Singapore Botanic Gardens, 1 Cluny Road, Singapore 259569 Tel: 64719921 Telefax: 64674832
The Gardens’ Bulletin Singapore Vol. 65(1) 2013
Singapore
ISSN *4-7859
VOL. 65(1) 2013
Singapore Botanic Gardens
THE GARDENS’ BULLETIN, SINGAPORE
The Gardens^ Bulletin, Singapore is a peer-reviewed journal publishing original papers and
reviews on a wide range of subjects: plant taxonomy (including revisions), phytogeography,
floristics, morphology, anatomy, as well as horticulture and related fields, such as ecology and
conservation, with emphasis on the plant life of the Southeast Asian-Pacific region.
“v’
Dr. K.M. Wong Dr. Jana Leong-Skoniickova
(Editor-in-Chief) (Managing Editor)
S. Lee Y.W. Low Christina Soh
(Graphics Editor) (Copy Editor) (Business Manager)
Editorial Advisory Board
Professor Sir Peter Crane
Yale University
U.S.A.
Dr. Rogier P.J. de Kok
Royal Botanic Gardens, Kew
UK.
Dr. W.J. Kress
National Museum of Natural History
Smithsonian Institution
U.S.A.
Dr. David J. Middleton
Royal Botanic Garden Edinburgh
UK.
Dr Kiat W. Tan
Gardens By The Bay
National Parks Board, Singapore
Dr. Nigel P. Taylor
Singapore Botanic Gardens
National Parks Board, Singapore
Dr. I.M. Turner
Singapore Botanic Gardens
National Parks Board, Singapore
Dr. J.F. Veldkamp
Nationaal Herbarium Nederland
The Netherlands
Dr. Jun Wen
National Museum of Natural History
Smithsonian Institution
U.S.A.
Professor Nianhe Xia
South China Institute of Botany
PR. China
Published twice yearly by the National Parks Board, Singapore, the annual subscription for the journal
is Singapore $100.00 including postage. Overseas subscribers should make payment in the form of
bank draft or international money order in Singapore cuirency, payable to National Parks Board. Please
forward payment to ‘■‘Accounts Receivable Section, National Parks Board, Headquarters,
Singapore Botanic Gardens, 1 Cluny Road, Singapore 259569”.
Instructions for contributing authors
(more details in http://www.sbg.org,sg/research/instructions-for-authors.pdf)
Manuscripts should be sent by e-mail to <
[email protected]> or posted to
The Editor, Gardens’ Bulletin Singapore, Singapore Botanic Gardens, 1 Cluny Road,
Singapore 259569.
The language used is English. Prior to submission, it may be advisable to have manuscripts checked by
someone fluent or proficient in that language. Contributions must not have been published or be under
consideration elsewhere. There are no page charges. Submitted material cannot be returned.
Authors cuiTently opt for 50 paper offprmts and/or a pdf reproduction of their conti ibution, gratis.
Cover letter, submission and copyright. In your cover letter or message, state clearly you are submitting
your manuscript (state title) for publication in the Gardens’ Bulletin, Singapore. By submitting the
manuscript(s), authors agree that upon acceptance, copyright of the entire work becomes the property
of the Singapore Botanic Gardens National Parks Board, Singapore. Authors must ensure all required
pennission has been obtained in writing to publish any material they present; proof may be required.
Manuscripts are best submitted in electronic form (Microsoft Word 97-2003 preferred). Use Times New
Roman, 10-point font, 1.5-lme spacing. Do not send original artwork unless requested by the Editor.
Number all pages serially including the title and abstract on the first.
(continued on inside back cover)
Instructions for contributing authors (continued)
Title and authorship. The title should concisely describe the contents. If a scientific name is used, its
authority is normally excluded, but the family name would be provided. Authors’ names, affiliations
and postal/ e-mail addresses are stated below the title. If more than one author, indicate “corresponding
author”. Avoid footnotes. A short running title (up to six words) should also be provided.
Abstract. The abstract is at most 100-300 words. It should concisely indicate the article’s contents without
summarising it; mentioning novelties and name changes. Keywords: Suggest at most eight keywords, in
alphabetical order.
Scientific names and author abbreviations. Genus and species names of organisms must be italicised and
followed by the authority (with family name in parentheses) when first mentioned in the text or diagnoses.
Standards for author abbreviations include:
Brummitt, R.R. & Powell, C.E. {1992) Authors of Plant Names. Kew; Royal Botanic Gardens, Kew.
Kirk, P.M. & Ansell, A.E. (1992) Authors of Fungal Names [Index to Fungi Supplement]. Wallingford:
CAB International.
Herbarium abbreviations (http://sciweb.nybg.org/science2/IndexHerbariorum.asp) follow
Holmgren, P.K., Holmgren, N.H. & Barnett, L.C. (eds) (1990) Index Herbariorum. Part I: The Herbaria
of the World [Regnum Veg. vol. 120]. New York: New York Botanical Garden.
Journal and book title abbreviations. For journals:
Bridson, G.D.R., Townsend, S.T., Polen, E.A. & Smith, E.R. (eds) (2004) BPH-2: periodicals with
botanical content: comprising a second edition ofBotanico-Periodicum-Hunlianum. Pittsburg: Hunt
Institute for Botanical Documentation.
For books:
Stafleu, F.A. & Cowan, R. S. (eds) (1976-88) Taxonomic Literature. 2nd edition. 7 vols [Regnum Veg.
vols 94, 98, 105, 110, 112, 115, 116].
Stafleu, F.A. & Mennega, E.A. (eds) (1992-) Taxonomic Literature. Supplements [Regnum Veg. vols
125, 130, 132].
(A useful source of verify ing names of publications is
<http://asaweb.huh.harvard.edu:8080/databases/publication_index.html>. If in doubt, list full titles.
Other abbreviations and units of measurement. If using standard abbreviations and acronyms, give the
full tenn on first mention. Dates are cited as: 1 Jan 2000. SI (metric) units of measurement are used and
spelled out except when preceded by a numeral; they are abbreviated in standard fom: g, ml, km, etc.
Tables. Tables are numbered in arabic numerals in the order they are first mentioned in the text and carry
an indicative legend at the head. Tables are given at the end of the manuscript.
Illustrations. All drawings, maps, graphs and photographic images (individually or collected in a plate)
are to be numbered in arabic numerals in the order they are first mentioned in the text, as fig. 1, Fig. 2,
etc. (plate components would be refeired to in the text as Fig. I A, IB, Fig. 1 A-D, etc.). If relevant, scale
bars should be used to indicate magnification.
When grouping photographs, the maximum page area 1 9.5 x 1 3 cm must be heeded. High resolution digital
unages may be submitted as separate files (line drawings in black and white at 600 dpi, photographs at
300 dpi) sent electronically or in a CD. Do not embed images into the main text file.
References in the text. Citation in the text should take the fonn: King & Gamble (1886) or (King &
Gamble 1 886), or King et al. (1886) if more than three authors to a work. Use 2000a, 2000b, etc. if several
papers by the same author(s) in one year are cited.
References listed at the end. There, works mentioned in the text are listed alphabetically as follows:
Dallwitz, M.J., Paine, T.A. & Zurcher, E.J. (1999) User ‘s Guide to the DELTA Editor, http://
biodiversity.uno.edu/delta/ (accessed on 2 Aug. 2010).
Persson, C. (2000) Phylogeny of Gardenieae (Rubiaceae) based on chloroplast DNA sequences from the
rps 16 intron and /r/7L(UAA)-F(GAA) intergenic spacer. Nordic J Bot. 20: 257-269.
Ridley. H.N, (1930) The Dispersal of Plants Throughout the World. Ashford, U.K.: L. Reeve.
Smith, A.C. & Darwin, S.P. (1988) Rubiaceae. In: Smith, A.C. (ed) Flora Viliensis Nova, A New Flora of
Fzy/ 4: 143-193.
References to web-based resources should include either a doi (digital object identifier) specification
or full URL mentioning also the date it was accessed. Use of DNA sequences from GenBank should be
acknowledged and the studies for which the sequences were generated should be cited.
Style of nomenclatural summaries. The following style is required:
Gardenia anisophylla Jack ex Roxb., FI. Ind. ed. Carey & Wall. 2: 561 (1824).
Medina la alternifolia Blume, Mus. Bot. 1: 19 (1849).
If authors include full bibliographic data for these works in the list of references at the end of the paper,
they should also be mentioned in the text briefly, e.g., “Nomenclatural references researched include
Blume (1849) and Roxburgh (1824).”
Homotypic synonyms should be provided in a block, stating the type at the end.
Front cover picture: Aspidistra jiewhoei Tillich & Skomick. (Photo by J. Leong-Skomickova)
The Gardens’ Bulletin
Singapore
VOL. 65(1) 2013 ISSN 0374-7859
CONTENTS
P.C. Boyce and S.Y. Wong
Studies on Schismatoglottideae (Araceae) of Borneo XXII:
The enigmatic Aridarum montanum refound 1
P.C. Boyce and S.Y. Wong
Studies on Schismatoglottideae (Araceae) of Borneo XXIII:
Piptospatha coJata and P. deceptrix, taxonomic novelties from Borneo 7
R. Gogoi and S. Borah
Musa markkui (Musaceae), a new species from Arunachal Pradesh, India 19
R. Gogoi and S. Borah
Two new species and a new record for Colocasia (Araceae: Colocasieae)
from Arunachal Pradesh, Northeast India 27
V
R. Kishor and J. Leong-Skornickova
Zingiber kangleipakense (Zingiberaceae):
Anew species from Manipur, India 39
J.D. Mood, L.M. Prince, J.F. Veldkamp and S. Dey
The history and identity of Boesenbergia longiflora (Zingiberaceae)
and descriptions of five related new taxa 47
M.F. Newman
Valid publication of Boesenbergia aurantiaca (Zingiberaceae) 97
H.-J. Tillich and J. Leong-Skornickova
Aspidistra jiewhoei (Asparagaceae), a new species from north Vietnam 101
Y.H. Tong, W.B. Xu, Y.F. Deng, K.M. Wong and N.H. Xia
Rubovietnamia sericantha (Rubiaceae: Gardenieae),
a new combination and notes on the genus in China
107
I. M. Turner
Additions to The Plant Taxa of H.N. Ridley, 4.
The Primitive Angiosperms (Austrobaileyales, Canellales,
Chloranthales, Laurales, Magnoliales, Nymphaeales and Piperales) 115
J. F. Veldkamp
Nomenclatural notes on Eugenia reinwardtiana (Myrtaceae)
and more or less associated names 117
Date of publication: 30 June 2013
Copyright ©
National Parks Board
Singapore Botanic Gardens
1 Cluny Road
Singapore 259569
Printed by Oxford Graphic Printers Pte Ltd
Gardens’ Bulletin Singapore 65(1): 1-5. 2013
1
Studies on Schismatoglottideae (Araceae) of Borneo XXII:
The enigmatic Aridarum montanum refound
RC. Boyce^ and S.Y. Wong^
^Pusat Pengajian Sains Kajihayat (School of Biological Sciences),
Universiti Sains Malaysia 1 1800 USM, Pulau Pinang, Malaysia
phymatarum@goog] email . com
^Department of Plant Science & Environmental Ecology,
Faculty of Resource Science & Technology,
Universiti Malaysia Sarawak,
94300 Kota Samarahan, Sarawak, Malaysia
ABSTRACT. Aridarum montanum Ridl., a species known from a single herbarium specimen
allegedly collected on Gunung (Mt) Santubong, Sarawak, Malaysian Borneo in 1909, has
been refound on exposed shales in Sri Aman Division, and Sarikei Division, Sarawak, and
subsequently flowered in cultivation. Morphological differences of the new collection
compared with the original description and figure are catalogued and commented upon. An
amended and expanded species description is provided, and the plant is illustrated in habitat,
and from flowering cultivated material. Speculations on the probable location origin of Brooks’
type material are proffered.
Keywords. Aroid, Mount Santubong, rare species, Sarawak, shales
Introduction
Aridarum montanum Ridl., the type species of the genus, has not been recollected
since Cecil Joslin Brooks gathered a single specimen, purportedly on Gunung (Mt)
Santubong, and now deposited m the Natural History Museum, London (BM). Boyce
& Wong (2011) outlined the few facts known pertaining to A. montanum, emphasizing
that numerous surveys of the supposed type locality, a large sandstone mountain
situated on a peninsula jutting into the South China Sea approximately 35 km north of
Kuching, the state capital of Sarawak, had failed to locate the plant, although another
quite different Aridarum (A. nicolsonii Bogner) is abundant there. Recollection of A.
montanum from a two quite separate very wet shale-dominated sites, one in Sri Aman
Division and the other in Sarikei Division, coupled with the persistent failure to locate
plants of this species at the supposed type locality on much drier sandstone ecology,
raises the probability that Brooks’ label data are in eiTor.
Brooks was in Sarawak during 1 900-191 0, employed as a metallurgical chemist
by the gold-exploitation arm of the Borneo Co. Ltd. During this period he collected
a wide range of wildlife, including plants, although mainly ferns. Data for Brooks’
fieldwork are often incomplete, and there are doubts over the numbering of at least part
2
Gard. Bull. Singapore 65(1) 2013
of his collections. Brooks’ Borneo fieldwork was concentrated almost exclusively in
west Sarawak. He made collections on Gunung (G.) Santubong (c. 1® 44' N 110®20'E),
G.Pueh(c. r48'N 109°41'E), G. Kapor(c. r23'N llO^^T'E), G. Singai (c. r30'18.28''N
110n0'21.36"E), the Banjaran Bungo (c. Tlb'N 110^9'E), Bau (c. r25'N 110^9'E),
Bidi (c. r23'N 110°8'E), and Tringgus (c. 1”14'N 110”5'E). With the exception of
Banjaran Bungo, none of the above areas has exposed shales. Gunung Santubong,
G. Singai, and Tringgus are predominantly sandstone; G. Kapor and Bidi are forested
karst limestone, while G. Pueh is granite. Our new collections coupled with high levels
of “geological endemism” present among aroids strongly favours A. montanum being
a shale-obligate.
Brooks’ only documented excursion away from this general area was in 1908
when he ventured to the source of the true right tributary of the Sungai Sarawak,
afterwards continuing to the headwaters of the Sungai Sambas where it rises in the
Bengkayum (Bengkayang) Mountains (G. Niyut and G. Bentuang) NE of Pontianak,
in modem Kalimantan Barat, Indonesian Borneo. Brooks returned to Sarawak fi'om
this expedition by way of Siluas and G. Pemissen (Brooks 1911). These areas do have
exposed shales, and fi-irthemiore there are floristic links with Banjaran Bungo and
via the Klingkang range to the border areas of Lubok Antu, close to one of the new
collections of A, montanum. The Sarawak Banjaran Bungo is botanically reasonably
well sampled and to date A. montanum has never been located there. On balance it
seems most likely that Brooks’ collection was made during the trip to the headwaters
of the Sungai Sambas.
Aridarum montanum Ridl., J. Bot. 51: 201(-202), pi. 527 (1913); Bogner & Hay,
Telopea 9(1): 186 (2000); Boyce & Wong, Malayan Nat. J. 63(4): 613-618, Figs. 2 &
3 (2011). TYPE: CJ. Brooks 1035, Malaysian Borneo, Sarawak, Kuching Division,
Santubong (but see above), Oct 1909 (holo BM!). (Fig. 1)
Trailing-pendent or tufted obligate rheophyte to c. 25 cm. Stem initially condensed,
later elongating and often branching from the base, trailing portions to c. 35 cm (or
more?), very slender, 3^ mm diam., all except the oldest portions clothed with tightly
fitting red-brown netted fibres derived from the prophylls and cataphylls, and slender
adhering sinuous green roots. Leaves numerous, earned in dense tufts at the tips of the
stems, often two or three leaf tufts basal to these stems; petiole 0.2-3 cm long, c. 1 mm
diam., sheathing at the very base, the wings extended into a namowly triangular ligular
portion 2.5-3 cm long, drying red-brown; blade linear-lanceolate, stiffly coriaceous,
deep green, 2-10 cm long x 3. 5-4. 5 mm wide, base very narrowly cuneate, apex
very narrowly acute and apiculate for 0.5-1 mm; midrib abaxially very prominent,
adaxially more or less flush with the lamina; primary lateral veins not differentiated;
secondary venation more or less obscure, running into a relatively thick marginal
vein; tertiary venation very obscure. Inflorescence solitary; peduncle much exceeding
the petioles, 9-10 cm long, c. 0.8 mm diam, green. Spathe narrowly ovate, apically
acute, unconstricted, 1.5-2 cm long, initially green, late in development (1-2 days
prior to opening) turning entirely white; spathe limb gaping at pistillate anthesis, the
Aridarum montanum in Sarawak interpreted
3
Fig. 1. Aridarum montanum Ridl. A. Plants in habitat on shale waterfall. Note the long, almost
naked stems. B. Flowering shoot. Note the very narrow leaf blades, the eonspieuous ligules,
and the netted fibre covering the naked stem C. Inflorescence at pistillate anthesis, with the
spathe gaping. D. Spadix, with the spathe artificially removed. Note the convex connective and
very long setiform terminus to the thecae. E. Alcohol-preserved spadix. All from P.C.Boyce et
al. AR-3728. (Photos: A, Mike Lo; B-E, Peter C. Boyce)
4
Gard. Bull. Singapore 65(1) 2013
upper 2/3 caducous at staminate anthesis, at which time the lower persistent 1/3 flares
into an obconic cup. Spadix 1.4-1. 5 cm long, c. 3 mm diam., subcylindric, distally
tapering to an acute apex; pistillate flower zone 2-3 mm long, about three irregular
whorls of subglobose-oblong pistils c. 0.5 mm diam.; stigma sessile, button-like,
narrower than the pistils, c. 0.4 mm diam., papillate, centrally impressed; staminate
flower zone contiguous with pistillate zone, c, 1 ,2 cm long, c. 2.5 mm diam., fertile
to the acute apex; stamens crowded, arranged in pairs, more or less ellipsoid and the
pairs rhombohexagonal from above, longitudinally aligned (with respect to spadix
axis), c. 1.2-1. 5 mm x 0.3-0.4 mm, convex in nature, drying with a deep longitudinal
excavation; thecae on the distal and proximal (with respect to spadix axis) sides of the
anther, base triangular, the remainder a long straight vei^ slender horn c. 7 mm long,
these folded in horizontally across the top of and meeting m the middle of the anther,
elevating somewhat at staminate anthesis. Fruiting spathe broadly obconic, white.
Fruit unknown.
Other specimens examined: MALAYSIAN BORNEO. Sarawak. Sri Aman, Lubok Antu,
Batang Lemanak, 0 l‘’09'N 1 1 1 ‘^39'E, P. C. Boyce et al AR-3 728 (SAR); Sarikei, Ulu Sarikei, Air
Terjun Ruan, 01'’55'02.0"N lir29'10.7"E, PC.Boyce & S.Y.WongAR-4100 (SAR).
Distribution. Known with certainty only the two localities reported here.
Ecology. Shale cascades and small waterfalls under very wet lowland forest; 25-60
m asl.
Notes. Recollection of A. montanum has revealed critical inaccuracies in the original
description and figure (Ridley 1913), and also interpretative misconceptions in the
description provided by Bogner & Hay (2000).
Inaccuracies in Ridley’s description and figure are the excavation of the stamen
connective, and the supposed presence of triangular-based, setiform sterile flowers
at the ‘base’ of each stamen. The connective excavation is an artefact resulting from
shrinkage during drying for preservation. In nature the stamen connective is markedly
convex, fonning a pronounced dome between the thecae horns (Fig. ID). It remains so
in alcohol, although the stamen pairs, which are appressed when fresh, shrink laterally
when spirit-preseiwed, revealing deep sutures between each pair of stamens (Fig. IE).
Ridley’s sterile flowers attached to each stamen are, in fact, the thecae, one on each
end of the stamen, and comprising a triangular somewhat gibbous basal portion (the
actual theca) and a long, setiform tenninus though which the pollen is released.
Bogner & Hay’s description contains the following statement: “inteipistillar
staminodes few at the base of the female zone, shortly stipitate, spindle-shaped,
narrower and shorter than the pistils (interpistillar staminodes fide Ridley (loc. cit.
[i.e., Ridley 1913]); absent from the Holotype in our observation)». Ridley (1913)
makes no mention of ‘interpistillar staminodes’. He does make comparison of the
‘sterile flowers’ he believed present at the base of each stamen (discussed above) with
Aridarum montanum in Sarawak interpreted
5
the club-shaped sterile stamens (Ridley says “flowers”) associated with the pistils in
most Homalomena. To Ridley this was pertinent because he supposed his Aridarum to
be related to Homalomena sect. Chamaecladon, However, nowhere does Ridley use
the term ‘interpistillar staminodes’ or mention such stmctures to be basal to the female
zone. What Ridley does say, in the protologue (here translated from the original Latin),
is: “sterile flowers basal to [i.e., at the base of the stamens]. . .”
Apart for correcting moiphological descriptive inaccuracies, access to
comprehensive material, coupled with field obseiwations, has established that uniquely
for the genus the stems of A. montanum are much elongated and somewhat branched,
forming pendent masses hanging in the water flow (Fig. 1 A). It may be assumed that
Brooks’ original collection comprised a single tuft of leaves taken from the base of one
of these stem complexes. Why Brooks failed to collect more representative material is
unclear. Other minor differences between the new collection and the type are that our
plants have very short petioles, less than 3 mm long. The type plant has petioles up to 3
cm long, although most are much less than this, and some very short, but none as short
as here recorded.
Circumscription of Aridarum
The morphologies noted above raise issues with the circumscription of Aridarum
sensu Bogner & Hay (2000), not least the absence of an excavated stamen connective
that is one of the defining morphologies for the genus Aridarum. However, pending
publication of an on-going molecular study, including placement of the type species,
Aridarum sensu Bogner & Hay (2000) is here retained, but with caution.
ACKNOWLEDGMENTS. Research and fieldwork in Borneo was, most recently, under
Sarawak Forestry Department Research Permit No. NCCD.907, 4.4(Jld.7) and Park Pennit
No: 104/2012. The continuing collaboration and support of the Forest Department Sarawak,
and Sarawak Forestry Corporation, are gratefully acknowledged.
References
Bogner, J. & Hay, A. (2000) Schismatoglottideae in Malesia II - Aridarum, Bucephalandra,
Phymatarum md Piptospatha. Telopea 9(1): 183-194.
Brooks, C.J. (1911) A trip to a source of the Sarawak River and Bengkamm Mountains. J.
Straits Branch Roy. Asiat. Soc. 60: 41-51.
Ridley, H.N. (1913) Some Bomean Aroideae. J. Bot. 51: 201-202.
Wong, S.Y. & Boyce, PC. (2011) Lost Aroids - On the taxonomic importance of relocating
poorly collected species. Malayan Nat. J. 63(4): 613-623.
Gardens’ Bulletin Singapore 65(1): 7-17. 2013
1
Studies on Schismatoglottideae (Araceae)
of Borneo XXIII:
Piptospatha colata and P. deceptrix,
taxonomic novelties from Borneo
RC. Boyce' and S.Y. Wong^
'Pusat Pengajian Sains Kajihayat (School of Biological Sciences)
Universiti Sains Malaysia 11800 USM, Pulau Pinang, Malaysia
^Department of Plant Science & Environmental Ecology,
Faculty of Resource Science & Technology,
Universiti Malaysia Sarawak,
94300 Kota Samarahan, Sarawak, Malaysia
ABSTRACT. Piptospatha colata P.C.Boyce & S.Y.Wong and P. deceptrix P.C.Boyce &
S.Y.Wong are newly described, respectively from Kalimantan Barat and Kalimantan Utara,
Indonesian Borneo. Recognition of these novelties takes to 13 the number of described,
accepted species of Piptospatha. An updated key to the genus is provided and both species are
illustrated, along with those speeies that are most similar.
Keywords. Aroid, Indonesian Borneo, Kalimantan Barat, Kalimantan Utara, Piptospatha
Introduction
Since the last full revision of Piptospatha (Bogner & Hay 2000) a combination of
molecular and morphological research has resulted in generic changes, and recognition
of a number of new taxa (Okada & Tsukaya 2010; Wong & Boyce 2010, 2012, in
press; Wong et al. 2009, 2011).
Major herbaria with significant tropical Asian collections (e.g., BO, L, SAR,
SING) abound in specimens of unnamed rheophytic aroids. These, however, frequently
defy attempts at identification owing to their incomplete nature, and frequently
inadequate preparation prior to preservation. Failing attempts to recollect at original
localities or, in the case of older material the distinct possibility that such localities
no longer support an indigenous ecology, such material will quite likely forever
remain undetemiined. Given this situation, it is ironic that fieldwork and subsequent
cultivation of plants from Borneo continues to reveal numerous taxonomically novel
rheophytic aroid species, which should come as no great surprise given that, has been
noted on numerous occasions, many aroids are highly localised.
Where possible, attempts are made to match cultivated novelties with pre-
existing herbarium specimens. However, often this not practicable owing to the
8
Gard. Bull. Singapore 65(1) 2013
problems highlighted above. Two such ‘unmatchable’ novelties belonging to the genus
Piptospatha N.E.Br. are here described.
la.
b.
2a.
b.
3a.
b.
4a.
b.
5a.
b.
6a.
b.
7a.
b.
8a.
b.
Key to Piptospatha
Sterile, staminodial interstice between pistillate and staminate flower zones well-
defined 2
Sterile interstice absent, or at most defined by one or two staminodes 5
Stem long, repent. (N Kalimantan Tengah) P. repens
Stem short, erect 3
Pistillate flowers green; spathe terminus slightly beaked but not pileate, glossy
deep pink 4
Pistillate flowers pinkish grey; spathe limb strongly pileate, deep magenta-
purple. (Shales; N Kalimantan Utara) P. pileata
Staminodes rounded, convex, white. Leaf blades with primary lateral veins
hardly visible abaxially. (NE Sarawak at Miri, Limbang; Brunei; W Sabah)
P. burbidgei
Staminodes prismatic, truncate, yellow. Leaf with primary lateral veins
impressed. Granite. Indonesian Borneo (Kalimantan Barat: Nanga Taman)
P. colata
Connective extended into a pronounced elongate central beak. (? NE
Sarawak) P. insignis
Connective not raised centrally above the thecae, or at most shortly elevated
and obtuse 6
Staminate flowers pubescent 7
Staminate flowers glabrous 10
Connective of stamen swollen (dome- shaped). (Peninsular Malaysia)
P. ridleyi
Connective not swollen 8
Spathe white at anthesis; stamen in closely-appressed, regularly-arranged
pairs; leaf blades abaxially with conspicuously tessellate 2-order veins.
(Malay Peninsula and southern peninsular Thailand) P perakensis
Spathe pink; stamens irregularly arranged; leaf blades abaxially with 2-order
veins not conspicuously tessellate, or only very faintly so. (Borneo 9
New Piptospatha species from Borneo
9
9a. Diminutive plants up to 14 cm tall with decumbent-creeping stems; leaf
blade elliptic, 4-6 cm long, tertiary venation abaxially forming a very faint
tessellate reticulum; spadix 8-12 mm long; pistillate flower zone with 3-5
oblique whorls of staminodes at the base; fruiting spathe up 1 cm long and
wide. (Plants of travertme; Kalimantan Tunur: Sangkulirang) ....P. manduensis
b. Robust plants to 25 cm tall or more, with short, erect stems; leaf blade very
narrowly oblong-elliptic, 12-20cm long, all veins parallel pinnate; spadix c. 2
cm long; pistillate flower zone fertile to the base; fruiting spathe 2.5 cm long
and wide. (Plants of exposed shales; Sarawak: Kapit) P. marginata
10a. Pistillate flowers bright green; spadix bullet-shaped, staminate portion bright
yellow; thecae broadly excavated, the excavations of adjacent anthers forming a
butterfly-shaped depression; interior of spathe tip rostrum with 5-7 conspicuous
keels; persistent fi'uiting spathe wide-flared. (Alkaline geologies (limestone,
basalt); SW Sarawak, N Kalimantan Barat) P. viridistigma
b. Pistillate flowers pink or dirty whitish; spadix cylindrical; staminate portion not
bright yellow; thecae longitudinally sulcate with the pores ventral and dorsal
to the sulcae; interior of the spathe tip rostrum with 2-3 conspicuous keels or
keels absent; persistent fruiting spathe nan'owly obconic. (Plants not of alkaline
geologies) 11
11a. Stigmas mid-deep pink; stamen connective with smooth raised rim. (Granites;
SW Sarawak) P. eJongata
b. Stigmas dirty whitish; stamen connective margins not smooth, rim-like.
(Sandstones or shales) 12
12a. Stamen connective with a triangular wing on each side; staminodes at base of
pistillate zone white, rounded. (Sandstones; NW Sarawak) P. impolita
b. Stamen connective with frilled margins; staminodes at base of pistillate zone
cream, truncate with a central depression. (Hard shales; Kalimantan Utara)
P deceptrix
Piptospatha colata P.C. Boyce & S.Y.Wong, sp. nov.
Piptospatha colata shares green pistils (or stigmas) with P. viridistigma P.C. Boyce,
S.Y.Wong & Bogner and P. burbidgei (N.E.Br.) M.Hotta. From P. viridistigma it may
be separated by the presence of a zone of staminodes at the interstice of the pistillate
and staminate flower zones, and by the staminate flowers much more densely arranged,
with cream (not deep yellow) stamens, and truncate (not excavated) connectives.
Piptospatha burbidgei and P colata are distinguished from one another by truncate
yellow, not convex white, staminodes at the interstice and at the base of the pistillate
flower zone. Leaf morphology also serves to separate P. colata and P burbidgei) the
leaf blades of P burbidgei are naiTowly oblong and obtuse, with the adaxial surface
smooth with the primary lateral veins almost invisible. Piptospatha colata vegetatively
10
Gard. Bull. Singapore 65(1) 2013
closely approaches R pileata S.Y.Wong & P.C.Boyce and R deceptrix S.Y.Wong
& P.C.Boyce. From both, R colata is distinguished by spadix morphology. Spathe
overall morphology of R. colata rather resembles that of R. pileata and R. elongata
(Engl.) N.E.Br., although again their individual spadix morphologies distinguished
them with ease.
TYPE: K.Nakamoto AR-3780, Indonesian Borneo, Kalimantan Barat, Sekadau,
Nangataman, west of Nangataman, Gunung Canayang east slope, 4 Feb 2012 (holo
SAR! iso BO!). (Fig. 1 A, 2A, 3A)
Clumping rheophytic herb to 35 cm tall. Roots strong, c. 2 mm in diameter. Stem
short, condensed, to 20 mm in diameter, all except the oldest portions obscured by leaf
bases. Leaves many together, spreading or arching, forming a dense rosette; petiole
bases clasping stem; petiole 5-8 cm long, up to 2.5 mm in diameter, D-shaped in
cross-section, minutely scabrous, dull reddish green; petiolar sheath with free ligular
portion, c. 4 cm long, marcescent and ultimately deciduous, pale reddish-pink when
fresh, drying dark reddish brown; leaf blades nan'owly elliptic, 5-20 cm long x 2^.5
cm wide, base cuneate, somewhat obtuse, apex acute with stout tubule, c. 5 mm long,
in life semi-glossy medium green adaxially, paler abaxially with the mid-rib and
primary lateral veins pale reddish, drying dark reddish brown with abaxial venation
slightly darker; mid-rib bluntly raised adaxially, rounded-raised and minutely scabrous
adaxially; primary lateral veins c. 6 per side, parallel pinnate, impressed adaxially,
very slightly raised abaxially; interprimary lateral veins weaker than primary laterals
although still conspicuous, interprimary veins joining a weakly defined submarginal
collecting vem; prunary lateral and interprimary veins very slightly raised abaxially
and adaxially; interprimary veins uregularly visible as semi- translucent broken lines
running parallel to the primary laterals. Inflorescence solitary, erect; peduncle 11-15
cm long (at anthesis), c. 3.5 mm in diameter, minutely but distinctly scabrous, reddish
brown. Spathe initially erect, later held at c. 90° to peduncle, later still (post anthesis)
again erect, not constricted, deep pink in late bud, spathe limb opening mainly in
shades of glossy deep pink, with the median keel and terminal rostrum deep purple-
pink, the rostrum ultimately deep reddish brown, proximal part of spathe dull olive-
greenish brown with pale speckles; spathe limb, c. 6 cm long, the base c. 1 cm wide,
mid-way inflated to c. 2.5 cm, then ventrally constricted and terminating in a rostrum c.
6 mm long, internally without rostral keels, or with one only and these weakly defined.
Spadix 2.3-2. 8 cm long x 6. 5-7. 5 mm in diameter, base slightly obliquely inserted
onto spathe/peduncle; pistillate flower zone with 1-4 rows of rhomboidal truncate pale
yellow staminodes inserted basally, pistillate flower zone jade-green, weakly barrel-
shaped, 5. 5-8. 5 mm long x 6-7.5 mm in diameter, pistils cylindrical, tmncate, very
congested, c. 0.6 mm diameter; stigma weakly umbonate, papillate, as wide as ovary;
pistillate and staminate zones separated by a zone c. 2 imn long comprised of c. 2
whorls of staminodes, these rhomboidal-polygonal, truncate, pale yellow; staminate
flower zone cream, equalling the pistillate zone in width, 1.5-21 cm long x 6. 5-7. 5
mm in diameter, weakly fusifonn to slightly tapering, apex blunt; staminate flowers
congested, comprised of paired stamens, irregularly oblong and very weakly butterfly
New Piptospatha species from Borneo
11
Fig. 1. A. Piptospatha colata P.C.Boyce & S.Y.Wong. B. Piptospatha viridistigma P.C.Boyce,
S.Y.Wong & Bogner. C. Piptospatha burbidgei (N.E.Br.) M.Hotta. D. Piptospatha deceptrix
P.C.Boyce & S.Y.Wong. E. Piptospatha pileata S.Y.Wong & P.C.Boyce. F. Piptospatha
elongata (Engl.) N.E.Br. A-F. Spadices at pistillate anthesis, in each instance the spathe
artificially removed. A. from AR-3665‘, B. from AR-250\ C. from AR-1972‘, D. from AR-3980‘,
E. from AR-3923‘, F. from AR-3601 . (Photos: Peter C. Boyce)
12
Gard. Bull. Singapore 65(1) 2013
Fig. 2. A. Piptospatha colata P.C.Boyce & S.Y.Wong. B. Piptospatha viridistigma RC. Boyce,
S.Y.Wong & Bogner. C. Piptospatha burbidgei (N.E.Br.) M.Hotta. D. Piptospatha deceptrix
P.C.Boyce & S.Y.Wong. E. Piptospatha pileata S.Y.Wong & P.C.Boyce. F. Piptospatha
elongata (Engl.) N.E.Br. A. from AR-3665; B. from AR-2432; C. from AR-1973; D. from Ai?-
3980; E. from AR-3923; F. from AR-3601 . (Photos: Peter C. Boyce)
shaped, c. 0.5 mm wide x c. 1 mm long, connective truncate, glabrous; thecae lateral,
c. 0.3 mm, ellipsoid with a wide rim, sunken into a shallow pit. Infructescence not
observed.
Other specimens seen: INDONESIAN BORNEO. Kalimantan Barat. Sekadau, Sekadau
Hilir, Kayu Eapis, south of Kayu Eapis , 0°2.38'S 111°0'33.99"E, 20 Sep 2011, Nakamoto AR-
3665 (SAR); Sekadau, south east of Nanga Taman, Kampung Seri Punti, Gunung Raya, south
slope, 3 Feb 2012, Nakamoto AR-377 6 (SAR).
Distribution. Indonesian Borneo, Kalimantan Barat, known from two localities at
Nanga Taman, and a third near Kayu Lipis, c. 37 km (in a straight line) to the NE.
Ecology. Obligate rheophyte on waterfalls and river boulders on granite under moist
lowland forest; 100^00 m. asl.
Notes. Piptospatha colata is defined by the combination of green pistils, pale yellow,
prismatic staminodes, a deep pink spathe with a prominent rostrum, semi-glossy
medium green leaves with primary lateral veins impressed adaxially.
New Piptospatha species from Borneo
13
Fig. 3. A. Piptospatha colata P.C.Boyce & S.Y.Wong. B. Piptospatha viridistigma P.C.Boyce,
S.Y.Wong & Bogner. C. Piptospatha burbidgei (N.E.Br.) M.Hotta. D. Piptospatha deceptrix
P.C.Boyce & S.Y.Wong. E. Piptospatha pileata S.Y.Wong & P.C.Boyce. F. Piptospatha
elongata (Engl.) N.E.Br. A-F. Plants in habitat. A. from AR-3776; B. from AR-3669; C.
from AR-1973; D. from AR-3980; E. from AR-3923; F. from AR-2052. (Photos: A& D-E, K.
Nakamoto; B-C & F, Peter C. Boyce)
14
Gard. Bull. Singapore 65(1) 2013
Piptospatha colata is the third species described to have green pistils and
stigmas. The others are vegetatively somewhat similar to P. viridistigma P.C.Boyce,
S.Y.Wong & Bogner, (alkaline geologies, NW Borneo), and the vegetatively very
dissimilar T! biirbidgei (N.E.Br.) M.Hotta, (shales, N Borneo) (Fig. \K-C). Piptospatha
colata is distinguished from P viridistigma by the presence of a zone of staminodes
at the interstice of the pistillate and staminate flower zones, by the staminate flowers
much more densely arranged, with cream (not deep yellow) stamens, and truncate (not
excavated) connectives (Fig. lA & B), and the spadix barely one third as long at the
spathe. Leaves of P colata differ by the combination of the relatively shorter petiole
and relatively longer, narrower erect, not arching blades. Piptospatha burbidgei and
P. colata are differentiated by staminode morphology and colour, with the staminodes
truncate, prismatic, yellow, and not convex, rounded, white (Fig. lA & C). Leaf
morphology also readily distinguishes P. colata from P. burbidgei; leaf blades of P.
burbidgei are narrowly oblong, obtuse, and adaxially smooth, with the primary lateral
veins almost invisible, and of a characteristically rather peculiar olive-green (Fig. 3A
&C).
Piptospatha colata vegetatively rather resembles P. deceptrix S.Y.Wong &
P.C.Boyce and P pileata S.Y.Wong & P.C.Boyce (both from shales, Kalimantan Utara).
The leaf blades of P. colata are adaxially semi-glossy medium green with impressed
primary lateral veins and noticeably different to matte leaf blades with only slightly
impressed veins of P. deceptrix (Fig. 3A & D), and the deep green, glossy blades
with barely impressed venation of P. pileata (Fig. 3A & E). In addition, P. colata is
distinguished from both by spadix morphology (Fig. 1 A, D & E).
Spathe morphology ofF! colata is similar that of both P. pileata andF! elongata
(Engl.) N.E.Br. (granites, NW Borneo — Fig. 2A, E & F), although the teraiinal portion
of the spathe of P. colata is much less pronounced-rostrate.
Etymology^. From Latin colatus [fern, colata], cleansed, purified, in whimsical allusion
to this new species being for some time muddled by the authors with P viridistigma,
a situation rectified here.
Piptospatha deceptrix P.C.Boyce & S.Y.Wong, sp. nov.
Flowering Piptospatha deceptrix is reminiscent ofF! burbidgei, with the blunt, rose-pink
spathe with short terminal rostrum almost indistinguishable. Flowever, P. deceptrix is
readily distinguished from P. burbidgei by the much longer zone of truncate, centrally
impressed (not weakly convex) pale yellow (not white) staminodes below the pistillate
flower zone; by the absence (or at most very depauperate) interstice staminodial
zone; and by the very pale pinkish grey (not green) pistils and stigmas. The nan*owly
elliptic, acute leaf blades with the primary lateral veins adaxially impressed are quite
different to those of P. burbidgei, in which the leaf blades are narrowly oblong, obtuse,
and adaxially smooth with the primary lateral veins almost invisible. Piptospatha
deceptrix most closely approaches P. pileata in overall apperance, although the latter
is readily differentiated by the spadix with much longer zone of yellow interstitial
New Piptospatha species from Borneo
15
staminodes, by almost lacking a zone of staminodes below the pistillate flowers, and
by the deep magenta-purple (not pale rose-pink) strongly pileate spathe limb. Leaves
of R deceptrix and P. pileata are somewhat similar, but distinguished by the leaf blades
being glossy (P. pileata) rather than matte {P. deceptrix), and (in P. deceptrix) the
petioles lacking the crispulate hyaline wings along the dorsal edges. From both R
burbidgei and P. pileata, P deceptrix is distinct by the stouter, blunt-tipped spadix.
TYPE: Nakamoto AR-3980, Indonesian Borneo, Kalimantan Utara, Malinau Selatan,
Mentarong village, near the confluence of Sungai Mentarang and Sg. Malinau, 1 8 June
2012 (holo SAR! iso BO!). (Fig. ID, 2D, 3D)
Clumping rheophytic herb to 35 cm tall. Roots strong, c. 3 mm in diameter. Stem short,
condensed, to 25 mm in diameter, obscured by leaf bases. Leaves many together, arching,
fonning a loose rosette; petiole bases clasping stem; petiole 5-8 cm long, up to 2 mm
in diameter,^ D-shaped in cross-section, basal portion of petiole minutely scabrous, dull
medium green; petiolar sheath with free ligular portion, 2-A cm long, marcescent and
ultimately deciduous; persistent part of ligular sheath with hyaline margin, somewhat
dark reddish brown; leaf blades narrowly elliptic to narrowly oblanceolate, 7-22 cm
long X 2-4.5 cm wide, base cuneate, somewhat obtuse, apex acute with stout tubule,
c. 5 mm long, in life matte medium green adaxially, paler abaxially, drying dull pale
brown with abaxial venation darker; mid-rib bluntly raised adaxially, rounded-raised
and mmutely scabrous adaxially; primary lateral vems c. 8 per side, parallel pinnate,
very slightly impressed adaxially, slightly raised abaxially; inteiprimary lateral veins
weaker than primary laterals although still conspicuous, inteiprimary veins joining
a weaklydefined submarginal collecting vein; primary lateral and inteiprimary veins
veiy slightly raised abaxially and adaxially; inter]3rimary veins irregularly visible as
semi-translucent broken lines running parallel to the primary laterals. Inflorescence
solitary, erect; peduncle 9-17 cm long (at anthesis), c. 3 mm in diameter, minutely
by distinctly scabrous, reddish brown. Spathe initially erect, later held at c. 45° to
peduncle, later still (post anthesis) once again erect, not constricted, rose-pink in late
bud, opening with spathe limb bright rose-pink shading to medium pink and then
pale olive-brown (base) proximally; spathe limb inflated at anthesis, shedding during
staminate anthesis, c. 3.5 cm long, the base c. 1.5 cm wide, mid-way inflated to c.
2.5 cm, tenninal rostrum c. 3 mm long, with 3-5 very weak internal rostral keels.
Spadix 1. 8-2.2 cm long x 6-7 mm in diameter, base obliquely inserted onto spathe
and peduncle; pistillate flower zone with 2-4 rows of cream rhomboidal, apically
impressed staminodes inserted basally, pistillate flower zone pale gi*ey, cylindric, c.
3.5 mm long x c. 5 mm in diameter, pistils cylindrical, truncate, very congested, c. 0.6
mm diameter; stigma pale grey, with a slight central depression, strongly papillate, as
wide as ovary; pistillate and staminate zone mostly contiguous, occasionally with a
few scattered cream staminodes between, these rhomboidal -polygonal, with a central
impression; staminate zone pale cream, slightly exceeding the pistillate zone in width,
c. 1.3 cm long x 6-7 mm in diameter, stoutly fusiform, apex blunt; staminate flowers
congested, comprised of obscurely paired stamens, irregularly oblong, c. 0.5 mm wide
X c. 1 mm long, connective with a weak longitudinal sulcus and slightly frilled margins.
16
Gard. Bull. Singapore 65(1) 2013
these extending around the thecae, glabrous; thecae lateral, c. 0.3 mm, ellipsoid with a
wide rim, the opposite stamens linked by a the connective transverse sulcus. Fruiting
spathe deeply cyathifonn, dull olive-green, c. 1 cm long x 1,2 cm wide, the base
obliquely inserted on peduncle. Fruits and seeds not observed.
Distribution. Indonesian Borneo, Kalimantan Utara, known only from the type locality
Ecology’. Obligate rheophyte on waterfalls and river boulders on very hard shales
under moist lowland forest; c. 200 m. asl.
Notes. Piptospatha deceptrix is defined by the combination of lacking a zone of
staminodes above the pistillate flowers, a blunt, rose-pink spathe, and matte medium
green leaf blades with (abaxially) slightly impressed primary lateral veins.
Inflorescences of P. deceptrix are very reminiscent of those of P. burbidgei,
with the blunt, rose-pink spathe with short tenninal rostrum (Fig. 2C & D). However,
P deceptrix is readily distinguished from P. burbidgei by the much longer zone of
truncate, centrally impressed (not weakly convex) pale yellow (not white) staminodes
below the pistillate flower zone, the absence (or at most very depauperate) interstice
staminodial zone, and the very pale pinkish grey (not green) pistils and stigmas (Fig. 1C
& D). The narrowly elliptic, acute leaf blades with the primary lateral veins adaxially
impressed are quite different to those P. burbidgei, where the leaf blades are narrowly
oblong, obtuse, and adaxially smooth with the primary lateral veins almost invisible
(Fig. 3C & D).
In overall appearance P. deceptiix most closely approaches P. pileata, although
the latter is readily differentiated by the spadix with much longer zone of yellow
interstitial staminodes, by almost lacking a zone of staminodes below the pistillate
flowers, and by the deep magenta-purple (not rose-pink) strongly pileate spathe limb
(Fig. ID & E; Fig, 2D & E). Leaves of P. deceptrix and P. pileata are somewhat
similar, but distinguished by the leaf blades that are glossy {P. pileata) instead of matte
{P. deceptrix), and (in P. deceptrix) the petioles lacking the crispulate hyaline wings
along the dorsal edges.
From both P. burbidgei and P. pileata, P. deceptrix is distinct by the stouter,
blunt-tipped spadix (Fig. IC-E).
Etymology. Latin deceptus [fern, deceptrix'], to deceive, in allusion to this novelty
resembling one species vegetatively, and another in floral morphology.
ACKNOWLEDGEMENTS. The study visits to the herbaria mentioned in this paper were
funded under the first author’s ITTO Fellowship Ref. 026/09A. This is part of an on-going
research which is funded by the Ministry of Higher Education, Malaysia by fundamental
research grant scheme vote: FRGS/0 1(1 2)7709/2009(25 ). We also wish to extend our thanks to
the Directors or Curators of BO, L, SAR, and SING for allowing access to material, and to their
staff for facilitating our observations.
New Piptospatha species from Borneo
17
References
Bogner, J. & Hay, A. (2000) Schismatoglottideae in Malesia II - Aridarum, Bucephalandra,
Phyrnatarum dind Piptospatha. Telopea 9(1): 183-194.
Okada, H. & Tsukaya, H. (2010) A new species of Piptospatha (Araceae: Schismatoglottideae)
from West Kalimantan, Indonesian Borneo. Acta Phytotax. Geobot. 61: 87-92.
Wong, S.Y., Bogner, J. & Boyce, P.C. (2011) Studies on Schismatoglottideae (Araceae) of
Borneo XIV: Piptospatha mai-ginata resurrected and observations on Piptospatha,
notably for the Rejang drainages. Webbia 66: 29-32.
Wong, S.Y., Boyce, RC. & Bogner, J. (2009) Studies on Schismatoglottideae (Ai'aceae) of
Borneo VIII: A review of Piptospatha elongata in Sarawak. Card. Bull. Singapore
61(1): 217-233.
Wong, S.Y. & Boyce, P.C. (2010) Studies on Schismatoglottideae (Araceae) of Borneo XI:
Ooia, a new genus, and a new generic delimitation for Piptospatha. Bot. Stud. (Taipei)
51:543-552.
Wong, S.Y. & Boyce, P.C. (2012) Araceae of Indomalaya 11: Piptospatha N.E.Br. Malayan
Nat.J. 64(1): 9-32.
Wong, S.Y. & Boyce, P.C. (in press) Schismatoglottideae of Borneo XIX - Piptospatha pileata,
a remarkable new species from Kalimantan Timur, Indonesian Borneo. Willdenowia.
Gardens’ Bulletin Singapore 65(1): 19-26. 2013
19
Musa markkui (Musaceae),
a new species from Arunachal Pradesh, India
R. Gogol ^ and S. Borah^
Botanical Survey of India, Arunachal Pradesh Regional Centre,
Senld View, Itanagar, 791 1 11, Arunachal Pradesh, India
'
[email protected] (corresponding author)
ABSTRACT. Musa markkui R.Gogoi & S. Borah, a new species of Musa of the section
Rhodochlamys, is described and illustrated from Lohit valley, Arunachal Pradesh, India based
on observed morphological characters in the field. A key to M. markkui and related taxa is
provided.
Keywords. Arunachal Pradesh, banana, India, Musa, Musaceae, new species
Introduction
North East India is considered a part of Southeast Asia and within the centre of diversity
of Musa (Musaceae), a region not studied in detail and where new species and varieties
continue to be reported (Hakkinen 2007, 2009). The genus Musa consists of about 73
species (Hakkinen & De Langhe 2001; Hakkinen & Sharrock 2002; Hakkinen 2003a,
b, 2004a, b, 2005a, b, 2006a-c, 2007, 2009; Hakkinen & Meekiong 2004, 2005;
Hakkinen et al. 2005; Hakkinen & Wang 2007; Hakkinen & Wallace 2007; Hakkinen
et al. 2007; Hakkinen & Vare 2008a-c; Hakkinen et al. 2008; Swangpol & Somalia
2011) and over 500 cultivars (Simmonds 1956, 1966; Champion 1967; Valmayor et al.
2001, 2002; Hakkinen 2009).
The present communication records the discovery of a new species of Musa
from the Lohit valley of Arunachal Pradesh, India, here named M. markkui, which
belongs to the section Rhodochlamys. The section Rhodochlamys is one of the four
sections (the others being Australimusa, Callimusa and Musa) into which the genus
Musa is divided, whieh is confined mainly to NE India, Bangladesh, Myamnar and
NW Thailand (Hakkinen 2002, 2009). Species in Rhodochlamys are characterised by
erect or drooping inflorescence with fruits pointing towards the bunch apex. Most of
the species typically have relatively few fruits and are best known for their brightly
coloured bracts (Cheesman 1947, 1949; Simmonds 1962; Shepherd, 1999; Hakkinen
& Shan'ock 2002; Hakkinen 2005b, 2007; Hakkinen et al. 2007).
Extensive field obseiwations were made by the senior author during four
expeditions in July 2011 and September 2012 in the border areas of Lohit and Anjaw
districts of Arunachal Pradesh, under the Annual Action Plan Project ''Flora of
20
Gard. Bull. Singapore 65(1) 2013
Anjaw distiicf' of the Botanical Survey of India. The new species is described in
the field following the traditional banana taxonomy approach as used by Siminonds
(Simmonds 1962, 1966). Relevant portions of the specimens are deposited as holotype
at the Central National Herbarium (CAL) of the Botanical Survey of India, Howrah,
and isotype at the ASSAM herbarium.
Musa markkui R.Gogoi & S. Borah, sp. nov.
Musa markkui is closely related to M. ornata Roxb, developing slender plants, erect
inflorescences, green peduncles, andpink female and male buds, but differs in developing
more pseudostems per plant, a much taller height, larger leaves, inflorescences that are
at first erect and later becoming horizontal, longer peduncles with whitish pubescence,
revolute bracts, more hands with more fruit in the fi*uit bunch, and bigger fruits.
TYPE; Gogoi & Borah 21854, India, Amnachal Pradesh, Lohit District, 7 km before
Salangam towards Tidding, 27°56'25.33’'N 96‘'22'38.76"E, 1302 m, 13 September
2012 (holo 3 sheets, CAL; iso ASSAM). (Fig.l & 2).
Plant slender, suckers 12-22, produced freely and close to parent plant, vertical;
mature pseudostem 300-325 cm tall, 9-12 cm in diameter at the base, generally light
green with blood red blotches, shining, sap milky. Petiole 48-193 cm long, 3-3.5 cm
in diameter, petiole bases winged and not clasping the pseudostem, margin reddish;
blade 1 93-240 cm long, 45-65 cm wide, margin with brownish or pinkish lining, apex
truncate, upper surface deep green, lower surface light gi"een, mid-rib on lower surface
pink, on upper surface green, leaf base asymmetric, both sides rounded. Inflorescence
erect, or sometimes erect at first and then horizontal, peduncle to 40 cm long and 5.5
cm in diameter, clothed with white pubescence, sterile pink bracts two, persistent at the
opening of the first female flowers. Female bud lanceolate, to 40 cm long and 8-9 cm
wide; bracts pinlc, convolute, not waxy, white pubescent, 3-4 bracts parting at a time,
revolute and deciduous. Basal flowers female, hermaphrodite, 4-7 per bract in a single
row, flower 10.5 cm long (whole); ovary 5 cm long, 1 .5 cm in diameter, slightly curved,
triangular to quadrangular in cross section; style to 4.3 cm long, stigma capitate, 0.7
cm across; compound tepal 5.5 cm long, 2 cm wide, orange coloured, with 2 thickened
keels, ribbed at the dorsal angles, with a 5-toothed orange apex, lobes subequal, rolled
outwards; free tepal 5 cm long, 2 cm wide, translucent yellow, ovate, with a simple
fold under the apex, acumen orange; stamens 5, filaments yellowish white, to 2.8 cm
long, anther lobes to 3.2 cm long, rusty brown, anther and style at the same level. Male
bud pink, lanceolate, to 2 1 cm long and 1 1 cm wide; bracts outside pink, internally
light pink to whitish, one or two bracts parting at a time, revolute and deciduous,
male bud inconspicous or without remains at infmetescence maturity, only the rachis
remaining, 1 3-1 6 cm long. Male flowers on average 6 per bract in a row, compound
tepal 3. 5-5. 5 cm long, 0.8-1 cm wide, golden yellow, with a 5-toothed apex; free tepal
3-3.5 cm long, to 1.2 cm wide, translucent white, ovate, with a short orange acumen;
style light yellow with creamy or light yellow stigma; stamens 5, filaments white,
anther lobes creamy or light brown, anther and style at the same level; ovary straight.
Musa markkui, new species from India
21
Fig. 1. Musa markkui R. Gogoi & S. Borah. A. Plant in wild. B. Pseudostem base. C. Emerging
inflorescenee. D. Infloreseence with immature fruits and male bud. E. Infructescence. (Photos:
R. Gogoi & S. Borah)
22
Gard. Bull. Singapore 65(1) 2013
white, without pigmentation. Fruit brunch compact, with 4-7 fingers in a row, 7-10
hands, pedicel to 4 cm long; individual fruit up to 12 cm long (without pedicel), 2.5-3
cm in diameter, 3-4-angled, angles raised, fruit apex blunt-tipped at apex, without
floral remains, fruit peel colour light greenish yellow when ripe, immature fruit pulp
white, becoming creamy and soft at maturity. Seeds black, compressed, quadrangular,
surface tuberculate, c. 4 mm long and 5mm wide at apex.
Distribution and habitat. Musa markkui is quite common in the hilly slopes of Tidding,
Salangam, all the way from Hyuliang to Mataliang, at the higher elevations of 900-
1400 m in the Lohit and Anjaw district of Arunachal Pradesh. It occurs sympatrically
with M nagensium var. hongii and M. cheesmanii Sinunonds.
Notes. Chromosome numbers of Rhodochlamys species are 2n=22 (Cheesman &
Carter 1935; Simmonds 1962; Shepherd 1999; Hakkinen & Sharrock 2002; Campion
1967; Hakkinen 2009; Li et al. 2010).
Etymology. The new species M. markkui is named in honour of Finnish botanist
Markku Hakkinen for his outstanding contribution to a better understanding of Musa
taxonomy.
There was some confusion in a horticultural context (Singh et al. 2001; Uma et al.
2005; Uma 2006: 9, Fig.7) with the name M. rosacea (non Jacquin, and used without
any authority ) from Aranachal Pradesh; indeed, that seems to refer to a distinct species,
and shows similarity to M. markkui, but it is not published and type specimens were
not deposited towards making a valid publication. On the other hand, the confusion
between M. ornata Roxb. and M. rosacea Jacquin is also considered to be resolved
as Jacquin ’s Musa is synonymous with Musa balbisiana Colla and distinct from the
former (Vare & Hakkmen 2009).
NE India is very relevant to Musa taxonomy as it is the type locality of several
species, viz., M. velutina H.Wendl. & Drude, M. laterita Cheesman, M. sanguinea
Hook.f , M. mannii H.Wendl. ex Baker, M. aurantiaca Mann ex Baker, M. cheesmanii
Simmonds, M. nagensium Prain, etc. The present discovery of abeautifiil Rhodochlamys
species with horticultural potential raises the possibility of further undescribed species
in the wild. The new species M. markkui would be a desirable plant for introduction
into horticultural circles worldwide.
Key to some closely related Rhodochlamys species
la. Basal flowers female, 4-5 flowers per bract; male bracts orange externally,
orange-yellow inside Musa aurantiaca
b. Basal flowers hermaphrodite, 3-7 flowers per bract; male bracts blood red,
pink or rose on both sides 2
Musa markkui, new species from India
23
Fig. 2. Musa markkui R.Gogoi & S.Borah. A. Emerging female bud. B. Male bud with immature
fruits. C. Bract with basal flowers of female bud. D. Basal hermaphrodite flower. E. Free tepal
of basal flower (dorsal view). F. Free tepal of basal flower (ventral view). G. Ovary with style
and stigma. H. Male flower. I. Compound tepal (ventral view) with style of male flower. J.
Compound tepal (dorsal view). K. Stamens of male flower. L. Longitudinal section of fruit. M.
Seeds. (Photos: R. Gogoi & S. Borah)
24
Gard. Bull. Singapore 65(1) 2013
2a. Pseudostems 2-3 in the same plant; inflorescence erect or initially erect and
then horizontal; free tepals a quarter the length of the compound tepal; bracts
brick red or rose 3
b. Pseudostems 12-22 in the same plant, free tepals as long as compound tepals,
bracts blood red or pink 4
3a. Pseudostem emerging 2 meters from the parent plant; inflorescence erect;
male flowers 6-10 per bract in two rows, orange in colour, bracts brick red
Musa laterita
b. Pseudostem emerging quite close to the parent plant; inflorescence horizontal;
male flowers 2-3 per bract in one row, light yellow; bracts rose in colour
Musamannii
4a. Plant up to 1 50 cm tall; inflorescence horizontal, peduncle red, bracts blood red
externally and internally; fruit bunch lax Musa sanguinea
b. Plant up to 250-325 cm tall; inflorescence erect, peduncle light green, bracts
pink; fruit bunch compact 5
5a. Plant up to 240 cm high; pseudostem up to 15 in the same plant, with black
blotches; leaves up to 200 cm long, 35 cm wide; peduncle glabrous; bracts not
revolute; fruit bunch up to 5 hands with 3-6 fingers; individual fruits up to 8
cm long and 2 cm diameter Musa ornata
b. Plants up to 325 cm high; pseudostems up to 22 in the same plant, with red
blotches; leaves up to 240 cm long and up to 65 cm wide; peduncle pubescent;
bracts revolute; fruit bunch up to 10 hands with 4—7 fingers; individual Ifuit up
to 12 cm long and 3 cm diameter Musa markkui
ACKNOWLEDGEMENTS. The authors are grateful to Dr. R Singh, Director, Botanical
Survey of India, Kolkata and Dr. A. A. Mao, Scientist E and HOO, Arunachal Pradesh Regional
Centre, Botanical Survey of India, Itanagar for much support and logistics. We are also thankful
to Dr. K.N. Gandhi, Senior Nomenclatural Registrar, HUH, Harvard, U.S.A., for his helpful
suggestions during preparation of the manuscript.
References
Champion, J. (1967) Les Bananiers et Leur Culture, pp. xii + 214. Paris: IFAC, Editions
SETCO.
Cheesman, E.E. (1947). Classification of the bananas II: The genus Musa L. Kew Bull. 2:
106-117.
Cheesman, E.E. (1949) Classification of the bananas III: Critical notes on species. Kew Bull.
3: 265-272.
Cheesman, E.E. & Larter, L.N.H. (1935) Genetical and cytological studies of Musa III:
Chromosome numbers in the Musaceae. J. Genet. 30(16): 31-52.
Musa markkui, new species from India
25
Hakkmen, M. (2002) Wild bananas: The genus Musa L. of the section Rhodochlamys in India.
Newslett. Bot. Sun’. India 8(1): 1-3.
Haldcinen, M. (2003a) Taxonomic history and identity of Musa rubra Wall, ex Kurz. Philipp.
Agric. Scientist 86(1): 92-98.
Hakkinen, M. (2003b) Musa campestris Beccari varieties in Northern Borneo. Philipp. Agric.
Scientist 86(4): 424-^35.
Halckinen, M. (2004a) M/st/ voonii, a nevj Musa species from Northern Borneo and discussion
of the section Callimusa in Borneo. Acta Phytotax. Geobot. 55(2): 79-88.
Hakkinen, M. (2004b) Musa campestris Becc. (Musaceae) varieties in northern Borneo. Folia
Malaysiana 5(2): 81-100.
Hakkinen, M. (2005a) Musa azizii, a new Musa species (Musaceae) from Northern Borneo.
Acta Phytotax. Geobot. 56(1): 27-31,
Hakkinen, M. (2005b) Oniamental bananas: Notes on the section Rhodochlamys (Musaceae).
Folia Malaysiana 6(1 & 2): 49-72.
Halddnen, M. (2006a) Musa barioensis, a new Musa species (Musaceae) from Northern
Borneo. Acta Phytotax. Geobot. 57(1): 55-60.
Hakkinen, M. (2006b) Musa lawitiensis Nasution & Supard. (Musaceae) and its intraspecific
taxa in Borneo. Adansonia ser 3, 28(1): 55-65.
Halckinen, M. (2006c) A taxonomic revision of Musa rosea (Musaceae) in Southeast Asia.
Novon 1 6(4): 492-496.
Hakkinen, M. (2007) Ornamental bananas: Focus on Rhodochlamys. Cliron. Hort. 47(2): 7-12.
Hakkinen, M. (2009) Lectotypification of two Musa sections (Musaceae). Nord. J. Bot. 27:
207-209.
Hakkinen, M. & De Langhe, E, (2001) Musa acuminata in Northern Borneo. Montpellier,
France: INIBAP.
Hakkinen, M. & ShaiTOck, S. (2002) Diversity in the genus Musa — ^Focus on Rhodochlamys.
INIBAP Annual Report 2001, pp 16-23. Montpellier, France:INIBAP.
Hakkinen, M. & Meekiong, K. (2004) (Publ. 2005) A new species of Musa from Borneo. Syst.
Biodivers. 2(2): 169-173.
Hakkmen, M. & Meekiong, K. (2005) Musa borneensis Becc. (Musaceae) and its intraspecific
taxa in Borneo. Acta Phytotax. Geobot. 56(3): 213-230.
Hakkmen, M,, Suleiman, M, & Gisil, J. (2005) Musa beccarii Simmonds (Musaceae) varieties
in Sabah, Northern Borneo. F/nTotra'. Geobot. 56(2): 137—142.
Hakkmen, M. & Wang, H. (2007) New species and variety of Musa (Musaceae) from Yunnan,
China. Novon 17: 440-446.
Hakkinen, M. & Wallace, R. (2007) Musa siamensis, a new Musa species (Musaceae) from
Southeast Asia. Folia Malaysiana 8(2): 61-70.
Hakkinen, M., Suchankova, P, Dolezelova, M., Hribova, E. & Dolezel, J. (2007) Karyological
observations in the new variety of Musa beccarii (Musaceae). Acta Phytotax. Geobot.
58(2/3): 61-67.
Hakkinen, M. & Vare, H. (2008a) A taxonomic revision of Musa aurantiaca (Musaceae) in
Southeast Asia, J. Syst. Evol. 46: 89-92.
Halckinen, M. & Vare, H. (2008b) Taxonomic history and identity of Musa dasycarpa, M.
velutina and M. assamica (Musaceae) in Southeast Asia. J. Syst. Evol. 46: 230-235.
Hakkinen, M. & Vare, H. (2008c) Typification and check-list of Musa L. names (Musaceae)
with nomenclatural notes. Adansonia ser 3, 30(1): 63-112.
Hakkinen, M., Wang, H. & Ge, X.-J. (2008) Musa itinerans (Musaceae) and its intraspecific
taxa in China. Novon 18: 50-60.
26
Gard. Bull. Singapore 65(1) 2013
Li, L.-F., Hakkinen, M., Yuan, Y.-M., Hao, G. & Ge, X.-J. (2010) Molecular phylogeny
and systematics of the banana family (Musaceae) inferred from multiple nuclear
and cliloroplast DNA fragments, with special reference to the genus Musa. Molec.
Phylogenet. Evol. 57: 1-10.
Liu, A.-Z., Li, D.-Z. & Li, X.-W. (2002) Taxonomic notes on wild bananas {Musa) from China.
Bot. Bull. Acad. Sin. 43: 77—81.
Shepherd, K. (1999) Cytogenetics of the genus Musa. Montpellier, France:INIBAP.
Singh, H.P., Uma, S. & Sathiamoorthy, S. (2001) A Tentative Key for Identification and
Classification of Indian Bananas. Tiruchirapalli, India: National Research Centre for
Banana (ICAR),
Simmonds^ N.W. (1956) Botanical results of the banana collecting expedition 1954-5. Kew
Bull. 11(3): 463-489.
Simmonds, N.W. (1962) The Evolution of Bananas. London: Longman.
Simmonds, N.W. (1966) Bananas. 2nd ed. London: Longman.
Swangpol, S. & Somalia, J. (2011) Musa serpentina (Musaceae): A new banana species from
Westem border of Thailand. Thai Forest Bull, Bot. 39: 31-36.
Uma, S. (2006) Farmers * Knowledge of wild Musa of India. Rome: FAO.
Uma, S., Sathiamoorthy, S. & Durai, P. (2005) Banana: Indian Genetic Resources and
Catalogue. Tiruchirapalli, India: National Research Centre for Banana (ICAR).
Valmayor, R.V. (2001) Classification and characterization of Musa exotica, M, alinsanaya and
M. acuminata ssp. errans. Philipp. Agric. Scientist 84(3): 325-331.
Valmayor, R.V. (2002) Classification and characterization of Musella splendida sp. nov.
Philipp. Agric. Scientist 85(2): 204-209.
Vare, H. & Hakkinen, M. (2009) Proposal to conseiwe the name Musa balbisiana Colla against
M. rosacea Jacq. (Musaceae). Taxon 58(3): 1010.
Gardens’ Bulletin Singapore 65(1): 27-57. 2013
27
Two new species and a new record
for Colocasia (Araceae: Colocasieae)
from Arunachal Pradesh, Northeast India
R. Gogoi^ and S. Borah^
Botanical Survey of India, Amnaclial Pradesh Regional Centre,
Senki View, Itanagar, 7911 1 1, Arunachal Pradesh, India
’
[email protected] (corresponding author)
ABSTRACT. Two new species of Colocasia (Araceae: Colocasieae), C. boyceana R.Gogoi &
S.Borah and C. dihangensis R.Gogoi & S. Borah are described and illustrated from Arunachal
Pradesh, NE hidia. Colocasia lihengiae C.L.Long & K.M.Liu is reported as a new record for
the Flora of India. All three species are illustrated from living plants. A key to the Colocasia of
India is provided.
Keywords. Aroid, Arunachal Pradesh, Colocasia boyceana, Colocasia dihangensis, India
Introduction
The genus Colocasia Schott, includes about 20 species mainly confined to tropical
and subtropical Asia (Li & Boyce 2010). One cultivated species C. esculenta (L.)
Schott (taro) had tremendous economic significance since time immemorial, but
taxonomically the genus is still poorly known. As a part of tropical and subtropical
Asia, India is home to multiple wild species of Colocasia, but the full number of such
species is not known, due to inadequate survey and study.
While working for the “Flora of Anjaw District” under the annual action plan
of the Botanical Survey of India, the authors discovered and collected three Colocasia
species in Lohit Valley and Lower Dibang Valley district of Arunachal Pradesh. After
critical study, including of the relevant literature (Schott 1854; Hooker 1893, 1900;
Karthikeyan et al. 1989; Mayo et al. 1997; Li & Wei 1993; Li & Long 1998, 1999,
2000; Cao & Long 2003; Long & Liu 2001; Yin et al. 2004; Cai et al. 2006; Li & Boyce
2010), two of the species were found to be new. These are described and named here
as Colocasia boyceana R.Gogoi & S.Borah and Colocasia dihangensis R.Gogoi &
S.Borah. The third species has been determined as C. lihengiae C.L.Long & K.M.Liu
and is presented here as a new addition for the Flora of India.
Colocasia boyceana R.Gogoi & S.Borah, sp. nov.
Colocasia boyceana is readily distinguished from C. fontanesii Schott (a dark purple
species commonly grown as ornamental) by the dense hairy male fiower zone, although
28
Card. Bull. Singapore 65(1) 2013
both lack an appendix. Overall, C. boyceana differs from C fontanesii by the dwarf
habit and in forming massive colonies; the velvety leaf blades with venation impressed
adaxially; the (frequent) presence of a conspicuous purple spot at the junction of the
petiole and adaxial side of the blade; the purple blade margins; and a purple line from
the blade sinus to the dorsal junction of the petiole. Colocasia boyceana approaches
C. lihengiae C.L.Long & K.M.Liu but differs by the dense hairy male flower zone and
formation of massive colonies, by the pink cataphylls to the stolons, green petiole, up
to 9 pairs of leaf lateral veins, blade with purple lining along the leaf margin, purple
lining of pink cataphylls in stolons, and the presence of a conspicuous purple spot at
the junction of the petiole and adaxial side of blade.
TYPE: India, Arunachal Pradesh, Lohit district, just crossing Udayak Pass towards
Salangam, 1600 m, 27°55’59.33”N 96^21’ 18.48”E, 5 September 2012, Gogoi & Borah
21807 (holo CAL; iso ASSAM). (Fig. 1 A-C, 2)
Herb, medium sized, stoloniferous. Corm subcylindric, not massive, erect or slightly
horizontal, 11-17 cm long, 4-6 cm across, fusiform, much rooting, roots thick,
white; stolons horizontal, non branching, light pink, with pink cataphylls, intemodes
cylindric. Leaves 3-6, petiole glabrous, green, 47-82 long, 0.8-1 cm wide, dull green
towards base, sheath to less than 'A length, bract to 32 cm long; blade ovate-cordate to
sagittate-cordate, peltate, 27-40 cm long, 14-21 cm wide, velvety, glossy, dark green
adaxially, pale green abaxially, with a purple spot at the ventral junction of petiole,
apex acuminate or caudate; lateral veins 5-9 pairs, raised abaxially and impressed
adaxially, margins with purple colouration, purple lining from sinus to junction of the
petiole dorsally. Inflorescence 1, peduncle green, cylindric, shorter than petiole, 34-
43.5 long, 0.6-0. 8 cm across, spathe constricted between tube and limb; tube green,
oblong, 3. 2-5. 5 long, 1.8-2cm wide, subcylindric; limb erect, yellow on both surfaces,
lanceolate, 13-16.5 cm long, apex acuminate. Spadix shorter than spathe, to 7 cm long;
female zone whitish green, cylindric, c. 2 x 0.8 cm, with inter-pistillar staminodes;
ovary ovate or obovoid, c. 2 mm long, 1 .5 mm wide, green, stigma inconspicuously
3-lobed, sessile, discifonn, translucent white, staminodes yellow, ovate, erect, c. 2 mm
long and 1.5 mm wide; sterile zone yellowish white, 2.5 x 0.5 cm, cylindric; male zone
c. 2.5 X 0,8 cm, synandria c. 6-androus, polygonal, creamy, with white hairs; appendix
absent. Infructescence green, elliptic, 5.5-6 cm long, 2. 3-2. 6 cm across; berries green
when young, many seeded, obovate, 6x5 imn, seeds many.
Distribution and habitat. Colocasia boyceana grows in massive colonies in moist
shady places along streams. It is so far endemic to the Lohit and Lower Dibang valley
district of Arunachal Pradesh, at 1200-1600 m, recorded only by the type. The habitat
is shared with Steudnera colocasiifolia C.Koch. another colocasioid.
Phenology. Flowering and fruiting July-September.
Etymology. The specific epithet is given in honour of Peter C. Boyce for his outstanding
contributions to the Araceae of South East Asia.
Colocasia from Northeast India
29
Fig. 1. A-C. Morphological features of Colocasia boyceana R.Gogoi & S.Borah. A. Habit
of the plant. B. Abaxial side of the leaf purple lining in the sinus. C. Corm of the plant. D-G.
Morphological features of Colocasia dibangensis R.Gogoi & S.Borah. D. Habit of the plant.
E. Abaxial side of the leaf showing pink veins. F & G. Corm of the plant. (Photos: R. Gogoi
& S. Borah)
30
Gard. Bull. Singapore 65(1) 2013
Fig. 2. Habit and reproductive parts of Colocasia hoyceana R.Gogoi & S. Borah. A. Habit
of the plant. B. Inflorescence showing spathe and spadix. C. A complete spadix. D. Portion
of the male zone showing synandria with white hairs. E. Portion of the female zone. F & G.
Infructescence with green berries. (Photos: R. Gogoi & S. Borah)
Colocasia from Northeast India
31
lUCN conservation status. Presently there is no perceived threat to this species.
Notes. Colocasia boyceana is distinct among species of Colocasia as it bears a hairy
male zone, which is the first record of such a character within the genus. This new
species is close to C. fontanesii and C. lihengiae but differs significantly as discussed
above. Colocasia fontanesii is treated here as legitimate in place of C. antiquorum (Li &
Boyce, 2010) as the issue is one of typification. When Schott described C. antiquorum
he intended the name to apply to a stoloniferous plant with glossy leaf blades, and a
spathe limb opening almost fully and then reflexing. Unfortunately, in selecting a type
he chose a sterile and incomplete Linnaeus collection that is without doubt referable to
C. esculenta (hydrophobic leaf blade epidermis). Thus C. antiquorum is a synonym of
C. esculenta. Given this, the next available name for the glossy-leaf plant is Schott’s
C. fontanesii.
Colocasia dibangensis R.Gogoi & S. Borah, sp. nov.
Colocasia dibangensis differs from C. yunnanensis C.L.Long & X.Z.Cai (another
Himalayan species found at similar elevations) by its reduced female zone, the lack
of a constriction at the interstice, and characters of the male zone, synandria (and
comiective), and the synandrodes of the interstice. It is also distinctive by its purple or
pink young leaves, pink veins on the abaxial blade surface, and reddish-pinkish spathe.
Overall, C. dibangensis differs from C. yunnanensis by the absence of colour patches
between the veins of the adaxial blade surface, the presence of purplish or pinkish
colouration of the young leaf blades and petioles, pinkish veins on the abaxial surface
of the blade, and the markedly more shallow sinus.
TYPE: India, Arunachal Pradesh, Lower Dibang valley distict, 5 km ahead of 65 point
from Mayodia towards Hunli, 28°17’40.84”N, 95°55’ir’E, 2129 m, 19 Sep 2012
Gogoi & Borah 21877 (holo CAL; iso ASSAM, ARUN). (Fig. ID-G, 3)
Herb, medium sized, tubercled. Corm erect, subglobose, 9-1 1 cm long, 6-8 cm across;
densely rooted, roots thick, white with reddish coloration. Leaves 2-4, young leaves
pinkish or reddish, old ones green adaxially; petiole pale green with pinkish or reddish
colouration, cylindric, 65-80 cm long, 4-5 cm diam., sheathing is up to Vi length
of petiole; leaf blade cordate-peltate, orbicular-cordate, 42-75 cm long, 40-75 cm
wide, membranous, apex slightly apiculate, lateral veins 7-8 pairs, raised abaxially,
pink. Inflorescence 1-3 together; peduncle light pinkish, cylindric, to 17 cm, slender.
Spathe constricted between tube and limb; tube reddish pink, to 5 cm long, 2.5 cm
wide, oblong; limb reddish black extemally, light yellow internally, subcylindric, to 13
cm long, to 2.5 cm wide, oblanceolate, margins entire, erect or slightly curved apically,
apex acuminate, never relaxed on anthesis. Spadix sessile, to 17 cm long, shorter than
spathe; female zone reduced, green and yellow, cylindric, to 2. 3-2.5 x 1.4 cm, green
fertile flowers mixed with light yellow staminodes, synandrodes broadly oblong to
depressed ovate or depressed obpyramidal, apex subtruncate; ovary green, subglobose
or ovoid, 1 .5-2 mm diam., 1-loculed, parietal, placentae 3, ovules many; stigma sessile
32
Gard. Bull. Singapore 65(1) 2013
>0
M
J
Fig. 3. Reproductive parts of Colocasia dibangensis R.Gogoi & S. Borah. A & B. Reddish-
purple coloured spathe and spadix of the plant. C. Reduced female zone. D. Portion of sterile
zone. E. Portion of male zone showing synandria. F. Appendix of the spadix. G. Infructescence
with green berries. (Photos: R. Gogoi & S. Borah)
Colocasia from Northeast India
33
or subsessile, translucent white, globose, 0.5 mm wide; sterile zone starts continually
from female zone up to male zone, no constriction or slightly constricted between the
zones, 2-2.5 cm long, to 1.3 cm wide, cylindric, synandrodes yellowish white, 2-3 mm
long, 2-5 mm wide; male zone pinkish, synandria yellow with pink tinge, polygonal,
6-10-androus; appendix pink, conic, 2.5 x 0.5 cm, apex acute. Infriictescence green,
c. 7 cm long, 5 cm across, berry green when young, obovoid, 4-6 mm, seeds many.
Distribution and habitat. Colocasia dibangensis grows in large colonies or isolated
small populations in cool open places on hill slopes or along roadsides. It is so far
endemic to the lower Dibang valley district of Arunachal Pradesh; elevation 1 800-
2200 m, recorded only by the type.
Phenology. Flowering and fruiting July- September.
Etymology. The species is named after its type locality.
lUCN consolation status. Not evaluated, but while collecting we found no obvious
threat to this species.
Notes. Colocasia dibangensis is a species growing at high elevation and with pink or
purple coloured veins abaxially. The pink-coloured spathe and pink male and highly
reduced female zone (l/12th of the spadix) distinguish it from all other species of the
genus. This species is with the group bearing a conspicuous appendix in the spadix,
but its comparatively reduced conic appendix separates it from other species like C.
esculenta, C. fallax and C. affinis which are commonly found in NE India.
Colocasia lihengiae C.L.Long & K.M.Liu in Bot. Bull. Acad. Sin. 42: 313-317. (Fig. 4)
Herb, medium sized, stoloniferous. Corm subglobose, not massive, erect, 3 cm in
diam. Leaves 3-5, petiole glabrous, 60-100 cm long, green with purple reticulation,
blade peltate, saggitate-cordate, abaxially light green, adaxially dark green, leathery,
shining, 25-35 cm long, 14-21 cm wide, lateral veins 4-5 pairs, green. Inflorescences
up to 5, peduncle green with purple reticulation, cylindric, shorter than petiole, 40-45
cm long, 0.7-0.8 cm across, spathe constricted between tube and limb; tube green,
elliptic, subcylindric, 5. 5-6. 5 cm long, 1.6-2 cm wide; limb erect, golden yellow both
dorsally and ventrally, ovate, 14-16 cm long, apex acuminate. Spadix sessile, shorter
than spathe, to 8.5 cm long; female zone green, cylindric, 2. 5-2. 8 cm x 1-1.3 cm, 1/3
of the spadix, with inter-pistillar staminodes, yellow; ovary oblong, 2-2.5 x 2 mm,
green, 1-loculed, placentae 2, stigma sessile, 3-lobed, disciform, white, staminodes
yellow; sterile zone yellow, 2.5-3 cm x 0.8-1 cm, cylindric; male zone yellow, 3.8-4
cm X 0.7-0. 8 cm, synandria 3-1 0-androus, polygonal, creamy, without hairs; appendix
absent. Infriictescence green, elliptic, 5-7 cm long, 2-2.5 cm across; berries green
when young, ovate, c. 3-4 mm diam., seeds many.
34
Gard. Bull. Singapore 65(1) 2013
Fig. 4. Habit and reproductive parts of Colocasia lihengiae C.L.Long & K.M.Liu. A. Habit of
the plant. B. Corm. C. Inflorescence. D. View of a complete spadix. E. Portion of the female
zone showing ovaries and interpistillar staminodes. F. Portion of the male zone showing
synandria and possible pollinator. G. Infructescence with green berries. (Photos: R. Gogoi &
S. Borah)
Colocasia from Northeast India
35
Distribution. India (Assam: Dihing Patkai Reserve; Arunachal Pradesh: road to
Parasuram Kimda from Chowkliam in Lohit district); China (Yunnan, Mengla,
Mengxing River watershed).
Habitat. Colocasia lihengiae grows in little colonies in moist forest floors of tropical
evergreen forests at about 200-400 m. A quite good population was encountered in
Dihing Patkai Reserve forest of Assam and on the way to Parasuram Kunda from
Chowkham in Lohit district of Amnachal Pradesh. The apical shoots and petioles are
sold in market as vegetable.
Phenology. Flowering and fruiting July- September.
Specimen examined. INDIA. Arunachal Pradesh. Between Wakro and Parasuram Kund, 250
m, 5 Sept. 2012, Gogoi & Borah 21814 (ARUN).
Notes. Colocasia lihengiae was described from Yunnan province of China (Long &
Liu 2001). In the Flora of China account (Li & Boyce 2010), it was treated as a
synonym of C. antiquorum. As mentioned above C. antiquorum is a synonym of C.
esculenta and C lihengiae is a distinct species from C. esculenta by the absence of an
appendix, and here it is treated as a valid species.
A key to the species of Colocasia is presented for NE India that includes and
distinguishes C. boyceana, C. dibangensis and C. lihengiae, as follows.
Key to Colocasia species in NE India
1 a. Appendix present and more than 2 cm long 2
b. Appendix absent or highly reduced, less than 1 cm long 5
2a. Young leaves pinkish, blade 42-75 x 40-75cm; spathe pink, tube reddish
purple; spadix deep pink, appendix triangular conic C. dibangensis
b. Young leaves whitish green or pale green, blade less than 10-45 x 10-35cm;
spathe yellow or greenish white, or slightly purplish apically ( C.fallax), tube
green; spadix yellow or pale yellowish green, appendix narrowly conic to
cylindric narrowly conic 3
3a. Plant tuberous or rhizomatous, up to 100 cm tall; spathe dull yellow, spreading
and open flat, not revolute; infructescence erect C. esculenta
b. Plant stoloniferous, less than 75 cm tall; spathe bright yellow, not spreading,
re volute; infrutescence pendent 4
4a. Leaves with dark patches between primary lateral veins; female and male zones
contiguous C affinis
b. Leaves usually concolourous green; female and male zone separated by a zone of
synandrodes C. fallax
36
Gard. Bull. Singapore 65(1) 2013
5a. Plant robust, up to 225 cm tall; petiole and peduncle deep purple red; spathe c.
25 X 11cm; appendix reduced, less than 1cm long C.fontanesii
b. Plant small, less than 130cm tall; petiole green or light puiple reticulate; spathe
less than 17 x 7cm; appendix absent 6
6a. Leaf margin with purple lining; purple spot at ventral junction of petiole;
venation impressed; synandria with white hairs C. boyceana
b. No puiple lining and spot on leaf; venation raised; synandria without hairs 7
7a. Basal lobes of leaf obtuse; petiole green; spathe tube c. 2.5 cm; synandria
stellately crenate; sterile zone c. 1.2 cm long C. manii
b. Basal lobes of leaf usually acute; petiole light purple reticulate; spathe tube c. 5 .5
cm; synandria polygonal; sterile zone c. 3 cm long C. lihengiae
Conclusion
The present report establishes the existence of wild species of Colocasia that are shared
between the western and eastern regions of Himalaya, in India and China. At the same
time, it expands our understanding of a possibly unique assemblage of diverse Colocasia
species growing wild inNE India, composed of C. esculenta, C. boyceana, C. affinis, C.
dibangensis, C. faUax, C. fontanesU, C. manii and C. lihengiae. In S China, the overall
assemblage of Colocasia species also appears to be unique with C. affinis, C. bicolor,
C. esculenta, C. fallax, C. fontanesU, C. gaoligongensis, C. gigantea, C. gongii, C.
heterochroma, C. menglaensis, C. tibetensis and C. yiinnanensis. The existence of
diverse assemblages of Colocasia species in different regions of Himalaya indicates
that the genus has a long and complex history in the Himalayan region. The recent
discoveries of two new Colocasia species raises a posibility of the further existence of
undescribed species in the wild, and at the same time the existence of more Chinese
species in the region of Indian Himalaya.
ACKNOWLEDGEMENTS. The authors are grateful to Dr. P. Singh, Director, Botanical
Survey of India and Dr. A. A. Mao, Scientist-E & HOO, BSI, APRC for support and logistics.
The first author is highly thankful to Peter C. Boyce, Sarawak, Malaysia for confinning the
novelty of the species here described as C. boyceana, and to Peter Matthews, Museum of
Ethnology, Japan for confinning the new status of the taxon here called C. dibangensis and
for detemhning C. lihengiae. Thanks are also to Dr. K.N. Gandhi, HUH, Harvard, U.S.A. for
helpful suggestions during preparation of the manuscript.
References
Cai, X.-Z., Long, C.-L. & Liu, K.-M. (2006) Colocasia yunnanensis (Araceae), a new species
from Yunnan, China. Ann. Bot. Fenn. 43: 139-142.
Colocasia from Northeast India
37
Cao, L.-M. & Long, C.-L. (2003) Colocasia bicolor (Araceae), a new species from Yunnan,
China. Ann. Bot. Fenn. 40: 283-286.
Hooker, J.D. (1 893) Araceae. In: Flora of British India 6: 490-558. London: L. Reeve & Co.
Hooker, J.D. (1900) Colocasia antiquorum wax.fontanesii. Curtis’s Bot. Mag. 126 (ser.3.v.56):
t. 7732.
Karthikeyan, S., Jain, S.K., Nayar, M.R & Sanjappa, M. (1989) Monocotyledonae. In: Florae
Indicae Enumeratio. R 10. Calcutta: Botanical Survey of India.
Li, H. & Boyce, R.C. (2010) Colocasia. In: Flora of China 23. Rp. 73-75. Beijing: Science
Rress; St. Louis: Missouri Botanical Garden Rress.
Li, H. & Long, C.L. (1998) A preliminary revision of Araceae in China. Acta Bot. Yunnan.
Supp. 10: 12-23.
Li, H. & Long, C.L. (1999) Anew species of Colocasia (Araceae) from Mts. Gaoligong, China.
Feddes Repert. 110: 423-424.
Li, H. & Long, C.L. (2000) Colocasia gongii (Araceae), a new species from Yunnan, China.
Feddes Repert. Ill: 559-560.
Li, H. & Wei, Z.X. (1993) Colocasia heterochroma, a new species of Colocasia from Araceae.
Acta Bot. Yunnan. 15: 16-17.
Long, C.L. & Liu, K.M. (2001) Colocasia lihengiae (Araceae; Colocasieae), a new species
from Yunnan, China. Bot. Bull. Acad. Sin. 42: 313-317.
Mayo, S.J., Bogner, J. & Boyce, R.C. (1997) The Genera of Araceae. U.K.: Royal Botanic
Gardens, Kew.
Schott, V. (1854) Rflanzenskizzen. In: Oesterreichischesbotanisches Wochenblatt A{5\): 409-
410.
Yin. J.-T., Li, H. & Xu, Z.-F. (2004) Colocasia menglaensis (Araceae), a new species from
southern Yunnan, China. Ann. Bot. Fenn. 41: 223-226.
Gardens’ Bulletin Singapore 65(1): 39-46. 2013
39
Zingiber kangleipakense (Zingiberaceae):
A new species from Manipur, India
Rajkumar Kishor' and Jana Leong-Skomickova^
'Medicinal Plants and Horticultural Resources Division,
Institute of Bioresources and Sustainable Development,
Takyelpat Institutional Area, linphal-795001, Manipur, India
-The Herbarium, Singapore Botanic Gardens,
1 Cluny Road, 259569 Singapore
ABSTRACT. Zingiber kangleipakense Kishor & Skomick. (Zingiberaceae) from Manipur,
India is newly described and illustrated. A comparison with the most closely related species, Z.
longiligulatum and Z. roseum is provided.
Keywords. Gingers, NE India, taxonomy. Zingiber longiligulatum. Zingiber roseum,
Zingibereae
Introduction
The genus Zingiber Mill. (Zingiberaceae, Zingibereae) is distributed in tropical
to warm-temperate Asia with the highest diversity in the monsoonal parts of Asia,
particularly in Thailand with 56 species (Triboun 2006) and China with 43 species (Wu
& Larsen 2000). The exact number of species in the genus is not known. More than
250 names in Zingiber have been published, but this probably corresponds to about
100 to 1 50 species (Theilade 1999; Wu & Larsen 2000). Key characteristic features of
the genus Zingiber include i) lateral staminodes fused to the labellum, ii) labellum not
comiate to the filament, iii) elongated, hom-like anther crest, wrapped around the style
and iv) presence of a pulvinus at the base of the petiole, which distinguishes Zingiber
from other ginger genera in the field even when sterile.
Roxburgh reported 11 species of Zingiber in India (1810, 1820). Later, Baker
(1892) described 24 species from British India. Of these, only 16 fall within India’s
current boundaries. In the checklist of Indian monocots, Karthikeyan et al. (1989)
listed 1 8 species, eight of which were reported by Sabu (2003 , 2006) from South India.
There is no recent work on the genus Zingiber from N or NE India.
hispite of some 60 new Zingiber taxa described in past twenty years from China
(e.g. Tong 1987; Tong & Xia 1987, Tong & Liu 1991, Fang & Qin 1996), Vietnam
(Theilade & Mood 2000), Thailand (e.g. Theilade 1999; Mood & Theilade 2002),
Peninsular Malaysia (Theilade 1998; Lim 2001 a, b, 2002, 2003), Borneo (Theilade
& Mood 1997, 1999) and Philippines (Mood & Theilade 2001), no new Zingiber has
been reported from India or Bangladesh recently.
40
Gard. Bull. Singapore 65(1) 2013
While exploring in NE India, the first author found a Zingiber species growing
quite abundantly in moist and shady areas of the Imphal valley in July 2000. It could not
be matched to any Indian, Chinese, Thai or Indochinese species, nor to the protologues
of the vast majority of other Zingiber species. Type specimens of the most closely
related species have been examined at BK, BKF, CAL, HTBC, KUN, MH & P. The
new Zingiber is thus described below.
The measurements and descriptions provided are based on living material. The
plant parts were photographed using a digital camera, while dissected materials were
directly scanned using a flatbed scanner (Model: 2300c, Hewlett Packard), micro
details were photographed using a stereo-zoom microscope (Model: SZ-II, Olympus,
USA).
Zingiber kangleipakense Kishor & Skomick., sp. nov.
Zingiberi roseo similis, robustiore (ad 1. 7 m longo contra 0.9 m), bracteis viridibus
(contra rubellis), corollae lobis luteis (contra dare mbris), antherae crista lutea
(contra aurantiaca) differt.
TYPUS: Kishor 9, India, Manipur, Imphal, Sagolband, c. 24°48'N 93®55'E, 780 m asl,
20 July 2000 (holo CAL; iso SING; iso Herbarium of Institute of Bioresources and
Sustainable Development, Imphal). (Fig. 1 & 2)
Terrestrial rhizomatous herb, rhizome branched, mature branches up to 2.0 cm in
diam., externally light brown, internally white when young, white to pale cream when
old, with mild tunueric aroma. Leafy shoot 150-170 cm tall, erect, fleshy. Leaf sheaths
green or with reddish tinge, glabrous or finely pubescent, with thin membranous
margins; ligule 2-3.2 x 1,3-1. 5 cm, slightly, unequally bilobed at apex when young,
more or less entire later, glabrous, hyaline and fragile. Leaves 8-15 per pseudostem,
sessile or shortly petiolate; petiole 0-5 mm long; lamina 35-42 x 7-8 cm, oblong-
lanceolate, adaxially dark green, smooth, pubescent along side of midrib, abaxially
off-green, pubescent, base cuneate, apex acuminate. Inflorescence generally arising
from the rhizome on a separate short peduncle 0.5-1 cm, sometimes breaking through
the leaf-sheaths up to 25 cm above the ground. Spike 5-8 x 3-^ cm, nan*owly ovoid,
bearing 15-20 flowers. Bracts 2. 8-6.5 x 1.8-3. 5 cm, outer bracts oblong, apex
rounded, green or tinged with purplish red, inner ones oblong-lanceolate, pale green,
apex reflexed, cuspidate, shortly hairy, margins hyaline. Bracteole 3. 8^.3 x 0.8
cm, lanceolate, shortly pubescent on the outside, margins thin, membranous, cream
coloured. Calyx c. 2.5 x 0.5 cm, tubular, white, membranous, tri-dentate with 1 cm
longitudinal unilateral incision, pubescent. Floral tube slender c. 5 cm long, pale
yellow to white towards the base, dorsal corolla lobe 2.5-3 .0 x 0.4-0. 6 cm, translucent
cream at the base, deep yellow with reddish tinge at apex, strongly recurved; lateral
corolla lobes c. 2.5 x 0.5 cm, coloured as the dorsal lobe, recurved, adhering basally
to the ventral surface of the labellum at 1.2 cm from the apex. Labellum c. 3 x 1,5
cm, light yellow with wavy and crisped margins, side lobes absent or reduced to a 1
mm long, triangular vestige. Anther sessile, thecae 1 .8 cm long; connective and crest
New Zingiber from Manipur, India
41
Fig. 1. Zingiber kangleipakense. A. Rhizome with roots. B. Pseudostems. C. Ligules. D. Apex
and base of the leaf. E. Inflorescenee. F. Braets. G. Bracteole. H. Single flower (side view,
calyx removed). I. Labellum (flattened). J. Dorsal and lateral corolla lobes (flattened). K.
Anther with crest (front view). L. Ovary with epigynous glands. M. Ovary with calyx and base
of the floral tube. N. Mature fruit with seeds. O. Seeds embedded in aril. Scale bars: A, C, E-K,
M-N (1 cm); B (50 cm), D (5 cm), L, O (5 mm). Based on Kishor 9. (Photos: Rajkumar Kishor)
42
Gard. Bull. Singapore 65(1) 2013
yellow. Pollen 277 x 158 |Lim, ovoid. Style 7.5 cm long, filiform, stigma projecting
from the anther crest, ostiole hairy. Epigynous glands two, 4 mm long, free from
each other, cream. Ovary c. 4 x 3-4 mm, trilocular with many ovules, placentation
axile, densely pubescent outside. FrwiV a capsule, 4 x 2.5 cm, ovoid-elliptic, trigonous,
green with red tinge outside, bright red inside; seeds up to 6 lum long, black, obovoid,
completely covered in white aril.
Distribution, habitat and ecology. The species is known to occur in at least three
districts of Manipur, namely Imphal West, Imphal East and Sanapati. It grows at 750-
1400 m above sea level in Imphal Valley usually in the undergrowth of groves and
bamboo brakes, prefering moist and shady areas. It may be found cultivated around
homesteads too. The prevailing climate in the valley is monsoon sub-tropical with an
annual rainfall of 1375 mm and a temperature range of 12-27°C.
Phenology. Flowering June-July, fruiting August-September.
Etymology. The specific epithet is assigned in honour of Kangleipak, an old name of
Manipur, which is the natural habitat of Z. kangleipakense. This area provides and
important contribution of plant and animal species to the Indo-Bunnese biodiversity
hotspot.
Vernacular names and uses. In Manipur, it is locally known as ‘Namra’. Young
rhizome along with the pseudostem are sold on local vegetable markets in Imphal and
neighbouring villages and are used as a minor vegetable by cooking with fermented
fish, potato and other items in a preparation commonly known as ‘iromba’.
Notes. Zingiber kangleipakense is similar to Indian Z. roseum (Roxb.) Roscoe from India
(Roxburgh 1798, 1820). Both species have thick, fleshy, white to pale cream rhizomes,
shortly petiolate leaves of similar size and shape, inflorescences arising from the rhizome
on a short peduncle embedded in the ground and single-lobed yellow labellum. The
lamina of more robust Z. kangleipakense, is, however, pubescent abaxially on the sides
of the midrib, has green and broader bracts, yellow corolla lobes and a yellow anther
crest. Z. kangleipakense is similar also to Cliinese Z. longiligulatum S.Q.Tong, but the
latter reaches only up to 1 m, has larger leaves, namower bracts, patent dorsal corolla
lobe and orange anther crest. More detailed comparison of characters among Z, roseum,
Z. longiligidatum andZ. kangleipakense is presented in Table 1.
Triboun (2006) pointed out the difficulties in placing Z. junceum and Z barbatum
at infrageneric level as these species produce inflorescence both basally and terminally
fittmg into section Zingiber and Dymczewiczia respectively. For similar reasons, it is
difficult to place Z. kangleipakense unequivocally in a section. Although the shape of
the labellum and the inflorescence borne directly from the rhizome resemble numerous
species of section Ciyptanthium), the inflorescence of Z. kangleipakense sometimes
protrudes tlirough the pseudostem, a characteristic known from section Pleuranthesis.
This species was previously misidentified as Amomum aromaticum by Singh et
al. (2003).
New Zingiber from Manipur, India
43
Fig. 2. Zingiber kangleipakense. A. Leafy shoot. B. Infmctescence with mature, opened fruit.
C. Infructescenee with elosed, not fully matured fruit. D-E. Inflorescence breaking through the
leaf-sheaths of pseudostem. F. Inflorescence emerging from the rhizome at the ground level.
Based on Kishor 9. (Photos: Rajkumar Kishor)
44
Gard. Bull. Singapore 65(1) 2013
Table 1. Comparison of characters of Zingiber kangleipakense with Z. roseutn and Z.
longiligulatum, the latter two as observed from original descriptions, original illustrations and
types.
Character
Z. kangleipakense
Z. longiligulatum
Z. roseum
Rhizome
white to pale cream
internally
not described
white internally
Leafy shoot
150-170 cm
80-100 cm
60-90 cm
Ligule
2-3.2 cm long, entire or
bilobed, glabrous
4-5 cm long, entire,
pubescent
not mentioned
Lamina
35^2 X 7-8 cm, midrib
sides pubescent abaxially
43^9 X 10-11 cm,
pubescent abaxially
30 X 8-10 cm,
both sides glabrous
Peduncle
up to 1 cm when arising
from the rhizome, rarely
prottuding thi'ough the
pseudostem up to 25 cm
above ground.
2-6 cm
not specified; short,
up to c. 5 cm based
on drawing
Bracts
2. 8-6. 5 X 1.8— 3.5 cm,
outer 2-3 green with
pmplish red tinge, inner
green, apex cuspidate, cusp
hairy
4^.5 X 0.8-0. 9 cm,
green, pubescent, apex
acuminate
reddish
Floral tube
white to pale yellow,
glabrous
yellowish at apex,
densely pubescent
white to pale yellow
Corolla
lobes
yellow with reddish tinge
tenninally, dorsal corolla
lobe strongly reflexed
yellowish, dorsal
corolla lobe patent
bright red, dorsal
corolla lobe strongly
reflexed
Labellum
entire, single-lobed or with
rudimentary side lobes,
unspotted, light yellow
entire, single-lobed,
yellowish, side lobes
absent
entire, single-lobed,
light yellow
Anther crest
light yellow
orange
orange
ACKNOWLEDGEMENTS. The first author thanks the Director, IBSD, Imphal for extending
the laboratory facilities for the study. We thank the curators of BK, BKF, CAL, HTBC, KUN,
MH, P herbaria for letting us examine specimens in their care. The Zingiberaceae Resource
Centre at the Royal Botanic Garden Edinburgh (http://elmer.rbge.org.uk/zrc/) and the Asian
Zingiberaceae Resource Centre at Singapore Botanic Gardens are acknowledged for providing
New Zingiber from Manipur, India
45
protologues, related references and images of numerous type specimens. We are grateful to Dr.
J.F. Veldkamp (L) for translating the diagnosis into Latin.
References
Baker, J.G. (1892) Zingiber. In: Hooker, J.D. (ed) Flora of British India 6: 243-249. London:
L. Reeve and Co.
Fang, D. & Qin, D. (1996) Five new species of monocotyledonae from Guangxi. Guihaia 16:
3-8.
Karthikeyan, S., Jain, S.K., Nayar, M.R & Sanjappa, M. (1989) Zingiberaceae. In: Florae
Indicae Enumeratio - Monocotyledonae. Pp. 289-299. Calcutta: Botanical Survey of
India.
Lim, C.K. (2001a) The ‘Firebird”: A resplendent new Zingiber from Peninsular Thailand and
Malaysia. Folia Malaysiana 2: 35^2.
Lim, C .K. (200 1 b ) The scented Zingiber wrayi Prain ex Ridley: A new variety. Folia Malaysiana
2: 43-53.
Lim, C.K. (2002) A new endemic species of Zingiber Boehm, from Johor, Malaysia. Folia
Malaysiana 3: 25-30.
Lim, C.K. (2003) Zingiber aurantiacum (Holtt.) Theilade, Z, petiolatum (Holtt.) Theilade and
two related new taxa from Peninsular Malaysia and Thailand. Folia Malaysiana 4: 65-
76.
Mood, J. & Theilade, 1. (2001) Two new species of Zingiber (Zingiberaceae) from the
Philippines. Nord. J. Bot. 21: 129-133.
Mood, J. & Theilade, I, (2002) New gingers from Southeast Asia. New Plantsman 1: 14-22.
Roxburgh, W. (1798) Plants of the Coast of Coromandel. Vol. 2. London: W. Bulmer & Co.
Roxburgh, W. (1810) Description of several of the monandrous plants of India. Asiat. Res. 11:
318-362.
Roxburgh, W. (1820) Flora Indica. Serampore: Mission Press.
Sabu, M. (2003) Revision of the genus Zingiber in South India. Folia Malaysiana 4: 25-52.
Sabu, M. (2006) Zingiberaceae and Costaceae of South India. Kerala: Printarts Offset.
Singh, H.B., Singh, R.S. & Sandhu, J.S. (2003) Herbal Medicine of Manipur: A Colour
Encyclopaedia. New Delhi, India: Daya Publishing House.
Theilade, I. (1999) A synopsis of the genus Zingiber (Zingiberaceae) in Thailand. Nord. J. Bot.
19: 389-410.
Theilade, 1. (1998) Revision of the genus Zingiber in Peninsular Malaysia. Gard. Bull.
Singapore 48: 207-236.
Theilade, I. & Mood, .1. (1997). Five new species of Zingiber (Zingiberaceae) from Borneo.
Nord. J. Bot. 17: 337-347.
Theilade, 1. & Mood, J. (1999) Five new species of Zingiber (Zingiberaceae) from Borneo.
Nord. J. Bot. 19:513-524.
Theilade, 1. & Mood, J. (2000) Validation of Zingiber collinsii (Zingiberaceae) from Vietnam.
Nord. J. Bot. 20: 32.
Tong, S.Q. (1987) New plants of Zingiber ImmYmmdin. Acta Phytotax. Sin. 25: 140-149.
Tong, S.Q. & Liu, X.Z. (1991) A new species of Zingiber from Yunnan. Acta Bot. Yunnan.
13:27-29.
Tong, S.Q. & Xia, Y.M. (1987) New taxa of Zingiberaceae from southern Yunnan. Acta
Phytotax. Sin. 25: 460^71.
46
Gard. Bull. Singapore 65(1) 2013
Triboun, P. (2006) Biogeography and Biodiversity of the Genus Zingiber in Thailand. PhD
thesis submitted to the Graduate sehool, Khon Kaen University, Thailand.
Wu, T.L. & Larsen, K. (2000) Zingiberaeeae. In: Wu, Z.Y., PH. Raven (eds) Flora of China 24:
333-346. Beijing: Science Press.
Gardens’ Bulletin Singapore 65(1): 47-95. 2013
47
The history and identity of Boesenbergia longiflora
(Zingiheraceae) and descriptions of five related new taxa
John D. Mood^, Linda M. Prince^, J.R Veldkamp^
and Santanu Dey^
'Lyon Arboretum, University of Hawaii, 3860 Manoa Road,
Honolulu, HI 96822, USA
zmgiber@ wannlava. com
^The Field Museum, Department of Botany,
1400 S Lake Shore Dr., Chicago, IL 60605, USA
^National Herbarium of The Netherlands, Naturalis Biodiversity Center,
P.O. Box 9514, 2300 RA Leiden, The Netherlands
"'Department of Botany, Nagaland University, Lumami 798627,
Zunheboto, Nagaland, India
ABSTRACT. The history of Boesenbergia longiflora (Wall.) Kuntze (Zingiheraceae) is
reviewed, its identity is discussed and a lectotype designated. Five new, related taxa are
described and illustrated: B. collinsii Mood & L.M.Prince, B. hamiltonii Mood, S.Dey &
L.M.Prince, B. kerrii Mood, L.M.Prince & Triboun, B. kingii Mood & L.M.Prince, and B.
maxwellii Mood, L.M.Prince & Triboun. A phylogenetic analysis of plastid trnK intron
(including inatK) and nuclear ITS DNA sequence data indicate these Boesenbergia species
form a clade within Boesenbergia. Results of the molecular data analyses in concert with
several diagnostic characters, support the recognition of the new taxa. Historical illustrations,
colour plates, a field key to the species, a comparative table, a listing of the botanical history of
B. longiflora, and a geographical distributional map are provided.
Keywords. Burma, Curcumorpha, Gastrochilus, India, Thailand
Introduction
Boesenbergia longiflora (Wall.) Kuntze was described in 1829 as Gastrochilus
longiflora by Nathaniel Wallich based on his collection from Rangoon, Burma [ Wallich
65 89 A (K-W)]. Boesenbergia was proposed in 1891 when Otto Kuntze observed that
Gastrochilus Wall, is a homonym of Gastrochilus D.Don (1825; Orchidaceae). In
1974 it was regarded as belonging to the monotypic genus Curcumorpha A.S.Rao &
D.M.Verma. This change was countered by Larsen (1997) but is still in use by some
(Kress et al. 2002, Gao et al. 2004).
During a botanical survey in the Lampang Province, Thailand in 1998, numerous
plants which at first were identified as B. longiflora were observed growing on the
margins of secondary forest. These were easily recognised by their robust stature and
large, white flowers. Later, another Boesenbergia, reminiscent of B. longiflora, but with
yellow flowers, was encountered on a limestone outcrop [Mood & Pedersen 1455 (C)].
48
Gard. Bull. Singapore 65(1) 2013
Its Specific identity remained unclear. Several years later, yet another Boesenbergia
with yellow flowers was collected by Mark Collins (1963-2011) from a limestone
area in Loei Province, Thailand. Living plants of this field collection (T~3068} were
later determined to be similar to the earlier Lampang collection. Identification of the
two collections began with a review of Wallich’s description of G. longiflora which
was described as having small, yellow flowers with red markings on the labellum
(Fig. 1). This infomiation was very surprising, as it was inconsistent with the cun-ent
perception of B. longiflora being a ginger with large, white flowers with pink markings
on the labellum (Wu & Larsen 2000; Kress et al. 2002; Gao et al. 2004, 2005; Larsen
& Larsen 2006). This significant discrepancy precipitated a complete review of the
history of B. longiflora (Appendix A).
The historical findings mdicated that the true B. longiflora (Wall.) Kuntze was
very similar to the two aforementioned Thailand collections. The current perception of
a white-flowered ginger appears to have been fostered by a watercolour published by
Hooker in 1 843 (Fig. 2). Based on a reference by Baker (1890), the plant Hooker used
for this illustration was sent to Kew fi‘om the Calcutta Botanical Gardens ( Wallich
1 840), which was identified with the unpublished name, G. jenkinsii. Although Baker
(1890) mentioned this error, he described white flowers, as did Schumann (1904).
Holttum (1950) also noted the discrepancy between the Hooker illustration and
Wallich’s, but did not pursue the matter. Rao and Vemia (1974) described their C.
longiflora as white-flowered, but in this case, it was based on 20 specimens from
Assam and Meghalaya, India, the area where Wallich found G. jenkinsii (Voigt 1845).
Although the historical information improved the taxonomic understanding of
B. longiflora, several taxa remained unconfinued or unidentified: Wallich’s G. jenkinsii
from Assam (Fig. 2); the large Boesenbergia coimnon to N. Thailand;
the specimens cited by Rao and Verma; and finally, the two yellow-flowered Thailand
collections. In order to properly identify these and other specimens, the present
research was initiated in 2008 using an integrated taxonomic/phylogenetic approach.
Materials and methods
Taxonomy. Historical references, both text and illustrations (Appendix A) were used to
provide an understanding of past taxonomic perceptions. Also, over 200 digital images
of B. aff. longiflora obtained from various sources were reviewed and categorised by
flower morphology and geographic location, providing early clues on diversity and
phytogeography. Herbarium specimens (75) labelled as B. longiflora or C. longiflora
were examined and photographed at ASSAM, BK, BKF and CAL in 2009. Another
75 specimens were viewed via digital images from AAU, C, E, K, L, P, SING and
US. This exercise provided an important finding — ^the B. longiflora complex was
extremely difficult to sort out and distinguish one taxon from the other in the herbarium.
Vegetative characters often used to determine the identity of dried specimens in
other Zingiberaceae were not particularly useful here. Additionally, flowers did not
preserve well, changed colour upon pressing and became indistinguishable by shape.
Boesenbergia longijiora and related taxa
49
Fig. 1. Gastrochilus longiflora {B. longiflora). Watercolour on paper by Vishnupersaud (1829)
from the Wallich Collection, Kew. Reproduced with permission of The Board of Trustees of
the Royal Botanic Gardens, Kew.
50
Gard. Bull. Singapore 65(1) 2013
To deteimine which taxon a B. aff. longiflora specimen belonged, the location, habitat,
plant height, flower colour and underground morphology were important. Here, the
“Additional specimens examined” under each described species are detennined based
on a combination of these parameters. The name B. longiflora (see “Taxonomy”
below) is lectotypified.
During 2008-2012, c. 25 live rhizome divisions of B. aff longiflora were
obtained from a variety of sources: botanical gardens, research institutions and various
personal collections. Each accession was grown by the first author in Hawaii, USA
under controlled, shade-house conditions. Details on the morphology and phenology
were recorded over several growing seasons. DNA samples with a corresponding
herbarium specimen were taken from each accession.
In 2009-2012 field observations were made in Thailand with botanists from
BK, the Thailand Institute of Scientific and Technological Research and Kasesart
University. Similarly in India, observations were conducted with personnel from the
Botanical Survey India (Shillong), the Assam Forestry Department and the Nagaland
University. Digital images of all Boesenbergia observed in the field and in cultivation
were recorded for later reference.
Early in the research, all Boesenbergia species known to have radical
inflorescences were evaluated for possible inclusion in the B, longiflora complex. Based
on molecular data (Mood et al., unpublished) B. basispicata K.Larsen ex Sirimgsa,
B. tenuispicata K.Larsen and B. trangensis K.Larsen belong to other Boesenbergia
clades. DNA samples were not available for B. angustifolia (Hallier f ) Schltr., B.
phyllostachya (Gagnep.) K.Larsen and B. siphonantha (King ex Baker) M.Sabu,
Prasantlik. & Skomick. Consequently, their phylogenetic position is undetemiined at
this time.
The final taxonomy presented here represents an incorporation of data from the
phylogenetic analyses, field observations and detailed study of the cultivated plants.
The descriptions are ordered with the yellow-flowered species first, followed by the
white-flowered species. The distribution map (Fig. 20) was constructed by mapping
types and selected specimens of each species (these are marked by an asterisk following
the herbarium abbreviations in the list of additional specimens examined).
Molecular phylogeny. Phylogenetic analyses were conducted to complement and
assist in taxonomic decisions required to elucidate relationships among species of
the B. longiflora clade as defined here. Taxon selection was based on an unpublished
broader analysis of plastid trnK data for Boesenbergia relative to other genera of
Zingiberaceae (authors in prep.). The bulk of the data for non-Boesenbergia samples
are from the earlier family-wide analyses of Kress et al. (2002) with a few additional
sequences from recently described genera such as from Kress et al. (2010) and Leong-
Skomickova et al. (2011). The data for the specimens cited in these references can
be found at http://www.ncbi.nlm.nih.gov/genbank/ (GenBank 2011). A representative
shortest maximum parsimony (MP) phylogram is shown in Fig. 3. Only names of
relevant Boesenbergia samples are indicated on the phylogram.
Boesenbergia longijiora and related taxa
51
Fig. 2. Hand-coloured lithograph published in Curtis’s Botanieal Magazine 69, t. 4010, 1843
as Gastrochilus longiflora. Reproduced with permission of The Board of Trustees of the Royal
Botanic Gardens, Kew. (Identihed by Baker (1890) as G. jenkinsii. Deseribed here as B.
hamiltonii.)
52
Gard. Bull. Singapore 65(1) 2013
DNA was extracted from silica-dried leaf material or leaf tissue from herbarium
specimens using standard methods as described in Kress et al. (2002). Thirty-seven
samples of Boesenbergia were used in the DNA sequencing analyses. Two samples
of B. piilcherrima (Wall.) Kuntze, the generic type, were designated as outgroup taxa.
Two other samples, B. plicata var. hirida (Ridl.) Holttum and B. plicata var. plicata
(Ridl.) Holttum were also included. The remaining samples were all members of the
B. longiflom clade. All samples were designated by a collection or accession number
and vouchered (Appendix B).
Both nuclear and plastid data were collected. The nuclear ribosomal ITS (nrlTS)
region was amplified using the 18S-F and 26S-R primers (Prince 2010) and Phusion
high fidelity polymerase (New England BioLabs, Ipswich, Massachusetts, USA)
with 5X GC Buffer per the manufacturer’s instmctions at an annealing temperature
of 62‘’C. The same primers were used for subsequent sequencing. The plastid trnK
region was amplified and sequenced using conditions described in Kress et al. (2002)
or Prince & Kress (2006). Two newly designed primers were synthesized to assist with
sequencing of some difficult samples (5Fb: CTCTATGGATTTTCAAGGAT and 5Rb:
AGACCAAAATGAAAATAATA). All samples were direct sequenced on a 3130x1
Genetic Analyser at Rancho Santa Ana Botanic Garden (Claremont, California, USA).
Noisy sequences (electrophoregrams showing more than a few polymorphic
sites) in the nrlTS data were cloned using TOPO TA cloning kits (Invitrogen, now Life
Technologies, Grand Island, New York, USA) with four to eight clones sequenced per
sample. A small number of the trnK sequences were also noisy (due to polymerase
“stutter” caused by a mononucleotide T repeat around 450bp). Those samples were
re-amplified using Phusion polymerase, which has been shown to outperform other
polymerases for this particular problem (Fazekas et al. 2010) and re-sequenced.
Individual sequences of each specimen were edited and a consensus sequence
was generated in Sequencher v4.9 (Gene Codes Corporation, Ann Arbor, Michigan,
USA). The consensus sequence was trinuned (18S and 26S data pruned from the
ITS1+5.8S+1TS2 region, removal of amplification primer sequences from the trnK
region) exported and aligned manually in Se-Al v2.0all (1996; available from A.
Rambaut, Oxford, England, UK at http://tree.bio.ed.ac.uk/software/seal). Alignment
was relatively straightforward due to the high degree of sequence similarity and length
for the taxa involved. Ambiguous regions were generally restricted to the monomeric
“T” repeat in the 5' trnK-matK intergenic spacer (IGS). All newly generated data have
been deposited in GenBank and are available under accession numbers JX992748-
JX992840 (Appendix B).
Data were analyzed under parsimony and likelihood criteria by genomic data
partition, first independently, and later in combination. The decision to combine data
partitions is often based upon the results of an incongruence-length difference, or ILD
test (Fanis et al. 1995). We did not perform this test as it has been suggested to be
too conservative (Cumiingham 1997, Struck 2007). We expected the test to fail due
to the presence of two very different ITS copies detected for at least one sample in
the ITS data partition. The decision to combine data partitions was instead based on a
combination of tree topology congruence and branch support values. In most instances
Boesenbergia longijiora and related taxa
53
— 5 changes
Fig. 3. One of many shortest maximum parsimony phylograms (simplified) for Boesenbergia
and other representatives of Zingiberaeeae based on plastid trnK data analysis, rooted using
Siphonochilus J.M.Woods & Franks as suggested by Kress et al. (2002). The position of the
genus Boesenbergia, the B. longiflora clade and the taxa sampled for this study are indieated.
• indicate branches with MP Bootstrap values >50%.
54
Card. Bull. Singapore 65(1) 2013
tree topologies were eonsistent between data partitions. In cases where tree topology
differed, branch support for the conflicting topology was reviewed. If branch support
was weak (<65% BS, <0.95 PP) the data for those taxa were analysed in combination.
As stated above, the ITS data for one taxon included two very different copies. In
another instance, there was strong positional conflict among the nuclear and plastid
phylogenies for one sample. Disparate copies were included in all individual data
set analyses, but only one copy was included in combined data analyses. The ITS
copy retained for combined analyses was selected to best match to the chloroplast
phytogeny.
Maximum parsimony and maximum likelihood (ML) analyses were conducted
in PAUP* (version 4.0b 10, Swofford 2002). Heuristic search methods were conducted
in each case with 1000 random addition replicates for MP and 10 random addition
replicates for ML, each with tree bisection and regrafting (TBR) branch swapping.
Maximum Parsimony analyses were conducted under Fitch parsimony criteria (Fitch
1971). Maximum likelihood analyses were conducted using model parameters selected
by jModelTest (version 0.1.1 available at http.V/dai-win.uvigo.es; Posada 2008, Guindon
& Gascuel 2003) under both the Akaike Infonnation Criterion (AlC; Akaike 1974) and
the Bayesian Information Criterion (BIC; Schwarz 1978). All Maximum Likelihood
trees were saved. Both AlC criterion and BIC criterion models were analysed for all
data partitions, but only the trees from the AIC analyses will be discussed as both
methods produced nearly identical trees.
Branch support was estimated using parsimony bootstrap (BS) in PAUP* and
posterior probabilities (PP) in MrBayes v3.2.1 (Ronquist & Huelsenbeck 2003).
MrBayes analyses were conducted through the CIPRES portal (Cyberinfrastructure
for Phylogenetic Research; Miller et al. 2010) and used partitioned data whenever
appropriate (partitions = 5T/77AHGS + STrwATlGS, matK, ITS) and were run in triplicate
to ensure convergence. Bootstrap values were based on 1 ,000 pseudoreplicates, each
with 100 random addition replicates, TBR branch swapping, saving a maximum of
10 trees per random addition replicate and hold=4 trees. The number of generations
necessary to estimate posterior probabilities varied depending upon the dataset and the
time required to reach stasis (average standard deviation of the splits frequency <0.01).
Results and discussion
A number of exploratory analyses were conducted to evaluate the consistency of the
phylogenetic hypotheses generated by the different data partitions. As stated above,
some of the data generated from the nuclear ribosomal partition were noisy, indicating
the presence of divergent ITS copies within a sample. Although it is not common,
multiple copies of ITS have been detected in a number of genera and species of
Zingiberaceae including Alpinia (Liu et al. 2009), and Cornukaempferia (L. Prince
pers. obs.), and multiple ITS copies per individual is prevalent in Curcuma (Zaveska
et al. 2012) and Kaempferia (L. Prince, pers. obs.). The presence of multiple, strikingly
different copies can be explained by a number of different evolutionary histories, a
Boesenbergia longiflom and related taxa
55
few of which are presented here. The ITS region is present in hundreds (or thousands)
of copies, often on multiple, different chromosomes. Processes affecting the utility
of ITS for phylogenetic reconstruction were reviewed by Alvarez & Wendel (2003)
including a discussion of the processes described below.
One explanation for the detection of multiple different copies in one organism
is that the multiple copies were present in the ancestor and those copies are being
maintained through time. Another explanation is recent genetic drift of some copies
due to relaxed evolutionary constraints. Given the importance of this region for the
functionality of the organism, it would not be likely unless there has been duplication
(perhaps due to polyploidisation). Chromosome counts have not been made for the
sample of B. longiflora {Kress 03- 7305, US ) included here, so perhaps this is a plausible
explanation. Yet another possibility is recent gene flow between closely related taxa.
If hybridisation happened in the recent past, there is a possibility that the two different
copies have not yet had the time to undergo concerted evolution. If this process is
incomplete, each parental copy will be recovered and, in a phylogenetic analysis, the
different copies would each cluster with one of the (putative) parents. Alternatively,
chimeric ITS sequences might be detected.
No matter the source of multiple, different copies of ITS present within any given
organism, there is ample indication that most organisms undergo concerted evolution
of the ITS region, a process by which the different copies are homogenised across the
genome resulting in a single (or at least dominant) copy per organism. The length of
time for complete homogenisation of the ITS of any given organism is unknown and
likely highly variable. Although there has been a great deal of speculation regarding
concerted evolution and homogenisation in purported hybrid taxa of flowering plants,
our best understanding of the actual time required is gleaned from experiments with
artificial hybrids (e.g., Armeria: Fuertes Aguilar et al. 1999, Feliner et al. 2001;
Hieracium: Mraz et al. 2011) and in recently derived polyploidy taxa (e.g., Spartina:
Ainouche et al. 2004; Helictotrichon: Winterfeld et al. 2009; Oryzcv. Ying et al. 2010).
Nuclear ribosomal ITS data
The aligned data matrix included 86 potentially parsimony-informative characters (43
for ingroup only). As indicated above, several samples required cloning to obtain clean
ITS sequences. Two other samples, indicated by an asterisk in Fig. 4, should be cloned
to clarify a few polymoiphisms. Maximum parsimony analysis produced over 1 00,000
shortest trees and could not be run to completion. One of the 37 shortest ML trees is
shown in Fig. 4.
The ML phylogram presented in Fig. 4 identifies a moderately supported clade
that includes all samples of B. kerrii and B. coUinsii plus one of the B. longiflora
clones (88% BS; 1.00 PP). Both B. kerrii and B. collinsii are resolved as monophyletic
with moderate to strong support. The other ingroup clade is moderately to strongly
supported (75% BS; 0.98 PP), and includes all samples of B. kingii, B. hamiltonii,
B. maxwellii and two clones of B. longiflora. Resolution within the clade is poor and
internal branches are generally poorly supported although most of the B. kingii samples
and clones cluster together with 70% BS and 1.00 PP.
56
Card. Bull. Singapore 65(1) 2013
70/1.00
75/0.98
-fh
100/1.00
—//—
B. kingiiUU?Al C\
B. kingii MUP47 C2
B. ^77gi7MllP47C3
B. kingii MWPAl CA
B. kingii M 1 1 P47 C5
B. ;^m«/M3019 CIO
B. 4w/fM3074 C2
— B. Kingll M3U t
B. kinginvmiA C3
B. kingii M307 A C8
B. kingirM30l9 C3
I — B. kingii 1V12002 C2
B. kingii M3020C\2
B. kingii M3074 C4
B. kingii M3074 C7
11P77
B. kingii MUP7^
B. kingii M30\5 C3
B. kingii M3019 C6
B. kingii M08P161
B. kingii M30\5 CA
B. kingiiM30\5 C13
B. kingiiM3272*
HI
B. kingii M3020 C7
B. kingii M3020 C8
■CT
B. kingii m002C]
B. kingii M3019 C9
B. kingiiM302Q C9
I — B. kingii M301 5 Cl
B. kingii M30 1 5 C 1 1
B. kingii M3019 Cl
' — B. kingii lV136l9 C8
I B, longiflora M11P48 Cl
' B. longiflora M11P48 C6
B. kingii M3615 C2
B. kingii Pi97-5m*
B. kingii M11P47 C6
B. /7a/77///om7 M3017
B. hamiltonii M3 026
B. hamiltoniiM32\2
B. maxwellii M 1 1 C 1 32
— B. maxvi’ellii M\\C\33
B. kingii M2002 C3
— B. kingiiM30\5 C12
I — B. maxwellii M2032
B. maxwellii M2040
B. maxwellii MP1450
B. maxwellii Mil P26
B. maxwellii M 1 1 P 1 24
B. maxwellii M20 1 7
B. collinsiiMldlO
B. collinsii M06P14
B. collinsii MP1455
' — B. collinsii M2011
B. collinsii M3()35
88/1.001 -S. ^em7M2058
100/1.00
74/.
o'.sb^
75/0.92
H
100/1.00
B, kerriiM3009
B. kerrii M2044
B. kerrii M2 049
B. longiflora M11P48 C5
100/1.00
B. plicata sohsp. plicata M3lH
B. plicata sub^. lurida M3 120
j — B. pulcherrima K98-6220
' B. pulcherrima M08P276
0.005 substitutions/site
Fig. 4. One of 37 best. Maximum Likelihood phylograms (-ln=22 18.749) for Boesenbergia
longiflora and closely related taxa based on analysis of nuclear ribosomal ITS data for all
samples and clones. Support values (Bootstrap/Posterior Probability ) for critical branches are
shown above branches. Bold typeface highlights strongly supported positions of the different
Boesenbergia longiflora copies generated by cloning. Asterisks indicate samples that should
also be cloned to clarify a few polymorphisms. Underlined samples are placed in conflicting
positions on the chloroplast phytogeny. Note: lower branches were pruned to fit page and are
not to scale.
Boesenbergia longiflom and related taxa
57
65/0.94
61/0.90
63/0.94
65/0.85
98/1.00
-fh
100/1.00
63/0.83
B. collinsii M20 1 0
B. collinsii M2011
B. collinsii MP1455
B. collinsii M06P 1 4
B. collinsii M3035
99/1.00
95/1.00
88 / 1.00
B. kerrii M2044
B. kerrii M2049
B. kerrii M2058
B. kerrii M3 009
B. maxwellii M20 1 7
B. maxwellii M2032
B. maxwellii M2040
B. maxwellii M 1 1 P26
B. maxwellii M 1 1 P 1 24
B. maxwellii M 1 1 C 1 32
B. maxwellii M 1 1 C 1 33
B. longiflora M11P48
B. A7«gnK97-5821
B. kingii M08P 1 6 1
B. kingii Mn?47
B. kingii M2002
B. kingii M3015
B. kingii M3019
B. kingii M3020
B. kingii M3074
' — B. kingii M3272
I B. kingii M 1 1 P78
B. kingii MUP71
B. hamiltonii M3026
B. hamiltonii M3017
99/1.00 — ^ plicata lurida M3 1 20
— B. plicata plicata M3 1 77
’-S. pulcherrima M08P276
' — B. pulcherrima K98-6220
— 0.0005 substitutions/site
Fig. 5. Single best Maximum Likelihood phylogram (-ln=3953.067) for B, longiflora and
elosely related taxa based on analysis of chloroplast trnK intron data. Support values (Bootstrap/
Posterior Probability) for critical branches are shown above branches. Numbers in bold typeface
indicate strong support. Underlined samples are placed in conflicting positions on the nuclear
ribosomal phylogeny. Note: lower branches were pruned to fit page and are not to scale.
58
Gard. Bull. Singapore 65(1) 2013
The identification of at least two disparate ITS copies for B. longiflora requires
further discussion. Only one sample of B. longiflora was available for inclusion in
this study. This sample, M11P48 was from cultivated plants grown by the first author,
but originally collected in Bumia {Kress 03-7305, US). Multiple clones representing
one B. longiflora ITS type were distributed among members of the B. kingii clade
(ITS copy “A”) while the other B. longiflora copy fell sister to the B, kerrii clade
(ITS copy “B”) as is shown in Fig. 4. Although a number of tests have been proposed
to distinguish between the processes of hybridisation and incomplete lineage sorting
(Joly et al. 2009) all have limitations. We were restricted here by the single sample for
B. longiflora, but hopefully, more samples will be available for future analyses.
The majority of the polymorphic samples were identified as B. kingii based
on morphology. Six of the twelve samples required cloning to generate clean ITS
sequences. These samples fall into two categories. The first group included samples
with multiple ITS sequence types, but those sequences were all quite similar with only
a few different bases or slight length variations. Analyses of the ITS data partition
placed all of these sequences in the B. kingii sensu lato clade as described above
{B. hamiltonii + B. kingii + B. marwellii), and with moderate to high support (75%
BS, 0.98 PP) but with poor resolution within the clade (Fig. 4). Further, most of the
B. kingii samples clustered with moderate support (70% BS, 1.00 PP). Among the
ingroup members, B. kingii is the most broadly distributed species and is the most
genetically diverse taxon.
Chloroplast tniK intron (including the protein coding matK gene)
A total of 36 potentially parsimony-informative characters (15 for ingroup only) were
used to generate almost 100,000 maximum parsimony trees. However, maximum
likelihood analyses resulted in a single best tree (Fig. 5). The likelihood tree had a
topology identical to several of the MP trees. As with the results of the ITS analyses,
both MP and ML analyses identified two clades witliin the ingroup, one including
samples of B. collinsii + B. kerrii + B. longiflora + B. maxwellii (65% BS; 0.85 PP)
and a clade comprising B, hamiltonii and B. kingii (63% BS; 0.83 PP). Three taxa were
resolved and supported as monophyletic: B. collinsii (65% BS, 0.94 PP) B. kenii (63%
BS, 0.94 PP) and B. maxwellii (99% BS, 1.00 PP). The relationship of B. maxwellii
to B. hamiltonii and B. kingii differed here relative to the ITS results, but only with
weak (65% BS; 0.85 PP) support. Sequences for two samples were not available for
this data set, B. hamiltonii M3212 and B. maxwellii MP1450. The two samples with
names underlined in Fig. 4, B. kingii M11P77 and M11P78, were identical and clearly
supported as members of the B. kingii group in the phylogeny produced by analyses of
the nuclear ITS dataset. Results of the chloroplast data analyses (Fig. 5) clearly (88%
BS, 1.00 PP) placed these two samples in a clade with B. hamiltonii.
Combined analyses
The combined data set required a number of samples to be excluded. Because the ITS
data required cloning for some samples, results of the ITS MP analyses were used to
select the clone with the shortest branch for each sample (as suggested by Beilstein et
Boesenbergia longiflom and related taxa
59
al. 2008) for subsequent use in the combined analyses. This was done only when all
clones for a particular sample either formed a monophyletic lineage or clustered within
a moderately or well-supported lineage (BS>75%). In the instance of B. kingii samples
M11P77 and M11P78, there was positional conflict between the nuclear and plastid
datasets. Those samples were excluded from the combined analysis. As mentioned,
there was only a single sample of B. longiflom available for this study. The nuclear
data set included two distinctly different copies, A and B. Rather than totally exclude
this critical taxon, we selected the nuclear copy B that best matched the chloroplast
phytogeny, wliile recognising we do not know which better represents the evolutionary
history of the species.
Maximum parsimony analysis produced 468 shortest trees. Maximum likelihood
analyses produced three equally likely trees, one of which is shown in Fig. 6. Both
MP and ML analyses identified two clades within the in-group most similar to those
of the ITS data analyses, a B, kingii clade including samples of B. hamiltonii + B.
kingii + B. maxwellii and a B. longiflom sensu lato clade including samples of R.
collinsii + B. kerrii + B. longiflom. The B. kingii sensu lato clade received 62% BS and
0.78 PP. Unlike the ITS data analyses results, the combined data analyses produced
highly resolved topologies within this clade. Significantly, B. maxwellii is resolved as
monophyletic (83% BS; 1.00 PP), Boesenbergia hamiltonii and B. kingii samples are
grouped together with 51% BS and 0.95 PP. Boesenbergia hamiltonii was also resolved
as monophyletic, but with weak support (<50% BS, 0.86 PP). The B. longiflora sensu
lato clade was strongly supported (95% BS; 1 .00 PP) with significant internal structure
and support. Boesenbergia collinsii was supported as monophyletic (100% BS; 1.00
PP) as was B. kerrii (93% BS, 1.00 PP). The single sample ofB. longiflora was sister
to B. kerrii (64% BS, 0.64 PP), but this placement should be viewed with caution.
Multiple accessions for each taxon (except B. longiflof'a) were included to assess
genetic variation within and among the newly identified taxa. The amount of sequence
variation withui each taxonomic clade was generally less than the amount of variation
between clades as is shown by the phylograms in Figs. 4-6. Despite the higher level of
sequence diversity within 5. kingii, it is supported as monophyletic. The results of both
maximum parsimony and maximum likelihood analyses of DNA data presented above
consistently identified five mostly strongly supported clades within the B. longiflora
complex: B. collinsii, B. hamiltonii, B. kerrii, B. kingii and B. maxwellii. The data also
support two sister relationships, one between B. collinsii and B. kerrii, and one between
B. hamiltonii and B. kingii. The position of B. longiflora and B. maxwellii are less clear.
The relationship of B. longiflora to these taxa is uncertain due to polymorphism in the
nuclear (ITS) data set, but it is clearly closely related to them. Boesenbergia maxwellii
jumps between the two clades depending upon data set examined. Finally, additional
data are needed to test between various hypotheses (incomplete concerted evolution
due to genetic drift post polyploidisation, hybridisation, or incomplete lineage sorting)
to explain the high level of genetic variation detected in the nrlTS of B. kingii. Overall,
although there are a number of questions remaining, the molecular data allowed for the
delineation of six taxa.
60
Card. Bull. Singapore 65(1) 2013
100/1.00
100/1.00
89/1.00
51/0.95
62/0.78
B. kingii M2002
B. kingii M3074
B. kingii MOSPiei
B. kingii MUPAl
B. kingii M3015
B. kingii M3272
I — B. kingii M3019
B. kingii M3020
-/ 0.86
83/1.00
95/1.00
B. kingii K97-5m
I — B. hamiltonii M3017
B. hamiltonii M3026
B. hamiltonii M32 1 2
I — B. maxwellii M2032
B. maxwellii M2040
B. maxwellii MP\ 450
B. maxwellii M 1 1P26
B. maxwell // M 1 1 P 1 24
— B. maxwellii M 1 1 C 1 32
B. maxwellii M11C133
B. maxwellii M20 1 7
B. collinsiiM10\0
B. coll ins a IVIP1455
I — I ' — B. collinsii M20\l
B. collinsii M06P14
- B. collinsii M3035
100 / 1.00
93/1.00
/
64/0.64
B. kerrii M2058
B. kerrii M3 009
B. kerrii M2044
B. kerrii M2049
B. longiflora M 1 1 P48
[ — B. pUcata lurida M3 120
* — B. plicata plicata M3 1 77
100/1.00
€
B. pulcherrimo K9 8-6220
B. pulcherrima M08P276
0.0005 substitutions/site
Fig. 6. Single best MaximumLikelihoodphylogram(-ln=5747. 386) for 5. longiflora and closely
related taxa based on analysis of combined chloroplast trnK intron and nuclear ribosomal ITS
data. Support values (Bootstrap/Posterior Probability) for critical branches are show above
branches. Numbers in bold typeface indicate strong support.
Boesenbergia longiflora and related taxa
61
Taxonomy
A field key to the Boesenbergia longiflora clade of species as elucidated above is
provided here (see also Table 1 .)
Key to six species in the Boesenbergia longiflora alliance
1 a. Flowers light yellow to bright, darker yellow 2
b. Flowers pure white to creamy white 4
2a. Plants c. 50-80 cm., leaves broad, some horizontal, thecae red (Thailand)
B. collinsii
b. Plants 1-1.2 m tall, leaves narrower, more vertical 3
3a. Flowers small, c. 2. 5-3.0 cm, very saccate, staminodes light yellow, throat
red maculate, labellum medium yellow, apex entire, thecae white (Bunna)
B. longiflora
b. Flowers larger, c. 3. 5-4.0 cm, saccate, staminodes very light yellow to white,
throat red-orange, maculate, labellum streaked with red, apex tmncate, thecae
light yellow (W Thailand) B. kerrii
4a. Rliizomes many, miming, cylindrical, c. 5-15 mm diameter, fiowers white to
creamy white, throat red, sometimes with pink apex (NE India, Bunna, SW
China, Thailand) B, kingii
b. Rhizomes few, small, with vertical tuberous roots c. 16 cm long 5
5a. Labellum apex light pink, tliroat red (NE India) B. hamiltonii
b. Labellum light and dark pink, throat orange, very frilled, crisped, large flower
(Bunna, N Thailand, Lao P.D.R.) B. maxwellii
Enumeration of species
Boesenbergia longiflora (Wall.) Kuntze, Revis. Gen. PI. 2: 685 (1891). - Gastrochilus
longiflorus Wall., PI. Asiat. Rar. 1: 22, t. 25 (1829) ("'longiflora'"). - Curcunwrpha
longiflora (Wall.) A.S.Rao & D.M.Venna, Bull. Bot. Surv. India 13: 339 (1974), pro
comb. LECTOTYPE (designated here): Wallich 6589A (K, IDC microfiche 7394,
digital image seen) Bunna, Rangoon. (Fig. 1,7, 17 & 19A).
Deciduous herb up to 1 m tall; rhizome small, irregularly shaped, c. 1 cm diam.,
externally brown, internally light yellow to white; multiple, small bulb-like rhizomes
62
Gard. Bull. Singapore 65(1) 2013
Fig. 7. Boesenbergia longiflora (Wall.) Kuntze. A. First-day flower. B. Second-day flower. C.
Plants. D. New rhizomes and tuberous roots. A-D, M11P48. (Photos: J. Mood)
U' \ 'J.i\ I Z4
Boesenbergia longiflom and related taxa
63
surrounding the main rhizome, c. 1 cm long, pink or white; tuberous roots two or
more, c. 8 x 0.5 cm, tapering to a tuber, c. 2 x 1 cm, externally white or pink, internally
white, root hairs few, c. 20 mm long, thin, white. Pseudostem up to c. 30 cm long,
composed of leaf sheaths, base c. 2-2.5 cm diam., 1-2 short leafless sheaths at the
base, leaf sheaths c. 10-16 cm, longitudinally ridged, green, glabrous, margin hyaline.
Leaves 5-8 per pseudostem; petiole 9-18 cm, deeply channelled, green, glabrous;
ligule slightly bilobed, lobes an extension of the hyaline margin, 2 mm long, slightly
acute, protruding outward, green, glabrous; lamina elliptical or broadly ovate, c. 41-
61 X 20-21 cm, plicate, ventrally dark green, glabrous, dorsally lighter green, glabrous
with a few hairs on the midrib, base rounded to cordate, sometimes asymmetric, apex
acute to long acuminate. Inflorescence radical, c. 3-4 per pseudostem, up to c. 12 cm
long (including peduncle) produced from the side of the rhizome, peduncle c. 1-3 cm
long, white, glabrous, basal sheaths 1-2, pink and white, glabrous; spike hom-shaped,
5-10 X 1-2 cm. Bracts cymbiform, 3-4, c. 5-6 x 1.5 cm, distichously arranged, red
and green, glabrous, each bract enclosing one flower, some basal bracts sterile, apex
sometimes curved; bracteole cylindrical, c. 5 x 0.5 cm, white, translucent, glabrous,
open to the base, apex acute. Flowers 2-3 per inflorescence, up to c. 1 1 cm long. Calyx
tubular, 20 x 5 mm, white, translucent, glabrous, apex bi-dentate. Floral tube 1 0 cm
long, c. 3 mm wide at the base, white, glabrous externally and internally, corolla lobes
(dorsal and ventral) linear to lanceolate, c. 2 x 0.5 cm, yellowish-white, glabrous,
margins involute; androecial tube cup-shaped, c. 4-5 mm long, c. 7 nmi diam. at the
top, yellowish-white, glabrous externally and internally. Labellum saccate, semi-
orbicular, 2. 2-2. 5 cm long, 2. 0-2.2 cm wide (when flattened at broadest point) light
yellow, throat centre dark red, maculate with yellow showing tlirough as dots, red
pattern broadening to the lip apex, glabrous, margin wavy or wrinkled, revolute on
the sides, apex elongate, emarginate; lateral staminodes obovate, 1.3 x 1.0 cm, light
yellow, glabrous, apex rounded. Stamen 8 mm long, filament 1 mm long, 2 mm wide
at base, light yellow, few short glandular hairs, anther 7 mm long, 2 mm wide (first
day) then 5 imn wide (thecae diverging on the second day) apex rounded with no
anther crest, thecae c. 7 x 1 mm, white, dehiscing along the entire length. Ovaty c. 7
X 3 mm, trilocular, axile placentation, white, glabrous; style filifonn, white, glabrous,
stigma rounded, white, ostiole transverse, without cilia, exuding a sticky liquid on
the second day; epigynous glands linear, two, 4 mm long, light yellow. Fruit not
seen. [Measurements based on living, cultivated material oiM]lP48, originating from
Kress 03-7305 (US)].
Distribution. So far known only from two locations in Burma (Fig. 20).
Ecology. Collected in the understorey of a primary teak forest {Kress 03-7305 (US)].
More observations are needed in Bunna to fully document the ecology.
Phenology. Flowering from May to September with a two-day flowering cycle for
each flower.
64
Gard. Bull. Singapore 65(1) 2013
Etymology. Latin, longus = long and flos = flower. Named by Wallich for the long
flower.
Notes. The cultivated material (M11P48) was grown from dormant rhizome divisions
of Kress GH2003-051 cultivated at the Smithsonian Institution, and originally
collected on 18 June 2003, in Rakliine state, Burma as Kress 03-7305 (US). This
accession compared very well with Wallich’s description and watercolour (Fig. 1 ). The
only exception was the lack of pigmentation on the lower lamina surface, a character
found to be highly variable tliroughout this clade. Of note are the very small, bulb-
like rhizomes which develop en masse, underground, at the base of the pseudostem.
Each of these small entities are loosely attached to the main rhizome and if separated
can produce a new plant. Wallich 6989B (CAL, K, microfiche 7394) annotated and
listed as G. longiflora (Wallich 1832) has a terminal inflorescence and as such, appears
to be a different taxon, perhaps related to B. siphonantha (King ex Baker) M.Sabu,
Prasanthk. & Skomick.
Boesenbergia kerrii Mood, L.M.Prince & Triboun, sp. nov.
Boesenbergiae longiflorae (Wall.) Kuntze ajjinis, inflorescentiis 4 vel plus floribus,
floribus maioribus 3. 8-4.0 cm longis c. 2.8 mm latis, labello elongatiore truncato
apice indentato differt.
TYPUS: Mood & Triboun 12PJ70, Cultivated in Hawaii, USA, 1 Nov 2012 (holo BK;
iso AAU). Originally from Thailand, Tak Province, Khao Pa Wo District, near Mae
Sot, c. 600 m asl, 16°48.783'N 98”39.70'E, 8 September 2010, Mood & Triboun 2044,
cultivated as M2044. (Fig. 8, 9, 17 & 19B)
Deciduous herb up to 1 .2 m tall; rhizome small, globular, c. 1 cm diam., externally red,
pink or light tan, internally light yellow to white; multiple, small bulb-like rhizomes
surrounding the main rhizome, c. 1 cm long, pink turning red with age; tuberous roots
few to numerous, c. 12 x 0.5-0. 8 cm, tapering to a point, externally and internally
white, root hairs few, c. 10 mm long, thin, white. Pseudostem up to 30 cm, composed of
leaf sheaths, base oval, c. 2-2.5 cm diam., 1-2 leafless sheaths at the base, leaf sheaths
longitudinally ridged, green, glabrous, margin hyaline. Leaves 5-8 per pseudostem;
petiole 9-18 cm, deeply channelled, green, glabrous; ligule slightly bilobed, lobes
an extension of the hyaline margin, 2 mm long, green, glabrous; lamina elliptical or
broadly ovate, c. 41-61 x 20-21 cm, plicate, ventrally dark green, glabrous, dorsally
lighter green, glabrous with a few hairs on the midrib, base rounded to cordate,
sometimes asymmetric, apex acute to long acuminate. Inflorescence radical, c. 3-6
or more per pseudostem, up to c. 15 cm long (including peduncle) produced from the
side of the rhizome; peduncle c. 1-4 cm long, white, glabrous, basal sheaths 1-2 , pink
and white, pubescent; spike hom-shaped, 5-12 x 1-2 cm. Bracts cymbiform, 4-6, c.
4-5 X 1 .5-2 cm, distichously anunged, green and red, glabrous, each bract enclosing
one flower, some basal bracts sterile, apex sometimes curved; bracteole cylindrical,
c. 5 X 0.5 cm, white, translucent, glabrous, open to the base, apex acute. Flowers 3-6
Boesenbergia longijiora and related taxa
65
Fig. 8. Boesenbergia kerrii Mood, L.M.Prince & Triboun. Ink line drawing with watercolour of
the type plant by Linda Ann Vorobik (2012).
66
Gard. Bull. Singapore 65(1) 2013
Fig. 9. Boesenbergia kerrii Mood, L.M.Prince & Triboun. A. First-day flower of M2 044. B.
Second-day flower of M 2044. C. Plants of M2049. D. Rhizomes and tuberous roots of M2058.
E. Typical habitat on limestone with bamboo. (Photos: J. Mood)
Boesenbergia longiflom and related taxa
67
per inflorescence, up to c. 15 cm long. Calyx tubular, 2.0 x 0.5 cm, white, translucent,
glabrous, apex bi-dentate. Floral tube 12-14 cm long, c. 3 mm wide at the base, white,
glabrous; corolla lobes (dorsal and ventral) linear to lanceolate, c. 2 x 0.5 cm, white
to light yellow, glabrous, margins involute; androecial tube cup-shaped, c. 4-5 mm
long, c. 10 mm diam. at the top, yellow, glabrous externally and internally. Labellum
saccate, semi-orbicular, 3.8-4 cm long, 2.2 cm wide (when flattened at the broadest
point) light yellow, throat centre orange-red, maculate with yellow showing tlirough
as dots, red pattern broadening toward the lip apex, ending c. 10 mm short of the
apex, then dark red streaks to the apex, glabrous, margin entire, revolute on the sides,
apex shortly to deeply bilobed, 2-8 mm, slightly wavy; lateral staminodes obovate,
1.3 X 1 cm, light yellow, glabrous, apex rounded, revolute, margin wavy. Stamen 11
mm long, filament 2 mm long, 2 mm wide at the base, light yellow, with a few short
glandular hairs, anther 9 mm long, 3 mm wide (first day) then 6 mm wide (thecae
diverging on the second day) apex rounded with no anther crest, thecae c. 9 x 1 mm,
light yellow, dehiscing along the entire length. Ovary c. 8 x 4 imn, trilocular, axile
placentation, white, glabrous; style filiform, yellowish-white, glabrous, stigma round
to oval, white, ostiole oval, without cilia, exuding a sticky liquid on the second day;
epigynous glands linear, two, 5 mm long, light yellow. Fruit not seen. (Measurements
based on living, cultivated material of M2044).
Distribution. This species is prevalent in western Thailand from the southern area of
Tak Province to the southern area of Kanchanaburi Province. It should be expected in
E. Bumia.
Ecology. This species has been found only in close proximity to limestone rock outcrops.
In almost all situations observed, the primary canopy component was bamboo with
mixed deciduous, hardwood species. The plants grow in the cracks between limestone
rocks where there is accumulation of organic matter or in deeper soils surrounding
the limestone karsts. In the dry season these areas are often burnt, leaving a biochar
residue. Shade is variable from light to medium. Plants commonly occur as single
individuals, but over time, can create small populations of scattered plants. The result
is a group of separate stems growing close together or scattered about.
Phenology. Flowering from June to October with a two-day flowering cycle for each
flower.
Etymology. Named in honour of Arthur F.G. Kerr (1877-1942) one of the ‘founding
fathers’ of botany in Thailand. His two specimens from the Thailand/Burma border
(1922) appear to be the first collections of this new taxon.
Additional specimens examined: THAILAND. Tak Province. Umphang, Kao Hua limestone
hills, 13 Jun 1922, Kerr 6133 (P, C; *); South of Mae Sot along Maenani Moei, 17 Jun 1922,
Kerr 6144 (K, L, P; ’''); Khao Pha Wo, 23 Jul 1973, Murata, Fukuoka & Phengkhlai T-16947
(BKF); Khao Pha Wo, 23 Jul 1973, Murata. Fukuoka & Phengkhlai T- 16949 (BKF, KYO,
68
Gard. Bull. Singapore 65(1) 2013
L); Mae Sot Dist, 20 Aug 1994, Maxwell 94-911 (BKF). Kanchanaburi Province. Tha Sao
Dist., 14 Sep 2010, Mood & Chalermglin 2049 (BISH; *); Huai Kayeng Dist., 15 Sep 2010,
Mood & Clialermglin 2058 (BISH; *); Sai Yok, 16 Sep 2010, Mood & Triboim 3009 (BISH;
*); Sai Yok, 100 m, Aug 1928, Marcan s.n,{C, K); Ka Tha Lai, Fan Faung River Valley, 25
km east of Wangka, 1 Jun 1946, Kostennans 787 (AAU, BO, C, L, P; *); Sai Sok Falls, 30
Jun 1963, Larsen 10349 (AAU; *); Dong Yai Ban Ka Kwang, 14 Aug 1971, Phengkhlai 2959
(AAU, BKF); Thong Pa Phum, 5 Jul 1973, Maxwell 73-109 (AAU; *); Sai Yok, Marcan s.n.
(C, K); Thong Pha Phum, Triboun 21 (BK; *); Huay Ban Kao to Kritee, 4 Jul 1973, Geesink &
Phengkhlai 6088 (BKF, L).
Notes. Boesenhergia kerrii is similar to B. longiflora, but the fomier has a more
exserted, longer floral tube, broader, longer lip with a truncate apex, different labellum
colour pattern and rectangular throat opening. When habitats are compared, B. kerrii
is found only on or around limestone, while the type of B. longiflora and the specimen,
Kress 03-7305 (US) appear to have been collected on sandstone or shale derived soils
(USAGE 1990), The small, bulb-like rhizomes described under 5. longiflora are also
found in B. kerrii.
Boesenhergia collinsii Mood & L.M.Prince, sp. nov.
Boesenbergiae longiflorae affinis, rhizomatium parvorum aliquot absentia radicibus
longis crassis tuberosis abuntis, pseudocaule breviore 50-80 cm longo, floribus
maioribus 4-4.2 cm longis 3 cm latis dijfert.
TYPUS: Mood 12P17fl Cultivated in Hawaii, USA, 1 Nov 2012 (holo BK; iso AAU).
Originally from Thailand, Loei Province, eastern border with Nong Bua Lamphu
Province, along road to Udon Thani, no exact location, c. 300 m asl, August 2003,
Collins T-3068, cultivated as 4. (Fig. 10, 11, 17 & 19C)
Deciduous herb up to 80 cm tall; rhizome small, elongate c. 5 x 0.5 cm, externally
brownish, internally yellow; tuberous roots prolific, c. 15-20, c. 10 x l cm, swelling
to 1.5 cm in the lower third or tapering, externally pink, internally tliree concentric
pink rings, root hairs many, c. 8 mm long, thin, white. Pseudostem up to c. 20 cm
long, composed of leaf sheaths, base oval, c. 2-2.5 cm diam., 1-2 leafless sheaths at
the base, leaf sheaths longitudinally ridged, green or green and red, glabrous, margin
hyaline. Leaves 5-6 per pseudostem; petiole 12-16 cm, deeply channelled, light green
or reddish, glabrous; ligule slightly bilobed, lobes an extension of the hyaline margin,
c. 3 mm long, white, glabrous; lamina elliptical or broadly ovate, c. 28-44 x 12-19
cm, ventrally dark green, glabrous, dorsally lighter green, glabrous with a few hairs
on the midrib, base rounded to cordate, sometimes asymmetric, apex acute to long
acuminate. Inflorescence radical, c. 3-6 or more per pseudostem, up to c. 9 cm long
(including peduncle) produced from the rhizome below the stem; peduncle c. 1 cm
long, white, glabrous, basal sheaths 1-2, white, glabrous; spike horn-shaped, 5-8.5 x
3 cm. Bracts cymbifonn, c. 4, c. 5-8 x 1.5-2 cm, distichously ainanged, green or dark
red, each bract enclosing one flower, apex sometimes curved; bracteole cylindrical,
c. 5 X 0.5 cm, white, translucent, glabrous, open to the base, apex acute. Flowers c. 4
per inflorescence, up to c. 15 cm long. Calyx tubular, 2 x 0.5 cm, white, translucent,
Boesenbergia longijiora and related taxa
69
Fig. 10. Boesenbergia collinsii Mood & L.M.Prince. Ink line drawing with watercolour of the
type plant by Linda Ann Vorobik (2012).
70
Gard. Bull. Singapore 65(1) 2013
Fig. 11. Boesenbergia collinsii Mood & L.M.Prince. A. First-day flower of M06P14. B. & C.
Flower and plants of M3035. D. Rhizome and tuberous roots of M06P 14. (Photos: J. Mood)
Boesenbergia longiflom and related taxa
71
glabrous, apex bi-deutate. Floral tube 14 cm long, 3 mm wide at the base, white,
glabrous externally and internally, dorsal corolla lobe lanceolate, 3-3.2 x 1 cm, creamy
white, glabrous, margins involute, ventral lobes linear, 4 x 0.6 cm, creamy white,
glabrous, margins involute; androecial tube cup-shaped, c. 8 mm long, c. 5 mm diam.
at the top, yellow, glabrous externally and internally. Labellum saccate, semi-orbicular,
4-4.2 cm long, 3 cm wide (when flattened at broadest point) light yellow, throat centre
bright orange-red, maculate with yellow showing through as dots, interrupted with a
yellow, iiTegular band, then a dark red band across the lip, turning to pink towards the
apex, externally with a few glandular hairs, internally glabrous, margin entire, revolute
on the sides, apex slightly truncate, wavy; lateral staminodes obovate, 1 .6 x l cm,
light yellow, dorsal surface with few glandular hairs, ventral surface glabrous, apex
rounded, revolute, margin wavy. Stamen 11 mm long, filament 1.5-2 nun long, 2-3
mm wide at the base, light yellow, few glandular hairs, anther c. 9 mm long, 3 mm
wide (first day) then c. 6 mm wide (thecae diverging on the second day) apex slightly
bilobed with no anther crest, thecae 9x1 mm, red, dehiscing along the entire length.
Ovary c. 8 x 5 mm, trilocular, axile placentation, white, glabrous; style filiform, white,
glabrous, stigma rounded to oval, white, ostiole oval, without cilia, exuding a sticky
liquid on the second day; epigynous glands narrowly ovate, two, 5 mm long, light
yellow. Fruit a capsule, elliptical, c. 2 cm long, 1 cm wide, trilocular, white, glabrous,
dehiscence loculicidal, valves rolling outward into coils; seed round, c. 15, c. 3 mm
diam., light brown, slightly pubescent, aril white, translucent. (Measurements based
on living, cultivated material of M06PI4).
Distribution. This species is more northerly in distribution than B. kerrii, extending
from Northern Lampang Province into Southern Lamphun Province. Moving eastward,
the species is not documented again until the mountains of northern Phitsanulok
Province, then northward into Loei and Nong Bua Lamphu Provinces. Currently, there
are no known specimens from the Lao P.D.R.
Ecology. This species has been found only on or around the base and slopes of limestone
outcrops in secondary forest with bamboo. Specimens from eastern Thailand also
occur on the lower slopes of larger mountains with limestone geology. The plants
prefer wet, but well-drained micro-habitats, even growing in the cracks and crevices
of rock similar to B. kerrii. A single plant was found growing in a tree crotch, possibly
indicating some consumption of the capsules and seed by rodents or birds. Plants can
occur singly or as small populations of scattered individuals.
Phenology. Flowering from June to mid-October with a two-day flowering cycle for
each flower.
Etymology. Named for Mark Collins (1963-2011) an American horticulturist who was
an avid plant collector and enthusiast. For over tw^enty years he promoted Zingiberales
worldwide and provided hundreds of plants to botanical gardens for conservation. This
72
Gard. Bull. Singapore 65(1) 2013
new species was one of the numerous collections Collins brought to the attention of
the first author over many years of cooperation.
Additional specimens examined: THAILAND. Lamphun Province. Li District, 4 Sep 2010,
Mood & Triboun 2010 (BISH; *); Li District, 5 Sep 2010, Mood & Triboun 2011 (BISH; *).
Lampang Province. Wang Tong District, 12 Aug 1998, Mood & Pedersen 1455 (C; *); Wang
Nua, 28 Jun 1996, Maxwell 96-927 (BKF, CMU, L). Phitsanulok Province. Tung Salaeng
Luang, Jul 1966, Larsen 832 (AAU, BKF; *). Phetchabun Province. Pa Prack, NamNaw, 19
Jun 1964, Chantanamuck 789 (BKF). Loei Province. Phu Luang, 18 Sep 1963, Phusomsaeng
& Bunchuai 47 (BKF); Loei, Triboun 1424 (BKF; *). Nong Bua Lam Phu Province.
Suwannakuha District, Ban Chokchai, 16 Aug 2011, Mood & McMakin 3035 (BISH; *).
Chaiyaphum Province. Thung Lui Lai, 27 Jul 1999, Newman 934 (BKF, E; *). Khon Kaen
Province. PhaNok, Khao, 9 Sep 1963, Smitinand 1123 (AAU; *).
Notes. Boesenbergia collinsii is similar to B. kerrii, but the former has a smaller stature
with broader lamina that tend to become horizontal when mature. The flower of B.
collinsii is also larger and longer with more varied coloration and pattern. The plant
normally lacks the many bulb-like rhizomes at the base of the pseudostem found in B.
kerrii and B. longiflora.
Boesenbergia maxwellii Mood, L.M. Prince & Triboun, sp. nov.
Boesenbergiae longiflorae (Wall.) Kuntze affinis, floribus maioribus 4.5 cm longis
2. 7-3.0 cm latis, labello elongato minus saccato albo demum lutescenti maculis rubris
roseis vel violaceis differt.
TYPUS: Mood & Triboun 12P172, Cultivated in Hawaii, USA, 1 Nov 2012 (holo BK;
iso AAU). Originally from Thailand, Tak Province, Mae Lamung, secondary forest,
granitic soil, c. 750 m asl, 1 5*^48. 085'N 98°53.754'E, 9 July 2010, Mood & Triboun
2032, cultivated as M2rJ5Z (Fig. 12, 13, 18 & 19D)
Deciduous herb up to 1.5 m tall; rhizome small, globular to elongated, c. 1-2 cm
diam., externally yellow, internally light violet, numerous cylindrical, tuberous roots
extending from the rhizome base, c. 10-20x 0.5-0. 8 cm, tapering, then enlarging into
a tuber, c. 2 x 3 cm, externally white, intemally pink, translucent, root hairs c. 1 8 mm
long, thin, white. Pseudostem up to c. 30 cm, composed of leaf sheaths, base oval, c. 2-3
cm diam., several leafless sheaths at the base, sheaths longitudinally ridged, externally
green, glabrous, intemally yellow (core) margin hyaline. Leaves 4-6 per pseudostem;
petiole c. 5-30 cm, channelled, light green, glabrous; ligule slightly bilobed, c. 2 mm
long, lobes an extension of the hyaline margin, acute, green, glabrous; lamina elliptic,
c. 33-50 X 15-25 cm, ventrally dark green, glabrous, dorsally lighter green, glabrous
with a few hairs on the midrib, base rounded to cordate, apex acute. Inflorescence
radical, c. 3-10 per pseudostem, up to 15 cm long (including peduncle) produced from
the rhizome below the stem, peduncle 3-5 x 0.5-8 cm, white, glabrous, basal sheaths
1-2, white or pinlc, glabrous; spike hom-shaped, c. 8-10 x 2 cm. Bracts cymbiform,
5-7, c. 5-8.5 X 2-3 cm, distichously arranged, white and pink or red, translucent.
Boesenbergia longijiora and related taxa
73
Fig. 12. Boesenbergia maxwellii Mood, L.M.Prince & Triboun. Ink line drawing with
watercolour of the type plant by Linda Ann Vorobik (2012).
74
Gard. Bull. Singapore 65(1) 2013
Fig. 13. Boesenbergia maxwellii Mood, L.M.Prince & Triboun. A. First-day flower of M2032.
B. Flowers of M2032. C. Flowers of M11P124. D. Flower of M11P26 from the Lao P.D.R. E.
Flowers, Chin State, Burma. F. Rhizome and tuberous roots of M2040. (Photos: A-D & F, J.
Mood; E, H. Funakoshi)
Boesenbergia longiflom and related taxa
75
glabrous, each bract enclosing one flower, apex attenuate; bracteole cymbifonn, c. 4
X 0.5 cm, white, translucent, glabrous, open to the base, apex 2-dentate. Flowers 5-7
per inflorescence, up to c. 16 cm long. Calyx tubular, 3 x 0.5 cm, white, translucent,
glabrous, apex tri-dentate. Floral tube c. 12-14 cm long, 3 mm wide at the base, white
with a pink tinge, glabrous externally and internally, dorsal corolla lobe oblong, 3.6 x
1.3 cm, white, glabrous, apex cucullate, margins involute, ventral lobes linear, c. 4.3
X 1 cm, white, glabrous, apex sometimes cucullate, margins involute; androecial tube
cup-shaped, c. 10-16 mm long, c. 12 mm diam. at the top, white, glabrous externally
and internally. Labellum slightly saccate, elongate, 4.5-5.0 cm long, 2. 7-3.0 cm wide
(when flattened at the broadest point) white, throat centre orange-red, maculate with
white showing through as dots, lip with an irregular, dark pink band, followed with a
lighter pink and white band to the apex, abaxial surface with few glandular hairs, lip
surface crinkled, margins crisped, apex entire, in'egular; lateral staminodes obovate,
c. 2.3 X 1 cm, white, abaxial surface with few glandular hairs, margins irregular, apex
revolute. Stamen 1 2 mm long, filament c. 3 mm long, c. 2 mm wide at base, white,
few glandular hairs, anther 10 mm long, 3 mm wide (first day) then c. 6 mm wide
(thecae diverging on the second day) apex slightly bilobed, with no anther crest, thecae
10 X 1 mm, white, dehiscing along the entire length. Ovary c. 7 x 3 mm, trilocular,
axile placentation, white, glabrous; style filiform, white, glabrous, stigma round, white,
ostiole round, without cilia, exuding a sticky liquid on the second day; epigynous
glands linear, two, 6 nun long, tan. Fruit a capsule, cylindrical, slightly ridged, c. 2 x 1
cm, trilocular, white, glabrous, calyx and floral tube remain partially intact, dehiscence
loculicidal; seed globular, c. 3 mm diam., yellowish-brown, slightly pubescent, aril
white, translucent. (Measurements based on living, cultivated material of M2032).
Distribution. This species is very common in northern Thailand. Collections from Chin
State, Burma and the Lao P.D.R. are known. It might also occur in Yunnan, China.
Ecology^ This species occurs in a variety of forest types to include evergreen, dry
deciduous and mixed evergreen/deciduous. Most collections are at middle to higher
elevations in mountainous terrain. Soil types vary from granitic to calcareous with
high organic matter content.
Phenology. Flowers from June to November with a two-day flowering cycle for each
flower.
Etymology. Named in honour of James F. Maxwell, Curator of the Chiang Mai
University Flerbarium, Thailand (CMU). For many years he has diligently collected,
documented, identified and preserved the flora of Thailand, Bunua, Cambodia and the
Lao P.D.R. to include hundreds of Zingiberaceae. Several of his collections represent
this new taxon.
Additional specimens examined: BURMA. Chin State. Kanpetlet, Laung Pan, Aug 2011,
Funakoshi s.n. (MBK; *); Kanpetlet, near Laung Pan, Aug 2011, Funakoshi s.n. (MBK).
76
Gard. Bull. Singapore 65(1) 2013
LAO P.D.R. Champasak Province. Near Pakxong, secondary forest, 2006, 1286 m,, collected
by T. Wood, Mood 11P26 (BISH; *). THAILAND. Mae Hong Son Province. 6 Sep 2010,
Mood & Triboun 2017 (BISH; *); Mae Hong Son, Khun Yuam, 5 Sep 1974, Larsen 34174
(AAU). Chiang Mai Province. Dong Duat waterfalls, 4 Sep 1999, Mood UP 124 (BISH; *);
Chiang Mai, Fang, 7 Jun 1973, Geesink 5750 (BKF); Chiang Mai, Doi Sutep, 18 Jun 1988,
Maxw'ell 88-875 (BKF; *); Chiang Mai, Sop Aep, 1 Oct 1971 , Murata T-15458 (BKF); Chiang
Mai, Mae Sanam, 27 Jun 1978, Phengkhlai 4140 (BKF); Chiang Mai, Doi Inthanon 14 Jul
1990, Phengkhlai 7516 (BKF); Chiang Mai, Doi Inthanon NP, 20 Jul 1988, Phengkhlai 6619
(BKF; *); Chiang Mai, Doi Chiang Dao, 25 Sep 1971, Murata T-14944 (AAU, BKF; *);
Chiang Mai, Doi Inthanon, 20 Jul 1988, Tamura T-60130 (BKF); Chiang Mai, Doi Sutep, 9
Aug 1988, Tamura T-60782 (BKF); Chiang Mai, Doi Chiang Dao, 9 Jun 1955, Fehrain 12477
(BKF); Chiang Mai, Doi Sutep, 11 Jul 1987, Maxwell 87-659 (BKF, CMU, L; *); Chiang Mai,
Chiang Dao, Doi Chiang Dao, 10 Jun 1989, Maxwell 89-731 (E); Chiang Mai, Fang, 26 May
1991, Maxwell 91-509 (E); Chiang Mai, Bo Luang, 4 Jul 1968, Larsen 2097 (AAU, BKF, L);
Chiang Mai, Doi Inthanon, 15 Sep 1995, Larsen 46499 (AAU); Chiang Mai, Doi Chiang Dao,
11 Sep 1967, Tagawa T-9865 (AAU); Chiang Mai, Baan Tham, Doi Chiang Dao, Watthana
737 (AAU). Lampang Province. Lampang, Doi Kuhn Dahn, 27 Jun 1993, Maxwell 93-695
(BKF, CMU, L; *); Lampang, Jae Sawn NP, 24 Aug 1995, Maxwell 95-575 (BKF, CMU, L).
Tak Province. 9 Aug 2010, Mood & Triboun 2040 (BISH; *). Chiang Rai Province. Chiang
Rai, Doi Yup, 13 Jun 1926, Garrett 294 (BKF); Tha Sai, 12 Aug 1998, Mood & Pedersen 1450
(C; *).
Notes. This species is closely related to B. kingii as discussed in the phylogenetic
analyses. Since B. maxwellii has a rhizome architecture different from B. kingii, there
is little chance of misidentification where their ranges might overlap, i.e., Burma,
Thailand and possibly China. The most westerly (known) record of B. maxwellii is
in Chin State, Burma, separating it geographically from B. hamiltonii. Boesenbergia
maxwellii differs from the latter in having larger flowers, different flower shape,
greater labellum texture, orange throat, a light and dark pink labellum and plant size
to c. 1.5 m.
Boesenbergia kingii Mood & L.M.Prince, sp. nov.
Boesenbergiae longiflorae (Wall.) Kuntze affinis, caulibus multiplicis, floribus
maioribus 5-6 cm longis 2.5-2. 7 cm latis, labello minus saccato elongato cremee albo
fauce rubra differt.
TYPUS: Mood & Vatcharakorn 12P173, Cultivated in Hawaii, USA, 1 Nov 2012
(holo BK; iso AAU). Originally from Thailand, Kanchanaburi Province, Huai Kayeng,
secondary forest margin, c. 200 m asl, 14°38.49'N 98^^31. 40'E, 21 August 2011, Mood
& Vatcharakorn 3074, cultivated M3 074. (Fig. 14, 15, 18 & 19E)
Deciduous herb up to c. 1 m tall; rhizomes numerous, horizontal runners of variable
length, multiple nodes, c. 0.5- 1.5 cm diam., pink or red when young, orange or red
when mature, internally yellow to orange; tuberous roots few, elongate c. 6 x 0.3 cm,
orange or white externally and internally, root hairs few, short, thin, white. Pseudostems
many, up to 30 cm, composed of leaf sheaths, base oval, c. 2.5 cm diam., 1-2 short.
Boesenbergia longijiora and related taxa
77
Fig. 14. Boesenbergia kingii Mood & L.M.Prince. Watercolour on paper by Edward King of
G. King 1020 (1874). Originally annotated as Gastrochilus longijiora. Reproduced by kind
permission of the Director, Botanical Survey of India.
78
Gard. Bull. Singapore 65(1) 2013
Fig. 15. Boesenbergia kingii Mood & L.M.Prince. A. Flower of M3074. B. Flower of M08P161.
C. Plant habit of M3074. D. Inflorescence, flower and leaf of M3074. E. Rhizomes of M3074.
F. Spreading habit (Assam, India). (Photos: J. Mood)
Boesenbergia longiflom and related taxa
79
leafless sheaths at the base, leaf sheaths longitudinally ridged, cross-hatched, reddish
or green, glabrous, margin hyaline. Leaves 3-7 per pseudostem; petiole 11-15 cm,
deeply channelled, green or red, glabrous; ligule slightly bilobed, an extension of the
hyaline margin, 4 mm long, white, translucent, glabrous; lamina elliptical 40-45 x
15-16 cm, ventrally dark green, glabrous, dorsally lighter green, glabrous with a few
hairs on the midrib, base rounded to cordate, apex acute to attenuate. Inflorescence
radical, c. 3-10 per pseudostem, up 18 cm long (including peduncle) produced from
the top of the horizontal rhizome near the pseudostem, peduncle 1-3 x 0.5-1 cm,
white or pink, glabrous, basal sheaths 1-2, 4-6 x 1.5-2 cm, white; spike cylindrical,
slightly asymmetric, 11-14 x 1-1.5 cm. Bracts linear to cymbifomi, 4-5, c. 6-11 x
1.5-2 cm, distichously arranged, white, green or red, glabrous, surface veined, each
bract enclosing one flower, apex acute; bracteole lanceolate, c. 5-6 x 0.5 cm, white,
translucent, glabrous, open to the base, apex 2-dentate. Flowers 4-5 per uiflorescence,
up to c. 20 cm long. Calyx tubular, 2-2.3 x 0.5 cm, white, translucent, glabrous, apex
tri-dentate. Floral tube c. 10-15 cm long, c. 0. 3-0.4 cm wide at the base, white, tinged
or striped pink, glabrous externally and internally, corolla lobes (dorsal and ventral)
oblong, c. 3.8-4 x 1.4 cm, creamy-white, glabrous, margins involute; androecial
tube cup-shaped, c. 10-12 mm long, c. 13 mm diam. at the top, white, glabrous
externally and intemally. Labellum slightly saccate, elongate, 5-6 cm long, c. 4
cm wide (when flattened at the broadest point) white to creamy-white, throat centre
bright red, maculate with white showing tlirough as dots, lip creamy- white, abaxial
surface with a few glandular hairs, margin undulate, wrinkled, apex entire; lateral
staminodes obovate, 2.5 x 1 .5 cm, creamy-white, abaxial surface with few glandular
hairs, apex rounded, revolute. Stamen 12 mm long, filament 3-4 mm long, 2-3 mm
wide at the base, white, glabrous, anther 8-9 mm long, 3 mm wide (first day) then c.
5 mm wide (thecae diverging on the second day) apex slightly bilobed with no anther
crest, thecae 9 x 1 mm, white, dehiscing along the entire length. Ovary c. 7 x 3 mm,
trilocLilar, axile placentation, white, glabrous; style filifomi, white, glabrous, stigma
elongate, white, ostiole vertically rectangular, without cilia, exuding a sticky liquid on
the second day; epigynoiis glands narrowly ovate, two, 8 mm long, white. Fruit not
seen. (Measurements based on living, cultivated material oiMS074).
Distribution. A widespread species, found in Bangladesh, Burma, NE India, SW China
and Thailand.
Ecology. The type locality is in a disturbed area on the margin of a secondary, riverine
forest in very light shade at c. 200 m asl. The soil is a brown, gravelly alluvium. Recent
observations of this species in Eastern Assam and Eastern Thailand were in disturbed,
lowland forest with light shade. From limited observations, it seems to prefer flat
terrain with loose soils having high moisture holding capacity.
Phenology. Flowers from May to September with a two-day flowering cycle for each
flower.
80
Gard. Bull. Singapore 65(1) 2013
Etymology. Named in honour of Sir George King (1840-1909) a Scottish medical
doctor and botanist who worked in India starting in 1865 after graduation from
medical school. For a short time he was Superintendent of the Garden at Saharanpur
and Conservator of Forests in that area. From 1870-1897, he was the Superintendent
of Calcutta Botanic Gardens. During the same period he became the first Director,
Botanical Survey of India (Burkill 1965). His contributions to botany and science
are numerous and far-reaching. The specimen King 1020 (CAL) is the first known
collection of this new species.
Additional specimens examined. BANGLADESH. Chittagong Division. Kaptai Lake, 5 Sep
1999, Newman 980 (E; *); Chimbiik Hill, Bandarban Hill Tracts, 8 Sep 2000, Newman 990 (E;
*). BURMA. Sagaing Dhlsion. Katha Dist., Pile R.F., 20 Aug 1915, Rogers 991 (CAL; *);
Alaungdaw Kathapa National Park, 17 .lul 1997, Kress 97-5821 (US; *). Mandalay Division.
Maymyo Hills, Jun 1 888, Khan 50 (CAL; *); Mt. Popa Park, 17 May 1996, Kress 96-5646 (US;
*). Shan State. 45 miles east of Pyin-Oo-Lwin, 26 Jun 2003, Kress 03-7366 (US; *). CHINA.
Yunnan Province. Xishuangbanna Prefecture (cultivated at Xishuangbanna B.G.) 1 Jul 2009,
Mood 2002 (BISH; *); Culyun Village, 49 km SW of Simao, 12 Jul 2009, Kress 09-8664 (US;
*). INDIA. Sikkim. Teesta Valley, 22 Jul 1874, King 1020 (CAL; *); Assam. Nambar Forest,
8 May, 1895, Reporter 11375 (ASSAM; *). THAILAND. Phetchabun Province. Nam Nao
vicinity, 14 May 2012, Mood & Vatcharakorn 3272 (BISH; *).
Notes. The type selected here with a creamy white flower, dark red throat and white
apex is the most common fomi observed across the range and as depicted in King’s
illustration (Fig. 14). Another fonri has also been observed with dark pink to light
violet colouring on the apex similar to the colours of B. hamiltonii. Based on limited
observations, this latter form seems to be less robust with shorter pseudostems and
smaller diameter rhizomes. The multi-stenmied habit of B. kingii (in both fomis) is
the result of the rhizome morphology — running in habit with multiple growth nodes
similar to a stolon (Fig. 15F). These runners gi'ow outward from the initial plant in
various directions, often producing a new pseudostem at a major node. The result
can be a large, clonal population such as at the type locality, where it encompasses
over 30 nF with hundreds of interconnected stems (Fig. 1 5C). In ex situ experiments
a planted piece of broken rhizome produced a new mass of miming rhizomes with
several pseudostems after one year of growth. In this vein, a specimen from Bumia,
C.G. Rogers 991 (CAL) is annotated, “Prevents the natural regeneration of Teak.” This
statement can now be understood with more clarity — B. kingii has the potential for
rapidly spreading once established in a suitable area.
Boesenbergia hamiltonii Mood, S.Dey & L.M. Prince, sp. nov.
Boesenbergiae longiflorae (Wall.) Kuntze ajfinis, floribus maioribus 3. 5-4. 5 cm
longis 2. 3-2. 8 cm latis, labello elongato minus saccato albissimo signis mbris roseis
violaceisque dijfert.
TYPUS: Dey NU53, India, Meghalaya, Riboha District, Nongpoh, tropical, semi-
evergreen forest, steep hillside along highway, c. 350 m asl, 25°57.5'N 9L51.183'E,
July 2009 (holo CAL; iso ASSAM). (Fig. 2, 16, 18 & 19F)
Boesenbergia longiflom and related taxa
81
Gastrochiliis jenkinsii Wall, ex Voigt, Hort. Suburb. Calcutt.: 572 (1845), nom.
inval., sine descr. - Voucher: Jenkins s.n. (CAL) India, Assam, Gowahatti. Bangleum
sulphureum Ham., nom. nud. = Alpinia hamiltoniana Wall., Numer. List: # 6579.
1832, nom. nud. - Voucher: Hamilton Ao 1808 = Wallich 6519 A, India, Gualpura, 30
May 1808 (K-W).
Gastwchilus longiflorus auct. non Wall.: Hooker in Curtis’s Bot. Mag. 69: t. 4010
(1843) (hand-coloured plate by W. Fitch; “Long-flowered Gastrochilus”); in Hook.f.,
FI. Brit. India 6 : 217 (1890) (= G. jenkinsii). - Voucher: Hooker in Curtis’s Bot. Mag.
69: t. 4010 (1843).
Curcumorpha longiflom auct. non A.S.Rao & D.M.Verma: A.S.Rao & D.M.Verma,
Bull. Bot. Surv. India 13: 339 (1974) (“1971”) pro specim.
Deciduous herb up to 1 m tall; rhizome to c. 2.3 cm diam., externally yellow-brown,
internally yellow; many cylindrical, tuberous roots extending from the rhizome base,
c. 12 X 0.5 cm, exteraally pink, internally white, sometimes with a swollen apex, c.
1 cm diam., 2 cm long; fibrous roots c. 45-50 x o.l cm, yellow-white, with many
secondary root hairs. Pseudostem up to c. 30 cm long, composed of leaf sheaths, base
round to oval, c. 2.5 cm. diam., several leafless sheaths at the base, green, glabrous,
leaf sheaths 12-24 cm, longitudinally ridged, lower portion reddish, upper green,
glabrous. Leaves 3-6 per pseudostem; petiole 8-26 cm, deeply channelled, light
green, glabrous; ligule, slightly bilobed, lobes an extension of the hyaline margin,
2 mm long, green or white, glabrous; lamina elliptical, 34-44 x 15-19 cm, plicate,
ventrally dark green, glabrous, dorsally lighter green, glabrous with a few hairs on
the midrib, base rounded to cordate, apex acute. Inflorescence radical, c. 3-10 per
pseudostem, up to c. 19 cm long (including peduncle) produced from the rhizome
below the pseudostem, peduncle 5-9 x 0.8 cm, white, glabrous, basal sheaths 1 -2, 3.5-
4.5 X 1-1.5 cm, white, glabrous; spike hom-shaped, 8-11 x 2 cm. Bracts cymbiform,
4-6, to c. 9 cm, distichously arranged, green and white, sometimes red, each bract
enclosing one flower, apex sometimes curved; bracteole cymbifomi c. 5-6 x 0.4
cm, white, translucent, glabrous, open to the base, apex 2-dentate. Flowers 4-6 per
inflorescence, up to c. 15 cm long. Calyx tubular, 2-2.4 x 0.5 cm, white, translucent,
glabrous, apex tri-dentate. Floral tube c. 9-12 cm long, 3-4 mm wide at the base,
white tinged with pink, glabrous exteraally and internally, corolla lobes (dorsal and
ventral) oblong, c. 4 x l .2 cm, white, glabrous, margins involute; androecial tube cup-
shaped, c. 8-10 mm long, c. 12 mm diam. at the top, white, glabrous exteraally and
interaally. Labellum slightly saccate, elongate, 5-5.5 cm long, 3.5-4 cm wide (when
flattened at the widest point) lip margins slightly crisped, crinlded, apex emarginate,
white, throat centre red, maculate with white showing thru as dots, colour broadening
toward the margins, ending c. 12 mm from apex, lip entirely pink to the apex, abaxial
surface with few glandular hairs; lateral staminodes obovate, 1.8 x 1.5 cm, white,
abaxial surface with few glandular hairs, apex rounded to slightly acute, margins
revolute in part. Stamen 12-14 mm long, filament 3 mm long, 3 mm wide at the base,
white, glabrous, anther 10-12 mm long, 3 mm wide (first day) then c. 8 mm wide
82
Gard. Bull. Singapore 65(1) 2013
Fig. 16. Boesenbergia hamiltonii Mood, S.Dey & L.M.Prince. A. First-day flower. B. First-day
flower. C. Mature plant. D. Rhizome and tuberous roots. All photos of Dey NU53. (Photos: J.
Mood)
Boesenbergia longiflora and related taxa
83
(thecae diverging on the second day) apex tmncate to slightly bilobed with no anther
crest, thecae 10-12 x 1 mm, white, dehiscing along the entire length. Ovary c. 5 x
4 mm, trilocular, axile placentation, white, glabrous; style filifonn, white, glabrous,
stigma elongate, ostiole vertically rectangular, without cilia, exuding a sticky liquid on
the second day; epigynous glands narrowly ovate, two, 5 mm long, tan-white. Fruit a
capsule, cylindrical, asymmetrical, 2 cm long, 1 cm wide, calyx and floral tube remain
partially intact, white, glabrous, surface smooth; seed globular, slightly flattened, apex
rounded, tan-yellow, aril sparse, white, translucent. (Measurements based on living,
wild material at the type location in India of Dey NU53).
Distribution. This taxon has been recorded primarily in Meghalaya and hill areas of
Assam. Its full range has not been detemiined.
Ecology. This species is normally found in sloped habitats where there is some shade,
good soil moisture and excellent drainage. Most plants are seen along roadside banks
on forest margins or more rarely in open forests. Observed elevations range up to 500
m asl, although Rao & Venua (1974) reported elevations up to 1850 m asl. The type
specimen was found growing under light shade in deep, black, well drained soil on the
margin of a disturbed secondary forest at 350 m asl. Associated plants were Shorea
robusta C.F.Gaertn., Tectona grandis L.f , Musa species, bamboo and understory
herbs.
Phenology. Flowers from May to September with a two-day flowering cycle for each
flower.
Etymology?. Named for Francis Buchanan Flamilton (1762-1829) a Scottish surgeon
and botanist in the employ of the East India Company from 1 794-1815. His botanical
research, collections, geographic documentation and statistical surveys provided a solid
foundation for future explorers and botanists in Northeast India, Burma and Nepal. He
served as Superintendent, Calcutta Botanical Gardens between 1814-1815. His two
specimens of Bangleum sulphureum from 1808 appear to be the first collections of this
new taxon.
Additional specimens examined: BANGLADESH: Sylhet Division. Laour, Jun 1830,
Gomez in Wallich 6579B (K-W; *). INDIA. Assam. Camrupa, 21 Jul 1808, Hamilton 12 (E;
*); Goalpara, Hamilton s.n. {Wallich 6579 A, K-W, CAL); no location, no date Jenkins s.n.
(ASSAM); Kami'up Dist., 13 Jun 1964, Rao 38791 (ASSAM; *); Darrang, Batasipur, 12 May
1947, Srinivasan 22411 (ASSAM);Tangla, 24 May 1958, Nath 13387 (ASSAM); Sibsagar,
Panbari, 15 Jun 1963, Deb 34846 (ASSAM). Meghalaya. Nongpoh, 31 Jun 1964, Joseph
37477 (ASSAM; *); Nowgong Dist., 18 Aug 1964, Balakrishnan 39222 (ASSAM); Nowgong
Dist., 31 Aug 1938, De 20327 (ASSAM); Nowgong Dist., 25 Aug 1964, Balakrishnan 39415
(ASSAM); Khasia Hills, J.D. Hooker s.n. (ASSAM, C; *); Garo Hills, 6 Sep 1962, Deb 29216
(ASSAM); Kliasia & Juanita Hills, 4 Jul 1938, De 20326 (ASSAM); Khasia & Juanita Hills, 8
Jun 1 939, Deka 19668 (ASSAM); Khasia & Juanita Hills, 4 Jul 1 940, Deka 20236A (ASSAM);
Khasia & Juanita Hills, 23 Jun 1941, De 21089 (ASSAM; ^).
84
Gard. Bull. Singapore 65(1) 2013
Notes. This species is distinguished from B. kingii by the small, short rhizome with
long, vertical tuberous roots which usually produces only a single, robust pseudostem
(Fig. 16D). Indicative of this below-ground morphology, B. hamiltonii is easily
recognized in the field by the widely scattered, individual plants, occurring in a low-
density population of seeded individuals (Fig. 16C). In contrast, B. kingii occurs in
multi-stemmed, high-density populations of clonal and seeded individuals (Fig. 15C, F).
Fig. 17A & B. Flowers. Left: Boesenbergia collinsii {M3035)\ Centre: B. kerrii {M2044);
Right: B. longiflora {M11P48). (Photos: J. Mood)
Boesenbergia longijiora and related taxa
85
The flower colour of B. hamiltonii is pure white with a red, maculate throat and a
pale pink lip apex. Colour variations between populations are primarily in degree of
pigmentation. When the labellum is dissected and flattened, it is very similar in shape
to B. kingii, but in living plants the full open, frontal shape is oval in the former and
truncate or rounded in the latter. As a historical note, after Hamilton collected his two
{Banglium) specimens in 1808, he used ''sulphureum” (light yellow) as the speciflc
Fig. 18A& B. Flowers. Left: Boesenbergia maxwellii {M11P124); Centre: B. kingii (M11P77)
Right: B. hamiltonii {M3209). (Photos: J. Mood)
86
Gard. Bull. Singapore 65(1) 2013
epithet. Initially, this was a confusing issue, since no yellow flowered Boesenbergia
had been described from NE India. Later, this anomaly was understood after examining
the newly pressed flowers of all of the specimens used in this study. No matter what the
original living flower colour, all turned a light yellow after drying. It appears Hamilton
based his species descriptor on the dried flower colour rather than on fresh flowers.
This yellow coloration can still be seen on Hamilton 12 (E).
Fig. 19. Stamens & labellum. A. Boesenbergia longiflora (M11P48). B. B. kerrii {M2044).
C. B. collinsii {M3 03 5). D. B. maxwellii {M11P124). E. B. kingii {M11P77). F. B. hamiltonii
{M3209). (Photos: J. Mood)
Boesenbergia longijiora and related taxa
87
Conclusions and further research
Our study fully supports Larsen’s (1997) conclusion that Curcumorpha should
be reduced to Boesenbergia. This is based on the phylogenetic analyses showing the
B. longiflora clade nested within the larger Boesenbergia clade (Fig. 3). In further
support, three of the four characters Rao & Verma (1974) used to justify Curcumorpha
have been found to occur in other Boesenbergia species. Their fourth character, spiral
bract arrangement, was misinterpreted and bracts are in fact distichously inserted
in taxa throughout the B. longiflora clade. Some of their cited specimens are now
determined as B. hamiltonii.
Fig. 20. Geographical distribution of the Boesenbergia longiflora clade showing type localities.
B. collinsii (yellow), B. hamiltonii (light blue), B. kerrii (red), B. kingii (white), B. longiflora
(dark blue) and B. maxwellii (green). Each specimen mapped is noted by an asterisk following
the herbarium abbreviation under the ''Additional specimens examined’'. (Mapped in GOOGLE
earth, US Dept of State Geographer, 2013 Cnes/Spot image, 2013 Mapabc.com and 2013
Google).
Table 1. Comparison ofsiiL Boesenbergia species from the B. longifiora clade. All measurements are derived from living material. Floral tube length
= apex of ovary to base of corolla lobes; androecial tube length = base of corolla lobes to androecial tube apex (point of divergence of staminodes,
filament and labellum).
88
Gard. Bull. Singapore 65(1) 2013
-a -s
oj S
■S o
M O
^ c 3
00
c
(U o
B z
N
^ §
Sh t/5
oj
O .ti
■U "I .SP
O
o § -S o rS
I g 2^ 5P u ^
m Cl, o c3 >, si;
« ^ o
0 ^ s N
m CIh
§ g §
all
c - a
c 3 T 3 ^
^ (U o
O s- o
-a ^
■S I
H CC
'T3
CD
H
O
'S ^
CO
2 ^ "g
X
'S
(N
-O .-tt
O ^
N S
’u S
y. 6
OJ OJ
4 C
Q,
p S CX
V "O TS
i .. (U ^ w
60 ^ "S
H v! C 3 ^ O
S S O
JH ^ 4c o
O c/j VI
,(U
t+H ^
'Tl
a l)
c3
g X
-C u
^ &
'73 ”
aj o
.a -C
t; >
U
(D
+-1
00
(U
• ^
<u
X
c
CD
per
’o
a
CIh
C/3
d
J3
(D
X2
a
1— >
60
C
CD
C/i
Uh
o
u
a
o
CD
(U
C3
P
CD
a->
<u
cd
(D
x>
CTi
cd
u.
a
c
a
c
Eg
Eg
P-H
<
<
'O
c: o
2 -2
00 g
53 .-S
~o JH
0 = P
tuberous roots vertical tuberous 0.5 -1.5 cm vertical tuberous
roots diameter roots
Boesenbergia longiflom and related taxa
89
Taxa in the B. longiflora clade can generally be distinguished from other
Boesenbergia by a combination of characters: robust plants with few leaves, radical
inflorescences with distichous bracts and large, two-day flowers. Their annual life
cycle begins as seed, rhizome-like bulbs {B. kerrii, B. longiflora) pieces of running
rhizome {B. kingii) or mature rhizomes from the previous year. Growth begins in April
or later, coinciding with the monsoon rains and continues through October when the
weather becomes cooler and dry. All species are donnant for about five months. Plants
of B. maxwellii grown in a different climate (Hawaii) with rainfall throughout the
dormancy period still follow their monsoonal cycle even after 20 years of cultivation
(Mood, pers. obs.).
Running rhizomes are found on all current B. kingii collections, including
the putative hybrids. This character, at least in part, might account for its very wide
distribution, whereas the other five species which propagate primarily through seed
dispersal have a much smaller range.
Specimens or pictures identified as B. longiflora in publications prior to this
study should be re-determined. For instance, the plants studied by Gao et al. (2004)
are not B. longiflora, but appear to represent B. kingii. Similarly, in Larsen & Larsen
(2006), the Boesenbergia pictured on page 32 is B. maxwellii, while the yellow-
flowered taxon on page 48 appears to be B. collinsU.
Long-tenn observation of cultivated gingers combined with field visits to
document ecology, geology, distribution, pollination biology and other elements has
shown to be an excellent strategy for the study of Boesenbergia. The daily observation
of multiple collections of various taxa from initial growth to dormancy provided
insight well beyond that of field observations alone.
The current study represents a small segment of an on-going research project
whose goal is to improve the overall knowledge of Boesenbergia by re-examining
nomenclature, improving descriptions, analysing genetic relationships and providing
phytochemical profiles. Additionally, further investigation of the B. longiflora clade
continues to include karyotyping, phenology, biogeography and conservation status.
ACKNOWLEDGEMENTS. We would like to thank W. John Kress, Mike Bordelon, Lopez,
Ingrid Pol-Yin Lin (US), Mark Newman (E) for assisting with specimens, plant photography
and collection data. Latin text was translated by Philip H. Oswald (Cambridge, U.K.). We
thank Henry Noltie and Helen Yeats (E), Malcolm Beasley (BM), Penny Brook (British
Library, UK), Gina Douglas (LINN), Louise B. Johansen (Denmark), Gitte Petersen (C),
Fimi Borchsenius and Olof Ryding (AAU), Nicholas Hind, Marcelo Sellaro, Lynn Parker,
Tim Utteridge, Martin Xanthos, Katherine Challis (K) and Axel Poulsen (Oslo BG, Norway)
for helpful discussion and assistance in preparatory research. Special thanks to Jana Leong-
Skomickova (SING), Peter Boyce (USM, Malaysia), Pieter Pelser (UC, NZ) David Gang
(WSU, USA), Ida Theilade (UC, Denmark) and Bob Faden (US) for manuscript assistance.
Special acknowledgement to colleagues in Thailand: Poonsak Vatcharakom, Pramote Triboun
(BK) Yingyong Paisooksantivatana (KU), Piya Charlennglin (TISTR) and the staff at BK
and BKF. In India, special thanks to Shii Jairam Ramesh, Minister of Rural Development;
Jatrinda Sarma, Assam Forestry Dept.; Pararnjit Singh, Director of Botanical Survey of India,
90
Gard. Bull. Singapore 65(1) 2013
P. Lakshminarasimlian, B.K. Singh, R. Kumar; and Moaakum (Kohima Science College). The
second author also thanks Rancho Santa Ana Botanic Garden for generously providing several
years of financial support and The Field Museum of Natural History for current and on-going
access to collections and facilities. Permissions for reprinting Figs. 1 and 2 were kindly granted
by the Board of Trustees of the Royal Botanic Gardens Kew; for Fig. 14, by the Director,
Botanical Survey of India, Kolkata, India. The original watercolours of B. colJinsii, B. kerrii
and B. maxweJlii were accomplished in a historical style by Linda Ann Vorobik (UCB, USA).
Colour plates were created by Tiffany D. Shafto (Hawaii, USA).
References
Ainouche, M.L., Baumel, A., Salmon, A. & Yannic, G. (2004) Hybridisation, polyploidy and
speciation in Spartina (Poaceae). NeM? Phytol. 161 : 165-172.
Akaike, H. (1974) A new look at the statistical model identification. IEEE T Automat. Contr
19: 716-723.
Alvarez, I. & Wendel, J.F. (2003) ITS sequences and plant phylogenetic inference. Molec.
Phylogenet. Evol. 29: 417^34.
Baker, J.G. (1890) Scitamineae. In: J.D. Hooker (ed.). The Flora of British India. Vol. 6. Pp.
217— 218. London: Reeve & Co.
Beilstein, M.A., Al-Shehbaz, I.A., Mathews, S. & Kellogg, E.A. (2008) Brassicaceae phylogeny
inferred from phytochrome A and ndhF sequence data: tribes and trichomes revisited.
Amer. J. Bot. 95: 1307-1327.
Burkill, I.H. (1965) Chapters on the History of Botany in India. Pp. 168-173. Calcutta: Bombay
Natural History Society & Botanical Suiwey India.
Cunningham, C.W. (1997) Can thi'ee incongruence tests predict when data should be combined?
Molec. Biol. Evol. 14: 733-740.
Don, D. (1825) Pivdromus Florae Nepalensis. P. 32. London: Gale.
Fan, L.N. (2004) Phylogenetic Relationship Based on Flavonoids and ITS Regions Studies
on Selected Boesenbergia Species in Sabah. Unpublished thesis. University Malaysia
Sabah, Kota Kinabalu, Sabah.
Farris, J.S., Kallersjo, M., Kluge, A.G. & Bult, C. (1995) Testing significance of incongruence.
Cladistics 10: 315-319.
Fazekas, A.J., Steeves, R. & Newmaster, S.G. (2010) Improving sequencing quality from PCR
products containing long mononucleotide repeats. BioTechniqiies 48: 277-285.
Feliner, G.N., Aguilar, J.F. & Rosello, J.A. (2001) Can extensive reticulation and concerted
evolution result in a cladistically structured data set? Cladistics 17: 301-312.
Fitch, W.M. (1971) Toward defining the course of evolution: Minunum change for a specific
tree topology. Syst. Zool. 20: 406-416.
Fuertes Aguilar, J., Rosselld, J.A. & Feliner, G.N. (1999) Nuclear ribosomal DNA (nrDNA)
concerted evolution in natural and artificial hybrids of Armeria (Plumbaginaceae)
Molec. Ecol. 8: 1341-1346.
Gao, J.Y., Zhang, L., Deng, X.B., Ren, P.Y., Kong, J.J. & Li, Q.J. (2004) The floral biology of
Curcumorpha longifloi^a (Zingiberaceae): A ginger with two-day flowers. Amer J. Bot.
91:289-293.
Gao, J.Y., Xia, Y.M., Huang, J.Y. & Li, Q.J. (2005) An Introduction to Chinese Ginger Plants.
Beijing: Science Press.
Boesenbergia longiflom and related taxa
91
GeiiBank NIH genetic sequence database (2011) Nucleic Acids Research, 201 1 Jan; 39 (Database
issue): D32-7. http://www.ncbi.nlm.mh.gov/genbanlc/ (accessed 26 Nov. 2012).
Guindon, S. & Gascuel, O. (2003) A simple, fast, and accurate algorithm to estimate large
phylogenies by maximum likelihood. Syst Biol. 52: 696-704.
Holttum, R.E. (1950) The Zingiberaceae of the Malay Peninsula. Gard. Bull. Singapore 13(1):
106-117.
Hooker, W.J. (1842) Gastrochilus pulcherrima. Handsome-flowered Gastrochilus. Curtis’s
Bot. Mag. 68: Tab. 3930.
Hooker, W.J. (1843) Gastrochilus longiflora. Long-flowered Gastrochilus. Curtis’s Bot. Mag.
69: Tab. 4010.
Joly, S., McLenachan, RA. & Lockhart, P.J. (2009) A statistical approach for distinguishing
hybridisation and incomplete lineage sorting. Amer, Naturalist 1 74: E54-E70.
Kress, W. J., Prince, L.M. & Williams, K. J. (2002) The phylogeny and a new classification of the
gingers (Zingiberaceae): Evidence from molecular data. Amer. J. Bot. 89: 1682-1696.
Kress, W.J., Mood, J.D., Mamiyil, S., Prince, L.M., Dey, S. & Sanoj, E. (2010) Larsenianthus,
a new Asian genus of gingers (Zingiberaceae) with four species. Phytokeys 1: 15-32.
Kuntze, O. (IS91) RevNio Generum Plantarum 2: 685. Leipzig: Felix.
Larsen, K. (1997) Further studies in the genus Boesenbergia (Zingiberaceae). Nord. J. Bot. 17:
361-366.
Larsen, K. & Larsen, S. (2006) Gingers of Thailand. Chiang Mai: Queen Sirikit Botanic
Garden.
Leong-Skomickova, J., Ly, N.-S., Poulsen, A.D., Tosh, J. & Forrest, A. (2011) Newmania: A
new ginger genus from central Vietnam. Taxon 60: 1386-1396.
Liu, S.C., Lu, C.T. & Wang, J.C, (2009) Reticulate hybridisation of Alpinia (Zingiberaceae) in
Taiwan. J. PI. Res. 122: 305-316.
Miller, M.A., Pfeiffer, W. & Schwartz, T. (2010) Creating the CIPRES Science Gateway
for inference of large phylogenetic trees. In: Proceedings of the Gateway Computing
Environments Workshop (GCE). New Orleans, Louisiana: IEEE.
Mraz, R, Chrtek, J. & Fehrer, J. (2011) Interspecific hybridisation in the genus Hieracium s.
str.; Evidence for bidirectional gene flow and spontaneous allopolyploidisation. PI. Syst.
Evol. 293: 237-245.
Ngamriabsakul, C. & Techaprasan, J. (2006) The phylogeny of Thai Boesenbergia
(Zingiberaceae) based on petA-psbJ spacer (chloroplast DNA). J. Biochem. Mol. Biol.
39: 361-370.
Posada, D. (2008) jModelTest: Phylogenetic model averaging. Molec. Biol. Evol. 25: 1253-
1256.
Prince, L.M. (2010) Phylogenetic relationships and species delimitation in Canna (Cannaceae)
In: Seberg, O., Petersen, G., Barfod, A.S. & Davis, J.I. (eds) Diversity, Phylogeny, and
Evolution in the Monocotyledons. Pp. 307-331. Aarhus: Aarhus University Press.
Prince, L.M. & Kress, W.J. (2006) Phylogenetic relationships and classification in Marantaceae:
Insights from DNA sequence data. Taxon 55: 281-296.
Rambaut, A. (1996) Se-Al (v2.0all) Sequence Alignment Editor, http://tree.bio.ed.ac.uk/
software/seal/ (accessed 26 Nov, 2012).
Rao, A.S. & Venna, D.M. (1974) Curcurnorpha — a new genus of Zingiberaceae. Bull. Bot.
Sufw. India 13: 339-341.
Ridley, H.N. (1924) The Flora of the Malay Peninsula 4: 246-252. London: Reeve & Co.
Ronquist, F. & Huelsenbeck, J.R (2003) MrBayes 3: Bayesian phylogenetic inference under
mixed models. Bioinfoimatics 19: 1572-1574.
92
Gard. Bull. Singapore 65(1) 2013
Sakai, S. & Nagamasu, H. (2006) Notes on inflorescence structure of Boesenbergia
(ZingihQmcQSie). Acta Phytotax. Geobot. 57: 107-111.
Schlechter, R. (1913) Die Gattungen Gastrochilus Don. und Gastrochilus Wall. VQddQ^Repert.
Spec. Nov. Regni Peg. 12:31 5-3 1 7.
Schumann, K. (1904) Zingiberaceae. In: Engler, A. & Prantl, K. (ed) Das Pflanzenreich IV, 46,
Heft 20: 91-95. Leipzig: Engelmann.
Schwarz, G.E. (1978) Estimatmg the dimension of a model. Ann. Stat. 6(2): 461^64.
Smith, R.M. (1981) Zingiberaceae Synoptic Ke\>, Royal Botanic Garden Edinburgh. (RBGE
distribution, unpublished).
Struck, T.H. (2007) Data congruence, paedomorphosis and salamanders. Front. Zool. 4:
22.Swofford, D.L. (2002) PAUP*: Phylogenetic Analysis Using Parsimony (*and other
methods), vers. 4.0b 10., Sunderland, Massachusetts, USA: Sinauer Associates, Inc.
Techaprasan, J., Ngamriabsakul, C., Klinbunga, S., Chusacultanachai, S., & Jenjittikul, T.
(2006) Genetic variation and species identification of Thai Boesenbergia (Zingiberaceae)
analyzed by chloroplast DN A polymorphism. J. Biochem. Mol. Biol. 39: 361-370.
Valeton, T. (1918) New notes on the Zingiberaceae of Java and Malaya. Bull. Jard. Bot.
Buitenzorg, Ser. 2, 27: 81-105.
Vanijajiva, O., Suvachittanont, W. & Sirirugsa, R (2003) Isozyme analysis of relationships
among Boesenbergia (Zingiberaceae) and related genera in Southern Thailand. Biochem.
Syst. Ecol. 31: 499-511.
Vanijajiva, O., Suvachittanont, W. & Sninigsa, R (2005) Isozyme analysis of relationships
among Boesenbergia (Zingiberaceae) and related genera by RAPD. Biochem. Syst.
Ecol. 33: 158-170.
Voigt, J. (1845) Hortus Suburbanus Calcuttensis. Pp. 571-572. Calcutta: Bishop’s College
Press.
Wallich, N. (1829) Plantae Asiaticae Rariores 1: 22-23. London: Treuttel & Wiirz.
Wallich, N. (1832) A Numerical List of Dried Specimens (“Catalogue”). London: Wallich.
Wallich, N. (1840) Inventory of 51 spp. of Live Plants Sent to Kew Gardens. Kew: Wallich
collection (unpublished).
Winterfeld, G., Schneider, J. & Roser, M. (2009) Allopolyploid origin of Mediterranean
species in Helictotrichon (Poaceae) and its consequences for karyotype repatterning and
homogenization of rDNA repeat units. Syst. Biodivers. 7: 277-295.
Wu, T.L. & Larsen, K. (2000) Zingiberaceae. In: Raven, R & Wu, T.L. (eds) Flora of China 24:
367-368. St. Louis: Missouri Botanical Garden Press; Beijing: Science Press.
Ying, B., Wendel, J.F. & Song, G. (2010) Multiple patterns of rDNA evolution following
polyploidy in Oryza. Molec. Phylogen. Evol. 55: 136-142.
Zaveska, E., Per, T., Sida, O., Leong-Skomickova, J., Sabu, M. & Marhold, K. (2011) Genetic
diversity patterns in Curcuma reflect differences in genome size. Bot. J.Linn. Soc., 165:
388^01.
Appendix A. Botanical history of Boesenbergia longiflora.
1808: Hamilton collected two ginger specimens in Assam, India which he labelled Bangleum
sulphureum {Hamilton 12 (E) md Hamilton s.n. {Wallich 6579A, K-W, IDC microfiche
7394)].
Boesenbergia longiflora and related taxa
93
1825: D. Don published Gastrochilus D.Don (Orchidaceae).
1 829: Wallich published Gastrochilus Wall. (Zingiberaceae) with two species, G. pulcherrima
Wall. {Wallich 6588, IDC microfiche 7394) and G. longiflora {Wallich 6589A, IDC
microfiche 7394). The detailed descriptions were accompanied by watercolour
illustrations.
1832: Wallich re-detemiined Bangleum sulphureum {Hamilton s.n., K-W, IDC microfiche
7394) to Alpinia hamiltoniana Wall. nom. nud. and identified Wallich 240 (K-W, IDC
microfiche 7394) from Bengal as the same species, grouping them under Wallich 6579,
A and B, consecutively.
1840: Wallich dispatched 51 species of living plants fi'om the Calcutta Botanical Gardens
to the Kew Gardens. On the inventory {Wallich 1840) the last two items listed are G.
pulcherrima and G.jenkinsii Wall. nom. nud.
1842: Hooker published, ''‘'Gastrochilus pulcherrima. Handsome-flowered Gastrochilus’’^ in
Curtis’s Botanical Magazine (t. 3930).
1843: Hooker published ‘'‘'Gastrochilus longiflora. Long-flowered Gastrochilus'’' in Curtis’s
Botanical Magazine (t. 4010). The description was accompanied by a hand-coloured
plate prepared by William Hood Fitch (Fig. 2). Hooker mentioned that both G.
pulcherrima and this species came to Kew Gardens as living plants from Wallich at the
Calcutta Botanical Gardens.
1845: Voigt, documenting the plants at the Calcutta Botanical Gardens described the G.
longiflora flower as “largish, pale-yellowish, with a rose-coloured lip” and mentioned
that G. jenkinsii is from “Assam and the hills about Gowhatti. Flowered in July 1 838.”
Note: This places G.jenkinsii in cultivation at the Calcutta Botanical Gardens just prior
to Wallich’s 1840 dispatch of plants to Kew Gardens.
1874: King collected King 1020 (CAL) in “Sikkim Hunalaya.” Accompanying the specimen
are two watercolour illustrations by Edward King, annotated as G. longiflora.
1890: Baker listed and briefly described six Gastrochilus species and three “Imperfectly
known and undescribed species.” He revised pait of Wallich’s original description of
G. longiflora stating “staminodes white rather longer than the white corolla-segments
lip tmged with red.” He also mentioned, “The Bot. Mag. plant is G. jenkinsif Wall,
mss. and has larger flowers than that figured by Wallich, of a purer white, the lip tipped
with bright red.” He broadly expanded the distributional range after annotating other
specimens as G.. longiflora.
1891: Kuntze obseiwed that Gastrochilus D. Don had priority over Gastrochilus Wall, and
proposed Boesenbergia Kuntze for the later homonym.
1904: Schumann listed six known and three imperfectly known Gastrochilus species,
describing G. longiflora as white flowered. Note: Schumann’s Fig. 13 is wrongly
labelled “’Gastrochilus longiflorum’’’’ . It is an exact copy of G. pulcherrima, t. 3930
(Hooker 1842).
1913: Schlechter accepted Boesenbergia Kuntze, listing 23 taxa.
1918: Valeton reviewed 17 Indonesian Gastrochilus species, commenting on the close affinity
of G. angustifolia Hallier f. (Sumatra) to G. longiflora.
1924: Ridley listed 24 Gastrochilus species for the Malay Peninsula, noting G. longiflora only
as a cultivated plant in Penang Gardens.
1950: Holttum provided an account of Boesenbergia for the Malay Peninsula, selecting B.
pulcherrima as the type. He commented that the illustration, t. 4010 in Curtis’s Botanical
Magazine (Hooker 1843) “does not agree very well with Wallich’s” and questioned
94
Gard. Bull. Singapore 65(1) 2013
whether B. longiflora actually belongs to Boesenbeigia or “may have to be transferred to
another genus.”
1974: Rao & Verma published Curcumorpha A.S.Rao & D.M.Verma with a single species, C.
longiflora (Wall.) A.S.Rao & D.M.Verma and cited 20 white-flowered specimens that
reportedly ditYered fi'om Boesenbergia by having stems spurious [a false stem] spikes
radical, bracts spiral and a staminodial cup.
1981: Smith supported Rao & Verma’s taxonomic distinction of B. longiflora as Curcumorpha
based on the four characters.
1997: Larsen questioned the necessity of Curcumorpha, suggesting that the characters
mentioned by Rao & Verma were not sufflciently different from other Boesenbergia
species and recommended that C. longiflora be maintamed in Boesenbergia.
2002: Kress et al. commented on the phylogeny of Boesenbergia suggesting that Boesenbergia
might be polyphyletic with B. pulcherrima allied to Curcumorpha.
2004: Gao et al. studied the floral biology of C. longiflora finding a two-day flowering cycle
for the species.
2006: Sakai & Nagamasu found that a living specimen identified as B. longiflora {Tanaka et
al. 023015, TI) had an inflorescence with a distichous bract arrangement.
2003-2006: Other references to B. longiflora or C longiflora include: Vanijajiva et al. 2003,
2005; Fan 2004; Techaprasan et al. 2006; and Ngamriabsakul & Techaprasan 2006.
Appendix B. GenBank accession numbers (ITS/tmK) for Boesenbergia spp. (Zingiberaceae)
used in this study. Sample number (voucher number, herbarium) GenBank numbers. Note:
c=clone.
Boesenbergia collinsii Mood & L.M.Prince: M06P14 {Mood 12P171, holotype, BK)
JX992751/JX992S12; MP1455 {Mood & Pedersen 1455, C) JX992752/JX992813; M2010
{Mood & Triboun 2010, BISH) JX992749/JX992810; M2011 {Mood & Triboun 2011, BISH)
JX992750/JX992811; M3035 {Mood & McMakin 3035, BISH) .1X992753/JX992814.
Boesenbergia hamiltonii Mood, S.Dey & L.M.Prince: M3017 {Dey NU53, holotype, CAL)
JX992754/JX992815; M3026 {Mood 12P177, BISH) JX992755/JX992816; M3212 {Mood
12P178, BISH) JX992794/no data.
Boesenbergia kerrii Mood, L.M.Prince & Triboun: M2044 {Mood & Triboun 12P170,
holotype, BK) JX992756/JX992817; M2049 {Mood & Chalermglin 2049, BISH) JX992757/
JX992818; M2058 {Mood 2058, BISH) JX992758/JX992819; M3009 {Mood & Triboun 3009,
BISH) JX992759/JX992820.
Boesenbergia kingii Mood & L.M.Prince: M3074 {Mood & Vatcharakorn 12PI 73, holotype,
BK) C2-JX992789, c3-JX992790, c4-JX992791, cJX992792, c8- JX992793/ JX992829;
M08P161 (live material Kress 03-7366, US) JX992760/JX992821; M11P47 (live material
of Kress 96-5646, US) cl- JX992761, Cc- JX992762, c3- JX992763, c4- JX992764, c5-
JX992765, C6-JX992766/ JX992822; M2002 {Mood 2002, BISH) cl-JX992769, c2-JX992770,
C3-JX992771/JX992825; M3015 {Mood 12P174, BISH) cl-JX992772, c2-JX992773, c3-
JX992774, C4-JX992775, C-JX992776, cl2-JX992777, cl3-JX992778/JX992826; M3019
(Moo^/72F/75.BISH)cl-.TX992779,c3-JX992780,c6-JX992781,c8-JX992782,c9-JX992783,
C10-JX992784/JX992827; M3020 {Mood 12P176, BISH) c7-JX992785, c8-JX992786, c9-
JX992787, C12-JX992788/JX992828; M3272 {Mood & Vatcharakorn 3272, BISH) JX992795/
JX992830; M11P77 (live material of Newman 980, E) JX992767/JX992823; M11P78 (live
Boesenbergia longiflora and related taxa
95
material oi Newman 990, E) JX992768/JX992824; K97-5821 {Kress 97-582 1,\JS) AF478742/
AF478842.
Boesenbergia longiflora (Wall.) Kuntze: M11P48 (live material of Kress 03-7305, US), cl-
JX992796, C5-JX992797, c6-JX992798/ JX992831 .
Boesenbergia maxH’ellii Mood, L.M.Prince & Triboun: M2032 {Mood & Triboim 12P172,
holotype, BK) JX992800, JX992833; MP1450 {Mood & Pedersen 1450, C) JX992802/
JX992802; M2017 {Mood & Triboun 2017, BISH) JX992799/JX992832; M2040 {Mood
& Triboun 2040, BISH) JX992801/JX992834; M11P26 {Mood 11P26, BISH) JX992803/
JX992835; MI1P124 {Mood 11P124, BISH) JX992804/JX992836; M11CI32 {Funakoshi s.n.,
MBK) JX992805/JX992837; Ml 1C133 {Funakoshi s.n., MBK) JX992806/JX992838.
Boesenbergia plicata var. lurida (Ridl.) Holttum: M3 120 {Mood & Vatcharakorn 3120,
BISH) JX992808/JX992839.
Boesenbergia plicata var. plicata (Ridl.) Holttum: M3 177 {Mood & Vatcharakorn 3177,
BISH) JX992807/JX992840.
Boesenbergia pulcherrima (Wall.) Kuntze: M08P276 {Mood 08P276, BISH) JX992748/
JX992809; K98-6220 {Kress 98-6220, US) AF478725/AF478825.
Gardens’ Bulletin Singapore 65(1): 97-100. 2013
97
Valid publication of Boesenbergia aurantiaca
(Zingiberaceae)
Mark F. Newman
Royal Botanic Garden Edinburgh,
20A Inverleith Row,
Edinburgh EH3 5LR, Scotland
ABSTRACT. The reason why Boesenbergia aurantiaca was invalidly published is given and
the name is validated here.
Keywords. Borneo, Danum Valley, gingers, Sabah, type specimen
Introduction
In 1 985, during construction of the Danum Valley Field Centre in Sabah, G.C.G. Argent
and J.A. Ratter of the Royal Botanic Garden Edinburgh visited the area and made
collections of herbarium specimens and living material for cultivation in Edinburgh.
Among the living collections were two Zingiberaceae which were registered in the
RBGE Garden Accessions book for 1985 on 15^‘" May, when they were given accession
numbers 19850843 and 19850847. The Garden Accessions book records that this was
plant material collected by Argent and Ratter during March 1985. Accession number
19850843 is still growing m Edinburgh while 19850847 is assumed to have died.
Among the dried herbarium specimens, which were collected under the Sandakan
herbarium collection number series, was Argent, Ratter, Leopold, Dongop & Kumin
SAN 108235, collected on 25 February 1985.
Boesenbergia aurantiaca R.M.Sm. was one of a number of new species
published by R.M. Smith in her review of the Zingiberaceae of Borneo (Smith 1987).
It appeared in the Notes from the Royal Botanic Garden Edinburgh 44(2): 226 (1987),
and was diagnosed and described in Latin. The type collection is cited as follows,
“Type: Sabah, Danum Valley, 100-250 m, mixed dipterocarp forest, in deep shade, iv
19^5, Argent & Ratter San 108235, cult. RBG Edinb., viii 1985 (holo. E).”
In the herbarium at E, there are two herbarium sheets and a spirit collection
which are relevant to the protologue of Boesenbergia aurantiaca. Argent et al. SAN
108235 consists of a leafy shoot with an inflorescence and, in a capsule attached to the
sheet, a fragment of leaf. The label shows differences in the collectors’ names, the date
of collection, and the altitude from those cited in the protologue. This sheet bears the
barcode number e00389050. There is a duplicate of this collection at SAN.
The other sheet consists of a leafy shoot with an inflorescence and a flower, and
bears the barcode number eOO 149734. The collector is not recorded but is likely to have
98
Gard. Bull. Singapore 65(1) 2013
been R.M. Smith. There is no eollection number but there is a reference to the living
accession from which it was made, 1 9850847. In the capsule attached to the sheet are a
smaller capsule marked, ''Boesenbergia (Danum Valley plant)”, which contains dried,
dissected parts of a flower, and a sheet of card with two flower dissections glued to
it. The dissection at the left is marked, “wild coll.” while that on the right is marked,
“cult, plant”; the bottom of the card is marked, “Argent & Ratter SAN 108235”. This
sheet is a mixed collection consisting of parts from the living collection at RBGE and
a part from the wild collection Argent et al SAN 108235.
The label on this sheet records the following:
Obsen>ations in cultivation
Orange flowers. Cultivated plant has corolla tube c.4 cm long; wild collection
shows tubes of up to 7 cm. Leaves dark green with a yellowish ‘cloud’.
Details of original collection
Sabah, Danum Valley, 1 00-250 m, mixed dipterocarp forest in deep shade, April
1985, Argent & Ratter San 108235 (material in spirit coll.)
RBGE No. 850847.
RBGE number 850847 is the accession number, now always given in full as 19850847.
The database of the living collection at E records this accession as having been collected
by G. Argent & J.Ratter s.n., 15 March 1985 but, as stated in the introduction above,
the Garden Accessions book gave the date simply as March 1985. When the Garden
Accessions books were digitised, the database may have created the date 15th March
1985 automatically (R. Cubey pers. comm,). Argent’s field book indicates that he and
Ratter were already in the Danum Valley on 25 February and stayed there until 14
March 1985 (G.C.G. Argent pers. comm.) so Smith’s record of the original collecting
date as April 1985 on the holotype is a mistake. Living accession 19850847 was alive
in 1992 but could not be located in November 1998 and has not been seen since; it is
assumed dead.
The spirit material is stored in a 500 ml jar with barcode number e00389005. It
is important to know whether this material was collected in the Danum Valley, along
with the wild collected herbarium material, or from one of the living accessions at the
Royal Botanic Garden Edinburgh. The fact that the spirit bottle contains an original
collecting tag from the Sandakan herbarium indicates clearly that the spirit material
was collected in the wild (G.C.G. Argent pers. conun.) The herbarium sheet and the
spirit material are not labelled as being parts of one specimen, however, so they must
be treated as duplicates (McNeill et al. 2006, Art. 8.3).
Smith (1987) regarded the cultivated specimen collected in August 1985 as
the holotype, indicated by the word “holotype” in red crayon in Smith’s hand on the
sheet. As this sheet is a mixed collection, with parts from two gatherings, however, the
name Boesenbergia aurantiaca was not validly published. The evidence available now
indicates that Smith based her description mainly on the plant cultivated at Edinburgh,
with supplementary notes from the spirit collection. Argent & Ratter SAN 108235
(E). There is no evidence one way or the other that she studied the herbarium sheet of
Argent & Ratter SAN 108235 (E). Thus, the name can be validly published here, as
follows:
Boesenbergia aurantiaca, valid publication
99
Boesenbergia aurantiaca R.M.Sm., sp. nov., floribus aurantiacis et habitu caespitoso
B. ornatae similis sed foliis fusco-viridibus et pallide luteo-viridibiis et ligula multo
breviore distincta. R,M. Smith (in Notes Roy. Bot. Gard. Edinburgh 44: 226-227, t.
4. 1987).
TYPUS: Anon. (R.M. Smith?) s.n., barcode no. e00149734, excluding dissected flower
of Argent, Ratter, Leopold, Dongop & Kumin SAN 108235 in capsule, RBGE living
collection, Aug 1 985, taken from a living plant originally collected in Malaysia, Sabah,
Lahad Datu District, Ulu Sg. Segama, Danum Valley Research Centre and grown at
RBGE under accession number 19850847 (holo E).
Erect herb. Leafy shoots cespitose, leaves 4-5. Leaves with petioles 2-8 cm long;
lamina 5-12 x 3-5 cm, elliptic, apex shortly acuminate, glabrous, tawny green,
brightly greenish yellowish variegated along the midrib; ligule 3-5 mm long, bilobed;
sheaths glabrous. Inflorescence terminal on the leafy shoot, more or less sessile, many-
flowered; bracts distichous, to 5 x 0.5 cm, cymbiform, glabrous, single-flowered;
bracteoles smaller than the bracts; flowers orange; calyx 5-6 mm long, 2-3-lobed;
corolla tube to 7 cm long (shorter in cultivated plants), lobes 1.5-1. 8 cm long, the
dorsal one broader; labellum c. 2 x 2 cm, saccate, more or less entire; lateral staminodes
1.3-1. 5 X 0.4-0.6 cm, spathulate. Stamen to 1.5 cm long; filament c. 1 cm long; anther
thecae c. 0.5 cm, parallel, dehiscing by slits, connective prolonged into a 1 mm long
crest; style glabrous; stigma glabrous. Epigynous glands 2-3 mm long, linear. Ovary
2-3 mm, trilocular with axile placentation. Capsule unknown.
Other specimens seem MALAYSIA. Sabah. Lahad Datu District, Ulu Sg. Segama, Danum
Valley Research Centre, 25 Feb 1985, Argent, Ratter, Leopold, Dongop & Kumin SAN 108235
(E, including spirit collection, SAN); ibid., East trail El, damp dipterocarp forest, 13 Oct 1985,
Still SAN 112115 {L).
Ecology. Deep shade in lowland mixed dipterocarp forest, at 100^00 m alt.
Notes: Two herbarium specimens have been made from the surviving RBGE living
accession, number 19850843, namely Ngamriabsakul 29 (E) and Newman &
Skornickovd 1471 (E). Images of all Zingiberaceae specimens housed at E may be
seen at the herbarium database of the RBGE, http://ehner.rbge.org.uk/bgbase/vherb/
bgbasevherb.php. Smith’s Latin description of this species has not been translated into
English. Since Latin is less widely read than formerly, a translation into English is
given (above).
ACKNOWLEDGEMENTS. 1 am grateful to D.J. Middleton (E) for useful advice on what
constitutes a valid description and for pennission to reprint the Latin diagnosis of Boesenbergia
aurantiaca from the Notes RBG Edinburgh 44: 226 (1987), and to J. Pereira (SAN) for locating
Argent et al. SAN 108235 at SAN and for sending me a photograph of it. The improvements
suggested by the reviewers, J. McNeill (E) and J. Leong-Skoraickova (SING), are also
gratefully acknowledged.
100
Gard. Bull. Singapore 65(1) 2013
References
McNeill, J., Barrie, F.R., Burdet, H.M., Demoulin, V., Hawksworth, D.L., Marhold, K.,
Nicolson, D.H., Prado, J., Silva, PC., Skog, J.E., Wiersema, J.H. & Turland, NJ. (eds)
(2006) International Code of Botanical Nomenclature (Vienna Code) adopted by the
Seventeenth International Botanical Congress, Vienna, Austria, July 2005. Ruggell:
A.R.G. Gantner Verlag KG [Regnum Veg. vol. 146].
Smith, R.M. (1987) A review of Bornean Zingiberaeeae: III (Hedyehieae). Notes Roy. Bot.
Gard. Edinburgh 44: 203-232.
Gardens’ Bulletin Singapore 65(1): 101-105. 2013
101
Aspidistra jiewhoei (Asparagaceae),
a new species from north Vietnam
Hans-Juergen Tillich* and Jana Leong-Skomickova^
*Ludwig-Maximilians-University, Systematic Botany,
Menzinger Str. 67, D-80638 Munich, Germany
^The Herbarium, Singapore Botanic Gardens,
1 Cluny Road, 259569 Singapore
ABSTRACT. An unusual new species of Aspidistra Ker Gawl. (Asparagaceae: Nolinoideae)
from north Vietnam, A. jiewhoei Tillich & Skomick. is described and illustrated here.
Keywords. Asparagaceae, Aspidistra, Nolinoideae, Vietnam
Introduction
The genus Aspidistra Ker Gawl. (Asparagaceae: Nolinoideae) is distributed from
Assam (India) in the west to southern Japan in the east, and from Central China
southwards to the Malay Peninsula, but the centre of diversity is SE China (Guangxi
Province) and adjacent northern Vietnam (Tillich 2005). During the past three decades
the number of known species has increased considerably from 1 1 in 1980 to more than
100 (Tillich & Averyanov 2012), with many novelties reported in last decade from
Vietnam (Bogner & Amautov 2004; Brauchler & Ngoc 2005; Tillich 2005, 2006;
Tillich et al. 2007; Tillich & Averyanov 2008, 2012; Averyanov & Tillich 2012, in
press). The total number of known species in Vietnam is currently 37, but as most of
the Aspidistra species seem to be stenoendemic, it is expected that with continuing
floristic explorations its numbers will grow progressively.
The first author has been extensively involved with taxonomy of the genus
Aspidistra, and provided a comprehensive key to the genus covering 93 species (Tillich
2008). So when an unidentified Aspidistra species flowered in the living collections
of Singapore Botanic Gardens it was brought to his attention by the second author. It
was clear that this unusual species endowed by several unique morphological features
represents a new species and is here described below.
hi line with the collecting practices as outlined by Tillich (2005), the spirit
conserved flower is part of the type specimen as well as colour photo documentation
of important characters including the flower dissection.
102
Gard. Bull. Singapore 65(1) 2013
Aspidistra jiewhoei Tillich & Skomick., sp. nov.
Similar to A. lateralis Tillich, but differs by its stamens overtopping the stigma
surface, the pistil closely attached to the perigone wall, and the growth form with
upright shoots, bearing the flowers on short peduncles in lateral position and clearly
above ground level.
TYPE: Jana Leong-Skornickovd JLS-1871, Cultivated in the Singapore Botanic
Gardens (SBG Acc. No. 20122069), 5 Dec 2012 (holo SING, including flowers in the
liquid collection; iso M, HN, both including flowers in the liquid collection). Originally
from Northern Vietnam, Tuyen Quang Province, Na Hang District (collector unknown),
donated to Singapore Botanic Gardens by the Singapore Gardening Society. (Fig. 1 & 2.)
Rhizomatous herb up to 35 cm tall. Rhizome with very short intemodes, diameter
10-13 mm. Leaves crowded, cataphylls deep purple when young, up to 12.5 cm long.
Petiole 10-20 cm long, stout, stiff, ventrally with a furrow, deeper at apical part,
shallower towards the base, basal 5-12 mm swollen. Blade broadly ovate, slightly
unequal, 20-30 x 8.5-13 cm, apex acuminate, base rounded, matt dark green above
(nearly dark bluish green), light grey-green beneath with strongly protmding midvein
and well-visible dark green secondary veins, margin very minutely serrate, making the
margin somewhat sharp to touch, revolute. Peduncle up to 4.5 cm long, semi-erect at
first, later more or less horizontal or descending when the flower opens, its tip bent
downward, dark purple externally, with 3 hood-like, dark purple scales, 2 subtending
the flower and 1 along the scape. Perigone nodding, widely bowl-shaped, 14-15 mm
in diameter, with nearly flat, fleshy base, reddish purple to deep purple internally
and externally, except sometimes outer basal part lighter (cream-yellowish). Lobes 6
(sometimes 8), ovate-triangular, erect to slightly patent, upper surface smooth, in two
whorls of 3 (sometimes 4), outer lobes c. 6-7 x 8-9 mm, inner lobes c. 5-6 x 6-7 mm.
Stamens 6 (8 in flowers with 8 lobes), inserted at apical part of the tube, overtopping
stigma surface, anthers sessile, somewhat sunken in a circular bulge, anther thecae c.
1.3 mm long, bean shaped, separated by light green connective tissue, pollen bright
yellow. Pistil depressed obconical, c. 3 mm high, outer (lower) surface closely attached
to perigone wall. Stigma circular, 5-6 mm in diameter, cream-coloured in the slightly
convex centre, margin and lower part tinged with purple red to deep purple, the margin
with small lobes. Fruit unknown.
Etymology’. We name this species in honour of Mr, Tan Jiew Hoe, president of Singapore
Gardening Society, for his continuous support of botanical and horticultural research
in Singapore as well as in other parts of Asia, particularly in Laos and Vietnam. It was
him who first brought this unusual plant to our attention and donated several individuals
to the research collections of Singapore Botanic Gardens, where it flowered.
Notes. This species can be readily recognised by stamens overtopping the stigma
surface and the obconical pistil, which, by its outer (lower) surface, is closely attached
to the perigone wall, lacking any space in between (Fig. 2 A, D, F). The latter feature
is so far unique in the genus. The flowers are superficially similar to A. lateralis Tillich
New Aspidistra from Vietnam
103
Fig. 1. Vegetative characters of Aspidistra jiewhoei. A. Leaf surface (abaxial) with well-visible
dark green veins. B. Habit. C. Leaf surface (adaxial). D. Basal part of the plant showing young
purple cataphyls. E. Base of the leaf blade. F. Swollen base of petioles. (Photos: J. Leong-
Skornickova)
104
Gard. Bull. Singapore 65(1) 2013
Fig. 2. Floral characters of Aspidistra jiewhoei. A. Dissection of the flower & detail of the
basal part of the flower (scale in min). B. Trimerie flower (front view; eultivated in deep shade
condition). C. Trimerie flower (side view; cultivated in deep shade eondition). D. Tetrameric
flower with 8 lobes and 8 anthers (front view; eultivated in deep shade condition). E. Trimerie
flower (side view; eultivated in semi-shade condition). F. Trimerie flower (front view; eultivated
in semi-shade condition). (Photos: J. Leong-Skomickova)
New Aspidistra from Vietnam
105
from Tlura Thien-Hue Province, but in that species the stamens are below stigma
level, and it differs clearly by its remarkable growth form with upright shoots, bearing
the flowers on short peduncles in lateral position clearly above ground level.
It has been observed that trimeric (6 lobes, 6 stamens) as well as tetrameric
flowers (8 lobes, 8 stamens) are produced on a single plant. This phenomenon has been
reported in Aspidistra before, e.g. A. lateralis Tillich, A. guangxiensis S.Tang & Y.Liu,
and^. leshanensis K.Y.Lang & Z.YZhou. It is also noticeable that plants cultivated in
deep shade produced slightly smaller flowers on longer peduncles, which were darker
in colour (Fig. 2 B-D), compared to the plants cultivated under semi-shade conditions,
which produced larger, overall slightly more robust flowers, with lighter coloration
(Fig. 2A&E-F).
ACKNOWLEDGEMENTS. The research of the second author is funded by the National Parks
Board, Singapore and the Czech Science Foundation, GACR (grant nos. 521/09/0202 and
P506/10/0623).
References
Averyanov, L.V. & Tillich, H.-J. (2012) New taxa of Aspidistra (Asparagaceae) from Central
Vietnam. Turczaninowia 15: 5-10.
Averyanov, L.V. & Tillich, FI.-J. (in press) Aspidistra truongii - a new species of Asparagaceae
(Con vail ariaceae s.str.) from Southern Vietnam. Taiwania 59.
Bogner, J. & Arnautov, N.N. (2004) Aspidistra locii (Convallariaceae), an unusual, new species
from Vietnam. Willdenowia 34: 203-208.
Brauchler, C. & Ngoc, L.H. (2005) Aspidistra renatae (Ruscaceae) - A new species from
Central Vietnam. Blumea 50: 527-529.
Tillich, H.-J. (2005) A key fox Aspidistra (Ruscaceae), including 15 new species from Vietnam.
Feddes Repert. 1 1 6 (5—6): 3 1 3-338.
Tillich, H.-J. (2006) Four new species of Aspidistra (Ruscaceae) from China, Vietnam, and
Japm. Feddes Repert. 117: 139-145.
Tillich. H.-J. (2008) Ai updated and unproved detennination key for Aspidistra Ker-Gawl.
(Ruscaceae, Monocotyledons). Feddes Repert. 119: 449-462.
Tillich. H.-J. & Averyanov, L.V. (2008) Two new species and one new subspecies of Aspidistra
Ker-Gawl. (Ruscaceae) from Vietnam. Feddes Repert. 119: 37^1.
Tillich. H.-J. & Averyanov, L.V (2012) Four new species of Aspidistra Ker-Gawl.
(Asparagaceae) from China and Vietnam with a comment on A. longifolia Hook.f and
A. hainanensis W.YChun & F.C.How. Gard. Bull. Singapore 64(1): 201-209.
Tillich, H.-J., Averyanov, L.V & Dzu, N.V (2007) Six new species of Aspidistra (Ruscaceae)
from northern Vietnam. Blumea 52: 335-344.
Gardens’ Bulletin Singapore 65(1): 107-114. 2013
107
Rubovietnamia sericantha (Rubiaceae: Gardenieae),
a new combination
and notes on the genus in China
Y.H. Tong" W.B. Xu^, Y.F. Deng", K.M. Wong^ and N.H, Xia"
^Key Laboratory of Plant Resources Conservation & Sustainable Utilization,
South China Botanical Garden, Chinese Academy of Sciences,
Guangzhou, 510650, People’s Republic of China
-University of Chinese Academy of Sciences,
Beijing 100049, People’s Republic of China
^Guangxi Institute of Botany, Guangxi Zhuang Autonomous Region
& Chinese Academy of Sciences, Guilin, 54 1 006 Guangxi,
People’s Republic of China
"^Singapore Botanic Gardens, 1 Chmy Road, Singapore 259569
ABSTRACT. Porterandia sericantha, originally published as Randia sericantha, is re-
combined as Rubovietnamia sericantha. Because of its earlier published specific epithet, it is
the coiTect name for the generic type, Rubovietnamia aristata. Rubovietnamia consists of two
species distributed in S W China and N Vietnam.
Keywords. China, new combination, nomenclature, Porterandia, taxonomy, Vietnam
Introduction
Porterandia Ridl. (1940: 593), a small genus of the Gardenieae in Rubiaceae, consists
of about twenty species distributed in Peninsular Thailand, west Malaysia and
Sulawesi with the centre of diversity in Borneo (Puff et al. 2005, Zahid & Wong 2010).
It is characterised by distinctly sheathing stipules, a densely bristly corolla tube outer
surface, absence of (or at most minute) hairs on the inner surface of the corolla-tube,
and included anthers and style (Zahid & Wong 2010).
Porterandia sericantha (W.C.Chen) W.C.Chen (1999: 384) is the only species
ascribed to the genus in Clfina. It was origmally described as Randia sericantha W.C.Chen
(1987: 298) based on collections irom the Guangxi and Yunnan provinces, SW Clfina (Tig.
1). Zahid & Wong (2010) pointed out that it is quite different from typical Porterandia in
having the stipules just slightly fused at the base and not fomfing a distinct tubular sheath,
a sparsely hairy corolla tube outer surface, long flexuous hairs on the inner surface of
the corolla tube, and exerted anthers and style. They (Zahid & Wong 2010) excluded this
species fi'om Porterandia, but did not place it into any genus. In fact, these characters of the
species conform well io Rubovietnamia Tirveng. (Tirvengadum 1998: 166).
108
Gard. Bull. Singapore 65(1) 2013
Rubovietnamia
The genus Rubovietnamia was established with the sole species R. aristata Tirveng.
(Tirveiigadum 1998: 167) based on collections from northern Vietnam. Later, R.
aristata was also reported from Yunnan and Guangxi, China (Zhang et al. 2007).
The genus differs from Vidalasia Tirveng. in having typically 2-8-flowered cymes
(sometimes reduced to single flower), subentire stipuliform bracts and bracteoles, and
2-4 ovules and seeds (Tirvengadum 1998, Zhang et al. 2007, Chen & Taylor 2011).
Vidalasia has many-flowered compound cymes, erose-setose stipules and bracts, and
numerous ovules and seeds, Mou & Zhang (2010) suggested a sister relationship
between Rubovietnamia and Dupeirea Pierre ex Pitard (1924: 334) based on combined
sequences of two chloroplast markers, but they were unable to test the relationship
between Rubovietnamia and Vidalasia, implied by Tirvengadum (1998) as close.
In China, the distribution recorded for Porterandia sericantha overlaps with
Rubovietnamia aristata, sharing a similar habitat. Also, these two species are very
difficult to distinguish by the illustrations provided by Chen (1987, 1999) and
Tirvengadum (1998), respectively. Chen (1987, 1999) included a line illustration for
the species, which incorrectly depicts an unequally bi-lobed stigma. After examining
the type material, it was found that the stigma is club-like, grooved, with 2 equal lobes
initially cohered together (Fig. 1). Zhang et al. (2007) had studied and noted specimen
material identified by Tiiwengadum when they reported R. aristata in China. We have
checked an image of the type of R. aristata, and have examined all specimens cited by
Zhang et al. These and Porterandia sericantha in Chinese herbaria represent the same
species. At the specific rank, the epithet ''sericantha'' has priority over "aristata", so
that the new combination, Rubovietnamia sericantha, is necessary (see below).
Mou & Zhang (2010) described a second species, Rubovietnamia nonggangensis
F.J.Mou & D.X.Zhang (2010: 123), from Guangxi, China. It differs from R. aristata
Tirveng, in having much broader foliaceous calyx lobes, and the leaves, young branches
and flowers (including pedicels, ovary, styles and calyx) densely covered with hairs.
Rubovietnamia sericantha (W.C.Chen) Y.F.Deng, Y.H.Tong, W.B.Xu & N.H.Xia,
comb. nov. Basionym: Randia sericantha W.C.Chen, Guihaia 7: 298 (1987). -
Porterandia sericantha (W.C.Chen) W.C.Chen, FI. Reipubl. Popularis Sin. 71(1): 384
(1999); FI, Yunnan. 15:192 (2003); Chen & Taylor, FI. China 19: 292 (2011), TYPE:
China, Yunnan, Xichou Xian, Xinjie, 1200 m, 10 June 1964, Wang 903 (holo KUN;
iso KUN). (Fig. 2)
Rubovietnamia aristata Tirveng., Biogeographica 74: 167 (1988); Zhang et ah, Acta
Phytotax. Sin. 45: 91 (2007); Chen & Taylor, FI. China 19: 320 (2011); synon. nov.
TYPE: Vietnam, Hoa Binh, Paco, Mai Cheu, 19 November 1997, Bastien & Doa 22bis
(holo P; iso HN).
Shrubs or small trees, 1-6 m tall. Bark covered with variously shaped lenticels.
Young branches eompressed to terete, glabrous or moderately to densely ferruginous
Rubovietnamia in China
109
rfi m wjW\- 'iJ?
* m At _ 5 ^ '
;iiusn!!ijt C- rJ ^
ST'-iSt Jii!®; '-•■ ' ^ '- F
.-i-.ja= ' ' '
* 1219581 *
»*»»’*'*, ,
232. R’.ibiaceae 1 TlflilS t
Randia sericantha Vf.C. Chen (lb87)
("ypua! ! )
A: ".'AiTfe .
Fig. 1. Holotype of Rubovietnamia sericantha. Courtesy of the herbarium of the Kunming
Institute of Botany, Chinese Aeademy of Sciences (KUN).
no
Gard. Bull. Singapore 65(1) 2013
Fig. 2. Rubovietnamia sericantha. A. Flowering branch. B. Portion of stem showing stipules.
C. Flower with calyx and corolla. D. Calyx slit and spread out. E. Corolla slit and spread out.
F. Stamen. G. Ovary and style. H. Fruiting branch. A-G from Wang 903 (KUN), H from Ching
6401 (IB SC). (Drawn by Wang Ling.)
Rubovietnamia in China
111
hirtellous. Stipules ovate to triangular, 5-7 mm, chartaceous, moderately to densely
strigillose to hirtellous or glabrous, temiinating with two minute interpetiolar limbs.
Leaves opposite; petiole 3-15 mm, moderately to densely pilosulous or hirtellous to
glabrescent; leaf blade elliptic, oblanceolate, oblong or obovate, 4-18 x 1.5-5 cm,
drying papery, adaxially sparsely strigillose to subglabrous, abaxially sparsely to
densely pilosulous or hirtellous, base cuneate to obtuse, margin entire, apex acute
to usually short-acuminate, often appearing aristate; lateral veins 7-14 pairs, with
pilosulous domatia in abaxial axils, abaxially inconspicuous, adaxially prominent.
Inflorescences cymose, 2-5.5 x 3-5 cm, (l-)3-5-flowered, basically terminal but
occupying a pseudo -axillary position because of sympodial growth; peduncle (0-)l-5
mm, densely pilosulous to hirtellous; bracts triangular, lanceolate or stipulifonn, 2.5-
3 mm long, apex acute to acuminate. Flowers with pedicels 0.5-1. 7 cm; bracteoles
minute, 1-2 mm long, hirtellous; calyx tube campanulate, 0.7-1 cm long, densely
pilosulous and/or strigose, lobes 5, valvate in buds, ovate-oblong, 5-7 mm long, apex
acute, with the central nerve dorsally ending into an arista, margin ciliate; corolla
white, outside densely yellow sericeous, tube cylindrical, 2-2.2 cm long, inside
glabrous except with a villous ring at middle, lobes 5, ovate to elliptic, 1-1.2 x 0.5-0. 6
cm; stamens 5, inserted near the throat, exerted, filaments absent or inconspicuous,
anthers linear, adnate, dorsifixed, 3-5 mm long, apex acute; ovai*y hirtellous, 1 -locular,
ovules 4; style subcylindrical, c. 2.5 cm long, hirsute; stigma bifid, 2-3 mm long,
striate. Fruit a beny, subglobose, 1-1.7 cm in diam., pilosulous to strigillose; seeds
about 4, ovoid or subglobose, 4-7 mm across.
Distribution. The species is distributed in N Vietnam and SW China (Guangxi and
Yunnan) (Fig. 3).
Ecology. Rubovietnamia sericantha grows in forests or thickets at streamside in
valleys, and also on slopes of limestone hills at elevations of 200-1500 m. It was
observed flowering from May to June and fruiting from July to October.
Additional specimens examined: CHINA. Guangxi. Baise Shi, Youjiang Qu, Daleng Xiang,
Longhe Cun, 8 Jun 1977, Huang 3-22060 (GXMI), 10 Jun 1984, Chen 37019 (GXMI); Daxin
Xian, Taocheng Zhen, Baoyuan, 13 May 1981, Chen & Ling 34194 (GXMI); Debao Xian,
Longguang Xiang, 700 m, 14 Jan 1956, Expedition to Baise 1904 (IBK, IBSC, KUN), Du’an
Xiang, Fushan Cun, 14 Jul 1977, Expedition to Debao 3-0466065 (GXMI, IBSC), Yandong
Xiang, Qinjia Cun, 24 May 1977, Expedition to Debao 3-47363 (GXMI, IBSC), Chengguan
Zhen, Hanlong Cun, 31 May 1977, Expedition to Debao 3-47384 (GXMI); Hechi Shi, 12 Jul
1928, Clung 6401 (IBSC), Jingchengjiang Qu, Baitu Xiang, Deming Cun, Jiliao, 2 Aug 1977,
Lan 4-4-156 (GXMI); Huanjiang Xian, Muhin Xiang, Leyi to Donglai, 2 1 Oct \99\, Botanical
Expedition to Yunnan, Guizhou & Guangxi 70060 (IBK, KUN), Donglai, 520 ni, 18 Apr 2012,
Xu, Peng & Hu ML 105 3 (IBK), Baidan Tun, Tantou, 270 m, 25 Apr 2012, Jiang, Yang & Mo
11591 (IBK), Daan Xiang, Dingxin Cun, Xiagang, 16 Aug 1977, Expedition to Huanjiang
4-3-322 (GXMI), Dongxing Zhen, Duya Cun, Caiken, 14 Aug 1977, Expedition to Huanjiang
4-3-755 (GXMI); Jingxi Xian, Renzhuang Xiang, Bangliang Cun, 750 m, 10 Sep 2006, Liu &
Xu 8 (IBK), near Laolangdong, 590 m, 8 Sep 2010, Huang & Pan LYJX0021 (IBK), Yuexu
Zhen, Daxing Cun, 850 m, Xu & Liang B0069 (IBK), Hurun Xiang, Dongpai Cun, 690 m, 20
112
Gard. Bull. Singapore 65(1) 2013
Sep 2010, Huang & Wu LYJX0574 (IBK), Sanhe Xiang, Gelu Cun, 840 m, 15 Sep 2010, Huang
& Wu LYJX0361 (IBK), Nanpo Xiang, Biding Cun, Baling Tun, 890 m, 25 Sep 2010, Huang &
Wu LYJX0696 (IBK), Dizhai, 850 m, 21 Dec 1958, Chang 15116 (IBK, IBSC), Wuping Xiang,
Yixing Cun, 20 Dec 1958, Chang 14820 (IBK, IBSC), Biaolin Xiang, Tongde, Laohuaidashan,
24 Aug 1935, Ko 55605 (IBK, IBSC), Tanggang to Dean, 3 Nov 1956, Li POOS 15 (IBK, IBSC),
Tanggang to Anzhen, roadside, on slope, 3 Nov 1956, Li 3472 (IBSC), Dizhou Xiang, Fuliu
Cun, 26 Jul 1977, Lin 21602 (GXMI); Long’an Xian, Pingshan Xiang, 18 May 2005, Shui,
Chen & Zhang B2005-3 11 (KUN, PE), 18 May 2005, Shui, Chen & Zhang B2005-325 (KUN,
PE); Longzhou Xian, Jinlong Zhen, Banbi, 9 Jun 1965, Fang & Liang 21602 (GXMI), 350
m, 14 Apr 2010, Xu & Pan 10067 (IBK), 6 Jun 1977, Expedition to Longzhou 2-007 (GXMI),
Longdao, 320 m, 23 Jul 2009, Huang, Ye & Li H09620 (IBK), Shashu, 4 May 1956, Li 282
(IBK, IBSC), Nonggang, 230 m, 16 Jul 2009, Huang, Wu & Chen H09099 (IBK), 240 m.
Expedition to Guangxi 2016 (IBK), 300 m, 7 Oct 2010, Xu & Wu LZ113 (IBK), 600 m, 10 Jul
2010, Xu & Wu 10544 (IBK), Qinglongshan, 160 m, 11 Aug 2008, Expedition to Guangxi 2570
(IBK), Sanlian Xiang, 290-370 m. Expedition to Guangxi 3755 (IBK), 370 m, 16 May 2009,
Huang H09473 (IBK), Xiadong Xiang, Nahua Cun, Longqin, 350 m, 15 Oct 2008, Expedition
to Guangxi 3955 (IBK), Xiangshui Xiang, Siqing Dadui, Longshui, 16 Jun 1979, Expedition
of Longzhou Institute of Medicine 0358 (GXMI), Zhupu Xiang, 200 m, 13 Oct 2008, Liang
et al. 8268 (IBK), 21 Sep 1935, Guangxi Museum 60 (IBSC), Shuikou Xiang, Shishan, 16
Sep 1958, Chang 12089 (IBSC), Paizong Xiang, Bagouniu, 380-650 m, 24 Aug 1957, Chen
13952 (IBK, IBSC); Luocheng Xian, Qiaoshan Xiang, Qiaoben Cun, Lading, 26 May 1977,
Expedition to Luocheng 4-1-1233 (GXMI), Huaiqun Zhen, Zhenxin Cun, Changdong, 29 May
1977, Expedition to Luocheng 4-1-1563 (GXMI), Tianhe Zhen, Beijiang Cun, 21 Jun 1977,
Rubovietnamia in China
113
Expedition to Luocheng 4-1-1777 (GXMl); Nandan Xian, Baxu Xiang, Li’ao Cun, Jiuxu, 28
Sep 1977, Expedition to Nandan 4-5-828 (GXMl); Napo Xian, Baidu Xiang, Nongbu Cun,
1200 m, 20 May 198, S’ China Expedition 845 (IBSC), 18 Oct 1977, Fang 3-1529 (GXMl),
Nonghua Cun, Nonghua, 950 m, 20 Jim 1982, Fang, Lai & Wang 25150 (GXMl), Nonglong
Cun, 4 Jul 2012, Tong & Bai 12070419 (IBSC), Delong Xiang, 21 May 1959, Liang 3094
(GXMl), Pingnieng Zhen, 16 Oct 1997, Sino-Japanese Botanical Expedition to Ytmnan &
Guangxi of China 1114 (IBK, KUN), Lengzhong Xiang, Longxu, 900 m, 3 Dec 1956, Li 3472
(IBK, IBSC), Baihe Xiang, Shanglong Cun, 27 Oct 1977, Fang 3-1573 (GXMl); Ningming
Xian, Longrui, 250 m, 29 Apr 1980, Expedition to Nonggang 11897 (IBK), 300 m, 25 May
2008, Expedition to Guangxi 1181 (IBK), 110-280 m, 13 Oct 2008, Expedition to Guangxi
3861 (IBK); Yizhou Shi, Lali Xiang, Baowei Cun, Machao, Chen & Sha 55953 (GXMl),
15 May 1991, Rao 55846 (GXMl), Desheng Zhen, Xmhui Cun, 29 Sep 1977, Expedition to
Yishan 4-2-1-266 (GXMl), Qianhe Cun, 2 Oct 1977, Expedition to Yishan 4-2-1-506 (GXMl),
Yunnan. Hekou Xian, Nanxi Zhen, Luyingqing, 700-950 m, 21 Oct 2001, Shiii et al 15160
(KUN), Yaoshan Xiang, Dudian Cim, Baiquanchong, 760 m, 27 Oct 1954, Feng 5185 (KUN);
Maguan Xian, Gulinqing Xiang, Laofangzi, 103”57’53”E 22M6’49”N, 1400 m, 16 Oct 2002,
Shui, Chen & Sheng 31547 (KUN, PE); Malipo Xian, Babu Xiang, Yunling Cun, Huangjinyin,
28 Nov 1964, unknown coll. 9944 (KUN), 1100 m, 20 Jan 1940, Wang 86267 (IBSC, KUN),
28 Nov 1964, Wu 9944 (KUN), 1030 m, 28 Nov 1964, Lin 658 (KUN), in 1947, Feng 13166
(KUN), 1100-1400 in, 15 Nov 1947, Feng 13259 (IBSC, KUN), 20 Aug 2012, Tong & Bai
12082012 (IBSC), Ganhe Xiang, 1100 m, 11 Nov 1951, Mao 645 (HITBC, KUN), Tiechang
Xiang, Guangao, 1000 m, 14 Feb 1940, Wang 86806 (IBSC, KUN), Xiantian, 24 Nov 1963,
Liu et al 101861 (KUN), 1000 m, 3 Jan 1940, Wang 86133 (IBK, IBSC, KUN), Dongding
Cun, 1000-1100 m, 18 Nov 1947, Feng 13364 (IBSC, KUN), 1000 m, 4 Jan 1940, Wang
86193 (IBSC, KUN), Xiajinchang, near Jiangjia Tun, 1210 m, 3 Oct 2003, Shui, Chen & Sheng
21642 (IBSC, KUN, PE), 1210 m, 3 Oct 2003, Shui, Chen & Sheng 32727 (KUN, PE), Majie
Xiang, 1300-1500 m, 14 Oct 1947, Feng 12484 (IBSC, KUN); Xichou Xian, Dongnia Xiang,
Guoditang, Dadi, 1350 m, 11 Jun 1991, Shui B91-140 (KUN), Cha-ban, 1000 m, 27 Dec 1939,
Wang 86093 (IBSC, KUN).
VIETNAM. Cao Bang. Trung Khanh District, Ngoc Khe Municipality, Pac Nga village,
22°54’59”N 106^3 U44”E, 700-750 m, 10 Jun 2004, Averyanov, Loc, The & Vinh 5529 (MO,
P). Ha Giang. Quan Ba District, Pass between Ha Giang and Quan Ba, 4-5 km outside Quan
Ba, 23‘’06’03”N 105‘’01’20”E, 11 Jul 2002, van der Werff Dao, Gray & Doan 17282 (MO, P),
17286 (MO, P).
ACKNOWLEDGEMENTS. We thank the curators of the herbaria GXMl, HITBC, IBK, IBSC,
KUN, MO, P and PE for their help with specimens for our studies. We are grateful to Dr.
Tirvengadum (P) for providing his publication on Rubovietnamia for reference, Ms. Wang
Ling who prepared the line drawing, and Dr. Yu Shengxiang (PE) for his help in preparing the
distribution map.
References
Chen, T. & Taylor, C.M. (2011) Porterandia and Rubovietnamia. In: Wu, Z.Y., Raven, P.H. &
Hong, D.Y. (eds) Flora of China 19. Pp. 291-292, 319-320. Beijing: Science Press; St.
Louis: Missouri Botanical Garden Press.
114
Gard. Bull. Singapore 65(1) 2013
Chen, W.C. (1987) Materials for Rubiaceae. Guihaia 7(4): 297-300.
Chen, W.C. (1999) Porterandia. In: Lo, H.S. (ed) Flora Reipublicae Popularis Sinicae 71(1).
Pp. 384-386. Beijing: Science Press., (in Chinese).
Ridley, H.N. (1940) Notes on some Malayan Rubiaceae. Bull Misc. Inform. Kew 1939: 593-
613.
Mou, F.J. & Zhang, D.X. (2010) Rubovietnamia nonggangensis (Rubiaceae), a new species
from China. Bot. Stud. 51:119-126.
Persson, C. (1996) Phylogeny of the Gardenieae (Rubiaceae). Bot. J. Linn. Soc. 121: 91-109.
Pitard-Briau, C.J.M. (1924) Rubiacees. In: Lecomte, P.H. (ed) Flore Generale de FIndo-Chine
3. Pp. 20—442. Masson, Paris.
Puff, C., Chayamarit, K. & Chamchumroon, V. (2005) Rubiaceae of Thailand — A Pictorial
Guide to Indigenous and Cultivated Genera. Bangkok: The Forest Flerbarium, National
Park, Wildlife & Plant Conservation Department.
Robbrecht, E. & Puff, C. (1986) A sui*vey of the Gardenieae and related tribes (Rubiaceae). Bot.
Jahrb. Syst. 108: 63-137.
Tirvengadum, D.D. (1998) Novelties in Rubiaceae from the limestone flora of Southeast Asia.
Biogeographica 74(4): 163-175.
Zahid, M.S. & Wong, K.M. (2010) The circumscription, taxonomy and biogeography of
Porterandia (Rubiaceae-Gardenieae). Edinburgh J. Bot. 67: 265—342.
Zhang, M.D., Chen, W.H. & Shui, Y.M. (2007). Miscellaneous notes on the tribe Gardenieae
(Rubiaceae) from China and Vietnam. Acta Phytotax. Sin. 45: 90-93.
Gardens’ Bulletin Singapore 65(1): 115-116. 2013
115
Additions to The Plant Taxa of H.N. Ridley, 4.
The Primitive Angiosperms (Austrobaileyales, Canellales,
Chloranthales, Laurales, Magnoliales, Nymphaeales and
Piperales)
I.M. Turner
Research Associate, Royal Botanic Gardens Kew
Research Associate, Singapore Botanic Gardens
Correspondence address:
Fairfield, Pett Level Road, Winchelsea Beach, East Sussex TN36 4ND, U.K.
ABSTRACT. Three taxa omitted from an earlier compilation are listed here. They represent
names authored by Henry Ridley for varieties in the Annonaceae. One name is lectotypified.
Keywords. Amionaceae, lectotype, Ridley
Introduction
In an oversight, three names (all at varietal rank in the Annonaceae) were omitted
from a recent compilation of Henry Ridley’s primitive angiospenn taxa (Turner 2012).
These three taxa are listed here in the same style as the original paper.
MAGNOLIALES
Annonaceae
1. Oxymitra fornicata Hook.f. & Thomson var. glabra Ridl., FI. Malay
Penins. 1 (1922) 80. SYNTYPES: Thailand, Pulau Adang, Ridley
15904 (lectotype, designated here, K; isolectotype SING). Peninsular
Malaysia, Penang, [Philipps] s.n. (K).
= Friesodielsia discolor (Craib) D.Das, Bull. Bot. Surv. India 5 (1963)
93. Oxymitra discolor Craib, Bull. Misc. Inform. Kew 1925 (1925)
11. Sinclair, Gard. Bull. Singapore 14 (1955) 457.
i. Alphonsea maingayi Hook.f. & Thomson var. elliptica (Hook.f.
& Thomson) Ridl., FI. Malay Penins. 1 (1922) 98. Basionym:
Alphonsea elliptica Hook.f. & Thomson, FI. Brit. India 1 (1872)
90.
116
Gard. Bull. Singapore 65(1) 2013
ii. Cyathostemma viridiflorum Griff, var. scortechinii (King) RidL, FI.
Malay Penins. 1 (1922) 27. Basionym: Cyathostemma scortechinii
King, J. Asiat. Soc. Bengal, Pt. 2, Nat. Hist. 61 (1892) 9.
= UvARiA GRiFFiTHii L.L.Zhou ct al., Syst. Biodivers. 7 (2009) 255.
References
Turner, I.M. (2012) The plant taxa of H.N. Ridley, 4: The primitive angiosperms
(Austrobaileyales, Canellales, Chloranthales, Laurales, Magnoliales, Nymphaeales and
Piperales). Gard. Bull. Singapore 64: 221-256.
Gardens’ Bulletin Singapore 65(1): 117-134. 2013
117
Nomenclatural notes on Eugenia reinwardtiana
(Myrtaceae) and more or less associated names
J.F. Veldkamp
National Herbarium of The Netherlands, Naturalis Biodiversity Center,
P.O. Box 9514, 2300 RA Leiden, The Netherlands
ABSTRACT. The nomenclatures of Calyptranthes ramiflora Blanco, Cmyophyllus cotinifolius
MiilQyEtigernabukobensis Engler,£’. codyensis Mumo ex Wight, A cotmifolia53.cc[.,E. elliptica
Lam., E. hypoleuca Thwaites ex Kosterm., E. phillyreoides Trimen, E. reinwardtiana DC., E.
roxburghii DC., E. salornonica C.T. White, Jossinia Comm, ex DC., Myrtiis caryophyllata L.,
M. cotini folio Plumier, M pinienta L., and Pimenta acris (Sw.) Kostel. (Myrtaceae), and more
or less associated names are outlined. Some typifications are made.
Keywords. Eugenia, Myrtaceae, Myrtus, nomenclature, Pimenta, Syzygium
Introduction
The generic delimitation of Eugenia L. against Syzygium J.Gaertn. (Myrtaceae) is
notoriously complicated but gradually, from various disciplines, a clearer concept is
evolving. For anatomy see, e.g., Ingle & Dadswell (1953) and Schmid (1972a, b, c),
and palynology (Pike 1956). Wilson et al. (2005), based on an analysis with matK,
found that they are in quite different clades: Eugenia was included in the Myrteae
(usually in the subtribe Eugeniinae O. Berg) and Syzygium in the new Syzygieae.
It must be noted, though, that of Eugenia only E. uniflora L. was included and for
Syzygium but 3 species. Similar results based on ITS and psbA-trnEl reported by
Lucas et al. (2005), where the genera again were in different clades. However, only
four Eugenia and two Syzygium species were included. Wilson restricted Syzygium
(over 500 spp.) to the Old World, and Eugenia (c. 550 spp.) to the New World, Pacific,
the Philippines, and Africa (2011: 245, 252). In the Philippines (Wilson 2009) there
would be 1 0 native species and an introduced one. He accepted two species for New
Guinea (Snow & Wilson 2010). The specialists apparently disagree, for according to
a recent revision by Ashton (A; in litt.) there would be only two Malesian species of
“true” Eugenia: E. craveniana N.Snow & Peter G. Wilson and E. reinwardtiana DC.
In the Pacific the related Eugenia salornonica C.T. White ranges from Mussau Isl. (St.
Matthias Group) and Bougainville to the Solomons. All other putative Eugenia would
belong to Syzygium.
An extract from the generic key by Wilson (2011: 227-228) compared to the
generic descriptions gives the following key, which clearly is polythetic:
118
Gard. Bull. Singapore 65(1) 2013
Young shoots and flowers often pubescent. Inflorescences usually axillary, uniflorous, rarely
dichasial or raceme-like and many-flowered . Cotyledons ftised. — Eugenia
Young shoots and flowers usually glabrous. Inflorescences usually temiinal (sometimes
rami- or cauliflorous), usually paniculate. Cotyledons free. — Syzygium
The nomenclatures of these and associated names are sometimes quite complicated
and their study led to various side paths. These admittedly rambling notes may be of
some interest and aid to myrtophiles.
Eugenia reinwardtiana (Blume) DC.
Eugenia reinwardtiana (Blume) DC., Prodr. 3: 267 (1828); Hyland, Austral. J. Bot.,
Suppl. 9: 28, t. 10 (1983). - Myrtiis reinwardtiana Blume, Bijdr. 17; 1082 (1826-
1827) (“1826”). -Jossinia reinwardtiana (Blume) Blume, Mus. Bot. 1: 120 (1850)
(“1849”); Merr., Arnold Arbor. 31: 329 (1950). -Jambosa maritima Miq., FI. Ned.
Indie 1: 435 (1855), nom. superfl. LECTOTYPE (designated here): Reinwardt s.n.
(L: sh, 898.203-352), Indonesia, Moluccas, Pulo Pombo.
Eugenia rariflora Benth. in Hook., London J. Bot. 2: 221 (1843); F. Br., Bull. Bernice
P. Bishop Mus. 130: 201 (1935). LECTOTYPE (designated by A.C. Smith 1985:
376): Barclay s.n., Fiji (K).
Eugenia carissoides F. Muell., Fragm. 3: 130 (1863). ). LECTOTYPE (designated by
Hyland 1983: Austral. J. Bot., Suppl. 9: 28): Fitzalan s.n., Australia, Queensland,
Port Denison (MEL 60221; iso MEL 60216).
Eugenia hypospodia F. Muell., Fragm. 5: 15 (1865). LECTOTYPE (designated by
Hyland 1983: 28): DaUachy s.n., Australia, Queensland, Rockingham Bay (MEL
60222).
Jossinia tahitensis Nadeaud, Enum. PI. Tahiti: 79 (1873). SYNTYPES: Not indicated
(P, PC, and perhaps elsewhere, e.g., BISH 1455102: 22 Oct 1857, Tahiti, Tiari,
“vallee de Haaripo et ailleurs”).
Eugenia rariflora Benth. ywc. parvifolia Hillebr., FI. Hawai IsL: 129 — Eugenia
waianensis O.Deg., FI. Hawaii. Fam. 273, illus. (15 Jul 1932), non Eugenia
parviflora DC. (1828). TYPE: Lydgate s.n., Hawaii, Oahu, northern slopes ofKaala
(holo B, lost).
Eugenia kangeanensis Valeton in Boerl., Icon. Bogor. 4: 107, t. 333 {“kangeensis”)
(1912); Men'. & L.M. Perry, Mem. Acad. Arts & Sci. 18; 140. = Mem. Gray
Herb. Harvard Univ. 4: 140 (1939), LECTOTYPE (designated here): Jaheri 518,
Indonesia, Moluccas, Kai Isl. (BO; 62, neg. 1 in L).
Eugenia costenoblei Merr,, Philipp. J. Sci. 9: 123 (1914) -Jossinia costenoblei (Merr.)
Diels, Bot. Jahrb. Syst. 56: 531 (1921). TYPE: Costenoble 1172, Guam, Hilaan
(holo US: sh. 653736, 653737).
Eugenia macrohila C.T. White & W.D.Francis, Proc. Roy. Soc. Queensland 35: 69
(1923). TYPE: W.D. Francis, s.n., Australia, Queensland, Mamior (holo BRI
212342; iso BRI 212343, 212344, MEL 60202).
Eugenia nomenclatural notes
119
Jossinia desmantha Diels, J. Arnold. Arbor. 10: 82 (1929). TYPE: Brass 881, Papua
New Guinea, Central Prov., Port Moresby (holo A).
Eugenia koolauensis O.Deg. var. glabra O.Deg., FI. Hawaii. Fam. Tl?> (10 Aug 1932).
TYPE : Degener & Bush 4194, Hawai’i, Oahu, 0.5 mile SE of Pohakea Pass (holo
BISH).
Distribution. Malesia: Java (Kangean IsL), Lesser Sunda Isl. (Flores), Borneo (Sabah,
Sarawak), Celebes? (fide cultivated tree in BO: Alston 17205, Rastini 61, both in L),
Moluccas (Ceram, Halmahera, Kai Isl., Pulau Pombo, Saparua), New Guinea (Am
Isl.; Central Prov., S and E of Port Moresby; curious that it is not more widespread);
Pacific: Austral Isl., Fiji, Gambier Isl., Guam, Hawaii, Henderson Isl,, Mariannes,
Marquesas Isl., Niue, Palau, Peleliu, Pitcairn, Rapa, Rarotonga, Samoa, Society IsL,
Tahiti, Tonga, Tmk, Vanuatu, Yap; Australia: coastal zone of Queensland and Torres
Strait Isl., N West Australia.
Habitat. On or near beaches, monsoon forests, deciduous vine thickets in Australia,
0-500 m alt.; dry forest slopes, occasionally inmesic forest, 180-730 m alt. in Hawaii;
on limestone in Guam.
Vernacular names. Beach cherry (Austr.), Cedar Bay Cherry (Austr.), Mountain topper
(Austr.).
Uses. The sweet fmit according to some has a better taste than cherries, “good bush
tucker”. Used in horticulture for decoration, a minor source of fmit, and for hedges.
Notes. Quite extensive discussions of this species are provided by Merrill (1950) and
Hyland (1983). Merrill discussed the delimitation of the genus Jossinia Comm, ex DC.
with an emphasis on J. reinwardtiana (Blume) Blume.
According to Hyland, the anatomy and vascularisation of the calyx tube
(hypanthium) of Eugenia reinwardtiana conforms with that of Eugenia s.s. as
elucidated by Schmid (1972a, b, c). A molecular analysis of mainly S African taxa by
Van der Merwe et al. (2005) placed it in a clade with species with eastern, i.e., Asian,
affinities. It was not in the clade with species fomierly attributed to Jossinia Comm,
ex DC.
Eugenia koolauensis var, glabra differs by being glabrous with the flowers
sometimes in two approximates pairs. The type was collected from a dying tree.
An anonymous reviewer of the present paper, perhaps echoing a remark by Diels
(1921: 531) suggested inclusion of Eugenia palumbis Mem Hosokawa (1940: 542)
and Stone (1970: 446, 448, t. 75, 76) regarded it as distinct. Thus:
Eugenia palumbis Mem., Philipp. J. Sci. 9: 122 (1914). - Jossinia palumbis (Mem.)
Diels, Bot. Jahrb. Syst. 56: 531 (1921). TYPE: Costenoble 1173, Guam, Tambun
(holo US 653738).
120
Gard. Bull. Singapore 65(1) 2013
According to another, referring to Hyland (1983), E. bryanii might be a synonym of
this, but Hosokawa (1940: 542) without comment, and Stone (1970: 447), tentatively
kept it as distinct:
Eugenia bryanii Kaneh., Botanical Magazine (Tokyo) 51: 913, f. 68 (1937). -Jossinia
bryanii (Kaneh.) Hosok., J. Jap. Bot. 16: 542. 1940. TYPE: Bryan 1229, Guam,
Achugas Point (holo FU).
Eugenia reinwardtiana (Blume) DC. forma lutea St. John
Eugenia reinwardtiana (Blume) DC. fomia lutea St. John, Phytologia 37: 441 (1977).
TYPE: St. John 14901, Polynesia, Gambier Islands, Mangareva, S side of Mt
Makoto (holo BISH; iso L).
St. John (1977) and Smith (1985) reported the fruits as being yellow to bright
orange to brownish, against red in the typical fomi. The latter did not mention the
palatability and said that there was no reliable local Fijian name. If the fruits are as
pleasant as reported elsewhere, this is remarkable and Fijian material should be studied
again to see whether it really belongs here. “It certainly does not look much like the
common form oiE. reinwardtiana that occurs in Australia.” (Snow in litt.).
Myrtus cotini folio Plumier
Plumier collected in the Caribbean between 1689 and 1697. Polhill & Steam (1976)
made the following observations. Plumier made over 1200 drawings (now in the
Bibliotheque Centrale, P), 508 of which were copied for Boerhaave in Leiden, the
“Codex boerhaavianus” (now in the Library of the University of Groningen, The
Netherlands). After Boerhaave’s death these were acquired by Johan Burman in
Amsterdam, who noted that Linnaeus together with Adriaan van Royen had assisted
Boerhaave in his study of the “Plumerian Codex” in the winter of 1737-1738 when
Linnaeus stayed at Van Royen’s place. Linnaeus made notes on it in an interleaved
copy of the Genera plantarum (now in LINN).
Plumier used the polynomial Myrtus cotini folio in 1703, while the plate and
descriptions were published by Bunnan in 1759. These references were not mentioned
by Linnaeus (Richter 1 840), possibly because he had no idea of the identity. Only as
late as 1771 did he accept the Eugenia cotinifolia of Jacquin (1768), see below.
Bumian’s combination was invalidly published as it was a phrase name;
therefore Steudel (1841) eiTed when he attributed “cotinifolia'' to him. The earliest
publication where a binomial was used was that by Aublet (1775), where in the index
to Latin names he cited Myrtus citrifolia for Myi^tus 4 on p. 513, which is Plumier ’s
Myr^tus cotini folio. The present identity is therefore with Myrcia citrifolia (Aubl.)
Urban.
Because all authors have relied on Plumier ’s plate and their combinations thus
are linked together by that, it seems the most logical choice to select it as the lectotype.
In some cases specimens are mentioned and the citation of Plumier is given in an
Eugenia nomenclatural notes
121
attempt to match the specimen-in-hand with existing literature. Obviously, especially
18th century authors had only a faint idea of the stupendous richness’s of tropical
floras, and their specimens may well be something quite different from what Plumier
depicted. To designate these possibly misidentified specimens (if they still exist,
and, if they have been re-identified, can be found) as epitypes would make several
combinations heterotypic and legitimate, and may have unforeseen destabilisation of
well-accepted names.
Vahl (Jul-Dec 1791) comQ&Myrtus coriacea, citing Swartz (1788), who is often
referred to as the validating author. However, the latter had Plumier ’s taxon as an
unnamed variety of his Myrtus acris Sw. (see for more under Pimenta acris, below)
and when he did use M. coriacea in 1798, he attributed it to Vahl. In the same period
Gmelin (late Sep-Nov 1791) was the first to make the combination AfyrtM.? cotinifolia.
As both names by lectotypification are later homotypic synonyms of Myrtus citrifolia
Aubl., it is rather unimportant to argue which had the priority over what. In the list
below I have arranged them alphabetically.
Poiret (1798) described a fragmentary specimen obtained by Lamarck from the
garden of “citoyen” Cels and thought he could identify that with the plants described
and depicted as Myrtus cotini folio Plumier (1703) or Myrtus foliis alternis ovatis
Plumier (1759), and Catyophyllus aromaticus indiae occidentalis, foliis & fructu
rotundis Plukenet (1696), and doubtfully with Myrtus caryophyllata Jacq. and Myrtus
acris Sw. However, as the Plumier plate is the lectotype of Myrtus cotinifolia Gniel.,
Poiret’s use of the identical combination makes it an isonym.
Steudel (1841) mentioned what he thought were three different uses of Myrtus
cotinifolia: by Burman, Poiret, and Sprengel (1825). Steudel accepted that by Butman,
which is an invalid name. Actually, unknown to him, Gmelin (1791) was the first to
validly make this combination. The ones by Gmelin and Poiret are wholly or partly
based on Plumier’s plate, so the combinations by Poiret and Steudel are isonyms of
that by Gmelin with no nomenclatural status. Sprengel by citing Eugenia Linnaeus
(i.e., 1771: 243) referred indirectly to Eugenia cotinifolia Jacq. (1768). It is therefore
a later homonym of Gmelin ’s name.
The coiTect combination seems to be as follows.
Myrcia citrifolia (Aubl.) Urb. in Fedde’s Repert. 16: 150 (1919). - [Myrtus cotini
folio Plum., Nov. PL Amer., Cat. PL: 19 (1703), nom. nud.; PL Amer.: 203, t. 208,
f. 2 (1759), nom. inval. (edited by J. Burman)]. - Myrtus citrifolia Aubl., Hist.
PL Guiane 1: 513 (1775); Table des noms Latins: 20 (1775). - {Myrtus acris Sw.
var. b Sw., Prodr: 79 (1788), sine comb.). - Myrtus coriacea Vahl, Symb. Bot.
2: 59 (Jul-Dec 1791); Sw., FI. Ind. Occid. 2: 912 (1798), nom. superfl. - Myrtus
cotinifolia GmeL, Syst. Nat., ed. 13, 2: 792 (late Sep-Nov 1791), nom. superfl.;
Poir. in Lam., Encycl. 4: 410 (1798); Bunn, ex Steud., Nomencl. Bot. ed. 2, 2:
177 (1841), isonyms. - Myrcia coriacea (Vahl) DC., Prodr. 3: 243 (1828), nom.
superfl. - Pimenta citrifolia (Aubl.) KosteL, Allg. Med.-Pharm. FI. 4: 1 525 (1835).
- Aulomyrcia coriacea (Vahl) O. Berg, Linnaea 27: 70 (1855), nom. superfl. -
Myrcia coriacea (Vahl) DC. var. swartziana Griseb., FI. Brit. W. L: 234 (1860).
122
Gard. Bull. Singapore 65(1) 2013
- Aulomyrcia citrifolia (Aubl.) Amshoff, Bull. Torrey Bot. Club 75: 531 (1948).
LECTOTYPE (designated here): Plumiers plate 208, fig. 2, India occidentalis, ?
Jamaica.
Eugenia paniculata Jacq., Coll. 2: 108, t. 5, f. 1 (Apr 1789) (“1788”); DC., Prodr.
3: 280 (1828), sub E. fra grans Willd. cum ? - Aulomyrcia jacquiniana O. Berg,
Linnaea 27: 69 (1855), non Aulomyrcia paniculata O. Berg (1855: 49). - Myrcia
coriacea (Sw.) DC. \ar. jacquiniana (O. Berg) Griseb., FI. Brit. W. I.: 234 (1860).
-Myrcia paniculata (Jacq.) Krug & Urb. in Urb., Bot. Jahrb. Syst. 19: 577 (1895)
{“panniculata’’^). TYPE: Aquart in Herb. Jacquin, s.n., Martinique (holo W).
Caryophyllus cotinifolius Miller
Miller (16 Apr 1768) was the first to validate Caiyophyllus cotinifolius, which in
previous editions of the Dictionary he had called Caryophyllus foliis ovatis obtusis
oppositis, floribus sparsis alatibus and noted that this would be the same as ''Myrtus
cotini folio. Plum. Cat. 19” of 1703.
His material had been collected between 1734-1740 by the surgeon Robert
Millar in Cartagena of New Spain (now Colombia). There is no evidence that either
Millar or Miller sent a duplicate to Linnaeus or anybody else. The name is not
mentioned by Sweet (1826) which suggests that the species was not in cultivation in
England anymore.
From Miller’s description and remarks it is obvious that that he was describing
living plants which he probably had grown in his garden in Chelsea, and tried to
identify these with existing literature, e.g., Plumier’s plate.
Remarkably, Scott (1980; 475) while stating that he had seen the holotype of
Eugenia cotinifolia Jacq. in BM, noted that “it was collected or communicated by D.
Miller in 1763”. This is against the fact that Jacquin did not mention any collector,
but said that he had seen the specimen in Gronovius’s herbarium with unknown
provenance! 1 think that there has been a mix-up with Philip Miller’s Caryophyllus
cotinifolius. Note that “D.” is not an initial, but stands for “Dominus”. Mr. Govaerts et
al. (2008: 62) have equated this with Eugenia cotinifolia Jacq., see below.
Caryophyllus cotinifolius Miller, The Gardeners Dictionary, ed. 8: Caryophyllus 4(16
Apr 1768). TYPE: Millar s.n. A"" 1736, possibly cultivated in Chelsea from seed
from Colombia, Cartagena (holo BM).
Eugenia cotinifolia Jacq.
Independently, Jacquin (1768, precise date unknown, presumably later than Miller)
described and depicted (fruits only) an Eugenia cotinifolia based on a specimen
he had seen (or received?) from Gronovius without an indication of its origin. He
compared it with E. carthagenensis Jacq. and E. uniflora, which he noted to have
seen in Martinique, where the natives called it “Cerisier de Cayenne”, or Cayenne
Eugenia nomenclatural notes
123
cherry. This was evidently misread by Linnaeus (1771) who gave as the provenance
of Jacquin’s species “Cayenne” (French Guyana), the start of a lengthy confusion and
misapplication of its name. Sprengel (1825) for some reason added the Mascarenes to
its distribution.
Johan Frederik (Jan Fredrik) Gronovius (1686-1762) was the patron, host, and
friend of Limiaeus during his stay in Leiden, Rapenburg 52, with the Hortus botanicus
on the other side of the canal and his printers on the comer at no. 56, now the well-
know pub Bamera. Linnaeus surely saw his herbarium, obtained material from it, and
also (falsely) attributed the name Linnaea to him. There is an unwritten (?) convention
that you cannot name taxa after yourself (or your ancestors).
In Linnaeus’s herbarium is a specimen {637.17; as usual without provenance)
misidentified (Merrill 1950: 332) as Myrtus pimenta L. with a pencilled note by J.E.
Smith referring to the Jacquin specimen in the Banks herbarium, BM. However,
Savage (1945) reported the presence of a list of specimens sent by Jacquin to Linnaeus
in the Linnaean Correspondence and this one was not in it. In short, its provenance is
unknown, and that it may have come from Gronovius, Jacquin, or even Miller is pure
speculation. 1 therefore think that McVaugh (1968) erred when he suspected that all
three references were based on the same source. However, he had found no match for
it among the taxa that he knew from the West Indies or northern South America.
Jacquin’s herbarium was bought by Banks and is presently in BM. However,
his West Indian collections are rare and fragmentaiy (Dandy 1979). McVaugh (1968)
couldn’t find anything, but Scott (1980: 475) did. He noted that it was not identifiable
anymore, as flowers (Jacquin didn’t have any) and fmits have been lost. In any case,
it was not like any species from the Mascarenes, Afiica, Madagascar, Malesia, or
Australia that he had seen.
De Candolle (1828) made the combmaXion Jossinia cotinifoUa and (mis)applied
it to material that had come from the mountains of Bourbon (now Reunion) in the
Mascareignes. He cited Sprengel with a question mark, adding “excl. patr.”, which 1
read as “excluding provenance (patria)”, apparently refeii'ing to Cayenne. Because
of the influence of the Prodromus this was perpetuated by later authors for various
species there (e.g. Baker 1877, with 5 varieties!) and its distribution was gradually
extended to Sri Lanka, S India, and Polynesia. This is the interpretation of the epithet
that Hyland was referring to.
Actually, Blume (1850: 123) had already seen the error, but as he retained J.
cotinifoUa DC. for the Mascareignes, excluding the references to Jacquin and Sprengel,
he actually created a new species with a later homonym, Jossinia cotinifoUa DC. ex
Blume, non Jacq., typified by Coinmerson 516 (holo L; iso K, P). This is a synonym of
E. orhiculata Lam. (Scott 1980: 480).
Urban (1920) restricted Miller’s name to Plumier’s Caribbean element, which
he identified with Myrcia citrifolia (Aubl.) Urban. This splitting-up is obviously
erroneous, as Miller described material from Colombia, and only attempted to match
it with existing literature. Moreover, in lectotypification material has priority over
illustrations.
124
Gard. Bull. Singapore 65(1) 2013
It therefore cannot be ruled out that Miller’s and Jacquin’s species, only known
from a few 18th century collections, is now extinct. For some reason, Govaerts et al.
(2008: 139) give Venezuela as the distribution.
Eugenia cotinifolia Jacq., Obs. Bot. 3: 3, t. 53 (1768); L., Mant. Alt.: 243 (1771)
(“Cayenne”). -Myrtus cotinifolia (Jacq.) Spreng., Syst. Veg. 2: 481 (1825)
(“Cayenn. Mascaren,”), non Poir. (1798). -Jossinia cotinifolia (Jacq.) DC., Syst.
Veg. 3: 238 (1828). TYPE: Herb. Jacquin s.n. ex herb. Gronovius, provenance
unknown (holo BM; ? LINN).
Jossinia Comm, ex DC.
The ING at the moment of writing (in a version of 9 Feb 1996) stated that a type had
not been designated. However, Scott (1980) Jossinia tinifolia (Lam.) DC. before
Ashton (1981: 408) selected cotinifolia (Jacq.) DC.
Jossinia Comm, ex DC., Prodr. 3: 237 (“337”) (1828). LECTOTYPE: Jossinia tinifolia
(Lam.) DC.
Other names
The following names are not in an alphabetical order as one is linked to the other.
Eugenia elliptica Lam.
This was described from Mauritius and reduced to one of the 5 varieties of Eugenia
cotinifolia by Baker (1877). Ashton (1981) regarded it as a synonym of the “typical
subspecies”, and added two more for Sri Lanka: Eugenia cotinifolia Jacq. subsp.
codyensis (Munro ex Wight) PS. Ashton from Sri Lanka and the Western Ghats, India,
and subsp. phillyreoides (Trimen) P.S. Ashton, a Sri Lanka endemic only known from
the type. Kostennans (1981: 164) disagreed with this and for what had been called
Eugenia cotinifolia and Eugenia elliptica in Sri Lanka he proposed the new species
Eugenia hypoleuca.
Blume (1850) made the new name Jossinia lamarckii for Eugenia elliptica
Lam. and Myrtus elliptica Spreng., because he considered E. elliptica Lam. and M.
elliptica Spreng as different from J. elliptica DC, but the latter was based on that of
Lamarck mid Jossinia lamarckii Blume is therefore a superfluous name. Scott (1990:
12) has all '"ellipticae"' under £■. elliptica, and (p. 16) Jossinia lamarckii erroneously
under E. liicida Lam., as if it was an independent species with Commerson 512 (L,
“holo”) as the type.
Eugenia elliptica Lam., Encycl. Meth. 3: 206 (1789). -Myrtus elliptica (Lam.) Spreng.,
Syst. Veg. 2: 483 (1825). - Jossinia elliptica (Lam.) DC., Prodr. 3: 237 (1828).
Eugenia nomenclatural notes
125
- Jossinia lamarckii Blume, Mus. Bot. 1: 121 (1850) (“1849”), nom. superfl. -
Eugenia cotinifolia Jacq. var. elliptica (Lam.) Lam. ex Baker, FI. Mauritius: 114
(1877). TYPE: Commerson s.n., Mauritius (holo P-LA; iso P, P-JU 13923).
Govaerts et al. (2008: 142) added to this:
Jossinia cordifolia Bojer, Hort. Maurit: 141 (1837), nom. nud. - Eugenia cotinifolia
Jacq. var. cordifolia Bojer ex Baker, FI. Maurit. Seych.: 114 (1877). TYPE: Bojer
s.n., Mauritius (K).
Eugenia hypoleuca Thwaites ex Kosterm.
This name needed to be included here, as Kostermans (1981: 164) compared it to
Eugenia codyensis Munro ex Wight and E phillyreoides Trimen.
Eugenia hypoleuca Thwaites ex Beddome, For. Man.: 1 12 (1872), nom. nud.; Kosterm.,
Quart. J. Taiwan Mus. 34 (3^): 164 (1981). TYPE: Kostermans 28088 (holo L,
iso PDA).
Eugenia codyensis Munro ex Wight
Eugenia codyensis Munro ex Wight, 111. Ind. Bot. 2: 13 (1841) - Eugenia cotinifolia
Jacq. subsp. codyensis (Munro ex Wight) P.S.Ashton in Dassan., Rev. Handb. FI.
Ceylon 2: 412 (1981). - Syzygium codyense (Munro ex Wight) Chandrab., Biol.
Mem. 2: 57 (1977). TYPE: Wight s.n., India, Karnataka, Coorg (Kodagu) near
Mercara (Madikeri) (12° 25’ N, 75° 45’ E) (holo K).
Notes. Named after the village Kody or Cody near Vittal close to Sampage Ghat. This
locality is also mentioned for Ophiorrhiza codyensis Gamble (1919).
Kostermans (1981: 165) said that from the description this is a species distinct
from E. hypoleuca, but Govaerts et al. (2008: 185) equated the two.
Eugenia phillyreoides Trimen
Eugenia phillyreoides Trimen, J. Bot. 23: 207 (Jul 1885); Syst. Cat. Ceylon: 33
(Jun / Jul 1885) (nom. nud,, "fhillyraeoides'f, Handb. FI. Ceylon 2: 183 (1894);
Kostenn., Quart. J. Taiwan Mus. 34(3-4): 164 (Dec \9^\).- Syzygium phillyreoides
(Trimen) Santapau, Kew Bull. (3): 276 (1948). - Eugenia cotinifolia Jacq. subsp.
phillyreoides (Trimen) P.S.Ashton in Dassan., Rev. Handb. FI. Ceylon 2: 413
(1981) Cphyllyraeoides'j. TYPE: Anon, s.n., May 1884, Sri Lanka, summit of
Kalupahane Kande (holo K; iso L, PDA).
Eugenia mooniana Wight, 111. Ind. Bot. 2: 13 (1841); Icon. PI. Ind. Orient. 2: 4, t.
551 (1840-1 843), non Gardn. (1841). SYNTYPES: Moon s.n., Sri Lanka (? BM),
Wight s.n., India, Courtallum (?K).
126
Gard. Bull. Singapore 65(1) 2013
Notes. Kostemians (1981: 165) said that this is a species entirely different from E.
hypoleuca, and more similar to E. mandugodaense Kostenn. and E. willdenowii DC.
There have been some alternative orthographies of the epithet. The original one
is ''phillyreoides'\ but '"phillyraeoides” and '"phyllymeoides” in later publications.
As it is derived from Phillyrea L. (Oleaceae) the correct orthography seems to be
"'phillyreoides'' [Rec. 60G.1(1) and (2)].
Eugenia bukobensis Engler
The combination Eugenia bukobensis Engler (1899) is for a species widespread
in Kenya, Tanzania, and Uganda. Engler had previously (1895) misidentified it
with Eugenia cotinifolia Jacq. var. elliptica (Lam.) Lam. ex Baker. That it was a
misidentification is not immediately clear, but can be deduced from the facts that
Engler called it a “n. sp.” (new species) and cited Baker’s combination name as “ex
Engl.”, which we now would write as “sensu Engl.”, or “auct. non Baker: Engl.”.
However, Fosberg (1978) and Verdcourt (1999, 2001) regarded the citation
as a reason to declare the name superfluous and it was proposed for conservation
(Verdcourt et al. 2002). This proposal was rejected as unnecessary for the reasons
given above (Brummitt 2004).
Eugenia bukobensis Engler, Notizbl. Bot. Gard. Berlin 2: 289 (1899). - Syntypes:
Stuhlmann 3261, 3749, 3756, 3794, 3881, “Centralafrikanisches Seengebiet”, now
Tanzania, Bukoba (B, lost). NEOTYPE (designated by Verdcourt et al. 2002):
Gillman 260 (K).
Eugenia cotinifolia Jacq. var. elliptica auct. non (Lam.) Baker: Engl., Pflanzenw. Ost-
Afrikas C: 287 (1895).
Myrtus pimenta L.
This is a totally different subject, brought about by Myrtus cytrifolia Poir. (1798), non
M. citrifolia Aubl. (1775) and the confusion created by the application of Myrtus cotini
folia Plum, by Landrum (1986: 106-107).
Linnaeus (1737: 501) mentioned Myrtus calycibus absque appendiculis based
on Myrtus arborea aromatica, foliis laurinis Sloan., flor. 161 [i.e. Cat. PI. Jamaica,
1 696]. hist. 2. p. 76, 1. 1 9 1 . f. 1 [i.e., Voy. Jamaica, 1 725], and Caiyophyllus aromaticus
americanus, lauri acuminatis foliis, fmctu orbiculari. Pluk. aim. 88, t. 155. f. 4 [1692],
both from Jamaica. He noted that the generic position needed further scrutiny by
those who could study living plants. In his Flora zeylanica (1748) for some reason he
mentioned this species again (as Myrtus foliis alternis, but did not actually say that it
occurred in Ceylon = Sri Lanka), while in the Materia medica (1749 sub no. 225) he
cited the FI. Zeyl. with a question mark. The remark “Zeylon?, Cuba, Guiana” cited
by Landrum (1986: 106 ) is made under the next species, Myrtus foliis obverse ovatis
FI. Zeyl. 183?, which is Pimenta racemosa. This made later authors believe that he
described the species from Sri Lanka (e.g. Landrum 1986: 106). The confusion was
Eugenia nomenclatural notes
127
increased when in 1753 for Myrtus pimenta he stated “Habitat in India” and gave
references to both the Flora zeylanica and the Jamaica ones. This is another example
that he was not always too clear in his distinction between the East and West Indies,
Thus Poiret (1798) was misled to think that there were American and Ceylonese species
involved and he apparently thought that the East Indian one was the major part and so
proposed Myrtus cytrifolia for the American one. This is an orthographic variant ofM.
citrifolia Aubl. (1775) and also is a superfluous name for Myrtus pimenta.
It is interesting to note that Heyne (1950: 1181, sub Pimenta officinalis Lindl.)
remarked that cultivation outside Jamaica has always been unsuccessful, and the plants
only exceptionally flowered. It was introduced in Sri Lanka in 1 824.
According to Landrum (1986, with an extensive synonymy) the correct name is
Pimenta dioica (L.) Merr., and he appointed as the lectotype Sloane, History of Jamaica
2: t. 191, f. 1. 1725. There is no mention of the possible presence of a specimen in the
Sloane Herbarium (BM) that may have served as the basis of the plate (“typotype”)
and would be a good candidate for an epitype.
Myrtus caryophyllata L.
The German physician, Paul Hermann, prepared a number of herbaria in book form
during his stay in Ceylon (Sri Lanka) between 1672 and 1677. One of these, now in
the Institute de France, Paris, was used by Burman (1737). Lourteig (1966) gave an
enumeration of the contents of its single volume. The largest and most important copy,
consisting of 5 volumes, is that now in BM which was seen by Linnaeus (1748). A
third copy in two volumes is in L which, conrtary to Van Ooststroom (1937), was not
seen by Linnaeus. It therefore contains no direct Linnaean elements although many
specimens may be syntypes under Art. 9 Note 2(c). A fourth 1 -volume copy is in the
Forschungsbibliothek, Gotha, Gennany, extensively discussed by Rauschert (1970).
Liimaeus (1748) described Myrtus foliis obverse ovatis with a fairly detailed
description and the following references:
Cerasus humilis umbellata, flosculis incamatis, fmctu Montinghos dicto. Burm. zeyl.
57.
Caryophyllus aromaticus indiae occidentalis, foliis & fmctu rotundis, dipyrene, seminus
fere orbiculatis planis. Pluk. aim. 88, t. 15.f 3 (an?)
Danighas Heiin. zeyl. 3.
Dam, Herm. zeyl. 14, 53.
Rightly, he was not sure about the Plukenet reference, as this refers to a West
(!) Indian collection, which, as we now know, possibly represents Pimenta racemosa
(Mill.) J.W.Moore (Landmm 1986: 106), but Limiaeus’s ideas about India were rather
hazy (as noted above, his “India” can refer to both the West and East Indies!) and so
he confused himself and later authors.
For his descriptions he used the BM Hermann herbarium in which there are
six fragments. All have been regarded as original elements by Jarvis (2007) and the
lectotypification is attributed to Kostennans (1981: 133). However, the latter merely
stated “Herb. Hermann (BM)”. BM 000621251 on vol. 1, fol. 7 is designated here as
128
Gard. Bull. Singapore 65(1) 2013
the lectotype. BM 000621253 would be an isolectotype. The other parts in the other
volumes were most likely collected at a later moment, and so are syntypes. The L
Hermann collection (Van Ooststroom, 1937: fol. 22), although not seen by Linnaeus, I
would call a syntype [Art. 9, Note 2(c)]. Lourteig (1966) did not mention any specimen
in the Paris copy, and Rauschert (1970) none in that at Gotha.
In 1 749, Linnaeus apparently had changed his mind and accepted the reference
to Plukenet and the origin as Cuba and Guiana (!), while the reference to the Flora
zeylanica and Zeylona were given a question mark. In 1753 he reversed again, now
giving the references to the Flora zeylanica and Plukenet equal status, but with
“Zeylona” as the only provenance. His reference to the Materia medica should read
“226”, not “225”, which latter number is correctly cited under the next species, Myrtus
pimenta.
Obviously, the Plukenet citation should be discarded as being an attempt to
identify material-in-hand with existing literature. This was also realised by Swartz
(1788, 1798), see below under Pimenta acris (Sw.) Kostel.
Although Trimen identified the Hermann specimens, he (1894: 174) probably
because of the Kew Rule (first epithet used under a particular generic name) called
the Sri Lanka species Eugenia coiymbosa Lam. (1789) with Myrtus caiyophyllata L.
(1753) and Syzygium caryophyllaeum Gaertn. (1788) in synonymy.
Eugenia corymibosa Lam. (1789: 199) is based on Njara Rheede, Hort Malab.
5: 53, t. 27 (1685) and a Sonnerat collection from India. The latter would seem the
obvious type. Ashton (1981 : 451) cited it as Syzygium corymbosum (Lam.) DC, which
is an error for “(Blume) DC.”, based on Calyptranthus coiymbosus Blume (1824:
291) from Java. De Candolle (1828: 261) transferred the latter to Syzygium corymbosa
(Blume) DC. while he retained (1828: 284) Eugenia corymbosa Lam. in Eugenia.
The occurrence of this species in Borneo as is mentioned in the older literature
is erroneous, and probably refers to Syzygium lineatum (DC.) Merr. & L.M.Perry
(1939: 172).
The coiTect name is Syzygium caryophyllatum (L.) Alston in Trimen, Hand-
Book FI. Ceylon 6, SuppL: 116 (1931).
Myrtus caryophyllus Spreng.
Myrtus caryophyllus Spreng., Syst. Veg. 2: 485 (“483”) (1825) is a superfluous name for
Caryophyllus aromaticus L. from the Moluccas. He also cited Eugenia caryophyllata
Thunb., Willdenow.
Syzygium caryophyllaeum Gaertn.
Syzygium caryophyllaeum Gaertn. is the conserved type of Syzygium Gaertn.
designated by McVaugh (1956). It was described on material then in L from Ceylon
(De Candolle 1828: 260, said “herb. Van-Royen”). This appears to have been lost. -
Eugenia cafyophyllaeim (Gaertn.) Wight, 111. Ind. Bot. 2: 15 (1841); Icon. PI. Ind.
Eugenia nomenclatural notes
129
Orient. 2: 3, t. “540 / 1017” (1840-1843). EPITYPE (designated here): Kostermans
24707 (L! iso K! PDA, US).
Pimenta acris (Sw.) Kostel.
Pimenta acris (Sw.) Kostel. was indirectly based onMyrtus acris Sw. (1788: 79; 1798:
909), which is generally considered as a supeifluous name for Myrtus cafyophyllata L.
This is incorrect, for Swartz referred to Caiyophyllus aromaticus indiae occidental is,
foliis et fructu rotundis, dipyrene, seminibus fere orbiculatis planis Pluk. (Aim. 188,
t. 155, f. 3. 1692) and Myrtus cajyophyllata sensu Jacq. (1767) from the Caribbean,
which he regarded as different from Linnaeus’s East Indian M. caiyophyllata L. as
he explained more fully in 1798 (p. 910). In this he was followed by Kosteletzky
(1835). This idea, however, was caused by the false impression that Linnaeus (1753)
made when he gave the provenance of his Myrtus caryophyllata as “Zeylona”, while
including also a South American reference. The Plukenet reference may represent
Pimenta racemosa (Mill.) J.W. Moore (Landrum 1986: 106).
The name therefore originally was legitimate, but in 1798 Swartz also
cited Caiyophyllus racemosus “Mill. Diet.”, which refers to the Card. Diet. Ed.
8, Caryophyllus no, 5, 1768, which epithet under the present rules he should have
adopted, and it becomes a synonym. According to Landrum (1986: 108) this is now
Pimenta racemosa (Mill.) J.W. Moore var. racemosa.
Pimenta acris (Sw.) Kostel. var. citrifolia Kostel. was mentioned by Ashton
(1981: 403) as introduced in Sri Lanka. I have not found this combination made
anywhere, and it is not in Govaerts et al. (2008: 342).
Eugenia roxburghii DC.
Eugenia roxburghii DC., Prodr. 3: 271, # 74 (1828). - Eugenia zeylanica auct. non
Willd.: Roxb., Hort. Beng.: 92 (1814) {‘'zeylonica''), nom. nud.; FI. Ind. 2: 490
(1832); Ashton in Dassan., Rev. Handb. FI. Ceylon 2: 416 (1981) {“ceylanica'').
- Eugenia bracteata (Willd.) Raeusch. ex DC, var. roxburghii (DC.) Duthie in
Hook.f., FI. Brit. India 2: 502 (1879), TYPE: Roxburgh in Herb. Lambert in Herb.
DC. (holo G; microfiche IDC), see also Wallich 3621-A (K; IDC microfiche 7394)
and Roxburgh s.n.. Icon Ined. 2502 (CAL, K), Bangladesh, Sylhet.
Myrtus bracteata Willd., Sp. PL, ed. 4, 2, 2: 969 (1799). - Eugenia ? bracteata
(Willd.) Roxb., Hort. Beng.: 37 (1814), nom. inval.; Raeusch. ex DC., Prodr.
3: 264. 1828; Roxb., FI. Ind., ed. 2, 2: 490 (1832), isonym, non Rich. (1792). -
Syzygium bracteatum (Willd.) Raeusch (“Roxb.”) ex Korth., Ned. Kruidk. Arch.
1: 205 (1846); Raizada, Indian For. 74: 336 (1948) (n.v.), isonym. TYPE: Klein A°
1796 in Herb. Willdenow 9553 (holo B; microfiche IDC 7440), “India orientali”,
probably Tamil Nadu, Tranquebar (= Tharangambadi).
Myrtus ruscifolia Willd., Sp. PL, ed. 4, 2, 2: 970 (1799), non Eugenia ruscifolia Poir.
(1 81 3). - Syzygium ruscifoliurn (Willd.) Santapau & Wagh, Bull. Bot. Surv. India 5:
130
Gard. Bull. Singapore 65(1) 2013
109 (1964), nom. superfl. [Duthie in Hook.f., 1879: 502, already had synonymised
M. mscifoUa with M. bracteata, therefore, under Art. 11.5 Santapau & Wagh
should have adopted S. bmcteatum (Willd.) Raeusch ex Korth,], LECTOTYPE
(designated here): Roxburgh in Herb. Willd. 9557, India orientali, probably Tamil
Nadu, Tranquebar (= Tharangambadi) (B; IDC microfiche 7440: third sheet on
right in microfiche; the other two are from Rottler through Klein, collected Sep 11,
Oct 3, 1 799, so too late to have been with Willdenow in Dec 1 799).
Myrtus latifolia B. Heyne ex Roth, Nov. PI. Sp.: 232 (1821); Panigrahi, J. Econ.
Taxon. Bot. 5: 993 (1984), non Eugenia latifolia Aubl. (1775). - Myrtus heynei
Spreng., Syst. Veg. 2: 482 (1825), nom. superfl. - Eugenia heynei Rathakr. & N.C.
Nair, J. Econ. Taxon. Bot. 5: 232 (1984), nom. superfl. [Eugenia bracteata (Willd.)
Roxb. cited]. - Eugenia rothii Panigrahi, J. Econ. Taxon. Bot. 5: 994 (1984), nom.
superfl. {Eugenia bracteata cited). TYPE: Heyne in Herb. Roth, India, probably
Tamil Nadu, Tranquebar (= Tharangambadi) (holo B, probably lost).
Eugenia fasciculata Wall, ex Blume, Mus. Bot. 1: 87 (1850) (“1849”). - Eugenia
bracteata (Willd.) Raeusch. ex DC. (“Roxb.”) var. fasciculata (Wall, ex Blume)
Duthie in Hook.f , FI. Brit. India 2: 502 (1879). - Eugenia rothii Panigrahi var.
fasciculata (Willd. ex Blume) H.B. Naithani, FI. PI, India, Nepal & Bhutan: 165
(1990). LECTOTYPE (designated here): Wallich 3622, India, Mont. Pundora (?),
1824 (L: sh. no. 898.203- 55; iso L, sh. no. 898.203-54; K; IDC microfiche 7396).
Myrtus quadripartita Royen ex Blume, Mus. Bot. 1: 87 (1850) (“1849”; nom. nud., in
synon. sub E. bracteata) — YowchQts: Kotella (Herb. A. van Royen s.n., Sri Lanka,
L sh. no. 898.203- 50, - 52-53).
Eugenia rnacrosepala Duthie in Hook.f, FI. Brit. India 2: 501 (1879). TYPE: Stocks
s.n., India, N. Canara (holo K).
Distribution. Bangladesh (Sylhet), India (Meghalaya, S India, Madras, Namailay
Mts), Sri Lanka, Myamnar (Irrawaddy, Tenasserim), Thailand (Northern: Phitsanulok,
Uttaradit; Northeast: Sakon Nakhon; East: Chaiyaphum; Southeast: Chanthaburi), S
Vietnam (Nhatrang; Thuduc; Poulo Condor, now Conson).
Notes. Govaerts et al. (2008: 163) regarded this as a “true” Eugenia.
The specimens cited under Syzygium bracteatum (Willd.) Raeusch (“Roxb.) ex
Korth,, Ned. Kruidk. Arc. 1 : 205. 1 846, belong to Syzygium zeylanicum (L.) DC. (Mr.
Wuu Kuang Soh, or. comm.).
Calyptranthes ramiflora Blanco
Govaerts et al. (2008: 416) included as a synonym Syzygium latifolium Blanco (1845)
and regarded it as a nom. illeg. (non DC.). Actually it is a misidentification by Blanco
of what he had described earlier (1837) as Calyptranthes ramiflora.
Calyptranthes ramiflora Blanco, FI. Filip.: 420 (1837). - Syzygium latifolium auct.
non DC.: Blanco, FI. Filip., ed. 2: 294 (1845). NEOTYPE (designated here):
Eugenia nomenclatural notes
131
Merrill Sp. Blancoan. 669 (Ramos), Philippines, Luzon, Bulacan Prov., Sapang
Santel, December 18, 1914 [holo US, 00904347, Barcode No.: 00689164; iso
A, B, BM, BO, CAL, F, GH, K, L, MO, NSW, NY, P, U (in L), UC, W]. See
http://botany.si.edu/colls/blanco/blancoimages/Blanco_640/00689164.jpg
= Eugenia similis Merr. = Syzy’gium simile (Merr.) Merr. (Robinson 1909: 386, 403;
followed by Merrill 1918).
Eugenia salomonica C.T. White
Eugenia salomonica C.T. White, J. Arnold Arbor. 32: 141 (1951). TYPE: Kajewski
1574, Solomon Isl., Bougainville, Kieta, March 1930 (holo A).
Distribution. Papua New Guinea (St. Matthias Group: Mussau Isl.; Bougainville),
Vanuatu (former Solomon Isl.: Santa Cruz Isl.: Tomotu Noi (Nendo); Santa Isabel).
ACKNOWLEDGEMENTS. Mr. L.A. Craven (CANB), Dr. N. Snow (BISH), Dr. P.G. Wilson
(NSW), Mr. P. Widodo (Institut Pertanian Bogor), and two unknown reviewers are mueh
thanked for various comments. Craven provided localities of Eugenia reinwardtiana in PNG.
Dr. H.-J. Esser kindly checked the holdings in M for some specimens.
References
Ashton, P.S. (1981) Myrtaceae. In: Dassanayake, M.D. A Revised Handbook to the Flora of
Ceylon 2: 408, 412, 450^51. New Delhi: Amerind Publishing Co.; Rotterdam: A. A.
Balkema.
Aublet, J.B.C.F. (1775) Histoire des plantes de la Guiane frangoise 1: 513; Table des noms
Latins: 20. London: Aublet; Paris: Didot f.
Baker, J.G. ( 1 877) Flora of Mauritius and the Seychelles: 1 14. London: Reeve & Co.
Blume, C.L. (1824) Ueber die vegetation des Berges Gedee auf der Insel Java. Flora 1: 291.
Blume, C.L. (1850) (“1 849”)- Ord. Myrtaceae. Subord. Myrteae. Museum Botanicum Lugduno-
Bataviim 1: 119-124.
Bnimmitt, R.K. (2004) Report of the Committee for Spemiatophyta: 54. Taxon 52: 822.
Burman, J. (1737) Thesaurus Zeylanicus: 57. Amsterdam: Jansson-Waesberg & Schouten.
Dandy, J.E. (1979) In; Staflleu, F.A. & Cowan, R.S. Taxonomic Literature ed. 2, 2. Regnum
Veg 98: 407.
De Candolle, A.P. (1 828) Myrtaceae. In: Prodromus Systematis Naturalis Regni Vegetabilis 3:
238. Paris: Treutel & Wiirz.
Diels, L. (1921) Die myrtaceae Mikronesiens. Bot. Jahrb. Syst. 56: 531.
Engler, A. (1895) Die Pflanzenwelt Ost-Afrikas und der Nachbargebiete C: 287. Berlin: Reimer.
Engler, A. (1899) Diagnosen neuer Afrikanischer Pflanzenarten. 3. Myrtaceae. Notizhl. Konigl.
Bot. Gart. Berlin 2: 289.
Fosberg, F.R. (1978) Miscellaneous notes on the flora of Aldabra and neighbouring islands.
VII. Eugenia elliptica var. levinervis (Myrtaceae). Kew Bull. 33: 133—134.
132
Gard. Bull. Singapore 65(1) 2013
Gaertner, J. (1788) De fructibus et Seminibus Plcmtarum: 166, t. 33, f. 1. Stuttgard: Gaertner.
Gamble, J.S. (1919) Decades kewenses. Bull. Misc. Inform. Kew 1919: 406.
Gmelin, J.F, (1791) Systema Naturae ed. 13, 2: 792. Leipzig: Beer.
Govaerts, R. et 12 al. (2008) World Checklist of Myrtaceae: xv, 455. U.K.: Royal Botanic
Gardens, Kew. (See also http://apps.kew.org/wcsp/myrtaceae)
Heyne, K. (1950) De Nuttige Planten van Indonesie 1: 1181. Bandung: Van Hoeve,
‘S-Gravenhage.
Hosokawa, T. (1940) Materials of the botanical research towards the flora of Micronesia (XIX).
J. Jap. Bot. 16: 542.
Hyland, B.RM. (1983) A revision of Syzygium and allied genera (Myrtaceae) in Australia.
Austral. J. Bot., Suppl. Ser 9: 31.
Ingle, H.D. & Dadswell, H.E. (1953) The anatomy of the timbers of the south-west Pacific area.
Austral. J. Bot. 1: 353^01.
Jacquin, N.J. (1767) Obsei^ationes Botanicarum 2: 1 . Vienna: Kraus.
Jacquin, N.J. (1768) Observationes Botanicarum 3: 3, t. 53. Vienna: Kraus.
Jarvis, C. (2007) Order Out of Chaos: 687. London: Linnean Society.
Kosteletzky, VF. (1835) Allgemeine Medizinisch-Pharmazeutische Flora 4: 1526. Prague:
Borrosch & Andre.
Kostermans, A.J.G.H. (1981) Eugenia, Syzygium and Cleistocalyx (Myrtaceae) in Ceylon: A
monographical revision. Quart. J. Taiwan Mus. 34(3^): 132-133, 164-165.
Lamarck, J.B.P.A. de Monet de (1789) Encyclopedie Methodique 3: 199, 206. Paris:
Panckoecke; Liege: Plomteux.
Landrum, L.R. (1986) Campomanesia, Pimenta, Blepharocalyx, Legrandia, Acca, Myrrhinum,
and Luma (Myrtaceae). FI. Neotrop. 45: 83-84, 105-107.
Linnaeus, C. (1737) Hortus Cliffortianus: 501. Amsterdam: Clifford.
Linnaeus, C. (1748) Flora Zeylanica: 83. Amsterdam: Wetstenium.
Linnaeus, C. 49) Materia Medica: 78. Stocldiolm: Salvius.
Limiaeus, C. (1753) Species Plantarum: 472. Stockholm: Salvius.
Linnaeus, C. {Ml \) Mantissa Altera: 243. Stockliolm: Salvius.
Lourteig, A. (1966) L’herbier de Paul Hermann, base du Thesaurus zeylanicus de Johan
Burman. Taxon 15: 23-33.
Lucas, E.J., Belsham, S.R., Nic Lughadha, E.M., Orlovich, D.A., Sakuragui, C.M., Chase,
M.W. & Wilson, PG. (2005) Phylogenetic patterns in the fleshy-fruited Myrtaceae -
preliminaiy molecular evidence. PI. Syst. Evol. 251: 35-51.
McVaugh, R. (1956) Nomenclatural notes on Myrtaceae and related families. Taxon 5: 164-
165.
McVaugh, R. (1968) Myrtaceae, in B. Maguire et al.. The Botany of the Guyana Highland-Part
VIII. Mem. New York Bot. Card. 18(2): 217-218.
Merrill, E.D. (1918) Species Blancoanae. Publ. Bur. Sci. Gov. Lab. 12: 289.
Merrill, E.D. (1 950) The synonymy ofJossinia reinwardtiana (Blume) Blume. J. Arnold Arbor.
31:329-333.
Merrill, E.D. & Perry, L.M, (1939) The myrtaceous genus Syzygium Gaertner in Borneo. Mem.
Amer Acad. Arts 18. =Mem. Gray Herb. 4: 140, 172.
Miller, P. (1 768) The Gardeners Dictionary’ ed. 8: 4, 5 (Caiyophyllus). London: Miller.
Pike, K.M. (1956) Pollen morphology of Myrtaceae from the south-west Pacific area. Austral.
J. Bot. 4: 13-53.
Plukenet, L. {1696) Almagestum Botanicum: 88. London: Plukenet.
Plumier, C. {M 93) Nova Plantarum Americanum Genera: 19. Paris: Bondot.
Eugenia nomenclatural notes
133
Plumier, C. (1759) Plantarum Americanum: 203, t. 208, f. 2. Leiden: Biimian;Amsterdam.
Poiret, J.L.M. (1798) In: Lamarck, J.B.A.P. de Monet de, Encyclopedie Methodique, Botanique
4: 410. Paris: Agasse.
Polhill, R.M. & Steam, W.T. (1976) Linnaeus’s notes on Plumier drawings with special
reference Xo Mimosa latisiliqua. Taxon 25: 323-325.
Rauschert, S. (1970) Das Herbarium von Paul Hermann ( 1 646-1695) in der Forschungbibliothek
Gotha. Hercynia N.F, 7: 301-328.
Rheede tot Draakestein, H.A. van (1 685) Hortus Indicus Malabaricus 5: 53, t. 27. Amsterdam:
Van Someren & Van Dijk.
Richter, H.E. (1840) Codex Botanicus Linnaeanus. Pp. 1102 + 202. Leipzig: Wigand.
Robinson, C.B. (1909) A preliminary revision of Philippine Myrtaceae. Philipp. J. Sci. 4: 386,
403.
Savage, S. (1945) A Catalogue of the Linnaean Herbarium: Pull-out Leaf at the Back. London:
Taylor & Francis.
Schmid, R. (1972a) A resolution of the Eugenia-Syzygium controversy (Myrtaceae). Amer. J.
Bot. 59: 423-436.
Schmid, R. (1972b) Floral anatomy of Myrtaceae. 1. Syzygium. Bot. Jahrb. Syst. 92: 435^89.
Schmid, R. (1972c) Floral anatomy of Myrtaceae. 11, Eugenia. J. Arnold Arbor. 53: 336-363.
Scott, A.J. (1980) Notes on Myrtaceae in the Mascarenes with some recombinations for taxa
from Aldabra, Malaya, New Caledonia. Kew Bull 34: 473-475, 477, 480, 496.
Scott, A.J. (1990) Myrtaceae. In: Flore des Mascareignes 92: 12, t. 2, f. 5, 6. Mauritius: Sugar
Industry Research Institute; Paris: ORSTOM; U.K.: Royal Botanic Gardens, Kew.
Smith, A.C. (1985) Myrtaceae. In: Flora Vitiensis Nova 3: 374, 376. Lawai, Hawaii: Pacific
Tropical Botanical Garden,.
Snow, N. & Wilson, P.G. (2010) New species of Eugenia and Gossia (Myrtaceae: Myrteae)
from Papua New Guinea. Telopea 12: 454-457, t. 1, 2. (See Telopea 13: 359 (2011) for
emendation of type.)
Sprengel, K. (1825) Systerna VegetabiJium ed. 16(2): 481. Gottingen: Dieterich.
St. John, H. (1977) Notes on Eugenia (Myrtaceae) and Haloragis (Haloragaceae) from
southeastern Polynesia. Pacific Plant Studies 34. Phytologia 37: 441.
Steudel, E.T. (1841) Nomenclator Botanicus ed. 2(2): 177. Stuttgart, Tubingen: Cotta.
Stone, B.C. (1970) The flora of Guam. Micronesica 6: 446-449, t. 75, 76. Swartz, O. (1788)
Nova Genera & Species sen Prodromus: 79. Upsala, Abo: Holmiae.
Swartz, O. (1798) Flora Indiae Occidentalis: 912-913. Erlangen: Palm.
Sweet, R. (1826) Hortus Brittanicus: 155-158. London: Ridgway.
Trimen, H. (1894) A Hand-Book to the Flora of Ceylon 2: 1 74, 183. London: Dulau & Co.
Urban, I. (1920) Plumier’s Leben und Schriften. Repert. Spec. Nov. Regni Veg. Beihefte 5: 86.
Vahl, M. (1791) Symbolae Botanicae 2: 59. Copenhagen: Vahl.
Van der Merwe, M.M., van Wyk, A.E. & Botha, A.M. (2005) Molecular phylogenetic analysis
of Eugenia L. (Myrtaceae), with emphasis on southern African taxa. PI. Syst. Evol. 251:
21-34.
Van Ooststroom, S.J. (1937) Heraiann’s Collection of Ceylon plants in the Rijksherbarium
(National Herbarium), at Leyden. Blumea, Suppl. 1: 198-209.
Verdcourt, B. (1999) The genus Eugenia L. (Myrtaceae) in East Africa. Kew Bull. 54: 47^8.
Verdcourt, B. (2001) Myrtaceae. In: Flora of Tropical East Africa: 59-60. Rotterdam,
Brookfield: A. A. Balkema.
Verdcourt, B., Eilu, G. & Katende, A. (2002) Proposal to conserve the name Eugenia bukobensis
Engl. (Myrtaceae) with a conserved type. Taxon 51: 389.
134
Gard. Bull. Singapore 65(1) 2013
Wilson, RG. (2009) Conspectus of the genus Eugenia (Myrtaceae) in the Philippines. Gard.
Bull, Singapore 60: 399^10.
Wilson, RG. (2011) Myrtaceae. In: K. Kubitzki The Families and Genera of Vascular Plants
10. Flowering plants- Eudicots- Sapindales, Cucurbitales, Myrtaceae: 227-228, 245,
252-253. Heidelberg: Springer- Verlag.
Wilson, RG., O’Brien, M.M., Heslewood, M.M. & Quinn, C.J. (2005) Relationships within
Myrtaceae sensu lato based on a matK phylogeny. PI. Syst. Evol. 251: 3-19.