European Journal of Taxonomy 196: 1-13
http://dx.doi.org/10.5852/ejt.2016.196
BY
This work is licensed under a Creative Commons Attribution 3.0 License.
ISSN 2118-9773
www. europeanj ournaloftaxonomy. eu
2016 • Garic R. & Batistic M.
Research article
urn:lsid:zoobank.org:pub:38CC4797-768A-44C5-8B85-EA3DCB6678CB
Description of Brooksia lacromae sp. nov. (Tunicata, Thaliacea)
from the Adriatic Sea
Rade GARIC 1 & Mirna BATISTIC 2 *
12 Institute for Marine and Coastal Research, University of Dubrovnik,
Kneza Damjana Jude 12, 20000 Dubrovnik, Croatia.
1 Email: [email protected]
* Corresponding author: [email protected]
1 urn:lsid:zoobank.org:author:9FAD77DC-5B2B-4257-AFFl-0CCD4F750D74
2 urn:lsid:zoobank.org:author:92314F89-7560-412C-BAAB-8509A8012F60
Abstract. Brooksia lacromae sp. nov. is described from zooplankton material collected at a marine
monitoring station in the South Adriatic in the autumn of 2014. The description of both solitary and
aggregate forms is given along with 18S rRNA and mitochondrial coxl sequence data that provides
strong evidence that both forms belong to the same species. The described species is morphologically
markedly different from B. rostrata (Traustedt, 1893) and B. berneri van Soest, 1975, previously the only
two species in the genus Brooksia. Genetic analysis based on 18S rRNA gene confirmed distinctness
of B. lacromae sp. nov. from B. rostrata (1.5% uncorrected pairwise distance). The appendicularian
Fritillaria helenae Biickmann, 1924, so far known from the Atlantic only, was found in the same samples
as B. lacromae sp. nov. Co-occurrence of B. lacromae sp. nov. with an Atlantic appendicularian suggests
an Atlantic or Western Mediterranean origin for this new taxon.
Keywords. Brooksia lacromae sp. nov., new species, climate changes, gelatinous zooplankton,
Fritillaria helenae.
Garic R. & Batistic M. 2016. Description of Brooksia lacromae sp. nov. (Tunicata, Thaliacea) from the Adriatic
Sea. European Journal of Taxonomy 196: 1-13. http://dx.doi.org/10.5852/eit.2016.196
Introduction
Thaliacea is a well investigated group, primarily because of their bloom potential and substantial grazing
impact on phytoplankton communities (Madin & Deibel 1998; Andersen 1998). The last new species
within the order Salpida were described 40 years ago (van Soest 1975), when, among other species,
Brooksia berneri van Soest, 1975 was described. Brooksia berneri and Brooksia rostrata (Traustedt,
1893) are two morphologically very similar species that make up the genus Brooksia (van Soest 1975;
Godeaux 1998). The blastozooid of Brooksia berneri is unknown or identical to that of Brooksia rostrata
(van Soest 1975). Both species are known from tropical and temperate parts of the Atlantic, Indian and
Pacific Oceans and their ranges seem to overlap (van Soest 1975). In the Mediterranean there have been
only three records of Brooksia rostrata (Sigl 1912; Fedele 1926; Batistic et al. 2014), while Brooksia
1
European Journal of Taxonomy 196 : 1-13 ( 2016 )
berneri has not been recorded. The last record of Brooksia rostrata was of a single oozooid in 2008 at
Lokrum station (Batistic et al. 2014; Fig. 1). After the discovery of Brooksia lacromae sp. nov. in 2014,
the material from 2008 is re-examined in this paper and it proved in fact to be an individual of Brooksia
lacromae sp. nov.
Brooksia lacromae sp. nov. was found in samples collected at the Lokrum station (South Adriatic,
Fig. 1) in October 2014. The Lokrum station is located off the south-east Adriatic coast of Croatia where
it is under the direct influence of incoming currents from the Ionian Sea. Such entering currents are
known to modify Adriatic zooplankton community composition and to bring alien species of Atlantic/
Western Mediterranean or Eastern Mediterranean/Lessepsian origin into the Adriatic on a pluriannual
scale (Batistic et al. 2014; Gacic et al. 2010; Civitarese et al. 2010).
The life cycle of salps consists of two alternating generations: the solitary asexual generation (oozooids)
and the aggregate sexual generation (blastozooids), which morphologically differ greatly. Here, we
describe both forms of Brooksia lacromae sp. nov. Given the considerable morphological differences
between these reproductive forms, and the limited differences between Brooksia species in aggregate
morphology, we also use genetic data to corroborate our descriptions. DNA sequences from both the
nuclear ribosomal small subunit RNA (18S) and mitochondrial cytochrome oxidase subunit I ( coxl )
genes were generated, as these have previously been successfully used for integrative taxonomic
research on closely related salp species (Goodall-Copestake 2014). Finally, we also discuss the potential
origin of Brooksia lacromae sp. nov.
Materials and methods
Collection of zooplankton samples
Zooplankton samples were collected on 3 Oct. 2014 at the Lokrum station (42°37'21" N, 18°06'05"E;
Fig. 1) by vertical tows using a 53 pm mesh (55 cm diameter, 250 cm length) and a 200 pm mesh
(56.5 cm diameter, 340 cm length) Nansen net. The samples were collected in two layers: 0-50 m and
50-90 m. After collection, the samples for morphological analysis and analysis of planktonic tunicate
community composition and abundance were preserved in 2.5% CaCCf buffered formaldehyde solution.
Temperature and salinity at the time of sample collection were measured using a SBE 19plus CTD
46°N
45° N
44°N
43° N
42° N
41°N
40°N
12°E
14°E
16°E
18°E
20°E
Lokrum
Fig. 1 . Position of the Lokrum station in the South Adriatic, where specimens of Brooksia lacromae
sp. nov. were collected.
2
f _ _ r
GARIC R. & BATISTIC M., Description of Brooksia lacromae sp. nov.
Table 1. PCR primers used for amplification of B. lacromae 18S rRNA and coxl gene fragments.
Primer
5’-3’ sequence
Reference
18S
app2f
nl800r
ATCTGGTTGATCCTGCCAGT
GATCCTTCCGCAGGTTCACCT
modified from
Medlin et al. 1988
500f
1300f
1500r
ATT GGAGGGC AAGTCTGGT G
GGTGGTGCATGGCCGTTCTTAG
CTAAGGGC AT C AC AGACCTG
universal
uni800r
oilco800f
appl200r
AGGTCTGCTTT GAAC ACTCTA
GAAAAAATTAGAGT GTT C AAAGC
CCGT GTT GAGT C AAATTAAGC
this study
coxl
coi-70f
coi-930r
AT GT CTACTAAT C ATAAAGATATT
GC AGTAAAATAAGCACGAGAAT C
this study
instrument (Seabird) from the surface to 90 m depth at every metre. The planktonic tunicate community
composition was determined using an Olympus SZX-16 stereo microscope by analysis of entire
zooplankton samples to the species level. The specimens of B. lacromae sp. nov. for morphological
analysis were additionally stained with a few drops of 0.1% Janus Green dye, which made muscle bands
clearly visible. Specimens were photographed using a DP25 (Olympus) digital camera mounted onto the
stereo microscope and measured from the photographs using Cell A D software (Olympus). In addition
to formalin-fixed samples, material for genetic analysis was taken with a 53 pm mesh net from 90 m
depth to the surface. The plankton material was then filtered through a 53 pm mesh to remove sea water
and subsequently preserved in 95% ethanol, for no more than 2 days. The ethanol sample was sorted
for Brooksia lacromae sp. nov. oozooids and blastozooids and then cleaned of attached debris using
dissection needles. Cleaned salps were placed in separate tubes containing pure acetone for long-term
storage at -20°C.
DNA isolation, PCR and sequencing
DNA was isolated from one oozooid individual (branchial bar tissue) and one blastozooid individual
(muscle and test tissue). About 1-2 mm 2 of the tissue was cut and used for DNA isolation. After removal
of acetone and drying the tissue for 20 min at 55°C, tissue fragments were lysed for 2 hours at 55°C in
30 pi of a solution containing 10 mM Tris-HCl pH 8.0, 0.5% SDS, and 0.5 mM EDTA, with the addition
of 1.5 pi of 20 mg ml' 1 proteinase K (Fermentas). After lysis, the DNA was purified using the modified
method described by Karatani et al. (2006) based on the anti-chaotropic effect of saturated (NH 4 ) 0 S0 4
solution on DNA molecules. The lysate was mixed with five times the volume of saturated ammonium
sulphate water solution and put in hand-made spin columns. The hand-made spin columns with glass
filters were made by making two holes with a red hot needle in a 0.5 ml polypropylene tube, one in the
cap and the other in the bottom of the tube. Two glass filters, 4 mm in diameter each, were then put in
every column. The glass filters were cut out of GF/F (Whatmann) filter using a flame-sterilised hollow
punch tool. After binding of DNA to the glass filters, the columns were washed with 300 pi of a buffer
made by mixing 10 ml of 10 mM Tris (pH 7.5) with 40 ml of 96% ethanol. After drying the colu mn s by
centrifugation at maximum for 3 min, the DNA was eluted with 35 pi of TE buffer pH 8.0 (10 mM Tris,
1 mM EDTA).
3
European Journal of Taxonomy 196 : 1-13 ( 2016 )
Table 2. Planktonic tunicate community composition (ind. nr 3 ) on 3 Oct. 2014 at Lokrum station using
200 pm and 53 pm mesh nets in 0-50 m and 50-90 m layers. Abbreviations: bis = blastozooid; ooz =
oozooid.
200-pm
0-50 50-90
53-
0-50
pm
50-90
Appendicularia
Oikopleura longicauda (Vogt, 1854)
15.2
8.5
11.1
11.5
O. fusiformis Fol, 1872
21.5
6.7
7.4
9.5
O. cophocerca (Gegenbaur, 1855)
0.7
0.4
2.6
1.6
O. gracilis Tohmann, 1896
2.8
0.1
1.4
0.9
O. parva Tohmann, 1896
0.2
11.8
1.1
5.6
O. dioica Fol, 1872
0.2
0.2
0.4
Folia mediterranea (Tohmann, 1899)
0.1
Stego somamagnum (Langerhans, 1880)
0.5
0.2
0.2
Mesoikopleura haranti (Vernieres, 1934)
1.1
0.4
0.1
0.3
Fritillaria haplostoma Fol, 1872
5.9
6.2
8.9
F. borealis sargassi Lohmann, 1896
4.9
0.7
1.2
4
F. borealis intermedia Lohmann, 1905
0.3
F. pellucida (Busch, 1851)
2.6
0.3
0.7
0.8
F. messanensis Tohmann in Biickmann, 1924
0.8
1
0.5
F. formica tuberculata Tohmann in Biickmann, 1926
1.2
0.4
0.4
0.9
F. formica digitata Tohmann in Biickmann, 1926
1.0
0.1
0.6
F. megachile Fol, 1872
0.2
0.2
0.2
F. fraudax Tohmann, 1896
0.1
3.7
1.8
F. helenae Biickmann, 1924
0.3
0.4
Appendicularia sicula Fol, 1874
0.1
0.6
0.8
A. tregouboffi Fenaux, 1960
0.1
Kowalevskia tenuis Fol, 1872
0.5
K. oceanica Tohmann, 1899
0.4
0.2
1.1
1.4
Thaliacea
Doliolina muelleri (Krohn, 1852) (ooz)
2.6
0.7
1.4
0.2
D. muelleri (Krohn, 1852) nurse
0.2
Doliolum nationalis Borgert, 1893 (bis)
1.3
0.1
0.1
Dolioletta gegenbauri Uljanin, 1884 (bis)
0.9
0.1
Dolioloides rarum (Grobben, 1882) (ooz)
0.3
0.2
0.2
Doliolida larvae
0.4
0.1
0.2
Thalia orientalis Tokioka, 1937 (ooz)
0.1
0.1
0.1
T. orientalis (bis)
0.1
0.1
Brooksia lacromae sp. nov. (bis)
0.2
0.9
0.5
0.4
Brooksia lacromae sp. nov. (ooz)
0.1
0.1
The 18S rRNA gene was PCR amplified and sequenced in four overlapping fragments using the primer
pairs app2f-uni800r, 500f-appl200r, oiko800f-1500r, and 1300f-nl800r (Table 1); the overlap between
any two fragments was 200-400 base pairs. The coxl fragment was amplified using primers coi-70f
and coi-930r (Table 1), which were designed by aligning complete coxl sequences of multiple tunicate
species available from GenBank.
4
f _ _ r
GARIC R. & BATISTIC M., Description of Brooksia lacromae sp. nov.
The PCR was performed in a 100 pi PCR mix containing: 1 x PCR buffer, 0.2 mM of each dNTP, 3 mM
MgCl 0 , 0.2 pM of each primer, 1.2 U of recombinant Taq polymerase (Thermo Scientific) and 2 pi of
template DNA. All amplifications of 18S DNA were performed using a PCR programme with a 2 min
denaturation step at 94°C, with 40 subsequent cycles of 94°C for 20 s, 50°C for 30 s, 72°C for 1 min, and
a final extension step at 72°C for 5 min. The coxl fragment was amplified using a PCR programme with
a 2 min denaturation step at 94°C, with 40 subsequent cycles of 94°C for 20 s, 45°C for 2 min, 72°C for
3 min, and a final extension step at 72°C for 5 min.
PCR products were purified for sequencing using the same method as for DNA isolation and eluted in
17 pi of 10 mM Tris buffer (pH 8.0).
All PCR products were sequenced by the Macrogen company (South Korea) in both directions using the
same primers as used for original amplification. Obtained 18S rRNA and coxl gene sequences from an
oozooid and a blastozooid were deposited in GenBanlc under accession numbers: KR057222 (oozooid
18S), KR057223 (blastozooid 18S), KT818685 (oozooid coxl ) and KT818686 (blastozooid coxl).
DNA data analysis
Sequence assemblies from 18S overlapping fragments were made using the BioEdit software (Ibis
Biosciences). Uncorrected pairwise distances were calculated between B. lacromae sp. nov. 18S
sequences and a B. rostrata 18S sequence obtained from GenBanlc, as well as between different
B. lacromae sp. nov. sequences. Coxl sequences were translated using ascidian mitochondrial genetic
code to check for nuclear pseudogenes and no stop codons were detected.
Results
Planktonic tunicate community composition
A total of 29 species of planktonic tunicates was recorded on 3 Oct. 2014 at the Tokrum station (Table 2).
Out of 29 species, there were 23 species of Appendicularia, four of Doliolida and two of Salpida. The
most abundant appendicularians were Oikopleura fusiformis Fol, 1872, Oikopleura longicauda (Vogt,
1854), Oikopleura parva Tohmann, 1896 and Fritillaria haplostoma Fol, 1872. The most abundant
doliolid was Doliolina muelleri Krohn, 1852. The most abundant salp was Brooksia lacromae sp. nov.
(0.2-0.9 ind. nr 3 ), while Thalia orientalis Tokiolca, 1937 was found in low numbers (0-0.1 ind. nr 3 ).
Systematics
Phylum Chordata Haeckel, 1874
Subphylum Tunicata Famarclc, 1816
Class Thaliacea Van der Haeven, 1850
Order Salpida Forbes, 1853
Family Salpidae Fahille, 1888
Genus Brooksia Matcalf, 1918
Brooksia lacromae sp. nov.
um:lsid:zoobank.org:act:2B9ACCBD-8B20-437D-B013-468F8E956864
Figs 1—4
Diagnosis
Oozooid (solitary form; Fig. 2)
Muscles II and III fuse dorsally before fusing with muscle I mid-dorsally. Muscles III and IV fuse briefly
dorsolaterally. Muscles IV and V fuse before approaching muscles VI and VII mid-dorsally. There is
one longitudinal ventral muscle which extends anteriorly into the proboscis. In addition, the proboscis
5
European Journal of Taxonomy 196 : 1-13 ( 2016 )
contains two lateral longitudinal muscles. The ventral longitudinal muscle branches posteriorly into two
branches. There are two slit-like openings in the ventral longitudinal muscle, one below the anterior end
of the endostyle, and the other slightly anteriorly from the first one. Muscle I fuses with branches of the
Fig. 2. Oozooid of Brooksia lacromae sp. nov. A. Dorsal view, drawing. B. Ventral view, drawing.
C. Dorsal view, photograph of an individual dyed with Janus Green, with an arrow indicating breakage
in the proboscis during collection. Abbreviations: as = atrial siphon; bl = branching of the ventral
longitudinal muscle; br = branchial bar; dt = dorsal tubercle; en = endostyle; g = ganglion; im =
intermediate muscle; lm = longitudinal muscle; lo = openings in the longitudinal muscle; nu = nucleus;
os = oral siphon; p = proboscis; pb = peripharyngeal band; st = stolon; tp = test processus; I-VII = body
muscles.
6
f _ _ r
GARIC R. & BATISTIC M., Description of Brooksia lacromae sp. nov.
ventral longitudinal muscle at their anterior part, while muscles VI and VII fuse with them posteriorly.
Muscles II, III, IV and V converge ventrally towards the junction between muscle I and the branches of
the ventral longitudinal muscle. Muscle II can be slightly fused with muscle I just before its connection
with branches of the ventral longitudinal muscle. Endostyle straight. Stolon emerges from the test
ventrally, slightly posteriorly from the nucleus. There is one test processus just posteriorly from the
stolon (Fig. 4D). Muscles I-VII with 52-58 muscle fibers in total, measured laterally in two examined
individuals.
Blastozooid (aggregate form; Figs 3, 4A-C)
Sinistral individual - Four muscles on the left side, three muscles on the right side. Dorsal IM1 continues
ventrally as the ventral muscle IM1, without extending to the anterior attachment processus (apl). A
branch of dorsal muscle IM1 (IMl-a) extends to the anterior attachment processus (apl). Dorsal muscles
IR, HR and IIIR branch dichotomously. Dorsal muscle IR-a continues ventrally as ventral muscle IR.
Dorsal muscle IR-b continues ventrally as muscle IIR-c. A small branch from muscle IR-b/IIR-c enters
the lateral attachment processus (ap2). Dorsal muscle IIR-a continues ventrally as ventral muscle IIR-a.
Muscle IIR-b ends blindly on the ventral side of the animal without entering the posterior attachment
processus (ap3). Dorsal and ventral muscles IIIR enter the posterior attachment processus (ap3) without
joining. Muscles IVF-a and IIIR-a extend from muscles IVF and IIIR, respectively, towards the nucleus.
Endostyle curved anteriorly. Muscles IF-IIIF, IR-a,b and IIR-a,b,c with 3 muscle fibers each in all
examined individuals. Muscle IVF with from 3 to 9 muscle fibers, muscle IIIR with from 5 to 7 muscle
fibers.
Fig. 3. Drawing of the blastozooid of Brooksia lacromae sp. nov. (sinistral individual). A. Dorsal view.
B. Ventral view. Abbreviations: apl-3 = attachment processes; as = atrial siphon; br = branchial bar;
dt = dorsal tubercle; e = embryo; en = endostyle; g = ganglion; h = heart; nu = nucleus; os = oral siphon;
pb = peripharyngeal band; I L -IV L = left side muscles; I R —III R = right side muscles; IM t and IM 0 = inter¬
mediate muscles.
7
European Jo urnal of Taxonomy 196 : 1-13 ( 2016 )
Dextral individual
Mirror image of sinistral individual.
Etymology
Brooksia lacromae sp. nov. is named after the island of Lokrum near which it has been found. The Latin
name of the island of Lokrum is Lacroma.
Material examined
Two oozooids and 19 blastozooids.
Holotype
One oozooid (14.8 mm body length, 23.9 mm total length including proboscis), collected from a 0-50
m depth layer on 3 Oct. 2014 in a 53 pm mesh plankton net. It is deposited in the Tunicata collection of
the Croatian Natural History Museum under inventory number CNHM Inv. br. 44/1.
Fig. 4. Brooksia lacromae sp. nov. A. Photograph of the ventral side of the dextral blastozooid.
B. Photograph of the dorsal side of the sinistral blastozooid. C. Photograph of the lateral side of a
blastozooid. D. Detail of the ventral posterior end of an oozooid. All indivuduals were dyed with Janus
Green dye. Abbreviations: st = stolon; tp = test processus.
8
r _ _ r
GARIC R. & BATISTIC M., Description of Brooksia lacromae sp. nov.
Allotype
One sinistral blastozooid (4.2 mm body length, without attachment processes), collected from a 0-50 m
depth layer on 3 Oct. 2014 in a 53 pm mesh plankton net. It is deposited in the Tunicata collection of the
Croatian Natural History Museum under inventory number CNHM Inv. br. 44/2
Paratypes
One oozooid (11.5 mm body length, 18.2 mm total length including proboscis) and one dextral
blastozooid (4.8 mm body length, without attachment processes), collected from a 50-100 m depth
layer on 3 Oct. 2014 using a 53 pm mesh plankton net, deposited in the Institute for Coastal and Marine
Research (University of Dubrovnik) under inventory number IMP-002; one dextral blastozooid (4.1
mm body length, without attachment processes) collected from a 0-50 m depth layer on 3 Oct. 2014
with a 200 pm mesh plankton net, deposited in the Dubrovnik Natural History Museum under inventory
number PMD 2106.
Other material
16 blastozooids deposited in the Institute for Coastal and Marine research (University of Dubrovnik)
under inventory number IMP-003.
Type locality
42°37'21"N, 018°06'05"E, off Dubrovnik, South Adriatic (Mediterranean Sea; Fig. 1).
The temperature average in the 0-50 m layer was 19.0°C, with a range between 16.2°C and 22.2°C,
while the salinity average was 38.36, with a range between 37.79 and 38.68. In the 50-90 m layer the
temperature average was 15.8°C, with a range between 15.5°C and 16.1°C, while the salinity average
was 38.71, with a range between 38.67 and 38.77.
Remarks
Oozooid. Brooksia rostrata and Brooksia berneri oozooids are very similar, differing only in the fact
that in B. berneri oozooid muscle I, joined with the intermediate muscle (im), is separated from muscle
II and discontinuous mid-dorsally. Due to this fact we will only compare the B. lacromae sp. nov.
oozooid to the B. rostrata oozooid. The Brooksia lacromae sp. nov. oozooid has one ventral longitudinal
muscle which extends into the proboscis, while B. rostrata has two (Fig. 2). The proboscides in both
collected oozooids broke off during collection, but were found in the sample (Fig. 2c). The proboscis of
Brooksia lacromae sp. nov. seems to be thinner at the base than in Brooksia rostrata and in both species
it contains two lateral longitudinal muscles. The ventral longitudinal muscle in B. lacromae sp. nov.
has two small slit-like openings anteriorly, one below the endostyle and the other just anteriorly to it,
partly overlapping with the anterior end of the endostyle. In Brooksia lacromae sp. nov., in contrast to
B. rostrata , body muscles are not arranged in a barrel-like structure where muscles are perpendicular
to the body axis dorsally, as well as ventrally, but they converge to the posterior third of the body. Only
muscles I, VI and VII fuse with the branches of the ventral longitudinal muscle, while muscles II, III,
IV and V converge to the connection between muscle I and branches of the ventral longitudinal muscle,
without fusing with either. Only muscle II can sometimes be slightly connected with muscle I ventrally.
The stolon in Brooksia lacromae sp. nov. seems to emerge from the test, slightly posteriorly from the
nucleus (Fig. 4D), while in B. rostrata it emerges from the anterior part of the nucleus (Thompson 1948).
Blastozooid (sinistral individual). The Brooksia lacromae sp. nov. and Brooksia rostrata blastozooids
are very similar. In Brooksia lacromae sp. nov., muscle IIR-b ends blindly on the ventral side of the
animal without entering the posterior attachment processus (ap3), while in Brooksia rostrata it enters the
posterior attachment processus (ap3). The left intermediate muscle (IMl) in Brooksia lacromae sp. nov.
is continuous dorsally and ventrally. Its branch IMl-a enters the anterior attachment processus (apl). In
9
European Journal of Taxonomy 196 : 1-13 ( 2016 )
Brooksia rostrata the left intermediate muscle is discontinuous. Its dorsal and ventral counterparts both
enter the anterior attachment processus. Because of this, the anterior attachment processus in B. lacromae
sp. nov. possesses two muscles (IMl-a and IM2), while in B. rostrata it possesses three muscles (dorsal
and ventral left intermediate muscle and right intermediate muscle). According to Thompson (1948),
the right intermediate muscle of the sinistral individual of B. rostrata ends blindly, while after Tokioka
(1954) and Godeaux (1998) it connects to muscle I. In B. lacromae sp. nov. the right intermediate
muscle (IM2) ends blindly.
Genetic analysis
There were no differences between blastozooid and oozooid 18S sequences. Between two coxl sequences
there were 7 substitutions out of 837 nucleotides, which results in 0.84% uncorrected pairwise distance.
Coxl sequences were translated using ascidian mitochondrial code and there were no differences in
amino acid sequence between them. The uncorrected pairwise distance between the Brooksia rostrata
18S sequence (HQ015403) and the Brooksia lacromae sp. nov. 18S sequence (KR057223) was 1.5%
(including gaps). Out of 26 differences in 1740 nucleotides between these two sequences, there were 21
transitions, 4 transversions and one single nucleotide gap.
Discussion
In the Mediterranean there are only two finds of Brooksia rostrata according to our knowledge. The
first record was in 1911 on the eastern side of the Middle Adriatic (Sigl 1912) and the second from the
Gulf of Naples (Fedele 1926). The find of B. rostrata in the South Adriatic in 2008 (Batistic et al. 2014)
proved to be in fact an individual of B. lacromae sp. nov., after careful examination of one oozooid in
poor condition. It thus seems that Brooksia species are rarely recorded in the Mediterranean.
Recent investigations have shown that entering currents, of either Atlantic/Western Mediterranean or
Eastern Mediterranean origin, modify the composition of the gelatinous zooplankon community in the
South Adriatic and each type of current brings different newcomers (Batistic et al. 2014). According
to a recently postulated BiOS theory, the entrance of different water masses into the Adriatic depends
on the direction of circulation of the North Ionian Gyre (Civitarese et al. 2010; Gacic et al. 2010). The
finding of the appendicularian Fritillaria helenae Buckmann, 1924, so far only known from the Atlantic,
in the same samples as Brooksia lacromae sp. nov., suggests that B. lacromae sp. nov. is of either
Atlantic or Western Mediterranean origin. In addition to F. helenae , Kowalevskia oceanica Tohmann,
1899 and Fritillaria formica digitata Tohmann in Tohmann & Buckmann, 1926 were found in the same
samples, which is their first peer-review published record from the Adriatic (Garic & Batistic 2013).
Fritillaria fraudax Tohmann, 1896, a rare appendicularian in the Adriatic as well as in the Mediterranean
(Skaramuca 1980; Fenaux 1967; Fenaux et al. 1998), was found in high numbers, which might also be
related to the increased inflow of water of Atlantic or Western Mediterranean origin. Curiously, the
oozooids of Brooksia lacromae sp. nov. were only found in a 53 pm mesh net, which suggests that the
filtration speed in a 200 pm mesh net may be too high to preserve the delicate oozooid body.
The morphological differences between Brooksia rostrata and Brooksia lacromae sp. nov. are quite high
for congeneric salp species (Godeaux 1998). The number of oozooid body muscles is the same in both
species but their dorsal fusing pattern and overall arrangement is markedly different. In B. rostrata body
muscles are parallel to each other and they fuse ventrally with the two longitudinal ventral muscles,
forming a barrel-like pattern. In B. lacromae sp. nov. body muscles converge ventrally to the posterior
third of the body and, except for muscles I, VI and VII, they don’t fuse with the single longitudinal
ventral muscle or its branches. The blastozooids are much more similar. There are only two differences
between B. rostrata and B. lacromae sp. nov. blastozooids. In B. rostrata the muscle IM1 enters the
anterior attachment processus and the muscle IIR-b enters the posterior attachment processus, while in
10
r _ _ r
GARIC R. & BATISTIC M., Description of Brooksia lacromae sp. nov.
B. lacromae sp. nov. only a branch of the first intermediate muscle (IMl-a) enters the anterior attachment
processus (apl) and the muscle IIR-b does not enter the posterior attachment processus (ap3). Tokioka
(1954) described a long testicular processus emerging from the posterior end of mature blastozooids of
B. rostrata. No such structure could be seen in examined B. lacromae sp. nov. blastozooids, but that is
perhaps due to their immaturity.
The 18S rRNA gene is very conservative and tends to underestimate the number of species when used
in biodiversity studies (Tanga et al. 2012; Raupach et al. 2010). It is generally used for phylogenies
of distant species or higher taxonomic groups. The pairwise distance of 1.5% between B. rostrata and
B. lacromae sp. nov. 18S sequences was higher than most intrageneric species distances of Thaliacea
(Govindarajan et al. 2011), supporting the designation of B. rostrata and B. lacromae sp. nov. as separate
species. In addition to 18S sequence data, coxl sequences from B. lacromae sp. nov. are also provided.
Although only one oozooid and one blastozooid sequence were generated, the pairwise difference
between them was consistent with expectations for intra-specific divergences in salps (cf. Goodall-
Copestake 2014). There are only a few published thaliacean coxl sequences (Yokobori et al. 2005;
Teray et al. 2013; Goodall-Copestake 2014), mainly because of their high evolutionary rate, which
makes common universal coxl primers unusable. The coxl sequences generated for the present study
will aid in the future identification of B. lacromae sp. nov. as well as help with further refinements of
Thaliacea-specific coxl PCR primers.
In the last couple of years two new species of gelatinous zooplankton were described from the Adriatic
Sea (Garic & Batistic 2011; Piraino et al. 2014), while one species was re-established more than 100
years after its first description (Batistic & Garic 2016). This incidence of new species of gelatinous
zooplankton in the Adriatic is likely partly due to climate change, with more and more alien species
entering the Adriatic (Batistic et al. 2014), and partly as a consequence of poor quality investigations of
marine zooplankton at the species level (Batistic & Garic 2016). In order to improve our ability to detect
climate-induced changes in marine ecosystems in the future, we suggest more research effort be placed
on taxonomically challenging groups such as the gelatinous zooplankton described here.
Acknowledgements
Thanks to Dr. Per Flood (Bergen, Norway) for providing us with Janus Green dye which was used for
dying Brooksia lacromae sp. nov. muscles. Many thanks to Nikola Arkulin for sampling assistance
during the rough sea. This research was supported by the Croatian Science Foundation (grant number:
HRZZ IP-2014-09-2945).
References
Andersen V. 1998. Salp and pyrosomid blooms and their importance in biogeochemical cycles. In: Bone
Q. (ed.) The Biology of Pelagic Tunicates : 125-137. Oxford University Press, Oxford.
Batistic M. & Garic R. 2016. The case of Bougainvillia triestina Hartlaub 1911 (Hydrozoa, Cnidaria),
a 100-year-long struggle for recognition. Marine Ecology 37 (1): 145-154. http://dx.doi.org/10.1111/
maec. 12270
Batistic M., Garic R. & Molinero J.C. 2014. Interannual variations in Adriatic Sea zooplankton mirror
shifts in circulation regimes in the Ionian Sea. Climate Research 61: 231-240. http://dx.doi.org/10.3354/
cr01248
Civitarese G., Gacic M., Tipizer M. & Eusebi Borzelli G.L. 2010. On the impact of the bimodal
oscillating system (BIOS) on the biogeochemistry and biology of the Adriatic and Ionian Seas (Eastern
Mediterranean). Biogeosciences 7: 3987-3997. http://dx.doi.org/10.5194/bg-7-3987-2010
11
European Journal of Taxonomy 196 : 1-13 ( 2016 )
Fedele M. 1926. Thaliacea nuovi o rari del Golfo di Napoli. Bollettino della Societa dei Naturalisti in
Napoli 37: 291-300.
Fenaux R. 1967. Les appendiculaires des mers d Europe et du Bassin Mediterraneen. Faune de FEurope
et du Bassin Mediterraneen 2. Masson et Cie, Paris.
Fenaux R., Bone Q. & Deibel D. 1998. Appendicularian distribution and zoogeography. In: Bone Q.
(ed.) The Biology of Pelagic Tunicates : 251-264. Oxford University Press, Oxford.
Gacic M., Eusebi Borzelli G.L., Civitarese G., Cardin V. & Yari S. 2010. Can internal processes sustain
reversals of the ocean upper circulation? The Ionian Sea example. Geophysical Research Letters 37:
L09608. http://dx.doi.org/10.1029/2010GLQ43216
Garic R. & Batistic M. 2011. Fritillaria ragusina sp. nov., a new species of Appendicularia (Tunicata)
from the Adriatic Sea. Journal of the Marine Biological Association of the United Kingdom 90: 555-
559. http://dx.doi.org/10.1017/S00253154Q9991627
Garic R. & Batistic M. 2013. Review of appendicularian biodiversity in the Adriatic. In: de Lange
G.J., Gacic M., Romana A., da Costa M., Boero F., Turan C., & Sala E. (eds) 40th CIESM Congress
Proceedings'. 544. CIESM, Monaco. Available from http://ciesm.org/online/archives/abstracts/pdf/40/
PG_0544.pdf [accessed 3 May 2016]
Godeaux J. 1998. The relationships and systematics of the Thaliacea, with keys for identification. In:
Bone Q. (ed.) The Biology of Pelagic Tunicates : 273-294. Oxford University Press, Oxford.
Goodall-Copestake W.P 2014. Morphological and molecular characterization of salps ( Thalia spp.)
from the Tristan da Cunha archipelago. Journal of Plankton Research 36 (3): 883-888. http://dx.doi.
org/10.1093/plankt/fbu013
Govindarajan A.F., Bucklin A. & Madin L.P 2011. A molecular phylogeny of the Thaliacea. Journal of
Plankton Research 33 (6): 843-853. http://dx.doi.org/10.1093/plankt/fbql57
Karatani H., Miyamoto K., Katsukawa C., Kono T. & Minakuchi H. 2006. Novel method for DNA
isolation using high-throughput monolithic silica gel column in combination with anti-chaotropic effect.
Chemistry Letters 35: 1354-1355. http://dx.doi.org/10.1246/cl.2006.1354
Leray M., Yang J.Y., Meyer C.P, Mills S.C., Agudelo N., Ranwez V., Boehm J.T. & Machida R.J. 2013.
A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding
metazoan diversity: application for characterizing coral reef fish gut contents. Frontiers in Zoology 10:
34. http://dx.doi.org/10.1186/1742-9994-10-34
Madin L.P. & Deibel D. 1998. Feeding and energetics of Thaliacea. In: Bone Q. (ed.) The Biology of
Pelagic Tunicates : 81-103. Oxford University Press, Oxford.
Medlin L., Elwood H.J., Stickel S. & Sogin M.L. 1988. The characterization of enzymatically amplified
eukaryotic 16S-like rRNA-coding regions. Gene 71: 491^499. http://dx.doi.org/10.1016/0378-
1119(88)90066-2
Piraino S., Aglieri G., Martell L., Mazzoldi C., Melli V., Milisenda G., Scorrano S. & Boero F. 2014.
Pelagia benovici sp. nov. (Cnidaria, Scyphozoa): a new jellyfish in the Mediterranean Sea. Zootaxa
3794 (3): 455—468. http://dx.doi.Org/10.11646/zootaxa.3794.3.7
Raupach M.J., Astrin J.J., Hannig K., Peters M.K., Stoeckle M.Y. & Wagele J.-W. 2010. Molecular
species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA
expansion segments and DNA barcodes. Frontiers in Zoology 7: 26. http://dx.doi.org/10.1186/1742-
9994-7-26
12
f _ _ r
GARIC R. & BATISTIC M., Description of Brooksia lacromae sp. nov.
Sigl A. 1912. Adriatische Taliaceenfauna. Sitzungsberichte der mathematisch-naturwissenschaftlichen
Klasse 121 (1): 463-508.
Skaramuca B. 1980. The Qualitative and Quantitative Distribution of the Appendicularian Populations
in the Adriatic Sea. PhD Thesis, University of Zagreb, Croatia, [in Croatian]
Tanga C.Q., Leasi R, Obertegger U., Kieneke A., Barraclough T.G. & Fontaneto D. 2012. The widely
used small subunit 18S rDNA molecule greatly underestimates true diversity in biodiversity surveys of
the meio fauna. Proceedings of the National Academy of Sciences of the United States of America 109:
16208-16212. http://dx,doi.org/10,1073/pnas. 1209160109
Thompson H. 1948. Pelagic Tunicates of Australia. Commonwealth Council for Scientific and Industrial
Research, Melbourne.
Tokioka T. 1954. Descriptions on the aggregated form of Brooksia rostrata (Traustedt), an insufficiently
known salpa. Publications of the Seto Marine Biological Laboratory 4 (1): 147-153.
van Soest R.M.W. 1975. Observation on taxonomy and distribution of some salps (Tunicata, Thaliacea),
with descriptions of three new species. Beaufortia 23: 105-129.
Yokobori S., Oshima T. & Wada H. 2005 Complete nucleotide sequence of the mitochondrial genome
of Doliolum nationalis with implications for evolution of urochordates. Molecular Phylogenetics and
Evolution 34 (2): 273-283. http://dx.doi.org/10.1016/j.ympev.2004.10.002
Manuscrip received: 25 September 2015
Manuscript accepted: 11 January 2016
Published on: 12 May 2016
Topic editor: Rudy Jocque
Desk editor: Kristiaan Hoedemakers
Printed versions of all papers are also deposited in the libraries of the institutes that are members of the
EJT consortium: Museum national d’Histoire naturelle, Paris, France; Botanic Garden Meise, Belgium;
Royal Museum for Central Africa, Tervuren, Belgium; Natural History Museum, Tondon, United
Kingdom; Royal Belgian Institute of Natural Sciences, Brussels, Belgium; Natural History Museum of
Denmark, Copenhagen, De nm ark.
13