Bonn Vomime 57
Issue 2
zoological 010
Bulletin
formerly: Bonner zoologische Beitrage
Herpetologia Koenigiana
Festschrift in honour of Prof. Wolfgang BOhme
Guest editor: Philipp Wagner
An open access journal of organismal zoology,.published by
Zoologisches Forschungsmuseum Alexander Koenig, Bonn
Bonn zoological Bulletin (BzB), formerly “Bonner zoologische Beitrage”, is published by the Zoologisches Forschungsmuseum
Alexander Koenig (ZFMK), Bonn. Two regular issues of BzB are published per year; supplements on focus topics are produced
in irregular succession.
Subscription price is 46 € per volume (year), including supplements and shipping costs. For subscription, back issues and insti-
tutional exchange, please contact the ZFMK library (ZFMK, Bibliothek, Frau Diane Steinebach, Adenauerallee 160, D-53113 Bonn,
Germany, tel. +49 228-9122-216, fax: +49 228-9122-212; [email protected]). The online version of BzB is avail-
able free of charge at the ZFMK homepage: http://www.zfmk.de/web/Forschung/Buecher/Beitraege/index.en.html.
© 2010 Zoologisches Forschungsmuseum Alexander Koenig, Bonn, Germany. ISSN 2190-7307
Produced by Eva-Maria Levermann, Kaiserstr. 129, D-53113 Bonn, Germany; [email protected].
Printed and bound by DCM, Werner-von-Siemens-Str. 13, D-53340 Meckenheim, Germany.
Bonn zoological Bulletin
Editor-in-Chief
Fabian Herder, Zoologisches Forschungsmuseum Alexander
Koenig (ZFMK), Ichthyology Section, Adenauerallee 160,
53113 Bonn, Germany,
tel. +49 228-9122-255, fax: +49 228-9122-212;
[email protected]
Guest Editor
Philipp Wagner, Zoologisches Forschungsmuseum Alexan-
der Koenig (ZFMK), Herpetology Section, Adenauerallee
160, 53113 Bonn, Germany,
tel. +49 228-9122-254, fax: +49 228-9122-212;
[email protected]
Editorial Board
Dirk Ahrens, Insects: Coleoptera, ZFMK,
tel. +49 2289122286, fax: +49 228-9122-332:
[email protected]
Wolfgang Bohme, Amphibians and Reptiles, ZFMK,
tel. +49 228-9122-—250, fax: +49 228-9122-212;
[email protected]
Netta Dorchin, Insects: Diptera, ZFMK,
tel. +49 228-9122-292, fax: +49 228-9122-212;
[email protected]
Renate van den Elzen, Birds, ZFMK,
tel. +49 228-9122-231, fax: +49 2289122212;
[email protected]
Bernhard Huber, Invertebrates except Insects, ZFMK,
tel. +49 2289122294, fax: +49 228-9122-212;
[email protected]
Rainer Hutterer, Mammals, ZFMK,
tel. +49 228-9122—261, fax: +49 228-9122-212;
r.hutterer.zfmk(@uni-bonn.de
Gustav Peters, Mammals, ZFMK,
tel. +49 2289122262, fax: +49 2289122212:
[email protected]
Bradley Sinclair, Canadian National Collection of Insects,
Ottawa Plant Laboratory — Entomology, CFIA, K.W. Neat-
by Bldg., C.E.F., 960 Carling Ave., Ottawa, ON, Canada
K1A 0C6, tel. + 1 613-759-1787, fax: + 1 613-759-1927;
[email protected]
Dieter Stiining, Insects except Coleoptera and Diptera,
ZFMK, tel. +49 228-9122-—220, fax: +49 228-9122-212;
[email protected]
Advisory Board
Theo C. M. Bakker, Rheinische Friedrich-Wilhelms-Univer-
sitat, Institut fiir Evolutionsbiologie & Okologie, 53113
Bonn, Germany, tel. +49 228—73-5 130, fax: +49 228-73-
2321; [email protected]
Aaron M. Bauer, Villanova University, Department of Biolo-
gy, 800 Lancaster Avenue, Villanova, PA 19085-1699,
USA, tel. +1 610-519-4857, fax: +1 610-519-7863; aa-
[email protected]
Wieslaw Bogdanowicz, Museum and Institute of Zoology,
Polish Academy of Sciences, Wilcza 64, 00-679 Warszawa,
Poland, tel. +48 22628-7304, fax: +48 22629-6302;
[email protected]
Matthias Glaubrecht, Museum fiir Naturkunde Berlin, Leib-
niz-Institut fiir Evolutions- und Biodiversitatsforschung an
der Humboldt-Universitat zu Berlin, Invalidenstrasse 43,
10115 Berlin, Germany,
tel. +49 30-2093-8504/ 8400, fax: +49 030-—2093-8565;
matthias. [email protected]
Jeremy D. Holloway, The Natural History Museum, Depart-
ment of Entomology, Cromwell Road, London, SW7 5BD,
U.K.; [email protected]
Boris KryStufek, Slovenian Museum of Natural History, P.
O. Box 290, Ljubljana, Slovenia; [email protected]
Wolfgang Schawaller, Staatliches Museum ftir Naturkunde,
Rosenstein 1, 70191 Stuttgart, Germany,
tel. +49 711-8936-221, fax: +49 711-8936-100;
[email protected]
Ulrich K. Schliewen, Department of Ichthyology, Bavarian
State Collection of Zoology, Minchhausenstr. 21, 81247
Munchen, Germany, tel. + 49 89-8107—110;
[email protected]
Michael Schmitt, Ernst-Moritz-Arndt-Universitat, Allge-
meine & Systematische Zoologie, Anklamer Str. 20, 7489
Greifswald, Germany,
tel. +49 3834864242, fax: +49 3834 86-4098:
[email protected]
W. David Sissom, Dept. of Life, Earth and Environmental
Sciences, W. Texas A. & M. University, WITAMU Box
60808, Canyon, Texas 79016, USA, tel. +1 806-651-2578,
fax: +1 806-651-2928; [email protected]
Miguel Vences, Technical University of Braunschweig, Zoo-
logical Institute, Spielmannstr. 8, 38106 Braunschweig,
Germany, tel. + 49 531-391-3237,
fax: + 49 531-391-8198; [email protected]
Erich Weber, Eberhard-Karls-Universitat, Zoologische
Schausammlung, Sigwartstr. 3, 72076 Tubingen,
tel. +49 70712972616, fax +49 7071—295170;
[email protected]
Editorial
On occasion of his 66th birthday and his retirement from
his position as curator of herpetology after nearly 40 years
at the Museum Alexander Koenig, I had the great pleas-
ure to be the editor of a Festschrift, and the co-ordinator
of a colloquium honouring the work of Wolfgang Bohme.
The title of this special issue of the Bonn zoological Bul-
letin and the colloquium is a combination of Herpetolo-
gia, referring to several symposia (e.g. the two SEH meet-
ings) he organized during his time at this institute, and
Koenigiana, referring to ‘his’ museum.
During his time at curator from 1971 onwards, he in-
creased the at this time ‘sleeping’ herpetological collec-
tion with less than 9500 specimens to one of the leading
collections in Germany and Europe with about 100.000
vouchers. His scientific work 1s documented in more than
530 publications and with his enthusiasm he influenced
and stimulated 32 PhD (ten more candidates are still work-
ing on their theses), 145 diploma and 35 state-examen stu-
dents, some of them working today as scientists in
renowned German and European institutions.
As his student, I was influenced since my first time at the
University of Bonn and the Museum Koenig by his cours-
es and lectures and he positively forced my decision to
work with herpetological systematics and the Afrotropi-
cal region.
These influences Wolfgang B6hme had on many upcom-
ing scientists and his numerous cooperations are in part
reflected by the impressive set of articles about various
topics published in the present issue of Bonn zoological
Bulletin, written by friends, colleagues and former stu-
dents. These articles are partly dealing with his main sci-
entific fields of interests: Africa, chameleons, or monitor
lizards, but also with ‘side’-fields like lacertids, nomen-
clature or the history of herpetology. Many articles are first
descriptions of new amphibian and reptile species named
after Wolfgang Bohme, which are the ‘living manifesta-
tions’ of his impressive work. Moreover, the two non-her-
petological articles show that he has also some impact in
other zoological disciplines.
As guest editor, I would like to thank all the reviewers for
their helpful comments. Without their fast work it would
not have been possible to have this issue ready right in
time. Especially, I would like to thank Brian Sinclair who
did the English in review in some of the articles.
Pe ladear
Philipp Wagner (Guest Editor)
Bonn, November 2010
Pe 0a
PGP TER eit
ph |
iter), Saas
pines ‘ice . Me wn Sa Leth Age oe Wy |
ne es ae ee a Co 5
‘Morita: ine eT TR
pasate ll RE ea
ree ae
td
es ha
bby
= Mas
Preface
This volume is dedicated to a scientist, who during the past
four decades transformed the herpetology collection of
Museum Koenig into one of the most prominent European
research facilities for reptile systematics and biology. Un-
der his management, the comparatively young collection
of reptiles and amphibians in Bonn has grown tenfold and
became one of the most important ones in Germany. More-
over, he dedicated his time and energy not only to science,
but also to the development of the institute, which has been
his second home. Thanks to his commitment and person-
ality, he became the undisputed head of the vertebrate de-
partment, which he still leads today. He also was, and still
is, the link between the museum and the many experts
among laypersons, who contribute substantially to the
growth of scientific knowledge and otherwise shy from
direct contact with professionals. With the same spirit he
cooperated with the Alexander Koenig Gesellschaft, the
friends of the museum society.
Wolfgang Bohme is a passionate zoologist whose enthu-
siasm infected several generations of students, many of
which later became successful scientists themselves. He
regularly takes students on field courses, where he teach-
es them how to discover, observe and capture snakes,
lizards and frogs, as well as identify other animals such
as grasshoppers and bees. His favourite destination for this
purpose has always been Lake Neusiedl that became a
popular destination among biology students in Bonn.
Wolfgang Bohme frequently invited like-minded zoolo-
gists from other countries to work with him in Bonn or
to attend German conferences, and it was obvious that he
was thrilled for the opportunity to learn of other people’s
discoveries out of pure fascination by animals and with-
out any jealousy.
During the past 40 years, the Museum’s directors were
grateful for his public-relations work. He frequently of-
fered evening lectures for the general public with an en-
joyable combination of adventure, discovery, and BOhme’s
characteristic humour. He authored popular articles for the
media and for the institute’s series “Tier und Museum”
(later “Koenigiana’’), a publication for which he acted as
an editor. Similarly, he was always ready to take part in
non-scientific events, where he participated in activities
such as reading poems by his ancestor Wilhelm Busch,
whose funny bone he obviously inherited.
With this volume on the occasion of his retirement from
official duties, we want to thank him for his outstanding
contribution to herpetology and to the development of Mu-
seum Koenig. I hope this is just the beginning of a new
period of active research, for which we will always have
a space available for him in our institute.
J. Wolfgang Wagele (Director)
Bonn, November 2010
j Sidaniteite
‘ sine
we ak
i
bia ety
Nl
Se)
wee ey wo Wi Te .
Ls “ ie ahi te
F eetlornty ma) ith
ay
A ant ie 10
Greetings from the SEH
I met Wolfgang Bohme for the first time at the very be-
ginning of my carrier, just after my graduation. I remem-
ber that he was extremely friendly when talking about
lizards, the Mediterranean basin and his deep love for
Africa and the tropics, making my first impact with the
international professional herpetological world easy and
smooth. Throughout our long professional relationship,
Wolfgang has always been extraordinarily open to new
ideas, sharing research projects with a number of scien-
tists worldwide and prompting the creation of a network
of enthusiastic believers, such as for the circum-Mediter-
ranean Podarcis fans. | remember very well the begin-
ning of the “saga” of the Symposia on the Lacertids of the
Mediterranean, together with Nicholas E. Arnold, Massi-
mo Capula, Valentin Pérez-Mellado, Efstratios Valakos
and, which 1s still successfully ongoing. In the nineties,
as President of the Societas Europaea Herpetologica,
Wolfgang Bohme put a tremendous effort into establish-
ing collaborations between the national European herpeto-
logical societies. He also opened the doors of the herpeto-
logical collection of the Alexander Koenig Museum to a
multitude of island zoologists, inducing the full scientif-
ic exploitation of such an extraordinary biological treas-
ure. His outstanding scientific activity, together with his
humanity and intellectual generosity make Wolfgang
Bohme one of the reference point in and out my profes-
sional life and Ill always be grateful to him and his love-
ly family for such a warm and positive friendship.
Claudia Corti
(President Societas Europaea Herpetologica)
Bonn, November 2010
ar
Wee ee
ij
ys
Tete eh
iy eae ; “a aii oi nin wi on ees
Rover See ie} it iti: aay, wih ig
oe iowoaanladi dota sal
poenllle, - ry) eaten) at bidil OE
| ned tis Ae dna li weit
hah @ aa Salat Hiriay i ribs rie an
Aly AD quiere fey / hens & wean
Ty LD ET EC eo
Greetings from the DGHT
On the occasion of the retirement of Prof. Dr. Wolfgang
Bohme, curator of herpetology, head of the vertebrate de-
partment, and deputy director of the Zoologisches
Forschungsmuseum Alexander Koenig, we were honoured
with an invitation to direct a few words to the readers of
this special issue of the Bonn Zoological Bulletin.
We sincerely appreciate this opportunity, as the name
Wolfgang Bohme is not only connected to a distinguished
career in herpetology, but also to a person who always
made an effort to keep a close connection between pro-
fessional scientific research and amphibian and reptile am-
ateurs all over the world. Wolfgang Bohme’s achievements
in this particular field of interaction are not less than out-
standing. There is probably no other herpetologist whose
research benefited as much from data supplied by ama-
teurs, and there are countless thankful amateurs whose
pastime has been deeply enriched by the scientific advice
and the stimulating attitude of Wolfgang Bohme. Sharing
data, knowledge and specimens with people operating out-
side the scientific community was paramount for many
spectacular discoveries and the furtherance of knowledge
about the biology and ecology of amphibian and reptile
species, many of which are considered to be well-known
today. Decades ago, it was mainly these amateur enthu-
siasts who travelled to remote and previously unexplored
exotic areas in search of their “pets” and returned with
treasures of data and photographs that gave rise to subse-
quent research projects. It is Wolfgang Bohme’s merit and
strength to have fostered and encouraged this tradition of
interaction for several decades.
Bringing professionals and amateurs together and promot-
ing their dialog is also one main characteristic of the
Deutsche Gesellschaft fiir Herpetologie und Ter-
rarienkunde (DGHT), as is apparent by the society’s name.
As a consequence, there was, and is, some kind of “nat-
ural relationship” between Wolfgang Bohme and the
DGHT, and this relationship has been a sustained and fruit-
ful one. Shortly after he took his position at the Museum
Koenig, he founded the “DGHT Stadtgruppe Bonn” in
1973. Later, Wolfgang B6hme became president of the so-
ciety and held this position from 1983 to 1991. He was
furthermore a founding member of the DGHT Work
Group Literature and History, and a regular member of the
Work Groups Chameleons and Lacertids. In 1994, Bohme
was made an honorary member of the DGHT, and very
recently, the current executive board asked him to join its
advisory council. And so it is for many reasons that
Bohme’s name and personality are closely interlinked with
the DGHT.
The DGHT as a society, DGHT members and associates,
as well as many students and colleagues owe a lot to Wolf-
gang Bohme. Despite facing his ‘official’ retirement as a
herpetologist now, we are convinced that few things will
change and that his fruitful relationships with the DGHT
will continue for many years to come. Dear Wolfgang
Bohme, thank you for everything.
The DGHT executive board
(Peter Buchert, Jorn Kohler, Axel Kwet, Stefan Lotters,
Wolfgang Schmidt, Holger Vetter)
Bonn, November 2010
it i (Aon w
da K cy wile Ws 4 1a a
\ Wyn
my a ni anil teh
ap |) a Toke vubeunite ry
byt if eis Me, eligte’ by A aie
wud rn i tie sal
Curriculum Vitae of Wolfgang Bohme
Born November 21, 1944 at Schdnberg near Kiel
(Schleswig-Holstein, Germany) as the 3rd child of the mu-
sician Ferdinand B6hme (1906-1971) and his wife Hed-
wig, born Stange (1913-1992). Ferdinand Bohme was vi-
olinist of the first desk at the municipal orchestra in the
opera house of Kiel and subject teacher for violine, both
privately and at the Pedagogic College of Kiel.
From a first marriage (1970-1974) father of one daugh-
ter (Judith). Since 1974 married with Roswitha Bohme.
From this marriage two sons (Moritz and Peter).
Wolfgang Bohme finished highschool (“Kieler Gelehrten-
schule”’) in Kiel, April 1965, and subsequently studied zo-
ology, botany and paleontology at the “Christian-Al-
brechts-Universitat” of Kiel. Doctoral degree with a the-
sis on hemipenis morphology in lacertid lizards in June
1971 under supervision of Prof. Dr. Wolf Herre.
From August 1971 until December 2010 head of the Her-
petology Section of the “Zoologisches Forschungsmuse-
um Alexander Koenig” (ZFMK) in Bonn, Germany. Since
then, increase of the herpetological collection from less
than ca. 9.600 specimens to ca. 100.000. From October
1992 to his retirement Head of the Vertebrate Department
and Vice Director of the Forschungsmuseum.
Since winter semester 1980/81 participation in teaching
at the “Rheinische Friedrich-Wilhelms-Universitat” Bonn;
habilitation (thesis on genital morphology in the Sauria)
and venia legendi received in May 1988. Since then reg-
ular teaching and supervision of more than 129 master and
32 doctoral theses, plus 35 theses for state examen. Award-
ed full professorship (“‘apl. Professor’) April 1996.
Fields of Research. Systematics, ecology and biogeog-
raphy of amphibians and reptiles, with taxonomic focus
on lizards (chameleons, monitor lizards) and its Tertiary
and Quaternary predecessors (e.g. lizard amber fossils);
genital morphology of squamates. Geographical focus on
the western Palearctic Region (founder and editor of
“Handbuch der Reptilien und Amphibien Europas’”, edi-
tion of 5 vols. between 1981 and 1999) and West Africa
(six larger field excursions to West/Central Africa, each
with 1—3 months duration: Spring 1973 Cameroon, win-
ter 1973/74 Cameroon, winter 1975/76 Senegal/Gambia,
1993 Guinea, 1998 Cameroon, 1999 crossing the Sahara
in both directions: Morocco, West Sahara, Mauritania,
Senegal). In 2002 an extensive educational trip through
the eastern half of the USA. Currently 530 sci. publica-
tions.
Working group. Members of his ZFMK herpetological
working group were/are active in the tropics of Central
and South America (Costa Rica, Venezuela, Peru, Bolivia,
Chile), Africa (Guinea Bissau, Gambia, Benin, Cameroon,
Gabon, Kenya, Zambia) and Madagascar, and of SE Asia
(Vietnam, Indonesia).
Societies. September 1979 host and founding member of
the “Societas Europaea Herpetologica”, which publishes
“Amphibia-Reptilia’, simultaneously founded at ZFMK,
and today the leading journal of its discipline in Europe.
Elected for president of the society 1993 in Barcelona, re-
elected for another 4 years 1997 in Prague.
From 1983 to 1991 Chairman of the “Deutsche
Gesellschaft fiir Herpetologie und Terrarienkunde”
(DGHT) which during this period grew from ca. 2000 to
over 5000 members, thus becoming the largest associa-
tion of its discipline in the world. Wolfgang Bohme has
the Honorary membership of the DGHT since 1994.
From 2000 to 2002 founding chairman of the working
group “Literatur und Geschichte der Herpetologie” of the
DGHT with its own periodical “Beitrage zur Literatur und
Geschichte der Herpetologie und Terrarienkunde’”, after
two issues, from 2003 onwards, continued as “Sekretar”.
From 2001 to 2005 member of the Commission of the “In-
ternational Committee of Zoological Nomenclature”
(ICZN).
From October 1996 to December 2006 President of the
“European Association of Zoological Nomenclature”
(EAZN).
Elected as ‘Honorary foreign member’ of the American
Society of Ichthyologists and Herpetologists in 2008.
Awarded with the Alexander Koenig Medal in 2010, by
the Alexander-Koenig-Gesellschaft, sponsoring society of
ZFMK.
Ph. Wagar
Philipp Wagner (Guest Editor)
Bonn, November 2010
eT Liars
War Lah F a wu
; See eal al fay
POLED |
i ; Pal wed
rie a he be)
2a} tan
SelveW eet “nai ire
\,
4 be rv 7, v ia ave votive :
Poe
MY — ;
ay ste a 1 ene
peo sis anti
Bonn zoological Bulletin Volume 57
Issue 2 pp. 111-118 Bonn, November 2010
Sharing resources in a tiny Mediterranean island?
Comparative diets of Chalcides ocellatus and Podarcis filfolensis in Lampione
Miguel A. Carretero!*, Pietro Lo Cascio, Claudia Corti3.! & Salvatore Pasta‘
'CIBIO, Centro de Investigag¢ao em Biodiversidade e Recursos Genéticos, Campus Agrario de Vairao,
P-4485-661 Vairao, Portugal; E-mail: [email protected]
2Associazione “Nesos”, Via Vittorio Emanuele 24, 98055 Lipari (ME), Italy; E-mail: [email protected].
3Museo di Storia Naturale dell’ Universita di Firenze, Sezione di Zoologia “La Specola”, Via Romana 17,
I1-50125, Firenze, Italy; E-mail: [email protected]
4via V.F. 19, 60/A, I-90126, Palermo, Italy; E-mail: [email protected]
*corresponding author: E-mail: [email protected] tel.+351252660400 fax.+351252661780
Abstract. The insular lizard microcommunity inhabiting the Lampione islet (Pelagian islands, S Italy) is constituted by
a skink (Chacides ocellatus) and a lacertid lizard (Podarcis filfolensis). Their diet composition (taxa and sizes) during
spring-early summer were analysed based on 131 faecal pellets, which could be individually assigned to a lizard species
and sex (only in P. filfolensis). The diet of C. ocellatus was biased towards hard prey of medium to large sizes (Coleoptera,
insect larvae). Podarcis filfolensis displayed a more diverse prey spectrum including Formicidae, Coleoptera, insect lar-
vae and minor prey not consumed by the skink, but restricted to the small items; differences between sexes were mini-
mal. Both species were partially herbivorous. Evidence of cannibalism was found for P. filfolensis and C. ocellatus preyed
upon P. filfolensis. Pseudocommunity analysis does not support community structure but instead points to convergence
in trophic strategies between both species due to insular conditions. Evolutionary history, rather than resource partition-
ing, seems responsible for the moderate trophic overlaps recorded and even may explain why both species coexist under
the harsh conditions of this tiny islet.
Keywords. Diet; Chacides ocellatus; Podarcis filfolensis; community ecology; islands; Lampione.
INTRODUCTION
For decades, lizards have constituted fruitful model organ-
isms for studies in community ecology, diet being the most
studied ecological dimension (see review by Luiselli
2008). Many of the initial and current studies are focused
on the most complex assemblages, namely those in trop-
ical or desert areas (Arnold 1984; Pianka 1986; Vitt &
Caldwell 1994; Vitt & Carvalho 1995; Vitt & Zani 1998;
Vitt et al. 2000; Akani et al. 2002, amongst many others),
where environmental stability could allow interspecific re-
lationships promoting detectable community structure
(Winemiller & Pianka 1990). In contrast, studies on lizard
assemblages inhabiting temperate regions are less abun-
dant (but see Pérez-Mellado 1982; Strijbosch et al. 1989;
Pollo & Pérez-Mellado 1991; Carretero & Llorente 1993;
Capula & Luiselli 1994; Carretero et al. 2006; Kuranova
et al. 2005; Rouag et al. 2007). This is probably because
these are composed of less species but also because abi-
otic restrictions of seasonal climates overcoming the role
of species interactions would make community structure
less expectable to appear (Barbault 1991). In fact, a
Bonn zoological Bulletin 57 (2): 111-118
recent meta-analysis concluded that lizards of most (80%)
communities worldwide do not partition their food re-
sources but are randomly organised in the trophic niche
axis (Luiselli 2008). Instead, increasing evidence is
demonstrating that the influence of evolutionary history
on the lizard trophic traits is stronger than previously
thought. Specifically, niche conservatism rather than
species interactions accounts for many trophic differences
between the community components (Brooks & McLen-
nan 2002; Webb et al. 2002; Vitt et al. 2003; Vitt & Pi-
anka 2005; Mesquita et al. 2007; Espinoza et al. 2008).
Within this context, lizards inhabiting small Mediterranean
islands constitute an apparent paradigm of simplicity. On
one hand, strong seasonality and impoverished trophic re-
sources impose severe constraints to insular lizards (Pérez-
Mellado & Corti 1993), higher than those in adjacent
mainland, making lizard communities inhabiting Mediter-
ranean islets extremely poor when compared to those on
big islands or on the continent (Mylonas & Valakos 1990).
©OZFMK
112 Miguel A. Carretero et al.
On the other hand, the exposition to less potential com-
petitors and predators and subsequent increase in the con-
specific density (Carretero 2004, 2006) may open new
possibilities for enlarging trophic niche (Pérez-Mellado &
Corti 1993; Carretero 2004). Nevertheless, evidence on
lacertid lizards indicates that the ecological response to
these shifted environmental pressures is not immediate and
some evolutionary time is needed to develop profound
trophic adaptations (Pérez-Mellado & Corti 1993; Car-
retero 2004). Literature on the diet of Mediterranean
lizards in small islands is abundant but usually focused
on a single species (reviewed in Van Damme 1999; Pérez-
Mellado & Traveset 1999; Carretero 2004), studies at mul-
tispecies level being rare (Nouira 1983).
Here, the diet composition of a microinsular community
constituted by two divergent lizard species is analysed dur-
ing spring-summer considering both inter- and intraspe-
cific variation and compared to other populations of the
same species. Moreover, the hypothesis of community
structure at the trophic level is specifically tested against
the null hypothesis of random trophic overlap.
MATERIAL AND METHODS
Study area
Lampione (35°33’00”N—12°19’11”E) is a small islet lo-
cated 17 km off the W coast of Lampedusa (Pelagian Is-
lands) and 110 km off Tunisia, in the Channel of Sicily.
The area is 0.021 km? and the maximum altitude is 36 m
a.s.l. From a geological point of view, the islet is composed
of dolomitised carbonates belonging to formations of the
Tunisian offshore, and its definitive isolation from North
Africa was since 18,000 years B.P. (Pasta 2002). The cli-
mate is arid, characterised by strong drought periods in
summer and by an average annual rainfall lower than 300
mm. The vegetation is mainly dominated by halo-ni-
trophile perennial shrubs. The occurrence of a large colony
of gulls causes a strong level of soil eutrophisation and
nutrient imbalances, which allow the expansion of the ni-
trophile biannual Malva veneta Soldano, Banfi & Galas-
so, 2005 during the late spring on the top of the islet. Lam-
pione is at present-day uninhabited, but late-Roman ru-
ins document an early human presence, though probably
only seasonal (Pasta & Masseti 2002). The invertebrate
assemblage of the islet reflects several features typical of
microinsular and arid environments, namely a low num-
ber of species (about 30, excluding flying insects; Lo Cas-
cio 2004, Lo Cascio unpublished), an over-representation
of some groups (e.g., five species of Coleoptera Tenebri-
onidae; Canzoneri 1972; Lo Cascio unpublished), some
being found at extremely high densities.
Bonn zoological Bulletin 57 (2): 111-118
Study lizards
Two lizard species inhabit the islet: the Maltese wall lizard,
Podarcis filfolensis (Bedriaga, 1876), (Squamata: Lacer-
tidae) and the Ocellated skink, Chalcides ocellatus
(Forskal, 1775) (Squamata: Scincidae). The first is a gen-
uine insular species endemic to the Maltese Archipelago
and two Pelagian islands, Linosa and Lampedusa, where
it is said to be introduced in early or recent time (Capula
2006; Lo Cascio & Corti 2008). The Ocellated Skink,
Chalcides ocellatus, is widely distributed on the Sindian-
Mediterranean area and 1s recorded for all the Pelagian is-
lands (Turrisi & Vaccaro 2006); the origin of the islet pop-
ulation is probably related to the Pleistocene connections
between Lampione and the nearby North-African main-
land (see Grasso et al. 1985). The first data on the occur-
rence of such species in Lampione were reported by Lan-
za & Bruzzone (1961). Population density is extremely
high for both species, only for Podarcis filfolensis being
estimated using standard methods (7500-8000 individu-
als/ha, see Lo Cascio et al. 2006). From field observations,
the ratio of apparent abundance between this species and
Chalcides ocellatus was 3:1 approximately (Lo Cascio un-
published).
Sampling and lab methods
Field sampling was carried out during several visits in late
spring/early summer of 2004 and 2005, when both species
show the peak of annual activity (Corti & Lo Cascio
2002). Faecal pellets were obtained from adult Podarcis
filfolensis and Chalcides ocellatus; all the specimens were
measured (snout-vent length, SVL) to the nearest 0.1 mm
using a digital calliper, sexed (in P. fi/folensis) and released
back in the site of capture. Whereas adult P. filfolensis
could be easily sexed in the field using sexual secondary
characters (Corti & Lo Cascio 2002) and hemipenis ever-
sion, the reduced external differences and the impossibil-
ity for analysing of internal cloaca did not allow identi-
fying the sexes of C. ocellatus in field (see Badir 1959;
Capula & Luiselli 1994).
The faecal contents were examined under stereoscopic mi-
croscope (10-40X). Remains were identified to Opera-
tional Taxonomy Units (OTUs) approximated here to the
order/family level. Item counting was based on cephalic
capsules, wings and legs, following the minimum num-
bers criterion by sample. When possible, prey lengths were
obtained measuring the remains with a micrometer eye-
piece and calculated by using regression equations (H6-
dar 1997) and then assigned to classes of 5 mm in length.
©OZFMK
Diet of Lampione lizards 113
Statistical methods
Three diet descriptors were used: the percentage of pel-
lets containing an OTU (%P), the percentage of numeric
abundance of each OTU (%N), and the use index (IU)
(Jover 1989); the latter is preferred because combines %N
and %P; the importance of a certain OTU in the diet be-
ing estimated by calculation of the homogeneity of its con-
sumption throughout all the individual contents (Carretero
2004). Brillouin’s index was used to estimate the diet di-
versity according to Magurran (2004). For a given sam-
ple, the average individual diversity (Hi) was obtained by
averaging the diversity values of each pellet whereas the
(asymptotic) population diversity (Hp) was estimated
through jack-knife resampling (Jover 1989, Magurran,
2004), that is, recalculating the total diversity missing out
each sample in turn and generating pseudovalues, which
are normally distributed. Whereas Hi and Hp have stan-
dard errors and allow statistical inference, the total accu-
mulated diversity (Hz) of all pellets is a fixed value only
provided for comparing with the literature (Ruiz and Jover
1981).
Overlap between diets was evaluated by means of the Pi-
anka’s index (Pianka 1973) applied on the IU values of
OTUs and size classes (Carretero et al. 2006) using the
Ecosym software (Gotelli & Entsminger 2004). Hypoth-
esis of non-random similarity (Gotelli & Graves 1996) was
tested using the RA2 (niche breadth relaxed / zero states
retained) and RA3 (niche breadth retained / zero states
reshuffled) Monte Carlo randomisation algorithms (Wine-
miller & Pianka 1990) generating 1000 pseudomatrices
considering each OTU equiprobable.
Normality (Lilliefors test) and homoscedasticity (Fisher
test) were assured prior to the application of parametric
tests. Individual diversity and number of prey per pellet
were compared using one-way ANOVA. Population diver-
sity estimations obtained through jack-knife could not be
compared using ANOVAs since the software provides on-
ly mean+SE and diversity is non-additive (Carretero &
Llorente 1993). Instead, t-tests corrected for multiple tests
(using False Discovery Rate, FDR, Benjamini & Hochberg
1995) were applied.
RESULTS
Pellets were obtained from 45 C. ocellatus and 86 P. fil-
folensis (58 males and 28 females). The SVLs in mm,
mean+SE (range) of such specimens were 104.02+2.26
(62.0—140.0) for C. ocellatus, 65.45+0.56 (54.0—72.0) for
male P. filfolensis, and 60.00+0.53 (44.5—67.0) for female
P. filfolensis, The skinks were, in fact, much bigger than
the wall lizards which displayed slight sexual size dimor-
Bonn zoological Bulletin 57 (2): 111-118
phism favourable to males (ANOVA F, jy = 267.58, P <
10-6, Scheffé tests C. ocellatus-P. filfolensis males
P< 10°, C. ocellatus-P. filfolensis females P< 10-6, P. fil-
folensis males-females P = 0.05).
The number of prey items by pellet (Table 1) was simi-
lar between both species and between male and female P.
filfolensis (ANOVA F j53 = 0.45, P = 0.64). However, the
taxonomic composition of the diet (Table 1) showed sub-
stantial interspecific differences, whereas intersexual dif-
ferences within P. filfolensis were minor. Both species con-
sumed important amounts of plant matter (IU = 41.61%
in C. ocellatus and IU = 18.37% in P. filfolensis). With-
in P. filfolensis, males (IU = 22.55%) used this resource
more than females (IU = 9.69%). Moreover, C. ocellatus
also consumed seeds and fruits (IU = 18.31%) but P. fil-
folensis almost did not IU = 1.24%).
Regarding the prey of animal origin (Table 1), the diet of
C. ocellatus was strongly biased towards Coleoptera (IU
= 24.95%) and only secondarily to insect larvae (IU =
7.79%). In contrast, the animal prey consumed by P. fil-
folensis were more evenly distributed between Formici-
dae (IU = 26.73%), Coleoptera (IU = 15.08%) and insect
larvae (IU = 14.27%) with minimal differences between
sexes. Interestingly, the diet of the Maltese wall lizard in-
cluded some minor prey (Araneae, Pseudoscorpiones,
Acarina, Homoptera, Malophaga) that were completely
absent from the diet of the Ocellated skink. Overall, ani-
mal diet was very similar between male and female P. fil-
folensis, the latter consuming more Araneae and Het-
eroptera (Table 1). It is worth noting that tails of juvenile
P. filfolensis were found in adult conspecifics (two in
males and two in females) and also in C. ocellatus (also
two).
Consequently, diet diversity (Table 2) was lower in C.
ocellatus than in P. filfolensis, with no differences between
males and females. This was true when considering either
individuals (ANOVA F, 9g = 9.93, P < 10-4; Scheffé tests
C. ocellatus - P. filfolensis males P = 0.0003, C. ocella-
tus —P. filfolensis females P = 0.0005, P. filfolensis males
- P. filfolensis females P = 0.99) or populations (C. ocel-
latus — P. filfolensis males To, = 4.67, P = 5*10-6, Pepe
<10-4; C. ocellatus — P. filfolensis females T7,; = 4.82, P
= 4*10°6, Pepe < 104; P. filfolensis males — P. filfolensis
females Tg, = 1.59, P = 0.06, Peper = 0.06).
As to the size of the items consumed (Table 3), C. ocel-
latus ate bigger prey than P. filfolensis but males and fe-
males of the latter species did not differ (ANOVA F, 17
= 20.81, P< 10-6, Scheffé tests C. ocellatus-P. filfolensis
males P < 10°, C. ocellatus-P. filfolensis females
P = 5*10°, P. filfolensis males-females P = 0.94). The
modal size class of C. ocellatus was 5-10 mm whereas
©ZFMK
114 Miguel A. Carretero et al.
P. filfolensis was shifted to the 1-5 mm class. In fact, ex-
cept in two females, pellets of P. filfolensis did not con-
tain items larger than 10 mm. No significant correlation
between prey and predator sizes was detected within each
group although those P. filfolensis females eating the
10-15 mm prey were bigger than the rest (ANOVA Fj 35
= 5.35, P= 0.009; Scheffé tets: 1-5 mm — 5—10 mm P=
0.86, 1-5 mm — 10-15 mm P = 0.01, 5-10 mm — 10-15
mm P= 0.01).
Finally, diet overlaps (Table 4) calculated from both tax-
onomical and size classification of prey were very simi-
lar, attaining moderate values between species but high
values between male and female P. filfolensis. Pseudocom-
munity analysis at species level revealed that taxonomi-
cal overlap was higher than simulated in the RA3 matrix
(niche breadth retained, P = 0.02) but similar to the RA2
matrix (zero states retained, P = 0.50). When considering
the three classes (C. ocellatus, male and female P. filfolen-
sis) none of the two algorithms indicated significant de-
viations from random. No significant differences were ei-
ther detected for the size overlap.
DISCUSSION
Differences in lizard diet arise from multiple factors in-
cluding anatomy, sex, reproductive state, body condition,
experience, prey availability, predation pressure, compe-
tition and evolutionary history (Schoener 1974; Dunham
1980; Pianka 1986; Losos 1992; Vitt & Zani 1998; Vitt
et al. 1999; Perry & Pianka 1999; Pitt & Ritchie 2002; Car-
retero 2004). In Lampione, the manifest size differences
between both species constitute the most obvious con-
straint for the prey they consume. Within species, prey
sizes tend to follow a logarithmic distribution, small in-
dividuals simply not been able to consume the biggest
items of the prey spectrum of the large individuals (Pi-
anka 1986). However, between species this pattern can be
altered if drastic divergence in anatomy or foraging tac-
tics occurs (Carretero 2004). This seems to be the case,
since C. ocellatus not only consumed large prey inacces-
sible for P. filfolensis as expected, but also kept the same
number of prey items but biased to medium sizes. This
result suggests that both species may follow different for-
aging strategies (Perry & Pianka 1999). In fact, C. ocel-
latus is described a semi-fossorial, sit-and-wait forager in
plant litter or under stones (Arnold 1984; Capula & Luisel-
li 1994; Kalboussi & Nouira 2004; Lo Cascio et al. 2008)
whereas P. filfolensis as most lacertids actively forages on
the surface (Corti & Lo Cascio 2002; Bombi et al. 2005;
Lo Cascio et al. 2006). Nevertheless, there is also evidence
for anatomical constraints, since ocellated skinks con-
sumed more hard prey (Coleoptera) than the wall lizards.
In lacertids, large species tend to consume more
Bonn zoological Bulletin 57 (2): 111-118
Coleoptera (Carretero et al. 2006) and there is experimen-
tal evidence for inter- and intraspecific differences in bite
force for prey crashing associated with the jaw muscle
mass (Herrel et al. 1999, 2001). Nonetheless, sexually di-
morphic lacertid heads, as intersexual differences in bite
force, primarily derive from sexual selection (Herrel et al.
1999; Kaliontzopoulou et al. 2007), and dietary shifts
(minimal in P. filfolensis) should be interpreted as a by-
product.
While divergent anatomy, foraging tactics and habitat use
between both species accounted for a substantial part of
the interspecific variation found, comparison with other
populations indicates that other factors modified the tax-
onomic composition of their diets. As other insular lacer-
tids in the Mediterranean (Pérez-Mellado & Corti 1993;
Carretero et al. 2001; Corti et al. 2008), P._filfolensis con-
sumed great amounts of ants not only in Lampione but al-
so in Linosa (Sorci 1990; Bombi et al. 2005) and Lampe-
dusa (Lo Cascio & Corti 2008). Since only Podarcis pop-
ulations inhabiting ancient Mediterranean islands (i.e.
Balearics, Mylos) are myrmecophagous, this has been in-
terpreted as a result of long term evolution in insularity
(Pérez-Mellado & Corti 1993; Carretero 2004). The de-
crease in predation pressure, the scarcity of alternative re-
sources, together with the gregarious behaviour and sea-
sonal stability of this prey may compensate for its low
profitability and noxiousness (Carretero 2004). Apparent-
ly, C. ocellatus has not been able to follow a similar strat-
egy since neither continental nor insular populations are
myrmecophagous (Capula & Luiselli 1994; Kalbousssi
2004; Lo Cascio & Corti 2008). Whether this is due to
evolutionary constraints or to recent colonisation of Lam-
pione currently remains under debate.
Cannibalism and, in general, saurophagy seem also to in-
crease in insular conditions due to the scarce resources and
high lizard densities (Pérez-Mellado & Corti 1993; Car-
retero et al. 2001) as is the case of P. filfolensis and C. ocel-
latus (Scalera et al. 2004; Lo Cascio et al. 2006). How-
ever, the predation of P. filfolensis by C. ocellatus consti-
tutes not only an additional food source but also an in-
stance of direct, asymmetric interaction between both
species (Chase et al. 2002).
As in the case of the ants, plants are also low profitable
matter and their consumption seems to be restricted to old
insular lacertid lineages which have developed behaviour-
al and anatomical adaptations for herbivory (Pérez-Mel-
lado & Corti 1993; Carretero 2004). Both P. filfolensis and
C. ocellatus were partially herbivorous in Lampione.
However, other populations of P. filfolensis studied also
consumed substantial amounts of seeds, fruits and other
plant remains (Sorci 1990; Bombi et al. 2005; Lo Cascio
& Corti 2008) and even seed dispersal for some plant
©OZFMK
Diet of Lampione lizards 115
species has been described in Linosa (Fici & Lo Valvo
2004). This suggests niche conservatism for herbivory in
this species. In contrast, herbivory seems to be rare in C.
ocellatus. Only two other microinsular populations, on
Lampedusa and the Conigli islet (Lo Cascio & Corti 2008;
Lo Cascio et al. 2008), were partially herbivorous, where-
as, no or almost no plant remains were found in the pop-
ulations from Sardinia (Capula & Luiselli 1994) and
Tunisia (Kalboussi & Nouira 2004). Nevertheless, even
continental ocellated skinks accept fruits in captivity
(Schleich et al. 1996) suggesting certain exaptation for her-
bivory in this species. Comparing the C. ocellatus popu-
lation from Lampione with those from the other Pelagian
islands (Lo Cascio & Corti 2008; Lo Cascio et al. 2008),
there is an apparent trend for increasing the degree of her-
bivory with isolation and for decreasing it with island area.
The analysis of trophic diversity indicates that P. filfolen-
sis is more euryphagous than C. oce//atus, with minimal
intraspecific variation in the first. Remarkably, for both
species, trophic diversity was much higher in populations
than in individuals, indicating strong interindividual vari-
ation typical of generalist predators (Carretero et al. 2006).
In fact, C. ocellatus displayed even stronger differences
(4x) than P. filfolensis (3x), which is accordance with its
sit-and-wait trend.
Finally, niche overlap summarises the trophic traits of the
community previously exposed. Coincidence between tax-
onomical and size overlaps and higher values between
species than within species indicate that intrinsical mor-
phological constraints constitute the main force for the or-
ganisation of this microinsular community. Pseudocom-
munity analysis does not support community structure but
instead points to enlarged, more overlapped trophic nich-
es.
When compared to other conspecific populations, conver-
gence in trophic strategies (herbivory, saurofagy) between
both species due to insular conditions seems the more fea-
sible hypothesis for explaining these results. Moreover,
evolutionary history at both deep (foraging strategies, Vitt
& Pianka 2005) and shallow (recent or ancient insular
colonisation, see above) levels seems, rather than resource
partitioning, responsible for the moderate trophic overlaps
recorded and even may explain why both species coexist
under the harsh conditions of this tiny islet. Nevertheless,
coincidence of trophic overlap between two species with
the direct predation of one on the other merits further
analyses (see also Castilla 1995).
Acknowledgements. We thank Giuseppina Nicolini, director of
the Natural Reserve “Isola di Lampedusa’,, all the staff of Legam-
biente, and Giuseppe Sorrentino of the Marine Protected Area
of the Pelagie Islands for their irreplaceable assistance during
Bonn zoological Bulletin 57 (2): 111-118
several visits at Lampione. We are also sincerely grateful to
Damiano Sferlazzo, who help us significantly during the field
work. The analysis of the collected samples has been done in
the framework of the scientific research projects of the Associ-
azione Nesos (Lipari). Analytical work was funded by the proj-
ect PTDC/BIA-BDE/67678/2006 and PTDC/BIA-
BEC/101256/2008 (to MAC) of Fundagao para a Ciéncia e a Tec-
nologia, FCT (Portugal). We are thankful to the Italian Minis-
tero dell’ Ambiente e della Tutela del Territorio for having issued
the permits to study these lizard populations (Prot.DPN-
/20/2004/17301).
REFERENCES
Akani GC, Capizzi D, Luiselli L (2002) Community ecology of
scincid lizards in a swamp rainforest of south-eastern Nige-
ria. Russian Journal of Herpetology 9: 125-134
Arnold EN (1984) Ecology of lowland lizards in the eastern Unit-
ed Arab Emirates. J. Zool. Lond. 204: 2—25
Badir N (1959) Seasonal variation of the male urogenital organs
of Scincus scincus L. and Chalcides ocellatus Forsk. Z. Wiss.
Zool. 160: 290-351
Barbault R (1991) Ecological constrains and community dynam-
ics: linking community patterns to organismal ecology. The
case of tropical herpetofaunas. Acta Oecologica 12: 139-163
Benjamini Y, Hochberg Y (1995) Controlling the false discov-
ery rate: A practical and powerful approach to multiple test-
ing. Journal of the Royal Statistical Society B 57: 289-300
Bombi P, Vignoli L, Scalera R, Bologna MA (2005) Food habits
of Podarcis filfolensis (Reptilia, Lacertidae) on a small
Mediterranean island during the dry season. Amphibia-Rep-
tilia 26: 412-417
Brooks DR, McLennan DA (2002) The nature of diversity: an
evolutionary voyage of discovery. University of Chicago
Press, Chicago
Canzoneri S (1972) Nuovi dati sui Tenebrionidae di “piccole
isole” italiane, con descrizione di Alphasida tirelli moltonii n.
ssp. Atti Soc. ital. Sci. nat. Mus. civ. St. nat. Milano 113:
288-296
Capula M (2006) Podarcis filfolensis (Bedriaga, 1876). pp. 466-
469 in: Sindaco R, Doria G, Razzetti E, Bernini F (eds.), At-
lante degli Anfibi e dei Rettili d'Italia. Polistampa, Firenze
Capula M, Luiselli L (1994) Resource partitioning in a Mediter-
ranean lizard community. Boll. Zool. 61: 173-177
Carretero MA, Llorente GA (1993) Feeding of two sympatric
lacertids in a sandy coastal area (Ebro Delta, Spain). Pp.
155-172 in: Bohme W, Pérez-Mellado V, Valakos E, Maragou
P. (eds.), Lacertids of the Mediterranean Region. A Biologi-
cal approach. Hellenic Zoological Society, Athens, Greece
Carretero MA (2004) From set menu to a la carte. Linking is-
sues in trophic ecology of Mediterranean lacertids. Italian
Journal of Zoology 74: 121-13
Carretero MA (2006) Reproductive cycles in Mediterranean lac-
ertids: Plasticity and constraints. Pp. 33-54 in: Corti C, Lo
Cascio P, Biaggini M (wds.) Mainland and insular lizards. A
Mediterranean perspective, Firenze University Press, Florence
Carretero MA, Llorente GA, Santos X, Montori A (2001) The
diet of an introduced population of Podarcis pityusensis. Is
herbivory fixed? Pp. 113—124 in: Vicente L, Crespo EG (eds.)
Mediterranean Basin Lacertid Lizards. A Biological Approach.
ICN, Lisboa
Carretero MA, Perera A, Harris DJ, Batista V, Pinho C (2006)
Spring diet and resource partitioning in an alpine lizard com-
munity from Morocco. African Zoology 41(1): 113-122
OZFMK
116 Miguel A. Carretero et al.
Castilla AM (1995) Interactions between lizards Podarcis his-
panica atrata and scorpions (Buthus occitanus). Bol. Soc. Hist.
Nat. Baleares 38: 47—S0
Chase JM, Abrams A, Grover JP, Diehl S, Chesson P, Holt RD,
Richards SA, Nisbet RM, Case TJ (2002) The interaction be-
tween predation and competition: a review and synthesis.
Ecology Letters 5: 302-315
Corti C, Lo Cascio P (2002) The Lizards of Italy and Adjacent
Areas. Chimaira, Frankfurt am Main
Corti C, Bruschi S, Spano G, Putzu M, Luiselli L, Lo Cascio P,
Navone A (2008) The herpetofauna of the “Area Marina Pro-
tetta di Tavolara-Punta Coda Cavallo” and, morphological and
preliminary ecological observations on Podarcis tiliguerta
ranzii of Molarotto Islet, NE Sardinia, Italy. Pp. 155—162 in:
Herpetologia Sardiniae. Societas Herpetologica Italica/Edi-
zioni Belvedere, Latina, “le scienze” (8), 504 pp
Dunham AE (1980) An experimental study on interspecific com-
petition between the iguanid lizards Sceloporus merriami and
Urosaurus ornatus. Ecological Monographs 50: 309-330
Espinoza RE, Wiens JJ, Tracy CM (2008) Recurrent evolution
of herbivory in small, cold-climate lizards: Breaking the eco-
physiological rules of reptilian herbivory. PNAS 101:
16819-16824
Fici S, Lo Valvo M (2004) Seed dispersal of Capparis spinosa
L. (Capparaceae) by Mediterranean lizards. Naturalista sicil.
28: 1147-1154
Gotelli NJ, Entsminger GL (2004) EcoSim: Null models soft-
ware for ecology. Version 7. Acquired Intelligence Inc. & Ke-
sey-Bear. Jericho, VT 05465. http://garyentsminger.
com/ecosim/index.htm
Gotelli NJ, Graves GR (1996) Null models in ecology. Smith-
sonian Institution Press, Washington
Grasso M, Pedley HM, Reuther CD (1985) The geology of Pela-
gian Islands and their structural setting related to the Pantel-
leria rift (Central Mediterranean Sea). Centro 1: 1-19
Herrel A, Spithoven R, Van Damme R, De Vree F (1999) Sex-
ual dimorphism of head size in Gallotia galloti: testing the
niche divergence hypothesis by functional analyses. Function-
al Ecology 13: 289-297
Herrel A, Van Damme R, Vanhooydonck B, De Vree F (2001)
The implications of bite performance for diet in two species
of lacertid lizards. Canadian Journal of Zoology 79: 662-670
Hodar JA (1997) The use of regression equations for the esti-
mation of prey length and biomass in diet studies of insecti-
vore vertebrates. Miscellania Zool. 20 (2): 1-10
Jover L (1989) Nuevas aportaciones a la tipificacion trofica
poblacional: el caso de Rana perezi en el Delta del Ebro. Ph.D.
Thesis, University of Barcelona, Barcelona
Kalboussi M, Nouira S, (2004) Comparative diet of northern and
southern Tunisian populations of Chalcides ocellatus (Forskal,
1775). Revista Espanola de Herpetologia 18: 29-39
Kaliontzopoulou A, Carretero MA, Llorente GA (2007) Multi-
variate and geometric morphometrics in the analysis of sex-
ual dimorphism variation in Podarcis lizards. Journal of Mor-
phology 268: 152-165
Kuranova VN, Patrakov SV, Bulakhova NA, Krechetova OA
(2005) The study of the ecological niche segregation for sym-
patric species of lizards Lacerta agilis and Zootoca vivipara.
Pp. 171-75 in: Ananjeva N, Tsinenko O. (eds.), Herpetologia
Petropolitana, Proc. 12th Ordinary General Meeting Soc. Eur.
Herpetol. Soc. Eur. Herpetol., Frankfurt am Main
Lanza B, Bruzzone CL (1961) Amphibia, Reptilia. Pp. 286-328
in: Zavattari E (Ed.) Biogeografia delle Isole Pelagie. Rend.
Accad. Naz. Lincei, (4) 11 [1960]
Bonn zoological Bulletin 57 (2): 111-118
Lo Cascio P (2004) Nuovi dati sui coleotteri di Lampione
(Canale di Sicilia). Naturalista sicil. 28: 1229-1231
Lo Cascio P, Corti C (2008) Indagini sull’ecologia dei rettili sauri
della R.N.O. e del S.LC. “Isola di Lampedusa’”’. Naturalista
sicil. 32: 319-354
Lo Cascio P, Corti C, Carretero MA, Pasta S (2008) Dati pre-
liminari sulla dieta di due popolazioni insulari di Chalcides
ocellatus. Pp. 314-317 in: Corti C (ed.), Herpetologia Sardini-
ae. Societas Herpetologica Italica-Edizioni Belvedere, Lati-
na
Lo Cascio P, Luiselli L, Corti C (2006) Preliminary data on the
ecology of Podarcis filfolensis of Lampione Islet (Pelagian Is-
lands, Channel of Sicily, Italy). Pp.103—110 in: Corti C, Lo
Cascio P, Biaggini M (eds.), Mainland and Insular Lacertid
Lizards: a Mediterranean Perspective. Firenze University
Press, Firenze
Losos JB (1992) The evolution of convergent structure in
Caribbean Anolis lizards. Systematic Biology 41: 403-420
Luiselli L (2008) Do lizard communities partition the trophic
niche? A worldwide meta-analysis using null models. Oikos
117: 321-330
Magurran AE (2004) Measuring biological diversity. Blackwell
Science, Oxford.
Mesquita DO, Colli GR, Vitt LJ (2007) Ecological release in
lizard assemblages of neotropical savannas. Oecologia 153:
185-195
Mylonas M, Valakos ED (1990) Contribution to the biogeograph-
ical analysis of the reptile distribution of the Mediterranean
islands. Revista Espanola de Herpetologia 4: 101-107
Nouira S (1983) Partage des resources alimentaires entre deux
Lacertidae sympatriques des Iles Kerkennah (Tunisie): Acan-
thodactylus pardalis et Eremias alivieri. Bull. Soc. Zool.
France 108: 477-483
Pasta S (2002) Caratteristiche fisico-geografiche. Pp.15—19 in:
Corti C, Lo Cascio P, Masseti M, Pasta S (eds.), Storia natu-
rale delle Isole Pelagie. L’Epos, Palermo
Pasta S, Masseti M (2002) Il popolamento umano. Pp. 123-127
in: Corti C, Lo Cascio P, Masseti M, Pasta S (eds.), Storia na-
turale delle Isole Pelagie. L’Epos, Palermo
Pérez-Mellado V, Corti C (1993) Dietary adaptations and her-
bivory in lacertid lizards of the genus Podarcis from western
Mediterranean island (Reptilia: Sauria). Bonn. zool. Beitr. 44:
193-220
Pérez-Mellado V (1982) Estructura de una taxocenosis de Lac-
ertidae (Sauria, Reptilia) del Sistema Central. Mediterranea
Ser. Biol. 6: 39-64
Pérez-Mellado V, Traveset A (1999) Relationships between
plants and Mediterranean lizards. Nat. Croat. 6: 275—285
Perry G & Pianka ER (1999) Animal foraging: Past, present and
future. Tree 12: 360-364
Pianka ER (1973) The structure of lizard communities. Annual
Review of Ecology and Systematics 4: 53-74
Pianka ER (1986) Ecology and Natural History of Desert
Lizards. Princeton University Press. New Jersey
Pitt WC, Ritchie ME (2002) Influence of prey distribution on
the functional response of lizards. Oikos 96: 157-153
Pollo CJ, Pérez-Mellado V (1991) An analysis of a Mediter-
ranean assemblage of three small lacertid lizards in Central
Spain. Acta Oecologica 12: 655-671
Rouag R, Djilali H, Gueriache H, Luiselli L (2007) Resource par-
titioning patterns between two sympatric lizard species from
Algeria. Journal of Arid Environments 69: 158-168
Ruiz X, Jover L (1981) Sobre la alimentacion otonal de la gar-
cilla bueyera — Bubulcus ibis (L.) en el delta del Ebro, Tarra-
©ZFMK
Diet of Lampione lizards
gona, Espana. Publicaciones del Departamento de Zoologia
de la Universidad de Barcelona 6: 65—72
Scalera R, Capula M, Fornasari L, Zava B, Bombi P, Mariotti-
ni P, Bologna MA (2004). Population structure, genetics and
conservation of the Maltese wall lizard Podarcis filfolensis,
on Linosa island (Reptilia, Lacertidae). Pp: 153-159, in:
Bologna M.A. & La Posta S. (Eds.): The Conservation Sta-
tus of Threatened Amphibian and Reptile Species of Italian
Fauna. Ital. J. Zool. 71 (Suppl.)
Schleich HH, Kastle W, Kabisch K (1996) Amphibians and rep-
tiles of North Africa. Koeltz. Koenigstein
Schoener TW (1974) Resource Partitioning in Ecological Com-
munities. Science 185: 27-39
Sorci G (1990) Nicchia trofica di quattro specie di Lacertidae
in Sicilia. Naturalista sicil. Series 4 24 (suppl.): 83-93
Strijbosch H, Helmer W, Scholte PT (1989) Distribution and
ecology of lizards in the Greek province of Evros. Amphib-
ia-Reptilia 10: 151-174
Turrisi GF, Vaccaro A (2006) Chalcides ocellatus (Forskal,
1775). Pp. 518-521 in: Sindaco R, Doria G, Razzetti E, Berni-
ni F (eds.), Atlante degli Anfibi e dei Rettili d’Italia. Polistam-
pa, Firenze
Van Damme R (1999) Evolution of Herbivory in Lacertid
Lizards: Effects of Insularity and Body Size. J. Herpetol. 33:
663-674
Vitt LJ, Caldwell J (1994). Resource partitioning and guild struc-
ture of small vertebrates in the Amazon forest leaf litter. Jour-
nal of Zoology London (B) 234: 463-476
Appendix
117
Vitt LJ, Carvalho CM (1995) Niche Partitioning in a Tropical
Wet Season: Lizards in the Lavrado Area of Brazil. Copeia
1995: 305-329
Vitt LJ, Pianka ER (2005) Deep history impacts present-day ecol-
ogy and biodiversity. PNAS 102: 7877-7881
Vitt LJ, Pianka ER, Cooper WE jr, Schwenk K (2003) History
and the Global Ecology of Squamate Reptiles. Am. Nat. 162:
44-61
Vitt LJ, Sartorius SS, Avila-Pires MT, Esposito MC, Miles DB
(2000) Niche segregation among sympatric Amazonian teiid
lizards. Oecologia 122: 410-420
Vitt LJ, Zani PA (1998) Ecological relationships among sym-
patric lizards in a transitional forest in the northern Amazon
of Brazil. Journal of Tropical Ecology 14: 63-86
Vitt LJ, Zani PA, Esposito MC (1999) Historical ecology of Ama-
zonian lizards: implications for community ecology. Oikos 87:
286-294
Webb CO, Ackerby DD, McPeek MA, Donoghue MJ (2002)
Phylogenies and Community Ecology. Ann. Rev. Eco. Syst.
33: 475-505
Winemiller KO, Pianka ER (1990) Organization in natural as-
semblages of desert lizards and tropical fishes. Ecological
Monographs 60: 27—55
Received: 08. II. 2010
Accepted: 16.X. 2010
Table 1. Descriptors of the taxonomic composition of the diet for Chalcides ocellatus and Podarcis filfolensis from Lampione is-
land. OTU: Operational taxonomical unit, %P: percentage of presence; %N: percentage of numerical abundance; IU: Resource use
index: — not consumed; 0.00: consumed but index value next to zero.
Chalcides ocellatus Podarcis filfolensis Podarcis filfolensis Podarcis filfolensis
total total males females
OTU %P %N IU %P %N IU %P %N IU %P %N IU
Gastropoda 9.09 1.28 0.65 2.33 0.39 0.09 7.14 1.16 0.42
Isopoda 9.09 1.28 0.65 11.63 1.94 1.47 10.34 1.74 Hall 1429233" 170
Araneae — - - 12.79 2.13 1.68 Sally) 0.87 0.35 28.57 4.65 5.10
Pseudoscorpiones - — - LO eal (2204 52925 2-9) 2.24 7.14 2°33, 0:85
Acarina - — - 2733) 10:39) 10109 3.45 0.58 0.15 - ~ —
Diptera SMS 2255 le 24.42 6.01 5.66 Zi59) 16198 6.51 17.86 4.07 3.20
Coleoptera 66.67 18.30 24.95 55.81 12.40 15.08 56.90 12:21 1498 53.57 12:79 16.48
Hymenoptera - — — 25.58 7.56 6.95 PES eH 6.41 21.43 814 7.04
Formicidae 18.18 4.26 3.19 60.47 23.45 26.73 58:62) 22538 25:18 ~64:29 25:58 3115
Homoptera ~ = — 6.98 1.74 0.97 10.34 2.62 1.60 - — =
Heteroptera 6.06 0.85 0.27 17.44 3.49 2.90 1325/9) 233 eS) DOO” Bes, “5:25
Mallophaga — — = 930 1.55 1.06 10.34 = 1.74 ills) 7.14 1.16 0.42
insect larvae BOBO 8S" AS 37.21 14.15 14.27 34.48 15.70 14.93 42.86 11.05 13.26
Arth ind. 9.09 1.70 0.78 O30 ESS: 106 Sali 0.87 0.35 IASG 229i 24g
Squamata 3.03 0.43 0.00 4.65 0.78 0.35 3.45 0.58 0.15 7.14 1.16 0.42
seeds, fruits MPN Poss) Itsesill 6.98 3.10 1.24 6.90 1.16 0.59 7.14 6.98 2.55
other plant matter 54.55 35.32 41.61 45.35 16.67 18.37 53.45 20.06 22.55 2857 9.88 9.69
Total (mean+SE) 45 pellets, 235 items
5.91+0.83 items/pellet
86 pellets, 516 items
5.19+0.34 items/pellet
58 pellets, 344 items
5.16+0.38 items/pellet
28 pellets, 178 items
5.25+0.70 items/pellet
Bonn zoological Bulletin 57 (2): 111-118
©ZFMK
118 Miguel A. Carretero et al.
Table 2. Diet diversities of Chalcides ocellatus and Podarcis filfolensis from Lampione island. Numbers indicate mean+SE. Hi:
individual diversity; Hp: population diversity; Hz: total accumulated diversity; all using Brillouin’s index.
Species (class) N Hi Hp Hz
Chalcides ocellatus (total) 45 0.61+0.03 2/201 2.44
Podarcis filfolensis (total) 86 0.98+0.02 3.33+0.08 B22
Podarcis filfolensis (males) 58 0.98+0.03 3.19+0.08 3.05
Podarcis filfolensis (females) 28 0.98+0.06 3.43+0.14 Bell 7
Table 3. Descriptors of the prey size composition of the diet for Chalcides ocellatus and Podarcis filfolensis from Lampione is-
land. OTU: Operational taxonomical unit, %P: percentage of presence; %N: percentage of numerical abundance; IU: Resource use
index: — not consumed; 0.00: consumed but index value next to zero.
Chalcides ocellatus Podarcis filfolensis Podarcis filfolensis Podarcis filfolensis
total total males females
OTU %P %N IU %P %N IU %P %N IU %P %N IU
0-5 mm 32.14 24.62 19.09 80.00 67.24 68.92 73.68 64.10 64.41 100.00 73.68 78.66
5-10 mm 85.71 58.46 69.63 84.00 31.03 31.08 84.21 135.90) -35:59 83.33 DOS me 2ies 4
10-15 mm 17.86 7.69 5.31 4.00 7D, O00 16.67 5.26 0.00
> 15mm 17.86 9.23 5.96 = = -
Total (mean+SE) 65 (of 235) items measured 116 (of 516) items measured 78 (of 344) items measured 38 (of 178) items measured
7.42+0.51 mm 4.22+0.24 mm 4.29+0.27 mm 4.0840.47 mm
Table 4. Diet overlaps (Pianka’s index) between the lizard species and classes from Lampione island considering the taxonomi-
cal and size composition of the prey consumed.
taxonomical overlap size overlap
C. ocellatus (total) — P. filfolensis (total) 0.54 0.63
C. ocellatus (total) — P. filfolensis (males) 0.54 0.64
C. ocellatus (total) — P. filfolensis (females) 0.53 0.50
P. filfolensis (males) — P. filfolensis (females) 0.97 0.97
Bonn zoological Bulletin 57 (2): 111-118 ©ZFMK
Bonn zoological Bulletin Volume 57 Issue 2 | pp. 119-126
Bonn, November 2010
Evolutionary reproductive morphology of amphibians: an overview
Susanne Kithnel!, Sandy Reinhard! & Alexander Kupfer!2*
| Institut fiir Spezielle Zoologie und Evolutionsbiologie mit Phyletischem Museum,
Friedrich-Schiller-Universitat Jena, Erbertstr. 1, D-07743 Jena, Germany
2 Biologie und Didaktik, Universitat Siegen, Adolf-Reichwein-Str. 2, D-57068 Siegen
* Correspondence; E-mail: [email protected]
Abstract. Reproduction is a crucial trait in the life history of any organism, and vertebrates, whether aquatic or terres-
trial, have evolved an extraordinary diversity of reproductive strategies and morphologies. Among tetrapods, the diver-
sity of reproductive modes is exceptionally high in amphibians, who also show multiple trends towards terrestrialisation
and internal fertilisation. Herein we give a brief overview of the diversity of amphibian reproductive morphology, with
a special emphasis on the cloaca, for all three major lineages, 1.e., anurans, urodeles and caecilians.
Key words. Reproduction, genital morphology, Amphibia.
INTRODUCTION
Reproduction is a crucial trait in the life history of any or-
ganism and scientists have been intrigued and challenged
by this event, and the structures associated with it, ever
since the days of Darwin (1871). Both aquatic and terres-
trial vertebrates have evolved an extraordinary diversity
of reproductive strategies and morphologies, including va-
rieties of oviparity and viviparity (Meisenheimer 1921;
Lombardi 1998). Among tetrapods, the diversity of repro-
ductive modes is exceptionally high in amphibians. In this
group, we also see multiple trends towards terrestrialisa-
tion and internal fertilisation (e.g. Haddad & Prado 2005).
Reproductive modes such as viviparity have evolved in-
dependently in all three lineages of modern amphibians
(e.g. Noble 1927; Wake & Dickie 1998; Wells 2007).
Herein we interpret a reproductive mode as a combina-
tion of several reproductive traits, including oviposition
site, clutch characteristics, stage and size of hatchling, and
type of parental care (sensu Salthe 1969).
Internal fertilization is a precondition for viviparity
(Wourms & Lombardi 1992; Bohme & Ziegler 2008). It
is associated with different strategies of sperm transfer,
which have evolved within all three amphibian orders,
ranging from cloacal apposition in anurans to a true cop-
ula via a male intromittent organ in caecilians (Sever et
al. 2001; Kupfer et al. 2006). Like most other tetrapods,
amphibians have a cloaca, a chamber that receives prod-
ucts from the kidneys, the intestine and the gonads, and
opens to the outside through a cloacal opening or vent
(Kardong 2006).
Bonn zoological Bulletin 57 (2): 119-126
Below we review the diversity of amphibian cloacal mor-
phologies involved in ensuring a secure direct sperm trans-
fer and internal fertilization among anurans, urodeles and
caecilians.
REPRODUCTIVE MORPHOLOGY OF
AMPHIBIANS
Anura
The majority of anurans, currently including almost 6000
species (AmphibiaWeb 2010), practice external fertiliza-
tion, and thus have no special male cloacal arrangements
facilitating direct sperm transfer (recently summarised by
Wells 2007). During copulation, males grasp females firm-
ly with their forearms (termed amplexus). In most cases,
sperm is directly released on the eggs protruding from the
female cloaca, but in some cases fertilisation takes place
without amplexus (e.g. Crump 1974; Kunte 2004). Inter-
nal fertilisation is rare among anurans, and mostly con-
nected to viviparity or other complex parental care mech-
anisms (e.g. Wake 1993; Beck 1998).
Exceptionally, the phylogenetically basal tailed frogs As-
caphus truei and A. montanus are the only anurans known
to have evolved a true intromittent organ in males (see Figs
1A—B). During courtship they practise a combination of
amplexus and copulation called “copulexus” (see Sever
et al. 2001; Stephenson & Verrell 2003). The so-called
©ZFMK
120 Susanne Kiihnel et al.
Fig. 1. | Reproductive morphology of anurans and salamanders. (A) Inguinal amplexus (“copulexus”) of Ascaphus truei. (B) ma-
le Ascaphus truei. The “tail”, a cloacal extension, can be inserted into the cloaca of the female during amplexus, ventrolateral view.
(C) male Mertensophryne micranotis (Anura: Bufonidae), left, dorsal view and its cloaca, right, caudal view (after Grandison 1980).
(D) cephalic amplexus of Notophthalmus viridescens (Urodela: Salamandridae). The male grasps the females’s neck whilst fan-
ning pheromones towards her nostrils. (E) cloacal region of lentic breeding Cynops pyrrhogaster (Urodela: Salamandridae). The
male’s cloaca (left) is heavily swollen compared to that of the female (right). (F) cloacal region of lotic breeding Euproctus mon-
tanus (Urodela: Salamandridae, after Brizzi et al. 1995). Males (left) possess a cloacal protuberance (cp) which bears a protusible
pseudopenis (pp), whereas the female cloaca is slightly conical shaped and its opening is located ventrally (right). (G) amplecting
pair of Calotriton arnoldi (Urodela: Salamandridae). The male grasps the female’s trunk with his tail.
Bonn zoological Bulletin 57 (2): 119-126 ©ZFMK
Amphibian reproductive morphology 121
“tail” resembles the posteriorly extended cloaca, proxi-
mately attended by Nobelian rods and strengthened by
vascularized tissue that is engorged with blood during cop-
ulation. This gives the ventral cloacal surface a pinkish
colour (Noble & Putnam 1931; Duellman & Trueb 1994).
To insert the posterior pointing “tail” into the female vent,
the male first flexes his pelvis at a right angle to the ver-
tebral column. Contraction of the paired Musculi compres-
sores cloacae (Duellman & Trueb 1994) bend the intro-
mittent organ ventrally, with the male vent pointing ante-
riorly (Slater 1931). Keratinised spines are present with-
in the male cloacal orifice, but whether they function to
enhance the attachment of the male to the female remains
unclear (Noble & Putnam 1931; Metter 1964).
Additionally, internal fertilisation including an amplexus
and cloacal apposition occurs in a few anurans, such as
several species of viviparous African dwarf toads Nec-
tophrynoides (Wake 1980; Wake & Dickie 1998) and Nim-
baphrynoides (Sandberger et al. 2010), and in two species
of Caribbean Eleutherodactylus, the viviparous E. jasperi
(Dewry & Kirkland 1976; Wake 1978) and the oviparous-
direct developing E. coqui (Townsend et al. 1981). Mat-
ing has only been observed in couples of E. coqui in a spe-
cial amplectic position called reverse hind leg clasp, that
is initiated by the female (Townsend & Stewart 1986).
Males do not clasp, and the female rests her hind legs on
top of the male’s legs. This behaviour might be correlat-
ed with terrestrial reproduction and internal fertilization.
It is also thought to be present in the viviparous E. jasperi
but has not yet been observed (Wake 1978). Within the
African Bufonidae, all species of Nectophrynoides (and
also Altiphrynoides malcolmi and Nimbaphrynoides oc-
cidentalis, former members of Nectophrynoides, see Frost
et al. 2006) practice internal fertilization. A/tiphrynoides
and Nimbaphrynoides both show a dimorphism of the
male and female vent, and an inguinal amplexus in a
unique belly-to-belly position has been reported as well
(Grandison 1978).
As in the internally fertilising Ascaphus ssp., males of the
East African toad Mertensophryne micranotis (Bufonidae)
exhibit modifications of the cloacal region (Duellman &
Trueb 1994). They have small conical spines around the
rim of the vent and at the entrance to the cloacal tube re-
stricted to the ridges of the puckered vent (Grandison
1980, see also Fig 1C). Males and females keep a very
tight cloacal contact during mating. Although the cloacal
spines play a role to ensure a close apposition of the vents,
to secure internal fertilisation, there is no evidence for a
direct interlocking mechanism in the furrows of the female
vent (Grandison & Ashe 1983).
Another potential record of internal fertilisation is provid-
ed for the neotropical Pumpkin Toadlet Brachycephalus
Bonn zoological Bulletin 57 (2): 119-126
ephippium (Pombal et al. 1994). During mating, males
shift from an inguinal to an axillary amplexus to optimal-
ly allow positioning of the vents, and thus maximize fer-
tilization of the relatively large eggs (5.1 to 5.3 mm). A
further record of viviparity in fanged frogs (Limnonectes
spec.) from Sulawesi probably also involves internal fer-
tilisation(Emerson 2001).
It can be hypothesised that (1) many terrestrially breed-
ing species with large direct-developing clutches are in-
ternal fertilizers and (2) if additional viviparous species
are encountered they will also show internal fertilisation.
Thus, internal fertilisation and viviparity in anurans might
be more widespread than currently recognized (see also
Wake 1978).
Data on the reproductive biology, including the mating be-
haviour, of many species is still lacking (Duellman &
Trueb, 1994; Wells 2007). Life history data from around
23 % of the currently known species is missing, as listed
in the data deficient category of the IUCN (Stuart et al.
2008).
Urodela
The majority of the 590 species of urodeles exhibit inter-
nal fertilization, whilst only males of the basal families
Hynobiidae, Cryptobranchidae, and presumably Sirenidae,
fertilise eggs externally (summarised in Duellmann &
Trueb 1994; Wells 2007). The complex and elaborate
courtship behavior of most salamanders includes the dep-
osition of a spermatophore by the male, which is subse-
quently received by the female. A true intromittent organ
in salamanders is lacking, although direct sperm transfer
can be found in one species — the Corsican brook newt
Euproctus montanus, a lotic breeding endemic of the is-
land of Corsica. The cloaca of the male brook newt re-
sembles a conical protuberance (Fig IF). The cloacal
chamber hosts a “pseudopenis”, a broad conspicuous
papilla, which can be evaginated during mating (Brizzi et
al. 1995; Carranza & Amat 2005). The male grasps the
female during amplexus, holding her tail with his jaws and
wrapping his tail around her trunk, whilst his backward
projecting cloaca is positioned close to that of the female.
A deep groove along the ventral surface of the pseudope-
nis, which is aligned with the cloacal tube, guarantees a
guided, unidirectional flux of cloacal products. Thus,
sperm mixed with secretory products is transferred direct-
ly into the female’s cloaca. The Salamandroidea that prac-
tice internal fertilization possess a distinct set of male cloa-
cal glands necessary for spermatophore production (Sev-
er 2002). The glands are hormonally controlled and hy-
pertrophied during the breeding season, often causing a
sexual dimorphism in cloacal shape. However, in Euproc-
©ZFMK
tus montanus, cloacal glands are reduced or partly lack-
ing (Brizzi et al. 1995; Sever 2002). Males of six salaman-
drid genera possess a so-called “pseudopenis”, a projec-
tion of the dorsal roof which nearly fills the entire ante-
rior chamber of the cloaca. It is involved in shaping and
expulsion of the spermatophore (Halliday 1998), but can-
not be everted as in the Corsican brook newt (Brizzi et al.
1995; Carranza & Amat 2005).
Sexes of most species, regardless of the mode of fertili-
sation, show a sexual dimorphism in cloacal shape (Figs
1E—-F). Usually, the male cloaca appears larger and more
swollen than the female one. This is caused by the activ-
ity of the glands mentioned above (see also Sever 2002).
Species that breed in the water and show elaborate
courtship dances or walks, such as some members of the
family Salamandridae, produce courtship pheromones,
which are fanned towards the female using the tail. Sala-
manders that mate terrestrially also use courtship
pheromones secreted from specialised glands to attract fe-
males. Pheromone-producing cloacal glands are therefore
highly influenced by sexual selection (e.g. Sever 2002;
Houck et al. 2008). Usually, female cloacae are less promi-
nent, but they may also possess up to three types of cloa-
cal glands in Salamandroidea, mainly accounting for
sperm storage (spermathecae), a unique feature among
vertebrates (Sever 1994). Females may retain and mix vi-
able spermatozoa from multiple matings in the spermath-
ecae for longer periods (e.g. Steinfartz et al. 2006). Fe-
male Eurycea fertilise eggs from stored sperm up to eight
months after insemination, female Notophthalmus viri-
descens effectively store sperm for up to six months, and
female Salamandra salamandra are reported to store
sperm for up to two years (Sever et al. 1996; Stebbins &
Cohen 1997; Sever & Brizzi 1998).
Additionally, the shape of female cloacae can be adapted
to a specific substrate for oviposition and type of water
body. Females of stream-breeding species, such as
Calotriton asper, sometimes have a conically shaped cloa-
ca for egg deposition and safe attachment between stones
and in crevices (e.g. Carranza & Amat 2005).
Lotic breeders such as Calotriton ssp. often engage in an
amplexus directly transferring the spermatophore into the
female cloaca (Fig 1G). It ensures direct and rapid sper-
matophore uptake, and thus reduces energy wasting, which
can hardly be avoided during aquatic breeding where the
male and the female often have no physical contact. Breed-
ing patterns including an amplexus are common in sala-
mandrids. Multiple ways of female capture are known,
such as the cephalic capture of Notophthalmus ssp. (see
Fig 1D), the dorsal capture of Zaricha, or the ventral cap-
ture performed by fire salamanders (Stebbins & Cohen
1997). The mating amplexus may last up to several hours,
Bonn zoological Bulletin 57 (2): 119-126
122 Susanne Kiihnel et al.
depending on the species. Salamanders of the family Am-
bystomatidae mate in the water, and the males guide fe-
males to spermatophore-uptake using a “tail-nudging-
walk”, except in Ambystoma gracile, A. laterale, A. jef-
fersonarium and A. macrodactylum, which capture fe-
males in an amplexus (Duellmann & Trueb 1994; Verrell
& Krenz 1998). In contrast, some plethodontids perform
a unique “tail-straddling-walk” behaviour (e.g. Arnold
1977).
Gymnophiona
In contrast to all salamanders (with the exception of Eu-
proctus montanus) and frogs (with the exception of As-
caphus ssp.), the male caecilian cloaca is evertible through
the vent and operates as an intromittent organ or phallus,
a unique structure among tetrapods (Tonutti 1931, see al-
so Fig 2A). Presumably all ca. 190 caecilian species
(oviparous and viviparous) practice internal fertilisation
with the help of the phallodeum (Tonutti 1931; Wake
1972; Gower & Wilkinson 2002), which is inserted into
the female vent during copulation (e.g. Kupfer et al.
2006a).
The caecilian vent is simply surrounded by several folds,
which are variably arranged among the groups and dis-
play sexual dimorphism in some species, such as mem-
bers of the Typhlonectidae (e.g. Taylor 1968; Kupfer
2007). In contrast, the cloaca is highly complex and di-
verse. The male caecilian cloaca is an elongated tube di-
vided into two distinct chambers. The cranial urodeum is
rather simply built, bearing longitudinal ridges, and con-
nects to the intestine and the urogenital ducts, which en-
ter after performing a U-bend (Sawaya 1942; Gower &
Wilkinson 2002). An extraordinary feature is the presence
of Millerian ducts, which become glandular during repro-
ductive activity, and secrete a fluid containing lipids and
sugars necessary for sperm motility (e.g. Wake 1981). The
caudal phallodeum is more broadly built and the inner
structure is very different. The ridges are arranged in a
more complex pattern (running transversely). In adults it
is often equipped with tuberosities or crests, which give
the phallodeum a characteristic morphology and gives rise
to an extraordinary variation in shape (Wiedersheim 1879;
Tonutti 1931, 1933; Wake 1972; Exbrayat 1991; Gower
& Wilkinson 2002, see also Fig 2), that is impotant for
caecilian systematics (Miller et al. 2005). East-African
scolecomorphid caecilians even have cartilaginous
spicules (Wake 1998). In many species, pouchy dorsolat-
eral appendixes — so called “blind sacs” — extend anteri-
or to the phallodeum. During eversion, the luminal sur-
face of the phallodeum represents the outer structure of
the phallus, with the urodeum lying in-between (see Tonut-
ti 1931; Gower & Wilkinson 2002, see also Fig. C right).
©ZFMK
Amphibian reproductive morphology 123
Smm
5mm
2mm
caudal
I
2mm 2mm
Fig. 2. Genital morphology of caecilian amphibians. (A) male Chthonerpeton indistincum (Gymnophiona: Typhlonectidae) show-
ing an everted phallus, MHNM 09323, right — detail. (B) Geotrypetes seraphini (Gymnophiona: Caeciliidae), lateral (left), dorsal
(central) and ventral (right) view of the everted phallus, AK 01149. (C) Zyphlonectes natans (Gymnophiona: Typhlonectidae), SRuCT-
Scan of the everted phallus. Right — virtual clipping, frontal view. (D) SRuwCT-Scan of female cloaca (/chthyophis cf. kohtaoen-
sis). Dorsolateral view, virtual cut of cloacal sheath, cranial part and blind sacs, green - cloaca, violet — oviducts, yellow — blad-
der. Abbreviations: MHNM = Museo Nacional de Historia Natural Montevideo Uruguay, AK = Alexander Kupfer collection.
Bonn zoological Bulletin 57 (2): 119-126 ©ZFMK
124 Susanne Kihnel et al.
To retract the cloaca within the body after copulation, cae-
cilians possess a specific muscle (musculus retractor cloa-
cae), which is also found in some females (Wilkinson
1990).
The female cloaca of caecilians has received little atten-
tion (e.g. Hypogeophis rostratus Tonutti 1931; Ty-
phlonectes compressicauda, Exbrayat 2006), the only ded-
icated morphological study was presented by Wake
(1972), proposing a functional association between the
specific male and female morphologies. The female cloa-
ca is supposed to be non-eversible (Wilkinson 1990),
therefore displaying a different morphology. Generally it
is shorter than in males, and the urogenital ducts lack a
copulatory loop (see Fig. 2D). There is also evidence for
a bisection of the female cloaca (Exbrayat 1991; Kiihnel
et al. submitted). The cranial chamber is homologous to
the male urodeum. The caudal chamber is marked by a
different arrangement of longitudinal cloacal folds most-
ly lacking tuberosities, and therefore easily recognised.
Nothing 1s at present known about how far the male phal-
lus inserts into the female cloaca, and if special structures
corresponding to the male ornamentation are present, help-
ing in fixation during copulation.
Copulations in caecilians have rarely been observed. Da-
ta are available for two aquatic/semiaquatic species, the
typhlonectids Typhlonectes compressicauda and Chthon-
erpeton indistinctum. Pairs of C. indistinctum copulated
for betwen 30 minutes and 5 hours (Barrio 1969) and those
of 7. compressicauda for between 75 minutes and 3 hours
(Murphy et al. 1977; Billo et al. 1985). Observations on
copulations in terrestrial caecilians have, to the best of our
knowledge, only been presented for the Indian ichthyophi-
id Ichthyophis beddomei (Bhatta 1999) and Ichthyophis
cf. kohtaoensis (Kupfer et al. 2006a). Bhatta reports on a
copulation lasting for about 40 or 45 minutes, an obser-
vation fitting well with the duration time of about 45 min-
utes that was observed in Ichthyophis cf. kohtaoensis
(Kupfer et al. 2006a).
Caecilians show a remarkable diversity of reproductive
modes associated with parental care (e.g. Wake 1977;
Himstedt 1996; Wilkinson & Nussbaum 1998). Oviparous
caecilians guarding egg clutches in terrestrial chambers
(e.g. Sarasin & Sarasin 1887-1890) either have the pre-
sumed ancestral amphibian life cycle with aquatic larvae,
or show direct development of juveniles with no aquatic
larval stage (e.g. Brauer 1897). Females of viviparous
species retain fertilised eggs. Embryogenesis is complet-
ed within the oviducts, and after hatching the foetuses feed
mainly intrauterinely on the hypertrophied oviductal lin-
ing (e.g. Parker 1956; Welsch et al. 1977). After a long
gestation period, the females give birth to fully metamor-
phosed, precocial young with the adult-type morphology
Bonn zoological Bulletin 57 (2): 119-126
(e.g. Billo et al. 1985; Exbrayat & Delsol 1985). Recent-
ly, a novel form of parental investment, maternal derma-
totrophy, a.k.a. skin feeding, where altricial young feed
externally on the mother’s hyperthrophied skin, has been
described (Kupfer et al. 2006b; Wilkinson et al. 2008).
SUMMARY AND PERSPECTIVES
In addition to their remarkable diversity of reproductive
modes, amphibians also show large variation in their re-
productive morphology. Many morphological peculiari-
ties are related to the evolution of internal fertilisation, and
ultimately to viviparity. In relation to fertilisation and
sperm transfer, different strategies have evolved within the
three amphibian orders, ranging from cloacal apposition
in anurans to a true copula via a highly complex male in-
tromittent organ in caecilians. Amphibians offer a prime
system for comparative studies of evolutionary reproduc-
tive biology. Research on the reproductive or genital mor-
phology should include modern methodology, such as 3D
reconstruction and soft tissue synchrotron radiation based
X-ray microtomography (SRuCT, see Fig. 2 C—D). Be-
cause amphibian diversity is steadily increasing (although
at the same time many species are declining or even go-
ing extinct) we envisage that many more unexpected re-
productive strategies and morphologies remain to be dis-
covered.
Acknowledgements. Phillipp Wagner is congratulated for or-
ganising this magnificent Festschrift volume. Many thanks for
giving us the opportunity to contribute. We would like to dedi-
cate our contribution to Wolfgang Bohme for his continuous ef-
fort in studying vertebrate, especially squamate genitalia and
their evolution. Synchrotron radiation based x-ray microtomog-
raphy (SRuCT) of caecilian genitalia was carried out at beam-
line BW2 at the Deutschen Elektronen Synchroton (DESY, Ham-
burg) under experimental projects I-20080054 and I-20090089.
Travel of SK and AK has been generously supported by DESY.
Felix Beckmann (DESY) provided initial 3D reconstructions and
Frank Friedrich (University of Hamburg) and Thomas Kleinte-
ich (University of Washington) aided in the successful process-
ing of 3D models. Alexander Haas (University of Hamburg) gen-
erously provided laboratory space and technical support for SK
during her collections-based research at the Museum fur Zoolo-
gie Hamburg (ZMH). SK is financially supported by the Volk-
swagen Stiftung (grant initiative “evolutionary biology”). An
anonymous referee, Lennart Olsson and Philipp Wagner gave
valuable comments on earlier versions of the manuscript.
REFERENCES
Arnold SJ (1977) The courtship behavior of North American
salamanders with some comments on Old World salamandrids.
Pp. 141-183 in: Taylor D & Guttman S (eds.) The Reproduc-
tive Biology of Amphibians. Plenum Press, New York
Barrio A (1969) Observaciones sobre Chthonerpeton indistinc-
tum (Gymnophiona, Caecilidae) y su reproduccion. Physis 28:
499-503
©ZFMK
Amphibian reproductive morphology 12
Beck CW (1998) Mode of fertilization and parental care in anu-
rans. Animal Behaviour 55: 439-449
Bhatta G (1999) Some aspects of general activity, foraging and
breeding in Ichthyophis beddomei (Peters) and Ichthyophis
malabarensis (Taylor) (Apoda: Ichthyophiidae) in captivity.
Zoos’ Print Journal 14: 23-36
Billo RR, Straub JO, Senn DG (1985) Vivipare Apoda (Amphib-
ia: Gymnophiona), Zyphlonectes compressicaudus (Duméril
& Bibron, 1841): Kopulation, Tragzeit und Geburt. Amphib-
ia-Reptilia 6: 1—9
Bohme W, Ziegler T (2009) A review of iguanian and an-
guimorph lizard genitalia (Squamata: Chamaeleonidae; Vara-
noidea, Shinisauridae, Xenosauridae, Anguidae) and their phy-
logenetic significance: comparisons with molecular data sets.
Journal of Zoological Systematics and Evolutionary Research
47: 189-202
Brauer A (1897) Beitrage zur Kenntnis der Entwicklungs-
geschichte und der Anatomie der Gymnophionen. Zoologis-
che Jahrbiicher, Abteilung fiir Anatomie und Ontogenie der
Thiere. 10: 389-472
Brizzi R, Calloni C, Delfino G, Tanteri G (1995) Notes on the
Male Cloacal Anatomy and Reproductive Biology of Euproc-
tus montanus (Amphibia: Salamandridae). Herpetologica 51:
8-18
Carranza S, Amat F (2005) Taxonomy, biogeography and evo-
lution of Euproctus (Amphibia : Salamandridae), with the res-
urrection of the genus Calotriton and the description of a new
endemic species from the Iberian Peninsula. Zoological Jour-
nal of the Linnean Society 145: 555-582
Crump ML (1972) Territoriality and Mating Behavior in Den-
drobates granuliferus (Anura: Dendrobatidae). Herpetologi-
ca 28: 195-198
Darwin CR (1871) The descent of man, and selection in rela-
tion to sex. John Murray Press, London
Drewry GE, Kirkland LJ (1976) A New Ovoviviparous Frog,
Eleutherodactylus jasperi (Amphibia, Anura, Leptodactyli-
dae), from Puerto Rico. Journal of Herpetology 10: 161—165
Duellman WE & Trueb L (1994) Biology of Amphibians. John
Hopkins, Baltimore
Emerson SB (2001) A macroevolutionary study of historical con-
tingency in the fanged frogs of Southeast Asia. Biological
Journal of the Linnean Society 73: 139-151
Exbrayat J-M & Delsol M (1985) Reproduction and Growth of
Typhlonectes compressicaudus: A Viviparous Gymnophione.
Copeia 1985: 950-955
Exbrayat J-M, Estabel J (2006) Anatomy with particular refer-
ence to the reproductive system. Pp. 79-156 in: Exbrayat J-
M (ed.) Reproductive Biology and Phylogeny of
Gymnophiona (Caecilians). Science Publishers Inc., Enfield,
NH
Exbrayat JM (1991) Anatomie du cloaque chez quelques
Gymnophiones. Bulletin de la Société Herpétologique de
France 58: 30-42
Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad CFB,
De Sa RO, Channing A, Wilkinson M, Donnellan SC, Rax-
worthy CJ, Campbell JA, Blotto BL, Moler P, Drewes RC,
Nussbaum RA, Lynch JD, Green DM, Wheeler WC (2006)
The amphibian tree of life. Bulletin of the American Muse-
um of Natural History 297: 1-370
Gower DJ, Wilkinson M (2002) Phallus morphology in caecil-
ians and its systematic utility. Bulletin of the Natural Histo-
ry Museum, Zoology Series 68: 143-154
Grandison AGC (1978) The occurrence of Nectophrynoides
(Anura: Bufonidae) in Ethiopia. A new concept of the genus
Bonn zoological Bulletin 57 (2): 119-126
n
with a description of a new species. Monitore zoologico ital-
iano (NS) supplemento 11: 119-172
Grandison AGC (1980) Aspects of breeding morphology in
Mertensophryne micranotis (Anura: Bufonidae): secondary
sexual characters, eggs and tadpole. Bulletin of the British Mu-
seum (Natural History) Zoology 39: 299-304
Grandison AGC, Ashe S (1983) The distribution, behavioural
ecology and breeding strategy of the pygmy toad, Merten-
sophryne micranotis (Lov.). Bulletin of the British Museum
(Natural History) Zoology 45: 85—93
Haddad CFB, Prado CPA (2005) Reproductive modes in frogs
and their unexpected diversity in the Atlantic forest of Brazil.
Bioscience 55: 207-217
Halliday T (1998) Sperm competition in amphibians. Pp.
465-502 in: Birkhead TR & Meller AP (eds.) Sperm Compe-
tition and Sexual Selection. Academic Press, London
Himstedt W (1996) Die Blindwihlen. Westarp Wissenschaften,
Magdeburg
Houck LD, Watts RA, Arnold SJ, Bowen KE, Kiemnec KM,
Godwin HA, Feldhoff PW, Feldhoff RC (2008) A Recombi-
nant Courtship Pheromone Affects Sexual Receptivity in a
Plethodontid Salamander. Chemical Senses 33: 623-631
Kardong KV (2006) Vertebrates: comparative anatomy, function,
evolution. Fourth edition. Mc Graw Hill, New York
Kuhnel S, Herzen J, Kleinteich T, Beckmann F, Kupfer A (ac-
cepted pending revision) The female cloaca of an oviparous
caecilian amphibian (Gymnophiona): functional and season-
al aspects. Acta Zoologica
Kunte K (2004) Natural History and Reproductive Behavior of
Nyctibatrachus ct. humayuni (Anura: Ranidae). Herpetolog-
ical Review 35: 137-140
Kupfer A (2007) Sexual size dimorphism in amphibians: an
overview. in: Fairbairn DJ, Blanckenhorn WU & Szekely T
(eds.) Sex, Size and Gender Roles: Evolutionary Studies of
Sexual Size Dimorphism. Oxford University Press, Oxford
Kupfer A, Kramer A, Himstedt W, Greven H (2006a) Copula-
tion and egg retention in an oviparous Caecilian (Amphibia:
Gymnophiona). Zoologischer Anzeiger 244: 223-228
Kupfer A, Miller H, Antoniazzi MM, Jared C, Greven H, Nuss-
baum RA, Wilkinson M (2006b) Parental investment by skin
feeding in a caecilian amphibian. Nature 440: 926-929
Lombardi J (1998) Comparative vertebrate reproduction. Kluw-
er Academic Publishers, Norwell, Massachusetts USA
Meisenheimer J (1921) Geschlecht und Geschlechter im Tier-
reiche. I. Die natiirlichen Beziehungen. Gustav Fischer, Jena
Metter DE (1964) A Morphological and Ecological Comparison
of Two Populations of the Tailed Frog, Ascaphus truei Ste}-
neger. Copeia 1964: 181-195
Murphy JB, Quinn H, Campbell J (1977) Observations on the
breeding habits of the aquatic caecilian 7yphlonectes compres-
sicaudus. Copeia |: 66-69
Noble GK (1927) The value of life history data in the study of
evolution. Annals of the New York Academy of Sciences 30:
31-128
Noble GK, Putnam PG (1931) Observations on the Life Histo-
ry of Ascaphus truei Stejneger. Copeia 1931: 97-101
Parker HW (1956) Viviparous caecilians and amphibian phyloge-
ny. Nature 178: 250—252
Pombal JP, Jr., Sazima I, Haddad CIFB (1994) Breeding Behav-
ior of the Pumpkin Toadlet, Brachycephalus ephippium
(Brachycephalidae). Journal of Herpetology 28: 516-519
Salthe SN (1969) Reproductive modes and the numbers and size
of ova in the urodeles. American Midland Naturalist 81:
467-490
OZFMK
126 Susanne Kihnel et al.
Sandberger L, Hillers A, Doumbia J, Loua N-S, Brede C, Rodel
M-O (2010) Rediscovery of the Liberian Nimba toad, Nim-
baphrynoides liberiensis (Xavier, 1978) (Amphibia: Anura:
Bufonidae), and reassessment of its taxonomic status. Zootaxa
2355: 56-68
Sarasin P, Sarasin F (1887-1890) Ergebnisse naturwis-
senschaftlicher Forschungen auf Ceylon in den Jahren
1884-1886. Zur Entwicklunggeschichte und Anatomie der
Ceylonesischen Blindwthle /chthyophis glutinosus. C. W.
Kreidel, Wiesbaden
Sawaya MP (1942) Sobre la cloaca dos Siphonops. Boletins da
Faculdade de Filosofia, Ciencias e Letras, Zoologia, Sao Pao-
lo 15: 3-43
Sever DM (1994) Observations on regionalization of secretory
activity in the spermathecae of salamanders and comments on
phylogeny of sperm storage in female amphibians. Herpeto-
logica 50: 383-397
Sever DM (2002) Female sperm storage in amphibians. Journal
of Experimental Zoology 292: 165—179
Sever DM, Brizzi R (1998) Comparative biology of sperm stor-
age in female salamanders. Journal of Experimental Zoology
282: 460-476
Sever DM, Moriarty EC, Rania LC, Hamlett WC (2001) Sperm
storage in the oviduct of the internal fertilizing frog Ascaphus
truei. Journal of Morphology 248: 1-21
Sever DM, Rania LC, Krenz JD (1996) Annual cycle of sperm
storage in spermathecae of the red-spotted newt, Notophthal-
mus viridescens (Amphibia: Salamandridae). Journal of Mor-
phology 227: 155-170
Slater JR (1931) The Mating of Ascaphus truei Steyneger. Copeia
1931: 62-63
Stebbins RC, Cohen NW (1997) A Natural History of Amphib-
ians. Princeton University Press, Princeton, NJ
Steinfartz S, Stemshorn K, Kuesters D, Tautz D (2006) Patterns
of multiple paternity within and between annual reproduction
cycles of the fire salamander (Salamandra salamandra) under
natural conditions. Journal of Zoology 268: 1—8
Stephenson B, Verrell P (2003) Courtship and mating of the tailed
frog (Ascaphus truei). Journal of Zoology 259: 15—22
Stuart S, Hoffmann M, Chanson J, Cox N, Berridge R, Ramani
P, Young B (2008) Threatened Amphibians of the World. Lynx
Edicions, Barcelona
Taylor EH (1968) The Caecilians of the World — A taxonomic
review. University of Kansas Press, Lawrence
Tonutti E (1931) Beitrag zur Kenntnis der Gymnophionen XV.
Das Genitalsystem. Morphologisches Jahrbuch 68: 151—293
Tonutti E (1933) Beitrag zur Kenntnis der Gymnophionen XIX.
Untersuchungen der Kopulationsorgane bei weiteren
Gymnophionenarten. Morphologisches Jahrbuch 72: 156-211
Townsend DS, Stewart MM (1986) Courtship and Mating Be-
havior of a Puerto Rican Frog, Eleutherodactylus coqui. Her-
petologica 42: 165-170
Bonn zoological Bulletin 57 (2): 119-126
Townsend DS, Stewart MM, Pough FH, Brussard PF (1981) In-
ternal Fertilization in an Oviparous Frog. Science 212:
469-47
Verrell PA, Krenz JD (1998) Competition for Mates in the Mole
Salamander, Ambystoma talpoideum: Tactics That May Max-
imize Male Mating Success. Behaviour 135: 121—138
Wake MH (1972) Evolutionary morphology of the caecilian uro-
genital system. IV. The cloaca. Journal of Morphology 136:
353-365
Wake MH (1977) The reproductive biology of caecilians: an evo-
lutionary perspective. Pp. 73-101 in: Taylor DH & Guttman
SI (eds.) The Reproductive Biology of Amphibians. Plenum
Publishing Corporation, New York
Wake MH (1978) The Reproductive Biology of Eleutherodacty-
lus jasperi (Amphibia, Anura, Leptodactylidae), with Com-
ments on the Evolution of Live-Bearing Systems. Journal of
Herpetology 12: 121-133
Wake MH (1980) The Reproductive Biology of Nectophrynoides
malcolmi (Amphibia: Bufonidae), with Comments on the Evo-
lution of Reproductive Modes in the Genus Nectophrynoides.
Copeia 1980: 193-209
Wake MH (1981) Structure and function of the male Mueller-
ian gland in caecilians, with comments on Its evolutionary sig-
nificance. Journal of Herpetology 15: 17—22
Wake MH (1993) Evolution of oviductal gestation in amphib-
ians. Journal of Experimental Zoology 266: 394-413
Wake MH (1998) Cartilage in the cloaca: Phallodeal spicules in
caecilians (Amphibia : Gymnophiona). Journal of Morphol-
ogy 237: 177-186
Wake MH, Dickie R (1998) Oviduct structure and function and
reproductive modes in amphibians. Journal of Experimental
Zoology 282: 477-506
Wells KD (2007) The ecology and behaviour of amphibians. Uni-
versity of Chicago, Chicago and London
Welsch U, Miller M, Schubert C (1977) Elektronenmikroskopis-
che und histochemische Beobachtungen zur Fortpflanzungs-
biologie viviparer Gymnophionen (Chthonerpeton indistinc-
tum). Zoologische Jahrbiicher ftir Anatomie 97: 532-549
Wilkinson M (1990) The presence of a Musculus Retractor Cloa-
cae in female caecilians (Amphibia: Gymnophiona). Amphib-
ia-Reptilia 11: 300-304
Wilkinson M, Kupfer A, Marques-Porto R, Jeffkins H, Antoni-
azzi MM, Jared C (2008) One hundred million years of skin
feeding? Extended parental care in a Neotropical caecilian
(Amphibia : Gymnophiona). Biology Letters 4: 358-361
Wilkinson M, Nussbaum RA (1998) Caecilian viviparity and am-
niote origins. Journal of Natural History 32: 1403—1409
Wourms JP, Lombardi J (1992) Reflections on the evolution of
piscine viviparity. American Zoologist 32: 276-293
Received: 25.1X.2010
Accepted: 16.X.2010
©OZFMK
Bonn zoological Bulletin Volume 57 | Issue 2 i: pp. 127-136 Bonn, November 2010
Updated checklist of the living monitor lizards of the world
(Squamata: Varanidae)
André Koch!, Mark Auliya? & Thomas Ziegler;
! Zoologisches Forschungsmuseum A. Koenig & Leibniz Institute for Animal Biodiversity,
Department of Herpetology, Adenauerallee 160, D-53113 Bonn, Germany;
E-mail: [email protected]
? Helmholtz Centre for Environmental Research — UFZ, Department of Conservation Biology,
Permoserstr. 15, D-04318 Leipzig; Germany; E-mail: [email protected]
3 AG Zoologischer Garten K6In, Riehler Strae 173, D-50735 K6lIn, Germany;
E-mail: [email protected]
Abstract. We provide an update of BOhme’s (2003) checklist of the living monitor lizards of the world. Since this con-
tribution, ten new species and one new subspecies have been described. Ten of these taxa were described from the is-
lands of the Indo-Australian Archipelago. One Soterosaurus taxon (macromaculatus) was revalidated to subspecies sta-
tus, whereas the younger melanistic taxon komaini was synonymized with the former. In addition, five taxa (beccarii,
cumingi, marmoratus, nuchalis, and togianus), that were formerly treated as subspecies, were re-elevated to species rank
resulting in 73 extant species (including 21 subspecies). This represents a 20% increase of the world’s varanid diversity
since 2003. In addition, ongoing taxonomic studies on V spinulosus from the Solomon Islands (formerly a member of
the V. indicus species group) indicate that this species most likely represents a new subgenus. Therefore, this taxon is
currently treated incertae sedis. In sum, taxonomic research in monitor lizards remains incomplete. Further studies must
be initiated to fully understand diversity and distribution of these CITES-listed lizards next to implications for sustain-
able conservation measures.
Key words: Reptilia, Varanus, Philippinosaurus, Soterosaurus, Euprepiosaurus, Odatria, checklist.
INTRODUCTION
Monitor lizards are among the largest living squamates of
the world. They inhabit Africa, the Arabian Peninsula,
South and Southeast Asia as well as the Indo-Australian
Archipelago including Australia and several Pacific island
groups. Due to their often large body size and ecological
role as top predators in most environments they inhabit,
monitor lizards have always been a small reptile group
comparable to large placental carnivores (Sweet & Pianka
2007). Nevertheless, the diversity of monitor lizards has
been underestimated for many decades.
One of the latest comprehensive listings of all extant mon-
itor lizards was published by BOhme (2003), who listed
58 different species and 28 subspecies. This checklist was
prepared at the request of the Nomenclature Committee
of the Convention on International Trade in Endangered
Species of Wild Flora and Fauna (CITES), because of the
increase in monitor lizard diversity in the early 1990s. This
caused considerable confusion within trade records,
which made communication about these economically im-
portant lizards in the CITES domain rather difficult.
Bonn zoological Bulletin 57 (2): 127-136
Therefore, BOhme’s (2003) checklist was adopted as the
standard reference for the Varanidae by the 12th Confer-
ence of the Parties to CITES in November 2002.
The need for an updated list only seven years after the last
synopsis by B6hme (2003) derives from ongoing descrip-
tions of new species. This is partly due to the fact, that
the understanding of monitor lizards, their systematics, and
the underlying concepts have been refined in recent years
(e.g. Koch et al. 2009). In addition, the taxonomic status
of several nominal taxa has changed. This involves either
subspecies elevated to species rank or the subgeneric al-
location of species. Also, knowledge of distribution ranges
of some rare monitor lizard species has been advanced by
the examination of new voucher specimens and investi-
gations in the field.
Next to taxonomic and phylogenetic studies on the
Varanidae, those focusing on conservation particularly of
the Indo-Australian realm remain scarce. A summary of
threats monitor lizards are exposed to in this region, cur-
©OZFMK
128 André Koch et al.
rent conservation studies and measures in place, and the
conservation status of all Indo-Australian species will be
outlined in detail elsewhere.
METHODS
In the present paper, we compiled all monitor lizard taxa
that were published after BOhme (2003). This includes al-
so such names where the taxonomic status has changed.
We basically follow the format of this author, which has
earlier been used by Mertens (1963).
The synonymy list of each taxon starts with the original
citation and is then arranged chronologically with the
source of the respective name and its type locality.
Chresonyms are generally not included with the excep-
tion of names with a changed taxonomic status exempli-
fied by subspecies names, that were elevated to species
level or when a new species is separated from a long re-
cognized species. In these cases, the taxon name and the
author(s) are separated by a “—*. In addition, type speci-
mens for valid taxa are provided, if available. Collection
acronyms are as follows: BMNH = British Museum of
Natural History, London, UK; KU = Kansas University,
Museum of Natural History, Lawrence, USA; MNHN =
Muséum national d’Histoire naturelle, Paris, France;
MSNG = Museo Civico die Storia Naturale di Genova Gi-
acomo Doria, Genova, Italy; MZB = Museum Zoologicum
Bogoriense, Bogor, Indonesia; NMW = Naturhistorisches
Museum Wien, Vienna, Austria; PNM = Philippine Na-
tional Museum, Manila, Philippines; RMNH = National
Natural History Museum Naturalis, Leiden, Netherlands;
SMF = Naturmuseum Senckenberg, Frankfurt, Germany;
USNM = National Museum of Natural History, Washing-
ton, USA; WAM = Western Australian Museum, Perth,
Australia, ZFMK = Zoologisches Forschungsmuseum
Alexander Koenig, Bonn, Germany; ZMA = Zoological
Museum, University of Amsterdam, Netherlands; ZMB =
Museum fiir Naturkunde, Berlin, Germany; ZMUC = Zo-
ological Museum, University of Copenhagen, Denmark.
Update of the checklist of extant monitor lizards by
Bohme (2003)
Subgenus Philippinosaurus Mertens, 1959
Varanus bitatawa Welton, Siler, Bennett, Diesmos,
Duya, Dugay, Rico, van Weerd & Brown, 2010
2010 Varanus bitatawa Welton, Siler, Bennett, Diesmos,
Duya, Dugay, Rico, van Weerd & Brown, Biol. Lett., 6:
654. — Type locality: Base of the San Ildefonso Peninsu-
Bonn zoological Bulletin 57 (2): 127-136
la, Sitio Casapsipan, Barangay Casiguran, Municipality of
Casiguran, Aurora Province, Luzon Island, Philippines.
2008 Varanus olivaceus — Eidenmiller & Philippen (in
part), Terralog, 6: 103.
Type specimens: Holotype PNM 9719 (formerly KU
320000), paratypes KU 322188 and PNM 9008.
Distribution: Northern Luzon, Philippines.
Remark: This species was recently separated from V. oli-
vaceus based on minor genetic variation, morphological
differences and biogeographic evidence (Welton et al.
2010).
Subgenus Soterosaurus Ziegler & Béhme, 1997
Varanus s. salvator (Laurenti, 1768)
1768 Stellio salvator Laurenti, Synops. Rept.: 56. — Type
locality: Sri Lanka.
1758 Lacerta monitor part. Linnaeus, Syst. nat., 10 (1):
201. — Type locality: In Indiis (nomen rejectum accord-
ing to ICZN 1959, Opinion 540).
1947 Varanus salvator kabaragoya Deraniyagala, Proc.
3rd ann. Sess. Ceylon Assoc. Sci., 2 (Abstr.): 12. — Type
locality: Ceylon (= Sri Lanka).
Type specimen: Neotype ZFMK 22092, designated by
Koch et al. (2007).
Distribution: Sri Lanka.
Remark: Until recently the nominotypic subspecies had
the widest distribution range within the widespread V. sal-
vator complex. Due to the revalidation of the subspecies
Vs. macromaculatus from continental Southeast Asia, the
nominotypic subspecies is now restricted to Sri Lanka.
Varanus salvator macromaculatus Deraniyagala, 1944
1944 Varanus salvator macromaculatus Derantyagala,
Spol. Zeyl. 24: 60. — Type locality: Siam (= Thailand).
1802 Tupinambis elegans Daudin (in part), Hist. nat. Rept.,
3: 36. — Type locality: Surinam.
1831 Tupinambis exilis Gray in Griffith, Anim. Kingd., 9:
25. — Type locality: India (nomen dubium, fide Koch et
al. 2007).
©ZFMK
Update of B6hme’s (2003) checklist of monitor lizards 129
1834 Varanus vittatus Lesson in Bélanger, Voyage Ind.
Orient. Zool.: 307. — Type locality: Indian subcontinent
and islands at the mouth of the Ganges River (nomen du-
bium fide Koch et al. 2007).
1842 Varanus binotatus Blyth, J. asiat. Soc. Bengal, 11:
867 (Lapsus fide Mertens 1942).
1942 Lacertus tupinambis Mertens (in part, non Lacépede,
1788) Abh. Senckb. Naturf. Ges., 466: 245. — Type loca-
lity: unknown (Lapsus fide Brygoo 1987).
1947 Varanus salvator nicobariensis Deraniyagala, Proc.
3rd ann. Sess. Ceylon Assoc, Sci., 2, Abstr.: 12. — Type
locality: Tillanchong, Nicobar Islands.
1987 Varanus salvator komaini Nutphand, J. Thai. Zool.
Center, 2 (15): 51. — Type locality: Sea shore areas and
small islands in south western Thailand.
2007 Varanus salvator macromaculatus — Koch, Auliya,
Schmitz, Kuch & Bohme, Mertensiella, 16: 136.
Type specimens: Lectotype MNHN 871, paralectotype
MNHN 1884.77, designated by Koch et al. (2007).
Distribution: Thailand, Peninsula Malaysia, Vietnam,
southern China, Hainan, Sumatra, and Borneo and small-
er off-shore islands.
Remark: This subspecies of V. salvator was recently res-
urrected from the synonymy of the nominotypic sub-
species which, due to differences in morphological char-
acters and colour pattern, had to be restricted to Sri Lan-
ka (Koch et al. 2007). At the same time, the melanistic tax-
on komaini from Thailand was identified as a junior syn-
onym of V. s. macromaculatus in the absence of morpho-
logical differences except for the lack of a light colour pat-
tern. Therefore, the remaining subspecies of V. salvator
are: Vs. salvator, V. s. macromaculatus, V. s. andamanen-
sis, and V. s. bivittatus (Koch et al. 2007).
Varanus cumingi Martin, 1838
1838 Varanus cumingi Martin, Proc. Zool. Soc. London
1838: 69. — Type locality: Mindanao, Philippines.
1942 Varanus (Varanus) salvator cumingi— Mertens, Abh.
Senckb. Naturf. Ges., 466: 256.
2007 Varanus (Soterosaurus) cumingi — Koch, Aultya,
Schmitz, Kuch & Bohme, Mertensiella, 16: 168.
Bonn zoological Bulletin 57 (2): 127-136
Distribution: Islands of the Greater Mindanao region (1.e.,
Mindanao, Samar, Leyte, and Bohol), Philippines.
Remark: Recently, % cumingi was demonstrated to be
specifically distinct from V. salvator (Koch et al. 2007).
The species was also shown to be polytypic and a new sub-
species was described from the northern islands within the
species range (Koch et al. 2010).
Varanus c. cumingi Martin, 1838
1838 Varanus cumingi Martin, Proc. Zool. Soc. London
1838: 69. — Type locality: Mindanao, Philippines.
1991 Varanus salvator cumingi — Gaulke (in part), Mer-
tensiella, 2: 154.
Type specimen: Lectotype BMNH 1946.8.31.5, designat-
ed by Koch et al. (2007).
Distribution: Restricted to Mindanao and off-shore islands,
Philippines.
Varanus cumingi samarensis Koch, Gaulke & Bohme,
2010 (Fig. 1D)
2010 Varanus cumingi samarensis Koch, Gaulke &
Bohme, Zootaxa, 2440: 19 — Type locality: San Augustin
near Gandara, Samar Island, Philippines.
1991 Varanus salvator cumingi — Gaulke (in part), Mer-
tensiella, 2: 161.
Type specimens: Holotype ZFMK 64713, paratype
ZFMK 64712.
Distribution: Samar, Bohol, and Leyte, Philippines.
Varanus marmoratus (Wiegmann, 1834)
1834 Hydrosaurus marmoratus Wiegmann, in Meyen,
Reise um die Erde, 3: 446. — Type locality: San Mat(h)eo
village or Talim Island, Laguna Bay, near Manila, Luzon,
Philippines.
1829 M[onitor| marmoratus Cuvier, Regne animal 2(2):
26. (nomen nudum fide Mertens 1942; Good et al. 1993).
1844 Monitor bivittatus philippensis Schlegel, Abb. Am-
phib.: x. — Type locality: Manila, Luzon.
©ZFMK
130 André Koch et al.
Fig. 1. Fig. 1: Some monitor lizards described after Bohme’s (2003) checklist and species where the taxonomic status has changed
since. A: Varanus boehmei Jacobs, 2003 (photo T. Ziegler); B: V. nuchalis, revalidated species status (photo M. Gaulke); C: V. to-
gianus, revalidated species status (photo A. Koch); D: V. cumingi samarensis Koch, Gaulke & Béhme, 2010 (photo M. Gaulke);
E: V. rasmusseni Koch, Gaulke & Bohme, 2010, juvenile paratype ZFMK 89391 (photo A. Koch); F: V. lirungensis Koch, Arida,
Schmitz, Bohme & Ziegler, 2009 (photo M. Auliya); G: V. palawanensis Koch, Gaulke & Béhme, 2010 (photo I. Langlotz).
Bonn zoological Bulletin 57 (2): 127-136 ©ZFMK
Update of BGhme’s (2003) checklist of monitor lizards 131
1876 Varanus manilensis von Martens, PreukB. Exped. Os-
tas. Zool., 1: 196. (Lapsus fide Mertens 1942).
1942 Varanus (Varanus) salvator marmoratus — Mertens,
Abh. Senckb. Naturf. Ges., 466: 254.
1944 Varanus salvator philippinensis Deraniyagala, Spol.
Zeylan., 24: 61. — Type locality: Luzon.
1997 Varanus (Soterosaurus) salvator marmoratus —
Ziegler & Boéhme, Mertensiella, 8: 177.
2007 Varanus (Soterosaurus) marmoratus — Koch, Auliya,
Schmitz, Kuch & Boéhme, Mertensiella, 16: 161.
Type specimen: Lectotype ZMB 470, designated by
Mertens (1942).
Distribution: Restricted to Luzon and some off-shore is-
lands, Philippines.
Remark: Originally, Wiegmann (1834) based his descrip-
tion on two voucher specimens (Koch et al. 2007). The
second larger syntype, however, which should have para-
lectotype status, is missing (Good et al. 1993). Recently,
V. marmoratus was shown to represent a collective species
(Koch et al. 2010). The disjunct island populations of the
Greater Palawan region and the Sulu Archipelago were al-
located to two new species (see below).
Varanus nuchalis (Giinther, 1872) (Fig. 1B)
1872 Hydrosaurus nuchalis Ginther, Proc. Zool. Soc.
London, 1872: 145. — Type locality: Philippines.
1942 Varanus (Varanus) salvator nuchalis — Mertens, Abh.
Senckb. Naturf. Ges., 466: 258.
1997 Varanus (Soterosaurus) salvator nuchalis — Ziegler
& Bohme, Mertensiella, 8: 177.
2007 Varanus (Soterosaurus) nuchalis — Koch, Aultya,
Schmitz, Kuch & Bohme, Mertensiella, 16: 165.
Type specimen: Holotype BMNH 1946.9.1.17.
Distribution: Islands of Negros, Panay, Masbate, Ticao,
and Cebu, Philippines.
Remark: Despite a high variation in colour pattern, a re-
cent study could not document a correlation between
colour pattern and distribution (Koch et al. 2010).
Bonn zoological Bulletin 57 (2): 127-136
Varanus palawanensis Koch, Gaulke & Bohme, 2010
(Fig. 1G)
2010 Varanus palawanensis Koch, Gaulke & Boéhme,
Zootaxa, 2446: 33.—Type locality: Tabon, Palawan Island,
Philippines.
1942 Varanus (Varanus) salvator marmoratus — Mertens
(in part), Abh. Senckb. Naturf. Ges., 466: 254.
1991 Varanus salvator marmoratus — Gaulke (in part),
Mertensiella, 2: 154.
2007 Varanus (Soterosaurus) marmoratus — Koch, Aultya,
Schmitz, Kuch & Bohme (in part), Mertensiella, 16: 161.
Type specimens: Holotype SMF 73912, paratypes SMF
73914-15, BMNH 94.6.30.19, BMNH 94.6.30.20,
MNHN 1884-187, ZMUC E78, and ZFMK 89691 (for-
merly SMF 73913).
Distribution: Islands of Greater Palawan (Palawan, Bal-
abac and the Calamian Island group) and Sibutu Island
within the Sulu Archipelago, Philippines.
Remark: Traditionally, the populations of Palawan and ad-
jacent islands were allocated to V. marmoratus, but recent
investigations confirmed their morphological distinctness
(Koch et al. 2010).
Varanus rasmusseni Koch, Gaulke & Bohme, 2010 (Fig.
1E)
2010 Varanus rasmusseni Koch, Gaulke & Bohme, Zoo-
taxa, 2446: 28. — Type locality: Tarawakan, north of Ba-
tu-Batu, Tawi-Tawi Island, Sulu Archipelago, Philippines.
1992 Varanus salvator marmoratus — Gaulke (in part), Ha-
madryad, 17: 21.
2007 Varanus (Soterosaurus) cf. marmoratus — Koch, Au-
liya, Schmitz, Kuch & Bohme, Mertensiella, 16: 163.
Type specimens: Holotype ZMUC R42151, paratype
ZFMK 89391 (formerly ZMUC R42153).
Distribution: Only known from the type locality, but prob-
ably also on other islands of the Tawi-Tawi island group,
Philippines.
Remark: Recent morphological investigations demonstrat-
ed the specific distinctness of the Tawi-Tawi population
which was formerly assigned to X marmoratus (Koch et
al. 2010).
©ZFMK
132 André Koch et al.
Varanus togianus (Peters, 1872) (Fig. 1C)
1872 Monitor (Hydrosaurus) togianus Peters, Monatb.
Kon. Preuss. Akad. Wiss., 1872: 582. — Type locality: Tim-
otto, Togian (= Togean) Islands, Central Sulawesi, Indone-
sia.
1942 Varanus (Varanus) salvator togianus — Mertens, Abh.
Senckb. Naturf. Ges., 466: 253.
1997 Varanus (Soterosaurus) salvator togianus — Ziegler
& Bohme, Mertensiella, 8: 177.
2007 Varanus (Soterosaurus) togianus — Koch, Auliya,
Schmitz, Kuch & Bohme, Mertensiella, 16: 156.
Type specimens: Lectotype ZMB 7388, paralectotype
ZMB 7389, by designation of Mertens (1942).
Distribution: Sulawesi, except the northern peninsula.
Remark: Recent investigations revealed this endemic Su-
lawesi taxon to be specifically distinct from V. salvator
(Koch et al. 2007) and polytypic (Koch et al. unpubl. da-
ta).
Subgenus Euprepiosaurus Fitzinger, 1843
Varanus indicus species group
Varanus lirungensis Koch, Arida, Schmitz, Bohme &
Ziegler, 2009 (Fig. 1F)
2009 Varanus lirungensis Koch, Arida, Schmitz, Bohme
& Ziegler, Austr. J. Zool., 57: 33. — Type locality: near
Lirung, Salibabu Island, Talaud Islands, Indonesia.
1915 Varanus indicus — de Rooj (in part), Rept. Indo-Aus-
tr. Arch., 1: 149.
1942 Varanus (Varanus) indicus indicus — Mertens (in
part), Abh. Senckb. Naturf. Ges., 466: 263.
Type specimens: Holotype MZB Lac. 5178, paratypes
MZB Lac. 5176-77, 5179-80, ZFMK 87587 (formerly
ZMA 15411a), ZMA 15411b.
Distribution: Only known from the type locality.
Remark: V. lirungensis represents the most north-western
member of the V. indicus species group (Koch et al. 2009).
Bonn zoological Bulletin 57 (2): 127-136
Varanus obor Weijola & Sweet, 2010
2010 Varanus obor Weijola & Sweet, Zootaxa, 2434: 18.
— Type locality: Soela-Bési (= Sanana Island), Sula Is-
lands, Moluccas, Indonesia.
Type specimen: Holotype RMNH 7225.
Distribution: Only known from the type locality.
Remark: V. obor represents the latest discovery of a mem-
ber of the V. indicus species group. Nothing is known
about its conservation status (Weijola & Sweet 2010).
Varanus rainerguentheri Ziegler, Bbhme & Schmitz,
2007
2007 Varanus rainerguentheri Ziegler, Bohme & Schmitz,
Mitt. Mus. Nat.kd. Berlin, Suppl. 83: 110. — Type locali-
ty: Jailolo, Halmahera Island, Moluccas, Indonesia.
2005 Varanus cf. indicus — Bohme & Ziegler, Salaman-
dra, 41: 57.
Type specimens: Holotype ZFMK 85404, paratype
USNM 237438.
Distribution: Northern Moluccan islands of Halmahera,
Ternate, Tidore, Morotai, Bacan, Gebe and Obi.
Remark: Originally, V. rainerguentheri was only known
from its type locality (Ziegler et al. 2007a), but recent field
studies showed that this species occurs over a wider range
in the Moluccas (Weijola 2010).
Varanus zugorum Bohme & Ziegler, 2005
2005 Varanus zugorum Bohme & Ziegler, Salamandra,
41(1/2): 52. — Type locality: Kampung Pasir Putih, Jailo-
lo district, Halmahera Island, Moluccas, Indonesia.
Type specimen: Holotype USNM 237439.
Distribution: Only known from the type locality.
Remark: V. zugorum appears to be the rarest or at least
known monitor lizard of all species described, known on-
ly from the holotype specimen. Recent field work on
Halmahera Island failed to record this secretive species
(Setiadi & Hamidy 2006; Weijola 2010; Awal Riyanto,
Bogor, pers. comm. viii.2010). Only one putative photo-
graph of a live specimen exists (see BOhme & Ziegler
2005).
©ZFMK
Update of B6hme’s (2003) checklist of monitor lizards 13
Varanus prasinus species group
Varanus beccarii (Doria, 1874)
1874 Monitor Beccarii Doria, Ann. Mus. Civ. Stor. Nat.
Genova, 6: 331.—Type locality: Wokam, Aru Islands, In-
donesia.
1942 Varanus (Odatria) prasinus beccarii — Mertens, Abh.
Senckb. Naturf. Ges., 466: 296.
2003 Varanus (Euprepiosaurus) prasinus beccarii —
Bohme, Zool. Verh., 341: 25.
2007 Varanus (Euprepiosaurus) beccarii — Ziegler,
Schmitz, Koch & Bohme, Zootaxa, 1472: 15.
Type specimens: Syntypes ZMB 7993, MSNG 28723.
Distribution: Restricted to the Aru Islands.
Remark: In the past, the taxon beccarii was considered a
subspecies of V. prasinus (e.g. Mertens 1942; Ziegler &
Bohme 1997). Recently, Ziegler et al. (2007b) demonstrat-
ed that V. beccarii is distinct from the latter species. The
species is potentially threatened by the international trade
in live specimens.
Varanus boehmei Jacobs, 2003 (Fig. 1A)
2003 Varanus boehmei Jacobs, Salamandra, 39(2): 66. —
Type locality: Waigeo Island, West Papua, Indonesia.
Type specimens: Holotype ZFMK 77837, paratypes
ZFMK 82826, ZFMK 84000, ZMA 21702 (formerly
ZFMK 79122) and three further specimens which were
still alive and will be deposited in ZFMK after their de-
mise.
Distribution: Only known from the type locality.
Remark: Due to its restricted distribution range and its ex-
ploitation for the international pet trade, Vv boehmei must
be considered threatened.
Varanus reisingeri Eidenmiller & Wicker, 2005
2005 Varanus reisingeri Eidenmiller & Wicker, Sauria,
27(1): 4. — Type locality: Insel Misol (= Misool Island)
off the west coast of West Papua, New Guinea, Indone-
sia.
Bonn zoological Bulletin 57 (2): 127-136
Ww
1942 Varanus (Odatria) prasinus prasinus — Mertens (in
part), Abh. Senckb. Naturf. Ges., 466: 292.
Type specimens: Holotype SMF 83679, the two paratypes
are still alive and will be deposited in SMF after their de-
mise (Bernd Eidenmiller, Frankfurt, pers. comm.
x11.2010).
Distribution: Only known from the type locality.
Remark: The taxonomic validity of this species remains
uncertain because diagnostic morphological characters
largely overlap with V. prasinus from New Guinea. As the
former species, V. reisingeri is also potentially threatened
by exploitation for the pet trade.
Subgenus Odatria Gray, 1838
Varanus bushi Aplin, Fitch & King, 2006
2006 Varanus bushi Aplin, Fitch & King, Zootaxa, 1313:
24. — Type locality: Marandoo, Western Australia (22°
S75 S08 4E):
1980 Varanus caudolineatus — Storr (in part), Rec. West.
Austr. Mus., 8: 250.
Type specimens: Holotype WAM R108999, paratypes
WAM R54230, WAM R56834, and WAM R62171.
Distribution: Endemic to the Pilbara region of Western
Australia.
Remark: V. bushi was described as morphologically and
genetically distinct from its closest relatives V. caudoline-
atus and V. gilleni. All three Australian dwarf monitor
lizards display complex patterns of sexual dimorphism
(Aplin et al. 2006).
Subgenus: Incertae sedis
Varanus spinulosus Mertens, 1941
1941 Varanus indicus spinulosus Mertens, Senckenber-
giana, 23: 269. — Type locality: Georgs-Insel (= St. George
Island or San Jorge Island), near Santa Isabel (= Ysabel)
Island, Solomon Islands.
1942 Varanus (Varanus) indicus spinulosus — Mertens,
Abh. Senckb. Naturf. Ges., 466: 271.
1994 Varanus spinulosus — Sprackland, Herpetofauna, 24
(2): 34.
©ZFMK
134 André Koch et al.
1997 Varanus (Euprepiosaurus) spinulosus — Ziegler &
Bohme, Mertensiella, 8: 14.
2007 Varanus (subgen. inc. sed.) spinulosus — Bohme &
Ziegler, Mertensiella, 16: 105.
Type specimen: Holotype NMW 23387 (formerly NMW
3709).
Distribution: San Jorge and Santa Isabel Islands, Solomon
Islands, and Bougainville Island, Papua New Guinea.
Remark: For almost 50 years, this rare monitor lizard
species was only known from the holotype (Sprackland
1993). The former collection number of the type was orig-
inally assigned by Mertens (1941, 1942) and still applied
by de Lisle (2009). Tiedemann et al. (1994) and B6hme
& Koch (2010) provided the current number. Sprackland
(1994) elevated spinulosus to full species status. Recent-
ly, the distribution range of V. spinulosus was extended,
when the species was newly recorded from Bougainville
Island and its occurrence was confirmed on the island of
Santa Isabel (BOhme & Ziegler 2007; Dwyer 2008).
VK. spinulosus was formerly allocated to the V. indicus
species group of the subgenus Euprepiosaurus (see Ziegler
& Bohme 1997), but a new monotypic subgenus is dis-
cussed based on new genital morphological findings
(Bohme & Ziegler 2007).
DISCUSSION
In total, ten new species and one new subspecies were in-
troduced to science since BOhme’s (2003) checklist. Nine
of the species (1.e., 90%) and the subspecies were de-
scribed from islands of the Indo-Australian Archipelago.
Only one new species, V. bushi, was recently identified
from Western Australia (Aplin et al. 2006). In addition,
five taxa (beccarii, cumingi, marmoratus, nuchalis, and
togianus) were re-elevated to full species status due to
morphological (e.g., scale counts, morphometrics, colour
pattern) and/or genetical idiosyncrasies, thus bringing the
global diversity to 73 (including 21 subspecies). This re-
presents an increase in species diversity of 20% since
2003. Particularly 2010 has been a very productive year
for the increase of monitor lizard diversity. Four new
species and one new subspecies were described from In-
donesia and the Philippines within the first half of 2010
(Koch et al. 2010; Weijola & Sweet 2010; Welton et al.
2010).
Descriptions of new monitor lizard species since 2003
mainly refer to two different taxonomic groups, the South-
Bonn zoological Bulletin 57 (2): 127-136
east Asian and Indo-Australian subgenera Soferosaurus
and Euprepiosaurus, with two and six new species, respec-
tively. In addition, the taxonomic status of several mem-
bers of the subgenus Soferosaurus has changed. While this
subgenus was hitherto considered monotypic with V. sal-
vator being the only, albeit polytypic species with eight
recognized subspecies (B6hme 2003), the Philippine sub-
species cumingi, marmoratus, and nuchalis, and togianus
from Sulawesi were re-elevated to their original species
status (Koch et al. 2007), thus resulting in a species com-
plex of closely related allies. Additionally, one subspecies
(V. salvator macromaculatus) of the Southeast Asian wa-
ter monitor lizard was revalidated, whereas the younger
melanistic taxon komaini was synonymized with the for-
mer (Koch et al. 2007).
With currently 22 recognized species, the subgenus Eu-
prepiosaurus has displaced the Australian Odatria as the
most species-rich subgenus of varanids. Within Eupre-
piosaurus, the new species descriptions are unevenly dis-
tributed over the two species groups involved, viz. the Pa-
cific monitors around V. indicus and the tree monitors
around V. prasinus, respectively. The latter group experi-
enced only two new species descriptions (1.e., v boehmei
and V. reisingeri) and currently comprises nine allopatric
species from New Guinea and its offshore islands. On the
other hand, four new species were added to the V. indicus
species group leading to a total of 13 recognized species,
at least four of which occur in sympatry on New Guinea
and Halmahera in the northern Moluccas. Among these
recently described Pacific monitor lizard species, next to
morphologically cryptic taxa, such as V. lirungensis or V.
rainerguentheri, there are also strikingly different species
with idiosyncratic features in morphology and colour pat-
tern, such as the melanistic V. obor and the silver-coloured
V. zugorum. Five years after its formal description and de-
spite repeated field trips to the northern Moluccas (Setia-
di & Hamidy 2006; Weijola 2010; Awal Riyanto, Bogor,
pers. comm. viti.2010), the latter species is still only
known from the holotype specimen and has thus to be re-
garded the rarest and at least known varanid species.
Bohme (2003) already recognized a taxonomic trend to-
wards a reduction of polytypic monitor lizard species by
the elevation of nominal subspecies to species rank. Cer-
tainly, this trend still continues as seen in the V. salvator
complex (Koch et al. 2007). The description of a new sub-
species of V. cumingi from the Philippines (Koch et al.
2010), however, demonstrates that a distinction is still
made between the degree of morphological (e.g., morpho-
metrics and scalation features) and molecular differenti-
ation (i.e. characteristics of the full species category) and
mere geographically correlated differences in colour pat-
tern (i.e. diagnostic features of subspecies).
©ZFMK
Update of B6hme’s (2003) checklist of monitor lizards 135
CONCLUSIONS
Because taxonomy is a dynamic discipline, further
changes and additions to the list of extant monitor lizards
are to be expected in the future. This will include new
species descriptions — either real discoveries or by the
splitting of already recognized species — as well as a
change of the taxonomic status. Therefore, we are aware
that this updated checklist can only represent the latest
state of art and may already be outdated by the time of
publication. In terms of conservation purposes, it is essen-
tial to refer to these most recent checklists, and with the
increase of monitor lizard diversity especially in the In-
do-Australian realm, there is definitely a need to estab-
lish user-friendly identification tools for a vertebrate group
globally sought after within the international pet and rep-
tile leather trade.
We do wish that our contribution will serve as a useful
supplement to the checklist of the living monitor lizards
of the world by B6hme (2003) for all those who are in-
terested in or concerned with the diversity of monitor
lizards.
Acknowledgments. The fact, that Wolfgang Bohme was in-
volved in most of the recent taxonomic changes and additions
to the global checklist of varanids together with the naming of
one new species, viz. V. boehmei, after him, reflect his interna-
tionally renowned competence and eminent position in syste-
matic monitor lizard research. On the occasion of his retirement,
we hereby wish to dedicate this contribution to Professor Dr.
Wolfgang Bohme, Vice Director, Head of the Vertebrate Depart-
ment and Curator of Herpetology for 39 years at the Zoologi-
sches Forschungsmuseum Alexander Koenig in Bonn, Germany.
We are deeply indebted to Wolfgang Béhme, who initiated and
supervised our careers related to varanid research.
Furthermore, we thank Gunter KG6hler (SMF, Frankfurt), Bernd
Eidenmiiler (Frankfurt), and Manfred Reisinger (Landshut), for
information on preserved and live type specimens in their care.
Awal Riyanto (MZB, Bogor) kindly shared his observations on
monitor lizards from the field. The helpful comments of two
anonymous referees improved an earlier version of this contri-
bution.
REFERENCES
Aplin KP, Fitch AJ, King DJ (2006) A new species of Varanus
Merrem (Squamata: Varanidae) from the Pilbara region of
Western Australia, with observations on sexual dimorphism
in closely related species. Zootaxa 1313: 1-38
Bohme W (2003) Checklist of the living monitor lizards of the
world (family Varanidae). Zoologische Verhandelingen 341:
3-43
Bohme W, Koch A (2010) On the type selection and re-typifi-
cation of two monitor lizard taxa (Squamata: Varanidae): Mon-
itor bivittatus celebensis Schlegel, 1844 and Monitor korden-
sis Meyer, 1874; with some comments and corrections on oth-
er name-bearing type specimens. Zootaxa 2440: 60-68
Bonn zoological Bulletin 57 (2): 127-136
Bohme W, Ziegler T (2005) A new monitor lizard from Halma-
hera, Moluccas, Indonesia (Reptilia: Squamata: Varanidae).
Salamandra 41(1/2): 51-59
Bohme W, Ziegler T (2007) Notes on the Distribution, Diet, He-
mipenis Morphology and Systematics of Varanus spinulosus
Mertens, 1941. Pp. 100-108 in: Horn H-G, B6hme W, Krebs
U (eds.) Advances in Monitor Research III. Mertensiella 16,
DGHT, Rheinbach
Brygoo E-R (1987) Les Types de Varanidés (Reptiles, Sauriens)
du Muséum national d’ Histoire naturelle Catalogue critique.
Bulletin du Muséum national d’Histoire naturelle 9: 21—38
Dwyer Q (2008) Field Observations on Varanus spinulosus. Bia-
wak 2: 162—168
Eidenmiiller B, Wicker R (2005) Eine weitere neue Waranart aus
dem Varanus prasinus-Komplex von der Insel Misol, Indone-
sien. Sauria 27(1): 3-8
Good DA, Bauer AM, Giinther R (1993) An annotated Type Cat-
alogue of the anguimorph Lizards (Squamata: Anguidae, Helo-
dermatidae, Varanidae, Xenosauridae) in the Zoological Mu-
seum, Berlin. Mitteilungen des Zoologischen Museum Berlin
69: 45-56
ICZN (1959) Opinion 540. Protection under the plenary power
of the specific names bengalensis Daudin, [1802], as published
in the combination Tupinambis bengalensis, and salvator Lau-
renti 1768, as published in the combination Sve/lio salvator.
Opinions and Declaration of the international Commission of
zoological Nomenclature 20: 77-85
Jacobs H J (2003) A further new emerald tree monitor lizard of
the Varanus prasinus species group from Waigeo, West Irian
(Squamata: Sauria: Varanidae). Salamandra 39 (2): 65—74
Koch A, Arida E, Schmitz A, Bohme W, Ziegler T (2009) Re-
fining the polytypic species concept of mangrove monitors
(Squamata: Varanus indicus group): a new cryptic species
from the Talaud Islands, Indonesia, reveals the underestimat-
ed diversity of Indo-Australian monitor lizards. Australian
Journal of Zoology 57: 29-40
Koch A, Auliya M, Schmitz A, Kuch U, Bohme W (2007) Mor-
phological Studies on the Systematics of South East Asian Wa-
ter Monitors (Varanus salvator Complex): Nominotypic Pop-
ulations and Taxonomic Overview. In: Horn H-G, BOhme W
and Krebs U (eds.) Advances in Monitor Research III. Merten-
siella 16: 109-180
Koch A, Gaulke M, BOhme W (2010) Unravelling the undere-
stimated diversity of Philippine water monitor lizards (Squa-
mata: Varanus salvator complex), with the description of two
new species and a new subspecies. Zootaxa 2446: 1-54
Koch A, Auliya M, Schmitz A, Ziegler T, Bohme W (in prep.)
The Monitor Lizards (Squamata: Varanidae) of Southeast Asia
and the Indo-Australian Archipelago: Updated Checklist and
Key, with notes on Taxonomy, Biogeography and Conserva-
tion.
Mertens R (1941) Zwei neue Warane des Australischen Faunen-
gebietes. Senckenbergiana 23: 266-272
Mertens R (1942) Die Familie der Warane. Abhandlungen der
Senckenbergischen naturforschenden Gesellschaft 462: 1-116;
465: 117-234; 466: 235-391
Mertens R (1959) Liste der Warane Asiens und der Indo-austra-
lischen Inselwelt mit systematischen Bemerkungen. Sencken-
bergiana biologica 40 (5/6): 221-240
Mertens R (1963) Liste der rezenten Amphibien und Reptilien:
Helodermatidae, Varanidae, Lanthanotidae. Pp. 1—26 in: Mer-
tens R, Hennig W (eds.) Das Tierreich. Walter de Gruyter &
Co., Berlin
Setiadi MI, Hamidy A (2006) Jenis-jenis herpetofauna di Pulau
Halmahera. Bogor, Indonesia: Museum Zoologicum Bogo-
©ZFMK
136 André Koch et al.
riense, Puslit Biologi Lembaga IImu Pengetahuan Indonesia
(LIPI), Jakarta
Sprackland RG (1993) Rediscovery of Solomon Islands moni-
tor lizard (Varanus indicus spinulosus) Mertens, 1941. Viva-
rium 4; 25—27
Sprackland RG (1994) Rediscovery and taxonomic review of
Varanus indicus spinulosus Mertens, 1941. herpetofauna 24:
33-39
Sweet SS, Pianka ER (2007) Monitors, Mammals and Wallace’s
Line. Pp. 79-99 in: Horn H-G, B6bhme W & Krebs U (eds.)
Advances in Monitor Research III. Mertensiella, 16.
Tiedemann F, Haupl M, Grillitsch H (1994) Katalog der Typen
der Herpetologischen Sammlung nach dem Stand vom 1. Jan-
ner 1994. Teil II. Reptilia. Naturhistorisches Museum Wien,
Wien
Weijola V (2010) Geographic distribution and habitat use of
monitor lizards of the North Moluccas. Biawak 4: 7-23
Weijola V, Sweet SS (2010) A new melanistic species of mon-
itor lizard (Reptilia: Squamata: Varanidae) from Sanana Island,
Indonesia. Zootaxa 2434: 17-32
Welton LJ, Siler CD, Bennett D, Diesmos A, Duya MR, Dugay
R, Rico ELB, van Weerd M, Brown RM (2010) A spectacu-
lar new Philippine monitor lizard reveals a hidden biogeo-
graphic boundary and a novel flagship species for conserva-
tion. Biology Letters 6: 654-658
Bonn zoological Bulletin 57 (2): 127-136
Wiegmann AFA (1834) Amphibien. Pp. 436-522 in: Meyen FJF
(ed.) Reise um die Erde ausgefiihrt auf dem K6niglich Preus-
sischen Seehandlungsschiffe Prinzess Luise, comandiert von
Capitain W. Wendt, in den Jahren 1830, 1831 und 1832. Drit-
ter Theil. Zoologischer Bericht. Sander’sche Buchhandlung,
C. W. Eichhoff, Berlin
Ziegler T, Bohme W (1997) Genitalstrukturen und Paarungsbio-
logie bei squamaten Reptilien, speziell den Platynota, mit Be-
merkungen zur Systematik. Mertensiella 8: 3-207
Ziegler T, Bohme W, Schmitz A (2007a) A new Varanus (Rep-
tilia, Squamata, Varanidae) from Halmahera, Moluccas: The
eleventh species of the V. indicus group. Mitteilungen aus Mu-
seum ftir Naturkunde in Berlin, Zoologische Reihe Supple-
ment 83: 109-119
Ziegler T, Schmitz A, Koch A, B6hme W (2007b) A review of
the subgenus Euprepiosaurus of Varanus (Squamata:
Varanidae): morphological and molecular phylogeny, distri-
bution and zoogeography, with an identification key for the
members of the V. indicus and the V. prasinus species groups.
Zootaxa 1472: 1-28
Received: 04. VII.2010
Accepted: 21.X.2010
©ZFMK
Bonn zoological Bulletin Volume 57
Issue 2 pp. 137-147
Bonn, November 2010
New discoveries of amphibians and reptiles from Vietnam
Thomas Ziegler! & Truong Quang Nguyen23
1 Cologne Zoo, Riehler StraBe 173, D-50735 Cologne, Germany; E-mail: [email protected]
2 Institute of Ecology and Biological Resources, 18 Hoang Quoc Viet, Hanoi, Vietnam;
E-mail: [email protected]
3 Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany
Abstract. We provide a list of 21 new amphibian and reptilian species and subspecies discoveries from Vietnam, includ-
ing one new snake genus, published after the comprehensive overview by Nguyen et al. (2009). The new herpetofauna
representatives are introduced inclusive of the original description, type locality, English and Vietnamese names, as well
as current distribution.
Key words. Vietnam, herpetofauna, new species.
INTRODUCTION
Although Vietnam has one of the world’s richest amphib-
ian and reptilian fauna, as revealed particularly through
surveys by Vietnamese scientists and their international
collaborators during the past quarter century, the study of
its herpetofauna was long overshadowed by research in
India, China, and the East Indies (Adler 2009). The first
significant summary of the Vietnamese herpetofauna was
written by Morice (1875), in which 13 amphibians and 114
species of reptiles including the marine species were list-
ed. Ten years later, Tirant (1885) published a 104-pages
book containing 166 species of herpetofauna from Viet-
nam and Cambodia. Subsequently, the following staff
members or associates of the Muséum d’Histoire Na-
turelle, Paris, published specific studies of Vietnamese am-
phibians and reptiles: Léon Vaillant (1834-1914), Francois
Mocquard (1834-1917), Jacques Pellegrin (1873-1944),
Paul Chabanaud (1876-1959), Fernand Angel
(1881-1950), and René Bourret (1884-1957), who was
the only one of the afore mentioned zoologists who ever
set foot in Vietnam (Adler 2009).
It was René Bourret, originally a geologist, who became
the leading authority on Vietnamese herpetofauna. From
1927 until 1947 he published a series of papers and books
Bonn zoological Bulletin 57 (2): 137-147
of Indochinese and specifically on Vietnamese herpetol-
ogy. Besides the publication of several identification man-
uals, he is most famous for a substantial series of mono-
graphs of Indochinese herpetology, which are to date the
most important background on the subject (Bourret 1936a,
b, 1941, 1942). In total, René Bourret reported of 177
lizard taxa (1.e., species and subspecies), 245 snake taxa,
45 turtle taxa and 171 amphibian taxa for the Indochinese
region (Nguyen 2006).
Because of the French Indochina War, no remarkable her-
petological studies were undertaken in the period from
1946 to 1954. In 1954, when northern Vietnam attained
independence from France, Vietnamese herpetologists be-
gan to conduct herpetological field surveys predominant-
ly in northern Vietnam, and the first lists and keys to the
species of Vietnamese amphibians and reptiles were com-
piled by Dao (e.g., 1977, 1978, 1979, 1981, 1982), includ-
ing 363 species in total, but with inaccuracies. Another
noteworthy key to snakes of southern Vietnam was writ-
ten during the Second Indochina War, better known in the
West as Vietnam War, by Campden-Main (1970), who had
served several years as a medic with American forces sta-
tioned in Vietnam.
©ZFMK
138 Thomas Ziegler & Truong Quang Nguyen
The end of the Vietnam War in 1975 marked the begin-
ning of another period of biodiversity research in Vietnam
(Sterling et al. 2006). Thereafter, an increasing engage-
ment in herpetological field work mainly by Russian in-
stitutions was observable, which is still persistent. Even-
tually, in the last 30 years many international herpetolog-
ical cooperations emerged, which led to an enormous in-
crease in new records and species descriptions from Viet-
nam (see overview in Nguyen 2006). As a consequence,
the updated checklist by Nguyen et al. (2005) comprised
458 species, viz., 162 species of amphibians and 296
species of reptiles, which included more than 100 addi-
tional species compared with the previous checklist of the
herpetofauna of Vietnam by Nguyen & Ho (1996). Fur-
thermore, the most actual list (Nguyen et al. 2009) cov-
ers 12 additional species of amphibians and 64 addition-
al species of reptiles compared with Nguyen et al. (2005).
On the occasion of this Proceedings Volume addicted to
Professor Dr. Wolfgang Béhme, Vice Director, Head of
the Vertebrate Department and Curator of Herpetology at
the Zoological Research Museum Alexander Koenig,
Bonn, Germany, we provide a list of new amphibian and
reptilian discoveries from Vietnam that were published
subsequent to the comprehensive overview provided by
Nguyen et al. (2009). We would like to dedicate this pa-
per to Wolfgang Bohme, who supervised the PhD theses
of both authors (T. Ziegler: 1997-2000; T.Q. Nguyen
2007-2011) and thus decisively brought forward herpeto-
diversity research in Vietnam.
MATERIAL AND METHODS
We herein compiled species’ descriptions that were for-
mally published after the appearance of Nguyen et al.
(2009). We therefore followed the style and taxonomic
arrangement provided by the latter authors.
Abbreviations are as follows: AMNH = American Muse-
um of Natural History, New York, USA; AMS = Australian
Museum, Sydney, Australia; IEBR = Institute of Ecolo-
gy and Biological Resources, Hanoi, Vietnam; ITBCZ =
Institute of Tropical Biology, Collection of Zoology, Ho
Chi Minh City, Vietnam; LSUHC = La Sierra Universi-
ty, Herpetological Collection, La Sierra University, River-
side, California, USA; UNS = Zoological Collection of
the University of Natural Sciences, Ho Chi Minh City,
Vietnam; VNMN = Vietnam National Museum of Nature,
Hanoi, Vietnam; ZFMK = Zoologisches Forschungsmu-
seum Alexander Koenig, Bonn, Germany; ZISP = Zoo-
logical Institute, St. Petersburg, Russia; a.s.]. = above sea
level.
Bonn zoological Bulletin 57 (2): 137-147
LIST OF NEW SPECIES AND SUBSPECIES SINCE
NGUYEN ET AL. (2009)
Amphibia
Anura
Megophryidae
Leptolalax applebyi Rowley & Cao, 2009
Leptolalax applebyi J.J.L. Rowley & T.T. Cao, 2009, Zoo-
taxa 2198: 52.
Holotype: AMS R171703.
Type locality: Song Thanh Proposed Nature Reserve,
Phouc Son (Phuoc Son) District, Quang Nam Province,
Vietnam, 1,402 ma.s.l.
English name: Appleby’s Asian Toad.
Vietnamese name: Coc may ap-li-bai.
Distribution: This species is currently known only from
the type locality.
Ranidae
Odorrana geminata Bain, Stuart, Nguyen, Che & Rao,
2009
Odorrana geminata R.H. Bain, B.L. Stuart, T.Q. Nguyen,
J. Che & D.-Q. Rao, 2009, Copeia 2: 355.
Holotype: AMNH 163782.
Type locality: Mount Tay Con Linh II, Cao Bo Commune,
Vi Xuyen District, Ha Giang Province, Vietnam, 1,420 m
a.s.l.
English name: Geminated Cascade Frog.
Vietnamese name: Ech bam da hoa.
Distribution: This species (Fig. 1a) is currently known on-
ly from montane areas in northeastern Vietnam (Ha Gi-
ang and Cao Bang provinces) and southeastern Yunnan
Province, China.
©ZFMK
New amphibians and reptiles from Vietnam 139
Fig. 1.
Rhacophoridae
Theloderma lateriticum Bain, Nguyen & Doan, 2009
Theloderma lateriticum R.H. Bain, T.Q. Nguyen & K.V.
Doan, 2009, Zootaxa 2191: 60.
Holotype: AMNH 168757/IEBR A. 0860.
Type locality: Nam Tha Commune, Van Ban District, Lao
Cai Province, Vietnam, 1,300—1,400 m a.s.l.
English name: Brick-red Bug-eyed Frog.
Vietnamese name: Ech cay san do.
Distribution: This species (Fig. 1b) is currently known on-
ly from the type locality.
Bonn zoological Bulletin 57 (2): 137-147
a) Odorrana geminata from Ha Giang Province, Photo T.Q. Nguyen; b) Theloderma lateriticum from Lao Cai Province,
Photo T.Q. Nguyen; c) Leiolepis ngovantrii from Ba Ria—Vung Tau Province, Photo L.L. Grismer; and d) Pseudocalotes ziegleri
from Kon Tum Province, Photo C.T. Ho.
Reptilia
Squamata
Sauria
Agamidae
Leiolepis ngovantrii Grismer & Grismer, 2010
Leiolepis ngovantrii J.L. Grismer & L.L. Grismer, 2010,
Zootaxa 2433: 52.
Holotype: LSUHC 9234.
Type locality: Binh Chau—Phuoc Buu Nature Reserve,
Xuyen Moc District, Ba Ria—Vung Tau Province, Vietnam,
30 ma.s.l.
©OZFMK
140 Thomas Ziegler & Truong Quang Nguyen
Fig. 2.
English name: Ngovantri’s Butterfly Lizard.
Vietnamese name: Nhong cat ngo van tri.
Distribution: This species (Fig. 1c) is currently known on-
ly from Vietnam (Ba Ria—Vung Tau Province).
Pseudocalotes ziegleri Hallermann, Nguyen, Orlov &
Ananjeva, 2010
Pseudocalotes ziegleri J. Hallermann, T.Q. Nguyen, N.
Orlov & N. Ananjeva, 2010, Russ. J. Herpetol. 17(1): 32.
Holotype: IEBR 330.
Type locality: Nuoc Ka forest, near Mang Canh, Kon
Plong District, Kon Tum Province, Vietnam, ca. 1,200 m
a.s.l.
English name: Ziegler’s Tree Lizard.
Vietnamese name: Nhong zig-lo.
Distribution: This species (Fig. 1d) is currently known on-
ly from Vietnam (Kon Tum Province).
Bonn zoological Bulletin 57 (2): 137-147
a) Cnemaspis psychedelica from Ca Mau Province, Photo L.L. Grismer; b) Cyrtodactylus cattienensis from Dong Nai
Province, Photo P. Geissler; c) Cyrtodactylus roesleri from Quang Binh Province, Photo T. Ziegler; and d) Dixonius aaronbaueri
from Ninh Thuan Province, Photo T.V. Ngo.
Remarks: Specimens identified as Pseudocalotes floweri
from Kon Tum Province (Bain et al. 2007) were subse-
quently re-identified as P. ziegleri by Hallermann et al.
(2010).
Gekkonidae
Cnemaspis psychedelica Grismer, Ngo & Grismer, 2010
Cnemaspis psychedelica L.L. Grismer, T.V. Ngo & J.L.
Grismer, 2010, Zootaxa 2352: 48.
Holotype: UNS 0444.
Type locality: Hon Khoai Island, Ngoc Hien District, Ca
Mau Province, Vietnam.
English name: Psychedelic Gecko.
Vietnamese name: Tac ke duoi vang.
Distribution: This species (Fig. 2a) is currently known on-
ly from the type locality.
©OZFMK
New amphibians and reptiles from Vietnam 14]
Cyrtodactylus cattienensis Geissler, Nazarov, Orlov,
Bohme, Phung, Nguyen & Ziegler, 2009
Cyrtodactylus cattienensis P. Geissler, R. Nazarov, N.L.
Orlov, W. Bohme, T.M. Phung, T.Q. Nguyen & T. Ziegler,
2009, Zootaxa 2161, 21.
Holotype: IEBR A.0856.
Type locality: Cat Tien National Park, Dong Nai Province,
Vietnam, 120 m a.s.1.
English name: Cattien Bent-toed Gecko.
Vietnamese name: Thach sung ngon cat tien.
Distribution: This species (Fig. 2b) is currently known on-
ly from Vietnam (Ba Ria-Vung Tau and Dong Nai
provinces).
Cyrtodactylus roesleri Ziegler, Nazarov, Orlov, Nguyen,
Vu, Dang, Dinh & Schmitz, 2010
Cyrtodactylus roesleri T. Ziegler, R. Nazarov, N. Orlov,
T.Q. Nguyen, T.N. Vu, K.N. Dang, T.-H. Dinh & A.
Schmitz, 2010, Zootaxa, 2413: 24.
Holotype: ZFMK 89377.
Type locality: Phong Nha—Ke Bang National Park, Minh
Hoa District, Quang Binh Province, Vietnam.
English name: Roesler’s Bent-toed Gecko.
Vietnamese name: Thach sung ngon ro-x-lo.
Distribution: This species (Fig. 2c) is currently known on-
ly from the type locality.
Cyrtodactylus yangbayensis Ngo & Chan, 2010
Cyrtodactylus yangbayensis T.V. Ngo & K.O. Chan,
Zootaxa, 2504: 48.
Holotype: UNS 0476.
Type locality: Yang Bay Waterfall, Dien Khanh District,
Khanh Hoa Province, southern Vietnam, 500-600 m a.s.1.
English name: Yangbay Bent-toed Gecko.
Vietnamese name: Than lan chan ngon yang bay.
Bonn zoological Bulletin 57 (2): 137-147
Distribution: This species is currently known only from
the type locality in Khanh Hoa Province.
Dixonius aaronbaueri Ngo & Ziegler, 2009
Dixonius aaronbaueri T.V. Ngo & T. Ziegler, 2009,
Zoosyst. Evol., 85(1): 119.
Holotype: UNS 0284.
Type locality: Binh Tien Forest Station, Ninh Hai District,
Nui Chua National Park, Ninh Thuan Province, southern
Vietnam, 4-5 m a.s.1.
English name: Aaron Bauer’s Leaf-toed Gecko.
Vietnamese name: Than lan chan la a-ron-bau-o.
Distribution: This species (Fig. 2d) is currently known on-
ly from the type locality.
Gekko canhi Rosler, Nguyen, Doan, Ho, Nguyen &
Ziegler, 2010
Gekko canhi H. Résler, T.Q. Nguyen, K.V. Doan, C.T. Ho,
T.T. Nguyen & T. Ziegler, 2009, Zootaxa 2329: 57.
Holotype: IEBR A.0910.
Type locality: Huu Lien, Huu Lung, Lang Son Province,
North Vietnam.
English name: Canh’s Gecko.
Vietnamese name: Tac ke canh.
Distribution: This species (Fig. 3a) is currently known on-
ly from northern Vietnam (Lang Son and Lao Cai
provinces).
Gekko russelltraini Ngo, Bauer, Wood & Grismer, 2009
Gekko russelltraini T.V. Ngo, A.M. Bauer, P.L. Jr. Wood
& J.L. Grismer, 2009, Zootaxa 2238: 34.
Holotype: UNS 0293.
Type locality: Chua Chan Mountain, Suoi Cat Commune,
Xuan Loc District, Dong Nai Province, Vietnam, ca. 100
m a.s.l.
English name: Russell Train’s Marble Gecko.
©ZFMK
142 Thomas Ziegler & Truong Quang Nguyen
Fig. 3.
a) Portrait of preserved Gekko canhi from Lang Son Province, Photo T. Ziegler; b) Gekko russelltraini from Dong Nai
Province, Photo T.V. Ngo; c) Gekko takouensis from Binh Thuan Province, Photo S.N. Nguyen; and d) Gekko vietnamensis from
An Giang Province, Photo S.N. Nguyen.
Vietnamese name: Than lan da ru-xen-tren.
Distribution: This species (Fig. 3b) is currently known on-
ly from Vietnam (Dong Nai Province).
Gekko takouensis Ngo & Gamble, 2010
Gekko takouensis T.V. Ngo & T. Gamble, 2010, Zootaxa
2346: 18.
Holotype: UNS 0491.
Type locality: Ta Kou Mountain, Ham Thuan Nam Dis-
trict, Binh Thuan Province, Vietnam, 425 m a.s.l.
English name: Takou Marbled Gecko.
Vietnamese name: Than lan da ta kou.
Distribution: This species (Fig. 3c) is currently known on-
ly from the type locality.
Bonn zoological Bulletin 57 (2): 137-147
Gekko vietnamensis Nguyen, 2010
Gekko vietnamensis S.N. Nguyen, 2010, Zootaxa 2501:
55:
Holotype: ITBCZ 667.
Type locality: Tuc Dup Hill, An Giang Province, south-
ern Vietnam, 43 m a.s.1.
English name: Vietnam Gecko
Vietnamese name: Tac ke viet nam.
Distribution: This species (Fig. 3d) is currently known on-
ly from the type locality.
Scincidae
Scincella apraefrontalis Nguyen, Nguyen, BOhme &
Ziegler 2010
Scincella apraefrontalis T.Q. Nguyen, S.V. Nguyen, W.
Bohme & T. Ziegler, 2010, Folia. Zool., 59(2): 116.
©ZFMK
New amphibians and reptiles from Vietnam 143
Holotype: IEBR A.0832.
Type locality: Huu Lien Nature Reserve, Huu Lung Dis-
trict, Lang Son Province, Vietnam, ca. 200 m a.s.].
English name: Huulien Ground Skink.
Vietnamese name: Than lan co huu lien.
Distribution: This species is only known from Lang Son
Province, northeastern Vietnam.
Tropidophorus boehmei Nguyen, Nguyen, Schmitz,
Orlov & Ziegler, 2010
Tropidophorus boehmei T.Q. Nguyen, T.T. Nguyen, A.
Schmitz, N.L. Orlov & T. Ziegler, 2010, Zootaxa 2439:
D7,
Holotype: VNMN 822.
Type locality: Hoang Lien Mountain, near Ban Khoang,
Sa Pa District, Lao Cai Province, northern Vietnam,
1,200—1,300 m a.s.l.
English name: Boehme’s Water Skink
Vietnamese name: Than lan tai boe-me
Distribution: This species (Fig. 4a) is currently known on-
ly from Hoang Lien Mountain in Sa Pa and Van Ban dis-
tricts, Lao Cai Province, Vietnam.
Serpentes
Colubridae
Calamaria gialaiensis Ziegler, Nguyen & Nguyen, 2008
Calamaria gialaiensis T. Ziegler, S.V. Nguyen & T.Q.
Nguyen, 2008, Current Herpetol., 27(2): 72.
Holotype: IEBR A.0714.
Type locality: Kon Ka Kinh, K Bang District, Gia Lai
Province, Vietnam, 1300 m a.s.l.
English name: Gialai Reed Snake.
Vietnamese name: Ran mai gam gia lai.
Distribution: This species (Fig. 4b) is currently known on-
ly from Gia Lai Province, Vietnam.
Bonn zoological Bulletin 57 (2): 137-147
Calamaria sangi Nguyen, Koch & Ziegler, 2010 (2009)
Calamaria sangi T.Q. Nguyen, A. Koch & T. Ziegler, 2010
“2009”, Hamadryad 34(1): 2.
Holotype: IEBR 360.
Type locality: Mang Canh Commune, Kon Plong District,
Kon Tum Province, Vietnam, 1,200 m a.s.1.
English name: Sang’s Reed Snake.
Vietnamese name: Ran mai gam sang.
Distribution: This species is currently known only from
Vietnam.
Colubroelaps nguyenvansangi Orlov, Kharin, Ananje-
va, Nguyen & Nguyen, 2009
Colubroelaps nguyenvansangi N.L. Orlov, V.E. Kharin,
N.B. Ananjeva, T.T. Nguyen & T.Q. Nguyen, 2009, Russ.
J- Herpetol. 16(3): 235.
Holotype: ZISP/IEBR 25682.
Type locality: Loc Bac Forest Enterprise, Lam Dong
Province, Vietnam, ca. 720 m a.s.].
English name: Nguyenvansang’s Snake.
Vietnamese name: Ran nguyen van sang.
Distribution: The second record of this species was report-
ed by N. Poyarkov from Bu Gia Map National Park, Binh
Phuoc Province (Fig. 5). Therefore Colubroelaps nguyen-
vansangi 1s currently known from Lam Dong and Binh
Phuoc provinces, Vietnam.
Lycodon ruhstrati abditus Vogel, David, Pauwels,
Sumontha, Norval, Hendrix, Vu & Ziegler, 2009
Lycodon ruhstrati abditus G. Vogel, P. David, O.S.G.
Pauwels, M. Sumontha, G. Norval, R. Hendrix, T.N. Vu
& T. Ziegler, 2009, Tropical Zoology 22(2): 144.
Holotype: ZFMK 86451.
Type locality: U Bo region, Phong Nha — Ke Bang Na-
tional Park, Quang Binh Province, Vietnam.
English name: Hidden Mountain Wolf Snake.
Vietnamese name: Ran khuyet an.
©ZFMK
144 Thomas Ziegler & Truong Quang Nguyen
Fig. 4. a) Tropidophorus boehmei from Lao Cai Province, Photo T.T. Nguyen; b) Portrait of preserved Calamaria gialaiensis
from Gia Lai Province, Photo T. Ziegler; and c) Protobothrops trungkhanhensis from Cao Bang Province, Photo T.T. Nguyen.
SSS
Osi a
ee ae
~~
Fig. 5. | Colubroelaps nguyenvansangi from Binh Phuoc Province, Photo N. Poyarkov.
Bonn zoological Bulletin 57 (2): 137-147 ©ZFMK
New amphibians and reptiles from Vietnam 145
Dao (1977-
1982) Fb (1996) = (2005)
Fig. 6. Species diversity of the herpetofauna of Vietnam.
Distribution: This subspecies is currently known from
Quang Binh and Vinh Phuc provinces in Vietnam, and
from Fujian, Anhui, Zhejiang, Guangdong, Yunnan,
Sichuan and Gansu provinces in China. Because it has of-
ten been confused with other taxa, its range is probably
much wider, both in northern Vietnam and China (prob-
ably also present in Guangxi Province).
Viperidae
Protobothrops trungkhanhensis Orlov, Ryabov &
Nguyen, 2009
Protobothrops trungkhanhensis N.L. Orloy, S.A. Ryabov
& T.T. Nguyen, 2009, Russ. J. Herpetol. 16(1): 71.
Holotype: ZISP 25351.
Type locality: Trung Khanh Nature Reserve, Trung
Khanh District, Cao Bang Province, Vietnam, 600 m a.s.1.
English name: Trungkhanh Pitviper.
Vietnamese name: Ran luc trung khanh.
Distribution: This species (Fig. 4c) is currently known on-
ly from the type locality.
Bonn zoological Bulletin 57 (2): 137-147
® Anphibians
Navan & Nanandal Navandal July 210
(2009)
DISCUSSION
After the publication of the “Herpetofauna of Vietnam”
by Nguyen et al. (2009) 20 new amphibian and reptilian
species, one new subspecies, and a new snake genus have
been described from Vietnam by June 2010. Among them
there were three new amphibians (1 Megophryidae, 1
Ranidae, | Rhacophoridae) and 18 new reptilian taxa (2
Agamidae, 9 Gekkonidae, 2 Scincidae, 4 Colubridae, and
1 Viperidae). In contrast, two species which were listed
as valid and occurring in Vietnam in Nguyen et al. (2009)
were synonymized meanwhile: Gekko ulikovskii Darevsky
& Orlov, 1994 was regarded as a junior synonym of Gekko
badenii Szczerbak & Nekrasova, 1994 by Nguyen et al.
(2010d) and the specimen previously identified as
Pseudocalotes floweri from Kon Tum Province was re-
identified as P. ziegleri by Hallermann et al. (2010). Most
of the recent species’ discoveries affected lizards, with
geckos clearly being the predominant group. In addition
to these new species descriptions, three new country
records were published after the book of Nguyen et al.
(2009): one amphibian species, the megophryid anuran
Leptobrachium promustache, the scincid lizard Scincella
monticola, and the colubrid snake Amphiesmoides ornat-
iceps (Bain et al. 2009b, Nguyen et al. 2010a, b).
The results of this paper clearly exemplify that even af-
ter the comprehensive book provided by Nguyen et al.
©ZFMK
146 Thomas Ziegler & Truong Quang Nguyen
(2009) much research is needed to describe Vietnam’s rich
herpetodiversity. In particular because not only cryptic or
inconspicuous species were discovered and formally de-
scribed in the past months, but also striking and colour-
ful species like Cnemaspis psychedelica (Grismer et al.
2010) or even new genera, as was recently shown by the
description of Colubroelaps (Orlov et al. 2009a). Current-
ly, the herpetofauna of Vietnam comprises 181 species of
amphibians and 385 species of reptiles (Fig. 6). Howev-
er, diversity research and species inventories are only the
first steps, which must be followed by investigations of
the natural history and specific adaptations, which final-
ly are prerequisites for adequate conservation measures.
Acknowledgements. We are indebted to our colleagues Peter
Geissler (Bonn), L. Lee Grismer (Riverside), Ngo Van Tri,
Nguyen Ngoc Sang (Ho Chi Minh City), Nguyen Thien Tao
(Hanoi), Nikolay Poyarkov (Moscow), and Nikolai L. Orlov (St.
Petersburg) who kindly provided photographs.
REFERENCES
Adler K (2009) Herpetological exploration, research, and con-
servation in Vietnam. Pp. 33-56 in: Nguyen VS, Ho TC &
Nguyen QT. Herpetofauna of Vietnam. Edition Chimaira,
Frankfurt am Main
Bain RH, Nguyen QT, Doan VK (2007) New herpetological
records from Vietnam. Herpetol. Rev. 38(1): 107-117
Bain RH, Nguyen QT, Doan VK (2009a) A new species of the
genus Theloderma Tschudi, 1838 (Anura: Rhacophoridae)
from northwestern Vietnam. Zootaxa 2191: 58-68
Bain RH, Nguyen QT, Doan VK (2009b) First record of Lepto-
brachium promustache from Vietnam. Herpetology Notes 2:
27-29
Bain RH, Stuart BL, Nguyen QT, Che J, Rao D-Q (2009c) A
new Odorrana (Amphibia: Ranidae) from Vietnam and Chi-
na. Copeia 2: 348-362
Bourret R (1936a) Les serpents de |’ Indochine. I. Etudes sur la
faune. Henri Basuyau et Cie, Toulouse
Bourret R (1936b) Les serpents de |’ Indochine. II. Catalogue sys-
tématique descriptif. Henri Basuyau et Cie, Toulouse
Bourret R (1941b) Les tortues de I’Indochine. Inst. Océanogr.
de |’Indochine: 1—235
Bourret R (1942) Les batraciens de |’ Indochine. Inst. Océanogr.
de I’Indochine: 1-547
Campden-Main SM (1970) A field guide to the snakes of south
Vietnam. Div. Rept. Amphib., U.S. Nat. Mus., Smiths. Inst.,
Washington
Dao VT (1977) On the identification of the Vietnamese amphib-
ians. J. Bio.-Geol. Hanoi 15(2): 33-40 (in Vietnamese)
Dao VT (1978) On the identification of the Vietnamese turtles
and crocodiles. J. Bio-Geol., Hanoi, 16(1): 1-6 (in Viet-
namese)
Dao VT (1979) On the identification of the Vietnamese lizards.
J. Biol., Hanoi: 2-10 (in Vietnamese)
Dao VT (1981) On the identification of the Vietnamese snakes:
Part 1. J. Biol., Hanoi, 3(4): 1-6 (in Vietnamese)
Dao VT (1982) On the identification of the Vietnamese snakes.
Part 2. J. Biol. Hanoi 4(1): 5—9 (in Vietnamese)
Bonn zoological Bulletin 57 (2): 137-147
Geissler P, Nazarov R, Orlov NL, Bohme W, Phung MT, Nguyen
QT, Ziegler T (2009) A new species of the Cyrtodactylus ir-
regularis complex (Squamata: Gekkonidae) from southern
Vietnam. Zootaxa 2161, 20-32
Grismer JL, Grismer LL (2010) Who’s your mommy? Identify-
ing maternal ancestors of asexual species of Leiolepis Cuvi-
er, 1829 and the description of a new endemic species of asex-
ual Leiolepis Cuvier, 1829 from Southern Vietnam Zootaxa
2433: 47-61
Grismer LL, Ngo VT, Grismer JL (2010) A new colorful new
species of insular rock gecko (Cnemapsis Strauch 1887) from
southern Vietnam. Zootaxa 2352: 46-58
Hallermann J, Nguyen QT, Orlov N, Ananjeva N (2010) A new
species of the genus Pseudocalotes (Squamata: Agamidae)
from Vietnam. Russ. J. Herpetol. 17(1): 31-40
Morice A (1875) Coup d’oeil sur la faune de la Cochinchine
frangaise. Ass. Lyon. A. Sci. Nat., Lyon: 25-121
Ngo VT, Bauer AM, Wood PL Jr, Grismer JL (2009) A new
species of Gekko Laurenti, 1768 (Squamata: Gekkonidae)
from Dong Nai Province, Southeastern Vietnam. Zootaxa
2238: 33-42
Ngo VT, Gamble T (2010) A new species of Gekko (Squamata:
Gekkonidae) from Ta Kou Nature Reserve, Binh Thuan
Province, southern Vietnam. Zootaxa 2346: 17-28
Ngo VT, Onn CK (2010) A new species of Cyrtodactylus Gray,
1826 (Squamata: Gekkonidae) from Khanh Hoa province,
Southern Vietnam. Zootaxa 2504: 47-60
Ngo VT, Ziegler T (2009) A new species of Dixonius from Nui
Chua National Park, Ninh Thuan Province, southern Vietnam
(Squamata, Gekkonidae). Zoosyst. Evol. 85(1), 117-125
Nguyen NS (2010) A new poreless species of Gekko Laurenti,
1768 (Gekkonidae: Squamata) from An Giang Province,
southern Vietnam. Zootaxa 2501: 54-60
Nguyen QT (2006) Herpetological collaboration in Vietnam. Pp.
233-240 in: Vences M, Kohler J, Ziegler T & BOhme W (eds.)
Herpetologia Bonnensis II. Proceedings of the 13th Ordinary
General Meeting of the Societas Europaea Herpetologica,
Bonn
Nguyen QT, David P, Tran TT, Luu QV, Le KQ, Ziegler T
(2010a): Amphiesmoides ornaticeps (Werner, 1924), an addi-
tion to the snake fauna of Vietnam, with a redescription and
comments on the genus Amphiesmoides Malnate, 1961
(Squamata: Natricidae). Rev. Suisse de Zoologie 117(1):
45-56
Nguyen QT, Koch A, Ziegler T (2009) A new species of reed
snake, Calamaria Boie, 1827 (Squamata: Colubridae), from
central Vietnam. Hamadryad 34(1): 1-8
Nguyen QT, Nguyen TT, Bohme W, Ziegler T (2010b) First
record of the mountain ground skink Scincella monticola
(Schmidt, 1925) (Squamata: Scincidae) from Vietnam. Russ.
J. Herpetol. 17(1): 67-69
Nguyen QT, Nguyen TT, Schmitz A, Orlov NL, Ziegler T
(2010c) A new species of the genus Tropidophorus Dumeril
& Bibron, 1839 (Squamata: Sauria: Scincidae) from Vietnam.
Zootaxa 2439: 53-68
Nguyen QT, Schmitz A, BGhme W (2010d) Gekko ulikovskii
Darevsky & Orlov, 1994: a junior synonym of Gekko badenii
Szezerbak & Nekrasova, 1994. Bonn zoological Bulletin
57(1): 15-17
Nguyen VS, Ho TC (1996) Danh luc bo sat va ech nhai Viet
Nam. Nha xuat ban khoa hoc va ky thuat, Hanoi (in Viet-
namese)
Nguyen VS, Ho TC, Nguyen QT (2005) A checklist of amphib-
ians and reptiles of Vietnam. Agricultural Publishing House,
Hanoi (in Vietnamese)
©OZFMK
New amphibians and reptiles from Vietnam 147
Nguyen VS, Ho TC, Nguyen QT (2009) Herpetofauna of Viet-
nam. Edition Chimaira, Frankfurt am Main
Orlov NL, Kharin VE, Ananjeva NB, Nguyen TT, Nguyen QT
(2009a) A new genus and species of colubrid snake (Squama-
ta, Ophidia, Colubridae) from South Vietnam (Lam Dong
Province). Russ. J- Herpetol. 16(3): 228-240
Orlov NL, Ryabov SA, Nguyen TT (2009b) Two new species
of genera Protobothrops Hoge et Romano-Hoge, 1983 and
Viridovipera Malhotra et Thorpe, 2004 (Ophidia: Viperidae:
Crotalinae) from karst region in northeastern Vietnam. Part I).
description of a new species of Protobothrops genus. Russ.
J. Herpetol. 16(1): 69-82
Roésler H, Nguyen QT, Doan VK, Ho TC, Nguyen TT, Ziegler
T (2009) A new species of the genus Gekko Laurenti (Squa-
mata: Sauria: Gekkonidae) from Vietnam with remarks on G.
japonicus (Schlegel). Zootaxa 2329: 56-68
Rowley JJL, Cao TT (2009) A new species of Leptolalax (Anura:
Megophryidae) from central Vietnam. Zootaxa 2198: 51—60
Sterling EJ, Hurley MM, Le DM (2006) Vietnam a natural his-
tory. Yale University Press, New Haven & London
Bonn zoological Bulletin 57 (2): 137-147
Tirant G (1885) Notes sur les reptiles et les batraciens de la
Cochinchine et du Cambodge. Excursions et Reconnaissance,
Saigon 20
Vogel G, David P, Pauwels OSG, Sumontha M, Norval G, Hen-
drix R, Vu NT, Ziegler T (2009) A revision of Lycodon ruh-
strati (Fischer 1886) auctorum (Squamata Colubridae), with
the description of a new species from Thailand and a new sub-
species from the Asian mainland. Tropical Zoology 22(2):
131-182
Ziegler T, Nazarov R, Orlov N, Nguyen QT, Vu NT, Dang NK,
Dinh HT, Schmitz A (2010) A third new Cyrtodactylus (Squa-
mata: Gekkonidae) from Phong Nha-Ke Bang National Park,
Truong Son Range, Vietnam. Zootaxa 2413: 20-36
Ziegler T, Nguyen VS, Nguyen QT (2008) A new reed snake of
the genus Calamaria Boie (Squamata: Colubridae) from Viet-
nam. Current Herpetology 27(2): 71-80
Received: 09. VI.2010
Accepted: 24. VIII.2010
©ZFMK
L Bonn zoological Bulletin Volume 57
Issue 2 pp. 149-171 Bonn, November 2010
The distinction between family-series and class-series nomina
in zoological nomenclature, with emphasis on the nomina
created by Batsch (1788, 1789) and on the higher nomenclature of turtles
Alain Dubois & Roger Bour
Reptiles & Amphibiens, UMR 7205 OSEB, Département de Systématique & Evolution,
Muséum national d’ Histoire naturelle, CP 30, 25 rue Cuvier, F-75005 Paris, France;
E-mails: [email protected], bour@mnhn. fr
Abstract. The Code only regulates the scientific names or nomina of zoological taxa from the rank subspecies to the
rank superfamily, but not those of taxa at ranks above the latter (class-series nomina). It is shown here that its current
Rules are somewhat ambiguous regarding the availability of family-series nomina and the distinction between the latter
and class-series nomina, and it is again suggested that it should be improved in this respect. It should cover the whole
nomenclatural hierarchy in zoology, which requires to expand it in order to incorporate Rules for the nomenclature of
higher taxa. A detailed analysis is devoted to the poorly known work of Batsch (1788, 1789), and it is shown that 17 fam-
ily-series nomina, 16 of which have remained unnoticed until now, are available and should replace the homonymous
junior nomina currently considered valid in zootaxonomy. Particular attention is given to the higher nomenclature of tur-
tles, and it is shown that the nomen 7éSTUDINES Batsch, 1788 is a family-series, not a class-series nomen. This nomen is
therefore the valid one, as TESTUDINIDAE Batsch, 1788, of the family including the genus Jestudo Linnaeus, 1758, but
cannot apply to the order of turtles, tortoises and terrapins.
Key words. Zoological nomenclature, Code, availability, class, family, Batsch, turtles, TESTUDINES, TESTUDINIDAE.
ABBREVIATIONS AND PRINTING CONVEN-
TIONS
In this paper, “ICZN” designates the International Com-
mission on Zoological Nomenclature and “the Code” the
edition currently in force of the /nternational Code of Zo-
ological Nomenclature (Anonymous 1999). For reasons
explained in details elsewhere (Dubois 2000, 2006a), some
terms of the Code are here substituted by other terms, as
follows (in the order of their first appearance in the text,
indicated there by an asterisk*): nomen (plural nomina)
for “scientific name” (Dubois 2000); nominal-series for
“groups of names” (Dubois 2000), with four such series
(“groups”) being discussed here: the species-, genus-, fam-
ily- and class-series (Dubois 2000); anoplonym for a
“nomenclaturally unavailable name” (Dubois 2000); so-
zonym for a nomen that has had a universal or significant
use in non-systematic literature after 31 December 1899
(Dubois 2005a—b); distagmonym for a nomen that has not
had such a use (Dubois 2005a—b); onomatophore for
“type” or “name-bearing type” (Simpson 1940); nucle-
ogenus (plural nucleogenera) for “type genus” (Dubois
2005b); nucleospecies for “type species” (Dubois 2005b);
Bonn zoological Bulletin 57 (2): 149-171
monophory for “monotypy” (Dubois 2005b); neonym for
“new replacement name” or “nomen novum” (Dubois
2000); autoneonym for a neonym being an “unjustified
emendation” (Dubois 2000); archaeonym for the nomen
replaced by a neonym (Dubois 2005a); hyponymous for
“nominotypical” (Dubois 2006c). The nomina belonging
to the species-series and genus-series are printed, as usu-
al, in lower case italics, whereas nomina of higher-ranked
taxa are printed in small capitals, with the following dis-
tinction: family-series nomina are in /74LICS, whereas
class-series nomina are in BOLD. Anoplonyms are print-
ed “between quotation marks”.
FAMILY-SERIES AND CLASS-SERIES NOMEN-
CLATURE IN ZOOLOGY
The Code regulates the nomina* of zoological taxa from
the rank subspecies to the rank superfamily, but not those
of taxa at ranks above the latter. Therefore the use and al-
©OZFMK
150 Alain Dubois & Roger Bour
location of nomina of taxa referred to the higher ranks of
zoological nomenclature (order, class, phylum, etc.) are
left to the freedom and opinions of individual zoologists,
as no Rules exist in the Code for their availability, allo-
cation to taxa and validity, the three basic steps of the
nomenclatural process (Dubois 2005a—c, 2006a).
The nomina covered by the Code are distributed in three
nominal-series*: the species-*, genus-* and family-se-
ries*. Any nomen, to be recognized as nomenclaturally
available, must first be explicitly or implicitly referred to
one of these nominal-series. No difficulty usually arises
regarding the allocation of nomina to the species- and
genus-series, but, in some cases, problems may be encoun-
tered to know whether a given nomen belongs in the fam-
ily-series, and thus is governed by the nomenclatural Rules
of the Code, or to a rank above the family-series, there-
fore in the class-series* and thus is outside the Rules of
the Code.
The Code is not fully clear regarding the conditions of
availability of family-series nomina. Only two conditions
are clear for all nomina, concerning the stem of the nomen
and the reference to a suprageneric taxon. Article 11.7.1.1
states that, to be available in its original publication, a fam-
ily-series nomen must “be a noun in the nominative plu-
ral formed from the stem of an available generic name’,
which is then its nucleogenus* (type-genus). Therefore,
any higher taxon nomen not based on an available gener-
ic nomen is unavailable for a family-series nomen, but
may under certain conditions be available for a class-se-
ries nomen. Article 11.7.1.2 adds that the new nomen must
“be clearly used as a scientific name to denote a supra-
generic taxon and not merely as a plural noun or adjec-
tive referring to the members of a genus”. Therefore, the
explicit use of the rank family, or of another traditional
rank of the family-series (subfamily, superfamily, tribe,
subtribe, etc.), is not required for availability of nomina
in the family-series. Two additional clear conditions, ap-
plying only to nomina published after 1999, are given in
Articles 16.1 (the nomen “must be explicitly indicated as
intentionally new”) and 16.2 (the nomen “must be accom-
panied by citation of the name of the type genus’’). Ac-
cording to Article 11.7.1.1, before 2000, the type-genus
may be indicated “either by express reference to the gener-
ic name or by reference to its stem”, 1.e., by implicit ety-
mological designation (Dubois 1984).
Three conditions are unclear in the current Code regard-
ing the status of new family-series nomina: (C1) the date;
(C2) the requirement for validity of the nomen of the nu-
cleogenus; and (C3) the distinction between family-series
and class-series nomina.
Bonn zoological Bulletin 57 (2): 149-171
(C1) No starting date is given in the Code for the use of
family-series nomina in zoological nomenclature. How-
ever, the rank family and related ones (superfamily, sub-
family, tribe, subtribe, etc.) were not recognized by Lin-
naeus (1758, 1761, 1764, 1766, 1767), although this au-
thor made use of no less than seven ranks above the rank
genus (Dubois 2007). Some authors of the 18 century
used the ranks family and tribe, but not always for taxa
above the rank genus and below the rank order, with fam-
ily as a rank above tribe (Dubois 2006a). For example,
some authors (e.g., De Geer 1778; Goeze & Donndorff
1797) used family as a rank below the rank genus, where-
as others, including some quite recently, used tribe as a
rank above the rank order (e.g., Scopoli 1777; de
Blainville 1816; Huene 1952) or below the rank order but
above the rank family (e.g., Oken 1821, 1833; Fitzinger
1826, 1843; Swainson 1835; Hogg 1841; Bonaparte 1845;
de Blainville 1847; Stannius 1856). In zoological taxon-
omy, the first authors that are traditionally credited with
the creation of family-series nomina for taxa above the
rank genus are authors who published their works in the
early 19th century: e.g., Lamarck (1801), Latreille (1802,
1824, 1825), Oppel (181la—b), Rafinesque-Schmaltz
(1814a—d), Rafinesque (1815), Vieillot (1816), Fischer
(1817), Goldfuss (1820), Gray (1825) or Vigors (1825).
However, a few authors in the second half of the 18" cen-
tury already used the rank family for taxa at ranks between
genus and order. This is the case of Batsch (1788, 1789),
in a rather poorly known work discussed in detail below.
Inasmuch as the familial nomina created by these authors
were clearly based on the stems of available generic nom-
ina considered valid by these authors, there is no reason
for not crediting these authors with the creation of these
familial nomina, even if this was ignored by most subse-
quent authors until now (Dubois 2010: 25).
(C2) Regarding the requirement for validity of the gener-
ic nomen used as stem (nucleogenus), Article 11.7.1.1
states that “the generic name must be a name then used
as valid in the new family-group taxon [Arts. 63, 64] (use
of the stem alone in forming the name is accepted as ev-
idence that the author used the generic name as valid in
the new family-group taxon unless there is evidence to the
contrary)”. There are several questions with this unclear
formulation. First, what does “then” mean in this context?
This word would have a clear sense only if it meant “in
the work where the new family-series nomen is created”,
but then why not write it in full words? If it meant “‘at the
period of this work”, this would be difficult to apply, first
because it is unclear how long the period to be considered
should be (preferably it seems that it should not include
more than ten or 20 years around the creation of the new
family-series nomen), and second because at any given pe-
©ZFMK
Family- and class-series nomina in zoology 151]
riod of taxonomy the same nomen may be accepted as
valid by part of the authors then active, and invalid by oth-
ers, as will be illustrated below with the example of the
nomina Lacerta Linnaeus, 1758 and LAcer7T4E Batsch,
1788. Furthermore, the words “used as valid in the new
family-group taxon” show that this condition cannot ap-
ply to works published before the creation of the latter tax-
on! Therefore, this part of Article 11.7.1.1 would be made
clearer by choosing between the two following formula-
tions: (Fl) “the generic nomen must be used as valid in
the new family-group taxon in the work where its nomen
is created’; (F2) “the generic nomen must be used as valid
by all active taxonomists in the 10 years before and after
creation of the new family-group nomen” (or another
span). Until this choice is made by the ICZN, this Article
is not fully operational, as will be exemplified below. The
French version of Article 11.7.1.1 in the current Code is
not strictly equivalent to its English version, which is prob-
lematic as these two texts are deemed to be “equivalent
in force and meaning” (Anonymous 1999: xiii). As a mat-
ter of fact, the French version of this Article ignores the
term “then” (“alors”). In the previous edition of the Code
(Anonymous 1985: 25), Article 11(f)(i)(1) wrote “then
used as valid for a genus contained in that family-group
taxon’. These elements suggest that formulation (F1)
above corresponds to the real meaning of this article, and
we follow this interpretation below.
(C3) Regarding the distinction between family-series and
class-series nomina, it is unambiguous in the Code only
in the case of suprageneric nomina that are not based on
available generic nomina, which are unavailable in the
family-series, but may be available in the class-series, at
least in some cases (see below). But what is the status of
nomina based on the stem of available generic nomina cre-
ated for taxa at ranks clearly above the family-series (or-
der, class, etc.), or for taxa of unusual ranks, not clearly
referable to the family- or class-series (such as phalanx,
cohort, gens, etc.), or for taxa of unspecified ranks? The
Code does not provide any clue for decision in such cas-
es, all the more that, as reminded above, the explicit use
of the rank family, or of another rank of the family-series,
is not required for availability of nomina in the family-
series. A few clear situations exist: (1) when a nomen is
created for a taxon that is explicitly originally referred to
a rank higher than superfamily, or than order, class or an-
other rank traditionally referred for the class-series in zo-
ology, whatever this rank is, such a nomen belongs in the
class-series; (2) in contrast, when a nomen is created for
a suprageneric taxon of rank lower than superfamily or
than any other traditional rank in the family-series (fam-
ily, subfamily, tribe, etc.), and is based on the stem of a
nucleogenus, it belongs in the family-series. But when-
ever a nomen is proposed for a taxon of any rank above
the rank genus, and without clear hierarchical relationships
Bonn zoological Bulletin 57 (2): 149-171
with other taxa of ranks unambiguously referable either
to the family- or to the class-series, it may be treated e1-
ther as a class-series nomen (this is the case for example
of all suprageneric nomina created by Linnaeus: see
Dubois 2007) or as a family-series nomen. In such cases,
the etymology of the nomen may be a help for the deci-
sion: 1f the nomen is based on the stem of an available
generic nomen, it may be treated as a family-series nomen,
otherwise as a class-series nomen.
Another matter ignored by the Code is what could be
called the consistency problem. In some publications of
the 18th, 19th and even 20 centuries, some authors were
not consistent regarding the mode of formation of their
new familial nomina: some were based on the stem of
available generic nomina, whereas others were not, being
descriptive or geographical terms, terms based on the
names of persons, etc. In such cases, the nomina of the
first category could be accepted as available both as fam-
ily-series and class-series nomina, but those of the second
category can be considered available only in the class-se-
ries. However, a choice has to be made between these two
nominal-series for a// the nomina created together with the
same rank, as it is not logical and conceivable to admit
that the same author, in the same publication, created both
family-series and class-series nomina for taxa of same rank
(for details, see Dubois 2008b). Dubois (2006a: 178) pro-
posed that, in such cases, for reasons of consistency in the
taxonomic hierarchy, all these nomina be referred to the
family-series, but that those which are incorrectly formed
(not being based on available generic nomina, or formed
through addition of a complex suffix unacceptable as a
family-series suffix according to the Code), be considered
nomenclaturally unavailable. These are of two kinds
(Dubois 2006a: 178): arhizonyms are family-series nom-
ina not based on generic nomina, and caconyms are fam-
ily-series nomina based on generic nomina but with a com-
plex suffix (such as -forma, -morpha, etc.). Examples of
arhizonyms include “BATRACINIA”, “GYMNODERMIA” and
‘“PHRYNACINIA”, coined by Rafinesque (1815) for taxa of
ranks family or subfamily, along with available family-
series nomina like HYLARINIA, RANARINIA and TRITONIA. Ex-
amples of caconyms include “RANIFORMES”, “HYLAE-
FORMES”, “BUFONIFORMES” and “PIPAEFORMES’’, coined by
Dumeéril & Bibron (1841) for taxa of rank family, along
with available family-series nomina like CECILIOIDES,
SALAMANDRIDES, AMPHIUMIDES and PROTEIDES.
In his study of class-series nomenclature in zoology,
Dubois (2006a: 228), after a detailed discussion of the
problems mentioned above and others, proposed two new
Rules to clarify this situation and to distinguish between
family-series and class-series nomina in a simple, objec-
tive and automatic manner:
©ZFMK
152 Alain Dubois & Roger Bour
“(R4) Allocation of nomina to the family-series or to the
class-series. Whenever a single new suprageneric nomen
of a given taxonomic rank was established in a publica-
tion, this nomen must be referred to the family-series if
both following conditions are fulfilled: (A) it was proposed
for a taxon of a rank usual within the family-series or of
an unusual rank but clearly presented as being hierarchi-
cally subordinate to a usual rank of that series although
above the genus; and (B) it was coined by addition of a
simple suffix denoting the plural to the stem of an avail-
able genus-series nomen. In all other cases, the nomen
must be referred to the class-series. Whenever several new
suprageneric nomina of the same rank were established
in a publication, they must all be referred to the same nom-
inal-series, if they were treated heterogeneously with re-
gard to the criteria above, they must follow the Rule of
Taxonomic Consistency (R5).
(R5) Rule of Taxonomic Consistency. All suprageneric
nomina created in the same publication for taxa that were
afforded the same taxonomic rank must be referred to the
same nominal-series. In case of conflict between their al-
location to nominal-series according to Rule (R4), the fam-
ily-series takes precedence over the class-series, and nom-
ina that, being incorrectly formed (arhizonyms or ca-
conyms), cannot be considered as belonging to that se-
ries, must be treated as nomenclaturally unavailable
(anoplonyms*).”
These proposed Rules should be studied carefully by the
ICZN and incorporated into the Code, or others Rules
should be proposed, but until this is done, ambiguity will
exist and decisions regarding the status of some nomina
of higher taxa will remain unclear, and will have to rely
on arbitrary decisions on the part of some zoologists, as
will now be shown.
In what follows, these general questions will be concrete-
ly studied in one zoological group: we will examine the
status of the nomina used by the authors until now for (1)
the order of reptiles including the turtles and (2) the fam-
ily of turtles including the genus 7estudo Linnaeus, 1758.
THE HIGHER NOMENCLATURE OF TURTLES
Despite various works dealing with it, the higher nomen-
clature of turtles is not yet stabilized. The nomenclatural
chaos is clearly emphasized by the use of different and
incompatible nomenclatures over very short periods of
times, not only by different authors, but sometimes by the
same one (e.g., Vetter 2002, 2004; Vetter & van Dijk
2006). The last publications in this respect, by Rhodin et
al. (2008, 2009), are not reliable references, as they dis-
play ignorance of several basic nomenclatural Rules of the
Bonn zoological Bulletin 57 (2): 149-171
Code. For example, they do not follow the Code’s Prin-
ciple of Coordination for superfamilies, which are cred-
ited to authors and dates different from those of their hy-
ponymous* families (e.g., KINOSTERNIDAE Agassiz, 1857
and KINOSTERNOIDEA Joyce, Parham & Gauthier, 2004) and
sometimes given incorrect endings (7RIONyCHIA Hummel,
1929). An important nomenclatural flaw, discussed in de-
tail below, is to refer the same nomen (7ESTUDINES Batsch,
1788) both to the family- and the class-series.
Table | (in Appendix 1) provides a survey of various nom-
ina, with their authors and dates when they were speci-
fied, that have been used until now by a number of zool-
ogists for the order of turtles and the family including the
genus Zestudo Linnaeus, 1758.
Several problems can be identified in this table. First, al-
though the family including the genus 7estudo has almost
always been known as TESTUDINIDAE, the author and date
of the latter nomen has not been consensual. Some authors
(e.g., Hunt 1958: 150; Iverson 1992: 3; Xianrui 1994: 4)
have credited a nomen “Testudines” to Linnaeus (1758:
194, 198). However, it is fully clear that, in this and oth-
er works of Linnaeus, the term Jestudines was a plural
noun referring to the members of the genus Jestudo, not
a family-series or class-series nomen (Article 11.7.1.2;
Bour & Dubois 1985). This is stressed by the fact that Lin-
naeus (1758: 198-199) also mentioned this word as 7és-
tudine and Testudinibus. Others have credited the famil-
ial nomen JESTUDINIDAE to Gray (1825), until Bour &
Dubois (1985) drew the attention to the fact that the nomen
TESTUDINES, coined by Batsch (1788: 437) for a family in-
cluding the single genus Zestudo Linnaeus, 1758, was
doubtless available in the family-series, where it has pri-
ority over all subsequent nomina coined on the basis of
the stem of this generic nomen (including 7EsTuUDIA
Rafinesque-Schmaltz, 1814c, a nomen ignored by most
authors until now). Following the Code, this nomen must
simply be emended to TESTUDINIDAE Batsch, 1788 if used
for a taxon of rank family, to TESTUDINOIDEA Batsch, 1788
for a taxon of rank superfamily, 7ESTUDININAE Batsch, 1788
for a subfamily, TESTUDININI Batsch, 1788 for a tribe and
TESTUDININA Batsch, 1788 for a subtribe.
Still more confusion has been exhibited by the authors re-
garding the nomen of the order of turtles. The nomen TEs-
TUDINES was used for this purpose, credited either to Lin-
naeus (1758) or to Batsch (1788), which is incorrect in
both cases for the reasons given above (the former being
a generic nomen in the plural, the latter a family-series
nomen). The first valid creation of a nomen TESTUDINES
for an order was by Wagler (1830: 130, 133), but this is
subsequent to the other nomina discussed below. As a mat-
ter of fact, three other nomina were also widely used for
the order, CHELONI, CHELONIA and TESTUDINATA.
OZFMK
Family- and class-series nomina in zoology 153
Both CHELON and CHELONIA are just subsequent la-
tinizations of CHELONIENS Brongniart, 1800a. The
spelling CHELONIA was first used by Ross & Macartney
(and not Macartney alone, as wrongly stated by Loveridge
1957 or Romer 1966) in their 1802 translation of the work
of Cuvier (1800). This latinization was posterior to that
in CHELONI by Latreille (1800), used by many subsequent
authors in the 19 century (Bour & Dubois 1985: 79) and
resurrected by Bour (1981). Although the Code provides
no guidelines for the authorship and date of class-series
nomina, for reasons discussed in detail by Dubois (2006a,
2009), by simple consistency and parallelism with the
Rules of the Code concerning family-series and genus-se-
ries nomina, it is justified to credit a class-series nomen
published first in a non-latinized form to the author of this
original nomen, so in this case to Brongniart (1800a). The
spelling CHELONII being anterior to CHELONIA, and the
latter being open to confusion because of hemihomonymy
(Starobogatov 1991) with the generic nomen Chelonia
Brongniart, 1800b, the use of CHELONII was supported by
Bour (1981) and Bour & Dubois (1985), who noted that
this nomen had priority over TESTUDINATA, an ordinal
nomen coined by Oppel (1811b). In conclusion, Bour &
Dubois (1985) proposed to use the nomen CHELONII
Brongniart, 1800a for the order of turtles, a suggestion
adopted by various subsequent authors (see Table 1).
As the Code provides no Rules or even guidelines for
class-series nomenclature, this suggestion was based on
the use of the Principle of Onomatophores* (so-called
“Principle of Typification”) in a way similar to its use in
the three lower nominal-series recognized by the Code, a
method explicitly presented by Dubois (1984). However,
as was later shown by Dubois (2004, 2005a—b, 2006a—b,
2009; Dubois & Ohler 2009), because no Principle of Co-
ordination is in force in class-series nomenclature, such
a practice does not allow unambiguous allocation of a
class-series nomen to a taxon as soon as several hierar-
chically subordinated taxa have the same onomatophore,
so that more complete Rules had to be devised (Dubois
2006a). For the precise allocation of nomina to higher taxa,
this system uses both the originally included genera or
conucleogenera of the newly established taxon, and the
genera originally expressly excluded from it, its alieno-
genera. Until these proposed Rules, or others, are incor-
porated into the Code in order to regulate class-series
nomenclature, the latter will remain chaotic and left to
“freedom” and “opinions” of individual zoologists, which
will be a permanent nuisance for proper and unambigu-
ous communication among all biologists.
This problem is made worse by the ambiguity, discussed
above, regarding the distinction between class-series and
family-series nomina in the Code. Although Batsch (1788)
had clearly referred his new taxon TESTUDINES to the rank
Bonn zoological Bulletin 57 (2): 149-171
family, there is nothing in the Code that imposes to refer
this nomen to the family-series, all the more that Batsch
(1788, 1789) was not consistent in his use of etymology
for his familial nomina, some only being based on the
stems of generic nomina he considered valid (see below).
Because of this ambiguity of the Code, it would be pos-
sible to refer the nomen 7ESTUDINES Batsch, 1788 either
to the family-series (which clearly has our preference) or
to the class-series. But it is fully unacceptable and impos-
sible to refer it to both! This would be similar to accept-
ing that a genus-series nomen, such as Ranoidea Tschu-
di, 1838 for example, can be considered available both as
the nomen of a genus and of a superfamily! This is how-
ever what has been done by Fritz & Havas (2006, 2007),
followed by Vetter & van Dijk (2006) and Rhodin et al.
(2008, 2009), who recognized, in the same classification,
an order TESTUDINES Batsch, 1788 and a family 7ésTU-
DINIDAE Batsch, 1788, although both nomina are based on
the one and single appearance of the nomen TESTUDINES
in page 437 of Batsch (1788)! The fact that such incred-
ible nomenclatural treatments can be accepted as valid by
several contemporaneous taxonomists and periodicals
points to the poor interest granted by many colleagues
nowadays to nomenclatural Rules and to the chaotic sit-
uation created in zoological nomenclature by the incom-
pleteness and ambiguity of the Code.
This exemplary case prompted us to undertake a detailed
and complete survey of all suprageneric nomina created
by Batsch (1788, 1789), which fully exemplifies these
problems and allows to propose solutions to them.
BATSCH’S (1788, 1789) SUPRAGENERIC NOMINA
IN ZOOLOGY
Batsch (1788, 1789) was one of the authors who, in the
late 18' century, proposed a comprehensive classification
of the animal kingdom and tried to improve the scheme
of Linnaeus (1758, 1766, 1767) in this respect. In this clas-
sification, he used four ranks above the rank genus: fam-
ily, order, class and an upper unnamed rank that we treat
here for more simplicity as “superclass”. This classifica-
tion is summarized here in our Table 2 (in Appendix 1).
Batsch (1788) was the first author to divide the animal
kingdom in two main groups, his “superclasses” OSSEA
and CRUSTACEA, which exactly correspond to the distinc-
tion between “animaux a vertébres” and “animaux sans
vertébres” first proposed by Lamarck in his lectures
(which were not published until 1801), and which
Cuvier (1800) was the first author to formally name in a
publication as VERTEBRES (VERTEBRATA) and IN-
VERTEBRES (INVERTEBRATA). Although Batsch’s (1788)
©ZFMK
154 Alain Dubois & Roger Bour
OssEaA has priority over VERTEBRATA, it would be inap-
propriate to replace the latter, which has been used mil-
lions of times in the scientific literature and therefore qual-
ifies as a sozonym*, by the former, which has been ignored
and which is therefore a distagmonym* (Dubois 200S5a:
86, 2005b: 412).
In his OsskA, Batsch (1788) recognized four classes,
MAMMALIA, AVES, AMPHIBIA and PISCES, whereas in his
CRUSTACEA he recognized two classes, INSECTA and VER-
MES. Although the nomina of these six classes are iden-
tical to those of the six zoological classes of Linnaeus
(1758, 1766, 1767), their content is not always exactly the
same. For example, Batsch (1789) removed from his VER-
MES the genus Myxine Linnaeus, 1758 placed in this clas-
sis by Linnaeus, and which is in fact a chordate. There-
fore, the nomina used by Batsch for these classes should
be credited to him, not to Linnaeus. They are junior
homonyms of Linnaeus’ identical nomina (see Dubois
2006a).
All genera in Batsch (1788, 1789) are referred to fami-
lies. Families are referred to orders and then to the class
only in one class (MAMMALIA). The nomina of the orders
of mammals also are in part borrowed from Linnaeus, but
here also sometimes with a slightly different content,
which requires to consider them as distinct, junior
homonymous nomina. In the other five classes, the only
rank used above genus is that of family. Because the rank
family is expressly used by Batsch, is situated in the
nomenclatural hierarchy above the rank genus and below
the ranks class and order (when available), and because
some at least of these nomina are coined by addition of
an ending indicating plural to the stem of an available
generic nomen considered valid by Batsch (1788, 1789),
we hereby consider the nomina of Batsch’s “families” to
be indeed family-series nomina, some of which only are
nomenclaturally available.
The available family-series nomina in Batsch (1788,
1789), that appear in Table 2, are the 17 familial nomina
in his work based on available generic nomina listed by
him as valid among the genera of the family. This is for
example the case of TESTUDINES Batsch, 1788, a taxon ex-
pressly mentioned as including the genus Jestudo Lin-
naeus, 1758.
As shown in Table 2, there are two categories of unavail-
able family-series nomina in Batsch (1788, 1789). The first
one consists of arhizonyms, 1.e., family-series that were
not based on any then available zoological generic nomen.
The second one consists of nomina that were indeed based
on then available zoological generic nomina, but these
nomina not being listed by Batsch (1788, 1789) as valid
Bonn zoological Bulletin 57 (2): 149-171
among the members of the family, being presumably con-
sidered invalid synonyms of nomina used by Batsch as
valid. As we here adopted the formulation (F1) above of
Article 11.7.1.1 of the Code, these nomina must be con-
sidered as nomenclaturally unavailable, but if interpreta-
tion (F2) had to be followed these nomina would have to
be treated as available. This small doubt is one of the con-
sequences of the ambiguous writing of Article 11.7.1.1 in
the current version of the Code.
The Code is silent about the nomenclatural status of fa-
milial nomina such as those created by Batsch (1788,
1789) but shown above to be unavailable in the family-
series. In contrast, under the Rules proposed by Dubois
(2006a) for class-series nomenclature, these nomina be-
long unambiguously in the family-series and are therefore
clearly unavailable in the class-series as well, because of
the Rule of Taxonomic Consistency presented above.
Except three, all the generic nomina listed by Batsch
(1788, 1789) in his classification of the animal kingdom
had previously been made available in zoological nomen-
clature by Linnaeus (1758) and in subsequent publications
between 1758 and 1790. The only three exceptions are the
nomina Cylindrus Batsch, 1789, Hydrocantharus Batsch,
1789 and Turris Batsch, 1789. The status of these three
nomina is discussed below in Appendix 2.
Table 3 (in Appendix 1) lists the 17 familial nomina made
nomenclaturally available in zoological nomenclature by
Batsch (1788, 1789). Until now, only one (TESTUDINIDAE)
has been credited to Batsch (1788), and the other 16 are
traditionally credited to other authors at subsequent dates,
but should now be credited to Batsch. This poses no prob-
lem of “nomenclatural stability”, as none of these 16 fa-
milial nomina has to change, the change concerning on-
ly their author and date.
The familial nomen LAceRTIDAE, that had previously
(Dubois 2004; Dubois & Bour 2010) been credited to
Batsch (1788), does not appear in Table 3. This is because
this nomen could be considered available only under in-
terpretation (F2) of Article 11.7.1.1. The genus Lacerta
Linnaeus, 1758 was recognized by most authors of the end
of the 18 century, but not by Laurenti (1768) who had
split it into several genera and had not retained the nomen
Lacerta for any of them (in contrast for what he had done
in other cases, e.g. for Rana). He was apparently followed
in this by Batsch (1788), who did not recognize or even
mention the genus Lacerta. As we here adopted interpre-
tation (F1) of Article 11.7.1.1, the family nomen L4cER-
TIDAE cannot be credited to Batsch (1788). It must there-
fore be credited to the first subsequent author who used
a family nomen based on the generic nomen Lacerta for
©ZFMK
Family- and class-series nomina in zoology 155
a family where the latter generic nomen was considered
valid. This happens to be Oppel (1811b: 16).
Establishing the proper nomen for the order of turtles (or
“turtles, tortoises and terrapins’’), i.e., including all recent
turtles as well as a few additional Triassic groups, is be-
yond the scope of the present paper, and we just provide
here a few comments in this respect. As discussed above,
the nomen 7ESTUDINES Batsch, 1788, being available in the
family-series, is not available in the class-series and can-
not be used for an order. Under the nomenclatural Rules
proposed by Dubois (2006a), the nomina CHELONII
Brongniart, 1800a and TESTUDINATA Oppel, 1811b are
available in the class-series. However, they do not apply
to the order of turtles, but to still higher taxa.
Under these Rules, the nomen CHELONI Brongniart,
1800a applies to the most inclusive class-series taxon con-
taining the genera Che/onia Brongniart, 1800b and Tes-
tudo Linnaeus, 1758, and excluding the 19 nominal gen-
era referred by Brongniart (1800b) to his orders BATRA-
CHIA, OPHIDIA and SAURIA.
As for the nomen TESTUDINATA Oppel, 1811b, it applies
to the most inclusive class-series taxon containing the gen-
era Chelonia Brongniart, 1800b, Chelys Oppel, 1811b,
Emys Dumeril, 1806, TJestudo Linnaeus, 1758 and Trionyx
Geoffroy Saint-Hilaire, 1809, and excluding the 48 nom-
inal genera referred by Oppel (1811b) to his orders SQua-
MATA and NUDA.
Oppel (1811b) credited the nomina of his orders TESTU-
DINATA and NupDaA to Klein (1751), a work which, being
anterior to 1758, is not nomenclaturally available. How-
ever, Joyce et al. (2004: 998) recently drew the attention
to Behn’s (1760) translation and adaptation of Klein’s
(1751) book, which includes all the taxa and nomina of
the latter work. These post-1758 nomina would be avail-
able, with the authorship “Klein in Behn, 1760”, if this
book was nomenclaturally available, but, for reasons ex-
plained in detail in our Appendix 2 below, we consider that
it should not be considered so.
Several other class-series nomina applying to turtles and
related groups have been published after the works just
mentioned. Establishing the class-series taxa to which
these nomina apply under Dubois’s (2006a) proposed
Rules requires a long and detailed survey that would take
us far beyond the purpose of the present paper and will
be presented elsewhere. For the time being, this work is
not urgent, as the phylogenetic relationships among these
groups, and with the other tetrapods, are currently high-
ly controversial (e.g., Werneburg & Sanchez-Villagra
2009, and included references), and it will be possible to
Bonn zoological Bulletin 57 (2): 149-171
settle a robust nomenclature of these groups only when
some consensus emerges on these questions.
CONCLUSION
The analysis presented above and the examples studied
show that the current Rules of the Code are ambiguous
regarding the allocation of nomina of higher zoological
taxa to either the family-series or the class-series of nom-
ina, and regarding the conditions of availability of fami-
ly-series nomina. These Rules should be improved
through modifications of Article 11.7.1.1 as suggested
above, and mostly through incorporation of Rules for
class-series nomina, as proposed in detail by Dubois
(2006a).
A detailed study of all suprageneric nomina in the work
of Batsch (1788, 1789) shows that this author proposed
many family-series nomina, which belong in three cate-
gories: (C1) nomina clearly based on the stems of avail-
able generic nomina that were considered valid in this
work: such nomina are available in the family-series; (C2)
nomina apparently based on the stems of generic nomina
nomenclaturally available at that time, but not treated as
valid in this work: such nomina are unavailable both in
the family-series and in the class-series; (C3) arhizonyms,
i.e., nomina not based on the stems of any generic nomen
nomenclaturally available at that time: such nomina are
also unavailable both in the family-series and in the class-
series. Nomina of the categories (C2) and (C3) are defi-
nitely unavailable and will never have to be used as valid
in zoological nomenclature. But the nomina of category
(C1) compete for priority with all other family-series sub-
sequently proposed in zoological nomenclature. It so hap-
pens that these 17 nomina are identical with family-series
nomina coined later on and based on the same nucleogen-
era. Therefore they must replace them, which entails no
change in the nomina themselves (and therefore no dis-
ruption of nomenclatural stability) but only modifications
regarding their authors and dates. These changes, listed
in Table 3, should be implemented without delay in the
respective zoological groups where they belong.
This analysis contributes to a clarification of the higher
nomenclature of turtles. The nomen 7ESTUDINES Batsch,
1788 is not a class-series, but a family-series nomen. It
cannot be used for the order of turtles, but is the valid
nomen, under the spelling 7esTUDINIDAE, of the family in-
cluding the genus 7estudo Linnaeus, 1758 and of all oth-
er coordinate taxa as recognized in any given classifica-
tion. As for the order of turtles, establishing the valid
nomen of this taxon and of its superordinate taxa under
the Rules proposed by Dubois (2006a) is beyond the scope
©OZFMK
156 Alain Dubois & Roger Bour
of the present paper, but it is shown here that neither TES-
TUDINES Linnaeus, 1758, nor TESTUDINATA Klein in Behn,
1760, nor TESTUDINES Batsch, 1788, nor CHELONII
Brongniart, 1800a, nor TESTUDINATA Oppel, 1811b apply
to this taxon. As long as the Code does not provide for-
mal Rules for the nomenclature of class-series taxa, the
higher nomenclature of turtles (as well as that of all oth-
er zoological groups) will remain a matter of personal or
collective tastes, opinions and arbitrary decisions of
zootaxonomists. At any rate, whatever Rules or guidelines
are followed, it is impossible and unacceptable under any
nomenclatural philosophy to accept that the nomen 7Es-
TUDINES Batsch, 1788 could be available both for the or-
der of turtles and for the family including the genus Tes-
tudo Linnaeus, 1758.
Acknowledgements. We are grateful to Annemarie Ohler (Paris)
for comments on this work while in progress, and to Franco An-
deone (Torino), Myrianne Brival (Paris), Andrea Kourgli
(Wien) and Victoire Koyamba (Paris) for bibliographic research.
REFERENCES
Anonymous [International Commission on Zoological Nomen-
clature] (1954) Opinion 259. Rejection of the names used by
Mark Catesby in the Natural History of Carolina, as republi-
shed by Edwards in the edition of 1771, but acceptance of na-
mes formed in accordance with the Linnean system inserted
by Edwards in that editon. Opinions and Declarations rende-
red by the International Commission on Zoological Nomen-
clature 5 (20): 253-264
Anonymous [International Commission on Zoological Nomen-
clature] (1964) Opinion 701. Pisidia Leach, 1820, designa-
tion of a type-species under the plenary powers; and Cancer
istrianus Scopoh, 1763, suppressed under the plenary pow-
ers (Crustacea, Decapoda). Bulletin of Zoological Nomencla-
ture 21: 108-110
Anonymous [International Commission on Zoological Nomen-
clature] (1985) International code of zoological nomenclature.
Third edition. International Trust for Zoological Nomencla-
ture, London
Anonymous [International Commission on Zoological Nomen-
clature] (1999) International code of zoological nomenclature.
Fourth edition. International Trust for Zoological Nomencla-
ture, London
Anonymous (2010) The Richmond Index. Washington, D.C, Di-
vision of Birds at the National Museum of Natural History.
Online at http://www.zoonomen.net/cit/RI/Genera/RIGenGt.
html (Version 1.06 (2010.07.03).) last accessed 02-09-2010
Abbazzi L, Carboni S, Delfino M, Gallai G, Lecca L, Rook, L
(2008) Fossil vertebrates (Mammalia and Reptilia) from Capo
Mannu formation (late Pliocene, Sardinia, Italy), with descrip-
tion of a new Testudo (Chelonii, Testudinidae) species. Riv-
ista italiana di paleontologia e stratigrafia 114: 119-132, pl. 1
Agassiz L (1857) Contributions to the natural history of the Uni-
ted States of America. First monograph, volume 1. Little,
Brown & Co., Boston, & Triibner & Co., London
Alderton D (1988) Turtles & tortoises of the world. Facts on file
publications, New York
Bonn zoological Bulletin 57 (2): 149-171
Auffenberg W (1974) Checklist of fossil land tortoises (Testu-
dinidae). Bulletin of the Florida State Museum 18 (3):
121-251
Barboza du Bocage JV (1895) Herpétologie d’Angola et du
Congo. Imprimerie Nationale, Lisbonne
Batsch AJGC (1788) Versuch einer Anleitung, zur KenntniB und
Geschichte der Thiere und Mineralien, fiir akademische Vor-
lesungen entworfen, und mit den néthigsten Abbildungen ver-
sehen. Erster Theil. Allgemeine Geschichte der Natur; beson-
dre der Saugthiere, V6gel, Amphibien und Fische. Akademi-
sche Buchhandlung, Jena
Batsch AJGC (1789) Versuch einer Anleitung, zur Kenntni8 und
Geschichte der Thiere und Mineralien, ftir akademische Vor-
lesungen entworfen, und mit den néthigsten Abbildungen ver-
sehen. Zweyter Theil. Besondre Geschichte der Insekten, Ge-
wurme und Mineralien. Akademische Buchhandlung, Jena
Baur G (1887) Osteologische Notizen tiber Reptilien. Fortzung
II. Zoologischer Anzeiger 10: 97-102
Baur G (1892) Notes on some little known American fossil tur-
tles. Proceedings of the Academy of natural sciences of Phi-
ladelphia [1891] 43: 411-430
Behn FD (1760) Jakob Theodor Kleins (...) Classification und
kurze Geschichte der Vierftigigen Thiere (...). Jonas Schmidt,
Liibeck
Bergounioux FM (1955) Testudinata. In: Piveteau J, Traité de
Paléontologie, Tome V, Amphibiens Reptiles Oiseaux, Mas-
son et Cie, Paris: 487-544
Blumenbach JF (1779) Handbuch der Naturgeschichte. Johann
Christian Dieterich, Géttingen
Boettger O (1893) Katalog der Reptilien-Sammlung 1m Museum
der Senckenbergischen naturforschenden Gesellschaft in
Frankfurt am Main. I. Theil (Rhynchocephalen, Schildkréten,
Krokodile, Eidechsen, Chamialeons). Gebriider Knauer, Frank-
furt am Main
Bonaparte CL (1831) Saggio di una distribuzione metodica de-
gli animali vertebrati. Giornale Arcadico di Scienze, Lettere
ed Arti 52: 1-78 + 129-209
Bonaparte, CLJL (1845) Specchio generale dei sistem erpeto-
logico, anfibiologico ed ittiologico. Luigi di Giacomo Pirola,
Milano
Bonaparte, CL (1850) Conspectus systematum herpetologiae et
amphibiologiae. Editio altera reformata. E. J. Brill, Lugduni
Batavorum
Boulenger GA (1889) Catalogue of the chelonians, rhynchoce-
phalians, and crocodiles in the British Museum (Natural His-
tory). Trustees of the British Museum, London
Boulenger GA (1923) Etude sur les batraciens et les reptiles rap-
portés par M. Henri Gadeau de Kerville de son voyage zoo-
logique en Syrie (avril-juin 1908). J. B. Baillére et fils, Paris
Bour R (1981) Etude systématique du genre endémique malga-
che Pyxis Bell, 1827 (Reptilia, Chelonii). Bulletin mensuel de
la Société linnéenne de Lyon 4: 132—144
Bour R, Dubois A (1985) Nomenclature ordinale et familiale des
Tortues (Reptilia). Studia geologica salmanticensia, vol. es-
pecial 1, Studia palaeocheloniologica, I, Salamanca, Edicio-
nes Universidad: 77-86
Boycott R, Bourquin O (2000) The southern African tortoise
book. O. Bourquin, Hilton
Brisson MJ (1760) Ornithologia sive synopsis methodica sistens
avium divisionem in ordines, sectiones, genera, species, ip-
sarumque varietates. Ornithologie ou méthode contenant la di-
vision des oiseaux en ordres, sections, genres, espéces & leurs
varictés. Tome 1. Cl. Joannem-Baptistam Bauche, Paris
©ZFMK
Family- and class-series nomina in zoology 157
Brisson MJ (1762) Regnum animale in classes IX distributum,
sive synopsis methodica sistens generalem animalium distri-
butionem in classes IX, & duarum primarum classium, qua-
drupedum scilicet & cetaceorum, particularem divisionem in
ordines, sectiones, genera & species. Cum brevi cujusque spe-
ciei descriptione, citationibus auctorum de ts tractantium, no-
minibus eis ab ipsis & nationibus impositis, nominibusque vul-
garibus. Editio altera auctior. Theodorum Haak, Lugduni Ba-
tavorum
Brongniart A (1800a) Essai d’une classification naturelle des rep-
tiles. I°"© partie. Etablissement des ordres. Bulletin des Scien-
ces, par la Société philomathique de Paris 2 (35): 81-82
Brongniart A (1800b) Essai d’une classification naturelle des rep-
tiles. II® partie. Formation et disposition des genres. Bulletin
des Sciences, par la Société philomathique de Paris, 2 (36):
89-91, pl. 6
Bruguiére JG (1789) Histoire naturelle des Vers. Encyclopédie
méthodique. Tome sixiéme. [Vol. 1]. Panckouke, Paris &
Plomteux, Liege
Brinnichius MT (1771) Zoologiz fundamenta przlectionibus
academicis accomodata. Frider. Christ. Pelt, Hafniz et Lip-
sle
Bucquoy E, Dautzenberg P, Dollfus GF (1883) Les Mollusques
marins du Roussillon. Tome 1°. Gastropodes. Fascicule 3. J.-
B. Bailli¢re & Fils, Paris
Catesby M (1771a) The natural history of Carolina, Florida, and
the Bahama Islands: containing the figures of birds, beasts,
fishes, serpents, insects, and plants; particularly, those not hi-
therto described, or incorrectly figured by former authors, with
their descriptions in English and French (...). By the late Mark
Catesby; F.R.S. Revised by Mr. Edwards of the Royal Col-
lege of Surgeons, London. To the whole is now added a Lin-
neean Index of the Animals and Plants. Volume the first. His-
toire naturelle de la Caroline, de la Floride, et des Isles de Ba-
hama: contenant les desseins [sic] des oiseaux, des quadru-
pedes, des poissons, des serpens, des insectes, & des plantes,
qui se trouvent dans ces pays-la; et en particulier, de ceux qui
n ont point été decrits jusqu’a present par les auteurs, ou peu
exactement dessinés. Avec leurs descriptions et Francois et en
Anglois (...) Par Feu Monsieur Mark Catesby, de la Société
Royale, reveue [sic] par Monsieur Edwards, du College Royal
des Medicins [sic] de Londres. Tome I. Benjamm White, London
Catesby M (1771b) The natural history of Carolina, Florida, and
the Bahama Islands: containing the figures of birds, beasts,
fishes, serpents, insects, and plants; particularly, those not hi-
therto described, or incorrectly figured by former authors, with
their descriptions in English and French (...). By the late Mark
Catesby; F.R.S. Revised by Mr. Edwards of the Royal Col-
lege of Surgeons, London. To the whole is now added a Lin-
neean Index of the Animals and Plants. Volume the second.
Histoire naturelle de la Caroline, de la Floride, et des Isles de
Bahama: contenant les desseins [sic] des oiseaux, des quadru-
pedes, des poissons, des serpens, des insectes, & des plantes,
qui se trouvent dans ces pays-la; et en particulier, de ceux qui
n’ont point été decrits jusqu’a present par les auteurs, ou peu
exactement dessinés. Avec leurs descriptions et Francois et en
Anglois (...) Par Feu Monsieur Mark Catesby, de la Société
Royale, reveue [sic] par Monsieur Edwards, du College Royal
des Medicins [sic] de Londres. Tome I. Benjamin White, Lon-
don
Ckhikvazde VM (1970) [On the origin of the modern Palaearctic
land tortoises]. Bulletin of the Academy of Sciences of the
Georgian SSR 75 (1): 245-247. [In Russian]
Cope ED (1875) Check-list of North American Batrachia and
Reptilia; with a systematic list of the higher groups, and an
Bonn zoological Bulletin 57 (2): 149-171
essay on geographical distribution. Based on the specimens
contained in the U. S. National Museum. Bulletin of the Unit-
ed States National Museum 1: i-1 + 1-104
Cuvier G (1800) Lecgons d’anatomie comparée. Tome |. Bau-
douin, Paris
Cuvier G (1802) Lectures on comparative anatomy. Translated
from the French of G. Cuvier (...) by William Ross, under the
inspection of James Macartney (...). Vol. 1. On the organs of
motion. Longman & Rees, London
David P (1994) Liste des Reptiles actuels du monde. I. Chelo-
nil. Dumerilia 1: 7-127
De Blainville H (1816) Prodrome d’une nouvelle distribution
systematique du régne animal. Bulletin des Sciences de la So-
ciété philomatique de Paris, juillet 1816: “105-112” [in fact
113-120] + 121-124
De Blainville H (1847) Sur les principes de la zooclassie ou de
la classification des animaux. Roret, Paris
De Broin F (1982) Chelonii. In: Fabre J, de Broin F, Onsburo
L, Wenz S, Les Vertébrés du Berriasien de Canjuers (Var,
France) et leur environnement, Geobios 15 (6): 897-898
De Geer C (1778) Mémoires pour servir a l’histoire des insec-
tes. Tome septieme. Pierre Hesselberg, Stockholm
De Lapparent de Broin F (2000) The European turtle fauna from
the Triassic to the Present: a short review. Dumerilia 4 (3):
155-216
De Rooy N (1915) The reptiles of the Indo-Australian Archipe-
lago. I. Lacertilia, Chelonia, Emydosauria. E. J. Brill, Leiden
Denys de Montfort P (1810) Conchyliologie systématique, et
Classification méthodique des coquilles (...). Coquilles uni-
valves, non cloisonnées. Tome second. F. Scheell, Paris
Deshayes GP (1824) Cylindre. In: Dictionnaire classique d’ His-
toire naturelle, Tome cinqui¢éme, CRA-D, Rey & Gravier, Bau-
douin Freres, Paris: 236
Draparnaud JPR (1805) Histoire naturelle des Mollusques ter-
restres et fluviatiles de la France, ouvrage posthume. Louis
Colas, Paris
Dubois A (1984) La nomenclature supragénérique des Amphi-
biens Anoures. Mémoires du Muséum national d’ Histoire na-
turelle (A) 131: 1-64
Dubois A (2000) Synonymies and related lists in zoology: ge-
neral proposals, with examples in herpetology. Dumerilia 4
(2): 33-98
Dubois A (2004) The higher nomenclature of recent amphibians.
Alytes 22 (1-2): 1-14
Dubois A (2005a) Propositions pour Il’ incorporation des nomina
de taxons de rang supérieur dans le Code international de no-
menclature zoologique. In: Dubois A, Poncy O, Malécot V,
Léger N (eds.), Comment nommer les taxons de rang supé-
rieur en zoologie et en botanique?, Biosystema 23: 73-96
Dubois A (2005b) Proposed Rules for the incorporation of no-
mina of higher-ranked zoological taxa in the /nternational
Code of Zoological Nomenclature. 1. Some general questions,
concepts and terms of biological nomenclature. Zoosystema
27 (2): 365-426
Dubois A (2005c) Proposals for the incorporation of nomina of
higher-ranked taxa into the Code. Bulletin of zoological No-
menclature 62 (4): 200-209
Dubois A (2006a) Proposed Rules for the incorporation of no-
mina of higher-ranked zoological taxa in the International
Code of Zoological Nomenclature. 2. The proposed Rules and
their rationale. Zoosystema 28 (1): 165-258
Dubois A (2006b) Incorporation of nomina of higher-ranked taxa
into the /nternational Code of Zoological Nomenclature: some
basic questions. Zootaxa 1337: 1-37
OZFMK
158 Alain Dubois & Roger Bour
Dubois A (2006c) Naming taxa from cladograms: a cautionary
tale. Molecular Phylogenetics & Evolution 42: 317-330
Dubois A (2007) Nomina zoologica linnaeana. In: Zhang Z-Q,
Shear WA (eds.), Linnaeus tercentenary: progress in inverte-
brate taxonomy, Zootaxa 1668: 81-106
Dubois A (2008a) Authors of zoological publications and nom-
ina are signatures, not persons. Zootaxa 1771: 63-68.
Dubois A (2008b) Phylogenetic hypotheses, taxa and nomina in
zoology. In: Minelli A, Bonato L, Fusco G (eds.), Updating
the Linnaean heritage: names as tools for thinking about ani-
mals and plants, Zootaxa 1950: 51-86
Dubois A (2009) Incorporation of nomina of higher-ranked taxa
into the /nternational Code of Zoological Nomenclature: the
nomenclatural status of class-series zoological nomina publi-
shed in a non-latinized form. Zootaxa 2106: 1-12
Dubois A (2010) Retroactive changes should be introduced in
the Code only with great care: problems related to the spellings
of nomina. Zootaxa 2426: 1-42
Dubois A, Bour R (2010) The nomenclatural status of the no-
mina of amphibians and reptiles created by Garsault (1764),
with a parsimonious solution to an old nomenclatural problem
regarding the genus Bufo (Amphibia, Anura), comments on
the taxonomy of this genus, and comments on some nomina
created by Laurenti (1768). Zootaxa 2447: 1-52
Dubois A, Ohler A (2009) The status of the amphibian nomina
created by Merrem (1820) and Ritgen (1828). Zootaxa 2247:
1-36
Duméril AMC (1806) Zoologie analytique, ou méthode naturelle
de classification des animaux, rendue plus facile a |’aide de
tableaux synoptiques. Allais, Paris
Duméril AMC, Bibron G (1834) Erpétologie générale ou his-
toire naturelle complete des Reptiles. Tome 1. Roret, Paris
Dumeéril AMC, Bibron G (1835) Erpétologie générale ou his-
toire naturelle complete des Reptiles. Tome 2. Roret, Paris
Dumeéril AMC, Bibron G (1841) Erpétologie générale ou his-
toire naturelle complete des Reptiles. Tome 8. Roret, Paris
Dundee HA (1989) Higher category name usage for amphibians
and reptiles. Systematic Zoology 38 (4): 398-406
Ernst CH, Barbour RW (1989) Turtles of the world. Smithso-
nian institution press, Washington
Fabricius JC (1775) Systema Entomologiz, sistens Insectorum
classes, ordines, genera, species. Libraria Kortii, Flensburgi
et Lipsize
Fischer G (1817) Adversaria zoologica. Fasciculus primus. Quae-
dam ad Mammalium systema et genera illustranda. Mémot-
res de la Société impériale des naturalistes de Moscou 5:
357-446
Fitzinger LJ (1826) Neue Classification der Reptilien. Heubner,
Wien
Fitzinger LJ (1833) Systematisches Verzeichnif der im Erzher-
zogthume Oesterreich vorkommenden Weichthiere, als Pro-
drom einer Fauna derselben. In: Beitrage zur Landeskunde
Oesterreich’s unter der Enns, Wien, in Commission der J.
Beck’schen Universitats-Buchhandlung 3: 88—122
Fitzinger L (1835) Entwurf einer systematischen Anordnung der
Schildkréten nach den Grundsatzen der natiirlichen Methode.
Annalen des Wiener Museums der Naturgeschichte 1:
105-128
Fitzinger LJ (1843) Systema Reptilium. Fasc. 1. Amblyglossae.
Braumiiller & Seidel, Vindobonae
Fitzinger LJ (1867) Bilder-Atlas zur wissenschaftlich-popularen
Naturgeschichte der Wirbelthiere. II. Amphibien. K.K. Hof-
und Staatsdruckerei, Wien
Frank C (2006) Plio-pleistozane und holozane Mollusken Oster-
reichs. Mitteilungen der Prahistorischen Kommission der
Bonn zoological Bulletin 57 (2): 149-171
Osterreichischen Akademie der Wissenschaften Plio-pleisto-
zane und Holozine Mollusken Osterreichs, Wien, Verlag der
Osterreichischen Akademie der Wissenschaften 62: i-xv + 1—
860
Freiberg MA (1938) Catalogo sistematico y descriptivo de las
tortugas argentinas. Memorias del Museo de Entre Rios 9,
Zoologia: 3—23, pl. 1-8
Fritz U, Havas P (2006) Checklist of chelonians of the world.
Dresden, Museum of Zoology
Fritz U, Havas P (2007) Checklist of chelonians of the world.
Vertebrate Zoology 57 (2): 149-368
Fuhn IE, Vancea $ (1961) Fauna Republicii Populare Romine.
Reptilia (Testoase, Sopirle, Serpi). Volumul 19 fascicula 2.
Editura Academiei Republicii Populare Romine, Bucuresti
Gaffney ES (1975) A phylogeny and classification of the higher
categories of turtles. Bulletin of the American Museum of na-
tural History 155 (5): 387-436
Garsault FAP de (1764) Les Figures des plantes et animaux
d’usage en médecine, décrits dans la Matiere Médicale de Mr.
Geoffroy Médecin. Paris
Geoffroy EL (1762) Histoire abrégée des Insectes qui se trou-
vent aux environs de Paris. Tome |. Durand, Paris
Geoffroy Saint-Hilaire E (1809) Mémoire sur les tortues mol-
les. Nouveau Bulletin des Sciences, par la Société philoma-
tique | (22): 363-367
Goeze, JAE (1782) Versuch einer Naturgeschichte der Eingewei-
dewiirmer thierischer K6rper. Philipp Adam Pape, Blanken-
burg
Goeze JAE, Donndorff JA (1797) Europaische Fauna oder Na-
turgeschichte des europdischen Thiere. Weidmann, Leipzig
Goin CJ, Goin OB (1962) Introduction to herpetology. W. H.
Freeman, San Francisco
Goldfuss GA (1820) Handbuch der Zoologie. II. Johann Leon-
hard Schrag, Niirnberg
Gray, JE (1821) On the natural arrangement of vertebrose ani-
mals. London Medical Repository 15: 296-310
Gray JE (1825) A synopsis of the genera of Reptiles and Am-
phibia, with a description of some new species. Annals of Phi-
losophy (2) 10: 193-217
Gray JE (1831a) A synopsis of the species of the class Reptilia.
In: Griffith E et al. The animal kingdom arranged in confor-
mity with its organization, by the Baron Cuvier, member of
the Institute of France, &c. &c. &c., with additional descrip-
tions of all the species hitherto named, and of many not be-
fore noticed, Vol. 9, Whittaker, Treacher & Co., London:
1-110
Gray JE (1831b) Synopsis Reptilium or short descriptions of the
species of Reptiles. Part I. Cataphracta. Tortoises, crocodiles
and enaliosaurians. Treuttel, Wirtz & Co., Sowerby & Wood,
London
Gray JE (1844) Catalogue of the tortoises, crocodiles, and am-
phisbzenians, in the collection of the British Museum. Trus-
tees of the British Museum, London
Gray JE (1855) Catalogue of shield reptiles in the collection of
the British Museum. Part I. Testudinata (tortoises). Trustees
of the British Museum, London
Gray JE (1873) Handlist of the specimens of shield reptiles in
the British Museum. Trustees of the British Museum, London
Griffith E, Pidgeon E (1831) The class Reptilia arranged by the
Baron Cuvier, with specific descriptions. In: Griffith E et al.
The animal kingdom arranged in conformity with its organi-
zation, by the Baron Cuvier, member of the Institute of France,
&c. &c. &c., with additional descriptions of all the species
hitherto named, and of many not before noticed, Vol. 9, Whit-
taker, Treacher & Co., London: 1-481
OZFMK
Family- and class-series nomina in zoology 159
Gueldenstaedt AJ (1770) Spalax, novum Glirium Genus. Novi
Commentari Academiz Scientiarum Imperialis Petropoli-
tane,Tome 14, Pars prior: 409-440, pl. 8—9
Gunther ACLG (1859) On sexual differences found in bones of
some recent and fossil species of frogs and fishes. Annals and
Magazine of Natural History (3) 3: 377-387, pl. 15-16
Gunther ACLG (1864) The Reptiles of British India. Ray So-
ciety, London
Hemprich, FW (1820) Grundrif} der Naturgeschichte fiir hohe-
re Lehranstalten. August Rticker, Berlin
Hogg J (1841) On the existence of branchiae in the young cae-
ciliae; and on a modification and extension of the branchial
classification of the Amphibia. Annals and Magazine of na-
tural History (1) 7: 353-363
Huene F von (1952) Die Saurierwelt und ihre geschichtlichen
Zusammenhange. Gustav Fischer, Jena
Hummel K (1929) Die fossilen Weichschildkréten (Trionychia).
Geologische und paleontologische Abhandlungen 16: 359-487
Hunt TJ (1958) The ordinal name for tortoises, terrapins and tur-
tles. Herpetologica 14 (3): 148-150
Illiger, JKW (1815) Ueberblick der Saugthiere nach ihrer Ver-
theilung tiber die Welttheile. Abhandlungen der physikalischen
Klasse der K6niglich-PreuBischen Akademie der Wissenschaf-
ten aus den Jahren 1804-1811 [1]: 39-159
Iverson JB (1992) A revised checklist with distribution maps of
the turtles of the world. J. Iverson, Richmond
Jan G (1830) Scientiae naturalis cultoribus conspectus method-
icus testaceorum in collectione mea exstantium anno 1830.
Parma
Jiufa Z, Ting Z (1992) Chinese chelonians illustrated. Jiangsu
science and technology publishing house, Nanjing
Joyce WG, Parham JF, Gauthier JA (2004) Developing a pro-
tocol for the conversion of rank-based taxon names to phylo-
genetically defined clade names, as exemplified by turtles.
Journal of Paleontology 78 (5): 989-1013
Keen AM (1971) Sea shells of tropical west America: marine
mollusks from Baja California to Peru. Second edition. Stan-
ford University Press, Stanford
Kennard J (1942) The Histoire and Prodrome of Férussac. Part
III. The divisional names. Journal of molluscan Studies 25 (3):
111-118
King FW, Burke RL (1989) Crocodilian, tuatara, and turtle spe-
cies of the world. Association of Systematics Collections,
Washington
Klein IT (1751) Quadrupedum dispositio brevisque historia na-
turalis. lonam Schmidt, Lipsiae
Kuhn O (1967) Amphibien und Reptilien. G. Fischer, Stuttgart
Kuzmin SL (2002) The turtles of Russia and other ex-Soviet Re-
publics. Edition Chimaira, Frankfurt am Main
Lamarck JB Monet de (1801) Systéme [sic] des animaux sans
vertebres, ou tableau général des classes, des ordres et des gen-
res de ces animaux; présentant leurs caractéres essentiels et
leur distribution, d’apreés la considération de leurs rapports na-
turels et de leur organisation. Déterville, Paris
Latreille (1800) Histoire naturelle des salamandres de France,
précédée d’un tableau méthodique des autres reptiles. Villier,
Paris
Latreille PA (1802) Histoire naturelle, générale et particuliére des
crustacés et des insectes. Ouvrage faisant suite a histoire na-
turelle générale et particuli¢re, composée par Leclerc de Buf-
fon, et rédigée par C. S. Sonnini, membre de plusieurs sociétés
savantes. III. F. Dufart, Paris
Latreille (1810) Considérations générales sur |’ ordre naturel des
crustacés, arachnides et insectes. Avec un tableau méthodique
de leurs genres disposés en familles. F. Scheell, Paris
Bonn zoological Bulletin 57 (2): 149-171
Latreille (1824) Esquisse d’une distribution générale du regne
animal. Agasse, Paris
Latreille (1825) Familles naturelles du régne animal. Bailliére,
Paris
Laurenti JN (1768) Specimen medicum, exhibens synopsin Rep-
tilium emendatam cum experimentis circa venena et antidota
Reptilium austriacorum. Joan. Thom. Nob. de Trattnern, Vien-
nae
Linnaeus C (1758) Systema Nature. per regna tria nature, se-
cundum classes, ordines, genera, species, cum characteribus,
differentiis, synonymis, locis. Editio decima, reformata. To-
mus I. Laurentii Salvii, Holmiz
Linnaeus C (1759) Systema Nature per regna tria nature, se-
cundum classes, ordines, genera, species, cum characteribus,
differentiis, synonymis, locis. Editio decima, reformata. To-
mus II. Laurentii Salvi, Holmiz
Linnaeus C (1761) Fauna Svecica. Editio altera, auctior. Lau-
rentii Salvii, Stocholmiz
Linneeus C (1764) Museum S:z R:z M:tis Adolphi Friderici Re-
gis Svecorum, Gothorum, Vandalorumque &c. &c. &c. in quo
Animalia rariora imprimis & exotica: Aves, Amphibia, Pisces
describuntur. Tomi Secundi Prodromus. Laurenti Salvi, Hol-
mize
Linnaeus C (1766) Systema Nature. Editio duodecima, refor-
mata. Tomus I, Pars I. Laurentii Salvii, Holmiz
Linnaeus C (1767) Systema Nature. Editio duodecima, refor-
mata. Tomus I, Pars I. Laurentii Salvii, Holmiz
Loveridge A (1957) Check list of the reptiles and amphibians
of East Africa (Uganda; Kenya; Tanganyika; Zanzibar). Bul-
letin of the Museum of comparative Zoology 117 (2): 151-362
+ 1-XXXVI
Loveridge A, Williams EE (1957) Revision of the African tor-
toises and turtles of the suborder Cryptodira. Bulletin of the
Museum of comparative Zoology 115 (6): 163-557, pl. 1-18
Mendes da Costa E (1776) Elements of Conchology: or, an in-
troduction to the Knowledge of Shells. Benjamin White, Lon-
don
Mendes da Costa E (1778) Historia Naturalis Testaceorum Bri-
tanniz, or The British Conchology. Millan, B. White, Elms-
ley & Robson, London
Merrem B (1820) Versuch eines Systems der Amphibien. Ten-
tamen systematis amphibiorum. Iohann Christian Krieger,
Marburg
Mertens R, Miller L (1928) Liste der Amphibien und Reptilien
Europas. Abhandlungen der senckenbergischen Naturfor-
schenden Gesellschaft 41: 1-62
Mertens R, Wermuth H (1955) Die rezenten Schildkréten, Kro-
kodile und Briickenechsen. Zoologischer Jahrbticher 83 (5):
323-440
Mickoleit G (2004) Phylogenetische Systematik der Wirbeltie-
re. Dr. Friedrich Pfeil, Mtinchen
Mtynarski M (1976) Handbuch der Palaoherpetologie. 7. Testu-
dines. G. Fisher, Stuttgart & New York
Miller OF (1771) Von Wiirmern des stissen und salzigen Was-
sers. Heineck und Faber, Kopenhagen
Miller OF (1773) Vermium terrestrium et fluviatilium, seu ani-
malium infusoriorum, helminthicorum et testaceorum, non
marinorum, succincta historia. Vol. I pars I. Heineck et Fa-
ber, Hauniz et Lipsize
Miiller OF (1776) Zoologiz Danicz prodromus, seu animalium
Daniz et Norvegiz indigenarum characteres, nomina, et sy-
nonyma imprimis popularium. Typis Hallageriis, Haunize
Miller OF (1777) Zoologiz Danicz, seu animalium Danie et
Norvegiz rariorum ac minus notorum icones. Fasciculus pri-
mus. Typis Mart. Hallageri, Hauniz
OZFMK
160 Alain Dubois & Roger Bour
Noriega JI, Manzano AS, De La Fuente M, Tonni EP (2000) Un
Testudinidae gigante (Chelonii: Cryptodira) del Pleistoceno
de la provincia de Corrientes, Argentina. Ameghiniana 37 (3):
321-326
Nutaphand W (1979) The turtles of Thailand. Siamfarm zoolo-
gical garden, Bangkok
Oken L (1821) Esquisse du systeme d’anatomie, de physiolo-
gie et d’histoire naturelle. Béchet Jeune, Paris
Oken L (1833) Allgemeine Naturgeschichte fiir alle Staénde. Vier-
ter Band. Thierreich, erster Band. Carl Hoffmann, Stuttgart
Oppel M (181 1a) Ordre II. Reptiles a écailles. Section 2. Ophi-
diens. Annales du Muséum d’Histoire naturelle [1810] 16:
254-295 + 376-393
Oppel M (1811b) Ordnungen, Familien und Gattungen der Rep-
tilien als Prodrom einer Naturgeschichte derselben. Joseph
Lindauer, Miinchen
Pallas PS (1766a) [March] Elenchus Zoophytorum sistens ge-
nerum adumbrationes generaliores et specierum cognitarum
succinctas descriptiones cum selectis auctorum synonymis.
Franciscum Varrentrapp, Hagee Comitum
Pallas PS (1766b) [November] Miscellanea zoologica quibus
nove imprimis atque obscure animalium species describun-
tur et observationibus iconibusque illustrantur. Petrum Van
Cleef, Hagee Comitum
Peters WCH (1862) Uber die von dem so frith in Afrika verstor-
benen Freiherrn von Barnim und Dr. Hartmann auf ihrer Reise
durch Aegypten, Nubien und dem Sennar gesammelten Am-
phibien. Monatsberichte der kéniglich preussischen Akademie
der Wissenschaften zu Berlin 1862: 271-279, | pl.
Peters WCH (1882) Naturwissenschaftliche Reise nach Mossam-
bique auf Befehl seiner Majestat des K6nigs Friedrich Wil-
helm IV in den Jahren 1842 bis 1848 ausgeftihrt. Zoologie.
IH. Amphibien. G. Reimer, Berlin
Philipsson LM (1788) Dissertatio historico—naturalis sistens nova
testaceorum genera. Quam venia ampliss. Facult. Philoso-
phic preside D. M. Andr. J. Retzio (...) ad publicum exa-
men desert Laurentius Miinter Philipsson scanus. Typis Ber-
lingianis, Lundz
Pitt WD, James MJ, Hixckman CS, Lipps JH, Pittr LJ (1986)
Late Cenozoic marine molluscs from cones in the Galapagos
Islands. Proceedings of the California Academy of Sciences
44 (12): 269-282
Pough FH, Andrews RM, Cadle JE, Crump ML, Savitzky AH,
Wells KD (2004) Herpetology. Third edition. Pearson, Upper
Saddle River (NJ)
Pritchard PCH (1967) Living turtles of the world. T.F.H. publi-
cations, Neptune City (NJ)
Pritchard PCH (2007) Evolutionary relationships, osteology,
morphology, and zoogeography of ridley sea turtles. Pp. 45-57
in: Plotkin PT, Biology and conservation of ridley sea turtles.
The Johns Hopkins University Press, Baltimore (MD)
Pritchard PCH, Trebbau P (1984) The turtles of Venezuela.
SSAR, Athens (OH)
Rafinesque CS (1815) Analyse de la nature ou Tableau de l’uni-
vers et des corps organisés. Jean Barravecchia, Palerme
Rafinesque-Schmaltz CS (1814a) O quadro del metodo sinot-
tico di somiologia. Specchio delle Scienze o Giornale enci-
clopedico di Sicilia 1 (1): 11-15
Rafinesque-Schmaltz CS (1814b) Principes généraux de Somio-
logie ou les loix [sic] de la nomenclature et de la classifica-
tion de l’empire organique ou des animaux et des végétaux,
contenant les régles essentielles de l’art de leur imposer des
noms immuables et de les classer méthodiquement. Franc.
Abate, Palerme
Bonn zoological Bulletin 57 (2): 149-171
Rafinesque-Schmaltz CS (1814c) Prodrono [sic] di Erpetologia
Siciliana. Specchio delle Scienze 0 Giornale enciclopedico di
Sicilia 2 (9): 65-67
Rafinesque-Schmaltz CS (1814d) Fine del Prodromo d’Erpeto-
logia Siciliana. Specchio delle Scienze o Giornale enciclope-
dico di Sicilia 2 (10): 102-104
Rhodin AGJ, Parham JF, van Dik PP, Iverson JB (2009) Tur-
tles of the world: annotated checklist of taxonomy and syno-
nymy, 2009 update, with conservation status summary. Che-
lonian Research Monographs 5: 39-84
Rhodin AGJ, van Dijk PP, Parham JF (2008) Turtles of the world:
annotated checklist of taxonomy and synonymy. Chelonian
Research Monographs 5: 1-38
Richard E (1999) Tortugas de las regiones aridas de Argentina.
LOLA, Buenos Aires
Ritgen FA (1828) Versuch einer nattirlichen Eintheilung der
Voégel. Nova Acta physico-medica Academiae Caesareae
Leopoldino-Carolinae Naturae Curiosorum 14: 245-284.
Réding PF (1798) Museum Boltenianum sive Catalogus cime-
liorum e tribus regnis natures. Pars secunda. Typis Johan.
Christi. Trappii, Hamburgi
Roederer JG (1761) [Untitled]. Géttingische Anzeigen von ge-
lehrten Sachen | (25): 243-246
Romer AS (1956) Osteology of the Reptiles. The University of
Chicago Press, Chicago
Romer AS (1966) Vertebrate paleontology. 3rd edition. The Uni-
versity of Chicago Press, Chicago & London
Rtippel E (1843) Verzeichniss der in dem Museum der Sencken-
bergischen naturforschenden Gesellschaft aufgestellten Samm-
lungen. Dritte Abtheilung: Amphibien. Museum Sencken-
bergianum. Abhandlungen aus dem Gebiete de beschreiben-
den Naturgeschichte 3: 293-316.
Schmidt KP (1953) A check list of North American amphibians
and reptiles. Sixth edition. American Society of Ichthyology
& Herpetology, Chicago
Schultze CF (1760) Betrachtung der versteinerten Seesterne und
ihrer Theile. Michael Groéll, Warschau & Dresden
Scopoli GA (1777) Introductio ad Historiam naturalem sistens
Genera lapidum, plantarum, et animalium. Wolfgangum Gerle,
Bibliopolam, Prage
Sherborn CD (1902) Index animalium sive index nominum quae
ab A.D. MDCCLVIII generibus et speciebus animalium im-
posita sunt. Sectio prima a kalendis ianuariis, MDCCLVIII us-
que ad finem decembris, MDCCC. Typographio Academico,
Cantabrigiae
Siebenrock F (1909) Synopsis der rezenten Schildkroten, mit Be-
riicksichtigung der in historischer Zeit ausgestorbenen Arten.
Zoologische Jarbiicher (Suppl. 10) 3: 427-618
Simpson GG (1940) Types in modern taxonomy. American Jour-
nal of Science 238: 413-431
Smith HM, Taylor EH (1950) An annotated checklist and key
to the reptiles of Mexico exclusive of the snakes. United Sta-
tes National Museum, Bulletin 199: 11—v + 1-253
Smith MA (1933) The fauna of British India, including Ceylon
and Burma. Reptilia and Amphibia. Vol. 1, Loricata, Testudi-
nes. Taylor & Francis, London
Sonnerat (1777) Reise nach Neuguinea, aus dem Franzéschen
tibersazt von J. P. Ebeling, der Arzeygehlarheit Beflissenen.
Weygandschen Buchhandlung, Leipzig
Stannius H (1856) Handbuch der Anatomie der Wirbelthiere. 2.
Zootomie der Amphibien. In: Von Siebold CT, Stannius H,
Handbuch der Zootomie, Vol. 1. von Weit & Comp., Berlin
Starobogatov YI (1991) Problems in the nomenclature of higher
taxonomic categories. Bulletin of zoological Nomenclature 48:
6-18
©OZFMK
Family- and class-series nomina in zoology 161
Statius Miller PL (1766) Delicize Naturze Selecte oder auserle-
senes Naturalien—Cabinet welches aus den drey Reichen der
Natur zeiget, was von curidsen Liebhabern aufbehalten und
gesammelt zu werden verdienet. Ehemals herausgegeben von
Georg Wolfgang Knorr beriihmten Kupferstecher in Niirnberg,
fortgesetzt von dessen Erben, beschrieben von Phillip Lud-
wig Statius Miller (...), und in das Franzésiche tibersetzt von
Matthaus Verdier de la Blaquiere (...). Knorr, Niirnberg
Steyneger L (1907) Herpetology of Japan and adjacent territory.
Bulletin of the United States national Museum 58: 1-xx +
1=577, pl. 1-35
Stejneger L, Barbour T (1917) A check list of North American
amphibians and reptiles. Harvard University Press, Cambridge
Strauch A (1862) Chelonologische Studien, mit besonderer Be-
ziehung auf die Schildkr6tensammlung der kaiserlichen Aka-
demie der Wissenschaften zu St.-Petersburg. Mémoires de
1’ Académie impériale des Sciences de Saint Petersburg (7) 5
(7): 1-196, 1 pl.
Strauch A (1865) Die Vertheilung der Schildkréten tiber den Erd-
ball. Ein zoographischer Versuch. Mémoires de I’ Académie
impériale des Sciences de Saint Petersburg (7) 8 (13): 1-207
Strauch A (1890) Bemerkungen tiber die im zoologischen Mu-
seum Schildkr6tensammlung der kaiserlichen Akademie der
Wissenschaften zu St.-Petersburg. Mémoires de I’ Académie
impériale des Sciences de Saint Petersburg (7) 38 (2): 1-127,
pl. 14
Swainson W (1835) A treatise on the geography and classifica-
tion of animals. In: Lardner D. (ed.), The cabinet cyclopae-
dia, Longman et al., London
Terent’ev PV, Chernov SA (1949) Key to amphibians and rep-
tiles. 3rd, enlarged edition. Translated from Russian [1965].
Israel program for scientific translations, Jerusalem
Troschel FH (1866) Bericht tiber die Leistungen in der Herpe-
tologie wahrend des Jahres 1865. Archiv ftir Naturgeschich-
te 32 (2): 180-192
Tschudi JJ von (1838) Classification der Batrachier, mit Bertick-
sichtigung der fossilen Thiere dieser Abtheilung der Reptilien.
Petitpierre, Neuchatel
Vanni S, Nistri A (2006) Atlante degli anfibi e dei rettili della
Toscana. Museo di storia naturale, Sezione di Zoologia La
Specola, Firenze
Vetter H (2002) Turtles of the World Vol. 1. Schildkréten der Welt
Band 1. Africa, Europe and Eastern Asia — Afrika, Europa und
Westasien. Chimaira, Frankfurt am Main
Vetter H (2004) Turtles of the World Vol. 2. Schildkréten der Welt
Band 2. North Anerica — Nordamerika. Chimaira, Frankfurt
am Main
Vetter H, van Dijk PP (2006) Turtles of the World Vol. 4. Schild-
kroten der Welt Band 4. East und South Asia — Ost- und Siid-
asien. Chimaira, Frankfurt am Main
Vieillot LP (1816) Analyse d’une nouvelle ornithologie élémen-
taire. Déterville, Paris
Bonn zoological Bulletin 57 (2): 149-171
Vigors NA (1825) Sketches in ornithology; or, observations on
the leading affinities of some of the more extensive groups
of birds. Zoological Journal 2: 368—405
Voet JE (1793) Ioannis Eusebii Voetii Icones et Descriptiones
Coleopterorum — Johann Euseb Voets Beschreibungen und Ab-
bildungen hartschaaligter Insecten Coleoptera Linn. Zweyter
Theil. Johann Jakob Palm, Erlangen
Voet JE (1806) Catalogus systematicus Coleopterorum — Cata-
logue systématique des Coléopteres — Systematische naam-
lyst van dat geslacht van Insecten dat men torren noemt. To-
mus primus. G. Bakhuysen, La Haye
Wagler JG (1828) Conspectus Systematis Amphibiorum. Isis von
Oken 21: 859-861
Wagler J (1830) Natiirliches System der Amphibien, mit voran-
gehender Classification der Saugethiere und Vogel. Cotta,
Munchen, Stuttgart & Tubingen
Webb JE, Wallwork JA, Elgood JH (1978) Guide to living rep-
tiles. Macmillan, London
Welch KRG (1982) Herpetology of Africa. Robert E. Krieger,
Malabar (FL)
Wermuth H, Mertens, R (1961) Schildkréten Krokodile Briicke-
nechsen. VEB Gustav Fischer Verlag, Jena
Werneburg I, Sanchez-Villagra MR (2009) Timing of organo-
genesis support basal position of turtles in the amniote tree
of life. BMC Evolutionary Biology 9, 82: 1—9. Online at
http://www.biomedcentral.com/1471-2148/9/82
(doi:10.1186/1471-2148-9-82) last accessed 08-02-2010
Westwood JO (1840) An introduction to the modern classifica-
tion of insects; founded on the natural habits and correspon-
ding organisation of the different families. Longman, Orme,
Brown, Green & Longman, London
Wiegmann AFA, Ruthe JF (1843) Handbuch der Zoologie.
Zweyte Auflage von FH Troschel und JF Ruthe. C. G. Liide-
ritz, Berlin
Wieland F (2010) Gralla Sonnerat, 1777. Goettingen, Animal-
Base. Online at http://www.animalbase.uni-goettingen.de
/zooweb/servlet/AnimalBase/home/genustaxon?id=4111 last
accessed 08-02-2010
Winckworth R (1945) The types of the Boltenian genera. Jour-
nal of molluscan Studies 26: 136-148
Xianrui Y (1994) Fossil and recent turtles of China. Science
Press, Beijing
Yeh HK (1963) Fossil turtles of China. Paleontologica sinica 150
(N.S.C. 18): i-iv + 1-112, pl. 1-21
Zhao E, Adler K (1993) Herpetology of China. Contributions to
Herpetology, Nr. 10. Society for the Study of Amphibians and
Reptiles, Athens (OH)
Zimmermann EAW von (1780) Geographische Geschichte des
Menschen, und der vierftiBigen Thiere. Zweiter Band. Wey-
gandschen Buchhandlung, Leipzig
Received: 10. VII.2010
Accepted: 25.1X.2010
©ZFMK
162
APPENDIX 1
Table 1.
Alain Dubois & Roger Bour
Chronological presentation of the family-series and class-series nomina used in various publications for the order of
turtles and for the family including the genus Zestudo Linnaeus, 1758. The authors and dates are mentioned below only when they
were so in the works cited. Nomina connected by the sign <> are allelonyms (Dubois 2006a), i.e., alternative nomina proposed or
used by an author in the same publication for the same taxon (same content and taxonomic rank), without choosing between them.
Reference
Nomen used for the order (or for a class-series
taxon of another rank) of turtles
Nomen used for the family including
the genus Zestudo Linnaeus, 1758
Batsch 1788: 437
Brongniart 1800a: 81
Latreille 1800: xi
Ross & Macartney in Cuvier 1802: tab. 3
Dumeéril 1806: 76
Oppel 1811b: 4, 6
Rafinesque-Schmaltz 1814c: 66
Rafinesque 1815: 74
Merrem 1820: 6, 7, 12, 17
Latreille 1825: 91
Gray 1825: 194, 210
Fitzinger 1826: 5
Ritgen 1828: 269, 270
Wagler 1828: 861
Wagler 1830: 130
Bonaparte 1831: 63, 68
Griffith & Pidgeon 1831: 4, 6
Gray 183la: 2
Gray 1831b: 3, 7
Duméril & Bibron 1834: 346, 352
Dumeéril & Bibron 1835: 1
Fitzinger 1835: 107
Fitzinger 1843: 29
Ruippel 1843: 297
Wiegmann & Ruthe 1843: 166, 168
Gray 1844: 3
Bonaparte 1845: 3
Bonaparte 1850: pl.
Gray 1855: title page, 1, 4
Agassiz 1857: 235, 249
Gunther 1859: 379
Peters 1862: 271
Strauch 1862: 19, 20
Gunther 1864: x, 1, 3
Strauch 1865: 205
Troschel 1866: 182
Fitzinger 1867: 85
Gray 1873: iv, 1
Cope 1875: 50, 54
Peters 1882: 2
Baur 1887: 96, 101
Boulenger 1889: 4, 48
Strauch 1890: 9, 10
Baur 1892: 419, 420
Boettger 1893: 2, 3
Barboza du Bocage 1895: |
Steyneger 1907: 483, 488
Siebenrock 1909: 429
De Rooij 1915: 285, 288
Stejneger & Barbour 1917: 113
Boulenger 1923: 42
CHELONIENS
CHELONII
CHELONIA
CHELONII
TESTUDINATA Klein, 1751
PEROSTIA
PEROSTIA
TESTUDINATA Oppel, 1811
CHELONII
CHELONII Latreille, 1800
Monopnoa [including tribe TestupINaATA Klein, 1751]
CHELONII <> STERRICHROTES
CHELYNAE
TESTUDINES
CHELONII
CHELONIA
TESTUDINATA
CHELONII
CHELONIENS Brongniart, 1800
CHELONIENS Brongniart, 1800
MONOPNOA
TYLOPODA Wagler, 1828
CHELONII
CHELONII
CHELONIA
CHELONII
CHELONII
TESTUDINATA Oppel, 1811 <* CHELONIA Gray, 1835 [sic]
TESTUDINATA Klein, 1751
CHELONII
CHELONII
CHELONIA
CHELONIA
CHELONII
CHELONII
TESTUDINATA
TESTUDINATA
CHELONI <> TESTUDINATA
TESTUDINATA
CHELONIA Brongniart, 1800
CHELONIA
TESTUDINATA
CHELONIA
CHELONIA
TESTUDINATA Oppel, 1811
TESTUDINATA Oppel, 1811
CHELONIA
TESTUDINATA Oppel, 1811
CHELONIA
TESTUDINES
AMYDAE
TESTUDIA
TESTUDIA
CRYPTOPODI
TESTUDINIDAE
TESTUDINOIDEA
CHERSOCHELONES <*> DYSMYDAE
TYLOPODAE
HEDRAEOGLOSSAE
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE Gray, 1825
“CHERSITES”
“CHERSITES”
TYLOPODA
TESTUDINES
CHERSINAE
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE
TESTUDININA Bonaparte, 1831
TESTUDINIDAE
TESTUDINIDA
TESTUDINIDAE
TESTUDINIDA
TESTUDINIDA
CHERSINAE
TESTUDINIDAE
TESTUDINIDAE
TESTUDININA
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDA
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE Gray 1825
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE
Bonn zoological Bulletin 57 (2): 149-171
©ZFMK
Reference
Family- and class-series nomina in zoology
Nomen used for the order (or for a class-series
taxon of another rank) of turtles
163
Nomen used for the family including
the genus Zestudo Linnaeus, 1758
Mertens & Miller 1928: 20
Smith 1933: 49, 136
Freiberg 1938: 7, 9
Terente’v & Chernov 1949: 88, 95
Smith & Taylor 1950: 12, 27
Schmidt 1953: 86, 104
Bergounioux 1955: 187, 508
Mertens & Wermuth 1955: 333, 370
Romer 1956: 495, 504
Loveridge 1957: 163
Loveridge & Williams 1957: 175, 181
Hunt 1958: 150
Wermuth & Mertens 1961: 1, 171
Fuhn & Vancea 1961: 157, 158
Goin & Goin 1962: 73, 254
Yeh, 1963: 7, 27
Romer 1966: 365
Kuhn 1967: 114
Pritchard 1967: 27
Ckhikvazde 1970: 245
Auffenberg 1974: 140
Gaffney 1975: 423
Mtynarski 1976: 6
Webb et al. 1978: vii
Nutaphand 1979: 13, 55
Bour 1981: 133
De Broin 1982: 897
Welch 1982: 206, 207
Pritchard & Trebbau 1984: 11, 197
Bour & Dubois 1985: 78
Alderton 1988: 108
Dundee 1989: 403
Ernst & Barbour 1989: 3, 227
King & Burke 1989: 16, 69
Jiufa & Ting, 1992: 1, 4
Iverson, 1992: 3,
Zhao & Adler, 1993: 164, 171
David 1994: 16, 18
Xianrui 1994: 4, 62
Richard 1999: 85
Boycott & Bourquin 2000: 32
De Lapparent de Broin 2001: 166, 187
Noriega et al. 2000: 321
Kuzmin 2002: 17, 84
Vetter 2002: 3, 5
Mickoleit 2004: 282, 294
Pough et al. 2004: 97, 109
Vetter 2004: 3, 8
Vanni & Nistri 2006: 23
Fritz & Havas 2006: 10, 122
Vetter & van Dijk 2006: 3, 8
Fritz & Havas 2007: 163, 265
Pritchard 2007: 46
Abbazzi et al. 2008: 123
Rhodin et al. 2008: 2, 12
Rhodin et al. 2009: 42, 52
TESTUDINATA Oppel, 1811
TESTUDINES Batsch, 1788
TESTUDINATA Oppel, 1811
CHELONIA [in subclass TESTUDINES |
TESTUDINES Batsch, 1788
CHELONIA
CHELONIA [in subclass TESTUDINATA ]
TESTUDINES
CHELONIA <> TESTUDINATA
TESTUDINATA Oppel, 1811
TESTUDINATA
TESTUDINES Linnaeus, 1758
TESTUDINES
TESTUDINES Batsch, 1788
TESTUDINATA
CHELONIA
CHELONIA Macartney, 1802
TESTUDINES Batsch, 1788
CHELONIA
CHELONIA
TESTUDINATA Shaw, 1802
TESTUDINES Batsch, 1788
TESTUDINES Batsch, 1788
CHELONIA
CHELONIA <> TESTUDINES
CHELONII
CHELONII Brongniart, 1800
CHELONIA
TESTUDINES
CHELONII Brongniart, 1800
CHELONIA
TESTUDINES
TESTUDINES
TESTUDINES Batsch, 1788
TESTUDINATA
TESTUDINES Linnaeus, 1758
TESTUDINES
CHELONI Brongniart, 1800
TESTUDINES Linnaeus, 1758
CHELONI Brongniart, 1800
CHELONIA <> TESTUDINES
CHELONI Brongniart, 1800
CHELONII
TESTUDINES
TESTUDINES Linnaeus, 1758
CHELONIA «> TESTUDINES
TESTUDINES <> CHELONIA
TESTUDINES Linnaeus, 1758
CHELONI Brongniart, 1800
TESTUDINES Batsch, 1788
TESTUDINES Batsch, 1788
TESTUDINES Batsch, 1788
CHELONII Latreille, 1800 <* CHELONIA Macartney, 1802
<> TESTUDINES [neither Linnaeus, 1758, nor Batsch, 1788]
CHELONH Brongniart, 1800
TESTUDINES Batsch, 1788
TESTUDINES Batsch, 1788
TESTUDINIDAE
TESTUDINIDAE Gray, 1825
TESTUDINIDAE Gray, 1825
TESTUDINIDAE
TESTUDINIDAE Gray, 1825
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE Gray, 1825
TESTUDINIDAE Gray, 1825
TESTUDINIDAE
TESTUDINIDAE Gray, 1825
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE Gray, 1825
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE Gray, 1825
TESTUDINIDAE Gray, 1825
TESTUDINIDAE Gray, 1825
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE Gray, 1825
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE Gray, 1825
TESTUDINIDAE
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE Gray, 1825
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE
TESTUDINIDAE
TESTUDINIDAE Rafinesque, 1815
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE Batsch, 1788
TESTUDINIDAE Batsch, 1788
Bonn zoological Bulletin 57 (2): 149-171
©ZFMK
164 Alain Dubois & Roger Bour
Table 2. The supraspecific taxa of animals listed in Batsch (1788, 1789). The animals are distributed in two class-series taxa,
OsseA and Crustacea, for which no ranks are given in this book; they are here referred to the rank “superclassis”. All other ranks
are mentioned expressly in Batsch (1788, 1789). Nomina connected by the sign <> are allelonyms (Dubois 2006a), i.e., alternative
nomina proposed by an author in the same publication for the same taxon (same content, onomatophore and taxonomic rank), with-
out choosing between them. The generic nomina are given here under their original spelling (protonym; Dubois 2000), with men-
tion between parenthesis of the subsequent spelling (aponym; Dubois 2000) used by Batsch, whenever relevant. All these generic
nomina had been created by Linnaeus (1758) or in subsequent works published before those of Batsch, except three, followed here
by the sign +, which were made nomenclaturally available by Batsch (1789), and the status of which is discussed below in Appen-
dix 1. This appendix also discusses the status of three post-Linnean generic nomina, followed by the sign ‘¢, which we consider
here nomenclaturally unavailable. The familial nomina created by Batsch (1788, 1789) are of three kinds: (1) a familial nomen un-
derlined in this Table was clearly based on the nomen (also underlined) of a genus expressly referred by Batsch to the familia as
a valid nomen, which is therefore its nucleogenus (type-genus) by implicit etymological designation (Dubois 1984), thus making
this family-series nomen available under Art. 11.7.1.1; (2) a familial nomen followed by an asterisk * can be considered derived
from the nomen of a genus traditionally referred to the same taxonomic group, but not used as valid by Batsch, being probably
considered a synonym of another nomen; this generic nomen is listed between square brackets, also followed by *, after the list
of the valid genera of the family according to Batsch; such a family-series nomen, being based on a generic nomen considered in-
valid by Batsch, is unavailable under Art. 11.7.1.1, thus shown “between quotation marks”; (3) a familial nomen followed by the
sign ° is an arhizonym (Dubois 2006a: 178), 1.e., cannot be construed as being based on a then available generic nomen and is
therefore unavailable under Art. 11.7.1.1, thus also shown “between quotation marks”.
“Superclassis” OssEA Batsch, 1788: 81.
Classis MAMMALIA Batsch, 1788: 87.
Ordo Bruta Batsch, 1788: 103.
Familia “Cozossr’° Batsch, 1788: 107.
Genera (2): Elephas Linnaeus, 1758: 18; Rhinoceros Linnaeus, 1758: 19.
Familia “CaT4PHrAcTA’* Batsch, 1788: 107.
Genera (2): Dasypus Linnaeus, 1758: 18; Manis Linnaeus, 1758: 18. [Cataphractus* Brisson, 1762: 12-13].
Familia BraDyPopa Batsch, 1788: 108.
Genera (2): Bradypus Linnaeus, 1758: 18; Myrmecophaga Linnaeus, 1758: 18.
Ordo Pecora Batsch, 1788: 103.
Familia “Ovina’’* Batsch, 1788: 105.
Genera (2): Camelus Linnaeus, 1758: 19; Capra Linnaeus, 1758: 19. [Ovis* Linnaeus, 1758: 19].
Familia CERVINA Batsch, 1788: 105.
Genera (4): Antilope Pallas, 1766b: 232; Bos Linnaeus, 1758: 19; Cervus Linnaeus, 1758: 19; Moschus Linnaeus, 1758: 19.
Ordo GLIRES Batsch, 1788: 103.
Familia Murina Batsch, 1788: 115.
Genus (1): Mus Linnaeus, 1758: 19.
Familia LEPORINA Batsch, 1788: 115.
Genera (4): Cavia Pallas, 1766b: 30; Lepus Linnaeus, 1758: 19; Marmota Blumenbach, 1779: 79; Spalax Gueldenstaedt, 1770:
409.
Familia SC/URINA Batsch, 1788: 115.
Genera (3): Dipus Zimmermann, 1780: 354; Glis Brisson, 1762: 13, 113; Sciurus Linnaeus, 1758: 19.
Familia C4s7orREA Batsch, 1788: 115.
Genera (2): Castor Linnaeus, 1758: 19; Hystrix Linnaeus, 1758: 19.
Ordo Primates Batsch, 1788: 103.
Familia “PrimaTes’’° Batsch, 1788: 108.
Genera (3): Homo Linnaeus, 1758: 18; Lemur Linnaeus, 1758: 18; Simia Linnaeus, 1758: 18.
Ordo FERAE Batsch, 1788: 103.
Familia FELINA Batsch, 1788: 110.
Genus (1): Fe/is Linnaeus, 1758: 18.
Familia Canina Batsch, 1788: 110.
Genera (2): Canis Linnaeus, 1758: 18; Hyaena Brisson, 1762: 13, 168.
Familia Ursivé Batsch, 1788: 110.
Genus (1): Ursus Linnaeus, 1758: 18.
Familia MUSTELINA Batsch, 1788: 110.
Genera (3): Lutra Brisson, 1762: 13, 201; Mustela Linnaeus, 1758: 18; Viverra Linnaeus, 1758: 18.
Ordo BELLUAE Batsch, 1788: 103.
Familia “BELLUAE”® Batsch, 1788: 105.
Genera (4): Equus Linnaeus, 1758: 19; Hippopotamus Linnaeus, 1758: 19; Hydrochoerus Brisson, 1762: 12, 80 (as Hydrochae-
rus); Sus Linnaeus, 1758: 18.
Ordo Rosores Batsch, 1788: 103.
Familia Z4LPinA Batsch, 1788: 113.
Genera (3): Erinaceus Linnaeus, 1758: 18; Sorex Linnaeus, 1758: 18; Za/pa Linnaeus, 1758: 18.
Familia “PTEROPoDA’* Batsch, 1788: 105.
Genus (1): Vespertilio Linnaeus, 1758: 18. [Pteropus* Brisson, 1762: 13, 153].
Bonn zoological Bulletin 57 (2): 149-171 ©ZFMK
Family- and class-series nomina in zoology 165
Familia “MarsuPidALes”* Batsch, 1788: 105.
Genus (1): Didelphis Linnaeus, 1758: 18 (as Didelphys). [“Marsupiale”*: Edward in Catesby, 1771].
Ordo PINNIPEDA Batsch, 1788: 103.
Familia “P/NN/PEDA’’° Batsch, 1788: 116.
Genera (3): Phoca Linnaeus, 1758: 18; Rosmarus Briinnichius, 1771: 34; Trichechus Linnaeus, 1758: 18 (as Trichecus).
Ordo CETACEA Batsch, 1788: 103.
Familia “Ce74cea”* Batsch, 1788: 116.
Genera (4): Balaena Linnaeus, 1758: 19; Del/phinus Linnaeus, 1758: 19; Monodon Linnaeus, 1758: 19; Physeter Linnaeus, 1758:
19. [Cetus* Brisson, 1762: 225].
Classis AVES Batsch, 1788: 88.
Familia “ANSERES”’* Batsch, 1788: 276.
Genera (11): A/ca Linnaeus, 1758: 84; Anas Linnaeus, 1758: 84; Colymbus Linnaeus, 1758: 135; Diomedea Linnaeus, 1758: 84;
Larus Linnaeus, 1758: 84; Mergus Linnaeus, 1758: 84; Pelecanus Linnaeus, 1758: 84; Phaeton Linnaeus, 1758: 84; Procel-
laria Linnaeus, 1758: 84; Rynchops Linnaeus, 1758: 138 (as Rhynchops); Sterna Linnaeus, 1758: 84. [Anser* Brisson, 1760:
262].
Familia “GrALLAe”* Batsch, 1788: 276.
Genera (11): Ardea Linnaeus, 1758: 84; Charadrius Linnaeus, 1758: 85; Fulica Linnaeus, 1758: 84; Haematopus Linnaeus, 1758:
85; Phoenicopterus Linnaeus, 1758: 84; Platalea Linnaeus, 1758: 84; Rallus Linnaeus, 1758: 84; Recurvirostra Linnaeus,
1758: 84; Scolopax Linnaeus, 1758: 84; Tantalus Linnaeus, 1758: 84; Tringa Linnaeus, 1758: 84. [“Gralla”+: Eberling in
Sonnerat, 1777].
Familia STRUTHIONES Batsch, 1788: 276.
Genera (3): Didus Linnaeus, 1766: 119; Otis Linnaeus, 1758: 85; Struthio Linnaeus, 1758: 85.
Familia “7ENUIROSTRES’”° Batsch, 1788: 276.
Genera (4): Certhia Linnaeus, 1758: 83; Merops Linnaeus, 1758: 83; Trochilus Linnaeus, 1758: 83; Upupa Linnaeus, 1758: 83.
Familia “CUNEIROSTRES’’° Batsch, 1788: 276.
Genera (2): Alcedo Linnaeus, 1758: 83; Picus Linnaeus, 1758: 83.
Familia “G4LLINAE’* Batsch, 1788: 276.
Genera (7): Columba Linnaeus, 1758: 85; Crax Linnaeus, 1758: 85; Meleagris Linnaeus, 1758: 85; Numida Linnaeus, 1764: 27;
Pavo Linnaeus, 1758: 85; Phasianus Linnaeus, 1758: 85; Tetrao Linnaeus, 1758: 85. [Gallus* Brisson, 1760: 45].
Familia “AccipiTres’’* Batsch, 1788: 277.
Genera (3): Falco Linnaeus, 1758: 83; Strix Linnaeus, 1758: 83 (as Stryx); Vultur Linnaeus, 1758: 83. [Accipiter* Brisson, 1760:
310].
Familia “LEVIROSTRES’° Batsch, 1788: 27.
Genera (4): Buceros Linnaeus, 1758: 83; Crotophaga Linnaeus, 1758: 83; Psittacus Linnaeus, 1758: 83; Ramphastos Linnaeus,
1758: 83.
Familia Cordces Batsch, 1788: 277 <> “P4SSERES”’° Batsch, 1788: 277.
Genera (20): Alauda Linnaeus, 1758: 85; Ampelis Linnaeus, 1766: 119; Caprimulgus Linnaeus, 1758: 85; Coracias Linnaeus,
1758: 83; Corvus Linnaeus, 1758: 83; Cuculus Linnaeus, 1758: 83; Emberiza Linnaeus, 1758: 85; Fringilla Linnaeus, 1758:
85; Gracula Linnaeus, 1758: 83; Hirundo Linnaeus, 1758: 85; Jynx Linnaeus, 1758: 83 (as Jynx); Lanius Linnaeus, 1758:
83; Loxia Linnaeus, 1758: 85; Motacilla Linnaeus, 1758: 85; Oriolus Linnaeus, 1766: 117; Paradisaea Linnaeus, 1758: 110;
Parus Linnaeus, 1758: 85; Sitta Linnaeus, 1758: 83; Sturnus Linnaeus, 1758: 85; Turdus Linnaeus, 1758: 85.
Classis AMPHIBIA Batsch, 1788: 88.
Familia TESTUDINES Batsch, 1788: 437.
Genus (1): Zestudo Linnaeus, 1758: 196.
Familia “Barracur’? Batsch, 1788: 437.
Genera (4): Bufo Laurenti, 1768: 25; Hy/a Laurenti, 1768: 32; Pipa Laurenti, 1768: 24; Rana Linnaeus, 1758: 196.
Familia “LACERTAE”* Batsch, 1788: 437.
Genera (13): Basiliscus Laurenti, 1768: 50; Caudiverbera Laurenti, 1768: 43; Chamaeleo Laurenti, 1768: 45 (as Chamaeleon);
Cordylus Laurenti, 1768: 51; Crocodylus Laurenti, 1768: 53; Draco Linnaeus, 1758: 196; Gekko Laurenti, 1768: 43; [Iguana
Laurenti, 1768: 47; Salamandra Laurenti, 1768: 41; Scincus Laurenti, 1768: 55; Seps Laurenti, 1768: 58; Ste//io Laurent,
1768: 56; Triton Laurenti, 1768: 37. [Lacerta* Linnaeus, 1758: 196].
Familia “SERPENTES’* Batsch, 1788: 437.
Genera (16): Amphisbaena Linnaeus, 1758: 196; Anguis Linnaeus, 1758: 196; Aspis Laurenti, 1768: 105; Boa Linnaeus, 1758:
196; Caecilia Linnaeus, 1758: 229; Caudisona Laurenti, 1768: 92; Cerastes Laurenti, 1768: 81; Cobra Laurenti, 1768: 103;
Coluber Linnaeus, 1758: 196; Constrictor Laurenti, 1768: 106; Coronella Laurenti, 1768: 84; Dipsas Laurenti, 1768: 89;
Laticauda Laurenti, 1768: 109; Naja Laurenti, 1768: 90; Natrix Laurenti, 1768: 73; Vipera Laurenti, 1768: 99. [Serpens*
Garsault, 1764: pl. 667].
Classis Pisces Batsch, 1788: 88.
Familia “Muzrirorr’° Batsch, 1788: 483.
Genera (3): Petromyzon Linnaeus, 1758: 196; Raja Linnaeus, 1758: 196; Squalus Linnaeus, 1758: 196.
Familia “Monsrrosr’° Batsch, 1788: 483.
Genera (2): Chimaera Linnaeus, 1758: 196; Lophius Linnaeus, 1758: 196.
Familia “Gzosarr’° Batsch, 1788: 484.
Genera (3): Diodon Linnaeus, 1758: 243; Ostracion Linnaeus, 1758: 243; Tetrodon Linnaeus, 1758: 243.
Familia “ArTicuLATr’? Batsch, 1788: 484.
Bonn zoological Bulletin 57 (2): 149-171 ©OZFMK
166 Alain Dubois & Roger Bour
Genera (3): Fistularia Linnaeus, 1758: 243; Pegasus Linnaeus, 1758: 243; Syngnathus Linnaeus, 1758: 243.
Familia “Lorica7r’® Batsch, 1788: 484.
Genera (4): Acipenser Linnaeus, 1758: 196; Centriscus Linnaeus, 1758: 243; Cyclopterus Linnaeus, 1758: 242; Loricaria Lin-
naeus, 1758: 243.
Familia “SPECULARES”’° Batsch, 1788: 484.
Genera (7): Callionymus Linnaeus, 1758: 242 (as Callyonimus); Cottus Linnaeus, 1758: 242; Gobius Linnaeus, 1758: 242; Scor-
paena Linnaeus, 1758: 242; Trachinus Linnaeus, 1758: 242; Uranoscopus Linnaeus, 1758: 242; Zeus Linnaeus, 1758: 242.
Familia “SoveaTr’* Batsch, 1788: 484.
Genera (3): Balistes Linnaeus, 1758: 243; Chaetodon Linnaeus, 1758: 242; Pleuronectes Linnaeus, 1758: 242. [“Soleas: Ed-
wards in Catesby, 1771].
Familia “Ferr’° Batsch, 1788: 485.
Genera (11): Coryphaena Linnaeus, 1758: 242; Esox Linnaeus, 1758: 243; Gasterosteus Linnaeus, 1758: 242; Labrus Linnaeus,
1758: 242: Mullus Linnaeus, 1758: 243; Perca Linnaeus, 1758: 242; Salmo Linnaeus, 1758: 243; Sciaena Linnaeus, 1758:
242; Scomber Linnaeus, 1758: 243; Sparus Linnaeus, 1758: 242; Trigla Linnaeus, 1758: 243.
Familia “BRACTEATI’® Batsch, 1788: 485.
Genera (5): C/upea Linnaeus, 1758: 243; Cyprinus Linnaeus, 1758: 243; Exocoetus Linnaeus, 1758: 243; Mugil Linnaeus, 1758:
243; Polynemus Linnaeus, 1758: 243.
Familia “Nupr’° Batsch, 1788: 485.
Genera (7): Anarhichas Linnaeus, 1758: 242; Blennius Linnaeus, 1758: 242; Cobitis Linnaeus, 1758: 243; Echeneis Linnaeus,
1758: 242; Gadus Linnaeus, 1758: 242; Silurus Linnaeus, 1758: 243; Xiphias Linnaeus, 1758: 242.
Familia “SERPENTINI’° Batsch, 1788: 485.
Genera (4): Ammodytes Linnaeus, 1758: 242; Gymnotus Linnaeus, 1758: 242; Muraena Linnaeus, 1758: 242; Trichiurus Lin-
naeus, 1758: 242.
“Superclassis” CRUSTACEA Batsch, 1788: 84.
Classis INSECTA Batsch, 1788: 89.
Familia “COLEOPTERA’®° Batsch, 1789: 539.
Genera (21): Attelabus Linnaeus, 1758: 342; Buprestis Linnaeus, 1758: 342; Byrrhus Linnaeus, 1766: 537; Cantharis Linnaeus,
1758: 342; Carabus Linnaeus, 1758: 342; Cassida Linnaeus, 1758: 342; Cerambyx Linnaeus, 1758: 342; Chrysomela Lin-
naeus, 1758: 342; Cicindela Linnaeus, 1758: 342; Coccinella Linnaeus, 1758: 342; Curculio Linnaeus, 1758: 342; Dermestes
Linnaeus, 1758: 342; Elater Linnaeus, 1758: 342; Hydrocantharus+ Batsch, 1789: 550; Lampyris Geoffroy, 1762: 165; Mordel-
la Linnaeus, 1758: 342; Necydalis Linnaeus, 1758: 342; Nicrophorus Fabricius, 1775: 71; Scarabaeus Linnaeus, 1758: 342;
Silpha Linnaeus, 1758: 342; Tenebrio Linnaeus, 1758: 342.
Familia “HEM/pPTERA’® Batsch, 1789: 539.
Genera (5): Blatta Linnaeus, 1758: 342; Forficula Linnaeus, 1758: 342; Gryllus Linnaeus, 1758: 342; Meloe Linnaeus, 1758:
342; Staphylinus Linnaeus, 1758: 342.
Familia “NEvRoPTERA’® Batsch, 1789: 539.
Genera (7): Ephemera Linnaeus, 1758: 343; Hemerobius Linnaeus, 1758: 343; Libellula Linnaeus, 1758: 543; Myrmeleon Lin-
naeus, 1767: 539 (as Myrmeleo); Panorpa Linnaeus, 1758: 343; Phryganea Linnaeus, 1758: 343; Raphidia Linnaeus, 1758:
343.
Familia “Hymenoprera’® Batsch, 1789: 540.
Genera (9): Apis Linnaeus, 1758: 343; Chrysis Linnaeus, 1761: xlii; Cynips Linnaeus, 1758: 343; Formica Linnaeus, 1758: 343;
Ichneumon Linnaeus, 1758: 343; Sirex Linnaeus, 1761: xli; Sphex Linnaeus, 1758: 343; Tenthredo Linnaeus, 1758: 343; Ves-
pa Linnaeus, 1758: 343.
Familia “Diprera’® Batsch, 1789: 540.
Genera (10): Asi/us Linnaeus, 1758: 344 (as Asylus); Bombylius Linnaeus, 1758: 344; Conops Linnaeus, 1758: 344; Culex Lin-
naeus, 1758: 344; Empis Linnaeus, 1758: 344; Hippobosca Linnaeus, 1758: 344; Musca Linnaeus, 1758: 344; Oestrus Lin-
naeus, 1758: 344; Tabanus Linnaeus, 1758: 344; Tipula Linnaeus, 1758: 344.
Familia CivicariA Batsch, 1789: 540.
Genera (3): Cimex Linnaeus, 1758: 343; Nepa Linnaeus, 1758: 343; Notonecta Linnaeus, 1758: 343.
Familia CicabiNa Batsch, 1789: 540.
Genera (6): Aphis Linnaeus, 1758: 343; Chermes Linnaeus, 1758: 343; Cicada Linnaeus, 1758: 343; Coccus Linnaeus, 1758:
343; Fulgora Linnaeus, 1766: 538; Thrips Linnaeus, 1758: 343.
Familia “LEPIDOPTERA”? Batsch, 1789: 540.
Genera (10): Alucita Linnaeus, 1758: 496; Bombyx Linnaeus, 1758: 495; Geometra Linnaeus, 1758: 496; Papilio Linnaeus, 1758:
343; Phalaena Linnaeus, 1758: 343; Pyralis Linnaeus, 1758: 496; Sphinx Linnaeus, 1758: 343 (as Sphynx); Tinea Linnaeus,
1758: 496; Tortrix Linnaeus, 1758: 496; Zygaena Fabricius, 1775: 550.
Familia “Hexv4Popa”’”° Batsch, 1789: 540.
Genera (4): Lepisma Linnaeus, 1758: 344; Pediculus Linnaeus, 1758: 344; Podura Linnaeus, 1758: 344; Pulex Linnaeus, 1758:
344.
Familia “PoLypopa”’® Batsch, 1789: 540.
Genera (10): Acarus Linnaeus, 1758: 344; Aranea Linnaeus, 1758: 344; Cancer Linnaeus, 1758: 344; Gammarus Fabricius, 1775:
418; Julus Linnaeus, 1758: 344 (as ulus); Monoculus Linnaeus, 1758: 344; Oniscus Linnaeus, 1758: 344; Phalangium Lin-
naeus, 1758: 344; Scolopendra Linnaeus, 1758: 344; Scorpio Linnaeus, 1758: 344.
Classis VERMES Batsch, 1788: 89.
Familia “/ivrestina’’° Batsch, 1789: 664.
Bonn zoological Bulletin 57 (2): 149-171 ©ZFMK
Family- and class-series nomina in zoology 167
Genera (8): Ascaris Linnaeus, 1758: 644; Cucullanus Miller, 1777: pl. 38 fig. 1-7; Echinorynchus Muller, 1776: 214 (as Echi-
norhynchus),; Gordius Linnaeus, 1758: 644; Hirudo Linnaeus, 1758: 644; Hydatigena Goeze, 1782: 192; Taenia Linnaeus,
1758: 646; Trichuris Roederer, 1761: 243.
Familia “SETIPEDA”° Batsch, 1789: 664.
Genera (4): Aphrodita Linnaeus, 1758: 644; Lumbricus Linnaeus, 1758: 644; Nais Miller, 1771: 6; Nereis Linnaeus, 1758: 644.
Familia “UBERES”° Batsch, 1789: 665.
Genera (6): Argonauta Linnaeus, 1758: 645; Clio Linnaeus, 1767: 1072; Lernaea Linnaeus, 1758: 644; Nautilus Linnaeus, 1758:
645; Scyllaea Linnaeus, 1758: 644; Sepia Linnaeus, 1758: 644.
Familia Limacina Batsch, 1789: 665.
Genera (25): Aplysia Linnaeus, 1767: 1072 (as Laplysia); Buccinum Linnaeus, 1758: 645; Bulla Linnaeus, 1758: 645; Cassis Scopoli,
1777: 393; Chiton Linnaeus, 1758: 645; Conus Linnaeus, 1758: 645; Cylindrus+ Batsch, 1789: 692; Cymbium Mendes da
Costa, 1776: 182; Cypraea Linnaeus, 1758: 645; Doris Linnaeus, 1758: 644; Fasciola Linnaeus, 1758: 644; Haliotis Lin-
naeus, 1758: 645; Helix Linnaeus, 1758: 645; Limax Linnaeus, 1758: 644; Murex Linnaeus, 1758: 645; Nerita Linnaeus,
1758: 645; Orthoceras Bruguiére, 1789: xvi; Patella Linnaeus, 1758: 645; Purpura Bruguiére, 1789: xv; Serpula Linnaeus,
1758: 645; Strombus Linnaeus, 1758: 645; Tethys Linnaeus, 1758: 644; Turbo Linnaeus, 1758: 645; Turris+ Batsch, 1789:
691; Voluta Linnaeus, 1758: 645.
Familia “SyPHoNATA’’° Batsch, 1789: 665.
Genera (17): Anomia Linnaeus, 1758: 645; Arca Linnaeus, 1758: 645; Ascidia Linnaeus, 1767: 1072; Cardium Linnaeus, 1758:
645; Chama Linnaeus, 1758: 645; Mactra Linnaeus, 1767: 1073; Mya Linnaeus, 1758: 670; Mytilus Linnaeus, 1758: 645;
Ostrea Linnaeus, 1758: 645; Pecten Miller, 1776: 248; Perna Philipsson, 1788: 20; Pholas Linnaeus, 1758: 645; Pinna Lin-
naeus, 1758: 645; Solen Linnaeus, 1758: 645; Spondylus Linnaeus, 1758: 645; Te/lina Linnaeus, 1758: 645; Venus Linnaeus,
1758: 645.
Familia “Cris74T4”’° Batsch, 1789: 665.
Genera (6): Actinia Pallas, 1766b: 152; Balanus Mendes da Costa, 1778: 249; Holothuria Linnaeus, 1758: 644; Lepas Linnaeus,
1758: 645; Medusa Linnaeus, 1758: 644; Triton Linnaeus, 1758: 644.
Familia “Crustosa”° Batsch, 1789: 665.
Genera (2): Asterias Linnaeus, 1758: 644; Echinus Linnaeus, 1758: 644.
Familia “FRoNDOSA’’? Batsch, 1789: 665.
Genera (2): Astrophyton Schultze, 1760: 53; Pennatula Linnaeus, 1758: 646.
Familia “Potypina’’® Batsch, 1789: 666.
Genera (10): Alcyonium Linnaeus, 1758: 646; Eschara Linnaeus, 1758: 646; Gorgonia Linnaeus, 1758: 646; Hydra Linnaeus,
1758: 646; Isis Linnaeus, 1758: 646; Madrepora Linnaeus, 1758: 646; Millepora Linnaeus, 1758: 646; Sertularia Linnaeus,
1758: 646; Spongia Linnaeus, 1759: 1317; Tubularia Linnaeus, 1758: 646.
Familia “FyveriATa’’° Batsch, 1789: 666.
Genera (3): Brachyonus Pallas, 1766a: 89; Trichoda Miller, 1773: 71; Vorticella Linnaeus, 1767: 1074.
Familia “CHa4orica’* Batsch, 1789: 666.
Genera (10): Burfaria Miller, 1773: 62; Cercaria Miller, 1773: 64; Cyclidium Miller, 1773: 49; Enchelis Miller, 1773: 33; Go-
nium Miller, 1773: 60; Kolpoda Miller, 1773: 56; Monas Miller, 1773: 25; Paramaecium Miller, 1773: 54; Vibrio Miller,
1773: 39; Volvox Linnaeus, 1758: 646. [Chaos* Linnaeus, 1767: 1074].
Bonn zoological Bulletin 57 (2): 149-171 ©ZFMK
VUOAINAVD “VIIVNNV]A “VLVGNOH)
SANIGALSAL “VdISdOUNVS ‘VLVGNOHD
VHdYOWNOAOVNINY ‘VITVAINVIA, “VLVGXOHD
SAWUOAINOIHLAULS ‘VAISAOUAVS ‘VLVGYOHD
VILNAGOY ‘VIIVAWVIA, “VLVCXOHD
VUOAINAV ‘VITVINNINV]A] “VLIVGNOHD
VILNAGOY ‘VIIVAWVIA, “VLVGNOHD
VIVNOWT1Ndg ‘VdOdOULSV) ‘VOSATIO[L
VHdaYOWODV’T ‘VITVININVIA, “VLVGQdOH)
Alain Dubois & Roger Bour
VUOAINUVD ‘VITVNWVIA, ‘VLVCaXOHD
SAWNUOALOVUOD “VAISdOUNVS ‘VIVAUOHD
VuALdINAH ‘VLOASN] ‘VdOdOUHLYY
VuaLdINaH{ ‘VLOASNY ‘VaGOdOUHLNY
VIALOVGOILYY ‘VITVAWV]] ‘VIVQXOHD
VILNAGOY ‘VITVAWV]A] ‘VIVGYOHD
VUOAINAVD ‘VITVAINV]A] ‘VLVGaYOHD
VSOTIg ‘VIIVANV]A] ‘VLVQaOHD
S8LI ‘Yyosieg gvaisyQ
S8LI ‘YOsweg IVCINIGNLST
QSLI ‘YOsweg IVCId TKI
B8LI ‘Yosieg FVGINOIHINULS
S8LI Yosieg arvariniog
S8LI ‘Yosweg FraITALSAW
S8LI ‘Yosieg arannpy
68L1 “YOseg APGIOVITT
S8LI “Yosieg @raroddT
S8LI “Yyosyeg araITAY
B8LI ‘Yosieg aVAIOKYOD
68L1 “Yosweg FFAIOINID
68LI “Yosieg IralaVIID
S8LI Yosieg grdiAN7D
SBI “Yosieg JVARIOLSVD
S8LI ‘Yosieg FrdINKD
S8LI ‘Yosieg avaidodsarag
TLE ‘LISI “JOYOSIY INISU)
LEv ‘88L1 Yosweg SINIdALSAL
TLE LIST IOYOSIA INTEL
JOP ‘STR ‘SIOSIA, FVCINOIHLNULS
TLE ‘LIST BOYosty mag
ZLE LIST ‘IOyosty INITILSAW
OF “SIT TOSI] KNIZAY
ZO (ORL “oteule’ 7] SYFIOKNIT
TLE (LIST “JOYOSIY INIIOdTT
TLE ‘LIST FOYOsty INITIY
66€ :ST8I “SIOBIA VNFIOFYOD
OFT :ZOST “ANT SIGIOINID
CTH ‘OPI “POOMISSM FVAKILD
PLe ‘O78 ‘SSNIplOH KNIANTD
€€ (OTSI “Yotduiay VNIYOLSKD
TLE ‘LIST AOydsty ININKD
POE FIT8I ‘ABI avaidsarag
LIST *tULoYypleAA op
IOyOSly,, JVGISYA
«88LI ‘YOsieg FVCINIGALSAL
LIST *WHSYpIeAA eP
JoyOSly,, IVCId TKI
LIST *.WULOYpleA\ ep
JOYOSIy,, JVCINOIHLNULS
LIST ‘.WHoypreM op
JOYOsly,, IFAMAIIS
LIST *.WHoypleM op
JOYOSIJ,, FAITALSAP
SIS] TOs] gran
LOST ‘yoreue] avCIOKNIT
LIST *..WuIoUpleM op
JOIST, TVCIMOdTT
LIST *.CuloypleA ep
JOYOSIy,, IVCITI
CTZ8I ‘SIOSIA FVAIOKYOD
TOSI ‘ay[lo-ne] AVGIOINID
OFS I ‘POOMISAM FFAIGKIID
OZ8I “SSIYP[OH avaiuuTD
OZ8I “Youduiay FraIVOLsKD
LIST *.CuloypleA ep
JOyoSty,, JVCINVD
ITS ‘AvIQ avaidodsarag
QSL] ‘sneeuury snsuQ BBL ‘yosyeg FNISUAQ
SSL ‘SnaeuUry opnisal Bgl ‘Yosweg SINIGALST
SSL] ‘snoeuury vdjny QSLT YOsweg FNIdTKT
BSL] ‘snoeuUry O17n.15 B8/ | “YOSIeY SINOIHLAULS
SSL ‘snoeuury snuniog == ST “Yosieg FNIZAIDS
SSLI Yoseg FNITILSAW
S8LI ‘Yosieg FNIZQW
68L1 “YOsyeg PNIOKWIT
SLI ‘sneeuury vjajsnpy
SSL] ‘ShevuuryT snpy
QSL ‘snoeuury xpuT
SSLI ‘snevuury sndaT — gL { “yosIeg VNIYOdTT
S8LI Yosteg rPNITAY
S8LI “Yosieg s7ory0D
68LI Yosweg FrRIFOINID
68LI “Yosreg FNIGKOID
S8LT “Yosieg KNIAYTD
S8LI ‘Yosieg rAYOLSKD
SSL ‘sneeuury] say
SSL] ‘sheeuury sp1on410)
SLI ‘Snovuury xaw1y
SSL] ‘snovuury vppo1g
SCL] ‘snevuury siasay
SCL] ‘snaeuury 1ojspy
QSL ‘snovuuryT sip) S8LI ‘Yyosieg FNINKD
QSL ‘snevuury snddpoig g8/ | ‘yosieg raodsarag
Opso ‘sisseyo ‘unyAyd :exe) JOYysTy PeUONIpPeLL
A]MuUey SI JO UOWIOU pIeA
ATW} SI} 1OJ pasn A][euoMIpe.y
UdWIOU JO WIAUOJOIg
Awe} SITY} 1OF pasn
A]JeuOn pel) USWION
(68L1 ‘88Z1) yos}eg ul
snuasosjonN Suriwodde uawiou Ayrwey
OZFMK
‘(RQQOT SlOgnd) SWeU Sty} JopuN pojId aq prnoys pue ,.JOYOSTy,, MWe a]SuIs ay} Aq pousdis AT[eNjIOw SI WIOYP]eAA YP JOYOSIJ,, 0} JIS UOSTUIOU
-OXxB], OY} Ul poyposd uOneKo[gnd sy “(/PpIM/S1o'erpadryimus//:dyy) erpodryl Ay OS OY} Ul PoZIUBOda1 SsOU} SAIS OM ‘,,YSLIO}Se UL Aq PIYACUI ‘dJIS STU} UL UDATS JOU de dJep pue diys
-IOYyINe YSIYM JOJ suo ATUO 9} IO ‘(/[UAWOUOXe)] UOSTWOUOXe}//:dyY) UOSTWIOUOXRT, SY} JO IIS IY} Ul PAZIUBOIaI dso} 91B SULUNIOS JseT] PUL PITY] OY} UI USATS exe} JOYSIY pue soiql
-WUJ JO PUTWIOU [BUOTIPe.Y sy], “AWOUOXk}00Z UI WY} 0} Popo1d AT[RUOTIPe.Y Sayep PUR SIOYING OY} YIM “(68/T “VSL 1) YOsie Ur o[quyileae opeUl PUILUIOU SdTIds-ATIWIR] OY, *E BTQUL,
168
Bonn zoological Bulletin 57 (2): 149-171
Family- and class-series nomina in zoology 169
APPENDIX 2
THE NOMENCLATURAL STATUS OF A FEW
PROBLEMATIC ZOOLOGICAL NOMINA
THE ZOOLOGICAL NOMINA CREATED IN THE
BOOK OF BEHN (1760)
Klein (1751) published a comprehensive classification of
his “QUADRUPEDIA”, 1.e., roughly, the tetrapods without the
cecilians, snakes, birds and whales. This book in Latin be-
ing pre-1758, the nomina it contains are nomenclaturally
unavailable. Joyce et al. (2004) pointed out the existence
of Behn’s (1760) German translation and adaptation of
Klein’s (1751) book, where all the taxa and nomina of the
latter work are reproduced. These post-1758 nomina
would be available, with the authorship “Klein in Behn,
1760”, if this book had to be considered nomenclatural-
ly available, but it should not. The nomenclatural hierar-
chy used in this book is unclear and inconsistent. It in-
cludes the ranks ordo (Ordnung) and familia (Familie), the
taxa at these ranks being designated by uninomina (nom-
ina consisting of a single term). The ranks used below the
rank Familie are denominated in German Geschlecht, then
Art, then Gattung. Considering their hierarchy and con-
tent, they could be construed to correspond respectively
to the ranks tribe, genus and species, but this would prob-
ably be misleading. Each of these ranks can contain a var-
ious numbers of unnamed subranks, and the number of
terms used to designate taxa is variable, from one to two
and more, some of these nomina being plurinominal di-
agnoses borrowed without change from various pre-1758
works. This work clearly does not comply with the re-
quirement of Article 11.4 of the Code for the availability
of species-, genus- and family-series nomina. However,
this might not preclude considering the class-series nom-
ina in this work, or some of them, as available, since Ar-
ticle 11.4 implicitly states that “this Article does not ap-
ply to the availability of names of taxa above the family
group”.
If it was possible to establish objectively where lays the
separation between the family-series and the class-series
nomenclature in Behn (1760), and if all these nomina were
uninomina, it could be possible to recognize as available
the class-series nomina proposed in this work, but this is
difficult if not impossible.
The nomina of the three orders of “QUADRUPEDIA” rec-
ognized in Behn (1760) are plurinomina, as follows: (O1)
“Pilosa et Ungulata (vivipara) sive “Zaotoxa”’; (O02) “Pi-
losa et Digitata sive sint tota coriacea, sive cataphracta;
omnia vivipara”’; (O03) “Depilata, sive tecta, sive nuda,
nequicquam pilosa, omnia ovipara, sive “Qotoxa”. Such
designations are in fact diagnoses, and cannot qualify as
Bonn zoological Bulletin 57 (2): 149-171
nomina of zoological taxa. They are unavailable in zoo-
logical nomenclature. It can be noted that, in the original
text of Klein (1751), the same taxa were designated by uni-
nomina (“UNGULATA”, “DIGITATA” and “DEPILATA’’), but
as this text is pre-Linnaean, these nomina also are unavail-
able.
In contrast, the nomina of the 13 “families” recognized
by Behn (1760) are all uninomina. They are distributed
as follows in the three orders: (O1) ‘“MONOCHELON”,
“DICHELON”, “TRICHELON”’, ““TETRACHELON” and “PEN-
TACHELON”; (O2) “DIDACTYLON”, “TRIDACTYLON”,
“TETRADACTYLON’, “PENTADACTYLON” and “ANOMALA-
PES” (instead of “ANOMALOPES” in Klein, 1751); (O3)
‘“TESTUDINATA ”, “CATAPHRACTA” and “NUDA”. Except pos-
sibly for one, these nomina are not based on the stems of
included nominal genera. “TESTUDINATA” could be con-
strued to be based on the stem of the only included genus
of the family, Zestudo Linnaeus, 1758, but this is highly
improbable. The other twelve familial nomina are clear-
ly based on characters that are considered diagnostic for
the taxa they designate, and the nomen “TESTUDINATA” can
also be understood as based on the Latin adjective testu-
dinatus, meaning “of turtle, vaulted, arched”. Therefore,
all nomina of “families” in Behn (1760) appear to be arhi-
zonyms. Under the Rules of Dubois (2006a), such nom-
ina cannot be accepted as family-series nomina and qual-
ify as class-series nomina. This case is not unique. Other
examples were discussed by Dubois (2006a, 2009) and
Dubois & Ohler (2009): for example, the nomina of “fam-
ilies” in Ritgen (1828), which are also arhizonyms, must
be treated as available class-series nomina.
However, in the case of the new familial nomina appear-
ing in Behn (1760), difficulties would arise if they were
to be treated as available class-series nomina. In the sys-
tem of Dubois (2006a), the allocation of class-series nom-
ina to taxa is made through their included (conucleogen-
era) and excluded (alienogenera) nominal genera, and to
be usable in this respect, conucleogenera and alienogen-
era must be nomenclaturally available. If all the nomina
of taxa just below the rank family in Behn (1760), desig-
nating taxa of rank “Geschlecht”, were considered to be
genus-series nomina, part of them could not be used for
taxonomic allocation of their nomina, because they are un-
available in Behn’s (1760) work. In his order (O3), cor-
responding to the traditional amphibians and reptiles, on-
ly three generic nomina then available are mentioned as
valid nomina: 7estudo Linnaeus, 1758 for a “Geschlecht”
of his family “TESTUDINATA”; Lacerta Linnaeus, 1758 for
a “Geschlecht” of his family “NupA”; Rana Linnaeus,
1758 for an “Art” of his “Geschlecht” “Batrachus” (then
an unavailable nomen) of his family “NuDA”’; and none
in his family “CATAPHRACTA”. In order to allocate the
nomen “NuDA” to a class-series taxon, one would have
©ZFMK
170 Alain Dubois & Roger Bour
to take an arbitrary decision, considering that either the
rank “Geschlecht” or the rank “Art” corresponds to the
rank genus in the current Code. If the rank “Geschlecht”
was considered to correspond to the rank genus, and “Art”
to the rank species, the nomen “NUDA” would apply, in a
modern classification, to the most inclusive taxon includ-
ing the genus Lacerta and excluding the genus Jestudo.
But if the rank “Geschlecht” was considered to correspond
to the rank tribe, and “Art” to the rank genus, the nomen
“NuDA” would apply, in a modern classification, to the
most inclusive taxon including the genus Rana and exclud-
ing all the mammalian genera, bearing then available Lin-
naean generic nomina, mentioned by Behn (1760) in his
orders (O1) and (O2). Therefore, according to the arbitrary
decision taken, the same nomen could apply to widely dis-
tinct higher taxa.
Because of these uncertainties, many other examples of
which could be given, we here argue that Behn’s (1760)
should not be considered as an available work in zoolog-
ical nomenclature, even for class-series nomina. We sug-
gest that this book should be invalidated as a whole by
the ICZN, and that all the new nomina it contains should
be considered unavailable in zoological nomenclature.
*Marsupiale” Edwards in Catesby, 1771
According to Sherborn (1902: 593), there exists a genus
Marsupiale, based on the following reference: “G. Ed-
wards in M. Catesby, Carol. I. 1771, xxix”. Actually this
refers to Catesby (177 1a: xxix), in “An account...” added
by George Edwards, where the binomen Marsupiale amer-
icanum appears, with a diagnosis. However, this item fol-
lows another one entitled Vulpi affinis americana and
many others where the nomenclature is not consistently
binominal. Consequently the ICZN (Anonymous 1954)
has suppressed the whole work (Catesby 1771a-b) for
nomenclatural purposes, except for the nomina employed
by Edwards in accordance with the Linnean system in his
“Catalogue of the Animals and Plants” (i.e., Catesby
1771a: 1-2, 1771b: 1-2), usually referred as George Ed-
wards’ “Appendix”.
“Solea” Edwards in Catesby, 1771
According to Sherborn (1902: 593), there exists a genus
Solea, based on the following reference: “G. Edwards in
M. Catesby, Carol. II. 1771, 27”. Actually this refers to
Catesby (1771b: 27), where appears the combination Solea
lunata et punctata, with a diagnosis and a plate; howev-
er, this is not a binomen, and therefore it has no status in
nomenclature. The ICZN (Anonymous 1954) has sup-
pressed the whole work (Catesby 1771a-b) for nomenclat-
Bonn zoological Bulletin 57 (2): 149-171
ural purposes, except for the nomina employed by Ed-
wards in accordance with the Linnean system in his “Cat-
alogue of the Animals and Plants” (i.e., Catesby 1771a:
1-2, 1771b: 1-2), usually referred as George Edwards’
“Appendix”. Edwards (in Catesby 1771b: 1) linked this
description with the binomen Pleuronectes lunatus Lin-
naeus, 1758.
“Gralla” Eberling in Sonnerat, 1777
According to Sherborn (1902: 431), there exists a genus
Gralla, based on the following reference: “J. P. Ebeling
in Sonnerat, Reise Neuguinea, 1777, 31”. Actually this
refers to Sonnerat (1777: 31 [and 45]), where appears the
combinations gralla parra and gralla fulica. Wieland
(2010) admitted the nomenclatural availability of both,
which he treated as binomina, and also of the genus Gral-
la Sonnerat, 1777, but with this comment: “The basic da-
ta of this taxon were not entered consulting the original
description, but from secondary sources”. On the other
hand, The Richmond Index, published by the Division of
Birds at the National Museum of Natural History, Wash-
ington, D.C (Anonymous 2010), states that Gralla Ebel-
ing in Sonnerat is not nomenclaturally a valid generic
name: “Gralla fulica p. 45; Gralla parra p. 31, Ebeling, in
Sonnerat, Reise Neu Guinea, 1777. These have no stand-
ing! being simply Ebeling ’s way of writing Order Gral-
le, Genus Fulica + Parra/!’’. Actually Ebeling (in Son-
nerat 1777) put a capital at the start of the generic name
of his binomina, but neither at gralla parra nor at gralla
fulica. We follow here The Richmond Index statement and
do not recognize the nominal genus “Gralla Ebeling in
Sonnerat, 1777”.
Cylindrus Batsch, 1789: 692
Three homonymous nominal genera Cylindrus are avail-
able in zoological nomenclature: Cylindrus Batsch, 1789:
692; Cylindrus Deshayes, 1824: 236; and Cylindrus
Fitzinger, 1833: 107.
Cylindrus Batsch, 1789 has apparently been ignored by
all authors until now. It was introduced with a diagnosis
that makes it nomenclaturally available and that clearly
points to marine cone shells.
Cylindrus Deshayes, 1824 is an autoneonym* (unjustified
emendation) of Cylinder Denys de Montfort, 1810: 390,
a nomen established for a genus of marine cone shells. Its
nucleospecies* (type-species) is Conus textile Linnaeus,
1758: 717, by original designation. The original nomen
of this genus was preceded in zoological nomenclature by
Cylinder Voet, 1793 and Cylinder Voet, 1806, but both
©ZFMK
Family- and class-series nomina in zoology 171
these nomina are unavailable, as published in books that
are not consistently binominal. Strangely enough howe-
ver, the nomen Cylinder Denys de Montfort, 1810 is cur-
rently not considered valid, but its autoneonym Cylindrus
Deshayes, 1824 is so, being currently treated as a subge-
nus of the genus Conus Linnaeus, 1758 (e.g., Keen 1971;
Pitt et al. 1986).
Cylindrus Fitzinger, 1833 was established with a single
valid species included, Pupa obtusa Draparnaud, 1805: 63,
which is therefore its nucleospecies by original specific
monophory* (monotypy). This generic nomen is current-
ly (e.g., Frank 2006) considered valid for a genus of ter-
restrial snails.
The current nomenclatural situation concerning the use of
the term Cylindrus in zoological nomenclature is not com-
pliant with the Rules of the Code, for two distinct reasons:
(R1) the autoneonym Cylindrus Deshayes, 1824 of Cylin-
der Denys de Montfort, 1810 is considered valid instead
of its archaeonym*, although the latter should be so, not
being preoccupied by an available homonymous generic
nomen; (R2) two homonymous genus-series nomina, Cy-
lindrus Deshayes, 1824 and Cylindrus Fitzinger, 1833, are
currently both considered valid in zoology, although the
second one, being a junior homonym of the former, should
be considered invalid (even if the former one was not so).
The two nomina are listed as valid in several current on-
line databases, but apparently never in the same one: Cy-
lindrus Deshayes, 1824 appears as the valid nomen of a
subgenus of Conus Linnaeus, 1758 in the databases Ca-
talogue of recent and fossil Conus (Alan J. Kohn)
[http://biology.burke.washington.edu/conus/recordview/sp
ecieslist P.html], The sea shells (Nauka Bulgarie)
[http://theseashells.nauka.bg/Conus_Cylindrus_ textile tex
tile-html] and Hardy’s Internet Guide to marine Gastro-
pods (Eddie Hardy) [http://jeh-temp.co.uk/Taxon_pages
/Family CONIDAE CONINAE.shtml], whereas Cylin-
drus Fitzinger, 1833 appears as the valid nomen of a ge-
nus of terrestrial snails in the databases Molluscs of cen-
tral Europe (Dr. Vollrath Wiese, Cismar, D-23743 Gro-
mitz-Cismar) |http://www.mollbase.de/list/liste.php], Ani-
malbase Goettingen [http://www.animalbase.uni-goettin-
gen.de/zooweb/servlet/AnimalBase/search] and Biolib.cz
[http://www.biolib.cz/en/taxon/1d18384].
The rediscovery of the nomen Cylindrus Batsch, 1789,
created for a genus of marine cone shells, allows to cla-
rify this nomenclatural situation. We hereby designate
Conus textile Linnaeus, 1758 as its nucleospecies (type-
species). The nomen Cylindrus Batsch, 1789 therefore re-
places both Cylinder Denys de Montfort, 1810 and Cy-
lindrus Deshayes, 1824 as the valid nomen of the subge-
nus of Conus Linnaeus, 1758 including the latter species.
As for Cylindrus Fitzinger, 1833, it is an invalid junior ho-
Bonn zoological Bulletin 57 (2): 149-171
monym of both Cylindrus Batsch, 1789 and Cylindrus
Deshayes, 1824 and it must be abandoned.
The homonymy between Cylindrus Deshayes, 1824 and
Cylindrus Fitzinger, 1833 was pointed out by Kennard
(1942), in a work that seems to have been overlooked by
most subsequent authors. This author rightly concluded
that the nomen Cy/indrus Fitzinger, 1833 is invalid, and
pointed to the existence of its senior objective synonym
Cochlopupa Jan, 1830: 5. The nucleospecies of this no-
minal genus is Pupa obtusa Draparnaud 1805 by original
specific monophory. The single species currently referred
to the genus Cylindrus Fitzinger, 1833 and known as Cy-
lindrus obtusus, must therefore bear the nomen Cochlo-
pupa obtusa (Draparnaud, 1805).
Hydrocantharus Batsch, 1789: 550
The nomen Hydrocantharus Batsch, 1789, created for an
aquatic beetle (dytiscid) is identical to several pre-1758
uses of the same nomen, which are nomenclaturally una-
vailable. For the same genus, Linnaeus (1758: 342) used
the nomen Dytiscus. In this genus, he listed (p. 411-413)
15 nominal species, among which Latreille (1810: 426)
designated Dytiscus marginalis Linnaeus, 1758: 411 as nu-
cleospecies. We hereby designate the same nominal spe-
cies as nucleospecies (type-species) of Hydrocantharus
Batsch, 1789, which therefore becomes an invalid junior
objective synonym of Dytiscus Linnaeus, 1758.
Turris Batsch, 1789: 691
A generic nomen Jurris was created for a gastropod ge-
nus by Statius Miller (1766: 129), but this nomen is una-
vailable as having been published in a book invalidated
by the ICZN (Anonymous 1964) as not applying the prin-
ciple of binominal nomenclature. A homonymous nomen
Turris was later created by R6ding (1798: 123) also for a
gastropod genus, and this nomen is currently considered
valid. However, the present rediscovery of Zurris Batsch,
1789 makes Turris Roding, 1798 its invalid junior syno-
nym.
As reckoned by Winckworth (1945), the nucleospecies of
Turris Roding, 1798 is Murex babylonius Linnaeus, 1758:
753, by subsequent designation of Bucquoy et al. (1883:
86). In order not to upset nomenclatural stability, we he-
reby designate Murex babylonius Linnaeus, 1758 as nu-
cleospecies (type-species) of Turris Batsch, 1789. The lat-
ter must now replace its junior objective synonym Turris
Roding, 1798 as the valid nomen of the genus.
©OZFMK
i aang iain, rare -
. - —s eae =
ae = act snittiia dander
et, - =r Poe
lel Pa ial > oi pulp od aan
ss 1) one Pipi toceide ulin
| ;
Hl x0 7 i
| H
| | { t fi
|
| ,
|| ‘vai
|
!
pa
,
i
.
if ;
= iiwen won
Teaie! on « ‘xy i
» Leh phim eee a
7 ‘ion
| oii
| aS
| 4
|
a iG 4 he yale ' hee ee rae et
- KF ; 7 weri¢ ri) te a pili ian ety
r mele Tgeltatiey MOR,
ee fe " ier H4toxnaal
rie hi
Bonn zoological Bulletin | Volume 57 | Issue 2 pp. 173-176
Bonn, November 2010
An addition to the East African herpetofauna: the first record of
Tarentola annularis relicta (Squamata: Gekkonidae) in Uganda
Miloslav Jirkt!, Andrei Daniel Mihalca?, Petr Necas} & David Modry!4
| Biology Centre, Academy of Sciences of the Czech Republic, Ceské Budéjovice, Czech Republic
2 University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca, Romania
3 SvinoSsice, Czech Republic
4 University of Veterinary and Pharmaceutical Sciences, Brno Czech Republic
Abstract. This is the first record of a member of the genus Zarentola from Uganda. Population of Zarentola annularis
relicta was found in Ubbi village on the South-Western foot of Mt. Otzi in northern Uganda, close to the border with Su-
dan. Brief comments on extraordinary biogeographical affinities of the area and characterization of the Mt. Otzi envi-
ronments are provided.
Key words: Zarentola, Uganda, East Africa, Mt. Otzi, new geographic record.
INTRODUCTION
In their account of the East African reptiles, Spawls et al.
(2004) listed 55 species of geckoes in 11 genera for East
Africa including Tanzania, Kenya, Uganda, Rwanda and
Burundi. Although biogeographically, the East African
realm includes also parts of South Sudan and Ethiopia, we
follow the above mentioned political delimitation of East
Africa used throughout literature for practical reasons.
During a short survey of the Mt. Otzi area in the very
North of Uganda on 9.X.2006, we collected specimens of
geckoes, that did not match any known East African genus.
Specimens were collected on buildings of the village
school in Ubbi, a small settlement at the South-Western
foot of Mt. Otzi. Upon collection, the animals were pho-
tographed and released at the original collection site.
The Ubbi village (03°35’07”N, 31°49°42”E, elevation of
690 m a.s.1.) is surrounded by a mosaic of farmland, small
rocky hillocks covered by bushy vegetation and numer-
ous rocky outcrops devoid of vegetation (Fig. 1a). The area
is situated in the Southern Sudanian savanna zone, the nat-
ural vegetation of which is mostly tree and shrub moist
savanna. The dominant geomorphological feature of the
area is the Mt. Otzi massif steeply rising above surround-
ing landscape. The Mt. Otzi located on the Western bank
of the Nile River has an undulating top plateau with
Bonn zoological Bulletin 57 (2): 173-176
several emergent rocky peaks reaching a maximum ele-
vation of 1565 m. Its slopes are covered by bush, while
its upper parts are covered by a mosaic of highland bush,
moist forest and farmland (Fig. 1b). The remaining for-
est patches are mostly degraded by logging and clearing
for agriculture and thus characterized by relatively open
canopy (Fig. 1c). The area south of the Mt. Otzi is dom-
inated by palm- and other moist-savanna types (Fig. Id).
Tarentola specimens
The geckoes were assigned to the genus 7arentola accord-
ing to absence of claws on digits 1, 2 and 5 and presence
of claws on digits 3 and 4 (as seen in Figs 2a—b). The on-
ly Tarentola species occurring thus far in the South-East
of the genus range is Zarentola annularis (Geoffroy, 1809),
in which two subspecies are recognized (Joger 1984). The
nominotypic Zarentola annularis annularis (Geoffroy,
1809) occurs throughout the Saharan region, whereas Tar-
entola annularis relicta Joger, 1984 is known only from
two disjunct areas — the Nile valley in the very south of
Sudan and Mora in the North Cameroon south of the Lake
Chad. Two confirmed Sudan localities include Juba (type
locality of the subspecies) and Nimule (Joger 1984).
©ZFMK
174 Miloslav Jirkt et al.
Fig. 1. | Landscape and vegetation of the Mt. Otzi and adjacent areas. Fig. la. Rocky outcrops in Ubbi village on the foot of Mt.
Otzi. Photograph A. D. Mihalca. Fig. 1b. Forest patch on the Mt. Otzi top plateau with an emergent rocky peak in the background.
Photograph M. Jirkt. Fig. le. Interior of the Mt. Otzi forest showing relatively open canopy and distinct Afromontane floristic el-
ement, the false banana of the genus Ensete in the foreground. Photograph M. Jirku. Fig. 1d. Palm savanna south of the Mt. Otzi
region in the Murchinson Falls NP, Uganda. Photograph M. Jirkd.
Bonn zoological Bulletin 57 (2): 173-176 ©ZFMK
First record of Zarentola from Uganda 175
[>
Fig. 2. Zarentola annularis. Fig. 2a. Adult specimen of Zarentola annularis relicta from Ubbi, Uganda. Photograph D. Modry.
Fig. 2b. Close-up of adult specimen of Zarentola annularis relicta from Ubbi, Uganda. Note the bright red trombiculid mites lo-
calized mainly around eye. Photograph D. Modry. Fig. 2c. Adult specimen of Zarentola annularis annularis from Awash NP, Ethiopia.
Note the four distinct white, dark-rimmed scapular flecks. Photograph P. Necas.
Apart from details in scaling patterns, 7! a. relicta can be
readily distinguished visually by an absence of four white,
dark-rimmed scapular flecks typical for the nominotypic
subspecies (compare Figs 2a—b with Fig. 2c). Based on
Bonn zoological Bulletin 57 (2): 173-176
coloration pattern, the specimens we collected in Ugan-
da can be assigned to the subspecies T. a. relicta. All ob-
served specimens were pale-grey colored with orange to
orange-brown blotches on dorsum of the head and body
©ZFMK
176 Miloslav Jirkt et al.
with intervening irregularly distributed faint whitish flecks
devoid of any dark margin, whereas the tail possessed just
faint grayish transversal bands (Figs 2a—b). As far as we
are aware, the Figs 2a—b are the first published color pho-
tographs of live 7! a. relicta.
BIOGEOGRAPHICAL CONSEQUENCES
To our best knowledge, the presented record of Zarento-
la in Uganda is the first record of the genus in the East
African region as defined above. The genus Zarentola
comprises 20 species distributed throughout the dry re-
gions of the Mediterranean, Middle East, some Atlantic
archipelagos (e.g. Canary and Cape Verde Islands) and
African mainland north of the savanna and forest zones
(see Joger 1984 for review). Three additional species are
known from the West Indies (Diaz & Hedges 2008, Joger
1984). The African-mainland part of the genus geograph-
ic range, 1.e. Saharan region, comprises a total of six
species (including Tarentola chazaliae, still treated by
some authors as the only representative of the monotyp-
ic genus Geckonia — see Carranza et al. 2002) the spe-
ciation of which seems to reflect the relatively recent arid-
ification of the Sahara desert region, which was gradual-
ly colonized from its rather mesic margins by ancestors
of extant species since mid Oligocene. In general, the
southern distribution limit of Zarentola spp. in African
mainland is delimited by an interference zone between the
southern margin of the arid Sahel belt and moist savanna
and forest equatorial zones.
To date, the southernmost confirmed locality of Tarento-
la has been the record of 7 a. relicta from Nimule
(03°35733”N, 32°04’14”E), on the Sudanian side of the
Sudan-Uganda border. The southern records of T a. re-
licta in Sudan and Uganda document an intrusion of Sa-
haran faunistic element into the relatively humid equato-
rial region which is dominated by moist savanna approx-
imately from 9°30’N southwards. Presence of the reptile
species associated with arid habitats here, deep in the sa-
vanna zone might be facilitated by a presence of an ex-
tensive network of huge rocky outcrops and ridges follow-
ing Aswa fault, which extend into this region from far
north-west and of which the Mt. Otzi is a magnificent
southernmost outpost. It is possible, that these exposed
rocky formations, largely devoid of vegetation, might
serve as refuges for Saharan taxa that normally would not
occur thus far south in the otherwise relatively humid re-
gion. Farther to the south from the Mt. Otzi region, the
landscape is dominated by gently undulating plains cov-
ered by various moist-savanna types (Fig. 1d) where pres-
ence of Zarentola seems unlikely due to lack of suitable
habitats.
Bonn zoological Bulletin 57 (2): 173-176
Interestingly, the Mt. Otzi region is the easternmost known
locality of a remarkable West-African savanna element,
the ball python Python regius, which was collected in the
vicinity of Moyo (3°39°14"N, 31°43°22”E), just 13 km
to the north-west from the Ubbi village reported here to
be (together with Nimule) the southernmost locality of
Tarentola.
Apart from the two outstanding herpeto-faunistic ele-
ments, P. regius and T! a. relicta, representatives of the
West African and Saharan realm(s) respectively, the re-
gion is mostly inhabited by East-African herpetofauna as
reflected by distribution maps provided by Spawls et al.
(2004). In addition, there is a relict population of eastern
chimpanzee Pan troglodytes schweinfurthii on the Mt.
Otzi (Caldecott & Miles 2005), which together with
colobus monkey Colobus guereza (pers. obs.) in the Otzi
forest show clear faunistic affinity to the Guineo-Congo-
lian rainforest block. Finally, a presence of false bananas
of the genus Ensete (pers. obs., Fig. 1c) in the Otzi for-
est suggests also presence of Afromontane elements in the
area. In conclusion, the Mt. Otzi region deserves further
attention as a potential biogeographical match point, where
East- and West-African (savanna), Saharan (desert), Cen-
tral-African (forest-savanna) and possibly Afromontane
biotas meet at one place.
Acknowledgements. We are grateful to the local people of the
Mt. Otzi region, the Ubbi village in particular. Philipp Wagner
and Colin McCarthy of the Zoologisches Forschungsmuseum
Alexander Koenig, Bonn (Germany) and the Natural History
Museum London (UK) respectively, helped us with confirma-
tion of the Zarentola locality records mentioned in the paper.
REFERENCES
Caldecott, J. & Miles, L. (eds.). 2005. World Atlas of Great Apes
and their Conservation. University of California Press,
Berkeley, 404 pp.
Carranza, S., Arnold, E. N., Mateo, J. A. & Geniez, P. 2002.
Relationships and evolution of the North African geckos,
Geckonia and Tarentola (Reptilia: Gekkonidae), based on
mitochondrial and nuclear DNA sequences. Molecular
Phylogenetics and Evolution 23: 244-256
Diaz, L. M. & Hedges, S. B. 2008. A new gecko of the genus
Tarentola (Squamata: Gekkonidae) from Eastern Cuba.
Zootaxa 1743: 43-52
Joger, U. 1984. Taxonomische Revision der Gattung Tarentola
(Reptilia: Gekkonidae). Bonner zoologische Beitrage 35:
129-174
Spawls, S., Howell, K., Drewes, R. & Ashe, J. 2004. A field guide
to the reptiles of East Africa. A & C Black Publishers Ltd.,
London, 72 pp.
Received: 30.V1.2010
Accepted: 24. VIII.2010
©ZFMK
Bonn zoological Bulletin Volume 57
Issue 2
pp. 177-188 Bonn, November 2010
The taxonomic status of Hyperolius spatzi Ahi, 1931 and
HAyperolius nitidulus Peters, 1875
(Amphibia: Anura: Hyperoliidae)*
Mark-Oliver Rodel!, Laura Sandberger!, Johannes Penner!, Youssouph Mané? & Annika Hillers!3
! Museum ftir Naturkunde, Leibniz Institute for Research on Evolution and Biodiversity at the Humboldt
University Berlin, Invalidenstrasse 43, D-10115 Berlin, Germany;
E-mail: [email protected]; Phone: +49 (0)30 20938571
2 Institut de Recherche pour le Dévelopement, Dakar, Senegal
3 Across the River Project, Royal Society for the Protection of Birds, 164 Dama Road, Kenema, Sierra Leone
* this paper is dedicated to Prof. Dr. Wolfgang BoOhme, who’s 1978 paper on the herpetology of Senegal
induced our investigations presented herein.
Abstract. We herein re-investigate the taxonomic status of Hyperolius nitidulus Peters, 1875 and H. spatzi Ahl, 1931 by
means of morphology, vocalization and genetic data. Both taxa are morphologically distinct, have different advertise-
ment calls and differ genetically from each other by 5.1—5.6% sequence divergence in the investigated 16S rRNA gene.
Based on these data we resurrect H. spatzi as a valid species and designate a lectotype for it. Both species occur in sa-
vannas of western Africa. Hyperolius spatzi is restricted to Senegambia and thus far known from Senegal and The Gam-
bia. Its occurrence in Guinea Bissau and southern Mauritania seems likely. Hyperolius nitidulus ranges from Guinea and
Mali eastwards into Nigeria and Cameroon. Records from the driest savannas in north-eastern Nigerian, Cameroon and
the Central African Republic are doubtful and may actually refer to H. pallidus Mertens, 1940.
Key Words. Bioacoustics, biogeography, genetics, morphology, savanna, West Africa.
INTRODUCTION
Many species of the diverse African reedfrog genus Hy-
perolius Rapp, 1842 exhibit very variable color patterns
(Schigtz 1971, 1975, 1999). Some of these color variations
are age and sex specific (Schiotz 1967, Veith et al. 2009).
As these frogs offer comparatively few other species spe-
cific morphological characters, this variability caused con-
siderable taxonomic confusion in the past and resulted in
the description of many taxa which are now regarded as
synonyms (Frost 2010). One author in particular, Ernst
Ahl, contributed to this chaos by describing many new
species (e.g. Ah] 1931a, b), most of which proved to be
invalid (Laurent 1961, Frost 2010). As the in-depth stud-
ies of Schiotz (1967, 1971, 1975) and others have shown,
color and advertisement calls are the most reliable char-
acters for identification of these species. Unfortunately, al-
cohol preserved Hypervolius specimens quickly loose col-
or (and do not call). Therefore it is often difficult, if not
impossible, to evaluate the status of older museum vouch-
ers. Reliable locality data may be of help in some cases
where taxa show allopatric distributions and/or different
habitat requirements.
Bonn zoological Bulletin 57 (2): 177-188
One group of savanna dwelling reedfrogs proved to be es-
pecially variable and consequently taxonomically compli-
cated: the Hyperolius marmoratus/viridiflavus complex
(Laurent 1951b, c, 1981; Schiotz 1971, 1999). These
amazing reedfrogs have an outstanding natural history
with annual population cycles and spectacular behavioral
(Grafe et al. 2002), morphological and physiological adap-
tations, and altogether a unique life history strategy to sur-
vive the harsh and long dry seasons (Spieler 1997; Lin-
senmair 1998; Lampert & Linsenmair 2002 and literature
cited therein). So far, they are the only tetrapods where
sex change has been documented (Grafe & Linsenmair
1989; for literary use of this knowledge see Crichton
1991). To date, Laurent (195la, 1976, 1983) and Schietz
(1971) undertook the most detailed morphological ap-
proach to disentangle the nomenclatory chaos of these
widespread savanna dwelling frogs, which all share a sim-
ilar morphology (short snout, very large vocal sac in
males, transversal gular fold in females, extensive web-
bing) and call (xylophone like metallic calls; for summa-
ry see Schiovtz 1971, 1999).
©ZFMK
178 Mark-Oliver Rédel et al.
However, the mentioned studies of these frogs, using col-
oration and acoustics, did not provide much insight into
their actual taxonomic status (see review by Wieczorek
et al. 1998). Only more recently Wieczorek & Channing
(1997) and Wieczorek et al. (2000, 2001) started to apply
molecular techniques to disentangle the taxonomic chaos.
In the course of their work in particular one member of
the H. viridiflavus-complex/superspecies/species-group,
Fig. 1.
Bonn zoological Bulletin 57 (2): 177-188
H. nitidulus Peters, 1875, was acknowledged species sta-
tus, a decision previously already applied for mostly prag-
matic reasons by e.g. Schietz (1967), Drewes (1984) and
Rédel (1996, 2000). This widespread West African savan-
na frog was described by Peters (1875) from “Yoruba (La-
gos)”, Nigeria. It was treated as a synonym of H. mar-
moratus by Boulenger (1882), as a synonym of H. pic-
turatus by Loveridge (1955) and as synonym or subspecies
Life coloration of Hyperolius spatzi and H. nitidulus; upper left: calling H. spatzi male from Sabodala, Senegal, remark
uniform yellow color at night; lower left: daytime coloration of H. spatzi from Sabodala, Senegal, with numerous minute black
points; upper right: calling H. nitidulus male from Pendjari National Park, northern Benin, remark dark lateral band; lower right:
H. nitidulus couple from Lamto reserve, Ivory Coast, remark almost uniform yellow color of male and grey mottling on legs and
on the flanks in the female.
©ZFMK
Taxonomy of West African Hyperolius
179
Table 1. Morphological differences between Hyperolius nitidulus and H. spatzi based on data provided in the original descrip-
tions and comments based on type specimens and additional material examined herein. Comments which are already deducible
from types only, are given in italic.
Characters H. nitidulus H. spatzi Comments based on types and additional material
Choanae large, not hidden small, hidden below similar sized and well visible in both species
beneath edge of mandible edge of mandible
Tongue large, broad and unusually small tongue in head width spatzi: 3.3 times;
Snout (dorsal view)
Snout (lateral view)
Position of narins
Position of heals
heart-shaped
roundish pointed
flattened or
roundish truncate
slightly closer to
snout-tip than to eye
cover Or Surpass
rounded
truncated
in mid distance
between eye and
snout-tip
in contact
when hind legs arranged to — each other
body at right angles
Dorsal skin skin smooth, laterally thick,
smooth or
with small warts
almost leathery,
rough, beset with
nitidulus: 1.7 times
truncated in dorsal and lateral view in juveniles,
a bit more rounded in adults of both taxa
truncated in dorsal and lateral view in juveniles,
a bit more rounded in adults of both taxa
in both species narins closer to snout-tip
than to eye
surpass each other in both taxa
both taxa with rough skinned juveniles in
dry season and smooth skinned adults
in wet season
many small smooth
or rough warts
Male gular flap absent
Dorsal color yellow often with dark
indistinct
chalk white or fine
present in both taxa
H. spatzi with white, brown or yellow back,
spots on back speckled with regularly beset with small black spots;
dark-brown H. nitidulus never with such uniform pattern of
black spots
Pattern on flanks dark canthal and lateral No pattern in H. spatzi like on back; H. nitidulus with very
stripe (continuous or distinct to rather indistinct black lateral band and
broken), bordered white dark spots
dorsally; below the
stripe flanks marbled in
dark grey and white
Body-length 28 mm 21mm adults of both species up to about 30 mm
of Hyperolius viridiflavus by many other authors (e.g. Lau-
rent 195la, c, 1961; Schigtz 1971). The latter author al-
so treated frogs described as Hyperolius spatzi Ahl, 1931
from Bakel-Kidira, Senegal (Ahl 1931a, b) as either be-
longing to H. nitidulus (Schietz 1967) or as a “subspecies”
of H. viridiflavus (Schietz 1971). In his book, Schietz
(1999) used the name “spatzi” as a vernacular name, de-
scribing “H. viridiflavus” populations of uncertain taxo-
nomic status from Senegambia, whereas Rédel (2000)
considered H. spatzi to represent a junior synonym of H.
Bonn zoological Bulletin 57 (2): 177-188
nitidulus. However, already in the late seventies, Bohme
(1978) revived the name H. spatzi for reedfrogs from
Senegal, thus emphasizing their distinctiveness from oth-
er West African savanna populations. Recently Emms et
al. (2006) adopted this view and reported H. spatzi from
Gambia. Our recent studies of many Hyperolius popula-
tions at various West African savanna localities are the ba-
sis of a taxonomic reinvestigation of both taxa presented
herein.
OZFMK
180 Mark-Oliver Rodel et al.
Fig. 2.
olius nitidulus (ZMB 7729, holotype, adult female) and right:
H. spatzi (ZMB 32602, lectotype, subadult male).
Dorsal and ventral views of the types of left: Hyper-
MATERIAL & METHODS
Morphological measurements were taken with a dial
caliper (+ 0.1 mm) and are given in millimeters. Webbing
formulae follow the scheme of Rédel (2000). Museum
vouchers originated from the Staatliches Museum fir
Naturkunde Stuttgart (SMNS) and the Museum fiir
Naturkunde Berlin (ZMB; Appendix 2). Calls were record-
ed with a Sony WM-D6C tape recorder and a direction-
al microphone (Sony ECM-Z157 and Sony ECU-959C9)
or an EDIROL R-09 24bit digital recorder (sample rate:
44.1 kHz, record mode: wav_24bit, microphone ECM-
950). These calls were analyzed with the program Avisoft
SAS Lab Pro 4.5 (R. Specht, Berlin, Germany). For se-
quence comparisons, we analyzed 247 base pairs (bp) of
the mitochondrial 16S ribosomal RNA gene from Hyper-
olius spatzi (ZMB 74280, GenBank HQ113098; Senegal,
Sabodala) and Hyperolius nitidulus (ZMB 74884, Gen-
Bonn zoological Bulletin 57 (2): 177-188
Bank HQ113099, Sierra Leone, Tingi Hills; no voucher,
GenBank HQ113100, Ivory Coast, Mont Sangbé Nation-
al Park, tissue without voucher). Further hyperoliid gene
sequences were obtained from GenBank (Tab. 1). DNA
extraction, amplification and sequence alignment followed
the procedures as described in Rédel et al. (2009). Uncor-
rected pairwise sequence divergence was calculated us-
ing PAUP*4b10 (Swofford 2002).
RESULTS & DISCUSSION
Morphological comparison. A major problem in using
external morphological characters for determination of
these frogs is their polymorphism. Schigtz’s (1963, 1967,
1971) described distinct color phases for many Hyperolius
species, i.e. called F or A and J or B, respectively. The
phase F/A of H. nitidulus/spatzi refers to the adult/wet sea-
son pattern, whereas phase J/B is the juvenile or sub-adult
dry season pattern. Young frogs in dry season condition
have a rough, warty dorsal skin which is brown below
35°C and chalk white above this temperature (see figs. in
Spieler 1997 and Rédel 2000). Adult frogs have smooth
skin and a completely different dorsal color pattern (Fig.
1). These morphological differences are part of the amaz-
ing aestivation strategy of these frogs (see Linsenmair
1998; Rédel 2000 and literature cited therein).
According to the descriptions by Ahl (1931b) differences
between Hyperolius nitidulus and H. spatzi would be those
summarized in Tab. 1 (compare also translations of the
original descriptions provided in Appendix 1). Major dif-
ferences between the descriptions of H. nitidulus and H.
spatzi consist in the fact that the description of the for-
mer is based on an adult female, whereas the description
of the latter is based on a series of subadult frogs in dry
season condition (Fig. 2).
Schiotz (1967, 1971, 1999) mentioned differences be-
tween various West African H. nitidulus populations, in-
cluding a cline in pattern from Sierra Leone (few and small
spots on flanks) to Cameroon (broad lateral band; same
cline in pattern on the lower legs). He also observed an
hour-glass pattern and a dark vocal sac in frogs from Sier-
ra Leone (likewise present in some juveniles in northern
Ivory Coast, see Rédel 2000). Our specimens from Sier-
ra Leone neither differed in coloration nor in genetics (see
below) from e.g. H. nitidulus populations from northern
Ivory Coast. Schietz (1971) further mentions that frogs
from drier northern savannas are more uniform grayish
colored, whereas more southern ones, 1.e. from the humid
savanna types, exhibit a distinct pattern. The latter differ-
ences might be related to age. R6del (2000) reported that
older specimens are more distinctly colored. As adult H.
nitidulus are unable to survive the dry season, all popu-
©ZFMK
Taxonomy of West African Hyperolius 181
H. spaizi
10
N
aE
=
>
oO
=
o
=)
oO
2
cs
1V
H._ nitidulus
Frequency (kHz)
1V
Fig. 3.
Waveforms, spectrograms and energy plots of the advertisement calls of Hyperolius spatzi (above) and H. nitidulus (be-
low; compare Tab. 2). The Hyperolius spatzi male from Sabodala, Senegal, was recorded in a terrarium. The Hyperolius nitidulus
was recorded at a savanna pond in Comoé National Park, Ivory Coast. The background noise is a chorus of other H. nitidulus males.
lations are annual (Linsenmair 1998). In more humid sa-
vannas, the wet season lasts longer and frogs may reach
older ages (and thus potentially a more colorful pattern).
Almost all anatomical differences (position and size of
choanae, position of narins, size, shape, length of extrem-
ities, head width) deducible from Ahl’s (193 1a, b) descrip-
tions (compare Tab. 1) are identical among both taxa (for
specimens investigated see Appendix 2). Both species
have very short, rounded snouts, females posses a typical
gular fold and males have very large vocal sacs with a
large but diffuse whitish yellow gular flap (gland). Juve-
niles are often almost indistinguishable. Hyperolius nitidu-
lus juveniles show clear dorsolateral bands or an hour-
glass pattern shortly after metamorphoses (see figs. in
Rédel 2000). In dry season conditions they are uniform
Bonn zoological Bulletin 57 (2): 177-188
brown or white. Juvenile H. spatzi in dry season condi-
tions are white with many small black dots, the latter
sometimes being indistinct. In contrast, adult frogs are dis-
tinctively colored. The dorsal surfaces of H. spatzi are
chalk-white to yellow, densely beset with tiny black spots,
whereas H. nitidulus is brownish or yellowish with black
spots and has black lateral lines and spots (plate 18 in
Leaché et al. 2006). H. nitidulus has white, yellow or red-
dish ventral surfaces, whereas these surfaces are exclusive-
ly yellow in H. spatzi (see fig. 2f in Emms et al. 2006).
The hidden parts of legs are pinkish to blood red in both
species (Fig. 2 and figs. 430 & 431 in Schiotz 1999, figs.
in Rédel 2000). Generally, females of H. nitidulus have
amore distinct lateral black pattern than males, which can
be almost uniform brown (Fig. | and figs. in R6del 2000).
At night, males of both taxa appear uniform yellowish.
©ZFMK
182 Mark-Oliver Rodel et al.
Table 2. Characteristics of the advertisement calls of Hyperolius spatzi, recorded in Sabodala, Senegal, and H. nitidulus, record-
ed in the Comoé National Park, Ivory Coast and Mount Nimba, Guinea (Fig. 3). Differences of call length, main frequency and
time between calls have been tested by comparing mean values of five males of each species (Wilcoxon test).
Call length [sec]
Frequency [Hz]
Inter-call intervals [sec]
mean 0.08
sd 0.04
H. spatzi
N (males) 5
N (calls) 25
mean 0.02
sd < 0.01
H. nitidulus
N (males) 5
N (calls) 25
W 616
P < 0.0001
2638.0 1
139.6 0.80
5 5
25 25
2927.6 1.01
85.1 0.29
>) 4
25 20
26 218
< 0.0001 0.4756
Usually, the pattern in H. nitidulus remains vaguely vis-
ible. The only morphological difference detected by us
(herein confirming Ahl 1931a, b), is the size and shape of
the tongue. Hyperolius spatzi usually have comparative-
ly smaller and narrower tongues than H. nitidulus, whose
tongue 1s broad and almost heart-shaped. This 1s also vis-
ible in the type specimens of both species.
Acoustics. The advertisement call of both taxa is a sin-
gle, pure, metallic and very loud tone (Fig. 3). Choruses
of both species resemble xylophones or bells. Although
superficially similar, advertisement calls of both taxa
showed significant differences. The call of H. spatzi was
of comparatively longer duration and lower frequency
(Tab. 2). The small sample size and the relatively slight
differences in call characteristics urge for some caution
in their interpretation. However, the acoustic results are
not contradicting the specific distinctiveness of H. nitidu-
lus and H. spatzi.
Genetics. The genetic distances in the investigated frag-
ment of the 16S RNA gene between Hyperolius spatzi (N=
1) and 1. nitidulus (N= 3, originating from Sierra Leone
and Ivory Coast) ranged from 5.1—5.6%. The mean dis-
tance between H. spatzi and various other members of the
H. viridiflavus/marmoratus-complex (N= 33; including H.
nitidulus) was 5.9% (+ 1.1 SD; range: 3.6-8.7%). The low-
est distance was present in comparison to a H. viridiflavus
angolensis, the highest to a H. viridiflavus viridiflavus
sample (sequences from GenBank, compare Tab. 3). Mean
Bonn zoological Bulletin 57 (2): 177-188
genetic distances between H. spatzi and nine other Hyper-
olius species was 18.7% (+ 3.9 sd; range: 11.2—23.2%).
The lowest distance present occurred in comparison to H.
Jusciventris, the highest to a H. cinnamomeoventris sam-
ple (compare Tab. 3).
Based on genetic data (12S and 16S), Wieczorek et al.
(2000, 2001) recognized H. nitidulus as being distinct on
the species level from other members of the H. viridiflavus
group. Altogether they accepted ten species within this
group of which H. nitidulus was most distinct (within in-
traspecific genetic variation 0.7—-4.8%; between clade vari-
ation 2.4-10.0%; Wieczorek et al. 2001). Our data con-
firm their results and speak in favor of likewise recogniz-
ing H. spatzi as a distinct species.
Distribution. Hyperolius nitidulus occurs in humid to dry
savannas of West Africa (Fig. 4; Lamotte 1966; Schietz
1967, 1999; Rédel 2000). Laurent’s (1951c) doubts con-
cerning the type locality of H. nitidulus were rejected by
Schiotz (1963), by explaining that savanna exists at the
type locality, and thus also suitable habitats for H. nitidu-
lus. Records have been published for Benin (Nago et al.
2006), Ghana (Schiotz 1964a, 1967; Hoogmoed 1980;
Hughes 1988; Rédel & Agyei 2003; Leaché 2005; Leaché
et al. 2006), Burkina Faso (this paper), eastern and cen-
tral Guinea (Laurent 1951a, c; Schiotz 1967; Rédel et al.
2004; Hillers et al. 2006, 2008; Greenbaum & Carr 2005),
Ivory Coast (Laurent 1951c; Lamotte & Perret 1963; Bar-
bault 1967, 1972; Lamotte 1967; Schigtz 1967; Vuattoux
©OZFMK
Taxonomy of West African Hyperolius 183
Fig. 4.
: 1
Kilometers
Known distributions of Hyperolius spatzi (circles) and H. nitidulus (squares) based on museum and literature records
(compare text and Appendix 2); stars indicate positions of type localities of H. spatzi (Senegal) and H. nitidulus (Nigeria). The
north-westernmost record of H. nitidulus in Nigeria may refer to H. pallidus, southern and central Cameroonian populations are
usually referred to two H. nitidulus subspecies (compare text and fig. 428 in Schiotz 1999).
1968; Euzet et al. 1969; Rédel 1996, 1998, 2000, 2003;
Spieler 1997; Linsenmair 1998; Rédel & Spieler 2000;
Rodel & Ernst 2003; Adeba et al. 2010), Mali (Schiotz
1967), Nigeria (Schiotz 1963, 1966, 1967; Walker 1968;
Onadeko & Rédel 2009), Sierra Leone (Schiotz 1964b,
1967; Lamotte 1971), and Togo (Bourgat 1979; Segniag-
beto et al. 2007).
Hyperolius spatzi, as defined herein, has been recorded
from Senegal (Boettger 1881, as H. cinctiventris;
Loveridge 1956; Schietz 1967; Lamotte 1969; Miles et al.
1978, listed as H. nitidulus; Ahl 1931a, b; B6hme 1978),
and The Gambia (Andersson 1937 as H. sp., but unam-
biguous description provided; Barnett & Emms 2005 as
H. nitidulus; Emms et al. 2006). A record from Guinea was
actually based on 7. nitidulus (Hillers et al. 2006; see Ap-
pendix 2). Schietz (1971) recognized “H. viridiflavus
spatzi’’ as a taxonomic unit occurring in Senegambia and
provides a map, indicating the distribution of H. spatzi and
H. nitidulus, respectively (fig. 42 in Schietz 1971). Padi-
al & de la Riva (2004) believed that H. nitidulus and H.
viridiflavus may occur in southern Mauritania. Hyperolius
viridiflavus (sensu stricto) certainly does not occur in
western Africa, including Mauritania. Hyperolius nitidu-
lus might reach eastern Mauritania and it seems very like-
ly that H. spatzi might be a part of the Mauritanian fau-
na, as is indicated by the close proximity of the type lo-
cality of this species to the boarder of Mauritania (Fig. 4).
Mountains and rivers can act as potential barriers between
taxa (e.g. Li et al. 2009, for contrasting results see Gas-
con et al. 1998). In this case, the Géba and Corubal rivers
Bonn zoological Bulletin 57 (2): 177-188
along the border between Guinea-Bissau and Guinea,
might fulfill such a role. It is also possible that the north-
ern foothills of the Fouta Djallon serve as an altitudinal
barrier. However, more data from Equatorial Guinea, west-
ernmost Guinea, eastern Senegal, western Mali and Mau-
ritania would be needed to clarify the exact limits of the
species’ ranges.
The distribution of H. nitidulus in Central Africa is more
complicated. The species is listed as 1. viridiflavus (sub-
species H. v. nitidulus, H. v. pallidus) for Cameroon, the
Central African Republic and the Democratic Republic of
Congo by Frétey & Blanc (2000). In northern Cameroon
and adjacent north-eastern Nigeria, Chad and the Central
African Republic (Joger 1990), H. nitidulus may be re-
placed by H. pallidus which was described by Mertens
(1940) from dry northern Cameroon (Poli near Garua) and
which has been treated by Perret (1966) as a full species,
and by Schietz (1971) and Amiet (1973) as a subspecies
of H. nitidulus. From Cameroonian savannas, situated a
bit further south, two H. nitidulus subspecies have been
described by Perret (1966). Hyperolius n. bangwae occurs
in elevated savannas, 1.e. Bamenda, Bamiléké, Adamaoua,
whereas H. n. aureus is said to occur in the drier north-
ern savannas and semi-deserts (Perret 1966; compare e.g.
Bohme & Schneider 1987 for some records). This view
was adopted by Schietz (1971) and Amiet (1973). The lat-
ter provided arguments for the treatment of these taxa as
subspecies of H. nitidulus, i.e. Cameroonian frogs differ
from typical H. nitidulus by slightly smaller size and
slightly duller coloration. The voices are “as good as iden-
tical” (Amiet 1973). More recently, Amiet thought that all
©OZFMK
184 Mark-Oliver Rodel et al.
Table 3. Genetic distances between Hyperolius spatzi (ZMB 74280; GenBank #: HQ113098) and other Hyperolius species. Un-
corrected p-distances are based on 247 base pairs of mitochondrial 16S ribosomal RNA. Values for H. nitidulus are given in bold.
Genus Species subspecies“ GenBank # p-distance
Hyperolius chlorosteus FJ594076 0.214
Hyperolius cinnamomeoventris FJ594077 0.232
Hyperolius concolor FJ594078 0.203
Hyperolius fusciventris FJ594080 0.112
Hyperolius guttulatus FJ594082 0.133
Hyperolius horstocki AF282410 0.199
Hyperolius kivuensis AF282409 0.183
Hyperolius naustus AF215442 0.219
Hyperolius nitidulus HQ113099 0.051
Hyperolius nitidulus HQ113100 0.051
Hyperolius nitidulus AF282435 0.056
Hyperolius picturatus FJ594090 0.186
Hyperolius viridiflavus AF215440 0.056
Hyperolius viridiflavus AF215441 0.061
Hyperolius viridiflavus AY323920 0.077
Hyperolius viridiflavus angolensis AF282411 0.036
Hyperolius viridiflavus albofaciatus AF282433 0.065
Hyperolius viridiflavus aposematicus AF282412 0.051
Hyperolius viridiflavus argentovittis AF282431 0.046
Hyperolius viridiflavus bayoni AF282413 0.082
Hyperolius viridiflavus broadleyi AF282414 0.071
Hyperolius viridiflavus ferniquei AF282416 0.051
Hyperolius viridiflavus ferniquei AY 603987 0.051
Hyperolius viridiflavus glandicolor AF282417 0.066
Hyperolius viridiflavus goetzi AF282418 0.066
Hyperolius viridiflavus mariae AF282419 0.066
Hyperolius viridiflavus mariae AF282420 0.066
Hyperolius viridiflavus marginatus AF282430 0.051
Hyperolius viridiflavus melanoleucus AF282432 0.056
Hyperolius viridiflavus pamtherinus AF282425 0.051
Hyperolius viridiflavus pitmani AF282426 0.066
Hyperolius viridiflavus marmoratus AF282421 0.056
Hyperolius viridiflavus ngorongoro AF282423 0.066
Hyperolius viridiflavus ommatostictus AF282424 0.056
Hyperolius viridiflavus pyrrhodictyon AF282434 0.046
Hyperolius viridiflavus rhodesianus AF282427 0.038
Hyperolius viridiflavus rubripes AF282436 0.062
FHyperolius viridiflavus swymmertoni AF282415 0.071
Hyperolius viridiflavus taeniatus AF282422 0.056
Hyperolius viridiflavus verrucosus AF282428 0.062
Hyperolius viridiflavus viridiflavus AF282429 0.087
Bonn zoological Bulletin 57 (2): 177-188 ©OZFMK
Taxonomy of West African Hyperolius 185
three Cameroonian taxa are subspecies of H. viridiflavus,
i.e. the highlands of western Cameroon and the Adamaoua
plateau being inhabited by H. v. aureus (and possibly H.
v. bangwae), and populations occurring in northern
Cameroon (mid-Sudanian, Sudano-Sahelian and Sahelian
zones) belong to H. v. bangwae and H. v. pallidus (J.-L.
Amiet pers. comm.).
Conclusions. Our investigations on the type specimens,
as well as on additional vouchers, revealed small but dis-
tinct morphological (mostly color pattern; tongue shape
and size), significant acoustic and large genetic differences
(16S gene). Especially the genetic differences are clear-
ly within the range that is thought to be species specific
in anurans (Vences et al. 2005a, b; Rédel et al. 2009;
Vieites et al. 2009). Our results thus speak in favor of rec-
ognizing both taxa as distinct species. A contradicting ar-
gument was seen in the very complicated situation of a
large variation of color patterns between and within pop-
ulations of the Hyperolius viridiflavus/marmoratus species
group(s). Schietz (1999) thus questions an approach where
the taxonomy for only a small part of the continent would
be resolved. However, in West Africa it is possible to as-
sign these frogs to particular names and we thus do not
see a reason for avoiding it. We therefore herein resurrect
the species status of H. spatzi, designate a lectotype from
the series of syntypes and redescribe the species based on
type and new material.
REDESCRIPTION OF HYPEROLIUS SPATZI
AHL, 1931.
ZMB 32602 (lectotype; Fig. 2), 74853-74876 (paralecto-
types, formerly all ZMB 32602), all from Bakel-Kidira,
Senegal, coll. Spatz.
Description of lectotype (all measurements in mm).
Subadult frog (male, vocal sac barely developed?); short,
compact body; snout-vent length 19.2; head width 7.3,
head length 6.9, thus head wider than long; snout short
and truncated in dorsal and lateral view; narins angular
narrow slit, closer to snout-tip than to eye; tympanum hid-
den; transversal gular fold; tongue small, narrow, almost
parallel and notched anteriorly, tongue width 2.3, tongue
length 3.2, tongue 3.3 times in head width; choanae small
and round, close to edge of mandible but well visible; dor-
sal skin slightly granular; belly granular (medially dissect-
ed); ventral skin on thighs near vent granular, remaining
ventral parts of hind limbs smooth; finger and toe tips en-
larged to discs; relative lengths of fingers: 1<2<4<3; basal
webbing between fingers; femur length: 8.4; tibia length:
10.4; foot incl. longest toe: 14.0; relative lengths of toes:
1<2<3<5<4; webbing formula: 1 (0), 2 (1.5-0), 3
(1.5—0.5), 4 (1-0), 5 (0); subarticular tubercles on fingers
Bonn zoological Bulletin 57 (2): 177-188
and toes not very prominent. Dorsal surfaces chalk white,
densely beset with minute black points; ventral skin on
thighs near vent white, remaining parts of thighs and ven-
tral parts of shanks, feet, inner parts of forelimbs, ventral
part of hands and fingers fleshy colored.
Variation. Series of paralectotypes almost indistinguish-
able from lectotype, exclusively subadult frogs in dry sea-
son conditions; dorsal skin partly more or less granular
than in lectotype; black points on white ground sometimes
more distinct or sometimes almost absent. Further mate-
rial (see Appendix 2) exhibit the following variation: Male
snout-vent length: 27.0—-31.3 (N= 6); female snout-vent
length 30.6 (N= 1); snout shape of adult frogs in dorsal
and ventral view slightly more rounded than in juveniles;
adults of both sexes in ethanol with dorsal surfaces (incl.
upper side of thighs) with brownish ground color (com-
posed of small, very dense brownish points), many very
distinct black spots; black spots sometimes a bit more
abundant on flanks than on back; some specimens with
black spots on throat; others with uniform clear ventral
surfaces; tongue in almost all specimens small and com-
paratively narrow (exception: ZMB 74279). Adult animals
in life brownish to yellow with very distinct black spots.
These may be not visible during night. Venter yellow.
Acknowledgements. We thank SRK Consulting (Canada) and
the Oromin Exploration Ltd. for financial and logistic support
for conducting a survey in south-eastern Senegal which enabled
us to collect and sequence several specimens of Hyperolius
spatzi; and the authorities in various West African countries for
the respective research, collection and export permits. J. Koh-
ler provided valuable comments on the manuscript. This study
is part of the BIOLOG-program of the German Ministry of Ed-
ucation and Science (BMB+F; Project BIOTA-West HI, amphib-
ian project, 01LC0617J).
REFERENCES
Adeba PJ, Kouassi P, R6del M-O (2010) Anuran amphibians in
a rapidly changing environment — revisiting Lamto, Cote
d'Ivoire, 40 years after the first herpetofaunal investigations.
African Journal of Herpetology 59: 1-16.
Ahl-E (193 1a) Zur Systematik der afrikanischen Arten der Baum-
froschgattung Hyperolius (Amph. Anur.). Mitteilungen aus
dem zoologischen Museum Berlin 17: 1-132
Ahl E (1931b) Anura HI, Polypedatidae. Pp. I-X VI + 1-477 in:
Schulze FE & Ktikenthal W (eds) Das Tierreich 55. Lieferung.
Walter de Gruyter, Berlin & Leipzig
Amiet J-L (1973) Compte rendu d’une mission batrachologique
dans le Nord-Cameroun. Annales de la Faculté des Sciences
du Cameroun 12: 63-78
Andersson LG (1937) Reptiles and batrachians. Collected in the
Gambia by Gustav Svensson and Birger Rudebeck (Swedish
Expedition 1931). Arkiv for zoologi 29A: 1—28
Barbault R (1967) Recherches écologiques dans la savane de
Lamto (Céte d’Ivoire): Le cycle annuel de la biomasse des am-
phibiens et des lézards. Terre Vie 3: 297-318
©ZFMK
186 Mark-Oliver Rodel et al.
Barbault R (1972) Les peuplements d’amphibiens des savanes
de Lamto (Cote dIvoire). Annales de l’ Université d’ Abidjan
Sér. E 5: 59-142
Barnett LK, Emms C (2005) Common amphibians of the Gam-
bia. Makasutu Wildlife Trust, Serrekunda, The Gambia
Bohme W (1978) Zur Herpetofaunistik des Senegal. Bonner zoo-
logische Beitrage 29: 360-417
Bohme W, Schneider B (1987) Zur Herpetofaunistik Kameruns
(III) mit Beschreibung einer neuen Cardioglossa (Anura: Ar-
throleptidae). Bonner zoologische Beitrage 38: 241-263
Boettger O (1881) Aufzahlung der von Frhrn. H. und Frfr. A.
von Maltzahn im Winter 1880/81 am Cap Verde in Senegam-
bien gesammelten Kriechtiere. Abhandlungen Senckenber-
gisch naturforschenden Gesellschaft Frankfurt a.M. 12: 393—
419 + | plate
Boulenger GA (1882) Catalogue of the Batrachia Salientia s.
Ecaudata in the collection of the British Museum. 2.ed. Bri-
tish Museum, London
Bourgat R (1979) Trématodes d’Amphibiens du Togo. Bulletin
du Muséum d’ Histoire naturelle 3: 597-624
Crichton M (1991) Jurassic Park. Random House Publishing
Group, New York
Drewes RC (1984) A phylogenetic analysis of the Hyperoliidae
(Anura): Treefrogs of Africa, Madagascar, and the Seychelles
Islands. Occasional Papers of the California Academy of Sci-
ences 139: 1-70
Emms C, Jambang MDK, Bah O, Mankali B, Rodel M-O, Bar-
nett L (2006) The amphibian fauna of The Gambia, West
Africa. Herpetological Bulletin 94: 6-16
Euzet L, Combaz C, Knoepffler L-P (1969) Parasites d’amphi-
biens de Cote d’Ivoire et du Liberia: Polystomatidae (Mono-
genea). Biologia Gabonica 3: 217-221
Frétey T, Blanc CP (2000) Liste des Amphibiens d’A frique cen-
trale. Cameroun, Congo, Gabon, Guinée-Equatoriale,
République Centrafricaine, République Démocratique du Con-
go, Sao Tomé et Principe. Les dossiers de |’ ADIE, Série Bio-
diversité N°2: 1-39.
Frost DR (2010) Amphibian species of the World: an online ref-
erence. Version 5.4 (8 April, 2010).
http://research.amnh.org/vz/herpetology/amphibia, American
Museum of Natural History, New York (accessed 12 July
2010)
Gascon C, Lougheed SC, Bogart JP (1998) Patterns of genetic
population differentiation in four species of Amazonian frogs:
A test of the riverine barrier hypothesis. Biotropica 30:
104-119
Grafe TU, Dobler S, Linsenmair KE (2002) Frogs flee from the
sound of fire. Proceedings of the Royal Society of London B
269: 999-1003
Grafe TU, Linsenmair KE (1989) Protogynous sex change in the
reed frog Hyperolius viridiflavus. Copeia 1989: 1024-1029
Greenbaum E, Carr JL (2005) The herpetofauna of Upper Niger
National Park, Guinea, West Africa. Scientific Papers of the
Natural History Museum University of Kansas 37: 1-21
Hillers A, Bangoura MA, Loua N-S, Rédel M-O (2006) Inven-
taire rapide des amphibians et des reptiles dans la région de
Boke dans le nord-ouest de la Guinée. Pp. 59-64, 131-136,
178-181 in: Wright HE, McCulloughn J, Diallo MS (eds) Une
inventaire biologique rapide de la préfecture de Boké dans le
nord-ouest de la Guinée / A rapid biological assessment of
Boke Préfecture, northwestern Guinea. RAP Bull. of Biol. As-
sessment 41, Conservation International, Washington D.C.
Hillers A, Loua N-S, Rédel M-O (2008) A preliminary assess-
ment of the amphibians of the Fouta Djallon, Guinea, West
Africa. Salamandra 44: 113-122
Bonn zoological Bulletin 57 (2): 177-188
Hoogmoed MS (1980) Herpetologische waarnemingen in
Ghana II. Lacerta 38: 10—20
Hughes B (1988) Herpetology in Ghana (West Africa). British
Herpetological Society Bulletin 25: 29-38
Joger U (1990) The herpetofauna of the Central African Repub-
lic, with description of a new species of Rhinotyphlops (Ser-
pentes: Typhlopidae). Pp. 85-102 in: Peters G, Hutterer R
(eds) Vertebrates in the tropics. Museum Alexander Koenig,
Bonn
Joger U, Lambert MRK (2002) Inventory of amphibians and rep-
tiles in SE Senegal, including the Niokola-Koba National Park,
with observations on factors influencing diversity. Tropical
Zoology 15: 165-185
Lamotte M (1966) Types de répartition géographique de quel-
ques batraciens dans l’Ouest Africain. Bulletin de |’Institut
fondamental d’ Afrique noire Sér. A 28: 1140-1148
Lamotte M (1967) Les batraciens de la région de Gpakobo (Cote
d'Ivoire). Bulletin de I’ Institut fondamental d’ Afrique noire
Ser. A 29: 218-294
Lamotte M (1969) Le parc national du Niokolo—Koba, Fasciule
UI; XXX. Amphibiens (deuxi¢me note). Mémoires de |’ Ins-
titut fondamental d’ Afrique noire 84: 420-426
Lamotte M (1971) Le Massif des Monts Loma (Sierra Leone),
Fasciule I; XIX. Amphibiens. Mémoires de |’ Institut fonda-
mental d’ Afrique noire 86: 397-407
Lampert KP, Linsenmair KE (2002) Alternative life cycle stra-
tegies in the West African reed frog Hyperolius nitidulus: the
answer to an unpredictable environment? Oecologia 130:
364-372
Laurent RF (1951a) Catalogue des rainettes africaines (genres
Afrixalus et Hyperolius) de la collection du Muséum Natio-
nal d’Histoire Naturelle de Paris. Annales de la Société Royale
Zoologique de Belgique 82: 23—50
Laurent RF (1951b) Quelques donnes nouvelles sur la systéma-
tique et l’écologie du genre Hyperolius Rapp. Annales de la
Société Royale Zoologique de Belgique 82: 329-337
Laurent RF (1951c) Apercu des formes actuellement reconnais-
sables dans la superespece Hyperolius marmoratus. Annales
de la Société Royale Zoologique de Belgique 82: 379-397
Laurent RF (1961) Note sur les Hyperolius et quelques Afrixa-
lus (Salientia) du Musée de Berlin. Revue de zoologie et de
botanique africaines 64: 65-96.
Laurent RF (1976) Nouveaux commentaires sur la superespéce
Hyperolius viridiflavus (Anura). Musée Royal d’ Afrique Cen-
trale Série IN-8, Science zoologique, 213: 71-114
Laurent RF (1983) La superespéce Hyperolius viridiflavus
(Duméril & Bibron, 1841) (Anura Hyperoliidae) en Afrique
Centrale. Monitore Zoologico Italiano N.S. Suppl. 18: 1-93
Leaché AD (2005) Results of a herpetological survey in Ghana
and a new country record. Herpetological Review 36: 16-19
Leaché AD, Rodel M-O, Linkem CW, Diaz RE, Hillers A, Fu-
jita MK (2006) Biodiversity in a forest island: reptiles and am-
phibians of the West African Togo Hills. Amphibian and Rep-
tile Conservation 4: 22-45
Li R, Chen W, Fu J (2009) Rivers as barriers for high elevation
amphibians: a phylogeographic analysis of the alpine stream
frog of the Hengduan Mountains. Journal of Zoology 277:
309-316
Linsenmair KE (1998) Risk-spreading and risk-reducing tactics
of West African anurans in an unpredictably changing and
stressful environment. Pp. 221—242 in: Newbery DM, Prins
HHT, Brown ND (eds) Dynamics of tropical communities.
Blackwell Science, London
Loveridge A (1955) On Amphibia Salientia from the Ivory Co-
ast. Revue suisse de Zoologie 62: 129-150
©ZFMK
Taxonomy of West African Hyperolius 187
Loveridge A (1956) VI. Amphibiens. In: Le Pare National de
Niokolo-Koba. Mémoires de |’ Institut fondamental d’ A frique
Noires 48: 163—166
Mertens R (1940) Zur Herpetologie Kameruns und Deutsch-Ost-
afrikas. Zoologischer Anzeiger 131: 239-250
Miles MA, Thomson AG, Walters GW (1978) Amphibians and
reptiles from the vicinity of Boughari, Casamance (Senegal),
and the Gambia. Bulletin de l'Institut fondamental d’A frique
noire Sér. A 40: 437-456
Nago SGA, Grell O, Sinsin B, Rédel M-O (2006) The amphib-
ian fauna of the Pendjari National Park and surroundings,
northern Benin. Salamandra 42: 93-108
Onadeko AB, Rédel M-O (2009) Anuran surveys in south-west-
ern Nigeria. Salamandra 45: 1-14
Padial JM, de la Riva I (2004) Annotated checklist of the am-
phibians of Mauritania (West Africa). Revista Espanola de
Herpetologia 18: 89-99
Perret J-L (1966) Les amphibiens du Cameroun. Zoologische
Jahrbticher (Systematik) 8: 289-464
Peters W (1875) Uber die von Hrn. Professor Dr. R. Buchholz
in Westafrika gesammelten Amphibien. Monatsberichte der
K@6niglich PreuBischen Akademie der Wissenschaften zu Ber-
lin Marz: 196-212 + 3 plates
RODEL M-O (1996) Amphibien der westafrikanischen Savanne.
Edition Chimaira, Frankfurt/M.
Rédel M-O (1998) Kaulquappengesellschaften ephemerer Sa-
vannengewasser in Westafrika. Edition Chimaira, Frankfurt/M.
Rédel M-O (2000) Herpetofauna of West Africa, Vol. I: Amphib-
ians of the West African savanna. Edition Chimaira, Frank-
furt/M.
Rédel M-O (2003) The amphibians of Mont Sangbé National
Park, Ivory Coast. Salamandra 39: 91-110
R6édel M-O, Agyei AC (2003) Amphibians of the Togo-Volta
highlands, eastern Ghana. Salamandra 39: 207—234
Rédel M-O, Bangoura MA, Bohme W (2004) The amphibians
of south-eastern Republic of Guinea (Amphibia:
Gymnophiona, Anura). Herpetozoa 17: 99-118
Rédel M-O, Boateng CO, Penner J, Hillers A (2009) A new cryp-
tic Phrynobatrachus species (Amphibia: Anura: Phrynobatra-
chidae) from Ghana, West Africa. Zootaxa 1970: 52-63
R6del M-O, Ernst R (2003) The amphibians of Marahoué and
Mont Péko National Parks, Ivory Coast. Herpetozoa 16: 23-39
Rédel M-O, Spieler M (2000) Trilingual keys to the savannah-
anurans of the Comoé National Park, Ivory Coast. Stuttgar-
ter Beitrage zur Naturkunde Serie A Nr. 620: 1-31
Schietz A (1963) The amphibians of Nigeria. Videnskabelige
Meddelelser fra Dansk Naturhistorisk Forening 125: 1-92 +
4 plates
Schietz A (1964a) A preliminary list of amphibians collected in
Ghana. Videnskabelige Meddelelser fra Dansk Naturhistorisk
Forening 127: 1-17
Schigtz A (1964b) A preliminary list of amphibians collected in
Sierra Leone. Videnskabelige Meddelelser fra Dansk Naturhis-
torisk Forening 127: 19-33 + 1 plate
Bonn zoological Bulletin 57 (2): 177-188
Schiotz A (1966) On a collection of amphibia from Nigeria. Vi-
denskabelige Meddelelser fra Dansk Naturhistorisk Forening
129: 43-48 + 3 plates
Schietz A (1967) The treefrogs (Rhacophoridae) of West A frica.
Spolia Zoologica Musei Hauniensis 25: 1-346
Schiotz A (1971) The superspecies Hyperolius viridiflavus (Anu-
ra). Videnskabelige Meddelelser fra Dansk Naturhistorisk
Forening 134: 21-76
Schiotz A (1975) The treefrogs of Eastern Africa. Steenstrupia,
Copenhagen
Schigtz A (1999) Treefrogs of Africa. Edition Chimaira, Frank-
furt/M
Segniagbeto GH, Bowessidjaou JE, Dubois A, Ohler A (2007)
Les amphibiens du Togo: état actuel des connaissances. Aly-
tes 24: 72-90
Spieler M (1997) Anpassungen westafrikanischer Froschlurche
an TrockenstreB und Réuberdruck in einer westafrikanischen
Savanne. Salamandra 33: 133-152
Swofford DL (2001) Paup*: phylogenetic analysis using parsi-
mony (and other methods), version 4.06b. Sinauer Associates,
Sunderland/Massachusetts
Veith M, Kosuch J, Rédel M-O, Hillers A, Schmitz A, Burger
M, Lotters S (2009) Multiple evolution of sexual dichroma-
tism in African reed frogs. Molecular Phylogenetics and Evo-
lution 51: 388-393
Vences M, Thomas M, Bonett RM, Vieites DR (2005a) Deci-
phering amphibian diversity through DNA barcoding: changes
and challenges. Philosophical Transactions of the Royal So-
ciety B Biological Sciences 360: 1859-1868
Vences M, Thomas M, van der Meijden A, Chiari Y, Vieites DR
(2005b) Comparative performance of the 16S rRNA gene in
DNA barcoding of amphibians. Frontiers in Zoology 2: 5
Vieites DR, Wollenberg KC, Andreone F, Kohler J, Glaw F,
Vences M (2009) Vast underestimation of Madagascar’s bio-
diversity evidenced by an integrative amphibian inventory.
Proceedings of the National Academy of Sciences of the
U.S.A. 106: 8267-8272.
Vuattoux R (1968) Le peuplement du palmier ronier (Borassus
aethiopum) d'une savane de Cote dIvoire. Annales de Il’ Uni-
versité d’ Abidjan, Sér. E, 1: 1-138
Walker RB (1968) The amphibians of Zaria, in the northern
Guinea savannah, Nigeria. Copeia 1968: 164-167
Wieczorek AM, Channing A (1997) The taxonomic status of
Broadley’s reed frog. African Journal of Herpetology 46:
110-116.
Wieczorek AM, Channing A, Drewes RC (1998) A review of the
taxonomy of the Hyperolius viridiflavus complex. Herpeto-
logical Journal 8: 29-34
Wieczorek AM, Drewes RC, Channing A (2000): Biogeography
and evolutionary history of Hyperolius species: application of
molecular phylogeny. Journal of Biogeography 27: 1231—1243
Wieczorek AM, Drewes RC, Channing A (2001) Phylogenetic
relationships within the Hyperolius viridiflavus complex (Anu-
ra: Hyperoliidae), and comments on taxonomic status. Am-
phibia-Reptilia 22: 155-166
©ZFMK
188 Mark-Oliver R6édel et al.
APPENDIX 1.
Translations of the original descriptions of Hyperolius nitidulus
by Peters (1875) and Hyperolius spatzi by Ahl (193 1a):
Hyperolius nitidulus (Fig. 2): “Body shape equals that of H.
marmoratus. Snout same length as eye. Tympanum hidden. Bel-
ly and ventral surfaces of thighs granular. The outer two fingers
and the forth toe, with the exception of the two most distal pha-
langes, webbed. Dorsally purple grey, shanks likewise colored,
whereas the thighs seem to be uncolored. A black band from nose
through eye to belly, there band dissolving into black spots on
white background; upper lip, flanks below this band, anal region,
upper surfaces of forearms, outer and inner edge of shanks and
external side of foot to toe tips (in ethanol) white with black
spots, which plus/minus fuse. Total length 28 mm; head: 8 mm;
head width: 8.5 mm; forearm: 19 mm; hand with 3" finger: 7
mm; hind leg: 44 mm; foot with fifth toe: 20 mm. From Yoru-
ba (Lagos). [comment added: referring to ZMB 7729, holotype]”
Plate 3 (figures 4 and 4a) in Peters (1875) figures the typical wet-
season color pattern of this species.
Hyperolius spatzi (Fig. 1): “stocky body shape; vomerine teeth
absent; choanae very small, hidden below edge of mandible;
tongue unusually small, notched posteriorly; large head, app. 1/3
of body length, wider than long; snout rounded, truncated in lat-
eral view, not or only slightly surpassing mouth, as long as eye,
much shorter than distance between anterior corner of eyes,
slightly longer than high; canthus rostralis rounded but distinct;
loreal region vertical, only slightly concave; narines in mid dis-
tance between eye and snout-tip; inter-narial distance slightly
narrower than inter-orbital distance, the latter twice as wide as
upper eyelid; tympanum hidden beneath skin.
Robust fingers, 1/3 to 1/2 webbed; well developed discs; 15* fin-
ger shorter than second, second shorter than fourth, which is
slightly surpassed by the 3"4 finger; 3" finger as long as snout;
subarticular tubercles moderately large, not prominent. Webbing
on feet complete with the exception of 4" toe where the last pha-
lanx is without webbing; discs as large as those on fingers; 5‘
toe slightly longer than 3'4; external metatarsalia tightly fused,
tarsal fold absent; very small inner metatarsal tubercle; outer
metatarsal tubercle lacking; no tarsal tubercle; subarticular tu-
bercle small, moderately distinct. Tibio-tarsal angle surpasses eye
or reaches snout-tip. Femur shorter than tibia, the latter 3.5—4
times longer than wide and twice or slightly less times in body
length, longer than foot; heals in contact when hind legs arranged
to body at right angles.
Dorsal skin thick, almost leathery, rough, beset with many small
smooth or rough warts; ventrum granular; distinct postgular and
postpectoral folds; no temporotemporal fold; males with subgu-
lar vocal sac and a small, indistinct gular flap.
Coloration in alcohol dorsally chalk white or, rarer, fine speck-
led with dark-brown. Venter white. Ventral parts of thighs and
inner parts of shanks flesh-colored (presumably red in life). No
markings at all.
Body length 21 mm. Bakel-Kidira (Upper Senegal region). 26
specimens, Bakel-Kidira, Spatz leg., types [comment added:
ZMB 32602, lectotype; 74853-74876, paralectotypes; formerly
all ZMB 32602]. The species is named to honor the collector,
the well know researcher Spatz, whose collecting activities re-
sulted in a large number of valuable reptiles and amphibians,
stored in the Berlin museum.”
Bonn zoological Bulletin 57 (2): 177-188
APPENDIX 2.
Voucher specimens, including types, of Hyperolius spatzi and
H. nitidulus in the ZMB and SMNS collections.
Hyperolius nitidulus. Benin: ZMB 74896-74898, Pendjari Na-
tional Park, Sudan savanna, October 2003, coll. Olaf Grell; ZMB
74890, Pendjari National Park, Tangieta, savanna, N 10°38.317’,
E 01°15.746’, 1 September 2004, coll. G.A. Nago & M.-O.
Rodel; Burkina Faso: ZMB 74893-74894, Dano, small river in
savanna, N 11°14’16.8”, W 03°01’24.1”, 22 October 2003, coll.
T. Moritz; Ivory Coast: SMNS 8995.1-2, Ananda, 1993, coll.
M.-O. Rédel; SMNS 9680.1-2, Bondoukou, 1996, coll. K. Koua-
dio; ZMB 74888 & SMNS 8967.1-7, Comoé National Park, sa-
vanna, June 1996, coll. M.-O. Rédel; ZMB 74886, Mont Sang-
bé National Park, Mare Soumarou, island forest in the savanna,
pitfall trap, dry season 2001, coll. G. Gbmalin & Y. Cesar;
Guinea: ZMB 74895, Mont Béro Classified Forest, savanna, N
08°08730.9”, W 08°34’09.6”, 1 December 2003, coll. M.A. Ban-
goura & M.-O. Rédel; ZMB 74891-74892 Nimba Mountains,
savanna Séringbara, with big ponds, close to village, N
07°36.181’, W 08°29.769’, 18 May 2006, coll. T.N.-S. Loua &
A. Hillers; ZMB 74889, Pic de Fon/Simandou range, Banko, sa-
vanna, 11 July 2004, coll. M.A. Bangoura & K. Kamara; ZMB
74882, Boké Préfécture/Kolaboui, swampy area in secondary
forest island, N 10°45.075’, W 14°27.040’, 23 & 24 April 2005,
coll. M.A. Bangoura & A. Hillers (originally listed as H. spatzi
in Hillers et al. 2006); Nigeria: ZMB 7729 (holotype), Yoruba
(Lagos), coll. Krause; Sierra Leone: ZMB 74884-74885, Tin-
gi Hills, big pond with a few trees around and swampy area in
savanna, N 08°51.047’, W 10°46.502’, 427 ma.s.l., 5 June 2007,
coll. J. Johnny & A. Hillers; Togo: ZMB 39028, station Sokode,
coll. Schréder.
Hyperolius spatzi. Gambia: ZMB 74877, Abuko Nature Re-
serve, savanna, 2005, coll. L. Barnett & C. Emms; Senegal:
ZMB 32602 (lectotype), 74853-74876 (paralectotypes, former-
ly all ZMB 32602), Bakel-Kidira, coll. Spatz; ZMB 74279, Sa-
bodala, ponds and puddles in degraded farmbush savanna next
to Oromin camp, N 13°09.368’, W 12°06.882’, 12 September
2009, coll. A. Hillers & Y. Mané; ZMB 74280-74285, Sabodala,
in and around big pond in farmbush savanna/grassland, with
some rocks, N 13°07.259’, W 12°07.622’, 7 September 2009,
coll. A. Hillers & Y. Mané.
Received: 26.VII.2010
Accepted: 24. VIII.2010
©OZFMK
Bonn zoological Bulletin Volume 57 Issue 2 pp. 189-196
Bonn, November 2010
Genetic variability in mainland and insular populations
of Podarcis muralis
(Reptilia: Lacertidae)
Massimo Capula! & Claudia Corti?
'Museo Civico di Zoologia, Via U. Aldrovandi, 18, I-00197 Roma, Italy;
E-Mail: [email protected]
2Museo di Storia Naturale dell’ Universita di Firenze, Sezione di Zoologia “La Specola”’, Via Romana,
1-50125 Firenze, Italy, E-Mail: [email protected]
Abstract. Allozyme electrophoresis was used to study the distribution of genetic variation within and among mainland
and insular populations of the lacertid lizard Podarcis muralis from western, southern and eastern Europe. Genetic vari-
ability in the species is low and genetic subdivision is high. The highest values of percent polymorphism and heterozy-
gosity were found in the samples from two Tyrrhenian islands (Elba Island, La Scola Islet). The occurrence of higher
levels of genetic variability in insular populations is probably because these populations inhabit marginal environments
characterized by temporal-ecological instability. In these environments high heterozygosity levels can be preserved af-
ter colonization events, unless founder populations are so small that bottleneck effects occur. The genetic heterogeneity
analysis demonstrates a certain amount of genetic differentiation among local populations of P. muralis, with a relative-
ly high level of genetic subdivision. Allozyme data show that genetic variation in P. muralis is distributed into two ma-
jor population groups: the first includes the closely related samples from Spain and SW France, the second the geneti-
cally recognizable samples from Germany, Italy, and Greece. The average genetic distance between the two groups is
relatively high (Ne1’s D = 0.059), with D ranging from 0.043 to 0.100.
Key words. Podarcis muralis, Lacertidae, allozyme electrophoresis, population heterogeneity, Tyrrhenian islands, Eu-
rope.
INTRODUCTION
There have been numerous surveys of the genetic struc-
ture of insular populations of vertebrates, especially rep-
tiles (e.g. Soulé & Yang 1974; Gorman et al. 1975; Pat-
ton et al. 1975). From these studies it became evident that
many demographic, historical, and geographic factors in-
fluence the pattern of genetic variation in the insular pop-
ulations (e.g. Soulé et al. 1973; Soulé 1976).
The Mediterranean lacertid lizards of the genus Podarcis
seem to be particularly useful for this type of investiga-
tion because they are widespread on several Mediterranean
islands and are normally characterized by high inter- and
intra-population morphological and genetic variability
(e.g. Harris & Arnold 1999; Arnold & Ovenden 2002; Cor-
ti & Lo Cascio 2002; Salvi et al. 2009). Although the evo-
lutionary significance of the pattern of variation observed
in these lacertid lizards has been unstudied for most taxa,
in some cases at least it was pointed out that species which
are characterized by a high degree of phenotypic plastic-
ity in the pattern of the upper parts may have levels of ge-
netic variability higher than those found in the morpho-
Bonn zoological Bulletin 57 (2): 189-196
logically low variable species (see e.g. Selander 1976; Ca-
pula 1994a, 1996, 1997; Losos et al. 1997; Capula & Cec-
carelli 2003; Caputo et al. 2008).
In this paper, based primarily on allozyme data, the dis-
tribution of genetic variation within and among mainland
and insular populations of the lacertid lizard Podarcis mu-
ralis from western, southern and eastern parts of its Eu-
ropean range was estimated. Podarcis muralis was cho-
sen as it is a morphologically and ecologically variable
species occurring in a wide variety of habitats over its dis-
tribution range, which extends from the northern border
of the Iberian Peninsula to north-western Turkey, and
throughout central and southern Europe (Arnold &
Ovenden 2002; Corti & Lo Cascio 2002). In the northern
part of its range this lizard is typically a thermophilous
and lowland species, with a reduced variability in the pat-
tern of the upper parts, while in the southern part it is more
often a mountain species, occurs especially in wet and
shady habitats, and is characterized here by high pheno-
typic variability (see Capula et al. 1993, 2009; Corti et al.
©ZFMK
190 Massimo Capula & Claudia Corti
Table 1. Geographic and collecting data for the Podarcis muralis samples used in this study.
Population Locality
Sample size
Guadarrama (Spain)
Anso (Spain)
Ordesa (Spain)
Deba (Spain)
Albaran (Spain)
Bidache (SW France)
Le Chiroulet (SW France)
St. Gaudens (SW France)
Bonn (Germany)
Cavalese (Italy)
Cesena (Italy)
Resceto (Italy)
Chiusdino (Italy)
Populonia (Italy)
Uccellina Mountains (Italy)
Ostia (Italy)
NS <t R So e Cle ny @ ACS) aa Re a nl ee iB, RY eal clesk le). @}. teel Ses
Viotia (Greece)
Elba Island, Tuscan Archipelago (Italy)
Nan nw kW nn
Scoghietto di Portoferraio Islet, Tuscan Archipelago (Italy)
Gorgona Island, Tuscan Archipelago (Italy)
La Scola Islet, Tuscan Archipelago (Italy)
2
4
Pianosa Island, Tuscan Archipelago (Italy) 7)
2
Palmaiola Island, Tuscan Archipelago (Italy) 3
6
in press). Allozyme variation in some Italian, Spanish and
Austrian populations of P. muralis was studied by Capu-
la (1997), who provided evidence of high level of genet-
ic variability in insular populations. Genetic variation and
differentiation in the Italian populations of the species
were recently investigated also by Caputo et al. (2008) and
Giovannotti et al. (2010), based on the sequencing of a
portion of a mitochondrial gene.
MATERIAL AND METHODS
Sampling. Samples of P. muralis used in this study were
obtained from 17 mainland localities of western, south-
ern and eastern Europe (Spain, SW France, Germany, Italy,
Greece) and six islands of the Tuscan Archipelago in the
Tyrrhenian Sea (Elba, Scoglietto di Portoferraio, Gorgona,
Pianosa, La Scola, Palmaiola). The precise geographic ori-
gin of each sample and the number of individuals analysed
per population are indicated in Table 1.
Bonn zoological Bulletin 57 (2): 189-196
Electrophoresis. The electrophoretic analysis was under-
taken for 134 specimens from all 23 localities. Standard
horizontal starch gel electrophoresis was performed on tail
muscle tissue, parts of which were crushed in 0.1 mL of
distilled water. Gene products for the following 21 pre-
sumptive enzyme loci were analysed: glycerol-3-phos-
phate dehydrogenase (E.C. 1.1.1.8, «Gpd), lactate dehy-
drogenase (E.C. 1.1.1.27, Ldh-1, Ldh-2), malate dehydro-
genase (E.C. 1.1.1.37, Mdh-1, Mdh-2), malic enzyme
(E.C. 1.1.1.40, Me-/, Me-2), isocitrate dehydrogenase
(E.C. 1.1.1.42, Idh-1, Idh-2), 6-phosphogluconate dehy-
drogenase (E.C. 1.1.1.44, 6Pgd), glyceraldehyde-3-phos-
phate dehydrogenase (E.C. 1.2.1.12, Gapd), superoxide
dismutase (E.C. 1.15.1.1, Sod-1), glutamate-oxaloacetate
transaminase (E.C. 2.6.1.1, Got-1, Got-2), creatine kinase
(E.C. 2.7.3.2, Ck), adenosine deaminase (E.C. 3.5.4.4,
Ada), carbonic anhydrase (E.C. 4.2.1.1, Ca), mannose-6-
phosphate isomerase (E.C. 5.3.1.8, Mpi), glucose-6-phos-
phate isomerase (E.C. 5.3.1.9, Gpi), phosphoglucomutase
(E.C. 5.4.2.2, Pgm-1, Pgm-2) (enzymes codes are accord-
©ZFMK
Genetic variation in Podarcis muralis 191
Table 2. Chi-square values resulting from contingency y? ana-
lysis of the polymorphic loci among populations of Podarcis mu-
ralis. d.f. = degree of freedom; NS = nonsignificant.
Locus No. 9 a d.f. P
of alleles
Ldh-1 2 172.417 22 <0.001
Ldh-2 2 33.841 22 <0.05
Me-1 4 462.317 66 <0.001
Me-2 2 32.622 22 NS
6Pgd 4 222.142 66 <0.001
Gapd 2 42.987 22 <0.004
Got-1 D) 63.179 22 <0.001
Pgm-2 2 80.490 22 <0.001
Ca 2 WS .42 22 <0.001
Gp-1 2 24.986 22 NS
Gp-2 2 38.449 22 NS
Gp-3 3 331.439 44 <0.001
Total 1580.010 374 <0.001
ing to Richardson et al., 1986). In addition, three uniden-
tified non-enzymatic proteins were studied: Gp-/, Gp-2,
Gp-3. The buffer systems used, electrophoretic procedures,
staining techniques, and loci and allele designations were
those described by Capula (1990, 1994b).
Analysis. Genotypic and allelic frequencies were deter-
mined by direct counts from allozyme phenotypes, and the
resulting data were analysed by various statistical meth-
ods to describe the genetic structure of the P. muralis pop-
ulations. Genotypic proportions expected on the basis of
Hardy-Weinberg equilibrium were calculated by Levene’s
formula (Levene 1949) for small samples. The statistical
significance of departures from Hardy-Weinberg equilib-
rium was estimated using a test for calculating exact sig-
nificance probabilities, analogous to Fisher’s exact test
(Elston & Forthofer 1977). To determine whether the het-
erogeneity in the genotypic distribution reflects differences
in allele frequencies, the variation in genic proportions
among populations was subjected to a contingency ?
Table 3. Genetic variability parameters in Podarcis muralis populations. A, mean number of alleles per locus; P, mean proporti-
on of polymorphic loci; H,, observed mean heterozygosity; H., expected mean heterozygosity; SE, standard error.
Population A P H, SE H, SE
Guadarrama 1,0 0.0 0.000 0.000 0.000 0.000
Anso 1.0 0.0 0.000 0.000 0.000 0.000
Ordesa 1.0 4.2 0.026 0.026 0.022 0.022
Deba 1.0 4.2 0.010 0.010 0.010 0.010
Albaran 1.0 0.0 0.000 0.000 0.000 0.000
Bidache 1.1 8.3 0.038 0.027 0.038 0.027
Le Chiroulet 1.0 4.2 0.008 0.008 0.008 0.008
St. Gaudens 1.1 4.2 0.031 0.031 0.029 0.029
Bonn 1.0 4.2 0.015 0.015 0.015 0.015
Cavalese 1.0 0.0 0.000 0.000 0.000 0.000
Cesena IF 12.5 0.038 0.023 0.040 0.024
Resceto 1.1 8.3 0.038 0.027 0.042 0.029
Chiusdino 1.2 16.7 0.064 0.032 0.066 0.033
Populonia Itoi 8.3 0.038 0.027 0.036 0.025
Uccellina Mountains 12 12.5 0.038 0.028 0.067 0.039
Ostia ileal 1225 0.031 0.018 0.030 0.017
Elba Island 1.1 12.5 0.077 0.046 0.055 0.031
S.to Portoferraio Islet 1.1 12.5 0.019 0.019 0.077 0.043
Gorgona Island Nell 8.3 0.029 0.021 0.028 0.020
Pianosa Island 1.1 8.3 0.038 0.027 0.042 0.029
La Scola Islet 12 16.7 0.077 0.046 0.097 0.046
Palmaiola Island 1.1 8.3 0.032 0.023 0.024 0.017
Viotia 1.0 0.0 0.000 0.000 0.000 0.000
Bonn zoological Bulletin 57 (2): 189-196
©ZFMK
Massimo Capula & Claudia Corti
192
8c0'0 6S0:0 €r00 re0O0 FrIO0 6s00 I1r00 Of00 sSe00 800 erp00 Sso0 er00 se00 S600 L800 0010 L800 L800 1600 L800 L800 Zh,
— 0c0'0 0000 co00 O0c00 O100 000 cood £000 £000 c000 cIl0O0 cooo0 £700 e800 Sr00 LS0OO0 Srh0O0 9F00 6r00 SrO0 Sr00 A
— 9700 ¢t00 0000 Te00 Lt0O0 P20 sed00 6700 800 IP00 900 LOO 600 £800 L600 7800 £800 L800 7800 7800 ial
— c000 ced00 0000 0000 0000 0000 900°0 0000 0000 0000 Lc0 I800 rr00 9500 £r00 Frr00 LOO f£r00 EF00 L
— Lao 9100 1000 1000 0000 £000 coood0 e100 1000 I100 csoo sro0 LS00 SroO0 sSrO0 s8F00 Sro0 Sro0 S
— croo rt00 LIOO 67200 LIDO LOO LOO 900 6700 1600 7800 9600 7800 £800 L800 7800 7800 qu
~ loo 6000 e100 17200 O100 O100 rI00 cred L900 6800 cLO0 6800 6500 £900 6500 6S50°0 ro)
~ 1000 000°0 s00;0 0000 so000 cood0 cco es00 sro0 LSOO0 SPro0 SrdO0 6r00 SPro0 Srd00 d
~ 0000 0000 1000 7000 8000 9000 1900 €s00 S900 es00 E€s00 LS00 S00 €S0°0 O
~ 1000 0000 £000 000 e100 soo Lr0O0 6s00 9600 LPOO OS00 9600 9F0°0 N
~ 9000 +vIl00 6000 e100 rs00 9F00 8800 9700 9600 6r0'0 9600 94600 W
“1000 000° Lcd0 9F00 rr00 OS00 er00 PrrOO0 er00 er00 £00 al
— 1100 6€00 ¢€900 9500 8900 sso0 9500 6800 sso0 ss0'0 a
-— 9c00 OS00 £700 S00 er00 £700 9F00 er00 £Er00 f
~ 6400 [200 ¢€800 0400 [2400 +200 0200 0200 I
~ L00°0 000°0 = 900°0 L000 000°0 9000 900°0 H
~ 6000 000° 0000 €00:0 0000 0000 D
— 0100 3000 0000 O100 O100 d
— 000°0 £000 0000 000°0 a
— €00°0 000°0 000°0 d
— €00°0 €00°0 8)
— 000°0 d
= Vv
A N L S u re) d O N W all a f I H 3) J d d 2) d Vv
NOILVTOd0d
“| [qe as (Z—V) suonendod jo ulsi10 yeorydes3008 JO ‘syp.inu slasppog Jo suonendod Suoure
20ue}SIp
oouesd paseiqun (8/6]) S,19N JO sonyeA “Pp a[quy
©ZFMK
Bonn zoological Bulletin 57 (2): 189-196
Genetic variation in Podarcis muralis 193
analysis (Workman & Niswander 1970). The genetic vari-
ability of populations was estimated using the following
parameters: mean number of alleles per locus (4); percent-
age of polymorphic loci, at the 99% level (P); observed
mean heterozygosity (H,); expected mean heterozygosi-
ty in Hardy-Weinberg equilibrium (/7,) (unbiased estimate;
Nei 1978). The genetic relationships among the studied
populations were evaluated using Nei’s unbiased genetic
distance (D, Nei 1978). All genetic variability and genet-
ic distance measures were calculated using the computer
program BIOSYS-2 (Swofford & Selander 1999). An es-
timation of phenetic relationships among populations was
obtained by generating a phenogram of all samples by
means of the unweighted pair-group method with arith-
metic averaging (UPGMA) based on the matrix of Nei’s
unbiased genetic distances (Sneath & Sokal 1973).
RESULTS
Of the 24 electrophoretic loci analysed, ten (46%) were
monomorphic and fixed for the same allele in all samples
(Mdh-1, Mdh-2, Idh-2, Gapd, Sod-l, Got-2, Mpi, Gpi,
Pgm-1!, Ada). Fourteen loci (54%) were found to be poly-
morphic («Gpd, Ldh-l, Ldh-2, Me-l, Me-2, Idh-l, 6Pegd,
Got-l, Ck, Pgm-2, Ca, Gp-1, Gp-2, Gp-3). The Me-I and
Pgm-2 loci only were highly polymorphic, while the oth-
er 12 loci were weakly polymorphic. Four samples out of
the 23 analysed were characterized by a unique allele (sen-
su Slatkin 1987): St. Gaudens (6Pgd!!°), Ostia (Gp-1!),
Gorgona Island (Me-2!), Elba Island (Got-1/9#). The re-
sults of the contingency y2 analysis are given in Table 2.
The analysis reveals that 9 out of 12 variable loci exhib-
it statistically significant heterogeneity in the allele fre-
quencies. This result shows that there are significant dif-
ferences among the gene pools of the studied samples, in-
dicating local genetic differentiation and a relatively high
degree of substructuring among populations. Significant
deviations from Hardy-Weinberg equilibrium in the direc-
tion of heterozygote deficiences were found in the follow-
ing populations and loci: Bonn (Me-/, P<0.005), Chius-
dino (Gp-3, P<0.05).
Genetic variability parameters (4, P. H,, H.) are reported
in Table 3. The overall number of alleles per locus (A) was
1.07, ranging from 1.0 to 1.2. The proportion of polymor-
phic loci (P) ranged from 0 (Guadarrama, Anso, Albaran,
Cavalese, Viotia) to 16.7% (Chiusdino, La Scola Islet), av-
eraging 7.25%. The observed heterozygosity (H,,) showed
a similar trend, ranging from 0 (Guadarrama, Anso, Al-
baran, Cavalese, Viotia) to 0.077 (Elba Islands, La Scola
Islet), and averaging 0.028. The samples from Spain, Ger-
many and Greece are characterized by very low levels of
genetic variability (Spain: average P = 1.68%, average H,
= 0.007; Germany: P = 3.8%, H, = 0.015; Greece: P =
Bonn zoological Bulletin 57 (2): 189-196
O
Oo. QS O. 03 0.02 0.0 \
0.06
Nei’s D
1OMOMVA>SY
J
<ac
NCHAOXAOZWNZTU!
Fig. 1. |Phenogram generated by UPGMA cluster analysis ba-
sed on Nei’s (1978) unbiased genetic distances among Podar-
cis muralis populations. For geographic origin of populations
(A—Z) see Table 1.
0%, H, = 0) when compared with the ones from France
(average P = 5.57%, average H, = 0.023) and mainland
Italy (average P=10.11%, average H, = 0.036). Howev-
er, it must be noted that Germany and Greece were rep-
resented in the analysis only by a sample respectively. Per-
cent polymorphism and observed heterozygosity detect-
ed in island populations from the Tuscan Archipelago
(Tyrrhenian Sea) were higher than those found in main-
land samples (islands: average P = 9.52%; average H,=
0.045; mainland: average P = 5.89%; average H,= 0.022);
however the differences in polymorphism and heterozy-
gosity values between mainland and insular samples were
not statistically significant (P, P = 0.141; H,, P = 0.029,
t-test). The samples from La Scola and Elba islands show
the highest heterozygosity (H,, = 0.077), and the sample
from La Scola Islet exhibits the greatest genetic variation,
with A = 1.2, P= 16.7%, and H, = 0.077.
The values of genetic distance for each pairwise compar-
ison are given in Table 4. Nei’s genetic distance (D) ranges
from 0 to 0.100, averaging 0.036. Based on the analysis
of genetic distance data, two main population groups can
be recognized: the first includes the samples from Spain
and SW France, which are genetically very close (aver-
age D = 0.003; D ranging from 0 to 0.010), the second
includes all other samples (Germany, Italy, Greece) (av-
erage D= 0.017; D ranging from 0 to 0.059; see Table 4).
The ave-rage genetic distance between the two groups is
relatively high (D = 0.059; D ranging from 0.043 to
0.100). The comparison between the populations from
western Europe (Spain, SW France) and Greece (Viotia)
gives the highest genetic distances (D ranging from 0.087
©OZFMK
194 Massimo Capula & Claudia Corti
to 0.100; see Table 4). Genetic differentiation was rather
low among insular populations from the Tuscan Archipel-
ago (average D = 0.017; D ranging from 0 to 0.042), and
relatively low between insular and mainland populations
(average D = 0.040).
The genetic relationships among the samples studied are
presented in Figure 1. The UPGMA clustering procedure
revealed two main clusters in the phenogram constructed
on the basis of the matrix of Nei’s unbiased genetic dis-
tances. The first cluster includes the closely related sam-
ples from Spain and SW France. Within the second clus-
ter the existence of four subclusters should be noted. The
first subcluster includes the sample from Bonn (Germany),
which is linked to the subcluster containing the closely
grouped samples from Italy and four Tyrrhenian islands
(Elba, Palmaiola, Pianosa, Gorgona), the third includes the
samples from other two Tyrrhenian islands, i.e. Scogliet-
to di Portoferraio and La Scola, the fourth contains the
sample from Viotia (Greece).
DISCUSSION
The results of the allozyme analyses indicate that genet-
ic variability is relatively low in P. muralis. The Common
wall lizard shows values of polymorphism and heterozy-
gosity higher than those estimated by Capula (2004) for
P. raffonei (P = 4.8%; H,= 0.011), similar to those ob-
served by Capula & Ceccarelli (2003) for Italian popula-
tions of P. sicula (P = 10%; H, = 0.029), and lower than
(1) those detected in the phylogenetically related P. wa-
gleriana from Sicily (P= 15%; H,= 0.037; Capula, 1994b)
and P. tiliguerta from Sardinia and Corsica (P= 22%; Hj=
0.066; Capula, 1996), (11) the average ones calculated by
Capula (1990) for nine species of the genus Podarcis (P
= 13%; H,= 0.053), and (111) the average ones calculated
by Nevo (1978) for 17 species of reptiles (P = 22%; H,
= ().047). The highest values of heterozygosity were found
in the samples from Elba Island and La Scola Islet (Tus-
can Archipleago, Tyrrhenian Sea), whereas the lowest ones
were observed in some samples from Spain (Guadarrama,
Anso, Albaran), Italy (Cavalese) and Greece (Viotia).
Based on the theory (see e.g. Nei et al. 1975, Gorman et
al. 1975, 1978) we expected to find low levels of genet-
ic variability in the insular samples of P. muralis. Our re-
sults were in some way not congruent with these expec-
tations, as some samples from the Tuscan Archipelago
(e.g. Elba, La Scola) were characterized by levels of per-
cent polymorphism and heterozygosity higher than those
found in most of the populations from mainland Italy,
Spain, SW France, Germany and Greece. This result in
agreement with the allozyme data provided by Capula
(1997) indicating that the insular P. muralis populations
from Elba Island, Isolotto di Porto Ercole Islet and Argen-
Bonn zoological Bulletin 57 (2): 189-196
tarola Islet (Tyrrhenian islands) are characterized by lev-
els of percent polymorphism and heterozygosity higher
than those found in the populations from the Italian Penin-
sula, and much higher than those observed in the conti-
nental populations from the Italian Alps, Spain and Aus-
tria (Capula 1997). Within the lacertid lizards, levels of
genetic variation are known to be large only in mainland
populations of a few species (e.g. Adriatic populations of
P. sicula: average H,= 0.09 (Gorman et al. 1975); Acan-
thodactylus spp.: average H,= 0.18, average P = 50%;
Blanc & Cariou 1980), while populations living on relict
islands and on tiny fringing islands (1.e. very small islands
that are separated by a short linear distance from the moth-
er island or continent) are usually characterized by very
low values of per cent polymorphism and heterozygosi-
ty (Gorman et al. 1975). However, the investigated
Tyrrhenian islands can be considered as relict islands, as
their lizard populations are genetically differentiated from
the mainland ones. Moreover, one of the islands consid-
ered here (Elba) is a large island (223 km2), while the oth-
er (La Scola) is a tiny island (0.016 km2), and both are
separated by a relatively short geographic distance from
mainland (peninsular Italy).
Among reptiles, high levels of genetic variation found in
populations of some species (e.g. Podarcis sicula, Cne-
midophorus tigris) are ascribed to high vagility and con-
sequent low levels of inbreeding (Gorman et al. 1977).
This does not seem to be true in the genetically highly vari-
able species of Acanthodactylus, as these are territorial
lizards (Blanc & Cariou 1980). Podarcis muralis is a ter-
ritorial lizard as well (Steward 1965), but in this case on-
ly some populations — almost exclusively island popula-
tions (Elba and La Scola: this paper; Elba, Isolotto di Por-
to Ercole, Argentarola: Capula 1997) — exhibit high ge-
netic variability. As suggested by Capula (1997), this is
probably because the insular populations inhabit margin-
al environments characterized by temporal and ecologi-
cal instability. According to Lewontin (1974), in such en-
vironments no particular genotype is favoured for long pe-
riods and natural populations usually show levels of ge-
netic variability higher than those found in more stable en-
vironments. On the basis of these considerations, finding
greater genetic variability in insular populations of P. mu-
ralis could indicate that high heterozygosity levels can be
preserved after colonization events in marginal popula-
tions of vertebrates, unless founder populations are so
small that bottleneck effects occur.
The genetic heterogeneity analysis demonstrates a certain
amount of genetic differentiation among local populations
of P. muralis, with a relatively high level of genetic sub-
division. Allozyme data show that, at the scale of the study,
genetic variation in P. muralis is distributed into two ma-
jor population groups: the first includes the closely relat-
OZFMK
Genetic variation in Podarcis muralis 195
ed samples from Spain and SW France, the second the ge-
netically recognizable samples from Germany, Italy, and
Greece. Genetic distance values found between the two
groups are relatively high (Ne1’s D ranging from 0.043 to
0.100), although falling below those normally encountered
comparing populations of well recognized biological
species of the genus Podarcis (see e.g. Mayer 1981; Thor-
pe 1983; Capula 1994a, b, c, 1996). The high genetic affin-
ity between the French and Spanish samples is congruent
with their geographic origin, as French samples are from
Pyrenean localities (F—H) close to the Spanish ones (A—E).
On the other hand, the large geographic distances sepa-
rating the French localities from the German one (Bonn)
could explain the relatively high genetic differentiation ob-
served between the samples from these countries, which
cluster separately in the UPGMA phenogram (see Fig. 1).
The data presented here are in agreement with the results
of the allozyme investigations carried out by Capula
(1997) on some P. muralis populations from Italy, Spain
and Austria, and are congruent with the results of the mo-
lecular investigations (analysis of mitochondrial DNA se-
quences) carried out by Caputo et al. (2008) and Giovan-
notti et al. (2010) on several Italian samples, which indi-
cate a certain amount of molecular divergence among P.
muralis populations, and a pronounced geographical struc-
ture of the Italian populations.
Acknowledgements. The authors wish to thank Giuseppe
Nascetti for providing facilities, financial support and assistance
during the laboratory analyses, and Wolfgang Bohme and
Valentin Pérez Mellado for their precious help and suggestions.
REFERENCES
Arnold EN, Owenden DW (2002) A field guide to the Reptiles
and Amphibians of Britain and Europe. Harper Collins Pub-
lishers Ltd., London, 288 pp.
Blanc F, Cariou ML (1980) High genetic variability of lizards
of the sand-dwelling lacertid genus Acanthodactylus. Gene-
tica 54: 141-147
Capula M (1990) Ricerche sulla struttura genetica di Podarcis
sicula, P. wagleriana e P. filfolensis (Reptilia: Lacertidae):
aspetti tassonomici ed evolutivi. Ph.D. Thesis, Universita de-
gli studi di Bologna, Bologna
Capula M (1994a) Population genetics of a colonizing lizard: loss
of variability in introduced populations of Podarcis sicula. Ex-
perientia 50: 691-696
Capula M (1994b) Genetic variation and differentiation in the
lizard, Podarcis wagleriana (Reptilia: Lacertidae). Biol. J. Lin-
nean Soc. 52: 177-196
Capula M (1994c) Evolutionary relationships of Podarcis lizards
from Sicily and the Maltese Islands. J. Zool. Syst. Evol. Res.
32: 180-192
Capula M (1996) Evolutionary genetics of the insular lacertid
lizard Podarcis tiliguerta: genetic structure and population het-
erogeneity in a geographically fragmented species. Heredity
77: 518-529
Bonn zoological Bulletin 57 (2): 189-196
Capula M (1997) High genetic variability in insular populations
of the lacertid lizard, Podarcis muralis. Biochemical System-
atics and Ecology 25: 411-417
Capula M (2004) Low genetic variation in a critically endangered
Mediterranean lizard: conservation concerns for Podarcis raf-
fonei (Reptilia, Lacertidae). Italian Journal of Zoology 71 Sup-
pl. 1: 161-166
Capula M, Ceccarelli A (2003) Distribution of genetic variation
and taxonomy of insular and mainland populations of the Ital-
ian wall lizard, Podarcis sicula. Amphibia-Reptilia 24:
483-495
Capula M, Rugiero L, Luiselli L (2009) Ecological correlates
of colour pattern polymorphism along the transition zone be-
tween two morphs of the common wall lizard, Podarcis mu-
ralis. Italian Journal of Zoology 76: 376-380
Caputo V, Giovannotti M, Olmo E (2008) Refugia-within-refu-
gia: the case of Podarcis muralis (Laurenti, 1768) in the Ita-
lian Peninsula. Pp.113—117 in: Corti C (Ed.) Herpetologia Sar-
dinie. Societas Herpetologica Italica/Edizioni Belvedere, La-
tina, “le scienze” 8, 504 pp.
Corti C, Capula M, Luiselli L, Razzetti E, Sindaco R (eds.) (in
press) Fauna d'Italia. Reptilia, Vol XLV, Edizioni Calderini
de Il Sole 24 ORE Editoria Specializzata S.r.1., Bologna
Corti C, Lo Cascio P (2002) The lizards of Italy and adjacent
areas. Edition Chimaira, Frankfurt am Main, 165 pp.
Elston RC, Forthofer R (1977) Testing for Hardy-Weinberg equi-
librium in small samples. Biometrics 33: 536-542
Giovannotti M, Nisi-Cerioni P, Caputo V (2010) Mitochondr-
ial DNA sequence analysis reveals multiple Pleistocene gla-
cial refugia for Podarcis muralis (Laurenti, 1768) in the Ital-
ian Peninsula. Italian Journal of Zoology 77: 277-288
Gorman G C, Kim Y J, Taylor C E (1977) Genetic variation in
irradiated and control populations of Cnemidophorus tigris
(Sauria, Tetidae) from Mercury, Nevada, with a discussion of
genetic variability in lizards. Theor. Appl. Genet. 49: 9-14
Gorman G C, Kim Y J, Yang S Y (1978) The genetics of colo-
nization: loss of variability among introduced populations of
Anolis lizards (Reptilia, Lacertilia, Iguanidae). J. Herpet. 12:
47-51
Gorman G C, Soule M, Yang S Y Nevo E (1975) Evolutionary
genetics of insular Adriatic lizards. Evolution 29: 52—71
Harris D J, Arnold E N, (1999) Relationships of Wall Lizards,
Podarcis (Reptilia: Lacertidae) based on mithocondrial DNA
sequences. Copeia 1999 (3): 749-754
Levene H (1949) On a matching problem arising in genetics.
Ann. Math. Stat. 20: 91-94
Lewontin R C (1974) The Genetic Basis of Evolutionary Change.
Columbia University Press, New York
Losos JB, Warheit KI, Schoener TW (1997) Adaptive differen-
tiation following experimental island colonization in Anolis
lizards. Nature 387: 70—73
Mayer W (1981) Elektrophoretische Untersuchungen an eu-
ropaischen Arten der Gattungen Lacerta und Podarcis, 111.
Podarcis tiliguerta-Art oder Unterart? Zool. Anz. 207:
151-157
Nei M (1978) Estimation of average heterozygosity and genet-
ic distance from a small number of individuals. Genetics 89:
583-590
Nei M, Maruyama T, Chakraborty R (1975) The bottleneck ef-
fect and genetic variability in populations. Evolution 29: 1—10
Nevo E (1978) Genetic variation in natural populations: patterns
and theory. Theor. Pop. Biol. 13: 121-177
Patton JL, Yang SY, Myers P (1975) Genetic and morphologi-
cal divergence among introduced rat populations (Rattus rat-
©OZFMK
196 Massimo Capula & Claudia Corti
tus) of the Galapagos Archipelago. Ecuador Syst. Zool. 24:
296-310
Richardson BJ, Baverstock PR, Adams M (1986) Allozyme elec-
trophoresis. A handbook for animal systematics and popula-
tion studies. Academic Press, London
Salvi D, Capula M, Bombi P, Bologna MA (2009) Genetic vari-
ation and its evolutionary implications in a Mediterranean is-
land endemic lizard. Biological Journal of Linnean Society 98:
661-676
Selander RK (1976) Genic variation in natural populations. Pp.
21-45 in: Ayala FJ (Ed.) Molecular Evolution. Sinauer Asso-
ciates Inc., Sunderland Massachussets
Slatkin M (1987) Gene flow and the geographic structure of nat-
ural populations. Science 236: 787-792
Sneath PHA, Sokal RR (1973) Numerical Taxonomy. W.H. Free-
man & Co., San Francisco
Soulé M (1976) Allozyme variation: its determinants in space
and time. Pp. 60—77 in: Ayala FJ (Ed.) Molecular evolution.
Sinauer Associates Inc., Sunderland Massachussets
Soulé M, Yang SY (1974) Genetic variation in side-blotched
lizards on islands in the Gulf of California. Evolution 27:
593-600
Bonn zoological Bulletin 57 (2): 189-196
Soulé M, Yang SY, Weiler MG, Gorman GC (1974) Island
lizards: the genetic-phenetic variation correlation. Nature 242:
190-192
Steward JW (1965). Territorial behavior in the wall lizard Lac-
erta muralis. Brit. J. Herpetol. 3: 224-229
Swofford DL, Selander RB (1999) BIOSYS-2: A computer pro-
gram for the analysis of allelic variation in population genet-
ics and biochemical systematics. (release 2). University of Ili-
nois, Urbana, Champaign, Illinois
Thorpe JP (1983) Enzyme variation, genetic distance and evo-
lutionary divergence in relation to levels of taxonomic sepa-
ration. . Pp. 131—152 In: Oxford GS, Rollinson D (eds.) Pro-
tein polymorphism: Adaptive and taxonomic significance. Sys-
tematics Association Special Volume 24, Academic Press,
London
Workman PL, Niswander JD (1970) Population studies on south-
western Indian tribes. II. Local genetic differentiation in the
Papago. Am. J. Hum. Genet. 22: 24-49
Received: 05.X.2010
Accepted: 20.10.2010
©ZFMK
Bonn zoological Bulletin Volume 57 | 2 pp. 197-210
Bonn, November 2010
Intraspecific variability of the Carpetane Lizard
([berolacerta cyreni [Muller & Hellmich, 1937|) (Squamata: Lacertidae),
with special reference to the unstudied peripheral populations
from the Sierras de Avila (Paramera, Serrota and Villafranca)
Oscar J. Arribas
Avda. Fco. Cambo 23; E-08003 Barcelona, Spain; E-Mail: [email protected]
Abstract. Canonical Discriminant (CDA), ANOVA and ANOSIM analyses were calculated for all recently known dis-
tribution areas of /berolacerta cyreni including several small and unstudied peripheral populations. The only differenti-
ated sample is Guadarrama (the nominate subspecies), with very limited overlap in the CDA (correct classification > 70%)
and different from nearly all the other samples in ANOSIM. Guadarrama is a recently differentiated but well diagnos-
able (morpho)subspecies (with lower values of dorsalia, ventralia and greater values of circumanalia). Despite the mtD-
NA differences of the Béjar specimens, their morphology is largely equivalent to that of 1. cyreni castiliana (Gredos),
but clearly differ in their female body elongation (near 1 cm) with shorter limbs, a possible strategy to increase clutch
size. Populations from the Sierras de Avila (Villafranca, Serrota and Paramera) are very similar among them. Villafran-
ca (in males) together with Beéjar (in females) are the most connected samples in MST, and the root of the species dif-
ferentiation from a morphological point of view, once discarded geographical and climatic influence on morphology. All
populations except Guadarrama shall be considered as J. c. castiliana by their morphological identity with Gredos. These
morphological similarities probably are the reflect of extensive gene flow among them, responsible of maintaining their
morphology largely equivalent.
Key words. Lacertidae, /berolacerta cyreni, Intraspecific variability, subspecies, Geographical variation, Iberian Penin-
sula.
Resumen. Se ha calculado un Analisis Discriminante Canonico, ANOVA y ANOSIM con toda el area de distribucion de
Iberolacerta cyreni, incluyendo varias poblaciones periféricas no estudiadas hasta la fecha. La unica muestra diferencia-
da es Guadarrama (la subespecie nominal), con muy poco solapamiento en el CDA (clasificacion correcta > 70%) que
difiere de practicamente todas las demas muestras en el ANOSIM. Guadarrama es una poblacion recientemente diferen-
ciada, pero bien diagnosticable como (morfo)subespecie (valores bajos de dorsalia y ventralia, y altos de circumanalia).
A pesar de las diferencias mitocondriales de Béjar, su morfologia es ampliamente asimilable a J. c. castiliana (Gredos),
siendo destacable el relativo elongamiento corporal de las hembras (casi | cm) con miembros proporcionalmente cortos,
una posible estrategia para incrementar el tamafio de puesta. Las poblaciones de las Sierras de Avila (Villafranca, Serro-
ta y Paramera) son muy similares entre si. Villafranca junto con Béjar (en machos y hembras respectivamente) estan mor-
fologicamente en la raiz de la diferenciacion de la especie (MST), una vez descartada cualquier influencia climatica o de
distancia geografica. Excepto Guadarrama, todas deben considerarse como J. c. castiliana por su identidad morfologica
con Gredos, lo que refleja la probable presencia de un flujo genético extensivo y reciente entre ellas.
INTRODUCTION
The Spanish Sistema Central consists of a series of Sier-
ras, more or less aligned in a ENE-WSW direction, which
separate the Duero (to the North) and Tajo (to the South)
river drainages, or what is the same, the Old and New
Castile plateauxes. It runs from the Portuguese Serra da
Estrela (inhabited by a relict population of /berolacerta
monticola |Boulenger, 1905]), across the Spanish Sierra
de Gata (apparently too low and dry for /berolacerta), the
Sierra de Francia with /berolacerta martinezricai (Arribas,
1996) and the main part of the Spanish portion of its range
Bonn zoological Bulletin 57 (2): 197-210
(over 240 km in length), which is inhabited in several
points by populations of the Carpetane Lizard (/berolac-
erta cyreni [Miller & Hellmich, 1937]).
The Carpetane Lizard is widespread through the main
parts of the Sistema Central and is mainly known from
Sierras de Béjar, Gredos and Guadarrama (Fig. 1). It was
raised to species level (Arribas 1996) based on allozymes
(Mayer & Arribas 1996), karyology (heterochromatiniza-
tion of sex-chromosome and localization of the NORs;
OZFMK
198 Oscar J. Arribas
Odierna et al. 1996) and adult and hatchlings pattern and
coloration. Two subspecies were defined, the nominal /.
c. cyreni from Guadarrama (type locality: Puerto de
Navacerrada), and /. cyreni castiliana from Gredos (type
locality: Circo de Gredos, Avila) to which frequently are
assimilated Béjar specimens. This latter subspecies differs
from the nominate one by a reduced dark pattern, more
dorsalia, ventralia, slightly larger diameter of the masse-
teric and hindlimb length, and lower circumanalia (Arribas
1996).
The degree of genetic differentiation between /. c. cyreni
(Guadarrama) and /. c. castiliana (Gredos) was analyzed
by Mayer & Arribas (2003), who found a mtDNA se-
quence divergence of 0.6 % in the 12s rRNA (12s) and
16s rRNA (16s) mitochondrial genes, which corresponds
to approximately 0.6 MY BP. Carranza et al. (2004) sug-
gested that both subspecies diverged approximately
0.8+0.2 MY BP, an estimation mainly based on the Cy-
tochrome b (Cyt b) mitochondrial coding gene (the 12s
and the nuclear gene C-mos were uninformative at this lev-
el), a divergence time almost identical to the one calcu-
lated by Crochet et al. (2004) using also the Cytb gene [1.6
% genetic divergence, which roughly corresponds to 0.6
to 1, with a mean of 0.8 MY BP). These two values were
very similar to the above-mentioned ciphers. The inferred
divergence time increased up to 1.2 (Cyt b) or 1.6 MY BP
(Cyt b+12s) when different terminal taxa evolutionary
models and phylogenetic methods were used (Arribas et
al. 2006; Arnold et al. 2007; respectively).
On the other hand, specimens from Sierra de Béjar
branched at the base of the 7. cyreni clade in some mtD-
NA analyses (Carranza et al. 2004; Arribas & Carranza
2004). It was suggested that the split of this populations
occurred approximately 1.7+0.3 MY BP (Carranza et al.
2004). However, in analyses using the same mtDNA re-
gions but different taxa and other evolutionary models and
phylogenetic methods than above (Arribas et al. 2006;
Arnold et al. 2007), the specimens from Béjar formed a
trichotomy with /. c. castiliana from Sierra de Gredos and
I. c. cyreni from Navacerrada.
Apart from the uninformative C-mos nuclear gene frag-
ment analyzed by Carranza et al. (2004) there is only one
other information about differences at the nuclear level,
the analysis of allozyme data by Almeida et al. (2002),
which showed a Nei’s distance of 0.002 between speci-
mens from Gredos and Guadarrama.
From West to East, the distribution of J. cyreni can be di-
vided into two axes connected by low mountain valleys
(see appendix II), but not clearly interrupted by clear cut
barriers as river valleys. One axis runs across Sierra de
Béjar (summit in La Ceya, 2.425 m) and Gredos (Alman-
Bonn zoological Bulletin 57 (2): 197-210
zor, 2.592 m), whereas the other axis is constituted by the
Sierras de Villafranca (Moros, 2.065 m), La Serrota (Ser-
rota, 2294 m), La Paramera (Zapatero, 2.160 m) and
slightly separated by lower areas, Guadarrama (Penalara,
2.430 m). The two axes greatly overlap longitudinally
leaving the Villafranca, Serrota and Parameras just to the
North of the Sierra de Gredos, but at their orographic shad-
ow for rains, and climatically more continentalised. This
explains the botanical similarities between the Paramera-
Serrota-Villafranca axis and the Sierra de Guadarrama
(Lucefio and Vargas 1991).
In Guadarrama (where Podarcis muralis also exists), I.
cyreni occurs only at the highest areas, from 1.760 m
(Puerto de Cotos, Puerto de Navacerrada) up to the peaks
(2.340 m in Penalara). In Gredos it lives almost from 1.700
to 2.500 m. It was seen in 17. VII. 1986 (own data) in
Puerto del Pico (at 1.352 m close to one of the fountains
of the pass) but recent research in this area has been to-
tally unfruitful. It is possible that these lower stations
favoured by accelerated cold winds in the mountain pass-
es (Venturi effect) had disappeared by climatic or best, by
habitat degradation due to human over-frequentation dur-
ing the last 20 years. In Béjar it has been found between
1.837 m (own data) and 2.443 m (see Lizana et al. 1988,
1992, 1993; and Martin 2005 for general data; own data
corrections for the confirmed lower limits).
Apart from the better known Sierras, the presence of the
Carpetane Lizard in the small parallel mountain ranges
called “Sierras de Avila” or ““Parameras” (composed by
three Sierras: Villafranca, La Serrota, and La Paramera)
was first discovered by the mountaineering group “Valle
de Ambles” (Lizana et al. 1993), but no specimens have
been studied so far. All aspects of morphology, status and
relationships of these small and isolated populations from
the Sierras de Avila are totally unknown. In these Sierras
the species is extremely localized, especially in La Ser-
rota and Paramera. In Sierra de Villafranca, the area with
a relatively more extended suitable area, I have found it
from 1.850 m probably up to the highest areas (Pico Mo-
ros, 2.065 m). In La Serrota it is extremely rare and lo-
calized, also cornered in the highest parts, from 2.284 m
(perhaps 1.935 m where excrements, possibly of this
species, were seen; pers. obs.) to the very summit (Pico
Serrota, 2.294 m):; and in La Paramera from 1.700 m in
the northern slopes to the summit (Pico Zapatero, 2.160
m) (own data).
After a three-year prospection of these parallel ranges, I
gathered data from these localized and barely known pop-
ulations in order to check the relationships of all the Car-
petane Lizards throughout its range. My aim is: a) to re-
assess differences between J. c. cyreni and I. c. castiliana
in the light of the existence of other small and isolated pop-
©OZFMK
Intraspecific variability in Jberolacerta cyreni 199
ulations; b) to ascertain the taxonomic status of the Bejar
populations and to check if these represent a further sub-
species; c) to study both the relationships among the sam-
ples from the Sierras de Avila (=Parameras) massifs, as
well as their similitude and differences with their neigh-
bouring and well known populations from Gredos, or the
more distant populations from Guadarrama and Bejar; and
d) as the type series of /. cyreni was destroyed during the
Second World War (SWW), to choose a Neotype for the
species (see appendix I) in order to fix unequivocally the
type locality (although apparently all lost, there were al-
sO specimens from Gredos in the original type series).
MATERIAL & METHODS
Morphology
A total of 106/92 male specimens, and 136/135 female
specimens of /. cyreni with a complete measurements
dataset and snout-vent length greater than 45 mm, were
included in the univariate (ANOVA) and multivariate (dis-
criminant) analyses, respectively. Given that these popu-
lations present sexual dimorphism (Arribas 1996, 1999a;
Arribas et al. 2006), analyses were carried out for males
and females separately. All material is from Oscar Arribas
(OA) database.
OTUs names, localities and specimens included in the
morphological multivariate analysis were as follows (Fig.
Ie
GUADARRAMA: Sierra de Guadarrama (Madrid and
Segovia provinces, Spain). 25 males and 36 females [/.
cyreni cyreni]. MIJARES: Puerto de Miyares (Sierra del
Fig. 1.
Schematic representation of the distribution of /bero-
lacerta cyreni in the Spanish Sistema Central. The different lo-
calities (OTUs) cited in the text are represented. 1: Béjar; 2: Gre-
dos; 3: Villafranca; 4: Serrota; 5: Paramera; 6: Mijares; 7: Gua-
darrama.
Bonn zoological Bulletin 57 (2): 197-210
Cabezo, Gredos Oriental Massif, Avila province, Spain).
6 males and 7 females. GREDOS: Circo de Gredos (Gre-
dos Central Massif, Avila province, Spain). 23 males and
46 females [/. cyreni castiliana]. BEJAR: Sierra de Bé-
jar (Gredos Occidental Massif, also known as Sierra de
Candelario, Salamanca province, Spain). 11 males and 28
females. VILLAFRANCA: Sierra de Villafranca (Avila
province, Spain). 20 males and 14 females. SERROTA:
La Serrota (Avila province, Spain). 3 males and 2 females.
PARAMERA: Sierra de La Paramera (Avila province,
Spain). 4 males and | female.
These populations are discontinuous among them (Appen-
dix IT) and constitute discrete geographical OTUs (Fig. 1).
Due to lower sample, it was necessary to cluster the Ser-
rota and Paramera specimens in the male discriminant
analysis, and these two plus Villafranca (all of them “Sier-
ras de Avila’”’) in the female one. However, reciprocal dis-
tances between each one of these poorly represented sam-
ples to the best represented ones were carefully checked
and commented in the results section. As the three popu-
lations from Sierras de Avila seemed to be largely equiv-
alent in the multivariate analyses, a posteriori, all of them
were treated as a single OTU (S: AVILA) in ANOVA.
Characters studied
Biometric characters. Snout-vent length (SVL); Forelimb
length (FLL); Hindlimb length (HLL); Pileus length (PL);
Pileus width (PW); Parietal length (PaL); Masseteric scale
diameter (DM); Tympanic scale diameter (DT); Anal
width (AW) and Anal length (AL). All linear measure-
ments were made with a digital calliper to the nearest 0.01
mm. These measurements were transformed to the follow-
ing more informative and not dimensional-depending ra-
tios: FLL/SVL (relative forelimb length; “FLL index’);
HLL/SVL (relative hindlinb length, “HLL index”);
PL/PW (pileus shape, ““Pileus index”); DM/PaL (relative
masseteric plate size, ““Masseteric index”); DT/PaL (rel-
ative tympanic size, “Tympanic index”); AL/AW (anal
plate surface, “Anal form index”) and AS/SVL
(V(AL*AW)*100/SVL, relative anal plate size with re-
spect to the total length, “Anal size index”’) (Arribas 1996,
2001). The results of the linear measurements and index-
es yielded largely similar results. All ratios were given
multiplied by 100 to avoid excessive decimal scores.
Scalation characters. Supraciliar Granula (GrS) for the
right and left sides; Gularia (GUL); Collaria (COLL); Dor-
salia (DORS); Ventralia (VENT); Femoralia rigth (FEMr)
and left (FEMI); 4". digit Lamellae (LAM); and Circum-
analia (CIRCA).
©ZFMK
200 Oscar J. Arribas
Statistical Procedures
Statistical analyses used in the morphological study in-
cluded both Univariate (ANOVA for SVL, scalation char-
acters and indexes, with post-hoc Tukey-Kramer tests at
P< 0.05 and P < 0.01 to detect differences among sam-
ples) as well as Multivariate techniques (Canonical Dis-
criminant Analysis, CDA). In this later analysis, each pop-
ulation is represented by a centroid (a hypothetical mid-
dle individual). Minimum-length spanning tree (MST) was
computed from the Mahalanobis’ distance matrix to de-
tect the nearest neighbours based on their position in the
multidimensional space. MST representation also avoids
distortion of UPGMA trees by the reciprocal pairwise dis-
tances recalculation in every step during their construc-
tion. UPGMA frequently clusters samples reflecting sam-
ple sizes than their true relationships. Distances of small
samples or isolated specimens appear greatly exaggerat-
ed with respect to the well represented ones. As a result
of that, the small-sized samples appear ever as the most
external or differentiated in UPGMA derived trees
(Kunkel et al. 1980; Cherry et al. 1982; Arribas 1997).
Moreover, the UPGMA trees based in very unevenly sized
samples also gave very poor Cophenetic Correlation In-
dexes between the tree-derived ultrametric distances ma-
trix and the original Mahalanobis distance matrix and
therefore we have not used them (Arribas et al. 2006).
To test the significance of the differences among pre-es-
tablished groups for the Discriminant Analysis (based in
a geographical origin), we carried out an Analysis of Sim-
ilarity (ANOSIM) (Clark 1988, 1993) that tests if the as-
signed groups are meaningful, this is, more similar with-
in groups than with samples from different groups. The
method uses the Bray-Curtis measure of similarity to con-
struct clusters of specimens. The null hypothesis 1s there-
fore that there are no differences between the members of
the compared groups (they are randomly blended). R-sta-
tistic scales from +1 to -1. Values closer +1 correspond
to a perfect case in which all groups were completely dif-
ferent (all specimens of the same group are more similar
among them than to any specimens of the other groups).
R = 0 occurs if the high and low similarities are perfect-
ly mixed and bear no relationship to the group, a common
situation if some of the groups are largely equivalent. A
value of -1 indicates that the most similar samples are all
outside of the groups (all groups largely equivalent and
randomly formed). To check for significance, pseudorepli-
cation tests (1000 randomizations) were run to test if the
given results can occur by chance. If the value of R is sig-
nificant, there is evidence that the samples within groups
are more similar than would be expected by random
chance. Even more important, pairwise tests among
Bonn zoological Bulletin 57 (2): 197-210
populations permit to test significance of the differences
among the concerned groups and to detect which ones are
really different from the others.
Mahalanobis’ (squared) distance matrices were compared
by means of Mantel Test (with 1000 permutations) with
matrices composed by Euclidean (squared) distances for
the climatic characteristics of localities: a) Precipitation
(mm) during the incubation months (July and August, as
scalation is invariant during lizard’s life); b) Annual pre-
cipitation (mm), c) Temperature (°C) (July and August);
d) Annual average temperature e) Sun radiation (n 10
kJ/(m2*day*micrometer)(July and August), and f) Annu-
al Sun radiation. Data were extracted from Ninyerola et
al. (2005). Also, these Mahalanobis’ distances were com-
pared with (d) the aerial (straight) geographical distances
among the sampling localities.
Multivariate (Discriminant and ANOSIM) analyses were
performed with Community Analysis Package 4.0 (Hen-
derson & Seaby 2007). MST trees and Mantel tests were
calculated with NTSYS 2.1° (Rohlf 2000). Univariate sta-
tistics were processed with NCSS 2001° package (Hintze
2001).
RESULTS
Males
Canonical Discriminant Analysis. The CDA conducted
with 106 male specimens shows three significant axes that
explain an 85 % of the total intersample variation. The two
first axes together explain the main part (70.6 %) and dis-
criminate fairly well the samples, especially the first one,
the unique with an eigenvalue >1. The first discriminant
axis has an Eigenvalue of 1.54 (51.2 % of variance ex-
plained; Chi-Sq. with 85 df= 200.71, P< 0.0001) and dis-
tributes the samples with fairly overlap among them, ex-
cept Guadarrama, that has only a small coincidence with
the other ones (Fig. 2 A). Guadarrama appears in the neg-
ative part of the axis, characterised by the lower values
for DORS (0.441553) and VENT (0.560765) and greater
values of CIRCA (-0.572683). Second and third axes
(eigenvalues < 1) present a considerable overlap among
the samples and do not discriminate populations.
This discriminant analysis applied to the samples reached
a 72.6% of correct classification among the specimens.
The Guadarrama sample (/. cyreni cyreni) reaches a 71.9
% of correct classification in respect to all the other sam-
ples UZ. c. castiliana).
©ZFMK
Intraspecific variability in Jberolacerta cyreni
201
Discriminant Plot - Ib. cyreni MALES
Function 2
Function 1
Discriminant Plot - Ib. cyreni FEMALES
Function 2
Fig. 2.
Function 1
Canonical Discriminant Analysis (CDA) plots for a) males (above) and b) females (below). Specimens, sample centroids
and group perimeters are represented. Guadarrama (inverted triangles), Gredos (triangles), Béjar (irregular circles), Mijares (cross),
Villafranca (asterisk) and Serrota-Paramera (sail). In females, the three last samples are grouped as Sierras de Avila (sail). Sample
centroids are represented by a square. See text for axis characteristics and results.
Minimum-length spanning tree (not represented) connect-
ing the centroid (hypothetical middle specimens) of each
sample is fairly congruent with their geographical posi-
tion, connecting in general neighbouring samples. The
most “central” (most connected) population is Villafran-
ca that connects with Gredos (at Mahalanobis Distance of
3.1870), Béjar (3.2199), Paramera (4.8042) and finally, to
the most isolated one, Guadarrama (6.8412). Two popu-
lations show overestimated distances due to their small
sample sizes: Mijares (East Gredos) that connects with Bé-
jar (7.0951), and Serrota with their neighbouring Param-
era (9.1822).
Bonn zoological Bulletin 57 (2): 197-210
Analysis of Similarity (ANOSIM) (Table 3) shows that
there is a considerable overlap among samples (R-statis-
tic = 0.122088, P < 0.005; 1000 randomizations) as our
value (that can range from | to -1), although positive, is
very small. Very significant differences among the (geo-
graphically) assigned groups, appear only among Guadar-
rama and Bejar, Gredos and Villafranca (P < 0.01) but do
not reach significance with Mijares and Serrota + Para-
mera (both with small samples). The other populations are
not differentiated among them (P > 0.01).
©ZFMK
NO
S
NO
Fig. 3. [berolacerta cyreni castiliana. a) La Covatilla Sky re-
sort (Sierra de Beéyar), July 2007, Male ; b) El Travieso (S# de
Beéjar), July 2004, Female ; c) El Calvitero (Sierra de Béjar), Ju-
ly 2004, Female (atypical pattern, with diffumination and coa-
lescence in a unique vertebral line); d) Puerto de Miyares (Gre-
dos Oriental Massif), July 2006, Female.
Bonn zoological Bulletin 57 (2): 197-210
Oscar J. Arribas
The Analysis of Variance (ANOVA) (Appendix III, Table
1) indicate that Guadarrama differs from all or nearly all
the other populations in VENT and CIRCA (with the
smaller and greater values for these parameters, respec-
tively, in the former population), but also appeared dif-
ferences between Guadarrama and Beyar in Dors (small-
er in the former), and with Gredos in PV (greater in the
former). An interesting and significant difference appears
in DORS among Gredos and Béjar samples (clearly
greater in the later).
There is no significant correlation among Mahalanobis’
distances and any of the geographic and climatic param-
eters analyzed (all Mantel Tests P > 0.05).
Females
Canonical Discriminant Analysis: The CDA conducted
with 136 female specimens shows three significant axes
that explain a 93.8 % of the total intersample variation.
The two first axes together explain a large part of the vari-
ance (85.7 %), and especially along the first one, that ac-
counts itself for 62.7 % of the total variation and is the
unique with an eigenvalue >1 (1.77), discriminating
Guadarrama specimens from the other neighbour samples
only with a small overlap (Fig. 2B). The other samples
show a considerable overlap among them. Guadarrama
discriminates towards the negative part of the axis, char-
acterised by the lower values of DORS (0.62) and VENT
(0.66) and greater ones of CIRCA (-0.38). Second and
third axes (eigenvalues < 1) present a considerable over-
lap among the samples and do not discriminate popula-
tions.
The discriminant analysis applied to the samples reached
a 74.26% of correct classification among the specimens.
Guadarrama sample (J. c. cyreni) reaches an 87.2 % of cor-
rect classification with respect all the other samples (J. c.
castiliana).
Minimum-length spanning tree (not represented) connect-
ing centroids is very similar to the male one. The most con-
nected sample is Béjar, which clusters with Villafranca (at
2.9), Gredos (3.5) and Mijares (7.38, but here exaggerat-
ed by the scarce sample of the later). Guadarrama connects
with the scarcely represented (and geographically inter-
mediate) Mijares (East Gredos) (at 6.09), and all the Sier-
ras de Avila samples cluster together (Villafranca with Ser-
rota + Paramera at 8.66).
Analysis of Similarity (ANOSIM) (Appendix III, Table
3) shows that there is a considerable overlap among sam-
ples (R-statistic = 0.162588, P < 0.001; 1000 randomiza-
tions), but the results are slightly best than for the male
©OZFMK
Intraspecific variability in /berolacerta cyreni 203
Fig. 4. [berolacerta cyreni castiliana. a) Pico Zapatero (Si-
erra de la Paramera), July 2005, Male; b) Puerto de Pena Negra
(Sierra de Villafranca), July 2006, Male; c) Pico Serrota (La Ser-
rota Massif), July 2005, Female; d) Pico Serrota (La Serrota Mas-
sif), July 2006, Male.
Bonn zoological Bulletin 57 (2): 197-210
analysis. Very significant differences (P < 0.01) appear
among Guadarrama and all the other samples except with
Miares. The other populations are not differentiated
among them (P > 0.01).
The Analysis of Variance (ANOVA) (Appendix II, Table
2), as in the male analysis, it shows that Guadarrama is
the most different one, especially in DORS, VENT and
CIRCA (the first two characters smaller, and the third one
greater in the former population). Guadarrama also dif-
fers from Gredos by its lower GUL, from Béjar by its
greater FLL, HLL, a lower SVL; and from Sierras de Avi-
la by its greater relative anal scale surface.
Also, significant differences appear in SVL between Bé-
jar (clearly the great sized female population) and Gre-
dos, and among this latter (with relative greater FLL and
HLL) with Béjar and Villafranca.
As in male analysis, there is no significant correlation
among Mahalanobis’ distances and the geographic and cli-
matic parameters analyzed (all Mantel Tests P > 0.05).
DISCUSSION
From the Discriminant and ANOVA analyses it appears
that the only differentiated sample is Guadarrama. It ap-
pears with very limited overlap with the other samples in
the CDA graphs (Figs 2 A and B). Diagnostic characters
for this population (nominate subspecies: /. c. cyreni) are
the lower values of DORS (difference more marked in fe-
males), lower values of VENT and greater CIRCA. More-
over, ANOSIM analyses show that Guadarrama is the
unique OTU that is significantly different from nearly all
the other samples, except from the close population of Mi-
jares (in both sexes) and Serrota + Paramera (but these ex-
ceptions occur only in the males and probably due to their
scarce sample size).
Mijares sample (very small) seems in some aspects ap-
proaching to Guadarrama (specially in DORS and VENT
values) but globally are clearly closer to /. c. castiliana
(specially to Béjar in male and female MST).
Populations West from Guadarrama show a great overlap
in CDA and lack differences in ANOSIM, being morpho-
logically fairly equivalent and all of them assimilable to
I. c. castiliana. There are only a few scattered very sig-
nificant differences among them (P < 0.01) in ANOVA,
as for instance among Gredos and Béjar (this latter has
greater DORS and a strikingly greater SVL and propor-
tionally shorter limbs that Gredos, but only in female spec-
imens). The reason of the longer SVL in Béjar females
(from 8 mm to | cm greater than in the other populations)
©ZFMK
204 Oscar J. Arribas
which leaves proportionately shorter limbs, can be a con-
sequence of body elongation that in lacertids appears
linked to a greater clutch size (Brana 1996). This is an in-
teresting question for future study: if Béjar specimens ef-
fectively have greater clutch size that other 1. cyreni pop-
ulations.
Both the MST results (in which Villafranca and Beéjar are
the most connected samples) as well as the presence of
related species further West (/. martinezricai and I. mon-
ticola), suggest an origin of the species towards the west-
ern extreme of their current distribution area. From these
westernmost parts, where it also occurs the higher haplo-
type diversity (see below), /. cyreni spread towards the
East. Despite that the Sierras de Avila (Villafranca, Ser-
rota and Paramera) are slightly more aligned with the
Guadarrama axis than with Gredos one, we cannot be sure
from which of these two mountain ranges the former was
colonized, as MST results in males and females are con-
tradictory. According to the male analysis Guadarrama is
more related to Villafranca, whereas in the female analy-
ses, it is Mijares (Eastern Gredos) the most related one.
The results of the mitochondrial analyses of these sam-
ples (Cyt B and 12s) (unpublished, Carranza, pers. com.)
indicates that the interruption of gene flow 1s fairly recent,
as a common haplotype appears in all populations except
Villafranca and Bejar. All Gredos, Guadarrama and La
Serrota specimens are identical for these two mitochon-
drial fragments. Independent changes in one nucleotide
with respect to the common haplotype appear in Villafran-
ca (the unique change is different in two specimens), Para-
mera, Miares and Béjar specimens, and two changes ac-
cumulate in one Béjar and one Mijares specimen (others
have only one).
The current morphological differences of Guadarrama
specimens seem to be relatively recent, and are possibly
the result of bottleneck effects during the colonization
process, or alternatively of strong selective pressures (or
a combination of both causes). Conversely, the absence
of marked differences among the other populations
(more or less with a similar age) could be due to the main-
tenance of a more continuous gene flow among them, re-
sponsible of maintaining their morphology largely equiv-
alent (nuclear genes remain unstudied). The current larg-
er geographical gap in the distribution of /. cyreni occurs
precisely between Guadarrama and the remaining popu-
lations to the West.
Despite the presumably short isolation time, as comment-
ed above, a considerable selection pressure or a genetic
bottleneck in the expanding populations might have pro-
moted and fixed the morphological differences now seen
in Guadarrama specimens. These factors do not seem to
Bonn zoological Bulletin 57 (2): 197-210
be due to isolation-by-distance processes but by histori-
cal vicariant events (cf. Irwin 2002) as there is no rela-
tionship between morphological differentiation and geo-
graphic distances. Also there is no relationship among the
more obvious climatic parameters (precipitation, temper-
ature and sun radiation) and these differences.
Concerning the position of Béjar populations, only spec-
imens from the west-facing slopes of the massif have been
studied, and therefore it is possible that in other parts of
the massif other haplotypes (the common one with Gre-
dos) could be present. The species was cited from “Puer-
to de Tornavacas, SA” (for Salamanca, sic.!; a mistake as
this locality is in Avila) (Lizana et al. 1992). This is the
natural pass between Béjar and Gredos, but I have been
unable to find it there. This place 1s a sub-Mediterranean
environment with Pyrenean Oak open forest inhabiting
populations of Zimon lepidus, Psammodromus algirus and
even Buthus occitanus, all thermophylous species typical
from dry conditions. The lower height of Puerto de Tor-
navacas (1010m) makes me to suspect that /. cyreni is not
there and the record is possibly a mistake. One possibil-
ity is that it was from the higher neighboring mountains.
An account about the pattern and coloration of [. cyreni
is in Arribas (1996) and it is especially detailed for the
main Sistema Central massifs in Perez-Mellado et al.
(1993). Both colour as well as the dark pattern, seem to
be selected in accordance to the substrate characteristics.
Overall, the background colour is brown in juveniles and
subadult specimens, changing in different percentages to
green in adult specimens (more frequently in males and
becoming more vividly linked to reproductive processes).
In populations inhabiting rocks (plenty of Rhizocarpon gtr.
geographicum lichens) as in Gredos and the upper parts
of Guadarrama (Penalara) green adults are more frequent
(both males and big females). When living in rocky talus
with sands and bare ground (as in Navacerrada area)
brownish adult specimens are more frequent (Arribas
1999b: Figs 9 and 10).
Concerning the reticulate pattern, it also varies in a dif-
ferent degree among the different populations depending
on the substrates inhabited. Juveniles and subadults have
temporal uniform or reticulate bands that coalesce during
growth with dorsal spots (more frequently in males) giv-
ing reticulated-like patterns. Usually, there is a relation-
ship between the size of the granite phanerocrystals (the
granite-rock spotting) and the habitus of the lizards liv-
ing on it. Lizards living on rocks that present large crys-
tals (as for instance the Béjar ones) are more reticulated
than specimens living in places in which the rocks pres-
ent smaller crystals (and thus finely spotted). Coloration
accounts described in Perez Mellado et al. (1993) are fair-
ly precise, especially for Gredos specimens. Concerning
©ZFMK
Intraspecific variability in Jberolacerta cyreni 205
Bejar (=Candelario in Perez Mellado et al. [1993]) the de-
scription should be corrected as, although it is true that
very old specimens are fairly reticulated, especially males,
females more frequently have two paravertebral rows of
distinctive spots (photo 2), as in females of other popu-
lations and in mid-grow specimens of both sexes in all lo-
calities. The statement that “the most common background
colour of the back and flanks is greenish or bluish” prob-
ably is true for fully adult specimens during the breeding
period, but in July and August only some big males con-
serve greenish tones, appearing even fully adult females
more or less brownish.
Concluding: a) /. c. cyreni is a recently differentiated but
well diagnosable (morpho)subspecies, a case paralleling
the relationship of 1. monticola monticola from Serra da
Estrela (Portugal) with repect to 1. m. cantabrica (from
Galicia and Cantabrian Mts.), in this later case, with no
genetic differences, but with singular morphological traits
that distinguishes it from other /. monticola in a multivari-
ate analysis (Arribas & Carranza 2004; Arribas et al.
2006). Highly variable nuclear markers as for instance in-
trons or microsatellites may help to clarify definitively the
status of these well diagnosable (morpho)subspecies.
b) Despite the mtDNA differences of the Béjar specimens
(one or two nucleotides), their morphology is largely
equivalent to /. c. castiliana. Lacking data from other Beé-
jar populations and genetic nuclear markers, I assume that
these morphological similarities reflect the presence of a
very recent gene flow with other neighbouring popula-
tions. The Béjar populations are however outstanding by
their female body elongation (up to near | cm larger), con-
serving proportionately shorter limbs, which can be a strat-
egy to increase clutch size.
c) The Sierras de Avila populations are very similar; the
closer among all the populations compared. One of them,
the Sierra de Villafranca, is together with Béjar, the most
connected sample, and it is, from a morphological point
of view, at the root of the species expansion. Both also
present the unique slightly variant haplotypes. All they
should be considered as /. c. castiliana by their closer iden-
tity with Gredos.
Acknowledgements. Dr. Sergi Pla (Barcelona, Spain), Jesus
Garcia (Huesca, Spain) and Dr. Vicente M. Ortuno (Madrid,
Spain) helped in some prospections. Dr. Salvador Carranza
(Barcelona, Spain) corrected and improved parts of the manu-
script. This study was financed completely by the author and
therefore it did not cost any Euro to the public arks. Prospec-
tions of the small Sierras de Avila and Béjar populations were
carried out under permissions n° 20051630007003 (2005),
20061630024599(2006), 2007167004130 (2007),
20081630020386 (2008), 20092390004760 (2009), issued by the
competent organisms in charge of the wildlife protection (Jun-
ta de Castilla y Leon, Spain)
Bonn zoological Bulletin 57 (2): 197-210
REFERENCES
Almeida AP, Rosa HD, Paulo OS, Crespo EG (2002) Genetic
differenciation of populations of Iberian rock-lizards [bero-
lacerta (Iberolacerta) sensu Arribas (1999). Journal of Zoo-
logical Systematics and Evolutionary Research 40: 57-64
Arnold EN, Arribas O, Carranza S (2007) Systematics of the
Palaearctic and Oriental lizard tribe Lacertini (Squamata: Lac-
ertidae: Lacertinae), with descriptions of eight new genera.
Zootaxa 1430: 1-86
Arribas O (1996) Taxonomic revision of the Iberian ‘Archaeo-
lacertae |: Anew interpretation of the geographical variation
of ‘Lacerta’ monticola Boulenger, 1905 and ‘Lacerta’ cyreni
Miller & Hellmich, 1937 (Squamata: Sauria: Lacertidae).
Herpetozoa 9 (1/2): 31-56
Arribas OJ (1997a) Morfologia, filogenia y biogeografia de las
lagartijas de alta montafia de los Pirineos. Ph. D. Thesis. Uni-
versidad Autonoma de Barcelona. (Bellaterra); 353 pp. (8 pp
and microfiche. Pub. U.A.B.)
Atribas O (1999 a) Taxonomic revision of the Iberian ’Archae-
olacertae’ 2: diagnosis, morphology, and geographic variation
of ’Lacerta’ aurelioi Arribas, 1994 (Squamata: Sauria: Lac-
ertidae). Herpetozoa 11: 155-180
Arribas OJ (1999 b) New data on the Peta de Francia Moun-
tain Lizard ‘Lacerta’ cyreni martinezricai Arribas, 1996. Her-
petozoa, Wien 12 (3/4): 119-128
Arribas OJ & Carranza S (2004) Morphological and genetic ev-
idence of the full species status of Jberolacerta cyreni mar-
tinezricai (Arribas, 1996). Zootaxa, Aucklan 634: 1—24
Atribas O, Carranza S, Odierna G (2006) Description of a new
endemic species of mountain lizard from Northwestern Spain:
Iberolacerta galani sp. nov. (Squamata: Lacertidae). Zootaxa
1240: 1-55
Arribas OJ (2008) Comments about the original description and
type specimens of /berolacerta monticola (Boulenger, 1905).
Herpetozoa 21 (1/2): 94-95
Brana F (1996) Sexual dimorphism in lacertid lizards: male head
increase vs female abdomen increase? Oikos 75: 511-523
Carraza S, Arnold EN, Amat F (2004) DNA phylogeny of Lac-
erta (Iberolacerta) and other lacertine lizards (Reptilia: Lac-
ertidae): did competition cause long-term mountain restric-
tion? Systematics and Biodiversity, London 2: 57-77
Cherry LM, Case MS, Kunkel JD, Wyles JS, Wilson AC (1982)
Body shape metrics and organismal evolution. Evolution 36:
914-933
Clarke KR (1988) Detecting change in benthic community struc-
ture. 131-142 in Oger R (eds.) Proceedings of invited papers,
14th international biometric conference, Namour, Belgium
Clarke KR (1993) Non-parametric multivariate analyses of
changes in community structure. Aust. J. Ecol. 18: 117-143
Crochet PA, Chaline O, Surget-Groba Y, Debain C, Cheylan M
(2004) Speciation in mountains: phylogeography and phyloge-
ny of the rock lizards genus /berolacerta (Reptilia: Lacertidae).
Molecular Phylogenetics and Evolution, Orlando; 30: 860-866
Franzen M, Glaw F (2007) Type catalogue of Reptiles in the Zo-
ologische Staatssamlung Mitinchen. Spixiana 30, 2: 201-274
Henderson PA & Seaby RMH (2007) Community Analysis Pack-
age 4.0 Pisces Conservation Ltd, Lymington, UK. 164 pp.
(www.pisces-conservation.com)
Irwin DE (2002) Phylogeographic breaks without geographic
barriers to gene flow. Evolution 56: 2383-2394
Kunkel JG, Cherry LM, Case SM, Wilson AC (1980) Reply to
W.R. Atchley’s “M-Statistic and Morphometric divergence.
Science 208: 1060-1061
©ZFMK
206 Oscar J. Arribas
PSE Sa dee ow
Custer eer a os
Fig. 5.
Lizana M, Ciudad MJ, Pérez-MelladoV (1988) Distribucion al-
titudinal de la herpetofauna en el Macizo Central de la Sierra
de Gredos. Rev. Esp. Herpetol. 3: 55—67
Lizana M, Ciudad MJ, Gil M, Guerrero F, Pérez-Mellado V,
Martin-Sanchez R (1992) Nuevos datos sobre la distribucion
de los anfibios y reptiles en el macizo central de la Sierra de
Gredos. Rev. Esp.Herpetol. 6: 61-80
Lizana M, Martin-Sanchez R, Morales JJ, Lopez-Gonzalez J,
Gutierrez J (1993) Nuevas poblaciones de la lagartija serrana
(Lacerta monticola cyreni) en las sierras de Avila. Bol. Asoc.
Herp. Esp. 4: 5—6
Martin J (2005) Lagartija carpetana - [berolacerta cyreni. En:
Enciclopedia Virtual de los Vertebrados Espanoles. Carrascal
LM, Salvador A (Eds.) Museo Nacional de Ciencias Natura-
les, Madrid. http://www.vertebradosibericos.org/
Mayer W & Arribas O (1996) Allozyme differentiation and re-
lationship among the Iberian-Pyrenean Mountain Lizards
(Squamata: Sauria: Lacertidae). Herpetozoa 9 (1/2): 57-61
Mayer W & Arribas OJ (2003) Phylogenetic relationships of the
European lacertid genera Archaeolacerta and Iberolacerta and
their relationships to some other ‘Archaeolacertae’ (sensu la-
to) from Near East, derived from mitochondrial DNA se-
quences. Journal of Zoological Systematics & Evolutionary
Research 41: 157-161
Bonn zoological Bulletin 57 (2): 197-210
reset) Cee eees
5o4 pee eeomet
sis aan ee
Iberolacerta cyreni NEOTYPE (here designed). MNCN n. 39934.
Miller L & Hellmich W (1937) Mitteilungen tiber die Herpeto-
fauna der Iberischen Halbinsel. II. zur Kenntnis der Lacerta
monticola. Zool. Anz. 117: 65—73
Ninyerola M, Pons X, Roure JM (2005) Atlas Climatico Digi-
tal de la Peninsula Ibérica. Metodologia y aplicaciones en bio-
climatologia y geobotanica. Universidad Autonoma de Bar-
celona, Bellaterra.<http://www.opengis.uab.es/wms/iberia/
index.htm>
Odierna C, Aprea G, Arribas OJ, Capriglione T, Caputo V, Ol-
mo E (1996) The Karyology of the Iberian Rock Lizards. Her-
petologica 52 (4): 542-550
Pérez-Mellado V, Barbadillo LJ, Barahona F, Brown RP, Corti
C, Guerrero F, and Lanza, B (1993) A systematic survey of
of the Iberian Rock lizard Lacerta (Archaeolacerta) montico-
la. In: Valakos E, Boehme W, Pérez-Mellado V and Maragou
P (eds.) Lacertids of the Mediterranean region. Athens: Hel-
lenic Zoological Society 85—105
Received: 29.VI.2010
Accepted: 15.X.2010
©ZFMK
Intraspecific variability in Jberolacerta cyreni 207
APPENDIX I
Neotype designation for /berolacerta cyreni (Miller & Hellmich,
1937)
The type series of /berolacerta cyreni (Lacerta monticola cyreni
Miiller & Hellmich, 1937) included 66 specimens (not only from
Guadarrama, the species’ type locality, but also some paratypes
from Gredos) formerly deposited in the Zool. Staatssamlung
(Herpet. Samml.) Miinchen. In fact, two syntype specimens,
male and female, respectively numbered “ZSM (SLM) 2329 a”
and “ZSM (SLM) 2329 b”, were originally considered as types
labelled “Guadarrama, Puerto de Navacerrada. W. Hellmich”.
(Miller & Hellmich, 1937).
Although it seems that all the original type series was destroyed
during the Second World War (Franzen & Glaw, 2007), and due
to the fact that in this type series there were included some Gre-
dos specimens (today part of another subspecies; /. c. castiliana),
and also that there was early confusion about the /. monticola
type locality which lead to the description of a new taxon as Lac-
erta estrellensis Cyren, 1928 (Arribas 2008), I design a new type
specimen (neotype) to fix unequivocally the type locality against
any contingence (as could be the highly improbable apparition
of any “surviving” original Gredos paratype).
I designate here as NEOTYPE for the species a specimen from
the Museo Nacional de Ciencias Naturales (Madrid) (MNCN n.
39934) (Fig. 5).
A male labelled as follows:
Left hindleg: (white label, Typewriter letter) MNCN (anverse),
39934 (reverse).
Right hindleg: (white label, pencil handwritten) “Pto. de
Cotos—Pto de Navacerrada. Srra. de Guadarrama (_ )[blank in-
side parenthesis], 21-IV—84, 18,15 h. Sol. Pedriza en pinar con
nieve. Ps=8.5 gr.” (no collector’s data).
Left foreleg: (White label, ink handwritten) Neotypus. O. Ar-
ribas designatio (anverse), “Lacerta monticola cyreni Miller &
Hellmich, 1937” (=/berolacerta cyreni) (reverse).
Right foreleg: (Red plastic label, Dymo® lettering) NEOTYPUS.
Neotype description (Fig. 5):
Biometry: Adult male with snout—vent length of 66.85 mm. Tail
126 mm (intact). Forelimb length 23.34 mm. Hindlimb length
34.52 mm. Pileus length 16.4 mm. Pileus width 8.2 mm. Pari-
etal legth 5.5 mm. Masseteric widest diameter 2.71 mm. Tym-
panic widest diameter 1.94 mm. Anal plate width 5.04 mm. Anal
length 3.19 mm. FLL/SVL (relative forelimb length): 0.349.
HLL/SVL (relative hindlimb length): 0.5163. PL/PW (pileus
Bonn zoological Bulletin 57 (2): 197-210
shape): 2.003. DM/PaL (relative masseteric plate size): 0.491.
DT/PaL (relative tympanic size): 0.352. AL/AW (anal plate sur-
face): 0.6329. AS/SVL (relative anal plate size in respect to to-
tal legth): 5.998.
Scalation: Number of supraciliary granules: 9 (rigth) and 11
(left). Supralabials: 5 (both sides). Sublabials: 6 (right side) and
7 (left side). Submaxillars: 6 (both sides). Gularia: 25. Collar-
ia: 9. Dorsalia: 53. Ventralia: 26. Femoral pores 19 (right) and
18 (left). Lamellae: 25. Circumanal Plates: 8. Rostral in full con-
tact with frontonasal. Supranasal separated from first loreal. One
postnasal (in both sides). First Postocular separated from Pari-
etal plate. Alternate wide and narrow scale rings in the tail. Twen-
ty—six scales across one of these rings.
Coloration: (in alcohol). Dorsal tract and pileus brown (proba-
bly also in life), densely spotted of medium-sized black spots
that in the middle of the dorsum nearly form transverse bands
and connect the two temporal bands. Temporal bands reticulat-
ed fairly dark (black—brown) with traces of clear occelli (bare-
ly visible) inside, also connecting with more light reticulated with
infratemporal band (barely discernible). No blue axillar occel-
li. Traces of blue points in the outermost ventral scales. Only
the outermost ventral scale ranges are clearly black spotted. Bel-
ly light bluish or white—bluish.
APPENDIX II
Barriers and high mountain passes (among parentheses) between
the different /. cyreni populations. All these intermediate areas
are at present apparently devoid of /. cvreni, thus constituting
these OTUs discrete populations:
BEJAR-GREDOS: no barrier (Puerto de Tornavacas, 1275m).
BEJAR-VILLAFRANCA: Tormes River Valley (no pass).
GREDOS-VILLAFRANCA: Tormes River Valley (Collado de
Cepegato, 1550m).
GREDOS-S? AVILA[Serrotat+Paramera]: Alberche River Valley
(no passes).
SERROTA—PARAMERA: no barrier (Puerto de Menga,
1566m).
VILLAFRANCA-SERROTA: no barrier (Puerto de Chia,
1663m).
S* AVILA (as a whole) -GUADARRAMA: no barrier (Puerto
del Boqueron, 1315m).
GREDOS—GUADARRAMA: Alberche River Valley (no pass)
©ZFMK
Oscar J. Arribas
208
IT 6£9-9C ELy
Ch 99S-€P VLy
vy C99-€l 6b
CL 6E9-€S 6bP
89°689-00 9Er
6LPEEO'0 rT 80'0FST'E9S 80 OFT'TZS LL OFb7 96S 87'0F89'60S ILOFIE'99S TAS/SV 2
€9£6S0'°0 9€7 PS IL-IL'6r SS89-ETSh = SP I8-18°Or 19° TL-10'SS 99°99-€8' SP iS
600°0F1b'6S ZO'OFEE'8S 10°0+6S'6S €0'0FPS 79 10'0F77'SS MAW/TV
TLy-19'8Z 1'9S-1'67 81 6r-S LZ 9€ 6£-TS ‘TZ €8°8r-18'1Z
8Z00S5°0 LL0 600°0FLE'SE Z0'OFL6'LE 10°060°9€ ZO'OFZT EE 10°0FS7'SE Ted/La
8L'€S-6b 67 98°SS-LS ‘91 p8'€S-O£ TE IZ 9b-L6'0€ 9€ 05-06 °0E
89LS10°0 rT LOOFIL bh €0'0FL6'6£ 10:0FZU' Zr Z0'OF88°LE 600 0FEE SE Ted/ING
C1608E'0 901 88°SET-EST6I O€8EE-BP'LOI I 9ZZ-91OZI O@8TZ-HI'66I PE LET-SP'S6I
ZO OFLY' FIZ ILOFZES7TZ = PO'OFTP'TIZ 70 0F87 FIZ Z0'OFEO'9I1T Md/'1d
6S PS—-68 Lr SLES-10'6bh ~—s6I'SS-€6'Eb 07 1S-6P' 8b re 9S-6£ OF
6£7709'0 690 €000FL8'0S 700'0FZ9'0S + S00'0F96'0S +00°0FLT'0S ro0';0F9r' IS "TAS/TTH
P6 8E-S6'IE IOLE-LLZE = LE-TH-TT'6T 99° SE-E8'TE 16 6418 0€
x 176940'0 7S'Z €00 OFSS'PE POO'OFEO'SE 900'0F9F'SE +00'0FPS FE €00°0FPT'9E TAS/T14
1-0 7-0 Z-0 €-0 €-0
x ek 60S+00'0 LO'Y L0'0¥S8'0 61 OFZL'0 ZL OFEr'O Tr OFEE'I LVOFTU'I Ad
1-0 50-0 0-0 1-0 0-0
P68LTZ1'0 rs'l 70°0L0'0 +0'0++0'0 00 91 0F910 00 107T-ug
1-0 I-0 Z-0 0-0 1-0
786089'0 850 90°0F¢7'0 60° 0FE1'0 60'0FS1'0 OF0 80'°0F7'0 td-0d
(Gal ZI Z-0 7-Z ZI
8L6698'0 1¢0 90'0F88'1 60'0F06'I OL 0FT8'I OFZ 90'0F88' I Ra
6-9 6-9 6-S 8-9 ZI-9
* eo Re ee S $00000'0 S8'8 LUOFP'L 97 OFL 17 0F£9°9 O€ OFE89 07 0F7'8 Would
O€-ITZ 67-47 67-17 67-€7 6C-CZ
9S9IPT'0 Or'l IE OFS8'PT vOFLT9Z Ev OFEI'SZ 96 0F97 E€ OFT ST WV
77-91 r7-91 7-H 07-81 IZ-91
r788L9'0 850 97 OFLO'8I OL OFTL'SI IC OFEL'SI be OFS SI 87 0F9S'81 LWaa
7-SI p7-LI TZ-SI 07-81 7-91
SLEL8T7'0 LTI 67 OFLO'SI SS OF81'61 POOFE SI O€ OFER'8I IC OFTL'SI 1WaA
67-17 87-17 6C-17 LT-STZ 97-€T
ek a pe 010000°0 87'8 77 OFPI'9Z 9€ 0F6'ST ZZOF8O'9T €€'0F99'ST T0F9'PZ INGA
LS-9P b9-0S LS9r LS-0S 9S-Sr
4 ex 60Z000'0 S19 LS OFTS ZZ TF81'SS OL'OFITIS 87 LFS'TS SS0Fb9 6b suoad
L78r00'0 €0'r €I-8 ZI-6 €1=L €I-ll ZI-8 es
ek e * se 61 0FSTOI 87 OFSP'OL IT OFEL OL Or OF9TTZI OT OFFr'OI T1090 =
87-07 67-€Z 1€-€Z S7-@Z ECNG ule
098 10°0 ble EL OFIL EZ Z9'OF9IE'ST br OFOE ST Tr 0F99'ET 9€ OFF0' FT 709 a
LI-8 SI-8 9I-L SI-6 SI-L Be
SUTFbr II 99 0F£9'II oF OF EF'OI S8'OFII 9€ OFTSOI IsI9a
I8Z6LT'0 6c I 91-8 SI-9 8I-L vI-6 €I-9 >
8079190 490 LE OFCT II S8'0F9E TI SS OF9T TI 6L 0F€8'01 LE OFF Ol ISId <
16'PL-ZI'SP 8ELL-€'8p V'TL-6 6P LETL-LU8h SPL-l'SP 3
ZLT8I1'0 06'1 6L 1FEP'E9 ITZ EFET PI LE LFre99 ZLPF60'9S OL 1FS8'19 TAS =
; (Lz=u) (S) (11=u) (pr) (¢7=u) (¢) (9=u) (7) (sz=u) (1) =
CS aS Se aes So Sr GES xa GUM Sexy CS) UU 2 Se) d Lr y V'IIAV «S uvrad Soda SaUVFIN “‘wAvVavAD SATIVIN.S
“SISATBUR SLIOUOYCIOUL SY} Ul PASN SOXOPUL PUK SID}IVILYO JO SUONLIADIQGK IO} 1X9} SpOYI|] pure [RLV]
29g ‘so[duies oper iuasd ‘7 JO SOXOpUl [ROLOWIOIG pue UONL]BdS ‘OLNOWOYdIOW WOT, (LUNLUTXBLU PUL LUINUTIUILU “10a prepuRys ‘URdLL) SISTR}S ODANCLIOSOp puke VAONV “LT eqeh
I XIGNaddV
Bonn zoolog
209
Intraspecific variability in /berolacerta cyreni
©ZFMK
P8'PZ9-90'SIb 8SPEI-EL Shh PE PPS-6S'POP IS OPL-9C9LP LES8S-L’8br
se . x 6br100'0 69> Ol OFT LOS IOOFIZOES 900F6T'PTS LIOFEL' P6r L0'0+09'€SS TAS/SV
66°99-00'0S QUSL-TWSLe 6T'B9-STLE ~—s-ZS9-06'6F ~—S 88 LOI-€0'9
9669L£°0 90'I 10'0FS8°8S €10'0FO1'09 — 800'0FF9'LS Z0'OFSL'8S 10: OFEL'9S MV/TV
9°9b-F8'0€ p8'6P-IE PT €69P-CL'TZ OL 'EP-ET'SE 6 IPI F'7Z
; ee 69r£0'0 rr 10°OF8L'LE 1OOFSP'6E 80 OFOF'SE 10;OFTS'8E L00°0F8L' PE Ted/La
py TS-IS 81 OV LS-PL'bt €O'IS-ES'SZT L9'BP-ZO'8Z 1Z'0S-00'8Z
9876900 ETT ZO'OF8E Ih 10'0FL8°0F 10: OFIL'6E Z0'0FZ0'8E 10'0F9L'9€ Ted/ING
p0'6IZ-O1'061 98'6ZT-OL'THI_ L'VET-H'TZEL OTGIZ-6O'L6I = 8B'LZ7-CT'POI
€£L190'0 I€Z OOFES 907 ZO'OF9P'FIZ OOFEO'ZIZ 7O'OFZE'SOZ 10076807 Md/'Td
IZ'6P-9E SE B0'6P-ESLE SLZS-ZBLE OT'IS-CEbr €€TS-Ol OF
£2 Fe * 6000000 96'L 800°00'br SOO'OFSP' Er SOOOF6I'Lr 800'0FPE9F S00';0Fr6'Sh ~~ TAS/TTH
El'PE-L'97 I8'S€-ThLZ —- 89'6E-EGLZ = HS HE-HS'8Z St'9€-PL 67
+m +e P ee 1000000 Tr6 900 0FE6'0E PrOOOFLSOE COO OFFE'EE 00° OF6ETE COOOFSTEE TAS/TTA
Z-0 €-0 Z-0 1-0 Z-0
S60ILS°0 €L'0 ST OFEH'O 91 0F6£'0 100970 7 OFT LOFLt'0 Ad
1-0 1-0 7-0 S$'0-0 Z-0
OZZIZL'0 ZS‘0 L0'0F71'0 90'°0FF1'0 LO'0FI7'0 60'0F61'0 900+80'0 10J-US
1-0 Z-0 Z-0 1-0 7-0
PSL169°0 950 110F9+'0 OL 0F6¢0 IV0FSS'0 81 0F87'0 IL OF8€0 vd-0d
Z-0 Z-0 7-0 7-0 7-0
€£TZ08'0 Ir'0 8L0F9S I €1'0F09'I 60°0FEL'I 87 OFIL'I ZL OFSS'I ra
6-9 6-9 6-S 6-S OI-L
ex ie +e xx 0000000 SS'II 97 OFST'L 61 0F9b'L ST0F80°L ZS'OFIL'9 ZLOFIP'S Vou
LTC LT-CTZ 67-07 97-€Z LCI
19LS+0'0 0S°7 LEOFIE PZ STOFST —« LT'OFZB"PT Ly OF87'PZ 97 OF16 EZ WV1T
6I-+1 0Z-SI OT-SI 8I-LI ZC-SI
6IZ8ZE0 Blel O€ OFTI'LI ST0F96 LI ZOFIOLI pL OFS8LI LTOFEN'LI 1 Wad
6I-SI IZ-SI Z7-SI SI-LI 17+
6PE189°0 LS‘0 87 OFIE LI €€0FTO'SI ST OFS LI plOFS8'LI 8TOFI6 LI Wad
1€-LZ 1€-LZ 1€-97Z 0€-97 67-ST
ee * ok et re 0000000 = SEST tT OFT9'6T 61 OFTE6Z «YT OFF0'6Z 0S OFS8°LZ OL OFSL'LZ INGA
SS-Sb 6S-Lr 6S-Lr pS-Ly bS-€b S
* He ek 000000°0 ~—LI'FI $9 OFEP'0S ESOFCS SPOFIT'ZS 90° 1FTP'0S ZS OFI9'LP suo 4
€1-6 ZI-8 1-6 11-6 bI-8 S
reoroc 0 €0'l ET OFL8'01 ZT OF87 01 STOFFE OI 97 OFFLO1 6 OFEE OL T1090 5
x * 97-07 67-17 €€-CZ LT-IZ Lt-61 a
ee £91000°0 90'9 Th OFSL ET LEOFIL PZ —- HE'OFS9'ST SL OFKT O€ OFE9' EZ 1nd —
SI-8 91-8 91-S ZI-8 €I-9 wm
* 101SZ0'0 88°7 Lr OF8U IT 1€ 0FP9'01 87'0F80'TI SSOFFI'OI 67 0F88'6 ISD.
bI-8 S1-8 LI-S 11-8 €I-8 2
P P 86£110°0 6E'€ 1S ‘OFST' IT 67 OFES 01 87'0F98'01 Zr OFLS'6 ZT '0F8'6 1819 8
EL18-4S' Lh pL 18-87'0S JEL 6h vETL-IP'8r ZL'6L-@O'8b =
# se * 5 Z£0000'0 €VL 80° €F7S'99 SUIFCOEL —« SB'OFLS'H9 eb CFLS €9 Sh 1F89'b9 TAS &
; (91=u) (s) (gz=u) (p) — (9b=) (¢) (L=u) (2) (9€=u) (1) =
Sr S-£ P= SZ at Sant Ge] OU co] So) a d Our hy V'TIAV ¢S UVrAA soadauDd SAUVETA waAVdVAD saTVNAd S
f=)
5
faa}
“So[eUUloy Mad J OF yNQ “| BqQui uUlsy °Z 9IqUL
210
Oscar J. Arribas
Table 3. Analysis of Similarity (ANOSIM) results (with 1000 randomizations). Males above diagonal and females below. The
number is the test probability results among each two concerned populations (significant results in bold).
FEM \ MAL BEJAR GREDOS GUAD. MIJARES SERR-PAR VILLAFR.
BEJAR — 0.058 0.001 0.644 0.138 0.064
GREDOS 0.021 — 0.001 0.691 0.867 0.198
GUAD. 0.001 0.001 = 0.097 0.128 0.001
MIJARES 0.53 0.039 0.327 — 0.224 0.513
SERR-PAR OM27, 0.025 0.001 0.217 — 0.86
Bonn zoological Bulletin 57 (2): 197-210 ©ZFMK
[ Bonn zoological Bulletin Volume 57 | Issue 2 pp. 211-229 Bonn, November 2010
Insights into chameleons of the genus Trioceros
(Squamata: Chamaeleonidae) in Cameroon,
with the resurrection of Chamaeleon serratus Mertens, 1922
Michael F. Barej!;*, Ivan Ineich?, Vaclav Gvozdik34, Nathaly Lhermitte-Vallarino>, Nono Legrand
Gonwouo®, Matthew LeBreton’, Ursula Bott’, & Andreas Schmitz?
1 Museum fiir Naturkunde, Leibniz Institute for Research on Evolution and Biodiversity at the Humboldt
University Berlin, Invalidenstrasse 43, D-10115 Berlin, Germany
2 Muséum National d’Histoire Naturelle, Département Systématique et Evolution (Reptiles et Amphibiens),
UMR CNRS 7205, CP 30, 25 rue Cuvier, F-75005 Paris, France
3 Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Department of
Vertebrate Evolutionary Biology and Genetics, Rumburska 89, CZ-277 21 Libéchov, Czech Republic
4 National Museum, Department of Zoology, Cirkusova 1740, CZ-19300 Prague, Czech Republic
5 Muséum National d’Histoire Naturelle, USM 30705 Département Ecologie et Gestion de la Biodiversité &
CNRS IFR 101, Parasitologie comparée et Modéles expérimentaux, 61 rue Buffon, 7 CP52, F-75231
Paris cedex 05, France
6 Université of Yaoundé I, Faculty of Science, Laboratory of Zoology, P.O. Box 812, Yaoundé, Cameroon
7 Global Viral Forecasting Initiative, BP 7039, Yaoundé, Cameroon
8 Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany
° Muséum d’histoire naturelle, Department of Herpetology and Ichthyology, C.P. 6434, CH-1211 Geneva 6,
Switzerland
* Corresponding author: E-mail: [email protected]
Abstract. Relationships among chameleons of the genus Zrioceros in Cameroon are reviewed on a molecular basis us-
ing mitochondrial genes and by morphology. Trioceros oweni is placed basal to two distinct clades (lowland-submon-
tane species vs. submontane-montane species) and its position is discussed due to high genetic differences to the remain-
ing taxa. Within the lowland-submontane species group, distinct subclades with low genetic differences exist within 7°
montium and T. cristatus. Differing relationships to previously published results are observed within the submontane-
montane species group, resulting in taxonomic changes: 7rioceros eisentrauti 1s grouped with the two 7) quadricornis
subspecies, showing only low genetic differences, which also correlates with the similar overall morphology. The taxon
is thus assigned to a subspecific rank: T. quadricornis eisentrauti. Within the wiedersheimi-group, the former southern
subspecies is elevated to species rank, 7rioceros perreti, and two additional species have been distinguished by molec-
ular and morphological methods in the former nominate taxon. Trioceros wiedersheimi is restricted to northernmost lo-
calities, while remaining populations have been assigned to the revalidated taxon Trioceros serratus (Mertens, 1922).
Differentiating morphological characters for the three species are provided and a neotype of Chamaeleon serratus Mertens,
1922 is designated and described to ensure clarification of its taxonomic status and type locality.
Key words. Reptilia, Chamaeleonidae, Trioceros, Trioceros serratus, Africa, Cameroon, phylogeny, taxonomy.
INTRODUCTION
Only recently, Tilbury & Tolley (2009) provided molec-
ular evidence that the two former subgenera (Chamaeleo
Laurenti, 1768 sensu stricto and Trioceros Swainson,
1839) of the chamaeleonid genus Chamaeleo as recog-
nized by Klaver & BOhme (1986) represent two distinct
and valid genera. For a diagnosis of the two genera see
Klaver & Bohme (1986, 1992) and Tilbury & Tolley
(2009). Klaver & Bohme (1992) additionally provided a
detailed overview of formerly published knowledge on the
Bonn zoological Bulletin 57 (2): 211-229
cristatus-subgroup inside the Trioceros-group from
Cameroon.
The Republic of Cameroon exhibits a very high diversi-
ty of chameleon species compared to adjacent countries,
especially in montane areas (BOhme & Klaver 1981;
Gonwouo et al. 2006; Herrmann et al. 2005, 2006). At
present 14 species of chameleons are known to occur in
Cameroon. They belong to the genera Chamaeleo [five
©ZFMK
212 Michael F. Barej et al.
species: C. africanus Laurenti, 1768; C. dilepis Leach,
1819; C. gracilis Hallowell, 1842; C. quilensis Bocage,
1886; C. senegalensis Daudin, 1802], Rhampholeon [one
species: R. spectrum (Buchholz, 1874)] and Trioceros
[eight species: 7. camerunensis (Miller, 1909); T. crista-
tus (Stutchbury, 1837); 7! eisentrauti (Mertens, 1968); T.
montium (Buchholz, 1874); 7. oweni (Gray, 1831); T. pf-
efferi (Tornier, 1900); 7. quadricornis (Tornier, 1899); T.
wiedersheimi (Nieden, 1910)]. Trioceros quadricornis and
T. wiedersheimi are polytypic, with one more subspecies
[TZ g. gracilior (BOhme & Klaver, 1981), TZ. w. perreti
(Klaver & Bohme, 1992)], resp. (BOhme & Klaver 1981;
Chirio & LeBreton 2007; Gonwouo et al. 2006; Klaver
& Bohme 1986; Tilbury & Tolley 2009). According to
Klaver & Bohme (1997) and Uetz & Hallermann (2010)
one additional species (Chamaeleo laevigatus Gray,
1863) is present in Cameroon, but this species has not been
listed by other recent authors (Chirio & LeBreton 2007;
Gonwouo et al. 2006; Tilbury 2010). While some species
such as Chamaeleo gracilis or Trioceros cristatus show
a large distribution ranging at least from Nigeria to Gabon
and the Congo (Necas 2004), five species are regarded as
montane endemics occupying restricted high elevation ar-
eas along the Cameroon mountain chain, with 7) eisen-
trauti the most restricted, being endemic to the Rumpi
Hills in western Cameroon (Chirio & LeBreton 2007;
Gonwouo et al. 2006; Klaver & BOhme 1992).
Pook & Wild (1997) published a preliminary phylogeny
of Trioceros from Cameroon, and we herein provide ad-
ditional and new insights into this species group based on
additional material.
MATERIAL AND METHODS
In all, 49 combined, mitochondrial 16S and 12S rRNA
gene fragments, sequences (Tab. 1, Appendix II; museum
acronyms see below) comprising 964 bp (lengths refer-
ring to the aligned sequences including gaps) were ob-
tained. One short section (4 bp from the 12S gene) was
too variable to be reliably aligned, and was excluded from
the analyses, resulting in a total of 960 bp which were used
in the analyses. Kinyongia tavetana (AM422414/
AM422433; Mariaux et al. 2008) was used as outgroup.
Its position outside of 7rioceros was demonstrated by
Tilbury & Tolley (2009). DNA was extracted using Qi-
Amp tissue extraction kits (Qiagen) and the peqGold Tis-
sue DNA Mini Kit (PEQLAB Biotechnologie GmbH) (see
Wagner et al. 2009a). The primers l|6sar-L (light chain;
5’— CGC CTG TTT ATC AAA AAC AT - 3’) and 1 6sbr-
H (heavy chain; 5’ - CCG GTC TGA ACT CAG ATC
ACG T — 3’) of Palumbi et al. (1991) were used to am-
plify a portion of the mitochondrial 16S ribosomal RNA
gene. Additionally, a section of the mitochondrial 12S ri-
Bonn zoological Bulletin 57 (2): 211-229
bosomal RNA gene was amplified using the primers
12SA-L (light chain; 5’°- AAA CTG GGA TTA GAT ACC
CCA CTA T — 3’) and 12SB-H (heavy chain; 5’- GAG
GGT GAC GGG CGG TGT GT — 3’) of Kocher et al.
(1989). PCR cycling procedures were as described in
Schmitz et al. (2005). PCR products were purified using
Qiaquick purification kits (Qiagen). Sequences were ob-
tained using an automatic sequencer (ABI 377). Sequences
were aligned using ClustalX (Thompson et al. 1997; de-
fault parameters) and manually checked using the origi-
nal chromatograph data in the program BioEdit (Hall
1999). PAUP* 4.0b10 (Swofford 2002) was used to com-
pute the uncorrected pairwise distances for all sequences
(Tab. 2, Appendix II). We performed neighbour-joining
(NJ), maximum parsimony (MP), maximum likelihood
(ML) and Bayesian reconstructions. For ML and Bayesian
analysis parameters of the model were estimated from the
data set using Modeltest 3.7 (Posada & Crandall 1998) and
MrModeltest 2.3 (Nylander 2002), respectively. For the
MP analysis, we used the “heuristic search” with the “ran-
dom addition” option of PAUP* (Swofford 2002) with 10
replicates, using the TBR (tree bisection-reconnection)
branch swapping option. For the ML tree we used the
PhyML 3.0 computer cluster of the Montpellier bioinfor-
matics platform (http://www.atgc-montpellier.fr/phyml/)
(Guindon & Gascuel 2003). All Bayesian analyses were
performed with MrBayes, version 3.12 (Huelsenbeck &
Ronquist 2001). The exact parameters used for the
Bayesian analyses followed those described in detail by
Reeder (2003). For the Bayesian reconstruction clades
with posterior probabilities (PP) = 95% were considered
strongly (significantly) supported. Additionally, we used
bootstrap analyses with 1000 (for ML), 2000 (for MP) and
20000 (for NJ) pseudoreplicates to evaluate the relative
branch support in the phylogenetic analysis.
In the morphological analysis measurements follow stan-
dard procedures (e.g.Werner 1902; Mariaux et al. 2008)
and were taken on preserved material with an electronic
dial calliper (+ 0.1 mm). All measurements are given in
mm (Tab. 3, Appendix II). Analysis of morphological da-
ta has been performed using PAST software (Version
1.82b; Hammer et al. 2001). If measurements (e.g. femur
length) differed between body sides, mean values were
used. Photos of living specimen have been used to analyse
colouration patterns.
Investigated specimens are deposited in Muséum d’his-
toire naturelle, Geneva (MHNG); Muséum national
d’Histoire naturelle, Paris (MNHN); National Museum,
Museum of Natural History, Prague (NMP6V); Zoologi-
sches Forschungsmuseum Alexander Koenig, Bonn
(ZFMK); Museum fiir Naturkunde, Leibniz-Institut fiir
Evolutions- und Biodiversitatsforschung an der Humboldt-
Universitat zu Berlin (ZMB); Zoologische Staatssamm-
lung Miinchen (ZSM).
OZFMK
Chameleons of the genus Trioceros from Cameroon 21
RESULTS
To date ten taxa belonging to the genus Trioceros have
been recognized in Cameroon (eight species + two sub-
species), but the present phylogenetic analysis is incon-
sistent with this arrangement (Fig. 1). All four used phy-
logenetic methodologies strongly agree in the overall
topology and in all cases support the same terminal clades.
The phylogenetic analyses reveal only a single difference
(discussed below) for the individual analysis of the two
applied gene fragments (not shown), therefore, we only
discuss the results of the combined analysis.
Distances between ingroup and outgroup species averaged
11.48% (10.58%-—12.30%); Tab. 2, Appendix II). Interspe-
cific distances within the ingroup ranged from
3.21%-6.90% excluding 7: oweni.
Trioceros oweni 1s the most basal taxon in respect to all
ingroup taxa, which are grouped within one clade fully
supported in NJ, MP and ML, while still strongly, but not
fully significantly supported in the Bayesian
reconstruction (PP: 0.91). The main clade is divided into
two major subclades with strong statistical support. The
first subclade includes 7. camerunensis, T. cristatus, and
T; montium, but their mutual relationships remain
unresolved. However, partly well supported substructure
can be recognized within the two species, 7. montium and
T. cristatus. Trioceros camerunensis stands in a basal
position to 7’ montium, but this is only significantly
supported by the MP reconstruction. Within 7. montium,
we find a subdivision into three only slightly differentiated
subclades. Overall the uncorrected p-distances of the
included 7 montium vouchers range between 0.00%-
0.75%. Similarly, within 7. cristatus a similar subdivision
into three more distinct subclades is apparent. Here, the
genetic distances between the included 7) cristatus
vouchers ranges between 0.00%—1.28%.
Contrary to the first major ingroup subclade, relationships
of the species of the second major subclade remain unre-
solved and form a basal polytomy. Nonetheless, all ter-
minal clades in this second major subclade are strongly
supported and are well distinct regarding the individual
branch lengths and bootstrap support for each terminal
clade, mostly corresponding to currently accepted species
within Zrioceros. The morphologically very distinct tax-
on 7: eisentrauti is grouped together with the two de-
scribed 7. quadricornis subspecies with uncorrected p-dis-
tance values of between 0.51%-—1.08% between these three
taxa. We found only one haplotype in each of the two sub-
specific taxa, 7. g. quadricornis and T. q. gracilior, while
in T. eisentrauti we uncovered a difference of two nu-
cleotide substitutions in our newly gained sequences in
comparison to the published 12S sequence of Pook & Wild
Bonn zoological Bulletin 57 (2): 211-229
Ww
(1997). The distances of 7. eisentrauti to the nominate
form T. q. quadricornis (0.51%-—0.64%) are about equal
in size to the distances of the latter to 7. qguadricornis gra-
cilior (0.63% 0.64%). The distance of 7. eisentrauti to T.
quadricornis gracilior is only moderately higher
(1.02%-—1.08%). These values are clearly within the in-
traspecific distance range of all included Trioceros
species. Contrarily, the remaining taxa of this subclade
show a much higher genetic differentiation between each
other, ranging from 3.18%-—5.00%. These other terminal
clades correspond to the taxa 7! pfefferi and T: wiedershei-
mi. The latter hornless taxon is represented by three ge-
netically well differentiated clades. Two of them corre-
spond to the two so far described subspecies, but we find
a further significant split within the populations current-
ly assigned to the nominate form.
DISCUSSION
Following our molecular and morphological results sev-
eral changes are necessary among Cameroonian
chameleons of the genus Trioceros. The overall number
of Trioceros taxa in Cameroon is raised to eleven and two
already known taxa are revised in their taxonomic rank.
Within the Cameroonian Jrioceros, T. oweni is the most
basal taxon, while the other taxa form two subclades, in
which 7. camerunensis, T. cristatus, T. montium form a
lowland to submontane group while remaining taxa of the
second subclade inhabit submontane to montane habitats
(Pook & Wild 1997). Results and required changes will
be discussed below in separate sections referring to the
relevant species groups.
Trioceros oweni (Gray, 1831) (Fig. 2A)
Trioceros oweni, the type species of the genus Trioceros,
is the most basal in respect to all remaining Cameroon-
ian taxa (Fig. 1). The value of uncorrected p-distance be-
tween 7. oweni and the outgroup taxon Kinyongia tave-
tana (12.21%) is within the genetic distance range of all
included Trioceros taxa to the outgroup (10.58—12.30%,
Tab. 2, Appendix II). However, values of uncorrected p-
distances between 7) oweni and remaining Cameroonian
Trioceros taxa (8.57—10.22%) are significantly higher than
values in-between the remaining ingroup taxa (see Tab.
2, Appendix II), and the maximum distance value is on-
ly marginally lower than the minimum distance of all 7ri-
oceros to the outgroup taxon. Based on molecular data,
Pook & Wild (1997) suggested that 77 oweni might belong
to a distinct species group, being closer related to 7. john-
stoni, an East African species, than to other western 7ri-
oceros. In the past, Werner (1902) grouped 7: oweni to-
gether with 7. johnstoni, T: melleri and T: werneri, while
T. cristatus, T: montium, T. pfefferi and T: quadricornis be-
©OZFMK
214
Michael F. Barej et al.
Kinyongia tavetana AM422414/AM422433
Ea fad
2
*/*
Trioceros ap
oweni Campo region/Nkoelon E146.15
camerunensis Mt. Cameroon/Njonji E130.1
montium Rumpi Hills/Mofako Balue E179.18
montium Bakossi Mts./Edib Hills E188.19
montium Bakossi Mts./Edib Hills E188.18
montium Mt. Kupe/Nyasoso E180.15
montium Bakossi Mts./Edib Hills E188.20
montium Mt. Kupe E130.5
montium Mt. Kupe E131.3
3| montium Mt. Cameroon E130.4
montium Mt. Cameroon E131.2
cristatus Rumpi Hills/Mofako Balue E180.2
© cristatus Rumpi Hills/Big Massaka E180.7
El ie
Lx
5
fe
a/* 3
cnistatus Mt. Cameroon/Njonji E131.1
cristatus Mt. Cameroon/Njonji E130.2
cnstatus Mt. Cameroon/Njonji E130.3
cristatus Campo region/Nkoelon E150.8
cristatus Mamfe region/Amebishu E146.13
cristatus Mamfe region/Amebishu E150.7
quadricomis eisentrauti
gquadricornis eisentrauti Rumpi Hills/Mt. Rata E178.10
7| © quadncornis eisentrauti Rumpi Hills/Mt. Rata E178.11
Lx
bl fd
+ /%
*/x
ai fs
*/e
quadricornis quadricomis Mts. Manengouba E131.5
8| quadricornis quadricornis Mts. Manengouba E130.9
quadricornis quadricomis Mts. Manengouba E130.10
quadricornis quadricornis Mts. Manengouba E131.8
H guadncornis gracilior Mt. Oku E130.8
guadnicomis gracilior Mt. Oku E130.7
guadncornis gracilior Oku village E131.4
pfeffen
perreti Mts. Manengouba E131.6
perreti Mts. Manengouba E130.11
perreti Mts. Manengouba E130.12
serratus Mt.Mbam E178.3
serratus Mt.Mbam E178.5
eof fs
tlhe
ake
0.1
serratus Mt.Mbam E178.2
serratus Mt.Mbam E178.4
serratus Big Babanki E188.16
serratus Belo, Mt. Oku [NEOTYPE] E130.17
serratus Big Babanki E189.8
serratus Oku village E131.16
serratus Oku village E131.17
serratus Lake Oku E130.16
serratus Mt. Oku E130.15
serratus Oku village E131.7
wiedersheimi Tchabal Mbabo E91.6
wiedersheimi Tchabal Mbabo E178.1
wiedersheimi Tchabal Gangdaba E188.13
Fig. 1. | Phylogram of the combined analysis of the 16S and 12S rRNA sequence fragments (49 sequences / 960 bp in total). The
star symbol “*” denotes significantly supported nodes. [The values for the internal nodes are as follows (NJ/MP/PP/ML, respec-
tively): 1:(78/61/0.78/73); 2:(95/98/1.00/96); 3:(99/87/0.99/99); 4:(100/98/1.00/100); 5:(100/93/1.00/100); 6:(86/96/1.00/92);
7:(81/89/0.82/86); 8:(97/67/0.56/94); 9:(100/89/0.97/99); 10:(69/83/0.61/63)].
Bonn zoological Bulletin 57 (2): 211-229 OZFMK
Chameleons of the genus 7rioceros from Cameroon 215
longed to a different morphological group. A simple
BLAST search in GenBank, performing a similarity check
of sequences, of the applied 7’ oweni-sequence identified
T. melleri (16S) or T: sternfeldi (12S) to show the high-
est similarity values; both again East African species. Ac-
cording to Townsend & Larson (2002) and Tilbury & Tol-
ley (2009), 7. melleri is related to T. johnstoni. While the
only western 7rioceros (T: feae from Bioko Island, Equa-
torial Guinea) in the study of Tilbury & Tolley (2009) is
placed basal to all other Zrioceros. Similarly, Townsend
& Larson (2002) found that all western 7rioceros (includ-
ing 7: feae) studied by them stand as a sister clade to the
other members of the genus.
Hence, concerning 7: oweni our results support the view
of Pook & Wild (1997) that Trioceros taxa in western Cen-
tral Africa are more closely related to each other than to
T. oweni. The exact position of 7: oweni remains to be as-
sessed in future studies with a wider sampling from the
whole distribution area of this genus.
Lowland-submontane clade
Trioceros camerunensis (Miller, 1909) (Fig. 2B)
In the past Mertens (1964) classified 7) camerunensis as
a subspecies of 7’ montium based on morphological sim-
ilarities and zoogeographical affinity, but Klaver & Bohme
(1992) reclassified the taxon as a valid species. Our mo-
lecular results do support close relationships between 7°
camerunensis and T: montium but also confirmed its full
species status. According to Pook & Wild (1997), 7:
camerunensis 1s more closely related to T. feae (not in-
cluded in our study) than to 7’ montium.
Lowland-submontane clade
Trioceros montium (Buchholz, 1874) (Fig. 2C)
Within the well supported monophyletic 7’ montium-clade,
distinct subclades appear (Fig. 1; Tab. 2, Appendix II).
Buchholz (1874) described T. montium from Bonjongo,
Mt. Cameroon. Later Mertens (1938) described a sub-
species T. montium grafi from Mongonge, on the oppo-
site side of Mt. Cameroon. Klaver & Bohme (1992) re-
garded it only as an aberrant form and moved it in syn-
onymy with the nominate form. Based on dorsal crest
shape, Perret & Mertens (1957) indicated a possible sub-
species from the Manengouba Mts. but, as in 7. m. grafi,
Klaver & Bohme (1992) proved the occurrence of this
character to be more widespread. However, Pook & Wild
(1997) mentioned differences in the courtship livery of 7:
montium between populations. Differences in colouration
are of importance in species recognition and may play a
role in character displacement (Pook & Wild 1997; Rand
Bonn zoological Bulletin 57 (2): 211-229
1961; Wagner et al. 2009b) but further studies on this as-
pect are required. 7rioceros montium inhabits the submon-
tane zone of Mt. Cameroon, Rumpi Hills, Manengouba
Mts. area and parts of the south-western edge of the Ba-
menda Highlands (Gonwouo et al. 2006). At first glance
no morphological characters indicate a separation of pop-
ulations. Hence, we refrain to draw any premature con-
clusions at this point.
Lowland-submontane clade
Trioceros cristatus (Stutchbury, 1837) (Fig. 2D)
A similar situation appears in 7? cristatus and distinct sub-
clades are detectable within this taxon and as in the pre-
ceding case, uncorrected p-distances show only compar-
atively low differences between the clades (Fig. 1; Tab.
2, Appendix II). Stutchbury (1837) described T. cristatus
from Gabon and since then no further subspecies have
been described or taxa synonymised with 7. cristatus. Tri-
oceros cristatus is widespread in the lowland to submon-
tane zone from Nigeria to the Central African Republic,
Gabon and the Republic of the Congo (Klaver & Bohme
1992; Pauwels & Vande weghe 2008). Furthermore, the
species has been reported from Ghana and Togo (see ref-
erences in Klaver & Bohme 1992) but, these localities
must be regarded with caution, as they have not been con-
firmed recently. In contrast to 77 montium the species 1s
more widespread. A more detailed analysis of the overall
distribution must be applied before any conclusions can
be drawn.
Submontane-montane clade
Trioceros quadricornis (Tornier, 1899)-group
(Figs 2E-—G), including Trioceros quadricornis eisen-
trauti (Mertens, 1968) NEW RANK
Molecular results require changes in the former quadri-
cornis-group. Morphological distinctness (body size,
shape of dorsal crest, number and size of rostral horns,
lung morphology) between populations from southern
parts of the Cameroon mountain chain (Mt. Kupe, Manen-
gouba Mts.) and northern parts (Bamenda Highlands to
Obudu Plateau in eastern Nigeria) have already been rec-
ognized by BGhme & Klaver (1981). Uncorrected p-dis-
tance values between the taxa quadricornis and gracilior
(Tab. 2, Appendix II), indicate a very recent split and these
taxa correspond to subspecies. 7. g. gracilior is known
from the Bamboutos Mts, Mbulu Hills, Mt. Lefo, Mt. Oku
and the Obudu Plateau, while 7) g. quadricornis is pres-
ent on Manengouba Mts. and Mt. Kupe (Bohme 1975;
Bohme & Klaver 1981; Gonwouo et al. 2006; Joger 1982;
Klaver & Bohme 1986, 1992).
©ZFMK
216 Michael F. Bare} et al.
—,
Fig. 2. Cameroonian chameleons (in life): A = Trioceros oweni male (Campo region; photo by J.A.M. Wurstner). B = 7. camer-
unensis (Njonji, Mt. Cameroon). C = T. montium male; specimen with an aberrant horn shown (Big Massaka, Rumpi Hills). D =
T. cristatus male (Nkoelon, Campo region). E = 7. g. quadricornis male (Mt. Kupe). F = T. q. gracilior male (Mt. Lefo; photo by
W. Bohme). G = T. q. eisentrauti female (Mt. Rata, Rumpi Hills). H = 7: pfefferi male (Kodmin, Bakossi Mts.).
Bonn zoological Bulletin 57 (2): 211—229 ©ZFMK
Chameleons of the genus Trioceros from Cameroon DG.
We group the morphologically highly distinct taxon 7.
eisentrauti as a distinct subspecies of 7) guadricornis (Fig.
1), a position already indicated by Pook & Wild (1997).
But, while in the latter publication and in our 12S-only
analysis (not shown) eisentrauti is placed as the basal sis-
ter taxon to the two 7! quadricornis subspecies, accord-
ing to our combined results (16S, 12S) this is not the case.
Despite its morphological uniqueness (gular crest formed
of flaps in eisentrauti and a gular crest formed of conical
scales in other 7rioceros taxa), molecular results reveal
close relationships between these three taxa with values
of uncorrected p-distances within intraspecific ranges. Val-
ues of uncorrected p-distances between eisentrauti and T.
q. quadricornis are comparable to values between the 7.
quadricornis subspecies and values are only marginally
higher between eisentrauti and the subspecies T. q. gra-
cilior (Tab. 2, Appendix II). However, the taxa show a dis-
junct distribution with 7 g. quadricornis occurring in the
Manengouba area (see above) and 7! eisentrauti being en-
demic to the Rumpi Hills in western Cameroon (Gonwouo
et al. 2006; Klaver & BOhme 1997). All taxa inhabit pris-
tine montane habitats, 7? g. quadricornis occurring at al-
titudes between 1.800—2.250 maz.s.l., 7. g. gracilior at al-
titudes between 1.800—2.400 ma.s.l. and 7. eisentrauti in
altitudes above 1.150 m a.s.1., respectively (Gonwouo et
al. 2006; Pook & Wild 1997). We have located T. eisen-
trauti on Mt. Rata in the Rumpi Hills only above 1.600
m a.s.l., hence, it is probably even more restricted in its
altitudinal and overall distribution range than previously
indicated. In the original description of 7. eisentrauti
Mertens (1968) had already indicated relatedness to 7.
quadricornis taxa according to body size and shape of the
dorsal and tail crests. Bohme & Klaver (1981) emphasized
the similarities of 7’ g. quadricornis and eisentrauti in
comparison to 7: q. gracilior and remarked that rostral tu-
bercles in eisentrauti might represent reduced rostral
horns, which are present in 7: g. quadricornis (up to two
pairs of rostral horns) and 7. qg. gracilior (up to three pairs
of rostral horns). However, reduction of rostral horns is
also known in T. gq. quadricornis and T. q. gracilior
(Bohme & Klaver 1981; Mertens 1968) and BOhme &
Klaver (1981) assumed that reduced horns represent a
more derived character state. From the genetic point of
view, we are aware that the low genetic differentiation in
mitochondrial DNA might be in some cases caused by in-
trogressive hybridization in the evolutionary history of two
species. However, we believe that the similar overall mor-
phology (body shape and size, shape of the crests) of T.
quadricornis and eisentrauti also further supports our hy-
pothesis of two closely related, but conspecific taxa. Due
to the constant morphological differences between them
and their allopatric distributions we regard the taxa quadri-
cornis and eisentrauti as subspecies of a single species.
Trioceros quadricornis quadricornis (Tornier, 1899)
from the Manengouba area represents the nominate form
Bonn zoological Bulletin 57 (2): 211-229
while the taxon eisentrauti from the Rumpi Hills is giv-
en a new systematic status Trioceros quadricornis eisen-
trauti (Mertens, 1968) NEW RANK. In contrast to the
afore discussed species (7! montium and T. cristatus), any
contact zone between these two allopatric taxa can be ex-
cluded due to their highly restricted altitudinal distribu-
tion. As above, low genetic differences suggest a very re-
cent split presumably connected to the altitudinal range
shifts of the lower-temperature forests up to the mountains
after the end of the Pleistocene Ice Ages (when montane
forests in the tropics expanded to the lower elevations; He-
witt 2004). All three subspecific taxa of 7. guadricornis
could now represent species in statu nascendi.
Submontane-montane clade
Trioceros wiedersheimi (Nieden, 1910)-group
(Figs 3A—-G), including Trioceros perreti (Klaver &
Bohme, 1992) NEW RANK
Further changes are necessary within the former wieder-
sheimi-group. Klaver & Bohme (1992) described the sub-
species 7. w. perreti from Manengouba Mts. Molecular re-
sults however reveal full species status for this taxon, as
the uncorrected p-distances between 7. wiedersheimi pop-
ulations from Manengouba Mts. and populations further
north (Bamenda area, Tchabal Mbabo) are clearly within
the interspecific range of other western Trioceros species
(Tab. 2, Appendix IT). We thus herein elevate the taxon
to the full species rank: Trioceros perreti (Klaver &
Bohme, 1992) NEW RANK. The present distribution of
T: perreti covers the Manengouba Mts. and the Bakossi
Mts. (Euskirchen et al. 2000; Gonwouo et al. 2006).
Regarding the former nominate 7’ w. wiedersheimi, mo-
lecular and morphological results lead to recognition of
two distinct clades with uncorrected p-values within in-
terspecific range of this genus (Tab. 2, Appendix II). For-
merly, 7’ w. wiedersheimi has been thought to occur in
Cameroon north of the Manengouba Mts. (inhabited by
T. perreti (Klaver & Bohme, 1992), see above). It has been
found along the Cameroon mountain chain (Bamboutos
Mts., Mbulu Hills, Mt. Lefo, Mt. Mbam, Mt. Oku and Mt.
Tchabal Mbabo) and in eastern Nigeria (Gotel Mts., Mam-
billa Plateau and Obudu Plateau), where it inhabits mon-
tane savannas and grasslands between 1400 and 2450 m
a.s.l. (BOhme & Nikolaus 1989; Chirio & LeBreton 2007;
Dunger 1967; Gonwouo et al. 2006; Herrmann et al. 2006;
Klaver & Béhme 1992). Nieden’s (1910) description of
T. wiedersheimi is based on two specimens, a female from
Genderogebirge (=Tchabal Mbabo) and a subadult male
from the village Tsch’a (Bekom), Bamenda area. In the
course of describing 7. w. perreti, Klaver & Bohme (1992)
designated the female specimen as lectotype and conse-
quently restricted the type locality to the Genderogebirge
©ZFMK
218 Michael F. Bare et al.
A
re
Fig. 3. Cameroonian chameleons (in life): A = Trioceros wiedersheimi male (Mt. Tchabal Gangdaba). B = T. perreti male (Kod-
min, Bakossi Mts.). C = T. serratus male (Kedjom Keku = Big Babanki, Bamenda Highlands). D = T. serratus female (Kedjom
Keku = Big Babanki, Bamenda Highlands). E = Male neotype of 7. serratus (in alcohol; MNHN 2007.1494; Belo, Mt. Oku). F =
Illustration of 7? serratus after Mertens (1922; “Sitidkamerun”’). G = Male neotype of 7. serratus (in life; MNHN 2007.1494, Be-
lo, Mt. Oku) in situ.
Bonn zoological Bulletin 57 (2): 211-229 OZFMK
Chameleons of the genus Trioceros from Cameroon 219
(=Tchabal Mbabo). As one of the uncovered molecular
clades contains specimens from Tchabal Mbabo, topotyp-
ic material, thus this clade should correspond to 7. wieder-
sheimi. The occurrence of ZT. wiedersheimi on Tchabal
Gangdaba has already been assumed in the past (Chirio
& LeBreton 2007; Klaver & B6hme 1992) and we can
confirm its occurrence on this mountain range. Thereafter,
the species is known from the northernmost parts of its
former assumed distribution, while populations of the
southern molecular clade from the Bamenda Highlands,
Mt. Mbam, and Mt. Oku represent a distinct taxon. It is
also very likely that this clade covers populations from the
Mbulu Hills, Mt. Lefo and the Obudu Plateau in south-
ern Nigeria as this would correspond to a bordering range
from other studies (Gonwouo et al. 2006). Solely one lo-
cality in direct proximity north of the Manengouba Mts.
(see map in Gonwouo et al. 2006) appears uncertain, as
T: perreti has been regarded as restricted to the mountain
range, but the specimen was not available to us for this
study.
Mertens (1922) described Chamaeleon serratus from
“Stidkamerun” (= South Cameroon, Fig. 3F), being most
similar to T. wiedersheimi, but differing by size, promi-
nence of the temporal cristae and course of the lateral
cristae (Fig. 3E). The species has been later synonymized
with 7: wiedersheimi by Mertens himself (1940; see be-
low). Klaver & Bohme (1992) argued that 7. serratus is
a synonym of 7: wiedersheimi, as the original description,
especially the low number of scales on the scalloped dor-
sal ridge, is not consistent with 7. perreti from Manengou-
ba Mts. A comparison with the type specimen of 7 ser-
ratus was not possible, as the type specimen was proba-
bly destroyed during the Second World War (H. Wermuth
16.4.1979 in litt., in Klaver & Bohme 1992).
Mertens (1922) rightly suggested that 7’ wiedersheimi 1s
morphologically the most similar species to 7. serratus,
but obviously he only compared his material with
Nieden’s (1910) original description and not with the type
specimen, as he only cited the original sections for com-
parison. Beside the characters cited above, Mertens (1922)
mentioned that no additional distinct characters like the
shape of the dorsal crest, which is at the origin of the spe-
cific name (Mertens 1968), are given in Nieden’s (1910)
description. [Remark: Nieden (1910) stated that a dorsal
crest is lacking but, a dorsal midline is formed of two rows
of tubercle scales which are separated in groups of 3-4
scales in the male specimen from the Bamenda region].
Later, Mertens (1940) reported on a collection delivered
by M. Kohler including chameleons from the Bamenda
Highlands (four males + two females) and concluded that
T. serratus is in fact a junior synonym of T. wiedershei-
mi. His conclusion was based on the fact that males of the
Bonn zoological Bulletin 57 (2): 211-229
new material corresponded to the “paratypoid” (=
paratype) of 7 serratus, while females are consistent with
the female cotype (=syntype) of 7. wiedersheimi and fi-
nally he recognized that the prominence of the lateral and
temporal cristae is subject to individual variation. In a sub-
sequent publication on material collected by Eisentraut at
Lake Oku and Lake Manengouba, Mertens (1968) con-
firmed his former statement and remarked that males in
T. wiedersheimi also do possess a serrated dorsal crest,
while the dorsal crest is straight and simple in females.
With the exception of Lake Manengouba (recognized as
distinct by Klaver & Bohme 1992), all localities of the ma-
terial examined by Mertens belong to the newly discov-
ered southern clade.
Our morphological analysis of material throughout the dis-
tribution range of the former taxon T. w. wiedersheimi re-
vealed that distinguishing characters chosen by Mertens
(1922) are hard to assign to members of one clade, as
many characters are present in members of both clades
(lack of heel spur, lack of occipital lobes, etc.) separating
them from other taxa. Of the three main characters given
by Mertens (1922), two of them seem to be inapplicable.
According to Mertens (1922): (a) T. serratus grows larg-
er than 7) wiedersheimi, but four of ten males from Tch-
abal Mbabo and the Gotel Mts. (= 7? wiedersheimi) pos-
sess a larger body length than the largest member of the
southern clade, and the largest female also belongs to T.
wiedersheimi; (b) temporal cristae are distinct in 7. wieder-
sheimi and indistinct in 7 serratus, but this character
varies within both clades (Fig. 4), which was already men-
tioned for Bamenda populations by Mertens (1940); and
(c) Mertens (1922) differentiated the course of the later-
al cristae (in front of the eye first running along the eye
then in a weaker slope to the tip of the snout in 7’ wieder-
sheimi, in contrast to an even slope in direction to the tip
of the snout in 7! serratus) and this character is clearly
more applicable to specimens belonging to the southern,
previously unrecognized clade (Fig. 4). Nonetheless, with
just a few specimens of each clade a determination on this
character alone is difficult. At last, the name-giving char-
acter, a serrated dorsal crest is also present in males of both
clades. The number of scale rows forming the crenulation
is consistent in both clades (being formed of up to three
rows of scales) and the extent of crenulation along the dor-
sum and base of tail also varies in both clades. Accord-
ing to Mertens (1922) each cusp of the crenulation is 3
mm high and 4.5 mm long, but only in one very large spec-
imen of 7. wiedersheimi a comparable size has been
reached, while specimens of similar size to Mertens’
(1922) specimens possess smaller cusps in both clades.
The given type locality “Stidkamerun” does not allow any
direct localization of 7: serratus. Moreover, the subadult
male paralectotype of 7. wiedersheimi originates from the
Bamenda area (part of the southern clade) and might have
OZFMK
220 Michael F. Barej et al.
Fig. 4. | Heads in lateral view. Row 1-3: Trioceros wiedersheimi (from left to right): ZMB 21873 female (lectotype), ZFMK 75744
female, ZFMK 68943 male, ZFMK 75740 male, ZMB 21857 male, ZMB 74805 female, ZFMK 78714 male, MNHN 2005.2753
male, NMP6V 74112 male, ZFMK 75745 female, MHNG 1544.001 male, MHNG 1544.002 male. Row 4—6: T. serratus (from left
to right): MNHN 2007.1494 male (neotype), MNHN 2007.1465 female, NMP6V 74104 male, MHNG 1365.023 female, ZSM 13.1925
subadult male, MNHN 2007.1464 male, ZFMK 5801 male, MNHN 2007.1463 male, MNHN 2007.1461 female, MHNG 1365.024
female, MHNG 1010.049 male, ZFMK 5800 female.
Bonn zoological Bulletin 57 (2): 211—229 ©ZFMK
Chameleons of the genus Trioceros from Cameroon 221
understandably mistaken as part of the distribution of 7.
wiedersheimi. The distribution of the southern clade cov-
ers the main part of former distribution of 7: wiedershei-
mi and makes it more plausible to be termed “Siid-
kamerun” (South Cameroon) in comparison to the Tcha-
bal Mbabo area. Of Mertens (1922), most informative
characters, the only reasonably useful for the recognition
of T. serratus is the course of the lateral cristae. A course
corresponding to Mertens’ (1922) information is present
in members of the southern clade.
According to Article 75 of the International Code of Zo-
ological Nomenclature (ICZN 1999) a neotype is required
when no name-bearing types are believed to be extant and
it is necessary to define a taxon objectively. In our case,
a designation of a neotype is necessary because the holo-
type is lost (H. Wermuth 16.IV.1979 in litt., in Klaver &
Bohme 1992; A. Schliter, herpetological curator of the
SMNS, in litt. 8.I11.2010) and the taxon requires unam-
biguous clarification of its taxonomic status. The type lo-
cality of the taxon is now set as the collecting locality of
the neotype (Article 76 in ICZN 1999). Hence, we here
revalidate 7. serratus and provide a description of the neo-
type at the end of this section.
Submontane-montane clade
Trioceros pfefferi (Tornier, 1900) (Fig. 2H)
According to Townsend & Larson (2002) T: pfefferi is
related to (what these authors termed) 7’ quadricornis and
T: wiedersheimi, but more closely to the latter species.
While the 12S-only analysis of Pook & Wild (1997) also
suggested a grouping of 7: pfefferi and T: wiedersheimi,
an unambiguous position of this rare taxon was not
possible in our analysis with the combined 16S+12S-gene
fragments (see Fig. 1). Further, because of the lack of a
working 12S sequence for the sample of 7: pfefferi that
we used, we used a chimera-sequence consisting of the
original 12S data as published by Pook & Wild (1997; only
available in the original publication, not in GenBank) and
our new 16S data of another specimen. Therefore, all that
can be said for now is that 7: pfefferi is more closely
related to the taxa of the hornless 7. wiedersheimi-complex
than to 7’ montium or T. quadricornis, which share
morphological characters like horns with 7: pfefferi. It is
also interesting to underline that the horned species, 7.
montium, T. quadricornis and T. pfefferi, do not form a
monophyletic clade, and thus, horns evolved several times
in the evolutionary history of the western Jrioceros species
group.
Regarding the overall distribution of 7. pfefferi, this
species shows a similar distribution pattern to two other
species groups (a) 7. perreti—T. serratus — T: wiedershei-
Bonn zoological Bulletin 57 (2): 211-229
mi and (b) T. qg. quadricornis —T. q. gracilior. Both groups
show a rough distribution with one taxon in the Manen-
gouba area and a second one in the Bamenda Highlands
(additionally a third in the northernmost parts in the case
of T. wiedersheimi). As in both these groups former al-
lopatric populations have been recognized as valid taxa,
the recently discovered populations of 7. pfefferi from
Mbulu Hills and Ediango (see Gonwouo et al. 2006)
should be compared to southern populations in future stud-
les, especially as the species also inhabits
submontane/montane altitudes between 1100-1800 m
a.s.l. and might show a disjunct distribution, as well.
Noteworthy is, that present distribution data reveal a dis-
junct partitioning of montane areas in the Cameroon
mountain chain with related taxa (with the exception of
T. pfefferi, but see above) but apparently the highest peak
(Mt. Cameroon) does not posses an endemic montane tax-
on. Only the submontane 7: montium is present on Mt.
Cameroon and elevations further north, but this taxon re-
quires further studies to understand a potential distribu-
tional separation (see above).
Designation of neotype and _ redescription of
Chamaeleon serratus Mertens, 1922 (now considered
as a member of the genus T7rioceros sensu Tilbury &
Tolley 2009)
Holotype (lost). Chamaeleon serratus Mertens (1922),
Zool. Anz., 54: 191. Mus. Stuttgart, Nr. 4640 (male), pro-
bably destroyed during the Second World War (H. Wer-
muth 16.4.1979 in litt., in Klaver & Bohme 1992; A.
Schliiter, herpetological curator of the SMNS, in litt.
8.3.2010), type locality: ,,Stidkamerun™.
Neotype. MNHN 2007.1494, adult male with everted
hemipenes. Collected by Ivan Ineich on 9 May 2007 on
a palm tree near road border of the road from Anyajua to
Belo, close to Belo, Mt. Oku, Cameroon. Coordinates: N
06°10°32” E 10°21°09” (Lat.: 6.17547°, Lon.: 10.35244),
1339 m (4394 feet) a.s.].
Type locality. Belo, Mt. Oku, Cameroon
Distribution. Cameroon, Nigeria
Additional material examined (Appendix I)
Diagnosis. 7rioceros serratus differs from all other 77i-
oceros except T. wiedersheimi and T. perreti by a crest
formed by the canthi rostrales merging above the snout,
forming a depression between the tip of the snout and the
merged crest. Moreover, it can be distinguished from 7:
q. eisentrauti by the absence of gular flaps (Fig. 2D), from
T. montium, T. oweni, T. q. quadricornis, T: q. gracilior
©ZFMK
NO
i)
tO
and 7: pfefferi by the absence of rostral appendages in male
specimens (Figs 2A, 2C, 2E-F, 2H) and from 7:
camerunensis and T. cristatus by the presence of a gular
crest (Figs 2B, 2D).
Trioceros serratus can be differentiated from 7. wieder-
sheimi by a combination of the following characters: 7.
serratus tends to stay smaller than 7? wiedersheimi and the
tail length / body length ratio is lower in T. serratus (Tab.
3, Appendix II): total body length, 77 wiedersheimi (max.
total length in males: 208 mm; in females: 172 mm) grow-
ing larger than 7. serratus (max. total length in males 179
mm; in females 158 mm), but this observation is not sta-
tistically significant (in males: p > 0.05 N,;,,=10,
N;,=27; in females: p > 0.05 Ny,,=8 N;,=15); mean tail
length / body length ratio is significantly higher in 7:
wiedersheimi (in males: p < 0.05 Ny, =10, Nr, =27; in fe-
males: p < 0.05 Ny, =8 N;,=15); the mean numbers of
flank scales at midbody, although values overlap, the num-
ber of flank scales at midbody is significantly higher (p<
0.01) in 7. serratus (N= 44; range: 56—76, mean: 66) than
in T: wiedersheimi (N= 19; range: 57-68, mean: 62); num-
ber of scales between the eye and the end of the head is
significantly higher (p < 0.001) in 7) serratus (N= 44;
range: 6-11, mean: 8) than in 7) wiedersheimi (N= 19;
range: 5—9, mean: 7) and single scales tend to be distinct-
ly larger in 7. wiedersheimi (Fig. 4); the course of the lat-
eral cristae in front of the eye, decreases almost steadily
from the eye to the tip of the snout in 7! serratus, while
it first runs along the eye and then, from a point approx-
imately at the middle of the eye, in a lower slope to the
tip of the snout in 7. wiedersheimi.
Trioceros serratus can be differentiated from 7: perreti by
a combination of the following characters: total body
length of similar size but, although largest specimens be-
long to T. serratus, the mean total length is slightly high-
er in 7. perreti (in males: p > 0.05 Ny, =25, Ny, =27; in
females: p > 0.05 Ny, =10, N;,=15); mean tail length /
body length ratio is significantly higher in 7. serratus in
males (p < 0.05 N;,,=25, Ny, =27) lower, but not signif-
icantly, in females (p > 0.05 N7,=10 N;,=15); mean
numbers of flank scales at midbody, although values clear-
ly overlap, the number of flank scales at midbody is sig-
nificantly lower (p < 0.001) in 7! serratus (N= 44; range:
56-76, mean: 66) than in 7. perreti (N= 36; range: 65-86,
mean: 74; in one single specimen even 93); number of
scales between the eye and the end of the head is signif-
icantly lower (p < 0.001) in 7. serratus (N= 44; range:
6-11, mean: 8) than in 7! perreti (N= 37; range: 9-15,
mean: 11), scales behind the eyes are of similar size to
flank scales in T. perreti and slightly enlarged in 7. ser-
ratus; maximum length of gular crest is significantly high-
er in T. serratus than in T: perreti (in males: p < 0.001
Nz) =25, Ny,=27; i females: p < 0.001 N;,=12,
Bonn zoological Bulletin 57 (2): 211—229
Michael F. Barej et al.
N;,=!7); length of mouth gap / distance mouth gap to tip
of helmet ratio is significantly higher in males of 7: ser-
ratus (p < 0.05; Np, =25, Ny, =27), while the value is not
significant in females (p > 0.05; Ny, =12, Ny. =17); dor-
sal part of the casque flat in 7 serratus (and T: wieder-
sheimi) and convex in T. perreti (BOhme & Klaver 1992).
For morphometrics see Tab. 3, Appendix II.
Description of the neotype. Adult male in good condi-
tion; body shape slender, laterally compressed; body
length (measured from snout tip to cloaca) 83.0 mm; tail
length 76.0 mm; tail base swollen and both hemipenes
everted (Fig. 3F); vertical eye diameter 7.0 mm; canthus
parietalis formed of 7 scales, measuring 6.8 mm (few ad-
ditional slightly rough and ridged scales cranially of the
parietal crest); distance snout tip to tip of helmet 24.3 mm;
rostral crest merging above snout tip; rostral appendages
absent; lateral and temporal crest distinct, both crests fus-
ing posteriorly; occipital lobes absent; length of mouth gap
12.3 mm, mouth slightly opened; throat with fine longi-
tudinal grooves between scale rows; gular crest present,
formed of 24 scales, max. length of gular crest scale 1.7
mm, gular crest passing into ventral crest; lateral head
scales behind eye enlarged in comparison to flank scales;
lateral body scalation subhomogeneous but with inter-
posed enlarged scales; dorsal crest present, serrated,
formed out of 2-4 scales, diminishing in height caudally,
scales of dorsal crest larger than flank scales; scales on
extremities and tail (laterally and ventrally) of similar size
as on body; fingers terminate in a single claw; hind feet
without tarsal spurs.
Colouration in live (Fig. 3G): general body colouration
greenish, enlarged scales on flanks pale brown, lateral and
upper side of head pale bluish, upper eye border bright yel-
low, gular region green, upper most part of flanks and low-
er flank pale blue.
Colouration in alcohol (Fig. 3E): head and body dark grey-
ish, gular crest of the same colour as body, ventral crest
pale grey; sole of foot and palm of hand whitish; everted
hemipenes whitish.
Variation. The number of interposed enlarged scales on
flanks vary in number per line and also in number of lines.
Length of gular crest scales and their number is quite vari-
able (Tab. 3, Appendix I). Comparing the sexes, males
show a higher body length — tail ratio than females and
longer scales forming the gular crest (Tab. 3, Appendix
II). Females generally possess a dorsal ridge, the dorsal
midline is slightly serrated in one specimen (MNHN
1998.0415) forming an indistinctly serrated dorsal crest.
Colouration. The general ground coloration tends to be
greenish or brownish. Enlarged scales on the flanks tend
©ZFMK
Chameleons of the genus Jrioceros from Cameroon 223
toward being brown or blue and more conspicious (Figs
3C—D). A bright stripe of differing colouration runs from
the anterior part of the eye (or even starts in front of the
eye) and splits into rays of colour on the eyelid; one of
them running backwards along the temporal crest or be-
tween the temporal and lateral crest (Figs 3C, G). As in
T. wiedersheimi the venter is brighter than the flanks and
is pale blue or a lighter green / brown in living specimens
(Fig. 3C). Blue colouration may be scattered around the
mouth gap, on the top of the head, and on the flanks. The
ventral line is whitish. In alcohol colourations fade away
and specimens turn either pale grey-bluish (leaving some
of the brighter rays on the eye visible) or turn dark and
colours disappear almost completely.
Distribution. The species is known to occur in Cameroon
and Nigeria. Within Cameroon it inhabits montane savan-
nahs in the Bamenda Highlands and Mt. Mbam, and in
Nigeria it has been reported from the Obudu Plateau
(Bohme 1975; Akani et al. 2001). In contrast, reports from
the Gotel Mts in Nigeria (BOhme & Nikolaus 1989) can
be referred to T. wiedersheimi.
Genetics. The genetic comparison for the uncorrected p-
distances of the combined mitochondrial 16S+12S rRNA
fragments (Tab. 2, Appendix II) with the two morpholog-
ically most similar species 7: wiedersheimi and T: perreti
gave the following results: interspecific comparison be-
tween 7) serratus and T. wiedersheimi ranged between
3.22% 4.08%, while the intraspecific variation within 7°
serratus was much lower at 0.00%-—0.42% (N= 12). The
interspecific difference between 7. serratus and T. perreti
ranges from 4.33%—4.86%, while those between the taxa
T: perreti and T. wiedersheimi reach 3.74%-4.13%.
Natural history remark: Six gravid females contained
the following numbers of eggs: 7, 8 (x2), 9 (x2) and 11.
Size of measured eggs (N=10) ranges between 13.0—15.0
x 7.7—8.3 mm. In contrast, Angel (1940) reported ten eggs
in a gravid female from the Mt. Bamboutos of 8 x 7 mm
in size, which have been most probably not fully devel-
oped.
Acknowledgements. The study was accomplished under the
conditions of the research, collecting and export permits issued
by the Cameroonian Ministry of Forestry and Wildlife and Min-
istry of Scientific Research and Innovation in 2007 and 2009
(Nos. 049/MINRESI/B00/C00/C10/C12; 0836/PRBS/MIN-
FOF/SG/DFAPSDVEF/SC; 0613/PRBS/MINFOF/SG/DFAP/
SDVEF/SC; 0132/MINRESI/B00/C00/C10/C13; 1010/PRBS
/MINFOF/SG/DFAP/SDVEF/SC). The senior author would al-
so like to thank the Federal Agency for Nature Conservation
(BEN) for the import permits (No. E-0997/08, No. E-03454/09).
Thanks are also given to Laurent Chirio, Marcel Talla Kouete,
Ivo Melle Ngwese, Samuel Wanji and Julia A. M. Wurstner for
assistance in fieldwork, and/or logistics, and/or additional tis-
Bonn zoological Bulletin 57 (2): 211-229
sue samples or specimens. Jean Mariaux provided the 16S se-
quence for 7: pfefferi. We thank Philipp Wagner (ZFMK) for his
help regarding the correct interpretation of some specific rules
of the ICZN code. Thanks to Andreas Schliiter and Axel Kwet
(both SMNS) for the effort to get information about A. Diehl
and his collection and to Frank Tillack (ZMB) for fruitful dis-
cussions. II and NLV work was supported by the Agence Na-
tionale de la Recherche Biodiversity Project, Iles Forestic¢res
Africaines, IFORA, 2006-2009. Field work of MFB was sup-
ported by the Alexander Koenig Stiftung. VG is thankful to
Ernest Vunan (SATEC, Big Babank1) for his kind assistance and
hospitality. The work of VG was supported by a grant from the
Ministry of Education, Youth and Sports of the Czech Repub-
lic (No. LC06073; Biodiversity Research Centre) and grants IRP
IAPG AVO0Z 50450515 and MK00002327201.
REFERENCES
Akani GC, Ogbalu OK, Luiselli L (2001) Life-history and eco-
logical distribution of chameleons (Reptilia, Chamaeleonidae)
from the rain forests of Nigeria: conservation implications.
Animal Biodiversity and Conservation 24: 1—15
Angel F (1940) Reptiles et amphibiens recueillis au Cameroun
par la Mission P. Lepesme, R. Paulian et A. Villiers (3° note).
Bulletin du Muséum National d’Histoire Naturelle 12:
390-399
Bohme W (1975) A montane chameleon new to Nigeria. The Ni-
gerian Field 40: 125—129
Boéhme W, Klaver C (1981) Zur innerartlichen Gliederung und
zur Artgeschichte von Chamaeleo quadricornis Tornier, 1899
(Sauria: Chamaeleonidae). Amphibia-Reptilia 10: 313-328
Bohme W, Nikolaus G (1989) Herpetological specimens from
the Gotel Mountains and Mambilla Plateau, Nigeria. Pp. 28—
30 in: Dowsett RJ (ed.) A preliminary natural history survey
of Mambilla Plateau and some lowland forests of eastern Ni-
geria. Tauraco Research Report
Buchholz R (1874) Bemerkungen tiber die im Cameroongebiet
vorkommenden Arten von Chamaeleonen. Monatsbericht der
k6niglich preussischen Akademie der Wissenschaften zu Ber-
lin: 77-89
Chirio L, LeBreton M (2007) Atlas des reptiles du Cameroun.
Muséum national d’Histoire naturelle, IRD editions, Paris
Dunger GT (1967) The lizards and snakes of Nigeria. Part 1 The
chameleons of Nigeria. The Nigerian Field 32: 53-73
Euskirchen O, Schmitz A, Bohme W (2000) Zur Herpetofauna
einer montanen Regenwald-region in SW-Kamerun (Mt. Kupe
und Bakossi-Bergland). IV. Chamaeleonidae, biogeographis-
che Diskussion und Schutzmafinahmen. herpetofauna 22:
21-34
Gonwouo NL, LeBreton M, Wild C, Chirio L, Ngassam P,
Tchamba MN (2006) Geographic and ecological distribution
of the endemic montane chameleons along the Cameroon
mountain range. Salamandra 42: 213-230
Guindon S, Gascuel O (2003) A simple, fast, and accurate al-
gorithm to estimate large phylogenies by maximum likelihood.
Systematic Biology 52: 696-704
Hall TA (1999) BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symposium Series 41: 95—98
Hammer @, Harper DAT, Ryan PD (2001) PAST: Paleontolog-
ical statistics software package for education and data analy-
sis. Palaeontologia Electronica 4: 1—9
©ZFMK
224 Michael F. Barej et al.
Herrmann H-W, Bohme W, Euskirchen O, Herrmann PA,
Schmitz A (2005) African biodiversity hotspots: the reptiles
of Mt. Nlonako, Cameroon. Revue Suisse de Zoologie 112:
1045-1069
Herrmann H-W, Schmitz A, Herrmann PA, B6hme W (2006)
Amphibians and Reptiles of the Tchabal Mbabo Mtns,
Adamaoua Plateau, Cameroon. Bonner zoologische Beitrage
55: 27-35
Hewitt GM (2004) Genetic consequences of climatic oscillations
in the Quaternary. Philosophical Transactions of the Royal So-
ciety London B 359: 183-195
Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian in-
ference of phylogenetic trees. Bioinformatics 17: 754-755
International Commission on Zoological Nomenclature (ICZN)
(1999) International Code of Zoological Nomenclature.
Fourth Edition. The International Trust for Zoological
Nomenclature, c/o The Natural History Museum, Cromwell
Road, London, SW7 5BD UK.
Joger U (1982) Zur Herpetofaunistik Kameruns (II). Bonner zo-
ologische Beitrage 33: 313-324
Klaver C, Bohme W (1986) Phylogeny and classification of the
Chamaeleonidae (Sauria) with special reference to hemipenis
morphology. Bonner Zoologische Monographien 22: 1-64
Klaver C, Bohme W (1992) The species of the Chamaeleo crista-
tus group from Cameroon and adjacent countries, West Africa.
Bonner zoologische Beitrage 43: 433-476
Klaver C, Bohme W (1997) Chamaeleonidae. Walter de Gruyter
& Co, Berlin, New York.
Kocher TD, Thomas WK, Meyer A, Edwards SV, Paabo S, Vil-
lablanca FX, Wilson AC (1989) Dynamics of mitochondrial
DNA evolution in animals: Amplification and sequencing with
conserved primers. Proceedings of the National Academy of
Sciences, USA 86: 6196-6200
Mariaux J, Lutzmann N, Stipala J (2008) The two-horned
chamaeleons of East Africa. Zoological Journal of the Linnean
Society 152: 367-391
Mertens R (1922) Ein neues Chamaleon aus Kamerun. Zoolo-
gischer Anzeiger 54: 191-193
Mertens R (1940) Zur Herpetologie Kameruns und Deutsch-Ost-
afrikas. Zoologischer Anzeiger 131: 239-250
Mertens R (1964) Die Reptilien von Fernando Poo. Bonner zoo-
logische Beitrage 15: 211-238
Mertens R (1968) Zur Kenntnis der Herpetofauna von Kame-
run und Fernando Poo. Bonner zoologische Beitrage 19: 69—
84
Necas P (2004) Chameleons — Nature’s hidden jewels. 2"4 re-
vised and updated edition. Edition Chimaira
Nieden F (1910) Neue Reptilien und Amphibien aus Kamerun.
Archiv ftir Naturgeschichte 1: 234-246
Palumbi SR, Martin A, Romano S, McMillan WO, Stice L,
Grabowski G (1991) The simple fool’s guide to PCR. Depart-
ment of Zoology and Kewalo Marine Laboratory, Hawaii
Pauwels O, Vande weghe JP (2008) Reptiles du Gabon.
Smithonian Insitution.
Perret J-L, Mertens R (1957) Etude d’une collection herpétolo-
gique faite au Cameroun de 1952 a 1955. Bulletin de |’ Insti-
tut Francais d’Afrique Noire. Série A 19: 548-601
Pook CE, Wild C (1997) The phylogeny of the Chamaeleo (Trio-
ceros) cristatus species-group from Cameroon inferred from
Bonn zoological Bulletin 57 (2): 211—229
sequencing of the mitochondrial 12S ribosomal RNA gene:
evolutionary and palaeobiogeographic implications. Pp. 297—
306 in: Bohme W, Bischoff W, Ziegler T (eds.) Herpetologia
Bonnensis SEH, Bonn
Rand AS (1961) A suggested function of the ornamentation of
East African forest chameleons. Copeia 1961: 411-414
Reeder TW (2003) A phylogeny of the Australian Sphenomor-
phus group (Scincidae: Squamata) and the phylogenetic place-
ment of the crocodile skinks (7ribolonotus): Bayesian ap-
proaches to assessing congruence and obtaining confidence
in maximum likelihood inferred relationships. Molecular Phy-
logenetics and Evolution 27: 384-397
Schmitz A, Ineich I, Chirio L (2005) Molecular review of the
genus Panaspis sensu lato (Reptilia: Scincidae) in Cameroon,
with special reference to the status of the proposed subgen-
era. Zootaxa 863: 1-28
Stutchbury S (1837) Description of a new species of the genus
Chamaeleo. Transactions of the Linnean Society of London
17: 361-362 + Plate X
Swofford DL (2002) PAUP”. Phylogenetic Analysis Using Par-
simony (“and Other Methods). Version 4.0b10. Sinauer As-
sociates, Sunderland, Massachusetts, USA
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins
DG (1997) The ClustalX windows interface: flexible strate-
gies for multiple sequence alignment aided by quality analy-
sis tools. Nucleic Acids Research 24: 4876-4882
Tilbury CR (2010) Chameleons of Africa — An Atlas — Includ-
ing the chameleons of Europe, the Middle East, and Asia. Chi-
maira, Frankfurt am Main.
Tilbury CR, Tolley KA (2009) A re-appraisal of the systemat-
ics of the African genus Chamaeleo (Reptilia:
Chamaeleonidae). Zootaxa 2079: 57-68
Townsend T, Larson A (2002) Molecular phylogenetics and mi-
tochondrial genomic evolution in the Chamaeleonidae (Rep-
tilia, Squamata). Molecular Phylogenetics and Evolution 23:
22-36
Uetz P, Hallermann J (2010) The TIGR Reptile Database, JCVI,
Rockville. Available from: http://www.reptile-database.org/
(July 20th, 2010).
Wagner P, BGhme W, Pauwels OSG, Schmitz A (2009a): A re-
view of the African red-flanked skinks of the Lygosoma fer-
nandi (Burton, 1836) species group (Squamata: Scincidae) and
the role of climate change in their speciation. Zootaxa 2050:
1-30
Wagner P, Barej M, Schmitz A (2009b) Studies on African Aga-
ma VII. A new species of the Agama agama-group (Linna-
eus, 1758) (Sauria: Agamidae) from Cameroon & Gabon, with
comments on Agama mehelyi Tornier, 1902. Bonner zoologi-
sche Beitrage 56: 285-297
Werner F (1902) Prodromus einer Monographie der Chamale-
onten. Zoologische Jahrbticher (Abteilung fur Systematik,
Okologie und Geographie der Tiere) 15: 295-460 + Plates
XV-XXVII
Received: 30. VII.2010
Accepted: 18.X.2010
©OZFMK
Chameleons of the genus Trioceros from Cameroon 225
Appendix I
List of examined specimens
Trioceros serratus (Mertens, 1922)
MNHN 2007.1494 (male neotype), Cameroon, Mt. Oku,
border of the road from Anyajua to Belo (near Belo, at low
altitude), date 9.V.2007, coll. I. Ineich; MHNG 964.037
(male), Cameroon, Bamenda, Kishong, 1.II.1939, coll. J.-
L. Perret & R. Mertens; MHNG 1010.049-50 (2 males),
Cameroon, Bafoussam, Bangwa, 1959, coll. J.-L. Perret;
MHNG 1365.010 (male), Cameroon, Foumban, Mt.
Nkogam, III.1969, coll. J.L. Amiet; MHNG 1365.019
(male), Cameroon, Bamiléké, Foto, X1I.1972, coll. J.L.
Amiet; MHNG 1365.023-24 (2 females), Cameroon,
Dschang, Foto, XI.1972, coll. J.L. Amiet; MNHN
1997.3642 (male), Cameroon, Oku village, V.1997, coll.
L. Chirio; MNHN 1998.0415, Cameroon, Lake Oku, al-
titude 2200 m, 7.VI.1998, coll. L. Chirio; MNHN
1998.0416-19, Cameroon, Mt. Oku, altitude 2000-2500 m,
25.V1.1998, coll. L. Chirio; MNHN 1998.0425, MNHN
1998.0429, Cameroon, Mt. Oku, altitude 2000-2500 m,
25.V1.1998, coll. L. Chirio; MNHN 2005.2781-2787,
MNHN 2005.2900 (5 males + 3 females), Cameroon, Mt.
Oku, Simonkuh, 10.572°E/6.234°N, altitude 2109 m,
8.VII.2002, coll. Programme CamHerp; MNHN
2005.2788 (male), Cameroon, Oku village, 19.1V.2000, al-
titude 2000 m, 10.505°E/6.202°N, coll. Programme
CamHerp; MNHN 2007.1461-64 (2 males + 2 females),
Cameroon, Mt. Oku area, around village of Elak Oku,
6.2441°N/10.5076°E, altitude 6474 ft, 6.V.2007, coll. I.
Ineich & N. Lhermitte-Vallarino; MNHN 2007.1465
(male), Cameroon, Mt. Oku_ area,’ Lake,
6.2019°N/10.4609°E, altitude 7456 ft, 8.V.2007, coll. I.
Ineich & N. Lhermitte-Vallarino; NMUP6V 74104 (male),
Cameroon, Kedjom Keku (= Big Babanki), Bamenda
Highlands, 6°06.968’N 10°15.760’E, 1290 m a.s.l.,
9.X1.2009, coll. V. Gvozdik; ZFMK 5798-5801 (2 males
+2 females), Cameroon, Lake Oku, 20-30.1.1967, coll. M.
Eisentraut; ZFMK 15283 (male), Cameroon, Mt. Lefo, 5.-
11.X.1974, coll. W. Bohme & W. Hartwig; ZFMK 18105-
6, ZFMK 18108 (male + 2 females), Cameroon, Mezam,
Bafout, 1975-76, coll. P. Shu Mfosono; ZMB 21860 (fe-
male), Cameroon, Bamenda, no date; ZMB 24909 (male),
Cameroon, Bamenda, coll. Adametz; ZSM 13/1925
(male), Cameroon, Tsch’a Bekom, Bamenda District, no
date, coll. Glauming.
Trioceros perreti (Klaver & Bohme, 1992)
MHNG 920.068-9 (male paratype + female paratype),
MHNG 964.038 (female paratype), MHNG 965.054 (male
paratype), MHNG 1010.052 (male holotype), MHNG
1010.053 (male paratype) Cameroon, Manengouba Mts.,
1956, coll. J.-L. Perret; MHNG 1365.011 (male paratype),
Cameroon, Manengouba Mts., Mwandong, 26.11.1972,
Bonn zoological Bulletin 57 (2): 211-229
coll. J.L. Amiet; MHNG 1365.012-18 (5 male paratypes
+ 2 female paratypes), Cameroon, Manengouba Mts.,
111.1973, coll. J.L. Amiet; MNHN 2007.1455-57 (3 fe-
males), Cameroon, Manengouba Mts., around Mouame-
na village, 9.796°E/4.984°N, altitude 4450 ft, 28.1'V.2007,
coll. I. Ineich & N. Lhermitte-Vallarino; MNHN
2007.1458-60 (2 males), Cameroon, Manengouba Mts.,
around Mouabi village, 5.0613°N/9.8155°E, altitude
5283 ft, 29.1V.2007, coll. I. Ineich & N. Lhermitte-Val-
larino; MNHN 2007.1460 (male), Cameroon, Manengou-
ba Mts., border of the road going to the lakes,
5.0512°N/9.8069°E, 28.IV.2007, coll. I. Ineich & N. Lher-
mitte-Vallarino; ZFMK 5802-3 (2 male paratypes),
Cameroon, Manengouba Mts., Lake Manengouba,
20.XII1.1966-5.1.1967, coll. M. Eisentraut; ZFMK 55599
(male), Cameroon, Manengouba, river east of Lake Ma-
nengouba, no date, F. Le Berre; ZFMK 58896-7 (2 males),
Cameroon, Manengouba Mts., 1993, coll. E. Wallikewitz;
ZFMK 59030 (male), Cameroon, Manengouba Mts.,
1994, from pet trade; ZFMK 61836 (male), Cameroon,
Manengouba area, no date, F. Le Berre; ZFMK 62571
(male), Cameroon, Manengouba area, no data, coll. un-
known; ZFMK 66579 (female), Cameroon, Manengouba
area, no date, from pet trade; ZFMK 66738, ZFMK 66740
(2 males), Cameroon, Manengouba area, 1998, from pet
trade; ZFMK 69828, ZFMK 69830 (male + female),
Cameroon, Bakossi Mts., 5.1.1998, coll. O. Euskirchen;
ZFMK 69848-51 (male + 3 females), Cameroon, Bakos-
si Mts., 5.1.1998, coll. A. Schmitz.
Trioceros wiedersheimi (Nieden, 1910)
MHNG 1544.1-2 (2 females), Cameroon, Mayo Darlé,
1941, coll. R. de Kalbermatten; MNHN 2005.2753 (fe-
male), Cameroon, Fongoi Village, Tchabal Mbabo,
12.053°E/7.230°N, altitude 1900 m, 12.1.2002, coll. Pro-
gramme CamHerp; NMP6V 74112 (male), Cameroon,
Tchabal Gangdaba, 7°44.678’N 12°42.741’E, 1560 m
a.s.l., 26.X.2009, coll. V. Gvozdik; ZFMK 47941 (male),
Nigeria, Gotel Mts. Gangirwal, app. 2400 m a.s.l.,
15.11.1988, coll. G. Nikolaus; ZFMK 68943 (male),
Cameroon, Tchabal Mbabo, southern slopes, XI.-
5.X1I.1998, coll. George & Johnson; ZFMK 75740-3 (3
males + female), Cameroon, Mayo Kelele, app. 1600 m
a.s.l., 7.1.2000, coll. H.-W. Herrmann & A. Schmitz;
ZFMK 75744-6 (male + 2 females), Cameroon, Tchabal
Mbabo, 25.1.2001, coll. H.-W. Herrmann & A. Schmitz;
ZFMK 78714 (male), Cameroon, Tchabal Mbabo, I.2001,
coll. H.-W. Herrmann & A. Schmitz; ZMB 21857, ZMB
74806 (formerly part of ZMB 21857) (male + female),
Cameroon, Banjo Gebirge, no date, coll. Riggenbach;
ZMB 21861, ZMB 74805 (formerly part of ZMB 21861)
(male + female), Cameroon, Banjo Gebirge, no date,
Riggenbach; ZMB 21873 (female lectotype), Cameroon,
Genderogebirge, 1500 maz.s.1., no date, coll. Riggenbach.
©ZFMK
226 Michael F. Barej et al.
Appendix II
Table 1. List of voucher specimens for each species included in the present study, with their respective localities, collection num-
bers and GenBank accession numbers (16S, 12S) [*sequence from Pook & Wild 1997; not in GenBank; same species but different
vouchers used for 16S and 12S] [**sequence from Pook & Wild 1997, not in GenBank; same voucher used for both sequences].
Species
Locality
Collection number
Accession number
Kinyongia tavetana
Trioceros oweni [E146.15]
Trioceros camerunensis [E130.1]
Trioceros cristatus [E130.2]
Trioceros cristatus [E130.3]
Trioceros cristatus [E131.1]
Trioceros cristatus [E146.13]
Trioceros cristatus [E150.7]
Trioceros cristatus [E150.8]
Trioceros cristatus [E180.2]
Trioceros cristatus [E180.7]
Trioceros montium [E130.4]
Trioceros montium [E130.5]
Trioceros montium [E131.2]
Trioceros montium [E131.3]
Trioceros montium [E179.18
Trioceros montium [E180.15
E188.19
E188.20
Trioceros perreti [E130.11]
Trioceros montium
[ ]
[ |
Trioceros montium [E188.18]
[ ]
[ ]
Trioceros montium
South Pare, Kilimanjaro, Tanzania
Nkoelon, Campo region
Njonji, Mt. Cameroon
Njonji, Mt. Cameroon
Njonji, Mt. Cameroon
Njonji, Mt. Cameroon
Amebishu, Mamfe region
Amebishu, Mamfe region
Nkoelon, Campo region
Mofako Balue, Rump Hills
Big Massaka, Rumpi Hills
Mt. Cameroon
Mt. Kupe
Mt. Cameroon
Mt. Kupe
Mofako Balue, Rumpi Hills
Nyasoso, Mt. Kupe
Edib Hills, Bakossi Mts.
Edib Hills, Bakossi Mts.
Edib Hills, Bakossi Mts.
Mts. Manengouba
MHNG 2612.58
ZFMK 87642
MNHN 2007.0037
MNHN 2007.1447
MNHN 2007.1448
MNHN 2007.1449
ZFMK 87646
ZFMK 87647
ZFMK 87649
ZFMK 89455
MNHG 2716.39
MNHN 2007.1429
MNHN 2007.1445
MNHN 2007.1430
MNHN 2007.1446
MNHG 2716.47
MNHG 2716.41
NMPO6V 74130/2
NMPO6V 74130/1
NMP6V 74130/3
MNHN 2007.1458
AM422414 / AM422433
HQ337816 / HQ337864
HQ337798 / HQ337846
HQ337799 / HQ337847
HQ337800 / HQ337848
HQ337801 / HQ337849
HQ337802 / HQ337850
HQ337803 / HQ337851
HQ337804 / HQ337852
HQ337805 / HQ337853
HQ337806 / HQ337854
HQ337807 / HQ337855
HQ337808 / HQ337856
HQ337809 / HQ337857
HQ337810 / HQ337858
HQ337811 / HQ337859
HQ337812 / HQ337860
HQ337813 / HQ337861
HQ337814 / HQ337862
HQ337815 / HQ337863
HQ337828 / HQ337876
Trioceros perreti [E130.12] Mts. Manengouba MNHN 2007.1459 HQ337829 / HQ337877
Trioceros perreti [E131.6] Mts. Manengouba MNHN 2007.1460 HQ337830 / HQ337875
Trioceros pfefferi Afua jim Forest, 10,4°E/6,15°N MNHN 2007.1499 HQ337817 / —*
Trioceros quadricornis eisentrauti Rumpi Hills voucher not collected HQ337820 / She
Trioceros quadricornis eisentrauti [E178.10] Mt. Rata, Rumpi Hills ZFMK 89466 HQ337818 / HQ337866
Trioceros quadricornis eisentrauti [E178.11] Mt. Rata, Rumpi Hills MNHG 2716.40 HQ337819 / HQ337867
Trioceros quadricornis gracilior [E130.7] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1426 HQ337821 / HQ337868
Trioceros quadricornis gracilior [E130.8] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1423 HQ337822 / HQ337869
Trioceros quadricornis gracilior [E131.4] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1424 HQ337823 / HQ337870
Trioceros quadricornis quadricornis [E130.9] | Mts. Manengouba MNHN 2007.1470 HQ337824 / HQ337871
Trioceros quadricornis quadricornis [E130.10] Mts. Manengouba MNHN 2007.1466 HQ337825 / HQ337872
Trioceros quadricornis quadricornis [E131.5] | Mts. Manengouba MNHN 2007.1469 HQ337826 / HQ337873
Trioceros quadricornis quadricornis [E131.8] | Mts. Manengouba MNHN 2007.1468 HQ337827 / HQ337874
Trioceros serratus [E130.15] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1463 HQ337831 / HQ337878
Trioceros serratus [E130.16] Lake Oku, Mt. Oku, Bamenda Highlands MNHN 2007.1465 HQ337832 / HQ337879
Trioceros serratus [E130.17] (NEOTYPE) Belo, Mt. Oku MNHN 2007.1494 HQ337833 / HQ337880
Trioceros serratus [E131.7] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1464 HQ337834 / HQ337881
Trioceros serratus [E131.16] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1461 HQ337835 / HQ337882
Trioceros serratus [E131.17] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1462 HQ337836 / HQ337883
Trioceros serratus [E178.2] Mt. Mbam voucher not collected HQ337837 / HQ337884
Trioceros serratus [E178.3] Mt. Mbam voucher not collected HQ337838 / HQ337885
Trioceros serratus [E178.4] Mt. Mbam voucher not collected HQ337839 / HQ337886
Trioceros serratus [E178.5] Mt. Mbam voucher not collected HQ337840 / HQ337887
Trioceros serratus [E188.16]
Trioceros serratus [E189.8]
Trioceros wiedersheimi [E91.6]
Big Babanki, Bamenda Highlands
Big Babanki, Bamenda Highlands
Tchabal Mbabo
Tchabal Mbabo
Tchabal Gangdaba
NMP6V 74104 HQ337841 / HQ337888
voucher not collected HQ337842 / HQ337889
ZFMK 75744 HQ337843 / HQ337890
voucher not collected HQ337844 / HQ337891
NMP6V 74112 HQ337845 / HQ337892
Trioceros wiedersheimi [E178.1]
Trioceros wiedersheimi [E188.13]
Bonn zoological Bulletin 57 (2): 211-229 ©OZFMK
Chameleons of the genus Trioceros from Cameroon oy)
Table 2. Uncorrected p-distances between Cameroonian Trioceros taxa based on 960 bp of the 16S + 12S rRNA gene fragments.
1 2 3 4 5 6 7 8 9 10 11 12
1 = Kinyongia tavetana AM422414/AM422433 -
2 oweni Nkoelon, Campo region [E146.15] 0.1221 -
3. camerunensis Mt. Cameroon [E130.1] 0.1230 0.0986 —
4 cristatus Big Massaka, Rumpi Hills [E180.7] 0.1138 0.0868 0.0381 —
5 cristatus Nkoelon, Campo region [E150.8] 0.1109 0.0868 0.0386 0.0086 —
6 — cristatus Amebishu, Mamfe region [E146.13] 0.1083 0.0857 0.0402 0.0095 0.0075 —
7 cristatus Amebishu, Mamfe region [E150.7] 0.1095 0.0868 0.0412 0.0106 0.0086 0.0011 —
8 cristatus Njonji, Mt. Cameroon [E130.2] O.11S1 0.0890 0.0396 0.0011 0.0096 0.0107 0.0118 = —
9 cristatus Njonji, Mt. Cameroon [E130.3] 0.1162 0.0901 0.0407 0.0021 0.0107 0.0118 0.0128 0.0011 —
10 cristatus Njonji, Mt. Cameroon [E131.1] 0.1150 0.0879 0.0391 0.0011 0.0096 0.0105 0.0116 0.0000 0.0011 —
11 cristatus Mofako Balue, Rumpi Hills [E180.2] 0.1138 0.0868 0.0381 0.0000 0.0086 0.0095 0.0106 0.0011 0.0021 0.0011 —
12. montium Edib Hills, Bakossi Mts. [E188.20] 0.1159 0.0958 0.0343 0.0365 0.0326 0.0365 0.0376 0.0380 0.0391 0.0375 0.0365 —
13 montium Edib Hills, Bakossi Mts. [E188.18] 0.1152 0.0943 0.0338 0.0360 0.0321 0.0360 0.0370 0.0375 0.0385 0.0370 0.0360 0.0000
14 montium Edib Hills, Bakossi Mts. [E188.19] 0.1152 0.0943 0.0338 0.0360 0.0321 0.0360 0.0370 0.0375 0.0385 0.0370 0.0360 0.0000
15 montium Mt. Kupe [E130.5] 0.1153 0.0944 0.0374 0.0386 0.0332 0.0375 0.0385 0.0396 0.0407 0.0396 0.0386 0.0032
16 montium Mt. Kupe [E131.3] 0.1153 0.0944 0.0374 0.0386 0.0332 0.0375 0.0385 0.0396 0.0407 0.0396 0.0386 0.0032
17 montium Nyasoso, Mt. Kupe [E180.15] 0.1152 0.0943 0.0338 0.0360 0.0321 0.0360 0.0370 0.0375 0.0385 0.0370 0.0360 0.0000
18 montium Mt. Cameroon [E130.4] 0.1153 0.0964 0.0381 0.0392 0.0364 0.0402 0.0413 0.0407 0.0418 0.0402 0.0392 0.0064
19 montium Mt. Cameroon [E131.2] 0.1153 0.0964 0.0381 0.0392 0.0364 0.0402 0.0413 0.0407 0.0418 0.0402 0.0392 0.0064
20 montium Mofako Balue, Rumpi Hills [E179.18] 0.1141 0.0923 0.0349 0.0360 0.0311 0.0349 0.0360 0.0375 0.0385 0.0370 0.0360 0.0011
21 perreti Mts. Manengouba [E131.6] 0.1194 0.0943 0.0623 0.0528 0.0525 0.0560 0.0571 0.0545 0.0556 0.0539 0.0528 0.0591
22. perreti Mts. Manengouba [E130.11] 0.1227 0.0953 0.0612 0.0517 0.0514 0.0549 0.0560 0.0534 0.0545 0.0528 0.0517 0.0580
23 perreti Mts. Manengouba [E130.12] 0.1227 0.0953 0.0612 0.0517 0.0514 0.0549 0.0560 0.0534 0.0545 0.0528 0.0517 0.0580
24 pfefferi 0.1099 0.0934 0.0627 0.0603 0.0563 0.0588 0.0575 0.0616 0.0629 0.0616 0.0603 0.0538
25 quadricornis eisentrauti Rumpi Hills 0.1058 0.0966 0.0690 0.0639 0.0614 0.0612 0.0626 0.0652 0.0665 0.0652 0.0639 0.0611
26 quadricornis eisentrauti Mt. Rata, Rumpi Hills 0.1118 0.0948 0.0638 0.0605 0.0591 0.0606 0.0617 0.0621 0.0632 0.0616 0.0605 0.0551
{E178.10]
27. quadricornis eisentrauti Mt. Rata, Rumpi Hills 0.1124 0.0957 0.0644 0.0611 0.0598 0.0611 0.0623 0.0629 0.0640 0.0622 0.0611 0.0556
(E178.11]
28 quadricornis gracilior Mt. Oku [E130.7] 0.1117 0.0911 0.0603 0.0539 0.0525 0.0539 0.0550 0.0556 0.0567 0.0550 0.0539 0.0526
29 quadricornis gracilior Mt. Oku [E130.8] 0.1117 0.0911 0.0603 0.0539 0.0525 0.0539 0.0550 0.0556 0.0567 0.0550 0.0539 0.0526
30 © quadricornis gracilior Oku village [E131.4] 0.1118 0.0922 0.0610 0.0545 0.0525 0.0545 0.0557 0.0556 0.0567 0.0556 0.0545 0.0532
31 quadricornis quadricornis Mts. Manengouba 0.1105 0.0933 0.0624 0.0560 0.0547 0.0560 0.0571 0.0577 0.0588 0.0571 0.0560 0.0548
[E130.10]
32 quadricornis quadricornis Mts. Manengouba 0.1105 0.0933 0.0624 0.0560 0.0547 0.0560 0.0571 0.0577 0.0588 0.0571 0.0560 0.0548
[E130.9]
33 quadricornis quadricornis Mts. Manengouba 0.1105 0.0933 0.0624 0.0560 0.0547 0.0560 0.0571 0.0577 0.0588 0.0571 0.0560 0.0548
{E131.5]
34 quadricornis quadricornis Mts. Manengouba 0.1108 0.0944 0.0632 0.0567 0.0546 0.0567 0.0579 0.0578 0.0589 0.0578 0.0567 0.0554
[E131.8]
35 serratus Belo, Mt. Oku [E130.17] 0.1174 0.1008 0.0651 0.0609 0.0601 0.0619 0.0620 0.0621 0.0632 0.0620 0.0609 0.0641
36 serratus Big Babanki, Bamenda Highlands 0.1174 0.0998 0.0646 0.0603 0.0601 0.0614 0.0615 0.0621 0.0632 0.0614 0.0603 0.0635
[E188.16]
37 serratus Big Babanki, Bamenda Highlands 0.1180 0.1014 0.0654 0.0611 0.0609 0.0622 0.0623 0.0629 0.0640 0.0622 0.0611 0.0634
[E189.8]
38 serratus Mt. Mbam [E178.2] 0.1163 0.1000 0.0664 0.0621 0.0612 0.0632 0.0633 0.0632 0.0643 0.0632 0.0621 0.0653
39 serratus Mt. Mbam [E178.3] 0.1165 0.0990 0.0654 0.0611 0.0602 0.0622 0.0622 0.0622 0.0633 0.0622 0.0611 0.0643
40 serratus Mt. Mbam [E178.4] 0.1163 0.0999 0.0664 0.0621 0.0612 0.0632 0.0632 0.0632 0.0643 0.0632 0.0621 0.0653
41 serratus Mt. Mbam [E178.5] 0.1151 0.0977 0.0646 0.0603 0.0601 0.0614 0.0615 0.0621 0.0632 0.0614 0.0603 0.0635
42 serratus Mt. Oku [E130.15] 0.1186 0.1022 0.0664 0.0621 0.0613 0.0632 0.0633 0.0632 0.0643 0.0632 0.0621 0.0654
43 serratus Lake Oku [E130.16] 0.1186 0.1021 0.0663 0.0621 0.0612 0.0632 0.0632 0.0632 0.0643 0.0632 0.0621 0.0653
44 serratus Oku village [E131.16] 0.1175 0.0998 0.0646 0.0604 0.0601 0.0614 0.0626 0.0622 0.0633 0.0615 0.0604 0.0636
45 serratus Oku village [E131.17] 0.1185 0.1009 0.0656 0.0614 0.0612 0.0624 0.0625 0.0632 0.0643 0.0625 0.0614 0.0646
46 serratus Oku village [E131.7] 0.1090 0.0988 0.0680 0.0645 0.0636 0.0633 0.0634 0.0656 0.0667 0.0656 0.0645 0.0670
47 wiedersheimi Tchabal Mbabo [E91.6] 0.1147 0.0923 0.0635 0.0520 0.0529 0.0533 0.0534 0.0538 0.0550 0.0531 0.0520 0.0590
48 wiedersheimi Tchabal Mbabo [E178.1] 0.1163 0.0900 0.0620 0.0508 0.0494 0.0498 0.0498 0.0526 0.0537 0.0519 0.0508 0.0565
49 wiedersheimi Tchabal Gangdaba [E188.13] 0.1146 0.0903 0.0637 0.0519 0.0527 0.0530 0.0541 0.0536 0.0547 0.0530 0.0519 0.0592
Bonn zoological Bulletin 57 (2): 211-229 ©ZFMK
228 Michael F. Bare] et al.
Table 2. Continued.
13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31
13 =
14 0.0000 —
15 0.0032 0.0032 -
16 0.0032 0.0032 0.0000 —
17 0.0000 0.0000 0.0032 0.0032 —-
18 0.0063 0.0063 0.0075 0.0075 0.0063 —
19 0.0063 0.0063 0.0075 0.0075 0.0063 0.0000 —
20 0.0011 0.0011 0.0021 0.0021 0.0011 0.0053 0.0053 —
21 0.0582 0.0582 0.0578 0.0578 0.0582 0.0603 0.0603 0.0571 —
22 0.0571 0.0571 0.0567 0.0567 0.0571 0.0592 0.0592 0.0560 0.0032 —
23 0.0571 0.0571 0.0567 0.0567 0.0571 0.0592 0.0592 0.0560 0.0032 0.0000 —
24 0.0535 0.0535 0.0521 0.0521 0.0535 0.0574 0.0574 0.0510 0.0365 0.0378 0.0378 —
25 0.0599 0.0599 0.0587 0.0587 0.0599 0.0613 0.0613 0.0575 0.0370 0.0382 0.0382 0.0392 —
26 0.0542 0.0542 0.0536 0.0536 0.0542 0.0563 0.0563 0.0522 0.0403 0.0435 0.0435 0.0368 0.0026 —
27 0.0547 0.0547 0.0542 0.0542 0.0547 0.0568 0.0568 0.0526 0.0407 0.0439 0.0439 0.0369 0.0027 0.0000 —
28 0.0518 0.0518 0.0513 0.0513 0.0518 0.0539 0.0539 0.0497 0.0433 0.0443 0.0443 0.0366 0.0102 0.0106 0.0107 —
29 0.0518 0.0518 0.0513 0.0513 0.0518 0.0539 0.0539 0.0497 0.0433 0.0443 0.0443 0.0366 0.0102 0.0106 0.0107 0.0000 —
30 0.0524 0.0524 0.0513 0.0513 0.0524 0.0545 0.0545 0.0503 0.0438 0.0448 0.0448 0.0366 0.0103 0.0107 0.0108 0.0000 0.0000 —
31 0.0539 0.0539 0.0535 0.0535 0.0539 0.0560 0.0560 0.0518 0.0422 0.0432 0.0432 0.0367 0.0051 0.0064 0.0064 0.0063 0.0063 0.0064 —
32 0.0539 0.0539 0.0535 0.0535 0.0539 0.0560 0.0560 0.0518 0.0422 0.0432 0.0432 0.0367 0.0051 0.0064 0.0064 0.0063 0.0063 0.0064 0.0000
33 0.0539 0.0539 0.0535 0.0535 0.0539 0.0560 0.0560 0.0518 0.0422 0.0432 0.0432 0.0367 0.0051 0.0064 0.0064 0.0063 0.0063 0.0064 0.0000
34 0.0546 0.0546 0.0535 0.0535 0.0546 0.0567 0.0567 0.0525 0.0427 0.0438 0.0438 0.0367 0.0051 0.0064 0.0065 0.0064 0.0064 0.0064 0.0000
35 0.0630 0.0630 0.0622 0.0622 0.0630 0.0652 0.0652 0.0620 0.0458 0.0447 0.0447 0.0434 0.0435 0.0480 0.0487 0.0426 0.0426 0.0427 0.0437
36 0.0625 0.0625 0.0622 0.0622 0.0625 0.0646 0.0646 0.0614 0.0454 0.0444 0.0444 0.0434 0.0435 0.0478 0.0483 0.0423 0.0423 0.0428 0.0433
37 0.0634 0.0634 0.0631 0.0631 0.0634 0.0655 0.0655 0.0623 0.0461 0.0451 0.0451 0.0437 0.0442 0.0484 0.0489 0.0428 0.0428 0.0433 0.0439
38 0.0643 0.0643 0.0632 0.0632 0.0643 0.0664 0.0664 0.0632 0.0459 0.0448 0.0448 0.0434 0.0435 0.0471 0.0477 0.0416 0.0416 0.0417 0.0427
39 0.0633 0.0633 0.0622 0.0622 0.0633 0.0654 0.0654 0.0622 0.0449 0.0438 0.0438 0.0434 0.0435 0.0460 0.0467 0.0406 0.0406 0.0407 0.0417
40 0.0643 0.0643 0.0632 0.0632 0.0643 0.0664 0.0664 0.0632 0.0459 0.0448 0.0448 0.0434 0.0435 0.0471 0.0477 0.0416 0.0416 0.0417 0.0427
41 0.0625 0.0625 0.0622 0.0622 0.0625 0.0646 0.0646 0.0614 0.0444 0.0433 0.0433 0.0447 0.0448 0.0478 0.0482 0.0423 0.0423 0.0428 0.0433
42 0.0643 0.0643 0.0633 0.0633 0.0643 0.0665 0.0665 0.0633 0.0470 0.0460 0.0460 0.0447 0.0447 0.0493 0.0500 0.0438 0.0438 0.0439 0.0449
43 0.0643 0.0643 0.0632 0.0632 0.0643 0.0664 0.0664 0.0632 0.0470 0.0459 0.0459 0.0447 0.0447 0.0492 0.0499 0.0438 0.0438 0.0438 0.0449
44 0.0626 0.0626 0.0623 0.0623. 0.0626 0.0647 0.0647 0.0615 0.0455 0.0444 0.0444 0.0446 0.0434 0.0479 0.0483 0.0423 0.0423 0.0428 0.0434
45 0.0636 0.0636 0.0633 0.0633 0.0636 0.0657 0.0657 0.0625 0.0465 0.0454 0.0454 0.0447 0.0447 0.0488 0.0493 0.0433 0.0433 0.0439 0.0444
46 0.0658 0.0658 0.0648 0.0648 0.0658 0.0669 0.0669 0.0647 0.0486 0.0475 0.0475 0.0447 0.0447 0.0475 0.0483 0.0419 0.0419 0.0419 0.0429
47 0.0591 0.0591 0.0587 0.0587 0.0591 0.0612 0.0612 0.0568 0.0374 0.0363 0.0363 0.0337 0.0318 0.0342 0.0345 0.0329 0.0329 0.0333 0.0329
48 0.0565 0.0565 0.0562 0.0562 0.0565 0.0609 0.0609 0.0543 0.0388 0.0377 0.0377 0.0340 0.0321 0.0345 0.0348 0.0333 0.0333 0.0337 0.0332
49 0.0583 0.0583 0.0580 0.0580 0.0583 0.0604 0.0604 0.0562 0.0413 0.0403 0.0403 0.0389 0.0341 0.0352 0.0354 0.0350 0.0350 0.0354 0.0360
32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49
32 -
33 0.0000 —
34 0.0000 0.0000 —
35 0.0437 0.0437 0.0438 = —
36 0.0433 0.0433 0.0439 0.0000 —
37 0.0439 0.0439 0.0445 0.0000 0.0000 —
38 0.0427 0.0427 0.0428 0.0011 0.0011 0.0011 —
39 0.0417 0.0417 0.0417 0.0011 0.0011 0.0011 0.0000 —
40 0.0427 0.0427 0.0428 0.0011 0.0011 0.0011 0.0000 0.0000 —
41 0.0433 0.0433 0.0439 0.0021 0.0021 0.0021 0.0011 0.0011 0.0011 —
42 0.0449 0.0449 0.0450 0.0011 0.0011 0.0011 0.0021 0.0021 0.0021 0.0032 —
43 0.0449 0.0449 0.0449 0.0011 0.0011 0.0011 0.0021 0.0021 0.0021 0.0032 0.0000 —
44 0.0434 0.0434 0.0439 0.0021 0.0021 0.0022 0.0032 0.0032 0.0032 0.0042 0.0011 0.0011 —
45 0.0444 = 0.0444 0.0449 0.0011 0.0011 0.0011 0.0021 0.0022 0.0021 0.0032 0.0000 0.0000 0.0011 —
46 0.0429 0.0429 0.0430 0.0011 0.0011 0.0012 0.0023 0.0023 0.0023 0.0034 0.0000 0.0000 0.0011 0.0000 —
47 0.0329 0.0329 0.0334 0.0344 0.0341 0.0340 0.0333 0.0322 0.0333 0.0341 0.0357 0.0356 0.0352 0.0352 0.0378 —
48 0.0332 0.0332 0.0337 0.0369 0.0365 0.0365 0.0359 0.0348 0.0359 0.0365 0.0382 0.0381 0.0377 0.0376 0.0403 0.0045 —
49 0.0360 0.0360 0.0365 0.0375 0.0371 0.0377 0.0365 0.0355 0.0365 0.0371 0.0387 0.0386 0.0372 0.0382 0.0408 0.0068 0.0066 —
Bonn zoological Bulletin 57 (2): 211-229 ©ZFMK
Chameleons of the genus Zrioceros from Cameroon
£00 £0°0 800 £0°0 £0°0 £00 10°0 10°0 900 VV Gil vO 81 Lal vl cl Tl Ve L0 Gla AE € ‘Aap’s 4
6L0 LS'0 Clit LS'0 veo cs'0 910 910 LL0 L9 8 Caesecls Gull vrt vil GL FENG SOE WLS OVE GEG uvoul =
L3'0 £9°0 Lol £9°0 8e0 8S°0 810 810 93°0 OL I] 6T 6¢I SHI Sol Vel €6 8V~ SL “0i0L 30°C6 Te xeul S
0L0 cs'0 10'T cS'0 670 Lv'0 vam) STO £9°0 09 oF 9i0) 2016 o'8 OCI 88 Ss «LT 8I go OSP Oss 61 urur
LI LI LI LI LI LI LI LI I LI LI LI LI LI LI LI LI LI LI sa LI LI N
(So[VUlaJ) SMJDsAAS SOADIOIT,
£00 c0°0 80°0 c0'0 c0'0 c0'0 10:0 100 80°0 ve Le! so. 6 UTT 80 60 OT GO) LA 50 86 L9 € “ASp's
820 890 60'1 850 €€0 cs'0 L10 910 98°0 £9 L CAE Sieles 265 GS -8l= Vile “6K? 69 OL9 68L VE6I uvoul
80 19°0 Ic 19°0 9¢°0 €S'0 810 L10 00'T 89 6 Sc OST 6F€I CO Sl Svs “Se EL 10:98 “ONES €C xXeUl
IL'0 cs'0 L60 cs'0 0c0 870 910 910 9L'0 LS Si OW Orl= 9301 ES viOl= 9:9. Si0¢ G9F {Ores — 20589 cI ur
6 6 6 6 6 6 6 6 8 6 6 6 6 6 6 6 6 6 6 8 6 6 N
(Sa[VUlaJ) 17410 YSAapaIM SOADIONT
£0°0 10°0 90°0 10°0 c0'0 c0°0 10°0 10°0 s0°0 (GS OT HO} =e 60 Lal LO Sid! VAL v0 its VL L “AQp's
9L0 9°50 STI 95°0 ce0 Ts'0 L10 910 T8°0 €L II 80 eel 8Cl 6sl Tcl SEL VASE EQS 0:69 EBL SOG ueoul
c8'0 890 CET 8S°0 peo vs'0 610 810 060 €8 cl OT St OFT G8l Sel $8 CLT SL OL9 0S6 0€ xeul
cL'0 es'0 00'T €s'0 870 670 S10 Sl 0 SL'0 L9 Ge 2910) Sill Sal vrl Dalat EAE EMG GO OivS ‘Oi0L cl ur
cl cl cl Gl cl al al cl Ol cl cl cl cl cl cl cl cl cl cl Ol cl cl N
(sayeulay) Yasdad sosaz01Ay,
700 c0'0 900 c0'0 £0°0 c0'0 100 10'0 90°0 vs (Gul v0, Sal vi I eT 0'l (EG L0 v6 o8 v “AQP'S
9L'0 6S'0 611 6S'0 9¢0 Is0 L10 910 c6'0 $9 eye SIL ORIEL = =) 0 GI Si Salil Oi8= Ace L9 069 6¢L 617 ueoul
98°0 £90 vel $90 tro cs'0 810 L10 £01 OL Ol LiG OSI -v20 Ay Gel Se0l ase 18 O16 088 6c xeul
89°0 cs'0 bO'l cs'0 0c'0 Lv'0 S10 St 0 €8°0 9¢ 9 80 8 c8 OTT G8 1019 Oj) VS $9b O¢S cI ura
LC LC LC LC LE LT LT LT LT LC LT EG ALE LT LT Le Le LC LC LC LC Lo N
(Sa]VUl) $JD449S SOADIOIT
+00 c0'0 L0°0 c0'0 c0'0 c0'0 10'0 100 L0'0 Vc Gil 0), EG OC oT cal SOF Cie 60 oll Prel iS “ASp's
bl 0 19°0 vIT 190 ceo 0s'0 810 L10 cO'l 19 L Sie Cirig See ES Salil 6L CT OL. 978 08 C8I ueoul
€8°0 p90 tcl b9'0 9€0 €s'0 610 810 Ol v9 8 GIG SHB GON SS eel: iG Se:9C c8 S$ LOI S00! €C xeul
69°0 LS0 £01 LS‘0 ce'0 Lv 0 910 m0) 68°0 LS & vl OT 9:01 vel 66 679 «Lel ss $09 O19 val Uru
Or OI Or Ol Ol Ol Ol Ol OI OI Ol Ol Ol Ol Ol Ol Ol Ol Ol Ol Ol OI N
(So[VUl) 1210 YSAAPAIM SOADIONT
70'0 cO'0 L0°0 c0'0 c0'0 c0'0 100 100 800 9°9 Lil co OOT 60 OT SiO) 0) val c0 6s vy 9 “AOp's
€L'0 850 aml 8S°0 e£°0 Is'0 L10 910 L8'0 SL I] 60 8cl OCI Oor 8 Il HE WX Se Oe Gils, WAG uvoul
c8'0 £9°0 scl £9°0 80 cs‘0 070 810 bO'l £6 SI 1S {SSSI Gill EA — 981 L6 09¢ 08 OPrL OT8 LE xeul
89°0 ps0 v6.0 ps0 8c 0 Lv'0 S10 ame) cL'0 $9 6 SO IIl Tol LAVAL © ts)! Se MUG TOSS OES SR OKED Il ura
SC SC ST SC Sc SC Sc SC SC SC SC SG SG SC SC SC Sc Sc Sc Sc SC SC N
(sajeul) Yassad Sosad01N],
JHOW/D OW/daA MA/GH OW/da 3HIS/MH 3HIS/DOW T4/T9d TH/TEL TH/1L WSH AHS TID TH TH JHOW OW MH IHS) Ga IL Wa OO
‘ones yowyoy Jo dy 0} des yynow / des ynow = iOW/OW ‘ones ypIM peoy / Jojowerp sA0 = MH/Ga_ ‘ones des yynour/ 1ajowerp sA0 = OW/C_ ‘ones yourpay Jo dy oj dy nous
/ (PIM peoy = IHIS/MH “ones jourjoy Jo dy o} dy ynous / des yynour = IHIS/OW ‘ones ySua] Apog / yISue] wWueoIO} Tq/ToJ ‘ones ySuo] Apog / yBuo] eign = Tq/THL “ones yISuI]
Apog / yjsus] [1e} = Tq/TL ‘Apogprur ye sayeos yuey = WSJ ‘peoy Jo puoa pure oX9 usamyaq a]kOs JO JoquINU = FHS ‘}Saso Jens Jo YSU] = TH ‘yISuo] wue o10f = TOI ‘ySug] viqn
= TIL owyoy Jo dy 0} de8 yynow sourjsip = IO ‘des now = yyy ‘yIpIM peoy = MH “owyoy Jo dy 0} dy ynous sourysip = HIS “Jo}ourerp dA0 [eoI}IOA = QA ‘[!e} JO dy 0} vovojo
WOT, YISUD] [Ie] = TL “VOVO]D 0} nous Jo dy Woy YSU] Apog = Tg ‘jSo1O Ie[NS BUIULIO} sapeos Jo JoquINU = DN (‘Aop's) UOeIASp plepuejs pue (URoIT) SonjeA UROW “(xeU) WINUITX
-PUL “(UTUT) WINUITUTU “(N{) OZIS o[dues oI UDAID “SNJDAIAS ‘J, Pu IUMaYssapaIM “J ‘Yadssad SOAJIOLAT, B[CUIDJ PUL [LUI W]Npe JO (UIW) SoINseoU [eoIso;oYydiow jo Arewung *¢ sq
Bonn zoological Bulletin 57 (2): 211-229
a
i
|
a
_ ang
ae
rod
ci
nation
Bonn zoological Bulletin Volume 57
Bonn, November 2010
Another new Cophixalus species (Amphibia: Anura: Microhylidae)
from western New Guinea
Rainer Gtinther
Museum ftir Naturkunde Berlin, Leibniz Institute for Research on Evolution and Biodiversity at the
Humboldt-University, Invalidenstr. 43, D-10115 Berlin, Germany
Abstract. Based on external morphological, anatomical, bioacoustic, and molecular traits, a new species in the micro-
hylid genus Cophixalus is described. The new species was discovered in the Fakfak Mountains, northwestern corner of
the Bomberai Peninsula, Papua Province, Indonesia. The new taxon is most closely related to the sympatric Cophixalus
tetzlaffi. It differs from that species in several morphological traits, but primarily by its advertisement call: the new species
utters a single peeping note with a mean duration of less than 200 milliseconds, whereas the advertisement call of C. tetz-
laffi consists of three to four notes, with a mean note duration of more than 400 milliseconds. Molecular data (mitochon-
drial 16S rRNA) support the determination of the specific distinctness of the new species.
Key words. Anura, Asterophryinae, Cophixalus, new species, New Guinea.
INTRODUCTION
Fifty-one species in the microhylid frog genus Cophixalus
are known at present (Frost 2010). Of these, 14 occur in
north-eastern Australia, 30 in Papua New Guinea, three
are known only from the Papua Province of Indonesia,
three are recorded from both Papua New Guinea and the
Papua Province of Indonesia, and one species seems to be
endemic to the Island of Halmahera, located about 300 km
west of the western tip of New Guinea. Although many
new Cophixalus species are expected to be described al-
so from western New Guinea, the distribution centre of
the genus seems to be clearly in eastern New Guinea and
north-eastern Australia. Cophixalus montanus has been
known since 1895 from Halmahera, and the detection of
three new species in the western part of New Guinea (on
Yapen Island, on the Wandammen Peninsula, and on the
Bomberai Peninsula) came as a surprise (Gunther 2003,
2006).
Here I describe another new species from the Fakfak
Mountains on the Bomberai Peninsula (located on the
“throat” of the Vogelkop) found during an expedition in
September 2008. Moreover, a population of Cophixalus
tridactylus and one specimen of a second undescribed
species was observed there. Consequently, at least four
Cophixalus species occur syntopically in the middle and
higher elevations (400-1000 m above sea level, a.s.l.) of
the Fakfak Mountains.
Bonn zoological Bulletin 57 (2): 231-240
MATERIAL AND METHODS
Most frogs were collected at night after locating them by
their advertisement calls. Some specimens were pho-
tographed in life the next day and all specimens were
anaesthetized with chlorobutanol and subsequently fixed
in 2 % formalin. Tissue probes from thigh muscle were
taken from some frogs and stored in about 96 % ethanol
to enable DNA sequencing, before fixing the animals in
formalin. All specimens were transferred to 75 % ethanol
later in the Berlin museum. One specimen was cleared and
stained as an osteological preparation according to a
method modified from Dingerkus & Uhler (1977).
The following measurements were taken with a digital cal-
liper (> 10 mm) or with a binocular dissecting microscope
fitted with an ocular micrometer (< 10 mm) to the near-
est 0.1 mm:
SUL — snout-urostyle length: from tip of snout to distal
tip of urostyle-bone; SUL is about one to two mm
shorter than the snout-vent length (SVL). As the
measurement error is higher in the latter, I prefer to
use the former. In general, both measurements are
more or less identical and are used interchangeably
in this paper.
TL -—tibia length: external distance between knee and an-
kle;
TaL — length of tarsus: external distance, tarsal and ankle
joints held at a right angle;
©ZFMK
232 Rainer Gtinther
10° I i 3]
Fig. 1.
cality (1).
Map of the western part of New Guinea with type lo-
T4L — length of fourth toe: from tip of toe to proximal end
of inner metatarsal tubercle;
T4D — transverse diameter of disc of fourth toe;
F3L — length of third toe;
F3D — transverse diameter of disc of third finger;
F1D — transverse diameter of disc of first finger;
T1D — transverse diameter of disc of first toe;
HL — head length: from tip of snout to posterior margin
of tympanum;
HW — head width, taken in the region of the tympana;
SL — snout length: from an imaginary line that connects
the centres of eyes to tip of snout;
END — distance from anterior corner of orbital opening
to centre of naris;
IND — internarial distance between centres of nares;
ED — eye diameter: from anterior to posterior corner of
orbital opening;
TyD — horizontal diameter of tympanum.
Advertisement calls were recorded under natural condi-
tions with a Sony Digital Audio Tape (DAT) Walkman
TCD-D 100 and a Sennheiser microphone MKE 300 and
analysed with Avisoft-SAS Lab Pro software. All speci-
mens are currently stored in the Museum fiir Naturkunde
Berlin (ZMB) and bear registration numbers of that insti-
tution. Part of the type series will later be transferred to
the Museum Zoologicum Bogoriense (MZB).
RESULTS AND DISCUSSION
Cophixalus monosyllabus sp. n.
Holotype. ZMB 74993 (field number, FN: RG 7888) ;
adult male collected by R. Giinther and A. Piahar 6 km
Bonn zoological Bulletin 57 (2): 231-240
Fig. 2. Holotype of Cophixalus monosyllabus sp. n. head in
lateral view (above); head in dorsal view (below).
direct line NNE of Fakfak town, near the Fakfak-Kokas
road, Bomberai Peninsula (neck of Vogelkop), Papua
Province, Indonesia, 2°53’S and 132°18'E, elevation 500
ma.s.l., 9 September 2008 (Fig. 1).
Paratypes. ZMB 74994 (FN: RG 7889), ZMB 74995
(FN: RG 7890), ZMB 74996 (FN: RG 7912), ZMB 74997
(FN: RG 7915), ZMB 74998 (FN: RG 7916), ZMB 74999
(FN: RG 7926), ZMB 75000 (FN: RG 7927), ZMB 75001
(FN: RG 7951), ZMB 75002 (FN: RG 7952). ZMB 74997
is now an osteological preparation. All nine paratypes are
males. They were collected from 9 to 14 September 2008
along the Fakfak-Kokas road in the southern part of the
Fakfak Mountains, at elevations of from 400 to 700 m
a.s.l. Collectors were R. Giinther, M. Kapisa, and A. and
F. Piahar.
©ZFMK
New Cophixalus from western New Guinea 233
Table 1. Body measurements and body ratios of the type series of Cophixalus monosyllabus sp. n. ZMB-No are the inventory
numbers of the Museum ftir Naturkunde Berlin, FN are the field numbers of the author, SD indicates the standard deviation. ZMB
74993 is the holotype; ZMB 74997 is now an osteological preparation. All specimens are adult males. All measurements are in
mm; abbreviations are explained in “Material and methods”.
ZMB-No 74993 74994 74995 74996 74997 74998 74999 75000 75001 75002 mean SD
FN 7888 7889 7890 7912 PONS OMG, 7926 7927 7951 7952 22.9 1.04
SUL 22.8 DBolk 24.1 22.5 22.4 23.6 20.6 22.8 24.3 23.0
WE 10.9 ey) IEA ele Wes} ES: 10.1 INS 7/ 12.3 USF
TaL 7.4 U2 Yell 6.8 6.9 eZ UP 7.6 7.3 7)
T4L 11.5 11.6 i EG 11.2 11.1 10.5 LE 12.5 10.9
T4D 1.3 1E2'5 1.4 1.0 163 3 1.0 LED: 13'S 1:25
TID 0.7 0.65 OTS “OS 0.7 0.6 0.45 0.7 0.6 0.6
SIE 6.0 6.4 6.8 6.4 6.1 6.5 5)5) 59 6.8 6.0
F3D 1.4 1.4 Ned 1.45 es) 1.3 1.25 1S) 1) 1.4
FID 0.6 0.45 0.50 0.50 0.5 0.4 0.45 0.5 0.5 0.5
HL 7.5 V2) 8.2 Toll es) 8.0 6.8 Wess ES ie
HW 8.5 9.0 9.1 9.0 95 9.8 8.5 9.0 9.6 9.6
SL 3.2 3.3 3.6 33 3.5 3.4 32 33 Shep) 3.6
END 2.2 2.1 2.5 2.0 2.1 De 2.0 2.1 DD 2.0
IND D3} DES) 7) D3 DED 2.4 22 2S 2.5 DED
ED 2.8 2.9 3.1 DRS 2.9 2.8 Dall 2.8 3.0 3.0
TyD 1.2 1.0 12 1.0 1.0 1.1 1.0 0.9 1.0 1.0
TL/SUL 0.48 0.51 0.47 0.51 0.50 0.49 0.49 0.51 0.51 0.51 0.50 0.051
TaL/SUL 0.32 0.31 0.29 0.30 0.31 0.31 0.35 0.33 0.30 0.32 0.31 0.017
T4L/SUL 0.50 0.50 0.49 0.52 0.50 0.47 0.51 0.49 0.51 0.47 0.50 0.016
F3L/SUL 0.26 0.28 0.28 0.28 0.27 0.28 0.27 0.26 0.28 0.26 0.27 0.009
F3D/SUL 0.061 0.060 0.071 0.064 0.067 0.055 0.061 0.066 0.062 0.061 0.063 0.004
FID/SUL 0.026 0.019 0.021 0.022 0.031 0.017 0.022 0.022 0.021 0.022 0.021 0.002
T4D/SUL 0.057 0.054 0.058 0.044 0.058 0.055 0.049 0.053 0.056 0.054 0.054 0.004
TID/SUL 0.031 0.028 0.031 0.022 0.031 0.025 0.022 0.031 0.025 0.026 0.027 0.004
HL/SUL 0.33 0.31 0.34 0.32 0.33 0.34 = 0.33 0.32 0.31 0.33 0.33 0.011
HW/SUL 0.37 0.39 0.38 0.40 0.42 0.42 041 0.39 0.40 0.42 0.40 0.018
HL/HW 0.88 0.80 0.90 0.79 0.77 0.82 0.80 0.81 0.78 0.78 0.81 0.043
END/IND 0.96 0.84 0.84 0.87 0.95 0:92) 0:91 0.84 0.88 0.89 0.89 0.044
ED/SUL 0.123 0.125 0.129 0.111 O29 OMS On3it 0.123 0.120 0.130 0.124 0.006
TyD/ED 0.43 0.34 0.39 0.40 0.34 039.037 0.32 0.33 0.33 0.36 0.037
SL/SUL 0.140 0.143 0.149 0.147 0.156 0.144 0.155 0.145 0.141 0.156 0.148 0.006
Bonn zoological Bulletin 57 (2): 231-240 ©ZFMK
234 Rainer Giinther
Fig. 3. Holotype of Cophixalus monosyllabus sp. n. ventral
view of right hand (left); ventral view of right foot (right).
Diagnosis. With a snout-urostyle length of from 20.6 to
24.3 mm in ten adult males, the new species belongs to
the middle-sized species of the genus. It is obviously a sis-
ter species of the sympatric Cophixalus tetzlaffi and dif-
fers from all other species in the same characters as the
latter. The new species differs from C. fefzlaffi, among
others, by its larger body size, its wider finger and toe
discs, and its advertisement call which consists of only one
peeping syllable (note) that lasts, on average, 196 millisec-
onds (ms). In contrast, the advertisement call of C. tetzlaf-
fi consists of three to four peeping notes, with a mean note
length of more than 400 ms.
Description of the holotype. For measurements see Table
1. Head broader than long (HL/HW ratio 0.88), canthus
rostralis roundish; loreal region straight; snout slightly pro-
truding in profile (Fig. 2, above) and rounded in dorsal
view (Fig. 2, below); horizontal eye diameter greater than
eye-naris distance; borders of tympanum scarcely visible,
its size less than half of the eye diameter (TyD/ED 0.43),
no supratympanic fold; internarial distance slightly
greater than distance between eye and naris (END/IND
0.96); tongue large, posteriorly broadened and without
posterior notch, its posterior and lateral margins free; a
strongly serrated fold present in front of the pharynx; long
Fig. 4.
Bonn zoological Bulletin 57 (2): 231—240
Dorsolateral view of a more brownish coloured paratype of Cophixalus monosyllabus sp. n. (ZMB 74995).
©ZFMK
New Cophixalus from western New Guinea
NO
Ww
Nn
Fig. 5. Dorsolateral view of a more greyish coloured paratype of Cophixalus monosyllabus sp. n. (ZMB 74999).
Fig. 6. Ventral view of a paratype of Cophixalus monosylla-
bus sp. n. (ZMB 74995).
Bonn zoological Bulletin 57 (2): 231-240
slits on both sides of the tongue are entrances to a subgu-
lar vocal sac. Legs moderately long, no webs between fin-
gers or toes (Fig. 3); tips of fingers wider than tips of toes,
first finger much smaller than other fingers, its tip only
scarcely wider than the penultimate phalanx; relative
length of fingers 3>2=4>1; third toe clearly longer than
the fifth, tip of first toe slightly smaller than tip of the fifth
toe, tips of remaining toes clearly wider than that of first
and fifth toe; all finger and toe tips with terminal grooves;
relative length of toes 4>3>5>2>1, all subarticular tuber-
cles as well as metatarsal and metacarpal tubercles not or
only scarcely developed. With exception of some tuber-
cles on flanks, all dorsal, lateral, and ventral surfaces
smooth.
Dorsum light brown and clearly demarcated against dark
brown upper flanks, dorsal surfaces of legs non-uniform
brown, chevron-shaped mark in scapular region, dorsal
surface of snout lighter than remaining body; dorsal sur-
faces of fingers and toes with yellowish, light brown, and
dark brown pattern; lateral and dorsolateral flanks with
longitudinal rows of blackish spots, a conspicuous black-
ish spot present also above insertion of foreleg and behind
eye; loreal region, tip of snout, and region below and be-
hind eye and underneath tympanum blackish (black face
mask); ventral surface of forelegs yellowish with irregu-
OZFMK
236 Rainer Gtinther
kHz
NO & OOO
0.05 0.10
Fig. 7.
mV
35 ]
|
304
Ls
——
eewe
at
251
erews wae vows rar
20
otosst
9 kHz
Ol a 2 Ss Ay On Oi mee L ane.
Fig. 8. | Power spectrum of an advertisement call of Cophixa-
lus monosyllabus sp. n.
Bonn zoological Bulletin 57 (2): 231—240
SSAA, ES GSS
FRR ARE RRS. GR RGR SRS.
Ont 0.20 Ss
Wave form (above) and spectrogram (below) of an advertisement call of Cophixalus monosyllabus sp. n..
lar dark brown flecks, ventral surface of hind legs also yel-
lowish with brown flecks but the latter less intense than
on forelegs (ventral skin and muscle tissue of the right
thigh was removed for biochemical studies); belly, chest
and throat yellowish with brown pigmentation, pigmen-
tation most intense on throat and chest and least intense
on abdomen; region around anal opening blackish and re-
gion from behind eye, through tympanum, and up to up-
per arm whitish.
Variation in the type series: Mensural variation for the type
series is shown in Table 1. The basic colour and colour
pattern elements of all preserved types are fairly uniform
and very much resemble those of the holotype. Charac-
teristic elements are a light brown dorsum, which is dif-
ferentiated from dark brown upper flanks, a dark brown
and irregularly pronounced interocular band, a dark
chevron or W-shaped mark in the scapular region, a dark
face mask, a blackish spot behind eye and above inser-
tion of fore leg, a blackish throat which fades posterior-
ly into a diffuse dark brown reticulum, and a pale dorsal
surface of the snout which is the palest part of all the dor-
sal surfaces. Only one specimen (ZMB 74996) has a
whitish middorsal line from snout tip to anal opening and
which continues on to the posterior thighs.
The basic colour in life varies from créme or grey to light
brown. Dorsum rather uniform brownish (Fig. 4) or grey
(Fig. 5); conspicuous is a blackish or dark brown chevron
or W-shaped mark in the scapular region, an irregular dark
brown interocular band between posterior parts of eyes,
and a créme or light brown coloured dorsal part of snout.
Lower flanks are mostly lighter than the remaining later-
al areas (Fig. 4). Upper flanks may be of nearly the same
©ZFMK
New Cophixalus from western New Guinea
Fig. 9.
brown or grey colour as on the dorsum. Conspicuous are
a blackish spot behind the eye, another blackish spot above
the foreleg insertion, and some blackish spots at the bor-
der between the dorsum and flanks. It is notable that the
dorsum in all preserved specimens is clearly lighter than
the upper flanks, whereas the dorsum and upper flanks in
most living specimens differed in colour only slightly. Lo-
real region in all specimens entirely or predominantly
black. In some specimens this black area continues to be-
low the eye and extends up to the upper arm, in others this
black area ends below the eye. The inner margin of the
“upper eyelid” is whitish in most specimens, this colour
merging in a broad and light postocular band.
While there are no or only a few tubercles in the preserved
specimens, most living specimens exhibited tubercles on
the flanks and extremities (rarely on the dorsum). Many
of these tubercles have a blackish base and a orange-red
cap. Most, and the largest, tubercles are arranged in dor-
solateral rows. The yellowish spot posterior of the
chevron sign in ZMB 74999 (Fig. 5), which faded to a
white spot in preservative, is obviously an exception. Or-
ange-red areas were also found on the forelegs of some
specimens. The fine whitish middorsal line in the living
Bonn zoological Bulletin 57 (2): 231-240
tO
Ww
Habitat of Cophixalus monosyllabus sp. n. in the Fakfak Mountains on the Bomberai Peninsula, 700 m a.s.1.
specimen in Fig. 5 disappeared completely in fixative.
Dorsal sides of legs similarly coloured as other dorsal and
dorsolateral body parts. Ventral sides of forearms créme-
coloured, its anterior and posterior part covered with ir-
regular dark spots. Throat and chest in all specimens dark-
er than on the remaining ventral surfaces. These dark ven-
tral areas are solidly or discontinuously black or dark
brown. Abdomen and ventral sides of hind legs show
greater light areas covered by a more or less dense retic-
ulum of grey-brown. Weakest pigmentation was common-
ly on the posterior abdomen (Fig. 6). Iris yellow-red and
nerved by a dense net of blackish lines.
Osteology. One cartilage-bone preparation (ZMB 74997)
did not show remarkable differences from that of Cophix-
alus tetzlaffi (see Giinther 2003).
Vocalisation. Most calling activities were recorded dur-
ing rain and damp weather from dusk to 9 p.m. All calls
were recorded at temperatures of approximately 21°C.
Calls are uttered in series lasting several minutes. The
shortest time between two successive calls was about 3
s. Each call consists of a single unpulsed and finely tuned
note (Fig. 7). Fifty-six calls (notes) from two males had
©ZFMK
238 Rainer Gtinther
~
Fig. 10. An undescribed Cophixalus species from the Fakfak Mountains, with a 16.9 mm snout-urostyle-length, which at first
glance resembles Cophixalus misimae recently described by Richards & Oliver (2007) from Misima Island, Louisiade Archipela-
go, Papua New Guinea.
a mean length of 196 ms, with a minimum of 173 ms and
a maximum of 224 ms. Most notes start with a sharp in-
crease in amplitude, and the sound volume may remain
constant during the entire note but may also change, with
the greatest sound volume mostly near the end. The end
of the note occurs more gradually and its exact cessation
is fairly difficult to identify (Fig. 7). The dominant fre-
quency 1s approximately 2.8 kHz (Fig. 8), the fundamen-
tal frequency is approximately 1.4 kHz, and the first (and
most pronounced) upper harmonic band is at about 4.2
kHz.
Distribution. The new species lives on slopes and in val-
leys of the southern part of the Fakfak Mountains. We
found it along the Fakfak town-Kokas road at elevations
of from 250 to 700 m a.s.l. Whether it also occurs in the
northern part of the Fakfak Mountains remains to be de-
termined.
Habitat and habits. Cophixalus monosyllabus sp. n. lives
mostly in the understory (bushes, young trees, and herbs)
of taller trees but also in shrubbery without a canopy cov-
er (Fig. 9). The frogs perched mainly on or between liv-
ing or dead leaves at heights of from one to three meters
above the ground. The species is common: we heard sev-
eral hundred males during a walk of three kilometres along
the Fakfak-Kokas road. Some males called at distances of
Bonn zoological Bulletin 57 (2): 231—240
only two m from one another. At favoured places about
ten males could be heard calling from one point. For bio-
geographical reasons it seems worthwhile to mention that
at elevations of between 500 and 700 m a.s.l., C. mono-
syllabus sp. n. occurs syntopically with C. tetzlaffi, C. tri-
dactylus, and another obviously new Cophixalus species
Cophixalus balbus ZMB 62594 (RG 7434)
Cophixalus balbus ZMB 62596 (RG 7487)
Cophixalus balbus ZMB 62597 (RG 7502)
Cophixalus tetzlaffi ZMB 62598 (RG 7144)
Cophixalus tetzlaffi ZMB 74988 (RG 7839)
Cophixalus monosyllabus ZMB 74994 (RG 7889)
Cophixalus monosyllabus ZMB 74997 (RG 7915)
Fig. 11. Bayesian inference phylogram of 16S rRNA. Numbers
on branches denote posterior probabilities.
OZFMK
New Cophixalus from western New Guinea 239
(Fig. 10). Ecological differences between these four
species are the following: C. monosyllabus sp. n. occurs
at from 250 to 700 m a.s.I. and its calling sites are at be-
tween one and three metres above ground; C. tetzlaffi oc-
curs at from 400 to 900 m a.s.l. (top of the mountains) and
its calling sites are on structures up to one m above the
ground; C. tridactylus was found at from 500 to 900 m
a.s.l. and its calling sites are on the ground; and the ob-
viously new species was found at 860 m a.s.]. in humus
soil below the ground surface.
Etymology. The Latin word “monosyllabus” is derived
from the Greek composite adjective “monosyllabos”
meaning one syllable or monosyllabic, and refers to the
advertisement call of the new species which consists of
only one uniform note. I dedicate this new species to my
dear colleague of many years, Prof. Dr. Wolfgang
Bohme, to acknowledge his extraordinary contributions
to herpetological science and on the occasion of his re-
tirement from official service, although it is well known
that Wolfgang is by no means monosyllabic but rather is
very eloquent.
Molecular evidence. According to B. Stelbrink and T. von
Rintelen (pers. comm., July 2010) DNA isolation and PCR
were done using the protocol of Kohler & Giinther (2008).
Forward and reverse strands were aligned using Codon-
Code Aligner v. 3.0.3 (CodonCode Corporation, Dedham,
MA, USA) and corrected by eye. Sequences were aligned
using MAFFT (Katoh & Toh 2008) and optimized using
ALISCORE (Misof & Misof 2009). Phylogenetic analy-
sis (Bayesian inference) was accomplished as conducted
by Giinther et al (2010).
The analysis of 480 base pairs of the 16S rRNA gene re-
vealed that Cophixalus monosyllabus sp. n. is clearly a
sister species of C. tetz/affi and both are a sister clade of
C. balbus (Fig. 11). C. tridactylus and C. humicola appear
more distant in the molecular tree (see also Kohler & Giin-
ther 2008), and indicate that the present genus Cophixalus
most probably is polyphyletic. The genetic distance (un-
corrected p-distance) between C. monosyllabus sp. n. and
C. tetzlaffi is 4.3 % for the 16S rRNA gene.
Comparison with other species. Cophixalus monosylla-
bus sp. n. is distinct from other Cophixalus species, des-
cribed up to the year 2003, in the same characters as is C.
tetzlaffi (Giinther 2003). All 16 Cophixalus species des-
cribed after 2003 (Hoskin 2004; Kraus & Allison 2006,
2009; Gtnther 2006; Richards & Oliver 2007) differ
clearly from C. monosyllabus sp. n. in body size and al-
so in their advertisement calls. The only species with
which C. monosyllabus sp. n. can be confused morpho-
logically is C. tetzlaffi, especially as both species occur
syntopically.
Bonn zoological Bulletin 57 (2): 231-240
.070
.065
.060
O55
050
O45
A B
Fig. 12. Box-Whisker-Plot of the ratio “diameter of disc of
fourth toe/snout-urostyle-length” (F3D/SUL) in Cophixalus tetz-
laffi (A) compared to that of Cophixalus monosyllabus sp. n. (B).
©ZFMK
240 Rainer Gunther
I compared the measurements of ten male C. monosyllabus
sp. n. with that of eight male C. fetzlaffi and found the fol-
lowing differences: with a mean body size (SUL) of 23.0
mm (range 20.6—24.3 mm), C. monosyllabus sp. n. 1s
somewhat larger than C. fetzlaffi (mean 21.4 mm, range
19.5—22.6 mm), Student’s t-test revealed a significant dif-
ference with t=2.98 and P=0.0046 in this character; C.
monosyllabus sp. n. has significantly shorter tibiae than
C. tetzlaffi (mean of TL/SUL in C. monosyllabus sp. n.
0.50, that in C. tetzlaffi 0.52, t= 3.39, P=0.0019); C. mono-
syllabus sp. n. has a longer third finger than C. tetzlaffi
(mean of F3L/SUL in the former 0.27, in the latter 0.26,
t=3.01, P=0.0041; C. monosyllabus sp. n. has a wider ter-
minal disc on the fourth toe than C. fetzlaffi (mean of
T4D/SUL in the former 0.054, in the latter 0.046, t=3.11,
P=0.0094); C. monosyllabus sp. n. has a wider terminal
disc on first toe than C. tetzlaffi (mean of T1D/SUL in the
former 0.027, in the latter 0.018, t=5.63, P=0.00002); C.
monosyllabus sp. n. has a wider terminal disc on first fin-
ger than C. tetzlaffi (mean of F1D/SUL in the former
0.021, in the latter 0.015, t=5.36, P=0.00003) and, most
significantly, C. monosyllabus sp. n. has a wider terminal
disc on the third finger than C. tetzlaffi (mean of F3D/SUL
in the former 0.063, and in the latter 0.051, t=6.14,
P=0.000007) (Fig. 12). There are continuous dorsolater-
al skin ridges in C. ftetzlaffi, but discontinuous dorsolat-
eral skin glands in C. monosyllabus sp. n.
Apart from these morphological differences, and most im-
portant for species differentiation, are the advertisement
calls: C. monosyllabus sp. n. utters a single peeping note
with a mean duration of 196 ms (range 173-224 ms),
while the call of C. tetzlaffi consists of three to four peep-
ing notes with a mean note duration of 422 ms (range
347-518 ms).
Acknowledgements. Field work and collection of voucher speci-
mens was permitted by representatives of Belai Besar Konser-
vasi Sumber Daya Alam (KSDA), Sorong, Papua Province of
Indonesia (PPI). Marthinus Kapisa (Biak/PPI), Andreas, Frank,
and Apner Piahar (Kampung Lusiperi near Fakfak Town/PPI),
and Christian Bergmann (Berlin/Germany) helped during field
work. The Family Piahar also permitted the collection of frogs
on their property. Rudolf Arndt (Pomona, New Jersey, USA)
carefully read my draft and made a number of helpful comments.
B. Stelbrink and T. von Rintelen (ZMB) “constructed” the mo-
lecular tree. Elisa Forster (Ztirich, Switzerland) prepared Figures
2 and 3, and Frank Tillack (ZMB) provided technical help. To
all of them I am deeply grateful.
Bonn zoological Bulletin 57 (2): 231-240
REFERENCES
Dingerkus G, Uhler LD (1977) Enzyme clearing of alcian blue
stained whole small vertebrates for demonstrating cartilage.
Stain Technology 52: 229-232
Frost DR (2010) Amphibian Species of the World: an online
reference, version 5.4 (8 April 2010). American Museum of
Natural History, New York. Available from:
http://research.amnh.org/herpetology/amphibia/index.php
Giinther R (2003) First record of the microhylid frog genus
Cophixalus from western Papua, Indonesia, with descriptions
of two new species. Herpetozoa 16 (1/2): 3-21
Giinther R (2006) Two new tiny Cophixalus species with reduced
thumbs from the west of New Guinea (Anura: Microhylidae).
Herpetozoa 19 (1/2): 59-75
Giinther R, Stelbrink B, Rintelen T von (2010). Oninia senglaubi,
another new genus and species of frog (Amphibia, Anura, Mi-
crohylidae) from New Guinea. Zoosystematics and Evolution
86 (2): 245-256
Hoskin CJ (2004) Australian microhylid frogs (Cophixalus and
Austrochaperina): phylogeny, taxonomy, calls, distributions
and breeding biology. Australian Journal of Zoology 52: 237—
269
Katoh K, Toh H (2008) Recent developments in the MAFFT
multiple sequence alignment program. Briefings in Bioinfor-
matics 9: 286-298
Kohler F, Giinther R (2008) The radiation of microhylid frogs
(Amphibia: Anura) on New Guinea: A mitochondrial phyloge-
ny reveals parallel evolution of morphological and life histo-
ry traits and disproves the current morphology-based classi-
fication. Molecular Phylogenetics and Evolution 47: 353-365
Kraus F, Allison A (2006) Three new species of Cophixalus
(Anura: Microhylidae) from southeastern New Guinea. Her-
petologica 62: 202—220
Kraus F, Allison A (2009) New species of Cophixalus (Anura:
Microhylidae) from Papua New Guinea. Zootaxa 2128: 1-38
Misof B, Misof K. (2009) A Monte Carlo approach successful-
ly identifies randomness in multiple sequence alignments: A
more objective means of data exclusion. Systematic Biology
58: 21-34
Richards SJ, Oliver PM (2007) A new species of Cophixalus
(Anura: Microhylidae) from Misima Island, Papua New Gui-
nea. Pacific Science 61 (2): 279-287
Received: 27.VII.2010
Accepted: 11.X.2010
OZFMK
Bonn zoological Bulletin | Volume 57
Issue 2
pp. 241-255 Bonn, November 2010 |
High mitochondrial sequence divergence meets morphological and
bioacoustic conservatism: Boophis quasiboehmei sp. n.,
a new cryptic treefrog species from south-eastern Madagascar
Miguel Vences !, Jérn Kohler 2, Angelica Crottini !3 & Frank Glaw 4
! Division of Evolutionary Biology, Zoological Institute, Technical University of Braunschweig,
Spielmannstr. 8, D-38106 Braunschweig, Germany; E-mail: [email protected]
? Department of Natural History — Zoology, Hessisches Landesmuseum Darmstadt, Friedensplatz 1,
D-64283 Darmstadt, Germany
3 Sezione di Zoologia e Citologia, Dipartimento di Biologia, Universita degli Studi di Milano, Via Celoria 26,
I-20133 Milano, Italy
4 Zoologische Staatssammlung Miinchen, Miinchhausenstr. 21, D-81247 Miinchen, Germany
Abstract. We describe a new species of treefrog from Madagascar that is highly similar in external adult morphology,
bioacoustics and colouration to Boophis boehmei but differs from this species by a remarkable differentiation in a frag-
ment of the mitochondrial 16S rRNA gene. A more detailed analysis revealed that this differentiation is concordant with
the pattern in two nuclear genes (Rag! and POMC) which show no hapiotype sharing of the new species with B. boehmei,
and with a consistent difference in tadpole morphology (third lower row of labial keratodonts reduced in length in the
new species). We conclude that concordance between these independent characters indicates two independent evolution-
ary lineages that should best be considered as separate species, despite their similar adult morphology. The new species,
Boophis quasiboehmei sp. n., is so far known only from an area in the southern central east and south-east of Madagas-
car, south of the Mangoro river, while B. boehmei is known only from the area around Andasibe north of the river Man-
goro. Preliminary data indicate that this group of treefrogs contains several more cryptic species, and a simple explana-
tion assuming the Mangoro river as a barrier being responsible for divergence between them is likely no longer tenable.
Key words. Amphibia, Anura, Mantellidae, Boophis boehmei, Boophis quasiboehmei sp. n., Madagascar.
INTRODUCTION
Treefrogs of the genus Boophis have long been among
Madagascar’s less studied amphibians, but intensified
fieldwork and application of integrative taxonomy proto-
cols have led to a steep increase of knowledge (Blommers-
Schlosser 1979; Cadle 2003; Glaw & Vences 2007; Glaw
et al. 2010). Many Boophis species call from high posi-
tions in the vegetation and intensive nocturnal searches
for calling males are needed to find them. Consequently,
many species have been described on the basis of only
small series or even single individuals, and females are
often unknown. Furthermore, many species of Boophis are
known to be morphologically very similar and a diagno-
sis based on external morphology alone is often unreli-
able (Glaw et al. 2001; Vences et al. 2008). However, be-
cause the advertisement calls of these species are usual-
ly loud and species-specific (Vences et al. 2006), the
Bonn zoological Bulletin 57 (2): 241-255
integration of bioacoustics into their taxonomy has led to
an improved understanding of Boophis species diversity.
Together with an initial screening of molecular diversity,
this has led to the description of many new species of
Boophis (e.g., Andreone 1993, 1996; Andreone et al. 1995;
Cadle 1995; Glaw & Thiesmeier 1993; Glaw & Vences
1992, 1994, 1997b, 2002; Glaw et al. 2001, 2010; Koh-
ler et al. 2007, 2008; Vallan et al. 2003, 2010; Vences &
Glaw 2002, 2005; Vences et al. 2010; Wollenberg et al.
2008) and the identification of a large number of addition-
al, yet undescribed candidate species (Vieites et al. 2009).
Furthermore, tadpoles of Boophis are among the most
commonly encountered anuran larvae in Malagasy rain-
forest streams (Vences et al. 2008), and a large number
of them have recently been described (e.g., Raharivololo-
niaina et al. 2006; Randrianiaina et al. 2009a, b).
©ZFMK
242 Miguel Vences et al.
Taking the latest species descriptions into account, the
genus Boophis, classified in the endemic Malagasy-Co-
moroan family Mantellidae, currently comprises 71 de-
scribed species. The genus is monophyletic and composed
of two main clades that correspond to mainly stream-
breeding (subgenus Boophis) and pond-breeding species
(subgenus Sahona), respectively (Glaw & Vences 2006,
2007). The stream breeders are further divided into eight
phenetic species groups. Most of these species groups
probably are monophyletic units although some are not
(particularly the Boophis majori group).
The Boophis goudoti species group contains 13 small to
large species of largely arboreal frogs that are mainly dis-
tributed in the rainforests and highlands of Madagascar.
A subgroup of small-sized species is characterized by
colourful eyes, usually with red iris colour and a bluish
iris periphery (Glaw & Vences 1997a, b). Several of these
species such as Boophis boehmei, B. burgeri, B. reticula-
tus, and B. rufioculis are known to occur at the same lo-
cality in the Andasibe region in the northern central east
of Madagascar and B. reticulatus, B. sp. aff. rufioculis and
B. sp. aff. boehmei (= B. sp. 8 and B. sp. 16 of Vieites et
al. 2009) in Ranomafana National Park in the southern
central east. Of the various confirmed candidate species
in the B. goudoti group (Glaw & Vences 2007; Vieites et
al. 2009), four have recently been described (or older
names were resurrected for them) on the basis of molec-
ular, morphological, and/or bioacoustic differences (Glaw
et al. 2010). However, no taxonomic conclusions have so
far been drawn for the two candidate species from the Ra-
nomafana region mentioned above (B. sp. 8 and B. sp. 16),
mainly because of their high morphological similarity to
Boophis rufioculis and to B. boehmei, respectively.
Boophis boehmei is the smallest species in the B. goudoti
group and has been originally described from Andasibe,
where it is rather common (Glaw & Vences 1992). Pop-
ulations from more southern localities, initially allocated
to this species (Ranomafana region and Andohahela)
turned out to be genetically highly divergent (Vieites et
al. 2009) and have therefore been considered as Boophis
sp. aff. boehmei (Glaw & Vences 2007) or B. sp. 16
(Vieites et al. 2009), although no reliable morphological
or bioacoustic difference between them had been ob-
served. The recent discovery of differences in the tadpole
labial tooth row arrangements of Boophis boehmei and
Boophis sp. 16 (Randrianiaina et al. 2009b) prompted us
to undertake a more detailed comparison. On the basis of
high mitochondrial divergences, consistent differences in
two nuclear genes, constant differences in tadpole mor-
phology, and subtle differences in iris colour, we conclude
that the central south-eastern populations indeed consti-
tute a distinct species which we describe herein as Boophis
quasiboehmei. It is however worth to note that B. boehmei
Bonn zoological Bulletin 57 (2): 241-255
and the newly described species are indeed among the
morphologically and bioacoustically most cryptic species
pairs so far discovered in Madagascar.
MATERIALS AND METHODS
Frogs were collected at night by opportunistic searching,
using torches and head lamps. Specimens were euthanized
in a chlorobutanol solution, fixed in 95% ethanol, and pre-
served in 70% ethanol. Locality information was record-
ed with GPS receivers. Specimens were deposited in the
collection of Université d’ Antananarivo, Département de
Biologie Animale, Antananarivo (UADBA), Zoologisches
Forschungsmuseum Alexander Koenig, Bonn (ZFMK),
and the Zoologische Staatssammlung Munchen (ZSM).
FGMV, FGZC and ZCMV refer to F. Glaw and M. Vences
field numbers. Terminology for biogeographic regions of
Madagascar follows Boumans et al. (2007).
Morphological measurements (in millimetres) were all
done by M. Vences with a digital caliper (precision 0.01
mm) to the nearest 0.1 mm. Used abbreviations are: SVL
(snout—vent length), HW (greatest head width), HL (head
length), ED (horizontal eye diameter), END (eye—nostril
distance), NSD (nostril-snout tip distance), NND (nos-
tril-nostril distance), TD (horizontal tympanum diameter),
TL (tibia length), HAL (hand length), HIL (hindlimb
length), FOL (foot length), FOTL (foot length including
tarsus), FORL (forelimb length), and RHL (relative
hindlimb length). Terminology and description scheme
follow Glaw et al. (2010). Webbing formulae follow
Blommers-Schloésser (1979). Statistical analyses were per-
formed with Statistica software (Statsoft Corp., Tulsa,
USA).
Vocalizations were recorded in the field using different
types of tape recorders (Sony WM-D6C, Tensai RCR-
3222) and external microphones (Sennheiser Me-80, Vi-
vanco EM 238), and an Edirol R-09 digital recorder with
internal microphones and saved as uncompressed files.
Recordings were sampled (or re-sampled) at 22.05 kHz
and 16-bit resolution and computer-analysed using the
software CoolEdit 98. Frequency information was ob-
tained through Fast Fourier Transformation (FFT; width
1024 points). Spectrograms were obtained at Hanning
window function with 256 bands resolution. Temporal
measurements are given as range, with mean + standard
deviation in parentheses. Terminology in call descriptions
follows Kohler (2000).
Two different molecular data sets were studied:
First, we analyzed sequences of the mitochondrial 16S
tRNA gene of around 500 bp from all Boophis goudoti
OZFMK
Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar
Table 1. Primer sequences and PCR conditions used in the present study. PCR conditions start with temperature (in °C) of each
step followed by the time in seconds.
Gene Primer name Sequence (5’ > 3’) Source PCR conditions
BDNF — BDNF DRV | ACCATCCTTTTCCTKACTATGG Vieites et al. (2007) 94(120), [94(20), 57(45),
BDNF — BDNF DRV 1 CTATCTTCCCCTTTTAATGGTC Vieites et al. (2007) 72(120) 39], 72(600)
Ragl Amp F2 ACNGGNMGICARATCTTYCARCC s. Chiari et al. (2004) = 94(120), [94(20), 50(50),
Ragl Amp R2 GGTGYTTYAACACATCTTCCATYTCRTA — s. Chiari et al. (2004) = 72(180) x 45], 72 (600)
POMC POMCDRVFI ATATGTCATGASCCAYTTYCGCTGGAA Vieites et al. (2007) 95(120), [95(60), 58(60),
POMC POMCDRVRI GGCRITYTTGAAWAGAGTCATTAGWGG _ Vieites et al. (2007) 72(90) x 35], 72(600)
group species and candidate species with reddish iris
colour as obtained by Vieites et al. (2009), Randrianiaina
et al. (2009b) and StrauB8 et al. (2010). After alignment and
removal of incomplete sections at its beginning and end
the data set for analysis had a length of 479 bp. Unparti-
tioned Bayesian inference searches were performed. The
best model of evolution (GTR+G) was determined by AIC
in MrModeltest (Nylander 2002). Bayesian analyses were
performed with MrBayes 3.1.2 (Ronquist & Huelsenbeck
2003). Two runs of 10 million generations (started on ran-
dom trees) and four incrementally heated Markov chains
(using default heating values) each, sampling the Markov
chains at intervals of 1000 generations were used. The last
5001 trees were retained post burn-in and summarized to
generate the majority rule consensus tree.
Second, we used tissue samples of four and one Boophis
boehmei from Andasibe and An’ Ala, respectively, and four
and two tissue samples of B. quasiboehmei from Sa-
hamalaotra (=Samalaotra) and Ambohitsara (Tsitolaka for-
est) for newly determining DNA sequences of various nu-
clear genes. Toe clips or leg muscle tissue samples (pre-
served in 95% ethanol) were used for DNA extraction. To-
tal genomic DNA was extracted from the tissue samples
using proteinase K digestion (10 mg/ml concentration) fol-
lowed by a standard salt extraction protocol (Bruford et
al. 1992). We amplified fragments of three genes from the
nuclear DNA (nuDNA): brain-derived neurotrophic fac-
tor (BDNF), recombination activating gene | (Rag1), and
pro-opiomelanocortin (POMC). Standard Polymerase
chain reactions were performed in a final volume of 11
ul and using 0.3 pl each of 10 pmol primer, 0.25 ul of to-
tal dNTP 10 mM (Promega), 0.08 ul of 5 U/ml GoTagq,
and 2.5 ul 5X Green GoTaq Reaction Buffer (Promega).
Primers and detailed PCR conditions are provided in Table
1. PCR products were then purified through QIAquick pu-
rification kit (Qiagen) according to the manufacturer’s in-
struction. Purified PCR templates were sequenced on an
automated DNA sequencer (Applied Biosystems ABI
3130XL). Chromatographs were checked and sequences
Bonn zoological Bulletin 57 (2): 241-255
were edited using CodonCode Aligner (v. 2.0.6, Codon
Code Corporation). All newly determined sequences have
been deposited in GenBank (HQ380132-HQ380172).
Haplotypes of POMC data were inferred using the PHASE
algorithm (Stephens et al. 2001) implemented in DnaSP
software (Version 5.10.3; Librado & Rozas 2009). Hap-
lotype network reconstruction of phased sequences of the
POMC (Fig. 2A) and Rag! (Fig. 2B) fragments were per-
formed using the software TCS, version 1.21 (Clement et
al. 2000). This software employs the method of Temple-
ton et al. (1992) and it calculates the number of mutation-
al steps by which pairwise haplotypes differ, computing
the probability of parsimony for pairwise differences un-
til the probability exceeds 0.95 (no manual adjustment of
threshold was necessary).
RESULTS
A detailed analysis of all available 16S rRNA sequences
of adults and tadpoles assigned to B. boehmei (GenBank
accession numbers GQ904739-GQ904746,
DQ792470-DQ792471, AY341717, AY848560—
AY 848562) and the candidate species B. sp. 16 (sensu
Vieites et al. 2009) (accession numbers
GQ904717—GQ904738, AY848529—AY 848536) con-
firmed that these two forms are genetically highly diver-
gent. Depending on the length of the sequence available,
the uncorrected pairwise distances were between 8.8% and
11.0% (note that these values are higher than the 6.8% re-
ported by Vieites et al. (2009) because of different lengths
of the sequences, with a different proportion of hypervari-
able sites included in the analysis). Next to single substi-
tutions we also detected one major insertion of seven nu-
cleotides in the candidate species which in this extent was
not present in any of the related species of Boophis (Fig.
1). Pairwise divergences were 0.0—-0.9% within B.
boehmei, 0.0—0.5% within specimens of B. sp. 16 from the
Ranomafana region, and 3.6-4.9% between the single
available sequence of B. sp. 16 from Andohahela
©ZFMK
244 Miguel Vences et al.
Boophis axelmeyeri (Tsaratanana - DQ118669)
Boophis rufioculis (An'Ala - DQ003334)
U——_______-. Boophis sp. 41 (Mahasoa - FJ559156)
** Boophis sp. 8 - aff. rufioculis (Maharira - ZCMV 235 - AY848535)
Boophis sp.8 - aff. rufioculis (Antoetra - FAZC 11465 - AY848553)
Lr Boophis sp. 8 - aff. rufioculis (Antoetra - FAZC 11451 - AY848551)
“ Boophis sp.8 - aff. rufioculis (Antoetra - FAZC 11452 - AY848552)
Boophis sp. 40 (Mahasoa - FJ559155)
lime Boophis boehmei [Ca43 HM631885] (Sahafina - PSG 418)
Lr Boophis boehmei [Ca43 HM631885] (Sahafina - PSG 313)
“ Boophis boehmei [Ca43 HM631885] (Sahafina - PSG 417)
*k* Boophis boehmei (Andasibe - LR 167 - DQ792471)
re Boophis boehmei (Andasibe - FGMV 2001.1206 - AY848560)
Boophis boehmei (Andasibe - MVTIS 2002G39 - AY848562)
[ Boophis boehmei (Andasibe - LR 145 - DQ792470)
Lp Boophis boehmei (Andasibe - FGMV 2001.1205 - AY848559)
** L— Boophis boehmei (Andasibe - FGMV 2001.1205 - AY341717)
Lp Boophis boehmei (Andasibe - MVTIS 2002G38 - AY848561)
“ Boophis boehmei (An'Ala - ZCMV 3508 - GQ904744)
** Boophis boehmei (An'Ala - ZCMV 3571 - GQ904746)
“ Boophis boehmei (An'Ala - ZCMV 3482 - GQ904739)
Boophis boehmei (An'Ala - ZCMV 3445 - GQ904740)
Ly Boophis boehmei (An‘Ala - ZCMV 3555 - GQ904745)
“ Boophis boehmei (An'Ala - ZCMV 3458 - GQ904741)
Boophis quasiboehmei (Andohahela - FGZC 236 - AY848529)
Boophis quasiboehmei (Ranomafana - ZCMV 324 - AY848536)
“ Boophis quasiboehmei (Ranomafana - ZCMV 2690 - GQ904734)
Boophis quasiboehmei (Ranomafana - FGMV 2002.327 - AY848534)
“ Boophis quasiboehmei (Ranomafana - ZCMV 3624 - GQ904729)
-— Boophis quasiboehmei (Ranomafana - ZCMV 3634 - GQ904731)
“ Boophis quasiboehmei (Ranomafana - ZSM 1153/2007 - GQ904725)
*k* Boophis quasiboehmei (Ranomafana - FGMV 2002.328 - AY848533)
“ Boophis quasiboehmei (Ranomafana - FGMV 2002.324 - AY848530)
L— Boophis quasiboehmei (Ranomafana - ZCMV 2688 - GQ904733)
‘ Boophis quasiboehmei (Ranomafana - ZCMV 3767 - GQ904728)
Boophis quasiboehmei (Ranomafana - FGMV 2002.325 - AY848531)
el “ Boophis quasiboehmei (Ranomafana - ZSM 752/2007 - GQ904719)
|. Boophis quasiboehmei (Ranomafana - ZSM 1370/2007 - GQ904724)
0.1 “ Boophis quasiboehmei (Ranomafana - ZSM 1010/2007 - GQ904721)
Boophis quasiboehmei (Ranomafana - ZCMV 4083 - GQ904726)
“ Boophis quasiboehmei (Ranomafana - ZCMV 3045 - FJ559139)
Boophis quasiboehmei (Ranomafana - FGMV 2002.326 - AY848532)
. Boophis quasiboehmei (Ambohitsara - ZCMV 4937 - GQ904735)
Boophis quasiboehmei (Ranomafana - ZSM 684/2007 - GQ904718)
Lr Boophis quasiboehmei (Ranomafana - ZSM 932/2007 - GQ904720)
“ Boophis quasiboehmei (Ranomafana - ZCMV 4491 - GQ904717)
DQ792471 (NTAAA ET ARTE RETA T RATE
0Q792470 |AtAAAT TART ET TAATBATEGRAGA
AY848562 [ATAAATEAR TDD ETAT EATE
AY848561 (MTARATTART TED DARTRATEER AEN
AY848560 [ATARAT TAA TEED TAATATEERABR-------
AY848559 (AGARATTA ATED EM AERATEG HABA. ------
AY341717 HeeeeeeenraaHAnlaniiiata aS
GQ904746 |ATAAA TT ANTE T TTA R EC RAGA
6Q904745 (ATEAREERE RADHA REREAD EAREER- ------
GQ904741 |AEAAAEANTONETANT HATO GEREN
GQ904740 (TMM N TANT TET TAN TAREE ERAGK
GQ904739 ATMA TE AATTTTTA ATE
AY848536 (MTAAATTAM TERT EAATEAGE ERAT ABRRRATAAT CRATERS
AY848534 (KTAAATTAAT TET OMATRAGEER ADAG CAO HOATOAEORESEAAE
AY848533 |ATAAATTARTTTRRAATEARERRATAGEE RATAN TERA TEAM CHARGE ANDRE AECERREEE)
AY848532 (HTAMATTAAT EDD EMATRARE ERAT ACR RRATANT ERAT OAAGRAAG RANA TT AGRE TERED)
AY848531 (ATMAATTAATTTTEAATPARRRRAT AGG ERAT ARTE RA DENNER ARECRAB TA
AY848530 (MPAAATTAAT TDD GAATHAREE RAT AERORATAATERARGAAGRAAGCAABET Bi
AY848529 (MHMAATTAMTEDEDAATRAREE RAT AERGRATAAT ERAT ERAGE GAMERTAG TO REE
Fig. 1. Phylogenetic tree of species and candidate species of the Boophis goudoti group with red iris colour, obtained using Bayesian
inference based on DNA sequences of the mitochondrial 16S rRNA gene (alignment length 479 bp). Bayesian posterior values
>0.95 symbolized by a single asterisk, of 0.99-1.00 by two asterisks. For each sequence, locality, voucher number and Genbank
number are given in parentheses. Boophis goudoti was used as outgroup (not shown). Note that the deeper phylogenetic relation-
ships shown are not reliable due to the limited amount of sequence information used in the analysis, and according to an unpub-
lished multi-gene data set of K. C. Wollenberg, B. boehmei and B. quasiboehmei are probably sister groups. The alignment in the
lower part of the figure shows a section of the 16S alignment, with sequences of Boophis boehmei (upper 13 sequences; numbers
to the left are Genbank accession numbers) and Boophis quasiboehmei (lower seven sequences). The insertion of seven nucleotides
is a synapomorphy of all B. guasiboehmei specimens for which a sequence was obtained, and in this extent is lacking also in all
other species of the B. goudoti group.
Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK
Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 245
10R
6R
Fig. 2.
Boophis quasiboehmei
® Sahamalaotra
= Ambohitsara
Boophis boehmei
Andasibe
= An'Ala
fe—
R 1\2\ 358
SS
Haplotype networks of the nuclear POMC (A) and Rag! (B) genes fragments in B. boehmei and B. quasiboehmei, each
from two different localities. Haplotypes per each individual were inferred using the Phase algorithm. The networks show com-
plete absence of haplotype sharing among the two taxa.
(AY848529) and those from Ranomafana. Genetically
identified specimens assigned to B. boehmei were from
Andasibe and An’ Ala. Specimens from Sahafina (Gehring
et al. 2010) had quite divergent DNA sequences and their
status is unclarified, but they clustered with B. boehmei
(Fig. 1). Following the scheme suggested by Padial et al.
(2010), this population was considered a new unconfirmed
candidate species Boophis boehmei [Ca43 HM631885] by
Gehring et al. (2010). Probably, specimens from Ankeni-
heny for which no molecular data are available belong to
this species as well. Specimens assigned to B. sp. 16 were
from the Ranomafana area (including Ambatovory, Sa-
hamalaotra, Imaloka, Kidonavo, Vohiparara) and Ambo-
hitsara, as well as from Andohahela.
Besides a simple assessment of molecular divergences be-
tween Boophis sp. 16 and B. boehmei it is also necessary
to comment on its phylogenetic position. The analysis of
Vieites et al. (2009) placed B. boehmei with B. sp. 8 from
Ranomafana and B. sp. 40 from Mahasoa forest, and the
clade made up by these species was sister to B. sp. 16. Our
Bonn zoological Bulletin 57 (2): 241-255
analysis (Fig. 1) included sequences of all these taxa and
confirmed the phylogenetic relationships suggested by
Vieites et al. (2009). However, an unpublished analysis
based on multiple mitochondrial genes by K.C. Wollen-
berg instead suggested a probable sister-group relationship
between B. boehmei and B. sp. 16, confirming that the 16S
rRNA gene alone as used here is insufficient to clarify the
phylogeny among Boophis species. Altogether, the phy-
logenetic relationships among all these species require a
much more detailed analysis which however is beyond the
scope of the present paper.
The results of the mitochondrial marker indicate no or lim-
ited gene flow between B. boehmei and B. sp. 16. This re-
sult was corroborated by the analysis of two nuclear mark-
ers (Fig. 2; the conserved BDNF gene showed no varia-
tion). While in POMC (Fig. 2A), the single included
An’ Ala specimen had a different haplotype not clustering
with those of Andasibe, in Rag! the haplotypes belong-
ing to the two species formed two well-defined clusters
separated from each other by a minimum of six mutation-
©ZFMK
ASUOpI|y
S OO Wel wee ivYs 86 T6l 8€ O€ EG Cv 61l oll SIl s0¢ W ~BYRIOJOY = 66L01 YOU 9007/8LT WSZ
uoIsal
G “A7S| ASI SIG fei v6 Gis fits VC eG OT 61 ¢Il TIl ¢€6c W eueyeuoury Id . C886$ MINAZ
uoIsal
Se 99 Sel “SiGe Sr 9'6 Ors ORE 8ST YT lv Oc SI SIL Coc W euefemoury td = T886S$ MINAZ
(Z) Joa Ajayeury-
& GS» Mel Cig Sei 16 esl 2 Gite [EXG SG OV ol Gly SL0l “6i8G IN vuouey Id plLee AWOZ 9007/77 WSZ
G GV. OGL WG OS V8 She Se LAG OG 6€ Oc OTL SOL 8l7 W PeustiouRy Id 09Ee AWOZ 9007/17 WSZ
G - WS “SG KG tsxor7 v6 (AW Gis LT OT One TZ SIl LOL 8% W Atoaoyequy Id OLO0E AWOZ 9007/07 WSZ
S Sl “SC Mae te ES 9'6 OrG le SIGE VC iG 6£ O07 TIL TIT 98% W Atoaojequy Id 690 AWOZ 9007/6777 WSZ
G GM “Gel OGG ~ Ws 66 SOC VE NG VC rv SI OIL TIL €6% W Atoaoyequy Id TSO€ AIWOZ = 9007/8T7 NSZ
S GM LEl SEG - 50S 9'6 Sisley eae OT Gi 6€ Si Sal AO SiGe an eyoreuy = =td 1$6c AWOZ = 9007/9TT WSZ
y WS Wal IOUG “Gs 88 SLITS Bese ST ST Uv 6T 9IT LOL Sle WeHovjeueyes Id 8860 AWOZ 9007/777T WSZ
C= SiS 6Il 80C O87 06 Wb, YES SC Sie LSE 61 OIL 901 887 W_ ererediyoA Id €9€0-COOTAW/DA £€007Z/SIL WSZ
GS GS TIT 80¢ I18pP 16 [EEN Nee 2G CC Lae O07 TIL 901 L9T W Atoaoyequy LH Sp0e AWOZ = 9007C/LTT WSZ
ea 1awyaogisonh -g
© ee. 28i611 ELSES) aaSiCOE OIG GUG ie VE Gis Os VG OAL Sil Ste se oqisepuy = = 6C009 MINAZ
3 G WIG SEI SG GS SIH Ore CY ce LAE Cv 6c VSI 8rl 90b d oqisepuy = = 8009 MINAZ
Ss IL --OWG POU Lee - Wee eel Isc vr tate cae Os Se “orl vl Sip a PIV UV = O00rC AWOZ = 9007/STT WSZ
2 S GWE -_OSIE OG “SQ oul! 6vC OF O€ Lig Os XG GSI AOA AEE oul oqisepuy = 90TT 100C ANWDA = CO0T/ST WSZ
=I ¢ CSI ICE OG SY c8 ILI ens LEG GE CV OFC = Ta 90 OPE CIN ey UV 7 = v8009 MWAZ
GSO WEG. wae Ass £6 Gol s68e IEG VC vv [eG. = VA lS 0S SN oqisepuy a = O0S90S MINAZ
bp 6ST CCl “SiN Gees SiSv. 9°8 VO vas SHG CaG Tv Ge GOK 901 8i8G-IN oqisepuy = = 6790S MINAZ
GC 6ul, VO “BOC” 9iLV L8 OIG HEE EaC VC CV OMG = KOM Si8G SAIN oqisepuy — S6ll100c ANDA = C00C/7T WSZ
G GSI] Sell SG EUS v6 C6l OE SC SC OT GG UG = AS OS AIA oqisepuy — €6ITTO0C ANDA 7O00T/ET WSZ
G Gol Gl Sikes Sey 9'6 ysl O¢€ VT CAC Oh OG “WAI BO SiON oqisepuy — Toll to0c ANDA = CO00T/TT WSZ
EO EGIL IGE. — «GOs C6 Ool TE VC ST vv EG 61 Si ioc = oqisepuy = = 000C/P0E WSZ
Geile SEG Calica GY, £6 y8I O¢ CT GG 9'€ Oc 91 LOI $8 W eqisepuy tid = 6£9CS MINAZ
Go= (oy! SGl WG GO 6'8 GSile 9S WAG EC CV BG VEE ANNE. VGRYG> Al eqisepuy Id = 8£9CS MINAZ
G AgESil Git Gi6l - 997 C8 [eb 038 ‘BG Gil OT Ore= SE Ie SiO S89 IN oqisepuy = Id = LE9cS MINAZ
GC GSI SII 60¢ S$ 9PF S'8 GEA Ws VC EAC 6€ GG - “Vall AGiOM vases sIN oqisepuy = =§Id (€p9ES MINAZ) 6661/€9S WSZ
CVI VO WONG V8 06 Cb Gs fC VC 6€ OG. “OTS ll Vice IN eqisepuy LH = Cr9ES MINAZ
— 1aWYaog ‘@
THY WaIL TOA TLOA WH IVH THOA GNN GSN CNH da GL ‘TH MH TAS XS Ayyevoy adAy, Joquinu plot Joquiny|
‘dy ynous puokag (¢) ‘dy nous (p) ‘dy ynous pure [Lysou ussMjoq (¢) ‘[LNsoU (Z) “IauIOD aAa IOLIO}UR (][) SOyOvoI UONLNOTVAe [esIe}OIqy ‘Apoqg Suoye passoidpe st quitjpury uUsyA\
6 “SMOT[OJ SB PIPOd SI (ISUS] QUIT[PUTY OANLIOI) THY ‘opewoy “y ‘oyeur ‘py ‘odAyered ‘pg ‘adAyopoy ‘LH :suoneiaciqge [euonippy ‘spousal pue syeLiayepy dos suAuOIOe UOTJOATJOO pue
a s}UDWOINSRIW SIIWIOYdIoW Jo suUONeIADIgQge 10, ‘awuYyaoqgispnb ‘g pure iauyaog siydoog jo suawideads JayONOA pouturexd JO (WIL UT [[e) sJuoWIaIMsvoW oLNOWOYdIOPy *7 JIqUL
©ZFMK
Bonn zoological Bulletin 57 (2): 241—255
Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 247
@ Boophis boehmei
O Boophis quasiboehmei
oO
S
iS)
©
LL
<x
O
oO
-2.0
=2:0 5) -2.0) =125:7=120) -0'5) 010) 1015) 120) AS) 2:0) (215) 13:6
PCA Factor 2
Fig. 3. Scatterplot of individual males of Boophis boehmei
(filled circles) and B. quasiboehmei (open circles) along the sec-
ond and third factor of a Principal Component Analysis (Vari-
max normalized rotation). The PCA was based on measurements
in Table 1. The specimen from Midongy was excluded from
analysis because the species identity of this population is not ful-
ly clarified.
al steps. Although the nuclear data set refers to only a lim-
ited number of specimens, the fact that there is no haplo-
type sharing between the two forms suggests that they rep-
resent independent evolutionary lineages.
Nevertheless, these pronounced genetic divergences were
contrasted by no or low divergences in adult morpholo-
gy and bioacoustics. The calls of the two forms were sim-
ilar, with no detectable differences (see call descriptions
below). In both forms, notes may be combined to short
regular series, and intervals between notes are otherwise
highly variable and mostly irregular. The temporal and
spectral parameters in calls of both forms are somewhat
variable among populations and individuals, but broadly
overlap at inter- and intra-populational level. Even the
pulse rate within notes, a character shown to be evolution-
ary highly dynamic among closely related species (e.g. Pa-
dial et al. 2008), is identical in both forms (see analysis
below). Inter-note intervals outside of regular note series
furthermore seem to depend on calling motivation of the
individual male.
A close examination of adult morphology yielded no dis-
crete characters that would allow a diagnosis between the
two forms. One subtle difference was detected in adult life
Fig. 4. Comparative photographs of oral discs of preserved tadpoles of Boophis quasiboehmei sp. n. (top, A-F) and Boophis boehmei
(bottom, G—I): (A) ZSM 442/2008, Imaloka; (B—C) ZSM 83—84/2008, Ambohitsara; (D) ZSM 509/2008, Ambatolahy; (E) ZSM
1682/2007, Sahalamaotra; (F) ZSM 443/2008, Imaloka; (G-I) ZSM 1738/2007, 1750/2007, 1779/2007, An’Ala. Note the short
third lower (= posterior) keratodont row of Boophis quasiboehmei sp. n. with only few (or even misssing [D]) keratodonts, and
the less reduced legth of this row in B. boehmei (indicated by white arrows). In the tadpoles of other species of the Boophis goudoti
group, the third lower keratodont row is more extended than in the two species shown (see Randrianiaina et al. 2009b).
Bonn zoological Bulletin 57 (2): 241-255
©ZFMK
248 Miguel Vences et al.
Table 3. Factor loadings, Eigenvalues and percent explained
variation from a Principal Component Analysis of morphome-
tric data in Table 2. Factor loadings >0.5 are shown in bold.
Factor 1 Factor 2 Factor3 Factor 4
SVL 0.535637 0.024396 0.278024 0.432915
HW 0.401178 -0.052815 0.722325 0.434988
HL 0.283729 = -0.059521 0.901536 -0.000783
TD -0.451112 0.171742 0.508941 0.315946
ED 0.042109 0.184460 0.248786 0.727413
END 0.263940 0.645782 0.593063 0.078554
NSD -0.058373 0.886713 -0.111786 0.323847
NND 0.169004 0.159007 -0.021443 0.796064
FORL 0.776970 = -0.189957 0.113991 0.209375
HAL 0.936216 0.015471 0.113066 -0.107870
HIL 0.852890 = -0.051712 0.150553 0.154111
FOTL 0.932469 0.147455 0.044485 0.068645
FOL 0.784388 0.333820 0.095038 0.209488
TIBL 0.743402 0.023610 0.266693 0.084073
Eigenvalue 5.977193 2.369640 1.412833 0.905600
% Variance 42.69424 16.92600 10.09166 6.46857
colouration. All specimens of B. boehmei had a bright red
outer iris area and a brownish inner iris area, whereas B.
sp. 16 had no such bright red colour but orange, either as
a more or less uniformly orange iris or as an orange out-
er iris area.
In a search for a possible morphometric differentiation,
we carried out a Principal Component Analysis on the ba-
sis of measurements in Table 2 (males only). The analy-
sis resulted in three factors with Eigenvalues greater than
1 (Table 3) which together explained 70% of the total vari-
ation. Because size of specimens was similar, the first fac-
tor was not representative mainly of body size, but of rel-
ative limb length; the highest factor loadings were for vari-
ables associated with limb length (Table 3). Factors 2 and
3 were associated with the shape of the head: Factor 2 with
END and NSD, and Factor 3 with mainly HW and HL.
While Factor | resulted only marginally in a trend of sep-
aration of the two species (not shown), Factors 2 and es-
pecially 3 separated most specimens of B. boehmei vs. B.
sp. 16 (Fig. 3). However, univariate analyses on the ba-
sis of the variables with highest factor loadings did not
result in a convincing separation (not shown), indicating
that morphometric data cannot serve as diagnostic char-
acters to separate these two forms.
Bonn zoological Bulletin 57 (2): 241—255
The most convincing diagnostic character comes from tad-
pole morphology and has been described in detail by Ran-
drianiaina et al. (2009a, b): all tadpoles of Boophis sp. 16
(from Ranomafana and Ambohitsara; N = 75) examined
had a short (or completely absent) third posterior row of
labial keratodonts (P3), whereas in B. boehmei (from lo-
calities Andasibe and An’ Ala) this row was slightly short-
er than in other species of the B. goudoti group, but still
much longer than in B. sp. 16, with no overlap in num-
bers of labial keratodonts in P3 and almost no overlap in
relative length of P3 (Fig. 4).
Given this constant difference in tadpole morphology
which fully correlates with high mitochondrial divergences
(among the highest observed between closely related man-
tellid frog species), and with fully separated haplotypes
in two nuclear genes, we conclude that B. boehmei and
B. sp. 16 constitute two separate and independent evolu-
tionary lineages. Therefore, they should best be consid-
ered as distinct species, although cryptic in adult morphol-
ogy and advertisement calls. In the following we thus de-
scribe B. sp. 16 as a new species.
Boophis quasiboehmei sp. n.
(Figs 5—6)
Holotype. ZSM 227/2006 (field number ZCMV 3045),
adult male (Fig. 5), collected at Ambatovory, at the edge
of Ranomafana National Park, south-eastern Madagascar,
21°14,279’ S, 47°25,487’ E, 966 m a.s.l., on 26 February
2006 by M. Vences, Y. Chiari, T. Rajoafiarison, E. Raje-
riarison, P. Bora and T. Razafindrabe.
Paratypes. ZFMK 59881-59882, two adult males, col-
lected in the Ranomafana region, south-eastern Madagas-
car, in December 1994 by M. Burger; ZSM 715/2003
(FG/MV 2002-0363), one adult male, collected at Vo-
hiparara (close to the Kidonavo bridge), Ranomafana Na-
tional Park, 21°13’ S, 47°22’ E, ca. 1000 m a.s.1., on 20
January 2003, by F. Glaw, M. Puente, L. Raharivololoni-
aina, M. Thomas and D. R. Vieites; ZSM 228/2006
(ZCMV 3051), ZSM 229/2006 (ZCMV 3069), and ZSM
230/2006 (ZCMV 3070), three adult males, from same lo-
cality and with same collectors and collection date; ZSM
224/2006 (ZCMV 2988), male, collected at Sahamalao-
tra, Ranomafana National Park, south-eastern Madagas-
car, 21°14.113’ S, 47°23.767’ E, south-eastern Madagas-
car, on 25 February 2006 by M. Vences, Y. Chiari, T. Ra-
joafiarison, E. Rajeriarison, P. Bora and T. Razafindrabe;
ZSM 226/2006 (ZCMV 2951), male, collected at Imalo-
ka, Ranomafana National Park, south-eastern Madagas-
car, 21°14,527’ S, 47°27,909’ E; 1020 m a.s.1., on 23 Feb-
ruary 2006 by Y. Chiari, P. Bora, T. Rajoafiarison, E. Ra-
jeriarison, and T. Razafindrabe; ZSM 231/2006 (ZCMV
OZFMK
Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 249
Fig. 5. Dorsolateral (A) and ventral (B) views of the male holotype of Boophis quasiboehmei sp. n. (ZSM 227/2006) in life.
3360), male, collected at Ranomena, 21°12,736’ S,
47°26,010’ E, Ranomafana National Park, south-eastern
Madagascar, on 28 February 2006, M. Vences, Y. Chiari,
T. Rajoafiarison, and E. Rajeriarison; ZSM 232/2006
(ZCMV 3374) from the Ranomafana region, perhaps col-
lected at Ranomafanakely river but without precise col-
lecting data; ZSM 2322/2007 (ZCMV 5948), male, col-
lected at Sahamalaotra, Ranomafana National Park,
south-eastern Madagascar, 21°14.113’S, 47°23.767’ E, on
5 March 2007 by M. Vences, A. StrauB, R. D. Randriani-
aina, and K. C. Wollenberg.
Bonn zoological Bulletin 57 (2): 241-255
Diagnosis. Assigned to the genus Boophis based on the
presence of an intercalary element between ultimate and
penultimate phalanges of fingers and toes (verified by ex-
ternal examination), presence of nuptial pads and absence
of femoral glands in males, and overall similarity to oth-
er Boophis species. Assigned to the Boophis goudoti group
because of its brownish ground colour, presence of der-
mal flaps or tubercles on heels and elbows, presence of
white tubercles ventrally of the cloacal opening, presence
of a sharp canthus rostralis, absence of red skin colour,
and molecular phylogenetic relationships.
©ZFMK
250 Miguel Vences et al.
Fig. 6. Specimens of Boophis quasiboehmei sp. n. in life: (A) frontal and (B) ventral views of a male from Ambohitsara (field
number ZCMV 5867); (C) dorsolateral and (D) ventral views of a male from Andohahela (deposited in UADBA); (E) male from
Ranomafana (deposited in UADBA); (F) male paratype ZFMK 59882 from Ranomafana (photo by M. Burger).
Together with B. boehmei, the smallest species in the
Boophis goudoti group characterized by a deviant oral
morphology of the tadpole which is unknown from any
other Boophis species. Boophis quasiboehmei sp. n. dif-
fers from all described species in the B. goudoti group by
substantial genetic differentiation (> 6% pairwise diver-
gence in a fragment of the 16S rRNA gene) and further-
Bonn zoological Bulletin 57 (2): 241—255
more from B. goudoti, B. obscurus, B. periegetes, B.
madagascariensis, B. roseipalmatus, B. brachychir, B.
entingae, B. rufioculis, B. burgeri, B. reticulatus, B. ax-
elmeyeri, and B. spinophis by smaller size (SVL of adult
males 28-31 mm versus 31—82 mm) and bioacoustic dif-
ferentiation (see Vences et al. 2006 for details). B. quasi-
boehmei sp. n. is most similar to B. boehmei and differs
©ZFMK
Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 251
Fig. 7. Male specimens of Boophis boehmei from Andasibe in
life: (A) paratype ZSM 563/1999 (originally ZFMK 53643); (B)
paratype ZFMK 52637.
from this species by an orange (versus red) outer iris ring,
by a very short third posterior keratodont row in the tad-
pole, consisting of only 0-15 keratodonts (versus 23-63
keratodonts in B. boehmei, see Randrianiaina et al. 2009b),
and substantial genetic differentiation.
Description of holotype. Adult male in excellent state of
preservation, muscles of right thigh removed as DNA tis-
sue sample. SVL 26.7 mm. Body moderately slender; head
slightly longer than wide, wider than body; snout point-
ed in dorsal view, obtuse to acuminate in lateral view; nos-
trils directed laterally, eqidistant to eye and to tip of snout;
canthus rostralis sharp, straight in dorsal view from eye
to nostril, slightly curved from nostril to tip of snout; lo-
real region slightly concave; eye large; tympanum distinct,
rounded, TD 54% of ED; supratympanic fold narrow,
prominent; vomerine odontophores distinct, well separat-
ed in two slightly elongated patches, positioned median
between choanae; choanae medium-sized, rounded.
Tongue distinctly bifid and free posteriorly. Arms mod-
erately slender; a small pointed dermal appendage on el-
Bonn zoological Bulletin 57 (2): 241-255
bow; subarticular tubercles single, round; inner palmar tu-
bercle poorly recognizable; fingers poorly webbed and
without lateral dermal fringes; webbing formula 1(—),
21(—), 2e(1), 3111.5), 3e(1.5), 4(1); relative length of fin-
gers 1<2<4<3 (finger 2 distinctly shorter than finger 4);
finger discs enlarged. Hind limbs slender; a pointed der-
mal appendage on heel; tibiotarsal articulation reaching
widely beyond snout tip when hind limb is adpressed
along body; lateral metatarsalia separated by webbing; in-
ner metatarsal tubercle medium-sized, distinct, elongat-
ed; no outer metatarsal tubercle; toes moderately webbed;
webbing formula 1(0), 2i(1), 2e(0), 31(1), 3e(0), 41(2),
4e(2), 5(0.75); relative length of toes 1<2<3=5<4; toe
discs enlarged. Skin smooth on dorsal surfaces, smooth
on throat and chest, coarsely granular on belly, rather
smooth on ventral surface of thighs, prominent scattered
tubercles around cloaca. A worm-like parasite (possibly
a nematode) apparently tried to escape when the frog was
preserved and sticks in the left nostril.
Measurements (in mm): SVL 26.7, HW 10.6, HL 11.2, ED
SH/REND 23. NSD23.NND)3:3, 0D) 2.0, Th 15.2, HAL
9.1, FOL 11.1, FOTL 20.8.
After almost four years in preservative, ground colour of
upper surface of head, dorsum and limbs greyish brown,
with few irregularly scattered and indistinct darker mark-
ings; supratympanic fold and tympanic region not distinct-
ly coloured; upper lip creamy white; dorsal surfaces of
thigh, shank, tarsus and external toe, as well as lower arm,
hand and external finger with distinct dark brown cross-
bands; flanks brown with small pale white spots and dots,
forming a reticulated pattern; several whitish dots below
the cloaca, but no additional single white tubercles in the
cloacal region; posterior surfaces of thighs greyish pale
brown with beige reticulation on the proximal part, light
brown without reticulations in the distal part; ventral sur-
face creamy beige, with some pale greyish mottling along
the lower jaw, the lower arms, hands and feet.
In life, ground colour of upper surface of head, dorsum
and legs light brown (slightly darker on the head), with
few irregularly scattered yellowish spots on the back and
scattered dark dots on back and more densely on the lat-
eral parts of the head; flanks with reticulated pattern of
brown, yellow and white; upper surfaces of hands and feet
mottled with brown and yellowish; outer edge of tarsus
with thin white line and white tarsal tubercle, outer edge
of lower arm with white tubercle; two irregular rows of
white tubercles on shank; dorsal surfaces of limbs with
moderately distinct brown crossbands; posterior surfaces
of thighs white, numerous white tubercles around the cloa-
ca and uniformly brown posteriorly. Throat, chest and ven-
ter creamy white; two irregular bluish spots on throat. Ven-
tral surfaces of limbs only partially with whitish pigment,
©ZFMK
252 Miguel Vences et al.
largest parts of thighs, shanks, hands and feet without
white pigment. Outer iris almost uniformly bright orange,
broadened above; inner iris ring brownish with some ves-
sel-like brown reticulation; iris surrounded by a black ring;
posterior iris periphery blue.
Variation. All paratypes were similar to the holotype in
general morphology. For measurements, see Table 2. Male
SVL ranged from 26.7—29.3 in the Ranomafana region,
and was 30.8 mm in one specimen from Midongy. No fe-
males are known. Colouration was relatively constant in
various localities of Ranomafana National Park, and in
Ambohitsara (Fig. 6). The rather uniform orange eye
colouration in life was typical for most specimens although
at Andohahela (Fig. 6C) specimens tentatively assigned
to this species had a more reddish eye colour.
Distribution. Besides different sites in (1) the Ra-
nomafana region, the species is also known from (2) Tsi-
tolaka forest near Ambohitsara, about 30 km from Ra-
nomafana, and was tentatively identified from (3) Befo-
taka-Midongy Reserve (specimen ZSM 178/2006), and
from (4) Andohahela National Park (Col Tanatana,
24°44’ S, 46°50’ E, 750 m a.s.l.). in the extreme south-
east of Madagascar (GenBank accession number
AY848529; specimen FGZC 236, deposited in UADBA).
Natural history. At Ranomafana National Park, Boophis
quasiboehmei sp. n. was one of the most common species
of frogs and its larvae occurred in 29 out of 30 streams
surveyed for tadpoles (Randrianiaina et al. 2009b; StrauB
et al. 2010). Adult specimens, however, were less com-
monly found, and in some areas occurred only in some
densely clustered demes along small stretches of the
streams. Males were observed calling at night from perch
heights of 2-3 m from bushes and trees close to streams
in primary as well as degraded rainforest.
Vocalization. Generally, calls of Boophis quasiboehmei
sp. n. exhibit a characteristic structure, consisting of short
to moderately long pulsatile notes. However, the pattern
of emission of these notes is highly variable and mostly
irregular. Sometimes, notes are combined to regular se-
ries (2—6 notes), with the initial note being longer than sub-
sequent secondary notes. The calls emitted by the holo-
type (Fig. 8) and recorded on 26 February 2006 at Am-
batovory have the main frequency distributed between
2100 and 3400 Hz, with additional frequency bands of
lower amplitude at 5500-6000 Hz and 8100-8900 Hz. Nu-
merical parameters for the holotype calls are as follows
(range followed by mean + standard deviation): duration
of note series, 335-736 ms (519 + 203; n = 3); number
of notes per series, 3-6 (4.3 + 1.5; n = 3); note duration
(including initial notes within series), 66-79 ms (72.1 +
4.6; n = 8), duration of secondary notes within series,
Bonn zoological Bulletin 57 (2): 241-255
Frequency (kHz)
No
Relative
amplitude ©
0 250 500 750
1000
Relative
amplitude
0 25 50 75 100
Time (ms)
Fig. 8. Spectrogram, corresponding waveform, and expanded
waveform (bottom) of the initial note of a regular note series
emitted by the holotype of Boophis quasiboehmei sp. n. Record-
ing obtained on 26 February 2006 at Ambatovory, Ranomafana
National Park.
20-34 ms (24.9 + 4.6; n = 8); pulses/note, 5-19 (12.6 +
6.2; n= 15); inter-note intervals, 97-125 ms (109.9 + 7.5;
n= 10); dominant frequency, 2680-2963 Hz (2807 + 86;
n= 10).
A short sequence with three notes recorded on 1 March
1996 at Ranomafana (Vences et al. 2006, CD 1, track 66)
has the following parameters: duration of note series, 373
ms, notes/series, 3; note duration, 18—58 ms; pulses/note,
5—12; inter-note intervals, 139-142 ms; dominant frequen-
cy, 2550-2637 Hz.
Calls of B. quasiboehmei sp. n. from Ambohitsara
recorded on 3 March 2007 generally agree in structure
with those emitted by the holotype, although they have
shorter note duration and more variable, distinctly longer
inter-note intervals. Numerical parameters are as follows:
duration of note series, 527 ms (n = 1); number of notes
per series, 6 (n= 1); note duration (including initial notes
within series), 22-47 ms (35.2 + 7.3; n= 13); pulses/note,
4—12 (7.9 +2.5; n= 18); inter-note intervals, 475—942 ms
(724.4 + 138.8; n= 16); dominant frequency, 2293-2572
Hz (2465 x 90; n= 9).
Comparative call data. The morphologically most sim-
ilar species, Boophis boehmei, has an almost identical call
compared to that of B. quasiboehmei sp. n. A re-analysis
of calls of B. boehmei from Andasibe (type locality)
recorded on 12 January 1992 at 23°C (Fig. 9) revealed the
following parameters: duration of note series, 455—530 ms
©OZFMK
Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 253
Relative
amplitude ©
0 250 500 750 1000
Relative
amplitude
0 25 50 75 100
Time (ms)
Fig. 9. Spectrogram, corresponding waveform, and expanded
waveform (bottom) of the initial note of a regular note series
emitted by Boophis boehmei. Recording obtained on 12 Janu-
ary 1992 at Andasibe (air temperature 23°C).
(n = 2); number of notes per series, 3—4 (n = 2); note du-
ration, 27-106 ms (62.6 + 23.0; n = 11); pulses/note,
10—24 (15.7 + 4.8; n= 9); inter-note intervals, 93-157 ms
(125.0 + 29.6; n =5); dominant frequency, 2640-3177 Hz
(2835 + 165.6; n= 8).
A second recording from the type locality of B. boehmei
recorded on 7 December 2001 at 24.8°C (Vences et al.
2006, CD 1, track 64) differs from the one described above
by longer inter-note intervals. Numerical parameters are
as follows: note duration, 34-98 ms (62.7 + 19.7; n= 18);
pulses/note, 13—23 (16.7 + 3.6; n = 11); inter-note inter-
vals, 591-1070 ms (766.1 + 210.0; n =7); dominant fre-
quency, 2360-2980 Hz (2760 + 198; n = 12). In this
recording, a single regular series composed of 6 notes 1s
present, exhibiting note durations of 3444 ms and inter-
note intervals within the series of 61—85 ms.
A call recording of B. boehmei from Ankeniheny record-
ed on 20 March 1994 at 22°C air temperature showed note
duration of 16—61 ms, inter-note intervals of 162—164 ms
and a dominant frequency of 2500-2800 Hz.
In conclusion, there are no temporal or spectral call char-
acters that distinguish B. boehmei from B. quasiboehmei
sp. n. (see above).
Etymology. The specific epithet is a combination of the
Latin word ‘quasi’, meaning ‘almost’, and a patronym for
Wolfgang Bohme (ZFMK). It refers to the impressively
Bonn zoological Builetin 57 (2): 241-255
cryptic morphological and bioacoustic similarity of the
new species to Boophis boehmei.
DISCUSSION
The initial detection of a probable species status of
Boophis quasiboehmei sp. n. was based on its large diver-
gence in a single marker of mitochondrial DNA. Due to
the extent of this divergence (>6% to all described
species), Vieites et al. (2009) deviated slightly from their
usual rationale and listed this species as confirmed can-
didate species, despite the lack of concordant indications
by independent taxonomic characters. Although the work
protocol of integrative taxonomy proposed by Padial et
al. (2010) would allow for the description of species based
on single characters if these are deemed to be sufficient-
ly indicative of the existence of independent evolution-
ary lineages, we do not recommend this procedure. In-
stead, we only decided to formally describe B. quasi-
boehmei sp. n. as new species once that independent and
congruent evidence of various taxonomic characters had
accumulated, even if those were subtle at first view: (1)
a weak and not fully constant difference in adult eye
colouration, (2) a slight tendency of morphometric differ-
entiation detectable only by multivariate techniques, (3)
a constant difference in tadpole morphology, and (4) con-
cordance between three independent molecular markers
(two nuclear and one mitochondrial). The molecular con-
cordance alone would be sufficient for species recogni-
tion under the genealogical concordance method of phy-
logenetic species recognition, GCPSR (Avise & Ball
1990), but the further strict concordance with one mor-
phological character (tadpole labial keratodonts) provides
amore convincing evidence, especially because it is based
on large series of individuals (Randrianiaina et al. 2009a,
b). We are therefore convinced that Boophis quasiboehmei
sp. n. and B. boehmei are to be considered as distinct
species under an evolutionary or general lineage species
concept (de Queiroz 2007).
Among the various mechanisms of species diversification
discussed for Madagascar (Vences et al. 2009), two (the
watershed and the river barrier mechanism) might apply
to the species pair B. boehmei and B. quasiboehmei sp. n.
that occur in two different neighbouring centres of en-
demism (CE2 and CE3) as defined by Wilmé et al. (2006),
and because these two CEs are divided by the Mangoro
river that has been invoked as an important river barrier
in eastern Madagascar (see Vences et al. 2009). Discern-
ing between these hypotheses is difficult, but both are con-
tradicted by the fact that B. quasiboehmei sp. n. also oc-
curs in Andohahela, which is in a different CE (CE5) and
separated by a further large river barrier (the Mananara
river). Also, the fact that numerous other red-eyed
©ZFMK
treefrog species and candidate species have been already
identified from eastern Madagascar (see Vieites et all.
2009: B. axelmeyeri, B. rufioculis, B. sp. 8, B. sp. 40, B.
sp. 41), several of which appear to be microendemic to
small areas while others might be more widespread, in-
dicates a more complex situation. Only a more compre-
hensive study of this group, with assessments of the sta-
tus of all candidate species and their phylogenetic rela-
tionships, and a more detailed analysis of their distribu-
tion, will significantly contribute to the understanding of
the diversification mechanisms that may have lead to this
surprising morphological cryptic diversity. However, the
fact that the phylogenetic position of B. boehmei and B.
quasiboehmei 1s unclarified should not be interpreted as
casting doubts on the species status of B. quasiboehmei
since this new species 1s differentiated from topotypical
B. boehmei by a high genetic differentiation and tadpole
mouthparts, and from all other nominal species in the B.
goudoti group by a high genetic differentiation, tadpole
mouthparts, adult morphology, and advertisement calls.
However, clarifying the phylogenetic relationships of all
species and candidate species will be important to under-
stand the status of the various UCS and CCS in the group
and to be able to provide formal descriptions of those for
which the data will confirm the status as distinct species.
Additional data still missing at this time are on tadpole
morphology of the populations from Andohahela, M1-
dongy, Sahafina and Mahasoa that herein we have as-
signed in a preliminary way to B. quasiboehmei (Ando-
hahela, Midongy) or different candidate species (Sahafi-
na, Mahasoa).
At Ranomafana National Park, Boophis quasiboehmei sp.
n. was commonly encountered at least in its tadpole stage,
and its occurrence was confirmed at Andohahela Nation-
al Park and tentatively in Befotaka-Midongy National
Park. Although we never observed the species in second-
ary vegetation formations, it appears to be tolerant to some
degree of rainforest degradation. The relatively large dis-
tribution area (from Ranomafana to Andohahela), its oc-
currence in at least two protected areas and large area of
occupancy at least in the Ranomafana area lead us to pro-
pose an IUCN red list status of Least Concern for this new-
ly described species (compare Andreone et al. 2005, 2008).
Acknowledgements. For assistance in the field we are indebt-
ed to Ylenia Chiari, Parfait Bora, Emile Rajeriarison, Theo Ra-
joafiarison, Tokihery Razafindrabe, Axel StrauB, and Katharina
C. Wollenberg. Marius Burger provided a photo and collected
specimens of the new species. Roger-Daniel Randrianiaina kind-
ly contributed the tadpole photographs. Meike Kondermann and
Gabriele Keunecke helped with lab work. This study was made
possible by collaboration agreements of the author’s institutions
with the Université d’ Antananarivo Département de Biologie An-
imale (UADBA) and the Association Nationale pour la Gestion
des Aires Protegées. We are grateful to the staff of UADBA for
Bonn zoological Bulletin 57 (2): 241-255
254 Miguel Vences et al.
their continuous support, and to the Malagasy authorities for re-
search and export permits. This research was supported by grants
of the Volkswagen Foundation to MV and FG, and of the
Deutsche Forschungsgemeinschaft to MV (grant number
VE247/2-1).
REFERENCES
Andreone F (1993) Two new treefrogs of the genus Boophis
(Anura: Rhacophoridae) from central-eastern Madagascar.
Bollettino del Museo Regionale di Scienze Naturali di Tori-
no 11: 289-313
Andreone F (1996) Another new green treefrog, Boophis anjana-
haribeensis n. sp. (Ranidae: Rhacophorinae), from northeast-
ern Madagascar. Aqua 2: 25—32
Andreone F, Cadle JE, Cox N, Glaw F, Nussbaum RA, Raxwor-
thy CJ, Stuart SN, Vallan D, Vences M (2005) Species review
of amphibian extinction risks in Madagascar: conclusions from
the Global Amphibian Assessment. Conservation Biology 19:
1790-1802
Andreone F, Cox N, Glaw F, Kohler J, Rabibisoa NHC, Ran-
driamahazo H, Randrianasolo H, Raxworthy CJ, Stuart SN,
Vallan D, Vences M. (2008) Update of the Global Amphib-
ian Assessment for Madagascar in light of new species dis-
coveries, nomenclature changes, and new field information.
Monografie del Museo Regionale di Scienze Naturali di Tori-
no 45: 419-438
Andreone F, Nincheri R, Piazza R (1995) Un nouveau Boophis
vert (Ranidae: Rhacophorinae) des foréts pluviales du Sud de
Madagascar. Revue francaise de Aquariologie et Herpetolo-
gie 21: 121-127
Avise JC, Ball RM (1990) Principles of genealogical concor-
dance in species concepts and biological taxonomy. In Sur-
veys in Evolutionary Biology (Futuyma D and Antonovics J,
eds.), Vol. 7, pp. 45-67, Oxford University Press
Blommers-Schlésser RMA (1979) Biosystematics of the Mala-
gasy frogs. H. The genus Boophis (Rhacophoridae). Bijdra-
gen tot de Dierkunde 49: 261-312
Bruford MW, Hanotte O, Brookfield JFY, Burke T (1992) Sin-
gle-locus and multilocus DNA fingerprint. In: Hoelzel, A.R.
(Ed.), Molecular Genetic Analysis of Populations: A Practi-
cal Approach. IRL Press, Oxford, pp. 225-270
Cadle J (1995) A new species of Boophis (Anura: Rhacophori-
dae) with unusual skin glands from Madagascar, and a dis-
cussion of variation and sexual dimorphism in Boophis albi-
labris (Boulenger). Zoological Journal of the Linnean Soci-
ety 115: 313-345
Chiari Y, Vences M, Vieites DR, Rabemananjara F, Bora P,
Ramilijaona Ravoahangimalala O, Meyer A (2004) New ev-
idence for parallel evolution of colour patterns in Malagasy
poison frogs (Mantella). Molecular Ecology 13: 3763-3774.
Clement M, Posada D, Crandall KA (2000) TCS: a computer
program to estimate gene genealogies. Molecular Ecology 9:
1657-1659
de Queiroz K (2007) Species concepts and species delimitation.
Systematic Biology 56: 879-886
Gehring PS, Ratsoavina FM, Vences M (2010) Filling the gaps
— Amphibian and reptile records from lowland rainforests in
eastern Madagascar. Salamandra, In press
Glaw, F, Kohler J, De la Riva I, Vieites DR, Vences M (2010)
Integrative taxonomy of Malagasy treefrogs: combination of
molecular genetics, bioacoustics and comparative morpholo-
gy reveals twelve additional species of Boophis. Zootaxa 2383:
1-82
©ZFMK
Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 255
Glaw F, Thiesmeier B (1993) Bioakustische Differenzierung in
der Boophis luteus-Gruppe (Anura: Rhacophoridae), mit
Beschreibung einer neuen Art und einer neuen Unterart. Sala-
mandra 28: 258-269
Glaw F, Vences M (1992) A Fieldguide to the Amphibians and
Reptiles of Madagascar. — KéIn, Vences & Glaw, 331 pp.
Glaw F, Vences M (1994) A fieldguide to the amphibians and
reptiles of Madagascar. 2nd edition. Cologne, Vences & Glaw
Verlag, 480 pp.
Glaw F, Vences M (1997a) Anuran eye colouration: definitions,
variation, taxonomic implications and possible functions, pp.
125-138. In: Béhme W, Bischoff W, Ziegler T (eds.) Herpe-
tologia Bonnensis. SEH Proceedings, Bonn
Glaw F, Vences M (1997b) Neue Ergebnisse zur Boophis gou-
doti-Gruppe aus Madagaskar: Bioakustik, Fortpflanzungsstra-
tegien und Beschreibung von Boophis rufioculis sp. nov. Sa-
lamandra 32: 225-242
Glaw F, Vences M (2002) A new cryptic treefrog species of the
Boophis luteus group from Madagascar: bioacoustic and ge-
netic evidence (Amphibia, Anura, Mantellidae). Spixiana 25:
173-181
Glaw F, Vences M (2006) Phylogeny and genus-level classifi-
cation of mantellid frogs. Organisms Diversity & Evolution
6: 236-253
Glaw F, Vences M (2007) A Field Guide to the Amphibians and
Reptiles of Madagascar. Third edition. Cologne, Vences &
Glaw Verlag, 496 pp.
Glaw F, Vences M, Andreone F, Vallan D (2001) Revision of the
Boophis majori group (Amphibia: Mantellidae) from Mada-
gascar, with descriptions of five new species. Zoological Jour-
nal of the Linnean Society 133: 495-529
Kohler J (2000) Amphibian diversity in Bolivia: a study with
special reference to montane forest regions. Bonner zoologis-
che Monographien 48: 1—243
Kohler J, Glaw F, Vences M (2007) A new green treefrog, genus
Boophis Tschudi 1838 (Anura Mantellidae), from arid west-
ern Madagascar: phylogenetic relationships and biogeograph-
ic implications. Tropical Zoology 20: 215-227
Kohler J, Glaw F, Vences M (2008) Two additional treefrogs of
the Boophis ulftunni species group (Anura: Mantellidae) dis-
covered in rainforests of northern and south-eastern Madagas-
car. Zootaxa 1814: 37-48
Librado P, Rozas J (2009) DnaSP v5: A software for compre-
hensive analysis of DNA polymorphism data. Bioinformatics
25: 1451-1452
Nylander JAA (2002) MrModeltest v1.0b. Program distributed
by the author. Available from: <http://www.ebc.uu.se/
systzoo/staff/nylander.html>
Padial JM, Kohler J, Munoz A, De la Riva I (2008) Assessing
the taxonomic status of tropical frogs through bioacoustics:
geographical variation in the advertisement calls in the
Eleutherodactylus discoidalis species group (Anura). Zoolog-
ical Journal of the Linnean Society 152: 353-365
Padial JM, Miralles A, De la Riva I, Vences M (2010) The in-
tegrative future of taxonomy. Frontiers in Zoology 7: art. 16
Randrianiaina RD, Raharivololoniaina L, Preuss C, Straus A,
Glaw F, Teschke M, Glos J, Raminosoa N, Vences M (2009a)
Descriptions of the tadpoles of seven species of Malagasy
treefrogs, genus Boophis. Zootaxa 2021: 23-41
Randrianiaina RD, Navarro Antunez R, Canitz J, Forth F, Lemme
I, Rodriguez B, Rinas H, Thanert R, Troger P, Westphal N,
Willim A, Wollenberg KC, Straul} A, Vences M (2009b) Vogue
or adaptive character? A tadpole’s goatee helps to distinguish
two cryptic treefrog species of the genus Boophis. Herpetol-
ogy Notes 2: 165-173
Bonn zoological Bulletin 57 (2): 241-255
Raharivololoniaina L, Grosjean S, Rasoamampionona
Raminosoa N, Glaw F, Vences M (2006) Molecular identifi-
cation, description and phylogenetic implications of the tad-
poles of 11 species of Malagasy treefrogs, genus Boophis.
Journal of Natural History 40: 1449-1480
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phy-
logenetic inference under mixed models. Bioinformatics 19:
1572-1574
Stephens M, Smith NJ, Donnelly P (2001) A new statistical
method for haplotype reconstruction from population data.
American Journal of Human Genetics 68: 978-989
StrauR® A, Reeve E, Randrianiaina R, Vences M, Glos J (2010)
The world’s richest tadpole communities show functional re-
dundancy and low functional diversity: ecological data on
Madagascar’s stream-dwelling amphibian larvae. BMC Ecol-
ogy 10: article 12
Templeton AR, Crandall KA, Sing CF (1992) A cladistic analy-
sis of phenotypic associations with haplotypes inferred from
restriction endonuclease mapping and DNA sequence data. IT.
Cladogram estimation. Genetics 132: 619-633
Vallan D, Vences M, Glaw F (2003) Two new species of the
Boophis mandraka complex (Anura, Mantellidae) from the
Andasibe region in eastern Madagascar. Amphibia-Reptilia 24:
305-319
Vallan D, Vences M, Glaw F (2010) Forceps delivery of a new
treefrog species of the genus Boophis from eastern madagas-
car (Amphibia: Mantellidae). Amphibia-Reptilia 31: 1-8
Vences M, Andreone F, Glos J, Glaw F (2010) Molecular and
bioacoustic differentiation of Boophis occidentalis with de-
scription of a new treefrog from north-western Madagascar.
Zootaxa 2544: 54-68
Vences M, Chiari Y, Teschke M, Randrianiaina RD, Raharivo-
loloniaina L, Bora P, Vieites DR, Glaw F (2008) Which frogs
are out there? A preliminary evaluation of survey techniques
and identification reliability of Malagasy amphibians. Mono-
grafie d. Mus. Regio. di Scienze Natur. di Torino 45: 233-253
Vences M, Glaw F (2002) Two new treefrogs of the Boophis rap-
piodes group from eastern Madagascar. Tropical Zoology 15:
141-163
Vences M, Glaw F (2005) A new cryptic frog of the genus
Boophis from the northwestern rainforests of Madagascar.
African Journal of Herpetology 54: 77—84
Vences M, Glaw F, Marquez R (2006) The Calls of the Frogs
of Madagascar. 3 Audio CDs and booklet, 44 pp. Alosa-Fono-
zoo, Barcelona
Vences M, Wollenberg KC, Vieites DR, Lees DC (2009) Mada-
gascar as a model region of species diversification. Trends in
Ecology and Evolution 24: 456-465
Vieites DR, Min MS, Wake DB (2007) Rapid diversification and
dispersal during periods of global warming by plethodontid
salamanders. Proceedings of the National Academy of Sci-
ences of the U.S.A. 104: 19903-19907
Vieites DR, Wollenberg KC, Andreone F, Kohler J, Glaw F,
Vences M (2009) Vast underestimation of Madagascar’s bio-
diversity evidenced by an integrative amphibian inventory.
Proceedings of the National Academy of Sciences of the
U.S.A. 106: 8267-8272
Wilmeé L, Goodman SM, Ganzhorn JU (2006) Biogeographic
evolution of Madagascar’s microendemic biota. Science 312:
1063-1065
Wollenberg KC, Andreone F, Glaw F, Vences M (2008) Pretty
in pink: a new treefrog species of the genus Boophis from
north-eastern Madagascar. Zootaxa 1684: 58-68
Received: 30.VI.2010
Accepted: 10.1X.2010
©ZFMK
(oy an 08 4 SA Sh anh
' ‘ cre : a8, Th
| wei » < i Aimar Ndi eek. «thal Me onal
: oy any i va “Hs y
: j vee 6 M01) 04 epee
4 opty ae
igiy (boy) ae :
' ;
ry a mT an.
Aa A diy m4
i | i & j
;
| | i : : ’ e ’
| | a) cg
| | / i) ;
1 | j
7 ;
4
i
Re
= cane
| i aA
iN
A
fo hoy b
Bie ois
te
t a j
Y
7 ' 4
7
inal
1
hf
i
ul
| {
| LS
Ue Wvpatllh Seige :
;
aay ‘i i
{) i r
Bonn zoological Bulletin Volume 57 Issue 2 | pp. 257-266 Bonn, November 2010
A new species of Pachydactylus (Squamata: Gekkonidae)
from the Otavi Highlands of northern Namibia
Aaron M. Bauer
Department of Biology, Villanova University, 800 Lancaster Avenue, Villanova, Pennsylvania 19085, USA;
E-mail: [email protected]
Abstract. A new species of the “northwestern clade” of Pachydactylus 1s described from the Otavi Highlands of north-
eastern Namibia. It is distinguishable from all other members of this clade and from the superficially similar members
of the Pachydactylus serval/weberi group on the basis of its inclusion of the rostral in the nostril rim, the possession of
a maximum of only four undivided scansors beneath the digits of the pes, is 16 rows of strongly keeled, rounded, juxta-
posed dorsal trunk tubercles, its projecting, keeled, lanceolate caudal tubercles, and its complex dorsal trunk patterning.
Its probable closest relative is P. otaviensis, also form the Otavi Highlands. These are the only known endemic reptiles
from this dolomitic area and their existence points both to an unappreciated area of diversity and endemism in northeast-
ern Namibia and to the need for additional herpetological work in even well-known parts of the country.
Key words. Gekkonidae, Pachydactylus, Namibia, new species.
INTRODUCTION
Pachydactylus Wiegmann, 1834 is the most species-rich
genus of geckos in southern Africa, with more than 50
species currently recognized (Bauer & Lamb 2005; Bauer
et al. 2006a, 2006b; Branch et al. 2010). Although all parts
of the subcontinent are inhabited by members of this
group, the arid zones of Namibia the adjacent portions of
the Northern Cape Province of South Africa have the high-
est diversity. A minimum of 35 species of Pachydactylus
occur in the Republic of Namibia alone, the majority of
which are endemic (Branch 1998; Bauer et al. 2002,
2006a; Branch et al. 2010). Most of these fall into one of
two species-rich clades that have been previously identi-
fied: the Pachydactylus serval/weberi group and the
“northwestern clade” of Pachydactylus (sensu Bauer &
Lamb 2005). Most species in both clades are relatively
small-bodied, rupicolous species. Most members of the P.
serval/weberi group are restricted to southern Namibia and
the Northern Cape, with the greatest richness along the
lower Orange River Valley and in the Karasberg Moun-
tains, where up to five members of the group occur sym-
patrically. However, five members assigned to the group
have been found north of 21°S latitude: P fasciatus
Boulenger, 1888 — widely distributed in northwestern
Namibia east of the Namib and north of the Swakop Riv-
er, P. waterbergensis Bauer & Lamb, 2003 — endemic to
the immediate vicinity of the Waterberg Plateau.
P. tsodiloensis Haacke, 1966 — in the Tsodilo Hills of
Bonn zoological Bulletin 57 (2): 257-266
northwestern Botswana, and P. otaviensis Bauer, Lamb &
Branch, 2006 and an undescribed species (‘Pachydacty-
lus sp. 2’, Bauer et al. 2006a) — both from the Otavi High-
lands (Otaviberge) of northeastern Namibia. Bauer &
Lamb (2005) and Bauer et al. (2006a) used molecular phy-
logenetic data to confirm that the first three of these
species comprise a monophyletic group that is sister to the
rest of the P. serval/weberi group. However, recent mul-
ti-gene phylogenetic analyses incorporating all but one of
the recognized species of Pachydactylus (Heinicke, Jack-
man & Bauer, unpublished) have demonstrated that P.
otaviensis is not a member of the P. serval/weberi clade
(these phylogenetic results will be presented in their en-
tirety elsewhere), but rather part of the “northwestern
clade”, which otherwise comprises ten morphologically
diverse species that are widely distributed in Namibia and
southern Angola, with a single species, P.- punctatus Pe-
ters, 1854, extending southwards into South Africa and
east to the Indian Ocean coast of Mozambique (Bauer &
Branch 1995).
Excluding P. punctatus, P. otaviensis has the easternmost
distribution of any member of the “northwestern clade”,
being known only from the farms Uithoek and Varianto,
both in the Tsumeb District, Oshikoto Region in the east-
ern Otavi Highlands (quarter degree square 1917Bc; Fig.
1). A second species from the Otavi Highlands was sig-
©ZFMK
bo
Nn
oo
Aaron M. Bauer
Table 1. Mensural and labial scale data for the type series of Pachydactylus boehmei sp.n. Abbreviations as in Materials and Me-
thods, all measurements in mm.
Holotype
MCZ R184884 MCZ R184880
Sex female female
SVL 44.4 43.21
ForeaL 6.6 6.8
CrusL 7.9 79
TailL (total) 44.5 6.9
TailL (regen.) = BR
TailW 4.8 4.7
TrunkL 21.0 18.8
HeadL 13.7 14.1
HeadW 8.3 8.3
HeadD 5.0 5.3
OrbD 315 3.8
EyeEar 3.4 Bill
SnEye 4.9 5.0
NarEye Sai) 329.
Interorb 44 4.3
EarL 1.0 0.9
Internar 1.4 1.1
Supralab. (L/R) 10/9 11/10
Infralab. (L/R) TT 8/8
Paratypes
MCZ R184881 MCZ R184882 MCZ R184883
female male female
44.0 35.4 34.8
6.6 5.4 4.7
8.6 ae) 5.9
39.0 35.8 30.3
33.4 — 21.6
47 3.9 3.5
19.0 15.6 13.8
13.0 11.5 12.0
9.0 6.9 V2
5.3 3.8 4.0
3.8 2.8 3.3
3.2 2.9 2.5
4.7 4.2 4.2
3.6 2.9 3.0
3.9 3.6 3.0
1.0 0.7 0.7
1.3 1.0 1.2
10/10 9/9 10/10
7/8 8/8 9/8
naled by Bauer et al. (2006a) as “Pachydactylus sp. 2”,
but was not described as it was known only from one ju-
venile and one hatchling, making meaningful comparisons
with other species difficult. However, Bauer et al.
(2006a) noted that it exhibited some features shared with
the PR. weberi complex sensu stricto and others with the
P. serval complex, and that it possessed a unique and di-
agnostic juvenile color pattern. Subsequent field work on
the Farm Uisib has yielded a series of adult specimens of
this species, permitting its description. Ongoing molecu-
lar phylogenetic work verifies that it too is, in fact, cor-
rectly assigned to the “northwestern clade” of Pachydact-
lyus.
MATERIALS AND METHODS
The following measurements were taken with Brown and
Sharpe Digit-cal Plus digital calipers (to the nearest 0.1
mm) as per Bauer et al. (2006a): snout-vent length (SVL;
from tip of snout to vent), crus length (CrusL; from base
of heel to knee); tail length (TailL; from vent to tip of un-
regenerated tail), tail width (TailW; measured at base of
tail); axilla to groin length (TrunkL); head length (HeadL;
distance retroarticular process of the jaw and snout-tip),
head width (HeadW; measured at angle of jaws), head
depth (HeadD; maximum height of head, from occiput to
Bonn zoological Bulletin 57 (2): 257-266
throat), ear length (EarL; longest dimension of ear); fore-
arm length (ForeaL; from base of palm to elbow); orbital
diameter (OrbD), nostril to eye distance (NarEye; distance
between anteriormost point of eye and nostril), snout to
eye distance (SnEye; distance between anteriormost
point of eye and tip of snout), eye to ear distance (Eye-
Ear; distance from anterior edge of ear opening to poste-
rior corner of eye), and interorbital distance (Interorb;
shortest distance between left and right superciliary scale
rows).
Scale counts and external observations of morphology
were made using a Nikon SMZ-1000 dissecting micro-
scope. Comparisons were made with museum material
(see Appendix) representing all species in the Pachydacty-
lus serval/weberi group and the “northwestern clade” of
Pachydactylus (sensu Bauer & Lamb 2005; Bauer et al.
2006a). Standard codes for museum collections follow
Leviton et al. (1985) except as noted (*): California Acad-
emy of Sciences, San Francisco (CAS), Museum of Com-
parative Zoology, Harvard University, Cambridge, USA
(MCZ), National Museum of Namibia, Windhoek
(NMN*), Naturmuseum und Forschungsinstitut Sencken-
berg, Frankfurt am Main (SMF), South African Museum,
Cape Town (SAM), Transvaal Museum, Pretoria (TM),
Zoologisches Forschungsmuseum Alexander Koenig,
Bonn (ZFMK).
OZFMK
A new Pachydactylus from northern Namibia 259
Fig. 1. Map of Namibia and surrounding countries illustrating
the type locality of Pachydactylus boehmei sp. n. (red star) and
of the related P. ofaviensis (blue circle) in the Otavi Highlands
of northeastern Namibia. Satellite image from NASA MODIS
sensor (available at http://visibleearth.nasa.gov).
RESULTS
Pachydactylus boehmei sp. n.
Pachydactylus sp. 2 Bauer, Lamb & Branch (Bauer et al.
2006a: 684)
Holotype. MCZ R184884 (Figs 2—3): adult male; Namib-
ia, Otjozondjupa Region, Grootfontein District, Farm Uis-
ib, 19°33’06”S, 17°14711”E, 1400 m a.s.l. coll. A.M.
Bauer, J. Marais, T. Jackman, and W.R. Branch, 15 Sep-
tember 2006.
Paratypes. MCZ R184880—81 (adult females), 184883
(subadult/adult female), MCZ R184882 (subadult/adult
male), same data as holotype.
Bonn zoological Bulletin 57 (2): 257-266
Additional material. TM 84999, 85005; Namibia, Otjo-
zondjupa Region, Grootfontein District, Farm Uisib
(IGS WS, LIN),
Diagnosis. Snout-vent length to at least 44.4 mm. A mod-
erate-sized Pachydactylus with a depressed body form.
Trunk with 16 rows of enlarged, keeled tubercles, grad-
ing into prominent conical scales on flanks (Figs 2-4). Or-
bital diameter as great as eye-ear distance. Rostral partic-
ipating 1n nostril rim. Dorsal surface of thighs and shanks
covered by enlarged conical to keeled scales. Tail with
keeled lanceolate tubercles restricted to one scale row per
tail segment. Dorsal pattern with an occipital-nuchal loop,
a “V”-shaped band on posterior of neck, a transverse bar
anterior to hindlimb insertion, and a series of oval mark-
ings or fusions thereof on the trunk (Figs 2—5).
Among its congeners P. boehmei sp n. is superficially sim-
ilar to some members of the P. weberi group, but can be
distinguished from these by its inclusion of the rostral in
the nostril rim and the possession of a maximum of only
four undivided scansors beneath the digits of the pes (ver-
sus at least five on some digits). Among other members
of the “northwestern clade” of Pachydactylus it may be
differentiated from P. bicolor Hewitt, 1926, P. punctatus,
P. scherzi Mertens, 1954, and P. caraculicus FitzSimons,
1959 by its tuberculate (versus atuberculate) dorsum, from
P. angolensis Loveridge, 1944 by its inclusion of the ros-
tral and first supralabial in the nostril border (versus both
excluded), from P. oreophilus McLachlan & Spence, 1967
by its smaller size (maximum SVL < 45 mm versus 57
mm), and lower number of subdigital lamellae (4 versus
5—6 undivided lamellae), from P. gaiasensis Steyn &
Mitchell, 1967 by its smaller size (maximum SVL < 45
mm versus 68 mm), lower number of subdigital lamellae
(4 versus 5—7 undivided lamellae), longer tail (slightly
longer than SVL versus less than SVL), and lack of a ver-
tebral stripe, from P. sansteynae Steyn & Mitchell, 1967
by its much larger dorsal tubercles (4-10 times larger than
other dorsal scales versus less than twice size of dorsal
granules) and presence (versus absence) of tubercles on
the parietal region, from P. parascutatus Bauer, Lamb &
Branch, 2002 by its larger size (to 44.4 mm versus < 40
mm SVL) and presence of a pale dorsal collar (versus no
collar), and from P. scutatus Hewitt, 1927 by is juxtaposed
(versus imbricating) keeled dorsal scales, enlarged coni-
cal (versus small and granular) flank scales, projecting
lanceolate (versus flattened and rounded to oval) caudal
tubercles, and its complex dorsal trunk patterning (versus
patternless or with small, scattered dark markings. Pachy-
dactylus boehmei sp n. is most similar to the geographi-
cally proximal P. otaviensis, but may be distinguished
from this form by its inclusion (versus exclusion) of the
rostral in the nostril rim, the presence of 4 (versus 5) lamel-
lae beneath digit IV of the pes, 16 (versus 18) longitudi-
©OZFMK
260 Aaron M. Bauer
Fig. 2.
Holotype of Pachydactylus boehmei sp. n., MCZ
R184884. Scale bar = 10 mm.
nal rows of keeled dorsal tubercles, and differences in col-
or pattern.
Description of holotype. Adult female. Snout-vent
length (SVL) 44.4 mm. Body relatively depressed, elon-
gate (TrunkL/SVL ratio 0.46). Head elongate, large
(HeadL/SVL ratio 0.31), relatively narrow
(HeadW/HeadL ratio 0.61), depressed (HeadH/HeadL ra-
tio 0.36), distinct from neck. Lores inflated; interorbital
region flat. Snout short (SnEye/HeadL ratio 0.36, longer
than eye diameter (OrbD/SnEye ratio 0.71); scales on
Bonn zoological Bulletin 57 (2): 257-266
snout enlarged, smooth, slightly domed, roughly hexag-
onal; scales on snout much larger than those of interor-
bital region and parietal table. Eye moderately large
(OrbD/HeadL ratio 0.25); orbits without extra-brillar
fringes; posterior superciliary scales bearing five small
spines; pupil vertical, with crenelated margins. Ear open-
ing oval, small (EarL/HeadL ratio 0.07), round; eye to ear
distance approximately equal to diameter of eyes (Eye-
Ear/OrbD ratio 0.97). Rostral approximately 50% as deep
(0.9 mm) as wide (1.9); no rostral groove; contacted by
two enlarged supranasals and first supralabials; nostrils
oval, each surrounded by two postnasals, one supranasal,
first supralabial, and rostral; supranasals in broad contact;
dorsal postnasals separated by two granules from one an-
other; nostril rims weakly inflated; 1—2 rows of scales sep-
arate orbit from supralabials; mental rectangular, only
slightly wider anteriorly than posteriorly, approximately
1.6 times deeper (1.8 mm) than wide (1.1 mm); no en-
larged postmentals or chin shields. Enlarged supralabials
to angle of jaws 9(R)—10(L), 8 to mid-orbit, several gran-
ular scales along labial margin to rictus; enlarged infral-
abials 7; interorbital scale rows between superciliary scale
rows (at midpoint of orbit) 30, 8 across narrowest point
of frontal bone.
Enlarged conical tubercles present from posterior border
of orbit and occiput posteriorly; dorsal trunk tubercles
large (4-10 times size of adjacent scales), rounded, with
a strongly developed median keel, forming approximate-
ly 16 longitudinal rows; tubercles largest on dorsolateral
surfaces of trunk, smaller along vertebral midline, and
grading into enlarged conical scales on flanks; each en-
larged tubercle surrounded by rosette of smaller pyrami-
dal scales, some also keeled, larger keeled tubercles typ-
ically separated from one another by a single smaller scale;
ventral scales flattened, subimbricate, becoming somewhat
larger posteriorly, approximately 40 between lowest tu-
bercular rows at midbody; non-tuberculate scales on dor-
sum at midbody similar in size to those on ventrum at
same level; gular granules less than one half size of ven-
tral scales of chest, increasing abruptly in size on throat.
No precloacal or femoral pores. Scales on palm, sole, and
ventral surface of forelimb small, smooth, granular, jux-
taposed; scales on ventral aspect of hindlimbs smooth, jux-
taposed to subimbricate; scales on dorsal aspect of fore-
limb heterogeneous, with midsized conical to keeled tu-
bercles intermixed with smaller granular to conical
scales; scales on dorsum of thigh and crus greatly enlarged,
conical and keeled, in contact with each other or narrow-
ly separated by much smaller interscales.
Forelimbs moderately short, stout; forearm short (Fore-
aL/SVL ratio 0.15); hindlimbs relatively short, tibia mod-
erately short (CrusL/SVL ratio 0.18); digits relatively
short, claws minute, stylet-like, visible only with difficul-
©ZFMK
A new Pachydactylus from northern Namibia 261
<== —— = - Sea ee es
ae ;
Fig. 3. Life photo of holotype of Pachydactylus boehmei sp. n. Photo by Johan Marais.
ty on some digits of the pes; subdigital scansors, except
for distalmost, entire, present only on distal portion of toes,
approximately 1.5 times wider than more basal (non-scan-
sorial) subdigital scales; interdigital webbing absent. Rel-
ative length of digits (manus): HI > IV > II > V > I; (pes):
IV > ll > V > II >I. Subdigital scansors, exclusive of di-
vided distalmost scansor (manus): I (4), II (4), II (4), 1V
(4), V (4); (pes) I (4), II (4), HI (4), TV (4), V (4).
Tail sub-cylindrical, clearly depressed; original tail approx-
imately snout-vent length (TailL/SVL ratio 1.00); tail con-
stricted basally, then expanded before tapering towards tip,
distinctly segmented; each segment with 5 rows of scales
dorsally and 3 ventrally, dorsal caudal , tail segment; cau-
dal tubercles heterogeneous, medial tubercles more-or-less
recumbent, lateral tubercles projecting, up to 8 keeled tu-
bercles per row basally, decreasing to 4 on distal caudal
segments; subcaudal scales smooth, imbricating, oval to
rectangular; no enlarged postcloacal spurs on side of tail-
base.
Coloration. In preservative (Fig. 2): Ground color of dor-
sum straw to yellowish brown with mid-brown markings.
A broad “V”-shaped nape band and a transverse band an-
terior to hindlimb insertion. Trunk bearing a series if ir-
regular oval markings, darker on their edges than at their
centers, 3 (left) and 4 (right) markings in paravertebral po-
sition, 6 on upper left flank, last fused with transverse
band, 2 on upper right flank followed by an irregular lon-
gitudinal marking representing the fusion of several oval
markings. An additional pair of small dark markings at an-
terior face of hindlimb insertion and an additional cross-
band on dorsum of posterior sacrum.
Bonn zoological Bulletin 57 (2): 257-266
Head with a pale stripe from nostril to anterodorsal rim
of orbit. Dark stripe along loreal region to mid-anterior
of orbit, continuing from midposterior of orbit, above ear,
to meet contralateral stripe to form a complete loop be-
tween the occiput and nape. Crown mottled, a triangular
brown marking with apex at supranasals scales extending
back to anterodorsal orbital rim. Labial scales pale with
diffuse speckling; grayish vertical markings on lateral
edges of rostral.
Limbs mottled with irregular markings. Tail with alternat-
ing irregular bands of grayish-brown and mid-brown, 20
dark bands including tail tip; most caudal tubercles cream
to beige. Body venter beige, soles and palms grayish, tail
venter grayish-brown with irregular darker gray-brown
markings scattered along length of tail.
In life (Fig. 3): Background color of dorsum a pale pink-
ish-gray. Labial scales, canthal stripe, and nape whitish.
Dark markings yellowish-to mid brown, darkest on head
and occiput. Venter white.
Variation. Variation in mensural characters of the holo-
type and paratypes are presented in Table 1. All paratypes
share with the holotype the same number of longitudinal
rows of dorsal tubercles, number of subdigital lamellae,
and configuration of the scales of the nasal region. Labi-
al scale numbers varied across the type series and are al-
so presented in Table 1. The male paratype, MCZ
R184882 has prominent precloacal spurs (Fig. 4A), each
bearing two rows of enlarged, compressed, dorsally-direct-
ed scales. Those of the dorsal row (5 scales on both sides)
larger than those of ventral row (5 scales left, 6 scales
©ZFMK
262 Aaron M. Bauer
Fig. 4.
right). Color pattern variable amongst paratypes (Figs
4-5). Dark occipital and nape bands thinner in MCZ
R184880, R184882 than in holotype. Dorsal oval patterns
largely replaced by coalescent blotches and lines except
in MCZ R184881. Dorsal pattern weakly contrasting in
MCZ R184883.
Etymology. Named for Prof. Dr. Wolfgang BOhme (born
21 November 1944), my longtime friend and colleague
and a leading contributor to African herpetology. It is a
privilege to apply this patronym to a species of one of the
continent’s dominant genera on the occasion of his nom-
inal retirement from his position at the Museum Alexan-
der Koenig. The epithet is formed in the masculine gen-
itive.
Distribution. The species is known only from Farm Uis-
ib in the Grootfontein District of northeastern Namibia
(Fig. 1). This lies in the western portion of the Otaviberge
or Otavi Highlands, 15 km northwest of the town of Otavi.
The distribution of P. boehmei sp n. in the region is un-
known and the closely related P. otaviensis occurs only
50 km to the northeast. These two geckos are relatively
isolated from other members of the “northwestern clade”
of Pachydactylus except the ubiquitous P. punctatus; the
nearest known localities for P. bicolor and P. scutatus be-
ing more than 200 km distant. Other rock-dwelling con-
geners in other clades are also quite remote, with P. wa-
terbergensis approximately 125 km to the south and P.
tsodiloensis almost 400 km to the north-northeast. The
Bonn zoological Bulletin 57 (2): 257-266
Life photos of paratypes of P. boehmei sp. n. (A) MCZ R184882, male — note the raised precloacal spur visible lateral
to the tail base. (B) MCZ R184880, female — note the transition from rounded, keeled dorsal tubercles to enlarged conical flank
scales. Photos by Johan Marais.
Otavi Highlands as a whole has been poorly explored her-
petologically and may harbor other isolated populations
and/or endemic species of lizards. A number of endemic
invertebrates and fish are already known from the Otavi-
Tsumeb-Grootfontein area (Barnard et al. 1998).
Natural history. The area where P. boehmei sp n. occurs
is characterized as mountain savanna and karstveld (Giess
1971). The type series was collected in broadleaf savan-
na on rocky dolomite hills (Fig. 6). Specimens collected
by the author and colleagues were moving on rock faces
or were found in large crevices or cracks between 22:30
and 00:30. The two Transvaal Museum specimens (see
Additional material) referred to this species were collect-
ed in the course of searching for scorpions (E. Scott & L.
Prendini, pers. comm.). Barnards Namib day gecko, Rhop-
tropus barnardi Hewitt, 1926, was also collected at Farm
Uisib, which is one of the easternmost localities for any
member of its genus. Other species observed at the type
locality were the widespread Chondrodactylus turneri
(Gray, 1864), Zrachylepis sulcata (Peters, 1867), and 7:
punctulata (Bocage, 1872). Lygodactylus capensis (Smith,
1849) was collected at the nearby Uisib farmhouse
(192332 Sa 7 ens 00uE):
Two enlarged eggs are visible through the ventral body
wall of the holotype collected in mid-September, suggest-
ing spring breeding and hatching late in the year, corre-
sponding to the rainy season. Trombiculid mites were
found on the specimens, most notably in between the
©ZFMK
A new Pachydactylus from northern Namibia 263
Fig. 5.
scales of the tail base. In the male paratype, MCZ 184882,
the infestation of mites around the tail base and scales of
the precloacal spurs was particularly severe.
Phylogenetic affinities. Pachydactylus boehmei sp n. is
similar in habitus to the other small-bodied, tuberculate
members of the “northwestern clade”. It is superficially
most similar to the neighboring species P. ofaviensis, al-
though the latter species lacks the rostral-nostril contact
that is typical for most members of the clade. Preliminary
molecular results suggest that these two species are indeed
sister taxa.
Conservation status. Pachydactytlus boehmei sp n. does
not occur in any protected areas. At its type locality it is
undisturbed and the jagged, rocky terrain precludes hu-
man encroachment into its specific habitat. However, de-
pending upon the extent of its actual range it may be un-
der some threat from local mining activity in some places.
Until such time as the species’ distribution and threats can
be evaluated more fully, I recommend that it be consid-
ered Data Defficient under the IUCN threat category sys-
tem.
Bonn zoological Bulletin 57 (2): 257-266
Paratype series of Pachydactylus boehmei sp. n. showing variation in the dorsal color pattern and degree of pattern bold-
ness. Scale bar = 10 mm.
DISCUSSION
The discovery of this apparently range-restricted species
highlights Namibia’s high biodiversity and endemism
(Maggs et al. 1998). M. Griffin (1998) identified 55 rep-
tile species as being strictly or primarily endemic to
Namibia, but recent discoveries, particularly in Pachy-
dactylus (Bauer et al. 2002, 2006a; Bauer & Lamb 2003)
have increased this to approximately 70. The “northwest-
ern clade” of Pachydactylus is particularly diverse along
the Northern Namibian Escarpment (sensu Irish 2002),
which corresponds roughly to the Kaokoveld center of
Floral Endemism (Volk 1966; van Wyk & Smith 2001) and
is recognized as a regional center of endemism for rep-
tiles in general (Crowe 1990; Simmons et al. 1998; Grif-
fin 2000). The Otavi Highlands have also been ranked as
an area of high biodiversity importance (Irish 2002), but
like the Waterberg to the south, the relatively low relief
(a maximum of 2155 m in surrounding plains of
1200-1500 m) and accessibility to surrounding areas that
promotes diversity also decreases the prospects for long-
term isolation and, consequently, endemism. Thus, it is
somewhat surprising that two species of Pachydactylus,
©OZFMK
264 Aaron M. Bauer
Fig. 6.
P. otaviensis and P. boehmei sp n., appear to be restrict-
ed to this region. Bauer (1999 [2000]) emphasized the role
of substrate specificity as a cladogeneic agent in Pachy-
dactylus and it seems likely that dependence on microhab-
itats provided by the dolomite outcrops of the Otaviberge
has isolated these species from rest of the “northwestern
clade”. Other groups of organisms that respond similarly
to historical ecological conditions should be expected to
show similar patterns of endemism and indeed this is the
case in scorpions (R.E. Griffin 1998), which include many
substrate specific rupicolous species, such as the bothri-
urid Lisposoma josehermana Lamoral, 1979, which is
largely restricted to the Otavi Highlands (Prendini 2003,
2005).
Despite over 50 years of relatively intense study (e.g.,
Mertens 1955, 1971; Haacke 1965; van den Elzen 1978;
Bauer et al. 1993; Griffin, 2000, 2003), novel herpetolog-
ical taxa continue to be discovered in Namibia on a reg-
ular basis. That Pachydactylus boehmei sp n. occurs in a
densely-populated (by Namibian standards) agricultural
district with excellent road access demonstrates that even
“well known” parts of the country remain understudied.
Acknowledgements. | thank the many colleagues and students
who have accompanied me on trips to Namibia, and in particu-
lar Johan Marais, Todd Jackman and Bill Branch, who partici-
pated on the field trip on which the types of P boehmei were
collected. I am also grateful to Andre Schoeman and his fami-
ly, who made us welcome at Farm Uisib, and to the Ministry of
the Environment and Mike Griffin, who have supported my work
in Namibia for more than 20 years. Specimens were collected
under Namibian Research/Collecting Permit 1068/2006. For ac-
cess to comparative material I thank José Rosado, Jonathan
Losos and James Hanken (MCZ), Lauretta Mahlengu and Wulf
Haacke (TM), Jens Vindum (California Academy of Sciences),
Mathilda Awases (NMN), Wolfgang B6hme (ZFMK), and Gun-
ther K6hler (SMF). Photos were kindly provided by Johan
Marais and Elizabeth Scott. This research was funded by the Na-
Bonn zoological Bulletin 57 (2): 257-266
Habitat of Pachydactylus boehmei sp. n. in the Otavi Highlands: (A) View of typical dolomite hill. (B) Broken dolomi-
te providing cracks and fissures as retreat sites for geckos. Photos by Elizabeth Scott.
tional Science Foundation of the United States through grants
DEB 0515909 and DEB 0844523 to the author. Finally, I thank
Philipp Wagner for inviting me to submit this manuscript, and
Wolfgang Bohme, whose illustrious career has provided the op-
portunity to present these data.
REFERENCES
Barnard P, Bethune S, Kolberg H (1998) Biodiversity of terres-
trial and freshwater habitats. Pp. 57-188 in Barnard P (ed) Bi-
ological Diversity in Namibia — A Country Study. Namibian
National Biodiversity Task Force, Windhoek
Bauer, AM (1999 [2000]) Evolutionary scenarios in the Pachy-
dactylus-group geckos of southern Africa: new hypotheses.
African Journal of Herpetology 48: 53—62
Bauer, AM, Branch WR (1995) Geographic variation in west-
ern populations of the Pachydactylus punctatus complex (Rep-
tila: Gekkonidae). Tropical Zoology 8: 69-84
Bauer AM, Lamb T (2003) A new species of the Pachydactylus
weberi group (Reptilia: Squamata: Gekkonidae) from the Wa-
terberg Plateau, Namibia. Cimbebasia 19: 1-12
Bauer AM, Lamb T (2005) Phylogenetic relationships of south-
ern African geckos in the Pachydactylus Group (Squamata:
Gekkonidae). African Journal of Herpetology 54: 105—129
Bauer AM, Branch WR, Haacke WD (1993) The herpetofauna
of the Kamanjab area and adjacent Damaraland, Namibia.
Madoqua 18: 117-145
Bauer AM, Lamb T, Branch WR (2002) A revision of Pachy-
dactylus scutatus (Reptilia: Squamata: Gekkonidae) with the
description of a new species from northern Namibia. Proceed-
ings of the California Academy of Sciences 53: 23-36
Bauer AM, Lamb T, Branch WR (2006a) A Revision of the
Pachydactylus serval and P. weberi groups (Reptilia: Squa-
mata: Gekkonidae) of Southern Africa, with the description
of eight new species. Proceedings of the California Academy
of Sciences 57: 595-709
Bauer AM, Barts M, Hulbert F (2006b) A new species of the
Pachydactylus weberi group (Reptila: Squamata: Gekkonidae)
from the Orange River, with comments on its natural history.
Salamandra 42: 83-92
Branch WR (1998) Field Guide to the Snakes and Other Rep-
tiles of Southern A frica, 3" ed. Struik Publishers, Cape Town,
399 pp
©OZFMK
A new Pachydactylus from northern Namibia 265
Branch WR, Bauer AM, Jackman TR, Heinicke M (2010) A new
species of the Pachydactylus weberi complex (Reptilia: Squa-
mata: Gekkonidae) from the Namib-Rand Reserve, southern
Namibia. Breviora xx: in press.
Crowe TM (1990) A quantitative analysis of patterns of distri-
bution, species richness and endemism in southern African
vertebrates. Pp. 145—160 in Peters G & Hutterer R (eds.) Ver-
tebrates in the Tropics. Zoologiches Forschungsinstitut und
Museum Koenig, Bonn
Giess W (1971) A preliminary vegetation map of South West
Africa. Dinteria 4: 5-114
Griffin M (1998) Reptile diversity. Pp. 148-154 in Barnard P
(ed) Biological Diversity in Namibia — A Country Study.
Namibian National Biodiversity Task Force, Windhoek
Griffin M (2000) The species diversity, distribution and conser-
vation of Namibian reptiles: a review. Namibia Scientific So-
ciety Journal 48: 116-141
Griffin M (2003) Annotated Checklist and Provisional Nation-
al Conservation Status of Namibian Reptiles. Namibia Scien-
tific Society, Windhoek, [2] + 169 pp
Griffin RE (1998) Species richness and biogeography of non-
acarine arachnids in Namibia. Biodiversity and Conservation
7: 467-481
Haacke WD (1965) Additional notes on the herpetology of South
West Africa with descriptions of two new subspecies of geck-
os. Cimbebasia (11): 1-40
Irish J (2002) Namibian Mountains: Biodiversity Potential Based
on Topography. Report to the Mountain Working Group of the
National Biodiversity Task Force, Windhoek, 42 pp
Leviton AE, Gibbs RH, Heal E, Dawson CE (1985) Standards
in herpetology and ichthyology: Part 1, Standard symbolic
codes for institutional resource collections in herpetology and
ichthyology. Copeia 1985: 802-832
Maggs GL, Craven P, Kolberg HH (1998) Plant species richness,
endemism, and genetic resources in Namibia. Biodiversity and
Conservation 7: 435-446
Mertens R (1955) Die Amphibien und Reptilien Stidwestafrikas,
aus den Ergebnissen einer im Jahre 1952 ausgefihrten Rei-
se. Abhandlungen der Senckenbergischen naturforschenden
Gesellschaft 490: 1-172
Mertens R (1971) Die Herpetofauna Stidwest-A frikas. Abhand-
lungen der Senckenbergischen naturforschenden Gesellschaft
529: 1-110
Prendini L (2003) Revision of the genus Lisposoma Lawrence,
1928 (Scorpiones: Bothriuridae). Insect Systematics and Evo-
lution 34: 241-264
Prendini L (2005) New records and observations on the natural
history of Lisposoma elegans and L. josehermana (Scorpiones:
Bothriuridae). American Museum Novitates 3487: 1-11
Simmons RE, Griffin M, Griffin RE, Marais E, Kolberg H (1998)
Endemism in Namibia: patterns, processes and predictions.
Biodiversity and Conservation 7: 513-530
van den Elzen P (1978) Observations sur l’herpétofaune du Wa-
terberg (Namibie). Bonner zoologische Beitrage 29: 171-182
Van Wyk AE, Smith GF (2001) Regions of Floristic Endemism
in Southern Africa. Umdaus Press, Hatfield, South Africa, viii
+ 199 pp
Volk OH (1966) Die Florengebiete von Siidwestafrika. Journal
der Stidwest Afrikanische Wissenschaftliche Gesellschaft 20:
25-58
Bonn zoological Bulletin 57 (2): 257-266
APPENDIX
Comparative specimens examined
See Bauer et al. (2006ab) for a list of P weberi group, P. otavien-
sis, and P. sansteynae specimens examined, Bauer & Branch
(1995) for a list of P. punctatus and P. scherzi examined, and
Bauer et al. (2002) for a list of P angolensis, P. scutatus and P.
parascutatus examined. Only specimens not included in these
publications are listed below. For localities without precise co-
ordinates quarter degree square (QDS) references have been pro-
vided when possible. Each single degree square is subdivided
into four quarter degrees, designated A-D (A=NW quadrant,
B=NE quadrant, C=SW quadrant, D=SE quadrant). Each quar-
ter degree is in turn divided into four similarly designated divi-
sions, yielding a basic unit one sixteenth of a degree square, or
one quarter of a degree on a side (e.g., 1915Ac represents the
unit bounded by 19°15’S and 19°30’S and 15°00’S and 15°15E).
All QDS references in this paper refer to degrees South and East.
P. angolensis: Angola: Namibe Province: San Nicolau
(1412Ab): TM 25454—55, 25459, 25476, 25478—79; Saco de Gi-
raul: TM 4032830, TM 46558; Lucira (1312Dc): TM 41172,
24406, 24445, 24449; Lungo: TM 24406; Benguela Province:
Hanha, 20 km N of Lobito (1213Ab); 24 km S Benguela: TM
39110—11; 30 km N of Dombe Grande: TM 41266.
P. bicolor: Namibia: Erongo Region: Karibib District: 47 mi
E Hentiesbaai: CAS 126210; 20 km W Karibib: MCZ
R163282—83; Swakopmund District: 29.0 km N of Swakop-
mund (22°25°38"S, 14°27°53”E): CAS 214576; 31.1 km N
Swakopmund on Hentiesbaai Rd. (22°25’42”S, 14°27°43”E):
MCZ R184218-20, 184225; Messum Crater (21°26’25.8’S,
14°13°12.9"E): CAS 214814; Kunene Region: Khorixas Dis-
trict: Torrabaai Rd, 63.4 km W of Kamanjab (19°41’00"S,
14°19°10”E): CAS 223912-15; Torrabaai Rd, 58 km W of Ka-
manjab (19°39°20"S, 14°21°10”E): CAS 223927-28; Torrabaai
Rd, 56.7 km W of Franken entrance: CAS 176284-85: Torrabaai
Rd, 37.8 km W of Franken entrance: CAS 176292—93: Kaman-
jab-Torrabaai Rd, Grootberg Pass (19°50.584’S, 14°07.696’E):
CAS 193675; Kamanjab-Torrabaai Rd, 59.3 km W of Kaman-
jab (19°39.100’S, 14°21.335’E): CAS 193680; Torra Bay Rd,
48 km W of Kamanjab, (19°39714"S, 14°21°03”E): CAS
214661—63; Torra Bay Rd, 68 km W of Kamanjab, (19°43’00"S,
14°18°40”E): CAS 21468-89; Torra Bay Rd, 74.2 km W of Ka-
manyab (19°45’°40"S, 14°17°03”E): CAS 21469396; E side of
Road 3706, 19.3 km N of entrance to Palmwag: CAS 175344;
Torrabaai Rd, 108.9 km W of Kamanjab: CAS 176101—08;
Torrabaai Rd, 101.7 km W of Kamanjab: CAS 176116—19;
Torrabaai Rd, 95.9 km W of Kamanjab: CAS 176126-31;
Torrabaai Rd, 44 km W of Kamanjab: CAS 176151; Henties-
baai-Uis Rd, 24 km W of Hwy C35 (21°18717”S, 14°35714”E):
CAS 206959; 25 km E of Grootberg Pass: CAS 206960; ~60
km W. Kamanjab on Torra Bay Rd. (19°40°57”S, 14°19°09”E):
MCZ R184919; 31.9 km E Grootberg Pass (19°40°57S,
14°19°09”E): MCZ R184197—98; 62.8 km W Kamanjab Rest
Camp on Rd. to Grootberg Pass (19°40’56”S, 14°19°08”E):
MCZ R185753-—55; 67.5 km W Kamanyjab on Torrabaai Rd.
(19°43’00"S, 14°18°44”E): MCZ R183766; Hobatere Lodge, 2.5
km from main gate (19°18’07"S, 14°27°26”E): MCZ
R184934—35; Opuwo District: Kamanjab-Ruacana Rd, 98.4 km
N of Kamanjab: CAS 193719; Opuwo-Okangwati Rd, Otjivize
(17°37.188 S, 13°27.535 E): CAS 193731; Outjo District: 17
mi S of Outjo: CAS 85944; Farm Franken: CAS 175347-S3,
175360-74, 176066—68, 176176—-77; Farm Franken, Haus
Franken: CAS 176261—62; Farm Franken, vic. Haus Franken:
©ZFMK
266 Aaron M. Bauer
CAS 176278; 62.0 km E Kamanjab, Farm Amolinda
(19°48°29"S, 15°22°46”E): MCZ R185745—47; Kamanjab Rest
Camp, 3 km W Kamanjab(19°37’48"S, 14°48°57”E): MCZ
R184887, 18489497.
P. caraculicus: Angola: Namibe Province: 36 mi. northwest of
Mocamedes [Namibe]: CAS 85959; Namibia: Kunene Region:
Opuwo District: Okangwati-Epupa Rd, 43.4 km N of Okang-
wati: CAS 193799; 193804—05; 41.9 km N. of Okanguati on
Epupa Falls Rd: CAS 206980; 32 km S Epupa Falls on Okang-
wati Rd. (17°1409”S, 13°13’45”): MCZ R185767.
P. gaiasensis: Namibia: Kunene Region: Khorixas District:
vic. Gat-as (20°47°18"S, 14°06’44”): CAS 214626—28; 22.4 km
N Ugab River on road to Gai-as (20°46°59”S, 14°06731”, 520
ma.s.l.): AMB 7568-69 (NMN), MCZ R184169-70, R184248;
Gai-As (20°46°45”S, 14°04°30”E, 520 m): AMB 8484 (NMN),
MCZ Z-37873 (NMN), MCZ R184181, R184192—93; Gai-As
(20°46 '46'°S,14°04'29""E): MCZ R185967—75, 185979-80;
“False Gai-As” (20°47°14.9"S, 14°06°44.6"E): MCZ Z-
37853-54 (NMN), MCZ R184185, R184187; 7 km E Gai-as
(20°47’S, 14°07’°E): TM 68962—66; Messem Crater, 21 26.430
S, 14 13.215 E : CAS 214800; Messum Mts. (2114Ac): TM
56346; Farm Twyfelfontein: TM 42182; near Gai-as, ~20 mi N
Brandberg: TM 32868—80 [paratypes].
P. oreophilus: Angola: Namibe Province: Caraculo (15°01’S,
12°40°E): TM 245 19-25, 24452; 20 km W Virei: TM 41011—15;
Tambor: TM 40532—34: 6 km S Rio Coroca towards Iona: TM
40575—76; Mutiambo River on road to Lucira: TM 41088; Fur-
nas: TM 40561—62; Namibe 7 km from Iona towards Oncocau,
Iona Reserve: TM 40762; Assuncao: TM 40152; Saiona River,
25 km NW Cainde: TM 40976—77; Benguela Province: 35 km
S Dombe Grande towards Lucira: TM 41246; Namibia:
Kunene Region: Opuwo District: near Purros (18°46’S,
12°59E); TM 68465-—67; Hoanib River (19°18’S, 13°15’E): TM
64185: Hoanib River, 44 km E Mudorib River (19°18’S,
13°15°E): TM 56889; Epupa Falls (16°59’°S, 13°17’E): TM
38771—72, 71579; 6 km S Ohnborimbonga (1712Bb): TM
49084—85; MarienfluB, 40 mls S Kunene: TM 32532; near Otji-
nende, Kaokoveld (1712Db): TM 49219; Epupa (1613Cc): TM
47775; N Okangwati on Epupa Falls Rd. (17°17'24’'S,
13°09°31°E): MCZ R185769; Paracamp, Sesfontein
Bonn zoological Bulletin 57 (2): 257-266
(19°07'52’’S, 13°35'17’"E): MCZ_ R-184945-47; Paracamp,
Sesfontein (19°07'55”S, 13°35’20”E): MCZ R184290; ca 2 km
N of Sesfontein, Para Camp (19°07’28”S, 13°35’29”E): CAS
214736, 214754; ca 4 km N of Sesfontein, Para Campsite
(19°07’56”S, 13° 35’18”E): CAS 223919-22.
P. otaviensis: Namibia: Oshikoto Region: Tsumeb District:
Farm Varianto (19°22°46"S, 17°44’27°E): MCZ R184867.
P. parascutatus: Namibia: Kunene Region: Opuwo District:
Mudorib River, 12 km from Hoanib River (19°23’S, 13°17’E):
TM 68488—92; Okamungodona, 15 km W Orawanji (18°49’S,
13°39°E): TM 71519-21; Otunungwa, Kaokoveld: TM
32401—03; Kharu-gaiseb River (19°45’S, 13°25’E): TM
68517—18; Bottom of Van Zyl’s Pass (1712Da): TM 71497; 37
km N Sesfontein towards Kaoko Otavi (1813Dc): TM 48876-77;
Otjiu, Kaokoveld: TM 32358; 32858—S9; 18 miles SW Orupem-
be: TM 31494; Otjinungwa, Kaokoveld: TM 32860; 4 km NW
Etenga towards Omborombongo (1712Bd): TM 49060; Nango-
lo Flats (1712Ad): TM 24322; Otjiunongua (1712Ab): TM
32546; Sesfontein (19°07’S, 13°37°E): TM _ 79078;
Ongongo/Kaoko: ZFMK 66434.
P. scutatus: Angola: Namibe Province: Iona, Iona Reserve: TM
40751; Espinheira, Iona Reserve: TM 40615—18; 6 km S Rio
Coroca, Iona: TM 40577; Namibia: Erongo Region: Omaruru
District: Ugab River Bridge near Brandberg W. Mine: TM 36463;
Ugab River (20°58’S, 14°12’E): TM 49708; Tsisab Gorge,
Brandberg (2114Ba): TM 79286; Brandberg: SMF 58564;
Sraussenhohle an der Jochmannswald, Brandberg: SMF 45658;
Kunene Region: Khorixas District: Farm Palmwag (19°53’S,
13°53’E): TM 56865; Farm Paderborn (1914Dd): TM 17302;
Kamanjab (1914Db): TM 17209, 17270, 36372; Damaraland
(20°30’S, 13°49°E): TM 68754; Farm Huab (1914Db): TM
17338; Farm Palmfontein (part of Grootberg): TM 36465; Farm
Blauwpoort (2014cb): TM 49419; Agab Spring (20°05’S,
13°50’E): TM 56936; Opuwo District: Epupa Falls (16°59’S,
13°17°E): TM 7135253; Otjiu, Kaokoveld: TM 32539.
Received: 04.VII.2010
Accepted: 11.X.2010
©ZFMK
Bonn zoological Bulletin | Volume 57 Issu
2 ia pp. 267-274 Bonn, November 2010
A new Tarentola subspecies (Reptilia: Gekkonidae)
endemic to Tunisia
Ulrich Joger & Ismail Bshaenia
Staatliches Naturhistorisches Museum, Pockelsstr. 10, D-38106 Braunschweig, Germany
Abstract. Mitochondrial DNA sequences as well as morphological characters reveal that geckos of the genus Zarentola
from Libya and central Tunisia are a monophyletic group which is different from both 7. mauritanica and T. deserti. Con-
sequently, we elevate the former subspecies 7. mauritanica fascicularis to species rank. Together with 7) neglecta and T.
mindiae, T. fascicularis constitutes the sister group of 7: deserti. Tarentola fascicularis comprises several evolutionary
units, one of which we describe here as a subspecies endemic to south-central Tunisia.
Key words. Zarentola, gecko, Tunisia, Libya, North Africa, taxonomy.
INTRODUCTION
The Mediterranean geckos of the genus Zarentola Gray,
1825 are classified in the nominative subgenus 7arento-
la. The Canary Islands are inhabited by geckos of the sub-
genera Jarentola (Eastern Canaries) and Makariogecko
(western Canaries, Selvagens and Cape Verde Islands)
whereas other subgenera inhabit sub-Saharan Africa and
the Caribbean (Joger 1984a, b). To date, the nominative
subgenus comprises the following species: Zarentola mau-
ritanica (L., 1758), T. deserti Boulenger, 1891, 7. angus-
timentalis Steindachner, 1891, 7. boehmei Joger, 1984. Al-
though no subspecies have been described in the latter
three species, the North African populations of 7) mauri-
tanica have been assigned to a number of subspecies; in-
cluding, 7 m. mauritanica, T. m. fascicularis (Daudin,
1802) from Egypt, 7 m. juliae Joger, 1984, and 7: m. pal-
lida Geniez et al., 1999, both from Morocco. Zarentola
angustimentalis (eastern Canary Islands) and 7: deserti
(northern margin of the Sahara Desert) used to be classi-
fied as subspecies of 7. mauritanica until they were ele-
vated to species rank (Joger 1984b). In the case of 7. de-
serti, sympatric records of 7: deserti and T: mauritanica
in Tunisia and Algeria gave reason to assume that these
were separate biological species.
Tarentola deserti and T. mauritanica can be distinguished
from each other in a number of characters (Table 1, Figs
1 and 2). In the field, 7. deserti is characterized often by
its very large size, pale, often rosy body colour and a yel-
lowish or ochre brown coloured iris, whereas typical 7.
mauritanica is smaller and has a grey body and iris
colouration.
Bonn zoological Bulletin 57 (2): 267-274
In contrast, in south-central Tunisia (Bou Hedma Nation-
al Park and areas to the north of the Chott al Djerid salt
pan) populations of Zarentola were found that show a mix-
ture of characters of both species (Table 1, Fig. 3). Their
size is smaller than 7. deserti, but body and eye colour are
close to 7: deserti (Joger & Bischoff 1989; Joger 2003).
A preliminary study of morphological and electrophoret-
ic characters (Willand 1997; Joger et al. 1998) showed that
these geckos cluster morphologically with 7. mauritani-
ca (yet not with any of its described subspecies), where-
as their dorsal colour and pattern is close to 7 deserti and
their blood plasma protein alleles are distinct and not
shared by neither 7) mauritanica nor T. deserti.
Previous molecular genetic studies (Carranza et al. 2002;
Rato et al. 2010) of North African 7arentola were biased
in that they concentrated on Moroccan populations but
largely neglected Tunisian and Libyan populations. In this
study, we use both morphological and molecular samples
of Tunisian and Libyan Jarentola to determine the affini-
ties and clarify the taxonomy of the enigmatic Zarentola
of south-central Tunisia.
MATERIALS AND METHODS
Animals were collected during several trips to Morocco,
Algeria, Tunisia (U.J.) and Libya (I.B.). Specimens from
Egypt were kindly provided by Sherif Baha El Din and
Adel Ibrahim. Blood samples were taken by heart punc-
ture or from muscle tissue of dead animals and preserved
©ZFMK
268 Ulrich Joger & Ismail Bshaenia
Fig. 1. Zarentola mauritanica (Tunisia).
Operational taxonomic units (OTUs) were defined using
a combination of mitochondrial DNA clades and geo-
graphic proximity. Linear Discriminant Function Analy-
ses (LDFA) were used to find variables that separate the
groups. Principal Component Analyses (PCA) were ap-
plied to see whether groups are distinguishable without
previous definition of OTUs. Significance of character dif-
ferences were tested with t-tests.
DNA was extracted from the preserved samples using
standard procedures. Universal primers were used to am-
plify mitochondrial 12S rRNA (372 bp) and 16s rRNA (2
fragments of 448 and 604 bp). Sequences were determined
using an automated sequencer, and aligned with
CLUSTAL-W omitting gaps. Sequences from Genbank
were added in some cases. A sequence of a paratype of
the new subspecies was submitted to GenBank (IB47:
Table 1. Distinguishing characters of North African Zarento/a (mean + standard deviation). Significant differences from T. sp.
(Tunisia) are highlighted (in bold). Significance values are given for males (first value) and females separately (if different).
*«* P<().001; ** P<0.01; * P<0.05; n.s. not significant.
characters Timauritanica - Tunisia 7T’sp.- Tunisia T:sp.-complex-Libya T'deserti ssp.- Libya T.d.deserti - N-Africa
N=22 N=15 N=139 N=73 N=24
Maximal head 83.5 86 79 Tell 103.3
+ body length
Lamellae under 11.0 + 1.0 10.3 + 0.8 10.9 + 0.6 n.s./*** 11.0 + 0.7 n.s./*** 1257 E See
Ist toe
Lamellae under 16.8 + 1.0 *** 15.3 + 1.0 15.8 + 1.0 15.9 + 0.8 n.s./** 18272 eS ees
4th toe
Lamellae under 20.5 + 1.5 19.7+1.1 20.2 + 1.6 2053 eal 22:8 Eesha
5th toe
Ventral scales 37 £33 34.3 + 2.7 36.6 + 3.2 40.0 + 2.7 *** 40.1 + 2.0 ***
Dorsal tubercles 13.5 + 1.0 12.1+ 0.5 12.8 +1.4 13.4 + 0.9 **/*** 12.2+0.7
Gular scales 41.1+4.7 43.3 + 6.6 43.3+4.7 45.3+5.4 56.0 + 6.9 ***
Interorbitals 14.9 + 1.2 ** 13.7 + 1.0 14.9 + 0.7 **« 14.6 + 0.9 ** 14.5 +0.7
Infralabials 8.0 + 0.7 7.9 + 0.7 7.9 + 0.5 8.0 + 0.5 8.8 + 0.6 ***
Supralabials 7.8 + 0.6 PaO 7.9 +0.5 8.0 + 0.4 8.0 + 0.4
Relative 0.38 + 0.03 0.42 + 0.04 0.36 + 0.04 *** 0.36 + 0.04 *** 0.43 + 0.06
inter-orbital 0.39 + 0.02 0.41 + 0.03 0.37 + 0.04 n.s. 0.37 + 0.05 * 0.42 + 0.04
width
Relative earto 0.84+40.03 0.91 + 0.03 0.66 + 0.07 *** 0.66 + 0.06 *** 0.89 + 0.04
mental distance 0.88 + 0.06 0.90 + 0.03 0.69 + 0.21 ** 0.68 + 0.09 *** 0.88 + 0.03
in 96% ethanol. Voucher specimens were preserved in
80% ethanol.
Morphological data were taken as described by Joger
(1984a). Measurements were taken to the nearest 0.1 mm
and normalized as proportion to body length. Pholidotic
counts were taken unaltered.
Bonn zoological Bulletin 57 (2): 267-274
HQ437282). Phylogenetic trees were constructed using a
Bayesian Markov Chain Monte Carlo inference applying
an evolution model suggested by MODELTEST 3.7. Sta-
tistical support for branches was indicated by posterior
probability values (MrBayes).
©ZFMK
A new Zarentola endemic to Tunisia 269
RESULTS
Morphological comparisons
CDF plots (Figs 4a, b) show that 7. sp. (Tunisia) are dif-
ferent morphologically from 7 deserti as well as from un-
described Zarentola from western Libya (‘7T. sp. com-
plex’). When North African populations of 7) mauritani-
ca are compared with 7. sp. (Tunisia), only males appear
distinct, whereas females cluster with 7 mauritanica from
Tunisia and Morocco (Fig. 5b).
Fig. 2. Zarentola deserti (Biskra, Algeria). Significantly different characters which distinguish
Tunisian 7arentola from Libyan and other North African
populations are shown in Table 1.
Molecular genetic affinities
Mitochondrial gene sequences (12S rRNA, 16s rRNA) re-
veal that 7. sp. (Tunisia) does not cluster with 7? mauri-
tanica but with undescribed Libyan Tarentola (Fig. 8).
These Libyan populations form several geographically re-
stricted, monophyletic clades; the most western ones are
sister to 7’ sp. (Tunisia) — yet with rather low statistical
support. Zarentola deserti, T. mauritanica fascicularis
(Egypt, East Libya), and even 7. neglecta appear more
closely related to the western Libyan-Tunisian group of
clades than 7. m. mauritanica. This 1s highly supported
statistically (1.00 posterior probability). It is noteworthy
that the populations near the (neo-) type locality of 7! m.
Fig. 3. Tarentola sp. (Bou Hedma, Tunisia).
Table 2. Uncorrected “P” distance between main clades, estimated of evolutionary divergence between sequences, based on pair-
wise analysis of 1433 bp mtDNA sequences.
Clade A Clade B Clade C Clade D Clade E Clade F Clade G Clade H
Clade A
Clade B 0.0921
Clade C 0.0972 0.0704
Clade D 0.1180 0.0977 0.0692
Clade E 0.1052 0.0853 0.0562 0.0705
Clade F 0.0974 0.0634 0.0630 0.0802 0.0645
Clade G 0.1145 0.0873 0.0662 0.0665 0.0694 0.0510
Clade H 0.1141 0.0886 0.0691 0.0711 0.0706 0.0578 0.0270
Outgroup 0.1234 0.1407 OMB Si 0.1545 0.1564 0.1422 0.1531 0.1490
Bonn zoological Bulletin 57 (2): 267-274 ©ZFMK
Canonical discriminant function
A &
eu ©
N Ai eian ©3
a
c Ce oe
9 °K af
ew 0 KGa aA aa
2 ie Nacteavay
s a
Ww 4 e
AL IGA
3
3 : .a
°
of
T T T SS) es
6 3 oO
Function 1
Canonical discriminant function
Function 2
Function 1
Fig. 4. CDF plots for Tarentola sp-Tunisia, Tarentola deserti-
North Africa, Zarentola sp-complex-Libya (western Libyan 7.
Jascicularis), and Tarentola deserti-Libya; males (above) and fe-
males (below).
fascicularis, in East Libyan Cyrenaica, belong to a sepa-
rate clade (clade D).
Genetic distances among Libyan and Tunisian Tarentola
clades are provided in Table 2.
Two of the mitochondrial clades occur sympatrically or
Group Nr:
“1 T. sp-complex-Libya
" 2T. deserti-Libya
° 3ST. sp-Tunisia
04 T. deserti-North Africa
C1 group center
parapatrically: 7: deserti (Libya) and ‘7. sp. complex’
(clade H) at Itwellia (western Libya), clades C and D along
the desert road Tobruk-Ajdabiya in Cyrenaica.
Bonn zoological Bulletin 57 (2): 267-274
Ulrich Joger & Ismail Bshaenia
Canonical discriminant function
Group Nr:
41 T. sp-complex-Libya
¥ 27. deserti-Libya
* 3 T. m. mauntanica-Morocco
4 * 47. m. mauritanica-Tunisia
* 5T. sp-Tunisia
* 6 T. m. meuritanica-Algeria
se 97 T, deserti-North Africa
. O group center
4 o *
a Pia o-
a o
a
Ps e)
N AGA Sola Bp:
< “a CT or °
i) » So aoe
Ss 4 a4 vattt 4
£ anwar 4 CI
s OED 3
ir Y » 245.5,
y A +o
.
a 4
6
T T T UT af
6 3 ° 3 6
Function 1
Canonical discriminant function
o
o 0
o oo
o
o° ia
o a
a v
Yah y ad
4” Ang
“ Nene? .
¢ mote ve 4
5 of * *4 eRe
r~ shige af A Fo a
° 3 % Set Y
c hes Oat ae a by
a
c A aN x “an As
™ 64% 7
Spe mag
3 a ON
+ Sr
|
T T T
4 3 ° 3 6
Function 1
Fig. 5. CDF plots of different populations of North African Za-
rentola, males (above) and females (below) plotted separately.
DISCUSSION
Parapatric or sympatric occurrence of mitochondrial clades
could be interpreted in different ways: either different bi-
ological species or co-existence of two mitochondrial dis-
tinct populations in a mixed interbreeding organismal pop-
ulation. In the case of 7! deserti in NW Libya, there is ev-
idence of the former explanation, as the molecular differ-
ences coincide with morphological differences.
©ZFMK
A new TJarentola endemic to Tunisia
Table 3. Variation of the Paratypes (part).
Variable Mean Minimum Maximum Standard deviation
Lamellae under 1st toe 10.27 9.00 12.00 0.80
Lamellae under 4 toe 15.27 14.00 17.00 0.96
Lamellae under 5‘ toe 19.67 18.00 21.00 heat
Ventral scales 34.33 28.00 38.00 Did
Supraorbital scales Sole) 5.00 6.00 0.46
Dorsal tubercles WATS 12.00 14.00 0.52
Gular scales 44.21 32.00 55.00 5.82
Interorbital scales S373 12.00 15.00 0.96
Head length 17.18 13.89 21.03 2.16
Head+body length 56.08 44.12 72.33 MOD
Infralabialia 793 7.00 9.00 0.70
Supralabialia Hol) 6.00 9.00 0.70
Relative hindleg length 0.49 0.45 0.51 0.02
Relative head width 0.70 0.62 0.82 0.05
Relative head length 0.31 0.29 0.32 0.01
Relative foreleg length 0.36 0.32 0.40 0.02
Relative ear-snout length 0.90 0.84 0.95 0.03
When a conservative two-species concept (7) mauritani-
ca —T. deserti) is applied, the mitochondrial tree unam-
biguously affiliates all sequenced Libyan OTUs with 7:
deserti, and not with 7) mauritanica. The mitochondrial
genetic distance between the central Tunisian Tarentola,
the Libyan clades and 7: deserti are lower than between
the Tunisian clade and 7. m. mauritanica. This supports
the view that despite some morphological similarity, the
Tunisian and Libyan-Egyptian clades are not subspecies
of 7. mauritanica.
Assigning these OTUs to 7: deserti would, however, cre-
ate a paraphyletic T. deserti, with T. neglecta and T. min-
diae — which are without doubt separate species — with-
in 7: deserti. The most parsimonious taxonomic solution
with regard to the cladogram is to subsume clades C, D,
E, G, and H under one separate species.
Morphological data indicate that several of the mitochon-
drially defined populations, in particular if they occur in
desert areas (Sabha in South Libya, Algerian and Tunisian
but not Libyan deserti, and also a subclade of clade D)
can be distinguished by larger size and higher scale counts.
These size-linked characters may be locally favoured by
Bonn zoological Bulletin 57 (2): 267-274
environmentally triggered selection. On the other hand,
morphological differences do not preclude genetic close-
ness, and genetically distant clades may share morpholog-
ical similarity.
In conclusion, the genetically studied Zarentola from
Libya and Egypt, as well as those from south central
Tunisian, should be assigned to 7! fascicularis (a former
subspecies of 7. mauritanica). Elevation of fascicularis to
species rank is largely consistent with data of Rato et al.
(2010), who distinguished two basal divisions in the sub-
genus Zarentola. One of these branches lead to T. deser-
ti and T. boehmei, another to 7: angustimentalis and T.
mauritanica from Europe, Morocco, Algeria and north-
ern Tunisia on one side, and to 7. (m.) fascicularis and
Tarentola from Lampedusa and Conigli Islands on the oth-
er side. Single individuals of ‘7. mauritanica’ from Alge-
ria and of ‘7: deserti’ from Morocco were loosely connect-
ed to the latter clade, but we do not know which taxa were
really represented by those samples. The Tunisian sam-
ples used by these authors clustered with 7? m. mauritan-
ica, but they were exclusively from northwestern Tunisia.
True 7. mauritanica exist in coastal areas of Tunisia and
western Libya.
OZFMK
Die, Ulrich Joger & Ismail Bshaenia
Males: 25 characters
13° 12
mare?
Factor 2: 19,24%
Factor 1: 24,69%
Females: 25 characters
Factor 2: 15,64
Factor 1: 20,77%
Fig. 6. PCA of Zarentola sp. (Tunisia), 7. m. fascicularis (Li-
bya), and different populations of 7 mauritanica. Males above,
females below.
In Tunisia, 7: deserti exists in the extreme south (south-
southeast of the Chott al Djerid) and a new subspecies of
7: fascicularis in south central Tunisia between the Chott
al Djerid and Djebel Bou Hedma. The description of this
new subspecies is presented below.
Description of a new subspecies of Tarentola fascicu-
laris
Tarentola fascicularis n. comb.
Gecko fascicularis Daudin, 1802
Tarentola mauritanica mauritanica, Loveridge 1947
(partim, non Linnaeus 1768)
Tarentola mauritanica fascicularis, Joger 1984
Terra typica (after designation of a neotype by Joger
[1984]): Ain Teyanah, 20 km south of Benghazi, Libya.
Bonn zoological Bulletin 57 (2): 267-274
Males: 25 characters
Factor 2: 16,79%
Factor 1: 24,15%
Females: 25 characters
Factor 2: 14,57%
- 0
Factor 1: 20,28%
Fig. 7. PCA of Zarentola deserti (Libyan populations), 7. sp.
(western population of 7. fascicularis, Libya) and T. sp. (Tuni-
sia). Males above, females below.
Tarentola fascicularis wolfgangi ssp. n.
Holotype. State Natural History Museum Braunschweig
(SNHM-BS) N 41980, male, collected 19 August 1998 by
Ulrich Joger (Fig. 9).
Terra typica. Bou Hedma National Park, Tunisia
(34.24°N, 9.23’E).
Paratypes. 33 specimens; SNHM-BS 39920-39930,
41981, Bou Hedma; HLMD 2105-2109, 2265-2271, 2363-
2366, Bou Hedma; HLMD 1238-1240, Djebel Orbata/El
Guettar; ZFMK 49525, 49526, Djebel Orbata: El Guettar.
Description of holotype. Measurements (mm). Head +
body 61.0, tail 71.4, head length 19.8, head width 14.7,
head height 10.8, interorbital width 8.4, distance snout-
ear 17.7; foreleg 23.9, hindleg 30.2, distance between fore-
leg and hindleg 25.1, 4* toe length 5.1, toe width 2.0, di-
ameter of eye 4.5.
©ZFMK
A new Zarentola endemic to Tunisia 27
(BL147 T so Tarhunah Libya
{BLISS Tgp Tajura Libye
U0 1BL207 T go Misratah Libya
nee 1BL185 T 90 Awellle Libya
Clade H
2OMV10692 T sp ElPerkat Libya
{BL072 T 3p Rass El Lia Libya
{BL089 Ee Genen Pa
lade G
“BOSE t= ai Hedina Tunisia
18051 Tsp Bou Hedmea Tunisie
18047 T sp Bou Hedma pene
181220 Tsp Ras Lanu Libya
0.88) 1BL219 Tsp Ras Lanuf Libya
0.57; /BL245 T gp Taknis Libya
oe Tsp Taknis el
1.00 184229 Tastm anne rr
1.00 1BL268 T sp Sidi Massod Litya
8EV8968 Tm fasicuctris Egypt
Clade C
2CMV10638 T sp GaberAan Oasis Libya
18055 Tnegbcta E/ Qued Agena
1.00 BEVEOY T mindiae pee
ila oak i ‘00 7014 T maureaaee Meke “ais
{8030 T maurkanica Maliorca
1.00 18021 Tmaurtanica Mallorca
1.00r 18004 Tangustimentalis Lanzarnte ade
esis 8003 T anqustimentatis Fuerteventura
BEV9007 Tannulens annularis Egypt
18018 T boettgen Gran Canana
18019 T boettgen Gran Canaria
18010 T.d.delalandii Tenerife
Clade B
Fig. 8. 50% majority-rule consensus tree obtained from Baye-
sian MCMC analysis, based on 1433 bp mtDNA sequences, de-
picting the relationships among haplotypes. Tarentola delalandii
designated as outgroup and Bayesian posterior probability va-
lues are given near branches.
Pholidosis. 36 longitudinal rows of ventral scales; 12 lon-
gitudinal rows of dorsal tubercles, bearing strong central
keel from which barely visible keels derive laterally; 13
lamellae under 1st toe, 15 lamellae under 4" toe, 20 lamel-
lae under 5'h toe; 15 interorbital scales, 6 supraorbital
scales; gular scales separated from mental by 3 scales, gu-
lar scale count 43; 10 supralabials, 7/8 infralabials; ros-
tral divided, touching nostril; nasal scales separated by one
scale proximally and one scale distally. Colour (in
ethanol) whitish, without any visible pattern.
Fig. 9. Holotype of Zarentola fascicularis wolfgangi ssp. n.
Bonn zoological Bulletin 57 (2): 267-274
Ww
Variability of paratypes. Colour (in ethanol) light or
medium grey dorsally, whitish ventrally. Most specimens
bear following pattern: dark line on side of head from eye
to above ear. Paired dark spots, followed posteriorly by
unpaired whitish spot (without clear margins) distributed
on mid-dorsum as follows: one in front of shoulder, one
behind shoulder, two on back, one on pelvic region, one
on base of tail, followed by 9-10 unpaired half-rings
around dorsal part of tail. Scale count variation is shown
in Table 3.
Diagnosis. A small subspecies of 7: fascicularis; maxi-
mum recorded bodythead length in males 72.3 mm, in fe-
males 57.5 mm (up to more than 100 mm in male 7! de-
serti, 81 mm in female 7: deserti; in eastern Libyan T. fas-
cicularis, 97 mm can be attained in males of the Ras Lanuf
population, yet only 79 mm in 7. fascicularis ssp. from
northwestern Libya).
Tail length usually clearly longer than body+head (index
bodythead/tail 0.77-1.00; mean 0.84, as opposed to 0.98
in 7. deserti, 0.96 in T. f. fascicularis, and 0.96 in T. m.
mauritanica). Snout (ear openings to mental) significant-
ly longer than in T. fascicularis and T. deserti subspecies
from Eastern Libya (about 90% of head length as opposed
to 60-70%).
Dorsal tubercles in 11—14 (most often 12) longitudinal
rows, most often simply keeled (multiply keeled in 7. f
fascicularis). 19-46 gular scales (45—59 gular scales in T.
d. deserti). Different from all other Tunisian or Libyan Zar-
entola (except T! neglecta group) by lower number of ven-
tral scales (34.3 +/- 2.7) and lower number of lamellae un-
derneath 1st and 4 toes (1st 10.3 +/- 0.8, 4th 15.3 +/- 1.0).
15—22 scale rows or lamellae underneath 5‘) toes (16-21
in 7. f. fascicularis, 2\—25 in T: deserti). Different from
Tunisian 7. mauritanica by lower number of interorbital
scales (13.7 +/- 1.0 versus 14.9 +/- 1.2); from Libyan 7.
mauritanica by lower number of sublabials (7.9 +/- 0.7
versus 8.7 +/- 0.7); from western Libyan subspecies of 7.
fascicularis by lower number of interorbital scales (13.7
+/- 1.0 versus 14.9 +/- 0.7). Rostral usually separated from
nostril by small scales (in 7! f fascicularis rostral usual-
ly in contact with nostril).
Dorsal colour in life similar to 7. deserti: rosy or yellow-
ish, with yellowish iris (grey in 7! m. mauritanica). Five
dark transverse bands across back, often reduced to paired
spots.
Distribution. Endemic to Central Tunisia; known from
Gafsa (Djebel Orbata) in the West to Bou Hedma in the
East, south to Degache and Tozeur at northern banks of
Chott al Djérid.
©OZFMK
274 Ulrich Joger & Ismail Bshaenia
Fig. 10. Terra typica of Tarentola fascicularis wolfgangi ssp. n., Djebel Bou Hedma, Tunisia.
Habitat. Bou Hedma National Park is famous for its relict
subtropical savanna with Acacia tortilis raddiana as the
dominating tree. The climate is semi-arid, with variable
amounts of rainfall (annual mean about 250 mm) in au-
tumn and winter. On the pediments of Djebel Bou Hed-
ma (Fig. 10) as well as on the slopes of the mountain
chains to the west and south of it, Zarentola fascicularis
wolfgangi ssp. n. is found in rock crevices, on walls and
underneath of road bridges; the geckos are active at night.
Derivatio nominis. The species is dedicated to Wolfgang
Bohme on the occasion of his retirement as the most suc-
cessful German curator of herpetology after Robert
Mertens. The senior author feels, however, also a strong
affinity to the other Wolfgang, Wolfgang Bischoff, who
retired this year, too. His field companionship in North
Africa will be ever remembered.
Acknowledgements. We thank Sherif Baha El] Din and Adel
Ibrahim for providing Egyptian specimens, Wolfgang Bischoff
for field companionship, Ulrich Willand for preliminary data,
Miguel Vences and Susanne Hauswaldt for providing laborato-
ry facilities.
Bonn zoological Bulletin 57 (2): 267-274
REFERENCES
Carranza S, Arnold E N, Mateo J A, Geniez M (2002) Relati-
onships and evolution of the North African geckos, Geckonia
and Tarentola. Mol. Phyl. Evol. 21: 244-256
Joger U (1984a) Morphologische und biochemisch-immunolo-
gische Untersuchungen zur Systematik und Evolution der Gat-
tung Zarentola (Reptilia: Gekkonidae). Zoologische Jahrbu-
cher (Anatomie) 112: 137-256
Joger U (1984b) Taxonomische Revision der Gattung Zarento-
la (Reptilia: Gekkonidae). Bonner zoologische Beitrage 35:
129-174
Joger U (2003) Reptiles and amphibians of southern Tunisia.
Kaupia 12: 71-88
Joger U, Bischoff W (1989): Erste Ergebnisse einer herpetolo-
gischen Forschungsreise nach Nordwest-A frika. Tier und Mu-
seum (Bonn) 1: 99-106
Joger U, Amann T, Lenk P, Willand U (1998) Molekulare Merk-
male und das phylogenetische Artkonzept. Zoologische Ab-
handlungen, Staatliches Museum fiir Tierkunde Dresden,
50/Suppl. ,,100 Jahre Artkonzepte in der Zoologie™: 109-123.
Rato V, Carranza S, Perera A, Carretero, M A & Harris D J (2010,
in press): Conflicting patterns of nucleotide diversity between
mtDNA and nDNA in the Moorish gecko, Tarentola mauri-
tanica. Mol. Phyl. Evol.
Willand U (1997) Revision der Untergattung Zarentola (Reptil-
ia: Sauria: Gekkonidae). Unpublished diploma thesis, Univer-
sity of Darmstadt
Received: 05.X.2010
Accepted: 01.XI.2010
©ZFMK
Bonn zoological Bulletin | Volume 57 Issue 2 pp. 275-280
Bonn, November 2010
A new species of the genus 7ropiocolotes from Central Saudi Arabia
(Reptilia: Sauria: Gekkonidae)
Thomas M. Wilms!;*, Mohammed Shobrak? & Philipp Wagner?
' Zoologischer Garten Frankfurt, Bernhard-Grzimek-Allee 1, D-60316 Frankfurt am Main, Germany;
E-Mail: [email protected]
? Biology Department, Science College, Taif University, P.O. Box 888, Taif, Saudi Arabia
3 Zoologisches Forschungsmuseum A. Koenig, Adenauerallee 160, D-53113 Bonn, Germany
“ corresponding author
Abstract. A new species of the genus 7ropiocolotes from central Saudi Arabia is described based on two specimens from
the Ath-Thumamah region. The new species is a member of the subgenus Zropiocolotes and belongs to the clade includ-
ing T. steudneri and T. nattereri.
Key words. Zropiocolotes sp. n., Ath-Thumama, Saudi Arabia.
INTRODUCTION
The genus 7ropiocolotes Peters, 1880 comprises a group
of small, nocturnal and ground dwelling geckos, rarely ex-
ceeding 35 mm snout-vent length. Biogeographically the
distribution of these geckos follows a Saharo-sindian pat-
tern, ranging from Morocco and Mauritania in the west
to western India (Sindaco & Jereméenco 2008; Agarwal
2009). About 13 nominal species are being distinguished
within the genus 7ropiocolotes, but in addition there are
published records of specimens which would possibly de-
serve specific recognition and which are not yet formal-
ly described (Arnold 1980; Kordges 1998; Anderson 1999;
Baha el Din 2001, 2006; Sindaco & Jereméenco 2008).
Beside this the species composition of the genus is under
debate since the taxa of the eastern part of the distribu-
tion area are assigned to Microgecko Nikolsky, 1907 and
Asiocolotes Golubev, 1984 on a generic or subgeneric lev-
el by some authors (Kluge 1983; Kuge 1991; Szcerbak &
Golubev 1996; Sindaco & Jereméenco 2008) while oth-
ers treat all of those taxa as belonging exclusively to the
genus Tropiocolotes (Anderson 1961, 1999). We prefer to
follow the more inclusive interpretation of 7ropiocolotes
and use the name in the broader sense encompassing al-
so the taxa of Iran, Afghanistan, Pakistan and India.
There have been uncertainties concerning the taxonomy
of some of the African and Arabian taxa within the genus,
like 7: tripolitanus algericus Loveridge, 1947, T: t. apok-
lomax Papenfuss, 1969, 7: steudneri (Peters, 1869) and
T. nattereri Steindachner, 1901 (Baha el Din 1994, 2001;
Werner 1998; Shifman et al. 1999). The main taxonomic
issues were related to the validity of certain taxa (e.g.,
Bonn zoological Bulletin 57 (2): 275-280
T. t. apoklomax; Baha E] Din 2001), the taxonomic rank
of certain taxa (e.g., 7) t. algericus which was assigned
specific rank based on a proven sympatric occurrence with
Tt. tripolitanus Peters, 1880; Baha El Din 2001), species
delimitation (e.g., between T. nattereri and T: steudneri,
Shifman et al. 1999; the type material of both species is
untraceable and therefore neotypes should be designated
and a thorough rediscription of both taxa prepared) and
to the existence of hitherto unknown species which were
discovered recently (7? nubicus Baha El Din 1999, T.
bisharicus Baha El Din 2001).
As already stated by Baha El Din (2001) the difficulty in
finding and studying these diminutive animals, combined
with their patchy geographical representation in scientif-
ic collections has led to a less than satisfactory taxonom-
ic evaluation to date.
The specimens described as a new species in the present
paper were collected in the Ath-Thumamah region in cen-
tral Saudi Arabia, approximately 90 km northeast of
Riyadh. According to Arnold (1986) the distribution of
Tropiocolotes in Saudi Arabia is confined to north-west-
ern Saudi Arabia, but already Tilbury (1988) recorded it
from the Riyadh area. Thus the first specimen from Ath-
Thumamah collected by Kordges was not the first pub-
lished record of the genus in central Arabia (contra Ko-
rdges 1998), but nevertheless the first record of the genus
from Ath-Thumamah (contra Cunningham 2010, who list-
ed Tropiocolotes as not yet confirmed for this area).
OZFMK
276 Thomas M. Wilms et al.
MATERIAL
106 specimens of the genus 7ropiocolotes from the col-
lections of the Zoologisches Forschungsmuseum A.
Koenig, Bonn (ZFMK), the Senckenberg Museum Frank-
furt (SMF), the California Academy of Science (CAS) and
the Natural History Museum Geneva (MHNG) belonging
to 7! algericus (n=14), T. depressus (n=3), T. helenae
(n=10), 7. nattereri (n= 14), T. persicus (n=12), T. scortec-
ci (n=4), 7. steudneri (n= 43), T. tripolitanus (n=4) and
the new taxon described herein (n=2) were examined. For
the species not available in the present study (7. bishari-
cus, T: latifi, T: levitoni, T. nubicus) morphological infor-
mation were taken from Leviton & Anderson (1972),
Szezerbak & Golubev (1996), Anderson (1999), Baha El
Din (1999, 2001).
The following characters were collected from 59 speci-
mens from Algeria, Egypt, Israel, Jordan and Saudi Ara-
bia (belonging to 7. nattereri, T. steudneri and the new tax-
on described herein): snout-vent-length, tail length (only
intact tails), number and size of postmental scales, num-
ber of interorbitals (transverse scales across the interor-
bital region at mid orbits, excluding palpebral folds), num-
Fig. 1. Holotype of Tropiocolotes wolfgangboehmei sp. n.
from Ath-Thumamah, Saudi Arabia (Fig. 1a: dorsal view, Fig.
lb: ventral view, Scale: 1mm interline distance).
Bonn zoological Bulletin 57 (2): 275-280
ber of upper and lower labials, number and characteris-
tics of keels on subdigital lamellae, number and identity
of scales bordering the nostril, number of scales around
midbody. Beside this, data on colouration and pattern was
collected. Additional data on morphological characters
were taken from Baha el Din (1999, 2001) and Shifman
et al. (1999). Measurements were taken with a digital cal-
liper to the nearest 0.1 mm.
Material examined
Tropiocolotes algericus: Algeria: SMF 8167, Algerian
Sahara; Mali: MHNG 2678.087, north of Bombax; Mo-
rocco: MHNG 1553.065-067, Tarfaya; MHNG 993.027,
Aouinet-Torkoz; SMF 73082-87, Goulimine; Western Sa-
hara: MHNG 1545.076, El-Aioun. Tropiocolotes depres-
sus: Pakistan: SMF 64490-92, east of Chiltan-Mountains,
Quetta. Tropiocolotes helenae: tran: MHNG 2627.011-
16, MHNG 2641.100, MHNG 2646.056-058, Mehkuyeh.
Tropiocolotes nattereri: Egypt: MHNG 2710.017-018,
Wadi Feran; SMF 8165, NW Sinai; ZFMK 70653-59, Ras
Mohammed; Israel: SMF 47112, Wadi el Hedhira, Cen-
tral Negev; Jordan: ZFMK 64673, Aqaba; Saudi Ara-
bia: CAS 148526, Hagl [29 18 N; 34.57 E]; CAS 148616,
Jabal as Sinfa [27 57 N; 35 47 E]. Tropiocolotes persi-
cus: Pakistan: SMF 63536-47, Hab Chauki. Tropio-
colotes_ scortecci: Yemen: MHNG 2428.065, Al
Mabraz, Wadi Zabid; MHNG 2428.065, MHNG 2553.041,
Mafraq-Mocca; MHNG 2581042, Sayhut. Tropiocolotes
steudneri: Algeria: CAS 138660-63, 3 km. East of
Tamanrasset; ZFMK 19853, 15 km S Terhenanet; ZFMK
33839, 90km S In Salah; Egypt: CAS 156660, Maadi-Wa-
di Gindali Rd. [29 59 N, 31 28 E]; MHNG 2710.019-020,
Oasis Kharga; SMF 22119, Kosseir; ZFMK 2359, ZFMK
64633, Luxor; ZFMK 20537, Cairo, Mokatana Hils;
ZFMK 64641, ZFMK 64643, 10 km NW Cairo; ZFMK
65477, Giza Abu Rawash; ZFMK 77765-67, between Beni
Suef u. Korimat; Sudan: CAS 174014, Assalaya Pump
Station 3; MHNG 1186.078-079, Tabo; ZFMK 33840-59,
Wadi Half; ZFMK 38429, Erkowit. Tropiocolotes tripoli-
tanus: Egypt: SMF 22472, Heliopolis; SMK 22473,
Cairo; Tunisia: MHNG 1335.04, Tozeur; SMF 8166,
Tunisian Sahara. Tropiocolotes sp. n.: Saudi Arabia:
ZFMK 43668, ZFMK 87120, Ath-Thumama.
Despite the overall similarity of the taxa involved and the
generally low level of character displacement, which is
typical for geckoes, it became clear, that the specimens
from central Saudi Arabia differ in several characters from
all known taxa in the genus 7ropiocolotes and will there-
fore be described as a new species.
OZFMK
A new species of the genus 7ropiocolotes from Central Saudi Arabia DTG
Fig. 2.
SPECIES DESCRIPTION
Tropiocolotes wolfgangboehmei sp. n.
Type material: Holotype, ZFMK 43668, Ath-Thumama,
Saudi Arabia, leg. T. Kordges, 1985; Paratype, ZFMK
87120, Ath-Thumama (25° 16’ N, 46° 37’ E), Saudi Ara-
bia, leg. T. Wilms, 09.05.2001, 10:30 hrs
Diagnosis. A small gecko with a maximum snout-vent-
length of 29.4 mm. The species possesses all diagnostic
characters of the genus Tropiocolotes (in the sense of
Kluge 1967) including digits slightly angularly bent, not
dilated, not fringed, not webbed, nor ornamented, covered
below with a single series of transverse lamellae, pupil ver-
tical, dorsal scales uniform, small, homogenous, imbricate
to subimbricate, preanal and femoral pores usually absent.
Tropiocolotes wolfgangboehmei sp. n. has two pairs of
postmental shields and therefore differs from T. latifi (no
postmentals), 7: helenae (one pair of postmentals) and 7.
depressus (no postmentals or only one pair of very small
postmentals). From 7 persicus it differs by having only
four scales in contact with the nostril instead of five.
It differs from T. algericus, T. tripolitanus, T. scorteccii,
T. somalicus and T. bisharicus by its smooth dorsal sca-
lation. 7. wolfgangboehmei sp. n. differs from 7: nattereri
by possessing clearly bi- or tricarinated subdigital scales
(versus smooth subdigital scales) and from T. steudneri
and 7. nubicus by having two pairs of postmental shields
of which the second is roughly a quarter of the size of the
first (both pairs of roughly equal size in 7: steudneri and
T. nubicus).
Bonn zoological Bulletin 57 (2): 275-280
Paratype of Tropiocolotes wolfgangboehmei sp. n. from Ath-Thumamah (25° 16’ N, 46° 37’ E), Saudi Arabia in life.
Description of the Holotype. An adult female with in-
tact tail. Body depressed. Snout-vent-length (SVL) 29.4
mm, Tail length 32.8 mm. Head narrow, 9.3 mm long
(about 31.6 % of SVL). Neck distinct. Right limb 10.8 mm
long. 5‘ digit of left manus lacking claw, all other digits
complete. Tail 1.12 times SVL, cylindrical tapering even-
ly to its tip.
Fig. 3.
Paratype of Tropiocolotes wolfgangboehmei sp. 0.
from Ath-Thumamah, Saudi Arabia (Fig. 3a: dorsal view, Fig.
3b: ventral view, Scale: 1 mm interline distance).
©ZFMK
278 Thomas M. Wilms et al.
Fig. 4. Habitat and Paratype locality of Tropiocolotes wolf-
gangboehmei sp. n. at Ath-Thumamah (25° 16’ N, 46° 37’ E),
Saudi Arabia.
Rostral 1.5 times as wide as high, divided partly by a me-
dian cleft. Nostril bordered by rostral, first upper labial
and two small postnasals, which are separated by two large
internasals. The internasals are followed by one pair of
subequal scales. Snout and upper surface of the head cov-
ered by hexagonal scales which are juxtaposed. Loreal re-
gion covered with slightly swollen scales, which are some-
what smaller than the remaining scales on the head. 16 in-
terorbitals, 10/10 upper labials, 8/8 lower labials. Occip-
italregion covered by juxtaposed scales slightly smaller
than the interorbitals, which become increasingly swollen
in the neck. Mental slightly wider than rostral, pentago-
nal in shape extending posteriorly not to the level of the
suture between first and second lower labials. One pair of
Tropiocolotes nattereri (SMF 47112), Wadi el Hedhi-
ra, Central Negev, Israel (Fig. 5a: dorsal view, Fig. 5b: ventral
view, Scale: 1mm interline distance).
Fig. 5.
Bonn zoological Bulletin 57 (2): 275-280
large postmentals, in contact with mental and the first two
lower labials. Second pair of postmentals only about one
fourth the size of the first postmentals, separated from each
other by four granular scales. The second pair of postmen-
tals is in contact with the second lower labials.
Body scalation homogenous, scales imbricate and smooth.
58 scales around midbody. Chest widely opened by an in-
cision. Dorsal sides of forelimbs covered with imbricate
scales, scales of ventral sides juxtaposed and slightly
swollen, somewhat smaller than scales on dorsal side of
forelimbs. Dorsal and ventral sides of hind limbs covered
with imbricate scales, which are almost equal in size. Pos-
terior surface of thigh with smaller granular scales. Sub-
digital lamellae strongly bi- or tricarinate. Lamellar for-
mula (digit 1 to 5) for left manus: 9, 12, 14, 13, 11.
Dorsal and ventral scales of the tail homogenous and im-
bricate. Scales at tail base not carinate, but becoming in-
creasingly so distally. Postanal sacs weakly developed
with two enlarged tubercular scales on either side. A pair
of slightly enlarged preanal scales present.
Measurements (in mm, from preserved specimen): Snout-
vent-length 29.4; tail length 32.8; head length 9.3; max-
imum head width 5.1; maximum head height 2.7; orbit di-
ameter 2.0; distance orbit — snouth 3.2; distance orbit —
ear 2.3; ear diameter 0.6.
Colouration of preserved specimen: The specimen 1s pre-
served in 70% ethanol and has almost completely lost his
coloration and pattern. Kordges (1998) depicted this spec-
imen in black and white, and its pattern resembles the
paratype almost exactly (in having six dark transverse
bands on the back and twelve on the tail, as well as hav-
ing exactly the same pattern of the head).
Description of the Paratype. Paratype similar in most re-
spects to holotype, except as noted. An adult male with
intact tail, which was broken during preservation near the
tail base. Body depressed. Snout-vent-length 27.3 mm, tail
length 31.1 mm. Head narrow, head length 8.2 mm (about
30 % of SVL). Neck distinct. Right limb 9.3 mm long.
All digits intact. Tail 1.13 times SVL, cylindrical taper-
ing evenly to its tip.
15 interorbitals, 10/10 upper labials, 7/8 lower labials. Sec-
ond pair of postmentals only about one fourth the size of
the first postmentals, separated from each other by three
granular scales. The second pair of postmentals is in full
contact with the second lower labials, and almost reach-
es the third labial on the left.
Body scalation homogenous, scales imbricate and smooth.
59 scales around midbody, 66 scales between a well
©OZFMK
A new species of the genus Tropiocolotes from Central Saudi Arabia 279
Fig. 6.
Tropiocolotes steudneri (ZFMK 33850), Wadi Halfa,
Sudan. (Fig. 6a: dorsal view, Fig. 6b: ventral view, Scale: 1mm
interline distance).
marked interruption between throat and chest and cloacal
slit. Dorsal sides of forelimbs covered with imbricate
scales, some of which show very slight carination, scales
of ventral sides juxtaposed and slightly swollen, somewhat
smaller than scales on dorsal side of forelimbs. Lamellar
formula (digit 1 to 5) for left manus: 9, 11, 15, 13, 10.
Measurements (in mm, from preserved specimen): Snout-
vent-length 27.3; tail length 31.1; head length 8.2; max-
imum head width 4.9; maximum head height 2.9; orbit di-
ameter 1.7; distance orbit — snouth 2.9; distance orbit —
ear 2.0; ear diameter 0.7.
Colour in life: Head light brown with a broad dark brown
band extending from the snout to just above the ear open-
ing. A narrow yellow line extending axially from the ros-
tral to the snout, up to the upper delimitation of the broad
dark brown band. Palpebral fold yellow. Labials and un-
derside of the head white. Dorsum light brown, with six
broad, dark brown transverse bands. Colouration between
those transverse bands yellowish brown. Ground colour
of dorsal sides of limbs light brown. Hind limbs scattered
with dark brown spots. Tail coloration light brown with
ten dark brown transverse bands. Ventral side without any
pattern, white.
Bonn zoological Bulletin 57 (2): 275-280
Derivatio nominis. This species is named after Prof. Dr.
Wolfgang Bohme in honour to his contributions to her-
petology during his 39 years as curator of herpetology at
the Zoological Research Museum A. Koenig, Bonn and
as the academic mentor of two of the authors of the pres-
ent paper.
Habitat. The holotype was found near a small village at
the border of the Ath-Thumamah area (Kordges 1998).
The paratype was found under a stone in a small canyon
within the Buwayb-Escarpment which is a cretaceous
coral reef consisting of sedimentary rock, mainly lime- and
sandstone.
DISCUSSION
Tropiocolotes wolfgangboehmei sp. n. is known only from
central Saudi Arabia. Because of the close proximity of
Ath-Thumamah to the city of Riyadh we consider the 7ro-
piocolotes recorded by Tilbury (1988) likely to be con-
specific with this new taxon. Based on the external mor-
phology 7. wolfgangboehmei sp. n. is a member of the
group consisting of 7) nattereri, T. steudneri and T: nubi-
cus and is most probably the sister taxon of 7. nattereri.
Biogeographically the distribution pattern of the Zropio-
colotes of north-eastern Africa and Arabia is quite puz-
zling, not the least because of the involvement of at least
two taxa which are not yet formally recognized (Guibé
1966, Arnold 1980, Anderson 1999). Due to the clarifi-
cation on the taxonomic identity of 7) nattereri and T.
steudneri (Werner 1998, Shifman et al. 1999) and the de-
scription in the present paper, it is clear, that actually three
nominal 7ropiocolotes species are known to occur on the
Fig. 7. Distribution of Arabian Tropiocolotes: & Tropiocolo-
tes nattereri from Saudi Arabia [upper &: CAS 148526, Hagl
(29° 18’ N; 34° 57’ E); lower A CAS 148616, Jabal as Sinfa (27°
57’ N; 35° 47° E)], @ Tropiocolotes wolfgangboehmei sp. n.,
@ Tropiocolotes spec. from Bandar-e-Lengeh (Anderson 1999),
Iran; Black areas: approx. Distribution of Tropiocolotes scortec-
ci, grey areas: approx. distribution of Tropiocolotes nattereri.
©ZFMK
280 Thomas M. Wilms et al.
Arabian Peninsula (7. nattereri, T. wolfgangboehmei sp.
n. and T. scortecci). T. nattereri is known from north-west-
ern Saudi Arabia and the adjacent areas in Jordan, Israel
and Egypt while 7: scortecci is an endemic species of
southern Arabia (Oman and Yemen). 7? wolfgangboehmei
sp. n. is the only species distributed in central Arabia some
800-1000 km away from the nearest Tropiocolotes local-
ities in north-western Saudi Arabia, Oman/Yemen and
Iran.
In the past, several authors (Tilbury 1988, Schneider 1990,
Baha El] Din 2006, Cunningham 2010) assigned the cen-
tral Arabian Tropiocolotes to T: steudneri or T. nattereri.
Two specimens from Bandar-e Lengeh on the coast of the
Arabian/Persian Gulf in Iran were also tentatively assigned
to T. steudneri (Guibé 1966, Anderson 1999). Based on
the current distribution of Tropiocolotes it would zoogeo-
graphically be extremely unlikely that the [ranian speci-
mens belong to either 7. steudneri or T nattereri. Based
on the morphological data given by Guibé (1966) and An-
derson (1999) and the photograph given by Anderson
(1999) we are sure that these animals do not belong to 7°
wolfgangboehmei sp. n. but to a new, as yet undescribed
taxon. Baha El Din (2001) suggested the investigation of
the relationship of those Iranian specimens to two Tropi-
ocolotes from eastern Dhofar, Oman, which were tenta-
tively assigned to 7. scortecci by Arnold (1980) despite
notable differences from T. scortecci specimens from fur-
ther west in Dhofar and from the type locality of this tax-
on in Hadramaut, Yemen. The taxonomy of the genus Tro-
piocolotes, especially in Arabia, is still in need of a thor-
ough revision, not only to clarify the species composition
within the genus but also to gain more data on the distri-
bution of the respective taxa and to establish a hypothe-
sis on their phylogenetic relationships.
Acknowledgements. We thank H.H. Prince Bandar ibn Saud
(Director General, Saudi Wildlife Commission, Riyadh) for the
support and continuous interest in our herpetological studies in
Saudi Arabia. The study would not have been possible without
the help of many colleagues of which we would like to thank
H.E. Prof. Dr. A. H. Abuzinada (former Director General, NCW-
CD, Riyadh), Prof. Dr. I. Nader (Former Director of KK WRC,
Thumama), and Dr. I. Galal (Riyadh). For the loan of important
material we thank Prof. Dr. W. Bohme (ZFMK, Bonn), Dr. A.
Schmitz (MHNG, Geneva), J. Vindum (CAS, San Francisco) and
Dr. G. Kohler (SMF, Frankfurt).
REFERENCES
Agarwal I. (2009) First record of Tropiocolotes persicus euphor-
biacola Minton, Anderson and Anderson 1970 (Sauria:
Gekkonidae) from the Republic of India, with notes on its
habitat and natural history. Russian Journal of Herpetology 16
(2): 83-87
Anderson SC (1961) A note on the synonymy of Microgecko
Nikolsky with Zropiocolotes Peters. Wassmann Journal of Bi-
ology 19 (2): 287-289
Bonn zoological Bulletin 57 (2): 275-280
Anderson SC (1999) The lizards of Iran. Society for the Study
of Amphibians and Reptiles, Ithaca, 442 pp.
Arnold EN (1980): The reptiles and amphibians of Dhofar,
Southern Arabia. Journal of Oman Studies, Special Report 2:
273-332
Arnold EN (1986) A key and annotated check list to the lizards
and amphisbaenians of Arabia. Fauna of Saudi Arabia 8:
385-435
Baha el Din S (1994) A contribution to the herpetology of Sinai.
British Herpetological Society Bulletin 48: 18—27
Baha el Din S (1999) A new species of Tropiocolotes (Reptilia:
Gekkonidae) from Egypt. Zoology in the Middle East 19:
17-26
Baha el Din S (2001) A synopsis of African and south Arabian
geckos of the genus Tropiocolotes (Reptilia: Gekkonidae) with
a description of a new species from Egypt. Zoology in the
Middle East 22: 45—56
Baha el Din S (2006): A Guide to the Reptiles and Amphibians
of Egypt. The American University in Cairo Press, Cairo, 359
Pp.
Cunningham PL (2010) Checklist of terrestrial reptiles in three
protected areas in the Kingdom of Saudi Arabia. Herpetolo-
gical Review 41 (1): 25-28
Guibé J (1966) Reptiles et amphibiens récoltes par la Mission
Franco-Iranienne. Bulletin du Muséum Natinal d’ Histoire Na-
turelle 38 (2): 97-98
Kluge AG (1967) Higher taxonomic categories of gekkonid
lizards and their evolution. Bulletin of the American Muse-
um of Natural History 135 (1): 1-59
Kluge AG (1983) Cladistic relationships among gekkonid lizards.
Copeia 1983 (2): 465-475
Kluge AG (1991) Checklist of gekkonid lizards. Smithsonian
Herpetological Information Service (85): 1-35
Kordges T (1998) Die Reptilienfauna des Thumama Nature Park
bei Riyadh, Saudi Arabien. Faunistische Abhandlungen
Staatliches Museum ftir Tierkunde Dresden, Band 21/Suppl.
Contribution to a “Herpetologia Arabica” Nr. 7: 67—83
Leviton A, Anderson SC (1972) Description of a new species
of Tropiocolotes (Reptilia: Gekkonidae) with a revised key to
the genus. Occasional Papers of the California Academy of
Sciences 96:1—7
Schneider B (1990) Verbreitung, Unterartgliederung, Okologie
und Schuppenmorphologie der Gekkoniden—Gattung Tropi-
ocolotes aus dem Bereich der Sahara. Mitteilungen Pollichia
77: 409-419
Shifman S, Shacham B, Werner Y (1999): Tropiocolotes nattereri
(Reptilia: Gekkonidae): comments on validity, variation and
distribution. Zoology in the Middle East 17: 51-66
Sindaco R, Jereméenco K (2008) The Reptiles of the Western
Palearctic. Monografie della Societas Herpetologica Italica 1,
Latina, 579 pp.
Szcerback N, Golubev M (1996) Gecko fauna of the USSR and
contiguous regions. Society for the Study of Amphibians and
Reptiles, St. Louis, [IX + 233 pp.
Tilbury C (1988) An annotated checklist of some of the com-
moner reptiles occurring around Riyadh, Kingdom of Saudi
Arabia. African Journal of Herpetology 34: 25-34
Werner Y (1998) The desert herpetofauna in and near Israel: a
personal review of advances (1986-1997), with new data (Am-
phibia; Reptilia). Faunistische Abhandlungen Staatliches
Museum fiir Tierkunde Dresden, Band 21/Suppl. Contributi-
on to a “Herpetologia Arabica” Nr. 14: 149-161
Received: 15.IX.2010
Accepted: 10.X.2010
©ZFMK
Bonn zoological Bulletin Volume 57 Issue 2 pp. 281-288 Bonn, November 2010
Description of a new subspecies of
Kinyongia uthmoelleri (Miller, 1938) (Squamata: Chamaeleonidae)
with notes on its captive propagation
Nicola Lutzmann!, Jan Stipala?, Ralph Lademann}, Patrick Krause+, Thomas Wilms’ & Andreas Schmitz®
'Seitzstrasse 19, D-69120 Heidelberg, Germany, [email protected], phone: +4962217298625
2Centre for Ecology and Conservation, University of Exeter, Tremough Campus, Penryn, Cornwall,
TR10 9EZ, England, [email protected]
3Muhlgasse 30, D-71034 Boblingen, Germany, [email protected]
4Lisztstrasse 3, D-53115 Bonn, [email protected]; 5Zoologischer Garten Frankfurt,
Bernhard-Grzimek-Allee 1, D-60316 Frankfurt am Main, Germany, [email protected]
6Department of Herpetology and Ichthyology, Muséum d’histoire naturelle, | route de Malagnou,
CH-1208 Geneva, Switzerland, [email protected]
Abstract. A new population of Kinyvongia uthmoelleri was found in the South Pare Mountains in Tanzania in 2000 by J.
Mariaux of the Natural History Museum of Geneva (MHNG). The morphology of this population corresponds well with
that of other previously known populations of K. uthmoelleri from Mt. Hanang and the Ngorongoro crater highlands.
Specimens from South Pare and Ngorongoro are morphologically very similar and show some distinctive characters which
are divergent from the holotype of K. uthmoelleri and other specimens from Mt. Hanang: smaller size, smooth squama-
tion on head and body, smooth head crests, clearly bi-forked parietal crest (only in males), parietal crest composed of
only a single row of scales, a relatively narrower and longer head and no sexual dimorphism in the tail length. K. uth-
moelleri is known from only few museum specimens but these morphological differences and geographic isolation jus-
tify describing the Ngorongoro and South Pare populations as a new subspecific taxon: Kinyongia uthmoelleri artytor
noy. ssp. The new subspecies has been successfully kept and bred in captivity by one author, and a short description is
given of its captive maintenance.
Key words. Kinyongia uthmoelleri, new subspecies, South Pare Mountains, captive propagation.
INTRODUCTION
Despite several recently described Kinyongia taxa from
East Africa (Menegon et al. 2009; Necas 2009; Necas et
al. 2009) the diversity within this genus has not yet been
completely uncovered. Several publications covering ma-
terial from the Eastern Arc Range have contributed to
knowledge on the systematics and taxonomy of these
chameleons (Mariaux et al. 2008; Tilbury et al. 2006). The
type material of the taxon described in the present paper
was collected in 2000 and was at that time deposited un-
der the name “Bradypodion tavetanum” in the Muséum
histoire naturelle (MHNG) in Geneva.
Kinyongia uthmoelleri was described by Miiller (1938) as
Chamaeleo uthmélleri on the basis of a single specimen
from Mt. Hanang. This specimen was collected at 2300
m asl in montane forest. In Loveridge’s (1957) check list
of East African reptiles and amphibians he designated wth-
moelleri as a subspecies of Ch. fischeri, a two-horned
Bonn zoological Bulletin 57 (2): 281-288
species. Mertens (1966) followed this classification, de-
spite the fact that he treated it as a full species in an ear-
lier publication after discovering the second specimen
known to science in the Staatliches Museum fir
Naturkunde Stuttgart (SMNS) (Mertens 1955). On the ba-
sis of lung and hemipenial morphology Klaver & BOhme
(1986) recognized uthmoelleri as a full species and includ-
ed it in the genus Bradypodion. Bo6hme & Klaver (1990)
discovered a third specimen, the first recorded female of
this species, in the Royal Museum for Central Africa in
Tervuren (MRAC). The above mentioned second and the
third specimens were collected from the locality of Old-
eani in the Ngorongoro crater highlands, a massif sever-
al hundred kilometres north of the type locality on Mt.
Hanang. Price (1996) also mentions statements from lo-
cal people about locations between Babati and Singida (a
road that passes close to Mt. Hanang) and 72 km north-
east of Mt. Hanang but up til now the presence of K. uth-
©ZFMK
282 Nicola Lutzmann et al.
Head view of the holotype of K. u. uthmoelleri (pho-
Fig. 1.
to: G. Vogel).
moelleri at these locations have not been confirmed. Re-
cently the taxon uthmoelleri was placed with all other east
African Bradypodion in a new genus, Kinyongia (Tilbury
et al. 2006). In the last 15 years only two authors have pub-
lished details on the captive husbandry and breeding of
K. uthmoelleri, specimens collected from the Ngorongoro
crater highlands (Price 1996; Necas & Nagy 2009).
Around the year 2000, specimens of “Bradypodion uth-
moelleri” appeared in the international pet trade. These
animals were very small in overall size, more slender and
with smoother scalation than K. uthmoelleri specimens
from Mt. Hanang. Even after six years of keeping some
of these specimens in captivity these distinct characters
have not changed and so ontogenetic change in these char-
acters can be ruled out. Unfortunately, the geographic ori-
gin of these specimens was not known until four similar
specimens were discovered in the collection of the
Muséum d’histoire naturelle in Geneva in 2004, which
suggests they originate from the same locality, the South
Pare Mountains, and belong to the new subspecies de-
scribed in this paper.
MATERIAL AND METHODS
In total 20 specimens of K. uthmoelleri of both subspecies
with a confirmed collection locality were located in mu-
seum collections and investigated: 8 from Mt. Hanang (5
males [ZSM 1/1948 (Holotype), ZFMK 74955, ZFMK
82188 and ZFMK 82189], 3 females [ZFMK74953,
ZFMK 74954 and ZFMK 82191] and one subadult
[ZFMK 82190]), 8 from the Ngorongoro crater highland
area [1 male (SMNS 324), 2 females (ZFMK 58664 and
ZFMK 58665), 1 subadult (MRAC R.G. 21852), 4 em-
bryos (ZFMK 58666-69] and 4 from the South Pare
Mountains [2 males (MHNG 2612.65 and MHNG
2612.66), 1 female (MHNG 2612.67), 1 juvenile (MHNG
2612.64)]. It seems probable that the embryos in the
Bonn zoological Bulletin 57 (2): 281-288
ZFMK collection are the unhatched specimens reported
by Price (1996).
Head-body length (HBL), tail length (TL), total length
(ToL), head length (HL) and head width (HW) were meas-
ured in all specimens except in the embryos. The data of
MRAC R.G. 21852 were taken from Bohme & Klaver
(1990). The ratio of HL to HW and the percentages of HL
to HBL, TL to ToL and TL to HBL were calculated. In
addition, we recorded head crest morphology following
Necas (1994), and the morphology and pattern of body
scalation.
RESULTS
All measurements and investigated morphological char-
acters of the specimens are listed in Tables 1-3. The mor-
phological traits which differentiate the male specimens
of Mt. Hanang from those of the South Pare Mountains
and Ngorongoro crater highlands are: higher measure-
ments, a relatively broader and shorter head, rougher
(more convex) scalation on the head and body, canthus
parietalis (cp) not bi-forked anteriorly but fan-shaped an-
teriorly and the cp composed of two rows of scales (Fig.
Fig. 2.
gel).
Type material of K. u. artytor ssp. n. (photo: G. Vo-
©ZFMK
New subspecies of Kinyongia uthmoelleri
Table 1. Morphological measurements of K. wthmoelleri in mm.
TL
remark
specimen locality sex HBL ToL HW HL
ZFMK 74955 Mt. Hanang m 90.1 Py PARE [Sal 26.6
ZFMK 82188 Mt. Hanang m 85.2 119.6 204.6 15.8 26.0
ZFMK 82189 Mt. Hanang m 92.8 WAST PASS) 16.4 30.0
ZFMK 82190 Mt. Hanang m 69.9 93.1 163.0 12.0 22.7 subadult
ZSM 1/1948 Mt. Hanang m 93.0 134.0 227.0 16.0 32.0 holotype of
K. u. uthmoelleri
SMNS 324 Ngorongoro area m 83.0 116.0 199.0 13.0 31.0
MHNG 2612.64 South Pare Mountains m 40.0 46.0 86.0 6.5 13.5 juvenile; paratype of
K. u. artytor ssp. n.
MHNG 2612.65 South Pare Mountains m 80.0 100.0 = 180.0 13.0 31.0 holotype of
K. u. artytor ssp. n.
MHNG 2612.66 South Pare Mountains m 67.0 86.0 153.0 10.0 24.0 paratype of
K. u. artytor ssp. n.
ZFMK 74953 Mt. Hanang f 86.1 95.3 181.4 13.2 20.2
ZFMK 74954 Mt. Hanang f 82.0 91.5 173.5 13%5 24.1
ZFMK 82191 Mt. Hanang if 78.5 82.9 161.4 12.9 ZS
ZFMK 58664 Ngorongoro area f 78.6 95.1 Sid) 11.4 21.1
ZFMK 58665 Ngorongoro area ie 76.1 92.2 168.3 1222 21.0
MRAC R.G.21852 Ngorongoro area f 54.0 61.0 115.0 8.0 19.0 — subadult
MHNG 2612.067 South Pare Mountains f 70.0 81.0 151.0 10.0 21.0 paratype of
K. u. artytor ssp. n.
1). The females show the same differences between both
populations except that the females from the Mt. Hanang
population show also a fan-shaped cp anteriorly, instead
of no furcation at all in the females from the South Pare
Mountains and Ngorongoro highlands. Additionally, the
Mt. Hanang specimens are sexually dimorphic in tail
length relative to body length (males having relatively
longer tails than females), whereas relative tail length be-
tween the sexes of specimens from the South Pare Moun-
tains and Ngorongoro highlands specimens is more or less
the same. Based on these key characters that differentiate
the two groups, we describe the populations from the
South Pare Mountains and the Ngorongoro crater high-
lands as a new subspecific taxon.
Fig. 3.
Holotype of K. u. artytor ssp. n. (photo: N. Lutzmann).
Bonn zoological Bulletin 57 (2): 281-288
Kinyongia uthmoelleri artytor ssp. n.
We chose the syntopic specimens collected by J. Mariaux
& C. Vaucher in the South Pare Mountains during their
journey in 2000 as the type specimens (Fig. 2).
Diagnosis. A small chameleon, which differs from the
nominate form on Mt. Hanang in the following charac-
ters: less convex scalation on body and head, smooth head
crests, parietal crest distinctly bi-forked anteriorly, the
ridge of the parietal crest contains only one scale row, a
higher ratio of HL to HW and HL to HBL (relatively
longer and narrower heads), smaller total length
[153.0-199.0 mm in males (204.6—227.0 mm in K. u. uth-
moelleri) and 151.0—-173.7 mm in females (161.4—181.4
mm in K. u. uthmoelleri)| and no sexual dimorphism in
the relative tail length.
Description of the Holotype (Figs 3-5). MNHG 2612.65,
adult male, 1840 m asl, South Pare Mountains, North Tan-
zania, leg. J. Mariaux & C. Vaucher, 29. 09. 2000. HBL
80.0 mm, TL 100.0 mm, ToL 180.0 mm, HL 31.0 mm,
HW 13.0 mm, the belly is cut and the intestine removed,
both hemipenes are partly everted, length of lower jaw
21.0 mm, distance from front edge of eye to nostril 9.8
mm, distance from nostril to snout tip 5.4 mm, distance
from lower jaw to the tip of casque 7.5 mm, head width
between eyes 6.5 mm, canthus temporalis from eye to an-
gle 7.7 mm, canthus parietalis (cp) is bi-forked anterior-
ly (Fig. 5), distance from bifurcation of cp to the top of
©ZFMK
284
Nicola Lutzmann et al.
Table 2. Ratios of morphological measurements of K. uthmoelleri.
specimen location sex HL/HW HLas% HBL TLas % ToL TL as % HBL
ZFMK 74955 Mt. Hanang m 1.76 29.52 57.68 136.29
ZFMK 82188 Mt. Hanang m 1.65 30.52 58.46 140.38
ZFMK 82189 Mt. Hanang m 1.83 32.33 S53 135.45
ZFMK 82190 Mt. Hanang m 1.90 32.47 57.12 133.19
ZSM 1/1948 Mt. Hanang m 2.00 34.41 59.03 144.09
SMNS 324 Ngorongoro area m 2.38 37.35 58.29 139.76
MHNG 2612.064 South Pare Mountains m 2.08 33.75 53.49 115.00
MHNG 2612.065 South Pare Mountains m 2.38 38.75 55.56 125.00
MHNG 2612.066 South Pare Mountains m 2.40 35.82 56.21 128.36
ZFMK 74953 Mt. Hanang f 1.53 23.46 52.54 110.69
ZFMK 74954 Mt. Hanang f 1.79 29:39 52.74 111.59
ZFMK 82191 Mt. Hanang f 1.65 27.13 51.36 105.61
ZFMK 58664 Ngorongoro area f 1.85 26.84 54.75 120.99
ZFMK 58665 Ngorongoro area fe a2 27.60 54.78 121.16
MRAC R.G.21852 | Ngorongoro area f 2.38 35.19 53.04 112.96
MHNG 2612.067 South Pare Mountains f P| 30.00 53.64 Seyi
casque 13.1 mm, length of bifurcation of cp 4.4 mm, max-
imum width of bifurcation of cp 4.3 mm, one conical scale
in the neck smaller than 2.0 mm, no ventral or tail crests,
collection and field number (TZ-141) are tied around the
left hind leg. The scales on the head, the head crests and
the body are flat. Only the ridge of the cp is pronounced
though not denticulate. Fig. 6 shows the colouration of the
holotype in life.
Variation on the paratypes (MNHG 2612.64, 2612.66-
67). All measurements of the paratypes and the other spec-
imens of K. wu. artytor ssp. n. are shown in Tables 1-2.
MNHG 2612.64 is a juvenile male, the belly is cut and
the intestines are removed, the colouration after preser-
vation is very dark, collection and field number (TZ-138)
is tied around the right hind leg. MNHG 2612.66 is an
adult male and fits quite well with the description of the
holotype: belly is cut but the intestines are still present, 2
conical scales in the neck, collection and field number
Fig. 4. Portrait of the holotype of K. u.
(photo: N. Lutzmann).
artytor ssp. Nn.
Bonn zoological Bulletin 57 (2): 281-288
(TZ-143) are tied around the right hind leg. The original
colouration is better preserved: head is greyish, red radi-
ations on the eyes, which continue darker on the head
sides, the interstitial skin is red around throat and neck,
the lateral stripe is greyish on dark background, the tail
is greyish. MNHG 2612.67 (Fig. 7) is an adult female with
a flat casque, cut belly without intestines and one conical
scale in the neck. Collection and field number (TZ-144)
are tied around the left hind leg, the colouration after
preservation is very dark with only some greyish flat scales
on the head and body.
Distribution. K. wu. artytor ssp. n. is know only from the
South Pare Mountains and the Ngorongoro crater high-
lands (Fig. 8).
Etymology. The subspecies name “‘artytor” 1s the latinised
substantive of the Greek verb “aptuetv" (artyein), which
can be translated as “to prepare / to make ready requiring
skills”. We name this new subspecies in honour and trib-
ute to Prof. Dr. Wolfgang Bohme and his skills to prepare
dozens of students on their way to scientific careers, which
was also the case for four of the authors of this publica-
tion.
Captive maintenance. All specimens were kept individ-
ually in full gauze terrariums indoor and outdoor in the
same cages in order to minimize the stress of relocation.
The size of the terrartums were for females 50x50x80 cm
and for males 45x50x70 cm (length x width x height). All
specimens were kept outdoor from spring to autumn, if
the temperatures did not fall consistently below 10 °C at
night time. The highest recorded temperature was 35 °C
at noon, the lowest 5 °C at night time. The cages were ex-
posed to the sun in the morning and fell into shade around
©ZFMK
New subspecies of Kinyongia uthmoelleri
Table 3. Morphological characters of K. uthmoelleri.
No
oO
Nn
head scalation
No. scale rows
specimen location SeX body scalation —_bi-forked cp
on the ridge of cp
ZFMK 74955 Mt. Hanang m rough rough no 2
ZFMK 82188 Mt. Hanang m rough rough no 2
ZFMK 82189 Mt. Hanang m rough rough no 2
ZFMK 82190 Mt. Hanang m rough rough no 1-2
ZSM 1/1948 Mt. Hanang m rough rough no 2
SMNS 324 Ngorongoro area m flat flat yes l
MHNG 2612.065 South Pare Mountains m flat flat yes ]
MHNG 2612.066 South Pare Mountains m flat flat yes
ZFMK 74953 Mt. Hanang tg rough rough no 7
ZFMK 74954 Mt. Hanang f rough rough no 2
ZFMK 82191 Mt. Hanang f rough rough no 2
ZFMK 58664 Ngorongoro area f flat flat = |
ZFMK 58665 Ngorongoro area f flat flat = 1
MRAC R.G.21852 Ngorongoro area f flat flat ? ?
MHNG 2612.067 South Pare Mountains =f flat flat - l
noon. In spring and autumn the cages were sprinkled with
water four times per day (in midsummer 6 times) for up
to four minutes in the hottest time of the day. During the
winter the terrariums were illuminated with common ter-
rarium-tubes (T5 with 35 W) 13 hours per day. A halo-
gen spot was activated for 45 minutes three times per day
for basking, so that the ambient temperature stayed be-
tween 22 and 24 °C at day time and between 6 and 16 °C
at night time. The terrariums were completely sprinkled
with water in the morning and evening. The diet consist-
ed of small arthropods, mainly self-bred crickets,
grasshoppers, flies, cockroaches etc. Every second feed-
ing the food was enriched with vitamins and minerals. On-
ly pregnant females were additionally given small pieces
of cuttlebone. To trigger mating behaviour, the males were
transferred into the cages of the females. Immediately, the
males started head bobbing and displayed bright colours.
Fig.5. Head view of the holotype of K. wu. artytor ssp. n.
(photo: N. Lutzmann).
Bonn zoological Builetin 57 (2): 281-288
In all cases the females displayed a colouration of green-
ish-white with small black dots, whereon the males
stopped courtship. Matings have not be observed until
now, but after several days the females started gaining
weight and became visibly rounder. The males were sub-
sequently removed, because it seemed that the females on-
ly lay their eggs if there were no males in their vicinity.
Older females laid their clutches without test excavations,
younger females with test excavations at a depth of 5 to
7 cm into the terrartum substrate. The clutches consisted
of 7 to 12 eggs. The dimensions of the eggs were approx-
imately 8.0x4.0 mm. The eggs were incubated in com-
pletely closed, small plastic boxes in wet vermiculite. Af-
ter approximately 115 days at 19-21 °C during the day
and 15-18 °C at night, the temperatures were increased
to 22 °C during the day and 20 °C at night. At this time
the humidity of the vermiculite was also increased to sim-
ulate the beginning of a rainy season. Hatching started af-
ter 147 to 161 days. After the hatchlings opened the egg
shells, they occasionally paused for up to 3 days to resorb
the yolk. The young chameleons were kept individually
in smaller cages 25x25x40 cm under the same conditions
as the adults. It should be taken into account that the tem-
perature changes should not be as pronounced for the ju-
veniles as for the adults, because it seems that they are un-
able to thermoregulate effectively. The maximum record-
ed lifespan in captivity for this species is six years (Fig.
9).
DISCUSSION
The genus Kinyongia contains currently 17 species, all of
which are restricted to moist montane forests in the East
and Central African highlands. Recently several new
©ZFMK
286 Nicola Lutzmann et al.
Fig. 6.
species have been described from montane forests in
Kenya and Tanzania (Menegon et al. 2009, Necas 2009,
Necas et al. 2009) and several subspecies have also been
raised to species status based on genetic divergence and
detailed morphological studies (Mariaux et al. 2008). No
doubt more species remain to be discovered in the still
poorly surveyed mountain ranges across East Africa. The
discovery of K. uthmoelleri in the South Pare Mountains
also shows that species’ distribution ranges are not well
documented and it is quite likely that K. uwthmoelleri also
occurs on other massifs in-between these now known pop-
ulations, such as Mt. Kilimanjaro and Mt. Meru (Fig. 8).
K. uthmoelleri has a similar distribution to the Trioceros
sternfeldi species complex, including the recently de-
scribed 7. hanangensis (Krause & B6hme 2010). Although
the phylogeography of all 7: sternfeldi populations has not
been investigated, the Mt. Hanang population has been
identified as a divergent sister clade to the Mt. Meru/ Kil-
imanjaro populations. A similar pattern is found in K. uth-
moelleri, the Mt. Hanang populations morphologically di-
Fig. 7.
(photo: J. Mariaux).
Female paratype of K. u. artytor ssp. n. in life
Bonn zoological Bulletin 57 (2): 281-288
Holotype of K. u. artytor ssp. n. in life (photo: J. Mariaux).
vergent from the Ngorongoro/ Pare populations, suggest-
ing that despite its geographically intermediate position,
Mt. Hanang populations have been isolated for a longer
period of time. Volcanic activity in the North of Tanza-
nia, which created these massifs, persisted from
Oligocene (37 myr ago) to the Quaternary. Subsequent
colonisation and population fragmentation of chameleon
populations on these massifs has resulted in their diver-
sification into a number of morphologically similar but
clear divergent (sub-) species.
The rarity of some species of the genus Kinyongia in mu-
seum collections is explainable because they inhabit the
rainforest canopy and their cryptic morphology and be-
haviour (Necas & Nagy 2009). Unfortunately Kinyongia
uthmoelleri is one of the rarest chameleons of East Africa
in museum collections, although Price (1996) mentioned,
that this species is common in the Ngorongoro crater high-
lands. But during eight days of fieldwork he also found
only five specimens. In total, there are only 20 specimens
in museum collections in Europe from three different lo-
calities and more intensive fieldwork is required to bring
to light if this reflects the real situation of population den-
sities, distribution and ecology of this species in the wild.
Further collections will also confirm if the morphologi-
cal variation recorded here, from the relatively few spec-
imens available, is consistent within and between the three
populations.
Nevertheless, there are pronounced morphological differ-
ences between the Ngorongoro and South Pare specimens
and the specimens from the type locality on Mt. Hanang
(Miller 1938). These are sufficiently distinct to justify
their description as a new taxon. This is similar to the sit-
uation where K. boehmei was originally described as a
subspecies of K. tavetana (Lutzmann & Necas 2002) and
later elevated in to full species rank based on genetic di-
vergence from all other two-horned chameleons (Mariaux
OZFMK
New subspecies of Kinvongia uthmoelleri 287
Cg
Ngorongoro crater ad
highlands #®
a Mt. Hanang
160 Kilometers
Fig. 8.
and Ngorongoro crater highlands)].
et al. 2008). Molecular studies have revealed numerous
cryptic species among East African chameleons (Matthee
et al. 2004; Tilbury & Mariaux 2006; Mariaux et al. 2008,
Krause & Bohme 2010) and follow-up studies using mo-
lecular data should provide a better insight into the evo-
lutionary relationships and genetic divergence that exists
between the three isolated populations of K. uthmoelleri,
some of which may justify species status.
Acknowledgements. We specially want to thank Jean Mariaux,
Geneva, for providing us the with type material, information on
the type locality and pictures of this new taxon. Thanks also to
the colleagues providing acces to collection and material: Wolf-
gang Bohme and Ulla Bott (ZFMK), Frank Glaw (ZSM), An-
dreas Schliiter and Axel Kwet (SMNS).
REFERENCES
Bohme W, Klaver C (1990) Zur Kenntnis von Bradypodion uth-
moelleri (Miller, 1938). Salamandra 26 (4): 260-266
Klaver C, Bohme W (1986) Phylogeny and classification of the
Chamaeleonidae (Sauria) with special reference to hemipenis
morphology. Bonn. Zool. Monogr. 22: 5—60
Bonn zoological Bulletin 57 (2): 281-288
TANZANIA
Mt. Kilimanjaro
are Mountains
Elevation (metres ak
| 0- 1000
[_] 1000 - 1500
[=>] 1500 - 2000
(5)} 2000 - 2500
(i) 2500 - 3000
ls) 3000 - 6000
SE
Collecting localities of K. uthmoelleri |K. u. uthmoelleri (Mt. Hanang); K. u. artytor ssp. nov. (South Pare Mountains
Krause P, Bohme W (2010) A new chameleon of the 7rioceros
bitaeniatus complex from Mt. Hanang, Tanzania, East Africa
(Squamata: Chamaelonidae). Bonn. Zool. B. 57(1): 19-29
Loveridge A (1957) Check list of the reptiles and amphibians
of East Africa (Uganda, Kenya, Tanganyika, Zanzibar). Bull.
Mus. Comp. Zool. 117: 153-362
Lutzmann N, Necas P (2002) Zum Status von Bradypodion tave-
tanum (Steindachner,1891) aus den Taita Hills, Kenia, mit
Beschreibung einer neuen Unterart (Reptilia: Sauria:
Chamaeleonidae). Salamandra 38 (1): 5-14
Matthee C, Tilbury CR, Townsend T (2004) A phylogenetic re-
view of the African leaf chameleons: genus Rhampholeon
(Chamaeleonidae): the role of vicariance and climate change
in speciation. Proc. Roy. Soc. 271: 1967-1975
Mariaux J, Tilbury CR (2006) The pygmy chameleons of the
Eastern Arc Range (Tanzania): Evolutionary relationships and
the description of three new species of Rhampholeon (Sauria:
Chamaeleonidae). Herpetological Journal 16: 315—331
Mariaux J, Lutzmann N, Stipala J (2008) The two-horned
Chameleons of East Africa. Zool. J. Linn. Soc. 152: 367-391
Menegon M, Tolley K, Jones T, Rovero F, Marshall AR, Tilbury
CR (2009) A new species of chameleon (Sauria:
Chamaeleonidae: Kinyongia) from the Magombera forest and
the Udzungwa Mountains National Park, Tanzania. African
Journal of Herpetology 58 (2): 59-70
©OZFMK
288 Nicola Lutzmann et al.
7
Fig. 9.
Mertens R (1955) Amphibien und Reptilien aus Ostafrika. Jh.
Ver. Vaterl. Naturk. Wiirtt. 110: 47-61
Mertens R (1966) Liste des rezenten Amphibien und Reptilien:
Chamaeleonidae. Das Tierreich, Berlin
Miiller L (1938) Uber die von den Herren L. Uthmiller und L.
Bohmann im britischen Mandatsgebiet “Tanganyika Territo-
ry” gesammelten Chamialeons. Zoologischer Anzeiger 122:
20-23
Necas P (1994) Bemerkungen zur Chamaleon-Sammlung des
Naturhistorischen Museums in Wien, mit vorlaufiger Beschrei-
bung eines neuen Chamaleons aus Kenia (Squamata:
Chamaeleonidae). Herpetozoa 7 (3/4): 95-108
Necas P (2009) Ein neues Chamaleon der Gattung Kinyongia
(Tilbury, Tolley & Branch 2006) aus den Poroto-Bergen, Stid-
Tansania (Reptilia: Sauria: Chamaeleonidae). Sauria 31 (2):
41-48
Bonn zoological Bulletin 57 (2): 281-288
A six year old K. u. artytor ssp. n. in captivity (photo: R. Lademann).
Necas P, Sindaco R, Koreny L, Kopecna J, Malonza PK, Mod-
ry D (2009) Kinyongia asheorum sp. n., a new montane
chameleon from the Nyiro Range, northern Kenya (Squama-
ta: Chamaeleonidae). Zootaxa 2028: 41—50
Necas P, Nagy P (2009) Ein Beitrag zur Kenntnis von Uthmdllers
Chamialeon, Kinyongia uthmoelleri (Miller, 1938). Sauria 31
(1): 15-21
Price T (1996) Zur weiteren Kenntnis von Bradypodion uthmoel-
leri (Miiller, 1938). Salamandra 32 (3): 199-202
Tilbury CR, Tolley KA, Branch WR (2006) A review of the sys-
tematics of the genus Bradypodion (Sauria: Chamaeleonidae),
with the description of two new genera. Zootaxa 1363: 23-38
Received: 30.VII.2010
Accepted: 15.X.2010
©ZFMK
Bonn zoological Bulletin | Volume 57 Issue 2 pp. 289-296 | Bonn, November 2010
A new species of the genus Lycodon (Boie, 1826)
from Yunnan Province, China
(Serpentes: Colubridae)
Gernot Vogel! & Patrick David?
‘Society for Southeast Asian Herpetology, Im Sand 3, D-69115 Heidelberg, Germany;
E-mail: Gernot. [email protected] _
2Muséum national d’ Histoire naturelle, Département Systématique et Evolution, Reptiles & Amphibiens,
UMR 7205 OSEB, Case postale 30, 57 rue Cuvier, F-75231 Paris Cedex 05, France; E-mail: pdavid@mnhn. fr
Abstract. A new species of the genus Lycodon is described from Yunnan Province, People’s Republic of China. It dif-
fers from the superficially similar Lycodon fasciatus by the fact that the loreal is not entering orbit, in colouration, and
lower numbers of subcaudals and infralabials. From the Lycodon ruhstrati group it differs by the colouration of the ven-
ter and the dorsal bands. This new species is only known the Chinese province of Yunnan.
Keywords. Oriental Region, China, Colubrinae, Lycodon fasciatus, taxonomy, Lycodon synaptor sp. n.
INTRODUCTION
Snakes of the species rich genus Lycodon Bole, 1826 re-
ceived considerable attention in most regions of Asia. Six
new species were described form the Philippines (Ota &
Ross 1994; Lanza 1999; Gaulke 2002) and new species
were discovered in Cambodia (Daltry & Wiister 2002), In-
dia (Mukherjee & Bhupathy 2007) and Myanmar (Slowin-
ski et al., 2001). The taxonomy of the Chinese part of the
genus remained unattended until recently. Pope (1935) list-
ed five species, namely Lycodon capucinus Bote, 1827,
Lycodon fasciatus (Anderson, 1879), Lycodon laoensis
Ginther, 1864, Lycodon ruhstrati (Fischer, 1886) and Ly-
codon subcinctus Bote, 1827. This arrangement has not
changed for the next 75 years. Vogel et al. (2010) reviewed
the Lycodon ruhstrati complex and described Lycodon
ruhstrati abditus as a new subspecies from China, and
revalidated Lycodon futsingensis (Pope, 1928). Detailed
examination of banded specimens of the genus led us to
the conclusion, that the diversity is much higher in this
region and that several species await description.
In the course of our ongoing review of the Lycodon fas-
ciatus complex, we came upon two specimens of the genus
Lycodon from Yunnan, China, which seemed to be differ-
ent from L. fasciatus. A detailed examination showed clear
morphological differences which lead us to describe them
as new species.
Bonn zoological Bulletin 57 (2): 289-296
MATERIAL & METHODS
This revision is based on a total of 67 preserved specimens
of Lycodon fasciatus auctorum examined for their exter-
nal morphological characters and on several photographed
specimens. They are listed in the Appendix I. Compara-
tive material of the L. ruhstrati complex is listed under
Vogel et al. (2010).
A total of 53 morphological characters were recorded for
each specimen. The characters and their abbreviations are
listed in Table 1. Not all of these characters have been used
for this study, but all of them were compared.
Measurements, except body and tail lengths, were taken
with a slide-caliper to the nearest 0.1 mm; all body meas-
urements were made to the nearest millimetre. The num-
ber of ventral scales was counted according to Dowling
(1951). Half ventrals were not counted except they were
present on both sides (divided ventrals). The terminal scute
is not included in the number of subcaudals. The dorsal
scale row counts are given at one head length behind head,
at midbody (1.e., at the level of the ventral plate correspon-
ding to a half of the total number of ventrals), and at one
head length before vent. We considered being sublabials
those shields that were completely below a supralabial.
Values for paired head characters are given in left / right
order.
©ZFMK
290
Gernot Vogel & Patrick David
Table 1. List of morphological characters used in this study and
their abbreviation.
Abbreviation Characters
Morphometry
l SVL
2 TaL
3 TL
4 Rel TL
Anatomy
5 TEETH
Scalation
6 DSR
i ASR
8 MSR
9 PSR
10 Keel
11 VEN
12 PreVEN
13. VEN not
14. VEN keel
[S56
16 ANA
17. Lor-l
18 ~ Lor-r
19. Lo touch-l
20 Lo touch-r
21 SL-l
22 SL-r
23 SL/Eye-l
24 SL/Eye-r
25. Larg SL-l
26 _Larg SLrl
29 Vel
28 IL-r
29 ~IL-tot
30“ IL/Ist child
31 = PreOc-l
32 PreOc-r
33 PostOc-l
34 ~=PostOc-r
35. ATem-1
36 =©6©ATem-r
37 =PTem-|
38 PTem-r
39 ~=ParaR
40 ‘Paras
41 Parab
Pattern
42 BODCOL
43 Bands
44 Tail bands
45 Tail venter
46 Bellycol
47 Bellyspeck
48 First band
49 Broad base
50. _ Broad vert
51 Edged
52 Coul throat
Ve throat
Snout-vent length (mm)
Tail length (mm)
Total length (mm)
Relative tail length TaL/TL
Number of upper maxill. teeth (one side)
Dorsal scale rows
Dorsal scale rows at neck
Dorsal scale rows at midbody
Dorsal scale rows before vent
Number of keeled dorsal rows
Ventral plates
Number of preventrals
Ventrals notched or not
Ventrals keeled
Subcaudal plates
Anal plate: 1: single — 2: divided
Number of loreal scale (0 or 1) at left
Number of loreal scale (0 or 1) at right
Loreal scale touches eye at left
Loreal scale touches eye at right
Number of supralabials at left
Number of supralabials at right
Numbers of the SL entering orbit at left
Largest SL left
Largest SL right
Number of infralabials at left
Number of infralabials at right
Total number of infralabials
Number of IL in contact with
anterior chin shield
Number of preoculars at left
Number of preoculars at right
Number of postoculars at left
Number of postoculars at right
Number of anterior temporals at left
Number of anterior temporals at right
Number of posterior temporals at left
Number of posterior temporals at right
Temporal row containing paraparietals
Plates surrounding paraparietals,
see Inger & Marx (1965)
Scales between the paraparietals
Body colour!: grey; 2: brown or ochre
Number of bands on body
Number of bands on tail
Colouration of tail venter
Colouration of belly
Speckling of belly
Number of VEN before the
first band starts, counted left side
Number of VEN that are covered at
the base of the first band
Numbers of vertebral scales that are
covered by the first band
Dorsal bands with light margins
Colour of the throat
Dark VEN on the throat before
the first band
Bonn zoological Bulletin 57 (2): 289-296
Numbers of the SL entering orbit at right
The white or light bands on the body and tail were count-
ed on one side. Hardly visible or incomplete bands were
counted as one, bands that were fused were counted as
two. The collar on the neck was not counted and bands
covering the anal shield were added to the bands of the
body.
Museum abbreviations
BMNH: The Natural History Museum, London, UK. —
BNHS: Bombay Natural History Society, Mumbai, India.
— CAS: California Academy of Sciences, San Francisco,
USA. — CIB: Chengdu Institute of Biology, Chengdu,
People’s Republic of China. — FMNH: Field Museum of
Natural History, Chicago, USA. — KIZ: Kunming Insti-
tute of Zoology, Kunming, People’s Republic of China.
— MNHN: Muséum national d’Histoire naturelle, Paris,
France. — NMW: Naturhistorisches Museum Wien, Aus-
tria. — ZFMK: Zoologisches Forschungsmuseum
Alexander Koenig, Bonn, Germany. — ZMB: Zoologis-
ches Museum fiir Naturkunde der Humboldt-Universitat
zu Berlin, Berlin, Germany. — ZSM: Zoologische
Staatssammlung, Miinchen, Germany.
RESULTS
Lycodon synaptor sp. n.
Holotype. BMNH 1905.1.30.63 adult female (tail dissect-
ed), from “Tongchuan, Yunnan”, today Dongchuan, 100
km north of Kunming, Yunnan Province, People’s Repub-
lic of China (Figs 1—3). Collected by the J. Graham Ex-
pedition, unknown date.
Be 12a Ee D
Fig. 1. Dorsal view of preserved holotype of Lycodon synap-
tor sp.n., BMNH 1905.1.30.63 from Dongchuan, 100 km north
of Kunming, Yunnan Province, People’s Republic of China. Pho-
tograph by Gernot Vogel.
©ZFMK
New Lycodon from Yunnan 29]
Fig. 2. Ventral view of preserved holotype of Lycodon syn-
aptor sp. n., BMNH 1905.1.30.63 from Dongchuan, 100 km
north of Kunming, Yunnan Province, People’s Republic of Chi-
na. Photograph by Gernot Vogel.
Paratype. MNHN 1905.0283, adult female (tail dissect-
ed), from “Tongchuan Fu, Chine”, at present Dongchuan,
Yunnan Province, People’s Republic of China. Collected
by W. F. H. Rosenberg on 21s‘ July 1905.
Diagnosis. A species of the genus Lycodon characterized
by: (1) loreal scale not entering orbit; (2) 15—17 dorsal
scale rows at the forepart of the body and 17 dorsal scale
rows at midbody; (3) upper and vertebral dorsal rows
(6-7) keeled; (4) 201—203 ventrals in females, males un-
known; (5) 68-69 Sc in females, males unknown; (6) a
relative tail length of about 0.189—0.192 in females, males
unknown; (7) 8 supralabials with SL 4—6 touching the or-
bit (7) 30-31 narrow white bands on a dark body; (8)
width of the first band vertebral 0.5—1.0 scales, on the base
3 ventrals; and (9) the belly with discreet bands through-
out.
Fig. 3. Lateral view of the right side of the head of preserved
holotype of Lycodon synaptor sp. n., BMNH 1905.1.30.63 from
Dongchuan, 100 km north of Kunming, Yunnan Province,
People’s Republic of China. Photograph by Gernot Vogel.
Bonn zoological Bulletin 57 (2): 289-296
The new species can be recognized by the combination
of the loreal scale not entering orbit (entering in L. fas-
ciatus sensu stricto), its narrow dorsal bands, with the first
band starting at ventral S—9 (more irregular in L. fascia-
tus [Fig. 4] and species of the L. ruhstrati group, where
they usually start later) and the dark throat, which usual-
ly is light in other species of the L. fasciatus group and
the L. ruhstrati group. Most other characters match with
Lycodon fasciatus.
Detailed comparisons with other species of the genus Ly-
codon appear below in the Discussion.
Fig. 4.
Dorsal view of Lycodon fasciatus. CIB 9804, from
Ruili City, Yunnan. Note the irregular bands. Photograph by Ger-
not Vogel.
Etymology. This species is indirectly named in honour of
Dr. Wolfgang Bohme. It was always a publicized aim of
Wolfgang Bohme to unite professional and amateur her-
petologists. We, both authors have always been amateur
herpetologists, so it is a delight for us to dignify his ef-
forts towards this aim. The specific name synaptor, a noun
in apposition, stems from the Greek word “ovuvonpts”
meaning “a connection”. In this case, this noun underlines
the connection of these two kinds of herpetologists.
We suggest the following common names: Boehme 5 wolf
Snake (English), Bohmes Wolfszahnnatter (German).
Description of the holotype. Habitus. Body elongate,
somewhat laterally compressed; head flattened anterior-
ly, well distinct from the neck; snout depressed and elon-
gate; nostril oval, large, in the middle of the nasal. Eye
moderate, with a vertically elliptic pupil.
SVL 374 mm; TaL 89 mm; TL 463 mm.
©ZFMK
292 Gernot Vogel & Patrick David
Fig. 5.
Ventral view of Lycodon fasciatus. CIB 9804, from
Ruili City, Yunnan. Note he whitish colouration of the anterior
part and te speckling of the posterior part. Photograph by Ger-
not Vogel.
Dentition. A total of 10 maxillary teeth, with the follow-
ing formula: 4 small anterior teeth + 2 strongly enlarged
teeth + a wide gap + 2 small teeth + a small gap + 2 strong-
ly enlarged, posterior teeth.
Body scalation. 201 VEN (+ 2 preventrals), 68 SC, all
paired. Anal single. Dorsal scales in 17—17—15 rows, the
7 upper rows feebly keeled. Vertebral row not enlarged.
No apical pit detected.
Head scalation. Rostral, triangular, hardly visible from
above; nasal vertically divided by a furrow below and
above the nostril; two small, trapezoidal internasals, wide-
ly in contact each with the other and with prefrontals; two
large prefrontals, longer and wider than internasals; a
rather small ogive-shaped frontal, about 1.3 times longer
than wide and about 0.8 time as long as the suture between
the parietals; 2 large parietals, each edged with three large
scales, 2 upper temporals and a larger paraparietal poste-
riorly; | / 1 wide, triangular supraocular; 1 / 1 small pre-
ocular, located above the posterior part of loreal; 2 / 2 pos-
toculars, about the same size; | / 1 subrectangular loreal,
elongateand narrow, not entering orbit, in contact with SL
2 and 3, the large preocular, the prefrontal (long contact)
and the posterior part of nasal; 8 / 8 SL, of which the first
four are higher than long, SL 1—2 in contact with nasal,
SL 3-5 entering orbit, 6 and 7 SL largest; 2+2 / 2+2
temporals, lower anterior temporal a bit broader than up-
per one, posterior temporals smaller; 8 / 8 infralabials, IL
1-4 in contact with the first pair of sublinguals; anterior
and posterior pair of sublinguals of about same length, but
anterior pair wider.
Coloration in preservation. Body and tail dark blackish-
brown, with 31 crossbands on body and 9 on tail, narrow
and cream, not speckled; these crossbands, about | dor-
sal scale long, widen at their ventrolateral limit, up to about
5-7 dorsal scale long; the first crossband, beginning at the
level of VEN 9; the second crossband is 8 scale rows be-
hind the first one; 9 cream crossbands on the tail, also not
speckled.
The head is uniformly blackish-brown, a broad nuchal col-
lar extends from the 6‘ and 7‘ supralabial across the low-
er posterior temporal across the posterior half of the pari-
entals. The underside of the head ist dark in the anterior
half and cream in the posterior one; the throat is cream,
with a dark clowdy spot on the preventrals and the first
ventral.
The venter is dark, with faint cream bands rather regular,
2 ventrals wide and with 34 ventrals in between. With-
in these bands some ventrals are dark on one half and
cream on the other, especially in the posterior part of the
body. The under surface of the tail is banded as the ven-
ter with the cream bands about 1.5 SC wide.
Fig. 6.
Comparison of lateral head scalation of Lycodon synaptor sp. n. (BM 1905.1.30.63 Holotype) and one L. fasciatus (BNHS
1223) where the Lo touches the eye. This is the case only in 6.3% of all cases seen by us. Please note that in L. synaptor sp. n. the
Lo is well separate from the eye by the preocular scale, whereas it is tapering and narrow in the L. fasciatus, where it is more or
less inserted between 2 sales and falls short from the eye. Drawings by Dick Visser.
Bonn zoological Bulletin 57 (2): 289-296
©ZFMK
New Lycodon from Yunnan 293
Table 2. Pholidosis of the two type type specimens of Lycodon synaptor sp. n.
BMNH_ 1905.1.30.63
Characters MNHN_ 1905.0283
holotype paratype
Sex Female Female
SVL 374 395
TaL 87 92
Reine 0.192 0.189
ASR 17 15
MSR 17 Ig)
VEN 201 203
SC 68 69
Lo enters eye no no
Dorsal bands 31 30
Tail bands 9 9
First band at VEN no 9 5)
Broad base [VEN] fi gS}
Broad vertebral [Dorsals] 2 l
Variation. The paratype, MNHN 1905.0283, agrees in
most respects with the description of the holotype with the
throat being dark instead of light. The maxilla are miss-
ing in the paratype. A comparison of the most important
morphological characters is summarized in Table 2.
Distribution. China. Lycodon synaptor sp. n. is current-
ly only known from the region of Dongchuan, Dongchuan
County, in the province of Yunnan, China.
Biology. There is no information available on the biolo-
gy of this species. However, the region of Dongchuan is
highly mountainous. Dongchuan is located between high
mountains of the ranges known as Gongwang Shan and
Liangwang Shan. In the area, the highest point is 4.344
meters high, and lowest is 695 meters asl.
DISCUSSION
Lycodon synaptor sp. n. is superficially similar to L. fas-
ciatus but differs from the whole L. fasciatus group (in-
cluding L. butleri) by the loreal, which does not enter or-
bit in L. synaptor. We have examined six specimens (out
of 35) of Lycodon fasciatus sensu stricto in which the lo-
real does not enter orbit (eight occurrence, three times on
both sides [4.7 %]), but the morphology of the anterior
region of the eye is different. In specimens of L. fascia-
tus in which the loreal does not enter orbit, the posterior
region of this narrow scale is very tapering (Fig. 6). Its
apex is more or less inserted between the preocular and
the 4th SL and falls short from the eye. In contrast, in L.
Bonn zoological Bulletin 57 (2): 289-296
synaptor, the loreal scale is well separated from the orbit
by a broad preocular. The tail is a bit shorter in L. synap-
tor sp. n. (0.189—0.192 vs. 0.190—0.219 in 29 females of
L. fasciatus). There are also differences in the shape of the
bands and the colouration of the belly (compare Figs 2 and
5). L. synaptor sp. n. has eight infralabials, whereas only
one specimen out of 60 specimens of L. fasciatus had eight
infralabials on both sides and rarely that character is seen
on one side (5 %) in L. fasciatus. L. synaptor sp. n. has
less subcaudals than L. fasciatus (68—69, x = 68.5, versus
70-88, x = 79.9 with one outlier having 67 subcaudals).
For a complete comparison of scale counts see Table 3.
L. synaptor sp. n. differs from the other Chinese and In-
dochinese species as follows: from L. subcinctus by the
fact that in L. synaptor sp. n. both a loreal and a preocu-
lar are present. From L. laoensis, L. zawi and L. capuci-
nus it differs by the anal shield which 1s single in L. synap-
tor sp. n. but divided in the latter two species. Furthermore
the colouration is much different. From the L. ruhstrati
group it differs by the colouration of the bands (small, reg-
ular, completely light in L. synaptor sp. n., getting broad-
er posteriorly, irregular and partly speckled with brown
in the L. ruhstrati complex), by the number of infralabi-
als (eight in L. synaptor, nine to ten in the L. ruhstrati
group) and by the colour of the belly, which is speckled
or uniform light in the L. ruhstrati group, but clearly band-
ed in L. synaptor sp. n. From L. paucifasciatus Rendahl,
1943, occurring in Vietnam, L. synaptor sp. n. differs by
the number of anterior dorsal scale rows (15-17 in L.
synaptor sp. n. and 19 in L. paucifasciatus).
©ZFMK
294
Gernot Vogel & Patrick David
Table 2. Important characters in the Lycodon fasciatus / ruhstrati groups.
Lycodon fasciatus synaptor sp.n. ruhstrati futsingensis cardamomensis
n females 35 2 23 6 l
TL, females N=29 N=2 N=22 N=5 N=1
679 487 876 WB 545
Rel TL, females 0.190-0.219 0.189-0.192 0.207—0237 0.205—0.217 0.25
N=29 N=2 N=22 N=11 N=1
VEN, females 180-219 201-203 217-229 198-208 223
N=35 N=2 N=23 N=13 N=1
SC, females (67) 70-88 68-69 90-108 78-85 92
N=29 N=2 N=21 N=5 N=1
IL both sexes 9-10 (8)* 8 10 (9.11) 9-10 (11) 10
N=120 N=2 N=86 N=44 N=4
Bands 19-43 30-31 19-46 19-33 12-13
N=60 N=2 N=45 N=22 N=4
Tail bands 7-21 9 10-23 9-18 6
N=62 N=2 N=43 N=21 N=4
First band 5-18 5-9 8-17 13-23 unknown
N=51 N=2 N=34 N=18
Broad base 3-12 3 5-9 (12) 5-8.5 unknown
N=51 N=2 N=34 N=18
Lo enters orbit Yes (rarely not**) No No (rarely yes***) — No No
N=126 N=4 N=86 N=44 N=4
Belly banded Yes Yes No No No
N=63 N=2 N=25° N=22 N=
“8 in 6 cases (5 %), in one specimen from Shillong on both sides (1.6 %)
“not entering in 8 occurrences (6.3 %), three times on both sides (4.7 %) (see above)
“in 6 specimens, all from Fujian the Lo touched the eye.
FORK
banded in juveniles only
Werner (1922) described Dinodon yunnanensis from Yun-
nanfu, now Kunming, Yunnan Province. This species was
synonymised with Lycodon fasciatus by Pope (1935: 188),
but according to our unpublished data, this taxon might
be valid. In any way this name is available, so we com-
pared Lycodon synaptor sp. n. with Dinodon yunnanen-
sis Werner, 1922 for which we re-examined the holotype
(NMW 23417; adult female). Lycodon synaptor sp. n. dif-
Bonn zoological Bulletin 57 (2): 289-296
fers from D. yunnanensis mainly by the loreal which is
touching the eye in D. yunnanensis, but also by the num-
ber of ventrals (201—203 against 193) and the number of
bands on the body (30-31 vs. 23) and the number of in-
fralabials (eight vs. nine in D. yunnanensis).
While preparing a review for the Lycodon fasciatus group,
we found quite a lot of obviously independent lineages,
©ZFMK
New Lycodon from Yunnan 295
which seem to constitute distinct species. Some of them
are restricted to small areas. A discussion of these lineag-
es will follow in the main review (Vogel & David in prep.).
Lycodon synaptor sp. n. differs so much from other mem-
bers of the group that we decided to describe it separate-
ly. The closest localities we got from Lycodon fasciatus
are from the vicinity of Kunming in Yunnan province,
which lies about 100 km south of Dongchuan. This latter
place (previously Tongchuan or Tongchuan Fu) is the type
locality for several reptile species, as Cuora yunnanensis
(Boulenger 1906), Nanorana yunnanensis (Anderson,
1879), Odorrana grahami (Boulenger 1917) and Bombi-
na maxima (Boulenger 1905). It is a relatively small city
that had about 300.000 inhabitants in 2006.
Revised Key for the genus Lycodon in China
According to our data, there are several unnamed species
of the genus Lycodon living in China. So this should be
regarded as preliminary key.
1. Both a loreal and a preocular scales present ................006+ 2
Either loreal or preocular absent ................0... L. subcinctus
Jao ANTE CRAIGS cocosligenascase08s ants arose sc cICGICE ae TE Coer aE EERE 3
ANTE SITIES. scoedectngseaaboReSERE DEES E ae PREEEL EERE SEER 4
3. Anterior chinshields not more than 1.5 times longer than
posterior ones; loreal in extensive contact with internasal,
when adult no crossbands on body ................- L. capucinus
Anterior chinshields 2 to 3 times longer than posterior ones;
loreal not, or barely in contact with internasal (very rarely a
strong contact), when adult yellow crossbands on forepart
Olt OOGH?. accoonsidoscosteonee noseee Lecce eee MEER cae L. laoensis
G\, TRIG? TORIC IEC scconcsasaccsbaccesco sco udentaaqsosacencecacode oguceciasscnosaere sae 5
IBIS Gt lO eTOVET EC | sce condnscecschoseoodacoae cers aondonoossspacbooosoriaaaeocHnesE 6
5. Lo not touching the eye, 8 lower labials .. L. synaptor sp. n.
Lo usually touching the eye, usually 9-10 lower labials
20000600000600¢00 00 00H IEE DEE ECE: CEE CEE CUR ee ESCs L. fasciatus
GaDorsallmows| keeled «.......2:2--s-ccs-ceeecneso-00e L. ruhstrati abditus
Dorsalirows'SMOOth 2.2. ...c-c.cceccsecsencsestereswees L. futsingensis
Bonn zoological Bulletin 57 (2): 289-296
Acknowledgements. The first author is indebted to Annemarie
Ohler and Alain Dubois (MNHN) for the grants to work in the
Paris collection. We are grateful to Silke Schweiger, NMW for
sending pictures of the type of Dinodon yunnanensis. Ke Jiang
and Jian Luo helped a lot with further information on Chinese
Lycodon. Montri Sumontha provided scalecounts. We also thank
Colin J. McCarthy (BMNH), Varad Giri (BNHS), Robert C.
Drewes and Jens V. Vidum (CAS), Wang Yuezhao, Zeng Xiao-
mao and Ermi Zhao (CIB), Alan Resetar (FMNH), Dingqui Rao
(KIZ), Ivan Ineich and Annemarie Ohler (MNHN), Franz Tiede-
mann and Richard Gemel (NMW), Wolfgang B6hme (ZFMK),
Mark-Oliver Rédel and Frank Tillack (ZMB), Frank Glaw and
Dieter Fuchs (ZSM) for the possibility to examine specimens de-
posited in the collection of their respective institutions. Dick Vis-
sers made the drawings for us. Many thanks for that.
REFERENCES
Daltry JC & Wiister W (2002) A new species of Wolf Snake (Ser-
pentes: Colubridae: Lycodon) from the Cardamon Mountains,
southwestern Cambodia. Herpetologica 58: 498-504
Dowling HG (1951) A proposed standard system of counting
ventrals in snakes. British Journal of Herpetology 1: 97-99
Gaulke M (2002) A new species of Lycodon from Panay Island,
Philippines (Reptilia, Serpentes, Colubridae). Spixiana 25:
85-92
Lanza B (1999) A new species of Lycodon from the Philippines,
with a key to the genus (Reptilia Serpentes Colubridae). Trop-
ical Zoology 12: 89-104
Mukherjee D & Bhupathy S (2007) A new species of Wolf Snake
(Serpentes: Colubridae: Lycodon) from Anaikatti Hills, West-
ern Ghats, Tamil Nadu, India. Russian Journal of Herpetol-
ogy 14: 21-26
Ota H & Ross CA (1994) Four new species of Lycodon (Ser-
pentes: Colubridae) from the Northern Philippines. Copeia
1994: 159-174
Pope CH (1935) The reptiles of China. Turtles, crocodilians,
snakes, lizards. Natural History of central Asia, X. American
Museum of Natural History, New York
Slowinski JB, Pawar SS, Win H, Thin T, Gyi SW, Oo SL, Hla
T (2001) A new Lycodon (Serpentes: Colubridae) from north-
east India and Myanmar (Burma). Proceedings of the Califor-
nia Academy of Sciences 52: 397-405
Vogel G, David P, Pauwels OSG, Sumontha M, Norval G, Hen-
drix R, Thanh VN, Ziegler T (2009) A revision of Lycodon
ruhstrati (Fischer, 1886) auctorum (Squamata: Colubridae),
with the description of a new species from Thailand and a new
subspecies from the Asian mainland. Tropical Zoology 22:
131-182
Werner F (1922) Neue Reptilien aus Stid-China, gesammelt von
Dr. H. Handel-Mazzetti. Anzeiger der Akademie der Wis-
senschaften in Wien 59: 220-222
Received: 24. VIII.2010
Accepted: 10.X.2010
OZFMK
296 Gernot Vogel & Patrick David
APPENDIX I
Additional comparative material of Lycodon fasciatus
India. Shillong, Assam, BMNH 92.1.25.1; BMNH
1908.6.23.6; BMNH 1908.6.23.8; BMNH
1907.12.16.28-29; BMNH 94.10.4.2; BNHS 1219-20,
1229.
Laos. Xieng-Khouang, Laos, MNHN 1928.69.
Myanmar. Maymyo, Burma, BMNH 1925.12.22.15—16;
Mogok, Burma, BMNH_ 1900.9.20.5—7; BMNH
1901.4.26.1Mogkok, Burma, BNHS 1221 “Burma”,
BMNH 1908.6.23.9-11 ; Burma, BNHS 1218; Toungyi,
Shan State, Myanmar, BMNH 91.11.26.31; Bhamo, Bur-
ma, BMNH 1925.4.2.28; Kachin Hills, Burma, BMNH
1925.9.17.10—11; South Shan State, BMNH 1908.6.23.14;
Burma-Siam Border, BMNH 1937.2.1.12; Rangoon, Bur-
ma, BMNH_ 1940.3.3.3; Maymyo, Burma, BNHS
1222-24; Thandung Hills, BNHS 1228.
Bonn zoological Bulletin 57 (2): 289-296
People’s Republic of China. Western China CAS 55147;
Yunnan, MNHN 1919.148; “Yunnan Fu” (holotype of
Dinodon yunnanensis), NMW 23417; Kuantun, ZSM
75/1938; Kunming, Yunnan, BMNH 1930.11.16.4; Ruili
City, Yunnan, CIB 9804; RuiLi, Yunnan,, CIB 9805;
XiShuangBanNa, Yunnan, CIB 9806, CIB 9808, CIB
9809; LongChuan GongWa, Yunnan, KIZ 74 I 0035;
LongChuan HuSa, Yunnan, KIZ 74 I 0145; Tengchong
County, Yunnan KIZ 74 II 0262; Menglian, Yunnan, KIZ
75 1473; TengChong TuanTian, Yunnan, KIZ 74 I 0263;
Kunming, Yunnan, KIZ 73009; Kunming, Yunnan, KIZ
77004; Kunming city, Yunnan, KIZ 83007; Yunnan, KIZ
83017; FMNH 15148; Tibet; MNHN 1921.0465 Tibet;
Yunnan,; ZMB 65453
Thailand. Chiang Mai, Thailand, FMNH 178369; CAS
172715, Southern Thailand ? FMNH 178368, Nan
province Thailand FMNH 270716.
Vietnam. Phong Nha, Vietnam, ZFMK 86448—S0 (Gen-
Bank: EU999214-215); ZFMK 80665; Ziegler unreg.
©ZFMK
Bonn zoological Bulletin | Volume 57 Issue 2
pp. 297-306 Bonn, November 2010
A crowned devil: new species of Cerastes Laurenti, 1768
(Ophidia, Viperidae) from Tunisia,
with two nomenclatural comments
Philipp Wagner!* & Thomas M. Wilms?
' Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, 53113 Bonn, Germany;
[email protected]
? Zoologischer Garten Frankfurt, Bernhard-Grizmek-Allee 1, 60316 Frankfurt a. Main, Germany;
* corresponding author
Abstract. A distinctive new species of the viperid genus Cerastes is described form Tunisia. It is closely related to Cerastes
vipera but easily distinguishable from this invariably hornless species by having tufts of erected supraocular scales form-
ing little crowns above the eyes. These crown-like tufts consist of several vertically erect, blunt scales which differ dras-
tically from the supraocular horns of C. cerastes or C. gasperettii that consist of one long, pointed scale only. Although
the new species is based on only one single specimen, further specimens had originally been available but were subse-
quently lost in private terraria.
The taxonomic status of the nomen ‘“Cerastes cerastes karlhartli” is discussed and the name is found to be unavailable
(nomen nudum). Also the authorship of “Cerastes cornutus” is discussed and ascribed to Boulenger.
Key words. Cerastes cerastes, Cerastes vipera, Cerastes sp. n., Cerastes c. karlhartli, Cerastes cornutus, horned viper,
North Africa, Tunisia.
INTRODUCTION
The genus Cerastes Laurenti, 1768 includes only five taxa
(three species and two subspecies), which are distributed
in northern Africa and on the Arabian Peninsula. All
species are stout-bodied and, as desert snakes, are char-
acterized by many xeromorphic physiological and mor-
phological adaptations. The most impressive adaptations
are the strongly keeled serrated lateral body scales, a char-
acter they share with their proposed sister taxon Echis
(Joger & Courage 1999, Pook et al. 2009), but not with
the also sand living snakes of the genus Bitis.
The largest member of the genus is Cerastes cerastes (Lin-
naeus, 1758) with a maximum body size of 80 cm and an
average size of 35 to 60 cm. The distribution range of the
nominotypic form includes all Saharan countries with a
southernmost distribution in Sudan (Phelps 2010) and the
northernmost in central Tunisia (Schleich et al. 1996).
Eastwards it reaches the Sinai, Israel and Jordan (Phelps
2010). Cerastes c. cerastes occurs in sandy and rocky
deserts and around well vegetated oases but not in wind-
blown dunes (Phelps 2010). Cerastes c. hoofienii Wern-
er & Sivan 1999, the second subspecies occurs in the ex-
treme southwestern edge of the Arabian Peninsula in
Yemen and Saudi Arabia.
Bonn zoological Bulletin 57 (2): 297-306
The second North African species is C. vipera (Linnaeus,
1758). Its distribution range is very similar to C. cerastes
but more restricted to the Saharan Desert and reaches east-
ward to the Sinai and Israel as it only occurs in dune sys-
tems. Therefore, according to Phelps (2010) both species
were never recognized as locally syntopic, but Joger
(2003) found both species occurring parapatrically at the
edge of the Grand Erg Oriental in Tunisia. Cerastes vipera
is the smallest viper of the genus and grows up to a max-
imum size of under 50 cm with an average about 35 cm.
The remaining species is Cerastes gasperettii Leviton &
Anderson, 1967 with its subspecies gasperettii and C. g.
mendelssohni Werner & Sivan, 1999. It is distributed on
the Arabian Peninsula and eastwards to Iraq and Iran, over-
lapping with other Cerastes species in its distribution on-
ly in the southern Sinai and the northwestern edge of the
Arabian Peninsula.
The common name ‘Horned Vipers’ is misleading as not
all species and not all populations possess supraocular
horns. In C. cerastes and C. g. gasperettii specimens usu-
ally bear horns but several populations are hornless. If
present, the horns are formed by a long, sulcated, single
©ZFMK
298 Philipp Wagner & Thomas M. Wilms
spike above each eye, usually surrounded by a ring of
elongate spinose but non-sulcated scales. This polymor-
phism is also known in other viperid snakes as the
supraocular horns of Bitis caudalis and the supranasal
horns of Bitis gabonica are absent in some specimens
(FitzSimons 1962, Branch 1988). However, C. g.
mendelssohni and C. vipera are strictly hornless as op-
posed to the other taxa.
Gasperetti (1988) described the characters of the genus
Cerastes as (a) the eyes are small to moderate and sepa-
rated from the labial scales by several rows of small scales;
(b) body scales with club or anchor shaped keels, not ex-
tending to the extremity of the scales; (c) lateral body
scales smaller than vertebral scales; (d) anal scale entire;
and (e) ventral scales with an obtuse keel on each side.
For many decades, only two species, C. cerastes and C.
vipera, were recognized but Werner (1987) and Werner
et al. (1991) elevated C. gasperettii to full species status,
which was later accepted by many authors (e.g. Schatti
& Gasperetti 1994, Phelps 2010).
Following Baha el Din (2006) the two African species are
easy to distinguish. In C. vipera, supraocular horns are
never present, there are less than 14 interorbitals and
counts of ventral scales are below 120, whereas in C.
cerastes there are more than 14 interorbitals and more than
130 ventrals. Schleich et al. (1996) distinguished the two
snakes mainly by the position of the eye (lateral in cerastes
and directed upwards in vipera), by the presence or ab-
sence of a supraocular horn and by the number of interor-
bital scales (15—21 in cerastes and 9-13 in vipera). Ge-
niez et al. (2004) distinguished both species by their lon-
gitudinal rows of dorsal scales at midbody (27-35 in
cerastes; 23—27 in vipera), but also mentioned the eyes
on the top of the head in C. vipera.
In the collection of the Zoologisches Forschungsmuseum
Alexander Koenig (ZFMK) a specimen of Cerastes is
present, which is generally similar to C. vipera but clear-
ly distinct in possessing supraocular crown-like scale tufts
instead of horns of a solitary scale. Because of this strik-
ing character, as such tufts or horns are absent in C. vipera,
the specimen was examined and compared with other
Cerastes specimens of the ZFMK collection and with rel-
evant literature.
MATERIAL & METHODS
This description is based on the comparison of 75 pre-
served Cerastes specimens and three vouchers of other
snakes of the ZFMK collection (see below) and the rele-
vant literature (Jooris & Fourmy 1996; Schleich et al.
1996; Geniez et al. 2004; Baha el Din 2006; Phelps 2010).
Bonn zoological Bulletin 57 (2): 297-306
Measurements were taken with a digital-calliper to the
nearest 0.1 mm. The number of ventral scales was count-
ed excluding the anal scale. The number of subcaudals in-
cluded the terminal scale. The dorsal scale row count is
given as (a) fore body: one head length behind head, (b)
midbody at the level of the ventral plate corresponding to
a half of the total number of ventrals), and (c) hind body
one head length before vent.
For SEM images a Hitachi S-2460N was used to compare
the scale morphology of different snake species. Dorsal
body scales from about the middle of the dorsum were
used from the following specimens: Cerastes sp. n.
(ZFMK 58054, Tunisia), Bitis peringueyi (Boulenger,
1888) (ZFMK 44887: Namibia, Swakopmund) and Bitis
schneideri (Boettger, 1886) (ZFMK 88450: Namibia,
without locality). These were compared with SEM-pho-
tographs from C. cerastes and C. vipera published by
Joger & Courage (1999).
Material examined. Cerastes cerastes: ALGERIA: ZFMK
7649-7650, Colomb-Béchar; ZFMK 18082, 60km west of Toug-
gourt; ZFMK_ 18083-084, 20km north of Bou-Saada; ZFMK
18085, Hoggar Mts., Guelta Afiale; ZFMK 23000, south of
Temassinin, Flatters; ZFMK 23001, Bordj-Saada; ZFMK
23002-005, south of Ouargla; ZFMK 38248, 20km south of
Djanet. EGyet: ZFMK 22996, Isna (=Esne); ZFMK 22997,
vicinities of Cairo; ZFMK 50295, Aswan desert; ZFMK 50296,
Faijum desert; ZFMK 50299-300, Nada el Wahda desert; ZFMK
32488, 50297-298, without locality. LiByA: ZFMK 63668, Wa-
di Matendus; Mauretania: ZFMK 17593, Chami. Morocco:
ZFMK 65218, Draa Valley. NIGER: ZFMK 20258, between Ar-
lit and Agadez, 120km south of Arlit; ZFMK 36629, 40km north-
east of Wadi Gougaram. SUDAN: ZFMK 32462, 100km south-
west of Burget Tuyur depression; ZFMK 32463, Dafur, Teiga
Mts., west of Eisa; ZFMK 32464, Darfur, Djebel Rahib; ZFMK
33697, Nubian desert, 130km southeast of Wadi Halfa; ZFMK
33698-700, Wadi Halfa; ZFMK 38410, 80km north of Port Su-
dan. TunistA: ZFMK 18081, 10km west of Tozeur, Oasis Stil;
ZFMK 22998-999, Tunisian desert; ZFMK 29047, El Hamma
du Djerid near Tozeur; ZFMK 29809-812, 29046, Tozeur; ZFMK
47020-024, between Tozeur and Nefta; ZFMK 49858, Oasis Nef-
ta. Cerastes gasperettii: IRAQ: ZFMK 18843-844, vicinities of
Basrah; ZFMK 19414, Basrah. KINGDOM OF JORDAN: ZFMK
44340, Wadi Araba, Fidan. KINGDOM OF SAUDI ARABIA: ZFMK
43659, 100km northeast of Riyadh. UNITED ARAB EMIRATES:
ZFMK 52419, Al-Mundam. Cerastes vipera: ALGERIA: ZFMK
22984, El Alia; ZFMK 41176, Ain Sefra. EGypt: ZFMK 22989-
994, 50339, vicinities of Cairo; ZFMK 22995, Sinai, Wadi Ar-
ish; ZFMK 50301-302, El Wasta, Abwid desert. LipyA: ZFMK
32489, Tripolis. MAURETANIA: ZFMK 17594, Chami. TUNISIA:
ZFMK 22985-988, Tunesian Sahara, without locality. WESTERN
SAHARA: ZFMK_ 83340, Laayoune Plage; Bitis caudalis:
NAMIBIA: ZFMK 65212, Swakopmund; Bitis peringueyi:
NAMIBIA: ZFMK 88453, without locality. Bitis schneideri:
NAMIBIA: ZFMK 88450, without locality.
©ZFMK
A new species of Cerastes from Tunisia
F500 um—4
Ghee NA WT
1mm | PERING,
+ 200 pm 4
Fig. 1. _ SEM images of dorsal body scales of viperid snakes.
1= Cerastes sp. n. from central Tunisia (ZFMK 58054); 2= Cerastes cerastes published by Joger & Courage 1999; 3= Cerastes
vipera published by Joger & Courage 1999; 4= Bitis peringueyi, 4A published by Joger & Courage 1999, 4B & 4C from Namib-
ia (ZFMK 44887), and 4A= published by Joger & Courage 1999; 5= Bitis schneideri from Namibia (ZFMK 88450).
A= dorsal scale, complete; 1B= dorsal scale, verrucate, secondary structure; 2B= dorsal scale, verrucate, secondary structure; 3B=
dorsal scale, liniar, tertiary structure; 4B= dorsal scale, verrucate to cristate, secondary structure; 5B= dorsal scale, cristate, sec-
ondary structure; 1C= dorsal scale, secondary structure in detail; 2C= dorsal scale, secondary structure in detail; 3C= dorsal scale,
secondary structure in detail; 4C= dorsal scale, secondary structure in detail; 5C= dorsal scale, secondary structure in detail.
Bonn zoological Bulletin 57 (2): 297-306 ©ZFMK
300 Philipp Wagner & Thomas M. Wilms
RESULTS & DESCRIPTION
The comparison of the fine structure of a dorsal, non-rat-
tling scale of the single specimen with images of lateral,
rattling scales of Cerastes and lateral scales of Bitis (see
fig. 1) shows similarities between the single specimen and
Cerastes. On the other hand, differences of the typical
scale fine structure of Bitis are distinct enough to recog-
nize the single specimen as a non-Bitis species. The struc-
ture typical in Bitis specimens is obvious in Bitis schnei-
deri (fig. 1.5). They possess a structure of slender, elon-
gated bulges, which are very distinct from Cerastes. How-
ever, Bitis peringueyi, (fig. 1.4) also a sand burrowing
snake, is the only species of Bitis showing a similar scale
structure to Cerastes species, but obvious from figure 2,
this species is very distinct from the new species of
Cerastes.
However, all Cerastes species are similar in their verru-
cate secondary structure; cell borders are well visible.
These borders are invisible in the cristate or verrucate sec-
ondary structure of Bitis species.
The comparison of the voucher with C. vipera and C.
cerastes results ina morphological similarity to C. vipera.
Both are similar in body size, shape of the nostril and head
scalation (see fig. 2, tab. 1). However, in other aspects they
are clearly distinct: the specimen has lower scale counts
as in C. vipera in its morphological variation of the en-
tire distribution in northern Africa. The specimen possess-
es supraocular horns, which are absent in C. vipera and
horns, encompassing several scales, are also not known
in C. cerastes. Therefore, we regard this specimen as a
new species of Cerastes:
Cerastes boehmei sp. n.
Holotype. ZFMK 58054. Female specimen from Tunisia,
SW Remada, east of Djebel National Park, close to the
road midway between Beni Kadeche (Bani Kheddache)
and Ksar el Hallouf, leg. T. Holtmann, 1991.
Diagnosis. This new species of Cerastes 1s characterized
by: (a) head depressed, eyes on the lateral part of the head
but slightly directed upwards; (b) supraocular coronets
(crowns) present, consist of several sulcated, medium
sized scales, instead of the supraocular horn formed by a
single sulcated long scale in C. cerastes or C. gasperettii;
(c) nostril slit-shaped; (d) low number of interorbital
scales; (e) 19-26-16 dorsal scale rows around fore-, mid-
and hind body.
Differential diagnosis. The new species differs from (a)
C. vipera in possessing supraocular coronets, a low num-
Bonn zoological Bulletin 57 (2): 297-306
ber of interocular scales (7 instead of 9-13 fide Schleich
et al. [1996], but 6—13 fide Jooris & Fourmy [1996]), a
lower number of circumocular scales (11 instead of 19-29
fide Jooris & Fourmy (1996), a lower number of supral-
abial/infralabial scales (11—12/12-11 instead of
20-33/19-27 fide Jooris & Fourmy [1996]) and a lower
number of subcaudal scales (25 instead of 33—57 fide
Jooris & Fourmy [1996]). Counts of dorsal scale rows
around midbody are ambiguous and depending on the
method of counting (see fig. 3). They differ from C. vipera
(21 instead of 23—27 fide Phelps [2010]) or lie with 26
scale rows within this range; from (b) C. cerastes in a low-
er number of interocular scales (7 instead of 15—21, fide
Schleich et al. [1996]), in its smaller size, in possessing
a slit-shaped nostril, in possessing supraocular coronets
each formed by more than one elongated scale; and final-
ly from (c) C. gasperettii in possessing supraocular coro-
nets each formed by more than one elongate scale and in
possessing a slit-shaped nostril.
From all recognized synonyms of C. vipera (mainly C.
vipera inornatus Werner, 1929 and C. richiei Gray, 1842)
the new species differs in possessing supraocular coronets,
whereas the synonymised taxa are lacking horns or equiv-
alent structures.
From the recognized synonyms of C. cerastes (mainly C.
c. mutila Doumergue, 1901) the new species differs in
possessing supraocular coronets, as all synonymised taxa
are lacking horns or equal structures. Following Boulenger
(1896) Cerastes cornutus Boulenger, 1896 (see also
nomenclatural comment as part of the discussion), regard-
ed as a synonym of C. cerastes following e.g. Schleich et
al. 1996, is also with either horn-bearing or hornless in-
dividuals, but differs from C. boehmei sp. n. in a higher
number of interorbital scales (15 to 21), in possessing
supraocular horns made up of a single scale, a higher num-
ber of scale rows around midbody (27-35) and a higher
number of ventral (130-165) scales.
Description of holotype (fig. 4). Habitus. Body elongate
and slender, somewhat compressed and oval in profile;
head flattened, triangular and well distinct from neck; Eye
small to moderate, with vertically elliptical pupil, on up-
per lateral side, but nearly on top of head; nostril slit-
shaped, slightly longer than first supralabial scale.
Measurements (in mm): Total length: 218.5; head length:
16; head width: 9.4; head height: 5.5; snout-vent length:
195; tail length: 25.5.
Scalation of head: Rostral broader than high, semicircu-
lar, slightly visible from above; menthal scale only in con-
tact and smaller than first infralabial scale, followed by
two large chinshields; nasal scale divided by large scale
©ZFMK
A new species of Cerastes from Tunisia 301
Fig. 2. | Comparison of different viperid snakes from Africa.
1= Cerastes boehmei sp. n.: ZFMK 58054, Tunisia; 2= Cerastes vipera: ZFMK 22985, Tunisia, without locality; 3= Cerastes vipera:
ZFMK 83340, Western Sahara, Laayoune Plage; 4= Cerastes cerastes: ZFMK 63668: Libya, Wadi Matendus; 5= Cerastes cerastes:
ZFMK 65218, Morocco, Draa Valley; 6= Bitis caudalis: ZFMK 65212: Namibia, Swakopmund; 7= Bitis peringueyvi: ZFMK 88453:
Namibia, without locality. A= head in profile; B= head from above; C= head from below.
Bonn zoological Bulletin 57 (2): 297-306 ©ZFMK
302 Philipp Wagner & Thomas M. Wilms
Table 1. Comparison of the three Cerastes species occurring in northern Africa.
C. boehmei sp. n.
C. vipera* C. cerastes**
Interorbital scales Vl
Ventral scales 110
Subcaudal scales 2S
Position of the eye lateral
Supraocular horn present
Scale rows around midbody 21 (26)***
Circumocular scales 11
less than 14 (6-13) more than 14 (14-21)
below 120 more than 130
33-57 18-42
directed upwards lateral
absent present/absent
23-37 27-35
19-29 -
*=fide Jooris & Fourmy 1996, Schleich et al. 1996, Baha el Din 2006, Phelps 2010. **= fide Schleich et al. 1996, Baha el
Din 2006, Phelps 2010. ***= see fig. 3
bearing nostril at its upper fringe, with smaller overlay-
ing scale; five, more or less trapezoidal internasal scales,
the two outer scales twice as large as three inner scales,
all keeled; no enlarged prefrontal scales; occipital tuber-
cle absent; supraocular coronets present, consist of elon-
gate, sulcate scales, four on left, five on right side; 11 cir-
cumocular scales on each side; interorbital scales 7 at mi-
dlevel of supraocular coronets; loreals 3 on each side;
supralabial scales: 11 on left, 12 on right side, only first
in contact with nasal scale, three scales between supral-
abial scales and eye (including ocular scale); infralabial
scales: 12 on left, 11 on right side.
Scalation of body: Ventral scales: 110; subcaudal scales:
25; number of scale rows around fore-body: 19, mid-body:
21 or 26 (see fig. 3), hind-body: 16; vertebral row not en-
larged, in 107 scales on body.
Colouration in preservative. After 20 years of preserva-
tion in ethanol, the specimen has more or less uniform
sandy colouration. Head uniform, upper side down to
height of supralabial scales sandy, underside up to height
of infralabial scales dirty white; body sand-coloured, with
irregular pattern of slightly darker blotches; upper fore part
of tail banded dark sand-coloured, underside dirty white,
from mid-tail to tip uniform dark, nearly black on both
sides; belly dirty white.
Colouration in life. Similar to preserved specimen: uni-
form yellowish sand-coloured with shades of some
slightly darker blotches. Head and forepart of body uni-
form yellowish-sandy, without darker pattern (see fig. 5).
Etymology. This new species is named, in deep respect,
after our ‘scientific father’ Prof. Dr Wolfgang Bohme,
deputy director and head of the Herpetology section at the
Zoologisches Forschungsmuseum Alexander Koenig in
Bonn, for his contributions to African herpetology for the
Bonn zoological Bulletin 57 (2): 297-306
past four decades and for the time he invested in his young
students. With his encouraging lectures, discussions, ex-
cursions and fieldtrips he had a significant influence on
the authors leading to their scientific current dedication
with herpetological systematics, ecology and zoogeogra-
phy.
Distribution. So far only known from the type locality,
but an adult male was caught by a local snake hunter near
Beni Kadeche (T. Holtmann pers. comm.). The new
species appears currently to be endemic to Tunisia and is
probably widespread in the area of Bani Kheddache.
Biology. Nearly no information is available on the biol-
ogy of this species. In captivity the adult female gave birth
to living young which reflects the close relationship to C.
vipera. In respect to colouration, a sandy habitat can be
assumed.
Comments. Although the species is described here based
on a single voucher, more specimens were known but be-
came apparently lost. This specimen was one of three ju-
veniles caught together with an adult female at the type
locality. The adult female had five juveniles in captivity.
Additionally, an adult male was caught in the area of the
type locality by a local hunter. All of these specimens have
shown the described character of the unique supraocular
horns.
DISCUSSION
Though described from a single specimen only, the valid-
ity of C. boehmei sp. n. is beyond doubt. As becomes ob-
vious from the comparison of fine structure of body scales,
the new species must be clearly assigned to the genus
Cerastes, being distinct from burrowing Bitis species from
southern Africa. However, the fine structure is similar to
©ZFMK
A new species of Cerastes from Tunisia 303
Fig. 3.
both, C. cerastes and C. vipera but many other characters
(e.g. shape of nostril, position of the eye, pholidosis, re-
productive biology) show that the new species is more
closely related to C. vipera than to C. cerastes. Accept-
ing the results of the morphological analysis of C. vipera
published by Jooris & Fourmy (1996) the new species has
lower counts in circumocular, subcaudal, supralabial, in-
fralabial scales and of ventral and interocular scales are
on the lower limit of morphological variation in C. vipera.
Therefore, C. boehmei sp. n. is clearly distinct from C.
vipera also in pholidosis. Nevertheless, in C. cerastes both
hornless and horned individuals are known but (a) the
morphology of the “crowns” of C. boehmei sp. n. is clear-
ly distinct to all other known horn structures in Cerastes
and (b) the fact that supraocular horns or similar structures
are completely unknown in C. vipera strengthens the va-
lidity of the new taxon as new and full species. Also Jooris
& Fourmy (1996) who analysed 246 specimens compar-
ing pholidosis in relation to a directed distribution did not
mention any individuals with horn-like structures. Also
none of the known synonyms of C. vipera possesses horns
or similar structures. Nevertheless, supraocular horns as
spontaneously mutation are extremely implausible. Only
one case is documented where a specimen of Macrovipera
lebetina possessed a solitary horn only on one side of the
head (Bohme & Wied! 1994).
Nevertheless, in C. cerastes and C. gasperettii hornless
and horn-bearing individuals are known and a taxonom-
ic differentiation is only known from C. gasperettii where
the subspecies mendelsohni is hornless. Therefore, it can
be also assumed that the supraocular scale tufts are sim-
ply a so far unknown variation within of C. vipera. But
first of all, C. vipera is a well known species and e.g.
Jooris & Fourmy (1996) have analysed a high number of
vouchers and no single specimen is known which possess
Bonn zoological Bulletin 57 (2): 297-306
Two different methods to count scale rows of dorsal scales around the midbody region of the holotype of Cerastes boehmei
sp. n., ZFMK 58054.
supraocular tufts and second these supraocular tufts are
strongly abnormal and very distinct to the supraocular
horns of cerastes and gasperettii who possess similar
supraocular horns to each other.
The function of supraocular horns remains unknown.
There were many speculations on the function of the horns
in Crotalus cerastes Hallowell, 1854 from America.
Klauber (1956) mentioned that they serve as radiators of
heat or shaders for the eyes, whereas Cowles (1953) re-
garded them simply as a whim of evolution and Cohen &
Myres (1970) suggest that they have the function of an
eyelid protecting the snake’s eye while passing through
burrows. They supported this hypothesis with an ecolog-
ical comparison between C. cerastes and C. vipera: the
former 1s only known to bury itself partially and frequent
rodent burrows whereas C. vipera is only known to bury
itself fully in sand and is not reported from rodent bur-
rows. However, another, not yet discussed, function could
be a sexual recognition between the two snakes. In many
reptile groups (e.g. Chamaeleonidae, Agamidae) body or-
naments are known for identification during mating time.
Although only males possess in most cases ornaments, it
should be verified if only those population of C. cerastes
(as this species does not strictly possess horns) bear horns,
which occur directly syntopically with the hornless C.
vipera.
Currently the new species is only known from central
Tunisia and a restricted distribution can be assumed. A
similar case is found in Pseudocerastes urarachnoides
Bostanchi, Anderson, Kami & Papenfuss, 2006 which was
described from a small area and a further study (Fathinia
et al. 2009) found a third locality relatively close the lo-
calities of the types only.
©ZFMK
304 Philipp Wagner & Thomas M. Wilms
Fig. 4. Holotype of Cerastes boehmei sp. n.: ZFMK 58054 from SW Remada, Tunisia.
Bonn zoological Bulletin 57 (2): 297-306 ©ZFMK
A new species of Cerastes from Tunisia 305
Fig. 5.
The SEM analyses of dorsal scales show that Bitis
peringueyi is different to other Bitis species in its second-
ary structure (Beyerlein 1993, and fig. 1). This structure
is more or less a verrucate structure and not comparable
with the cristate structure of e.g. Bitis schneideri, but sim-
ilar to the Cerastes species. However, it is distinct to
Cerastes as the imprints of borders between Clear layer
cells, which are present in Cerastes, are not visible. Both,
the Cerastes species and B. peringueyi are moreover sim-
ilar in their habitats as B. peringueyi 1s one of the sand-
burrowing Bitis species living in windblown sands of the
Namib desert. Other burrowing Bitis like e.g. B. schnei-
deri (see fig. 1) or B. caudalis (imaged in an unpublished
thesis, see Beyerlein 1993) show the typical cristate sec-
ondary structur of Bitis. B. schneideri occurs in stable veg-
etated sand dunes and not like B. peringueyi and Cerastes
in windblown sands. Therefore, this scale structure could
be interpreted as an adaptation for this special habitat of
windblown sands.
Nomenclatural comment to the nomen ‘Cerastes c.
karlhartli’. Sochurek (1974) ‘described’ a subspecies of
C. cerastes which he called *C. cerastes karlhartli’. How-
ever, the description was done in his privately published
so-called ‘Herpetologische Blatter’, which according to
art. 8.1 of the International Code of zoological Nomen-
clature (ICZN 1999) does not constitute a publication and
therefore the description is not valid. Later, Sochurek
(1979) used the name again in a summary of North African
snakes but failed to provide a diagnosis, description or fig-
Bonn zoological Bulletin 57 (2): 297-306
Living holotype of Cerastes boehmei sp. n. in captivity.
ure and moreover did not designate a holotype. He only
mentioned the distribution and a type locality. Later, Tiede-
mann & Haupl (1980) accepted the name as a valid sub-
species in their herpetological type catalogue of the Nat-
ural History Museum in Vienna. Werner & Sivan (1992)
placed the ‘subspecies’ in the synonymy of C. cerastes,
whereas Golay et al. (1993) placed it in the synonymy of
C. gasperettii. Werner et al. (1999) did not mention the
name, whereas McDiarmid et al. (1999) and Baha el Din
(2006) followed Werner & Sivan (1992). However, all
these authors gave neither a diagnosis nor a figure of a
specimen. Therefore the name ‘Cerastes cerastes karl-
hartli must be recognized as a nomen nudum.
Nomenclatural comment to the nomen Cerastes cornu-
tus Boulenger, 1896. The name is used for the first time
in Forskal (1775, IX), and he is often mentioned as the
author of this taxon name (e.g. Schleich et al. 1996, Ba-
ha el Din 2006). But Petrus Forskal died during the Dan-
ish Arabia expedition, and Carsten Niebuhr published
Forskal’s results after his death. Nevertheless, the name
is part of a summary about different species which Forskal
wanted to describe, but finally never managed to do be-
fore his untimely death. Additionally, this nomen is not
accompanied by either a description or a drawing. There-
fore, Boulenger (1896) who was the first to use the name
together with a description must be recognised as the au-
thor of Cerastes cornutus, despite the fact that Boulenger
himself mentions Forskal as the author of this species.
©ZFMK
306 Philipp Wagner & Thomas M. Wilms
Acknowledgements. We are grateful to Thorsten Holtmann
(Oberhausen) for providing information about the species and
the image of the holotype alive. We are very thankful to Melanie
Strauch (Bonn) who provided SEM specimens of the holotype
and Bitis schneideri. Wolfgang Bohme (Bonn), Andreas Schmitz
(Geneve) and Bradley Sinclair (Ottawa) gave very important
comments to the manuscript and we are thankful for fruitful dis-
cussions with them.
REFERENCES
Baha el Din S (2006) A guide to the reptiles and amphibians of
Egypt. The American University in Cairo Press, Cairo,
359 pp.
Beyerlein P (1993) Systematische Relevanz epidermaler Ultra-
strukturen bei modernen Schlangen (Colubroidea). Unpublis-
hed Thesis, University of Bonn
Bohme W, Wied! H (1994) Status and zoogeography of the
herpetofauna of Cyprus, with taxonomic and natural history
notes on selected species (genera Rana, Coluber, Natrix,
Vipera). Zoology of the Middle East, 10: 31-52
Boulenger GA (1896) Catalogue of the snakes in the British Mu-
seum (Natural History). Vol. 3, XIV, London, 727 pp.
Branch WR (1988) Field guide to the snakes and other reptiles
of southern Africa. Struik Publishers, Cape Town, 326 pp.
Cohen AC, Myers BC (1970) A function of the horns (supraoc-
ular scales) in the sidewinder rattlesnake, Crotalus cerastes,
with comments on other horned snakes. Copeia 3: 574-575
Cowles RB (1953) The sidewinder: master of desert travel. Pa-
cific Discovery 6: 12—15
Fathinia B, Anderson SC, Rastegar-Pouyani N, Jahani H, Mo-
hamadi H (2009) Notes on the natural history of Pseudo-
cerastes urarachnoides (Squamata: Viperidae). Russian Jour-
nal of Herpetology 16 (2): 134-138
FitzSimons VFM (1962) Snakes of southern Africa. Purnell,
Cape Town, 423 pp.
Forskal P (1775) Descriptiones animalium, avium, amphibiorum,
piscium, insectorum, vermium; quae in itinere Orientali ob-
servavit Petrus Forskal. Méller1, Hauniae, xxxiv + 164 pp
Gasperetti J (1988) Snakes of Arabia. Fauna of Arabia 9:
169-450
Geniez P, Mateo JA, Geniez M, Pether J (2004) The Amphib-
ians and Reptiles of Western Sahara: An Atlas and Field Guide.
Frankfurt am Maim, Chimaira
ICZN (International Commission on Zoological Nomenclature)
(1999) International Code of Zoological Nomenclature. 4th
edition, The International Trust for Zoological Nomenclature
Joger U (2003) Reptiles and amphibians of southern Tunisia.
Kaupia 12: 71-88
Joger U, Courage K (1999) Are Palaearctic ‘rattlesnakes’ (Echis
and Cerastes) monophyletic? Kaupia 8: 65-81
Bonn zoological Bulletin 57 (2): 297-306
Jooris R, Fourmy R (1996) An analysis of scutellation in pop-
ulations of Cerastes vipera (Linnaeus, 1758): Scale charac-
ters co-vary with environmental temperature. African Journal
of Herpetology 45 (2): 59-67
Klauber LM (1956) Rattlesnakes. Their habits, life histories, and
influence on mankind. Univ. California Press
McDiarmid RW, Campbell JA, Touré TA (1999) Snake species
of the world. Vol. 1. Herpetologists’ League, 511 pp.
Phelps T (2010) Old world vipers. A natural history of the
Azemiopinae and Viperinae. Chimaira, Frankfurt, 558 pp.
Pook CE, Joger U, Stitmpel N, Wtister W (2009) When conti-
nents collide: Phylogeny, historical biogeography and system-
atics of the medically important viper genus Echis (Squama-
ta: Serpentes: Viperidae). Molecular Phylogenetics and Evo-
lution 53: 792-807
Schatti B, Gasperetti J (1994) A contribution to the herpetofau-
na of Southwest Arabia. Fauna of Saudi Arabia 14: 348-423
Schleich HH, Kastle W, Kabisch K (1996) Amphibians and Rep-
tiles of North Africa. Koeltz, Koenigstein, 627 pp.
Schmidt KP (1939) Reptiles and amphibians from Southwest-
ern Asia. Publ. Field Museum of natural History, zoological
Series 24: 49-92
Sochurek E (1974) Cerastes cerastes karlhartli n. spp. Herpe-
tologische Blatter 1: 3
Sochurek E (1979) Die Schlangen Nordafrikas. Mitteilungen der
Zoologischen Gesellschaft Braunau 3: 219-226
Tiedemann F, Haupl M (1980) Typenkatalog der Herpetologi-
schen Sammlung. Reptilia. Kataloge der wissenschaftlichen
Sammlungen des Naturhistorischen Museums in Wien (Selbst-
verlag Naturhistorisches Museum Wien) 4 (Vertebrata 2): 1—
79
Werner YL (1987) Ecological zoogeography and Saharo-Arabi-
an, Saharo and Arabia reptiles in the sand deserts of southern
Israel. In: Proceedings of the Symposium on the Fauna and
Zoogeography of the Middle East, Mainz, 1985. Krupp F,
Schnider W, Kinzelbach R (eds.), Beihefte zum TAVO A 28,
272-295
Werner YL, Sivan N (1992) Systematics and zoogeography of
Cerastes (Ophidia: Viperidae) in the Levant: 2, Taxonomy,
ecology, and zoogeography. The Snake 24: 34-49
Werner YL, Sivan N, Kushnir V, Motro U (1999) A statistical
approach to variation in Cerastes (Ophidia: Viperidae), with
the description of two endemic subspecies. Kaupia 8: 83-97
Werner YL, Verdier A, Roseman D, Sivan N (1991) Systemat-
ics and zoogeography of Cerastes (Ophidia: Viperidae) in the
Levant: 1, Distinguishing Arabian from African Cerastes
cerastes. The Snake 23: 90-100
Received: 10.V.2010
Accepted: 29.VI.2010
OZFMK
Bonn zoological Bulletin | Volume 57 Issue 2 | pp. 307-328
Bonn, November 2010
The taxonomic history of the Linnean genus Lacerta
(Squamata: Sauria: Lacertidae)
in the mirror of book-illustration
Josef Friedrich Schmidtler
Oberfohringer Str. 35, D-81925 Miinchen, [email protected]
Abstract. The taxonomic history of the Linnean genus Lacerta illustrates the general taxonomic history in herpetology
and can be visualized by the history of book illustration. There is a cohesive pattern in lumping Lacerta (Linnaeus, 1758;
comprising lizards, crocodiles and salamanders; expanding to almost 100 species in Shaw, 1802) and splitting (Lauren-
ti, 1768; comprising among others his new genus Seps, a part of Linnaeus’ Lacerta), since the creation of binominal nomen-
clature by Linnaeus, and proceeding above all to the controversy of Boulenger and Méhely after 1900. These wavelike
advances through the centuries are also characterized by a slow consolidation of the higher systematic categories (class-
order-family-subfamily, etc.) and by a gradual reduction of the term Lacerta to almost the species level. This develop-
ment ended now in an enormous generic and specific splitting within the family Lacertidae (Arnold et al. 2007), main-
ly based upon mitochondrial DNA research. The remaining “true” Lacerta comprises at present only half a dozen species,
all of them close relatives of the type species, Lacerta agilis.
There is an historical interdepency between verbal descriptions and illustrations in the taxonomic advances of the genus
Lacerta. The first illustrations of lizards (in the 16'® century) are in equal measure characterized by the lack of system-
atic insight and the lack of technical options. Copper engravings (handcoloured) were used a little later. Since the end of
the 18th century, new techniques accompanied and immensely facilitated a better recognisability of taxa: wood engrav-
ings — lithographs — chromolithographs — photos — modern digital colour photographs. The better understanding of the
diagnostic scale structures called for their schematic depiction, and a schema of the dorsal drawing pattern was estab-
lished. Diagrams for identification keys and/or of the phylogenetic relationships have become an indispensable part of
modern taxonomic work. On the contrary, the genetic revolution of the last 20 years caused a great loss in importance
of morphological characters, whereas top-quality digitalized coloured photos have shifted their importance mainly to pop-
ular publications on ecology, ethology, field herpetology and terraristic studies.
Keywords. Genus Lacerta; history; interdepency text/illustrations.
1. INTRODUCTION: SOME COMMENTS ON THE
ZOOLOGICAL TERM GENUS
The history of the Linnean genus Lacerta is likewise a his-
tory of the term “genus”. As Mayr et al. stated in 1953,
the genus is a collective taxonomic unit consisting of a
number of similar or related species. It is distinguished
from all other higher categories by being recognized in
the scientific name. The nomenclature proposed in Lin-
naeus’ Systema Naturae (1758; animals) is binominal, con-
sisting of two names, each with its own function. The func-
tions which Linnaeus visualized for the components of the
scientific name are diametrally opposite. The specific
name signifies singularity and distinctness; the generic
name calls attention to the existence of a group of simi-
lar or related species — it relieves the memory (Mayr et
al. 1953: 48).
Bonn zoological Bulletin 57 (2): 307-328
Even before Linnaeus there was a recognition of the cat-
egories genus and species. So, Plato definitely recognized
two categories, the genus (“genos”’) and the species (“e1-
dos”), and so did his pupil Aristotle. The naturalists of the
pre-Linnean era were not consistent in the Latin names
they gave to plants and animals. These names ranged all
the way from uninominals (a generic name only), and bi-
nominals (a generic and a simple trivial) to polynominals
(a generic name with several trivial epithets). The reason
for this confusion was that they tried to combine two dif-
ferent functions in the name: naming (in the restricted
sense of the word) and describing (Mayr et al. 1953: 202;
see the legends in the images of Gessner and Aldrovandi
Figs 2 and 3 hoc loco).
©ZFMK
308 Josef Friedrich Schmidtler
An objective criterion for the generic rank does not exist
equivalent to the biological species concept (“reproduc-
tive isolation”) in species systematics (see Mayr 1984:
141, 219; Jahn 2004: 237, 397; Joger 1996) as a criteri-
on. It is therefore impossible to give an objective defini-
tion of the genus. So Mayr et al. (1953: 48) came to the
following conclusion: “A genus is a systematic category
including one species or a group of species of presumably
common origin, which is separated from other similar
units by a decided gap”. They suggest for practical rea-
sons that the size of the gap be in inverse ratio to the size
of the unit; the latter qualification should prevent the
recognition of unjustified monotypical genera.
The general view on the definition of the category genus
has not changed much since then, contrary to the differ-
ent species concepts (e.g. Joger 1996). Even Mayr et al.
(1953) had attenuated their clause appearing so strict (“An
objective criterion does not exist ....”; p. 48) when dis-
cussing the presence of an “ecological niche” (p. 50) be-
tween genera. Later on Dubois (1988) and recently Dubois
& Bour (2010) have extensively discussed the demand of
“hybridizability” as a criterion for the definition of gen-
era and subgenera. Additionally, the genetic revolution in
taxonomy since the 1990s has decidedly consolidated the
phylogenetic trees. So Speybroeck et al. (2010), in the in-
troduction to their recent species list of the European her-
petofauna, come to the decision: “As a distinct genus, we
tend to recognize monophyletic clades that are genetical-
ly as divergent as other widely accepted genera in the same
group. This is usually the approach employed by authors
of scientific papers....”. As a conclusion one might assert,
that it was molecular biology which gave rise to a still con-
tinuing revolution in herpetological taxonomy, and —
above all — to an enormous generic splitting, be it of the
old Linnean genera Testudo, Rana, Coluber, or Lacerta,
the latter being discussed here.
2. A BRIEF HISTORY OF THE LINNEAN GENUS
LACERTA
2.1 The “lumper” Linnaeus (1758 / 1766) and his fol-
lowers
The history of the genus Lacerta reflects also a history of
zoological terms and categories, which can be dealt here
only with its basic intentions. The word “Lacerta” (or the
male gender “Lacertus”’) is of Latin origin. One of its three
meanings is the linguistically derived English term
“lizard”. In this sense it is traceable in the Historia Nat-
uralis of Plinius or in some works of the classic Latin po-
ets Ovidius and Virgilius (Scheller, 1796). Since the era
of renaissance this term was renewed by natural scientists
in both the male and female gender (see Figs 1, 2, 4). Thus
Bonn zoological Bulletin 57 (2): 307-328
the term Lacerta / Lacertus had a long history before Lin-
naeus began to use it in the different editons of his “Sys-
tema Naturae” since 1735.
Linnaeus (or “Linné” after nobilitation), in his famous 10th
edition of 1758, divided the class “Amphibia” into three
orders: I. Reptiles, H. Serpentes, HI. Nantes. The “Rep-
tiles” comprise the four genera Testudo, Draco, Lacerta,
Rana; the Serpentes comprise the six genera Crotalus,
Boa, Coluber, Anguis, Amphibaena, Caecilia. The Nantes
comprise six genera, all of them being transferred later on
into the class Pisces. The Linnean Rana, parts of Lacer-
ta and Caecilia constitute the current class Amphibia
whereas the other genera in Linné’s orders Reptiles and
Serpentes are comprised in the present-day — polyphylet-
ic — Reptilia. Linnaeus’ (1758/1766) large genus Lacerta
is an aggregation of 43/49 species, e.g. comprising the cur-
rent Lacertidae (type species of Linnaeus’ Lacerta is Lac-
erta agilis by later designation in Fitzinger 1843: 20),
many other Reptile orders (like the crocodylia) and fam-
ilies, and even amphibians (e.g., salamanders; see Fig. 1).
His genus Lacerta is encompassed by the diagnosis “Cor-
pus, tetrapodum, caudatum, nudum” (body with four legs,
caudate, “naked”; the latter characterization being com-
pletely incomprehensible, since his genus Rana is also
characterized to be “naked”!). It seems that Linnaeus did
not misjudge completely the heterogenity of his genus
Lacerta. He tried to resolve the problem by species groups,
characterized by short diagnoses and different stars. So his
Lacerta agilis is within a group characterized by “** Cau-
da verticillata” (Tail round) and the group with the fire
salamander, “Lacerta salamandra”’,, 1s characterized by
aK Palmis tetradactylis; Corpore alepidoto nudo”
(fore legs with four toes; body without scutes, naked).
Nevertheless the newt “Lacerta vulgaris” (number 25;
now: Lissotriton vulgaris) is grouped together with geck-
os and skinks.
Gmelin (1789) was formally a follower of Linnaeus, but
he undermined his concept in the so called 13 edition of
Linné’s “Systema Naturae” where he accumulated the
number of Lacerta species up to 77. Gmelin introduced
eleven species groups within Lacerta, characterized by
short diagnoses and mostly (but not always!) naming them
(nominative plural of a main species being included, like
“Salamandrae” with five stars ( ), comprising the
Linnean Lacerta salamandra, No. 47) — or his ““Ameivae
s. Sepes” (“‘s.” = sive”; English: “or’”’) comprising the Lin-
nean Lacerta agilis — or the ““Lacerti” (with nine stars) cov-
ering current tailed amphibians and reptiles, except lac-
ertids, like the newt “Lacerta vulgaris” (now: Lissotriton
vulgaris which is therefore not a part of his “Salaman-
drae”’!). It is clearly noticeable that Gmelin, following Lin-
naeus, avoided dividing the genus Lacerta formally, un-
like Laurenti (1768) had executed. The non-scientific rea-
©OZFMK
Taxonomic history of the genus Lacerta
sons may have been similar as described below in the dis-
cussion on Shaw.
Donndorf (1798) followed Gmelin (1789). He used the
German terms “Geschlecht und Gattung” instead of “Gat-
tung und Art” (genus and species; “Vorrede” p. 5). In his
genus Lacerta Gmelin’s system with eleven species
groups, characterized by eleven stars, is comprised; he
added however 14 newer species (“neuere Gattungen”)
within these species groups and nine species of undeter-
mined species groups.
Shaw’s (1802) General Zoology (vol. II, part II], Amphib-
ia) is the last of the great encyclopaedias around 1800
which formally retains the generic name Lacerta in the
broad Linnean sense. Its number of species has increased
up to 86. Like the preceding encyclopaedias Shaw divid-
ed Lacerta into nine “sections or sets” giving them Eng-
lish names. He admitted however: “The above divisions
Linnaeus (1758)
Laurenti (1768)
Wagler (1830)
Dumeéril & Bibron (1839)
Boulenger (1920)
Arnold (1973)
Arnold & al. (2007)
o
Pa
ia")
me)
=)
Oo
Oo
&
2
<=
foe
Testudines
Crocodilia
Fig. 1.
309
neither are, nor can be, perfectly precise...” His “4.
Lizards proper “ comprised also the current day Lacer-
tidae, among them the ’Green lizard” “Lacerta agilis” tak-
ing first place. Smith & David (1999: 12, 13), when dis-
cussing the taxonomic situation then, drew the conclusion:
“The rudimentary level of understanding of herpetologi-
cal classification in Shaw’s time is admirably exemplified
by his treatment of the Division Lacertae, containing on-
ly two genera — Draco and Lacerta — that are extremely
disparate in diversity. Nevertheless, Shaw was much more
aware of the diversity and affinities of members of his
genus Lacerta than is apparent in the assignment to one
genus, inasmuch as he recognized nine distinct groups. To
us it seems strange that such diversity was not reflected
taxonomically when the relatively minor specialization of
Draco received such emphasis. However, although Shaw
boldly named new species or changed names, he reflect-
ed the trepidation widely shared at that time among his
colleagues in splitting Linnean genera. Change then, as
other Squamata
other Lacertini
Gallotiinae
Eremiadini
Zootoca
Podarcis
Serpentes
Anguidae
Lacertidae
Overview of the gradual reduction of the Linnean genus Lacerta (Laurenti’s genus Seps respectively) from selected mo-
nographs: Linnaeus (1758) — Laurenti (1768) — Wagler (1830) — Dumeéril & Bibron (1839) — Boulenger (1920) — Arnold (1973) -
Arnold et al. (2007: fig. 20); displayed upon a current phylogenetic tree (strongly simplified; from Dawkins, 2008, figs. p. 366,
422, 462; Arnold et al. 2007 figs.). The symbols Z or S make clear a quotation of “Lacerta” (or “Seps” by Laurenti) within a gi-
ven current systematical unit; X (no species from this group being described then).
Bonn zoological Bulletin 57 (2): 307-328
©ZFMK
310 Josef Friedrich Schmidtler
362
Det Kohe von den Eydeken foll auch viel
Krafft haben fiir etlicheRrancEheiten dev Augen.
Lcbendig in Del geFocht/ follein gare Gefiche
machen. Dahero Becherus:
Gefnert Thierbuch
Die Eydcy lebendigin Ocl man fochen thut/
Es macht cin weif Geficht/ ift vor die Rehte
gut.
rob SEL SSB- GOST SB SSS SOB BES 0F- U) BEST ES BES OB~ SEBS OR ESF 263
Von der grinen Eyoere.
Lacertus viridis. Grtiner Heydor/Egochs/Sltachs/
oder Eder. :
Fig. 2.
“Lacertus viridis” from Gessner’s (1671) last edition, the so called “Frankfurter Ausgabe”. Wood cut.- The eye-catching
bars across the tail indicate the whorls typical for a Lacertid tail. The text consists of medical and cosmetic advices, the latter in
the form of a verse. The different insights of a painter and a mere engraver as well as the different qualities of a water colour com-
pared with an engraving are shown by a comparison to an Aldrovandi image (Fig. 3).
now, came slowly. Shaw worked in a surprisingly substan-
tial intellectual milieu of peers who would look critical-
ly at any change from established authority”. A compara-
ble thoughtfulness seems to have been widespread in sc1-
ence — at least then (compare the situation of N.M. Op-
pel after his studies in Paris, being surrounded by “natu-
ral philosophers” in Munich since 1811; Schmidtler 2009:
509; Figs 16, 17 hoc loco).
The “Histoire Naturelle des Quadrupédes Ovipares et des
Serpens” by Lacepede (1788/89) is a milestone in the his-
tory of natural science. It highlights the beginning of the
acceptance of Linnaeus’s binominal system also in
France, then leading in natural science. Up to that time
the well known scientific controversies of Linnaeus
(1708-1779) and Buffon (1708-1788) had prevented to
a large extent the application of Latin binominal names
in the French zoological and botanical literature, especial-
ly in the dozens of volumes of Buffon’s “Histoire Na-
turelle” having appeared since 1750. The acceptance of
Linnaeus’ binominal system by Lacepéde appears admit-
tedly in a rather hesitant and concealed manner. It turns
Bonn zoological Bulletin 57 (2): 307-328
up only in the gigantic Latin “Synopsis methodica
Quadrupedum oviparorum” beside the French “Table
méthodique des Quadrupedes ovipares” (see the elaborate
description in David et al. 2002: Fig. 2). Here Lacepéde
accepted two classes. His first class (“Quadrupedes ovipari
caudati”) comprises two genera, 7estudo and Lacertus
(“Corpus absque testa’). The latter, with 56 species, is di-
vided into eight divisions (“divisio”) which are each de-
scribed shortly, but not named. As Spix (1811: 342) point-
ed out there is however a contradiction between La-
cepéde’s (1788) zoological findings in the text and the con-
struction in the “Table méthodique” when stating that the
salamanders are nearly related with the frogs. He accept-
ed two current lacertid species in his third division (Lac-
ertus cinereus and Lacertus viridis; both highly collective
groupings, comprising among others the current genera
Lacerta / Timon and Podarcis / Zootoca respectively; see
also Schmidtler & Béhme, in prep.). The six species of
salamanders are, contrary to Linnaeus and Gmelin, con-
centrated in one division (“VIII. Divisio”). It may be not-
ed that the name with the male gender “Lacertus” La-
cepéde, 1788 is regarded to be an unjustified emendation
©ZFMK
Taxonomic history of the genus Lacerta 311
Fig. 3. Podarcis siculus ssp. From the collection of Aldrovan-
di’s natural history images (16'" century), see also Ceregato &
Alessandrini (2007: fig. 462 upper part) and Delfino & Cerega-
to (2008). Water colour (Tempera). — The shapes and colours of
lizards are excellently painted but the head shields are scarcely
indicated. The naming of tail anomalies (especially Lacerta “‘bi-
ceps”!!!) reveals the lack of a species concept and the lack of a
preset nomenclatural terminology. See chapter 3.2.
of Lacerta Linnaeus, 1758 (see David et al. 2002: 24). La-
cepede’s volume | and volume 2 (on the snakes) were re-
jected in general as a non-binominal work. This opinion
remained heavily controversial (see David et al. 2002: 22;
Dubois & Bour 2010). Anyway, one year later many
species were adopted by Bonnaterre (1789) who has there-
fore become the correct author of many of Lacepéde’s
names not being available. On Bonnaterre’s Lacerta see
more in chapter 2.2.
As obvious from the title, Bechstein’s encyclopedia
(1800-1802), “Herrn De la Cepede’s Naturgeschichte der
Amphibien” is first of all a translation from Lacepéde’s
(1788 / 89) Histoire Naturelle, but comprising many ad-
ditions. Bechstein used German terms. In his “Methodis-
che Ubersicht der eyerlegenden vierfiiBigen Thiere” he
translated Lacepede’s system with the terms Classe, Gat-
tung (genus) and Art (species), inserting the term “Fam-
ilie”, apparently in the sense of a species group below his
“Gattung” in some genera, like the “Eidechsen” (lizards).
He neglected Linnaeus’ Latin binominal teminology to a
large extent. His terminological system concerning the cat-
egory “Art” (species) is inconsistent and confusing. In his
“Zweyte Gattung, dritte Familie” (vol. II, like in Lacepéede
1788) some current Lacertidae (“L. cinereus, die graue Ei-
dechse” and “L. viridis, die griine Eidechse’”’) are com-
prised. He gave an excellent picture of the “Graue Ei-
dechse / L. cinereus” (vol. I, Taf. 1; depicting the male
and the female of a present-day Lacerta agilis), and
demonstrating thereby that this important taxon was then
differently understood in different European countries (see
Fig. 4.
Lacerta agilis (male). Left figure: Draft of the right figure; drawer Résel von Rosenhof (Cod. Icon. 48, Bayerische Staats-
bibliothek Miinchen; before 1758). Water colour. — Right figure: Frontispiece in Résel v. Rosenhof (1758). Hand coloured engra-
ving.- The changes in scientific insight by the famous drawer and natural scientist Résel mirror as well his personal “metamor-
phosis” as the changes in general views in differentiating a “salamander” (left: with its nude skin!) from a lizard (right: with its li-
felike scaly skin and pileus scutes; but: occipital and interparietal scutes are still lacking!). Both, salamanders and lizards, became
in the same year parts of the Linnean genus Lacerta.
Bonn zoological Bulletin 57 (2): 307-328
©ZFMK
312 Josef Friedrich Schmidtler
also Schmidtler 2004; Schmidtler & Bohme in prep.). In
his “Anhang” (additions; vol. I, 297-325) however, Bech-
stein on the one hand accepted the modern binominal ter-
minology of Laurenti (1768) and Schneider (1799; e.g.
Stellio phylluros, p. 307) or used Gmelin’s (1789: 1060)
Latin species group terms, (p. 311; like Stelliones =
“Spiegeleidechsen”).
2.2. Early generic splitting after Linnaeus
Laurenti (1768) was the first to subdivide the Linnean gen-
era of amphibians and reptiles (Testudines excluded) in a
comprehensive work, especially Linnaeus’ large genera
Lacerta and Coluber. Laurenti totally suppressed the name
Lacerta, but established instead of 11 new genera within
his order II ““Gradientia” (see Kuzmin 2005: 246), among
them “Seps’’ comprising also the current species of Cen-
tral European Lacerta and Podarcis and some of their syn-
onyms (see chapter 2.4; see Fig. 1). After Steyneger’s
(1936) type species designation (Seps caerulescens = La-
certa agilis; see also Dubois 2010; and Fig. 6 hoc loco)
Laurenti’s Seps became a junior synonym of Lacerta. Seps
Laurenti comprised after all only four current families, all
within the Squamata (Lacertidae, Scincidae, Teiidae,
P1668.
} il Wi)
i|
| I
tll AN AAW
Fig. 5.
Gymnophthalmidae) and appears therefore much more re-
stricted than the Linnean Lacerta.
Laurenti’s splitting had still an earlier forerunner in
Garsault’s (1764) long forgotten and just rediscovered
work “Les Figures des Plantes et Animaux” here concern-
ing in particular the French herpetofauna around Paris in
ten plates (see Welter-Schultes et al. 2008, 2009; Dubois
& Bour 2010; Fig. 5 hoc loco). Garsault (1764) used the
species names Lacertus terrestris (now: Podarcis muralis
(Laurenti); nomen conservandum), Lacertus viridis (now:
Lacerta bilineata Daudin; nomen conservandum), the
genus names Scincus, Salamandra (with the French name
“salamandre” behind; depicting Salamandra salamandra
terrestris Bonnaterre). A certain systematic unstableness
is however unmistakable when depicting the crested newt
(today 7riturus cristatus (Laurenti), nomen conservan-
dum) under the Latin nomen Lacertus aquatilis, but simul-
taneously under its French name “Salamandre d’eau”.
Valmont de Bomare in the second issue of his “Diction-
naire d’ Histoire Naturelle” (1767/68) added for the first
time Latin names to the French names. There appear like-
wise considerable systematic inconsequences: On the one
hand, under the key word and generic name “Lézard / Lac-
|
|
|
' b j | =)
jidse id j j 1}
| |
EY
Mi i
TORING
“Lacertus terrestris” (= Podarcis muralis; western subspecies) from Garsault (1764), a forerunner of Laurenti (1768),
having been rediscovered in the last years (see Dubois & Bour 2010). Copper engraving. — The pattern of the upper head scutel-
lation (right figure) is not yet perfect; the frontal and postfrontals are not executed within the central part of the pileus.
Bonn zoological Bulletin 57 (2): 307-328
©ZFMK
Taxonomic history of the genus Lacerta 313
Tas: I. ,
Fig. 6. Seps caerulescens (= Lacerta agilis; Fig. ID), Seps muralis (= Podarcis muralis; Fig. 1V), Seps argus = a juvenile La-
certa agilis; Fig. V). From Laurenti (1768: Tab. I, upper part). Copper engraving. — Laurenti’s (1768: Tab.I, fig.II]) Seps caerules-
cens has accomplished perfection for the first time in the history of a lacertid engraving: The arrangement and shape of all of the
pileus scutes are accurate. In equal measure the dorsal pattern is very representative for the species. This figure is all the more out-
standing, as Laurenti himself was obviously not yet aware of the enormous impact of head scutellation in species recognition. So
it was the exactness of the drawer and the engraver who were solely responsible for the quality of the figure. Developments like
these demonstrate the prospective relevance of naturalistic figures in book illustration for the scientific progress in reptile syste-
matics about 1800. Otherwise, the quality of the smaller figures IV and V is considerably lower and does scarcely contribute to
species recognition.
ertus” (Vol. III, p. 548, 1768), all the “amphibian species”
in Linnaeus’ (1758) sense are understood. On the other
hand, under the keyword Salamandre / Salamandra, Val-
mont de Bomare (vol. V, p. 441, 1767) described only “re-
al” salamanders, and explicitely the two species Salaman-
dra terrestris (currently: Salamandra salamandra ter-
restris Bonnaterre) and Salamandra aquatica (apparent-
ly a collective species comprising some current species
of water newts, especially 7riturus cristatus). This diction-
ary was however suppressed by the ICZN (Anonymus
1925; Dubois & Bour 2010), its nomenclature not being
always binominal for species.
Although Bonnaterre (1789; see also 2.1), often misun-
derstood as a mere copyist of Lacepede, took over many
details from Lacepede (1788) in his “Tableau Ency-
clopédique”’, he did not follow him (nor indirectly Lin-
naeus) in his generic lumping. On the contrary, he wide-
ly accepted the generic splitting by Laurenti. His first class
(“Reptilia ecaudata”) comprised the three genera of Lau-
renti: Rana, Hyla, Bufo, whereas his second class (Rep-
tilia caudata) with seven genera approached Laurenti’s sec-
ond order (less genera indeed), excluding the snakes as
well, but comprising the turtles (Zestudo). Bonnaterre’s
Lacerta comprised 52 species, among them still some of
Laurenti’s new “lizard” genera, like Basiliscus, Iguana,
Ameiva, Stellio. Bonnaterre suppressed Laurenti’s gener-
Bonn zoological Bulletin 57 (2): 307-328
ic name Seps and the current Lacertidae are comprised in
his genus Lacerta. He also doubted the validity of some
of Laurenti’s new species (e.g. Seps caerulescens, now
Lacerta agilis).
Latreille in Sonnini & Latreille (1801) in gross terms ac-
cepted the generic systematics of Laurenti (1768). Some
of Laurenti’s species of the new genus Seps were includ-
ed in the “Ie genre Lézard, Lacerta’. Latreille anticipat-
ed many of Daudin’s (1801-1803; see chapter 3.3) de-
scriptions and took the opportunity to thank him for his
communications (1801, vol. 1, p. 215; “M. Daudin...a eu
Vamitié de me communiquer, par extrait, les descriptions
qu’il a faites de plusieurs reptiles de la famille des
lézards... Il me sera doux, en le citant, de lui payer a la
fois le tribute de mon estime et celui de l’amitié”’). Harp-
er (1940) named this procedure a certain sort of piracy.
In early regional faunas, which do not cover the whole
family of lacertids, the acceptance of Linnaeus’ lumping
or Laurenti’s splitting was heterogenous. Being one of the
first authors, Schrank (1784 and 1798) completely adopt-
ed Laurenti’s genera (e.g. “Salamandra atra” Laurent,
“Seps viridis” Laurenti), whereas Razoumowsky (1789)
or Wolf in Sturm (1799, 1802, 1805) were using Linnaeus’
terminology system (e.g. “Lacerta agilis” Linnaeus or
Lacerta paradoxa s. helvetica” (n.sp.; now the newt Lis-
©ZFMK
314 Josef Friedrich Schmidtler
THE GREEN LIZARD.
Tux colours of this species are subject to variety,
becoming pale at certain seasons of the year, and
more particularly after the death of the animal.
The upper parts of the body are of a beautiful
green, more or less variegated with yellow, grey,
brown, and even sometimes with red. In warm
regions it grows to a larger size than in more
temperate countries, being sometimes found thirty
inches in length. The inhabitants of Africa eat
the flesh of this animal.
Fig. 7. “Green lizard” (= Lacerta viridis); probably the first
lizard in the renewed wood cut technique by Bewick (1809 —
1816; “wood engraving”; cf. Dance, 1989, Schmidtler, 2007).
As usual then, engravings of the “abhorrent” reptiles (so Linna-
eus 1758:194) were significantly of a lower quality than the birds
or mammals (cf. the images in Bewick 1791). Nevertheless this
green lizard is recognizable here. It was a great advantage of this
printing technique that the images could be printed together with
the text upon the same page (unlike copper engravings or litho-
graphs - these upon separate plates). So, later on, wood engra-
vings proved to be adequate for the popular small English “chap
books”, or the German “Naturgeschichten”. This kind of letter
press was also often used for schematic figures in a text page.
sotriton helveticus) in the former; “Lacerta atra” (Lau-
renti), and “Lacerta agilis” Linnaeus in the latter. In con-
trast Koch in Sturm (1828) made use of Laurenti’s gener-
ic names (“‘Seps stellatus” Schrank, “Triton alpestris” Lau-
renti) in the same “Deutschlands Fauna”.
2.3. An enormous increase of knowledge since 1800
Since about 1800 the knowledge in natural science in-
creased immensely and many new species were described.
Laurenti’s (1768) system of splitting the Linnean genera
began to win recognition. Nonetheless, Laurenti’s total re-
placement of the generic name Lacerta, e.g. by Seps, was
usually not accepted.
Bonn zoological Bulletin 57 (2): 307-328
Some months after the issue of Sonnini & Latreille’s
(1801) encyclopaedia Daudin started his “Histoire Na-
turelle des Reptiles” (“An X” = 1801; see Harper 1940
for the exact data). His “Second ordre. Les Reptiles
Sauriens” approximately conforms with the genus Lacer-
ta lumped by Linnaeus and Lacepéde (1789), but the sala-
manders were transferred to his fourth order “Les Rep-
tiles Batraciens” comprising also the frogs. His genus Lac-
erta is one of 16 genera within these “sauriens”, most of
them being current lacertids except the Ameivas. His
generic systematics resembles Laurenti’s (1768) splitting
system in general. One of the decisive differences was its
essential feature in the formal persistence of a large genus
Lacerta, whereas Laurenti’s generic name Seps was made
use of for only some two- or four-legged saurians.
Daudin’s greatest progress may be the redivision of his
newly split genus Lacerta: It comprised 32 species sub-
divided into seven unnamed “sections”. These sections
presage the present lacertid genera in some very ambigu-
ous outlines. For example, his second section “Lézards
verds” contains Lacerta ocellata (now Timon lepidus) and
Lacerta viridis (now: within Lacerta s. str.) as well, where-
as his fourth section “Lézards tachetés” contains “Lacer-
ta lepida”’ (a young Timon lepidus) and his new Lacerta
maculata (a very cryptic name in some respects). Espe-
cially with Daudin the level of knowledge began to in-
crease immensely. This growth did not only include fur-
ther generic taxa but also an inflation of species names
by naming “real” new species, also individual or local
variations, both sexes or juveniles. Replacement names
took the upperhand more and more. The names for the one
current species Lacerta agilis (three Seps species names
in Laurenti (1768); see Schmidtler 2004 and Kuzmin
2005) were augmented by Daudin to three more names
(male, female, young) in his fifth section “Lézards gris”.
This fifth section comprised also his “lézard gris” with the
Latin name “Lacerta agilis” (currently Podarcis muralis).
Until very recently Oppel (1811, see Fig. 16) was held as
the author of the family Lacertidae (“Lacertini”) (now:
Lacertidae Batsch, 1788; cf. e.g. Speybroeck & al. 2010).
Based upon Dumeéril (1806) he moved ahead the system-
atics in the higher categories and made them clear by trees
as a forerunner of evolutionary ideas (Schmidtler 2009).
Merrem (1820) was the first to publish a schematic im-
age and a terminology of the lacertid head scutellation
(chapter 3, Fig.12). His genus Lacerta comprised 27
species, some of them being new. His systematics is based
in general upon Daudin (1801-1803), Oppel (1811) and
Cuvier (1819). He introduced some new terms and taxa
in the higher categories. So his genus Lacerta is part of
the “stirpes” A. Ascalabotae, the “tribus” 1. Gradientia,
the III. order Squamata and the class 1. Pholidota (the 2.
class is named Batrachia).
©ZFMK
Taxonomic history of the genus Lacerta 315
P,Z.S 1908). Pl. LXVI.
Fig. 8.
Lacerta chlorogaster (= Darevskia chlorogaster) from Boulenger (1909: Pl. LVI). Below one chromolithograph (i.e. an
image printed successively with differently coloured lithograph plates), and above two (pen-) lithographs (scutellation of pileus
and surroundings of the anal region). The highly informative combination of naturalistic and schematic figures upon one lithogra-
phic plate turned up at first in the middle of the 19t" century.
The “Neue Classification der Reptilien nach ihren natiir-
lichen Verwandtschaften” was Fitzinger’s (1826) first im-
portant work (see Mertens, 1973). His “XI. Familia. Lac-
ertoidea. Lacertoiden” comprises three genera, among
them Lacerta with 17 species. It was apparently the first
time in a systematic listing that neither this family nor the
genus Lacerta comprehended any taxa now being ranked
outside the present-day Lacertidae.
It was the age of the great systematic monographs and
shortly afterwards Wagler (1830) published his “Natiirlich-
es System der Amphibien mit vorausgehender Classifica-
tion der Saugethiere und Végel”. Wagler’s monograph is
especially distinguished by comprehensive and progres-
sive morphological and anatomical descriptions and con-
siderations (pp. 211-344). His genus Lacerta only com-
prised lizards belonging to the current genera Lacerta
(s.str.) and Timon. His “Familia III. L. autarchoglossae”
comprehended the Linnean taxa Lacerta and Tachydro-
mus, as well as the new lacertid genera Zootoca, Podar-
cis, Aspistis, Psammuros (the latter two are still synonyms
of Psammodromus Fitzinger), apart from some genera be-
Bonn zoological Bulletin 57 (2): 307-328
longing to other current families. Zootoca and Podarcis
were regarded mostly as synonyms subsequently, but were
revalidated more than 150 years later. All in all Wagler’s
systematics of the genus Lacerta appears rather modern
(Fig. 1).
The “Histoire Naturelle des Reptiles” in eight large vol-
umes by Duméril & Bibron (1834-1854) represents a new
kind of herpetological monograph, compared with
Daudin’s (1801-1803) work. Especially because of the im-
mense growth of knowledge the different species chap-
ters increased, comprising different sub-chapters (e.g. in
Lacerta vivipara: “caractéres, synonymie, déscription”
with “patrie et moeurs” in seven pages). His species chap-
ters on Lacerta were based on many detailed new works,
including also relatively new disciplines (e.g. reproduc-
tion biology) by Milne Edwards (1829), Duges (1835),
Cocteau (1835) and Tschudi (1837). Dumeril & Bibron
(1839) were lumpers, compared with Wagler (1830). Their
genus Lacerta comprised 16 species (some of them new),
subdivided into three species groups. Their genus Lacer-
ta is currently ranked in 14 genera, some of them having
©ZFMK
316 Josef Friedrich Schmidtler
a. Pact AZ
» Be oe
| eee >.
ry.
Qa ry
la. ie i
Fig. 9.
Ventral sides of “Lacerta muralis vars. lilfordi / serpa / brueggemanni”’ (i.e. now three different species of Podarcis),
from Boulenger (1905: pl. XXII). — Hand coloured photos (The combination of hand colouring and photographs was very unusu-
al then in natural science). The spotting and the colouration are of systematic importance in these “varieties”. The diagnostic fea-
tures, especially the sutures of the shields, are not presentable simultaneously in the same figure (See Fig. 8!). — In 1853 the new
technique of photography had been received with enthusiasm after a publication on reptiles (varans and a crocodile) and other ani-
mals (“Even the best painter would not have the patience and ability to make visible all the details and structures. ..”; see Niekisch
2010).
been described before Duméril & Bibron. The present-day
Lacertidae corresponds to Duméril & Bibron’s subfami-
ly “Coelodontes” comprising nine genera. Duméril &
Bibron (1839: 1-19; 181-189) published a substantial his-
torical outline of their family “Lacertiens ou Autosaures”
and their genus Lacerta, respectively.
It is worth mentioning the chapters on “Erpétologie” or
“Lézards” in different French natural science dictionaries,
which are now more or less forgotten. They mirror im-
posingly the general advances in herpetology between
1800 and 1850 and in Lacerta in particular: See Bosc
d’ Antic (1817: 521-528), Cloquet (1819/1823), Bory de
Saint- Vincent (1826/1828), Cocteau (1835) and Meunier
in Guérin (1836).
Contrary to Duméril & Bibron (1839), Fitzinger (1843)
proved to be a splitter. Within his class Reptilia he includ-
ed the categories “Series”, “Ordo”, “Tribus” and ‘“‘Famil-
Bonn zoological Bulletin 57 (2): 307-328
ia”. The present-day Lacertidae were divided into three
families: Lacertae, Tachyscelides and Eremiae. His first
family Lacertae comprised four genera (Scelarcis, Podar-
cis, Chrysolamprus, Lacerta), most of them being subdi-
vided into subgenera. As Mertens (1973: V) stated,
Fitzinger’s (1843) work is of tremendous significance for
the study of amphibians and reptiles, not so much of the
nearly one hundred new generic and subgeneric names
proposed, but because he always cited generic type
species. In the case of Lacerta this tremendous signifi-
cance is manifested in Fitzinger’s (1843: 20) determina-
tion of “Lacerta agilis. Linné” as the type species of Lac-
erta. The excellent coloured engraving by Wolf (1799)
may have been here the decisive motive. Like Kaup (1836;
see also Fig. 17), Fitzinger (1843: 12) was also a follow-
er of the so called, unusual “Naturphilosophie” (natural
philosophy), then distributed above all among German
speaking natural scientists.
©ZFMK
Die Griinen
vom Kaiserstuhl
e Kalserstuhl ist
Y cults irmstes
Weinbaugeblet und vul
kanischen Ursprungs.
Die dortigen LéBberge
sildlicher Lagen erwirmen sich im Hoch:
sommer bis auf 40 °C und darilber. Aber
Gas macht ein vorziigliches Welnbauge-
Diet noch nicht aus — erst die Durch
schnittstemperaturen sind es, die Spitzen:
weine, aber auch seltene Tiere und Pflan
zen gedeihen lassen.
Unsere Smaragdeidechsen
Klimatisch bevorzugte Inmitten kihlerer
Gegenden — der Kalserstuhl liegt zwi
Taxonomic history of the genus Lacerta 317
Text und Fotos von Walther Rohdich
Norden geschoben: flr Orchideen, In
Sekten und Reptilien. Damit kommen im
Kalserstuhl Arten vor, die wir erst wieder,
und da sehr zahlreich, im Mittelmeer
raum antreffen. Dem uns hier am mels:
ten interessierenden Tier wollen wir uns
Ugste Eldechse, die
(Lacerta dilineata), Si
Deutschland, aber
Schwesterart Lace!
einigen Stellen inselartig vor. Die Sma
ragdeidechse ist die Wirmebedtirftgste
unserer Eldechsen. AuGer am Kaiserstuhl
Ein Maikifer ist cin fetter Happen
lebt sie noch In der
und im Donaugel
4) sowie an}
fa), Das Vorkommen
Mark Brandenburg
ten Jahrzehn:
bau der Welnber
hen. Der Bestand
Kurz elnig zu lhrer Biologie: Die
Smaragdeldechse ist dle gréfte Eldechse
Mitteleuropas, mit einer Linge von 40
cm. Sle Ist durchgehend leuchtend
grin gefdrbt, mit ve; enen
Anordnungen dunkler h
nungselemente, wie Punk:
far dieses prachtyolle Mannchen im
schen den ruppigen Gebirgen Schwarz Hochra eid.
wald und Vogesen — sind meistens
Oasen fiir ungewéhniiche Tiere
und Pflanzen. So auch hier:
Hauptlebensriume, die
weiter siidlich lie
gen, haben Aus
MWufer nach
te und Flecken. Die
Mannchen sind in
Fig. 10. Male of Lacerta bilineata from the journal “Reptilia”
(Nr. 20, 2004: 68): A perfect layout and a perfect digital colour
photo have been combined here. The beautiful and viewable pho-
tos serve firstly for keepers (demonstrating feeding habits, etc.)
and field herpetologists (identification in the field / shop) in po-
pular articles. In the light of modern genetic methods the images
have lost their traditional predominance in underlining systema-
tic descriptions.
2.4 The era
(ca. 1880-1920)
of George Albert Boulenger
The end of the 19th century was initially characterised by
new questions and topics as is displayed by Eimer’s (1881)
indication of «darwinism» in the caption of his article.
There infrageneric and infraspecific, geographical re-
searches came to the fore. I should like to emphasize the
basic advances, such as his formation of terminologies in
the dorsal pattern (Fig. 14). We may remember here his
long-standing controversy with Bedriaga concerning the
origin of colouration in insular lizards (see Muller 1994).
In this Darwinian sense Bedriaga (1886) tried to explain
the phylogenetic relations and origins of lacertid taxa (the
genus Lacerta with the five subgenera Lacerta, Algy-
roides, Tropidosaura, Zerzumia, Bettaia) by detailed dis-
cussions. His subgenus Lacerta, however, contained still
Bonn zoological Bulletin 57 (2): 307-328
species of all current subfamilies and tribes. With respect
to book illustration (see chapter 3) it may be regretted that
his descriptions were corroborated by a single lithograph-
ic plate only. The reasons here — as ever — may have been
economical ones.
Simultaneously the time of Boulenger’s great comprehen-
sive catalogues in herpetology commenced. In the intro-
duction of his Catalogue of the Lizards (three volumes)
Boulenger (1887) displayed the immense increase in the
numbers of lacertid species known and characterized:
Dumeéril & Bibron (1839), 43 species — Gray (1845), 57
species — Boulenger (1887), 97 species. Boulenger’s Lac-
ertidae comprised 17 genera and his genus Lacerta com-
prised 21 species, among them species of the whole
Eurasian and African range, i.e. species within the current
subfamilies Gallotiinae and Lacertinae (some species of
the current tribe Eremiadini not excluded; see Figs 1 and
19). The chapter «11 Lacerta muralis» (1887: 28) with
many «varieties» underlines his very typical species con-
cept. Boulenger’s vol. II contains a set of excellent lith-
ographs, among them the new species L. parva (now
Parvilacerta) and L. yayakari (now Omanosaura).
Meéhely (1909) carried out intensive studies on morphol-
ogy and osteology of European and Caucasian lacertids.
Aside from the further development of the terminology
of scutellation, osteology (Fig. 13), and pattern of muralis-
like lacertids, he described the genus Apathya and the «I.
Gruppe: Archaeolacertae» of his genus Lacerta, compris-
ing species of the current genera Anatololacerta, Phoeni-
colacerta, Hellenolacerta, Dinarolacerta, Iberolacerta and
Darevskia. His victorious species concept («species» in-
stead of Boulenger’s L. muralis-varieties) displays his fa-
mous controversy with Boulenger.
Schreiber (1912) adopted the view of Méhely and his
species concept within the European-Caucasian lacertids.
Within the current genus Podarcis he accepted as the first
in a large monograph not less than eight species, most of
them, especially Lacerta muralis and Lacerta serpa (= Po-
darcis siculus), comprising many varieties and subvari-
eties.
Boulenger (1920 / 1921), covered the lacertids in their
whole Eurasian and African range. Irrespective of the ac-
ceptance of six «sections» within Lacerta he insisted up-
on his system of the one muralis-like species, following
his catalogue (Boulenger, 1887) and later papers (1905 and
1913 especially; see Fig. 19). His Lacerta muralis (belong-
ing to his subgenus Podarcis Wagler) covers not less than
31 (!) «varieties». Most of them are presently species or
subspecies or invalid forms within the genus Podarcis, but
there are also taxa of the current genera Archaeolacerta,
Iberolacerta and Darevskia to be found. It seems now that
©OZFMK
318
Tab. IZ.
iS
Tee
87 At Ait
i
Josef Friedrich Schmidtler
TABOR es:
AMPHIBIA nonmilla fiftens:
1, AMPHISBANA 87. annulis circularibus trur:
cum I—7o 3 caudamque 1—15 cins
gentibus.
a, Caput. b. Anus,
2. COLUBER 89 feuta abdomen tegentia i—8o;
fquame caudam fubtus tegen:
tes I—I7.
a. Caput. b. Anus: c. Apex caude.
9. ANGUIS 88. fquame abdomen tegentes 1-1203
> 1 ?
{quame caudam tegentes 1—17.
a. Caput. b. Anus.
4. CROTALOPHORUS 9%. feuta abdominis
I—903
feuta caude1—1 33
crepitaculi articuli
I—5;
c. Crepitaculum.
a. Caput. b. Anus.
z, DRACO 92. pedes quatuor; cauda; Ale due
cum radiis cartilagineis alarum.
aby
Qs Ps
Fig. 11. Some reptiles and their scale countings depicted by Linnaeus (1756: Tab. III; 94 edition. Copper engraving). The scale
countings refer mostly to the ventrals and subcaudals in snakes and were given especially in the text on the genus Coluber. In the
diagnoses of the genus Lacerta no scutellation features were used then. This is apparently the first attempt of a schematic delinea-
tion and description of body shields in herpetology. The same features were used also, without depictions, in the text of the 10t
and 12th editions (1758 / 1766).
his system was a relatively superficial morphological one,
because he accepted also some (morphologically) conspic-
uously different species besides his «L. muralis», like Lac-
erta taurica (now within Podarcis), or Lacerta chloro-
gaster (now within Darevskia). This was one of
Boulenger’s rare mistakes in which, soon later, the her-
petologists of this time did not follow his exceptional au-
thority.
Mertens & Miller (1928) adopted Boulenger’s (1920) Eu-
ropean subgenera (Archaeolacerta, Podarcis, Zootoca,
Lacerta), but they did not diverge in substance from the
species concept of Méhely (1909) and Schreiber (1912).
They were the first to accept geographical subspecies (see
Wermuth in B6hme 1981), 1.e. a trinominal nomenclature
in European herpetology (e.g. «Lacerta agilis exigua Eich-
wald»). In addition they carried out some changes being
nomenclaturally necessary (e.g. Lacerta lepida Daudin,
1802 - instead of the preoccupied Lacerta ocellata Daudin,
1802).
Bonn zoological Bulletin 57 (2): 307-328
In Mertens & Wermuth (1960) there are considered many
new discoveries of the European herpetofauna (especial-
ly new descriptions of many lizard subspecies of «Lacer-
ta» sicula, L. erhardii, L. melisellensis, L. lilfordi, etc.,
from Mediterranean islands, by Cyrén, Miller, Wettstein,
Radovanovic, Eisentraut, Buchholz, in various papers
each, since the second list of Mertens & Miiller (1940).
Nevertheless this «Dritte Liste» characterizes the relative-
ly stable generic and specific systematics and nomencla-
ture in lizards between 1940 and 1990.
2.5 Towards a final breaking up of the genus Lacerta
by new methods and techniques
The basic works of Arnold (1973, 1989) and Bohme
(1971) broke new ground in the systematics of the Lac-
ertidae. New techniques (genital-morphological, karyolog-
ical, electrophoretical, albumin-immunological, genetic
features) and modern univariate and multivariate statis-
tics were executed.
©ZFMK
Taxonomic history of the genus Lacerta 319
Fig. 12. Schema of the pileus scutellation in Merrem (1820:
p. XII-XII and fig. p. 191 upper part). (Pen-) lithography. —
The decisive step ahead in the schematic depiction of lizards was
made by Merrem (1820). Based upon his similar system in sna-
kes (Merrem 1790 and 1820), he gave names to the pileus shields
of an adult Lacerta ocellata (now: Timon lepidus; see his pages
XI and XII) and depicted their abbreviations in this figure. The
description covered seven types of scutes with the letters A (Wir-
belschilder — Scuta vertebralia), B (Hinterhauptschilder — Scu-
ta occipitalia), C (Augenbrauenschilder — Scuta superciliaria),
E (Stirnschilder — Scuta frontalia posterioria), F (Schnautzen-
schilder — Scuta frontalia anterioria), G (Rtisselschild — Scutum
rostrale, L (Nasenlécherschilder — Scuta nasalia). This system
was later on differentiated and improved by Milne Edwards
(1829: pls. 5—8) who depicted and described also the shields of
the lower sides of head, body and limbs. The concept of Mer-
rem (1820) and Milne Edwards (1829) remain valid today.
The first results of Arnold’s (1973, 1989; see Fig.1) elab-
orate researches, based mainly on morphology were the
revalidation of the old Waglerian genus Podarcis and of
Gallotia Boulenger, 1916 (then a subgenus) besides two
very preliminary groups, named “Lacerta groups [ and II’.
The taxonomic tentativeness at that time found its way in-
to the comprehensive “Handbuch der Reptilien und Am-
phibien Europas” (Bohme in BOhme 1981, Bohme, 1981).
Mayer & Bischoff (1996) (re-) established further sepa-
rations from the so far comprehensive genus Lacerta
(Zootoca, Omanosaura, Timon, Teira). They visualized a
phylogenetic tree of the Lacertidae from the relationships
of their serum albumins.
Bonn zoological Bulletin 57 (2): 307-328
The numerous and very detailed morphological works of
Arribas (1997/1999) resulted in the splitting off of the
mainly SW-European genus /berolacerta Arribas 1997,
and above all of the mainly Caucasian genus Darevskia
Atribas, 1997 from Lacerta. Thereby also a very old con-
troversy (especially of Méhely and Boulenger; see chap-
ter 2.4) on the muralis-like “Archaeolacertae” could be fin-
ished. The name Darevskia was given in honour of the
great Russian herpetologist IS. Darevsky (1925-2009)
who had detected parthenogenesis in these lizards, and
therewith in reptiles (see Darevsky 1967; Schmidtler
2010).
Beginning with the comprehensive work of Harris et al.
(1998) new genetic methods have also been adopted in the
systematics of the lacertids and they have caused here, like
everywhere in systematics, a revolutionary situation. DNA
sequences from parts of the 12S, 16S and cytocrome b mi-
tochondrial genes, together with morphological informa-
tion, were used to estimate the relationships within the
family. This work was continued by Arnold et al. (2007;
Fig. 20 hoc loco). DNA sequences indicated that the Lac-
Fig. 13. Schema of skull bones (“Lacerta horvathi’’= Ibero-
lacerta horvathi) in Méhely (1909: Taf. X, upper part) on the
basis of Siebenrock (1894). — In the middle of the 19" century
important osteological investigations also were executed in la-
certids. They allowed taxonomic research in the higher catego-
ries but also within lacertid genera and species, after a reasona-
ble schematization in osteology, above all in skull terminology,
had been found.
©ZFMK
320 Josef Friedrich Schmidtler
7887.
OTD oa
LT
N erie
wy
iy iv
x
iy
RTE
ae
Rs
WE ite n\ Sr a
Laf, XU.
rs
Nema
io Ce
52a,
y
tee an Ven
a F
te
-
Fig. 14. Schema of the dorsal pattern in some Podarcis by Eimer (1881: Taf. XII). Lithograph. It was the research since the middle
of the 18 century which revealed the crucial importance of the dorsal pattern especially in the specific and infraspecific taxono-
my of the current genus Podarcis. Eimer (1881: Taf. XIII) named the different longitudinal zones (“I bis VI erste bis sechste Zo-
ne”) which usually exhibit a system of narrow light longitudinal streaks (nrs. I and IH, ““Grenzlinien”) and dark bands (nrs. II,” in-
neres / 4uBeres Band’). Méhely (1909: Fig. 1) eased his terminology and gave it the presently valid content; the seven light stre-
aks and dark bands were named after their initial points at the pileus shields (like “Supraciliarstreifen” and “Occipitalband”); see
also Schreiber (1912: Fig. 68; p. 333-335) and Mertens (1915: Fig. 3).
ertidae contain two subfamilies, Gallotiinae and Lacerti-
nae, the latter comprising two monophyletic tribes, the
Eremiadini of Africa and arid southwestern and central
Asia, and the Lacertini of Europe, northwestern Africa and
southwestern and eastern Asia. Relationships within the
108 species of Lacertini were explored using mtDNA for
59 nominal species. The morphology of the tribe was re-
viewed and also used to assess relationships. The Lacer-
tini were assigned to 19 monophyletic units of 1 to 27
species. There were described five new Lacertini-genera
out of the old collective genus Lacerta: Dalmatolacerta,
Dinarolacerta, Hellenolacerta, Iranolacerta, Phoenicolac-
erta (see Fig. 20 for a complete listing of current genera).
The new generic concept does not include subgenera ex-
cept in [berolacerta (Pyrenesaura Arribas, 1997). The
genus Lacerta is presently restricted to eight species, the
majority of them being polytypic: Lacerta agilis Linnaeus,
1758 (type species), L. bilineata Daudin, 1802, L. media
Lantz & Cyrén, 1920, L. pamphylica Schmidtler, 1975,
L. schreiberi Bedriaga, 1878, L. strigata Eichwald, 1831,
L. trilineata Bedriaga, 1886, L. viridis Laurenti, 1768.
Bonn zoological Bulletin 57 (2): 307-328
Thus the genus Lacerta appears to have finished its re-
duction through the centuries (Fig. 1) and to have stabi-
lized at a level a little above the species level (according
to the biological species concept). It seems however, that
the species systematics of the eight species of Lacerta has
not yet drawn to a close.
3. THE INTERACTION OF VERBAL DESCRIP-
TIONS AND ILLUSTRATIONS IN LACERTID TAX-
ONOMY
3.1 General notes
Zoological publishing in a modern sense, and together
with it, zoological book illustration, started at the end of
the middle ages, at the beginning of the renaissance era
in the 16' century (Nissen 1978: 113). They included
above all Belon, Gessner, Rondelet and Aldrovandi — all
of them physicians — who did no more than see their cru-
cial challenge in lining up reports and opinions of ancient
OZFMK
Taxonomic history of the genus Lacerta 321
De Animalibus in geuere. 83
Aninalinne Tabula generalis.
Animalia fune vel
{ Sanguinea, eaque vel
Pulmone refpirantia, Corde ventriculis przdito,
{ Duobus,
Vivipara,
[ Aquatica ; Cetaceum genus,
|| Terreftria, Quadrupedia, vel, ut Manat: etiam
< complectamur , pilofa. Animalia hujus
{| generis amphibia terreftribus annnme-
| T Bea
| Ovipara, Aves.
Unico, Quadrupedia Vivipara & Serpentes.
Branchiss. repirantia, Pifces fanguinei preter
i Cetaceos omnes.
LBivang nia
ements AN es
{ Mojora, quz vel
|| € Molliz, Manrdscy Poly pus, Sepia, Loiligo.
ee Maarunsseoxa, Locutta, Aftacus Cancer.
‘ Teftacea, "OsegxoSeeue, que vel univalvia, vel
|! bivalvia, vel eurbinata.
, Minora, Infeca,
Fig. 15. From Ray (1693): First attempt to exhibit affinities
or relationships in animals by a tree-like diagram; comprising
also amphibians and reptiles.
4, Familia.
29
authors without criticism. They made rather use of these
earlier authors descriptions to identify the indigenous fau-
na. They began to understand the pedagogic function of
images and the importance of accuracy in representing the
natural things in order to objectively describe them. The
most important collection of natural history coloured
paintings, among them 50 tables with amphibians and rep-
tiles, originates from Ulisse Aldrovandi (1522-1605), hav-
ing been detected for science and described in the last
years. “Their number and quality allow this collection of
images to be considered as the first attempt to organize
an iconographic atlas of the Italian and Mediterranean fau-
na and, without any doubt, the first collection of herpeto-
logical images realized with relatively modern criteria”
(Delfino, 2007; Delfino & Alessandro, 2008; Alessandri-
ni & Ceregato, 2007). The lack of a species concept and
the lack of the understanding of the animal organism, as
well as the use of different engraving- and printing tech-
niques (above all wood cuts) caused an excessive simpli-
fication in most contemporary publications and rendered
the figures useless to represent the distinctive character
of a species (cf. Gessner’s figure; Fig. 2 hoc loco). The
different insights of a painter and a mere engraver as well
as the different qualities of a water colour and an engrav-
ing are shown by a comparison of an Aldrovandi water
colour (Fig. 3).
It was about 250 years later, when the zoologist Hermann
Schlegel (see Schmidtler, 2007) delved into the theory of
natural science images (German translation in Nissen,
Lacertini.
Lingua tenuis, furcata, protractilis, scuta abdominalia et caudalia la-
teralibus majora, haec omnia verticillata.
squamae dorealibus sequales; cauda hicavinata —-
Capitis < scuta, dorsalibus
majora; collare
nullum -
Fig. 16.
distinctum 5 poo
Gula non dilatsbilis.
a upmambis,
(quadricarinata - Dracaena.
rotundata - - Lacerta.
- - - - = Tachidromus.
Diagram of the family “Lacertini” in Oppel (1811): Oppel (1811: 20) established the family “Lacertini” (now: Lacerti-
dae), among six families within his order ““Squamata’’. The “Lacertini” comprised four genera, two of them (Zupinambis and Dra-
caena) belonging now to other families, before Duméril (1806: No. 49-51) had established two families only (“Planicaudati” and
“Tereticaudati’’) in his order “Saurii’’.— Similar trees or identification keys like this and Duméril’s were the forerunners of an evo-
lutionary view in herpetology (see Schmidtler 2009).
Bonn zoological Bulletin 57 (2): 307-328
©ZFMK
Ww
ho
bo
1 Stannn, Ul. Gtannn.
X. Ordnuna, E. Ovounung,
@®reehkone,
Kialoten. I. Ordnuag,
Hlugeidechfer. ILE. Stamm. IV. Stamne.
LE. Ordmung. Flugeidechfer. Sramn Stat
WEE, Ovdnung, EF. Oronung. — ¥, Ovdnung.
Chamileone, CECidech fen. divokodile. War vive.
IXY, Ordming,
Megalefaurier,
1a. Ordnung. WE. Ordnung.
MeereiDechfen. Bepfe. V. Stain,
Le. Ovtnung, HO. Ovdnung. YF. Ovdnung.
Schildkroten. Schlangen. Srifche.
UWL Ordnung.
Sulawawder,
dT, Ordnung,
Cicilien.
Fig. 17. Diagram from Kaup (1836): His “III. Ordnung E1-
dechsen” (,,Lacertae“, text p. 26) corresponds to the rank of the
present day family Lacertidae, comprising several genera like
the “eigentliche Eidechsen” = Lacerta. His “Stamm” corresponds
nearly to a current order. In this diagram there is exhibited the
famous and strange dead end of “natural philosophy”; display-
ing more a mysticism of numbers than a concept of natural sci-
ence: Like in birds, mammals and amphibians as well, there
exists in Kaup only a strict number of five “Stémme” and in each
there are enclosed strictly three “Ordnungen”! See chapter 3.4.
This mysticism does not proceed in the number of lacertid ge-
nera. See also Fitzinger (1843) and the critique in Mertens
(1973).
acerla
Arico ts
| Notopholis / \
Gtxnyprt
Fig. 18.
Preertidn
Josef Friedrich Schmidtler
1978: 231). According to him it is the function of such a
figure to supersede the subjects difficult to be seen or ex-
amined in nature, in order to recognize them after the de-
piction and to be able to derive their shape, colours, pro-
portions and other features as exact as possible. The per-
fection of this claim calls for a full interaction of text and
illustration in the scientific, artistic and technical aspects
— in this article being demonstrated on the basis of the Lin-
nean genus Lacerta.
When the taxonomic importance of the different struc-
tures, like scales, spotting and colouration had been rec-
ognized about 1800, there originated also the need to dis-
play them separately from each other. The joint — natura-
listic — appearance interfered with their independant per-
ceptibility, for instance because of their poor visibility (e.g.
sutures of scutes), overlapping with spotting, light reflec-
tion (Figs 8, 9), etc. At the same time abstracted figures
(diagrams) were also used to exhibit relationships and /
or identification keys, etc. (Figs 15—20).
—— Puedes
SS
oN Be yi
| Podareis
/
Nnmon j
orgllalips
From Camerano (1877: Tav. I, excerpt): Another rather popular kind of diagram displaying the relations between taxa.
The small circles within the large circles symbolise related taxa of the four lacertid genera (Lacerta, Podarcis, Notopholis, Timon).
The lines between such encircled taxa designate important morphological resemblances.
Bonn zoological Bulletin 57 (2): 307-328
OZFMK
Taxonomic history of the genus Lacerta 323
The first engraving — and printing — techniques were wood
cuts (15'* century), and shortly later, copper engravings.
Around 1800 copper engraving was refined (etchings) and
the first very expensive and rare colour prints in herpetol-
ogy were based upon them (Daudin 1802; see Schmidtler
2007) after centuries of hand colouring. Lithography (the
first lizards in Schmid 1819) was invented and improved
more and more up to the time of chromolithography (see
Fig. 8). Bewick (e.g. 1809-1816; Fig. 7) renewed the
wood cuts (“Wood engraving”). In the second half of the
19th century the first photographs appeared (see Niekisch,
2010; Fig. 9 hoc loco) and revolutionised the book-illus-
tration also in natural science and herpetology together
with new letterpress printing techniques. These technical
advances were attended by the expansion of some zoo-
logical / herpetological disciplines — or facilitated their
proliferation — like ethology, husbandry, ecology.
It is noteworthy to emphasize that each of the engraving-
and printing techniques displays its technical, artistic and
economical strengths and weaknesses as measured by the
different requirements they have to satisfy (see Schmidtler,
2007). Book illustrations were always expensive and this
was the most important reason why the informative val-
ue of many important works had to suffer immensely.
Greek Archipelago, S. Russia,
Constantinople, Asia Minor,
3.2 Naturalistic figures
As was explained above, the lack of species recognition
was especially responsible for rendering many figures use-
less in representing distinctive characters. This was espe-
cially the case for many of the reptiles, being regarded as
abhorrent or less important (except the venomous snakes),
compared to mammals or birds — up to the Linnean times
and later.
A good example is Gessner’s fabulous creature (Fig. 1),
called “‘Lacertus viridis”, and typically attended with a po-
em advertising a medical and cosmetic prescription. It is
only the indentations across the tail which suggests the
possible belonging to the current Lacertidae.
Shortly before Linnaeus, the “Thesaurus” of the wealthy
pharmacist Seba (1735) described many exotic animals
from Seba’s “Wunderkammer”. This voluminous work de-
picted also many mythical creatures — besides some in-
digenous reptiles, e.g. the male of a “Lacerta viridis” (=
Lacerta agilis), being identifiable only by means of the
distinctive dorsal pattern and the green and brown
colours (see Schmidtler, 2004: Abb. 1).
i
8 rudss Spanish Peninsula, Baleares,
c mays OA ftaly with Corsica & Malia. i
a portschinskit | dofilippii PaaeecosecocOsoass Sc aE ie ae ee Sei SEAS Dh eanleay RSE
= | ‘ i
Se | saxicola ' ' H
o-2 5 ot “ ' <]
q = 1 horvathi | bedriage sardoa ' hispanica — monticola t >
er , : (South Hungary) ' ES
3 chalybdea . caitcasica ; t =
<= 1 ee
ee Ss
erhard; | siliguerta wa
| ' ea
teroclvphi } ' \
hieroglyphica } : g
ares ee aces toca oe lee Soh = || insulanica nigriveniris _filfolensss a lilfordi =
| is He ky ;
a 6 H | quadrilineata 1 pityusensis | 2
a 3S ’ : j i ;
oe = | | i. brveggemanni AS ees hiolepis bocavii vaucheri ' =
ee 4 S :
2
2 ES ae
a CP TSR SROs Soca dee see Orne! SEE apa oe eeSoeer nets F Si
3 be serpa eee
wt @ = sateoncese 4
Zi 5
8 } typicg N
» : R
ui Easi Coast & Islainds of the Adriatic, be
Seeds event (31hl laatier | Li (iran?) 9) Sie? @igss-ssee+ La eee ante on RR rp NRE SUE EEA Bote a
> er er er brev ceps S
oe
is
campestris _ fimane pe —— tieliselle:
Fig. 19.
From Boulenger (1913: 205-206): Linear diagram of the forms of Lacerta muralis: Citation: “The preceding diagram
expresses their affinities, as I conceive them, and also their distribution. It will also enable the reader to see at a glance how my
views on the possible derivation of these forms differ from those advocated by Prof. Méhely.” The “varieties” of Boulenger’s on-
ly species “Lacerta muralis” comprise four current genera (Podarcis, Darevskia, Iberolacerta, Archaeolacerta) with at least 17
current species and some more subspecies.
Bonn zoological Bulletin 57 (2): 307-328
©ZFMK
324
B oe perenne GOMotia galloti
Psammodromus algirus
= Omanosaura jayakari
100 ke eran _— === Omanosaura cyanura
68/51 |
#797 i y
AW cota Re : = Lacerta agilis
0.05 subs./site _
Fig. 20.
0 Podarcis muralis
————— aoe SCelorcis perspicillata
Teira dugesii
=== Timon princeps
== Timon lepidus
100 beens TION pater
Josef Friedrich Schmidtler
Gallotiinae
Eremiadini
ees Lakydromus sexlineatus
> Archaeolacerta bedriagae
Zootoca vivipara
Podarcis taurica
dUpHyAIVy]
1938]
IBUIGAIIV'T
aI
Phoenicolacerta laevis gem. nov.
= Iberolacerta bonnali
Iberolacerta horvathi
Dalmatolacerta oxycephala gen. nov.
——==- Apathya cappadocica
Hellenolacerta graeca gen. nov.
Anatololacerta danfordi gen. nov.
Parvilacerta fraasii gen. nov.
Algyroides marchi
Franolacerta brandtii gen. nov.
Darevskia chiorogaster
— Darevskia saxicola
From Arnold et al. (2007: Fig. 1B): The most actual phylogenetic tree of the Lacertidae comprising in detail the tribe
Lacertini (among them Lacerta and the new genera Phoenicolacerta, Dalmatolacerta, Hellenolacerta, Anatololacerta, Iranolacer-
ta), having been broken up from it). The relationships are indicated by DNA sequences (ML tree from a reanalysis of the mt DNA
data set of Harris et al. (1998) based on cytochrome b, 12 S RNA and 16 S RNA). Different probability values resulting from Baye-
sian analysis are indicated.
The changes in scientific insight are visible by the differ-
ences of the earlier drafts and the final hand coloured en-
graving in Roésel v. Rosenhof’s (1758) famous frontispiece
(see Fig. 4).
Garsault (1764: pl. 688; fig. 5 hoc loco), a forerunner of
Laurenti (1768), and a splitter like him (Chapter 2), moved
an almost correct drawing of lacertids forward. In contrast
to this figure, Laurenti’s (1768: Tab.I, Fig.IID) Seps
caerulescens (= Lacerta agilis) has accomplished perfec-
tion for the first time in the history of a lacertid drawing.
Laurenti’s (1768) image remained unique for some
decades. Even the excellently hand coloured copper en-
Bonn zoological Bulletin 57 (2): 307-328
gravings of male and female specimens of Lacerta agilis
in Wolf in Sturm (1799) and Bechstein (1800) display
some deficiencies in pileus scutellation (cf. also
Schmidtler 2004). The black / white and coloured engrav-
ings in Daudin (1802) are comparably of a very different
quality. The colours of his excellently drawn shape of L.
ocellata (1802: pl. XX XIII; without the blue ocellae) re-
veals that he did not see a live specimen. But the shape
of the adult male is to the point. In Daudin (1801—1803),
part of the so called Sonnini edition, for the first time the
progressive but extremely expensive technique of colour
printing was used in herpetology (see Schmidtler 2007).
©ZFMK
Taxonomic history of the genus Lacerta 325
On the contrary, the hand coloured engravings in Sonni-
ni & Latreille (1801) are very small — and bad; likewise
the figures in the numerous popular editions of the French
natural histories, named “Buffon — Cuvier — Lacepéde’”’,
are out of the question. Their images were cribbed per-
manently and often lost their quality step-by-step up to an
unrecognisable condition.
In the second half of the 19th century research on colours
and patterns, the biological reasons and causes of their
adaptation, became important for the evaluation of infra-
specific variation and biology in general (Eimer, 1881: Taf.
XHI-XV). Subsequently, many subspecies, especially
within the current genus Podarcis (then mostly “Lacerta
lilfordi, Lacerta melisellensis, Lacerta muralis, Lacerta
sicula”), were based upon minute differences in scale
counts, colouration and pattern (see Mertens & Wermuth
1960). As a result of the genetic revolution in the last years
the importance of naturalistic figures in lacertid system-
atics is on the decline. At the same time top-quality pho-
tos (Fig. 10) have gained in importance especially in pop-
ular vivaristic publications.
3.3 Schematic figures
The abstraction of systematically important features, be-
ing more or less hidden to the unprejudiced observer, is
a condition for successful species recognition. The first
noteworthy attempts towards a schematisation of zoolog-
ical / herpetological features were displayed by Linnaeus
in his earlier editions of the “Systema Naturae” (Fig. 11).
It is above all the scale counts of ventrals and subcaudals
in snakes which are explained in his table III (Linnaeus
1756). Only these scale counts are given in the diagnoses
of snakes (see also Linnaeus 1758 and 1766).
The decisive step forward in lizards was made by Mer-
rem (1820). Based upon his similar system in snakes (Mer-
rem 1790, 1820; see Schmidtler 2006) he gave names to
the pileus shields of an adult Lacerta ocellata (now: Ti-
mon lepidus; see his page XI and XII) and depicted their
abbreviations in this figure. This description (see Fig. 12)
covered seven types of scutes with the letters A
(Wirbelschilder — Scuta vertebralia), B (Hinter-
hauptschilder — Scuta occipitalia), C (Augenbrauen-
schilder — Scuta superciliaria), E (Stirnschilder — Scuta
frontalia posterioria), F (Schnautzenschilder — Scuta
frontalia anterioria), G (Rtisselschild — Scutum rostrale,
L (Nasenlécherschilder— Scuta nasalia). This system was
later on differentiated and improved by Milne Edwards
(1829: pls. 5-8) who depicted and described also the
shields of the lower sides of head, body and limbs. The
concept of Merrem (1820) and Milne Edwards is valid up
to now.
Bonn zoological Bulletin 57 (2): 307-328
In the middle of the 19 century important osteological
investigations also were executed in lacertids. They al-
lowed taxonomic research in the higher categories but al-
so within lacertid genera and species, after a reasonable
schematization in osteology, above all in skull terminol-
ogy, had been found (Fig. 13 from Méhely). They brought
about the famous and interminable controversy of L. v.
Mehely (“splitter”) and G.A. Boulenger (“lumper’’) on the
then intractable “Muralis-Frage” (see Méhely 1909;
Boulenger 1920; among others).
It was the research since the middle of the 18" century
which revealed the crucial importance of the dorsal pat-
tern especially in the specific and infraspecific taxonomy
of the current genus Podarcis. Eimer (1881: Taf. XIH; Fig.
14 hoc loco) named the different longitudinal zones (“I
bis VI erste bis sechste Zone”) which usually exhibit a sys-
tem of n narrow longitudinal light streaks (nrs. I and III,
“Grenzlinien”’) and dark bands (nrs. II,” inneres / 4uBeres
Band”). Méhely (1909: Fig. 1) eased his terminology and
gave it the presently valid content. The seven light streaks
and dark bands were named after their initial points at the
pileus shields (like “Supraciliarstreifen” and “‘Occipita-
band”’); see also Schreiber (1912: Fig. 68; p. 333-335) and
Mertens (1915: Fig. 3).
Admittedly, morphological schemata (scutellation, dorsal
pattern) like these have lost their crucial taxonomic im-
portance in the 19th and 20‘ centuries during the last two
decades because of the reasons given above (see Section
252)
3.4 Diagrams
Semi-verbal depictions known in many different shapes
(concerning biology as a whole) are book illustrations in
broader terms. Contrary to naturalistic figures or the
schemata discussed above, phylogenetical trees, based up-
on genetic research, have become indispensable parts of
comprehensive taxonomic work in the last years (Fig. 20).
In many analyses the genetic distances currently have to-
tally replaced the traditional taxonomic decisions based
upon morphology and reproduction biology — be it ap-
propiate or not.
Tree-like diagrams, comprising also reptiles, trace back
to Ray (1693) (see Fig. 15). They have an enormous im-
portance in the history of general biology, not only in
lizards. In the field of herpetology, lizards included, they
became common practice since the basic works of Duméril
(1806) and Oppel (1811; Fig. 16 hoc loco; see also
Schmidtler 2009) and Cuvier in Cloquet (1819). Strange
to say, it was not clear in those pre-evolutionary times, if
the trees should represent identification keys only, or if
©OZFMK
326 Josef Friedrich Schmidtler
they should depict relationships (too) when illustrating the
Linnean hierarchical system by diagrams. Gould (2003:
105) explained the secret of the then triumph of the Lin-
nean categories (from species to class) being nested into
one another, by the circumstance that this system later on
was capable of being converted into a phylogenetic inter-
pretation (see also Schmidtler 2009: 500, Figs 7a—d).
The subsequent diagrams are not yet phylogenetic trees
in a strict sense; especially the one by Kaup (see Fig. 17),
who was a follower of the fanciful “natural philosophy”.
Similar is the quality of Camerano’s diagram (Fig. 18 hoc
loco) with its differently sized circles including the phe-
nomenon of resemblances due to morphology.
Acknowledgements. I thank Kraig Adler who reviewed the ab-
stract and Benno Schmidtler who drawed up Fig. 1.
REFERENCES
Alessandrini A & Ceregato A (eds.) (2007) Ulisse Aldrovandi
Natura Picta. Bologna, Compositori Editore
Arnold E N (1973) Relationships of the Palaearctic Lizards as-
signed to the Genera Lacerta, Algyroides and Psammodromus
(Reptilia: Lacertidae). Bulletin British Museum Natural His-
tory (Zool.) 25 (8): 291-366
Arnold E N (1989) Towards a phylogeny and biogeography of
the Lacertidae: relationships within an Old-World family of
lizards derived from morphology. Bulletin British Museum
Natural History (Zool.) 25 (8) 55 (2): 209 — 257
Arnold EN, Arribas O J & Carranza S (2007) Systematics of
the Palaearctic and Oriental lizards tribe Lacertini (Squama-
ta: Lacertidae, Lacertinae), with descriptions of eight new gen-
era. — Zootaxa 1430: 1-86
Arribas O (1997) Morfologia, filogenia y biogeogegrafia de las
lagartijas de alta Montana de los Pirineos.- Publicacions de
la Universitat Autonoma de Barcelona (Edicié microfotogra-
fica). Bellaterra
Arribas O (1999) Phylogeny and Relationships of the Mountain
Lizards of Europe and Near East (Archaeolacerta Mertens,
1921, sensu lato) and their Relationships among the Eurasian
Lacertid Radiation. Russian Journal Herpetology 6 (1): 1-22
Bedriaga J v. (1886) Beitrage zur Kenntnis der Lacertiden-Fa-
milie (Lacerta, Algiroides, Tropidosaura, Zerzumia und Bet-
taia). Abhandlungen. Senckenberg. Naturforschende Gesell-
schaft Frankfurt a.M. 14 (2): 17-444
Bewick T (1791): A General History of Quadrupeds. S. Hodg-
son & al., Newcastle upon Tyne (2. ed.).
Bewick T (1809-1819): A Natural History of British Quadru-
peds, Foreign Quadrupeds, British Birds, Water Birds, Foreign
Birds, Fishes, Reptiles, Serpents & Insects. Davison, Alnwick
(7 booklets)
Béhme W (1971) Uber das Stachelepithel am Hemipenis lacer-
tider Eidechsen und seine systematische Bedeutung. Zeitschrift
fiir Zoologische Systematik und Evolutionsforschung 9: 187—
223
Bohme W (ed.) (1981) Handbuch der Reptilien und Amphibien
Europas. Band | Echsen (Sauria) I, 2.1.7. Lacertidae — Ech-
Bonn zoological Bulletin 57 (2): 307-328
te Eidechsen, p. 373-375. Akademische Verlagsgesellschaft,
Wiesbaden
Bory de Saint-Vincent JBMG (1826) Lézard. Lacerta Rept. Saur.
In: Bory (ed.): Dictionnaire classique d’ Histoire Naturelle, vol.
9. Rey et Gravier, Paris
Bory de Saint-Vincent JBMG (1828) Précis d’herpétologie ou
histoire naturelle des reptiles. Complété par une iconogra-
phie des reptiles. Encyclopédie Portative
Boulenger GA (1887) Catalogue of the Lizards in the British mu-
seum (Natural history). Vol. IM. Lacertidae, Gerrhosauridae,
Scincidae, Anelytropidae, Diabamidae, Chamaeleontidae,
2nd ed., vol 3. Trustees British Museum XII
Boulenger GA (1905): A Contribution to our Knowledge of the
Varieties of the Wall-Lizard (Lacerta muralis) in Western Eu-
rope and North Africa. Transactions Zoological Society Lon-
don XVII (4): 351-424
Boulenger GA (1909) Description of a new Species of Lacerta
from Persia. Proceedings Zoolical Society London, 1908:
934-936
Boulenger GA (1913) III. Second contribution to our Knowledge
of the varieties of the Wall-Lizard (Lacerta muralis). Trans-
actions Zoological Society London XX (3): 135-230
Boulenger GA (1920/1921) Monograph of the Lacertidae, vol.
1/2. Trustees British Museum, London, England. X, 352 /
X-II, 451 pp.
Bose d’Antic LAG (1817) Lézard, Lacerta; tome 17, p.
521-528. In: Nouveau dictionnaire d’ Histoire Naturelle. Dé-
terville Paris
Camerano L (1877) Considerazioni sul genere Lacerta Linn. e
descrizione di due nuove specie. Estratto dagli Atti R. Aca-
dademia. Scienze. Torino, XIII
Cloquet H (1819) Erpétologie, (p. 217-259). In: Cuvier & Le-
vrault (ed.): Dictionnaire des Sciences Naturelles. Tome Quin-
zieme. Strasbourg
Cocteau T (1835) Sur un genre peu connu de Lézards vivipares
(Zootoca, Wagler), et sur une nouvelle espéce de ce genre. Re-
vue et Magazin de Zoologie
Cuvier G (1819) Table Synoptique de la Méthode erpé-
tologique. In: Cloquet, H. (1819): Erpétologie (p. 217-259).
In: Cuvier & Levrault (eds.): Dictionnaire des Sciences Na-
turelles. Tome Quinziéme. Strasbourg
Dance P (1981) The Art of Natural History. Bracken Books, Lon-
don
Darevsky, I.S. (1967): Skalniye yashtsheritsy Kavkaza. Lenin-
grad, Akademii Nauk
Daudin FM (1802) Histoire Naturelle, Générale et Particuliére
des Reptiles, tome troisiéme. Paris, Dufart
David P, Dubois A, Smith HM (2002) A Corrective Note on the
Authorship of Taxa Credited to Lacepéde and Bonnaterre in
the Introduction to the SSAR’s Reprint of Shaw’s General Zo-
ology. Volume III. Amphibians and Reptiles, with remarks on
some of Lacepéde’s works. International Society History and
Bibliography of Herpetology. Newsletter and Bulletin 3 (2):
16-27
Dawkins R (2008) Geschichten vom Ursprung des Lebens. E1-
ne Zeitreise auf Darwins Spuren (engl.: The ancestor’s Tale.
London 2004). Ullstein, Berlin
Delfino M. (2007) Un piccolo tesoro per gli erpetologi, p.
103-105. In: Alessandrini, A & Ceregato A (eds.) (2007) Ulis-
se Aldrovandi — Natura Picta. Bologna, Compositori Editore.
Delfino M & Ceregato A (2008) Herpetological Iconography
in16‘h century: the Tempera Paintings of Ulisse Aldrovandi.
Bibliotheca Herpetologica, 7 (2): 4-12
©ZFMK
Taxonomic history of the genus Lacerta 327
Donndorf J.A. (1798): Zoologische Beytrage zur XIII. Ausgabe
des linneischen Natursystems. Dritter Band. Amphibien und
Fische. Leipzig, Weidmannsche Buchhandlung
Dubois A (1988) The genus in zoology: a contribution to the the-
ory of evolutionary systematics. Mémoires Muséum d’ Histoire
Naturelle, Zoologie 140: 11-122
Dubois A. (2010): The multiple meanings of ancient zoological
terms. Bionomina | (in press)
Dubois A & Bour R (2010) The nomenclatural status of the no-
mina of amphibians and reptiles created by Garsault (1764),
with an unexpected and elegant solution to an old nomencla-
tural problem regarding the genus Bufo (Amphibia, Anura).
Zootaxa 2447: 1-52
Duméril AMC (1806) Zoologie Analytique ou Méthode Natu-
relle de Classification des Animaux rendue plus facile 4 l'aide
de Tableaux Synoptiques. Allais, Paris
Duméril AMC & Bibron G (1839) Erpétologie Générale ou Hi-
stoire Naturelle compléte des Reptiles. Tome cinquiéme. Pa-
ris, Roret
Eimer T (1881) Untersuchungen tiber das Variiren der Mauerei-
dechse, ein Beitrag zur Theorie von der Entwicklung aus con-
stitutionellen Ursachen, sowie zum Darwinismus. Archiv fiir
Naturgeschichte, Berlin, 47: 239-517
Fitzinger LI (1826) Neue Classification der Reptilien nach ih-
ren natiirlichen Verwandtschaften. J.G. Heubner, Wien
Fitzinger LI (1843) Systema Reptilium. Fasciculus primus Am-
blyglossae. Vindobonae (Wien), Braumiller et Seidel
Garsault FAP de (1764) Les figures des plantes et animaux
d’usage en médécine, décrits dans la matiére médicale de Mr.
Geoffroy médecin, dessinés d’aprés nature par Mr. de Garsault.
(Tome V): (3), pls. 644-729. Paris, chez l’auteur
Gessner K (“1662”, correct: 1671) De serpentibus. Oder
Schlangenbuch. Das ist eine griindliche und vollkommene Be-
schreibung aller Schlangen, so im Meer, siissen Wassern, und
auff Erden ihre Wohnung haben: sampt derselben eigentlichen
Abbildung. Erstlich durch den hochgelehrten und weitberithm-
ten D. Conrad Gefiner zusammen getragen. Und hernacher
durch den wolgelehrten Herrn Jacobum Carronum vermehrt,
und in diese Ordnung gebracht: Anitzo aber mit sonderem
Fleif} verteutschet. Franckfurt am Mayn (Wilhelm Serlin)
Gmelin JF (1789): Caroli a Linné Systema naturae per regna tria
naturae. Tom. I., pars III. Georg Emanuel Beer, Lipsiae, p.
1033-1516
Gould SJ (2003) Die Ltigensteine von Marrakesch. Vorletzte
Erkundungen der Naturgeschichte (engl. The Lying Stones of
Marrakech, 2003). S. Fischer, Frankfurt a. M.
Gray JE (1845) Catalogue of theSpecimens of Lizards in the Col-
lection of the British Museum. Trustees, London, XVIII
Harper F (1940) Some works of Bartram, Daudin, Latreille, and
Sonnini, and their Bearing upon North American Herpetolog-
ical Nomenclature. American Midland Naturalist. An Interna-
tional Journal of Ecology, Evolution, and the Environment.
University of Notre Dame Press, Notre Dame 23(3): 692-723
Harris DJ, Arnold EN, Thomas RH (1998) Relationships of la-
certid lizards (Reptilia: Lacertidae) estimated from mitochon-
drial DNA sequences and morphology. Proceedings Royal So-
ciety London B (1998): 1939-1948
Jahn I (ed.) (2000) Geschichte der Biologie. Theorien, Metho-
den, Institutionen, Kurzbiografien. 3., neu bearbeitete Aufla-
ge. Nikol Verlagsgesellschaft, Hamburg
Joger U (1996) Molekularbiologische Methoden in der phylo-
genetischen Rekonstruktion. Zoologische Beitrage, NF., 37:
77-131
Kaup JJ (1836) Das Thierreich in seinen Hauptformen systema-
tisch beschrieben. Zweiter Band. Naturgeschichte der Vogel.
Bonn zoological Bulletin 57 (2): 307-328
Zweiter Band. Zweiter Theil. Naturgeschichte der Amphibien.
Darmstadt, Johann Philipp Diehl
Koch CL (1828) Seps stellatus. Schr. Rothriickige Eidechse / 7ri-
ton alpestris. Laur. Brunnen-Triton (5 / 4p. + 3 / 4 pls). In: J
Sturm (ed.) Deutschlands Fauna in Abbildungen nach der Na-
tur mit Beschreibungen. Dritte Abtheilung. Die Amphibien.
4. Heft
Kuzmin SL (2005) Comments (to: Laurenti J.N. (1768): Speci-
men medicum, exhibens Synopsin Reptilium. Trattnern, Vien-
nae. Suppl. Zeitschrift fiir Feldherpetologie 7, Bielefeld, p.
237-247
Lacepéde BGE (1788) Histoire Naturelle des Quadupédes Ovi-
pares et des Serpens. Tome premier. Hotel de Thou, Paris
Laurenti, J.N. (1768): Specimen medicum, exhibens Synopsin
Reptilium. Trattnern (Viennae)
Linnaeus C (1756) Systema Naturae sistens regna tria naturae.
Accedunt vocabula Gallica. Editio multo auctior & emenda-
tior. Lugduni Batavorum, apud Theodorum Haak
Linnaeus C (1758) Systema Naturae per regna tria naturae, to-
mus I, editio decima, reformata. Holmiae, Laurentii Salvii.
Linné (Linnaeus), C a (1766) Systema Naturae per regna tria na-
turae, tomus I, editio duodecima, reformata. Holmiae, Lau-
rentil Salvi
Mayer W & Bischoff W (1996) Beitrage zur taxonomischen Re-
vision der Gattung Lacerta (Reptilia: Lacertidae), Teil I: Zooto-
ca, Omanosaura, Timon und Teira als eigenstandige Gattun-
gen. Salamandra, 32 (3): 163-170
Mayr E, Linsley EG, Usinger RL (1953) Methods and Princi-
ples of Zoology. Mc Graw-Hill, New York, Toronto, London
Mayr E (1984) Die Entwicklung der biologischen Gedankenwelt.
Vielfalt, Evolution und Vererbung (engl. The Growth of Bi-
ological Thought), Springer, Berlin, Heidelberg, New York,
Tokyo
Meéhely L v. (1909) Materialien zu einer Systematik und Phy-
logenie der muralis-ahnlichen Lacerten. Annales Musei Na-
tionalis Hungarici, VII: 409-621
Merrem B (1790) Beytraege zur Geshichte [sic!] der Amphibien.
Erstes Heft. Meyersche Buchhandlung, Duisburg, Lemgo
Merrem B (1820) Versuch eines Systems der Amphibien. Ten-
tamen Systematis Amphibiorum. Marburg, J. Ch. Krieger.
Mertens R (1915) Studien zur Systematik der Lacertiden. I. Teil
Untersuhungen tiber die Variabilitat der italienischen Mauerei-
dechsen (Lacerta muralis Laur. und Lacerta serpa Raf.). In-
augural-Dissertation, Leipzig
Mertens R (1973) Leopold Fitzinger: His Life and Herpetolo-
gical Work (Introduction to Fitzinger’s Systema Reptilium).-
Society for the Study of Amphibians and Reptiles. Misc. Pu-
blications. Facsimile Reprints in Herpetology
Mertens R & Miller L (1928) Liste der Amphibien und Repti-
lien Europas. Abhandlungen der Senckenbergischen Naturfor-
schenden Gesellschaft 41 (1): 1-62
Mertens R & Miiller L (1940) Liste der Amphibien und Repti-
lien Europas (Zweite Liste, nach dem Stand vom 1. Januar
1940). Abhandlungen der Senckenbergischen Naturforschen-
den Gesellschaft 451: 1-56
Mertens R & Wermuth H (1960) Liste der Amphibien und Rep-
tilien Europas (Dritte Liste, nach dem Stand vom 1.Januar
1960). Waldemar Kramer, Frankfurt a. M.
Meunier V (1836) Lézard, Lacerta. (Rep.), p. 401-412. In: Gue-
rin F-E (ed.): Dictionnaire Pittoresque d’ Histoire Naturelle et
des Phénoménes de la Nature. Tome Quatriéme. Bureau de
Souscription, Paris
Milne Edwards MH (1829) Recherches zoologiques pour ser-
vir a histoire des Lézards, extraites d’une Monographie de
ce genre. Annales Sciences Naturelles, Paris 16: 50-89
©ZFMK
328 Josef Friedrich Schmidtler
Muller, GH (1994) Zur Kontroverse zwischen Theodor Eimer
und Jacques von Bedriaga tiber die Farbung mediterraner Ei-
dechsen.- Aufsatze u. Reden Senck.naturf. Ges. 41: 101-116
Niekisch M (2010) Very early photographs of Reptiles. Herpe-
tological Rev. 51 (1): 50-51
Nissen C (1978) Die zoologische Buchillustration. Ihre Biblio-
graphie und Geschichte. Band I: Geschichte. Anton Hierse-
mann, Stuttgart
Oppel M (1811) Die Ordnungen, Familien und Gattungen der
Reptilien als Prodrom einer Naturgeschichte derselben. Joseph
Lindauer, Mtinchen
Razoumowsky G de (1789) Histoire Naturelle du Jorat et de ce
ses environs, tome premier. Lausanne, Jean Mourier
Ray (Raius) J (1693) Synopsis Methodica Animalium Quadru-
pedum et Serpentini Generis. Londini, Impensis S. Smith &
B. Walford
Rosel von Rosenhof AJ (1758) Historia Naturalis Ranarum No-
stratium. Die natiirliche Historie der Frésche hiesigen Landes.
Johann Jakob Fleischmann, Nirnberg
Scheller IJG (1796) Lateinisch-deutsches und deutsch-lateini-
sches Handlexicon vornehmlich ftir Schulen. Erster oder la-
teinisch-deutscher Theil. Leipzig, Caspar Fritsch
Schmid K (1819) Naturhistorische Beschreibung der Amphibien.
Lithographische Kunstanstalt, Minchen
Schmidtler JF (2004) Uber die Entwicklung der bildlichen Dar-
stellung bei der Zauneidechse (Lacerta agilis L.) im 18. und
19. Jahrhundert. Die Eidechse, 15 (3): 79-90
Schmidtler JF (2006) Blasius Merrems Beytraege zur Geschich-
te der Amphibien — eine neue Ara in der in der Methodik der
Schlangen-Darstellung. Sekretar. Beitrage zur Literatur und
Geschichte der Herpetologie und Terrarienkunde, Rheinbach,
6 (2): 45-60
Schmidtler JF (2007) Frihe Drucktechniken der zoologischen
und insbesondere herpetologischen Buchillustration (Bewicks
Holzstiche — Inkunabeln der Lithografie — Sonninis Buntkup-
ferdrucke). Sekretar. Beitrage zur Literatur und Geschichte der
Herpetologie und Terrarienkunde, Rheinbach, 7 (2): 16-38
Schmidtler JF (2009) Der ,, Thiermahler“ Nikolaus Michael Op-
pel (1782-1820) und die Anfange der herpetologischen For-
schung an der Bayerischen Akademie der Wissenschaften.
Zeitschrift ftir bayerische Landesgeschichte, Mtinchen 72 (2):
483-512
Schmidtler JF (2010) 50 years with herpetology and herpetolo-
gists in Turkey and the Near East. Cewe Fotobuch, Miinchen
Schmidtler JF & Bohme W (in prep. / press): The synonymy and
nomenclatural history of the Viviparous Lizard — now Zooto-
ca vivipara (Lichtenstein, 1823)
Schneider JG (1799) Historiae Amphibiorum naturalis et liter-
ariae Fasciculus Primus continens Ranas Calamitas, Bufones,
Salamandras et Hydros in genera et species decriptos notisque
suis distinctos. Jenae, Friederici Frommanni
Schneider JG (1801) Historiae Amphibiorum naturalis et litera-
riae Fasciculus Secundus continens Crocodilos, Scincos, Cha-
maesauas, Boas, Pseudoboas, Elapes, Angues, Amphisbaenas,
et Caecilias. Jenae, Friederici Frommanni
Schrank Fv.P (1785) Zwanzigster Brief. Thiere in Berchtesga-
den, p. 296-316. In: Schrank Fv.P & Moll E Ritter v.: Natur-
historische Briefe ttber Oesterreich, Salzburg, Passau und
Berchtesgaden.- Salzburg, Joh. Jos. Mayers seel. Erbinn
Bonn zoological Bulletin 57 (2): 307-328
Schrank Fv.P (1798) Durchgedachte Geschichte der in Baiern
einheimischen und zahmen Thiere. Erster Band. Nurnberg,
Stein’sche Buchhandlung
Schreiber E (1912) Herpetologia Europaea, 2. Aufl. Fischer, Je-
na, 960 S
Shaw G (1802) General Zoology or Systematic Natural Histo-
ry Volume II, Part I. Amphibia. London, G. Kearsley
Siebenrock F (1894) Das Skelet der Lacerta simonyi Steind. Und
der Lacertidenfamilie tiberhaupt. Sitzungsberichte Akad.
Wiss. CI
Smith HM & David P (1999) Introduction. George Shaw and
the Herpetology Volume in His Series, General Zoology. So-
ciety for the Study of Amphibians and Reptiles
Speybroeck J, Beukema W, Crochet P-A (2010) A tentative spe-
cies list of the European herpetofauna (Amphibia and Repti-
lia) — an update. Zootaxa 2492: 1-27
Spix JB (1811) Geschichte und Beurtheilung aller Systeme in
der Zoologie nach ihrer Entwiklungsfolge von Aristoteles bis
auf die gegenwartige Zeit. Schrag’sche Buchhandlung, Nirn-
berg
Valmont de Bomare JC (1767/68) Dictionnaire raisonné univer-
sel d’histoire naturelle contenant |’histoire des animaux, des
végéetaux et de minéraux. Paris, Lacombe, 6 vols
Wagler J (1830) Natiirliches System der Amphibien, mit vor-
angehender Classification der Saugethiere und V6gel.
Miinchen, Stuttgart und Tubingen, J.G. Cotta’sche Buchhand-
lung
Welter-Schultes FW, Klug R, Lutze A (2008) Les ?gures des
plantes et animaux d’usage en médecine, a rare work pub-
lished by F. A. P. de Garsault in 1764. Archives of natural His-
tory, 35(1), 118-127
Welter-Schultes FW & Klug R (2009) Nomenclatural conse-
quences resulting from the rediscovery of Les figures des plan-
tes et animaux d’usage en médecine, a rare work published
by Garsault in 1764, in the zoological literature. Bulletin of
zoological Nomenclature 66 (3): 225-241
Wermuth H (1981) Zum Geleit II (8-11). In: W. Bohme (ed.):
Handbuch der Reptilien und Amphibien Europas. Band 1 Ech-
sen (Sauria) I. Akademische Verlagsgesellschaft, Wiesbaden
Wolf J (1799) Lacerta agilis L. Kleinéugige Eidechse. Gemei-
ne Eidechse (10 p., unpag. + 2 pls.) / Lacerta salamandra L.
Gemeiner Molch. (12 p., unpag. + 2 pls.). In: J Sturm (ed.):
Deutschlands Fauna in Abbildungen nach der Natur mit Be-
schreibungen. Dritte Abtheilung. Die Amphibien. 2. Heft
Wolf J (1802) Lacerta palustris L. Der Wassersalamander / La-
certa taeniata Schneid. Der Teichsalamander. (14/10 p., un-
pag. + 2/2 p.). In: J Sturm (ed.): Deutschlands Fauna in Ab-
bildungen nach der Natur mit Beschreibungen. Dritte Abthei-
lung. Die Amphibien. 3. Heft
Wolf J (1805) Lacerta nigra Mihi. Die schwarze Eidechse (2 p.,
unpaginiert + 1 Tafel) / Lacerta crocea Mihi. Die gelbe Ei-
dechse (3 p., unpaginiert + 3 Tafeln). In: J Sturm (ed.):
Deutschlands Fauna in Abbildungen nach der Natur mit
Beschreibungen. Dritte Abtheilung. Die Amphibien. 4. Heft
Received: 20. VII.2010
Accepted: 20.[X.2010
©ZFMK
Bonn zoological Bulletin | Volume 57 | Issue 2 | pp. 329-345
Bonn, November 2010
A brief history of Greek herpetology
Panayiotis Pafilis !.2
'Section of Zoology and Marine Biology, Department of Biology, University of Athens, Panepistimioupolis,
Ilissia 157—84, Athens, Greece
2School of Natural Resources & Environment, Dana Building, 430 E. University, University of Michigan,
Ann Arbor, MI — 48109, USA; E-mail: [email protected]; [email protected]
Abstract. The development of Herpetology in Greece is examined in this paper. After a brief look at the first reports on
amphibians and reptiles from antiquity, a short presentation of their deep impact on classical Greek civilization but also
on present day traditions is attempted. The main part of the study is dedicated to the presentation of the major herpetol-
ogists that studied Greek herpetofauna during the last two centuries through a division into Schools according to researchers’
origin. Trends in herpetological research and changes in the anthropogeography of herpetologists are also discussed. Last-
ly the future tasks of Greek herpetology are presented.
Climate, geological history, geographic position and the long human presence in the area are responsible for shaping the
particular features of Greek herpetofauna. Around 15% of the Greek herpetofauna comprises endemic species while 16%
represent the only European populations in their range.
THE STUDY OF REPTILES AND AMPHIBIANS IN
ANTIQUITY
Greeks from quite early started to describe the natural en-
vironment. At the time biological sciences were consid-
ered part of philosophical studies hence it was perfectly
natural for a philosopher such as Democritus to contem-
plate “on the Nature of Man” or to write books like the
“Causes concerned with Animals” (for a presentation of
Democritus’ work on nature see Guthrie 1996). The very
name of the discipline of herpetology derives from the
Greek words epzeto (reptile) and Adyog (science) while the
term amphibian reflects the typical dual (aquatic and ter-
restrial) life style of frogs (from the Greek augi — both—
and Biog — life).
The first formal Greek herpetologist was Aristotle
himself. In his books on animals (History of Animals,
Generation of Animals and On the Parts of Animals) the
father of zoology discussed the morphology, physiology
and classification of reptiles and amphibians. Nicander
was fascinated by the lethal power of snakes, focusing on
the venom of serpents in two of his surviving poems
(Theriaca, Alexipharmaca, see Knoefel & Covi 1991).
In late antiquity Pausanias, though he wasn’t a naturalist,
gave interesting information on the fauna and flora in
various locations in Greece through the ten books of his
notorious Description of Greece (EAAddoc¢ TMeptuiyots).
Bonn zoological Builetin 57 (2): 329-345
Therein one could find citations to the Greek herpetofauna
such as the Seriphian frogs or the tortoises of Arcadia.
REPTILES AND AMPHIBIANS IN GREEK
CULTURE
Snake venom and the ability for ecdysis had deeply im-
pressed ancient Greeks who incorporated reptiles in many
of their myths. Snakes were considered magical creatures,
capable of both good and evil, and were associated with
chthonic religious beliefs. In Minoan Crete snakes repre-
sented the underworld deities and were worshiped. Tens
of statuettes depicting the Goddess of Snakes have been
found in excavations all around the island. Ophion (from
the Greek ophis — oqis meaning serpent), one of the
mighty Titans, was the first ruler of Mount Olympus be-
fore he was cast down by Cronus and Rhea. According to
legend the first king of Athens, Kekrops, was half-snake
half-man (Supvng meaning double nature) and thanks to his
wisdom he decided to offer his city (known as Kekropeia
at the time which afterwards changed to Athens to honor
the patron goddess) to Athina instead of Poseidon when
the two immortals were fighting over its possession. On
the other hand Medusa (or Gorgon) the mythical monster
that had snakes instead of hair, could turn anyone who
©ZFMK
330 Panayiotis Pafilis
looked at her into stone. Perseus, using his shield as mir-
ror, made Medusa look at herself and then decapitated her.
He then offered her head to Athina who put it on her own
shield (known as gorgoneion) so as to petrify her enemies.
A serpent-like dragon, Python, was sent by Hera after
Leto, mother of Apollo and Artemis, to punish her for hav-
ing an affair with Zeus. Young Apollo took revenge for
his mother by killing Python at Delphi, where the serpent
dwelled. Since then the priestess of the oracle was named
Pythia. The etymology of the name derives from the verb
pythein (mbevv, “to rot”), referred to Python’s flesh in the
state of decomposition. The priest of Poseidon Laocoon
warned the Trojans about the Trojan Horse and tried to
convince them to burn it. Athina, who was supporting the
Greek army during the War of Troy, sent two snakes to
strangle and kill Laocoon together with his sons.
Greeks were aware not only of the lethal power of ven-
om but also of its healing properties. In the statues of
Hygeia, the goddess of health (the meaning of the word
in Greek), a snake is lying on her shoulders. Aesculapius,
the god of medicine and son of Apollo, was carrying al-
ways his famous rod, a snake-entwined staff (the species
was Zamenis longissimus). In his most magnificent tem-
ple in Epidaurus, that used to function as a hospital, a
strange construction known as tholos (dome) was erect-
ed. Patients spent the night inside tholos together with tens
of snakes that were believed to heal them. Two small
snakes were coiled around Hermes wand, symbolizing the
wisdom with which he spoke, since he was considered,
together with Athina, god of eloquence.
A fascinating story about the symbolic role of reptiles in
antiquity comes from the island of Aegina. During the pe-
riod of Aegina’s naval acme (6 century B.C.) the is-
landers coined silver staters depicting the sea turtle Caret-
ta caretta. However a terrapin (Zestudo sp.) replaced the
sea turtle when the neighboring Athens inaugurated its
long period of thalassocracy in Greek seas (after 480
B.C.):
Due to the arid climate Greeks were more familiar with
reptiles than amphibians. Thus only few references are
known from antiquity, like the Aristophanes’ comedy
“Frogs” (Batpayot) or the silver stater that Seriphians
coined (ca 530 B.C.) to honor their local hero Perseus
since frogs were associated with his cult (Pausanias, 2nd
century A.D.). Frogs from Serifos Island were famous in
antiquity for not croaking (another story linked to Perseus
legend) and the expression “Seriphian frogs” was used as
a popular proverb during ancient times for people refus-
ing to talk.
With the prevalence of Christianity reptiles become the
personification of evil, starting from the Original Sin. Saint
Bonn zoological Bulletin 57 (2): 329-345
George and Saint Demetrius, the so called militant saints,
are depicted as dragon slayers, symbolizing the triumph
of Good, as expressed by the Greek-Orthodox Church,
over Evil, the former idolatry faith. The Serpentine col-
umn, dedicated by Greeks in 479 B.C. to Apollo’s altar
at Delphi to commemorate the victory over the Persians
at the battle of Plataea, was formed by three intertwined
snakes (Tpixdprnvoc Oguc), meaning three-headed snake).
Constantine the First moved the column to the Hippo-
drome of his new capital. However the people of Constan-
tinople destroyed the higher part of the column (the heads
of the snakes) since they thought it was the representa-
tion of the devil. On the other hand the Apostolic Fathers
recognizing the wisdom of snakes were advising the first
Christians to be “prudent as the serpent” (Ignatius of An-
tioch to Polycarp of Smyrna).
Traces of the ancient beliefs still echo in folklore and
traditions. The presence of geckoes in a house is
considered good fortune. In many households in Cyclades
people used to fill with milk a small cup for the “snake
of the house” (in Greek onitdgid0, Zamenis situlus). The
most amazing case though comes from the island of
Cephalonia where pagan creeds survive together with
christian rituals at the temple of Madonna of the Snakes
(Ilavayta yn gidovoa). According to the legend a
monastery stood at the very same place. When pirates
disembarked close to the spot and tried to conquer and
harry the treasures of the monastery, nuns prayed for help
and Virgin Mary sent snakes that surrounded the building
and scared away the pirates. Every year at August the 15th
(when Greek Orthodox Church celebrates the Dormition
of Holy Mary) locals collect cat snakes (Telescopus fallax)
days prior to the feast and put them by the icon of the
Virgin. Pilgrims touch these snakes and even let them coil
around their shoulders or hands since they believe that they
will protect them from sickness.
GEOGRAPHY, BIOGEOGRAPHY AND SPECIES
RICHNESS
Greece is one of the small European countries with a to-
tal area of around 132,000 km?. However its unique lo-
cation at the biogeographical crossroads of three conti-
nents, each making its distinct biological contribution,
makes the country an invaluable site for biodiversity
(Lymberakis & Poulakakis 2010). The rough geological
mosaic encompassing mountain chains that separate the
country into clearly distinct climatic zones and the large
number of islands (approximately 8000, most of them in
Aegean Sea) have a huge impact on the flora and the fau-
na (Hausdorf & Hennig 2004). Hundreds of endemic
species are hosted in both the mainland and the islands
highlighting the region as a hot spot of endemism.
©OZFMK
A brief history of Greek herpetology 331
The climate is typical Mediterranean with long, dry and
hot summers and mild winters (though in the north and
the mountainous parts of the country winter period could
be harsh). These conditions are ideal for reptiles, which
thrives in the hospitable Greek habitats but also support
various amphibian species and populations. Despite the
small size of the country, Greece is home to one of the
richest herpetofaunas of Europe hosting 64 species of rep-
tiles and 22 of amphibians. Ten of the reptilian species are
endemic and 11 maintain their only European populations
in Greece, whereas the respective figures for amphibians
are 3 and 2, respectively.
The majority of Greek reptiles and amphibians has
Palearctic origin and are common in most of Europe or
the Balkans (e.g. Natrix natrix or Bombina bombina).
However, Greece hosts also species of Asian (e.g. Mon-
tivipera xanthina, Lyciasalamandra luschani) or even
African (Chameleo africanus) origin. Definitely the most
interesting group is the one comprised of the endemic
species, the majority of which are islanders, such as Pelo-
phylax cerigensis, Podarcis levendis or Macrovipera
schweizeri.
The range and particularities of Greek reptiles and amphib-
lans are, in a considerable degree, the result of the recent
geology of the eastern Mediterranean Basin. During the
Messinian salinity crisis, the Mediterranean Sea underwent
long periods of desiccation that, in Aegean Sea, led to the
emergence of landmasses that become islands. The old-
est Greek islands (Crete, Skyros and Karpathos) remain
to this status even after the Zanclean flood. The Ice Age
periods during the Pleistocene with their consecutive
freezing and warming conditions had a strong impact on
the area, shaping glacial refugia that harbored many cold-
intolerant species, which afterwards reinvaded the rest of
the Balkans (e.g. Rana graeca). Many islands were con-
nected either to mainland Greece or Asia Minor as a con-
sequence of the low sea level during the last Ice Age pe-
riod. Nowadays the herpetofauna of these islands still re-
flects this geological incident with islands closer to Greece
having a clearly “European” composition (e.g. Evvoia,
Thassos), whereas those next to Asia Minor show a more
“Asian” character (e.g. Lesvos, Chios, Samos). This sep-
aration between European and Asian herpetofaunas 1s fur-
ther supported by the existence of a deep-water trench run-
ning over the Aegean Sea from southeast to northwest,
separating the eastern “Asian” cluster from the western
“European” one with only few exemptions. Another im-
portant geological factor is the intense volcanism of the
region. The Aegean volcanic arch, spanning the southern
part of the area, was formed during the Pliocene as a con-
sequence of the northward subduction of the African plate
beneath the Aegean one (Fytikas et al. 1984). Milos Arch-
ipelago, a small but extremely important in terms of en-
Bonn zoological Builetin 57 (2): 329-345
demism island group, was separated from the rest of the
Cyclades by middle Pleistocene as a result of volcanic ac-
tivity (Sondaar et al. 1986; Dermitzakis 1990).
In summary, most endemic species are concentrated to the
oldest islands where the long history of isolation provid-
ed the necessary conditions for speciation. The astonish-
ing variety of subspecies in the islands, for instance 19 for
Podarcis erhardii and 13 for Cyrtopodion kotshyi reflects
the importance of insularity in the evolution of different
morphs. In mainland Greece endemic species are located
in the southernmost part of the country, Peloponnese,
thanks to historical biogeographical reasons (glacial
refugia) matched by a fair period of isolation.
Last, but certainly not least, humans had a significant con-
tribution in shaping the Greek herpetofauna. In the Aegean
Sea navigation started quite early (around gth millenium
B.C., Kotsakis 1990; Simmons 1991). Voyagers carried
materials (e.g. marble or pottery) that offered an excellent
opportunity for transportation of small-bodied species or
their hidden eggs (typical examples are Hemidactylus tur-
cicus and Tarentola mauritanica and most probably Lau-
dakia stellio). In some other cases humans may deliber-
ately transport reptiles or amphibians related to religious
beliefs. Apart from dispersal, human activities favored rep-
tiles with the deforestation of the largest part of the coun-
try, providing opportunities for thermoregulation and for-
aging. Thousands of kilometers of dry-stone walls all
around the country, and especially in the Aegean islands,
offer ideal hiding places and support thriving populations.
On the other hand touristic development with its acces-
sory consequences (water over-pumping, wetland
drainage, habitat degradation), over grazing and intensive
agriculture has largely altered the landscape, influencing
negatively upon reptiles and, mostly, amphibians.
THE FRENCH MOREA EXPEDITION
The Morea (the Greek vernacular name for Peloponnese)
Expedition (French: Expédition de Morée) accomplished
by the French Army at the end of the Greek War of Inde-
pendence. After the naval battle of Navarino where the
united Franco-Russo-British fleet destroyed the Ottoman
fleet, French expeditionary corps disembarked at south-
ern Peloponnese to secure the evacuation of the area from
the Turks. Following the example of the successful
Napoleon’s Egyptian Campaign where a scientific com-
mittee accompanied the French troops, a scientific mis-
sion escorted the expedition in Peloponnese. The Head of
the 17 experts of different disciplines that comprised the
mission was the naturalist Jean Baptiste Bory de Saint Vin-
cent. Bory collected hundreds of plants and animals that
were sent to France for further identification and classi-
©ZFMK
fication. It was from these specimens that the herpetology
of Greece began formally in 1833, when the first endem-
ic species to Peloponnese were described by Bory and his
colleague Gabriel Bibron, who also participated in the
Morea expedition. Bibron worked extensively on Her-
petology and helped his mentor Duméril in the publica-
tion of the first herpetological monograph Erpétologie
generale (1834-—-1854) where many species distributed in
Greece were described.
The Morea Expedition covered not only Peloponnese but
also numerous Greek islands. The importance of this mis-
sion was crucial and later studies on Greek herpetofauna
were largely based on the Expedition’s observation.
Bibron and Bory described in total three species (A/gy-
roides moreoticus, Podarcis peloponnesiacus and
Ophiomorus punctatissimus), while later Duméril and
Bibron, using specimens from Corfu, described one
species (Algyroides nigropunctatus).
THE GERMAN SCHOOL
It is widely accepted that Greek herpetology, at least dur-
ing its early period, literally “spoke German”. Eminent
herpetologists from Germany, Austria and Switzerland
worked (and are still working) extensively on Greek rep-
tiles and amphibians, setting the basis for herpetology in
the country. Maybe the underlying reason should be
seeked in the first king after the War of Independence, Ot-
to the First, son of Ludwig of Bavaria (Wittelsbach
House), who brought with him hundreds of Germans to
staff the administration of the new country. In this session
the most important contributions in Greek herpetology
were presented.
The first German naturalists who arrived in the country
and presented information on Greek amphibians and
reptiles were not herpetologists but ornithologists (Erhard,
Reiser) or botanists (Heldreich, Herzog). Hence many of
their first observations proved to be incorrect since they
were not familiar with herpetological systematics.
Jacques von Bedriaga wrote the first major monograph on
Greek reptiles and amphibians in 1881. After receiving his
PhD Thesis from the University of Jena he started to trav-
el very frequently to both Italy and Greece. The fruits of
these trips was his “Die Amphibien und Reptilien
Griechenlands” which was published in Moscow in three
volumes. His special interest on lacertids is best reflect-
ed in the description of four new species, two of which
are endemic to Peloponnese and Milos Island (namely
Hellenolacerta graeca, Podarcis milensis, Lacerta trilin-
eata and P. erhardii). Though Bedriaga was born in Rus-
sia, where he also took his bachelor’s degree at the Uni-
Bonn zoological Bulletin 57 (2): 329-345
332 Panayiotis Pafilis
versity of Moscow, he became scientifically active in Ger-
many and published most of his works in German. That’s
why his name is herein included in the so-called German
School.
Oskar Boettger, though never visited Greece, made the
second important contribution to Greek herpetology. Dur-
ing the years he was infirm and remained at home, he re-
ceived numerous specimens sent by his many friends and
colleagues. Among them von Oertzen shipped him rep-
tiles and amphibians he collected while in Greece.
Boettger worked on this collection and later published his
findings (1888, 1891).
On of the most prominent European herpetologists, Robert
Mertens, worked also on the Greek herpetofauna. He re-
alized at least three herpetological excursions in the coun-
try, which later resulted in a series of paper (1959, 1961,
1968a, 1972). Using types and specimens from the large
collections of the Senckenberg Museum in Frankfurt he
also wrote systematics articles (1955, 1968b). His most
significant contribution though, was the publication, to-
gether with Miiller (1928, 1940) and Wermuth (1960), of
the European checklists of amphibians and reptiles. This
book has been a useful reference for researchers of the
Greek herpetofauna. At this point it is worthy of mention-
ing that Miller himself contributed one of the first her-
petological papers on Greek herpetofauna in 1908.
Karl Buchholz and Ulrich Gruber, both curators of her-
petology in the Zoologisches Forschungsmuseum Alexan-
der Koenig (hereinafter ZFMK), dedicated a large part of
their research on Greek reptiles and especially to the is-
land populations. Buchholz undertook numerous herpeto-
logical excursions to Greece and collected many speci-
mens (being an excellent markeman he shot his targets
from long distance). His collections were published in a
series of paper on the Aegean reptiles (1960, 1961,
1962a,b). Gruber focused also on insular populations (Gru-
ber & Fuchs 1977, Gruber 1979) and following Werner’s
example, specialized in the North Sporades island group
(Gruber & Schultze-Westrum 1971, Gruber 1986).
Hans Schneider, one of the leading researchers of amphib-
ians, worked closely with Sofianidou and Kyriakopoulou-
Sklavounou analyzing the acoustic properties of various
species of frogs (1984, 1985, 1988, 1993). Acknowledg-
ing the impact of his research on Greek herpetology he
was invited as the pleninary speaker at the 10'* Meeting
of Societas Europea Herpetologica in Crete in 1999 (Bioa-
coustic studies in European Anurans).
Many more German herpetologists, professional or ama-
teurs, did research on Greek species and it would be 1m-
possible to mention all of them in this brief paper. In any
©ZFMK
A brief history of Greek herpetology 333
case it would be an omission not to mentioned B. Schnei-
der who reported on the herpetofaunas of many Greek is-
lands (e.g. 1986, 1995), A. Beutler who was interested al-
so in insular populations (1979, Beutler & Froer 1980) and
B. Trapp who investigated the Greek population of
Chamaeleo africanus (e.g. 2003, 2004) and also wrote a
book on Greek amphibians and reptiles in German (2006).
Wolfgang Bohme is maybe the last of the Mohicans of the
one-time all-potent German School. His engagement with
Greek herpetofauna dates back to the time he was a stu-
dent at the Christian-Albrechts University of Kiel. At 1969
he traveled with a friend to the Syrian borders of Turkey.
On their way back they visited Thessaloniki and planned
a field trip to study the endemic species of Peloponnese.
Unfortunately their old Volkswagen “beetle” let them
down in Athens so they had to cancel their excursion un-
til the engine could be fixed. However they didn’t waste
their time and attempted a herpetological survey of the
area surrounding Acropolis. Their persistence was reward-
ed with observations on Chalcides occelatus and Zame-
nis situlus while they also discovered a dense population
of Lacerta trilineata (specimens of this population can be
found in the collections of ZFMK).
In 1971 Wolfgang Bohme took office as Curator of the
Herpetological Collection in ZFMK. His predecessors,
Karl Buchholz and Ulrich Gruber, were keenly interest-
ed in Greek herpetofauna, as mentioned above, and thus
enhanced considerably the collections of the Museum.
Thanks to them the newly appointed BOhme was able to
immerse himself in the Greek collections during his cu-
ratorship. It was in a series of Pseudepidalea viridis spec-
imens collected by Buchholz in Peloponnese that BOhme
discovered two misplaced adult individuals of Pelobates
syriacus, the first record of this species in Greece (1975).
The aborted field trip to Peloponnese finally took place
in 1996, after his participation in the Congress of the Hel-
lenic Zoological Society in Athens where he presented a
paper on the Cypriot herpetofauna. During this trip Bohme
went to Sparta and Mystras and observed many endemic
species in situ. But another chance to visit Peloponnese
would come from the far past.
The former director of ZFMK, the archeozoologist Gtin-
ther Nobis, had a house near Pylos. During his vacations
he shot a black-and-white photo of a chameleon and up-
on his return to Bonn gave it to BOhme. Since morpho-
logical details were not discernible, B6hme assumed it to
be C. chamaeleon and consequently published this record
in a brief note (1989). In 1997 Bohme visited Nobis so
as to have a first-hand examination of the species. Dur-
ing this visit he met Andrea Bonetti and George Chiras
who led him to the chameleon habitat where they soon de-
Bonn zoological Bulletin 57 (2): 329-345
tected the first male individual. To their surprise instead
of the typical small occipital flaps of C. chamaeleon, they
found a tarsal spur, characteristic of the African species
C. africanus. At the time the range of this species was be-
lieved to be restricted only to Africa. Bohme and his col-
leagues assumed that C. africanus was introduced to the
area as result of the trade between Alexandria and Pylos,
since the Gialova lagoon (the only place where the African
chameleon is distributed in the country) is located to the
exact site of the former ancient harbor of Nestor’s Palace
(Bohme et al. 1998). The results were later verified with
mtDNA analysis (Kosuch et al. 1999). This fascinating dis-
covery came to corroborate the human influence on
species dispersal in the Mediterranean Sea.
Together with Evgeny Roitberg and his former PhD stu-
dent Andreas Schmitz, now curator of herpetology in
Geneva, Bohme traveled to Greece once more in 1999 to
attend the 10'* Meeting of SEH in Iraklion, Crete. They
made herpetological observations in Macedonia and at
Mount Olympos. The last SEH Meeting in Kussadasi
(2009) gave another opportunity to visit Greece. On his
way back from Turkey, Bohme stopped, with his phd stu-
dent Philipp Wagner, at various localities in northeastern
Greece (Thrace and Macedonia).
Last, but certainly not least, the impact of the Handbuch
der Amphibien und Reptilien Europas (1981, 1984, 1986,
1993a) in which Bohme edited the volumes for snakes and
lizards (and also contributed personally some species ac-
counts — 1984, 1993b,c), has been catalytic for the devel-
opment of herpetology in Greece. Data on ecology, sys-
tematics, physiology and behavior were for the first time
gathered and accessible to researchers.
Besides the above, Wolfgang Bohme has another, more
“indirect”, nonetheless important, relationship with Greek
herpetology. During all the years he served as Head of the
Herpetology Section in ZFMK (1971—2010) and Vice Di-
rector of the Museum, he facilitated in every possible way
researchers who were working on specimens from
Greece. Many Greek herpetologists visited numerous
times the rich herpetological collections of the Museum
and retrieved valuable information on diet, reproduction,
morphology, ontogeny, intra- and inter-population varia-
tion, anatomy and phylogeny of Greek amphibians and
reptiles. These data led to the publication of various sci-
entific papers that considerably enlarged our knowledge
of the Greek herpetofauna.
THE AUSTRIAN SCHOOL
Franz Werner was one of the most prolific and influential
herpetologists who worked on Greek amphibians and rep-
OZFMK
334 Panayiotis Pafilis
tiles. Starting from 1894 he was an avid and consistent re-
searcher of Greek herpetofauna and remained active till
his death (1939), publishing a series of papers (1912, 1927,
1933, 1937, 1938). He was the first to describe the her-
petofauna of Ioanian islands (1894) and he also expand-
ed his studies to the Aegean Sea. Maybe his most impor-
tant manuscript was the one published in English, some-
thing quite unusual for a German-speaking scientist at the
time, by the University of Michigan (1930). Therein he
describes the findings of the visit he made at some Aegean
Islands in 1927. In this mission he had the chance to col-
laborate with K.H. Rechinger while informative photos
shot by Prof. Schoenwetter illustrated the final paper. In
his long herpetological pursuits in Greece Werner de-
scribed four new species: Lacerta anatolica, L. oertzeni
(a tribute to von Oertzen), Podarcis gaigeae (endemic to
Skyros Archipelago and dedicated to Helen Gaige) and
Macrovipera schweizeri. After his death his sons donat-
ed his huge personal collection to the Natural History Mu-
seum of Vienna, which since then is one of the wealthier
in specimens coming from Greece.
Werner’s pupil Otto von Wettstein followed up with en-
thusiasm the work of his teacher on Greek reptiles. He
took over as Curator of vertebrates at the Natural Histo-
ry Museum of Vienna in 1920 and published his first pa-
per on the herpetofauna of Crete in 1931. In his studies
he emphasized the reptilian and amphibian populations of
the Aegean islands of which he was a regular visitor. In
1942 he participated in a scientific mission to Crete that
was conducted by a German Wehrmacht biological re-
search squad. Without doubt his most important paper was
the emblematic Herpetologia Aegea (1953). In the 182
pages of this landmark effort, Wettstein presented in the
most detailed way, full of knowledge, all the information
on the zoogeography of the Aegean Sea herpetofauna.
The legacy Wettstein left to the Natural History Museum
of Vienna is enormous and, luckily, his interest in Greek
herpetofauna survived among his successors till today.
Heinz Grillitsch, the actual Head of the Herpetological
Collection since 1984, investigated aspects of the Greek
herpetofauna (Grillitsch & Tiedemann 1984, Grillitsch &
Cabela 1990, Grillitsch & Grillitsch 1991). Within his re-
sponsibilities lies the heavy burden to maintain and pre-
serve the huge collection, one of the greatest in Greek
specimens. Werner Mayer from the molecular systemat-
ic lab of the Museum has been working on the ecology
and distribution of reptiles and continues to study the phy-
logenetic relationships of numerous Greek lizards (May-
er 1986, 1993, Mayer & Beyerlein 2002, Mayer & Arribas
2003). Franz Tiedemann, who 1s collaborating closely with
the Museum, has conducted numerous studies on various
aspects of herpetology on Greek species (e.g. Tiedemann
& Haupl 1980, 1982, Tiedemann & Grillitsch 1986).
Bonn zoological Bulletin 57 (2): 329-345
There are many more Austrian herpetologists that need to
be mentioned here like Peter Keymar, who frequently vis-
ited Greece and published papers on Greek amphibians
and reptiles (1984, 1986a, b, 1988) or Thomas Bader and
Christoph Riegler (2004, 2009) who described the herpeto-
fauna composition of Rhodes Island. A special citation
should be made to the very active Austrian herpetologi-
cal group www. herpetofauna.at. In their excellent website
one may find a wide variety of photos of Greek reptiles
and amphibians since the members of the group have re-
peatedly visited Greece.
THE “INTERNATIONAL BRIGADES”
Besides the predominant German and Austrian Schools
that shaped the history of Greek herpetology, researchers
from many other European countries made important con-
tributions to the study of amphibians and reptiles of the
country.
Dodecanese islands during the first decades of the 20th
century were under Italian rule and Italian naturalists de-
scribed the herpetofauna of the region. Enrico Festa of the
Museum of Zoology in Turin made herpetological obser-
vations in the island of Rhodes that later were published
by Calabresi (1923b) who also write his impression of a
survey on Samos Islands (1923b). At the same period Et-
tore Zavattari published a study on the fauna of the “Ital-
ian islands of the Aegean Sea” (1929). Augusto Cattaneo
is one of the most prolific authors on the distribution of
Greek reptiles and amphibians, especially in the insular
country (e.g. 1984, 1997, 1999, 2007). Another Italian her-
petologist who investigated the range of Greek herpeto-
fauna is Pierangelo Crucitti (e.g. 1990).
The United Kingdom is represented by a handful of very
productive herpetologists. Adrian Hailey (now at the Uni-
versity of West Indies, Trinidad and Tobago), who worked
for a long period at the University of Thessaloniki, em-
phasized his research on the tortoise populations in Greece
(e.g. Hailey 2000, Hailey & Willemsen 2003) while he al-
so examined the metabolism of Laudakia stellio in col-
laboration with Nikos Loumbourdis. Richard Clark wins
easily the title of the champion of publications on the dis-
tribution of Greek amphibians and reptiles. Starting from
1967 he wrote over 20 papers (e.g. 1968, 1971, 1989,
1996, 2000) covering most places of the country. Finally
David Buttle traveled around Greece and published many
new localities regarding the distribution of Greek herpeto-
fauna (e.g. 1989, 1994, 1997). Nicholas Arnold with the
different editions of his excellent guide on European am-
phibians and reptiles (1985, 2004) offered an important
reference book to herpetologists working on Greek
species.
©ZFMK
A brief history of Greek herpetolog 335
In the 1970’s Hans Lotze did many field trips in Greece
and gave considerable information about snakes (e.g.
1974, 1977). Peter Beerli of Florida State University stud-
ied Aegean water frogs (Beerli et al. 1996) and even de-
scribed two new endemic species using molecular biolo-
gy tools (Beerli et al. 1994): Pelophylax cerigensis and
Pelophylax cretensis. But the real star of Swiss herpetol-
ogists that involved the study of Greek species was un-
doubtedly Hans Schweizer, the famous “Schlangenhansi”.
Schweizer, an amateur herpetologist with a particular pref-
erence to vipers, had already a reputation among the Eu-
ropean herpetological community when in 1931 visited
Milos Island. After spending considerable time walking
throughout the island and observing lizards and snakes,
he noted the striking differences between the local and
mainland herpetofaunas. He begun to publish his findings
(1932, 1935, 1938, 1957) and also contacted profession-
al herpetologists around Europe, with whom he had a reg-
ular correspondance, and started sending specimens. It was
from one of those samples that Miller described the en-
demic Milos grass snake in 1932 and dedicated it to him
(Natrix natrix schweizeri). Thanks to Schweizer, Milos Is-
land gained its reknown as herpetological hot spot in
Mediterranean. Besides the grass snake, two more species
bear Schlangenhansi’s name: Macrovipera schweizeri and
Lacerta trilineata hansschweizeri.
Otto Cyrén, one of the pioneers of Greek herpetology, was
born in Sweden but spent many years of his life in Ger-
many and consequently wrote in German his papers on
Greek and Balkan herpetofauna (1928, 1933, 1935). Goran
Nilson of Géteborg University, a viper expert, has exam-
ined various aspects of the biology of Macrovipera
schweizeri with his Greek collaborators Dimaki, Ioanni-
dis and Dimitropoulos (Andren et al. 1994, Nilson et al.
1999). A younger representative of Swedish herpetology
is Anna Runemark of Lund University who is doing her
PhD thesis on the sexual isolation between mainland and
inland populations of Podarcis gaigeae (Runemark et al.
2008).
Two herpetologists from the Netherlands have studied the
Greek herpetofauna. Ronald Willemsen focused on the
study of Mediterranean tortoises (e.g. Willemsen 1991,
1999, Willemsen & Hailey 2002) while Henk Strijbosch
examined the distribution and ecology of lacertids (Stri-
jbosch et al. 1989, Strijbosch 2001).
The Czechoslovakian Stepanek traveled to Greece and
published an important contribution to the knowledge of
Greek herpetofauna in 1944, along with two other papers
(1934, 1938). Mario Broggi from Liechtenstein is a reg-
ular visitor to Greece and has published over 15 papers
on local herpetofaunas around the country (e.g. 1978,
1988, 1997, 2009). The Danish Henrik Bringsge is anoth-
Bonn zoological Bulletin 57 (2): 329-345
er researcher that wrote on different species of reptiles and
amphibians (e.g. 1986, 1997, 2004). Jeroen Speybroeck
from Belgium has visited Greece many times and runs a
well organized website with great photographs of Greek
amphibians and reptiles (http:/www.hylawerkgroep.be/jeroen).
GREEKS ON GREEK HERPETOLOGY
Until the late 1960’s only foreign scientists, mostly from
Central Europe, were researching on the Greek herpeto-
fauna. In 1968 John Ondrias of the University of Patras
(which hosts the oldest School of Biology in Greece) pub-
lished the first list of amphibians and reptiles. That was
the starting point that instigated many Greek zoologists
to get involved in herpetological studies. Theodora Sofi-
anidou of the University of Thessaloniki carried out the
first dissertation on herpetology in 1977. Since then 18 re-
searchers defended their PhD theses on herpetological sub-
jects. Namely (in order of seniority): Loumbourdis
(1981), Kyriakopoulou-Sklavounou (1983), Xyda (1983),
Chondropoulos (1984), Tzannetatou-Polymeni (1988),
Valakos (1990), Asimakopoulos (1992), Maragou (1997),
Adamopoulou (1999), Vassara (1999), Kassapidis (2001),
Poulakakis (2003), Pafilis (2003), Tsiora (2003),
Sotiropoulos (2004), Mantziou (2006), Dimaki (2007) and
Simou (2009).
Bassilis Chondropoulos published the checklists of Greek
lizards and snakes in 1986 and 1989 respectively. These
papers remained for a long period the most dependable
source for the distribution of the Greek herpetofauna. Sofi-
anidou wrote the first complete herpetological monograph
in Greek in 1999 on Testudo marginata. In 2000 Achil-
leas Dimitropoulos and Yannis Ioannides published their
work on the reptiles of Greece and Cyprus (in Greek), the
first herpetological book to appear in Greece.
Nowadays Greek herpetologists are working under the
auspices of Universities, non-governmental organizations
and Museums. The major groups of herpetological re-
search are located at three Universities. At the Universi-
ty of Athens (the oldest in the country) Professors of Ecol-
ogy Ioannis Matsakis and Moisis Mylonas though not her-
petologists encourage young people to work in the field
and do indepth research during preparations of their dis-
sertation. Rosa Maria Tzannetatou-Polymeni and Sratis
Valakos, pupils of the aforementioned, became faculty in
1990 and 1992 respectively and with their turn supervised
new herpetological PhD theses. Tzannetatou-Polymeni
(assistant professor) is an expert on both Lyciasalaman-
dra species and is actually supervising a PhD thesis on
the endemic Helversen’s salamander (Karpathos and Kas-
sos islands). Valakos (associate professor) laid a founda-
tion for an active group that has already produced five dis-
OZFMK
336 Panayiotis Pafilis
sertations while two more are in process. Together with
colleagues from other institutions he published an accom-
plished guide for the amphibians and reptiles of Greece
(in English) in 2008. Earlier, with his collaborators, wrote
the first volume on a local herpetofauna (2004, in both
Greek and English). His research focuses on the environ-
mental physiology and phylogeny of lacertid lizards (e.g.
Valakos 1989, Valakos & Mylonas 1992, Valakos et al.
2007). Angeliki Xyda, former faculty (now retired), con-
ducted studies on the ecology of Laudakia stellio (e.g.
1986).
Professor Mylonas moved to the University of Crete at
1992 and set the basis for a new herpetological nucleus.
Three dissertations have been completed so far whereas
more PhD candidates are still working on their theses. Pet-
ros Lymberakis, curator of vertebrates at the Natural His-
tory Museum of Crete (belonging to the University of
Crete) deals with numerous aspects of herpetology (e.g.
Lymberakis et al. 2007, 2008). Nikos Poulakakis (assis-
tant professor) has worked extensively on the reconstruc-
tion of the phylogenetic histories of various amphibians
and reptiles (e.g. Poulakakis et al. 2003, 2005a, b, 2008).
At the Aristotelian University of Thessaloniki the research
group of Sofianidou and Kyriakopoulou-Sklavounou be-
gan a series of papers on frogs in collaboration with Hans
Schneider. Fruit of their work, based on bioacoustics, was
the description of a new species (Pelophylax epeiroticus
— 1984). Sofianidou (now retired) supervised two disser-
tations and worked mainly with amphibians (e.g. Sofian-
idou & Kyriakopoulou-Sklavounou 1983, Sofianidou
1996). She was also one of the editors and main contrib-
utors to the Atlas of Amphibians and Reptiles in Europe
(Gasc et al. 1997). Kyriakopoulou-Sklavounou (associate
professor) supervised one PhD thesis while studying life-
history traits and genetic differentiation of Greek frogs
(e.g. Kyriakopoulou-Sklavounou 1992, Kyriakopoulou-
Sklavounou et al. 2000, 2003). Nikos Loumbourdis (pro-
fessor) studies the metabolism and overall physiology of
amphibians and reptiles (e.g. Loumbourdis & Hailey 1985,
Loumbourdis 1997, 2005, 2007).
Besides the aforementioned foundations the Goulandris
Natural History Museum hosts a group of active herpetol-
ogists: Dimitropoulos who contributed many new locali-
ties for reptiles (e.g. 1986, 1990), Ioannides wrote on the
herpetofaunas of numerous areas and also on the ecolo-
gy of reptiles (e.g. Ioannides et al. 1994, Ioannides &
Bousbouras 1997) and Maria Dimaki, who has focused on
chameleons (e.g. Dimaki et al. 2000a,b). Panayiota
Maragou of the WWF Hellas studies the ecology of lac-
ertids endemic to Peloponnese (e.g. Maragou et al. 1996,
1999), while Chloe Adamopoulou (Zoological Museum
Bonn zoological Bulletin 57 (2): 329-345
of the University of Athens) is emphasizing on Podarcis
milensis (e.g. Adamopoulou et al. 1999, Adamopoulou &
Valakos 2005). Dimitris Margaritoulis of Archelon did an
important work on the conservation of sea turtles (e.g.
Margaritoulis et al. 1986, Margaritoulis 2005).
US based Greek Johannes Foufopoulos (assistant profes-
sor, University of Michigan) is investigating the evolution
and physiological adaptations of lizards on islands of
Aegean Sea (e.g. Foufopoulos 1997, Foufopoulos & Ives
1999) in close collaboration with herpetologists in
Greece. Recently two more members of the Greek her-
petological community became faculty: Konstantinos
Sotiropoulos (University of Ioannina, lecturer) who stud-
ies genetic differentiation and phylogenetic relations in
newts (e.g. Sotiropoulos et al. 2001, 2008a,b, 2009) and
Panayiotis Pafilis (University of Athens, assistant profes-
sor), focusing on functional ecology and conservation
physiology of lacertids (e.g. Pafilis et al. 2005, 2007, 2008,
2009).
The increasing number of people involved in herpetolog-
ical studies in Greece is also reflected in the organization
of three Congresses: the First (1992) and the Sixth (2008)
Symposia on the Lacertids of the Mediterranean Basin
(both held in Lesvos Island) and the 10‘ Ordinary Gen-
eral Meeting of SEH in Crete (1999). Some of the con-
tributions presented during the last were published in a
volume under the general title Hereptologia Candiana
(Lymberakis et al. 2001).
The threatened species of the Greek herpetofauna have
been recorded in the two editions of the Red Data Book
of threatened species of Greece. In the first edition
(Karandinos & Paraschi 1992) eight species (seven rep-
tiles and one salamander) are listed as threatened while
in the second edition (Legakis & Maragou 2009) twelve
reptiles and six amphibians are characterized as critical-
ly endangered, endangered or vulnerable.
An important step in the history of Greek Herpetology was
the foundation of the Hellenic Herpetological Society (So-
cietas Herpetologica Hellenica, EAdnvucy Epretodoyuxy,
Etatpe/a— http://www.elerpe.org) in 2000. The members
of the Society are scientists who are involved in the study
of amphibians and reptiles but also amateur herpetologists
(as non-full members) who are interested in conservation
and natural history. At this point Arche/on, the Sea Tur-
tle Protection Society of Greece (http://www.archelon.gr),
should be mentioned as well. Thanks to the efforts of this
pioneer group (founded on early 1980’s), Greek public
opinion was sensitized towards the conservation of
Caretta caretta.
©ZFMK
A brief history of Greek herpetology 337/
PAST, PRESENT AND FUTURE OF GREEK
HERPETOLOGY
Unlike herpetologies of other European countries, herpeto-
logical publications in Greece up to the 1970’s dealt with
systematics, focusing on the discovery and description of
new species. The majority of studies concerned the dis-
tribution of various taxa and the description of local her-
petofaunas, with emphasis on the islands. Nonetheless,
during the last decade, herpetologists are covering success-
fully a wide spectrum of biological aspects including mo-
lecular biology, genetic differentiation, environmental
physiology, functional ecology, immunology and the over-
all picture has been reversed (Fig. 1).
120 -
| eee
1880- 1900- 1960- 1970-
1900 1960 1970 1980
1980-
1990
1990-
2000
2000-
2010
Fig. 1. Histogram of publications (total 606 papers) made by
foreign (light bar) and Greek herpetologists (spotted bar).
The number of species inhabiting Greece has been raised
throughout the years (see Appendix I). During the first two
decades of 19th century only the species described by the
classical taxonomists (Linnaeus, Laurenti and Pallas) were
known from Greece. The French Morea Expendition led
to the description of the first endemic species and since
then the study of the Greek herpetofauna became method-
ical and continuous. New species are rather rare and their
description is based on cutting edge technology tools, like
molecular inference, paired though with typical anatom-
ical-morphological studies (e.g. Beerli et al. 1994). This
is also the case for the recently described lacertids Podar-
cis cretensis and P. levendis, the first Greek species that
were published by an exclusively Greek group (Lymber-
akis et al. 2008).
Until today foreign researchers were publishing most of
the papers on the Greek herpetofauna. However this trend
has changed during the last 20 years and today the scien-
tific work of Greek herpetologists has yielded a continu-
ously growing number of papers (Fig. 2). It is important
to mention that most Greek researchers are working in col-
laboration with colleagues from Europe and North Amer-
Bonn zoological Bulletin 57 (2): 329-345
ica, keeping alive the international interest for the Greek
herpetofauna and exchanging ideas and methods.
Habitat degradation, environmental pollution, introduced
species and the non-stop, greedy development of tourism
(principal source of money for Greek economy) stress the
imperious need for conservation studies in the immediate
future. Though knowledge of species distribution is in sat-
isfactory level, the evaluation of populations’ status 1s still
very poor. Amphibian and fresh water turtle populations
are known to decrease as a consequence of water pollu-
tion and the desiccation of water bodies. The problem is
much more intense in the islands because of tourism-re-
lated activities (excessive withdrawal of groundwater and
construction projects on wetlands areas). Reptile popula-
tions are threatened by wildfires that the last 10 years de-
stroyed a significant part of Greek forests and also, in the
case of small islets, by overgrazing. Greece hosts some
very important nesting beaches for Caretta caretta, endan-
gered as well by tourism and fishing. In order to protect
and maintain one of the richest European herpetofaunas
special conservation projects should be undertaken short-
ly with the contribution of herpetologists from all fields.
120
100
80
60
40
everwelN ian a
we ilies 1
1880- 1900- 1960- 1970- 1980- 1990- 2000-
1900 1960 1970 1980 1990 2000 2010
Fig. 2. Chart of publications concerning systematics and dis-
tribution (light bar) and non-systematic and distributional records
(spotted bar) of a total of 606 papers.
REFERENCES
Adamopoulou C (1999) Structure and composition of animal
ground communities with an emphasis on the lizard Podar-
cis milensis (Sauria: Lacertidae), in island ecosystems of the
Aegean Sea. Dissertation in Greek. University of Athens,
Athens
Adamopoulou C, ED Valakos, Pafilis P (1999) Summer diet of
Podarcis milensis, P. gaigeae and P. erhardii (Sauria: Lacer-
tidae). Bonner Zoologische Beitraege 48:275—282
Adamopoulou C, Valakos ED (2005) Thermal ecology and ac-
tivity cycle of Podarcis milensis in a sandy coastal area. Is-
rael Journal of Zoology 51: 39-52
Andren C, Nilson G, Dimitropoulos A, Ioannides Y (1994) Con-
servation of the Milos Viper (Macrovipera schweizeri, syn.
Vipera lebetina schweizeri). Preliminary report. Annales Mu-
sei Goulandris 9: 245—252
©ZFMK
338 Panayiotis Pafilis
Aristotle, History of Animals (in ten books). Translated by R.
Cresswell. Original edition Henry G. Bohn, London, reprint-
ed by Elibron Classics.
Aristotle, Generation of Animals. Translated by AL Peck. Loeb
Classical Library Volumes. Cambridge, MA, Harvard Univer-
sity Press; London, William Heinemann Ltd.
Aristotle, On the Parts of Animals I-IV. Translated by JL Lennox.
Clarendon Aristotle Series
Arnold EN (2004) Field Guide to the Reptiles and Amphibians
of Britain and Europe Collins, London
Arnold EN, Burton JA (1985) A Field Guide to the Reptiles and
Amphibians of Britain and Europe. Collins, London
Asimakopoulos V (1992) Geographical distribution and ecolo-
gy of the water frog Rana graeca (Boulenger 1891) in Greece.
Dissertation in Greek. University of Thessaloniki
Bader T, Riegler C (2004) Herpetological observations on
Rhodes (Greece). OGH-Aktuell 13:6—9
Bader T, Riegler C, Grillitsch H (2009) The herpetofauna of the
Island of Rhodes (Dodecanese, Greece). — Herpetozoa,
Wien; 21 (3/4): 147-169
Bedriaga J (1881) Die Amphibien und Reptilien Griechenlands
(Ophidia, Chelonia). 1. Bulletin de la Societé Imperial Natu-
relle de Moscou 56: 243-310
Bedriaga J (1881) Die Amphibien und Reptilien Griechenlands
(Ophidia, Chelonia). 2. Bulletin de la Societé Imperial Natu-
relle de Moscou 56: 43—103
Bedriaga J (1881) Die Amphibien und Reptilien Griechenlands
(Ophidia, Chelonia). 3. Bulletin de la Societé Imperial Natu-
relle de Moscou 56: 278-343
Bedriaga J (1883) Die Amphibien und Reptilien Griechenlands.
Zoologischer Anzeiger 6: 216—220
Beerli P, Hotz H, Tunner H, Heppich S, Uzzell T (1994) Two
new water frog species from the Aegean islands Crete and
Karpathos (Amphibia, Salientia, Ranidae). Notulae Naturae
— The Academy of Natural Sciences of Philadelphia 470: 1-9
Beerli P, Hotz H, Uzzell T (1996) Geologically dated sea barri-
ers calibrate a protein clock for Aegean water frogs. Evolu-
tion 50: 1676-1678
Beutler A (1979) General principles in the distribution of repti-
les and amphibians in the Aegean. Biologia Gallo—Hellenica
8: 337-344
Beutler A, Froer A (1980) Die Amphibien und Reptilien der
Nordkykladen (Griechenland). Mitteilungen der Zoologischen
Gesellschaft Braunau 3: 255-290
Boettger O (1888) Verzeichniss der von Hrn. E. von Oertzen aus
Griechenland und aus Kleinasien mitgebrachten Batrachier
und Reptilien. Verlag der Koeniglichen Akademie der Wissen-
schaften, Berlin 1: 139-186
Boettger O (1891) Reptilien von Euboea. Zoologischer Anze1-
ger 14: 418
Bohme W (1975) Zum Vorkommen von Pelobates syriacus Bo-
ettger, 1890) in Griechenland. Senckenbergiana Biologica 65:
199-202
Bohme W (editor) (1981) Handbuch der Amphibien und Rep-
tilien Europas, Echsen I. Akademische Verlagsgesellschaft,
Wiesbaden, Deutschland
Bohme W (editor) (1984) Handbuch der Amphibien und Rep-
tilien Europas, Echsen II. Akademische Verlagsgesellschaft,
Wiesbaden, Deutschland
Bohme W (editor) (1986) Handbuch der Amphibien und Rep-
tilien Europas, Echsen II. Akademische Verlagsgesellschaft,
Wiesbaden, Deutschland
Bohme W (editor) (1993) Handbuch der Amphibien und Rep-
tililen Europas, Schlangen I. Akademische Verlagsgesellschaft,
Wiesbaden, Deutschland
Bonn zoological Bulletin 57 (2): 329-345
Bohme W (1984) Lacerta graeca Bedriaga 1886 — Taygetos-Ei-
dechse, Griechische Spitzkopfeidechse. Pages 255—264 in W.
Bohme, editor. Echsen I (Lacerta). Handbuch der Reptilien
und Amphibien Europas. Aula-Verlag, Wiesbaden, Germany.
Bohme W (1989) Neuer Nachweis von Chamaleo chamaleon
(Linnaeus,1758) vom Peloponnes, (Griechenland). Herpeto-
fauna 11: 32-34
Bohme W (1993a) Coluber gyarosensis Mertens, 1968. -— Gya-
ros-Pfeilnatter. Pages 111-114 in W. Bohme, editor. Schlan-
gen (Serpentes) I. (Typhlopidae, Boidae, Colubridae 1: Co-
lubrinae). Handbuch der Reptilien und Amphibien Europas.
Aula-Verlag, Wiesbaden, Germany
Bohme W (1993b) Elaphe longissima (Laurenti, 1768) — Asku-
lapnatter. Pages 331-372 in W. Bohme, editor. Schlangen
(Serpentes) I. (Typhlopidae, Boidae, Colubridae 1: Colubri-
nae). Handbuch der Reptilien und Amphibien Europas. Aula-
Verlag, Wiesbaden, Germany
Bohme W, Bonetti A, Chiras G (1998) The chameleons of the
Greek mainland: taxonomic allocation and conservation needs
of a second European species. (Squamata: Sauria:
Chamaeleonidae). Herpetozoa 11: 87-91
Bringsee H (1986) Podarcis peloponnesiaca (Bibron und Bo-
ry, 1833) — Peloponnes-Eidechse. Pages 209-230 in W. Boh-
me, editor. Handbuch der Reptilien und Amphibien Europas.
Echsen (Sauria) HI. Lacertidae HI: Podarcis. Aula-Verlag,
Wiesbaden, Germany
Bringsge H (1997) Turistvenlige Karpenisi 1 Centralgraekenland
et ideelt rejsemal til herpetologiske udflugter. Nordisk Her-
petologisk Forening 40: 38-56
Bringsee H (2004) The swamp turtle Emys orbicularis helleni-
ca in the Strofilia forest on the Peloponnese. Nordisk Herpe-
tologisk Forening 47: 88—95
Broggi MF (1978) Herpetologische Beobachtungen auf der In-
sel Lesbos (Griechenland). Salamandra 14: 161-171
Broggi MF (1988) Herpetologische Beobachtungen auf der In-
sel Lesbos (Griechenland). Berichte der Botanisch-Zool. Ge-
sellschaft Liechtenstein-Sargans-Werdenberg 17: 93-99
Broggi MF (1997) Notizen zur Herpetofauna von Kalymnos und
Leros (Dodekanes, Griechenland). Herpetozoa 10: 135-138
Broggi MF (2009) The herpetofauna of Ithaki (Ithacam Ioania
Islands, Greece). Herpetozoa 22: 87—90
Buchholz KF (1960) Zur Kenntnis von Lacerta peloponnesia-
ca. Bonner Zoologische Beitrage 11: 87-107
Buchholz KF (1961) Uber Elaphe quatuorlineata von der Zykla-
den und das Elaphe-taxon von der Insel Amorgos (Reptilia,
Colubridae). Bonner Zoologische Beitrage 12: 135-148
Buchholz KF (1962a) Die Smaragdeidechse der Kykladeninsel
Tinos. Bonner Zoologische Beitrage 13: 341-352
Buchholz KF (1962b) Die Mauereidechse von Ananes, Milos-
Archipel. Bonner Zoologische Beitrage 13: 216-218
Buttle D (1989) Notes on reptiles and amphibians of northeast-
ern Greece and the island of Samothraki. British Herpetolog-
ical Society bulletin 29: 49-53
Buttle D (1994) An addition to the article “Notes on the herpeto-
fauna of some of the Cyclades islands, Greece’. British Her-
petological Society Bulletin 46: 11
Buttle D (1997) Observations on reptiles and amphibians of An-
dros (Cyclades, Greece). British Herpetological Society Bul-
letin 60: 5—12
Calabresi E (1923a) Escursioni zoologiche del Dr. E. Festa nell’
isola di Rodi. Anfibi e rettili. Bollettino dei Musei di Zoolo-
gia e Anatomia Comparata della Regia Universita di Torino
38: 1-16
Calabresi E (1923b) Anfibi e Rettili dell’isola di Samos. Moni-
tore Zoologico Italiano 34: 75—78
OZFMK
A brief history of Greek herpetology 339
Cattaneo A (1984) Reperti erpetologici nelle Cicladi occidentali:
Testudo marginata a Milos, Hemidactylus turcicus ed Elaphe
situla a Sifnos (Reptilia). Natura (Milan) 75: 75-78
Cattaneo A (1997) L’ erpetofauna dell’ isola greca di Skiathos
(Sporadi settentrional1). Atti della Societa Italiana di Scienze
Naturali e del Museo Civico di Storia Naturale di Milano 136:
145-156
Cattaneo A (1999) Variabilita e sottospecies di Elaphe quatuor-
lineata (Lacepede) nelle piccole isole Egee (Serpentes: Colu-
bridae). Atti della Societa Italiana di Scienze Naturali e del
Museo Civico di Storia Naturale in Milano 140: 127-132
Cattaneo A (2007) Observations on the snakes of the Aegean 1s-
land of Symi (Southern Sporades). Bollettino del Museo Civi-
co de Storia Naturale de Venezia 58: 257-267
Chondropoulos BP (1983) Rectifications to: Anton’s “A note on
the herpetofauna of Greece and its islands”. Bulletin Chica-
go Herpetological Society 18: 43
Chondropoulos BP (1984) Study of the lacertid lizards in west-
ern Greece. A morphological, serological, immunological and
ecological approach. University of Patras
Chondropoulos B.P (1986) A checklist of the Greek reptiles. 1.
The lizards. Amphibia-Reptilia 7: 217-235
Chondropoulos BP (1989) A checklist of Greek reptiles. 2. The
snakes. Herpetozoa 2: 3-36
Clark RJ (1968) A collection of snakes from Greece. British Jour-
nal of Herpetology 4: 45-48
Clark RJ (1971) Further comments on the Aegean 4-lined snake
Elaphe quatuorlineata including a consideration of the
Amorgos Elaphe snakes. British Journal of Herpetology 4:
207-209
Clark RJ (1989) A check list of the herpetofauna of the Argo-
Saronic Gulf district, Greece. British Herpetological Society
Bulletin 28: 8—24
Clark R (1996) Some notes on the reptile fauna of Fournoi,
Ikaria, and Schoinoussa, Aegean Sea, Greece. British Herpeto-
logical Society Bulletin 56: 35-39
Clark R (2000) The herpetology of Samos Island, eastern Aegean
Sea, Greece. Journal of the International Herpetological So-
ciety 25: 172-175
Crucitti P, Campese A, Malori M (1990) Popolazione sintopiche
di Emys orbicularis e Mauremys caspica nella Tracia. Grecia
orientale (Reptilia: Testudines: Emydidae). Bollettino del
Museo Regionale di Scienze Naturali di Torino 8: 187—196
Cyrén O (1928) Herpetologische Berichte von einer Reise nach
Griechenland. Blatter fiir Aquarien- und Terrariener-Kunde,
Stuttgart 1: 8-15
Cyrén O (1933) Lacertiden der stidéstlichen Balkanhalbinsel.
Mitteilungen des KG6niglichen Naturwissenschaftlichen Insti-
tut Sofia 6: 219-240
Cyrén O (1935) Herpetologisches vom Balkan. Blatter fiir Aqua-
rien- und Terrariener-Kunde, Stuttgart 46: 129-135
Dermitzakis MD (1990) Paleogeography, geodynamic process-
es and event stratigraphy during the Late Cenozoic of the
Aegean area. Academia Nazionale di Lincei 85: 263-288
Dimaki M, Valakos ED, Legakis A (2000a) Variation in body
temperatures of the African chameleon Chamaeleo africanus,
Laurenti, 1768 and the Common chameleon Chamaeleo
chamaeleon (Linnaeus, 1758). Belgian Journal of Zoology 130
(Supplement 1): 87-91
Dimaki M, Valakos ED, Chondropoulos BP, Legakis A (2000b)
Morphometric analysis of the African chameleon Chamaeleo
africanus Laurenti (1768) from the southwestern Peloponnese,
Greece. Israel Journal of Zoology 46: 77-83
Bonn zoological Bulletin 57 (2): 329-345
Dimaki M (2007) Ecology and physiology of chameleon
(Chamaeleo sp) in Greece. Dissertation in Greek. University
of Athens
Dimitropoulos A (1986) Some notes on the color and pattern
variation of the Greek snake fauna in relation to geographic
distribution. Biologia Gallo-Hellenica 12: 463-471
Dimitropoulos A (1990) A new locality record of Ottoman viper,
Vipera xanthina (Serpentes, Viperidae) from the Greek island
of Oenousses, N.E. Aegean. Annales Musei Goulandris 8:
245-249
Dimitropoulos A, Ioannidis J (2002) Goulandris’ Natural His-
tory Museum: Reptiles of Greece and Cyprus (in Greek).
KOAN, Athens
Foufopoulos J (1997) The reptile fauna of the northern Dode-
canese (Aegean islands, Greece). Herpetozoa 10: 3—12
Foufopoulos J, Ives AR (1999) Reptile extinctions on land-bridge
islands: life-history attributes and vulnerability to extinction.
American Naturalist 153: 1-25
Fytikas M, Innocenti P, Manetti R, Mazzuoli R, Peccerillo A,
Villari L (1984) Tertiary to Quaternary volcanism in the
Aegean region. In: The geological evolution of the Eastern
Mediterranean. Dixon, J.E., Robertson, A.H.F., Eds., Geolog-
ical Society of London Special Publications 17: 687—699
Gasc JP, Cabela A, Crnobrnja-Isailovic J, Dolmen D, Grossen-
bacher K, Haffner P, Lescure J, Martens H, Martinez Rica JP,
Maurin H, Oliveira ME, Sofianidou TS, Veith M, Zuiderwijk
A (1997) Atlas of Amphibians and Reptiles in Europe. Socie-
tas Europaea Herpetologica & Museum National d’ Histoire
Naturelle (IEGB/SPN), Paris
Grillitsch H, Tiedemann F (1984) Zur Herpetofauna der griechi-
schen Insel Kea, Spanopoula, Kythnos, Sifnos, Kitriani (Cy-
claden), Alonnisos und Piperi (Nordliche Sporaden). Annalen
des Naturhistorischen Museums, Wien 86: 7-28
Grillitsch H, Cabela A (1990) Zum systematischen Status der
Blindschleichen (Squamata: Anguidae) des Peloponnes und
der stidlichen Ionischen Inseln (Griechenland). Herpetozoa 2:
131-153
Grillitsch H, Grillitsch B (1991) Zur Taxonomie und Verbrei-
tung des Feuersalamanders, Salamandra salamandra (Linna-
eus, 1758) (Caudata: Salamandridae), in Griechenland. Her-
petozoa 4: 133-147
Gruber U, Schultze-Westrum T (1971) Zur Taxonomie und Oko-
logie der Cycladen-Eidechse (Lacerta erhardii) von der Nord-
lichen Sporaden. Bonner Zoologische Beitrage 22: 101-130
Gruber U, Fuchs D (1977) Die Herpetofauna des Paros-Archipels
(Zentral-A giis). Salamandra 13: 60-77
Gruber U (1979) Patterns of relationship and ecology of Aegean
snakes. Biologia Gallo-Hellenica 8: 345-348
Gruber U (1986) Podarcis gaigeae (Werner, 1930) — Skyros-
Mauereidechse. Pages 65—70 in W. Bohme, editor. Handbuch
der Reptilien und Amphibien Europas. Echsen (Sauria) III.
Lacertidae II]: Podarcis. Aula-Verlag, Wiesbaden, Germany
Guthrie WKC (1996) A History of Greek Philosophy, Vol. 2: The
Presocratic Tradition from Parmenides to Democritus. Cam-
bridge University Press
Hailey A, Pulford EA, Stubbs D (1984) Summer activity pat-
terns of Testudo hermanni Gmelin in Greece and France. Am-
phibia-Reptilia 5: 69-78
Hailey A (2000) The effects of the fire and mechanical habitat
destruction on survival of the tortoise 7estudo hermanni in
northern Greece. Biological Conservation 92: 321—332
Hailey A, Willemsen RE (2003) Changes in the status of tortoise
populations in Greece 1984-2001. Biodiversity and Conser-
vation 12: 991—1000
OZFMK
340 Panayiotis Pafilis
Hausdorf B, Hennig C (2004) The influence of recent geogra-
phy, palaeogeography and climate on the composition of the
fauna of the central Aegean Islands. Biological Journal of the
Linnean Society 84: 785-795
Ioannides Y, Dimaki M, Dimitropoulos A (1994) The herpeto-
fauna of Samos (Eastern Aegean, Greece). Annales Musei
Goulandris 9: 445-456
Ioannidis Y, Bousbouras D (1997) The space utilization by rep-
tiles in Prespa National Park. Hydrobiologia 351: 135-142
Legakis A, Maragou, P (2009) The Red Data Book of threatened
vertebrates of Greece. Hellenic Zoological Society, Athens
Karandinos M, Paraschi L (1992) The Red Data Book of threat-
ened vertebrates of Greece. Hellenic Zoological Society, Hel-
lenic Ornithological Society, Athens
Kasapidis P (2001) Study of the phylogeography of the geck
Mediodactylus kotschyi (Reptilia: Gekkonidae) in the Aege-
an archipelago and adjacent areas. Dissertation in Greek. Uni-
versity of Crete
Keymar PF (1984) Vorlaufige Ergebnisse herpetologischer Auf-
sammlungen auf den Ionischen Inseln: I.Korfu und Paxos. An-
nalen des Naturhistorischen Museums in Wien Serie B Bota-
nik und Zoologie 86: 285-286
Keymar PF (1986a) Die Amphibien und Reptilien der Ionischen
region (Griechenland). Analyse ihrer rezenten Verbreitungs-
muster und Uberlegungen zu ihrer Ausbreitungsgeschichte.
Osterreichische Gesellschaft fuer Herpetologie-Nachrichten:
8-43
Keymar PF (1986b) Liste der Amphibien und Reptilien der Pe-
loponnes-Halbinsel. Osterreichische Gesellschaft fiir Herpe-
tologie — Nachrichten: 3—26
Keymar PF (1988) Vorlaufige Ergebnisse herpetologischer Auf-
sammlungen auf den Ionischen Inseln: Zakynthos und Mara-
thonisi. Annalen des Naturhistorischen Museums in Wien. Se-
rie B Botanik und Zoologie 90: 17-25
Knoefel PK, Covi MC (1991) A Hellenistic Treatise on Poiso-
nous Animals. The Theriaca of Nicander of Colophon: a Con-
tribution to the History of Toxicology. Edwin Mellen Press
Kotsakis T (1990) Insular and non-insular vertebrate fossil fau-
na in Eastern Mediterranean islands. Atti Convenci Lincei 85:
289-334
Kosuch J, Vences M, B6hme W (1999) Mitochondrial DNA se-
quence data support the allocation of Greek mainland
chameleons to Chamaeleo africanus. Amphibia-Reptilia 20:
440-443
Kyriakopoulou-Sklavounou P (1983) Contribution to the study
of biology of the water frog Rana ridibunda Pallas (Anoura,
Ranidae). Dissertation in Greek. University of Thessaloniki
Kyriakopoulou-Sklavounou P (2000) Adaptations of some am-
phibian species to Mediterranean environmental conditions.
Belgian Journal of Zoology 130: 113-117
Kyriakopoulou-Sklavounou P, Xiromeritis NK, Spyridis HC
(1992) An experimental bioacoustic analysis of mating and ter-
ritorial calls of the frog Rana ridibunda. Acustica 76: 247-252
Kyriakopoulou-Sklavounou P, Xeros G, Charilaou C, Tsiora A
(2003) Preliminary data on the genetic differentiation of po-
pulations of three frog species (Anura, Amphibia) from Cy-
prus and Greece. Belgian Journal of Zoology 113: 191-193
Lotze HU (1974) Eine Vierstreifennatter (Elaphe quatuorlineata)
von den Sporadeninsel Kos. Salamandra 10: 27-30
Lotze HU (1977) Coluber ravergieri non Elaphe quatuorlineata
von der Sporadeninsel Kos (Reptilia, Serpentes, Colubridae).
Salamandra 13: 117
Loumbourdis N (1981) Study of the reproductive biology of the
lizard Agama stellio (L.) (Sauria: Agamidae). Dissertation in
Greek. University of Thessaloniki
Bonn zoological Bulletin 57 (2): 329-345
Loumbourdis NS, Hailey A (1985) Activity metabolism of the
lizard Agama stellio stellio. Comparative Biochemical Phys-
iology (A) 82: 687-691
Loumbourdis NS (1997) Heavy metal contamination in a lizard,
Agama stellio stellio, compared in urban, high altitude and
agricultural, low altitude areas of north Greece. Bulletin of En-
vironmental Contamination and Toxicology 58: 945—952
Loumbourdis NS (2005) Hepatotoxic and nephrotoxic effects of
Cadmium in the frog Rana ridibunda. Archives of Toxicolo-
gy 79: 434-440
Loumbourdis NS (20070 Liver histopathologic alterations in the
frog Rana ridibunda from a small river of Northern Greece.
Archives of Environmental Contamination and Toxicology 53:
418-425
Lymperakis P, Valakos ED, Pafilis P, Mylonas M (2001) [Jer-
petologia Candiana, Societas Herpetologica Europea. Natur-
al History Museum of Crete
Lymberakis P, Poulakakis N, Manthalou G, Mylonas M (2007)
Mitochondrial phylogeography of Rana (Pelophylax) popu-
lations in the Eastern Mediterranean region. Molecular Phy-
logenetics and Evolution 44: 115-125
Lymberakis P, Poulakakis N, Kaliontzopoulou A, Mylonas M,
Valakos ED (2008) Two new species of Podarcis (Squamata:
Lacertidae) from Greece. Systematics and Biodiversity 6:
307-318
Lymberakis P, Poulakakis N (2010) Three Continents Claiming
an Archipelago: The Evolution of Aegean’s Herpetofaunal Di-
versity. Diversity 2: 233-255
Maragou P, Valakos ED, Giannopoulos Z, Stavropoulou A,
Chondropoulos BP (1996) Spring aspect of feeding ecology
in Podarcis peloponnesiaca (Bibron & Bory, 1833) (Squama-
ta: Sauria: Lacertidae). Herpetozoa 9: 105—110
Maragou P (1997) A comparative ecological study of the sym-
patric Peloponnese species Lacerta graeca (Bedriaga, 1886)
and Podarcis peloponnesiaca (Bibron I-E Bory, 1883). Dis-
sertation in Greek. University of Patras
Maragou P, Chondropoulos BP, Valakos ED (1999) Compara-
tive data on reproduction in Podarcis erhardii, Podarcis pelo-
ponnesiaca, and Podarcis taurica (Reptilia, Sauria, Lacer-
tidae). Israel Journal of Zoology 45: 487-496
Mantziou G (2006) Phylogeography and population genetics of
the species Mauremys rivulata (Chelonia — Geomydidae). Dis-
sertation in Greek. University of Crete
Margaritoulis D, Arapis T, Kornaraki E, Mytilineou C (1986)
Three specimens of the sea turtle Chelonia mydas (L.) record-
ed in Greece. Biologia Gallo-Hellenica 12: 237-243
Margaritoulis D (2005) Nesting activity and reproductive out-
put of loggerhead sea turtles, Caretta caretta, over 19 Seasons
(1984-2002) at Laganas Bay, Zakynthos, Greece: the largest
rookery in the Mediterranean. Chelonian Conservation and
Biology 4: 916-929
Mayer W (1986) Proteinelektrophoretische Untersuchungen zur
subspezifischen Gliederung von Lacerta (Podarcis) pelopon-
nesiaca. Bonner Zoologische Beitraege 37: 123-129
Mayer W (1993) Die Lacertiden Griechenlands — eine kritische
Liste. Die Eidechse 10: 8-14
Mayer W, Beyerlein P (2002) Genetische Differenzierung des
Lacerta viridis/bilineata Komplexes und von Lacerta trilin-
eata in Griechenland: mtDNA Sequenzen. Mertensiella 13:
52-59
Mayer W, Arribas O (2003) Phylogenetic relationships of the Eu-
ropean lacertid genera Archaeolacerta and Iberolacerta and
their relationships to some other ‘Archaeolacertae’ (sensu la-
to) from Near East, derived from mitochondrial DNA
©ZFMK
A brief history of Greek herpetology 341
sequences. Journal of Zoological Systematics and Evolutio-
nary Research 41: 157-161
Mertens R, Miller L (1928) Die Amphibien und Reptilien
Europas. Verlag, Frankfurt
Mertens R (1955) Der Typus von Vipera lebetina schweizeri.
Senckenbergiana Biologica 36: 297-299
Mertens R (1959) Zur Kenntnis der Lacerten auf der Insel Rho-
dos. Senckenbergiana Biologica 40: 15-24
Mertens R (1961) Die Amphibien und Reptilien der Insel Kor-
fu. Senckenbergiana Biologica 42: 1-29
Mertens R (1968a) Eine schwarze Zornnatter von den Cycladen:
Columber gemonensis gyarosensis n.subsp. Senckenbergiana
Biologica 49: 181-189
Mertens R (1968b) Nachtrag zur Reptilienfauna der Insel Kor-
fu. Senckenbergiana Biologica 49: 173-180
Mertens R (1972) Zoologische Wandertage auf Korfu, der In-
sel der Phaaken. Natur und Volk 90: 321-339
Mertens R, Wermuth T (1960) Die Amphibien und Reptilien
Europas. Verlag, Frankfurt
Meyer M (1985) Die Reptilienfauna des stidlichen Peleponnes.
Sauria 7: 13-16
Miller L (1908) Eine herpetologische Exkursion in den Tayge-
tos. Bl. F. Aquarium u. Terrarienkunde XIX, pp. 121-122,
138-140, 149-151, 163-166, 180-182, 188-190, 200-202,
250-252, 267-270
Nilson G, Andren C, Ioannides Y, Dimaki M (1999) Ecology and
conservation of the Milos viper, Macrovipera schweizeri (Wer-
ner, 1935). Amphibia-Reptilia 20: 355-375
Ondrias JC (1968) Liste des Amphibiens et des reptiles de la
Grece. Biologia Gallo-Hellenica 2: 111-135
Pafilis P (2003) Adaptations of lacertids based on their thermal
biology, metabolic rate and phylogenetic history. Dissertation
in Greek. University of Athens
Pafilis P, Valakos ED, Foufopoulos J (2005) Comparative post-
autotomy tail activity in six Mediterranean lacertid lizard
species. Physiological and Biochemical Zoology 78(5):
828-838
Pafilis P, Foufopoulos J, Poulakakis N, Lymberakis P, Valakos
ED (2007) Digestive performance in five Mediterranean lizard
species: effects of temperature and insularity. Journal of Com-
parative Physiology B 177: 49-60
Pafilis P, Pérez-Mellado V, Valakos ED (2008) Post autotomy
tail activity in Balearic wall lizard, Podarcis lilfordi. Natur-
wissenschaften 95 (3): 217-221
Pafilis P, Foufopoulos J, Poulakakis N, Lymberakis P, Valakos
ED (2009) Tail shedding in island lizards [Lacertidae, Rep-
tilia]: Decline of antipredator defenses in relaxed predation en-
vironments. Evolution 63(5): 1262—1278
Pausanias, Description of Greece (in ten books). Translated by
WHS Jones and HA Omerod. Loeb Classical Library Volumes.
Cambridge, MA, Harvard University Press; London, William
Heinemann Ltd.
Poulakakis N (20030 Investigation of the phylogenetic proce-
dures in the lizards of the genus Podarcis (Sauria: Lacertidae)
in Greece. Dissertation in Greek. University of Crete
Poulakakis N, Lymberakis P, Antoniou A, Chalkia D, Zouros E,
Mylonas M, Valakos ED (2003) Molecular phylogeny and bio-
geography of the wall-lizard Podarcis erhardii (Squamata :
Lacertidae). Molecular Phylogenetics and Evolution 28: 38-46
Poulakakis N, Lymberakis P, Tsigenopoulos CS, Magoulas A,
Mylonas M (2005a) Phylogenetic relationships and evolution-
ary history of the snake-eyed skink Ablepharus kitaibelii
(Sauria: Scincidae). Molecular Phylogenetics and Evolution
34: 245-256
Bonn zoological Bulletin 57 (2): 329-345
Poulakakis N, Lymberakis P, Valakos ED, Pafilis P, Zouros E,
Mylonas M (2005b) Phylogeography of Balkan wall lizard
(Podarcis taurica) and its relatives inferred from mitochon-
drial DNA sequences. Molecular Ecology 14: 2433-2443
Poulakakis N, Pakaki V, Mylonas M, Lymberakis P (2008) Mol-
ecular phylogeny of the Greek legless skink Ophiomorus
punctatissimus (Squamata : Scincidae): The impact of the Mid-
Aegean trench in its phylogeography. Molecular Phylogenet-
ics and Evolution 47: 396-402
Runemark A, Gabirot M, Bensch S, Svensson E, Martin X, Pa-
filis P, Valakos ED, Hansson B (2008) Identification of poly-
morphic microsatellite loci in Podarcis gaigeae and Podar-
cis hispanica (Squamata: Lacertidae) and assessment of their
utility in three other Podarcis species. Mollecular Ecology Re-
sources 8: 1367-1370
Schneider B (1986) Zur Herpetofauna der Insel Limnos (Helle-
spontische Inseln, Nordagais, Griechenland). Salamandra 22:
276-280
Schneider B (1995) The herpetofauna of Agios Efstratios (Helle-
spontic Islands, northern Aegean Sea, Greece), with remarks
on the zoogeography of this region. Biologia Gallo-Helleni-
ca 22: 49-55
Schneider H, Sofianidou TS, Kyriakopoulou-Sklavounou P
(1984) Bioacoustic and morphometric studies in water frogs
(genus Rana) of Lake Ioannina in Greece, and description of
anew species (Anura, Amphibia). Zeitschrift ftir Zoologische
Systematik und Evolutionsforschung 22: 349-366
Schneider H, Sofianidou TS (1985) The mating call of Rana ridi-
bunda (Amphibia, Anura) in northern Greece as compared
with those of Yugoslavian and Israeli populations: proposal
of a new subspecies. Zoologischer Anzeiger 214: 309-319
Schneider H, Sofianidou TS, Kyriakopoulou-Sklavounou P
(1988) Calling bahaviour and calls of Rana dalmatina (Anu-
ra, Ranidae) in Greece. Zoological Journal of Physiology 92:
231-243
Schneider H, Sinsch U, Sofianidou. TS (1993) The water frogs
of Greece. Bioacoustic evidence for a new species. Zeitschrift
fuer Zoologische Systematik und Evolutionsforschung 31: 47—
63
Schweizer H (1932) Beitrag zur Kenntnis der Vipera lebetina
Levanteotter auf Milos. Blaetter Aquarien- und Terrarienkun-
de 43: 383-386
Schweizer H (1935) Beitrag zur Reptilienfauna der Inselgrup-
pe von Milos (Cycl.). Blaetter Aquarien- und Terrarienkunde
1935: 8-15
Schweizer H (1938) Weiteres tiber die Reptilienwelt der stidwest-
lichen Kykladen (Vipera lebetina lebetina von Milos eine Ei-
erlegerin). Blaetter Aquarien- und Terrarienkunde 1938: 33—
38
Schweizer H (1957) Weiteres ueber die Ringelnatter und Lev-
ante-Otter der West-Cycladen. Aquar. Terr. Zeitung Stuttgart
10: 161-164
Simmons A (1991) Humans, island colonization and Pleistocene
extinctions in the Mediterranean: the view from Akrotiri Ae-
tokremnos, Cyprus. Antiquity 65: 857-869
Simou Ch (2009) Tail autotomy in lacertid lizards (Reptilia-
Sauria): mechanisms and adaptations. Dissertation in Greek.
University of Athens
Sofianidou TS (1977) Study of the biology and ecology of Pelo-
bates syriacus, Boettger (Anura: Pelobatidae). Dissertation in
Greek. University of Thessaloniki
Sofianidou TS (1996) Electrophoretic studies of hybrids of Wa-
ter Frogs (Rana epeirotica, R.balcanica) in the Ionian zone of
Greece. Israel Journal of Zoology 42: 149-157
©Z7FMK
342 Panayiotis Pafilis
Sofianidou ThS (1999) Testudo marginata, the endemic turtle
of Greece. Giachoudis Publications, Thessaloniki, Greece
Sofianidou TS, Kyriakopoulou-Sklavounou P (1983) Studies on
the biology of the frog Rana dalmatina Bonaparte, during the
breeding season in Greece (Amphibia: Anura: Ranidae). Am-
phibia-Reptilia 4: 125-136
Sondaar PY, de Vos J, Dermitzakis MD (1986) Late Cenozoic
faunal evolution and palaeogeography of the South Aegean
island arc. Modern Geology 10: 249-259
Sotiropoulos K, Tomovic L, Dzukic G, Kalezic ML (2001) Mor-
phological differentiation of the Alpine Newt (Triturus
alpestris) in the Balkans: Taxonomic implications. Herpeto-
logical Journal 11: 225-231
Sotiropoulos K (2004) Genetic and morphological diversity of
the genus Triturus (Amphibia, Urodela) in Greece: historical
and ecological interpretations. Dissertation in Greek. Univer-
sity of Athens
Sotiropoulos K, Legakis A Tzannetatou-Polymeni R, (2008a)
Patterns of morphometric variation in the smooth newt (Lis-
sotriton vulgaris) from Greece: environmental correlates. Jour-
nal of Natural History 42: 435-450
Sotiropoulos K, Tsaparis D, Eleftherakos K, Tzannetatou-Poly-
meni R, Legakis A (2008b) New polymorphic microsatellite
loci for the Macedonian crested newt, 7riturus macedonicus,
and cross-priming testing in four other crested newt species.
Molecular Ecology Resources 8: 1402—1404
Sotiropoulos K, Eleftherakos K, Tsaparis D, Tzannetatou-Poly-
meni R, Legakis A (2009) New polymorphic microsatellite lo-
ci for the Greek smooth newt, Lissotriton vulgaris graecus,
and their utility in the nominotypical subspecies. Molecular
Ecology Resources 9: 292—295
Stepanek O (1934) Gymnodactylus kotschyi Steindachner und
sein Rassenkreis. Archiv fiir Naturgeschichte, N. F. 6: 258—
280
Stepanek O (1938) Zweiter Beitrag zur Herpetologie der Insel
Kreta (Vorlaufige Mitteilung). Vestn. ceskosl. zool. Spol. 5:
77-19
Stepanek O (1944) Zur Herpetologie Griechenlands. Vestn.
ceskosl. zool. Spol. 9: 123-147
Strijbosch H, Helmer W, Scholte PT (1989) Distribution and
ecology of lizards in the Greek province of Evros. Amphib-
ia-Reptilia 10: 151-174
Strijbosch H (2001) Habitat selection of Lacerta trilineata and
Lacerta viridis in eastern Greece. Mertensiella 13: 159-164
Tiedemann F, Haupl M (1980) Eine neue Unterart von Cyrtod-
actylus kotschyi von den griechischen Insel Nisos Makri und
Nisos Strongili (NW Rhodos). Annalen des Naturhistorischen
Museums Wien 83: 539-542
Tiedemann F, Haupl M (1982) Cyrtodactylus kotschyi (Stein-
dachner, 1870) in the Santorini archipelago. Amphibia-Rep-
tilia 3: 377-381
Tiedemann F, Grillitsch H (1986) Zur Verbreitung von Vipera
xanthina (Gray, 1849) in Griechenland (Serpentes: Viperidae).
Salamandra 22: 272-275
Trapp B (2003) Chamaeleo africanus in Europe: information on
a protection project for extinction avoidance for an endange-
red species in Europe. Reptilia 8: 39
Trapp B (2004) Good news on Greek chameleons. Elaphe 12:
50-54
Trapp B (2006) Die Amphibien und Reptilien des Griechischen
Festlandes. Natur und Tier Verlag.
Tsiora A (2003) Study of the reproductive biology of the water
frog Rana epeirotica (Schneider et al. 1984) in Ioannina Lake.
Dissertation in Greek. University of Thessaloniki
Bonn zoological Bulletin 57 (2): 329-345
Tzannetatou-Polymeni RM (1988) Contribution to the study of
the amphibian species Mertensiella luschani (Steindachner
1891) (Urodela, Salamandridae). Populations and biochemi-
cal data. Dissertation in Greek. University of Athens
Valakos ED (1986) The feeding ecology of Podarcis erhardii
(Reptilia — Lacertidae) in a main insular ecosystem. Herpeto-
logical Journal 1: 118-121
Valakos ED (1989) Thermal ecology of Cyrtodactylus kotschyi
(Steindachner, 1870) (Sauria Gekkonidae) in the insular
ecosystems of the Aegean. Herpetological Journal 1: 396-399
Valakos ED, Mylonas M (1992) Distribution and ecological as-
pects of the herpetofauna of Strofadhes Islands (Ionian Arch-
ipelago, Greece). Herpetozoa 5: 33-39
Valakos ED 1990. The ecology of the lizard Podarcis erhardii
(Bedriaga, 1882) (Sauria: Lacertidae) in a typical island
ecosystem on Naxos. Dissertation in Greek. University of
Athens
Valakos ED, Dimaki M, Pafilis P (2004) Natural History of
Lesvos: Reptiles and Amphipians. Natural History Collection
of Vrissa, Lesvos, University of Athens. Mytilene
Valakos ED, Kourkouli A, Skopeliti M, Pafilis P, Poulakakis N,
Voutsas IF, Lymberakis P, Simou Ch, Voelter W, Tsitsilonis
OE (2007) Combining immunological and molecular data to
assess phylogenetic relations of some Hellenic Podarcis
species. Comparative Biochemistry and Physiology (A) 147:
1-10
Valakos ED, Pafilis P, Sotiropoulos K, Lymberakis P, Marangou
P, Foufopoulos J (2008) Reptiles and Amphibians of Greece,
Chimaira Publications, Frankfurt am Mainz
Vassara E (1999) Intrapopulation study of the frog Bombina va-
riegata (Linnaeus 1758) in Greece. Dissertation in Greek. Uni-
versity of Thessaloniki
Werner F (1894) Die Reptilien- und Batrachierfauna der Ioni-
schen Inseln. Verhandlungen der Zoologisch-Botanischen Ge-
sellschaft in Wien 44: 225-237
Werner F (1912) Beitraege zur Kenntnis der Reptilien und Am-
phibien Griechenlands. Archive fuer Naturgeschichte 78: 167—
180
Werner F (1927) Beitrage zur Kenntnis den Fauna Griechen-
lands. Zoologische Anzeiger LXX, pp. 135-143
Werner F (1930) Contribution to the knowledge of the reptiles
and amphibians of Greece, especially the Aegean islands. Oc-
casional papers of the University of Michigan Museum of Zo-
ology 211: 1-47
Werner F (1933) Ergebnisse einer zoologischen Studien- und
Sammelreise nach den Inseln des Aegaeischen Meeres. I. Rep-
tilien und Amphibien. Sitzungsberichte der Mathematisch-Na-
turwissenschafftlichen Klasse-Abteilung B. 143: 105-131
Werner F (1937) Beitraege zur Kenntnis der Tierwelt des Pelo-
ponnes, der Inseln Kythira und Euboea sowie der kleinen In-
seln im Saronischen Golf. Sitzungsberichte der Mathematisch-
Naturwissenschaftlichen Klasse Abteilung B. 146: 135—153
Werner F (1938) Ergebnisse der achten zoologischen For-
schungsreise nach Griechenland (Euboea, Tinos, Skiathos,
Thasos usw.). Sitzungsberichte der Mathematisch-Naturwis-
senschafftlichen Klasse Abteilung B. 147: 151-173
Wettstein O v (1931) Herpetologie der Insel Kreta. Annalen des
Naturhistorischen Museums Wien 45: 159-172
Wettstein O v (1953) Herpetologia Aegaea. Sitzungsberichte der
Mathematischen-Naturwissenschafftlichen Klasse Abteilung
B. 162: 651-833
Willemsen RE (1991) Differences in thermoregulation between
Testudo hermanni and Testudo marginata and their ecologi-
cal significance. Herpetological Journal 1: 559-567
©ZFMK
A brief history of Greek herpetology 343
Willemsen RE (1999) Variation of adult body size of the tortoise
Testudo hermanni in Greece: proximate and ultimate causes.
Journal of Zoology 248: 379-396
Willemsen RE, Hailey A (2002) Body mass condition in Greek
tortoises: regional and interspecific variation. Herpetological
Journal 12: 105-114
Xyda A (1983) Differentiation between the local Greek and
Cypriot populations of Agama stellio (Reptilia: Agamidae).
Dissertation in Greek. University of Athens
APPENDIX
Xyda A (1986) Supplementary evidence on the biometry and
ecology of the lizard Stellio stellio of Greece and Cyprus. Bi-
ologia Gallo-Hellenica 12: 451-458
Zavattari E (1929) Ricerche faunistiche nelle Isole Italiane dell’
Egeo. Anfibi e Rettili. Archivo Zoologico Italiano 12/13:
161-166
Received: 30.VII.2010
Accepted: 31.VII.2010
Table 1. List of species known from Greece with distribution and date of original description.
Date Species Author Range Group
1758 Anguis fragilis Linnaeus Mainland Greece, Thassos and Corfu islands —_ Rept: Anguidae
1758 Bombina variegata Linnaeus Mainland Greece, not in Peloponnese Amph: Discoglossidae
1758 Bufo bufo Linnaeus Mainland Greece and large Aegean islands Amph: Bufonidae
1758 Caretta caretta Linnaeus All Greek seas Rept: Chelontidae
1758 Chamaeleo chamaeleon Linnaeus Chios and Samos Islands Rept: Chamaeleonidae
1758 Chelonia mydas Linnaeus All Greek seas Rept: Cheloniidae
1758 Dolichophis jugularis Linnaeus Islands of southeastern Aegean Sea Rept: Colubridae
1758 Emys orbicularis Linnaeus Mainland Greece, Samos, Samothraki, Rept: Emydidae
Kos, Lesvos and Evvoia islands
1758 Eryx jaculus Linnaeus Throughout the country excluding Crete Rept: Boidae
1758 Hemidactylus turcicus Linnaeus Throughout the country Rept: Gekkonidae
1758 Hyla arborea Linnaeus Mainland Greece and large islands Amph: Hylidae
1758 Lacerta agilis Linnaeus Northern borders in high elevations Rept: Lacertidae
1758 Laudakia stellio Linnaeus Only European population Rept: Agamidae
Eastern Aegean Sea Islands, Corfu,
Thessaloniki and central Cyclades
1758 Lissotriton vulgaris Linnaeus Mainland Greece and large Ionian islands Amph: Salamandridae
1758 Natrix natrix Linnaeus Throughout the country excluding Crete Rept: Colubridae
1758 Rana temporaria Linnaeus Northern borders with Bulgaria Amph: Ranidae
1758 Salamandra salamandra Linnaeus Mainland Greece Amph: Salamandridae
1758 Tarentola mauritanica Linnaeus Western Peloponnese, Crete and Ionian Islands Rept: Gekkonidae
1758 Testudo graeca Linnaeus Mainland Greece and many islands Rept: Testudinidae
1758 Trionyx triunguis Forsskal Introduced, Kos island Rept: Trionychidae
1758 Trachylepis auratus Linnaeus Rhodes, Kos, Symi and Samos islands Rept: Scincidae
1758 Vipera ammodytes Linnaeus Throughout the country excluding Crete, Rept: Viperidae
Milos Archipelago and eastern Aegean Sea islands
1758 Vipera berus Linnaeus Macedonia and Thrace in high elevations Rept: Viperidae
1758 Zamenis situlus Linnaeus Throughout the country Rept: Colubridae
1761 Bombina bombina Linnaeus Borders with Bulgaria, River Evros Amph: Discoglossidae
1761 Dermochelys coriacea Vandelli All Greek seas Rept: Dermochelyidae
1768 Chamaeleo africanus Laurenti Only European population, Rept: Chamaeleonidae
a restricted zone in southeastern Peloponnese
1768 Coronella austriaca Laurenti Epirus, Macedonia, Thrace, Thassos Rept: Colubridae
and Samothraki islands
1768 Hierophis gemonensis Laurenti Throughout mainland Greece Rept: Colubridae
excluding Macedonia and Epirus,
Ionian islands and Crete
Bonn zoological Bulletin 57 (2): 329-345
©ZFMK
344 Panayiotis Pafilis
Date Species Author Range Group
1768 Lacerta viridis Laurenti Mainland Greece excluding Peloponnese Rept: Lacertidae
1768 Mesotriton alpestris Laurenti Mainland Greece Amph: Salamandridae
1768 Natrix tessellata Laurenti Throughout the mainland country, Rept: Colubridae
Crete and some Aegean and Ionian islands
1768 Podarcis muralis Laurenti Throughout mainland Greece Rept: Lacertidae
and Thassos island
1768 Pseudepidalea viridis Laurenti Mainland and insular Greece Amph: Bufonidae
1768 Triturus carnifex Laurenti Epirus, Macedonia and Corfu island Amph: Salamandridae
1768 Zamenis longissimus Laurenti Throughout the mainland country, Rept: Colubridae
Corfu and Paxoi islands
1774 Pelophylax ridibundus Pallas Eastern Macedonia and Thrace Amph: Ranidae
1775 Chalcides ocellatus Forsskal Attica and close islands, Rept: Scincidae
Crete, eastern Peloponnese
1775 Pseudopus apodus Pallas Mainland Greece and in many large islands Rept: Anguidae
1789 Dolichophis caspius Gmelin Throughout the country excluding Crete, Rept: Colubridae
Rhodes and the majority of Peloponnese
1789 Elaphe quatorlineata Lacepéde Throughout the country excluding Crete Rept: Colubridae
and Rhodes
1789 Eurotestudo hermanni Gmelin Mainland Greece, Zakynthos, Cephalonia, Rept: Testudinidae
Corfu and Evvoia islands
1789 Hierophis viridiflavus Lacepéde Introduced, Gyaros Island Rept: Colubridae
1789 Platyceps najadum Gmelin Throughout the mainland country Rept: Colubridae
and in some Aegean islands
1795 Testudo marginata Schoepff Endemic, Mainland Greece Rept: Testudinidae
excluding Thrace and many Aegean islands
1802 Rana catesbeiana Shaw Introduced, Crete Amph: Ranidae
1804 Malpolon monspessulanus Hermann Throughout the country Rept: Colubridae
excluding Crete and Cyclades
1814 Elaphe sauromates Pallas Thrace and Thassos island Rept: Colubridae
1814 Podarcis tauricus Pallas Throughout mainland Greece Rept: Lacertidae
and Ionian islands
1820 Typhlops vermicularis Merrem Throughout the country excluding Crete Rept: Typhlopidae
1831 Telescopus fallax Fleischmann Throughout the country Rept: Colubridae
1832 Ophisops elegans Ménétriés Only European population, Rept: Lacertidae
islands of northeastern Aegean Sea
1833 Ablepharus kitaibelii Bibron & Bory Throughout the country Rept: Scincidae
/ terra typica in Greece
1833 Algyroides moreoticus Bibron & Bory Endemic, Peloponnese and Rept: Lacertidae
few Ionian Islands
1833 Mauremys rivulata Valenciennes Throughout the country Rept: Geoemydidae
1833 Ophiomorus punctatissimus Bibron & Bory Only European population, Rept: Scincidae
Peloponnese, Kythira and Kastelorizo islands
/ terra typica in Greece
1834 Darevskia praticola Evermann Eastern Thrace near river Evros Rept: Lacertidae
1834 Hemorrhois nummifer Reuss Only European population, Rept: Colubridae
Islands of southeastern Aegean Sea
1833 Podarcis peloponnesiacus Bibron & Bory Endemic, Peloponnese / Rept: Lacertidae
terra typica in Greece
1835 Vipera ursinii Bonaparte Central and northern Greece Rept: Viperidae
in high elevations
1838 Eirenis modestus Martin Only European population, Rept: Colubridae
Thrace and eastern Aegean Sea islands
1839 Algyroides nigropunctatus Duméril & Bibron Western mainland Greece Rept: Lacertidae
(excluding Peloponnese) and Ioanian Islands
/ terra typica in Greece
1840 Rana dalmatina Bonaparte Discontinuous range in mainland Greece Amph: Ranidae
Bonn zoological Bulletin 57 (2): 329-345
©ZFMK
A brief history of Greek herpetology 345
Date Species Author Range Group
1849 Montivipera xanthina Gray Only European population, Rept: Viperidae
Thrace and eastern Aegean Sea islands
1870 Cyrtopodion kotschyi Steindachner Throughout the country Rept: Gekkonidae
1870 Trituris karelinii Strauch Macedonia and Thrace Amph: Salamandridae
1876 Podarcis erhardii Bedriaga Throughout mainland Greece, Rept: Lacertidae
Sporades and Cyclades
/ terra typica in Greece
1881 Hellenolacerta graeca Bedriaga Endemic, Peloponnese Rept: Lacertidae
1882 Pelophylax bedriagae Camerano River Evros, east Aegean Islands Amph: Ranidae
1882 Podarcis milensis Bedriaga Endemic, Milos Arhipelago Rept: Lacertidae
/ terra typica in Greece
1884 Blanus strauchi Bedriaga Only European population, Rept: Amphisbaenidae
Islands of southeastern Aegean Sea
1886 Lacerta trilineata Bedriaga Throughout the country Rept: Lacertidae
/ terra typica in Greece
1889 Pelobates syriacus Boettger Localities in northern Greece Amph: Pelobatidae
and Peloponnese, Lesvos island
1891 Lyciasalamandra luschani Steindachner Only European population, Amph: Salamandridae
Kastellorizo island
1891 Rana graeca Boulenger Mainland Greece Amph: Ranidae
1894 Anguis cephallonicus Werner Endemic, Peloponnese, Rept: Anguidae
Ithaca, Cephalonia and Zakynthos islands
1900 Anatololacerta anatolica | Werner Only European population, Samos island Rept: Lacertidae
/ terra typica in Greece
1904 Anatololacerta oertzeni Werner Only European population, Ikaria, Symi Rept: Lacertidae
and Rhodes islands / terra typica in Greece
1930 Podarcis gaigeae Werner Endemic, Skyros Arhipelago Rept: Lacertidae
/ terra typica in Greece
1935 Macrovipera schweizeri Werner Endemic, Milos Archipelago Rept: Viperidae
and Siphnos island / terra typica in Greece
1940 Pelophylax kurtmuelleri Gayda Mainland Greece, Thassos and Amph: Ranidae
Zakynthos islands, most Cycladic islands
1963 Lyciasalamandra helverseni Pieper Endemic, Karpathos, Kassos Amph: Salamandridae
and Saria islands / terra typica in Greece
1984 Pelophylax epeiroticus Schneider, Western mainland Greece Amph: Ranidae
Sofianidou &
Kyriakopoulou-
Sklavounou
1994
Pelophylax cerigensis
typica in Greece
1994
2008
Pelophylax cretensis
Podarcis cretensis
Beerli, Hotz,
& Uzzell
Beerli, Hotz,
Tunner, Heppich &
Uzzell
Lymberakis,
Poulakakis,
Endemic, Karpathos and
Tunner, Heppich
Endemic, Crete / terra typica in Greece
Endemic, Crete / terra typica in Greece
Amph: Ranidae
Rhodes islands / terra
Amph: Ranidae
Rept: Lacertidae
Kaliontzopoulou,
Mylonas & Valakos
Lymberakis,
Poulakakis,
Kaliontzopoulou,
Mylonas & Valakos
2008 Endemic, islets Pori and Lagouvardos Rept: Lacertidae
close to Antikythira / terra typica in Greece
Podarcis levendis
Bonn zoological Bulletin 57 (2): 329-345 ©ZFMK
|
|
tal
|
ik
‘a i
i 3)
|
{| i
\} i
Hi Hitues
Hi Pee
FSD
|
Weith y
i
|
|
|
|
|
i
|
i
|
il
ae fe
\
i
ti
HHI
i}
i
1}
mi
Bonn zoological Bulletin Volume 57 Issue 2 pp. 347-357 | Bonn, November 2010
The history of reptiles and amphibians at Frankfurt Zoo
Manfred Niekisch
Zoo Frankfurt, Bernhard-Grzimek-Allee 1, D-60316 Frankfurt am Main;
E-mail: [email protected]
Abstract. Reptiles and amphibians were kept in Frankfurt Zoo from the very beginning in 1858. Information on the col-
lection is somewhat fragmentary but still sufficient to draw a picture on its development from then until today. Starting
with just a few reptile cages in the monkey house, reptiles soon became a major attraction for the visitors, and a special
section in the aquarium building was opened for them in 1904. Knowledge about how to keep reptiles and amphibians
was still very poor, but evolved steadily, and shortly before World War II Frankfurt Zoo was famous for its impressive
collection of herps, especially crocodilians. Completely destroyed in 1944, the zoo re-opened only a few months after
the end of war, but it was not until 1957 that the reptile hall on top of the newly erected aquarium building, which now
was called “Exotarium”, could be opened. Having undergone a number of improvements and renovations in the last four
decades, the Frankfurt Exotarium today has a number of remarkable breeding results and is putting — as the whole zoo
—a focus on nature conservation.
Key words: Exotarium, terrarium, herpetological collection, breeding success, nature conservation
THE START WITH A FEW SPECIES
Frankfurt Zoo was opened on 8 August 1858, the second
zoo in Germany after Berlin’s. Reptiles and amphibians
were exhibited here from the beginning. They were shown
in a wing of the monkey house and consisted mainly of
European species. The first Frankfurt Zoo guide published
in 1860 mentions a few tailed amphibians and lizards,
snakes and turtles (see Table 1). That chapter on herps al-
so mentions that there were plans to replace the small “rep-
tiles cage” and aquarium by a bigger facility. The newts
and the salamanders were at that time kept in the aquar-
tum together with the Great Loach (Cobitis fossilis). With
regard to the salamanders, it was stated that the animals
could be found “on the leaves” in the aquarium, but it is
not clear what this means exactly. Were they presented on
leaves floating on the water surface?
Unfortunately, aside from this first small “inventory” of
the reptiles and amphibians kept in Frankfurt Zoo, a sys-
tematic list was started only in the 1950s. Daily reports
contained information on new acquisitions, deaths and
births, and an electronic register for herps has been start-
ed only recently. So there is no detailed, continuous doc-
umentation of the herpetological species kept here from
the beginning until today. Substantial information on rep-
tiles and amphibians in the Frankfurt collection is
Bonn zoological Bulletin 57 (2): 347-357
scattered over a wide range of articles, zoo guides, and
annual reports, allowing one to gain an overall picture with
limited, but nevertheless interesting data.
Despite the growing importance and attractiveness of
Frankfurt Zoo’s herpetological section, not much attention
was paid to it in the zoo publications, as will also be shown
later. For example, the book published on the occasion of
the 100th anniversary of Frankfurt Zoo (Zoologischer
Garten der Stadt Frankfurt am Main 1958) has no picture
of a reptile or amphibian and only one — rather unimpor-
tant — view of the interior of the reptile building from
1957-58.
THE FOUNDING OF THE “DEFINITIVE” ZOO
This first zoo was a huge success as it awoke much inter-
est among the citizens of Frankfurt, but the terrain at the
“Leers’scher Garten” was small and could be rented for
only ten years. As a consequence, the founders of the zoo
decided to find a new location for a bigger and “defini-
tive” zoo. In 1865, the Frankfurt Zoological Society and
the Senate of the City of Frankfurt signed a contract to
establish a new Zoo at the “Pfingstweide”, (then) outside
©ZFMK
348
Manfred Niekisch
Table 1. Herpetological species as mentioned in the first guide to Frankfurt Zoo (Weinland 1860).
Scientific name*
Common name
Remarks (translated from German)
(translated from German)
Lacerta viridis
Pseudopus Pallasii
(scheltopusik, horned serpent)
Tropidonotus natrix var. bilineata
Coronella laevis
Testudo graeca
Testudo polyphemus
Glass snake
Ringed snake
Smooth snake
Greek tortoise
Gopher tortoise
Triton cristatus, igneus, taeniatus
Salamandra maculata
European green lizard
our specimens come from Vienna
eats grass, outside during the summer
on the flamingo meadow during the
summer
Our German water salamanders
Common European salamander
on the leaves
* Note: Scientific names in the whole article, when in quotes, and in this table are given as they are mentioned in the respective
publication and have not been transferred into modern nomenclature.
the City of Frankfurt. Reptiles and fishes had turned out
to be a real attraction for the visitors, and so, from the be-
ginning, the plan for the new zoo included designs for a
herpetological exhibition and aquaria. Due to a number
of complications and especially as a consequence of the
Fig. 1. The ,,romantic Aquarium tower of Frankfurt Zoo abo-
ve the lake in 1880.
Bonn zoological Bulletin 57 (2): 347-357
wars between Prussia and Austria (1866) and France and
Germany (1870-71), this contract never materialized and
the zoo remained — with an extension of the old contract
—at the “Leers’scher Garten” for a few more years. Fi-
nally, under a new contract, the new zoo was opened at
the Pfingstweide on 29 March 1874, at the same place that
had already been envisaged before the wars. Frankfurt Zoo
has remained at this site until today. Thanks to an initia-
tive of Bernhard Grzimek immediately after the Second
World War it was enlarged and now covers eleven
hectares. The city of Frankfurt has grown around it, so to-
day Frankfurt Zoo is in a central location.
SLOW START FOR THE TERRARIUM SECTION
Despite all the plans and good intentions, the construction
of a number of enclosures for mammals and birds and, in
particular, a new aquarium and terrarium building had to
be postponed due to financial and other constraints once
the zoo had moved to its new destination in 1874. But at
least there was substantial planning, and the knowledge
about how to keep fish and herps as well as the develop-
ment of technical means was rapidly increasing right
throughout that period. This is also indicated by the fast
growing number of associations of aquarium and terrari-
um hobbyists in Germany in the last two decades of the
19th century.
To provide the financial means for the aquarium building,
the members of the administrative council and supervi-
sory board provided a loan of 50,000 Reichsmarks. In
1877, the building, comprising two freshwater and 12 sea-
water aquaria and (as far as is known) a few terraria was
©ZFMK
Herpetology at Frankfurt Zoo 349
finally able to be opened. The building was placed inside
an artificial hill, so the walls were insulated and the tem-
perature could be kept relatively constant. The issue of ma-
jor concern and of utmost importance for the aquarium
section, namely water, was solved by erecting a tower with
water tanks inside filled with ground water. This simple
technique, based on gravity, is still functioning today, guar-
anteeing the constant and uniform flow of water into the
filters and aquaria.
The tower was made to look like an old castle or ruin, and,
together with the hill it stands on and the neighbouring
lake, it catered nicely to the romantic taste of that time
(Fig: 1):
An extra entrance fee was charged for the aquarium in or-
der to pay the loan back. So the aquarium had its own en-
trance fee, and only in 1992 was this practice abandoned
and no extra fee was charged any more for visiting the
aquarium.
DIFFICULT TIMES, BUT A STEADY INCREASE IN
EXPERIENCE
The herpetological section had been planned as the sec-
ond storey of the aquarium building and could only be
built later. It finally opened on 15 May 1904. In the ten
years before that, the reptiles seem to have had a rather
difficult life at Frankfurt Zoo. Especially in winter, many
of these animals died because of the poor conditions they
were kept in. It was Wilhelm Haacke, director of the zoo
from 1888 to 1893, in particular, who expanded the rep-
tile collection. During the summer months, when the mon-
keys were kept in outside enclosures, he used the mon-
key house to put boxes with reptiles and amphibians on
exhibit. As can be read in the 1895 zoo guide, the “col-
lection that was outstanding because of its richness ...
[was] usually set up in May, temperatures allowing, and
remained there until October, a few boxes (containing the
giant snakes and bigger lizards) even remaining on show
during the winter”. For that latter purpose, a heated plat-
form (“Warmetisch”’) had been built in 1891.
Fig. 2.
Bonn zoological Bulletin 57 (2): 347-357
In the newly opened “Reptile Hall” sunlight was seen an important factor for the well being of reptiles (1904).
OZFMK
350 Manfred Niekisch
5 Panag) 42 ae .
Fig. 3.
It is plain that mortality was high. The 1895 zoo guide (the
first to be published after ten years!) lists, however, an im-
pressive number of species — or to be more precise: two
crocodiles, eleven turtles, 17 snakes, 22 lizards and ten
Fig. 4.
(1912).
A big specimen of Python reticulatus in its terrarium
Bonn zoological Bulletin 57 (2): 347-357
San
Rit “<
we,
LS W 7h
Mixed life in a tropical jungle environment: Tiliqua rugosa (?), Cordylus giganteus and Macroscincus coctei (1912).
anuran species and three species of urodela. A few of the
comments and specimens are truly remarkable. So
“thanks to the goodness of Mr Schmacker from Shang-
hai”, the collection contained “the first specimen of the
Chinese alligator brought live to Europe” and “two giant
Aldabra turtles (7estudo elephantina)’. With regard to the
latter, the 1895 zoo guide states that “only a few decades
will pass until this turtle of such incredible dimensions will
have become extinct”. “One of the rarest species at the Zo-
ological Garden, the snake-necked turtle, Hydraspis hi-
laire’’”’, was kept together with Chelydra serpentina. “The
Sinai lizard (Uromastix ornatus)” is described as a “very
strange animal. It feeds on rose petals in summer and on
acacia and lettuce in winter; as soon as the sun shines on
its back, it opens certain depressions in the skin and the
body assumes a very beautiful colour”. The lizard species
ranged from Anguis fragilis to “Silubosaurus stokes” and
from “Lacerta muralis” to “Tiliqua gigas”. Aside from
alpine salamander, Japanese giant salamander, bull frog
and Leptodactylus, all amphibians kept at that time were
species that occurred wild in the Frankfurt area.
©ZFMK
Herpetology at Frankfurt Zoo 351
Fig. 5.
(1912).
Tropical jungle landscape made of aquaria and plants
Haake (who by the way had been vividly recommended
by Ernst Haeckel for the post of zoo director) had a well-
developed collector’s mentality but his attempt to estab-
lish systematic collections of birds and herps did not re-
ceive much of a positive response from visitors to the zoo,
and he quit the job in 1893. His immediate successor,
Adalbert Seitz, then started to develop a completely new
concept for a reptile exhibit, recognizing that these ani-
mals needed sunlight. A glasshouse called the “reptile hall”
was erected on top of the aquarium building and inaugu-
rated on 15 May 1904 (Fig. 2). In the venomous snakes
section, increased security measures were introduced in
the year 1906 to offer the keepers better protection. The
number of species had by then risen to twelve turtles, 28
snakes, 25 lizards and 13 amphibians. Evidently there was
some “fluctuation” in the crocodile species, as the 1905
Z00 guide states: “Mostly different species such as the al-
ligator, Nile crocodile, dwarf crocodile etc. are on exhib-
it”. The Chlamydosaurus kingi kept in the collection is said
to be the first specimen “to have reached the European
continent alive”. In 1907, even before becoming zoo di-
rector in 1908, the then zoo assistant, Kurt Priemel, start-
ed changing the concept again. He wanted to show the vis-
itors the diversity of life, abandoning the approach of sys-
tematic collections. He built a second glasshouse next to
the first one, added to the reptile hall 40 aquaria for trop-
ical fish (Fig. 5) and a tropical wetland area for crocodiles
as well as big terraria for giant snakes (Fig. 4) and turned
the reptile house, together with the aquarium, into the
“biggest and most diverse of all such institutions on the
continent” (Scherpner 1983). As visitors to the zoo had
to pay an additional entrance fee for the aquarium and ter-
rarium building, visitor numbers could be easily moni-
tored. The new and enlarged building attracted more than
80,000 people every year.
Bonn zoological Bulletin 57 (2): 347-357
The zoo did not suffer any major physical damage dur-
ing the First World War, but the economically difficult
post-war era obliged director Priemel to be creative. He
made an interesting contract with the animal catcher and
dealer John Hagenbeck. Frankfurt hosted reptiles import-
ed by Hagenbeck and, in exchange, got the pre-emption
rights and a reduced price on the specimens Priemel want-
ed to buy. It is reported that visitors were quite astonished
by a sign saying “for sale” on a big container full of gi-
ant snakes which “none of the visitors managed to count”
(Scherpner 1983).
Soon the reptile collection had reached an impressive di-
mension, and its increasing importance is also document-
ed by a number of articles on it which were published in
the Zoo’s own “Mitteilungen aus dem Frankfurter Zoo”
and elsewhere. One of the authors is Robert Mertens who
did evidently have a close relationship with the zoo, since
he authored seven papers between 1921 and 1925 specif-
ically about the species and specimens kept at Frankfurt
Zoo, and more precisely on the freshwater turtles (1921),
giant snakes (1921, 1924 — the latter one not mentioned
by Schirner 1977), venomous snakes (1925), news from
the reptile house (1922), new animals (1922) and on Cer-
atophrys ornata (1922). An exhaustive paper on the whole
collection of reptiles by Richard Wieschke (1925) gives,
like the articles just mentioned, short notes and comments
on the different species shown and mentions, as a special
attraction, a giant salamander from Japan which was ex-
hibited in an aquarium in the lower basement. From that
description of the collection one can deduce that, in 1925,
there were more than 40 snake species, 28 lizard species,
more than 20 turtles and tortoises (including a loggerhead
sea turtle), and seven crocodile species on exhibit. An in-
teresting detail is the mentioning of a female reticulated
python 8 m in length which, after having undergone “dif-
ficult surgery”, had not taken any food for 16 months be-
fore she finally accepted a piglet. Six anuran and 2 urode-
lan species are specifically mentioned as part of the col-
lection “plus the numerous European frogs, toads, sala-
manders and newts”. Among the amphibians mentioned
are “two giant bull frogs..., and, even more impressive,
two South American horned frogs”, as well as African
clawed frogs “which because of their hopping movements
under water soon got the name ‘water monkeys’”, besides
Pipas, a Japanese giant salamander and a Proteus.
Whereas Robert Mertens 1s well known among herpetol-
ogists even today and does not need to be introduced to
the reader, a few words have to be said about Wieschke.
In one of the articles, his name is given as “Fritz”, in the
other article as “Rich[ard]’”. It was not possible to find out
if Fritz and Rich[ard] Wieschke were the same person —
and “Fritz” a printing error? — or whether and how they
©ZFMK
352 Manfred Niekisch
were related. “Fritz” could not be identified at all, where-
as it is known that Richard was a volunteer assistant, help-
ing out quite actively with many activities in the zoo such
as the administration of the library, keeping the register
of animals and observing them. He published several small
papers in the Mitteilungen, the last one appearing in No-
vember 1928, and, as far as is known, died at the age of
23 ani l929:
A remark in a review authored by zoo director Priemel on
issues | and 2 of Wilhelm Klingelhoffer’s Terrarienkunde
in the Mitteilungen from May 1925 gives an interesting
insight into the concept of reptile keeping. Priemel wel-
comes Klingelhoffer’s approach to arranging the contents
of the terraria in such a way that they resemble the habi-
tat of the species in the wild. Furthermore, he writes that
terraria for schools should always be arranged so that they
imitate nature, but then he goes on to write: “Unfortunate-
ly, the containers in public exhibitions cannot follow this
principle, as so many inhabitants must be kept in them in
order that visitors can observe the major part of them at
any time of the day”.
on
“ea
Fig. 6.
the nght foreground.
Bonn zoological Bulletin 57 (2): 347-357
In the following years, the collection continued to grow
and attracted more and more visitors. Various publications
talk about anacondas, chameleons, Gila monsters and sea
turtles all becoming part of the collection and, of course,
about “Komo”, the tame Komodo monitor lizard which
came to Frankfurt in 1927, only 15 years after this species
had been discovered. It was brought from Komodo to
Frankfurt by Robert Mertens. Frankfurt already had some
experience in taming monitor lizards. Two Varanus sal-
vator had come to Frankfurt Zoo in 1922—23, when they
were just 25 cm long. They were quite aggressive and,
while one died, the other one had grown to a length of
1.35 m by 1926 and thanks to “persistent, gentle, careful
treatment and care” had become tame. Whenever the door
to his enclosure was opened or his name (“Bubchen’”’, lit-
tle boy) was called, he climbed onto the keeper’s shoul-
der and allowed himself to be carried around (Fig. 7).
In that time before World War II, discussions arose about
the rights and wrongs and justifications of keeping ani-
mals “in captivity”, and, as one of the arguments in favour
of zoos, curator Gustav Lederer (1937) published infor-
mation about the longevity of reptiles at Frankfurt Zoo.
Different species, different sizes: A look into the “world renown” crocodile collection in 1925. Note the Macroclemys in
©ZFMK
Herpetology at Frankfurt Zoo 353
——
Fig. 7. Varauns salvator “Bubchen” and his keeper — in the
truest sense of the word! — in 1929.
In that year, the zoo was home to an Alligator mississip-
piensis, a Trionyx triunguis and two Heloderma suspec-
tum that had been living at the zoo since 1905, 1912 and
1927 respectively, as well as a Chinese alligator. The lat-
ter had moved to Frankfurt in 1910 when the Berlin Aquar-
tum had to be closed because of financial problems and
Frankfurt took over its entire reptile collection. This alli-
gator had come to the Berlin Aquarium in 1886 and so had
lived for 30 years in Frankfurt when he died in 1940.
The already highly diverse collection of crocodiles was
enriched by a Jomistoma schlegeli in 1937, raising the
number of species kept to eight. In addition, young and
old, small and large individuals were all kept together (Fig.
6). This crocodile collection is repeatedly referred to as a
major attraction and as “world renowned” (Lederer 1937),
but, looking at it today, it certainly must be regarded as
highly problematic from a zoological point of view as well
as from the aspects of animal welfare. Wieschke (1927)
mentions, for example, that the “newly created tropical
swamp area for crocodiles” is host to “numerous species,
among others a large number of American alligators (A/-
ligator mississippiensis), one of the few surviving speci-
mens of the Chinese alligator, Nile crocodiles, saltwater
crocodiles and African dwarf crocodiles” — each in the plu-
Bonn zoological Bulletin 57 (2): 347-357
ral! A completely new approach to keeping crocodiles was
only introduced around 1975, when this collection was fi-
nally dissolved to create a larger crocodile enclosure.
With the retirement of Kurt Priemel in March 1938, the
dynamic development of the herp collection came to an
end, as his successor, Georg Steinbacher, was more of a
“bird man” and evidently not much interested in reptiles.
The first bombs hit Frankfurt Zoo in October 1943, caus-
ing some limited damage including to the aquarium build-
ing, but most, if not all, of the reptiles survived. The ven-
omous snakes, however, now had to be put down for se-
curity reasons. A few months later, the disastrous bomb-
ing of Frankfurt on 18 March 1944 completely destroyed
the zoo and the aquarium with all its animals (Fig. 9).
ON THE WAY TO A MODERN ZOO: THE PERIOD
AFTER WORLD WAR II
The reconstruction of the zoo, under its new director Bern-
hard Grzimek, started immediately after the end of the war.
The zoo re-opened on | July 1945, offering its visitors a
few animals and a lot of entertainment in the form of all
kinds of cultural events, circus shows, carousels and so
on. The re-building of the aquarium started in 1951 and
the shell of a “24 m long tropical swamp area destined for
the keeping of crocodiles, turtles and so on” had been com-
pleted in 1952. Precisely | chameleon, four snakes, 26 tur-
tles and seven crocodiles were housed in the preliminary
terraria in 1953. From then on, more and more reptiles and
amphibians were acquired by or donated to the zoo. The
building with the new big reptile hall was opened official-
ly on 27 August 1957 and by the end of that year, it had
had 282,084 visitors. There were “giant crocodiles able
to kill a human being” and “gigantic land tortoises 200
years of age” living in the (altogether eleven) “climatic
landscapes”, with plant arrangements giving the visitor the
illusion of being in a tropical jungle.
As the “aquarium” was now housing fish and other aquat-
ic animals, as well as penguins in an Antarctic environ-
ment and a few other birds in the tropical section, along
with many reptile and amphibian species, it was decided
to give it a new name to better reflect the situation and
intention of the building. Since 1954, this building has
therefore been known as the “Exotarium’”’. The innovative
ideas and plans for the Exotarium were basically devel-
oped by Gustav Lederer, who had already been the key
person for the “pre-war” aquarium under director Priemel.
After the war, he became the zoo’s chief curator. How far-
sighted and innovative his thinking was and how careful-
ly he observed his animals is reflected, for example, in his
paper on the “importance of light in animal keeping” (Le-
derer 1927).
©ZFMK
354 Manfred Niekisch
soe et wh wt Whee PU}
%
be
Fig. 8. An unidentified keeper working in the terrarium section (1936).
At the suggestion of Bernhard Grzimek and in recogni-
tion of his merits and the quality of his scientific publi-
cations, he received an honorary doctorate from Frankfurt
University in 1953. He retired on 30 September 1958, af-
ter having served Frankfurt Zoo for 45 years, accompa-
nying it through two world wars and all its ups and downs.
Gustav Lederer died at the age of 69 on 13 February 1962.
THE EXOTARIUM TODAY
Despite all changes, improvements and renovation activ-
ities in the 1980s and 1990s, the concept of the herpeto-
logical section of the Frankfurt Exotarium until today es-
sentially goes back to Gustav Lederer. He was followed
by curator Dieter Backhaus who, in 1973, handed over to
Hartmut Wilke. It was still a time of much “trial and er-
ror’, since knowledge regarding the keeping of reptiles
was still limited. In 1960, a few adult and juvenile spec-
imens of Amblyrhynchus cristatus were even exhibited,
but did not survive the first two years.
Reptiles and amphibians were selected for their “didac-
tic, zoogeographical and ecological aspects” and the zoo
“dispensed with animals which were always hiding away
during opening hours”. Backhaus, as well as his succes-
Fig. 9. | View of the reptile hall after the bombing in 1944.
Bonn zoological Bulletin 57 (2): 347-357 ©ZFMK
Herpetology at Frankfurt Zoo 355
Fig. 10. The Exotarium Tower overlooking the “seal cliffs” (2008). Photograph: Sabine Binger.
sor, constantly tried to improve the living conditions of
the animals, trying out all sorts of lamps, heating equip-
ment and other means to improve the climate control of
the terraria. They also did lots of work on nutrition and
disease prevention and carried out the associated physi-
cal changes and improvements to the building, such as spe-
cial rooms to prepare food, raise foraging animals and
raise newly born reptiles and amphibians. Terraria were
equipped with appropriate soil substrate for digging
species as well as stones and trees for climbing species,
in addition to hiding places and other structures, paving
the way to modern reptile keeping. Another remarkable
change was the renovation of the crocodile enclosure
which had made it necessary to give up the crocodile col-
lection in around 1975 and to send the gharial (which had
been living at Frankfurt Zoo since 1958) to the Gharial
Breeding Centre in Orissa, India in 1979. After the reno-
vation of the building had been completed, Nile crocodiles
returned to the zoo in 1977, but the enclosure turned out
to be unsuitable for that aggressive species.
Finally, in 1990, Frankfurt Zoo started keeping Australian
freshwater crocodiles, which started breeding regularly in
1994 and still do so today. This is one of the many breed-
ing successes at the Frankfurt Exotarium since Rudolf
Wicker became its curator in 1984. He took over at a time
when again some necessary renovation work had started,
and so the opportunity to build a big landscape terrartum
Bonn zoological Bulletin 57 (2): 347-357
for freshwater tortoises (1987) was seized. The group of
Cyclura cornuta then consisted of shy and aggressive an-
imals. They had come to the zoo in 1974, but Wicker re-
placed them by ten new animals imported from the zoo
in Santo Domingo. These animals laid eggs for the first
time in 1987, but the keeping facility was not the most
favourable in many aspects, and there was little breeding
success. Just a few weeks after they had been moved to
anewly built enclosure in 1991, they started breeding suc-
cessfully and have done so ever since.
Other remarkable breeding successes of the last two
decades have been the Phelsuma klemmeri from Mada-
gascar, Varanus salvator cumingi and Erymnochelys
madagascariensis, as well as the Laemanctus serratus and
Petrosaurus thalassianus that were all bred in Frankfurt
for the first time ever under human care. Our specimens
of Crocodylus johnsoni form the only breeding group out-
side Australia, and Frankfurt Zoo keeps and breeds
Ctenosaura bakeri, the highly endangered iguana from
Utila island.
Especially as Frankfurt Zoo has made nature conservation
in situ and ex situ one of its top priorities, its close coop-
eration with the Customs Service at Frankfurt Airport must
also be noted. Every year, this results in hundreds of rep-
tiles being seized from travellers or commercial shipments
at Frankfurt Airport and being brought to the Exotarium
OZFMK
oS)
n
on
Fig. 11.
(2008). Photograph: Sabine Binger.
— even rare animals such as a few Psammobates from two
different species. Some of the shipments seized contain
quite a number of specimens, for example 300 Geoche-
lone elegans or more than 70 Cordylus mossambicus and
C. rhodesianus and, repeatedly, also large numbers of poi-
son arrow frogs. Particularly with regard to the more com-
mon species and relatively high numbers of specimens, it
is extremely difficult to find appropriate people and in-
stitutions willing and able to take them on. All these an-
imals are lost to the natural world as they cannot usually
be taken back and released into the wild.
One exception was the case of five hawksbill turtles
(Eretmochelys imbricata) in 2009. Dogs trained to detect
CITES species at Frankfurt Airport discovered the eggs
in the luggage of a tourist. The eggs were brought to the
Exotarium, and, as they looked good, were put into an in-
cubator. During the following days, the turtles hatched and
were kept in an aquarium until they had reached a length
of around 20 cm. As it was known from which beach in
the Seychelles they had been collected, they could be sent
Bonn zoological Bulletin 57 (2): 347-357
Manfred Niekisch
sda aoe. “ : ~
The entrance to the Frankfurt Exotarium still preserves the charm and character of the 1950s when it was rebuilt
back and were released into the sea by the local authori-
ties. The media attention was huge, and so this success-
ful, but quite untypical, story could be accompanied by
the message that one should not take home souvenirs of
endangered and protected species.
Generally, species conservation aspects today play an im-
portant role in Frankfurt Zoo, and this, of course, also ap-
plies to the Exotarium. This building, with its long and
interesting history and its rich collection of reptiles and
amphibians, is certainly one of the best places in Frank-
furt Zoo to demonstrate to the visitors the multitude of
forms, colours, adaptations and other expressions of the
diversity of life. Today, there is neither a separate entrance
fee nor any counting of the number of visitors to the Ex-
otarium, but, in all probability, it may be assumed that al-
most all the visitors to Frankfurt Zoo (more than 900,000
per year!) also visit the Exotarium. Showing around 170
adult specimens of 29 amphibian species and more than
400 reptiles from 68 species, it is and remains one of the
main attractions of Frankfurt Zoo.
©ZFMK
Herpetology at Frankfurt Zoo 357
Sabine Binger.
REFERENCES
Anonymous (1895) Fiihrer durch den Zoologischen Garten zu
Frankfurt am Main.
Lederer G (1927) Die Bedeutung des Lichtes in der Tierpflege.
Blatter ftir Aquarien- und Terrarienkunde 37: 36-42, 63-64
Lederer G (1937) Merkwiirdigkeiten und Seltenheiten im
Frankfurter Tiergarten-Aquarium. Frankfurter Zoo-Zeitung 13:
37-38
Mertens R (1921) Die StiRwasserschildkréten des Frankfurter
Zoologischen Gartens. Lacerta 1: 55—56
Mertens R (1921) Die Riesenschlangen des Frankfurter Zoolo-
gischen Gartens. Blatter ftir Aquarien- und Terrarienkunde 32:
277-278
Mertens R (1922) Neues aus dem Reptilienhause des Zoologi-
schen Gartens in Frankfurt am Main. Naturwissenschaftlicher
Beobachter 63: 43-44
Mertens R (1922) Neue Tiere. Naturwissenschaftlicher Beobach-
ter 63: 173
Mertens R (1922) Schmuckhornfrésche (Ceratophrys ornata
Bell) im Frankfurter Zoologischen Garten. Naturwissenschaft-
licher Beobachter 63: 208
Mertens R (1924) Riesenschlangen. Mitteilungen aus dem Frank-
furter Zoo 2: 6—7, 10-11
Mertens R (1925) Giftschlangen. Mitteilungen aus dem Frank-
furter Zoo 4: 6-11
Bonn zoological Bulletin 57 (2): 347-357
Priemel K (1925) Buchbesprechung “Terrarienkunde”. Mittei-
lungen aus dem Frankfurter Zoo 5: 20-21
Scherpner C (1983) Von Burgern ftir Biirger — 125 Jahre Zoo-
logischer Garten Frankfurt am Main
Schirner E. (1977) Die Veroffentlichungen von Robert Mertens.
Courier Forschungsinstitut Senckenberg 20: 12-104. Frank-
furt am Main
Weinland D F (1860) Fiihrer durch den Zoologischen Garten in
Frankfurt am Main. Verlag der Zoologischen Gesellschaft,
Frankfurt
Wieschke F (1924) Echsen des Frankfurter Aquariums — Mit-
teilungen aus dem Frankfurter Zoo 5: 14-16
Wieschke R (1925) Die Reptilienabteilung unseres Zoo. Mittei-
lungen aus dem Frankfurter Zoo 2: 12-13, 20-28
Wieschke R (1927) Die Tropische Sumpfanlage ftir Krokodile.
Mitteilungen aus dem Frankfurter Zoo 4: 2
Zoologischer Garten der Stadt Frankfurt am Main (Ed.) (1958)
Hundertjahriger Zoo in Frankfurt am Main
Zoologischer Garten der Stadt Frankfurt am Main (Ed.) (no year)
Jahresbericht des Zoologischen Gartens der Stadt Frankfurt
a. M. 116-130 fiir 1974-1991. Report of the Zoological Gar-
dens [sic!] of Frankfurt 116-130 for 1974-1991
Received: 25.VIII.2010
Accepted: 25.1X.2010
OZFMK
0
Nii Te
el
Bonn zoological Bulletin Volume 57 Issue 2 pp. 359-366 Bonn, November 2010
Tetramorium boehmei sp. n. —
a new ant (Hymenoptera: Formicidae) species
from the Kakamega Forest, Western Kenya
Francisco Hita Garcia, Georg Fischer, Patrick Kick, Birthe Thormann & Marcell K. Peters
Zoological Research Museum Koenig, Adenaueralle 160, D-53113 Bonn, Germany.
E-mails: [email protected]; [email protected]; [email protected];
[email protected]; [email protected]
Abstract. Tetramorium boehmei Hita Garcia & Fischer sp. n. — a new ant species from the Kakamega Forest in Western
Kenya is described. The new species can be placed in the 7etramorium camerunense species group and differs signifi-
cantly from the other members of the group by its highly reduced sculpturation on head and mesosoma. With only two
available specimens sampled in undisturbed primary forest, Zetramorium boehmei sp. n. seems to be a relatively rare en-
demic species. Additionally, a first key to the Tetramorium species groups found in the Kakamega Forest is provided.
Keywords. Ants, Kakamega Forest, species group key, taxonomy, 7etramorium, Tetramorium camerunense species group.
INTRODUCTION
The ant genus 7etramorium Mayr, 1855 is almost global-
ly distributed, and with over 430 described species one of
the most species-rich genera worldwide (Bolton 1995; B
Bolton, Isle of Wight, pers. comm. 2010). The Afrotrop-
ical zoogeographic region holds the largest diversity with
over 210 listed Tetramorium species (Bolton 1976, 1980,
1985, 1995; Hita Garcia et al. 2010).
The Kakamega Forest, one of the last indigenous forests
in Kenya, and its animal diversity have received consid-
erable scientific attention in the last decades (e.g. Claus-
nitzer 1999, 2005; Copeland et al. 2005; Hita Garcia et
al. 2009; Kitihne 2008; Schick et al. 2005; Tattersfield et
al. 2001; Wagner & Bohme 2007; Zimmermann 1972).
Generally, the forest is considered to be the eastern-most
relict of the equatorial Guineo-Congolian lowland rain for-
est belt (Kokwaro 1988; Wagner et al. 2008; Zimmermann
1972). The strong biogeographic affinities to West and
Central African forests can be clearly seen in some fau-
nal elements like reptiles, dragonflies, and ants (Claus-
nitzer 2005; Hita Garcia et al. 2009; Wagner et al. 2008).
The ant fauna proved to be remarkably diverse with 288
species from 52 genera and 11 subfamilies constituting the
second highest species richness reported for the Afrotrop-
ical zoogeographic region (Hita Garcia et al. 2009). By
far the most species-rich genus in Kakamega Forest was
Tetramorium with more than 40 species belonging to 14
Bonn zoological Bulletin 57 (2): 359-366
species groups (Hita Garcia et al. 2009; FHG, unpub-
lished). The Zetramorium camerunense species group was
well represented with four species: Tetramorium lu-
cayanum Wheeler, W.M., 1905, Tetramorium cf. gegaimi
Forel, 1916, and two undescribed species.
Recent taxonomic work was primarily focused on the
Tetramorium weitzeckeri species group with the descrip-
tion of Tetramorium snellingi Hita Garcia, Fischer & Pe-
ters, 2010 and a species group revision for the whole
Afrotropical region (FHG, unpublished). However, around
10 species or 25% of the Tetramorium fauna of the
Kakamega Forest still remain undescribed. With this work
we present a first preliminary key to the 7etramorium
species groups present in the Kakamega Forest and de-
scribe a new species belonging to the 7’ camerunense
species group.
MATERIAL AND METHODS
The type material has been deposited in the following in-
stitutions:
NMK: National Museums of Kenya, Nairobi, Kenya
ZFMK: Zoological Research Museum Koenig, Bonn, Ger-
many
©ZFMK
360 Fancisco Hita Garcia et al.
Both, holotype and paratype, were measured with an
Olympus SZX 12 stereomicroscope equipped with a dual-
axis optical micrometer at a magnification of 90x. The fol-
lowing measurements and indices, in parts adapted from
Bolton (1980) and Gusten et al. (2006), were used:
Head length (HL): maximum distance from the mid-point
of the anterior clypeal margin to the mid-point of the oc-
cipital margin, measured in full-face view.
Head width (HW): width of head directly behind the eyes
measured in full-face view.
Scape length (SL): maximum scape length excluding basal
condyle and neck.
Eye length (EL): maximum diameter of compound eye
measured in oblique lateral view.
Pronotal width (PW): maximum width of pronotum meas-
ured in dorsal view.
Weber’s length (WL): diagonal length of mesosoma in lat-
eral view from the postero-ventral margin of propodeal
lobe to the anterior-most point of pronotal slope, exclud-
ing the neck.
Propodeal spine length (PSL): in dorsocaudad view, the
tip of the measured spine, its base, and the centre of the
propodeal concavity between the spines must all be in fo-
cus. Using a dual-axis micrometer the spine length is
measured from the tip of the spine to a virtual point at its
base where the spine axis meets orthogonally with a line
leading to the median point of the concavity.
Petiole length (PTL): maximum length of petiolar node
measured in dorsal view.
Petiole height (PTH): maximum height of petiolar node
measured in lateral view from the highest (median) point
of the node to the ventral outline. The measuring line is
placed in an orthogonal angle to the ventral outline of the
node.
Petiole width (PTW): maximum width of petiolar node
measured in dorsal view.
Postpetiole length (PPL): maximum length of postpetiole
measured in dorsal view.
Postpetiole height (PPH): maximum height of the post-
petiole measured in lateral view from the highest (medi-
an) point of the node to the ventral outline. The measur-
ing line is placed in an orthogonal angle to the ventral out-
line of the node.
Bonn zoological Bulletin 57 (2): 359-366
Postpetiole width (PPW): maximum width of postpetiole
measured in dorsal view.
Ocular index (OI): EL / HW * 100
Cephalic index (CI): HW / HL * 100
Scape index (SI): SL/ HW * 100
Propodeal spine index (PSLI): PSL / HL * 100
Petiolar node index (PeNI): PTW / PW * 100
Lateral petiole index (LPel): PTL / PTH * 100
Dorsal petiole index (DPel): PTW / PTL * 100
Postpetiolar node index (PpNI): PTW / PW * 100
Lateral postpetiole index (LPpI): PPL / PPH * 100
Dorsal postpetiole index (DPpI): PPW / PPL * 100
Postpetiole index (PPI): PPW / PTW * 100
Measurements and indices are presented as minimum and
maximum values. Additionally, all measurements are ex-
pressed in mm and presented with three decimal places.
The digital colour images were produced with a QImag-
ing Micropublisher 5.0 RTV camera attached on a LEICA
Z6 APO stereo-microscope and mounted with Syn-
croscopy Auto-Montage software (version 5.03). The
mounted images were processed for publication with
Adobe Photoshop CS2 and ImageJ. All images present-
ed in this work are also online available at Antweb (Fish-
er, 2002). Furthermore, holotype and paratype are unique-
ly identified with specimen-level codes (e.g.
CASENT0217239) affixed to each pin.
Total genomic DNA was extracted from two dissected sin-
gle legs of the holotype, using the Qiagen
DNeasy®Blood&Tissue Kit, following the manufacturers’
protocol. DNA was eluted with 50 ul buffer AE; this step
was repeated once to maximize yield.
A ca. 650 bp long fragment of the 5’-region of the cy-
tochrome c oxidase subunit I (COI), the standard DNA
barcode-marker for animals, was amplified using the
primers LCO 1490 and Nancy (5’-GGT CAA CAA ATC
ATA AAG ATA TTG G-3’ and 5’-CCC GGT AAA ATT
AAA ATA TAA ACT TC -3’; Folmer et al. 1994) and the
Qiagen® Multiplex PCR Kit. Amplification reactions were
carried out in a 20 pl volume containing 10 ul QIAGEN
Multiplex PCR Mastermix, 2 111 Q-Solution, 1.6 pl of each
primer (both 10 pmol/ul), and 2.5 tp] DNA template, and
filled up to 20 ul with sterile HO. The PCR temperature
profile consisted of an initial denaturation at 95° (15 min),
followed by 40 cycles at 94° (35 s, denaturation), 48.5°
(90 s, annealing), 72° (90 s, extension), and a final exten-
sion at 72° (10 min). PCR success was checked by elec-
trophoresis on an 1.5% agarose gel containing ethidium
bromide. The PCR product was purified using 3 pl of the
ExoSAP-IT® PCR purification reagent following the man-
ufacturers’ protocol.
©ZFMK
A new species of Zetramorium from the Kakamega Forest 36]
The sample was bidirectionally sequenced by a commer-
cial company (Macrogen Inc., Seoul, Republic of Korea;
http://www.macrogen.com) using PCR primers. BLAST
search confirmed belonging of the sequence to the genus
Tetramorium. The sequence is deposited in GenBank (ac-
cession number HM753586).
KEY TO THE TETRAMORIUM SPECIES GROUPS
FOUND IN KAKAMEGA
The following key to species groups is adapted from
Bolton (1976, 1980) and specific for the Kakamega For-
est, though it also works for Western Kenya in general:
1. Whole body covered with regularly branched hairs,
either bifid or trifid, giving the ant a woolly or furry
APPS ALAN CE teeter ene aesere oe elaeines. iene Seen ctes 2
— Hairs generally simple, rarely bizarrely modified, but
never regularly branched bifid nor trifid as above . 3
2 Antennae 11-segmented; elongate simple hairs pres-
ent along the antennal scapes and upper borders of the
DROWN CTGTIVEYS, ccsnooseccosasdascocospsecedz0so000 T. ericae group
— Antennae 12-segmented; elongate simple hairs absent
along the antennal scapes and upper borders of the
PO MCaleCARMNAC Heese ceseseee cee eee T. gabonense group
Smeemtcmmac lil =seommemte dees esac eccesecesstesccascrsenessstses 4
SP AMLemmMac I 2-SeCmeMte ds a-..-cresccersceecessce-eeeeeseeeeeree 5
4 Petiolar node squamiform to high nodiform, never
blocky nodiform with sharply defined angles.
paqgacadoodadoOdaed Here reRe nee eee eRe OE Se T. weitzeckeri group
— Petiolar node strongly blocky nodiform, generally
with sharply defined angles. ... 77 angulinode group
5 Lateral portion of clypeus prominent, raised to a tooth
or crest in full-face view; in dorsal view the lateral
clypeal portions rise to a high peak in front of the an-
tennal insertions and then slope down towards the me-
dian part of the clypeus. ............ T. sericeiventre group
— Lateral portion of clypeus not modified as above. . 6
6 Antennal scapes very long (always SI > 120); frontal
carinae weakly developed and short, at most reach-
ing the posterior eye margins. ....... T: aculeatum group
— Antennal scapes distinctly shorter than above (always
SIO) strontalicarinae wantablet eee ssere-eeeeeeee-c- a
7 Propodeum armed with a pair of small triangular teeth
or denticles which at most are as large as the
pro podeallObesh eres c eee eee seer eee senses 8
— Propodeum armed with a pair of medium-sized to
long spines which are noticeably larger than the
propodeallObes: 2s es. vicssscecascn a5. sscasscanckseecess eae hones cose 12
Bonn zoological Bulletin 57 (2): 359-366
8 Anterior clypeal margin with median impression.
Bear cence: Metre ssute ae eniny tnaieess T. dumezi group (in parts)
= AntentorclypealitmareimCmtines <c-.-<.cccc-cecesoeeeeve-ee--s- 9
9 Tibiae with short appressed pubescence. ................ 10
— Tibiae with subdecumbent to erect pilosity or pubes-
(AEINC SS sanacacenrbotenceoshcooneGee neste ecto eae te Dacca ere Tra 11
10 Hairs on dorsal mesosoma and gaster usually sparse,
short, stout, and blunted ............... T. simillimum group
— Hairs on dorsal mesosoma and gaster usually numer-
ous, elongate and fine ........... T. quadridentatum group
11 Frontal carinae long, usually reaching occiput.
BAe Cone TR ene ERT ERT T: dumezi group (in parts)
— Frontal carinae short and weakly developed, ending
BUCVC CVC leet et teres nc tae cies T. convexum group
12 Anterior clypeal margin with median impression. .. 13
— Anterior clypeal margin entire, without a median im-
ORCS SIO Meese eee ene ta ae cea tee Rees ae Sieh shade eaeeaten cs 14
13 Occipital region of head variably rugose, rugulose or
unsculptured, rarely with few anastomoses, without
MU SO=Ne CCUM ees eeseeeeesee ene T. camerunense group
— Occipital region of head distinctly rugo-reticulate.
PS i es cne T. bicarinatum group
14 Eyes larger, at least 9 ommatidia in the longest row.
ee eter cece cucne tere teneeav one ohne eats T. setigerum group
— Eyes smaller, at most 7 to 8 ommatidia in the longest
TON Nio- egeoneacc soncmagnaen tactcceeete ua ace nese T. flabellum group
Tetramorium camerunense species group
Examination of the new species led to the conclusion that
it can be easily placed in the 7 camerunense species
group. Though the species group was well defined in
Bolton (1980) it seems useful to reproduce it here:
1. antennae 12-segmented
antennal scape relatively small to moderate (SI < 90)
3. anterior clypeal margin generally with small median
impression (absent in one species)
4. frontal carinae long and fine, generally reaching pos-
terior eye margin, sometimes running to occipital mar-
gin
5. antennal scrobe weakly developed
6. propodeal spines of varying length, but always
longer than propodeal lobes
7. mandibles generally smooth and shining, rarely fine-
ly striate
clypeus with three longitudinal rugae
9. cephalic dorsum usually finely longitudinally rugu-
eo
OZFMK
362 Fancisco Hita Garcia et al.
Figs 1-2. Tetramorium boehmei sp. n., holotype worker, CASENT0217238. 1 dorsum of body; 2 body in profile.
Bonn zoological Bulletin 57 (2): 359-366 ©ZFMK
A new species of Zetramorium from the Kakamega Forest 363
Figs 3-4.
lose, without cross-meshes; occipital rugoreticulum
never developed
10. all dorsal body surfaces with numerous standing hairs
11. dorsal surfaces of hind tibiae generally with decum-
bent to appressed pubescence only, in two species
suberect
12. sting appendage triangular, dentiform or pennant-
shaped
Prior to this study, the 7’ camerunense species group con-
tained 12 species that were subdivided into two species
complexes based on differences in sculpturation (Bolton
1980). The 7 lucayanum complex, containing four
species, can be characterized by the presence of sculptured
mandibles, petiole and postpetiole. One or both of the
waist segments are generally strongly sculptured. The oth-
er and larger complex, the 77 camerunense complex with
eight species, possesses typically unsculptured waist seg-
ments and mandibles.
Tetramorium boehmei Hita Garcia & Fischer sp. n.
(Figs 1—6)
Holotype worker, KENYA, Western Province, Kakamega
Forest, Colobus, 00° 21’ 16” N, 34° 51’ 36” E, 1650 m,
primary rain forest, hand collected, VII.2009, leg. G. Fis-
cher (NMK: CASENT0217238). Paratype worker,
KENYA, Western Province, Kakamega Forest, Salazar,
00° 19° 36” N, 34° 52’ 14.6” E, 1650 m, Kakamega For-
est survey 2007, Transect 6, primary forest, Winkler leaf
litter extraction, 21.V1I.2007, leg. M. Peters (ZFMK:
CASENT0217239).
Bonn zoological Bulletin 57 (2): 359-366
Tetramorium boehmei sp. n.. 3 holotype worker, CASENT0217238, full-face view of head; 4 paratype worker,
CASENT0217239, full-face view of head.
Diagnosis. The highly reduced cephalic and mesosomal
sculpturation renders Tetramorium boehmei straightfor-
wardly recognizable within the 7? camerunense species
group.
DESCRIPTION
HL 0.700-0.772; HW 0.633-0.711; SL 0.533—0.578; EL
0.122-0.139; PW 0.450-0.489; WL 0.822—0.900; PSL
0.150—0.189; PTL 0.194—0.200; PTH 0.211—0.239; PTW
0.178-0.189; PPL 0.189—0.200; PPH 0.194—0.222; PPW
0.250—0.267; CI 90-92; SI 82-84; OI 19-20; PSLI 21-24;
PeNI 39-40; LPel 84-92; DPel 91—94; PpNI 55-56; LP-
pI 90-97; DPpI 132-133; PPI 141 (2 measured).
Head longer than wide (CI 90-92). Anterior clypeal mar-
gin with small but distinct median notch. Frontal carinae
fine and relatively weak, even weaker behind eye level and
significantly not reaching occipital margin. Antennal
scrobe very weakly developed, nearly vestigial. Antennal
scape of moderate length, not reaching posterior margin
of head (SI 82-84). Eyes small to moderate (OI 19-20),
with 8 to 9 ommatidia in longest row. Metanotal groove
not impressed. Propodeal spines moderately sized (PSLI
21-24), relatively thin, spinose and straight. Propodeal
lobes small, elongate-triangular and acute, always short-
er than propodeal spines. Petiolar node nodiform, in pro-
file weakly higher than long (LPel 84—92), in dorsal view
slightly longer than wide (DPel 91—94) and posteriorly
wider than anteriorly. Postpetiole rounded, in dorsal view
around 1.3 times wider than long (DPpI 132-133), and
around 1.4 times wider than petiole (PPI 141); in lateral
view weakly higher than long (LPpI 90-97). Sting ap-
pendage triangular.
OZFMK
364 Fancisco Hita Garcia et al.
Figs 5-6. Tetramorium boehmei sp. n., paratype worker, CASENT0217239. 5 dorsum of body; 6 body in profile.
Bonn zoological Bulletin 57 (2): 359-366
©ZFMK
A new species of Zetramorium from the Kakamega Forest 365
Mandibles either unsculptured, smooth and shining or
finely striate. Clypeus with three longitudinal rugae, me-
dian ruga stronger developed than lateral rugae. Cephal-
ic sculpturation greatly reduced, laterally with only weak
partial rugulation, mostly smooth and shining; cephalic
dorsum with 5—6 very weak and fine, widely spaced lon-
gitudinal rugulae between frontal carina, most of them bro-
ken along their length and never reaching occipital mar-
gin, occipital region unsculptured. Cephalic ground
sculpturation absent, generally smooth and shining. Lat-
eral mesosoma anteriorly mostly unsculptured, smooth and
shiny, posteriorly with weak irregular rugulation; dorsum
of mesosoma unsculptured or with few weak rugulae, or
traces of rugulae only, generally smooth and shining. Peti-
ole either completely unsculptured or with traces of sculp-
ture; postpetiole and gaster completely unsculptured,
smooth and shiny.
All dorsal surfaces of head, mesosoma, both waist seg-
ments and gaster with numerous long, simple, suberect to
erect hairs. Fine pubescence on antennal scapes and tib-
ia appressed to subdecumbent.
Head, mesosoma, waist segments, and gaster very dark
brown to black, antennae, mandibles, and legs of lighter
brownish colour.
Queen and male unknown.
Etymology. The new species is dedicated to Prof. Dr.
Wolfgang Bohme from Bonn, Germany, in honour of his
nearly four decades of passionate herpetological work at
the Zoological Research Museum Koenig in Bonn. Fur-
thermore, with his encouraging, and always interesting,
lectures, courses and excursions he had a significant pos-
itive influence on the authors leading to their scientific
dedication with zoological systematics and the Afrotrop-
ical zoogeographical region.
Notes. Generally, it is not recommendable for large and
diverse genera as 7etramorium to describe single species
based only on few specimens outside a comprehensive
generic revision. Nevertheless, in the case of 7’ boehmei
it seems justified for the following reasons. First, it does
fit all group characters and can therefore easily be iden-
tified as a T. camerunense species group member, either
by using the species group key presented above or the one
in Bolton (1980). Within the 7’ camerunense species group
it obviously belongs to the 7? camerunense species com-
plex because of the unsculptured petiole and postpetiole.
Second, and more importantly, 77 boehmei shows a re-
markable character combination that varies significantly
from the other members of the species group, and allows
an easy and clear identification. The single best diagnos-
tic character to separate T. boehmei from the rest of the
Bonn zoological Bulletin 57 (2): 359-366
group is the almost completely reduced sculpturation on
head and mesosoma. This reduction to a few weak rugu-
lae on the cephalic dorsum, and even less sculpturation
on the mesosomal dorsum, is unique in the species group.
All other species possess a distinctly longitudinally rugose
or rugulose head and mesosoma, though variable from
species to species, and sometimes irregularly shaped.
It has to be mentioned that the holotype and paratype dif-
fer in some aspects that could be considered as sufficient
enough to divide them into two different species. First, the
mandibular sculpturation is completely smooth and shiny
in the holotype while it is longitudinally striate in the
paratype. This character is usually species-specific and
could be considered as a good diagnostic tool to divide
them. Second, the paratype is larger and possesses more
sculpture on head and mesosoma than the holotype which
appears generally much more smooth and shining. Fur-
thermore, the clypeal notch is distinct in both species but
stronger developed in the paratype. However, at present,
the observed variation is considered as intraspecific vari-
ation until more material becomes available. Apart from
the noted differences there is a striking morphological sim-
ilarity between both specimens and also the morphomet-
ric measurements of both are very close. Concluding,
based on the analysis of two specimens, it would be pre-
mature to describe them as different species.
Currently, the new species seems to be endemic to the
Kakamega Forest in Western Kenya where it was sampled
in primary forest sites. Considering the high sampling ef-
fort to assess the ant fauna of the Kakamega Forest (Hi-
ta Garcia et al. 2009), and the only two available speci-
mens of 7. boehmei, it seems to be a rather rare species.
In addition, only little information is available on its bi-
ology. One specimen was found in a Winkler leaf litter ex-
traction sample and one was hand collected from the
ground. Considering this, the new species could be regard-
ed as a rare terrestrial species, living either in the ground
or the leaf litter. Though, it might also be possible that 7°
boehmei lives in the lower vegetation or the canopy, and
the two specimens were only accidentally collected by the
mentioned methods (the canopy ant fauna was consider-
ably less well sampled by the authors than the ground liv-
ing ant fauna). At present, taking into account our knowl-
edge of the leaf litter fauna of the Kakamega Forest, we
consider the leaf litter hypothesis as more likely. The over-
all morphological appearance with small to moderate eyes
and antennal scapes as well as the strongly reduced body
sculpturation are within the genus 7etramorium more of-
ten found in the leaf litter than in the canopy where species
tend to have larger eyes and scapes. However, more spec-
imens from more sampling events are necessary to reveal
the preferred stratum of 7: boehmei. Furthermore, it should
be noted that 7 boehmei was sampled in the two least dis-
©ZFMK
366 Fancisco Hita Garcia et al.
turbed primary forest sites examined in the Kakamega For-
est (FHG, unpublished data). This might indicate that the
new species prefers undisturbed primary forest and reacts
negatively to anthropogenic disturbance like selective log-
ging.
Acknowledgements. First, we want to thank Philipp Wagner,
ZFMK, for making this more entomological and less herpeto-
logical publication possible within the Festschrift. Then, we are
very grateful to Barry Bolton, Isle of Wight, U.K., who was so
kind to review an early draft of the manuscript, and provide help-
ful comments. In addition, we thank Brian Fisher, California
Academy of Sciences, San Francisco, U.S.A., for his coopera-
tion with the images, Antweb, and also for reviewing the man-
uscript and helping to improve it. Furthermore, we would like
to thank Prof. Dr. Johann Wolfgang Wagele, ZFMK, for his gen-
eral help. In addition, we are thankful for the assistance provid-
ed by the invertebrate lab of the National Museums of Kenya
in Nairobi and the Kenya Wildlife Service in Kakamega. This
work was funded by the German Ministry of Education and Re-
search (BMBF) within the BIOLOG programme (BIOTA East
Africa subproject E16 [01LC0625A2}).
REFERENCES
Bolton B (1976) The ant tribe Tetramoriini (Hymenoptera:
Formicidae). Constituent genera, review of smaller genera and
revision of Triglyphothrix Forel. Bulletin of the British Mu-
seum (Natural History) Entomology 34: 281-379
Bolton B (1980) The ant tribe Tetramoriini (Hymenoptera:
Formicidae). The genus Zetramorium Mayr in the Ethiopian
zoogeographical region. Bulletin of the British Museum (Nat-
ural History) Entomology 40: 193-384
Bolton B (1985) The ant genus Trig/yphotrix Forel a synonym
of Tetramorium Mayr (Hymenoptera: Formicidae). Journal of
Natural History 19: 243-248
Bolton B (1995) A new general catalogue of the ants of the world.
Harvard University Press, Cambridge
Clausnitzer V (1999) Dragonfly (Odonata) records of Kakamega
Forest, Western Kenya, with notes on the ecology of rain for-
est species. Journal of East African Natural History 88: 17—23
Clausnitzer V (2005) An updated checklist of the dragonflies
(Odonata) of the Kakamega Forest, Kenya. Journal of East
African Natural History 94: 239-246
Copeland RS, Okeka W, Freidberg A, Merz B, White IM, De
Meyer M, Luke Q (2005) Fruit flies (Diptera: Tephritidae) of
Kakamega Forest, Kenya. Journal of East African Natural His-
tory 94: 247-278
Bonn zoological Bulletin 57 (2): 359-366
Fisher BL (2002) Antweb (California Academy of Sciences, San
Francisco,U.S.A.). Online at http://www.antweb.org last ac-
cessed on July 20, 2010
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA
primers for amplification of mitochondrial cytochrome c ox-
idase subunit I from diverse metazoan invertebrates. Molec-
ular Marine Biology and Biotechnology 3: 2942299
Hita Garcia F, Fischer G, Peters MK, Wagele JW (2009) A pre-
liminary checklist of the ants (Hymenoptera: Formicidae) of
Kakamega Forest (Kenya). Journal of East African Natural
History 98: 147-165
Hita Garcia F, Fischer G, Peters MK (2010) Zetramorium snellin-
gi sp. n. — a new leaf-litter ant species (Hymenoptera: Form1-
cidae) from a Western Kenyan rain forest. Myrmecological
News 13: 141-146
Giisten R, Schulz A, Sanetra M (2006) Redescription of Tetramo-
rium forte Forel, 1904 (Hymenoptera: Formicidae), a west-
ern Mediterranean ant species. Zootaxa 1310: 1-35
Kokwaro JO (1988) Conservation status of the Kakamega For-
est in Kenya — the easternmost relict of the equatorial rain
forests of Africa. Monographs in Systematic Botany of the
Missouri Botanical Garden 25: 471-489
Kihne L (2008) Butterflies and moth diversity of the Kakame-
ga Forest (Kenya). Brandenburgische Universitatsdruckerei,
Potsdam-Babelsberg
Mayr G (1855) Formicina austriaca. Beschreibung der bisher im
oesterreichischen Kaiserstaate aufgefundenen Ameisen nebst
Hinzufuegung jener in Deutschland, in der Schweiz und in Ita-
lien vorkommenden Ameisen. Verhandlungen des Zoologisch-
Botanischen Vereins in Wien 5: 273-478
Schick S, Veith M, Létters S (2005) Distribution patterns of am-
phibians from the Kakamega Forest, Kenya. African Journal
of Herpetology 54: 185-190
Tattersfield P, Seddon MB, Lange CN (2001) Land-snail faunas
in indigenous rainforest and commercial forestry plantations
in Kakamega Forest, Western Kenya. Biodiversity and Con-
servation 10: 1809-1829
Wagner P, Bohme W (2007) Herpetofauna Kakamegensis — the
amphibians and reptiles of Kakamega Forest, western Kenya.
Bonner zoologische Beitrage 55: 123—150
Wagner P, Kohler J, Schmitz A, Bohme W (2008) The biogeo-
graphical assignment of a west Kenyan rain forest remnant:
further evidence from analysis of its reptile fauna. Journal of
Biogeography 35: 1349-1361
Zimmerman DA (1972) The avifauna of Kakamega Forest, West-
ern Kenya, including a bird population study. Bulletin of the
American Museum of Natural History 149: 257-337
Received: 05.VII.2010
Accepted: 20.VII.2010
©OZFMK
Bonn zoological Bulletin Volume 57 | Issue 2 ‘) pp. 367-373
Bonn, November 2010
Homeless mammals from the Ionian and Aegean islands
Marco Masseti
Dipartimento di Biologia Evoluzionistica “Leo Pardi” dell’ Universita di Firenze,
Via del Proconsolo, 12, I-50122 Firenze, Italia; E-mail: [email protected].
Abstract. The paper present information about several mammalian species reported erroneously from the Ionian and Aegean
islands and the occurrence of stuffed specimens in museum collections which reveal intriguing stories about their ori-
gins, especially about the islands from which they were collected. According to scientific and popular literature, these
islands were often not numbered among the original homelands, nor even the territories of the artificial distribution of
the species. So it is almost impossible today to understand why and how certain specimens reached these islands, espe-
cially in the case of those which were dangerous predators for the livestock, and even humans. This is the case, for ex-
ample, of the Asia Minor Leopard, Panthera pardus tulliana Valenciennes, 1856, which today figures among the collec-
tions of the Natural History Museum of the Aegean, in the village of Mytelenii on the island of Samos.
Keywords. museum specimens, Ionian and Aegean islands, continental mammals, Asia Minor leopard.
INTRODUCTION
Scientific travellers and other authors of the past have oc-
casionally reported the diffusion on the Ionian and Aegean
islands of several mammalian species today completely
unknown among the relative faunal assemblages (Fig. 1).
Werner (1928) for example quoted the occurrence of a
kind of squirrel on the island of Skyros (Northern Spo-
rades), where he collected a specimen between the villages
of Skyros and Linaria which he recognized as Sciurus
lilaeus. According to Ellerman & Morrison-Scott (1951),
this taxon is used to define a Greek subspecies of the red
squirrel, Sciurus vulgaris lilaeus Miller, 1907, character-
istic of the region of Mount Parnassus in continental
Greece. Nevertheless, the occurrence of the same species
on Skyros was subsequently also recorded by other au-
thors such as Wettstein (1942) or Cheylan (1988) in re-
cent times. On the basis of the authority of Werner, and
to an even greater extent that of Wettstein, it is very dif-
ficult to refute the truth of these reports, even if red squir-
rels are today completely unknown on Skyros and the oth-
er islands of the Aegean and Ionian basin. Perhaps with
the exception of Euboea, the natural occurrence of these
rodents is, even on the rest of the Mediterranean insular
environments, practically unknown. Their presence on
some of these islands, such as Veli Briyuni (Croatia) (Scot-
ti 1980), is essentially regarded as a consequence of re-
cent human intervention (Masseti 2005). Representatives
of the genus Sciurus Linnaeus, 1758, occur also on Les-
bos (Ondrias 1966; Hecht-Markou 1994, 1999; Gavish &
Gurnell 1999; Thorington & Hoffman 2005) and the
Bonn zoological Bulletin 57 (2): 367-373
Turkish island of Gékceada (Imbros) (Ozkan 1995, 1999;
Gavish & Gurnell 1999). These islands are, however, in-
habited by another species of the genus, the Persian squir-
rel, Sciurus anomalus Gueldenstaedt, 1785, whose west-
ernmost continental distribution extends to far-eastern Eu-
rope and western Anatolia (Gavish & Gurnell 1999). At
the same time, however, there 1s no evidence to exclude
the former diffusion of red squirrels on Skyros, where a
population could have existed up to the first half of the
20th century, later becoming extinct. Red squirrels could
have been imported by man onto the island from the near-
by island of Euboea, where their presence was already re-
ported by Lindermayer (1835). In the light of modern eth-
nozoological enquiry, it would also appear that red squir-
rels figure among those mammal species which have been
the subject of particular human attention for a variety of
cultural purposes. In the Levant, for example, people still
eat Persian squirrels and live specimens are regularly sold
in the markets (Mendelssohn & Yom-Tov 1999).
SPECIES ERRONEOUSLY REPORTED FROM
THE IONIAN AND AEGEAN ARCHIPELAGOS
Travellers of the past have often erroneously reported
certain mammalian species from the Greek islands.
According to Lindermayer (1835), the blind mole Zalpa
caeca Savi, 1822, was dispersed on Euboea. However this
19th century report strikes a false note, since the species
©ZFMK
368 Marco Masseti
oa
{ aad
2 _ iia f
| oF @tassos\__ y = t
Q o LX Se
¢ —) Ga SS
" Gokceada L
LA
(nies) Yy
GS
Sy
~
COR
~. \
SS ey S
Ne
Euboea
\ Se Samos j
NB Tinos b
- WO) SUN Bena
Se PS GSP) ee Ikaria. . Ly
\ VSS ¥
D Se00
_ Naxos Q
Si mee OO -- =f a)
p cianass Sane A Cai
eas) aes -O q
OS > es 2 ;
> Santorini ~ x
(Thera) =
0 3 (
ioe Crete j whe
iS)
Fig. 1. | Map with the locations of the Ionian and Aegean is-
lands mentioned in the text.
is limited in its south-eastern European distributional range
to the continental Balkan peninsula. No moles have ever
been reported from the eastern Mediterranean islands, with
the only exception of the Balkan mole Talpa stankovici
V. Martino & E. Martino, 1931 on the islands of Corfu
(Niethammer 1962, 1990; KryStufek 1999a) and
Cephalonia (Catsadorakis 1985; Giagia-Athanassopoulou
1998; Stamatopoulos, in verbis). Wettstein (1942)
observed another species, the crested porcupine Hystrix
cristata Linnaeus, 1758, but mentioned that local people
referred to its presence on the Eastern Aegean islands of
Ikaria and Lesbos. He (Wettstein 1942) added that this
might have been the result of confusion with a hedgehog,
the today dispersed Northern white-breasted hedgehog
Erinaceus roumanicus Barrett-Hamilton, 1900 (Krystufek
et al. 2009). Effectively, the Greek term used to indicate
the hedgehog is skanzohiros, which means “spiny pig”,
which is probably the reason of a confusion with the
English “porcupine” (and/or the Italian “porcospino” and
the French “porc-épic’’). Moreover, the common porcupine
has never been reported from the Balkan peninsula
(Masseti et al. in press), while the Indian crested
porcupine, Hystrix indica Kerr, 1792 is known from
Anatolia with an occurrence further east to the Near East,
including Arabia, Kashmir, Nepal and through peninsular
India to Sri Lanka (Harrison & Bates 1991). These
publications are probably the baseline of several unproven
reports. Cheylan (1988) still quoted the occurrence of
“Hystrix cristata” (sic) on the Eastern Aegean islands of
Rhodes, Ikaria and Lesbos. The occurrence of Microtus
subterraneus (de Sélys-Longchamos, 1836) was reported
from Euboea by Cheylan (1988), while Niethammer
(1982) and Krystufek (1999b) mentioned it as absent from
Bonn zoological Bulletin 57 (2): 367-373
the entire Mediterranean coast and islands (see also
Masseti 2009). A label without specimen, written by
Ioannis C. Ondrias himself, in the mammal collection of
the University of Patras (coll. no. 3158) reports the
occurrence of the common vole Microtus arvalis (Pallas,
1779), from the area of Mytilene in south-eastern Lesbos.
But, according to Stella Fraguedakis Tsolis (in litteris 13th
July 2006), this species does not appear to exist or to have
ever existed on this island. Furthermore, the specimen to
which the label referred has unfortunately been lost.
Contrary, the presence of Gunther’s vole M. guentheri
(Danford & Alston, 1880) is known from Lesbos
(Stamatopoulos & Ondrias 1995), but according to
Krystufek & & Vohralik (2005) this is the only record
from all Mediterranean islands so far.
THE INSULAR EDIBLE DORMICE
Erroneous evaluations, or rather inattentive reading of pub-
lications of early authors have supported cultural models
which are still difficult to eradicate, e.g. the consideration
of the diffusion of several species of glirids in the Greek
islands. One example is the erroneously supposed occur-
rence of the forest dormouse Dryomys nitedula (Pallas,
1778). Erhard (1858) reported the occurrence of Myoxus
nitela Schreber, 1782, a species of glirid, similar in name
to the forest dormouse from Andros, Naxos and Siphnos,
where it occurred in orchards and orange groves. This re-
port supported the assumption that this rodent occurs on
these islands, but in reality the taxonomic classification
does not correspond to that of the forest dormouse. Ac-
cording to Ellerman & Morrison-Scott (1951) Myoxus
nitela is indicated as one of the synonyms of Eliomys
quercinus (Linnaeus, 1766; garden dormouse), a species
currently unknown in the Aegean area and being wide-
spread in the central-western Mediterranean basin. Here
it is not found further east than Dalmatia and the north-
western Balkan Peninsula. Although according to
Krystufek (1999b), this forest dormouse does not occur
on Mediterranean islands, Cheylan (1988) reported it from
Euboea. Recently, the presence of the forest dormouse was
reported on the island of Andros, which is still an uncon-
firmed record (Chondropoulos & Fraguedakis-Tsolis, in
verbis). We have, on the other hand, known for some time
of the presence of the edible dormouse on islands such as
Crete (Zimmermann 1953; Kahmann 1959; Niethammer
& Krapp 1978; Catsadorakis 1994), Euboea (Ondrias
1966), Corfu (Niethammer 1962; Niethammer & Krapp
1978) and Cephalonia (Niethammer & Krapp 1978; Cat-
sadorakis 1985; Giagia-Athanassopoulou 1998). On the
latter island, its occurrence has been recently confirmed
by H. Pieper (in litteris), whereas Dimaki (1999) provid-
ed arguments for the existence of the species on Andros.
According to H. Alivitzatos & A. Lane (in verbis), the ed-
©ZFMK
Homeless mammals from Ionian & Aegean islands
ible dormouse is also present on the island of Thassos
where they mentioned its occurrence in the surroundings
of the village of Panaghia, on 30 August 2000. Wettstein
(1942) reports the occurrence of a dormouse, possibly the
forest dormouse, from Rhodes, but according to other au-
thors the species is still unknown here (cf. Festa 1914; De
Beaux 1929; Zimmermann 1953). A remarkable human
impact on the geographical distribution of some dormouse
species in the Mediterranean region was observed by
Carpaneto & Cristaldi (1994), Colonnelli et al. (2000) and
Masseti (2005). The population density can be document-
ed since antiquity through historical and biogeographical
analyses, supported by paleontological and archaeozoo-
logical data. Furthermore, ethnozoological enquiries doc-
ument the utilisation of dormice for food or medicine,
through traditional captive-breeding techniques, up to very
recent historical times.
HOMELESS GREEK ISLAND CARNIVORES IN
THE EUROPEAN MUSEUMS
Several European natural history museums conserve ma-
terial collected on the Greek islands which create prob-
lems in the attempt to arrive at their origins. This is the
case, in the lynx, Lynx lynx (Linnaeus, 1758), collected
on the island of Corfu and part of the collection of the Mu-
seum Alexander Koenig in Bonn, registered under the col-
lection number ZFMK 93423. The specimen was pur-
chased by Jochen Niethammer during the mammalogical
exploration of the island. But the occurrence of the lynx
on Corfu was very questionable and immediately resolved
by the collector himself. Niethammer reported that he had
bought it at the market, where he had been told that it orig-
inated from northern Greece, more specifically from
Macedonia. In other cases specimens represent species
which are in fact completely unknown to the islands which
they are reported to originate from. In some cases, species
have recently become extinct, like jackals from Corfu rep-
resented in the collections of the Museum Koenig
(ZFMK 61193, 93420). Dispersed in the Balkan and Ana-
tolian peninsulas, the Golden or Asiatic jackal Canis au-
reus Linnaeus, 1758 has been reported from Corfu (Ni-
ethammer 1962; Douma-Petridou 1977; Adamakopoulos
et al. 1991; Demeter & Spassov 1993), Cephalonia (Deme-
ter & Spassov 1993), Lefkada (Douma-Petridou 1977;
Demeter & Spassov 1993) and Kythera (Jameson 1836,
1937), while other authors mentioned its occurrence on
Ikaria (Atanassov 1955) and Skyros (Werner 1928;
Wettstein 1942; Atanassov 1955). Ioannidis & Giannatos
(1991) surveyed with positive results the island of Samos
where jackals exist in the same habitats as in the rest of
the southern Balkan Peninsula. Following the account of
the expedition to the Greek archipelago published by the
botanist Joseph P. de Tournefort (1717), Clarke (1801) ob-
Bonn zoological Bulletin 57 (2): 367-373
369
Fig. 2.
Stuffed specimen of the badger Meles meles collec-
ted on the island of Santorini (Thera) in 1859, and part of the
collection of the Zoological Museum of the University of Athens
(ZMUA 128) (photo Anastasios Legakis; courtesy Zoological
Museum of the University of Athens).
served that “Samos is infested with wolves”. Anyway, this
record should refer to jackals rather than wolves. There
is in fact no evidence for the occurrence of the latter
canides on the Greek islands of the late Holocene. Accord-
ing to Ioannidis & Giannatos (1991), the jackal no longer
exists on Corfu, Kythera, Skyros and Ikaria, where it pos-
sibly became extinct in very recent historical times, but
jackals vanished from Corfu not before 1991-1992
(Grémuillet, in verbis). The only Aegean islands where the
species still survives are Euboea (Demeter & Spassov
1993) and Samos (Laar & Daan 1967; Douma-Petridou
1977; Adamakopoulos et al. 1991; Ioannidis & Giannatos
1991; Demeter & Spassov 1993; Ioannidis et al. 1996;
Dimitropoulos et al. 1998).
Among the collections of the Greek museums, there are
several specimens that provoke questions which are still
far from having been satisfactorily answered. For exam-
ple, there is a stuffed badger, Meles meles (Linnaeus,
1758) today on display at the Zoological Museum of the
University of Athens (ZMUA 128, Fig. 2) and collected
on the island of Santorini (Thera) by K. Bassiliou in 1859.
This specimen is intriguing because of the old age and it
is the only record of the badger from this island. Accord-
ing to Schmalfuss (1991) the species is today unknown
from Santorini. If the origin of the ZMUA specimen is cor-
rect, the species must have become extinct around the end
of the nineteenth century because Douglas (1892) did not
mention the badger in his list of the insular mammals. San-
torini should therefore be added to the distribution areas
of the badger within the Aegean islands. Known in Greek
as asvos, the badger was recorded from Cephalonia (Cat-
sadorakis 1985), Rhodes (Festa 1914; Tortonese 1973) and
Crete (Raulin 1859; Barrett-Hamilton 1899; Bate 1906,
©ZFMK
370 Marco Masseti
Fig. 3.
Detail of the early 16th century wall decoration sho-
wing the “Life of St. Benedict” in the Great Cloister of the mo-
nastery of Monte Oliveto Maggiore (Siena, Italy) painted by the
Italian artist Giovanni Antonio Bazzi.
1913; Miller 1907, 1912; Zimmermann 1953; Ondrias
1965; Ragni et al. 1999) where it is locally indicated by
the vernacular term arkalos. In the course of the present
study, it was possible to confirm its occurrence on the is-
lands of Tinos, where it is locally known as chakalos
(Gaetlich, pers. com.), Euboea, Crete, Rhodes, and pos-
sibly Andros (Gaetlich, pers. com.). There are unconfirmed
records of badgers from Siphnos (Erhard 1858; Heldre-
ich 1978; Cheylan 1988), but this does not exclude a pri-
ori the possibility of a previously more widespread dis-
tribution in the Aegean basin, and more specifically on the
Cyclades. Moreover, the human practice of the 1mporta-
tion of badgers onto the Greek islands is documented since
prehistorical times. On Crete the oldest bones of M. meles
were discovered in the Aceramic Neolithic levels at Knos-
sos, while Ceramic Neolithic and later levels produced nu-
merous remains of the species (Jarman 1996). Other os-
teological material was found on the site of Aghia Tria-
da, and Kavousi-Vroda and has been respectively referred
to the Ancient Minoan period (about 3,000—2,200 B.C.)
(Wilkens 1996), and to the Late Minoan HI C (Klipper &
Snyder 1991; Snyder & Klippel 1996). It is not immedi-
ately apparent why human should have wanted to intro-
duce badgers onto the islands, which is suggested because
otherwise they would not have been able to pass unob-
served on the small boats employed to reach the new ter-
ritories (Vigne 1988, 1995; Masseti 1995). Since very an-
Bonn zoological Bulletin 57 (2): 367-373
cient times, they may have played an important role in hu-
man societies, both symbolically and as food. Badgers
might also have been utilised for their fur (Masseti 1995).
Moreover, in medieval Europe another use of this
mustelid has been documented. Wall paintings from the
early 16th century (Fig. 3) at the monastery of Monte
Oliveto Maggiore (Siena, Italy), painted by the Italian Gio-
vanni Antonio Bazzi, better known as Sodoma, clearly
show badgers as pets, very likely representing an authen-
tic status symbol that underscored the affluence and so-
cial position of their owner, the painter himself (Carli
1980).
LEOPARDS
REMARKS
ON SAMOS - CONCLUDING
A stuffed adult leopard (Fig. 4) is on display at the Natural
History Museum of the Aegean in Mytelenti, on the Greek
island of Samos (Masseti 2000). This specimen previously
belonged to the Town Council (Greek: Nomarkia) and has
been exhibited there for several decades (Ioannidis et al.
1996; Dimitropoulos et al. 1998). On its label it is
classified as kap/ani, with the explanation that this is the
Samian terminology indicating a species of panther.
However, the word derives from the Turkish term kaplan,
commonly used in Anatolia to indicate the tiger, and
erroneously also the leopard (Danford & Alston 1880). On
the basis of available information, it is today not possible
to ascertain the age and the origin the specimen. It is said
that the leopard was killed on the island between 1870 and
1880, but there is no evidence that this is correct. The title
of one of the most famous novels of the contemporary
Samian writer Alki Zei, To kaplani tis vitrinas (~The
kaplani of the showcase), better known however as
Wildcat under glass, was inspired by this leopard.
Speaking of her childhood, the author described this
kaplani, and since she was born in 1936, it can be
presumed that the leopard is older. Unfortunately, the
Samian specimen is of an unnatural shape because it has
been rather inexpertly stuffed, and hardly recalls the form
of a living individual. It has a total length of about 235
cm and tail length of 90 cm, apparently proving that this
specimen is a large one. But since the skin of felids is
extremely elastic, the original dimensions could have been
altered during the taxidermic procedure. The coat colour
has deteriorated due to bad preservation conditions, and
its prolonged display under daylight. The hair of the skin
is worn in patches, but it seems that originally the
colouration was tawny or buff on the back and paler on
the flanks, where it could have merged into the white of
the belly. Today, the entire coat is uniform pale, with dark-
brown rosettes along the flanks and the back, which are
fairly large (about 34 cm in diameter), widely spaced and
thinly rimmed, with the centres slightly darker than the
©ZFMK
Homeless mammals from Ionian & Aegean islands 37]
Fig. 4.
The stuffed specimen of Asia Minor leopard, Panthera pardus tulliana Valenciennes, 1856, shown at the Natural Histo-
ry Museum of the Aegean, Samos (Greece) (photo Marco Masseti; courtesy Natural History Museum of the Aegean, Mytelenii,
Samos).
ground tint. The coat is fairly short and full, the hair on
the nape is long, and the tail is decidedly bushy.
According to the colouration and coat pattern, this
specimen could belong to the Anatolian leopard Panthera
pardus tulliana, as mentioned by Valenciennes (1856),
Pocock (1930) and Leyhausen (1991), and clearly distinct
from other Near Eastern subspecies (Masseti 2000). It has
also been said that the animal arrived at Samos from the
opposite coast of Turkey, swimming across the channel
separating the island from western Anatolia. In fact there
is a deeply-rooted traditional belief on Samos which refer
to leopards swimming from Anatolia in various periods.
This was reported by Tournefort (1717) who confirmed
this legend, observing that: ““‘// y passe quelques tigres
qui viennent de terre ferme par le Petit Boghas’’. Petit
Boghas was the name used at this time to indicate the
above mentioned channel. Clarke (1801) followed this
observation and mentioned that: “tigers sometimes arrive
from the mainland, after crossing the little Boccaze;
thereby confirming all observation made by the author in
the former section, with regard to the existence of triggers
in Asia Minor’. However, Tournefort (1717) report was
probably not based on an own observation, but rather
Bonn zoological Bulletin 57 (2): 367-373
inspired by local people. In any case, since the distance
between the island and the mainland is not more than 1.7
km, it cannot be excluded that leopards could have reached
the island by swimming, at various times. These felids are
good swimmers and could have come e.g. from the
Samsundag area (Masseti 2000) which was until the early
1970s the last western Anatolian stronghold of the species
(Kumerloeve 1971; Avci 1978; Ulrich & Riffel 1993;
Masseti 2000).
Acknowledgements. I would like to express my appreciation
and gratitude to the following friends and colleagues for their
suggestions and assistance while the preparation of the present
paper: Wolfgang Bohme and Rainer Hutterer, Zoologisches
Forschungsmuseum Alexander Koenig, Bonn; Suleyman
Karakaya and Suleyman Kagar, Forest Department of Antalya
(Turkey); Ioannis C. Ondrias, Basil Chondropoulos, Stella
Fraguedakis-Tsolis and A. Stamatopoulos, Department of Biol-
ogy of the University of Patras; Martin Gaetlich, Zoological Mu-
seum of the University of Athens; Xavier Gremillet, SOS Otter
Network Sizun, France; Achilleas Dimitropoulos, Maria Dima-
ki and Yannis Ioannidis, Goulandris Natural History Museum,
Athens; and Anastasios Legakis, Department of Biology of the
University of Athens.
©ZFMK
372. Marco Masseti
REFERENCES
Adamakopoulos P, Adamakopoulos T, Bousbouras D, Giannatos
G, Hatzirvassanis V, Yoannidis Y, Papaioannou DH, Sfougaris
A (1991) Les grand Mamiféres de Gréce (Carnivores et Ar-
tiodactyles): situation actuelle, repartition, habitats - les es-
peces menacees, perspectives de protection. Biologia Gallo-
hellenica 18: 107—126
Atanassov N (1955) The jackal (Canis aureus L.) in Bulgaria.
Comptes Rendus Acad. Bulg. Sci. Sofia 8 (4): 61-63
Avci O (1978) Dilek Yarimadasi Milli Parki. Unpub. MS for
Dilek Yarimadasi Milli Park fiefi. Orman Fakiiltesi, Istanbul
Universitesi, 4 pp.
Barrett-Hamilton G (1899) Note on the Beech Marten and Bad-
ger of Crete. Ann. Mag. Nat. Hist. London 7 (4): 383-384
Bate DMA (1906) On the mammals of Crete. Proc. Zool. Soc.
London 2: 315-323
Bate DMA (1913) The Mammals of Crete. In Trevor-Battye A
(ed.) Camping in Crete. Witherby & Co., London, pp. 254-256
Carli E (1980) Le storie di San Benedetto a Monteoliveto Mag-
giore. Silvana Editoriale/Monte dei Paschi di Siena, Siena, 184
Pp.
Carpaneto GM, Cristaldi M (1994) Dormice and man: a review
of past and present relations. Hystrix The Italian Journal of
Mammalogy 6 (1-2): 303-330
Catsadorakis G (1985) HMpokatapKtky Kkataypagyn tt tavidac
Kat dtagmowmv drayetpittKMV BeuatwV ToL eOvLKOL SpLLLLLOL
Awvot (Kepaanviat). AevOuvon Aaowy Kegaanviat, Cephalo-
nia, 25 pp.
Catsadorakis G (1994) The vertebrate animals of Samaria Na-
tional Park (Crete, Greece). Biologia Gallo-hellenica 22: 9-22
Cheylan G (1988) Compte-rendu de la table ronde: répartition
géographique et statut des mammiferes menaces dans les iles
méditerranéennes. Bull. Ecol. 19 (2-3): 481-484
Clarke ED (1801): Travels in various countries of Europe, Asia
and Africa. / First Part, Russia Tartary and Turkey. 2nd ed.
(1810). Xxviu, T. Cadell and W. Davies, London, 812 pp.
Colonnelli G, Carpaneto GM, Cristalli M (2000) Uso alimenta-
re e allevamento del ghiro (Myoxus glis) presso gli antichi ro-
mani: materiale e documenti. In Atti del 2° Convegno
Nazionale di Archeozoologia. Asti, 14-16 novembre 1997.
Abaco Edizioni, Forli, 315—325
Danford CG, Alston ER (1880) On the Mammals of Asia Mi-
nor. Part I. Proceedings of the Scientific Meetings of the Zo-
ological Society of London 1880: 50-64
De Beaux O (1929) Mammiferi. In Ghigi A. (ed.): Ricerche fau-
nistiche nelle isole italiane dell’ Egeo. Archivio Zoologico Ital-
iano 12-13: 135-154
Demeter A, Spassov N (1993) Canis aureus Linnaeus, 1758 -
Schakal, Goldschakal. In Stubbe M. & Krapp, F. (eds.) Hand-
buch der Saugetiere Europas. Raubsauger 1. Aula Verlag,
Wiesbaden, pp. 107-138
Dimaki M (1999) First record of the edible dormouse Giis glis
(L., 1766) from the Greek island of Andros. Ann. Musei
Goulandris 10: 181-183
Dimitropoulos A, Dimaki M, Ioannidis I. (1998) The animals
and wetlands, close to human settlements. Contribution to is-
land fauna 14, Athens, 180 pp.
Douglas G (1892) Zur Fauna Santorins. Zool. Anz. Leipzig 15:
453-455
Douma-Petridou E (1977) Systematics and geographical distri-
bution of the families Canidae and Mustelidae in the Pelopon-
nese (in Greek). Unpl. Manuscript. University of Patras, 197
pp.
Bonn zoological Bulletin 57 (2): 367-373
Ellerman JR, Morrison-Scott TCS (1951) Checklist of Palaearc-
tic and Indian mammals 1758 to 1946. British Museum (Nat-
ural History), London, 810 pp.
Erhard D (1858) Fauna der Cykladen. Die Wirbelthiere der Cyk-
laden, Nebst einem Anhange tiber deren Pflanzendecke. Voigt
and Gunther, Leipzig, 117 pp.
Festa E (1914) Escursioni del Dr. Enrico Festa nell’ Isola di Ro-
di. Mammiferi. Boll. Mus. Zool. Anat. Comparata R. Univ.
Torino 686: 1-21
Gavish L, Gurnell J (1999) Sciurus anomalus Gildenstaedt,
1785. In Mitchell-Jones AJ et al. (eds.) The Atlas of the Eu-
ropean mammals. Academic Press, London, pp. 176-177
Giagia-Athanassopoulou E (1998) Ta OnAaotika — Mammals.
In Efthymiatou-Katsouni N (ed.) Dedication to the National
Park of Ainos. Museum of Natural History, Cephalonia and
Ithaca, pp. 159-161
Harrison DL, Bates PJJ (1991) The Mammals of Arabia. Har-
rison Zoological Museum, Sevenoaks (England), 354 pp.
Hecht-Markou P (1994) Beschreibung, geografische Verbreitung,
Biotope und Ortswechsel des Sciurus anomalus Gildenstaedt,
1785 auf der Insel Lesbos (Griechenland). Ann. Musei
Goulandris 9: 429-444
Hecht-Markou P (1999) Das Markieren des Lebenraumes von
Sciurus anomalus auf der Insel Lesbos. Ann. Musei Goulan-
dris 10: 201-221
Heldreich T (1878) La faune de la Gréce. Ie Partie. Animaux ver-
tebrés. Expos. Univ. de Paris en 1878
Ioannidis Y, Giannatos G (1991) Preliminary survey on the dis-
tribution and status of jackal (Canis aureus L., 1758) in south-
ern Greece. Biologia Gallo-hellenica 18 (1): 67-74
Ioannidis I, Dimaki M, Dimiropoulos A (1996) Saugetiere auf
Samos. In Samiakes M (ed) Samiotische Studien, B 1995-
1996; Pnevmatiko Idryma Samou “Nikolaos Dimitriou”;
Athen, S. 465-468
Jameson R (1836) Naturgeschichte der Insel Cerigo. Isis (Oken)
1838 (2): 127-130
Jameson R (1837) Notes on the Natural History and Statistics
of the Island of Cerigo et its dependencies. The Edinburgh
New Philosoph. Journal Oct. 1936-Apr. 1937, 22: 62-69
Jarman MR (1996) Human Influence in the Development of the
Cretan Mammalian Fauna. In Reese DS (ed.) Pleistocene and
Holocene Fauna of Crete and its First Settlers. Prehistory
Press, Madison (Wisconsin), pp. 211-239
Kahmann H (1959) Notes sur le statut actuel de quelques mam-
miféres menacés dans la région méditerranéenne. Mammalia
3: 329-331
Klipper WE, Snyder LM (1991) Dark age fauna from Kavousi,
Crete. The vertebrates from the 1987 and 1988 excavations.
Hesperia 60: 179-186
Krystufek B (1999a) Talpa stankovici V. Martino & E. Martino,
1931. In Mitchell-Jones, A.J. et al. (eds.) The Atlas of
European Mammals. Academic Press, London, pp. 88-89
Krystufek B (1999b) Dryomys nitedula (Pallas, 1778). In
Mitchell-Jones, A.J. et al. (eds.) The Atlas of European
mammals. Academic Press, London, pp. 300-301
Krystufek B, Vohralik V (2005) Mammals of Turkey and Cyprus.
Rodentia I: Sciuridae, Dipodidae, Gliridae, Arvicolinae.
University of Primorska, Koper (Slovenia), 292 pp.
Krystufek B, Tvrtkovie N, Paunovice M, Ozkan B (2009) Size
variation in the Northern white-breasted hedgehog, Erinaceus
roumanicus: latitudinal cline and island rule. Mammalia 73:
209-306
Kumerloeve H (1971) Zum Stand des Vorkommens von Pan-
thera pardus tulliana Valenciennes, 1856 in Kleinasiaen. Zo-
ol. Garten N.F., Leipzig 40: 4-22
©ZFMK
Homeless mammals from Ionian & Aegean islands By3
Laar V, Daan S (1967) The Etruscan Shrew, Suncus etruscus
(Savi, 1822), found on Samos, Greece. Zeitschrift ftir
Saugetierkunde 32: 174-175
Leyhausen P (1990) The subspecies question. Cat News 15:
17-18
Lindermayer D (1835) Euboea. Eine naturhistorische Skizze.
Bulletin de la Société Impériale de Naturalistes de Moscou,
XXVIII. Imprimerie de |’ Université Impériale, Moscou: 27-30
Masseti M (1995) Quaternary biogeography of the Mustelidae
family on the Mediterranean islands. Hystrix The Italian Jour-
nal of Mammalogy 7 (1-2): 17-34
Masseti M (2000) Wild cats (Mammalia, Carnivora) of Anato-
lia. With some observations on the former and present occur-
rence of leopards in south-eastern Turkey and on the Greek
island of Samos. Biogeographia 20: 607-618
Masseti M (2005) Natural and anthropochorous squirrels and
dormice of the Mediterranean Region. Hystrix The Italian
Journal of Mammalogy 16 (1): 3-26
Masseti M (2009) Mammals of the Mediterranean islands: ho-
mogenization and the loss of biodiversity. Mammalia 73:
169-202
Masseti M, Albarella U, De Grossi Mazzorin J (in press) The
crested porcupine, Hystrix cristata L., 1758, in Italy. Anthro-
pozoologica
Mendelssohn H, Yom-Tov Y (1999) Fauna Palaestina. Mammalia
of Israel. The Israel Academy of Sciences and Humanities,
Jerusalem, 439 pp.
Miller GS (1907) Some new European Insectivora and Carnivo-
ra. Ann. Mag. N. H. London, Sez. 20: 389-398
Miller G (1912) Catalogue of the mammals of Western Europe
(Europe exclusive of Russia). British Museum (Natural His-
tory), London, 1019 pp.
Mitchell-Jones AJ, Amori G, Bogdanowicz W, Krystufek B, Rei-
jnders PJH, Spitzenberger F, Stubbe M, Thissen JBM, Vohra-
lik V, Zima J (eds) The Atlas of the European mammals. Aca-
demic Press, London, 484 pp.
Niethammer J (1962) Die Saugetiere von Korfu. Bonner zool-
ogische Beitrage 13: 1-49
Niethammer J (1982) Microtus subterraneus (De Sélys-
Longchamps, 1836) — Kurzohrmaus. In Niethammer J,
Krapp F (eds.) Handbuch der Saugetiere Europas. Bd. 2/I Ro-
dentia I]. Akademische Verlagsgesellscahft, Wiesbaden, pp.
397-418
Niethammer J (1990) TYalpa stankovici V. et E. Martino, 1931
— Balkan-Maulwurf. In Niethammer J, Krapp F (eds.) Hand-
buch der Séugetiere Europas. Bd. 3/I (Insektenfresser, Her-
rentiere). AULA-Verlag GmbH, Wiesbaden, pp. 141-144
Niethammer J, Krapp F (1978) Handbuch der Saugetiere Eu-
ropas. Band 1. Rodentia 1. Aula Verlag, Wiesbaden
Ondrias JC (1965) Die Saéugetiere Grienchenlands. Saugetierk.
Mitt. 13: 109-127
Ondrias JC (1966) The taxonomy and geographical distribution
of the rodents of Greece. Saugetierk. Mitt. 14: 1-136
Ozkan B (1995) Gékeada ve Bozcaada Adalarinin Kemiricileri.
Trakya Universitesi, Edirne, unpublished PhD thesis
Ozkan B (1999) Gékceada ve Bozcaada Kemirici Faunasi (Mam-
malia; Rodentia). Turkish Journal of Zoology 23: 133-147
Pocock RI (1930) The Panthers and Ounces of Asia. Journal of
the Bombay Nat. Hist. Soc. 34: 63-82, 307-336
Bonn zoological Bulletin 57 (2): 367-373
Ragni B, Masseti M, Roussos T, Belardinelli A, Cicconi P (1999)
The carnivores of the island of Crete, Greece. Contributions
to the Zoogeography and Ecology of the Eastern Mediter-
ranean Region 1: 117—123
Raulin V (1859) La Crete en 1845. Description physique de l’ile
de Crete. Livre I. Th. Lafargue, Bordeaux (Editions de l’En-
tre-deux-Mers/Entre-deux-Mers - Régions d’Europe, Saint-
Quentin—de-Baron, 2009), 159 pp.
Schmalfuss H (1991) Santorin. Leben auf Schutt und Asche. Ein
naturkundlicher Reiseftihrer. Verlag Josef Margraf-Scientific
Books, Weikersheim, 85 pp.
Scotti G (1980) L’arcipelago del Quarnero. Mursia, Milano, 270
pp.
Snyder ML, Klippel WE (1996) The Cretan badger (Meles
meles) as a food resource at Late Bronze/Early Iron Age
Kavousi-Kastro. In Reese DS (ed.) Pleistocene and Holocene
fauna of Crete and its first settlers. Prehistory Press, Madison
(Wisconsin), pp. 283-293
Stamatopoulos C, Ondrias I (1995) First record of the Levant
vole Microtus guentheri Danford and Alston, 1880 in Lesbos
island, Greece. Saugetierk. Mitt. 36: 53-59
Thorington RW, Hoffman RS (2005) Family Sciuridae. In Wil-
son DE, Reeder DM (eds.) Mammals species of the world. A
taxonomic and geographic reference. The John Hopkins Uni-
versity Press, Baltimora, pp. 754-843
Tortonese E (1973) Appunti faunistici relativi all’isola di Rodi.
Atti del Museo Civico di Storia Naturale-Trieste 28: 269-280
Tournefort de JP (1717) Relation d’un du Levant, Fait par Or-
dre du Roy. 3 Vols. Lyon
Ulrich B, Riffel M (1993) New evidence for the occurrence of
the Anatolian leopard Panthera pardus tulliana (Valenciennes,
1956) in Western Turkey. Zoology in the Middle East 8: 5—14
Valenciennes MA (1856) Sur une nouvelle espéce de Pantheére
tuée par M. Tchihatcheff a Ninfi, village situé a huit lieues Est
de Smyrne. Comptes Rendus Hebdomadaires |’ Académie des
Sciences 42: 1035-1039
Vigne J-D (1988) Les Mammiferes post-glaciares de Corse.
Etude archéozoologique. 26e suppl. Gallia Préhistorie. CNRS,
Paris, 337 pp.
Vigne J-D (1995) Aproximacions arquezoologiques de la rela-
cio’ home-animal en els territoris insulars: l’exemple mediter-
ram. Cota Zero 11: 61-70
Werner F (1928) Beitrage zur Kenntnis der Fauna Griechenlands,
namentlich der agdischen Inseln. Sitzungsberiche d. matem-
naturw. K1., Abt. I, Akademie der Wissenschaften in Wien 137:
284-295
Wettstein von O (1942) Die Saéugetierwelt der Agiis nebst ein-
er Revision des Rassenkreises von Erinaceus europaeus. Ann.
Naturhist. Mus. Wien 52: 245-278
Wilkens B (1996) Faunal remains from the Italian excavations
on Crete. In Reese, D.S. (ed.) Pleistocene and Holocene fau-
na of Crete and its first settlers. Prehistory Press, Madison
(Wisconsin), pp. 241-261
Zimmermann K (1953) Das Gesamtbild der Sauger-Fauna Kre-
tas. Zeitschrift fiir Saugetierkunde 67: 1-72
Received: 01.1X.2010
Accepted: 03.X1.2010
OZFMK
‘ad vey eel ore aay a
it Pl. f ve i j 4 , nia ial irae
th) ab
ribald ah
Bonn zoological Bulletin (BzB)
Instructions to authors
Scope
The Bonn zoological Bulletin (BzB), formerly “Bonner zoologi-
sche Beitrage”, is an international, peer-reviewed, open access jour-
nal publishing original research articles, reviews, and scientific notes
dealing with organismal zoology. Focus of the BzB are (1) taxon-
omy, (2) systematics and evolution, and (3) biodiversity and bio-
geography, all with respect to terrestrial animals. Terrestrial animals
as understood here include those inhabiting fresh or brackish wa-
ters. Contributions from related fields like ecology, morphology,
anatomy, physiology or behaviour are welcome when of clear rel-
evance to the focus topics.
Publication in BzB is free of charge, including colour illustrations
or photographs contributing significantly to quality and / or read-
ability of the manuscript. Authors retain full copyright of their pub-
lished papers, may share them with colleagues, and are encouraged
to post the original pdfs on their personal or institutional website
for non-commercial use. All material must be original, unpublished
work and not under consideration for publication elsewhere.
Research articles: Manuscript preparation and submission
Manuscripts should be written in English. For serving readers from
the organism’s country of origin, bilingual abstracts are welcome.
If you plan to submit a manuscript of more than 50 manuscript pages,
please contact the editor-in-chief in advance. Please submit your
manuscript as electronic file (see paragraph on electronic submis-
sion below). Manuscripts should strictly follow the instructions spec-
ified below. Manuscripts not compatible with these guidelines will
not be taken into consideration.
Format Typing should be double-spaced in 12 pt throughout the text,
including tables, figure legends, and reference list. Pages and lines
should be numbered consecutively. Short subheadings may struc-
ture the text into sections. Do not number headings or subheadings.
Structure Research articles should be organized as follows: Title,
Author(s), Address(es) including email address and telephone, Ab-
stract, Key words, Running Title, Introduction, Material and Meth-
ods, Results, Discussion (or combined Results and Discussion), Con-
clusions (optional), Acknowledgements, References, Tables, Figure
Captions, Figures (separately numbered and identified), Appendices
(if necessary). Footnotes should not be used except in Tables.
Title The title should be brief (30 words limit, ideally shorter) and
indicate clearly the field of study and group of animals investigat-
ed. The systematic position of taxa listed in the title must be indi-
cated (e.g. “Squamata: Colubridae”). A Running Title (maximum 45
characters inclusive of spaces) should describe the paper’s core top-
ic.
Abstract Each manuscript should contain a concise abstract as sin-
gle paragraph (max. 200 words) summarizing the significant find-
ings, followed by not more than six key words.
References In the text, cited sources should be referred to as fol-
lows: Ax (2001), Kim & Lumaret (1989), Holm et al. (1997) — for
three or more authors, or, if cited consecutively: (Ax 2001, 2002;
Holm et al. 1997; Kim & Lumaret 1989) — please follow exactly
the use of commas and semicolons. Do not use commas between
author and year (only exception: taxonomic names, in which a com-
ma is placed between author and year).
The list of references should be arranged alphabetically according
to the surname of the first author; all authors should be included.
Citations of two or more authors should be arranged alphabetical-
ly according to the first- and then the following author’s surname.
When more than one reference is given for a single author or the
same combination of authors, these should be arranged chronolog-
ically. If citing more than one reference by the same author(s) pub-
lished in the same year, use a, b, etc. after the year in both, text and
reference list (e.g. 2006a, b). The names of journals in the
References should be given in full. References “in press” shall on-
ly be cited when they have been accepted for publication. Exam-
ples of reference style are:
Kottelat M, Whitten T, Kartikasari SN, Wirjoatmodjo S (1993)
Freshwater fishes of Western Indonesia and Sulawesi. Periplus
Editions, Hong Kong
Mayr E (2000) The biological species concept. Pp. 17-29 in: Wheel-
er QD & Meier R (eds.) Species Concepts and Phylogenetic The-
ory — A Debate. Columbia University Press, New York
Parenti RP (2008) A phylogenetic analysis and taxonomic revision
of ricefishes, Oryzias and relatives (Beloniformes, Adrianichthyi-
dae). Zoological Journal of the Linnean Society 154: 494-610
Sullivan J (1994) Bufo boreas. In: Fire Effects Information System
(U.S. Department of Agriculture, Forest Service, Rocky Moun-
tain Research Station, Fire Sciences Laboratory). Online at
http://www. fs. fed.us/database/feis/animals/amphibian/bubo/all.ht
ml last accessed on December 28, 2009
Sztencel-Jablonka A, Jones G, Bogdanowicz W (2009) Skull mor-
phology of two cryptic bat species: Pipistrellus pipistrellus and
P. pygmaeus —a 3D geometric morphometrics approach with land-
mark reconstruction. Acta Chiropterologica 11: 113-126
Authors are kindly requested to make sure that sources listed in the
References match those cited in the text. Names of persons who pro-
vided unpublished information should be cited by including the in1-
tial(s) and city as follows: “(JG Frommen, Bonn, pers. comm.
2009)”.
Tables and Figures Tables and Figures should not duplicate infor-
mation provided in the text. Tables should be numbered consecu-
tively in Arabian numbers in order of their mention in the text (Table
1, Tables 1-3; do not abbreviate “Table(s)”). A brief self-explana-
tory title should be typed directly above each table, not on a sepa-
rate page. Do not insert frames, vertical rules, dotted lines or foot-
notes. Figures (maps, graphs, charts, drawings, photographs etc.)
must be numbered consecutively using Arabian numbers in order
of their mention in the text (abbreviate “Fig. 1”, “Figs 1-3” etc. in
the text, but use the full term “Figure(s)” in the captions. If refer-
ring to illustrations in cited sources, use “fig. / figs”. Grouped fig-
ures should be lettered with a lower case block letter in the lower
left corner. Scale should be indicated on figures by a scale bar. A
fully descriptive caption of each figure should contain all relevant
information; captions are to be typed together on a separate page.
Colour figures will be published free of charge if contributing sig-
nificantly to quality and / or readability of the manuscript. The de-
cision to print in colour or black and white any figure submitted in
colour will generally be based on the referee’s and handling editor’s
recommendations, but remains with the editor-in-chief and publish-
er. If appropriate, authors may be asked to group single colour fig-
ures into plates. For review, tables and figures should be enclosed
to text (preferable one electronic file per manuscript), but may al-
ternatively also be submitted as separate files (jpg, pdf, tiff). At this
stage, illustrations of low resolution allowing the referees to follow
the contents are sufficient; high-resolution files (jpg, pdf, tiff of pho-
tographs, maps etc. at > 300 dpi; line artwork etc. at 600 dpi or in
eps format) will be requested after acceptance. Unless otherwise
agreed with the editor, single electronic submissions should not ex-
ceed 6 MB file size.
Appendix Appendices should be numbered consecutively in Roman
numbers, in order of their mention in the text (Appendix I, Appen-
dices I-VI).
Abbreviations Except of very common abbreviations such as mm,
kg etc.; all abbreviations should be explained in the Methods sec-
tion or figure legend if appropriate. Hyphenation or upper case let-
ters for entire words are not permitted. All measurements must be
metric units and given to the same decimal, 1.e., 5.3-6.0 mm (not:
5.3-6 mm).
Instructions to authors
Taxonomy Names of animals and the description of new genera or
species must follow the current version of the International Code
of Zoological Nomenclature (ICZN, available at
http://www.iczn.org/iczn/index.jsp). Type specimens should be de-
posited in recognised institutions; deposition at ZFMK is highly ap-
preciated. Italics are required for species names which are written
in full the first time they appear in the text, e.g. Carassius auratus
(Linnaeus, 1758), but abbreviated at subsequent mention, e.g. C. au-
ratus. List names in synonymies as follows: Attelabus asparagi
Scopohi, 1763 (Scopoli 1763: 36, fig. 113.), and list the source un-
der References. Dichotomous keys are desirable in taxonomic pa-
pers.
Statistics Statistics presented should include the name of the test,
number of observations or degree of freedom, and probability lev-
el (P > 0.05, P < 0.05, P > 0.001, P < 0.001). Values of test statis-
tics are not required.
Scientific Notes
Notes should comply with the instructions given above, but have to
be (1) confined to a single point or issue of progress, (2) must be
short (typically no more than 3 printed pages including illustrations
and references), and (3) do not include headings or subheadings. A
brief abstract of no more than three lines is required.
Review papers
Reviews should be concise, critical and creative, seeking to sum-
marize the state-of-the-art of complex topics, and stimulate debates
and new research initiatives. Review papers should comply with the
instructions for preparation of Research articles, with the exception
that the main body of text may be structured as appropriate.
Electronic submission
Manuscripts should be submitted as text files (*.doc or *.rtf; *.pdf
is welcome for the review process, but for production *.doc or *.rtf
will be required) via e-mail ([email protected]) to the editor-
in-chief. Alternatively, send a CD. If neither is possible for any rea-
son, please contact the editor-in-chief. The file name must start with
the submitting author’s last name.
Review process
Each manuscript will be peer-reviewed, generally by two or more
referees. Manuscripts should be submitted to the editor-in-chief, and
will be handled by the editor dealing with the respective taxon or
topic (see list of editors). Authors are encouraged to suggest poten-
tial referees for their manuscripts. Final acceptance for publication
is in the responsibility of the editor-in-chief. This decision 1s main-
ly based on the referees’ report and the handling editor’s recommen-
dation. Revised manuscripts received more than 6 months after the
reviewers’ comments had been sent will be treated as new submis-
sions.
Ethical and legal aspects
Authors are obliged to state clearly that they followed the legal reg-
ulations and laws for the collection and ethical treatment of animals.
Publication and reprints
Manuscripts will be published online after acceptance as preprint
version, which will be replaced by the final pdf after publication of
the printed issue of BZB. The corresponding author must clearly state
so if preprint online publication is not desired. In that case, only ti-
tle, authors and the information that this manuscript has been ac-
cepted for publication will be made available at that stage. Imme-
diately after publication, the corresponding author will receive an
e-mail containing the final pdf. On request (see order form submit-
ted with page proofs), 25 reprints are supplied free of charge. Ad-
ditional reprints may be purchased on the author’s expense.
Questions we ask our reviewers
Authors preparing manuscripts for BZB should keep in mind the fol-
lowing questions which referees for the journal are asked:
. Is the paper of interest to the readers of BZB?
. How well does it meet the focus of BZB?
. Is it acceptable for publication, or should it be reconsidered af-
ter revision?
. Please grade originality, quality of data, quality of statistical analy-
ses, and quality of interpretation on a scale from | = low to 5 =
high.
4. Please grade clarity and quality of text, figures and tables from
1 = low to 5 = high.
5. Has the welfare of any experimental animals been adequately tak-
en into account?
. Does the title aptly and correctly describe the paper?
. Does the abstract summarize only the significant findings?
. Is the length of the paper appropriate?
. Are all (colour) figures and tables necessary and appropriate?
WN
WwW
‘Oo OND
Contents
Descriptions of New Taxa
Joger, Ulrich & Bshaenia, Ismail:
A new Tarentola subspecies (Reptilia: Gekkonidae) endemic to Tunisia
Wilms, Thomas M., Shobrak, Mohammed & Wagner, Philipp:
A new species of the genus Tropiocolotes from Central Saudi Arabia
(Reptilia: Sauria: Gekkonidae)
Lutzmann, Nicola, Stipala, Jan, Lademann, Ralph, Krause, Patrick, Wilms, Thomas M. &
Schmitz, Andreas:
Description of a new subspecies of Kinyongia uthmoelleri (Muller, 1938)
(Squamata: Chamaeleonidae) with notes on its captive propagation
Vogel, Gernot & David, Patrick:
A new species of the genus Lycodon (Boie, 1826) from Yunnan Province, China
(Serpentes: Colubridae)
Wagner, Philipp & Wilms, Thomas M.:
A crowned devil: new species of Cerastes Laurenti, 1768 (Ophidia, Viperidae) from Tunesia,
with two nomenclatural comments
History of Herpetology
Schmidtler, Josef Friedrich:
The taxonomic history of the Linnean genus Lacerta (Squamata: Sauria: Lacertidae)
in the mirror of book-illustration
Pafilis, Panayiotes:
A brief history of Greek herpetology
Niekisch, Manfred:
The history of reptiles and amphibians at Frankfurt Zoo
Non-herpetological articles
Hita Garcia, Francisco, Fischer Georg, Ktick, Patrick, Thormann, Birthe & Peters, Marcell K.
Tetramorium boehmei sp. n. — a new ant (Hymenoptera: Formicidae) species
from the Kakamega Forest, Western Kenya
Masseti, Marco:
Homeless mammals from the lonian and Aegean islands
267
275
28)
289
297
307
329
347
359
367
re a es yo
SG Ian eam ae
vol
tone
vo
Contents
UN
567 9293
Ecology & Evolution
Carretero, Miguel A., Cascio, Pietro Lo, Corti, Claudia & Pasta, Salvatore:
Sharing recources in a tiny Mediterranean Island? ;
Comparative diets of Chalcides ocellatus and Podarcis filfolensis in Lampione
Kuhnel, Susanne, Reinhard, Sandy & Kupfer, Andreas:
Evolutionary reproductive morphology of amphibians: an overview
Checklists, Nomenclature & Distribution
Koch, André, Auliya, Mark & Ziegler, Thomas:
Updated checklist of the monitor lizards of the world (Squamata: Varanidae)
111
119
127
Ziegler, Thomas & Nguyen, Truong Quang:
New discoveries of amphibiens and reptiles from Vietnam
Dubois, Alain & Bour, Roger:
The distinction between family-series and class-series nomina in zoological nomenclature,
with emphasis on the nomina created by Batsch (1788, 1789) and on the higher nomencature
of turtels
137
149
Jirkt, Miloslav, Mihalca, Andrei Daniel, Necas, Petr & Modry, David:
An addition to the East African herpetofauna:
the first record of Tarentola annularis relicta (Squamata: Gekkonidae) in Uganda
Taxonomy
Rédel, Mark-Oliver, Sandberger, Laura, Penner, Johannes, Mané, Youssouph & Hillers, Annika:
The taxonomic status of Hyperolius spatzi Ahl, 1931 and Hyperolius nitidulus Peters, 1875
(Amphibia: Anura: Hyperoliidae)
173
177
Capula, Massimo & Corti, Claudia:
Genetic variability in mainland and insular populations of Podarcis muralis (Reptilia: Lacertidae)
189
Arribas, Oscar J.:
Intraspecific variability of the Carpetane Lizard (/berolacerta cyreni [Muller & Hellmich, 1937])
(Squamata: Lacertidae), with special reference to the unstudied peripheral populations
from the Sierras de Avila (Paramera, Serrota and Villafranca)
197
Bare}, Michael F., Ineich, lvan, Gvozdik, Vaclav, Lhermitte-Vallarino, Nathaly, Legrand Gonwouo,
Nono, LeBreton, Matthew, Bott, Ursula & Schmitz, Andreas:
Insights into chameleons of the genus 7rioceros (Squamata: Chamaeleonidae) in Cameroon,
with the resurrection of Chamaeleon serratus Mertens, 192
221
Descriptions of New Taxa
GUnther, Rainer:
Another new Cophixalus species (Amphibia: Anura: Microhylidae) from western New Guinea
231
Vences, Miguel, Kohler, Jorn, Crottini, Angelica & Glaw, Frank:
High mitochondrial sequence divergence meets morphological bioacoustic conservatism:
Boophis quasiboehmei/ sp. n., a new treefrog species from south-eastern Madagascar
Bauer, Aaron M.:
A new species of Pachydactylus (Squamata: Gekkonidae) from the Otavi Highlands of
northern Namibia
241
257
yy Ministerium fiir Innovation, ' ' b
Wissenschaft, Forschung i i
is und Technologie des Landes eh RW. Lei i iz
<@S” Nordrhein-Westfalen @ G emein sch aft
|
|