. & Aspock H.,
2011. Ascalaphus cf. festivus (Rambur, 1 842) in Sar-
dinia, a new genus of Ascalaphidae for Europe. Book
of Abstracts, XI International Symposium on Neu-
ropterology, Ponta Delgada, Azores, Portugal, 12-15
June 2011, 3.
Prost A., 2011. The genus Ascalaphus Fabricius, 1775
(Myrmeleontidae, Ascalaphidae) in Africa. Book of
Abstracts, XI International Symposium on Neurop-
terology, Ponta Delgada, Agores, Portugal, 12-15
June 2011, 10.
Tjeder B., 1980. Ascalaphidae (Neuroptera) from Sene-
gal and the Gambia. Entomologica Scandinavica, 1 1 :
401-412.
van der Weele H.W., 1907. Note on the Ascalaphidae
(Planipennia) described by Linnaeus. Notes from the
Leyden Museum, 28: 153-157.
van der Weele H.W., 1909. Ascalaphiden, monographisch
bearbeitet. Collections Zoologiques du Baron Edm.
de Selys Longchamps, Catalogue Systematique et
Descriptif, fasc. VIII, 1908, 1-326.
Biodiversity Journal, 2013, 4 (1): 183-208
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhai-
dae) in the italian Plio-Pleistocene
Mauro M. Brunetti 1 & Maurizio Forli 2
'Via 28 Settembre 1944 n. 2, 40036 Rioveggio (BO), Italy; e-mail: [email protected]
2 Via Grocco n. 16, 59100 Prato (PO), Italy; e-mail: [email protected]
ABSTRACT The species of the genus Aporrhais Da Costa, 1778 (Gastropoda, Aporrhaidae) of the italian
Plio-Pleistocene are described and illustrated. To the three species known, A. pespelecani
pespelecani (Linnaeus, 1758), A. uttingeriana (Risso, 1826) and A. peralata (Sacco, 1893),
the new species A. etrusca n. sp., reported only for the Zanclean period of Tuscany (central
Italy) and A. pliorara (Sacco, 1893), distributed from the Piacenzian to the Lower Pleis-
tocene (Calabrian), elevated to species, are added; moreover, A. pespelecani var. crenatulina
(Sacco, 1893), the most common in the italian lower-middle Pliocene, widespread from the
Tortonian to the Piacenzian, is elevated to subspecies. A. serresiana (Michaud, 1827) is
considered to have occurred in the Mediterranean basin only in very recent times. The exa-
mined species were compared either with extant taxa of Mediterranean (A. pespelecani pe-
spelecani, A. serresiana) and Afro-Atlantic origin (A. pesgallinae Barnard, 1963 A.
senegalensis Gray, 1838) or with species of the European Neogene: A. burdigalensis (d'Or-
bigny, 1852), A. meridionalis (Basterot, 1825), A. alata (Von Eichwald, 1830), A. dingde-
nensis Marquet, Grigis et Landau, 2002, A. scaldensis Van Regteren Altena, 1954 and A.
thersites Brives, 1897.
KEY WORDS Gastropoda; Aporrhaidae; Aporrhais', Pliocene; Pleistocene; Italy.
Received 13.12.2012; accepted 18.02.2012; printed 30.03.2013
INTRODUCTION
The genus Aporrhais Da Costa, 1778 exists with
certainty since the Eocene and, in the Oligocene,
underwent a significant increase in the number of
species. During the Miocene there were at least a
dozen species in the European basins (Landau et al.,
2004), while during the Pliocene a significant re-
duction in the number of species, that continued
throughout the Pleistocene, occurred. Currently the
genus Aporrhais, comprising five species, is pre-
sent exclusively in the North Atlantic, the Mediter-
ranean (including the Black Sea) and along the
West African coast. A. occidentalis (Beck, 1836) of
western and North-Eastern Atlantic has been attrib-
uted by some authors to different genera, namely
Arrhoges Gabb, 1868 and Drepanocheilus Vaught,
1989, both currently considered synonyms of Apor-
rhais, or Chenopus Philippi, 1836 and Pelecanus
Piette, 1876 (not Linnaeus, 1758). The main feature
of this genus is the development of external digits
from the peristome. The characteristics of the pro-
toconch of extant species suggest a planktotrophic
development (Bouchet & Waren, 1990).
MATERIALS AND METHODS
The examined material, collected during field
researches, comes from Pliocene and Pleistocene
184
Mauro M. Brunetti & Maurizio Forli
deposits (Table 1). For most taxa under study, more
than 200 specimens were examined. For all speci-
mens, the height of the shell was measured (on sam-
ples with well formed digits) and the number of
tubercles in the penultimate whorl (NTG) counted
(Table 2). Systematic nomenclature is according to
Manganelli et al. (2008).
ACRONYMS AND ABBREVIATIONS. CB =
M.M. Brunetti collection, Rioveggio, Bologna,
Italy; CD A = B. Dell’ Angelo collection, Genova,
Italy; CD = G. Della Bella collection, Monterenzio,
Bologna, Italy; CF = M. Forli collection, Prato,
Italy; H = maximum height of the shell, measured
from the apex or the end of the first digit until the
front end of the siphonal canal or at the end of the
last type, coll. = collection; ex = specimen; exx =
specimens; MZB = Museum of Zoology, University
of Bologna; MSNF = Museum of Natural Sciences
in Florence; MRSNT = Regional Museum of Natu-
ral Sciences of Turin; MSNM = Museum of Natural
Sciences of Milan; NMB = Naturhistorisches Mu-
seum Basel; NHMW = Naturhistorisches Museum,
Geologisch - Palaontologische Abteilung, Wien.
SISTEMATIC
Classe GASTROPODA Cuvier, 1797
Ordine Neotaenioglossa Haller, 1882
Superfamily STROMBOIDEA, Rafmesque, 1815
Family APORRHAIDAE, Gray J.E., 1850
Genus Aporrha is Da Costa, 1778
type species: Aporrhais quadrifidus Da Costa, 1778
= Strombus pespelecani Linneus, 1758
Aporrhais pespelecani pespelecani (Linnaeus,
1758) (Figs. 1-10,70,71)
Strombus pes pelicani - Linnaeus, 1758: 742
Aporrhais quadrifidus - Da Costa, 1778: 136-138,
pi. 7, fig. 7
Rostellaria ala-draconis - Perry, 1811: 11, fig. 6
Murex gracilis - Brocchi 1814: 437, pi. 9, fig. 16
Fusus fragilis - Risso, 1826: 206, pi. 6, fig. 75
Aporrhais pes -pelicani - Wood, 1848: 25, pi. 2, fig. 4
Chenopus anglicus - d'Orbignyi, 1852: 38
Chenopus pespelicani var. minor - Bucquoy et al.,
1884: 220, pi. 23, fig. 11
Chenopus pespelicani var. oceanica - Bucquoy et al.,
1884: 220, pi. 24 ,figs. 4-5
Aporrhais michaudi - Locard, 1888: 11
Aporrhais pelecanipes - Locard, 1892: 123, fig. 109
Chenopus pespelecani - Cerulli-Irelli, 1911: 275,
pi. 26, figs. 29-31
Aporrhais pespelecani - Harmer, 1918: 432, pi. 41,
figs. 26-30
Aporrhais pespelecani quadrifidus - Glibert, 1958:
25, pi. 2, fig. 21
Aporrhais ( Aporrahis ) pespelecani - Malatesta,
1960: 113, pi. 6, fig. 4
Aporrhais pespelecani - Settepassi, 1971: 1, pi. 1-8,
figs. 1-68
Aporrhais michaudi - Settepassi, 1971: 14, pi. 8,
fig. 69
Aporrhais pespelecani quadrifida - Geys & Mar-
quet, 1979: 22, pi. 28, fig. 1
Aporrhais pespelecani - Macri, 1983: pi. 2, fig. 4
Aporrhais (A.) pespelecani - Brambilla & Lualdi,
1988: pi. 12, fig. 1
Aporrhais ( Aporrahis ) pespelecani - Travaglini,
1988: 5, figs. 2-3
Aporrhais {. Aporrahis ) pespelecani - Gonzales Del-
gado, 1988: 130, pi. 3, figs. 5-7
Aporrhais pespelecani - Marques da Silva, 1993:
157, pi. 3, fig. 5
Aporrhais pespelecani - Saunders, 1995: 42, fig. 8
Aporrhais pespelecani - Giannuzzi-Savelli et al.,
1996: 132, figs. 573-587
Aporrhais pespelecani quadrifida - Marquet, 1998:
74, fig. 49
Aporrhais pespelecani - Solsona et al., 2000: 83, pi.
1, figs. 1-2
Aporrhais pespelecani - Nielsen et al., 2007: 187 fig. H
Aporrhais pespelecani - Chirli, 2007: 8, pi. 3, fig. 6
Examined Material. Chiusa di Codrignano (Bolo-
gna), Gelasian-Calabrian, 104 exx. (CB, CD); Tor-
rente Stirone (Parma), Calabrian, 42 exx (CB, CD);
Porto Corsini (Ravenna), modern, 40 exx (CB,
CD); Cava Lustrelle (Lecce), Calabrian, 39 exx
(CB, CF); Ca' Meldola (Bologna). Calabrian 33 exx
(coll. Della Bella); Spicchio (Firenze), Zanclean-
Piacenzian, 32 exx (CB, CD, CF); Riparbella (Pisa),
Calabrian 20 exx (CB, CF); Calambrone (Pisa), mo-
dem, 17 exx (CF); Portoazzurro (Livorno) -80, mo-
dern, 12 exx (CD); Torrente Arda (Piacenza),
Calabrian, 12 exx (CB, CD, CF); Fauglia (Pisa),
Calabrian 10 exx (CF); Rodi Garganico (Foggia),
modern, 6 exx (CB); Lucena del Porto (Huelva -
Spain), Zanclean, 5 exx (CB); Moronico (Ravenna),
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
185
LOCALITIES
AGE OF DEPOSITS
REFERENCES
Acate (Ragusa)
Calabrian
Armaiolo (Siena, Italy)
Zanclean-Piacenzian*
Baschi (Terni, Italy)
Piacenzian
Malatesta, 1974
Bibbiano (Siena, Italy)
Zanclean*
Campino (Siena, Italy)
Zanclean
Laghi, 1984
Ca Bianca (Bologna, Italy)
Zanclean
Della Bella & Scarponi, 2004
Ca Lametta (Bologna, Italy)
Piacenzian
Della Bella & Scarponi, 2004
Ca Meldola (Bologna, Italy)
Calabrian
Della Bella & Scarponi, 2007
Casciana Terme (Pisa, Italy)
Gelasian
Castelnuovo Berardenga Scalo (Siena, I)
Zanclean
Manganelli et al., 2008
Cava Campore (Parma, Italy)
Piacenzian
Cerergato, 200 1
Cava Certaldo (Firenze, Italy)
Piacenzian*
Cava Lustrelle (Lecce, Italy)
Calabrian
Deir Angelo et al., 2007
Cava Lugagnano (Piacenza, Italy)
Zanclean
Rio et. al., 1988
Cava Signorella (Lecce, Italy)
Calabrian
Macri, 1983
Cava Tacconi (Roma, Italy)
Calabrian
Malatesta & Zarlenga, 1985
Cedda (Siena, Italy)
Zanclean-Piacenzian
Brunetti M. & Della Bella, 2006
Chianello (Siena, Italy)
Zanclean-Piacenzian*
Chiusa di Codrignano (Bologna, Italy)
Gelasian-Calabrian
Ruggieri, 1962
Ciuciano (Siena, Italy)
Zanclean
Forli & Dell’Angelo, 2000
Cossato (Biella, Italy)
Piacenzian
Aimone & Ferrero Mortara, 1983
Fauglia (Pisa, Italy)
Calabrian
Brunetti M. et al., 2008
Ficulle (Terni, Italy)
Zanclean-Piacenzian
Brunetti M. & Della Bella, 2006
Fosso della Possessione (Ravenna, Italy)
Gelasian
Della Bella & Scarponi, 2010
Guidonia (Roma, Italy)
Piacenzian
Mancini (1997)
Guistrigona (Siena, Italy)
Zanclean-Piacenzian
Bogi et al., 2002
Lagune (Bologna, Italy)
Zanclean*
Latsia (Cyprus)
Gelasian
Leognan (France)
Burdigalian
Cauzac et al., 1993
Letkes (Hungary)
Badenian
Csepreghy-Meeznerics, 1956
Linari (Siena, Italy)
Piacenzian
Bogi et al., 2002
Lucena del Porto (Huelva, Spain)
Zanclean
Gonzales Delgado, 1988
Luciana (Pisa, Italy)
Zanclean
Maglie (Lecce, Italy)
Calabrian
Marzeno (Bologna, Italy)
Piacenzian*
Masserano (Biella, Italy)
Piacenzian*
Miste (Netherlands)
Middle Miocene
Janseen, 1984
Montecatone (Bologna, Italy)
Calabrian*
Montegibbio (Modena, Italy)
Tortonian
Davoli, 1982
Monte Padova (Piacenza, Italy)
Piacenzian
Rio et. al., 1988
186
Mauro M. Brunetti & Maurizio Forli
LOCALITIES
AGE OF DEPOSITS
REFERENCES
Moronico (Bologna, Italy)
Calabrian*
Orciano Pisano (Pisa, Italy)
Piacenzian
Gatto, 1997
Pianella (Siena, Italy)
Zanclean
Poggio alia Staffa (Siena, Italy)
Zanclean
Della Bella & Scarponi, 2004
Ponte a Elsa (Pisa, Italy)
Piacenzian
Benvenuti et al., 1997
Pradalbino (Bologna, Italy)
Piacenzian
Della Bella & Scarponi, 2007
Rio Albonello (Ravenna, Italy)
Piacenzian
Tabanelli, 1994
Rio Carbonaro (Piacenza, Italy)
Piacenzian
Della Bella & Scarponi, 2007
Rio Crevalese (Piacenza, Italy)
Piacenzian
Brunetti M. & Vecchi, 2005
Rio Merli (Ravenna, Italy)
Piacenzian
Tabanelli, 2008
Rio Stramonte (Piacenza, Italy)
Piacenzian
Brunetti M. & Vecchi, 2003
Rio Torsero (Savona, Italy)
Zanclean
Violanti, 1997
Riparbella (Pisa, Italy)
Calabrian
Dell'Angelo & Forli, 1995
San Faustino (Temi, Italy)
Zanclean-Piacenzian
Malatesta, 1974
San Lorenzo in collina (Bologna, I)
Piacenzian
Brunetti M. & Soccio, 2006
San Martino a Maiano (Firenze, Italy)
Zanclean*
Spicchio (Firenze, Italy)
Zanclean-Piacenzian
Dominici et. al., 1997
Strolla (Siena, Italy)
Zanclean-Piacenzian
Bossio et al., 1992
Szob (Pest, Hungary)
Badenian
Csepreghy-Meeznerics, 1956.
V
Sentjemej (Slovenia)
Tortonian*
Tabiano Bagni (Parma, Italy)
Zanclean
Pelosio, 1967
Tabiano Castello (Parma, Italy)
Zanclean-Piacenzian*
Torrente Arda (Piacenza, Italy)
Gelasian-Calabrian
Brunetti M. & Vecchi, 2005
Torrente Stirone (Parma, Italy)
Zanclean-Gelasian-Calabrian
Papani & Pelosio, 1962
Treppie (Siena, Italy)
Zanclean
Pantoli & Raffi, 1981
Vignola (Modena, Italy)
Piacenzian
Della Bella & Scarponi, 2004
Table 1. Localities from which the present study material comes, age of deposits and references (when available). Age indications
marked with a star are proposed by the authors of the present work basing on the malacological assemblage.
Calabrian, 5 exx (CB); Castiglione della Pescaia
(Grosseto), modern, 4 exx (CD); Cava Tacconi
(Roma), Calabrian, 4 exx (CB); Ciuciano (Siena),
Zanclean, 3 exx (CD); Poggio alia Staffa (Siena),
Zanclean, 3 exx (CB); Acate (Ragusa) Calabrian, 2
exx (CF); Camaret sur Mer (France), modem, 2 exx
(CF); Casciana Terme (Pisa), Gelasian, 2 exx (CF);
Bibbiano (Siena), Zanclean 1 ex (CB); Cecilia (Li-
vorno), modem, 1 ex (CB); Lagune (Bologna), Pia-
cenzian, 1 es., (CD); Maglie (Lecce) Calabrian, 1
ex (CD); Malaga (Spain), modem, 1 ex (CB); Ponza
(Latina), modem, 1 ex (CB).
Aporrhais burdigalensis (d'Orbigny, 1852), Leo-
gnan (France), Burdigalian, 12 exx (CB, CF).
Description. Shell medium sized (average H =
28.5-36.6 mm), spindle-shaped loop consisting of
9 to 10 whorls. Protoconch smooth, of 2.5 whorls;
the beginning of the teleoconch is characterized by
a dense spiral sculpture consisting of ten equally-
spaced spiral tracks, in the next whorl there are nu-
merous ribs that, crossing the tracks, form a thin
spiral cancelled sculpture. In the subsequent whorls,
ribs increase in thickness and decrease in number
up to 13-15 on the penultimate whorl, forming ver-
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
187
tical pleats that, starting at the adapical suture, sub-
side and eventually disappear before the abapical
suture. These ribs, first straight, become more and
more inclined and protruding into the abapical part
of the whorls, forming a tubercular keel; it is often
present a small pre-sutural thread more or less no-
ticeable. The last whorl, which occupies about half
of the total, is crossed by two nodulose hulls, plus
a third one, little noticeable in the rear part of the
whorl, and by numerous spiral, sub-equal threads.
Aperture elongated, very large, lip expanded with
four digits, the first of which separate and divergent;
basal digit folded forward. The second and third di-
gits generally elongate. Operculum homy, elliptical.
Distribution. Based on available data, A. pespele-
cani pespelecani is a species living in the Mediter-
ranean and north-eastern Atlantic, with stratigraphic
distribution from the Zanclean to present. A. pespe-
lecani pespelecani inhabits sandy-muddy circalit-
toral bottoms (Sabelli & Spada, 1977).
Remarks. In this species, as in the whole Stromboi-
dea Superfamily, the development of keystrokes
outside the peristome shows the successful sexual
maturity of the individual. Juvenile specimens ana-
lyzed herein have no digits and correspond to
Murex gracilis Brocchi, 1814 (Figs. 1,2) and Fusus
fragilis Risso, 1826. A. pespelecani pespelecani
shows variability in shape and, sometimes, in the
number of digits (see Settepassi, 1971; Filippi,
1984; Giannuzzi Savelli et al., 1996), while the
sculpture of the teleoconch and the shape of the
mouth are overall pretty constant.
In line with Bouchet & Waren (1990, p. 708) we
consider A. michaudi Locard, 1890 as a simple form
of A. pespelecani pespelecani with five digits. With
respect to A. pespelecani minor Bucquoy, Dautzen-
berg et Dollfus, 1884, the examination of the origi-
nal iconography (Bucquoy, Dautzenberg & Dollfus,
1884, p. 220, pi. 23, fig. 11) shows clearly that it is
a juvenile specimen. There are many reports in the
literature of A. pespelecani pespelecani relating
to the italian Plio-Pleistocene, most of these may,
however, be referring to A. pesp. crenatulina Sacco
(see below), especially those relating to the Zan-
clean period. In the lands of Pleistocenic origin A.
pespelecani pespelecani is very common from Nor-
way to the Mediterranean. Currently, in the North
Atlantic there is a morph, rather rare in the Mediter-
ranean, A. pespelecani var. bilobata Clement, 1873
[= var. oceanica Bucquoy, Dautzenberg et Dollfus,
1884, see illustrations by Wood (1848, pi. 2, fig. 4),
Saunders, (1995, p. 42, fig.8) Settepassi, (1971, p.
8, pi. 3, figs. 17-18), Malatesta, (1960, p. 113, pi. 6,
Aporrhais species
Nd
H
min.
H
max
H
med.
NTG
min.
NTG
max
NTG
med
T
z
p
G
C
A
A. pespelecani pespelecani - Pliocene
4
21
38
28,5
12
13
12,5
A. pespelecani pespelecani - Pleistocene
4
25,5
45
36,6
10
16
13,2
A. pespelecani pespelecani - modem
4
27,5
48,5
39,4
10
15
11,9
A. pespelecani crenatulina
4
14,5
33
24,4
14
19
18
9
A. etrusca n. sp.
5
14,5
31
21,4
12
16
13,8
A. uttingeriana - Pliocene
4
18,5
39,5
29,2
15
18
16
A. uttingeriana - Pleistocene
4
31,5
75
44,6
18
22
20
A. peralata
5
18
23
20
19
26
22
A
A. pliorara
5
28,5
50
38,8
19
21
20
A. serresiana
5
30
40
36
12
16
15
Table 2. Morphological characteristics and stratigraphic distribution of the species treated. Abbreviation: Nd = numero digitazioni,
NTG = numero dei tubercoli sul penultimo giro, T = Tortonian, Z = Zanclean, P = Piacenzian, G = Gelasian, C = Calabrian, A =
modern.
188
Mauro M. Brunetti & Maurizio Forli
fig. 4)] characterized by the second and third digits
partially fused and little expanded. This morph is
quite common in the early Pleistocene of Nor-
thern Italy (Fig. 10) and, while not being able to
consider it as a valid species or subspecies, never-
theless, it may be some sort of paleoclimate indica-
tor - i.e. a " Nordic guest " (sensu Ruggieri, 1967).
This morph corresponds to the populations of the
Pliocene of Northern Europe known as A. pespele-
cani quadrifidus Da Costa, 1778 (Wood, 1848; Har-
mer, 1918; Glibert, 1959; Geys & Marquet, 1979;
Marquet, 1998).
Reports of A. pespelecani pespelecani of the Mio-
cene (Friedberg, 1914; Baluk, 1975; Marquet et al.,
2002; Landau et al., 2004), are thought to be all re-
ferable to different species. Among the noticeable
miocenic examined species, A. burdigalensis
(d'Orbigny, 1852), as understood in Marquet et
al. (2002), (Fig. 11), while similar to A. pespele-
cani pespelecani , shows however very distinct
characters including: smaller size, a more elaborate
sculpture of the loop and different shape of digits.
Therefore, we do not agree with Solsona (1998)
who considers both A. burdigalensis and A. meri-
dionalis (Basterot, 1825) identical to A. pespelecani
pespelecani. We also noted that specimens in
MRSNT, catalogued by Sacco as both A. meridio-
nalis (Basterot, 1825) (Fig. 30) and A. meridionalis
var. taurinensis Sacco, 1893 (Fig. 32), are likely to
refer to a different species with sculpture and shape
of digits that differ markedly from the typical speci-
mens of French Miocene (Fig. 31). In the italian
Pliocene A. pespelecani pespelecani consists of
rather small populations that coexist with the sub-
species treated below, significantly more widespread.
Finally, We emphasize an increase in the average size
of specimens from the Zanclean to the Present.
Aporrhais pespelecani crenatulina (Sacco,
1893) (Figs. 12-14, 18-22, 23-26, 72)
Chenopus pes-pelicani - Fontannes, 1879: 153, pi.
9, fig. 3
Chenopus pespelicani var. crenatulina - Sacco,
1893:30, pi. 2, fig. 32
Chenopus pespelicani var. parvecincta - Sacco
1893: 30, pi. 2, fig. 33
Chenopus pespelicani var. turritolonga - Sacco,
1893:30, pi. 2, fig. 34
Chenopus pespelicani var. variecincta - Sacco
1893:30, pi. 2, fig. 35
Chenopus pespelicani var. basicincta - Sacco, 1893:
31, pi. 2, fig. 36
Chenopus pespelicani var. apicevoluta - Sacco,
1893: 31, pi. 2, fig. 34
Aporrhais pes-pelicani minor - Glibert, 1949: 208,
pi. 12, fig. 19
Aporrhais uttingeriana miosubulatus - Settepassi
1971: 18, pi. 17, figs. 52-63
Aporrhais pespelecani - Malatesta, 1974: 215, pi.
16, fig. 2
Aporrhais pespelecani - Chirli, 1988: 17, pi. 3, fig. 8
Aporrhais pespelecani - Cavallo & Repetto, 1992:
61, fig. 102
Aporrhais pespelecani crenatulina - Segurini & Ta-
banelli 1994: 9, pi. 1, fig. 3
Aporrhais pespelecani - Solsona et al., 2000: 83, pi.
1, fig. 3, 5-6
Aporrhais ( Aporrhais ) pespelecani - Landau et. al.,
2004: 65, pi. 14, figs. 7a-7b
Aporrhais pespelecani - Chirli, 2007: 8, pi. 3, figs.
1-5, 7-9
Aporrhais pespelecani - Manganelli et al., 2008:
509, figs. 17-18, 34-45
Examined Material. Lagune (Bologna), Zanclean,
40 exx (CD); 35 exx (CB, CF); Rio Carbonaro (Pia-
cenza), Piacenzian, 30 exx (CB, CD); Poggio alia
Staffa (Siena), Zanclean, 18 exx (CB, CF); SanFau-
stino (Temi) Zanclean-Piacenzian, 22 exx (CB, CF);
Cossato (Biella), Piacenzian, 21 exx (CF); Ciuciano
(Siena) Zanclean, 1 1 exx, (CB, CF); Rio Crevalese
(Piacenza), Piacenzian, 10 exx (CB, CD); Linari
(Siena), Piacenzian, 10 exx (CB, CD, CF); Masse-
rano (Biella), Piacenzian, 9 exx (CB); Guistrigona
(Siena), Zanclean-Piacenzian, 5 exx (CB); Ponte a
Elsa (Firenze), Piacenzian, 5 exx (CD); Baschi
(Temi), Piacenzian, 4 exx (CB); Campino (Siena),
Zanclean 4 exx (CB); Rio Stramonte (Piacenza),
Piacenzian, 4 exx (CB); Vignola (Modena), Piacen-
zian, 3 exx (CD); Ficulle (Temi), Zanclean-Piacen-
zian, 2 exx (CB); Pradalbino (Bologna), Piacenzian,
2 exx (CB); Bibbiano (Siena), Zanclean, 1 ex (CD);
San Martino a Maiano (Firenze), Zanclean, 1 ex
(CB); Rio Torsero (Savona), Zanclean, 1 ex (CB).
A. senegalensis Gray, 1838. Senegal, modern, 4 exx
(CD, CF).
A. meridionalis (Basterot, 1825). Leognan (France),
Burdigalian, 12 exx (CB).
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
189
A. dingdenensis Marquet, Grigis et Landau, 2002.
Miste (Netherlands), Middle Miocene, 20 exx
(CB, CF).
A. alata (Eichwald, 1829). Szob (Hungary), Bade-
nian, 3 exx (CB); Letkes (Hungary), Badenian, 2
exx (CD A).
Description. Shell small to medium sized (average
H = 24.4 mm), spindle-shaped loop composed of
eight whorls. Protoconch smooth, compressed supe-
riorly, of 2.5 whorls. The beginning of the teleoconch
is characterized by a dense spiral sculpture consisting
of ten equally-spaced spiral tracks, in the next whorls
there are numerous ribs that, by crossing the tracks,
form a thin spiral, cancelled sculpture. In subsequent
whorls ribs increase in thickness and decrease in
number, up to 18 on the penultimate whorl, forming
vertical substraight pleats which, starting from the
upper suture, subside and eventually disappear be-
fore the rear suture forming a tuberculate hull; there
is always an evident pre-sutural thread. Pronounced
spiral sculpture including threads separated by wider
gaps that, on the penultimate whorl, amount to about
twenty. The last whorl, which occupies about half of
the total height of the loop, is crossed by two nodu-
lose hulls plus a third one, little noticeable in the rear
part of the whorl. Aperture elongated, narrow, with
typical crenulations on both sides of the mouth. Lip
expanded formed by four digits, usually leaf-like, the
first of which separate and divergent; basal digit bent
forward.
Distribution. Based on available data, A. pespele-
cani crenatulina is a species with an infralittoral-
circalittoral bathymetry and a stratigraphic
distribution from the Zanclean to the Piacenzian.
Remarks. Sacco (1893, p. 30) relates the variety
crenatulina, both with the var. minor Sacco, 1893
(in turn, according to the Author, in relation with
A. pespelecani minor Bucquoy, Dautzenberg et
Dollfus, 1884) and the var. dertominor Sacco,
1893 (Figs. 15,16). This latter is, in our opinion,
a completely different species, with the first digit
fused to the loop, most probably related to the
miocenic A. alata (Von Eichwald, 1830) as the
var. taurominor Sacco, 1893 (Fig. 17). Sacco
(1893) gave little importance both to difference in
size and typical crenulations of the aperture and con-
sidered A. pespelecani crenatulina as a simple form
of A. pespelecani pespelecani noting, however, that:
"among the living forms, C. senegalensis GRAY
presents this character very accentuated." We be-
lieve A. pespelecani crenatulina shows constant
features that differentiate it from A. pespelecani
pespelecani : smaller size, different and more pro-
nounced spiral sculpture, shape of the nodes on the
hulls of the last whorls, hulls not tilted but sub-
straight; never elongated digits, but flat and leaf-
shaped (as already noted by Sacco, 1893, p. 30);
first whorls considerably less elongated, proto-
conch larger and less flattened, aperture narrower
and, above all, denticles more or less developed
but always present on both sides of the mouth
(Fig. 25), which is never the case in A. pespele-
cani pespelecani neither in living nor in fossil
specimens.
As regards the chronostratigraphic distribution
of A. pespelecani crenatulina, it begins to appear
with certainty only in the Zanclean and seems not
to go beyond the Middle Piacenzian (unit
MPMU2, Monegatti & Raffi, 1993). Based on
these considerations, we therefore propose to ele-
vate to subspecies the variety described by Sacco,
and indicate as its lectotype the specimen deposi-
ted in the coll. Bellardi-Sacco, MRSNT, catalogue
no. BS. 041. 01. 021 (Figs. 12-13).
To A. pespelecani crenatulina corresponds A.
pespelecani var. parvecincta Sacco, 1893 (Fig.
1 8) , reported by the same author for several places
of the Ligurian-Piedmont basin: Astigiana (Asti),
Volpedo (Alessandria), Masserano (Biella), Rio
Torsero (Savona), Bordighera (Savona), Bussana
(Savona), Albenga (Savona). Sacco (1893) de-
scribes and illustrates several pliocenic varieties
all corresponding to A. pespelecani crenatulina
amidst which are included Chenopus pespelecani
var. apicevoluta (Fig. 22), C. pespelecani var. ba-
sicincta (Fig. 21), C. pespelecani var. variecincta
(Fig. 20), C. pespelecani var. turritolonga (Fig.
19) , and the var. anglica (d'Orbigny, 1852) (Fig.
23), which are, according to the author, pretty rare.
As for A. pespelecani, A. pespelecani crenatulina
is reported and depicted by Fontannes (1880) for
the French Pliocene and by Malatesta (1974) for
the Umbrian. Segurini & Tabanelli (1994) report
A. pespelecani crenatulina for the Piacenzian of
Rio Albonello (Ravenna) and are the first to prop-
erly illustrate the species. More recently, Marquet
et al. (2002) consider A. pespelecani crenatulina,
A. pespelecani parvecincta (Sacco, 1893), A.
190
Mauro M. Brunetti & Maurizio Forli
Figures. 1-6. Aporrhais pespelecani pespelecani. Figs. 1, 2. Murex gracilis Brocchi, 1814, holotypus, Piacentino, Neogene, H =
13,1 mm (MSNM, Brocchi coll., i5430). Figs. 3, 4. Spicchio (Firenze), Zanclean-Piacenzian, H = 30 mm (CB). Figs. 5, 6. Torrente
Arda (Piacenza), Calabrian, H = 48 mm (CB).
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
191
Figures. 7-10. Aporrhais pespelecani pespelecani. Figs. 7, 8. Cecina (Livorno), modern, H= 52 mm, (CB) Fig. 9: bilobed shape,
Chiusa di Codrignano (Bologna), Calabrian, (CB). Fig. 10: apical whorls, Torrente Arda (Piacenza), Calabrian, (CB) (Scale bar
100 pm ). Fig. 11. Aporrhais burdigalensis, Leognan (France), Burdigalian, H = 24,2 mm (CB).
192
Mauro M. Brunetti & Maurizio Forli
Figures. 12-14. Aporrhais pespelecani crenatulina. Figs. 12, 13: Lectotypus, Colli Astesi (Asti), Zanclean-Piacenzian, H = 19
mm, (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 021). Fig. 14: apical whorls, Rio Carbonaro (Piacenza), Piacenzian, (CB) (Scale
bar 100 pm). Figs. 15, 16. Chenopus pespelicani dertominor, Stazzano (Alessandria), Tortonian, H = 16,5 mm, (MRSNT, Bellardi
and Sacco coll., BS. 041. 01. 019). Fig. 17. C. pespelicani taurominor, Baldissero Torinese (Torino) Middle Miocene, FI = 18 mm,
(MRSNT, Bellardi and Sacco coll., BS.041.01.018).
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
193
Figures. 18-22. Aporrhais pespelecani crenatulina. Fig. 18. Chenopus pespelicani var. parvecincta, Rio Torsero (Imperia), Zanclean,
FI = 16,8 mm, (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 022). Fig. 19. C. pespelicani var. turritolonga Sacco, 1893, Colli Astesi
(Asti), Zanclean-Piacenzian, H = 36,9 mm, (MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.025). Fig. 20. C. pespelicani var. variecincta,
Colli Astesi (Asti), Zanclean-Piacenzian, H = 29 mm, (MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.024). Fig. 21. C. pespelicani
var. basicincta, Volpedo (Alessandria), Piacenzian, H = 32,4 mm, (MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.024). Fig. 22. C. pe-
spelicani var. apicevoluta, Colli Astesi (Asti), Zanclean-Piacenzian, H = 30,3 mm, (MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.026).
194
Mauro M. Brunetti & Maurizio Forli
Figures 23-26. Aporrhais pespelecani crenatulina. Fig. 23: Chenopus pespelicani var. anglica , Rocca d'Arazzo (Asti), Piacenzian,
FI = 33,2 mm, (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 027). Fig. 24: Rio Carbonaro (Piacenza), Piacenzian, FI = 31 mm
(CB). Fig. 25: Particular of the aperture, Rio Carbonaro (Piacenza), Piacenzian, (CB) (scala = 5 mm). Fig. 26: Rio Carbonaro
(Piacenza), Piacenzian, FI = 17 mm (CB). Fig. 27. A. pespelecani pespelecani, depth form, Fauglia (Pisa), Calabrian, H = 50 mm
(CB). Fig. 28. A. senegalensis, Senegal, modem, H = 26 mm (CB). Fig. 29. A. scaldensis, Kallo (Belgium), Piacenzian, H = 27,2
mm (CB). Fig. 30. C. meridionalis, Monte Capuccini (Torino), H = 27,6 mm (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 001).
Fig. 31. A. meridionalis, Leognan (France), Burdigalian, FT = 13 mm. Fig. 32. C. meridionalis var. taurinensis. Colli Torinesi (To-
rino), H = 27 mm (MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.002).
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
195
pespelecani taurominor (Sacco, 1893) (Fig. 17)
and A. pespelecani dertominor (Sacco, 1893)
(Figs. 15, 16) as forms of A. pespelecani pespele-
cani, since "these all, however have a tendency to
form an extra digit between the third and the aba-
pical digit" which is a character certainly present,
but of little significance when compared to the nu-
merous differences mentioned above.
The specimens reported by Settepassi (1971) as A.
uttingeriana miosubulatus Sacco, 1893, of the
Pliocene of Orvieto are identical to A. pespelecani
crenatulina. Cossmann & Peyrot (1922) depict a
A. pespelecani mut. dertominor Sacco, that, in our
opinion, seems closer to A. meridionalis . Glibert
(1949) reports a sample similar to A. pespelecani
crenatulina of the Middle Miocene of the Loire
basin (France) as A. pespelecani minor Bucquoy,
Dautzenberg et Dollfus, 1884 which may suggest
the presence of A. pespelecani crenatulina in the
Middle Miocene as well. These data need further
confirmation, however, not having been able to
examine directly the material.
A. pespelecani crenatulina presents a remarkable
constancy of characters, the only real variation con-
sisting in the size of some specimens that may be
significantly below the average height (Fig. 26). We
have been able to examine other species of the Eu-
ropean Miocene showing nearly the same size as A.
pespelecani crenatulina including A. burdigalensis
(d'Orbigny, 1852) (Fig. 11), A. meridionalis (Baste-
rot, 1825) (Fig. 30) and A. dingdenensis Marquet,
Grigis et Landau, 2002 (Fig. 55). All these taxa
show spiral sculpture and digits completely dif-
ferent from the species in question, and, in addi-
tion, they lack of crenulations inside the mouth as
is the case of A. scaldensis Van Regteren Altena,
1 954 (= Chenopus pespelicani var. anglica in Nyst,
1878, pi. 6 fig. 11) (Fig. 29) from Belgium.
A. senegalensis Gray, 1838 (Fig. 28), currently dis-
tributed from Senegal to Gabon on sandy bottoms
(Ardovini & Cossignani, 2004), presents crenula-
tions similar to A. pespelecani crenatulina, but dif-
ferent shape and sculpture (large and rounded
tubercles, first digit fused to the loop). Previous re-
ports of A. senegalensis for the italian Pliocene
(Settepassi, 1971) are wrong and probably attribu-
table to this subspecies. Notably, different pleis-
tocenic populations attributable to A. pespelecani
pespelecani (Fig. 27), found in sediments corre-
sponding to the deep circalittoral, show characters
that lead partly to A. pespelecani crenatulina (nar-
row aperture, very light crenulations) and partly to
A. pespelecani pespelecani. This could be inter-
preted as a retention of primitive characters in
depth-populations .
Aporrhais etrusca n. sp.
(Figs. 33-40, 73)
Examined Material. Holotypus (Figs. 33-35), H =
30 mm, Cedda (Siena, Tuscany, Italy), Zanclean-
Piacenzian, 43° 23’ 44 ”N, 11°11 , 52 ,, E (MZB). Pa-
ratypi same locality of the holotypus: paratypus 1
(Fig. 36), H =30 mm (MZB); paratypus 2 (Fig. 37),
H = 32 mm (MSNF); paratypus 3 (Fig. 38), H = 32
mm (MSNF); paratypus 4 (Fig. 39), H = 27 mm
(MSNF); paratypus 5 (Fig. 40), H = 31 mm
(MSNF).
Other material examined. Cedda (Siena), Zanclean,
120 exx (CB, CD, CF); Chianello (Siena), Zan-
clean, 100 exx (CB, CD); 67 exx Strolla (Siena)
Zanclean, (CB); Treppie (Siena), Zanclean, 35 exx
(CB, CD, CF).
Description of holotype. Shell small to medium
sized (H = 30 mm), spindle-shaped loop consisting
of eight whorls. The beginning of the teleoconch is
characterized, in the first two whorls, by a dense
spiral sculpture consisting of ten equally-spaced
spiral tracks. In subsequent whorls appear nu-
merous nodulose ribs, sharp, sub-straight, 14 on the
penultimate whorl, forming a hull with sharp nodu-
les; always present a pre-sutural thread. The spiral
sculpture is pronounced consisting of several
threads separated by sub-equal interspaces, 10 on
the penultimate whorl. The last whorl, which occu-
pies half of the total height of the loop, is crossed
by two nodulose hulls plus a third one, little no-
ticeable in the rear part of the whorl. Aperture elon-
gated. Lip expanded consisting of five digits, the
second and third of which, and sometimes the
fourth, fused together and thick; the first digit
weakly developed, separate and divergent; basal
digit very short, slightly bent forward.
Variability. The adult specimens, with outer lip
formed, can vary in size and number of tubercles
on the penultimate whorl (see tab. 2), while keeping
constant the morphological characteristics of the te-
leoconca. Only very old specimens show the se-
cond, third and fourth digits welded.
196
Mauro M. Brunetti & Maurizio Forli
Etimology. The name derives from the ancient in-
habitants of the region of discovery, the Etruscans.
Distribution. Based on available data, A. etrusca
n. sp. occurred at depths between the infralittoral
and the circalittoral with stratigraphic distribution
limited to the Zanclean.
Remarks. In all specimens examined the proto-
conch was not complete for which it was not possi-
ble to describe it. A. etrusca n. sp. differs
significantly from both A. pespelecani pespelecani,
for the largest number of digits, the sculpture of the
teleoconch and for big, pointed tubercles, while dif-
fers from A. pespelecani crenatulina for the lack of
crenulations on the aperture and the shape and num-
ber of digits. There are no forms of transition to the
one or other subspecies. At the moment it is known
only for the Zanclean from a narrow area of Central
Tuscany.
Aporrhais uttingeriana (Risso, 1826)
(Figs. 41-47,49,50,74)
Rostellaria uttingeriana - Risso, 1826: p. 225
Rostellaria brongniartianus Risso, 1 826 226
Rostellaria pes ardeae - Sassi, 1827: 480
Chenopus Uttingeriana - Fontannes, 1880: 155, pi.
9 fig. 4
Chenopus uttingerianus - Sacco, 1893: 23, pi. 2,
figs. 21-22
Chenopus uttingeriana var. crassulosa - Sacco,
1893: 25
Chenopus uttingeriana var. peraraneosa - Sacco,
1893:26, pi. 2, fig. 23
Chenopus uttingeriana var. percarinata - Sacco,
1893:24, pi. 2, fig. 24
Chenopus serresiana var. pliotransiens - Sacco,
1893:27, pi. 2, fig. 26
Figures. 33-40. Aporrhais etrusca n. sp. from Cedda (Siena, Tuscany, Italy), Zanclean-Piacenzian. Figs. 33-35: Holotypus, H = 30
mm (MZB-). Fig. 36: Paratypus 1, FI = 30 mm (MZB-). Fig. 37: Paratypus 2, H = 32 mm (MSNF-). Fig. 38: Paratypus 3, H = 32
mm (MSNF). Fig. 39: Paratypus 4, H = 27 mm (MSNF). Fig. 40: Paratypus 5, H = 31 mm (MSNF).
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
197
Aporrhais uttingeriana var. mutica - Almera & Bo-
fill 1898: 64, pi. 4, fig. 2
Chenopus pespelecani - Cerulli Irelli, 1911: 275, pi.
26, figs. 26-28
Chenopus uttingeriana - Dieni & Omenetto, 1960:
614, pi. 62, figs. 7a-b
Aporrhais (A.) uttingeriana - Papani & Pelosio,
1962: 305, pi. 2, fig. 2.
Aporrhais ( Aporrhais ) uttingeriana (Risso) - Pelo-
sio, 1967: 109, pi. 37, figs. 2-4.
? Aporrhais uttingeriana peraraneosa - Settepassi,
1971, pi. 15, fig. 39.
Aporrhais uttingeriana mioaustriacus Sacco - Set-
tepassi, 1971, pi. 15, fig. 40
Aporrhais uttingeriana longidigitatus Settepassi,
1971, pi. 17, figs. 52-63
Aporrhais uttingeriana - Settepassi, 1971, pi. 16,
figs. 42-47
Aporrhais uttingeriana major - Settepassi, 1971, pi.
16, figs. 48-49
Aporrhais ( Aporrhais ) uttingeriana - Malatesta,
1974: 215, pi. 16, figs. 3 a-c
Aporrhais uttingeriana - Caprotti, 1976: 8, pi. 14,
figs. 2-8
Aporrhais uttingeriana - Chirli, 1988: 17, pi. 3, fig. 2
Aporrhais (A.) uttingeriana - Brambilla & Lualdi,
1988, pi. 12, fig. 3
Aporrhais ( Aporrhais ) uttingeriana - Travaglini,
1988: 9, figs. 7-9
Aporrhais uttingeriana uttingeriana - Cavallo &
Repetto, 1992: 61, fig. 103
Aporrhais uttingeriana - Piccioli Resta & Prete,
2003: 50, fig. 7a-b
Aporrhais ( Aporrhais ) uttingeriana - Landau et al.,
2004: 67, pi. 14 fig. 8
Aporrhais uttingeriana - Manganelli et. al. , 2008:
507, figs. 15-16, 20-31
Examined Material. Rio Carbonaro (Piacenza),
Piacenzian, 60 exx (CB, CD, CF); Tabiano Castello
(Parma), Zanclean-Piacenzian, 47 exx (CD); Pra-
dalbino (Bologna), Piacenzian, 27 exx (CB); Ciu-
ciano (Siena), Zanclean, 36 exx (CB, CD, CF); San
Lorenzo in collina (Bologna), Zanclean-Piacenzian,
18 exx (CD); Chiusa di Codrignano (Bologna), Ge-
lasian - Calabrian, 18 exx (CB, CD); Ca Lametta
(Bologna), Piacenzian, 17 exx (CB, CD); Cava Cam-
pore (Parma), Zanclean, 16 exx (CB, CD); Ca'
Bianca (Bologna), Zanclean 15 exx (CB, CD); Ar-
maiolo (Siena), Piacenzian, 12 exx (CB); Monte Pa-
dova (Piacenza), Piacenzian, 23 exx (CB, CD, CF);
Orciano Pisano (Pisa), Zanclean-Piacenzian, 20 exx
(CF); Cava Tacconi (Roma), Emilian, 10 exx (CB);
Rio Torsero (Savona), Zanclean, 10 exx (CF); Spic-
chio (Firenze), Zanclean-Piacenzian, 10 exx (CD,
CF); Torrente Stirone (Parma), Calabrian, 10 exx
(CB, CD); Tabiano Bagni (Parma), Zanclean, 7 exx
(CD); Cava Certaldo (Firenze), Piacenzian, 6 exx
(CB); Linari (Siena), Piacenzian, 5 exx (CB, CD);
Rio Crevalese (Piacenza), Piacenzian, 4 exx (CB,
CD); Lagune (Bologna), Zanclean 4 exx (CD); San
Faustino (Temi), Zanclean, 8 exx (CB, CF); Latsia
(Cyprus), Gelasian, 4 exx (CF); Pianella (Siena),
Zanclean, 4 exx (CF); Riparbella (Pisa), Calabrian,
4 exx (CF); Strolla (Siena), Zanclean, 4 exx (CB);
Torrente Arda (Piacenza), Calabrian, 4 exx (CB);
Cava Lugagnano (Piacenza), Zanclean, 4 exx (CB,
CD); Rio Merli (Ravenna), Zanclean, 3 exx (CD);
Fauglia (Pisa), Calabrian, 2 exx (CF);
A. alata (Eichwald, 1829), Szob (Hungary), Bade-
nian, 3 exx (CB); Letkes (Hungary), Badenian, 2 exx
(CD A).
A. pesgallinae Barnard, 1963, Morocco, modem, 2
exx (CD); Guinea Bissau, modem, 2 exx (CB).
Description. Shell medium-large sized (average H
= 29.2-44.6 mm), loop sharply angular consisting of
8-9 whorls. The teleoconch is characterized by a
dense spiral sculpture made by threads of equal
thickness (about fifteen on the penultimate whorl).
Evident striae of growth wiggly, intersecting with the
spiral threads forming, in the early whorls, a reticu-
lated surface with a parallelogram or mmble mesh.
Presutural spiral chord not grainy. Carinate, angular
whorls, with very small and numerous nodules
(about 28 on the penultimate whorl). The last whorl,
which occupies about half of the total height of the
loop, is crossed by two nodulose hulls plus a third
one, little noticeable in the rear part of the whorl.
Elongated aperture; lip expanded formed by four
very elongated and narrow digits, the first of which
is adherent and parallel to the loop; basal digit long
and almost straight, without expansions.
Distribution. According to the locality of discovery,
A. uttingeriana occurred at depths corresponding to
the circalittoral/deep circalittoral. Stratigraphic dis-
tribution seems to go from the Tortonian to the Ca-
labrian.
Remarks. In all specimens examined the proto-
conch was not complete for which it was not possi-
198
Mauro M. Brunetti & Maurizio Forli
ble to describe it. This species, reported for the
Mediterranean basin from the Tortonian (late
Miocene) to the Sicilian baseline (lower Pleistocene),
is extraordinarily abundant in the Piacenzian. The
real presence of this taxon during the Miocene
should anyway be best investigated, indeed in the
Tortonian is also present a similar species: A. ther-
sites (Brives, 1897) (see the material of the coll.
Mayer-Eymar of Stazzano deposited in NMB, avai-
lable at http://www.stromboidea.de/?n=Species.
AporrhaisThersites.), characterized by a marked
columellar callus and a more pronounced spiral
sculpture; to this species also seem to correspond
the specimens reported by Settepassi (1971, figs.
79-80) as A. zancleanus Monterosato ms. Friedberg
(1914, pi. 8 fig. 2) describes for the Polish Miocene
A. uttingeriana which we believe can be referred to
another species.
As with all species of the genus, including A. uttin-
geriana, the number of digits may exceptionally be
different from the norm, Travaglini (1988) depicts
an example of the Calabrian from the Stirone tor-
rent (Parma), with five digits while another, found
in the Piacenzian of Rio Carbonaro (Piacenza), pre-
sents only three digits (Fig. 45). Also the length of
digits can be variable, Sacco (1893) described the
var. peraraneosa (Fig. 43) characterized by long
digits. The var. percarinata Sacco, 1893 (Fig. 44)
with more pronounced fairing, falls within the range
of variability of the species.
The specimen illustrated by Sacco (1893) as Che-
nopus serresiana var. pliotransiens (Fig. 47), ex-
amined by us, is attributable to a teratological form
of A. uttingeriana.
The varieties crassulosa Sacco, 1893 (Fig. 50) and
ornatissima Sacco, 1893 (Fig. 51) are, according to
the author, identical to the specimens figured by
Hornes (1856) as A. pespelecani. By the direct ex-
amination of the material it was found that, while
Chenopus uttingeriana var. crassulosa Sacco, 1 893
falls into the variability of A. uttingeriana, the va-
riety ornatissima is closely related to A. alata as
well as the examined samples of the Austrian Mio-
cene. The var. mutica Almera & Bofill, 1898 of the
Spanish Pliocene falls into the variability of A. ut-
tingeriana. Marquet et al. (2002), consider the
miocenic A. alata (Von Eichwald, 1 829) identical
to A. uttingeriana', on the contrary, the same species
is considered by Strausz (1966) and, more recently,
by Baluk (1995) attributable to A. pespelecani. In
our opinion there are several morphological dif-
ferences between these species and we disagree
with the beliefs of these Authors. Even with all the
precautions due to the scantiness of examined ma-
terial, we believe that A. alata, as we understood it,
presents obvious differences from A. uttingeriana
including in particular the sculpture of the fairings
made up of elongated tubercles and short digits, the
first of which is welded to the loop always not ex-
ceeding half of the second whorl.
Beyrich (1853, pi. 11 fig. 8), Sorgenfrei (1958, pi.
17 fig. 143), Schultz (1998, pi. 23, fig. 8), Marquet
et al. (2002) report as A. uttingeriana various sam-
ples of the Middle Miocene of Central Europe all,
we believe, referable to A. alata. While presenting
an undeniable affinity with A. uttingeriana, we are
inclined to believe that A. alata is to be intended as
a distinct species, or perhaps as a "species group",
probably related to A. uttingeriana, which began to
spread with certainty only from the Tortonian. We
do not agree with the theory of Vinassa de Regny
(1896) who relates A. meridionalis to A. uttinge-
riana, considering the first progenitor of the second,
in fact, as mentioned above, A. meridionalis (Fig.
31) shows dimensions, shape and sculpture com-
pletely different.
During the Pleistocene, there is a considerable in-
crease of size of the shell of A. uttingeriana. Count-
less are the reports of A. uttingeriana for the italian
Plio-Pleistocene, see for example, Sacco (1893) for
several Pliocene localities, Fontannes (1880) for
the French Pliocene, Cerulli-Irelli (1911) for the
Gelasian of Monte Mario (Roma), Dieni & Ome-
netto (1960) for the Zanclean of Orosei (Nuoro), Di
Geronimo (1969) for the Calabrian of Monte Na-
vone (Enna), Marasti & Raffi (1976) for the Piacen-
zian of Maiatico (Parma), Caprotti (1976) for the
Piacenzian of Castell'Arquato (Piacenza), Cavallo
& Repetto (1992) for the Pliocene of Roero
(Cuneo), Segurini & Tabanelli (1994) for the Zan-
clean of rio Albonello (Ravenna), Piccioli Resta &
Prete (2000) for the Fower Sicilian of Nardo
(Fecce), Fandau et al. (2004) for the Zanclean of
Estepona (Spagna), just to say a few.
In Morocco and Western Atlantic, there is a similar
species, A. pesgallinae Barnard, 1963 (Fig. 48), dis-
tributed, according to Ardovini & Cossignani (2004),
from Morocco to Namibia on sandy bottoms; Mala-
testa (1974), Mienis (1976) and Kronenberg (1991)
consider instead A. pesgallinae (=A. elegantissima
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
199
Pareiizan, 1970 and A. pseudoserresiana procerus
Settepassi, 1971) subspecies of A. uttingeriana or
even conspecific with this species (Solsona et al.,
2000; Marquet et. al., (2002). Although we do not
want to get in on the issue, due to the small number
of specimens examined, we point out that either dif-
ferences in teleoconch shape (rounded and without
keeled whorls), or the different arrangement of digits
(first digit separate and divergent in A. pesgallinae,
adherent and parallel to the loop in A. uttingeriana )
make us consider, in line with Manganelli et at.
(2008), A. pesgallinae as a valid species, probably
derived from A. uttingeriana from which is well dif-
ferentiated (Forli, 1988, 1989).
Aporrhais peralata (Sacco, 1893)
(Figs. 56-59, 75)
Chenopus uttingeriana war. peralata - Sacco, 1893:
26, pi. 2, fig. 25
Aporrhais pespelecani peralata - Marquet et al.,
2002: 156, figs. 38-39
Aporrhais peralata - Manganelli et al., 2008: 499,
figs. 4-14.
Examined Material. Tabiano Castello (Parma),
Zanclean-Piacenzian, 66 exx (coll. Della Bella);
Cava Campore (Parma), Piacenzian, 58 exx (CB,
CD); Castelnuovo Berardenga Scalo (Siena), Zan-
clean, 25 exx (CF); Marzeno (Ravenna), Piacenzian,
21 exx (CD); Rio Merli (Ravenna), Piacenzian, 10
exx (CD); Luciana (Pisa), Zanclean, 8 exx (CF); Or-
ciano Pisano (Pisa), Zanclean, 6 exx (CF); Pradal-
bino (Bologna), Piacenzian, 2 exx (CD); Rio
Albonello (Ravenna), Piacenzian, 2 exx (CB);
Monte Padova (Piacenza), Piacenzian 1 ex (CD).
Description. Shell small to medium sized (av-
erage H = 20 mm), spindle-shaped loop consisting
of 7-8 whorls. The beginning of the teleoconch is
characterized by a spiral sculpture consisting of ten
spiral threads of equal thickness. The teleoconch is
characterized by a dense spiral sculpture consisting
of ten spiral threads of equal thickness (about 1 5 on
the penultimate whorl). Striae of growth evident,
wiggly, intersecting the threads so that the first
whorls have a reticulated surface with a parallelo-
gram mesh. Whorls carinated, angular, with very
tiny, pointy and numerous nodules (approximately
25 on the penultimate whorl). The last whorl, which
occupies about half of the total height of the loop,
is crossed by two angolose hulls plus a third one,
little noticeable in the rear part of the whorl. Aper-
ture elongated. Lip expanded consisting of five dig-
its, the second, third and fourth of which welded
into a single flat and thin expansion; the first digit
separate, partly adhering to the loop; basal digit
short with a slight expansion.
Distribution. According to the locality of discoveiy,
A. peralata was living at depths corresponding to the
deep circalittoral. Certain stratigraphic distribution
seems to go from the Zanclean to the Piacenzian.
Remarks. In all specimens examined the protoconch
was not complete, for which it was not possible to
describe it. Sacco (1893), with reference to his A. ut-
tingeriana var. peralata (Figs. 56, 57), says: “It is a
form that one might say anomalous, with adult cha-
racters although not yet fully developed". Actually,
at a first glance, A. peralata may resemble a small-
sized A. uttingeriana , looking good, though, there are
some important differences between the two: no-
tably the first digit is never completely welded to
the loop as in A. uttingeriana, but always slightly
separate; the second, third and fourth digits are
welded together to form a wing; the basal digit is
never veiy elongated and the striae of growth are
much pronounced and visible. Some of these featu-
res, according to Landau et al. (2004), make A. pe-
ralata come close to A. pespelecani pespelecani.
Given the substantial differences between the two in
the early whorls, in our opinion, this hypothesis is
entirely inappropriate; we think, instead, that A. pe-
ralata should be considered a valid species, well
typical, as recently suggested by Manganelli et al.,
(2008). A. peralata is limited to the Zanclean and the
Piacenzian of North-Central Italy, surely living at
considerable deepths. A. peralata is reported for the
Piacenzian of Bordighera (Imperia) (Sacco, 1893)
and of Cava Campore (Parma) (Landau et al., 2004).
Aporrhais pliorara (Sacco, 1893)
(Figs. 60-66, 76)
Chenopus serresiana ? var. pliorara - Sacco, 1893:
26, pi. 2, fig. 27
Aporrhais sarsi - Settepassi, 1971: 21, pi. 11, figs.
13-15
Aporrhais sarsi palmipes - Settepassi, 1971: 21, pi.
11, figs. 16-18, 21, pi. 12, fig. 23
200
Mauro M. Brunetti & Maurizio Forli
Aporrhais sarsi minor - Settepassi, 1971: 22, pi. 11,
figs. 19-21
Aporrhais sarsi - Macri, 1983: 112, pi. 2, fig. 4
Aporrhais sarsi - Travaglini, 1988: 7, figs. 4-5
Aporrhais serresiana pliorara - Segurini & Taba-
nelli, 1994: 9, pi. 1, figs. 1-2
Examined Material. Cava Lustrelle (Lecce), Cala-
brian, 30 exx (CB, CD); Cava Signorella (Lecce),
Calabrian, 30 exx (CL); Chiusa di Codrignano (Bo-
logna), Gelasian - Calabrian 15 exx (CB, CD); Mon-
tecatone (Bologna), Calabrian, 4 exx (CB); Losso
della Possessione (Ravenna) Gelasian, lex (CD).
Description. Shell medium-large sized (average H
= 38.8 mm), consisting of eight to nine whorls. Pro-
toconch flat, smooth, of about 2.5 whorls, with a
small core (nucleus). The beginning of the teleo-
conch is characterized by a dozen spiral threads more
or less equally spaced; from about the middle of the
second whorl appear striae of growth opistocirte with
a moderately deep notch, which, by crossing the spi-
ral cords, form a reticulate of elongated rhomboid
meshes. Prom about half loop the axial ribs decrease
and rise in thickness forming a hull made of at first
13-15 tubercles little elongated, and then about 20 on
the last whorl. Prom about mid-loop there is a thread
near the abapicale suture, with the same number of
tubercles of the hull, but smaller, giving rise, on the
last whorl, to the second hull. The last whorl, about
half of the total length, is adorned with three hulls,
the most obvious of which is the adapical one. Spiral
sculpture made up of flattened threads more or less
similar in size, separated by narrow grooves, axial
sculpture absent or little evident. Aperture elongated
and rather large, lip wide forming five digits inter-
nally flattened and crossed in the middle by a crease
that forms in the opposite side a hull for each digit,
first digit separate and divergent from the loop, se-
cond in length, compared to the other digits. The se-
cond digit is the longest one, and the third is a little
bit longer than the fourth. Abapical digit a little
shorter than the opposite first adapical digit, slightly
bent towards the aperture.
Distribution. According to the locality of dis-
covery, A. pliorara was living at depths correspond-
ing to the circalittoral/deep circalittoral. Certain
stratigraphic distribution seems to go from the Zan-
clean to the Calabrian.
Remarks. Chenopus serresiana var. pliorara (Pigs.
60, 61) has been described for the Pliocene of the
“Astigiana” (Asti). We propose herein to elevate to
the species level the variety described by Sacco due
to the peculiar characteristics of the shell sculpture
or shape and number of digits. We consider as lec-
totype the specimen of the coll. Bellardi-Sacco at
the MRSNT, catalogue no. BS. 04 1.0 1.021. The
species with which A. pliorara has more affinity is
definitely A. serresiana (Pigs. 67-69) that differs for
shell heavier, loop more stretched, digits thinner,
elongated, less in number but more prominent, and
tubercles on the penultimate whorl. Strong are also
affinities with A. peralata from which A. pliorara
stands out mostly for larger size, angle of the major
loop, shape of the digits and the ornamentation
with tubercles which tend to form hulls. For the
Pliocene, in addition to that of Sacco (1893, p. 26),
the only report of A. pliorara is by Segurini & Ta-
banelli (1994, pi. 1, figs. 1-2), for the Piacenzian of
Rio Albonello (Ravenna). For the Gelasian and the
Calabrian, the species is found most frequently in the
deep sediments of Romagna and into those of South-
ern Italy. To these populations, in our opinion, are
attributable the reports of A. serresiana by Tabanelli
(1981) for the Pliocene of Monte Gebolo (Ravenna),
by Palazzi & Villari (1994), for the Lower Pleisto-
cene of Venetico Marina (Messina) and by Vazzana
(1996) for Vallone Catrica (Reggio Calabria). The
largest number of reports of this species refers to the
Calabrian (Emilian) of Southern Italy. To A. pliorara
correspond the morphs named by various authors
(Settepassi, 1971, Macri, 1983, Travaglini, 1988) as
A. sars/ Kobelt, 1908.
Settepassi (1971) considers A. sarsi a valid species
and reports its presence in the collection of Monte-
rosato from the Lower Pleistocene of Ficarazzi (Pa-
lermo) and Monte Pellegrino (Palermo); according
to his thesis, A. sarsi is currently living in the North
Sea and belongs to the stocks of Northern species
that inhabited the Pleistocenic seas during the cold
periods. Interestingly, Settepassi (1971) indicates A.
sarsi palmipes as corresponding to the pliocenic A.
pliorara. According to Bouchet & Waren (1990, p.
708), which we agree with, A. sarsi , an exlusively
extant species, falls perfectly in the range of varia-
bility of A. serresiana. It is noteworthy that in pleis-
tocenic populations examined, no specimens of the
typical form of A. serresiana were found. A. serre-
siana would be present in the Mediterranean basin
only since very recent times. The hypothesis of
Sacco (1893) of a phyletic relationship between
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
201
A. uttingeriana and A. serresiana lacks any foun-
dation, as well evidenced by Malatesta (1974).
Aporrhais serresiana (Michaud, 1827)
(Figs. 67-69, 77)
Aporrhais macandreae - Jeffreys, 1867: 253
Aporrhais pes-carbonis - Sowerby, 1842: 21, pi. 5,
fig. 1 (non Brongniart, 1 823)
Aporrhais pes pelecani sarsii - Kobelt, 1908: 17,
pi. 102, figs. 3, 4
Aporrhais serreseanus borealis -Kobelt, 1888: 155
Aporrhais serreseanus hexapoda - Nordsieck,
1968:97, pi. 15, figs. 57,17
Examined Material. Isola Capraia (Livorno) - 80,
modem, 36 exx (CD, CF); Isola Elba (Livorno),
modern, 10 exx (CD); Portoferraio (Livorno) - 80 /
- 90, modern, 8 exx (CD); Tarragona (Spain) - 14,
modern, 1 ex (CB).
Description. Shell medium-sized (average H = 36
mm), teleoconch made of 8-9 whorls. Protoconch
flat, smooth, of about 2.75 whorls, with a small
core. The beginning of the teleoconch is characte-
rized by a dozen spiral threads more or less
equally spaced and equivalent in size. From about
half of the second whorl appear the striae of
growth, opistocirte, with a medium-deep hollow,
fewer than in the previous species that, crossing
with spirals chords, form a reticulate with a very
elongated rhomboid-meshed grid. From about half
loop, the axial ribs rise in thickness and decrease
in number forming an abapical hull, at about two-
thirds of the total height of the whorl, consisting
of fifteen sickle tubercles, which become approxi-
mately 18 on the last whorl. From about the half
of the loop there are, in the lower part of the main
upper knots, in correspondence of the suture, small
thickenings that make a little more evident the last
two abapical tracks, which will form, on the last
whorl, the second hull. The last whorl is about half
the total length, decorated with three hulls the
most evident of which is the adapical one, whereas
the abapicale is the least one. Spiral sculpture
made up of flattened threads more or less similar
in size, separated by narrow grooves, axial sculpture
formed by the striae of growth, opistocirte, sinuous
towards the anterior digit. Aperture elongated and
narrow, with expanded lip forming five digits, the
first, second and fifth of which are similar in
length, while the third is nearly double the fourth
which is also the one with the labial groove absent
or barely noticeable.
Distribution. To our knowledge, the only speci-
mens of Aporrhais serresiana fossil are those re-
ported for the Wurmian of the Northern Tyrrhenian
Sea by Cecalupo (1988). Currently, A. serresiana
is living in the Mediterranean on the circalittoral
seabed at greater depths than A. pespelecani pe-
spelecani (Sabelli & Spada, 1977).
Remarks. The species differs from A. pliorara for
a more robust shell with the columellar edge less
broad, and interdigital plan less extended. As
mentioned above, there are no fossil records of
the species prior to the Wurmian, and even these
populations slightly differ from the living species
(Cecalupo, 1988).
CONCLUSIONS
The Aporrhaidae fossils, found in the italian
Plio-Pleistocene, consist of five species and one
subspecies. Together with the two known and uni-
versally accepted species (Aporrhais pespelecani
pespelecani , A. uttingeriana ) there also are three
species and one subspecies often confused with
the previous ones (A. pliorara , A. peralata, A.
etrusca n. sp.). With the beginning of climate de-
terioration, begun during the Piacenzian, the latter
three went extinct. During the late Piacenzian and
the early Calabrian appear several populations at-
tributable to the depth-morph of A. pespelecani
and A. pliorara.
The relationships between plio-pleistocenic and
miocenic species are still all to define. On the one
hand, the relationships among A. alata of the Mid-
dle Miocene, as we intend it, A. uttingeriana of the
Tortonian-early Pliocene-Pleistocene and the ex-
tant A. pesgallinae of West Africa appear pretty
clear; moreover, no doubt there is a link between
the Plio-Pleistocenic A. pliorara and the extant A.
serresiana. On the other hand, the phyletic rela-
tionships of A. pespelecani group with the other
species of the Miocene of Europe remain to be clar-
ified, which, however, is definitively beyond the
aim of this work.
202
Mauro M. Brunetti & Maurizio Forli
Figures. 41-47. Aporrhais uttingeriana. Figs. 41-42: Bordighera (Imperia), Piacenzian, FI = 32 mm (MRSNT, Bellardi and Sacco
coll., BS. 041. 01. 005). Fig. 43: Chenopus uttingeriana var. peraraneosa, Albenga (Savona), Zanclean, H = 34 mm (MRSNT, Bel-
lardi and Sacco coll., BS. 041. 01. Oil). Fig. 44: C. uttingeriana var. percarinata, Carru (Cuneo), Piacenzian, H=30,3 mm (MRSNT,
Bellardi and Sacco coll., BS. 041. 01. 012). Fig. 45: Rio Carbonaro (Piacenza) Piacenzian, H=34 mm (CB). Fig. 46: Torrente Arda
(Piacenza) Calabrian, H=80 mm, (CB). Fig. 47: C. serresiana (an Chenopus uttingeriana ?) var. pliotransiens, Bordighera (Im-
peria), Piacenzian, H = 19,5 mm (MRSN, Bellardi and Sacco coll., BS. 041. 01. 015). Fig. 48: Aporrhais pesgallinae, Guinea
Bissau, modern, H=39 mm.
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
203
Figures. 49-50. Aporrhais uttingeriana. Fig. 49: Chenopus uttingeriana var. brogniartiana, Colli Astesi, Zanclean-Piacenzian, H = 36
mm (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 010). Fig. 50: C. uttingeriana var. crassulosa, Stazzano (Alessandria), H = 38 mm
(MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.007). Figs. 51-54 .Aporhhais cf. alata. Fig. 51: C. uttingeriana var. ornatissima, Monte
Cappucini (Torino), Middle Miocene, H = 18,3 mm (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 008). Fig. 52: C. pes pelecani (in
Floemes 1856 pi. 18 fig. 2a), Gainfahren (Austria), Tortonian, H = 37,5 mm (NHMW, 1846/0037/0190). Figs. 53-54: C. pes pelecani
(in Floemes 1856 pi. 18 fig. 3a), Baden (Austria), Tortonian, H = 34 mm (NHMW, 1846/0037/0190). Fig. 55. A. dingdenensis, Miste
(Netherlands), Middle Miocene, H = 14 mm (CB). Figs. 56-59. A. peralata. Figs. 56, 57. Lectotypus, Bordighera (Imperia), Piacenzian,
H = 21,5 mm (MRSNT, Bellardi and Sacco coll., BS.041.01.013). Figs. 58, 59. Campore (Parma), Piacenzian, H = 20,5 mm (CB).
204
Mauro M. Brunetti & Maurizio Forli
Figures. 60-66. Aporrhais pliorara. Figs. 60, 61: Lectotypus, Colli Astesi (Asti), Zanclean-Piacenzian, H = 28,5 mm (MRSNT,
Bellardi and Sacco coll., BS. 041. 01. 014). Figs. 62, 63. Cava Lustrelle (Lecce), Lower Pleistocene, H = 40 mm (CB). Figs. 64, 65:
Cava Lustrelle (Lecce), Lower Pleistocene, H = 44 mm (CB). Fig. 66: apical whorls, Cava Lustrelle (Lecce), Lower Pleistocene,
(CB) Scale bar 100 pm. Figs. 67-69. A. serresiana. Figs. 67, 68: Isola d'Elba (Livorno), modern, H = 32 mm. Fig. 69: apical
whorls, Anzio (Roma), (CF) Scale bar 100 pm.
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
205
Figures. 70-77. Aporrhais apical whorls. Fig. 70. A. pespelecani pespelecani, Rodi Garganico (Foggia), modem, H = 48
mm (CB). Fig. 71. A. pespelecani pespelecani , depth form, Fauglia (Pisa), Calabrian, H = 50 mm (CB). Fig. 72. A. pespe-
lecani crenatulina, Guidonia (Roma), Piacenzian, 36 mm. (CB). Fig. 73. A. etrusca n. sp., Cedda (Siena), Zanclean-
Piacenzian, H = 34 mm (CB). Fig. 74. A. uttingeriana, Rio Carbonaro (Piacenza), Piacenzian, H = 44 mm (CB). Fig. 75.
A. peralata, Campore (Parma), Piacenzian, H = 23 mm (CB). Fig. 76. A. pliorara, Cava Lustrelle (Lecce), Lower Pleistocene
, H = 44 mm (CB). Fig. 77. A. serresiana, Isola d'Elba (Livorno), modern, H = 37 mm (CB). Scale bar = 5 mm.
ACKNOWLEDGEMENTS
Grateful thanks to Paolo Magenes (Milano,
Italy), Maurizio Sosso (Genova, Italy), Bruno
Dell'Angelo (Genova, Italy), Ulrich Wieneke
(Murnau, Germany), M. Harzhauser (NMHW),
and S. Dominici (MSNF).
REFERENCES
Aimone S. & Ferrero Mortara E., 1983. Malacofaune
plioceniche di Cossato e Candelo (Biellese, Italia
NW). Bollettino del Museo regionale di Scienze Na-
turali di Torino, 1: 279-328.
Ardovini R. & Cossignani T., 2004. Conchiglie dell'Africa
Occidentale. L'lnformatore Piceno, Ancona, 319 pp.
Baluk W., 1975. Lower Tortonian gastropods from Ko-
rytnica, Poland, Part 1, Paleontologia Polonica, 32:
1-186.
Baluk W., 1995. Middle Miocene (Badenian) gastropods
from Korytnica, Poland Part II. Actca Geologica Po-
lonica 45: 153-255
Benvenuti M., Bertini A., Conti C., Dominici S. & Fal-
cone D., 1997. Analisi stratigrafica e paleoambientale
integrata del Pliocene dei dintorni di San Miniato.
Quaderni del Museo di Storia Naturale di Livorno,
14: 28-49.
Bogi C., Cauli L., Pagli A. & Pagli F., 2002. Le Archi-
tectonicidae Gray, J.E., 1840 del Pliocene Toscano.
Bollettino Malacologico, 38: 31-40.
206
Mauro M. Brunetti & Maurizio Forli
Bossio A., Mazzanti R., Salvatorini G., 1992. Nuovi dati
sui depositi miocenici del settore meridionale del ba-
cino del flume Elsa Loc. Poggibonsi-La Strolla. Pa-
leopelagos, 2: 104-112.
Brunetti M. & Vecchi G., 2003. Sul ritrovamento di Te-
retia elegantissima (Foresti, 1868) in terreni plioce-
nici delTEmilia e della Toscana. Bollettino della
Societa Paleontologica Italiana, 42: 49-57.
Brunetti M. & Vecchi G., 2005. Nuove specie di Gastero-
podi del Piacenziano di rio Crevalese, CastelTArquato
(Piacenza, Italia), Bollettino Malacologico, 41: 1-22.
Brunetti M. & Della Bella G., 2006. Jujubinus astraea-
formis nuova specie per il Pliocene italiano, Bollet-
tino Malacologico, 41: 75-78.
Brunetti M. & Soccio S., 2006. Osservazioni su Nassa-
rius strobelianus (Cocconi, 1873), specie poco nota
del Pliocene italiano, Bollettino Malacologico, 41:
85-88.
Brunetti M., Forli M. & Vecchi G., 2008. Una nuova spe-
cie di Gibbula ( Forskalena ) per il Pleistocene italiano
(Gastropoda: Trochidae). Bollettino Malacologico,
44: 5-9.
Brunetti M. & Della Bella G., 2006. Leufroyia ferrierii:
una nuova specie per il Pliocene toscano (Gastropoda:
Conidae). Bollettino Malacologico, 42: 118-120.
Bucquoy E., Dautzenberg P. & Dollfuss G., 1882. Les
mollusques marins du Roussillon Tome 1 Gastero-
podes. Paris, J.B. Bailllliere & Fils, 570 pp.
Beyrich E., 1853-1857. Die Conchylien des norddeut-
schen Tertiargebirges. Berlin, 36 pp.
Bouchet P. & Waren A., 1993. Revision of the North-East
Atlantic bathyal and abyssal Mesogastropoda. Bol-
lettino Malacologico, (Suppl. 3): 579-840.
Cahuzac B., Cluzaud A., Lesport J. F. & Ringeade M.,
1993. Etude de populations de Glycymeris (Bivalvia,
Glycymerididae) du Miocene dAquitaine, Sud-Ouest
de la France. Ciencias da Terra (UNL), 12: 91-109.
Caprotti E. 1976. Malacofauna dello stratotipo piacenziano
(Pliocene di CastelfArquato). Conchiglie, 12: 1-56.
Cavallo O. & Repetto G., 1992. Conchiglie fossili del
Roero. Associazione naturalistica piemontese amici
del Museo “F.Eusebio”, Studio grafico Athena, Alba,
251 pp.
Cecalupo A., 1988. Rinvenimento di specie rare al largo
della Sardegna sud-orientale (contributo IV). Bollet-
tino Malacologico, 24: 33-39.
Ceregato A., 2001. Paleocomunita batiali a molluschi del
Pliocene del Bacino Padano.Tesi di Dottorato, Uni-
versity degli Studi di Modena e Reggio Emilia, 52 pp.
Cerulli-Irelli S., 1910. Fauna Malacologica Mariana,
parte IV. Scaphopoda: Dentaliidae; - Gastropoda: Ste-
nogyridae, Gadinidae, Acteonidae, Tornatinidae, Sca-
phandridae, Bullidae, Ringiculidae, Philinidae,
Umbrellidae, Conidae, Pleurotomidae. Paleontogra-
phia italica, 16: 23-70.
Chirli C., 1988. Malacofauna Pliocenica Poggibonsi,
cava delle Piaggiole. Firenze, Lalli Editore, 89 pp.
Chirli C., 2007. Malacofauna pliocenica toscana vol. 6
Neotaenioglossa. C. Chirli, Firenze, 128 + 76 pp.
Cossmann M. & Peyrot A., 1922. Conchologie neogeni-
que de 1' Aquitaine. Extrait des Actes de la Societe
Linneenne de Bordeaux, Bordeaux, 4: 323-610.
Csepreghy-Meznerics I.,. 1956. Die Molluskenfauna von
Szob und Letkes. Annales Instituti Geologici Publici
Hungarici, 45, 443-477.
Davoli F., 1982. Cancellariidae (Gastropoda) in E. Mon-
tanaro Gallitelli (ed.). Studi monografici sulla mala-
cologia miocenica modenese. Parte I - I molluschi
tortoniani di Montegibbio. Paleontographia Italica,
72: 5-73.
Della Bella G. & Scarponi D., 2004. Molluschi Marini
del Plio-Pleistocene delT Emilia-Romagna e della To-
scana, Conoidea Vol. 1 Drillidae e Turridae. Museo
Geologico G. Capellini, Editografica, Rastignano
(Bologna), 92 pp.
Della Bella G. & Scarponi D., 2007. Molluschi Marini
del Plio-Pleistocene delT Emilia-Romagna e della To-
scana, Conoidea Vol. 2 Conidae 1. Museo Geologico
G. Capellini, Tipografia moderna, Bologna, 93 pp.
Della Bella G. & Scarponi D., 2010. Molluschi Marini
del Plio-Pleistocene delT Emilia-Romagna e della To-
scana, Conoidea Vol. 3 Conidae 1. Museo Geologico
G. Capellini, Grafiche Scarponi, Osimo, 128 pp.
Dell'Angelo B. & Forli M., 1995. I Polyplacophora del
Pleistocene inferiore di Riparbella (Pisa) con elenco
dei molluschi ritrovati. Bollettino Malacologico, 30:
221-252.
Dell’Angelo B., Piccioli Resta G. & Bonfitto A., 2007.
Notes on Fossil Chitons. 3. A new species of Lepto-
chiton (Mollusca: Polyplacophora) from the Pleisto-
cene of South Italy. Bollettino Malacologico, 43:
139-142.
Dieni I. & Omenetto P., 1960. Studio di una macro-
fauna del Pliocene inferiore di Orosei (Sardegna).
Rivista Italiana di paleontologia e stratigrafia, 66:
605-618.
Dominici S., Mazzanti R. & Nencini C., 1997. Geologia
dei dintorni di San Miniato tra TArno, TElsa e l’Era.
Quaderni del Museo di Storia Naturale di Livorno,
14: 1-35.
Filippi M., 1984. Sul polimorfismo di Aporrhais pespe-
lecani (L., 1758), nota preliminare. Thalassia Salen-
tina, 14: 39-45.
Fontannes M., 1 879. Les invertebre du bassin tertiaire du
sudest de la France. Les mollusques pliocenes de la
vallee du Rhone et du Rousillon. Vol 1 , Gasteropo-
des. Georg Libraire, Lyon, 276 pp.
Forli M., 1988. Considerazioni filogenetiche su alcune
specie del genere Aporrhais da Costa, 1778 (Mollu-
sca: Gastropoda), I parte. Argonauta, 4: 4-12.
The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene
207
Forli M., 1989. Considerazioni filogenetiche su alcune
specie del genere Aporrhais da Costa, 1778 (Mollu-
sca: Gastropoda), ultima parte. Argonauta, 5: 49-54.
Forli M. & Dell’Angelo B., 2000. Anew species of Mar-
ginella (Mollusca, Gastropoda) from the Italian Plio-
cene. Bollettino Malacologico, 36: 93-98.
Friedberg W., 1914. Miqczaki Miocenskie ziem Polskich
(Mollusca Miocaenica Poloniae), Czesc I. Slimaki i
Lodkonigi (Pars I. Gastropoda et Scaphopoda). Mu-
zeum Imiena Dzieduszyckich (Muzeum Dzieduszyc-
kianum), vol. 3: 241-360.
Gatto R., 1997. Systematic revision of the Conoidean
species of the genus Asthenotoma Harris and Bur-
rows, 1891 from the Italian Neogene. Memorie di
Scienze Geologiche, 49: 37-64.
Geys J. F. & Marquet R. , 1979. Veldatlas Cenozoische
fossielen van Belgie. Deel 1. Neogeen. Publicatie van
de Belgische Vereniging voor Paleontologie, 2: 1-123.
Giannuzzi Savelli R., Pusateri F., Palmeri a. & Ebreo C.,
1996. Atlante delle conchiglie marine del Mediterraneo
vol. 2. Edizioni de "La Conchiglia", Roma, 258 pp.
Glibert M., 1949. Gastropodes du Miocene moyen de
bassin de la Loire. Memoires de FIstitut Royal de
Sciences Naturelles de Belgique, 30 : 1-240.
Glibert M., 1958. Gastropodes du Diestien, du Scaldisien
et du Merxemien de la Belgique. Duexieme note.
Bullettin de l'lnstitut royal des Sciences naturelles de
Belgique, 34: 1-36.
Gonzalez Delgado J.A., 1988. Estudio sistematico de los
Gasteropodos del Plioceno de Huelva (SW de
Espana). 3. Mesogastropoda (Scalacea-Tonnacea).
Studia Geologica Salmanticensia, 25: 109-160.
Harmer F. W., 1918. The Pliocene mollusca of Great Bri-
tain, being supplementary to S. V. Wood’s Mono-
graph of the Crag Mollusca. Vol. 1 . Monograph of
Paleontographical Society London, 67: 303-461.
Hornes M., 1856. Die fossilen Mollusken des Tertiar-
Beckens von Wien. Abhandlungen der Kaiserlich-
Koniglichen Geologischen Reichsanstaldt. 3, 1-736.
Kobelt W., 1908. Iconographie der schalentragenden eu-
ropaischen Meeresconchylien, 4. C. W. Kreidel, Wie-
sbaden, 172 pp.
Kronenberg, G. C., 1991. The recent species of the family
Aporrhaidae. Vita Marina, 41: 73-84.
Janssen, A.W., 1984. An account of the Cancellariidae
(Gastropoda) of Winterswijk-Miste (Miocene, Hem-
moorian), The Netherlands. Scripta Geologica, 68:
1-39.
Laghi G. F. 1984. Sorprendente densita di Chiton sae-
niensis n. sp. in sabbie gialle plioceniche dei dintorni
di Serre di Rapolano, Siena. Bollettino Museo Regio-
nal di Scienze Naturali di Torino, 2: 555-564.
Locard A., 1890. Contributions a la faune malacologique
frangaise, XVI. Les coquilles marines vivant de la
faune frangaise decrites par G. Michaud. Etude criti-
ques d'apres les types de ses collections. Baillieer et
fils, Paris, 46 pp.
Locard A., 1892. Les coquilles marines des cotes de
France. Description des families, genres et especes.
Paris, Librairie J.-B. Bailliere, 384 pp.
Landau B., Marquet R. & Grigis M., 2004. The Early
Pliocene Gastropoda (Mollusca) of Estepona Sou-
thern Spain. Parth 2: Orthogastropoda, Neotaenio-
glossa. Palaeontos, 4: 1-108.
Maori G., 1983. Contributo alia conoscenza delle argille
di Cutrofiano (Lecce). La malacofauna di cava Si-
gnorella. Quaderni del Museo comunale di Paleonto-
logia di Maglie, Ed. Salentina 112 pp.
Malatesta A., 1960. Malacofauna pleistocenica di Gram-
michele (Sicilia). Memorie per servire alia descri-
zione della carta Geologica Italiana, XII. Servizio
Geologico d'ltalia, Roma, 392 pp.
Malatesta A., 1974. Malacofauna pliocenica umbra. Me-
morie per servire alia descrizione della carta Geolo-
gica Italiana, XIII. Servizio Geologico D'ltalia Tip.
Pinto, Roma, 498 pp.
Malatesta A. & Zarlenga F., 1985. II Quaternario di Po-
mezia (Roma) e la sua fauna marina. Bollettino della
Societa Geologica Italiana, 104: 503-514.
Mancini A., 1997. Molluschi fossili della cava di For-
mello (Guidonia - Roma). Annali Associazione No-
mentana di Storia e Archeologia, 3: 35-44.
Manganelli G., Spadini V. & Fiorentino V., 2008. The lost
Aporrahais species from the italian Pliocene: A. pe-
ralata (Sacco, 1893) (Gastropoda, Caenogastropoda).
Journal of Conchology, 39: 493-516.
Marasti R. & Raffi S., 1976. Osservazioni biostratigrafi-
che e paleoecologiche sulla malacofauna del Piacen-
ziano di Maiatico (Parma, Emilia occidentale).
Bollettino della Societa Paleontologica Italiana, 15:
189-214.
Marquet R., 1998. De Pliocene Gastropodenfauna van
Kallo (Oost-Vlaanderen, Belgie). Belgische Vereni-
ging voor Paleontologie, 17: 1-246.
Marquet R., Grigis M. & Landau B. M., 2002. Aporrhais
dingdensis, a new species from the Miocene of the
North Sea Basin (Gastropoda, Caenogastropoda,
Aporrhaidae). Basteria, 66: 149-161
Marques Da Silva Pires C.A., 1993. Gastropodes plioce-
nicos Marinhos de Vale de Freixo (Pombal, Portugal).
Lisboa, Facultade de Ciencias de Universidade de Li-
sboa, 313 pp.
Mienis H.K., 1976. On the identity and distribution of
Aporrhais elegantissima. Conchiglie, 12: 89-92.
Raffi S. & Monegatti P., 1993. Bivalve taxonomic diver-
sity throughout the Italian Pliocene as a tool for cli-
matic-oceanographic and stratigraphic inferences.
Ciencias de terra (UNL), 12: 45-50.
Nielsen J.K., Hanken N.M., Nielsen J.K. & Hansen K.S.,
2006. Bio stratigraphy and paleoecology of the ma-
208
Mauro M. Brunetti & Maurizio Forli
rine Pleistocene of Rhodes, Greece: Scleractinia, Ser-
pulidae, Mollusca and Brachiopoda. Bullettin of Geo-
science, 81: 173-196.
Nyst P.H., 1878. Conchyliologie des terrains Tertiaires
de la Belgique. F. Hayez Editeur, Bruxelles, 263 pp.
Palazzi S. & Villari A., 1994. Malacofaune batiali Plio-
pleistoceniche del Messinese. 1 : Venetico Marina. II
Naturalista siciliano, 18: 73-106.
Pantoli D. & Raffi S., 1981. Presenza del genere Tugonia
(Myidae, Bivalvia) nel Pliocene mediterraneo. Bol-
lettino della Societa Paleontologica Italiana, 20: 73-
80.
Papani G. & Pelosio G., 1962. La serie Plio-Pleistocenica
del T. Stirone (Parmense occidentale). 2° contributo
alia conoscenza dei nuovi affioramenti fossiliferi del
Calabriano nel Preapennino Parmense. Bollettino
della Societa Geologica Italiana, 81: 293-361.
Pelosio G. 1967. La malacofauna dello stratotipo del Ta-
bianiano (Pliocene inferiore) di Tabiano Bagni
(Parma). Bollettino della Societa Paleontologica Ita-
liana, 5: 101-183.
Piccioli Resta G. & Prete B., 2000. Segnalazione di un gia-
cimento di molluschi marini pleistocenici nel comune
di Nardo (Lecce, Italy). La Conchiglia, 308: 47-54.
Rio D., Sprovieri R., Raffi I. & Valleri G., 1988. Biostra-
tigrafia e paleoecologia della sezione stratotipica del
Piacenziano. Bollettino della Societa Paleontologica
Italiana, 27: 213-238.
Ruggieri G., 1962. La serie marina pliocenica e quater-
nary della Romagna. Camera di Commercio e del-
Flndustria agricola di Forli, Forli, 79 pp.
Ruggieri G., 1967. Un raro lamellibranchio nordico nel
Quatemario (Siciliano) di Gela. Natura, 58: 120-124.
Sabelli B. & Spada G., 1977. Guida illustrata all'identi-
ficazione delle conchiglie del Mediterraneo. Calyp-
traeidae, Xenophoridae e Aporrhaidae. Suppl.
"Conchiglie”, 13:9-10.
Sacco F., 1893. I Molluschi dei terreni terziarii del Pie-
monte e della Liguria. Parte XIV, Carlo Clauser, To-
rino, 42 pp.
Settepassi F., 1971. Atlante malacologico I molluschi
marini viventi nel Mediterraneo. Inivag Roma II vol,
290 pp.
Saunders G.D., 1995. Note sulle popolazioni di Mollu-
schi di Portland ed aree adiacenti (Gran Bretagna).
La Conchiglia, 276: 40-44.
Schultz O., 1998. Tertiarfossilien Osterreichs. Gol-
dschneck-Verlag, Frieburg, 160 pp.
Solsona M., 1998. Paleobiologia dels Mesogasteropodes
del Plioce del Mediterrani nord-occidental. Tesis
Doctorales, Universitat de Barcellona, Spain.
Solsona M., Gili C. & Martinell J., 2000. Patterns of
change in the biogeographic distribution of Atlanto-
Mediterranean Aporrhaidae (Gastropoda) from the
Neogene to the Present. Palaeogeography, Palaeocli-
matology, Palaeoecology, 158: 83-97.
Sorgenfrei, T., 1958. Molluscan Assemblages from the
marine middle miocene of South Jutland and their en-
vironments. Danmarks Geoogiske Undersogelse, 79:
356-503.
Strausz L., 1966. Die Miozan-Meiterranen Gastropoden
Ungarns. Akaideimiai Koido, Budapest, 693 pp.
Tabanelli C., 1981. II genere Ringicula Deshayes, 1838
nei depositi profondi del Pleistocene basale in Roma-
gna. Bollettino Malacologico, 17: 211-222.
Tabanelli C. & Segurini R., 1994. Nota preliminare alia
malacofauna pliocenica di Rio Albonello (Faenza).
Quaderni di studi e notizie di Storia Naturale della
Romagna, 3: 3-22.
Tabanelli C., 2008. Associazioni di Paleocomunita batiali
a Molluschi bentonici nel Pliocene della Romagna.
Metodologie e indicazioni per nuove tematiche. Qua-
derni di studi e notizie di Storia Naturale della Ro-
magna, 26: 1-20.
Travaglini A., 1988. Gli Aporraidi del Mediterraneo e i
loro antenati fossili. Notiziario di Mineralogia e Pa-
leontologia, 56: 2-10.
Vazzana A., 1995. Malacofauna batiale del Pleistocene
inferiore del Vallone Catrica (Reggio Calabria, Italia).
Bollettino Malacologico, 3 1 (5-8): 143-162.
Vinassa de Regny P.E., 1896. II Chenopus uttingeriana
Risso e il Chenopus pespelecani L. del Pliocene ita-
liano. Bullettino della Societa Malacologica Italiana,
20: 21-44.
Violanti D., 1987. Analisi paleoambientali e tassonomi-
che di associazioni a foramminiferi del Pliocene li-
gure (Rio Torsero). Bollettino del Museo Regionale
di Scienze Naturali, 5: 239-293.
Wood S.V., 1848. A monograph of the Crag Mollusca,
with descriptions of shells from the upper Tertiaries
of the British Isles. Vol 1 Univalves. The Palaeonto-
graphical Society of London, London, 209 pp.
Biodiversity Journal, 2013, 4 (1): 209-218
The Carabini from different altitudes of Changbai mountain,
Jilin Province, North-Eastern China (Coleoptera Carabidae
Carabinae)
Zhang Xueping 1 , Ivan Rapuzzi 2 *, Gao Meixiang 1 , Li Jingke 3 ,Vongkhampha Manola 3 , Lin Lin 1 & Huang Lirong 4
‘Key Laboratory of remote sensing monitoring of geographic environment. College of Heilongjiang Province, Harbin Normal
University, Harbin, 1 50025, P.R. China
2 V ia Cialla 47, 33040 Prepotto (Udine), Italy; email: info@ ronchidicialla.it
3 P. O. Box 22, Vientiane, Laos
4 College of Environm ental Sciences, Liaoning University Chongshan Road No. 66, Shenyang City 110036, Liaoning Province,
C hina
* C orresponding author
ABSTRACT In the present paper the Carabini fauna of different altitudes and habitats of Changbai
Shan Mountains, Jilin Province, North-eastern China was investigated. After examination
of the collected specimens we describe one new CavabllS taxon: CciKClbllS (CcirabuS) SZeli
changbai CHS Rapuzzi et Li n. s s p . ; C. ( AulonOCarabuS ) rufinus Beheim et Breuning, 1943
was elevated to the specific status. Six CarabllS taxa were recorded for the first time for
the Chinese fauna: C. ( CarabuS ) manifeStUS pyotlganicola Deuve et Li, 1998; C. ( Mor -
phocarabus) venustus cf. kaesongensis im ura, 1 9 9 3 ; C. ( Diocarabus ) caustomarginatus
Imura et Mizusawa, 1994; C. (Scambocambus) kruberi cf. chaos Im ura, 1 993; C. (Acop-
tolabrus) schrencki minpongsanensis d euve et Li, 2003 and C. (Fulgenticarabus) flutschi
coreus Deuve, 2006. C. ( AcoptolabrilS ) constricticollis jilinicus Deuve, 1992 was treated
as a valid subspecies.
KEY WORDS Carabus ■ North-Eastern China; new subspecies; faunistic; taxonomy.
Received 28.12.2012; accepted 11.02.2013; printed 30.03.2013
INTRODUCTION
Changbai Mountain Chain is located in Antu
county, Jilin province, North-Eastern China. The
Mountains are on the border between China and
North Korea (41° 35 '- 42° 25’NL; 127° 40 ’- 128°
16' EL); the highest peak (White Rock Pk.) is 2749
m and it is the highest ofNorth-Eastern China. It is
composed by trachyte, white rock exposed in the
summer; in winter the mountain is covered with
pure white snow formed by the repeatedly volcanic
eruptions. It is the head stream of Tumen river, Yalu
river and Song-hua river. This mountain is heavily
forested, there are mainly PitlUS kOTCliensis S ieb old
et Zucc., yezo spruce, Abies holophylld Maxim.,
hornbeam and maple at elevations between 500-
1 200 m; at 1200-1 800 m above sea level there are
spruce and fir forests; at the elevation of 1 800 m
mainly there is E rm an s B irch forest, which is one of
the China's most important forest areas. Sika deer,
marten, Amur Tigers and other rare animals live in
this forest. Till 19 60 it is a nature reserve w ith an area
of 215,0 0 0 hectares. Changbai Shan mountain is lo -
cated in a temperate continental mountain climate
zone, it is characterized by a long and cold winter,
short and cool summer and the weather is rainy and
210
Z. XUEPING ET ALII
windy in spring, foggy in autumn. The annual aver-
age oftemperature is between -7 °C and + 3 °C . The
aim of the research was to study the Carabini fauna
from Changbai Mountain at different altitudes and
different habitats. We used sets of pitfall traps (50
plastic cups for each location) between June 13th-
15th 2012. To attract and collect Carabini we used a
mixture of granulated sugar, rice vinegar, white wine
and w a ter.
Four different altitudes and habitats were inve-
stigated: 1) Ql. Er-dao-bai-he, elevation 800 m.
Theropencedry m ion ; 2) Q2. H u an g - s o n g -p u - lin -
chang, elevation 1 300 m. Coniferous forest; 3) Q3.
B ai- sh an -sh an g -fan g , elevation 1 850 m. Ermans
Birch forest zone; 4) Q4. Nearby Tianchi weather
station, elevation 2100 m. Tundra belt.
The examination of the collected Carabini
spec-imens permited us to have great results: 1) one
new CarabltS taxon is described and figured: C.
( Carabus ) szeli changbaicus Rapuzzi et Li n. spp.
2) the cohabitation of two different subspecies of
C. {Aulono carabus) canaliculatus a d a m s , 1 8 1 2 : C.
(A.) canaliculatus rufinus Beheim et Breuning,
194 3 and C. (A.) canaliculatus vojnitsi M andl, 19 79
permited us to elevate as valid species C. (A.) rufi-
nUS. 3 ) six Carabus taxa were recorded for the first
time for the Chinese fauna: C. ( Scambocarabus )
kruberi cf. chaos imura, 1 993; C. ( Tomocarabus )
caustomarginatus Imura et Mizusawa, 1994; C.
( Carabus ) manifestus pyonganicola d euve e t Li,
1998; C. (Morphocarabus) venustus cf. kaesongen-
sis imura, 1 993; C. ( Acoptolabrus ) schrencki
minpongsanensis Deuve et Li, 2003 and C. ( Ful -
genticarabus) flutschi koreus Deuve, 2006 . 4) C.
( Acoptolabrus ) constricticollis jilinicus d euve,
1992 was treated as a valid subspecies in the present
paper: C. (Acoptolabrus) constricticollis jilinicus
Deuve, 1992 stat. rest.
The adopted systematic order for the listed spe-
cies of genus Carabus is in accord to Deuve (2012).
RESULTS
Alt. Changbai Shan, Antu county, Jilin pro-
vince, China. 13 1 15. VI. 2012. Ql: Er-dao-bai-he,
elevation 800 m. Theropencedrymion
- Carabus {Aulonocarabus) rufinus b e h e i m et
Breuning, 1943 Status novo (Fig. 1). C. rufinus is
widespread in Liaoning Province, a single locality
was recorded from Jilin (Dongfeng, Xiaogyuedin-
gzi) nearby the border with Liaoning (Deuve et
al., 2011). The new locality on Changbai Moun-
tain is of great interest. On the same mountain but
at higher altitude (see Q3, 1850 m) we observed the
cohabitation with C. ( Aulonocarabus ) canaliculatus
Vojnitsi Mandl, 1979 (Figs. 4, 7, 8). In that case the
two taxa must belong to two different species and
C. (A.) rufinus must be treated as a different species:
Carabus { Aulonocarabus ) rufinus b eheim et b re li-
ning, 1943 stat. nov. The aedeagus of C. rujinUS is
very characteristic (Figs. 2, 3), the median lobe is
expanded and angled in the ventral side, the apex is
enlarged, spatula like. The aedeagus of C. Canal-
CulatUS Vojnitsi is smaller in general, without the
expansion of the median lobe and with the apex
shorter and simple (Figs. 5, 6, 9, 10); the aedeagus
is in general similar to the edeagus of C. ( Aulono -
carabus) canaliculatus Adams, 1 8 1 2 . C. rufinus is
a polimorphic species with several subspecies wide-
spread in North-Eastern China: Liaoning Province,
Jilin Province (marginal) and North-Western Korea.
The subspecies are: Carabus {Aulonocarabus) ru-
finus Beheim & Breuning, 1 943 C. (A.) ruflUUS pap -
pianus Mandl, 1980 comb. nov. C. (A.) rufinus
beizhenensis Deuve et Li, 2000 comb. nov.
- C. {Lepto carabus) seishinensis elongatipennis
Imura et Yamaya, 1994 (Fig. 11), a common species
in Korea Peninsula, is very local in North-Eastern
China known from only very few localities nearby
the border with North Korea (Deuve & Li, 2000a;
Deuve et al., 2011).
- C. (Scambocarabus) kruberi cf. chaos imura,
1993 (Fig. 12) By the shape of male aedeagus and
the sculpture of elytra the collected specimens are
close to the subspecies chaos Imura, 1993 from
North Korea. New subspecies for Chinese fauna.
- C. ( Tomocarabus ) fraterculus gaixianensis
Deuve etLi, 1998 (Fig. 13) By the cordate shape of
the pronotum and slightly blu elytra collected speci-
mens belong to gaixianensis Deuve et Li, 1998.
- C. ( Carabus) granulatus telluris b ates, 1883
(Fig. 16) The species is very constant in North-
E astern C hina.
- C. ( Carabus) manifestus pyonganicola Deuve
et Li, 1998 (Fig. 18) The species is very common
and widespread through Shanxi Province in the
North China to North Korea with some valid sub-
species. The specimens from Changbai Shan cor-
The Carabini from different altitudes of Changbai mountain, Jilin Province, North-Eastern China
211
okxypu*
Ur
b*
Him
Ch./
Cattal
VO
*
V*
KOJUU,
Rjhtag-giutg:
Chwin-Pay
Stt-ii- r *n.l700 -s
i9,?aii.
jbij im
1»(. *. p*pp
tt A* fojdit*
Fig . 1 . C. (A.) rufinUS, locality Q 1 , 28.5 mm. Fig. 2. Idem, aedeagus frontal view. Fig. 3. Idem, aedeagus lateral view. Fig. 4. C.
(A.) canaliculatus vojnitsi, locality Q3, 29 mm. Fig. 5. Idem, aedeagus frontal view. Fig. 6. Idem, aedeagus lateral view. Fig. 7.
Idem , holo type , 25 m m , w ith lab el. Fig. 8. Idem , holotype, details ofhead and pro no turn . Fig. 9. Idem , holotype, aedeagus frontal
view. Fig. 10. Idem, holotype, male aedeagus lateral view. Fig. 11. C. ( L .) seishinensis elongdtipeiVlis , locality Q 1 , 25 .2 mm.
212
Z. XUEPING ET ALII
Fig. 12. C. (S.) krubericf. chaos . locality Ql, 23.3 mm. Fig. 13. C. (T.) f rater cuius gaixianensis, locality Ql, 21mm. Fig.
14. C. (T.) fraterculus neochinensis, locality Q3, i 6 . 8 mm. Fig. 15. C. ( D .) caustomarginatus, locality Q2, 20 mm. Fig. 16.
C. (C.) granulatus telluris , locality q 1, 22.9 mm. Fig. 17. C. (C.) arvensis faldermanni, locality Q3, 1 9 . 1 mm.
The Carabini from different altitudes of Changbai mountain, Jilin Province, North-Eastern China
213
respond with the ssp. pyOTIgCITlicolci Deuve et Li,
1998 diffused not far in North Korea. New subspe-
cies for Chinese fauna.
- C. ( Morphocarabus ) hummeli pusongensis
Imura, 1 993 (Fig. 22) Very variable species with
a number of subspecies described through North-
Eastern Europe (Polar Ural), Siberia to the Pacific
Ocean (including Sakhalin and some sm all Islands
of Peter the Great Gulf). The very polychromus
specimens with green-violet pronotum and green
elytra margined with violet belong to the ssp. pu-
songensis Imura, 19 9 3.
- C. ( Morphocarabus ) wulffiusi dekraatzi k raatz,
1881 (Fig. 23) The species is widely distributed and
common in North-Eastern China.
- C. ( Megodontus ) vietinghoffi caesareus Seme-
nov, 1906 (Fig. 25) The subspecies is widely distri-
buted in North-Eastern China (Deuve & Li, 2000 b).
- C. ( Acoptolabrus ) schrencki schrencki m ot-
schulsky, 1 860 (Fig. 26) The collected speci-
mens belong to the typical form widespread in
North-Eastern China and adjacent area of Far
East Russia.
- C. ( Acoptolabrus ) constricticollis jilinicus
Deuve, 1992 stat. rest. (Fig. 28). The two collected
specimens correspond well with the specimens
from Antu County area from where was originally
described C. C. jilinensis Li, 1992 (name changed
in C. (A.) C. jilinicUS Deuve, 1 992) by general
morphology and size, also the elytra sculpture is
much more interrupted with less elevated tuber-
cles. The subspecies jilinicus was considerated as
a mere synonym of C. constricticollis COYlStricti-
Collis Kraatz, 1886 by Deuve & Li (2000 b). In
our opinion, the collected specimens from the new
locality confirm the differences between the two
subspecies; the nominal subspecies is widespread
in a large area of Heilongjiang, Jilin and Liaoning
Provinces, and jilinicus is more localized on the
mountain area of East Jilin near the border with
N orth K orea.
- C. ( Damaster) jankowskii lii d e u v e , 1 9 9 8 (Fig.
3 0). By the green lu stre of ely tra th e pop u la t ion w ell
corresponds to the ssp. Hi Deuve, 1998.
- C. ( Damaster, smaragdinus liaodongensis l i ,
1 992 (Fig. 31) The specimens show very shiny
cold-green elytra without any cupper color. The
pronotum is cupper-greenish, elongate (ratio L/l =
1.12) and the head very elongate.
Q2: Huang-song-pu-lin-chang, elevation 1300
m. Coniferous forest
- Calosoma (Calosoma) inquisitor cyanescens
Motschulsky, 1 859.
- C. ( Aulonocarabus ) rufinus Beheim et Breu-
n in g , 1943.
- C. ( Diocarabus ) caustomarginatus imura et
Mizusawa, 1994 (Fig. 15) This beautiful taxon d e -
scribed from North Korea for the first time is indi-
cated from China. New species for the Chinese
f au n a .
- C. ( Carabus) manifestus pyonganicola d eu ve
et Li, 1998.
- C. ( Carabus ) szeli changbaicus Rapuzzi et Li
n. ssp. (Fig. 19) In this locality as well as at higher
altitude (see Q3, 1 850 m) we found a small size Ca-
rabuS s. str. close to C. angUStUS Roeschke, 1898
species group typical from North Korea. After exa-
mination and comparison of the collected speci-
mens with the closest taxa, we found that they
belong to a new subspecies close to C. ( Carabus )
SZeli Deuve, 1994. See description below.
- C. ( Acoptolabrus ) schrencki minpongsanensis
Deuve et Li, 2003 (Fig. 27) By the small size, small
and tiny head, shape of pronotum, sculpture of ely-
tra, the collected specimens belong to the subspe-
cies m inpongsanenis Deuve et Li, 2003 described
and known not far in the Northern part of North
Korea. It is the first locality recorded to China. New
subspecies for the Chinese fauna.
- C. ( Acoptolabrus ) constricticollis jilinicus
Deuve, 1992.
- C. ( Damaster ) jankowskii jankowskii Oberthur,
1 8 8 3 (Fig. 29) The elytra are black with a luster
green margin and well correspond to the typical
form widespread in North Korea.
- C. (Damaster) smaragdinus coreicus Hauser,
1921. The species is widespread in North-Eastern
China with several subspecies described, most of
them are with green or blue-green color of elytra.
The specimens collected at low altitude of Chan-
gbai Shan (Ql, 800 m) well correspond to the ssp.
liaodongensis Li, 1992 by the green elytra color.
The specimens from Changbai Shan from medium
and high altitudes belong to the subspecies coreicus
known from North Korea and they are very diffe-
rent from the low altitude specimens. These speci-
mens are of large size (37.3 mm, male fig. 32),
orange-red color, and larger pronotum and head;
214
Z. XUEPING ET ALII
also the aedeagus is different: larger and more regu-
larly curved. Further investigations will be neces-
sary to better understand the systematic position of
C. S ITlCircl gditlUS on Changbai Shan Mountains. If
not any transition forms between liaodongensis and
COVeicUS w ill found at interm ediate altitude, the tw o
forms must be treated as valid species. Under that
consideration it will be possible that C. ( Darnaster )
smaragdinus and C. ( Damns ten branickii represent
two different species.
- C. ( Fulgenticarabus ) flutschi coreus d e u v e ,
2006 (Fig. 33) The collected specimens belong to
the subspecies COreUS Deuve, 2006 described and
known from a single locality in North Korea (Yan-
ggang, M t. Samjiyon San) not far from Changbai
Shan. New subspecies for the Chinese fauna.
Q3. Bai-shan-shang-fang, elevation 1850
m. Ermans Birch forest
- Calosoma ( Calosoma ) inquisitor cyanescens
Motschulsky, 1859.
- C. ( Aulonocarabus ) canaliculatus vojnitsi
Mandl, 1979 (Fig. A). As written above, in this lo -
cality we observed the cohabitation of two CarcibuS
C Aulonocarabus ) tax a: C. ( Aulonocarabus ) rufinus
Beheim et Breuning, 1943 and C. (A.) CCinClliculcitUS
Vojnitsi M an dl, 1979: the specimens with elongate
body, brown elytra and very dilated apex of aedea-
gus are C. (A.) rufinuS; the specimens with black
elytra, shorter body, larger pronotum and tiny apex
of aedeagus are C. (A.) CanaliculatUS Vojnitsi.
- C. ( Aulonocarabus ) rufinus B eheim et Breu-
ning, 194 3
- C. ( Tomocarabus ) fraterculus neochinensis
Deuve et Li, 1998 (Fig. 14). By the smaller body
size, the more regular elytral sculpture and the black
color, the specimens correspond exactly with the
subspecies neochinensis Deuve et Li, 1 998.
- C. ( Carabus ) arvensis faldermanni Dejean,
1 829 (Fig. 17). The taxon is known from different
localities of North-Eastern China, Far East Russia
North Korea; few localities are reported from South
Korea (Kwon & Li, 1984).
- C. ( Carabus ) szeli changbaicus n . ssp. See de-
scription below .
Fig. 18. C. (C.) manifestus pyonganicola, locality Ql, 22.4 mm. Fig. 19. C. (C.) szeli changbaicus n. ssp., holotype male,
21 mm. Fig. 20. Idem, aedeagus frontal view. Fig. 21. Idem, aedeagus lateral view.
The Carabini from different altitudes of Changbai mountain, Jilin Province, North-Eastern China
215
Fig. 22. C. (M.) hummeli pusongensis, locality Q 1, 25.2 mm. Fig. 23. C. (M.) wulffiusi dekraatzi, locality Q 1, 22 mm. Fig.
24. C. (M) venustus cf. kaesotlgensis, locality Q4, 1 6 .8 mm. Fig. 25. C. (M) vietinghoffi caesareus, locality Ql, 28.9 mm.
Fig. 26. C. (A.) schrencki schrencki, locality q 1 , 24,5 mm . Fig. 27. C. (A.) schrencki minpongsanensis, locality Q2, 24 mm .
216
Z. XUEPING ET ALII
B Sjk nk
w & y
JoBl ,
K.
: 'K' _ Sfr
< § \ / Oa
Fig. 28. C. (A.) constricticollis jilinicus, locality Ql, 28.8 mm. Fig. 29. C. (D.) jankowskii jankowskii, locality Q 2 , 32.7
mm. Fig . 30. C. ( D .) jankowskii lii, locality Q 1 , 3 6 .5 m m . Fig . 3 1 . C. (D.) SmaragdinUS liaodongensis , locality Q 1 , 3 3 mm.
Fig. 32. C. ( D .) SmaragdinUS coreicus, locality Q3, 37.7 mm. Fig. 33. C. (F.) flutschi coreus, locality Q 2 , 20.6 mm.
The Carabini from different altitudes of Changbai mountain, Jilin Province, North-Eastern China
217
- C. ( Morphocarabus ) venustus cf. kaesongensis
Imura, 1993. The specimens collected on the high
altitude of the Changbai Shan are very similar to the
specimens from the adjacent areas of North Korea.
By the morphological characters they belong to C.
(M.) venustus kaesongensis Imura, 1993. New sub-
species for the Chinese fauna.
- C. ( Damaster) smaragdinus coreicus Hauser,
192 1 (Fig. 32).
Q4. Nearby Tianchi weather station, ele-
vation 2100 m. Tundra belt
- C. ( Aulonocarabus ) rufinus Beheim etBreu-
nin g , 1 943.
- C. (Tomocarabus) fraterculus neochinensis
Deuve et Li, 1998 New subspecies for the Chinese
fau n a .
- C. ( Morphocarabus ) venustus cf. kaesongensis
Imura, 1 993 (Fig. 24).
New taxon
Carabus (Carabus) szeli changbaicus
Rapuzzi et Li n. ssp.
Holotype: 1 male, H u an g -so n g -p u -lin -ch an g ,
13 0 0 m., Mt. Changbai Shan, Antu county, Jilin
province, China. 13/15. VI. 2012 (Coniferous fo-
rest); preserved in Ivan Rapuzzi collection, Pre-
potto (UD), Italy. Paratype: 1 male, Bai-
shan-shang-fang, 1850 m., Mt. Changbai Shan,
Antu county, Jilin province, China. 1 3/1 5 .V 1.20 1 2
(Ermans Birch forest); preserved in Key Labora-
tory of remote sensing monitoring of geographic
environment, Harbin, China.
Description of holotype male. Length in-
cluding mandibles: 21 mm (Fig. 19), maximum
width of elytra: 7.1 mm. Color black with metallic
luster on head, dorsum and pronotum cupped with
margin of elytra green. Very close to C. (Carabus)
SZeli Deuve, 1 994 but separate by ticked head,
more parallel elytra with stronger elevated inter-
vals. Aedeagus (Figs. 20, 21) longer and thin; apex
more regular curved in frontal view. In lateral view
the apex is a little larger and more curved on the left.
Variability. In general very little variability: the
length of the body is 20.3 mm. The color is more
green and shiny.
Q1 locality
N-E China
Korea
Peninsula
l ) C. rufinus
X
2 ) C. seishinensis elongatipennis
X
3 ) C. kruberi c f . chaos
X
4) C. fraterculus gaixianensis
X
5 ) C. hummeli pusongensis
X
X
6 ) C. wulffiusi dekraatzi
X
7 ) C. granulatus telluris
X
X
8 ) C. manifestus pyonganicola
X
9 ) C. vietinghoffi caesareus
X
1 0 ) C. schrencki
X
1 1 ) C. constricticollis jilinicus
X
1 2 ) C. jankowskii lii
X
1 3) C. smaragdinus liaodongensis
X
10 taxa
5 taxa
Q2 locality
l ) C. rufinus
X
2 ) C. caustomarginatus
X
3 ) C. manifestus pyonganicola
X
4) C. szeli changbaicus n. ssp.
X
5) C. schrencki minpongsanensis
X
6 ) C. constricticollis jilinicus
X
7) C. jankowskii
X
8 ) C. smaragdinus coreicus
X
9) C. flutschi coreus
X
3 taxa
6 taxa
Q3 locality
l ) C. canaliculatus vojnitsi
X
2 ) C. rufinus
X
3 ) C. fraterculus neochinensis
X
X
4) C. arvensis faldermanni
X
X
5) C. szeli changbaicus n. ssp.
X
6) C. venustus cf. kaesongensis
X
7 ) C. smaragdinus coreicus
X
5 taxa
5 taxa
Q4 locality
l ) C. rufinus
X
2 ) C. fraterculus neochinensis
X
X
3) C. venustus cf. kaesongensis
X
2 taxa
2 taxa
Table 1 . The Carabus fauna of Changbai Shan.
218
Z. XUEPING ET ALII
CONCLUSIONS
The Carabini fauna of Changbai Shan Mountain
is of a great interest. The study of the collected speci-
mens from different altitudes and habitats permitted
us to (i) describe one new CdVdbuS taxon: C. SZeli
chdngbdicus n . ssp., (ii) record for the first time six
new CdTdbllS taxa for the Chinese fauna; and (iii)
better understand the system a tic position of CdTdbuS
(. Aulonocdmbus ) CdUdliculdtUS Adams, 1812 species
group and the status of C. (. AcoptoldbruS ) COYlStricti-
Collis jilinicUS Deuve, 1992. Further investigations
will be necessary to clarify the status of C. ( CoptO -
Idbrus) smdrdgdinus/bmnickii group that will be
possibly to be treated as separate species.
The Carabini fauna of Changbai Shan is very
rich: 23 CdVdbuS taxa and 1 CdloSOMd species were
recorded. In general the CdVdbuS fauna is some-
thing intermediate between the "classic" fauna of
North-Eastern China (9 taxa) and Korean Peninsula
fauna (11 taxa); one taxon seems to be endemic (C.
szeli chdngbdicus n . ssp .) b u t it b elo n g s to a typical
species group from Korean Peninsula (C. dngUStUS
species group) and 3 species are widespread in
North-Eastern China and Korean Peninsula. We
also found some differences in the Carabus fauna
from the four investigated areas of the Changbai
Shan Mountains. In fact many of the CdTdbuS spe-
cies collected at the lower altitude on the Western
slope of the mountain (locality Q 1, 800 m) belong
to the classic species known from North-Eastern
China. Instead the CdVdbuS from medium-high al-
titudes on Changbai Shan Mountain (localities
from Q2 to Q4, 1 300/2 100 m) are mainly the typi-
cal species from the North Korea fauna.
The table 1 report the collected CdTdbuS taxa
from every investigated localities and their main di-
stribution .
ACKNOWLEDGEMENTS
We wish to thank Dr. Thierry Deuve (Paris,
France) and Dr. Otto M erkl (Budapest, Hungary)
for loaning to one of us (I.R.) the holotypes of dif-
ferent Cdmbus ( Aulonocdmbus ) taxa necessary to
determinate the collected specimens. This work was
supported by a grant from the National Science
Foundation of China (No. 4 1 07 1 033; No.
411 0 1049), Innovation Talents Fund for Science
and Techno logy of Ha rb in: 2011RFXXN039. S up -
ported by China Postdoctoral Science Foundation
(20 1 2M 5 1 1 3 6 1 ).
REFERENCES
D euve Th., 2012. Une nouvelle classification du genre
CarabllS L ., 1 758. Association Magellanes: 1-56.
Deuve Th. & Li J. K., 2000a. Diagnoses des trois nouve-
aux CarabllS L. de la Chine, de la Coree et du Paki-
stan (Coleoptera, Carabidae). Coleopteres, 6: 55-76.
Deuve Th. & Li J. K., 2000b. Esquisse pour la connais-
sance du genre CarabuS L. en Chine du Nord-Est
(Carabidae). L am b illion ea, 100: 502-530.
Deuve Th., LiJ.K. & Zhang X.P., 2011. Surquelques Ca-
rabinae du Nord-East de la Chine (Coleoptera, Cara-
bidae). Les C oleopteriste, 14: 55-61.
Kwon Y.J. & Lee S.-M., 1984. Classification of the sub -
family Carabinae from Korea (Coleoptera: Carabi-
dae). Insecta koreana, 4: 1 -148, 107 pi.
Biodiversity Journal, 2013, 4 (1): 219-228
The Giant Butterfly-Moths (Lepidoptera Castniidae) of the
Upper Silesian Museum (Muzeum Gornoslqskie) in Bytom,
Poland, with notes on the history of the Museum
Jorge M. Gonzalez 1 , Pawel Domagala 2 & Adam Larysz 3
'Research Associate, McGuire Center for Lepidoptera & Biodiversity. California State University, Fresno, Department of Plant
Sciences, Fresno CA 93740-8033, USA
2 ul. Wolnosci 2, 42-713 Kochanowice, Poland
3 Upper Silesian Museum, Natural History Department, Sobieskiego 2, 41-902 Bytom, Poland
Corresponding author: [email protected]
ABSTRACT The Upper Silesian Museum was founded in 1910, and besides the struggles and restrictions
suffered during World War II it still remains as a relevant showcase for culture and science of
Silesia, its surrounding regions, the country and even the world. Its Natural History collections
are recognized as one of the largest and most important in the country. In an effort to revise
and curate the Lepidoptera collection, we found an interesting and well maintained group of
giant butterfly moths (Castniidae). Besides providing historical information on the Museum
and its origins, we also include a list with notes about the Castniidae under their care.
KEY WORDS Giant Butterfly-Moths; Castniidae; Biodiversity; Natural History.
Received 13.01.2013; accepted 19.02.2013; printed 30.03.2013
INTRODUCTION
It was 1910 when a group of history enthusiasts
founded the Bytom Historical-Museum Society
(Beuthener Geschichts-und Museumsverein). A
Museum was created with the private collections of
Mr. Simon Mach and the teacher Kurt Bimler, as
well as some city memorabilia and archival mate-
rials donated by the Bytom municipality. The law-
yer William Immerwahr, the priest Emanuel Bu-
chwald and the architect Carl Brugger were also
among the founders of the association. The holdings
of the museum were exhibited in two rooms as-
signed by the school (Oberrealschule) at Kloster-
straBe (now Szymanowski Street) in the present
Sikorski square. One of the rooms housed the col-
lections donated by the founders, while the other
showed a collection of minerals supervised by the
Upper Silesian Association of Technical and Mi-
ning Officials (Verein Bergtechnische Beamten
Oberschlesiens).
During the years 1929-1930 a new building
(where the Museum still stands today) (Fig. 1) was
built to host the collections, but the then named “Na-
tional Museum of the Upper Silesian” (Oberschle-
sisches Landesmuseum) officially opened its doors
the 24th of October 1932 (Fig. 2). The new Museum
included a Natural History Department after acqui-
ring a large collection of animal specimens, but
mainly birds, from the keen ornithologist Major Jo-
hann Nepomuk Walter Eberhard Drescher (1872-
1 938), a landowner near the Figota Otmuchow who
actively collected in the vicinities of Paczkow and
Otmuchow in Upper Silesia (Cempulik & Hadas,
220
J.M. GonzAlez, P. Domagala & A. Larysz
Figure 1. Upper Silesian Museum, Bytom, Poland (1940).
Figure 2. Hall of the Museum exhibiting mounted birds.
The Giant Butterfly-Moths (Lepidoptera Castniidae) of the Upper Silesian Museum in Bytom, Poland
221
1995). The first curator of the Department was Hu-
bert Emanuel Kotzias (1892-1941) (Fig. 3).
In October 1939, slightly over a month after the
German invasion, the Silesian Museum in Katowice
(which was in the Polish part of Silesia) was closed
and its entire collection was transported to Bytom’s
Museum and placed in storage. By 1943-1944 the
most valuable collections (including those from Ka-
towice) were moved to the western part of Upper
Silesia. As a result of the war, the activities of So-
viet war commissioner and looters, the Bytom’s
Museum building was damaged and the remains of
the collection were destroyed and dispersed. During
the stressful times of the World War II the curator
of the Natural History Department was the widely
recognized entomologist Sergiusz Toll (1893-1961)
(Reisser, 1962) (Fig. 4).
By March 1945, a group of people that were
members of the staff of the Silesian Museum helped
rescue and recover parts of the Katowice and By-
tom’s collections. These collections became the
basis for the reactivation of the museum in Bytom,
aiming to continue pre-war Museum traditions esta-
blished at the Silesian Museum. On May 10th,
1 946, the Museum of Silesia in Bytom opened its
first post-war exhibition which was devoted to the
Silesian uprisings. Permanent exhibitions dedicated
to natural, archaeological, and ethnographic issues
and a Polish art gallery opened to the public later in
1946 and in 1947. By this time, the museum had the
following departments: Archaeology, Ethnography,
History, History and Culture of Fviv, Nature and
Art. A library was also established, and it hosts
today over 50,000 volumes.
The Natural History Department inventory re-
vealed the presence of 54,320 objects by that time.
Included were also nature collections owned by
the museum but hosted in the cities of Gliwice,
Chorzow, Cieszyn and Pszczyna. Those, which
were also called “abandoned property” of the De-
partment of Natural History, included insect col-
lections assembled by both the renowned
coleopterologist Theodor Franz Wilhelm Kirsch
(1818-1889) (Anonymous, 1889; Kraatz, 1889)
and the entomologist Hans Nowotny (1897-1971).
Witold Niesiolowski (1866-1954), a retired mili-
tary man but knowledgeable amateur who volun-
teered as an entomologist after retirement from the
Austrian Army, was then in charge of the Depart-
ment (Feliksiak, 1987).
3 4
Figure 3 . Hubert Emanuel Kotzias ( 1 892- 1941), first curator
of the Natural History Department.
Figure 4. Sergiusz Toll (1893-1961), curator of the Natural
History Department during the World War II years.
Today, the Natural History Department has
one of Poland’s largest natural sciences collec-
tions, with 700,000 insects and about 150,000 only
in the order Fepidoptera. The entire nature collec-
tion was created after those taken from the Ober-
schlesisches Fandesmuseum, the former Silesian
Museum. These collections document the flora
and fauna of Silesia and other regions of Poland
and worldwide. The entomological (mainly butter-
flies and moths, beetles, dragonflies, wasps, lace-
wings) and the ornithological (bird dermoplasties,
nests, eggs) collections are the most valuable and
largest at the Bytom’s museum today. Noteworthy
are also the collections of mammals, arachnids,
mollusks and the more than 12,000 herbarium
sheets of vascular plants.
The Bytom’s collection of Castniidae is a part
of the newly created entomological collection of the
Museum, which gathered specimens from different
collections. After a detailed investigation of the ar-
chives of the museum we found a total of 20 speci-
mens belonging to 14 species and 17 taxa of Giant
Butterfly-moths (Figs. 5-16). However, we could
not find any information on how they were ob-
tained. Even though all pre-war archives were de-
stroyed during the war, we are certain that all
specimens were probably bought during pre-war
times, after the German Occupation of Poland, as
evidenced by the labels written in German. Fortu-
nately enough, the specimens have been maintained
well and are in very good to excellent condition.
222
J.M. GonzAlez, P. Domagala & A. Larysz
ANNOTATED LIST OF CASTNIIDAE OF
THE UPPER SILESIAN MUSEUM SPECI-
MENS
Eupalamides cyparissias amazonensis
(Houlbert, 1917)
This crepuscular species is known as pest of se-
veral Palms (Arecaceae) including some crops (i.e.
Coccos nucifera L., Elaeis guineensis L.), and it is
distributed along the Amazon basin, in Northern
Brazil, Colombia and Peru (Houlbert, 1917; Miller,
1986; Gonzalez et al., 2010; Hemandez-Baz at al.,
2012). The Bytom’s specimen is in very good con-
dition, except for a light damage in its left hind
wing (Fig. 1) which was repaired by using a piece
of wing from an unknown Lepidoptera.
Examined material. 1 male, Iquitos, Omaguas,
150 m. [Peru], 360, Castnia daedalus Am, 5959/
3286, coll. Upper Silesian Museum (USMB)
Bytom, Poland.
Amauta cacica angusta (Druce, 1907) (Fig. 7)
Described originally from Ecuador (as Castnia
angusta ), not much is known about this subspecies
(Druce, 1907; Miller & Sourakov, 2009). Larvae of
this subspecies are associated with Heliconia (He-
liconiaceae) and Musa (Musaceae) plants in Ecua-
dor (Suarez-Capello et al., 2002; Miller &
Sourakov, 2009).
Examined material. 1 male, Macas, Ecuador
or., 359, Castnia angusta Am, 5959/ 32960, coll.
Upper Silesian Museum (USMB) Bytom, Poland.
Amauta cacica procera (Boisduval, [1875])
(Fig. 5)
This large species is distributed from Guate-
mala to Panama, but very few specimens with ade-
quate data are known from museum collections
(Miller, 1986; Gonzalez & Stunning, 2007; Miller
& Sourakov, 2009; Gonzalez & Hernandez-Baz,
2012). This subspecies has been observed feeding
on flowers of Heliconia pogonantha Cuf. (Helico-
niaceae), which is also a possible larval hostplant
(Miller & Sourakov, 2009).
Examined material. 1 male, Chiriqui, Panama,
358, Castnia cacica Am., 5959/ 32176, coll. Upper
Silesian Museum (USMB) Bytom, Poland.
Amauta papilionaris velutina (Houlbert, 1917)
This beautiful subspecies, was originally descri-
bed (as Castnia velutina) based on a female from
Ecuador (Houbert, 1917). It has only subtle diffe-
rences from the nominate species which is of Co-
lombian distribution (Miller, 1986). It has been
suggested that all four supposed subspecies of A.
papilionaris could be nothing more than simple se-
xual dimorphisms or local geographic variations
(Miller, 1986).
Examined material. 1 male, Riobamba, Ecua-
dor, 2000 m., 357, Castnia papilionaris Am, 5959/
32763, coll. Upper Silesian Museum (USMB)
Bytom, Poland.
Hista fabricii (Swainson, 1823) (Figs. 8, 9)
This species used to be considered as two to four
different ones by some authors, while others consi-
dered it to have several subspecies (Dalla Torre,
1913; Houlbert, 1918; Lamas, 1995; Miller, 1995).
Those treatments where mainly based on simple in-
trapopulational variations but its real status has been
clarified and the species is actually considered mo-
notypic (Moraes et al., 2010). The scarcity of col-
lection information is likely one of primary factors
limiting our understanding of the morphological-
geographical variations of the species (Moraes et
al., 2010). It was, however, interesting to find that
both sexes of the species collected from the same
region are in Bytom’s Museum collection.
Examined material. 1 male, Brasilien, Santa
Catharina, Timbo-Blumenau, 400 m., 347, Dez.-Ja-
nuar., Castnia boisduvali Am, 5959/32823, coll.
Upper Silesian Museum (USMB) Bytom, Poland;
1 male, Brasil, Castuia[ sic] basckei[ sic] leg.,
5959/30745, coll. Upper Silesian Museum (USMB)
Bytom, Poland [beheaded specimen]; 1 female,
idem, 5959/32869, coll. Upper Silesian Museum
(USMB) Bytom, Poland.
Imara pallasia (Eschscholtz, 1821) (Fig. 10)
This species is restricted to South-Eastern Brasil
(Miller, 1986; Gonzalez & Stunning, 2007; Gonza-
lez et al., 2010). It is a species found within the
cloud forests ecosystem (Miller, 1986). Unfortu-
nately not much more is known about the ecology
and biology of this species.
The Giant Butterfly-Moths (Lepidoptera Castniidae) of the Upper Silesian Museum in Bytom, Poland
223
Figures 5-16. Castniidae of the Upper Silesian Museum, Bytom, Poland. Fig. 5: Amauta cacica procera, Chiriqui,
Panama. Fig. 6: Geyeria hubneri, Santa Catharina, Brasil. Fig. 7: Amauta cacica angusta, Macas, Ecuador. Fig. 8:
Hista fabricii male, Brasil. Fig. 9: Hista fabricii female, Brasil. Fig. 10: Imam pallasia, Rio de Janeiro, Brasil. Fig.
11: Castnia invaria volitans, Magdalena, Colombia. Fig. 12: Prometheus cochrus, Riobamba, Ecuador. Fig. 13:
Divana diva diva , St. Laurent, French Guiana (?). Fig. 14: Telchin licus magdalena, Caqueta, Colombia. Fig. 15: Ga-
zera heliconioides, Amazonas, Brasil. Fig. 16: Xanthocastnia evalthe evalthoides, Riobamba, Ecuador. Scale: 10 mm.
224
J.M. GonzAlez, P. Domagala & A. Larysz
Examined material. 1 female, Rio [de] Ja-
neiro, [Brasil], 361, Castnia umbratula Am,
5959/32535, coll. Upper Silesian Museum
(USMB) Bytom, Poland.
Imara satrapes (Kollar, 1839)
This beautiful species is sympatric with the
above mentioned I. pallasia and it is commonly
found in the southeastern region of Brazil. The
fore wing patterns of both species are very different,
but the hindwing markings are highly variable in
I. satrapes and in some specimens they might re-
semble those of I. pallasia (Gonzalez & Stunning,
2007; Rios & Gonzalez, 2011). Its larvae are bo-
rers of Bromeliaceae (Biezanko, 1961a,b; Miller,
1986; Rios & Gonzalez, 2011). The Bytom’s spe-
cimen was originally collected and determined by
the Polish Entomologist Czeslaw Marian Biezanko
(1895-1986). Biezanco (1961a,b) mentions that the
species is common in Pelotas, Brasil, and that it
flies in December and January, from 1 1 :00 to 1 5:00
along wood clearings. He also named the “form”
found in Pelotas as “ Castnia satrapes catharina ”
(Biezanko, 1961a,b) (=Imara satrapes catharina ),
which is now synonymized under I. satrapes (see
Rios & Gonzalez, 2011).
Examined material. 1 male, Pelotas [Rio
Grande do Sul, Brasil], 23.1.[19]52, C. Biezanko
leg.; Castnia satrapes Kollar, 1839, C. Biezanko
det., 5959/31825, coll. Upper Silesian Museum
(USMB) Bytom, Poland.
Castnia invaria volitans Lamas, 1995 (Fig. 11)
A subspecies commonly found in northern re-
gions of South America, north of the Amazon, and
along the Orinoco River basin, from Colombia,
through Venezuela and east to the Guianas (Gon-
zalez & Stunning, 2007; Gonzalez et al., 2010).
This singular specimen clearly confirms the pre-
sence of the species in Colombia, however several
specimens belonging to this ssp. are known from
the country (J. Salazar, pers. comm.).
Examined material. 1 female, Rio Magda-
lena, Aipe, Columbien, 600 m, Castnia icarus Am,
Castnia icarus Brm female, 5959/32625, coll.
Upper Silesian Museum (USMB) Bytom, Poland.
Telchin licus (Drury, 1773)
The species T. licus (Drury, 1773) is one of the
most common Castniidae found in Lepidoptera col-
lections worldwide, mainly because it is a pest of
Sugarcane ( Saccharum officinarum L., Poaceae),
bananas ( Musa spp., Musaceae) and heliconias (He-
liconiaceae) (Gonzalez & Cock, 2004; Gonzalez
&FemandezYepez, 1993; Gonzalez & Stunning,
2007; Gonzalez et al., 2010; Miller, 1987;Moraes &
Duarte, 2009; Silva-Brandao et al., 2013). The taxo-
nomy of the several associated subspecies is confu-
sing since many specific and subspecific epithets
have been proposed based sometimes in simple va-
riations of wing color patterns (Miller, 1986; Gon-
zalez & Stunning, 2007). Lamas (1995) would
consider this as the ssp. T. licus licoidella (Strand,
1913). However, Silva-Brandao et al. (2013) studied
several specimens from different regions of Brazil,
and found that T. licus albomaculata (Houlbert,
1917) genetically corresponds well with those in the
Amazon region including the Peruvian Amazon,
where this specimen comes from. Could the suppo-
sed ssp. “ licoidella ” remain valid after a genetic
comparison? Since specimens with these phenotypic
characters have been found with more typical
“licus” populations (Miller, 1986, 1995; Gonzalez
& Cock, 2004) we prefer to follow Gonzalez &
Stunning, ’s (2007) approach and not include the By-
tom’s specimen in any other subspecies herein.
Examined material. 1 male, Ob. Hualaga, N.
Peru, Castnia licoidella Am, Castn. Licoidella 80
Pfg., 5959/32911, coll. Upper Silesian Museum
(USMB) Bytom, Poland.
Telchin licus magdalena (Joicey et Talbot, 1925)
(Fig. 14)
This subspecies was originally described by
Joicey & Talbot (1925) based on a large series of
male and female specimens originally collected
in Villavicencio, Colombia. However, it appears
that the subspecies has a wider distribution in the
country (Julian Salazar, pers. comm.). Other than
the fact that this ssp. might be a pest of sugarcane
in the region where it occurs, not much else is
known (Julian Salazar, pers. comm.).
Examined material. 1 female, Castnia licus,
MottaTeff. Caqueta, Columbia[sic], 5959/34325,
coll. Upper Silesian Museum (USMB) Bytom,
Poland.
The Giant Butterfly-Moths (Lepidoptera Castniidae) of the Upper Silesian Museum in Bytom, Poland
225
Xanthocastnia evalthe evalthoides (Strand, 1913)
(Fig. 16)
This subspecies was described from Bolivia (as
Castnia evalthoides ) by Strand (1913). However,
specimens have been collected in the high Amazon
and effluents from the Andes piedmonts in several
localities from Bolivia, Brazil, Ecuador and Peru
(Houlbert, 1918). Even though not much is known
about the species and its supposed several subspe-
cies it appears that their larvae feed on terrestrial
Bromeliaceae (Miller, 1986).
Examined material. 1 male, Riobamba, Ecua-
dor, 2000 m., Castnia evalthoides Am, 5959/33092,
coll. Upper Silesian Museum (USMB) Bytom, Po-
land.
Geyeria hubneri (Gray, 1838) (Fig. 6)
Some researchers still mention “Latreille, 1830”
as author of this species (Miller, 1986, 1995), based
on text and image presented by Pierre Andre La-
treille in Cuvier (1830). However, Lamas (1995)
has clearly stated that “ Castnia hubneri Latreille,
1830” should be considered a ghost name since the
name “ Castnia hubneri ” was first made available
by Gray (1838). Virtually nothing is known of this
species, except that they are found in some areas of
South East Brasil (Gray, 1838; Bucheker, [1880];
Miller, 1986; Gonzalez et al., 2010).
Examined material. 1 female, Brasilien, Santa
Catharina, Timbo-Blumenau, 400 m. Dez.-Januar,
630, Castnia sp. Am, 5959/32375, coll. Upper Si-
lesian Museum (USMB) Bytom, Poland.
Prometheus cochrus (Fabricius, 1787) (Fig. 12)
This species is also distributed throughout Sou-
theast Brazil (Gonzalez et al., 2010). It resembles
Parides ascanius (Papilionidae) behaviorally, and
they both might be copying some other model and
be all part of a larger mimetic ring (Miller, 1986).
Its larvae have been found feeding on Bromelia an-
tiacantha Bertol, and Tillandsia aeranthos (Loisel)
L.B. Smith, as well as other bromeliads (Brome-
liaceae) (Biezanko, 1961a; Miller, 1986; Gonzalez
et al., 2010).
Examined material. 1 female, C. garbei Fott.
female Brasil. Collection Niepelt, 5959/31706, coll.
Upper Silesian Museum (USMB) Bytom, Poland
[this is very interesting specimen. It appears that it
was collected by Jose G. Foetterle (18??- 1929), a
well-known lepidopterist from Brasil. The speci-
men was traded with Friedrich Wilhelm Niepelt
(1862-1936) who placed it in his collection. Since
most of Niepelt’s collection was scattered to seve-
ral European Museums during and after WWII it
is not surprising that this particular specimen
ended up in Bytom’s]; 1 female, Riobamba, Ecua-
dor, 2000 m., 364, Castnia garbei Am, Castnia
garbei female, 5959/32306, coll. Upper Silesian
Museum (USMB) Bytom, Poland.
Divana diva diva (Butler, 1870) (Fig. 13)
The unusual wing maculation and coloration of
the species and its ssp., makes them one of the most
beautiful Castniidae. Even though not much is
known about the species, collection records seem
to indicate that the genus is bivoltine, with crepu-
scular flight periods during December- January and
July- August (Miller, 1986). This polytypic species
is distributed from Mexico, throughout Central
America, and to Colombia and Ecuador (Lamas,
1995; Miller, 1995; Vinciguerra, 2010). Specimens
from the nominal ssp. have been collected in Co-
lombia and Ecuador (Vinciguerra, 2010). The spe-
cimen owned by the Bytom’s Museum is clearly
the ssp. diva, which is commonly found from Me-
xico to Ecuador (Vinciguerra, 2010). It is even
more curious that this specimen bears a label that
clearly states that it was collected in French
Guyana (see Material examined below). Beneluz
& Gallard (2012) report the presence of 19 taxa of
Castniidae in French Guyana after carefully stu-
dying several collections from the country. Howe-
ver, not a single specimen of D. diva is mentioned.
In addition, our (J.M.G.) revising of several
Castniidae collections worldwide has not revealed
evidence of any specimen of this species collected
in French Guyana. Curiously enough, Gonzalez et
al. (2010) report a specimen of D. diva (actually D.
diva chiriquiensis ) from Brazil at the Field Mu-
seum of Natural History, Chicago, Illinois, USA,
which was originally traded or exchanged by Her-
man Strecker with Otto Staudinger. Since the ssp.
chiriquiensis is Colombian-Panamanian in distri-
bution (Strand, 1913; Salazar, 1999; Vinciguerra,
226
J.M. GonzAlez, P. Domagala & A. Larysz
2010) , the authors suspected that the specimen was
mislabeled (Gonzalez et al., 2010). Could it be that
this supposedly French-Guy anan specimen of D.
diva diva was also mislabeled?
Examined material. 1 male, St. Laurent, Ma-
roni Fluff Franz Guayana, 300 m, Januar-Marz,
Castnia diva Am., 5959/32944, coll. Upper Silesian
Museum (USMB) Bytom, Poland.
Divana diva tricolor (Felder, 1874)
As with all subspecies in the group, not much
is known of its biology and ecology. Even though
Felder (1874) reported (and illustrated) this sub-
species from specimens collected in Bogota and
Chiriqui, it is more commonly found in the central
regions of Colombia (Houlbert, 1918; Salazar,
1999; Vinciguerra, 2010).
Examined material. 1 male, Cartago, Caucatal,
[Cauca Valley], Columbien, 600 m, Castnia diva
Am, 5959/33094, coll. Upper Silesian Museum
(USMB) Bytom, Poland.
Gazera heliconioides Flerrich- Schaffer, [1853]
(Fig. 15)
Members of this genus are easily recognized by
a coloration pattern that resembles the genera Ly-
corea (Nymphalidae Danaidae) and Thyridia and
Methona (Nymphalidae Ithominae), as well as the
species Notophyson heliconides (Erebidae Arctii-
nae), and their interactions and possible mimetic
significance have been studied (Lamas, 1973; Mil-
ler, 1986; Contreras, 2009; Rios & Gonzalez,
2011) . The genus appears to be bivoltine, espe-
cially in the Amazon Basin (Miller, 1986). Several
subspecies have been described from various re-
gions in South America, from Venezuela and Co-
lombia, southward to Bolivia, Paraguay and
Southern Brazil (Miller, 1986; Contreras, 2009;
Rios & Gonzalez, 2011). Even though their host is
not known, suspect abounds about the possibility
that its larvae feed on Bromeliaceae (Contreras
2009; Rios & Gonzalez, 2011).
Examined material. 1 female, Manacapuru,
Amazonenstrom, [Brasil], 39 m. Febr - Marz, 316,
heliconoides [sic]?, Castnia heliconoides [sic] Am,
5959/32191, coll. Upper Silesian Museum (USMB)
Bytom, Poland.
Paysandisia arch on (Burmeister, 1918)
This species was originally restricted to nor-
thern Argentina, South East Brasil, western Uru-
guay and Paraguay, but it was introduced in
Europe sometime between 1985 and 1995 where it
is now considered an important pest of ornamental
palms (Arecaceae) (Aguilar et al., 2001; Sarto I
Monteys, 2002; Gonzalez & Stunning, 2007; Rios
& Gonzalez, 2011).
Examined material. 1 female, Kongo, 1952, T.
Spalstenstein, Coll. Tadeusz Spaltenstein. [The lo-
cality appears to refer to the Republic of the Congo
(Kongo in German) in central Africa. Paysandisia
archon was introduced in Europe sometime bet-
ween the mid 80’s and mid 90’s (Aguilar et al.,
2001) and as far as we know there are no reports of
the species in any African country. We assume that
the specimen was mislabeled.]
ACKNOWLEDGEMENTS
We are greatly indebted to John T. Bushoven
(California State University, Fresno, USA), Julian
Salazar (Museo de Historia Natural Universidad de
Caldas, Colombia) and Roberto Vinciguerra (Pa-
lermo, Italy) for their insightful comments and ad-
ditions that help us improve the original manuscript.
REFERENCES
Aguilar L., Miller J.Y., & Sarto I Monteys, V., 2001. A
new Lepidopteran family for the European fauna.
SHILAP Revista de Lepidopterologia, 29: 86-88.
Anonymous, 1889. [Kirsch, Th. F. W.]. Entomology
Monthly Magazine, (3)25: 402.
Beneluz F. & Gallard J.-Y., 2012. Les Castniidae de
Guyane Frangaise (Lepidoptera: Castniidae). In: La-
comme D. & Manil L. (Eds.). Lepidopteres de
Guyane - Tome 6: Castniidae, Erebidae (Letis), Sa-
turniidae (Eacles), pp. 14-38.
Biezanko C.M., 1961a. Castniidae, Zygaenidae, Dalce-
ridae, Eucleidae, Megalopygidae, Cossidae et Hepia-
lidae da Zona Sueste do Rio Grande do Sul.
Archivosde Entomologia da Escola de Agronomia
“Eliseu Maciel” (Pelotas) (A), 14: 1-13.
Biezanko C.M., 1961b. Castniidae, Zygaenidae, Dalce-
ridae, Eucleidae, Megalopygidae, Cossidae et Hepia-
lidae da Zona Sueste do Rio Grande do Sul.
The Giant Butterfly-Moths (Lepidoptera Castniidae) of the Upper Silesian Museum in Bytom, Poland
227
Archivosde Entomologia da Escola de Agronomia
“Eliseu Maciel” (Pelotas) (B), 14: 1-12.
Bucheker H., [1880]. Systema entomologiae sistens in-
sectorum Classes, Genera, Species. Pars 6: 2+ 30 pis.
Munchen, Author.
Cempulik P. & Hadas, T.B., 1995. Eberhard Drescher.
Przyrodnik i kolekcjoner. Przyroda Gomego SI ask a,
1: 11.
Contreras A. O., 2009. Registros de Gazera heliconioides
micha (Druce, 1 896) (Lepidoptera: Castniidae) en la
Ecoregion del Neembucu, Paraguay. Azariana, 1:18-
22 .
Cuvier [G.], 1830. Le Regne Animal Distribue D’Apres
son Organisation pour servir de base a L’Histoire na-
turelle des Animaux et D’ Introduction a L’Anatomie
Comparee. Nouvelle Edition, Revue et Augmentee.
Tome III. Paris: Chez D’eterville, Libraire, 504 pp.
Dalla Torre K.W., 1913. Castniidae: subfam. Castniinae,
Neocastniinae, Pemphigostolinae. Lepidopteroram
Catalogus, 15: 1-28.
Druce H., 1907. Descriptions of five new species of He-
terocera. Annals and Magazine of Natural History,
20: 505-506.
Felder C., 1874. Reise der osterreichischen Fregatte No-
vara um die Erde in den Jahren 1857, 1858, 1859
unter den Befehlen des Commodore B. von Wiiller-
storf-Urbair. Zoologischer Theil. Zweiter Band.
Zweite Abtheilung: Lepidoptera: 4: 1-10. pis. 75-107.
Wien: C. Gerald’s Sohn.
Feliksiak S., 1987. Witold Niesiolowski. Slownik Biolo-
gow Polskich. Warszawa: Panstwowe Wydawn,
Nauk, 390 pp.
Gonzalez J.M., Boone J.H., Brilmyer G.M. & Le D.,
2010. The Giant Butterfly-moths of the Field Mu-
seum of Natural History, Chicago, with notes on the
Herman Strecker Collection (Lepidoptera: Castnii-
dae). SHILAP Revista de Lepidopterologia, 38:
385-409.
Gonzalez J.M. & Cock M.J.W., 2004. A synopsis of the
Castniidae (Lepidoptera) of Trinidad and Tobago,
Zootaxa, 762: 1-19.
Gonzalez J.M. & Hemandez-Baz. 2012. Polillas y tala-
dradores gigantes de la familia Castniidae (Lepidop-
tera) de Guatemala. In: Cano E.B. & Schuster J.C.
(Eds.). Biodiversidad de Guatemala, Volumen 2.
Guatemala: Universidad del Valle de Guatemala, pp.
145-153.
Gonzalez J.M. & Fernandez Yepez F., 1993. Lista pre-
liminar de las especies de Castniinae (lepidoptera:
Castniidae) del Parque Nacional “Henri Pittier”,
Venezuela. Diagnosis y comentarios. Memorias de
la Sociedad de Ciencias Naturales La Salle, 53:
47-53.
Gonzalez J.M. & Stunning D., 2007. The Castniinae at
the Zoologisches Forschungsmuseum Alexander
Koenig, Bonn (Lepidoptera: Castniidae). Entomolo-
gische Zeitschrift, 117: 89-93.
Gray G.R., 1838. Synopsis of the species belonging to
the genus Castnia. Transactions of the Entomological
Society of London, 2: 140-149.
Houlbert C., 1917. Diagnoses de Castnies nouvelles et
rectification de quelques noms indumenta employes.
Etudes de Lepidopterologie Comparee, 13: 49-87.
Houlbert C., 1918. Revision monographique de la sous-
famille des Castniinae. Etudes de Lepidopterologie
Comparee, 15: 1-730.
Joicey J.J. & Talbot G., 1925. Notes on some Lepidop-
tera, with descriptions of new forms. Annals and Ma-
gazine of Natural History, (9)16(96): 633-653.
Kraatz G., 1889. [Kirsch, Th. F. W.]. Deutsches Entomo-
logische Zeitschrift, 4: 8.
Lamas G., 1973. Taxonomia e Evolucao dos generos Ituna,
Doubleday (Danainae) e Paititia , gen. n., Thyridia
Hubner e Methona Doubleday (Ithominae). Ph.D. the-
sis. Universidade de Sao Paulo, Brazil. 225 pp.
Lamas G., 1995. A critical review of J. Y. Miller’s chec-
klist of the Neotropical Castniidae (Lepidoptera). Re-
vista Peruana de Entomologia, 37: 73-87.
Miller J.Y., 1986. The Taxonomy, Phylogeny, and Zoo-
geography of the Neotropical Castniinae (Lepidop-
tera: Castnioidea: Castniidae), Ph.D. Thesis.
University of Florida, Gainesville. 571 pp.
Miller J.Y., 1987. Castniidae (Castnioidea). In: Stehr F.
W. (Ed.), Immature Insects. Dubuque, Iowa: Ken-
dall/Hunt Publishing Company, pp. 417-419
Miller J.Y., 1995.- Castnioidea: Castniidae: Castniinae:
In: Heppner J.B. (Ed.). Checklist: part 2. Hyblaeoi-
dea-Pyraloidea-Tortricoidea. Atlas of Neotropical Le-
pidoptera.- Gainesville, Florida: Association for
Tropical Lepidoptera and Scientific Publishers, pp.
133-137.
Miller J.Y. & Sourakov A., 2009. Scientific note: some
observations on Amauta cacica procera (Boisduval)
(Castniidae: Castniinae) in Costa Rica. Tropical Le-
pidoptera Research, 19: 113-114.
Moraes S.S. & Duarte M., 2009. Morfologia externa
comparada das tres especies do complexo Telchin
liens (Drury) (Lepidoptera, Castniidae) com uma si-
nonimia. Revista Brasileira de Entomologia, 53: 245-
265.
Moraes S.S., Duarte M. & Gonzalez J.M., 2010. Revision
of Hista Oiticica (Lepidoptera: Castniidae) and di-
scusion on the validity of its subspecies. Zootaxa,
2421: 1-27.
Reisser H., 1962. Dr. Sergiusz (Graf von) Toll. Zeitschrift
Wiener Entomologische Gesselschaft, 47: 79-85.
Rios S.D. & Gonzalez J.M., 2011. A synopsis of the Ca-
stniidae (Lepidoptera) of Paraguay. Zootaxa, 3055:
43-61.
228
J.M. GonzAlez, P. Domagala & A. Larysz
Salazar J.A., 1999. Datos de recoleccion para 16 especies
de castnidos colombianos (Lepidoptera: Castniidae).
Boletln Cientlfico del Museo de Historia Natural,
Universidad de Caldas, Manizales, 3: 43-51.
Sarto i Monteys, V., 2002. The discovery, description
and taxonomy of Paysandisia archon (Burmeister,
1880), a castniid species recently found in south-we-
stern Europe (Castniidae). Nota Lepidopterologica,
25: 3-15.
Silva-Brandao K.L., Almeida L.C., Moraes S.S. & Con-
soli F.L., 2013. Using population genetic methods to
identify the origin of an invasive population and to
diagnose cryptic subspecies of Telchinlicus (Lepidop-
tera: Castniidae). Bulletin of Entomological Rese-
arch, 103: 89-97.
Strand E., 1913. Gattung: Castnia F. In: Seitz A. (Ed.).
Die Gross-Schmetterlinge der Erde, 6: 7-17. A. Ker-
nen, Stuttgart.
Suarez-Capello C., Belezaca C., Flowers W., Echeverria F.,
Carroll R.R., Williams R., Ellis M., Norton G., Alwang
J. & Justicia., 2002. IPM for plantain/coffee agro fore-
stry system in northwestern Ecuador: a land use
alternative to low-quality pasture within a
fragile agro-ecosystem. The Integrated Pest manage-
ment Collaborative Research Support Program
(IPM CRSP). Ninth Annual Report, 2002.
http://www.oired.vt.edu/ipmcrsp/Publications/An-
nualReports/2002/Ecuador/ecuador topic 1 5 .pdf
Vinciguerra R., 2010. Observazioni sulla distribuzione di
Divana diva hoppi (Hering, 1923) (Lepidoptera: Ca-
stniidae). SHILAP Revista de Lepidopterologia, 38:
379-383.
Biodiversity Journal, 2013, 4 (1): 229-234
Gastrointestinal helminths in the local chicken Gallus gallus
domesticus (Linnaeus, 1 758) in traditional breeding of North-
Western Algeria
FouziaYousfi, Kheira Senouci*, llyes Medjoual, Hanene Djellil &Touria Hadj Slimane
Department of Biology, Faculty of Sciences, University of Oran, Algeria
’Corresponding author, email: [email protected]
ABSTRACT This study was aimed to identify the gastrointestinal helminths of local chicken, Gallus gallus
domesticus (Linnaeus, 1758), in traditional breeding of North-Western Algeria and to deter-
mine their prevalence and average abundance. For this purpose, 114 local chickens were ex-
amined between November 2010 and May 2012. The results show an overall prevalence of
100%, with a mean intensity of infection of 124 parasites per chicken. The birds were infected
whatever the sex, weight and season. The parasitic fauna was composed of four taxonomic
groups with prevalence significantly different (P<0.05): cestodes (95.61%), nematodes
(93.86%), trematodes (18.42%) and acanthocephalan (1.75%). The most prevalent cestode
species encountered were: Raillietina echinobothrida (85.09%), R. cesticillus (30.70%) and
Hymenolepis carioca (28.95%). The predominant nematode species were Heterakis gallina-
rum (78.07%), Subulura brumpti (62.28%), Ascaridia galli (39.47%) and Capillaria cau-
dinflata (35.96%). The trematode species recorded were Postharmostomum gallinum
(18.42%) and Brachylaema sp. (2.63%). Finally, only one acanthocephalan, Prosthorhynchus
sp. (1.75%), was found. Among these helminths, the highest average abundance occurred
with Heterakis gallinarum (39.04) and Subulura brumpti (35.88). This study revealed the im-
portance of helminthic parasitism in traditional breeding of NW Algeria, and the need to use
preventive and therapeutic measures for a better profitability of poultry algerian production.
KEY WORDS Chicken; digestive tract; helminths; North-Western Algeria; traditional breeding.
Received 03.01.2013; accepted 09.03.2013; printed 30.03.2013
INTRODUCTION
In Africa, 80% of chicken populations are raised
under the extensive system (Gueye, 1998; 2001).
This is based on a traditional undemanding mode
of exploitation and it is considered as an important
source of protein and income for rural communities.
However, in this type of production system the
chickens are with higher risk of infection by a wide
variety of parasites. Helminth parasites are a major
cause of the decline in poultry productivity (delay
of growth, reduced egg production, death of young
birds). The recording of gastrointestinal hel min thes
was reported in several studies conducted on back-
yard poultry from different regions of Africa (Sse-
nyonga, 1982; Fatihu et al., 1991; Poulsen et al.,
2000; Hassouni & Belghyti, 2006; Phiri et al., 2007;
Mungube et al., 2008).
In Algeria, there is insufficient information on
parasitism in chickens although their exploitation
under various systems of breeding prevails on that
of the other poultries. According to OFIAAL
230
F. Yousfi, K. Senouci, I. Medjoual, H. Djellil &T. Hadj Slimane
(2011), 29,316 exploitations of broilers and laying
breeding reproducers were inventoried against
150,000 exploitations of domestic chicken under
the extensive system. The aim of this study was to
evaluate the prevalence and average abundance of
helminths identified in the digestive tract of chick-
ens raised under traditional system.
MATERIALS AND METHODS
This study was done on 1 14 adult local chickens
from eight communes in the area of Oran. This re-
gion, located in the North-West of Algeria, is cha-
racterized by a Mediterranean climate with warm
winter and long hot summer. The mean annual mi-
nimum and maximum temperature is 12°C and
22°C, respectively and the annual rainfall is of
about 420 mm.
The sampling was carried out monthly (from
November 2010 to May 2012) and was random be-
cause no parameters (i.e. age and/or sex) were taken
into account. The chickens were bought from farms
in which the traditional breeding is practiced. They
were of both sexes and their weight ranged from
0.516 to 2.250 kg.
The birds were slaughtered and post-mortem
examination was performed immediately. The di-
gestive tract was removed from the abdominal
cavity and different portions (esophagus, crop, pro-
ventriculus, gizzard, small intestine and caecum)
were opened separately and longitudinally, then
rinsed with physiological saline. Mucosa and con-
tents of these fragments were placed in Petri dishes
containing water. They were then examined under
a binocular magnifying glass with a black bottom
for the search of adult helminth parasites. The col-
lected worms were counted, fixed and stored in
70°ethanol.
Segments of cestodes (tapeworms) and trema-
todes (flatworms) were stained with aceto car-
mine, dehydrated and mounted in Canada balsam.
The scolex of cestodes and acanthocephala (spiny-
headed worms) were cleared and mounted in Ho-
yer's fluid. Nematodes (roundworms) were cleared
in lacto phenol and mounted in glycerin. All worms
were observed under a light microscope (with 40-
100x magnification) and identified using the char-
acters described by Euzeby (1961; 1963; 1966),
Yamaguti (1963) and Gibson et al. (2002).
Comparative analysis of prevalence and average
abundance of collected helminths in chickens and
their distribution in the digestive tract, was perfor-
med using the Kruskal-Wallis test (XLSTAT soft-
ware. 3.1. 2012). A P-value <0.05 was considered
statistically significative.
RESULTS
The present study revealed that all the examined
chickens (100%) were infected with gastrointestinal
helminths. The birds were infected by at least two
species of helminths whatever the sex, weight and
season. Multiple infections associated 4 or more
species in 90.27% of cases. The mean intensity of in-
fection was 124 worms per chicken. The collected
helminths and their prevalence were: cestodes
(95.61%), nematodes (93.86%), trematodes (18.42%)
and acanthocephalan (1 .75%). The difference in these
prevalence rates was significant (P<0.05). A total of
7 cestode species, 8 nematode species, 2 trematode
species and one acanthocephalan species were iden-
tified (Table 1).
The dominant helminth group was cestodes, of
the 114 examined chickens, 109 (95.61%) were
found to harbor diverse species. The most prevalent
species was Raillietina echinobothrida (85.09%)
followed by R. cesticillus (30.70%) and by Hyme-
nolepis carioca (28.95). The least common were
Raillietina tetragona (21.93%) and Choanotaenia
infundibulum (20.17%). Others species, Davainea
proglottina (7.89%) and Amoebotaenia cuneata
(0.88%) were the least frequently recorded (Fig. 1)
The highest average abundance was seen in
Raillietina echinobothrida (8.24) and the lowest
average abundance was noted in Amoebotaenia cu-
neata (0.04) (Fig. 1). The nematodes were iden-
tified in 107 (93.86%) chickens, the most prevalent
species being Heterakis gallinarum (78.07%) and
Subulura brumpti (62.28%). Three species, Ascari-
diagalli (39.47%), Capillaria caudinflata (35.96%)
and Cheilospirura hamulosa (31.58%) were also
frequently identified followed by Capillaria annu-
lata (28.07%) and C. anatis (20.17%); Gongylo-
nema ingluvicola was rarely observed (0.88%) (Fig.
1). Among these species, Heterakis gallinarum
(39.04) and Subulura brumpti (35.88) were the
most abundant. Gongylonema ingluvicola was the
least average abundant species (0.02) (Fig. 1).
Gastrointestinal helminths in the local chicken Gallus gallus domesticus in traditional breeding of North-Western Algeria 23 1
Helminth species
Sites of
predilection
CESTODES
Raillietina echinobothrida
Megnin, 1881
Small intestine
Raillietina cesticillus Molin, 1858
Small intestine
Hymenolepis carioca Magalhaes, 1898
Small intestine
Raillietina tetragona Molin, 1885
Jejunum-ileum
Choanotaen ia in fun dibit l urn
Bloch, 1779
Small intestine
Davainea proglottina Davaine, 1860
Duodenum
Amoebotaenia cuneata Linstow, 1972
Duodenum
NEMATODES
Heterakis gallinarum Schrank, 1788
Caecum
Subulura brumpti Lopez-Neyra, 1922
Caecum
Ascaridia galli Schrank, 1788
Small intestine
Capillaria caudinflata Molin, 1858
Small intestine
Cheilospirura hamulosa Diesing, 1851
Gizzard
Capillaria annulata Molin, 1858
Esophagus-Crop
Capillaria anatis Schrank, 1790
Caecum
Gongylonema ingluvicola
Ransom, 1904
Esophagus-Crop
TREMATODES
Postharmostomum gallinum
Witenberg, 1923
Caecum
Brachylaema sp.
Jejunum
ACANTHOCEPHALAN
Prosthorhynchus sp.
Small intestine
Table 1. Sites of predilection of helminth species in the di-
gestive tract of chickens.
No statistically significant difference in hel min th
species prevalence was observed according to the
sex and the season.
Table 1 shows a heterogeneous dispersion (sig-
nificant P<0.05) of helminth species in relation to
their predilection sites. All segments of the dige-
stive tract examined, except for the pro ventriculus,
were parasitized. Worms were more often located
in the small intestine where the mixed helminth in-
fections were common. The most prevalent cestode
species, Raillietina echinobothrida and R. cesticil-
lus, occupied different parts of this organ. The most
common nematode species, Heterakis gallinarum
and Subulura brumpti, colonized the caecum.
DISCUSSION
This study indicated a high prevalence (100%)
of gastrointestinal helminths in local chickens in
traditional breeding in North-Western Algeria, sug-
gesting that domestic poultry kept under this type
of production system are strongly parasitized. High
prevalence of gastrointestinal helminths was al-
ready observed in free-range chickens from dif-
ferent African countries. The prevalence rate was
reported to be 100% in Tanzania (Magwisha et al.,
2002) and in Eastern Ghana (Poulsen et al., 2000).
These results are comparable with those of Sse-
nyonga (1982), Fatihu et al. (1991), Phiri et al.
(2007), Mungube et al. (2008) and Hassouni & Bel-
ghyti (2006). These authors reported 97% preva-
lence in Uganda, 95.7% in Nigeria, 95.2% in central
Zambia, 93.3% in Eastern Kenya and 89.9% in
Gharb-region of Morocco, respectively. These stud-
ies indicated also multiple infections with hel min th
parasites, which is in agreement with our observa-
tions.
The recording of high prevalence of gastroin-
testinal helminthes and multiple infections in the
present study might be attributed to environmental
conditions and traditional breeding which were suit-
able for infections. The chickens seek their food in
the soil and this one is frequently contaminated with
infective stages of parasites and living organisms
(earthworms, insects and mollusks) which serve as
intermediate hosts.
This work revealed also the richness of the
helminth fauna. The helminth species (eighteen)
identified were compared to those recorded by
232
F. Yousfi, K. Senouci, I. Medjoual, H. Djellil &T. Hadj Slimane
many authors such as Phiri et al. (2007), Ashenafi
& Eshetu (2004), Hassouni & Belghyti (2006) and
Mungube et al. (2008).
Seven species of cestodes were identified in this
study and the predominant species was Raillietina
echinobothrida with a markedly higher prevalence
(85.09%). This finding is comparable with 81%
prevalence observed in Eastern Ghana (Poulsen et
al., 2000) and 65.26% determined in central Ethio-
pia (Ashenafi & Eshetu, 2004). According to Has-
souni & Belghyti (2006), this prevalence was lower
(5.7%). In the study area, the environmental condi-
tions appear to be favorable for the survival of Rail-
lietina echinobothrida eggs and the development of
insects (Hymenoptera) which serve as an interme-
diate hosts for this parasite. The insects are very
spread in the ground and their contact with the chick-
ens is almost permanent. R. cesticillus was the sec-
ond most prevalent cestode recorded (30.70%) in
this work. In their studies, Ashenafi & Eshetu
(2004), and Hassouni & Belghyti (2006) indicated
a prevalence of 19% and 12% respectively. We rarely
found Davainea proglottina (7.89%) which is the
most pathogen cestode of chickens; Mungube et al.
(2008) observed it with a prevalence of 19.4%. On
the other hand, several other authors did not record
this parasite. The nematodes observed in this study
comprised eight species. The prevalence of Hetera-
kis gallinarum (78.07%) was the highest. This is in
agreement with previous observations although
with lower values, 39.62%, in North Gondar (Ethio-
pia) (Molla et al., 2012) and 32.8% in central Zam-
bia (Phiri et al., 2007). Another nematode species
detected with an important prevalence was Subulura
brumpti (62.28%); Ashenafi & Eshetu (2004) found
a comparable result (55.3%) in central Ethiopia.
Figure 1. Prevalence and average abundance of helminth species.
Gastrointestinal helminths in the local chicken Gallus gallus domesticus in traditional breeding of North-Western Algeria 233
The higher prevalence of these two nematode
species can be explained by the presence in the
study area, of favorable conditions (temperature,
hygrometric degree) for the development of Hete-
rakis gallinarum eggs and of insects (Coleoptera)
that may be an intermediate host for Subulura
brumpti. The prevalence of Gongylonema ingluvi-
cola (0.88%) was the lowest in this study. Whereas,
this species was found with a higher prevalence
(50%) by Phiri et al. (2007).
Trematodes detected during our study were Po-
stharmostomum gallinum (18.42%), identified in
Uganda by Ssenyonga (1982), and Brachylaima sp.
(2.63%). This one has a wide range of hosts in-
cluding birds and mammals (Cribb & O’ Callaghan,
1992). Poulsen et al. (2000) reported one unidenti-
fied trematode (1%). The only acanthocephalan
found, Prosthorhynchus sp. (1 .75%) occurred rarely
in examined chickens. The infection of the domestic
chicken and turkey by this acanthocephalan was
demonstrated experimentally (Schmidt & Olsen,
1964). According to Smales (2003) and Dimitrova
et al. (2000), Prosthorhynchus sp. occupies the in-
testines of many birds, especially that of Passerifor-
mes. According to studies conducted in Africa, the
trematodes and acanthocephalan were rarely ob-
served in the local chicken. This can be explained
by the complexity of their life cycle and inaccessi-
bility of intermediates hosts. Otherwise, the varia-
tions in prevalence of gastrointestinal helminths of
local chickens from different regions of Africa is in
relation to the geographic factors and climatic con-
ditions that influence the life cycle of worms.
CONCLUSIONS
This is the first study done in the North-West Al-
geria on helminthic parasitism of the digestive tract
in the local chickens kept under traditional breeding
system. The recording of high prevalence and mul-
tiple helminth infections highlighted in the present
study requires therapeutic measurements with the
adequate use of multi-purpose anti-helminthic treat-
ments. These latters need to be combined with pre-
ventive actions based on (i) assuring and
maintaining hygienic conditions of the buildings;
(ii) the improvement of nutrition quality and of
techniques of breeding; and (iii) a regular health
control. Chickens of local origin are generally resi-
stant to hostile conditions but various pathogens
and precisely parasites represent a major obstacle
for their development.
REFERENCES
Ashenafi H. & Eshetu Y., 2004. Study on gastrointestinal
helminths of local chickens in Central Ethiopia.
Revue Medecine Veterinaire, 155: 504-507.
Cribb T.H. & O’Callaghan M., 1992. An unusual trema-
tode infecting domestic chickens. Australian Veteri-
nary Journal, 69: 69-70.
Dimitrova Z., Georgiev B. & Genov T., 2000. Review of
the avian acanthocephalans from Bulgaria. Acta Zoo-
logica Bulgarica, 52: 3-22.
Euzeby J., 1961. Les maladies vermineuses des animaux
domestiques et leurs incidences sur la pathologie hu-
maine, Tome I, Maladies dues aux nemathelminthes,
fascicule 1. Edition Vigot Freres, Paris, 473 pp.
Euzeby J., 1963. Les maladies vermineuses des animaux
domestiques et leurs incidences sur la pathologie hu-
maine, Tome I, Maladies dues aux nemathelminthes,
fascicule 2. Edition Vigot Freres, Paris, 830 pp.
Euzeby J., 1966. Les maladies vermineuses des animaux
domestiques et leurs incidences sur la pathologie hu-
maine, Tome II, Maladies dues aux nemathelminthes,
fascicule 12. Edition Vigot Freres, Paris, 660 pp.
Fatihu M.Y., Ogbogu V.C., Njoku C.O. & Saror D.I.,
1991. Etudes comparatives des helminthes gastroin-
testinaux chez les poulets a Zaria, Nigeria. Revue
d’elevage et de Medecine Veterinaire des Pays Tro-
picaux, 44: 175-177.
Gibson D.I., Jones A. & Bray R.A., 2002. Keys to the
Trematoda, Vol. 1. CABI Publishing and The Natural
History Museum, Wallingford, 521 pp.
Gueye E.F., 1998. Village egg and fowl meat production
in Africa. World’s Poultry, Science Journal, 54: 73-
86 .
Gueye E. F., 2001. The role of family poultry in poverty
alleviation, food security and the promotion of gender
equality in rural Africa. Outlook on Agriculture, 29
(2000): 129-136.
Hassouni T. & Belghyti D., 2006. Distribution of gastroin-
testinal helminths in chicken farms in the Gharb re-
gion, Morocco. Parasitology Research, 99: 181-183.
Magwisha H.B., Kassuku A.A., Kyvsgaard N.C & Per-
min A., 2002. A comparison of the prevalence and
burdens of helminth infections in growers and adult
free-range chickens. Tropical Animal Health and Pro-
duction, 34: 205-214.
Molla W., Haile H., Almaw G. & Temesgen W., 2012.
Gastrointestinal helminths of local backyard chickens
in North Gondar Administrative Zone, Ethiopia.
Revue Medecine Veterinaire, 163: 362-367.
234
F. Yousfi, K. Senouci, I. Medjoual, H. Djellil &T. Hadj Slimane
Mungube E.O., Bauni S.M., Tenhagen B.A., Wamae
L.W., Nzioka S.M., Muhammed L. & Nginyi J.M.,
2008. Prevalence of parasites of the local scavenging
chickens in a selected semi-arid zone of Eastern
Kenya. Tropical Animal Health and Production, 40:
101-109.
OFIAAL (Observatoire des filieres avicoles en Algerie),
Rapport 2011. Edition Institut de Technologie des Pe-
ches et de T Aquaculture, Alger.
Phiri I.K., Phiri A.M., Ziela M., Chota A., Masuku M. &
Monrad J., 2007. Prevalence and distribution of ga-
strointestinal helminthes and their effects on weight
gain in free-range chickens in Central Zambia. Tro-
pical Animal Health and Production, 39: 309-315.
Poulsen J., Permin A., Hindsbo O., Yelifari L., Nansen
P.& Bloch P, 2000. Prevalence and distribution of
gastrointestinal helminthes and haemoparasites in
young scavenging chickens in upper eastern region
of Ghana, West Africa. Preventive Veterinary Medi-
cine, 45: 237-245.
Schmidt G.D. & Olsen O.W., 1964. Life cycle and deve-
lopment of Prosthorhynchus formosus (Van Cleave,
1918) Travassos, 1926, an acanthocephalan parasite
of birds. The Journal of Parasitology, 50: 721-730.
Smales L.R., 2003. An annotated checklist of the Au-
stralian Acanthocephala from mammalian and bird
hosts. Records of the South Australian Museum, 36:
59-82.
Ssenyonga G.S.Z., 1982. Prevalence of helminth parasi-
tes of domestic fowl ( Gallus domesticus ) in Uganda.
Tropical Animal Health and Production, 14: 201-204.
Yamaguti S., 1963. Systema helminthum, Acanthoce-
phala. Interscience Publishers John Wiley and Sons,
New York- London, 423 pp.
Biodiversity Journal, 2013, 4 (1): 235-242
Diversity and richness of bird species in newly formed habitats
of Chandoli National Park in Western Ghats, Maharashtra
State, India
Abdar Mohan Ramchandra
Department of Zoology, Krantisinh Nana Patil College Walwa Dist. Sangli, 416313, Maharashtra State, India; email:
abdarmohanO 1 @gmail.com
ABSTRACT The study of bird species diversity and richness in newly formed habitats of Chandoli National
Park in Western Ghats (now declared as international heritage), Maharashtra State, India was
carried out in early wet and dry seasons. Since richness and diversity of bird species are good
indicators of the ecosystem quality, this paper focused on providing some information on the
abundance, diversity and activities of various bird species occurring in Chandoli National
Park. To this aim, line transect survey was used to generate data for ecological analysis. Birds
observed incuded resident, migratory and palearctic species. A total of 151 species repre-
senting 15 orders and 45 families were recorded from September 2009 to August 2011, and
a high value calculated for the Simpson’s Index of Diversity (0.8291) indicated a marked
richness and diversity of bird species in the area under examination.
KEY WORDS Birds; Diversity; Richness; Western Ghats; Chandoli National Park.
Received 16.01.2013; accepted 02.03.2013; printed 30.03.2013
INTRODUCTION
The south-north hill range of Western Ghats lies
on the Western side of Maharashtra state (India)
from the border of Gujarat up to Kerala. It harbours,
in its heart, the Chandoli National Park and Reser-
voir, recently declared as World heritage, which is
very rich in biodiversity. The Western Ghats include
several man-made reservoirs with the majority of
streams running through it ultimately joining the
Krishna and Kaveri rivers.
This area is also recognized internationally as the
Western Ghats Endemic bird area and is known to
host some rare and globally threatened bird species.
It is one of the best briding hot spots in India for va-
riety, beauty and ecofriendliness. About 508 bird
species have been recorded recently. The Indian re-
gion is incredibly rich in birdlife. Over 1200 of the
worlds 8650 species of birds are found in the re-
gion. This number rises to over 2000 with sub-
species included which makes the Indian check list
twice the size of those of Europe and North Amer-
ica. This abundance is due to the variety of habitats
and prevalent climate; altitude ranges from the sea
level to the peak of the Himalaya.
Birds and their diversity constitute a main part
of the natural environment and play a functional
role as agents of flower pollination, seed dispersal,
source of food chain and agents in breaking seed
dormancy (Nason, 1992). Birds are good environ-
mental indicators revealing the state of the ecosys-
tems such as forest edges, wetlands and major river
basins. They also act as dispersal agents in transfer-
ring nutrients and spores from one place to another
during their migration and local movements
(Niemi, 1985). The avian habitat is roughly divided
into forest, scrub and wetlands, although many
236
Abdar Mohan Ramchandra
species require a mixed type of habitat. After the
snow fall, birds coming from sub tropical temperate
region migrate in thousands up to North West comer
of India and then radiate into local aquatic network
of reservoirs of Western Ghats according to food
availability in each habitat. Although this region is
considered an important spot of biodiversity, never-
theless still little is known about the migrations of
birds that inhabit the reserve throughtout the year.
Hence, this study was set out to obtain information
on the presence, richness, diversity and activities of
various bird species in Chandoli National Park both
in favourable and adverse climatic conditions.
MATERIAL AND METHODS
Study area
The newly formed habitat of Chandoli National
Park (Fig. 1) is at the junction area of four districts
(Sangli, Kolhapur, Satara and Ratnagiri). It lies be-
tween longitudes 73°40' and 73°53'E and latitudes
17°03' and 17°20'N near Sangli in Western Mahara-
shtra. A very distinct feature is the presence of nu-
merous barren rocky lateritic plateaus locally called
‘Sadas’ devoid of any perennial vegetation and nu-
Figure.l Map of Chandoli National Park, India.
merous fallen boulders with dense thorny secondary
vegetation. The area is about 308.97 Knr.The maxi-
mum temperature during day time ranges from 30 °C
to 38 °C. From October both day and night tempera-
tures decrease progressively. In December or January
the temperature often is up to 26 °C in day time. Dur-
ing rainy season maximum and minimum tempera-
ture range remains between 11-28 °C. The all area is
characterized by humid and mild climate, there are
heavy rains during the South West monsoon season,
from June to September. Premonsoon starts in April.
Therefore, this area has no notable dry season.
The cold season is from December to February,
followed by the pleasant summer season from
March to May. The forest types are tropical hill for-
est, semi- evergreen forest and mixed deciduous fo-
rest. Anjan ( Memecylon umbellatum), Jambhual
(Syzygium cumini ) and Pisa (Actinodaphna angu-
stifolia ) are the most common species of this area.
Due to high altitude, perennial snow, reservoirs and
presence of evergreen vegetation, general climatic
conditions are cool and humid, which provides a
good habitat for wild fauna.
Methods
Some of the basic methods used in this study as
described by Bibby et al. (1992) are: a) point
counts: to determine abundance by undertaking a
bird count from a fixed location for a fixed period
of time. The bird species seen or heard are recorded,
b)line transect: suitable for estimating density and
abundance which involves moving along a fixed
route (transect) and recording the bird species seen
and heard on both sides of the transect.
The study was conducted from September 2009
to August 2011. The bird counts were carried out in
the morning from 7.00 am to 10.00 am. and in the
evening from 4.00 pm to 6.00 pm. A binocular
(Olympus ) was used to confirm the identification of
the birds; nests were located by sight. For every bird
species the following parameters were recorded: (i)
activity of the bird when first sighted; (ii) the number
of bird species at eveiy sighting; (iii) location of nests
and species involved; all the numbers were noted.
Data analysis
a. Species composition: abundance for each
species was calculated by summing up the number
of individuals recorded in all the transect.
Diversity and richness of bird species in newly formed habitats of Chandoli National Park, India
237
b. Species diversity using Simpson index (D),
Simpson Diversity index (1-D) and Simpsons Re-
ciprocal index (1/D).
c. Activities of birds recorded during the survey
period included calling, overflying, perching, walk-
ing, mobbing, bissy in the construction of nest, col-
lection of grass materials, feeding and loafing. The
frequency of each activity was summed up to give
the activity rating and the percentages values of the
frequence of each activity were calculated.
RESULTS AND DISCUSSION
A total of 151 species distributed in 15 orders
and 45 families were recorded during the survey
period. Sixteen families were represented only by
one species each. Passerifomes was the most rich
of species (63 species ) followed by Ciconiiformes
(39 species). Rosy starling (Sturnus roseus ) was re-
corded in the months of January, February and
March; whereas Baya Weaver ( Ploceus philippinus )
was more abundant in the months of July, August
and September.
The Simpson’s index (i.e. the probability that
two randomly selected individuals in the commu-
nity belong to the same category) was 0.1709 and
the Simpson’s diversity index (i.e. the probability
that two randomly selected individuals in a commu-
nity belong to different species) was 0.8291. A
value of 5.8 was obtained as the reciprocal of Simp-
son index; a total number of 1 5 1 species was recor-
ded during the survey.
A total of 253 nests belonging to species of 15
families were recorded, most of which were of
House Swift (Apus nipalensis, 200 nests) and Baya
Weaver {Ploceus philippinus , 180) (see Table 2).
Figure 2. Activities of birds of the Chandoli National Park,
India.
ACTIVITIES OF BIRD
SPECIES
FREQUENCY %
FEEDING
68%
BREEDING
27%
LOAFING
5%
Table 1. Activities of bird species in newly formed habitat
Chandoli National Park.
Bird species
Nest
condition
Nests
Birds
recorded
at nest
Red Vented
Bulbul
New and Old
15
2
Hoopoe
New and Old
5
1
Oriental white
eye
New
4
1
Baya Weaver
New
180
1
Paddy field
Warbler
New
6
1
House Swift
New
200
2
Jungle Crow
New
4
1
Woolly-necked
Stork
New
7
1
Glossy Ibis
New
11
1
Woodpecker
New and Old
19
2
Grey Hornbill
New
4
1
Spotted Dove
New
9
1
Black Kite
New
5
1
Table 2. Bird nests recorded in the newly formed habitat of
Chandoli National Park, India.
BIRD SURVEY RESULTS
GALLIFORMES - PHASIANIDAE
Coturnix coturnix (Linnaeus, 1758)
Common Quail
Perdicula asiatica (Latham, 1790)
Jungle Bush Quail
238
Abdar Mohan Ramchandra
■ No. of birds recorded at nests
■ No. of nests
Figure 3. Number of nests and number of birds of the Chandoli National Park, India.
Francolinus pondicerianus (Gmelin J.F., 1789)
Grey Partridge
Pavo muticus Linnaeus, 1758
Indian Peafowl
ANSERIFORMES - ANATIDAE
Tadorna ferruginea Pallas, 1764
Ruddy Shelduck
Anas crecca Linnaeus, 1758
Common Teal
Anas acuta Linnaeus ,1758
Northern Pintail
Nettapus coromandelianus Gmelin, 1789
Cotton Teal
Anas poecdorhyncha J. R. Forster, 1781
Spot-billed Duck
Ay thy a ferina Linnaeus, 1758
Common Pochard
Anas clypeata Linnaeus, 1758
Shoveler
PICIFORMES - PICIDAE
Dinopium javanense (Ljungh, 1797)
Woodpecker (Indian Golden-backed)
MEGALAIMIDAE
Megalaima haemacephala (Statius Muller, 1776)
Coppersmith Barbet
Megalaima asiatica (Latham, 1790)
Blue throated Barbet
BUCEROTIFORMES - BUCEROTIDAE
Ocyceros hirostris (Scopoli, 1786)
Indian Grey Hornbill
UPUPIFORMES - UPUPIDAE
Upupa epops Linnaeus, 1758
Common Hoopoe
CORACIIFORMES - CORACIIDAE
Coracias henghalensisis (Linnaeus, 1758)
Indian Roller
ALCEDINIDAE
Alcedo atthis Linnaeus, 1758
Common Kingfisher
HALCYONIDAE
Halcyon smyrnensis (Linnaeus, 1758)
White-throated Kingfisher
CERLIDAE
Ceryle rudis (Linnaeus, 1758)
Pied Kingfisher
Diversity and richness of bird species in newly formed habitats of Chandoli National Park, India
239
MEROPIDAE
Merops orientalis Latham, 1802
Green Bee-eater
Merops leschenaulti Vieillot, 1817
Chestnut headed Bee eater
Merops persicus Pallas, 1773
Blue-cheeked Bee-eater
CUCULIF ORME S - CUCULIDAE
Cuculus micropterus Gould, 1838
Indian Cuckoo
Surniculus lugubris (Horsfield, 1821)
Drongo Cuckoo
Eudynamys scolopacea (Linnaeus, 1758)
Asian Koel
CENTROPODIDAE
Centropus sinensis (Stephens, 1815)
Greater Coucal
Centropus bengalensis (Gmelin, 1788)
Lesser Coucal
PSITTACIFORMES - PSITTACIDAE
Psittacula krameri (Scopoli, 1769)
Rose-ringed Parakeet
Psittacula columboides (Vigors, 1830)
Malabar Parakeet
APODIFORMES - APOD1DAE
Collocalia unicolor (Jerdon, 1840)
Indian Swiftlet
Apus affinis (Gray J.E., 1830)
House Swift
ACCIPITRIF ORMES - ACCIPITRIDAE
Milvus migrans (Boddaert, 1783)
Black Kite
Haliastur indus (Boddaert, 1783)
Tyto capensis (Smith, A, 1834)
Grass Owl
STRIGIDAE
Glaucidium radiatum (Tickell, 1833)
Jungle Owlet
COLUMBIF ORMES - COLUMBIDAE
Columba livia Gmelin, JF, 1789
Rock Pigeon
Streptopelia senegalensis (Linnaeus, 1766)
Little Brown Dove
Streptopelia chinensis (Scopoli, 1786)
Spotted Dove
Streptopelia decaocto (Frivaldszky, 1838)
Eurasian Collared-Dove
GRUIFORMES - GRUIDAE
Grus virgo (Linnaeus, 1758)
Demoiselle Crane
RALLIDAE
Porphyrio porphyrio (Linnaeus, 1758)
Purple Moorhen
Gallinula chloropus (Linnaeus, 1758)
Common Moorhen
Fulica atra Linnaeus, 1758
Common Coot
Amaurornis phoenicurus (Pennant, 1769)
White-breasted waterhen
Gallicrex cinerea (Gmelin, 1789)
Watercock
CICONIIFORMES - PTEROCLIDAE
Pterocles exustus Temminck, 1 825
Indian Sandgrouse
Brahminy Kite
Circus aeruginosus (Linnaeus, 1758)
Marsh Hamer
Accipiter badius (Gmelin J.F., 1788)
Shikra
STRIGIFORMES - TYTONIDAE
Tyto alba Scopoli, 1769
Bam Owl
S COLOPACID AE
Gallinago gallinago (Linnaeus, 1758)
Common Snipe
Limosa limosa (Linnaeus, 1758)
Black-tailed Godwit
Limosa lapponica (Linnaeus, 1758)
Bar-tailed Godwit
Tringa erythropus (Pallas, 1764)
Spotted Redshank
240
Abdar Mohan Ramchandra
Tringa stagnatilis (Bechstein, 1803)
Marsh Sandpiper
Tringa glareola Linnaeus, 1758
Wood Sandpiper
Calidris minuta (Leisler, 1812)
Little Stint
Philomachus pugnax (Linnaeus, 1758)
Ruff
CHARADRIIDAE
Himantopus bimantopus (Linnaeus, 1758)
Black-winged Stilt
Charadrius dubius Scopoli, 1786
Little Ringed Plover
Charadrius alexandrinus Linnaeus, 1758
Kentish Plover
Vanellus malabaricus (Boddaert, 1783)
Yellow-wattled Lapwing
Vanellus gregarius (Pallas, 1771)
Red- wattled Lapwing
Cursorius coromandelicus (Gmelin, 1789)
Indian Courser
LAR1DAE
Sterna aurantia Gray,JE, 1831
River Tern
Sterna hirundo Linnaeus 1758
Common Tern
PODICIPEDIDAE
Tachybaptus ruficollis (Pallas, 1764)
Little Grebe
ARDEIDAE
Egretta garzetta (Linnaeus, 1766)
Little Egret
Egretta gularis (Bose, 1792)
Indian Reef ITeron
Ardea cinerea Limiaeus, 1758
Grey Heron
Ardea goliath Cretzschmar, 1829
Giant Heron
Ardea purpurea Linnaeus, 1766
Purple Heron
Casmerodius albus Linnaeus, 1758
Great Egret
Mesophoyx intermedia (Wagler, 1829)
Intermediate Egret
Bubulcus ibis (Linnaeus, 1758)
Cattle Egret
Ardeola grayii (Sykes, 1832)
Indian Pond Heron
Nycticorax nycticorax (Linnaeus, 1758)
Black-crowned Night Heron
THRESKIORNITHIDAE
Plegadis falcinellus (Linnaeus, 1766)
Glossy Ibis
Threskiornis melanocephalus (Latham, 1790)
Black-headed Ibis
Pseudibis papillosa (Temminclc, 1 824)
Black Ibis
Platalea leucorodia Linnaeus, 1758
Spoonbill
CICONIIDAE
Mycteria leucocephala (Pennant, 1769)
Painted Stork
Anastomus oscitans (Boddaert, 1783)
Asian openbill
Ciconia episcopus (Boddaert, 1783)
Woolly-necked Stork
Ciconia ciconia (Linnaeus, 1758)
White Stork
PHALACROCORACIDAE
Phalacrocorax niger (Vieillot, 1817)
Little Cormorant
Phalacrocorax fuscicollis Stephens, 1 826
Indian Cormorant
Phalacrocorax carbo (Linnaeus, 1758)
Great Cormorant
PASSERILORMES - PITTIDAE
Pitta brachyura (Linnaeus, 1766)
Indian Pitta
LANIIDAE
Lanius isabellinus Hemprich et Ehrenberg, 1833
Rufous -tailed shrike
Lanius vittatus Valenciennes, 1 826
Bay backed shrike
Diversity and richness of bird species in newly formed habitats of Chandoli National Park, India
241
CORVIDAE
Corvus splendens Vieillot, 1817
House Crow
Corvus macrorhynchos Wagler, 1 827
Large -billed Crow
Pericrocotus roseus (Vieillot, 1818)
Rosy Minivet
Pericrocotus cinnamomeus (Linnaeus, 1766)
Small Minivet
Pericrocotus erythropygius (Jerdon, 1 840)
White-bellied Minivet
Rhipidura hypoxantha Blyth, 1 843
White-throated Lantail
Dicrurus macrocercus Vieillot, 1817
Black Drongo
Tephrodornis pondicerianus (Gmelin, JL, 1789)
Common Woodshrike
Aegithina tiphia (Linnaeus, 1758)
Common Iora
MUSCICAPIDAE
Monticola solitarius (Linnaeus, 1758)
Blue Rock Thrush
Zo other a citrina (Latham, 1790)
Orange-headed Thrush
Muscicapa muttui (Layard, EL, 1854)
Brown-breasted Llycatcher
Luscinia brunnea (Hodgson, 1837)
Indian Blue Robin
Copsychus saularis (Linnaeus, 1758)
Oriental Magpie-Robin
Saxicoloides fulicata (Linnaeus, 1766)
Indian Robin
Saxicola torquata (Linnaeus, 1766)
Common Stonechat
Oenanthe oenanthe (Linnaeus, 1758)
Pied Chat
STURNIDAE
Sturnus roseus (Linnaeus, 1758)
Rosy Starling
Acridotheres tristis (Linnaeus, 1766)
Common Myna
Acridotheres ginginianus (Latham, 1790)
Bank Myna
Acridotheres fuscus (Wagler, 1 827)
Jungle Myna
Sturnus pagodarum (Gmelin, JL, 1789)
Black Headed Myna
PARIDAE
Parus major Linnaeus, 1758
Great Tit
HIRUDINIDAE
Hirundo smithii Leach, 1818
Wire -tailed Swallow
Hirundo daurica (Laxmann, 1769)
Red-rumped Swallow
Hirundo fluvicola (Blyth, 1855)
Indian Cliff Swallow
PY CNONOTIDAE
Pycnonotus cafer (Linnaeus, 1766)
Red-vented Bulbul
CISTICOLIDAE
Prinia hodgsonii Blyth, 1844
Lranklin’s Wren Warbler
Prinia gracilis (Lichtenstein, 1823)
Streaked Wren Warbler
Prinia sylvatica Jerdon, 1840
Jungle Prinia
ZOSTEROPIDAE
Zosterops palpebrosus (Temminck, 1824)
Oriental White-eye
SYLVIIDAE
Acrocephalus bistrigiceps Swinhoe, 1860
Paddy field Warbler
Acrocephalus stentoreus (Hemprich et Ehrenberg, 1 833)
Indian Great Reed Warbler
Orthotomus sutorius (Pennant, 1769)
Common Tailorbird
Graminicola bengalensis Jerdon, 1863
Large Grass Warbler
Macronous gularis (Horsfield, 1 822)
Yellow-breasted Babbler
Turdoides caudatus (Dumont, 1 823)
Common Babbler
Turdoides striatus (Dumont, 1 823)
Jungle Babbler
Alcippe poioicephala (Jerdon, 1841)
Quaker Babbler
242
Abdar Mohan Ramchandra
ALAUDIDAE
Mirafra erythroptera Blyth, 1 845
Lonchura punctulata (Linnaeus, 1758)
Spotted Munia
Indian Bush lark
Calandrella raytal (Blyth, 1 845)
LRINGILLIDAE
Sand lark
NECTARINIIDAE
Melophus lathami (Gray J.E., 1831)
Crested Bunting
Nectarinia zeylonica (Linnaeus, 1766)
Purple rumped Sunbird
CONCLUSION
Nectarinia minima (Sykes, 1832)
Crimson-backed Sunbird
Nectarinia asiatica (Latham, 1790)
Purple Sunbird
Nectarinia lotenia (Linnaeus, 1766)
Loten’s Sunbird
Aethopyga siparaja (Raffles, 1 822)
Crimson Sunbird
Arachnothera longirostra (Latham, 1790)
Little Spiderhunter
PASSER1DAE
Passer domesticus (Linnaeus, 1758)
House Sparrow
Dendronanthus indicus (Gmelin, 1789)
Lorest Wagtail
The high value of the Simpson’s index of diver-
sity (0.8291) is an indication of richness of bird di-
versity in the Chandoli National Park. Some
endemic species were recorded in this area such as
Green Barbet ( Stactolaema olivacea), Lorest War-
bler (Artisornis moreaui ), Small Sunbird ( Lepto -
coma minima ) and Rock Pigeon. Such a richness
in birds species can largely be explained by the par-
ticular characteristics of the area. In fact, it includes
a network of man-made reservoirs as feeding
ground for both migratory and residential birds in
the winter period. In addition, the secure and dense
mixed forest made of big and thick trees provide
good habitat and forage for bird species; and, fi-
nally, some sugar factories provide shelter for
Swifts and Red vented Bulbuls (Nason, 1992).
Motacilla alba Linnaeus, 1758
White Wagtail
ACKNOWLEDGEMENTS
Motacilla citreola Pallas, 1776
Yellow headed Wagtail
Motacilla flava Linnaeus, 1758
Yellow Wagtail
Anthus hodgsoni Richmond, 1907
Indian Tree Pipit
Ploceus benghalensis (Linnaeus, 1766)
Black- throated Weaver
The Maharashtra State Lorest Department is
gratefully aknowledged for granting me the permis-
sion to study the Avian fauna of Chandoli National
Park and nearby areas. This study was funded by a
grant in aid of Minor research project from Univer-
sity Grants Commission WRO Pune.
Ploceus philippinus (Linnaeus, 1766)
REFERENCES
Baya Weaver
Ploceus megarhynchus Hume, 1869
Linns Baya
Amandava amandava (Linnaeus, 1758)
Red Munia
Lonchura malabarica (Linnaeus, 1758)
Indian Silverbill
Bibby C.J., Burgess N.D. & Hill D.A., 1992. Bird Census
Techniques. Academic Press, London, pp. 67-84.
Nason I., 1992. Discovering birds. Pisces Publication, pp.
67-69.
Niemi G.J., 1985. Patterns of morphological evolution in
bird genera of New World and Old World Peatlands.
Ecology, 66: 1215-1228.
Biodiversity Journal, 2013, 4 (1): 243-252
Molecular variation of Iranian local and exotic strawberry
(Fragaria x ananassa Duch.) varieties using SSR markers
Seyed Arman Hosseini 1 , Ezzat Karami 2 & RezaTalebi 2 *
'College of Agriculture, Islamic Azad University, Kermanshah Branch, Kermanshah, Iran
2 College of Agriculture, Islamic Azad University, Sanandaj Branch, Sanandaj, Iran
*Corresponding author: [email protected]
ABSTRACT In this study, we report the genetic diversity in a collection of 1 7 local strawberry cultivars
collected from ‘Kurdistan’ province north-west of Iran with 13 exotic cultivars, using 20 SSR
markers. The 20 SSR loci analysed produced 118 alleles with an average 5.9 alleles per mar-
ker. The number of alleles ranged from 3 to 16, whereas the maximum was observed in
UAFv7648. The effective allelic number (ne) was 3.03 on average of and ranged from 1.22
to 6.98. The genetic diversity (GD) and PIC values ranged from 0.22 to 0.88 and 0. 19 to 0.87,
with an average of 0.63 and 0.60, respectively. Cluster analysis grouped genotypes in four
clusters. Local cultivars grouped in two distinct clusters and other exotic cultivars grouped
in other two clusters. Results of cluster analysis suggested that the local cultivars may ori-
ginated from Queen, Missionary, Ventana and Fresho or may share a same pedigree sources
with these cultivars. This is first information on commercially grown local and exotic
strawberry cultivars from different origins in Iran using SSR markers.
KEY WORDS Strawberry; Genetic diversity; SSR markers; population structure.
Received 18.01.2013; accepted 20.2.2013; printed 30.03.2013
INTRODUCTION
Assessment of genetic diversity is important in
plant breeding to foresee improvement by selection.
The commercially important strawberries {Fragaria
x ananassa Duch.) belong to the family Rosaceae
and the genus Fragaria L., which comprises 23 spe-
cies (Rousseau-Gueutin et al., 2009). With its high
nutritional value, the strawberry is one of the most
popular berry fruits in the world. All of these
strawberries have seven basic types of chromoso-
mes. However, they exhibit a series of ploidy le-
vels, ranging from diploid species such as Fragaria
vesca (2n = 2x = 14), to decaploid species, such as
some accessions of F. iturupensis (2n = lOx = 70).
The cultivated strawberry, F. x ananassa , is an octo-
ploid (2n = 8x = 56) (Nathewet et al., 2010).
Because of this, it is difficult to breed it suc-
cessfully to develop new varieties with differing
genetic characteristics. The verification of straw-
berry cultivar identity is essential for fanners and
plant breeders, as part of certification programs, to
prevent mixtures or misidentiflcation of cultivars
and to protect breeder’s rights. Because of the large
number of strawbeny cultivars grown today, there
is a pressing need for the development of reliable
methods for identify ing/distinguishing strawberry
cultivars and for assessing genetic diversity in
strawbeny germplasm for breeding purposes. The
cultivated strawberry, F. x ananassa has a nanow
genetic pool (Sjulin & Dale, 1987). Efforts to in-
crease the germplasm diversity of the cultivated
strawberry have focused on wild species and adapted
local germplasm, as parents (Luby et al., 2008).
244
S.A. Hosseini, E. Karami & R.Talebi
Strawberry was imported into Iran about 100
years ago from France. Its cultivation area in Iran
is about 3000 ha and the total production averages
about 2 1 Kt yearly. Strawberry can be grown suc-
cessfully in different parts of Iran. Strawberry cul-
tivation and production in Iran has doubled in the
last two decades. At present the two main regions
of the country producing strawberries are Kurdi-
stan (North-west) and Golestan (North) provinces
(Eshghi et al., 2007). Kurdistan province grows
about 80% of the total strawberry production in
the Iran (Fig. 1).
Currently, morphological traits are used to cer-
tify the identity of strawberry cultivars, but this in-
formation often does not yield clear answers
concerning discrimination of a plant variety, due to
ambiguous differences or phenotypic modifications
caused by environmental factors (Garcia et al.,
2002). For these reasons, as molecular marker tech-
nologies become available, they are being evaluated
for their usefulness in strawberry cultivar identifi-
cation and assessing genetic diversity. With respect
to genetic diversity, the overriding question is how
well do estimates based on molecular marker data
correspond to actual levels of genetic diversity
and/or to assessments of diversity based on pedi-
gree. Microsatellites, or simple sequence repeats
(SSRs) have proved to be locus-specific, codomi-
nant, highly reproducible and usually highly poly-
morphic molecular markers (Powell et al., 1996).
Many simple sequence repeat (SSR) markers were
developed for Fragaria from A vesca (James et al.,
2003; Cipriani & Testolin, 2004; Hadonou et al.,
2004; Bassil et al., 2006a; Davis et al., 2006; Mon-
fort et al., 2006), F. x ananassa (Lewers et al. 2005;
Bassil et al., 2006b; Gil-Ariza et al., 2006), F. vir-
giniana (Ashley et al., 2003), F. bucharica Losinsk.
(Sargent et al., 2006), and F. viridis Weston (Sar-
gent et al., 2003). A major drawback of SSRs, the
high cost of microsatellite development (Gupta &
Varshney, 2000), was eliminated by high levels of
cross-species transferability within Fragaria
(Ashley et al., 2003; Sargent et al., 2003; Lewers et
al., 2005; Bassil et al., 2006a; Davis et al., 2006;
Monfort et al., 2006). This has facilitated the use of
SSRs in Fragaria for fingerprinting (Govan et al.,
2008), linkage mapping (Sargent et al., 2006; 2009),
and genetic diversity analysis (Hadonou et al.,
2004; Gil-Ariza et al., 2006). Expressed sequence
tag (EST) projects have generated a vast amount of
Figure 1. Map of Iran showing the approximate areas of collection site of the 17 local strawberry varieties used in this study.
Molecular variation of Iranian local and exotic strawberry (Fragaria * ananassa Duch.) varieties using SSR markers 245
No.
Genotype
Source
No.
Genotype
Source
1
NashurVasat
Local (Kurdistan province-Iran)
16
Sanandaj2
Local (Kurdistan province)
2
Barkulan
Local (Kurdistan province)
17
Sanandaj 1
Local (Kurdistan province)
3
Yaminan
Local (Kurdistan province)
18
Missionary
Exotic (Europe)
4
NashurSafli
Local (Kurdistan province)
19
Ventana
Exotic (Europe)
5
Yaminan2
Local (Kurdistan province)
20
Fresho
Exotic (Europe)
6
Toriverl
Local (Kurdistan province)
21
Karcy
Exotic (Europe)
7
Karabad
Local (Kurdistan province)
22
Marak
Exotic (Europe)
8
Toriver2
Local (Kurdistan province)
23
Gaviota
Exotic (Europe)
9
Qalaji
Local (Kurdistan province)
24
Camarosa
Exotic (Europe)
10
Danikesh
Local (Kurdistan province)
25
Diamant
Exotic (Europe)
11
Sanandaj3
Local (Kurdistan province)
26
Paroos
Exotic (Europe)
12
Sanandaj4
Local (Kurdistan province)
27
Classica
Exotic (Europe)
13
Drileh
Local (Kurdistan province)
28
Pajaro
Exotic (Europe)
14
Dorood
Local (Kurdistan province)
29
Selva
Exotic (Europe)
15
Shian
Local (Kurdistan province)
30
Queen
Exotic (Europe)
Table 1. List of 30 strawberry ( Fragaria x ananassa Duch.) varieties used for SSR fingerprinting.
publicly available sequence data from plant spe-
cies; these data can be mined for simple sequence
repeats (SSRs). These SSRs are useful as molecu-
lar markers because their development is inexpen-
sive, they represent transcribed genes and a
putative function can often be deduced by a ho-
mology search. Because they are derived from tran-
scripts, they are useful for assaying the functional
diversity in natural populations or germplasm col-
lections (Varshney et al., 2005).
The objective of this study was to use genomic
SSR and EST-derived SSR markers for genetic di-
versity analysis in some local and exotic strawberry
genotypes available in north-west of Iran.
MATERIALS AND METHODS
Thirty genotypes of strawberry, 17 of which col-
lected from different villages of Kurdistan province,
north-west of Iran, were examined. All of these ge-
notypes are named as ‘Kurdistan’ variety, while
huge morphological differences exist between
them. The additional thirteen genotypes under
study are famous exotic varieties that grow in most
strawberry production zones of Iran (Table 1).
Genomic DNAs were extracted from approxi-
mately 2 g of young leaves tissue. Leaf tissue was
ground to a fine powder in liquid nitrogen and sto-
red at -70 °C until total genomic DNA was isolated.
DNA was extracted using the CTAB method accor-
ding to Lassner et al. (1989) with the modification
described by Torres et al. (1993). The DNA final
concentration was determined by agarose-gel elec-
trophoresis using a known concentration of uncut X
DNA as a standard. Twenty-eight of 82 previously
published SSR primer pairs (Lewers et al., 2005;
Bassil et al., 2006a, b) were selected based on am-
plification of expected size fragments and allelic di-
versity reported by previous studies.
246
S.A. Hosseini, E. Karami & R.Talebi
Primer
pair
SSR type
sequ ence
Repeat motif
Reference
Forward
reverse
FAC-001
Genomic
AAATCCTGTTCCTGCCAGTG
TGGTGACGTATTGGGTGATG
(AAAAT)7
Lewers et al., 2005
FAC-008
Genomic
TACTGTGCACGCAACAACAG
CTCTCCAATCCTTCATTGAT
(CT)5A(TC)4
Lewers et al., 2005
FAC-011
Genomic
GTTTT C AGGCGGTCA ATT CTA
GCTTCAAGCAAAATGCATCATC
(TA)7A(AT)6
Lewers et al., 2005
FAC-012
Genomic
TACACGTGTCCTAGGGTTTTCA
AGCGGAGAATGAGTGACGATAG
(CCT)6
Lewers et al., 2005
UAFv7648
EST
AACCAGAGCCAGAGCCAG
CGACAGTGATGTAGAGGAAGA
(CT)12
Bassil et al., 2006a
UAFv8204
EST
CTCTGCCTTTCTCTACCC
CCCAAGTCTATGAGTGGAAC
(CT)ll
Bassil et al., 2006a
UAFv8936
EST
GTGACTTTGACGCTGACC
TGAGAGTGGTTCTGTTCCTC
(TA)7
Bassil et al., 2006a
UFFa01H05
EST
GGGAGCTTGCTAGCTAGATTTG
AGATCCAAGTGTGGAAGATGCT
(CT)8
Bassil et al., 2006a
UFFa02A03
EST
GAGCTACACAATGCCATCAAAA
GCGCATTCGACTCTGTAACTCT
(AG) 12
Bassil et al., 2006a
UFFa02G01
EST
ACGAGGTGGGTTTTGTGTTGT
CCCAGATGAAGAAACCGATCTA
(AG)6
Bassil et al., 2006a
UFFa03Dll
EST
TACCTTCTGCATTCACCATGAC
GCCTTGATGTCTCGTTGAGTAG
(AG A) 5
Bassil et al., 2006a
UFFa09Bll
EST
CTTGGGAGAGAACCAGAAAAAC
TCAGAACCAACTCCAGAGAAGC
(AG)6
Bassil et al., 2006a
UFFal4F08
EST
GTTTCTCTCAGGGCCAAAAT
CTTGAGTAGTCCTCTCACCATTG
(TC)9, (TA)5
Bassil et al., 2006a
UFFal9B10
EST
ATTTCTGTTGTCTCCCTCCTTC
GCTCGATCTCTAGCTTTCTCTCT
(CT)10, (TC)6
Bassil et al., 2006a
UFFa20G06
EST
ACTCAACCACCACATTTCACAC
GAGAAGTTGTCAATAGTCCAGGTG
(CT)ll
Bassil et al., 2006a
UFFal6H07
EST
CTCTACCACCATTCAAAACCTC
CACTGGAGACATCTAGCTCAAAC
(CT)ll
Bassil et al., 2006a
SF- 2H12
EST
CCTGCATATCTTCTGCAACAAC
AAGCAGCACCACCTTCAGTAGT
(TC)15
Bassil et al., 2006b
SF-1B07
EST
GGAGAGACAGACCTCAAAGGTG
GAGGGGTTCTGTTTTTGACAAG
CTs (AG) 7
Bassil et al., 2006b
SF-4B12
EST
GCAAAGTCGGAGAGAGATAGA
CTGAAGAAGGTGTTGAGGAA
(CT)8
Bassil et al., 2006b
SF-5G02
EST
CTTTTGCTGCTAGCTCTTTGTG
TACGTACTCCACATCCCATTTG
(TC)ll
Bassil et al., 2006b
Table 2. List of 20 SSR primer pairs, including the type of SSR (EST or genomic), primer sequences (F-forward, R-re-
verse), and repeat motifs, used for genetic diversity assessment of strawberry varieties.
These twenty-eight SSRs were tested for ampli-
fication by 3% agarose gel electrophoresis in 10 ge-
notypes and identified 20 well-amplified SSR
primer pairs (Table 2). These SSR primer pairs were
chosen for this study based on polymorphism and
ease of scoring after fragment analysis.
These SSRs consisted of 16 expressed sequence
tag (EST) SSRs and four genomic SSRs. PCRs
were performed in 20 pi total reaction volumes con-
taining: 1 x PCR buffer, 2 mM MgC12, 0.2 mM each
dNTP, 0.3 pM of each primer, 1 U of Taq polyme-
rase enzyme (Cinagen, Iran) and 15 ng of DNA
Molecular variation of Iranian local and exotic strawberry (Fragaria * ananassa Duch.) varieties using SSR markers 247
Microsatellite
Expected
size
N e
GD
c i
D j
PIC
FAC-001
212
4
1.95
0.53
0.22
0.78
0.50
FAC-008
138
3
1.22
0.22
0.39
0.61
0.19
FAC-011
298
4
3.36
0.74
0.15
0.85
0.71
FAC-012
169
6
2.99
0.69
0.16
0.84
0.68
UAFv7648
235
16
6.98
0.88
0.06
0.94
0.87
UAFv8204
238
6
2.17
0.59
0.27
0.77
0.55
UAFv8936
310
3
1.41
0.34
0.35
0.65
0.30
UFFa01H05
246
5
2.18
0.60
0.20
0.80
0.55
UFFa02A03
168
5
4.12
0.79
0.13
0.77
0.77
UFFa02G01
159
4
2.16
0.57
0.28
0.72
0.55
UFFa03Dll
189
4
2.11
0.58
0.19
0.71
0.54
UFFa09Bll
197
6
3.46
0.74
0.14
0.86
0.72
UFFal4F08
137
6
2.96
0.69
0.17
0.73
0.67
UFFal9B10
183
7
3.09
0.72
0.18
0.82
0.69
UFFa20G06
154
5
1.9
0.50
0.25
0.75
0.53
UFFal6H07
248
3
2.54
0.66
0.18
0.82
0.62
SF- 2H12
240
8
5.44
0.88
0.09
0.91
0.83
SF-1B07
163
9
3.8
0.77
0.14
0.86
0.75
SF-4B12
355
5
1.62
0.42
0.31
0.69
0.39
SF-5G02
229
9
5.17
0.85
0.09
0.91
0.82
Table 3. List of 20 SSR primer pairs, including the type of SSR (EST or genomic), primer sequences (F-forward, R-re-
verse), and repeat motifs, used for genetic diversity assessment of strawberry varieties.
template. PCR products were analyzed using 3%
methaphor agarose electrophoresis gels stained with
ethidium bromide. Alleles were scored as present
(1) or absent (0) for each marker and a binary data
matrix was created. DARwin version 5.0 was used
for calculating pair-wise genetic distances and for
constructing the dissimilarity matrix (Perrier et al.,
2003). The dissimilarity matrix thus obtained was
subjected to cluster analysis using the un-weighted
neighbour-joining (UNJ) method (Gascuel, 1997),
followed by bootstrap analysis with 1 ,000 permu-
tations to obtain a dendrogram for all the 30 acces-
sions (Perrier et al., 2003). Frequencies of incidence
of all polymorphic alleles for each SSR markers
were calculated and used for determining statistical
parameters. Confusion probability (Cj) and discri-
248
S.A. Hosseini, E. Karami & R.Talebi
minating power (Dj) of each SSR were estimated
according to Tessier et al. (1999) and polymorphic
information content (PIC) following Botstein et al.
(1980).
RESULTS
SSR polymorphisms
In the present study, a total of 20 SSR loci (4 ge-
nomic and 16 EST-derived SSRs) (Table 2) were
used to analyze genetic diversity among 17 local
varieties collected from ‘Kurdistan’ province
(North-west of Iran) and 13 exotic cultivars. All
SSR markers showed a high level of polymor-
phisms, display a total of 1 1 8 different alleles with
fragment size ~ 130 to 300 bp (Table 3). The num-
ber of alleles per locus varied from 3 to 16, with an
average value of 6 alleles. FAC-008, UAFv8936
and UFFal6H07 amplified minimum number of al-
leles (3), whereas the maximum was observed at
UAFv7648, with 16 different alleles. The effective
allelic number (ne) was 3.03 on average and ranged
from 1.22 to 6.98 (Table 3). The gene diversity
(GD) and PIC values ranged from 0.22 to 0.88 and
0.19 to 0.87, with an average of 0.63 and 0.60, re-
spectively (Table 3). Fligh value of discriminating
power (Dj> 0.70) and PIC>0.50, and low values of
confusion probability (Cj<0.30) were obtained for
all SSR markers evaluated except for FAC-008,
UAFv8936 and SF-4B12 (Table 3), thus indicating
the usefulness and power of these SSR markers for
genetic identification in strawberries.
Cultivar identification
The genetic similarity matrix was analysed using
un- weighted neighbor joining (UNJ) clustering al-
gorithm by software programme DARwin 5.0 (Fig.
2). The radial branching clearly delineated the ge-
notypes in four major clusters (Fig. 2). Group 1
was further divided in two subgroups. This cluster
contained eight genotypes three of which (Fresho,
Ventana and Missionary) were exotic cultivars and
the remaining ones were local cultivars collected
from southern parts of ‘Kurdistan’ province. In
group 2, only two exotic cultivars (Karcy and
Marak) were placed with two local cultivars origi-
nated from central zone of ‘Kurdistan’ province.
Eight cultivars grouped in cluster 3 including all
exotic cultivars. Cluster 4 contained ten genotypes
all of which were local cultivars mostly collected
from the southern part of ‘Kurdistan’ province (Fig.
2). Most of the local cultivars grouped in clusters 1
and 4, and four exotic cultivars (Queen, Missionary,
Ventana and Fresho) were the closest cultivars to
these local varieties. In cluster 3 were grouped
most of the remained exotic cultivars, significantly
distant from local varieties. These results suggested
that the local cultivars in Kurdistan province may
be originated from Queen, Missionary, Ventana and
Fresho or may share the pedigree sources with these
cultivars. In order to determine the ability of SSR
markers to display genetic relationships among
strawberry cultivars, principle co-ordinate analysis
(PCoA) was carried out and cultivars were plotted
in the coordinate system for the first two coordi-
nates which accounted for 45% and 30% of the va-
riation, respectively (Fig. 3). Most of the cultivars
are separated by the first or second PCoA (Fig. 3)
which demonstrated distinct groups of cultivars cor-
responding to cluster analysis (Fig. 2).
DISCUSSION AND CONCLUSIONS
Whereas phenotypic descriptors may vary with
climate, geography or cultural practices, forensic
tools based on genetic material allow cultivar au-
thentication with great certainty. DNA markers
provide a robust, rapid, and relatively inexpensive
means to differentiate closely related plant mate-
rials. Strawberry plants are propagated vegetative ly
and can be easily misidentified based on phenotype
(Bassil et al., 2006b). Being a vegetative propaga-
ted species, collected strawberry accessions show
considerable levels of genetic divergence. Despite
its economic value, the polyploid constitution of
the strawberry has been a major barrier to the ge-
netic characterization of the cultivated species and
limited information on the genome structure has
been published.
In this study, 20 SSR primers that bracket well-con-
served and readily amplifiable regions of strawberry
genomic DNA were used to assay the strawberry ger-
mplasm typically grown by farmers in ‘Kurdistan’
province (North-west of Fan) and the exotic cultivars
available in the collection of agricultural research
station of Kurdistan. SSR markers have the advan-
Molecular variation of Iranian local and exotic strawberry (Fragaria * ananassa Duch.) varieties using SSR markers 249
NasluirSafli
Yaniiium 2
Dri Leh
Saimaa
Pajaro
Classics
Dorood
&31iaiulaj 4
NashurVasat Barkulan
Queen*—
Sanaiidaj 1
Sauandaj 2
Freslio
Shi an*
Toriver 1
i an Li] Lin i
\ entana
Marak
Missionary
Kara bad
Selva
Danikesh
Toriver 2
Gaviofa
CaniancKia
Diamanl
Figure 2. Un-weighted pair grouping method of arithmetic averages dendrogram of 30 strawberry varieties based on ge-
netic distances computed from SSR markers.
Coord. 1
Figure 3. Two-dimensional representation of genetic relations among 30 strawberry varieties using SSR data.
250
S.A. Hosseini, E. Karami & R.Talebi
tage over arbitrary marker systems in using pri-
mer pairs of a defined sequence, and are therefore
highly reproducible and in the case of EST-SSRs,
are developed directly from the sequence of genes
of known function. Thus, SSR markers could cor-
respond to candidate sequences relevant to horti-
cultural traits. In addition, SSRs can be genotyped
with a high degree of precision, permitting the
standardization of fingerprint data between labo-
ratories providing a reference cultivar set which
can be used in all experiments. This is the first
known report on the use of SSR markers for
creating genetic fingerprints and determining ge-
netic relationships among Iranian strawberry ge-
notypes.
The results clearly demonstrate that SSR markers
can be used in a genetic diversity study as well as
in genotypic identification of strawberries, as al-
ready noted by Bmnings et al. (2010) and Njuguna
et al. (2011). In the current study, a total number
of 118 alleles, detected using 20 SSR selective
markers, with an average of 5.9 allele per locus,
suggested the presence of a considerable polymor-
phism at studied microsatellite loci and revealed a
high level of genetic diversity in the existing straw-
berry germplasm (Table 3) which is close to results
obtained by Bmnings et al. (2010) and Njuguna et
al. (2011). Moreover we demonstrate that a low
number of polymorphic SSR markers could be ap-
plied to differentiate a large number of strawberry
genotypes and that SSR markers potentially detect
a higher level of DNA polymorphism than do other
DNA markers in strawberries. The effective number
of allele (ne) was taken into account for both the
number of alleles and their frequencies. It allowed
us to compare populations where the number and
distributions of alleles differ drastically. We also
tried to assess the effective number of alleles as a
corollary to the expected heterozygosity. PIC values
estimate the discriminatory power of a marker. The
mean PIC value for markers used in present study
was 0.60 and it ranged from 0.19 for locus FAC-
008 to 0.87 for locus UAFv7648 (Table 3).
Markers with high PIC values could be effecti-
vely used in genetic diversity studies in strawberry.
Despite the high number of alleles observed in most
SSR loci, a high number of alleles was observed in
exotic cultivars in comparison to local cultivars.
There are fewer alleles present in the local cultivars,
suggesting that the resource was constmcted from
a narrower genetic set than that which comprises
the bulk of the exotic cultivars. This finding is
somewhat anticipated as the exotic cultivars as-
sayed represent plant materials arising from many
different origins and breeding programs. Still, fu-
ture breeding efforts might benefit from a parallel
introgression of additional diversity from ranging
sources. SSR-based fingerprinting can guide the in-
crease in genetic diversity by selection of genoty-
pes with different alleles than those present in
existing breeding programs.
The existing genetic diversity observed in
studied cultivar, indicated the efforts underway
to widen the genetic base of strawberry for va-
rious traits. Information about current genetic di-
versity permits the classification of our available
germplasm into various/heterotic groups, which is
particularly important to hybrid/cross-breeding
programs in strawberry. Even though the genetic
mechanisms that explain heterosis are not fully un-
derstood, it is well documented that crosses bet-
ween unrelated and genetically distant parents,
show a greater hybrid-vigor than crosses between
closely related parents (Stuber 1994; Hallauer,
1999). There could be a possibility to exploit hy-
brid in strawberry. The previous crossing pro-
grams in most research centers of Iran were based
on only phenotypic characters.
The current study confirmed the importance of
molecular studies beside the morphological data in
detecting genetic variation among genotypes in se-
lecting diverse parents to carry out a new crossing
program successfully.
REFERENCES
Ashley M.V., Wilk J.A., Styan S.M.N., Craft K.J., Jones
K.L., Feldheim K.A., Lewers K.S. & Ashman T.L.,
2003. High variability and disomic segregation of mi-
crosatellites in the octoploid Fragaria virginiana Mill
(Rosaceae). Theoretical and Applied Genetics, 107:
1201-1207.
Bassil N.V., Njuguna W. & Slovin J.P., 2006a. EST-SSR
markers from Fragaria vesca L. cv. Yellow Wonder.
Molecular Ecology Notes, 6: 806-809.
Bassil N.V., Gunn M., Folta K. & Lewers K., 2006b. Mi-
crosatellite markers for Fragaria from ‘Strawberry
Festival’ expressed sequence tags. Molecular Eco-
logy Notes, 6: 473-476.
Botstein D., Withe R.L., Skolnick M. & Davis R.W.,
1980. Construction of genetix linkage map in man
Molecular variation of Iranian local and exotic strawberry (Fragaria * ananassa Duch.) varieties using SSR markers 25 1
using restriction fragment length polymorphisms.
American Journal of Human Genetics, 32: 314-331.
Brunings A.M., Moyer C., Peres N. & Folta K.M., 2010.
Implementation of simple sequence repeat markers
to genotype Florida strawberry varieties. Euphytica,
173: 63-75.
Cipriani G. & Testolin R., 2004. Isolation and characte-
rization of microsatellite loci in Fragaria. Molecular
Ecology Notes, 4: 366-368.
Davis T.M., Dimeglio L.M., Yang R., Styan S.M.N. & Le-
wers K.S., 2006. Assessment of SSR marker transfer
from the cultivated strawberry to diploid strawberry
species: functionality, linkage group assignment, and
use in diversity analysis. Journal of American Society
of Horticultural Science, 131: 506-512.
Eshghi S., Abdi G., Tafazoli E. & Yavari S., 2007. Straw-
berry Research and Biotechnology in Iran. Middle
Eastern and Russian Journal of Plant Science and
Biotechnology, 1: 39-41.
Garcia M.G., Ontivero M., Diaz Ricci J.C. & Castagnaro
A., 2002. Morphological traits and high resolution
RAPD markers for the identification of the main
strawberry varieties cultivated in Argentina. Plant
Breeding, 121: 76-80.
Gascuel O., 1997. BIONJ: an improved version of the NJ
algorithm based on a simple model of sequence data.
Molecular Biology and Evolution, 14: 685-695.
Gil-Ariza D.J., Amaya I., Botella M.A., Munoz Blanc J.,
Caballero J.L., Lopez-Aranda J.M., Valpuesta V. &
Sanchez-Sevilla J.F., 2006. EST-derived polymorphic
microsatellites from cultivated strawberry (Fragaria
x ananassa ) are useful for diversity studies and varie-
tal identification among Fragaria species. Molecular
Ecology Notes, 6:1195-1197.
Govan C.L., Simpson D.W., Johnson A. W., Tobutt KR..
& Sargent D.J., 2008. A reliable multiplexed micro-
satellite set for genotyping Fragaria and its use in a
survey of 60 F. x ananassa cultivars. Molecular
Breeding, 22: 649-661.
Gupta P.K. & Varshney R.K., 2000. The development
and use of microsatellite markers for genetic analysis
and plant breeding with emphasis on bread wheat.
Euphytica, 113: 163-185.
Hadonou A.M., Sargent D.J., Wilson F., James C.M. &
Simpson D.W., 2004. Development of microsatellite
markers in Fragaria , their use in genetic diversity
analysis, and their potential for genetic linkage map-
ping. Genome, 47: 429-438.
Hallauer A.R., 1999. Temperate maize and heterosis. In:
Coors J. and Pandey S. (Eds.). The Genetics and ex-
ploitation of heterosis in crops, CIMMYT, Mexico
City 17-22 Aug. 1997 ASA, Madison, WI. pp. 353-361.
James C.M., Wilson F., Hadonou A.M. & Tobutt K.R.,
2003. Isolation and characterization of polymorphic
microsatellites in diploid strawberry (Fragaria vesca
L.) for mapping, diversity studies and clone identifi-
cation. Molecular Ecology Notes, 3:171-173.
Lassner M.W., Peterson P. & Yoder J.I., 1989. Simulta-
neous amplification of multiple DNA fragments by
polymerase chain reaction in the analysis of transge-
nic plants and their progeny. Plant Molecular Biology
Reporter, 7: 116-128.
Lewers K.S., Styan S.M.N. , Hokanson S.C. & Bassil
N.V., 2005. Strawberry GenBank-derived and geno-
mic simple sequence repeat (SSR) markers and their
utility with strawberry, blackberry, and red and black
raspberry. Journal of American Society of Horticul-
tural Science, 130:102-115.
Luby J.J., Hancock J.F., Dale A. & Serge S., 2008. Re-
constructing Fragaria x ananassa utilizing wild F.
virginiana and F chiloensis\ inheritance of winter in-
jury, photoperiod sensitivity, fruit size, female ferti-
lity and disease resistance in hybrid progenies.
Euphytica, 163: 57-65.
Monfort A., Vilanova S., Davis T.M. & Arus P, 2006. A
new set of polymorphic simple sequence repeat
(SSR) markers from a wild strawberry (Fragaria
vesca) are transferable to other diploid Fragaria spe-
cies and to Fragaria x ananassa. Molecular Ecology
Notes, 6: 197-200.
Nathewet P„ Hummer K.E., Yanagi T., Iwatsubo Y. &
Sone K., 2010. Karyotype analysis in octoploid and
decaploid wild strawberries in Fragaria (Rosaceae).
Cytologia, 75: 277-288.
Njuguna W., Hummer K.E., Richards C.M., Davis T.M.
& Bassil N.V., 2011. Genetic diversity of diploid Ja-
panese strawberry species based on microsatellite
markers. Genetic Resources & Crop Evolution, 58:
1187-1198.
Perrier X., Flori A. & Bonnot F., 2003. Data analysis me-
thods. In: Hamon P., Seguin M., Perrier X. & Gla-
szmann J.C. (Eds.). Genetic diversity of cultivated
tropical plants. Science Publishers, Montpellier, pp.
43-76.
Powell W., Morgante M., Andre C., Hanafey M., Vogel
J., Tingey S. & Rafalski A., 1996. The comparison of
RFLP, RAPD, AFLP and SSR (microsatellite) mar-
kers for germplasm analysis. Molecular Breeding, 2:
225-238.
Rousseau-Gueutin M., Gaston A., Ai'nouche A., A'inou-
che M.L., Olbricht K., Staudt G., Richard L. & De-
noyes-Rothan B., 2009. Tracking the evolutionary
history of polyploidy in Fragaria L. (strawberry):
new insights from phylogenetic analyses of low-copy
nuclear genes. Molecular Phylogenetics & Evolution,
51: 515-530.
Sargent D., Fernandez-Fernandez F., Ruiz-Roja J., Su-
therland B., Passey A., Whitehouse A. & Simpson D.,
2009. A genetic linkage map of the cultivated straw-
berry (Fragaria x ananassa ) and its comparison to
252
S.A. Hosseini, E. Karami & R.Talebi
the diploid Fragaria reference map. Molecular Bree-
ding, 24: 293-303.
Sargent D.J., Clark J., Simpson D.W., Tobutt K.R., Arus P.,
Monfort A., Vilanova S., Denoyes-Rothan B., Rous-
seau M., Folta K.M., Bassil N.V. & Battey N.H., 2006.
An enhanced microsatellite map of diploid Fragaria.
Theoretical and Applied Genetics, 112: 1349-1359.
Sargent D.J., Hadonou A.M. & Simpson D.W., 2003. De-
velopment and characterization of polymorphic micro-
satellite markers from Fragaria viridis, a wild diploid
strawberry. Molecular Ecology Notes, 3: 550-552.
Sjulin T. & Dale A., 1987. Genetic diversity of North
American strawberry cultivars. Journal of American
Society of Horticultural Science, 112: 375-385.
Stuber C.W., 1994. Heterosis In Plant Breeding. Plant
Breeding Review, 12: 227-251.
Tessier C,, David J., This P., Boursiquot J.M. & Charrier
A., 1999. Optimization of the choice of molecular
markers for varietal identification in Vitis vinifera L.
Theoretical and Applied Genetics, 98: 171-177.
Torres A.M., Weeden N.F. & Marin A., 1993. Linkage
among isozyme, RFLP and RAPD markers in Vicia
faba. Theoretical and Applied Genetics, 85: 937-945.
Varshney R.K., Graner A. & Sorrels M.E., 2005. Genic
microsatellite markers in plants: Features and appli-
cations. Trends in Biotechnology, 23: 48-55.
Biodiversity Journal, 2013, 4 (1): 253-259
Fields survey of freshwater fishes in Upper Moei River, Sal
ween Basin, frontier of Thailand and Myanmar
Sitthi Kulabtong 1 *, Sawika Kunlapapuk 2 , Parin/a Pawangkanant 3 , Cha/ajit Deekrachang 4 ,Thiti Ruangsu-
wan 4 , Domes Limpivadhana 4 , Supapong Patarapongpan 4 & Chaiyapat Pramoolpol 4
'Save wildlife volunteer Thailand, Wangnoi District, Ayuttaya Province 13170, Thailand, e-mail: kulabtong201 [email protected]
2 Aquatic Animal Production Technology Program, Faculty of Animal Sciences and Agricultural Technology, Silpakom University,
Phetchaburi IT campus, Petchaburi 76120, Thailand
3 Bansomdejchaopraya Rajabhat University, Bangkok 10600, Thailand
4 Department of Marine science, Faculty of Fisheries, Kasetsart University, Bangkok 10900, Thailand
Corresponding author
ABSTRACT The present paper reports on a field survey in Upper Moei River, at Phop Phra District, Tak
Province, Northwest Thailand, carried out in January and June 2010. Specimens encountered
belong to 5 orders, 8 families and 20 species of freshwater fishes. In particular, Schistura
waltoni, S. vinciguerrae, Lepidocephalichthys micropogon, Neonoemacheilus labeosus and
Gagata dolichonema are new records for Moei River; two species remain not fully identified
and, at the moment are reported as Devario sp. and Channa cf. gachua. The Thai local names
and distribution data of freshwater fishes are provided.
KEY WORDS freshwater fishes; Moei River; Salween Basin; Thailand.
Received 13.08.2012; accepted 09.12.2012; printed 30.03.2013
INTRODUCTION
Salween River System originates at the Hima-
laya mountain range and flows from the Tibetan
Plateau into the Andaman Sea. It drains a narrow
and mountainous watershed of 324,000 square kilo-
metres that extends into the countries of China,
Burma and Thailand.
In Thailand, Salween Basin has three large tribu-
taries namely Pai River, Suriya - Maekasat River and
Moei River (Vidthayanon et ah, 1997). Moei River,
at the frontier between Thailand and Myanmar, Tak
Province, is characterized by its own ecological fea-
tures which differentiate it from the other river sy-
stems of the Indo-Bunnese Province. Although it is
certainly of interest, nevertheless is poorly investi-
gated and little is known about freshwater fishes oc-
curring in this area. For this reason, a survey project
on freshwater fishes of the Upper Moei River at Phop
Phra District, Tak Province, Northwest Thailand
(Fig. 3) was carried out in January and June 2010.
We separated this area into 3 regions in accordance
to the ecosystems; namely:
1) Pool of the headwater stream. The average
width of the pool is about 5-10 m, average depth less
than 1 m, the bottom is a combination of clay and
sand, the stream is transparent and running slowly.
2) Small tributary streams, in the foothill. Ave-
rage width is about 5 m or less, depth is less than 1
m, the bottom is sandy, the stream is turbid and run-
ning fast.
3) Main stream of Upper Moei River, at the
frontier of Thailand and Myanmar. Average width
is about 100 m, average depth is about 1-2 m, the
bottom is sandy with clay, the stream is turbid and
running fast.
254
S. Kulabtong et alii
RESULTS
Order CYPRINIFORMES Bleeker, 1859
Family CYPRINIDAE Cuvier, 1817
Devario sp.
Distribution. This species (Fig. 3) is known
exclusively from Upper Moei River, Tak Province,
Thailand.
Habitat. Devario sp. was found in the pool of
the headwater stream.
Remarks. Body side and all fins of specimens
observed in this study are dark red, which in our
opinion, could be referred to mature males. In Thai-
land, many species of cyprinid fish of the genus De-
vario still have unclear identifications. Although
further studies are certainly needed, nevertheless we
believe this taxon to be different from other Devario
species of Thailand.
Thai local name. Pla seel bai pai.
Barilius infrafasciatus Fowler, 1934
Distribution. This species (Fig. 4) is known
from Chao Phraya River and Mekong basins, Thai-
land.
Habitat. B. infrafasciatus was found in the
small tributary streams.
Remarks. While alive, the specimens show
many clearly blue upright strips along the body.
Thai local name. Pla num murk.
Mystacoleucus argenteus (Day, 1888)
Distribution. This species (Fig. 5) is known
only from Salween Basin, frontier of Thailand and
Myanmar; Tenasserim Basin in Myanmar.
Habitat. M. argenteus was found in headwater
of the main stream.
Thai local name. Pla kee yok or Pla num lung.
Pethia stolitzkaenus (Day, 1869)
Distribution. This species (Fig. 6) is known
from Meklong River and Chao Phraya River, Thai-
land; Mekong Basin, Thailand and Laos; Salween
Basin, Thailand and Myanmar; Irrawaddy Basin in
Myanmar; Bengal, India.
Habitat. P. stolitzkaenus was found in the
headwater of the main stream.
Thai local name. Pla ma phai.
Systomus orphoides (Valenciennes, 1842)
Distribution. This species (Fig. 7) is native
Figures 1 , 2. Study area: Upper Moei River, Salween Basin, frontier of Thailand and Myanmar.
Fields survey of freshwater fishes in Upper Moei River, Salween Basin, frontier of Thailand and Myanmar
255
Figure 3. Devario sp., 55 mmSL. Figure 4. Barilius infrafasciatus, 38 mmSL. Figure 5. Mystacoleucus argenteus, 52 mmSL.
Figure 6. Pethia stoliczkana, 35 mmSL. Figure 7. Systomus orphoides , 48 mmSL. Figure 8. Neolissochilus stracheyi, 92
mmSL. Figure 9. Homaloptera bilineata, 43 mmSL. Figure 10. Acanthocobitis zonalternans, 29 mmSL. Figure 11. Neo-
noemacheilus labeosus, 66 mmSL. Figure 12. Schistura waltoni, 27 mmSL.
256
S. Kulabtong et alii
species from Myanmar, Thailand, Laos, Cambodia,
Viet Nam, Malaysia and Indonesia; introduced in
Europe and India.
Remarks. In this study, only one specimen was
found in the pool of the headwater stream.
Thai local name. Pla gam chum.
Neolissochilus stracheyi (Day, 1871)
Distribution. This species (Fig. 8) is known from
Meklong River, Chao Phraya River, Southeast
Basin and Peninsular Thailand; Mekong Basin in
Thailand, Laos, Cambodia and Viet Nam; Salween
Basin, Thailand and Myanmar.
Habitat. N. stracheyi was found in the pool of
the headwater stream.
Remarks. Juveniles show a clearly black blot
on the caudal peduncle which was never observed
in the adults.
Thai local name. Pla plong.
Family BALITORIDAE Swainson, 1839
Homaloptera bilineata Blyth, 1860
Distribution. H. bilineata (Fig. 9) is known
from Himalayan waters, Nepal; India; Tenasserim
Basin, Myanmar; Salween Basin, Thailand and
Myanmar.
Habitat. In this study, only one specimen of H.
bilineata was found in small tributary stream.
Thai local name. Pla jing jok.
Acanthocobitis zonalternans (Blyth, 1860)
Distribution. A. zonalternans (Fig. 10) is known
from Manipur, India; Irrawaddy Basin, Chindwin
Basin, Tenasserim Basin, Myanmar; Salween Basin,
Thailand and Myanmar; Mekong Basin and Penin-
sular Thailand; Peninsular Malaysia.
Habitat. This species was found in the head-
water of the main stream.
Thai local name. Pla kor ta narm.
Neonoemacheilus labeosus (Kottelat, 1982)
Distribution. In Thailand, N. labeosus (Fig.
11) is recorded only in Salween River at Mae
Sahm Leap, Mae Hong Son Province, Thailand.
New record for Moei River.
Habitat. In this study, only one specimen was
found in the main stream.
Remarks. In the genus Neonoemacheilus ex-
ternal characters are similar to those of many
loach-like fishes, i.e. Nemacheilus and Schistura.
But this genus is distinguished from the other ones
by the combination of the following characters: the
upper lip of the mouth is thick and fringed, adult
males show a suborbital flap (Kottelat, 1990).
Thai local name. Pla kor.
Schistura waltoni (Fowler, 1937)
Distribution. S. waltoni (Fig. 12) is known
from the Upper Chao Phraya River system. New
record for Moei River.
Habitat. This species was found in the pool of
the headwater stream.
Thai local name. Pla kor.
Schistura vinciguerrae (Hora, 1935)
Distribution. S. vinciguerrae (Fig. 13) is
known from India; Irrawaddy and Salween basins
in Myanmar and China. In Thailand, this species
was known only in Salween Basin. New record for
Moei River.
Habitat. This species was found in the pool of
the headwater stream.
Thai local name. Pla kor.
Family COBITIDAE Swainson, 1839
Acanthopsoides delphax Siebert, 1991
Distribution. This species (Fig. 14) is known
from Mekong, Salween and Chao Phraya basins,
Thailand.
Habitat. A. delphax was found in the main
stream.
Remarks. A. delphax is distinguished from A.
gracilentus by the combination of the following
characters: eye almost wholly in posterior half of
the head (in A. gracilentus eye almost wholly in
Fields survey of freshwater fishes in Upper Moei River, Salween Basin, frontier ofThailand and Myanmar
257
Figure 13. Schistura vinciguerrae, 58 mmSL. Figure 14. Acanthopsoides delphax , 40 mmSL. Figure 15. Lepidocephalichthys
berdmorei, 71 mmSL. Figure 16. Lepidocephalichthys micropogon, 68 mmSL. Figure 17 . Xenentodon cancila, 117 mmSL.
Figure 18. Mastacembelus armatus, 142 mmSL. Figure 19. Parambasis vollmeri, 34 mmSL. Figure 20. Channa cf. gachua,
136 mmSL. Figure 21. Channa striata, 129 mmSL.
258
S. Kulabtong et alii
anterior half of the head), snout long 2 times or less
than head length (in A. gracilentus is short), verte-
bral number is 37 or more (in A. gracilentus is
usually less than 37) (Siebert, 1991).
Thai local name. Pla rak kluy kae.
Lepidocephalichthys berdmorei (Blyth, 1860)
Distribution. L. berdmorei (Fig. 15) is known
from India; Bangladesh; Myanmar; China; Thai-
land; Laos; Peninsular Malaysia.
Habitat. This species was found in the pool of
the headwater stream.
Remarks. Two species of this genus, were
found in the study area. L. berdmorei in the head-
water stream and L. micropogon (Fig. 16) in the
main stream. Although the two species are very
similar, L. berdmorei is distinguished fromL. mi-
cropogon by the combination of the following
characters: caudal fin is truncate (in L. micropo-
gon is strongly forked), dorsal-fin origin usually
posterior to pelvic-fin origin (Vidthayanon et al.,
2005).
Thai local name. Pla eed.
Lepidocephalichthys micropogon (Blyth, 1 860)
Distribution. It is known from India, Bangla-
desh and Myanmar; It is a new record for Moei
River.
Habitat. L. micropogon was found in the main
stream.
Thai local name. Pla eed.
Order SILURIFORMES Cuvier, 1817
Family SISORIDAE Bleeker, 1858
Gagata dolichonema He, 1996
Distribution. This species is known from
Chindwin Basin, Manipur, India; Irrawaddy Basin,
Tenasserim Basin, Salween Basin in Myanmar; in
Thailand, this species was known only in Salween
Basin and is a new record for Moei River.
Habitat. G. dolichonema was found in the main
stream.
Thai local name. Pla ya kui.
Order BELONIFORMES Berg, 1940
Family BELONIDAE Bonaparte, 1832
Xenentodon cancila (F. Hamilton, 1 822)
Distribution. X. cancila (Fig. 17) is known
from India Sub-continent to Southeast Asia. Intro-
duced in America.
Habitat. This species was found in a small tri-
butary of the main stream.
Thai local name. Pla kra tung hav.
Order SYNBRANCHIFORMES Bonaparte, 1838
Family MASTACEMBELIDAE Bleeker, 1870
Mastacembelus armatus (Lacepede, 1800)
Distribution. M. armatus (Fig. 18) is known
from India Sub-continent to Southeast Asia.
Habitat. This species was found in the headwater
of the main stream
Thai local name. Pla kra ting.
Order PERCIFORMES Bleeker, 1859
Family AMB AS SID AE Bonaparte, 1832
Parambassis vollmeri Roberts, 1994
Distribution. This species (Fig. 19) is known
from Salween Basin, Thailand and Myanmar.
Habitat. P. vollmeri was found in a small tribu-
tary of the main stream.
Thai local name. Pla pan ghav.
Family CHANNIDAE Berg, 1940
Channa cf. gachua (Hamilton, 1 822)
Distribution. C. cf. gachua (Fig. 20) is known
from India Sub-continent to Southeast Asia.
Habitat. This species was found in the main
stream.
Remarks. In Thailand, the taxonomic status of
this taxon is still unclear, being reported from time
to time as C. gachua or C. limb at a.
Fields survey of freshwater fishes in Upper Moei River, Salween Basin, frontier ofThailand and Myanmar
259
Thai local name. Pla gung.
Channa striata (Bloch, 1793)
Distribution. C . striata (Fig. 21) is known from
Pakistan, India Sub-continent to Southeast Asia and
China; introduced in Europe, Africa, America, Phi-
lippines, Papua New Guinea and Korea.
Habitat. This species was found in the main
stream.
Thai local name. Pla chon.
ACKNOWLEDGEMENTS
The authors are grateful to two anonymous
referees for reviewing this manuscript, and to all
rangers of the Namtok Pha Charoen National Park,
Tak Province, Thailand for providing help during
the field survey. A very special thank to Dr. Cha-
valit Vidthayanon, Mr. Chaiwut Grudpan and Mr.
Anuratana tejavej for providing the identification
of some species; and to the Siamensis Team for
helping in collecting the specimens employed in
this study.
REFERENCES
Kottelat M., 1990. Indochinese nemacheilines. A revi-
sion of nemacheiline loaches (Pisces: Cyprinifor-
mes) of Thailand, Burma, Laos, Cambodia and
southern Viet Nam. Verlag Dr. Friedrich Pfeil, Miin-
chen, 262 pp.
Siebert D.J., 1991. Revision of Acanthopsoides Fowler,
1934 (Cypriniformes: Cobitidae), with the descrip-
tion of new species. Japanese Journal of Ichthyology,
38: 97-114.
Vidthayanon C., Kamasuta J. & Nabhitabhata J., 1997.
Diversity of freshwater fishes in Thailand. Office of
Environmental and Planning, Bangkok, 120 pp.
Vidthayanon C., Termvidchakorn A. & Pe M., 2005. In-
land fishes of Myanmar. Southeast Asian fisheries de-
velopment center, 160 pp.