a eee ke oR ts Dak ak de ee ee a Oe re Wa wie We Wied A, he Meet
Lee LLLE Sent ie ror ne aren he Motive De the EL TEE Masten an ON,
oi RM NTL Me Ade OE NaN EAS RY AE UNGER AR YEA TR Mb dete UR SII SH OMAN AUNEG BCI
AW PPR Ba Nhe MMOH TS OTL Ee Paty REN 2ST OLE NS Ba re had dO CERNE GH Se TL NVPEN 5 fe ca do ASAE Ae OO MINE OTE
Ay Noite My MOB ete Ho Hd MA Te See Be HOR IO AQ Me et IE BEC IEE Nera My atVit es APL OUP LTME MENTO Dea tg eck ee jae Nd baer ins
Ne He BRM MAT AL MSMy CODE NA TRMI CO Oy Moe Ay SS Oe Be PEA EE CNTR ES ET RET PG MM te INO Late
PNR. BW Mo tetas Betis DOM ity a BME MEANT, OAM TY ROR NEL fag ALES MN NLN TENS TUPI ee AURA EE ACAUE NSN Thar
RFR Be MAM Mea MK MS POMS FAM AT AMA AG AANA Pa he MR RGM LU Fae
SOROS PPM ree £
PMT T I es Or ey Meer®
SRO bl ponte
WUEMRENN WR Ct SL ae Ope gy eye
te AOE iM UM 1h
EV MDI Gy Lag 4M
DRS ie Re Ia fee JT
De NE BO EON He EEO. eae
annie re a Oe he A WE WAN ME Ol MEM dE ee a
Sh Sana hey ogy nA A ee MMM el UTE MMe NAM WANED, cov MANSY Bh,
Dan ears Pe ae Ct aoe WN Wm CNN AN DIL AN GARDE HEY BOD Khe DONG pO BSH
EO EIT yy ’ Pe ern ee oe Do 9 DENATURED 2M MEM AAS
ee ee Le ee eer) Um ee ee URL eee, me re 1 LOAM REHM OM ON Ie te gw
fee te wg ae ok DON NO AINA MTN VM oth UTM hilo fed? ert eee Te Val Ma eae a Bay MLD MAA IMS yh ie
Case ec es re ey LF WN Bon
a Arn
Sele
Wile WEG! Mee bah. tia Val GR yo gah 0 Wh NAA has
Woh MN Yan VV ast Webi yaa st WA Bad GVM BV Ge AS Oe Meta MIN oan,
Ves Doe Raves Ce rd cea Bo whi Hie ES oe Pd St Pe ae ee SOP ott ol
VAWONGS tbSae Abr eee Ree eanne Bie a Pree) 1h a ed A 2a es eC 2 ee a TO et M14 tN Mt
NAGEL Med OBER MAS Fe eet le ate VEE ON INT DRO Meter ONL Le Me re gt ROAP UE IN Seer Bh ey Vit “bavee Saeas RNAV MM FO OTE AL EEA toh MO Vso ON IND Bh ads ng MI ADEA sb OU ML ENON, Be Vite!
A Be IRS EMR OM Me WOE MR A UR DN A ae litte Hast a Ce A cn ee SCOPE MAEVE sae ln phat neat ee Peat ay DULY SUL a ea ivh Ce eye PP eae cere ee 2) | MAAR LA ee a a a BAN MM MH te Mes ah Mae ML VE My i gh sw
ee eee NEN a REN stadia R tts AVR Ay MAI Mall Me Me NGA Me Tete ber nied chee Heaney? NUDES NERA U EG Me eto ita Sot emer ene at APO hy ul Day rane tye uss Mn es bi Si
NP) Aah eto Hat Mi RI TCU er tL OL, tae FOUR OSH AME MNES Ve AUR TG SPEER BTR EY Ot tity OCHRE TOP EM TIRE 5 EAE
9 0 Ma Rel PMSA TEN REN MA Pate e mien ia he MOU MH SWS HS MEN ay ALE RN Bak WM. Oy Ou Ste me Hai ety AN a CO ee RS Oe eh
We VEMe FEM Ms Be Meda My MAN My MLE AMT Raven Ne Fytla Me Pa elas g My Mee Ay NEE E hee HG
ty
es ee Sl Me Se
Re BAS BON He Res:
Vetta ger
be agtely
PUM SIREN Se AGRE MU MAE IUM Mads
thee
+ Cn eee eer en
Wea BN ME ae oS AMM Oly
Bom
SRE OIE,
OT AEN MN Ee A US oe Yang
NM ENON TNO RIN IRE SHEN WTR SA TY MAYAN CL Mb ile gM oA th 4m GA J 1 MW ROH SE IRD, eeu] e a Met em
my Pe LEELA Ee cae es i a nr a rd ANY vor MDE Mes AIS,
erie peas n Maw AW Ee big ELGG MANET Mah OAS VA aVet ed eh ee
NO RAT RAIA He Ne Dan ho HASSLES Gea tad fe WET etn Eevee hE IE Pee eh ANSI ALI WoO STN FE EV 1 Bg EhEN Me AA ha Veneer S178 Ob ry A, Parr) hoe
SN Ra Re de Meme VOM eat MEN ALOT S MOM He oS ROM RM Stade Pa Pe aah PM eG RENE Ady AE SOSH EG et weve gees MONO PPh ety Dan OO ata (a eT OO ed er) Pree Cd rd ee ee | io
aE BARE RL AL SANG Pod ay d Magy CATON U AEN RR, ALT ME ROL ST Maint te aE One ad Pan ae eC TT MAIS WANDS SS PRY SCR PGR TT BY AP UR ans Viton hehe rap b's Sah PLU CMEC N ETA Ae deat ate boat @ ddd)
ATR IMI, 8 oa A eR a Hy a Reeds Ps Mat SOE He ee, Ree MO Or) ea a ee ota tet gt ay eure ee Dea So er es ed TD WY AP bry th Et
Hoh Fe RA MRS CA TI RL MM AB DU RSS, RT ee eo 3 Wea 5
BSH EK Wo Bee Mowe ite Pe hedeedams FaVante Ry Ms Mee MAN Ds fad Panky Re ded e Ee. Mate
SREB A OMA ene OG Bath b en ee en ae eee
Due atata ty
wher,
NAMA NN Ba Pate MAN, WY Hoe BS WN rey Sadig MW TARE ER AN MG an
Pee en ea be rs eae
aaa NaI ely eee?
oe Be Door i
A ae
NNT Mite git pa gle fete
fe tyra gne
pw teu de
eA AN
HSGERE OVEN, oe a8 eo) i
Tas a fa VAT RORACT mse \ Sesh ee ferrite hah gears ga dey! “,
er ce Meese’ A BET Ae MN MeN aye Pye VA Me RED EW Ad ghey
Oni. er ners anh Oe ne OE N tesig PINT CR Ge Eh Pet HN ay Me TT AE ye R TY dnt pee
i ON wh MMT, PLN HN Ve RaW Ramee a I ace eT at EEN No a8 :
I Weel datas aN ae Bee Hee ay ;
UW Shah
Le ays
ah Hee HINES eg
Hiden f
Vebees Mee age tw yt ny
NAO IRA i tah
weegs
SAI Fr DS ta dee
ERA bet VE Ly
RIDING FOAL ALE a
TAM Daina gees,
Ha Mostyn tt
HMI, rece ome
SMe?
Pett BI Sw
Pm AY Na
NTO
arn
stated
be Benen ©
EME De aN
ake ta Hes ody tga es &
SRN IN EOIN
ee Meee wants
oe ae re
ANUP. Meee ta aN"
TG A Ot
NM OM
Mids vss
pn Se
CEM SET ieee
Mew Rataey Mod “a?
wet hewa ate Ra tall yet
sehen he y
aM Be ae
Vee ate Dee
ENT
L5E49
HARVARD UNIVERSITY
ave tians
Ernst Mayr Library
of the Museum of
Comparative Zoology
MCZ
LIBRARY
JUL 24 2012
HARVARD |
UNIVERSITY
MCZ_
LIBRARY
r EB 5 t Que
HAN RSITY
JOURNAL
of the
ENTOMOLOGICAL»y
Volume
One Hundred and Thirty-Eight
2007 :
Published November 2007
JOURNAL
of the
ENTOMOLOGICAL SOCIETY
ONTARIO. | -
Volume One Hundred and Thirty-Eight 7
=") 2007 : ur F
Published November 2007
THE ENTOMOLOGICAL SOCIETY OF ONTARIO
OFFICERS AND GOVERNORS
2006-2007
President: Webmaster:
B. HELSON D. B. LYONS
Natural Resources Canada, Canadian Forest Service
1219 Queen St E., Sault Ste. Marie, ON P6A 2E5
[email protected]
President-Elect:
R. HALLETT
Dept. of Environmental Biology,
University of Guelph, Guelph, ON NIG 2W1
[email protected]
Past President:
J. HUBER
Natural Resources Canada, Canadian Forest Service
c/o Eastern Cereal and Oilseed Research Centre
960 Carling Ave., Ottawa, ON K1A 0C6
[email protected]
Secretary:
D. HUNT
Agriculture and Agri-Food Canada G.P.C.R.C.
2585 County Road 20, Harrow, ON NOR 1G0
[email protected]
Treasurer:
K. BARBER
Natural Resources Canada, Canadian Forest Service
1219 Queen St E., Sault Ste. Marie, ON P6A 2E5
[email protected]
Librarian:
J. BRETT
Library, University of Guelph
Guelph, ON NIG 2W1
Directors:
D. CURRIE (2007-2009)
Royal Ontario Museum, Toronto, Ontario
H. FRASER (2005-2007)
Ontario Ministry of Agriculture and Food
Vineland Resource Centre, P.O. Box 8000
4890 Victoria Avenue North
Vineland, ON LOR 2E0
M. PICKLES (2005-2007)
3252 Garner Road, Niagara Falls, ON L2E 6S4
J. SKEVINGTON (2007-2009)
Agriculture and Agri-Food Canada
960 Carling Ave., Ottawa, ON K1A 0C6
L. TIMMS (2006-2008)
Faculty of Forestry, University of Toronto
Toronto, ON MS5S 3B3
S. VANLAERHOVEN (2006-2008)
Dept. of Biology, University of Windsor
Windsor, ON NOB 3P4.
ISSN 1713-7845
of
Natural Resources Canada, Canadian Forest Service
1219 Queen St E., Sault Ste. Marie, ON P6A 2E5
Student Representative:
A. THIELMAN
Brock University, St. Catharines, ON L2S 3A1
Newsletter Editor:
J. ALLEN
Ontario Ministry of Agriculture, Food and Rural Affairs
1 Stone Road West, Guelph, ON NIG 4Y2
EDITORIAL COMMITTEE
Scientific Editor:
M. H. RICHARDS*
Dept. of Biological Sciences, Brock University
St. Catharines, ON L2S 3A1
[email protected]
Technical Editor: A. Rutgers-Kelly
Layout Artist: A. Rutgers-Kelly
Associate Editors:
A. BENNETT
Agriculture and Agri-Food Canada
960 Carling Ave., Ottawa ON K1A 06C
N. CARTER
Ontario Ministry of Agron and Food
Vineland, ON LOR 2E0
R. HARMSEN
Biology Department, Queen’s University
Kingston, ON N7L 3N6
Y. MAUFFETTE
Faculté des sciences, Département des sciences biologiques _
Université 4 Québec Montréal, Montréal, QC H3C 3P8
J. SKEVINGTON
Agriculture and Agri-Food Canada
Eastern Cereal and Oilseed Research Centre
960 Carling Ave., Ottawa, ON K1A 0C6
~
*Please submit manuscripts electronically to the Editor
([email protected]). |
JESO Volume 138, 2007
JOURNAL
of the |
ENTOMOLOGICAL SOCIETY OF ONTARIO
VOLUME 138 2007
You will notice that there are two Editors’ Forwards in this volume of the Journal
of the Entomological Society of Ontario. On page 2 is the forward from Special Editor
Steve Marshall that was originally printed in Volume 137, which I have been thinking of as
‘Pengelly I’, with the first five papers in this volume comprising ‘Pengelly II’. About two
years ago, we began planning a special volume in memory of David Pengelly, an entomologist
at the University of Guelph who inspired many Ontario and Canadian entomologists. It is
a mark of the esteem in which his students and colleagues held him, that the memorial
volume had to be split into two. I would like to express my warmest thanks and appreciate
to Steve Marshall who acted as the Special Editor of the Pengelly volumes.
With the publication of Volume 138, I am delighted to note that JESO has resumed
a timely publication schedule. Not only is the 2007 volume actually being published in
2007, but preparations are already underway for Volume 139, to be published in 2008.
Another important change is electronic distribution of published manuscripts, with the
added attraction that the electronic versions may include colour plates and maps, which are
generally impossibly expensive to print. Electronic distribution will enable our authors’
work to reach the wider audience that it deserves, not least of all because it will become
accessible to web search engines. These are important developments in bringing JESO
to a wider audience, and everyone who has helped to get us to this point, should award
herself or himself a pat or two on the back. I especially thank the JESO Editorial Board,
the ESO Board, our patient Technical Editor, and the many reviewers whose hard work and
enthusiasm for the Journal, have been the real impetus for these changes.
After that moment of self-congratulation, let me assure you that we are not resting
on our laurels, but intend to continue building on the momentum we have established. First,
we are committed to maintaining annual publication in the autumn of each year (dare we
dream of bi-annual publication?), so please submit your work to JESO — we are already
considering manuscripts for Volume 139 (2008), and the more, the merrier. Remember,
all entomological research is welcome, whether its subjects are in Ontario or elsewhere.
Second, we are planning to begin converting back volumes of JESO into electronic format
for distribution from the website — eventually we would like to post all volumes of JESO
and its predecessor, the Proceedings of the ESO, right back to volume 1. Third, the success
of these Pengelly volumes has inspired suggestions for future special volumes devoted to
particular entomological themes. All these plans will help to ensure a bright and buggy
future for the Journal.
Happy reading!
Miriam H. Richards
Editor
JESO Volume 138, 2007
JOURNAL
of the
ENTOMOLOGICAL SOCIETY OF ONTARIO
VOLUME 138 2007
It has been a pleasure for me to serve as Special Editor for the D. H. Pengelly tribute
volumes, and to work with regular Editor Miriam Richards to line up a diverse assemblage
of papers touching on the range of entomological disciplines influenced by Dave Pengelly
(1922-2004). Dave was widely known, and is fondly remembered, as a fantastic teacher of
entomology and as a huge contributor to the development of the University of Guelph Insect
Collection; but he is also sorely missed as a seemingly infinite reservoir of entomological —
trivia, anecdotes, insightful stories, jokes, support, and wise advice. Almost all of the
authors in these volumes were strongly influenced by Professor Pengelly, most shared his
enthusiasm and passion for collecting and identifying insects, and many worked with Dave
to build up the University of Guelph Insect Collection. Although now widely appreciated as
a treasure trove of information about faunal change and insect distribution while also serving
as the foundation for a growing body of taxonomic research, the University of Guelph
Insect Collection during Pengelly’s tenure was a beleaguered resource used mostly as a
source of specimens for a myriad of entomology courses including the hands-on third year
entomology labs that Dave taught every weekday. It is a testimonial to his foresight that he
not only kept the collection from deterioration or destruction due to invasions of dermestid
beetles and indiscriminate colleagues, he consistently built up the collection and increased
its curatorial level annually. He did not do this alone, of course. Professor Pengelly had a
contagious vision of what was needed to improve our understanding of Ontario’s insects,
and his enthusiasm for the study of insect biology and diversity was such that he was always
associated with dedicated students. Thousands of specimen labels in the insect collection
bear the names of most of the authors of papers in these volumes, standing as permanent
testimonials to a shared vision that started with students working with their mentor at
University of Guelph, and which continues through the widely dispersed teaching, research,
and publications by Dave’s students and colleagues today. I think he would have liked these
sets of papers, and he would have been pleased to see them published in the journal that
he supported so selflessly ... almost every copy of this journal sent out during the 16 year
period “D.H.” was Secretary-Treasurer of the ESO was sent out by Dave personally. We all
wish he were still here to send this one out!
Steve Marshall
Special Editor
Review of Eustochus JESO Volume 138, 2007
REVIEW OF EUSTOCH US, A RARELY COLLECTED GENUS OF
MYMARIDAE (HYMENOPTERA)
J.T. HUBER’? and E. BAQUERO?
Canadian Forestry Service, Natural Resources Canada
Abstract J. ent. Soc. Ont. 138: 3-31
The four nominal species of Eustochus are reviewed. Four new species, E.
confusus from Spain, E. pengellyi and E. yoshimotoi from North America,
and E. nipponicus from Japan are described and a key to the eight species is
given.
Résumé
Nous revisons les quatre espéces nominales d’Eustochus. Nous décrivons
quatre nouvelles espeéces, E. confusus d Espagne; E. pengellyi et E. yoshimotoi
d’Ameérique du Nord, et E. nipponicus du Japon, et pourvoyons une clé
d identification aux huit espéces.
Published November 2007
Introduction
The Holarctic genus Eustochus was established by Haliday (1833) for a species
described by Curtis (1832) ina key as a species of Mymar—M. atripennis (which he attributed
to Walker). Curtis’s laconic description, abstracted here from his key, reads: ‘abdomen
petiolated, wings ciliated and perfect, ovipositor exserted, longer than the abdomen’. The
collection information given next to the name atripennis states simply ‘June, amongst grass
in a wood’. Graham (1982) suggested that perhaps only one specimen had been collected by
Walker, probably at or near Southgate, Middlesex (England). Haliday (1833) redescribed
E. atripennis (Curtis) in more detail, and included it as the only species within his new
genus Eustochus. He mentioned that the species occurred ‘in autumn, among trees, but very
rare’. Since then, the genus has been mentioned infrequently in the literature and only three
more species have been described, based on very few specimens each. Here, we review the
described species and describe four new ones from Spain, Canada, USA, and Japan.
' Author to whom all correspondence should be addressed.
* Correspondence address: Systematic Entomology, K.W. Neatby Building, 960 Carling
Avenue, Ottawa, Ontario, Canada K1A 0C6, email: [email protected]
> Departamento de Zoologia y Ecologia, Faculdad de Ciencias, Universidad de Navarra,
31080, Pamplona, Spain
Huber and Baquero JESO Volume 138, 2007
Materials and Methods
This study is based on recent examination of about 115 specimens from the
institutions listed below.
Eustochus species all appear to be very similar to one another so long descriptions
for each species, as for E. besucheti Bakkendorf, would be repetitious; therefore, diagnoses
only are given. The new species are described and illustrated based on females because males
are known for only two species and are exceedingly rare (7 specimens known). Specimens
from Japan were dissected and gold coated for the scanning electron micrographs (Figs. 1
—]5).
Morphological terms used follow Gibson (1997). Measurements, from slide-
mounted specimens unless otherwise indicated, are given in micrometers (uum), and are as
described in Huber (1987). The range is followed by the number of specimens measured, in
parentheses. Primary type data is recorded as found on each label, with slashes indicating
the beginning of each new line. Data from other specimens is given in a standardized format
to simplify retrieval or comparison. Abbreviations used are: Fl —Fl,=funicle segment one to
six, FWL or FWW=forewing length or forewing width, Fl, L (W)=flagellar segment length
(width).
Acronyms of repositories: CNC—Canadian National Collection of Insects, Ottawa,
Canada, J. Huber; FAFU-—Biological Control Research Institute, Fujian Agricultural and
Forestry University, Fuzhou, China, N.-Q. Lin; MRSN—Museo Regionale di Scienze
Naturali (Spinola Collection), Turin, Italy, G. Pagliano; MZNA—Museo de Zoologia,
Universidad de Navarra, Pamplona, Spain, E. Baquero; MHNG—Museum d’ Histoire
Naturelle, Geneva, Switzerland, C. Besuchet; UCRC—University of California, Riverside,
CA, USA, S. Triapitsyn; USNM-—National Museum of Natural History, Washington, DC,
USA, M. Gates.
Eustochus Haliday
Eustochus Haliday, 1833: 269 (key), 349 (description); Westwood, 1839: 78 (diagnosis);
Walker, 1846: 50 (diagnosis); Foerster, 1847: 225 (diagnosis); Foerster, 1856:
117 (key); Blanchard, 1840: 293 (diagnosis); Dalla Torre, 1898: 428 (catalogue);
Ashmead, 1904: 363 (key); Schmiedeknecht, 1909: 494 (key), 495 (diagnosis);
Gahan and Fagan, 1923: 64 (type species designation); Schmiedeknecht, 1930:
450 (key); Kryger, 1950: 61 (description); Annecke and Doutt, 1961: 24 (generic
comment); Debauche, 1948: 200 (description); Schauff, 1984: 50 (diagnosis,
phylogeny); Yoshimoto, 1990: 57 (diagnosis); Xu and Lin, 2003: 65 (diagnosis).
Type species: Mymar atripennis Curtis, by monotypy.
Diagnosis. Body 670-1330 um in length (critical point or air dried specimens); brown to
dark brown, with appendages somewhat lighter in colour. Head (except face) and mesosoma,
scape, dorsal surface of gastral petiole, coxae and femora with distinct reticulate sculpture
(Figs. 1-5, 7-10, 13, 15, 35, 36, 38-43); gaster, underside of petiole, and remainder of legs
4
Review of Eustochus JESO Volume 138, 2007
FIGURES 1-6. Head, Eustochus sp. probably atripennis (Japan, Mt. Tsukuba). 1—dorsal;
2-lateral 3—anterior; 4—ventral; 5—posterior; 6—mouthparts.
Huber and Baquero JESO Volume 138, 2007
100 um
100 um
100 um
20m
20 um
FIGURES 7-15. Mesosoma and metasoma, Eustochus sp. probably atripennis (Japan, Mt.
Tsukuba). 7—mesosoma, dorsal; 8-mesosoma lateral; 9-mesosoma ventral; 10—metasoma,
dorsal; 1 1—metasoma, lateral; 12—metasoma, ventral; |3—petiole dorsal; 14—petiole, ventral;
15—petiole, lateral.
Review of Eustochus JESO Volume 138, 2007
pe
OO cre rr ie th
FIGURES 16-20. Eustochus spp., female antenna, lateral. 16—atripennis (Germany,
Bornheim); 17—besucheti (Switzerland, Laquintal); 18—nearcticus (Canada, MacKenzies
Mt.); 19-triclavatus (paratype); 20—pengellyi (holotype).
Huber and Baquero JESO Volume 138, 2007
FIGURES 21-25. Eustochus spp., female antenna (except 25), lateral. 21—yoshimotoi
(holotype); 22—?nearcticus (USA, Andrews Bald); 23—confusus (holotype); 24—nipponensis
(holotype); 25—atripennis, male (Switzerland, Chancy).
Review of Eustochus JESO Volume 138, 2007
en VOR D0, 200
~
FIGURES 26-27. Eustochus spp., wings. 26—atripennis (Germany, Bornheim); 27—
besucheti (Switzerland, Laquintal).
Huber and Baquero JESO Volume 138, 2007
28
4 ai A
Ye
FIGURES 28-29. Eustochus spp., wings. 28—nearcticus (NS, MacKenzies Mt.); 29—
triclavatus (paratype).
Review of Eustochus JESO Volume 138, 2007
i I a 10, 20
FIGURES 30-31. Eustochus spp., wings. 30—pengellyi (holotype); 31—voshimotoi
(holotype).
11
JESO Volume 138, 2007
Huber and Baquero
SN
aaa
y WY Y Yi
SSN
SSS
>
dl
an?
4
/
=
ee
>
Ss
a=
--
oe
——
9
-
nd ~~ ;
ss
<<
~ <2?
- -_ ~~
~~
>>
———
= ~
2
a+
Ys,
ar
ts
- vo
«>
— er
— =
MO
_
32
Yi
Ks
ath
sf.
Y ”
: :
ph} : My
4,' i} oh
/ '"
j Alf seth A wan ‘ ? rf ve “ Rn .
Lyi ter wiiees? gts TANNIN RONAN
: AMYT AA" ur’ ‘ HN ee we
Ay ' +? 3h a ryt \' ~e
IIA AVAL ON WAN YN
AA Ae ARS
i , if , ey ” ty : Ya »
4 La rh HALyS
7 s) * 4 . x \) |
VS 4 ay, ,
Seiler
oD
9
33-
ustochus spp., Wings, 32—?nearcticus (USA, Andrews Bald)
a)
al
4
l
38 32-33.
FIGURI
confusus (holotype),
Review of Eustochus JESO Volume 138. 2007
i a OREO EU
—.
_——
FIGURES 34-36. Eustochus spp., wings and bodies. 34—nipponicus, wings (holotype):
35—atripennis, body lateral (Germany, Bornheim); 36—besucheti, mesosoma dorsal
(Switzerland, Laquintal).
13
Huber and Baquero JESO Volume 138, 2007
0.1mm
FIGURES 37-40. Eustochus spp., bodies. 37—besucheti, metasoma lateral (Switzerland,
Laquintal), 38—nearcticus, lateral (NS, MacKenzies Mt.); 39-triclavatus, mesosoma +
metasoma, lateral (paratype); 40—pengellyi, mesosoma + metasoma, dorsal (holotype).
14
Review of Eustochus JESO Volume 138, 2007
I i 0,
FIGURES 41-43. Eustochus spp., bodies. 41—yoshimotoi, lateral (holotype); 42-
?nearcticus, mesosoma + metasoma, lateral (USA, Andrews Bald); 43—confusus, lateral
(holotype).
15
Huber and Baquero JESO Volume 138, 2007
FIGURES 44-46. Eustochus spp. 44—nipponensis, body lateral (holotype); 45—atripennis,
male head, anterior (Switzerland, Chancy); 46—atripennis, male genitalia, ventrolateral.
16
Review of Eustochus JESO Volume 138, 2007
0.4mm
FIGURES 47-50. Eustochus confusus (paratype). 47-antenna; 48—clava: 49—wings
(forewing damaged); 50—forewing venation.
Huber and Baquero JESO Volume 138, 2007
smooth (Figs. 10-12, 14). Legs with 4 tarsal segments, the basal one not much longer than
each of the others.
Female. Eyes of normal size but ocelli small, the posterior ocelli not much larger than the
mesh diameter of surrounding scupture (Figs. 1-3). Mandibles either relatively short and
not quite meeting medially or occasionally slightly overlapping medially, with two (Fig.
6) or, usually, three teeth. Antennal funicle 6-segmented and clava 2-segmented (Figs.
16-18, 20-24) or, rarely, 3-segmented (Fig. 19); flagellum with longitudinal sensilla on fl,
(1 sensillum), fl, (2 sensilla), fl, (2 sensilla) and clava (1 sensillum on basal segment, 5 on
apical segment) [distribution of longitudinal sensilla on clava of E. triclavatus not clear
due to collapse and poor orientation]. Forewing oval, with a more or less distinct, comma-
shaped, dark mark extending from basal half of marginal vein to posterior margin just beyond
retinaculum (Figs. 26-34); venation 0.35-0.4 times length of forewing; marginal + stigmal
vein longer than submarginal vein; hypochaeta directly in front of proximal macrochaeta or
slightly basal to it and two, widely separated, distal macrochaetae present, the second distal
macrochaeta near apex of venation near base of short stigmal vein. Petiole long and narrow
(Figs. 13-15, 38, 40, 42, 44). Gaster smooth, deep, and somewhat compressed, with gt, the
largest tergum (Figs. 10, 11, 13, 38-44); spiracle present on gt,; dorsal one or two cercal
setae extremely long and curved (Figs. 11, 13), distinctly longer than ventral two setae.
Ovipositor either very long and conspicuously exerted beyond gastral apex, or short and not
extending beyond gastral apex.
Male. Forewing minute and hindwing absent, with very small eyes and ocelli absent, and
large, tridentate mandibles that meet medially (Fig. 45); body with reticulate sculpture less
pronounced than in female. Antenna with 9 flagellar segments, the apical two widely joined
to form a loose clava (Fig. 25).
Discussion. Eustochus is most closely related to Caraphractus Walker, another strictly
Holarctic genus (Schauff 1984). Members of both genera have strongly sclerotized bodies
with distinct reticulation on the head, mesosoma, petiole, coxae, and scape, and they have
similar mesosomal, metasomal, and wing structure. Sclerotization, surface sculpture, and
wings may be convergent due to the habitats in which the species of both genera are found.
A well sclerotized body and strengthened wings are needed for protection while moving
around in forest litter (Ewstochus) or water (Caraphractus). The heavy surface sculpture
may trap air around the body. A host shift from terrestrial to semiaquatic to aquatic host
may have occurred in some ancestral Eustochus species, leading to species that are now
classified as Caraphractus, which parasitize only Dytiscidae, as far as is known. Though
hosts for Eustochus are unknown, a few specimens of Eustochus have been collected near
water (see E. atripennis, below) and the change from hosts in forest litter or soil to hosts
near and eventually in water may easily have occurred.
Biology. Hosts are unknown. Most specimens of Eustochus examined were collected from
deciduous forests. A few were collected near water, and one specimen of £. nearcticus
Yoshimoto from Alberta was collected from gravel in water. A few specimens appear to
have been collected in more open habitats (heron rookery, edge of cornfield), though it
18
Review of Eustochus JESO Volume 138, 2007
is not possible to know exactly what microhabitat they were in. Females and the males
of E. atripennis and E. besucheti were collected near the base of an old trunk (Viggiani
1970), from soil under oak (specimen record, below), and from moss (Bakkendorf 1965),
respectively. A few were also collected in pitfall or Malaise traps. Label data on many
females from Switzerland indicated they were collected from dead leaves and the Belgian
specimen (from Forét de Soignes, Rouge Cloitre) described by Debauche (1948) was
collected by sifting dead leaves. Most likely, species of Eustochus parasitize hosts that lay
their eggs in soil, surface litter, or mosses. The number of specimens collected near water
suggests an aquatic host. A given species of Eustochus likely has more than one generation
per year, judging from the range of dates when specimens were collected, e.g., March to
September for E. atripennis.
Key to Eustochus species
Females
l Ovipositor exerted distinctly beyond apex of gaster, considerably longer than
emenmens. SAT SOAN) LOC. eb! adouedatl ..lmortemaesls) Fano: 2
— Ovipositor not exerted beyond apex of gaster, shorter than metatibia (Figs. 38, 42,
| ER kee SEUPEN Ng avd SE ee ee ee BE CE ges gee LY eee Mee eer eee | 4 nn 6
2(1) Fl, 3.5 times as long as wide, only slightly shorter than fl, (Figs. 16, 19) ............. 3
— Fl, at most 2.2 times as long as wide, distinctly shorter than fl, (Figs. 17, 20, 21)
3(2) Clava 2-segmented; fi, 2.1 times as long as wide (Fig. 16); forewing with longer
venation (distance between second and third macrochaeta at least 1.8 times distance
between first and second macrochaeta) .................00000eeeeeeeees E. atripennis (Curtis)
_ Clava 3-segmented; fi, 2.7 times as long as wide (Fig. 19); forewing with shorter
venation (distance between second and third macrochaeta about 1.4 times distance
between first and second macrochaeta) ................::0000ceee E. triclavatus Xu and Lin
4(2) Fl fi, each longer than wide (Figs. 20, 21); Nearctic ............cccceseseseseeeeseeeeseeees 5
— Fl.-fl, each as wide as long, quadrate (Fig. 17); European ............c:ccceeseeeseseeeeees
empresa tie Nd Oat Cool ted sates La Acadaieds E. besucheti Bakkendorf
5(4) Forewing (Fig. 31) with distinct triangular asetose area behind venation (between
level of hypochaeta and first distal macrochaeta) and in front of one and a partial
second row of microtrichia that extend basally to level of submarginal vein;
mandible with 3 teeth [Western North America] ..................... E. yoshimotoi sp. n.
= Forewing (Fig. 30) with narrow, linear asetose area behind venation (between level
of hypochaeta and first distal macrochaeta) and in front of two rows of microtrichia
that extend basally to level of submarginal vein; mandible with 2 teeth [Eastern
mmmmincds OS bile to) uo hid oul Lleida dina. E. pengellyi sp. n.
6(1) FWL/FWW less than 4.0; Nearctic ..................ccssssseeseeeees E. nearcticus Yoshimoto
se nF OW aVoereater than:4.0; Palacarctic wi..2 :.6...aties. a 7
7(6) Mesosoma deep, about 1.5 times as long as high and dorsum distinctly curved
in lateral view (Fig. 43); forewing (Fig. 33) with about 8 microtrichia on blade
behind apex of submarginal vein + base of marginal vein, arranged in 1-2 indistinct
19
Huber and Baquero JESO Volume 138, 2007
rows; asetose area behind these (and in front of retinaculum) relatively wide [area
concealed: behind -wirigsin Fig; 33} elia...cciw. soos. Ba E. confusus sp. n.
- Mesosoma shallow (Fig. 44), about 1.8 times as long as high and dorsum much
flatter in lateral view; forewing (Fig. 34) with about 15 microtrichia on blade
behind apex of submarginal vein + base of marginal vein, arranged in 2-3 indistinct
rows; asetose area behind these (and in front of retinaculum) relatively narrow
wa ddd. Sots oi GMebereh eased, 2c ae es nies ates baat E. nipponicus sp. n.
Eustochus atripennis (Curtis)
(Figs. 1-15 [but see comments below], 16, 25, 26, 35, 45, 46)
Mymar atripennis Curtis, 1832: folio 411 (description in key); Haliday, 1833: 350 (list).
Eustochus atripennis Haliday, 1833: 349 (description, transfer to Eustochus); Walker, 1846:
54 (list); Foerster, 1847: 226 (description), 233 (German record from Aachen);
Blanchard, 1840: 293 (diagnosis); Dalla Torre, 1898: 428 (list); Ashmead,
1904: 363 (mention in key); Schmiedeknecht, 1909: 495 (list); Kryger, 1950:
63 (description); Debauche, 1948: 201 (description); Bakkendorf, 1965: 122
(key); Viggiani, 1970: 135 (male description); Trjapitzin, 1978: 967 (duplicate
of Bakkendorf key); Graham, 1982: 221 (type material); Schauff, 1984: 51 (type
material lost); Viggiani, 1989: 146 (male genitalia); Ulrich, 1999: 388 (collection
record).
Diagnosis. Female. Body length 978 (820-1330, air and critical point dried specimens).
Head width 201-251 (n=6). Mandibles each with 3 teeth (2 teeth in specimens from Japan
that may be E. atripennis, see additional material, below), the middle tooth slightly the
largest, the dorsal tooth blunt. Mesosoma length/height 1.29-1.44 (n=2). Ovipositor length
746-1007 (n=9), 1.55-1.78 times length of hind tibia; distinctly exserted beyond apex of
metasoma, the exserted part slightly less than hind tibial length.
Antenna (Fig.16). Segment L (W) (n=10): scape 136-169 (32-41), pedicel 66-81
(30-36), fl, 65-95 (15-20), fl, 64-83 (17-20), fl, 56-77 (17-20), fi, 49-60 (22-32), fl, 42-51
(29-40), fl 38-45 (34-45), entire clava 130- 157 (55-79). Ratios of L/W: scape 3. 74- 4.79,
pedicel 1.84-2.48, fl, 3.82-5.48, fl, 3.53-4.45, fl, 3.29-4.1, fl, 1.69-2.26, fi, 1.16-1.54, fi,
0.86-1.04, entire bias 1.84-2.46.
Wings (n=10). FWL 948-1282, FWW 323-454, FWL/FWW ratio 2.88-3.06.
Distance between first and second distal macrochaetae 1.85-2.15 (n=6) times distance
between proximal and first distal macrochaeta. HWL 841-1044, HWW 33-43.
Male. Body length 1075 (critical point dried specimen). Head brown, distinctly darker
than yellowish brown body. Head (Fig. 45) large, with height 208, length on midline 149,
width 307, and 1.55 width of mesosoma. Face in lateral view forming a distinct rounded
protrusion just below eye level, with toruli facing obliquely upward and lower face and
mouthparts strongly sunken in, in lateral view not visible due to protruding gena; face in
anterior view with a curved row of 6 setae above mouth margin. Vertex small, without
ocelli (cf. Viggiani 1970), and widely separated from back of head by occiput. Eye small.
20
Review of Eustochus JESO Volume 138, 2007
Malar space as long as eye and malar sulcus absent. Gena 3 times width of eye. Mouth
about two-thirds width of head, with mandibles huge and capable of overlapping, each
with three teeth, the dorsal one blunt and set back, not in line with the two ventral teeth.
Labrum with one median seta. Mesosoma narrow and reduced. Pronotum visible in dorsal
view, divided medially. Propleura visible in dorsal view as protruding ‘shoulders’ lateral to
pronotum. Mesoscutum small, triangular, margined laterally by posterior of each pronotal
lobe. Notauli absent. Scutellum apparently not divided into anterior and posterior portions
and without placoid sensilla. Dorsellum narrow. Propodeum with small spiracle separated
about 3 times its diameter from dorsellum; propodeal seta midway between anterior and
posterior margins of propodeum, slightly more medial in position than spiracle. Pronotal
lobe length (maximum) 46, mesoscutum length45, scutellum length 47, dorsellum length 14,
propodeum length 122. Metasoma with petiole length 122. Gastral tergum1 overhanging
entire petiole, approximate relative lengths of gt,-gt, (along dorsal margin, critical point
dried specimens) 11, 15, 12, 9, 9, 9, 4. Spiracle apparently present. Cerci with two dorsal
setae longer than ventral two and curved. Gaster length (critical point dried specimen) 614.
Genitalia as in Fig. 46.
Forewing present (cf. Viggiani 1970) but minute and almost haltere-like. Hindwing
absent.
Antenna (Fig. 25) with 9 flagellomeres, the apical two widely joined, clava-like.
Relative proportions of segments L (W) [number of longitudinal sensilla, when present; if
different between left and right antenna, both numbers are given]: scape 130 (35), pedicel
72 (38), fi, 42 (22), fl, 41 (22), fi, 39 (27/24) [1/0], fl, 41 (26/34) [1/2], fl, 36 (36) [2], fi,
36 (37) [2/3], fi, 43 (38) [2], fl, 42 (39) [3], fl, 44 (35) [3]. The widths of fl, and fi, differ
between the left and right antennae due to the different numbers of longitudinal sensilla.
Discussion. This species is distinguished from the other species with long ovipositors by
proportions of the funicle segments, microtrichial pattern behind the forewing venation,
and relatively longer marginal vein. No other described species has such a long venation
(distance between first and second distal macrochaeta at least 1.8 times distance between
proximal and first distal macrochaeta).
The type material of E. atripennis is lost (Graham 1982). Haliday sent specimens
to Spinola in Turin (MRSN) and Graham examined the one specimen of E. atripennis there.
He suggested that it could be designated as neotype, if no undoubted Walker specimen were
found. This specimen was examined by JH. It is still in good condition, exactly as Graham
(1982) described it (complete, except right pair of wings missing) but is not designated as
a neotype here because E. atripennis is not a problematic taxon and an objective definition
of it is not necessary (ICNZ, 1999, Article 75). The specimen (MRSN) is labelled: 1.
“Museo Zoologia/Torino - Italia”. 2. “Eustochus/ atripennis Haliday/ Lectotype °/ M de
V. Graham, 1972”. This lectotype designation is incorrect, because the specimen was not
from the original material seen by Curtis. If desired, the specimen certainly serves as an
example of what Haliday meant when redescribing the species but there are many, more
recently collected, specimens in several museums that can serve as well.
Material examined. Forty-seven females and | male on cards or points, 10 female and one
male on slides (58 additional Swiss and one French specimen were examined many years
21
Huber and Baquero JESO Volume 138, 2007
prior to the present study; they are listed here). CZECH REPUBLIC, Bohemia: Praha-
Stomovka, 18-19August 1999, L. Masner, riparian, yellow pan trap (2, CNC); Revnice
environs, 20-21 August 1999, L. Masner, creek (2, CNC). ENGLAND, Avon: Bristol,
Hallen Wood, 22 July 1925 (2, USNM); Berkeshire, Wytham, em., 8 September 1949,
from soil under oak, G. C. Varley (22, BMNH); Cornwall, Scilly Is., Tresco, 21 September
1975, J. S. Noyes (2, BMNH); Devon, Birchette Wood, 13-21 August 1980 (2, BMNH);
Dorset, Bournemouth, 13 July, 17 August, and September 1981, 28 June 1983, S.C. S.
Brown (42, BMNH); Greater London, Richmond, 25 September 1907, C. Waterhouse
(2, BMNH); Hampshire, New Forest, 24 June 1954, J. Murgetroyd (9, BMNH); Romsey,
Awbridge, August, September 1981, June 1982. C. Vardy (92, BMNH). FRANCE, Haute-
Savoie: Vongy, 11 June 1964, C. Besuchet, dead leaves (9, MHNG). GERMANY, North
Rhine-Westphalia: Bornheim-Brenig, no date, M. Boness, on red currant (2, CNC).
HUNGARY, Somogy: Mernye, 17 August-4 September 1985, N. D. Springate (32, CNC).
SPAIN, Navarra: Artikutza, 29 May 1995, 600 m, 18 May 1997, 25 August—22 September,
6-20 October, and 20 October—17 November 1996, 590-610 m, L. Martinez de Murguia,
Malaise trap (62, CNC, MZNA); Iratibizkar, 26 July 2000, E. Baquero, pitfall trap (29,
CNC, MZNA). SLOVENIA: Bled, 5-12 August 1978, L. Huggert, luxuriant spruce forest,
pan trap (2, CNC); Rateée, 31 July—7 August 1978, L. Huggert, edge of marshy area, pan
trap, (2, CNC). SWITZERLAND, Geneva: Chancy, 8 May 1964, C. Besuchet, dead
leaves (54, 232, CNC, MHNG); L’Allondon, 2 and 7 May 1959, C. Besuchet, sifting
mosses (15°, MHNG); Ticino: Rancate, 8 August 1963, C. Besuchet, dead leaves (289,
CNC, MHNG); Valais, Euseigne, 1000 m, 10 July 1970, C. Besuchet, det. Viggiani, 1976
(52, MHNG); Vouvry, 27 March 1967, at base of old stump, det Viggiani, 1970 (¢, 29,
MHNG); Vaud, Cossonay, 4 August 1953, C. Besuchet, in old stump (2, MHNG).
Additional material (possibly E. atripennis). JAPAN, Honshu: Ibaraki, Mt. Tsukuba,
800 m, 18 September—2 October, 2-20 October 1989, M. J. Sharkey, pan trap (72, CNC).
SOUTH KOREA, Kangwon-Chucheon: Nam-myeon, Hudong-li,°31 July—16 August
2003, Malaise trap in semi-shade, forest edge (2, CNC). The South Korean specimen is as
large as the European (especially British) specimens, but fl, is longer so it is only tentatively
identified as E. atripennis. The Japanese specimens are smaller than E. atripennis from
Europe and because we are not sure if they are conspecific with it, we list them separately
here. The scanning electron micrographs were taken from the Mt. Tsukuba specimens and
may be E. atripennis. They have a long marginal vein but bidentate, instead of tridentate,
mandibles.
Eustochus besucheti Bakkendorf (Figs. 17, 27, 36, 37)
Eustochus besucheti Bakkendorf, 1965: 117 (description); Xu and Lin, 2003: 65 (list).
Diagnosis. Female. Body length 712-772 (n=3, critical point dried specimens). Head
width 192 (n=1). Mandibles each with 3 teeth. Mesosoma length/height about 1.35.
Ovipositor length 585, distinctly exserted beyond apex of metasoma and 1.85 times length
of hind tibia.
22
Review of Eustochus JESO Volume 138, 2007
Antenna (Fig. 17). Segment L (W) (n=1): scape 135 (32), pedicel 64 (31), fl, 45
(18), fl, 45 (18), fl, 53 (20), fl, 33 (30), fi, 33 (36), fl, 33 (39), entire clava 123 (58). Ratios
of L/W: scape 4.21, pedicel 2.05, fi, 2.48, fl, 2.56, fi, 2.68, fl, 1.1, fi, 0.92, fl, 0.84, entire
clava 2.15.
Wings (Fig. 27). FWL 810, FWW 229, FWL/FWW ratio 3.54. Distance between
first and second distal macrochaetae 1.33 times distance between proximal and first distal
macrochaeta. HWL 689, HWW 34.
Male. Eustochus besucheti is the only other species besides E. atripennis whose male is
known, based on a single specimen from Laquintal, the type locality. Apart from apparently
narrower fi, and fi, in E. besucheti, the males of the two species appear to be identical.
Discussion. This species is distinguished from FE. atripennis, the only other European
species with a long ovipositor, by its smaller size, shorter funicle segments, especially fi,
(Fig. 17), shorter forewing venation, and less sclerotized posterior margin of the forewing
just beyond the retinaculum.
Material examined. Three females on cards or point, one on slide. The holotype 2 and
allotype ¢ (MHNG) were not examined. CZECH REPUBLIC, Bohemia: Studnice near
Jablonec nad Nison, 860 m, 14 July 1964, V. Martinek (Q, CNC). SWITZERLAND,
Turgau: Unterwasser, 1440 m, 4 August 1984, L. Masner, screen sweeping (2, CNC);
Valais, Laquintal, 1400-1500 m, 1 July 1962, C. Besuchet, mosses (29, CNC). The
Laquintal specimens examined were preserved in alcohol from the type locality, but not
designated as paratypes by Bakkendorf (1965). They were critical point dried and point
mounted by the senior author and distributed between MHNG and CNC, by permission of
C. Besuchet.
Eustochus confusus Huber and Baquero, sp. nov. (Figs. 23, 33, 43, 47-50)
Diagnosis. Female. Body length 1100 (n=1, paratype on slide). Head width 230 (n=1).
Mandibles tridentate, each with a small dorsal tooth and 2 larger teeth, the middle one
thicker and longer than the ventral one. Mesosoma length/height about 1.5 (Fig. 43).
Ovipositor length 338-356 (n=2), not exserted beyond apex of metasoma and less than
(0.80-0.82 times) length of hind tibia.
Antenna (Figs. 23, 47, 48). Segment L (W) (n=2): scape 161-174 (38-40), pedicel
76-78 (32-33), fl, 64-66 (20), fl, 58-66 (21-24), fl, 51-52 (20-21), fl, 40-44 (28-31), fl, 38-41
(29-35), fl, 37-39 (29-41), entire clava 125-132 (46-48). Ratios of L/W: scape 4.21-4.39,
pedicel 2.35-2.36, fi, 3.24-3.29, fl, 2.38-3.10, fl, 2.54-2.60, fl, 1.29-1.57, fi, 1.08-1.38, fi,
0.94-1.33, entire clava 2.58-2.87.
Wings (Figs. 33, 49). FWL 1083-1151, FWW 262, FWL/FWW ratio (n=1) 4.39.
Distance between first and second distal macrochaetae 1.03-1.04 times distance between
proximal and first distal macrochaeta (Fig. 50). HWL 857-916, HWW 33-41.
23
Huber and Baquero JESO Volume 138, 2007
Discussion. This species is distinguished from the only other species with a non-exserted
ovipositor in the Palaearctic region, E. nipponicus, by the deeper mesosoma that is dorsally
more rounded in lateral view (Fig. 43) compared to a shallower mesosoma that is dorsally
flatter in lateral view (Fig. 44) and the wider asetose area between the retinaculum and rows
of microtrichia behind the venation (Fig. 33). In Europe, E. confiusus is the only species
with an ovipositor shorter than the hind tibial length. The other two, E. atripennis and E.
besucheti have long, exserted ovipositors that are longer than the hind tibia. It differs from
E. nearcticus by its narrower forewing (length/width ratio about 4.4).
Material examined. Two females on slides. HOLOTYPE ¥Y (MZNA) on slide labelled:
1. “MZNAXAO98a /Irati (Navarra, Spain), /18.1X.1982/ UTM:30TXN5460,/390 m,
UNZYEC leg./ MUSEO DE ZOOLOGIA/UNIV. DE NAVARRA”. 2. “Eustochus confusus
Huber and Baquero. Holotype Y”. The holotype is complete and was originally uncleared
and mounted laterally in Hoyer’s medium under a single cover slip (Fig. 23, 33, 43). After
being photographed it was cleared and remounted in Canada balsam. PARATYPE. Same
data as holotype (9, MZNA).
Species name. The species name, confusus, is Latin for confusing. It refers to the initial
confusion we had as to whether E. confusus was the same as E. nearcticus or not. If it had
been, it would be the first Eutochus species occurring in both Europe and North America.
While this is possible, because soil brought to North America as ballast in ships may have
contained parasitized hosts, it is unlikely, given the occurrence of both species in localities
that are not particularly near ports and that consist of native vegetation rather than human
altered habitats.
Eustochus nearcticus Yoshimoto (Figs. 18, 28, 38, possibly also 22, 32, 42)
Eustochus nearcticus Yoshimoto, 1990: 96 (description).
Diagnosis. Female. Body length 690-717 (n=2, critical point dried specimens). Head
width 194 (n=1). Mandibles each with 3 teeth, the dorsal one smaller than the ventral two.
Mesosoma length/height 1.55 (n=1) (Fig. 38). Ovipositor length 256-268 (n=2), 0.69-0.76
times length of hind tibia; not exserted beyond apex of metasoma.
Antenna (Fig. 18). Segment L (W) (n=2): scape 125-141 (30-32), pedicel 66-69
(29-30), fl, 55-66 (15), fl, 52 (19-20), fl, 44-46(17-18), fl, 41-47 (22-24), fl, 38-40 (29),
fl, 36-37 (32-35), entire clava 124-129 (39-50). Ratios of L/W: scape 4.17-4.44, pedicel
2.30-2.33, fl, 3.66-4.42, fl, 2.62-2.76, fl, 2.47-2.68, fl, 1.73-2.09, fl, 1.32-1.41, fl, 1.05-1.12,
entire clava 2.48-3.32.
Wings (Fig. 28). FWL 978-1048, FWW 278-283, FWL/FWW ratio 3.46-3.85.
Distance between first and second distal macrochaetae 1|.03-1.09 times distance between
proximal and first distal macrochaeta. HWL 778-863, HWW 30-31.
Discussion. Eustochus nearcticus is the only described species with a short ovipositor (Fig.
38) in the Nearctic region. It is distinguished from the two Palaearctic species with short
24
Review of Eustochus JESO Volume 138, 2007
ovipositors by proportions of the forewing and mesosoma. Eustochus nearcticus differs
from E£. nipponicus by its deeper mesosoma (length/height ratio about 1.5 compared to
about 1.8), with a more rounded dorsum in lateral view. It differs from E. confusus by its
wider forewing (length/width ratio at most 4.08).
Several specimens from western North America (AB, BC, MT) and southeastern
USA (NC) may belong to FE. nearcticus. We exclude them because we are not sure that
they really are conspecific. They are listed separately below. Minor differences in their
antennal proportions (funicle segments relatively short, somewhat as in E. confusus,
in those specimens slide mounted and measured) size of bare area in front of fore-wing
retinaculum, and height of mesosoma (e.g., Figs. 22, 32, and 42, all from a specimen from
NC), may reflect intraspecific variation within.£. nearcticus but may also indicate that they
are a separate species. A conservative approach is taken here and they are excluded from
E. nearcticus until more material, especially from intervening areas, becomes available
for detailed study. The antenna (Fig. 22) of the NC specimen resembles that figured by
Yoshimoto (1990, fig 36) in that fl, is relatively short, compared to Fig. 18. Both of the
latter figures are specimens from the type localities.
The specimens from British Columbia appear to have a flatter mesosoma, more
resembling FE. nipponicus, than the point-mounted paratypes of FE. nearcticus. It is difficult
to be sure how these specimens are distinguished from E. nipponicus. However, the western
Nearctic specimens all appear to have fl, slightly longer than fl,, whereas E. nipponicus has
fi, shorter than fl,. If they are indeed the same species as E. nipponicus then wider species
limits would then have to be accepted. Similarly, FE. nearcticus specimens from eastern
Canada may be the same as E. confusus, but, if so, wider species limits would again have to
be accepted. Finally, the western specimens may represent a different species from either
E. nipponicus, E. confusus, or E. nearcticus, and possibly could be defined geographically
as well as morphologically. But since several specimens, possibly of E. nearcticus, are from
Ontario it is difficult to define the two populations geographically. It is also possible that
E. nipponicus and E. confusus are the extremes of only one species occurring across the
Palaerctic region, but so far no Eustochus resembling these two species has been collected
between Spain and Japan.
We prefer to treat the specimens with short-ovipositors as three species, with E£.
nearcticus occurring in northeastern North America but not in the Palaearctic region, and EF.
nipponicus distinct from E. confusus in the Palaeactic region. Much more material of these
species is required, especially from intervening areas, to verify their status relative to one
another and determine how many species really are involved.
The craterlike pits on the propodeum, visible on the scanning electron micrograph
in figure 148 of Yoshimoto (1990), are an artifact, presumably due to remnants of a liquid
deposit on the specimen. Cleared, slide mounts prepared of two specimens from the type
locality do not show these pits; the sculpture is uniformly reticulate.
Material examined. Three females on points, two on slides. The holotype (CNC) is
complete and in good condition on a point. Three paratypes from Nova Scotia, as listed
in the original description, were also seen. The fourth paratype, from British Columbia,
is a different species, assigned here to E. yoshimotoi, sp. n. (see below). The paratype
from MacKenzies Mt. was slide mounted for detailed study. An additional specimen from
25
Huber and Baquero
JESO Volume 138, 2007
MacKenzies ML, listed below, was also slide mounted; it was not included in the type series
by Yoshimoto (1990), for unknown reasons,
CANADA, Nova Scotia: Cape Breton Highlands Nat. Park, MacKenzies Mt., 9
August 1983, J. E. H. & R. J. Martin (9, CNC),
Additional material, Thirteen other specimens that may be /, nearcticus were examined,
3 of them (MT and NC) are on slides. CANADA, Alberta: Waterton Lakes National Park,
2 August 1985, Cameron Creek on Akamina Parkway near mouth of Rowe Creek, gravel in
riffle, 1. M. Smith (9, CNC). British Columbia: Kootenay National Park, Daer Pitts, 16-
30 July 2000, G. Gareau, MT, aspen (25°, CNC). Ontario: Brucedale Conservation Area
near Port Elgin, 19 April-16 June 1988, C. Dondale and J. Redner, pit fall trap at edge of
swamp (Y, CNC). UNIFPED STATES: Montana, Flathead Co., Glacier National Park, N.
Fork Flathead area, S. Big Prairie, 3560°, T35N R21 W, sect. 16, 10-17 August 1993, M. A,
Ivie, old growth light burn (24°, CNC). North Carolina: Jackson Co., Whiteside Mt., near
Highlands, 1600 m, April-20 July 1987, CNC Hym. Team, oak forest (29, CNC); Swain
Co., Andrews Bald, pitfall 51, N 35° 20°32” W 83° 39°29’, 10-24 May, 6-22 June, and 10-
25 September 2001, Parker, Stocks, Petersen (S°, CNC).
Eustochus nipponicus Huber and Baquero, sp. nov. (Figs. 24, 34, 44)
Diagnosis. Female. Body length 947-1100 (n=3, critical point dried specimens), Head
width 188-198. Mandibles each apparently tridentate, with 2 large ventral teeth and a small,
dorsal tooth. Mesosoma length/height 1.82 (Fig. 44). Ovipositor length 281 (holotype), not
exserted beyond apex of metasoma and less than (0.91 times) length of hind tibia.
Antenna (Fig. 24). Segment L (W) (holotype): scape 138 (35), pedicel 69 (32),
fl, 51 (19), fl, 51 (20), fi, 41 (20) fl, 44 (24), fl, 39 (29), fl, 37 (32), entire clava 110 (54).
Ratios of L/W: scape 3.89, pedicel 2.19, fl, 2.71, fl, 2.62, fl, 2.01, fl, 1.10, fl, 1.36, fl, 1.15,
entire clava 2.03.
Wings (Fig. 34). FWL 974, FWW 232, FWL/FWW ratio 4.09. Distance between
first and second distal macrochaetae 1.04 times distance between proximal and first distal
macrochaeta. HWL 823, HWW 34.
Discussion. This species is distinguished from /. confusus, the only other Palaearcic species
with a short ovipositor, by the shallower mesosoma with a flatter dorsum in lateral view,
and the narrower asetose area between the retinaculum and rows of microtrichia behind the
venation (Fig. 34).
Material examined, Four females, one ona slide. HOLOTYPE Y (CNC) on slide labelled:
|. “Japan: Honshu/, Iwate, lwaizumi/ Hitsutori, 770m/11-17.vili.1991/ A. Smetana [J47]”.
2. “Eustochus/ nipponicus/ Huber &/ Baquero/ Holotype Y”. The holotype is cleared and
mounted laterally (Fig. 44) under a 6 mm cover slip, with the wings and one antenna under
two additional cover slips. PARATYPES. Same locality data as holotype (29, CNC);
Iwate, Kawai, Yoshibezawa, N 39° 37’ E 141° 31°, 500 m, 25 August 1996, L. Masner,
screen sweeping (Y, CNC).
Review of Eustochus JESO Volume 138, 2007
Species name. The species is named from the Japanese name for the country of origin,
Nippon.
Eustochus pengellyi Huber and Baquero, sp. nov. (Figs. 20, 30, 40)
Diagnosis. Female. Body length 666-896 [up to 973 when gaster somewhat inflated] (n=8,
critical point dried specimens). Head width 184 (holotype). Mandibles each with 2 teeth.
Mesosoma length/height 1.33-1.44 (n=3, critical point dried specimens). Ovipositor length
439, 1.40 times length of hind tibia and distinctly exserted beyond apex of metasoma.
Antenna. Segment L (W) (holotype): scape 121 (30), pedicel 62 (27), fl, 50 (14),
fl, 46 (17), fl, 39 (20), fl, 38 (23), fl, 36 (27), fl, 35 (29), entire clava 105 (54). Ratios of
L/W: scape 4.08, pedicel 2.29, fl, 3.63, fl, 2.62, fl, 1.97, fl, 1.66, fl, 1.33, fl, 1.22, entire clava
1.93.
Wings. FWL 799, FWW 228, FWL/FWW ratio 3.51. Distance between first and
second distal macrochaetae 1.15 (1.30 on other wing) times distance between proximal and
first distal macrochaeta. HWL 668, HWW 26.
Discussion. This species is distinguished from FE. yoshimotoi, the only other Nearctic
species with a long, exserted ovipositor, by a narrower asetose area above the retinaculum
that is separated from the venation by only one complete line of microtrichia (wider asetose
area and at least a partial second line of microtrichia in E. pengellyi). It differs from E.
atripennis by its shorter venation, from E. besucheti by antennal proportions, and from E.
triclavatus by the number of claval segments. The specimens from Japan that we treat as
possibly E. atripennis on the basis of a long venation, also have bidentate mandibles.
Material examined. Thirteen females, two on slides. HOLOTYPE 9 (CNC) on slide
labelled: 1. “CANADA: ON/, Flint Hill near/ Kemptville/, 19-20.vii.1983/, L. Dumouchel”.
2. “Eustochus/ pengellyi/ Huber and Baquero °/ Holotype”. The holotype is cleared
and mounted dorsally in Canada balsam under one 6 mm cover slip and the wings, and
head, antennae and prothorax are under two other coverslips. PARATYPES. CANADA,
Ontario: Frontenac Co., 5 km W. Chaffey’s Locks, Skycroft Campground, 9-14 July
1987, B. Hubley, MT (22, CNC); Thetford, 10-13 October 1982, A. Tomlin, FIT (2, CNC);
Haliburton Forest and Wildlife Reserve, N 45° 15’ W 78° 35’, 12 July 2001, C. Vance,
maple forest, MT (2, CNC); 7 km SE Westport, 134 m, N 44° 37°727’ W 76° 217545’,
1-31 August 2005, S. Peck, maple sugar bush, FIT (9, CNC). Quebéc, Lac Jean-Venne, N
45° 41’ W 76° 03’, 15-20 June, Osmunda marsh, YPT and 14-21 August 1995, L. Masner &
J. Denis, Osmunda marsh creek, YPT (22°, CNC). UNITED STATES, Indiana: Laporte
Co., Indiana Dunes National Lakeshore, Heron Rookery, 29 July 1997, R. Grundel, MT
(22, CNC, USNM). Maryland: Prince George's Co., Beltsville-Agricultural Research
Centre, 1-9 July1980, K. Thorpe, Malaise trap on corn field edge (2, USNM). Tennessee:
Blount Co., Cades Cove, N 35° 2535’ W 83° 17”50’, 29 July1997, R. Grundel, MT (2°,
CNC).
S|
Huber and Baquero JESO Volume 138, 2007
Species name. The species is named in honour of Dr. David Pengelly, whose enthusiasm for
teaching entomology encouraged several students to pursue insect taxonomy as a career.
Eustochus triclavatus Xu and Lin (Figs. 19, 29, 39)
Eustochus triclavatus Xu and Lin, 2003: 66 (description).
Diagnosis. Female. Body length about 720 (n=1, ?paratype on slide). Head width
193. Mandibles each with 3? teeth (not clearly visible). Mesosoma length/height 1.35.
Ovipositor length 415, distinctly exserted beyond apex of metasoma and 1.16 times length
of hind tibia.
Antenna (Fig. 19). Segment L (W) (?paratype): scape—[not measurable] (ca. 23),
pedicel 63 (24), fl, 47 (15), fl, 52 (15), fl, 47 (14), fi, 52 (20), fl, 45 (23), fi, 41 (23), entire
clava 137 (40). tion of L/W: pedicel 2. 58, fi, 3. 14, fi, 3.46, fl, 3.25, fi, 2:57, fi, 1.96, fi,
1.77, entire clava ca. 3.42.
Wings (Fig. 29). FWL 857, FWW 264, FWL/FWW ratio 3.25. Distance between
first and second distal macrochaetae 1.41 times distance between proximal and first distal
macrochaeta. HWL 731, HWW 31.
Discussion. This species is distinguished from all others described so far by the three-
segmented clava (two segmented in other species). It belongs to the group of species with
distinctly exserted ovipositors.
Material examined. One female on slide. CHINA, Shanxi: Fengxian, 2°, 4 September
1999, N.Q. Lin, CNC. The locality (Baoji) given in the original description differs from
the specimen label, quoted here; it is not certain whether this specimen is a paratype. The
holotype 2 (FAFU) was not examined.
The paratype is uncleared, poorly oriented, and the clava of each antenna is slightly
collapsed. It appears to have the division between claval segments 2 and 3 less distinct and
perhaps incomplete, at least on one antenna.
Eustochus yoshimotoi Huber and Baquero, sp. nov. (Figs. 21, 31, 41)
Diagnosis. Eustochus yoshimotoi is one of two Nearctic species with a distinctly exserted
Ovipositor. It is distinguished from the other, E. pengellyi, by the wider, more distinct
asetose area behind the marginal vein (narrower in pengell/yi) and the tridentate mandible
(bidentate in E. pengellyi).
Description. Female. Body length 845 (n=3, critical point dried specimens). Head width
211 (n=2). Mandibles each with 3 teeth. Mesosoma length/height 1.29-1.48. Ovipositor
(Fig. 41) distinctly exserted beyond apex of metasoma, 485-525 (n=3) long and 1.24-1.32
times length of hind tibia.
Antenna (Fig. 21). Segment L (W) (n=2): scape 135-144 (32-33), pedicel 66-71
(32-33), fl, 55-60 (17), fl, 48-56 (17), fl, 44-54 (19-20), fi, 39-44 (27-29), fi, 39-41 (34),
28
Review of Eustochus JESO Volume 138, 2007
fi, 39-40 (38), entire clava 121-138 (57-59). Ratios of L/W: scape 4.06-4.28, pedicel 2.07-
2.10, fi, 3.27-3.51, fi, 2.80-3.19, fl, 2.25-2.87, fl, 1.43-1.55, fi, 1.14-1.20, fi, 1.05-1.06, entire
clava 2.03-2.59. .
Wings (Fig. 31). FWL 950-994, FWW 281-298, FWL/FWW ratio 3.33-3.44.
Distance between first and second distal macrochaetae 0.90-1.02 times distance between
proximal and first distal macrochaeta. HWL 739-809, HWW 38-41.
Material examined. Seven females, four of them on slides. HOLOTYPE & (CNC) on
slide labelled: 1. “USA, WA,/ Pierce Co./ Ashford/ 1-14.viti.1985/ L. Masner, Malaise trap”.
2.“Eustochus/ yoshimotoi °/ Huber and/ Baquero/ Holotype”. The holotype is cleared and
mounted laterally under one 6 mm cover slip.in Canada balsam and the wings are under
another coverslip. PARATYPES. Same data as holotype (42, CNC, USNM); CANADA,
British Columbia, Vancouver Is., Mesache Lake, July 1984, MT, Sharkey—Johnson (°,
CNC). UNITED STATES, California, El Dorado Co., Blodgett Forest, 27 August 1975,
F. Andrews, M. Wasbauer, Pinus ponderosa log (2, UCRC). The paratype from British
Columbia was designated originally as a paratype of E. nearcticus by Yoshimoto (1990) and
bears the paratype label “Eustochus nearcticus”, as well as ours “Eustochus yoshimotoi’.
Species name. The species is named in honour of Carl Yoshimoto, the senior author's
predecessor with the Canadian Forest Service, who was a taxonomist at the CNC and
described the first North American species of Eustochus.
Acknowledgements
We thank K. Bolte for preparing the digital images and compiling the plates and
the curators of the institutions listed above for loaning or donating material to us for study.
B. Landry kindly checked the number of specimens of E. atripennis and E. besucheti in
MHNG and provided their collection information. Through the kindness of G. Pagliano
(MRSN), the senior author was able to borrow the Haliday specimen of E£. atripennis in the
Spinola collection, and an additional specimen of one species was found and brought to my
attention by S. Triapitsyn (UCRC). The manuscript was critically reviewed by G. Gibson
and A. Bennett (CNC).
References
Annecke, D. P. and R. L. Doutt. 1961. The genera of the Mymaridae. Hymenoptera:
Chalcidoidea. Entomology Memoirs. Department of Agricultural Technical
Services, Republic of South Africa 5: 1—71.
Ashmead, W. H. 1904. Classification of the chalcid flies of the superfamily Chalcidoidea,
with descriptions of new species in the Carnegie Museum, collected in South
America by Herbert H. H. Smith. Memoirs of the Carnegie Museum 1(4): 225—
555.
29
Huber and Baquero JESO Volume 138, 2007
Bakkendorf, O. 1965. Description of a new subterranean species including a male and
female of Eustochus Hal. Mitteilungen der Schweizerischen Entomologischen
Gesellschaft 37: 117—122.
Blanchard, E. 1840. Histoire naturelle des insectes Orthopteres, Névroptéres, Hémiptéres,
Hyménopteres, Lépidopteres et Dipteres. Paris: Duménil. 672 pp.
Curtis, J. 1832. British Entomology 9: folio 411. Plates 386—433 (with text).
Dalla Torre, C. G. de. 1898. Subfam. Mymarinae. pp. 422-431. Catalogus hymenopterorum
hucusque descriptorum systematicus et synonymicus. Vol.5: Chalcididae et
Proctotrupidae. Lipsiae [Leipzig]: Guilelmi Engelmann. 598 pp.
Debauche, H. R. 1948. Etude sur les Mymarommidae et les Mymaridae de la Belgique
(Hymenoptera Chalcidoidea). Mémoires du Musée Royal d’Histoire Naturelle de
Belgique 108: 1—248 + 24 plates.
Foerster, A. 1847. Ueber die Familie der Mymariden. Linnaea Entomologica 2: 195-233.
Foerster, A. 1856. Hymenopterologische Studien. II]. Heft. Chalcidiae und Proctotrupii.
Aachen: Ernst ter Meer. 152 pp.
Gahan, A. B. and Fagan, M. M.1923. The type species of the genera of Chalcidoidea or
chalcid-flies. Bulletin of the United States National Museum 124: 1-173.
Gibson, G. A. P. 1997. Morphology and terminology. pp. 16-44 /n Gibson, G. A. P., J.
T. Huber, and J. B. Woolley (eds.), Annotated keys to the genera of Nearctic
Chalcidoidea. Ottawa: NRC Research Press. 794 pp.
Graham, M. W. R. de V. 1982. The Haliday collection of Mymaridae (Insecta, Hymenoptera,
Chalcidoidea) with taxonomic notes on some material in other collections.
Proceedings of the Royal Irish Academy, B 82: 189-243.
Haliday, A. H. 1833. An essay on the classification of the parasitic Hymenoptera of Britain,
which correspond with the Ichneumones minuti of Linnaeus. Entomological
Magazine |: 259-276, 333-350.
Huber, J. T. 1987. Review of Schizophragma Ogloblin and the non-Australian species of
Stethynium Enock (Hymenoptera: Mymaridae). The Canadian Entomologist 119:
823-855.
ICZN. 1999. International Code of Zoological Nomenclature, Fourth Edition. London:
International Trust for Zoological Nomenclature c/o The Natural History Museum.
306 pp.
Kryger, J. P. 1950. The European Mymaridae comprising the genera known up to c. 1930.
Entomologiske Meddelelser 26: 1—97.
Schauff, M. E. 1984. The Holarctic genera of Mymaridae (Hymenoptera: Chalcidoidea).
Memoirs of the Entomological Society of Washington 12. 67 pp.
Schmiedeknecht, O. 1909. Hymenoptera fam. Chalcididae. Genera Insectorum 97: 1—550
+ 8 pls.
Schmiedeknecht, O. 1930. Die Hymenopteren Nord- und Mitteleuropas. Jena: Gustav
Fischer. 1062 pp.
Trjapitzin, V. A. 1978. Hymenoptera II. Chalcidoidea 18. Mymaridae. Opred Nasek. Evrop.
Chasti SSSR. 516-538. [In Russian.] [English translation: Family Mymaridae
(Mymarids). pp. 942—982 Jn Keys to the Insects of the European Part of the USSR.
III. Part 2., Medvedev, G. S. (ed.), 1987. Oxonian Press, New Dehli. 1341 pp.]
30
ee
Review of Eustochus. JESO Volume 138, 2007
Ulrich, W. 1999. Phenology and life cycles of the parasitic Hymenoptera of a dry meadow
on limestone. Polskie Pismo Entomologiczne 68: 383-405.
Viggiani, G. 1970. Description of the male of Eustochus atripennis Hal., 1833, and new
terricolous spcies of Cleruchus Enock, with remarks on Anagrella Bkdf. (Hym.,
Mymaridae). Mitteilungen der Schweizerischen Entomologischen Gesellschaft
43: 135-142.
Viggiani, G. 1989 (1988). A preliminary classification of the Mymaridae (Hymenoptera:
Chalcidoidea) based on the external male genitalic characters. Bollettino del
Laboratorio di Entomologia Agraria “Filippo Silvestri” 45: 141-148.
Walker, F. 1846. Descriptions of the Mymaridae. Annals and Magazine of Natural History
18: 49-54.
Westwood, J. O. 1839. Synopsis of the genera of British insects: 78—79. [Issued with An
Introduction to the Modern Classification of Insects. London: Longman, Orme,
Brown, Green, and Longmans. |
Xu, M. and Lin, N.-Q. 2003. A new species of the genus Eustochus Haliday (Hymenoptera:
Chalcidoidea: Mymaridae) in China. Entomologia Sinica 10: 65-68.
Yoshimoto, C. M. 1990. A review of the genera of New World Mymaridae (Hymenoptera:
Chalcidoidea). Flora & Fauna Handbook no. 7. (Gainesville: Sandhill Crane
Press). 166 pp.
¢ ‘yeti, Vs 1a “Fiat Pines eg wo
-eeunyQusetcatt ) wnbi mareh/ elt hoor
fob dot ating amstagiedy silesinieg aaah’ Eis
Nee Bete tbh rp ‘pao vie agayh Tuba, Wig
veubhecht hecieie “© 329 Gas — bos sdesta- websted A
Jonnecqaneenp ). Meanie ei Mans Ra
aA die feougel) OP et” sgasens: owbidl: io aveneg ott ip: peatidale ie
want? ,.ans Af aaa irene i. dr tena a
jae, crolér hibeteathe hypo eal AAMT
uveiquet gare iby rian bug pen ieDokaas A vine, ot Ta zoroqa
' Nei A IM parte atone
vtutyor gery) ly othr i Gate te wait Jo #oamgonhhile
conwe,) Mdbnwe Bauaereseonas pnb tue
rol 3 By Wen lasted, psoas
bie a in NC Retina etl teas pep
| WW oY; OORT Toe Mealideventin Vand Moyrioridae |
4h George “netéy od: Seip nnareriak’ tn) enther 6
| { , he icpik, HS 2e TAS AaB, ’
. . sercsapet) he parmatite By yghopte
neruiti a Lien cut 2
Pei
f i i“ _
7 ninter aiik he son Awira rc
' vester wT TAC } J} ai 0 ino
vo ¥f
TU a jth vat adi
. ’
fo Die boinc) Mae
, is , vd ron micty; Chalota
Oo ik Se FW cocheatgy gn 12. OF pp, :
fare, Clvelodudes. {feng ra lnsectonedt 1 Med
oe a o> Ope!
‘ . = ie
ymenontoren” Word: tain Majtelenoi pall
eg lt cba nidot or
iM fie mumnar) 1:
New genus and species of Perilampidae JESO Volume 138, 2007
A NEW GENUS AND SPECIES OF PERILAMPIDAE
(HYMENOPTERA: CHALCIDOIDEA) WITH UNCERTAIN
PLACEMENT IN THE FAMILY
J. M. HERATY! AND D. C. DARLING?
Department of Entomology, University of California, Riverside, CA 92521, USA
email: john. [email protected]
Abstract J. ent. Soc. Ont. 138: 33-47
A new genus and species of perilampid wasp is described from Yemen and
Israel. The features of the adult do not allow for accurate placement within
any of the existing subfamilies of Perilampidae. The adults are similar to
Chrysolampinae; however, the mandibles have a 3/2 formula and although
the ventral surface of the male scape has distinct pores, these are not isolated
within pits or depressions, which is characteristic of Chrysolampinae and
Perilampinae. The labrum is similar to most Perilampinae, but the prepectus
is associated with the mesepimeron and not the pronotum. The ovipositor is
strongly expanded at the apex and scimitar-shaped, whereas the ovipositor
in all other Perilampidae is needle-like. The morphological features that
relate to the potential phylogenetic placement of this genus in the perilampid/
eucharitid complex are discussed.
Published November 2007
Introduction
The composition and higher level relationships of Perilampidae are uncertain.
There has been debate over the inclusion of Akapalinae, Chrysolampinae, Echthrodapinae,
and Philomidinae together with the more easily characterized Perilampinae within a single
family (Ferriére and Kerrich 1958; Riek 1966; Graham 1969; Bouéek 1972, 1983, 1988;
Burks 1979; Bouéek and Rasplus 1991; Darling 1986, 1995; Noyes 1990; Gibson et al.
1999). Echthrodapinae are now placed in Torymidae (Grissell 1995). Together or in part,
these problematic subfamilies have also been proposed as a sister group or paraphyletic grade
to Eucharitidae (Darling 1988, 1992; Gibson et al. 1999). Support for a close relationship
between these groups is based almost entirely on morphology and behavior of the first-instar
larva or planidium (Heraty and Darling 1984; Darling 1988, 1992; Heraty et al. 2004). The
planidia of the eucharitid subfamilies, Gollumiellinae, Oraseminae, and Eucharitinae, are
all very similar and several features support the monophyly of the Eucharitidae (Heraty and
' Author to whom all correspondence should be addressed.
? Department of Natural History, Royal Ontario Museum, 100 Queen’s Park, Toronto,
Ontario, M5S 2C6, Canada and Department of Ecology and Evolutionary Biology,
University of Toronto, Toronto, Ontario, Canada M5S 1A1; [email protected]
33
Heraty and Darling JESO Volume 138, 2007
Darling 1984; Heraty et al, 2004), The life history and immature stages of Akapalinae, which
has been placed in either Perilampidae or Eucharitidae, are unknown. In an analysis of 20
morphological features of immature stages, Chrysolampinae were sister to Philomidinae
+ (Perilampinae + Eucharitidae), with the latter three groups united by features of the
planidium that include presence of a straplike tergite, absence of larval antennae, and an
eversible postlabium (Darling 1992), Similar results were obtained from a combined larval
and adult morphology dataset (Gibson et al. 1999), Initial results from molecular analyses
with 28S-D2 ribosomal transcript supported monophyly of Eucharitidae (two genera), but
not Perilampidae + Chrysolampinae, although with only four taxa sampled, the results are
not reliable (Campbell et al. 2000).
Adults of Chrysolampinae and Perilampinae share two apomorphic features: one
or more pores concentrated within distinct pits or depressions on the ventroapical surface
of the male scape, and the gaster high and triangular in profile with the 2™ and 3" gastral
tergites subequal in size and fused medially (Darling 1986, 1997; Gibson et al. 1999).
Philomidinae have been tentatively placed within Perilampidae (Noyes 1990, 2002), but
other than possessing a similar compressed antennal flagellum and a similar gaster shape,
there are no compelling adult characters to support this grouping. Similarly, the only adult
feature of consequence grouping Perilampidae and Eucharitidae is the flap-like labrum with
marginal setae (Darling 1988a); the labrum of Philomidinae is very different and more
similar to Chaleididae (Darling 1988a; Gibson et al, 1999),
Chrysolampinae are easily recognized but difficult to define with synapomorphies.
Apart from what defines Perilampidae as a whole, Chrysolampinae have only a single
prominent synapomorphy — the mandibles each with two sharp apically positioned teeth
(Bouéek 1972, 1988; Darling 1986). Darling (1986, 1988) proposed that the flap-like
structure of the labrum with marginal setae (and no digits) could be another synapomorphy,
although some species that are referable to Chrysolampus have since been discovered to
have a digitate labral margin, as is typical of Eucharitidae and some Perilampinae (Darling,
unpublished),
Perilampinae are easily recognized and have anumber of diagnostic and apomorphic
features (Bouéek 1978, 1988). Synapomorphies of Perilampinae include fusion or at least
a very close association between the prepectus and pronotum, and pronotum with a dorsal
collar (Bouéek 1978). The labrum of Perilampinae is flap-like, digitate, and medially
incised (Darling 1988). Most species also have a pair of aboral digits or sessile setae, and
a pair of translucent areas that are interpreted as vestigial sockets (Darling 1988). The
groundplan structure in Perilampidae is considered to be a fan-like labrum with marginal
digits as in Eucharitidae, although aboral digits are possibly a groundplan feature (Darling
1988). Perilampinae all have 3/2 dentate mandibles, but this is likely plesiomorphic for
Chalcidoidea (Bouéek 1978).
Philomidinae do not help to resolve the relationships of Chrysolampinae and
Perilampinae. The subfamily is highly autapomorphic in morphology. Adults share with
Perilampidae a compressed, densely setose antennal flagellum, and the basal tergite (Gt, )
with distinct dorsal and lateral panels, but the labrum is sclerotized, flap-like, and broadly
attached ventrally to the epipharynx with scattered surface setae (as in Chalcididae), the
prepectus is swollen and shoulder-like, and the pronotum is reduced and obscured in dorsal
view (Darling 1988; Heraty and Darling, unpublished), Like Chrysolampinae, the mandibles
34
New genus and species of Perilampidae JESO Volume 138, 2007
are bidentate with sharp apical teeth. If Philomidinae are part of this same lineage, as
suggested by the morphology of the first-instar larva, then the sails am mandibles are
potentially plesiomorphic for Chrysolampinae.
Recently, a species representing a new genus of chalcidoid wasp was collected
in Israel and Yemen. It has features shared with both Chrysolampinae and Perilampinae
that suggests that it may be either a plesiomorphic perilampid or a potential sister group
to one or both of these subfamilies. Our purpose here is not to provide a final and formal
placement of this genus, but to establish its name and provide a detailed discussion of
important features as a prologue to more in-depth morphological and molecular studies that
are in progress on the higher relationships of the perilampid-eucharitid complex.
Methods and Materials
Terms follow Darling (1988; for mouthparts), Heraty (2002), Gibson (1997), and
Heraty and Quicke (2003; for ovipositor). Our terms differ in one major aspect involving
the apex of the antennal flagellum. In many Chalcidoidea with an apparent 13-segmented
antenna, the apical segment of the clava often has a small button-like apical sensillar area
beyond flagellomere 11 (f1,,; antennomere 13) that is differentiated to the same degree
as between fi'° and fl'', but with no multiporous plate sensilla (Fig. 2, f1,,). The archaic
family Rotoitidae has a 14-segmented antenna (Boucek and Noyes 1988), and we consider
this button-like structure in these and other Chalcidoidea as homologous to the 14"
flagellomere of Rotoitidae. Therefore, a 14-segmented antenna is a more general condition
across Chalcidoidea. Colour versions of the figure plates are accessible from JMH or http://
hymenoptera.ucr.edu.
Jambiya vanharteni n. gen. and n. sp. (Figs. 1-23)
Etymology. Jambiya is treated as an arbitrary combination of letters; the gender is
considered to be female. The name is based on the name of the small curved Yemeni dagger
of the same name which is similar in form to the female ovipositor. The species is named
after Tony van Harten, the collector of the specimens from Yemen.
Current placment. J/ncertae sedis within Perilampidae (see discussion below).
Diagnosis. In Jambiya, the mandibles are 3/2 toothed (Fig. 6), the epipharynx has a single
pair of epipharyngeal setae (Fig. 4), the labrum is flap-like and digitate with paired aboral
digits and translucent areas (Fig. 5), the petiole is membranous ventrally (Fig. 15), the ventral
surface of the male scape has scattered minute pores without prominent pits or depressions
(Figs. 7, 8), the mucro is long and acuminate (Fig. 20), and the ovipositor is apically expanded
and dentate (Fig. 20). This genus is similar to Chrysomalla (Chrysolampinae), which also
has the distinct carina demarking a pronotal collar and a ventrally membranous petiole, but
differs in several key features considered as diagnostic of the subfamily. Jambiva differs
from all known genera of Perilampinae by having the labrum not medially incised, ventral
35
Heraty and Darling JESO Volume 138, 2007
surface of the male scape without any distinct pits (although minute pores are present),
pronotum and prepectus + mesepisternum loosely articulated, ovipositor with the ventral
valves expanded and flattened, and in several aspects of the forewing venation (parastigmal
break, linear stigmal sensilla, short postmarginal vein), Without any congeneric species for
comparison, all of the generic diagnostic features are also relevant for species recognition.
Female. Length |.1-1.3 mm. Body color black with iridescent bluish reflections; tarsi pale
brown; ovipositor valves light brown. Wings hyaline, forewing venation brown.
/ F
a “4
60 sm
FIGURES 1-8, Jambiya vanharteni. \-female head in frontal view; 2—female antenna;
3—male antenna, 4—epipharynx; 5—labrum; 6—mandibles; 7—male scape, ventral view; 8—
closeup of inset box from Fig. 7, Abbreviations; anl-anellus; f1,,flagellomere 12; pdl—
pedicel,
36
New genus and species of Perilampidae JESO Volume 138, 2007
FIGURES 9-15. Jambiya vanharteni. 9-female habitus; 10—female head and mesosoma,
dorsal view; 11—13, male mesosoma: 11-—subdorsal view, 12-—sublateral view, 13-
posterodorsal view; 14—petiole in dorsal view, closeup of Fig. 13; 15, petiole and first
sternite in subventral view. Abbreviations: axg—axillular groove; clc—collar; crs—crenulate
sulcus; fmd—femoral depression; fre—frenum; Gs,—gastral sternite 1; Gt,—gastral tergite 1;
occ—occiput; pre—prepectus; vmpt—ventral margin of petiole.
37
Heraty and Darling JESO Volume 138, 2007
FIGURES 16-22. Jambiya vanharteni. 16—forewing; 17—hind wing; 18—stigmal vein; 19-
forewing vein; 20—apex of gaster, lateral view; 21—male genitalia, ventral view; 22—ovariole.
Abbreviations: aed—aedeagus; dgs—digitus; dv—dorsal valve; muc—mucro; par—paramere;
phb—phallobase; pmv—postmarginal vein; stg—stigmal vein; unc—uncus; vv—ventral valve;
2vf-second valvifer; 3v—third valvula.
Head. Rounded in frontal view (Fig. 1); eyes bare; median ocellus anterior to lateral
ocelli. Frons and lower face smooth and shining with scattered semi-erect setae; ocellar-
ocular depression absent; scrobal depression finely reticulate, shallow with rounded lateral
margins, and extending 2/3 distance to median ocellus; vertex lateral to ocelli transversely
strigate; occiput circularly colliculate (Fig. 6), dorsal occipital margin with a sharp carina
(Fig. 10, occ), carina extending to oral fossa although partially obscured ventrally by fine
postgenal striae. Clypeus smooth with few scattered short setae, margins demarked dorsally
and laterally by weakly impressed smooth sulci that are rounded at dorsolateral margins of
clypeus (clypeus nearly semicircular), clypeal margin slightly rounded with a transverse
shelf (Fig. 1); supraclypeal area indistinct. Malar sulcus demarked by a weak carina (Fig.
38
New genus and species of Perilampidae JESO Volume 138, 2007
transverse ridge
Dees Foe
Pi een oye" i iy
rw.
ee ee Tiwi oS
FIGURE 23. Jambiya vanharteni, ovipositor: A—dorsolateral view of apex; B—ventrolateral
view. Abbreviations: dv—dorsal valve; go-gonangulum; Gt —gastral tergites 7; lw—line of
weakness between third valvula and second valvifer; trs—triangular sclerite; v—valvula; vf—
valvifer; vv—ventral valve.
6); hypostomal lobes broadly separated. Mandibles opposing, 3/2 dentate with teeth long
and subequal (Fig. 6), basal articulation with gena membranous medially. Oral fossa broad.
Epipharynx with single pair of stout epipharyngeal setae (Fig. 4). Labrum with 9 marginal
acuminate digits, 2 aboral digits and 2 medial aboral translucent areas/vestigial sockets
(Fig. 5); palpi 4/3 segmented. Antenna 14-segmented; scape narrow and elongate with
no indication of ventral pits or pores in slide mounted antenna; anellus transverse (Fig. 2,
anl); length of flagellum less than height of eye; funicle 7-segmented, all segments broader
than long and slightly increasing in width apically; clava with four distinct, partially fused
segments, apical segment (f1,,) small and button-like; multiporous plate sensilla large and
numerous on all flagellomeres except flagellomeres 1—2 and flagellomere 12 (Figs. 2, 3);
numerous socketed setae on pedicel and flagellum.
Mesosoma. Pronotum with distinct transverse collar demarked by a transverse carina (Figs.
9-12, clc); collar swollen and projecting laterally anterior to spiracle (Fig. 13), anterior
face imbricate and mostly bare, mostly smooth posterior to carina and with scattered semi-
erect setae; pronotum overlapping mesoscutum (Fig. 11). Mesoscutum mostly smooth with
scattered setae; notauli deeply impressed and converging but not meeting at midline (Figs.
39
Heraty and Darling JESO Volume 138, 2007
10, 11). Scutoscutellar sulci diagonal, meeting anteriorly at transscutal articulation; lateral
axillar lobe rounded and smooth (Figs. 10, 11); scutellar disc smooth medially and weakly
imbricate laterally, with scattered setae; axillular groove (axg) present but broad and only
slightly raised above surface (Fig. 11). Frenal line present and complete dorsally; frenum
(fre) broadly rounded, smooth medially and weakly striate laterally, extended only slightly
over metanotum (Figs. 11-13). Metanotum with broad rounded flange laterally, overlapping
propodeum but not overlapping propodeal spiracle (Fig. 13). Propodeum reticulate
medially with a smooth nucha; spiracle separated from anterior margin by its diameter,
margin of spiracle thick and raised (Figs. 11, 13); callus weakly sculptured with several
long setae (Figs. 11, 12); metepimeral groove present and foveate. Femoral depression
(fmd) broadly and shallowly impressed and weakly reticulate (Fig. 12); transepimeral
sulcus present; transepisternal sulcus present and associated with a weak carina (Fig. 12);
posterior margin of upper mesepimeron even and without any indication of the metathoracic
spiracle. Prepectus (pre) associated with mesepimeron, not fused with pronotum, and in a
different plane from pronotum (Fig. 12); dorsal half of prepectus ovoid with a broad foveate
medial depression (Fig. 12), overlapping base of tegula (Fig. 12), ventral half strongly
narrowed and associated with anterior inflected margin of mesepisternum; mesothoracic
spiracle exposed and prominent (Fig. 12). Propleura broadly separated ventrally, meeting
only near anterior margin (Fig. 12). Coxae smooth to weakly imbricate with scattered long
setae; midcoxa less than half size of hind coxa, hind coax semiglobose and with several
prominent long hairs dorsally; femora expanded medially; tibiae densely setose; fore tibia
obliquely truncate apically and with one large, curved, and bifid spur; mid tibia with a
single long spur almost as long as basitarsus; hind tibia with two spurs, longest half as long
as basitarsus; all tarsi 5-segmented; claws simple. Forewing venation distinct (Figs. 16,
18, 19); submarginal vein with 7 long setae dorsally; parastigma with hyaline break and
2 campaniform sensilla along posterior margin (Fig. 19); stigmal vein broadened apically
and with distinct uncus and 4 campaniform sensilla, stigmal vein roughly perpendicular
to forewing margin; postmarginal vein extending beyond stigmal vein, but equal in length
to vertical height of stigmal vein (Fig. 18); basal area bare except for track of setae along
cubital vein, speculum irregular (mostly setose), costal cell with dense short setae; disc with
dense fine setae and distinct marginal fringe, setal tracts on wing disc absent (Fig. 16). Hind
wing venation complete, no trace of basal vein (submarginal vein parallel and continuous);
3 hamuli; fringe present.
Metasoma. Petiole short and transverse, visible only as narrow smooth band dorsally (Fig.
14), ventrolateral margins of petiolar tergite (vmpt) not fused and petiole membranous
ventrally (Fig. 15); membrane attaching to anterior margin of gastral sternite; not overlapping.
Gastral terga smooth to very lightly coriaceous; basal tergites (Gt,.,) tightly appressed,
following tergites distinctly overlapping and articulating; Gt, depressed medially, anteriorly
with medial crenulate depression, laterally with irregular patch of setae (Fig. 13); following
tergites with single row of prominent setae (Fig. 9). Cerci circular with 5 setae. Sclerotized
epiproct absent. Basal sternite (Gs,) with transverse crenulate sulcus (crs) and raised flat
anterior region (Fig. 15); hypopygium with long, bare mucro (Fig. 20, muc). Ovipositor
sheaths long and parallel (Fig. 20, 2vf and 3v), second valvifer fused dorsally with a strong
internal ridge across dorsal apical margin (Fig. 23), third valvula (3v) separated from
40
Rn
New genus and species of Perilampidae JESO Volume 138, 2007
second valvifer by oblique suture (Fig. 23, posterior ventral margin of 2vf indicated by
arrow), and apically with tuft of setae; ventral valve abruptly expanded apically, laterally
flattened and scimitar shaped with 2 apical prongs (Fig. 20, vv); dorsal valve apically with 2
pronounced basally-directed, keel-like spines (Fig. 20, dv, one spine showing) and a minute
spine subapical to these.
Male. Length, 1.02 mm. Dark brown to black. Antennal scape smooth ventrally (Fig. 7),
minute pores present on ventral surface of scape, but visible only at high magnification, and
scape lacking pits or depressions surrounding pores (Fig. 8). Gt, subtriangular and setose.
Genitalia elongate (Fig. 21); aedeagus articulating and with prominent apodemes; parameres
long and thin with a single apical seta; digitus broad, rounded, and with 2 marginal spines.
Ovarian egg. (Fig. 22). Length 0.15-0.16 mm. Cylindrical without apical stalk or surface
sculpture.
Holotype. Female: YEMEN, 12 km NW Manakhah, 05 May—17 June 2002, A. van Harten;
deposited in CNCI. Paratypes. YEMEN: same locality and collector data, but 3 July—21
August 2001 (2), 6 July—21 August 2002 (2, 24; 2 with slide mount of antenna and one
set of wings, base of metasoma on card, ovipositor in vial on pin; 6 with head on card and
slide mount of wings, antenna and genitalia; body used for SEM); ISRAEL: Arava Valley,
0.2 km N Hazeva Field, N 30°46’56” E 35°14’39”, 26-27 April 1996, 450 ft, school in small
wadi, M. E. Irwin (@). All specimens deposited in CNCI.
Discussion
We are confident that Jambiya belongs to the family Perilampidae. The problem
remains as to which subfamily it should be associated with, or if it deserves a new subfamily
status. Several features are of interest in the placement of Jambiya and also affect our
current treatment of the existing subfamilies of Perilampidae.
Male scape. In all Perilampinae and Chrysolampinae, the ventral subapical region of the
male scape has distinct pits that are usually visible using simple light microscopy (Darling
1986, 1983, 1988b). Each of these pits is associated with | or more pores that are likely
associated with pheromone glands (Darling 1986); pores do not appear in the surrounding
interstices. The male scape of Philomidinae is reticulate without any visible pores, even
in slide mounts (Heraty and Darling, unpublished). Males of some Eucharitidae (some
Gollumiella, Psilocharis, and Neolosbanus) have scattered ventral pores visible only in
slide preparations or under high magnification using SEM (Heraty 1994, 2004), however
these are never associated with pits. Males of Jambiya have minute pores scattered over the
ventroapical surface that are visible only with SEM, and no pits (Figs. 7, 8); pores are absent
in the female scape. The presence of these scattered pores is likely a plesiomorphic condition
among the pteromaloid Chalcidoidea, and possibly all Chalcidoidea (Heraty, unpublished).
The association of pores with distinct pits is the derived feature of Chrysolampinae and
Perilampinae which is not present in Jambiya.
4]
Heraty and Darling ~ JESO Volume 138, 2007
Antennal flagellum. The antennal flagellum is similar in Chrysolampinae and Perilampinae
(cf. Figs 2, 3). The groundplan segmentation of the flagellum includes a distinct transverse
anellus (f1,), followed by seven articulated funicular segments (f1, ,) that are usually broader
than long and slightly increasing in width apically, and finally a four segmented clava (f1, ,,)
with the flagellomeres fused but clearly demarked. The apical flagellomere (fl,,) is small
and button-like. Multiporous plate sensilla (MPS) and numerous stout socketed sensilla
are present on at least flagellomeres 4-11 and the MPS are always absent on the anellus
and flagellomere 12. Although there are exceptions within Chrysolampinae (Brachyelatus,
Austrotoxeuma), the flagellum is compressed and much shorter than the head height, and
often barely extending to the clypeal margin. Philomidinae differ only in that some males
have ventrally ramose antennae, whereas they are always simple in other Perilampidae.
In Eucharitidae, the antennal flagellum is much more elongate, and f1,, is never present
in the same form (may be a complete additional segment in some more derived taxa, cf.
Heraty 2002). Except for the absence of MPS on the second flagellomere, the antenna of
Jambiya is similar to that of most Perilampidae; however many of these features are found
in other Chalcidoidea and it is difficult to ascertain which attributes are synapomorphic for
Perilampidae.
Epipharynx. Chrysolampinae and Philomidinae have two patches of epipharyngeal seta,
whereas Perilampinae, all Eucharitidae, and Jambiya have a single pair of stout setae. The
polarity of this character is uncertain (Darling 1988).
Labrum. The labrum of Jambiya is similar in some regards to both Chrysolampinae and
Perilampinae, but not Philomidinae. A weakly sclerotized, flap-like labrum with evenly
placed digits along the apical margin is known for only some Chrysolampus (Darling,
unpublished). In most Chrysolampinae, digits are absent and the setae are arranged evenly
along the apical margin (Darling 1988a). Within Perilampidae, aboral digits and paired
transluscent areas are known only within Perilampinae (Darling 1988a). Furthermore,
the labrum of Perilampinae is excised medially and arranged into two distinct lobes, with
the translucent areas located along the inner margin of the lobes (Darling 1988a). Darling
(1988a) proposed that aboral digits in Perilampinae were likely derived. Their presence in
Jambiya, in combination with other characters, would suggest that aboral digits might be
plesiomorphic for Perilampinae. The labral digits of Jambiya are finely tapered apically;
they may be either tapered or spatulate in Chrysolampinae and Perilampidae; tapered digits
are considered to be plesiomorphic (Darling 1988).
Pronotal-prepectal association. Jambiya and Chrysolampinae have the prepectus closely
associated with the mesepimeron and broadly separated from the pronotum by a wedge-
shaped gap along most of its anterior length (Fig. 12). The size of the gap is related to the
orientation of the pronotum, and can be more correctly correlated with a close association
of the prepectus with the mesepipleuron and not the pronotum. This form of the prepectus
is typical for Pteromalinae, Torymidae, and other chalcidoids, and is presumed to be
plesiomorphic. Philomidinae have a prepectus unique in Chalcidoidea. The articulation
between the pronotum and prepectus is rigid and closely appressed, but the prepectus
remains separate and uniquely overlaps the posteroventral margin of the pronotum. In
42
New genus and species of Perilampidae JESO Volume 138, 2007
Perilampinae, Akapalinae, and Eucharitidae, the prepectus is more closely associated with
the pronotum, and is fused to the pronotum in all Perilampinae (except Steffanolampus) and
within Eucharitidae (Gollumiellinae and all Eucharitini) (Heraty 2002). Close association
with eventual fusion of the pronotum and prepectus is considered the derived state (Heraty
2002).
Forewing venation. The wing venation of Jambiya is almost identical to that found in
Chrysolampus or Chrysomalla (Chrysolampinae), including the presence of a hyaline break
in the parastigma, shape of the stigmal vein and stigma, and length of the postmarginal vein
(Figs. 16-19). The only difference is the linear arrangement of the campaniform sensilla
along the uncus, which are clustered in Chrysolampinae (cf. Darling 1986). Perilampinae
have no hyaline break, a distinctly different stigma, and a much longer postmarginal vein.
The venation of Philomidinae is similar to Chrysolampinae, but without a hyaline break and
they have numerous campaniform sensilla in the stigma that are arranged in a dense cluster
(Heraty, unpublished).
Petiole. The petiole of Jambiya is short and smooth, with the ventral margins of the petiolar
sclerite broadly separated by a membranous area, and the apex of the petiolar scperite abuts
with the anterior margin of the first gastral sternite (neither overlapping or inserted). A
ventrally membranous petiole is found in Chrysomalla (Chrysolampinae) and females of
Indosema and Timoderus (Eucharitidae: Oraseminae). A ventrally membranous petiole is
known in some Pteromalidae (cf. Heydon 1989) and whether it is a derived or plesiomorphic
state is uncertain. In taxa with a fused petiole (i.e. Orasema in Oraseminae), the sternal
antecostal muscles attach between the crenulate sulcus of the first gastral sternite and the
ventral midline of the petiole (Heraty, unpublished). However, in Jambiya, these same
antecostal muscles divide anteriorly and attach to the ventrolateral margins of the sclerotized
portion of the petiole, suggesting that the remnant of the ventral (first) sternite of the petiole
has been split. If so, this could be an apomorphic state within Chalcidoidea, although it is
potentially plesiomorphic for Perilampidae or Perilampidae + Eucharitidae.
Gastral tergites. Perilampinae and Chrysolampinae have the gaster usually high and
triangular in profile, with the first and second tergites usually similar in size, fused dorsally,
and Gt, has a large lateral panel (Darling 1986, 1997). In these two subfamilies, the margins
of the basal two terga are abutting and non-overlapping dorsally. Philomidinae have the
basal tergite longer than the second and also overlapping the second tergite; the basal tergite
(Gt,) has a lateral panel, but this may be associated more with the odd shape of the gaster,
which is strongly compressed dorsoventrally. The basal gastral tergites of Jambiya are
subequal in length and with Gt, abutting Gt, (Fig. 9). These terga are not fused, and there
is no distinct lateral panel on Gt,. Although the basal tergite is broadly depressed medially,
the gaster is rounded and not triangular (Fig. 9). Other than having closely associated and
abutting basal tergites, the gaster of Jambiya is not similar to other Perilampidae.
Ovipositor. The ovipositor of Jambiya is unique within Chalcidoidea. The ovipositor valves
in Chrysolampinae and Perilampinae are simple and needle-like. An expanded ovipositor
with prominent ridges or spines is associated with oviposition into cavities formed in leaf
43
Heraty and Darling | JESO Volume 138, 2007
tissue occurs in the three subfamilies of Eucharitidae (Gollumiellinae, Oraseminae, and
some Eucharitinae) and Akapalinae, although oviposition habits are unknown in this latter
subfamily (Heraty 1994, 2002; Heraty et al. 2004). It is difficult to postulate a use for
the peculiar ovipositor in Jambiya, however its form may suggest a habit of oviposition
into leaf surfaces as is known for some Eucharitidae (Gollumiellinae, Oraseminae, and
some Eucharitinae; Heraty 2002; Heraty and Quicke 1998). This raises the possibility that
expanded ovipositor and leaf ovipositions are plesiomorphic for the perilampid/eucharitid
complex.
Egg. Jambiya has a fusiform smooth egg (as inferred from ovarian eggs). Perilampinae
have a fusiform egg with a sculptured surface (Heraty and Darling 1984; Darling and
Roberts 1999) whereas Chrysolampinae have a fusiform, although slightly dumbbell-shaped
egg, with a smooth surface (Darling and Miller 1991). The eggs of some Eucharitidae are
fusiform and smooth, but most species have a stalked egg, both in the ovariole and after the
egg is deposited (Heraty 1994, 2002). A fusiform egg is likely plesiomorphic.
None of the morphological features discussed above accurately places Jambiya
within any of the perilampid subfamilies, and at best, the features of Jambiya confuse
the putative synapomorphies of Chrysolampinae and Perilampinae. Although closest to
Chrysolampinae, and especially the genus Chrysomalla, Jambiya lacks any of the defining
characteristics of the subfamily. The antennae are similar in general form (antennal formula,
compact flagellum, and dense setation) to all three subfamilies of Perilampidae, but the lack
of pits on the male scape would seem to exclude this genus from either Chrysolampinae
or Perilampinae. The single pair of epipharyngeal setae is shared with Perilampinae and
Eucharitidae, but not Chrysolampinae or Philomidinae. The 3/2 mandibular formula
excludes Jambiya from Chrysolampinae and Philomidinae. The labrum has a composite of
features shared with Chrysolampinae and Perilampinae, but not Philomidinae. The pronotal-
prepectal complex is likely plesiomorphic and uninformative. The wing venation is almost
identical with some Chrysolampinae, but with a different arrangement of campaniform
sensilla. Polarity is difficult to assess for the forewing vein features, but Jambiya is very
different from either Philomidinae or Perilampinae. The petiole is membranous ventrally
and similar to some Chrysolampinae and Eucharitidae, but the polarity of this feature is
uncertain. The gastral tergites are closely associated and abutting, but otherwise it is not
similar to other Perilampidae. The ovipositor is unique within Chalcidoidea, but has some
similarities with Eucharitidae and Akapalinae that may be suggestive of oviposition into
leaf tissue. Lastly, the egg is fusiform which is characteristic of Perilampinae and some
Eucharitidae, but this is likely a plesiomorphic feature. In summary, Jambiya might well
deserve subfamily status within Perilampidae. A combined morphological and molecular
analysis is currently in progress which should resolve not only the placement of this
enigmatic wasp, but also the phylogeny of the perilampid/eucharitid complex.
New genus and species of Perilampidae JESO Volume 138, 2007
Acknowledgements
This paper is dedicated to Dr. ‘DP’ David Pengelley. He was an extraordinary
mentor that inspired undergraduate students to achieve goals that were far and above what
they would have ever expected of themselves. JMH in particular owes his entire career to
the passion for insects that was instilled by studying under DP as both an undergraduate
and as one of his last graduate students. We would like to thank Gary Gibson (CNCI) and
Roger Burks (UCR) for bringing these specimens to our attention. Johan Liljeblad provided
comments on an earlier draft of this manuscript. We acknowledge the support of NSF
grants DEB-0108245 and EF-0341149 to JMH and an NSERC Discovery Grant to DCD.
References
Boucek, Z. 1972. Mediterranean Perilampidae: Euperilampus and genera allied to
Chrysomalla (Hym., Chalcidoidea). Mitteilungen der Miinchener Entomologischen
Gesellschaft 61: 90-107.
Bouéek, Z. 1978. A generic key to Perilampinae (Hymenoptera, Chalcidoidea) with a revision
of Krombeinius n.gen. and Euperilampus Walker. Entomologica Scandinavica 9:
299-307.
Bouéek, Z. 1983. Perilampidae (Hymenoptera) of Mongolia, from Dr. Z. Kaszab’s
expeditions. Acta Zoologica Academiae Scientiarum Hungaricae 29: 107-121.
Boucek, Z. 1988. Australasian Chalcidoidea (Hymenoptera). Wallingford: CAB
International.
Boucek, Z. and J. S. Noyes. 1987. Rotoitidae, a curious new family of Chalcidoidea
(Hymenoptera) from New Zealand. Systematic Entomology 12: 407-412.
Bouéek, Z. and J.-Y. Rasplus. 1991. Illustrated key to West-Palaearctic genera of
Pteromalidae (Hymenoptera: Chalcidoidea). Institut National de la Recherche
Agronomique, Paris.
Burks, B. D. 1979. Chalcidoidea (part) and Cynipoidea. pp. 768-1107, Jn Catalog of
Hymenoptera in America north of Mexico. Krombein K. V., P. H. Hurd, D. R.
Smith, and B. D. Burks (eds.), Smithsonian Institution Press, Washington, DC.
Campbell, B., J. M. Heraty, J.-Y. Rasplus, K. Chan, J. Steffen-Campbell, and C. Babcock.
2000. Molecular systematics of the Chalcidoidea using 28S-D2 rDNA. pp. 57—71,
In The Hymenoptera: Evolution, Biodiversity and Biological Control. Austin, A.,
and M. Dowton (eds.), CSIRO Publishing, Melbourne.
Darling, D. C. 1983. Systematic studies of the Perilampidae (Hymenoptera: Chalcidoidea).
Unpublished Ph.D. thesis, Cornell University.
Darling, D.C. 1986. Revision of the New World Chrysolampinae (Hymenoptera:
Chalcidoidea). Canadian Entomologist 118: 913-940.
Darling, D. C. 1988a. Comparative morphology of the labrum in Hymenoptera: the digitate
labrum of the Perilampidae and Eucharitidae (Chalcidoidea). Canadian Journal of
Zoology 66: 2811-2835.
Darling, D. C. 1988b. A review of the genus Krombeinius (Hymenoptera: Perilampidae)
with a reexamination of generic limits and phylogenetic relationships and the
45
Heraty and Darling : JESO Volume 138, 2007
descriptions of two new species. Journal of the New York Entomological Society
96: 63-81.
Darling, D. C. 1992. The life history and larval morphology of Aperilampus (Hymenoptera:
Chalcidoidea: Philomidinae), with.a discussion of the phylogenetic affinities of the
Philomidinae. Systematic Entomology 17: 331-339.
Darling, D. C. 1995. New species of Krombeinius (Hymenoptera: Chalcidoidea:
Perliampidae) from Indonesia, and the first description of first-instar larva for the
genus. Zoologische Mededelingen, Leiden 69: 209-229.
Darling, D. C. 1997. Perilampidae. pp 534-540, Jn Annotated keys to the genera of Nearctic
Chalcidoidea (Hymenoptera).Gibson, G. A. P., J. T. Huber, and J. B. Woolley
(eds.), Ottawa, NRC Press.
Darling, D. C. and T. D. Miller 1991. Life history and larval morphology of Chrysolampus
(Hymenoptera: Chalcidoidea: Chrysolampinae) in western North America.
Canadian Journal of Zoology 69: 2168-2177.
Darling, D. C. and H. Roberts. 1999, Life history and larval morphology of Monacon
(Hymenoptera: Perilampidae), parasitoids of ambrosia beetles (Coleoptera:
Platypodidae). Canadian Journal of Zoology 77: 1768—1782.
Ferriére, C. and G. J. Kerrich. 1958. Hymenoptera 2. Chalcidoidea. Section (a) Agaontidae,
Leucospidae, Chalcididae, [Eucharitidae, Perilampidae, Cleonymidae and
Thysanidae. Handbooks for the Identification of British Insects 8: 140.
Gibson, G. A. P. 1997. Morphology and Terminology. pp. 16—44, /n Annotated Keys to the
Genera of Nearctic Chalcidoidea (Hymenoptera). Gibson, G. A. P., J. T. Huber,
and J. B. Woolley (eds.), Ottawa, NRC Press.
Gibson, G. A. P., J. M. Heraty, and J. B. Woolley. 1999. Phylogenetics and classification
of Chalcidoidea and Mymarommatoidea — A review of current concepts
(Hymenoptera, Apocrita). Zoologica Scripta 28: 87—124.
Graham, M. W. R. de V. 1969. The Pteromalidae of north-western Europe (Hymenoptera:
Chalcidoidea). Bulletin of the British Museum (Natural History), Entomology
Supplement 14: 1—908.
Grissell, E. E. 1995. Toryminae (Hymenoptera: Chalcidoidea: Torymidae): A redefinition,
generic classification and annotated World catalog of species. Memoirs of
Entomology International 2: 470 pp.
Heraty, J. M. and D. C. Darling. 1984. Comparative morphology of the planidial larvae
of Eucharitidae and Perilampidae (Hymenoptera: Chalcidoidea). Systematic
Entomology 9: 309-328.
Heraty, J. M. 1994. Classification and evolution of the Oraseminae in the Old World,
with revisions of two closely related genera of Eucharitinae (Hymenoptera:
Eucharitidae). Life Sciences Contributions, Royal Ontario Museum 157: 174 pp.
Heraty, J. M. 2002. A revision of the genera of Eucharitidae (Hymenoptera: Chalcidoidea)
of the World. Memoirs of the American Entomological Institute 68: 359 pp.
Heraty, J., D. Hawks, J. S. Kostecki, and A. Carmichael. 2004. Phylogeny and behaviour
of the Gollumiellinae, a new subfamily of the ant-parasitic Eucharitidae
(Hymenoptera: Chalcidoidea). Systematic Entomology 29: 544-559.
Heraty, J. M. and D. J. Quicke. 2003. Phylogenetic implications of ovipositor structure in
Eucharitidae and Perilampidae (Hymenoptera: Chalcidoidea). Journal of Natural
History 37: 1751-1764.
46
— sy
New genus and species of Perilampidae JESO Volume 138, 2007
Heydon, S. L. 1989. Review of Nearctic Rhicnocoelia and Callimerismus with a discussion
of their phylogenetic relationships (Hymenoptera: RieeRD naa) Journal of the
New York Entomological Society 97: 347-357.
Noyes, J. 1990. A word on chalcidoid classification. Chalcid Forum 13: 6—7.
Noyes, J. 2002. Interactive catalogue of World Chalcidoidea (2"' edition). CD-ROM.
Taxapad and The Natural History Museum.
Riek, E. F. 1966. Australian Hymenoptera Chalcidoidea, family Pteromalidae, subfamily
Perilampinae. Australian Journal of Zoology 14: 1207—1236.
47
“yt : itt
Pati fag be Cs > Tate istong Oe
Seti See ina oe
eae ’ Ms ou OTe |
eee es tare ew apentenetio
fo él muittdo ponge cnaieee Act? reel
es NS Te ‘got SA! |
oop 5 Sd Sat ply oe ee 7 a OF R
i on) Li nn C4 1 bers bor i -
toe 2 he «14
af, Li intopy adda pppoe
dent aiear Bivenoltiagineg) an: tater oath,
i) GRO OB-LIFL Taree ld Caras
Vale itary ‘ead terials
ribectep “ae | Persie ‘of bmberoai
dian Ae dtoolowy ik 7681
horrid, 164 — cea Ca r
¥ ewceegicling, C tsinhinbadl metharninieng, - Bett)
a ; sbocntacwiegs “10? Uw iceetteura deel Hish ir ;
= focohmlnyey aod Seominaigy op (Gusd. Ie ke
q y ““ikeretes ¢ Dut div:: tee Chloe nesters) Leite, Ges
- ie Ri Press.) ran mu
Suites, Tv Pav logenct nes mn
jal ™ y oa 7" ar! ot TT see
| ; ine as é i. : ’ ae “« _ _
. acy Europe (Ayinent
‘ Museu (Netord! Hatt) “Bt
| ?
,
“ crery .: mie olamds
\ cid wea). SY
‘ e* ‘TR : ian Mi fine
aged * ince ok bnchatnine (Ayr
Dini aval samy e Musouniy a od hs H
frei ble tentnige pi lid
y Aegan Bric omchigical liye
ae. * (were pe the 4. ite AF met |
fal W gabthmnils the .
jai nylonhkinics » Systimane 8 i
b dL iniees 3000 de apa
fee. cin Prilas mnpdae ¢
ois he Le Wt) eae
£ *
Gut bacteria from Neodiprion abietis JESO Volume 138, 2007
PRELIMINARY EXAMINATION OF GUT BACTERIA FROM
NEODIPRION ABIETIS (HYMENOPTERA: DIPRIONIDAE)
LARVAE |
B. WHITTOME', R. I. GRAHAM?, AND D. B. LEVIN?
Department of Biosystems Engineering, University of Manitoba,
E2-376 EITC, Winnipeg, Manitoba, Canada R3T 5V6
email: [email protected]
Abstract - J. ent. Soc. Ont. 138: 49-63
The gut microbiotas of insects are important for many processes, including
digestion, nitrogen fixation, and nutrient recycling. Bacterial 16S ribosomal
DNA (rDNA) extracted from excised Neodiprion abietis larval guts was
amplified using PCR. Two combinations of primers produced six fragments
that were separated using Denaturing Gradient Gel Electrophoresis (DGGE).
The DNA fragments were sequenced directly. BLAST-n analysis and
comparison-rank searches, using the Ribosomal Database Project II, revealed
four predicted bacterial species, one that had similarity to Alphaproteobacteria
and three that aligned with Gammaproteobacteria. Phylogenetic analysis by
maximum parsimony and neighbour joining confirmed these findings and
suggest that Rahnella, Yersinia, Enterobacter, and a Caulobacter-like species
inhabit the N. abietis larval gut.
Published November 2007
Introduction
The balsam fir sawfly, Neodiprion abietis (Hymenoptera: Symphyta: Diprionidae),
is an indigenous phytophagous insect in North America. The larvae feed predominantly
on balsam fir (Abies balsamea Mill), but will also consume white spruce (Picea glauca
Moench) and black spruce (Picea mariana Mill.) (Wallace and Cunningham 1995).
Outbreak populations typically occur every 5-15 years, lasting 4-5 years in duration (Piene
et al. 2001; Moreau et al. 2005). Larvae emerge in early summer after overwintering as
eggs sheltered in the needles of the host plant. Male larvae pupate after their fifth instar,
whereas female larvae may go through an additional instar before pupation. Adults emerge
in late summer and, after mating, females lay eggs in current year foliage, using a saw-
‘Department of Biology, University of Victoria, Victoria, British Columbia, Canada
V8W 2Y2
? Population Ecology Group, Faculty of Forestry and Environmental Management,
University of New Brunswick, Fredericton, New Brunswick, Canada E3B 6C2
> Author to whom all correspondence should be addressed.
49
Whittome et al. JESO Volume 138, 2007
like ovipositor. The majority of current knowledge regarding diprionid sawflies is based
on ecological (Wallace and Cunningham 1995; Li et al. 2005; Moreau et al. 2005) and
anatomical studies (Bordas 1895; Maxwell 1955). Current knowledge of the structure and
organization of the sawfly digestive tract is limited, and almost nothing is known about the
microbiota of sawfly guts.
The insect gut is a complex and highly structured organ. Gut morphology and
function are dependent on several factors: the insect taxon, its stage of development, feeding
behaviour of each developmental stage, food source, environment that the insect inhabits,
and the inhabiting microorganisms (Wigglesworth 1972; Chapman 1985; Nation 2002;
Dillon and Dillon 2003). The first comparative review of hymenopteran guts was made,
by Bordas (1895), describing the macro-morphology of guts from selected insects of every
family in the order Hymenoptera. Sixty years later, Maxwell (1955) compared the internal
anatomy of larvae from 132 species, in eleven families of North American and European
sawflies, within the suborder Symphyta. Neither of these reviews on sawfly gut morphology
mentioned gut microbes.
The natural microbiota of the gut represent microbial-host interactions that range
from pathogenic to obligate mutualism. Studies that define the composition of microbial
communities in the digestive system have primarily been performed using termites,
tsetse flies, aphids, and cockroaches (Dillon and Dillon 2003). Recent interest in insect
endosymbionts, such as bacteria in the genera Wolbachia, Buchnera, or Wigglesworthia
bacteria, has increased our knowledge about relationships of microbes with their insect
hosts. Termite microbiota are best characterized, primarily because the functional roles of
gut microbes in other insects have not been investigated (Brune 1998; Bignell 2000; Breznak
2000). In termites, microbes are mainly located within specialized regions and structures
of the gut. The majority of the termite microbiota are found in pouches of the hindgut,
where bacterial densities can reach 10'' cells per ml of gastric fluid (Breznak and Pankratz
1977). In the midgut, microbial communities are typically sparse and tend to localize
between the microvilli of the epithelial cells (Breznak and Pankratz 1977). Microorganisms
may colonize the gut wall, attach to surfaces such as spines, or course freely in the lumen
(Bignell 2000). Depending on the termite species and its food source, the functional role of
the microbes may range from fermentation and hydrogen production to nitrogen recycling
and carbon elimination (Breznak and Pankratz 1977; Brune 1998; Bauer et al. 2000; Bignell
2000; Brauman et al. 2001).
Recent studies of gut microbiota in the ant genera Camponotus, Solenopsis, and
Tetraponera (Hymenoptera: Formicidae), have shown that bacteria localize to bacteriocytes
within the midgut and the pouch of the hindgut (Shannon et al. 2001; Sauer et al. 2002;
van Borm et al. 2002a; Li et al. 2005). These symbiotic microbiota are members of Alpha,
Beta, and Gamma divisions of Proteobacteria, as well as Flavobacteria (van Borm et al.
2002a), and including a novel candidate genus, Blochmannia (Sauer et al. 2000; Sauer et al.
2002). Classification of these microbes was accomplished by culture-independent methods
as these bacteria often cannot be cultured outside of their hosts (Schroder et al. 1996). In
addition, media for culturing has typically been developed for medical studies and the growth
conditions for fastidious microorganisms are often lacking, leading to misrepresentative
sampling of the gut microbiota (Dillon and Dillon 2003). To surmount these difficulties,
sequence analysis of 16S ribosomal DNA (rDNA) has become widely accepted as a tool
50
Gut bacteria from Neodiprion abietis JESO Volume 138, 2007
for investigating unculturable microbes in these often complex communities (Hongoh et al.
2003a, b).
This manuscript represents the first preliminarily analysis of the gut microbiota
of a diprionid species. PCR was used to amplify bacterial 16S ribosomal DNA (rDNA),
extracted from excised larval guts, and along with Denaturing Gradient Gel Electrophoresis
(DGGE) revealed 4 distinct DNA products. BLAST-n analysis and comparison rank
searches of the Ribosomal Database Project II (RDP II) database showed similarity to
Alphaproteobacteria and Gammaproteobacteria. Maximum parsimony and neighbour
joining analyses confirmed these observations.
Materials and Methods
Larval collection
Balsam fir branches, containing Neodiprion abietis larvae, were collected from
forest stands near Old Man’s Pond (near Corner Brook), Newfoundland, Canada (N 49°
05°59’ W 57° 56°05’). Larvae were maintained on balsam fir in paper bags at 4°C. Head
capsule widths of healthy larvae were measured using a dissecting microscope with a
calibrated objective. Larvae with head-capsule widths between 0.68-1.4 mm, corresponding
to 2™ to 4" instar larvae, were harvested for histological preparation and extraction of total
DNA from the excised gut.
PCR amplification, DGGE, and sequencing of bacterial /6S gene
Larvae harvested for molecular characterization of sawfly-gut bacteria were surface
sterilized with a 60 second wash in 5% bleach, followed by a 60 second rinse in DEPC-treated
water (0.1% diethyl pyrocarbonate). Larvae were submerged in sterile phosphate buffered
saline (PBS, pH 7.4), and anterior and posterior segments were excised just posterior of the
head capsule and immediately anterior to the eighth proleg, respectively. The cuticle was
secured and the gut was pulled from the body cavity. The excised gut was transferred to
fresh PBS and the peritrophic membrane, containing the food bolus, was pulled from the gut
lumen using forceps. The gut tissue was immediately placed into RNAlater (Ambion Inc.,
Austin, Texas) and stored at -20°C.
DNA was purified using TRIzol (Invitrogen Co., Burlington, Ontario), following the
manufacturer’s protocol. Two primer sets were used to ensure amplification of the targeted
bacterial 16S rDNA. Primers p984f-GC (5’-CGCCCGGGGCGCGCCCCGGGCGGGGCGG
GGGCACGGGGGGAACGCGCCGAACCTTAC-3’) and pl40Ir (5’-GCGTGTGT
ACAAGACCC-3’) were used to amplify the V6 to V8 regions of 16S ribosomal DNA
(Nobel et al. 1996; Frederick and Caesar 2000). Primers p515f-GC (5’-CGCCC
GGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGCCAGCAGCCGCGGTAA
-3’) and p806r (5’°-GGACTACCAGGGTATCTAAT-3’) were used to amplify the variable
V4 region of 16S rDNA (Relman 1993). PCR mixtures of 50 ul volume contained reaction
buffer (10 mM Tris-HCI pH 8.3 at 25°C, 50 mM KCl, 1.5 mM MgCl, 0.001% gelatin), 10
uM each of dATP, dTTP, dCTP, and dGTP, 0.1 uM of each primer, | unit Zag polymerase
(Qiagen, Mississauga, Ontario) and approximately 10 ng insect genomic DNA template.
PCR was conducted using a Mastercycler EP thermal cycler (Eppendorf, Mississauga,
51
Whittome et al. JESO Volume 138, 2007
Ontario), with the following settings: (1) 94°C for 5 min, | cycle; (11) 94°C for 30 sec, 52°C
for 30 sec, 72°C for 45 sec, 40 cycles; (iii) 72°C for 5 min, 1 cycle. On completion of
thermal cycling, 10% of the reaction was loaded on a 1% agarose gel and electrophoresed
in 1X TBE buffer (90 mM Tris Borate, pH 8.3, 2 mM EDTA) for 2 hrs at 60 V. The gel was
stained with ethidium bromide and visualised using UV illumination.
Subsequently, the PCR products (50% of the reaction) were separated by DGGE
using the DCode system (BioRad) according to the: manufacturer’s instructions. Gels
consisted of 1 mm thick 6% polyacrylamide with a denaturing gradient of 30-70 % (100%
denaturant corresponds to 7 M urea and 40 % vol/vol deionized formamide) and 1X TAE
buffer (90 mM Tris Acetate, pH 8.3, 2 mM EDTA) for 16 hours. Electrophoresis was
performed at 60°C and 80 V in 1X TAE running buffer for 16 hours. Gels were stained with
SYBR Gold nucleic acid stain (Invitrogen) for 30 minutes and images captured upon UV
illumination. DNA bands were excised with a sterile razor blade and placed in 100 ul of
sterile distilled H,O. The samples were placed at 94°C for 5 minutes to elute the DNA from
the polyacrylamide and were stored at 4°C overnight. Five uL of the supernatant were used
as template to reamplify the individual DNA bands. The PCR conditions were the same as
above, but with only 30 cycles of amplification. The PCR products were gel purified using
the QIAquick Gel Extraction Kit (Qiagen), and samples stored at -20°C until ready for
sequencing. Sequencing was performed by Ontario Genomics Innovation Centre, using an
ABI 3730 DNA Analyzer (BigDye version 3.1).
Sequence data was analysed using BLAST-n (http://www.ncbi.nlm.nih.gov/
BLAST) and the Similarity Rank program of the RDP II (http://rdp.cme.msu.edu/seqmatch/
seqmatch intro.jsp) (Maidak et al. 1999), to determine similarity with known bacterial
species (in the database). Closely related species, as well as gut microbiota listed in recent
publications (Boursaux-Eude and Gross 2000; Sauer et al. 2000; Shannon et al. 2001; van
Borm et al. 2002b; Hongoh et al. 2005), were used to construct phylogenetic trees using
neighbour joining and maximum parsimony algorithms, with 1000 bootstrap replicates.
Phylogenetic and molecular evolutionary analyses were conducted using MEGA version
3.1 (Kumar et al. 2004).
Results
DGGE separated four 16S rDNA fragments when using the p984f-p1401r primer
set (Table 1, #1 to 4), and two fragments after amplification from the p515f-p806r primer
set (Table 1, #5 and 6). BLAST-n analysis and similarity rank comparisons to the RDP II
sequence database predicted four bacteria matches: Rahnella sp. (sequence #1, GenBank
Accession No. EF140875), Yersinia sp. (sequences #2-4, GenBank Accession No. EF 140876-
EF 140878 ), an Enterobacteriaceae (sequence #5, GenBank Accession No. EF140880), and
an Alphaproteobacteria (sequence #6, GenBank Accession No. EF140879).
Phylogenetic analysis confirmed the predicted identities of the first four bacteria and
showed their close relationship to other known insect-gut microbes in the Enterobacteriaceae
family of Gammaproteobacteria. Maximum parsimony and neighbor joining analyses
suggest that sequence #1 was most closely related to Rahnella aquatilis. Both analyses
weakly supported the clustering of sequences #2-4 with Yersinia, with the degree of their
52
JESO Volume 138, 2007
Gut bacteria from Neodiprion abietis
dsfonut yoyeubos/ysyeubos/nponsurawo'dps//:dyy :dy1sqom [| ddu z
LSV1d/A03 yr wy Tqou MMM //:dyYy:ayISgomM LSV TE IGON |
~ (%NOT) 8910090008
‘(%OO1) €STE60000S
(%001) 660L67000S
“(% 001) L6ZS 100008
(%001) E8P6ES000S
‘(%O01) T8PEESOOOS
(%€'S6) E8P6ESOOOS
“(%ES6) T8P6ESOOOS
(%9'b6) E8P6ES000S
‘(%9'v6) T8P6ESOOOS
(%5'°96) I8S€S9000S
_ (%S'96) TLL8EPOOOS
(AyUSPI %) day
(%001) 9P6€91OG
(%001) PL86SrlV
(%16) 8pSOrrOd
( %L6) C9TE6N
(%L6) TTLOSSAV
(%66) OO9LZ9LV
‘(%66) 66SL7Z9LV
(%66) OOILZ9LV
‘(%66) 66SL7T9LV
(%66) OOILZ9LV
‘(%66) 66SL79LV
( %L6) 8rSOrPrOd
‘(%66) 8SL06N
(AjIWUSPI %)
JOquInN) UOISSODNV
Yyoye | seq
~ uintiajoeqoajoideydyy
poinyjnouy)
‘ds ovaoviiajoeqo1ajuq
‘ds DIuIssaX
‘ds pIulsuag
‘ds pIulsUax
‘ds pjjauyoy
AyUap] Poyo!peld
rs (1908d/9D-3S1¢d) 94
OI (1998d/0D-351Sd) S#
80€ (1100p 19/9D-J7864) p#
ri¢ (110 19/9D-Jr86d) c#
IZE (110p19/9D-Jr86d) TH
- Sele (10r1d/O03P86d) 14
(dq) ozis (jas 1ourtid)
uooldury juswseLy FOO
‘(a990d Aq uonesedas pur Yd Aq
uoneoytdure Jaye) synsprui-jeasey siaigo uolsdipoaN JO KAOIQOAIU DY} WO Po}oV.X9 WNC WO. pourej;qo soousnbes WNq [ewosoqi
S9| JO suonsod soy (sosequyep |] dde My) pue yuRquoy wou) sonjea uostedusoo [| dy Pur synsor U-LSV Td IAON SOUSIH “1 ATAVL
53
Whittome et al. | JESO Volume 138, 2007
Uncultured N. abietis bacteria # 2
Uncultured N. abietis bacteria# 3 | —-————
Uncultured N. abietis bacteria # 4 |
Yersinia aleksiciae
Wigglesworthia ssp. of Glossina brevipalpis
Yersinia pestis
Brenneria quercina
79 Symbiont of Formica fusca
Serratia maracens
52 Rhanella spp.
54 Yersinia rhodei
Plesiomanas shigelloides
64 Candidatus Blochmannia silvicola
Candidatus Blochmannia rufipes
Candidatus Blochmannia socius
Candidatus Blochmannia herculeanus
Buchnera aphidicola
Uncultured sheep mite bacteria
Unclassified Pseudomonadaceae of Tetraponera binghami
51 Candidatus Clostridium massiliensis
Candidatus Clostridium timonensis
Clostridium thermocellum
Chloroflexus aggregans
Bacillus megaterium
61 87 Bartonella henselae
69 Wolbachia melophagi
Unclassified Rhizobiaceae of Tetraponera binghami
Wolbachia maritima
Unclassified Methylobacteriaceae of Acromyrmex octospinosus
sd 79 Caulobacter leidyia
99 Unidentified eubacterium AM084885
Unidentified eubacterium of Myrmeleon mobilis DQ163946
Unidentified eubacterium AJ459874
Burkholderia spp. of Tetraponera binghami
Wolbachia inokumae
Wolbachieae incompatibility symbiont of Nasonia vitripennis
96
77
53
FIGURE 1. Phylogenetic analyses of bacterial 16S ribosomal DNA gene sequences
amplified from insect guts. Maximum parsimony (A and C) and neighbour joining trees (B
and D) were inferred using the Mega 3.1 program with 1000 bootstrap repetitions. Support
values >50% are listed at nodes. Sequences of 16S ribosomal DNA from the microbiota
of N. abietis larval guts are indicated with arrows. Bacteria identified by sequences #1-—
4 (from primer set p984f-GC/p140Ir) are represented in Trees A and B, while bacteria
identified by sequences #5 and #6 (primer set p515f-GC /p806r) are represented in Trees C
and D. Boxes indicate groups referred to in Table 1.
54
Gut bacteria from Neodiprion abietis JESO Volume 138, 2007
Uncultured WN. abietis bacteria # 2
B 83 Yersinia aleksiciae
52
Yersinia pestis
62 Brenneria quercina
85 Symbiont of Formica fusca
Serratia maracens
64 Rhanella spp.
87 Uncultured N. abietis bacteria # 1
Rhanella aquatilis
69 rersinia rhodei
Plesiomanas shigelloides
87 Candidatus Blochmannia silvicola
Candidatus Blochmannia rufipes
Candidatus Blochmannia socius
Candidatus Blochmannia herculeanus
Buchnera aphidicola
Burkholderia spp. of Tetraponera binghami
99 Uncultured sheep mite bacteria
Unclassified Pseudomonadaceae of Tetraponera binghami
Flavobacterium of Tetraponera binghami
99 — Wolbachia inokumae
Wolbachieae incompatibility symbiont of Nasonia vitripennis
97—=_ Bartonella henselae
91 Wolbachia melophagi
Unclassified Rhizobiaceae of Tetraponera binghami
Wolbachia maritima
Unclassified Methylobacteriaceae of Acromyrmex octospinosus
91 Caulobacter leidyia
99 Unidentified eubacterium AJ459874
Unidentified eubacterium of Myrmeleon mobilis DQ163946
Unidentified eubacterium AM084885
Bacillus megaterium
Chloroflexus aggregans
80 Candidatus Clostridium massiliensis
56—_§$.. Candidatus Clostridium timonensis
Clostridium thermocellum
FIGURE 1. Continued
5D
Whittome et al. JESO Volume 138, 2007
¢ Yersinia pestis 2
Unidentified eubacterium A Y537571
Plesiomanas shigelloides
Uncultured NV. abietis bacteria # 5
Yersinia aleksiciae
Yersinia rhodei
Rhanella aquatilis
Brenneria quercina
Rhanella spp. DQ217650
Serratia maracens
andidatus blochmannia socius
Candidatus Blochmannia herculeanus
Candidatus Blochmannia rufipes
Candidatus Blochmannia silvicola
Wigglesworthia ssp. of Glossina brevipalpis
Buchnera aphidicola
Burkholderia spp. of Tetraponera binghami
92 Uncultured sheep mite bacteria
Unclassified Pseudomonadaceae of Tetraponera binghami
97 Candidatus Clostridium massiliensis
Candidatus Clostridium timonensis
96 Wolbachia inokumae
Wolbachieae incompatibility symbiont of Nasonia vitripennis
Wolbachia maritima
Clostridium thermocellum
Chloroflexus aggregans
Lactococcus lactis
Bacillus subtilis
52 Bacillus megaterium
53 Lactobacillus maltaromicus
Carnobacterium piscicola
67
Caulobacter leidyia
Bartonella henselae
67 Wolbachia melophagi
Unclassified Rhizobiaceae of Tetraponera binghami
Unclassified Methylobacteriaceae of Acromyrmex octospinosus
Unclassified Alphaproteobacteria DQ516567
80
Unidentified eubacterium of Myrmeleon mobilis DQ163946
Unidentified eubacterium AM084885
Unidentified eubacterium AJ459874
Unidentified eubacterium AJ874181
Unclassified Caulobacteria AY807064
Uncultured N. abietis bacteria # 6
FIGURE 1. Continued
56
Gut bacteria from Neodiprion abietis
60
98
99
73
88
58
55
95
58
FIGURE 1. Continued
JESO Volume 138, 2007
Unidentified eubacterium AJ459874
Unidentified eubacterium AM084885
Unidentified eubacterium of Myrmeleon mobilis DQ163946
Uncultured N. abietis bacteria # 6
Unclassified Caulobacteria AY807064
Unidentified eubacterium AJ874181
Unclassified Alphaproteobacteria DQ516567
Bartonella henselae
Wolbachia melophagi
Unclassified Rhizobiaceae of Tetraponera binghami
Unclassified Methylobacteriaceae of Acromyrmex octospinosus
Flavobacterium of Tetraponera binghami
Candidatus Clostridium massiliensis
Candidatus Clostridium timonensis
Clostridium thermocellum
Lactococcus lactis
Bacillus subtilis
Bacillus megaterium
Lactobacillus maltaromicus
Carnobacterium piscicola
Wolbachia maritima
Wolbachia inokumae
Wolbachieae incompatibility symbiont of Nasonia vitripennis
Candidatus Blochmannia rufipes
Buchnera aphidicola
Candidatus Blochmannia silvicola
Wigglesworthia ssp. of Glossina brevipalpis
Burkholderia spp. of Tetraponera binghami
Uncultured sheep mite bacteria
Unclassified Pseudomonadaceae of Tetraponera binghami
Candidatus Blochmannia socius
Candidatus Blochmannia herculeanus
erratia maracens
Yersinia aleksiciae
Yersinia rhodei
Uncultured N. abietis bacteria #5
Brenneria quercina
Plesiomanas shigelloides
Yersinia pestis
Unidentified eubacterium AY537571
Rhanella aquatilis
Rhanella spp. DQ217650
oroflexus aggregans
57
Whittome et al. JESO Volume 138, 2007
relatedness to Yersinia aleksiciae varying (Table | and Figure 1). The three 16S rDNA
sequences showed 98.7% identity to each other and were approximately 320 bp in length.
The identity of the bacterium from which sequence #5 was derived was not
determined beyond Enterobacteriaceae because results from maximum parsimony and
neighbor joining analyses were inconsistent. The difficulty in confirming the identity of
this bacterium may be a result of the small amplicon size (180 bp). However, sequence
#6 (184 bp), which was amplified with the same primer set, clearly clustered with the
Alphaproteobacteriaceae. Maximum parsimony analysis suggested that bacteria, from
which sequence #6 was derived, belonged to the genus Caulobacter.
Discussion
The microbiota identified by 16S rDNA sequences from N. abietis gut tissues
include those that have been found ubiquitously in the environment and likely originated
from the host’s diet (Selenska-Pobell et al. 1995; Dillon and Charnley 2002; Sprague and
Neubauer 2005). Similarly, other free-living microbial species have been isolated from
other sawfly gut tissues, including Pristiphora geniculata, Acantholyda erythrocephala,
and Pikonema alaskensis (R. Graham, unpublished data). Fragments #1-5 (based on 16S
rDNA sequences) represent bacteria that belong to the Gammaproteobacteria, specifically
those in the Enterobacteriaceae family of Gram-negative, anaerobic microbes.
Neither Rahnella aquatilis nor Yersinia aleksiciae have been published as insect
gut microbes, although R. aquatilis has been isolated from both chicken ticks (Montasser
2005) and the intestinal contents of snails (Brenner et al. 1998). An uncultured Rahnella sp.
was reported in GenBank (Accession # U84730) from an isolate of the microbial gut flora
from the coleopteran genera Phaleria and Latreille (Tenebrionidae). Rahnella spp. have
been isolated from foliage (Hashidoko et al. 2002; Izumi et al. 2006) and ferment several
polysaccharides (Brenner et al. 1998). Additionally, Rahnella spp. have been recognized
as strong nitrogen fixers (Brenner et al. 1998; Izumi et al. 2006). This characteristic would
be important for nitrogen recycling in nutrient-poor diets and possibly promote its retention
as a symbiont within the gut, perhaps originally acquired through the sawfly’s diet.
Species of Yersinia have been isolated from other insect guts (Ulrich et al. 1981);
therefore it is not surprising that we found related bacteria in the gut of N. abietis. No
beneficial characteristics have been attributed to Yersinia. Their ubiquitous presence in
soils and detritus suggest that this bacterium is more likely to be a transient microbe ingested
with food matter, rather than part of the permanent flora of the sawfly gut.
16S-sequence analysis of fragment #5 and subsequent phylogenetic comparisons
to other Gammaproteobacteria was inconsistent and poorly resolved. Maximum parsimony
indicated that the closest relative to the N. abietis bacteria was Plesiomanas shigelloides,
while neighbour joining analysis suggested that Y. rhodei was more closely related.
BLAST-n searches of the 16S ribosomal sequence commonly aligned Serratia spp. with
high degrees of identity (97%). Yersinia, Rahnella, and Serratia spp. have been shown to
cluster closely together in a Group B of the enterobacterial genera, with the main signature
nucleotides located between positions 590-649 (Sproer et al. 1999). The p515f-p806r primer
set amplifies the variable V4 region of 16S rDNA between base pairs 627 and 807. This
58
Gut bacteria from Neodiprion abietis JESO Volume 138, 2007
region only overlaps the signature nucleotides by 22 bp, making a positive identification
difficult. Therefore bacterial sequence #5 can only be classified as an Enterobacteriaceae
until further data is collected. .
Finally, 16S-sequence analyses indicated that bacterium #6 was a member
of the Alphaproteobacteria, showing high similarity with uncultured bacteria of insect
larvae and soil (GenBank AJ459874, DQ163946, and AM084885; Table 1; Figure 1 C,
D). An uncultured Caulobacter (GenBank AY 807064) aligned within the unidentified
Alphaproteobacteria, supported by a 98% bootstrap value, suggesting that the N. abietis
bacterium #6 may be Caulobacter-like. Although Caulobacteria have typically been
isolated from aquatic environments, a few isolates have been reported from the intestinal
contents of a millipede (Abraham et al. 1999) and the mite Jetranychus urticae (Hoy and
Jeyaprakash 2005). If N. abietis bacterium #6 is a Caulobacter, this microbe may play a
key role in nutrient acquisition since Caulobacteria have been shown to uptake phosphorus
from nutrient-poor environments (Gonin et al. 2000). Chemical analyses of current year
foliar nutrients have reported phosphorous levels at 900-4000 ppm along the eastern US
coastline and in the Laurentide-Onatcheway region of Québec, Canada (Bauce et al. 1994;
Richardson 2004). Although foliar chemical data for balsam fir growing in Newfoundland
could not be found, it is known that phosphorous levels decline rapidly in trees growing in
harsh conditions (Richardson 2004). Due to the often severe climate of Newfoundland, one
would predict phosphorous levels at the lower end of the range reported.
The diversity of the gut microbiota of N. abietis, using a PCR prospecting
approach, is relatively low compared to the variety of microbes observed in termite and
cockroach guts (Cruden and Markovetz 1984; Hongoh et al. 2003a). Approximately 270
phylotypes have been detected in the gut of Reticulitermes speratus and the bacteria were
classified into 9 of the 20 phyla of eubacteria (Hongoh et al. 2003a). In contrast, only
6 phylotypes were detected in N. abietis and were classified within a single eubacterial
phylum (Proteobacteria).
Although low levels of bacterial diversity within insect guts are not uncommon,
the microbiota are generally composed of multiple phyla. The gut of the gypsy moth,
Lymantria dispar (Order Lepidoptera) has a microbial diversity that ranges from 7 to 15
phylotypes, depending on its diet source (Broderick et al. 2004). A total of 13 genera
were identified from larvae feeding on all diet sources and were classified within the
Actinobacteria, the Bacteroidetes/Chlorobi group, Firmicutes, and Proteobacteria. Similar
results were obtained from cultured isolates and 16S sequence analysis of microbes detected
within the midgut of Culex quinquefasciatus (Order Diptera), where bacteria from 13
genera were identified (Pidiyar et al. 2004). The majority of mosquito bacteria belonged to
the Gammaproteobacteria class (60% of cultured and 46% of culture-independent), while
Actinobacteria and Firmicutes constituted the remainder of the bacterial types.
While diet influences the acquisition of bacterial flora observed in insect guts,
morphology is often a significant factor affecting the diversity of the gut microbiota. Many
termites and cockroaches have evolved complex and convoluted guts (Wigglesworth 1972;
Brune and Friedrich 2000) that allow the retention of bacteria in specialized fermentation
structures. Insects possessing simple and straight alimentary canals, such as the Diprionidae,
Lepidoptera, and many Diptera, generally have a lower diversity of gut microbes (Dillon
and Dillon 2003). Due to the selective diet of N. abietis and the simple morphology of its
gut, the low level of bacterial diversity is not unexpected.
a9
Whittome et al. JESO Volume 138, 2007
Nonetheless, 16S rDNA sequencing and phylogenetic analyses identified six
phylotypes in the larval gut of the balsam fir sawfly; four of the bacteria were clustered with
Rahnella sp. and Yersinia sp., while the other two bacteria were determined to belong to
the Enterobacteriaceae and Caulobacteriaceae. Whether or not they are present as obligate
endobionts, they may variously play significant roles as associated microflora in sawfly
larvae.
Acknowledgements
This work was supported by grants from the BioControl Network of Canada and
the National Sciences and Engineering Research Council of Canada (NSERC). The authors
would like to thank Chris Lucarotti for his valuable comments and editing.
References
Abraham, W. R., C. Strompl, H. Meyer, S. Lindholst, E. R. Moore, R. Christ, M. Vancanneyt,
B. J. Tindall, A. Bennasar, J. Smit, and M. Tesar. 1999. Phylogeny and polyphasic
taxonomy of Caulobacter species. Proposal of Maricaulis gen. nov. with Maricaulis
maris (Poindexter) comb. nov. as the type species, and emended description of
the genera Brevundimonas and Caulobacter. International Journal of Systematic
Bacteriology 49 Pt 3: 1053-1073.
Bauce, E., M. Crepin, and N. Carisey. 1994. Spruce budworm growth, development and
food utilization on young and old balsam fir trees. Oecologia 97: 499-507.
Bauer, S., A. Tholen, J. Overmann, and A. Brune. 2000. Characterization of abundance and
diversity of lactic acid bacteria in the hindgut of wood- and soil-feeding termites
by molecular and culture-dependent techniques. Archives of Microbiology 173:
126-137.
Bignell, D. E. 2000. Introduction to symbiosis. pp. 209-231. /n Termites: Evolution,
Sociality, Symbioses, Ecology. T. Abe, D. E. Bignell, and M. Higashi (eds.),
Dordrecht, Netherlands.
Bordas, M. L. 1895. Appareil glandulaire des Hyménopteres. Annales des Sciences
Naturelles Zoologie et Biologie Animale 19: 1-362.
Boursaux-Eude, C. and R. Gross. 2000. New insights into symbiotic associations between
ants and bacteria. Research in Microbiology 151: 513-519.
Brauman, A., J. Dore, P. Eggleton, D. Bignell, J. A. Breznak, and M. D. Kane. 2001.
Molecular phylogenetic profiling of prokaryotic communities in guts of termites
with different feeding habits. FEMS Microbiology Ecology 35: 27-36.
Brenner, D. J., H. E. Muller, A. G. Steigerwalt, A. M. Whitney, C. M. O’Hara, and P.
Kampfer. 1998. Two new Rahnella genomospecies that cannot be phenotypically
differentiated from Rahnella aquatilis. International Journal of Systematic
Bacteriology 48 Pt 1: 141-149.
Breznak, J. A. 2000. Ecology of prokaryotic microbes in the gut of wood- and litter-feeding
termites. pp. 209-231. Jn Termites: Evolution, Sociality, Symbioses, Ecology. T.
Abe, D. E. Bignell, and M. Higashi (eds.), Dordrecht, Netherlands.
60
Gut bacteria from Neodiprion abietis JESO Volume 138, 2007
Breznak, J. A. and H. S. Pankratz. 1977. Jn situ morphology of the gut microbiota of wood-
eating termites Reticulitermes flavipes (Kollar) and Coptotermes formosanus
(Shiraki). Applied and Environmental Microbiology 33: 406-426.
Broderick, N. A., K. F. Raffa, R. M. Goodman, and J. Handelsman. 2004. Census of the
bacterial community of the gypsy moth larval midgut by using culturing and
culture-independent methods. Applied and Environmental Microbiology 70: 293—
300.
Brune, A. 1998. Termite guts: the world’s smallest bioreactors. Trends in Biotechnology
16: 16-21.
Brune, A. and M. Friedrich. 2000. Microecology of the termite gut: structure and function
on a microscale. Current Opinion in Microbiology 3: 263-269.
Chapman, R. F. 1985. Structure of the digestive system. pp. 165—211. Jn Comprehensive
insect physiology, biochemistry and pharmacology. 4, Regulation - Digestion,
Nutrition, Excretion. G. A. Kerkut and L. I. Gilbert (eds.), Oxford.
Cruden, D. L. and A. J. Markovetz. 1984. Microbial aspects of the cockroach hindgut.
Archives of Microbiology 138: 131-139. —
Dillon, R. and K. Charnley. 2002. Mutualism between the desert locust Schistocerca
gregaria and its gut microbiota. Research in Microbiology 153: 503-509.
Dillon, R. J. and V. M. Dillon. 2003. The gut bacteria of insects: nonpathogenic interactions.
Annual Review of Entomology 49: 71—92.
Frederick, B. A. and A. J. Caesar. 2000. Analysis of Bacterial Communities Associated with
Insect Biological Control Agents using Molecular Techniques. Proceedings of the
10" International Symposium on Biological Control of Weeds 261-267.
Gonin, M., E. M. Quardokus, D. O’Donnol, J. Maddock, and Y. V. Brun. 2000. Regulation of
stalk elongation by phosphate in Caulobacter crescentus. Journal of Bacteriology
182: 337-347.
Hashidoko, Y., E. Itoh, K. Yokota, T. Yoshida, and S. Tahara. 2002. Characterization of
five phyllosphere bacteria isolated from Rosa rugosa leaves, and their phenotypic
and metabolic properties. Bioscience Biotechnology and Biochemistry 66: 2474—
2478.
Hongoh, Y., P. Deevong, T. Inoue, S. Moriya, S. Trakulnaleamsai, M. Ohkuma, C.
Vongkaluang, N. Noparatnaraporn, and T. Kudo. 2005. Intra- and interspecific
comparisons of bacterial diversity and community structure support coevolution
of gut microbiota and termite host. Applied and Environmental Microbiology 71:
6590-6599.
Hongoh, Y., M. Ohkuma, and T. Kudo. 2003a. Molecular analysis of bacterial microbiota in
the gut of the termite Reticulitermes speratus (Isoptera; Rhinotermitidae). FEMS
Microbiology Ecology 44: 231-242.
Hongoh, Y., H. Yuzawa, M. Ohkuma, and T. Kudo. 2003b. Evaluation of primers and PCR
conditions for the analysis of 16S rRNA genes from a natural environment. FEMS
Microbiology Letters 221: 299-304.
Hoy, M.A. and A. Jeyaprakash. 2005. Microbial diversity in the predatory mite Metaseiulus
occidentalis (Acari: Phytoseiidae) and its prey, Tetranychus urticae (Acari:
Tetranychidae). Biological Control 32: 427-441.
61
Whittome et al. JESO Volume 138, 2007
Izumi, H., I. C. Anderson, I. J. Alexander, K. Killham, and E. R. Moore. 2006. Endobacteria
in some ectomycorrhiza of Scots pine (Pinus sylvestris). FEMS Microbiology
Ecology 56: 34-43.
Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: Integrated software for Molecular
Evolutionary Genetics Analysis and sequence alignment. Briefings in
Bioinformatics 5: 150-163.
Li, H., F. Medina, S. B. Vinson, and C. J. Coates. 2005. Isolation, characterization, and
molecular identification of bacteria from the red imported fire ant (Solenopsis
invicta) midgut. Journal of Invertebrate Pathology 89: 203-209.
Maidak, B. L., J. R. Cole, and C. T. J. Parker. 1999. A new version of the RDP (Ribosomal
Database Project). Nucleic Acids Research 27: 171-173.
Maxwell, D. E. 1955. The comparative internal larval anatomy of sawflies (Hymenoptera:
Symphyta). Canadian Entomologist 87: 1—132.
Montasser, A. A. 2005. Gram-negative bacteria from the camel tick Hyalomma dromedarii
(Ixodidae) and the chicken tick Argas persicus (Argasidae) and their antibiotic
sensitivities. Journal of the Egyptian Society of Parasitology 35: 95—106.
Moreau, G., C. J. Lucarotti, E. G. Kettela, G. S. Thurston, S. Holmes, C. Weaver, D. B.
Levin, and B. Morin. 2005. Aerial application of nucleopolyhedrovirus induces
decline in increasing and peaking populations of Neodiprion abietis. Biological
Control 33: 65-73.
Nation, J. L. 2002. Digestion. pp. 27—64. /n Insect physiology and biochemistry. J. L. Nation
(ed.), Boca Raton, Florida.
Nobel, U., B. Englen, A. Felske, J. Snaidr, A. Wieshber, R. I. Amann, W. Ludwig, and
H. Backhaus. 1996. Sequence heterogeneities of genes encoding 16S rRNAs in
Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.
Journal of Bacteriology 178: 5636—5643.
Pidiyar, V. J., K. Jangid, M. S. Patole, and Y. S. Shouche. 2004. Studies on cultured and
uncultured microbiota of wild Culex quinquefasciatus mosquito midgut based on
16s ribosomal RNA gene analysis. American Journal of Tropical Medicine and
Hygiene 70: 597-603.
Piene, H., D. Ostaff, and E. Eveleigh. 2001. Growth loss and recovery following defoliation
by the balsam fir sawfly in young, spaced balsam fir stands. Canadian Entomologist
133: 675-686.
Relman, D. 1993. The identification of uncultured microbial pathogens. Journal of Infectious
Diseases 168: 1-8.
Richardson, A. D. 2004. Foliar chemistry of balsam fir and red spruce in relation to elevation
and the canopy light gradient in the mountains of the northeastern United States.
Plant and Soil 260: 291-299.
Sauer, C., D. Dudaczek, B. Holldobler, and R. Gross. 2002. Tissue localization of the
endosymbiotic bacterium “Candidatus Blochmannia floridanus” in adults and
larvae of the carpenter ant Camponotus floridanus. Applied and Environmental
Microbiology 68: 4187-4193.
Sauer, C., E. Stackebrandt, J. Gadau, B. Holldobler, and R. Gross. 2000. Systematic
relationships and cospeciation of bacterial endosymbionts and their carpenter
62
Gut bacteria from Neodiprion abietis JESO Volume 138, 2007
ant host species: proposal of a new taxon “Candidatus Blochmannia (gen nov)”.
International Journal of Systematic and Evolutionary Microbiology 50: 1877—
1886.
Schroder, D., H. Deppisch, M. Obermayer, G. Krohne, E. Stackebrandt, B. Holldobler, W.
Goebel, and R. Gross. 1996. Intracellular endosymbiotic bacteria of Camponotus
species (carpenter ants): systematics, evolution and ultrastructural characterization.
Molecular Microbiology 21: 479-489.
Selenska-Pobell, S., E. Evguenieva-Hackenberg, and O. Schwickerath. 1995. Random
and repetitive primer amplified polymorphic DNA analysis of five soil and two
clinical isolates of Rahnella aquatilis. Systematic and Applied Microbiology 18:
425-438.
Shannon, A. L., G. Attwood, D. H. Hopcroft, and J. T. Christeller. 2001. Characterization
of lactic acid bacteria in the larval midgut of the keratinophagous lepidopteran,
Hopmannophila pseudospretella. Letters in Applied Microbiology 32: 36-41.
Sprague, L. D. and H. Neubauer. 2005. Yersinia aleksiciae sp. nov. International Journal of
Systematic and Evolutionary Microbiology 55: 831—835.
Sproer, C., U. Mendrock, J. Swiderski, E. Lang, and E. Stackebrandt. 1999. The
phylogenetic position of Serratia, Buttiauxella and some other genera of the
family Enterobacteriaceae. International Journal of Systematic Bacteriology 49 Pt
4: 1433-1438.
Ulrich, R. G., D. A. Buthala, and M. J. Klug. 1981. Microbiota associated with the
gastrointestinal tract of the Common House Cricket, Acheta domestica. Applied
and Environmental Microbiology 41: 246-254.
van Borm, S., J. Billen, and J. J. Boomsma. 2002a. The diversity of microorganisms
associated with Acromyrmex leafcutter ants. BMC Evolutionary Biology 2: 9.
van Borm, S., A. Buschinger, J. J. Boomsma, and J. Billen. 2002b. Tetraponera ants have
gut symbionts related to nitrogen-fixing root-nodule bacteria. Proceedings of the
Royal Society of London - B: Biological Sciences 269: 2023-2027.
Wallace, D. R. and J. C. Cunningham. 1995. Diprionid sawflies. pp. 193-232. Jn Forest
Insect Pests in Canada. J. A. Armstrong, W. G. H. Ives, and E. J. Mullins (eds.),
Ottawa, Ontario.
Wigglesworth, V. B. 1972. Digestion and nutrition. pp. 476-536. /n The Principles of Insect
Physiology. V. B. Wigglesworth (ed.), London.
63
. breif 120 ARE al
: coehaaeesiar anita Die itl
M dick 52 Vonage nae
Mcaigh Saws ail ah MH) lof ny roan apaden
ow) brn thee owl tocabeelae 1 AE) gaden a, beaten
th seu orcoallés barley sh hee piano < ibaa ns Pt ee
Y Me
' t Hosearet ig a de Le $
woites coral > @00rapl ter cmt aat, A atte Rove! A hhybe i
noo icoheash esvqulnpauned oft de dbase the ek; ah oe spel risa
Lb at 5? ywolqadenald baited cetyl ‘oltre waht elAR
Mae ae ee Acts
Lin ATK Je Ranges
odl.2PO1 Jhavwiadagté, 2: bows La PRR RH
mo) imeem * elim (ace, Oe - when setagbiomeat
rit} vaclomeoell qinminde a pecan chip ee
wh daw bondeown wonoradld fBR2b ante. ‘ pAtladll 7
baiignA eakecgpcke Madge. pede Senol! nomen} sd) to rom verse pak
nhah a | dander leesanain ™ f a
rrvoaeer, | liasowsl: adh ASA pra ianodh a tag be atietinky aS AM
ai oludou) OMG. atanriey ryhee| paar mbit Lie, Bote D
were COC eliett 4 bee gaeate HE. lL 3a ional A ea
beeee7yd .abiaione beter roy i bare ae Py Airis minions oe
' at | radia ‘au Bt ME? 3) ry caphent » ike crete thas Hale
OF Oak OT ee hele wit} oly jeais irda dug JT Adem A Lea
| 4) orsnythertt or fi) 4 i lant an
: SHA a Deo
nine bos qeuhog OLS VEL Nee a
; : inoweslon 4 47 yale tt
5 n 7 Tal c7 q
'
= >» <«
‘ Leras ~ im relst
roe © ae . a i Lh! 38°
a AD at Ay, tine | east
‘andiddhrt- Piasecgnie Aarakonn
me C cnr extie pores Apyried
Revision of North American Sobarocephala JESO Volume 138, 2007
REVISION OF THE NORTH AMERICAN SOBAROCEPHALA
(DIPTERA: CLUSIIDAE, SOBAROCEPHALINAE)
OWEN LONSDALE'AND STEPHEN A. MARSHALL?
Entomology Department, Smithsonian Institution, National Museum of Natural History,
Rm. CE-607, 10" & Constitution Ave. NW, Washington, D.C., 20560-0168
email: [email protected]
Abstract J. ent. Soc. Ont. 138: 65-106
The 17 species of Sobarocephala Czerny, 1903 occurring in the Neartic
north of Mexico are reviewed and keyed. Sobarocephala wirthi spec. nov.
and S. pengellyi spec. nov. are described from the eastern United States.
Descriptions, illustrations, and distribution maps are provided for all Nearctic
species.
_ Published November 2007
Introduction
Sobarocephala Czerny, 1903, as redefined by Lonsdale and Marshall (2006), is
a large, predominantly neotropical genus with 17 Nearctic species and at least a dozen
described and undescribed species from the Afrotropical, Australian, and Oriental Regions.
The Nearctic species do not form a monophyletic group, but instead belong to a number of
independent lineages, several of which are tropical in origin. The North American fauna,
including two new eastern species allied to S. /atifrons (Loew), is here revised.
North American Sobarocephala species are small (2.4-5.6 mm), thin, pale yellow
flies, often with distinctive brown patterning. Two male genitalic characters define the
genus (a basal shield on the distiphallus and a “thumb” on the lateral lobe of the distiphallus
(Lonsdale and Marshall 2006)), but Sobarocephala is most easily separated from other
Nearctic Clusiidae by the absence of interfrontal bristles (found in Clusiodes Coquillett,
1904 and Clusia Haliday, 1838), the possession of inclinate anterior fronto-orbital bristles
(reclinate in Clusiodes and Craspedochaeta Czerny, 1903), and the presence of a well-
developed dorsal preapical bristle on the mid tibia (absent in Clusia and Heteromeringia
Czerny, 1903). A key to the North American genera of Clusiidae was provided in Sods
(1987); we follow Woodley (1984) in treating the single Nearctic Chaetoclusia (C. affinis
Johnson) identified in that key as Sobarocephala.
Although the Nearctic Sobarocephala were recently treated by Sabrosky and
Steyskal (1974), considerable new material has become available since then, allowing us
' Author to whom all correspondence should be addressed.
Insect Systematics Lab, Department of Environmental Biology, University of Guelph,
Guelph, Ontario, Canada NIG 2W1
65
Lonsdale and Marshall JESO Volume 138, 2007
to reconsider the Nearctic fauna on the basis of over 1200 specimens. We here add two
species to the genus, provide an updated key, list new distributional data, and draw attention
to previously unrecognized sister-group relationships.
Materials and Methods
Material from the following institutions was examined for this revision: California
Academy of Sciences, San Francisco (CASC); Carnegie Museum of Natural History,
Pittsburgh (CMNH); Canadian National Collection, Ottawa (CNCI); University of Guelph
Insect Collection, Guelph (DEBU); Entomological Museum of Utah State, Logan (EMUS);
Instituto Nacional de Biodiversidad, Santo Domingo de Heredia (INBC); Museum of
Comparative Zoology, Cambridge (MCZC); North Carolina State University, Raleigh
(NCSU); Texas A&M University, College Station (TAMU); Tel Aviv University, Tel Aviv
(TAUI); United States National Museum, Washington, D.C. (USNM).
Specimen preparation and terminology follows that in Lonsdale and Marshall
(2006). The M.,,, ratio is defined as the length of the ultimate section of vein M divided
by the length of the penultimate section. Size ranges include both sexes. Label data for
non-type material is not listed for the relatively abundant S. flaviseta (Johnson), S. latifacies
Sabrosky & Steyskal, and S. /atifrons (Loew). Maps only include Nearctic records.
Generic Diagnosis
Pedicel with pronounced outer and inner angulate extensions. Cell bm open or
closed. Interfrontal bristle absent. Anterior fronto-orbital bristle inclinate. Vein R, bare
dorsally. Thorax usually with two postsutural dorsocentral bristles (rarely one or three in
some tropical species). Presutural intra-alar bristle absent or weak in Nearctic species. Mid
tibia with preapical dorsal bristle. Male 6" spiracle moved into membranous region anterior
to annulus. Ventrolateral lobe of hypandrium setose and relatively large. Distiphallus
almost always with basal shield (present in all Nearctic species); lateral lobe of distiphallus
often with “thumb” (Fig. 20).
Key to the species of Sobarocephala north of Mexico
l. Arista densely plumose (Figs. 1, 2,6, 7). Bristles usually yellow. Gena eee shiny.
First flagellomere with dorsal stripe or spot around base of arista .............. AY 3
— Arista sparsely plumose or pubescent (Figs. 3—5). Bristles light lotto to erry
Gena pilose to silvery tomentose. First flagellomere entirely yellow dorsally (S.
texensis and some S. setipes with light infuscation around base of arista and S. flava
females with anterior margin lightly pigmented) ..................eeeeeeeseeeeeeseeeeseeeeeseeees >
Z: Ocellar bristles minute to absent. Scutum with two pairs of spots; scutellum brown,
at least in part. Sides of frons converging posteriorly. Female tergite 8 yellow.
Surstylus with tubercle—like bristles apical. Southern United States ................8. 3
66
Revision of North American Sobarocephala JESO Volume 138, 2007
- Ocellar bristles well-developed. Scutum and scutellum yellow. Sides of frons
parallel. Female with basal half of tergite 8 brown. Surstylus with tubercle-like
bristles along length of distal and posterior margins. Eastern United States ........... 4
3 Scutellum, laterotergites, and epandrium entirely brown (Fig. 1). Gena shiny. Cerci
flush with distal margin of epandrium (Fig. 28). Surstylus subrectangular with long
palisade-like bristles along inner-distal margin (Figs. 27, 28). Distiphallus large and
spoon-shaped; lateral lobe without thumb (Fig. 29). Southeastern United States,
Central America, Bahamas, Colombia ...........................9. quadrimaculata So6s
~ Scutellum brown laterally (Fig. 2), laterotergites brown lateral to scutellum, and
epandrium yellow. Gena silvery tomentose. Cerci projecting (Fig. 25). Surstylus
triangular with apical tubercle-like bristles (Figs. 24, 25). Distiphallus relatively
small and thin; lateral lobe with thumb (Fig. 26). Florida ...........0.ccecccecesssceeesseeeeeees
mre tae OR UW, SLU IRGR LQ Raii tcc ea. UE S. cruciger Sabrosky & Steyskal
4. Bristles and epandrium yellow (Fig. 6). Wing clear. Hind tibia and tarsi yellow.
Frons yellow. Occiput occasionally pilose. Eastern United States 42.29... id:
RR SO ah NL a le S. affinis (Johnson)
- Bristles ind sereondnitdin brown (Fig. 7). Wing very lightly clouded on distal 1/3
along R,,,. Hind tibia and tarsi sometimes brownish. Frons sometimes with anterior
margin white. Occiput usually pilose. Eastern and southeastern United States
SEENON A RIAN Re OMNI: Sos cniva daaansadsase aces S. muesebecki Sabrosky & Steyskal
3; Sides of frons converging posteriorly. Notopleuron and/or scutellum sometimes with
een aET RS esate Milan lisa Gaile tel) Je. hosluck! AL RAL tic 6
- Sides of frons parallel. Neither notopleuron nor scutellum with white spots ..........8
6. Scutellum white. Scutum with brown supra-alar spot and basal quadrate stripe;
notopleuron, postpronotum, and posterolateral scutal spots white (Fig. 5). Arista
pubescent. Florida, Dominican Republic ............8. atrifacies Sabrosky & Steyskal
— Scutellum yellow. Scutum predominantly yellow, sometimes with brown markings;
white markings, if present, restricted to notopleuron and postpronotum (Fig. 3).
Arista short-plumose .. Uae MMe oon
h Bristles brown. Cell - edosedl) iNest saliote sia potipleunon anid postpronotum
white, at least in part (Fig. 3). Fore tarsi yellow. Female abdomen yellow with thin
central stripe on tergite 3 and with wide light brown stripe (narrowing anteriorly)
on tergites 4 and 5. Tubercle-like bristles on surstylus confined to apex (Fig. 19).
Widespread mv NortlvAmeriva ! oti i0.0. ek ed ee S. flaviseta (Johnson)
— Bristles black. Cell bm open. Notum yellow, sometimes with lateral margin brown
(Fig. 4). Fore tarsi light brown, at least apically. Female abdominal tergites 2-5 with
small brown anteromedial spot; tergites 6 and 7 dark brown. Tubercle-like bristles
on surstylus extending onto agg margin (Fig. 22). Northeastern North America
and Utah .. 6. vissesessssseeeeeesedd» latifacies Sabrosky & Steyskal
8. Scutellum betes hie (Hig. 14). Frons sometimes with orange tint (darkest
posteriorly). Scutum with one pair of wide postsutural stripes (connected posteriorly).
Basicon North Atmerica y).) 00100. 8200. Wa. S. dreisbachi Sabrosky & Steyskal
Scutellum yellow, at least in part. Frons yellow. Pattern on scutum variable ......... 9
9. Scutellum usually with central brown stripe (sometimes only brown medially or
apically), but if yellow with distal infuscation on ventromedial surface, then surstylus
67
Lonsdale and Marshall JESO Volume 138, 2007
14.
hook-shaped (some S. /atifrons; te 48) or subtriangular (some S. wirthi; Fig. 45)
Scutellum entirely yellow or brown lateiuliys never yellow with ventromedial
infuscation. Surstylus — rounded or bifid, but never hook-like or triangular
d 14
Stina on » scmplinp peer at i anlipeiat (Bigs fbi 17). Austad Saidtiis ahecth
Female tergite 2 with wide central stripe. Male abdomen with wide central stripe on
tergites 2-5. Male sternite 5 with posteromedial comb of bristles. Surstylus small,
lobate, and without tubercle-like bristles (Fig. 60) ............ccccceceecceeeeeesseceeeeeeessseeees 1]
Stripe on scutellum evenly brown or darkest at apex (Fig. 10). Acrostichal bristle
present. Female tergite 2 brown along posterior margin or with thin central stripe.
Male abdomen entirely yellow or with variable light brown pattern. Male sternite 5
without comb. Surstylus at least 2/3 length of ap with tubercle-like bristles
along distal 2/3 of posterior margin (Fig. 43) .. ihe sake 2
Scutum yellow with one pair of brown spots on latonanan ie Gemunieon® one pair
of postsutural stripes (Fig. 15). First flagellomere yellow. Bristles light brown.
Fore tibia yellow. Occiput pilose. Small bristle in front of anterior dorsocentral.
Female tergite 6 with wide central stripe. Laterotergites sometimes brown laterally.
Distiphallus short, and lateral lobe small and ovate (Fig. 61). Eastern North America
amin Ab Mttawaleciss caval Aik 6..420ir es ARKS S. setipes Melander & Argo (in part)
Scutum yellow, sometimes with light brown prescutellar spot extending onto
scutellum (Fig. 17). First flagellomere with light infuscation around base of arista.
Bristles brown. Fore tibia light brown. Occiput shiny. No small bristle in front of
anterior dorsocentral. Female tergite 6 yellow. Laterotergites yellow. Distiphallus
longer than half length of phallapodeme, and lateral lobe well-developed (Fig. 58).
Tekasiiaale wea wie... obdneedh eau S. texensis Sabrosky & Steyskal
Bristles light brown. Scutum with light brown lateral markings (Fig. 12). Male face
light brown medially and female face sometimes orange medially. Epandrium dark
brown. Surstylus small, rounded, and 2/3 length of epandrium (Fig. 42). Female
tergite 6 brown, and tergites 2-4 yellow except for thin central brown stripe. Alabama,
Georpiew aivieiaio discs. ds cvallev. Wicket og nde S. pengellyi spec. nov.
Bristles dark brown to black. Scutum with variable lateral markings. Face yellow in
both sexes. Epandrium predominantly or entirely yellow. Surstylus almost as long
as epandrium. Female tergite 6 brown laterally and (sometimes) basally, and tergites
2-4 dark laterally (sometimes also dark medially). Eastern United States ............. 13
Surstylus hook-shaped (Fig. 48). Female abdomen sometimes with central brown
stripe in addition to lateral markings (Fig. 10). Epandrium sometimes with small
basalspot sss Anh. el 4a ee ee has. S. latifrons (Loew)
Surstylus broad and rounded apically (Fig. 45). Female abdomen yellow medially
(Fig. 11): . Epandrium entirely yellow .:¢1.22i2240 aetowleuleling S. wirthi spec. nov.
Female abdomen mostly or entirely yellow on tergites 1-5 and dark brown on tergite
6. Male abdomen entirely yellow and gena thin (height less than half that of first
flagellomere). Surstylus large, lobate, and widest distally. Male cerci rounded and
slightly projecting wwiJak. os eeqewe een. beeen dliw.. see. Jogleeiee
68
Revision of North American Sobarocephala JESO Volume 138, 2007
16.
Female abdomen with wide central stripe on tergites (2) 3-6 (interrupted on tergite
5 in some S. lachnosternum and on tergite 6 in S. interrupta). Male abdomen with
wide central stripe, but if entirely yellow, gena as high as first flagellomere. Surstylus
less than half length of epandrium, small, and rounded or bifid. Male cerci flush with
distal margin of epandrium or sunken .. te satcoheg ..16
First flagellomere yellow in both sexes, \ eit anterior margin n lightly oa SS in
females (Fig. 8). Wing lightly (sometimes indistinctly) clouded along R,,, and costa
(darkest distally). Female Se aes Eastern United States, Texas, Utah
i ...9. flava Melander & Argo
First Racclidmere fark ae to i blacks on jereal half (Fig. 9). Wing clear. Female
laterotergites brown, at least in part. Northeastern North America, Kansas ...............
EN eS Se ee: ane. eon S. atricornis Sabrosky & Steyskal
Postsutural stripe serrate on anterior margin. Scutellum brown laterally (rarely
yellow) (Fig. 13). Female tergite 6 yellow, sometimes with anteromedial spot.
No small bristle in front of anterior dorsocentral. Anterior lateral scutellar bristle
minute or absent. Surstylus bifid (Fig. 51). Male cerci flush with distal margin
of epandrium (Fig. 52). Posterior margin of male sternite 5 without posteromedial
comb. Southeastern United States, Illinois ......... S. interrupta Sabrosky & Steyskal
Postsutural stripe entire and rounded on anterior margin, if present. Scutellum
usually yellow, but if lateral corner brown (some S. setipes), small bristle present in
front of anterior dorsocentral. Female tergite 6 brown, at least medially. Anterior
lateral scutellar bristle not much smaller than posterior bristle, if at all. Surstylus
rounded. Male cerci sunken below distal margin of epandrium. Male sternite 5 with
SE IE IS. SEE ee Se eS ers 17
Notopleuron brown posteriorly (females sometimes with most of notopleuron and
postpronotum brown) and scutum with one pair of wide brown postsutural stripes
(Fig. 15). Acrostichal bristle absent. Length 2.4-2.9 mm. Female abdomen with
wide brown stripe on tergites 2-6. Eastern North America .............csceeesseeeeseeeeeeeeeeees
en en eo S. setipes Melander & Argo (in part)
Scutum yellow with dark brown quadrate spot on notopleuron (sometimes faded
in males and teneral specimens) (Fig. 16). Acrostichal bristle present. Length 3.9-
4.9 mm. Female abdominal pattern as follows: tergite 2 sometimes brown along
posterior margin, tergites 3 and 4 with wide central stripe, tergite 5 with narrow
central stripe, and tergite 6 dark brown. Eastern and central North America .............
ee ta sa radacarescesaonseccesccansncs S. lachnosternum Melander & Argo
69
Lonsdale and Marshall JESO Volume 138, 2007
FIGURES 1-9. 1—Sobarocephala quadrimaculata Soos; male (left) and female abdomen
(right). 2—S. cruciger Sabrosky & Steyskal; male (left) and female abdomen (right). 3—S.
flaviseta (Johnson); female. 4—S. latifacies Sabrosky & Steyskal; male (left) and female
abdomen (right). 5—S. atrifacies Sabrosky & Steyskal; female. 6—S. affinis (Johnson); male
(left) and female abdomen (right). 7—S. muesebecki Sabrosky & Steyskal; male (left) and
female abdomen (right). 8—S. flava Melander & Argo; male (left) and female (right; arista
not illustrated). 9-—S. atricornis Sabrosky & Steyskal; male (left) and female (right; head
not illustrated).
70
Revision of North American Sobarocephala JESO Volume 138, 2007
FIGURES 10-17. 10—Sobarocephala latifrons (Loew); male (left) and female (right; head
not illustrated). 11—S. wirthi spec. nov.; male (left) and female abdomen (right). 12—S.
pengellyi spec. nov.; male (left) and female abdomen (right). 13—S. interrupta Sabrosky &
Steyskal; male (left) and female abdomen (right). 14—S. dreisbachi Sabrosky & Steyskal;
male (left) and female abdomen (right). 15—S. setipes Melander & Argo; male (left) and
female (right; head not illustrated). 16—S. Jachnosternum Melander & Argo; male (left) and
female abdomen (right). 17—S. texensis Sabrosky & Steyskal; male.
Al
Lonsdale and Marshall JESO Volume 138, 2007
Species Descriptions
Sobarocephala affinis (Johnson, 1913) (Figs. 6, 39-41; Map 1)
Chaetoclusia affinis Johnson, 1913: 101. Melander & Argo, 1924: 9.
Sobarocephala testacea Soos, 1964: 449. Sabrosky & Steyskal, 1974: 378.
Sobarocephala affinis, Woodley, 1984: 120.
Redescription (Fig. 6)
Male. Body length 2.8-4.4 mm. Bristles yellow. Two dorsocentral bristles with
one minute bristle in front of anterior dorsocentral. Acrostichal bristle absent. Two pairs
of well-developed lateral scutellar bristles. Arista densely plumose. Sides of frons parallel.
Body yellow except as follows: fore tibia usually light brown to brown; fore tarsi dark
brown; coxae, base of femora, posterior half of katepisternum, parafacial and gena white;
first flagellomere with dark spot around base of arista; occiput occasionally pilose. Male
from Alabama with one pair of small spots behind suture, and lateral margin of postpronotum
(and part of notopleuron) brown. M__,, ratio 3.9-4.6. Wing clear. Cell bm open. Face flat.
Female. Externally similar to male except as follows: abdomen with median stripe
on tergites (2) 3-4; tergites 5-7 and anterior half of tergite 8 brown.
Male terminalia. (Figs. 39-41) Similar to S. muesebecki, except pregonite ovate
and hypandrium with four minute distal bristles.
Distribution: United States: AL, FL,GA, MA, NC, NJ, NY, VA (Map 1).
Holotype. UNITED STATES, VA: Cape Henry, 26 June 1939, A. L. Melander, 3,
USNM.
Additional material examined. UNITED STATES, AL: Kushla, 22 July 1914, A. H.
Sturtevant, 4, USNM; Baldwin Co., Bon Secour Nat. Wildlife Refuge, 5-7 May 1994, S.
A. Marshall, 4, DEBU; Bon Secour (site 4), Malaise, 19 October 2004, 30.30N, 88.74W,
E. Benton, 2, DEBU. FL: Alachua Co., Gainesville, Austin Cary Forest, insect flight
trap, CO, baited, G. B. Fairchild, 6 August 1976, 23, 22, USNM; 9 August 1976, 3, 9,
USNM;; 13 August 1976, 29, USNM; 20 August 1976, 4, 29, USNM; 17 September 1976,
©, USNM; 30 July 1976, ¢, USNM; 26 July 1976, 2, USNM; 16 August 1976, 9, USNM;
Gainesville, Pine Hill Estates, H. V. Weems Jr., Malaise trap, 26 September 1973, 2, USNM;
3 October 1973, 2, USNM; Gainesville, Pierce’s homestead, 8 April 1976, W. H. Pierce,
flight intercept trap, 2, USNM; Mobile Co., Camp Scoutshire (site 24), Malaise trap, 14
December 2004, 31.05N, 88.18W, E. Benton, 9, DEBU. GA: Liberty Co., St. Catherine’s
Isl., 18-21 September 1972, F. C. & B. J. Thompson, 3, AMNH; 24-28 April 1972, Thomas
& Picchi, 9, AMNH. MA: Concord, 19 July 1961, W. W. Wirth, marsh, 3, USNM. NC:
Wake Co., 7 air mi. SW of Raleigh off rd., Malaise trap, C. S. Parron, 21 September 1985,
3, NCSU; 14 August 1985, 3, NCSU; 2 July 1985, 9, NCSU; 30 August 1985, 9, NCSU.
NY: Kalfleisch, 15 August 1962, R. S. Huntington, 2, USNM.
72
Revision of North American Sobarocephala JESO Volume 138, 2007
MAP 1. Distribution of Sobarocephala affinis (Johnson) (circle) and S. muesebecki Sabrosky
& Steyskal (dot).
Comments. While the sister-species Sobarocephala muesebecki and S. affinis are both
largely restricted to the eastern and southeastern coastal United States, the range of S.
muesebecki extends further west into Texas and Pennsylvania. Males of S. muesebecki and
S. affinis are easy to separate using the colour of the epandrium, but females are much more
difficult to distinguish: the bristles of S. muesebecki are darker and the anterior margin of
the frons is light yellow to white, but these characters are often difficult to see in poorly
preserved specimens.
Sobarocephala atricornis Sabrosky & Steyskal, 1974 (Figs. 9, 30-32; Map 2)
Sobarocephala atricornis Sabrosky & Steyskal, 1974: 382.
Redescription (Fig. 9).
Male. Body length 3.0-3.3 mm. Bristles dark brown. Two dorsocentral bristles.
Acrostichal bristle present. Two pairs of well-developed lateral scutellar bristles. Arista
sparsely plumose. Sides of frons parallel.. Notum yellow, usually with light to dark spot on
and (usually) behind notopleuron (pigment sometimes indistinct). Pleuron and legs light
yellow to white. Head largely yellow, with ocellar tubercle brown and ventral half of first
73
Lonsdale and Marshall JESO Volume 138, 2007
flagellomere black; parafacial and gena white and silvery tomentose. Abdomen yellow.
M,,, ratio 4.4. Wing clear or with cloud around apex of R,,, (sometimes filling first radial
cell). Cell bm open. Face flat.
Female. As described for male except as follows: bristles black; scutum yellow
with lateral margin dark brown (sometimes faded) (one female from Ontario (DEBU) with
scutum yellow excluding brownish lateral margin on notopleuron); scutellum sometimes
with thin brown border along lateral margin; laterotergites brown, sometimes yellow below
scutellum; face white; fore tarsi sometimes light brown; tergites 2-4 sometimes with small
spot on posterior margin; tergite 6 and basal margin of tergite 7 brown; lateral stripe present
along length of abdomen (not visible dorsally).
Male terminalia. (Figs. 30-32) Sternite 5 evenly setose. Sclerites of annulus
well-developed. Width of epandrium 4/5 height and length 3/5 height. Surstylus 2/3 height
of epandrium, slightly wider on distal half; tubercle-like bristles along length of posterior
margin, but more concentrated apically. Cerci projecting and rounded; bristles short
with several slightly longer central bristles. Ventral lobe of hypandrium long with three
minute distal bristles; arm short and truncate. Phallapodeme well-developed. Pregonite
ovate, membranous, and possibly fused to hypandrium. Postgonite and basiphallus small.
Epiphallus long, projecting, and perpendicular to basiphallus. Distiphallus half length of
phallapodeme, and lateral lobe thin, hooked, spinulose distally, and without thumb.
243
Distribution. Canada: ON, PQ. United States: KS, MA, MI, NY (Map 2).
Holotype. CANADA, ON: Maynooth, 8 July 1965, J. F. McAlpine, 3, CNCI.
Allotype. UNITED STATES, MI: Claire Co., 23-28 July 1959, R. R. Dreisbach, 9,
USNM.
Paratypes examined. CANADA, ON: Ottawa, J. R. Vockeroth, 12 July 1959, 29, CNCI;
9 July 1962, 2, CNCI. PQ: Abbotsford, 23 June 1937, G. Shewell, 2, CNCI. UNITED
STATES, MI: Monroe Co., J. Truchan, ex. Malaise trap, 1 August 1965, ¢, USNM; 1 July
1965, 2, USNM.
Additional material examined. CANADA, ON: Innisville, 12 July 1963, W. R. M. Mason,
2, CNCI; White R., July 1980, S. A. Marshall, 2, DEBU; Five Points, 25-30 July 1983,
Malaise trap, J. Thompson, 9, DEBU; Wellington Co., University of Guelph Arboretum,
ex. dung, O. Lonsdale, 9 August 2004, 2, DEBU [in alcohol]; 19 July 2005, 6, DEBU [in
alcohol]; University of Guelph Arboretum, B. Brown, unbaited pitfalls, 22 May—8 July
1983, 29, DEBU; mushroom baited pitfalls, 19 July 1983, 22, DEBU; Guelph, 11 July
1981, J. Ernst, 2, DEBU; Fergus, Malaise trap, S. A. Marshall, 16 July 1990, 22, DEBU;
9 July 1990, 2, DEBU; 10 July 1990, 2, DEBU; Rondeau, 25 July 1981, S. A. Marshall,
dung trap, 2, DEBU; Lambton Co., Port Franks, Watson Property, pans, J. Skevington,
15-18 July 1996, 52, DEBU; 31 July—6 August 1996, 2, DEBU; 27 June—2 July 1996, °,
DEBU; 18-22 July 1996, 2, DEBU; Sault Ste. Marie, Ft. Creek Cons. Area, 8 July 1998,
K. N. Barber, sweeps, Jmpatiens, sedge, fern, 46°32.5’N, 84°20.8’W, 3, DEBU; Sault Ste.
Marie, Birchwood Park, 27 July 1986, K. N. Barber, mixed forest, 2, DEBU; Essex Co.,
74
Revision of North American Sobarocephala JESO Volume 138, 2007
Point Pelee N. P., Visitor Centre, Malaise trap and pans, 6-11 August 2000, O. Lonsdale,
2°, DEBU; Ottawa, J. R. Vockeroth, damp, second-growth Acer-Betula wood, 16 July 1989,
3, CNCI; 4 July 1991, 9, CNCI; 7 mi E Griffith, 11 July 1990, B. E. Cooper, 4, CNCI:;
McDonald Island, St. Lawrence Isl. N. P., A. Carter, 15 July 1976, 2, CNCI; Ottawa, 13
August 1974, J. R. Vockeroth, 2, CNCI. UNITED STATES, KS: Riley Co., Manhattan,
8 July 1966, Malaise trap, G. F. Hevel, 2, USNM. NY: Corlear Bay, L. Champlain, June
1939, R. C. Shannon, 3, USNM; Ulster Co., Cherrytown, 4 mi NNW Kerhonkson, 15-30
July 1971, P. & B. Wygodzinsky, 9, AMNH.
Comments. Sobarocephala atricornis can be readily diagnosed by a ventrally black first
flagellomere (hence its name). If the antennae are missing, females can be identified by their
characteristic notal and abdominal patterns. Male S. atricornis are more difficult to identify
because, like many other North American Sobarocephala, they are weakly pigmented and
have dark bristles, however they can be distinguished by their clear wings and brown supra-
alar spots.
MAP 2. Distribution of Sobarocephala atricornis Sabrosky & Steyskal.
75
Lonsdale and Marshall JESO Volume 138, 2007
Sobarocephala atrifacies Sabrosky & Steyskal, 1974 (Fig. 5; Map 3)
Sobarocephala atrifacies Sabrosky & Steyskal, 1974: 379.
Redescription (Fig. 5) |
Female. Body length 3.8-4.4 mm. Bristles light brown. Two dorsocentral bristles.
Acrostichal bristle present. Two pairs of well-developed lateral scutellar bristles. Arista
pubescent. Sides of frons converging posteriorly. Thorax mostly yellow; notopleuron,
postpronotum, scutellum, laterotergites beside scutellum and posterior notal spots white;
one pair of dark brown supra-alar spots and one large posteromedial spot; if face yellow,
anterior margin of scutum brown, including inner half of postpronotum. Coxae white. Legs
mostly yellow, with tarsi dirty white to light brown, and fore tarsomeres 2-5 and distal 1/3 of
tarsomere | brown. Head predominantly yellow, with parafacial and gena white, face black
(yellow in some Dominican Republic specimens), and ocellar tubercle brown. Abdomen
yellow with tergites 3-6 dark brown (tergites 5 and 3 yellow on anterior corner). Cerci
brown. M_,, ratio 3.7, Wing clear. Cell bm closed. Face flat.
Male. Unknown.
Distribution. Florida (Map 3), Dominican Republic.
MAP 3. North American distribution of Sobarocephala atrifacies Sabrosky & Steyskal
(diamond) and S. guadrimaculata Sos (circle).
76
Revision of North American Sobarocephala JESO Volume 138, 2007
Holotype. UNITED STATES, FL: Pinellas Co., High Point, 17 November 1971, K.
Hickman, 2, USNM.
Paratypes. UNITED STATES, FL: Dade Co., Miami, 3 November 1971, G. R. Searis,
McPhail trap in Loquat tree, 62, USNM.
Other material examined. DOMINICAN REPUBLIC. Pedernales, 26 km N Cabo
Rojo, 18°06’N, 71°38’W, 730 m, 13-25 July 1990, L. Masner, J. Rawlins & C. Young,
wet deciduous forest, intercept trap, 22, CMNH; RD-095 Rodeo, ~0.5 km E Presa de
Blanco, Bonao, Monsenor Nouel Prov., 20 March 2003, D. Perez, R. Bastardo, B. Hierro,
2, USNM.
Comments. The paratypes from Florida were collected on grapefruit and guava trees
(Sabrosky and Steyskal 1974).
Sobarocephala cruciger Sabrosky & Steyskel, 1974 (Figs. 2, 24-26; Map 4)
Sobarocephala cruciger Sabrosky & Steyskal, 1974: 376.
Redescription (Fig. 2)
Male. Body length 3.5-5.4 mm. Bristles yellow. Two dorsocentral bristles.
Acrostichal bristle absent. Two pairs of well-developed lateral scutellar bristles. Ocellar
bristle absent. Arista densely plumose. Sides of frons converging posteriorly. Scutum
mostly yellow; lateral margin with one pair of brown spots behind transverse suture and
one pair of spots abutting scutellum; postpronotum light yellow. Scutellum brown laterally.
Anatergite brown below scutellum. Pleuron and legs yellow with fore tarsi brown. Coxae
white. Head mostly yellow, with gena and parafacial white, and first flagellomere brown on
dorsal half; gena silvery tomentose. Tergites 1-5 with central brown stripe; posterior half
of tergite 4 brown; tergite 6 with small central spot; surstylus white; remainder of abdomen
yellow. M,,, ratio 4.0-4.8. Wing clouded on distal 1/3. Cell bm open. Face convex on
dorsal half below antennal bases.
Female. Externally as described for male except anatergite and tergite 6 with
brown medial stripe, tergite 7 light brown, and cerci brown.
Male terminalia. (Figs. 24-26) Sternite 5 evenly setose. Annulus reduced to
thin band ventrally. Width of epandrium 2/3 height and length half height. Surstylus short,
acutely triangular, and curved inwards; tubercle-like bristles terminal only. Cerci projecting
and bifid. Hypandrial arm longer and thicker than ventral lobe, projecting at 90° basally
(arcuate medially); ventral lobe with one minute and two long distal bristles. Pregonite
long and thin with one distal bristle. Postgonite and basiphallus small. Epiphallus thin and
weakly sclerotized. Distiphallus short and bent medially; lateral lobe truncate and minutely
toothed distally with thumb half length of lobe.
Distribution. Florida (Map 4).
qT
Lonsdale and Marshall JESO Volume 138, 2007
Holotype. UNITED STATES, FL: Manatee Co., Cedar Hammock, 16 September 1966,
D. C. Chancey, Steiner trap, ¢, USNM.
Allotype. UNITED STATES, FL: Dade Co., Miami Springs, 3 January 1972, G. R.
Searls, 9, USNM. | :
Paratypes examined. UNITED STATES, FL: Sarasota, McPhail trap, C. K. Hickman,
13 March 1972, 34, USNM; Bradenton, Steiner trap, D. C. Chancey, 10 September 1965,
2, USNM; 29 July 1966, 2, USNM; Volusia Co., S. Dayton, McPhail trap, J. N. Pott, 18
October 1966, 3, 22, USNM; 5 October 1965, 2, USNM; 10 March 1972, 2, USNM; 14
May 1965, 3, USNM; grapefruit tree, 29 October 1971, 9, USNM; 12 October 1972, 9,
USNM; 10 March 1972, 29, USNM; Allendale, McPhail trap, 3 November 1966, 2°, USNM;
Volusia Co., Harbour Oakes, McPhail trap, J. N. Pott, 28 October 1966, 29, USNM; 3
November 1966, 2, USNM; Dade Co., Miami Springs, G. R. Searls, 3 January 1972, 39,
MAP 4. Map of Florida showing distribution of Sobarocephala cruciger Sabrosky &
Steyskal.
78
Revision of North American Sobarocephala JESO Volume 138, 2007
USNM; 22 October 1971, 9, USNM; C. F. Dawling Jr., McPhail trap, 20 February 1968, 2,
USNM; Pinellas Co., High Point, McPhail trap, grapefruit tree, K. Hickman, 17 November
1971, 2, USNM; Sarasota Co., Osprey, McPhail trap, S. V. Hiatt, 24 October 1966, °,
USNM; Hillsborough Co., Tampa, McPhail trap, T. J. Flavoroso, 1 August 1968, 9°,
USNM; 9 October 1967, 2, USNM; 20 October 1969, 29, USNM; Manatee Co., Palmetto,
McPhail trap, 23 September 1966, C. J. Bickner, 9, USNM; J. R. McFarlin, McPhail trap, 8
August 1971, 22, USNM; McFarlin & Bickner, 9 March 1972, 29, USNM.
Additional material examined. UNITED STATES, FL: Gainesville, Doyle Conner
Bldg., Malaise trap, 23 September 1973, H. V. Weems Jr., 9, USNM; Alachua Co., Pierce’s
Homestead, Malaise trap, W. H. Pierce, 13 October 1973, 2, USNM.
Sobarocephala dreisbachi Sabrosky & Steyskal, 1974 (Figs. 14, 54-56, Map 5)
Sobarocephala dreisbachi Sabrosky & Steyskal, 1974: 382.
Redescription (Fig. 14)
Male. Body length 3.3 mm. Bristles brown to dark brown. Two dorsocentral
bristles with one minute bristle in front of anterior dorsocentral. Acrostichal bristle absent.
Two pairs of well-developed lateral scutellar bristles. Arista sparsely plumose. Sides of
frons parallel. Scutum yellow, with notopleuron brown to light brown and postsutural
stripes brown (broadly connected at base). Scutellum and laterotergites beside scutellum
brown (sometimes also with large spot below scutellum). Pleuron and legs light yellowish-
white with fore tarsi brown and anepisternum sometimes yellow. Head yellow with orange
tint (sometimes darker laterally), with ocellar tubercle brown and gena light yellow and
pilose. Abdomen yellow. M.,,, ratio 4.8. Wing lightly clouded around distal half of R,,..
Cell bm open. Face flat.
Female. Similar to male except tergites 3-6 and posterior margin of tergite 2
brown; posterior corners of tergite 5 yellow. Females from Québec with notopleuron yellow
or light brown and fore tibia brown (tip lighter).
Male terminalia. (Figs. 54—56) Fifth sternite with posteromedial comb. Sclerites
of annulus well-developed. Epandrium slightly wider than high; length approximately 3/5
width. Surstylus as high as epandrium, with outline subtriangular and broadly rounded;
tubercle-like bristles absent. Cerci sunken below distal margin of epandrium, and all
bristles short. Hypandrial arm atrophied; ventral lobe with one minute distal and two long
medial bristles. Phallapodeme carinate and atrophied distally. Postgonite small. Pregonite
membranous with one distal setula. Basiphallus well-developed. Epiphallus long, thin, and
strongly projecting from basiphallus. Distiphallus 2/5 length of phallapodeme; thumb of
lateral lobe short and truncate.
Distribution. Canada: ON, PQ. United States: MI, NC, TN, TX (Map 5).
Holotype. UNITED STATES, MI: Ogemaw Co., 1-2 August 1959, R. R. Dreisbach, °,
USNM.
79
Lonsdale and Marshall JESO Volume 138, 2007
Paratypes. CANADA, ON: Ottawa, 26 July 1959, J. R. Vockeroth, ¢, CNCI. UNITED
STATES, NC: Macon Co., Wayah Gap, 3500 ft, 10 August 1957, J. G. Chillcott, 4,
CNCI.
Additional material examined. CANADA, ON: Algoma Dist., Hilton Twp., Hilton Beach,
Malaise trap at edge of field and hardwood forest, 20 August 1992, J. E. Swann, 2, DEBU;
Bruce Co., Inverhuron P. P., back dunes, 44°17°50”N, 81°35’27”W, 20 July—20 August
2003, Malaise, S. A. Marshall, 9, DEBU. PQ: Duncan Lk., nr. Rupert, J. F. McAlpine,
6 August 1970, 9, CNCI; 21 July 1971, 2, CNCI; 16 July 1971, 29, CNCI; 27 July 1971,
2, CNCI. UNITED STATES, TN: Union Co., 9 mi SE La Folette, 9 June 1973, A. O.
Lavallee, 9, EMUS. TX: Jasper Co., Bouton Lake Rec. Area, Angelina Nat’! Forest 11
miles SE of Zavaila, off Texas Hwy 63, 15 May 1993, I. Yarom, 4, TAUI.
Comments. The genitalia of Sobarocephala dreisbachi are similar to those of S. setipes
and S. lachnosternum, in that there is a comb of bristles on the fifth sternite and the cerci are
sunken, but the surstylus is much longer.
MAP 5. Distribution of Sobarocephala dreisbachi Sabrosky & Steyskal.
80
Revision of North American Sobarocephala JESO Volume 138, 2007
Sobarocephala flava Melander & Argo, 1924 (Figs. 8, 33-35, Map 6)
Sobarocephala flava Melander & Argo, 1924: 40. Sabrosky & Steyskal, 1974: 383.
Sobarocephala populi Steyskal, 1951: 129.
Redescription (Fig. 8)
Male. Body length 2.8-5.3 mm. Bristles dark brown to black. Two dorsocentral
bristles plus one minute bristle in front of anterior dorsocentral. Acrostichal bristle present.
Lateral scutellar bristles weak to well-developed. Arista sparsely plumose. Sides of
frons parallel. Notum yellow with notopleuron light brown to brown and lateral margin
of scutum behind notopleuron sometimes brown. Pleuron, coxae, tibiae, and basal 1/3
of femora white, with fore tarsi light brown or yellow and anepisternum sometimes light
yellow. Head yellow with ocellar tubercle brown and sclerites below antenna white; gena
pilose. Abdomen yellow. M,,, ratio 4.0. Wing dusky along R,,, and costa (more so on
distal 4); occasionally clear. Cell bm open. Face flat.
Female. Similar to male except as follows: notopleuron rarely yellow (yellow in
holotype); face, parafacial, and gena sometimes light yellow to white; first flagellomere with
light infuscation along anterior margin; tergites 6-7 brown (tergite 7 usually only pigmented
anterolaterally); specimens from Mississippi with tergites 2-5 (sometimes also tergites 7
and 8) brown laterally; female from Texas mostly yellow, with notopleuron light brown, and
tergites 6 and 7 dark brown anteriorly and laterally. Female from Rondeau Provincial Park
(Ontario) with entire lateral margin of scutum and scutellum dark brown.
Male terminalia. (Figs. 33—35) Externally similar to S. atricornis (Figs. 30, 31)
except apex of surstylus slightly broader. Internally similar to S. atricornis (Fig. 32) except
as follows: pregonite clavate with five bristles along length; only two hypandrial bristles
usually present; lateral lobe strongly bent medially with thumb short, pointed, and projecting
at 90°.
Distribution. Canada: ON. United States: FL, GA, IL, IN, LA, MD, MI, MO, MS, NC,
NY, PA, TX, UT, VA (Map 6).
Holotype. UNITED STATES, VA: Fairfax Co., Dead Run, ISS 15 April [year unknown],
2, USNM.
Paratypes examined. UNITED STATES, LA: Opelousas, April 1917, 2, USNM. MI:
Plummer Isl., 29 June 1913, 9, USNM. VA: Dead Run, R. C. Shannon, 15 July 1915, 39,
USNM; ex. Maple log, 13 March 1915, ISS 19 April 1915, 2, USNM; 11 July 1915, 9,
USNM; Falls Church, N. Banks, June 1920, 2, USNM; 4 July 1913, F. Knab, 29, USNM.
Additional material examined. CANADA, ON: 7 mi E Griffith, 1 July 1990, B. E.
Cooper, 22, CNCI; Hamilton, 13-19 July 1980, Malaise trap, M. Sandborne, 22, DEBU;
Burlington, Royal Bot. Gardens, 16 July 1997, K. N. Barber, sweeps, trail-side Poa, Agrostis,
Phleum, Festuca, Juncus, 43°17.5’N, 79°52.4’W, 2°, DEBU; Burlington, Bronte Crk. Prov.
Pk., 17-20 August 1983, Brown & Marshall, Malaise trap, 9, DEBU; Dundas, May 1980, E.
A. Menard, reared, larva in dead Elm, 2, DEBU; Algonquin Prov. Pk., Swan Lk. Res. Sta.,
81
Lonsdale and Marshall JESO Volume 138, 2007
reared from rothole in dead Maple tree, emerged 30 May 1995, D. C. Caloren, 9, DEBU;
Five Points, 29-30 July 1983, J. G. Thompson, 2, DEBU; Fergus (yard), 9 August 1985, S.
A. Marshall, floodplain, Malaise trap, 2, DEBU; Fergus, Malaise trap, S. A. Marshall 8-14
June 1982, 2°, DEBU; 16 July 1990, 29, DEBU; Port Credit, 15 July 1918, M. C. Van Duzee,
2, CASC; Bells Corners, E. C. Becker, 31. May 1954, reared from under Beech, 2, USNM;
21 June 1954, reared ex. puparia on rotten log, ¢, USNM; Bells Corners, reared ex. puparia
on rotten log, 21 June 1954, E. C. Becker, 54, 62, CNCI; Ottawa, J. R. Vockeroth, damp
second-growth Acer-Betula wood, 4 July 1991, 32, CNCI; 2 July 1992, 22, CNCI; 11 July
1989, 2°, CNCI; 13 August 1991, 22, CNCI; 6 July 1991, 29, CNCI; 28 July 1991, 29, CNCI;
9 August 1992, 9, CNCI; McDonald Isl., St. Lawrence Isl. N. P., A. Carter, Malaise trap,
19 July 1976, 2, CNCI; 20 July 1976, 2, CNCI; 5 August 1976, 29, CNCI; Metcalfe, B.
E. Cooper, 24 July 1984, 22, CNCI; 22 July 1984, 2, CNCI; 4 August 1984, 2°, CNCI; 1
August 1984, 9, CNCI; Essex Co., Point Pelee, 18 July 1978, J. M. Cumming, 2, DEBU;
Windsor, Ojibway Prairie, S. Paiero unburnt forest, yellow pans, 3-6 July 2001, 2, DEBU;
31 July—3 August 2001, 29, DEBU; burnt savannah, yellow pans, 25-29 June 2001, 9,
DEBU; Kent Co., Rondeau P. P., Spicebush Trail, 42°18°09"N, 81°51°06”W, Carolinian
forest, Malaise, 16-29 July 2003, S. A. Marshall, 22, DEBU. UNITED STATES, FL:
Gainesville, Pine Hill Estates, 4 October 1973, H. V. Weems Jr., Malaise trap, 9, USNM.
GA: Forsyth, 2 June 1970, 22, CNCI. IL: Champaign Co., Brownfield Woods, 2 mi
NE Urbana, 29 June 1976, C. T. Maier, 2, EMUS; Mason Co., Sandridge St. Forest, 4 mi
NW Forrest City, 23 June 1976, C. T. Maier, 9, EMUS; Tazewell Co., 3 mi N Macking
along Panther Cr., Webb & Marlin, 10 June 1969, 4¢, EMUS; Carlinville, 9 May 1952, M.
R. Wheeler, 4, AMNH. IN: La Fayette, 8 July 1916, ¢, USNM; July 1912, ¢, USNM; J.
M. Aldrich, 3 July 1915, 9, USNM; August 1914, ¢, USNM; July 1921, ¢, USNM. MD:
Plummers Isl., 11 July 1915, R. C. Shannon, 2, USNM; Colesville, W. W. Wirth, 11 July
1974, 42, USNM; 4 July 1976, 2, USNM; 18 June 1977, 22, USNM; 14 June 1977, 9,
USNM; 28 July 1976, 2, USNM; Montg’y Co., Colesville, W. W. Wirth, Malaise trap, 30
June 1977, ¢, USNM; 26 June 1977, 4,22, USNM; Montg’y Co., Dickerson, G. A. Foster,
14 July 1974, 24, USNM; Montg’y Co., Rockville, W. W. Wirth, Malaise trap, 4 September
1977, 2, USNM; 3 August 1979, ¢, USNM; 26 July 1979, 9, USNM; Montg’y Co., Chevy
Chase “woodend”, 3 August 1974, G. F. Hevel, 2, USNM; Prince Georges Co., Patuxent
Wildlife Res. Centre, W. W. Wirth, 8 July 1978, 2, USNM; J. F. Reinert 31 July 1977, ,
USNM;; Glen Echo, J. R. Malloch, 23 July 1921, 9, USNM; Laurel, 11 June 1965, marsh
edge, 32, CNCI; Prince George Co., Beltsville, 15 July 1979, A. Freidberg, 9, TAUI. MI:
Grosse Ile, 30 June 1949, G. Steyskal, 9, USNM; Berrien Co., St. Joseph, D. D. Wilder, 14
July 1971, 2, USNM; Monroe Co., 20 July 1965, J. Truchan, ex. Malaise trap, ¢, USNM;
Wayne Co., Grosse Isle, G. C. Steyskal, 1 July 1949, 9, USNM; 14 June 1949, 2, USNM;
4 June 1962, 29, USNM; 4 August 1956, 22, USNM; 3 August 1951, 22, USNM; 7 August
1951, 29, USNM; 8 August 1956, 2, USNM; 22 June 1949, 29, USNM; 24 July 1951, 69,
USNM. MO: Columbia, Malaise trap, 24 June 1967, 4pm—7am, F. D. Parker, 2, USNM.
MS: Forrest Co., 6 mi W Wiggins, Sweet Bay Bog, dung trap, 5-8 May 1994, sphagnum,
S. A. Marshall, 32, DEBU. NC: Columbus Co., Lk. Waccamaw, 6 July 1985, W. Stein
& A. Gerberich, blacklight in Oak & Pine scrub sand barriers nr lake, 9, USNM; Bladen
Co., Singletary Lk. St. Pk., 34°35’0N, 78°27°30W, Malaise, 19-22 May 2003, Marshall
& Paiero, 2, DEBU: Wake Co., 7 air mi SW of Raleigh off rd., 1 September 1985, C. S.
82
Revision of North American Sobarocephala JESO Volume 138, 2007
MAP 6. Distribution of Sobarocephala flava Melander & Argo.
Parron, Malaise trap, 29, NCSU; Raleigh, late July, F. Sherman, 2, NCSU. NY: Brainard,
Rensselaer Co., 11-22 July 1966, P. & B. Wygosinsky, 9, AMNH. PA: State College,
Centre Co., 4 July 1972, D. J. Shetlar, 9, CASC. TX: Kerrville, 23 April 1959, Becker
& Howden, 2, CNCI. UT: Garden City, 15 July 1951, F. C. Harmaton, 9, USNM. VA:
Alexandria, 24 June 1951, W. W. Wirth, 3, USNM; St. Falls, 9 July 1926, A. L. Melander,
2, USNM; Falls Church, Holmes Run, 6 August 1960, light trap, 4, USNM; Dead Run, 28
July 1915, 2, USNM; 29 June 1915, 9, USNM; R. C. Shannon, 15 July 1915, 29, USNM;
28 July 1915, 2, USNM; Scott Run, July 1954, M. R. Wheeler 3, 2, USNM:; Marina
National Airport, 28 August 1994, A. Freidberg, 2, TAUI.
Comments. Sobarocephala flava is a commonly collected species throughout much of
eastern North America; specimens have also been collected in central Texas and Utah.
Sobarocephala flaviseta (Johnson, 1913) (Figs. 3, 18—20; Map 7)
Heteromeringia flaviseta Johnson, 1913: 99.
Heteromeringia convergens Malloch, 1922: 50.
Sobarocephala flaviseta, Sabrosky & Steyskal 1974: 380.
Redescription (Fig. 3)
Male. Body length 3.0-5.0 mm. Bristles brown. Two dorsocentral bristles plus
one minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Two pairs of
83
Lonsdale and Marshall JESO Volume 138, 2007
well-developed lateral scutellar bristles. Arista sparsely plumose. Sides of frons converging
posteriorly. Scutum yellow with postpronotum and notopleuron white (at least centrally).
Pleuron light yellow. Legs light yellow with coxae and base of femora white. Head yellow
to white, with ocellar tubercle brown, and with parafacial, gena, sides of face, and scape
white. Abdomen yellow. M__,, ratio 3.1-3.3. Wing clear (sometimes clouded distally in
first radial cell). Cell bm closed. Face, parafacial, and anterior margin of frons uniformly
bulging.
Female. As described for male except as follows: tergite 3 with faded central
stripe; tergites 4 and 5 light brown with anterior-lateral corners widely yellow; abdominal
pattern sometimes reduced to central stripe on tergite 5. Cercus light brown.
Male terminalia (Figs. 18—20). Sternite 5 evenly setose. Sclerites of annulus well-
developed. Epandrium as wide as high and length 3/4 height. Surstylus short, acute, and
curved inwards; tubercle-like bristles distal only. Cerci projecting and slightly emarginate
with one pair of slightly longer central bristles. Hypandrial arm stout and projecting at 90°;
ventral lobe thin, slightly longer than arm, and with one minute and two long distal bristles.
Phallapodeme well-developed and slightly sinuate. Pregonite narrow basally, wide distally
and with five apical bristles. Postgonite absent. Distiphallus % length of phallapodeme and
curved at base; lateral lobe wide, truncate, minutely serrate, and with long thumb.
MAP 7. Distribution of Sobarocephala flaviseta (Johnson).
84
Revision of North American Sobarocephala JESO Volume 138, 2007
Distribution. NB, ON, PQ and eastern U.S. to BC, AB, ID, CO, and TX (Map 7).
Holotype. UNITED STATES, NJ: New Brunswick, 28 May, J. B. Smith, 2, MCZC.
Paratypes examined. UNITED STATES, IN: Lafayette, July 1927, 9, USNM. VA:
Chainbridge, 20 August 22, J. R. Malloch, 9, USNM. NJ: same collection as holotype, °,
MCZC.
Additional material examined. 192, 1982 [AMNH, CNCI, DEBU, TAMU, TAUI,
USNM].
Comments. Sobarocephala latifrons and S. flaviseta are two of the most commonly
encountered Sobarocephaila in northeastern North America, although neither is as frequently
collected as species of Clusia or Clusiodes. Sobarocephala flaviseta is common in eastern
North America, and it has been occasionally collected in Texas and the northwest (Sabrosky
and Steyskal 1974). ;
The apparent female-biased sex ratio of over 10:1 is unusual, although females of
other species are generally more often collected than males. We suspect that this apparent
female-biased sex ratio is a collecting artifact, and is more likely to reflect the clumping of
males at mating sites than a population-level ratio. Too few reared specimens are available
to assess actual sex ratios of any clusiid species.
Sobarocephala interrupta Sabrosky & Steyskal, 1974 (Figs. 13, 51-53; Map 8)
Sobarocephala interrupta Sabrosky & Steyskal, 1974: 384.
Redescription (Fig. 13)
Male. Body length 4.5 mm. Bristles light brown. Two dorsocentral bristles.
Acrostichal bristle present. Arista sparsely plumose. Anterior lateral scutellar bristle minute
or absent. Sides of frons parallel. Notum yellow, with notopleuron brown, scutum with
one pair of basal spots (often serrate), and lateral margin of scutellum brown. Pleuron and
legs light yellow with fore tarsi brown; Mississippi specimens with pleuron and basal half
of femora white. Head yellow, with gena and parafacial dirty white to white, ventral margin
of face sometimes orange, and ocellar tubercle brown; gena pilose. Abdomen yellow with
tergites 2-5 brown (excluding anterior corners). M,_, ratio 3.6-5.5. Wing clear. Cell bm
open.
Female. Similar to male except tergites 3 and 4 brown and tergite 6 with posterior
margin light brown centrally. Scutellum entirely yellow in South Carolina paratype.
Male terminalia. (Figs. 51-53) Sternite 5 evenly setose. Sclerites of annulus
well-developed. Epandrium as high as wide and length half height. Surstylus bifid with
anterior lobe well bristled and posterior lobe sparsely setose with small conical tubercle-
like bristles; lobes subequal in length. Cerci concave medially, flush with distal margin
of epandrium, and with all bristles short. Hypandrial arm very short; ventral lobe with
one minute distal and two long medial bristles. Phallapodeme thinned medially, wide and
85
Lonsdale and Marshall JESO Volume 138, 2007
truncate distally, and not extending past dorsal margin of hypandrium. Pregonite large and
circular with four medial bristles. Postgonite thin and flat with four bristles. Basiphallus
well-developed. Epiphallus small and well-sclerotized. Distiphallus nearly half length of
phallapodeme; lateral lobe small and finger-like with thumb absent.
Distribution. United States: FL, GA, IL, LA, MS, SC, TX (Map 8).
Holotype. UNITED STATES, FL: Orange Co., Rock Springs, 21 April 1970, W. W.
Wirth, 7, USNM.
Allotype. UNITED STATES, FL: Alachua Co., Chantilly Acres, 25 April 1970, W. W.
Wirth, Malaise trap, 9, USNM.
Paratypes examined. UNITED STATES, LA: Kilbourne, 3 May 1959, W. W. Wirth, °,
USNM. SC: Greenwood, Long Cane Lake, 21 July 1957, W. R. Richards, 9, CNCI.
Additional material examined. UNITED STATES, FL: Gainesville, Doyle Conner
Bldg., H. V. Weems Jr., Malaise trap, 16 October 1973, 2, USNM; 8-9 September 1973,
2, USNM; Highlands Hammock St. Pk., H. V. Weems Jr., 15 July 1956, 9, USNM. GA:
MAP 8. Distribution of Sobarocephala interrupta Sabrosky & Steyskal (dot) and S. texensis
Sabrosky & Steyskal (circle).
86
Revision of North American Sobarocephala JESO Volume 138, 2007
Liberty Co., St. Catherine’s Isl., 18-21 September 1972, F.C. & B. J. Thompson, 3, AMNH.
IL: Champaign Co., Brownfield Woods, 2 mi NE Urbana, 29 June 1976, C. T. Maier, 9,
EMUS. MS: Forrest Co., 6 mi W Wiggins, Sweet Bay Bog, 5-8 May 1994, sphagnum,
dung trap, S. A. Marshall, ¢ 32, DEBU. SC: Georgetown Co., Hobcaw Barony, Belle
Baruch Marine Field Lab, on slime mold, May 2004, S. A. Marshall, 9, DEBU [in alcohol].
TX: Montg. Co., Jones St. Forest, 8 mi S Conroe, 28 June—13 July 1987, Wharton, Steck,
Carroll, ¢, TAMU; 1-7 June 1987, Wang, Wharton, Praetorius, Malaise trap, 2, TAMU.
Comments. The medially yellow scutellum, characteristic notal stripes, and bifid surstylus
most readily diagnose Sobarocephala interrupta.
Sobarocephala lachnosternum Melander & Argo, 1924 (Figs. 16, 62-64; Map 9)
Sobarocephala lachnosternum Melander & Argo, 1924: 42. Sabrosky & Steyskal, 1974:
382. .
Redescription (Fig. 16)
Male. Body length 3.9-4.9 mm. Bristles dark brown. Two dorsocentral bristles
plus one minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Two
pairs of well-developed lateral scutellar bristles. Arista sparsely plumose. Sides of frons
parallel. Scutum yellow with notopleuron dark brown (notopleuron sometimes faded,
often in newly emerged adults). Scutellum and laterotergites yellow, although anatergite
sometimes with one pair of light brown stripes lateral to scutellum. Pleuron light yellow
to white excluding yellow anepisternum and katepisternum. Coxae white. Legs yellow
with fore tarsi brown. Head yellow with parafacial and occiput white, gena white and
silvery tomentose, ocellar tubercle brown, and anterior margin of frons with dirty yellow
tint continuing onto dorsal margin of face. Abdomen light yellow, occasionally with light
brown to brown bands on posterior margin of tergites 3-5 (faded medially). M,,, ratio 3.1-
3.5. Wing clear. Cell bm open. Face flat.
Female. Similar to male except as follows: posterior margin of tergite 2 sometimes
brown; tergites 3 and 4 brown with anterior corners yellow; tergite 5 brown centrally and
on posterior margin (sometimes reduced to light posterior spot); tergite 6 dark brown;
remainder of abdomen yellow; pedicel brown in one female (Maryland).
Male terminalia. (Figs. 62—64) Sternite five with comb of bristles on posteromedial
margin. Sclerites of annulus well-developed. Epandrium large and barrel-shaped (as wide
and high as pre-genitalic abdominal segments). Surstylus small and broadly rounded;
tubercle-like bristles absent. Cerci small, rounded, slightly projecting, and with all bristles
short. Ventral lobe of hypandrium elongate and poorly-defined with three minute bristles.
Phallapodeme elongate and well-developed. Basiphallus well-developed. Epiphallus small.
Postgonite large and ovate with several minute setulae. Pregonite absent. Distiphallus very
short and curved; lateral lobe ovate.
Distribution. Canada: ON, PQ, SK. United States: IL, IN, KS, MD, MI, NC, TX, UT, VA
(Map 9).
87
Lonsdale and Marshall JESO Volume 138, 2007
Holotype. UNITED STATES, VA: Rosslyn, R. C. Shannon, found larva 25 November
1912, 3, USNM.
Paratypes. UNITED STATES, VA: Rosslyn, R. C. Shannon, found larva 25 November
1912, ISS 10 January 1913, 4, USNM; bred specimen coll. 25 November 1912, ISS 26
January 1913, °, USNM; bred specimen coll. 25 November 1912, ISS 24 January 1913,
, USNM; ex. rotten log, 2 May 1913, ISS 20 May 1913, 9, USNM; ex. rotten log, 2 May
1913, ISS 17 May 1913, 4, USNM.
Additional material examined. CANADA, ON: Fergus, 10 July 1990, Malaise trap, S. A.
Marshall, ‘°°, DEBU; Guelph, 21 July 1978, W. Ralley, °, DEBU; Dundas, 29 June 1981,
J. Kircher, °, DEBU; Algonquin Prov. Pk., Swan Lk. Survey, 45°29°15”"N, 78°43°20°W,
Malaise trap, hemlock/hardwood, 16-28 July 1993, Larson, Marshall & Barr, ‘°, DEBU;
Shakwa Lk., Oulette Twp., 21 July 1996, A. Applejohn, °°, DEBU; Hamilton, 19-28 August
1980, M. Sandborne, Malaise trap, ‘°°, DEBU; Elgin Co., Springwater Cons. Area, 24 June
1996, D. C. Caloren, °, DEBU; Bruce Co., Dunk’s Bay, Malaise trap, S. A. Marshall,
17 July-18 August 1996, 9°, DEBU; Icewater Crk., 12.7 km NNE Searchmont, mil0.5
Whitmore Dam Rd., 24 June 1986, K. N. Barber, mixed forest, ¢, DEBU; [Nippising]
Hwy#1l7, 7 km W Mattawa, 12 June—2 July 2004, opaque mini sticky traps, mixed forest,
46°17.3°N, 78°49.0°W, K. N. Barber, YY, DEBU; Windsor, Malaise trap, S. A. Marshall,
7-16 August 1982, Y°, DEBU; Sault Ste. Marie, Bristol Pl. Pk., 2 July 2001, K. N. Barber,
sweeps, mostly sedges, 46°30.8’°N, 84°16.6°W, 2°, DEBU; 40 km SSW White River, K.
N. Barber, boreal mixedwood, Malaise trap, 48°14.08’N, 85°22.02’W, 7-22 July 2003, °,
DEBU; multi-colour sticky trap, 48°14.05’N, 85°21.97’W, 10-23 July 2003, 4,39, DEBU;
16-26 June 2003, 4, DEBU; 48°14.14°N, 85°22.02’W, 26 June—10 July 2003, 7, 6%,
DEBU; Ottawa, 24 July 1972, J. R. Vockeroth, damp secondary growth Acer-Betula wood,
©, CNCI; Innisville, 12 July 1963, W. R. M. Mason, Y°, CNCI; 7 mi E Griffith, 5 July 1990,
B. E. Cooper , 2, CNCI. PQ: Gatineau, King Mtn., S. A. Marshall; 23 August 1977, ¢,
DEBU; Kirk’s Ferry, 23 August 1924, G. S. Walley, 4, CNCI; Duncan Lk. Nr. Rupert, J. F.
McAlpine, 20 July 1969, 2, CNCI; 28 July 1971, 2, CNCI; 24 July 1971, 9, CNCI. SK:
Beaver Crk. Cons. Area, ~13 km S Saskatoon, 12 July 1999, K. N. Barber, sweeps, mostly
grasses under Betula/Populus, 51°58.6°N, 106°43’W, 3°, DEBU. UNITED STATES, IL:
Tazewell Co., 3 mi N Mackinaw along Panther Crk., Webb & Marlin, 10 June 1969, 2,
EMUS. IN: Posey Co., Harmonie St. Pk., 24-26 June 1998, Wharton et al., ‘°°, DEBU.
KS: Pottawatomie Co., 12 mi W Wamego, 24 July 1966, G. F. Hevel, 9, USNM. MD:
Montg’y Co., Colesville, W. W. Wirth, Malaise trap, 26 June 1977, , USNM; 15 August
1975, 2, USNM; Colesville, W. W. Wirth, 6 August 1976, 2, USNM; 28 July 1976, 2°,
USNM; Malaise trap, 13 August 1977, °, USNM; Montg’y Co., Bethesda, G. C. Steyskal,
9 August 1972, 29, USNM; Laurel, 11 June 1965, marsh edge, ¢, CNCI. ME: Dryden,
7 July 1959, G. H. Heinrich, 9, CNCI. MI: Wayne Co., Grosse Isle, G. C. Steyskal, 8
August 1956, 2, USNM; 15 June 1949, °, USNM; 4 August 1956, 2, USNM; 23 June
1956, 4, USNM; 19 June 1955, 4, USNM; Monroe Co., 26 July 1956, J. Truchan, ex.
Malaise trap, 3, USNM. NC: Wake Co., 7 air mi SW of Raleigh off rd., 25 July 1985, C.
S. Parron, Malaise trap, 9, NCSU. TX: Salmon, Anderson Co., 6-19 October 1974, H.R.
Burke, 2, TAMU. UT: Utah Co., Provo, Malaise trap, 6-9 July 1985, 4, 9, EMUS; 16-23
88
Revision of North American Sobarocephala JESO Volume 138, 2007
et ogi te asm ee
'
i
' !
i
!
i
awe
oo
MAP 9. Distribution of Sobarocephala lachnosternum Melander & Argo.
July 1985, 22, EMUS; 20-27 July 1985, 9, EMUS; 7-14 August 1985, 32, EMUS; 14-21
August 1985, 9, EMUS; 6-16 July 1985, 32, EMUS; 18-26 June 1985, 4, 149, EMUS; 25
June—6 July 1985, 112, EMUS. VA: Warsaw, 26 July 1952, W. W. Wirth, 2, USNM.
Comments. While male Sobarocephala lachnosternum superficially resemble other pale
North American Sobarocephala, they can be readily identified by a large barrel-shaped
epandrium and small surstyli. Females can be identified by their characteristic abdominal
pattern.
See comments for Sobarocephala setipes.
Sobarocephala latifacies Sabrosky & Steyskal, 1974 (Figs. 4, 21—23; Map 10)
Sobarocephala latifacies Sabrosky & Steyskal, 1974: 380.
Redescription (Fig. 4)
Male. Body length 3.0-5.6 mm. Bristles black. Two dorsocentral bristles plus one
minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Two pairs of
well-developed lateral scutellar bristles. Arista short-plumose. Sides of frons converging
posteriorly. Notum predominantly yellow with notopleuron brown to dark brown; scutum
sometimes brown on lateral margin and laterotergites yellow or brown. Pleuron light yellow.
Coxae white. Legs yellow with fore tarsi light brown (at least apically). Head yellow with
gena and parafacial white, face light yellow and ocellar tubercle brown. Abdomen yellow.
89
Lonsdale and Marshall JESO Volume 138, 2007
M, ,, ratio approximately 3.0. Wing clouded in cell R,, around distal 1/5 of R,,., and around
R,,,. Cell bm open. Face, parafacial, and anterior margin of frons uniformly bulging.
Female. Scutum as described for male. Abdomen yellow with tergites 6 and 7
brown and tergites 2-5 with small spot on anteromedial margin (tergites 2-5 sometimes with
light brown medial stripe and light brown border, or only with posterior margins brown).
Male terminalia. (Figs. 21—23) Sternite 5 evenly setose. Sclerites of annulus
well-developed. Epandrium as wide as long and almost as high as wide. Surstylus short,
rounded, thick, and slightly pointed apically; tubercle-like bristles along entire length
of apical and posterior margins, somewhat encroaching upon posterior surface. Cerci
projecting, somewhat emarginate and with one pair of longer central bristles. Hypandrial
arm curved, widest distally, as long as ventral lobe and projecting at 60-70° basally; lobe with
one minute and two long distal bristles. Phallapodeme long and relatively thin. Pregonite
long, tapered at both ends and with five medial bristles. Postgonite minute. Basiphallus
large with epiphallus at tip. Distiphallus approximately 2/3 length of phallapodeme and
bent at midpoint; lateral lobe well-developed, curved, and toothed distally; thumb well-
developed.
Distribution. Canada: NB, ON, PQ. United States: MA, MI, NC, NH, NY, SC, UT
(northeastern North America and Utah) (Map 10).
Holotype. UNITED STATES, MI: Grosse Ile, Wayne Co., 29 August 1948, G. Steyskal,
3, USNM.
Paratypes examined. CANADA, ON: Bells Corners, ex. Rotten log, 21 June 1954, E. C.
Becker, 2, 2, USNM; Bells Corners, 12 June 1954, E. C. Becker, reared ex. puparia on
rotten log, 2¢, 22, CNCI; Burke Falls, 13 July 1926, F. P. Ide, 29, CNCI; nr. Picton, 9 July
1970, J. F. McAlpine, 2, CNCI. PQ: Hull, 10 August 1965, ex. Malaise trap, 2, CNCI;
Laniel, 28 July 1933, 2, CNCI; Duncan Lk. Nr. Rupert, 1 August 1969, J. F. McAlpine, 9,
CNCI. UNITED STATES. White Mts., Morrison, ¢, USNM.
Additional material examined. CANADA, ON: Tenby Bay, Malaise at lake edge, 19 July
1992, 9, DEBU; Hamilton, 10-13 July 1980, Malaise trap, M. Sandborne, 3’, 32, DEBU;
Dundas, E. A. Menard, 27 June 1980, 3, 22, DEBU; 13 June 1980, 4, 9, DEBU; 17 June
1980, d, 2, DEBU; 1 July 1980, 24, DEBU; 23 June 1980, 9, DEBU; 8 July 1980, 3,
DEBU; 15 July 1980, 4, DEBU; reared in dead Elm, May 1980, ¢, DEBU; Dornoch, fen, 20
July 1996, S. A. Marshall, 4, DEBU; Port Franks, Watson property nr. lake, pans, 8-12 July
1996, J. Skevington, 9, DEBU; Sault Ste. Marie, Bristol Pl. Pk., sweeps, mostly /mpatiens,
Clematis, Rubus, grasses, 46°30.8’N, 84°16.6’W, 11 June 1999, K. N. Barber, 2, DEBU;
Fergus, Malaise trap, S. A. Marshall, 5 July 1990, 2, DEBU; 4 August 1990, 2, DEBU;
9 July 1990, 2, DEBU; (yard) flood plain, Malaise trap, 27 June 1985, S. A. Marshall, °,
DEBU; Guelph, K. N. Barber, 11 July 1979, 29, DEBU; 9 July 1979, 2, DEBU; pan traps,
5-18 July 1980, 22, DEBU; Brown & Marshall, University of Guelph Arboretum, Malaise
head, 28 June4 July 1983, 9, DEBU; Arkell, E. A. Innes, 7 May 1979, 2, DEBU; 7 May
1979, (emerged 22 May 1979), 2, DEBU; 8 May 1979 (emerged 22-30 May 1979), 416,
222, DEBU. UNITED STATES, MD: Colesville, W. W. Wirth, 4 July 1976, 2, USNM; 11
90
Revision of North American Sobarocephala JESO Volume 138, 2007
{
: Jos?
: : ;
’ Sas os :
4 \ a y
‘ XS
7A Os
WV
¢,
at
Aine
fi 3S Id
MAP 10. Distribution of Sobarocephala latifacies Sabrosky & Steyskal.
July 1974, 3, USNM; 18 June 1977, 3, USNM; Montgomery Co., Carderock Pk., 13 June
1970, L. V. Knutson, 2, USNM; Prince Georges Co., Patuxent Wildlife Res. Centre, W. W.
Wirth, 14 July 1978, 9, USNM. MI: Wayne Co., Grosse Ile, 30 June 1949, G. Steyskal,
22, USNM. NC: Cumberland Co., Ft. Bragg, 28 May-3 June 1967, J. D. Birchim, 9,
CASC; Wake Co., 7 air mi SW of Raleigh off rd., 30 August 1985, C. S. Parron, Malaise
trap, ¢, NCSU. NY: Rensselaer Co., 11-22 July 1966, P. &.B. Wygodzinsky, 2, AMNH.
SC: Georgetown Co., Hobcaw Barony, Belle Baruch Marine Field Lab, on slime mold,
May 2004, S. A. Marshall, 29, DEBU [in alcohol]. UT: Summit Co., Coalville, 1710 m, 30
July 1973, P. H. Arnaud Jr., 2, CASC.
Comments. The abdominal pattern of the female is characteristic, but the male abdomen is
entirely yellow, similar to that of several other North American species. Males can be best
diagnosed by a frons that narrows posteriorly, an absence of white shoulder patches, and an
open cell bm.
Sobarocephala latifrons (Loew, 1860) (Figs. 10, 48-50; Map 11)
Heteroneura latifrons Loew, 1860: 82.
Heteromeringia latifrons, Johnson, 1913: 99. Malloch, 1918: 8.
Sobarocephala latifrons, Melander & Argo, 1924: 42. Sabrosky & Steyskal, 1974: 381.
91
Lonsdale and Marshall JESO Volume 138, 2007
Redescription (Fig. 10)
Male. Body length 3.3-4.5 mm. Bristles black. Two dorsocentral bristles plus
one minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Small,
weak presutural intra-alar bristle sometimes present. Lateral scutellar bristles weak. Arista
sparsely plumose. Sides of frons parallel. Scutum predominantly yellow with notopleuron
brown and lateral margin behind suture light brown. Scutellum yellow with median brown
stripe (darkest apically and sometimes faded basally). Laterotergites sometimes light brown
lateral to scutellum. Pleuron and legs white with fore tarsi light brown. Head predominantly
yellow, with face light yellow, ocellar spot large and triangular, and mouthparts, parafacial
and gena white; gena pilose. Abdomen light yellow, often light brown on tergite 5 and
laterally on tergites 2-4, and sometimes with small spot at base of epandrium. M.,, ratio
3.8-4.4. Wing clear. Cell bm open. Face flat.
Female. Similar to male except as follows: lateral brown margin on scutum
wider; fore tarsi brown; scutellar stripe and lateral stripes on laterotergites strong and
always present; laterotergites with thin stripe below scutellum; tergites 2-4 brown laterally,
medially, on posterior margin and laterally on anterior margin; tergite 5 sometimes with
wide median stripe (tapering anteriorly); tergite 6 and anterior margin of tergite 7 brown;
wing dusky along anterior margin.
Male terminalia. (Figs. 48-50) Sternite 5 evenly setose. Sclerites of annulus
well-developed. Epandrium as wide as high and length 4/5 height. Surstylus 4/5 height
of epandrium and with rounded emargination from midpoint of posterior margin to apex
MAP 11. Distribution of Sobarocephala latifrons (Loew) (dot), S. wirthi spec. nov. (circle)
and S. pengellyi spec. nov.
92
Revision of North American Sobarocephala JESO Volume 138, 2007
(appearing “hook-like”’); tubercle-like bristles along posterior and apical margins. Cerci
small and rounded with one slightly longer central bristle. Hypandrial lobe with three
short distal bristles. Phallapodeme and postgonite well-developed. Pregonite elongate and
ovate with four basal bristles, and with thin elongate projection on inner-medial surface.
Basiphallus and epiphallus small. Distiphallus 2/3 length of phallapodeme; thumb and
lateral lobe well-developed with lobe half length of distiphallus.
Distribution. Canada: ON, PQ. United States: DC, GA, IL, MA, MD, MI, NC, NJ, NY,
PA, TX, VA, WV (Map 11).
Holotype. UNITED STATES, DC: “Osten Sacken”, 2, location unknown.
Paratype. UNITED STATES, VA: Fairfax Co., Dead Run, 22 June 1915, R. C. Shannon,
3, USNM.
Additional material examined. 1034, 1532 AMNH, [CASC, CNCI, DEBU, EMUS,
TAMU, TAUI, USNM].
Comments. Sobarocephala latifrons is a commonly collected species in northeastern North
America south of Ottawa and east of the Mississippi. Specimens have also been found in
North Carolina, Georgia, and Texas. The only similar species with an overlapping range is
the closely related S. wirthi, which is more southeastern in distribution. Males of these two
species are distinct (see couplet 13), but females are more difficult to separate.
Sobarocephala muesebecki Sabrosky & Steyskal, 1974 (Figs. 7, 36-38; Map 1)
Sobarocephala muesebecki Sabrosky & Steyskal, 1974: 378.
Redescription (Fig. 7)
Male. Body length 2.6-4.1 mm. Bristles brown. Two dorsocentral bristles plus
one minute bristle in front of anterior dorsocentral. Acrostichal bristle absent. Two pairs
of well-developed lateral scutellar bristles. Arista densely plumose. Sides of frons parallel.
Body yellow with fore tibia and tarsi light brown, ocellar spot and infuscation at base of
arista brown, epandrium dark brown, and coxae, gena, parafacial, and anterior (or lateral)
margin of frons usually white; sometimes lateral half of postpronotum brown (Alabama),
or postpronotum and notopleuron brownish (some North Carolina specimens). Occiput
usually pilose. M,_,, ratio 4.0-4.5. Wing lightly clouded along R,,, on distal 1/3. Cell bm
open. Face flat.
Female. Externally similar to male except as follows: fore tibia light brown; hind
tibia and tarsi sometimes browned (Alabama, Florida, North Carolina); tergites 3, 4, and
posterior margin of tergite 2 with central stripe; tergites 5-7 brown; tergite 8 brown or with
anterior half light brown.
Male terminalia. (Figs. 36-38) Similar to S. atricornis (Figs. 33-35), except
surstylus broader at base, tubercle-like bristles densely arranged along surstylus, pregonite
93
Lonsdale and Marshall JESO Volume 138, 2007
widest basally, and lateral lobe strongly bent medially with small swelling at base of thumb;
thumb short, pointed, and projecting at 90°.
Distribution. United States: AL, FL, NC, NJ, PA, TX (Map 1).
Holotype. UNITED STATES, FL: Levy Co., 7 mi NE of Cedar Key, 1 June 1970, D. L.
Bailey, 3, USNM.
Allotype. UNITED STATES, FL: same collection as holotype, 2, USNM.
Paratypes examined. UNITED STATES, FL: Levy Co., 7 mi NE of Cedar Key, | June
1970, D. L. Bailey, 3, USNM; ex. Malaise, 18 May 1970, 2, USNM.
Additional material examined. UNITED STATES, AL: Baldwin Co., Bon Secour
Nat. Wildlife Refuge, 5-7 May 1994, S. A. Marshall, 22, DEBU. FL: Santa Rosa Co.,
Blackwater R. St. Forest, 23 June 1973, W. W. Wirth, 2, USNM; Levy Co., 7 mi NE
Cedar Key, | June 1970, D. L. Bailey, 4, 2, USNM; Cedar Key, ex Malaise trap, 18 May
1970, D. L. Bailey, 9, USNM; Highlands Co., Archbold Biol. Stn., 11 October 1964, P. H.
Arnaud Jr., 42, CASC; 23 April 1967, B. V. Peterson, 2, CNCI. NC: Columbus Co., Lk.
Waccamaw, 6 July 1985, W. Steiner & A. Gerberich, 9, USNM; Cumberland Co., Fort
Bragg, J. D. Birchim, 23-25 August 1967, 2°, CASC; 16 August 1967, 2, CASC; Bladen
Co., Singletary Lk. St. Pk., 34°35’0N, 78°27°30W, Malaise, 19-22 May 2003, Marshall &
Paiero, 62, DEBU. NJ: Oswego Lk., Burlington Co., 30 August 1974, Menke & Miller,
4°, USNM. PA: State College, Centre Co., 4 July 1972, D. J. Shetlar, 9, CASC. TX:
Salmon, Anderson Co., 22 June 1974, H. R. Burke, Malaise trap, 4, TAMU; 1-8 July 1974,
3,22, TAMU; | June 1974, 4,52, TAMU; Anderson Co., 10 mi SW Elkhart, H. R. Burke,
modified Malaise, 5-6 June 1976, 29, TAMU; Brazos Co., College Stn., Wharton, Malaise
trap, 20 September-4 October 1974, 4, TAMU; 22 July—2 August 1974, 49, TAMU; 14-
21 July 1974, 54, 22, TAMU: Montg. Co., Jones St. Forest, 8 mi S Conroe, 28 June—13
July 1987, Wharton, Steck & Carroll, 22, TAMU; 21-27 June 1987, Wharton, Steck &
Carroll, 2, TAMU; 1-7 June 1987, Wang, Wharton & Praetorius, Malaise trap, 2, TAMU;
28 April—13 July 1987, Steck, Wharton & Carroll, 329, TAMU.
Comments. See comments for Sobarocephala affinis.
Sobarocephala pengellyi spec. nov. (Figs. 12, 42-44; Map 11)
Description (Fig. 12)
Male. Body length 2.9-3.8 mm. Bristles brown. Two dorsocentral bristles plus
one minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Two pairs
of well-developed lateral scutellar bristles. Arista sparsely plumose. Sides of frons parallel.
Scutum yellow with lateral margin brownish behind light brown notopleuron; scutellum
with thin light brown central stripe extending onto base of scutum. Pleuron light yellow with
anepisternum and anterior face of katepisternum yellow. Coxae white. Legs light yellow
94
Revision of North American Sobarocephala JESO Volume 138, 2007
with fore tarsi light brown. Head yellow with face light brown centrally, gena and parafacial
white and pilose, occiput white and ocellar tubercle brown. Abdomen predominantly yellow
with wide light brown central stripe on tergites 2-4 (tapering anteriorly on each tergite) and
epandrium brown (lighter on distal half). M,,, ratio 3.0. Wing clear or with light apical
cloud around R,,,. Cell bm open. Face flat.
Female. As described for male except as follows: scutum with one pair of light
brown lateral spots at base; scutellar stripe most pronounced apically (sometimes continuing
onto base of scutum); laterotergite sometimes with light brown stripe lateral to scutellum
and one stripe below; fore tarsi brown; face yellow (sometimes with orange tint); central
stripe on tergites 2-4 brown, thin, and of equal width along length; tergites 5-7 brown and
sternites 6 and 7 brown.
Male terminalia. (Figs. 42-44) Sternite 5 evenly setose. Sclerites of annulus
well-developed. Length, height, and width of epandrium subequal; tapered to base.
Surstylus 7/10 height of epandrium and broadly rounded; tubercle-like bristles along apical
and posterior margins. Cerci small, rounded, and slightly projecting. Hypandrium with arm
and ventral lobe subequal in length, and ventral lobe with two short medial bristles and one
minute distal bristle. Phallapodeme and basiphallus well-developed. Epiphallus minute.
Pregonite large and ovate with five central bristles. Postgonite absent. Distiphallus 7/10
length of phallapodeme; lateral lobe strongly bent, spinulose distally, with broad flat medial
lobe, and with thumb absent.
Distribution. United States: AL, GA (Map 11).
Holotype. UNITED STATES, GA: Forsyth, 2 June 1970, 3, CNCI.
Paratypes. UNITED STATES, AL: Baldwin Co., Raft River Tributary, 16 October 2001,
30.52.261N, 87.56.934W, J. W. McCreadie, 22, DEBU. GA: same collection as holotype,
102, CNCI.
Comments. Sobarocephala pengellyi can be distinguished from congeners by a black
epandrium, one pair of lateral subbasal spots on the female scutum, a light facial spot, a
relatively short surstylus, and a characteristic lateral lobe on the distiphallus.
Etymology. The specific name is a patronym dedicated to the late D. H. Pengelly, a great
entomologist whose spirit lives on in the community of entomologists associated with “his”
insect collection, the University of Guelph Insect Collection.
Sobarocephala quadrimaculata Sos, 1963 (Figs. 1, 27-29; Map 3)
Sobarocephala nitida Sos, 1963: 393.
Sobarocephala quadrimaculata Sos, 1963: 394. Sabrosky & Steyskal, 1974: 374.
Redescription (Fig. 1)
Male. Body length 2.9-4.4 mm. Bristles yellow with lateral scutellar bristles dark
95
Lonsdale and Marshall JESO Volume 138, 2007
brown. Two dorsocentral bristles. Acrostichal bristle absent. Two pairs of well-developed
lateral scutellar bristles. Ocellar bristle absent. Arista densely plumose. Sides of frons
converging posteriorly. Scutum yellow with one pair of short transverse presutural spots
behind postpronotum and one pair of large, quadrate, postsutural spots on lateral margin;
small triangular spot sometimes in front of scutellum. Scutellum and laterotergites dark
brown. Pleuron yellow. Coxae white. Legs yellow with fore tibia and tarsi brown; fore
tibia and basal 2/3 of fore tarsomere 1 yellow in lighter specimens; hind tibia sometimes
light brown. Head yellow with parafacial and (sometimes) gena white, first flagellomere
with brown dorsal stripe, and ocellar tubercle brown. Abdomen yellow with epandrium
and tergites 2 (medially), 3, 4, 5 (medially) and 6 brown. M ,, ratio 4.0-4.2. Wing lightly
clouded in cell R, and around bm-cu, and with dark infuscation distally on R,,, (appearing
“smudged” to R,,.). Cell bm closed. Face convex on dorsal half below antennal bases.
Female. Externally as described for male except tergite 1 with large oval spot and
abdomen past tergite 6 yellow. Female from Alabama with scutellum yellow medially.
Male terminalia. (Figs. 27—29) Sternite 5 evenly setose. Annulus with sternites
6 and 7 reduced to thin but well-sclerotized band ventrally. Epandrium as wide as high
and almost as long as high. Surstylus rectangular; tubercle-like bristles long, curved, and
terminal. Cerci flat with one longer central bristle. Hypandrial arm relatively long and
sharply angled with base projecting at 90° basally; ventral lobe wide, slightly shorter than
arm, and with one minute and two long distal bristles. Phallapodeme well-developed with
head reduced. Pregonite long, thin, and setulose medially and apically. Postgonite small,
rounded, and setulose. Basiphallus small. Epiphallus long and thin. Distiphallus *% length
of phallapodeme and wide distally (appearing “spoon-shaped”’); lateral lobe large, broad,
and serrate distally, with thumb absent.
Distribution. Bahamas, Colombia, Costa Rica, Mexico, Nicaragua, Panama, United States
(AL, FL, GA, TX) (Map 3, in part).
Holotype. UNITED STATES, FL: 2°, USNM.
Additional material examined. COSTA RICA. Guanacaste: 14 km S Canas, F. D.
Parker, 19-28 February 1990, 2, EMUS; 5-10 August 1990, 4, EMUS; 20-30 October
1989, 3, EMUS; 28 July 1991, 4, EMUS; 1-7 April 1991, 3, 52, EMUS; 8-15 February
1991, 24, 32, EMUS; 20-24 March 1989, 2, EMUS; 16-22 February 1990, ¢, 32, EMUS;
1-5 August 1992, 9, EMUS; 19-28 February 1990, ¢, 22, EMUS; 1-15 July 1991, d,
EMUS; 16-26 January 1990, ¢, EMUS; 24-31 May 1990, 2¢, EMUS; 23-28 February
1990, 73, EMUS; 5-11 January 1991, ¢, EMUS; 1-10 July 1991, 2, EMUS; 2-4 June
1991, 29, EMUS; 9-14 February 1989, 2, EMUS; 3 km SE R. Naranjo, F. D. Parker, 15-25
January 1993, 9, EMUS; 21 July 1993, 2, EMUS; 11-20 December 1992, 2, EMUS; S
Canas, F. D. Parker, 7-10 March 1989, 9, EMUS; 28 July 1991, 2, EMUS; 21-25 January
1989, 22, EMUS; 9-14 February 1989, 3, EMUS; Santa Cruz, P. N. Marino Las Baulas, 0
m, 14 December 2000, Malaise, Y. Cardenas, 2, INBC. Heredia: LaSelva Res. Sta., 11-17
June 1986, W. Hanson & G. Bohart, ¢, EMUS. Limon: Cuatro Esquinas, P. N. Tortuguero,
0 m, September 1989, J. Solano, 2, INBC. Puntarenas: Pen. De Osa, Puerto Jimenez,
10 m, P. Hanson, January 1991, 2, DEBU; May 1991, ¢, DEBU; November 1991, 9,
96
Revision of North American Sobarocephala JESO Volume 138, 2007
DEBU; May 1992, 4, DEBU; 5 km N Puerto Jimenez, 10 m, May 1991, P. Hanson, 4, 29,
DEBU; Malaise trap, June-July 1990, 9, USNM. COLOMBIA. Tol. Armero, Malaise
trap, 30 January—5 February 1977, E. L. Peyton, 2, USNM. HONDURAS. Roatin Isl.,
27 February 1979, G. E. Bohart, 9, EMUS, Roatin Isl (west), 1 January 1980, 29, EMUS.
MEXICO. Jalisco: Puerto Vallarta, 1 January 1971, sea level, P. H. & N. Arnaud, 9,
EMUS; Puerto Vallarta, G. E. Bohart, 10 December 1988, 29, EMUS; 8 December 1984, 3,
EMUS; Quint. Roo, sweeping, F. Carillo, 10-14 October 1986, 24, EMUS. NICARAGUA.
Puerto Rabezas, July 1971, J. Maldonado, 2, USNM. UNITED STATES, AL: Mobile
Co., Chunchula (site 20), Malaise, 25 October 2004, 30.90N, 88.20W, E. Benton, 2°,
DEBU. FL: Royal Palm Pk., 29 January 1933, A. L. Melander, 9, USNM; Gainesville, 8-
22 December 1986, hardwood forest, Malaise trap, W. Mason, 3, 9, CNCI. GA: Georgia:
Liberty Co., St. Catherine’s Island, 18-21 September 1972, F. C. & B. J. Thompson, &,
AMNH. TX: Austin, 28 October 1951, M. R. Wheeler, 2, AMNH.
Comments. Sobarocephala quadrimaculata is a relatively common species from Florida
and Mexico to Colombia. .
Sobarocephala setipes Melander & Argo, 1924 (Figs. 15, 59-61; Map 12)
Sobarocephala setipes Melander & Argo, 1924: 47. Sabrosky & Steyskal, 1974: 384.
Redescription (Fig. 15)
Male. Body length 2.4-2.9 mm. Bristles light brown. Two dorsocentral bristles
plus one minute bristle in front of anterior dorsocentral. Acrostichal bristle absent. Two pairs
of well-developed lateral scutellar bristles. Arista sparsely plumose. Sides of frons parallel.
Scutum yellow with posterior corner of notopleuron and (often) one pair of wide basal
stripes brown. Scutellum yellow (sometimes with brownish central tint). Laterotergites
brown lateral to scutellum; yellow in specimens from Florida and holotype with posterior
notal stripes also absent. Pleuron yellow, with meron and posterior half of katepisternum
white. Legs yellow, with coxae and basal half of femora white and fore tarsi light brown
to brown. Head predominantly yellow, with gena, parafacial, and occiput white and pilose,
ocellar tubercle brown, and light infuscation sometimes around base of arista. Abdomen
yellow with wide stripe on tergites 2-5 (also tergite 6 in one FL male). M__,, ratio 3.2-3.7.
Wing clear. Cell bm open. Face flat.
Female. Similar to male except as follows: anterior half of notopleuron and
postpronotum sometimes brown; notopleuron with central light brown spot; tergite 6 with
wide central stripe. One female from Florida (CNCI) with distal 2/3 of fore tibia brown,
and several females from Québec with fore tibia light brown. Ontario specimens sometimes
with corners of scutellum brown.
Male terminalia. (Figs. 59-61) Sternite five with comb of bristles on posteromedial
margin. Annulus reduced to thin band ventrally. Epandrium as high as wide and length 3/5
height. Surstylus short and rounded; tubercle-like bristles absent. Cerci small, rounded,
slightly sunken below distal margin of epandrium, and bristles short and subequal in length.
Hypandrial arm short, thin and projecting distally; three minute distal bristles on ventral
il
Lonsdale and Marshall JESO Volume 138, 2007
lobe. Phallapodeme thin and shorter than length of hypandrium. Pregonite clavate with
one distal bristle. Postgonite minute. Basiphallus 1/3 length of phallapodeme. Epiphallus
absent. Distiphallus “4 length of phallapodeme; lateral lobe small and ovate with thumb
absent.
Distribution. Canada: ON. United States: FL, IL, IN, LA, MD, MI, MS (Map 12).
Holotype. UNITED STATES, MD: Marlboro, 19 June 1916, R. C. Shannon, ¢, USNM.
Additional material examined. CANADA, ON: Wellington Co., University of Guelph
Arboretum, ex. dung, 8 August 2004, J. Klymko, ¢, DEBU [in alcohol]; 9 August 2004, O.
Lonsdale, 22, DEBU [in alcohol]; 12 August 2004, O. Lonsdale, 34, 2, DEBU [in alcohol];
19 July 2005, O. Lonsdale, 4, DEBU [in alcohol]; Essex Co., Point Pelee N. P., forested area
by west beach, Malaise trap and pans, 10-21 July 1999, O. Lonsdale, ¢, DEBU; Carleton
Place, 27 July 1959, J. G. Chillcott, 9, CNCI; Ottawa, J. R. Vockeroth, 13 August 1974,
&, CNCI; 28 July 1964, 29, CNCI; damp second-growth Acer-Betula wood, 11 July 1991,
2, CNCI; 16 July 1991, 29, CNCI; 3 August 1992, 29, CNCI; Perth Rd., Rideau Tr., 14 July
1981, H. J. Teskey, 9, CNCI; North Gower, 10 August 1984, D. Bell, 2, CNCI. UNITED
STATES, FL: Gulf Hammock, 23 April 1952, G. Peck, 2, CNCI; Sarasota Co., Myakka
R. St. Pk., 21 May 1973, W. W. Wirth, Malaise trap, 2, USNM; Alachua Co., Pierce’s
homestead, W. H. Pierce, 13 October 1973, Malaise trap, 9, USNM; Alachua Co., Chantilly
Acres, 25 April 1970, W. W. Wirth, Malaise trap, 9, USNM; Gainesville, Doyle Corner
MAP 12. Distribution of Sobarocephala setipes Melander & Argo.
98
Revision of North American Sobarocephala JESO Volume 138, 2007
Bldg., 23 September 1973, H. V. Weems Jr., Malaise trap, 29, USNM. IL: Champaign
Co., Brownfield Woods, 2 mi NE Urbana, 26 June 1976, C. T. Maier, 29, EMUS; Equality,
11 September 1952, M. R. Wheeler, 22, AMNH. IN: La Fayette, 2 July [year not given] ,
2, USNM; La Fayette, J. M. Aldrich, 5 August [year not given], 2, USNM; 31 July [year
not given], 2, USNM; 23 July [year not given], 9, USNM; | August [year not given],
2, USNM. LA: Chicot S. Pk. nr. Ville Platte, September 1954, M. Wheeler, 2, USNM.
MD: Montg’y Co., Dickerson, 14 July 1974, G. A. Foster, 4, 2, USNM: Glen Echo, J. R.
Malloch, 16 July 1922, d, 2, USNM; 9 July 1922, 2, USNM; 2 July 1922, 23, USNM.
MI: Wayne Co., Grosse Isle, 21 July 1957, G. C. Steyskal, 9, USNM; St. Joseph, Berrien
Co., 17 April 1972, D. D. Wilder, ¢, CASC. MS: Forrest Co., 6 mi W Wiggins, Sweet Bay
Bog, dung trap, 5-8 May 1994, sphagnum, S. A. Marshall, 2, DEBU.
Comments. Sobarocephala setipes is largely sympatric with the similar S. Jachnosternum,
but S. lachnosternum occurs west into Saskatchewan, Lake Superior, Texas, and Utah (Map
9), and is not known from the southeastern United States.
Sobarocephala setipes is sometimes attracted to dung, and we have observed
copulating pairs on dung baits in mid August in the University of Guelph Arboretum.
Sobarocephala texensis Sabrosky & Steyskal, 1974 (Figs. 17, 57, 58; Map 8)
Sobarocephala texensis Sabrosky & Steyskal, 1974: 381.
Redescription (Fig. 17)
Male. Body length 2.6 mm. Bristles brown. Two dorsocentral bristles.
Acrostichal bristle absent. Two pairs of well-developed lateral scutellar bristles. Arista
sparsely plumose. Sides of frons parallel. Thorax yellow with narrow light brown spot
from base of scutum to center of scutellum. Legs yellow with fore tibia and tarsi brown.
Head predominantly yellow, with occiput white, gena and parafacial white and silvery
tomentose, first flagellomere with infuscation at base of arista and ocellar tubercle brown.
Abdomen yellow with wide central stripe on tergites 2-5. M_,, ratio 2.8-3.7. Wing lightly
clouded along anterodistal margin. Cell bm open. Face flat.
Female. Externally as described for male.
Male terminalia. (Figs. 57,58) Sternite five with comb of bristles on posteromedial
margin. Sclerites of annulus well-developed. Epandrium as wide as high and length 2/3
height. Surstylus rounded and 2/5 height of epandrium; tubercle-like bristles absent. Cerci
small, rounded, slightly sunken below distal margin of epandrium, and with all bristles short.
Hypandrium with one minute distal and one short and one long medial bristle on ventral
lobe; arm atrophied, distal, and projecting at acute angle to long axis of phallapodeme.
Phallapodeme relatively thin. Pregonite rectangular with one distal bristle. Basiphallus
well-developed. Epiphallus and postgonite small. Distiphallus 2/3 length of phallapodeme
with lateral lobe well-developed.
Distribution. United States: TX (Map 8).
99
Lonsdale and Marshall | JESO Volume 138, 2007
Holotype. UNITED STATES, TX: Rio Frio, Leakey, Real Co., 23 May 1972, W. W.
Wirth, ¢, USNM [not examined].
Allotype. UNITED STATES, TX: same collection as holotype, 9, USNM.
Paratypes examined. UNITED STATES, TX: same collection as holotype, 24, 9°,
USNM. ;
Comments. Sobarocephala texensis differs from the similarly coloured S. setipes (Fig. 15)
in having a yellow thorax with a light median stripe on the scutellum that extends onto the
base of the scutum.
Sobarocephala wirthi spec. nov. (Figs. 11, 45-47; Map 11)
Description (Fig. 11)
Male. Body length 3.3-5.0 mm. Bristles dark brown. Two dorsocentral bristles
plus one minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Lateral
scutellar bristles weak. Arista sparsely plumose. Sides of frons parallel. Notum yellow
with notopleuron and (sometimes) postpronotum brown; supra-alar spot sometimes present
(Georgia) and confluent with notopleural spot. Pleuron, coxae, and femora white, with
yellow spot on anepisternum. Legs yellow (entirely yellow in Georgia specimens) with fore
tarsi brown and fore tibia usually light brown to brown. Scutellum with brown apical spot
(highly reduced in some North Carolina specimens) that is sometimes wide and attaining
anterior margin of scutellum. Laterotergites variably coloured. Head yellow with face
light yellow, ocellar tubercle brown, and parafacial, gena, and occiput white; gena pilose.
Abdomen yellow, sometimes with lateral margins of tergites (2)3-5 lightly infuscated
(Georgia). M,,, ratio 3.3. Wing clear, but if scutellar stripe entire, wing dusky in cell R,
and around distal 1/3 of R,,,. Cell bm open. Face flat.
Female. Externally similar to male except as follows: central stripe on scutellum
weak if entire; abdomen partly yellow, with tergite 6 brown, tergite 7 brown basally and
laterally, and posterolateral margins of tergites 2-5 with light brown spots.
Male terminalia. (Figs. 45-47) Sternite 5 evenly setose. Sclerites of annulus
well-developed. Epandrium as wide as high and with length 4/5 height. Surstylus as high
as epandrium and subtriangular; tubercle-like bristles along posterior and apical margins.
Cerci small and rounded with one pair of longer central bristles. Hypandrium with one
minute distal and two long medial bristles on ventral lobe, sometimes with two minute
distal bristles and three long medial bristles. Phallapodeme well-developed with head
thin and recurved. Pregonite thin and elongate with four distal bristles. Basiphallus and
postgonite small. Epiphallus as large as basiphallus in outline. Distiphallus half length of
phallapodeme; lateral lobe well-developed with thumb short, thin, and strongly projecting.
Distribution. United States: DE, FL,GA, MD, NC, NJ (Map 11).
Holotype. UNITED STATES, MD: Montg’y Co., Colesville, W. W. Wirth, 11 July 1974,
3, USNM.
100
Revision of North American Sobarocephala JESO Volume 138, 2007
Paratypes. UNITED STATES, DE: Rehoboth, W.W. Wirth, Malaise trap, 18 July 1972,
3, 2, USNM. FL: Jackson Co., Florida Caverns State Pk., 26 May 1973, W. W. Wirth,
Malaise, 3, USNM; Liberty Co., Torreya State Pk., 13 June 1974, H.'V. Weems Jr. & C.
R. Artaud, Malaise trap, 2, USNM; 5 July 1965, H. V. Weems Jr., Malaise trap, 2, USNM;
Alachua Co., Gainesville, Austin Cary Forest, G. B. Fairchild, 30 August 1976, 2, USNM;
30 July 1976, 2, USNM; 11 June 1976, insect flight trap, 6, 9, USNM. GA: Athens, 8-
11 July 1969, R. & J. Matthews, Malaise, 2, EMUS; Forsyth, 2 June 1970, 234, CNCI.
MD: Montg’y Co., Colesville, W. W. Wirth, 11 July 1974, ¢, 22, USNM; 4 July 1976, 2,
USNM; Malaise trap, 26 June 1977, 29, USNM; 30 June 1977, 3, USNM; Glen Echo, 25
June 1922, J. R. Malloch, 2, USNM. NC: Wake Co., 7 air mi SW of Raleigh off rd., C.
S. Parron, Malaise trap, 17 July 1985, 0, NCSU; 10 July 1985, 24, NCSU; 29 June 1985,
2, NCSU; 31 July 1985, 2, NCSU; 25 June 1985, 9, NCSU; Mecklenberg Co., 22 June
1996, T. Daggy, 2, NCSU. NJ: Oswego Lk., Burlington Co., 30 August 1974, Menke &
Miller, 9, USNM.
Comments. See comments for Sobarocephala latifrons.
Etymology. The specific name honours the late W. W. Wirth, who collected most of the
type material.
Acknowledgements
We would like to thank a number of people for their aid in the preparation of this
paper, including the curators who loaned us most of the material used in this study: T. Nguyen
and D. Grimaldi (AMNH), K. Ribardo and N. Penny (CASC), C. Young (CMNH), D. M.
Wood, J. R. Vockeroth, J. O’Hara, S. Brooks, J. Skevington, L. Bartels and J. Cumming
(CNCI), W. Hanson (EMUS), M. Zumbado and M. Solis (INBC), P. Perkins (MCZC), R.
Blinn (NCSU), E. Riley (TAMU), A. Freidberg (TAUI), and D. Furth, A. Norrbom and F. C.
Thompson (USNM). W. Reeves (Center for Disease Control and Prevention, Atlanta, GA)
graciously donated material from the southern United States. Comments provided by two
reviewers were greatly appreciated. This study was supported by NSERC discovery grants
awarded to Stephen Marshall, and NSERC and OGS grants awarded to Owen Lonsdale.
References
Johnson, C. W. 1913. A study of the Clusiodidae, (Heteroneuridae) of the Eastern United
States. Psyche 20(3): 97-101.
Loew, H. 1860. Diptera Americana ab Osten-Sackenio collecta. Decas prima. Wiener
Entomologische Monatschrift 4: 79-84.
Lonsdale, O. and S. A. Marshall. 2006. Redefinition of the Clusiinae and Clusiodinae,
description of the new subfamily Sobarocephalinae, revision of the genus
Chaetoclusia and a description of Procerosoma gen. n. (Diptera: Clusiidae).
European Journal of Entomology 103: 163-182.
101
Lonsdale and Marshall JESO Volume 138, 2007
Malloch, J. R. 1918. A revision of the dipterous family Clusiodidae (Heteroneuridae).
Proceedings of the Entomological Society of Washington 20(1): 2-8.
Malloch, J. R. 1922. Notes on Clusiodidae (Diptera). Occasional Papers of the Boston
Society of Natural History 5: 47-50.
Melander, A. L. and N. G. Argo. 1924. Revision of the two-winged flies of the family
Clusiidae. Proceedings of the United States Natural History Museum 64: 1—54.
Sabrosky, C. W. and G. C. Steyskal. 1974. The genus Sobarocephala (Diptera: Clustidae)
in America North of Mexico. Annals of the Entomological Society of America
67(3): 371-385.
Sods, A. 1963. Identification key to the species of the “p/umata-group” of the genus
Sobarocephala Czerny (Diptera: Clusiidae). Acta Zoologica Hungarica 9(3-4):
391-396.
Sods, A. 1964. New Sobarocephala—Species from the “plumata-group” (Diptera:
Clusiidae). Annales Historico-Naturales Musei Nationales Hungarici 56: 449-
455.
Sods, A. 1987. Clusiidae. pp. 853-857 Jn Manual of Nearctic Diptera, Vol. 2. (eds), J. F.
McAlpine et al. Monograph 28, Research branch, Agriculture Canada, Ottawa.
1332 pp.
Steyskal, G. C. 1951. The dipterous fauna of tree trunks. Papers of the Academy of Science,
Arts and Letters, Michigan 1949: 121—134.
Woodley, N. E. 1984. The identity of Chaetoclusia affinis Johnson and its placement in
Sobarocephala Czerny (Diptera: Clusiidae), Psyche 91(1—2): 119-121.
102
Revision of North American Sobarocephala JESO Volume 138, 2007
Annulus
Distiphallus
Lateral lobe of
distiphallus
Basal shield of
distiphalus
Epiphallus
FIGURES 18-20. Sobarocephala flaviseta (Johnson), male terminalia. 18—external, left
lateral. 19-external, posterior. 20—hypandrial complex, left lateral. FIGURES 21-23. S.
latifacies Sabrosky & Steyskal, male terminalia. 21—external, left lateral. 22—external,
posterior. 23—hypandrial complex, left lateral. FIGURES 24-26. S. cruciger Sabrosky &
Steyskal, male terminalia. 24—external, left lateral. 25—external, posterior. 26—hypandrial
complex, left lateral. FIGURES 27-29. S. quadrimaculata Soos, male terminalia. 27—
external, left lateral. 28—external, posterior. 29—hypandrial complex, left lateral.
103
Lonsdale and Marshall JESO Volume 138, 2007
an
x
a
FIGURES 30-32. Sobarocephala atricornis Sabrosky & Steyskal, male terminalia. 30—
external, left lateral. 31—external, posterior. 32—hypandrial complex, left lateral. FIGURES
33-35. S. flava Melander & Argo, male terminalia. 33—external, left lateral. 34—external,
posterior. 35— hypandrial complex, left lateral. FIGURES 36-38. S. muesebecki Sabrosky
& Steyskal, male terminalia. 36—external, left lateral. 37— external, posterior. 38—hypandrial
complex, left lateral. FIGURES 39-41. S. affinis (Johnson), male terminalia. 39—external,
left lateral. 40—external, posterior. 41—hypandrial complex, left lateral.
104
Revision of North American Sobarocephala JESO Volume 138, 2007
y Ne 0
=
FIGURES 42-44. Sobarocephala pengellyi spec. nov., male terminalia. 42—external, left
lateral. 43—external, posterior. 44—hypandrial complex, left lateral. FIGURES 45-47. S.
wirthi spec. nov., male terminalia. 45—external, left lateral. 46—external, posterior. 47—
hypandrial complex, left lateral. FIGURES 48-50. S. latifrons (Loew), male terminalia.
48—external, left lateral. 49-external, posterior. 50—hypandrial complex, left lateral.
FIGURES 51-53. Sobarocephala interrupta Sabrosky & Steyskal, male terminalia. 51—
external, left lateral. 52—external, posterior. 53—hypandrial complex, left lateral.
105
Lonsdale and Marshall JESO Volume 138, 2007
FIGURES 54—56. Sobarocephala dreisbachi Sabrosky & Steyskal, male terminalia. 54—
external, left lateral. 55—external, posterior. 56—hypandrial complex, left lateral. FIGURES
57-58. S. texensis Sabrosky & Steyskal, male terminalia. 57—external, left lateral. 58-—
hypandrial complex, left lateral. FIGURES 59-61. S. setipes Melander & Argo, male
terminalia. 59—external, left lateral. 60—external, posterior. 61—hypandrial complex, left
lateral. FIGURES 62-64. S. lachnosternum Melander & Argo, male terminalia. 62—
external, left lateral. 63—external, posterior. 64—-hypandrial complex, left lateral.
106
Decline in long-horned wood boring beetle species? JESO Volume 138, 2007
A DECLINE IN THE NUMBER OF LONG-HORNED WOOD
BORING BEETLE (COLEOPTERA: CERAMBYCIDAE) SPECIES
IN ONTARIO DURING THE 20° CENTURY?
D. B. MCCORQUODALE', J. M. BROWN, AND S. A. MARSHALL?
Department of Biology, Cape Breton University, Sydney, Nova Scotia, Canada B1P 6L2
email: [email protected]
Abstract J. ent. Soc. Ont. 138: 107—135
Documenting loss of biodiversity in insects is hindered by the lack of species
level inventories for many taxa. In Canada we have a better understanding
of Coleoptera distributions than for most other taxa. Here we ask if we
know how many species of Cerambycidae occur in Ontario, and whether
there has been a change in the number of species over the past 100 years.
More than 18,000 specimens collected since 1862 were examined. A species
accumulation curve demonstrates that the inventory is reasonably complete.
Rarefaction estimates of species richness by decade show that fewer species
were collected after 1950 than before. Most of the 20 species collected only
prior to 1950 were associated with hardwood trees in the Carolinian zone of
extreme southern Ontario. Loss of forested habitat and replacement of old
growth forests with younger forests may have played a role in the decline.
Nine species were first collected after 1950, resulting in a net loss of 11
species. Selected records from after 2000 suggest that the introduction of
species, range expansions into Ontario, and discovery or rediscovery of rare
species is continuing.
Published November 2007
Introduction
Entomologists have difficulty documenting biodiversity losses because species-
level inventories do not exist for most taxa for most locations. In Canada, only about 60-
65% of all arthropod species that exist in the country have been documented (Danks 1979).
For many insect groups we lack keys, comprehensive revisions, or the expert taxonomists
able to identify species, undertake the revisions, and write the keys necessary for species
identification; in short there is a ‘taxonomic impediment’ (Taylor 1983).
The insect fauna of Ontario is incompletely known, although two approaches,
broad scale inventories and curation of existing collections, have expanded our knowledge
in the past 20 years. These approaches have produced species-level inventories for a few
' Author to whom all correspondence should be addressed.
? Department of Environmental Biology, University of Guelph, Guelph, Ontario, Canada
N1G 2W1
107
McCorquodale et al. , JESO Volume 138, 2007
locations (e.g. Skevington et al. 2001; Paiero et al. in press) and many newly recorded
species in relatively well known taxa, such as aculeate Hymenoptera (Buck 2004; Buck et
al. 2006), Hemiptera (Paiero et al. 2004), Orthoptera (Marshall et al. 2006), and Mecoptera
(Cheung et al. 2006). For Cerambycidae, McCorquodale (2002) documented 14 new
records for Ontario, including seven new records for Canada, and clarified the status of 11
other species for which there was equivocal evidence of occurrence in Ontario.
The Cerambycidae are plant-feeding beetles with about 1,100 species in North
America (Linsley 1961; Linsley and Chemsak 1997; Allison et al. 2004). A series of
taxonomic monographs by Linsley (1962a; 1962b; 1963; 1964), Linsley and Chemsak
(1972; 1976; 1985; 1995), and Chemsak (1996), as well as a recent field guide, make
taxonomic information accessible (Yanega 1996). Although most species of Cerambycidae
in North America are well known taxonomically, new taxonomic notes on the genus Oberea
(Yanega 1996) and current work on Jetropium by Serge Laplante, Canadian National Insect
Collection, indicate that systematics work is still required.
Most cerambycids depend on tree or shrub hosts for development. Therefore host
availability and changes in host distribution and abundance should influence the distribution
and abundance of these beetles. In Ontario, land use and forest cover have changed
dramatically over the past 300 years, particularly south of the Canadian Shield (Keddy
1997; Larson et al. 1999; Armson 2001; Suffling et al. 2003). Forests were converted to
agricultural fields and timber was extracted from large areas during the 1800s; forest area
was at a minimum in the 1920s, with about 10% of the original forest cover remaining south
of the Canadian Shield (Larson et al. 1999). Besides the loss of forested area, there has been
a change in the character of forests. Larson et al. (1999) explain that forests in southern
Ontario are younger, more fragmented, and more homogeneous now compared to 300 years
ago. North of the French and Mattawa Rivers, the area of forest cover has changed less
dramatically, but composition of the forest has changed through forest harvesting (Jackson
et al. 2000).
Land use change is expected to change the insect fauna. About 60% of nationally
listed species of vertebrates and vascular plants occur in Ontario, with most of these
occurring only in Ontario and only in the Carolinian or Deciduous Forest zone (Canadian
Wildlife Service 2006). Habitat loss through clearing for agriculture and urbanization are
prime factors.
Here we ask whether there is a good inventory of the Cerambycidae in Ontario.
Given that recent work on a variety of groups has increased the number of species known
for Ontario, it is important to assess the completeness of our inventory. Next, because of
land use changes and decrease in older forests, we ask whether there are fewer species
represented in collections from 1950 to 1999 compared to before 1950. At a finer level, the
same question is asked for eight shorter time periods, roughly decades, four before 1950 and
four from 1950-1999. Host preferences and geographic range of the species in collections
only from before 1950 and only from 1950-1999, are compared to test whether potential
losses are mostly from the extreme south of the province. Finally, significant records from
after 2000 are considered.
This analysis is possible because of the efforts of many generalist insect collectors,
epitomized and encouraged by D. H. Pengelly. Beetles were not his focus, yet while pursuing
bees, many beetles ended up on pins. For each of more than 30 consecutive years starting
108
Decline in long-horned wood boring beetle species? JESO Volume 138, 2007
in the mid-1950s, there are cerambycids collected by Pengelly in the University of Guelph
collection. These are of inestimable value in documenting faunal change. Perhaps more
important are the hundreds of specimens collected by dozens of young students motivated
by Pengelly to learn about where insects live and what they do. From the 1960s to the
1980s students in his insect collection course collected beetles across southern Ontario.
These students, including several contributors to this volume, are prominent on labels of
cerambycids. The specimens deposited in the University of Guelph collection, are more
important than numbers alone indicate, because at the same time relatively few cerambycids
were being deposited in the other major collections in Ontario. D. H. Pengelly’s genuine
curiosity about insects and his ability to ignite curiosity in others made this contribution
possible.
Methods
We identified all pinned adult specimens of Cerambycidae collected in Ontario
(N=18,469) in five major insect collections: Canadian National Insect Collection, Ottawa,
ON [CNC, n=6,050 specimens]; Royal Ontario Museum, Toronto, ON [ROME, n=4,517];
University of Guelph, Guelph, ON [DEBU, n=4,511]; Great Lakes Forestry Centre,
Sault Ste. Marie [GLFR, n=2,142]; Canadian Museum of Nature, Aylmer, PQ [CMNC,
n=705]; and in collections with smaller holdings: Lyman Entomological Museum, McGill
University, Montreal, PQ [LEMQ, n=397]; Canadian Forestry Service-Fredericton, NB
[FRLC, n=80]; Algonquin Provincial Park Visitors Centre, ON [APVC, n=67]; and the
Nova Scotia Museum of Natural History, Halifax, NS [NSMC, n=1].
The primary source for identifications and taxonomy was Yanega (1996),
supplemented with Linsley (1962a; 1962b; 1963; 1964), Linsley and Chemsak (1972; 1976;
1985; 1995), Chemsak (1996), and a few recent revisions to nomenclature (e.g. Napp 1994).
McNamara (1991) provided a checklist of species in Ontario. Non-native species collected
in Ontario but presumed not to be established, such as Physocnemum andreae (Laplante
1989; McCorquodale 2002), Phymatodes lividus, and Prionus californicus (Fletcher 1907),
are not included.
Label data were recorded for all specimens collected up to and including 1999. All
specimens from the same location in one year were considered one record. Specimens from
a more specific locality and a less specific locality in the same year were counted as one
record (i.e. Ottawa in 1905 and Eastern Ontario in 1905 counted as one record). Selected
specimens collected since 2000 and deposited in the University of Guelph collection are
included separately and are not considered in the main analysis.
Old specimens with no year indicated on the label made up a substantial proportion
of all specimens (McCorquodale 2002) and were combined in the category ‘Limited Data’
and then with all specimens from the 1860s to 1919 in the category ‘Before 1920’. The
importance and the limitations of these data were explained in McCorquodale (2002).
These specimens represent the fauna of Ontario prior to 1920, despite having incomplete
label information.
From the specimen label data, we tallied the number of records before 1950, from
1950-1999, and in eight ‘decade’ categories (before 1920, 1920s, 1930s, 1940s, 1950s,
109
McCorquodale et al. JESO Volume 138, 2007
1960s, 1970s, 1980s+1990s), four before 1950 and four from 1950-1999. These latter
categories are referred to as ‘decades’. Some analyses compare pre-1950 and 1950-1999
records, two categories with an approximately equal number of records (Fig. 1; 3,902 and
4,160). Others compare the eight ‘decades’, again each having a similar number of records
(range 855 to 1,284). The biased sample of specimens from after 2000 is only considered
separately.
Individual-based rarefaction, using records as defined above, was used to calculate
expected species richness for each of the time categories (before 1950 and 1950-1999 and
decade) to test whether species richness changed. Rarefaction iteratively sub-samples a data
set to produce a taxon-sampling curve that represents the expected number of species for
a given sample size (Krebs 1999; Buddle et al. 2005; Gotelli and Entsminger 2005). This
allows comparisons between data sets with different sample sizes by comparing expected
species richness for a common number of individuals (i.e. the sample size is set slightly
smaller than the smallest sample). Expected species richness was compared at 3,800
records for before 1950 compared to 1950 to 1999 and at 800 records for the eight ‘decades’.
Estimates of the expected species richness, variance and 95% confidence intervals were
based on 1,000 iterations using EcoSim 7.72 (Gottelli and Entsminger 2005).
Results
Completeness of inventory. Two hundred species, approximately 95% of the 211 species
of Cerambycidae now known from Ontario, had been collected before 1950 (Table 1). The
many old specimens collected prior to 1920, some with incomplete label data, included 179
species; the next highest ‘decade’ total is 157 species from the 1930s (Fig. 1). The 1930s
also had the fewest records. The asymptotic nature of the species accumulation curve (Fig.
2) suggests the inventory of Cerambycidae of Ontario is relatively complete. Between 1950
and 1999 one species was added to the fauna about every 5 years.
We here add the following species not recorded in Ontario by McNamara (1991) or
McCorquodale (2002).
Cerambycinae, Clytini, Xylotrechus mormonus (LeConte): Ontario, Deux-Rivieres, 26 July
1956, F[orest] I[nsect] S[urvey], CNC.
Lamiinae, Ataxiini, Ataxia brunnea Champlain and Knull. Ontario, Chatham Lab, Summer
1937, CNC; Ontario, Harrow, | July 1961, R. S. Dickout, DEBU.
Comparison of species richness before 1950 and 1950 to 1999. Fewer species of
Cerambycidae were collected between 1950 and 1999 than prior to 1950. Raw species
richness prior to 1950 was 200, compared to 191 for 1950-1999. However, it is more
appropriate to compare species richness with rarefaction estimates that control for unequal
sample size. The rarefied expected species richness prior to 1950, 199.5 (198-200, 95%
CI), was higher than for the period 1950-1999, 188.3 (186-190, 95% CI). Comparison of
rarefaction estimates for the eight ‘decades’ (Fig. 3) demonstrates the decline in species
richness for collections from 1950 to 1999 compared to prior to 1950. All four pre-1950
‘decades’ had higher species richness than all four 1950 to 1999 ‘decades’.
110
JESO Volume 138, 2007
Decline in long-horned wood boring beetle species?
C7 I I I hee Pee ok v (Aqiry]) snjoipiuip sapoyoudyg
| a ae 9 ¢ l Me we If | (Aes) snuaowp sapojoudyg
L I I € 6 (UPLUMON) Snasap sapojoudyg
ve, | G I bv «OO! I I 17 (Aqiry[) snajoud wnjjatsay
6C . c c € oe epee (6 v (snoeuUuly) wnaovjoia wnIpyjoD
9€ Meee eo Big) GS XS Rates Kasey winpisiyf wnipyyj0Z
I I UBUIMON| WNjoUUajUD WNIpIjOD
unpre
AA GS Ss c I C I I € (AInIq) 0j9U19 DJJUID DUDYNUY
turf idsoimmjog
6 € I € Z (AI0D pue ay10de7) syjjooissaiduoo snjAjoo4.oyy
SON Se | aia | a: ae | a 9 en A I 9 (JIAO) snsoonssaa snsoydopscy
lundA[seuy
avurAquiviay
a ay A I C (G I. € I I (Aes) vsnfuod psnfuos niunyp
Urry
E € c I I Aaseg wnuvizanmyss wnidojay
I I I € c Aoseg wnjnasnd wnidosjay
CC ue ¢ C C Sg 6 I I € Aqiry wndsajdowpuuis wnidoja
NE ae a 2 < ele 3 | : ei (snoeuUry) wnjolys wnuasp
I I (jJepuey) snjajosqo snoysna snjodoysp
eZ ¢ 6 6 SY £6 () Ap. @ v a (UeSp[eH) $77/0I1aA0f snjodoyap
IUIIOS
IVUINIISY
1 Se ee ae ae Ge
bs 6 © 2 2 &€@ S&S 8S &s S 2 BE
n n n n n n n n n 77) 77) oO
Qu.
‘PEUTQUIOS OS]B S19M SHH] PUL SOG] PUL NZHI SWOJog Ul PAUIWIOD d19M SCG] PUL ‘SOO6T ‘SOOST ‘eIEP powu] ,sopeoop,
JO sashjeue JO “OLRJUO Ul po}d9]]09 seplokquuesaD Jo suounoads Ggp‘g] UO peseq speoap Aq spsode1 Jo Joquinu sy], “| ATAVL
111
Om NON
tm
“E i SF. OO
JESO Volume 138, 2007
Dns eee ao Tt
MAN mH NY
va)
onmonn~mnme FNITFTAN SO
CON = WN
— eer rr —
nae m- ON
Noe -— AN hw
mnrN eH =
—_—
oO
_
oe)
_
(snioliqe,,) snuojoa snyradojAXy
(Aes) snsouup snyrasjojAy
JOYSL] Sta snyIadJO]AY
(snioliqe) supuiujnf sayjsasoAvy
(sniolige) smjouosonul snjdjI0aN
(A10D pure ay10deq) snuozoana snjdj20aN
(Aes) vaudpo snjajo0an
(snioliqe) snypulunon snjajo0aN
(1918104) aviuigos auapjAonsaypy
(ueyen) anduva aualjdonsayy
(Aes) snsoizads sniqooa]5
(I9IAI[Q) VjOIlANA SNJA]D
Alo‘) pure oylode’] s1joouisanu snjay
(A10x) pure oyodeTq) smpiaspfogyp snidajoiayD
(sIue}]) szjigou saplojjoD
UNF)
(Aased) snso1sij1] snjounuag
(snioliqe J) snausi) snjounuag
(uJO}]) syjooluinsups sndojodoy
(Aqary) 8140]]09 DAIIOUOA
(Aes) wnauipiaasg unumaur0saAyd
(snioLiqey) smiipa sapojoudyd
(snovuurq) snaonjsa} sapojpudyd
MUODeT SjoaynapU sapowwudAyd
ponuljuos TUlIpr[e)
[BIOL
S066]
S086]
SOL61
S096]
sOS6|
S061
SOe6]
SOZ6I |
S016]
S006]
S008 1
eyed |
pomury
McCorquodale et al.
‘ponunuoy) “| WIaVvVL
112
JESO Volume 138, 2007
Decline in long-horned wood boring beetle species?
IL
N
N ™~ OM
Nae ee OMTan oa
—~Y
Oo
N
+
N
est EN, MANO
b ee |
ABg snypjnopug snyr10j0y
PUTqOIOLOY
ueWopleH smojnovuaponb sayjyovsajayy
FUTMOTpIqy
uBWap[eH snpojynopug snjouojA]
(uelap[eH) suarsaqgnd sauvydosadsayy
(Aes) vyouwmasiaponh ving zy
Turueydosodsay
(JSIAI[Q) SmjDjou snuaydsouas
({[jepuey) sojooiun vssvidsg
(ueWopley) wnsiadsp uoipiydvjasiwg
(uBWop[eH) sijnfn1 sapojoydougq
(peoysiel)) snspydysos sapojpydpugq
(Aintiq) sniupuojp sapojoydouq
(Aes) wnjouosonu uoipiydy 7
(sntoliqe) snsozjia snydvjaup
(UBLUIMON) smjiuind snydpjaup
(UBLIMON) SjazjD1vd snydvjaup
luliprydeyq
(Aes) snyojnpun snysasjojAy
(IBULIDD) SNyDYISDS snydasO/AY
(uBWapleH) smjojnovuaponb snysaaqojAy
(9]U0D9T) snuomsoM snydadjo]Ay
MUODIT Ssuassaauod snydadjojAy
ponunuos tundya
[BIOL
$0661
S0861
SOL61
$0961
SOS61
SOr6I
S061
S0Z6I
SOI61
S0061
S008 I
poqury
‘penunuo) “l AaTaVvL
113
JESO Volume 138, 2007
McCorquodale et al.
Rute eee te TE
ZZ ae Z € € ee I z (uewoplep}) snaiajauuds sasanjdaT
L I I L. Ce I (uewoplep) suansfuoo sasanjdaT
ZI | ¢€ I = 6 I Z (jeyUd[AD) snsuaasuvay snjdjsojdaT
pS Se a SR SO: <a S| p uewopley Mpjnavul sdppjduadaH]
paee=te;- £F fT th ‘ti Ol. € - (Avs) vsuadsp sAqnjdaadayy
9 Se UOTIIG pure UOTII Mos saj9aq
ee. SF FF Lo bed € | (Avg) pypyinsxas sisdoj(sp
2 | Be C L S Gc $f" .4 S (Avg) pjnovu sisdojAispy
v C I I (uewiopyeH) s7.10]/09 sisdojaisy
be. f be oy L ae ee ee S I t g Aqury snypisnd snujsoyjuvay
9 I Z I Z (A9IAI]Q) snjajosqgo snulaoyjuvdp
IUIUIOOYJUBIY
. IVUIIWIe'T
val Z | € 4 ra Z (snioliqeq) sypsauny snuarlandind
wm Sy] I eso te. Pog s | (Avg) sippanins ajdipg
lULIopAYyors |,
GS a) eS se i a a” a Se a (snioliqef) sadiaid saosapng
rurydsowiojytL
Iv Poet ae Se a ee ee € (J9IAI]O) SIJOIUINsUDS SAxOULI]]O)
1u119}d0u9}§
¢ Z I (Avs) auofifnans unoipoug
UISTPOWS
woe | © iC 9 € L i F¥ I C uByeH wnjnfns WnldqC
[ I (I9IAT[Q) WNyDjnodU WiNLAGOE
(uILIqO
i= = @ Ss ££ SS Be SS @ ee
2.2 os € 6 Ss eS & £ & Ge
”n n n n n n n n n 77) 77) oO
[on
‘ponunuoy) “| ATaVv
114
JESO Volume 138, 2007
Decline in long-horned wood boring beetle species?
(Aes) wnaSiu puiayospo4oq-
SC I I v ei C I t
¢ I I I (ADIAI|Q) wnasauld DUaYyIsvI40G
I I (Aes) wnjousayp Duayasv210gq
lUIBWOYoseoIOd
I I (ueWap[eH) snapusdd snus)
lULUTIAS)
Z I I [[nUy pue urejdweyD vauunag vixnjy
FUTIXe} V7
SOL @ 1 -€ 4h #6 €l Ol 6 . 74 (Avg) smgojousadns snsazouasg
b I I I It It Z (ueUlap[ey]) snsojuamo) sniuosodng
an | t I g £ ¢ 9 |L Z (9]U0D27J) snjowavgns sniuosodny
IC oe ¢ 6 C S © Bg I I 91U0D9] 4adnnd sniuosodnq
1ulAsepody
BC I 9 3 € 6 t C (9}U0D97J) YjIqnu vIsojdC
I I (Aes) snqqisiaponh snydiowosap
ce t 9g € rg I t &£ v [ € (jeyuaT[AD) snysapow snydiowosay
TULIspoyUeOV
poi Of OL FF 9 c € V |) a 4 9 Zz ¢ (129H9q) smw1ospf siydpssosy
6 I Ls tt 7% I Cc (Q}U0D97) snjoadsap siydpsso1Q
oe Tt € TI I a 2. ££ = 1 I (91U0De7) snyousis sajdajsuQ
ate) oF ot EL § 6g c (Yout.q) sa1anb sajdapsuyQ
S I I I I I (Aes) snjaan{ sajdajsujQ
St I Ol I a. eZ I Z Z (UBLDP[eH) SMsaivA snipiusa|s
1s Co Oo et Om HM hue € (Avg) pydjo snudorT
‘ponurjuod TUTUTDOYyVUROY
Poe = be © 6S SS S SS YE
P22 Pie. 2 € 6 Se s = 8S €e
n n n n n n n n n n n oO
QO.
‘penuyuoy) “| ATaVL
115
N
JESO Volume 138, 2007
NNN
=
Oo — = | CO
— COM O — OO CO =
-_
WON —
—_
be |
(Aes) $1//091)0]NIO Da2gG—Q
UBWdp|eH 2D]]290 vas2qC
(snioliqe 4) ojpydaso0syjaAua vadaqC
[[NUy 1su0jap va4saq¢—C
Aaseg sualoyap va4aqcQ
AOYIYSIS|IAR]g 1Masvo vasaq—
uo} IIe} pure Susy] siuiffp vasaqcQ
TUID90}]AYd
(Aes) DyDjNsU1I Sasap1gUucy
lUHSpiouO
(sniolige.) 40jD]/1)1) Snuupy20Uu0py
(Aes) snjojjainas snupyrouopy
(Ainiq) snjpjou snumyrou0py
MUODIT HOjDjNU SnuDYyIOU0py
AQAVS| AOJDAOWADUL SNULDYIOUO[Y
(IIAI[Q) SISUaUIJOADI SNUIDYIOUOPP
(a\U0DeT) SMJDINIO SA0BOAII
ueWdap|eH Vsojnqau vjojsaqay]
(199H9q) SNU14B1] SA0H
(ueWdpleH) smjuajnsaajnd saoyH
(uewopleH) 4ayajnd saoH
UODIT Sijigap saoH
TUTTE ’y
(snio1iqeq) pypasiumay sisdoddiyy
1uisdoddipyy
[ROL
$0661
S086
SOL6I
S096 1
sOS6l
S0r6|
S061
S076
S016]
S0061
S008
B1eq
pour]
McCorquodale et al.
‘ponunuoy) “T dTaVvL
116
A a |
— TMH
JESO Volume 138, 2007
SENNA NA
~AAAM =
— cO C~ — Cc
ALG ra Gy = A
NANMNANHN MM NM | CO CO
fae)
—_—
Cy Ch GY 6h) GH IN Oh IG ca f- CN
m~ Fees MAB NM
NO — —e
koe SP-en
om Ct
\O
N
\o
WY
N
— |S
=a FN SM
_
=<
Keg sijpoayaound ppsadps
3U0DI7T Yisaou vaujndod ppsadvs
Keg onbijgo ppaadvs
Aeg vayjnu ppsadvs
snioliqe s1jp4ajp] bpsadvs
Aeg pjpusoul bpsadvs
[anor pue ya4 subj Dpsadvs
puelg 1pf ppsadps
snioliqe | vaploasip vpsadvs
UCVWIMON YIDjJa19 Dpsadvs
snioliqe | opipuvs vpsadvs
Keg pjpspajva ppsadvs
Tulpiodes
MUON] suwoppioiuad snsayIOUuOsog
MUNDI] snjnaspd snsayIouosog
UBWOp|eH SMX SNABYIOUOSO
(Aes) snaaadspp snaaadspp snadoq
TULIaYIOUOSOg
(sniapaMms) DyDJIUNA1A] DAAAGE
MUNDI] MwnvyIS vas2g—
Aaseg vsouindd vasaqcQ
Aaseg psuojapid vasaqQ
ueWopleH 770)]101ds4ad vasaqcQ
Kasey vpyjod pasaqcQ
‘ponuljuos 1u19901)AYg
[P10]
$0661
S061
S0L6I
$0961
S0S6I
S0r61
SOC6I
S0Z6I
SOI6I
S0061
S008I
Beg
paywury
Decline in long-horned wood boring beetle species?
“penuyuoy) 1 ATaVL
117
JESO Volume 138, 2007
McCorquodale et al.
I I (Aes) pjoyjiaig ppimosdyoodg
DS aa a I es Se ae I rd (Aeg) va1agna panjdajAyooig
nino tt & EE Ge t eS € Kase) iuipjdumys panjdajAyovag
os Gp ge ff S&S ee eC EE @ (Avg) stupjpos panun]jag
€ I 7 MUODE] Sypiaia xojcydoyup
eet 6h UE ULE S. 2 oP 4 (uewopyeH) snaundo xpjdydoyjuy
SE a nn a a Z (uewop|eH) smonuayw xpjdydoyjuy
ine. 8] (i 6l «6FllCUGlCU CU EUEUCUCUDCOD (Avg) vuagnd paapojdouy
€| 4 € I 4 | (Q1U0eT) DauINsuDsS DIYsUDASDUy
i eee Se Gali SR Se: ss 4 9 (Avg) pjoaul] vanjdajpuy
6 € v Z (uewoplepy) vjnfns saplosdoapuay
i a, a | a) aS a a | Se Soe | 9 (Aqiry]) snajoud sdoapuay
CP aoe, 6 ey Sr Bt Beek: 8 (Sumeyorey) s1suajosd sdoapuiay
| ruiinyday
et, alee aoe | ae eS ee De ee (19)S10,J) sipyjpod sn4aooulsaq]
TULIDDOWIS9C
avulinjda']
Pevgerige cg) Pf, 1 €l BE AL & 1b. 8. bt (19810) snuyoysydo.sjay sadov.a]
¢€ ¢ I I uewopley spojnapuanbuinb sadovajay
4 I | | | LoyuoyyS snanuvjau sadov.jay
€ | | | 3U0ge7] snjpsouaf sadov.ja]
1uidoenye],
£6 Pon Cf 6 +S 8 Ste Tr As Keg pjiisaa ppsadvg
Ay See yaa ae ee Ay 2 a JOIAL[Q DIDIUaplA) Dpsadbg
‘ponuijuos tulpssdes
a. =f ££ & & & Be & & SB He
aa. 2 © £282 2 82 e & ¢ * =
n n n n n n n n n n n oO
jon
‘ponunuoy) “| Wav
118
Va)
~Y
CON ONM
NANAWANOMNM
N
=z
JESO Volume 138, 2007
NO TN MN Sm eS
ON OAINNN
Ww re
MONN AN
NAN N
tom +t
—=aANnTMMNN OA
“+t
+
— = AG OC) OO GS = oO AN
N
laa)
=
_ ps Eos Coy ba
CO Mm SH ND SS
eS EY WO St eS ica (>
= OD os i
os he OC Fe A
Noto T+
MANDA HOM
rTFree NAN
ON TAT =—
\o
N
boo |
foe)
(UBLUMON) S2UuUadiBnd DIGOUI]DYIDS
(snoeuul’y) 4ojisinbul wnispyYy
(Aes) pyjas3iu vAnjdajo3Ag
(UBUOp|eH) VIDJUaNAI DIDBUu_ASOpNas
(puel[g) s7puimopqgn puljosnpsopnasg
(Aes) syjooyna puoplg
Aqiry, pau] vidyovod
(UPLUMON) BIDI1dDI DUsAJSO]IDOAN
(UeUIMON) S240f1g sisdosnjdaT
(Aqity[) buoJ0sMyd DISOgOANJdaT
[[Jepuey vyowpyqns vanjdaT
J[epuey vlagajd vanjdaT
sniolige, DjpulsivUua DANJdIT
(a3U0ge7) DyD4ponh vyopne
(1odnod) supspayuou viyjopne
(93U0ga]) Sjbpad viuopidoipy
(AqIty) DIDJUasADGNS DAajdOUMUDAH
(UPLIMON) SazoWany DAaJdOWWUDAD
(UBUIMON) ONBIXA DAajdouUDADH
(Aes) siuuadiuvds sajoanvy
(Jepuey) o7oOdUOWM SnulpOAT
(Aes) vajnsava sdojaAouq
(UvIOp| eH) VUDILMAWUD DIIVSLADYD)
(SILIB}H) DIDAOJOIAp DAIAPOAJUAD
‘ponunuos rund]
[BIOL
50661
S0861
SOL6I
s096I
SOS6I
SOr6I
SOC6I
SOZ6I
SOI6I
S0061
s008I
powury
Decline in long-horned wood boring beetle species?
‘ponuyuoy) “| dTaVvL
119
S 4, ae eS Saar 3 SS & AR Mae S| ee. | I ee S L (snioliqe) vauunsg DApUvaN
S 1uLIpueled
a IVULIpUBle
‘© 9 I oe ff Z (Aes) vjyjau syopdoan
E tulyepAdON
iC 7 ee? @ ré € € (Q{U0De7T) SyVIgy DANjdajojsay
= 6 C I I I v (Aes) DpypjouonjI0 DAnjdajojsax
eit 8 Sr 82 «OF 6G] hUPeCUSTUCUBlUSlhUCUCU 9 (ADIAI[Q) snuynjada sn4sav0dAa]
= owe ¢| Sf £ O81 £& 8 ££ 2 ¢ 3U0ge7] snsupds snuav0dA]
I | (ueWopleH) smjojouojz0 snaavo0dA]
9 Lt -¢ c (Aes) siaqnsny snsav0da]
Cl ee I € € l | Aaseg ppnpaijnop snsa20da]
ee 2 ae ee”) Ge ee a 4 (Avg) puixo4d Sp4yjADUOS14]
i SNS a ie; a A oe, Ae: Se | ¢ | (Ase) DUDJOSAUUIUL S1AYJADUOSIA]
mor. $c 6): fc 8] 81.01 OC Fe € FE Ss (UBLUMON) SI/IqDINU DpISAYIDAT
See Vee oe é 3 € I I | (udpMO}]) SUOAfiAadg DAIdsD DPISAYIDA]
Renta I I ¢ 9 C 74 ¢ (419}S810,J) suajiu Duolydods
CC | a a ae | Z (sniolige) siusorlajn] DIpBUv.AS
I | (SnJapaMs) 40/091g DI/DBUDAIS
Cc I | (J91AI[Q) BIDUIWINID DI]DBUB4S
mor wi ph’ BE cf ff dl 8c Gé £ ft 8 i (IBWHAD) DIVIAaiqqn vj dajpsub.AIG
IIS Sa SS 9) SR 9) ee 5 A ee | | Se Se 6 (JOIAI[Q) sisuapouns banidajojoug
97 I I 8 i 9g I rd 9 ([jepuey) 4asijJ1A snso20uayy
= 61 I I C € Te : a 2 | (QUODIT) MUNDYIS snsAODOUAIS
io) ‘ponunuog tuiinydsy
i?)
3 [fof > 2 bse es es 6 6 & #e
s a.
2 ‘ponunuoy “| ATAVL
120
JESO Volume 138, 2007
Decline in long-horned wood boring beetle species?
908 Of€F OSL SL
I
va)
foe)
I
OT OLOL F68
Cl
No)
198
\ oe
SS8 706
bon!
el
—_
C87
617
8r7
ses
bo
IVLOL
(WoYyiouURY) susofidn syApuodsoany
lurpl[Apuodg
avulplApuods
ueuyed sijnood snuolg
(AiniIq) syjooyw) snuog
(19]S1OJ) Wnauunsg DUWOSOYJAC
Pod
(snoeuuly) wnisosdap nuosospA,
IUISI[IOSOIO/
dVUIUOLIg
[BOL
80661
SO86I
SOL6I
80961
SOS6l
SOr6!
SOC6I
SOCc6I
SOT6I
80061
80081
Req
pow]
‘penuyuoy) “| ATEaVL
121
JESO Volume 138, 2007
so1sed
McCorquodale et al.
§ jo Jsqunny
‘sasA[eue SWIOS
JOJ 6861-0861 SB SN661 PUL SOZ6H] Wo ssoY} puke *YZH] WOJoY SP SHTHT PUL SODGI “SOOST FU} Wosy ssOYI YIM PoUTquUIoS o1e ,eIeq
poHWIT, SY] “OURIUG WO seploAquivia,D Jo susutdads GOp‘g | SY} 1OJ (ARdK/UONLIO]J/]) Sp10dd1 JO UOTNQLYsIp jerodway, “| FUNOW
soroedS —@— §p100° eee Bec]
S0661 SO861 SOL61 S0961 SOS6I SOP6I SOE6I SOZ6I SOI6I SOO6I SOO8T POUT
0) m= | | mM ma | 0
007
OV
09 |
08 7
OOl
t t
oor £
=|
S
009 &
rs
:
al + 008 3
4)
Or
0001
091
081 0071
122
JESO Volume 138, 2007
Decline in long-horned wood boring beetle species?
‘0Z6I 01 JOLId poq}d9][09 st yeU} ‘sjaqey] oy}
UO BJLP POUT] YIM SproAquuesso [[e sjUssoidos ATOSIyWwO JSIY OY “OVplOAQuivsdD OLIeJUGC JO} dAINO uonepnumnsoe saisadg *7 FUNOI
IVI
\ 4 a < \ ‘, \ \ <7
gs & os & & e gs oe ge
0 2
=}
o
a)
og ™
°
—,
N
a=)
3
OO! t
CQ
©
a
OSI
o
a
S
ooz
o
OSTZ
123
JESO Volume 138, 2007
McCorquodale et al.
‘(SQOZ JOBuIWIS]U_ puUP I][9}0H) WIGOd Suisn suoTesd}I YY‘ PUL Sp1O991 YOR JO o[duIes-qns kB UO poseq oIv SdIVUITIST “6661—-0S6I1
Joe WOT, S9pedop, INOJ dy} JO S[BAIOUL DOUSIPYUOS % CFG SY} YIM JOOSIOJUI JOU OP YSH] WOJoq WO ,sapeoap, INO} dy} JO sTeAIOVUI
DOUIPYUOS CG OY} JY} SMOYS Ul] [VOIVIOA OY *,SOpedap, IYSIO JO} SplOAQuIeIIS OLIRJUGD JOJ ssouYyo soiseds poyorey “¢€ FTUNOIA
(ID %$6) ssauyrry sapadg payaivy
SLI Sol SSI Sbl SEI STI
66-0861
6L-0L61
69-0961 5
=
or]
6S-0S61
i)
i=}
6r-0r6l
=.
6E-0661 &
67-0261
0761 -O8d
124
Decline in long-horned wood boring beetle species? JESO Volume 138, 2007
Species only in collections from prior to 1950 or 1950 to 1999. Twenty species were
collected prior to 1950, but not between 1950 and 1999 (Table 2). Nine species not collected
before 1950 are first represented in collections by specimens collected between 1950 and
1999 (Table 3).
Most species collected only before 1950 or only between 1950 and 1999 were from
southern Ontario, that is south of the Canadian Shield (Tables 2, 3). Locality information
on labels from 100 years ago is often imprecise. However, most of these species were
collected in extreme southern Ontario, along the Lake Ontario shore, Lake Erie shore, or in
southwestern Ontario. Of the 28 species in these two categories, only two were collected in
central and northern Ontario, with one, Microclytus compressicollis, also collected further
south.
Many of the species only collected prior to 1950 use hardwoods as larval hosts
(Table 2). The relatively few, 3 of the 20, that use conifers are associated with pines.
The nine species collected only between 1950 and 1999 included three that use conifers as
hosts.
Four significant records since 2000. Since 2000, three species have been detected in
Ontario for the first time:
Disteniinae, Disteniini, Distenia undata (Fabricius). Ontario, Essex, 10 km E of Essex,
1 August 2000, R. Marchese, Det. BD Gill 2003, CNC. Ontario, Pelee Island,
Porchuk property malaise trap 17-22 July and 28 August—10 September 2001, S.
A. Marshall and B. Porchuk, DEBU.
Lamiinae, Lamiini, Anoplophora glabripennis (Moltschulsky). First identified in Canada
on the basis of specimens brought to University of Guelph from packing crates
shipped to an industry in Waterloo, Ontario in June of 1998, but not detected
outdoors in Canada until 2003 (in northwest Toronto and Vaughan). The Canadian
Food Inspection Agency (2005) reports on ongoing attempts to eradicate and maps
occurrences up until September 2005.
Lamiinae, Tetraopini, Jetrops praeusta (Linnaeus). ONT: Halton (Reg.), Milton, Woodland
Trails Cape, 6" Line Nassagewaya, meadow, yellow pans, 5-6 June 2001, S. Paiero,
DEBU 00172650 and 00172655. ONT. Wellington Co., Guelph, meadow, 6 June
2002, O. Lonsdale, DEBU00185522.
One species that was not collected between 1950 and 1999 was found after 2000.
Cerambycinae, Anaglyptini, Microclytus compressicollis (Laporte and Gory). ON Cornwall,
14 May 2003, Old-growth forest F[light] I[ntercept] T[rap]-20, 45° 02.160’ N, 74° 47.470”
W, OG2-COR, R. Zeran, LEMQ.
Discussion
Do we know the Ontario cerambycid fauna? The Cerambycidae in Ontario are well known,
in contrast to many insect taxa. Three pieces of evidence support this assertion. About 95%
of the species were collected prior to 1950, the species accumulation curve approaches an
125
JESO Volume 138, 2007
McCorquodale et al.
angad ALaq[nyj OLIeJUO I Z (Aes) Wnjousaj]D DUAYISVIAOT
nddd spoompiey 1oyiO
“TWO ONO = ‘‘Pnqpey ‘AroyorH ‘aydey ABMOSPIY I 6 (uewiopeH) snapusdd snui4cy
spoompiey IoyIO
JNO ‘AIOYOIH “Yoiig ‘oldeyy OLILIJUD UII}seq I I (Aes) sngqisiaponb snydsowosapy
yeO “Ausqiny|
angaada ‘Auaqyoe pH ‘AIOYSI ABMOSPIY I ¢ (JOIAI[Q) WnNyD]nNoDUL WUN1AG—E
‘OD prempy
ANgdd ‘ONO Aulaqyoey ‘AIOYxSTH sould ‘AeMospry Y Z (191AI]Q) SMyDjou snuaydsoualy
ABMOSPTY
nad “AWOU “Splaeq “Ig “UepIOL
‘OWT ‘ONO Allaqyoe ‘AQSUILID ‘MOLIe] 9 II (snioliqeq) smjouosonul snjAjo0aN
spooMpiey JoyIO “NUleM
AGA ‘ONO § ‘USV ‘Auiaqyoey ‘AIOYOIHH «= UOPUOT “souLTBYyye IS Z ra (Aes) vaudpo snjA4jo0an
atsictal sonidg ‘ould ABMOSply I I URUIMON wnjouuajuD UNIp1]]0D
uOJIWeH “Udy
ndad “AWOow ‘BMENQO “YSNOIOGII}94g (A10H pure oy0de7)
WAT) ‘ONO 3 ‘Avg Jopuny | 6 0Z S1JODISSAAAUOD SNJAJIOAII
(jjepuey)
ONO ould puog purin I S snjajosgo snaysna snyodoysp
suotdz[[0D s}SOH suOI}vIO'T Sp1od0y «= - SudWTDadS so1sodsg
(966|) BSouey pur (1661) YeswayD pue As]sur] WY are s}soy pue ejep [aqe] WO, 1B SUOTBIOT “OHEIUQ UT
666] PUL 0S] UPEA\I9q OU ING ISG] 0} JOLId payoa]]Oo aeploAquei9y JO sarsads ()Z 94} JO Spode pue suoumtoads Jo JaqUINN ‘7 ATaVL
126
JESO Volume 138, 2007
Decline in long-horned wood boring beetle species?
nad spoompreH Uopuo’y I 6 (Ainiq) s17jooyny snuoisd
ONO SOSSBID aes eT I I (uUBWop[eH) smppjouojI0 snsaz0dA]
agdad uopuoT ‘Ysno10g19}0g
“AWOU ‘ONO ould — ‘Kemospry ‘adopy u0g 9 AG (Aes) siuqn3sny] snsadodd]
ONO yeo ‘ade JOOUIIS I | (SN.IopaMs) 10]/001g DIIDBUDAS
YIVQoUIN “WeoquIoH dyeT
angdd ‘ONO doy ‘poomuol] Jappy poomusasyH ‘uojZuruesT Z € (JDIAI[Q) DJDUIWUNID DIpsUDAS
angad {SPpoompley OJUOIOT, I I (Aes) Djpy1A1g Dpiwosdyoosg
OND é Aemqulo I I (Avg) syjjoounjnz0 va1aqQ
Spoompley
nad JayIO “ALaqyoeH
YWATD ‘ONO ‘AIOYOIH] ‘POOMUOL] uopuo’7T ‘ydjany Z 6 (Aes) DyDjnsu19 sasap1zuc—
tay
angad ‘yeo “ynuyen ‘A1OyoTH ABMOSPIy ¢ p (199H9q) SnUuls1] S20H
PMEVO
ngad ‘uopuo7T “sinoqod
‘AINOW ‘ONO wy “YeO “AloyoIH ‘uoysurUea'T ‘Aemospry 6 €€ (uewopleH) 4ayajnd saonH
SsuoldI[[0D SJSOH suones0'] Sp10ddy«- SUDTATIDOdS sa1ads
‘penunuo) “¢c WIEVE
7
JESO Volume 138, 2007
(wi1oysouuRe yy’)
WATO ouig ‘sonids JUNOWIYSIVIS I ¢ siusofidn sijApuodsoan
FWOUUATD —s- ooo “your ‘ojdeyy = Avg Aqua, “soulja 2ong € b QUOD] sipiia xojdydoyjuy
Aingpng *]]9qind
‘Avg UOI[IWWIA “Lay
‘LIB “91S WNeVS “ayeT
nad uodsIMIS youl “YI2uID
WAT) ‘ONO ,aonids JQIVMII] “JUNOWYIIVIS 6 €] (uewiopleH) vjnfna sapiosdoapuapy
aAgad ‘ONO adinds JOSPUIA “OpIsoRig ré | (yueIyos) Djpydas0syjAsa DAAGOC
| Wy] ‘POOMsseg
AWOU ‘yeQ “jnUsoYyD ‘AJOYOIH yieg nespuoy Z (ueUIMON) spiuind snydvjaup
JNO MOTTA SOIDIATY XNIG I I (a\U0DeT) SNUOULIOU SNYIAAJOIAX
punos A1OD) pue oyi0de]
Angad ‘ONWO ould udMQ ‘Avg 90uR}SUOD) Z Z SIJJOPIUIBADUL SNA]
‘OD prempy 90ulld (A10y pure oy0de'7)
nddad ‘ONO adein ‘29]9q ‘Id ‘UOIIWIeH ¢ v snoiaspfoqp snydajojayD
ONWO I poylVv I [ gU0DI7T s7joaynapu sapojoulAYyd
suoljd2][09 s}SOH suones0'] ~ gpaov0y = suauseds oo o—— sa1sadg
‘(966|) BSouRA pue (/66]) YeswWoYyD pue Adjsur] WO s1B s}soy pur BBP [Ege] WO d18 SUOT]VIO'T
‘OLIRIUD Ul HHH] PUL KSH] USdMI0q ATUO P9}d9]]09 seploAquiviad jo sa1sads 6 dy} JO Sp1Oda1 pue suowloeds Jo JoquINN “¢ ATAVL
McCorquodale et al.
128
Decline in long-horned wood boring beetle species? JESO Volume 138, 2007
asymptote, and with a similar collecting effort to before 1950, only 9 additional species
were found in the 50 years after 1950. This has been achieved largely through efforts of
general collectors. Four significant contributions by cerambycid specialists are by Brimley
(1941) from Prince Edward County and environs, Gardiner (e.g. 1957; 1975) in the Sault
Ste. Marie area, Hicks from Windsor and Ottawa (e.g. 1947; 1962; 1971), and E. J. Zavitz
from Ridgeway in the Niagara Peninsula in the early 1900s.
Four significant records of Cerambycidae collected since 2000 demonstrate that
the Ontario fauna is not static. Ranges change through both contraction and expansion, and
for many species our understanding of their distributions within Ontario is rudimentary.
The arrival of Anoplophora glabripennis in northwestern Toronto was expected (Allen and
Humble 2002). Its potential to wreak havoc on suburban trees and potentially on native
hardwoods in the Carolinian forest has prompted eradication efforts (Ontario Ministry of
Natural Resources 2006). Another non-indigenous species, Jetrops praeusta, continues to
expand its range in eastern North America. Distenia undata ranges from Ohio south to the
southern Appalachians, and since 2000, it has been found twice in extreme southwestern
Ontario, at Harrow and Pelee Island. In fact it is surprising that more species have not
expanded their ranges north to include extreme southern Ontario. Species with a wide
geographic range, hence more subpopulations, may have a better chance of surviving
significant population declines. Prior to 1950 M. compressicollis was collected from
Thunder Bay to Hamilton and Ottawa, a widespread distribution in Ontario. A specimen
collected in 2003 as part of intensive sampling of saproxylic beetles in hardwood forests of
eastern Ontario (Zeran et al. 2006) demonstrates it persists in Ontario. As with many other
species the specimen raises more questions than it answers. Is it still widespread? What is
the host plant? What are its habitat requirements? Is it endangered in Ontario?
Has the number of species in Ontario declined? Both raw species richness and rarefied
estimates show about a 10% decline in the number of species collected since 1950. A
contributing factor is the 20 species not collected between 1950 and 1999. In addition, 23
species were minimally represented between 1950 and 1999, 20 with only one record and
another three collected in only one decade. Only 9 species were first recorded between
1950 and 1999, a net loss of 11 species. The date 1950 is not of special significance, but
merely a convenient split to produce two samples with similar collecting effort. Using 1940
or 1960 as the break results in similar patterns. The general trend for lower species richness
per decade (Fig. 3) supports this assertion.
The decline in number of species of cerambycids in Ontario may have been driven
by environmental change; for cerambycids the most likely changes are in the abundance and
distribution of host plants and their habitats. Alternatively, the apparent decline may be a
function of collecting biases.
Forest regions: The cerambycids collected only prior to 1950 were concentrated in the
southern part of the province, primarily the Carolinian Forest Region. Most of Ontario is
boreal forest (dominated by coniferous trees) and Great Lakes-St Lawrence mixed forest
(Rowe 1972; Hosie 1990; Armson 2001). Only one species from the boreal forest in northern
Ontario, Microclytus compressicollis, was not collected 1950-1999; it was also collected
further south. In contrast, many species from the Carolinian or deciduous forest region
129
McCorquodale et al. JESO Volume 138, 2007
of extreme southern Ontario were not collected from 1950 to 1999. This forest region
occupies a limited area along the north shore of Lake Ontario, west to Pinery Provincial
Park on Lake Huron and all areas to the south, including the Niagara Peninsula and the
north shore of Lake Erie (Rowe 1972; Larson et al. 1999). Despite the limited geographic
area, at least 16 of the 20 species collected only prior to 1950 are known only from this
area. In contrast only two of the nine species collected only between 1950 and 1999 were
restricted to the Carolinian forest region.
Clearing land for farms, towns and cities, and for timber extraction removed
most of southern Ontario’s original forest cover before 1900 (Armson 2001). Reduction
of forest area is most pronounced in the Carolinian because of intensive agriculture and
the concentrations of urban centres (Austen et al. 1994; Larson et al. 1999; Armson 2001).
Significant forest loss from the small overall area of Carolinian forest in Ontario has
contributed to the reduction in its unique cerambycid fauna and consequently to the Ontario
fauna as a whole.
Host plants: The distribution of each cerambycid species depends on the range of appropriate
host plants. Southern hardwoods, such as hickory and hackberry, are the host plants of half
of the 20 species collected only before 1950. Given the decline of Carolinian forests, it
is not surprising many of these apparently declining species use southern hardwoods as
hosts. Of the 9 species collected only between 1950 and 1999, only Anelaphus pumilus uses
southern hardwoods (hickories) as hosts.
The lack of collections after 1950 of three species that feed on pine was not expected,
because White Pine, Pinus strobus L., is still a reasonably common and widespread tree,
even if there are fewer really old trees now. In addition, Red Pine, P. resinosa Soland and
Jack Pine, P. banksiana Lamb, are now more common in southern Ontario in plantations,
especially on abandoned farms on poor sandy soils.
Are the species not collected between 1950 and 1999 extirpated? Our understanding
of current distributions of cerambycids is based on specimens in insect collections, as
are the compilations of Linsley and Chemsak (e.g. 1985; 1995), McNamara (1991) and
McCorquodale (2002). Unlike the recent atlas of bird distributions in Ontario (Cadman et
al. 1987), we have no broad, recent, focused, geographical surveys of cerambycids. Though
we do have a reasonable inventory, and an apparent decline in the number of species, we do
not have sufficient information to assert that the lack of specimens of a particular species in
post-1950 collections represents a significant population decline or an extirpation.
At first glance the decline in the number of species does not appear to be the
result of a lack of collecting because there are more specimens and records from 1950—
1999 than prior to 1950. It seems unlikely that the ability of collectors has declined since
1950, and certainly our understanding of natural history and host plant use has increased.
General collecting has revealed new records for Ontario, for example Anelaphus pumilus,
Clytoleptus albofasicatus, Anthophylax viridis, and Clytus marginicollis. All were part of
general insect collecting rather than focused collecting for cerambycids.
However, since 1950 there has been limited collecting in southern Ontario by
cerambycid specialists and this may have reduced the number of species collected. The hard
to collect specimens may have been missed because specialized knowledge and collecting
130
Decline in long-horned wood boring beetle species? JESO Volume 138, 2007
techniques were lacking. In southern Québec, where similar changes in forest cover have
occurred, there has been not been a similar decline in species richness in collections of
cerambycids. The main reason is a cadre of keen amateur coleopterists with specialized
knowledge of cerambycid natural history (e.g. Laplante 1989).
The hypothesis that the number of cerambycid species in Ontario has declined since
1950 is eminently testable. Focused collecting of cerambycids in the Carolinian forests of
extreme southern Ontario, specifically the Niagara Peninsula, Long Point, Rondeau, Point
Pelee, and Pinery, could provide the data. If many of the species in Table 2 were to be
collected, the logical conclusion would be that the decline is more apparent than real, wheras
if these species were not found, the contention that the decline is real would be supported.
Data on phenology, distribution, and abundance would be useful. The COSEWIC
species at risk ranking (Committee on the Status of Endangered Wildlife in Canada 2004) for
the 20 species only collected prior to 1950 and the 9 collected only between 1950 and 1999,
would likely be ‘Data Deficient’. The lack of information about population size, population
trends, geographic range in Ontario, and the paucity of records would all contribute to this
designation. .
Challenges: Understanding wood boring beetles has not been a priority for the public,
government agencies, or research institutions in Ontario or Canada. Phenology and
host preferences of only a few species of cerambycids have been studied in Ontario (e.g.
Hicks 1947; 1962; 1971; Gardiner 1954; 1955; 1957; 1975). Therefore specific habitat
requirements and phenology in Ontario are largely unknown. With such a low priority,
the opportunity to develop expertise has been limited. This lack of interest is not limited
to the Cerambycidae, as shown by this quote from a recent book on forest insect pests in
Canada: ‘There is no current research being conducted in Forestry Canada on any of the
wood-boring insects described in this chapter’ (Safranyik and Moeck 1995). Since then,
spurred by the detection of Brown Spruce Long-horned Beetle, Tetropium fuscum, in Nova
Scotia and Asian Long-horned Beetle, Anoplophora glabripennis, in Illinois, New York,
and recently Ontario, there has been a redirection of efforts by Canadian researchers (e.g.
Allison et al. 2001; Peddle et al. 2002). If we are going to understand what changes are
occurring in the Ontario cerambycid fauna, understand the reasons behind the changes and
be prepared to detect novel introductions, it is necessary to consider native and introduced
species, and have the expertise to identify both (Huber and Dang 2003).
Acknowledgments
We thank the curators and entomologists at Canadian National Collection (Yves
Bousquet, Serge Laplante, Jeff Cumming, John Huber, Henri Goulet), Royal Ontario
Museum (Chris Darling, Doug Currie, Brad Hubley), University of Guelph (Steven Paiero,
Matthias Buck, Andrew Applejohn, David Caloren, Jeff Skevington), Canadian Museum of
Nature (Bob Anderson, Henry and Anne Howden), Great Lakes Forestry Centre (Kathryn
Nystrom, Kevin Barber), Lyman Entomological Museum (Terry Wheeler, Stephanie
Boucher), Atlantic Forestry Centre (Georgette Smith, Ken Harrison), Algonquin Park
Visitor Centre (Dan Strickland, Ron Tozer), and Nova Scotia Museum of Natural History
131
McCorquodale et al. JESO Volume 138, 2007
(Andrew Hebda, Christopher Majka) and for access to collections and discussions about
cerambycid collections. Serge Laplante graciously shared his expertise on cerambycid
taxonomy, identification, and biology. Don Sutherland, Richard Knapton, and Bill Crins
provided information on the natural history of southern Ontario. Chris Thomson and
Sheena Townsend read through preliminary drafts and provided helpful comments. Bruce
McCorquodale helped out with the old literature and locating old communities in southern
Ontario. Financial support was provided by NSERC and CBU research grants to DBMcC.
References
Allen, E. A. and L. M. Humble. 2002. Nonindigenous species introductions: A threat to
Canada’s forests and forest economy. Canadian Journal of Plant Pathology 24:
103-110.
Allison, J. D., J. H. Borden, R. L. McIntosh, P. deGroot, and R. Gries. 2001. Kairomonal
response by four Monochamus species (Coleoptera: Cerambycidae) to bark beetle
pheromones. Journal of Chemical Ecology 27: 633-646.
Allison, J. D., J. H. Borden, and S. J. Seybold. 2004. A review of the chemical ecology of
the Cerambycidae (Coleoptera). Chemoecology 14: 123-150.
Armson, K. A. 2001. Ontario forests, a historical perspective. Fitzhenry and Whiteside,
Toronto, ON. 233 pp.
Austen, M. J. W., M. D. Cadman, and R. D. James. 1994. Ontario birds at risk, status
and conservation needs. Federation of Ontario Naturalists and Long Point Bird
Observatory, Don Mills, ON. 165 pp.
Brimley, J. F. 1941. A list of the long-horned beetles (Cerambycidae) of Prince Edward
County, Ontario. University of Toronto Studies, Biological Series. 48: 120—123.
Buck, M. 2004. An annotated checklist of the spheciform wasps of Ontario (Hymenoptera:
Ampulicidae, Sphecidae and Crabronidae). Journal of the Entomological Society
of Ontario 134 [2003]: 19-84.
Buck, M., S. M. Paiero, S. A. Marshall. 2006. New records of native and introduced aculeate
Hymenoptera from Ontario, with keys to eastern Canadian species of Cerceris
(Crabronidae) and eastern Nearctic species of Chelostoma (Megachilidae). Journal
of the Entomological Society of Ontario [2005] 136: 37-52.
Buddle, C. M., J. Beguin, E. Bolduc, A. Mercado, T. E. Sackett, R. D. Selby, H. Varady-
Szabo, and R. M. Zeran. 2005. The importance and use of taxon sampling curves
for comparative biodiversity research with forest arthropod assemblages. The
Canadian Entomologist, 137: 120-127.
Cadman, M. D., P. F. J. Eagles, and F. M. Helleiner. 1987. Atlas of breeding birds of Ontario.
Federation of Ontario Naturalists and Long Point Bird Observatory, Don Mills,
ON. 671 pp.
Canadian Wildlife Service. 2006. Species at risk in Ontario. http://www.on.ec.gc.ca/wildlife/
sar/sar-e.html. Viewed 23 June 2006.
Chemsak, J. A. 1996. Illustrated revision of the Cerambycidae of North America. Volume 1.
Parandrinae, Spondylidinae, Aseminae, Prioninae. Wolfsgarden Books, Burbank,
CA. 1x + 149 pp. + 10 pls.
132
Decline in long-horned wood boring beetle species? JESO Volume 138, 2007
Cheung, D. K. B., S. A. Marshall, and D. W. Webb. Mecoptera of Ontario. 2006. Canadian
Journal ofArthepod Identification. |. http://www.biology.ualberta.ca/bsc/ejournal/
cemw01/cmw_01.html. Viewed 18 March 2007.
Committee on the Status of Endangered Wildlife in Canada. COSEWIC assessment process
overview. http://www.cosewic.gc.ca/ Viewed 18 March 2007.
Danks, H. V. 1979. Canada and its insect fauna: An overview. Memoirs of the Entomological
Society of Canada 108: 567-573.
Fletcher, J. 1907. Entomological Record, 1906. Thirty seventh Annual Report of the
Entomological Society of Ontario, 1907: 86—103.
Gardiner, L. M. 1954. Larval description of Acmaeops proteus (Kby.) (Coleopt., Ceramb.).
The Canadian Entomologist 86: 190-192.
Gardiner, L. M. 1955. Larval description of Acanthosinus pusillus Kby. (Coleoptera,
Cerambycidae). The Canadian Entomologist 87: 219-220.
Gardiner, L. M. 1957. Deterioration of fire-killed pine in Ontario and the causal wood-
boring beetles. The Canadian Entomologist 89: 241-263.
Gardiner, L. M. 1975. Insect attack and value loss in wind-damaged spruce and Jack Pine
stands in northern Ontario. Canadian Journal of Forest Research 5: 387-398.
Gotelli, N. J. and G. L. Entsminger. 2005. EcoSim: Null models software for ecology.
Version 7.72. Acquired Intelligence Inc. & Kesey-Bear. Jericho, Vermont 05465.
Available from http://garyentsminger.com/ecosim.htm (08 August 2005).
Hicks, S. D. 1947. Additional notes on Coleoptera taken in Essex County and southern
Ontario. The Canadian Entomologist 79: 117-119.
Hicks, S. D. 1962. The genus Oberea Mulsant (Coleoptera: Cerambycidae) with notes on the
taxonomy, variation, and host affinities of many of the species. The Coleopterists
Bulletin 16: 5—16.
Hicks, S. D. 1971. Comments on certain Coleoptera from extreme southern Ontario and the
Ottawa district. The Coleopterists Bulletin 25: 103—106.
Hosie, R. C. 1990. Native Trees of Canada, 8" edition. Fitzhenry and Whiteside, Toronto,
ON. 380 pp.
Huber, J. T. and P. T. Dang. 2003. Biosystematics in forestry: invasive pests and native
biodiversity. Page 55 Jn Secretariat on the Convention on Biological Diversity
(eds), Facilitating conservation and sustainable use of biological diversity. CBD
Technical Series No. 9. Montreal, QC. 70 pp.
Jackson, S. M., F. Pinto, J. R. Malcolm, and E. R. Wilson. 2000. A comparison of pre-
European settlement (1857) and current (1981—1995) forest composition in central
Ontario. Canadian Journal of Forest Research 30: 605-612.
Keddy, C. 1997. Forest history in eastern Ontario. Eastern Ontario Model Forest, Kemptville,
ON. 42 pp.
Krebs, C. J. 1999. Ecological Methodology. 2" edition. Addison Wesley Longman, Don
Mills, Ontario.
Laplante, S. 1989. Contribution a |’inventaire des Cerambycidae [Coleoptera] de la province
de Québec. Fabreries 14: 56-83.
Larson, B. M., J. L. Riley, E. A. Snell, and H. G. Godschalk. 1999. Woodland heritage
of Southern Ontario: a study of ecological change, distribution and significance.
Federation of Ontario Naturalists, Don Mills, Ontario. 262 pp.
133
McCorquodale et al. JESO Volume 138, 2007
Linsley, E. G. 1961. The Cerambycidae of North America. Part I. Introduction. University
of California Publications in Entomology 18: [111] + 1-135.
Linsley, E. G. 1962a. The Cerambycidae of North America. Part II. Taxonomy and
classification of the Parandrinae, Prioninae, Spondylinae and Aseminae. University
of California Publications in Entomology 19: v + 1-102 + 1 pl.
Linsley, E. G. 1962b. The Cerambycidae of North America. Part III. Taxonomy and
classification of the subfamily Cerambycinae, tribes Opsimini through Megaderini.
University of California Publications in Entomology 20: xi + 1-188.
Linsley, E. G. 1963. The Cerambycidae of North America. Part IV. Taxonomy and
classification of the subfamily Cerambycinae, tribes Elaphidionini through
Rhinotragini. University of California Publications in Entomology 21: ix + 1-
165.
Linsley, E.G. 1964. The Cerambycidae of North America. Part V. Taxonomy and classification
of the subfamily Cerambycinae, tribes Callichromatini through Ancylocerini.
University of California Publications in Entomology 22: viii + 1-197.
Linsley, E. G and J. A. Chemsak. 1972. The Cerambycidae of North America. Part VI. No 1.
Taxonomy and classification of the subfamily Lepturinae. University of California
Publications in Entomology 69: viii + 1-138 + 2 pls.
Linsley, E. G and J. A. Chemsak. 1976. The Cerambycidae of North America. Part VI. No 2.
Taxonomy and classification of the subfamily Lepturinae. University of California
Publications in Entomology 80: 1x + 1—186.
Linsley, E. G, and J. A. Chemsak. 1985. The Cerambycidae of North America, Part VII.
No 1: Taxonomy and classification of the subfamily Lamiinae, tribes Parmenini
through Acanthoderini. University of California Publications in Entomology 102
[1984]: xi+ 1-258.
Linsley, E. G and J. A. Chemsak. 1995. The Cerambycidae of North America, Part VII. No
2. Taxonomy and classification of the subfamily Lamiinae, tribes Acanthocinini
through Hemilophini. University of California Publications ‘in Entomology 114:
xi + 1-292.
Linsley, E. G and J. A. Chemsak. 1997. The Cerambycidae of North America, Part VIII:
Bibliography, index and host plant index. University of California Publications in
Entomology 117: ix + 1-534.
Marshall, S. A., S. M. Paiero, and O. Lonsdale. 2006. New records of Orthoptera from
Canada and Ontario. Journal of the Entomological Society of Ontario 135 [2004]:
101-107.
McCorquodale, D. B. 2002. New records and notes on previously reported species
of Cerambycidae (Coleoptera) for Ontario and Canada. Proceedings of the
Entomological Society of Ontario 132 [2001]: 3-13.
McNamara, J. 1991. Family Cerambycidae. pp. 277-300 Jn Checklist of beetles of Canada
and Alaska. (ed.), Bousquet, Y. Agriculture Canada, Publication No. 1861/E,
Ottawa, Ontario.
Napp, D. S. 1994. Phylogenetic relationships among the subfamilies of Cerambycidae
(Coleoptera: Chrysomeloidea). Revista Brasileira de Entomologia 38: 265-419.
Ontario Ministry of Natural Resources. 2006. Forest Health Alert 1: Asian long-horned
beetle, Anoplophora _ glabripennis. _ http://ontariosforests.mnr.gov.on.ca/
foresthealthoverview.cfm. Viewed 24 June 2006.
134
Decline in long-horned wood boring beetle species? JESO Volume 138, 2007
Paiero, S. M.,S. A. Marshall, and K. G. A. Hamilton. 2004. New records of Hemiptera from
Canada and Ontario. Journal of the Entomological Society of Ontario 134 [2003]:
115-129.
Paiero, S. M., S. A. Marshall, P. D. Pratt, and M. Buck. In press. The insects of a southern
Ontario tallgrass prairie. Jn Arthropods of Canadian grasslands: Ecology and
interactions in grassland habitats. Biological Survey of Canada (Terrestrial
Arthropods). Wheeler, T. A., H. V. Danks, and & R. E. Roughley (eds).
Peddle, S., P. deGroot, and S. Smith. 2002. Oviposition behaviour and response of
Monochamus scutellatus (Coleoptera: Cerambycidae) to conspecific eggs and
larvae. Agricultural and Forest Entomology 4: 217-222.
Rowe, J. S. 1972. Forest regions of Canada. Canadian Forestry Service Publication 1300,
Ottawa, ON.
Safranyik, L and H. A. Moeck. 1995. Wood Borers. Jn Forest insect pests in Canada.
Armstrong, J.A., and W. G. H. Ives (eds.) Canadian Forest Service, Ottawa. pp
171-177.
Skevington, J., D. Caloren, K. Stead, and K. Zufelt. 2001. Insects of North Lambton.
Lambton Wildlife Incorporated, Sarnia, Ontario. 181 pp.
Suffling, R., M. Evans, and A. Perera. 2003. Presettlement forest in southern Ontario:
Ecosystems measured through a cultural prism. Forestry Chronicle 79: 485-501.
Taylor, R. W. 1983. Descriptive taxonomy: past, present and future. pp 93—134, Jn Australian
Systematic Entomology: a Bicentenary Perspective. Highley, E. and R. W. Taylor
(eds.), CSIRO, Melbourne.
Yanega, D. 1996. Field guide to northeastern longhorned beetles (Coleoptera: Cerambycidae).
Illinois Natural History Survey Manual 6, Champaign, Illinois.
Zeran, R. M., R. S. Anderson, and T.A. Wheeler. 2006. Sap beetles (Coleoptera: Nitidulidae)
in managed and old-growth forests in southeastern Ontario, Canada. The Canadian
Entomologist 138: 123-137.
135
PALA iy Te 2g 2G a lextat whi arnt Mob etRalea
o = _—
~ Wales oe
; enn PA peti baestene: Tui cow ae |
ie: ei et eh Cee mre -
_P Yee
ig ae ai
La
“Kabob aelelgttcoR aeaTh atl nro Sooke
Yo stnogeetchasg cmeerienseo tiny
bon. may eigoquge cr; foabisnestens Di seted manly hay
, Foun ol SB TA cucpisoeienaetaae
DUET nokta pert: gneage leanne piV0 Anoka B
=. Gavi ue4 i
qt AW ETD Sobreh enol aueaing: b Gai ah nh
cms, Pablcommein Eetoraed
nétdes 4+ dee we euch. Loot Hors’. reer se
-~ apt oly eieetaOh slettoke
hve modiuoe iti woh deecoelyy seer gb OE naw
ns ee Qi eae? pian th vow eve ura
cade Awlobblnd 2am uk hos yoy
obit We toes aprceliaareg net wanngald s regoomnonnit
>» 19R" The vrnpenmed ht
(sabroyelranry J Te a dds ial bored gil rt eaamabrnent 02 ayes bls Y nf
aioli nguciset) demi’ woah besntads aieniibte
(satrtulisVcoeewla Vpeatiosd qa2 a00C z0leed WAT bie. noebak Bush vir
eaibane) ofl cabane) Sirint) ershesdaio alana Sartre ie
nicely Shae haeige a
nevCr\yi«’ ff Lh wo +) Scares ie Can
7
UVOWIAD « OT eres, Fi
“©
1! host ahi LA laity Of an fornte Mubligaliie
ay
ee A
fal, 4 A ati gn in cel Orthar wt it
yooreenti | Saiciety a Crwartey $94
*
a.
Ty 'atuliics 4 rT] } ViOWaIyY rope i ee }
for: (arttnrns and Canada. Pipe
af (apiarn ba Tae ion Se r -
‘4 reste ula ix i“), 37 yen) ft ‘hes we ye,
‘ ‘Tieueit, Y. Augrecadece Kcneat
shack ve we Se
Phyfee iho senbane ary
4 ann amok heals Res fie rt,
nike epee mM Mental Rear
Kin, aghokdte om
rite were: ewokb bias
Bees of the genus Hylaeus of Ontario JESO Volume 138, 2007
BEES OF THE GENUS HYLAEUS OF ONTARIO
(HYMENOPTERA: APOIDEA: COLLETIDAE)
TATIANA G. ROMANKOVA
Entomology, Department of Natural History, Royal Ontario Museum, 100 Queen’s Park,
Toronto, Ontario, Canada MSS 2C6
email: [email protected]
Abstract J. ent. Soc. Ont. 138: 137—154
Eight species of Hylaeus Fabricius are reported from Ontario: H. affinis
(Smith), H. annulatus (Linnaeus), H. basalis (Smith), H. bisinuatus Forster,
H. mesillae (Cockerell), H. modestus Say, H. verticalis (Cresson), and
for the first time recorded for Canada, H. nelumbonis (Robertson). Five
additional species, H. fedorica (Cockerell), H. hyalinatus Smith, H. saniculae
(Robertson), H. sparsus (Cresson), and H. rudbeckiae (Cockerell & Casad)
have also been reported in the researched area, but were not found in the
collections examined. The Hylaeus flight period in Ontario starts in May
and continues until the last warm days in autumn. Identification keys for
male and female Hylaeus reported for Ontario are provided, in addition to
information on phenology and locality records.
Published November 2007
Introduction
There has been no comprehensive study of Hylaeus Fabricius (Colletidae) in
Ontario, but separate records of species found in the province are scattered in the literature
(Fye 1965; MacKay and Knerer 1979; Mitchell 1960; Usui 1994). As a result of studying
this group of bees at the largest collections of eastern Canada, knowledge about the
distributional ranges of discussed species has been considerably expanded. The material
examined yielded eight Hy/aeus species from Ontario. At least five more species are likely
present in the province. Three of these have been recorded in the literature from Ontario: H.
saniculae (Robertson) (Mitchell 1960; Snelling 1970; Hurd 1979), H. rudbeckiae (Cockerell
& Casad) (Mitchell 1960), H. hyalinatus Smith (Buck et al. 2005). In addition, H. fedorica
(Cockerell) has been recorded from “Canada” (Metz 1911, as H. grossicornis). Finally, H.
sparsus (Cresson) has been recorded “from southeastern Canada” (Snelling 1968). The first
annotated list of Ontario Hylaeus is presented herein, with distribution maps compiled from
studied specimens, and identification keys to the species for both males and females.
iS7
Romankova JESO Volume 138, 2007
Materials and Methods
All specimens examined are deposited in the entomological collections of the Royal
Ontario Museum (ROME), University of Guelph (DEBU), Canadian National Collection
of Insects (CNCI), University of Manitoba (EDUM), University of California (UCRC), and
North Carolina State University (NCSU). Wooden trap nests were also used by the author to
obtain additional material (Krombein 1967). Species morphological characteristics, flight
periods, and distribution data are based on specimens from these collections. Since I have
not examined any specimens of the additional species recorded for Ontario, the characters
given for them in the keys are taken from published descriptions or rely on examined
specimens from other regions (Ascher 2001; Metz 1911; Mitchell 1960; Osychnyuk 1978).
The distributional data are presented in the form of an annotated list and are illustrated
with maps. The locality records in the annotated lists are arranged from north to south
according to Ontario’s primary administrative divisions, but the terms “county”, “district”,
etc., are omitted. Distribution records from outside Ontario are given according to studied
collections and literature records (Ascher 2001; Buck et al. 2005; Dathe 1994; Hurd 1979;
Metz 1911; Mitchell 1960; Snelling 1966 a,b, 1968, 1970). The morphological terms used
in this paper were defined and illustrated by Michener (1944, 2000). The abbreviations are
as follows: F—flagellar segment, T—metasomal tergum, S—metasomal sternum. An asterisk
designates a species record new for Ontario (and Canada). More than 2500 specimens were
identified using Metz (1911) and Mitchell (1960). All existing determinations in the studied
collections were checked.
Genus Hylaeus Fabricius
Ontario bees of the genus Hy/aeus are distinguished from other members of the
provincial bee fauna by the following combination of characters: small to medium size (4-
9 mm); integument black, shiny, without noticeable pubescence; head, pronotum, tegulae,
and legs usually with yellow markings, which are more extensive in males; scopa absent.
Like other Holarctic Colletidae, Hy/aeus are defined by their short, truncate,
bilobbed glossa, and subantennal suture meeting the antennal socket at its inner side.
The flight period extends from May until the last warm autumn days.
Many Hylaeus species nest in hollow dead stems, others use different pre-existing
cavities (in wood, ground, etc.). Nest cells are made of cellophane-like secretion. Although
females have no scopa, pollen and nectar are carried in the crop. Provisions in cells are
liquid, and the egg floats on the surface of the provisions. Polylectic.
Key to Hylaeus species of Ontario
The brief species descriptions that follow the dashes in the couplets refer only to
the most distinctive characteristics for the particular species. Some frequently encountered
synonyms are given in brackets following the species name in the key. Distributional and
flight period data are included in the male key. Only males generally can be identified with
138
Bees of the genus Hy/aeus of Ontario JESO Volume 138, 2007
confidence; the identification of females is often tentative except for a few species (Metz
1911; Mitchell 1960).
Males. Clypeus always yellow. Antennae with 13 segments. Scape modified or not.
ks Mesepisternum with lamelliform carina between anterior and lateral faces. —S8
spatulate, protrudes conspicuously from genital opening in combination with long
slender gonostyli that extend far beyond apices of penis valves. T1 with white hair
fringes laterally on posterior margin. Malar area as long as basal mandibular width.
Body length 5-6 mm. Ontario: June-August. —Palearctic. New York .................05-
nea re nen es, Pook intaninheon hh Gees le H. hyalinatus Smith
Mesepisternum without lamelliform carina . ane tanh... aod
XM Front coxae angulate or toothed Laitceally: eich nal area nko etna than eye
width. Scape maculated. Paraocular yellow markings abruptly truncate at level
of antennae. Body ae 6 mm. —Quebec, New York, ps to Georgia,
Texas.. eas manancoley miionculnit 2ekal lean Asparsas\(Cresson)
Front coxae ee aS ON Cae EG ox tees EE 2 “a RR LIN ease 3
5 S3 with central eatiling: T1 with white hair fines laterally on posterior margin
NN so os cre old feaa ds. ianeda at hnncytvinde. RARER. Ih aorta, Bef use 4
— 53 eres swellings. T1 with or without hair fringes on posterior margin .......... 5
4. Scape transverse, wider than long, outer half yellow. S2 with swellings. —Labrum
and mandibles black. Supraclypeal area longer than half clypeal length. Antennal
sockets surrounded with elevation. Genal area as wide as eye at its widest part.
Pronotum and tegulae without yellow markings. T1 tessellate, with uniformly
close, shallow, minute punctures. Body length 8-9 mm. Ontario: June-August. —
Transcontinental (alpine in southern part of distribution) ...........H. basalis (Smith)
— Scape longer than wide, curved, yellow antero-laterally. S2 without swellings. —
Labrum and mandibles on inner margins yellow. Supraclypeal area not longer than
half clypeal length. Paraocular yellow marking with inner angle extending beyond
upper margin of antennal socket. Genal area narrower than eye width. Pronotal
collar, pronotal lobes, and tegulae with yellow marks. T1 tessellate, with uniformly
dense, shallow, minute punctures. Body length 4.5-6 mm. Ontario: June—September.
—From British Columbia to Eastern Canada, south to Utah, Louisiana, Mississippi,
eeeees reinw i iil 2. assleccice. H. affinis (Smith) (Prosopis ziziae Robertson)
ne Scape heart-shaped, with outer half yellow. —Paraocular yellow patches apically
truncate, reaching upper edge of antennal sockets at middle. Labrum and mandibles
without yellow markings. Supraclypeal area longer than half clypeal length. Genal
area wider than half width of eye. F1 short, transverse; F2 longer than F1, transverse.
Pronotal lobes with yellow markings, pronotal collar and tegulae without yellow
markings. Mesepisternum with deep, dense punctures less than diameter apart.
T1 without lateral hair fringes, tessellate, with evenly dispersed, minute, shallow
punctures. Body length 5-6 mm. Ontario: May—August. —Holarctic, south to
menial ceticlwaninlie i Hane ss. H.annulatus (Linnaeus) (H. ellipticus Kirby)
* Seanerparuleladedior completely black wait cg Aes Fle. A I a ce eeeeeeees 6
139
Romankova JESO Volume 138, 2007
10.
T1 with lateral white hair fringes on posterior margin. Scape without yellow marking
o Saavia San eitcsisolippile' Duane Soneuee pinch ct caxe lec epite rc e sical 7
Tl idiouk s Biacie on posterior margin. Scape with or without yellow marking
piwdien ed GL. AA a en aes. Saou ee 8
Pa giiblilie seilton markings extending along inner eye margins. Supraclypeal area
shorter than half clypeal length. Frons without impunctate spaces above antennal
sockets. —Scape curved. Mandibles and labrum black to completely yellow. Genal
area wider than half width of eye. Pronotal lobes and usually pronotal collar marked
with yellow. Scutum and mesepisternum with punctures well separated, mostly
diameter or more apart. T1 with dense fine punctures. Body length 4-6 mm. Ontario:
May-—September. —Alaska, transcontinental to California .......... H. modestus Say
Paraocular yellow markings narrow apically, expand from eye margin to upper margin
of antennal sockets. Supraclypeal area longer than half clypeal length. Frons above
antennal sockets with large, shiny, impunctate spaces. —Scape about twice as thick
as flagellum. Mandibles yellow, labrum black. Genal area equal to or narrower than
width of eye. Pronotal lobes and tegulae with yellow markings. Mesepisternum with
punctures more than diameter apart. T1 shiny, with sparse or dense, deep punctures.
Body length 6-7 mm. Ontario: May—September. —Transcontinental ..................
vase uptodate hock aA Se, ee H. verticalis (Cresson)
Seinienlinwel area shorter than half clypeal length. F1 as long as wide. —Scape and
pronotal collar without yellow markings. F1 shorter than F2. Malar area flat, 3 times
as wide as long. Genal area wider than half width of eye (4/5). Paraocular yellow
markings narrowly round apically, terminated above antennal sockets. Pronotal lobes
and tegulae with yellow markings. Scutum subrugose, with deep punctures less than
diameter apart. Scutellum shiny, with well separated punctures. Mesepisternum
hairy, with deep, large, confluent pits. Front tibiae outer and anterior faces, mid
tibiae basal third, hind tibiae basal half, all spurs and tarsi yellow. T1 ferruginous,
disk shiny, with punctures very sparse and obscure. S3 with slight central elevation.
Body length 7 mm. —Ontario, Illinois, Ohio, south to Louisiana, Alabama, Florida ..
Rea ...*H. nelumbonis Gieiblerisias)
Sephieheiedd area vile fie half elias length. F I transverses 1100 (Lee 9
Genal area not longer than half eye width. Mesepisternum with large, deep punctures
irregularly spaced. T1 disk and sterna with deep, distinct and abundant punctures. —
Paraocular yellow marking with upper extension slightly removed from eye margin.
Mandibles and labrum black, or labrum with yellow spot. F1 short, transverse; F2
longer, slightly transverse; F3 elongate. Pronotal lobes, tegulae and often pronotal
collar marked with yellow. Body length 4-6 mm. Ontario: June-August. —Holarctic,
south to California, Georgia .....H. bisinuatus Forster (Prosopis stevensi Crawford)
Genal area wider than half eye width. Mesepisternum with small punctures diameter
or less apart. T1 disk and sterna with sparse, shallow, minute punctures .............10
Mesepisternum shiny, tessellate, with deep punctures a diameter or less apart.
Paraocular areas elevated apically at antennal sockets. Face with depressions above
paraocular areas. —Scape and pronotum without yellow markings. Fl and F2 much
shorter than wide, F3 slightly transverse. Propodeum with long basal area wrinkled.
Body length 3.5-4 mm. —Ontario, Nova Scotia, to Minnesota, Tennessee, Georgia ..
snp on gelesen ls te eda ae cote H. saniculae (Robertson)
140
Bees of the genus Hylaeus of Ontario JESO Volume 138, 2007
ll.
B2:
Mesepisternum shagreened, with shallow punctures. Paraocular area not elevated.
Face without depressions above paraocular areas . on raz. ! ...10
Paraocular yellow marking narrowly tipped, euling it pide ‘ab rift sista —
Propodeal triangle mostly smooth, shagreened, with short, fine wrinkles basally. —
Scape with yellow strip anteriorly. Pronotal lobes without yellow markings. Body
length 4-5 mm. —Michigan, Minnesota, to Texas, North Carolina .....................
egpndnalane H. fedorica (Cockerell) (Prosopis grossicornis Swenk & Cockerell)
paaicular yellow marking narrowed at antennal socket, then clavate, bent towards
upper margin of antennal socket. Propodeal triangle mostly wrinkled .................. 12
Paraocular yellow marking with constriction wider than distance to inner orbit.
Pronotal lobes with yellow markings. —Scape with or without yellow marking. F1
and F2 transverse, F1 little shorter than F2, F3 elongate. Pronotal collar black. Body
length 4-5 mm. Ontario: May—October. —Transcontinental, to northern Mexico
....H. mesillae (Cockerell) (Prosopis cressoni Cockerell; P. telepora Lovell)
Paraocular yellow marking strongly constricted, separated from inner orbits by
much more than its minimum width at constriction. Pronotal lobes black. —Scape
without yellow marking. F1 half as long as F2, or shorter. T1 with distinct, regularly
spaced punctures; central impunctate space distinctive. Body length 4.5 mm. —
Transcontinental ...........cccccccceceeeeeseeeeeeeeeeeeeeeeedH, rudbeckiae (Cockerell & Casad)
Females. Clypeus black, rarely yellow apically. Antennae with 12 segments. Scape not
lb» & a
oS)
modified. Separation of H. modestus and H. affinis, as well as H. mesillae and H.
rudbeckiae is doubtful.
Mesepisternum with lamelliform carina between anterior and lateral faces. —Malar
area not shorter than half basal mandibular width. Mesepisternum with punctures
diameter or more apart. T1 with white hair fringes laterally on posterior margin.
Peeper vernyehti 95-6. Srinath). 028). AGN)... BR IAL, Oe H. hyalinatus Smith
Mesepisternum without lamelliform carina between anterior and lateral faces ........ 2
T1 without hair fringes laterally on posterior Margin ................. ccc ceseeeeeesteeeeeteee 3
T1 with white hair fringes laterally on posterior margin . eK Rc
Supraclypeal area narrowed between antennal sockets, eed spiGhllys and joining
frons at 45° angle. —Clypeus often with apical yellow patch. Genal area wider than
half eye width. Fl and F3 subequal, about as long as wide; F2 shorter, transverse.
Mesepisternum with small, deep punctures, diameter or less apart. T1 disk shiny, with
scattered fine punctures. Body length 5-7 mm. ................... H. annulatus (Linnaeus)
Supraclypeal area not narrowed between antennal sockets, not swollen apically ....4
Pronotal collar with yellow markings. Genal area equal to or narrower than half
width of eye. —F1 elongate, F2 short, transverse, F3 slightly transverse. Pronotal
lobes and tegulae marked with yellow. Mesepisternum with large, deep, irregularly
spaced punctures. T1 disc impunctate medially, anteriorly, and laterally with minute
Pumeranes) Bory Vert 4-6 ois i ci iseesesecneseeseceeseuceiens H. bisinuatus Forster
Pronotal collar usually without yellow markings. Genal area wider than half width
of eye. T1 disk shiny, with sparse, tiny punctures medially, dense laterally ............ 5
141
Romankova JESO Volume 138, 2007
T1 ferruginous. Malar area flat, three times as wide as long. Mesepisternum with large,
well separated to confluent pits. —Genal area as wide as eye width. F2 transverse, F 1
and F3 subequal, as long as wide, little longer than F2. Scutal punctures less than a
diameter apart. Scutellum shiny, with punctures about a diameter apart. Hind tibiae
yellow aoe fore and mid tibiae sometimes with yellow basal spots. Body length
6-7 mm. oad mnithhn ...H. nelumbonis (Robertson)
Tl — ahaha area wikiticgh aiid tiene teases with shallow punctures less
than-diameterapatt .v3 to.. oink waite nena ee ee Ga 6
Pronotal lobes ethane enarens mostly wrinkled. F2 and F3 transverse, shorter
than Fi. Body length 4-Simm tiixtinca dd. Dain ee eee
ise: peewee H. mesillae (Cockerell), H. rudbeckiae (Cockerell & Casad)
Pronotal lobes without yellow markings ........... +S amatge
Propodeal triangle mostly smooth, slendcbetasd Snlth short fine eirisikine basally. —F1
as long as F3, slightly transverse; F2 much shorter, transverse. Body length 4.5 mm
2 dae ../H. fedorica (Cockerell)
Prohedbiah eiidsigtes with imide Metaba area seviiidiitll vill te as ea as F3, or longer; F2
and F3 transverse. Body length 4.5 mm .................. eee H. saniculae (Robertson)
Genal area equal to or wider than width of eye. Pronotal collar usually without
yellow markings. T1 disk centrally punctured or not ................c.cccecceeeeeenseees 9
Genal area narrower than width of eye. Pronotal collar with yellow markings. T1
disk impunctatée centrallyouisiu4,..u eas. well eee ee eee ee 11
Genal area as wide as eye width. —F1 longer than F3, F2 short, transverse.
Integument with yellow markings. Pronotal lobes and tegulae with yellow markings.
Mesepisternum with small, deep punctures, more than diameter apart. T1 shiny, with
punctures scattered on disc ae dense on sides, or punctures almost invisible.
Body length 6-7 mm . 3 Lecce sseseeesessstttsseeeeessssseeed. verticalis (Cresson)
Genal area wider than iit as eye. mite: aie ...10
Integument with yellow markings. Fr ront coxae ~todihieda or -aipelieals on tinflen lies
Mesepisternum shiny, with small punctures a few diameters apart. —F1 as long as
F3, Fl as long as wide, F3 slightly transverse; F2 short, transverse. T1 shiny, with
sparse, obscure, exceedingly minute punctures. pee a 627 mandi vy. J fas. cont
../H. sparsus (Cresson)
ekasuaindios eaugieiihy bilick:! Bi ront coxae not spinose. «Miseuiitdraains with deep
punctures less than or equal to diameter apart. —F1 as long as F3, F2 transverse. T1
shiny, with punctures very fine and shallow. Body length 7-9 mm .....................
RRR. BAA... en es ae H. basalis (Smith)
nudity isteaintth with punctures more than diameter apart. Body length 5-6 mm......
xe. Didi te. Leathe EA ee H. affinis (Smith)
Wesapiotencnnd with punctures equal to or less than diameter apart. Body length 6-7
MIM 6) 39s si 12. Wee Qeee hh: elie cop ee er ale) H. modestus Say
142
Bees of the genus Hy/aeus of Ontario JESO Volume 138, 2007
Annotated list of Ontario Hylaeus
The species are listed in alphabetical order. The abbreviations of the names of the
collectors are as follows: AR—W. Attwater; AT—C. Atwood; BG-N. Bigelow; BK—M. Buck;
BL-S. Beiley; BR—-K. Barber; CL—S. Clark; ED—C. Edwards; GL—T. Galloway; KL-L.
Kelton; KN—G. Knerer; MK—P. MacKay; MN—J. Martin; PA—S. Paiero; PG—D. Pengelly;
RM-T. Romankova; SL-F. Sladen; US—M. Usui.
1. H. affinis (Smith)
Kenora: Oneside Lake, 25 July 1960, 4, CL; Jordan, 13 June—28 July 1914, 34, Ross
(CNCI). Rainy River: Pinewood, 22-28 June.1960, 34, KL; Fort Frances, 15 June 1960,
3, KL(CNCI). Thunder Bay: Fort William, 2 June 1915, 9, SL, det. H. Viereck (CNCI).
Algoma: Black Lake, 29August 1970, ¢, J. MacAlpine (CNCI). Parry Sound: North Bay,
9 June 1963, 3, W. Gague (CNCI). Renfrew: Calabogie, 14 June 1978, 4, M. Gunderman
(ROME); Rackett, 6 August 1953, 9, PG (CNCI). Carleton: Merivale, 7 August 1958,
3, M. Prime (DEBU); Ottawa, 8 June 1970, 2, N. Mills; 22 August 1958, 3, KL; 12-
20 June 1913, gd, 2, SL, det. Swenk (CNCI). Russell: Limoges, 19 July 1978, 9, E.
Fuller, R. Jaagumagi (ROME). Leeds: Chaffeys Locks, 10 July 1963, 9, J. Riotte, I. Smith
(ROME); St. Lawrence Isl., 31 July—14 August 1975, 34 (CNCI). Frontenac: Perth Road,
18 August 1957, ¢, J. Vockeroth (CNCI). Hastings: Marmora, 24 June—23 July 1952,
44, Ross (CNCI); Belleville, 26 June 1949, 4, MN; 15 August 1948, 4, MN; Trenton, 27
August 1905, ¢, Evans (CNCI). Haliburton: Algonquin Park, 14 August 1903, 22, EMW
(ROME). Muskoka: Severn Bridge, 9 July 1965, 2, R. Scott (ROME). Peterborough:
Peterborough, 26 June 1975, 2, F. Quan (ROME); Serpent Mounds P. P., 8 August 1983,
2, 6, GL (EDUM). Durham: Kendal, 19 June 1960, 9, KN, Rubus (ROME). Simcoe:
Simcoe, 19 June 1989, 3, Walley (CNCI). York: Toronto, 4 June 1959, 9, 4, Allium;
14 June 1914, 2; 7 July 1949, 2; 9, W. Brodie (ROME); 30 July 1953, 3, M. Hearst
(DEBU); 7-14 June 1896, 3; 42, 30 July 1893, 3; 21 June 1892, 9; 19 July 1891, g; 14
August 1890, 24; 19 August-2 September 1888, 24 (CNCI); Vivian, 22 June 1961, 29,
KN, Brassica (ROME). Bruce: Sauble Beach, 31 July 1977, 2, W. Maddison; Tobermory,
3-5 August 1977, 23, 52, W. Maddison; 10 July 1960, 9, KN (ROME); Hepworth, 27
June 1979, 24, B. Wit; Dyers Bay, 22 August 1952, 9, PG (DEBU). Dufferin: Primrose,
19, 27 July 1977, 6, AR (DEBU). Peel: Terra Cotta, 25 July 1999, 73,59, RM ; HWY
25 and Burhumthorp Rd., 2001, 34, 49, from nests, TR; Forks of the Credit, 16 June—29
August 1969, 264, 1139, MK; 4 June—12 August 1968, 42¢, 1259, MK; 22-28 June1965,
53, 112, KN (ROME). Wellington: Guelph, 3 July 1973, 3, PG; 13 June 1979, 3, D.
Levis; 26 June 1978, ¢, 2, M. Lichtenberg; 16-23 June 1978, 24, BR; 23 August 1977,
3, BR; 30 May 1962, 3, KN; 7 August 1952, 9, PG; Arkell, 6 June 1978, 23, S. Ball; 8
June 1978, ¢, N. Pierce; 26 May 1977, 24, BR; 11 June 1958, 4, PG; 25 July 1952, 2,
PG (DEBU). Halton: Hilton Falls, 16 July 1999, 2, RM; Speyside, 12 August 1999, 3,
2, RM (ROME); Burlington, 6 June 1984, 3, B. Sinclair; Oakville, 5 July 1978, <, P.
Jursevskis (DEBU). Huron: Goderich, 20 July 1977, 392, W. Maddison (ROME); Kinburn,
26 July 1957, 3, MN (CNCI). Wentworth: Dundas, 25 June 1980, 4, S. Beierl; 19 June
1978, 3, S. Ball; Hamilton, 25 June 1979, 2, K. Runciman; 27 June 1980, 3, S. Beierl
(DEBU). Lincoln: Grimsby, 19 June 1979, 3, M. Bailey; Vineland, 26 June 1956, ¢, C.
143
Romankova JESO Volume 138, 2007
Small (DEBU); Grassie, 31 May 1962, 3, KL(CNCI). Welland: Effingham, | September
1954, ¢ (CNCI). Brant: Ohsweken, 19. June 1979, 3, D. Morris; Brantford, Railway
Prairie, 24 August 2001, 9, PA (DEBU). Haldimand: Long Point, 3 June 1983, 2, T.
Thompson (ROME, DEBU); 18 June 1962, 4, G. Thorpe; Dunnville, 5 August 1954, 2,
C. Miller; Cayuga, 12 July 1925, 3 (CNCI). Middlesex: Komoka, Feed Mill Prairie, 11
July—11 September 2001, 54, 2, PA(DEBU). Elgin: New Glasgow, 27 June 1961, 3¢,
KL(CNCI). Norfolk: Turkey Point, 4 July 1962, 3, G. Thorpe; Normandale, 4 September
1954, 4, R. Lambert (CNCI); Delhi-Simcoe Railway, 7-21 September 2001, 4, PA, prairie
(DEBU). Kent: Rondeau Park, 16-21 June 1977, 3 22, (ROME). Essex: Point Pelee,
25 July 1979, 2; 23 June 1920, 29, BG (ROME); 25 July 1979, 2, AR; 8 September 1954,
3, KL (CNCI); Kingsville, 23 May 1962, ¢, KL (CNCI); 8 July 1977, ¢, BR; Windsor,
Ojibway Prairie, 5 June—21 September 2001, 24, 22, PA (DEBU); Leamington, 4-7 August
1985, 124, GL, 14 July—18 August 1987, 23, GL, (EDUM). Figure 1.
Localities other than Ontario: British Columbia, Manitoba, Saskatchewan, Québec,
Colorado, Wisconsin, Michigan, New York (CNCI, ROME).
45°
e H. affinis
FIGURE 1. Ontario collection localities of Hylaeus affinis.
2. H. annulatus (Linnaeus)
Kenora: Kenora, 13 June 1960, 4, KL; Oneside Lake, 24 June—27 July 1960, 73, CL;
Black Sturgeon Lake, 1963, 303¢ & 2 (CNCI); Vermilion Bay, Cedar Lake, 10 August
1959, 2, E. Cameron (DEBU). Rainy River: Gold Rock, 22 July 1905, 2, H. Newcomb,
144
Bees of the genus Hylaeus of Ontario JESO Volume 138, 2007
det. Stephen (EDUM); Pinewood, 22 June 1960, 43, KL; Finland, 21 July 1960, 3, KL
(CNCI). Thunder Bay: Macdiarmid, 22 June 1921, 2, BG (ROME); Manitouwadge, 12
June 1977, 3, M. Eimann (DEBU). Cochrane: Iroquois Falls, 10 August 1961, 22, KN,
Solidago (ROME); 22 June 1987, 3, J. Vockeroth (CNCI); Porquis, 10 August 1961, 9,
KN; Abitibi, Low Bush, 30 June—19 July 1925, 24,32, BG (ROME). Algoma: Wawa, 7
August 1992, 2, D. Bennett; 13 June 1977, 2, BR; 2 August 1976, 9, P. Heel; Erickson,
7 August 1979, 22, PG; Otasawian Lake, 17 August 1963, 32, KN (DEBU). Sudbury:
Sudbury, 1892, 32 (CNCI); Chapleau, 10 June 1992, 4, US; 5 June 1991, 24, US; 1 July
1990, 2°, US (DEBU). Timiskaming: Haileybury, 7 May 1916, 29, SL(CNCI). Nipissing:
Belwood, 23 June—13 July 1965, 32, ED (DEBU); Temagami, 22 July 1932, 9°, A. Brown
(ROME). Parry Sound: Sand Lake, 30 June 1926, @, F. Ide; Burk’s Falls, 15 July 1926,
3, F. Ide (CNCI); Killbear Park, 20 August 1978, 29, AR (DEBU). Renfrew: Petawawa,
7 June 1961, 4, J. Vockeroth (CNCI). Lanark: Bells Corners, 29 June 1945, 4, O. Peck
(CNCI). Carleton: Ottawa, 17 July 1963, 2, KN (ROME); 2 May-—29 July 1913, 82,
SL (CNCI); 5-16 June 1913, 44, 9, SL (DEBU); 12-20 June 1913, 29, SL (EDUM).
Glengarry: Algonquin Park, 14 August 1903, 2, EMW (ROME). Leeds: St. Lawrence
Isl., 18 July 1975, 4, C. Curran (CNCI). Hastings: Marmora, 11 July 1957, 9; 9 June 1957,
3S, K. Southern (DEBU); 12-24 July 1952, 2, J. Vockeroth; Trenton, 30 June 1905, 9;
22 June 1902, 4, Evans (CNCI). Muskoka: Port Sydney, 24 June—11 July 1919, 29, BG
(ROME). Simcoe: Orillia, 18 June 1924, 4 (CNCI). Bruce: Sauble Falls, 24 July 1977,
3, W. Maddison (ROME); Crane River, 16 July 1977, 2, D. Murrell; Tobermory, 30 May
1998, 4, D. Vaccari; Sauble Beach, 8 July 1981, 2, G. Aiudi; Dyers Bay, 24 July 1954, 9,
PG; 7 July—15 August 1953, 102, PG (DEBU). York: Toronto, 17 July—1 August 1891, 59
(CNCI); 23 June 1990, 2; 7 June 1914, 9, E. Walker; 19-28 July 1891, 29; 3 July 1890,
2 (DEBU); 7 July 1949, 4, (ROME). Dufferin: Primrose, 27 July 1977, 3, AR (DEBU).
Peel: Forks of the Credit, 4 July—18 August 1968, 289, MK; 2 July 1969, 3, MK; 9; Terra
Cotta, 2001, 34, 159, RM, from nests in wood (ROME). Wellington: Arkell, 7 June 1960,
3S, PG; 25 July 1965, 3, PG; Guelph, 3 June 1974, 4, I. Kigatiira; 20 August 1979, 3, J.
Ernst; 11 August 1977, 29, D. Murrell; 17 August 1976, 2, D. Levin; 2 August 1977, 9,
D. Levin; 14 June 1965, 22, 24, ED (DEBU). Halton: Hilton Falls, 16 July 1999, 2,
32, RM; Speyside, 12 August 1999, 3, 9, RM (ROME); Halton, 5 August 1981, @, G.
Aiudi (DEBU); Milton, 9 June 1978, 2’, J. Heraty; Campbellville, 10 June 1977, 22, AR
(DEBU). Huron: Brussels, 22 July 1963, 2, J. VanLoon (DEBU); Kinburn, 26 July 1953,
3, MN (CNCI). Waterloo: Oliver’s Marsh [Oliver Bog], 9 (DEBU). Wentworth: Borer’s
Falls, 1 June 1978, 4, N. Kevin (DEBU); Freelton, 27 July 1984, 3, M. Kasserra (DEBU).
Lincoln: Grimsby, 17 June 1894, 9 (CNCI). Haldimand: Cayuga, 6 August 1952, 2, PG
(DEBU). Essex: Kingsville, 9 July 1977, 9, AT (DEBU); 23 May 1962, 3, KL (CNCI).
Locality unknown: SSH, 19 August 1981, 2, G. Aiudi (DEBU); Ontario, 2 June 1906, °
(DEBU); 7 June 1961, ¢, J. Chillcott (CNCI). Figure 2.
Localities other than Ontario: Alaska, Yukon, North West Territories, British Columbia,
Alberta, Saskatchewan, Manitoba, Québec, New Brunswick, Nova Scotia, Utah (CNCI,
DEBU, ROME).
145
Romankova JESO Volume 138, 2007
50° P< 3
H. annulatus Ln |
90° as°
FIGURE 2. Ontario collection localities of Hylaeus annulatus.
3. H. basalis (Smith)
Kenora: Oneside Lake, 19 July 1960, 2, CL (CNCI); Martin, 20 July 1984, 4, 29,
ROM field party (ROME); 20 June 1984, 4, 29, R. Jaagumagi (DEBU). Thunder Bay:
Nipigon, 25 June 1895, @, J. Fletcher; Black Sturgeon Lake, 30 June 1962, 4¢, 29,
(CNCI). Cochrane: Abitibi Lake, Low Bush, 20 June—17 July 1925, 74, 72, BG (ROME);
Mattagami River, Smoky Falls, 22 June 1936, ¢, G. Walley (CNCI). Algoma: Sault Ste.
Marie, 7 July 1963, 2, D. Stotz (DEBU). Sudbury: Sudbury, 1892, 4; 10 August 1887,
S (CNCI); Chapleau, Racine Lake, 11 June 1992, 492, US; 4 June 1991, 2, US; 5 June-3
August 1990, 34, 112, US, on Early Goldenrod (DEBU). Timiskaming: Haileybury, 7
July 1916, 29, SL(CNCI). Carleton: Ottawa, 5 June—1 July 1913, 3,42, SL.; 1 July 1885,
2; 2 (DEBU); 14 June 1917, 2, SL; 13 June—22 July 1913, 44,42, SL(CNCI). Hastings:
25 July 1902, 2, Evans (CNCI). Haliburton: Dorset, 20 August 1961, 32, KN (ROME).
Muskoka: Macdiarmid, 12-19 June 1921, 6¢, 82, BG (ROME). York: Toronto, 20 July
1893, 2; 19-26 July 1891, 42; 4 June 1883, ¢ (CNCI). Bruce: Dyers Bay, 25 July 1954,
24,32, PG (DEBU). Figure 3.
Localities other than Ontario: Yukon, North West Territories, British Columbia, Alberta,
Saskatchewan, Manitoba, Québec, New Brunswick, Nova Scotia, Wisconsin (CNCI,
DEBU).
4. H. bisinuatus Forster
Algoma: Sault Ste. Marie, 13 July 1963, 2, D. Stoltz (DEBU). Grenville: Prescott, 29 May
1977, 2°, BR (DEBU). Haliburton: Dorset, 16 August 1961, 22, KN, Solidago (DEBU).
146
Bees of the genus Hy/aeus of Ontario JESO Volume 138, 2007
a ON VY OME 150, 2UU7
50°
45°
77 4 oe
H. basalis 7
ey
90° e
> \
FIGURE 3. Ontario collection localities of Hylaeus basalis.
50° wae
A H. verticalis
mw H. bisinuatus
eH. nelumbonis
wid gs°
FIGURE 4. Ontario collection localities of Hylaeus: H. bisinuatus, H. nelumbonis, and H.
verticalis.
147
Romankova JESO Volume 138, 2007
Victoria: Norland, 18 July 1961, 2, PG (DEBU). Durham: Kendal, 12 July 1961, ¢,
KN (ROME). Simcoe: Midland, 9 June 1974, 3, J. Huber (DEBU). Bruce: Dyers Bay,
19 July—17 August 1953, 22, PG; 10-28 July 1952, 22, PG (DEBU). York: Toronto, 11
July 1999, ¢, RM (DEBU). Peel: HWY 25 and Burnhamthorpe Road, 2001, 34, 42, RM,
from nests in wood (ROME). Wellington: Arkell, 24 June 1952, 2°, PG; Guelph, 14 June
1954, 9, R. Crawford; 7 August 1994, ¢, A. Rios; 12 July 1978, ¢, D. Morris; 9 June
1976, 2, C. Miller; 29 June 1965, 3, ED; 9 July 1961, ¢, S. Canetti (DEBU). Haldimand:
Cayuga, 25 August 1952, ¢, PG (CNCI). Lambton: Sarnia, Clear Water Nature Trail, 12
September 2001, 9, PA(DEBU). Kent: Fargo, 3 July 1959, 2, ¢, PG (DEBU). Essex:
Leamington, 18-19 August 1983, 4¢, 22, GL; 7 August 1985, ¢, 2, GL; 17 August 1987,
2,GL(EDUM). Figure 4.
Localities other than Ontario: British Columbia, Alberta, Manitoba, California (CNCI,
DEBU, ROME).
5. H. fedorica (Cockrell)
UNITED STATES, North Carolina: Raleigh, 24 April 1954, 2¢, T. B. Mitchell, on
Pyracantha (NCSU); 25 June 1950, 2, on Daucus carrota (NCSU). Texas: Dallas, 17 March
1907, ¢, R. A. Cushman Coll. [Prosopis grossicornis Swenk & Cockerell] (UCRC).
6. H. hyalinatus Smith
Halton: Oakville, 16 Mile Creek nr Hwy 407, 21 August 2004, ¢, 2, 25 June 2005, 4, M.
Buck (DEBU). Essex: W of Harrow, 28 June 1993, ¢, J. Doherty.
7. H. mesillae (Cockerell)
Kenora: Oneside Lake, 25 June—26 August 1960, 34, CL (CNCI). Rainy River: Rainy
River, 5 June—3 August 1960, 74, CL; Finland, 11-21 June 1960, 2¢,CL(CNCI). Thunder
Bay: Schreiber, 16 August 1962, 29, KN, Solidago (DEBU). Sudbury: Chapleau, Racine
Lake, 6 July 1990, ¢, US, raspberry (DEBU). Renfrew: Petawawa; 7 June 1961, 2, J.
Vockeroth (CNCI). Carleton: Ottawa, 31 May 1914, 2, SL; 5 May 1913, 9, SL; 24 June
1913, 29, SL(DEBU); 4 June—8 October 1913, 54, 62, SL; 15 August 1912, 9; 2 September
1888, 2; 4 June—7 July 1970, 22, N. Mills; 26 July 1955, 4, P. Taschereau; Constance Bay,
30 June 1959, 24, CL; Mer Bleue, 23 June 1952, 34, Chevell (CNCI). Leeds: Morton,
2 August 1961, 2°, KN, Apocynum (DEBU); St. Lawrence N. P., 20 August 1975, 30,
Sigler (CNCI). Hastings: Marmora, 26 May 1952, ¢, R. Lambert (CNCI). Haliburton:
Dorset, 16 August 1961, ¢, KN (ROME). Muskoka: Barrie, 16 July 1961, 29, KN, Rhus
(ROME). Peterborough: 5 July 1977, 2, 2, GL; Serpent Mounds P. P., 8 August 1983, 2,
GL(EDUM). Victoria: Coboconk, 14 August 1961, 2, KN, Rhus; Norland, 18 July 1961,
©, KN, Solidago (DEBU). Northumberland: Brighton, 13 July 1956, ¢ (CNCI). Simcoe:
Barrie, 16 July 1961, 2, KN (ROME). York: Toronto, 31 May 1914, 4; 30 June 1913, 9,
SL; 17 June 1896, 4; 16-30 July 1893, 29; 19 June—2 September 1891, 44, 49; 13 July
1890, 2; 9 September 1888, 4 (CNCI); 1 July 1999, 3, RM (ROME); 2 August 1991, 3; 20
June 1892, 24: 14 June 1891, 4; Keswick, 18 June 1976, ¢ (DEBU). Bruce: Dyers Bay,
14 August 1952, 24, 2, PG; 7 July 1953, 22, PG (DEBU); Kincardine, 28 May 1962, 3¢,
KL (CNCI). Peel: Forks of the Credit, 14 June—3 September 1968, 1969, 18¢, 442, MK,
Melilotus, Rhus, Prunus (ROME). Wellington: Guelph, 4 August 1979, 3, D. Murrell; 20
148
Bees of the genus Hylaeus of Ontario JESO Volume 138, 2007
July 1974, 2, J. Huber; 12 July 1965, 2, ED; 9 July 1961, 3, S. Caultti; 26 June 1956, 32,
PG; Arkell, 28 July 1952, 4, PG; 23 June 1959, 9, PG (DEBU). Halton: Georgetown, 30
August 1893, ¢ (CNCI). Huron: Kinburn, 26 July 1957, ¢, MN (CNCI). Wentworth:
Spencer Creek, 7 September 2003, 2, RM (ROME). Lincoln: Vineland, 7 June 1928, 22
(CNCI); Jordan, 24 August 1961, <4, G. Brumpton (DEBU). Waterloo: Oliver’s Marsh
[Oliver Bog], 21 August 1987, 22, D. Blades (DEBU). Welland: Wainfleet Bog, 14
September 1987, 2, Stirleeng (DEBU). Brant: Ohsweken, 19 June 1979, 3, D. Morris
(DEBU). Haldimand-Norfolk: Cayuga, 26 June 1911, ¢, PG; Delhi-Simcoe Railway, 27
July 2001, 2, PA (DEBU). Kent: Rondeau P. P., 16 June 1977, 9, field party (ROME).
Essex: Kingsville, 17 July 1955, 24, KL; Point Pelee, 4 June 1951, 3; 21 June 1927, 2, F.
Ide (CNCI); Harrow, 6 September 1959, 2, PG;.22 August 1972, 2, J. Huber; River Canard,
10 July 1977, 2, AR; Ojibway, 17 June 1980, ¢, D. Krailo (DEBU); Leamington, 18 August
1983, 2, GL; 4-7 August 1985, 59, 13 ¢, GL; 18 August 1987, 5¢, GL(EDUM). Locality
unknown: Crinif Bog, 8 May 1987, 2<, D. Blades; Figure 5.
Localities other than Ontario: North West Territories, British Columbia, Alberta,
Saskatchewan, Manitoba, Québec, Wisconsin (CNCI, DEBU).
50° ——
4
la
H. mesillae }
90°
ie
oP 80°
FIGURE 5. Ontario collection localities of Hylaeus mesillae.
8. H. modestus Say
Kenora: Oneside Lake, 9 July 1960, ¢ (CNCI); Martin, 20 August 1888, 2; 20 June 1984,
2 (ROME). Rainy River: Minahico, 27 July 1962, 6, KL (CNCI). Thunder Bay: Healy
149
Romankova JESO Volume 138, 2007
Falls, 7 July 1987, 22, GL (EDUM). Algoma: Wawa, 7 August 1992, 9, D. Bennett;
Algoma, 7 August 1977, 2, Crins (DEBU). Nipissing: Opeongo Lake, 25 July 1981, 9,
Brown; Keswil, 5 June 1975, 3, T. Sawingal (DEBU). Parry Sound: Killbear Park, 30
June 1979, 3, AR; 17-20 August 1978, 29, AR; Powassan, 12 July 1978, 29, S. Ball;
11 July 1978, 3, J. Cappleman (DEBU); Port Elwin, 8 June 1955, ¢ (CNCI). Renfrew:
Hills, 14 July 1978, 9, M. Lichtenberg (DEBU). Carleton: Merivale, 30 July 1958, 9, M.
Prime; Ottawa, 8 September 1913, 2, SL; 12 June 1914, 9, SL (DEBU); 22 July 1913,
SL (EDUM); 22 July 1955 , 4, P. Taschereau; 164, 299; Constance Bay (CNCI); 4 mi E
Carp, 10 July 1950, 32, W. P. Stephen, Lonicera (EDUM). Glengarry: Alexandria, 13
July 1978, 3, E. Fuller (ROME). Grenville: Prescott, 29 May—30 July 1977, 24, 2, BR
(DEBU). Leeds: Morton, 2 August 1961, ¢, KN, Apocynum (ROME). Hastings: Madoc,
23 July 1947, 3; Marmora, 5 June 1952, 4, CL; Trenton, 17 August 2000, 2¢; Belleville,
15 June 1962, 4, KL; Bancroft, 18 June 1962, 4, KL (CNCI). Haliburton: Haliburton,
11 September 1957, 2, P. Muller; Dorset, 20 July—16 August 1961, 32, KN, Solidago,
Trifolium, Melilotus; (DEBU). Muskoka: Port Sydney, 13 July—1 August 1919, 29, BG
(ROME). Peterborough: Lakefield, August 1983, 9, GL(EDUM). Victoria: Norland, 18
July 1961, 22, KN (ROME). Northumberland: Crowe Bridge, 18 July 1979, 2, AR; 17
July 1979, 2, BL; 18 July 1977, 2, BL; Healey Falls, 18 July 1979, 2, B. Wit (DEBU).
Simcoe: Orillia, 25 July 1924, 4, H. Viereck, (CNCI); Midland, 26 June 1970, °, J. Huber
(DEBU). York: Oakwood, 18 July 1961, 29, KN, Melilotus; Toronto, 1 July—18 August
1999, 23, 39, RM, Vicia; 27 June 1965, 22, KN (ROME); 164, 2592 (CNCI); Leaside, 4
August 1961, 22, G. Brumpton (DEBU); 9, KN, Trifolium; Hope, 15 June 1929, 3, M.
Dennis (ROME). Bruce: Tobermory, 6 August 1977, 29, D. Maddison; Bruce Peninsula,
10 July 1960, 22, KN, Rhus (ROME); 8 June 2000, 2, C. Onodera; Sauble Beach, 9 July
1981, 82, G. Aiudi, Kircher (DEBU); Hepworth. Grey: Owen Sound, 4 July 1979, 3, B.
Wit; 21 August 1976, 2, P. Heels (DEBU). Peel: Forks of the Credit, 2 July—21 August
1969, 3, 2332, MK; 14 June—23 July 1968, 354, 42, MK, Melilotus; 28 June 1965, 34,
112, KN (ROME); 26 June 1973, 4, PG (DEBU); Terra Cotta, 25 July 1999, 6¢, 72, RM
(ROME). Wellington: Ariss, 27 May 1962, 4, KL; Niagara Falls, 8 June 1962, 4, KL
(CNCI); Belwood, 5-30 July 1972, 3, 2, PG; 5-16 July 1973, 3,59, PG; 19 June 1982, 20,
PG; Arkell, 14 June 1973, 3, PG; 26 May 1977, 3, BR (DEBU); Guelph, 31 May 1962, 4,
2°, Cornus, Helianthus (ROME); 18 August 1964, 2, B. Wyatt; 16 June—September 1994,
32, Brewen; 8 June 1991, 2, M. Castillo; 22 July 1979, 29, J. Corrigan; 30 August 1978,
©, Kreuzer; 5 July 1977, 292, AR; 23 July—23 August 1977, 23, BR; 12 July 1974, 2, J.
Huber; 27 June 1974, ¢, Kigatiira; 22 July 1974, 392, Eden; 19 August 1973, 3, Smith; 4
July 1956, 2°, PG; Rockwood, 12 June 1981, 3, Kircher (DEBU). Halton: Speyside, 12
September 1999, 4°, 492, PM; Hilton Falls, 16 July 1999, 22, RM (ROME); Oakville, 31
July 1976, 2, AR; Milton, 9 June—6 July 1978, 32, Heraty; 27 June 1979, 3, J. Huber;
Halton, 6 July 1978, 4, 2, J. Cappleman; Campbellville, 10 June 1977, 6, BR (DEBU).
Huron: Maitland, 20 July 1977, 52 (ROME). Perth: Listowel, 27 May 1965, ¢, KL
(CNCI). Waterloo: Hespeler, 18 June 1962, 6, KL (CNCI). Wentworth: Ancaster, 24
June 1955, 4, O. Peck (CNCI); Stoney Creek, 12 July 1980, 2, R. Thomson; Dundas,
11 June 1980, 54, C. Bolter; Spencer Gorge, 18 August 1993, 2; Hamilton, 3 July 1979,
3S, S. Beierl; 27 June 1980, 4, S. Beierl (DEBU). Lincoln: Jordan, 3; Vineland, 7 June
1979, 3, BL; 14 June 1977, 22, BR; Grimsby, 19 June 1979, 9, BL; 21 June 1978, 3,
150
Bees of the genus Hy/aeus of Ontario JESO Volume 138, 2007
M. Lichtenberg; 19 June 1978, 2, BL; 14 June 1977, 2, AT (DEBU). Welland: Thorold,
1 July 1984, 32, Gilberg (DEBU). Brant: Brantford, 24 August 2001, ¢ PA (DEBU).
Haldimand: Dunnville, 3 August 1962, 4, KL; Peacock Point, 3 September 1954, <4, C.
Miller; Dunn Twp, 9 August 1990, 2 (CNCI). Middlesex: Komoka, Feed Mill Prairie, 27
July—13 August 2001, ¢, PA(DEBU). Elgin: St. Thomas, 19 July 1955, 4 (CNCI); Orwell,
14 June 1978, 4, M. Lichtenberg (DEBU). Norfolk: St. Williams, 27 May—3 June 2000,
73, BK; 7 September 2001, 2, BK; Delhi-Simcoe Railway, 27 July 2001, ¢, PA (DEBU).
Kent: Rondeau Park, 21 June 1977, 2¢, 22, D. Maddison (ROME); 10 July 1960, 2,
CL; Chatham, 23 August 1913, ¢, SL; Bothwell, 4 July 1962, ¢, CL (CNCI). Essex:
Point Pelee, 31 July 1960, 2¢, 2, KN; 30 June 1920, 6, BG (ROME); 1 June 1982, 3, C.
Hare; 13 June 1979, 4, D. Morris; Windsor, Ojibway Prairie, 5 June—3 July 2001, 32, PA
(DEBU); Kingsville, 23 May 1962, ¢, KL (CNCI); 8 July 1977, 9, Innes; 8 June—8 July
1977, 23, 42, BR; 8 July 1977, 52, AR (DEBU); Leamington, 19 August 1983, 114, 112,
GL; 4-7 August 1985, 104, 102, GL; Weatley, 15 August 1982, 3, 2, GL; 19 August 1987,
22,GL(EDUM). Ontario: Port Perry, 1 August 1934, 9°, F. Urguhart (ROME). Locality
unknown: Lake Superior, 29 June 1961, 2, KN, Rubus (ROME). Figure 6.
Localities other than Ontario: Alaska, North West Territories, British Colombia,
Saskatchewan, Manitoba, Québec, New Brunswick, Nova Scotia (CNCI, DEBU, ROME).
50° —-
a
4
H. modestus
90"
ih 80°
\
FIGURE 6. Ontario collection localities of Hylaeus modestus.
9. *H. nelumbonis Robertson
Norfolk: Long Point, 199?, 72, ¢ (Dr. L. Packer’s Collection). Figure 4.
Localities other than Ontario: UNITED STATES, Ohio: Put-in-Bay, S. Bass Isl., 11 July
151
Romankova JESO Volume 138, 2007
1920, 2, ¢, C. H. Kennedy Coll. (UCRC); North Carolina: Wenona, 27 May 1925, 9, T.
B. Mitchell (NCSU). Louisiana: opp Orange, Sabine R. Ferry, 20 June 1917, ¢ (NCSU);
New Orleans, 13 March 1955, 2, ¢, R. R. Dreisbach [Homotype: Prosopis nelumbonis
Robertson].
10. H. rudbeckiae (Cockerell & Casad)
UNITED STATES, California: Riverside, 2 September 1935, 2, Timberlake Coll.
(UCRC)
11. H. saniculae (Robertson)
UNITED STATES, Tennessee: Gatlinburg, Sm. Mt. N. P., 25 June 1947, 4, T. B. Mitchell
[Homotype: Prosopis saniculae Robertson] (NCSU). Michigan: Mecosta Co., 25 July 1951,
2, R. R. Dreisbach (NCSU); Alcona Co., 27 July 1946, 2, R. R. Dreisbach (NCSU).
12. H. sparsus (Cresson)
UNITED STATES, North Carolina: Mt. Pisgah, 23 June 1934, 22, T. B. Mitchell
(Homotype: Prosopis thaspii Robertson; Homotype: Prosopis sparsa Cresson] (NCSU).
13. H. verticalis (Cresson)
Kenora: Black Sturgeon Lake, 4-8 July 1962, ¢ and 81°; Oneside Lake, 2 June 1960, 2,
CL(CNCI). Sudbury: Chapleau, Racine Lake, @, US (DEBU). Carleton: Ottawa, 3 June
1986, 2, H. Goulet; 11-20 June 1913, 94, SL (CNCI); 18-20 June 1913, ¢, 2, SL; 7 June
1914, 9, SL(EDUM). Hastings: Trenton, 31 May 1896, @, Evans (DEBU). Haliburton:
Minden, 11 September 1957, 2, McMullen; Algonquin Park, 22 August 1993, 2, C. Jons
(DEBU). Northumberland: Hastings, 1895, ¢, Evans; Alderville, First Nations Prairie,
1 September 2001, 2, PA(DEBU). Prince Edward: Picton, Smith Bay [Smith’s Bay], |
July 1970, 2, J. MacAlpine (CNCI). Bruce: Dyers Bay, 19 July—19 August 1953, 52, PG
(DEBU); Bruce Peninsula, 10 July 1960, 2 (ROME). Peel: Caledon East, 28 June 1980, 2,
C. Beierl (DEBU). Wellington: Bellwood, 13 July 1965, 2, ED: Arkell, 2 June 1952, 2,
PG; Guelph, 10 August 1951, 2, PG (DEBU). Halton: Halton Lake, 2001, RM (ROME),
from nests in wood, 3¢. Lincoln: Jordan, 21 June 1919, 3, C. Cunra (CNCI). Essex:
Leamington, 4 August 1985, 2, GL (EDUM); Windsor, Ojibway Prairie, 31 July—3 August
2001, ¢, PA(DEBU). Locality unknown: Ontario, 26 June 1886, ¢ (DEBU). Figure 6.
Localities other than Ontario: British Columbia, Alberta, Saskatchewan, Manitoba,
Québec, New Foundland (CNCI).
Acknowledgments
I am thankful to D. Currie, C. Darling, and B. Hubley (Royal Ontario Museum),
S. Marshall and M. Buck (University of Guelph), J. Huber (Canadian National Collection),
and L. Packer (York University), who made the collections under their care available to me
and who were very supportive during my work on this paper. My thanks are also extended
to R. Roughley (University of Manitoba), D. Yanega (University of California, Riverside),
and R. Blinn (North Carolina State University) for providing specimens from collections
152
Bees of the genus Hy/aeus of Ontario JESO Volume 138, 2007
at their respective institutions. Special gratitude goes to J. Huber, H. Frania, M. Buck,
and anonymous peer reviewers for their thorough reading of the manuscript and valuable
comments, and to L. Packer and J. Grixti (York University) who kindly agreed to test the
keys and also provided important comments. I am very thankful to M. Buck for allowing
me use his yet unpublished locality information on H. hyalinatus. I am thankful to the
members of the Board of Directors for providing me with assistance for this publication.
My deep appreciatation goes to my husband, Alexander, for his enthusiasm in exploring
Ontario bees.
References
Ascher, J. S. 2001. Hylaeus hyalinatus Smith, a European bee new to North America,
with notes on other adventive bees (Hymenoptera: Apoidea). Proceedings of the
Entomological Society of Washington 103(1): 184—190.
Buck, M., S. Paiero, and S. Marshall. 2005. New records of native and introduced Aculeate
Hymenoptera from Ontario, with keys to Eastern Canadian species of Cerceris
(Crabronidae) and eastern Nearctic species of Chelostoma (Megachilidae). Journal
of the Entomological Society of Ontario 136: 37-52.
Dathe, H. H. 1994. Studien zur Systematik und Taxonomie der Gattung Hylaeus F. (Apidae,
Colletidae). 1. Hylaeus annulatus (L.) eine holarktische, Hylaeus aborigensis sp.
n. eine neue sibirische Art. Beitrage zur Entomologie 44: 441-445.
Fye, R. E. 1965. Biology of Apoidea taken in trap nests in Northwestern Ontario
(Hymenoptera). Canadian Entomologist (97): 863-877.
Hurd, P. D. 1979. Superfamily Apoidea, pp. 1741—2209 Jn Catalog of Hymenoptera in
America North of Mexico. Vol. 2. K. V. Krombein, P. D. Hurd, Jr., D. R. Smith,
and B. D. Burks (eds.), Washington: Smithsonian Institution Press.
Krombein, K. V. 1967. Trap-nesting wasps and bees: Life histories, nests and associates.
Washington: Smithsonian Press. 570 pp.
MacKay, P. A., Knerer, G. 1979. Seasonal occurrence and abundance in a community of
wild bees from an old field habitat in Southern Ontario. Canadian Entomologist
111(3): 367-376.
Metz, C. W. 1911. A revision of the genus Prosopis in North America. Transactions of the
American Entomological Society 37: 85—156.
Michener, C. D. 1944. Comparative external morphology, phylogeny, and a classification
of the bees (Hymenoptera). Bulletin of the American Museum of Natural History
82: 151-326.
Michener, C. D. 2000. The Bees of the World. Baltimore & London: Johns Hopkins
University Press. 913 pp.
Mitchell, T. B. 1960. Bees of the eastern United States, 1. North Carolina Agricultural
Experiment Station Technical Bulletin No.141: 1-538.
Osychnyuk, A. Z., D. V. Panfilov, and A. A. Ponomareva. 1978. Apoidea, pp. 279-519 Jn
Species of Insects of the European Region of the USSR. Vol. 3, Hymenoptera. V. I.
Tobias (ed.), Leningrad: Zoological Institute, Academy of Sciences of the USSR.
[In Russian].
153
Romankova JESO Volume 138, 2007
Romankova, T. 2003. Bees of the genus Colletes of Ontario (Hymenoptera, Apoidea,
Colletidae). Journal of the Entomological Society of Ontario 134: 91-106.
Snelling, R. R. 1966a. Studies on North American bees of the genus Hy/aeus, |. Distribution
of the western species of the subgenus Prosopis with description of new forms.
Contribution in Science, Los Angeles County Museum of Natural History No. 98:
1-18.
Snelling, R. R. 1966b. Studies on North American bees of the genus Hylaeus, 2. Description
of anew subgenus and species. Proceeding of the Biological Society of Washington
79: 139-144.
Snelling, R. R.1968. Studies on North American bees of the genus Hy/aeus, 4. The subgenera
Cephalylaeus, Metziella and Hylaeana (Hymenoptera: Colletidae). Contribution
in Science, Los Angeles County Museum of Natural History 144: 1-6.
Snelling R. R. 1970. Studies on North American bees of the genus Hy/aeus, 5. The subgenera
Hylaeus s. str. and Paraprosopis. Contribution in Science, Los Angeles County
Museum of Natural History 180: 1—59.
Usui, M. 1994. The pollination and fruit production of plants in the boreal forest of Northern
Ontario with special reference to blueberries and native bees. M. Sc. Thesis,
University of Guelph, Guelph, ON. 278 pp.
154
EEE a
hn
Snc cd
Sal
Jom Mw
7. ~. Av"). skies Of-° . vi eth’ Lanesboro ae
t: 2. pee: pha ene =~
af a rare subz ves wit) | pei Prensa a ey jen Betty 0
7. Pat +e at :
: @, } Oa). S0odies Of ~emthy American hook MOR age ed at
riudviange, Mectlle 1a Artaine, Otyienontent Cola:
% as : 3 ‘ . on eres ae x as ‘ a
base a isd fe ae CA Si a Nhe ee
ms
ay
ie ae
oe
"i ye
im Seirzent, Loo Adgeles Cratly Rignaeagieesa egy 71-7 = —
Nylons > ef. Mi Pane. Consign bi Lag comieg Las A
Stina uf Natoral History 1 Ale be S?, 7 i. fy, 20 hee
1 the pullnation sad tad ginoducticnt if, prhaiats
Once with specail refatoce ty, tiluclgeriie:
Untversiny of Gueiph, Ouetph ON; 238 pp. ae
*
Ce -?
*
2006 ANNUAL MEETING
The 143" Annual Meeting of the Entomological Society of Ontario took place from October 27" to the 29",
2006 with the theme “The Many Facets of Entomology”. As is becoming usual, there was an impressive number
of students at the conference, as well as professional entomologists from around the province. Plenary talks at
the meeting were delivered by Sander Koenraadt (Cornell University), Roger Quinn (Case Western Reserve
University), and Elizabeth Tibbetts (University of Michigan). Additional highlights included several awards
and expressions of appreciation. Dr. Glenn Wiggins became a new Fellow of the ESO. Richly deserved service
awards were presented to several individuals whose work has contributed to ‘the many facets of entomology”
in Ontario: Yves Prévost (former Editor of JESO), David Pree (formerly a JESO Associate Editor), and
Dana Gagnier (former Editor of the ESO newsletter). Last but not least, President’s Prize Awards awards for
outstanding student presentations were made to Amy Sharp (Brock University) and Hien Ngo (York University).
The conference was supported by generous contributions from the University of Guelph, Wings of Paradise
Butterfly Conservatory, Firefly Books, BASF, Bayer CropScience, Engage Agro, Syngenta Seeds, NK Seeds
(Syngenta), Pioneer DuPont, MGS Horticultural Inc., and Laresco. Further details of the 2006 Annual Meeting
can be found in the Autumn 2006 issue of the ESO Newsletter, available on the ESO website.
ENTOMOLOGICAL SOCIETY OF ONTARIO
The Society founded in 1863, is the second oldest Entomological Society in North America and among the
nine oldest, existing entomological societies in the world. It serves as an association of persons interested in
entomology and is dedicated to the furtherance of the science by holding meetings and publication of the Journal
of the Entomological Society of Ontario. The Journal publishes fully refereed scientific papers, and has a
world-wide circulation. The Society headquarters are at the University of Guelph. The Society’s library is
housed in the McLaughlin Library of the University and is available to all members.
An annual fee of $30 provides membership in the Society, and the right to publish in the Journal and receive
the Newsletter and the Journal. Students, amateurs and retired entomologists can join free of charge but do not
receive the Journal.
A World Wide Web home page for the Society is available at the following URL:
http://www.entsocont.com
FELLOWS OF THE ENTOMOLOCIAL SOCIETY OF ONTARIO
W. W. Bill Judd 2002
C. Ron Harris 2003
Edward C. Becker 2003
Glenn Wiggins 2006
APPLICATION FOR MEMBERSHIP
Name:
Address:
Postal Code:
Please send cheque or money order to:
D. Hunt, Secretary, Entomological Society of Ontario
c/o Agriculture and Agri-Food Canada G.P.C.R.C.
2585 County Road 20, Harrow, ON, NOR 1G0
NOTICE TO CONTRIBUTORS
Please refer to the Society web site (http://www.entsocont.com/pub.htm) for current instructions to authors,
which were last printed in Volume 131 (2000), pages 145-147 and can be updated at any time. Copies of those
ve \ instructions are available from the Editor.
..
CONTENTS + ey ae
I. FROM THE EDITOR. Sis ae vieweonsentsatectatiaiatstipiimete neni
If. FROM THE SPECIAL EDITOR... anette a
Ii. SUBMITTED MANUSCRIPTS
J.T. HUBER and E. BAQUERO. — — Review of Bist a rarely oe nus of
Mymaridae (Hymenoptera).| .................:--idsrntsesbedckactssusetaren tee oie
Pe el
I a
J. M. HERATY and D. C. DARLING. — A new genus and species of Perilampi¢ dae
(Hymenoptera: Chalcidoidea) with uncertain placement in the family. ............
B. WHITTOME, R. I. GRAHAM, and D. B. LEVIN. — Preliminary examination of
gut bacteria from Neodiprion abietis (Hymenoptera: Diprionidae) larvae. .......4 9-63
O. LONSDALE and S. A. MARSHALL. — Revision of the North Ame
Sobarocephala (Diptera: Clusiidae, Sobarocephalinae). ................. eile 65-106
D. B. MCCORQUODALE, J. M. BROWN, and S. A. MARSHALL. — A decli ne in
the number of long-horned wood boring beetle er Cerambycidae) species
in Ontario during the 20th century? ........4:::<c..«e-cstesveestssssuusenes eee .... 107-135
vi
T. G. ROMANKOVA — Bees of the genus Hylaeus of Ontario (Hymenoptera:
Apoidea: Colletidae). ...............-s:sss.cscesestesésbssdessentetessrshedseoneataaena 137-154
g
IV. ENTOMOLOGICAL SOCIETY OF ONTARIO inside back cover
V. APPLICATION FOR MEMBERSHIP ~ inside back cover
s
VI. NOTICE TO CONTRIBUTORS inside back cover
ai
‘TOA
= (& pide baad « Meee
hile Pie, Co a8 =) Sawn f oy S=ie-
4, «kt -€e ote Gabe
Prcesiqelgl Park, Leeterte eee
‘a Be
“i
.
~ ar w pt apy Boe i dd
& my a, B,
eS Le see byteen
~ a-¢ 2
a OAc ee
.
.
*
é So ae “
io | @
re ee
4 ~
¢ ¢ »
uy 2% WPLY
|
HO AO
3 2044 118 666 171
a ee ee
ae ed
Lee a er ce Pr
tree
re)
Char erin
any meee
Pent whimy
Nie gien RANS Kia aads vasa e
amisypd papers a
oC Lnys Orne
FH MRR: A, en, 8 sn Geothoae,
AN SEMIND ID EE ENA SOL einai ay Siva, Bin Coe iy
Wms ar dient apa imapetepuenza ve
eV MALE teeynsy be
SV VEN vente ee
wots
ee ees
AON ahaa Naat
1A we aig Oe
TNO deed apne
Om ea mea are
7844 Sane
er nang
VPS e mye cate
Corer
ee)
Pysce syns ae
PORUATS Oe ae
eo Caen
Pore rye
,
Fe emee an we
wae
en ees
ny
cere
APSE K A Ae
Sy Re ete hh eke
CNM
AR ene habe
Sun yene
VE We
avin
Sonne eat
Seat Penytes
SURO Pm te SO Peete
a Cras Senet ny
wy
" Tanne aye
BON BOR eR RG ey A
10 Aenean my Oy =
Am 6p tyme,
Bt dhe be ay
On WO era
ayaa,
VP ree menpe
ae
Meter ©
my ND ay
rape
Poe)
WA ee ener a Larrige,
ae ags Ne nis, AYA TN Ane,
Sa toy ty Puen evra
a WOME Wop Manes) \pssaney aaa v pry PMU ee wees
Up Wrists b AD osan by Mckee : PAESERDAYANE Magy ae
SY Urnsivvamycaraess w
yous IW UAE UND Uaur grup atQd Spay ane et tarey APACS
evens PHPPASUS INS eres HWE NUEON od oe Sorcery
PAU MOUP SIH LE- AN CEL ED tte etme tine
Pere ;
se tyeyts tas AUTO ARLE G4 OD EP ELuEee UNe eT
rere voyeasar ia
ae CLR set ea
Hoe ntyasegang. >
ty Em
PMOL UN Wer ee eipe tne
Me ER REM INGAT SCA HF
Sgt
Ree APE A,
Weis
PCa Ee ee
NEN Petey
2 RRA RAR, STE Re moka ney may
youn vpne Cr ee
my Weare MWe yee Ny VER PL Meee map tae
Pe RULE nies {BoM NOES ONES antag
SPAM Weng 8G whan wanes 2A MORE TEAL ray Seg
' MMER Re a LY OP Le
PAA NAL ES I LP sea ie REAR Le One uey PP gae te PE AY Mee Pan ie OM AD SANE ct) MA iH NG ex BUD ADA Penn
een “eycrit jane Ta ee ea TARP MON PL CO LEAST ELAN eae Weaeuey HD OWN Ne eat tes rsd ae PAPAL WOM ENS ty pi tie dak Se at
Ua RAKED \ npc Henao ie a OR te et Wie cre one oa date PMR NBN So Wy 8 Be MAU tone Sy oe
eat acc a ee ROE Ts Ui oe oh Cal a Be VANES VERN UN I Ys ee Gane EN op ’ Le ges AR AES Sot dea speed A
ree g i! © vik whe ape ete tk ELIA UT Os ayes i Amy ae mlts ge : a Sb 1H Kye Mt By eth on
Aas Wwe ey man red MP ew yy wove ree Seb bey He Mant A EM
‘ Re beh Syrah i toaee whe Wy Stier SRE pA Py Lehner ete rd ee ae PY SST
» ; dw VEO tage AAEM UAWE OT bea [6 te be Ee Rea Wha eM ee bait +e Maen, th s Soy Ev A MME MC tee dep nyt a
SWE WS pte vege aur ee Cl eee Whe avn oye w , hk Wh : ‘
aot Satan ci aytat yr tena pein’ Be rita Na antane s mARiae cs bah eta bee mh Sreere wa ie usin fet aa rey
ba RT ergy SIRES Ur UE ee a ye usual ve ba ye ne es Mae y WYTN ORDA L RP LE as Ut ho tae A A MANE AIT Gs A AN Ay Uh GUY Yee AY AY Sacer ae ta ay tls te ry AY
ati, ae Hi ne bs " Na WRIA er ae Lye ge MPa aes augy EW NA) Aare Peay eg
, Pye ot ytenns ge aay Fue Aap eet VP Whig, bel MVE Py Ver hgeney, W phew igs wren SUe NEAR MS NT ag ay eg
ue wee Ye aa TVR ASE ane yay Une Wy be ge yt vibe Oe Lars vee EN ON he fe
ter seyren Actes eae e DESPA UE MEME NF Rw POP han peat PR Ae GU CPS tae
at rWideinwea tate: 4 S7 EMT vay aU URAL Wiel weary vey PW Ee CE ae yy he ens Wer halg, We tov nee
TNT GS ry BAPE MSG ME Wate Bae ange An beds qe ye WEEDS VEG RUE ELLE ne dy gee WG eee WAP Mee
wey SP VE EPA BS NP AN We YE LE a Watt WA WEDS ye ge eg coer m oy eny
HU TYE VE ye WME WE eae yey VOSA at veya :
Pyeng e ye PAY OW ROUT WF WN yt \
WP PE er Ws ye WUT WY We yE ie ye i"
ee ee PY
Pe RS MEU we AS Wi a a
SESTUE VES ORNS VR Qe 8 ge gee WPS LL Ep ae ae
8 Yr phy
Cea eee ee SE MEMS FYE Ls ye ye Be yn
eS RPE UME be vr ue Mtge RE ye WUUs Heung a
RAT MPEP UT UN Qe ire
‘y
SEAL IEE PE Bip Oy tye
Nd
PME ELE
HLT yt teat oe
Vy
WE oe AWAD Mt ve
Tey
4
ae
4 t
VEER) RU UY ROL Ry
oP RY DAN AY
ye NS
‘W
AWE ae ot PAE YY Ae ov EM PEA Sy tay
Kk ee eer i Rte EE eT) MGR irs mR Rd
err a SELES We ye SEM FE od Ay OL ts Me ONPG Mca ey ty AEE yey
CM Tap asa RR PaO TR RELY ECE pi! Se eRe ibd t Lid
Wet ws Cee Sar Dot ? act eo TS ay sang eC Nr eis eu she
aie 4 , are Me ves AD Wm bON Sg AY ORCL MY A MRC rey Xe
Wr Verte vw LEvAVEN (tye mir te eww ‘ : Wine tt dp anag ey ite yan ae cos a Me Hy hw
Nr hot meh LA he ld Ils a spd SOV E aie ye PEs pens engi Fie 3 raat Wye heir ity eu Warts e NEW Whales SILK” ae
WY WEE per he wey ere vnyeey SLUT MEME EAE SP NAS Usain erie Uae eat is whee y Perel Ferd IP phy ys brew UH UAT NS ta A eM RY Ape wil tas RU ENLAM Mul ah
Yrcyt gs cian aww eye amie yee ey wea ryt ys cM LF yrued ge poe eat ines ma ab rari ae : bes eA ‘ wey
eI 4 Beye oS 3E SE toe eure be amr WM tes Whe ye AVERY yee ae me he gs yes MEME WO Uae ie i eer it
see Fike rece rer urneeea ge See Vee AERO Me a a Oe HH OME 0.85 ah 4 cant Nongee uray nyt ay YN Pep Foy RU Rt RO
VER Ura Rla ge ge NIME Nay Letru Lae aoa ae eae uretrah Wyeast A ae Fa MEAL AN UtLaD Rdte cirkn) Yo TAN MW thar real ay i
le Whee ape ao veut . Lis 7M EUS? ay is Dy At ¥ f i 7 al fthae ale 3 : OU NE METH ME San oy ty
MAM oe be et Bhatt MON Y TW WERE Yc NSP UE WE et we ye VEC gD y Ae WL s t “4 i ay * ‘ fetta bt 1a vn) it 7 an
SO rut ate ney OA YOR yt we we VN YE WE (NP Yt ye wy "y weyers : rule a) wre M Pa nate ae wy $ ste eetiinek
EWM yrye WHERE BP aC We Nee yt ye ye, We et et ge eat ye UT at ae Pyke " : fabless Wily
Pao WE WER ae yee PM yt tery FW Le OW Wha VEN ys WO ae We ge ;
BP eRe ye ys ws wet ve eve fete 6 ye re TM RRVEME AU LT UOT UP UE tat Wtiseantdt ged wee ea one ret
RAMA Od eos ant ee Te tees ATE MT ATURE Leuk tig wens BOP ye atta ge ie WAS aways
Be mete ew MME D LE NOL Urey tun idl ASS TT) WPvel ene WSN DP yr aes ee
Were Ww Baye Megs Be AVE “" Towle weed ten.
AY WwW itwee Me ty