VOLUME 115
ani
ae
Phialophora nielamuensis sp. nov.
(Wu & Zhang— Fic. 2, p. 253)
ISSN (PRINT) 0093-4666 DOT: 10.5248/115 ISSN (ONLINE) 2154-8889
MYXNAE 115: 1-539 (2011)
Il ... MYCOTAXON 115
EDITORIAL ADVISORY BOARD
SEPPO HUHTINEN (2006-2012), Chair
Turku, Finland
HENNING KNUDSEN (2008-2013)
Copenhagen, Denmark
WEN-YING ZHUANG (2003-2014)
Beijing, China
Scott A. REDHEAD (2010-2015)
Ottawa, Ontario, Canada
SABINE HUHNDORE (2011-2016)
Chicago, Illinois, U.S.A.
PETER BUCHANAN (2011-2017)
Auckland, New Zealand
Published by
MYCOTAXON, LTD, P. O. BOX 264
Ithaca, NY 14581-0264, USA
WW W.MYCOTAXON.COM
© Mycotaxon, Ltd, 2011
MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
VOLUME 115
JANUARY-MARCH, 2011
EDITOR-IN-CHIEF
LORELEI L. NORVELL
Pacific Northwest Mycology Service
6720 NW Skyline Boulevard
Portland, Oregon 97229-1309 USA
NOMENCLATURE EDITOR
SHAUN R. PENNYCOOK
Manaaki Whenua Landcare Research
Auckland, New Zealand
Book REVIEW EDITOR
ELSE C. VELLINGA
861 Keeler Avenue
Berkeley CA 94708 U.S.A.
CONSISTING OF 1-x11 + 539 PAGES INCLUDING FIGURES
ISSN 0093-4666 (PRINT) © 2011. Mycotaxon, Ltd. ISSN 2154-8889 (ONLINE)
DOT: 10.5248/115.CVR
IV ... MYCOTAXON 115
MYCOTAXON
VOLUME ONE HUNDRED FIFTEEN — TABLE OF CONTENTS
COVER SECTION
RESEARCH ARTICLES
A new species of Ophiocordyceps (Clavicipitales, Ascomycota) from
southwestern China Ji-Yue Chen, Yong-Qiang Cao,
Da-Rong Yang & Ming-Hua Li
Rediscovery of Microporellus iguazuensis in southern Brazil
Mateus A. Reck, Mauro C. Westphalen & Rosa Mara B. da Silveira
A new species of Hyphodiscus (Helotiales) on Stereum
Kadri Partel & Kadri Példmaa
Chaetomium siamense sp. nov., a soil isolate from Thailand, produces
a new chaetoviridin, G Chaninun Pornsuriya,
Kasem Soytong, Supattar Poeaim, Primmala Khumkomkhet,
Fu-Cheng Lin, Hong Kai Wang & Kevin David Hyde
New taxa and new reports of Phyllospora (lichenized Ascomycotina)
from India Gaurav K. Mishra,
Dalip K. Upreti, Sanjeeva Nayaka & Biju Haridas
New records of lichenicolous and lichenized fungi: 7. More notes on
taxa from North America James C. Lendemer & Kerry Knudsen
Phyllactinia sebastianiae sp. nov. on Sebastiania brasiliensis
Maria Graciela Cabrera & Gernot Vobis
Two new species of Lyophyllum s.l. (Basidiomycota, Agaricomycetes)
from La Palma (Canary Islands, Spain)
Rose Marie Dahncke, Marco Contu & Alfredo Vizzini
Two new alectoronic acid-containing Parmotrema species from
the coast of SAo Paulo State, southeastern Brazil
Marcelo P. Marcelli, Michel N. Benatti & John A. Elix
New or noteworthy records of Caloplaca (Teloschistaceae) from Poland
Karina Wilk
Aspicilia subfarinosa, the correct name for A. substerilis
Ayhan Senkardesler & Mohammad Sohrabi
Building the jigsaw puzzle of the critically threatened Pleurotus nebrodensis:
historical collection sites and emended description
Maria Letizia Gargano, Alessandro Saitta,
Georgios I. Zervakis & Giuseppe Venturella ....
Diplotomma, Lecanora, and Xanthoria lichen species new to Turkey
Yalcin Karagéz, Ali Aslan, Kenan Yazic1 & André Aptroot
JANUARY-MARCH 2011... V
First report of Conidiobolus coronatus in Turkey
Cafer Eken, Saban Giiclit & Kibar Ak..... 121
Carbonea, Gregorella, Porpidia, Protormnicarea, Rinodina, Solenopsora,
and Thelenella lichen species new to Turkey
Kadir Kinalioglu & André Aptroot..... 125
Type studies of the Russula species described by W.A. Murrill 1.
R. roseiisabellina, R. sericella, and R. obscuriformis
Bart Buyck & Slavomir Adamé¢ik..... 131
New species and new records of Crepidotus from the northwest
region of Sao Paulo State, Brazil Marina Capelari..... 145
Pilidiella crousii sp. nov. from the northern Western Ghats, India
Kunhiraman C. Rajeshkumar, Rahul P. Hepat,
Subhash B. Gaikwad & Sanjay K. Singh..... 155
Calocera bambusicola sp. nov. and C. sinensis newly recorded.
from Taiwan Sheng-Hua Wu, Kelly Shih & Shih-Yi Yu..... 163
Stachybotrys subreniformis, new from soil in China
Qi-Rui Li & Yu-Lan Jiang. .... 171
New species of Koorchaloma and Ciliochorella from xeric forests
in Argentina Natalia Allegrucci, Lorena Eliades,
Marta Cabello & Angélica Arambarri..... 175
A new taxonomic classification for species in Gomphus sensu lato
Admir J. Giachini & Michael A. Castellano..... 183
New records of Uredinales from Fairy Meadows, Pakistan
N.S. Afshan, A.N. Khalid, A.R. Niazi & S.H. Iqbal..... 203
Observations on Melanoleuca. Type studies—3
Roberto Fontenla & Roberto Para..... 215
Coprinopsis neophlyctidospora sp. nov., a new ammonia fungus
from boreal forests in Canada Jay K. Raut, Akira Suzuki,
Toshimitsu Fukiharu, Kiminori Shimizu,
Susumu Kawamoto & Chihiro Tanaka. .... 227
Stachybotrys thaxteri sp. nov. and the nomenclatural status of
three Stachybotrys species De-Wei Li..... 239
Two new species of Phialophora from soil
Yue-Ming Wu & Tian-Yu Zhang. .... 251
Phlebiopsis mussooriensis (Agaricomycetes), a new corticioid species
from India Priyanka, G.S. Dhingra & Navneet Kaur. .... 255
Pseudocolus fusiformis, an uncommon stinkhorn new to
Turkish mycobiota Igaz Akata & Hasan Huseyin Dogan..... 259
New lichen records from Turkey — 2: Aspicilia, Protoparmeliopsis,
and Ramalina Ayhan Senkardesler & Orcgun Fuat Calba. .... 263
Tropical Trametes lactinea is widely distributed in the eastern USA
Josef Vlasak & Ji#i Kout..... 271
A new species of Nephroma (Nephromataceae) from the Tibetan
Plateau Qiong Tian, Li-Song Wang,
Hai-Ying Wang & Zun-Tian Zhao. .... 281
v1... MYCOTAXON 115
Studies in Erysiphales anamorphs (4): Species on Hydrangeaceae
and Papaveraceae Anke Schmidt & Markus Scholler
Paecilomyces wawuensis, a new species isolated from soil in China
Jin He, Jichuan Kang, Bangxing Lei & Tingchi Wen
Mycosphaerella nyssicola revisited: a species distinct from M. punctiformis
Andrew M. Minnis, Amy Y. Rossman & Richard T. Olsen
Acaulospora soloidea, a new arbuscular mycorrhizal fungus from
rhizosphere soils of Murraya paniculata
J.D. Vaingankar & B.F. Rodrigues
Conidial fungi from semi-arid Caatinga biome of Brazil.
New species and records for Thozetella Flavia Rodrigues Barbosa,
Silvana Santos da Silva, Patricia Oliveira Fiuza
& Luis Fernando Pascholati Gusmao
Chrysothrix flavovirens, Lepraria elobata, and Ochrolechia arborea
new to Portugal Sandrina Azevedo Rodrigues, Tor Tonsberg,
Arsenio Terrén-Alfonso & Amadeu M.V.M. Soares
Lichenological notes 2: Lichenothelia convexa, a poorly known
rock-inhabiting fungus Jana Kocourkova & Kerry Knudsen
Mortierellomycotina subphyl. nov., based on multi-gene genealogies
K. Hoffmann, K. Voigt & P.M. Kirk
‘Three species excluded from Melanopsamma (Ascomycetes)
You-Zhi Wang
Tubakia seoraksanensis, a new species from Korea
Hye Young Yun & Amy Y. Rossman
Two new species of Hymenochaete (Hymenochaetales) from China
Shuang-Hui He & Hai-Jiao Li
Rare or little known corticioid basidiomycetes from southern
Belarus Eugene Yurchenko & Heikki Kotiranta
Conidial morphology changes in four Phyllosticta species Jing Jin
Notes on some Japanese smut fungi. 5. Anthracoidea blepharicarpae
and A. dispalatae, spp. nov. Cvetomir M. Denchev,
Teodor T. Denchev, Muneo Michikawa & Makoto Kakishima
Notes on two species of Boletellus (Boletaceae, Boletales) from China
Nian-Kai Zeng & Zhu L. Yang
Aspergillus flavus — primary causative agent of aflatoxins
in dried figs H. Imge Oktay, Dilek Heperkan,
Emrah Yelboga & Nevin Gul Karaguler
A new species and a new record of Pyxine (Physciaceae) with
norstictic acid from Sao Paulo State, Brazil
Patricia Jungbluth, Marcelo Pinto Marcelli & Klaus Kalb
Marine fungi from Sarushima Island, Japan, with a phylogenetic
evaluation of the genus Naufragella Mohamed A. Abdel-Wahab
Paraconiothyrium babiogorense sp. nov., a new endophyte from
fir club moss Huperzia selago (Huperziaceae) Julia Budziszewska,
Wojciech Szyputa, Mateusz Wilk & Marta Wrzosek
JANUARY-MARCH 2011... VII
Additional species of Graphis from Maharashtra, India
Gayatri Chitale, Urmila Makhija & Bharati Sharma. .... 469
Septobasidium sichuanense (Septobasidiaceae) from China
Suzhen Chen & Lin Guo..... 481
Hypogymnia irregularis (Ascomycota: Parmeliaceae)—
a new species from Asia Bruce McCune..... 485
Marasmius galbinus, a new species from China
Chun-Ying Deng & Tai-Hui Li..... 495
A new Puccinia on Thymelaea from Turkey
Sevda Kirbag, M. Catherine Aime & Murat Kursat..... 501
Pucciniastrum enkianthi nom. nov., a replacement name for
PB. hakkodaense Ying-Mei Liang & Makoto Kakishima. .... 505
Morphological studies in Dothideomycetes: Elsinoe (Elsinoaceae),
Butleria, and three excluded genera
Yanmei Li, Haixia Wu, Hang Chen & Kevin D. Hyde. .... 507
BOOK REVIEWS AND NOTICES Else C. Vellinga (EDITOR)..... 521
MycoBIOTAS ONLINE
Abstracts of newly posted annotated regional species lists = 8 8 ~— ..... 534
NOMENCLATURE
Nomenclatural novelties proposedin volume 115 0 537
PUBLICATION DATE FOR VOLUME ONE HUNDRED FOURTEEN
MycorTaxon for OCTOBER-DECEMBER, VOLUME 114 (I-v1 + 1-522)
was issued on February 11, 2011
vill ... MYCOTAXON 115
REVIEWERS — VOLUME ONE HUNDRED FIFTEEN
‘The Editors express their appreciation to the following individuals who have,
prior to acceptance for publication, reviewed one or more of the papers
prepared for this volume.
M. Catherine Aime
Vladimir Antonin
Andre Aptroot
Angélica Margarita
Arambarri
Ulf Arup
Zeliha Bahcecioglu
D. Joseph Bagyaraj
Victor M. Bandala
Gerald L. Benny
Svetoslav Ganchev Bobev
Uwe Braun
Peter Buchanan
Palmira Carvalho
Rafael E Castafieda Ruiz
Wolfgang Damon
Yu-Cheng Dai
Cvetomir M. Denchev
Enrique Descals
Dennis E. Desjardin
Arve Elvebakk
Theodore L. Esslinger
Fernando Esteve-Raventdés
Lidia Itati Ferraro
André Fraiture
Alan Fryday
Ricardo Galan Marquez
Ester Gaya
Paolo Giordani
Mireia Giralt
Shouyu Guo
Ying-Lan Guo
Luis Fernando Pascholati
Gusmao
M. Gokhan Halici
Nils Hallenberg
Roy E Halling
Maria Havrylenko
Shuang-Hui He
Hsiao-Man Ho
Charles S. Hodges
Sybren de Hoog
Seppo Huhtinen
Elsad Huseyin
Kuulo Kalamees
Mitko Karadalev
Abdullah Kaya
Bryce Kendrick
Alexander Khodosovtsev
Paul M. Kirk
Fatma Nese Kok
Irmgard Krisai-Greilhuber
James C. Lendemer
De-Wei Li
Tai-Hui Li
Jun-Feng Liang
Laszlé Lékés
Robert Liicking
C. Manoharachary
Eric H.C. McKenzie
Luis C. Mejia
David W. Minter
Bertrand de Montmollin
Pierre- Arthur Moreau
Gabriel Moreno
Keiichi Motohashi
Akira Nakagiri
Karen Nakasone
Lorelei L. Norvell
Walter Obermayer
Alan Orange
Katarina Pastir¢éékova
Omar Paino Perdomo
Shaun R. Pennycook
Marcin Piatek
Mario Rajchenberg
Victor J. Rico
Peter Roberts
Andrea Irene Romero
Amy Y. Rossman
Malgorzata
Ruszkiewicz-Michalska
Vildes Maria Scussel
B.M. Sharma
John W. Sheard
Carol A. Shearer
Roger Graham Shivas
G.P. Sinha
Harrie J.M. Sipman
Matthew E. Smith
Leo Spier
Kazuaki Tanaka
Einar Timdal
Chaiwat To-anun
Matthew J. Trappe
Celal Tuncer
Kalman Vanky
Gerard J.M. Verkley
Orvo Vitikainen
Yun Wang
Stéphane Welti
Daniel Winkler
Yusuf Yanar
Zhu Liang Yang
Wen-Ying Zhuang
Mikhail Zhurbenko
JANUARY-MARCH 2011... IX
FROM THE EDITOR-IN-CHIEF
WELCOME TO MycoTaxON ONLINE! When we wrote, “Print is dead. Long live the
pixel!” a few months ago, we somehow hoped that with the end of press and postal
delays our first volume would just leap onto the website all by itself. Alas — the quantity
of editorial work remains the same, and a late MycoTaxon 114 led to an equally late
Mycotaxon 115, while we adjusted our workflow for on-line publication and revised
author instructions for what we all hope is the very last time. Although the first online
volume is late, our taxonomic insights are now accompanied by free living color. Enjoy!
COVER SECTION — We have combined the former editorial ‘front matter’ (masthead
information, table of contents, publication dates) and ‘back matter’ (reviewer list,
editorial letter, errata, submission protocols) into one free access PDF, opening now
with an original drawing chosen from among current papers and ending with our belief
that good taxonomy is vital to everyone. (Special thanks to Noni Korf Vidal for the
refurbished logo!). The author index has disappeared—no longer needed in the Google
era. The 101 new names proposed or typified in our first online edition stand in a
separate handy, free-access PDF at the end of the volume.
“WEBLISTS” ARE REGIONAL MYCOBIOTAS — When we first set up the MycoTaxon
regional annotated species list webpage, we called the posted PDFs ‘weblists’ to convey
the idea that these papers were available for free download from the Internet. However,
that term does not fully describe what these works encompass — nomenclature,
geography, ecology, substrata, and (often) brief descriptions or illustrations. Only when
revising how to submit such works for posting on our non-journal website, did I realize
that these treatments are, in fact, ‘mycobiotas’ (a term used instead of ‘mycoflora to
emphasize that fungi are Nor plants).
Obviously, Mycotaxon still publishes mycobiotas presenting original and complete
taxonomic research in its online journal. For that reason, we will continue to refer to the
less comprehensive distributional compilations as ‘weblists’ Pages 534-536 announce
six additions to our website and cites authors, titles, and abstracts for species reported
from Central America (Nicaragua, Panama), South America (Brazil), Europe (Greece,
Italy), and the Mid-East (Turkey).
OPEN ACCESs — Our cover section, book reviews, weblist abstracts, and nomenclatural
pages are freely available to anyone on the Internet, and we encourage authors to offer
their papers for immediate release by paying a $20/page open access fee. MycOTAXON
115 offers open access articles by Cabrera & Vobis (53-63), Raut & al. (227-238), D.-W.
Li (239-250), Schmidt & Schlosser (287-301), J. He & al. (303-310), S.A. Rodrigues & al.
(335-344), Y.-Z. Wang (365-368), S.-H. He & H.-J. Li (375-382), Oktay & al. (425-433),
and McCune (485-494). Special thanks are due them for showing that MycoTAxon is
well on its way to becoming a fully open access journal.
Warm regards,
LORELEI NORVELL,
Mycotaxon Editor-in-Chief
28 April 2011
xX... MYCOTAXON 115
ERRATA FROM PREVIOUS VOLUMES
VOLUME 114
p. iv, line 31 for: Gregario Delgado 231 read: Gregorio Delgado 231
p 342,page number for: no page number read: 342
p. 375, header for: Minimelanolocus chimonanthi read: Minimelanolocus chimonanthi
p- 377, line 2 for: 377-393 read: 377-392
A481, abstract, line 6 for: lividina read: fascicularia
p. 483, line 14 for: lividina Hjortstam read: fascicularia (Rick) Burds. & Nakasone
p- 517, line 31 for: 377-393 read: 377-392
JANUARY-MARCH 2011... XI
FOUR EASY STEPS TO SUCCESSFUL MYCOTAXON PUBLICATION IN 2011
Prospective Mycoraxon authors should download instructions PDF, review and
submission forms, and other helpful templates by clicking the ‘file download page’ link
on our INSTRUCTIONS TO AUTHORS page before preparing their manuscript. Below is a
summary of our simple ‘4-step’ publication process.
Step 1—PEER REviEW: Authors send a formatted text document with illustration files
and Mycotaxon Reviewer Comments Form to 2-3 experts for peer review. Authors
should (i) ask peer reviewers to Email the revised manuscripts and comment forms
to both authors and the Editor-in-Chief <
[email protected]> and (ii) revise their
manuscript according to reviewer suggestions before submitting all text files to the
Nomenclature Editor for nomenclatural review. NEW: doi reference numbers must be
added to cited references prior to sending a manuscript out for review. (See MycoTAXON
112: 514-515.)
Step 2—NOMENCLATURAL REVIEW: Authors next Email their revised master text file
(containing footnotes, tables and captions but NO illustrations) to the Nomenclature
Editor <
[email protected]> for accession and pre-submission
review. The Email message MUST include the word ‘Mycoraxon’ on the subject line
and MUST include names and Email addresses of all peer reviewers. The Nomenclature
Editor will return annotated files with a list of needed corrections to the authors and
Editor-in-Chief.
Step 3—FINAL SUBMISSION: After authors receive their manuscript accession number
and make revisions requested during nomenclatural review, they should send (i) a
completed Mycotaxon submission form; (ii) separate text files for main text, tables,
and legends; and (iii) art files to the Editor-in-Chief <
[email protected]>. Only
text and image files considered ready for immediate publication should be sent at this
time. The Editor-in-Chief will try to acknowledge receipt of files within two weeks.
Authors are asked to wait at least 14 days before sending a follow-up query (without
attachments) to avoid unnecessary Email traffic near publication deadlines or during
temporary closures of the editorial office.
Step 4—PRESS PREPARATION: After preparing a PDF from the author’s text and art files,
the Editor-in-Chief sends journal entries for the nomenclatural novelties with the PDF
proof to all coauthors for approval. Editorial errors are always corrected free of charge,
but authors who ask the Editor-in-Chief to correct errors present in their original files
will be charged $10 per correction (minimum charge of $40). Payment arrangements for
all fees should be made by writing the Business Manager <subscriptions@mycotaxon.
com>.
MycorTaxon frequently updates its webpages where we regularly post abstracts, table
of contents, book reviews, indices, important announcements, and revised instructions
and forms. We invite everyone to browse both the official MycoTaxon site download
distributional weblists (regional mycobiotas) and the MycoTaxon ONLINE journal site
via the two urs below:
MYCOTAXON LTD: www.mycotaxon.com
MYCOTAXON ONLINE: www.ingentaconnect.com/content/mtax/mt
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 1-4 January-March 2011
DOT: 10.5248/115.1
Anew species of Ophiocordyceps (Clavicipitales, Ascomycota)
from southwestern China
Ji- Yur CHEN", YONG-QIANG Cao!, Da-RonG YANG" & Minc-Hva Lr’
*Key Laboratory of Tropical Forest Ecology, Xishuangbannan Tropical Botanical Garden,
Chinese Academy of Sciences, Kunming 650223, Yunnan, China
?Kunming Institute of Zoology, Chinese Academy of Sciences,
Kunming 650223, Yunnan, China
ABsTRACT — Anew species of caterpillar fungus, Ophiocordyceps laojunshanensis, is described
based on specimens collected from southwestern China. This species is characterized by
slender stromata, sparse perithecia, and the unique habitat of growing in mosses. Its habitat,
gross morphology, and microscopic features are illustrated and relationships to similar
species discussed.
Key worps —Cordyceps, Ophiocordyceps sinensis, Ophiocordycipitaceae, taxonomy
Introduction
The genus Cordyceps includes over 400 species, of which 120 species have
been reported in China (Liang 2007). Although the genus was formerly classified
in the Clavicipitaceae, based on recent results of the multi-gene phylogeny of
Cordyceps sensu lato, the taxonomy of both Cordyceps and the Clavicipitaceae
has been revised.
A new family Ophiocordycipitaceae has been proposed based on the
genus Ophiocordyceps Petch, which has been emended by Sung et al. (2007).
Ophiocordyceps is now characterized by stromata that are darkly (or rarely
brightly coloured) pigmented, tough, fibrous, pliant to wiry and rarely fleshy,
often with aperithecial apices or lateral pads, perithecia that are superficial to
completely immersed and arranged ordinally or obliquely (Sung et al. 2007).
In the past three years, the authors undertook numerous mycological
explorations to mountainous Northern Yunnan, where they collected many
specimens of caterpillar fungi that grow among mosses and have morphological
features that do not correspond to any previously described taxa. One new
species, Ophiocordyceps laojunshanensis, is described and illustrated in this
paper.
2... Chen & al.
Materials & methods
Field notes were taken for gross morphology of fresh ascomata and habitat. Detailed
macroscopic features were examined under a stereomicroscope (Carl Zeiss Discovery
12). Microscopic examination of ascomata and measurements of microscopic structures
were made from freehand sections under a microscope (Olympus 520). The sections
were mounted in 5% aqueous KOH and then Cotton-blue lactophenol. The holotype of
Ophiocordyceps laojunshanensis was deposited in the Cryptogamic Herbarium, Kunming
Institute of Botany, Chinese Academy of Sciences (KUN-HKAS 57066). Isolates from
fresh ascomata of O. laojunshanensis were maintained on potato dextrose agar with 1%
peptone (PPDA) using techniques described by Liu et al (1989), all isolates were kept in
Key Laboratory of Tropical Forest Ecology, Xishuangbannan Tropical Botanical Garden,
Chinese Academy of Sciences (No. laol-lao20).
Taxonomy
Ophiocordyceps laojunshanensis J.Y. Chen, Y.Q. Cao & D.R. Yang, sp. nov. Fig. 1
MycoBank MB 517206
Stromatibus clavatis, singularibus, 47.0-93.0 mm longis, 1.0-3.9 mm crassis. Capitulis
cylindricis, 8.5-17.0 mm longis, prophyro—brunneis vel atro—brunneis, apis acerosis
sterilibus 3.5-8.0 mm longis. Perithecia globosa, 200-300 x 200-350 jum; Stipitibus, 25.0-
72.0 mm longis; Asci clavuli, cylindraci, 165-275 x 11.5-14.5 um. Ascosporis hyalinis,
filiformis, multiseptatis, 130-250 x 5.0-6.0 um.
Type: China: Yunnan Province, Lijiang Naxi Autonomous Prefecture, Laojunshan
mountain, 26°37°33.76N 99°42’58.07E, alt. 3974 m; under Rhododendron mariae Hance;
associated with Oncophorus wahlenbergii Brid. and Pleurozium schreberi (Brid.) Mitt., 8
May 2009, Ji-yue Chen 09032.(HOLOTYPE: KUN-HKAS 57066).
ErymMo.oey: The epithet refers to the type locality, Laojunshan Mountain
Stromata clavate, slender, simple, rarely 2 or 3 from host head, rarely 1 from
host head and another from the terminal region, 47.0-93.0 mm long, 1.0-3.9
mm in diam. Ascogenous portion almost 1/5 to 1/3 of the stromata length,
cylindrical, 8.5-17.0 mm long, purplish to dark brown. Apex sterile acuminate,
3,5-8.0 mm long. Perithecia, globoid, 200-300 x 200-350 tum. arranged loosely
in irregular lateral cushions. Stipe 25.0-72.0 mm long. Asci clavate, 165.0-275.0
x 11.5-14.5 um. Ascospores hyaline, filiform, septate, 130.0-250.0 x 5.0-6.0
um (Fic. laf).
Colonies (F 1c. 1g-l) grew very slowly, only up to 6-10 mm in diameter
after 2 months on PPDA at 16°C. They were white at first, then became
brown-yellow or black brown, and sparse white mycelia emerged 3 month
later, with conidiophore and conidia, reverse blackish brown. Conidiophore,
hyaline, branching or non-branching; conidiogenous cell phialidic, hyaline,
with verrucose, acerate, 15-39(-50) um long; Conidia, hyaline, long elliptic,
6.0-13.5 x 3.0-4.0 um, one or two encased in a mucus drop.
Host: Larvae of Thitarodes yunnanensis Nielsen et al. (Hepialus yunnanensis
Yang et al.)
Ophiocordyceps laojunshanensis sp. nov. (China) ... 3
“gz
ae’.
Fic 1. Ophiocordyceps laojunshanensis—a. habitat; b. fresh fruiting body; c. dry fruiting bodies;
d. ascogenous portion, bar = 2 mm; e. ascus with ascospore, bar = 20 um; f. ascus tip, bar = 20
um; g—h. culture (bar = 5 mm): g. surface, h. reverse; i. colonies, bar = 20 mm; j. conidiophore and
conidia, bar = 20 um; k. conidiophore (detail), bar = 25 um; |. conidia (detail), bar = 10 um.
ADDITIONAL SPECIMENS EXAMINED: CHINA: YUNNAN PROVINCE, Lijiang Naxi
Autonomous Prefecture, Laojunshan mountain, 26°37'03.98N 99°42°18.02E to
26°37°82.71N 99°42797.86E, alt. 3874-4075 m. Under Abies delavayi Franch and
Rhododendron mariae Hance. Associated with Oncophorus wahlenbergii Brid., Dicranum
muehlenbeckii Bruch & Schimp. or Pleurozium schreberi (Brid.) Mitt., 8 May 2009, Ji-yue
Chen 09033-09035.
Discussion: Ophiocordyceps laojunshanensis is characterized by slender
stromata, sparse perithecia, and its unique habitat of growing among mosses.
It strongly resembles the most precious caterpillar fungus, O. sinensis (Berk.)
G.H. Sung et al., and is often sold together with that fungus. The two species
could be living in the same host larvae, except that O. laojunshanensis is found
most often growing among mosses, while O. sinensis appears to grow more
frequently in grasslands. Morphologically, O. laojunshanensis differs from O.
sinensis by having a slimmer stroma with a shorter ascogenous portion and
relatively sparse irregular perithecia compared to the close ordered perithecia
found in O. sinensis.
A... Chen & al.
Acknowledgments
The authors would like to thank Prof. Mu Zang (Kunming Institute of Botany,
Chinese Academy of Sciences) for his valuable suggestions and discussion. They also
give thanks to Dr. Yun Wang (Plant & Food Research, New Zealand) and Mr. Daniel
Winkler (MushRoaming, USA) for serving as pre-submission reviewers, Dr. Nicholas
Cummings (Plant & Food Research, New Zealand) for reviewing English, Prof. X.J. Li
(Kunming Institute of Botany, Chinese Academy of Sciences) for identifying the moss
species. This study was supported by the Knowledge Innovation Program of the Chinese
Academy of Sciences Project (No. KSCX2-Y W-G-024), the Natural Science Foundation
of Yunnan (No. 2007C105M), and West doctor Project of West Light Foundation of The
Chinese Academy of Sciences.
Literature cited
Liang ZQ. 2007. Cordyceps, Flora Fungorum Sinicorum. Science Press, Beijing. 32: 1-190.
Liu XJ, Guo YL, Yu YX, Zeng W. 1989. Isolation and identification of the anamorphic stage of
Cordyceps sinensis (Berk.) Sacc. Acata Mycologica Sinica 8: 35-40.
Sung GH, Hywel-Jones NL, Sung JM, Luangsa—aard J, Shrestha B, Spatafora JW. 2007. Phylogenetic
classification of Cordyceps and the clavicipitaceous fungi. Studies in Mycology 57: 5-59.
doi:10.3114/sim.2007.57.01
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 5-10 January-March 2011
DOT: 10.5248/115.5
Rediscovery of Microporellus iguazuensis
in southern Brazil
Mateus A. REcK, Mauro C. WESTPHALEN
& RosA MARA BORGES DA SILVEIRA
Universidade Federal do Rio Grande do Sul, Departamento de Boténica
Ay. Bento Goncalves, 9500, 91501-970, Porto Alegre, RS, BRAZIL
CORRESPONDENCE TO:
[email protected]
Asstract — Microporellus iguazuensis is redescribed from the southern Atlantic rainforest
of Brazil 23 years after its original description. The species is characterized by stipitate
basidiomata, smooth ellipsoid basidiospores, simple-septate generative hyphae, dextrinoid
skeletal hyphae, and a root-parasite habit. In the present work this noteworthy polypore is
described, illustrated and its taxonomy discussed.
Key worps — Polyporaceae, Basidiomycota, neotropical fungi
Introduction
The genus Microporellus Murrill comprises about 19 accepted species
worldwide with a predominantly tropical distribution (Kirk et al. 2008).
Microporellus was originally described as a segregate from the also tropical
genus Microporus P. Beauv., which presents a trimitic hyphal system and
coralloid dichophytic elements along the dissepiments (Ryvarden & Johansen
1980), features lacking in Microporellus. The taxonomic concept of the genus
(Decock 2007) includes pileate species with a dimitic hyphal system and, mostly,
dextrinoid skeletal hyphae and subglobose spores. The following species are
known from Brazil: M. brasiliensis Ryvarden & Decock (Decock & Ryvarden
2002), M. dealbatus (Berk. & M.A. Curtis) Murrill (Loguercio-Leite & Wright
1991), M. obovatus (Jungh.) Ryvarden (Rajchenberg & Meijer 1990), and
M. terrestris (Gibertoni & Ryvarden) Decock (Decock 2007).
In the present paper, we report the occurrence of a rare and poorly known
Microporellus species that was collected during polypore surveys in the Atlantic
rainforest. This ecosystem is located throughout most of the Brazilian Atlantic
coast from the northeast to the south, covering the lower eastern slopes of the
6 ... Reck, Westphalen & Silveira
mountain ranges (Morellato & Haddad 2000). It experiences a warm climate
with abundant rainfall and, as one of the world’s most endangered forests, is
considered a hotspot worthy of conservation and research (Mittermeier et al.
2005).
Materials & methods
Basidiomes were collected between March 2007 and March 2009 in the northeast
region of Rio Grande do Sul State, southern Brazil. Macro- and microscopical analyses
followed usual polypore protocols (Nutiez & Ryvarden 2001). Microscopic examinations
were made from freehand sections mounted in a drop of 5% KOH solution and 1%
phloxine solution; amyloid or dextrinoid reactions were observed in Melzer’s reagent.
The cyanophilous reaction was observed in cotton blue. Abbreviations follow Coelho
(2005): Dm = diameter mean, Lm x Wm = means of length and width, Q = range
of length/width ratios, Qm = length/width mean, and n = x/y, with x = number of
measurements from y = number of specimens. Color names and codes follow Kornerup
& Wanscher (1978). All the specimens are preserved at the ICN Herbarium (UFRGS).
Taxonomy
Microporellus iguazuensis Rajchenb., Mycotaxon 28: 111, 1987. Figs 1-8
SPECIMENS EXAMINED: BRAZIL. Rio Grande do Sul State, Dom Pedro de Alcantara,
RPPN Mata do Professor Baptista, 27.III.2007, leg. M.A. Reck 035/07 (ICN 139893);
Porto Alegre, Refugio da vida Silvestre Morro Santana, 30.11.2007, leg. M.C. Westphalen
003/07 (ICN 154057); leg. M.C. Westphalen 006/07 (ICN154060); 13.III.2009, leg.
M.A.Reck 004/09 (ICN154263).
Basidiomes annual, lateral to eccentrically stipitate, coriaceous and flexible
when fresh, corky and rigid upon drying. Pileus up to 6.0 x 4.0 cm, flabellate-
spathulate, with fusions between one or more parts of them, margin regular,
some incurved upon drying; upper surface glabrous to slightly velutinate,
zonate in shades of orange red (8.B7) and pastel red (8.A4), becoming pale upon
drying, dull red (8.C3) with reddish brown zones (9.E6); stipe erect, lateral to
eccentric, velutinate, light brown (7.D8), dark brown (8.F7) upon drying, up to
6.0 cm long and 5.0 mm wide; pore surface orange grey (5.B2; 6.B2) to greyish
orange (5.B3), pores irregular, round to angular, 1-2/mm, shallow, up to 1 mm
deep, decurrent on the stipe and, then, becoming daedaloid, dissepiments thick,
entire; margin sterile, context very thin, concolorous with the pore surface, up
to 2.5 mm.
Hyphal system dimitic, Generative hyphae simple septate, 2.5-5.0 um wide,
hyaline, in the trama Dm = 3.5, in the context Dm = 3.85, thin to slightly
thick-walled, rarely branched, in the stipe Dm = 3.73, pale yellow to brown,
with some branches; skeletal hyphae 3.5-7.5 um wide, unbranched, thick-
walled, with wide lumen, dextrinoid (strongly dextrinoid when seen in mass),
hyaline to pale cinnamon, in the trama Dm = 4.64, in the context Dm = 5.24
Microporellus iguazuensis new to Brazil ... 7
ke
Fics. 1-2. Basidiome of Microporellus iguazuensis (ICN 154263)
1. Connected to roots of Ocotea indecora, showing the hymenophore. 2. Upper surface.
and parallel, in the stipe Dm = 5.11, pale yellow to rusty brown (all hyphae
measurements n = 100/2). Cystidia lacking, but fusoid cystidioles can be found
in the dissepiment edges. Basidia clavate 25.0-35.0 x 9.0-10.0 um, tetraspored,
with long sterigmata. Basidiospores broadly ellipsoid to ellipsoid, obovate,
asymmetric in side view, smooth and hyaline, thin- to slightly thick-walled,
generally with one big oil drop or a sparse oily content, IKI-, acyanophilous,
7.5-9.0 x 5.5-6.5 um, Lm x Wm = 8.08 x 5.99, Q = 1.23-1.60, Qm = 1.35,
n= 100/2.
CuLTuRE: Unknown. Attempts to obtain cultures from the context and spore
print, using Malt Extract and Potato Dextrose Agars, were unsuccessful.
SupsTRATA: Found on the ground among the litter, but connected to roots
of living trees of Ocotea indecora (Schott) Mez (Lauraceae). Type of rot
unknown.
DisTRIBUTION: Previously known only from the type locality, in the forest of
Iguazu National Park, in NE Argentina (Rajchenberg 1987), and now found
in the Rio Grande do Sul state, southern Brazil, in two different sites of the
Atlantic rainforest. If the species follows the host distribution, it could be
widely distributed in forest systems where O. indecora (or perhaps other related
species of Ocotea Aubl.) occur. In Brazil, O. indecora is distributed from Bahia
to Rio Grande do Sul states (Sobral et al. 2006).
8 ... Reck, Westphalen & Silveira
Fics. 3-8. Microporellus iguazuensis (ICN 139893).
3. Cystidioles from dissepiment edges. 4. Basidiospores. 5. Basidia.
6. Generative hyphae from trama and context. 7. Skeletal hyphae. 8. Generative hyphae from stipe.
ADDITIONAL SPECIMEN EXAMINED: ARGENTINA. Misiones, Parque Nacional Iguazu,
ad viam Apept, 08.III.1980, leg. J.E. Wright M-3379 (BAFC 30708 holotype).
Remarks: Microporellus iguazuensis is an interesting polypore distinguished
by its lateral to eccentric stipitate basidiome with flabelliform pileus and
irregular large pores decurrent on the stipe. Microscopically it is characterized
by a dimitic hyphal system with simple septate generative hyphae and strongly
dextrinoid skeletal hyphae, large basidia, and ellipsoid to obovate basidiospores.
Moreover, it presents a parasitic habit, growing on living roots of laurel trees
Microporellus iguazuensis new to Brazil ... 9
(Fic. 1). Macroscopically, M. iguazuensis can be confused with some species
of Polyporus P. Micheli ex Adans. that present a dark stipe and large pores (like
P. guianensis Mont.). However, Polyporus species differ microscopically by
clamped generative and non-dextrinoid skeleto-binding hyphae.
Heterobasidion annosum (Fr.) Bref., an important root-rot pathogen of
conifers, also presents a dimitic hyphal system with simple septate generative
and dextrinoid skeletal hyphae but, in contrast with M. iguazuensis, has sessile
basidiomes and minutely echinulate basidiospores (Gilbertson & Ryvarden
1986).
Decock (2007) cited the main morphological features of Microporellus as
follows: light-weight pileate basidiomata possessing a white to pale cream
context and trama, a dimitic hyphal system with unbranched skeletal hyphae,
non- to dextrinoid vegetative hyphae, and slightly thick-walled spores with
cyanophilous walls, generally containing an oil drop. Microporellus iguazuensis
fits in this circumscription in some characters states, but it is the only species of
the genus that combines simple septate generative hyphae, dextrinoid skeletal
hyphae and a phytopathogenic habit. Most Microporellus species, including the
type species, also present ventricose and thick-walled cystidia (Decock 2007), a
feature absent in M. iguazuensis.
The unique combination of features in M. iguazuensis suggests that it should
not be included in either Microporellus or Heterobasidion Bref., but perhaps
represents a distinct genus. However, we think that these morphological data
are not distinct enough to circumscribe a new genus to accommodate this
species; further studies are necessary, including cultural characteristics and
molecular data. Our attempts to obtain cultures from the context and spore
print, using MEA and PDA, were not successful. Maybe further attempts using
other media will succeed in initiating mycelial growth.
Acknowledgements
The authors thank Dr. Karen Nakasone (USDA, USA) and Dr. Mario Rajchenberg
(CIEFAP, Argentina) for the critical revision. Martin Grings (UFRGS, Brazil) and Dr.
Vagner Cortez (UFPR, Brazil) are acknowledged for botanic identifications and valuable
suggestions, respectively. CAPES and CNPq (Brazil) are acknowledged for financial
support.
Literature cited
Coelho G. 2005. A Brazilian new species of Auriporia. Mycologia 97: 266-270. doi: 10.3852/
mycologia.97.1.263
Decock C. 2007. On the genus Microporellus with two new species and one recombination
(M. papuensis spec.nov., M. adextrinoideus spec. nov., and M. terrestris comb. nov.). Czech
Mycol. 59: 153-170.
Decock C, Ryvarden L. 2002. Two undescribed Microporellus species and notes on M. clemensiae,
M. setigerus, and M. subincarnatus. Czech Mycol. 54: 19-30.
10 ... Reck, Westphalen & Silveira
Gilbertson RL, Ryvarden L. 1986. North American polypores. Vol. 1. Abortiporus—Lindtneria. Oslo
(Norway): Fungiflora. 433 p.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth and Bisby’s dictionary of the fungi.
10® ed. Wallingford (UK): CABI. 771 p.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. 3 ed. London (UK): Eyre
Methuen.
Loguercio-Leite C, Wright JE. 1991. Contribution to a biogeographical study of the austro-american
xylophilous polypores (Aphyllophorales) from Santa Catarina Island, SC., Brazil. Mycotaxon 41:
161-166.
Mittermeier RA, Gil PR, Hoffman M, Pilgrim J, Brooks T, Mittermeier CG, Lamoreux J, Fonseca
ABG. 2005. Hotspots revisited: Earth’s biologically richest and most endangered terrestrial
ecoregions. Chicago (USA): University of Chicago Press. 392 p.
Morellato LPC, Haddad CEB. 2000. Introduction: the Brazilian Atlantic Forest. Biotropica 32:
786-792. doi: 10.1111/j.1744-7429.2000.tb00618.x
Nufiez M, Ryvarden L. 2001. East Asian polypores. Oslo (Norway): Fungiflora. 168 p.
Rajchenberg M. 1987. New South American Polypores. Mycotaxon 28: 111-118.
Rajchenberg M, Meijer AAR. 1990. New and noteworthy polypores from Parana and Sao Paulo
Sates, Brazil. Mycotaxon 38: 173-185.
Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Oslo (Norway):
Fungiflora. 636 p.
Sobral M, Jarenkow JA, Brack P, Irgang I, Larocca J, Rodrigues RS. 2006. Flora arbérea e arborescente
do Rio Grande do Sul, Brasil. Sao Carlos/Porto Alegre (Brazil): RiMa/Novo Ambiente. 350 p.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 11-17 January-March 2011
DOT: 10.5248/115.11
A new species of Hyphodiscus (Helotiales) on Stereum
KADRI PARTEL'® & KADRI POLDMAA*
‘Department of Botany, Institute of Ecology and Earth Sciences, University of Tartu
Lai 40, EE-51005, Tartu, Estonia
*Mycological Herbarium, Institute of Agricultural and Environmental Sciences,
Estonian University of Life Sciences, Riia 181, EE-51014 Tartu, Estonia
*CORRESPONDING AUTHOR:
[email protected]
ApsTRAcT — A new species, Hyphodiscus stereicola, is described based on material from
Northern Europe, the Canary Islands, and North America. In all of these, greenish apothecia
grew on decayed basidiomata of Stereum spp. Morphology and host specialisation of the new
species are compared with those of other members of the genus.
Key worps — fungicolous ascomycetes, rDNA, taxonomy
Introduction
Hyphodiscus is a genus in the order Helotiales characterised by hairy
apothecia that are formed on dead, often decorticated, deciduous or coniferous
wood. Several species occur on decaying fruitbodies of polypores and corticioid
fungi.
Several years ago a light glaucous fungus was found on old basidiomata
of Stereum in Mexico. The material was sent for identification to the late Ain
Raitviir (Tartu, Estonia), who made some hand-written remarks about the
delimitation of this fungicolous species as a member of the genus Hyphodiscus.
Soon a similar specimen was collected in Northern Europe, from Estonia. In
autumn 2008, additional material was found from La Gomera (Canary Islands)
and Estonia. All four collections are similar in their morphology and host. As
these represent a unique combination of characters in the genus Hyphodiscus, a
new species will be described herein.
Materials & methods
Living ascomata were studied in tap water, 3% aqueous KOH solution, Melzer’s reagent
(MLZ) and Lugol’s solution (LUG). Microphotos and measurements of microscopical
elements were taken from living cells of unsquashed freehand sections under cover
12 ... Partel & Példmaa
glasses. The colour names and codes were adopted from Kornerup & Wanscher (1967).
DNA was extracted and the ribosomal DNA ITS regions and 5’ end of the large subunit
amplified and sequenced according to the protocol described by Példmaa (2011). The
primers ITS1F and LR5 were used for PCR and sequencing. The holotype of the new
species is deposited in the mycological herbarium of the Natural History Museum of the
University of Tartu (TU). The DNA sequences were deposited to EMBL and the UNITE
database (Kéljalg et al. 2005).
Taxonomy
Hyphodiscus stereicola Raitv., Partel & K. Poldmaa, sp. nov. PLATE 1
MycoBank MB 518733
Apothecia gregaria, subsessilia, cupulata, 300-600 ym diametro, margine piloso,
viridi-albo, disco olivaceo. Pili cylidracei, obtusi, incrustati, septati, 31-62 x 2-2.8 ym.
Excipulum ectale gelatinosum, cellulis venetis; medulla textura intricata composita,
brunneolo-aurantiaca. Asci cylindraceo-clavati, octospori, 37-47 x 5-6 um longi, basi
uncinati, poris in solutione iodi non coloratis. Ascosporae hyalinae, ellipsoideae, apicibus
obtusis, biguttulatae, 7.6-11.5 x 2.6-4 um. Paraphyses filiformes, 1.5-2 um in diametro.
Fungicolae ad basidiomata Stereumorum.
HoLotype — ESTONIA. JécEva Co., Puurmani Community, Alam-Pedja Nature
Reserve, ca 50 m SW from the beginning of the Kirna hiking trail, mixed forest
with dominant Populus tremula, 58.544°N, 26.233°E, on decaying basidiomata of
Stereum subtomentosum Pouzar, 8 Oct 2008, leg. Kadri Példmaa, TU 104241 [EMBL
FN995636].
EryMoLocy — named after the host genus.
EcoLoey — fungicolous, growing on old basidiomata of Stereum spp.
APOTHECIA densely gregarious, subsessile to shortly stipitate. Disc almost flat
to slightly depressed, 300-600 um in diameter, olivaceous (1E5), RECEPTACLE
at first deeply cup-shaped, later saucer-shaped, externally and at the margin
with numerous greenish-white (25A2-3) hairs. Ectal excipulum composed
of gelatinous, more or less parallel, slightly interwoven, bluish-green (25B7)
pigmented cells terminating above the surface into cylindrical hairs (10-19 x
2-2.2 um). Medullary excipulum brownish-orange (5C6), of textura intricata.
Hairs greyish green (30C3), mostly straight, cylindrical, slightly pointed, thin-
walled, 0-3-septate, 31-62 x 2-2.8 um, without iodine reaction; wall (except the
base) covered with loose irregular-tuberculate greyish green warts. Pigment in
excipulum and hair walls dissolving in KOH, apothecia extracting pale yellow
hue into KOH solution. Asci arising from croziers, 8-spored, cylindric-clavate,
conically pointed at apex, apical pore not staining in Lugol's or Melzer's reagent
(with or without KOH pretreatment), 37-47 x 5-6 um. Ascosporss ellipsoid
with obtuse apices, hyaline, smooth, biguttulate (one lipid body at each end,
1-2.8 um in diameter), aseptate, biseriate or irregularly seriate in asci, 7.6-11.5
x 2.6-4 um. Parapuyses filiform, with 2-3 septa, not exceeding the asci,
approximately as long as the asci, 1.5-2 um in diameter, filled with fine green
Hyphodiscus stereicola sp. nov. on Stereum ... 13
PLATE 1. Hyphodiscus stereicola. a, b. apothecia; c. paraphyses; d. asci; e. asci (in Melzer’s);
f. Hairs and upper part of excipulum; g. ascospores; h. ectal excipulum; i. medullary excipulum;
(a-d, f, g,i= holotype); e, h = TU 104272. All microscopical subjects (except e) were mounted in
water. Scale bars: a = 500 um; b = 300 um; c-e, g = 5 um; f, h, i = 10 um.
14... Partel & Példmaa
vacuolar bodies, simple or branched only at the base, gradually sligthly tapering
towards the apex.
ADDITIONAL SPECIMENS EXAMINED: ESTONIA. PARNU Co., Saarde Community, W
of Reinu, Nigula Nature Reserve, Picea abies nemoral forest, 58.04183°N, 24.72383°E,
on dead basidiomata of Stereum subtomentosum, 26 Aug 2003, leg. I. Parmasto, TAAM
181316. MEXICO. Cuinuanua, Sierra Madre Occidental, Cascada de Basaseachi,
above the left riverbank at the bottom of the waterfall, 28.16944°N, 108.20694°W, alt. ca
1650 m, in mixed forest, on dead basidiomata of Stereum ostrea (Blume & T. Nees) Fr., 24
Jul 1994, leg. J. Hafellner 38772, TAAM 200599. SPAIN. Canary IsLanps. La Gomera,
Garajonay National Park, near El Cedro, in laurel forest, 28.13090°N, 17.21319°W, alt ca
800 m, on dead basidiomata of Stereum ostrea, 2 Dec 2008, leg. K. Példmaa; TU 107690
[EMBL FR686966]; leg. K. Partel, TU 104272.
ComMENTS. Hyphodiscus stereicola clearly differs from other species in the
genus due to a unique combination of characters: olivaceous disc, greyish green
hairs, and the comparatively large ellipsoidal ascospores. Characteristic of the
species is also its fungicolous habit and specialization to old basidiomata of
Stereum.
It is similar to H. viridipilosus (Graddon) Baral which also has green hairs
and ellipsoidal ascospores. ‘This species, growing on deciduous wood, is
characterized by an ochraceus apothecial disc (Graddon 1974, Baral 1993). The
asci and ascospores are smaller (ca 3-4 x 1.5-2 um) than in H. stereicola. There
are several yet undescribed species shown in Hans Otto Baral’s detailed drawings
(Baral & Marson 2005), none of which seems to resemble H. stereicola.
Hyphodiscus stereicola reveals substrate specificity, as all the specimens have
been collected on Stereum spp. Found either on the pileus or on the hymenium,
it appears to prefer decaying basidiomata. In the two collections from boreal
forests in Estonia the host is S. subtomentosum. ‘The morphologically very
similar species, S. ostrea having a southern distribution, serves as the host for
the other specimens, collected in Mexico and the Canary Islands. In Estonia
and La Gomera the collection habitats represent primeval forests with many
fallen rotting trunks.
Although the fungicolous lifestyle is rare among the Helotiales, members of
Hyphodiscus tend to grow on fruitbodies of basidiomycetes. The most common
of these, H. hymeniophilus (P. Karst.) Baral, grows on decaying basidiomata of
Antrodia serialis (Fr.) Donk, Antrodiella hoehnelii (Bres.) Niemela, Piptoporus
betulinus (Bull.) P. Karst., Polyporus varius (Pers.) Fr. and Trametes versicolor (L.)
Lloyd (Helfer 1991). Clavidisculum stereicola (Cooke) Raitv., later synonymised
with H. hymeniophilus by Raitviir (2004), was reported to grow on Stereum sp.
(Raitviir 1970).
In addition, H. theiodeus (Cooke & Ellis) W.Y. Zhuang occurs on Peniophora
spp. (Zhuang 1988) and other wood-decaying basidiomycetes, while
H. incrustatus (Ellis) Raitv. has been found on old Polyporus spp. (Raitviir
Hyphodiscus stereicola sp. nov. on Stereum ... 15
2004). Hosoya et al. (2010) speculated that fungicolous association might
stimulate formation of ascomata in the whole genus, as suggested by the
frequent observation of other fungi near Hyphodiscus fruitbodies.
Hyphodiscus stereicola is one of the few species of apothecial ascomycetes
that is found on basidiomata of species of Stereum. At the same time members
of this basidiomycete genus serve as hosts to a number of representatives of the
Hypocreales, the ascomycete order richest in fungicolous associations. Besides
several species of Hypomyces (Példmaa 2003, Rogerson & Samuels 1993) and
Sphaerostilbella, these include also Nectriopsis oropensoides (Rehm) Samuels.
Despite the overall low host-specificity of members of these fungicolous genera
growing on aphyllophoroid basidiomycetes (Példmaa 2000, Rogerson &
Samuels 1993), the majority of the species inhabiting Stereum are found only on
basidiomata of this genus. The annual, dimitic, comparatively soft basidiomata
apparently provide a specific niche, in contrast to the mostly perennial, di- or
trimitic, tough basidiomata of many aphyllophoroid genera which host other
fungicolous ascomycetes, including Hyphodiscus. Such specialisation could also
be explained by the phylogenetic component as the genus Stereum (Russulales)
is not closely related to most of the other aphyllophoroid genera distributed
across the Agaricomycetes.
The asexual stages of Hyphodiscus species have been described in the
anamorph genus Catenulifera: C. rhodogena (EF Mangenot) Hosoya for
H. hymeniophilus and unnamed Catenulifera spp. for H. pinastri R. Galan &
Raitv., H. theiodeus, and H. otanii Hosoya (Galan & Raitviir 2004, Hosoya
2002). Our attempts to isolate the most recent collections into pure culture
were not successful.
The genus Hyphodiscus has been accepted as a member of Hyaloscyphaceae
by most authors (Verkley 1993, 1996; Hosoya 2002; Raitviir 2004, Hosoya et
al. 2010) with unclear affinities based on rDNA sequences (Untereiner et al.
2006, Bogale et al. 2010). However, rDNA ITS and SSU sequences reveal that
H. hymeniophilus is related to members of Hyaloscyphaceae and Dermateaceae
but also to anamorphic helotialean root endophytes like Phialocephala
(Vibrisseaceae) (Untereiner et al. 2006, Bogale et al. 2010). The true phylogenetic
relationships of Hyphodiscus species are currently being clarified (R. Galan pers.
comm.). The rDNA ITS region of the two Estonian specimens of H. stereicola
were identical, whereas that of the La Gomeran material differed in 6 bp. A
BLAST search of ITS regions found only weak correspondence between the
type of H. stereicola and databased sequences from identified species (a best
match of 84% with H. hymeniophilus and Catenulifera brachyconia (W. Gams)
Bogale & Unter.). However, the true phylogenetic affinities of H. stereicola
remain unclear due to the lack of sequence data for most of the species of this
and related genera.
16 ... Partel & Példmaa
Acknowledgments
We acknowledge the contribution of the late Ain Raitviir to the initiation of this
study. We thank Josef Hafellner (Austria, Graz) and Ilmi Parmasto (Estonia, Tartu) for
providing specimens for study. We are also indebted to Erast Parmasto for identifying
the Stereum species and for the revision of the Latin and to Bellis Kullman for technical
assistance. We thank Ricardo Galan (Alcala de Henares, Spain) and Seppo Huhtinen
(Turku, Finland) for reviewing the manuscript. This study was funded by the Estonian
Science Foundation (grant 6939), the Estonian Ministry of Education and Science
(projects SFO180153s08 and SFO180012s09) and the European Union through the
European Regional Development Fund (Center of Excellence FIBIR).
Literature cited
Baral HO. 1993. Beitrage zur Taxonomie der Discomyceten III. Zeitschrift fur Mycologie 59(1):
3-22.
Baral HO, Marson G. 2005. In Vivo Veritas. Over 10000 of fungi and plants, with materials on vital
taxonomy and xerotolerance. 3. ed. DVD-ROM.
Bogale M, Orr M-J, O’Hara MJ, Untereiner WA. 2010. Systematics of Catenulifera (anamorphic
Hyaloscyphaceae) with an assessment of the phylogenetic position of Phialophora hyalina.
Fungal Biology 114: 396-409. doi:10.1016/j.funbio.2010.02.006
Galan R, Raitviir A. 2004. Deux Hyaloscyphaceae jaunes. Bulletin de la Société Mycologique de
France 120: 187-198.
Graddon WD. 1974. Some new discomycete species. Transactions of British Mycological Society
63(3): 475-485. doi:10.1016/S0007-1536(74)80095-1
Helfer W. 1991. Pilze auf Pilzfruchtkérpern. Libri Botanici 1. IGW Verlag. Eching. 157 pp.
Hosoya T. 2002. Hyaloscyphaceae in Japan (6): the genus Hyphodiscus in Japan and its anamorph
Catenulifera gen. nov. Mycoscience 42: 611-622.
Hosoya T, Han J-G, Sung G-H, Hirayama Y, Tanaka K, Hosaka K, Tanaka I, Shin H-D. 2010.
Molecular phylogenetic assessment of the genus Hyphodiscus with description of Hyphodiscus
hyaloscyphoides sp. nov. Mycological Progress. Published online 20 Aug. 2010. doi:10.1007/
$11557-010-0693-2
Kornerup A, Wanscher JH. 1967. Methuen Handbook of Colour. 2" edition. Methuen & Co Ltd.
London. 243 pp.
Kéljalg U, Larsson K-H, Abarenkov K, Nilsson RH, Alexander IJ, Eberhardt U, Erland S, Hoiland
K, Kjoller R, Larsson E, Pennanen T, Sen R, Taylor AFS, Tedersoo L, Vralstad T, Ursing BM.
2005. UNITE: a database providing web-based methods for the molecular identification
of ectomycorrrhizal fungi. New Phytologist 166: 1063-1068. doi:10.1111/j.1469-8137.2005.
01376.x
Példmaa K. 2000. Generic delimitation of the fungicolous Hypocreaceae. Studies in Mycology 45:
83-94,
Példmaa K. 2003. Three species of Hypomyces growing on basidiomata of Stereaceae. Mycologia
95(5): 921-933. doi:10.2307/3762020
Példmaa K. 2011. Tropical species of Cladobotryum and Hypomyces producing red pigments.
Studies in Mycology 68: 1-34. doi:10.3114/sim.2011.68.01
Raitviir A. 1970. Synopsis of the Hyaloscyphaceae. Scripta Mycologica 1. Institute of Zoology and
Botany. Tartu. 115 pp.
Raitviir A. 2004. Revised Synopsis of Hyaloscyphaceae. Scripta Mycologica 20. Estonian Agricultural
University, Institute of Zoology and Botany. Tartu. 132 pp.
Hyphodiscus stereicola sp. nov. on Stereum ... 17
Rogerson CT, Samuels GJ. 1993. Polyporicolous species of Hypomyces. Mycologia 85: 231-272.
doi: 10.2307/3760461
Untereiner WA, Naveau FA, Bachewich J, Angus A. 2006. Evolutionary relationships of Hyphodiscus
hymeniophilus (anamorph Catenulifera rhodogena) inferred from {-tubulin and nuclear
ribosomal DNA sequences. Canadian Journal of Botany 84: 243-253. doi:10.1139/B05-165
Verkley GJM. 1993. Ultrastructure of the ascus apical apparatus in Hymenoscyphus and other
genera of the Hymenoscyphoideae (Leotiales, Ascomycotina). Persoonia 15: 303-340.
Verkley GJM. 1996. Ultrastructure of the ascus apical apparatus in genera Lachnum and Trichopeziza
(Hyaloscyphaceae, Ascomycotina). Nova Hedwigia 63: 215-228.
Zhuang W-Y. 1988. Notes on Lachnellula theiodea. Mycotaxon 31: 411-416.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 19-27 January-March 2011
DOT: 10.5248/115.19
Chaetomium siamense sp. nov., a soil isolate from Thailand,
produces a new chaetoviridin, G
CHANINUN PoRNSURIYA’, KASEM SOYTONG?, SUPATTAR POEAIM},
SOMDEJ] KANOKMEDHAKUL*‘, PRIMMALA KHUMKOMKHET*
Fu-CHENG LIN*, HONG KAI WANG? & KEVIN Davip HypE%7
' Department of Biology, Faculty of Science, Srinakharinwirot University
Bangkok 10110, Thailand
2Department of Plant Pest Management Technology, Faculty of Agricultural Technology &
’Department of Applied Biology, Faculty of Science — King Mongkut’s Institute
of Technology, Ladkrabang (KMITL), Bangkok 10520, Thailand
‘Natural Products Research Unit, Department of Chemistry & Center of Excellence
for Innovation in Chemistry, Faculty of Science, Khon Kaen University,
Khon Kaen 40002, Thailand
5College of Agriculture and Biotechnology, Biotechnology Institute, Zhejiang University
Kaixuan Road, Hangzhou 310029, P.R. China
°School of Science, Mae Fah Luang University, Thasud, Chiang Rai 57100, Thailand
"Botany and Microbiology Department, College of Science, King Saud University,
Riyadh, Saudi Arabia
CORRESPONDENCE TO *: “
[email protected]
ABSTRACT — Chaetomium siamense sp. nov., isolated from soil in a pineapple plantation
in Thailand, is described and illustrated. The new species is similar to C. cupreum in
having superficial globose or ovate ascomata with red circinate ascomatal hairs but can be
distinguished by its fusiform ascospores with two apical germ pores. Phylogenetic analysis of
ITS rDNA sequence data also supports C. siamense as distinct. Investigation of the secondary
metabolites of C. siamense led to the isolation of one new (chaetoviridin G) and seven known
compounds (ergosterol, 24(R)-5a,8a-epidioxyergosta-6-22-diene-3B-ol, ergosterylplamitate,
cochliodone D, chaetoviridin A, chaetoviridin F, chrysophanol).
Key worps — Ascomycota, Chaetomiaceae, novel compound
Introduction
Chaetomium Kunze, established in 1817, is an ascomycete genus in the family
Chaetomiaceae (von Arx et al. 1986). Chaetomium is one of the largest genera of
saprotrophic ascomycetes, comprising more than 300 species worldwide (Seth
1970, von Arx et al. 1986, Cano & Guarro 1987, Carris & Glawe 1987, Moustafa
& Ess El-Din 1989, Horie & Udagawa 1990, Abdullah & Zora 1993, Udagawa et
20 ... Pornsuriya & al.
al. 1994, Gené & Guarro 1996, Decock & Hennebert 1997, Udagawa et al. 1997,
Rodriguez et al. 2002, Wang & Zheng 2005a,b). Chaetomium is characterized
by superficial ascomata, usually covered with hairs or setae, surrounding a
rather wide ostiolar pore at the apex. The ascospores are aseptate, brown or
gray-olivaceous, and with one or two germ pores (von Arx et al. 1986).
During a study on antagonistic fungi for controlling root rot disease of
pineapple, numerous strains of Chaetomium were isolated from soil using a
baiting technique (Soytong & Quimio 1989). Although several species have
been only recently recorded for Thailand (Pornsuriya et al. 2008), one isolate
could not be identified as any known Chaetomium species. ‘This isolate is here
described and illustrated as Chaetomium siamense sp. nov., and is compared
with C. cupreum, the most similar species. Molecular evidence, also provided,
supports this species as an independent taxon.
Materials & methods
Sampling, isolation and morphological study
Soil samples were collected from pineapple plantations in Phatthalung Province,
Thailand, during August to November 2007. They were placed in clean plastic bags
for transport to the laboratory at King Mongkut’s Institute of Technology Ladkrabang,
Bangkok, Thailand. Chaetomium species were originally isolated by the baiting technique
described by Soytong & Quimio (1989). Chaetomium species developing on baits were
observed daily and their ascomata transferred to glass slides with a small amount of
sterilized water before being spread on water agar (WA) in a 9-cm diameter Petri dish
and then incubated for 24 h at room temperature, Individual colonies were transferred
onto potato dextrose agar (PDA) and corn meal agar (CMA) for identification.
Morphological structures of the new species were observed under compound and
scanning electron microscopes. The holotype is deposited in Biocontrol Research Unit
and Mycology Section (KMITL).
DNA extraction, polymerase chain reaction (PCR) and data analysis
Genomic DNA was extracted from a mycelial culture grown in potato dextrose broth
(PDB) by using Dneasy Plant Mini kit (Qiagen, Hilden, Germany). Polymerase chain
reaction (PCR) amplification of the internal transcribed spacer (ITS1, 5.88 and ITS2
regions) was performed with primer pair PN3 and PN16 (Neuvéglise et al. 1994). The
reaction was carried out in 25 ul volumes containing 1 ul genomic DNA, 0.5 ul dNTPs,
1 pl of each primer and 0.2 ul Taq DNA polymerase in 2.5 ul PCR buffer. Amplifications
were performed with an initial denaturation step of 95°C for 5 min followed by 35
cycles of 94°C for 1 min, 60°C for 2 min and 72°C for 3 min and a final extension of
72°C for 5 min. The PCR product was separated on an agarose gel and purified for
DNA sequencing by the U-gene Gel Extraction Kit II (U-gene Biotechnology Co, P.R
China). DNA sequences of related species, based on the ITS including 5.8S gene data,
were retrieved from GenBank (TABLE 1). Chaetomium nigricolor and Chaetomium sp.
15004 were used as outgroup. All sequences were assembled using BioEdit ver. 7.0.2
and aligned using ClustalX ver 1.83. Phylogenetic relationships were determined by
Chaetomium siamense sp. nov. (Thailand) ... 21
TABLE 1. Chaetomium species and isolates used in this study
ISOLATES : ITS GENBANK i HOST/SUBSTRATE i GEOGRAPHIC
} ACCESSION No. } i ORIGIN
hinese child
C. atrobrunneum
C. cupreum
Macrotermitinae nest
__&. globosum chrysanthemum
C. longicolleurm
C. murorum deteriorated painting
“GE pachypodioides
__Chaetomium sp. 15004
: Chaetornium sp. INBI2-26(-)
C. thermophilum EF550983
heuristic search under neighbor joining (NJ) using PAUP* 4.0b8 (Swofford 2001). Tree
was drawn using Treeview.
Identification of metabolites
Erlenmeyer flasks (1 L) containing 200 ml PDB were inoculated with mycelial
plugs from a 5-day-old culture of C. siamense. The flasks were incubated for 4 weeks
on stationary state at 27-30°C. Mycelium mats were then harvested, air dried, ground,
and extracted with a series of methanol, ethyl acetate and hexane. The crude extract was
loaded onto a silica gel column. The column was successively eluted to obtain different
fractions and monitored by TLC, and reduced to one active fraction. The chemical
structures isolated from dried mycelial mats of C. siamense were elucidated on the basis
of spectroscopic evidence (IR, 'H NMR, and ?C NMR and 2D-NMR).
Taxonomy & discussion
Chaetomium siamense Pornsuriya & Soytong, sp. nov. Figs 1
MycoBank MB 506801
Coloniae modica bardus crescents in agaris PDA et CMA, cum mycelio aerio; reversum
rubus. Mycelium ex hyphis hyalinis vel subhyalinis, septatis, laevibus, 1.8-2.3 um diam
compositum. Ascomata superficialia, globosae, ovata, ostiolata, fuscobrunneum in
refulgens, paramariae ad 87-148 x 107-177 um. Peridium fuscobrunneum et ex textura
angularis; epidermoidea ex fuscus, paramariae ad 2.8-5.7 x 5.1-10.4 um. Ascomatal
pili abundantibus, simplici, aurantiacus in refulgens, spira in ultima parte et ex septati,
22 ... Pornsuriya & al.
Figure 1. Chaetomium siamense. A. Ascoma viewed under a scanning electron microscope.
B. Ascoma viewed under a light microscope. C-D. Arcuate ascomatal hairs with swollen basal
cells (arrowed) viewed under a scanning electron microscope. E. Peridium viewed under a
light microscope. F. Asci viewed under a light microscope. G. Ascospores viewed under a light
microscope. H. Ascospores viewed under a scanning electron microscope. I. Fusiform ascospores
with two apical germ pores (arrowed). J. Ascospore viewed under a scanning electron microscope.
Bars: A, B = 50 um; C, E-G = 10 um; D, H = 5 wm; I, J= 2 pm.
Chaetomium siamense sp. nov. (Thailand) ... 23
Figure 2. Comparison of the characteristics of Chaetomium cupreum (A-D) and C. siamense (E-
H). Bars: A, E = 50 um; B-D, F-H = 10 um.
1.3-4 um diam, 170 um longi. Pili laterals recti, leviter, verrucosi, paramariae ad 56-
160 um longi. Asci numerosis, fasciculati, clavati, pedicellati, 8-spori, 9-14 x 28-40 um.
Ascosporae fusiformia, fascobrunnneum, laevibus, 4.3-5 x 11.1-13.5 um, cum 2 poro
germinalibus apicali visibile.
Hototype: Thailand, Phatthalung, isolated from soil in a pineapple plantation, 27
September 2007, Chaninun Pornsuriya TMACCO01, deposited in herbarium of the
Biocontrol Research Unit and Mycology Section, King Mongkut’s Institute of Technology
Ladkrabang (KMITL), Bangkok 10520, Thailand.
ETYMOLOGY: siamense refers to Thailand (Siam), country of origin.
Colonies on PDA and CMA growing moderately slowly, covering 9 cm Petri
dish surface after 14 days at room temperature, with aerial mycelium; becoming
red due to red pigment exudates when young, yellow when old and formation
of ascomata. Mycelium composed of hyaline to subhyaline, septate, smooth
hyphae, 1.8-2.3 um diam. Ascomata discrete, maturing within 10-14 days,
superficial, globose or ovate, ostiolate, dark brown in reflected light, 87-148 x
107-177 um. Peridium dark brown, of textura angularis; outer layer composed
of brown, thick-walled cells measuring 2.8-5.7 x 5.1-10.4 um. Ascomatal hairs
abundant, unbranched, red or orange-red in reflected light, apically circinate
or coiled, regularly septate and forming a dense tuft around the ostiole, finely
verrucose towards the tip, up to 170 um long, 1.3-4 tm diam near the base.
Lateral hairs less abundant, straight, finely verrucose, 56-160 tm long. Asci
numerous, fasciculate, clavate, stalked, 8-spored, 9-14 x 28-40 um. Ascospores
fusiform, dark brown at maturity smooth and rather thick-walled, 4.3-5 x
11.1-13.5 um, with two apical germ pores.
24 ... Pornsuriya & al.
Chaetomium nigricolor EU543258
Chaetomium sp. EU750692
Chaetomium bostrychodes EU520130
os Lio fen funicola EU552109
Chaetomium funicola EU139246
‘6 Chaetomium murorum GQ376100
Chaetomium globosum FJ538594
Chaetomium sp. AJ620951
e is Chaetomium hispanicum DQ069021
Chaetomium sp. DQ093660
98 Chaetomium siamense sp. nov.
am [ Chaetomium cupreum AB509373
96 Chaetomium cupreum AB509370
Chaetomium cupreum AB509366
67. Chaetomium cupreum AB509367
Chaetomium cupreum AB509369
Chaetomium cupreum AB509371
Chaetomium cupreum AB511968
Chaetomium atrobrunneum FJ595483
59
Chaetomium longicolleum GQ922525
Chaetomium thermophilum GQ922527
Chaetomium pachypodioides GQ922526
10
Ficure 3. Phylogenetic tree of Chaetomium spp. from GenBank including Chaetomium siamense
constructed after distance-based analysis of ITS1 and 5.8S regions of rDNA. Numbers at the
branches indicate the percentage of bootstrap values after 1000 replications. The outgroup taxa are
Chaetomium nigricolor and Chaetomium sp.
COMMENTS: Chaetomium is a large ascomycete genus with species inhabiting
various cellulose-based substrates including paper and plant compost. After
review of the genus by von Arx et al. (1986) several new species have been
described: C. biporatum (Cano & Guarro 1987), C. histoplasmoides (Carris &
Glawe 1987), C. sinaiense (Moustafa & Ess El-Din 1989), C. subcurvisporum
Chaetomium siamense sp. nov. (Thailand) ... 25
O ©O OH
6 7 8
Figure 4. Compounds isolated from Chaetomium siamense. 1. chaetoviridin G; 2. ergosterol;
3. 24(R)-5a,8a-epidioxyergosta-6-22-diene-3B-ol; 4. ergosterylplamitate; 5. cochliodone D;
6. chaetoviridin A; 7. chaetoviridin F; 8. chrysophanol.
(Abdullah & Al-Bader 1989), C. myricicola (Horie & Udagawa 1990),
C. mesopotamicum (Abdullah & Zora 1993), C. novae-caledoniae (Udagawa
et al. 1994), C. floriforme (Gené & Guarro 1996), C. cuyabenoensis (Decock
& Hennebert 1997), C. umbratile (Udagawa et al. 1997), C. macrostiolatum,
C. olivicolor, C. tarraconense (Rodriguez et al. 2002) C. acropullum (Wang
& Zheng 2005a), and C. ampulliellum (Wang & Zheng 2005b). Chaetomium
siamense can be distinguished from other species by its superficial, spherical or
ovate ascomata with angular brown walls. Ascomatal hairs are red or orange-red
in reflected light, arcuate, apically circinate or coiled, septate and ascospores are
fusiform with two apical germ pores. The new species was initially identified
as C. cupreum L.M. Ames, which produces red pigment in agar medium and
which also produces superficial spherical or ovate ascomata (Fics. 2A,E) with a
peridium of angular brown-walled cells.
Ascomatal hairs are red, arcuate, apically circinate or coiled and septate
(Fics. 2B,F). However, ascospore morphology easily separates the new species
26 ... Pornsuriya & al.
from C. cupreum (Fics. 2H,D). The longer (11.1-13.5 um) fusiform ascospores
with two apical germ pores (Fic. 2H) of C. siamense clearly differ from the
shorter (7-10 tum) reniform ascospores with a single apical germ pore (Fic.
2D) that characterize C. cupreum. Although the phylogenetic analysis indicates
that C. siamense is related to C. cupreum, sequence differences (as shown by the
separate branch tips, Fic. 3) clearly support C. siamense as a distinct species.
Investigation of the secondary metabolites from crude extracts of dried
mycelial mats of C. siamense led to the isolation of a new compound named
chaetoviridin G (1). Seven other known compounds — ergosterol (2),
24(R)-5a,8a-epidioxyergosta-6-22-diene-3B-ol (3), ergosterylplamitate (4),
cochliodone D (5), chaetoviridin A (6), chaetoviridin F (7), and chrysophanol
(8) — were also identified. Structures were elucidated based on spectroscopic
evidence (IR, 'Hd NMR, and °C NMR and 2D-NMR). Compounds 2-8 (Fic. 4)
have also been reported from C. cochliodes (Phonkerd et al. 2008).
Acknowledgments
We are grateful to Drs Eric McKenzie and Chaiwat To-anun for kindly reviewing
the manuscript. The first author would like to acknowledge Sommart Pornsuriya for his
kind assistance in collecting soil samples.
Literature cited
Abdullah SK, Al-Bader SM. 1989. A new thermotolerant species of Chaetomium from Iraqi forest soil.
International Journal of Mycology and Lichenology 4: 83-92.
Abdullah SK, Zora SE. 1993. Chaetomium mesopotamicum, a new thermophilic species from Iraqi
soil. Cryptogamic Botany 3: 387-389.
Arx JA von, Guarro J, Figueras MJ. 1986. The Ascomycete genus Chaetomium. Beihefte zur Nova
Hedwigia 84: 1-162.
Cano J, Guarro J. 1987. Soil ascomycetes from Spain. XII. Chaetomium biporatum sp. nov. Nova
Hedwigia 44: 543-546.
Carris LM, Glawe DA. 1987. Chaetomium histoplasmoides, a new species isolated from cysts of
Heterodera glycines in Illinois. Mycotaxon 29: 383-391.
Decock C, Hennebert GL. 1997. A new species of Chaetomium from Ecuador. Mycological Research
101: 309-310. doi:10.1017/S0953756296002456
Gené J., Guarro J. 1996. A new Chaetomium from Thailand. Mycological Research 100: 1005-1009.
doi: 10.1016/S0953-7562(96)80055-4
Horie Y, Udagawa S. 1990. New or interesting Chaetomium species from herbal drugs. Transactions
of the Mycological Society of Japan 31: 249-258.
Moustafa AF, Ess El-Din EK. 1989. Chaetomium sinaiense sp. nov., a new soil ascomycete from
Egypt. Canadian Journal of Botany 67: 3417-3419. doi:10.1139/b89-416
Neuvéglise C, Brygoo Y, Vercambre B, Riba R. 1994. Comparative analysis of molecular and biological
characteristics of strains of Beauveria brongniartii isolated from insects. Mycological Research 98:
322-328. doi:10.1016/S0953-7562(09)80460-7
Phonkerd N, Kanokmedhakul S, Kanokmedhakul K, Soytong K, Prabpai S, Kongsaeree P. 2008. Bis-
spiro-Azaphilones and Azaphilones from the fungus Chaetomium cochliodes VTh01 and C. cochliodes
CTh05. Tetrahedron 64: 9636-9645. doi:10.1016/j.tet.2008.07.040
Chaetomium siamense sp. nov. (Thailand) ... 27
Pornsuriya C, Lin FC, Kanokmedhakul S, Soytong K. 2008. New record of Chaetomium species
isolated from soil under pineapple plantation in Thailand. Journal of Agricultural Technology 4:
91-103.
Rodriguez K, Stchigel A, Guarro J. 2002. Three new species of Chaetomium from soil. Mycologia
94: 116-126. doi:10.2307/3761851
Seth HK. 1970. A monograph of the genus Chaetomium. Nova Hedwigia 37: 1-133.
Soytong K, Quimio TH. 1989. A taxonomic study on the Philippine species of Chaetomium. The
Philippine Agriculturist 72: 59-72.
Swofford DL. 2001. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version
4.0b8. Sunderland : Sinauer Associates.
Udagawa S, Uchiyama S, Kamiya S. 1994. Two new species of pyrenomycetous Ascomycetes from New
Caledonia. Mycoscience 35: 319-325. doi:10.1007/BF02268501
Udagawa S, Toyazaki N, Yaguchi T. 1997. A new species of Chaetomium from house dust.
Mycoscience 38: 399-402. doi:10.1007/BF02461679
Wang XW, Zheng RY. 2005a. Chaetomium acropullum sp.nov. (Chaetomiaceae, Ascomycota), anew
psychrotolerant mesophillic species from China. Nova Hedwigia 80:413-417. doi:10.1127/0029-
5035/2005/0080-0413
Wang XW, Zheng RY. 2005b. Chaetomium ampulliellum sp.nov. (Chaetomiaceae, Ascomycota) and
similar species from China. Nova Hedwigia 81: 247-255. doi:10.1127/0029-5035/2005/0081-
0247
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 29-44 January-March 2011
DOT: 10.5248/115.29
New taxa and new reports of Phyllopsora
(lichenized Ascomycotina) from India
GAURAV K. MisHra’, DALIP K. UPRETI*, SANJEEVA NAYAKA! &
Byu HARIDAS?
‘Lichenology Laboratory, National Botanical Research Institute (NBRI-CSIR)
Rana Pratap Marg, Lucknow 226001, India
2Microfungi e& Lichens Unit, Tropical Botanic Garden and Research Institute
Palode, Thiruvananthapuram 695562, India
CORRESPONDENCE TO *:
[email protected]
AsstTracT— Anaccount of 14 species of Phyllopsora from India is provided. P. catervisorediata
and P himalayensis are described as new species, while P corallina var. subglaucella as a
new variety. P albicans, P. breviuscula, P. chlorophaea, P. confusa, P. isidiotyla, P. kalbii,
P. mauritiana, P. nemoralis, P. subcrustacea, and P. swinscowii are new records for the Indian
lichen biota.
Key worps— Ramalinaceae, Ascomycetes, squamulose, taxonomy
Introduction
The genus Phyllopsora is characterised by a crustose to squamulose thallus,
thin to thick, white to brown to reddish brown prothallus, minute to subfoliose
squamules which are corticated on upper side, green alga photobiont, convex,
biatorine apothecia with a hyaline to pale yellow epihymenium, hyaline to
reddish-brown exciple, hyaline to yellowish-brown hymenium, hyaline or
golden yellow to brownish hypothecium, simple to conglutinated paraphyses,
8-spored asci and hyaline, simple, ellipsoid, bacilliform to fusiform ascospore.
The species of Phyllopsora mostly inhabit bark but sometimes grow on rock and
bryophytes. The species exhibit wide ranges of altitudinal distribution from sea
level up to an height of 3000 m.
Phyllopsora (Ramalinaceae) is a common lichen genus in tropical and
subtropical areas of the world. Swinscow & Krog (1981) revised the East
African species of Phyllopsora and reported the occurrence of eleven species
from the region. Brako (1989, 1991) monographed the neotropical flora and
enumerated eighteen species and eight varieties. Timdal & Krog (2001) studied
30 ... Mishra & al.
the East African and Mascarene Phyllopsora species. Elix (2006a, b) recorded
five new species of Phyllopsora from Australia and for the first time Timdal
(2008) described sorediate Phyllopsora species from Peru.
Upreti et al. (2003) described five species of Phyllopsora from India. Later,
Awasthi (2007) updated the occurrence of six taxa of Phyllopsora from India,
where P. kiiensis (Vain.) Gotth. Schneid. was considered to be a synonym
of PB haemophaea (Nyl.) Mull. Arg. However, it is clear from our study and
according to Timdal & Krog (2001) that P. kiiensis is a distinct species, while
P. haemophaea is a synonym of P. furfuracea (Brako 1991). The known taxa of
Phyllopsora from India prior to the present communication include P. buettneri
(Mull. Arg.) Zahlbr., PB corallina (Eschw.) Mill. Arg., P furfuracea, P. kiiensis,
P. manipurensis (Mill. Arg.) Gotth. Schneid., P parvifolia (Pers.) Mull. Arg. var.
parvifolia, and P. parvifolia var. subgranulosa (Tuck.) Mull. Arg. The present
investigation adds further 13 taxa of Phyllopsora to the Indian lichen biota,
including two new species and one new variety. The description and illustration
of P furfuracea is also provided here for better understanding of the taxa.
Materials & methods
The present study is based on the lichen specimen preserved at the herbarium of
the National Botanical Research Institute, Lucknow (LWG), which also includes the
personal herbarium of Dr. Awasthi (LWG-AWAS). The specimens were examined
morphologically, anatomically, and chemically. Thin hand-cut sections of apothecia and
thallus were mounted in plain water, cotton blue and 5% KOH and observed under
a compound microscope. For chemical spot tests the usual reagents of K, C and P
were used. TLC was performed in solvent system A, following Walker & James (1980).
Swinscow & Krog (1981) was followed for the terminology of cortex types.
Key to the Indian Phyllopsora taxa
1. Thallus isidiate or sorediate..... 0... cece cnet n een e ee 2
Late” Dallas otherwise. sccm wteet scene: choy hetnstime doa eating W dhaet aati atime sie eta 5 11
2; Thallus:sorediate ... 222 ye sus peel VR oe HE PR pee P. catervisorediata
Dar. halls isidiates’ 5163 tins 4 a hikgad eaten tea bss PRS Aa Me aba durd Seth das 3
3. Isidia mostly globular. ....... 0.0. cece nee e nas 4
3a. Isidiamosthycylindrical. . 0. .ccce ced tie ed een ed tee ced wale e tied nae ne 5
4. Thallus greenish, upper cortex type 2; apothecia brown to black, K-.... P. kalbii
4a. Thallus yellowish, upper cortex type 1-2; apothecia dark brown, K+ yellow
Jie, Shai BY SAE Tei nd Te Aap nee te os P. himalayensis
5. Squamules 0.3-1.5 mm wide .... 0.0... ccc cece nee nee 6
5a. Squamules 0.1-0.3 mm Wide. ...... 0.0... cece cece ence een ee eae 8
6. Thallus containing methyl 2,7-dichloropsoromate and methyl 2,7-dichloronor-
PSOLOMIALE 8 ees oe cae ee ee es ane Becton ee EY ed Reng ates te DE P. swinscowti
19.
19a.
Phyllospora in India... 31
Thallus chemistry otherwise. 0.0.0.0... 00. c ec cecceee eee ence n eens 7
Thallus containing furfuraceic acid .... 2... eee eee P. kiiensis
Thallus lacking furfuraceic acid ..............0...000,4 P. corallina vay. corallina
Thallus K-, containing furfuraceic acid......... 0... P. furfuracea
Thallus K+ yellow, lacking furfuraceic acid ..... 0.0... cece eee eee 9
Isidia mostly bulbate at the base, thick; apothecia brown
Sete nS A PS Oe eee tae P. corallina var. subglaucella
Isidia simple or coralloid, common to abundant; apothecia brown to black... 10
Isidia thick, irregular shaped; upper cortex thin, gelatinous ......... P isidiotyla
Isidia thin, short; upper cortex type 1-2............... 02 eee eee P. nemoralis
Squamules 0.1-0.3 mm Wide. 0.0.0... cece ene eee n eens 12
. Squamules 0.3-1.5 mm Wide. ..... 0... cece eee en een ees 16
Prothallus reddish brown to black; squamules ascending ........ P. chlorophaea
Prothallus white or red; squamules adnate to ascending ................... 13
Prothallus red; hypothecium colourless ......... P. parvifolia var. subgranulosa
Prothallus white; hypothecium yellowish to reddish brown ................ 14
Squamules yellowish to greenish; hypothecium dark brown ..... P. manipurensis
. Squamules greenish; hypothecium golden yellow to reddish brown ......... 15
Ascospores 11-18 x 2-3 um; apothecia with fibrillose margin... P subcrustacea
. Ascospores 8-11 x 1-2 um; apothecia glabrous margin.............. P. confusa
Thallus:PD+orangesred Seika. 142 8R hs a Aiwa ab Abd 17
roi avsV Nuch 218 os Say Rien kon, Here Ronee meee AAD, ere RS ih A cI RV Som BY fo 18
Squamules mostly pruinose, strongly pubescent, not imbricate ...... P. buettneri
. Squamules not pruinose, rarely pubescent, imbricate................ P. albicans
Squamules mostly ascending, upper side yellowish brown,
pubescent at margin .......... 0... cece eee eee eee P. parvifolia var. parvifolia
. Squamules adnate to ascending, upper side greenish, margin occasionally
pubescent Shs ee shee he Raue og teh eed BM Mel ee tei lene, hat aco, Polis gate 2 as 19
Squamules closely adnate, overlapping; hypothecium colourless to pale brown
cies He set ght Bt ged 5 ME gar A eG cee LB gl ME od a P. mauritiana
Squamules ascending; hypothecium golden yellow to brown ........ P. buettneri
The species
Phyllopsora albicans Mill. Arg., Bull. Soc. R. Bot. Belg. 32: 132 (1893). Fic. 1
Prothallus thin to thick, reddish brown. Thallus squamulose, ascending, mainly
imbricate, elongate, incised to deeply divided, 0.3-1.0 mm wide; upper surface
glabrous to slightly pubescent, pale green to dark green, plane to convex, margin
pubescent. Isidia absent. Cortex 1-2 type, 12-20 tm thick; medulla containing
crystals, dissolving in K.
32 ... Mishra & al.
Apothecia rare, up to 1.5 mm diam.; disc plane to convex, reddish brown;
margin raised. Exciple reddish-brown; epihymenium hyaline; hymenium
colourless to pale yellow; hypothecium golden yellow and containing crystals
which dissolve in K. Ascospores hyaline, simple to narrowly ellipsoidal to
bacilliform, 6-10 x 1-2 um. Pycnidia not seen.
CHEMISTRY — ‘Thallus K-, C-, KC-, PD+ yellow orange; argopsin and pannarin
in TLC.
SPECIMENS EXAMINED — INDIA: Arunachal Pradesh, Upper SIANG DISTRICT, Jengging,
Apanavan area, alt. 1014 m, on bark, 18.11.2008, D.K. Upreti, U. Dubey, R. Khare & G.
Mishra 08-009322 (LWG), West SIANG DiIsTRICT, Eyi village, on bark, 17.10.2007, U.
Dubey s.n. (LWG), Kerala, PALGHaT DiIsTRICcT, Silent Valley National Park, on Mesua
ferea bark, 24.11.2006, B. Haridas 06-014751 (LWG).
Remarks — Phyllopsora albicans is distinguished by the elongated, often
imbricate squamules. It is close to P. buettneri in having a PD+ orange reaction
(pannarin or related compounds), but the later species differs in having pruinose,
strongly pubescent squamules containing additionally zeorin. P. albicans was
earlier reported from the montane habitats of Africa, Costa Rica, Philippines
and Taiwan, between altitudes of 540-2000 m (Swinscow & Krog 1981, Timdal
& Krog 2001). In India, the species is distributed in tropical to subtemperate
areas in the state of Arunachal Pradesh and Kerala between altitudes 500-1500
m. It is a new record for the country.
Phyllopsora breviuscula (Nyl.) Mill. Arg., Bull. Herb. Boissier 2(App. 1):
45 (1894). Fic. 2
= Lecidea breviuscula Nyl., Annls Sci. nat., Bot., ser. 4, 19: 339 (1863).
Prothallus thick and reddish brown. Thallus squamulose; squamules adnate,
ascending to elongate, crenulate to incised 0.3-1.0 mm wide; upper surface
glabrous, pale green to green, plane to convex, sometime fibrillose at the
margin. Isidia absent. Cortex 2 type, 20-35 um thick; medulla containing
crystals dissolving in K.
Apothecia common, up to 1.5 mm in diam.; disc plane to convex, reddish-
brown; margin slightly raised and glabrous; exciple pale brown; epihymenium
hyaline to pale yellow; hymenium hyaline; hypothecium reddish brown,
containing crystals which dissolve in K. Ascospores hyaline, simple to fusiform,
6-11 x 2-3.5 um. Pycnidia not seen.
CHEMISTRY — Thallus K-, C-, KC-, PD-; no lichen substance in TLC.
SPECIMENS EXAMINED — INDIA: Karnataka, CHIKMAGALURE DISTRICT, Chamudi Ghat,
Kuvettu, alt. 104 m, on bark of trees in evergreen forest, 15.01.2008, H.T. Lumbsch, D.K.
Upreti & P.K. Divakar 19740/B (LWG).
Remarks — Phyllopsora breviuscula is distinguished by the large, partly
imbricate squamules and the reddish brown hypothecium. The Indian specimen
Phyllospora in India ... 33
contains crystals in medulla and hypothecium, but no lichen substances were
detectedin TLC. It is close to B parvifolia in having large squamules and reddish
brown prothallus but the latter species differs in forming more plane squamules
with phyllidia on the lobe margins in the inner part of the thallus. P breviuscula
was earlier known from Cuba, Mauritius, and La Réunion between altitudes
of 300-1390 m (Timdal & Krog 2001). In India, the species is collected from
tropical areas of Karnataka in western Ghat between altitudes of 100-500 m,
and is a new species from the country.
Phyllopsora catervisorediata G.K. Mishra, Upreti & Nayaka, sp. nov. FIG. 3
Mycosank MB 518498
Thallus squamulosus; squamulae ascendentes, elongatae, luteo-virescentes, sorediatae.
Apothecia ignota.
Ho otyre — Inp1a: Uttarakhand, BAGESHWAR DISTRICT, enroute to Pindari glacier,
from Dwali to Khati, alt. 2734-3210 m, on bark, 13.05.2007, S. Joshi & Y. Joshi 07-
008932 (LWG).
EryMo.ocy: From the latin noun caterva (= group or heap), referring to the appearance
of the soredia.
Prothallus indistinct. Thallus squamulose, closely adnate, rounded to elongate,
sometimes ascending, 0.1-0.5 mm wide; upper surface glabrous, pale green to
yellowish, plane to convex, epruinose, sorediate. Soredia farinose, developing
from the margin of squamules, forming heaps. Cortex of type 2, 5-10 tm thick;
medulla containing crystals dissolving in K.
Apothecia and pycnidia not seen.
CHEMISTRY — ‘Thallus K+ yellow, C-, KC-, PD-; atranorin in TLC.
Remarks — Phyllopsora catervisorediata is characterized by the marginally
sorediate squamules and the indistinct prothallus. The soredia forms heaps
on the margin of the squamules. It is close to P soralifera Timdal, in having
sorediate squamules and cortex of type 2, but the latter species differs in having
capitate soredia and in lacking lichen substances. P. catervisorediata is known
from its type locality in the Western Himalayas, where it was found growing on
bark of tree in moist and humid forest at an altitude of 2730 m.
Phyllopsora chlorophaea (Mull. Arg.) Zahlbr., Denkschr. Akad. Wiss. Wien 83: 133
(1909). Fic. 4
= Psora chlorophaea Mill. Arg., Flora 70: 320 (1887).
Prothallus reddish brown to black. Thallus squamulose, ascending, overlapping,
elongate, minute 0.1-0.3 mm wide; upper surface glabrous above, pale brown,
plane to convex, sometime fibrillose at the margin. Isidia absent. Cortex of type
1-2, 5-10 um thick; medulla containing crystals that dissolve in K.
Apothecia and pycnidia not seen.
34 ... Mishra & al.
CHEMISTRY — Thallus K-, C-, KC-, PD-; + atranorin in TLC.
SPECIMENS EXAMINED — INDIA: Karnataka, SHimoGa D1sTRICcT, Sharavati Ghat, near
Gersoppa, alt. 718 m, in evergreen forest, on bark, 16.01.2008, H.T. Lumbsch, D.K. Upreti
& PK. Divakar 19744Q (LWG), Orissa, GANJAM DisTRICT, foothills of Mahendragiri,
Burukhat area, on bark, 04.03.1986, D.D. Awasthi, G. Awasthi, R. Mathur & P. Srivastava
86-184 (LWG-AWAS).
Remarks — Phyllopsora chlorophaea is distinguished by minute, lacinulate
squamules and reddish brown prothallus. It is close to BP mediocris Swinscow
& Krog in having reddish-brown prothallus and in cortex type, but the latter
species differs in having medium sized, 0.3-1.0 mm wide squamules and in
lacking lichen substances. P. chlorophaea is a pantropical species earlier reported
from montane rainforest and humid woodland in Kenya, Peru, Mauritius,
Tanzania, between altitudes of 600-1600 m (Broko 1991, Swinscow & Krog
1981, Timdal & Krog 2001, Timdal 2008). In India, the species is recorded from
tropical to subtemperate areas in the states of Karnataka and Orissa, between
altitudes of 200-800 m. It is a new to India.
Phyllopsora confusa Swinscow & Krog, Lichenologist 13: 229 (1981). Fi. 5
Prothallus white to reddish brown. Thallus squamulose, adnate to ascending,
overlapping, minute, 0.1-0.3 mm wide; upper surface glabrous, pale to green,
plane to convex, finely pubescent along the margin. Isidia absent. Cortex of
type 2, 10-20 um thick; medulla containing crystals dissolving in K.
Apothecia common, up to 1.0 mm in diam., disc plane to convex, reddish-
brown, margin slightly raised and glabrous; exciple colourless to pale brown;
epihymenium hyaline; hymenium colourless; hypothecium reddish brown,
containing crystals which dissolve in K. Ascospores hyaline, simple, narrowly
ellipsoid, 8-11 x 2-3 um. Pycnidia not seen.
CHEMISTRY — Thallus K-, C-, KC-, PD-; no lichen substance in TLC.
SPECIMENS EXAMINED — INDIA: Assam, NorRTH CACHAR HILLS DIsTRICT, Mahur
area, on bark, 01.08.2005, D.K. Upreti & J. Rout 05-002958 (LWG), Himachal Pradesh,
KANGRA DISTRICT, Macleodganj, alt. 1600-1800 m, on Quercus leucotrichophora bark,
13.05.2001, D.K. Upreti & S. Nayaka 01-75209 (LWG), Karnataka, SHIMOGA DISTRICT,
Sagara, Holebagilu, alt. 623 m, on bark of Knema attenuata, 16.03.2001, S. Nayaka 01-
022794 (LWG); Homnemardu Island, alt. 621 m, on bark of Olea dioica, 19.03.2001,
S. Nayaka 01-66143 (LWG); Muppane, alt. 626 m, on bark of Memecylon terminale
bark, 21.03.2001, S. Nayaka 01-66193, 01-66169 (LWG); Negiloni, alt. 710 m, on bark,
18.03.2001, S. Nayaka 01-107249 (LWG); 3km before Agumbe Ghat from Koppa, alt.
649 m, on evergreen forest, on bark, 14.01.2008, H.T. Lumbsch, D.K. Upreti & PK.
Divakar 1973/G (LWG); Kerala, ERNAKULAM DISTRICT, BS Thattekkad, alt. 430 m, on
bark, 21.12.2006, B. Haridas 06-009600 (LWG); PALGHAT DIsTRICT, Parambikulam
Wildlife Sanctuary, alt. 610 m, on bark, 14.11.2006, B. Haridas 06-009823, 06-015954
(LWG); M.C.L. Mine area Walayar forest, alt. 300 m, on bark, 22.03.1985, D.D. Awasthi,
R. Tiwari & R. Mathur 85.21 (LWG); SIRUVANI DISTRICT, alt. 810 m, on bark, 16.11.2006,
Phyllospora in India ... 35
Pee ARS a4
Ficures 1-8. Habit. 1. Phyllopsora albicans; 2. P. breviuscula; 3. P. catervisorediata (holotype);
4. P. chlorophaea; 5. P. confusa; 6. P. corallina var. subglaucella; 7. P. furfuracea; 8. P. himalayensis.
Bar = 2mm
36 ... Mishra & al.
B. Haridas 06-009599 (LWG); TRIVENDRUM DIsTRICT, ABP, Athirumala, Pathalamathy,
alt. 1250 m, on bark, 25.04.2006, B. Haridas 06-009602 (LWG); Uttarakhand, Paurt
DISTRICT, Pauri Kandoliya, on bark of Cedrus deodara, 19.06.2005, V. Shukla & Y. Joshi
s.n. (LWG).
Remarks — ‘The most characteristic features of P confusa are the minute,
ascending squamules and the absence of lichen substances. It is close to
P. isidiotyla in having reddish-brown prothallus and minute squamules but
the latter species differs in having longer ascospores and fibrillose apothecia.
Phyllopsora confusa is a pantropical species earlier reported from montane
rainforest and humid woodland in Kenya, La Réunion, Mauritius, and Tanzania
between altitudes of 130-2000 m (Brako 1991, Swinscow & Krog 1981, Timdal
& Krog 2001). In India, the species is recorded from tropical to temperate areas
in the states of Assam, Himachal Pradesh, Karnataka, Kerala, and Uttarakhand
and occurs between altitudes of 300-1800 m. It is new to India.
Phyllopsora corallina var. subglaucella G.K. Mishra, Upreti & Nayaka, var. nov.
MycoBank MB 518499 FIG. 6
Thallus squamulosus; squamulae ascendentes, elongatae, luteo-virescentes. Apothecia
convexa, badio-fusca. Ascosporae ellipsoideae.
Hototypre — Inpia: Uttarakhand, PITHORAGARH DISTRICT, on way to Thalkedar
Temple, alt. 1900-2400 m, on bark, 27.06.1983, D.K. Upreti 212878 (LWG).
EryMo.oey: From the similarity to var. glaucella.
Prothallus thin, white to reddish. Thallus squamulose, closely adnate, rounded
to elongate, sometimes ascending, 0.1-0.3 mm wide; upper surface glabrous,
pale green to yellowish, plane to convex, sometimes fibrillose at the margin,
isidiate. Isidia cylindrical, thick, commonly bulbate at the base. Cortex of type
1-2, 5-8 wm thick; medulla containing crystals dissolving in K.
Apothecia common, up to 1.5 mm in diam.; disc plane to convex, brown;
margin slightly raised. Exciple colourless; epihymenium hyaline; hymenium
colourless; hypothecium colourless to pale brown. Ascospores hyaline, narrowly
ellipsoid, 4-8 x 1-2 um. Pycnidia common, yellow to brown, immersed in
thallus; conidia rod-shaped, straight 6-15 x 1-2 um.
CHEMISTRY — Thallus K+ yellow, C-, KC-, PD-; atranorin in TLC.
Remarks — Phyllopsora corallina var. subglauceila is distinguished by the
cylindrical to bulbate base of the isidia, cortex type 1-2 and presence of
atranorin. It is close to the neotropical P. corallina var. glauceila (Vain.) Brako
in having bulbate isidia, but the latter variety differs in having a cortex of type 2
and in containing different lichen substances, mainly vicanicin (Brako 1991).
‘This species is known from its type locality in the Western Himalayas, where
it was found growing on bark of Quercus leucotrichophora and Cedrus deodara
in moist and humid forest between altitudes of 1900-2500 m.
Phyllospora in India ... 37
ADDITIONAL SPECIMENS EXAMINED — INDIA: Uttarakhand, BAGESHWAR DISTRICT,
Dhakuri to Khati (en route to Pindari), alt. 2590 m, on bark, 20.05.1950, D.D. Awasthi
& A.M. Awasthi 683, 676, 767 (LWG-AWAS); Loharkhet, Pindari Glacier, alt. 1760 m,
on bark, 09.05.2007, S. Joshi & Y. Joshi 07-010710 (LWG); PITHORAGARH DISTRICT,
Chandak Forest, alt. 1550 m, on Quercus leucotrichophora, May 2006, S. Bhatt, 06-
009206, 06-010866 (LWG); Gangoli Hat, Hoat Kali Sacred Grove, on Cedrus deodara, H.
Singh s.n. (LWG); Gori-ganga catchment, East Ghandhura, alt. 1600-2000 m, on bark,
03.10.2002, V. Pant 02000876, 02000880 (LWG); Narain Nagar, alt. 1500 m, on bark,
11.05.1977, O.P. Arora s.n. (LWG); Thakala Forest, alt. 1800m, on bark, 29.10.2002, V.
Pant 02000673 (LWG).
Phyllopsora furfuracea (Pers.) Zahlbr., in Engler & Prantl, Nat. Pflanzenfam. 1(1*):
138 (1905). Fic. 7
= Lecidea furfuracea Pers., in Gaudichaud, Voy. Uran.: 192 (1827).
Prothallus well developed, thin, white. Thallus squamulose; squamules closely
adnate, isodiametric, minute, 0.1-0.3 mm wide; upper surface glabrous,
yellow green to green, rarely pubescent at margin, isidiate. Isidia common,
simple, cylindrical, glabrous, rarely branching, sometimes arising directly
from prothallus. Cortex of type 2, 7-10 wm thick; medulla containing crystals
dissolving in K.
Apothecia common, up to 0.5-1.0 mm in diam.; disc plane to convex, brown,
sometimes fibrillose at base; margin indistinct, paler than the disc. Exciple
colourless to pale brown; epihymenium hyaline; hymenium and hypothecium
pale brown throughout, the latter containing crystals which dissolve in K.
Ascospores hyaline, simple, narrowly ellipsoidal, 5-6(-7) x 2-3 tum. Pycnidia
not seen.
CHEMISTRY — Thallus K-, C-, KC-, PD-; furfuraceic acid in TLC.
SPECIMENS EXAMINED — INDIA: Kerala, PALGHAT DISTRICT, Parambikullam, Wildlife
Sanctuary, alt. 450 m, on bark, 14.11.2006, B. Haridas, 06-009609 (LWG); Thirssur,
Sholayar Range, Mukkanipara, alt. 450 m, on bark, 28.10.2006, B. Hridas 06-009609
(LWG); Uttarakhand, Pauri District, Srinagar, Dhari Devi Temple, on Mangifera
indica, 26.06.2005, V. Shukla & Y. Joshi 05-005278 (LWG); Khirshu, on Quercus,
18.06.2005, V. Shukla & Y. Joshi 05-005103 (LWG); PITHORAGARH DISTRICT, Chandak
Forest, alt. 1550m, on Quercus leucotrichophora, May 2006, S. Bhatt, 06-010888 (LWG);
Ginni band, on bark, 30.10.2009, D.K. Upreti, S. Joshi, H. Rai, R. Khare, G.K. Mishra
& A. Dwivedi 09-012601 (LWG); Munsiyari, Khuliya Top, alt. 2700-3000 m, on bark,
31.10.2009, D.K. Upreti, S. Joshi, H. Rai, R. Khare, G.K. Mishra & A. Dwivedi 09-012602
(LWG).
Remarks — Phyllopsora furfuracea is characterized by minute squamules and
isidia directly attached to the prothallus. It is close to P. nemoralis in having
usually white prothallus and minute squamules but the latter species differs in
having smaller isidia and containing argopsin and atranorin. Two other species
P. dolichospora Timdal & Krog and PB furfuracea, are close to P. furfuracea in
chemistry but they are morphologically different.
38 ... Mishra & al.
The species is a pantropical species earlier reported from montane rainforest
and humid woodland of Australia, Belize, Brazil, Colombia Cuba, Cuzco,
Dominican Republic, East Africa, Ethiopia, Ecuador, French Guiana, Ivory
Coast, Jamaica, Java, Kenya, La Réunion, Loreto, Madagascar, Mexico, Peru,
Tanzania, United States, and Venezuela from sea level to an altitude of 2400 m
(Brako 1991, Swinscow & Krog 1981, Timdal & Krog 2001, Timdal 2008). It is
anew record for the Indian mycota and reported from the states of Kerala and
Uttarakhand between altitudes of 300-2500 m.
Phyllopsora himalayensis G.K. Mishra, Upreti & Nayaka, sp. nov. Fic. 8
MycosBank MB 518500
Thallus squamulosus; squamulae ascendentes, elongatae, luteo-virescentes. Apothecia
convexa, badio-fuscescentia. Ascosporae ellipsoideae vel fusiformes.
Ho.orypus - Inp1a: Himachal Pradesh, KuLLu District, Great Himalayan National
Park, Shilt, alt. 2800 m, on bark, 04.11.2002, S. Nayaka & R. Srivastava 02-001037
(LWG).
EryMo.ocy: From the Himalayas, the type locality.
Prothallus thin, white. Thallus squamulose; squamules closely adnate, rounded
to elongate, ascending to overlapping, crenulate to incised, 0.1-0.5 mm wide;
upper surface glabrous, pale green to yellow, plane to convex, pubescent along
the margin, isidiate. Isidia mostly globular. Cortex of type 1-2, 7-10 um thick,
with scattered crystal dissolving in K; medulla containing crystals dissolving
in K,
Apothecia common, up to 2.0 mm in diam.; disc plane to convex, brown
to dark brown; margin raised. Exciple colourless; epihymenium hyaline to
pale yellow; hymenium colourless; hypothecium colourless to pale yellow,
containing crystals which dissolve in K. Ascospores hyaline, simple, narrowly
ellipsoid to fusiform, 5-10 x 1-2.5 um. Pycnidia common, orange to brown,
immersed in the thallus; conidia rod-shaped, straight, 6-12 x 1-1.5 um.
CHEMISTRY — Thallus K+ yellow, C-, KC-, PD-; atranorin in TLC.
ADDITIONAL SPECIMENS EXAMINED — INDIA: Himachal Pradesh, KULLU DISTRICT,
Great Himalayan National Park, Shilt, alt. 2800 m, on bark, 04.11.2002, S. Nayaka &
R. Srivastava, 02-001152, 02-001113, 02-001077 (LWG); Pardi, alt. 3140 m, on bark,
05.11.2002, S. Nayaka & R. Srivastava, 02-001244 (LWG); Uttarakhand, BAGESHWAR
pisTRict, Dhakuri to Khati, en route to Pindari Glacier, alt. 2210-2734 m, on bark,
20.05.1950, D.D. Awasthi & A.M. Awasthi, 683 (LWG-AWAS); 12.05.2007, S. Joshi & Y.
Joshi, 07-008931 (LWG); Tehri Garhwal, above Jamnotri, alt. 3657 m, on bark of Quercus
tree, 22.06.1951, D.D. Awasthi 904 (LWG-AWAS).
Remarks — Phyllopsora himalayensis is distinguished by the rounded to
elongate, convex, pale green to yellow squamules, the globular isidia, and the
colourless to pale yellow hypothecium. The new species is close to P. kalbii in
Phyllospora in India ... 39
having globular isidia and dark brown apothecia, but P himalayensis differs in
having a cortex of type 2 and in lacking lichen substances.
Phyllopsora himalayensis occurs in temperate areas of the Himalayas in
Himachal Pradesh and Uttarakhand between alt. 1500-3140 m. It grows on
rough bark trees in moist and humid forests.
Phyllopsora isidiotyla (Vain.) Riddle, Mycologia 15: 81. (1923). Fic. 9
= Lecidia isidiotyla Vain., Etud. Lich. Bresil 2: 49 (1890).
Prothallus thick pale brown. Thallus squamulose; squamules adnate, granular
to elongate, minute, 0.1-0.3 mm wide; upper surface glabrous, yellowish-green,
fibrillose at the margin, isidiate. Isidia abundant, thick, cylindrical, rarely
branched. Cortex thin, gelatinous, to 5 um thick; medulla containing crystals
dissolving in K.
Apothecia common, up to 1.0 mm in diam.; disc plane to convex, yellow-
brown to brown; margin raised. Exciple pale yellow; epihymenium hyaline
to pale yellow; hymenium golden yellow; hypothecium pale yellow-brown,
containing crystals which dissolve in K. Ascospores hyaline, simple, ellipsoid
to fusform, 6-11 x 1-2 um. Pycnidia not seen.
CHEMISTRY — Thallus K+ yellow, C-, KC-, PD-; atranorin in TLC.
SPECIMENS EXAMINED — INDIA: Assam, NorTH CACHAR HILLs pisTrIctT, Haflong, on
bark, 01.08.2005, D.K. Upreti & J. Rout 05-002963 (LWG); Bihar, PACHIM CHAMPARAN
pisTRicT, Don Hills, Devatapatta, on bark, 20.02.1995, D.K. Upreti & J. Tandon 213288
(LWG); Himachal Pradesh, CHamBa DIsTRICT, in and around Khajiar, alt. 2000 m,
on bark, 15.05.2001, D.K. Upreti & S. Nayaka 01-75441 (LWG); Karnataka, SHIMOGA
DISTRICT, Sagara, Moolagadde, alt. 600 m, on bark of Calycopetris floribunda, 22.3.2001,
S. Nayaka 01-104966 (LWG); Kerala, PALGHAT DISTRICT, Sailent valley National Park,
alt. 810 m, on bark, 16.11.2006, B. Haridas, 06-007945 (LWG); Sikkim, SouTH SIKKIM
DISTRICT, 20 km before Temi tea, state, alt. 1500 m, on bark, 31.03.2001, D.K. Upreti
& S. Chatterjee 01-26673 (LWG); SouTH SIKKIM DisTRIcT, Narnchi 15 km towards
Jagthang, alt. 1000 m, on bark, May 2006, D.K. Upreti & S. Chatterjee 219565 (LWG);
Tamil Nadu, PaALN1 HILLs, Perumal to Palni road side, via short cut road, alt 1524 m,
on bark, 15.12.1970, K. P. Singh 70.951 (LWG-AWAS); Uttarakhand, Pauri DISTRICT,
near Kiyonkaleshwar Temple, on Pinus, 19.06.2005, V. Shukla & Y. Joshi 05-005449,
05-005443 (LWG); PITHORAGARH DISTRICT, Chandak Forest, alt. 1500 m, on Quercus
leucotrichophora, May 2006, S. Bhatt 06-001088/B (LWG); Gori-ganga catchment,
Thakala forest, alt. 1400 m, on bark of Madhuca longifolia, 29.10.2002, V. Pant 02000616
(LWG); Saurlekh forest area, Near Microwave Station, alt. 2700 m, on bark, 30.09.1990,
D.K. Upreti & G.N. Hariharan 202253 (LWG); on way to Thalkedar temple, alt. 1900-
2400 m, on bark, 27.06.1993, D.K. Upreti 212849/B (LWG).
Remarks — Phyllopsora isidiotyla is distinguished by abundant isidia and
granular squamules. It is close to P furfuracea in having minute squamules and
thick isidia, but the latter species contains furfuraceic acid.
The species is earlier reported from Brazil, Costa Rica, Venezuela, and
United States, from sea level to an altitude of 3000 m (Brako 1991). In India
AQ ... Mishra & al.
it is known from tropical to temperate areas in the states of Assam, Himachal
Pradesh, Karnataka, Kerala, Sikkim, Tamil Nadu, and Uttarakhand, between
altitudes of 600-2700 m. It is new to the Indian lichen biota.
Phyllopsora kalbii Brako, Flora Neotropica Monograph 55: 51 (1991). Fic. 10
Prothallus thin, white to pale brown. Thallus squamulose; squamules closely
adnate to overlapping, crenulate to incised, 0.1-0.3 mm wide; upper surface
glabrous, pale green, convex, pubescent along the margin, isidiate. Isidia
mostly globular. Cortex of type 2, 5-17 um thick; medulla containing crystals
dissolving in K.
Apothecia common, up to 2.0 mm in diam.; disc plane to convex, brown to
black; margin raised. Exciple pale brown; epihymenium hyaline; hymenium
pale yellow; hypothecium colourless to pale yellow-brown, containing crystals
which dissolve in K. Ascospores hyaline, simple, narrowly ellipsoid to fusiform,
5-12 x 2-3 um. Pycnidia yellowish; conidia straight, 4-6 x 1 um.
CHEMISTRY — Thallus K-, C-, KC-, PD-; no lichen substance in TLC.
SPECIMENS EXAMINED — INDIA: Madhya Pradesh, Dinpori District, 13 km, before
Kabir from Chauradader, alt. 640 m, on Shorea robusta tree trunk, 06.07.2005, D.K.
Upreti, S. Nayaka & Satya 05-005704 (LWG); Around Jagatpur Forest Rest House, alt.
640 m, on Shorea robusta tree trunk, 05.07.2005, D.K. Upreti, S. Nayaka & Satya 05-
005578 (LWG); Tarwartola near to Chauradeder, alt. 640 m, on Shorea robusta tree
trunk, 06.07.2005, D.K. Upreti, S. Nayaka & Satya 05-005662, 05-005882/B (LWG).
Remarks — Phyllopsora kalbii is distinguished by the globular isidia, mostly
rounded, convex squamules, and brown to black apothecia. It is close to
P. corallina var. santensis (Tuck.) Brako in having globular to cylindrical isidia
and dark brown apothecia, but the latter taxon differs in chemistry (mainly
argopsin).
The species is a pantropical species earlier reported from Brazil, Dominican
Republic, Kenya, Tanzania, and United States between altitudes of 300-2400
m (Brako 1991). In India, P. kalbii is known from tropical areas in the state of
Madhya Pradesh, between altitudes of 300-650 m. It is new to the Indian lichen
biota.
Phyllopsora mauritiana (Taylor) Gotth. Schneid., Biblioth. Lichenol. 13: 177 (1980,
1979’). Fic. 11
= Lecidea mauritiana Taylor, London J. Bot. 6: 151 (1847).
Prothallus thick, reddish-brown. Thallus squamulose; squamules closely adnate,
overlapping, mostly isodiametric, 0.3-1.0 mm wide; upper surface glabrous,
green, plane to convex, fibrillose at the margin. Isidia absent. Cortex of type 2,
8-20 um thick; medulla containing crystals dissolving in K.
Apothecia common, up to 1.0 mm in diam.; disc plane to convex, pale brown
Phyllospora in India... 41
Ficures 9-14. Habit. 9. Phyllopsora isidiotyla; 10. P kalbii; 11. PB. mauritiana; 12. P. nemoralis;
13. P. subcrustacea; 14. P. swinscowii. Bar = 2 mm
to brown; margin slightly raised and sometimes fibrillose. Exciple colourless to
brown; epihymenium hyaline; hymenium hyaline to yellowish; hypothecium
golden yellow, containing crystals which dissolve in K. Ascospores hyaline,
simple, bacilliform, narrowly ellipsoid to fusiform, 6-9 x 1-2 um. Pycnidia
yellowish; conidia straight, 4-8 x 1 um.
CHEMISTRY — Thallus K-, C-, KC-, PD-; no lichen substances in TLC.
SPECIMENS EXAMINED — INDIA: Kerala, PALGHAT DISTRICT, Siruvani, alt. 810 m, on
bark, 16.11.2006, B. Haridas 06-009686, 06-009824 (LWG); Tamil Nadu, PALNI HILLs,
Kodaikanal road, on way to Gumparai, alt. 914 m, on bark, 23.12.1970, K.P. Singh
70.1268 (LWG-AWAS); Shola near 18" mile of Kodaikanal road, alt. 1066 m, G. Foreau,
S.J. 4141 (LWG-AWAS).
42 ... Mishra & al.
Remarks — The most characteristic feature of P. mauritiana is large, adnate,
mostly isodiametric squamules, and golden yellow hypothecium. It is close to
P. breviuscula in squamule and prothallus characters, but the later species forms
thicker, elongated lobes.
Phyllopsora mauritiana was earlier reported from humid submontane forest
in Tanzania and Mauritius between altitudes of 600-1500 m (Timdal & Krog
2001). In India it is recorded from tropical to temperate areas in the state of
Kerala and Tamil Nadu between altitudes of 800-1066 m. It is a new species
for the country.
Phyllopsora nemoralis Timdal & Krog, Mycotaxon. 77: 85 (2001). Fig. 12
Prothallus thin, reddish brown. Thallus squamulose; squamules adnate,
granular to elongate, minute, 0.1-0.3 mm wide; upper surface glabrous, green,
fibrillose at the margin, isidiate. Isidia abundant, thin, short, cylindrical, rarely
branched. Cortex of type 1-2, 10-15 um thick; medulla containing crystals
dissolving in K.
Apothecia common, up to 2.0 mm in diam; disc plane to convex, dark brown
to black; margin raised. Exciple colourless; epihymenium hyaline; hymenium
colourless; hypothecium pale brown, containing crystals which dissolve in K.
Ascospores hyaline, simple, ellipsoid to fusform, 6-11 x 1-2 um. Pycnidia not
seen.
CHEMISTRY — ‘Thallus K+ yellow, C-, KC-, PD-; containing + argopsin and
atranorin in TLC.
SPECIMENS EXAMINED — INpIA: Assam, NORTH CACHAR HILLs DISTRICT, Hoflong, on
bark, 01.08.2005, D.K. Upreti & J. Rout 05-003568 (LWG); Mahur, on bark, Sept. 2005,
D.K. Upreti & J. Rout 05-009945/A (LWG).
Remarks — Phyllopsora nemoralisis characterized by the thin, small, shortisidia
and the colourless hymenium. It is close to P halei (Tuck.) Zahlbr., in having
a reddish brown prothallus and in the presence of atranorin, but that species
differs in having thick, erect isidia and a dark reddish brown hypothecium.
‘The other isidiate species, P. isidiotyla, differs in cortex type, while P furfuracea
contains furfuraceic acid.
Phyllopsora nemoralis was earlier known from woodland in Tanzania, La
Réunion and South Africa between altitudes of 1550-2010 m (Timdal & Krog
2001). In India it is recorded from temperate areas in the state of Assam at an
altitude of 1014 m. The species is new to the Indian lichen biota.
Phyllopsora subcrustacea (Malme) Brako, Mycotaxon 35(1): 15,1989. FIGURE 13
= Lecidea corallina var. subcrustacea Malme, Ark. Bot. 28A(7): 47. 1936.
Prothallus thick, reddish brown to red. Thallus squamulose; squamules first
adnate, later ascending, overlapping, minute 0.1-0.3 mm wide; upper surface
Phyllospora in India ... 43
glabrous, yellow-green to green, plane to convex, finely pubescent along the
margin. Isidia absent. Cortex of type 2, 8-20 tm thick, medulla containing
crystals dissolving in K.
Apothecia common, up to 1.5 mm in diam.; disc plane to convex, reddish-
brown; margin slightly raised and fibrillose. Exciple colourless to pale brown;
epihymenium hyaline; hymenium colourless to pale yellow; hypothecium
golden yellow, containing crystals which dissolve in K. Ascospores hyaline,
simple, narrowly ellipsoid to fusiform, 12-21 x 2-3 um. Pycnidia not seen.
CHEMISTRY — Thallus K-, C-, KC-, PD-; no lichen substances in TLC.
SPECIMENS EXAMINED — INDIA: Karnataka, SHIMOGA DISTRICT, Sagara to Talgappa,
Ulanhalli, alt. 697 m, on bark in evergreen forest, 16.02.2008, H.T. Lumsch, D.K. Upreti
& P.K. Divakar 19742/0/2 (LWG); Sagara, Muppane, alt. 626 m, on bark, 21.03.2001,
S. Nayaka 01-66191 (LWG); Shavauti River Basin, Holebagilu, alt. 650 m, on bark of
Diospyros crumenata, 16.03.2001, S. Nayaka 01-222798, 01-22276 (LWG); Kerala, IDUKKI
DISTRICT, Adimali Forest range, Chekuthon Mukku, alt. 750 m, on Turpinia malabarica
bark, 16.02.2006, B. Haridas 06-009606 (LWG); PALGHAT DIsTRICT, Parambikulam
Wildlife Sanctuary, alt. 800 m, on bark, 14.11.2006, B. Haridas 06-009603 (LWG).
Remarks — Phyllopsora subcrustacea is characterized by the minute, adnate to
ascending squamules and the fibrillose apothecia. It is close to P manipurensis
in having adnate squamules and in the absence of lichen substances but
that species differs in having small ascospores 5-10 x 2-2.5 um and a white
prothallus.
The species was earlier reported only from Paraguay (Brako 1991). In India
this species is known from tropical areas in the states of Karnataka and Kerala
between the altitudes of 300-800 m. It is new for the country.
Phyllopsora swinscowii Timdal & Krog, Mycotaxon 77: 88 (2001). Fic. 14
Prothallus thick, red to reddish brown. Thallus squamulose; squamules adnate,
overlapping, isodiametric, scattered when young, slightly imbricate, crenulate
to incised, 0.3-1.0 mm wide; upper surface glabrous, greenish to yellowish-
brown, sometimes pubescent along the margin, isidiate. Isidia common, simple,
cylindrical, medium thick, attached to the margin of the squamules. Cortex of
type 1-2, 5-10 um thick; medulla containing crystals dissolving in K.
Apothecia common, up to 1.5 mm in diam.; disc plane to convex, pale brown
to brown; margin slightly raised. Exciple colourless; epihymenium hyaline;
hymenium golden yellow; hypothecium colourless to pale yellow-brown,
containing crystals which dissolve in K. Ascospores hyaline, simple, narrowly
ellipsoid to fusiform, 5-8 x 1-2 um. Pycnidia not seen.
CHEMISTRY — Thallus K-,C-, KC-, PD+ orange; methyl 2,7-dichloropsoromate
and methyl 2,7-dicholoronorpsoromate in TLC.
SPECIMENS EXAMINED — Inp1a: Karnataka, SHIMOGA DISTRICT, Sagara, Mattikoppa,
alt. 603 m, on bark of Holigarna sp., 17.03.2001, S. Nayaka, 01-67383, 01-67390 (LWG);
A4 ... Mishra & al.
Hubse, alt. 594 m, on bark of Diospyros crumenata, S. Nayaka 01-222743, 01-67393/B
(LWG); Kerala, [pUKKI DisTRICcT, Pariyar Tiger, Reserve, Thekkady, Cheveloda, on bark,
22.03.2006, B. Haridas, 06-007969 (LWG).
REMARKS — Phyllopsora swinscowii is characterized by the PD+ orange reaction
and the red, thick prothallus. It is close to P africana Timdal & Krog, and
P. martinii Swinscow & Krog in having a PD+ orange reaction but both those
species contain different lichen substances.
The species has earlier been reported from woodland in East Africa, Kenya,
Mauritius, and Tanzania between altitudes of 300-1900 m (Timdal & Krog
2001). In India it is recorded from tropical areas in the states of Karnataka and
Kerala, between altitudes of ca. 100-600 m. It is a new species for the country.
Acknowledgements
We thank the director of the National Botanical Research Institute, Lucknow for
providing laboratory facilities, the Ministry of Environment and Forests and the council
of scientific and Industrial Research (CSIR-SIP 005), New Delhi for financial support,
members of Lichenology laboratory for their cooperation, Drs. Einar Timdal and G.P.
Sinha for their valuable comments on the manuscripts.
Literature cited
Awasthi DD. 2007. A compendium of the macrolichens from India, Nepal and Sri Lanka. Bishen
Singh Mahendra Pal Singh, Dehra Dun, India.
Brako L. 1989. Reevalutaion of the genus Phyllopsora with taxonomic notes and introduction of
Squamacidia gen. nov. Mycotaxon 35: 1-19.
Brako L. 1991. Phyllopsora (Bacidiaceae). Fl. Neotrop. Monogr. 55: 1-66.
Elix JA. 2006a. Five new species of Phyllopsora (lichenized Ascomycota) from Australia. Australas.
Lichenol. 58: 4-13.
Elix JA. 2006b. Additional lichen records from Australia 62. Australas. Lichenol. 60: 6-12.
Swinscow TDV, Krog H. 1981. The genus Phyllopsora, with a report on East African species.
Lichenol. 13(3): 203-247. doi:10.1017/S0024282981000315
Timdal E, Krog H. 2001. Further studies on African species of the lichen genus Phyllopsora
(Lecanorales). Mycotaxon 77: 57-89.
Timdal E. 2008. Studies on Phyllopsora (Ramalinaceae) in Peru. Lichenol. 40(4): 337-362.
Upreti DK, Divakar PK, Nayaka S. 2003. Notes on species of the lichen genus Phyllopsora in India.
Biblioth. Lichenol. 86: 185-191.
Walker FJ, James PW. 1980. A revised guide to microchemical techniques for the identification of
lichen products. Bull. Brit. Lich. Soc. 46(Suppl.): 13-29.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 45-52 January-March 2011
DOT: 10.5248/115.45
Studies in lichens and lichenicolous fungi: 7.
More notes on taxa from North America
JAMES C, LENDEMER*™’ & KERRY KNUDSEN?
'Cryptogamic Herbarium, Institute of Systematic Botany, The New York Botanical Garden,
Bronx, NY 10458-5126, USA
The Herbarium, Dept. of Botany & Plant Sciences, University of California,
Riverside, CA 92521-0124, USA
CORRESPONDENCE TO *: ‘jlendemer @nybg.org & ’
[email protected]
ABSTRACT— Acarosporacomplanata, Fellhaneropsis myrtillicola, and Lecanora stramineoalbida
are reported new for North America north of Mexico. Acarospora superfusa is confirmed
as occurring in North America. Biatorella rappii is placed in synonymy with Ramonia
microspora.
Key worps— Appalachian Mountains, Magnusson, Sonoran Desert, SE coastal plain.
1. Acarospora complanata H. Magn., Svensk. Bot. Tidskr. 18: 332. 1924.
TyPE: FRANCE. PROVENCE-ALPES-COTE D’azur: Var Dist., Massif volcanique de la
Courtine, pres Ollisules, 1923, de Crozals (hb. B. de Lesd.[n.v.-presumed destroyed],
holotype; UPS! isotype).
Acarospora complanata was described from France (Magnusson 1924) and
Magnusson recognized it as occurring in Africa and Mexico (Magnusson 1929,
1956). The species forms a brown areolate orbicular thallus with inconspicuous
immersed apothecia and an effigurate margin with narrow lobes, a hymenium
80-90 uum high, paraphyses at mid-height mostly 2-2.5 um in diameter, and a
cortex that contains gyrophoric and lecanoric acids (KC+ pink). For a fuller
description see Magnusson (1929).
Morphologically, the species does not appear related to A. molybdina
(Wahlenb.) Trevis, A. macrocyclos Vain., or A. wahlenbergii H. Magn., which have
thicker rugulose thalli, thinner paraphyses, and pseudo-lecanorine apothecia
often in convex areoles. Instead, A. complanata appears morphologically
more closely related to A. trachyticola (Miill. Arg.) Hue, currently known only
from Peru (Magnusson 1929), from which it differs mainly in having a lower
A6 ... Lendemer & Knudsen
hymenium (80-90 vs. 100-120 um) and producing gyrophoric and lecanoric
acids (absent in A. trachyticola).
The concept of Acarospora complanata as revised by Clauzade & Roux
(Clauzade et al. 1981) differs from Magnusson’s concept of the species
(Magnusson 1929), which is the species concept used here. Acarospora
complanata sensu Magnusson (1929) has a thallus that reacts KC+ pink
(gyrophoric and lecanoric acids), but Clauzade & Roux (Clauzade et al. 1981)
synonymized seven species with A. complanata that all lack these substances.
These authors probably included more than one taxon in their concept of
A. complanata and a revision of their material is needed.
Acarospora complanata was included in the checklist of lichens of North
America north of Mexico (Egan 1987) because A. obscura H. Magn., which
was reported by Magnusson (1956) from California, was one of the seven
species synonymized with A. complanata by Clauzade & Roux (Clauzade et al.
1981). The type specimen of A. obscura was collected in Mexico and was in the
herbarium of Bouly de Lesdain. It is presumed to be lost, but Magnusson (1929,
1956) treated A. obscura as a C- and KC-, species with a non-effigurate and
non-orbicular thallus. The one specimen identified as A. obscura by Magnusson
that was seen during the Sonoran Flora Project, was actually A. veronensis
A. Massal. (Knudsen 2008).
Bruce McCune collected A. complanata s. str. in Montana just west of Pine
Butte Swamp in the limestone steppes and we here report the species as new
to North America north of Mexico. The McCune specimen is overgrowing
another lichen, but the behavior appears competitive (for space) rather than
parasitic.
NortH AMERICAN SPECIMEN EXAMINED— U.S.A. MONTANA. TETON Co.: 47°50°N,
112°36’W, 1480 m, on limestone outcrops, viii.1985, McCune 15165 (hb. McCune).
2. Acarospora superfusa H. Magn., Meddel. Géteborgs Bot. Tradgard 5: 65.
1930.
Type: U.S.A. NEw Mexico: Las Vegas, 2000 m., 1927, Broward (hb. de Lesd. [n.v.-
presumed destroyed], holotype; UPS!, isotype).
During the Sonoran Flora Project, a small number of specimens of Acarospora
superfusa were seen, including the isotype. These were distinctly pruinose and
broadly attached to the substrate because the specimens were predominately
reduced or young and, consequently, Knudsen (2008) included A. superfusa
within a broad concept of A. veronensis.
The study of additional, recently collected specimens led to the observation
that unlike Acarospora veronensis, mature specimens of A. superfusa have larger
pruinose areoles (0.5-1.5 vs. 0.2-0.5 um) and one apothecium per areole (rather
than up to six smaller apothecia) (Magnusson 1929, 1930; Knudsen 2008) The
North American lichen records 7 ... 47
A
Figure 1. A, a complanata (McCune 15165, scale = 1.0 mm). B-C, Lecanora
stramineoalbida (Lendemer 20785, scale = 1.0 mm and 0.25 mm respectively).
areoles of A. superfusa become gomphate (i.e., have an elongated mycelial base),
and eventually lobulate and squamulose, developing a short stout stipe half the
width of the squamule, rather than remaining broadly attached to the substrate
as in A. veronensis. Otherwise, as observed by Magnusson (1930), in terms of
cortical measurements, etc., A. superfusa is similar to A. veronensis.
Acarospora superfusa can also be confused with A. nicolai B. de Lesd. or
pruinose specimens of A. obpallens (Nyl. ex Hasse) Zahlbr. However, both
species produce gyrophoric and lecanoric acids. Thalli of A. obpallens further
A8 ... Lendemer & Knudsen
differ by the presence of faveoles (Knudsen 2008), while A. nicolai differs in not
becoming squamulose (Knudsen & Morse 2009). All three of the above species
are sympatric from the Greater Sonoran Desert Region eastward to Oklahoma
in the Great Plains.
Acarospora versicolor Bagl. & Carestia, which occurs in Europe and Siberia
(Magnusson 1929; Clauzade et al. 1981), also appears to be closely related to
A. superfusa, but has a higher hymenium on average (100-110 vs. 80-90 um), a
slightly thicker cortex, and narrower paraphyses (1.0-1.5 vs. 1.8-2.5 um).
While revising specimens at the Farlow Herbarium (FH) a specimen of
Acarospora superfusa from New Mexico was discovered that Magnusson had
identified as A. cinereoalba (Fink) H. Magn. Based on this evidence it is likely
that all the reports of A. cinereoalba from New Mexico by Magnusson (1930)
are A. superfusa. Acarospora cinereoalba was originally described by Fink
(1899) from Illinois and Minnesota as a variety of A. cervina (Ach.) A. Massal.
We consider A. cinereoalba to be a pruinose morphotype of A. veronensis.
While such pruinose specimens of A. veronensis are rare in North America
they do occur, especially near waterfalls or on rocks were water settles and
evaporates. Specimens of A. superfusa that are young or reduced and have not
become gomphate or stipitate may be indistinguishable from pruinose forms of
A. veronensis.
The protologue of Acarospora superfusa (Magnusson 1930) does not include
an etymology. It is not known what Magnusson meant by the inclusion of
“fusa” in the epithet. While he might have meant “fusca” (brown) alluding to a
similarity to Acarospora fusca B. de Lesd., he nonetheless retained the original
spelling 26 years later (Magnuson 1956) and we do the same here.
SPECIMENS EXAMINED— CANADA. SASKATCHEWAN: Rural Municipality of Waverley
No. 44, Grasslands National Park, eroded bluff overlooking McGowan Creek Valley, on
acidic rock, 49°03’54”N, 106°3127”W, 899 m, 19.vi.2009, Freebury 859 (hb. Freebury);
eroded hilltop on mixed-grass prairie, on acidic sandstone, 898 m, 12.ix.2009, Freebury
999 (hb. Freebury). U.S.A. CALIFORNIA. SAN BERNARDINO Co.: San Bernardino
Mountains, Clark Mountains, east edge of wash south of Pachalka Springs, 35°30°44”
N, 115°37°17”W, 1548 m, on Hcl- boulder, rare, 11.x.2009, Knudsen 11769 & Pietrasiask
(UCR). San DigGo Co.: Anza Borrego Desert State Park, Plum Canyon, 33°06'28"N,
116°25’43”W, 688 m, on granite boulder in wash, rare, 22.ix.2005, Knudsen 3665 e&
Marsden (UCR). OKLAHOMA. GREER Co.: Quartz Mountain Arts & Conference
Center, along New Horizon Trail, 34°53’35”N, 99°18'05” W, 482-588 m, on pink granite
outcrops, 10.iv.2007, Morse 15048 & Ladd (KANU, NY, UCR).
3, Fellhaneropsis myrtillicola (Erichsen) Sérus. & Coppins, Lichenologist,
28(3): 199. 1996.
TyPE: GERMANY: Schleswig-Holstein, Lauenburg, im Sachsenwald bei Friedrichsruh, an
Vaccinium myrtillus am Rande des Reviers Saupark, 2.xi.1924, Erichsen (HBG [n.v.],
holotype).
North American lichen records 7... 49
Figure 2. A, Acarospora superfusa (Freebury 999, scale = 0.5 mm). B, Ramonia microspora
(Lendemer 20125, scale = 0.2 mm). C, Fellhaneropsis myrtillicola (Buck 50138, scale = 0.2 mm).
During the 2006 H.L. Bloomquist Foray, William Buck collected an interesting
foliicolous lichen on Rhododendron leaves at the base of a waterfall at a high
elevation site in the southern Appalachian Mountains. Foliicolous lichens
50 ... Lendemer & Knudsen
are not uncommon on evergreen leaves in high humidity microhabitats in
this region; however they are only rarely collected. This collection remained
unidentified until recently when Robert Liicking agreed to examine it and
determined it to represent Fellhaneropsis myrtillicola. This is the first report of
the species from North America and at his request we are publishing it here.
Fellhaneropsis Sérus. & Coppins resembles Fellhanera Vézda in most respects,
differing in exciple type and in having filiform-sigmoid (vs. bacilliform)
conidia (Sérusiaux 1996; Liicking 2008). Although Fellhanera species are
common in the southern Appalachians, using the key provided by Harris &
Lendemer (2009) none can easily be confused with Fellhaneropsis on account
of the different conidia. Felhaneropsis myrtillicola can be separated from other
Pilocarpaceae in the region by its filiform-sigmoid conidia, 3-septate hyaline
ascospores, and very small dark brownish-black convex immarginate apothecia.
For a full description see Sérusiaux (1996). Fellhaneropsis vezdae (Coppins & P.
James) Sérus. & Coppins has also been reported from western North America
(Tenbserg 1997), however it differs from E myrtillicola in having 5-septate
ascospores,
SPECIMEN EXAMINED— U.S.A. NORTH CAROLINA. JACKSON Co.: Nantahala National
Forest, Panthertown Valley, vicinity of Schoolhouse Falls along Greenland Creek, 1190
m, hemlock-pine-hardwood forest with gneissic exposures, on Rhododendron leaves,
29.iv.2006, Buck 50138 (NY).
4. Lecanora stramineoalbida Vain., J. Bot. 34: 35. 1896.
Type: SAINT VINCENT: Richmond Valley, Elliott 239 (TUR-V 5582 [n.v.], holotype).
While collecting on Sapelo Island, Georgia, in December 2009, the first author
collected an unusual Lecanora species with a dark (vs. hyaline) hypothecium
on Juniperus in a dense coastal maritime forest. Using the revision of Lecanora
species with dark hypothecia by Lumbsch et al. (1996) the collection keyed to
L. stramineoalbida, a rare species from the West Indies. This is the first report of
the species from North America. Lecanora stramineoalbida can be recognized by
its corticolous habit, sessile apothecia, epihymenium with crystals that dissolve
in K, brown K- hypothecium, and the production of 2’-0-methylperlatolic acid
in addition to atranorin. For a full description refer to Lumbsch et al. (1996).
SPECIMEN EXAMINED— U.S.A. GEORGIA. McINTOSH Co. : Sapelo Island, behind Nanny
Goat Beach, on Juniperus branch, 15.xii.2009, Lendemer 20785 (NY).
5, Ramonia microspora Vézda, Folia Geobot. Phytotax., 1: 162. 1966.
TyPE: ARGENTINA. JUjUY PRov.: Laguna de la Brea, 1901, R.E. Fries (S [n.v.], holotype)
= Biatorella rappii Zahlbr., Ann. Mycol. 29: 82. 1931, syn. nov.
[non Ramonia rappii Vézda 1966}.
Type: U.S.A. FLORIDA. SEMINOLE Co.: Mecca, xii.1923, on Carpinus, Rapp (W [n.v.],
holotype; FLAS-27141!, isotype).
North American lichen records 7... 51
Ramonia microspora is a minute, easily overlooked, crustose lichen that is
widespread throughout the Coastal Plain of southeastern North America. For
a full description see Vézda (1966). It can be distinguished from other species
of Ramonia using the key to the genus provided by Lendemer & Knudsen
(2008). Recently Richard Harris pointed out that the type of Biatorella rappii is
conspecific with R. microspora. Although B. rappii is the older name, the epithet
“rappii” is preoccupied in Ramonia by R. rappii Vézda. Thus B. rappii should
be placed in synonymy with R. microspora, and we do so here. A selection of
specimens documenting the geographic distribution of this species in North
America is provided below.
SPECIMENS EXAMINED— U.S.A. ARKANSAS. FRANKLIN Co.: Ozark National Forest,
Boston Mountain Ranger District, Shores Lake, 17.x.2005, Harris 51759-A (NY).
GEORGIA. CANDLER Co.: Charles Harold TNC Preserve, 22.xii.2009, Lendemer et al.
21756 (NY). PreRcE Co.: Little Satilla Wildlife Management Area, 21.xii.2009, Lendemer
et al. 21515 (NY). LOUISIANA. EAST BATON ROUGE PaRISH: Burden Research Plantation,
16.v.1979, Tucker 18603-A (NY). Missouri. BUTLER Co.: Big Cane Conservation Area,
23.x.2001, Harris 45255 (NY). NORTH CAROLINA. CAMDEN Co.: Dismal Swamp State
Park, 10.xii.2009, Lendemer 20125 & Williams (NY). CARTERET Co.: Bogue Banks,
Theodore Roosevelt Natural Area, 20.iii.2003, Buck 43860 (NY). JONES Co.: Croatan
National Forest, Catfish Lake South Wilderness, 17.iii.2003, Buck 43723 (NY). PENDER
Co.: Holly Shelter Game Land, 18.iii.2003, Buck 43757 (NY). SoUTH CAROLINA.
AIKEN Co.: Savannah River Bluffs Heritage Preserve, 13.iii.2010, Harris 55994-A (NY),
Lendemer 21954 (NY).
Acknowledgments
We thank our reviewers, Alan Fryday and M. Gékhan Halici. For the loan of
specimens we thank the curators of F FH, KANU, KRAM and UPS as well as A. Flakus
(Poland) and Bruce McCune (Oregon State University).
Literature cited
Clauzade G, Roux C, Rieux R. 1981 [1982]. Les Acarospora de Europe occidentale et de la region
méditerranéenne. Bulletin du Musée d’Histoire Naturelle de Marseille 41: 41-93.
Egan RS. 1987. A fifth checklist of the lichen-forming, lichenicolous and allied fungi of the
continental United States and Canada. The Bryologist 90(2): 77-173. doi:10.2307/3242609
Fink B. 1899. Contributions to a knowledge of the lichens of Minnesota, IV. Lichens of the Lake
Superior Region. V. Lichens of Minnesota Valley and southwestern Minnesota. Minnesota
Botanical Studies 18-19: 215-329.
Harris RC, Lendemer JC. 2009. The Fellhanera silicis group in eastern North America. Opuscula
Philolichenum 6: 157-174.
Knudsen K. 2007 [2008]. Acarospora In: Nash II, TH, Gries, C, Bungartz, F. (eds.). Lichen Flora
of the Greater Sonoran Region, Vol. 3. Lichens Unlimited, Arizona State University, Tempe,
Arizona, pp. 1-38.
Knudsen K, Morse CA. 2009. Acarospora nicolai (Acarosporaceae), a rediscovered species. The
Bryologist 12: 147-151. doi:10.1639/0007-2745-112.1.147
Lendemer JC, Knudsen K. 2008. Ramonia vermispora, a new species from the Sonoran Desert
region of southwestern North America. Opuscula Philolichenum 5: 83-88.
52 ... Lendemer & Knudsen
Licking R. 2008. Foliicolous Lichenized Fungi Flora Neotropica Monograph, 103. Published by
The New York Botannical Garden Press, 866 pp.
Lumbsch HT, Guderley R, Elix JA. 1996. A Revision of Some Species in Lecanora Sensu Stricto
with a Dark Hypothecium (Lecanorales, Ascomycotina). The Bryologist 99(3): 269-294.
doi: 10.2307/3244300
Magnusson AH. 1924. New species of the genus Acarospora. Svensk Botanisk Tidskrift 18:
329-342.
Magnusson AH. 1929. A monograph of the genus Acarospora. Kungl. Svenska Vetenskaps-
Akademiens Handlingar, Stockholm, ser. 3, 7(4): 1-400.
Magnusson AH. 1930. The lichen genus Acarospora in New Mexico. Meddelelser fran Géteborgs
Botaniska Tradgard 5: 55-72.
Magnusson AH. 1956. A second supplement to the monograph of Acarospora with keys. Goteborgs
Kungl. Vetensk.- & Vitterhets.-Samhalles Hand1., sjatte foljden ser. B 6(17): 1-34.
Sérusiaux E. 1996. Foliicolous lichens from Madeira, with the description of a new genus and two
new species and a world-wide key of foliicolous Fellhanera. The Lichenologist 28(3): 197-227.
doi:10.1006/lich.1996.0019
Tonsberg T. 1997 [1998]. Additions to the lichen flora of North America VI. The Bryologist 100(4):
522-524. doi:10.2307/3244417
Vézda A. 1966. Flechtensystematische Studien II. Die Gattungen Ramonia Stiz. und Gloeolecta
Lett. Folia Geobot. Phytotax. 1: 154-175. doi:10.1007/BF02989091
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 53-63 January-March 2011
DOT: 10.5248/115.53
Phyllactinia sebastianiae sp. nov. on Sebastiania brasiliensis
MARIA GRACIELA CABRERA! & GERNOT VOBIS?
"Universidad Nacional del Nordeste, Facultad de Ciencias Agrarias,
Sargento Cabral 2131, 3400, Corrientes, Argentina
*Universidad Nacional del Comahue, Centro Reg. Universitario Bariloche Quintral,
1250, 8400 San Carlos de Bariloche, Rio Negro, Argentina
* CORRESPONDENCE TO:
[email protected]
ApsTRAcT — The new powdery mildew species Phyllactinia sebastianiae on Sebastiania
brasiliensis (Euphorbiaceae) is described. This species was collected in Corrientes, Argentina,
and is well characterized by conidiophores with twisted foot-cells and dimorphic conidia
(lanceolate primary conidia and oblanceolate to ellipsoid-ovoid secondary conidia),
indicating an anamorph belonging in the genus Streptopodium. Detailed descriptions and
illustrations of both anamorph and teleomorph states of the new species are given, and it is
compared with morphologically similar taxa.
Key worps — Erysiphales, taxonomy
Introduction
Recent collections ofinfectedleaves of Sebastiania brasiliensis (Euphorbiaceae)
from local forests of Corrientes, a northeastern province of Argentina, showed
severe symptoms of powdery mildew. Sebastiania brasiliensis is a native tree
of South American subtropical rain forests phytogeographically characterized
as “Provincia Paranaense” ‘The region has a warm and humid climate, with
precipitations of about 1500 mm per year, more abundant in summer. The
medium temperature of the year in this region is 20-21°C (Cabrera 1976).
S. brasiliensis (“lecheron” or “palo de leche”) grows wild in Corrientes in virgin
forests, along path edges and ditches, or untilled landscapes. It is a species
without timber value but is used as an ornamental due to its conspicuous waxy
leaves.
The anamorphic genus Oidium Link. seems to be the predominant
representative of Erysiphales on plants of the Euphorbiaceae in the “Paranaense”
region. Many species (eg. Acalypha wilkesiana Maéll.-Arg., Croton
bonplandianus Baill, C. glandulosus L., Euphorbia heterophylla L., E. hirta L.
var. hirta, E. tithymaloides L., Jatropha curcas L., J. breviloba (Morong) Pax &
54 ... Cabrera & Vobis
K. Hoffm., Manihot esculenta Crantz, Microstachys hispida (Mart.) Govaerts)
are infected by Oidium spp. These unpublished data supplement the data
given in Amano (1986), who listed only Oidium spp. and Phyllactinia suffulta
(Rebent.) Sacc. on Sebastiania sp.
Other South American records of Phyllactinia Lév. refer to collections on
Erythrina spp. (Fabaceae) and Morus alba L. (Moraceae) (Mazzanti & Cabrera
1985). Additional South American species (Braun 1987, Havrylenko 1995,
Havrylenko et al. 2006) include Phylactinia adesmiae Havryl. on Adesmia
(Fabaceae), P. ampulliformis Havryl. on Discaria (Rhamnaceae), P. antarctica
Speg. on Ribes (Grossulariaceae), and P. chubutiana Havryl. et al. on Lycium
(Solanaceae) from Argentina and P. caricaefolia Viégas on Carica (Caricaceae)
and P. chorisiae Viégas on Chorisia (Bombacaceae) from Brazil.
In this work, a new powdery mildew on S. brasiliensis is treated in detail and
compared with allied species.
Materials & methods
During 2007 and 2008, leaves showing symptoms of powdery mildew were collected
from adult plants in the field. All sites are situated in the province of Corrientes,
Argentina (see MATERIAL EXAMINED).
Anatomical observations
The fungal fruiting bodies were carefully scraped from the leaf surfaces with
moistened pointed dissection needles and mounted in distilled water. The specimens
were then stained and embedded with lactophenol cotton blue (LB) (Gams et al.
1980). Penicillate cells were stained with lactofuchsin (LF) (Carmichael 1955) over
a small flame (Shin & Lee 2002). Hyphae, conidiophores, and conidia were stripped
from the leaf surfaces with clear adhesive tape and mounted in water, LB, or LF on a
microscope slide with the fungal material uppermost. Dried herbarium material was
first restored by boiling a small piece of infected leaf in a drop of lactic acid (Shin & La
1993) before being examined as described above. In order to observe the endophytic
mycelium, the technique of leaf clearing of Liberato et al. (2005) was used. In each case,
fifty measurements of structures of taxonomical value (x 400 magnification) were made,
with the average given in parentheses.
CONIDIAL GERMINATION — Conidial germ tubes were observed by incubation on
glass slides in damp chambers at room temperature and pressing a sporulating leaf surface
directly onto a slide or dislodging conidia by tapping an infected leaf (Boesewinkel 1980,
Cook & Braun 2009). In addition, the inoculation on the epidermis of onion scales was
used (To-anum et al. 2005). In both cases, the conidia were incubated at 20°-25°C for
24 h until microscopic observation.
LIGHT MICROscopy — Micrographs were taken with a NIKON SC 102 light
microscope and a camera Sony Cyber-shot 4.1 mpegmovie VX.
SCANNING ELECTRON MICROSCOPY — Fresh leaves with the most suitable areas with
powdery mildew symptoms were selected for detailed study. Small pieces about 5 mm?
were cut out and fixed for 48 h in FAA. The samples were washed, dehydrated, critical
Phyllactinia sebastianiae sp. nov. (Argentina) ... 55
point dried, and sputter coated with gold according to D‘ Ambrogio de Argtieso (1976).
SEM preparations were observed in a JEOL 5800 LV microscope.
Taxonomy
Phyllactinia sebastianiae M.G. Cabrera & Vobis, sp. nov. Figures 1-6
MycoBank MB 518796
Phyllactiniae robiniae morphologice valde similis, sed conidiophoris ad 287.5 um longis,
conidiis ad 120 x 28 um, conidiis secundariis oblanceolatis vel ellipsoideis-ovoideis, truncis
cellularum penicillatarum chasmotheciorum minoribus, 25-30 x 15-25 um, simplicibus
vel bifurcatis, ascis 2-sporis.
Type: Argentina, Corrientes province, Santa Ana de los Guacaras, on living leaves of
Sebastiania brasiliensis Spreng. (Euphorbiaceae), 6 Jun. 2007, M.G. Cabrera. (Collection
Ne 442; CTES 0591005, holotype; BCRU 05146, isotype).
EryMoLocy: derived from the name of the host genus, Sebastiania.
Symptoms ‘The symptoms of typical powdery mildew were restricted to the
leaves of Sebastiania brasiliensis trees. Forming at first rounded to irregular
patches of 0.5 to 1 cm in diameter, the fungal parasite developed typical mycelia
on both sides of the leaves, predominantly on the adaxial surface (Fic. 1 AB).
‘The infections varied and were more abundant on mature than on young leaves.
During mycelial development, the leaves changed in color from green to yellow
and copper-colored. At a later stage, the most affected areas turned golden-
brown (Fic. 1B). The leaves lost their flexibility, dried, and became fragile but
kept their flat form. Extensively colonized leaves showed slight chlorosis and
later developed a tan necrosis (Fic. 1AB).
The initial mycelia were white, causing a yellowing of the host tissue.
Subsequently, the mycelia became denser and changed to yellowish or ash-
colored by producing abundant conidia. At this stage, the fungus showed the
typical powdery aspect. A hyperparasitic Cladosporium sp. frequently slowed
down the development of the mycelium, finally destroying it, and darkening
the surface of the leaves.
Throughout the year, the foliage of the trees of S. brasiliensis was attacked
by the powdery mildew in an irregular manner. During the summer, from
November to April, the mycelia were scarce, rather opaque, and shriveled. Only
slight production of turgescent conidia could be observed. The more remarkable
infections were detected during the cold and frosty winter months from May
to August, but sometimes also through all seasons, especially on trees growing
in shady habitats or in perennially humid environments. In severe attacks,
the diseased plants appeared highly deteriorated with completely defoliated
branches.
MyceELIuM Two types of mycelia developed: external and internal.
The ectophytic mycelium is amphigenous, at first delicate, later becoming
dense, effuse at maturity, moderately thick and subpersistent, more compressed
56 ... Cabrera & Vobis
Figure 1. Phyllactinia sebastianiae aspect. A. Powdery mildew symptoms and occurrence
of chasmothecia on S. brasiliensis leaves. B. Mycelia covering the adaxial surfaces (1 and 3),
and abaxial surfaces (2 and 4). C. Group of immature and mature chasmothecia on mycelium.
D. Chasmothecium with acicular appendages
with age. The mycelium is initially whitish, later yellow. Finally, the external
mycelium covers the whole surface of the leaf (Fic. 1AB). The ectophytic
hyphae are almost straight to sinuous, sometimes geniculate, hyaline, thin-
walled, smooth and septate, branched, with long cells, 44(72.5)140 x 3.75(5.8)8
uum (Fic. 3CD). Appressoria are solitary, variable in shape, ranging from nipple-
shaped, lobed to almost coralloid to hooked or slightly forked (Fics. 3F 6E).
‘The appressoria are generally not very abundant.
In addition, a typical endophytic mycelium is developed (Fic. 3C). In
transverse sections of the leaf, hyaline, branched hyphae were observable
within the host plant tissue (Fic. 5A). Globose haustoria formed terminally on
short hyphal side branches (Fic. 5B). Ectophytic and endophytic mycelia are
connected by hyphae emerging through the stomata (Fic. 3C).
ConipiopHoRrEs The anamorphic structures are characterized by hyaline
conidiophores, which arise directly from the external mycelium (Fic. 3D). They
are 75(158)287 um long and 5(6.78)8 um wide. The basal septa are situated
above the junctions with the supporting ectophytic hyphae, up to about 7.5 um
Phyllactinia sebastianiae sp. nov. (Argentina) ... 57
Ficure 2. Characteristics of Phyllacinia sebastianiae conidia. AC. Primary conidia. DE. Secondary
conidia. Germ tube development in B, C and E. (Bar: 25 um)
(Fic. 6E). The long foot-cell, 37(158)250 x 5(6.78)8 tum, is twisted in 1-3 loops
or sinuous at its base (Fic. 3D) and followed by 1 or 2 shorter cells (Fic. 6E).
Conipia The conidia are developed singly at the apex of the conidiophore
(Fic. 6E). Sometimes two conidia are produced successively. They are one-
celled and hyaline with thin walls. Young conidia are slightly rough, becoming
rougher or slightly reticulate when mature (Fics. 2DE 3E). In young conidia,
the cytoplasm is hyaline with abundant vacuoles of different sizes (Fic. 2A).
Oil drops can also be observed (Fic. 2B). Two types of conidia are produced
(Fic. 6E). The primary conidia are lanceolate and apically pointed (Fics. 2AC
4E), whereas the secondary conidia are more oblanceolate to ellipsoid-ovoid
(Fics. 2DE 3F). Primary and secondary conidia have similar sizes (57.5(78)120
x 14(24)28 um).
CONIDIAL GERMINATION ‘The germ tubes are usually produced in a subapical
position, sometimes also laterally or at both apices. They are 70-95 um long and
develop unlobed or multilobed appressoria (Fics. 2BCE 3F 6E). Under natural
conditions, the germination rate for both primary and secondary conidia was
moderate (70%). Laboratory assays demonstrated a lower germination rate,
23% for the incubation method on glass slides, and 29% for inoculation on
onion scales.
58 ... Cabrera & Vobis
Ficure 3. Teleomorphic structures of Phyllactinia sebastianiae (holotype). A. Anatomical structures
of ascomata. B. Superficial vision of numerous filaments and penicillate cell. C. Peridial cells and
basal penicillate cell D- Immature ascus and ascospores E. Pedicellate immature ascus. F. Immature
ascospores. ((Bar: A,B, 50 tum; C,F. 25 um; D. 15 wm; E. 12 um)
CHASMOTHECIA The chasmothecial ascomata are gregarious or scattered
on both surfaces of the leaves (Fic. 1AC). They are spherical when young
(Fic. 4A), becoming later distinctly depressed at the lower side (Fic. 1D). The
color of the initials of the fruiting bodies is white, changing to pale yellow
and orange, and finally turns dark brown or nearly black when mature (Fic.
1CD). The well developed chasmothecia have diameter of 142(180)250 um. The
peridium consists of polygonal cells with thick and dark walls. (Fics. 3A 4A
6A). They measure 6.25(10)12.5 um in diameter.
APPENDAGES Each individual fruiting body presents two types of appendages:
acicular appendages and penicillate cells.
The acicular appendages are arranged in equatorial position. Each
chasmothecium bears 9(17)22 acicular appendages (Fic. 3A), which are rigid,
hyaline, with thick walls, having a crystalline or vitreous appearance (Fic. 1D).
Their bases are swollen, forming a 27.5(32.5)40 um diam., globular structure,
and the apexes are pointed (Fic. 6AC). The acicular appendages are variably long
(107(195)312.5 um), generally exceeding the diameter of the chasmothecium.
Phyllactinia sebastianiae sp. nov. (Argentina) ... 59
Figure 4. SEM Micrographs of Phyllactinia sebastianiae. A. Development of penicillate cells on
chasmothecia. B. Young penicillate cells and acicular appendages of immature ascoma (500x).
C. Hypha protruding from a stoma (2000x). D. Conidiophores and hyphae of external mycelium
and conidiophores (1000x). E. Rough conidium outer surface (1700x). F. Germ tube with
appressorium of secondary conidium (700x)
The penicillate cells, which are located on the upper side of the ascoma
(Fics. 3B 4B), are composed of a stem that bears free thin filaments (Fics. 4B
6B) and is connected to the peridium and protrudes from the surface of the
ascoma wall (Fic. 4C). The stem is roughly cylindrical, 25-30 x 15-25 um,
occasionally bifurcate in its upper part and extending into numerous, thin,
25-70 um long filaments. The stem walls are thin and the filaments are embedded
in a mucilaginous mass that covers completely the top of the chasmothecium
(Fic. 3B).
ASCI AND ASCOSPORES Various specimens, collected from the same sites
during different periods over two years, were investigated, but material with
totally mature asci was never observed. The description is based on collections
obtained in winter, the most favourable season for growth and development of
reproductive structures. The asci are arranged in clusters inside the ascoma.
They are broadly clavate to globoid, with well-developed pedicels (Fics. 4DE
6D).
The ascus walls are thin and hyaline. The asci are 50-57.5 x 32.5-37.5
tum. It is estimated that about 10% of the asci produce ascospores under the
above characterized natural conditions. A number of 2-3 ascospores per ascus
perhaps can be observed. The ascospores are hyaline, ellipsoidal to ovoid
(Fic. 6D), having a dense cytoplasm, which contains 2-3 yellow oil drops
(Fics. 2F), They are 25-37.5 um long and 18-22.5 um wide.
ADDITIONAL SPECIMEN EXAMINED: ARGENTINA. CORRIENTES PROVINCE, Santa Ana
de los Gudcaras, near National Route 12 (S 27°2’; W 58°23’), 4 June 2007, R.E. Alvarez
Ne 441 (CTES 0591004).
60 ... Cabrera & Vobis
Ficure 5. Phyllactinia sebastianiae A. Endophytic hyphae within S. brasiliensis leaf. B. Formation
of haustoria.
Discussion
Although the median temperature of the year in the Paranaense
phytogeographical region is 20-21°C (Cabrera 1976), in the province of
Corrientes the temperature ranges from —2.8°C to 42.4°C (median temperature
26.8°C) (Sanchez et al. 2007). This thermic variation is important for its
influence on chasmothecial maturity. During the growing season the fungus
produces mainly the anamorphic stage. Ascospores were usually immature.
The fungus exhibits the typical anamorphic morphology of Streptopodium
R.Y. Zheng & G.Q. Chen as circumscribed by Braun (1987), characterized
by a hemiendophytic mycelium that enters the leaf tissue through stomata
(Fic. 3C) and dimorphic conidia (Fic. 6E). The conidia outer walls are verrucose
when viewed by SEM (Fic. 3E), and the conidiophores have sinuous bases
(Fic. 3DF). Ascoma characters agree with those of the genus Phyllactinia.
Amano (1986) registered Oidium sp. and Phyllactinia suffulta on Sebastiania
sp. However, the anamorph of P guttata (Wallr.) Lév. (the current name for
P. suffulta) belongs to Ovulariopsis Pat. & Har. (Takamatsu et al. 2008), which
is characterized by straight conidiophores. The anamorph of the fungus we
observed on S. brasiliensis does not belong to Ovulariopsis, and the teleomorph
is not conspecific with P. guttata (Braun 1987). Furthermore, the conidiophore
foot-cells are spirally twisted or sinuous. Several Phyllactinia spp. with twisted
Phyllactinia sebastianiae sp. nov. (Argentina) ... 61
Ficure 6. Phyllactinia sebastianiae (holotype). A. Chasmothecium with peridial cells
and appendages. B. Numerous filaments on penicillate cells. C. Acicular appendage with
swollen base. D. Pedicellate ascus and ascospores. E. Conidiophores with sinuous basal
cells. F. Primary and secondary conidia. (Bar: A, 20 um; B, 40 um; C-F, 20 um)
conidiophore foot-cells and dimorphic conidia are known, butall of them inhabit
hosts of unrelated families. Phyllactinia robiniae U. Braun & Yafiez-Morales is
morphologically close to P. sebastianiae but differs in having shorter (70-130
um) conidiophores, narrower (40-70 x 12-22 tum) clavate secondary conidia,
penicillate cells with narrower stems (25-50 x 8-18 tm), several short terminal
branchlets, and 2-spored asci (Braun & Yafiez-Morales 2009). Phyllactinia
erythrinae-americanae Yafiez-Morales & U. Braun (Braun & Yafiez-Morales
2009) is distinguished by its conidiophores with basal septa elevated 10-35 um
above the junction with the supporting hypha. Furthermore, the twisted part
of the conidiophores is usually confined to the portion below the basal septum.
The Phyllactinia sp. on Erythrina spp. in Argentina (Mazzanti de Castanén &
62 ... Cabrera & Vobis
Cabrera de Alvarez 1985) is morphologically rather close to the latter species
but differs in having larger chasmothecia with a larger number of appendages.
The taxonomy of these collections from Argentina is not yet clear (Braun &
Yafiez-Morales 2009). Phyllactinia caricaefolia on Carica papaya in Brazil
is also characterized by forming dimorphic conidia but this species is easily
distinguishable from P. sebastianiae by its much smaller ascomata and distinctly
clavate secondary conidia (Viégas 1944, Liberato et al. 2004). Streptopodium
caricae Liberato & R.W. Barreto (Liberato et al. 2004) is probably the anamorph
of P. caricaefolia. Phyllactinia chorisiae on Chorisia speciosa in Brazil is another
species with dimorphic conidia, but the conidiophores are straight and the
secondary conidia distinctly clavate (Liberato 2007). Phyllactinia dalbergiae
Piroz. on hosts of the Fabaceae possesses conidiophores with twisted foot-cells,
but the conidia are uniformly clavate (Mukerji 1968, Braun 1987).
Acknowledgements
We are much obliged to Dr. Havrylenko and Dr. Braun for their valuable suggestions
on the original manuscript and to Ing. Agr. R-E. Alvarez for his valued collaboration in
collecting specimens. Financial support for this research was provided by Universidad
Nacional del Nordeste.
Literature cited
Amano (Hirata) K 1986. Host range and geographical distribution of the powdery mildews fungi.
Japan Scientific Societies Press, Tokyo. 741 p.
Boesewinkel HJ. 1980. The morphology of imperfect states of powdery mildews (Erysiphaceae).
Botanical Review 46(2):167-224. doi. 10.1007/BF02860869
Braun U 1987. A monograph of the Erysiphales (powdery mildews). Beihefte zur Nova Hedwigia
89: 1-700.
Braun U Yafiez-Morales M 2009. Phyllactinia and Ovulariopsis species on legumes. Mycotaxon
109: 145-160.
Cabrera AL. 1976. Regiones fitogeograficas Argentinas. Enciclopedia Argentina de Agricultura y
Jardineria 2(1): 1-85. Kluger WF (ed). ACME Buenos Aires.
Carmichael JW. 1955. Lacto-fuchsin: A new medium for mounting fungi. Mycologia 47: 611.
Cook RTA, Braun U. 2009. Conidial germination patterns in powdery mildews. Mycological
Research 113: 616-636. doi: 10.1016/j.mycres.2009.01.010
D*‘Ambrogio de Argiieso A. 1986. Técnicas de preparacién del material para ser observado con
MEB (microscopio electrénico de barrido). 60-63, in: Manual de Técnicas en Histologia
Vegetal. Editorial Hemisferio Sur SA. Buenos Aires, Argentina.
Gams W, Aa HA van der, Plaats-Niterink AJ van der, Samson RA & Stalpers JA. CBS Course of
Mycology. 2™. ed. 1980. Centraalbureau voor Schimmelcultures Baarn (The Netherlands).
ERLA, Amsterdam-Zuid.
Havrylenko M, Takamatsu S, Divarangkoon R, Braun U. 2006. Phyllactinia chubutiana: a new species
of Erysiphales from Patagonia (Argentina). Mycoscience 47: 237-241. doi:10.1007s10267-006-
0301-0
Havrylenko M, Takamatsu S. 2005. Notes on Erysiphales (Ascomycetes) from Patagonia, Argentina.
Mycoscience 46: 32-38. doi: 10.1007/s 10267-004-0209-5
Phyllactinia sebastianiae sp. nov. (Argentina) ... 63
Liberato JR. 2007. Taxonomic notes on two powdery mildews: Phyllactinia chorisiae and
Ovulariopsis wissadulae (Erysiphaceae: Phyllactinieae). Mycotaxon 101: 29-34.
Liberato JR, Barreto RW, Louro RP. 2004. Streptopodium caricae sp. nov., with a discussion of
powdery mildews on papaya, and emended descriptions of the genus Streptopodium and
Oidium caricae. Mycological Research 108: 1185-1194. doi: 10.1017/S0953756204000991
Liberato JR, Barreto RW, RG Shivas. 2005. Short Research Notes. Leaf-clearing and staining
techniques for the observation of conidiophores in the Phyllactinoideae (Erysiphaceae).
Australasian Plant Pathology 34: 401-404.
Mazzanti de Castatiién MA, Cabrera de Alvarez MG. 1985. Estudio de ofdios (formas sexuales
y asexuales) registrados sobre cinco especies ornamentales en Corrientes, Argentina. 2°
Congreso Latinoamericano de Fitopatologia. Tomo I. Micologia book of abstracts. Buenos
Aires: 303-312.
Mukerji KG. 1968. Phyllactinia dalbergiae. C.M.I. descriptions of pathogenic fungi and bacteria. N°
186. Eastern Press Ltd., London.
Sanchez JE, Aleman JA, Prosdocimi A, (eds.). 2008. Atlas total clarin de la Republica Argentina.
Corrientes. Arte Grafico Editorial Argentino SA.Buenos Aires. Tomo 11.
Shin HD, La YJ. 1993. Morphology of edge lines of chained immature conidia on conidiophores in
powdery mildews fungi and their taxonomic significance. Mycotaxon 46: 445-451.
Shin HD, Lee HJ. 2002. Morphology of penicillate cells in the genus Phyllactinia and its taxonomic
application. Mycotaxon vol. 83: 301-325.
Takamatsu S, Inagaki M, Niinomi S, Khodaparast SA, Shin HD, Grigaliunaite B, Havrylenko M.
2008. Comprehensive molecular phylogenetic analysis and evolution of the genus Phyllactinia
(Ascomycota: Erysiphales) and its allied genera. Mycological Research 112: 299-315 doi:
10.1016/jmycres.2007.11014
To-anun C, Kom-un S, Sunawan A, Sato Y, Takamatsu S. 2005. A new subgenus, Microidium, of
Oidium (Erysiphaceae) on Phyllanthus. Mycoscience 46: 1-8. doi: 10.1007/s10267-004-0202-z
Viégas AP. 1944. Alguns fungos do Brasil II. Ascomycetes. Bragantia 4(1-6): 1-392.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 65-71 January-March 2011
DOT: 10.5248/115.65
Two new species of Lyophyllum s.1.
(Basidiomycota, Agaricomycetes)
from La Palma (Canary Islands, Spain)
RosE MARIE DAHNCKE!, MARCO CONTU? & ALFREDO VIZZINI3*
'Finca ‘Los Castafieros’, 38710 Brena Alta - La Palma (Islas Canarias), Espana
2Via Marmilla, 12 (I Gioielli 2), 1-07026 Olbia (OT), Italy
’Dipartimento di Biologia Vegetale - Universita degli Studi di Torino
Viale Mattioli 25, I-10125, Torino, Italy
*CORRESPONDENCE TO: alfredo.
[email protected]
ABSTRACT — Two new species in the genus Lyophyllum collected in La Palma (Canary Islands),
L. fuscobrunneum and L. impudicum, are here described and taxonomically delimited based
upon morphological data. For each species detailed descriptions, microscopical drawings,
and plates are provided.
Key worps — Agaricales, Lyophyllaceae, taxonomy, biodiversity
Introduction
The present paper deals with two new species belonging to Lyophyllum
P. Karst. emend. Kithner s.1., L. fuscobrunneum and L. impudicum, collected in
La Palma, Canary Islands, by Rose Marie Dahncke. Three papers concerning
Lyophyllum species from La Palma have been already published in the recent
past by the present authors (Dahncke et al. 2009, 2010; Vizzini & Contu 2010)
but it is obvious that this genus is very well represented in this island and that
careful studies could easily lead to the discovery of new taxa since nobody other
than RMD has conducted extensive collections and studies on it there.
Materials & methods
The macromorphological descriptions follow the detailed field notes taken for each
collection on fresh material. The micromorphological descriptions are based both upon
study of fresh and herbarium material. Dried material was revived in 2% KOH and
stained in Congo red and Phloxine B. Cotton Blue was used to highlight the siderophilous
granulation in the basidia (Baroni 1981). Spore measurements are based on means of
30 spores. The width of basidia was measured at the thickest part, and the length was
66 ... Dahncke, Contu & Vizzini
measured from the apex (sterigmata excluded) to the basal septum. We followed the
taxonomic concept of Bon (1999) and Kalamees (2004) for the Lyophyllaceae because
a natural (molecular based) classification has not yet been proposed for this group,
despite the important preliminary study by Hofstetter et al. (2002). Author citations
follow the IPNI Authors website and the Index Fungorum Authors of Fungal Names
website. Herbarium abbreviations are according to Thiers (2010). All examined material
is housed at WU (Herbarium of the Department of Plant Systematics and Evolution,
Faculty of Life Sciences, Universitat Wien). Latin descriptions of the new taxa are
deposited in MycoBank (http://www.mycobank.org).
Taxonomy
Lyophyllum fuscobrunneum Dahncke, Contu & Vizzini, sp. nov. Figs. la, 2a—c
MycoBank MB518872
Pileus 3-8 cm latus, parce carnosus, convexus, castaneo-brunneus, ad medium fusco-
brunneus et obtuse lateque umbonatus, siccus, estriatus, hygrophanus, aetate pallescens.
Lamellae latiusculae, subconfertae, uncinato-adnatae, cremeae deinde griseo-brunneae,
nigrescentes. Stipes 4-6 x 1-1.5 cm, cylindricus, haud bulbosus, albus vel leviter brunneus,
politus. Caro parce conspicua, alba, cartilaginea, nigrescens. Odor saporque farinae
recentis. Sporae 5.2-6.7 x 3.7-4.5 um, late ellipsoideae vel ellipsoideae, obtusae, leves.
Basidia 30-50 x 7-9 um, tetraspora. Cellulae marginales 20-35 x 3-7.5 um, plerumque
fusiformes vel cylindro-flexuosae. Pilei cutis ex hyphis iacentibus, radialibus vel laxe
intertextis, 2-8 um latis efformata. Fibulae numerosae.
Hoxorypws: Hispania, Insulae Canariae, in insula La Palma dicta, ad locum dictum
Hoyo del Rehielo, 26.X1.2009, leg. R.M. Dahncke (WU 30641).
Erymo.oey. The specific epithet, derived from the Latin adjectives fuscus (dark) and
brunneus (brown), refers to the dark brown-pigmented pileus.
PiLeus 3-8 cm wide, not very fleshy, elastic-cartilaginous, at first broadly convex
with an inrolled margin, then expanding, at centre with a broad, low and obtuse
umbo, dry, glabrous, chestnut-brown with a dark brown to fuscous centre,
hygrophanous and fading with age, non-striate, without pruina. LAMELLAE
moderately close, uncinate-adnate, thin, cream then greyish-brown with age,
staining brown then black when bruised. Stipe 4-6 x 1-1.5 cm, cylindric-
equal, without an inflated basis and lacking a bulb, polished, white, stuffed
with a thick white pith. ConTExT thick in the disk but progressively thinning
towards the pileus margin, white, staining black; smell and taste mealy. SPoRE
PRINT white.
Spores 5.2-6.7 x 3.7-4.5 um, on average 6.25 x 4.22 um, hyaline, cyanophilous,
carminophilous, broadly ellipsoid to ellipsoid, smooth, with a single, central,
ellipsoid oil-drop, apex obtuse (Fic. 2a). Basip1a 30-50 x 7-9 um, clavate,
somewhat hygrophoroid, four-spored, with basal clamp-connection (Fic. 2b);
SUBHYMENIUM made up of elongate to inflated elements. HyMENOPHORAL
Ficure 1 (right). Basidiomes. a. Lyophyllum fuscobrunneum. b. L. impudicum. Scale bars = 4 cm
67
Lyophyllum spp. nov. (Canary Islands, Spain) ...
68 ... Dahncke, Contu & Vizzini
TRAMA regular, consisting of hyaline hyphae often turning golden brown in 2%
KOH. MARGINAL CELLS (cheilocystidia) 20-35 x 3-7.5 um, mostly fusiform to
cylindro-flexuose, inconspicuous, hyaline, thin-walled (Fic. 2c). PILEIPELLIS
a cutis of differentiated, repent to loosely interwoven, cylindrical, smooth
hyphae, 2-8 um wide, with dominant parietal pigment; suprapellis an ixocutis
of very thin elements 2-3 um wide; subpellis and pilei trama with progressively
wider hyphae. STIPITIPELLIs a cutis of elongate hyphae. CLAMP CONNECTIONS
present at all septa. THROMBOPLEROUS HYPHAE not observed.
Hapitat. Gregarious near Cistus symphytifolius Lam. (Cistaceae) in a forest
dominated by Pinus canariensis C. Sm. (Pinaceae). Autumn. Thus far known
only from La Palma, in the Canary Islands.
CoMMENTs. Among the closest European species, Lyophyllum bonii Contu
(Consiglio & Contu 2002) has a paler pileus with no umbo, decurrent lamellae,
and larger, less elongate spores. L. ignobile (P. Karst.) Clémengon shows a
dark brown pigmented pileus, but differs in having different, non-mealy smell
and taste, more elongate and narrower spores, definitely shorter and non-
hygrophoroid basidia, and encrusted pigment in the pileipellis (Clémencon
1982, 1986; Bon 1999; Consiglio & Contu 2002). The recently described
L. brunneo-ochrascens E. Ludw. has an umbilicate pileus and larger spores
(“7-9.5 x 4.5-6 um” in the type; Ludwig 2001) whilst L. pulvis-horrei E. Ludw.
& Koeck (Ludwig 2001), also with small, broadly ellipsoid spores, differs
in having adnate to decurrent gills, a different smell, and smaller basidia.
Among the extra-European species keyed out by Clémencon & Smith (1983)
L. fistulosum Clémencon & A.H. Sm. and L. gracile Clémengon & A.H. Sm.
have bigger spores, often longer than 8 tm, shorter basidia (“27-33” um long),
and a more farinose-rancid smell. Finally, L. chamaeleon Clémengon & A.H.
Sm. is close to L. fuscobrunneum in having very elongate, “37-45 x 5-7” um
basidia and a context with a mealy smell, but its spores are longer, narrower,
and very elongate (“7.1-8.8 x 3.5-4.4” um in the type).
Lyophyllum impudicum Dahncke, Contu & Vizzini, sp. nov. Figs. 1b, 2d-f
MycoBank MB518873
Pileus 2-3.5 cm latus, parce carnosus, convexus, ad medium umbonatus, in juventute
cremeo-ochraceus deinde brunneus, ad medium fuscus, siccus, estriatus, hygrophanus,
aetate pallescens, sericeus. Lamellae subconfertae, adnatae, albae, immutabiles. Stipes 3-4
x 0.3-0.6 cm, cylindricus, haud bulbosus, albus vel leviter brunneus, politus. Caro parce
conspicua, alba, immutabilis. Odor gravis, malus; sapor non notatus. Sporae 4.5-6.7 x
3.2-4.5 um, late ellipsoideae vel ellipsoideae, obtusae, leves. Basidia 25-35 x 7-8.5 um,
tetraspora. Cellulae marginales nullae vel inconspicuae. Pilei cutis ex hyphis iacentibus,
radialibus, 3-10 um latis efformata. Fibulae numerosae.
Hoxorypus: Hispania, Insulae Canariae, in insula La Palma dicta, ad locum dictum
Cumbre Vieja, 12.X1I.2009, leg. R.M. Daéhncke (WU 30642).
Lyophyllum spp. nov. (Canary Islands, Spain) ... 69
Ficure 2. Basidiomes. Microscopical features. Lyophyllum fuscobrunneum (from the holotypus).
a. Spores. b. Basidia. c. Marginal cells. L. impudicum (from the holotypus). d. Spores. e. Basidia.
f. Marginal cells. Scale bar = 10 um
EryMoLoey. The specific epithet, derived from the Latin adjective impudicus (= indecent,
shameless, stinking, disgusting), means an evil-smelling, stinking species.
PiLeus 2-3.5 cm wide, not fleshy, not cartilaginous, at first broadly convex
to convex-paraboloid, then convex but never expanding, with a small and
rounded central umbo, dry, in young basidiomes pale ochre-cream then
light brown with a darker, fuscous centre, hygrophanous and fading with age.
LAMELLAE moderately close to close, adnate to adnate-emarginate, thin, white,
not staining when bruised. Sripg 3-4 x 0.3-0.6 cm, subequal, white, brownish
in old basidiomes, surface polished. CoNTEXT thin, white, unchanging; smell
unpleasant, disgusting; taste not recorded. SPORE PRINT white.
Spores 4.5-6.7 x 3.2-4.5 um, on average 6.15 x 4.27 um, hyaline, cyanophilous,
carminophilous, broadly ellipsoid to ellipsoid with an obtuse to slightly
tapered apex, with a single, central, ellipsoid oil-drop, smooth, thin-walled,
very slightly thick-walled only when old (Fic. 2d). Basrp1a 25-35 x 7-8.5 um,
clavate, four-spored, with basal clamp-connection (Fic. 2e); SUBHYMENIUM
70 ... Dahncke, Contu & Vizzini
made up of elongate to inflate, hyaline elements. HYMENOPHORAL TRAMA
regular, composed of thin, hyaline hyphae. MARGINAL CELLS (cheilocystidia)
inconspicuous, cylindric-flexuose to subfusiform (Fic. 2f). PILEIPELLIs a
compact undifferentiated cutis of repent, cylindric, smooth hyphae, 3-10
um wide, with dominant parietal pigment; subpellis scarcely differentiated,
suprapellis not or very scarcely gelatinized. STIPITIPELLIS a cutis of elongate
hyphae. CLAMP CONNECTIONS present at all septa. THROMBOPLEROUS HYPHAE
not seen.
Hapitat. Under Cistus symphytifolius, in small groups. Autumn.
COMMENTS. L. impudicum is well circumscribed on the basis of the pale cream-
ochraceous turning brown and umbonate pileus, the unchanging context with
an unpleasant smell, and small, ellipsoid spores on four-spored basidia. There
are no similar species in the literature since all the non-staining and non-
caespitose species thus far known have globose to subglobose spores.
Acknowledgements
Our most sincere thanks are due to Prof. I. Krisai-Greilhuber (Department of
Systematic and Evolutionary Botany, University of Vienna, Vienna, Austria) and to
Prof. K. Kalamees (Institute of Ecology and Earth Sciences University of Tartu, Tartu,
Estonia) for their pre-submission reviews.
Literature cited
Baroni TJ. 1981. The genus Rhodocybe Maire (Agaricales). Beihefte zur Nova Hedwigia 67: 1-194.
Bon M. 1999. Flore Mycologique d’Europe. Les Collybio-marasmioides et ressemblants. Doc Mycol
Mémoire hors-série n. 5. Amiens. 171 pp.
Clémencon H. 1982. Types studies and typifications in Lyophyllum (Agaricales). I. Staining species.
Mycotaxon 15: 67-94.
Clémencon H. 1986. Schwarzende Lyophyllum-Arten Europas. Zeitschr ftir Mykol 52 (1): 61-84.
Clémencon H, Smith AH. 1983. New species of Lyophyllum (Agaricales) from North America and
a key to the known staining species. Mycotaxon 17: 379-437.
Consiglio G, Contu M. 2002. Il genere Lyophyilum P. Karst. emend. Kihner, in Italia. Riv Micol
45(2): 99-181.
Dahncke RM, Contu M, Vizzini A. 2009. Some rare, critical, interesting taxa of the genus Lyophyllum
s.l. (Basidiomycota, Agaricomycetes) from La Palma (Canary Islands, Spain). Osterr Z Pilzk 18:
129-139,
Dahncke RM, Contu M, Vizzini A. 2010. New taxa in the genus Lyophyllum s.l. from La Palma
(Canary Islands, Spain). Mycotaxon 111: 323-330. doi:10.5248/111.323
Hofstetter V, Clémengon H, Vilgalys R, Moncalvo J-M. 2002. Phylogenetic analyses of the
Lyophylleae (Agaricales, Basidiomycota) based on nuclear and mitochondrial rDNA sequences.
Mycol Res 106: 104-1059. doi:10.1017/S095375620200641X
Kalamees K. 2004. Palearctic Lyophyllaceae (Tricholomataceae) in Northern and Eastern Europe
and Asia. Scripta Mycol 18: 3-134.
Ludwig E. 2001. Pilzkompendium, Bd.1 Beschreibungen: Die kleineren Gattungen der
Makromyzeten mit lamelligem Hymenophor aus den Ordnungen Agaricales, Boletales und
Polyporales. Eching.
Lyophyllum spp. nov. (Canary Islands, Spain) ... 71
Thiers B. 2010. [continuously updated] Index Herbariorum: A global directory of public herbaria
and associated staff. New York Botanical Garden’s Virtual Herbarium. http://sweetgum.nybg.
org/ih/
Vizzini A, Contu M. 2010. Lyophyllum rosae-mariae sp. nov. (Basidiomycota, Agaricomycetes) from
La Palma (Canary Islands, Spain). Mycosphere 1(1): 83-86.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 73-81 January-March 2011
DOT: 10.5248/115.73
Two new alectoronic acid-containing Parmotrema species from
the coast of Sdo Paulo State, southeastern Brazil
MARCELO P. MARCELLI’, MICHEL N. BENATTI? & JOHN A. ELIX 3
Instituto de Botdnica, Niicleo de Pesquisa em Micologia
Caixa Postal 3005, Séo Paulo / SP 01031-970, Brazil
3Research School of Chemistry, Building 33, Australian National University
Canberra, A.C.T. 0200, Australia
CORRESPONDENCE TO: ‘
[email protected],
2michelbenatti@yahoocombr
[email protected]
ApstTracT— Descriptions are presented for two new Parmotrema species containing
alectoronic acid, PR conidioarcuatum and P pycnidiocarpum, resulting from a survey of
Parmeliaceae species in natural ecosystems and urbanized coastal areas of southeastern
Brazil.
Key worps— Parmotrema maraense, Parmotrema subrugatum
Introduction
The genus Parmotrema A. Massal. is characterized by lobes with broad,
rotund apices and naked lower margins, the absence of pseudocyphellae,
the frequent occurrence of marginal cilia, simple rhizines, and thick-walled,
ellipsoid ascospores (Brodo et al. 2001, Nash & Elix 2002). More than 300
species are known worldwide (Nash & Elix 2002), and about one third of them
occur in Brazil.
Two new species containing alectoronic acid were discovered by the authors
during research on the broad-lobed species of Parmeliaceae at the coast in Sao
Paulo State, Brazil, at the same localities cited in Benatti et al. (2010).
Both new species lack vegetative propagules, and are corticolous in coastal
mangrove or restinga forests. More morphological and chemical comparisons
with other somewhat similar species can be found in Benatti (2005).
Material & methods
Specimens were distinguished by morphological characters using standard
stereoscopic and light microscopes. Anatomical sections, including those of apothecia
7A ... Marcelli, Benatti & Elix
and pycnidia, were made with a razor blade by hand. The chemical constituents were
checked by spot tests with potassium hydroxide (K), sodium hypochlorite (C) and
para-phenylenediamine (P), and also examined under UV light (360 nm). Chemical
constituents were identified by thin-layer chromatography (TLC) using solvent C
(Bungartz 2001), high performance liquid chromatography (HPLC) (Elix et al. 2003)
and comparison with authentic samples.
We have encountered problems dealing with the many morphological terms present
in the literature. For the purpose of this paper, we consider that lacinules represent
adventitious, ribbon-like secondary outgrowths from the primary lobe margins
(Marcelli et al. 2007). Lobules are similar, but short and rounded.
The diagnosis for each taxon refers exclusively to observations of the holotype
specimen and the English descriptions and comments to all the material studied.
The species
Parmotrema conidioarcuatum Marcelli, Benatti & Elix, sp. nov. FIG. 1
MycoBank MB 518890
Species cum thallo similis Parmotrematis subrugati sed lobis latioribus, lacinulis multum
longioribus et ramosioribus, lobulis aggregatis saepe submarginalibus formans, ciltis
saepe majoribus, margine inferne eburnea solum subter apothecia vel lacinulis, apotheciis
cum margine semper eciliata, sporis minoribus et conidia variabiliter arcuatis differt.
atranorinam, chloroatranorinam, acidum alectoronicum, acidum f-alectoronicum,
acidum dehydrocollatolicum et acidum dehydroalectoronicum continens.
Hotortype: Brazil, Sao Paulo State, Municipality of Ilha Comprida, near the raft to
Cananéia, low “restinga’” vegetation, corticolous, under partial sunlight, leg. A.A.
Spielmann, M.P. Marcelli, L.S. Canéz, & M.N. Benatti 964, 03-IV-2004 (SP).
ErymMo.oey: This species is named after the arcuate conidia.
THALLUS up to 23 cm in diameter, subcoriaceous, ramulicolous, pale greenish
gray but becoming dark gray in the herbarium, lobed to sublobed. LoBeEs
irregularly branched, (3.5-)8.0-18.0 mm wide, crowded, weakly to strongly
ascending, generally unattached; apices + plane to subconvex, subrotund
(primary lobes) to irregular and partially lacinulate; margin subcrenate to
irregularly dissected, +plane to ascending as it begins to form lacinules and/
or apothecia, irregularly weakly incised, ciliate. UPPER SURFACE continuous to
irregularly cracked, smooth to subrugose; MACULAE distinct and punctiform
to linear when present on the stipes and amphithecia of the apothecia, laminal
maculae rare and weak. LACINULES usually long, 0.3-17.5 x 0.2-2.3 mm,
regularly spreading from lobe margins or apices, abundant at thallus center,
initially simple but becoming irregularly branched, subcanaliculate, truncate
or acute, ciliate, underside generally white, often mixed with tiny ciliate lobules
which may develop into peculiar, scattered, submarginal, small, bouquet-shaped
agglomerations, 3.0-8.0 mm wide. SOREDIA, PUSTULES and ISIDIA absent. CILIA
black, simple or rarely furcate, 0.4-4.5 x ca. 0.05 mm, abundant at the lateral
margins of the lobes but sparse at the apices. MEDULLA white, with scattered
Parmotrema spp. nov. (Brazil) ... 75
Figure 1. The holotype of P. conidioarcuatum and the bouquet of lobules
typical of the species (arrow and detail). Bar = 1 cm.
orange, pigmented spots. Lower suRFACE black, shiny, smooth to rugose or
veined, free of rhizines when not contacting the substrate, MARGINAL ZONE
shiny, usually brown, but turning white, cream or sometimes variegate under
lacinules or apothecia, smooth to subrugose, 1.0-8.0 mm wide, naked; RHIZINES
black, simple, furcate to irregularly branched, 0.10-2.30 (3.80) x 0.05 (-0.10)
mm, frequent to abundant, in scattered groups. APOTHECIA submarginal or
subapical, sometimes originating from subcanaliculate lobe apices, common,
concave when young but becoming fissured and distorted with age, up to 25.2
mm wide, margins smooth to subcrenate, rarely lacinulate, always eciliate,
76 ... Marcelli, Benatti & Elix
with very inflated stipes, amphithecia and stipe smooth at first then strongly
veined and rugose or folded with age; disc brown, epruinose, imperforate;
ASCOSPORES ellipsoid, 19.0-25.0 x 9.5-12.5 um, epispore 1.5-2.0 um thick;
PycnipiA submarginal, common, particularly abundant on the lacinules, with
black ostioles; conrp1a variable inside a single pycnidium, bacilliform or short
filiform, often arcuate, sigmoid or contorted into several different shapes,
5.0-7.5 x ca. 1.0 um.
COLOR REACTIONS: upper cortex K+ yellow, UV-; medulla K+ weakly yellowish,
C-, KC+ rose, P-, UV+ bluish green, and scattered spots of an orange, K+ dark
reddish pigment.
TLC/HPLC: cortical atranorin (minor) and chloroatranorin (minor); medullary
alectoronic acid (major), B-alectoronic acid (minor), dehydrocollatolic acid
(minor), and dehydroalectoronic acid (trace).
CoMMENTs: This species produces no vegetative propagules, has densely ciliate
margins with abundant, long and branched lacinules, a brown lower marginal
zone that turns white or cream colored only under lobes with apothecia and/
or lacinules. The apothecia have smooth to subcrenate, eciliate margins, with
ascospores up to 25.0 um long, and a white medulla containing frequent spots
of an orange, K+ dark reddish pigment.
However, the most striking characteristics of P. conidioarcuatum are the
formation of tiny ciliate lobules, especially at submarginal parts of the thallus,
lobules which eventually aggregate into small bouquets, and, most notably, the
bacilliform or short filiform conidia that are often variably arcuate (arched,
sigmoid, sinuous, subcrescent, somewhat unciform and several other shapes)
intermixed with some linear conidia. Together, these characters readily
distinguish P conidioarcuatum from other Parmotrema species containing
alectoronic acid. It is also one of the species with the broadest lobes in the
genus.
We found no reference to Parmotrema species bearing similar small
bouquets of lobules, nor are they present in any other Brazilian species known
to us. Initially, we considered the possibility that this was due to some kind of
deformation of the lacinules, but these lobules are clearly very common and
consistent, differing in shape from the lacinules and with such regularity on the
upper cortex, that they constitute a very unique morphological characteristic of
the species. In addition, we had access to other specimens collected from inland
Sao Paulo State, which have the same lobular bouquets (in early development),
arcuate conidia and the other specific characteristics.
At first glance, P. conidioarcuatum might be mistaken for P subrugatum
(Kremp.) Hale, which invariably has unciform conidia (4.0-6.0 um) and
larger ascospores (26.0-39.0 um). Sterile specimens of P. subrugatum (M1!)
are readily distinguished by the much narrower, more sparingly ciliate lobes,
Parmotrema spp. nov. (Brazil) .... 77
the continuously white borders under the margins of all lobes, the absence
of the lobular bouquets, and the simple to dichotomously branched lacinules
(Benatti et al. 2010). In contrast, the lacinules of P conidioarcuatum are more
canaliculate, irregularly branched, densely ciliate, and grow crowded along the
lobe margins; in addition they are sometimes more rugose due the accumulation
of pycnidia.
Because of the dense marginal lacinulae and cilia, P conidioarcuatum is
probably more closely related to the P. wainioi subgroup, as they have similarly
sized ascospores and conidia as well as a brown marginal zone on the underside.
The unusually shaped conidia present in P. conidioarcuatum are believed to be
derived from bacilliform or short filiform conidia.
Parmotrema maraense Hale (Hale 1990) has narrower lobes, with margins
bearing sparingly branched lacinules, as well as more lacinulate and ciliate
apothecia (Benatti 2005, Benatti et al. 2010), and short bacilliform conidia
(Klaus Kalb, pers. comm.).
Parmotrema pycnidiocarpum Benatti, Marcelli & Elix, sp. nov. FI. 2
MycoBank MB 518892
Species cum thallo simili Parmotrematis subrugati sed pycnidiis absentibus in lobis,
apotheciis bullatis et multum pycnidiatis, cum pigmento aurantiaco disposito sub hymeniis
et ad marginem differt. Atranorinam, chloroatranorinam, acidum alectoronicum,
acidum «-collatolicum, acidum f-alectoronicum, acidum -collatolicum, acidum
dehydrocollatolicum, methyl pseudoalectoronatum, et methyl pseudo-a-collatolatum
continens.
HotoryPe: Brazil, Sao Paulo State, Municipality of Iguape, Barra do Ribeira, between
Suamirim “River” and the ocean, low “restinga” vegetation growing on inundated soil,
on small tree branch in the wood, leg. M.P. Marcelli & O. Yano 6663, 17-VII-1989 (SP).
EryMo.oey: This species is named after the peculiar distribution of the pycnidia.
THALLUS up to 14.5 cm wide, submembranaceous, ramulicolous, pale
grayish green, becoming darker in the herbarium, lobate to sublobate. LoBEs
1.5-3.5(-5.0) mm wide, irregularly branched, imbricate to crowded, adnate,
ascending when fertile, adnate to loosely adnate or unattached; apices tplane
to subconvex when fertile, subrotund to irregular; margin smooth near
the apices, +flat to ascending and subundulate, entire to irregularly incised,
irregularly sublacinulate, ciliate. UPPER SURFACE continuous but becoming
irregularly cracked with age, smooth to subrugose. MACULAE present only on
some amphithecia and stipes, weak, punctiform, sometimes aggregated and
linear. ADVENTITIOUS LACINULES sparse, simple or irregularly ramified, flat,
0,3-1.3 x 0,2-1.1 mm, irregularly distributed along the lobe margins, truncate
or acute, underside concolorous with the lower margin or cream on fertile
lobes, occasionally intermixed with some small irregular lobules. Cri1a black,
simple to rarely furcate or irregular, 0.1-1.5 x ca. 0.05 mm, frequent along the
78 ... Marcelli, Benatti & Elix
margins but sparse at the lobe apices. MEDULLA white, invariably with orange
pigmentation below the hymenium as apothecia mature, pigmented also at
some apices and margins of older lobes. SOREDIA, PUSTULES and ISIDIA absent.
Lower suRFACE black, shiny, smooth to subrugose or weakly veined; MARGINAL
ZONE shiny, brown, smooth to weakly veined, 0.5-3.5 mm wide, naked, turning
cream under lobes with apothecia; RHIZINEs black, simple, furcate or irregularly
branched, 0.10-0.80(-1.30) x ca. 0.05(-0.10) mm, frequent to abundant,
occasionally becoming agglutinated, usually scattered but partly in groups.
Apothecia submarginal or subterminal, in part originating from subcanaliculate
lobe apices, concave to urceolate, becoming rugose and distorted with age, up to
5.2 mm wide, eciliate, stipes highly inflated and bullate, margins smooth when
young, then crenate, amphithecia and stipes smooth when young but becoming
rugose or vertically folded; disc brown, epruinose, imperforate; ascospores
absent, no asci observed in hymenia; pycnidia frequent to very abundant on
the stipes and amphithecia, rarely submarginal on apotheciate lobes, with black
ostioles; conidia short, unciform, 3.0-5.0 x ca. 1.0 um.
COLOR REACTIONS: upper cortex K+ yellow, UV-; medulla K-, C-, KC+ rose,
P-, UV+ bluish green, with a K+ dark reddish, orange pigment (unknown
anthraquinone) below the hymenia of all mature apothecia.
TLC/HPLC: cortical atranorin (minor) and chloroatranorin (minor); medullary
alectoronic acid (major), a-collatolic acid (minor), B-alectoronic acid (trace),
B-collatolicacid (trace),dehydrocollatolicacid(trace),methylpseudoalectoronate
(trace) and methyl pseudo-a-collatolate (trace).
ComMMENTs: ‘This alectoronic acid-containing species is characterized by
narrow, ciliate lobes, the absence of vegetative propagules, eciliate apothecia
with highly inflated, bullate stipes, pycnidia mainly on the amphithecia and
stipes of the apothecia, very small unciform conidia, and an orange-pigmented
medulla around the hymenium.
‘The orange medullary pigment (K+ dark reddish, possibly an anthraquinone)
which is frequently deposited under and around the hymenia of apothecia,
appears also in the medulla of some of the older lobes (often those beginning
to form apothecia).
Particularly notable is the uncommon distribution pattern of the pycnidia.
‘They grow almost exclusively on the amphithecia and stipes of the apothecia.
Only rarely some submarginal pycnidia are found on the lobes, precisely where
apothecial initials are being formed, around the edge of the juvenile disc.
The shape of the highly inflated stipes somewhat resemble large “skirts”
as they begin to form, with the resulting lobe apices becoming more convex,
especially the subapical ones. In this aspect, they differ from all other Brazilian
species with inflated apothecia (Hale 1965, Fleig 1997, Louwhoff & Elix 1999,
Parmotrema spp. nov. (Brazil) ...
Ficure 2. Both sides of the holotype of P pycnidiocarpum.
Bar = 1 cm.
79
80 ... Marcelli, Benatti & Elix
Eliasaro 2001, Kurokawa & Lai 2001, Canéz 2005, Spielmann 2005), where the
apothecial pedicel is always +cylindrical.
The conidia shape and size place this species in the P. subrugatum subgroup
(Benatti et al. 2010). However, the lower marginal zone of P. pycnidiocarpum
varies from brown on the distal lobes to cream on those bearing apothecia, in
contrast to the almost entirely white margins of P subrugatum (Benatti et al.
2010).
Acknowledgements
The authors wish to thank Harrie Sipman (Berlin) and Lidia Ferraro (Corrientes)
for the critical revision of the manuscript and help with the Latin diagnosis, and Klaus
Kalb for information on the conidia of the P maraense type specimen. This work
could not have been accomplished without the support of the Conselho Nacional de
Desenvolvimento Cientifico e Tecnolégico (CNPq) for a Master Scholarship to the
second author and a Research support grant to the first author.
Literature cited
Benatti MN. 2005. Os géneros Canomaculina, Parmotrema e Rimelia (Parmeliaceae, Ascomycetes)
no litoral centro-sul do Estado de Sdo Paulo. Mastership dissertation, Instituto de Botanica,
Sao Paulo. 389 p.
Benatti MN, Marcelli MP, Elix JA. 2010. Two new species of the Parmotrema subrugatum
group from the coast of SAo Paulo State, southeastern Brazil. Mycotaxon 112: 377-388.
doi: 10.5248/112.377
Brodo IM, Sharnoff SD, Sharnoff S. 2001. Lichens of North America. Yale University Press. New
Haven & London. 795 p.
Bungartz F. 2001. Analysis of lichen substances. http://nhc.asu.edu/lichens/lichen_info/tlc.jsp#
TLC2. Accessed on July 2008.
Canéz LS. 2005. A familia Parmeliaceae na localidade de Fazenda da Estrela, municipio de Vacaria,
Rio Grande do Sul, Brasil. Mastership dissertation, Instituto de Botanica, S40 Paulo, 302 p.
Eliasaro S. 2001. Estudio taxonomico y floristico sobre las parmeliaceae sensu stricto (Ascomycota
liquenizados) del Segundo Planalto del Estado de Parana, Brasil. Tesis de Doctorado. Facultad
de Ciencias Exactas y Naturales, Universidad de Buenos Aires. Buenos Aires.
Elix JA, Giralt M, Wardlaw JH. 2003. New chloro-depsides from the lichen Dimelaena radiata.
Bibliotheca Lichenologica 86: 1-7.
Fleig M. 1997. Os géneros Parmotrema, Rimelia e Rimeliella (Lichenes-Ascomycota, Parmeliaceae)
no Rio Grande do Sul, Brasil. Tese de Doutorado, Instituto de Biociéncias da Universidade de
Sao Paulo. 250 p.
Hale ME. 1965. A Monograph of the Parmelia subgenus Amphigymnia. Contributions from the
United States National Herbarium 36(5): 193-358.
Hale ME. 1990. New species of Parmotrema (Ascomycotina: Parmeliaceae) from Tropical America.
Bibliotheca Lichenologica 38: 109-119.
Kurokawa S, Lai MJ. 2001. Parmelioid lichen genera and species in Taiwan. Mycotaxon 77:
225-284.
Marcelli MP, Jungbluth P, Benatti MN, Spielmann AA, Canéz LS, Cunha IPR, Martins MEN. 2007.
Some new species and combinations of Brazilian lichenized fungi. Bibliotheca Lichenologica
96: 209-227,
Parmotrema spp. nov. (Brazil) ... 81
Louwhoff SHJJ, Elix JA. 1999. Parmotrema and allied lichen genera in Papua New Guinea.
Bibliotheca Lichenologica 73: 1-152.
Nash TH II, Elix JA. 2002. Parmotrema. Pp. 318-329, in: Nash et al. (Eds). Lichen flora of the
greater Sonoran Desert Region. Volume 1. Lichens Unlimited, Arizona State University, Tempe,
Arizona, USA.
Spielmann AA. 2005. A familia Parmeliaceae (fungos liquenizados) nos barrancos e peraus da
encosta da Serra Geral, Vale do Rio Pardo, Rio Grande do Sul, Brasil. Masters Dissertation,
Instituto de Botanica, Sao Paulo. 204 p.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 83-98 January-March 2011
DOT: 10.5248/115.83
New or noteworthy records of Caloplaca
(Teloschistaceae) from Poland
KARINA WILK
Laboratory of Lichenology, W. Szafer Institute of Botany, Polish Academy of Sciences
Lubicz 46, Krakéw PL-31-512, Poland
CORRESPONDENCE TO:
[email protected]
AsstTract— Caloplaca atroalba, C. dichroa, C. marmorata, C. oasis, and C. pseudofulgensia
are reported as new to Poland. Two other taxa: C. albopruinosa and C. pusilla are discussed
in view of modern approaches. The species reported here were mainly collected in the Polish
Carpathians. Additionally, C. atroalba is reported as new to Ukraine. Detailed taxonomic
descriptions and comments are provided for the treated taxa.
Key worps— Central Europe, geographical distribution, lichenized fungi, taxonomy
Introduction
According to the checklist of the Polish lichen biota (Fattynowicz 2003) and
the most recent publications (Bielczyk 2003, Ceynowa-Gieldon & Adamska
2005, Wilk & Flakus 2006, Sliwa & Wilk 2008), 67 species of Caloplaca are
known from Poland. The genus is relatively well-known in Poland, as it is
in neighboring countries (Germany, Czech Republic, Slovakia, Ukraine).
Among the authors that mostly contributed to this knowledge in Poland,
Tobolewski (1956, 1958), Glanc & Tobolewski (1960), Nowak (1960, 1961),
Nowak & Tobolewski (1975), and Alstrup & Olech (1988, 1992) are the best
representatives.
The author has already reported on her 2004-2008 study of the taxonomic
diversity of calcicolous Caloplaca species in the Polish Western Carpathians
(Wilk 2008). In the course of this survey, several species were recognised as new
to Poland. Some of them were reported recently (i.e., Wilk & Flakus 2006, Sliwa
& Wilk 2008), and the remainder is presented here: C. atroalba, C. dichroa,
C. marmorata, C. oasis, and C. pseudofulgensia. In addition, several noteworthy
species were found in the area; two of them (C. albopruinosa and C. pusilla)
are discussed in detail also in this study. Recently, the taxonomic placement
84 ... Wilk
of the latter two species has been changed and they are presented here in their
modern sense.
Material & methods
Specimens collected by the author and further material obtained from KRAM, KTC,
UGDA, and herbaria of the Gorce National Park (GPN) and the Pieniny National Park
(PPN) were examined. Additional reference material was studied in the Minnesota
herbarium (MIN).
Morphological characters were measured on dry material using a dissecting
microscope. Thallus color was compared with the color standard by Séguy (1936).
Anatomical characters were measured from hand-cut sections and squash preparations
mounted in water. The structure of paraphyses and cortical tissues were observed in 25%
KOH (K). The granulation of tissues was observed in polarized light; pol+/ pol- indicates
that granules do/do not reflect polarized light. Solubility of granules and/or crystals was
tested with K and 65% nitric acid (N). Chemicals used in spot test reactions were: K,
Lugol's iodine [0.3% IK]] (I) and N. The terminology for tissues follows Bungartz (2002),
Ryan et al. (2002) and Gaya (2009). Systematic nomenclature of lichen associations and
species concepts follow Roux et al. (2009), and additional lichen association data are
provided by Gaya (2009).
Taxonomy
Caloplaca albopruinosa (Arnold) H. Olivier, Mém. Soc. Sci. Nat. Math.
Cherbourg 37: 147 (1909).
THALLUs endolithic or partially epilithic, thin, continuous to slightly cracked,
white or grey (Séguy 1936, color code: 494), rarely limited by a dark grey
prothallus; without vegetative propagules. APOTHECIA zeorine, abundant, in
groups or more rarely slightly scattered, timmersed at first, becoming sessile,
round or slightly angular by mutual compression or flexuose, 0.2-1.2 mm
diam., leaving pits in the rock when detached; disc at first slightly concave,
then flat, black (Séguy 1936, color codes: 527, 528), more or less white or
bluish due to pruina; proper margin persistent, thick, smooth (margin
sometimes discontinuous and slightly cracked in young apothecia), distinctly
raised above the disc, black, white or bluish due to pruina; thalline margin
inconspicuous or suppressed. Parathecium well developed, thick, 65-170 um,
prosoplectenchymatous, lumina of cells elongated or slightly oval, outer part
blackish. Amphithecium much reduced with few algae, cortex sometimes well
developed up to 50 um, paraplectenchymatous, cells with big round lumina,
almost completely filled by small, yellow brown crystals (pol+, insoluble in
K, soluble in N). Epihymenium granular, grey. Hymenium hyaline, without
crystals, 80-115 um tall. Paraphyses simple, constricted at septa, 1-2(-3) apical
cells slightly thickened, up to 5 um wide. Hypothecium hyaline, with many
Caloplaca in Poland ... 85
oil droplets, paraplectenchymatous. Asci 8-spored, spores polaribilocular,
thin-walled, 12-16.5 x 6.5-10 um, isthmus 2-4(-5) um wide. Pycnrpia
rather common, immersed in rock or thallus; ostiolum black, distinct; conidia
colorless, ellipsoid to ovoid, 2-3.5 x 1-1.5 um.
SPOT TEST REACTIONS: thallus K-, epihymenium K+ violet, KN+ violet-
brown and outer part of parathecium K+ violet.
DIsTRIBUTION AND ECOLOGY — Caloplaca albopruinosa has a Central Europe-
Mediterranean distribution (Nimis et al. 1987). It grows on limestone and
dolomite rocks in sun-exposed places in the subalpine and alpine belts (e.g.,
Alps, Apennines) and occasionally at lower elevations (Nimis 1993, Nimis et
al. 1996a, Muggia et al. 2008). The species is characteristic of the association
Bagliettoetum marmoreae Roux 1978.
In Poland C. albopruinosa is rare, occurring in the Carpathians only in Tatra
Mts. Eitner (1901) also reported the species from the Sudety Mts. It grows on
limestone boulders in sun-exposed situations ca. 1200 m in montane glades.
ExsICCATES SEEN — Arnold, Lich. Exsicc. 1222 (sub Pyrenodesmia agardhiana)
(KRAM).
SPECIMENS EXAMINED — PoLANp. Western Carpathians, West Tatra Mts: Dolina
Chochotowska valley, Polana Dudowa glade, alt. 1185 m, 49°14’°58”N/19°49°37E, 16
Jul 2004, L. Sliwa 3151, 3169, K. Wilk 2157 (KRAM), Dolina Koscieliska valley, Przystop
Mietusi glade, 49°15’48”N/19°53’22”E, 15 Jul 2004, L. Sliwa 3026 (KRAM).
COMMENTS — Caloplaca albopruinosa is characterized by an endolithic
thallus and black, white pruinose apothecia with thick proper margin. The
amphithecium is reduced with few algae. The epihymenium is grey and reacts
K+ violet.
Together with C. alociza (A. Massal.) Mig., C. badioreagens Tretiach &
Muggia and C. erodens Tretiach et al., C. albopruinosa forms a group of
species characterized by black apothecia and an endolithic thallus. Caloplaca
albopruinosa (= C. agardhiana auct., see Muggia et al. 2008 for nomenclature)
is a problematic species, considered by some authors as a synonym to
C. alociza. The presence or absence of crystals in the hymenium was a primary
key character used to distinguish both species (Clauzade & Roux 1985, Nimis
1992), but recent studies indicate that crystals may occur in C. albopruinosa as
well as in C. alociza (Muggia et al. 2008). Current concepts separate C. alociza
from C. albopruinosa by a thin evanescent apothecial margin and by more
rarely white pruinose apothecia. A brownish grey epihymenium (K+ brownish
red) and paraphyses neither apically thickened and nor constricted at the septa
distinguish C. badioreagens from C. albopruinosa (Tretiach & Muggia 2006). In
comparison to C. albopruinosa, C. erodens has smaller apothecia with distinct
thin proper margins and an endolithic-epilithic thallus producing grey soredia.
This species occurs mostly as a sterile form (Tretiach et al. 2003).
86 ... Wilk
Caloplaca atroalba (Tuck.) Zahlbr., Cat. Lich. Univ. 7: 68 (1930). PLATE 1
THALLUS epilithic, thin, areolate or continuous, brownish grey or creamy
brownish (Séguy 1936, color codes: 234, 235, 338, 339), epruinose, rarely limited
by a grey prothallus; without vegetative propagules. Areoles irregular, flat,
with uneven surface. Thallus cortex paraplectenchymatous, without crystals;
algal layer continuous; medulla prosoplectenchymatous. APOTHECIA Zeorine,
abundant, in the centre of the thallus, crowded, sessile from the beginning,
round or angular by mutual compression, small, up to 0.5 mm diam.; disc
flat, dark brown (Séguy 1936, color code: 117), epruinose; proper margin
persistent, thin, concolorous with disc, epruinose; thalline margin usually
persistent or +reduced, but visible at least at the base of apothecia. Parathecium
well developed, 50-65 um thick, paraplectenchymatous, lumina of cells oval
or round, outer part brown and without crystals. Amphithecium present,
algae abundant, cortex poorly developed. Epihymenium brownish grey or pale
brown. Hymenium hyaline, sometimes with fine crystals (pol-, insoluble in K),
85-115 um tall. Paraphyses simple or slightly branched, constricted at septa,
1-3 apical cells slightly thickened, up to 5 um wide, or apical cells not thickened.
Hypothecium hyaline, sometimes with fine crystals (pol-, insoluble in K).
Asci 8-spored, spores polaribilocular or occasionally 1-locular, thin-walled,
11.5-15 x 6-9.5 um, isthmus ca. 1.7 um wide, often incomplete or poorly
formed. Pycnipia inconspicuous, immersed in thallus; conidia not observed.
SPOT TEST REACTIONS: thallus K+ violet, epihymenium and outer part of
parathecium K+ violet.
DIsTRIBUTION AND ECOLOGY — Caloplaca atroalba is widely distributed in
the temperate zone of North America (Wetmore 1994, 2007) and is reported
from Austria (Hafellner & Tiirk 2001) and Sweden (Santesson et al. 2004) in
Europe. It grows on calcareous and occasionally non-calcareous rocks such as
limestone, dolomite, or sandstone (data from MIN herbarium labels, Johnsen
1965, Wetmore 1994, Hafellner 2001).
In the Carpathians (Pieniny and Tatra Mts) and Gory Swietokrzyskie Mts,
the species grows on limestone and calcareous sandstones in sun-exposed sites
up to 1100 m. This is the first report of the species from Poland and Ukraine.
SPECIMENS EXAMINED — POLAND. Western Carpathians, Pieniny Mts, limestone
outcrops by Czorsztyn Castle, alt. ca. 600 m, 49°26 11”N/20°18'48”E, 5 Jun 2005, K. Wilk
3470b (KRAM); West Tatra Mts, Dolina Chochotowska valley, Polana Chochotowska
glade, alt. 1105 m, 49°1416”N/19°47°47”E, 16 Jul 2004, L. Sliwa 3118 (KRAM). Géry
Swietokrzyskie Mts, Kielce County: Wesota town above Wierna Rzeka river, hill near
railway, 31 Aug 1976, K. Toborowicz (KTC-6332).
ADDITIONAL MATERIAL EXAMINED — UKRAINE. Khmelnitskyi region, Kamianets
Podilskyi district, National Park “Podilskyi Tovtry”: Kitaihorod, 15 km SE of Kamianets
Podilskyi, 48°38'25”N/26°46'58"E, 24 Jun 2003, P Czarnota 3793 (KRAM), Bagota
on the Dniester near Stara Ushytsia, 30 km SE Kamianets Podilskyi, alt. 259 m,
48°35’ 10”N/26°59°57”E, 25 Jun 2003, J. Kiszka (KRAM-L 63304).
Caloplaca in Poland ... 87
here
section of apothecium; scale bar= 150 tum. C - ascospores; scale bar= 20 um.
COMMENTS — Caloplaca atroalba is characterized by a creamy brown,
epruinose, areolate thallus. The brown, epruinose apothecia usually have a
persistent thalline margin. Spores have a thin isthmus (ca. 1.7 um diam) and
are often poorly formed. The epihymenium is brown and K+ violet.
Caloplaca atroalba can be similar to C. albovariegata (B. de Lesd.)
Wetmore, C. chalybaea (Fr.) Mill. Arg., C. diphyodes (Nyl.) Jatta, C. pratensis
Wetmore, and C. variabilis (Pers.) Mull. Arg. According to Wetmore (1994),
C. atroalba is more common in Europe than currently thought but has been
often misidentified as C. diphyodes. The latter, however, differs by producing
spores with a wider isthmus (> 3 um diam.) and a shorter (usually < 100 um)
hymenium. An additional distinguishing feature is the parathecial structure,
which is prosoplectenchymatous in C. diphyodes (Wunder 1974, Oksner 1993,
Kondratyuk et al. 2004).
Caloplaca albovariegata can be distinguished from C. atroalba by its
distinct grey areolate thallus with areoles constricted at the base. Moreover,
C. albovariegata has a discontinuous algal layer (algal clusters separated from
one another by vertical columns of hyphae) and a necral layer over the cortex.
‘The species is known only from North America, but Wetmore (1994) notes that
it probably also occurs in Europe.
Caloplaca atroalba may also be confused with C. chalybaea and C. variabilis,
even though in the two latter species thalli and apothecia are covered by
conspicuous white pruina (hyaline crystals visible in section, pol+, insoluble
in K) and produce spores with considerably wider isthmuses. Moreover, the
apothecia of C. chalybaea are + immersed in the thallus and have a hypothecium
88 ... Wilk
that consists of distinct rows of small isodiametric cells (Wetmore 1994).
Finally, Wetmore (2009) recognises C. atroalba as a non-sorediate counterpart
of C. pratensis, recently described from North America.
Caloplaca dichroa Arup, Lichenologist 38: 13 (2006).
THALLUS epilithic, 0.1-0.4 mm thick, granular-areolate, sometimes with small
indistinct lobes at margin, yellow, yellowish orange or dark orange (Séguy
1936, color codes: 256, 257, 201), often occurring with yellow and orange
thalli side by side, prothallus seldom present, concolorous with thallus. Areoles
continuous to scattered, irregular, flat to convex, often with slightly incised
margins; blastidia and granules numerous on the surface and margin of areoles,
usually covering most of the thallus, 30-90 tm diam. Thallus cortex very thin,
up to 10 um; medulla with many yellow crystals. APOTHECIA zeorine, present
or absent, not abundant, scattered in the centre and near margins of the thallus,
slightly immersed at first, then sessile, round or flexuose when old, 0.5-1.5
mm diam.; disc flat, somewhat convex in old apothecia, orange (Séguy 1936,
color codes: 211, 246); proper margin concolorous with disc or slightly paler,
smooth; thalline margin thick and prominent at first, becoming reduced and
visible at the base of apothecia, smooth or crenulate, or alternatively tpersistent
and only slightly reduced. Parathecium thin or thick, prosoplectenchymatous,
lumina of cells oval or round. Amphithecium often reduced and visible only at
the base of apothecium, algae abundant and in groups. Epihymenium granular,
brownish yellow. Hymenium hyaline, 65-95 um tall. Paraphyses simple, slightly
branched or anastomosing, with oil droplets, 1-3(—5) apical cells thickened, up
to 5-8 um wide, or apical cells not thickened. Hypothecium hyaline, with oil
droplets, prosoplectenchymatous. Asci 8-spored, spores polaribilocular, thick-
walled (1-2 um wide), 10-15 x 5-8 um, isthmus 2.0-4.5 um wide. PycNIDIA
common, numerous, immersed; ostiolum orange; conidia colorless, bacilliform
2-3(-4) x 1 wm.
SPOT TEST REACTIONS: thallus K+ purple, medulla K-, epihymenium K+
purple.
DISTRIBUTION AND ECOLOGY — Caloplaca dichroa is widespread in Europe
(Arup 2006, Vondrak et al. 2009), where it grows on calcareous substrata such
as limestone rocks, boulders, pebbles, and (rarely) concrete and mortar (Arup
2006). It prefers sun-exposed sites, occurs at varying altitudes (Arup 2006,
Vondrak et al. 2007), and is typically inland, away from maritime influences
(Vondrak et al. 2009).
The species seems to be common in the Carpathian (Pieniny, Tatra, Beskid
Maty) mountain ranges on limestone and calcareous sandstones mainly in
sun-exposed sites, usually on south-facing vertical rock walls or upper rocky
outcrops at 500-1800 m. This is the first report of the species from Poland.
Caloplaca in Poland ... 89
SPECIMENS EXAMINED — POLAND. Western Carpathians, Beskid Maly Mts, Zamczysko
above Lysina village, alt. 756 m, 49°44°52”N/19°18'17"E, 22 Sept 2005, K. Wilk 3945b
(KRAM); Pieniny Mts, Zielone Skatki rocks by Czorsztyn lake, NE of Falsztyna, alt.
ca. 580 m, 49°25°56”N/20°17°35”E, 6 Jun 2005 and 12 Nov 2005, K. Wilk 3484, 3485,
4137, 4138 (KRAM); West Tatra Mts: Wawdéz Krakéw canyon, alt. 1100 m, 15 Jul 2004,
K. Wilk 2141 (KRAM), below Mnichy Chochotowskie, E of Skorusi Zleb, alt. 1300 m,
49°14’29"N/19°47°43”E, 19 Jul 2004, K. Wilk 2177 (KRAM), Mnichy Chochotowskie, S$
slope, alt. 1488 m, 49°14’40”N/19°47°42”E, 19 Jul 2004, K. Wilk 2183 (KRAM), Rzedy
below Ciemniak, alt. 1800 m, 49°13’75”N/19°53’80"E, 11 Jul 2004, K. Wilk 2109b, 2111
(KRAM).
ADDITIONAL MATERIAL EXAMINED — UKRAINE. Kamelnitskyi region, Kamianets
Podilskyi district, National Park “Podilskyi Tovtry”?, Privorita near Makiv, 10 km N
of Kamianets Podilskyi, alt. 223 m, 48°47°27”N/26°38'41”E, 25 Jun 2003, U. Bielczyk
(KRAM-L 48993).
COMMENTS — Caloplaca dichroa is characterized by a yellow or dark orange
granular-areolate thallus (often both color morphs occur side by side). It
produces vegetative propagules, such as blastidia and granules that usually
cover the thallus entirely. The distinctly thickened spore walls are diagnostic.
This species is included within the C. citrina group (Arup 2006). Specimens
of C. dichroa with thin, weakly developed thalli may be difficult to distinguish
from C. citrina (Hoffm.) Th. Fr, which is differentiated by its distinctly
sorediate, yellow-colored thalli and thin-walled spores. Caloplaca arcis (Poelt
& Vézda) Arup is distinguished from yellow-colored forms of C. dichroa by its
thicker thallus with distinct marginal lobes and thin-walled spores. According
to Vondrak et al. (2009), C. dichroa can also be confused with C. austrocitrina
Vondrak et al. and C. limonia Nimis & Poelt, but the latter two species produce
thicker thalli. Additionally, C. limonia produces larger vegetative diaspores and
a more intensely yellow thallus.
Caloplaca calcitrapa Nav.-Ros. et al., which also produces thick-walled, sand-
glass spores, is distinguished by its complete absence of vegetative diaspores
(Navarro-Rosinés et al. 2000).
Caloplaca dichroa has often been confused with C. coronata (Kremp. ex
Kérb.) J. Steiner, which produces a more distinctly isidiate thallus and smaller,
thin-walled spores (see Arup 2006 for comments).
Caloplaca marmorata (Bagl.) Jatta, Sylloge Lich. Ital.: 251 (1900).
THALLUS endolithic, without prothallus. AporHEciA pseudolecanorine,
abundant, scattered or in groups, immersed in rock at first, then sessile, round or
slightly angular by compression, 0.2-0.7 mm diam.,; disc flat or slightly convex,
more rarely strongly convex, rust to brownish orange (Séguy 1936, color code:
171, 172), epruinose; proper margin persistent, raised, particularly in young
apothecia rather thick, smooth, slightly paler than disc; thalline margin not
visible. Parathecium well developed, thick, 85-170 um, prosoplectenchymatous,
90 ... Wilk
lumina of cells oval. Amphithecium much reduced, algae grouped at the base
of apothecium. Epihymenium granular, reddish yellow. Hymenium hyaline,
85-110 um tall. Paraphyses simple or slightly branched, with irregular lumina,
1-4 apical cells slightly thickened, up to 5 wm wide. Hypothecium hyaline,
without crystals and oil droplets, prosoplectenchymatous. Asci 8-spored,
spores polaribilocular, thin-walled, 12.5-17 x 5.5-8.5 um, isthmus 1.5-3.5 um
wide. PycNIDIA not observed.
SPOT TEST REACTIONS: epihymenium K+ purple.
DIsTRIBUTION AND ECOLOGY — Caloplaca marmorata is widespread in Europe,
the Near East and north Africa (Navarro-Rosinés & Hladun 1996) and is also
reported from North America (Wetmore 2007). It is a pioneer taxon occupying
hard calcareous pebbles and rocks, e.g. pure limestone, marble, gypsum or
sandstones (Nimis & Poelt 1987, Nimis et al. 1996b, Navarro-Rosinés & Hladun
1996). It grows in sun-exposed and dry microhabitats at varying altitudes
(Nimis 1993, Navarro-Rosinés & Hladun 1996). The species is characteristic of
the association Caloplacetum lacteae-marmoratae Roux 2009.
In the Carpathians, the species was found only in Pieniny Mts, where it
grows on sun-exposed limestone sites at 500-1000 m. This is the first report
from Poland.
SPECIMENS EXAMINED — POLAND. Western Carpathians, Pieniny Mts, near summit of
Trzy Korony, 4 May 1957, J. Nowak (KRAM-L 4401); Mate Pieniny Mts: Dolina Biatej
Wody valley, near Jaworki village, 8 Jun 1968, Jj, Nowak (KRAM-L 18696), near Jaworki
village, Sottysie Skatki rocks, alt. 580 m, 49°24’20”N/20°32'30"E, 3 Jun 2005, K. Wilk
3395 (KRAM), Jaworki village, 1888, W. Boberski (KRAM-L 20914).
ADDITIONAL MATERIAL EXAMINED — UKRAINE. Kamelnitskyi region, Kamianets
poilskyi district, National Park ,,Podolskyi Tovtry”: Chotiri Kavalyeri near Vyerbka,
13 km N of Kamianets Podilskyi, alt. 289 m, 48°48'24”N/26°35'54”E, 25 Jun 2003, J.
Kiszka (KRAM-L 49147), Kitaihorod, 15 km SE of Kamianets Podilskyi, alt. 141 m,
48°38'25"N/26°46°58E, 24 Jun 2003, M. Kukwa (KRAM-L 48718), Tovtra Vyerbyetska
Reserve, alt. 289 m, 48°48’24”N/26°35’54”E, 25 Jun 2003, L. Sliwa 1964 (KRAM), ibid.,
A. Zalewska (KRAM-L 49328).
COMMENTS — Caloplaca marmorata is characterized by an endolithic thallus
and rusty or brownish orange, small apothecia with well developed proper
margins. The parathecium is thick, and the amphithecium is reduced but with
algae usually visible at the base of apothecium. The epihymenium is yellowish
red and the spores have a thin (< 3 um) isthmus.
The species belongs to the C. lactea group (Navarro-Rosinés & Hladun
1996), within which it could be confused with C. lactea (A. Massal.) Zahlbr.,
C. lacteoides Nav.-Ros. & Hladun, and C. nashii Nav.-Ros. et al. Caloplaca lactea
has orange apothecia, persistent and thin proper margins, and broadly ellipsoid
spores. Caloplaca lacteoides is differentiated by yellow, more rarely brownish
orange apothecia, simple paraphyses with strongly thickened apical cells, an
upper parathecium that is distinctly paraplectenchymatous, and very long
Caloplaca in Poland ... 91
(< 25 um) spores. Caloplaca nashii produces paler apothecia that are orange and
never brownish or rusty, a thin parathecium, simple paraphyses with narrow or
slightly thickened apical cells, and distinctly narrower spores (see also Navarro-
Rosinés et al. 2001).
Caloplaca oasis (A. Massal.) Szatala, Magyar Bot. Lapok 31: 120 (1932).
THALLUs strongly reduced and only some small granules or areoles visible at
thallus margin, pale yellow (Séguy 1936, color code: 290), rounded in shape;
without prothallus and vegetative propagules. APOTHECIA pseudolecanorine
or zeorine, abundant, crowded, sessile, round or angular by compression,
0.1-0.3 mm diam.; disc flat or slightly convex, orange (Séguy 1936, color codes:
196, 211), epruinose; proper margin very thin, not prominent, slightly raised
or level with disc, smooth, concolorous with or slightly paler than disc; thalline
margin much reduced, only in young apothecia visible. Parathecium thin, ca.
60 um, prosoplectenchymatous, hyphae radiating with oval to elongated cells.
Amphithecium +reduced, with numerous algae, cortex poorly developed.
Epihymenium granular, yellow. Hymenium hyaline, 75-85 um tall. Paraphyses
simple or slightly branched above, 1-2 apical cells thickened, up to 7 um wide.
Hypothecium hyaline, without crystals or oil droplets, prosoplectenchymatous,
hyphae irregular, ca. 40-50 um high. Asci 8-spored, spores polaribilocular,
thin-walled, 8.5-13.5 x (4.0-)4.8-6.8 tum, isthmus 3-5 um wide. PycNnipIa not
observed.
SPOT TEST REACTIONS: thallus K+ purple, medulla K-, epihymenium K+
purple.
DISTRIBUTION AND ECOLOGY — Caloplaca oasis, which is widespread in Europe
(Arup 2009), is also reported from Western Asia (John et al. 2004) and North
Africa (Thor & Nascimbene 2010). The species grows mainly on pure limestone,
concrete and mortar (Arup 2009), where it occurs as free living or a parasitic
lichen growing on endolithic Verrucaria s. lat. The species is characteristic for
the associations Aspicilietum calcareae Du Rietz 1925 emend. Roux 1978 and
Caloplacetum citrinae Beschel ex Klement 1955.
The species was found in the Carpathians (Gorce Mts) at elevations up to 550
m and in the Pomeranian lowlands, where it grows on calcareous sandstones
and concrete. ‘This is the first report of the species from Poland.
SPECIMENS EXAMINED — POLAND. Western Carpathians, Gorce Mts, Park Dworski in
Poreba Wielka, alt. 550m, 5 Oct 1993, P Czarnota(GPN 49/94). Pomeranian Voivodeship,
Wadzydze Landscape Park: Czarlina village, near bus stop, 13 Sept 2006, K. Wilk 7271
(UGDA), southern part of Wdzydze Tucholskie village, 53°58’05”N/17°55'°32”E, 13 Sept
2006, E. Adamska, W. Gruszka & L. Sliwa 3668a (UGDA).
COMMENTS — Caloplaca oasis is characterized by a reduced thallus and small
dark orange apothecia with thin proper margins.
92 ... Wilk
Arup (2009), who discusses the species in detail in the recent monograph
on the C. holocarpa group, notes that C. oasis has been often misidentified as
C. holocarpa (Ach.) A.E. Wade, especially when growing on anthropogenic
substrates. However, C. holocarpa produces more yellow-tinged apothecia with
thicker, more prominent proper margins and spores with a broader isthmus
(see Arup 2009). Well-developed parasitic C. oasis specimens may also be
confused with C. polycarpa (A. Massal.) Zahlbr., which can be distinguished by
larger apothecia with thicker margins and more distinct, thicker orange thalli
(see Arup 2009 for more details).
Caloplaca pseudofulgensia Gaya & Nav.-Ros., Biblioth. Lichenol. 101: 69 (2009).
THALLUS placodioid, rosettes 2-14 mm in diam., 0.1-0.4 mm thick, single or
often forming bigger congregations, yellow, creamy yellow, orange, brownish
orange, sometimes pale yellow to greenish yellow in shade (Séguy 1936, color
codes: 246, 226-230, 211-215), thallus in the centre often whitish, surface
rough, matt, pruinose (pruina concolorous with thallus); without prothallus
and vegetative propagules. Marginal lobes 0.5-2 mm long and 0.1-0.5(-0.8)
mm wide, closely adjacent to each other, richly and rather irregularly branched,
convex in the centre of thallus, but flat and slightly broadening at tips; surface of
lobes wrinkled and with delicate furrows along. Internal areoles flat to convex,
irregular or resembling small sublobules; young thallus often lacking internal
areoles, and then lobes forming from the centre. Thallus cortex distinct, thin
or sometimes thick, paraplectenchymatous, without necral layer, with hyaline
crystals (pol+, insoluble in K, soluble in N); algal layer tcontinuous; medulla
dense, with numerous hyaline crystals (pol+, insoluble in K, soluble in N).
APOTHECIA zeorine or pseudolecanorine, abundant, in centre of thallus, sessile
from the beginning, crowded, rarely scattered, round or angular and flexuose
by compression, 0.2-0.8(-1) mm diam.; disc flat, then convex, dark orange or
brownish orange (Séguy 1936, color codes: 186, 196, 201, 202), epruinose or
slightly pruinose; proper margin persistent, slightly paler than disc; thalline
margin present at first, then disappearing, thick, smooth or rough, even or
slightly cracked, pruinose; sometimes thalline margin excluded from the
beginning and only proper margin visible. Parathecium thin or thick, 25-60 tm,
prosoplectenchymatous, lumina of cells oval. Amphithecium well developed or
t+reduced, algaein groups orformingacontinuouslayer,sometimesamphithecial
tissue loose and with holes, with a paraplectenchymatous cortex, with hyaline
crystals (pol+, insoluble in K, soluble in N). Epihymenium granular, brownish
yellow. Hymenium hyaline, 65-90 um tall. Paraphyses simple or seldom
slightly branched, 1-2(-3) apical cells thickened, up to 6-6.5(-7.5) um wide.
Hypothecium hyaline, with numerous oil droplets, prosoplectenchymatous.
Asci 8-spored, spores polaribilocular, thin-walled, 7-13 x 3-6.5 um, isthmus
2.5-5 wm wide. Pycnip1A not observed.
Caloplaca in Poland ... 93
SPOT TEST REACTIONS: thallus K+ purple, J-, N-, medulla K-, J-, N-,
epihymenium K+ purple.
DIsTRIBUTION AND ECOLOGY — Caloplaca pseudofulgensia is widespread in
Europe (Gaya 2009), where it grows on calcareous rocks in warm and sun-
exposed places on north-exposed vertical walls. This nitrophilous species
belongs to the association Caloplacetum arnoldii Clauzade & Roux 1975 (corr.
Roux 2009; see also Gaya 2009).
The species was found in the Carpathian Pieniny and Tatra mountain
ranges, where it is not rare. It grows on limestone in sun-exposed to shaded
sites, mostly on vertical rock walls at 500-1700 m. This is the first report of the
species from Poland.
EXxsICCATES SEEN — Arnold, Lich. Exsicc. 1372 (sub Physcia pusilla) (KRAM).
SPECIMENS EXAMINED — PoLAND. Western Carpathians, Male Pieniny Mts, near
Jaworki village, Soltysie Skatki rocks, alt. 580 m, 49°24’20”N/20°32’30”E, 3 Jun 2005,
K. Wilk 3415 (KRAM); West Tatra Mts: Gtadkie Jaworzynskie, 18 Aug 1925, J. Motyka
(KRAM-L 10527), Dolina Koécieliska valley, 16 Jul 1912, W. Augustynowicz (KRAM-L
571), Dolina KoScieliska valley, alt. 1000 m, 25 Jul 2004, K. Wilk 2264 (KRAM), Stoly
above Dolina Koéscieliska valley, S slope, alt. 1400 m, 26 Jul 2004, K. Wilk 2277 (KRAM),
Waw6z Krakow canyon, alt. 1100 m, 15 Jul 2004, K. Wilk 2155 (KRAM), Waw6z Krakow
canyon, slope of Saturn, alt. 1500 m, 29 May 1959, J. Nowak (KRAM-L 8868), Kominy
Tylkowe, by trail from Przetecz Iwaniacka pass, alt. 1700 m, 5 Jul 1955, J. Nowak (KRAM-
L 4796), Kalacka Turnia, above Suchy Zleb, 9 Jul 1957, J. Nowak (KRAM-L 2472),
below Mnichy Chochotowskie, E of Skorusi Zleb, alt. 1300 m, 49°14’29”N/19°47°43”E,
19 Jul 2004, K. Wilk 2178 (KRAM), W slope of Wielka Swistéwka, in the direction to
Kobylaszowy Zleb, 27 Jun 2004, A. & M. Ronikier (KRAM-L 55074); High Tatra Mts,
Kalacka Turnia, alt. 1300 m, 9 Jul 1957, J, Nowak (KRAM-L 122).
ADDITIONAL MATERIAL EXAMINED — SLOVAKIA. SPI8, [uboviia Castle, s.d., s.coll.
(KRAM-L 20803).
COMMENTS — Caloplaca pseudofulgensia is characterized by a placodioid,
yellow to orange thallus covered by a distinct, concolorous pruina. Marginal
lobes are flat and broad at tips and the lobe surfaces are wrinkled and furrowed.
Dark orange apothecia contrast with the thallus.
The species belongs to the C. saxicola group (Gaya 2009), of which C. pusilla
is the most similar. However, C. pusilla produces robust, convex, bigger, less
branched lobes with surfaces that have neither wrinkles nor furrows and
a thallus that is often salmon colored and white pruinose; furthermore its
apothecia, which are initially immersed in the thallus, produce bigger spores.
Caloplaca saxicola (Hoffm.) Nordin differs from C. pseudofulgensia in its
intensely orange, epruinose, smooth thallus. The thalline lobes, which are
usually short to strongly reduced, convex, ascend slightly from the rock surface.
Its apothecia, which are initially immersed in the thallus before becoming
sessile and aggregated, produce bigger spores.
94 ... Wilk
Morphologically, C. pseudofulgensia can be very similar to C. aurea (Schaer.)
Zahlbr., a species that belongs to another taxonomical group but which produces
1- or polaribilocular spores with pointed apices and a greatly reduced isthmus
and considerably longer (< 20 um) size. Caloplaca aurea also produces a thicker,
epruinose thallus that does not form the rosettes typical of C. pseudofulgensia.
Caloplaca pusilla (A. Massal.) Zahlbr., Annal. Naturhist. Hofmuseums
Wien 4: 353 (1889).
THALLUs placodioid, rosettes 2-10 mm in diam., 0.3-0.4 mm thick, single or
usually forming bigger congregations, yellow ochre, pinkish or salmon, often
whitish in the centre (Séguy 1936, color codes: 185, 189-190, 203, 205, 215),
surface white pruinose, especially in the centre of thallus, where necrosis may
also occur; without prothallus and vegetative propagules. Marginal lobes 0.5-2
mm long and 0.2-0.5 mm wide, closely adjacent to each other or sometimes
overlapping, convex or flat and broad at tips. Internal areoles convex, rounded
to elongated, or areoles absent and lobes forming from the centre. Thallus
cortex thin to thick, 13-80 um, scleroplectenchymatous, without necral
layer; layer of algae not continuous; medulla loose, with or without crystals.
APOTHECIA zeorine or pseudolecanorine, abundant, in centre of thallus,
crowded or scattered, immersed at first, then sessile and often constricted at the
base, rounded or angular by compression, 0.2-1 mm diam.; disc flat or slightly
convex, dark orange, brownish orange or blood-red, more rarely reddish
orange (Séguy 1936, color codes: 126, 161, 168, 171, 186, 202, 247), sometimes
slightly white pruinose; proper margin persistent, slightly raised or level with
disc, concolorous with disc or slightly paler; thalline margin persistent or
disappearing, sometimes heavily white pruinose. Parathecium thin, 30-42
um, sclero-prosoplectenchymatous. Amphithecium with numerous algae in
groups or forming a continuous layer, sometimes amphithecial hyphae loose,
cortex thick, with crystals. Epihymenium granular, brown or reddish golden.
Hymenium hyaline, 60-90 pm tall. Paraphyses simple or slightly branched,
1-2(-4) apical cells thickened, up to 8(-10) um wide. Hypothecium hyaline,
without oil droplets and crystals, prosoplectenchymatouseous. Asci 8-spored,
spores polaribilocular, thin-walled, 8.5-15 x 4-8.5 uum, isthmus 2.5-5 tum wide.
Pycnipia infrequent, inconspicuous, immersed; conidia colorless, ellipsoid to
bacilliform, 3 x 1.5 um.
SPOT TEST REACTIONS: thallus K+ purple, J-, N-, medulla K-, J-, N-,
epihymenium K+ purple.
DIsTRIBUTION AND ECOLOGY — ‘The widely distributed Caloplaca pusilla is
probably cosmopolitan (Gaya 2009). The species grows on natural calcareous
rocks and mortar, is known from varying altitude and exposures, and prefers
eutrophic environments. It is characteristic of the association Caloplacetum
Caloplaca in Poland ... 95
pusillae Du Rietz ex Kaiser 1926 but may also be found in the Caloplacetum
arnoldii association (see Gaya 2009).
The species, which appears widely distributed in Poland, was found in
the Carpathians (Gorce and Pieniny Mts) and in the lowlands in Warmian-
Masurian province. More herbaria materials need revision to determine the
true distribution, because C. pusilla has previously been filed under the name
C. saxicola (Fattynowicz 2003). In Poland the species occurs on limestone,
calcareous sandstones, and (commonly) concrete in sunny sites at up to
980 m.
SPECIMENS EXAMINED — POLAND. Western Carpathians, Gorce Mts, Boginka
rock, above valley of Lubarski stream, alt. 680 m, 15 Aug 1967, K. Glanc (KRAM-
L 27476); Pieniny Mts: Popieska Skatka rock by Sronowickie lake, alt. 560 m,
49°24’48"N/20°19°50"E, 5 Jun 2005, K. Wilk 3457 (KRAM), below summit of Trzy
Korony, 4 May 1957, J. Nowak (KRAM-L 3786, KRAM-L 3790), Czorsztyn, s.d., s.coll.
(KRAM-L 20787), Podtazce, 10 Oct 1999, J. Kozik (PPN), Ociemny Wierch, 5 May 1955,
J. Nowak (KRAM-L 3245), Zielone Skatki rocks by Czorsztyn lake, NE of Falsztyna,
alt. 588 m, 49°25’56"N/20°17°35”E, Nov 2005, K. Wilk 4131 (KRAM); Male Pieniny
Mts, Zabaniszcze, Gora Trzy Skatki Mt., alt. 740 m, Aug 1980, K. Toborowicz (KTC).
Warmian-Masurian province, Gizycko County, Szymonka village, concrete bridge
among meadows, 11 Jun 1974, L. Olesinski (KRAM-L 30631).
COMMENTS — Caloplaca pusilla is characterized by a placodioid, yellow ochre,
pinkish or salmon colored thallus with long and + convex marginal lobes that
are tightly attached to the substratum.
Caloplaca pusilla, which was was treated as a synonym of C. saxicola for
many years, has been just recently recovered as independent by Gaya (2009).
Caloplaca saxicola differs from C. pusilla by an epruinose thallus with short to
strongly reduced lobes that ascend distinctly from the rock, apothecia that are
initially immersed in thallus and form finely, bigger and strongly aggregated
clusters. The spores of C. saxicola are longer and narrower than in C. pusilla. To
distinguish C. pusilla from C. pseudofulgensia, see remarks under that species.
Caloplaca pusilla often grows together with C. arnoldii (Wedd.) Zahlbr.
and C. clauzadeana (Gaya) Nav.-Ros. & Cl. Roux. In comparison to C. pusilla,
C. arnoldii has a distinctly reddish and smaller thallus, whereas C. clauzadeana
has strongly convex lobes with yellowish tips and much narrower ellipsoid
spores. For more details see Gaya (2009).
Acknowledgements
I am grateful to E. Gaya (Durham, USA) and U. Arup (Lund, Sweden) for peer-
reviewing the manuscript and providing valuable suggestions and improvements.
I also thank L. Sliwa (Krakow, Poland) for revising and commenting an early version
of the paper. U. Arup is acknowledged for confirming the C. dichroa identification. The
curators of the herbaria are thanked for sending the material for study. CM. Wetmore
(St. Paul, USA) is thanked for hospitality and constructive discussions during my visit
96 ... Wilk
to the Minnesota herbarium. Financial support was provided by the Ministry of Science
and Higher Education, grant no. N N303 294334.
Literature cited
Alstrup V, Olech M. 1988. Additions to the lichen flora of the Polish Tatra Mountains. Zeszyty
Naukowe Uniwersytetu Jagielloriskiego [Prace Botaniczne] 17: 179-183.
Alstrup V, Olech M. 1992. Additions to the lichen flora of the Polish Tatra Mountains. III. Zeszyty
Naukowe Uniwersytetu Jagielloriskiego [Prace Botaniczne] 24: 179-184.
Arup U. 2006. A new taxonomy of the Caloplaca citrina group in the Nordic countries, except
Iceland. Lichenologist 38(1): 1-20. doi:10.1017/S0024282905005402
Arup U. 2009. The Caloplaca holocarpa group in the Nordic countries, except Iceland. Lichenologist
41(2): 111-130. doi:10.1017/S0024282909008135
Bielczyk U. (ed.). 2003. The Lichens and Allied Fungi of the Polish Carpathians - An Annotated
Checklist. Biodiversity of the Polish Carpathians, Vol. 1, W. Szafer Institute of Botany, Polish
Academy of Sciences, Krakéw. 342 pp.
Bungartz F. 2002. Morphology and anatomy of the fertile structures. 24-35, in: Nash TH II, Ryan
BD, Gries C, Bungartz F. (eds.), Lichen Flora of the Greater Sonoran Desert Region. 1. Tempe:
Lichens Unlimited, Arizona State University.
Ceynowa-Gieldon M, Adamska E. 2005. Caloplaca ruderum, a lichen species new to Poland. Polish
Botanical Journal 50(1): 75-76.
Clauzade G, Roux C. 1985. Likenoj de Okcidenta Europo. Ilustrita Determinlibro. Bulletin de la
Société Botanique du Centre-OQuest, Nouvelle Série - Numéro Spécial 7. Royan, France. 893
Pp.
Eitner E. 1901. II Nachtrag zur Schlesischen Flechtenflora. Jahresbericht der Schlesischen
Gesellschaft fiir vaterlandische Cultur 78: 5-27.
Faltynowicz W. 2003. The lichens, lichenicolous and allied fungi of Poland. An annotated checklist.
W. Szafer Institute of Botany, Polish Academy of Sciences, Krakow. 435 pp.
Gaya E. 2009. Taxonomical revision of the Caloplaca saxicola group (Teloschistaceae, lichen-
forming Ascomycota). Bibliotheca Lichenologica 101: 1-191.
Glanc K, Tobolewski Z. 1960. Porosty Bieszczadéw Zachodnich. Poznanskie Towarzystwo Przyjaciét
Nauk. Wydziat Matematyczno-Przyrodniczy. Prace Komisji Biologicznej 21(4): 1-108.
Hafellner J. 2001. Bemerkenswerte Flechtenfunde in Osterreich. Fritschiana 28: 1-30.
Hafellner J, Tiirk R. 2001. Die lichenisierten Pilze Osterreichs - Eine Checkliste der bisher
nachgewiesenen Arten mit verbreitungsangaben. Stapfia 76: 1-167.
John V, Seaward MRD, Sipman HJM, Zedda L. 2004. Lichens and lichenicolous fungi from Syria,
including a first checklist. Herzogia 17: 157-177.
Johnsen AB. 1965. Some lichens from West Fork, Coconino County, Arizona. Bryologist 68(2):
241-243. doi:10.2307/3241026
Kondratyuk S, Khodosovtsey A, Oksner AN. 2004. Caloplaca. 38-235, in: Khodosovtsev A,
Kondratyuk S, Makarova I, Oksner A. (eds.), Handbook of the lichens of Russia. 9. Fuscideaceae,
Teloschistaceae. Russian Academy of Sciences, St. Petersburg.
Muggia L, Grube M, Tretiach M. 2008. A combined molecular and morphological approach to
species delimitation in black-fruited, endolithic Caloplaca: high genetic and low morphological
diversity. Mycological Research 112: 36-49. doi:10.1016/j.mycres.2007.02.001
Navarro-Rosinés P, Hladun NL. 1996. Les especies saxicolo-calcicolas del grupo de Caloplaca lactea
(Teloschistaceae, liquenes), en las regiones mediterranea y medioeuropea. Bulletin de la Société
linnéenne de Provence 47: 139-166.
Caloplaca in Poland ... 97
Navarro-Rosinés P, Gaya E, Hladun NL. 2001. Caloplaca nashii sp. nov. (Teloschistaceae, Lichenes),
a North American species of the C. lactea-group growing in caliche. Mycotaxon 79: 29-41.
Navarro-Rosinés P, Gaya E, Roux C. 2000. Caloplaca calcitrapa sp. nov. (Teloschistaceae) un nuevo
liquen saxicolo-calcicola mediterrdneo. Bulletin de la Société linnéenne de Provence 51:
145-152.
Nimis PL. 1992. Chiavi analitiche del genere Caloplaca Th. Fr. in Italia (Lichenes, Teloschistaceae).
Notiziario della Societ¢ Lichenologica Italiana 5: 9-28.
Nimis PL. 1993. The Lichens of Italy. An annotated catalogue. Monografia XII. Bollettino del
Museo Regionale di Scienze Naturali — Torino. 897 pp.
Nimis PL, Poelt J. 1987. The lichens and lichenicolous fungi of Sardinia (Italy): an annotated list.
Studia Geobotanica 7 (Supplement 1): 1-269.
Nimis PL, Monte M, Tretiach M. 1987. Flora e vegetazione lichenica di aree archeologiche del
Lazio. Studia Geobotanica 7: 3-161.
Nimis PL, Ottonello D, Tretiach M. 1996a. Some new or interesting lichen records from Taormina
(E Sicily). Bollettino del Museo Regionale di Scienze Naturali — Torino 14(1): 117-138.
Nimis PL, Poelt J, Tretiach M. 1996b. Lichens from the gypsum Park of the northern Apennines (N
Italy). Cryptogamie, Bryologie Lichenologie 17(1): 23-38.
Nowak J. 1960. Naskalne zespoly porost6w Wyzyny Krakowsko-Czestochowskiej [Saxicolous
associations of the lichens of Cracow-Czestochowa Upland]. Fragmenta Floristica et
Geobotanica 6: 22-392.
Nowak J. 1961. Porosty Wyzyny (Jury) Krakowsko-Czestochowskiej [The lichens of the Krakéw-
Czestochowa Upland]. Monographiae Botanicae 11(2): 1-128.
Nowak J, Tobolewski Z. 1975. Porosty polskie. Opisy i klucze do oznaczania porostéw w Polsce
dotychczas stwierdzonych lub prawdopodobnych. Paristwowe Wydawnictwo Naukowe,
Warszawa — Krak6éw. 1177 pp.
Oksner AM. 1993. Flora lishaynikiv Ukraini. Vol. 2(2). Naukova Dumka, Kiiv. 541 pp.
Roux C, Bultmann H, Navarro-Rosinés P. 2009. Syntaxonomie des associations de lichens saxicoles-
calicoles du sud-est de la France. 1. Clauzadeetea immersae, Verrucarietea nigrescentis, Incertae
saedis. Bulletin de la Société linnéenne de Provence 60: 151-175.
Ryan BD, Bungartz F, Nash TH HI. 2002. Morphology and anatomy of the lichen thallus. 8-23, in:
Nash TH III, Ryan BD, Gries C, Bungartz F. (eds.), Lichen Flora of the Greater Sonoran Desert
Region. 1. Lichens Unlimited, Arizona State University, Tempe, Arizona.
Santesson R, Moberg R, Nordin A, Tonsberg T, Vitikainen O. 2004. Lichen-forming and
Lichenicolous Fungi of Fennoscandia. Museum of Evolution, Uppsala University, Uppsala,
Sweden. 359 pp.
Séguy E. 1936. Code Universel des Couleurs. Encyclopédie Pratique du Naturaliste 30. Paul
Lechevalier, Paris.
Sliwa L, Wilk K. 2008. Is a remarkable species — Caloplaca flavescens (lichenized fungi) — new to the
Polish lichen biota? Acta Mycologica 43(2): 207-213.
Thor G, Nascimbene J. 2010. An annotated checklist and bibliography of lichens and lichenicolous
fungi of Libya. Cryptogamie Mycologie 31(1): 67-95.
Tobolewski Z. 1956. Materialy do flory porostow Tatr. Poznariskie Towarzystwo Przyjaciét Nauk.
Wydziat Matematyczno-Przyrodniczy. Prace Komisji Biologicznej 17(2): 3-34.
Tobolewski Z. 1958. Porosty Pienin. Poznariskie Towarzystwo Przyjaci6t Nauk. Wydziat
Matematyczno-Przyrodniczy. Prace Komisji Biologicznej 17(5): 1-124.
Tretiach M, Muggia L. 2006. Caloplaca badioreagens, a new calcicolous, endolithic lichen from
Italy. Lichenologist 38(3): 223-229. doi:10.1017/S0024282906005305
98 ... Wilk
Tretiach M, Pinna D, Grube M. 2003. Caloplaca erodens [sect. Pyrenodesmia], a new lichen species
from Italy with an unusual thallus type. Mycological Progress 2(2): 127-136. doi:10.1007/
$11557-006-0050-7
Vondrak J, Kocurkova J, Palice Z, Li8ka J. 2007. New and noteworthy lichens in the Czech Republic
— genus Caloplaca. Preslia 79: 163-184.
Vondrak J, Riha P, Arup U, Sechting U. 2009. The taxonomy of the Caloplaca citrina group
(Teloschistaceae) in the Black Sea region; with contributions to the cryptic species concept in
lichenology. Lichenologist 41(6): 571-604. doi:10.1017/S0024282909008317
Wetmore CM. 1994. The lichen genus Caloplaca in North and Central America with brown or
black apothecia. Mycologia 86(6): 813-838. doi:10.2307/3760596
Wetmore CM. 2007. Caloplaca. 179-220, in: Nash TH IU, Gries C, Bungartz F. (eds.), Lichen Flora
of the Greater Sonoran Desert Region. 3. Tempe: Lichens Unlimited, Arizona State University.
Wetmore CM. 2009. New species of Caloplaca (Teloschistaceae) from North America. Bryologist
112(2): 379-386. doi:10.1639/0007-2745-112.2.379
Wilk K. 2008. Kalcyfilne gatunki rodzaju Caloplaca w polskich Karpatach Zachodnich. Doctoral
thesis, W. Szafer Institute of Botany, Polish Academy of Sciences, Krakéw. 158 pp.
Wilk K, Flakus A. 2006. Four species of Caloplaca (Teloschistaceae, lichenized Ascomycota) new to
Poland. Mycotaxon 96: 61-71.
Wunder H. 1974. Schwartzfruchtige, saxicole Sippen der Gattung Caloplaca (Lichenes,
Teloschistaceae) in Mitteleuropa, dem Mittelmeergebiet und Vorderasien. Bibliotheca
Lichenologica 3: 1-186.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 99-106 January-March 2011
DOT: 10.5248/115.99
Aspicilia subfarinosa, the correct name for A. substerilis
AYHAN SENKARDESLER™ & MOHAMMAD SOHRABI?
‘Biology Department, Faculty of Science, Ege University, 35100 Izmir, Turkey
?Plant Biology, Department of Biological and Environmental Sciences,
PO. Box 65, 00014, Helsinki University, Finland
e& Department of Plant Science, University of Tabri, 51666, Tabriz, Iran
AsstTractT— Lecanora subfarinosa is lectotypified and transferred to the genus Aspicilia, where
it is recognized as the correct name for A. substerilis. Lecanora farinosa f. subopegraphoides,
which is also lectotypified, is reduced to a synonym of A. subfarinosa. Aspicilia subfarinosa is
newly reported from France, Israel, Iran, Iraq, and Turkey.
Key worps— Ascomycetes, Croatia, Greece, Italy, Syria
Introduction
We began our study of Aspicilia in SW Asia by examining all available
types, which gave us an opportunity to look for earlier names for A. substerilis
(Sipman 2007), aname recently published for a widespread, common species in
our study area that has been confused with A. farinosa (Flérke) Hue. However,
determination of the earliest available name was made difficult because so many
new species have been described from the arid lands of SW Asia (Azerbaijan,
Iran, Iraq, Lebanon, Syria and Turkey), SE Europe (Greece), and N Africa
(Algeria, Egypt, Tunisia).
Aspicilia appears particularly diverse in SW Asia, where Julius Steiner
described 44 representatives of Lecanora sect. Aspicilia (Steiner 1893, 1894,
1895, 1898, 1899, 1902, 1904, 1905, 1909, 1910, 1919a, b, 1921). R.G. Werner
next described 18 new taxa in Aspicilia (Maire & Monod 1950, Werner 1936,
1938, 1954, 1956, 1957a,b, 1963, 1966, 1979). O. Szatala described 10 more
species (Szatala 1929, 1931, 1939, 1941, 1943, 1956), and another 10 were
proposed by A.N. Oxner (Kopaczevskaja et al. 1971, Oxner 1929, 1933, 1939,
1940). Altogether 55 (of 82) taxa described from SE Europe and SW Asia
appeared as potential older names for A. substerilis. Of these, 27 taxa had either
been originally proposed at or later raised to the species level prior to Sipman’s
100 ... Senkardesler & Sohrabi
500 1.000 Kilometers
(a ae Ser
Figure 1. Distribution of Aspicilia subfarinosa.
A = Localities cited in Sipman (2007), @ = Specimens examined.
2007 description of A. substerilis. Examination of the 27 types revealed that
one, Lecanora subfarinosa, was conspecific with Aspicilia substerilis. Among the
remaining 28 infraspecific taxa, only the type specimen of Lecanora farinosa f.
subopegraphoides appeared to be also conspecific with Aspicilia substerilis.
Materials & methods
The study presented here is based mainly on herbarium material kept in BC, BCN,
BP, G, GZU, KW, W and WU. Most of type specimens in Aspicilia slat. described by
A.N. Oxner, J. Miller Argoviensis, J. Steiner, O. Szatala and R.G. Werner have been
revised. Extensive herbarium collections of Aspicilia calcarea and A. farinosa (incl.
synonyms) were examined by the first author. The specimens were studied in the usual
way by stereomicroscope and compound microscope, and all measurements (ascospores,
conidia, and other apothecial structures) were made in microscopic preparations in
tap water. To study ascus structure, Lugol’s solution was added to sections and squash
preparations after pre-treatment with 10% KOH.
Selected specimens were analysed for secondary metabolites by high performance
thin-layer chromatography (HPTLC) in accordance with Arup et al. (1993), using a
CAMAG Nanomat 4 sample applicator and a CAMAG Horizontal Development
Chamber.
Additional specimen information obtained from collection labels is presented in
English. Label data is abbreviated where necessary and reorganized for easy access with
site information preceding collection data.
Aspicilia subfarinosa correct name for A. substerilis ... 101
Taxonomy
Aspicilia subfarinosa (J. Steiner) Senkard. & Sohrabi, comb. nov. Fic. 2
MycoBank MB 518413
= Lecanora subfarinosa J. Steiner, Ann. Naturhist. Mus. Wien 34: 38 (1921).
Typus: [Syria] Mesopotamia, in summo cacumine Tschil Miran montium Dschebel
Sindschar, ad rupes substrato calcareo, ca. 1400 m, 9.6.1910, H.F. von Handel-Mazzetti
3297 (W 1920-827!-lectotypus, hic designatus, W 1929-2110!-isolectotypus)
= Aspicilia substerilis Sipman, Biblioth. Lichenol. 96: 267 (2007), syn. nov.
Typus: “Greece, W Aegean, Nomos Evvias, Eparchia & Dimos Karistos: E Evvia,
Agios Dimitrios Gorge, c. 350 m., calcareous, N-facing cliffs and boulders along
dry stream in ravine, 30.9.2005, H. Sipman & Th. Raus 54305 [B-holotype, Sipman
(2007)]
= Lecanora farinosa f. subopegraphoides Werner, Bull. Soc.
Bot. France 103(7-8): 462 (1956), syn. nov.
= Aspicilia farinosa f. subopegraphoides (Werner) S.Y. Kondr., in
Kondratyuk & Zelenko, Ukr. Bot. Zhurn. 59: 603 (2002).
Typus: “Syrie: monts Ansarieh (Alaouites), région de Slenfé, versant Est dans le
Cedretum, 1200-1300 m., sur les rochers calcaires, 27.8.1938, R.G. Werner” (BC!-
lectotypus, hic designatus, BC!-isolectotypus).
ECOLOGY AND DISTRIBUTION— On the upper surface of well-lit, exposed limestone
outcrops. Widespread in the Mediterranean (Fic. 1).
KEY CHARACTERS— ‘This species is characterized by a thin, continuous to
fissured, chalky-white thallus with farinose surface, apothecia separated from
thallus by a fissure when dry, 4-spored asci, medium sized to large ascospores
of 20-37 x 20-25 um in size, rather short to medium sized conidia of 7-18 um
in length, and by the absence of secondary metabolites.
EXPANDED DESCRIPTION [based on Steiner (1921), Sipman (2007), and our
own observations]— Thallus crustose, forming large patches usually over 5
cm wide, chalky white, farinose, continuous or more or less fissured around
the ascocarps, 0.1-1.5 mm thick; margins without black prothallus, but with a
groove between two adjacent thalli; cortex with paraplectenchymatous tissue
constructed of less branched, moniliform-like and perpendicular hyphae and
occasionally with a necrotic layer up to 60 tm thick; algal layer c. 60 «um thick,
filled with small crystals; medulla white or occasionally becoming ochre in
lower parts, composed of branched and reticulate hyphae and filled by larger, c.
5-10 um wide crystals. Apothecia c. 0.2-0.8(-1.0) mm wide, immersed in the
thallus and separated from it by a fissure when dry, without thalline margin,
rounded or lobulate to elongate, often in groups seemingly originating from
disintegrated larger apothecia, with grey, white-pruinose, concave disc and
white, raised margins and sterile ridges (columellae); hymenium 100-150
pum tall, hyaline, clear, I+ persistently weak blue or partly turning to yellow;
paraphyses in upper parts branched and submoniliform and 4-5 um wide,
in lower part 2.5-4 tum wide, loose, not branched; epithecium dark brown to
102 ... Senkardesler & Sohrabi
green, N+ green; hypothecium colourless, without algal layer below; asci of
Aspicilia-type, subclavate, usually sterile, c. 95-130 x 23-44 um; ascospores
simple, hyaline, 2-4 in asci, c. 20-37 x 16-35 um, usually absent. Pycnidia
immersed, flask-like, with a black and punctiform ostiole; conidia filiform,
straight, 6-18 x 0.6-1 um.
SECONDARY METABOLITES— None detected by HPTLC.
ADDITIONAL SPECIMENS EXAMINED: FRANCE: Forcalquier, Les Moures, Provence,
600 m — on calcareous stone, 18 Aug. 1969, G. Clauzade & X. Llimona (BCN-lich. 41
as A. farinosa). ISRAEL: C. Negev, NEAR AVDATH — on calcareous stone, 16 Apr. 1974,
}. Garty 36(7 as L. farinosa) (GZU s.n as L. farinosa); NEAR BEER-SHEBA, Nizana road
— on hard limestone, 17 Mar. 1947, Y. Gutter (BCN-lich. 279 as L. farinosa). IRAN:
Lorestan Prov., ALIGUDARZ DISTRICT, Oshtran Kouh, “Schuturun Kuh, Luristan’ — no
date, S.D. Strauss (W s.n. as L. farinosa); East Azerbaijan, MARAND DISTRICT 32 km N of
Marand, 38.6763 N, 45.6573 E, 1440 m — 2 Nov. 2007, M.Sohrabi, H.Sipman, U.Sachting
& M.R. Asef. (hb. Sohrabi, MS010094). IRAQ: ‘Mesopotamia, SEIRAMUN prope Mossul,
ca. 250 m — on calcareous stone, no date, H.R von Handel-Mazzetti, as L. farinosa
(WU 40899); Kurdistania Turcica, MosuL, ON MAR JakuB — Jun 1910 F Nabelek (BP
42430 as L. farinosa); ca. 800 m — no date, Nabelek (W s.n. as A. farinosa). SYRIA: Ain
Arus, between Rakka & Urea, near Dschidle (Dicle), at Belich R. spring, ca. 350 m
— on calcareous stone, 3 Jul. 1910, H.E von Handel-Mazzetti 1843 (W 1929-15582 as
L. farinosa, with L. platycarpa f. pruinosa & L. contorta var. glaucopruinosa); Dschebel
Sindschar, NEAR DscHADDALE between Dschaddale & El Chattunije, ca. 600 m — on
tufa-like calcareous stone, 10 Jun. 1910, H.E von Handel-Mazzetti 1543 (WU 40901 as L.
farinosa); EL MAGHARAD MT on SINDSCHAR, ca. 700-1000 m — on calcareous stone, 8
Jun. 1910, H.R von Handel-Mazzetti 1375 (WU 40903 as L. farinosa); ca. 1000 m — on
calcareous stone, 9 Jun. 1910, H.R von Handel-Mazzetti 1437 (WU 40897 as L. farinosa);
TscuiL Mt. sumMIT, ca. 1400 m — on calcareous stone, 9 Jun. 1910, H.E. von Handel-
Mazzetti 3295 (WU 40894 as L. farinosa); Haleb (Aleppo), near train station, ca. 380
m — on calcareous stone, 15 Mar. 1910, H.E von Handel-Mazzetti 162 (WU 40900 as
L. farinosa); Alaouites, QAsTAL EL Moag, in Baér 40 km from Lattaquié (Muhafazah)
on the road to Antioche (Hatay) — on calcareous-siliceous stone, 3 Sep. 1938, R.G.
Werner, (BC s.n. as L. farinosa f. subopegraphoides jointly with type specimens of L.
angulata). TURKEY: Bithynia, OsMANKGJ (OsMANKOy), Gdkszu (Géksu), in tree grove
on limestone cliff, 300 m — 6 Oct. 1918, I. Gyérffy de Szigeth (BP 42433 as “L. calcarea
var. concreta f. farinosa”); BANK OF TiGRipIs (TiGRIS) RIVER BETWEEN SERT (SIIRT)
& DsSCHESIRET-IBM-OMAR (CIZRE), near Fiindiik, ca. 1100 m — on calcareous stone,
18 Aug. 1910, H.R von Handel-Mazzetti 3036 (W 1929-15666 & WU 40893, both as L.
farinosa); between Balak & Fiindiik, ca. 500 m — on calcareous stone, 18 Aug. 1910, H.F
von Handel-Mazzetti 3018 (WU 40893 as L. farinosa) & 3041 (WU 40904 as L. farinosa).
Afyon, S6GUT Mrs, between Korpeli & Sankéy, 3rd km, 37°54.96’ N, 30°06.16’ E, 1160
m — 24 Jun. 2009, A. Senkardesler (EGE 39734); AHIR Mt, between Arizlar & Cepni,
3rd km, 38°34.02’ N, 30°03.90’ E, 1300 m — 23 Apr. 2010, A. Senkardesler (EGE 39735);
between Yaga & Calhisar, 4rd km, 38°39.90’ N, 30°04.26’ E, 1490 m — 23 Apr. 2010,
A. Senkardesler (EGE 39736); between Arharim & Karadirek, 2nd km, 38°36.00° N,
30°11.28’ E, 1280 m — 23 Apr. 2010, A. Senkardesler (EGE 39737); between Gedikevi &
Alibeyce, Ist km, 39°08.82’ N, 31°04.56’ E, 1130 m — 24 Mai 2010, A. Senkardesler (EGE
39738); between Salihler & Toklucak, Ist km, 39°02.88’ N, 31°22.74 E, 980 m — 24
Mai 2010, A. Senkardesler (EGE 39739). SULTAN Mrs, 0.5 km south of Kirca, 38°30.60°
Aspicilia subfarinosa correct name for A. substerilis ... 103
subfarinosa (EGE 39735, central), with the deeply cracked-areolate surface of A. calcarea (EGE
39735, left; EGE 39735, right).
N, 31°13.86’ E, 1120 m — 25 Mai 2010, A. Senkardesler (EGE 39740); between Pazaragac
& Inli, 5th km, 38°31.80’ N, 30°49.38’ E, 1060 m — 25 Mai 2010, A. Senkardesler (EGE
39741). Usak, BETWEEN DELIHIDIRLI & COKAKLI, 0.5 km, 38°20.58’ N, 29°34.56’ E, 910
m — 14 Mai 2010, A. Senkardesler (EGE 39742). ULUBEY CANYON, between Alfaklar &
Pasalar, 4th km, 38°24.90° N, 29°30.42’ E, 860 m — 14 Mai 2010, A. Senkardesler (EGE
39743).
COMMENTS— Steiner (1915) provides a description with 4 ascospores per
ascus for this species under the name Lecanora farinosa but admittedly never
studied original material. Therefore he was unable to decide which of the two
was correct, “Lecanora farinosa sensu J. Steiner” or “A. farinosa (Florke) Hue’,
which has asci with up to 8 ascospores (Sipman 2007, Nordin & Roux 2009).
All specimens of Lecanora farinosa sensu J. Steiner listed in Steiner (1910, 1915,
1921), Szatala (1927, 1941) and Senkardesler & L6kés (2010) that we examined
appear to belong to the species described by Sipman (2007) and not to
“A. farinosa (Florke) Hue”.
The species A. subfarinosa was based on its longer conidia compared with
A. farinosa sensu J. Steiner (11-18 tm vs. 7-12 um). However, the cited specimen
from Iran has conidia 11-14 um long and a specimen from Israel, covered only
with pycnidia, has longer (9-16 tum) conidia. Together with the similar external
104 ... Senkardesler & Sohrabi
thallus morphology for both species, the intermediate conidial lengths suggest
that there are no informative morphological differences between A. subfarinosa
and A. farinosa sensu J. Steiner.
The short description of Lecanora farinosa f. subopegraphoides is based only
on the farinose surface and absence of areoles, which our study confirms. We
also observed fissures around the ascocarps and 4-spored asci and detected no
secondary metabolites. For these reasons, we synonymize here A. farinosa var.
subopegraphoides and A. substerilis with A. subfarinosa.
‘The type specimen for a second form described by Szatala (1943), A. farinosa
f. ochracea, has not been found even after diligent searches in BP, W, and WU.
Probably it was lost during World War II. Verseghy (1964, 1968, 1974, 1981)
did not report this type specimen from BP, either.
Aspicilia subfarinosa is very similar to and could be confused with A. calcarea
(L.) Kérb., but their surface structure is evidently different: A. subfarinosa has a
farinose smooth surface with occasional very fine cracks, while A. calcarea has
a deeply cracked-areolate surface (Fic. 2). Another difference between both
species is the fissures around the apothecia in dry condition: A. subfarinosa has
immersed apothecia, which are separated from the thallus by a fissure, while
this is not a trait of A. calcarea.
Conclusion
Although A. subfarinosa and A. farinosa seem to be well defined species,
the names have a complicated application history in some publications and
checklists, chiefly in those dealing with southwest Asian and Mediterranean
lichen flora. During this study it became clear that in the herbaria indicated
above, a large number of examined specimens should be referred to A. farinosa.
‘There are also some specimens in the A. calcarea complex, tentatively filed
under A. farinosa or vice versa, deposited in different herbaria, that may need
to be referred to A. subfarinosa after the number of ascospores per ascus and
occurrence of fissures around the apothecia have been noted.
Acknowledgments
The authors wish to thank to Dr Harrie J.M. Sipman (Berlin) and Dr Orvo Vitikainen
(Helsinki) for revision and helpful comments on the draft of this paper. Fresh material
was collected by the first author with the support of The Scientific and Technological
Research Council of Turkey (TUBITAK) under project number 1061628. The studies in
G were supported by the Science-Technology Application and Research Centre of Ege
University (EBILTEM); studies in BC, BCN and KW by Ege University Faculty of Science
(09 FEN 55 & 10 FEN 9) and by TUBITAK (106T628); studies in BP and W by two
mobility programs of TUBITAK; studies in WU by an award from the Synthesys Project
(AT-TAF-3435) which is financed by the European Community Research Infrastructure
Action under the FP6 “Structuring the European Research Area” Programme.
Aspicilia subfarinosa correct name for A. substerilis ... 105
Literature cited
Arup U, Ekman S, Lindblom L, Mattsson J-E. 1993. High performance thin layer chromatography
(HPTLC), an improved technique for screening lichen substances. Lichenologist 25(1): 61-71.
doi:10.1006/lich.1993.1018
Kondratyuk SY, Zelenko SD. 2002. New lichens and lichenicolous fungi from Israel and the Near
East. Ukr. Bot. Zhurn. 59: 598-607.
Kopachevskaya EG, Makarevich MF, Oxner AN, Rassadina KA. 1971. Handbook of the lichens of
the USSR. 1. Pertusariaceae, Lecanoraceae and Parmeliaceae. Leningrad.
Maire R, Monod T. 1950. Etudes sur la flore et la végétation du Tibetsi. Mémoires de l'Institut
Francais d’Afrique Noire 8. Paris, Dakar. 140 pp.
Nordin A, Roux C. 2009. Proposal to conserve the name Aspicilia farinosa (Ascomycota:
Pertusariales: Megasporaceae) with a conserved type. Taxon 58(1): 292.
Oxner AN. 1929. Neue Arten von Aspicilia aus zentral Asien. Izv. Kievsk. Bot. Sada: 87-88.
Oxner AN. 1933. Species lichenum novae ex Asia. Bot. Zhurn. (Kiev) 7/8: 167-172.
Oxner AN. 1939. Contribution to the lichen flora of Middle Asia. Zhurn. Inst. Bot. Vseukrajins’k.
Akad. Nauk 20: 111-136.
Oxner AN. 1940. New and little-known lichens for the USSR. Zhurn. Inst. Bot. Vseukrajins’k.
Akad. Nauk 1 (1): 101-109.
Senkardesler A, L6kés L. 2010. Reassessment of lichen collections from Turkey deposited in
Hungarian Natural History Museum and examined by Odon Szatala. Acta Bot. Hung. 52 (1-2):
197-215. doi: 10.1556/ABot.52.2010.1-2.¢4
Sipman HJM. 2007. New lecanoroid lichens from Greece. Bibliotheca Lichenologica 96: 267-277.
Steiner J. 1893. Beitrage zur lichenflora Griechenlands und Agyptens. Akad. Wiss. Wien
Sitzungsber., Math.-Naturwiss. K]. 52: 152-167.
Steiner J. 1894. Flechten. 262-266, in: E Halacsy (ed.): Botanische Ergebnisse einer im Auftrag der
hohen Kais. Akademie der Wissenschaften unternommenen Forschungsreise in Griechenland.
Denkschr. Kaiserl. Akad. Wiss., Wien. Math.-Naturwiss. KL 61.
Steiner J. 1895. Ein Beitrag zur Flechtenflora der Sahar. Akad. Wiss. Wien Sitzungsber., Math.-
Naturwiss. Kl. 104: 384-393.
Steiner J. 1898. Prodromus einer Flechtenflora des griechischen Festlandes. Akad. Wiss. Wien
Sitzungsber., Math.-Naturwiss. K1. 107: 103-189.
Steiner J. 1899. Flechten. 222-238, in: C. Fritsch (ed.): Beitrag zur Flora von Konstantinopel.
Bearbeitung der von J. Nemetz in den Jahren 1894-1897 in den Umgebungen von
Konstantinopel gesammelten Pflanzen. I. Kryptogamen. Denkschr. Kaiserl. Akad. Wiss., Wien.
Math.-Naturwiss. KL. 48.
Steiner J. 1902. Zweiter Beitrag zur Flechtenflora Algiers. Verh. Zool.-Bot. Ges. Wien 52: 469-487.
Steiner J. 1904. Flechten auf Madeira und den Kanaren gesammelt von J. Bornmiiller in den Jahren
1900 und 1901. Oesterr. Bot. Z. 54: 399-409. doi:10.1007/BF01793846
Steiner J. 1905. Lichenes. 369-384, in A Penther, E Zederbauer (eds.): Ergebnisse einer
naturwissenschaftlichen Reise zum Erdschias-Dagh (Kleinasien). Ann. Naturhist. Mus. Wien
20.
Steiner J. 1909. Lichenes. 107-123, in: H. von Handel-Mazzetti (ed.): Botanische Reise in das
Pontische Randgebirge. Ann. Naturhist. Mus. Wien 23.
Steiner J. 1910. Lichenes Persici coll. a cl. Consule Th. Strauss. Ann. Mycol. 8: 212-245.
Steiner J. 1915. Adnotationes lichenologicae, HI. Oesterr. Bot. Z. 65: 278-292. doi:10.1007/
BF01660996
106 ... Senkardesler & Sohrabi
Steiner J. 1919. Beitrage zur Kenntnis der Flora Griechenlands. Bearbeitung der anlasslich der
zweiten Wiener Universitatsreise im April 1911 in Griechenland gesammelten Pflanzen - C.
Lichenes. Verh. Zool.-Bot. Ges. Wien 61: 52-101.
Steiner J. 1919. Flechten aus Transkaukasien. Ann. Mycol. 17: 1-32.
Steiner J. 1921. Lichenes aus Mesopotamien und Kurdistan sowie Syrien und Prinkipo. Ann.
Naturhist. Mus. Wien 34: 1-68.
Szatala O. 1927. Lichenes in Asia minore ab directore Dr. Stefano Gyérffy de Szigeth (Budapest) et
Dr. Josefo Andrasovszky collecti. Folia Crypt. 1: 271-278.
Szatala O. 1929. Beitrage zur Flechtenflora von Bulgarien. I. Magyar Bot. Lapok 28: 82-99.
Szatala O. 1931. Uj zuzmék. II. Neue Flechten. II. Magyar Bot. Lapok 30: 135-136.
Szatala O. 1941. Lichenes in Armenia, Kurdistania, Palaestina et Syria annis 1909-1910 a cl. Fr.
Nabelek collecti. Borbdsia 3: 70-80.
Szatala O. 1943. Lichens. 16-58, in: KH Rechinger (ed.): Flora Aegaea — Flora der Inseln und
Halbinseln des Agaischen Meeres. Wien, Denkschr. Kaiserl. Akad. Wiss., Wien. Math.-
Naturwiss. Kl. 105/1.
Szatala O. 1956. Neue Flechten. V. Ann. Hist.-Nat. Mus. Natl. Hung. 7: 271-282.
Verseghy K. 1964. Typen-Verzeichnis der Flechtensammlung in der Botanischen Abteilung des
Ungarischen Naturwissenschaftlichen Museums. Természettudomanyi Muzeum, Budapest.
Verseghy K. 1968. Nachtrag I. zum “Typenverzeichnis der Flechtensammlung in der Botanischen
Abteilung des Ungarischen Naturwissenschaftlichen Museums”. Fragm. Bot. 6: 41-55.
Verseghy K. 1974. Nachtrag II. zum “Typenverzeichnis der Flechtensammlung in der Botanischen
Abteilung des Ungarischen Naturwissenschaftlichen Museums”. Studia Bot. Hung. 9: 23-29.
Verseghy K. 1981. Nachtrag III. zum “Typenverzeichnis der Flechtensammlung in der Botanischen
Abteilung des Ungarischen Naturwissenschaftlichen Museums”. Stud. Bot. Hung. 15: 45-47.
Werner RG. 1936. Contributions a la flore cryptogamique du Maroc. Fascicule XVI. Bull. Soc. Sci.
Nat. Maroc 16: 258-260.
Werner RG. 1938. Contribution a la flore cryptogamique du Maroc. Fasc. XVII (Algae, Lichenes et
Fungi). Bull. Soc. Sci. Nat. Maroc 18(2): 126-135.
Werner RG. 1954. Lichens et champignons nord-africains. Rev. Bryol. Lichenol. 23 (1-2):
197-213.
Werner RG. 1956. Notes de lichénologie libano-syrienne. III. Bull. Soc. Bot. France 103(7-8):
461-467.
Werner RG. 1957a. Notes de lichénologie libano-syrienne. IV. Bull. Soc. Bot. France 106: 321-326.
Werner RG. 1957b. Contributions a la flore cryptogamique du Maroc. Fascicule XXI. Bull. Soc.
Hist. Nat. Afrique N. 48: 441-453.
Werner RG. 1963. Flore lichénique du Maroc meridional. Rev. Bryol. Lichénol. 32(1-4): 270-278.
Werner RG. 1966. Notes de lichénologie libano-syrienne et égyptienne VIII. Bull. Soc. Bot. France
113: 74-83.
Werner RG. 1979. La flore lichénique de la Cordillere Betico-Rifaine. Etude phytogeographique et
écologique. Collect. Bot. (Barcelona) 11(17): 409-471.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 107-114 January-March 2011
DOT: 10.5248/115.107
Building the jigsaw puzzle of the critically endangered
Pleurotus nebrodensis: historical collection sites and
an emended description
MarIA LETIZIA GARGANO’, ALESSANDRO SAITTA’,
GeEorGIOs I. ZERVAKIS? & GIUSEPPE VENTURELLA*
' Dipartimento di Scienze Botaniche, Universita di Palermo, Via Archirafi 38,
I-90123 Palermo, Italy
? Laboratory of General and Agricultural Microbiology, Department of Agricultural Biotechnology.
Agricultural University of Athens. Iera Odos 75, 11855 Athens, Greece
AssTRACT — Historical collection sites of the critically endangered Pleurotus nebrodensis
were retraced in Sicily (southern Italy) using recently rediscovered documents and through
interviews with local people. These localities were visited in 2009 and checked for the presence
of this rare mushroom, confirming a continuing decline in fruiting. An emended description
of the taxon is provided based on observations on abundant recently collected material.
The need for more incisive action to safeguard this valuable mushroom by the University of
Palermo, Regional Park of Madonie Administration and policy makers is emphasized.
Key worps — threatened macrofungi, mushroom collection, IUCN, Cachrys ferulacea,
macromycete conservation
Introduction
After the death on 30 October 1887 of Giuseppe Inzenga, the mycologist who
described Pleurotus nebrodensis [as Agaricus nebrodensis], Ferdinando Alfonso
Spagna replaced him as director of the periodical Nuovi Annali di Agricoltura
Siciliana and continued some of the mycological research started by Inzenga.
In his paper on poisonous fungi growing in Sicily, Spagna (1902) also added
a list of edible species appreciated by local populations for their organoleptic
characters that included P. nebrodensis, “the most delicious mushroom growing
in Sicily” Unzenga 1863).
This mushroom, which has been a sought-after edible since ancient times,
remains prized (Venturella 2005) today. The recent rediscovery of Spagna’s paper
108 ... Gargano &al.
has permitted a new piece to be added to the ongoing “jigsaw puzzle” of the
critically endangered P. nebrodensis. In addition to clarifying morphological,
taxonomical, and genetic features and in situ and ex situ conservation strategies
(Venturella 2000, Zervakis et al. 2001, Zervakis & Venturella 2002), we are now
able to identify the historical collection sites of P. nebrodensis that Inzenga
(1865-68) omitted from his publication, provide an emended description of the
species, and evaluate its declining fruiting productivity over the last centuries.
Materials & methods
Based on data reported by Spagna over one hundred years ago, we conducted
cartographic analysis, field investigations, and in-depth interviews of cattle farmers,
working for many years in the Regional Park of Madonie (northern Sicily). Two
localities were established and mapped (scale 1:50.000). Additional field investigations
during spring 2009 verified the presence of basidiomata of P. nebrodensis. Macroscopic
and microscopic features were evaluated according to Largent et al. (1977) and Largent
(1986). Macroscopic features include pileus size, shape, and color; margin shape and
surface; pileus surface and flesh; lamellar characters; stipe characteristics; presence
or absence of veil on stipe; type of basidioma attachment; spore print. Colors refer to
the RAL matching system. Microscopic features evaluated were hyphal system; hyphal
wall; septations; hyphal branching; hyphal inflations; specialized hyphae; pigmentation;
type of pellis; trama, position, type, shape, pigmentation and incrustations of cystidia;
basidia and basidioles; spore features; chemical reactions. The collected basidiomata
were identified, analysed in our laboratory, and are now preserved in the PAL fungal
dried reference collection.
Specimens collected
Field investigations carried out in the Madonie area during spring 2009 confirmed the
presence of a very low number of basidiomata of P. nebrodensis (Fic. 1). The detection
of ripe and unripe basidiomata is complicated by excessive collecting by mushroom
pickers. Progressive erosion of soils and changes in habitat at higher altitudes should
also be considered as factors contributing to the decline of P. nebrodensis. In some years
the irregular precipitation in the Madonie area heavily reduced fructification. Modern
collections are limited strictly to localities belonging to the territories of Isnello and
Petralia Sottana (only 50 kilometres apart) and Polizzi Generosa (a small town 16
km from Petralia Sottana). In the reported localities the number of ripe basidiomata
observed from April to May usually did not exceed 25-30 in the more protected areas
and 5-15 in habitats subject to a high anthropogenic pressure. The lowest collection
locality is Mandria del Colle (1260 m) while the highest is Pizzo Carbonara (1979 m).
Original and emended descriptions
Pleurotus nebrodensis (Inzenga) Quél., Enchir. fung.: 148 (1886). Fics 1-2
= Agaricus nebrodensis Inzenga, Giorn. Reale Ist. Incoragg. Agric. Sicil. Palermo 1: 161
(1863). [TypE (Venturella 2000): lectotype — Inzenga (1863: fig. 1);
epitype — PC, Agaricus nebrodensis).
Pleurotus nebrodensis (Italy) ... 109
OFS. as
Fic. 1. Pleurotus nebrodensis. Basidiomata.
EryMo.oey: from the name of the Nebrodi mountain chain of northern Sicily. (Since
old maps did not differentiate between the Nebrodi and Madonie mountain chains,
botanists applied the name Nebrodi to both areas.)
110 ... Gargano &al.
ORIGINAL DESCRIPTION (Inzenga 1863): Ag. magnus caespitosus, albus, vel dilute
sub-flavus, pileo carnoso nargine revoluto, lamellis confertis lineari-lanceolatis,
liberis, decurrentibus in stipite sublaterali, versus basim permixtis.
Fungi umbilicum exprimentes, simul albi C_B.P. — Fungi plures simul, albi, ad
arborum radices, esculenti J. B. - Cup. H. Cath. pag. 80.
Pileus junior laevigatus, albus, subumbonatus, demum dilute flavus, irregulari,
modo ex epidermide diffracia rimoso-tessulatus, gregarious, caespitosus, aliquando
ob coacervata insitaque individua ramosus: 2-5 unc. latus, et ultra. — Stipes rare
centralis, supra dilatatus atque in pileo diffuses, brevis, subnullus, basi attenuates.
Lamellae confertae tenues, lineari-lanceolate, longo decurrentes sub striarum forma
versus stipitis basim productae. Lamellulae numerosae, breviores lanceolatae,
longiores postice rotundatae. Caro fibrosa, subtenax, saporis gratissimi, ac odoris
farina molitae, albida, sicca dilute-flava. Sporidia alba.
Agarico Eryngii DC. characteribus variis consimilis, sed magnitudine, colore
albido pilei sporidiorumque, stipite breviore, lamellis confertis, angustis, lineari-
lanceolatis omnino distinctus.
In montium culminibus Siciliae, Nebrodibus magis obvia e radicibus
marcescentibus Elaeoselini Asclepii Bert., Opopanacis Chironti Koch., etc. Aprili,
Majo nive dilabente. Esculentus!
EMENDED DESCRIPTION (based on recent collections): BAsIDIOMATA sturdy
and fleshy. PILEUs s1zE 3.0-14.5 cm (width), 3.7-13.5 cm (length); applanate,
uplifted, shallowly depressed or convex in side view; ovoid or conchate in top
view; unicolorous, light ivory, sometimes bicolorous, cream to ivory. MARGIN OF
PILEUS plane, incurved, uplifted, incurved or involute in cross section, entire to
eroded in surface view. SURFACE OF MARGIN entire or eroded, smooth. SURFACE
OF PILEUS shiny or translucent, dry, cracking-glabre, smooth or glabrous. FLESH
of pileus, cream, with consistency hard-tough to turgid, without color changes,
sulphur-yellow when dry, 1-2 mm thick at the margin and 1-4 cm thick at the
center. Taste mild and farinous. LAMELLAE 4-8 mm width, 2.5-7.5 cm length,
attachment adnexed to decurrent, gills spacing subdistant to close, moderately
broad in thickness, light ivory colored, margin of gills smooth to eroded, face
of gills waxed, lamellulae present, extending one-half to one-third the length
of gills. Stipe 1.4-3 cm width, 2.1-7.5 cm length, terete in cross section, equal
to bulbose, slightly tapered to tapered at the base in longitudinal view. STIPE
SURFACE smooth, light ivory colored. STIPE CONSISTENCY fibrous, flesh solid
to stuffed. Stipe eccentrically or lateral attached to pileus, inserted in the root
residues of Cachrys ferulacea, basal tomentum and veil absent. GROWTH HABIT
solitary or connate. TYPE OF BASIDIOMATA ATTACHMENT: stipitate. SPORE
PRINT light ivory to cream. SpoREs 12.5-15.1(-18) x 5.2-6.1 um, cream,
heterotrophic, asymmetrical, phaseoliphorm, smooth, hyaline, guttulate.
BasIpIA with basidioles, 4-spored, 40-50 x 10-11.5(-14)um, sterigmata 3-4.5
um. CHEILOCYSTIDIA 50-60 x 6,2-7.5(-9) um, leptocystidia type, clavate, apex
mucronate to capitulate. HyPHAL sYSTEM monomitic. HyPHAL WALL thin.
Pleurotus nebrodensis (Italy) ... 111
10 pm
10pm
Fic. 2. Pleurotus nebrodensis microscopic characters:
a. cheilocystidia; b. basidiospores; c. basidia; d. hyphal system of hymenium; e. pellis.
HyPpHae septate with clamp connections. SPECIALIZED HYPHAE absent, no
pigmentation. PELLIs topography in two layers, 5-10 wm width, enterocutis,
element of pellis absent (Fic. 2).
SPECIMENS EXAMINED: All on Cachrys ferulacea (L.) Calest. (Apiaceae) root residues
— ITALY. SictLy: PROVINCE OF PALERMO, Isnello: Bevaio del Faggio, 1355 m, A. Saitta,
001, 5 May 2009 (PAL); Mandria del Colle, 1260 m, A. Saitta, 002, 24 April 2009 (PAL);
Pizzo Carbonara, 1979 m, A. Saitta, 003, 28 May 2009 (PAL); Valle Pelata, 1745 m, A.
Saitta, 004, 20 May 2009 (PAL); Petralia Sottana: Monte Ferro, 1906 m, A. Saitta, 005,
30 May 2009 (PAL); Monte Mufara, 1685 m, A. Saitta, 006, 26 May 2009 (PAL); Pizzo
Carbonara, 1979 m, A. Saitta, 007, 28 May 2009 (PAL); Valle di Zottafonda, 1843 m, A.
Saitta, 008, 29 May 2009 (PAL); Vallone Faguare, 1380 m, G. Venturella & ML Gargano,
009, 12 May 2009 (PAL); Polizzi Generosa: Cozzo Cerasa, 1687 m, A. Saitta, 010, 18
May 2009 (PAL); Monte dei Cervi, 1794 m, A. Saitta, 011, 23 May 2009 (PAL); Piano
della Madonna, 1692 m, A. Saitta, 012, 3 May 2009 (PAL); Pizzo Colla, 1676 m, A. Saitta,
013, 8 May 2009 (PAL).
CuLTuRE PDA: pigments absent, reverse colour unchanged, dikaryotic colonies
mostly presenting a loose submerged and suppressed aerial mycelium, more or
less zonate and radial, growth margin even and regular, colour light ivory to
ivory; thin-walled hyphae, hyaline in aqueous KOH and Melzer’s reagent, with
112 ... Gargano &al.
Ubi KS WAS ae \
Died
SF : Sak) Deda
24020 2437000 2438000
Fic. 3. Vallone Faguare locality (map scale 1:50000).
abundant clamp-connections, occasional production of microdroplets, singly
on short secretory sterigmata on aerial hyphae (nematode trapping devices);
optimal mycelium growth at 18-25°C (growth rate: 1.2 mm day'').
Discussion
Mr Norata, one of the cattle farmers interviewed, now a grey-headed
gentleman in his 90s, provided the critical evidence enabling us to rediscover
the historical collection sites of P. nebrodensis. In an enthusiastic and moving
reconstruction of his working life in the pasture areas of Madonie, including
memories of fear as a young boy during lonely nights guarding his cows, Mr
Norata pointed out the sites which, at the beginning of the 20th century, were
best for collecting this valuable mushroom. He also recounted his observation
of the progressive decline of P. nebrodensis, which he attributed to intense
exploitation of the area by cattle farmers and progressive loss of habitat
due to road building. On the basis of Mr Norata’s information and our field
observations we identified the two collection localities reported by Alfonso
Spagna, which he named as “Canna” and “Dragonara”. These are fiefdoms of
the property of Baron Nicolé Turrisi Colonna’s heirs. The two localities, nesting
in a deep valley of the Madonie Mountains (northern Sicily) named Vallone
Pleurotus nebrodensis (Italy) ... 113
Faguare (Fic. 3), currently belong to the lands of Petralia Sottana (province
of Palermo). The precise coordinates (Gauss Boaga coordinate, ed. 1950) are
4191750 N and 2436300 E. ‘Their vegetation is characterized by wide-ranging
pastures of Cachrys ferulacea intensively exploited for grazing until 1989 when
the Regional Park of Madonie was established.
The new rules introduced by the Madonie National Park Administration
have not interrupted the stream of mushroom pickers stimulated by the high
economic value of PB nebrodensis (50-60 euro per kg). After inclusion of this rare
mushroom as Critically Endangered in the IUCN Red List of Threatened Species,
G. Venturella (Head of the Laboratory of Mycology in Palermo) persuaded the
Park of Madonie administration to issue a conduct code for mushroom pickers.
Unfortunately, mainly due to a lack of trained staff, the level of practical control
by forest rangers has been insufficient to prevent an increase in mushroom
picker pressure on the collection sites. As a consequence, unripe basidiomata
are collected every spring, increasing the decline of P. nebrodensis. Now, a very
low number of ripe basidiomata is collected in the area of Vallone Faguare, and
this present situation clearly contradicts Spagna’s report in 1902 and the direct
evidence gained through our interviews. At that time “abundant collections of
the renowned mushroom” were reported by the local population. The presence
of ripe basidiomata of P. nebrodensis has progressively decreased during the
last centuries and the population is now severely fragmented (Venturella 2005).
In 2009, an investigation carried out in Sicily (southern Italy) during the period
of fructification (April-June) confirmed the negative trend and the need for
more incisive action by the University, Park Administration, and policy makers
to safeguard the existence of this important taxon.
Acknowledgements
The authors wish to thank Dr Bertrand de Montmollin (Switzerland) and Dr David
Minter (United Kingdom) for critically reviewing the manuscript. This study was carried
out in the frame of a research grant awarded by the Italian Ministry of University and
Research (MIUR) entitled Caratterizzazione bio-morfologica, ecologica, produttiva
e qualitativa di Pleurotus nebrodensis (Inzenga) Quél., raro basidiomicete a rischio di
estinzione/ Bio-morphological, ecological, productive and qualitative characterization
of Pleurotus nebrodensis (Inzenga) Quél., rare basidiomycete at risk of extinction. Thanks
are also due to Mrs Stefania Paglialunga for the drawing of microscopic characters.
Literature cited
Alfonso Spagna EF. 1902. Dei funghi velenosi. Nuovi Annali di Agricoltura Siciliana 13: 129-142.
Inzenga G. 1863. Nuova specie di agarico del Prof. Giuseppe Inzenga. Giornale.del Reale Istituto
dIncoraggiamento di Agricoltura, Arti e Manifatture in Sicilia 1: 161-164.
Inzenga G. 1865-68 (“1865). Funghi Siciliani, Centuria I. Tipografia Lao, Palermo.
Largent DL. 1986. How to identify mushrooms to genus. I: macroscopic features. Eureka, CA.
166 pp.
114 ... Gargano &al.
Largent DL, Johnson D, Watling R. 1977. How to identify mushrooms to genus. HI: microscopic
features. Eureka, CA. 148 pp.
Venturella G. 2000. Typification of Pleurotus nebrodensis. Mycotaxon 75: 229-231.
Venturella G. 2005. Pleurotus nebrodensis. In de Montmollin B, Strahm W. (eds). The Top 50
Mediterranean Island Plants: Wild plants at the brink of extinction, and what is needed to save
them. IUCN/SSC Mediterranean Islands Plant Specialist Group, IUCN, Gland, Switzerland
and Cambridge, UK.
Zervakis G, Venturella G. 2002. Mushroom breeding and cultivation enhances ex situ conservation
of Mediterranean Pleurotus taxa. Pp. 351-358, in: Engels JMM et al. (eds) 2002: Managing Plant
Genetic Diversity. CABI Publishing, UK.
Zervakis G, Venturella G, Papadopoulou K. 2001. Genetic polymorphism and taxonomic
infrastructure of the Pleurotus eryngii species-complex as determined by RAPD analysis,
isozyme profiles and ecomorphological characters. Microbiology 147: 3183-3194.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 115-119 January-March 2011
DOT: 10.5248/115.115
Diplotomma, Lecanora, and Xanthoria lichen species
new to Turkey
YALGIN KARAGGz', ALI ASLAN’, KENAN YAZICI?* & ANDRE APTROOT‘
‘Department of Biology, Science Faculty, Atatiirk University, TR-25240, Erzurum, Turkey
Biology Department, Kazim Karabekir Education Faculty, Atatiirk University, Erzurum, Turkey
3Biology Department, Science Faculty, Karadeniz Technical University, 61080, Trabzon, Turkey
“ABL Herbarium G.v.d.Veenstraat 107, NL-3762 XK Soest, The Netherlands
* CORRESPONDENCE TO:
[email protected]
AsstTract — During a recent excursion in Kemaliye district of Erzincan region (Turkey),
we sampled lichens from 6 localities, among which Diplotomma hedinii, Lecanora valesiaca,
and Xanthoria weberi were determined as new to Turkey and the Middle East and X. weberi
also new to Asia. Geographic distribution, substrate, chemistry, and comparisons with
morphologically similar taxa are presented.
Key worps — Ascomycota, biodiversity
Introduction
The lichen flora of Turkey, as in many parts of the world, is still incomplete.
Although many recent studies (Candan & Turk 2008, Candan & Halici 2009,
Halici & Giivenc 2008, Halici & AKsoy 2009, Yazici & Aslan 2009, Yazici et al.
2008, 2010a,b) contributed to the lichen flora of Turkey, unexplored regions of
the country are still larger than the explored ones. Therefore, more studies are
needed to form a complete lichen flora of Turkey.
Although part of Erzincan flora has been previously described (Yazici &
Aslan 2003), no studies were carried out around Kemaliye district.
Material & methods
Some lichen species were collected from 6 localities in June and July 2009. Air-dried
samples were examined with Nikon SMZ1500 stereomicroscope and a Nikon Eclipse
80i light microscope. Identifications were determined by consulting using books (Poelt
1974, Smith et al. 2009) and papers (Upreti & Chatterjee 1998, Aptroot et al. 2009,
Lindblom 2006).
The Kemaliye district has many deep valleys, high mountains, and plateaus.
Continental climate dominates the higher altitudes while a mediterranean-type
116 ... Karagéz & al.
microclimate is present on the valley floors. The district’s largest valley is Karasu Valley,
and other valleys have been carved by branches of the Karasu River, which reaches Keban
Dam Lake just beyond the district border. The presence of Keban Lake dramatically
alters climatic conditions at the valley bottoms, where summer temperatures and
humidity significantly increase compared to near regions (Bulut 2006). Dominant plant
cover in the district is mountain steppe. Frequent patches of squat trees like Quercus sp.
and Juniperus sp., as well as Rosa canina shrubs can be seen over on the hills. The valleys
are mostly covered by fruit trees of anthropogenic origin.
The collection site is a well-lit, windswept, open area with gently sloped terrain with
grass and rocks. The stream is mostly surrounded by fruit trees. Quercus, Populus and
Rosa trees are dominant in the vicinity, with Salix and Carpinus occasionally present.
The climate is characterized by cold, snowy winters and hot, dry summers. Mean annual
temperature is16. 6°C. The mean annual rainfall is about 380.6 mm, with a precipitation
range of 206-633 mm. Mean annual humidity is 62% (Akman 1999).
Vouchers are stored in the herbarium of the Biology Department, Kazim Karabekir
Education Faculty, Ataturk University, Erzurum, Turkey (ATAKKEF).
Species
Diplotomma hedinii (H. Magn.) P. Clerc & Cl. Roux, (as “hedinianum”) Crypto-
gamica Helvetica 19: 292. 2004.
SPECIMEN EXAMINED: TURKEY. Erzincan: KEMALIYE, Avaz place, Avukatin gesmesi
(Lawyer’s spring), 38°28'28”N, 39°13'02”E, on calcareous rock, 1375 m, 15.06.2009,
ATAKKEF-450.
‘Thallus white or pale to dark grey, thin or thick, often wide-spreading, smooth
or rimose-cracked or sometimes granular, + determinate; prothallus absent.
Apothecia 0.3-0.8(-1.5) mm diam.; disc flat at first, soon + convex, often
pruinose; thalline exciple sometimes present, white, sometimes + crenulate;
true exciple inconspicuous; epithecium brown; hymenium 45-75 um tall,
colourless. Asci 55(-65) x (10-)17(-24) um. Ascospores 15-20 x 7-11um,
(1-)3-septate, not longitudinalsepta, frequently curvedand mostlysubmuriform
at maturity. Thallus C-, K-, KC-, Pd-, UV-.
Diplotomma hedinii is mainly a temperate species of exposed calcareous
rocks and sandstone outcrops in more or less sunny conditions. Previously
known from Africa, Asia, Europe, and Central and North America; new to
Turkey and the Middle East.
RemMARKs—Diplotomma hedinii is similar to D. alboatrum, but D. alboatrum
has 15-24 x 8-10 um ascospores with longitudinal septa and which are less
frequently curved.
Lecanora valesiaca (Miill. Arg.) Stizenb., Ber. Thatigk. St. Gallischen Naturwiss.
Ges. 81: 342.1882
SPECIMENS EXAMINED: TURKEY. Erzincan: KEMALIYE, Mezbanbas: place, 6.5 km
SW of Sirakonak, 38°25°54”N, 39°11715”E, on siliceous rock, 1851 m, 10.06.2009,
Three lichens new to Turkey ... 117
ATAKKEF-—453; 900 m SW of Kekikpinari, 38°27°30”N, 39°08'37”E, on siliceous rock,
1275 m, 10.06.2009, ATAKKEF-456; Geso Bogazi place, 1700 m NE of Yesilyamac,
38°3400"N, 39°16715”E, on siliceous rock, 1682 m, 11.06.2009, ATAKKEF-455; Avaz
place, Avukatin Cesmesi (Lawyer's Spring), 38°28'28”N, 39°13°02”E, on siliceous rock,
1375 m, 15.06.2009, ATAKKEF-452; vicinity of Citkiy, 38°3622”N, 39°06'45”E, on
siliceous rock, 1030 m, 12.07.2009, ATAKKEF-454.
Thallus up to 3.0 cm diameter, + white, rosettes, pruinose, flat, frequently
slightly undulate margins, yellow-greenish under the pruina, centrally areolate;
thallus lobes rounded, older lobes not hollow; marginal lobes, 0.5-1.1 mm
wide, (0.9-)1.0-2.0(-2.1) mm long, flattened, bifurcate and verrucose; upper
surface, pruinose., Apothecia sessile to adnate, in the centre of the thallus
0.3-1.0(-1.3) mm diam., discs, yellow-brown light brown, pruinose, convex
at maturity; margins thick, entire, covering the discs at first, thin, curved at
maturity; epithecium brown; hypothecium pale yellow; paraphyses mainly
cylindrical, unbranched, apices swollen; asci cylindrical-clavate, 8-spored,
(25-)32-40(-42) x (11-)12-14(-15) tum; ascospores oval-ellipsoid, (8-)9-12
x 4-6(-7) um. Thallus and medulla K-, C-, KC+ yellow, PD-.
Lecanora valesiaca grows on sloping faces of lime-poor, hard, base-rich rocks
containing some calcium in warm-dry situations, and above all on south-facing
exposed sites in the interior alpine dry valleys. Previously known from Asia,
Europe, and North America; new to Turkey and the Middle East.
ReMARKS—Lecanora valesiaca is very similar to L. freyi, but L. valesiaca has
thin lobes, a thicker margin, and verrucose lobe ends while L. freyi has thick
lobes, a thin margin, and smooth lobe ends. Although both species possess
similarly sized apothecia and ascospores, apothecia with incurved margins
and yellow brown discs will separate L. valesiaca from L. freyi, characterized
by apothecia with entire margins and flat, blackish green discs. The incurved
apothecial margins, verrucose lobe ends, and pruinose thallus also distinguish
L. valesiaca from Protoparmeliopsis muralis var. muralis.
Xanthoria weberi (S.Y. Kondr. & Karnefelt) Aptroot, Herzogia 22: 151 (2009)
SPECIMEN EXAMINED: TURKEY. Erzincan: KEMALIYE, 1200 m, SE of Dutluca,
38°37 25°N, 39°07'42”E, on calcareous rock, 1165 m, ATAKKEF-451.
Thallus foliose, up to 4(-5) mm wide, forming small thalli, adnate to loosely
adnate. Lobes horizontal to somewhat ascending, dorsiventral, flat, 0.3-0.5
mm wide, lobe tips often incurved, outermost parts of mature lobes + truncate.
Upper surface yellow to orange, smooth. Lower surface white. Cortex layers
paraplechtenchymatous. Photobiont trebouxioid, green, unicellular. Medulla
reticulate, of short cells. Rhizines mostly present (abundantly in a few specimens
seen), white, yellow when exposed, attached or free. Soralia in lobe tips, often
forming small bird nest soralia, soredia yellow. Apothecia rare, 0.7-2.0 mm
wide. Ascospores 12.5-14 x 7-7.5 um, septum 2.8-4.5 um thick. Pycnidia
118 ... Karagéz & al.
laminal, common, orange. Conidia bacilliform, 3.3-3.5 um long. Cortex and
apothecia K+ purple, C-, PD-, I-; medulla K-, C-, PD-, I-.
X. weberi grows in dry habitats on a variety of substrates, both bark and rock
as well as on man-made substrates such as concrete and tombstone. Previously
known from Europe and North America; new to Turkey and Asia.
REMARKS—Aanthoria weberi resembles X. gallowayi, X. oregana, and X. fulva.
Xanthoria weberi has shorter and slightly wider lobes with more incurved
lobe tips than X. gallowayi, and where X. weberi sometimes has apothecia and
frequently conspicuous pycnidia, no apothecia and pycnidia have been noted
for X. gallowayi (Kondratyuk & Karnefelt 1997). Xanthoria weberi has longer
lobes and abrighter yellow pigmented upper surface than X. fulva, from which it
is also distinguished by its dichotomously branched lobes, with more distinctly
truncate lobe tips and relatively long internodes. The small bird nest-like soralia
that occur mostly in the lobe tips and narrower, more regular dichotomously
branched lobes in X. weberi help to differentiate it from X. oregana.
Acknowledgements
We are grateful to Dr. Paolo Giordani and Dr. Leo Spier for linguistic revision and
helpful comments on an earlier draft of this manuscript.
Literature cited
Akman Y. 1999. Climate and bioclimate (The methods of bioclimate and climate types of Turkey).
1*Edn., Kariyer Matbaacilik Ltd., Sti, Ankara.
Aptroot A, Schumm F, Gabriel R. 2009. Lichens new to the Azores collected on Terceira. Herzogia
22: 147-152.
Bulut Z. 2006. Kemaliye (Erzincan) ilcesi ve yakin ¢evresinin alternatif turizm kapsaminda
rekreasyonel turizm potansiyelinin belirlenmesi. Doktora Tezi. Atatiirk Universitesi Fen
Bilimleri Enstitiisi, Erzurum.
Candan M, Turk AO. 2008. Lichens of Malatya, Elazig and Adiyaman provinces (Turkey).
Mycotaxon 105: 19-22.
Candan M, Halici MG. 2009. Two new lichenicolous Arthonia species from Turkey. Mycotaxon
107: 209-213.
Halici MG, Guvenc S. 2008. Lichens from the Mediterranean phytogeographical region of Turkey.
Cryptogamie Mycologie 29(1): 95-106.
Halici MG, Aksoy A. 2009. Lichenised and Lichenicolous Fungi of Aladaglar National Park (Nigde,
Kayseri and Adana Provinces) in Turkey. Turkish Journal of Botany 33(3): 169-189.
Kondratyuk S, Karnefelt I. 1997. Josefpoeltia and Xanthomendoza, two new genera in the
Teloschistaceae (lichenized Ascomycotina). Bibliot. Lichenol. 68: 19-44.
Lindblom L. 2006. Xanthomendoza galericulata, a new sorediate lichen species, with notes on similar
species in North America. Bryologist 109(1): 1-8. doi:10.1639/0007-2745(2006) 109[0001:
XGANSL]2.0.CO;2
Poelt J. 1974. Bestimmungsschliissel europaischer Flechten. J. Cramer, Vaduz. 757 p.
Smith CW, Aptroot A, Coppins BJ, Fletcher A, Gilbert OL, James PW, Wolseley PA, Orange A.
2009. The Lichens of Great Britain and Ireland. The British Lichen Society, London. 1046 p.
Three lichens new to Turkey ... 119
Upreti DK, Chatterjee S. 1998. Lichen genus Lecanora subgenus Placodium in India Feddes
Repertorium 109(3-4): 279-289.
Yazici K, Aslan A. 2003. Lichens from the regions of Gumushane, Erzincan and Bayburt (Turkey).
Cryptogamie Mycologie 24(3): 287-300.
Yazici K, Aptroot A, Etayo J, Aslan A, Guttova A. 2008. Lichens from the Batman, Mardin,
Osmaniye, and Sivas regions of Turkey. Mycotaxon 103: 141-144.
Yazici K, Aslan A. 2009. Lichen species new to Turkey and Asia. Mycotaxon 108: 463-466.
Yazici K, Aptroot A, Aslan A, Etayo J, Spier L, Karagoz Y. 2010a. Lichenized and lichenicolous fungi
from nine different areas in Turkey. Mycotaxon 111: 113-116. doi:10.5248/111.113
Yazici K, Elix JA, Aslan A. 2010b. Some parmelioid lichens new to Turkey and Asia. Mycotaxon
111: 489-494, doi:10.5248/111.489
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 121-124 January-March 2011
DOT: 10.5248/115.121
First report of Conidiobolus coronatus in Turkey
CAFER EKEN*”’, SABAN GUGLU? & KIBAR AK?
'Graduate School of Natural and Applied Sciences, Ardahan University, Ardahan,75000,Turkey
2Department of Plant Protection, Faculty of Agriculture, Atatiirk University, Erzurum,25240, Turkey
*Black Sea Agricultural Research Institute, Gelemen, Samsun,55001, Turkey
*CORRESPONDENCE TO:
[email protected]
AsstTract — Conidiobolus coronatus (Entomophthorales, Zygomycota) was isolated from
infected specimens representing an Issus sp. Issidae, Hemiptera) collected from the Trabzon
province of Turkey. The species, which represents a new record for the Turkish mycoflora, is
described briefly and illustrated.
KEY worDs — insect, entomopathogenic fungi, hazelnut
Introduction
Members of the widespread order Entomophthorales (Zygomycota) are
predominantly pathogens of insects and mites (Pell et al. 2001). Species of
Conidiobolus, most notably the ubiquitous C. coronatus, are recorded as
widespread soil saprophytes utilising a variety of substrates, including plant
detritus, living plants, different dead arthropods and the fruiting bodies
of other fungi in various regions of the world (MacLeod & Miiller-Kégler
1973, Keller 1987, Sajap et al. 1997, Dromph et al. 2001, Laxman et al. 2005,
Manning et al. 2007, Comerio et al. 2008). Conidiobolus coronatus, mainly
tropical strains, is known to cause disease in both insects and humans (Ribes et
al. 2000, Prabhu & Patel 2004); the disease has been named rhinophyco-
mycosis, rhinophycomycosis entomophthorae, rhinoentomophthoromycosis,
and conidiobolomycosis (King 1979, Ochoa et al. 1996, Yang et al. 2010).
Material & methods
Dead insects collected in 2008 from a hazelnut orchard in in the Black Sea region
of Turkey were cultured for entomopathogenic fungi. After the cadavers were washed
in a solution of 2% sodium hypochlorite for 1 min, they were dried on filter paper.
After transfer to Petri dishes containing 20 ml of PDA, the cadavers were incubated
at 25°C for 1 week with high humidity (80 + 10% rh). Colonies of filamentous fungi
122 ... Eken, Giiclii & Ak
emerging from each cadaver and identifiable as the genus Conidiobolus were transferred
to PDA and identified to species using the relevant literature (Emmons & Bridges 1961,
Prasertphon 1963, MacLeod & Miiller-Kégler 1973, King 1979, Keller 1987, Humber
1997, Hatting et al. 1999, Toledo et al. 2007, Comerio et al. 2008). After identification,
all isolates were deposited in the fungal collection of Department of Plant Protection,
Faculty of Agriculture, Atatiirk University, Erzurum-Turkey.
Results
The description and illustration of Conidiobolus coronatus given below
are based on the Turkish collections of the material. This is the first report of
C. coronatus from Turkey.
a
Ficure 1. Conidiobolus coronatus: A— primary conidium and germinating primary conidium;
B— primary conidia and secondary conidia produced on germ tube arising from primary conidia;
c— villose conidia may be the equivalent of resting spores in this species. Bar = 20 um.
Conidiobolus coronatus (Costantin) A. Batko, Entomophaga,
Mem. Hors. Ser. 2: 129. 1964. Fig. 1
CoLontgs (PDA) expanding, hyaline, soon with irregular radial blooms; at
25°C reaching 85 mm diam. after 2 days; PRIMARY CONIDIA (Fic. 1A) globose,
with more prominent basal papilla tapering toward obtuse apex; variable in
size, (23.2-)32.1(-46.8) x (18.1-)24.6(-35.1) tm; basal papilla prominent with
pointed apex, forcibly discharged; sECONDARY CONIDIA (Fic. 1B) forming
singly and forcibly discharged or (more commonly) producing many forcibly
discharged secondary microconidia on short germ tubes arising from primary
conidia; CONIDIOPHORES simple, unbranched; VILLOSE CONIDIA (resting spores;
Fic. 1c) resembling primary conidia but covered with villose appendages
(unique to this species), (19.9-)25.8(-34.8) um diam.
SPECIMEN EXAMINED: On cadavers of Issus sp. Ussidae, Hemiptera). TURKEY: TRABZON
PROVINCE, Of district, Corylus avellana L. (Corylaceae) orchards, 40°51’30"N,
40°167007E, alt. 160 m, VI-VIII 2008, coll. K AK (KA 123).
Conidiobolus coronatus new to Turkey ... 123
Discussion
Conidiobolus coronatus, originally isolated from a culture of Agaricus
campestris L. (possibly derived from a dead insect hidden between the lamellae),
was described in 1897 as Boudierella coronata Costantin (MacLeod & Miiller-
Kégler 1973). Since then it has been isolated from numerous and diverse
sources (MacLeod & Miiller-Kégler 1973, King 1979, Keller 1987, Sajap et al.
1997, Dromph et al. 2001, Laxman et al. 2005, Manning et al. 2007, Comerio
et al. 2008). Utilization of the species as a biological control is limited by its
potential to cause human disease (King 1979, Ochoa et al. 1996, Ribes et al.
2000, Prabhu & Patel 2004).
Diameters of both the primary and villose conidia measured in this study
fell within the ranges observed by Emmons & Bridges (1961; primary conidia:
36-44 um), Prasertphon (1963; primary: 25-61 tm; villose: 8-42 um), Keller
(1987; primary: 37-74 tm; villose: 16-42 um), Hatting et al. (1999; primary:
41.5-66 x 30-48 um), Toledo et al. (2007; primary: 17.6-39.5 x 24.7-29.6 um;
villose: 19.8-24.7 um), and Comerio et al. (2008; primary: 30-38 um).
Acknowledgments
We are grateful to Dr. Celal Tuncer and Dr. Yusuf Yanar for reviewing the
manuscript.
Literature cited
Comerio RM, Andorno AV, Botto EN. 2008. Conidiobolus coronatus isolation from a pest aphid of
chives (Allium schoenoprasum L.). Revista Iberoamericana de Micologia 25: 193-195.
Dromph KM, Eilenberg J. Esbjerg P. 2001. Natural occurrence of entomophthoralean fungi
pathogenic to collembolans. Journal of Invertebrate Pathology 78: 226-231. doi: 10.1006/
jipa.2002.5077
Emmons CW, Bridges CH. 1961. Entomophthora coronata, the etiologic agent of a phycomycosis of
horses. Mycologia 53: 307-312. doi: 10.2307/3756277
Hatting JL, Humber RA, Poprawski TJ, Miller RM. 1999. A survey of fungal pathogens of aphids
from South Africa, with special reference to cereal aphids. Biological Control 16: 1-12. doi:
10.1006/bcon.1999.0731
Humber RA. 1997. Fungi: identification. 153-185, in LA Lacey (ed.), Manual of Techniques in
Insect Pathology. London, Academic Press.
Keller S. 1987. Arthropod-pathogenic Entomophthorales of Switzerland. I. Conidiobolus,
Entomophaga and Entomophthora. Sydowia 40: 122-167.
King DS. 1979. Systematics of fungi causing entomophthoramycosis. Mycologia 71: 731-745. doi:
10.2307/3759185
Laxman RS, Sonawane AP, More SV, Rao BS, Rele MV, Jogdand VV, Deshpande VV, Rao MB. 2005.
Optimization and scale up of production of alkaline protease from Conidiobolus coronatus.
Process Biochemistry 40: 3152-3158. doi: 10.1016/j.procbio.2005.04.005
MacLeod DM, Miiller-Kégler E. 1973. Entomogenous fungi: Entomophthora species with pear-
shaped to almost spherical conidia (Entomophthorales: Entomophthoraceae). Mycologia 65:
823-893. doi: 10.2307/3758521
124 ... Eken, Giiclii & Ak
Manning RJ, Waters SD, Callaghan AA. 2007. Saprotrophy of Conidiobolus and Basidiobolus in leaf
litter. Mycological Research 111: 1437-1449. doi: 10.1016/j.mycres.2007.08.019
Ochoa LF, Dubque CS, Velez A. 1996. Rhinoentomophthoromycosis. Report of two cases. Journal
of Laryngology and Otology 110: 1154-1156. doi: 10.1017/S002221510013600X
Pell JK, Eilenberg J, Hajek AE, Steinkraus DC. 2001. Biology, ecology and pest management
potential of Entomophthorales. 71-153, in TM Butt et al. (eds.), Fungi as Biocontrol Agents.
Wallingford, CABI Publishing. doi: 10.1079/978085 1993560.0071
Prabhu RM, Patel R. 2004. Mucormycosis and entomophthoramycosis: a review of the clinical
manifestations, diagnosis and treatment. Clinical Microbiology and Infection 10 (Suppl 1):
31-47. doi: 10.1111/j.1470-9465.2004.00843.x
Prasertphon S. 1963. Conidial formation in Entomophthora coronata (Costantin) Kevorkian.
Journal Insect Pathology 5: 318-335.
Ribes JA, Vanover-Sams CL, Baker DJ. 2000. Zygomycetes in human disease. Clinical Microbiology
Reviews 13: 236-301. doi: 10.1128/CMR.13.2.236-301.2000
Sajap AS, Atim AB, Husim H, Wahab YA. 1997. Isolation of Conidiobolus coronatus (Zygomycetes:
Entomophthorales) from soil and its effect on Coptotermes curvignathus (Isoptera:
Rhinotermitidae). Sociobiology 30: 257-262.
Toledo AV, Remes Lenicov AMM de, Lépez Lastra CC. 2007. Primer registro de Conidiobolus
coronatus (Zygomycetes: Entomophthorales) en crias experimentales de dos especies plaga del
maiz: Delphacodes kuscheli y D. haywardi (Hemiptera: Delphacidae) en la Argentina. Boletin de
la Sociedad Argentina de Botanica 42: 169-174.
Yang X, Li Y, Zhou X, Wang Y, Geng S, Liu H, Yang Q, Lu X, Hiruma M, Sugita T, Ikeda S, Ogawa
H. 2010. Rhinofacial conidiobolomycosis caused by Conidiobolus coronatus in a Chinese rice
farmer. Mycoses 53: 369-373. doi: 10.1111/j.1439-0507.2009.01716.x
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 125-129 January-March 2011
DOT: 10.5248/115.125
Carbonea, Gregorella, Porpidia, Protomicarea, Rinodina,
Solenopsora, and Thelenellia lichen species new to Turkey
KADIR KINALIOGLU * & ANDRE APTROOT ”
' Giresun University, Faculty of Science and Arts, Department of Biology, 28049, Giresun, Turkey
? Adviesbureau voor Bryologie en Lichenologie,
G.v.d. Veenstraat 107, NL-3762 XK Soest, The Netherlands
ApsTRACT—Seven species of lichenized fungi (Carbonea vorticosa, Gregorella humida,
Porpidia tuberculosa, Protomicarea limosa, Rinodina turfacea, Solenopsora holophaea, and
Thelenella modesta) are new to Turkey. Gregorella humida is also new to Asia. For each a short
description is presented.
Key worps —biota, Giresun, Ordu
Introduction
Since John (2004) listed 361 papers referring to lichens from Turkey, many
additional studies have been carried out on Turkish lichen biota (e.g., Aptroot
& Yazici 2009, Aslan et al. 2005, Candan & Ozdemir Turk 2008, Cobanoglu et
al. 2008, Halici & Aksoy 2006, Kinalioglu 2010, Oztiirk & Gitveng 2010, Oran
& Oztiirk 2010, Yazic1 & Aptroot 2008). However, there are still a high number
of records for lichen species yet to be added. This contribution reports further
first records of species new to Turkey.
Materials & methods
The collections were identified with various lichen guides (Brodo et al. 2001, Purvis
et al. 1992, Smith et al. 2009, Wasser & Nevo 2005, Wirth 1995). They are deposited in
the herbarium of the Faculty of Science and Arts, Giresun University, Giresun, Turkey.
The collector and collection number are given in parentheses after the locality details.
Species recorded
Carbonea vorticosa (Flérke) Hertel
A detailed description is provided by Chambers et al. ( 2009).
SPECIMEN EXAMINED: TURKEY. Orpwu: Kumru, Saricicek high plateau, 40°45’28”N,
37°12’51"E, 1521 m, 16 Jul. 2005, on siliceous rock, (herb. Kinalioglu 1802).
126 ... Kinahoglu & Aptroot
Thallus brownish, subsquamulose to eroded-dispersed. Apothecia 0.2-0.7 mm
diam., scattered; disc black, concave, rarely plane. Epihymenium dark blue.
Ascospores 7.5-12 x 3.7-5 um, colourless, simple. Thallus C-, K-, KC-, PD+
orange.
Carbonea vorticosa is often overlooked. In other parts of its range, it grows
on siliceous rock, boulders, and walls in upland to high montane habitats. In
Turkey, it was collected only from siliceous rock in a sun exposed area.
Known from Europe, Asia, Australasia, Antarctica, North America and
South America (Andreev 2003). New to Turkey.
Gregorella humida (Kullh.) Lumbsch
Detailed descriptions are provided by Lumbsch et al. (2005) and Woods (2009).
SPECIMEN EXAMINED: TURKEY. Orpw: Unye, the top of Unye castle, 40°05’46”N,
37°14’22”E, 245 m, 07 Aug 2004, on siliceous rock, (herb. Kinalioglu 1800).
Thallus bluish grey, consisting of roundish goniocysts. Photobiont Nostoc.
Apothecia 0.2-0.7 mm diam., numerous, roundish; disc convex, colourless
when young, red-brown when mature, true exciple yellowish. Hymenium I-.
Ascospores colourless, 12.5-20 x 6.5-10 um. Thallus C-, K-, KC-, PD-.
Gregoriella humida is probably much overlooked. In other parts of its
range, it is a pioneer lichen, growing on well drained acidic to somewhat basic,
+ clayey soil exposed on steep banks such as in disused railway cuttings, on
tipped material on roadsides and on the ground in old lead mines. In Turkey, it
was collected only from siliceous rock.
Known from Europe (Cezanne et al. 2003). New to Asia.
Porpidia tuberculosa (Sm.) Hertel & Knoph
A detailed description is provided by Fryday et al. ( 2009).
SPECIMEN EXAMINED: TURKEY. GirEsuN: Kesap, Degirmenagzi village, sea shore,
40°58'20°N, 38° 37°23”E, 0m, 11 Apr. 2010, on siliceous rock, (herb. Kinalioglu 1809).
Thallus white to pale blue-grey, sometimes rusty red in parts; prothallus dark
brown-black; soralia 0.1-0.8 mm diam., round to irregular; soredia pale grey or
blue-grey. Apothecia not observed. Medulla and soralia C-, K-, KC-, I+violet,
PD-.
In other parts of its range, P tuberculosa is a common species found on
siliceous rocks, walls, pebbles, and rarely on worked timber. In Turkey, it was
collected only from siliceous rock at the sea shore.
Known from North America, South America, Asia, Europe, Macaronesia
(Fryday et al. 2009). New to Turkey.
Protomicarea limosa (Ach.) Hafellner
A detailed description is provided by Coppins (2009).
SPECIMEN EXAMINED: TURKEY. GirEsun: Dereli, E of Kuzu golii high plateau,
40°34’42°N, 38°29°21”E, 2200 m, 09 Aug. 2008, on dead grass, (herb. Kinalioglu 1803).
Seven lichens new to Turkey... 127
Thallus greyish. Apothecia 0.25-0.9 mm diam., black. Epihymenium and
hymenium greenish, K-; hymenial gel I+red; hypothecium K+orange.
Ascospores colourless, narrowly ellipsoid, 10-15 x 3.5-5 um. Thallus C-, K-,
KC-, PD+ orange-red.
This rare species is found on acid soil, over mosses or humus mostly above
900 m. In Turkey, P limosa was collected only from dead grass in sun exposed
areas at high elevation.
Known from Europe and North America (Smith et al. 2009). New to Asia.
Rinodina turfacea (Wahlenb.) Korb.
Detailed descriptions are provided by Brodo et al. (2001) and Thomson (1997).
SPECIMEN EXAMINED: TURKEY. GirEsun: Dereli, E of Kuzu golii high plateau,
40°34’42”N, 38°29°21”E, 2200 m, 09 Aug. 2008, on moss, (herb. Kinalioglu 1808).
Thallus thick, pale brownish or grey. Apothecia abundant, 0.5-1.8 mm diam.;
disc dark brown to black; concolourous with thalline exciple. Ascospores thick-
walled, brown, Physcia-type, 22.5-35 x 10-15 wm. Thallus C-, K-, KC-, PD-.
Rinodina turfacea is found on soil, moss, decaying vegetation, peat and
wood in arctic or alpine sites. In Turkey, it was collected only from moss in sun
exposed areas at high elevation.
‘This species is known from Europe, Asia, North America, and South America
(Brodo et al. 2001, Kotlov 2008, Redchenko et al. 2010). New to Turkey.
Solenopsora holophaea (Mont.) Samp.
A detailed description is provided by Gilbert at al. ( 2009).
SPECIMENS EXAMINED: TURKEY. Orbw: Fatsa, Yalikoy, sea shore, 0 m, 13 Jul. 2005, on
siliceous rock, (herb. Kinalioglu 1798). Giresuw: Dereli, E of Kuzu golii high plateau,
40°34’42”N, 38°29°21”E, 2200 m, 09 Aug. 2008, on soil, (herb. Kinalioglu 1799).
Thallus squamulose to 3 mm wide, upper surface red-brown when dry and
olive green when wet. Apothecia 0.5-1.2 mm diam., numerous, disc dark
reddish brown to black. Ascospores 2-celled, colourless, 12.5-17 x 4 um in size.
Thallus C-, K-, KC-, PD-.
In other parts of its range, this species grows on soil and soft rocks chiefly
in slightly sheltered clefts on vertical cliffs or old walls at the coast. In Turkey, it
was collected from siliceous rock at the sea shore and from soil in sun-exposed
areas at high elevation.
Solenopsora holophaea is known from Africa, Asia, Europe, Macaronesia,
North America, and South America (Giivenc & Oztiirk 1999, Smith et al. 2009).
New to Turkey.
Thelenella modesta (Ny1.) Nyl.
Detailed descriptions are provided by Smith et al. (2009) and Wasser & Nevo (2005).
SPECIMEN EXAMINED: TURKEY. Orpu: Kumru, Ericek high plateau, 40°53'35”N,
37°13'48"E, 1120 m, 16 June 2005, on fuglans regia L. Juglandaceae), (herb. Kinalioglu
1813).
128 ... Kinahoglu & Aptroot
Thallus pale yellowish-grey. Perithecia 0.3-0.8 mm diam., rounded, sparse.
Ascospores muriform, colourless, 25-42 x 10-17 um. Thallus C-, K-, KC-,
PD-.
Elsewhere in its range growing on + rough bark of wayside or parkland
Fraxinus, twigs of Crataegus, and smooth bark of Quercus agrifolia and Juglans
californica. In Turkey, we recorded it from the trunk of Juglans regia.
Thelenella modesta is known from Europe, North America, Asia, Africa, and
Australia (Smith et al. 2009, Wasser & Nevo 2005). New to Turkey.
Acknowledgements
I would like to thank Dr. A. Khodosovtsev & A. Orange for reviewing this paper.
Literature cited
Andreev MP. 2003. Carbonea. 120-131, in NS Golubkova (ed.) Handbook of the Lichens of Russia.
8. Bacidiaceae, Catillariaceae, Lecanoraceae, Megalariaceae, Mycobilimbiaceae, Rhizocarpaceae,
Trapeliaceae. St. Petersburg: Russian Academy of Science. (in Russian)
Aptroot A, Yazici K. 2009. Opegrapha pauciexcipulata, a new corticolous lichen from Turkey.
Mycotaxon 108: 155-158.
Aslan A, Vézda A, Yazici K, Karagoz Y. 2005. New foliicolous lichen records for the lichen flora of
Turkey. Cryptogamie, Mycologie 26(1): 61-66.
Brodo IM, Sharnoff SD, Sharnoff S. 2001. Lichens of North America. Yale University Press,
London.
Candan M, Ozdemir Tiirk A. 2008. Lichens of Malatya, Elazig and Adryaman provinces (Turkey).
Mycotaxon 105: 19-22.
Cezanne R, Eicher M, Lumbsch HT. 2003. Muelleropsis humida — eine tibersehene Flechte?
Herzogia 16: 161-166.
Chambers SP, Galloway DJ, James PW. 2009. Carbonea (Hertel) Hertel (1983). 278-280, in CW
Smith et al. (eds.), The Lichens of Great Britain and Ireland. British Lichen Society, London.
Cobanoglu G, Sevgi E, Sevgi O. 2008. Epiphytic lichen mycota of, and new records from, Serif
Yiksel research forest, Bolu, Turkey. Mycologia Balcanica 5: 135-140.
Coppins BJ. 2009. Protomicarea Hafellner (2001). 751-752, in CW Smith et al. (eds.), The Lichens
of Great Britain and Ireland. British Lichen Society, London.
Fryday AM, Gilbert OL, Galloway DJ, Coppins BJ. 2009. Porpidia Korb. (1855). 739-748, in CW
Smith et al. (eds.), The Lichens of Great Britain and Ireland. British Lichen Society, London.
doi:10.1017/S0024282904014628
Gilbert OL, Purvis OW, James PW. 2009. Solenopsora A. Massal. (1855). 842-843, in CW Smith et
al. (eds.), The Lichens of Great Britain and Ireland. British Lichen Society, London.
Giiveng S, Oztiirk S. 1999. Lichens in the north-east regions of Cyprus. Feddes Repertorium 110
(5-6): 455-463.
Halica MG, Aksoy A. 2006. Saxicolous and terricolous lichens of Sirvan Mountain (Pinarbasi,
Kayseri). Tr. J. Bot. 30: 477-481.
John V. 2004. Lichenological studies in Turkey and their relevance to environmental interpretation.
Abstract book, XI OPTIMA meeting 5-11.9.2004, Belgrade: 45.
Kinalioglu K. 2010. Lichens of Ordu Province, Turkey, Mycotaxon 112: 357-360.
Kotlov YV. 2008. Rinodina. 309-359, in NS Golubkova (ed.), Handbook of the Lichens of Russia.
10. Agyriaceae, Anamylosporaceae, Aphanopsidaceae, Arthrorhaphidaceae, Brigantiaeaceae,
Seven lichens new to Turkey ... 129
Chrysotrichaceae, Clavariaceae, Ectolechiaceae, Gomphillaceae, Lecanoraceae, Lecideaceae,
Mycoblastaceae, Phlyctidaceae, Physciaceae, Pilocarpaceae, Psoraceae, Ramalinaceae,
Stereocaulaceae, Vezdaeaceae, Tricholomataceae. Nauka. St-Petersburg: Russian Academy of
Science. (in Russian)
Lumbsch HT, del Prado R, Kantvilas G. 2005. Gregorella, a new genus to accommodate Moelleropsis
humida and a molecular phylogeny of Arctomiaceae. The Lichenologist 37(4):291-302.
doi:10.1017/S002428290501532X.
Oztiirk $, Giiveng S. 2010. Additional lichen records from the western Black Sea region of Turkey.
Acta Botanica Hungarica 52(1-2): 159-175. doi:10.1556/ABot.52.2010.1-2.14.
Oran S, Oztiirk S. 2010. Three lichenized fungi new to Turkey. Mycotaxon112: 389-392.
Purvis OW, Coppins BJ, Hawksworth DL, James PW, Moore DM. 1992. The lichen flora of Great
Britain and Ireland. Natural History Museum & British Lichen Society, London.
Redchenko O, Koénar J, Gloser J. 2010. A contribution to lichen biota of the central part of
Spitsbergen, Svalbard Archipelago. Pol. Polar Res. 31 (2): 159-168. doi: 10.4202/ppres.2010.09
Smith CW, Aptroot A, Coppins BJ, Fletcher A, Gilbert OL, James PW, Wolseley PA. 2009. The
Lichens of Great Britain and Ireland. British Lichen Society, London.
Thomson JW. 1997. American Arctic Lichens. 2. The Microlichens. The University of Wisconsin
Press, Madison.
Wasser SP, Nevo E. 2005. Lichen-forming, Lichenicolous, and Allied Fungi of Israel. International
Center for Cryptogamic Plants and Fungi, Institute of Evolution, University of Haifa, Israel.
Wirth V. 1995. Die Flechten Baden-Wirttembergs. Ulmer, Stuttgart.
Woods RG. 2009. Gregorella Lumbsch (2005). 417, in CW Smith et al. (eds.), The Lichens of Great
Britain and Ireland. British Lichen Society, London.
Yazic1 K, Aptroot A. 2008. Corticolous lichens of the city of Giresun with descriptions of four
species new to Turkey. Mycotaxon 105: 95-104.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 131-144 January-March 2011
DOT: 10.5248/115.131
Type studies of Russula species described by W.A. Murrill, 1.
R. roseiisabellina, R. sericella, and R. obscuriformis
BART Buyck! & SLAVOMIR ADAMCIK?
’ Muséum National d’Histoire Naturelle, Dépt. Systématique et evolution
UMR7205, Paris F-75005 France
? Institute of Botany, Slovak Academy of Sciences, Department of Cryptogams
Diubravské cesta 9, Bratislava SK-84523 Slovakia
Asstract — The study of the North American russulas remains severely handicapped by the
lack of sufficient microscopic detail on approximately one third of the described taxa. In this
contribution, microscopic features are examined and illustrated in detail for three of Murrill’s
type specimens. The authors reinterpret these data in combination with the macroscopic
features supplied in the original diagnoses and propose amore appropriate infrageneric
placement of the taxa: (i) R. roseiisabellina is not close to R. sericeonitens (subgenus Russula) as
suggested in Murrill’s protologue, nor is ita synonym of R. rimosa (subgenus Heterophyllidia)
as suggested by Hesler — it is a typical member of the R. foetens group (subgenus Ingratula);
(ii) R. sericella is absolutely unrelated to R. obscuriformis as suggested in Murrill’s protologue
and probably fits within subgenus Russula or Tenellula; and (iii) R. obscuriformis is similar
to the recently described R. texensis in Russula sect. Xerampelinae, but new collections are
needed to verify whether it possesses the typical field characters of this group.
Key worps — Florida, micromorphology, Russulaceae, taxonomy
Introduction
William Murrill (1869-1957) was without any doubt one of the most colorful
and influential personalities among 20th century mycologists in America
(Weber 1961). His prolific description of new taxa has given him avery
controversial reputation, also in the case of Russula Pers., and Murrill surpasses
by far his fellow mycologists with a total of 111 newly described Russula species,
most collected near Gainesville, Florida (Buyck 2007).
As a professional mycologist, Murrill started his career at the New York
Botanical Garden, where he was probably influenced and stimulated towards
description of new taxa by the nomenclatural views and ambitions of the
newly imposed “American Code for nomenclature” at the New York Botanical
132 ... Buyck & Adamétik
Garden (Weber 1961). Murrill usually published his new russulas without any
critical revision or discussion of related or similar taxa and without placing
or grouping them into a subgeneric classification scheme. His descriptions
were very short and mainly oriented towards field characters at a time when
the study of the microscopic features of European Russula (Maire 1910, Melzer
1934) had already reached the degree of precision that is still in use today.
Judging from published synonymies (Bills 1984, Bills & Miller 1984) and our
own experience with his collections, it is therefore not surprising that Murrill
had probably difficulties in recognizing his own taxa (see commentary under
R. roseiisabellina below for example).
Hesler (1960, 1961) and Singer (1947, 1958) were the only mycologists who
ever tried to add something more substantial to Murrill’s original diagnoses.
Hesler published very short notes on microscopic features for many of Murrill’s
types, but even the kind of precision Hesler added for spores and elements
of the pileipellis is still largely insufficient to allow for good interpretations
and comparisons with modern descriptions of Russula. More recently,
afew other mycologists (e.g., Bills 1984, Bills & Miller 1984, Kibby & Fatto
1990) have studied at least some of Murrill’s collections but mostly without
publishing the features they examined on Murrill’s types. In a few instances,
these re-examinations eventually resulted in proposed synonymies or different
interpretations for some of Murrill’s taxa.
With taxonomic expertise on Russula having literally vanished in North
America over the past decennia (Buyck 2007) and in the absence of precise data
on Murrill’s types, the study of the North American russulas remains severely
handicapped by the lack of sufficient microscopic detail on approximately one
third of the described russulas on the continent.
This paper is the second of aseries of detailed and_ illustrated
microscopic revisions of Murrill’s taxain an effort to promote and stimulate rapid
progress in the study of American Russula (see Adam¢ik & Buyck 2010). We
also try to place the examined species in the latest available (mainly European)
classifications of the genus. And even if such a placement remains very tentative
in the absence of more precise data on fresh material, our observations suggest
in most cases very different affinities for most of the examined species.
One character shared by nearly all taxa in this contribution concerns the
color change on bruising or on drying: nearly all examined taxa supposedly
exhibit a distinct browning of at least part of the fruit bodies: R. roseiisabellina
(Murrill 1943) has lamellae “becoming brownish where bruised”, R. sericella
(Murrill 1945) was described with a stipe “becoming pale-brownish when
handled”. Finally, we also include here R. obscuriformis (Murrill 1945), which
was considered to be a synonym of R. sericella by Singer (Singer in sched.).
Type studies — Murrill Russula species ... 133
Materials & methods
Micromorphological characters were observed in Olympus CX-41 and Nikon Eclipse
E400 microscopes using an oil-immersion lens at a magnification of 1000x. All drawings
of microscopical structures — except of spores - were made with ‘camera lucida using a
Nikon Y-IDT drawing attachment at a projection scale of 2400x. Contents of hymenial
cystidia and pileocystidia in the illustrations are indicated schematically, except for a
single element where contents are indicated as observed in Congo red preparations
from dried material. Spores on the lamellae were observed in Melzer’s reagent. All
other microscopic observations were made in ammoniacal Congo red, after a short
aqueous KOH pre-treatment to improve tissue dissociation through gelatinous matrix
dissolution. All tissues were also examined for the presence of ortho- or metachromatic
contents or incrustations in cresyl blue as explained in Buyck (1989).
Spores were scanned with an Olympus Artcam camera and measured using Quick
Micro Photo (version 2.1) software. Enlarged scanned pictures of spores were used
for measuring with an accuracy of 0.1 um and for drawing. Q gives length/width ratio
of the spores. Measurements exclude ornamentation. Statistics for measurements of
microscopical characters are given as mean value (boldface) plus/minus standard
deviation and are based on 30 measurements. Values in parentheses give measured
minimum or maximum values. An estimate for spore ornamentation density is given
following Adam¢ik & Marhold (2000).
Names for infrageneric taxa follow the classification system proposed by Romagnesi
(1985, 1987).
Taxonomy
Russula obscuriformis Murrill, Lloydia 7(4): 312. 1945. Fics 1-6
ORIGINAL DESCRIPTION AND TYPIFICATION — Pileus convex to slightly depressed,
solitary, 8 cm broad; surface dry, smooth, at length glabrous, dark-roseous with bay
center, darker on drying, margin even or slightly striate, entire, peeling readily; context
thin, white, discolored on drying, odorless, mild; lamellae adnate, mostly equal, few
forked, broad, medium distant, entire, white; spores subglobose to broadly ellipsoid,
finely tuberculate, stramineous in mass, about 8 um long; cystidia none; stipe equal,
smooth, glabrous, white, 5 x 2 cm.
Type collected by W. A. Murrill under an oak at LaCrosse, Alachua Co., Fla., July 13,
1938 (F 15536). Suggesting R. obscura Romell but differing in color and spore color. The
gills in dried specimens are distinctly gray. [Holotype at FLAS sub nr. F15536].
MICROSCOPIC FEATURES — Sporss broadly ellipsoid, (7.3-)7.7-8.1-8.4(-8.7)
x (6.2-)6.4-6.7-7(-7.4) um, Q = (1.11-)1.15-1.2-1.25(-1.27); ornamentation
rather dense, subreticulate to reticulate, composed of conical to hemispherical,
often large, strongly amyloid warts, ca (3-)5-7(-8) warts in a 3 um diam. circle,
measuring 0.5-0.7 um high, interconnected by fine line connections (2-6 in a
circle) or fused in ridges (0-4 fusions in the circle); suprahilar plage amyloid.
BASIDIA (32-)37.5-40.5-43.5(-45) x (10-)11-12-13(-13.5) um, 4-spored,
clavate. SUBHYMENIUM pseudoparenchymatic. LAMELLAR TRAMA mainly
composed of large spherocytes. HYMENIAL CysTIDIA widely dispersed, less
134 ... Buyck & Adamétik
‘So
eV, RF,
Fics. 1-2. Russula obscuriformis (holotype). 1. Pileocystidia, with contents indicated in one element
as seen in Congo red. 2. Hyphal terminations near cap margin. Scale bar = 10 um.
Type studies — Murrill Russula species ... 135
Fics. 3-6. Russula obscuriformis (holotype). 3. Basidia. 4. Basidiola. 5. Spores in Melzer’s reagent.
6. Hymenial cystidia with contents indicated in one element as seen in Congo red.
Scale bar = 5 um for spores, 10 tum for the other elements.
than 500/mm? and very difficult to observe except near gill edge, measuring
ca, 56-80 x 9-14 um on sides, clavate to fusiform-pedicellate, mucronate-
appendiculate, thin-walled, with few and ill-defined, SV-negative contents
that are not strongly refringent in KOH. MARGINAL CELLS not differentiated.
PILEIPELLIs orthochromatic in cresyl blue, without incrustations, not sharply
delimited from the underlying spherocytes of the context, vaguely divided in
a rather poorly gelatinized subpellis and a more dense suprapellis of intricate
to ascendant hyphae, with poorly differentiated pileocystidia. Hyphal endings
thin-walled and easily collapsing, near margin with terminal cells measuring
(19-)24.5-34.2-44(-55) x (2.5-)3-3.2-4(-4.5) wm, slender, attenuated or
136 ... Buyck & Adamétik
cylindrical, with apex often more or less abruptly, irregularly or repeatedly
constricted and only 1.5-2.5 um diam., occasionally clavate; subapical cells
shorter and often somewhat larger in diam., often branched. Pileocystidia
scarce and indistinct, single-celled, arising from the subpellis, cylindrical to
subclavate, ca. 4-5.5(7.5) um wide, with poorly differentiated, granular contents
that do not react to sulphovanillin. CLAMP CONNECTIONS absent in all parts.
COMMENTARY — R. obscuriformis differs from all other species discussed in
this paper by the spores that are “stramineous in mass” — an observation that
confirms at least that Murrill did distinguish between pale and darker spore
prints in Russula. Itis therefore difficult to understand why Singer synonymizes
this species with R. sericella (having a white spore print), which has indeed a
completely different pileipellis under the microscope.
The discoloring context should, in our opinion, be interpreted as ‘graying’
context because of the comparison to “R. obscura Romell” (= R. vinosa
Lindblad) and the mention of the distinctly grayish lamellae on drying. This
graying context, together with the odorless flesh and the very prominent
reticulation of the spores, is a combination of characters that does not suggest
a place in Russula sect. Xerampelinae (Singer) Jul. Schaff. However, the recently
described R. texensis (Buyck et al. 2008) is a fishy Russula with grayish-brownish
discoloring context and a weak fishy smell. It has an overall similar color and
also similar features of spores and pileipellis. The two taxa differ nevertheless by
the much more pronounced reticulation of the spores in R. obscuriformis and
the very scarce, smaller and hardly prominent pileocystidia. The spore print
color of R. texensis was noted as ‘pale’ on the gills (a sufficient spore print was
not obtained). A dark cream to pale ochre spore print may therefore still be
possible and could perhaps match the ‘stramineous’ color noted by Murrill for
R. obscuriformis. It can therefore not be excluded for the moment that Murrill’s
species is a good member of sect. Xerampelinae.
The use of the synoptic key by Kibby & Fatto (1990) is quite frustrating
in the case of R. obscuriformis since the interpretation of many features (in
particular cap color, spore print color, peeling and bruising), does not allow for
unambiguous coding and therefore does not lead to any reliable identification.
Russula roseiisabellina Murrill, Lloydia 6(3): 216. 1943. EIGS 7-13
ORIGINAL DESCRIPTION AND TYPIFICATION —Pileus convex to depressed, 4.5-6 cm
broad; surface glabrous, slightly viscid, the cuticle not readily separable, rosy-isabelline,
margin entire, somewhat striate; context rather thick, white, unchanging, sweet,
odorless; lamellae adnate, narrow, close, entire, mostly equal, scarcely any forked,
white to pallid, becoming brownish where bruised; spores white in mass, globose or
subglobose, distinctly echinulate, 6-7 jum; stipe tapering downward, smooth, glabrous,
white, unchanging on drying but brownish where bruised, 4-6 x 1-1.5 cm.
Type collected under an evergreen oak on the west shore of the Prairie, near
Gainesville, Fla., June 19, 1938 (F 16365). Also collected under oaks at the Tung-oil
Type studies — Murrill Russula species ... 137
Fics. 7-9. Russula roseiisabellina (holotype). 7. Pileocystidia, with contents indicated in one
element as seen in Congo red. 8. Hyphal terminations in cap center. 9. Hyphal terminations near
cap margin. Scale bar = 10 um.
138 ... Buyck & Adamétik
Mill, west of Gainesville, June 15, 1938, by Margaret Johnson (F 17209), and in the
same locality, June 22, 1938, by West and Murrill (F 17210). This species seems to prefer
soil with some lime in it. It is rare, and is found alone or, at most, two near together.
[Holotype at FLAS sub nr. F16365].
MICROSCOPIC FEATURES — SPORES ellipsoid, (6.1-)6.7-7.1-7.6(-8) x (4.7-)
4.8-5.1-5.4(-5.9) um, Q = (1.18-)1.29-1.39-1.49(-1.54); ornamentation
dens (with 7-10(-13) warts in a 3 wm circle), composed of low and obtuse,
amyloid warts measuring 0.2-0.3 um high, mostly isolated, with some very
rare connectives or twinned warts (0-2 fusions in the circle) on some spores;
suprahilar plage inamyloid. BAstp1a (35-)40-42.6-45(-46) x (9-)9.5-10.3-11
(-11.5) wm, 4-spored, clavate. SUBHYMENIUM pseudoparenchymatic, small-
celled. LAMELLAR TRAMA mainly composed of large spherocytes. HYMENIAL
CYSTIDIA dispersed, often less than 600/mm? but more numerous on gill
edge, measuring (35.5-)47.5-56.4-65.5(-70) x (7.5-)8.5-10.2-12(-14) um,
fusiform-pedicellate, mucronate-appendiculate, thin-walled, with SV-negative,
crystalline-granular contents, that are strongly refractive in KOH. MARGINAL
CELLS undifferentiated. PILEIPELLIs near the surface slightly metachromatic in
cresyl blue, not sharply delimited from the underlying context, thin, vaguely
divided in a poorly gelatinized subpellis of intermingled hyphae, and a
suprapellis of more branched and intricate endings with many pileocystidia
near the surface only. Hyphal endings thin-walled, often branched at the first
or second subapical cell, overall slightly narrower and with shorter terminal
cells in cap center compared to cap margin; terminal cells near margin
measuring (12-)15.5-21.6-28(-42.5) x 4-4.8-5.5(-6) wm, subcylindrical or
mostly somewhat narrowing upward, in cap center (12.5-)15.5-19.8-24(-29)
x (3-)3.5-3.8-4(—5) tum, less narrowing but on the contrary more often slightly
inflated at the tip and subcapitulate; subapical cells mostly equal in width,
often branched. Pileocystidia present near surface only, numerous, unicelled,
(23.5-)31-42.1-53(-68) x (3.5-)4.5-5.2-6(-6.5) tum with the largest one
near the cap margin, narrow, fusiform to typically subulate with mucronate
tips, thin-walled; contents granular-crystalline, often concentrated in upper
half or middle portion of the cystidium, insensitive to sulfovanillin. CLAMP
CONNECTIONS absent in all parts.
COMMENTARY — Because of the mention of the white spore print, the mild taste,
and a weakly striate cap margin in the original description, this species keys
out to R. subgen. Heterophyllidia Romagn. when using most keys for European
russulas (Bon 1988, 2002a,b; Romagnesi 1985). Using the synoptic key of Kibby
& Fatto, the easy and straightforward coding of features (FHKNPTV) leads
directly to R. decora Shaffer. The latter species is a member of the R. nigricans
group (R. subgen. Compactae (Fr.) Bon) and therefore absolutely not a close
match for Murrill’s type.
Type studies — Murrill Russula species ... 139
10
Fics. 10-13. Russula roseiisabellina (holotype). 10. Basidia. 11. Basidiola. 12. Spores in Melzer’s
reagent. 13. Hymenial cystidia with contents indicated in one element as seen in Congo red.
Scale bar = 5 um for spores, 10 um for the other elements.
Our own observations on features of spores and particularly of pileipellis
place R. roseiisabellina without any doubt in R. subgen. Ingratula Romagn.
(perhaps close to R. ventricosipes Peck): the non-amyloid suprahilar spot, the
slender, narrow, mucronate pileocystidia, the weak metachromatic reaction
of the suprapellis elements in cresyl blue, and finally the spore ornamentation
consisting of low, mostly isolated and obtuse warts are all well known features
for other taxa in this group. The metachromatic reaction in cresyl blue and the
type of spore ornamentation may also remind of R. subsect. Cyanoxanthinae
Singer (R. subgen. Heterophyilidia) but the latter species group differs by
a different and very characteristic type of pileocystidia and in having strongly
incrusted, metachromatic hyphal ends, which are quite different from the ones
observed here.
140 ... Buyck & Adamétik
R. roseiisabellina therefore appears to be a good and perhaps rare species
that does not correspond to any of the already described members of subgen.
Ingratula in North America. Whether it is very characteristic in the field is
unlikely: our examination of the second specimen identified and mentioned
as such in the protologue by Murrill reveals a clearly different species of the
R. foetens-group with very different spores.
Hesler (1960), who has published a “type-study” with some notes on the
spores and pileipellis of R. roseiisabellina, describes a quite different type of
pileipellis, reminiscent of R. virescens (Schaeff.) Fr., and concludes that Murrill’s
species is identical to R. rimosa Murrill, reducing the latter into synonymy.
However, as the senior author has had access to Hesler’s personal files and
duplicate collections at TENN, it is evident that the disagreement between
Hesler’s and our own observations can be easily explained by the fact that
Hesler never examined the type, but relied for his publication on a different,
but misidentified specimen sent to him by Murrill.
The essential features of R. roseiisabellina reside with the pinkish flush on
the cap, the pale spore print (described as white, but given the imprecision at
that period, a pale cream spore print can not be excluded), mild taste, browning
context at least for the gills, and absence of a distinct smell. The importance of
its association with Quercus on limy soil remains to be verified, but may help in
separating it from small individuals of R. ventricosipes, a typical pine associate
on sandy soil possessing equally a pinkish flush on the cap.
Russula sericella Murrill, Lloydia 7(4): 313. 1945. Fics 14-21
ORIGINAL DESCRIPTION AND TYPIFICATION — Pileus convex to depressed, 5-7 cm broad;
surface dry, smooth, finely pruinose, vinosous on the disk, paler toward the margin,
which is entire and very slightly striate at times; context white, unchanging, odorless,
mild; lamellae adnate, many forked at the very base, few inserted, close, narrow, entire,
white, gray when dried; spores globose or subglobose, plainly short-tuberculate, white
in mass, 6-7 tum; cystidia none; stipe usually equal, stuffed, smooth, glabrous, white,
becoming pale-brownish when handled, 5-7 x 1.5-2 cm.
Type collected by W. A. Murrill under a live-oak in Gainesville, Fla., June 1, 1938 (F
12075). Also collected several times under frondose trees in Alachua Co. and once in
Clay Co., Fla. Closely related to Kauftman’s R. sericeonitens but easily distinguished by the
change in the color of the stipe. Spores tuberculate; not echinulate as in R. xerampelina
Fr. [Holotype at FLAS sub nr. F12075].
MICROSCOPIC FEATURES — Spores subglobose to broadly ellipsoid, (7.3-)
7.5-7.8-8.1(-8.5) x (6.3-)6.5-6.8-7(-7.4) um, Q = (1.07-)1.11-1.16-1.21
(-1.35); with a dense subreticulate ornamentation (ca (7-)8-10(-11) elements
in a 3 wm circle), composed of broadly conical, amyloid, warts measuring
0.4-0.6 um high, with numerous line connections ((0-)2-5(-6) connections
in a 3 um circle) or locally fused in short or long ridges (0-4(-5) fusions in
the circle); suprahilar plage amyloid. Basip1a (37-)39,.5-42.2-45(-48) x
Type studies — Murrill Russula species ... 141
N
fan
Pf
Fics. 14-16. Russula sericella (holotype). 14. Pileocystidia, with contents indicated in one element
as seen in Congo red. 15. Hyphal terminations in cap center. 16. Hyphal terminations near cap
margin. Scale bar = 10 um.
142 ... Buyck & Adamétik
Fics. 17-21. Russula sericella (holotype). 17. Basidia. 18. Basidiola. 19. Spores in Melzer’s reagent.
20. Hymenial cystidia with contents indicated in one element as seen in Congo red. 21. Marginal
cells of gill edge. Scale bar = 5 um for spores, 10 um for the other elements.
(10-)11-11.9-12.5(-13) um, 4-spored, clavate. SUBHYMENIUM small-celled.
LAMELLAR TRAMA with many very large spherocytes. HYMENIAL CYSTIDIA on
sides moderately numerous (1000-1500/mm/’), hardly emergent, originating in
the subhymenium, measuring (49-)52.5-63.3-74(-89) x (7-)8-9.3-10.5(-11)
um, mostly obtuse, occasionally mucronate or appendiculate (up to 4 um long),
thin-walled, with SV-negative contents. MARGINAL CELLS on edge of gills very
small and slender, hardly differentiated, ca. 7-18 x 2.5-4 um. PILEIPELLIs
orthochromatic in cresyl blue, without incrustations, not sharply delimited
from the underlying large spherocytes of the context, thin, vaguely divided in
Type studies — Murrill Russula species ... 143
a rather poorly gelatinized subpellis and a thin, discontinuous and disrupted
suprapellis of intricate, small-celled and highly branched hyphal endings; these
very thin-walled and also with thin septa; terminal cells very small and short,
measuring (8-)12.5-17-21.5(-27) x (2.5-)3.5-4.1-4.5(-5) tm, mostly very
irregular and often nodulose in form, with local contortions and inflations, not
attenuated but rounded-obtuse or somewhat inflated near the tips, in the centre
of pileus similar, somewhat more regular and with terminal cells of similar size,
(8.5-)11.5-14.7-18(-20) x (2.5-)3-3.6-4.5(-5) wm. Pileocystidia distinct,
dispersed, 1-3 celled, of very variable length, mostly situated at the cap surface
and with terminal cells 12-17.5-23.5 x 5.5-6.6-8 um, ellipsoid, fusiform or
rarely clavate, obtuse, but some also longer and cylindrical, ascending from
the subpellis, absent in the underlying trama; contents granular to crystalline,
refringent, hardly reacting with sulfovanillin. CLAMP CONNECTIONS absent in
all parts.
COMMENTARY — ‘The only mycologist who published on the type of R. sericella
was Hesler (1960), unfortunately without any comment on the quite distinctive
pileipellis. Singer also examined the type as evidenced by the note he left
with the type specimen stating that “R. sericella = R. obscuriformis Murrill =
R. xerampelina”. We disagree completely with the proposed synonymy, these
three taxa being very different as shown here.
Using the synoptic key of Kibby & Fatto (1990) the combination of
A?KNPT (with the question mark allowing for variation in our interpretation
of the second feature: the “readily” peeling cap) leads either to R. rosea Quél.
(choosing I = %4-% peeling ) or to R. sericeonitens Kauffman (choosing J =
% to completely peeling), the latter being indeed the species that is suggested
by Murrill himself as being very close to R. sericella. Both species are quite
different from R. sericella.
Use of European Russula-keys results in similar placements as for some of
the species discussed above and leads to the mild or faintly acrid species around
R. krombholzii Shaffer in R. subgen. Russula when using Romagnesi’s key (1985)
or to a placement in R. subgen. Tenellula Romagn. with Bon’s key (2002).
Acknowledgements
The authors would like to thank the curators of the mycological herbaria of FLAS
(Gainesville, Florida) and TENN (Knoxville, Tennessee) for their efficiency and R.H.
Petersen at TENN for access to Hesler’s personal notes and duplicate specimens. A study
visit to the Paris’ Herbarium by Adam¢ik was funded through the Synthesys program
of the European Union (FR-TAF-3122 and FR-TAF-5110), his further studies funded
national project Vega 2/0028/11. Overseas travel of the senior author has been funded
by the research program “Etat et structure phylogénétique de la biodiversité actuelle
et fossile” (Dir. Ph. Janvier) at the Paris’ Museum. Reviewers of the manuscript, André
Fraiture and Pierre-Arthur Moreau, are acknowledged for valuable comments.
144 ... Buyck & Adamétik
Literature cited
Adam¢ik S, Buyck B. 2010. Re-instatement of Russula levyana Murrill as a good and distinct
American species of Russula section Xerampelinae. Cryptog. Mycol. 31(2): 119-135.
Adamé¢ik S, Marhold K. 2000. Taxonomy of the Russula xerampelina group. I. Morphometric study
of the Russula xerampelina group in Slovakia. Mycotaxon 76: 463-479.
Bills GE. 1984. Southern Appalachian russulas. II. Mycotaxon 21: 491-517.
Bills GK Miller OK. 1984. Southern Appalachian Russulas. I. Mycologia 76(6): 975-1002.
doi: 10.2307/3793015
Bon M. 1988. Clé monographique des russules dEurope. Doc. Mycol. 18(70-71): 1-120.
Bon M. 2002a. Nouvelles clés des Russules (1). Doc. Mycol. 32(125): 43-165.
Bon M. 2002b. Nouvelles clés des Russules (2). Doc. Mycol. 32(127-128): 49-67.
Buyck B. 1989. Valeur taxonomique du bleu de crésyl pour le genre Russula. Bull. Soc. Mycol.
France 105(1): 1-6.
Buyck B. 2007. A new initiative towards the study of Russula in the eastern USA. Pagine Micol.
27: 81-86.
Buyck B, Adaméik S, Lewis DP. 2008. Russula section Xerampelinae in Texas. Cryptog. Mycol.
29(2): 121-128.
Hesler LR. 1960. A study of Russula Types. Mem. Torrey Bot. Club 21: 1-59.
Hesler LR. 1961. A study of Russula Types. IL Mycologia 53: 605-625. doi:10.2307/3756461
Kibby G, Fatto RM. 1990. Keys to the species of Russula in northeastern North America., 3" ed.
Somerville, Kibby-Fatto Enterprises.
Melzer V. 1934. Contribution a l'étude microscopique des Russules. Bull. Soc. Mycol. France 50:
218-225.
Murrill WA. 1943. More new fungi from Florida. Lloydia 6: 207-228.
Murrill WA. 1945 [“1944”]. More fungi from Florida. Lloydia 7: 303-327.
Maire R. 1910. Les bases de la classification dans le genre Russula. Bull. Soc. Mycol. France 26:
49-125,
Romagnesi H. 1985. Les Russules d'Europe et d'Afrique du Nord, 2"4 ed. Vaduz: J. Cramer.
Romagnesi H. 1987. Status et noms nouveaux pour les taxa infragénériques dans le genre Russuia.
Doc. Mycol. 18: 39-40.
Singer R. 1947. Type studies on Basidiomycetes III]. Mycologia 39(2): 171-189.
doi: 10.2307/3755005
Singer R. 1958. New and interesting species of Basidiomycetes V. Sydowia 11: 141-272.
Weber GE 1961. William Alphonso Murrill. Mycologia 53(6): 543-557.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 145-153 January-March 2011
DOI: 10.5248/115.145
New species and new records of Crepidotus from the
northwest region of Sao Paulo State, Brazil
MARINA CAPELARI
Instituto de Botdnica, Niicleo de Pesquisa em Micologia
Av. Miguel Stéfano, 3687, Sao Paulo, 04301-902, SP, Brazil
CORRESPONDENCE TO:
[email protected]
AsstTract — The study of Agaricales collections gathered in the northwest region of Sao
Paulo State, Brazil revealed the occurrence of four species of Crepidotus. Two of them,
C. flavus and C. longicystidiatus, are proposed as new, while C. apodus and C. defibulatus are
recorded for the first time in the northwest region of Sao Paulo State.
Key worps — diversity, South America, taxonomy
Introduction
The genus Crepidotus (Fr.) Staude includes members with a lignicolous
habit, pleurotoid basidiomata often bearing a reduced stipe, and pilei that are
glabrous to densely villose especially near the rear portion. The spore print is in
shades of pale brown or sometimes yellowish, and spores that may be smooth
or ornamented but which always lack a germ pore. Pleurocystidia are normally
absent, but cheilocystidia are mostly present. Hyphae may be clamped or not.
Spore ornamentation and the presence or absence of clamp connections are
the basis of infrageneric classification in Crepidotus by Singer (1947, 1973) and
Hesler & Smith (1965). In her study of European species, Senn-Irlet (1995)
based her infrageneric classification on pileus trama type, including the
presence or absence of a gelatinous layer.
In Brazil, Crepidotus is represented by 36 taxa, of which 10 — C. apodus,
C. applanatus var. subglobiger, C. candidus, C. catamarcae, C. crocophyllus,
C. defibulatus, C. martinii, C. palmarum, C. polylepidis, C. quitensis, C. rubriceps,
C. scymnodes, C. stromaticus, C. tigrensis, C. uber, C. variabilis — occur in Sao
Paulo State (Capelari 2007). Parana and Rio Grande do Sul are the states with
the next highest numbers of known species (Senn-Irlet & Meijer 1998, Rick
1930, 1938, 1961). Singer (1989) cited two species for Amazonas (C. igapoensis,
146 ... Capelari
C. pilosiceps), which are known only by the types. Singer (1973) described
C. guzmanii and mentioned C. truncatus for Pernambuco State. For the state
of Rio de Janeiro, Singer (1973) cited C. albidus var. bisporus and both he and
Bandala et al. (2006) mentioned C. septicoides.
This paper, which deals with collections from forest fragments in the
northwest region of Sao Paulo State, proposes two newspecies: C. longicystidiatus
and C. flavus.
Materials & methods
Materials were collected in four private forest remnants within the northwest region
of Sao Paulo State. These remnants are composed of semideciduous seasonal forest,
which is very fragmented and surrounded by either sugar cane or orange plantations or
pasture. The human impact on these places probably will not be reverted and they tend
to disappear.
For microscopic analyses, dried material was rehydrated in 70% ethanol followed
by 5% KOH. For spore and cheilocystidia dimensions, 20 measurements were taken
for each specimen; Qm represents the mean length/width quotient of the total spores
measured. All microscopic illustrations were made with the aid of a drawing tube. The
colors of fresh material, when possible, were compared with those described by Ktippers
(1979), and the specimens were deposited at the herbarium of the Instituto de Botanica
(SP).
Taxonomy—new species
Crepidotus flavus Capelari, sp. nov. Figs 1a, 2
MycoBank MB 519063
Pileus 3-17 mm latus, flabellatus, flavus vel ochraceus, brunneus prope substrato,
pruinosus, margine flava vel ochracea, involuta. Lamellae adnatae, flavae vel ochraceae.
Stipes nullus. Basidiosporae 8.7 x 8.7 um, globosae, valde verruculosae. Pleurocystidia
nulla. Cheilocystidia 19.3-29.2 x (5.2-) 7.0-9.2 um, numerosa, flageliformia, leavia,
interdum cum apicibus incrustatis. Trama pileorum flavida, hyphae fibulatae, 6.2-12.5 um
latae. Trama lamellarum regularis, flavida, hyphae fibulatae, 6.2-8.7 um latae. Pileipellis
ex hyphis repentibus vel erectiusculis, fibulatis. Gregarius, supra trunco caduco.
Type: BRAZIL, SP, Matao, (21°37'14”S 48°32’ 14”W), 12 December 2007, F. Karstedt 1011
(holotypus in herbarium SP asservatur).
Erymo.oey: Latin, yellow, the basidiomata color.
MACROCHARACTERS: Pitgus 3-17 mm broad, flabelliform, yellow to
ochraceous, brown near the attachment to the substrate, margin yellow to
ochraceous yellow, pruinose at the rear portion, dry, not hygrophanous, margin
plane to slightly incurved, smooth. LAMELLAE adnate, diverging from acommon
central point, distant, with 1-2 series of lamellulae, yellow to ochraceous. STIPE
absent. CONTEXT yellowish, thin.
MICROCHARACTERS: BASIDIOSPORES 8.7 x 8.7 um, Q. = 1.0, uniformly globose,
ornamented, strongly verrucose, light brown, thick-walled, inamyloid. BAsipIA
Crepidotus spp. nov. (Brazil) ... 147
Fig. 1. A. Crepidotus flavus (type); B. Crepidotus longicystidiatus (type). Bars = 1 cm.
148 ... Capelari
not seen. PLEUROCYSTIDIA absent. CHEILOCYSTIDIA 19.3-29.2 x (5.2-)7.0-9.2
um, numerous, turning the margin completely sterile, ventricose, smooth,
hyaline, thin-walled, some with apical encrustations, clamp connections at
the base not seen. PILEUs TRAMA thin, yellowish, with cylindrical, thin-walled
hyphae, 6.2-12.5 um diam, hyaline, clamped, ungelatinized. HYMENOPHORAL
TRAMA regular, yellowish, with cylindrical, slightly thin-walled hyphae, 6.2-8.7
um diam, hyaline, clamped, ungelatinized. PILEIPELLIs light brown, a cutis of
prostate to some loose and suberect yellowish to light brownish hyphae, 3.7 um
diam, thick-walled, clamped.
HABIT AND HABITAT: Gregarious, on fallen trunk.
COMMENTSs: Macroscopically, this material fits very well with the illustration
of Crepidotus stromaticus (Cooke & Masse) Sacc. published by Hemmes &
Desjardin (2002). According to these authors, C. stromaticus from Hawaii had
been previously referred to C. citrinus Petch and C. sulphurinus Imazeki & Toki.
Literature on C. stromaticus is limited, although it was cited for Brazil by Rick
(1961) in material that needs revision.
Pilat (1950) described the Australian type material of C. stromaticus as
“albido-isabellino ... Pileus 10-15 mm. latus ... Sporae ... distincte dense
obtuse verrucosae, 8-8.5 x 6.7-7.5 pw”, and considered it identical to C. pogonatus
(Kalchbr.) Sacc. However, in the same paper, he described the basidiospores of
C. pogonatus as “punctato-verrucosae ... 5-5.6 4 diam.,” much smaller than
he measured for C. stromaticus. On the other hand, Singer (1955) described
the type of C. stromaticus as “strongly punctate and somewhat rough, about
7-7.5 «wm in diameter” and regarded C. stromaticus so close to C. nephrodes
that a specific separation could hardly be justified. Information by Ripkova et
al. (2005) and Bandala et al. (2008) suggests that C. nephrodes is a different
taxon and should even be considered a synonym of C. crocophyllus, a broadly
distributed temperate fungus with variable pigmentation that was already
mentioned for Sao Paulo State by Rick (1930, 1961).
Crepidotus sulphurinus (Imazeki & Toki 1954), according to the protologue,
has bisporic basidia and basidiospores that are 7-10 x 6-9 um, subglobose,
apiculate, brownish-yellow, and echinulate-verrucose. Crepidotus flavus, on the
other hand, produces truly globose, perhaps less ornamented basidiospores (as
far as I know there are no available MEV photographs of C. sulphurinus), and
ventricose cheilocystidia (some apically encrusted) and not clavate as illustrated
by Imazeki & Toki (1954).
Singer (1953) identified a yellow Crepidotus from Argentina as C. citrinus
growing together on the same trunk with another species he identified as
C. fulvifibrillosus Murrill, which Ripkova et al. (2005) consider a synonym of
C. crocophyllus. Crepidotus citrinus was described from Sri Lanka and, according
Crepidotus spp. nov. (Brazil) ... 149
Lh, WW \ ee che SLAG
Fig. 2. Crepidotus flavus (type):
a. basidiospores; b. cheilocystidia. Bars = 10 um.
to Singer (1955), the type has globose basidiospores that are 7-8 x 7-8 um,
with strongly imbedded spinules that project slightly beyond the episporium so
that the spore surface appears rough in immersion oil. Singer (1955), however,
did not mention cheilocystidia size and shape. The Argentinean material of
the same species described by Singer (1953) has globose basidiospores that are
6.8-8.3 um, 2-, 3-, or 4-spored basidia, and hyaline to light yellow versiform
cheilocystidia, the majority of which have irregular excrescences but lack
encrustations and which measure (15.0-)27.5-42 x (4.0-)6.8-11(-14.5) um.
No other modern description of C. citrinus was found in order to clarify the
cheilocystidia. Indeed, C. citrinus sensu Singer appears to be the closest species
to the new Brazilian one, but they differ in cheilocystidia shape and size.
Horak (1978) described two species with yellow colors and encrusted
cheilocystidia—C. aureus from New Caledonia and C. parietalis from New
Zealand—that can be compared with C. flavus. Crepidotus flavus differs from
C. aureus in basidioma dimensions, less ornamented pileus surface, and
basidiospore and cheilocystidial morphology, with C. aureus producing smaller
(6-7 um), subglobose spores and cheilocystidia that are fusoid to lageniform,
basally thin-walled and apically thick-walled (< 1.5 um). From C. parietalis,
C. flavus differs in pileus color (paler in C. parietalis) and especially by the
basidiospore dimension and shape (5-6.5 wm and globose in C. parietalis) and
the absence of thick-walled hyphae at the pileipellis.
150 ... Capelari
Crepidotus longicystidiatus Capelari, sp. nov. Fics 1B, 3
MycoBank MB 519064
Pileus 3-7 mm latus, primum flabellatus, deinde convexus vel plano-convexus, dorsaliter
affixus in substrato tum circularis vel reniformis, subroseus, pilosus; margine plana ad
involutam. Lamellae adnatae, vinaceo-roseae. Stipes nullus. Basidiosporae (6.2-)7.5(-8.7)
x 6.2-7.5 um, globosae vel subglobosae, verruculosae. Basidia 20-25 x 5.0-6.0 um, clavata,
tetraspora. Pleurocystidia nulla. Cheilocystidia 60-116 x 5.0-7.0 um (14.0 um apicem),
cylindracea ad flexuosa, hyalina, cum fibulis in base. Trama lamellarum regularis, hyphae
fibulatae, 6.2-11.2 um latae. Pileipellis ex hyphis repentibus composite, fibulatae, 6.2-10.0
um latis. Gregarius ad ramo putridos.
Type: BraziL, SP, Turmalina, (20°00'13”S 50°26’02”W), 27 November 2007, Capelari
4358 (holotypus in herbarium SP asservatur).
ErymMo.oey: Latin, because of the very long cheilocystidia.
MACROCHARACTERS: PILEUS 3-7 mm broad, flabelliform in primordial
stages, becoming convex or plane-convex, dorsally attached to substrate, then
circular, subcircular or more or less reniform when seen from hymenophore,
light pinkish, dry, not hygrophanous, surface pilose, margin plane to incurved,
smooth, LAMELLAE adnate to acommon central or excentric point, distant, wit
1-2 series of lamellulae, vinaceous pink (near N,,A,.M.,), edges lighter. STIPE
absent. CONTEXT thin.
MICROCHARACTERS: BASIDIOSPORES (6.2-)5.0-7.0(-8.7) x 6.2-7.5 um, Q.
= 1.19, globose to subglobose, ornamented, verrucose, ferruginous-brown,
slightly thick-walled, inamyloid. Basip1a 20-25 x 5.0-6.0 uum, clavate, four-
spored, hyaline, thin-walled. BAsIDIOLEs numerous. PLEUROCYSTIDIA absent.
CHEILOCYSTIDIA 60-116 x5.0-7.0 tum, up to 14.0 um at the apex), numerous,
cylindrical, narrowly clavate, flexuous, smooth, hyaline, slightly thin-walled,
clamped at the base. PILEUs TRAMA thin, of cylindric, slightly thin-walled
hyphae, 6.2-10 um diam, hyaline, clamped, ungelatinized. HyMENOPHORAL
TRAMA regular, of cylindric, slightly thin-walled hyphae, 6.2-11.2 um diam,
hyaline, clamped, constricted at the septum, ungelatinized. PILEIPELLIs a
cutis of undifferentiated flexuous hyphae, 6.2-10 um diam, hyaline to slightly
brownish, slightly thick-walled, clamped, with small clamp connections. PILEUs
HYPHAE at the substrate hyaline slightly brownish hyphae, 2.5-3.7 um diam,
moderately thick-walled, sometimes encrusted, branched, clamped.
HABIT AND HABITAT: Gregarious, on fallen branch.
CoMMENTSs: Of the species with pink or pinkish pilei or lamellae, the new
species can be compared with C. roseus Singer, C. roseolus Singer, and
C. velutinoaffinis Singer, described in Singer’s 1973 monograph of Crepidotus
for the Neotropics.
Crepidotus roseus differs in basidiospore morphology and cheilocystidia
size and is characterized by less broad (6.5-7.0 x 5.3-5.8 tm) subglobose
basidiospores and smaller (30-48 x 7.5-13 tm) cheilocystidia. The new
Crepidotus spp. nov. (Brazil) ... 151
Fig. 3. Crepidotus longicystidiatus (type):
a. basidiospores; b. basidia; c. basidioles; d. cheilocystidia. Bars = 10 um.
species differs similarly from C. roseolus, which has smaller (5.0-6.2 um, most
~5.5 um) punctate globose basidiospores and cheilocystidia that are 32-35 x
6.7-9.3 tum, ventricose in the lower and upper portions and slightly constricted
in the middle, and often with one or two finger-like appendages. Crepidotus
velutinoaffinis differs in its small (2 x 1 mm) stipe (lacking in C. longicystidiatus)
and cheilocystidia, which are 40-61 x 3.8-7 um, cylindric or cylindric-
subclavate to slightly ventricose with apices that are mostly subcapitate or at
least slightly constricted just below the apex or occasionally equal and rounded
or attenuate (rarely acute).
152 ... Capelari
Crepidotus rubrovinosus Bandala et al. (2006), with a reddish or red-wine
pileus described from Mexico, differs in its persistently reddish fimbriate
lamellar edges, oblong/ellipsoid basidiospores with a suprahilar depression and
ornamentation comprising short, broad and sinuous blunt bulges and ridges
that often anastomose to form a subreticulate pattern, and cheilocystidia that
are cylindric-clavate to clavate, narrowly utriform, 35-138(-147) x 3-7(-8)
pum, occasionally septate, sinuous toward the base, apex rounded or subcapitate,
rarely attenuated, and, at times, bifurcate or lobate (Bandala et al. 2006).
Taxonomy—new records
Crepidotus apodus Capelari, Hoehnea 34: 76. 2007.
MATERIAL EXAMINED: BrazIL, SP, Onda Verde, 20°2’08”S 48°49°35”W, 09 December
2008, Capelari 4426 (SP).
COMMENTS: Crepidotus apodus produces many very small yellowish basidiomata
that colonize shrubs on the forest floor. It was described from Parque Estadual
das Fontes do Ipiranga (south of Sao Paulo city), and since its publication,
it has frequently been collected in other protected areas of Sado Paulo State.
Description and illustrations can be found in Capelari (2007).
Crepidotus defibulatus Singer, in Singer & Digilio, Lilloa 25: 410. 1952 [“1951”].
MATERIAL EXAMINED: BRAZIL, SP, Turmalina, 20°00°13”S 50°26’02”W, 27 November
2007, Capelari 4348 (SP).
COMMENTs: Crepidotus defibulatus is one of the few Crepidotus species with
ornamented basidiospores and clampless hyphae. It occurs in Argentina (Singer
1973, type locality) and Sao Paulo State, Brazil (Capelari 2007). Descriptions
can be found in Singer & Digilio (1952), Singer (1973), and Capelari (2007,
with illustrations).
Acknowledgements
The author thanks Dr. Tarciso de Sousa Filgueiras, for assisting with the Latin
descriptions, Dra. Noemia K. Ishikawa, Instituto Nacional de Pesquisas da Amazénia,
for sending some useful literature and Klei Sousa for inking the illustrations. I also thank
Victor M. Bandala, Instituto de Ecologia, Biodiversidad y Sistematica, Mexico, and
M. Catherine Aime, LSU AgCenter, U.S.A., for their careful review of the manuscript,
and Shaun Pennycook for his comments on the manuscript. This study was supported by
Fundagao de Amparo a Pesquisa do Estado de S40 Paulo (FAPESP, grant 04/04820-3).
Literature cited
Bandala VM, Montoya L, Horak E. 2006. Crepidotus rubrovinosus sp. nov. and Crepidotus septicoides,
found in the cloud forest of Eastern Mexico, with notes on Crepidotus fusisporus var. longicystis.
Mycologia 98: 131-140. doi:10.3852/mycologia.98.1.131
Crepidotus spp. nov. (Brazil) ... 153
Bandala VM, Montoya L, Mata M. 2008. Crepidotus crocophyllus found in Costa Rica and
Mexico and revision of related species in subsection Fulvifibrillosi. Mycologia 100: 335-346.
doi: 10.3852/mycologia.100.2.335
Capelari M. 2007. O género Crepidotus no Parque Estadual das Fontes do Ipiranga, S40 Paulo, SP,
Brasil e descrigaéo de duas novas espécies. Hoehnea 34: 75-85.
Hemmes DE, Desjardin DE. 2002. Mushrooms of Hawaii: an identification guide. Ten Speed Press:
Berkeley.
Hesler LR, Smith AH. 1965. North American species of Crepidotus. Hafner Publishing Company:
New York.
Horak E. 1978 [“1977”]. Crepidotus episphaeria and related species from the southern hemisphere.
Berichte der Schweizerischen Botanischen Gesellschaft 87: 227-235.
Imazeki R, Toki S. 1954. Higher fungi of Asakawa Experiment Forest. Bulletin of the Government
Forest Experiment Station 67: 20-71
Kuppers H. 1979. Atlas de los colores. Blume: Barcelona.
Pilat A. 1950. Revision of the types of some extra-european species of the genus Crepidotus Fr.
Transactions of the British Mycological Society 33: 215-249. doi:10.1016/S0007-1536(50)
80077-3
Rick J. 1930. Contributio IV ad monographiam Agaricearum Brasiliensium. Brotéria, Série
Botanica 24: 97-118.
Rick J. 1938. Agarici Riograndenses. Lilloa 3: 399-455.
Rick]. 1961. Basidiomycetes Eubasidii in Rio Grande do Sul - Brasilia 5. Agaricaceae. Iheringia série
Botanica 8: 296-450.
Ripkova S, Aime MC, Lizén P. 2005. Crepidotus crocophyllus includes C. nephrodes. Mycotaxon 91:
397-403.
Senn-Irlet B. 1995. The genus Crepidotus (Fr.) Staude in Europe. Persoonia, 16: 1-80.
Senn-Irlet B, Meijer AAR de. 1998. The genus Crepidotus from the state of Parana, Brazil. Mycotaxon
66: 165-199,
Singer R. 1947. Contribution toward a monograph of the genus Crepidotus. Lilloa 13: 59-95.
Singer R. 1953. Quelques agarics noveaux de lArgentine. Revue de Mycologie 18: 3-23.
Singer R. 1955. Type studies on Basidiomycetes. VIII. Sydowia 9: 367-431.
Singer R. 1973. The genera Marasmiellus, Crepidotus and Simocybe in the Neotropics. Beihefte zur
Nova Hedwigia 44: 1-517.
Singer R. 1989. New taxa and new combinations of Agaricales (Diagnoses fungorum novorum
Agaricalium IV). Fieldiana, Botany, n.s. 21: 1-133.
Singer R, Digilio APL. 1952 [“1951”]. Prédromo de la flora Agaricina argentina. Lilloa 25: 5-461.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 155-162 January-March 2011
DOT: 10.5248/115.155
Pilidiella crousii sp. nov.
from the northern Western Ghats, India
KUNHIRAMAN C. RAJESHKUMAR?’, RAHUL P. HEPAT,
SUBHASH B. GAIKWAD & SANJAY K. SINGH?
National Facility for Culture Collection of Fungi,
MACS’ Agharkar Research Institute, G.G. Agarkar Road, Pune, India
AssTRACT — The coelomycete genus Pilidiella (Schizoparmaceae, Diaporthales) was recently
revised to include species with hyaline to pale brown conidia in contrast to the dark brown
conidia of Coniella. The present paper describes a new species of Pilidiella, P. crousii, based
ona molecular phylogenetic analysis of the ITS nrDNA and its unique conidial morphology.
Pilidiella crousii is associated with severe fruit drop of Terminalia chebula (Combretaceae) in
natural forests of Mahabaleshwar in the Western Ghats of India.
Key worps — anamorphic fungi, plant pathogen, Schizoparme
Introduction
The exploration of microfungal diversity of the Western Ghats, which is one
of the biodiversity hot spots of the world, is the prime goal of the National
Fungal Culture Collection of India (NFCCI). The NFCCI aims to explore
fungi from this region for their biotechnological and bioprospecting potential
(Rajeshkumar et al. 2010; Singh et al. 2009). During July 2010 a routine survey
was conducted to explore the microfungal diversity in the natural forests of
Mahabaleshwar, situated in the northern part of the Western Ghats, India, at
17°58’N and 73°43’E. Discovered during this survey, an interesting species of
Pilidieila Petr. & Syd. was found on fallen fruits of Terminalia chebula, associated
with severe fruit infection followed by fruit drop. The aim of the present study
is to identify the species of Pilidiella associated with fruit drop of Terminalia in
India.
Materials & methods
ISOLATES AND MORPHOLOGY — Conidiomata of the fungus were directly isolated
from the surface of fallen fruits and observed under a Nikon Binocular stereo microscope
156 ... Rajeshkumar & al.
(Model SMZ — 1500 with Digi-CAM, Japan). Single conidial cultures were established
on 2% Potato Dextrose Agar plates (PDA; Crous et al. 2009). For morphotaxonomic
studies and photomicrographs an Olympus CX-41 (Japan) microscope was used.
Conidia and conidiomata were mounted in lactic acid cotton blue and measured using
an ocular micrometer, with 30 observations per structure. Colony characteristics in
culture were studied on different media, viz. 2% Malt Extract Agar (MEA), Potato
Carrot Agar (PCA), and PDA (Crous et al. 2009). Herbarium specimens were deposited
in Ajrekar Mycological Herbarium (AMH); the culture was accessioned and preserved
in the National Fungal Culture Collection of India (WDCM-932), Agharkar Research
Institute, Pune, India.
POLYMERASE CHAIN REACTION AND SEQUENCING — Total DNA was extracted from
cultures grown on PDA plates for two weeks at 25 °C, using a DNA extraction kit as
per the manufacturer’s instructions (MP Biomedicals GmbH, Germany). Fragments
containing the region encoding the ITS 1-5.8S-ITS 2 were amplified using primer pairs
ITS4 (5’-TCC TCC GCT TAT TGA TAT GC-3’) and ITS5 (5°-GGA AGT AAA AGT
CGT- AAC AAG G-3’) (White et al. 1990). PCR was performed in a 25 ul reaction
using 2 ul of template DNA (10 ng - 25 ng), 0.5 U of Taq DNA polymerase (Genei,
Bangalore, India), 2.5 ul of 10OX Taq DNA polymerase buffer, 0.5 ul of 200 uM of each
dNTPs (Genei, Bangalore, India), 0.5 ul of 10 pmol primer, H,0 (Sterile Ultra Pure
Water, Sigma) qsp 25 yl. Amplification was performed on an Eppendorf Mastercycler
AG using the following parameters: 5 min step at 95 °C, followed by 30 cycles of 1 min
at 95 °C, 30s at 56 °C and 1 min at 72 °C for ITS region amplification, then a final 7 min
extension step at 72 °C. The PCR products were purified with Axygen PCR cleanup kit
(Axygen Scientific Inc, CA, USA) and sequenced using the BigDye Terminator v3.1
Cycle Sequencing Kit (Applied Biosystems, USA). The sequencing reactions were run
on an ABI 3100 automated DNA sequencer (Applied Biosystems, USA).
SEQUENCE ALIGNMENT AND PHYLOGENETIC ANALYSIS — Sequence alignment of
partial ITS1-5.8S-ITS2 of B crousii was performed manually using the text editor option
of the software Molecular Evolutionary Genetics Analysis (MEGA) software v4.0.
(Tamura et al. 2007). The manually edited sequences of NFCCI 2213 were deposited
in the NCBI sequence nucleotide database (HQ264189). They were also subjected to a
BLAST search. The partial ITS sequences were aligned using Clustal W together with
the homologous regions of ITS of closely related species of Pilidiella and Schizoparme
Shear. For ITS, the matrix was analyzed with the Maximum Parsimony method using
the Tamura model (Tamura et al. 2007) to calculate the sequence divergence, and
the bootstrap consensus tree inferred from 1000 replicates is taken to represent the
evolutionary history of the taxa analyzed. All positions containing gaps and missing
data were eliminated from the dataset (Complete Deletion option).
Results
DNA pHyYLoGcENy — For the phylogenetic analysis of the genus Pilidiella,
the alignment of 557 bp of the ITS sequence data included 450 positions in the
final data set. The analysis of ITS1-5.8S-ITS2 sequence presented here (Fic.
1) reveals a significant association of Schizoparme and its anamorphic genus
Pilidiella. The phylogenetic analysis based on ITS sequences resulted in four
Pilidiella crousii sp. nov. (India) ... 157
66 ) AY339344.1| Pilidiella quercicola
DQ914688.1| Pilidiella quercicola
AB465200.1| Pilidiella sp. B8-71
AY339348.1| Schizoparme straminea
AY339330.1| Pilidiella diplodiella
AY339331.1| Pilidiella diplodiella
AY339334.1| Pilidiella diplodiopsis
AY339333.1| Pilidiella diplodiopsis
EU301051.1| Pilidiella diplodiella
\_ AY339346.1| Pilidiella sp. STE-U 3828
HQ117851.1| Pilidiella sp. E8514b
FN908875.1| Pilidiella granati
AY339342.1| Pilidiella granati
(eee Pilidiella eucalyptorum
EU301050.1| Pilidiella eucalyptorum
AY339340.1| Pilidiella eucalyptorum
AY339343.1| Pilidiella macrospora
AF265658.1| Cryphonectria cubensis
5?
100
5
Fic. 1. Phylogenetic tree based on aligned internal transcribed spacer sequences of Schizoparme
and its anamorphic species of Pilidiella. The consistency index is (0.660000), the retention index
is (0.821053), and the composite index is 0.674127 for all sites and parsimony-informative sites.
The percentage of replicate trees in which the associated taxa clustered together in the bootstrap
test (1000 replicates) is shown next to the branches. The MP tree was obtained using the Close-
Neighbour-Interchange algorithm with search level 3 in which the initial trees were obtained with
the random addition of sequences (10 replicates). The tree is drawn to scale; with branch lengths
calculated using the average pathway method and are in the units of the number of changes over
the whole sequence.
major clades, P diplodiella (Speg.) Crous & Van Niekerk, P. diplodiopsis Crous
& Van Niekerk, P quercicola (Oudem.) Petr. and S. straminea Shear clustered
together and formed a major group. Pilidiella eucalyptorum Crous & M.J.
Winef. formed a unique clade (100% similarity). P macrospora (71% similarity)
clustered as a unique clade. The new species, P. crousii, clustered with Pilidiella
sp. (HQ 117851.1) (52% similarity), which was sister to PB granati (Sacc.) Aa.
Cryphonectria cubensis (Bruner) Hodges was chosen as outgroup, as it belongs
to the Cryphonectria-Endothelia complex that is allied to the Schizoparme
complex (Castlebury et al. 2002).
158 ... Rajeshkumar & al.
TAXONOMY — Based on a DNA comparison with other species currently
in GenBank (Fic. 1), and its unique morphological characters (Fic. 2), such
as the highly variable conidial shape, size and length-width ratio, the species
of Pilidiella from Terminalia can be distinguished from the other taxa in this
genus, and hence is described as new to science.
Pilidiella crousii Rajeshkumar, S.K. Singh & Hepat, sp. nov. Fic. 2
MycoBank MB 518897
In fructis. Pycnidia globosa vel subglobosa, 124-280 x 115-190um, laeves, pariete
mutltitunico ex 2-4 stratis et textura angulari. Conidiophora 15-25 x 2.5-3 um, simplicia
velramose. Cellulae conidiogenae 6-12 x 2-3um, simplices, laeves. Conidia primo hyalinia,
deinde pallida vel modice brunnea, forma et amplitudine valde variabilibus, laevia,
ellipsoidea vel anguste ellipsoidea, apice acute rotundato vel subobtuso, basi truncata,
(6-)7-12(-13.5) x (2.5-)3-5 um (plus minusve 9.5 x 4.0 um), ratione longitudinis/
latitudinis = 2.2-2.3.
Hototyee: India, Mahabaleshwar, Western Ghats, Maharashtra, on fallen fruits of
Terminalia chebula (Combretaceae) July 2010, K.C. Rajeshkumar (AMH 9406; ex-type
culture NFCCI 2213.)
ETYMOLOGY: ‘crousii? named in honour of Prof. dr. Pedro W. Crous, Director,
Centraalbureau voor Schimmelcultures, Fungal Biodiversity Centre, Utrecht, The
Netherlands, for his scientific contribution to this fungal group.
On fruits, forming pustule-like structures erupting through pericarp, scattered
over fruit surface; conidiomata aggregated in a dark reddish brown mass.
Conidiomata pycnidial, globose to sub-globose, 124-280 x 115-190 um,
smooth; wall of textura angularis, initially hyaline, becoming pale to medium
brown, consisting of 2-4 layers. Conidiophores developing from a basal or
central, hyaline cushion of cells, simple or branched, densely packed, encased
in mucous, 15-25 x 2.5-3 wm. Conidiogenous cells simple, smooth, 6-12 x
2-3um. Conidia initially hyaline, becoming pale to medium brown when
mature, smooth, highly variable in shape and size, straight, occasionally slightly
curved, ellipsoidal to narrowly ellipsoidal, with subobtuse apex and base or
truncate base in a few conidia, but acutely rounded apices also present in
others, bi- to multiguttulate, (6-)7-12(-13.5) x (2.5-)3-5 um (mean 9.5 x 4.0
um), length-width ratio = 2.2-2.3.
TELEOMORPH: Unknown; no sexual state or fungus resembling Schizoparme
was present on any specimen examined.
Colonies on PDA fast growing, 79 mm diam after 7 days and 90 mm diam
after 10 days, white initially, later turning pale brown to dark brown, floccose,
reverse pale to dark brown. Colonies on MEA fast growing, 80 mm diam after
7 days, initially white, brownish when mature, margin irregular, reverse dark
gray-brown. Colonies on PCA fast growing, 60 mm diam after 7 days, pale
brown margin regular, colonies reverse dark brown.
Pilidiella crousii sp. nov. (India) ... 159
>
: &
aw
Fic. 2. Pilidiella crousii (holotype). a. Fallen fruits of Terminalia chebula. b-d. Conidiomata on
fruits. e-h. Pycnidia in culture. i. Conidiophores developing from basal pad of tissue. j. Pycnidial
wall. k-. Variable shaped conidia. Bars: k, | = 10 um.
160 ... Rajeshkumar & al.
Discussion
Petrak & Sydow (1927) established the genus Pilidiella with hyaline to pale
brown conidia, differentiating it from Coniella Hohn., which has dark brown
conidia. Later, von Arx (1957, 1972) also supported the differentiation of these
genera based on their conidial pigmentation. However, Sutton (1980) and Nag
Raj (1993) treated Pilidiella as a synonym of Coniella.
Castlebury et al. (2002) determined that Pilidiella with its teleomorph
Schizoparme formed a distinct lineage within the Diaporthales, representing
a genus separate from Coniella. Later, Van Niekerk et al. (2004) conducted an
extensive study of the group, including a thorough molecular analysis based
on ITS, EF1-a and LSU gene sequence data. Based on all three data sets, they
confirmed the separation of Pilidiella (typified by P. quercicola (Oudem.) Petr.
[=P castaneicola]) from Coniella (typified by C. pulchella Hohn. [= C. fragariae]).
Pilidieila is characterized by having species with hyaline to pale brown conidia
with a length-width ratio >1.5 in contrast to dark brown conidia of Coniella
with length-width ratio <1.5.
Samuelsetal. (1993) linkedseveralspecies of Coniellato speciesof Schizoparme,
which they regarded as a member of Diaporthales (Melanconidaceae).
However, Castlebury et al. (2002) suggested that the Schizoparme-complex is
representative of an undescribed family in the Diaporthales, with Coniella and
Schizoparme-Pilidiella as separate genera. In a further study, Rossman et al.
(2007) established Schizoparmaceae Rossman (type genus: Schizoparme) to
accommodate these genera, with diagnostic characteristics “Ascomata fusca
vel nigra, collapsa, erumpentia, superficialentia. Asci annulo apicali distincto
praediti, ad maturitatem separati, paraphyses nullae. Ascosporae non septatae”.
The pycnidial anamorphs of this family are Coniella and Pilidiella. The type
species of Schizoparme is S. straminea, which is linked to the anamorph Pilidiella
castaneicola (Ellis & Everh.) Arx. In contrast with the Schizoparme teleomorphs
associated with Pilidiella, no teleomorph has thus far been reported for Coniella
(Rossman et al. 2007).
In India, Sharma et al. (1985) studied the genus Coniella from Eucalyptus
plantations in Kerala State. They reported C. castaneicola (Ellis & Everh.)
B, Sutton and C. fragariae (Oudem.) B. Sutton causing a leaf spot disease in
E. grandis and E. tereticornis. Van Niekerk et al. (2004) pointed out that the
isolates from Eucalyptus treated as C. fragariae should be recognized as
P. eucalyptorum. Coniella granati (Sacc.) Petr. & Syd. was reported as a saprobe
on leaf litter of Tectona grandis (Mary & Sankaran 1991; Sankaran 1994).
Rajeshkumar (2007) explored the pathogenic microfungal diversity in natural
forests in the Kerala part of the Western Ghats, and reported four species of
Coniella: C. australiensis Petr. on Macaranga peltata, C. minima B. Sutton &
Thaung on Garcinia gummi-gutta, C. petrakii B. Sutton on Careya arborea and
Syzygium caryophyllatum, and C. fragariae on more than 10 different hosts
plants in natural forests.
Pilidiella crousii sp. nov. (India) ... 161
Coniella spp. have been reported as important foliar pathogens of Terminalia
spp. in India. Conieila terminaliae (Firdousi et al. 1994) was identified as a new
species causing necrotic spots on Terminalia tomentosa (IMI 823384) from
the forests of Gopalpura (Sagar), Madhya Pradesh. This species is close to
C. fragariae in shape and colour of its pycnidia and conidia, but its conidia are
smaller (2—8 x 3—5 pm) and globose to subglobose in shape. Rajeshkumar
(2007) also recorded foliar diseases caused by Coniella fragariae on Terminalia
chebula and T. paniculata in natural forests of Kerala. Coniella macrospora (van
der Aa 1983) is the only species under this genus so far recorded on Terminalia
ivorensis from the Ivory Coast, but its conidia are much larger, (18.3-)25-29
(-32.5) x (13-)16-20(-21.5) um.
In the present study, Pilidiella crousii is proposed as a new species based
on the ITS sequence analysis (Fig. 1) and highly variable shape and size of its
conidia (Fic. 2). The morphological characteristics of P granati differ from
those of the new species. In P granati the conidia are ellipsoidal, 9-16 tm
long, and length- width ratio is 1.9. In PB crousii, the conidia are ellipsoidal
or narrowly ellipsoidal, (6-)7-12(-13.5) um long, with a length -width ratio
of 2.2-2.3. The conidial length-width ratio of P crousii is close to that of P.
diplodieila, but the conidia in P. diplodiella are longer. Also the ITS sequence
analysis clearly differentiates these two species.
Appendix
In their treatment of Pilidiella and Coniella, Van Niekerk et al. (2004)
referred to Coniella macrospora as “Pilidiella macrospora”, but did not make a
valid combination. This combination is proposed here:
Pilidiella macrospora (Aa) Crous & Van Niekerk, comb. nov.
MycoBank MB 517391
BasionymM: Coniella macrospora Aa, Proc. Kon. Ned. Akad. Wetensch., C 86: 121. 1983.
Acknowledgements
We are indebted to Amy Y. Rossman, Systematic Mycology & Microbiology Lab.,
USDA, ARS, Beltsville, U.S.A., and Uwe Braun, Martin-Luther-University, Institute of
Biology, Department of Geobotany and Botanical Garden, Herbarium, Halle (Saale),
Germany, for reviewing this manuscript. Thanks are also due to Department of Science
and Technology (DST), Government of India, New Delhi for providing financial support
under IRHPA programme for setting up the state-of the-art National Facility for Culture
Collection of Fungi (No. SP/SO/PS-55/2005) at MACS’Agharkar Research Institute,
Pune, India and the Director, MACS’ARI for providing facility.
Literature cited
Aa HA van der. 1983. A new species of Coniella. Proceedings of the Koninklijke Nederlandse
Akademie van Wetenschappen, C 86: 121-125.
Arx JA von. 1957. Revision der zu Gloeosporium gestellten Pilze. Verhandelingen der Koninklijke
Nederlandse Akademie van Wetenschappen, Afd. Natuurkunde, 2de Reeks, 51(3). 153 p.
162 ... Rajeshkumar & al.
Arx JA von. 1972. Centraalbureau voor Schimmelcultures, Baarn and Delft, progress report
1971. Verhandelingen der Koninklijke Nederlandse Akademie van Wetenschappen, Afd.
Natuurkunde, 2de Reeks, 61(3): 50-69.
Castlebury LA, Rossman AY, Jaklitsch WJ, Vasilyeva LN. 2002. A preliminary overview of the
Diaporthales based on large subunit nuclear ribosomal DNA sequences. Mycologia 94:
1017-1031. doi:10.2307/3761867
Crous PW, Verkley GJM, Groenewald JZ, Samson RA (eds). 2009. Fungal biodiversity. CBS
Laboratory Manual Series. Centraalbureau voor Schimmelcultures, Utrecht, Netherlands.
Firdousi SA, Sharma CD, Vyas KM. 1994. A new species of Coniella from India. Acta Botanica
Indica 22: 134-135.
Mary MV, Sankaran KV. 1991. Ex-situ decomposition of leaf litters of Tectona grandis, Eucalyptus
tereticornis and Albizia falcataria. Kerala Forest Research Institute Research Report No. 71.
Kerala Forest Research Institute, Peechi, Thrissur, Kerala.
Nag Raj TD. 1993. Coelomycetous anamorphs with appendage-bearing conidia. Waterloo, Ontario:
Mycologue Publications. 1101 p.
Petrak F, Sydow H. 1927. Die Gattungen der Pyrenomyzeten, Sphaeropsideen und Melanconieen. 1.
Teil: Die phaeosporen Sphaeropsideen und die Gattung Macrophoma. Repertorium Specierum
Novarum Regni Vegetabilis 42. 551 p.
Rajeshkumar KC, Singh PN, Yadav LS, Swami VS, Singh SK. 2010. Chaetospermum setosum sp. nov.
from the Western Ghats, India. Mycotaxon 113: 397-404.
Rajeshkumar KC. 2007. Diversity of plant pathogenic fungi in natural forests in the Western Ghats,
India. Ph.D thesis, FRI University, Dehradun, India. 201 p.
Rossman AY, Farr DE, Castlebury LA. 2007. A review of the phylogeny and biology of the
Diaporthales. Mycoscience 48: 135-144. doi:10.1007/s10267-007-0347-7
Samuels GJ, Barr ME, Lowen R. 1993. Revision of Schizoparme (Diaporthales, Melanconidaceae).
Mycotaxon 46: 459-483.
Sankaran, KV. 1994. Fungi associated with the decomposition of teak and Albizia leaf litter in
Kerala. Indian Forester 120(5): 446-454.
Sharma JK, Mohanan C, Florence EJM. 1985. Disease survey in nurseries and plantations of forest
tree species grown in Kerala. Kerala Forest Research Institute Research Report No. 36. Kerala
Forest Research Institute, Peechi, Thrissur, Kerala. 320 p.
Singh SK, Singh PN, Yadav LS, Hepat RP. 2009. A new species of Gonatophragmium from Western
Ghats, India. Mycotaxon 110: 183-187.
Sutton BC. 1980. The Coelomycetes: fungi imperfecti with pycnidia, acervuli, and stromata. Kew,
Surrey, UK: Commonwealth Mycological Institute. 696 pp.
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis
(MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599. doi:10.1093/
molbev/msm092
Van Niekerk JM, Groenewald JZ, Verkley GJM, Fourie PH, Wingfield MJ, Crous PW. 2004.
Systematic reappraisal of Coniella and Pilidiella, with specific reference to species occurring
on Eucalyptus and Vitis in South Africa. Mycological Research 108: 283-303. doi:10.1017/
$0953756204009268
White TJ, Bruns T, Lee J, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds)
PCR protocols: a guide to methods and applications. Academic, San Diego.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 163-169 January-March 2011
DOT: 10.5248/115.163
Calocera bambusicola sp. nov. and C. sinensis
newly recorded from Taiwan
SHENG-Hua Wv%, KELLY SHIH & SHIH-Y1I Yu
Department of Botany, National Museum of Natural Science,
Taichung, Taiwan 404, ROC
CORRESPOND TO *:
[email protected]
ApstTract — Calocera bambusicola is presented as a new species, based on specimens
collected from rotten culms of bamboo (Pseudosasa usawai) near a sulfur hot spring on
Yangminshan mountain in Yangminshan National Park, Taipei, Taiwan. This new species
morphologically resembles C. sinensis but differs in its much smaller basidiocarps, narrower
basidiospores, much narrower contextual hyphae, and growth on bamboo culms. ITS
differences also separate these two species. A key to species of Calocera with nodose-septate
hyphae is provided, and C. sinensis is newly reported from Taiwan.
Key worps — Dacrymycetaceae, Dacrymycetales, taxonomy
Introduction
The genus Calocera (Fr.) Fr. (Dacrymycetaceae J. Schrot., Dacrymycetales
Henn.) is ecologically saprobic, causing a brown rot in wood. McNabb (1965)
treated twelve species and infraspecific varieties in his worldwide monograph
of Calocera, among which only four species possess clamped hyphae. Reid
(1974), who treated five Calocera species in his monographic survey of British
Dacrymycetales, included a new species, C. pallidospathulata D.A. Reid. Peng et
al. (1992) recognized six species of Calocera from China, including the newly
described species C. mangshanensis B. Liu & L. Fan (Liu & Fan 1989) and
C. morchelloides B. Liu & L. Fan (Liu & Fan 1990). The three species published
after McNabb’s (1965) monographic work all have simple-septate hyphae.
Previous taxonomic study of Calocera was based on morphological analyses.
DNA sequence analyses have never been used to test species delimitations. So
far, only Calocera cornea (Batsch) Fr. and C. viscosa (Pers.) Fr. sequences have
been submitted to the GenBank database (Shirouzu et al. 2009).
In 1999-2001, several specimens of Calocera were collected from rotten culms
of the bamboo species Pseudosasa usawai near a sulfur spring on Yangminshan
164 ... Wu, Shih & Yu
mountain in Taipei, Taiwan. Basidiocarps of these Calocera specimens are
very small and bear nodose-septate hyphae. Morphological and ITS sequence
analyses reveal that these specimens represented an undescribed species,
C. bambusicola, which is described here. Calocera sinensis, which resembles the
new species, is here reported for the first time from Taiwan.
Materials & methods
MorpuHo.tocy — Specimens for this study were collected in Taiwan during 1992-
2007 and are deposited at the herbarium of the National Museum of Natural Science of
ROC (TNM). For microscopic observations, the sections were stained with 1 % aqueous
Phloxine in 5 % KOH. Melzer’s reagent (IKI) was employed to detect amyloidity and
dextrin oidity.
PHYLOGENY — DNA was extracted from dried fruiting body tissue or cultured
mycelia as described in Wu et al. (2007) from eight strains representing six species
(TaBLE 1). Both DNA strands were sequenced by ITS1 and ITS4 primers (White et al.
1990). Consensus data from the forward and reverse sequences were matched using
BioEdit 7.0.4.1 (Hall 1999). Alignment was performed using Clustal X 1.83 (Thompson
et al. 1997) and adjusted by hand also using BioEdit 7.0.4.1. The optimized alignment
file was analyzed by maximum parsimony (MP) in PAUP 4.0b10 (Swofford 2003). The
analytical parameter preferences are described in Wu et al. (2007). Bootstrap analysis
(Hillis & Bull 1993) was performed with 1,000 replicates with random addition
sequences to obtain estimates of the reliability of the nodes.
TABLE 1. Taxa used in this study, along with their strain/specimen numbers,
origins and GenBank accession numbers.
SPECIES* : STRAIN/SPECIMEN NO. : ORIGIN ! GENBANK ACCESSION NO.
Calocera bambusicola Wa 9910-12 Taipei, Taiwan i FJ195751
C. cornea Wa 0606-1 Taichung, Taiwan : FJ195752
C. sinensis ?Wu 0703-6 Nantou, Taiwan ?FJ195754
C. sinensis Wu 0505-3 'Nantou, Taiwan Wu 0505-3
C. sinensis :JCH 070726 :Chiayi, Taiwan iFJ195755
C. viscosa ?Wu 9905-30 : Taichung, Taiwan ?FJ195756
Dacrymyces sp. ?FPL8953 ‘USA DQ205684
Guepiniopsis buccina : AFTOL-ID 888 Washington, USA :DQ206986
Taxon names in bold indicate sequences from this study.
Taxonomy
Key to five species of Calocera with nodose-septate hyphae
1a. Basidiospores 1=septate ces scoce-wsscee soon aged deere matmie ieonanudlin dipie sont nh Sweeping Hees 2
1b. Basidiospores 1-3-septate. 0.0... cece nent tenn ee eens 4
2a. Basidiocarps tiny, shorter than 1.5 mm; contextual hyphae 1.5-3.3 um diam.;
basidiospores mostly narrower than 4.3 um...............0000% C. bambusicola
2b. Basidiocarps 3-25 mm high; contextual hyphae 3-7.5 um diam.;
basidiospores wider than 4.3 Um 0.0.0... eee eee cnet nee een eee 3
Calocera bambusicola sp. nov. (Taiwan) ... 165
3a. Basidiocarps large, up to 25 mm high; clamped dikaryophyses lacking
eis eee eva so4 ely bg ak guia sched pel ale GRE baat Gad coh el C. fusca Lloyd
3b. Basidiocarps smaller, rarely exceeding 10 mm high; clamped dikaryophyses
PAEESENE I Lie, he a ete pehcer yl aiate ceive hegeranaMegelneyt slate ght dhgty ie ale IG ce Laven ssa C. sinensis
4a. Basidiocarps cylindrical, spathulate, petaloid, or palmately lobed;
basidiospores 11-15.5 um long.................000.0 08 C. guepinioides Berk.
4b. Basidiocarps subulate or fusiform; basidiospores 13.5-17.5 um
LOTT Caper oat torah nl kets es, ath Manley dbetl aes etetns Shetanh ee C. macrospora Brasf.
Fic. 1. Basidiocarps of Calocera bambusicola (Wu 9910-10). (scale bar = 1 cm).
Calocera bambusicola Sheng H. Wu, sp. nov. Fic. 1,2 a-c
MycoBank MB 516557
Basidiocarpi gregarii, aurantiaci, simplices, clavati vel cylindrici, 0.1-0.3 mm diametro,
ad 1.5 mm alti. Hyphae fibulatae. Cystidia desunt. Probasidia subclavata, 20-35 x 4-5
um, deinde bifurcate. Basidiosporae ellipsoidea, 9-12 x 3.3-4.5 um, 1-septatae, laeves,
tenuitunicatae.
>
HoLotypPe — Taiwan. Taipei City: Yangminshan National Park, Hsiaoyukeng, 25° 11
N 121°33°E, alt. 700 m, on culm of Pseudosasa usawai, leg. S.H. Wu et al., Oct. 23, 1999,
Wu 9910-10 (TNM F9942).
EryMoLocy — referring to the habitat of this species.
Basidiocarps gregarious, yellow-orange when fresh, orange-brown when dry,
gelatinous-cartilaginous when soaked, corneous when dry, simple, clavate or
cylindrical, terete or slightly flattened, unbranched, apically blunt, 0.1-0.3 mm
diam., up to 1.5 mm high. Hymenium amphigenous, surface smooth. Context
with dense texture; hyphae nodose-septate, colorless, 1.5-3.3 um diam., walls
thin or up to 0.5 um diam. Cystidia lacking. Probasidia subclavate, 20-35 x
4-5 um, becoming bifurcate. Basidiospores ellipsoid, adaxially concave, slightly
166 ... Wu, Shih & Yu
curved, colorless, 9-12 x 3.3-4.5 um, smooth, thin-walled, with one septum
when mature, bearing a distinct apiculus, IKI-, germination not seen.
EcoLocy & DisTRIBUTION — All specimens of Calocera bambusicola were
collected from culms of Pseudosasa usawai, beside a sulfur spring; so far known
only from northern Taiwan.
ADDITIONAL SPECIMENS EXAMINED — Taiwan. Taipei City: Yangminshan National
Park, Hsiaoyukeng, 25° 11’ N 121°33’E, alt. 700 m, on culm of Pseudosasa usawai, leg.
S.H. Wu et al., Oct. 23, 1999, Wu 9910-12 (INM F9943); Dec. 30, 1999, Wu 9912-19
(TNM F10187), Wu 9912-20 (TNM F10188), Wu 9912-24 (TNM F10189); Oct. 30,
2000, Wu 0010-205 (TNM F12263); Jun. 15, 2001, Wu 0106-18 (TNM F13446), Wu
0106-19 (TNM F 13447), Wu 0106-24 (TNM F13449).
Remarks — Calocera bambusicola is distinct from other species of this genus
in having very tiny basidiocarps and by growing on culms of bamboo. This
new species resembles C. sinensis in having clamped hyphae and similar
basidiospores, but differs in having much smaller basidiocarps, narrower
basidiospores, and much narrower contextual hyphae.
Calocera sinensis McNabb, New Zealand J. Bot. 3: 36. 1965. Fic. 2 D-G
Basidiocarps gregarious, yellow to orange when fresh, orange-brown when dry,
gelatinous-cartilaginous when soaked, corneous when dry, simple, cylindrical-
clavate or spathulate, rarely branched, apically blunt or rarely pointed,
0.5-1.5 mm diam., up to 8mm high. Hymenium amphigenous, surface smooth.
Context with dense texture; hyphae nodose-septate, colorless, 3-7 um diam.,
with 0.5-2 um thick walls. Cystidia lacking. Hyphidia simple or branched.
Probasidia subclavate, 25-40 x 3-4 um, becoming bifurcate. Basidiospores
ellipsoid, adaxially concave, slightly curved, colorless, 9-13 x 4.3-5.5 um,
smooth, thin-walled, with one septum when mature, bearing a distinct apiculus,
IKI-, germination by conidia or by germ tubes.
EcoLocy & DisTRIBUTION — This species grows on both gymnosperms
and angiosperms in Taiwan, and causes a wood brown rot. Known from China
(McNabb 1965, Peng et al. 1992) and Taiwan (this study).
SPECIMENS EXAMINED — Taiwan. Taoyuan Hsien: Takuanshan, alt. 1,500 m, on log, leg.
S.H. Wu & S.W. Chou, 20 Jul 1999, Wu 9907-7 (TNM F9939). MIAOLI HSIEN: Kuanwu-
Hsuehchien, Peikenghsi Abandoned Trail, 24° 27’ N 121°03’ E, alt. 1800 m, on wood, leg.
WN. Chou, 9 Oct 1995, CWN 01311 (TNM F4397). Taichung Hsien: Anmashan, 24° 16’
N 120°00’ E, alt. 2,250 m, on trunk of gymnosperm, leg. SH. Wu & H.J. Chan, 8 Nov
1997, Wu 9711-30 (TNM F9382); on rotten trunk of angiosperm, leg. S.H. Wu et al., 10
May 1999, Wu 9905-25 (TNM F9937); Tashueishan Forest Road, alt. 1200 m, leg. S.Z.
Chen, 31 May 1999, Chen 865 (TNM F9919). Nantou Hsien: Hsitou, 23° 40’ N 120°47’
E, alt. 1200 m, on stump of Cryptomeria japonica, leg. S.H. Wu, 19 Jun 1993, Wu 9306-11
(TNM F1054), Wu 9306-12 (TNM F1050); on stump of Cryptomeria japonica, leg. S.H.
Wu, 27 Jul 1993, Wu 9307-78 (TNM F1243); on trunk of Cryptomeria japonica, leg. S.H.
Wu, 6 Apr 1997, Wu 9704-19 (INM F8604); on rotten wood of gymnosperm, leg. S.H.
Calocera bambusicola sp. nov. (Taiwan) ... 167
Fic. 2. Calocera bambusicola (Wu 9910-10: A-C); C. sinensis (Chen 865: D-G). Contextual
hyphae (A, D); hyphidia (E); basidia (B, F); basidiospores (C, G). (scale bars = 10 um).
Wu, 3 May 2005, Wu 0505-3 (TNM F18731); on branch of gymnosperm, leg. S.H. Wu
& S.Z. Chen, 6 Jul 2007, Wu 0703-6 (TNM F20958); Sunlinhsi, 23° 38’ N 120°47’ E, alt.
1700 m, on fallen branch of Cryptomeria japonica, leg. S.H. Wu, 1 Jul 1992, Wu 9207-42
(TNM F0272); 19 Sep 1992, Wu 9209-88 (TNM F0361); Yushan National Park, Tatachia,
23° 29° N 120°54’ E, alt. 2600 m, on decorticated branch of angiosperm, leg. S.H. Wu, 25
Nov 1993, Wu 9311-106 (TNM F1520). Ilan Hsien: Chilanshan, 24° 41’ N 121°28’ E, alt.
400 m, on wood of angiosperm, leg. S.H. Wu, 18 Nov 1992, Wu 9211-17 (INM F0486).
REMARKS — Calocera sinensis has only been reported from China (McNabb
1965, Peng et al. 1992). In Taiwan, this species was collected from temperate
to subtropical belts and is fairly common. Calocera fusca is allied to C. sinensis,
but differs from the latter in having larger basidiocarps and lacks clamped
dikaryophyses. Calocera fusca was reported from New Zealand, Australia, and
Juan Fernandez Islands (McNabb 1965), and China (Peng et al. 1992). However,
further study should be performed to evaluate the importance of the features
used for separating these two species.
Results and discussion on analysis of the ITS region
Amplification of the ITS region yielded PCR products approximately 530 bp
long. The final alignment of the 8 sequences included 533 positions. Excluding
the ambiguous sites at both ends, 452 sites were used for the MP analysis. Only
168 ... Wu, Shih & Yu
Calocera sinensis
Calocera sinensis Wu 0703-6
51
Calocera sinensis Wu 0505-
Calocera bambusicola Wu 9910-
Calocera viscosa Wu 9905-
Calocera cornea Wu 0606-
Dacrym yces sp.
Guepiniopsis buccina DQ206986
Fic. 3. The most parsimonious tree derived from ITS DNA sequence data. Bootstrap values
are shown at nodes supported by no less than 50% from 1000 replicates. TL = 293, CI = 0.846,
RI = 0.724.
one most parsimonious tree (293 steps, CI = 0.846, RI = 0.724) was retained
in this analysis. Of the 452 included sites, 264 were constant, 96 were variable
but parsimoniously uninformative, and 92 were parsimoniously informative.
Bootstrap percentages were assigned above the branches. Three strains of
C. sinensis were clustered together with 100% bootstrap support, and they were
further clustered together with C. bambusicola, supported by a 51% bootstrap
value (Fic 3).
Calocera bambusicola sp. nov. (Taiwan) ... 169
The phylogenetic analysis indicates that the two species with clamp
connections (C. bambusicola, C. sinensis) are more closely allied to each other
than to two other species without clamp connections (C. cornea, C. viscosa).
The three studied C. sinensis strains are identical in the alignment matrix of
the 452 sites, after excluding the ambiguous sites at both ends. However, there
were 32 transition, 49 transversion, and 29 deletions between C. bambusicola
and C. sinensis, showing a 23.34% difference between the two species. Our
ITS sequence analysis strongly supports C. bambusicola as independent from
C. sinensis.
Acknowledgements
The author is indebted to Dr. Nils Hallenberg and Dr. Peter Roberts for reviewing
this paper, also to Ms. S.Z. Chen and Mr. WN. Chou for contributing some collections
for this study. This study was supported by the National Science Council of ROC
(No. NSC 97-2621-B-178-001) and National Agriculture Council of ROC (No. 97AS-
11.1.2-FB-e2).
Literature cited
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41: 95-98.
Hillis DM, Bull JJ. 1993. An empirical test of bootstrapping as a method for assessing confidence in
phylogenetic analysis. Syst. Bio. 42: 182-192.
Liu B, Fan L. 1989. Two new species of Dacrymycetaceae from China. Acta Mycol. Sin. 8: 22-24.
Liu B, Fan L. 1990. New species and new variety of Dacrymycetaceae in China. Acta Mycol. Sin.
9: 12-19.
McNabb RER.1965. Taxonomic studies in the Dacrymycetaceae II. Calocera (Fries) Fries. New
Zealand J. Bot. 3: 31-58.
Peng, YB, Liu B, Li F. 1992. Flora Fungorum Sinicorum vol. 2. Tremellales et Dacrymycetales.
Science Press, Beijing, 151 pp. + 2 pls.
Reid DA. 1974. A monograph of the British Dacrymycetales. Trans. Brit. Mycol. Soc. 62: 433-494.
doi: 10.1016/S0007-1536(74)80060-4
Shirouzu T, Hirose D, Tokumasu S. 2009. Taxonomic study of the Japanese Dacrymycetes. Persoonia
23: 16-34. doi:10.3767/003 158509X468443
Swofford DL. 2003. PAUP* - Phylogenetic Analysis Using Parsimony (*and Other Methods).
Version 4. Sinauer Associates, Massachusetts.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTAL X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucl. Acids Res. 25: 4876-4882.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. In Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds), PCR
Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, pp.
315-322.
Wu SH, Wang DM, Tschen E. 2007. Brunneocorticium pyriforme, a new corticioid fungal
genus and species belonging to the euagarics clade. Mycologia 99: 302-309. doi:10.3852/
mycologia.99.2.302
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 171-173 January-March 2011
DOT: 10.5248/115.171
Stachybotrys subreniformis, new from soil in China
Q1-Ru1 Li & Yu-LAN JIANG*
Department of Plant Pathology, Guizhou University, Guiyang, Guizhou, 550025, China
*CORRESPONDENCE TO:
[email protected]
AssTRACT — A new species of Stachybotrys from soil in China, S. subreniformis, is illustrated
and described. It differs from similar species mainly by producing smaller conidia and
shorter conidiophores. The type specimen (dried culture) and living culture are deposited in
the Plant Pathology Herbarium of Guizhou University (HGUP).
Key worps — soil fungi, taxonomy, dematiaceous hyphomycetes
Introduction
During an investigation of soil dematiaceous hyphomycetes in Guizhou
Province, Southwestern China in 2009, one isolate possessing the typical
characters of Stachybotrys Corda was obtained from forest soil and found to
differ from described species of Stachybotrys in conidial and conidiophore
morphology. The new taxon is illustrated and described below.
Materials & methods
Fifteen soil samples were collected from Duyun, Guizhou Province. The methods of
sample collection, isolation and identification of fungi, and preparation of dried cultures
were as previously reported by Jiang & Zhang (2007). Conidia and conidiophores
were placed in a drop of 85% lactic acid and examined and photographed using light
microscopy. Thirty mature conidia and phialides were measured by using a UB200i
microscope (Chongqing UOP Photoelectric Technology Co., China) at 1000x
magnification. The fungi are described from cultures grown at 25°C on corn meal agar
(CMA).
Taxonomy
Stachybotrys subreniformis Q.R. Li & Y.L. Jiang, sp. nov. FIG. 1 A-B
MycoBank MB 519085
Coloniae effusae, densae, pilosae, griseae vel nigrae. Mycelium superficiale vel immersum.
Hyphae hyalinae, ramosae, septatae, laeves, 5-7 um crassae. Conidiophora macronemata,
mononemata, erecta vel flexuosa, ramosa, septatae, hyalinae vel artobrunnea, 48-98 x
172 ... Li & Jiang
- eon = _
Fic. 1a—B. Conidia and conidiophores of Stachybotrys subreniformis. (Bars = 20 um)
5.0-7.5 um. Phialides brunnea, obovatae, laeves, 8.0-11.5 x 4.5-6.0 um. Conidia sphaerica
vel reniformia, aseptata, atrobrunnea, verruculosa, 6.0-9.5 x 4.5-7.5 um.
Ho.orype: CHINA. GuizHou Province, Duyun, from forest soil, 15 December 2009,
QR. Li, HGUP,,1051.
EryMOLoGy: in reference to the slightly reniform shape of many of the conidia.
CoLontgs on CMA effuse, dense, hairy, grey to black, colourless at first, then
becoming dark with production of abundant anamorphic structures. MYCELIUM
superficial and immersed: hyphae hyaline, branched, septate, smooth, 5-7 um
wide. CONIDIOPHORES macronematous, mononematous, erect or flexuous,
branched, septate, hyaline to dark brown, 48-98 x 5.0-7.5 um, tapering toward
the apex which bears terminal phialides in a whorl of 2-7 around a central
phialide. PHIALIDEs brown, obovate, smooth, 8.0-11.5 x 4.5-6.0 (av. 9.3 40.9 x
5.3 + 0.4, n= 30) um, with conspicuous collarettes. ConIpIA aggregated in slimy
masses, spherical or slightly reniform, nonseptate, dark brown, verruculose,
6.0-9.5 x 4.5-7.5 (av. 7.6 + 1.0 x 6.1 + 0.8, n = 30) um.
In the key to Stachybotrys species (Pinruan et al. 2004), seven species
produced reniform conidia. They are S. nephrodes McKenzie (McKenzie 1991),
S. sinuatophora Matsush. (Matsushima 1971), S. reniverrucosa Whitton et al.
(Whitton et al. 2001), S. nephrospora Hansf. (Hansford 1943), S. reniformis
Tubaki (Tubaki 1963) and S. renisporoides K.G. Karand. et al. (Karandikar et
al. 1992) and S. oenanthes M.B. Ellis (Ellis 1971). However, only S. oenanthes
produces ovoid to reniform conidia, which is very close to S. subreniformis.
Conidia of S. subreniformis (6.0-9.5 x 4.5-7.5 tym) are smaller than those of
S. oenanthes (9-12 x 4.5-8 um). In addition, the conidiophores of S. subreniformis
(48-98 wm) are shorter than those of S. oenanthes (up to 190 um).
Acknowledgments
The authors are grateful for pre-submission comments and suggestions provided by
Dr. E.H.C. McKenzie, Dr D.W. Li, and Prof. Y.L. Guo. This project was supported by the
National Science Foundation of China (no. 31060005).
Stachybotrys subreniformis sp. nov. (China) ... 173
Literature cited
Ellis MB. 1971. Dematiaceous hyphomycetes. X. Mycological Papers 125: 1-30.
Hansford CG. 1943. Contributions towards the fungus flora of Uganda. V. Fungi imperfecti.
Proceedings of the Linnean Society of London 155: 34-67. doi: 10.1111/j.1095-8312.1943.
tb00340.x
Jiang YL, Zhang TY. 2007. Notes on soil dematiaceous hyphomycetes from Shennongjia
Natural Conservation Area, Hubei Province I. Mycosystema 26(1): 17-21. doi: CNKI:SUN:
JWXT.0.2007-01-004
Karandikar KG, Kulkarni SM, Patwardhan PG. 1992. Some new and interesting hyphomycetes
from India. Biovigyanam 18(2): 78-81.
Matsushima T. 1971. Mycological reports from New Guinea and the Solomon Islands. 7. Some
interesting fungi imperfecti. Bulletin of the National Science Museum, Tokyo, 14: 460-480.
McKenzie EHC. 1991. Dematiaceous hyphomycetes on Freycinetia (Pandanaceae). 1. Stachybotrys.
Mycotaxon 41: 179-188.
Pinruan U, McKenzie EHC, Jones EBG, Hyde KD. 2004. Two new species of Stachybotrys, and a key
to the genus. Fungal Diversity 17: 145-157.
Tubaki K. 1963. Notes on the Japanese hyphomycetes. I. Chloridium, Clonostachys, Ishmospora,
Pseudobotrytis, Stachybotrys and Stephanoma. Transactions of the Mycological Society of Japan
A: 83-90.
Whitton SR, McKenzie EHC, Hyde KD. 2001. Microfungi on the Pandanaceae: Stachybotrys, with
three new species. New Zealand Journal of Botany 39: 489-499. doi: 10.1080/0028825X.2001
-9512752
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 175-181 January-March 2011
DOT: 10.5248/115.175
New species Koorchaloma and Ciliochorella
from xeric forests in Argentina
NATALIA ALLEGRUCCI*, LORENA ELIADES, MARTA CABELLO
& ANGELICA ARAMBARRI
Instituto de Botanica Spegazzini, Facultad de Ciencias Naturales y Museo,
Universidad Nacional de La Plata, 53 # 477, La Plata (1900),
Provincia de Buenos Aires, Argentina
* CORRESPONDENCE TO:
[email protected]
AssTRACT— Two new species, Koorchaloma scutiae and Ciliochorella buxifoliae, isolated
from leaf litter of Scutia buxifolia forest are described, illustrated, discussed, and compared
with similar species. The specimens were collected in Magdalena, Buenos Aires province,
Argentina. The type specimens are deposited in LPS. Keys are provided to all species of both
genera.
Key worps— anamorphic fungi, taxonomy
Introduction
Xeric forests dominated by Scutia buxifolia Reissek (Rhamnaceae) and Celtis
tala Gillies ex Planch. (Ulmaceae) represent the most important woodland
community (“La Pampa”) in the eastern plains of Buenos Aires Province,
Argentina (South America). They range from the banks of the Parana River to
the suburbs of Mar Chiquita town. The District of Magdalena has one of the
most well preserved native forest areas, with an environmental heterogeneity
that determines the variability in vegetation composition. Wooded ranges
run parallel to the La Plata River, where the forest grows on highly calcareous
substrates derived from Quaternary sea transgressions and regressions (Sanchez
et al. 1976).
Several works have examined the fungal communities on decaying leaf litter
of Scutia buxifolia and Celtis tala (Allegrucci et al. 2004, 2005, 2007; Crous
et al. 2005). Yanna et al. (2001) noted that fungal species composition varies
according to the different hosts and sites, which is particularly evident in the
xeric forests of the Buenos Aires province (Allegrucci et al. 2009). This paper
176 ... Allegrucci & al.
describes two new species, Koorchaloma scutiae and Ciliochorella buxifoliae,
recently recovered from S. buxifolia leaf litter during biodiversity surveys of
this region.
Materials & methods
STUDY sITE— The study area lies in the Magdalena District, 20 km southeast of
Magdalena town (35°11’S, 57°17°W) in the province of Buenos Aires, Argentina in
a forested area dominated by Scutia buxifolia (“coronillo”) and Celtis tala (“tala”) and
covering marine shell deposits that form parallel ridges along the coastline. See Arturi
et al. (1997) for details on climate and forest ecology.
SAMPLE COLLECTION— Samples of leaf litter were collected from the forest, placed
in zip-lock bags for transport to the laboratory, and stored in a refrigerator at 4°C until
processed. Plant material was incubated at 25°C in Petri dish moist chambers (Eliades et
al. 2007). Samples were examined over four weeks. Fungal species were examined with
a Wild MB stereo microscope and a Dialux 20 Leitz microscope.
SCANNING ELECTRON Microscopy— For the determination of fungal species in
their natural substrate (leaf litter), material remained in formaldehyde at 1% for 4 hours
and then postfixed with 2% formaldehyde for 12 hours. The fixative was removed by
means of three consecutive washes with distilled water for subsequent dehydration.
The fixing of the cultured material was modified with respect to time: a fixation was
carried out in 1% formaldehyde for 3 hours and post-fixation in 2% formaldehyde for
4 hours. All the samples were then dehydrated in graded series of 30%, 50%, 70% and
100% ethanol (45 min in each concentration), the ethanol was replaced by liquid CO,
and the samples dried by Critical Point (Blazers equipment, CP-30). All the samples
were mounted onto double-sided carbon tape and gold plated in a Joel Fine Ion Sputter,
JCF 100. Observations and photomicrographs were obtained with a Scanning Electron
Microscope, JMS-T 100, and with a JEOL Model 6340 LV Scanning Electron Microscope
belonging to the Service of Electron Microscopy of the Museum of Natural Sciences of
La Plata, Buenos Aires.
Taxonomy
Koorchaloma scutiae Alleg., Fliades & Aramb., sp. nov. PLaTE 1
MycoBank MB518290
Foliicola conidiomata stromatica, dispersa, alba vel flavida gelatinosa usque 40-60
um diam. Stroma basale parva ex cellulis isodiametricibus, atrobrunneis vel brunneis
compositae. Setae penitus conidiomatis intersparsae, sterile, solitariae, non-ramosae,
erectae, rectae, laeves, crassitunicatae, septate, brunneae, ad epicem pallidorae 170-
400 um longae, 10-15 um latae ad basem, 3-5 um latem ad apicem. Conidiophora
macronematosa, erecta, ramosa, tenuitunicata, laevia, hyalina. Cellulae conidiogenae
discretae, monoblasticae, terminales, subcylindricae, cum collario, laeves hyalinae 10-15
x 2-2.7 um. Conidia 18-20 x 1.8-2 um fusiformia ad apice rotundata ad basim truncata,
laevia hyalina utrique appendices mucosas ferentia, in masso gregaria.
Typus: Argentina, Buenos Aires, Magdalena, in foliis mortuis Scutia buxifolia, Cazau
48245 (LPS, holotypus), May 2004
EryMo.oey: referring to substrate genus, Scutia.
Koorchaloma and Ciliochorella spp. nov. (Argentina) ... 177
Fe : a = ry
PLATE 1. Koorchaloma scutiae. A. Conidiomata on natural substrate. B. Detail of
conidiomata. C. Conidiophores, conidiogenous cells, conidia and setae. D. Conidium.
Folicolous conidiomata stromatic, scattered, pulvinate, gelatinous, white to
creamy, rounded or irregular in outline, setose, 40-60 um diam. Basal stroma
thin of textura angularis with 4-5 layers of thick walled cells, dark brown. No
margin was observed. Conidiomatal setae marginal and frequently interspersed,
through the basal stroma straight, smooth walls, subcylindrical, unbranched,
multiseptate, thick walled dark brown at the base, pale brown in the apex,
170-400 um at the terminal cell which has telescopic growing. Conidiophores
arising from the upper layer of cells of the basal stroma, irregularly branched,
septate, hyaline, invested in mucus.
Conidiogenous cells discrete, monoblastic, subcylindrical with flaring
collarettes, colourless, smooth 10-15 x 2-27 um. Conidia 18-20 x 1.8-2 um
fusiform to slightly sigmoid with rounded base and truncated apex, mucoid
appendage bearing in both extremes, funnel shape, mean conidium length/
width 10:1.
COMMENTS: Koorchaloma Subram. was proposed by Subramanian (1953) for
the type species, K. madreeya Subram., collected on dead, rotting culms of
Oryza sativa in India. The genus is characterized by sporodochial to acervular
setose conidiomata (with setae either marginal or interposed through the basal
stroma), holoblastic conidiogenesis, and unicellular, colourless, and fusiform
conidia that bear mucoid appendages either only apically or at both ends
(Nag Raj 1984, 1993). Nag Raj (1993) recognized five species: K. madreeya,
K. bambusae Nag Raj, K. jamaicensis Nag Raj, K. occidentalis Nag Raj (Nag Raj,
178 ... Allegrucci & al.
1984), and K. okamurae I. Hino & Katum. (Hino 1961). Since this publication,
five more species have been described — K. novojournalis Yanna et al. (Yanna
et al. 1998), K. galateae Kohlm. & Volkm.-Kohlm. (Kohlmeyer & Volkmann-
Kohlmeyer 2001), K. spartinicola V.V. Sarma et al. (Sarma et al. 2001),
K. dimorpha Matsush. (Matsushima 2003), and K. europaea Treigiené (Treigiené
2006).
The new species, K. scutiae, which grows throughout the year on Scutia
buxifolia leaf litter, is differentiated from other Koorchaloma species by its
longer and wider conidia (length/width ratio = 10:1). Its macronematous
conidiophores resemble those of K. novojournalis, which can be distinguished
by shorter conidia (mean length/width ratio = 3.5:1). Koorchaloma scutiae is
also resembles K. jamaicensis, described from grass blades in Jamaica, in setal
structure and sporodochia, but the latter species produces distinctly broader
conidia (mean conidium length/width ratio = 5.3:1).
Although two Koorchaloma species have Kananascus teleomorphs (Nag Raj
1984, 1993), no teleomorph is known for Koorchaloma scutiae.
Key to Koorchaloma species
aisMarine labitat : ee.c 9 apg! 3 sts piesa pals isis wes Bk Giel s ol dte ami a eh 2
Ib-Non-marine habitat, a5 5a lh conse cahcee UL eee eats Sol ete ool as Bean 3
2a. Mean conidium length/width ratio = 3.4:1...............00.0.00005. K. galateae
2b. Mean conidium length/width ratio = 2.9:1................0000005 K. spartinicola
3a. Species with Acremonium synanamorphosis.................0.0. 00. K. dimorpha
3b. Species without synanamorphosis ........... 0.0. e cece cece teen eee ees 4
4a. Conidia bearing mucoid appendage usually at the apex only,
conidioma not gelatinous ....... 0... cece eet en en een eee 5
4b. Conidia bearing mucoid appendage usually at the apex only or at both ends,
ConidiomajeelatityGUs: A) 2, ie oeet rassteen coo aeons eesti se aaaroee we tegie tdetigael es 6
5a. Mean conidium length/width ratio =2.8:1...................0.008. K. okamurae
5b. Mean conidium length/width ratio = 3.7:1................ 00.00.08. K. madreeya
6a. Conidia bearing mucoid appendage usually at the apex only.......... K. europaea
6b. Conidia bearing mucoid appendage at both ends ............... 0... eee ee ee 7
Fax Omid das USI OPIS eas asc Sh,cosed flay tea of nth ea eB oalle od Laat d goad a Mead Lanbte thoes 8
7b. Gomidia naviculates; 007 wee i. ye geese gh: patie uh: gate UR eh ees pave GU ee 9
8a. Conidiophores reduced to conidiogenous cells .................0005 K. bambusae
8b. Conidiophores macronematous ...... 0.00. cece cette e een e nas 10
9a. Excipulum well developed; mean conidium length/width ratio = 5.3:LK. jamaicensis
9b. Excipulum less developed; mean conidium length/width ratio = 3.9:1K. occidentalis
10a. Mean conidium length/width ratio = 3.5:1................0.004 K. novojournalis
10b. Mean conidium length/width ratio = 10:1 ............. 00.0.0. eee K. scutiae
Koorchaloma and Ciliochorella spp. nov. (Argentina) ... 179
Ciliochorella buxifoliae Allegr., Eliades & Aramb., sp. nov. PLATE 2
MycoBank MBs518291
Foliicola, conidiomata stromatica, dissita vel gregaria, origene subcuticularia, in sectione
lenticula 300-500 um lat, 140-150 ym alt., unilocularia, glabra, brunnea, paries 20-35
um cr., e textura angulari compositus. Conidiophora e cellulis strati intimi telae basalis
conidiomatum enascentia, simplicia et basi 1-2 septata vel ad cellulas conidiogenas redacta,
in muco involuta. Cellulae conidiogenae holoblasticae, ageniformes, hyalinae, laeves, 3-3.5
x 4-5 um. Conidia subfusiformia, triseptata, 19-21 x 2.5-2.7 um, appendices ferentia;
cellula basalis obconica, hyalina, laevis 2-3 um long; cellulae medianae duae, cylindraceae,
subhyalinae, aliquantum inaequalis 8 um long, cellula apicalis hyalina, laevis, cassa, in
appendicem apicalem singularem attenuata; appendix basalis singularis, excentrica
simplex attenuata 3-5 um long; ratione conidii long /lat.= 7:1.
Typus: Argentina, Buenos Aires, Magdalena, in foliis mortuis Scutia buxifolia, Allegrucci
& Cazau 48244 (LPS holotypus) February 2005.
EryMoLoey: referring to its leaf litter substrate species, Scutia buxifolia.
Folicolous conidiomata lenticular, stromatic, picnidioid scattered, subcuticular,
conical in sectional view, 300-500 wm wide, 140-150 um deep, unilocular,
glabrous, pale brown, wall 20-35 um thick, textura angularis, cells thin walled,
pale brown to almost colourless with area of dehiscence ultimately breaking
wide open. Conidiophores lining the cavity of the conidioma, unbranched,
1-2 septate at the base or reduced to conidiogenous cells, invested in mucus.
Conidiogenous cells holoblastic, lageniform, hyaline, smooth 3-3.5 x 4-5 um.
Conidia subfusiform, slightly curved 3-septate 19-21 x 2.5-2.7 um bearing
appendages; basal cell obconical with a truncate base, hyaline, smooth, 2-3
uum long, devoid of contents; 2 median cells cylindrical, almost colourless,
equal, 8 um long, apical cell hyaline, smooth devoid of contents and modified
into a branched appendage divided with 27-30 um between both extremes;
basal appendage single, eccentric, unbranched, attenuated, 3-5 um long, mean
conidium length/width ratio 7:1.
CoMMENTs: The genus Ciliochorella Syd. was described in 1935 for the type
species, Ciliochorella mangiferae (Sydow & Mitter 1935; see Sutton 1964 for a
brief history of the genus). Ciliochorella is characterized by having cylindrical,
straight or slightly curved conidia with euseptate pale brown middle cells,
colourless end cells that bear a single, eccentric appendage. Nag Raj (1993)
recognized three species: C. splendida Nag Raj & R.E Castafieda (Nag Raj
1993), C. castaneae Munjal (Munjal, 1966), and C. mangiferae Syd. (Sydow &
Mitter 1935), Although three other Ciliochorella species have been described,
Nag Raj (1993) synonymized C. eucalypti T.S. Viswan. and C. indica Kalani with
C. mangiferae and C. bambusarum Shanor with Placonema bambusacearum
(Sacc. et al.) Petr.
The new species, C. buxifoliae, grows profusely throughout the year on
Scutia buxifolia leaf litter. We placed our species into Ciliochorella because the
180 ... Allegrucci & al.
4um
PLATE 2. Ciliochorella buxifoliae. A-C. Conidiogenous cells and conidia. D. Conidium.
stromatic pycnidioid subcuticular adpressed to lenticular conidioma is never
immersed in the host tissue; it differs from other Cliochorella species in size,
septation, ramification, and form of the conidial appendage.
Ciliochorella buxifoliae differs from the three other species described above
mainly by the longer and wider conidia. It most closely resembles C. mangiferae,
which produces longer conidia (32-43 x 2.5-3.5 um) with a mean conidium
length/width ratio = 12.3:1.
Key to Ciliochorella species
la. Conidiomata not lenticular ....... 0.0. cece een eee C. splendida
lb? Conidiomatatenticular. 3.0 oc G20 a ee eh at ek Fan eb dad ee bate 2
2a. Conidiophores 0-2 septate, branched occasionally reduced to
conidiogenous:cells t's Ned rats slant tthe serena the he orale heats C. castaneae
2b. Conidiophores invariably reduced to conidiogenous cells...............0..0000. 3
3a. Mean conidium length/width ratio = 12.3:1..................0.00. C. mangiferae
3b. Mean conidium length/width ratio = 7:1..............0... 00.0000. C. buxifoliae
Acknowledgements
This research is part of the 11/N527 UNLP Project. This work was performed with the
financial support of CONICET and CIC. Allegrucci is a recipient of a scholarship from
CONICET. Eliades and Arambarri are research scientists from CONICET, and Cabello
is a researchers from CICPBA. The authors wish to thank Dra. Andrea I. Romero and
Dr. Luis E. Pascholati Gusmao for their suggested revisions of the manuscript.
Koorchaloma and Ciliochorella spp. nov. (Argentina) ... 181
Literature cited
Allegrucci N, Arambarri AM, Cazau C, Cabello MN. 2004. Thozetella buxifolia a new hyphomycete
from Argentina. Mycotaxon 90(2): 275-279.
Allegrucci N, Cazau MC, Cabello MN, Arambarri AM. 2005. Andlisis de las Comunidades de
microhongos de la hojarasca de Scutia buxifolia (Rhamnaceae) en el Este de la Provincia de
Buenos Aires (Argentina). Darwiniana. 43(1-4): 1-9.
Allegrucci N, Elfades L, Bucsinszky AM, Cabello MN, Arambarri AM. 2007. Diversidad de
Hyphomycetes en bosques nativos de Celtis tala (Ulmaceae) en la provincia de Buenos Aires,
Argentina. Soc. Argent. Bot. 42(1-2): 79-86.
Allegrucci N, Cabello MN, Arambarri AM. 2009. Diversity of saprotrophic fungi imperfecti from
native forests in Argentina: an up-dated review. Darwiniana 47(1): 108-124.
Arturi M. 1997. Regeneracién de Celtis tala en el noreste de la Provincia de Buenos Aires. Tesis
doctoral, Facultad de Ciencias Naturales y Museo. UNLP. 163 p.
Crous PW, Allegrucci N, Arambarri MA, Cazau MC, Groenewald JZ, Wingfield MJ. 2005.
Dematiocldium celtidis gen. sp. nov. (Nectriaceae, Hypocreales) a new genus from Celtis leaf
litter in Argentina. Mycological Research. 109(7): 833-840. doi:10.1017/S0953756205002911
Eliades LA, Voget CE, Arambarri AM, Cabello MN. 2007. Fungal communities on decaying
saltgrass (Distichlis spicata) in Buenos Aires province (Argentina). Sydowia 59(2): 227-234.
Hino I. 1961. Icones fungorum bambusicolorum Japonicorum. The Fuji Bamboo Garden town,
Kobe, Japan. 335 p.
Kohlmeyer J, Volkmann-Kohlmeyer B. 2001. Fungi on Juncus roemarianus. 16. More new
coelomycetes, including Tetranacriella, gen. nov. Botanica Marina 44: 147-156. doi:10.1515/
BOT.2001.020
Matsushima T. 2003. Matsushima mycological. memoirs. N°10: Published by the author, Kobe,
Japan. 214 p.
Munjal RL. 1966. The genus Ciliochorella in India. Indian Phytopath. 19: 198-200.
Nag Raj TR, 1984. Koorchaloma, Koorchalomella and Kananascus gen. nov. Mycotaxon 19:
167-212.
Nag Raj TR (ed.). 1993. Coelomycetous anamorphs with appendage-bearing conidia. University of
Waterloo, Ontario. 1101p.
Sanchez RO, Ferreer JA. Duymovich OA. Hurtado MA. 1976. Estudio pedoldgico integral de los
Partidos de Magdalena y Brandsen (Provincia de Buenos Aires). 1-123, in: Anales del LEMIT,
serie II, N° 310. Ministerio de Obras Publicas de la provincia de Buenos Aires, Argentina.
Sarma VV, Newell SY, Hyde KD. 2001. Koorchaloma spartinicola sp.nov. A new marine sporodochial
fungus from Spartina alterniflora. Botanica Marina 44: 321-326. doi:10.1515/BOT.2001.041
Subramanian CV. 1953. Koorchaloma, a new genus of the Tuberculariaceae. Journal of the Indian
Botanical Society 32: 123-126.
Sutton BC. 1964. Coelomycetes III. Annellolacinia gen. nov., Aristastoma, Phaeocytostroma,
Seimatosporium, etc. Mycological papers 97: 1-42.
Sydow H, Mitter JH. 1935. Fungi indici, II. Ann. mycol. 33: 46-71.
Treigiené A. 2006. New species of Kananascus and its anamorph from Lithuania. Mycotaxon 96(2):
173-180.
Yanna, Hyde, KD, Goh TK. 1998. Koorchaloma novojournalis sp nov., a new sporodochial fungus
from Hong Kong. Fungal Diversity 1: 193-197.
Yanna, Ho WH, Hyde KD. 2001. Fungal communities on decaying palm fronds in Australia, Brunei,
and Hong Kong. Mycological Research 105(12): 1458-1471. doi:10.1017/S0953756201005214
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 183-201 January-March 2011
DOT: 10.5248/115.183
A new taxonomic classification for species in
Gomphus sensu lato
ADMIR J. GIACHINI'! & MICHAEL A. CASTELLANO”
1 Universidade Federal de Santa Catarina, Departamento de Microbiologia, Imunologia e
Parasitologia, Florianopolis, Santa Catarina 88040-970, Brasil
2U.S. Department of Agriculture, Forest Service, Northern Research Station, Forestry Sciences
Laboratory, 3200 Jefferson Way, Corvallis, Oregon 97331, USA
ABsTRACT — Taxonomy of the Gomphales has been revisited by combining morphology
and molecular data (DNA sequences) to provide a natural classification for the species
of Gomphus sensu lato. Results indicate Gomphus s.l. to be non-monophyletic, leading to
new combinations and the placement of its species into four genera: Gomphus sensu stricto
(3 species), Gloeocantharellus (11 species), Phaeoclavulina (41 species), and Turbinellus
(5 species).
Key worps - Fries, nomenclature, Persoon, systematics
Introduction
Gomphus sensu lato (Gomphaceae, Gomphales, Basidiomycota) is
characterized by fleshy basidiomata that can have funnel- or fan-shaped pilei
with wrinkled, decurrent hymenia. The genus, which was described by Persoon
(1797a), has undergone several taxonomic and nomenclatural modifications
over the past 200 years.
The taxonomy of Gomphus s.1. (Gomphales) has proven difficult because of the
few reliable morphological characters available for classification. Consequently,
species of Gomphus s.]. have been classified under Cantharellus, Chloroneuron,
Chlorophyllum, Cratereilus, Gloeocantharellus, Nevrophyllum, and Turbinellus.
A few species are mycorrhizal (Agerer et al. 1998, Bulakh 1978, Guzman &
Villarreal 1985, Khokhryakov 1956, Kropp & Trappe 1982, Masui 1926, 1927,
Pantidou 1980, Trappe 1960, Valdés-Ramirez 1972). Some are considered rare
*This paper was prepared by a U.S.A. government employee on official time and is therefore in
the public domain and not subject to copyright.
184 ... Giachini & Castellano
and endangered, especially in the Pacific Northwestern USA (USDA/USDI
1994) and certain regions of Europe (Bulakh 1978, Bulakh & Govorova 2000,
Dahlberg & Croneborg 2003, Kluzak 1994, Urbonas et al. 1990). Gomphus
bonarii, G. clavatus, G. floccosus, and G. kauffmanii are listed as threatened in
the 1994 Northwest Forest Plan (USDA/USDI 1994) because of their apparent
close association with old-growth forests. Gomphus clavatus is considered rare
(red-listed) in 17 countries of Europe (Dahlberg & Croneborg 2003).
Nomenclatural history of Gomphus sensu lato
The concept of Gomphus s.]. was established when Persoon (1796) first
mentioned the name Merulius. Subsequently Persoon (1797b) proposed four
new combinations, including M. violaceus (= M. clavatus). Persoon (1797a)
also introduced the name Gomphus at the generic level, but did not assign
species to his newly created genus; still the name was validly published. Later
Persoon (1801) transferred Gomphus to Merulius section Gomphus with two
documented taxa [M. clavatus var. violaceus and M. clavatus var. spadiceus
(= Clavaria truncata Schmidel)] and afterward restored the genus rank to
Gomphus (Persoon 1825) with five species, including G. truncatus (= M.
clavatus). Gray (1821) accepted Persoon’s genus name, which he assigned to
one species, Gomphus clavatus. ‘The genus has frequently been cited in the past
as “Gomphus (Pers.) Gray” or “Gomphus Pers. ex Gray”; but once the starting
date for fungal nomenclature was emended to 1753 (Voss et al. 1983), the
correct citation has been Gomphus Pers.
Fries (1821) accepted Gomphus only at the infrageneric level, as Cantharellus
‘tribus’ Gomphus (not to be confused with the unrelated Agaricus subgen.
Gomphus Fr.) and subsequently (Fries 1825) introduced the genus Gomphora
as a nomenclatural synonym of Gomphus Pers.
Other authors involved with shaping the history of Gomphus s.]. included
Schweinitz (1832), Berkeley (1839), Berkeley & Curtis (1859), Peck (1887), and
Smith & Morse (1947), all of whom assigned gomphoid species to Cantharellus.
Fries (1838) moved Merulius clavatus to Craterellus. Doassans & Patouillard
(1886) described Nevrophyllum to accommodate Gomphus species, and Earle
(1909) proposed Turbinellus to accommodate some species formerly assigned
to Cantharellus.
Singer (1945) described Gloeocantharellus (based on Cantharellus
purpurascens) with the key diagnostic character of gloeocystidia to separate it
from Cantharellus. More importantly, here he also recognized Gomphus at the
generic level, recombining Cantharellus bonarii as G. bonarii.
Corner (1950, 1966, 1970), and Petersen (1967, 1968, 1969, 1971, 1972),
who clarified the natural classification of this group, accepted the classifications
proposed by Donk (1933, 1941, 1949a,b), who also proposed the family
Gomphus sensu lato reclassified ... 185
Gomphaceae (Donk 1961). The Gomphaceae was considered a member of the
Aphyllophorales until Julich (1981) proposed the order Gomphales.
The molecular overview of gomphoid-phalloid phylogeny by Hosaka et al.
(2006) incorporated the data from Giachini (2004) for Gomphus s.L, including
its four generic segregates. We here provide the conclusions from Giachini’s
research, a key to the segregate genera, and a list of accepted names, including
new combinations, and synonyms.
Systematics, taxonomy, and evolutionary biology
Most difficulties in identifying taxa of Gomphus s.1. arise because of the
few reliable morphological characters available for classification. However,
distinctive clusters of species can be consistently separated by morphology.
Most are united by a few consistent features, such as fan-shaped, lilaceous vs.
funnel-shaped, orange-brown pilei, scaly vs. inconspicuously fibrous pileus
surface, presence vs. absence of clamp connections, echinulate vs. verrucose
spores, tropical vs. temperate habitat, etc.
Given the difficulty in identifying species of Gomphus s.1. by morphological
characters, combined morphological and molecular data (DNA sequences)
were used to verify the monophyly of Gomphus and to identify morphological
features to reliably separate taxa within Gomphus.
Materials & methods
Collections examined
In all, 434 collections of Gomphales species were analyzed for distinct macro- and
micro-morphological features, of which 189 were selected for molecular characterization
(for details see Giachini 2004, Giachini et al. 2010).
Molecular characterization
Twenty-nine sequences of Gomphus sl. representing 22 taxa were sampled for
molecular characterization and phylogenetic analysis; DNA extraction, purification,
sequencing, and analyses are according to Giachini (2004) and Giachini et al. (2010).
Results
Reexamination of generic types by morphological and molecular approaches
revealed the inadequacy of some characters used by early workers to differentiate
species within Gomphus s.]. Additionally, genetic data strongly suggest that
Gomphus s.1. is not monophyletic (Giachini 2004, Giachini et al. 2010). Rather, it
originated several times within the order Gomphales (Giachini et al. 2010: figures
1, 2). Because basidioma morphology and overall microscopic characteristics
differentiate among species in many clades within Gomphus s.1., segregation of
species into the genera Gomphus s.s., Gloeocantharellus, Phaeoclavulina (some
species of Gomphus s.l. and all species of Ramaria subgenus Echinoramaria),
186 ... Giachini & Castellano
and Turbinellus is proposed. Detailed description of all species listed here will
be published elsewhere.
Key to genera
la.
1b.
2a.
2b.
3a.
3b.
Basidiomata unipileate or merismatoid (composed of several pilei); pileus
mostly funnel-shaped, surface almost glabrous to fibrillose, appressed-floccose,
squamose scaly or with heavy recurved scales; clamp connections sometimes
present but mostly absent; spores verrucose....... 0.0... cece cece eee eee 2
Basidiomata ramarioid, unipileate or merismatoid; pileus, when present,
fan- to funnel-shaped, surface glabrous; clamp connections always present;
spores echinulate, verrucose, subreticulate or reticulate .................004. 3
Pileus minutely to strongly scaly, orange-yellow to orange-scarlet, blood red,
pale orange, orange, or brown, often changing color on drying; scales generally
darker than pileus surface; hymenium wrinkled................... Turbinellus
Pileus glabrous to tomentose, off-white, pale yellow, pale yellow brown,
yellow-pink, pale to livid orange, orange-pink, pink, pale brown, dark
yellow-orange, dark rusty brown, or pale red; hymenium decurrent,
supported by either true lamellae, bifurcating broad hymenial folds,
or wertinkled folds... oe: oe: sth, aes pees 4 a de gee oles petit a gi Gloeocantharellus
Basidiomata unipileate or merismatoid, terrestrial; pileus fan-shaped to slightly
funnel-shaped, bright violet, pale olivaceous or brown; hymenium wrinkled
to almost poroid, violet, vinaceous brown to milky-coffee colored; spores
VELEUCOSES ES gical tite Ath Le tesl Soak eons stat RIE eats engl tyes ate Pigelah gag Alia Gomphus
Basidiomata ramarioid, unipileate or merismatoid, sometimes lignicolous;
pileus, when present, funnel-shaped or fan-shaped, pileus and branch surfaces
white, brown-green, pale to sordid olivaceous, violet, brown-yellow or red-
cinnamon, gray, brick red, or pale to dark orange-yellow; hymenium smooth
in some species, sublamellate or irregularly wrinkled with decurrent folds in
others, in general yellow to orange-red or brown, pale to sordid olivaceous,
or violet; spores echinulate (mostly with acute spines), verrucose,
subreticulate or reticulate ....... 0... eee Phaeoclavulina
Accepted names and new combinations
New synonymies are prefixed with an asterisk * (based on Giachini et al. 2010)
Gomphus Pers. Tent. Disp. Meth. Fung.: 74 (1797)
[non Gomphus (Fr.) Weinm. 1826].
= Merulius sect. Gomphus Pers., Syn. Meth. Fung.: 498 (1801).
= Cantharellus ‘trib? Gomphus (Pers.) Fr., Syst. Mycol. 1: 322 (1821).
= Gomphora Fr., Syst. Orb. Veg.: 88 (1825).
= Nevrophyllum Pat., in Doassans & Patouillard, Revue Mycol. 8: 26
(1886), nom. illegit. [non Neurophyllum Torr. & A. Gray 1840].
= Cantharellus sect. Gomphus A.H. Sm. & Morse, Mycologia 39: 499 (1947).
Type species: Gomphus clavatus (Pers.) Gray 1821.
Gomphus sensu lato reclassified ... 187
Gomphus brunneus (Heinem.) Corner, Ann. Bot. Mem. 2: 116 (1966).
Basionym: Neurophyllum brunneum Heinem., Bull. Jard. Bot. Etat. Brux. 28: 435 (1958).
= Gomphus clavatus var. parvisporus Corner, Ann. Bot. Mem. 2: 118 (1966).
Gomphus clavatus (Pers.) Gray, Nat. Arr. Brit. Pl. 1: 638 (1821).
Basionym: Merulius clavatus Pers., Observ. Mycol. 1: 21 (1796).
= Cantharellus clavatus (Pers.) Fr., Syst. Mycol. 1: 322 (1821).
= Craterellus clavatus (Pers.) Fr., Epicr. Syst. Mycol.: 533 (1838).
= Thelephora clavata (Pers.) P. Kumm., Fuhr. Pilzk: 46 (1871).
= Nevrophyllum clavatum (Pers.) Pat., in Doassans &
Patouillard, Revue Mycol. 8: 26 (1886).
= Trombetta clavata (Pers.) Kuntze, Revis. Gen. Pl. 2: 873 (1891).
= Clavaria elveloides Wulfen, Miscell. Austriaca Bot. 2: 99 (1781).
= Clavaria truncata Schmidel , Anal. Pl. 3: 237 (1796).
= Gomphus truncatus (Schmidel) Pers., Mycol. Eur. 2: 9 (1825).
= Merulius clavatus var. spadiceus Pers., Syn. Meth. Fung.: 498 (1801).
= Cantharellus brevipes Peck, Rep. N. Y. St. Mus. Nat. Hist. 33: 21 (1883).
= Merulius brevipes (Peck) Kuntze, Revis. Gen. Pl. 2: 862 (1891).
= Craterellus nucleatus Schréd., Centralbl. Gesammte Forstwes. 34: 396 (1908).
*= Cantharellus purpuraceus Iwade, Bull. Tokyo Univ. Forests. 33: 54 (1944).
= Gomphus purpuraceus (Iwade) K. Yokoy., in Imazeki,
Colour. Illustr. Mushr. Japan 2: 98 (1989).
Gomphus crassipes (L.M. Dufour) Maire, in Maire & Werner, Mém. Soc. Sci. Nat.
Maroc 45: 81 (1937).
Basionym: Cantharellus crassipes L.M. Dufour, Rev. Gen. Bot. 1: 358 (1889).
= Merulius crassipes (L.M. Dufour) Kuntze, Revis. Gen. Pl. 3(2): 494 (1898).
= Nevrophyllum crassipes (L.M. Dufour) Maire, Bull. Soc. Mycol. Fr. 30: 214 (1914).
Gloeocantharellus Singer, Lloydia 8: 140 (1945).
= Linderomyces Singer, Farlowia 3: 157 (1947).
Type species: Cantharellus purpurascens Hesler 1944.
Gloeocantharellus corneri (Singer) Corner, Nova Hedwigia 18: 799 (1970).
Basionym: Linderomyces corneri Singer, Vellozia 1: 14 (1961).
Gloeocantharellus dingleyae (Segedin) Giachini, comb. nov.
MycoBank MB512928
BasionymM: Gomphus dingleyae Segedin, New Zealand J. Bot. 22: 536 (1985), as “dingleyi”.
Note: The masculine termination ‘-? is an error to be corrected to ‘-ae’, because the
epithet is a feminine possessive noun honouring Joan Dingley [see McNeill et al. 2006:
Art. 32.7, 60.11 + Rec. 60C.1(a)].
Gloeocantharellus echinosporus Corner, Nova Hedwigia 18: 801 (1970).
Gloeocantharellus lateritius (Petch) Corner, Nova Hedwigia 18: 803 (1970).
BasionyM: Paxillus lateritius Petch, Ann. Roy. Bot. Gard. Peradeniya 6: 202 (1917).
188 ... Giachini & Castellano
= Phyllobolites lateritius (Petch) Singer, Ann. Mycol. 40: 59 (1942).
= Linderomyces lateritius (Petch) Singer, Farlowia 3: 157 (1947).
= Gomphus lateritius (Petch) R.H. Petersen, J. Elisha Mitchell Scient. Soc. 84: 380 (1968).
Gloeocantharellus mamorensis (Singer) Giachini, comb. nov.
MycoBank MB 512929
BasionyM: Gomphus mamorensis Singer, in Singer et
al., Beih. Nova Hedwigia 77: 17 (1983).
Gloeocantharellus novae-zelandiae (Segedin) Giachini, comb. nov.
MycoBank MB512930
Basionym: Gomphus novae-zelandiae Segedin, New Zealand J. Bot. 22: 533 (1985).
Gloeocantharellus okapaensis (Corner) Corner, Nova Hedwigia 18: 803 (1970).
BasionyM: Gomphus okapaensis Corner, Ann. Bot. Mem. 2: 123 (1966).
Gloeocantharellus pallidus (Yasuda) Giachini, comb. nov.
MycoBank MB512931
Basionym: Cantharellus pallidus Yasuda, in Lloyd, Mycol. Notes 47: 661 (1917).
= Gomphus pallidus (Yasuda) Corner, Ann. Bot. Mem. 2: 123 (1966).
Gloeocantharellus persicinus T.H. Li, Chun Y. Deng & L.M. Wu, in Deng & Li,
Mycotaxon 106: 450 (2009).
Gloeocantharellus purpurascens (Hesler) Singer, Lloydia 8: 140 (1945).
Basionym: Cantharellus purpurascens Hesler, in Smith & Hesler, Lloydia 6: 248 (1944).
= Gomphus purpurascens (Hesler) R.H. Petersen, J. Elisha
Mitchell Scient. Soc. 84: 380 (1968).
Gloeocantharellus uitotanus Vasco-Pal. & Franco-Mol., Mycotaxon 91: 90 (2005).
Phaeoclavulina Brinkmann, Jahresber. Westfal. Provinz.-Ver. Wiss.
Kunst 25: 197 (1897).
= Clavaria sect. Phaeoclavulina (Brinkmann) Killerm., in
Engler & Prantl, Nat. Pflanzenfam. 6: 155 (1928).
*= Lachnocladium sect. Dendrocladium Pat., J. Bot. Morot 3: 33 (1889).
= Dendrocladium (Pat.) Lloyd, Mycol. Notes 60: 870 (1919).
= Ramaria sect. Dendrocladium (Pat.) R.H. Petersen, Bibl. Mycol. 79: 44 (1981).
*= Chloroneuron Murrill, Mycologia 3: 25 (1911).
= Chlorophyllum Murrill, North Amer. Flora 9: 172 (1910),
nom. illeg. [non Chlorophyllum Massee 1898].
= Neurophyllum subgen. Chloroneuron (Murrill) R. Heim, Revue Mycol. 19: 51 (1954).
*= Clavaria subsect. Terrestres Killerm., in Engler & Prantl, Nat. Pflanzenfam. 6: 154 (1928).
*= Ramaria subgen. Echinoramaria Corner, Beih. Nova Hedwigia 33: 238 (1970).
*= Ramaria ser. Grandisporae Corner, Beih. Nova Hedwigia 33: 239 (1970).
= Ramaria sect. Grandisporae (Corner) Franchi & M.
Marchetti, Fungi non Delineati 16: 15 (2001).
*= Ramaria ser. Flaccidae Corner, Beih. Nova Hedwigia 33: 239 (1970).
= Ramaria sect. Flaccidae (Corner) R.H. Petersen, Bibl. Mycol. 79: 100 (1981).
Gomphus sensu lato reclassified ...
*= Ramaria ser. Virescentes Corner, Beih. Nova Hedwigia 33: 239 (1970).
*= Gomphus subgen. Phaeoclavulinoides R.H. Petersen, Mycologia 68: 432 (1976).
Type species: Phaeoclavulina macrospora Brinkmann 1897.
Phaeoclavulina abietina (Pers.) Giachini, comb. nov.
MycoBank MB512962
BasionyM: Clavaria abietina Pers., Neues Mag. Bot. 1: 117 (1794)
[sanctioned name; non “Clavaria abietina” sensu Fr. 1821].
= Merisma abietinum (Pers.) Spreng., Syst. Veg. 4: 495 (1827).
= Hydnum abietinum (Pers.) Duby, Bot. Gall 2: 778 (1830).
= Clavariella abietina (Pers.) P. Karst., Revue Mycol. 3(9): 21 (1880).
= Ramaria abietina (Pers.) Quél., Fl. Mycol. France: 467 (1888).
= Clavaria ochraceovirens Jungh., Linnaea 5: 407 (1830).
= Ramaria ochraceovirens (Jungh.) Donk var. ochraceovirens,
Meded. Ned. Mycol. Ver. 22: 112 (1933).
= Clavaria abietina f. persoonii Fr., Hymenomyc. Eur.: 671 (1874).
= Clavaria abietina var. virens Gillet, Tab. Anal.: 183 (1884).
*= Clavaria abietina subsp. cyanescens Romell, in Krok & Almquist, Sv.
FL. Skol., Krypt., 24 ed., (1911) [not seen; fide Corner 1950].
= Clavaria cyanescens (Romell) S. Lundell, in Krok & Almquist, Sv. FI.
Skol., Krypt., 5" ed.: 286 (1932) [not seen; fide Corner 1950].
= Clavaria virescens Gramberg, Pilz- Krauterfreund 5: 57 (1921).
= Ramaria virescens (Gramberg) Hennig, in Michael, Fiihr. Pilzfr. 3: 320 (1927).
*= Ramaria ochrochlora Furrer-Ziogas & Schild, in Schild,
Fung. Rar. Icon. Color. 5: 17 (1971).
*= Ramaria ochraceovirens var. parvispora K.S. Thind, Khurana
& S.C. Kaushal, Kavaka 11: 33 (1984).
Phaeoclavulina africana (R.H. Petersen) Giachini, comb. nov.
MycoBank MB512932
BasionyM: Gomphus africanus R.H. Petersen, Mycologia 68: 429 (1976).
Phaeoclavulina angustata (Lév.) Giachini, comb. nov.
MycoBank MB512933
Basionym: Merisma angustatum Lév., Ann. Sci. Nat., Bot. sér. 3, 5: 158 (1846).
189
= Thelephora angustata (Lév.) Fr., Nova Acta Regiae Soc. Sci. Ups., Ser. 3, 1: 108 (1851).
= Ramaria angustata (Lév.) Corner, Beih. Nova Hedwigia 33: 242 (1970).
Phaeoclavulina apiahyna (Speg.) Giachini, comb. nov.
MycoBank MB512934
BasionyM: Clavaria apiahyna Speg., Bol. Acad. Nac. Cienc. (Cérdoba) 23: 435 (1919).
= Ramaria apiahyana (Speg.) Corner, Ann. Bot. Mem. 1: 555 (1950).
Phaeoclavulina argentea (R.H. Petersen) Giachini, comb. nov.
MycoBank MB512935
BasionyM: Ramaria argentea R.H. Petersen, Bibl. Mycol. 79: 111 (1981).
*= Ramaria incognita R.H. Petersen, Bibl. Mycol. 79: 145 (1981).
*= Ramaria incongrua R.H. Petersen, Bibl. Mycol. 79: 147 (1981).
190 ... Giachini & Castellano
Phaeoclavulina articulotela (R.H. Petersen) Giachini, comb. nov.
MycoBank MB512936
Basionym: Ramaria articulotela R.H. Petersen, Bibl. Mycol. 79: 115 (1981).
Phaeoclavulina camellia (Corner) Giachini, comb. nov.
MycoBank MB512937
BAsIONYM: Ramaria camellia Corner, Darwin. 11: 200 (1957).
Phaeoclavulina campestris (K. Yokoy. & Sagara) Giachini, comb. nov.
MycoBank MB512938
BasionyM: Ramaria zippelii var. campestris K. Yokoy. &
Sagara, Trans. Mycol. Soc. Japan 14: 302 (1973).
= Ramaria campestris (K. Yokoy. & Sagara) R.H. Petersen, Bibl. Mycol. 79: 57 (1981).
Phaeoclavulina campoi (Speg.) Giachini, comb. nov.
MycoBank MB512939
Basionym: Clavaria campoi Speg., Bol. Acad. Nac. Cienc. (Cordoba) 25: 28 (1921).
= Ramaria campoi (Speg.) R.H. Petersen, Bibl. Mycol. 79: 119 (1981).
Phaeoclavulina capucina (Pat.) Giachini, comb. nov.
MycoBank MB512940
BasionyM: Clavaria capucina Pat., Bull. Soc. Mycol. Fr. 33: 50 (1917).
= Ramaria capucina (Pat.) Corner, Ann. Bot. Mem. 1: 565 (1950).
Phaeoclavulina cervicornis (A.L. Sm.) Giachini, comb. nov.
MycoBank MB512941
BastonyM: Clavaria cervicornis A.L. Sm., J. Linn. Soc., Bot. 35: 10 (1901).
= Ramaria cervicornis (A.L. Sm.) Corner, Ann. Bot. Mem. 1: 565 (1950).
Phaeoclavulina clavarioides (Schild) Giachini, comb. nov.
MycoBank MB512942
Basionym: Ramaria clavarioides Schild, Z. Mykol. 64: 60 (1998).
Phaeoclavulina cokeri (R.H. Petersen) Giachini, comb. nov.
MycoBank MB512945
BasionyM: Ramaria cokeri R.H. Petersen, Dist. Hist. Biota S. Appalachians 4: 291 (1976).
*= Clavaria echinospora Berk. & Broome, J. Linn. Soc., Bot. 14: 75 (1873).
= Scytinopogon echinosporus (Berk. & Broome) Corner, Ann. Bot. Mem. 1: 655. (1950).
*= Clavaria fragillima Sacc. & P. Syd., Syll. Fung. 16: 206 (1902).
= Clavaria echinospora Henn., Monsunia 1: 141 (1899), nom.
illegit. [non C. echinospora Berk. & Broome 1873].
= Clavariella fragillima (Sacc. & P. Syd.) Overeem, Bull.
Jard. Bot. Buitenzorg, ser. 3, 5: 275 (1923).
= Ramaria fragillima (Sacc. & Syd.) Corner, Ann. Bot. Mem. 1: 588 (1950).
Phaeoclavulina curta (Fr.) Giachini, comb. nov.
MycoBank MB512946
BasionyM: Clavaria curta Fr., Ofvers. Forh. Kongl. Svenska Vetensk.- Akad. 18: 31 (1861).
= Ramariopsis curta (Fr.) Corner, Ann. Bot. Mem. 1: 639 (1950).
= Ramaria curta (Fr.) Schild, Z. Mykol. 60(1): 125 (1994).
Gomphus sensu lato reclassified ... 191
= Clavaria myceliosa Peck, Bull. Torrey Bot. Club 31(4): 182 (1904).
= Ramaria myceliosa (Peck) Corner var. myceliosa, Ann. Bot. Mem. 1: 607 (1950).
*= Clavaria decurrens var. australis Coker, Clav. U.S.: 177 (1923).
= Ramaria pusilla var. australis (Coker) Corner, Ann. Bot. Mem. 1: 618 (1950).
= Ramaria decurrens var. australis (Coker) R.H. Petersen, Bibl. Mycol. 79: 127 (1981).
= Ramaria pusilla Corner var. pusilla, Ann. Bot. Mem. 1: 617 (1950).
= Clavaria pusilla Peck, Ann. Rep. Reg. Univ. St. N.Y. 25: 83
(1873), nom. illegit. [non C. pusilla Pers. 1797].
= Ramaria myceliosa var. microspora R.H. Petersen, Bibl. Mycol. 79: 157 (1981).
*= Ramaria subdecurrens var. burnhamii R.H. Petersen, Bibl. Mycol. 79: 171 (1981).
Phaeoclavulina cyanocephala (Berk. & M.A. Curtis) Giachini, comb. nov.
MycoBank MB512947
BasionyM: Clavaria cyanocephala Berk. & M.A. Curtis, J. Linn. Soc., Bot. 10: 338 (1868).
= Ramaria cyanocephala (Berk. & M.A. Curtis) Corner, Ann. Bot. Mem. 1: 568 (1950).
= Ramaria grandis f. cyanocephala (Berk. & M.A. Curtis)
R.H. Petersen, Bibl. Mycol. 79: 71 (1981).
*= Clavaria grandis Peck, Bull. Torrey Bot. Club 29(2): 73 (1902).
= Ramaria grandis (Peck) Corner f. grandis, Ann. Bot. Mem. 1: 595 (1950).
= Ramaria zippelii f. grandis (Peck) R.H. Petersen, Taxonomy of
Fungi, (Proc. int. Symp. Madras, 1973) Part 2: 569 (1984).
*= Clavaria spiculospora G.F. Atk., Ann. Mycol. 7: 368 (1909) [cited as
“spiculisperma” (lapsus calami) in Syll. Fung. 21: 426 (1912)].
Phaeoclavulina decolor (Berk. & M.A. Curtis) Giachini, comb. nov.
MycoBank MB512948
BasionyM: Clavaria decolor Berk. & M.A. Curtis, Proc.
Amer. Acad. Arts Sci. 4: 124 (1860).
= Ramaria decolor (Berk. & M.A. Curtis) R.H. Petersen, Persoonia 12(3): 231 (1984).
*= Ramaria zippelii var. cristatospora Corner, Proc. Linn. Soc. London 178: 103 (1967).
= Ramaria cristatospora (Corner) R.H. Petersen, Bibl. Mycol. 79: 64 (1981).
Phaeoclavulina echinovirens (Corner, K.S. Thind & Dev) Giachini, comb. nov.
MycoBank MB512950
BasionyM: Ramaria echinovirens Corner, K.S. Thind &
Dev, Trans. Br. Mycol. Soc. 40: 473 (1957).
Phaeoclavulina eumorpha (P. Karst.) Giachini, comb. nov.
MycoBank MB512949
BasionyM: Clavariella spinulosa subsp. eumorpha P. Karst.,
Bidr. Kannedom Finl. Natur Folk 37: 185 (1882).
= Clavaria spinulosa subsp. eumorpha (P. Karst.) Sacc., Syll. Fung. 6: 701 (1888).
= Clavariella euamorpha (P. Karst.) P. Karst., Bidr. Kannedom
Finl. Natur Folk 48: 388 (1889).
= Ramaria eumorpha (P. Karst.) Corner, Ann. Bot. Mem. 1: 575 (1950).
*= Clavaria patagonica Speg., Bol. Acad. Nac. Cienc. (Cérdoba) 11: 21 (1887).
= Clavulinopsis patagonica (Speg.) Corner, Ann. Bot. Mem. 1: 383 (1950).
= Ramaria patagonica (Speg.) Corner, Darwin. 11: 203 (1957).
192 ... Giachini & Castellano
= Clavaria invalii Cotton & Wakef., Trans. Br. Mycol. Soc. 6: 176 (1919).
= Clavaria flaccida subsp. invalii (Cotton & Wakef.) Konrad &
Maubl., Icon. Select. Fung., fasc. 4: p1.488 (1928).
= Ramaria invalii (Cotton & Wakef.) Donk, Meded. Ned. Mycol. Ver. 22:113 (1933).
= Clavaria flaccida var. invalii (Cotton & Wakef.) J. Favre,
Mater. FI. Crypt. Suisse 10(3): 32 (1948).
*= Clavaria murrillii Coker, Clav. U.S.: 190 (1923).
= Ramaria murrillii (Coker) Corner, Ann. Bot. Mem. 1: 607 (1950).
Phaeoclavulina flaccida (Fr.) Giachini, comb. nov.
MycoBank MB512951
BasionyM: Clavaria flaccida Fr., Syst. Mycol. 1: 471 (1821).
= Clavariella flaccida (Fr.) P. Karst. var. flaccida, Revue Mycol. 3(9): 21 (1881).
= Ramaria flaccida (Fr.) Bourdot var. flaccida, Rev. Sci. Bourb. 11: 235 (1898).
*= “Clavaria abietina” sensu Fr., Syst. Mycol. 1: 469 (1821),
nom. inval. [non Clavaria abietina Pers. 1794].
*= Clavaria muscicola Pers., Observ. Mycol. 2: 60 (1800).
= Pistillaria muscicola (Pers.) Fr., Syst. Mycol. 1: 498 (1821).
= Typhula muscicola (Pers.) Fr., Epicr. Syst. Mycol.: 585 (1838).
= Eocronartium muscicola (Pers.) Fitzp., Phytopathology 8: 197 (1918).
*= Clavaria crispula Fr., Syst. Mycol. 1: 470 (1821).
= Merisma crispulum (Fr.) Spreng. Syst. Veg. 4: 496 (1827).
= Clavariella crispula (Fr.) P. Karst., Revue Mycol. 3(9): 21 (1881).
= Ramaria crispula (Fr.) Quél., Fl. Mycol. France: 464 (1888).
= Ramaria flaccida var. crispula (Fr.) Schild, Hoppea 61: 317 (2000).
*= Clavaria decurrens Pers. Mycol. Eur. 1: 164 (1822).
= Ramaria decurrens (Pers.) R.H. Petersen var. decurrens, Bibl. Mycol. 79: 124 (1981).
*= Clavaria corrugata P. Karst., Not. Sallsk. Fauna Fl. Fenn. Férh. 9: 371 (1868).
= Clavariella corrugata (P. Karst.) P. Karst., Revue Mycol. 3(9): 21 (1881).
= Clavaria abietina f. corrugata (P. Karst.) Killerm., Denkschr.
Bayr. Bot. Ges. Regensburg 15: 113 (1922).
= Ramaria corrugata (P. Karst.) Schild, Schweiz. Z. Pilzk. 53: 130 (1975).
*= Clavariella flaccida var. dendroides P. Karst., Not. Sallsk.
Fauna FI. Fenn. Forh. 9: 372 (1868).
*= Clavaria muscigena P. Karst., Not. Sallsk. Fauna Fl. Fenn. Forh. 9: 373 (1868).
= Clavaria uncialis subsp. muscigena (P. Karst.) Sacc., Syll. Fung. 6: 730 (1888).
= Eocronartium muscigena (P. Karst.) Hohn., Sitzungsber. K. Akad.
Wiss., Math.-Naturwiss. K1., Abt. 1, 118: 1463 (1909).
*= Eocronartium typhuloides G.F. Atk., J. Mycol. 8: 107 (1902).
= Helicobasidium typhuloides (G.F. Atk.) Pat., Bull. Soc. Mycol. Fr. 36: 176 (1920).
*= Clavaria subdecurrens Coker var. subdecurrens, Clav. U.S.: 172 (1923).
= Ramaria subdecurrens (Coker) Corner var. subdecurrens, Ann. Bot. Mem. 1: 626 (1950).
*= Ramaria ligustri Velen., Novit. Mycol.: 162 (1939).
*= Ramaria fuscobrunnea Corner, in Balfour-Browne, Bull. Brit. Mus. Nat. Hist. 1: 200 (1955).
*= Ramaria flaccida var. longiramosa Corner, Beih. Nova Hedwigia 33: 250 (1970).
*= Ramaria perfluopunicea R.H. Petersen, New Zealand DSIR Bull. 236: 100 (1988).
Gomphus sensu lato reclassified ... 193
Phaeoclavulina gigantea (Pat.) Giachini, comb. nov.
MycoBank MB512952
BasionyM: Lachnocladium giganteum Pat., J. Bot. (Morot) 3: 34 (1889).
= Ramaria gigantea (Pat.) R.H. Petersen f. gigantea, Bibl. Mycol. 79: 66 (1981).
= Lachnocladium olivaceum Henn., Hedw. 36: 196 (1897).
= Lachnocladium echinosporum Bres., Ann. Mycol. 9: 551 (1911).
*= Ramaria zippelii var. gracilis Corner, Ann. Bot. Mem. 1: 635, 700 (1950).
*= Ramaria gigantea f. tenuispora R.H. Petersen, New Zealand DSIR Bull. 236: 97 (1988).
Phaeoclavulina glauco-aromatica (R.H. Petersen) Giachini, comb. nov.
MycoBank MB512953
Basionym: Ramaria glauco-aromatica R.H. Petersen, Bibl. Mycol. 79: 141 (1981).
Phaeoclavulina grandis (Corner) Giachini, comb. nov.
MycoBank MB512954
BasionyM: Gomphus grandis Corner, Nova Hedwigia 18: 812 (1970).
Phaeoclavulina griseobrunnea (Singer) Giachini, comb. nov.
MycoBank MB512955
BasionyM: Ramaria griseobrunnea Singer, in Singer et
al., Beih. Nova Hedwigia 77: 19 (1983).
Phaeoclavulina guadelupensis (Pat.) Giachini, comb. nov.
MycoBank MB512956
BasionyM: Stereum guadelupense Pat., Bull. Soc. Mycol. Fr. 15: 201 (1899).
= Gomphus guadelupensis (Pat.) D.A. Reid, Persoonia 2: 134 (1962).
*= Nevrophyllum ochraceum Pat., in Duss, Enum. Champ. Guadeloupe: 38 (1903).
= Cantharellus ochraceus (Pat.) Sacc. & D. Sacc., Syll. Fung. 17: 36 (1905).
= Gomphus ochraceus (Pat.) Singer, Lloydia 8: 140 (1945).
Phaeoclavulina guyanensis (Pat.) Giachini, comb. nov.
MycoBank MB512957
Basionym: Lachnocladium guyanense Pat., J. Bot. (Morot) 3: 35 (1889).
= Ramaria guyanensis (Pat.) Corner, Ann. Bot. Mem. 1: 596 (1950).
= Clavaria guyanensis (Pat.) Rick, Iheringia 5: 132 (1959).
*= Lachnocladium leucoceras Pat., J. Bot. (Morot) 3: 33 (1889).
= Ramaria leucoceras (Pat.) Corner, Ann. Bot. Mem. 1: 600 (1950).
Phaeoclavulina insignis (Pat.) Giachini, comb. nov.
MycoBank MB512958
Basionym: Lachnocladium insigne Pat., J. Bot. (Morot) 3: 34 (1889).
= Ramaria insignis (Pat.) R.H. Petersen, Bibl. Mycol. 79: 77 (1981), as “insigne”.
Phaeoclavulina longicaulis (Peck) Giachini, comb. nov.
MycoBank MB512959
Basionym: Clavaria longicaulis Peck, Bull. Torrey Bot. Club 25: 371 (1898).
= Ramaria longicaulis (Peck) Corner, Ann. Bot. Mem. 1: 600 (1950).
194 ... Giachini & Castellano
Phaeoclavulina macrospora Brinkmann, Jber. Westf. Prov. Ver. Wiss. Kunst 25: 198
(1897).
= Ramaria macrospora (Brinkmann) Corner, Ann. Bot. Mem. 1: 603
(1950), nom. illegit. [non R. macrospora Velen. 1947].
= Phaeoclavulina nigrescens Brinkmann, Jber. Westf. Prov. Ver. Wiss. Kunst 25: 198 (1897).
= Ramaria nigrescens (Brinkmann) Donk var. nigrescens,
Meded. Ned. Mycol. Ver. 22: 104 (1933).
= Clavaria broomei Cotton & Wakef., Trans. Br. Mycol. Soc. 6: 170 (1919).
= Phaeoclavulina broomei (Cotton & Wakef.) Overeem, Bull.
Jard. Bot. Buitenzorg, ser. 3, 5: 277 (1923).
= Ramaria broomei (Cotton & Wakef.) R.H. Petersen, Bibl. Mycol. 79: 53 (1981).
*= Ramaria nigrescens var. americana Corner, Ann. Bot. Mem. 1: 608, 700 (1950).
= Ramaria americana (Corner) R.H. Petersen, Bibl. Mycol. 79: 48 (1981).
Phaeoclavulina mutabilis (Schild & R.H. Petersen) Giachini, comb. nov.
MycoBank MB512960
BasionyM: Ramaria mutabilis Schild & R.H. Petersen,
in Petersen, Bibl. Mycol. 79: 149 (1981).
Phaeoclavulina ochracea (Bres.) Giachini, comb. nov.
MycoBank MB512961
BasionyM: Lachnocladium ochraceum Bres., in Bresadola &
Saccardo, Bull. Soc. Roy. Bot. Belgique 38: 157 (1899).
= Ramaria ochracea (Bres.) Corner var. ochracea, Ann. Bot. Mem. 1: 610 (1950).
*= Clavaria intricatissima Speg., Anales Mus. Nac. Buenos Aires 19: 279 (1909).
= Ramaria intricatissima (Speg.) Corner, Ann. Bot. Mem. 1: 598 (1950).
*= Ramaria luteoflaccida Corner, Ann. Bot. Mem. 1: 601, 699 (1950).
*= Ramaria flaccida var. chilensis Lazo, Mycol. 64: 77 (1972).
*— Ramaria ochracea var. sicco-olivacea R.H. Petersen,
New Zealand DSIR Bull. 236: 98 (1988).
Phaeoclavulina pancaribbea (R.H. Petersen) Giachini, comb. nov.
MycoBank MB512963
BasionyM: Ramaria pancaribbea R.H. Petersen f. pancaribbea, Bibl. Mycol. 79: 88 (1981).
*= Ramaria pancaribbea f. caerulea R.H. Petersen, Bibl. Mycol. 79: 90 (1981).
Phaeoclavulina quercus-ilicis (Schild) Giachini, comb. nov.
MycoBank MB512964
BasionyM: Ramaria quercus-ilicis Schild, Z. Mykol. 64: 53 (1998).
Phaeoclavulina retispora (Corner) Giachini, comb. nov.
MycoBank MB512965
BasionyM: Gomphus retisporus Corner, Ann. Bot. Mem. 2: 124 (1966).
Phaeoclavulina roellinii (Schild) Giachini, comb. nov.
MycoBank MB512966
BastonyM: Ramaria roellinii Schild, Schweiz. Z. Pilzk. 56: 97 (1978).
Phaeoclavulina sikkimia (S.S. Rattan & Khurana) Giachini, comb. nov.
MycoBank MB512967
BasionyM: Ramaria sikkimia S.S. Rattan & Khurana, Bibl. Mycol. 66: 18 (1978).
Gomphus sensu lato reclassified ... 195
Phaeoclavulina subclaviformis (Berk.) Giachini, comb. nov.
MycoBank MB512968
BasionyM: Thelephora subclaviformis Berk., Hooker’s J. Bot. Kew
Gard. Misc. 8: 238 (1856), as “sebclavaeformis”.
Note: ‘The ‘-ae-’ connective is an error, to be replaced with an ‘-i-’ (McNeill et al. 2006:
Art. 60.8).
= Gomphus subclaviformis (Berk.) Corner, Nova Hedwigia
18: 815 (1970), as “subclavaeformis”.
*= Gomphus cavipes Corner, Nova Hedwigia 18: 808 (1970).
Phaeoclavulina tropicalis (R.H. Petersen) Giachini, comb. nov.
MycoBank MB512969
BasionyM: Ramaria tropicalis R.H. Petersen, Bibl. Mycol. 79: 173 (1981).
Phaeoclavulina vinaceipes (Schild) Giachini, comb. nov.
MycoBank MBs512970
Basionym: Ramaria vinaceipes Schild, Z. Mykol. 56(1): 131 (1990).
Phaeoclavulina viridis (Pat.) Giachini, comb. nov.
MycoBank MBs512971
Basionym: Nevrophyllum viride Pat., J. Bot. (Morot) 2: 406 (1888).
= Chlorophyllum viride (Pat.) Murrill, North Amer. Flora 9(3): 172 (1910).
= Chloroneuron viride (Pat.) Murrill, Mycologia 3(1): 25 (1911).
= Gomphus viridis (Pat.) Singer, Lloydia 8: 140 (1945).
*= Cantharellus patouillardii Sacc., Syll. Fung. 9: 65 (1891).
= Merulius patouillardii (Sacc.) Kuntze, Revis. Gen. Pl. 3(2): 494 (1898).
Phaeoclavulina zealandica (R.H. Petersen) Giachini, comb. nov.
MycoBank MB512972
Basionym: Ramaria pancaribbea var. zealandica R.H. Petersen,
New Zealand DSIR Bull. 236: 99 (1988).
Phaeoclavulina zippelii (Lév.) Overeem, Bull. Jard. Bot. Buitenzorg, ser. 3, 5: 276
(1923).
BasionyM: Clavaria zippelii Lév., Ann. Sci. Nat., Bot. sér. 3, 2: 215 (1844).
= Ramaria zippelii (Lév.) Corner f. zippelii, Ann. Bot. Mem. 1: 632 (1950).
*= Merisma guadelupense Lév., Ann. Sci. Nat., Bot. sér. 3, 5: 157 (1846).
= Pterula guadelupensis (Lév.) Sacc., Syll. Fung. 6: 742 (1888).
= Lachnocladium guadelupense (Lév.) Pat., J. Bot. (Morot) 3: 33 (1889).
= Microporus guadelupensis (Lév.) Kuntze, Revis. Gen. Pl. 3(2): 496 (1898).
= Dendrocladium guadelupense (Lév.) Lloyd, Mycol. Writ.
5(Index): 13 (1919), as “guadeloupe”.
= Ramaria guadelupensis (Lév.) Corner, Ann. Bot. Mem. 1: 596 (1950).
= Aphelaria guadelupensis (Lév.) Corner, Beih. Nova Hedwigia 33: 19 (1970).
*= Clavaria nigrescens Fr., Nova Acta Regiae Soc. Sci. Ups., Ser. 3, 1: 116 (1851).
*= Lachnocladium hookeri Berk., Hooker's J. Bot. Kew Gard. Misc. 4: 140 (1852).
= Clavaria thwaitesii Berk. & Broome, J. Linn. Soc., Bot. 14: 75 (1873).
= Clavaria aeruginosa Pat., Bull. Soc. Mycol. Fr. 14: 189 (1898).
= Ramaria zippellii var. aeruginosa (Pat.) R.H. Petersen, Bibl. Mycol. 79: 96. 1981.
196 ... Giachini & Castellano
= Clavaria phaeocladia Pat., Bull. Soc. Mycol. Fr. 14: 189 (1898).
= Lachnocladium albidum Pat., Bull. Soc. Mycol. Fr. 14: 188 (1898).
*= Lachnocladium englerianum Henn., Bot. Jahrb. Syst. 25: 499 (1898).
*= Lachnocladium neglectum Massee, in Wakefield et al.,
Vierteljahrsschr. Naturf. Ges. Ziirich 61: 630 (1916).
Turbinellus Earle, Bull. N. Y. Bot. Gard. 5: 407 (1909).
= Cantharellus sect. Excavatus AH. Sm. & Morse, Mycologia 39: 500 (1947).
= Gomphus sect. Excavatus (A.H. Sm. & Morse) Corner, Ann. Bot. Mem. 2: 113 (1966).
= Gomphus subgen. Excavatus (A.H. Sm. & Morse) R.H. Petersen,
J. Elisha Mitchell Scient. Soc. 84: 381 (1968).
Type species: Cantharellus floccosus Schwein. 1832.
Turbinellus flabellatus (Berk.) Giachini, comb. nov.
MycoBank MB512973
Basionym: Cantharellus flabellatus Berk., J. Linn. Soc., Bot. 16: 50 (1877).
= Merulius flabellatus (Berk.) Kuntze, Revis. Gen. Pl. 3(2): 494 (1898).
= Gomphus flabellatus (Berk.) Corner, Ann. Bot. Mem. 2: 119 (1966).
*= Cantharellus glutinosus Pat., Bull. Soc. Mycol. Fr. 25: 7 (1909).
= Gomphus glutinosus (Pat.) R.H. Petersen, Nova Hedwigia 21: 92 (1972).
Turbinellus floccosus (Schwein.) Earle, Bull. N.Y. Bot. Gard. 5: 407 (1909).
Basionym: Cantharellus floccosus Schwein. f. floccosus,
Trans. Amer. Phil. Soc. 4: 153 (1832).
= Merulius floccosus (Schwein.) Kuntze, Revis. Gen. Pl. 2: 862 (1891).
= Chanterel floccosus (Schwein.) Murrill, N. Amer. Flora 9(3): 168 (1910).
= Gomphus floccosus (Schwein.) Singer f. floccosus, Lloydia 8: 140 (1945).
= Nevrophyllum floccosum (Schwein.) R. Heim, Revue Mycol. 19: 51 (1954).
= Cantharellus canadensis Klotzsch, in Berkeley, Ann. Nat. Hist. 3: 380 (1839).
= Craterellus canadensis (Klotzsch) Sacc., Syll. Fung. 6: 519 (1888).
= Trombetta canadensis (Klotzsch) Kuntze, Revis. Gen. Pl. 2: 873 (1891).
= Gomphus canadensis (Klotzsch) Corner, Ann. Bot. Mem. 2: 116 (1966).
= Cantharellus princeps Berk. & M.A. Curtis, Ann. Mag. Nat. Hist., ser. 3, 4: 293 (1859).
= Merulius princeps (Berk. & M.A. Curtis) Kuntze, Revis. Gen. Pl. 2: 862 (1891).
*= Cantharellus bonarii Morse, Mycologia 22: 219 (1930).
= Gomphus bonarii (Morse) Singer f. bonarii, Lloydia 8: 140 (1945).
*= Cantharellus floccosus f. excavatus A.H. Sm. & Morse, Mycologia 39: 525 (1947).
= Gomphus floccosus f. excavatus (A.H. Sm. & Morse)
Corner, Ann. Bot. Mem. 2: 121 (1966).
*= Cantharellus floccosus f. rainieriensis AH. Sm. & Morse, Mycologia 39: 521 (1947).
= Gomphus floccosus f. rainieriensis (A.H. Sm. & Morse) Corner,
Ann. Bot. Mem. 2: 121 (1966), as “raineriensis”.
= Gomphus floccosus subsp. rainieriensis (A.H. Sm. & Morse)
R.H. Petersen, Nova Hedwigia 21: 48 (1972).
*= Cantharellus floccosus f. wilsonii AH. Sm. & Morse, Mycologia 39: 523 (1947).
= Gomphus floccosus f. wilsonii (A.H. Sm. & Morse)
Corner, Ann. Bot. Mem. 2: 121 (1966).
Gomphus sensu lato reclassified ... 197
= Gomphus bonarii f. wilsonii (A.H. Sm. & Morse) R.H.
Petersen, Nova Hedwigia 21: 37 (1972).
*— Cantharellus wilkinsiae Morse, in Smith & Morse,
Mycologia 39: 528 (1947), as “wilkinsae”.
= Gomphus wilkinsiae (Morse) Corner, Ann. Bot. Mem. 2: 128 (1966), as “wilkinsae”.
= Gomphus bonarii f. wilkinsiae (Morse) R.H. Petersen,
Nova Hedwigia 21: 35 (1972), as “wilkinsae”.
*= Gomphus floccosus f. cystidiophorus R.H. Petersen, J.
Elisha Mitchell Scient. Soc. 84: 376 (1968).
*= Gomphus megasporus Corner, Nova Hedwigia 18: 813 (1970).
*= Gomphus bonarii f. novamexicanus R.H. Petersen, Nova Hedwigia 21: 44 (1972).
*= Gomphus floccosus f. coccineobasalis R.H. Petersen, Nova
Hedwigia 21: 52 (1972), as “coccineo-basalis”.
*= Gomphus floccosus f. olivaceus R.H. Petersen, Nova Hedwigia 21: 54 (1972).
*= Gomphus szechwanensis R.H. Petersen, Nova Hedwigia 21: 102 (1972).
*= Gomphus thiersii R.H. Petersen, Evol. Higher Basidio.: 363 (1971).
Turbinellus fujisanensis (S. Imai) Giachini, comb. nov.
MycoBank MB512974
Basionym: Cantharellus fujisanensis S. Imai, Bot. Mag. Tokyo 55: 519 (1941).
= Nevrophyllum fujisanense (S. Imai) S. Ito, Mycol. Fl.
Japan 2(4): 103 (1955), as “fujisanensis”.
= Gomphus fujisanensis (S. Imai) Parmasto, Ident. URSS Clav.: 28 (1965).
Turbinellus kauffmanii (A.H. Sm.) Giachini, comb. nov.
MycoBank MB512975
BasionymM: Cantharellus kauffmanii A.H. Sm., in Smith
& Morse, Mycologia 39: 516 (1947).
= Gomphus kauffmanii (A.H. Sm.) Corner, Ann. Bot. Mem. 2: 122 (1966).
Turbinellus stereoides (Corner) Giachini, comb. nov.
MycoBank MB512976
BasionyM: Gomphus stereoides Corner, Ann. Bot. Mem. 2: 124 (1966).
*= Gomphus brasiliensis Corner, Nova Hedwigia 18: 807 (1970).
Discussion
Hibbett et al. (1997), Pine et al. (1999), Humpert et al. (2001), Giachini
(2004), and now Giachini et al. (2010) have shown that evolutionarily the
genus Ramaria, long recognized as having morphological features similar to
Gomphus s.1., is closely related to species of that genus. Aside from the overall
evolutionary relationships of Gomphus s.l. and Ramaria, Giachini (2004)
revealed in particular a closer relationship between some species of Gomphus
s.l. and species of Ramaria subgen. Echinoramaria (Giachini et al. 2010: figs.
1-2). Of the genera treated here, Gomphus s.s. and Phaeoclavulina share the
most macro- and microscopic features. Although Phaeoclavulina is mostly
ramarioid, it also includes a few pileate species previously placed in Gomphus s.1.
Both Gomphus s.s. and Phaeoclavulina have uni- and multi-pileate species that
198 ... Giachini & Castellano
present fan- to funnel-shaped, glabrous to subtomentose or floccose-squamose
pilei. Nearly all species have decurrent hymenia with wrinkled hymenial folds,
and all species possess clamp connections.
Gomphus s.s. and Gloeocanthareilus are fairly easily differentiated by
abundance of gleoplerous hyphae and clamp connections: Gomphus s.s. has
ubiquitous clamp connections, whereas these structures are present only
irregularly in Gloeocantharellus. Gloeocantharellus is characterized by abundant
gleoplerous hyphae dispersed among all hyphal tissues, separating it from other
genera in the Gomphaceae.
Turbinellus was proposed by Earle (1909) to accommodate Cantharellus
floccosus. Earle (1909) assigned three species to his genus, all from North
America. Turbinellus species were later transferred to Gomphus (Singer 1945),
then Cantharellus (Smith & Morse 1947), Nevrophyllum (Heim 1954: only
T. floccosus), and finally back to Gomphus (Corner 1966). The taxonomy of its
species has been challenging, primarily to the lack of morphological features
sufficiently reliable to differentiate species, resulting in many nomenclatural
synonyms.
The morphological and genetic sampling of all species, forms, and subspecies
by Giachini (2004), Giachini et al. (2010), and this study support the new
generic circumscriptions reflected here. Many species previously delimited on
morphological grounds have been shown to represent phenotypic variants of
a few well-supported genetic taxa. Genetic data indicate that Gomphus bonarii
and G. floccosus (and all their forms and subspecies) represent phenotypes of
a single species (Giachini et al. 2010). Hence, G. bonarii and G. floccosus (and
all their variants), long thought to be different species but seldom correctly
separated on morphological grounds, are synonymized, with the name
Turbinellus floccosus having priority. Even though Giachini (2004: fig. 3)
presented three clades of bonarii/floccosus species, the overall morphological
similarities (e.g., basidioma morphology, spore size, hyphal arrangement)
combined with the inconsistent arrangement of species/subspecies within and
among each of those clades, imply that those species/subspecies are sufficiently
similar to comprise one single taxon.
The overall conclusions indicate an intricate organization for Gomphus
s.l. and its counterparts. Additional studies, focusing on generic and species
distribution, are undoubtedly necessary.
Acknowledgements
The extensive collecting and laboratory work on the Gomphales was partially supported
by the Forest Mycology Team (US. Forest Service, Pacific Northwest Research Station,
Corvallis, Oregon). The senior author thanks Conselho Nacional de Desenvolvimento
Cientifico e Tecnolégico (CNPq) of the Brazilian Ministry of Education for the doctoral
fellowship. Special thanks to the following herbaria for fungal loans: BPI, BR, CANB,
Gomphus sensu lato reclassified ... 199
CUP, DAOM, DAR, F, FH, GH, H, K, L, LPS, M, MICH, NCU, NY, NYS, OULU, OSA,
OSC, PC, PDD, PERTH, PH, S, SFSU, TENN, TNS, UC, UPS, WTU, and ZT. Dr. Richard
Halse provided unconditional assistance on herbarium loans. Special thanks to Matthew
E. Smith and Matthew J. Trappe for presubmission review and Shaun R. Pennycook and
James M. Trappe for nomenclatural assistance.
Literature cited
Agerer R, Beenken L, Christian J. 1998. Gomphus clavatus (Pers.: Fr.) S. F. Gray + Picea abies (L.)
Karst. In R Agerer et al. (eds), Descriptions of Ectomycorrhizae 3: 25-29.
Berkeley MJ. 1839. Descriptions of exotic fungi in the collection of Sir W. Hooker, from memoirs
and notes of J.F. Klotzsch, with additions and corrections. The Annals of Natural History 3:
375-401.
Berkeley MJ, Curtis MA. 1859. New species of North American fungi. XXXI — Centuries of North
American fungi. The Annals and Magazine of Natural History, series 3, 4: 284-296.
Bulakh EM. 1978. Macromitsety pikhtavo-elovykh lesov. In DF Efremov, TA Komarova, VA
Rosenberg (eds), Biotsenotycheskiye Issledovaniya na Berkhneussuriyskom Statsionare.
Academiya Nauk SSSR Dalnevostochnyi Nauchnyi Tsentr Biologo-Pochvenniy Institut,
Vladivostok. Pp. 73-81.
Bulakh EM, Govorova OK. 2000. Rare and new for Russia Basidiomycetes from Primorsky territory.
Mycology and Phytopathology 34: 21-25.
Corner EJH. 1950. A monograph of Clavaria and allied genera. Annals of Botany Memoir 1:
1-740.
Corner EJH. 1966. A monograph of the cantharelloid fungi. Annals of Botany Memoir 2: 1-255.
Corner EJH. 1970 [“1969”]. Notes on cantharelloid fungi. Nova Hedwigia 18: 783-818.
Dahlberg A, Croneborg H. 2003. 33 threatened fungi in Europe: complementary and revised
information on candidates for listing in appendix I of the Bern convention. http://www.coe.
int/T/E/Cultural_Cooperation/Environment/Nature_and_biological_diversity/Nature_
protection/sc21_34erev_introduction.pdf¢L=E.
Doassans MME, Patouillard NT. 1886. Champignons du Béarn (2° liste). Revue Mycologique 8(29):
25-28. (Reprint from ‘Collected Mycological papers’ chronologically arranged and edited by L.
Vogelenzang, Librarian Rijksherbarium, Leiden, Amsterdan, vols. 1-3, 1978).
Donk MA. 1933. Revision der Niederlandischen Homobasidiomycetae—Aphyllophoraceae, Teil II.
Mededeelingen van de Nederlandsche Mycologische Vereeniging. 22: 1-278.
Donk MA. 1941. Nomina generica conservanda and confusa for Basidiomycetes (Fungi). Bulletin of
the Botanic Gardens Buitenzorg, series 3, 17: 155-197.
Donk MA. 1949a. New and revised nomina generica conservanda proposed for Basidiomycetes
(Fungi). Bulletin of the Botanic Gardens Buitenzorg, series 3, 18: 83-168.
Donk MA. 1949b. Nomenclatural notes on generic names of agarics (Fungi: Agaricales). Bulletin of
the Botanic Gardens Buitenzorg, series 3, 18: 271-402.
Donk MA. 1961. Four new families of Hymenomycetes. Persoonia 1: 405-407.
Earle FS. 1909. The genera of the North American gill fungi. Bulletin of the New York Botanical
Garden 5: 373-462.
Fries EM. 1821. Systema mycologicum, vol. 1. Lund.
Fries EM. 1825. Systema Orbis Vegetabilis. Lund.
Fries EM. 1838. Epicrisis Systema Mycologicum. Uppsala.
Giachini AJ. 2004. Systematics, Phylogeny, and Ecology of Gomphus sensu lato. Ph.D. Dissertation,
Oregon State University. Corvallis.
200 ... Giachini & Castellano
Giachini AJ, Hosaka K, Nouhra ER, Spatafora JW, Trappe JM. 2010. Phylogenetic relationships
of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA and mit-atp6-DNA combined
sequences. Fungal Biology 114: 224-234. doi:10.1016/j.funbio.2010.01.002
Gray SF. 1821. A Natural Arrangement of British plants, vol. 1. London.
Guzman G, Villarreal L. 1985. Estudios sobre los hongos, liquenes y mixomicetos del Cofre de
Perote, Veracruz, I: Introduccion a la mico-flora de la region. Boletin de la Sociedad Mexicana
de Micologia 19: 107-124.
Heim R. 1954. A propos de trois Chanterelles Américaines. Revue Mycologique 19: 47-56.
Hibbett DS, Pine EM, Langer E, Langer G, Donoghue MJ. 1997. Evolution of gilled mushrooms
and puftballs inferred from ribosomal DNA sequences. Proceedings of the National Academy
of Science U.S.A. 94: 12002-12006. doi:10.1073/pnas.94.22.12002
Hosaka K, Bates ST, Beever RE, Castellano MA, Colgan III W, Dominguez LS, Nouhra ER, Geml J,
Giachini AJ, Kenney SR, Simpson NB, Spatafora JW, Trappe JM. 2006. Molecular phylogenetics
of the gomphoid-phalloid fungi with an establishment of the new subclass Phallomycetidae and
two new orders. Mycologia 98(6): 949-959. doi:10.3852/mycologia.98.6.949
Humpert AJ, Muench EL, Giachini AJ, Castellano MA, Spatafora JW. 2001. Molecular
phylogenetics of Ramaria (Gomphales) and related genera:evidence from nuclear large
subunit and mitochondrial small subunit rDNA sequences. Mycologia 93(3): 465-477.
doi: 10.2307/3761733
Jiilich W. 1981. Higher taxa of Basidiomycetes. J. Cramer, Germany.
Khokhryakov MK. 1956. Mycorrhiza. In MV Gorlenko and IV Voronkevich (eds). (Griby—Druziya
I vragi cheloveka) Sovyetskaya Nauka, Moscow. Pp. 178-181.
Kluzak Z. 1994. Gomphus clavatus, a seriously endangered species in the Czech Republic. Zeitschrift
fiir Mykologie 60: 113-116.
Kropp BR, Trappe JM. 1982. Ectomycorrhizal fungi of Tsuga heterophylla. Mycologia 74(3):
479-488. doi:10.2307/3792970
Masui K. 1926. A study of the mycorrhiza of Abies firma, S. et Z., with special reference to its
mycorrhizal fungus, Cantharellus floccosus, Schw. Memoirs of the College of Science, Kyoto
Imperial University. Series B, vol. 2(1), Article 2: 1-84.
Masui K. 1927. A study of the ectotrophic mycorrhizas of woody plants. Memoirs of the College of
Science, Kyoto Imperial University. Series B, vol. 3: 149-279.
McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH, Prado
J, Silva PC, Skog JE, Wiersema JH, Turland NJ (eds). 2006. International Code of Botanical
Nomenclature (Vienna Code). Adopted by the Seventeenth International Botanical Congress,
Vienna, Austria, July 2005. Regnum Vegetabile 146. 568 p. (http://ibot.sav.sk/icbn/main.htm)
Pantidou ME. 1980. Macrofungi in forests of Abies cephalonica in Greece. Nova Hedwigia 32:
709-723.
Peck CH. 1887. New York species of Cantharellus. Bulletin of the New York State Museum of
Natural History 1(2): 34-43.
Persoon CH. 1796. Observationes mycologicae seu descriptiones tam novorum quam notabilium
fungorum exhibitae, vol. 1. Leipzig (Reprint 1967, New York).
Persoon CH. 1797a. Tentamen dispositionis methodicae fungorum in classes, ordines, genera et
familias. Leipzig.
Persoon CH. 1797b. Commentatio de fungis clavaeformibus sistens specierum hus usque notarum
descriptiones cum differentiis specificis. Leipzig.
Persoon CH. 1801. Synopsis methodica fungorum. Gottingen.
Persoon CH. 1825. Mycologia europeae, seu completa omnium fungorum in variis Europaeae
regionibus detectorum enumeratio, methodo naturali disposita, vol. 2. Erlangen.
Gomphus sensu lato reclassified ... 201
Petersen RH. 1967. Evidence on the interrelationships of the families of clavarioid fungi. Transactions
of the British Mycological Society 50: 641-648. doi:10.1016/S0007-1536(67)80096-2
Petersen RH. 1968. Notes on cantharelloid fungi. 1. Gomphus S. F. Gray and some clues to the origin
of the ramarioid fungi. The Journal of the Elisha Mitchell Scientific Society 84: 373-381.
Petersen RH. 1969. Notes on cantharelloid fungi. II. Some new taxa, and notes on Pseudocraterellus.
Persoonia 5(3): 211-223.
Petersen RH. 1971. The genera Gomphus and Gloeocantharellus in North America. Nova Hedwigia
21: 1-118. 1970.
Petersen RH. 1972 [“1971”]. Interfamilial relationships in the clavarioid and cantharelloid fungi.
In RH Petersen (ed.). Evolution in the higher Basidiomycetes. University of Tennessee Press,
Knoxville. Pp. 345-374.
Pine EM, Hibbett DS, Donoghue MJ. 1999. Phylogenetic relationships of cantharelloid and clavarioid
Homobasidiomycetes based on mitochondrial and nuclear rDNA sequences. Mycologia 91(6):
944-963. doi:10.2307/3761626
Schweinitz LD. 1832. Synopsis fungorum in America boreali media degentium. Article VIII.
Transactions of the American Philosophical Society 4: 141-316. doi:10.2307/1004834
Singer R. 1945. New genera of fungi. Lloydia 8: 139-144.
Smith AH, Morse EE. 1947. The genus Cantharellus in the western United States. Mycologia 39:
497-534. doi:10.2307/3755192
Trappe JM. 1960. Some probable mycorrhizal associations in the Pacific Northwest. II. Northwest
Science 34(4): 113-117.
Urbonas VA, Matyalis AA, Gritsyus AI. 1990. Trends of variability of macromycetes, extinguishing
species and principles of their protection in Lithuania. Mycology and Phytopathology 24:
385-388.
USDA/USDI [U.S.D.A. Forest Service; U.S.D.I. Bureau of Land Management]. 1994. Final
supplemental environmental impact statement on management of habitat for late-successional
and old-growth forest related species within the range of the northern spotted owl (Northwest
Forest Plan). Portland, OR.
Valdés-Ramirez M. 1972. Microflora of a coniferous forest of the Mexican basin. Plant and Soil 36:
31-38. doi:10.1007/BF01373453
Voss EG, Burdet HM, Chaloner WG, Demoulin V, Hiepko P, McNeill J, Meikle RD, Nicolson
DH, Rollins RC, Silva PC, Greuter W. 1983. International Code of Botanical Nomenclature.
Adopted by the Thirteenth International Botanical Congress, Sydney, August 1981. Regnum
Vegatabile 111. 472 p.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 203-213 January-March 2011
DOT: 10.5248/115.203
New records of Uredinales from Fairy Meadows, Pakistan
N.S. AFSHAN”, A.N. KHALID™, A.R. Nrazr? & S.H. IQBAL?
Centre for Undergraduate Studies & *Department of Botany,
University of the Punjab, Quaid-e-Azam Campus, Lahore, 54590, Pakistan
CORRESPONDENCE TO *:
[email protected], *drankhalid@gmailcom, *
[email protected]
ABSTRACT— Puccinia pygmaea var. angusta and P. urticata var. urticata were collected in
Fairy Meadows and are new records for Pakistan. Similarly the aecidial stages of Uromyces
hedysari-obscuri and U. polygoni-avicularis are an addition to the rust flora of this country.
Puccinia alpina, P. leveillei, and P. ribis are redescribed and illustrated from Fairy Meadows.
Key worps — Bistorta vivipara, Nanga Parbat
Introduction
Fairy Meadows in Northern Pakistan is a floristically rich area, from which
about 70 species of rust fungi have been reported (Afshan et al. 2009). During
several extensive surveys of the region, seven plants infected with rust fungi
were collected. Among these, Puccinia pygmaea var. angusta on Calamagrostis
epigejos and P. urticata var. urticata on Carex flacca are new records for Pakistan.
‘The aecidial stages (1) of Uromyces hedysari-obscuri and U. polygoni-avicularis
are also here described as an addition to the rust flora of Pakistan. Puccinia
alpina, P. leveillei, and P. ribis, which represent new records for Fairy Meadows,
are re-described to illustrate important morphological features using scanning
electron microscopy.
Materials & methods
Freehand sections of infected tissue and spores were mounted in lactophenol and
gently heated to boiling. The preparations were observed under a NIKON YS 100
microscope and photographed with a digipro-Labomed and JSM5910 scanning electron
microscope. Drawings of spores and paraphyses were made using a Camera Lucida
(Ernst Leitz Wetzlar, Germany). Spore dimensions were taken by an ocular micrometer.
At least 25 spores were measured for each spore stage. Images were also obtained of the
rust spores using a scanning electron microscope (SEM). The rusted specimens have
been deposited in the herbarium of the Botany Department at the University of the
Punjab, Lahore (LAH).
204 ... Afshan & al.
Taxonomy
Puccinia pygmaea var. angusta Cummins & H.C. Greene, Mycologia 58: 715
(1966). Fic. 1
SPERMOGONIA and AECIA not found. UREDINIA amphigenous, mostly on adaxial
surface, pale brown to golden brown, 0.09-0.3 x 0.1-0.4 mm. UREDINIOSPORES
ellipsoid to broadly ellipsoid or ovoid, 21-25 x 25-29 um; wall 1.5-2 wm
thick, pale yellow to pale brown, echinulate; germ pores obscure, 4-6(-8),
scattered. PARAPHYSES clavate to capitate, peripheral to intermixed, hyaline to
pale brown, 14-18 um wide, to 80 wm long. TELIA amphigenous, covered by
epidermis, dark brown to blackish brown, loculate, 0.09-0.4 x 0.2-0.6 mm.
TELIOSPORES 1-2 celled, clavate or ellipsoid; wall 1.5-2 um thick, cinnamon
brown to chestnut brown, smooth; 15-23 x 42-58 um (mean 16.6 x 47.5 um);
apex mostly truncate, sometimes rounded to conical, 4-6(-7) um thick; germ
pore obscure; pedicel hyaline to pale brown, 5-7 x 8-15 um, one-celled spores
abundant.
B ;
Fic. 1. Lucida drawings of Puccinia pygmaea var. angusta.
(A) Urediniospores and paraphyses. (B) 1-2 celled teliospores. Scale bar = 10 um.
Uredinales new to Fairy Meadows (Pakistan) ... 205
MATERIAL EXAMINED: On Calamagrostis epigejos (L.) Roth (Poaceae), with II and II
stages, Pakistan, Northern Areas, Fairy Meadows, 3036 m, 12 Aug 2007, N.S.Afshan #G
90. (LAH Herbarium NSA 1083).
COMMENTS: Six varieties of P. pygmaea are recognized based on spore size:
P. pygmaea var. ammophilina (Mains) Cummins & H.C. Greene, P pygmaea var.
angusta, P. pygmaea var. chisosana Cummins, P. pygmaea var. major Cummins
& H.C. Greene, P. pygmaea var. minor Cummins & H.C. Greene, and P. pygmaea
Erikss. var. pygmaea (Cummins 1971).
Ahmad (1956a, b) reported P pygmaea on Agrostis munroana Aitch. &
Hemsl. from Kaghan valley, and Afshan & Khalid (2009) reported P. pygmaea
var. pygmaea on Agrostis gigantea Roth from Bara Gali (NWEP). The variety
P. pygmaea var. angusta is a new record for Pakistan.
K—
Fic. 2. Lucida drawings of Puccinia urticata var. urticata.
(A) Urediniospores. (B) Teliospores. Scale bar = 10 tum.
Puccinia urticata F. Kern, Mycologia 9: 214 (1917) var. urticata Fic. 2
SPERMOGONIA and AECIA unknown. UREDINIA mostly hypophyllous, sometimes
amphigenous, on leaves and culms, intermixed with telia. UREDINIOSPORES
ovoid to obovoid or ellipsoid to broadly ellipsoid, 18-24 x 23-31 tm (mean
22.0 x 27.6 um); wall 1.5-2 um thick, pale brown to cinnamon brown, finely
and sparsely echinulate; germ pores 2-4, equatorial; pedicel hyaline, short.
TELIA mostly hypophyllous, rarely amphigenous, intermixed with uredinia,
dark brown to blackish brown, covered by epidermis, 0.1-0.3 x 0.2-0.5 mm.
TELIOSPORES clavate to broadly clavate or oblong, not or slightly constricted
at septum, 14-24 x (38-)42-71 tum (mean 19.2 x 52.5 um); wall 2-3 um thick,
golden brown to chestnut brown, smooth; apex mostly rounded, 9-15 um
206 ... Afshan & al.
thick; germ pores obscure; pedicel hyaline to pale brown, thin walled, 7-10 um
wide and up to 100 um long.
MATERIAL EXAMINED: On Carex flacca Schreb. (Cyperaceae), with II and III stages,
Pakistan, Northern Areas of Pakistan, Fairy meadows, 3036 m, 12 Aug 2007, N.S.Afshan
#74. (LAH Herbarium NSA 1098).
Puccinia urticata var. urticata is a new record for Pakistan.
Fic. 3. Uromyces hedysari-obscuri. (A) Aecium containing aeciospores (B) SEM photograph of an
aecium. (C) Aeciospores with peridial cells. (D) Aeciospores showing verrucose wall ornamentation.
(E) SEM photograph of teliospores. (F) Teliospores showing verrucose wall ornamentation. Scale
bar for E = 0.1 mm.
Uredinales new to Fairy Meadows (Pakistan) ... 207
Uromyces hedysari-obscuri (DC.) Carestia & Picc., in Orbigny, Erb. critt. Ital., Ser.
2, 9: no. 447 (1871). Fras. 3-4
SPERMOGONIA not known. AEcIA mostly caulicolous, gregarious, in rounded
groups. AECIOsPoRES angular to globose, verrucose, hyaline with a yellowish
tinge, 16-21 x 20-24 um; peridial cells hyaline to pale yellow, angular to
rectangular, verrucose, 20-24 x 23-31 um. TELIA amphigenous, mostly
epiphyllous, scattered or gregarious, small, roundish, early naked, surrounded
by aruptured epidermis, dark brown to blackish brown. TELIosporgs globose,
oblong or ellipsoid; 16-19 x 20-29 um; apex rounded, with light colored papilla,
3-6 um thick; wall 1.5-2.5 um thick, dark brown to chestnut brown, verrucose;
germ pores 2, equatorial; pedicel hyaline, short, deciduous, 6-7 x 14-16 um.
MATERIAL EXAMINED: On Hedysarum falconeri Baker (Fabaceae), with I & III stages,
Pakistan, Northern Areas, Fairy Meadows, 3036 m, 125 Aug 2007. N.S.Afshan #G16.
(LAH Herbarium NSA 1006).
The teliospore stage of Uromyces hedysari-obscuri has been reported on the
same host from Fairy Meadows (Sultan 2005). The aecidial stage (1) of this
fungus, which is described here for the first time from Pakistan, is an addition
to our rust flora.
Fic. 4. Lucida drawings of Uromyces hedysari-obscuri.
(A) Aeciospores showing verrucose wall ornamentation. (B) Peridial cells.
(C) Teliospores showing verrucose wall ornamentation.
Scale bar for A = 5 um, B & C = 10 um.
208 ... Afshan & al.
Fic. 5. Lucida drawings of Uromyces polygoni-avicularis.
(A) Peridial cells. (B) Aeciospores. (C) Urediniospores showing germ pores.
(D) Teliospores. Scale bar = 10 um.
Uromyces polygoni-avicularis (Pers.) P. Karst., Bidr. Kann. Finl. Nat. Folk 4: 12
(1879), as ‘polygoni aviculariae. Fics. 5-6
AscIA hypophyllous, minute, in circular or irregular shaped groups, orange,
cupulate. AEcIosPoREs globose to ellipsoid, verrucose, hyaline to yellow with
orange granules, 15-22 x 18-24 um; peridial cells rhomboid, hyaline to pale
yellow, striate, verrucose, 17-24 x 23-29 um. UREDINIA amphigenous, scattered
or gregarious, minute, roundish, brown to cinnamon brown, 0.09-0.3 x 0.2-0.8
mm. UREDINIOSPORES globose to subglobose or ellipsoid, 18-24 x 20-29 um;
wall 1.5-3.0 um thick, golden brown to cinnamon brown, verruculose; germ
pores 2-4, equatorial. TELIA amphigenous, small, scattered or gregarious, on
leaves and stem, roundish or oblong, blackish brown, 0.1-0.5 x 0.2-0.8 mm.
TELIOSPORES subglobose, ovate or ellipsoid, 18-24 x 22-31(-35) wm; apex
rounded or truncate, 4-6 tm thick; wall 2-3 wm thick, smooth, golden brown
to chestnut brown; germ pore, apical or sub-apical; pedicel hyaline to pale
yellow, persistent, 8-10 x 90-104 um.
MATERIAL EXAMINED: On Bistorta vivipara (L.) Delarbre (Polygonaceae), with II &
III stages, Pakistan, Northern Areas, Bial camp (Nanga Parbat base camp), 11 Aug
2007. N.S.Afshan #G10. (LAH Herbarium NSA 1008). On Polygonum aviculare L.
Uredinales new to Fairy Meadows (Pakistan) ... 209
Fic. 6. Uromyces polygoni-avicularis. (A) SEM photograph of an aecium. (B) An aeciospore showing
verrucose wall ornamentation. (C) SEM photograph of a uredinial sorus. (D) SEM photograph of a
urediniospore showing verrucose wall ornamentation. (E) SEM photograph of a telium containing
teliospores. (F) Teliospores.
(Polygonaceae), with I & III stages, Pakistan, Northern Areas, Fairy Meadows, 3036 m,
12 Aug 2007. N.S.Afshan #G02. (LAH Herbarium NSA 1007)
The uredinial and telial stages of Uromyces polygoni-avicularis were previously
reported on Polygonum aviculare from Kaghan and Quetta valleys and on
Bistorta vivipara (as P. viviparum L.) from Hazara, Madian, and Swat (Ahmad
et al. 1997). The aecidial stage represents a new record for Pakistan
210 ... Afshan & al.
Fic. 7. A-B. Puccinia alpina. (A) SEM photograph of telium showing teliospores. (B) Teliospores
showing striately verrucose wall ornamentation. C—D: Puccinia leveillei. (C) SEM photograph of a
telium (D) Teliospores showing verrucose wall ornamentation.
Puccinia alpina Fuckel, Jahrb. Nassauischen Vereins Naturk. 27-28: 13 (1873).
Fre. 7A-B, 8A
SPERMOGONIA, AECIA and UREDINIA unknown. TELIA hypophyllous, scattered
or loosely clustered, small roundish, soon naked, pulvinate, dark brown to
blackish brown, 0.08-0.1 x 0.2-0.8 mm. TELrosporss ellipsoid to oblong or
clavate, rounded at both ends or sometimes attenuated downwards, not or
slightly constricted at septum, base roundish or narrowed, 16-26 x (25-)31-50
um; wall 1.5-2 um thick, verrucose, golden brown to chestnut brown; apex
3-5 «um thick, pale in color; germ pore 1 per cell, germ pore of both cells near
septum or sometimes apical cell, with hyaline umbo over each pore; pedicel
hyaline, deciduous, up to 25 um long and 5-6 um wide.
MATERIAL EXAMINED: On Viola biflora L. (Violaceae), with III stage, Pakistan, Northern
Areas, Fairy Meadows, 3036 m, 12 Aug 2007. N.S.Afshan #G 08. (LAH Herbarium NSA
1005).
Ono (1992) previously reported Puccinia alpina on Viola rupestris FW. Schmidt
from Kaghan valley. The above collection is a new record for Fairy Meadows.
Uredinales new to Fairy Meadows (Pakistan) ... 211
B
Fic. 8. (A) Lucida drawing of teliospores of Puccinia alpina.
(B) Lucida drawing of teliospores of Puccinia leveillei.
Scale bars = 10 um.
Puccinia leveillei Mont., in Gay, Hist. Fis. Polit. Chile 8: 41 (1852). Fic. 7C-D, 8B
= P geranii-sylvatici P. Karst., Enum. Fung. Lapponia: 220 (1866).
SPERMOGONIA, AECIA and UREDINIA unknown. TELIA mostly amphigenous,
0,2-0.4 x 0.2-0.6 mm, dark brown. TELIOsPoREs mostly two-celled, sometimes
three-celled; ellipsoid to clavate, not or slightly constricted at septa, 14-23 x
30-44(-47) um; wall 2-3 wm thick, densely verrucose, brown to chestnut
brown; apex rounded or truncate, 4-5 um thick; germ pore of upper cell mostly
apical, sometimes sub-apical, of lower cell near pedicel; pedicel short, hyaline,
8-9 x 10-15 um.
MATERIAL EXAMINED: On Geranium sibiricum L. (Geraniaceae), with III stage, Pakistan,
Northern Areas, Fairy Meadows, Bial camp (Nanga Parbat base camp) 3036 m, 12 Aug
2007. N.S.Afshan # G13. (LAH Herbarium NSA 1010).
212 ... Afshan & al.
Ahmad 1956a reported P leveillei on Geranium pratense L., G. collinum Stephan
ex Willd., G. rectum Trautv., and G. eglandulosum Dalla Torre from Kaghan,
Kalam, Baltistan, and Barum valleys. This above collection represents a new
record from Fairy Meadows (Bial camp); Geranium sibiricum is a new host
species in Pakistan.
Fic. 9. Lucida drawing of Puccinia ribis.
1-2 celled teliospores showing verrucose wall ornamentation. Scale bar = 10 um.
Puccinia ribis DC., FI. frang., 3e Ed., 2: 221 (1805). Fic. 9
SPERMOGONIA unknown, AECIA and UREDINIA absent. TELIA epiphyllous,
surrounded by a discolored yellow zone, circinate, pulverulent, 0.9-3 x 3-5
mm, chestnut brown. TELIospoREs ovoid or oblong to ellipsoid, rounded
above and below, hardly constricted, 15-24 x 20-35 wm; wall 1.5-2.5 um thick
at sides and 4-5 um thick at apex, verrucose, chestnut brown; germ pores
1 per cell, apical in upper cell with a hyaline papilla, pore of lower cell usually
basal; pedicels hyaline, deciduous, 4-5 x 18-25 um. A few one-celled spores
also observed.
MATERIAL EXAMINED: On Ribes nigrum L. (Grossulariaceae), with III stage, Pakistan,
Northern Areas, Fairy Meadows, 3036 m, 12" Aug 2007. N.S. Afshan # G14. (LAH
Herbarium NSA 1011).
Ahmad 1956a reported P. ribis on Ribes rubrum L. from Swat, Kalam, and
Hazara. Our collection represents a new record from Fairy Meadows.
Acknowledgements
We sincerely thank Dr. Amy Rossman, Systematic Mycology and Microbiology
Laboratory, USDA-ARS, Beltsville, and Omar Paino Perdomo, Dominican Mycological
Society, Santo Domingo, for their valuable suggestions to improve the manuscript and
acting as presubmission reviewers. We are thankful to Dr. Asim Sultan for help in the
field. We are highly obliged to Higher Education Commission (HEC) of Pakistan for
providing financial support.
Uredinales new to Fairy Meadows (Pakistan) ... 213
Literature cited
Afshan NS, Khalid AN. 2009. New records of Puccinia and Pucciniastrum from Pakistan. Mycotaxon
108: 137-146.
Afshan NS, Khalid AN, Iqbal SH, Niazi AR, Sultan A. 2009. Puccinia subepidermalis sp. nov. and
new records of rust fungi from Fairy Meadows, Northern Pakistan. Mycotaxon 110: 173-182.
Ahmad S. 1956a. Uredinales of West Pakistan. Biologia 2: 29-101.
Ahmad S. 1956b. Fungi of Pakistan. Biological Society of Pakistan, Lahore Monograph 1: 1-126.
Ahmad §, Iqbal SH, Khalid AN. 1997. Fungi of Pakistan. Nabiza Printing Press, Karachi, Pakistan.
Cummins GB. 1971. The rust fungi of cereals, grasses and bamboos. Springer Verlag, Berlin-
Heidelberg—New York.
Ono Y. 1992. Uredinales collected in the Kaghan Valley, Pakistan. Cryptogamic Flora of Pakistan
1: 217-240.
Sultan MA. 2005. Taxonomic study of rust flora of Northern Areas of Pakistan. Ph.D. Thesis,
University of the Punjab. Lahore, Pakistan.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 215-226 January-March 2011
DOT: 10.5248/115.215
Observations on Melanoleuca. Type studies - 3
ROBERTO FONTENLA’* & ROBERTO PARA ”
1 Via Monte Marino, 26 - I 60125 Ancona, Italy
? Via Martiri di via Fani, 22 - 1 61024 Mombaroccio (PU), Italy
CORRESPONDENCE TO *:
[email protected]
AssTRACT — The results of type studies on several taxa of the genus Melanoleuca are reported
and discussed: Melanoleuca substrictipes, M. polioleuca, M. alutaceopallens, M. permixta, M.
wrightii, M. lapataiae, and M. lapataiae var. ochroleuca. For the first two taxa a lectotype and
a neotype are designated respectively.
Key worps — taxonomy, Tricholomatales
Introduction
Type materials of sixteen critical Melanoleuca taxa have already been
discussed in two previous publications (Fontenla & Para 2007, 2008). Fontenla
& Para (2007) reported on M. diverticulata G. Moreno & Bon, M. electropoda
Maire & Malencon, M. kavinae (Pilat & Vesely) Singer, M. meridionalis
G. Moreno & Barrasa, M. metrodii Bon, M. nigrescens (Bres.) Bon, and
M. pseudobrevipes Bon. Fontenla & Para (2008) discussed Melanoleuca decembris
Métrod ex Bon, Tricholoma humile var. bulbosum Peck, M. luteolosperma
(Britzelm.) Singer, Clitocybe nobilis Peck, M. pseudopaedida Bon, M. decembris
var. pseudorasilis Bon, M. subalpina (Britzelm.) Bresinsky & Stangl, M. subdura
(Banning & Peck) Murrill, and M. tucumanensis Singer.
In this paper we hope to shed new light on seven more taxonomically critical
taxa and designate one lectotype and two neotypes to clarify relationships of
the three taxa to their closest allies.
Materials & methods
Microscopical characters were examined using a Leitz Biomed optical microscope
equipped with 100x, 500x and 1000x lenses; a stereomicroscope mod. MbC-10 was
used to make thin sections. The pileipellis was sectioned from radial sections of the
pileus margins, and the stipitipellis was sectioned from longitudinal sections of the
medial third of the stipe. Sections were routinely revived in L4, stained in Phloxine B,
216 ... Fontenla & Para
and tested for amyloidity in Melzer’s. Micrographs were made using a Nikon Coolpix
4500 digital camera. Throughout all text, citations in quotes (“..”) comes from the
original protologues (even if incorrect), except that the en-dash (—) is substituted to
separate data.
The systematic framework adopted follows Bon (1991) with some personal
changes.
Taxonomy
Melanoleuca substrictipes Kubner, Bull. Soc. Linn. Lyon 47(1): 52. 1978. Fic. 1
ORIGINAL DIAGNosIs: Pileus 25-105 mm latus, carnosulus, e convexo expansus, saepe
obtuse umbonatus, jove pluvio albus vel eburneolo albus, sed mox albus, demum saepe
alutaceus vel subisabellinus. Stipes 17-80 mm altus, 4-14 mm crassus, subaequalis,
albus, glaber, apice subtiliter pruinosus, solidus vel farctus. Lamellae confertae, plus
minusve sinuatae vel emarginatae, albidae. Odore spermatico. Sporae 8-10 x 5-6.5 um,
ellipsoideae, modice elongatae, asperulae. Cystidiae fusoideae-subcuspidatae, angustae,
inferne 5-9 um, superne 2-3 um latae, septatae. In pascuis alpinis, frequens. Typus Herb.
Kiihner, n° 66-13.
SPECIMEN STUDIED — “Herbier R. Kthner (G) — Melanoleuca substrictipes R. Kiuhner
— F - Savoie — Parc Nat. de la Vanoise, environs de Pralognan — Entre le Pas de LAne
et le Cirque des Nants — Alt.: 1900 — « K 66-13 » — Leg./Det. : R. Ktthner — 20-07-1966”
lectotypus, hic designatus. [G, Conservatoire et Jardin botaniques de la ville de Genéve,
GENEVA, Switzerland]. Revision date: 26 August 2008.
(MACROCHARACTERS, see Ktihner 1978: 46-49).
MICROCHARACTERS —Basidiospores 7.2-9.6 x 4.8-6.0 tum; av. = 8.60 x 5.55
uum; Q = 1.35-1.75; Qm = 1.55; ellipsoid, with small, dense, isolate and rounded
warts, without a suprahilar plage. Basidia 31-33 x 7-8 um, clavate, 4-spored.
Cheilocystidia 45-55 x 6-8 um, rare, urticiform, with a thin wall, hyaline,
sometimes with incrusted apex. Pleurocystidia not seen. Stipitipellis made up
of long, narrow hyphae, intermixed with shorter ones constricted at septa, with
scattered short, clavate or cylindroid cells, not in clusters; caulocystidia not
seen. Pileipellis a cutis of interwoven hyphae, without emergent elements, with
a thin gelatinized suprapellis. Dermatocystidia and thromboplerous hyphae
absent. Clamp connections absent.
COMMENTS - The authentic material kept in Geneva (G) is subdivided into
two portions. “Pr. 66-13” is composed of fragments of several pilei and stipes
and is difficult to study; “66-13 lot B” consists of basidiomata sections, all in
good state. Each part is accompanied by various barely legible hand-written
notes, interpreted for us by Pierre Arthur Moreau: Envelope 66-13 (Fic. 1)
— “Melanoleuca Pr.66-13 (Pr is for Pralognan, the name of the locality in the
Vanoise National Park), 20 July 1966, 17 carpophores (remarquable qualité !)
Odeur vite aigrelette bolétoide” Envelope 66-13 lot B— “Melanoleuca Pr 66.13,
lot B, 3 exemplaires. 20 July 1966. Sirement pas spermatique en coupe!”
Type studies of Melanoleuca ... 217
Figure 1. Melanoleuca substrictipes. 66-13 envelope (lectotypus).
However, it seems clear that the two parts represent two different collections
made the same day - 20 July 1966 - and that Kthner decided to separate them
due to differences in appearance and odor. In Pr. 66-13, we observed urticoid
(fusoid) cystidia, as reported in the protologue, while in 66-13 “lot B’, we noted
numerous fusoid macrocystidia, very different from those in the Pr. 66-13
basidiomata.
The indication of the “aigrelette boletoide” odor for Pr. 66-13 matches the
protologue description (Kithner 1978: 370), while the “lot B” spermatic odor
(“stirement pas spermatique”) contradicts “souvent distinctement spermatique
apres la coupure” noted in the protologue.
Based on ICBN Arts. 9.9 and 9.12 (McNeill et al. 2006), we here designate
the portion of the original material marked Pr. 66-13 as lectotype of M.
substrictipes, since the protologue is also based on this material and it fits the
protologue very well.
Melanoleuca favrei Bon is a closely related species with longer spores (Qm =
1.71, as confirmed by our type study).
Other similar European species are M. substrictipes var. sarcophylla Kihner
and M. pseudoevenosa Bon ex Bon & G. Moreno, which have ochraceous gills
at maturity and spore ratios of Qm = 1.56 and 1.72, respectively. Comparable
extraeuropean species are M. conspurcata (Berk. & Broome) Pegler and M.
tropicalis Pegler, which our type studies showed to have spore ratios of Qm
= 1.48 and 1.65, respectively. We need more data to confirm whether these
differences are taxonomically significant.
218 ... Fontenla & Para
Melanoleuca alutaceopallens (P. Karst.) Konrad & Maubl., Icon. Select. Fung.
6(10): 324. 1937.
= Tricholoma melaleucum var. alutaceopallens P. Karst.,
Medd. Soc. F. Fl. Fenn. 9: 40. 1882.
= Tricholoma melaleucum subsp. alutaceopallens (P. Karst.) Sacc.., Syll. Fung. 5: 135. 1887.
= Tricholoma alutaceopallens (P. Karst.) P. Karst., Medd.
Soc. E. Fl. Fenn. 16: 85. 1890 (“1889”).
ORIGINAL DIAGNOSIS: Pileus carnosus, mollis, econvexo planus, obsolete umbonatus, laevis,
glaber, alutaceopallens, vix hygrophanus, circ. 7 cm. latus. Stipes farctus, rigidofragilis,
strictus, aequalis, basi incrassatus, primitus squamutloso-fibrillosus, glabrescens, apice
pruinosus, albidus, demum nigrescens, 6-7cm. longus, 4-5 mm. crassus. Lamellae
emarginatae, planae, horizontales, rectae, lineares, sat angustae, admodum confertae,
integerrimae, albae, 4—5 mm. latae. Caro alba, mollis, non hygrophana. In clivis sterilibus
prope Mustiala, m. Sept. 1882.
SPECIMEN STUDIED: “Museum Botanicum Universitatis, Helsinki (H) — Herbarium
Petter Adolf Karsten (1834-1917) #5270 — (Tricholoma) n-sp. — Tricholoma melaleucum
(Pers.) var. - FINLAND. ETELA-HAME (EH/Ta). Tammela. Mustiala — Grid 27° E: — [no
date] — leg. & det. P.A. Karsten — (H6003411)”, neotypus, hic designatus (H). Revision
date: 7 February 2008.
(MACROCHARACTERS, see Karsten 1882: 40).
MICROCHARACTERS — Basidiospores 7.8-10.8 x 4.8-6.2 tum; av. = 8.82 x 5.73
um; Q = 1.25-2.00; Qm = 1.55; subglobose or subcylindrical, with small or
medium, weakly amyloid warts, which are dense, isolate, rounded, rarely, with
well-delimited suprahilar plage. Basidia 23-30 x 7-10 um, clavate, 4-spored.
Cheilocystidia numerous, macrocystidia type, 65-85 x 12-19 um, lageniform
or fusoid in shape, thin-walled, with crystals at apex. Pleurocystidia scarce,
similar to cheilocystidia. Stipitipellis made up of hyphae up to 240 x 20 um,
without emergent elements or caulocystidia. Pileipellis made up by interwoven
hyphae, with conspicuous yellow-tawny intracellular pigment. Dermatocystidia
and thromboplerous hyphae absent. Clamp connections absent.
CoMMENTS - ‘The type collection is composed of three entire basidiomata
in good condition. No collection date is noted on the specimen envelope,
but the locality, which is included, agrees with the original diagnosis (“prope
Mustiala”). Karsten’s envelope bears the herbarium number “5270”, but the
material is filed at H with the number H6003411. As we cannot assume that
Karsten’s original description is based on H6003411, it cannot be selected as
a lectotype. However, given the lack of other material suitable for a lectotype
selection, we think that the above collection can be designated as the neotype
of Tricholoma melaleucum var. alutaceopallens.
This species is difficult to separate from other representatives of the same
subgenus, which seem to differ mainly on macroscopical features that are lost
in drying (pileus colour etc.): e.g, M. melaleuca (Pers.) Murrill, M. cavipes
Métrod ex Bon, M. pallidicutis Bresinsky.
Type studies of Melanoleuca ... 219
Karsten (1890) also described Tricholoma alutaceopallens var. stercorarium,
which has not yet been transferred to Melanoleuca and which differs from the
typical form (var. alutaceopallens) in darker pileus color and growth on dung.
Melanoleuca polioleuca (Fr.) Kihner & Maire, Bull. trimest. Soc. mycol. Fr.
50: 18 (1934).
= Agaricus melaleucus var. polioleucus Fr., Syst. Myc. 1: 115. 1821.
= Agaricus polioleucus (Fr.) Pass., Nuovo Giorn. Bot. Ital. 4: 58. 1872.
= Tricholoma melaleucum var. polioleucum (Fr.) Gillet, Les Hyménomycetes: 128. 1874.
= Tricholoma melaleucum subsp. polioleucum (Fr.) Sacc., Syll. Fung. 5: 134. 1887.
= Tricholoma polioleucum (Fr.) Lapl., Dict. Iconogr. Champ. Sup.: 339. 1894.
= Melanoleuca vulgaris var. polioleuca (Fr.) Konrad &
Maubl., Icon. Select. Fung.6(10): 322. 1937.
= Melanoleuca melaleuca var. polioleuca (Fr.) J. Favre, Ergebn. wiss. Unters.
schweiz. Nat. Parks 6(42): 441. 1960, comb. inval. (basionym lacking).
ORIGINAL DIAGNOsIs: A. melaleucus y. polioleucus, pileo griseo-livido, lamellis sordide
albis, stipite subfarcto brevi, apice albo-pruinato. Constanter utique ab a. diversus nec
elegans; sed e solo locoque diverso ortum puto; plurima enim utrique specei communia.
Stipes 2 unc. longus, 2-3 lin. crassus, equalis, sat firmus. Pileus obtuse umbonatus. Lam.
late. Accedit ad A. oreinum, ut A. melaleuc. ad A. humilem. In regionibus depressis,
campestribus, locis graminosis. (Lund, Alnarp etc) Oct. Nov. (v.v.)
SPECIMEN STUDIED: “Mus. Botan. Stockholm. — Fungi suecici — Tricholoma polioleuca
— Smaland: Femsjé s:n, Femsjé, Hagnen, Grytskedsangen, aker. — 4.8.48 — G. Haglund
et Seth Lundell — (S) reg. nr. F70162”, neotypus, hic designatus (S). Revision date: 1
October 2008.
(MACROCHARACTERS, see Fries 1821: 115).
MICROCHARACTERS - Basidiospores 6.0-8.4 x 3.8-4.8 um; av. = 7.24 x
4.66; Q = 1.30-1.88; Qm = 1.56; with small, dense, amyloid warts, which are
isolate and rounded, more rarely elongated, with well-delimited suprahilar
plage. Basidia 28-33 x 8.5-9.5 um, clavate, 4-spored. Cheilocystidia 50-70 x
12-17 um, frequent, mostly fusiform, thin-walled. Stipitipellis made up of long,
narrow hyphae, with scattered, small clusters of short, clavate cells, intermixed
with caulocystidia, which are similar to cheilocystidia. Pileipellis made up of
a thick ixocutis. Dermatocystidia and thromboplerous hyphae absent. Clamp
connections absent.
CoMMENTSs - ‘The type collection comprises four entire basidiomata in good
condition. These specimens were collected in the same place where Fries
used to collect and its micromorphological features match those proposed by
nearly all authors as characterizing the taxon “polioleucus” (see Métrod 1949,
Singer & Clémencon 1972, Bresinsky & Stang] 1977, Kithner 1978, Enderle &
Krieglsteiner 1987, Bon 1991, Gulden 1992, Moreno et al. 1994, Lonati 1998,
Watling & Turnbull 1998, Boekhout 1999, Grilli & Lanzoni 1999, Fontenla et
al. 2001, Munzmay 2005, Caroti et al. 2006, Vesterholt 2008). Therefore, since
220 ... Fontenla & Para
there is no original material available, this collection is here proposed as the
neotype of Agaricus melaleucus var. polioleucus.
Melanoleuca melaleuca has white flesh, a non-pruinose stipe, and usually
grows in the forests; M. subpulverulenta (Pers.) Singer has lageniform cystidia,
a grey pileus, and grows in the forests; M. heterocystidiosa (Bon & Beller) Bon
has grey pileus and fusiform or lageniform cystidia; M. polioleuca f. langei
Boekhout differs from the typical form only in the relatively short stipe;
M. polioleuca f. pusilla Boekhout & Kuyper is smaller and grows in grassland;
and M. polioleuca var. confusa G. Moreno has pale stipe flesh and grows under
coniferous trees.
Neotypes should be designated for the last two taxa, as their holotypes
are believed to be missing (personal communication by L and AH herbaria
curators).
Melanoleuca permixta Raithelh., Hong. Argentin. 1: 139. 1974. Fic. 2
ORIGINAL DIAGNOSIS: Pileo sordidae pallido, centro fusco, convexo-umbonato, glabro,
4-5 cm lato. Odore grato, sapore miti. Lamellis cremeis, sinuatis(-adnatis), subdistantibus.
Stipite pallido, cavo, 4-5 cm/6-8 mm, carne pallida. Sporis in cumulo candidis, amyloides,
subverrucosis, 7.5—9/4.5-6 my. Cheilocystidiis nullis. Pratis, autumno.
Typus: Veronica/Prov. Buenos Aires nitmero MeA-10472 in herb. mihi conservatur.
SPECIMEN STUDIED: “M. permixta, nr. 104-72”, holotype (Z+ZT). Revision date: 3
September 2008.
(MACROCHARACTERS, see Raithelhuber 1974: 139).
MICROCHARACTERS — Basidiospores 8.2-9.8 x 5.0-6.2 tum; av. = 8.58 x 5.77 um;
Q = 1.35-1.78; Qm = 1.49; with thick, dense, isolate, amyloid warts, rounded
or more rarely elongated in shape, with well-delimited suprahilar plage. Basidia
28-31 x 7-8 um, clavate, 4-spored or 2-spored. Cheilocystidia 37-55 x 7-10
um, frequent, urticoid (fusoid-shaped), thin-walled, often with crystals at the
apex. Pleurocystidia similar to cheilocystidia, frequent, especially in the sinus of
lamellae. Stipitipellis made up of long, narrow hyphae, with numerous clusters
of short, clavate or cylindraceous cells. caulocystidia not seen. Pileipellis made
up of interwoven hyphae, with some ascending but not emergent elements.
Dermatocystidia and thromboplerous hyphae absent. Clamp connections
absent.
ComMMENTSs - ‘The type collection is composed of two-thirds of a basidiome
in good condition. In the protologue Melanoleuca permixta is described as
an acystidiate species, but we found urticoid cystidia in the original material
studied (Fic. 2), which would place this species in subgenus Urticocystis. This
species is close to M. exscissa (Fr.) Singer owing to its colours and microscopic
features, but the lack of further collections does not allow us to evaluate the
variability of such features or to propose synonymy.
Type studies of Melanoleuca ... 221
Ficure 2. Melanoleuca permixta. Cystidia.
Melanoleuca wrightii Raithelh., Metrodiana 2(4): XXVII. 1971. Fic. 3
ORIGINAL DIaGNosis: Pileo pallide griseo, centro suboscuriore, convexo depressove,
gibboso, flexuoso, subviscoso, deinde nitente, 5—6.5 cm lato. Carne albida. Odore subingrato,
sapore miti. Lamellis cremeis vel pallide griseis, basi clarioribus, 6-8 mm latis, adnatis vel
dente decurrentibus, medio distantibus. Stipite cremeo, sursum suboscuriore; subfibrilloso,
farcto, 2-3 cm longo, 5-7 mm lato. Sporis amyloideis, in cumulo albis, 8.5-11/6-6.5 my,
subasperis. Ap. Fraxinum in hortis; autumno.
Typus: Palermo/Buenos Aires. Sub numero MeA-3470 in herb. mihi conseryv.
SPECIMEN STUDIED: “M. wrightii, nr. 3470”, holotype (Z+ZT). Revision date: 3 September
2008.
(MACROCHARACTERS, see Raithelhuber 1971: XXVII).
MICROCHARACTERS — Basidiospores 7.4-9.6 x 4.8-6.2 Lum; av. = 8.68 x 5.68 um;
Q = 1.20-1.80; Qm = 1.53; with thick, dense, isolate, amyloid warts, rounded
or rarely elongated in shape, with well-delimited suprahilar plage. Basidia 33-
38 x 8-9 um, clavate, 4-spored or 2-spored. Cheilocystidia 35-50 x 8-10 um,
numerous, urticoid (typical in shape), thin-walled and with incrustated apex.
Pleurocystidia very rare, similar to cheilocystidia. Stipitipellis with scattered,
large clusters of short, clavate cells, intermixed with frequent urticoid (fusoid-
shape) caulocystidia, 30-45 x 7-8 um. Pileipellis made up of a trichoderm
of ascendant cylindrical hyphae bearing apex-rounded terminal elements.
Dermatocystidia and thromboplerous hyphae absent. Clamp connections
absent.
222 ... Fontenla & Para
Ficure 3. Melanoleuca wrightii. Cystidia.
ComMENTs - The type collection consists of one entire basidiome and one
single pileus without stipe, all in good condition.
In the protologue the author does not record the presence of cystidia, but
the original material exhibits typical cystidia (Fic. 3); accordingly, we place
M. wrightii in subgenus Urticocystis. Like M. permixta, this species is close to
M. exscissa, but the lack of further collections does not allow to estimate the
variability of such features and to propose the synonymy.
Melanoleuca lapataiae Raithelh., Metrodiana 2(4): XXVI. 1971. Fic. 4
ORIGINAL DIAGNosiIs: Pileo lilacino-griseo vel albido cum centro pallide lilacino-griseo,
interdum maculoso, margine clariore, + gibboso, convexo, deinde depresso, glabro, vel
partim nitido vel leviter tomentoso, interdum subsquamuloso; carne albida, sub cuticula
+ lilacina-grisea. — 3-5 cm lato. Odore nullo, sapore miti. Lamellis albidis, nunc adnatis
nunc dente decurrentibus nunc subliberis, saepe basi coniunctis. Stipite albido, interdum
leviter grisaceo, primo farcto, adulto cavo, crustato, superficie leviter fibrilloso, rarior basi
subbulboso, 3-4 cm longo, 4-10 mm lato; carne albida. Sporis amyloideis, in cumulo
albidis vel candidis, asperis, 7-8.5/4.5-5.5 um, ovoideis. Cheilocystidiis fibulisque nullis.
Pascuis, partim cum Nothof. dombeyo.
Typus: Lapataia/Argentina prope Hosteria Alakush. Sub numero MeA-271 in herb.
mihi conserv.
SPECIMEN STUDIED: “M. lapataiae — Nr. 271’, holotype (Z+ZT). Revision date: 19 August
2008.
(Macrocharacters, see Raithelhuber 1971: xxvi-xxvii).
Type studies of Melanoleuca ... 223
Ficure 4. Melanoleuca lapataiae. Cystidia.
MICROCHARACTERS — Basidiospores 8.2-10.8 x 4.8-6 tum; av. = 9.48 x 5.79
um; Q = 1.36-2.05; Qm = 1.64; with small, dense, isolate, rounded amyloid
warts, with poorly developed but obvious suprahilar plage. Basidia 43-52
x 10-12 um, clavate-elongate, 4-spored. Cheilocystidia 43-65 x 7-8 um,
abundant, macrocystidia type, fusoid, many of them bearing a septum, thin-
walled, and with an encrusted apex. Pleurocystidia present but less numerous
than cheilocystidia, even if very similar in size and shape. Stipitipellis made up
of long, narrow hyphae, with frequent cylindrical cells, isolate or in clusters.
caulocystidia not seen. Pileipellis made up of a trichoderm of ascendant hyphae
with rounded and/or strangled terminal elements. Dermatocystidia and
thromboplerous hyphae absent. Clamp connections absent.
CoMMENTS - ‘The type collection includes two entire basidiomata in good
condition. Raithelhuber did not record the presence of cystidia for this species,
either in the protologue (Raithelhuber 1971) or in two subsequent papers
citing this agaric (Raithelhuber 1972, 1987). However, in a later description
(Raithelhuber 1993), he wrote: “Cheilo (and pleuro?) cystidia 40-55/5-7 um,
fusiform, with thin wall.”
These contradictions have so far made it impossible refer M. lapataiae to a
subgenus. Study of the holotype (Z+ZT) allowed us to ascertain that M. lapataiae
exhibits very unusually shaped cystidia (Fic. 4), which make it difficult to assign
to any of the currently accepted cystidial types for Melanoleuca. We have never
seen such cystidia in any of the very numerous collections of Melanoleuca we
have examined. Due to its peculiar size and shape — always fusoid and mostly
224 ... Fontenla & Para
septate — M. lapataiae takes an intermediate position between the subgenera
Urticocystis and Melanoleuca. Only further studies, especially those based on a
molecular approach, will provide further data on its taxonomic treatment.
Melanoleuca lapataiae var. ochroleuca Raithelh., Metrodiana Sonderheft 1: 16.
1972.
ORIGINAL DIAGNOsIs: Differt M. lapataiae pileo albo-ochraceo vel cremeo, umbo +
ochraceo, basi stipiti subaurantio-croceo in adultis et sporis 6.5-7.5 x 3.2-5 my.
Typus: Lapataia, ripo Lago Rocae, sub numero MeA-371 in herb. mihi conserv.
SPECIMEN STUDIED: “M. lapataiae var. ochroleuca, nr. 3-71”, holotype (Z+ZT). Revision
date: 19 August 2008.
(MACROCHARACTERS, see Raithelhuber 1972: 16).
MICROCHARACTERS — Basidiospores 8.4-10.8 x 5.0-6.0 um; av. = 9.21 x
5.67 um; Q = 1.44-1.90; Qm = 1.63; with small to medium, dense, isolate,
rounded, amyloid warts, with poorly developed but obvious suprahilar plage.
Basidia 31-36 x 5-8 um, clavate, 4-spored or 2-spored. Cheilocystidia 40-65
x 8-11 um, not very frequent, macrocystidia type, fusoid, partially septate (in
approximately 50% of cases), sometimes with encrusted apex, thin-walled,
hyaline. Pleurocystidia very rare, similar to cheilocystidia. Stipitipellis made
up of long, narrow hyphae, with frequent cylindrical cells, isolate or in clusters,
caulocystidia not seen. Pileipellis made up of a cutis of interwoven hyphae,
with some scattered, rising but not emerging elements. Dermatocystidia and
thromboplerous hyphae absent. Clamp connections absent.
COMMENTS - The type collection is composed of an almost entire pileus and the
stipe apex, all in good condition. The basidiospore size recorded in the original
diagnosis is wrong, according to a personal communication by J. Raithelhuber,
who states that the correct size is “10-11 x 5-7.5 um? which was confirmed by
our study of the original material.
Melanolecua lapataiae var. ochroleuca showed us the same micromorphology
as that of M. lapataiae var. lapataiae, except for the different pileipellis structure.
We think that it is correct to regard these as two taxa separated by differences
in the pileipellis structure and colors of the pileus and stipe base. The peculiar
cystidial morphology of these varieties prevents placement in any of the
currently named subgenera and suggests erection of a new subgenus; however,
because it was not possible to obtain comparable molecular sequences from
the two specimens due to age, we prefer to wait for collection of fresh material
before suggesting taxonomic changes.
Acknowledgments
We want to express our gratitude to Marco Contu for his encouragement and precious
advice, and to Fabio Taffetani, curator at ANC; Philippe Clerc, curator at G; Anna-Lena
Type studies of Melanoleuca ... 225
Anderberg, curator at S; Tuomo Niemeli, curator at H; Reinhard Berndt, curator at
Z+ZT for providing us with the material requested. Our most sincere thanks are due to
Pierre Arthur Moreau and Fernando Esteve Raventés for their pre-submission reviews.
Edmondo Grilli is thanked for improvements in the English text.
Literature cited
Boekhout T. 1999. Melanoleuca Pat., Cat. Rais. Pl. cell. Tunésie: 22. 1897 (nom. conserv.). Flora
Agaricina Neerlandica 4: 153-165.
Bon M. 1991. Flore mycologique d'Europe 2. Tricholomes et ressemblants. Documents
Mycologiques, Mémoire hors série 2. Amiens.
Bresinsky A, Stangl J. 1977. Beitrage zur Revision M. Britzelmayrs “Hymenomyceten aus Stidbayern”
13. Zeitschrift fiir Pilzkunde 43: 145-173.
Caroti V, Consiglio G, Contu M, Fontenla R, Gottardi M, Para R. 2006. Contributo alla conoscenza
dei Macromiceti del? Emilia-Romagna. XXII. Genere Melanoleuca. Bollettino dell Associazione
Micologica ed Ecologica Romana 22(67): 9-39.
Enderle M, Krieglsteiner GJ. 1987. Uber neue, seltene, kritische makromyceten in der
Bundesrepublik Deutschland (Mitteleuropa) VUI. Mitteilungsblatt der Arbeitsgemeinschaft
Pilzkunde Niederrhein 5(1): 7-29.
Fontenla R, Para R. 2007. Osservazioni sul genere Melanoleuca. Studio dei typi — I. Rivista di
Micologia 50 (3): 221-236.
Fontenla R, Para R. 2008. Osservazioni sul genere Melanoleuca. Studio dei typi — II. Rivista di
Micologia 51 (2): 147-162.
Fontenla R, Gottardi M, Para R. 2001. Osservazioni sul genere Melanolueca. 1° contributo. Rivista
di Micologia 43 (1): 27-41.
Fries EM. 1821. Systema mycologicum vol. 1. Lund.
Grilli E, Lanzoni G. 1999. Specie interessanti dellerbario Lanzoni. Fungi non delineati, pars VII.
Alassio.
Gulden G. 1992. Melanoleuca Pat. Nordic Macromycetes 2: 148-150
Karsten PA. 1882. Symbolae ad mycologiam fennicam. IX. Meddelanden af Societatis pro Fauna et
Flora fennica 9: 39-56.
Karsten PA. 1890 (“1889”). Symbolae ad mycologiam fennicam. Pars XXIX. Meddelanden af
Societas pro Fauna et Flora Fennica 16: 84-106.
Kithner R. 1978. Agaricales de la zone alpine. Genre Melanoleuca Pat. Bulletin de la Société
Linnéenne de Lyon 47(1): 12-52.
Lonati G. 1998. Funghi rari o poco conosciuti. Bollettino dell’Associazione Micologica ed Ecologica
Romana 14: 3-7.
McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH,
Prado J, Silva PC, Skog JE, Wiersema JH, Turland NJ. 2006. International Code of Botanical
Nomenclature (Vienna Code), adopted by the Seventeenth International Botanical Congress,
Vienna, Austria, July 2005. Regnum Vegetabile 146. 568 p.
Métrod G. 1949 (“1948”). Essai sur le genre Melanoleuca Patouillard emend. Bulletin trimestriel de
la Société mycologique de France 64: 141-165.
Moreno G, Arenal F, Gonzalez V. 1994. Algunos Agaricales de las playas de Espafia peninsular.
Cryptogamie Mycologie 15(4): 239-254.
Munzmay T. 2005. Meine mini Melanoleuca Monographie. Der Tintling 4: 4-13.
Raithelhuber J. 1971. Lateinische Kurzdiagnosen der auf der Dreilandertagung in Neubulach
vorgestellten Pilzarten aus Argentinien. Metrodiana 2(4): XXVI-XXVIL.
226 ... Fontenla & Para
Raithelhuber J. 1972. Neue und wenig bekannte Tricholomataceae Argentiniens. Metrodiana
Sonderheit 1: 1-28.
Raithelhuber J. 1974. Hongos Argentinos I. Hongos de la provincia de Buenos Aires y de la capital
federal. Buenos Aires.
Raithelhuber J. 1987. Flora mycologica argentina Hongos I. Stuttgart.
Raithelhuber J. 1993. Agaric flora of South America (6). Metrodiana 20(4): 151-200.
Singer R, Clémengon H. 1972. Notes on some leucosporous and rhodosporous European agarics.
Nova Hedwigia 23: 305-328.
Vesterholt J. 2008. Munkehat (Melanoleuca) i Danmark. Svampe 57: 18-29.
Watling R, Turnbull E. 1998. British fungus flora vol. 8. Edinburgh.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 227-238 January-March 2011
DOT: 10.5248/115.227
Coprinopsis neophlyctidospora sp. nov.,
a new ammonia fungus from boreal forests in Canada
Jay K. Raut", AKIRA SUZUKI” *, TOSHIMITSU FUKIHARU3,
KIMINORI SHIMIZU4, SUSUMU KAWAMOTO! & CHIHIRO TANAKA$
‘Graduate School of Horticulture, Chiba University, Matsudo City, Chiba, 271-8510, Japan
Faculty of Education, Chiba University, Chiba 263-8522, Japan
3Natural History Museum and Institute, Chiba 260-8682 Japan
‘Medical Mycology Research Center, Chiba University, Chiba 260-8673, Japan
5Graduate School of Agriculture, Kyoto University, Kyoto 606-0026, Japan
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Coprinopsis neophlyctidospora sp. nov. (Basidiomycota, Agaricales), collected
in urea treated soil of boreal forests from Canada is described and illustrated. Its
micromorphological features, phylogenetic analysis, and mating test delineate this taxon as a
new species. In addition, its ecological characters also indicate it is a new ammonia fungus.
Key worps — biogeography, cryptic species, ITS, species-complex, taxonomy
Introduction
‘The ammonia fungi are defined as a chemoecological group of fungi whose
growth can be stimulated by the addition of urea or aqueous ammonia or any
other related nitrogenous materials to forest soils (Sagara 1975). The diversity
and ecology of ammonia fungi have been studied in diverse geographical areas
such as in Japan, Taiwan, New Zealand, Western Australia, UK and western
US (Suzuki et al. 2003). However, ammonia fungi in the boreal region of
North America had not previously been examined. We, therefore, conducted
the first survey of ammonia fungi in boreal forests of Canada. In this study,
we focused on an ammonia fungus in the Coprinopsis phlyctidospora species-
complex. Coprinopsis phlyctidospora had been believed to be a cosmopolitan
species (Fukiharu & Horigome 1996, Suzuki et al. 2003), though we have
revealed that this group represents of cryptic species (Suzuki et al. 2002) in
different areas of the world. In this study, we reveal morphological characters
and phylogenetic relationships based on rDNA nucleotide sequences of a new
228 ... Raut &al.
saprobic Coprinopsis ammonia fungus collected from the urea treated soil of
boreal forests in Canada.
Materials & methods
Isolation and culture
A mixture litter (A,) and soil from the upper A horizon from a lodge pole pine (Pinus
contorta var. latifolia) forest and from an aspen (Populus tremuloides) forest both near
Edmonton, Canada was collected in May 2001. To stimulate fruiting of ammonia fungi,
a large amount of aqueous urea (granular fertilizer; 46% nitrogen, 5-20 mg urea/g dry
soil) was applied in plant pots containing the soil/litter mixture from two different
forests separately and incubated at 23-25°C under a 12 hrs light/12 hrs dark regime
for 30-72 days. Sterile water was applied at 1-3 day intervals to avoid desiccation of the
surface of the mixture. Basidiomata were collected from plant pots and cultured in the
laboratory. All cultures were grown at 25°C under a 12 hrs light/12 hrs dark regime on
MY agar medium [(malt extract 10 g/L (Difco, USA), yeast extract 2g/L (Difco, USA)
and agar 15g/L (Nakalai, Japan)].
Morphology
All descriptions of macro- and microscopic features were obtained from cultivated
basidiomata. Different developmental stages of basidiomata were photographed
and collected to observe the changes in pileus colors and veil features. Anatomical
observations and measurements were made on material mounted in 25% aqueous
ammonia. Microscopic terminology of basidiospores and cystidia followed that
of Vellinga (1988). Color terms and notations used in this description are based on
Kornerup & Wanscher (1978). Herbarium abbreviations are according to Holmgren &
Holmgren (1998). Basidiospore statistics: x, the arithmetic mean of spore length by
spore width (+ standard deviation) ; n, number of spores measured; Q, the quotient
of spore length and spore width; Q_, the mean of Q-values (+ standard deviation). For
scanning electron microscope (SEM) observation of basidiospores samples from spore
prints were rehydrated in 25% aqueous ammonia and fixed in 2.5% osmic acid, coated
with platinum-palladium in an ion sputter-coater (Hitachi E-1030; Hitachi Tokyo,
Japan), and observed under a SEM (Hitachi S-800) operating at 15.0 kV.
Phylogeny
Fungal strains were grown in a MY liquid medium. Mycelia were harvested, squeezed
with a paper towel, frozen and lyophilized. The dried mycelia were then ground with a
spatula and suspended in a TES buffer [50 mM Tris-HCl (pH 7.5), 20mM EDTA, 1%
SDS] and soluble fractions were recovered by centrifugation. The DNA was purified
by a TE buffer [10 mM Tris-HCl (pH 8.0), lmM EDTA] saturated phenol/chloroform/
isoamy] alcohol (Nippon gene) extraction followed by an iso-propyl alcohol precipitation.
After desiccation of the DNA pellet, the DNA was dissolved in 30 ul TE buffer. For
some samples, the genomic DNA was further purified using a NucleoSpin Extract II
(Macherey-Nagel) following the manufacture’s recommendation. Primers ITS1 (5’-
TCCGTAGGTGAACCTGCGG-3) and ITS4 (5'-TCCTCCGCTTATTGTATGC-3’)
were used to amplify the ITS1-5.8S-ITS4 ribosomal DNA region. PCR reactions were
carried out using Ex Taq (TakaraBio) according to the manufacturer’s protocol. PCR
229
Coprinopsis neophlyctidospora sp. nov. (Canada) ...
PI8sred
<q
cO8TZo"d
TO8TZ0d
008TZ0d
66Z120d
86Z1Z0d
68Z1Z0d
S6LTLOd
PoLTZO"d
c6ZTZ0"d
OT9TZO”d
609TZ0d
9T9TZO"d
PI9TLO”d
ST9TZO"d
i a a a a a i a
T@Lvosd
OlProsd
s0rresd
90rrOSd
LOvPoSd
60rroSd
“ON NOISSHOOV
MNVANAD,
cgtat at <
ZOOZ Te IA LANZNg Bouasayay y
juaurtiedxa play ur juaurjeed vain Aq peureyqgo eyeuorpseg ,, quautiadxa ArojeIOQR] UI JUUT]eAT] Barn Aq PauTe}qo ByeULOIpIsEY ,
vyopidsn ‘F)
pypuasd iy
pypuasd iy
pypuasd iy
vyouasd sns8oq
(UoneUR[q) vyIpHsL snuig
posnf ‘N “Hsaizuaul ‘Ny
posnf ‘N “ Hsaizuaul ‘Ny
vosnf ‘N Usaizuaus sn8nfoyjon
pnw TC
Dyno 0
oyppidsna “9 vinw D
vyppidsno ‘d “‘vyno sn2san?)
vyopidsng sisdouvjsyD
saplopnuiass q
saplojnuas q
saplopnuias q
saplopnuiaay g
sapiomnusasy srpndog
DYOfyv] “IRA DyLOJUOI Snug
NOILVLASTA
ONILYNIWO(
uede{ ‘o0A4y
uede( 18eATA]
uede( Tiowloy
uede( Tiowloy
uede( ‘opreyyoH
ZN ‘PUrys] YON
ZN ‘Purys] YON
ZN PuUrysy YON
ZN PUris] YON
uede( ‘oAYoq,
uede ‘oA¥oq,
uede{ eqryy
uede{ eqryy
uede{ ‘oj 0A4y
NYO elegy ‘ueudry
NV) ®heqy ‘ueudry
NV) ®Heqy ‘ueurdry
NYO ®heqy ‘ueurdry
NYO ®heqy ‘ueudry
NVO ®ieqry 9pefon
Oo OO (Oro
ALITVOOT
x€EZI7d
xSCLIT"
+6091"
xP9T17"
+LVC0E"
+09S67"
x
x
x8
*K
x
x
x
pos6cd
90T?d
x6€S07"
VSPCCO
PrSted
pcosed
+968"
reseed
06eed
+668"
x0€7T
“Wd
“Wd
“Wd
“Wd
fo) pe; TEE
OO 0 0
id
“Wd
“Wd
“Wd
“Wd
“Wd
“Wd
“Wd
BeBe Ge) Jey, Me, ke
OOo Oo GO
iad
“Wd
“Wd
“Wd
“Wd
“Wd
HAVA
id
iad
id
iad
oo OO. Oo Oo
iad
“ON NAWIOddS
YHHONOA
8Se6FOOVA
+6T0€NHO
xxZ00€NH
9TO€NH
sTOeNH
FIOENH
OOO 0
co0e NH
ZI0€NH
O1O€NH
«x8ZP0C0OU
ZOo0
ScO¢NH
¥COCNH
ecOc?NH
ecOcNH
T@O?NH
6007NH
OO 00 0 0
“ON ALV TOS]
DIADJUIUIDAID “)
dnows Lng
y baodsoutysa “>
y @uodsopysdjydoajsny, “2
, vaodsopyadqyd *D
SHONANOS ANVGNEDH
viodsopjadjydoau sisdoursdon
NOXV],
‘sisAjeue stjauasoAyd oy} UI popnpouT suoryaT[o9 sisdoutsdoy 2] LIAVI,
230 ... Raut & al.
products were purified using the NucleoSpin Extract H, and DNA fragments were
directly sequenced using the BigDye Terminator ver3.1 Cycle Sequencing Kit (Applied
Biosystems) according to the provided protocol. The reactions were then cleaned up
using the Centri Sep (Princeton Separations) before analysis by capillary electrophoresis
on a 3130x DNA Analyzer (Applied Biosystems). Sequences were assembled and
edited using the ATSQ software (Genetyx). All nucleotide sequences were deposited in
GenBank/EMBL/DDJB and accession numbers are provided (Table 1). The data set was
aligned using Clustal X ver. 1.81 (Jeannmougin et al. 1998), and the resulting alignment
was manually refined. The alignment was deposited in TreeBASE under accession
number _http://purl.org/phylo/treebase/phylows/study/TB2:S10848. All phylogenetic
analyses were performed with Paup* 4.0b10 (Swofford 2001). Gaps were treated as
missing data. The ITS data set of 730 bp was analysed with maximum parsimony. The
maximum parsimony was performed with a full heuristic search with 100 random
stepwise addition replicates and TBR (tree bisection-reconnection) branch swapping
and equal weighting of all characters. The robustness of inferred MP tree topologies
was tested by the bootstrap value (Felsenstein 1985) with 1000 replicates. Coprinopsis
atramentaria was used as an outgroup. Sequences for C. atramentaria, C. phlyctidospora,
C. “austrophlyctidospora” and C. echinospora were retrieved from GenBank (TaBLE 1).
Mating tests
Mating compatibility of C. neophlyctidospora with C. phlyctidospora and
C. “austrophlyctidospora” was examined. Monokaryotic testers of C. phlyctidospora
NBRC 30478 (Suzuki et al. 2002) and C. “austrophlyctidospora” CHU 3007 (tester
strains were generated by the authors of this paper, unpublished) were used in this study.
Small mycelium-covered agar blocks of dikaryotic C. neophlyctidospora and one of the
monokaryotic testers were placed 5 mm apart in the center of an MY agar plate. After
about two weeks incubation at 25°C in the dark, several pieces of mycelia from the
outer edge of the monokaryotic colony were examined and compatible crossings were
determined by the presence of clamp connections (TABLEs 2, 3). Individual pairings
were performed three times.
Taxonomy
Coprinopsis neophlyctidospora Raut, Fukiharu & A. Suzuki, sp. nov. Fies. 1-3
MycoBank 518507
Pileo primo 5-12 mm lato 3-6 mm alto, usque ad 10-30 mm lato, ovato-campanulato,
demum in margine lacerato revolutoque, radiatim sulcato, candido vel eburneo, deinde
cinerascenti, primo squamis albis radiatim hirsuto-fibrillosis ubique tecto, dein fere glabro;
carne tenuissima, fragilissima, alba, sapore miti, odore nullo; lamellis adnexis vel liberis,
comfertis, angustis (0.5-1.0 mm), albis, deinde atratis, deliquescentibus; stipete 50-80 mm
longo, 1-3 mm crasso, aequali vel sursum leviter attenuato, basi leviter incrassatula, cavo,
candido, fragilissimo, primo squamis albis fibrillosis squarrosis ubique tecto, dein nudo;
basidiosporis in cumulo atratis, sub microscopio rufo-brunneis, 7.8-8.5 um longis x 5.4—
6.0 um anticis x 5.4—5.8 latis, ovoideis vel ellipsoideis, verrcosis, poro germinationis centrali
1.8-2.1 um lato, cum plagiis; basidiis 26.2-36.2 x 7.7-8.5um, tetrasporis; pleurocystidiis
40-65 x 15-30 um, obovatis vel utriculiformibus, hyalinis, tenui-tunicatis; cheilocystidiis
25-35 x 15-25 um, subglobosis vel utriculiformibus, hyalinis, tenui-tunicatis; velo pilei,
Coprinopsis neophlyctidospora sp. nov. (Canada) ... 231
ANY
rN.
Up | N\ Hii
AW aa”
Fic. 1. Macromorphology of the newly described species, Coprinopsis neophlyctidospora.
A. Basidiomata (UAMH 11230); B. Longitudinal section of basidioma (UAMH 11230); and
C-E different developmental stages of basidiomata. Bars, A-B = 5 mm, C-E = 20 mm.
232 ... Raut & al.
E
Fic. 2. Anatomical details of Coprinopsis neophlyctidospora (drawn from the holotype)
A. Basidiospores B. Basidia C. Pleurocystidia D. Cheilocystidia D. Veil elements.
Bars A = 5 um B—-D = 20 um, E = 30 um.
Coprinopsis neophlyctidospora sp. nov. (Canada) ... 233
ex hyphis multi-septatis, divaricatis, tenui-tunicatis, hyalinis, 28.2-68.2 x 5.8-7.8 um
compositis; fiblis praesentibus.
Type: Canada, Alberta: Nojack (115°35'15”W 53°36'19"N; 828 m) on a large amount of
aqueous urea (granular fertilizer; 46% nitrogen, 5 mg urea/g dry soil) applied soil/litter
mixture collected from pine (Pinus contorta var. latifolia) forest, May 2001, A. Suzuki
[CHU 2009] (HoLoTYPE UAMH 11230).
EryMo.ocy: The Latin neo- refers to the “New World” origin of the species, and -
phlyctidospora reflects its morphological resemblance to Coprinopsis phlyctidospora.
PiLeus 5-12 mm broad, 3-6 mm high in button stage, when young ellipsoid to
ovoid, later convex to plane, 10-30 mm broad when expanded, finally uplifted
with age, radially sulcate; pileipellis color at first grayish orange to pale orange
(5B, 3), soon becoming grayish brown (5D-E, 3), surface when young densely
covered with white, hairy fibrillose scales (Fig.1), soon breaking up in small
radially arranged fibrillose veil, later almost glabrous or veil remaining only
in the center. Context very thin, fragile, white; taste mild; odor indistinct.
LAMELLAE adnexed to free, close (number of lamellae 40-60), with 0-1 lamellulae
(between two lamellae), narrow (0.5-1.0 mm wide), edge slightly pruinose, at
first white, then grayish, finally blackish, deliquescent. STIPE up to 50-80 x
1-3 mm, central, cylindrical, equal or somewhat tapering upward, sometimes
the base clavate, not rooting, fistulose, fragile, surface white, at first with white
fibrillose scales (Fig. 1), soon becoming smooth (Fig. 1). Bastpiosporss black
in mass, dark reddish brown under the light microscope, 7.8-8.5 x 5.4-6.0 um
in face view (x, =7.9+0.6 x 5.8 +0.5 um, Q= 1.2-1.5,Q =14+0.1,n= 40),
5.4-5.8 um diam in side view (x, = 5.6 + 0.4 um, n = 40), ovoid to ellipsoid
with warty ornamentation, a central germ pore 1.8-2.1 (1.8 + 0.1, n = 10) um
wide and vague plage (Figs. 2, 3A). BAsIDIA 26.2-36.2 x 7.7-8.5 «um, 4-spored
(Fig. 3C), PLEUROcysTIDIA 40-65 x 15-30 um, obovoid or clavate to utriform,
thin-walled, colorless (Fig. 3C). CHEILOCYSTIDIA 25-35 x 15-25 um, subglobose
or obovoid to utriform, numerous, thin-walled, colorless (Fig. 3D). ELEMENTS
OF VEIL on the pileal surface composed of thin-walled, diverticulate, colorless
hyphae, 28.2-68.2 x 5.8-7.8 um (Fig. 3E). CLAMP CONNECTIONS present in
vegetative mycelia and in pileal veil elements.
Hapit & Hapitat - Saprobic, growing after application of urea in the soil
collected from lodgepole pine (Pinus contorta var. latifolia Engelm.) and aspen
(Populus tremuloides Michx.) forests in Canada. Fruiting of this fungus in urea-
treated soil indicates that it is an ammonia fungus (Sagara 1975).
DisTRIBUTION — Only known from the type locality in Canada.
ADDITIONAL SPECIMENS EXAMINED: CANADA. ALBERTA: Chipman, (112°45’10°W
53°39 '46"N; 728 m) ina large amount of aqueous urea (granular fertilizer; 46% nitrogen,
20 mg urea/g dry soil) applied soil/litter mixture collected from an aspen (Populus
tremuloides) forest, CBM-FB33899, CBM-FB33901, CBM-FB33894, CBM-FB33896
December 2003, T. Fukiharu, CBM-FB38024 January 2004, T. Fukiharu.
234 ... Raut & al.
Fic. 3. Comparison of scanning electron micrographs (SEM) of basidiospores among:
A. Coprinopsis neophlyctidospora; B. C. “austrophlyctidospora” (Fukiharu et al. 2011); and
C. C. phlyctidospora (Fukiharu et al. 2011). Bars, A-C=2.5 um.
Results & discussion
According to conventional Coprinus Pers. taxonomy, Coprinopsis
neophlyctidospora belongs to Coprinus subsect. Alachuani (Singer 1986) based
on its diverticulate veil elements. In this subsection four species are reported
Coprinopsis neophlyctidospora sp. nov. (Canada) ... 235
to have warty ornamented basidiospores, i.e., Coprinopsis echinospora (Buller)
Redhead &al. (= Coprinus echinosporus), Coprinopsis phlyctidospora (Romagn.)
Redhead & al. (= Coprinus phlyctidosporus), Coprinopsis rugosobispora (J.
Geesink & Imler) Redhead & al. (= Coprinus rugosobisporus) (Orton & Watling
1979, Moser 1983, Uljé & Noordeloos 1997, Uljé 2005), and Coprinopsis
“austrophlyctidospora” nom. prov. (proposed as a new species by Fukiharu
et al. 2011). Macroscopically it is difficult to separate C. neophlyctidospora
from these species, but some microscopic features are distinctive. Coprinopsis
echinospora differs in its amygdaliform basidiospores and two hyphal types
in the pileal veil. Coprinopsis rugosobispora has two-spored basidia and is
also distinguished from C. phlyctidospora and C. ‘austrophlyctidospora”
KACC49358 (C. atramentaria)
CHU2025
CHU2024
CHU2009
CHU2023
CHU2022
CHU2021
CHU3010
CHU3003
CBM FB21061
CHU3017
NBRC30478
CHU3015
CHU3016
E5808
CHU3014
ri CBM FB214562
6 CHU3019
98 CBM FB21733 C. echinospora
CBM FB21725
CBM FB21264
C. neophlyctidospora
97
C. phiyctidospora
C. austrophiyctidospora
~ 10 changes
Fic. 4. The most parsimonious tree (156 steps) from a heuristic search based on the nuclear rDNA
sequences in ITS region for phylogenetically related Coprinopsis spp. The tree was rooted to the
outgroup, C. atramentaria. The numbers on branches indicate bootstrap support (value >50% only
shown) with 1000 replications. The distance corresponding to 10 base changes per 1000 nucleotide
position is indicated by the bar. Sidebar represents the inferred clades of Coprinopsis species.
236 ... Raut & al.
TABLE 2: Dikaryon-monokaryon mating reactions between the dikaryotic isolates of
Coprinopsis neophlyctidospora from Canada and monokaryotic testers of
C. phlyctidospora (NBRC30478).
Monokaryotic testers of C. phlyctidospora from Japan
Dikaryotic A.B, AB, AB, AB,
Isolates
cHu003 cHu00L cHu008 = cHU007 cHuU010 =cHU009 cHu0l1 cHu012
cHu2009 - - - - - - - -
cHu2021 - - - - - - - -
cHU2022 - - - - - - - -
cHu2023 - - - - - - - -
-, Clamp connections did not form
TABLE 3: Dikaryon-monokaryon mating reactions between the dikaryotic isolates of
Coprinopsis neophlyctidospora from Canada and monokaryotic testers of
C. “austrophlyctidospora” (cHuU3007).
Monokaryotic testers of C. “austrophlyctidospora” from New Zealand
A.B, AB, AB, ALB,
cHU013 cHUO15 cHU021 = cHU022 cHU0I6 ~=cHUO020 cHU018 = cHUO019
Dikaryotic
isolates
cHu2009 - - - - - - - -
cHu2021 - - - - - - - -
cHU2022 - - - - - - - -
cHu2023 - - - - - - - -
-, Clamp connections did not form
TABLE 4: Diagnostic basidiospore features of Coprinopsis neophlyctidospora and its
allies.
BASIDIOSPORE C. neophlyctidospora _C. phlyctidospora C. ‘austrophlyctidospora”
CHARACTER
Size 7.8-8.5 X 8.4-10.6 x 6.5-7.5 x
(um) 5.4-6.0 6.0-7.6 51-65
Surface warts more flattened, warts coarse & cone-like, warts smaller,
(verrucose) plage not distinct plage +/- distinct plage always distinct
in basidiospore size and surface ornamentation. The basidiospore size of
C. neophlyctidospora is smaller than that of C. phlyctidospora (8.4-10.6 x 6.0-
7.6 um; Uljé and Noordeloos 1997, Uljé 2005) while larger and more elongated
than those of C. “austrophlyctidospora” (6.5-7.5 x 5.1-6.5 «um; Fukiharu et al.
2011). The scanning electron micrographs also revealed its distinct broadly
warted basidiospores, showing warts more flattened than those in other species
Coprinopsis neophlyctidospora sp. nov. (Canada) ... 237
(Fic. 2). Furthermore, in the phylogenetic analysis based on ITS nucleotide
sequences C. neophlyctidospora formed a conspicuous and distinct clade among
its allies. The tree topology is strongly supported by high bootstrap values
(Fic. 3), indicating that C. neophlyctidospora is a distinct taxon. Moreover, the
mating test results comparing C. neophlyctidospora with C. phlyctidospora (TABLE
2) and C. “austrophlyctidospora” (TABLE 3) also strongly support biological
separation of these species. In conclusion, we propose C. neophlyctidospora as
anew cryptic species within the C. phlyctidospora species-complex, distributed
in the boreal region of Canada. Further research in unexplored regions is
needed to resolve comprehensive global understanding of the distribution of
these species.
Acknowledgments
The authors are deeply indebted to Prof. Dennis Desjardin (San Francisco State
University, San Francisco, USA) and Dr Peter Buchanan (Landcare Research, Auckland,
New Zealand) for their critical reviews of the manuscript and valuable remarks that
greatly improved it. The constructive nomenclature reviews from Dr. Shaun Pennycook
that further improved it are also greatly acknowledged. This work was financially
supported in part by a Grant-in-Aid for the Scientific Research (Nos. 14560112 and
16570073) from the Japan Society for the Promotion of Science (JSPS). We would
like to express sincere thanks to Prof. R. S. Currah (University of Alberta, Canada)
for his making the experimental sites available and supporting field and laboratory
experiments in Canada. We also express appreciation to Emeritus Research Scientist,
Y. Hiratsuka (Canadian Forest Service, Northern Forestry Center, Edmonton, Canada) and
H. Ono (Land and Forests Division, Alberta Sustainable Resource Development,
Alberta, Canada) for their support and making the field experiment in Canada possible.
We are thankful to the staff of Cold Creek Ranger Station, Alberta, Canada, for their
support and making the experimental sites available and secure.
Literature cited
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using bootstrap. Evolution 39:
783-791.
Fukiharu T, Horigome R. 1996. Ammonia fungi in the Abukuma Mountains and its biogeographical
distribution around Japan (in Japanese). Mem. Natl. Sci. Mus. Tokyo No. 29: 105-112.
Fukiharu T, Bougher NL, Buchanan PK, Suzuki A, Tanaka C, Sagara N. 2011. Coprinopsis
austrophlyctidospora sp. nov., an agaric ammonia fungus from Southern Hemisphere plantations
and natural forests. Mycoscience in press. doi:10.1007/s10267-010-0077-0.
Holmgren PK, Holmgren NH. 1998. Index Herbariorum: A global directory of public herbaria
and associated staff. New York Botanical Garden’s Virtual Herbarium. http://sciweb.nybg.org/
science2/indexHerbariorum.asp
Jeannmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. 1998. Multiple sequence alignment
with Clustal X. Trends Biochem. Sci. 23: 403-405. doi:10.1016/S0968-0004(98)01285-7
Kornerup A, Wanscher JH. 1978. Methuen Handbook of Color, 3"! edn. Sankt Jorgen Tryk Ltd,
Copenhagen.
238 ... Raut & al.
Moser M. 1983. Key to agarics and boleti (Polyporales, Boletales, Agaricales, Russulales), 4% edn. The
Whitefriars Press Ltd., Tonbridge UK.
Orton PD, Watling R.1979. British fungus flora. Agarics and boleti. 2. Coprinaceae Part 1: Coprinus.
Royal Botanic Garden, Edinburgh.
Redhead SA, Vilgalys R, Moncalvo JM, Johnson J, Hopple JS. 200la. Coprinus Pers. and the
disposition of Coprinus species sensu lato Taxon 50: 203-241. doi:10.2307/1224525
Redhead SA, Vilgalys R, Moncalvo JM, Johnson J, Hopple JS. 2001b. Proposal to conserve the
name Psathyrella (Fr.) Quél. with a conserved type and to reject the name Pselliophora P. Karst.
(Basidiomycetes: Psathyrellaceae). Taxon 50: 275-277. doi:10.2307/1224529
Sagara N. 1975. Ammonia fungi: a chemoecological grouping of terrestrial fungi. Contrib. Biol.
Lab. Kyoto Univ. 24: 205-276.
Singer R. 1986. The Agaricales in modern taxonomy, 4% edn. Koeltz Scientific Books, Koenigstein.
Suzuki A, Motoyoshi N, Sagara N. 1982. Effects of ammonia, ammonium salts, urea and potassium
salts on basidiospore germination in Coprinus cinereus and Coprinus phlyctidosporus. Trans.
Mycol. Soc. Japan 23: 217-224.
Suzuki A, Tanaka C, Bougher NL, Tommerup CI, Buchanan PK, Fukiharu T, Tsuchida S, Tsuda M,
Oda T, Fukuda J, Sagara N. 2002. ITS rDNA variation of the Coprinopsis phlyctidospora (Syn.:
Coprinus phlyctidosporus) complex in the Northern and Southern Hemispheres. Mycoscience
43: 229-238. doi:10.1007/s 102670200033
Suzuki A, Fukiharu T, Tanaka C, Ohono T, Buchanan PK. 2003. Saprobic and ectomycorrhizal
ammonia fungi in the Southern Hemisphere. New Zeal. J. Bot. 41: 391-406. doi:10.1080/
0028825X.2003.9512858
Swofford DL. 2002. PAUP*. Phylogenetic analysis using parsimony (*and other methods), Version
A, Sinauer Associates, Sunderland, Massachusetts, USA.
Uljé CB. 2005. Coprinus Pers. Flora Agaricina Neerlandica 6: 22-109.
Uljé CB, Noordeloos ME.1997. Studies in Coprinus IV. Coprinus section Coprinus: subdivision and
revision of subsection Alachuani. Persoonia 16: 265-333.
Vellinga EC.1988. Glossary. Flora Agaricina Neerlandica 1: 54-64.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 239-50 January-March 2011
DOT: 10.5248/115.239
Stachybotrys thaxteri sp. nov. and the
nomenclatural status of three Stachybotrys species
DeE-WEI LI
The Connecticut Agricultural Experiment Station, Valley Laboratory,
153 Cook Hill Road, Windsor, CT 06095
CORRESPONDENCE TO:
[email protected]
ABSTRACT — A new species of Stachybotrys, S. thaxteri, is described as producing oblong or
ellipsoid conidia with a median constriction and undulating diagonal striations and colorless
conidiophores up to 360 um long. The nomenclatural status of S. cannae, “S. pallida,” and
“S$. striatispora” is clarified.
Key worps — anamorphic fungi, Periconiella, synonym
Introduction
The genus Stachybotrys was erected by Corda (1837: 21) with S. atra
Corda as type species. Verona & Mazzucchetti (1968), who monographed
Stachybotrys and Memnoniella, accepted 16 species of Stachybotrys and 3
species of Memnoniella. Jong & Davis (1976) published culture studies of 11
species of Stachybotrys and 2 species of Memnoniella. Pinruan et al. (2004)
accepted 55 taxa in Stachybotrys (including seven taxa formerly placed in
Memnoniella). At present, 96 Stachybotrys names have been published (Jiang
& Zhang 2009, Wang et al. 2009, Index Fungorum 2010), of which ca. 44 were
accepted in the 10 edition of Dictionary of Fungi (Kirk et al. 2008). Since that
publication, Stachybotrys variabilis H.R. Wang & T.Y. Zhang (Wang et al. 2009)
and Stachybotrys pallescens Y.L. Jiang & T.Y. Zhang (Jiang & Zhang 2009) have
been added.
During study of exsiccati from the U.S. National Fungus Collections
(BPI), The Farlow Herbarium (FH), Harvard University, and University of
Wisconsin Herbarium, Madison (WIS), one specimen (FH 2633) collected by
R. Thaxter labeled as Stachybotrys sp. was found to represent an undescribed
species, described below as Stachybotrys thaxteri. During the same research,
Stachybotrys cannae (isotype specimen BP1422138) was determined to represent
240 ... Li
not Stachybotrys but Periconiella. The nomenclatural status of S. cannae,
“8. pallida”, and “S. striatispora” is clarified and those species are redescribed.
Materials & methods
Specimens of Stachybotrys on loan from BPI, FH, WIS, and several other herbaria
were studied. Fungal structures including hyphae, conidiophores, conidiogenous cells,
and conidia were tape-lifted from each specimen with transparent tape (2 x 3 mm) and
mounted in lacto-fuchsin (0.1 g acid fuchsin, 100 mL 85% lactic acid). Morphological
characters (e.g., conidiophores, conidiogenous cells, conidia) from each specimen were
observed with a Nomarski differential interference contrast optical system at three
different times (immediately, after one week, after one month) to determine whether
rehydration had any effect on the morphology of the fungal structures. Herbarium
acronyms follow Holmgren & Holmgren (1998). Articles of the International Code of
Botanical Nomenclature are hereafter cited as from the “Vienna Code” (McNeill et al.
2006).
Results
Stachybotrys thaxteri D.W. Li, anam. sp. nov. Figures 1-4
MycoBank MB515398
Coontz olivascens, effusae, velutinae. CONIDIOPHORA macronemata, erecta, simplicia,
septata, solitaria vel interdum fasciculata, determinata, recta vel exigua curvata, laevia vel
verrucosa, hyalina, usque ad 360 um longa et 3.0-5.0 wm crassa. CELLULAE CONIDIOGENAE
phialidicae, determinatae, discretae, laeviae, subclavatae, prope apicem fuscae olivaceae,
(10.5-)11-13(-15.5) x (4.5-)5-6(-6.5) wm, collo conspicuo, praeditae, 4-6 in verticillo
dispositae. Conrpra oblonga, elliptica vel subcylindro-elliptica, primo hyalina et laevia,
deinde atro-olivaceobrunnea, diagnaliter striata, (12.5-)15-17.5(-19) x (6—) 6.5-7.5(-8)
um, biguttata, in massam mucosam nigram congesta. Teleomorphosis ignota.
Type: Trinidad: Maravel Valley, de aroid folii, per Roland Thaxter. Coll. 7-XII-1913, FH
2633 (holotype).
Erymo.oey: the specific epithet honors Roland Thaxter, the longtime curator of the
Farlow Herbarium, Harvard University, who collected the holotype.
COLONIES olivaceous, effuse, and velutinous; Mycelia superficial, partially
immersed. Hyphae septate, branched, light olivaceous, smooth. CONIDIOPHORES
differentiated, determinate, solitary or in groups, erect, straight or flexuous,
simple, 3-7-septate, smooth to verrucose, hyaline, up to 360 um in length, 3.0-5.0
um in width, apices inflated (Fics. 1-2). PHIALIDEs , unilocal, determinate,
discrete, subclavate, smooth, hyaline, dark olivaceous at the tip, (10.5-)11-13
(-15.5) x (4.5-)5-6(-6.5) um (mean = 12.2 + 1.0 x 5.4 + 0.6 um, n = 20), with
or without conspicuous collarettes, in digitate clusters of 4-6 (Fic. 1), CoNIDIA
unicellular, oblong, ellipsoid, occasionally constricted in the middle or slightly
curved, rounded at both ends, light gray and smooth at first, gray to dark
olivaceous when mature, forming delicate undulating diagonal striations with
minute dots in lines on the conidial surface, (12.5-)15-17.5(-19) x (6-)6.5-7.5
Stachybotrys thaxteri sp. nov. (Trinidad) ... 241
Figures 1-4. Stachybotrys thaxteri. 1. Conidiophore, phialides, and conidia. 2. Long
conidiophores, phialides, and conidium. 3. Conidia showing striations. 4. Biguttulate
conidia. Scale bars: 1, 3, 4 = 10 tm, 2 = 40 um.
(-8) um (mean = 16.1 + 1.3 x 7.1+0.4 um, n = 31), ratio of length/width 1.8-2.7
(mean = 2.3), biguttulate, especially when young, aggregated in slimy masses;
the striations becoming thicker and irregular with age (Fics. 3-4, TABLE 1).
eyided ayeouny
xode ye Avis L-SF ® YIM 10 pepunor 71-8
N qoours 0} ssay1opoo X SL-FS aSOOLLI3A Wry aseq prosdiya X61-S BLIYDIIDM *S
PRE aSOONLIaA S9-S
N asornon4qeA snoaseayo —- X Q9Z-OZI Ajasreo snoacealyo yeotspuyAr 0} prosdiyya Xx 61-0 SHDULOSOYJUD *S
aSONLLIaA oF sg-s
N Ajas.re09 uMoIg X OOT aSOMLI3A uMoIg Yep prosdija X €1-Z DIWSAA *S
aSOMLIIAA uUMOIq 0} PR-e asOondaa uMmolq yep prosdija €I-€
N 0} Yjoours aurpedyqns X OL-SF 0} Yoours 0} umodq ated 0} asqoysqns X OC-F SIIQDLADA.*S
o-F aSOMLLI3A 8I-ST
k yyoours ssa]IO[Oo xX 00T> 0} Yoours Wrqyg snqnotde we tym yeao X 87-0 avusosgoayy ‘S
aSOMIIAA o-¢€ Aqjeuo8erp [PPT ye payotysu0s GL-L
k 0} Yjoouss Ssa]IO[O2 Xx Q9E5 aqerdys snoaoealyo prosdyja ‘suotqo X8I-S Majxvyy “S
snoaoearyo 6-8 8-9
k yyoours oy auredygns =X QSZ-OST aSOMLLIOA snoaoealyo Suolgo xX PI-0 sisuajpduvy *S
aSOMLIIAA umogq ajed G8-G'S asOONLaa SPP
k Jo yyoours TO ssay1opoo x OCES Ajasreo3 rg yeotpurpAa x ST-0 avijauiaad ‘S
snoasearo eared S-¢ Ayjeurpnysucy os-s'¢
k QSOOLIIAA 0} ssayropoo x 00@> aqyeLys snoaoealyo yeotpurpAo X OT-€ viodsoupuydona *S
ayepnuess Io ayqeiqea
paueysnor snoaoealjo S-$'7 pespu prosdyya 9-S'¢
hy qjoours 0} UMOI x OOT< 0} asOONLIOA snoaoealyo ATpeorg XTI-L WNADIADYD *S
ey (tar) azig
pa Pe aovadns woo) AZIS aovadns woTOD aqdVHS
2 ees oe eS SSS Sa1Ogds
SHUYOHAOICINO’) VICINOD
5
NN
~~
‘satoods sfyogdyonyjs IepLUnis pure tagxvyy skajogdyonys Jo stsdouds oatyereduroy *T ATV],
Stachybotrys thaxteri sp. nov. (Trinidad) ... 243
TELEOMORPH: unknown.
DISTRIBUTION AND HABITAT: Known only from Trinidad on aroid leaves.
ADDITIONAL TYPE SPECIMENS OF SIMILAR STACHYBOTRYS SPECIES EXAMINED: Canada.
Ontario: Near Guelph, from peat soil, cedar bog, Nov. 1960, G.L. Barron [DAOM
87664, type of Stachybotrys eucylindrospora]. Czech Republic. PRAGUE, on plaster,
A.CJ. Corda [PRM 155670, holotype of Stachybotrys atra Corda]. Germany. BERLIN.
Unknown locality, on paper, date, collector unknown [Herb. Inst. Syst. Bot. Uppsala,
Sweden. Herb. E. Fries, ex holotype of Stilbospora chartarum Ehrenb. (= Stachbotrys
chartarum) (DAOM 51026)]. New Zealand. Waikato. Mt. Pirongia, No. 3 Track, on
Freycinetia banksii A.Cunn., 19 Nov 1984, E.H.C. McKenzie [PDD 57639, holotype
of Stachybotrys freycinetiae]. Uganda. KampaLa: on dead wood, March 1930, C.G.
Hansford (1138) [K(M) 165379, holotype of Stachybotrys kampalensis Hansf.]; on dead
branches of Theobroma cacao L., May 1936, C.G. Hansford (1138), [K(M) 165384,
holotype of Stachybotrys theobromae Hansf.].
COMMENTS—A comparison of S. thaxteri and similar Stachybotrys species is
given in TABLE 1.
One striking character of S. thaxteri is the long (< 360 um) conidiophore.
Both S. freycinetiae McKenzie and S. xanthosomatis Mercado & J. Mena also
have long conidiophores. The holotype of S. freycinetiae has conidiophores up
to 320 um long, but its conidia are cylindrical and much smaller (10-15 x 4-
4.5 um; McKenzie 1991) than those of S. thaxteri. Stachybotrys xanthosomatis
produces 120-260 um long conidiophores and conidia with extremely variable
lengths (Mercado & Mena 1988) that overlap those of S. thaxteri, but from
which it is distinguished by its narrower, ellipsoid or cylindrical conidia (10-19
x 5-6.5 um). The conidial widths of the two species do not overlap (TABLE I).
Stachybotrys virgata has warted conidiophores up to 100 um long and ellipsoid
conidia that are smaller (12-13 x 5-5.5 um; Krzemieniewska & Badura 1954)
than those of S. thaxteri. Although the type specimens of S. xanthosomatis and
S. virgata were deposited in herbaria in Cuba and Poland and thus unavailable
to the author, the literature descriptions of these two species are detailed enough
for comparison.
Conidia of several other species are similar in size or shape to those of
S. thaxteri. Conidia of S. waitakere Whitton et al. are similar in size (14.5-19
x 8-11.5 um) but differ in ornamentation (verrucose) and shape (ellipsoid to
broadly ellipsoid) and are produced on short (< 75 um) conidiophores (Whitton
et al. 2001). Conidia of S. kampalensis are morphologically similar to those of
S. thaxteri but smaller (10-14 x 6-8 um; Jong & Davis 1976; holotype examined).
The conidia of S. theobromae (20-28 x 15-18 um; Hansford 1943; holotype
examined) and S. variabilis (4-20 x 3-13 um; Wang et al. 2009) overlap those of
S. thaxteri in size. However, the larger ovoid conidium with the apical apiculus
of S. theobromae separates that species from S. thaxteri.
In S. variabilis some conidia are oblong, but smooth to verrucose (not
striate) and the size and shape variability combined with the short (45-70 um)
244 ... Li
conidiophores easily separate this species from S. thaxteri. Although conidia
of S. thaxteri and S. eucylindrospora are both striate, the longitudinal striations
on the smaller (12.8-16 x 3.5-5.5 um) cylindrical conidia of S. eucylindrospora
readily distinguish that species from the larger conidia with diagonally oriented
striations in S. thaxteri (TABLE 1) (Li 2007).
A culture of S. thaxteri was not isolated when the specimen was collected.
Therefore DNA sequencing couldnotbe conducted to determine its phylogenetic
relationship with the species of Stachybotrys that have DNA sequence data in
GenBank.
Nomen Excludendum
Stachybotrys cannae Bat.
Examination of this specimen showed that its conidiogenous cells were
clearly sympodial and cicatrized, rather than phialidic, and that the fungus
had been misdetermined. It is identical with Periconiella portoricensis, which
is redescribed as follows:
Periconiella portoricensis (F. Stevens & Dalbey) M.B. Ellis, Mycol.
Pap. 111: 26 (1967) FIGURES 5-12
= Haplographium portoricense F. Stevens & Dalbey, Mycologia 11(1): 6 (1919).
= Cephalotrichum portoricense (F. Stevens & Dalbey) Toro, Sci. Survey
Porto Rico Virgin Islands, New York Acad. Sci. 8: 224 (1932).
= Stachybotrys cannae Bat., in Batista & Vital, Anais Soc.
Biol. Pernambuco 15(2): 394 (1957).
CoLonligs brown, velutinous, effuse. Mycelium superficial, partially immersed.
Hyphae septate, branched, light brown, smooth. ConrpropHorss differentiated,
solitary or in groups, septate, erect, straight or flexuous, smooth, brown to dark
brown, thick-walled, occasionally branched, up to 430 um in length, 4-6.5 um
in width, with a defined foot cell (Figs. 5-6), CONIDIOGENOUS CELLS clavate or
cylindrical, polyblastic, sympodial, cicatrized, smooth, brown, thick-walled in
basal area, aggregated in groups of 2 - 5 on the apex of the conidiophores or
solitary; solitary ones longer than these in groups; aggregated conidiogenous
cells (14-)17-23(-25) x (4.5-)5-7(-8.5) um (mean = 20.6 + 3 x 6.1 + 0.9
um, n = 20) um, fertile part as wide as the basal part (Fics. 5-8); solitary
conidiogenous cells terminal or intercalary, (19-)23-34(-43.0) x (5-)5.5-7(-
7.5) um (mean = 29.2 + 5.5 x 6.3 + 0.8 um, n= 15) um, fertile part often wider
than the basal part (Figure 9). Conrp1a unicellular, acropleurogenous, single or
in short chains, obovoid, ellipsoid or subcylindrical, brown, smooth or rarely
verruculose, (15-)16-20(-22) x (6-)7.5-10(-13) um (mean = 18.2 + 1.9 x 9.2
+ 1.5 um, n= 31) um, ratio of length/width 1.5-3.2 (mean = 2.0), cicatrized on
basal end, occasionally on both ends (Fics. 10-12). Teleomorph unknown.
TELEOMORPH: unknown.
Stachybotrys thaxteri sp. nov. (Trinidad) ... 245
Ficures 5-12. Periconiella portoricensis. 5-6, 8. Conidiophores, and conidiogenous cells in groups.
7. Conidiophore, conidiogenous cells in a group, and conidium. 9. Solitary conidiogenous cells and
conidia. 10-12. Conidia. Scale bars: 7, 8, 10-12 = 10 um, 5, 6, 9 = 20 um.
DIsTRIBUTION AND HABITAT: Known from Ecuador, Guyana and Puerto Rico
on Canna coccinea Mill. and Canna sp.
SPECIMENS EXAMINED: Puerto Rico. AIBONITE: on Canna coccinea, 16 July 1915, J. A.
Stevenson 8447 [ILL 15999 (= Herbarium of John Stevenson, paratype of Haplographium
portoricense]; EL GIANTE: on Canna sp., 16 July 1915, J.A. Stevenson 8495 [ILL 16000 (=
246 ... Li
Herbarium of John Stevenson), holotype of Haplographium portoricense]; GUAYNABO:
on leaves of Canna sp., September 1917, J.A. Stevenson 6608 [BPI 422138 (= Herbarium
of John Stevenson), isotype of Stachybotrys cannae].
COMMENTS—he genus Periconiella was erected by Saccardo (Saccardo &
Berlese 1885: 727). It is characterized by differentiated conidiophores having
a branched head with polyblastic, sympodial, conspicuously cicatrized
conidiogenous cells (Ellis 1967). Batista & Vital (1957) proposed Stachybotrys
cannae as a new species. However, its possession of polyblastic, sympodial
conidiogenous cells, rather than phialides, indicates that it should be classified
in Periconiella rather than in Stachybotrys. Unlike Stachybotrys, which is defined
as having — without exception — unicellular conidia, the conidia of Periconiella
species are transversely non- to multi-septate (Ellis 1971). Examination of
the Stachybotrys cannae and Periconiella portoricensis type materials led the
author to conclude that these two species are conspecific due to their shared
conidiogenesis, conidial shape and size, as well as habitat and distribution.
Conidia of S. cannae were 16-20 x 7.5-10 um, while those of P. portoricensis are
17-20 x 7-10 um. Since H. portoricense (published in 1919) has priority over
S. cannae (published in 1957), Periconiella portoricensis is the correct name of
S. cannae (Vienna Code Art. 11.4).
Periconiella portoricensis was first described as Haplographium portoricense.
Toro (1932) transferred this species from Haplographium to Cephalotrichum.
However, this transfer was incorrect, because the species of Cephalotrichum
have annellidic (percurrently proliferating) conidiogenesis and synnematous
conidiophores (Kirk et al. 2008). Ellis (1967) proposed a new combination,
transferring H. portoricense to Periconiella. Because the description and
illustrations by Stevens & Dalbey (1919) and Batista & Vital (1957) were
not detailed enough to show clearly diagnostic characters such as conidial
orientation on conidiogenous loci, photographic illustrations and a detailed
description are provided here.
“Acrodesmis portoricensis (F. Stevens & Dalbey) M.B. Ellis ined.” is listed as
an obligate synonym of Periconiella portoricensis in Mycobank. Since “ined.”
refers to an unpublished name, “Acrodesmis portoricensis” is nom. inval.
Nomina Invalida
“Stachybotrys pallida” Orpurt, Studies on the soil microfungi of Wisconsin
prairies. Ph.D. dissertation, University of Wisconsin, pages 95-96 (1954), nom.
inval. (Vienna Code, Art. 30.5 and 36.1).
The valid name for this taxon is:
Stachybotrys elegans (Pidopl.) W. Gams, Compendium of Soil Fungi (London): 746
(1980).
= Hyalobotrys elegans Pidopl., Fungus flora of coarse fodder: 186 (1948).
Stachybotrys thaxteri sp. nov. (Trinidad) ... 247
= Hyalostachybotrys bisbyi Sriniv., J. Indian Bot. Soc. 37: 340 (1958).
= Stachybotrys bisbyi (Sriniv.) G.L. Barron, Mycologia 56: 315 (1964).
= Hyalostachybotrys sacchari Sriniv., J. Indian bot. Soc. 37: 341 (1958).
= Stachybotrys sacchari (Sriniv.) G.L. Barron, Mycologia 56: 315 (1964).
= Stachybotrys aurantia G.L. Barron, Can. J. Bot. 40: 258 (1962).
SPECIMENS EXAMINED: Canada. BRITISH COLUMBIA: Vancouver International Airport,
Straw from interior of cushings shipped from Thailand and seized at the airport, 13
January 1998, G. White, [DAOM 225565 (labeled as S. bisbyi)]. ONTARIO: from soil, J.A.
Traquair, [DAOM 222969]. Ottawa, isolated from serially washed roots of yellow birch,
November 1961, E.A. Peterson, [DAOM 87338 (labeled as S. bisbyi)]. Ottawa, CEF, from
soil, 18 August 1998, D. Overy, [DAOM 226830]. Egypt. from soil, 16 December 1965,
A.H. Moubasher, [IMI 116426 (labeled as S. sacchari)]. India. Gwalior, from soil, 15
September 1976, R.K.S. Chauhan, [IMI 206921]. Kenya. Nairobi, from Isoptera (Insecta),
7 November 1985, M.O. Kotengo [IMI 299091]. Pakistan. from Linum usitatissimum L.,
1965, M. Kamal, [IMI 114745 (labeled as S. sacchari)]. South Africa. from Saccharum
officinarum L., 19 January 1962, J.R. Anderson, [IMI 91211 (labeled as S. sacchari)].
USA. CoLorapo: Fort Collins, isolated from rhizosphere of Agropyron repens (L.) P.
Beauv., 1969, L.W. Durrell, [DAOM 129721 (labeled as S. bisbyi)]. NEw York: Ithaca,
isolated from soil, May 1962, WJ. Jooste, [DAOM 89199 (2 packets) (labeled as S.
bisbyi)]. Wisconsin: Columbia County, Morrisonville, isolated from soil of Mesic
Prairie, on corn meal potato dextrose, 6 August 1952, P.A. Orpurt, [(WIS 55), “holotype”
of “Stachybotrys pallida”).
COMMENTS— Examination of the type specimen of “S. pallida” (WIS 55) revealed
only mycelia, with both conidia and phialides lacking. The nomenclatural status
of “S. pallida” is therefore based on the English description and accompanying
illustrations in Orpurt’s dissertation. “Stachybotrys pallida” (= S. elegans) was
frequently isolated from the soils of the prairie in Wisconsin (Orpurt & Curtis
1957).
“Stachybotrys striatispora” Orpurt, Studies on the soil microfungi of Wisconsin
prairies. Ph.D. dissertation, University of Wisconsin, pages 93-94 (1954), nom.
inval. (Vienna Code, Art. 30.5 and 36.1).
The valid name for this taxon is:
Stachybotrys eucylindrospora D.W. Li, Mycologia 99(2): 333 (2007).
SPECIMENS EXAMINED: Canada. ALBERTA: Waterton National Park, Aspen parkland
picnic area, on Populus log, 4 August, 1980, G.P. White-696, [DAOM 176800a (2
packets)]. BrrrisH CoLumB1a: South Burnaby, Dahlia stems, 9 August 1957, S.J. Hughes,
[DAOM 56386éd (2 packets)]. ONTARIO: near Guelph. From peat soil, cedar bog, Nov.
1960, G.L. Barron, [DAOM 87664, holotype of Stachybotrys eucylindrospora]; Ottawa,
on stems of “Ligustrum officinale Lilach” (invalid pre-Linnaean name), 26 May 1983,
WI. Illman, [DAOM 186941]; St. Lawrence Islands National Park, MacDonald Is. Carya
ovata husks, 23 July 1979, S.J. Hughes, [DAOM 172376g]. QuEBEc: MacDonald College,
from soil, 1 June 1955, O.A. Olsen, [DAOM 70309 (as S. atra)]. United Kingdom:
ENGLAND— YORKSHIRE: Gundale, from Angelica sp., 18 October 1959, W.G. Bramley,
[IMI 79062 (labeled as S. atra)]; Pickering, from Heracleum sp., 3 July 1964, W.G.
Bramley, [IMI 107222]. USA. Wisconsin: Racine County, Mesic Prairie soil (isolated on
248 ... Li
corn meal potato dextrose), 23 August 1952, P.A. Orpurt, [(WIS 56 319-13), “holotype”
of “Stachybotrys striatispora”].
ADDITIONAL SPECIMENS EXAMINED: Israel. BEESHABA, soil, September 1953, S. Borat,
[IMI 76515, (labeled as Stachybotrys atra var. cylindrospora (C.N. Jensen) Rayss & Borut
1958 (= S. chartarum), the specimen on which the new combination was based) ]. USA.
New York, North Cohocton, arable soil, August 1911, C.N. Jensen, [CUP 5925, holotype
of Stachybotrys cylindrospora (= S. chartarum)].
COMMENTsS—According to Orpurt (1954) “S. pallida” was a common species
found throughout the prairie in Wisconsin, while “S. striatispora” (= S.
eucylindrospora) was isolated from only two locations. The former species was
occasionally isolated from indoor environments.
Although “S. striatispora” was proposed much earlier than S. eucylindrospora,
S. eucylindrospora is the valid name for this species due to the nomenclaturally
invalid status of “S. striatispora”. Orpurt (1954) examined a slide prepared by
Dr. Richard Korf from the holotype of Stachybotrys cylindrospora C.N. Jensen
as suggested by Dr. G.R. Bisby. He concluded that S. cylindrospora is a synonym
of S. atra (= S. chartarum). This conclusion is in agreement with the same
conclusion drawn by three other authors (Bisby 1943, Gilman 1945, Li 2007).
Discussion
Examination of the specimens from several major herbaria including 31
types has clarified the circumscriptions of the species presented in this paper.
In the author’s opinion, delineation of several Stachybotrys species, such as S.
lunzinensis Szilvinyi, remains doubtful due to the sketchy descriptions and/or
unavailable illustrations and type specimens. Further studies on these doubtful
species are needed. Without examining type materials of the species in question
or sequencing their DNA (if a culture were available), a nomenclature change
would be preliminary and thus add to the confusion.
Stachybotrys cannae may not be the last species transferred to a different
genus. One challenge is the availability and accessibility of type materials
collected in the 19" and early 20" centuries. A number of types collected at
much later times are missing or were destroyed by natural disaster, such as the
Kobe earthquake in Japan in 1995 (Matsushima pers. comm. 2008).
Acknowledgments
Theauthoris deeply indebtedto Dr. Bryce Kendrickand Dr. Rafael F. Castafieda Ruiz for
reviewing the manuscript. The author also expresses his sincere gratitude to the curators
and directors of following herbaria: The Farlow Herbarium (FH), Harvard University,
US. National Fungus Collections (BPI), University of Wisconsin (WIS), Herbarium of
the University of Illinois (ILL), Cornell University (CUP), The National Mycological
Herbarium, Ottawa, Canada (DAOM), UK (IMI), New Zealand Fungal Herbarium,
Landcare Research, New Zealand (PDD), Czech National Museum Herbarium, Prague,
Czech Republic (PREM), New York Botanic Garden (NY), the ARS Culture Collection
Stachybotrys thaxteri sp. nov. (Trinidad) ... 249
USDA (NRRL), Auburn University (AUA), University of Alberta (UAMH), Herbarium
of Institute of Microbiology, Chinese Academy of Sciences, Beijing, China (HMAS) for
specimen loans and to BPI and FH for providing the access to the mycological libraries
in their institutions for this study. The author is very grateful to Dr. Lorelei L. Norvell
for her editorial review, Dr. Shaun Pennycook for his nomenclature review, Dr. Weidong
Wu for scanning the descriptions of Stachybotrys species from Orpurt’s dissertation, and
support from Jiangsu Natural Science Foundation (BK2008243).
Literature cited
Barron GL. 1961. Studies on species of Helicodendron, Oidiodendron and Stachybotrys from soil.
Can. J. Bot. 39: 1563-1571. doi:10.1139/b61-136
Batista AC, Vital AF. 1957. Novas diagnoses de fungos Dematiacee. Anais da Sociedade de Biologia
de Pernambuco 15: 373-397.
Bisby GR. 1943. Stachybotrys. Trans. Brit. Mycol. Soc. 26: 133-143. doi:10.1016/S0007-
1536(43)80018-8
Corda ACJ. 1837. Icones fungorum hucusque cognitorum, vol. 1. Prague. 32 p.
Ellis MB. 1967. Dematiaceous hyphomycetes VIII, Periconiella, Trichodochium, etc. Mycol. Pap.
111: 1-46.
Ellis MB. 1971. Dematiaceous hyphomycetes. Wallingford, CABI.
Gilman JC. 1945. A manual of soil fungi. lowa State College Press, Ames, Iowa. 392 p.
Hansford CG. 1943. Contributions toward the fungus flora of Uganda. V. Fungi Imperfecti. Proc.
Linn. Soc., Lond. 155: 34-67.
Holmgren PK, Holmgren NH. 1998. Index Herbariorum: A global directory of public herbaria
and associated staff. New York Botanical Garden's Virtual Herbarium. http://sweetgum.nybg.
org/ih/
Index Fungorum. 2010. Index Fungorum. www.indexfungorum.org; accession date 3 August
2010.
Jiang YL, Zhang TY. 2009. Notes on soil dematiaceous hyphomycetes from Sichuan Province,
China. Mycosystema 28(5): 644-647.
Jong SC, Davis EE. 1976. Contribution to the knowledge of Stachybotrys and Memnoniella in
culture. Mycotaxon 3: 409-485.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the Fungi, 10 Edition. CABI,
Wallingford, UK.
Krzemieniewska H, Badura L. 1954. Przyczynek do znajomosci mikroorganizméw scidlki i gleby
lasu bukowego (A contribution to the knowledge of the microorganisms from the litter and soil
of beech wood). Acta Societatis Botanicorum Poloniae 23: 727-781.
Li DW. 2007. Stachybotrys eucylindrospora, sp. nov. resulting from a re-examination of Stachybotrys
cylindrospora. Mycologia 99: 332-339. doi:10.3852/mycologia.99.2.332
McKenzie EHC. 1991. Dematiaceous hyphomycetes on Freycinetia (Pandanaceae). 1. Stachybotrys.
Mycotaxon 41: 179-188.
McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH,
Prado J, Silva PC, Skog JE, Wiersema JH, Turland NJ. 2006. International Code of Botanical
Nomenclature (Vienna Code). Regnum Vegetabile 146. A-R.G. Gantner Verlag KG.
Mercado Sierra A, Mena Portales J. 1988. Nuevos o raros hifomicetes de Cuba. V. Especies de
Stachybotrys. Acta Bot. Cub. 55: 1-8.
Orpurt PA. 1954. Studies on the soil microfungi of Wisconsin prairies. Ph.D. dissertation, University
of Wisconsin. 138 p.
250 ... Li
Orpurt PA, Curtis JT. 1957. Soil microfungi in relation to the prairie continuum in Wisconsin.
Ecology 38(4): 628-637. doi:10.2307/1943129
Pinruan U, McKenzie EHC, Jones EBG., Hyde KD. 2004. Two new species of Stachybotrys, and a
key to the genus. Fungal Diversity 17: 145-157.
Robert V, Stegehuis G, Stalpers J. 2010. The MycoBank engine and related databases. http://www.
mycobank.org (accession date: 24 January 2010).
Saccardo PA, Berlese AN. 1885. Miscellanea mycologica. Series II. Atti R. Ist. Veneto Sci. Lett. Arti,
Ser. 6, 3: 711-742.
Stevens FL, Dalbey NE 1919. New or noteworthy Porto Rican fungi. Mycologia 11: 4-9.
doi: 10.2307/3753206
Verona O, Mazzucchetti G. 1968. I generi Stachybotrys e Memnoniella. Roma: Publicazioni dell’ Ente
Nazionale, per la Cellulosa e per la Carta, Laboratorio Di Cartotecnica Speciale. pp. 1-110.
Wang HE, Kong JH, Wu YM, Zhang TY. 2009. Notes on soil dematiaceous hyphomycetes from the
Qaidam Basin, Qinghai Province, China I. Mycosystema 28(1): 20-24.
Whitton SR, McKenzie EHC, Hyde KD. 2001. Microfungi on the Pandanaceae: Stachybotrys, with
three new species. New Zeal. J. Bot. 39: 489-499. doi:10.1080/0028825X. 2001.9512752
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 251-254 January-March 2011
DOT: 10.5248/115.251
Two new species of Phialophora from soil
YuE-MING Wu & TIAN-Yu ZHANG’
Department of Plant Pathology, Shandong Agricultural University, Taian, 271018, China
* CORRESPONDENCE TO:
[email protected]
ApsTRACT — Two new species, Phialophora microspora and P. nielamuensis, both from
soil in China are described and illustrated. The type specimens (dried cultures) and living
cultures are deposited in the Herbarium of Shandong Agricultural University Plant Pathology
(HSAUP). Isotypes are kept in the Herbarium of Institute of Microbiology, Academia Sinica
(HMAS).
Key worps — taxonomy, soil fungi, dematiaceous hyphomycetes
Introduction
Since Phialophora Medlar was erected in 1915, 86 epithets have been
proposed in the genus (Anonymous 2010). This genus is characterized by
possession of pigmented or hyaline colonies, weakly pigmented or hyaline,
thin-walled, branched conidiophores or simple phialides (which are discrete,
typically flask-shaped, with a distinct collarette), and one-celled, hyaline or
slightly pigmented conidia. In the course of a survey of soil dematiaceous
hyphomycetes in China, several unusual species of Phialophora were collected.
Two of them are described as new species, P microspora and P. nielamuensis.
Taxonomy
Phialophora microspora Y.M. Wu & TY. Zhang, sp. nov. Fic. 1
MycoBank MB 518896
Coloniae in PDA velutinae, leviter radiatis sulcais, griseo-olivaceae. Hyphae ramosae,
septatae, olivaceae, laeves vel modice scabrae, 2-3 um crassae. Conidiophora micronemata
vel semi-macronemata, mononemata, erecta, ex hyphis oriunda, simplicia, dilute brunnea,
laevia, verrucosa, 30-80 x 4-7 um. Cellulae conidiogenae monophialidicae, terminales
vel laterales, ex hyphis statim et singulatim oriundae, discretae, subcylindricae, gradatim
attenuatae versus apicem, subcollari modice angustatae, dilute brunneae, verrucosae, 20-
30 x 4-7 um, nonnumquam percurrenter proliferantiae; colla conspicua, infundibuliformia
252 ... Wu & Zhang
F ia. 1. Conidia, conidiophores, and conidiogenous cells of Phialophora microspora.
Left: drawings. Right: photomicrographs (Bars = 25 um).
vel ureceolata, paulo-obscura. Conidia unicellularia, globosa vel subglobosa, pallide
olivacea, hyalina, laevia, 2-3 x 1.5-2.5 um, coacervata in mucosa capitula.
Ho.otype: China. Tibet, Nielamu, from a mountain soil, altitude 2600 m, 14 Sept. 2007,
¥.M. Wu, HSAUPII ,,1381, holotype; HMAS 196259, isotype.
EryMo.ocy: The epithet refers to the small conidia of this species.
Colonies on PDA at 25°C for 28 days 3-5 cm diam., velvety, with faint radial
furrows, gray-olivaceous. Mycelium mostly superficial, partly immersed.
Hyphae branched, septate, smooth or sometime roughened, olivaceous, 2-3
um wide. Conidiophores semi-macronematous, mononematous, erect, arising
from the hyphae, simple or occasionally branched, light brown, verrucose,
30-80 x 4-7um. Conidiogenous cells monophialidic, terminal and integrated
or discrete borne directly on the hyphae, subcylindrical, gradually tapering
towards the apex and more or less constricted below the collarette, light brown,
verrucose, 20-30 x 4-7 um, sometimes proliferating percurrently; collarettes
conspicuous, funnel to vase-shaped, slightly darker. Conidia one-celled, globose
or subglobose, hyaline, smooth, 2-3 x 1.5-2.5 um, aggregated in slimy heads.
Phialophora microspora resembles P. richardsiae (Nannf.) Conant (Conant
1937) and P. benthica K.R. Millar (Millar 1990) in conidial colour and shape,
but the conidiogenous cells of these species are smooth, and the conidia of
P. microspora are smaller than those of either P. benthica (2.5-4 x 2-2.5 um) or
P. richardsiae (2.7-3.3 um) diam.
Phialophora spp. nov. (China) ... 253
w
2 e 9 8 @ .)
59 Oo 6
o
. (e)
Ss é
A Aro
0 &
is 5
Q. oN °
oN SO
Oghys @ @)
2
Fa LS i)
}
(e)
.@)
8
Fic. 2. Conidia, conidiophores, and conidiogenous cells of Phialophora nielamuensis.
Left: drawings. Right: photomicrographs (Bars = 25 um).
Phialophora nielamuensis Y.M. Wu & TY. Zhang, sp. nov. Fic. 2
MycoBank MB 518895
Coloniae in PDA velutinae, leviter radiatis sulcatis, griseo-olivacea. Hyphae ramosae,
septatae, olivaceae vel dilute bruneae, laeves, 1.5-3 um crassae. Conidiophora micronemata
vel semi-macronemata, mononemata, erecta, ex hyphis oriunda, simplicia, dilute brunnea,
laevia, 20-110 x 1.5-3 um. Cellulae conidiogenae monophialidicae, terminales vel
laterales, ex hyphis statim et singulatim oriundae, discretae, subcylindricae, gradatim
attenuatae versus apicem, subcollari modice angustatae, dilute brunneae vel subhyalinae,
laevia, 15-60 x 1.5-3 um, nonnumquam percurrenter proliferantiae; colla conspicua,
infundibuliformia vel ureceolata, paulo-obscura. Conidia unicellularia, pyriformia,
ellipsoidea vel subglobosa, hilo basilari plano, pallide olivacea, laevia, 3.5-5 x 2-2.5 um,
coacervata in mucosa capitula.
Ho.ortype: China. Tibet, Nielamu, from a grassland soil, altitude 2300 m, 14 Sept. 2007,
¥.M. Wu, HSAUPII ,,1354, holotype; HMAS 196258, isotype.
ETYMOLOGY: in reference to the type locality.
Colonies on PDA at 25°C for 28 days 3-5 cm diam., velvety, with faint radial
furrows, gray-olivaceous. Mycelium mostly superficial, partly immersed.
Hyphae branched, septate, smooth, olivaceous to light brown, 1.5-3 um wide.
Conidiophores micronematous to semi-macronematous, mononematous,
erect, arising from the hyphae, sometimes branched light brown, smooth, 20-
110 x 1.5-3 um. Conidiogenous cells monophialidic, integrated and terminal,
or discrete, subcylindrical, gradually tapering towards the apex and more or
less constricted below the collarette, light brown to subhyaline, smooth, 15-60
254 ... Wu & Zhang
x 1.5-3 um, sometimes proliferating percurrently; collarettes conspicuous,
funnel to vase-shaped, slightly darker. Conidia one-celled, pyriform, ellipsoidal
or subglobose, with a flat basal hilum, pale olivaceous, smooth, 3.5-5 x 2-2.5
um, aggregated in slimy heads.
This fungus resembles Phialophora japonica Iwatsu & Udagawa (Iwatsu &
Udagawa 1985) and P. taiwanensis Matsush. (Matsushima 1983) in conidial
morphology. However the former species has smaller conidia (1.5-3.5 x 1.2-2
tum), and the latter has larger (4.5-7 x 2-2.8 um), darker conidia.
Acknowledgments
The authors are grateful for pre-submission comments and suggestions provided by
Dr. Eric McKenzie, Prof. Y.L. Guo, and Dr. Shaun Pennycook. This project was supported
by the National Science Foundation of China (no. 30670014 & 30499340).
Literature cited
Anonymous 2010. Index Fungorum. http://www.indexfungorum.org/Names/Names.asp; accessed.
16 September 2010.
Conant GT. 1937. The occurrence of a human pathogenic fungus as a saprophyte in nature.
Mycologia 29: 597-598. doi: 10.2307/3754512.
Iwatsu T, Udagawa S. 1985. A new species of Phialophora from Japan. Mycotaxon 24: 387-393.
Matsushima T. 1983. Matsushima Mycological Memoirs No. 3.
Millar KR. 1990. A new species of Phialophora from lake sediment. Mycologia 82: 647-650. doi:
10.2307/3760056.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 255-258 January-March 2011
DOT: 10.5248/115.255
Phlebiopsis mussooriensis (Agaricomycetes),
a new corticioid species from India
PRIYANKA, G.S. DHINGRA’ & NAVNEET KAUR
Department of Botany, Punjabi University Patiala 147 002
“CORRESPONDENCE TO:
[email protected]
ABSTRACT - A new corticioid species, Phlebiopsis mussooriensis, is described from Mussoorie
in Uttarakhand.
Key worps - Company Garden, Cedrus deodara
While conducting the fungal foray in the Company Garden in Mussoorie of
Uttarakhand, India, Dhingra and Navneet made a collection from a decaying
log of Cedrus deodara. On the basis of macroscopic and microscopic characters
it was compared with species of Phlebiopsis and Phanerochaete (Eriksson et al.
1978 1981, Burdsall 1985, Dhingra 1987, Parmasto et al. 2009). As it could not
be assigned to any of the known taxa in these genera, it is here described as a
new species. With the addition of the new species to the four earlier reported
species, the total number from India has become five, a key to which is also
provided.
Phlebiopsis mussooriensis Priyanka, Dhingra & N. Kaur, sp. nov. Fics 1-5
MycoBank MB 517441
Basidiocarpum resupinatum, adnatum, effusum, ad 560 um crassum; hymenium
tuberculatum; systema hyphale monomiticum; hyphae ad 3.6 um latae, fibulae destitutae;
cystidia 40.0-62.0 x 7.2-10.9 um, subfusiformia vel fusiformia, encrustata; basidia 13.0-
26.7 x 3.3-5.0 um, clavata, 4-sterigmata; basidiosporae 5.0-7.1 x 2.5-3.8 um, ellipsoidae,
tenuitunicatae, inamyloidae, acyanophilae.
Type: India, Uttarakhand: Mussoorie, Company Garden, on a decaying log of Cedrus
deodara (Roxb.) G. Don (Pinaceae), Navneet 3405 (PUN, holotype), September 26,
2004.
EryMo.ocy: The epithet refers to ‘queen of hills? Mussoorie, in Uttarakhand where the
holotype was collected.
256 ... Priyanka, Dhingra & Kaur
Fics 1-4. Phlebiopsis mussooriensis: microscopic structures
1. basidiospores; 2. basidia; 3. cystidia; 4. vertical section through basidiocarp.
Phlebiopsis mussooriensis sp. nov. (India) ... 257
Fic. 5. Phlebiopsis mussooriensis: basidiocarp showing hymenial surface.
Basidiocarp resupinate, adnate, effused, up to 560 um thick in section; hymenial
surface smooth to somewhat tuberculate, grayish yellow, not changing to
purplish on putting a drop of 3% KOH solution, cracks appearing on drying;
margins thinning out to abrupt. Hyphal system monomitic; generative hyphae
up to 3.6 wm wide, branched, septate, without clamps; basal zone up to 290
uum thick, composed of compactly packed hyphae running parallel to the
substratum; subhymenium of irregularly branched, compactly packed vertical
hyphae; hymenium thickening with evenly distributed cystidia. Cystidia
40.0-62.0 x 7.2-10.9 um, numerous, subfusiform to fusiform, thin- to somewhat
thick-walled, especially at the base, naked when young to heavily encrusted
in the upper % portion when mature, immersed or projecting up to 45 um
from the hymenium. Basidia 13.0-26.7 x 3.3-5.0 um, narrowly clavate, apically
widened, thin-walled, 4-sterigmate, without basal clamp; sterigmata up to
5.0 um long. Basidiospores 5.0-7.1 x 2.5-3.8 um, ellipsoid, smooth, thin-
walled, inamyloid, acyanophilous.
REeMARKS—Phlebiopsis mussooriensis resembles members of the genus
Phanerochaete in producing a thickened hymenium with evenly distributed
encrusted cystidia, but the newly described species differs from the same by
a distinctly firm subiculum composed of narrow, thin-walled hyphae (up to
3.5 um wide). On the other hand, it is quite similar to Phlebiopsis himalayensis
258 ... Priyanka, Dhingra & Kaur
Dhingra in producing a smooth to somewhat tuberculate basidiocarp and
thick-walled encrusted cystidia, but the basidiospores of the latter species
are considerably shorter (3.5-4.75 x 2.5-3.0 um) than in the new species. In
addition, basidiocarp of P. himalayensis turns purplish on putting a drop of
3% KOH solution, a reaction that is not observed for P mussooriensis. The new
combination of features supports an independent species.
Consolidated key to the Indian species of Phiebiopsis:
1. Cystidia not massive (generally up to 10 um wide) .......... 00.0... e eee eee eee 2
1. Cystidia massive (more than 10 wm wide) ........ 00. cece eee eee eee 3
2. Hymenial surface turns purplish on putting a drop of 3% KOH solution,
basidiospores 3.5-4.75 X 2.5-3.0 HM... . eee eee eee eee P. himalayensis
2. Hymenial surface not changing color in 3% KOH solution,
basidiospores 5.0-7.1 x 2.5-3.8 MM ..... 0c. eee eee eee P. mussooriensis
3. Basidiospores broadly ellipsoid, 5-6 x 3.5-4.5 um ...........000. P. darjeelingensis
3. Basidiospores oblong-narrowly ellipsoid-sub cylindrical ................0.0.04. 4
4. Subiculum well developed ...... 00... ccc ccc cece ence een ees P. gigantea
4. Subiculum scanty or lacking ........ 00. ccc ee eee ee P. roumeguerei
Acknowledgements
Authors thank Prof. Nils Hallenberg (Gothenburg, Sweden) for valuable suggestions
and peer review; Prof. B. M. Sharma, Department of Plant Pathology, COA, CSKHPAU,
Palampur, H.P., India for peer review; Head, Department of Botany, Punjabi University,
Patiala, for providing research facilities.
Literature cited
Burdsall HH. 1985. A contribution to the taxonomy of the genus Phanerochaete (Corticiaceae,
Aphyllophorales). Mycologia Memoir No. 10. 165 p.
Dhingra GS. 1987. The genus Phlebiopsis in the Eastern Himalayas. Nova Hedwigia 44: 221-227.
Eriksson J, Hjortstam K, Ryvarden L. 1978. The Corticiaceae of North Europe — V. Fungiflora, Oslo
pp. 889-1047.
Eriksson J, Hjortstam K, Ryvarden L. 1981. The Corticiaceae of North Europe — VI. Fungiflora,
Oslo pp. 1051-1276.
Parmasto E, Nilsson H, Larsson KH. 2009. Cortbase: a nomenclatural database of corticioid fungi
(Hymenomycetes). Version 2.1 (Dec. 2009). http://andromeda.botany.gu.se/cortbase.html
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 259-262 January-March 2011
DOT: 10.5248/115.259
Pseudocolus fusiformis, an uncommon stinkhorn
new to Turkish mycobiota
ILGAZ AKATA™ & HASAN HUSEYIN DOGAN*
‘Ankara University, Science Faculty, Department of Biology, TR 06100, Ankara Turkey
*Selcuk University, Science Faculty, Department of Biology, TR 42031 Campus/Konya, Turkey
* CORRESPONDENCE TO:
[email protected]
AsstrActT — Pseudocolus fusiformis is the first representative of the genus to be recorded from
Turkey. The species is characterized by basidiocarps with three apical arms that are distally
fused and inner surfaces covered by a dark greenish mucoid gleba. A short description and
macro- and microphotographs are provided.
Key worps — Basidiomycota, biodiversity, new record, Phallales
Introduction
Pseudocolus Lloyd is asmall and uncommon stinkhorn genus, which includes
P. fusiformis, which is characterized by white to pale orange stem bearing
usually 3-4 apical arms united at the their tips and dark greenish mucoid gleba
covering the inner surface of the arms (Hemmes & Desjardin 2002, Meyers
2004, Phillips 2005). According to current checklists (Solak et al. 2007, Sesli &
Denchev 2010) and latest records (Uzun et al. 2010, Kaya et al. 2010), the genus
has not yet been reported from Turkey. Our recent collection of P. fusiformis,
therefore, constitutes the first report of the species and genus for Turkey.
Materials & methods
The fungi samples were collected from Yomra district of Trabzon province on the east
of Black Sea coast of Turkey. Specimens were photographed, and their morphological
and ecological properties were recorded in their natural habitats. Thereafter the samples
were taken to the laboratory for further investigation. Some reagents (distilled water,
Melzer’s reagent, 5% KOH) were used for microscopic investigation. Microphotographs
of basidiospores were taken under a light microscope (Leica DM 1000). The specimens
were identified based on their macroscopic and microscopic features and aided by
the literature (Sumstine 1916, Blanton 1977, Blanton & Burk 1980, Quadraccia 1983,
Hemmes & Desjardin 2002, Meyers 2004, Phillips 2005). A short description, images,
260 ... Akata & Dogan
habitat, geographical position, locality and collection date of the species are also
provided. All specimens were deposited at the herbarium of Ankara University (ANK).
Taxonomy
Pseudocolus fusiformis (E. Fisch.) Lloyd, Syn. Phalloids: 53 (1909). Fic. 1
= Colus fusiformis E. Fisch., Neue Denkschr. Allg. Schweiz.
Ges. Gesammten Naturwiss. 32(1): 64 (1890).
= Colus javanicus Penz., Ann. Jard. Bot. Buitenzorg 16: 160 (1899).
= Pseudocolus javanicus (Penz.) Lloyd, Mycol. Notes 2: 358 (1907).
= Anthurus javanicus (Penz.) G. Cunn., Proc. Linn. Soc. N.S.W. 56: 186 (1931).
= Pseudocolus rothae E. Fisch. ex Lloyd, Phalloids Australas.: 20 (1907).
“Colus rothae” E. Fisch., Neue Denkschr. Allg. Schweiz. Ges.
Gesammten Naturwiss. 33(1): 23 (1893), nom. inval.
= Colus rothae (Lloyd) Sacc. & Traverso, Syll. Fung. 19: 389 (1910).
= Anthurus rothae (Lloyd) G. Cunn., Proc. R. Soc. N.S.W. 56: 188 (1931).
= Colus schellenbergiae Sumst., Mycologia 8: 183 (1916).
= Pseudocolus schellenbergiae (Sumst.) M.M. Johnson,
Ohio Biol. Survey Bull. 22: 338 (1929).
= Pseudocolus jaczewskii Woronow, Izv. Kavkaz. Muz. 11: 196 (1918).
IMMATURE FRUIT BODY 12-16 mm broad, globose to subglobose, resembling
pear to egg shaped; peridium white to whitish gray or pale gray, thin, smooth,
opening irregularly along three seams; rhizomorphs whitish, filiform, attached
to the base. MATURE FRUIT BODY 40-70 mm height, forming a stalk with tapering
three united arms and a volva, arms 2-4 times length of stipe. Stalk white to
whitish gray or pale gray, 15-30 mm height, 5-20 mm wide, not extending
past volva, thin-walled, hollow, chambered, transversely rugose, flaring toward
the upper end. Arms are three in all samples, bright orange to red orange,
lanceolate, spongy, united at apex, cylindrical to flattened, transversely rugose
and chambered. GLEBA olive-green to dark green and slimy. VoLva white to
whitish gray or grayish, rugose and tough.
BasIpIosPporEs 2.8-3.2 x 4.9-5.6 um, ellipsoid, smooth, hyaline. BAsIDIA
with 6-8 spores.
Eco.oey solitary or scattered, on disturbed soil in deciduous, coniferous,
or mixed forests, gardens; also on old woodchip mulch, thick grass, leaf mulch
and humus.
SPECIMEN EXAMINED: TURKEY—rraszon: Yomra, [kisu Village: in common hazel
(Corylus avellana) garden, in soil, 40°56'30''N - 39°48'55”E, 84 m, 21 August 2009, leg.
Akata and Dogan, Akata 2141.
Discussion
Pseudocolus fusiformis is characterized by its onion shaped fruiting body
when young and 3-4 (occasionally up to 6) arms when mature (Blanton &
Burk 1980). From our measurements taken from 15 fresh specimens, the radius
of the four unopened onion shaped fruiting bodies averaged 12-16 mm. All
Pseudocolus fusiformis new to Turkey ... 261
Figure 1. Pseudocolus fusiformis: a,b. mature fruit body; c. immature fruit body; d. spores.
specimens bore only three arms. Mature fruit bodies measured 40-70 x 12-30
mmm, and the lengths of the arms were 34-57 mm. These results are confirmed
in Blanton & Burk (1980) and Quadraccia (1983).
In the literature, basidiospore sizes for P fusiformis are reported as 1.7-2 x
4.5-5 wm by Burk (1976), 1.8-2 x 3.2-5.5 um by Quadraccia (1983), and 1.5-2
x 3.75-4.5 um by Blanton (1977). The spore sizes in our collection —2.8-3.2 x
4.9-5.6 um — are greater than those given in the relevant literature.
This species appears not to require a specific habitat. Pseudocolus fusiformis
occurs in habitats possessing mulch, wood mulch, or humus, and has been
reported from Africa (La Réunion), Asia, Australia, Europe, North America,
and South America (Blanton & Burk 1980).
Acknowledgements
We would like to thank Mitko Karadalev, Abdullah Kaya, Gabriel Moreno, and
Shaun Pennycook for reviewing this article.
Literature cited
Blanton RL. 1977 (“1976”). Pseudocolus fusiformis, new to North Carolina. Mycologia 68:
1235-1239.
Blanton RL, Burk WR. 1980. Notes on Pseudocolus fusiformis. Mycotaxon 12: 225-234.
Burk WR. 1976. Pseudocolus javanicus in Connecticut and its distribution in the United States.
Mycotaxon 3: 373-376.
Hemmes DE, Desjardin DE. 2002. Mushrooms of Hawaii. Berkeley, CA, Ten Speed Press.
Kaya A, Uzun Y, Keles A, Demirel K. 2010. Three coprinoid macrofungi taxa, new to Turkey. Turk
J Bot 34: 351-354. doi:10.3906/bot-1001-276.
Meyers R. 2004. Pseudocolus fusiformis, the stinky squid. http://www.mushroomexpert.com/
pseudocolus_fusiformis.html (Accessed 25 May 2010).
262 ... Akata & Dogan
Phillips R. 2005. Mushrooms and other fungi of North America. Firefly Books.
Quadraccia L. 1983. Pseudocolus fusiformis (Fisch.) Lloyd in Italy. Micologia Italiana 12(2): 3-8.
Sesli E, Denchev CM. 2008. Checklists of the myxomycetes, larger ascomycetes and larger
basidiomycetes in Turkey. Mycotaxon 106: 65-67; on-line version: 1-133 pp. http://www.
mycotaxon.com/resources/checklists/sesli-v106-checklist.pdf (Accessed March 2010).
Solak MH, Isiloglu M, Kalmus E, All H. (2007). Macrofungi of Turkey Vol. 1. izmir. Universiteliler
Ofset.
Sumstine DR. 1916. A new species of Colus from Pennsylvania. Mycologia 8: 183-184.
Uzun Y, Demirel K, Kaya A, Giicin F. 2010. Two new genus records for Turkish mycota. Mycotaxon
111: 477-480.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 263-270 January-March 2011
DOT: 10.5248/115.263
New lichen records from Turkey — 2:
Aspicilia, Protoparmeliopsis, and Ramalina
AYHAN SENKARDESLER' & ORGUN FuaT CALBA?
Biology Department, Faculty of Science, Ege University, 35100 Izmir, Turkey
AsstTract— Lecanora albosparsa is lectotypified, the new combination Protoparmeliopsis
klauskalbii is proposed, and three species of lichen-forming fungi — Aspicilia albosparsa, P.
klauskalbii, and Ramalina carpatica — are reported as new to the lichen biota of Turkey
Key worps— Afyon, Ascomycetes, Batman, Diyarbakir, Elaz1g, Izmir, Sirnak, Usak
Introduction
Examination of last century collections from Turkeyin the herbaria of Vienna
(W, WU) has revealed Aspicilia albosparsa and Protoparmeliopsis klauskalbii as
species new to the Turkish lichen biota. These species and Ramalina carpatica
have also been recently collected by the authors.
Materials & methods
Specimens deposited in W and WU were studied in Vienna, while the type specimens
of Aspicilia albosparsa, deposited in BC, were studied in Barcelona. Fresh materials were
collected from Afyon and Usak provinces in 2009 and 2010 and deposited at the Aegean
University Herbarium (EGE).
The samples were identified using a stereomicroscope, a compound microscope,
and standard spot tests. Measurements were made on dry herbarium material or in
microscopic preparations in tap water. Hand sections were mounted in water or in
lactophenol-cotton-blue (Merck Rf. 13741). To study the ascus structure, Lugol’s solution
was added to sections and squash preparations after pre-treatment with 10% KOH.
The descriptions presented below are based on both original descriptions (Fritze &
Ilse 1870, Sipman 2007, Werner 1958) and our own observations.
For secondary metabolite study, high performance thin-layer chromatography
(HPTLC) was performed in accordance with Arup et al. (1993), using a CAMAG
Nanomat 4 sample applicator and CAMAG Horizontal Development Chamber.
264 ... Senkardesler & Calba
Taxonomy
Aspicilia albosparsa (Werner) S.Y. Kondr., Ukr. bot. Zh. 59: 603 (2002) Fic. 1
= Lecanora albosparsa Werner, Bull. Soc. Bot. France 105: 241 (1958).
Typus: Syrie, roches volcaniques du littoral prés Banias, 27.8.1938, R.G. Werner (BC!-
lectotypus, hic designatus; BC!-isolectotypus).
Key CHARACTERS— Thallus usually sterile, epilithic, crustose (becoming semi-
umbilicate occasionally) and squamulose, with dirty green to ochraceous brown
colours, with dominancy of white pseudocyphellae on the surface; hymenium
rather shallow to medium, up to 125 um, with non-moniliform paraphyses;
conidia rather short (6-9 um); secondary metabolites absent.
DEscRIPTION— ‘Thallus epilithic, crustose, sometimes becoming semi-
umbilicate (only seen in the collection locality from Usak!), areolate-efhigurate,
marginal lobes up to 2 mm long and slightly ascending, flat to slightly convex,
dirty green to ochraceous brown, epruinose; pseudocyphellae dominating
the surface, white, 1 to 8 in each areole, at first punctiform than becoming
elongated and joining into sinuous, branched lines; cortex unistratose,
paraplectenchymatous, constructed of perpendicular and moniliform hyphae,
up to 50 um tall, outer part up to 25 um brown; soredia and isidia absent;
prothallus not visible. Ascomata rare, with a black disc, at first punctiform and
concave, then slightly convex and up to 1 mm in diam.; excipulum hyaline, up
to 30 um broad, I-; hymenium 75-125 um tall, hyaline, I+ blue; epihymenium
Aspicilia-green, N+ green to blue-green; hypothecium distinct, shallow, to 40
um tall, hyaline, without algae, I-. Asci clavate, Aspicilia-type, 75-85 x 19-
25 wm, usually sterile; paraphyses septate, simple or branched, 2.5 um broad,
apical cells swollen, up to 3.8 um; mature ascospores not seen. Conidia straight
or slightly curved, 6-9 x 1.3 um.
SECONDARY METABOLITES— None detected by HPTLC. Spot tests K-, C-,
KC-, Pd-.
DIsTRIBUTION AND ECOLOGY— ‘This xerophytic species, known from Syria and
Turkey (Fic. 2), is perhaps common in the Eastern Mediterranean. It grows on
sun-exposed calcareous rocks up to 1700 m altitude in the eu-mediterranean to
the mediterranean-montane belt.
ADDITIONAL SPECIMENS EXAMINED— AFYON, BETWEEN CAGLAYAN & KEKLICEK
VILLAGES, Ist km, Kirag Mountain, 38°10.26’N, 30°10.48E, 1140 m, 25 June 2009, A.
Senkardesler (EGE 39726); BETWEEN MURATLI & KEKLICEK VILLAGES, Ist km, Kira¢
Mountain, 38°10.10’N, 30°08.67’E, 1490 m, 25 June 2009, A. Senkardesler (EGE 39728);
BETWEEN PAZARAGAG & INLI VILLAGES, 5th km, 38°31.80’N, 30°49.38’E, 1060 m, 25 May
2010, A. Senkardesler (EGE 39728); BATMAN, “in valle Sassun districtus Bitlis, ad rupes
prope vicum Goro” [on rock probably in environs of Sarryayla village], 1700 m, 12 Aug.
1910, H.E von Handel-Mazzetti Nr. 3305 (W 1929-15489); ELAZIG, near GOLDSCHIK
(=G6LcUK) VILLAGE, at subsaline lake with same name (source of western Tigris),
1350 m, 28 July 1910, H.E von Handel-Mazzetti Nr. 2543 (W 1920-00704); SIRNAK,
DsCHESIRET-IBN-OMAR (Cizre), ca. 400 m, 21 Aug. 1910, H.E von Handel-Mazzetti
New lichen records — 2 (Turkey) ... 265
FicureE 1: Aspicilia albosparsa. (a) Lectotype: white, punctiform to jointed pseudocyphellae
dominate the surface of the crustose thalli (BC); (b) Semi-umbilicate form with mainly
punctiform pseudocyphellae (EGE 39729); scale bars = 2 mm.
266 ... Senkardesler & Calba
Nr. 3082 (W 1929-15643, WU 41317); Usax, between ORMANDAMI & UGKUYULAR
VILLAGES, 3rd km, 38°47.28’ N, 29°06.24’ E, 920 m, 22 Apr. 2010, A. Senkardesler (EGE
39730).
REeMARKS— (1) Aspicilia albosparsa, which is not included in any identification
key, is characterized by a usually sterile, epilithic, crustose (occasionally
becoming semi-umbilicate) and areolate-effigurate thallus with dirty green
to ochraceous brown colours, a surface largely covered by conspicuous white
pseudocyphellae, a rather shallow to medium (< 125 um thick) hymenium with
non-moniliform paraphyses, rather short conidia (6-9 um), and the absence of
secondary metabolites.
(2) The species is morphologically similar to A. maculata (H. Magn.)
Oxner, A. sphaerothallina (J. Steiner) Szatala, and A. syriaca (J. Steiner) Szatala.
Aspicilia albosparsa differs from these species by one or more of the following
characters: white pseudocyphellae, shorter conidia (8-12 um in A. maculata,
7-13 wm in A. sphaerothallina, and 8-15 um in A. syriaca) and a shallower
hymenium (100-120 um in A. maculata, 140-190 um in A. sphaerothallina,
and 140-180 um in A. syriaca).
(3) Specimens seen in the Natural History Museum in Vienna (W) and
the University of Vienna Herbarium (WU) in 2007 and 2008 were labeled
“Lecanora (Aspicilia) pseudocyphellata J. Steiner”, a perfect name reflecting
its main key character but one that was never published. In 2009 the author
found a suitable type in the herbarium of Guy Roger Werner (BC), labeled as
Lecanora albosparsa, which was later transferred to Aspicilia in Kondratyuk &
Zelenko (2002).
(4) The localities of the specimens collected by H.F. von Handel-Mazzetti
cause problems, because many village names are no longer in use or unusually
spelt. A map deposited in W provided some information about these localities.
The locality “Goro” lies about 50 km east of Bitlis province; this information
directs the author to the surroundings of Sartyayla village within Batman
province. The locality “Géldschik” corresponds to the present village Gélctik in
Elazig province; the lake indicated in the label is currently called Hazar Lake,
lying just east of Golctik. Dschesiret-ibn-Omar is the former name of Cizre
village in Sirnak province.
Protoparmeliopsis klauskalbii (Sipman) Senkard., comb. nov. Fic. 3
MycoBank MB 518655
= Lecanora klauskalbii Sipman, Biblioth. Lichenol. 96: 270 (2007).
Typus: Greece, W Aegean, Nomos Evvias, Eparchia Karistias, S Evvia, Aetés, alt. ca. 20
m, schist rock outcrops along the coast and in phrygana, 23.09.2005 H. Sipman & Th.
Raus no 54654 [B-holotype].
Key CHARACTERS— Thallus placodioid, brown, without pruina; areoles with
white margins and non-swelling lobes with black lower side; apothecia with
New lichen records — 2 (Turkey) ... 267
Q pens
. By
& ©
oS i
S No GS oe
2% ft
Cam $ ae 0 125 250 500Kilometers
Ficure 2. Distribution of Aspicilia albosparsa (WH) and Protoparmeliopsis klauskalbii (A= Specimens
examined, @= Locality cited in Sipman 2007)
brown discs; lecanoric acid present (in Turkish specimens) (C+ orange to
reddish), usnic and norstictic acids absent (K-, KC-).
DescRIPTION— Provided by Sipman (2007).
SECONDARY METABOLITES— Zeorin, lecanoric acid and unknown fatty acids.
Spot tests K-, C+ orange to reddish, KC+ orange to reddish, Pd-.
DIsTRIBUTION AND EcoLocy— ‘This species, known from the Aegean island
of Evvia (Greece) and three localities in the western and eastern central
highlands of Turkey (Fic. 2), is probably widespread throughout the eastern
Mediterranean.
SPECIMENS EXAMINED— AFYON, between ATAKOY & KUGUKKALECIK VILLAGES,
2nd km, Kumalar Mountains, 38°40.99’ N, 30°32.78 E, 1140 m, 23 June 2009, A.
Senkardesler (EGE 39731); between BUYUKKALECIK & KOCATEPE VILLAGES, 3rd km,
Kumalar Mountains, 38°40.06’ N, 30°28.30’ E, 1700 m, 23 June 2009, A. Senkardesler
(EGE 39732). DIYARBAKIR, near GORO VILLAGE [close to CATAKKOPRU VILLAGE] in
Sassun valley, ca. 700 m, 08 Aug. 1910, H.E von Handel-Mazzetti Nr. 3308 (WU 41350,
labelled as Lecanora riparia, published in Steiner (1921); specimen attached with a note
of Bruce Ryan in 1992 as “Holotype of Lecanora steineri ined?. W 1929-15537, labelled
as Lecanora riparia, published in Steiner (1921); specimen annotated by Bruce Ryan in
1992 as “Isotype of Lecanora steineri ined.’).
RemMaRKs— (1) Protoparmeliopsis klauskalbii, not yet included in any
identification key, differs from Lecanora graeca J. Steiner and L. placentiformis
J. Steiner by the absence of norstictic acid and from other placodioid species
of Lecanora Ach. and Protoparmeliopsis M. Choisy by the absence of usnic
acid and the presence of lecanoric acid. It differs from related species known
from Turkey and adjacent regions by the combination of a brown thallus with
white areole margins, non-swelling lobes, and a black underside. Lecanora
bolcana (Pollini) Poelt, L. dispersoareolata (Schaer.) Lamy, L. garovaglii (K6érb.)
Zahlbr., L. graeca, Protoparmeliopsis achariana (A.L. Sm.) Moberg & R. Sant.,
P. laatokkaensis (Rasanen) Moberg & R. Sant., P macrocyclos (H. Magn.) Moberg
& R. Sant., and PB muralis (Schreb.) M. Choisy are not brown and their areoles
lack white margins; unfortunately, old herbarium material of these 8 species
268 ... Senkardesler & Calba
Ficure 3: Protoparmeliopsis klauskalbii. Thallus margin (W 1929-15537); scale bar = 2 mm.
often becomes brownish, so that TLC/HPTLC analyses become necessary to
differentiate them from P. klauskalbii. Lecanora placentiformis is also brown but
its areolar margins are not white.
(2) The Turkish material seems to deviate by the presence of lecanoric acid,
a substance not reported by Sipman (2007).
(3) Choisy (1929) briefly described the genus Protoparmeliopsis as having
a placodioid and submembranous thallus with hypothecium containing
photobionts [“Thalle submembraneux, lacinié divisé au pourtour, straminé,
apothécies vulgairement pénétrées par les gonidies dans Phypothécium.”]”
and as type species proposed P muralis, which has long (< 25 um), curved
pycnoconidia. Hafellner & Tiirk (2001) and Santesson et al. (2004) have
recently proposed many new combinations, and the genus has been accepted
in numerous local floristic studies. According to Sipman (2007), P. klauskalbii
is closely related to P muralis and fits well in Protoparmeliopsis even in a
narrower concept of the genus. Therefore we do not hesitate to propose this
new combination even in the absence of one generic character—the straw-like
colour (presence of usnic acid). Other transfers to Protoparmeliopsis will be
made in future papers.
(4) Steiner used the name Lecanora riparia (Flot.) J. Steiner for specimens
related to “Lecanora muralis” with a brown colour and whitish margins,
New lichen records — 2 (Turkey) ... 269
conspecific with P. klauskalbii (specimens seen by the authors in W and WU).
However, this name is not applicable because the type specimen is from Central
Europe, where P. klauskalbii does not occur. Bruce Ryan, who reinvestigated
these specimens using TLC and annotated some as “Lecanora steineri B. Ryan
ined.,.” died before he could publish his species. Later, Sipman (2007) realized
that the usnic acid-lacking, brown, white-margined specimens collected in
Greece should be treated as a distinct species, for which he proposed the name
Lecanora klauskalbii.
(5) As mentioned above, recognition of the collection localities of H.E von
Handel-Mazzetti is problematic. The map deposited in W situates “Batman
K6éprt” about 15 km east of Mejafarkin (currently known as Silvan). It is inside
the province of Diyarbakir, close to the border with Batman, a location that
matches the current environs of Catakkoprii.
Ramalina carpatica Korb., in Fritze & Ilse, Verh. Zool.-Bot. Ges. Wien 20: 501
(1870).
TYPE: “Mittelgrat”, Vysoké Tatry, Slovakia, 1863, leg. Hausknecht & Fritze [W? not
seen].
Key CHARACTERS— ‘Thallus epilithic, erect, with distinctly blackened branch
tips, lacking soredia, isidia and pseudocyphellae; apothecia apical, occasionally
blackening like the tips of branches; ascospores kidney-shaped.
DescripTION— Thallus epilithic, shrubby, tufted, erect, up to 9 cm high;
branches usually single, thick, smooth to unevenly pitted, hollow, cylindrical
or rarely flattened at the base, not dorsiventral and not filamentous; soredia,
isidia and pseudocyphellae absent; tips of the branches distinctly blackened;
cortex plectenchymatous of perpendicular hypes, thin, indistinct, overlaying
a strongly developed and cylindrical zone of prosoplectenchymatous tissue
including the photobiont zone; photobiont trebouxioid. Ascomata apothecia,
frequent, apical, partly blackened, shortly stalked, disc pale green or blackened.
Asci elongate-clavate, Bacidia-type, 8-spored. Ascospores 1-septate, kidney-
shaped, colourless, 11-16 x 5-7 um.
SECONDARY METABOLITES— None detected by HPTLC. Spot tests K-, C-, KC-
, Pd-. Earlier studies report evernic, obtusatic and usnic acid for this species
(Culberson 1970). Our material seems to belong to a deficient strain.
DIsTRIBUTION AND ECOLOGY— ‘This species, previously known only from
Poland to Greece in the Carpathian Mountains and the Balkans (Keissler 1959,
Abbott 2009), is reported here for the first time from Turkey. It is a saxicolous
species from wind-exposed cliffs of acidic silicate rocks.
SPECIMEN EXAMINED— Izmir, Bozdag Mountains, between YILANLI & DOKUZLAR
VILLAGES, Ist km, 38°18.22’ N, 28°07.45’ E, 2063 m, 11 May 2009, S. G. Senol, conf. O.
Blum (EGE 39733).
270 ... Senkardesler & Calba
REeMARKS— (1) Ramalina carpatica is easily recognizable at first glance by its
habit on siliceous rocks and its blackening tips and apothecia. The collected
specimens, reaching up to 9 cm tall, are the longest reported for this species.
(2) The identification of this species was confirmed by Prof. Dr Oleg Blum
(Kiev).
Acknowledgements
I thank Dr Laszl6 Lékés (Budapest) and Dr Harrie J.M Sipman (Berlin) for reviewing
this paper. Dr Harrie J.M Sipman (Berlin) is acknowledged for his useful comments
on Protoparmeliopsis klauskalbii, Dr Serdar G. Senol (Izmir) for collecting Ramalina
carpatica and Dr Oleg Blum (Kiev) for the confirmation of R. carpatica. The study in the
Institut Botanic de Barcelona was supported by the Ege University (09 FEN 055), that
in the Herbarium of the Natural History Museum Vienna was financed by the mobility
program of The Scientific and Technological Research Council of Turkey (TUBITAK),
that in the University of Vienna Herbarium was awarded by the Synthesys Project
(http://www.synthesys.info/) which is financed by the European Community Research
Infrastructure Action under the FP6 “Structuring the European Research Area”
Programme, while the specimens from Afyon and Usak provinces were collected in the
framework of the TUBITAK Research Project No 1061628 and by the Ege University
(08 BIL 025).
Literature cited
Abbott BFM. 2009. Checklist of the lichens and lichenicolous fungi of Greece. Biblioth. Lichenol.
103. Berlin/Stuttgart. J. Cramer Verlag.
Arup U, Ekman S, Lindblom L, Mattsson J-E. 1993. High performance thin layer chromatography
(HPTLC), an improved technique for screening lichen substances. Lichenologist 25(1): 61-71.
doi:10.1006/lich.1993.1018
Choisy M. 1929. Genres nouveaux pour la lichénologie dans le groupe des Lecanoracées. Bull. Soc.
Bot. France 67: 521-527.
Culberson CE. 1970. Supplement to “Chemical and Botanical Guide to Lichen Products”. Bryologist
73: 177-377. doi:10.2307/3241261
Fritze R, Ilse H. 1870. Karpaten-Reise. Gemeinschaftlich ausgefiihrt im Juli und August 1868 und
beschrieben. Verh. K.K. Zool.-Bot. Ges. Wien 20: 467-526.
Hafellner J, Turk R. 2001. Die lichenisierten Pilze Osterreichs — eine Checkliste der bisher
nachgewiesenen Arten mit Verbreitungsangaben. Stapfia 76: 1-167.
Kondratyuk SY, Zelenko SD. 2002. New lichens and lichenicolous fungi from Israel and the Near
East. Ukr. Bot. Zhurn. 59: 598-607.
Keissler K. 1959. Usneaceae. 321-480, in Dr. L. Rabenhorst’s Kryptogamen-Flora von Deutschland,
Osterreich und der Schweiz. IX. Band, 5. Abteilung, 4. Teil, Lieferung 3. Leipzig, Akademische
Verlagsgesellschaft Geest & Portig.
Santesson R, MobergR, Nordin A, Tensberg T, Vitikainen O. 2004. Lichen-formingand lichenicolous
fungi of Fennoscandia. Uppsala, Museum of Evolution, Uppsala University, Uppsala.
Sipman HJM. 2007. New lecanoroid lichens from Greece. Bibliotheca Lichenologica 96: 267-277.
Steiner J. 1921. Lichenes aus Mesopotamien und Kurdistan sowie Syrien und Prinkipo. Ann.
Naturhist. Mus. Wien 34: 1-68.
Werner RG. 1958. Notes de lichénologie libano-syrienne. V. Bull. Soc. Bot. France 105(5-6):
238-243.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 271-279 January-March 2011
DOT: 10.5248/115.271
Tropical Trametes lactinea is widely distributed
in the eastern USA
JosEF VLASAK* & Jikf KouT3
‘Biol. Centre of the Academy of Sciences of the Czech Republic &’ University of South Bohemia,
Faculty of Science, Branisovskd 31, CZ-370 05 Ceské Budéjovice, Czech Republic
2University of West Bohemia, Faculty of Education, Department of Biology,
Klatovské 51, CZ-306 19 Pilsen, Czech Republic
* CORRESPONDENCE TO:
[email protected]
ABsTRACT — Trametes lactinea is reported from the USA for the first time. This large and
conspicuous polypore, known until now only from tropical regions, was collected in many
different localities in eastern USA. ITS region of six collected specimens and four others
from public and private herbaria was sequenced and compared with the sequences in the
GenBank. Important macro- and micro-characteristics that discriminate between T. lactinea
and its similar species T. elegans are pointed out and discussed.
Key worps — Basidiomycota, USA new record, taxonomy, invasive species
Introduction
Since 2001, we have occasionally collected in the eastern USA (from Virginia
to Connecticut) a very large (< 7 cm thick, < 20 cm wide), white to light greyish
Trametes species with a velutinous but not hirsute pileus and large, regular pores
that appear a bit brownish when old. The collections, which were always sterile,
could not be identified using the keys for USA Trametes species. In early spring
2009 when travelling around southern Florida we noted a great abundance of
a very similar, but thinner and fertile, Trametes sp. that was in many localities
the dominant fungus on both hardwoods and pines. In this article we present
evidence that both the early spring/southern and the autumn/northern USA
collections represent the same species, Trametes lactinea, that is, accordingly,
widely distributed in the eastern USA and locally very common, in contrast to
literature data.
Trametes lactinea is a typical Trametes species with a white tough context,
white tomentose pileus, and large pores. Described from Sri Lanka (Berkeley
1843), it was reported as common in the tropics of East Asia and Australia, rare
272 ... Viasdk & Kout
TABLE 1. Trametes lactinea and T. elegans specimens examined.
SPECIMEN
T. lactinea
PRM560783
Damm 8936
Damm 4703
V0108/8-H
V0309/130-J
V0309/186A
V0312/28.2-J
V0410/11-J
V0709/179
V0808/29
0809/50
0904/23
0904/24
0904/27
0904/43 =
PRM915660
0904/79
0904/93
V0904/120
V0904/127
V0409/145 =
PRM915661
V0904/146
V0904/147
V0904/148
V0904/148A
T. elegans
PRM871961
PRM887367
6069-Dammrich
V0212/37-J
V0411/2-Ja&Ro
V0511/2-Kop
*
4
10
11
12
13
LocaLity
Fungi of west Pakistan
15286, coll. S. Ahmad
Mahé, Beau Vallon, Seychelles
Mauritius Island
Valley Forge, PA, USA
Hatfield Apartments, Hatfield, PA, USA
Promised Land St. Park, Pike
County, PA, USA
Tree Tops Park, Miami, FL, USA
Mason Neck St. Park,
Woodbridge, VA, USA
Mason Neck St. Park,
Woodbridge, VA, USA
Swamp Creek, Schwenksville, PA, USA
Yale Univ. arboretum,
New Haven, CN, USA
Royal Palm, Everglades N.P., FL, USA
Royal Palm, Everglades N.P, FL, USA
Royal Palm, Everglades N.P, FL, USA
Long Pine Key, Everglades N.P., FL, USA
Long Pine Key, Everglades N.P., FL, USA
Long Pine Key, Everglades N.P., FL, USA
East Main Tram, Fakahatchee
Strand Preserve, FL,USA
Collier-Seminole St. Park, FL, USA
Myakka River St. Park,
Sarasota Co., FL, USA
Myakka River
Sarasota Co.,
Myakka River
Sarasota Co.,
Myakka River
Sarasota Co.,
Myakka River
Sarasota Co.,
L, USA
L, USA
HwHamnmnN aw
Esmeralda pr. Camagtiey,
Mt. California, Cuba
Pico Perillo, Sierra del
Escambray, Cuba Centr.
Ko Samui, Thailand
Gainsville, FL, USA
Cameroon Highlands, Malaysia
Ecuador
SUBSTRATE
Morus alba
Cocos
hardwood
Populus
Carya
beech
Casuarina
Nyssa
hardwood
oak
beech
hardwood
hardwood
hardwood
pine
pine
pine
hardwood
pine
ive oak
ive oak
ive oak
ive oak
ive oak
Eugenia
hardwood
hardwood
Carya
hardwood
hardwood
COLLECTED
27.11.1961
10.I1.2008
13.I1.2000
1.VIL.2001
18.IX.2003
22.1X.2003
28.X11.2003
9.X.2004
22.1X.2007
28.VIIL.2008
13.IX.2008
19.IV.2009
19.IV.2009
19.IV.2009
19.IV.2009
21.1V.2009
22.1V.2009
22.1V.2009
23.1V.2009
24,1V.2009
24. 1V.2009
24. 1V.2009
24. 1V.2009
24, 1V.2009
14.X.1966
51.1967
15.I1.2002
20.X11.2002
27.X1.2004
3.X1.2005
* Numbers indicate sequenced specimens. Bold numbers indicate specimens with ribosomal RNA
ITS region sequence deposited in GenBank: 2 = HM756192, 3= HM756193, 10 = HM756191,
11=HM756196, 12 = HM756194, 13 = HM756195. Sequences 1, 4, 6, 7, 8 are identical with published
sequence AY684178; sequences 5, 9, 10 are also identical.
Trametes lactinea in eastern U.S.A. ... 273
in southern China and Africa, but not occurring in tropical America (Corner
1989, Dai 2009, Dai et al. 2004, Ryvarden 1976, Ryvarden & Johansen 1980).
Since 2000, its occurrence in South America has slowly been acknowledged
(Ryvarden 2000, 2001), but there are no previous records for the USA. We have
compared our USA collections with three standard T. lactinea samples from
public and private herbaria, including ITS region sequencing, and found that
they are identical. We also show that other sequences in the GenBank annotated
as T! lactinea are often derived from another species, Trametes elegans (Spreng.)
Fr., and so we summarize here the most important characteristics that allow to
discriminate these two species. Comments regarding other lenzitoid Trametes
species are also provided.
Materials & methods
Specimens studied
We collected 13 fertile specimens of T. lactinea in early spring 2009 in Florida and
nine other sterile specimens from various states of eastern USA from late summer
through early winter during 2001, 2003, 2004, 2007, and 2008. We also studied one
sample (unfortunately sterile) of T’ lactinea obtained from PRM collection in Prague
and one fertile sample from Frank Dammrich private collection that was reputedly
determined by Prof. Ryvarden. We have also inspected some typical samples of similar
T. elegans (TaBLE 1) and one aberrant sample from the Dammrich collection labeled
as T. menziesii (Berk.) Ryvarden. Pieces of dried basidiocarps mounted in water were
examined microscopically and 20 basidiospores from each specimen were measured.
One drop of 10% KOH was added to study the swelling of skeletal hyphae. Specimens
are deposited in the private herbarium of the first author (http://mykoweb.prf.jcu.cz
/polypores) and PRM (TaBLe 1).
ITS amplification and sequencing
0.25 g of the context tissue from dried specimens was frozen and disintegrated 60 s
with steel ball in mixer mill MM301 RETSCH under liquid nitrogen. DNA was isolated
using CTAB/NaCl extraction buffer as described by Murray & Thompson (1980),
followed by repeated extraction with chloroform and isopropanol precipitation. Crude
DNA was dissolved in 100 ul of sterile water and further purified using Wizard Clean
Up kit PROMEGA. Resulting DNA solution (50 ul) was diluted ten times and 1 ul was
used as template for amplification with ITS1 and ITS4 primers (White et al. 1990) in 25
ul reaction mixture using 55°C annealing temperature. Amplified DNA was purified
using Wizard Clean Up kit PROMEGA and sequenced in the Genomics laboratory of
Biology Centre, Academy of Sciences of the Czech Republic, Ceské Budéjovice, on ABI
3730xl DNA analyzer, using BigDye Terminator 3.1 kit.
ITS sequence analysis
The sequences were aligned by Clustal X and manually pruned. The evolutionary
history was inferred using the Neighbor-Joining method (Saitou & Nei 1987). The
evolutionary distances were computed using the Maximum Composite Likelihood
method (Tamura et al. 2004). All positions containing gaps and missing data were
274 ... Viasdk & Kout
eliminated from the dataset (complete deletion option). There were a total of 454
positions in the final dataset. Phylogenetic analyses were conducted in MEGA4 (Tamura
et al. 2007).
Taxonomy
Ryvarden & Johansen (1980) and Corner (1989) published very good
descriptions of Trametes lactinea; here we compile the most important features
and add some new characteristics based on our own observations of many
fresh USA specimens.
Trametes lactinea (Berk.) Sacc. FIGURE 1
Photos in (http://mykoweb.prf.jcu.cz/polypores)
BASIDIOMES annual to biennial, solitary to more rarely imbricate (when
growing on short stumps), pileate, broadly to narrowly attached, 1-25 cm
broad and wide, and 0.5-2 cm thick (exceptionally up to 7 cm thick at the
base in specimens from the Northern USA), hard corky; pILEus semicircular,
mostly applanate but sometimes rather thick at the base, surface velvety, but
with no hairs visible under 20x lens, becoming warted with age, sometimes
with irregular outgrows especially near the base, azonate or very slightly
concentrically sulcate, sometimes with narrow greyish zones near the margin
or with wide, concentric furrows that mark periods of an intensive growth;
MARGIN obtuse and thick at first, sterile below, later sharpened, with pores
developed to the very edge; porgs at first white, later cream to ochraceous and
darker than the upper surface, at first round, thick-walled, later with wedge-
narrowed edges, in old specimens thin-walled, distinctly angular, but never
labyrinthine, 2-3 per mm; TUBEs concolorous with the context, 6-12 mm long;
CONTEXT 5-20 mm, sometimes up to 60 mm thick, white, corky.
Hyphal system trimitic, GENERATIVE HYPHAE clamped and thin-walled,
1-3 um in diam.; SKELETAL HYPHAE abundant, hyaline, mostly with only
moderately thickened walls, 4-6 um in diam., but sometimes 3-4 um broad
and almost solid. After adding 10% KOH the solid hyphae swell to 10-15 um
in diam. and shrink quickly in vivid movements; in moderately thickened
hyphae the swelled walls only fill the hole but the outer diameter remains
unchanged. BINDING HYPHAE abundant, hyaline, thick-walled, arboriform, 1-5
um in diam.; BAsIDIA clavate, 4-sterigmate, 12-16 x 5-7 wm; CYSTIDIA none;
BASIDIOSPORES oblong-ellipsoid to cylindric, hyaline, negative in Melzer’s
reagent, 5-7 x 2.5-3.2 um, thin-walled.
Differentiation between Trametes lactinea and Trametes elegans
Because Trametes lactinea keys in the American literature as T. elegans
(Gilbertson & Ryvarden 1987), we summarize here the most important
characteristics ofboth species. Spores are clearly diagnostic — they are distinctly
Trametes lactinea in eastern U.S.A... 275
Ficure 1: Trametes elegans PRM 887367 (A): basidiospores. Trametes lactinea (B): a. basidiospores,
b. skeletal hyphae, c, d. binding hyphae.
larger in T: lactinea (usually > 6 um x 3 um) and more curved and smaller (< 6
um x 2.5 um) in T. elegans (Fic. 1). Basidia of T. elegans are also quite small, only
8-13 x 4-6 um. Unfortunately, many collections of both species are completely
sterile. Trametes lactinea does not have hyphal pegs but all 6 studied specimens
of T. elegans had pegs in the tubes that could be best seen on cut tubes under
lens as scattered warts or protuberances on tube sides. Although this feature
has never been mentioned in T° elegans descriptions, we regard it as rather
constant. Pores of T. lactinea change in the course of basidiocarp development
from thick-walled, round, and white to relatively thin-walled, angular, and
brownish, but they are never labyrinthine, whereas in T' elegans they are
mostly lamellate and when poroid, they are a bit elongated or labyrinthine at
least in part of the fruitbody. The KOH reaction is only moderate in T! elegans:
the hyphae swell slightly, without shrinking accompanied by quick hyphal
movements. Unfortunately, the typical swelling reaction of T: lactinea skeletal
hyphae is much weaker or less striking in very old herbarium specimens. The
pileus surface of T. lactinea is quite variable but never glabrous, as it appears in
most specimens of T. elegans (and never hirsute like by T: gibbosa (Pers.) Fr.).
276 ... Viasdk & Kout
1. T. lactinea PRM560783 Pakistan
GQ982888* T. lactinea Thailand
2. T. lactinea Damm8936 Seychelles
5. T. lactinea JV041011J Virginia
GQ982887* T. lactinea Thailand
8. T. lactinea JV090424 Florida
AY684178* T. "elegans" Tennessee
6. T. lactinea JV080829 Pennsylvania
7. T. lactinea JV080950J Connecticut
36
T.lactinea clade BI 10. T. lactinea JV0904145 Florida
9, T. lactinea JV090443 Florida
4. T. lactinea JV0309186A Pennsylvania
EU661879* T. “elegans” China
Liege GU731566* Lenzites sp.
66'3. T. lactinea Damm 4703
FJ372692* T. "lactinea" Thailand
—-"| FJ372691* T. "lactinea" Thailand
12. T. elegans Damm6069 Thailand
13. T. elegans JV021237J Florida
GU731565* L. elegans
FJ711054* L. elegans
11. T. elegans PRM887367 Cuba
FJ711055* L. elegans
AY684170* T. hirsuta
FJ608587* T. versicolor
GU067734 L betulinus Sweden
GU731576* T. gibbosa
100 ' AY684176* T gibbosa
T. elegans clade
93
+—_
0.005
Ficure 2: Evolutionary relationships of 28 Trametes species based on ITS region sequence. The
bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary
history of the taxa analyzed. The percentage of replicate trees in which the associated taxa
clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The tree
is drawn to scale, with branch lengths in the same units as those of the evolutionary distances
used to infer the phylogenetic tree. The evolutionary distances are in the units of the number
of base substitutions per site. Accession numbers with * represent sequences retrieved from
GenBank. Other GenBank accession numbers are in TABLE 1.
ITS sequence analysis
Allour collections and one PRM herbarium specimen from Pakistan showed
striking sequence similarities with only one variable site in ITS1. The sequence
is identical with two recently published sequences (GQ982887, GQ982888) of
Trametes lactinea in eastern U.S.A. ... 277
Trametes lactinea from Thailand and also with sequences AY684178 (Tennessee;
TomSovsky et al. 2006) and EU661879 (China, unpublished) that were derived
from putative T. elegans collections (Fic. 2). The GenBank sequence GU731566,
identified as “Lenzites sp” and derived from the CIRM-BRFM 1050 strain and
also somewhat aberrant specimen of EF Dammrich from Mauritius show about
15 transitions/transversions in ITS region, but overall sequence similarity with
T’ lactinea is prevails (see discussion). Other T° elegans/lactinea sequences from
GenBank as well as from our own, E Dammrich, and PRM collections are
distinct and comprise a distinctly separate clade (Fic. 2) that represents the
true T. elegans.
Discussion
The massive fruiting of a previously unrecognized, large polypore, Trametes
lactinea, in southern Florida is very surprising. It is possible that the species has
been misdetermined as T' elegans or T. menziesii and that many collections in
American herbaria are in fact T. lactinea. We have not systematically studied
its ecology, but it is worth mentioning that during September 2010 in our best
localities around Miami, FL, we could not find any basidiocarps except for some
disintegrated remnants. We infer that in the southernmost USA, the species
develops very late in autumn, survives winter, and disintegrates in spring, which
might contribute to its imperceptibility in the past. Nevertheless, the striking
sequence homogeneity of all American collections of T. lactinea also suggests
a relatively recent colonization of the American continent. We have previously
described a similar case of the sudden appearance of the European T. gibbosa in
the northern USA and Canada (Kout & Vlasak 2007); currently, 7: gibbosa is the
dominant polypore in the region, at least in Pennsylvania (Vlasak, unpublished
observations 2010). Notably, T. gibbosa also had been misdetermined as
T. elegans. More extensive studies are needed to confirm that T. lactinea is a
recent invasive species in the USA. Long-term and population studies may also
help explain the unexpected spread of T: lactinea to northern USA that has, to
our knowledge, no parallel in its primary distribution area in Asia.
A somewhat aberrant specimen from Mauritius, Damm 4703, with a small
pileus and slightly labyrinthine or split tubes and initially determined as
T. menziesii, has a sequence that corresponds to most of that from T. lactinea but
contains several mutations that are often identical with GenBank GU731566
derived from a Lenzites sp. collected in French Guiana. These two sequences
cluster together with 66% bootstrap support (Fic. 2). The contributors of
GU731566 note that several other French Guianan Lenzites sp. specimens with
quite variable pore surfaces (poroid with 1-2 mm wide pores, or daedaloid, or
lamellate) but with similar sequences were all sterile (A. Favel, INRA, Marseille,
pers. comm.). Fertile basidiocarps are needed to solve this problem. Trametes
278 ... Viasdk & Kout
menziesii is a similar but variable paleotropical species with no sequence yet
deposited in GenBank. According to Ryvarden & Johansen (1980), it should
have rather narrow spores, only 1-2 um wide. We have seen only one specimen
with older name Polyporus meleagris Berk. in PRM herbarium. It was a very
different fungus and so much damaged that we could not isolate DNA.
The T. elegans clade (Fic. 2) is much more divergent than that of T. lactinea
and the division into two branches is well supported. Again, we have no good
explanation for it at present. Trametes elegans is often regarded a member of
genus Lenzites (L. elegans (Spreng.) Pat.) based on its sometimes lamellate
hymenophore and some pointed ends of binding hyphae protruding into
hymenium, reminiscent of the catahymenium characteristic of L. betulinus
(L.) Fr. (Nufiez & Ryvarden 2001). Nevertheless, our ITS region sequence
phylogram shows no similarity between T° elegans and L. betulina, and so we
find the name T! elegans more appropriate.
Acknowledgements
We are grateful to Josef Vlasdk Jr. for collecting of many interesting polypore
specimens and revising the English language. We also thank Frank Dammrich for
generous loan of his herbarium specimens. Dr. Yu-Cheng Dai and Dr. Stephane Welti
have kindly acted as presubmission reviewers and their help is acknowledged. This
research was supported by CEZ: AV0Z50510513 fund.
Literature cited
Berkeley MJ. 1843. Notices of fungi in the Herbarium of the British Museum. Annals and Magazine
of Natural History 10: 369-384.
Corner EJH. 1989. Ad Polyporaceas VI: The genus Trametes. Beih. Nova Hedwigia 97: 1-197.
Dai YC. 2009. A checklist of polypores in China. Mycosystema 28: 315-327 .
Dai YC, Wei YL, Wang Z. 2004. Wood-inhabiting fungi in southern China 2. Polypores from
Sichuan Province. Annales Botanici Fennici 41: 319-329.
Gilbertson RL, Ryvarden L. 1986, 1987. North American polypores Vol. 1 and 2. Oslo, Fungiflora.
885 p.
Kout J, Vlasdk J. 2007. Trametes gibbosa (Basidiomycetes, Polyporales) in the USA and Canada.
Canadian Journal of Botany 85: 342-346. doi:10.1139/B07-013
Murray MG, Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic
Acids Research 8: 4321-4325. doi:10.1093/nar/8.19.4321
Nujiez M, Ryvarden L. 2001. East Asian polypores 2. Synopsis Fungorum 14: 170-522.
Ryvarden L. 1976. Type studies in the Polyporaceae 7. Species described by M.J. Berkeley from 1836
to 1843. Kew Bulletin 31: 81-103. doi:10.2307/4108997
Ryvarden L. 2000. Studies in neotropical polypores 8. Poroid fungi of Jamaica — a preliminary check
list. Mycotaxon 74: 349-360.
Ryvarden L. 2001. Studies in neotropical polypores 9 - a critical checklist of poroid fungi from
Venezuela. Mycotaxon 78: 393-405.
Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Oslo, Fungiflora. 636 p.
Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution 4: 406-425.
Trametes lactinea in eastern U.S.A. ... 279
Tamura K, Nei M, Kumar S. 2004. Prospects for inferring very large phylogenies by using the
neighbor-joining method. Proceedings of the National Academy of Sciences (USA) 101:
11030-11035. doi:10.1073/pnas.0404206101
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis
(MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599. doi:10.1093/
molbev/msm092
TomSovsky M, Kolafik M, PaZoutova S$, Homolka L. 2006. Molecular phylogeny of European
Trametes (Basidiomycetes, Polyporales) species based on LSU and ITS (nrDNA) sequences.
Nova Hedwigia 82: 269-280. doi:10.1127/0029-5035/2006/0082-0269
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in MA Innis et al. (eds.), PCR Protocols: a guide to
methods and applications.). San Diego, Academic Press.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 281-285 January-March 2011
DOT: 10.5248/115.281
A new species of Nephroma (Nephromataceae)
from the Tibetan Plateau
QIonG TIAN?, LI-SONG WaNc?, Hal- YING WANG” & ZUN-TIAN ZHAO™*
‘College of Life Sciences, Shandong Normal University, Jinan, 250014, P. R. China
*Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming, 650204, P. R. China
ApsTRAcT — A new species, Nephroma flavorhizinatum, is described from the Tibetan
Plateau. This species is characterized by marginal and laminal lobules, an obvious pruina, a
white to golden yellow medulla, a golden yellow rhizinal base, and a unique chemistry.
Key worps — China, lichen, Peltigerales, taxonomy
Introduction
Nephroma Ach. is the only member of the lichen family Nephromataceae
(Peltigerales, Lecanoromycetes, Ascomycota) (Kirk et al. 2008). The genus is
morphologically characterized by a cyanobacterium (Nostoc) or a green alga
(Coccomyxa) photobiont, a coriaceous foliose thallus with cortex on both
surfaces, a kidney-shaped apothecium at lobe apices of the lower surface, an 8-
spored ascus, and often 3-septate pale brown ascospores (James & White 1987,
White & James 1988, Burgaz & Martinez 1999, Brodo et al. 2001, Wetmore &
Nash 2002, Louwhoff 2009). Most Nephroma species contain a variety of lichen
substances, including hopane triterpenoids, phenarctin, usnic acid, perlatolic
acid derivatives, anthraquinones, or other pigments (James & White 1987).
Nephroma is a cosmopolitan genus of 36 species worldwide (Kirk et al.
2008). In the southern temperate zone, Australia, North America, Europe,
Macaronesia, and South Korea, the species of Nephroma were studied
systematically (Wetmore 1980, Tensberg & Holtan-Hartwig 1983, James &
White 1987, White & James 1988, Park 1990, Goward & Goffinet 1993, Burgaz
& Martinez 1999, Brodo et al. 2001). In China, nine Nephroma species were
reported: N. helveticum, N. isidiosum, N. javanicum, N. moeszii, N. parile, N.
resupinatum, N. sinense, N. subparile, and N. tropicum (Wei 1991).
282 ... Tian & al.
During our study of the lichen flora of the Tibetan Plateau, an interesting
species of Nephroma new to science was found.
Materials & methods
The specimens studied were collected from Sichuan, China, and are preserved in
SDNU (Lichen Section of Botanical Herbarium, Shandong Normal University). The
morphological and anatomical characters of the specimens were examined using a
stereo microscope (COIC XTL7045B2) and a microscope (OLYMPUS CX21). Lichen
substances in all specimens cited were identified using the standardized thin layer
chromatography techniques (TLC) with G system (Culberson et al. 1981). Photos of the
thallus were taken under OLYMPUS SZX12 with DP72.
Taxonomy
Nephroma flavorhizinatum Q. Tian & H.-Y. Wang, sp. nov. Fies 1,2
MycoBank MB 519038
Lobus crenatus. Lobulus marginalis et laminalis. Medulla alba ad flava. Rhizina flava ad
basis. Phycobiont Nostoc. Thallus T1, T2 et T4 continens.
TYPE COLLECTION: CHINA. Sichuan province, Litang, alt. 4200 m, on ground, Z. S. Sun,
20080755, 5 Nov. 2008. (Holotype in SDNU).
EXPANDED DESCRIPTION — Thallus foliose, coriaceous, about 4 cm in diameter.
Lobes irregular, usually 2-10 mm wide, often ascending at the margins,
crenulate or with lobules. Upper surface brown, smooth; isidia and soredia
absent; lobules marginal and laminal, usually 0.2-1 mm wide, developing from
isidioid papillae, immediately becoming flat, some of them branched; pruina
white, at the margins of lobes and the dorsal surface of apothecia. Photobiont
Nostoc. Medulla white to golden yellow. Lower surface dark brown, tomentose,
paler and smooth at the margins; rhizines about 3 mm long, brush-like, golden
yellow at the bases, white at the tips. Apothecia common, immersed on lower
surface at tips of lobes, kidney-shaped, usually erect; disc dark brown, 1-4
mm in diameter; dorsal surface often with short tomentum; margins usually
entire, rarely crenulate or with lobules. Asci 8-spored; ascospores pale brown,
3-septate, 15-20 x 3.5-5 um. Pycnidia not seen.
Spots TEsts—Thallus upper surface: K-, C-, KC-, PD-; white medulla: K-,
C-, KC-, PD-; golden yellow medulla: K+ violet, C-, KC-, PD-; rhizinal base:
K+ violet, C-, KC-, PD-; rhizine tip: K-, C-, KC-, PD-.
SECONDARY METABOLITES—7[-acetoxyhopan-22-ol (T1), 15a-acetoxyhopan-
22-ol (T2), hopane-7B,22-diol (T4).
DISTRIBUTION AND SUBSTRATE —Nephroma flavorhizinatum is a terricolous
species, at present known only from the type locality.
ADDITIONAL SPECIMENS EXAMINED —CHINA. Sichuan: Litang. alt. 4200 m, on soil, 5
Nov. 2008, Z.S. SUN 20084011 & 20103317 (SDNU).
Nephroma flavorhizinatum sp. nov. (Tibetan Plateau) ... 283
Fic. 1 Nephroma flavorhizinatum (holotype).
A. Thallus. B. Pruina at the dorsal surface of apothecia. (Scale bars = 2 mm).
COMMENTS— lhe presence of laminal and marginal lobules, a white to golden
yellow medulla, a golden yellow rhizinal base, and the unique chemical
characters distinguish Nephroma flavorhizinatum from all other Nephroma
284 ... Tian & al.
Fic. 2 Nephroma flavorhizinatum (holotype).
A. Crenulate lobe. B. Developing laminal lobules. C. Marginal lobules.
D. Developed laminal lobules. E. Rhizines: golden yellow at the bases, and white at the tips.
FE. 8-spored ascus. G. 3-septate ascospore.
(Scale bars: A, C, D = 0.5 mm; B = 0.1 mm; E = 2 mm; F = 5 um; G = 2 um)
species. Many Nephroma species have laminal lobules (phyllidia or folioles),
but most Nephroma species have no rhizines. N. isidiosum, N. kuehnemannii
and N. microphyilum are rhizinate. However, N. isidiosum and N. kuehnemannii
have no laminal lobules, and the former is isidiate, the latter is lichenized with
green algae. N. microphyilum has laminal lobules, but its ascospores are 5-8-
septate rather than 3-septate, and longer than the new species (70-90 tum vs.
15-20 um). Moreover, the medulla and rhizines of all the three Nephroma
species mentioned above are white rather than golden yellow. N. analogicum,
Nephroma flavorhizinatum sp. nov. (Tibetan Plateau) ... 285
N. chubutense, N. laevigatum, N. tangeriense, and N. venosum all have white to
yellow medulla and lobules. However, these five species are not rhizinate, and
their lichen substances are different from the new species.
Acknowledgements
The project was financially supported by the National Natural Science Foundation of
China (31070010) and Natural Science Foundation of Shandong Province (Y2007D21).
The authors would like to thank Prof. Ana Rosa Burgaz (Madrid University, Spain)
for the assistance in the specimen identification. The authors thank Prof. A. Aptroot
(ABL Herbarium, Soest, The Netherlands) and Prof. Shou-Yu Guo (Key Laboratory of
Systematic Mycology & Lichenology, Institute of Microbiology, Chinese Academy of
Sciences, Beijing, China) for presubmission reviews.
Literature cited
Brodo IM, Sharnoff DS, Sharnoff S. 2001. Lichens of North America. Yale University Press: New
Haven and London. 795 pp.
Burgaz AR, Martinez I. 1999. The genus Nephroma Ach. in the Iberian Peninsula. Cryptogamie,
Mycol. 20: 225-235. doi:10.1016/S0181-1584(00)87030-X
Culberson CE, Culberson WL, Johnson A. 1981. A standardized TLC analysis of B-orcinol
depsidones. The Bryologist 84: 16-29. doi:10.2307/3242974
Goward T, Goffinet B. 1993. Nephroma silvae-veteris, a new lichen (Ascomycotina) from the Pacific
Northwest of North America. The Bryologist 96(2): 242-244. doi:10.2307/3243809
James PW, White FJ. 1987. Studies on the genus Nephroma I. The European and Macaronesian
species. Lichenologist 19: 215-268. doi:10.1017/S0024282987000239
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi. 10th Edition. CABI
Bioscience: CAB International. 771 pp.
Louwhoff SHJJ. 2009. Nephromataceae. Pp. 423-427, in McCarthy PM (ed.). Flora of Australia, Vol.
57. ABRS, Canberra & CSIRO Publishing, Melbourne.
Wetmore CM. 1980. A new species of Nephroma from North America. The Bryologist 83: 243-247.
doi: 10.2307/3242144
Wei JC. 1991. An enumeration of lichens in China. International Academic Publishers: Beijing.
278 pp.
Wetmore CM, Nash III TH. 2002. Nephroma. Pp. 296-298, in: Nash III TH, Ryan BD, Diederich P,
Gries C, Bungartz F (eds.). Lichen Flora of the Greater Sonoran Desert Region, Vol. 1. Lichens
Unlimited: Arizona State University, Tempe, Arizona. 532 pp.
Park YS. 1990. The macrolichen flora of South Korea. The Bryologist 93: 105-160.
doi: 10.2307/3243619
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 287-301 January-March 2011
DOT: 10.5248/115.287
Studies in Erysiphales anamorphs (4):
species on Hydrangeaceae and Papaveraceae
ANKE SCHMIDT! & MARKUS SCHOLLER”
'Holunderweg 2 B, D-23568 Liibeck, Germany
*Staatliches Museum fiir Naturkunde, Erbprinzenstr. 13, D-76133 Karlsruhe, Germany
* CORRESPONDENCE TO:
[email protected]
AssTRACcT — Anamorphic powdery mildews on Hydrangeaceae and Papaveraceaein Germany
are revised. Species are documented in detail including line drawings, photomicrographs, and
identification keys. On Papaveraceae three species are accepted, specifically Erysiphe macleayae
on Chelidonium majus and Macleaya cordata, E. cruciferarum on Eschscholzia californica, and
Oidium sp. (an unknown species previously assigned to E. cruciferarum) on Pseudofumaria
lutea. Species on Hydrangeaceae are Oidium hortensiae on Hydrangea macrophylla and
E. deutziae on Deutzia cf. scabra and Philadelphus cf. coronarius. The fungus on the latter host
plant was previously assigned to O. hortensiae. Erysiphe deutziae, E. macleayae, and Oidium
hortensiae are introduced species.
Key worps — conidial germination, morphology, neomycete
Introduction
In Germany, there are three species of Erysiphales reported on Papaveraceae
(Erysiphe cruciferarum, Erysiphe cf. macleayae, Golovinomyces orontii (Castagne)
Heluta); and two (Erysiphe deutziae, Oidium hortensiae) on Hydrangeaceae
(Braun 1995, Jage et. al. 2010). The following is a revision of anamorphs on
certain host plants of Papaveraceae/Hydrangeaceae (Chelidonium, Deutzia,
Hydrangea, Macleaya, Meconopsis, Philadelphus and Pseudofumaria) for which
the host/pathogen affiliations have been doubtful.
Materials & methods
Both fresh and dried structures were examined in tap water mounts with light
microscopy using Olympus BH 2 and Zeiss Axioskop 2 Plus. Pertinent features were
measured at a magnification of 400x or 1000x and documented by line drawings and
photographs using a Canon Al or Canon Powershot A80. From each specimen up to
25 spores were measured. To induce conidial germination, the method of Schmidt &
Scholler (2002) was applied. Fresh conidia were spread on a microscope slide and placed
288 ... Schmidt & Scholler
in a Petri dish with moist cellulose tissue. The closed Petri dishes were incubated at
room temperature and exposed to daylight through a north-facing window for 24 h.
Specimens were studied from HAL, KR, and private herbaria (Herbarium J. Kruse,
A. Schmidt). Specimens collected by the authors were deposited in KR (some duplicates
in the private herbarium of the first author). Permanent slides were made using Hoyer’s
medium (Cunningham 1972). If possible, fresh material was studied, but for study of
outer cell wall ornamentation of conidia only dried material was used according to
Bélanger et al. (2002).
The species concept and nomenclature follows Braun (1999) and Braun & Takamatsu
(2000). The host plants are named according to the Flora Europaea (Tutin et al.
1964-80).
Taxonomic descriptions
Species on Papaveraceae (incl. Fumariaceae)
Erysiphe macleayae RY. Zheng & G.Q. Chen PLATE 1
SPECIMENS STUDIED — On Macleaya cordata R. Br.: Germany, Brandenburg, Potsdam-
Bornim, Am Raubfang, (MTB 3544/3/3), 8 Nov. 2004, leg. V. Kummer (KR 0021921 and
herbarium A. Schmidt no. KM 203) (host species cf.) (fresh); Sachsen, Gorlitz, Sonnenstr.
17, front garden of Dunger house of Staatliches Museum fiir Naturkunde, 25 Oct. 2005,
leg. et det. H. Boyle as «cf. Erysiphe macleayae R.Y. Zheng & G.Q. Chen» (HAL 2209
F = GLM F070246), with hyperparasite Ampelomyces quisqualis; Brandenburg, Teltow,
Lichterfelde direction, Lenaustr., 18 Sep. 2009, leg. et det. V. Kummer as «cf. Erysiphe
macleayae R.Y. Zheng & G.Q. Chen» (HAL 2133 F) (dry). On Meconopsis cambrica
(L.) Vig.: Germany, Niedersachsen, Hannover, Zoo, Adenauerallee 3, wayside (MTB
3624/2/1), 55 m, 9 Oct. 2009, leg. J. Kruse, det. U. Braun, anamorph + teleomorph with
mature ascomata on stem (mixed infection with Peronospora meconopsidis Mayor, det.
M. Scholler) (herbarium J. Kruse no. E 0293) (dry).
Mycelium conspicuous, dense, either covering the whole surface or around
leaf veins, whitish to slightly brownish, amphigenous, but predominantly
epiphyllous; sterile hyphae hyaline, branched, smooth, 3.5-7 um wide;
hyphal appressoria lobed or nipple-shaped, singly or in pairs; epiphyllous
conidiophores 45-90 um, 5.5-11 um wide, attenuated toward base, lowermost
cell up 8 um, uppermost cell up to 11 um wide, 3-celled, rarely 2- or 4-celled,
foot-cell, longest cell of conidiophores, 25-40 um long, often curved; conidia
formed singly, ellipsoid to cylindrical (-doliiform), 26.5-44.0(-47.5) x (10-)
14.5-18.5(-20) um, length/width ratio 1.8-3, average 2.4 (dry material) or
2.1-3.4, average 2.5 (fresh), wrinkling pattern of outer wall angular, of end wall
fibrillar; germ tubes subapically inserted, non- to two-septate, short to long,
20-115 x 2.5-6.0 um, germ tubes terminating simply or in a club-shaped or
rarely in a lobed appressorium, sometimes branching.
Erysiphe cf. macleayae RY. Zheng & G.Q. Chen on Chelidonium majus PLATE 2
SPECIMENS STUDIED — On Chelidonium majus L.: Germany, Brandenburg, Potsdam,
Lennéstr./Carl-von-Ossietzky-Str., 4 Oct. 2004, leg. V. Kummer (KR 0021909 and
Erysiphales on Hydrangeaceae & Papaveraceae ... 289
PLATE 1. Erysiphe macleayae on Macleaya cf. cordata (KR 0021921 = KM 203). A. Conidiophores
(epiphyllous), B. Appressoria, C. Conidia. Bar = 10 tm; drawings by A. Schmidt.
herbarium A. Schmidt no. KM 202) (fresh); Brandenburg, Potsdam, Maulbeerallee 2,
25 Sep. 2005, leg. V. Kummer (KR 0021933 and herb. A. Schmidt no. KM 212) (fresh);
Thiiringen, Jena, near University, Institut fiir Okologie, near Dornburger StraBe, 18 Oct.
2005, leg. V. Kummer (KR 0021934 and herbarium A. Schmidt no. KM 215); Thiiringen,
Bad Frankenhausen, on town wall between Fritz-Brather-Str. and Franz-Winter-Str., 14
Oct. 2007, leg. A. Schmidt (KR 0002945 and herbarium A. Schmidt no. KM 250) (fresh);
Baden-Wiirttemberg, Karlsruhe, Griinwinkel, Albsiedlung, Silcherstr., slope, 110 m, 13
290 ... Schmidt & Scholler
PLateE 2. Erysiphe cf. macleayae on Chelidonium majus. A. Conidiophores (epiphyllous) (KR 0021909
= KM 202), B. Appressoria (KR 0021934 = KM 215), C. Conidia with oil drops (KR 0004850),
D. Conidia (KR 0021909 = KM 202), E. Germinated conidia after 24 h in moist chamber cultures
(KR 0021909 = KM 202). Bar = 10 um; drawings 2A, B, D, E by A. Schmidt, 2C by M. Scholler.
Erysiphales on Hydrangeaceae & Papaveraceae ... 291
Sep. 2009, leg. M. Scholler (KR 0004850) (fresh). Hungary, Martonvasar, 9 Sep. 2004, leg.
et det. T. Jankovics (2007) as «Oidium sp. » (HAL 1842 F) (dry).
Mycelium not conspicuous, not dense, arachnoid, whitish, amphigenous,
predominantly epiphyllous, often around leaf veins and leaf margins; sterile
hyphae superficial, hyaline, sparingly branched, smooth, 3.5-6 «um wide; hyphal
appressoria rarely formed, lobed or nipple-shaped, single or sometimes in pairs;
epiphyllous conidiophores 60-115 um, 7-10.4 um wide, sometimes slightly
attenuated toward base, with uppermost cell widest, 3-celled, rarely 2-celled,
foot-cell, longest cell of conidiophore, 31-70 um, often curved, uppermost
cell often shortest; conidia formed singly, ellipsoid, partly cylindrical, (28-)
31-40(-46.5) x (11.5-)12.5-17.5(-18.5) um, length/width ratio 2.1-3 (average
2.4), wrinkling pattern of outer wall with angular ridges, partly without ridges;
germ tubes subapically inserted, non- to two-septate, first septum close to
conidium, germ tubes short to long, 15-125 x 3.5-6.0 «um, terminating simply
or in a club-shaped or, if in short germ tubes, then in a lobed appressorium,
sometimes branching.
Erysiphe cruciferarum Opiz ex L. Junell PLATE 3
SPECIMENS STUDIED — On Eschscholzia californica Cham.: Germany, Niedersachsen,
Soltau, Heidepark, wayside (MTB 2925/3), 57 m, 23 Sep. 2009, leg. J. Kruse (herbarium
J. Kruse no. E 0279, mixed infection with Acroconidiella eschscholziae (Harkn.) M.B.
Ellis) (dry).
Mycelium not conspicuous, sparse, whitish, amphigenous, mainly hypophyllous
and caulicolous; sterile hyphae superficial, hyaline, sparingly branched,
ee ay
Pate 3. Erysiphe cruciferarum on Eschscholzia californica (herb. J. Kruse no. E 0279).
Conidiophores (hypophyllous). Bar = 10 um; drawings by M. Scholler.
292 ... Schmidt & Scholler
smooth, 4-10 wm wide; hyphal appressoria lobed; hypophyllous conidiophores
central on mother cell, 55-70(-100) wm, 7.5-9.5 um wide, sometimes slightly
attenuated, 2-3(—4)-celled, foot-cell, longest cell of conidiophore, straight or
rarely slightly curved; conidia formed singly, cylindrical to ellipsoid, 37.5-52.5
x (12.5-)14.5-18.5 um, length/width ratio 2-3.9 (average 2.9), wrinkled wall
surface angular; germ tubes inserted subapically, non- to one-septate, 20-55 x
3.5-5.5 um, terminating simply or in a club-shaped appressorium.
Oidium sp.
SPECIMENS STUDIED — On Pseudofumaria lutea (L.) Borkh. (= Corydalis lutea (L.) DC.):
Germany, Brandenburg, Potsdam-Bornim, Florastr. 4, 2 Oct. 2004, leg. et det. V. Kummer
as «cf. E. werneriy (HAL 2123 F) (dry); Germany, Sachsen-Anhalt, Tangermiinde,
“Roffurth’, Elbtor, shady wall, 8 Oct. 2004, leg. et det. H. Jage as «Oidium» (HAL 2124
F) (dry, scanty material).
Mycelium conspicuous, dense, whitish, amphigenous, predominantly
hypophyllous; sterile hyphae hyaline, branched, smooth, 4-6.5 um wide;
hyphal appressoria lobed or nipple-shaped in pairs; conidiophores 65-130 um
long; epiphyllous 65-75 um, hypophyllous 95-125 um, uniformly 5.5-9 um
wide, not attenuated toward base, (2-)3(-4)-celled, foot-cell, longest cell of
conidiophore, straight or sinuous; conidia formed singly, cylindrical to ellipsoid,
29,5-50.0 x 9-12(-13) um, length/width ratio 2.3-5.3 (average 3.6), wrinkled
outer wall angular; germ tube subapically inserted, non-septate, 20.5 x 3 um,
terminating simply.
Species on Hydrangeaceae
Oidium hortensiae Jorst. PLATE 4
SPECIMENS STUDIED — On Hydrangea macrophylla (Thunb.) Ser: Germany, Berlin,
Lichterfelde, Hortensienstr., balcony, flower-pot, 27 Jun. 1993, leg. M. Scholler (KR
0003726) (fresh); Hamburg-Nienstedten, Cordsstr. 3, Cords nursery, flower-pot, 26 Jun.
2009, leg. A. Schmidt (KR 0024164, herbarium A. Schmidt no. KM 275) (fresh).
Mycelium not conspicuous, not dense, arachnoid, whitish, in small patches
on violet spots, amphigenous; hyphal appressoria numerous, lobed, in pairs,
often in sequences of several pairs (up to 4); epiphyllous and hypophyllous
conidiophores about central on mother cell, 40-130 um long, 7-10 um wide,
mostly 2-3-celled, rarely 4-5-celled, foot-cell 17-45(-50) um long, mostly
straight, sometimes attenuated toward base or curved, 4—5-celled conidiophores
occur on both sides of the leaf, conidiophores longer and slightly narrower
below; conidia formed singly, ellipsoid to cylindrical, partly doliiform or ovoid,
(25-)27-40(-45) x (11.5)-13-22 um, length/width ratio 1.7-3.1 (average
2.2), wrinkling pattern of outer wall with mainly longitudinal, slightly angular
ridges; germ tubes subapically inserted, one-septate, 20-88 x 2-5 um, germ
Erysiphales on Hydrangeaceae & Papaveraceae ... 293
A B
Pate 4. Oidium hortensiae on Hydrangea macrophylla (KR 0024164 = KM 275). A. Conidiophores
(epiphyllous), B. Conidiophores (hypophyllous), C. Appressoria, D. Conidia, E. Germinated
conidia after 24 h in moist chamber cultures. Bar = 10 um; drawings by A. Schmidt.
294 ... Schmidt & Scholler
tubes short to long, rarely terminating simply, mostly in a club-shaped or lobed
appressorium, sometimes branched, often germinating with two or three germ
tubes per conidium.
Erysiphe deutziae (Bunkina) U. Braun & S. Takam. on Deutzia PLATE 5
SPECIMENS STUDIED — On Deutzia cf. scabra Thunb.: Germany, Hamburg-Nienstedten,
Wesselhoeftpark, 27 Jun. 2009, leg. A. Schmidt (KR 0024165, herbarium A. Schmidt
no. KM 276/1) (fresh); Hamburg-Nienstedten, Wesselhoeftpark, 18 Jul. 2009, leg. A.
Schmidt (KR 0024168, herbarium A. Schmidt no. KM 276/2) (fresh).
Mycelium not conspicuous, not dense, whitish, epiphyllous, low rate ofinfection;
hyphal appressoria numerous, lobed, in pairs; epiphyllous conidiophores
55-65 um long, 8-10 um wide, sometimes slightly attenuated toward base, 2-3-
celled, foot-cell 25-35 um long, straight or sometimes curved; conidia formed
singly, mostly ellipsoid, partly ovoid or doliiform, 26.5-36(-40) x (16.5-)
18-20 tm, length/width ratio 1.4—2.2 (average 1.7), fresh conidia with numerous
small conspicuous droplets beside large oil drops, wrinkling pattern of outer
cell wall irregular with interrupted longitudinal and angular ridges; germ tubes
subapically inserted, always one-septate, septum distant from conidium, mostly
about middle of germ tube, germ tubes short to moderately long, 25-125 x
3.0-4.5 um, terminating in a mostly lobed or club-shaped appressorium.
Erysiphe deutziae (Bunkina) U. Braun & S. Takam. on Philadelphus PLATES 6-8
SPECIMENS STUDIED — On Philadelphus cf. coronarius L. (cult.): Germany, Nordrhein-
Westfalen, University campus, 20 Mar. 2003, leg. G. Feige & N. Ale-Agha (published
as Oidium cf. hortensiae, see Ale-Agha et al. 2008), Baden-Wiurttemberg, Karlsruhe-
Griinwinkel, Silcherstr. 25, garden, 20 Aug. 2008, leg. M. Scholler (KR 0025921,
herbarium A. Schmidt no. KM 269/1) (fresh); Baden-Wirttemberg, Karlsruhe-
Griinwinkel, Silcherstr. 25, garden, 26 Aug. 2008, leg. M. Scholler (KR 0025922,
herbarium A. Schmidt no. KM 269/2) (fresh).
Mycelium not conspicuous, not dense, whitish, arachnoid, amphigenous and
on fruits; hyphal appressoria numerous, lobed, mostly in pairs; epiphyllous
conidiophores 50-75 um long, 8.5-12.0 um wide, slightly attenuated toward
base, 2-3-celled, upper cell sometimes slightly swollen, foot-cell 21-31 um,
straight or sometimes slightly curved, hypophyllous conidiophores not different
in length; conidia formed singly, mostly ellipsoid, partly ovoid or doliiform,
24-34.5 x (16.5-)17.5-20(-22) um, length/width ration 1.3-1.9 (average 1.6),
fresh conidia with numerous small conspicuous oil drops beside large oil drops,
wrinkling pattern of outer cell wall with mainly longitudinal ridges; germ tubes
subapically inserted, non- to one-septate, septum distant from conidium, about
middle of germ tube, germ tubes short to long, 20-84 x 3.5-5.5 um, terminating
simply, in a lobed or club-shaped appressorium.
Erysiphales on Hydrangeaceae & Papaveraceae ... 295
PiatE 5. Erysiphe deutziae on Deutzia cf. scabra (KR 0024165 = KM 276/1). A. Conidiophores
(epiphyllous), B. Appressoria, C. Conidia, D. Germinated conidia after 24 h in moist chamber
cultures. Bar = 10 um; drawings by A. Schmidt.
296 ... Schmidt & Scholler
PLATE 6. Erysiphe deutziae on Philadelphus cf. coronarius. A. Conidiophores (epiphyllous)
(KR 0025921 = KM 269/1), B. Appressoria (KR 0025921 = KM 269/1), C. Conidia (KR 0025921 =
KM 269/1), D. Germinated conidia after 24 h in moist chamber cultures (KR 0025922 = KM 269/2).
Bar = 10 um; drawings by A. Schmidt.
Erysiphales on Hydrangeaceae & Papaveraceae ... 297
im
PLATE 7. Germinating conidia of Erysiphe deutziae on Philadelphus cf. coronarius (KR 0025922 =
KM 269/1). Bar = 10 um; photograph by A. Schmidt.
PLaTE 8. Anamorph of Erysiphe deutziae on fruits of Philadelphus cf. coronarius in a garden in
Karlsruhe. 24 Aug. 2008; photograph by M. Scholler.
298 ... Schmidt & Scholler
Key to anamorphs of powdery mildew species
recorded or expected in Germany
On Papaveraceae (incl. Fumariaceae)
la. Conidia formed in chains; on Papaver rhoeas............. Golovinomyces orontii
Ib.:Gonidia formedisingly.. o2 2. sg pe ie eed pd eae REE Wes ee eee eee eee 2
2a. Mycelium internal and external; conidiophores mostly emerging through stomata;
conidia distinctly dimorphic, primary conidia lanceolate, apically attenuated,
secondary conidia ellipsoid-cylindrical; on Glaucium spp., Papaver spp.
Ses Phan anni LanYoanh Ab tat ta et Rape rah Sana ie Ree, Leveillula taurica
2b. Mycelium external; conidiophores arising from superficial hyphae; conidia +
ellipsoid ae ey ee A ete ee here gt eee boleh nage gt Mead ches tothe tng ee 3
3a. Conidiophore foot-cells usually straight, rarely sinuous; on Eschscholzia californica,
¢Fumaria officinalis, Glaucium flavum, Papaver argemone,
P. dubium, P. nudicaule, P. orientale, P. rhoeas, P. somniferum
Aba dea SI Togas ct eager: Meee PED acdc cee eee Paes ae fors Erysiphe cruciferarum
4a. Mycelium predominantly hypophyllous, average length/width ratio of
conidia about 3.5; on Pseudofurnaria lutea ......0. 0... ccc eee eee Oidium sp.
4b. Mycelium predominantly epiphyllous, average length/width ratio of
conidia below 3.5 (2 to 3); on other hosts. 2.0... 6.0... 5
5a. Conidiophores mostly 60-115 um long, often attenuated toward base;
on Chelidonium majus .. 0.0.0.0. 0c Erysiphe cf. macleayae
5b. Conidiophores shorter, mostly 50-85 «um, often attenuated toward base;
on Macleaya cordata, Meconopsis cambrica ............... Erysiphe macleayae
On Hydrangeaceae
la. Conidia formed in chains; on Hydrangea spp. ............ Golovinomyces orontii
Ib. Gonidia formedssingl ysis i! v5, os peek pete eet pels ke OL Ue ppt ee 2
2a. Conidiophores 2-3-celled, rarely 4—5-celled, conidia without small oil drops,
conidia often germinating with two or three germ tubes per conidium; on
Hydrangea macrophylla... 0... ccc cece nee eens Oidium hortensiae
2b. Conidiophores only 2—-3-celled, conidia with numerous small oil drops, generally
germinating with only one germ tube per conidium; on Deutzia xmagnifica, D.
scabra and Philadelphus coronarius ...........0.0 0.00000 Erysiphe deutziae
Discussion
Species on Papaveraceae
Erysiphe macleayae is an introduced species native of Asia (Braun 1987)
that was previously reported from Germany by Ale-Agha et al. (2008) on
Macleaya cordata. The anamorph of this species is reported here from Germany
on Macleaya (HAL 2133 F, KR 0021921) and Meconopsis .The features of the
anamorph and only ascomata on Meconopsis (herb. J. Kruse no. E 0293) agree
Erysiphales on Hydrangeaceae & Papaveraceae ... 299
with the short description of E. macleayae on Macleaya cordata by Braun (1987).
The specimen HAL 2209 F on Macleaya is heavily infested by the hyperparasite
Ampelomyces quisqualis Ces., which obscures the morphological characters
of the powdery mildew. HAL 2133 F contains many germinated conidia.
Meconopsis cambrica is a new host genus and species for E. macleayae. Erysiphe
cruciferarum has previously been listed on this host (Braun 1987: 204) but the
specimens may belong to E. macleayae. A powdery mildew reported from
Bulgaria on Papaver somniferum L. was identified as E. macleayae (Fakirova
1991) but U. Braun studied this material and determined that it belongs to
E. cruciferarum (Braun 1995).
A powdery mildew on Chelidonium majus was first recorded in Italy by
Ciferri & Camera (1962). This material is not available, so we do not know
whether it is conspecific with the fungus on this host in Central Europe. The
Chelidonium powdery mildew may be related to or even conspecific with
E. macleayae. Minor differences are: number of septa in the conidial germ
tubes, one versus up to two on Chelidonium; and conidiophore foot-cells up to
AO um versus up to 70 um on Chelidonium.
Jage et al. (2010) identified specimens HAL 2123 F and HAL 2124 F on
Pseudofumaria luteaas E. cruciferarum. We re-studied this material and it differs
from the anamorph of E. cruciferarum by: 1) often sinuous foot cells, 2) an
extraordinarily high length/ width ratio - 3.6, and 3) formation of predominantly
hypophyllous mycelium. Braun (1987) reports a “larger than 2” L:w ratio for
E. cruciferarum and in the specimens we studied this averaged between 2.4 and
2.9. Braun (1987) also reported that in E. cruciferarum the mycelium is formed
amphigenously. Therefore, it is doubtful that the Pseudofumaria powdery
mildew is conspecific with E. cruciferarum.
One other species, E. werneri U. Braun, occurs on Papaveraceae (Corydalis s.
str.). The anamorph of this species bears some resemblance to the oidial state on
Pseudofumaria. Based on the protologue, E. werneri forms large conidia (48-63
x 15-23 wm). In a recent description of E. werneri from Korea, Shin (2000)
reported conidia 35-48 x 13-18(-20) tm with single hyphal appressoria and
mainly two-celled conidiophores. This agrees with the German material except
that it is not as wide, 9-12 (-13) um, has hyphal appressoria, and mainly three-
celled conidiophores.
Species on Hydrangeaceae
The anamorph Oidium hortensiae occurs on Hydrangea (Blumer 1967;
Braun 1987, 1995). Described as straight, cylindrical, we determined that the
conidiophores may also be attenuated toward base or curved. In contrast to
Braun (1987, 1995), we did not find conidiophores producing conidia rarely in
short chains. Our germination experiments indicated that germ tubes mostly
produced a club-shaped or lobed terminal appressorium. Simple germ tubes
300 ... Schmidt & Scholler
without any appressoria were rare. In this respect, our observations agree
with those of Blumer (1967) but disagree with Braun (1987) who stated that
the species was “without terminal lobed appressorium” According to Braun
(1995), Hydrangea macrophylla may be infected by another powdery mildew,
Golovinomyces orontii. This species is known from Switzerland and may be
expected in Germany.
A detailed description of the anamorph of the Asian Erysiphe deutziae on
Deutzia spp. in Europe was provided by Bolay et al. (2005). Our observations
agree with their description and provide additional information on the mode
of germination and germ tube morphology. However, Bolay et al. (2005)
described the conidia as 12.5-15 um wide while the German specimens were
(16.5-)17.5-20(-22) um wide. This difference may be because Bolay et al. (2005)
measured dried stained conidia whereas we measured only fresh conidia. In his
monograph, Braun (1987) described them as 14-20 um wide. An important
diagnostic feature of E. deutziae is the formation of numerous small refractive
droplets in the conidia; these are clearly visible in fresh conidia. The smaller
droplets are formed in addition to larger oil drops that are common in most
powdery mildews. Interestingly, in contrast to the large drops, the small drops
are visible even in dried conidia (when rehydrated in water). The anamorph
on Philadeiphus agrees with E. deutziae on Deutzia and we therefore consider
them to belong to the same species. This also applies to HAL 2138 F, which
was previously published as Oidium cf. hortensiae (Ale-Agha et al. 2008). The
typical Oidium hortensiae differs from E. deutziae by several morphological
characters, e.g. by not forming small droplets. Also infection experiments
reported by Blumer (1928, cited after Blumer 1933) support our results. This
study reports that Oidium hortensiae infects various Hydrangea species but not
Deutzia and Philadelphus species.
Acknowledgements
Special thanks are due to Volker Kummer who sent us literature and fresh material
for germination studies, Uwe Braun and Julia Kruse for providing herbarium specimens
and literature and Amy Rossman for critically reading the manuscript. Finally, we thank
U. Braun and Marcin Piatek for functioning as presubmission reviewers.
Literature cited
Ale-Agha N, Boyle H, Braun U, Butin H, Jage H, Kummer V, Shin H-D. 2008. Taxonomy, host range
and distribution of some powdery mildew fungi (Erysiphales). Schlechtendalia 17: 39-54.
Bélanger RR, Bushnell WR, Dik AJ, Carver TLW. 2002. The powdery mildews. The American
Phytopathological Society, St. Paul.
Blumer S. 1928. Uber den Mehltau der Hortensie. Zeitschrift fiir Pflanzenkrankheiten 38: 78-83.
Blumer S. 1933. Die Erysiphaceen Mitteleuropas mit besonderer Beriicksichtigung der Schweiz.
Beitrage zur Kryptogamenflora der Schweiz 7(1): 1-483.
Blumer S. 1967. Echte Mehltaupilze (Erysiphaceae). G. Fischer, Jena.
Erysiphales on Hydrangeaceae & Papaveraceae ... 301
Bolay A, Braun U, Delhay R, Kummer V, Piatek M, Wotczariska A. 2005. Erysiphe deutziae — anew
epidemic spread in Europe. Cryptogamie, Mycologie 26(4): 293-298.
Braun U. 1987. A monograph of the Erysiphales (powdery mildews). Beihefte zur Nova Hedwigia
89: 1-700.
Braun U. 1995. The powdery mildews (Erysiphales) of Europe. G. Fischer, Jena, Stuttgart, New
York.
Braun U. 1999. Some critical notes on the classification and the generic concept of the Erysiphaceae.
Schlechtendalia 3: 48-54.
Braun U, Takamatsu S. 2000. Phylogeny of Erysiphe, Microsphaera, Uncinula (Erysipheae) and
Cystotheca, Podosphaera, Sphaerotheca (Cystotheceae) inferred from rDNA ITS sequences
— some taxonomic consequences. Schlechtendalia 4: 1-33.
Ciferri R, Camera C. 1962. Tentativo di elencazione dei funghi italiani. I. Erisifali. Istituto Botanico
Della Universita Laboratorio Crittogamico Pavia, Quaderno 21: 1-46.
Cunningham JL. 1972. A miracle mounting fluid for permanent whole-mounts of microfungi.
Mycologia 64: 906-911. doi:10.2307/3757946
Fakirova VI. 1991. Fungi Bulgaricae, I Tomus, Ordo Erysiphales. Publishing House of Bulgarian
Academy of Sciences, Sophia.
Jage H, Klenke K Kummer V. 2010. Neufunde und bemerkenswerte Bestatigungen von
phytoparasitischen Kleinpilzen in Deutschland - Erysiphales (Echte Mehltaupilze).
Schlechtendalia 21: 1-140.
Jankovics T. 2007. First report of powdery mildew (Oidium sp.) on greater celandine (Chelidonium
majus). Plant Pathology 56: 353. doi:10.1111/j.1365-3059.2007.01533.x
Schmidt A, Scholler M. 2002. Studies in Erysiphales anamorphs (II): Colutea arborescens, a new
host for Erysiphe palczewskii. Feddes Repertorium 113: 107-111.
Shin H-D. 2000. Erysiphaceae of Korea. Plant Pathogens of Korea 1. National Institute of Agricultural
Science and Technology, Suwon.
Tutin TG, Heywood VH, Burges NA, Valentine DH, Walters SM, Webb DA. 1964-80. Flora
Europaea, 2nd ed. Volumes 1-5. Cambridge University Press, Cambridge.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 303-310 January-March 2011
DOT: 10.5248/115.303
Paecilomyces wawuensis, anew species
isolated from soil in China
Jin HE?, JICHUAN KANG'?", BANGXING LEI & TINGCHI WEN?
? Engineering and Research Center for Southwest Bio-Pharmaceutical Resources
of National Education Ministry of China &
? Key Laboratory of Agricultural Bioengineering at Guizhou
2 Guizhou University, Huaxi, Guiyang 550025, Guizhou Province, PR China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — A new species, Paecilomyces wawuensis, isolated from soil samples of the
Wawu Mountain, Sichuan Province, China, is described and illustrated. It is characterized by
phylogenetic analysis of ITS rDNA and -tubulin gene sequences, white obverse and sandy
beige reverse colonies that grow slowly on Czapek agar, cylindrical phialides with long, thin
necks, and ellipsoidal-ovate, spinulose conidia.
Key worps — taxonomy, fungi, hyphomycete
Introduction
The hyphomycete genus Paecilomyces was introduced by Bainier (1907) to
accommodate Paecilomyces variotii Bainier, a species growing in the air, soil,
and compost and on wood. It was characterized by verticillate conidiophores
with divergent whorls of phialides, which have a cylindrical or inflated base
tapering into a long and distinct neck. The conidia are typically hyaline,
one-celled, smooth-walled, and produced in basipetal chains. The genus was
revised by Brown & Smith (1957) and further modified by Samson (1974), who
accepted 31 species. Some species of Paecilomyces were later found to represent
anamorphs of Byssochlamys Westling, Talaromyces C.R. Benj., Thermoascus
Miehe, Cordyceps Fr., and Torrubiella Boud. (Stolk & Samson 1972, Samson
1974).
In Paecilomyces, most species can be separated from each other with colonies,
conidiogenous cells, conidia, and phialides. Han (2007) accepted only 64 of
the 125 published Paecilomyces species. According to Index Fungorum (www.
indexfungorum.org), over 140 epithets were assigned to Paecilomyces; many of
them, however, are known to be taxonomic synonyms or dubious taxa.
304 ... He & al.
A total of 39 species in Paecilomyces have been reported in China, including
18 entomogenous species and 21 species from soil (Liang et al. 2005a,b, 2006;
Han et al. 2005a,b,c; Li et al. 2006).
Based on the records of Paecilomyces and the distinctive molecular and
morphological characteristics, the fungus isolated from soil samples of the
Wawu Mountain, Sichuan Province, China, is described as a new species of
Paecilomyces.
Materials & methods
Collection and strain isolation
Strain GZU-BCECWS15 was isolated from a soil sample collected from the Wawu
Mountain, Sichuan Province, China, in July, 2008. Two grams of soil were added to a
flask containing 20 ml sterilized water and glass beads. The soil suspension was diluted
to a concentration of 10-'-10° after shaking for about 10 min. A 1 ml soil suspension
(concentration 10°) was mixed with Martin medium in sterilized 9 cm diam Petri dish
and incubated at 25°C for 5 days. The strain was purified by transplanting to Martin’s
slants.
Morphological identification of strain
The strain studied was transplanted onto Czapek agar, potato dextrose agar (PDA),
and Sabouraud agar. After incubating at 25°C for 14 days, morphological identification
of the strain was carried out based on colony characters, conidiogenous structure and
other biological features (Brown & Smith 1957, Samson 1974).
The generic names Paecilomyces and Penicillium are abbreviated as “P.” and “Pen.”
respectively. The holotype GZU-BCECWS15 of PR wawuensis was deposited in the
Engineering and Research Center for Southwest Bio-Pharmaceutical Resources of
National Education Ministry of China, Guizhou University, PR China.
TaBLE 1. ITS rDNA sequences from GenBank used in the phylogenetic analysis
NAME GENBANK No. NaME GENBANK No.
P antarcticus AJ879113 P. gunnii AJ309339
P carneus AY624171 P. marquandii AY624193
P carneus AB103179 P. niphetodes AY624192
P carneus DQ888728 P. penicillatus AY624194
P carneus DQ914684 P viridis AY624197
P. gunnii AJ309343 P. wawuensis GU453921
P. gunnii GY453920 Pen. expansum AF404655
TABLE 2. B-tubulin gene sequences from GenBank used in the phylogenetic analysis
NAME GENBANK No. NAME GENBANK No.
P. carneus AY624209 P. viridis AY624235
P carneus AY624210 P. wawuensis HM480496
P. gunnii HM480497 Pen. expansum AF003248
Paecilomyces wawuensis sp. nov. (China) ... 305
DNA sequencing & phylogenetic analysis
Genomic DNA was extracted from fungal mycelia directly collected from the plates
following the CTAB isolation protocol of Oscar et al. (1999). Template DNA (30-40
ng) was amplified in a 50 ul PCR reaction mixture consisting of 10 mM KCl, 10 mM
(NH,),SO, 20 mM Tris-HCl (pH 8.8), 6 mM MgCl, and 500 uM each of dATP,
dCTP, dGTP, and dTTP, with 60 pmols ITS4 & ITS5 primers (White et al. 1990) for
ITS rDNA or T1&T22 primers (O'Donnell & Cigelnik 1997) for B-tubulin gene, and 2
units TaqDNA polymerase (TianGen, China). The reaction was set up as follows: initial
denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 1 min,
annealing at 51°C for 1 min, extension at 72°C for 1 min and final extension at 72°C for
10 min in Gene Amp PCR system 9700 (Gene Amp, U S). The temperature of annealing
for B-tubulin gene (TUB2) was 54°C.
The PCR products were purified by using a UNIQ-10 PCR Purification Kit (Sangon
Biotech, China). The purified PCR products were sequenced using the ABI Prism 377
DNA Sequencer (Perkin-Elmer, Norwalk, Connecticut) with ITS4 or ITS5 and T1 or
T22. The DNA sequences of ITS rDNA and B-tubulin gene of the fungus have been
submitted to GenBank.
Nucleotide sequences of ITS rDNA and f-tubulin gene of the isolate GZU-
BCECWS15 and their allies as well as the outgroups retrieved from GenBank were
assembled using Tex-Edit Plus (Bender,
[email protected]) respectively. The alignment
of the sequence files was conducted using the CLUSTAL W software (Thompson et
al. 1994). Phylogenetic analyses were performed with PAUP version 4.0b10 (Swofford
2004). The most parsimonious trees (MPT) were determined from the data sets using
the heuristic search options with 1000 random sequence input orders with MULPARS
on and TBR branch swapping for the exact solution. The unconstrained topologies of the
equally parsimonious trees were compared using the Kishino- Hasegawa test of PAUP.
The best topology was selected as the most parsimonious tree topology. Parsimony
bootstrap with 1000 replicates in PAUP was applied to the tree to evaluate the stability.
Other measures including tree length, consistency, retention, rescaled consistency and
homoplasy indexes (TL, CI, RI, RC and HI) were also calculated.
Taxonomy
Paecilomyces wawuensis Jin He, J.C. Kang & B.X. Lei, sp. nov. FIG. 1
MycoBank MB 518791
On agaro Czapekii, coloniae 25-26 mm diam in 14 diebus ad 25°C, albae, floccosae,
margine regularis, reversum vinacea. Hyphae hyalinae, septatis, levibus, 1.3-1.5 um crassis.
Conidiophora breva, simplicia, 16-40 x 1.3-2.0 um, phialides singulare vel phialidibus
2 ad 4 terminatis, Phialides12-42 x 1.8-4.0 um, cylindricae, e basi inflata, angustatae
collolongo minus quam 0.4 um. Conidia monocellula, hyalina, verrucosa, ellipsoidea ad
ovata vel subglobosa, 4.3-6.9 x 3.3-5.3 um, facientia divergentes, catenas exsiccates.
Typus: GZU-BCECWS15 et cultara , isolatus ab soli in solo Wawu, Provinice Sichuan,
VII.2008, T.C. Wen; in Guizhou Univ., conservatur.
COLONIES ON CZAPEK AGAR growing slowly, attaining a diameter of 25-26
mm 14 days at 25°C; white, ridged, dense floccose, thick, with orderly margins,
with some irregular radiating furrow and more or less hyaline exudates; reverse
306 ... He & al.
Fic. 1. Photographs of colony and conidiogenous structure of Paecilomyces wawuensis under
scanning electron microscope. A. Colony on Czapek agar after 14 days at 25°C. B. Conidiogenous
structure. C. Ellipsoidal conidia in chains. D. Phialides of the conidiogenous structure.
E. Echinula of a conidium. Scale bars: A =10 mm, B = 5 um, C-D = 2 um, E = 0.5 um.
sandy beige, appearing soluble wine red pigment. Vegetative hyphae septate,
hyaline, smooth-walled, 1.3-1.5 um wide. Conidiophores mononematous erect
or absent, hyaline, smooth-walled, uneven length, 16-40 x 1.3-2.0 um, with
single phialide or whorls of 2 to 4 phialides, or phialides growing from hyphae
directly. Phialides 12-42 x 1.8-4.0 um, consisting of a cylindrical, somewhat
inflated base, tapering into a long and thin neck, somewhat incurved, 6.0-6.7
uum long and less than 0.6 um wide. Conidia one-celled, hyaline, roughened-
walled with spinulose, most ellipsoidal or ovate to subglobose, 4.3-6.9 x
3,3-5.3 wm, forming divergent, dry and basipetal chains. Chlamydospores
present, produced singly or in short chains, thick-walled, roughened, globose
to subglobose, 7.5-8.5 um in diameter.
COLONIES ON PDA at 25°C within 14 days, usually growing more rapidly
than on Czapek agar, 27mm, consisting of a pink mycelium, with some irregular
radiating furrow and more or less hyaline exudates. Reverse saddle brown, with
distinct radiating furrow and present wine red pigment diffusion.
COLONIES ON SABOURAUD AGAR 25 mm at 25°C within 14 days, consisting
of white mycelium, with some irregular radiating furrow. Reverse light brown,
with distinct radiating furrow.
Paecilomyces wawuensis sp. nov. (China) ... 307
P. carneus
P. carneus
P. carneus
P. carneus
GZU -BCECWSI15
P. gunnii
P. gunnii
P. gunnii
P. marquandii
P. viridis
P. penicillatus
P. niphetodes
P. antarcticus
en, expansum
Fic. 2. The gene tree was constructed using the MP method and based on phylogenetic analysis of
the nucleotide sequences of ITS1-5.8S-ITS2 rDNA. It shows the relationships between GZU-
BCECWS15 and other Paecilomyces species. Bootstraps values (1,000 replicates) are indicated
at the nodes (TL = 577, CI = 0.825, HI = 0.175, RI = 0.710, RC = 0.586).
97 P. carneus
94 P. carneus
100 P. gunnii
GZU -BCECWS15
P. viridis
Pen. expansum
Fic. 3. The gene tree was constructed using the MP method and based on phylogenetic analysis of
the B-tubulin gene sequences. It shows the relationships between GZU-BCECWS15 and other
Paecilomyces species. Bootstraps values (1,000 replicates) are indicated at the nodes (TL = 174,
CI = 0.937, HI = 0.063, RI = 0.645, RC = 0.604).
Phylogenetic analyses
The ITS1-5.8S-ITS2 rDNA of the 2 wawuensis has been sequenced
and compared with that of P carneus (CBS 239.32, GenBank Accession
No.: AY624171) and PB gunnii (GenBank Accession No.: AJ3093390) in an
alignment. In comparison with PB carneus, P wawuensis exhibited 31 transitions/
transversions and 36 deletion and 6 insertion substitutions. Meanwhile
there were 60 positional transitions/transversions and 57 insertion/deletion
substitutions in ITS1-5.8S-ITS2 rDNA between P. gunnii and P. wawuensis.
308 ... He & al.
At the same time, the alignment of B-tubulin gene sequences from
P. gunnii, PB. carneus, and P. wawuensis showed that P. wawuensis had 1 insertion
substitution, 6 deletion substitutions and 12 transitions/transversions both to
P. gunnii and P. carneus.
Both the most parsimonious trees (MPT) inferred from the ITS rDNA
(Fic. 2) and the B-tubulin gene sequences data (Fic. 3) showed that the strain
GZU-BCECWS15 stands parallel to the others, although it is clustered with
P. gunnii and P. carneus in a subclade.
Discussion
In the genus Paecilomyces, rare species have been found to have echinulate
conidia. The previously accepted species with echinulate conidia were
P. carneus Brown & Smith (Samson 1974), P. gunnii Z.Q. Liang (Liang 1985),
and P curticatenatus Z.Q. Liang & Y.F. Han (Han et al. 2007). Liang et al. (2009)
recombined P curticatenatus in a new genus, Taifanglania, characterised by
solitary phialides; this character separates P. curticatenatus from P. wawuensis.
The new species P wawuensis can be separated from P carneus and P. gunnii by
the sandy beige reverse of the colony on Czapek agar and the large ellipsoidal-
ovate conidia (TABLE 3). Paecilomyces wawuensis can be distinguished from
the other species in having a white/ sandy beige colony on Czapek agar and
echinulate conidia.
TABLE 3. A comparison between Paecilomyces wawuensis and its related species
CoLony PHIALIDES CONIDIA CHLAMYDO-
SPECIES [a
OBVERSE REVERSE SEORES
P. carneus white olive cylindrical subglobose to ellipsoidal absent
drab 3-4 x 2-2.5 um
P. gunnii grey brown cylindrical subellipsoidal or subovate present
1.6-4.8 x 1.2-3.5 um
P wawuensis white sandy cylindrical/ ellipsoidal or ovate to subglobose _ present
beige ampulliform 4.3-6.9 x 3.3-5.3 um
Meanwhile the dominant substitutions and transitions/transversions in the
alignments of ITS1-5.8S-ITS2rDNA and B-tubulin gene sequences of P. carneus,
P. gunnii, and PB wawuensis differentiate the new species from the others.
In conclusion, Paecilomyces wawuensis can be distinguished from the other
species in the genus by the following morphological characters: 1) colonies on
Czapek agar grow slowly and the obverse is white while the reverse is sandy
beige; 2) phialides consist of a cylindrical, sometimes inflated base, tapering
into a long, thin, and sometimes incurved neck; and 3) conidia are ellipsoidal
or ovate to subglobose, large and roughened-walled with spinules.
Both phylogenetic trees (Fics. 2, 3) based on ITS rDNA and 6-tubulin gene
sequences show that the strain GZU-BCECWS15 stands parallel to P. carneus
Paecilomyces wawuensis sp. nov. (China) ... 309
and P gunnii in a sub-clade, although all of them possess roughened-walled
conidia with spinules. Both molecular and morphological evidence supports
P. wawuensis (GZU-BCECWS15) as a new species.
Acknowledgements
This work was supported by the grant of National Natural Science Foundation of
China (No. 30660002). We are grateful to Prof. Wen-Ying Zhuang and Prof. Zhu-Liang
Yang for their comments on the manuscript. At the same time, we sincerely appreciate
editorial review and revisions.
Literature cited
Brown AHS, Smith G. 1957. The genus Paecilomyces Bainier and its perfect stage Byssochlamys
Westling. Trans. Brit. Mycol. Sac. 40(1): 17-89. doi:10.1016/S0007-1536(57)80066-7
Bainier G.1907. Mycothéque de lécole de Pharmacie. XI. Paecilomyces, genre nouveau de
Mucedinees. Bull. Trimest. Soc. Mycol. Fr. 23: 26-27
Han YF, Chu HL, Liang ZQ. 2005a. Two new species of the genus Paecilomyces in China. Mycotaxon
92: 311-316.
Han YF, Liang ZQ, Chu HL, Kang JC. 2005b. Paecilomyces parvisporus, a new species and its allies
from Yunnan, China. Mycotaxon 94: 357-363.
Han YF, Liang ZQ, Chu HL. 2005c. Studies on the genus Paecilomyces in China II. Paecilomyces spp.
from Guizhou. Mycotaxon 91: 361-364.
Han YF, Liang ZQ, Chu HL. 2007. A new thermophilic species of Paecilomyces, Paecilomyces
Curticatenatus. Mycosystema 26(1): 13-16.
Li Z, Han YE, Liang ZQ. 2006. A new species Paecilomyces verticillatus sp. nov. from soil in China.
Mycotaxon 95: 133-136.
Liang ZQ. 1985. Isolation and identification of the conidial stage of Cordyceps gunnii. Mycosystema
(3): 162-166.
Liang ZQ, Han YF, Chu HL, Liu AY. 2005a. Studies on the genus Paecilomyces in China I. Fungal
Diversity 20: 83-101.
Liang ZQ, Han YF, Liu AY, Huang JZ. 2005b. Some entomogenous fungi from Wuyishan and
Zhangjiajie nature reserves II. Three new species of the genus Hirsutella. Mycotaxon 94:
349-355,
Liang ZQ, Han YF, Chu HL. 2006. Studies on the genus Paecilomyces in China IV. Two new species
of Paecilomyces with monophialides. Mycotaxon 97: 13-20.
Liang ZQ, Han YE, Chu HL, Fox RTV. 2009. Studies on the genus Paecilomyces in China V.
Taifanglania gen. nov. for some monophialidic species. Fungal Diversity 34: 69-77.
O’DonnellK, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic
lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenet. Evol. 7: 103-116.
Oscar FC, Ana C, Jamshid £1999. DNA extraction and PCR amplification method suitable for
fresh, herbarium-stored, lichenized, and other fungi. Plant Systematics and Evolution 216:
243-249. doi: 10.1007/BF01084401
Samson RA. 1974. Paecilomyces and some allied hyphomycetes. Stud. Mycol. 6: 1-119.
Stolk AC, Samson RA. 1972. Studies on Talaromyces and related genera II. The genus Talaromyces.
Stud. Mycol. 2: 1-65.
Swofford DL. 2004. PAUP*: Phylogenetic analysis using parsimony (*and other methods). Version
4.0 Sinauer Associates, Sunderland, MA.
310 ... He & al.
Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, positions-specific gap penalties and
weight matrix choice. Nucleic Acids Research 22:4673-4680. doi:10.1093/nar/22.22.4673
WhiteTJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: PCR Protocols: A Guide to Methods and
Applications. Academic Press, New York.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 311-322 January-March 2011
DOT: 10.5248/115.311
Mycosphaerella nyssicola revisited:
a species distinct from M. punctiformis
ANDREW M. Minnis", Amy Y. RossMAN! & RICHARD T. OLSEN?
‘Systematic Mycology & Microbiology Laboratory, USDA-ARS &
Floral and Nursery Plants Research Unit, US National Arboretum, USDA-ARS:
Rm. 128, BOIOA, 10300 Baltimore Avenue, Beltsville, MD 20705, USA
* CORRESPONDENCE TO: Drew.
[email protected]
ABsTRACT —Nyssa trees involved in a breeding program for ornamentals were found
to be affected deleteriously by a leaf spot disease. The causative agent was identified as a
species of Mycosphaerella that had been classified as morphologically indistinguishable from
M. punctiformis. A subsequent taxonomic investigation using morphological data from new
and existing herbarium collections, cultural data, and ITS region rDNA sequences suggested
that this was a distinct species on Nyssa that represents the previously described M. nyssicola.
The species is lectotypified and epitypified to promote nomenclatural and taxonomic
stability.
Key worps — Ascomycota, Asteromella nyssae, Dothideomycetes, lectotype, Phyllosticta
nyssae
Introduction
Nyssa (Cornaceae) is a small genus of trees disjunct between eastern Asia
and eastern North America and Central America (Wen & Stuessy 1993), Four
North American species (N. aquatica L., N. biflora Walter, N. ogeche W. Bartram
ex Marshall, and N. sylvatica Marshall), collectively known as gums or tupelos,
are found in swamps and alluvial soils as well as uplands. The black gum,
N. sylvatica, is the most commonly cultivated species for ornamental and urban
tree use due to its beautiful red fall color. The USDA-ARS National Arboretum
began a Nyssa breeding program in the early 1990’s directed at improving
urban adaptability and transplantability for the nursery industry. Increased use
of Nyssa has been tempered by a disfiguring leaf spot disease that results in
reduced aesthetic appeal and premature defoliation (Dirr 1998). In 2006, the
Arboretum refocused the Nyssa program towards developing resistance to this
organism.
312 ... Minnis, Rossman & Olsen
Recent attempts at identifying the causal organism failed or resulted in
isolation of secondary pathogens (Dirr 1998, Charles Hodges pers. comm.).
It was assumed to be a widely distributed species of Mycosphaerella Johanson
(Dothideomycetes, Ascomycota) that has been classified as morphologically
indistinguishable from and probably conspecific with M. punctiformis (Pers.)
Starback, the type species of the genus (Aptroot 2006). The genus Mycosphaerella
includes a vast diversity of species on multitudinous hosts, and it is successful
in several ecological roles, including most importantly as a plant pathogen
(Verkley et al. 2004, Crous 2009). Species of Mycosphaerella are in general
host specific, but several species have broader host ranges (Crous 2009). A
recent paper serving to stabilize the taxonomic application of M. punctiformis
suggested that this species, in a strict sense, was specific to Quercus (Verkley et
al. 2004).
Knowledge of the identity and host range of the leaf spot fungus from Nyssa
is important in the development of disease control strategies and resistant
cultivars. New isolates were obtained from Nyssa in field plots of the USDA
breeding program and DNA sequence data of the ITS region were generated for
comparison with other Mycosphaerella species. New specimens were compared
with herbarium collections including type specimens, which are designated
herein to promote nomenclatural and taxonomic stability.
Materials & methods
Isolation from fruiting bodies
Overwintered, dead, and fallen leaves were collected in spring. Cultures on cornmeal
dextrose agar (CMD) were obtained variously by growth at room temperature from
ascospores ejected from bits of leaves containing pseudothecia glued to the top lid of
Petri dishes that were incubated with either the top lid oriented upwards or downwards
or ascospores, usually with associated asci, from crushed pseudothecia isolated with a
pipette. Cultures were deposited in the Centraalbureau voor Schimmelcultures (CBS).
Morphological examination
Microscopic observations and measurements of sections and crush mounts of fresh
material were made in water. For viewing of dried material, material was wetted with
95% ethanol and subsequently rehydrated and viewed in 3% KOH. Phloxine solution
(Largent et al. 1977) was also used to aid in microscopic examination. In the descriptions,
an ™ indicates average or mean and Q is the length to width ratio. For phenotypic
observations, cultures were grown on potato dextrose agar (PDA). See Farr & Rossman
(2010) for complete collection data of examined historical herbarium collections. New
collections were deposited in the US National Fungus Collections (BPI).
Fic. 1. Strict consensus of the 600 equally most parsimonious trees resulting from the phylogenetic
analysis. Percent bootstrap support values from the 1000 replicates are indicated above branches.
GenBank accession numbers are shown to the right of the names.
Mycosphaerella nyssicola is not M. punctiformis ... 313
Ramularia clade
99
55
75
65
99
100
0.9
81
61
91
70
100
57
62
91
‘M. fragariae AY 152597
‘M. fragariae AF297325
‘M. fragariae AY152596
‘M. fragariae AY152595
‘M. fragariae AF173312
R. collo-cygni AF173310
R. sp. AJ417496
‘M. rubella AY490767
M. punctiformis AY490759 ex Acer
-M. punctiformis AY490760 ex Tilia
M. punctiformis AY152593 ex Acer
-M. punctiformis AY 152594 ex Quercus
‘M. phacae-frigidae AY490758
‘M. punctiformis AY490762
‘M. punctiformis AY490764
‘M. punctiformis AY490766
‘M. punctiformis AY490765 sensu stricto
-M. punctiformis AY490761
‘M. punctiformis AF222848
‘M. punctiformis AY490763 ex-epitype
-M. nyssicola HQ162263
‘M. nyssicola HQ162266 ex-epitype
‘M. nyssicola HQ162265
‘M. nyssicola HQ162264
‘M. graminicola AY 152602
‘M. graminicola AY 152603
‘M. graminicola AF181692
‘M. graminicola AF 181693
‘Septoria passerinii AF181697
ladosporium bruhnei AY251078 ] Outgroup
sensu lato
314 ... Minnis, Rossman & Olsen
DNA isolation, amplification, sequencing
DNA was isolated from cultures on CMD and the ITS region rDNA was amplified and
sequenced following the methods of Bao et al. (2010). Sequences were also assembled
and edited from chromatographs according to Bao et al. (2010).
Phylogenetic analyses
An initial BLAST search on GenBank indicated that the Nyssa isolates were closely
related to M. punctiformis with 96% maximum identity. The ITS region sequence data
from these isolates were subsequently aligned with that of the taxa included in a prior
taxonomic study of M. punctiformis (Verkley et al. 2004) using Clustal X version 2.0.10
(Larkin et al. 2007). A preliminary analysis employed PAUP* 4.0b10 (Swofford 2002)
using the same settings as Verkley et al. (2004). A reduced dataset was constructed
using the Nyssa isolates and selected members of the Ramularia clade and closely related
species from the Verkley et al. (2004) study with Cladosporium bruhnei Linder as the
outgroup [= “Davidiella tassiana” (De Not.) Crous & U. Braun of Verkley et al. 2004]
and aligned with Clustal X using the default settings (Larkin et al. 2007) with the ingroup
aligned in the first step and the outgroup added in a subsequent second step alignment.
The resulting alignment was visually inspected and the unaligned ends were omitted
from later analyses. GenBank accession numbers of included sequences are indicated in
Fic. 1. A maximum parsimony analysis was performed using the default parameters of
the heuristic search of PAUP* 4.0b10 (Swofford 2002) that included characters 50-560 of
the dataset. A parsimony bootstrap analysis was performed using the default settings of
PAUP* 4.0b10 (Swofford 2002) with 1000 replicates and maxtrees set at 1000.
Results
The preliminary analysis showed the Nyssa isolates were part of the Ramularia
clade (Verkley et al. 2004, Crous et al. 2009), also known as Mycosphaerella
sensu stricto (Crous et al. 2009). Analyses of the reduced ITS region dataset
contained thirty taxa with Cladosporium bruhnei as outgroup and included 501
characters, of which 83 were parsimony informative. The heuristic search of
the maximum parsimony analysis produced 600 equally most parsimonious
trees of length 225. The consistency (CI), homoplasy (HI), retention (RI),
and rescaled consistency (RC) indices were 0.831, 0.169, 0.912, and 0.758,
respectively. A strict consensus tree is presented in Fic. 1. The Ramularia clade
(Mycosphaerella sensu stricto) was recovered with 99% bootstrap support
(BS). The isolates from Nyssa formed a well-supported clade (99% BS).
A larger clade, one lacking significant statistical support but composed of
several moderately supported subclades, was sister to the Nyssa isolate clade.
One of these subclades is M. punctiformis sensu stricto with 65% BS, which
is distinct from the isolates from Nyssa that are determined to represent
M. nyssicola. Isolates of M. punctiformis sensu lato and M. phacae-frigidae
grouped in a clade (75% BS) with M. phacae-frigidae sister to a strongly
supported (100% BS) M. punctiformis sensu lato clade.
Mycosphaerella nyssicola is not M. punctiformis ... 315
Taxonomy
Mycosphaerella nyssicola (Cooke) B.A. Wolf, Mycologia 32: 333. 1940,
as ‘nyssaecola’ Fics. 2-5
= Sphaerella nyssicola Cooke, Hedwigia 17: 40. 1878, as ‘nyssoecola’.
Lectotypus of Sphaerella nyssicola (hic designatus): USA. Florida: Gainesville, on leaves
of Nyssa, leg. Ravenel, Func AMERICANI ExsiccarI no. 96 (BPI 608979). Note: BPI has
more than one of these exsiccatae. This one is mounted on a separate sheet and given a
specific BPI number.
Epitypus of Sphaerella nyssicola (hic designatus): USA. Maryland: Prince George's
Co., Glenn Dale, U.S. Plant Introduction Station, 11601 Old Pond Dr. (38°58'00.49"N
76°48’ 12.78” W), on overwintered, dead, and fallen leaves of Nyssa spp., V.2009, leg. RT
Olsen (BPI 880897, AR 4656 ex-epitype culture deposited at CBS 127665, ITS GenBank
Accession No. HQ162266).
PsEUDOTHECIA developing overwinter on fallen dead leaves; chiefly
hypophyllous; scattered to gregarious, sometimes touching but not confluent;
erumpent; semi-immersed; globose; black; 65-125 um diam. (74-97 um diam.
in lectotype); ostiole apical, 10-23 umdiam. PsEUDOTHECIAL WALL with
2-3 layers of brown textura angularis. PARAPHYsEs absent. Ascr bitunicate,
34-48 x 6.5-8 um, fasciculate, cylindrical, straight to slightly curved, with a
short pedicel, octosporous. AscosporEs 6.4-8.3 x 1.9-3.2 um, Q = 2-3.3 um
("= 7.1 x 2.6 um, Q™ = 2.7 um), fusoid-ellipsoid, tapering towards ends,
tapering more prominently towards lower end, ends obtuse, widest above
septum, with 1 septum, median or slightly supramedian, slightly constricted at
septum, thin-walled, hyaline, uniseriate to biseriate, sometimes oblique within
and among asci. Germination not observed.
In CULTURE: CoLony after 31 days on PDA at approx. 22°C and exposed to
ambient lighting, up to 29 mm diam., low without abundant aerial mycelium,
raised in a mound at center, texture somewhat slimy but not yeast-like, pinkish,
or with a pinkish base covered by a whitish tomentum, paler at margin, reverse
pinkish to rosette, not sporulating, older cultures sometimes developing
fruiting structures more or less globose, black, presumably immature, with
walls textura angularis. MycELIuM with hyphae branching, septate, hyaline or
faintly pigmented at times when viewed in mass, walls smooth, width 1.9-3.2
yum.
SPECIMENS EXAMINED: USA. FLoripa: (BPI 608979, designated lectotype); idem (3
additional exsiccatae duplicates of lectotype without BPI numbers); GEorGIA: Richmond
Co. AuGusTA, PHINIZY SWAMP NATURE Park, on overwintered, dead and fallen leaves
of Nyssa aquatica, 19.1I1.2010, leg. J.E. Gordon (BPI 880908, asci and ascospores not
observed); MARYLAND: Prince George’s Co. GLENN DaLe, U.S. PLANT INTRODUCTION
STATION, 11601 OLD PonD DR., 38°58'00.49”N 76°48 12.78 W, on overwintered, dead
and fallen leaves of Nyssa spp., V.2009, leg. RT Olsen (BPI 880897, designated epitype,
ex-epitype culture deposited at CBS 127665 = AR 4656, ITS GenBank Accession No.
316 ... Minnis, Rossman & Olsen
Fic. 2. Mycosphaerella nyssicola. Upper: leaf discoloration and defoliation at U.S. National
Arboretum research plots, Glenn Dale, MD. Lower: leaf spot symptoms on Nyssa ogeche in fall,
USNA, Washington, DC.
HQ162266; AR 4655 additional culture not preserved, ITS GenBank Accession No.
HQ162265); idem (BPI 880800, culture deposited at CBS 127664 = AR 4629, ITS
GenBank Accession No. HQ162264; AR 4626 additional culture not preserved, ITS
GenBank Accession No. HQ162263); NORTH CAROLINA: (BPI 608981, 876718); WEST
VIRGINIA: (BPI 601980, immature; BPI 608980, immature).
Mycosphaerella nyssicola is not M. punctiformis ... 317
Fic. 3. Mycosphaerella nyssicola. UPPER LEET: leaf spot symptoms on Nyssa sylvatica x N. ogeche
hybrid in USNA research plots, Beltsville, MD. UPPER RIGHT: leaf spot symptoms on N. ogeche
and N. sylvatica growing at USNA research plots, Washington, DC. Lower LEFT: leaf spot
symptoms on N. sinensis growing in the Asian collections at the USNA, Washington, DC.
LOWER RIGHT: overwintering Nyssa leaves at USNA research plot, Glenn Dale, MD.
ANAMORPH (SPERMATIAL STATE): Asteromella nyssae (Cooke) Aa, A revision
of the species described in Phyllosticta: 336. 2002.
= Phyllosticta nyssae Cooke, Grevillea 12: 26. 1883.
Lectotypus of Phyllosticta nyssae (hic designatus): USA. Georgia: Darien, on leaves of
Nyssa capitata, leg. Ravenel, FUNGI AMERICANI ExsiccatI no. 798 (BPI 353790). Note:
BPI has more than one of these exsiccatae. This one is mounted on a separate sheet and
given a specific BPI number.
LEAF spots epiphyllous, but discoloring beneath, irregular, frequently
coalescing, large, pallid with margin purplish or purplish. SPERMOGONIA chiefly
hypophyllous; frequently but not always associated with spots; scattered to
318 ... Minnis, Rossman & Olsen
Fic. 4. Mycosphaerella nyssicola. UPPER ROW: pseudothecia of BPI 608981. MIDDLE ROW AND
LOWER LEFT: asci and ascospores of BPI 608981. LowER RIGHT: ex-epitype culture on PDA
(CBS 127666). Scale bars = 10 um.
gregarious, sometimes touching but not confluent; erumpent; semi-immersed;
pseudopycnidial; globose; black; 61-103 wm diam. (65-103 um diam. in
lectotype); ostiole apical, 16-29 um diam. (16-23 tm diam. in lectotype);
unilocular. SPERMAGONIAL WALLS composed of an outer layer of brown textura
angularis and a hyaline inner layer that produces the spermatogenous cells.
SPERMATOGENOUS CELLS determinate; phialidic; hyaline; walls smooth; discrete
or more typically integrated on spermatiophores; spermatiophores up to three
Mycosphaerella nyssicola is not M. punctiformis ... 319
Fic. 5. Asteromella nyssae (spermatial state of Mycosphaerella nyssicola). UPPER ROW:
spermogonia of BPI 353792. Middle row: conidiogenous cells of BPI 353799. LowER
ROW: spermatia of BPI 353792. Scale bars = 10 um.
septate, occasionally branching at base; loci apical or on short side branches
formed one per cell immediately below septa of spermatiophores. SPERMATIA
3,2-5.8 x 0.6-1.6 um, Q = 2.4-5.3 um ("= 4.1 x 1.2 um, Q™ = 3.4 um)
(3.8-4.5 x 1-1.3 um in lectotype), at times copious and adhering in large
numbers, bacilliform, aseptate, walls smooth, hyaline, eguttulate.
SPECIMENS EXAMINED: USA. GEorGIA: (BPI 353789, duplicate of lectotype; BPI 353790,
designated lectotype); MICHIGAN: (BPI 353793); NorTH CAROLINA: (BPI 353792);
SouTH CAROLINA: (BPI 353796, 353797); TENNESSEE: (BPI 860755); VIRGINIA: (BPI
353788, 353791, 353795, 353799); WEST VIRGINIA: (BPI 353798, 521392, 521393).
320 ... Minnis, Rossman & Olsen
HABITAT & DISTRIBUTION — Based on Farr & Rossman (2010) and examined
specimens, Mycosphaerella nyssicola is known to occur on leaves of Nyssa
aquatica, N. biflora (= N. sylvatica var. biflora), N. ogeche, and N. sylvatica, and
it is widely distributed in the eastern USA (AL, FL, GA, MD, MI, NC, NY, PA,
SC, TN, VA, WV), especially in the southeastern states. Observations of disease
symptoms at the USDA field plot also confirmed as hosts: N. sinensis and two F1
hybrids, N. sylvatica x N. ogeche and N. sylvatica x N. sinensis. It is possible that
the distribution of M. nyssicola is greater than that reported in the literature,
and the fungus may occur throughout the range of Nyssa in the USA.
COMMENTS — Analyses of the DNA sequence data from the ITS region suggest
that isolates from Nyssa are distinct from isolates of M. punctiformis both sensu
stricto and sensu lato as presented by Verkley et al. (2004). Morphological
examination of new collections and historical herbarium collections indicates
that the Nyssa isolates are identical with Mycosphaerella nyssicola. Although M.
nyssicola is more or less indistinguishable from M. punctiformis, as was noted
by Aptroot (2006), DNA evidence and host specificity support M. nyssicola as
a distinct species on Nyssa.
With respect to types, Cooke (1878) described Sphaerella nyssicola as a
new species occurring on Nyssa, and the original material was distributed as
exsiccatae in Ravenel’s FUNGI AMERICANI Exsiccati. Confusingly, the labels
of the exsiccatae cited in the protologue by Cooke (1878) indicate specimens
from Florida on Nyssa, while the protologue lists South Carolina and Nyssa
multiflora (= N. sylvatica) for distribution and host. These exsiccatae are
syntypes (McNeill et al. 2006: Art. 9.4). Aptroot (2006), who listed a specimen
from South Carolina at K as holotype and exsiccata no. 96 at BPI from Florida
as isotype, did not use the phrase ‘hic designatus? which would have caused an
accidental lectotypification of the species (McNeill et al. 2006: Arts. 7.11, 9.8).
However, to assume that a collection housed in the original author’s herbarium
represents the holotype when no holotype has been designated is not the correct
course of action. Additional confusion results from whether original material
exists from Florida, from South Carolina, or from both regions. To resolve the
confusion, we designate one syntype as lectotype (McNeill et al. 2006: Art. 9.2).
‘The original material (as noted by Cooke, 1878) is immature. Despite repeated
attempts, we were unable to find asci or ascospores in any of the four exsiccatae
(including the designated lectotype) housed at BPI.
Similarly, Cooke (1883) described Phyllosticta nyssae as a new species
on Nyssa capitata (= N. ogeche), and the original material was distributed as
exsiccatae in Ravenel’s FUNGI AMERICANI EXSICCATI. Seaver (1922), Wolf
(1940), and Aa & Vanev (2002), all of whom provided morphological data on
this species and cited the exsiccatae, did not designate a type. Hence, we here
also designate one syntype as lectotype.
Mycosphaerella nyssicola is not M. punctiformis ... 32.1
Lastly, because the type material is immature, we epitypify S. nyssicola based
on a recent collection of Mycosphaerella nyssicola from Maryland. The living
culture and DNA data obtained from the epitype aid in the application of the
name (McNeill et al. 2006: Art. 9.7), although we are somewhat reluctant to
epitypify the name based on a specimen that was not collected in the type
locality (.e., either Florida or South Carolina). The epitype is otherwise
identical in all regards to material observed by Wolf (1940) and so maintains
current usage of the name.
Wolf (1940) provided an excellent symptomatological account of this leaf
spot disease and the life history of M. nyssicola. We have nothing to add except
that Koch's postulates have not yet been completed, linkage of the teleomorphic
and spermatial states is circumstantial, and no attempts have been made to
germinate spermatia that would confirm they are not conidial in nature. We
also have not studied fresh material of the spermatial state. As with Wolf (1940),
we found no Ramularia or other conidial state for this fungus. Mycosphaerella
nyssicola is typical of members of the Ramularia clade (also known as section
Mycosphaerella or Mycosphaerella sensu stricto) and it is quite similar to M.
punctiformis (Verkley et al. 2004, Crous 2009, Crous et al. 2009). At this time,
we do not propose anew combination in Ramularia based on the teleomorphic
state as advocated by Crous et al. (2009) for species of Mycosphaerella sensu
stricto, as the latter generic name correctly adheres to ICBN Art. 59.1 (McNeill
et al. 2006).
Acknowledgments
We thank Tunesha Phipps and Sasha Allen of the Systematic Mycology and
Microbiology Laboratory for assistance with DNA sequencing. Judith Gordon of
Augusta State University is warmly acknowledged for sending fungal material. We
extend our gratitude to Uwe Braun of Martin-Luther-Universitat and Charles Hodges of
North Carolina State University for their expert reviews of this manuscript.
Literature cited
Aa HA van der, Vanev S. 2002. A revision of the species described in Phyllosticta. Centraalbureau
voor Schimmelcultures, Utrecht, The Netherlands.
Aptroot A. 2006. Mycosphaerella and its anamorphs: 2. Conspectus of Mycosphaerella. CBS
Biodiversity Ser. 5: 1-231.
Bao X, Carris LM, Huang G, Luo J, Liu Y, Castlebury LA. 2010. Tilletia puccinelliae, a new species
of reticulate-spored bunt fungus infecting Puccinellia distans. Mycologia 102: 613-623.
doi: 10.3852/09-135
Cooke MC. 1878. North American fungi. Hedwigia 17: 37-40.
Cooke MC. 1883. New American fungi. Grevillea 12: 22-33.
Crous PW. 2009. Taxonomy and phylogeny of the genus Mycosphaerella and its anamorphs. Fungal
Diversity 38: 1-24.
Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, Burgess TI, Andjic V, Barber
PA, Groenewald JZ. 2009. Unraveling Mycosphaerella: do you believe in genera? Persoonia: 23:
99-118. doi:10.3767/003158509X479487
322 ... Minnis, Rossman & Olsen
Dirr MA. 1998. Manual of Woody Landscape Plants: Their Identification, Ornamental
Characteristics, Culture, Propagation, and Uses. Stipes, Champaign, IL.
Farr DE, Rossman AY. 2010. Fungal databases, Systematic Mycology and Microbiology Laboratory,
ARS, USDA. Retrieved June 14, 2010, from http://nt.ars-grin.gov/fungaldatabases/.
Largent D, Johnson D, Watling R. 1977. How to identify mushrooms to genus III: Microscopic
Features. Mad River Press, Eureka, CA.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,
Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and
Clustal X version 2.0. Bioinformatics 23: 2947-2948. doi:10.1093/bioinformatics/btm404
McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH, Prado
J, Silva PC, Skog JE, Wiersema JH, Turland NJ (eds.). 2006. International Code of Botanical
Nomenclature (Vienna Code): Adopted by the Seventeenth International Botanical Congress,
Vienna, Austria, July 2005. ARG Gantner, Ruggell, Liechtenstein.
Seaver FJ. 1922. Phyllostictales Phyllostictaceae (pars). N. Amer. Fl. 6: 1-84.
Swofford DL. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods). Version
4.0b10. Sinauer Associates, Sunderland, MA.
Verkley GJM, Crous PW, Groenewald JZ (Ewald), Braun U, Aptroot A. 2004. Mycosphaerella
punctiformis revisited: morphology, phylogeny, and epitypification of the type species of the
genus Mycosphaerella (Dothideales, Ascomycota). Mycol. Res. 108: 1271-1282. doi:10.1017/
$0953756204001054
Wen J, Stuessy TF. 1993. The phylogeny and biogeography of Nyssa (Cornaceae). Syst. Bot. 18:
68-79. doi:10.2307/2419789
Wolf FA. 1940. A leafspot fungus on Nyssa. Mycologia 32: 331-335. doi:10.2307/3754315
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 323-326 January-March 2011
DOT: 10.5248/115.323
Acaulospora soloidea, a new arbuscular mycorrhizal fungus
from rhizosphere soils of Murraya paniculata
J.D. VAINGANKAR' & B.F. RODRIGUES?
Department of Botany, Goa University, Goa 403 206, India
ABSTRACT — A new species of Acaulospora from the laterite soils in Goa, India is described
and illustrated. The spores have a unique wall with fibrillose, hairy outgrowths, which appear
like the rays of the sun when mounted in water or PVLG, hence named as A. soloidea.
Key worps — Glomeromycota, spore morphology, taxonomy, species description
Introduction
A survey was conducted on the rhizosphere soils of ornamental flowering
plants of Goa state to collect the arbuscular mycorrhizal fungal diversity and
distribution data. During the survey an interesting taxon was isolated from
Murraya paniculata. The spore wall is covered with numerous fibrillose,
acellular, hairy outgrowths forming a thick cover. When the spores are mounted
in a drop of water or PVLG, these hairs unfold from the spore surface to spread
around the spore like solar rays, giving the spore an appearance of sun, hence
proposed as Acaulospora soloidea sp. nov.
Materials & methods
Spores were isolated from the rhizosphere soils by wet sieving, decanting and sucrose
centrifugation (Sieverding 1991). The spores were mounted in Polyvinyl alcohol lacto-
glycerol (PVLG) and in PVLG mixed with Melzer’s reagent (1:1, v/v). Wall description
and terminology are based on those suggested by Walker (1983) and Walker & Vestberg
(1998). Type material has been deposited in the Goa University Arbuscular Mycorrhizal
Culture Collection. To study more carefully the external morphology of the spores, a
number of them were prepared for Scanning Electron Microscopy (SEM). Before the
preparation of the material for SEM, spores were put under a dissecting microscope to
remove any debris adhering to the spore surface. For SEM studies, clean dry spores were
mounted on an aluminum stub with double-sided transparent tape, coated with gold,
and observed.
324 ... Vaingankar & Rodrigues
Fics 1-6. Acaulospora soloidea. 1. Fresh spores under transmitted light. 2. Dry spore.
3. Spores mounted in PVLG. 4-6. Spores showing wall layers.
Acaulospora soloidea Vaingankar & B.F. Rodrigues, sp. nov. Ficures 1-12
MycosBank MB 518836
Sporae singulae pallide brunneae vel brunneae, globosae vel subglobosae (50-)65-84(-90)
um diam. Tunica sporae e stratis quinque in turmis tribus, in totum 2.0-3.0 um crassa.
Tunica exterium (stratum 1) unitum, hyalinum 0.4-0.6 um crassa, caducus, tenue et
evanescens. Tunica media stratis duobus, stratum exterius (stratum 2) brunneae, 1.2-1.6
um crassa, rigido, cum appendicibus numerosis fibrillosis, pilosae sporae, 3-6 jm cr.
formantibus. Stratum interioris (stratum 3) hyalinum vel pallide brunneae 0.3-0.4um
crassa. Tunica interior stratis duobus (strati 4, 5); quarto hyalinum, 0.1-0.2 um crassa;
quinque hyalinum, 0.1-0.2 um crassa amorpho.
HoLotype: India. Goa: Arambol, from rhizosphere soil of Murraya paniculata (L.)
Jack (Rutaceae), 3 Jan. 2009, Jyoti. (Arbuscular Mycorrhizal Culture Collection, Goa
University: Slide no. OFP-VJ1).
EryMo.ocy: soloidea, from Latin sol (= sun) and —oideus (= resembling), referring to
the sun like appearance of the spore.
Acaulospora soloidea sp. nov. (India) ... 325
100pm*
Fics 7-12. Acaulospora soloidea. 7. Crushed spore showing lipid content. 8. Spore
mounted in PVLG + Melzer’s reagent showing inner wall. 9-10. Spores showing hairy
ornamentation. 11-12. SEM images of spores.
Spores formed singly in the soil, sessile, borne laterally on the subtending hypha
of the sporiferous saccule. The spores are pale brown to brown, globose to
subglobose (50-)65-84(-90) tum diam. Spore wall structure of 5 walls (1-5) in
three groups (A, B, C), exterior, medium and interior, in total 2.0-3.0 um thick
(Fics 4-6, 8). Group A with a single wall (W1). Wall 1 is hyaline, 0.4-0.6 um
thick, sloughing completely, evanescent and thus present only in young spores.
Group B consisting of two walls (W2 and W3). Wall 2 is continuous, brown
1.2-1.6 um thick, rigid, with numerous acellular, fibrillose, hairy outgrowths
forming a pile or thick coat 3-6 um on the spore surface (Fics 3-4). The hairs
are tightly packed together on the spore surface when dry (Fic. 2). The length
of each may vary from 10-15 tm, Wall 3 hyaline to light brown, laminated,
0.3-0.4 wm thick tightly adherent to W2. Group C composed of two hyaline
flexible walls (W4 and W5), which are formed after the differentiation of spore
326 ... Vaingankar & Rodrigues
wall. Wall 4 hyaline, bilayered, very thin 0.1-0.2 um, does not show any reaction
with Melzer’s reagent. Wall 5 is hyaline, thin, 0.1-0.2 um, amorphous and is not
beaded (Fic. 8). Spore contents of hyaline lipid globules (Fic. 7).
Discussion
Gerdemann & Trappe (1974) established the genus Acaulosporaand presented
the first key for the two species, A. laevis and A. elegans. The key differentiated
one species known to produce spores with a smooth surface (A. laevis) from
another with an ornamented surface (A. elegans). Presently 19 Acaulospora
species with smooth spore surfaces (http://www.lrz-muenchen.de/~schuessler/
amphylo/) and 15 Acaulospora species with outer spore wall ornamentation have
been identified (Sieverding et al. 2006). Schenck et al. (1984) presented a key to
the ornamented species of Acaulospora. Differentiating features such as spines,
tubercles, ridges, folds, pits or cracks as for the spore wall ornamentations were
used. The species described here is included in this genus. It presents affinities
with the type species in spore shape and wall layers. It differs from other
Acaulospora species in the morphology of the spore surface, which gives rise to
numerous acellular, fibrillose hairy outgrowths forming a pile or thick coat on
the spore surface, which when extended look like the rays of the sun. On the
basis of its morphological characteristics, the isolate represents a novel species
of the genus Acaulospora, for which the name A. soloidea sp. nov. is proposed.
Acaulospora soloidea can be easily distinguished from all other known species
in the genus.
Acknowledgements
We thank Prof. C. Manoharachary and Prof. D.J. Bagyaraj for their helpful suggestions
and critical review of the manuscript. One of us (JDV) acknowledges, with thanks
Department of Science and Technology, New Delhi, for the fellowship.
Literature cited
Gerdemann JW, Trappe JM. 1974. The Endogonaceae in the Pacific Northwest. Mycologia Memoir
No. 5. 76 p.
Oehl F, Sykorova Z, Redecker D, Wiemken A, Sieverding E. 2006. Acaulospora alpina, a new
arbuscular mycorrhizal fungal species characteristic for high mountainous and alpine regions
of the Swiss Alps. Mycologia, 98(2): 286-294. doi:10.3852/mycologia.98.2.286
Schenck NC, Spain JL, Sieverding E, Howeler RH. 1984. Several new and unreported vesicular-
arbuscular mycorrhizal fungi (Endogonaceae) from Colombia. Mycologia 76: 685-699.
doi: 10.2307/3793226
Sieverding E. 1991. Vesicular-arbuscular mycorrhiza management in tropical ecosystems. GTZ
Eschborn Germany.
Walker C. 1983. Taxonomic concepts in the Endogonaceae: spore wall characteristics in species
descriptions. Mycotaxon 18: 443-455.
Walker C, Vestberg M. 1998. Synonymy amongst the arbuscular mycorrhizal fungi: Glomus
claroideum, G. maculosum, G. mutltisubstensum and G. fistulosum. Annals of Botany 82:
601-624. doi:10.1006/anbo.1998.0714
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 327-334 January-March 2011
DOT: 10.5248/115.327
Conidial fungi from the semi-arid Caatinga biome of Brazil.
New species and records for Thozetella
FLAVIA RODRIGUES BARBOSA, SILVANA SANTOS DA SILVA,
PATRICIA OLIVEIRA FIUZA & Luis FERNANDO PASCHOLATI GUSMAO
Departamento de Ciéncias Biolégicas, Laboratério de Micologia, Universidade Estadual de Feira de
Santana, Av. Transnordestina s/n, Novo Horizonte, 44036-900, Feira de Santana, BA, Brazil
CORRESPONDENCE TO: faurb
[email protected], silvanasdasilva@hotmail.
ApsTRACT — As a result of an investigation of microfungi in northeastern Brazil, the
hyphomycete Thozetella submersa sp. nov. is described from submerged wood. Its diagnostic
features are the smooth, elliptic-fusiform, obclavate to rarely obovoid to obclavate, slightly
curved, sometimes corniculate at the ends, microawns. T. boonjiensis and T. gigantea are
recorded for the first time for the American continent. A key to all described species is
included. A synopsis of drawings of microawns (most based on original papers) is provided
for all Thozetella species.
Key worps — anamorphic fungi, diversity, taxonomy
Introduction
Thozetella Kuntze presently includes fifteen species (Castaneda et al. 2002,
Paulus et al. 2004, Allegrucci et al. 2004, Jeewon et al. 2009) found in temperate
and warm regions (Nag Raj 1976, Grandi & Gusmao 2002, Piontelli & Giusiano
2004, Barbosa et al. 2007). Among the variety of sterile structures known for
the hyphomycetes, the presence of microawns is unique for the genus (Sutton
& Cole 1983).
Recent phylogenetic and morphological research of five species of Thozetella
from Australia by Paulus (et al. 2004) confirms that Thozetella species are
anamorphs of the ascomycete Chaetosphaeria Tul. & C. Tul. Their key to 14
described species of Thozetella (Paulus et al. 2004) did not include T! buxifolia
Allegr. et al. (Allegrucci et al. 2004). In their synoptic table of Thozetella species,
Paulus et al. (2004), who apparently did not examine the holotype, cited a
median to submedian septum for microawns in T’ canadensis Nag Raj although
this character was not mentioned in the protologue (Nag Raj 1976). In the
present work, almost all characters are based on original species descriptions.
328 ... Barbosa & al.
Recently, T° pinicola S.Y.Q. Yeung et al. was described from leaf litter of Pinus
elliottii Engelm. in Hong Kong. This new taxon was based on morphology and
DNA sequence analyses (Jeewon et al. 2009).
Paulus et al. (2004), Allegrucci et al. (2004), and Jeewon et al. (2009) retain
T. ciliata (R.E Castafieda et al.) Hol.-Jech. & Mercado within Thozetella.
However, we refer this specimen to Venustosynnema ciliatum (R.F. Castaneda et
al.) R.E. Castafieda & W.B. Kendr. In their discussion of V. ciliatum, Castafieda-
Ruiz et al. (2002) note that the absence microawns and presence of dark brown
setae are characters that exclude the species from Thozetella.
Thozetella species have been reported from leaf litter (Grandi 1999, Parungao
et al. 2002, Castafieda-Ruiz et al. 2003, Allegrucci et al. 2004), decaying floral
parts (Agnihothrudu 1958), soil (Agnihothrudu 1962), roots (Waipara et al.
1996), stalks (Nag Raj 1976), and bark (Morris 1956). This constitutes the third
report of the genus from freshwater habitats following those of T. havanensis
R.E Castafieda (from submerged leaf litter) and T’ nivea (Berk.) Kuntze (from
wood) (Sivichai et al. 2002, Delgado-Rodrigues & Mena-Portales 2004).
From Brazil, five Thozetella species have been found: T. cristata Piroz. & Hodges,
T. cubensis R.E. Castafieda & G.R.W. Arnold, T. havanensis (Barbosa et al. 2007, Silva
& Grandi 2008), T) queenslandica B.C. Paulus, Gadek & K.D. Hyde (Cruz & Gusmao
2009), and T. tocklaiensis (Agnihothr.) Piroz. & Hodges (Maia et al. 2002).
Materials & methods
STUDY SITE. Collecting trips were made to the hygrophilous forests called “Serra da
Jibdia” in the semi-arid region in the northeastern of Brazil. This area has been described
previously (Barbosa et al. 2007, Marques et al. 2007)
COLLECTION TECHNIQUES. Submerged leaves and wood debris were collected from
a lotic habitat in an unnamed stream in the “Serra da Jibdia”. Samples were placed in
plastic bags and returned to the laboratory. The plant material was then incubated at
25°C in Petri dish moist chambers and stored in 50 L plastic boxes with 200 ml sterile
water plus 2 ml glycerol. Samples were examined over four weeks for the presence of
conidiomata.
SPECIMEN EXAMINATION. Conidiomata were located with a dissecting microscope
and removed to a glass slide where they were crushed and mounted in polyvinyl alcohol-
glycerol (8.0 g in 100 ml of water, plus 5 ml of glycerol). Measurements were made of
fixed material. Permanent slides were deposited in HUEFS.
Taxonomy
Thozetella submersa ER. Barbosa & Gusmao, sp. nov. Fic. 1-5
MycoBank MB518831
Abomnibus speciebus Thozetellae differt microaristis unicellularibusellipsoidi-fusiformibus,
raro obovatis vel obclavatis, minute curvis, laevibus, utrinque interdum solo corniculatis
praeditis, hyalinis, 16-25um longis, 3-4 um latis at basi, 2-3 um latis at apicem.
Thozetella in Brazil ... 329
Fics. 1-5. Thozetella submersa (from the holotype). 1. Conidioma on the natural substrate.
2. General aspect of a conidioma without the conidial mass. 3. Conidiogenous cells.
4. Conidia. 5. Microawns. (Scale bars: 1 = 100 um; 2 = 50 um; 3-5 = 10 um).
330 ... Barbosa & al.
Hotorypus: Brazil. Bahia: Santa Terezinha, Serra da Jibdia, on submerged wood from
a stream, 25.III.2009, coll. FR Barbosa, HUEFS 141560.
EryMo.ocy: the Latin submersa refers to the submerged habitat.
CoNIDIOMATA sporodochial, superficial, sessile, 200-250 x 105-150 um, moist
and white mass. CONIDIOPHORES macronematous, compact at the base but
more or less free distally, septate, smooth, cylindrical, brown, paling toward
the apex, < 3 um diam. CoNIDIOGENOUS CELLS monophialidic, integrated,
determinate, terminal, cylindrical, light brown, 7.5-10 x 2.5-3 wm, lacking an
apical collarette. MICROAWNS not visible in mass on the natural substratum,
smooth, elliptic-fusiform, rarely obovoid to obclavate, slightly curved,
sometimes corniculate at the ends, hyaline, 16-25 um long, 3-4 um wide at
the base, 2-3 um wide at the apex. CoNIDIA aseptate, smooth-walled, finely
guttulate or eguttulate, lunate, hyaline, 14-15 x 2-2.5 um, provided with a
single filiform setula at each end, 5-7 um long.
Notes: Thozetella submersa can be easily diagnosed by the morphology and
smaller size of the microawns. A synopsis of microawns (Fic. 6) and a key to
the published species are included.
Thozetella boonjiensis B.C. Paulus, Gadek & K.D. Hyde, Mycologia 96: 1076. 2004.
CONIDIOMATA sporodochial. Microawns L-shaped, 0-septate, hyaline, 54-63
x 3-4.5 tum, apex acerose. CONIDIA 10.5-14.3 x 1.5-3 um. SETULAE 5.3-7.5
uum long.
EXAMINED MATERIAL: BRAZIL. Bauia: Santa Terezinha, Serra da Jibéia, on decaying
wood, 01.VIII.2008, coll. Fiuza P.O. (HUEFS 148834).
Notss: Thozetella boonjiensis resembles T. acerosa B.C. Paulus et al., T. gigantea,
and T! tocklaiensis in the L-shaped microawns, which are, however, septate in
T. acerosa. Both microawns and conidia are larger in T: gigantea and smaller
in T. tocklaiensis (Paulus et al. 2004, Piontelli & Giusiano 2004). Thozetella
boonjiensis was previously known only from the type locality (Australia)
(Paulus et al. 2004).
Thozetella gigantea B.C. Paulus, Gadek & K.D. Hyde, Mycologia 96: 1080. 2004.
CONIDIOMATA sporodochial; Microawns L-shaped, 0-septate, hyaline, 81-141 tm
long, 4.5-6 um wide at base. CONIDIA 13-15 x 1.5-2 um. SETULAE 7.5-9 um long.
EXAMINED MATERIAL: BRAZIL. Bauia: Santa Terezinha, Serra da Jibéia, on decaying
leaves, 02.VIII.2007, coll. Silva, $.S. CHUEFS141569).
Notss: T gigantea is characterized by its microawns, which are the largest for
the genus (Paulus et al. 2004). This species has been registered only from type
locality (Australia) (Paulus et al. 2004).
Thozetella in Brazil... 33.1
tL—
4 ed
Fic. 6. Microawns of Thozetella species. A. T. acerosa; B. T. boonjiensis; C. T. buxifolia;
D. T. canadensis; E. T. cristata; F. T. cubensis; G. T. effusa; H. T. falcata; |. T. gigantea; J. T: havanensis;
K. T. nivea; L. T. pinicola; M. T. queenslandica; N. T. radicata; O. T. submersa; P. T. tocklaiensis.
(Scale bars: A-P = 10 um).
332 ... Barbosa & al.
Key to Thozetella species
15.
15a.
Microawns predominantly L-shaped. .......... 0... cece cee eee eee nee 2
Microawns not L-shaped or variously shaped ............... 0.000 c eee eee ee 5
Microawns 0-2 septate. .... 0... cece eee eee T. acerosa
Microawns aseptate ..... 6660 e eee eee 3
Microawns 75 wm or longer ...... 0... eee eee een eee T. gigantea
Microawns shorter than 75 UM. ... 0... cece etn een e een e ee 4
Microawn apex undulating to geniculate ..........0. 0... cee eee eee T. nivea
Microawn apex straight to slightly undulating................... T. boonjiensis
Microawns predominantly sickle-shaped, uncinate, hamate or
otherwise strongly curved ..... 0... cece nee ene n eee nena 6
Microawns predominantly straight, sigmoid or of other shape............... 11
Conidiomata predominantly synnematous............ 0.0... c cece eee ee eee 7
Conidiomata predominantly sporodochial.............. 00.0.0 cece eee eee 10
Synnemata proliferating conidiophores form ridges....................00004 8
Synnemata non-proliferating ..... 0... cece cnet nen ee ene ee 9
Microawns 40-60 x 2.5-3 wm, smooth... 0.0... eee eee eee T. cristata
Microawns 25-30 x 3-3.5 fm, Verrucose.... 6... eee eee eee ee T. buxifolia
Microawns 40-95 x 2.5-5 ym, setulae 5-8 um long.................. T. falcata
Microawns 30-60 x 3-4.5 um, setulae 5 um long.................. T. radicata
Microawns 21-34 x 2-4 um, smooth or apically verrucose..... T. queenslandica
Microawns 40-100 um long, 2.5-4 um wide at base,
0.5-1 um wide at apex, smooth ...... 0... eee eee eee T. cubensis
Conidiomata effuse. 0... 0. ccc cece enn ene e es T. effusa
Conidiomata otherwise .....0 00... es 12
Conidiomata sporodochial 0.0.0.0... 0. cece enn en een ees 13
Conidiomata synnematous . 0.0.0.0... ccc eet e tenn n ees 15
Microawns Verrucose. 6... eee eee ee T. canadensis
Microawns smooths 5 t.°s Baz. ise sete Bogs igi AG eg tee ig. Se, Sls fg tela 14
Microawns elliptic-fusiform, 16-25 x 3-4 wide at the base,
2-3 um wide at the apex 0... cece eee ees T. submersa
Microawns straight or slightly undulating with the apical end acerose,
DEAD DS Ke2 DD) UMM, A a cce o> eg ontra at Nee rete tee een ky Mee ee es le T. pinicola
Microawns variously shaped, bulbous base, acerose apex, straight,
undulate, uncinate or bent,18-38 x 1.5-4 um 0.0.0... 0 eee T. tocklaiensis
Microawns with + uniform width, sigmoid, allantoid, uncinate,
DRARABD Ss WHS Dollies, Mas ved hs & sanghiegtatae Mega yage ts Bi Rees oe Ot ay Reaaepett T. havanensis
Thozetella in Brazil ... 333
Acknowledgements
We especially thank Dr E. Descals (Instituto Mediterraneo de Estudios Avanzados,
CSIC-Universitat de les Illes Balears, Spain) and Dr A.M. Arambarri (Instituto de
Botanica Spegazzini, Argentina) for their contribution to this paper. The authors thank
the CNPq (Conselho Nacional de Desenvolvimento Cientifico e Tecnoldgico) for
financial support and the “Programa de Pdés-graduacdo em Botanica — PPGBot/UEFS”.
Literature cited
Agnihothrudu V. 1958. Notes on fungi from North East India. I. A new genus of Tuberculariaceae.
Mycologia 50: 571-579. doi:10.2307/3756119
Agnihothrudu V. 1962. A comparison of some techniques for the isolation of fungi from tea soils.
Mycopathology 16: 234-242. doi:10.1007/BF02145735
Allegrucci N, Cazau MC, Cabello MN, Arambari AM. 2004. Thozetella buxifolia sp. nov. — a new
hyphomycete from Argentina. Mycotaxon 90(2): 275-279.
Barbosa FR, Gusmao LEP, Barbosa, FF. 2007. Thozetella species (Anamorphic Fungi-Hyphomycetes)
from semi-arid of Bahia State, Brazil. Sitientibus 7(2): 184-187.
Castafieda-Ruiz RE, Iturriaga T, Minter DW, Saikawa M, Vidal G, Velazquez-Noa S. 2003.
Microfungi from Venezuela. A new species of Brachydesmiella, a new combination and new
records. Mycotaxon 85: 211-229.
Castafieda Ruiz RF, Minter DW, Rodriguez Herndndez M. 2002. Venustosynnema ciliatum. IMI
Descriptions of Fungi and Bacteria. No. 1490. 3 pp.
Cruz ACR da & Gusmao LFP. 2009. Fungos conidiais na Caatinga: espécies lignicolas. Acta bot.
bras. 23(4): 1133-1144.
Delgado-Rodrigues G, Mena-Portales J. 2004. Hifomicetos Aero-acuaticos e Ingoldianos de la
reserve de la Biosfera Sierra del Rosario (Cuba). Bol. Soc. Micol. Madrid 28: 105-113.
Grandi RAP. 1999. Hifomicetos decompositores do folhedo de Euterpe edulis Mart. Hoehnea 26(1):
87-101.
Grandi RAP, Gusmao LFP. 2002. Hyphomycetes decompositores do folhedo de Tibouchina pulchra
Cogn. Rev. Brasil. Bot. 25(1): 79-87. doi:10.1590/S0100-84042002000100010
Jeewon R, Yeung SYQ, Hyde KD. 2009. A novel phylogenetic group within Thozetella
(Chaetosphaeriaceae): a new taxon based on morphology and DNA sequence analyses. Can. J.
Microbiol. 55(6): 680-687. doi:10.1139/W08- 148
Maia LC, Yano-Melo AM, Cavalcanti MA. 2002. Diversidade de fungos no Estado de Pernambuco.
Pp. 15-50, in: Tabarelli M, Silva JMC. Diagnéstico da diversidade de Pernambuco, v.1. Editora
Massangana, Recife.
Marques MFO, Barbosa FR, Gusmao LEP, Castafieda-Ruiz RF, Maia LC. 2007. Conidial fungi from
the semi-arid Caatinga biome of Brazil. Cubasina microspora sp. nov. a note on C. albofusca,
and some new records for South America. Mycotaxon 102: 17-23.
Morris EF. 1956. Tropical Fungi Imperfecti. Mycologia 48: 728-737. doi:10.2307/3755382
Nag Raj TR. 1976. Miscellaneous microfungi. I. Can. J. Bot. 54: 1370-1376. doi:10.1139/b76-149
Parungao MM, Fryar SC, Hyde KD. 2002. Diversity of fungi on rainforest litter in North Queensland,
Australia. Biodiversity and Conservation 11: 1185-1194. doi: 10.1023/A:1016089220042
Paulus BC, Gadek P, Hyde KD. 2004. Phylogenetic and morphological assessment of five new species
of Thozetella from an Australian rainforest. Mycologia 96(5): 1074-1087. doi:10.2307/3762090
Piontelli E, Giusiano G. 2004. Notas micoldégicas VIII: acerca de Thozetella tocklaiensis en aciculas
senescentes de Pino (Misiones, Argentina). Boletin Micologico 19: 117-124.
334 ... Barbosa & al.
Waipara NW, Di Menna ME, Cole AL], Skipp RA. 1996. Characterisation of Thozetella tocklaiensis
isolated from the roots of three grass species in Waikato pastures. New Zealand. J. Bot. 34:
517-522. doi:0028-825X/96/3404-0517
Silva P da, Grandi, RAP. 2008. Hyphomycetes sobre o folhedo de Caesalpinia echinata Lam. com
duas novas citagdes para o Brasil. Hoehnea 35(4): 477-488.
Sivichai S, Jones EBG, Hywel-Jones N. 2002. Fungal colonization of wood in a freshwater stream at
Tad Ta Phu, Khao Yai National Park, Thailand. Fungal Diversity 10: 113-129.
Sutton BC, Cole GT. 1983. Thozetella (Hyphomycetes): an exercise in diversity. Trans. Br. mycol.
Soc. 81(1): 97-107. doi:10.1016/S0007-1536(83)80209-5
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 335-344 January-March 2011
DOT: 10.5248/115.335
Chrysothrix flavovirens, Lepraria elobata, and Ochrolechia arborea
new to Portugal
SANDRINA AZEVEDO RODRIGUES, TOR T@NSBERG?,
ARSENIO TERRON-ALFONSO? & AMADEU M. V. M. SOARES?
'CESAM ¢& Departamento de Biologia, Universidade de Aveiro, Campus Universitario de
Santiago, 3810-193 Aveiro, Portugal
? Museum of Natural History, University of Bergen, Allégaten 41, P. O. Box 7800,
N-5020 Bergen, Norway
[Departamento de Biodiversidad y Gestion Ambiental, Area Botanica, Facultad de Biologia y
Ciencias Ambientales, Universidad de Leon, Campus Vegazana S/N, 24071, Léon, Spain
*CORRESPONDENCE TO:
[email protected]
Asstract — Chrysothrix flavovirens, Lepraria elobata, and Ochrolechia arborea are reported
as new to Portugal, based on surveys carried out in pine forests along the Portuguese coast.
Data on the distribution, secondary products and ecology of the species are presented.
Key worps — lichens, epiphytic, sand dunes
Introduction
The epiphytic lichen flora of pine forests in coastal areas in Portugal is
poorly studied and is in need of a thorough survey. Pine forests are a common
biotope along the Portuguese coast and many of them are classified as Natural
Parks or Nature Reserves (Fic. 1A&B: 3, 8, 18-19, 21-22, 24), while others are
national forests or forest perimeters that are owned and/or partially managed
by the Portuguese State (Fic. laws: 1, 7, 9-18, 20, 24). Moreover, many of
them are currently classified as Natura 2000 sites (ICN 2006) by the European
Commission (Fic. 1A&B: 1-3, 8, 10, 12, 18-19, 21-22, 24). The only known
inventory of epiphytic lichen species in pine forests on sand dunes was generated
by Catarino et al. (1985) in the framework of biomonitoring studies.
In the course of our investigations on the epiphytic lichens of these areas —
particularly the well-preserved Dunas de Quiaios (Figueira da Foz) (Fic. 1A&B:
12) — new epiphytic lichen records were reported for the Iberian Peninsula
(Rodrigues et al. 2007) and a new Lecanora species has been published
(Rodrigues et al. 2011). These discoveries point to the importance of coastal
336 ... Rodrigues & al.
pine forests as habitats for lichens, which is an extra incentive to ensure their
future preservation. At Dunas de Quiaios, the tree vegetation, rich in epiphytic
lichens, is a planted Pinus pinaster forest mixed with P. pinea, Acacia longifolia,
A. melanoxylon, and Eucalyptus globulus. Arbutus unedo and Myrica faya are
also appropriate supports for lichens (Almeida 1997, Danielsen 2008, Rodrigues
et al. 2007, 2011).
Theaim of this work is to report three crustose and sorediate epiphytic lichens
growing on P pinaster and P. pinea, new to Portugal: Chrysothrix flavovirens,
Lepraria elobata and Ochrolechia arborea. Data on their distribution along the
Portuguese coast, secondary products, and ecology are also provided.
Materials & methods
Unless otherwise stated, all specimens were collected by the first author (SAR) on
P. pinaster trunks in pine forests on sand dunes along the Portuguese coast (Fic. la&s,
see also EXAMINED SPECIMENS). Samples were deposited in AVE, BG, and LEB herbaria.
Distribution maps are based on UTM grid projection and coordinates of the locations
are given in MGRS. Maps [a] and [B] represent the distribution along the Portuguese
coast of C. flavovirens, and O. arborea respectively. The location where L. elobata was
found [12] appears on both maps. Visited locations (indicated by numbers on each map)
were geo-referenced using GoogleEarth and maps were plotted using ArcGis version
OF,
Samples were analysed morphologically and chemically, with standard identification
methods for lichenized fungi (Nash et al. 2001, Smith et al. 2009) and compared to
authentic material deposited in BG herbarium. Morphology of the thallus was examined
with a Leica MS5 stereomicroscope and anatomical observations of hand cut sections of
apothecia were performed under a Leitz HM-LUX 3 microscope. For that, sections were
mounted in distilled water and K/I and the latter was used for measuring anatomical
characters. Chemical analyses followed standardized TLC methods (White & James
1985; Orange et al. 2001). Data regarding companion species were retrieved at Dunas
de Quiaios (Fic. 1aA&B: 12) during a small biomonitoring campaign, using the method
proposed by Asta et al. (2002), in which 9 sampling units with 10 or 12 trees each were
studied. Only C. flavovirens was detected using this method, and therefore it is the
only species for which such data are provided. Only species present in each 10 x 10 cm
quadrate where C. flavovirens was detected were considered as companion species.
The species
Chrysothrix flavovirens Tonsberg Fic. 1A
This common species is characterized by a vivid yellowish-green and
leprose thallus, which is neither stratified nor lobed. The soralia are discrete
to contiguous, forming an areolate or, more often, a thin to thick, continuous
thallus. In our material, diffractaic and rhizocarpic acids and + unidentified
substances were detected. Fertile material was found at Mata do Camarido
(Caminha) (Fic. 1a: 1). Fertile specimens had scattered and sessile apothecia,
Chrysothrix, Lepraria, & Ochrolechia spp. new to Portugal ... 337
0 25 50 100 Km
Lop
Source: IGEO 2009
Fic. 1. Distribution of Chrysothrix flavovirens [a] and Ochrolechia arborea [B] along the
Portuguese coast; Lepraria elobata [12] appears in both [a] and [B]. Dot numbers correspond to
the localities shown in square brackets within the SPECIMENS EXAMINED sections. Asterisks flag
locations where the species were found on both Pinus pinaster and P. pinea.
which were 0.3-0.6 mm in diam. (n = 30), yellowish brown in colour, mostly
rounded, convex and immarginate, but sometimes surrounded by soredia as
also reported by Laundon (1981). Sections of the apothecia reacted K+ violet in
the centre and intensified yellow at the border of the section. The epihymenium,
hymenium, and hypothecium were constituted by anastomosing paraphysis,
and reacted K/I+ blue. The epihymenium was 2.5-12.5 «zm (n = 15) high, the
hymenium 38-83.5 tm (n = 8) and the hypothecium 1485-265 (n = 8). Asci
were clavate, sometimes slightly curved, 23-40.5 x 8.5-14 um (n = 14). Spores
338 ... Rodrigues & al.
were narrowly ellipsoid, some slightly curved, mostly 3-septate, 9.5-12.5 x
2-4 um (n = 21), although some were found 2-septate and 1-septate, but of
smaller sizes. Detailed descriptions can be found in Laundon (1981), Smith et
al. (2009), and Tansberg (1992).
HABITAT AND DisTRIBUTION — Chrysothrix flavovirens may form large
patches extending over a large part of the pine trunk or appear as small patches
associated with other species. At Dunas de Quiaios (Fic. 1a: 12) it was found
together mostly with C. candelaris (L.) J.R. Laundon, Hypogymnia physodes (L.)
Nyl., and Pyrrhospora quernea (Dicks.) Kérb. but also with Usnea rubicunda
Stirt., U. subscabrosa Nyl. ex Motika, and Flavoparmelia caperata (L.) Hale,
Lecanora strobilina (Spreng.) Kieff., Parmotrema reticulatum (Taylor) M.
Choisy and Trentepohlia sp.
This species was frequently found in well-preserved to open coastal pine
forests on sand dunes and also in localities with scanty pines, growing on
P. pinaster and in some sites also on P pinea (Fic. 1A, see also EXAMINED
SPECIMENS). It was also collected in mountains near the coast at Serra da Boa
Viagem (Figueira da Foz) (Fic. 1a: 13) and Serra de Sintra (Sintra) (Fic. 1a: 18).
Elevations observed ranged from about 2 m at Dunas de Ofir/Fao (Esposende)
(Fic. 1A: 3) to about 260 m at Serra de Sintra. Although C. flavovirens is
widespread throughout the Atlantic and Mediterranean biogeographic
regions of Portugal (ICN 2006), it was not found in surveys at a coastal pine
forest in south-eastern Portugal, Dunas de Vila Real de Santo Anténio (Vila
Real de Santo Antdénio). This species, which is frequent and of which reports
are increasing, is regarded as a preferentially coastal species of acidic bark
(Laundon 1981 [as sorediate thalli of C. chrysophthalma (P. James) P. James &
J.R. Laundon], Kowalewska & Jando 2004, Tonsberg 1992 [as sorediate thalli of
C. chrysophthalma], Smith et al. 2009).
Chrysothrix flavovirens is widely distributed in Europe (Aptroot et al. 2003;
Kowalewska & Jando 2004; Laundon 1981; Llimona & Hadlun 2001; Nimis &
Martellos 2008; Smith et al. 2009; Sachting & Alstrup 2008; Sparrius et al. 2002;
Suija et al. 2009; Tonsberg 1992, 1994) and is also known from North America
(Richardson et al. 2009) and Asia (Kowalewska & Jando 2004). A very similar
species recently described from eastern North America, C. chamaecyparicola
Lendemer, is similar to C. flavovirens except that it lacks diffractaic acid
(Lendemer & Elix 2010).
SPECIMENS EXAMINED (square bracketed numbers refer to localities indicated in Fic.
1a): PORTUGAL. Mrinuo: [1] Caminha. MoLepo, Mata NACIONAL DO CAMARIDO,
29TNG1133, 14 m, 22.3.2009, AVE-L 337, LEB-Lichenes 7810. [2] Viana do Castelo.
CuaFE, PRAIA DA AMOROSA, 29TNGI1510, 17 m, 5.9.2009, AVE-L 380, LEB-Lichenes
7811. [3] Esposende. FAo, Dunas DE OFtR/FAO (PARQUE NATURAL DO LITORAL
Norte), 29TNF1894, 2 m, 15.5.2009, AVE-L 358. Douro LIToRAL: [4] Vila do Conde.
MINDELO, RESERVA ORNITOLOGICA DO MINDELO, 29TNF2275, 24 m, 25.6.2009, AVE-
L 376, LEB-Lichenes 7812; id., on trunk of Pinus pinea AVE-L 364. [5] Matosinhos.
Chrysothrix, Lepraria, & Ochrolechia spp. new to Portugal ... 339
ANGEIRAS, PARQUE DE CAMPISMO DE ANGEIRAS — ina small pine stand on sand dunes
used for camping, 29TNF2368, 23 m, 15.5.2009, AVE-L 366. [6] Vila Nova de Gaia.
VALADARES — in an area with scanty pines, 29TNF2949, 24 m, 15.5.2009, AVE-L 359.
Berra Lirorat: [7] Ovar. CorTEGAGA, DUNAS DE Ovar, 29TNF2932, 8 m, 25.6.2009,
AVE-L 375, LEB-Lichenes 7813. [8] Aveiro. S. JACINTO, DUNAS DE S. JACINTO (RESERVA
NATURAL DAS DuNAS DE S. JACINTO), 29TNF2302, 2 m, 23.4.2009, AVE-L 349, LEB-
Lichenes 7814. [9] flhavo. GAEANHA DO CARMO, Dunas DA GAFANHA, 29TNE2394,
13 m, 9.9.2009, AVE-L 377, LEB-Lichenes 7815. [10] Vagos. GAEANHA DO AREAO,
DuNAS DE VAGos, 29TNE2185, 21 m, 23.3.2009, AVE-L 340. [11] Mira. Serxo, Dunas
DE Mira, 29TNE2280, 24 m, 26.3.2009, AVE-L 341, LEB-Lichenes 7816. Figueira da
Foz. [12] Quraios, DUNAS DE QUIAIOS, 29TNE1654, 49 m, 4.9.2007, AVE-L 383; id.,
29TNE1554, 49 m, 11.1.2007, BG-L 88214, LEB-Lichenes 7817; id., epiphytic on trunk
of PB pinea, 29TNE1353, 45 m, 26.6.2009, AVE-L 373. [13] SeRRA DA Boa VIAGEM,
Marta DO PRAZO DE SANTA MARINHA/SERRA DA Boa VIAGEM — ina pine forest ina
mountainous area, 29TNE1149, 205 m, 26.6.2009, AVE-L 371; id., epiphytic on trunk of
P. pinea, 29TNE1149, 200 m, 26.6.2009, AVE-L 372. [14] Costa DE Lavos, DuNas DA
Lerrosa, 29TNE1137, 21 m, 25.4.2009, AVE-L 356, LEB-Lichenes 7818; id., epiphytic
on trunk of P. pinea, 29TNE1037, 16 m, 25.4.2009, AVE-L 354, LEB-Lichenes 7819. [15]
Lerrosa, Mata Do Urso, 29TNE1132, 28 m, 25.4.2009, AVE-L 352, LEB-Lichenes 7820.
[16] Leiria. PEDROGAo, MATA DO PEDROGAO, 29SNE0416, 24 m, 25.4.2009, AVE-L 344,
LEB-Lichenes 7821. ESTREMADURA: [17] Marinha Grande. S. PEDRO DE MUEL, Mata
DE LEIRIA, 29SNE0004, 49 m, 25.4.2009, AVE-L 351. [18] Sintra. SERRA DE SINTRA,
ULGUEIRA, PER{METRO FLORESTAL DA SERRA DE SINTRA (PARQUE NATURAL DE SINTRA
CascalIs) — in a pine forest in a mountainous area 29SMC5993, 260 m, 27.4.2009,
AVE-L 347. BAIxo ALENTEJO: [19] Alcdcer do Sal. Comporta, PRAIA DA COMPORTA,
29SNC1748, 24 m, 1.6.2009, AVE-L 367. [20] Santiago do Cacém. Retvas Verpes, AREA
FLORESTAL DE SINES, 29SNC2106, 75 m, 3.4.2009, AVE-L 336. ALGARVE: [21] Aljezur.
ROGIL, PRAIA DE VALE DOS HOMENS (PARQUE NATURAL DO SUDOESTE ALENTEJANO
E CosTA VICENTINA), 29SNB1537, 49 m, 30.5.2009, AVE-L 370. [22] Vila do Bispo.
SAGRES, PINHAL DE VALE SANTO (PARQUE NATURAL DO SUDOESTE ALENTEJANO E
Costa VICENTINA) — epiphytic on branch of P. pinaster, 29SNB0300, 74 m, 31.5.2009
AVE-L 369.
Remarks — Recently separated as the sorediate counterpart of C. chrysoph-
thalma (Smith et al. 2009, Tonsberg 1994), C. flavovirens may be confused with
C. candelaris, which also occurs on pine trees in the study areas, but developing
a more yellowish thallus with calycin (Elix & Kantvilas 2007, Laundon 1981).
The chemical constitution of C. flavovirens (Elix & Tensberg 2004, Laundon
1981, Tonsberg 1992) is variable, as Elix & Kantvilas (2007) refer to the presence
of barbatic and conrhizocarpic acids, as well as epanorin, and the absence of
atranorin in samples from the United Kingdom and Sweden.
Lepraria elobata Tonsberg
This species develops a diffuse, leprose, predominantly non-lobed and non-
stratified, bluish-grey thallus, without medulla and with profuse more or less
continuous fine soredia (Saag et al. 2009, Tonsberg 1992). Our sterile material
of L. elobata contained atranorin, zeorin and stictic acid with satellites. Detailed
descriptions are provided by Saag et al. (2009), Smith et al. (2009) and Tansberg
(1992).
340 ... Rodrigues & al.
HABITAT AND DIsTRIBUTION: Only one specimen of L. elobata was found
epiphytic on P. pinaster bark at Dunas de Quiaios (Fic. 1AxB: 12), at an
altitude of about 49 m, where it appears to be uncommon. This species occurs
preferentiality on bark but is also known to grow on soil and siliceous rocks in
shady and wet locations (Kukwa 2006). Regarding bark preferences, L. elobata
seems to prefer deciduous to conifer trees (Saag 2007) and should be expected
to occur in other habitats in Portugal.
Lepraria elobata is known from several European countries (Bayerova
& Kukwa 2004, Boom et al. 1996, Coppins 2002, Czyzewska & Kukwa 2005,
Diederich et al. 2009, Ekman & Tonsberg 2002, Feuerer 2009, LukoSiené
& Naujalis 2009, Nimis & Martellos 2008, Osyczka & Stolarczyk 2005, Paz-
Bermudez et al. 2000, Priigger 2000, Tonsberg 1992) and North America (Saag
et al. 2009, Tonsberg 2004).
SPECIMEN EXAMINED - PORTUGAL. Berra Lirorat: [Fic. 1A&s: 12] Figueira da Foz.
Qutaios, DuNAS DE QUIAIOS, 29TNE1554, 49 m, 11.1.2007, AVE-L 390, BG-L 88184.
Remarks — Lepraria nylanderiana Kiummerl. & Leuckert is the most frequent
Lepraria species at Dunas de Quiaios and is thought to be widespread in pine
forests on sand dunes in the central west coast of Portugal. Both L. elobata
and L. nylanderiana have a leprose, bluish-grey thallus, but L. nylanderiana
has a delimited margin where minute lobes may appear in well-developed
specimens. Also, L. nylanderiana usually has a whitish medulla, medium to
coarse soredia, and thamnolic and roccellic acids and atranorin (Smith et al.
2009). Lepraria elobata is morphologically similar to L. caesiella R.C. Harris
and L. incana (L.) Ach., which are differentiated chemically by the content in
atranorin and zeorin, and divaricatic acid and zeorin, respectively (see Saag et
al. 2009). Neither species has been found so far epiphytic on pine at Dunas de
Quiaios.
Ochrolechia arborea (Kreyer) Almb. Fic. 1B
This species is characterized by a whitish grey, sorediate and thin thallus,
which may be tuberculate in the centre. The soralia are mostly discrete and may
be delimited and orbicular or more or less diffuse, rarely being confluent, but not
covering the whole thallus (Boqueras et al. 1999, Tonsberg 1992). Our material
was sterile and contained gyrophoric and lecanoric acids, lichexanthone (UV+
orange), and + atranorin (Tonsberg 1992).
HABITAT AND DISTRIBUTION — Ochrolechia arborea was found in localities
along the western coast from Minho to Estremadura provinces (Fic. 1B, see
also EXAMINED SPECIMENS) in Portugal’s Atlantic and Mediterranean regions
(ICN 2006). It was also found in mountainous locations at Serra da Boa Viagem
(Figueira da Foz) (Fic. 1p, 13) and Serra de Sintra (Cascais) (Fic. 1p: 24),
Chrysothrix, Lepraria, & Ochrolechia spp. new to Portugal ... 341
having been recorded at altitudes up to 205 m at Serra da Boa Viagem. Most
specimens were found on P pinaster, but some were also found on P. pinea.
Contrary to C. flavovirens, O. arborea is not restricted to maritime habitats
and has been reported from inland countries such as Switzerland (Diederich
& Sheidegger 1996) and Mongolia (Hauck & Javkhlan 2006). It is expected
to occur in inland Portugal on a wide variety of phorophytes as reported in
the literature (Boqueras et al. 1999, Christensen & Svane 2007, Kukwa 2009,
Tonsberg 1992). The species has been noted as typical of shady habitats or soft
barks johansson et al. 2007).
Ochrolechia arborea is currently known from several European countries
(Andrianova et al. 2006, Boqueras et al. 1999, Brodo 1991, Christensen &
Svane 2007, Coppins 2002, Diederich et al. 2009, Dietrich & Scheidegger 1996,
Farkas et al. 2009, Feuerer 2009, Jablonska & Kukwa 2007, Kukwa 2009, Ligka
et al. 2008, Nimis & Martellos 2008, Priigger 2000, Roux et al. 2008, Sechting
& Alstrup 2008, Tibell 1992, Tonsberg 1992). It is also known from North and
South America (Brodo 1991) and Asia (Hauck & Javkhlan 2006, John & Nimis
1998, Koneva 2007).
SPECIMENS EXAMINED (square bracketed numbers refer to localities indicated in Fic.
1s): PORTUGAL. Minuo: [1] Caminha. MoLEDo, Mata NACIONAL DO CAMARIDO,
29TNG1133, 15 m, 17.5.2009, AVE-L 320, LEB-Lichenes 7822. [2] Viana do Castelo.
CHAFE, PRAIA DA AMOROSA, 29TNG1510, 20 m, 17.5.2009 AVE-L 323, LEB-Lichenes
7823. BEIRA LITORAL: [23] Ovar. FURADOURO, 29TNF2823, 9 m, 23.3.2009 AVE-L 310.
[11] Mira. Serxo, DuNAs DE Mira, 29TNE2280, 24 m, 26.3.2009, LEB-Lichenes 7824;
id., on a branch of Pinus pinaster, 29TNE2280, 24 m, 26.3.2009, AVE-L 312. Figueira da
Foz. [12] Quiaios, Dunas DE Quiatos, ona branch of P. pinaster, 29TNE1353, 42 m,
14.4.2006, AVE-L 389; id., epiphytic on trunk of P. pinea, 29TNE1758, 49 m, 26.6.2009,
AVE-L 326, LEB-Lichenes 7825. [13] SERRA DA Boa VIAGEM/ MaTA DO PRAZO DE
SANTA MARINHA/SERRA DA BoA VIAGEM — in a pine forest in a mountainous area,
29TNE1149, 205 m, 26.6.2009, AVE-L 328; id., on trunk of P. pinea, 29TNE1149, 200
m, 26.6.2009, AVE-L 324. [16] Leiria. PEDROGAO, MATA DO PEDROGAO —on a branch
of PB. pinaster, 29SNE0416, 24 m, 25.4.2009, AVE-L 315. ESTREMADURA: [24] Cascais.
SERRA DE SINTRA, PENHA LONGA, PER{METRO FLORESTAL DA PENHA LONGA (PARQUE
NATURAL DE SINTRA CascalIs) — ina pine forest in a mountainous area, on a branch of
P. pinaster, 29SMC6490, 149 m, 27.4.2009, AVE-L 317.
Remarks — In our study area, O. arborea specimens growing on branches
frequently developed roundish and delimited soralia, while those on trunks
often generated confluent soralia. Orsellinic acid, detected in Spanish specimens
(Boqueras etal. 1999), was not found in our material. Ochrolechia microstictoides
Rasanen is another very common species in pine forests on sand dune areas in
the centre of Portugal. This species, which has confluent soralia towards the
centre of the thallus that give it a leprose appearance, contains variolaric and
lichesterinic acids (Tonsberg 1992).
342 ... Rodrigues & al.
Acknowledgments
SAR thanks the staff of the Natural Parks of Litoral-Norte, Sintra-Cascais, and
Sudoeste Alentejano e Costa Vicentina; the Nature Reserves of S. Jacinto and Estudrio
do Sado for permission to collect the lichens and also for valuable information on the
location of pine areas. Isabel Mata of the National Forest Authority is specially thanked
for a guided visit in Serra de Sintra. Carla Quintaneiro, Salomé Menezes (Universidade
de Aveiro, Portugal) and Rui Costa are thanked for helping in some of the field trips.
Ana B. Fernandez-Salegui (Universidad de Leén, Spain) is thanked for her assistance
in the course of this study. José Vingada (Universidade do Minho, Portugal) is thanked
for reviewing the manuscript. The peer-reviewers Palmira Carvalho (Universidade de
Lisboa, Portugal) and Victor Rico (Universidad Complutense, Spain) are gratefully
acknowledged for reviewing and improving the manuscript. The first author was
supported by Fundacao para a Ciéncia e Tecnologia (SFRH/BD/18541/2004). Part of
this work was supported by FCT Project Grant reference PTDC/AMB/76006/2006.
Literature cited
Almeida AC. 1997. Dunas de Quiaios, Gandara e Serra da Boa Viagem: uma abordagem ecolégica
da paisagem. Lisboa, Fundacéo Calouste Gulbenkian - Junta Nacional de Investigacao
Cientifica e Tecnolégica.
Andrianova TV, Dudka IO, Hayova VP, Heluta VP, Isikov VP, Kondratiuk SYa, Krivomaz TI, Kuzub
VV, Minter DW, Minter TJ, Prydiuk MP, Tykhonenko YuYa. 2006. Fungi of Ukraine [http://
www.cybertruffle.org.uk/ukrafung/eng (viewed online on 6 January 2010)].
Aptroot A, Herk CM van, Sparrius LB, Spier JL. 2003. New lichens and lichenicolous fungi from the
Netherlands, with additions to the checklist. Buxbaumiella 63: 32-37.
Asta J, Erhardt W, Ferreti M, Fornasier F, Kirshbaum U, Nimis PL, Purvis OW, Pirintsos S,
Scheidegger C, Haluwyn C van, Wirth V. 2002. Mapping lichen diversity as an indicator
of environmental quality. 273-279, in PL Nimis et al. (eds.), Monitoring with lichens —
Monitoring lichens. Nato Science Series. IV. Earth and Environmental Sciences. Dordrecht,
Kluwer Academic Publishers.
Bayerova $, Kukwa M. 2004. New records of leprarioid lichens in the Czech Republic. Biologia,
Bratislava 59(1): 19-23.
Boom P van den, Diederich P, Sérusiaux E. 1996. Lichens et champignons lichénicoles nouveaux ou
intéressants pour la flore de la Belgique et des régions voisines. VII. Bulletin de la Société des
naturalistes luxembourgeois 97: 81-92.
Boqueras M, Barbero M, Llimona X. 1999. The genus Ochrolechia A. Massal. (Pertusariaceae,
lichens) in Spain and Portugal. Cryptogamie Mycologie 20(4): 303-328. doi:10.1016/S0181-
1584(00)88858-2
Brodo IM. 1991. Studies in the lichen genus Ochrolechia. 2. Corticolous species of North America.
Canadian Journal of Botany 69(4): 733-772. doi:10.1139/b91-099
Catarino F, Sérgio C, Jones MP. 1985. Contribuic¢4o para o estudo da avaliacao do impacte ambiental
da nova central a carvao da EDP na Costa de Lavos. Relatério — 1° ano. Museu Laboratério e
Jardim Botanico — Faculdade de Ciéncias de Lisboa. Lisboa.
Christensen S, Svane S. 2007. Contribution to the knowledge of the lichen flora of Crete (Kriti),
Greece. Willdenowia 37: 587-593. doi:10.3372/wi.37.37218
Coppins BJ. 2002. Checklist of lichens of Great Britain and Ireland. London, British Lichen Society.
[http://www.thebls.org.uk/content/checklist.html (viewed on line on 12 January 2010)].
Czyzewska K, Kukwa M. 2005. Notes on two species of Lepraria from Belarus. Graphis Scripta 17:
20-21.
Chrysothrix, Lepraria, & Ochrolechia spp. new to Portugal ... 343
Danielsen R. 2008. Palaeoecolgical development of the Quiaios-Mira dunes, northern-
central littoral Portugal. Review of Palaeobotany and Palynology 152: 74-99. doi:10.1016/
j.revpalbo.2008.04.005
Diederich P, Ertz D, Stapper N, Sérusiaux E, Broeck D Van den, Boom P van den, Ries C. 2009. The
lichens and lichenicolous fungi of Belgium, Luxembourg and northern France [http://www.
lichenology.info (viewed online on 6 January 2010)].
Dietrich M, Scheidegger C. 1996. The importance of sorediate crustose lichens in the epiphytic
lichen flora of the Swiss plateau and the pre-alps. Lichenologist 28(3): 245-256. doi:10.1017/
$002428299600031X
Ekman S, Tensberg T. 2002. Most species of Lepraria and Leproloma form a monophyletic group
closely related to Stereocaulon. Mycological Research 106(11): 1262-1276. doi:10.1017/
$09537562020067 18
Elix JA, Kantvilas G. 2007. The genus Chrysothrix in Australia. Lichenologist 39(4): 361-369.
doi: 10.1017/S0024282907006998
Elix JA, Tonsberg T. 2004. Notes on the chemistry of some lichens, including four species of
Lepraria. Graphis Scripta 16: 43-45.
Farkas E, Lékés L, Molnar K. 2009. Ochrolechia arborea (lichen-forming fungi) in Hungary.
Mikoldogiai Kozlemények, Clusiana 48(1): 19-24.
Feuerer TE. 2009. Checklists of lichens and lichenicolous fungi [http://www.checklists.de (viewed
on line 16 December 2009)].
Hauck M, Javkhlan S. 2006. Additions to the lichen flora of Mongolia: records from Khentey and
Khangay. Willdenowia 36: 895-912. doi:10.3372/wi.36.36221
ICN. 2006. Plano sectorial da Rede Natura 2000. Lisboa, Instituto da Conservagao da Natureza e
Biodiversidade [http://www.icn.pt/psrn2000/conteudo_plano.htm (viewed on line 5 January
2010)].
IGEO. 2008. Carta administrativa oficial de Portugal (CAOP v. 6.0). Lisboa, Instituto Geografico
Portugués [downloaded from http://www.igeo.pt/produtos/cadastro/caop/ versao6.htm].
Jabtoniska A, Kukwa M. 2007. The lichen genus Ochrolechia in Poland I. O. androgyna s. lat. and
O. arborea. Herzogia 20: 13-27.
Johansson P, Rydin H, Thor G. 2007. Tree age relationships with epiphytic lichen diversity and
lichen life history traits on ash in southern Sweden. Ecoscience 14(1): 81-91. doi:10.2980/1195-
6860(2007) 14[81:TARWEL]2.0.CO;2
John V, Nimis PL. 1998. Lichen flora of Amanos Mountain and the Province of Hatay. Turkish
Journal of Botany 22: 257-267.
Koneva VV. 2007. Lichen flora of the territory between the Ob and the Chulym. Siberian Journal
of Ecology 3: 409-415.
Kowalewska A, Jando K. 2004. Chrysothrix flavovirens in Poland. Graphis Scripta 15: 51-52.
Kukwa M. 2006. The lichen genus Lepraria in Poland. Lichenologist 38(4): 293-305. doi:10.1017/
$0024282906005962
Kukwa M. 2009. The lichen genus Ochrolechia in the Baltic countries. Folia Cryptogamica Estonica
A6: 67-74.
Laundon JR. 1981. The species of Chrysothrix. Lichenologist 13(2): 101-121. doi:10.1017/
$002428298 1000169
Lendemer JC, Elix JA. 2010. Two new species of Chrysothrix from eastern North America. Opuscula
Philolichenum 8: 51-58.
LiSka J, Palice Z, Slavikova $. 2008. Checklist and Red List of lichens of the Czech Republic. Preslia
80: 151-182.
Llimona X, Hladun N. 2001. Checklist of the lichens and lichenicolous fungi of the Iberian
Peninsula and Balearic Islands. Bocconea 14: 5-581.
344 ... Rodrigues & al.
LukoSiené I, Naujalis J. 2009. Rare lichen associations on common oak (Quercus robur) in Lithuania.
Biologia 64(1): 48-52. doi:10.2478/s11756-009-0004-z
Nash III TH, Ryan BD, Gries C, Bungartz F. (eds.) 2001. Lichen flora of the Greater Sonoran Desert
region 1. Tempe, Lichens Unlimited, Arizona State University.
Nimis PL, Martellos S. 2008. ITALIC - The information system on Italian lichens [http://dbiodbs.
univ.trieste.it/ (viewed on line on 6 January 2010)].
Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.
London, British Lichen Society.
Osyczka P, Stolarczyk P. 2005. Lichens of the genus Lepraria in the Jas. Fragmenta Floristica et
Geobotanica Polonica 12(2): 371-383.
Paz-Bermudez G, Lépez de Silanes ME, Carballal R. 2000. Liquenes saxicolas y terricolas y hongos
liquenicolas interesantes de la costa de Galicia (NW Espafia). Candollea 55: 137-152.
Prigger J. 2000. Lichen biodiversity in Slovenia. Graz, University of Graz [http://members.chello.
at/johannes.pruegger/uni/slovenia/index.html (viewed on line 6 January 2010)].
Richardson DHS, Lucas Z, Anderson F. 2009. The lichen flora of Sable Island, Nova Scotia: its past,
present and likely future status. Bryologist 112(3): 558-571. doi:10.1639/0007-2745-112.3.558
Rodrigues SA, Elix JA, Vingada JV, Terrén Alfonso A, Soares AMVM. 2007. The first records
of Hypotrachyna lividescens and H. pseudosinuosa in the Iberian Peninsula. Cryptogamie
Mycologie 28(2): 155-157.
Rodrigues SA, Terrén-Alfonso A, Elix JA, Peréz-Ortega S, Tonsberg T, Fernandez-Salegui AB,
Soares AMVM. 2011. Lecanora sorediomarginata, a new epiphytic lichen species discovered
along the Portuguese coast. Lichenologist 43(2): 99-111. doi:10.1017/S002428291000071X
Roux C, Coste C, Bricaud O, Bauvet C, Masson D. 2008. Lichens et champignons lichénicoles du
parc national des Cévennes (France) 5 — Vue demsemble et conclusion. Bulletin de la Société
Linnéene de Provence 59: 243-279.
Saag L. 2007. The substrate preferences of epiphytic Lepraria species in old-growth forests in
Estonia. Folia Cryptogamica Estonica 43: 51-56.
Saag L, Saag A, Randlane T. 2009. World survey of the genus Lepraria (Stereocaulaceae, lichenized
Ascomycota). Lichenologist 41(1): 25-60. doi:10.1017/S0024282909007993
Smith CW, Aptroot A, Coppins BJ, Flechter A, Gilbert OL, James PW, Wolseley PA. 2009. The
lichens of Great Britain and Ireland. London, British Lichen Society, Department of Botany,
The Natural History Museum.
Sechting U, Alstrup V. 2008. Danish lichen checklist. Version 2. Copenhagen, Faculty of Science,
University of Copenhagen. [downloaded from http://www.bi.ku.dk/lichens/dkchecklist/
default.asp].
Sparrius LB, Diederich P, Signoret J, Sérusiaux E. 2002. The lichen flora of the Boulonnais (France,
Pas-de-Calais). Belgian Journal of Botany 135(1-2): 50-75.
Suija A, Czarnota P, Himelbrant D, Jiiriado I, Kukwa M, Lohmus P, Motiejimaité J. 2009. New
Estonian records: lichenized and lichenicolous fungi. Folia Cryptogamica Estonica 46: 83-89.
Tibell L. 1992. Crustose lichens as indicators of forest continuity in boreal coniferous forests.
Nordic Journal of Botany 12(4): 427-450. doi:10.1111/j.1756-1051.1992.tb01325.x
Tonsberg T. 1992. The sorediate and isidiate, corticolous, crustose lichens in Norway. Oslo, Natural
History Museum, University of Oslo.
Tonsberg T. 1994. Chrysothrix flavovirens sp. nov. — the sorediate counterpart of C. chrysophthalma.
Graphis Scripta 6: 31-33
Tonsberg T. 2004. Lepraria. 322-329, in TH Nash Het al. (eds), Lichen flora of the Greater Sonoran
Desert region. Volume II. Tempe, Arizona.
White FJ, James PW. 1985. A new guide to microchemical techniques for the identification of lichen
substances. British Lichen Society Bulletin 57 (supplement).
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 345-351 January-March 2011
DOT: 10.5248/115.345
Lichenological notes 2: Lichenothelia convexa,
a poorly known rock-inhabiting and lichenicolous fungus
JANA KocouRKOVA! & KERRY KNUDSEN?
‘Department of Ecology, Faculty of Environmental Sciences, Czech University of Life Sciences,
Prague, Kamyckd 129, Praha 6 - Suchdol, CZ-165 21, Czech Republic
*Herbarium, Department of Botany and Plant Sciences, University of California,
Riverside CA, 9252-0124, USA
CORRESPONDENCE TO: !
[email protected] & ?knudsen@ucredu
Asstract — Lichenothelia convexa, a saxicolous and lichenicolous microfungus, is reported
new for the Czech Republic. The poorly known species is provided with a description and is
illustrated.
Key worps — Lichenostigma saxicola, Lichenothelia paradoxa
Introduction
Rock-inhabiting fungi (known as RIF) are common throughout the
world. They are rich in diversity (Ruibal et al. 2009) and often collected by
lichenologists who study saxicolous lichenized fungi. Lichenothelia D. Hawksw.
is a cosmopolitan genus of RIF currently comprising 24 species (Robert et
al. 2005). The genus Lichenothelia was introduced by Hawksworth (1981)
for the Microthelia aterrima group of fungi with apothecioid ascomata with
bitunicate asci, pseudoparaphyses, 1-3 septate to submuriform brown halonate
ascospores, and a black areolate non-lichenized thallus. The generic type is
L. scopularia (Nyl.) D. Hawksw.,a widespread species on acid rock or micaschists
in Europe and North America, which has mainly 3-septate to submuriform
ascospores and an I- hymenium. Hawksworth included a second species in the
genus, L. metzleri (J. Lahm) D. Hawksw., which has a similar thallus, but differs
in having predominately 1-septate ascospores, an amyloid reaction on the outer
layers of the asci (I+ blue), and occurs on calcareous rock and serpentine. It is
also known from Europe and North America (Hawksworth 1981).
Aino Henssen published 18 new species in the genus on calcareous or
non-calcareous rock (Henssen 1987). Five of the species had apothecioid
346 ... Kocourkova & Knudsen
ascomata with pseudoparaphyses. Henssen emended the genus to include taxa
with ascomata with asci developing in cavities within a centrum of spherical
cells, describing 13 more species. Henssen’s species varied from dispersed to
contiguous areoles, becoming lobulate or efhigurate thalli in some species.
Some produced superficial hyphae called stolons, which usually produce new
ascomata. Many taxa produced globose macroconidia, often on stalks, or
meristematic offshoots. The centrums were either amyloid or non-amyloid.
Some taxa were described as facultatively lichenicolous or fungicolous. The
paper excited curiosity among lichenologists, who occasionally collected the
more conspicuous rock-inhabiting fungi. But it proved perplexing. It was
without a key and only a short diagnosis was given for each species. Most
species were not illustrated and the pictures of the thalli, though good for the
time, were over-all dark and too small. A monograph was apparently planned
but was never completed. Authentic specimens of the new species were rare
in herbaria and most types were unavailable for loan as Henssen continued
her studies. Few of the types of Henssen’s species are accessible now, although
Hessen will eventually deposit them in Helsinki (H). Most lichenologists lost
interest and stopped collecting the fungi when they found they could not be
identified.
In the 23 years since Henssen’s paper, only 4 new species have been
described. Lichenothelia antarctica Ovstedal (Ovstedal & Lewis Smith 2001) has
apothecioid ascomata with pseudoparaphyses and large muriform ascospores.
It appears to be endemic to Antarctica. Lichenothelia renobalesiana D. Hawksw.
& V. Atienza (Atienza & Hawksworth 2008) also has apothecioid ascomata
with pseudoparaphyses. It has no thallus and is lichenicolous on Verrucaria
species on limestone in Europe and North America (Kocourkova & Knudsen
2009). Lichenothelia spiratispora Etayo is similar to L. renobalesiana but has
smaller ornamented and halonate 1-septate ascospores and is lichenicolous on
Acarospora sphaerospora H. Magn. (Etayo 2010). Lichenothelia uralensis Zhurb.
(Zhurbenko 2008) from the Russian Federation has a cellular centrum and
dispersed areoles and is known only from the type.
Recent pioneering studies of rock-inhabiting fungi using molecular analysis
are renewing interest among mycologists (Ruibal et al. 2009). Currently several
species of Lichenothelia are being cultured and sequenced. The reconstruction
of their phylogeny is anticipated.
We became interested in saxicolous microfungi while studying lichenicolous
fungi. We recently described Lichenostigma saxicola K. Knudsen & Kocourk.
from southern California (Knudsen & Kocourkovdé 2010), a taxon Henssen
would have described in Lichenothelia. The new species has a non-amyloid
centrum of spherical cells, 1-septate ascospores, dispersed thallus, produces
stolons, and is both saxicolous and lichenicolous. From the Czech Republic
Lichenothelia convexa revisited [Europe] ... 347
we examined two taxa with amyloid centrums with spherical cells, both
facultatively lichenicolous. The more common species was eventually identified
as Lichenothelia convexa. In this paper we publish a revised description of
L. convexa and report it new for the Czech Republic. The other taxon may be
new to science or else represent wider variation in L. convexa but needs further
study and more specimens.
Materials & methods
Specimens of Lichenothelia calcarea Henssen, L. convexa, L. metzleri, L. paradoxa
Henssen, L. renobalesiana, L. scopularia, L. tenuissima Henssen, as well as Lichenostigma
saxicola and several probably undescribed taxa from Australia, Europe, North and
South America were studied from B, FH, IMS, MIC, SBBG, PRM, UCR, UPS, and the
Hb. Mycologicum J. Kocourkova & K. Knudsen. Specimens have been examined using
standard microscopical techniques with an Olympus SZX 7 Stereomicroscope or an
Olympus BX 51 fitted with Nomarski differential interference contrast. Hand-made
sections were studied in water and 10% KOH [K]. Amyloid reactions were tested in
Lugol’s iodine 1% [I] with and without pretreatment with K. Ascospore measurements
were made in water with an accuracy of 0.5 um and given in the form “(minimum-)
mean minus standard deviation-mean—mean plus standard deviation (-maximum)”
and followed by the number of measurements (n); the length/breadth ratio of ascospore
is indicated as 1/b and given in the same way. Over-mature ascospores were few and
excluded.
Macro- and microphotographs were taken with a digital Olympus D72 camera
mounted on an Olympus SZX 7 Stereomicroscope and or an Olympus BX 51 fitted with
Nomarski differential interference contrast.
Taxonomy
Lichenothelia convexa Henssen, Bibl. Lichenol. 25: 259 (1987). PLATE 1
TYPE: GERMANY. Hessen. Kr. Marburg, Wollenberg, on quartzite rock, 1980, Henssen
26750a (MB, holotype)
Vegetative hyphae, 4-5 um in diam., brown, with granular surface, thick-walled,
cells 7-10 um long, branching not observed, immersed in substrate, usually
one per stroma, often absent or hard to observe, I-. Thallus dispersed areolate,
stromata sometimes congregated, infrequently confluent but separated by wide
cracks, superficial on rock and lichens, not connected to other ascomata by
networks of superficial hyphae. Stromata black, irregularly rounded, convex
to somewhat flattened, mostly 100-200 x 90-120(-150) tum, some becoming
as wide as 400 um across, infrequently producing 1 to 3 superficial hyphae,
“stolons” sensu Henssen (1987), black in dissecting microscope, black-brown
with granular surface in light microscope, up to 1 mm long, but often shorter,
one cell wide, cells various size, many 4-6 x 4-6 um, often forming new stroma
at tips of stolon, sometimes 3 stromata appearing linked in row. Stromata in
348 ... Kocourkova & Knudsen
section pseudoparenchymatous, with round to angular cells mostly 4-5 um
in diam., external cells brown with granular surface, internal cells hyaline to
light brown, I-, often sterile. Non-ostiolate, opening in apex by wall decay. Asci
immersed in cavities in the stromata, bitunicate, broadly saccate to clavate,
20-30(-35) x 10-20 um, fragile, mostly 8-spored. Intercellular spaces with an
I+ blue, K/I+ blue gel, sometimes weak, reaction not observed when ascomata
sterile. Ascospores hyaline to light brown when young, becoming darker brown,
ellipsoid to broadly ellipsoid, faintly ornamented, halonate at least when young,
cells not equal in size, 1-4 septate, sometimes becoming submuriform, (10.0-
)10.5-10.8-11.5(-12.0) x (5.0-)6.0-6.1-6.5 wm (n = 20); I/b = (1.5-)1.7-1.8-
1.9(-2.1). A few larger over-mature submuriform ascospores were seen, 14 x
6-6.5 um, but were excluded. (Henssen 1987 gives ascospore measurements
of 11-14 x 5.5-6.5 wm). Macroconidia globose, often absent, 10-15(-20) um.
Meristematic outgrowths also produced from surface of stromata of various
sizes and shapes.
ECOLOGY AND SUBSTRATE - On non-calcareous rocks and on saxicolous
lichens. It is not host specific. In some specimens no damage to the host
was observed. In a specimen from KrkonoSe National Park, Knudsen 12560,
Lichenothelia convexa is clearly pathological on the thallus of a Lecidea
species.
DisTRIBUTION. — Europe (Czech Republic, Germany, Sweden, United
Kingdom), Asia (Turkey), North America in the United States (California,
Colorado, Washington) (Halici et al. 2006; Hawksworth 1992; Henssen 1987).
SPECIMENS EXAMINED. — CZECH REPUBLIC. East BoHEMIA. Krkonoge National
Park, KrkonoSe Mts, map of Czech Republic. 50°43’20”N 15°42’03”E, 1426 m, on granite
outcrop and Lecidea species, 10 Oct. 2010, K. Knudsen 12560 w/ J. Kocourkova (Hb.
Mycologicum Kocourkova & Knudsen). CENTRAL BoueEMIA. Distr. Praha, Pitkovice,
Pitkovické stran, 50°1’26"N 14°34'21”E, 276 m, on shale and Rinodina aspersa, 21
Sept. 2010, J. Kocourkovd 7744 (Hb. Mycologicum Kocourkova & Knudsen), on shale
and Acarospora gallica, Knudsen 12452 (BM, GZU, Hb. Mycologicum Kocourkova &
Knudsen); Nova Ves, Prokopské valley, Hemrovy rocks, 50°2’34.88"N 14°21711.6137E,
265 m, on west-facing slope above road, on diabase and Acarospora fuscata, 7 June, 2010,
J. Kocourkovdé 7404 (Hb. Mycologicum Kocourkova & Knudsen); GERMANY. HEssEn.
Kreis Marburg/Biedenkopf, TK 25: 5117 Buchenau, Wollenberg, Wichtelhauser,
Hohler Stein, 385 m, on quartzite, 13 Aug. 1989, H. T. Lumbsch & E. Mietzsch 6948 (B,
TOPOTYPE); Harz. Selketal, Meiseberg, 3 June 1990, H. T: Lumbsch (B).
Discussion
Lichenothelia convexa is widespread and probably under-collected. We
report it as new for the Czech Republic, where it appears to be infrequent on
non-calcareous rock (although often locally common on diabase and shale)
and is often sterile. Unlike L. scopularia, L. metzleri, or L. paradoxa, all of
which have conspicuous black areolate thalli, the dispersed areolate thallus of
Lichenothelia convexa revisited [Europe] ... 349
Pate 1. A, Lichenothelia convexa on Acarospora fuscata and rock (J. Kocourkovd 7404, scale = 1
mm). B, Section of stroma of L. convexa (scale = 20 um). C, Young 1-septate halonate ascospore
(scale = 10 um). D, Faintly ornamented surface of ascospore (scale = 10 um). E, Spore with 3
septa becoming submuriform (scale = 10 um).
350 ... Kocourkova & Knudsen
L. convexa looks like the dispersed thalli of many rock-inhabiting microfungi
seen on calcareous and non-calcareous rock throughout the world. Rarely does
L. convexa form a more confluent thallus of stromata separated by wide, deep
cracks.
In southern California, Lichenothelia convexa resembles Lichenostigma
saxicola, which is distinguished by thinner usually hyaline or light brown
stolons, 1-septate ascospores, and a non-amyloid centrum and which occurs
at relatively low elevations in desert and coastal xeric habitats (Knudsen &
Kocourkové 2010). Lichenothelia convexa was collected in California at a
mesic low elevation site (Silverwood, San Diego County) and higher elevation
montane sites (Yosemite in the Sierra Nevada Mountains and Mt. Baldy in San
Gabriel Mountains) (Henssen 1987). Lichenostigma saxicola, which has not
been reported yet from Europe, is currently considered endemic to western
North America and may be a predominately desert species.
Henssen (1987) originally described Lichenothelia convexa as having 3-4
septate ascospores, but our observations show the ascospores to be variably 1-4
septate. We also observed a K/I+ blue stain in the apex of the ocular chamber
and lacking an amyloid ring. Further study of fresh material, best for taxonomic
study, is needed, as good asci for staining were insufficient in our specimens.
Sterile stromata are common.
Lichenothelia paradoxa is currently known only from Slovakia on quartzite
but is expected in the Czech Republic. Itresembles L. scopularia, but L. paradoxa
has paraplectenchymatous stromata with asci forming in cavities rather than
apothecioid ascomata with pseudoparaphyses. Otherwise the brown ascospores
with 2 or 3 septa are similar in size to the ascospores of L. convexa.
Acknowledgments
We thank our reviewers, James C. Lendemer (NY) and M. Gékhan Halici (University
of Erciyes, Turkey). We thank the curators of B, FH, IMS, MIC, UPS and SBBG. The
work of Jana Kocourkova was supported financially by the grant “Environmental
aspects of sustainable development of society” 42900/1312/423114 from the Faculty of
Environmental Sciences, Czech University of Life Sciences Prague.
Literature cited
Atienza V, Hawksworth DL. 2008. Lichenothelia renobalesiana sp. nov. (Lichenotheliaceae), for a
lichenicolous ascomycete confused with Polycoccum opulentum (Dacampiaceae). Lichenologist
40(2): 87-96. doi:10.1017/S0024282908007342
Etayo J. 2010. Liquenes y hongos liquenicolas de Aragén. Guineana 16: 1-501.
Halici MG, Kocakaya M. & Aksoy A. 2006. Additional and interesting lichenized and lichenicolous
fungi from Turkey. Mycotaxon 96: 13-19.
Hawksworth DL. 1981. Lichenothelia, a new genus for the Microthelia aterrima group. Lichenologist
13: 141-153. doi:10.1017/S0024282981000182
Lichenothelia convexa revisited [Europe] ... 351
Hawksworth DL. 1992. Lichenothelia D. Hawks. (1981). 359-360, in: Purvis OW, Coppins BJ,
Hawksworth DL, James PW, Morse DM (eds.): The Lichen Flora of Great Britain and Ireland.
British Lichen Society, Natural History Museum Publications, Great Britain.
Henssen A. 1987. Lichenothelia, a genus of microfungi on rocks. Bibliotheca Lichenologica 25:
207-293,
Knudsen K, Kocourkova J. 2010. A new Lichenostigma species (genus incertae sedis) from southern
California. The Bryologist 113(2): 229-234. doi:10.1017/S0024282908007342
Kocourkova J, Knudsen K. 2009. Three lichenicolous fungi new for North America. Evansia 26(3):
148-151. doi:10.1639/0007-2745-113.2.229
@vstedal DO, Lewis Smith RI. 2001. Lichens of Antarctica and South Georgia: A guide to their
identification and ecology. Studies in Polar Research, Cambridge University Press, Cambridge,
England. 411 pp.
Robert V, Stegehuis G, Stalpers J. 2005. The MycoBank engine and related databases. http://www.
mycobank.org
Ruibal C, Gueidan C, Selbmann L, Gorbushina AA, Crous PW, Groenewald JZ, Muggia L, Grube
M, Isola D, Schoch CL, Staley JT, Lutzoni F, de Hoog GS. 2009. Phylogeny of rock-inhabiting
fungi related to Dothideomycetes. Studies in Mycology 64: 123-133.
Zhurbenko MP. 2008. A new species from the genus Lichenothelia (Ascomycota) from the Northern
Ural. Mikologia i Fitopatologia 42(3): 240-243.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 353-363 January-March 2011
DOT: 10.5248/115.353
Mortierellomycotina subphyl. nov.,
based on multi-gene genealogies
K. HOFEMANN?, K. VoictT! & P.M. Kirk?
! Jena Microbial Resource Collection, Institute of Microbiology, University of Jena,
Neugasse 25, 07743 Jena, Germany
?CABI UK Centre, Bakeham Lane, Egham, Surrey TW20 9TY, United Kingdom
“CORRESPONDENCE TO: Hoffmann. Kerstin@ Uni-Jena.de
ABsTRACT — The Mucoromycotina unifies two heterogenous orders of the sporangiferous, soil-
inhabiting fungi. The Mucorales comprise saprobic, occasionally facultatively mycoparasitic,
taxa bearing a columella, whereas the Mortierellales encompass mainly saprobic fungi lacking
a columella. Multi-locus phylogenetic analyses based on eight nuclear genes encoding 18S
and 28S rRNA, actin, alpha and beta tubulin, translation elongation factor lalpha, and RNA
polymerase II subunits 1 and 2 provide strong support for separation of the Mortierellales
from the Mucoromycotina. The existence of a columella is shown to serve as a synapomorphic
morphological trait unique to Mucorales, supporting the taxonomic separation of the
acolumellate Mortierellales from the columellate Mucoromycotina. Furthermore, irregular
hyphal septation and development of subbasally vesiculate sporangiophores bearing single
terminal sporangia strongly correlate with the phylogenetic delimitation of Mortierellales,
supporting a new subphylum, Mortierellomycotina.
Key worps — Zygomycetes, SSU rDNA, LSU rDNA, protein-coding genes, monophyly
Introduction
The type species of Mortierella Coem. 1863, M. polycephala Coem. 1863, was
originally isolated from a parasitic interaction with a mushroom and named in
honour of M. Du Mortier, the president of the Société de Botanique de Belgique
(Coemans 1863). However, the common habit of mortierellalean species is as
soil saprobes, enabling the fungi to grow on excrements, decaying plants, or
(not infrequently) on decaying mushrooms and mucoralean fungi (Fischer
1892). Members of the Mortierellales do occasionally occur as opportunistic
pathogens in animals and humans as well (de Hoog et al. 2009: 79). Because of
the morphological differences to other mucoralean-like fungi, the genus was
classified in a separate family, Mortierellaceae A. Fisch. 1892 (Fischer 1892),
which is the only family within the Mortierellales Caval.-Sm. 1998 (Cavalier-
354 ... Hoffmann, Voigt & Kirk
Smith 1998). In addition to Mortierella, the Mortierellaceae includes a further
five genera, Aquamortierella Embree & Indoh 1967, Dissophora ‘Thaxt. 1914,
Gamsiella (R.K. Benj.) Benny & M. Blackw. 2004, Lobosporangium M. Blackw.
& Benny 2004 (= Echinosporangium Malloch 1967, nom. illegit.), and Modicella
Kanouse 1936. Currently, the Mortierellales are classified within the subphylum
Mucoromycotina Benny 2007 with the Mucorales Fr. 1832 and Endogonales
Moreau ex R.K. Benj. 1979 (Hibbett et al. 2007). This classification, based
upon informal supertrees, abandons the phylum Zygomycota and recognizes
four subphyla of uncertain phylogenetic position: Zoopagomycotina,
Entomophthoromycotina, Kickxellomycotina, and Mucoromycotina.Supermatrix-
based phylogenetic approaches using multiple genes in concatenated analyses
place the Mortierellales basal to the Mucorales (Tanabe et al. 2004, James et al.
2006). In contradiction to this, the Mortierellales has also been shown to be
more closely related to the Dikarya and Glomeromycota (Benny et al. 2001, Liu
et al. 2009, Voigt et al. 2009).
‘This study provides evidence for the missing sister relationship between both
orders. All attempts to constrain the monophyly were statistically insignificant
and rejected under the null hypothesis. Therefore, the possibility of a common
ancestor for both orders is unlikely. Combined Bayesian inference, maximum
likelihood, maximum parsimony and distance phylogenetic analyses imply
clear separation of the Mortierellales and the Mucorales. Both orders appear
as well-separated, monophyletic groups in single and combined analyses.
Two synapomorphic morphological features are identified that reliably
characterize, strongly support, and justify the introduction of anew subphylum,
Mortierellomycotina.
Materials & methods
SEQUENCE AND PHYLOGENETIC ANALYSES. Nucleotide sequences encoding the
nuclear small (18S) and large (28S) ribosomal RNA (rDNA), actin (act), translation
elongation factor 1 alpha (tef), RNA polymerase II largest subunit (rpbl), RNA
polymerase II second largest subunit (rpb2), alpha- (atub) and beta-tubulin (btub) from
twenty-seven fungal species were retrieved from GenBank (www.ncbi.nlm.nih.gov),
aligned and subjected to single and combined phylogenetic analyses using Bayesian
inference, maximum likelihood, maximum parsimony and distance algorithms. In
addition, amino acid sequences were also obtained from the protein-coding genes and
used for validation of the tree topologies. Furthermore, nucleic acid sequences available
from genome projects were screened for genomic regions, which are orthologous
to the phylogenetic marker genes selected in this study. Accession numbers of the
sequences retrieved from GenBank as well as the loci from the genome projects (http://
genome.jgi-psf.org/ and www.broadinstitute.org/) are indicated by the taxon labels in
Fic. 1. Individual alignments of the ribosomal DNA sequences and the protein-coding
sequences were performed using ClustalW implemented in BioEdit version 7.0.9.0 (Hall
1999). Considering the triplet-based coding of the protein sequences, these sequences
Mortierellomycotina subphyl. nov. ... 355
were re-translated into their nucleic acid sequences using RevIrans (Wernersson &
Pedersen 2003, www.cbs.dtu.dk/services/RevTrans/). Ambiguously and divergently
aligned blocks were removed from the alignments prior to phylogenetic analysis, which
was finally conducted in individual and all possible gene combinations of concatenated
analyses. Two phylogenetic trees, which are representative for these analyses, are
shown in Fic. 1. The phylogram presented in Fic. 1A bases on a combined alignment
of the nuclear ribosomal DNA consisting of a total of 2103 characters (1518 and 585
characters for 18S and 28S rDNA, respectively). The phylogram presented in Fic. 1B was
computed based on an aligned supermatrix concatenating a total of 5382 characters of
the protein-coding genes (807; 1515; 1890 and 1170 characters for ACT, RPB1, RPB2 and
BTUB, respectively). For the trees shown in Fic. 1a and 1B, respectively, the combined
nucleotide data sets of the ribosomal DNA and the protein-genes were subjected to
MrBayes v3.1.2 (Huelsenbeck & Ronquist 2001, Ronquist & Huelsenbeck 2003). The
Bayesian inference was initiated from a random starting tree. Two independent runs
with four chains each were conducted for 2,500,000 generations with samples collected
every 2500th generation. After discarding the first 25% of the generated trees (burn-in)
the consensus tree was calculated using the halfcompat option. Posterior probabilities
(in percent) are indicated at the nodes and represent node confidence values. Additional
bootstrap analyses (Felsenstein 1985; 50% majority rule) with 100 and 1000 replicates of
maximum likelihood (RaxML; Stamatakis 2006; Stamatakis et al. 2008) and neighbor-
joining (Saitou & Nei 1987) searches, respectively, were used to calculate clade stability.
The amoeboid protist genus Nuclearia was chosen as outgroup taxon because it appears
to be the closest extant relative to the fungi (Liu et al. 2009). The probability of alternative
phylogenetic tree topologies constraining the phylogenetic relationship of the Mucorales
and Mortierellales unified within a common monophyletic clade was evaluated by
several independent statistical tests, such as (i) the Kishino-Hasegawa test (Kishino &
Hasegawa 1989), (ii) the Templeton test (Templeton 1983) and (iii) the winning-sites
test (Prager & Wilson 1988), based on the evaluation of the number of steps necessary to
find the most parsimonious tree as implemented within PAUP*v4.0b10 (Swofford 1998).
Additionally, the number of trees found after reaching a stationary phase (stationarity)
from the constraint topology in the Bayesian analyses were compared to the number of
trees without particular topological constraints using PAUP*v4.0b10.
IDENTIFICATION OF SEQUENCE SIGNATURES. Exonic nucleotide and protein
sequences of the genes encoding act, RPB1, and TEF were identified as suitable marker
genes for short unique sequence regions that differentiate the Mortierellales from the
Mucorales. The sequence fragments were subjected to BLAST (Altschul et al. 1990, 1997)
at NCBI in order to exclude identical sequence regions within the order Mucorales.
These discriminatory sequences were defined as signature sequences and are displayed
in TABLE 1.
Results & discussion
Phylogenetic tree reconstructions
In 2007, Hibbett et al. proposed a re-classification of the Fungi, which is now
widely accepted, abandoning the phylum Zygomycota which was reported as
356 ... Hoffmann, Voigt & Kirk
Feo al paises cae Saag Taare see whSTee Sap Pee yet ere esas eel? Soe aes se ee eee eee eee ewe S6SP6TOC VIDIIIN4AA “A
840}2 49 TN...
SLOADOOWWODOOWWNL DA LYMODL DOA DWMOOMLODLLMOOUWOOOLLOD IdMdMTIVdLd149aM9 IsH0UV' [] ASVAAWAIOR VNY
eee eee eee eee emote tees eens teen eee eee eee eeneee eee enzee ee eeeeeee ZOCLSTAV VIDHIIDIA
SC HS seen eae eee e eee ees L9@LSTAV vpydartjiod we
SO I es a SOZOELNT vuttssHnutu
PO A ns ea POTIELNA Byopur We
SCE Ho A seen ogee cece ees 6SZLSTAV vsodsopduinjys “We
SfON e REE Ceres Ay Se leah 7 esse yt: Bins SES. 8 reieian € coats xete: Behe oe ence ee 6 48-8 Tee ere SPORES haere ge xO) Bree Se) COTIELNG BUldy “We
Fo Ce ns see ogee ence ees SPTLSIAY ajosiaasunsy “J
POCO ne eo ns on a OOZLSTAY vIDIAvaIpLyNU “ED
DILILYO DDD LSD LL ODO LL DO LOWY OD DOVWOV LL SD OL SD YYOVYOLD SIdAdAdASMdNADAMMA
AOLALYOOOOLOOLLADSA LDA DGD VW OD OOVWOVLLOD OLOOVYOVYOLD elena ayaa Seay ee an eee
A(W/L/S) H4NADAMMA WOLOVA NOILVONOTA NOLLVISNVUL
Di CI te tin A i) ae > cin i a > is Cs TLIZ82(V tyfjom
BG BART OE s ies Roe RCE a: ARR G8 SSAC ENE BOR RCE eT de SRRCE ES Bop aCe ol METAR pe sete E eeeere 88: 88 OLILZST(V VIDIfIDIZ4aA “Ay
POO Co On Saget eee eee 69TL8zlV Mpydariod ‘Ww
SIE oon eC SE gece eee ees 6ETIELNT vuessynunu
SOI on sages ete eyes RETIEL AT vueissynunu
SINE Coe Saget eens LEZOSLOA NYOpUT “E
FG ey see ge eee e eee eee LOTLET(V vsodsopkumpy we
Sn Ct ce cc a settee eee eeeeee SESTIFINY Duidp vyjasansoyy
RAS AO AOS oc eee eee cece ee eee OSTLRT[V afosuansuns weniSuvsodsoqoT
Son CCCI son in CC Seog eee eee ee ees ROLLET[V VIDIADAIpYNU DYaIsUADD
DDD DI LIOWOVWO LL OO LOW LOS LSD OWS LYOL OO LYOVYOLYOL OWL WSLINASADMAWIIMWIA
W(L/S)L(0/S/N)dSa9
AQSEGOMOOVENHOLLAOLOVLADDHSDOOWOOLNSLOALYOYUVOLYSLOOWL wg (1/W) TI (d/o) WIA SOSNHSNOO ‘(.LOV) NILOV
[.€-.¢] SONaNDAS GIOV OIgTOAN [.¢ -.S] JONdNDdAS GIOV ONINV
‘sappsoon Jop1O ayy Jo Jaquiaur Aue ut juasard
JOU oe PUL sapyjjasaty Loy WY} 9Z119]DeIeY ATTeE.0ammboun sasuanbes amnyeusis 3y} [GON Je sayozeas [Sy Tq Aq poylsiaa sy ‘[adu pue
“AL “ure BuIpooua sauas WO] eyep pide WapPnu pue oUTUTe paUsi[e UO paseq poyuapt 10M soduonbeas omnjyeusis “(OTOZ YIeW
I Jo se) puyorkwmoyasaysoyy unAydqns oy} Jo erauas a[qepear [je Jo Yuequay ul sosuanbeas wos paatiap sosuanbas sinyeusis *[ ATAVI,
Mortierellomycotina subphyl. nov. ... 357
paraphyletic in several previous phylogenetic studies (e.g. Gehrig et al. 1996,
Tanabe et al. 2000). The hypothesis of a close relationship between Mortierellales
and Mucorales (classified as Mucoromycotina) was recently rejected by Liu et al.
(2009) and, moreover, the justification for a classification of the Mortierellales
into a separate supra-ordinal taxon distinct from the Mucoromycotina was
proposed by Voigt et al. (2009). In our single and combined phylogenetic
analyses both orders appear as distinct clades (Fic. 1a-B). Although, the
actual relationship between both clades is not resolved, none of the sequence
analyses supported a sister-clade relationship between Mucorales (clade @
and Mortierellales (clade ‘b’). Based on ribosomal DNA data, the Mortierellales
are more closely related to the Glomeromycota and the Dikarya (Ascomycota
+ Basidiomycota), but less related to the Mucorales (Fic. 1A). This relationship
was also shown by Liu et al. (2009), but here the Glomeromycota were not
included, using instead a phylogeny inferred from mitochondrially encoded
sequences. Analyses of the protein-coding sequences show a minimal sister
group relationship between Mucorales and Glomeromycota but fairly unresolved
relationships between all other groups, probably due to a lack of informative
characters and the phylogenetic signal of the marker genes for clade ‘b’ (Fic. 18).
Both phylogenies support the monophyly and also, therefore, the phylogenetic
distinctiveness, of both clades ‘@ and ‘v by bootstrap proportions (BP) of 100%.
Eight-locus phylogenies using RaxML analyses resulted in the coherence of the
Mortierellales supported by a BP of 77% grouping apart from the Mucorales (BP
90%; data not shown).
Rejecting the coherence of a Mortierellales-Mucorales clade
In single-locus analyses none of the eight loci supported the phylogenetic
coherence of the Mortierellales with the Mucorales (TABLE 2). Using 185,
288 rDNA and Brus the individual clades of Mortierellales and Mucorales
are supported by BP values of 100% each. But a coherent node for a unified
Mortierellales-Mucorales clades collapses due to a BP below 50%. Also, no
support of a monophyletic Mortierellales-Mucorales clade occurs if rpb1 and
rpb2 are used, with 92% and 100% BP for a monophyletic Mucorales clade
separated from the Mortierellales, respectively, for each individual gene. Since
there is currently only one mortierellalean nucleotide sequence available for
each of the phylogenetic markers RpB1 and RpB2, this order appears without
statistical support. For act and tef only the Mortierellales are well supported
(100% BP for TEF and 81% BP for act), there is also no statistical support
for a monophyletic origin of both orders. With the exception of arus, from
which no sequences were available for the Mortierellales, single-gene based
bootstrapping of all other loci suggests the incoherence of the Mucoromycotina
as a whole in its current circumscription, supporting the separation of the
Mortierellales from the Mucorales (TABLE 2).
358 ... Hoffmann, Voigt & Kirk
[sszzocda ‘96sr6za * “-] sunsaja saaduopodoyy
L- ‘plpz6oav © -] ossasdap sypydaouds 18
[sozzocda ‘gzsp6zdd * -] vjnosnqun saotuony
[eszzosda ‘rosbozOa ‘eesrroAv ~] ‘ds nisupuaoD
aus/SUOTININSGNS 1°O
[- = Tsgzssav ‘ZlosoEAv] ‘ds piunajonyy
66
[oszzoeda * ‘.90z9 1a ~] “ds saoduourdy
001
| LL
[Loerlodd ‘LIPLOOaY ‘E90791AV ~] snBuDsauodg saatuojnadney 001
[zgzzocdd ‘c6sh6zOa ‘690z91 AV *] anjasyno wniniUg
[szzzoeda “o6srozda ~ ‘oosrerad] avosnu nsoyrydowojug
[80br10dd ‘O6EPIOAT ‘SPBPPOAV ‘IP8Z8SAV] “ds saodmoliyD
[p8zzoeda ‘s6sh6ZOd “ILOZ9IAV ‘OLIL8ZLV] DIDIPIYLAA DjJasaysOpy
“SOILL8ZLV] DIDILAVAIPHINU DjJaIsSWuyy
[--* ‘ostzszry] appsuaasupy umsuvsodsogoT
[- = ‘eogroAv ‘SsIL8ziv] suagquinzap vsoydossiq
_Telozse WX ‘po06s6 WX ‘9LSzS6 WX ‘or09s6 Wx] Dssns9 psodsoanay
[ssoozt o'Sd Tysouady axqIse ‘ESPOT O'sn[aastMeuED IxqISe
“9
“66E76EIOO NX “LL109 D'1asimeuen IxqIS9] ,.Wadiu snypsiodsy 0OT SL
[880678100 WX ‘Szs8Z8100 WX ‘91 1000dV ‘E1€6€8100 WX] vasauis sisdoutsdod __ [001]
[Z9098LAW ‘79ZO00T PloeOs Dud [ysoussy
“SEI ZEEaV ‘L0601 O° Tasimousg 1xq3s9] 4 SNPDALISO SNJOANALT Or
[90s0100000°zAeueng “zrEooozT PIQYeos D'8d_eysouedy
“ILTZE88100 WX ‘LO00SZ O'S Lysousdy xqIs9] ,.10J091g DIMDIIDT 001
[Zpoo9T O'snidtesimeuan 3xqyse
‘TL spud qaysouedy ‘pe10z O’snjdlasimeuan axgise *] ,, smuvaajsaynyq Saadumordyd
[ezezel DEOU ‘e'PSEL0 DEOU ‘€'S0K00 DEOU ‘€ ZOOPT OEOUl ~SuZyssy sndozyy
[90%06 O'Tesimausn axquse ‘T's 1'Z1 139
“egcoz Oud Qpysoussy axqIs9 “610001 O'S¥ OWYsoUSsy 3xqIS9] ,, SAPIO[9UIIsII LOIN 01
[ozezoeda ‘16sr6zda ‘ssoz91AV ‘] snjDUOLOD snjogoIpIuED) 66
[scoszgdq ‘zosp6zOa ‘El ebL itd -] wnjgnd00 snuojspaog
= al oor
L ‘eserloda ‘.8esstav “] avassouw snuoj DoT
O01
[oszzoeda ‘rosrezda ‘ozerLifa ‘9Eszostv] ‘ds nuodsojjamog
[p6zz0edd ‘eo9p6zOd ‘ozE9ZEAYV *] SadIp.AD.UI SNLUO]D ool
aUsSUOHMNSGAS [°O
[oegezzOd ‘Lepoesdal snurody saoduomuidyd
[s6osrlAv ‘o9seredv] ‘ds piuwajony
[szszssAv ‘peszssAW] Djnosngdp saoduonjy
[zLeczOa ‘ozsse9AV] avosnu vsoyjydowojug
[le99rsAv ‘esc96zdVv] snjpuo.109 snjogoIpiuoD (OOT
[eosployeos ‘-] , snunaajsayng sarduordyg re
[o'¢8nuooiedns ‘9'¢8nuoor0dns] ,. sm2zysav sndozyy DOT LJ
[eproygeos ‘Z[poyyeos] ~saproyaurouts soonpy 96
[socezzOa “pesseoAv] sunsaja saoduojndoyy
[- ‘11o910av] vssaudap sipoydooudg
[ezzezzO ‘0s66za] anjasijno wnigpiUug
. O0T
[608220 ‘seszooav] suSupsauoog sarduojnoénsy 00T
[ool corv ‘ZhsLooa] sninuu saotuosdy oor
[esoorsAv “] ‘ds pisupuaoD OOT
[Zorel lav ‘bZbEl 1A] apusuansupay unjisuvsodsogoT
[861 LS1AV ‘prILSIAV] BDIsDAIpH]NU Vjjaisupy mT
[peLeczOd ‘LIO9TOGV] BIDIPLINIaA DYaLaysOPYy
[e8Izslav ‘€e1slav] suaqunaap vsoydossiq
[- ‘ezozzeda] unjjno20 snuojsp.1ng
09
[zoxexzda ‘zesseoAv] DuirBo.ia1ay nsodsojjainogy is
[eozezzOa ‘eesseoAv] avassou snuojy
=] oor
[szsezzdq ‘ocozzedal sazippansjur snuojy oor
[sSTI89AV ‘ILZ9POAV] Dssin49 D1odsoanan’ u
ee
[z18szn ‘gesszx] 4asiu snypisuadsy OT
[poosoena ‘STOLS9AW] snmpadiso snjodna}g dor
[zoz1L004 “perployseos] 4oj001g DLDIODT
[ror rosy ‘166z6W] Basauto sisdoutadoy __|L6
Mortierellomycotina subphyl. nov. ... 359
TABLE 2. Bootstrap proportions of the Mucorales and Mortierellales nodes and
the combined Mucorales—Mortierellales clade in single-locus analyses.
NA-sequences 18S 28S ATUB BTUB RPBL RPB2 TEE ACT
Mucorales (Mu.) 100 100 78 100 92 100 Boat
Mortierellales (Mo.) 100 100 ni 100 nd nd 100 81
Mu. + Mo. 0 0 - 0 0 0 0 0
*NA = nucleic acid sequences coding for: 188/28S: small/large subunit nuclear ribosomal DNA; aTUB/BTUB:
alpha-/beta-tubulin; rpB1/2: RNA polymerase I] subunit 1 or 2; TEF: translation elongation factor lalpha;
ACT: actin. ni: not included; nd: not determined because there is only one member of the Mortierellales
included in the analysis.
Statistical tests for a monophyletic relationship between Mortierellales and Mucorales
The Ascomycota, Basidiomycota and Kickxellomycotina are well resolved and
show high clade stability support in both analyses presented in Fic. 1. However,
the relationships among those groups and the other groups are less clear-cut,
showing no significant support values. Statistical tests for an alternative topology
with a monophyletic Mucorales—Mortierellales clade allowed the exclusion of
that hypothesis of a biordinal monophyletic relationship, which justifies their
classification into a common subphylum. All tests rejected the phylogenetic
alliance between Mucorales and Mortiereilales with P<0.0001 under the
assumption of the null hypothesis. In Bayesian inference analyses only 23 trees
out of 2,002 were found after stationarity showing the topological constraint
unifying both orders using the ribosomal DNA data set and no tree was found
based on the combined protein data set. Therefore, it can be concluded that the
probability of a monophyly for the Mucorales—Mortierellales clade is 1.15% for
the ribosomal DNA data set and zero for the protein data set.
Identification of signature sequences
Based on Act, TEFand RPB1, consensus amino and nucleic acid sequences were
identified which represent diagnostic signatures unique for the Mortierellales
(TABLE 1). These are the protein sequence YLM[K/R]IL[M/L]ERGYSF[[N/s/Q]T[s/
T]A with its corresponding nucleic acid 5°-TAC CTS ATG ARG ATY CTS MTG
GAG CGH GGY TAC TCY TTC HMB ACC WCB GcyY-3° for act, VKKVGYNPK[s/T/
A]v[p/A]FV PIs with 5°-GTC AAG AAG GTC GGT TAC AAC CCC AAG DCY GTY SCY
Ficure 1. Bayesian inference analysis displaying the relationship between the orders Mucorales and
Mortierellales. The phylogenetic reconstruction is based on A: a total of 2103 aligned nucleotide
characters from the nuclear small and large subunit ribosomal DNA (1518 and 585 characters of the
18S and 28S rDNA, respectively) and B: a total of 5382 nucleotide characters from aligned protein-
coding genes (807; 1515; 1890 and 1170 characters of AcT, RPB1, RPB2 and BTUB, respectively), each
from 27 taxa. The protistan genus Nuclearia was chosen as outgroup taxon. Posterior probabilities
are indicated as clade stability support values above the branches. Clade ‘a represents the subphylum
Mucoromycotina and clade ‘b’ is represented by the Mortierellomycotina.
360 ... Hoffmann, Voigt & Kirk
TTC GTC ccc ATY TCY-3° for TEF and GWEGFLPTPAILKPKPL with 5°-GGT TGG
GAR GGW TTC CTR CCW ACY CCT GCW ATY CTM AAG CCC AAG CCyY CTS-3° for
RpPB1 (TABLE 1). These signatures based upon sequences currently available in
GenBank (as of 1% of March, 2010).
Identification of micromorphological traits
Typical micromorphological structures are shown in Fic, 2. ‘The
Mucorales develop a columella, a sterile swelling of the sporangiophore apex
protruding into the multi-spored sporangium. Conversely, the Mortierellales
lack this structure, suggesting that the columella is a synapomorphy of the
Mucoromycotina. The vegetative hyphae of the Mucorales are coenocytic, with
septation only rarely occurring below the columella within the sporangiophore.
In contrast, the Mortierellales develop irregularly septate vegetative hyphae and,
in addition, septa also appear among the hyphae lacking generative structures
and sporangiophores. Also, the sporangiophores are typically subulate, being
broad at the base and tapering towards the apex, whereas the sporangiophore
diameters in the Mucorales remain more-or-less constant (Benny et al. 2001).
Rhizoids are more pronounced and occur more frequently in the Mucorales
than among the Mortierellales; giant cells are absent in the Mortierellales.
Taxonomic description
Mortierellomycotina Kerst. Hoffm., K. Voigt & P.M. Kirk, subphylum nov.
INDEX FUNGORUM IF 539369
Mycelium hypharum bifurcate ramosarum anastomosantium compositum. Sporangiophora
basin inflata, apicem attenuata, erecta, non ramosa vel ramosa, ab initio non-septata,
sed irregulariter septata ubi plene creta. Sporangia sphaerica, unispora vel mutltispora;
columella carens. Sporangiosporae globosae usque ad ellipsoideas, vel irregulares, muris
laevibus ornamentatisve. Stylosporae, rhizoides et chlamydosporae interdum praesentes.
Zygosporae muris crassis; zygosporangium laeve; suspensores sine appendicibus.
Typus: Mortierella Coem. 1863
Zygomycota, incertae sedis. Mycelium with anastomosing hyphae, dichotomously
branching, bearing stylospores. Hyphae sporangiferous, sporangiophores
basally inflated and elongating towards the sporangiophore apex, erect,
coenocytic initially, but irregularily septated at maturity. Asexual reproduction
via sporangia and sporangiola. Sporangia sphaerical, multi-spored; columella
absent. Ramifications gracilous, primarily horizontally expanding, erecting
hyphae sometimes terminate with sporangiola. Spores globose to ellipsoid or
irregular, smooth or ornamented. Rhizoids only occasional. Giant cells absent.
Zygospores naked.
EXEMPLAR GENERA: Mortierella, Dissophora, Modicella, Lobosporangium,
Gamsiella, Aquamortierella.
Mortierellomycotina subphy]. nov. ... 361
Ficure 2. Micromorphological characteristics of prominent members of the subphyla
Mucoromycotina and Mortierellomycotina. a) Sporangiophore of Mortierella sp. lacking a columella
(white arrows). b) Tapering sporangiophore with rhizoids of Mortierella sp. Rejuvenating towards
the sporangiophore apex is characteristic for the Mortierellomycotina. c+d) Non-tapering
sporangiophores with rhizoids of Rhizopus/Rhizomucor sp. with sporangia. After spore release a
well-developed columella remains (black arrows).
Acknowledgements
The authorsthank Martin Eckart for assistancein theestablishment ofacomprehensive
sequence database comprising basal fungi and allied taxa. We also express our gratitude
to John David (Royal Horticultural Society, Wisley, UK) for his help with the Latin
diagnosis. Appreciation is extended to Dr. Hsiao-Man Ho (National Taipei University
of Education, Taiwan), Sybren de Hoog (CBS-Knaw Fungal Diversity Centre, Utrecht,
The Netherlands), Gerald L. Benny (University of Florida, Gainesville), and Dr. Shaun
Pennycook for critical review of the manuscript and valuable remarks. This work was
financially supported by the Deutsche Forschungsgemeinschaft (VO772/9-1).
Literature cited
Altschul SE, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool.
Journal of Molecular Biology 215: 403-410. doi:10.1016/S0022-2836(05)80360-2
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids
Research 25: 3389-3402. doi:10.1093/nar/25.17.3389
362 ... Hoffmann, Voigt & Kirk
Benny GL, Humber RA, Morton JB. 2001. Zygomycota: Zygomycetes. 113-146, in DJ McLaughlin et
al. (eds.), The Mycota Vol. 7A: Systematics and Evolution. Springer Verlag, Berlin, Germany.
Cavalier-Smith T. 1998. A revised six-kingdom system of life. Biological Reviews, Cambridge 73:
203-266. doi:10.1017/S0006323 198005 167
Coemans E. 1863. Quelques hyphomycétes nouveaux. — Ire. — I. Mortierella polycephala et II.
Martensella pectinata. Bulletin de Académie Royale des Sciences, des Lettres et des Beaux-Arts
de Belgique, Sér. 2, 15: 536-544.
de Hoog GS, Guarro J, Gené J, Figueras MJ (eds). 2009. Atlas of clinical fungi, 3rd ed. Centraalbureau
voor Schimmelcultures, Utrecht, The Netherlands.
Fischer A. 1892. Phycomycetes. Dr. L. Rabenhorst’s Kryptogamen-Flora von Deutschland,
Oesterreich und der Schweiz. Zweite Auflage, Band I — Pilze, Abt IV. Eduard Kummer, Leipzig
(Germany). 505 pp.
Felsenstein J. 1985. Confidence limits of phylogenies: An approach using the bootstrap. Evolution
39: 783-791. doi:10.2307/2408678
Gehrig H, SchiiBler A, Kluge M. 1996. Geosiphon pyriforme, a fungus forming endocytobiosis with
the Nostoc (Cyanobacteria), is an ancestral member of the Glomales: Evidence by SSU rDNA
analysis. Journal of Molecular Evolution 43: 71-81. doi:10.1007/BF02352301
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acid Symposium Series 41: 95-98.
Hibbett DS, Binder M, Bischoff JE, Blackwell M, Cannon PF, Eriksson OE, Huhndorf S, James
T, Kirk PM, Licking R, Lumbsch H, Lutzoni F, Matheny PB, McLaughlin DJ, Powell MJ,
Redhead S, Schoch CL, Spatafora JW, Stalpers JA, Vilgalys R, Aime MC, Aptroot A, Bauer
R, Begerow D, Benny GL, Castlebury LA, Crous PW, Dai YC, Gams W, Geiser DM, Griffith
GW, Gueidan C, Hawksworth DL, Hestmark G, Hosaka K, Humber RA, Hyde KD, Ironside
JE, Kéljalg U, Kurtzman CP, Larsson KH, Lichtwardt R, Longcore J, Miadlikowska J, Miller A,
Moncalvo JM, Mozley-Standridge S$, Oberwinkler F, Parmasto E, Reeb V, Rogers JD, Roux C,
Ryvarden L, Sampaio JP, Schiissler A, Sugiyama J, Thorn RG, Tibell L, Untereiner WA, Walker
C, Wang Z, Weir A, Weiss M, White MM, Winka K, Yao YJ, Zhang N. 2007. A higher-level
phylogenetic classification of the Fungi. Mycological Research 111: 509-547. doi:10.1016/
j-mycres.2007.03.004
Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:
754-755. doi:10.1093/bioinformatics/17.8.754
James TY, Kauff F Schoch CL, Matheny PB, Hofstetter V, Cox C, Celio G, Gueidan C, Fraker E,
Miadlikowska, J, Lumbsch HT, Rauhut A, Reeb V, Arnold EA, Amtoft A, Stajich JE, Hosaka K,
Sung G-H, Johnson D, O’Rourke B, Crockett M, Binder M, Curtis JM, Slot JC, Wang Z, Wilson
AW, Schii®ler A, Longcore JE, O’Donnell K, Mozley-Standridge S, Porter D, Letcher PM,
Powell MJ, Taylor JW, White MM, Griffith GW, Davies DR, Humber RA, Morton J, Sugiyama
J, Rossman AY, Rogers JD, Pfister DH, Hewitt D, Hansen K, Hambleton S, Shoemaker RA,
Kohlmeyer J, Volkmann-Kohlmeyer B, Spotts RA, Serdani M, Crous PW, Hughes KW, Matsuura
K, Langer E, Langer G, Untereiner WA, Lacking R, Badel B, Geiser DM, Aptroot A, Diederich
P, Schmitt I, Schultz M, Yahr R, Hibbett DS, Lutzoni F, McLaughlin D, Spatafora J, Vilgalys R.
2006. Reconstructing the early evolution of the fungi using a six-gene phylogeny. Nature 443:
818-822. doi:10.1038/nature05110
Kishino H, Hasegawa M. 1989. Evaluation of the maximum likelihood estimate of the evolutionary
tree topologies from DNA sequence data, and the branching order in hominoidea. Journal of
Molecular Evolution 29: 170-179. doi:10.1007/BF02100115
Liu Y, Steenkamp ET, Brinkmann H, Forget L, Philippe H, Lang BF. 2009. Phylogenomic analyses
predict sistergroup relationship of Nucleariids and Fungi and paraphyly of Zygomycetes with
significant support. BMC Evolutionary Biology 9: 272. doi:10.1186/1471-2148-9-272
Mortierellomycotina subphyl. nov. ... 363
Prager EM, Wilson AC. 1988. Ancient origin of lactalbumin from isozyme: analysis of DNA and
amino acid sequences. Journal of Molecular Evolution 27: 326-335. doi:10.1007/BF02101195
Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. doi:10.1093/bioinformatics/btg180
Saitou N, Nei M. 1987. The neighbor-joining method: anew method for reconstructing phylogenetic
trees. Molecular Biology and Evolution 4: 406-425.
Swofford DL. 1998. PAUP*: Phylogenetic Analysis using Parsimony (*and Other Methods). Version
4., Sinauer Associates, Sunderland, MA.
Stamatakis A. 2006. RAxML-VI-HPC: Maximum Likelihood-based phylogenetic analyses
with thousands of taxa and mixed models. Bioinformatics 22(21): 2688-2690. doi:10.1093/
bioinformatics/btl446
Stamatakis A, Hoover P, Rougemont J. 2008. A fast bootstrapping algorithm for the RAxML Web-
Servers. Systematic Biology 57: 758-771. doi:10.1080/10635 150802429642
Tanabe Y, O’Donnell K, Saikawa M, Sugiyama J. 2000. Molecular phylogeny of parasitic Zygomycota
(Dimargaritales, Zoopagales) based on nuclear small subunit ribosomal DNA sequences.
Molecular Phylogenetics and Evolution 16: 253-262. doi:10.1006/mpev.2000.0775
Tanabe Y, Saikawa M, Watanabe MM, Sugiyama J. 2004. Molecular phylogeny of Zygomycota
based on EF-1la and RPB1 sequences: limitations and utility of alternative markers to rDNA.
Molecular Phylogenetics and Evolution 30: 438-449. doi:10.1016/S1055-7903(03)00185-4
Templeton AR. 1983. Phylogenetic inference from restriction endonuclease cleavage site map
with particular reference to the evolution of humans and the apes. Evolution 37: 221-244.
doi:10.2307/2408332
Voigt K, Hoffmann K, Einax E, Eckart M, Papp T, Vagvélgyi C, Olsson L. 2009. Revision of the
family structure of the Mucorales (Zygomycetes) based on multigene-genealogies. 313-332, in
Y Gherbawy et al. (eds.), Current Advances in Molecular Mycology. Nova Science Publishers,
Inc.
Wernersson R, Pedersen AG. 2003. RevTrans — Constructing alignments of coding DNA from
aligned amino acid sequences. Nucleic Acids Research 31: 3537-3539. doi:10.1093/nar/
gkg609
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 365-368 January-March 2011
DOT: 10.5248/115.365
Three species excluded from Melanopsamma (Ascomycetes)
You-ZHI WANG
Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China
Tibet Institute of Plateau Biology, Lhasa 850008, China
CORRESPONDENCE TO:
[email protected]
AsstTract— Melanopsamma is a unitunicate ascomycete genus. However, examinations of
the holotypes of M. aggregata, M. merrillii, and M. pomiformis var. monosticha has revealed
that all were bitunicate. They are synonyms of Astrosphaeriella africana, Didymosphaeria
dimastospora, and Keissleriella sambucina, respectively.
Key worps— morphology, mycology, taxonomy
Introduction
Melanopsamma Niessl ex Sacc. is a unitunicate ascomycete genus. As
currently recognized, its main characters are superficial ascomata that are
ostiolate, glabrous, and collabent when mature; reddish brown, 2- or 3-layered
peridia; unitunicate, cylindrical, paraphysate, 8-spored asci; and ellipsoidal or
fusiform, hyaline, 1-septate ascospores.
Of the approximately 110 Melanopsamma species names listed in Index
Fungorum (2010), only 41 species are accepted in the genus (Kirk et al. 2008).
To date, nine taxa have been transferred to other genera (Index Fungorum
2010), leaving about 80 names that are either synonyms or probably do not
belong in the genus.
Most of the excluded species are bitunicate ascomycetes. The concept
of bitunicate/unitunicate asci was not introduced until 1951 (Luttrell 1951),
Before 1951 Melanopsamma included bitunicate taxa, which were otherwise
very similar to unitunicate Melanopsamma species. ‘The same situation occurred
also with the unitunicate genus Amphisphaeria (Wang et al. 2004), in which
earlier authors described many bitunicate taxa. There is no world monographic
study on Melanopsamma.
In this paper, we exclude three bitunicate Melanopsamma species from the
genus and reallocate them based on re-examination of their type specimens.
366 ... Wang
Materials & methods
Type specimens were borrowed from BPI, YAM and W. Dried material was
rehydrated in water and fruiting structures were observed using a Zeiss 2000-C dissecting
microscope. Slides of ascospores, asci, and sections of ascomata mounted in water were
examined, photographed, and measured using a Zeiss Axioplan II image microscope.
Taxonomy
Astrosphaeriella africana D. Hawksw., Sydowia 38: 116.1986 [‘1985’]. Fas 1-2.
= Melanopsamma aggregata I. Hino & Katum., Bull. Fac. Agric. Yamaguti Univ. 6: 53.1955.
SPECIMEN EXAMINED: Japan, Sakaedani, Tokuyama, on dead stems of Phyllostachys
bambusoides Siebold & Zucc. (Poaceae), 28 November 1954, I. Hino, YAM 20365,
holotype of Melanopsamma aggregata.
Ascomata immersed, erumpent, arising singly in the substrate, 650-900 um
diam., hemispherical, black, base applanate, with a central papilla (Fic. 1). Asci
bitunicate, 135-160 x 12-17 um, 8-spored, cylindrical. Ascospores 50-57 x
5.5-6.5 um, 2-3-seriate, fusiform, pale yellowish brown, 1-septate, constricted
at the septum, with longitudinal wall striations (Fic. 2).
Didymosphaeria dimastospora Sousa da Camara, Agron. lusit. 13: 123. 1951.
Fics 3-4.
= Melanopsamma merrillii H.S. Yates, Philipp. Journ. Sc. 12: 376. 1917.
SPECIMEN EXAMINED: Philippines, Alabat Island, substrate undetermined, 21 December
1916, E.D. Merrill 10554, BPI 612151, holotype of Melanopsamma merrillii.
Ascomata bitunicate, 400-600 um diam., globose, erumpent (Fic. 3). Ostiole
raised, lateral. Pseudoparaphyses filaments 1-1.5 um wide. Asci 100-135 x
9-12 um. Ascospores ellipsoidal, grey, 17-22 x 6-9 um, often widened at the
septum, 1-septate, cells equal, without ornamentation, but sometimes with
brownish gel at the poles (Fic. 4).
Notes: Didymosphaeria Fuckel was monographed by Aptroot (1995), who
accepted seven species out of 550 named taxa. The excluded taxa belong to
other similar genera, which are bitunicate or unitunicate ascomycetes.
Keissleriella sambucina (Rehm) Hohn., Sitzungsber. Kaiserl. Akad. Wiss.,
Math.-Naturwiss. K1., Abt. 1, 128: 582. 1919. Fics 5-6.
= Melanopsamma pomiformis var. monosticha Keissl., Beih.
Bot. Centrlbl., Abt. IT, 29: 400. 1912.
SPECIMENS EXAMINED: Slovenia, Carniola, on dry branch of Sorbus aria (L.) Crantz
(Rosaceae), July 1908, leg. & det. K.V. Keissler, W 1908/9129, holotype of Melanopsamma
pomiformis var. monosticha. Austria, Ybbsitz, on Cydonia japonica Pers. (Rosaceae),
March 1909, W 1939/0113, [as Melanopsamma amphisphaeria Schulzer & Sacc.]
Ascomata subglobose, semi-immersed to superficial, gregarious to crowded,
black, 300-500 um in diam., 300-450 um in height (Fic. 5). Ostiole papillate
Melanopsamma exclusions ... 367
Ficures 1-6. Fics 1-2: Astrosphaeriella africana (from holotype of Melanopsamma aggregata):
1—habit of ascomata on host surface; 2—ascospores. Fics 3-4. Didymosphaeria dimastospora
(from holotype of Melanopsamma merrillii): 3—habit of ascomata on host surface; 4—intact
ascus, ascospores. Fics 5-6. Keissleriella sambucina (from holotype of Melanopsamma
pomiformis var. monosticha): 5—habit of ascomata on host surface; 6—ascus, ascospores.
368 ... Wang
with short, blackish brown setae, not collabent. Pseudoparaphyses trabeculate.
Asci bitunicate, cylindrical, 8-spored, 110-140 x 11-13 um (Fic. 6). Ascospores
16-20 x 6-8 um, hyaline, ellipsoidal, asymmetrical with upper hemispore
wider and more obtuse than lower, 1-septate, wall smooth, constricted at the
septum (Fig. 6).
Key to the genera
la. Ascomata collabent when mature, asci unitunicate ............. Melanopsamma
1b. Ascomata not collabent, asci bitunicate ......0 0.0 ee ee ce ec eee eee 2
2a. Ascomata gregarious to crowded, ascospores ellipsoidal or fusiform,
L=miultizseptaterg. SPisesannodl cesaeitis tis) cesanee mtarterqxat elas ee ete Keissleriella
2b. Ascomata scattered 26... ccc een enn nes 3
3a. Ascospores 1-seriate, ellipsoidal, 1-septate ..................0.. Didymosphaeria
3b. Ascospores 2-3-seriate, elongate-fusiform, 1-5-septate ........... Astrosphaeriella
Acknowledgments
Drs Eric McKenzie and André Aptroot are deeply thanked for pre-submission
reviews. The author would also like to thank the curator of herbarium BPI, W, YAM,
for loan of specimens. Thanks are extended to Dr Shaun Pennycook for nomenclatural
review. This work was supported by the Funds of the Knowledge Innovation Program of
the Chinese Academy of Sciences (KSCX2-YW-Z-004).
Literature cited
Aptroot A. 1995. A monograph of Didymosphaeria. Studies in Mycology 37: 1-160.
Index Fungorum. 2010. http://www.indexfungorum.org/Names/NA MES. ASP.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth and Bisby’s dictionary of the fungi.
Tenth edition. CAB International. UK.
Luttrell ES. 1951. Taxonomy of the Pyrenomycetes. University of Missouri Studies 3: 1-120.
Wang YZ, Aptroot A, Hyde KD. 2004. Revision of the genus Amphisphaeria. Hong Kong, Fungal
Diversity Press. 168 p.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 369-373 January-March 2011
DOT: 10.5248/115.369
Tubakia seoraksanensis, a new species from Korea
Hyg YOUNG YUN’ & Amy Y. RossMAN
Systematic Mycology & Microbiology Laboratory, USDA-ARS,
Rm. 246, BOIOA, 10300 Baltimore Avenue, Beltsville, MD 20705, USA
* CORRESPONDENCE TO:
[email protected]
AsstTract — An unknown species of Tubakia was collected recently from Quercus mongolica
on Seoraksan Mountain, GangWon Province, in Korea. This species was characterized with
cultural, ITS region sequence, and morphological data. After comparison with known species
of Tubakia, this species is here described as Tubakia seoraksanensis, sp. nov.
Key worps — Ascomycota, Diaporthales, Dicarpella, forest pathogen, Sordariomycetes
Introduction
‘The anamorphic genus Tubakia B. Sutton (Diaporthales, Ascomycota) causes
leaf spot diseases on Castanea, Quercus, and various other trees and shrubs
primarily in the Fagaceae (Sinclair et al. 2005). Currently, five species are
recognized in Tubakia, namely I! castanopsidis (T. Yokoy. & Tubaki) B. Sutton,
T. dryina (Sacc.) B. Sutton, T: japonica (Sacc.) B. Sutton, T) rubra (T. Yokoy. &
Tubaki) B. Sutton, and T. subglobosa (T. Yokoy. & Tubaki) B. Sutton (Belisario
1991, Limder & Cash 1945, Sutton 1973, Yokoyama & Tubaki 1971). Tubakia
has been associated with the teleomorphic genus Dicarpella Syd. & P. Syd.
with the single species D. dryina Belisario & M.E. Barr connected to T. dryina
(Belisario 1991).
In Korea, three species of Tubakia have been reported: T. japonica on
Castanea crenata Siebold & Zucc., Quercus acutissima Carruth., and Q. aliena
Blume; I) rubra on Q. serrata Murray; and an undescribed Tubakia sp. on
Q. rubra L. (Cho et al. 2004, Lee et al. 1991,). In August 2009, specimens of
Tubakia were collected on leaves of Quercus mongolica Fisch. ex Ledeb.
(Mongolian oak) in Seoraksan Mountain, Gangwon Province, Korea. Quercus
mongolica is a mountain tree that grows on ridgelines in Korea and is resistant
to drought and wind conditions (Lee 1997). We determined that the specimens
represented a previously undescribed species of Tubakia, which we then
370 ... Yun & Rossman
analyzed using cultural, molecular, and morphological methods and compared
with known species. The new species is described below.
Materials & methods
Fungal Isolations
Diseased leaves of Quercus mongolica were collected from nature. Isolates from
fructifications were made from two different areas on the leaves, namely necrotic areas
surrounding veins and leaf spots. Cultures were grown on malt extract agar (MEA,
1.5% malt extract and 2.0% agar) at 25°C in the dark. Specimens were deposited at
the U.S. National Fungus Collections, Beltsville, Maryland, USA (BPI 880798 and BPI
880799) and cultures were deposited in CBS Fungal Biodiversity Centre, Utrecht, The
Netherlands (CBS 127490, CBS 127491, CBS 127492, and CBS 127493).
Morphological examination
Observations of microscopic structures were made from material mounted in
distilled water and measured using a compound light microscope (Axiophot, Zeiss,
Germany). Colors of cultures were described using Munsell soil color charts (Macbeth
2000).
DNA extraction, PCR, sequencing, analysis of sequence data
DNA was isolated from cultures on MYEA (2% malt extract, 0.2% yeast extract, and
1.5% agar) grown for about 10 to 14 days at room temperature. Mycelium was used for
DNA extraction using PrepMan” Ultra reagent following the manufacturer's instructions
(Applied Biosystems, Foster City, CA). The internal transcribed spacer regions 1 and 2
and the 5.8 S rDNA hereafter referred to as ITS were amplified using the primer pair,
ITS-1F and ITS4 (Gardes & Bruns 1993). Amplification of the ITS region was achieved
with initial denaturation at 85°C 2 min; 35 cycles, each consisting of denaturation at
94°C for 1 min 35 sec, annealing at 49°C for 1 min, and extension at 72°C for 1 min;
and final extension at 72°C for 15 min. PCR products were purified using QIAquick
PCR purification kit (Qiagen Inc., Valencia, CA, USA) following the manufacturer’s
instructions. Automated sequencing was performed at the Iowa State University DNA
Sequencing and Synthesis Facility (Ames, IA). Reactions were set up using Applied
Biosytems (Foster City, CA) Prism BigDye Terminator v3.1 cycle sequencing kit with
AmpliTaq DNA polymerase, FS and analyzed on an Applied Biosystems 3730 DNA
analyzer.
Sequences were deposited at GenBank sequence database (HM991734, HM991735,
HM991736, and HM991737). A GenBank Blast search was performed with the resulting
sequence data and a comparison was made to existing Tubakia ITS region sequences. All
sequences of Tubakia species were aligned and compared using the jPHYDIT program
Jeon et al. 2005).
Results: Analysis of sequence data & taxonomy
The ITS sequences from each of the four isolates were identical. The GenBank Blast
search revealed the closest identifiable match as Dicarpella dryina (= Tubakia dryina,
accession no. AY853242, culture CBS 115970) with 94% maximum identity. Additional
Tubakia seoraksanensis sp. nov. (Korea) ... 37 1
comparison with sequences of all other Tubakia species revealed a close relationship
with Tubakia japonica (unpublished data). In the ITS region alignment produced in
PHYDIT, sequences of Tubakia seoraksanensis were 98% similar to T: japonica and
97.8% similar to D. dryina (accession no. AY853242) (unpublished data).
Tubakia seoraksanensis H.Y. Yun, sp. nov. Fic. 1
MycoBank MB 519212
Coloniis in MEA similis Tubakiae japonicae coloratis, sed conidiis minoribus, 13-25 um
x 10-15 ym, differt.
Type: Korea, Gangwon, Seoraksan National Park, Seorak-dong, Sokcho-si, Gangwon-
do, on living leaves of Quercus mongolica, 31.VIII.2009, coll. Hye Young Yun. Holotype,
BPI 880799 (cultures CBS 127490, ITS GenBank HM991734; CBS 127491, ITS GenBank
HM991735); Isotype, BPI 880798 (cultures CBS 127492, ITS GenBank HM991736; CBS
127493, ITS GenBank HM991737).
EryMo.oey: referring to the type locality.
LEAF spots epiphyllous, occasionally amphigenous, 2-10 mm diam., globose
to broadly ellipsoidal on blade, at times necrotic areas ellipsoidal to fusiform,
extending along midrib or veins, pale brown, margin regular or irregular in
shape, dark brown; typically discrete, may become confluent. CoNIDIOMATA
epiphyllous, occasionally amphigenous, frequently but not always associated
with spots, scattered to gregarious, sometimes confluent, especially near veins,
superficial, easily removed from leaf surface, brown to dark brown, scutellate,
each attached to leaf by a central columella, circular or somewhat irregularly
subcircular as viewed from above, more or less plane as viewed from side.
SCUTELLA 90-160 x 90-130 tum, membranous, composed of thick-walled, pale
brown to brown, 4-6 um diam., septate hyphae radiating, typically bifurcating
up to three times from a central disc that consists of a single hyaline cell
towards margin, acute and cornute at margin that is fringed and unattached to
substrate. CONIDIOGENOUS CELLS formed on underside of scutella, radiating
downward and towards margin, 14-22 x 3-5 um, cylindrical or slightly clavate
to fusiform, narrowing to a thin point at neck, pale brown to hyaline. CoNIDIA
13-25 x 10-15 um (Q = 1.15-1.56), acrogenous, blastic, subglobose, broadly
ellipsoid to ellipsoid, hyaline, becoming pale yellowish brown, walls smooth,
thickening in age, with a prominent frill at base. Microconidia unknown.
IN CULTURE: Colony (after 10 days on MEA at 25°C in the dark) 32-44 mm
diam., low velutinous to fuzzy, wrinkled, margin with uneven growth, whitish
to pale yellow (8/1-2), reverse wrinkled, center darker, becoming progressively
paler towards margin, olive brown, light olive brown to yellow (4/3, 5/6, 8/6),
margin white (8/1), without sporulation. Mycelium branching, septate, 3.2-4.8
um diam., hyaline or slightly brownish in mass, some hyphae forming short
coils on side branches.
372 ... Yun & Rossman
Fic. 1. Tubakia seoraksanensis (a—-p, holotype; E-E, CBS 127491). a. Necrotic leaf spot and
conidiomata along leaf midrib of Quercus mongolica. B. Scutellum and conidia by light microscopy
(LM). c. Scutella and conidia by LM. p. Conidia and conidiophores by LM. £. Colony on MEA.
F. Colony reverse on MEA. (Scale bars: a = 2mm, B—c = 50 um, d = 20 um)
HaBITaT & DisTRIBUTION — Known only from Quercus mongolica at the type
locality in Seoraksan National Park, Republic of Korea.
COMMENTS — Tubakia seoraksanensis can be distinguished from all known
species of Tubakia except T. japonica by its larger conidia. In culture on MEA,
the colony color of T. seoraksanensis resembles that of T’ japonica but is readily
distinguished from the other species as illustrated in plate 2 of Yokoyama &
Tubaki (1971).
Conidial size is the primary morphological difference distinguishing
T. japonica and T! seoraksanensis, with T. japonica producing conidia that
are much larger (40-55 x 35-45 um) compared to those of T! seoraksanensis
(13-25 x 10-15 um). Yokoyama & Tubaki (1971) noted that the sizes of scutella,
columellae, and conidia and hosts are useful in differentiating species. As with
Jones & Holcomb (1978), Glawe & Crane (1987), and Taylor (2001), we found
columellar characters untenable due to difficulty in observing these fragile
structures and unreliable historical data.
Isolates of T. seoraksanensis from the different parts of the leaves (e.g., leaf
blades or surrounding veins) produced identical sequences and conidiomatal
morphology. However, necrotic areas surrounding veins tended to extend some
distance along veins, be more irregular in shape, and were associated with a
greater number of epiphyllous and hypophyllous conidiomata. ‘The leaf spots
on the leaf blades tended to be more confined in size, more regularly circular
Tubakia seoraksanensis sp. nov. (Korea) ... 373
in shape, and associated with a smaller number of epiphyllous and especially
hypophyllous conidiomata.
Acknowledgments
We would like to thank several people at Iowa State University including Tom
Harrington and Dave Volkers for kind assistance, Doug McNew for technical support,
and Gary Polking for support at the DNA Sequencing and Synthesis Facility. We would
like to express thanks to our reviewers, Svetoslav Bobev and Luis C. Mejia.
Literature cited
Belisario A. 1991. Dicarpella dryina sp. nov., teleomorph of Tubakia dryina. Mycotaxon 41:
147-155.
Cho WD, Shin HD (eds). 2004. List of plant diseases in Korea, Fourth Edition. Korean Society of
Plant Pathology.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity of basidiomycetes: application
to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118. doi:10.1111/j.1365-
294X.1993.tb00005.x
Glawe DA, Crane JL. 1987. Illinois fungi XIII. Tubakia dryina. Mycotaxon. 29: 101-112.
Jeon YS, Chung H, Park S, Hur I, Lee JH, Chun J. 2005. jPHYDIT: a JAVA-based integrated
environment for molecular phylogeny of ribosomal RNA sequences. Bioinformatics 21:
3171-3173. doi:10.1093/bioinformatics/bti463
Jones JP, Holcomb GE. 1978. Conidium ontogeny and cytology of Tubakia dryina from Louisiana
hardwoods. Mycologia 70: 1212-1216. doi:10.2307/3759319
Lee KJ. 1997. Tree physiology. Seoul National University Publishing.
Lee YH, Cho WD, Kim WK, Jin KS, Lee EJ. 1991. Report on host-unrecorded diseases identified
from economical crops in Korea. Res. Rep. Rural Develop. Admin. 33: 15-19.
Limber DP, Cash EK. 1945. Actinopelte dryina. Mycologia 37: 129-137. doi:10.2307/3754856
Macbeth G. 2000. Munsell Soil Color Charts. Gretag Macbeth, New Windsor, NY.
Sinclair WA, Lyon HH, Johnson WT. 2005. Diseases of trees and shrubs, Second edition. Comstock
Publishing, USA.
Sutton BC. 1973. Tubakia nom. nov. Trans. Brit. Mycol. Soc. 60: 164-165. doi:10.1016/S0007-
1536(73)80077-4
Taylor J. 2001. Pycnothyrium ultrastructure in Tubakia dryina. Mycol. Res. 105: 119-121.
doi: 10.1017/S0953756200003099
Yokoyama T, Tubaki K. 1971. Cultural and taxonomical studies on the genus Actinopelte. Inst.
Fermentation, Osaka, Res. Comm. 5: 1-77. doi:10.1007/BF0205 1502
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 375-382 January-March 2011
DOT: 10.5248/115.375
Two new species of Hymenochaete (Hymenochaetales) from China
SHUANG-Hu!1 HeE* & Har-JIAo LI
Institute of Microbiology, RO. Box 61, Beijing Forestry University,
Beijing 100083, China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Two new species, Hymenochaete megaspora and Hymenochaete acerosa are
described from Xizang Autonomous Region (Tibet), China. Hymenochaete megaspora
distinguishes from other species by its large basidiospores and heavily encrusted setae; while
Hymenochaete acerosa is unique for its acerose setae, loosely interwoven hyphae and relatively
large basidiospores.
Key worps — Hymenochaetaceae, taxonomy, wood-inhabiting fungi
Introduction
Hymenochaete is one of the important genera in Hymenochaetaceae. ‘This
group of wood-decaying fungi has been studied by several authors in China,
who recorded 39 taxa from the country (Dai et al. 2000, Xu et al. 2003, Zhang
& Dai 2005, Dai & Niemela 2006, Dai 2010, 2011, He 2010). Dai (2010a)
revised the genus in China systematically and illustrated 23 species. However,
in comparison with the total number of known species worldwide (ca. 110), the
genus is still poorly known in China, and many species remain undiscovered.
Xizang Autonomous Region (Tibet) and its adjacent areas are largely
unknown mycologically. Despite reports on polypores in the region by Dai et
al. (2004, 2007a, b) and Yuan & Dai (2008), many species of other groups of
wood-decaying fungi are still unrecorded. Recently, during a survey of wood-
inhabiting fungi in Xizang Autonomous Region approximately 100 specimens
of Hymenochaete were collected. Two species are distinctly different from
known species of the genus. Therefore they are described as new species in this
paper.
Materials & methods
Voucher specimens are deposited in the herbarium of Beijing Forestry University
(BJFC), and the microscopic procedure follows Cui & Dai (2008). In the text the
376 ... He & Li
following abbreviations are used: L = mean spore length (arithmetical average of all
spores), W = mean spore width (arithmetical average of all spores), Q = variation in the
L/W ratios between the specimens studied (quotient of the mean spore length and the
mean spore width of each specimen), n = the number of spores measured from given
number of specimens. In presenting the size range of spores, 5% of the measurements
were excluded from each end of the range, and the measurements were given in
parentheses. IKI stands for Melzer’s reagent, KOH for 5% potassium hydroxide, and
CB is the abbreviation of Cotton Blue. IKI- = inamyloid and nondextrinoid, CB- =
acyanophilous. Special color terms follow Petersen (1996).
Taxonomy
Hymenochaete megaspora $.H. He & Hai J. Li, sp. nov. Fics. 1-2
MycoBank MB 519354
Carpophorum annuum, effusum vel effuso-reflexum, margine leviter elevatum, laxe
adnatum, coriaceum, in sicco durum fragileque, 150-600 um crassum. Superficies pilei
griseo-brunnnea vel atro-grisea, tomentosa, concentrice sulcata et zonata. Hymenophorum
laeve vel tuberculatum, submurinum vel vinaceo-griseum. Cortex, tomentum et stratum
hypharum adsunt; cortex ex hyphis agglutinatis compositus, 10-25 um crassus. Systema
hypharum monomiticum, hyphae generativae sine fibulis, hyalinae vel flavo-brunneae,
tenuiter tunicatae vel crasse tunicatae, interdum septatae, rare ramosae, plus minusve
intertextae, 2-4 um diam; setae in hymeniis stratosis abundae, subulatae, acutae, parte
superiore cum crystallis incrustatae, (80-)90-120(-140) x 8-13(—14) um; cystidia desunt;
hyphidia hyalina, 2-3 um in diam; basidia clavata, 4 sterigmatibus praedita, 25-32 x 5-8
uum; sporae late ellipsoideae, IKI-, CB-, (7-)7.5-10(-11) x 5-7 um.
Type: China. Xizang Autonomous Region, Linzhi County, Lulang, alt 3700 m, on dead
branch of Quercus (Fagaceae), 17.1X.2010 He 328 (Holotype, BJFC).
ETYMOLOGY: megaspora, refers to the large basidiospores.
Fruirsopy: Annual, effused or effused-reflexed with slightly elevated margins,
loosely adnate, easily detached, coriaceous without odour or taste when fresh,
becoming hard and brittle when dry, 150-600 um thick, resupinate part up to
7cm long, reflexed part short and broad, projecting 0.1-0.4 cm. Pileal surface
grayish brown to dark gray, silky, tomentose, concentrically sulcate and zonate;
margin thin, lighter than pileal surface. Hymenophore smooth or tuberculate,
slightly irregularly cracked when old, pale mouse-gray to vinaceous gray;
resupinate margin thinning out, indistinct, silky, slightly fimbriate, lighter than
hymenophore, cinnamon to yellowish brown, up to 0.5 cm.
HYPHAL STRUCTURE: Hyphal system monomitic; generative hyphae without
clamp connections; tissue darkening but otherwise unchanged in KOH.
SUBICULUM: Cortex, tomentum and hyphal layer present. Cortex composed
of strongly agglutinated hyphae, 10-25 um. Setal layer thickening in old
specimens, sometimes a hyphal layer present between rows of setae. Generative
hyphae hyaline to yellowish brown, thin- to distinctly thick-walled with a
Hymenochaete spp. nov. (China) ... 377
Fic. 1. Fruitbody of Hymenochaete megaspora (He 302, paratype).
narrow lumen, occasionally septate, rarely branched, regularly arranged, more
or less interwoven, 2-4 tm in diam.
STRATIFIED HYMENIUM: Hyphae in this layer similar to those in subiculum,
yellowish to yellowish brown, thick-walled, more or less agglutinated,
interwoven, 2-3.5 um in diam. Setae abundant, subulate, dark brown, thick-
walled with a wide or narrow lumen; tip acute, always encrusted with small
crystals; setae projecting up to 80 um above the hymenium, (80-)90-120(-140)
x 8-13(-14) um; cystidia absent; hyphidia present in sterile specimens, hyaline,
slightly conical, 2-3 wm in diam; basidia clavate, with four sterigmata and a
simple septum at base, 25-32 x 5-8 um; basidioles in shape similar to basidia,
but smaller.
Spores: Basidiospores broadly ellipsoid, hyaline, thin-walled, smooth, IKI-,
CB-, (7-)7.5-10(-11) x 5-7 um, L = 8.59 um, W = 5.94 um, Q= 1.40-1.50 (n
= 60/2).
ADDITIONAL SPECIMENS (PARATYPES) EXAMINED: CHINA. X1IzZANG AUTONOMOUS
ReGIon, Linzhi County, Lulang, alt 3700 m, on dead branch of Quercus (Fagaceae),
16.IX.2010 He 302; 18.1X.2010 He 334; Bomi County, on dead branch of Quercus
(Fagaceae), 19.1X.2010 He 351 (Paratypes, BJFC).
RemaRKs: Hymenochaete megaspora is characterized by large and broadly
ellipsoid basidiospores, encrusted setae, and the presence of a cortex. Its
basidiospores are similar to those of H. gigaspora D.A. Reid (6.5-8.5 x 5.2-6.5
378 ... He & Li
—
10 ym
Fic. 2. Microscopic structures of Hymenochaete megaspora (drawn from the holotype).
a: Basidiospores. b: Basidia and basidioles. c: Setae. d: Hyphae from subiculum.
Hymenochaete spp. nov. (China) ... 379
um), but H. gigaspora differs in having smaller setae without encrustation (75-
100 x 5-10 um), and lacking a cortex and tomentum (Léger 1998, Parmasto
2005). Another similar species, H. tabacina (Sowerby) Lév., which also has
encrusted setae and a cortex, can be distinguished by its smaller basidiospores
(4.5-7 x 1.2-2.2 um) and presence of setal hyphae (Parmasto 2001).
Macroscopically, Hymenochaete megaspora is similar to H. rigidula Berk.
& M.A. Curtis, which is another common species on Quercus in Xizang
Autonomous Region. However, H. rigidula has shorter setae (40-60 x 7-12
um) and smaller basidiospores (3.7-5 x 1.5-2.3 um, Parmasto 2001).
Hymenochaete acerosa S.H. He & Hai J. Li, sp. nov. Fics. 3-4
MycoBank MB 519355
Carpophorum annuum, effusum, adnatum, molle, 200-600 um crassum. Hymenophorum
laeve, azonatum, non crevisum, cinnamomeum vel flavo-brunneum. Cortex et tomentum
desunt, stratum hypharum adest. Systema hypharum monomiticum, hyphae generativae
non fibulatae, in subiculo hyalinae vel flavo-brunneae, crasse tunicatae, ad angulum 90°
frequanter ramosae, septatae, laxe intertextae, 2-5 um diam; setae in hymeniis stratosis
numerosae, flavo-brunneae, acerosae, acutae, interdum curvatae vel leviter sigmoideae,
(55-)85-170(-180) x 5-8(-9) um; hyphidia et cystidia desunt; basidia clavata, 4
sterigmatibus praedita, 13-21 x 5-8 um, ad basim uniseptata; sporae ellipsoideae vel late
ellipsoideae, hyalinae, tenuiter tunicatae, laeves, IKI-, CB-, (6.5-)7-8.5(-9) x (4.6-)4.8-6
um.
Type: China. Xizang Autonomous Region, Linzhi County, Lulang, alt 3700 m, on dead
angiosperm branch, 18.[X.2010 He 344 (Holotype, BJFC).
ETYMOLOGY — acerosa, refers to the acerose setae.
Fic. 3. Fruitbody of Hymenochaete acerosa (He 344, holotype).
380 ... He & Li
sa (drawn from the holotype).
s. c: Setae. d: Hyphae from subiculum.
f Hymenochaete acero.
nd basidiol
Hymenochaete spp. nov. (China) ... 381
FruiTBopy: Annual, effused, adnate, detachable, soft, first as small colonies,
later confluent up to 15 cm or more in longest dimension, 200-600 tum thick.
Hymenophore smooth, azonate, cinnamon to yellowish brown, usually
not cracked; margin thinning out, indistinct, byssoid, concolorous with
hymenophore.
HYPHAL STRUCTURE: Hyphal system monomitic; generative hyphae without
clamp connections; tissue darkening but otherwise unchanged in KOH.
SUBICULUM: Cortex and tomentum absent, hyphal layer present. Generative
hyphae hyaline to yellowish brown, thick-walled with a wide lumen, frequently
branched at a right angle, with numerous simple septa, loosely interwoven, 2-5
uum in diam.
STRATIFIED HYMENIUM: Hyphae in this layer similar to those in subiculum,
yellowish to yellowish brown, thick-walled, more or less agglutinated,
interwoven, 2-4 uum in diam. Setae numerous, yellowish brown, acerose with
acute tip, sometimes curved or slightly sigmoid, projecting up to 100 um above
the hymenium, (55-)85-170(-180) x 5-8(—9) tm; cystidia and hyphidia absent;
basidia clavate, with four sterigmata and a simple septum at base, 13-21 x 5-8
tum; basidioles in shape similar to basidia, but smaller.
Spores: Basidiospores ellipsoid or broadly ellipsoid, hyaline, thin-walled,
smooth, IKI-, CB-, (6.5-)7-8.5(-9) x (4.6-)4.8-6 um, L = 7.69 um, W = 5.30
pum, Q= 1.40-1.50 (n = 60/2).
ADDITIONAL SPECIMENS (PARATYPES) EXAMINED: CHINA. X1zZANG AUTONOMOUS
REGION, Linzhi County, Lulang, alt 3700 m, on dead angiosperm branch, 18.IX.2010 He
338; 25.IX.2010 He 399 (Paratypes, BJFC).
Remarks: Hymenochaete acerosa is distinguished by the very long and narrow
(acerose) setae, large basidiospores, and loosely inter wove hyphae. It is similar
to H. depallens Berk. & M.A. Curtis, which also has long setae and loosely
interwove hyphae; however, the new species differs in having narrower setae
(85-170 x 5-8 um vs. 80-150 x 9-13 um), larger basidiospores (7-8.5 x
4.8-6 um vs. 6-7.3 x 3.7-4.2 um), and an uncracked hymenophore (Léger
1998, Parmasto 2005).
Hymenochaete acerosa is superficially similar to H. cinnamomea (Pers.) Bres.,
which differs in having shorter setae (70-120 x 5-9 um), smaller basidiospores
(4.5-6.5 x 1.8-2.8 um), and always stratified hyphal and setal layer (Léger 1998,
Parmasto 2001).
Acknowledgments
The authors would like to express their deep thanks to Prof. Yu-Cheng Dai (Institute
of Applied Ecology, Chinese Academy of Sciences) and Dr. Jun-Feng Liang (Chinese
Academy of Forestry) for serving as pre-submission reviewer; to Prof. Jian-Yun Zhuang
(Institute of Microbiology, Chinese Academy of Sciences) for Latin corrections. This
382 ... He & Li
study was supported by the Beijing Forestry University Young Scientist Fund (No.
BLX2009023); the Fundamental Research Funds for the Central Universities (No.
YX2010-22); the National Natural Science Foundation of China (No. 31000006).
Literature cited
Cui BK, Dai YC. 2008. Wood-rotting fungi in eastern China 2. A new species of Fomitiporia
(Basidiomycota) from Wanmulin Nature Reserve, Fujian Province. Mycotaxon 105: 343-348.
Dai YC. 2010. Hymenochaetaceae (Basidiomycota) in China. Fungal Diversity 45: 131-343.
doi: 10.1007/s13225-010-0066-9
Dai YC. 20111. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience
52: 69-79. doi:10.1007/s 10267-010-0068-1
Dai YC, Niemela T. 2006. Hymenochaetaceae in China: hydnoid, stereoid and annual poroid genera,
plus additions to Phellinus. Acta Botanica Fennica 179: 1-78.
Dai YC, Zhang XQ, Zhou TX. 2000. Changbai wood-rotting fungi 12. Species of Hymenochaete
(Basidiomycota). Mycotaxon 75: 445-450.
Dai YC, Wei YL, Wang Z. 2004. Wood-inhabiting fungi in southern China 2. Polypores from
Sichuan Province. Annales Botanici Fennici 41: 319-329.
Dai YC, Wei YL, Yuan HS, Huang MY, Penzina T. 2007a. Polypores from Altay and Tian Mts. in
Xinjiang, northwest China. Cryptogamie Mycologie 28: 269-279.
Dai YC, Yu CJ, Wang HC. 2007b. Polypores from eastern Xizang (Tibet), western China. Annales
Botanici Fennici 44: 135-145.
He SH. 2010. Hymenochaete (Hymenochaetales) in Hainan. Mycosystema 29: 835-839.
Léger JC. 1998. Le genre Hymenochaete Léveillé. Bibliotheca Mycologica 171: 1-319.
Parmasto E. 2001. Hymenochaetoid fungi (Basidiomycota) of North America. Mycotaxon 79:
107-176.
Parmasto E. 2005. New data on rare species of Hydnochaete and Hymenochaete (Hymenochaetales).
Mycotaxon 91: 137-163.
Petersen JH. 1996. Farvekort. The Danish Mycological Society’s colour-chart. Foreningen til
Svampekundskabens Fremme, Greve. 6 pp.
Xu SZ, Zhou TX, Wang L, Yao XL, Zhai JW. 2003. A note on the species and new records of
Hymenochaete Lév in Yunnan. Journal of Southwest Forestry College 23: 53-58. (in Chinese).
Yuan HS, Dai YC. 2008. Polypores from northern and central Yunnan Province, Southwestern
China. Sydowia 60: 147-159.
Zhang XQ, Dai YC. 2005. Flora fungorum sinicorum, vol. 29, Hymenochaetaceae. Science Press,
Beijing, 205 pp. (in Chinese).
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 383-400 January-March 2011
DOT: 10.5248/115.383
Rare or little known corticioid basidiomycetes
from southern Belarus
EUGENE YURCHENKO ** & HEIKKI KOTIRANTA ?
'V.E. Kuprevich Institute of Experimental Botany, Akademichnaya str. 27,
Minsk, BY-220072, Belarus
2 Finnish Environment Institute, Natural Environment Centre, RO. Box 140,
Helsinki, F-00251, Finland
CORRESPONDENCE TO *: “
[email protected] e& *heikki.kotiranta@ymparisto,fi
ApsTRACT — Six non-poroid resupinate homobasidiomycete species, collected within
the borders of Paleskaya Physiographic Province, or Polesia (Belarus), are described and
illustrated: Crustodontia chrysocreas, Hyphoderma cryptocallimon, H. transiens, Oliveonia
citrispora, Trechispora caucasica, T: minuta. According to the known distributional data, these
taxa are rare or exceptionally rare in Belarus and other European countries; they are, except H.
transiens, reported from Belarus for the first time. Distinctive characters and morphological
differences from similar-looking species are discussed.
Key worps — Basidiomycota, Corticiaceae, geography, morphology
Introduction
This paper continues a series on rare corticioid fungi from Belarus. Two
previous publications were devoted to the species found in central (Yurchenko
& Kotiranta 2006) and northern (Yurchenko & Kotiranta 2007) parts of the
country. The species described here were found in southern Belarus and are
rare or very rare in Belarus and most of the other European countries. The
morphology of these species, except Crustodontia chrysocreas, is relatively little
documented, and thus additional descriptions are needed.
Materials & methods
The material was collected from Paleskaya Province, or province No.845 according
to the European decimal physiographic division (see Klitsunova et al. 2002). In
geographical literature this area is better known as Belarusian part of Polesia Lowland or
Belarusian Palesse (Fic. 1). The corresponding author collected most of the specimens
in 2006 and 2007; otherwise the collector’s name is indicated.
384 ... Yurchenko & Kotiranta
124°E
Fic. 1. Study area and collection sites: a, contour of the Republic of Belarus and Paleskaya Province
(province No. 845, according to the European decimal physiographic division); b, collection sites,
northern border of the Province and the borders of Belarus administrative districts (site numbers
are the same as mentioned in SPECIMENS EXAMINED).
The macromorphology was described from dry samples. For micromorphological
measurements and drawings the material was mounted in 3% KOH water solution or
in distilled water to observe crystals; Melzer’s reagent (Mz’s) was used to test amyloidity
or dextrinoidity, and Cotton Blue (CB; 0.1% Cotton Blue in 60% lactic acid) to test
for cyanophily. The studied samples are deposited in the Herbarium of V-F. Kuprevich
Institute of Experimental Botany (MSK-F); duplicates are also deposited in the reference
herbarium of Heikki Kotiranta (H.K.) and one in the University of Oslo Herbarium
(O).
Species descriptions
Crustodontia chrysocreas (Berk. & M.A. Curtis) Hjortstam & Ryvarden Fic. 2
BasIDIOMA totally effused, closely adnate, about 10 x 5 cm, 50-100 um
thick in dry state, ceraceous or subcartilaginous, somewhat fissured in dry
state; hymenophore greyish ochraceous with orange tint, under the lens slightly
pruinose, with the naked eye like grayish bloom, smooth or with minute,
quite scattered, blunt warts. MARGIN concolorous, thinning out. SUBICULUM
rather thin and subhymenium thick; subhymenium with pigmented resinous
inclusions. HyPHAL sYsTEM monomitic, hyphae clamped at all septa. Subicular
hyphae moderately branched, more or less sinuous, even or with swellings,
2.2-4.1 tum wide, hyaline, thin- to slightly thick-walled, smooth. Subhymenial
hyphae densely branched, short-celled, densely packed and forming a
pseudoparenchymatic tissue, 2-3 um wide, with swellings up to 4 um wide,
Unusual corticioids from Belarus... 385
hyaline, thin- or slightly thick-walled, smooth. HyMENIUM consisting of
densely palisade-arranged cells, with brownish resinous excretions in between.
CYSTIDIOLES (leptocystidia) fusoid, blunt, about 20 um long, 2.3-4.3 um wide,
projecting 6-8 um above the hymenium, hyaline, thin-walled, naked or apically
with capitate, pale brownish or yellow encrustations, 2.2-6.7 um in diam.
Basip1a cylindrical or narrowly clavate, 16-21 x 3.8-4.2 tm, hyaline, thin-
walled, with 4 sterigmata 6-6.5 x 0.8 um. BAsIDIosPoREs narrowly ellipsoid,
(3.7-)4.2-4.7(-5.5) x (2-)2.2-2.3 um, mostly slightly thick-walled, hyaline or
subhyaline, with very small apiculus, Mz’s-negative, acyanophilous.
SPECIMEN EXAMINED—BELARUS. Homel’ voblast’: Lel'chytsy district, in vicinity of
Baravoe village (site 5), on decorticated fallen wood of Quercus robur L. in Quercus
forest of Vaccinium myrtillus type, coll. E.P. Komarova 22 VIII 1963 (MSK 10574; H.K.;
O).
Crustodontia chrysocreas is distinguished by its slightly warted hymenial surface,
usually ochraceous hymenium with orange and brownish hues, short-celled,
and tightly packed hyphae in textura intricata, which gives the basidioma a
cartilaginous consistency (Lombard et al. 1975 as ‘Phlebia chrysocrea (Berk. &
M.A. Curtis) Burds? Domariski 1991 as “Ph. chrysocreas’). Our specimen fits
C. chrysocreas in colour, hymenial configuration, basidioma texture,
leptocystidia, basidia, and spore morphology. However, we did not observe
microbinding hyphae or the waxy, yellow substance described by Lombard et
al. (1975) in the substratum under the basidioma. Moreover, no parts of the
fungus turned red in 3% KOH, which is characteristic for American (Lombard
et al. 1975), Hawaiian (Gilbertson & Adaskaveg 1993), and Japanese (Maekawa
1993) material. Microbinding hyphae were not observed in Asian material (Wu
1990 as ‘Amethicium chrysocreas (Berk. & M.A. Curtis) Sheng H. Wu} Maekawa
1993), Abundant yellowish (but not orange brown, as in the American samples)
granular material was found in subhymenium and especially hymenium, but
absent in subiculum. The colour differences and the absence of KOH reaction
is probably due to the long-time storage of the specimen in herbarium.
Remarkably, in his original description of Corticium chrysocreas Berk. & M.A.
Curtis, Berkeley stated, “subiculum bright yellow” (Berkeley 1873: 178), but
Maekawa (1993) described the fungus as pale yellow in section. Our sample has
smaller (although similarly shaped) cystidia compared with those described
by Lombard et al. (1975) and Maekawa (1993). The material described from
Hawaii (Gilbertson & Adaskaveg 1993) had oblong to cylindrical spores and
remarkable hyphal elements with vesicular apices up to 22 um wide, which are
absent in our sample.
‘The species is new for Belarus and the record is the northernmost (51.7°N)
known in the world. It has a pantropical distribution and is exceptionally rare
in Europe, earlier collected in France (Bourdot & Galzin 1928), Poland, and
386 ... Yurchenko & Kotiranta
x GOO CI VOR O%, a
TO ee
iu Nas See
( foiess Sail
50 pm
eld
0869)
5 pm
Fic. 2. Crustodontia chrysocreas (MSK 10574): a, vertical section through basidioma; b, subicular
hyphae close to the substratum; c, portions of hymenium and subhymenium; d, cystidia and
basidioles; e, basidia; f, basidiospores.
Ukraine (Bernicchia & Gorjén 2010). The species has been reported from
southeastern and eastern USA (Lombard et al. 1975 - 10 localities), Costa
Rica (K.-H. Larsson 2010, pers. comm.), Caribbean Islands (Minter et al. 2002
- 18 records), Venezuela (Minter 2010), six countries of equatorial Africa
Unusual corticioids from Belarus ... 387
(Hjortstam et al. 1993, Roberts 2000), Sri Lanka (Lombard et al. 1975), southern
and southeast China (Dai et al. 2004, Dai 2010), Taiwan (Lin & Chen 1990,
Wu 1990), Japan (Maekawa 1993 - 8 localities; Kubayashi & Maekawa 2001),
Hawaii (Gilbertson & Adaskaveg 1993), Brunei (Hjortstam et al. 1998), western
Australia (Hjortstam et al. 2009), New Zealand (Pennycook & Galloway 2004).
We suppose, in accordance with Hjortstam et al. (2009), that the material from
different isolated landmasses is heterogeneous, comprising several species,
which is reflected in differences in descriptions.
Hyphoderma cryptocallimon B. de Vries Fi. 3
BAsIDIOMA effused, closely adnate, subceraceous, several cm long, 0.1-0.2
mm thick, smooth and continuous to porulose, especially towards the margin,
cream- or pale coloured. Marcin diffuse. HyPHAL sysTEM monomitic.
Subicular hyphae clamped, moderately branched, 2-3.7 ttm wide, hyaline, thin-
walled. CysTIpIA scattered, projecting up to 65-100 um above the hymenium,
cylindrical or with some dilatations towards the base and/or to the apex, apically
occasionally subcapitate or with a small resinous cap, non-septate or seldom
with 1-3 adventitious septa, 70-90(-125) x 5.5-9.2 um, hyaline, apically thin-
walled, at the base slightly or distinctly thick-walled (to 1 um). HypHrpia
numerous in some hymenial areas, cylindrical, hyaline, thin-walled, straight
to sinuous, 1.5-2.3 um wide, projecting up to 5-15 um. BAsIDIOLEs often rich
in oil-drops. Basip1a subcylindrical or narrowly clavate, hyaline, thin-walled,
rich of oily inclusions, (30-)45-50 x 7-10.3 um, with (2)4 sterigmata 6.5-9 x
1.3-1.7 um, some sterigmata basally with an oily inclusion, with attenuated
to hair-like tip when mature. BAstpIosporEs narrowly ellipsoid to oblong,
sometimes narrowing to the base, (8.5-)9.5-11(-13.5) x (4.5-)5-5.5(-6.7) um,
hyaline, often with a large, strongly refractive oil drop, thin-walled, smooth,
with rather narrow, distinct apiculus, inamyloid, acyanophilous.
SPECIMEN EXAMINED—BELARUS. Homel’ voblast’: Lel’chytsy district, in vicinity of
Simanichy village (site 3), on fallen decorticated branch of Pinus sylvestris L. in Pinus
forest of Pleurozium type, coll. 9.X1.2007 (MSK 6904; H.K.). The fungus is mixed with
Tubulicrinis subulatus (Bourdot & Galzin) Donk basidioma, and grew over it.
Eriksson & Ryvarden (1975: 543) first diagnosed this taxon under the name
Hyphoderma sp. de Vries 488, based on asingle sample from northwest Germany.
Nakasone & Gilbertson (1982: 603-605) described a new species in the genus
Crustoderma, C. opuntiae Nakasone & Gilb., from Arizona, with the notation
that it is morphologically similar to Hyphoderma sp. de Vries 488. However, we
see several differences between the C. opuntiae and H. cryptocallimon diagnoses
that do not support their synonymy: C. opuntiae has floccose subiculum with
moderately thick-walled hyphae, somewhat flexuose cystidia, narrower basidia
(6-7 wm) of narrowly clavate shape, narrower spores (4-5 um wide), and
388 ... Yurchenko & Kotiranta
0-0 .00
Fic. 3. Hyphoderma cryptocallimon (MSK 6904): a, subicular hyphae; b, cystidia; c, basidioles;
d, basidia; e, basidiospores.
O
EM
negative oxidase test, indicating a brown rot activity, whereas the members of
the genus Hyphoderma are white rot fungi.
Hyphoderma cryptocallimon is morphologically close to H. obtusiforme
J. Erikss. & A. Strid, differing from it by shorter basidiospores, much longer
and projecting cystidia that are often distally slightly clavate and basally with
thickened or thick walls and sometimes with adventitious septa, and somewhat
Unusual corticioids from Belarus ... 389
larger and slightly more sinuous basidia (25-70 x 7-10 um), usually with many
guttules (Eriksson & Ryvarden 1975, de Vries 1987). Cystidia in H. obtusiforme
are 50-80 um long, thin-walled and not subclavate; besides, they often have
dense protoplasm in the distal part. The spore size in H. cryptocallimon is noted
as 7-12 x 4.5-7 um, whereas spores are 10-14 x 5-7 um in H. obtusiforme
(Eriksson & Ryvarden 1975, de Vries 1987). There is also a presumed ecological
distinction: H. cryptocallimon prefers habitats on poorer sandy soils, which is
seen at least from the finds described by de Vries and from our finding. Some
spores in our material were longer than 12 tm, thus approaching the spore size
of H. obtusiforme. Moreover, our sample has many cylindrical cystidia, only
some of which expanded slightly toward the apex; some cystidia are subcapitate,
uncommon for H. cryptocallimon.
The species is new for Belarus and known from a single locality.
H. cryptocallimon was described on Juniperus communis from northwest
Germany and reported also from southern Sweden and the Netherlands (de
Vries 1987), Italy on Juniperus and Pinus (Bernicchia 2000, Bernicchia et al.
2007a), Zakarpats’ka oblast in Ukraine (Kiiffer et al. 2004), Britain including
Northern Ireland (Kirk & Cooper 2009), and Belgium and Spain (Bernicchia
& Gorjén 2010).
Hyphoderma transiens (Bres.) Parmasto Fic. 4
BAsIDIOMATA totally effused, more or less closely adnate, 5 cm or more in
extent, 50-130 um thick between the teeth, subceraceous, cream-coloured.
HyMENOPHORE odontioid, at basidioma periphery partly smooth or minutely
porulose; teeth tuberculate-flattened at the periphery of the basidioma, in the
center conical or cylindrical, brownish or dark ochraceous, glossy, fragile,
up to 0.4 mm long and 0.2 mm wide, simple or slightly branched, obtuse or
acute, smooth or apically short-setaceous; with age or when dry basidioma
minutely cracked. MARGIN farinaceous, diffuse, in some areas almost mould-
like (short-fibrillose), whitish or cream-coloured, 0.3-0.7 mm wide. HYPHAL
SYSTEM monomitic, hyphae clamped at all septa. Subicular hyphae moderately
branched, more or less loosely interwoven, 2-3.7 um wide, hyaline, thin- to
slightly thick-walled, smooth or sparsely encrusted (in KOH). Tooth trama
with abundant yellowish, coarse crystalline material (in water); apical hyphae
of the teeth often forming clusters, individual hyphae 1.3-3.5 um wide.
Subhymenial hyphae moderately branched, more or less vertically arranged,
2-2.5 um wide, hyaline, thin-walled, richly covered with aggregations of
yellowish coarse crystalline material, not dissolved in KOH. Cystip1a rare
or scattered, more or less embedded, subcylindrical, 40-95 x 7-9(-10) um,
subhyaline, thin-walled, in KOH smooth. Basip1a irregularly clavate, 25-30
(-38) x 5.7-6.7 «um, hyaline, thin-walled, smooth or basally encrusted, with 2-4
sterigmata, initially stout and obtuse, when mature conical or subulate, 6.5-9.5
390 ... Yurchenko & Kotiranta
Fic. 4. Hyphoderma transiens (MSK 3965): a, view of odontioid hymenophore; b, subicular hyphae;
c, cystidia; d, basidia; e, basidiospores.
x 1.5-1.8 um. Basiprosporss cylindrical, adaxially straight or slightly concave,
occasionally gently sigmoid, 8.5-12 x 2.7-4.1 «um, thin-walled, colourless, with
small dispersed oil drops, with short and blunt, sometimes not pronounced
apiculus, Mz’s-negative, acyanophilous.
SPECIMENS EXAMINED—BELARUS. Homel’ voblast: Zhytkavichy district, in the
vicinity of Naida village (site 1), on fallen corticated branch of Corylus avellana L. and
unidentified deciduous tree in Alnus glutinosa forest of Urtica type, coll. A. Golovko
21.VIIL.1967 (MSK 10505a, 10505b); Lelchytsy district, in the vicinity of Baravoe village
(site 5), on fallen decorticated wood of Populus tremula L. in Alnus glutinosa forest of
Sphagnum type, coll. E.P. Komarova 17.VIII.1963 (MSK 3965).
Unusual corticioids from Belarus... 391
Distinctive characters of H. transiens are the odontioid hymenophore, which
smoothens towards the basidioma periphery, crystal-rich aculeal trama, the
presence of scattered, almost immersed subcylindrical cystidia (Maekawa
1994), and relatively narrow basidiospores. The hymenophore colour is usually
pale ochraceous and varies little even between samples from different continents
(Hjortstam & Ramos Bononi 1987, Maekawa 1994). Other authors (Nikolajeva
1961 as “Odontia transiens Bres?, Hjortstam & Ramos Bononi 1987, Maekawa
1993: 12 as ‘H. longosporum (H. Furuk.) N. Maek3 1994: 65) noted longer
basidiospores (< 13-15 um). Nikolajeva (1961) described also cylindrical,
spindle-shaped or slightly capitate apically encrusted (rough) cystidia, which
were not observed by us. The same author described the hymenophore as warted
with warts having penicillate apices, whereas our material is irregularly warted
to irregularly short-aculeate, with barely pronounced or absent penicillate
projections at aculei apices. A morphologically close species is H. roseocremeum
(Bres.) Donk, but it differs by a smooth hymenophore.
Hyphoderma transiens was published for the first time from Belarus from the
northwestern part of the country (Yurchenko 2008). Two other known sites are
in the southern part, but the species has not been recollected there since 1967.
The species is common in the Mediterranean and frequent on Quercus in Italy
(Bernicchia et al. 2007b, 2008) and has been reported from many other warm
regions: southern Brazil (Hjortstam & Ramos Bononi 1987), Azores (Telleria et
al. 2009a,b - common), Madeira (Telleria et al. 2008), Krasnodar krai of Russia,
Georgia, Azerbaijan, northeast Turkey, northern Iran (Ghobad-Nejhad et al.
2009), north-central China (Dai et al. 2004, Dai 2010), Japan (Maekawa 1994).
In the more northern areas there are records from the Carpathians and the
Forest Steppe Zone of Ukraine (Nikolajeva 1961, Zerova et al. 1972 - under the
name ‘Odontia transiensis’), and Middle Volga Region in Russia (Malysheva &
Malysheva 2008). Bernicchia & Gorjén (2010) cite the northernmost localities
as Sweden and Estonia.
Oliveonia citrispora (Hauerslev) P. Roberts Fic. 5
BasIDIOMA totally effused, 1-7 mm long, ca 30 um thick, hypochnoid,
comparatively loosely attached to the substratum, not continuous, porulose-
reticulate, greyish with yellowish or brownish tint. MARGIN rather abrupt
or indistinct. SuBicuLUM poorly developed; subicular hyphae moderately
branched, with small clamps or rarely with simple septa, (1.3-)1.6-2(-2.8) um
wide (some segments inflated to 4 um), thin-walled, smooth, hyaline or with
pale yellowish refractive contents. Subbasidial hyphae moderately branched,
1.8-2(-3) um wide, thin-walled, hyaline or with yellowish contents, with
clamped septa. CysTIDIA none, but broadly fusoid cystidioles scattered,
12-17.5 x 3.2-4.7 um, yellowish. BAsIDIOLEs broadly clavate, narrowly ovoid
392 ... Yurchenko & Kotiranta
~ OO00Gr
Fic. 5. Oliveonia citrispora (MSK 6895): a, subicular hyphae; b, broadly fusoid cystidioles;
c, basidioles and basidia; d, basidiospores.
or subcylindrical, 11-25 x 5.7-7.5(-8.5) um, with subhyaline to brownish
yellow, minutely granular or refractive contents. BAsIDIA ovoid to broadly
clavate, basally clamped (but the clamp not always seen), 10-16.5 x 4.5-7.7
uum, hyaline or pale yellowish, thin-walled (wall thinner basally), with 1-4
Unusual corticioids from Belarus... 393
sterigmata, 2.2-6.5 x 0.8-1.1 um. Basiprospores wide-navicular - citriform,
narrowing towards both ends, (4.3-)6-8.2 x 2.9-4.3 um, thin-walled, smooth,
hyaline to yellowish, with short blunt apiculus, Mz’s-negative, acyanophilous.
SPECIMENS EXAMINED—BELARUS. Homel’ voblast’: Lelchytsy district, Prypyatski
National Park, in the vicinity of Simanitskaya Rudnya village (site 4), on decorticated
wood of strongly decayed Picea abies (L.) H. Karst. stump in Betula-Picea forest of
Vaccinium myrtillus type, coll. 9.X1.2007 (MSK 6895; H.K.); the same locality, on
decaying Picea abies bark in Picea forest of swampy moss type, coll. 21.V.2010 (MSK
7291).
Oliveonia citrispora is distinguished from other members of the genus by bi-
apiculate basidiospores. Our material deviates somewhat compared with
other descriptions of the species. According to Roberts (1999), O. citrispora
has narrower (1.5-2 um) hyphae, subglobose, cuboid or ellipsoid basidia that
are shorter (7.5-11 tm) and often pleural, larger sterigmata (4-10 x 1-1.5
um) and larger basidiospores (6-10 x 3.5-8 wm) with pronounced apiculi.
However, such small differences are common in Rhizoctonia-forming fungi.
Basidiospores in our material are notably narrow, even when compared with
the data by Roberts (1999: Tab. 30) for a sample with the narrowest spores
(up to 6 um). Our samples have a dirty yellowish pigmentation in hymenial
elements and hyphae, giving a yellowish or brownish tinge to the hymenial
surface, whereas basidiomata are greyish-white according to other descriptions
(Hauerslev & Roberts 1997 as ‘Sebacinella citrispora Hauerslev, Roberts 1999).
Spore repetition is often found in this taxon (Hauerslev & Roberts 1997) but
was not detected in the specimens examined here.
The species is new for Belarus and known from a single locality. Itis probably
rare over its entire small range: so far it is known from the Netherlands,
Denmark (Roberts 1999), southern Britain (Kirk & Cooper 2009 - 7 records),
and Sweden (Bernicchia & Gorjén 2010).
Trechispora caucasica (Parmasto) Liberta Fia. 6.
BasIDIOMATA totally effused, ca 5-15 mm long, very thin, closely adnate but
not firmly attached to the substratum, pure white, arachnoid-reticulate, with
scattered loose granules, 0.2-1 mm in diam., containing conidia or hyphae with
abundant coarse crystalline material. MARGIN abrupt or indistinct. HyPHAL
STRANDS present, 70-150 um wide, situated near the basidiomata or radiating
in flabelliform pattern from the margins. HyPHAL sysTEM monomitic, hyphae
clamped. Subicular hyphae moderately branched, 1.3-1.8 um wide, hyaline,
thin-walled, in strands straight, 1-1.5 um wide. Subhymenium rich of fine
crystalline material and also with groups of coarse crystals (separate crystals
2.5-11 um across). Subbasidial hyphae moderately branched, 1.6-2(-3.5) um
wide, hyaline, thin-walled, moderately encrusted or smooth. CysTIDIA none.
Basip1A basally clamped, short clavate to subcylindrical, some with a median
394 ... Yurchenko & Kotiranta
Fic. 6. Trechispora caucasica (MSK 6891): a, subicular hyphae; b, fragments of hymenium; c, basidia
and basidioles; d, basidiospores; e, conidiophores with developing conidia; f, conidia.
constriction, thin-walled, hyaline, 9-11.5(-18) x 4-4.5(-5) wm, with 2-4
sterigmata, 2.5-3.2 x 0.5 um. BAsIpIosPoREs ovoid, somewhat bent, adaxially
concave, 3.3-4(-5.5) x 2.5-2.7 um, relatively evenly covered with spines up to
0.8 um long, thin-walled, hyaline, with middle-sized apiculus, Mz’s-negative,
acyanophylous. ConipiA (blastoconidia) numerous, originating terminally,
sometimes intercalarly, on delicate hyphae, 1-2 um wide, ellipsoid, ovoid,
angular-subglobose or irregular-shaped, 4.2-6.2 x 2.2-4 tum, smooth, or with
one, or a few protuberances, with thickened walls, subhyaline, with one large
drop or several smaller inclusions.
SPECIMEN EXAMINED—BELARUS. Homel’ voblast’: Lelchytsy district, Prypyatski
National Park, in the vicinity of Simanichy village (site 3), on corticated fallen branch of
Pinus sylvestris in Pinus forest of Pleurozium type, coll. 9.X1.2007 (MSK 6891; H.K.).
The presence of hyphal cords, lack of skeletal hyphae, often irregular shape
of conidia, and especially morphology of basidiospores, which are ventrally
Unusual corticioids from Belarus... 395
somewhat concave and bearing comparatively long aculei, are characteristic
for T. caucasica (Parmasto 1965, Larsson 1992). A very similar species is
T. tenuicula (Litsch.) K.H. Larss., which, however, is dimitic, grows mostly
on ferns (whereas 7: caucasica grows on wooden substrata), and spores are
ellipsoid to nearly lacrymiform, densely aculeate, with a small spine-free area
on the ventral side (e.g., Larsson 1992, Kotiranta & Saarenoksa 2000).
Trechispora caucasica is new for Belarus and known from a single locality.
The species was described for the first time from Azerbaijan (Parmasto 1965,
as ‘Cristella caucasica Parmasto’), but today it is known from Britain (Kirk &
Cooper 2009 — 2 records), Norway (Ryvarden et al. 2003 - from 3 localities),
Finland (Kotiranta et al. 2009 - 2 localities), Lithuania (R. IrSénaité 2010),
Sweden, Denmark, France, Austria, Italy, USA (Larsson 1992), Azores (Telleria
et al. 2009b). It is a rare or probably under-reported taxon, as earlier it was not
distinguished from T. farinacea (Pers.) Liberta s. 1. (Liberta 1973, Hjortstam
1987, Domanski 1992). However, Liberta (1973) did not describe blastoconidia
or aleuriospores, typical of I’ caucasica, in T: farinacea s.]. The distinction of
T. caucasica from T. farinacea was made clear after the treatments by Larsson
(1992; 1996).
Trechispora minuta K.H. Larss. Fic. 7
BasIDIOMATA totally effused, closely adnate, very thin (about 15-20 um
thick), discontinuous, farinaceous or pruinose, 3-10 mm in extent, white.
MarcIn diffuse, sometimes with very slender, closely adpressed, fan-shaped
hyphal strands at the periphery. HyPHAL sysTEM dimitic. Generative hyphae
clamped, moderately branched, hyaline, thin-walled, smooth to slightly
encrusted, (0.9-)1.3-2.3 um wide, subbasidial ones 1.6-1.8(-4.2) um wide.
Hyphae in cords with blunt, cystidia-like hyphal ends up to 3.7-4.3 um wide.
Skeletals not present in all parts of basidiomata, but in some areas abundant,
very sparingly branched, rather straight to wavy, hyaline, 0.5-1.1(-1.8) um
wide, with lumen about 0.3 um wide or seemingly without lumen, gradually
turning into narrow generative hyphae with clamps. Skeletals often covered
with numerous, coarse (mostly 3-10 tm across) crystals. HyPHIDIA occasional,
sinuous, 18-32 um long, often swollen at base to about 4 um. BasIpia basally
clamped (clamps often obscured by fine crystalline material), shortly clavate to
oblong and slightly pedunculate, straight or curved, 7.5-9.2 x (3.3-)3.5-4 um,
with 4 subulate sterigmata 3.3(-4) um x 0.5 um. Basiprosporgs ellipsoid or
ovoid, with flat or convex ventral side, minutely echinulate to short aculeate,
3,3-3.8(-4.5) x 1.7-2.1 um excluding the aculei, hyaline, thin- or rather thin-
walled, Mz's-negative, acyanophilous, with minute or indistinct apiculus.
SPECIMEN EXAMINED—BELARUS. Homel’ voblast: Mazyr district, NW outskirts of
town Mazyr (site 2), in ravine bottom, on angiosperm twig in litter in Alnus glutinosa
forest of Rubus idaeus-Oxalis type, coll. 26.X.2006 (MSK 7307; H.K.).
396 ... Yurchenko & Kotiranta
OG selseaoaoaa
e
Fic. 7. Trechispora minuta (MSK 7307): a, generative hyphae; b, skeletal hyphae and crystals;
c, hyphidia; d, basidioles and basidia; e, basidiospores.
$5 um
The main distinctive characters for T. minuta are the presence of skeletal hyphae,
usually pruinose to farinaceous basidiomata, very short basidia (< 10 x 5 um),
and a subhymenium of intricately branched hyphae in fully mature specimens
Unusual corticioids from Belarus ... 397
(Larsson 1992). Trechispora tenuicula differs in having longer basidia (10-13
um) and the presence of blastoconidia. In contrast to the original description
of I! minuta, our sample has an undeveloped subhymenium and narrower
basidiospores with rather evenly distributed aculei. According to Larsson
(1992, Fig. 28) spores are 2.4-2.7 um wide without aculei and have almost a
smooth area on the ventral side near the apiculus.
The species is new for Belarus and known from a single locality. It is widely
distributed and presumably common, but is evidently neglected or often
misidentified. The species is known from Norway (10 localities), Sweden (7
localities), Finland, France, Austria, Poland (at the eastern border close to
Belarus), Canada, USA (Larsson 1992), and Azores (Telleria et al. 2009b).
Acknowledgments
The authors are grateful to Prof. Nils Hallenberg (Department of Plant and
Environmental Sciences, University of Géteborg, Sweden) and to Dr Wolfgang Damon
(St. Georgen bei Salzburg, Austria) for presubmission review of the manuscript. We
are thankful to Dr Karl-Henrik Larsson (Natural History Museum, University of Oslo,
Norway) for the identification of Crustodontia chrysocreas and giving some data on
its distribution, and to Dr Bernhard de Vries (Hoogeveen, The Netherlands) for the
discussion on Hyphoderma cryptocallimon taxonomy.
Literature cited
Berkeley MJ. 1873. Notices of North American fungi. Grevillea 1(12): 177-180.
Bernicchia A. 2000. Wood-inhabiting aphyllophoraceous fungi on Juniperus spp. in Italy.
Mycotaxon 75: 241-256.
Bernicchia A, Gorjon SP. 2010. Corticiaceae s.]. Fungi Europaei n°12. Ed. Candusso, Italia. 1008
PP-
Bernicchia A, Savino E, Gorjén SP. 2007a. Aphyllophoraceous wood-inhabiting fungi on Pinus
spp. in Italy. <http://www.mycotaxon.com/resources/checklists/bernicchia-v101-checklist1.
pdf>. (Summary of web publication: Mycotaxon 101: 5-8.)
Bernicchia A, Venturella G, Saitta A, Gorjén SP. 2007b. Aphyllophoraceous wood-inhabiting fungi
on Fagus sylvatica in Italy. <http://www.mycotaxon.com/resources/checklists/ bernicchia-
v101-checklist2.pdf>. (Summary of web publication: Mycotaxon 101: 229-232.)
Bernicchia A, Benni A, Venturella G, Gargano ML, Saitta A, Gorjén SP. 2008. Aphyllophoraceous
wood-inhabiting fungi on Quercus spp. in Italy. <http://www. mycotaxon.com/resources/
checklists/bernicchia_v104-checklist.pdf> (Summary of web publication: Mycotaxon 104:
425-428.)
Bourdot H, Galzin A. 1928. Hyménomycétes de France. Hetérobasidiés — Homobasidiés
Gymnocarpes [Contribution a la flore mycologique de la France 1]. Paris: Lechevalier. 764 pp.
Dai YC. 2010. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience.
Published online 31 Aug 2010. doi:10.1007/s10267-010-0068-1
Dai YC, Wei YL, Zhang XQ. 2004. An annotated checklist of non-poroid Aphyllophorales in China.
Ann. Bot. Fennici 41: 233-247.
Domanski S. 1991. Mala flora grzybéw. T. 1. Basidiomycetes (Podstawczaki). Aphyllophorales
(Bezblaszkowce), Stephanosporales (Stefanosporowce). Czesé 6. Corticiaceae: Kavinia
398 ... Yurchenko & Kotiranta
— Rogersella. Stephanosporaceae: Lindtneria. Paistwowe wydawnictwo naukowe: Warszawa,
Krakéw. 273 pp.
Domaniski S. 1992. Mala flora grzybéw. T. 1. Basidiomycetes (Podstawczaki). Aphyllophorales
(Bezblaszkowce). Czesé 7. Corticiaceae: Sarcodontia — Ypsilonidium, Christiansenia &
Syzygospora. Instytut botaniki im. W. Szafera: Krakow. 258 pp.
Eriksson J, Ryvarden L. 1975. The Corticiaceae of North Europe. Vol. 3: Coronicium — Hyphoderma.
Fungiflora: Oslo. Pp. 287-546.
Ghobad-Nejhad M, Hallenberg N, Parmasto E, Kotiranta H. 2009. A first annotated checklist
of corticioid and polypore basidiomycetes of the Caucasus region. Mycologia Balcanica 6:
123-168.
Gilbertson RL, Adaskaveg JE. 1993. Studies on wood-rotting basidiomycetes of Hawaii. Mycotaxon
A9: 369-397,
Hauerslev K, Roberts P. 1997. Ceratobasidiaceae Julich. 112-115, in: Hansen L, Knudsen H.
(eds), Nordic macromycetes. Vol. 3: Heterobasidioid, aphyllophoroid and gastromycetoid
Basidiomycetes. Nordsvamp: Copenhagen.
Hjortstam K. 1987. A check-list to genera and species of corticioid fungi (Hymenomycetes).
Windahlia 17: 55-85.
Hjortstam K, Ramos Bononi VL. (1987). A contribution to the knowledge of Corticiaceae s.l.
(Aphyllophorales) in Brazil. Mycotaxon 28(1): 1-15.
Hjortstam K, Ryvarden L, Watling R. 1993. Preliminary checklist of non-agaricoid macromycetes
in the Korup National Park, Cameroon and surrounding area. Edinb. J. Bot. 59(1): 105-119.
doi: 10.1017/S0960428600000743
Hjortstam K, Roberts PJ, Spooner BM. 1998. Corticioid fungi from Brunei Darussalam. Kew
Bulletin 53(4): 805-827. doi:10.2307/4118870
Hjortstam K, Roberts PJ, Spooner BM. 2009. Corticioid fungi from the Kimberley Region, Western
Australia. Kew Bulletin 64(2): 353-368. doi: 10.1007/s12225-009-9104-8.
Irgénaité R. 2010. Aa annotated checklist of corticioid fungi of Lithuania. Bothanica Lithuanica
16(2-3): 83-95.
Kirk P, Cooper J. 2009. The checklist of fungi of the British Isles - name search. British Mycological
Society, FRDBI [website]. <http://www.fieldmycology.net/GBCHKLST/ gbchklst.asp>.
Klitsunova NK, Martsynkevich HI, Pirozhnik II, Shchasnaya II, Yakushka VP. 2002. Map 17.
Physiographic division (in European decimal division system). In: Myasnikovich MU,
Shymau UM et al. (eds), National atlas of Belarus: 152. Belkartahrafiya; KPZRHiK: Minsk. [in
Belarusian]
Kotiranta H, Saarenoksa R. 2000. Corticioid fungi (Aphyllophorales, Basidiomycetes) in Finland.
Acta Bot. Fennica 168: 1-55.
Kotiranta H, Saarenoksa R. 2005. Ceratobasidium and Oliveonia (Basidiomycota, Aphyllophorales)
in Finland. Ann. Bot. Fennici 42: 237-245.
Kotiranta H, Saarenoksa R, Kytovuori I. 2009. Aphyllophoroid fungi of Finland: A check-list with
ecology, distribution, and threat categories [Norrlinia 19]. Botanical Museum, Finnish Museum
of Natural History: Helsinki. 223 pp.
Kubayashi T, Maekawa N. 2001. Identification and pathogenicity of the fungus isolated from butt
rot of Japanese cypress, Chamaecyparis obtusa. J. Gen. Plant. Pathol. 67: 262-267. doi:10.1007/
PL00013027
Kifer N, Lovas PS, Senn-Irlet B. 2004. Diversity of wood-inhabiting fungi in natural beech forests
in Transcarpathia (Ukraine): a preliminary survey. Mycologia Balcanica 1: 129-134.
Larsson KH. 1992. The genus Trechispora (Corticiaceae, Basidiomycetes). Dissertation. Géteborg.
Unusual corticioids from Belarus... 399
Larsson KH. 1996. Taxonomy of Trechispora farinacea and proposed synonyms II. Species with a
smooth hymenophore. Nordic J. Bot. 16(1): 73-82. doi:10.1111/j.1756-1051.1996.tb00217.x
Liberta AE. 1973. The genus Trechispora (Basidiomycetes, Corticiaceae). Can. J. Bot. 51(10):
1871-1892. doi:10.1139/b73-240
Lin SH, Chen ZC. 1990. The Corticiaceae and the resupinate Hydnaceae of Taiwan. Taiwania 35(2):
69-111.
Lombard FF, Burdsall HH, Gilbertson RL. 1975. Taxonomy of Corticium chrysocreas and Phlebia
livida. Mycologia 67(3): 495-510. doi:10.2307/3758388
Maekawa N. 1993. Taxonomic study of Japanese Corticiaceae (Aphyllophorales) I. Rept. Tottori
Mycol. Inst. 31: 1-149.
Maekawa N. 1994. Taxonomic study of Japanese Corticiaceae (Aphyllophorales) Il. Rept. Tottori
Mycol. Inst. 32: 1-123.
Malysheva VE, Malysheva EF. 2008. The higher basidiomycetes in forest and grassland communities
of Zhiguli. KMK Scientific Press: Moscow, St. Petersburg. 243 pp.
Minter DW (ed.) 2010. Cybertruffle’s robigalia. Observations of fungi and their associated
organisms [website]. Retrieved at <http://www.cybertruffle.org.uk/robigalia/eng/ index.htm>
11 Nov 2010.
Minter DW, Mena Portales J, Rodriguez-Hernandez M, Iglesias Brito H, Camino Vilaré M,
Mercado Sierra A. (2002). Electronic distribution maps of Caribbean fungi [website, version
1.00]. <http://www.biodiversity.ac.psiweb.com/carimaps>.
Nakasone KK, Gilbertson RL. 1982. Three brown-rot fungi in the Corticiaceae. Mycologia 74(4):
599-606.
Nikolajeva TL. 1961. Familia Hydnaceae. Flora plantarum cryptogamarum URSS. 6: Fungi (2). Typ.
et imp. Acad. Sc. URSS: Moscow, Leningrad. 433 pp. [in Russian]
Parmasto E. 1965. Corticiaceae URSS. I. Descriptiones taxorum novarum. Combinationes novae.
Eesti NSV Tead. Acad. Toim., Biol. 14(2): 220-233.
Pennycook SR, Galloway DJ. 2004. Checklist of New Zealand “fungi”. Fungi of New Zealand 1:
401-488. Fungal Diversity Press: Hong Kong.
Roberts P. 1999. Rhizoctonia-forming fungi: A taxonomic guide. The Herbarium, Royal Botanic
Gardens: Kew. 239 pp.
Roberts P. 2000. Corticioid fungi from Korup National Park, Cameroon. Kew Bulletin 55(4):
803-842. doi:10.2307/4113628
Ryvarden L, Stokland J, Larsson KH. 2003. A critical checklist of corticioid and poroid fungi of
Norway. Synopsis Fungorum 17: 1-109.
Telleria MT, Melo I, Duefias M, Salcedo I, Cardoso J, Rodriguez-Armas JL, Beltrén-Tejera E.
2008. Corticioid fungi (Basidiomycota) from Madeira Island. <http://www.mycotaxon. com/
resources/checklists/telleria-v106-checklist.pdf>. (Summary of web publication: Mycotaxon
106: 419-422.)
Telleria MT; MeloI, Duefias M, Rodriguez-Armas JL, Beltran-Tejera E, Cardoso J, Salcedo I. 2009a.
Diversity and richness of corticioid fungi (Basidiomycota) on Azores Islands: a preliminary
survey. Nova Hedwigia 88(3-4): 285-308. doi:10.1127/0029-5035/2009/ 0088-0285
Telleria MT, Melo I, Duefias M, Salcedo I, Cardoso J, Rodriguez-Armas JL, Beltran-Tejera E. 2009b.
Corticioid fungi (Basidiomycota) from the Azores Islands: Flores and Séo Miguel. <http://
www.mycotaxon.com/resources/checklists/telleria-v109-checklist.pdf>. (Summary of web
publication: Mycotaxon 109: 141-144.)
Vries BWL de. 1987. Some new corticioid taxa. Mycotaxon 28(1): 77-90.
Wu SH. 1990. The Corticiaceae (Basidiomycetes) subfamilies Phlebioideae, Phanerochaetoideae and
Hyphodermoideae in Taiwan. Acta Bot. Fenn. 142: 1-123.
A00 ... Yurchenko & Kotiranta
Yurchenko E. 2008. Corticioid fungi (Basidiomycota) on living wooden plants in Belarus: species
inventory and host colonization strategies. Botanica Lithuanica 14(3): 177-189.
Yurchenko EO, Kotiranta H. 2006. Rare corticioid fungi (Basidiomycetes, Aphyllophorales) from
central Belarus. Mycena 6: 67-88.
Yurchenko EO, Kotiranta H. 2007. Rare corticioid fungi (Basidiomycetes, Aphyllophorales) from
northern Belarus. Mycena 7: 20-47.
Zerova MYa, Radziyevs’ kyi HH, Shevchenko SV. 1972. Fungi of Ukraine identification book. T. 5.
Basidiomycetes. Book 1. Exobasidiales, Aphyllophorales, Cantharellales. Naukova dumka: Kyiv.
240 pp. [in Ukrainian]
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 401-406 January-March 2011
DOT: 10.5248/115.401
Conidial morphology changes in four Phyllosticta species
JING JIN
Agronomy and Plant Protection College, Qingdao Agricultural University, Qingdao 266109 China
CORRESPONDENCE TO: caroljin8100@ 163.com
AssTRACT — Production of pycnidia and conidia by Phyllosticta theacearum, Phyllosticta
sp. (ex Euonymus) and Phyllosticta sp. (ex Portulaca) (grown on PDA), and P. cruenta (from
specimens) was studied. On PDA, conidial appendages of Phyllosticta sp. (ex Portulaca)
disappeared completely after 16 days, of P theacearum after 29 days, and of Phyllosticta sp.
(ex Euonymus) after 14 days. In slide preparations mounted in water, appendages of all four
species persisted; the appendages of P. cruenta and Phyllosticta sp. (ex Euonymus) became
2-4 times longer within 30 minutes, while those of Phyllosticta sp. (ex Portulaca) and
P. theacearum remained unchanged.
Key worps — caducous, extend, identification, anamorph, Ascomycota, Phoma
Introduction
Species of the anamorphic ascomycete genus Phyllosticta Pers. have often
been recorded as plant pathogens, saprobes, and endobionts (Liu & Lu 2007,
Okane et al. 2003, Punithalingam 1974). Identification is highly problematic,
as few characters are available to separate different species. Sometimes a
single difference in conidial morphology, such as thickness of the mucoid
layer surrounding the conidium or appendage shape or size, has been used
to distinguish different species (Motohashi et al. 2008a,b, Nag Raj 1993,
Punithalingam & Woodhams 1982, Aa & Vanev 2002, Wulandari et al. 2009).
There have also been frequent confusions between Phyllosticta and Phoma,
which have many morphological similarities. The key distinctions between these
two genera are the mucoid sheath and appendage, reported for Phyllosticta but
not for Phoma. Those two structures are, however, delicate, faint, colourless,
and easily overlooked under the poorly contrasting conditions of bright field
microscopy. In the past, that has made misidentifications between Phyllosticta
and Phoma frequent. With improvements in the quality of microscopes and
the wide availability of phase contrast and differential interference contrast
optics, it is now easier to detect mucoid sheaths and appendages. But there is
402 ... Jin
an additional problem: in some species of Phyllosticta the appendages can be
caducous even in fresh material and cultures (Aa 1973).
The objectives of the present paper are therefore to report preliminary
observations about the time span during which appendages can be observed,
and to record some changes that can occur in appearance of appendages
during that period. As the species used in this study are not well documented,
the opportunity is also taken to provide illustrations and descriptions of
appearances in pure culture.
Materials & methods
Isolates were obtained using standard phytopathological techniques, and for three
species pure cultures were established (P. cruenta failed because of contamination
by bacteria) and incubated at 28°C in the dark. Slants on PDA were preserved at 4°C
in a refrigerator. Fungal identifications were based on specific literature such as the
contributions as Aa (1973), Aa & Vanev (2002) and Nag Raj (1993) among others. All
slides were prepared using sterile technique. Observations of pycnidia and conidia were
made on subcultures derived from original slants. Starting from 5 days after making
the subculture, each Petri dish was examined daily for pycnidia. When pycnidia
were detected, a slide was prepared to check for presence of conidia. The date of first
appearance of conidia was then noted. From first appearance of conidia, slides were
prepared daily to observe appendages. Two key dates were noted: that on which at
least some conidia no longer had appendages, and that on which no conidia remained
with visible appendages. Thereafter observations were discontinued. Squash mounts
of pycnidia were also prepared in water to observe conidial appendages. Each slide
prepared in this way was then examined at three minutes intervals for 30 minutes, and
the condition of appendages noted and photographed using bright field, phase contrast,
and differential interference contrast microscopy. Where no change in appendage
appearance was noted, the slide was then placed on moist filter paper in a Petri dish and
re-observed every 30 minutes up to 3 hours. Material that still showed no change was
then re-observed daily for three days.
SPECIMENS EXAMINED — Phyllosticta cruenta (Fr.) J. Kickx f.: CHINA, Shandong: Kunyu
Mountain, in diseased leaves of Polygonatum odoratum var. pluriflorum (Miq.) Ohwi
(Convallariaceae), 37°17°04.76"N, 121°44’49.24”E, 284 m, 12 July 2007, MHQAU0134.
Phyllosticta theacearum Aa: CHINA, Shandong: Laoshan Mountain, in diseased leaves
of Thea sinensis L. (Theaceae), 36°11700.42”N, 120°40°49.50"E, 79 m, 25 April 2008,
MHQAU0192, JJ 196.
Phyllosticta sp. (Euonymus): CHINA, Shandong: campus of Qingdao Agricultural
University, in diseased leaves of Euonymus japonicus Thunb. (Celastraceae),
36°19°16.50"N, 120°2401.62”E, 9 m, 22 July 2009, MHQAU0248, JJ243.
Phyllosticta sp. (Portulaca): CHINA, Shandong: campus of Qingdao Agricultural
University, as endobiont from stem of Portulaca oleracea L. (Portulacaceae),
36°19 1L.ODN, 120°2358.18"E, 9 m, 19 July 2008, JJ219.
All the specimens and isolates are deposited in Mycology Herbarium, Qingdao
Agricultural University (MHQAU).
Conidia in Phyllosticta ... 403
Results
Appearance of cultures on PDA
Phyllosticta theacearum: mycelium immersed and superficial, initially pale
grey, gradually turning greenish black, dense, floccose, margin undulate with
abundant submerged mycelium (Fic. 1A); reverse black (Fic. 1B).
Phyllosticta sp. (Euonymus): colonies were initially pale yellow, eventually
turning grey with thin submerged mycelium; aerial mycelium scanty, sparse,
thin; margin irregular with sparse submerged mycelium (Fic. 1N); reverse with
a grey centre surrounded by a black ring and a grey perimeter (Fic. 10).
Phyllosticta sp. (Portulaca): mycelium immersed and superficial, white at
first, becoming greyish black; surface covered by a thin mat of whitish aerial
mycelium, dense, flat, fissured, with a clearly-defined edge (Fic. 1R); reverse
greyish black (Fic. 1S).
Production of pycnidia and conidia on PDA
Phyllosticta sp. (Portulaca) produced pycnidia and conidia in 8 days;
Phyllosticta sp. (Euonymus) produced pycnidia and conidia in 7-8 days;
P. theacearum produced pycnidia and conidia in 14 days.
Loss of appendages with time
Appendages of P. theacearum, Phyllosticta sp. (Euonymus), and Phyllosticta
sp. (Portulaca) disappeared with ageing of colonies on PDA. Conidia of
Phyllosticta sp. (Portulaca) with no visible appendages began to be observed 5
days after conidia were first sighted, and by 8 days no appendages could be seen.
Conidia of Phyllosticta sp. (Euonymus) with no visible appendages began to be
observed 3-4 days after conidia were first sighted, and by 6 days no appendages
could be seen. Conidia of P. theacearum with no visible appendages began to be
observed 10 days after conidia were first sighted, and by 15 days no appendages
could be seen.
Changes in appearance of appendages in water
Appendages of Phyllosticta sp. (Portulaca) (Fic. 1T) and P. cruenta (Fic. 1G,
H) were initially about 50% of the length of conidia. Appendages of Phyllosticta
sp. (Euonymus) (Fic. 1P) and P. theacearum (Fic. 1C) were initially between
50% and 100% of the length of conidia. In water mount slides, appendages of
P. cruenta and Phyllosticta sp. (Euonymus) extended, while those of Phyllosticta
sp. (Portulaca) (Fic. 1T) and P. theacearum (Fic. 1D) remained unchanged,
retaining their original length even in water for three days. Appendages of P.
cruenta began to extend after 6 minutes in water (Fic. 11) and became 3-4
times the original length in 18-30 min (Fic. 1J, K, arrows). After that, no
further extension occurred. In P. cruenta, the conidia contained small greenish
guttules (Fic. 1G-H) which, with time immersed in water, fused into two large
drops (Fic. 1J, K). Guttules in the other three species did not fuse. Appendages
404 ... Jin
of Phyllosticta sp. (Euonymus) extended to 2-3 times their original length in
12-30 min (Fic. 1Q, arrow) and no change occurred thereafter.
Discussion
The presence or absence of appendages is routinely used to distinguish
Phyllosticta species (Nag Raj 1983, Punithalingam & Woodhams 1982, Aa
1973, Weidemann et al. 1982). Aa (1973), however, reported that Phyllosticta
appendages may be caducous in freshly collected specimens and even in
pure cultures, being usually visible only on a proportion of the conidia. For
cultures on PDA, the present results confirm that appendages of some species
in Phyllosticta can disappear with time. Prior to the present study, apparently
nothing was known about Phyllosticta appendage longevity on artificial media.
For all three Phyllosticta species studied here on PDA, the longest period of
appendage visibility lasted no longer than one month. Earlier reports of
Phyllosticta species lacking appendages may need to be reviewed in the light
of this result. Longevity of appendages in cultures on other artificial media
commonly used to grow Phyllosticta species also needs to be determined, and it
may be advisable to record the age of cultures used when describing Phyllosticta
appendages.
When mounted in water, appendages of the four species of Phyllosticta
in the present study remained persistent, but responded differently. Those
of P. theacearum and Phyllosticta sp. (Portulaca) kept their original length in
water for several days, while those P. cruenta and Phyllosticta sp. (Euonymus)
extended 2-4 times their original length in a short time (12-30 minutes).
This phenomenon may explain why in earlier reports there is sometimes
considerable divergence in the stated length of conidial appendages in the same
species. Aa (1973), for example, reported that conidia of P. vaccinii were 8-12 x
5-8 um and had appendages usually 4-8 um long and sometimes up to 17 um
long, while Weidemann et al. (1982), studying the same species, reported larger
measurements of spore appendage lengths. ‘They described appendage lengths
as ranging from 3-70 um for conidia 8-13 x 7-9 um in size. In another species
P. elongata, Weidemann et al. (1982) reported appendages varying in length
from 4-120 um. Unfortunately, the time elapsed between preparing the slide
and measuring the appendages was not stated. Earlier reports of appendage
lengths should therefore be treated with caution. At present it is not clear if this
phenomenon of extending appendages is widespread in Phyllosticta, or present
only in some species. Given its potential impact on Phyllosticta identification,
more species could usefully be studied.
The identity of the Phyllosticta spp. on Euonymus japonicus and on Portulaca
oleracea merits discussion. Numerous taxa described as Phyllosticta spp. from
Euonymus belong in other genera or are of dubious application (Aa & Vanev
Conidia in Phyllosticta ... 405
PLaTE 1 Four species of Phyllosticta. Phyllosticta theacearum: (A) upper colony; (B) converse
colony; (C) conidia; (D) conidia after three days in water. Phyllosticta cruenta: (E) symptom on the
leaf of Polygonatum odoratum var. pluriflorum; (F) pycnidia; (G,H) conidia; (I) conidia after 6 min.
in water; (J,K) conidia after 18-30 min. in water. Phyllosticta sp. (on Euonymus): (L,M) pycnidia
on the leaf of Euonymus japonicus; (N) upper colony; (O) converse colony; (P) conidia; (Q)
conidia after 12-30 min. in water. Phyllosticta sp. (on Portulaca): (R) upper colony; (S) converse
colony; (T) conidia. (C,G,J under light field; D,H,I,K,P,Q,T under phase contrast field.) Scale bars:
A,B,E,L,N,O,R,S = 2.5 cm; F = 1 mm; M = 100 wm; C,D,G-K,P,Q,T = 10 um.
2002). Phyllosticta euonymi-japonici L.L. Liu & G.Z. Lu is apparently the
only species of Phyllosticta sensu stricto described from Euonymus; it differs
from the present species in shape and dimension of conidia. The conidia of
P. euonymi-japonici are ellipsoid to ovoid, 10-12.5 x 7.5-10 um, while those of
406 ... Jin
Phyllosticta sp. (Euonymus) are clavate and 15-23 x 6-8 um. It therefore seems
possible that the present species is undescribed. Phyllosticta sp. (Portulaca) may
also represent an undescribed species. There is no named species of Phyllosticta
recorded on Portulaca, but Batista & Vital (1952: 57) reported Phyllosticta sp. on
P. oleracea from Brazil. ‘There is insufficient information to determine whether
the Brazilian fungus is a species of Phyllosticta sensu stricto, or to compare it
with our Portulaca isolate.
Acknowledgments
The author thanks Dr. Katarina Pastirtéd4kova (Nitra, Slovakia) and Dr.
Keiichi Motohashi (Tokyo, Japan) for pre-submission reviewing the manuscript and is
grateful to Dr. David Minter for checking the English translation and valuable comments
on the manuscript. Ms Jun Yang, a student in the Plant Protection Department of
Qingdao Agricultural University in 2009 assisted with some of the experiments. This
project was supported by National Natural Science Foundation of China (30500004).
Literature cited
Aa HA van der. 1973. Studies in Phyllosticta I. Stud. Mycol. 5: 1-110.
Aa HA van der, Vanev S. 2002. A revision of the species described in Phyllosticta. Centraalbureau
voor Schimmelcultures: Utrecht (Netherlands). 510 p.
Batista AC, Vital AF 1952. Monografia das espécies de Phyllosticta em Pernambuco. Bol. Secr.
Agric. Ind. Com. Est. Pernambuco 19: 1-80.
Liu LL, Lu GZ. 2007. Phyllosticta euonymi-japonici sp. nov., an endophytic fungus isolated from
Euonymus japonicus. Mycosystema 26: 171-173.
Motohashi K, Araki I, Nakashima C. 2008a. Four new species of Phyllosticta, one new species
of Pseudocercospora, and one new combination in Passalora from Japan. Mycoscience 49:
138-146. doi:10.1007/s10267-007-0395-z
Motohashi K, Nishikawa J, Akiba M, Nakashima C. 2008b. Studies on the Japanese species belonging
to the genus Phyllosticta (1). Mycoscience 49: 11-18. doi:10.1007/s10267-007-0386-0
Nag Raj TR. 1993. Coelomycetous anamorphs with appendage-bearing conidia. Mycologue
Publications: Waterloo (Canada). 1101 p.
Okane I, Lumyong S, Nakagiri A, Ito T. 2003. Extensive host range of an endophytic fungus
Guignardia endophyllicola (anamorph: Phyllosticta capitalensis). Mycoscience 44: 353-363.
doi:10.1007/s10267-003-0128-x
Punithalingam E. 1974. Studies on Sphaeropsidales in culture II. Mycol. Pap. 136: 1-63.
Punithalingam E, Woodhams JE. 1982. The conidial appendage in Phyllosticta spp. Nova Hedwigia
36: 151-175.
Weidemann GJ, Boone DM, Burdsall Jr HH. 1982. Taxonomy of Phyllosticta vaccinii (coelomycetes)
and a new name for the true anamorph of Botryosphaeria vaccinii (Dothideales, Dothioraceae).
Mycologia 74: 59-65. doi:10.2307/3792629
Wulandari NF, To-anun C, Hyde KD, Duong LM, de Gruyter J; Meffert JP, Groenewald JZ, Crous
PW. 2009. Phyllosticta citriasiana sp. nov., the cause of Citrus tan spot of Citrus maxima in Asia.
Fungal Divers. 34: 23-39.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 407-411 January-March 2011
DOT: 10.5248/115.407
Notes on some Japanese smut fungi. 5.
Anthracoidea blepharicarpae and A. dispalatae, spp. nov.
CVvETOMIR M. DENCHEV’, TEODOR T. DENCHEV',
MuNEO MICHIKAWA? & MAKOTO KAKISHIMA3
'Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Sciences,
2 Gagarin St., 1113 Sofia, Bulgaria
?College of Biological Sciences, University of Tsukuba, Tsukuba, Ibaraki 305-8572, Japan
3Graduate School of Life and Environmental Sciences, University of Tsukuba,
Tsukuba, Ibaraki 305-8572, Japan
* CORRESPONDENCE TO:
[email protected]
ABsTRACT — Two new smut fungi, Anthracoidea blepharicarpae on Carex blepharicarpa and
A. dispalatae on Carex dispalata, are described and illustrated from Japan.
Key worps — Anthracoideaceae, taxonomy, Ustilaginomycetes
Introduction
During a taxonomic revision of the genus Anthracoidea in Japan, we founda
specimen of a verruculose-spored species with relatively large spores on Carex
blepharicarpa. After comparison with the known species of Anthracoidea on
Carex sect. Mitratae, we consider this fungus new. The host of another Japanese
specimen, originally identified as Anthracoidea caricis on Carex sp., was found
to represent Carex dispalata, which is a member of the sect. Anomalae. Species
of Anthracoidea have been considered by Vanky (1979) to be restricted to host
plants belonging to the same or closely related sections of Carex. As no species
of Anthracoidea has previously been reported on a representative of Carex sect.
Anomalae, we propose a new species for this collection.
Material & methods
Material from the mycological collections the Graduate School of Life and
Environmental Sciences, University of Tsukuba, Tsukuba (TSH), and Faculty of
Agriculture, Hokkaido University, Sapporo (SAPA), was examined under the light (LM)
and scanning electron (SEM) microscopes. For LM observations, spores were mounted
in lactophenol solution on glass slides, gently heated to boiling point, and then cooled.
A08 ... Denchev & al.
Spore measurements are given in the form: min-max (mean + 1 standard deviation).
For SEM, spores were attached to specimen holders by double-sided adhesive tape and
coated with gold with an ion sputter. The surface structure of spores was observed at 10
kV and photographed with a JEOL SM-6390 scanning electron microscope.
Taxonomy
Anthracoidea blepharicarpae Denchevy, T. Denchev & Kakish., sp. nov. Fics 1-2
MycoBank MB 519311
Sort in ovariis in inflorescentia dispersi, sicut corpora ellipsoidea vel basi cuneata, nigra,
3-4 mm longa, in superficie pulverei. Sporaz a fronte visus late ellipticae, irregulares
vel angulares, 18-30 x 14-25 (24.4+2.1 x 20.741.8) um, a latere visus 12.5-15 um,
rufobrunneae vel atro-rufobrunneae; paries inaequaliter incrassatus, 1-3 um crassus,
plerumque 1-3 (-5) gibberis internis, et interdum etiam maculis lucem refringentibus;
superficie verruculosa.
Holotypus in matrice Carex blepharicarpa Franch.: JAPONIA, Hokkaido, Otaru (Ishikari
Prov.), Mt. Tengu, 19. VI. 1932, leg. Otani, Yabe, Takee & Murayama (SAPA, sine num.).
EryMo_oey: the name refers to the host species.
Sor! in ovaries, scattered in the inflorescence, as ellipsoidal or cuneate at base,
black, hard bodies, 3-4 mm long, when young covered by a thin membrane,
later becoming exposed; spore mass of the mature sori powdery on the surface.
Spores flattened, in plane view broadly elliptical, irregular or moderately
angular in outline, sometimes elliptical or oval, in plane view 18-30 x 14-25
(24.442.1 x 20.741.8) um (n = 150), as an exception up to 34 um long, in side
view 12.5-15 um thick, middle to dark reddish brown, wall unevenly thickened,
1-3 um thick, thickest at the angles, with 1-3 (-5) internal swellings, sometimes
with light-refractive spots; verruculose. SPORE GERMINATION unknown.
DisTRIBUTION — On Cyperaceae: Carex — subgen. Carex, sect. Mitratae:
C. blepharicarpa, Asia (Japan - Hokkaido).
COMMENTS — Carex blepharicarpa is an eastern Asian species distributed in
Japan, Korea, Kuril Islands, and Sakhalin Island.
Anthracoidea blepharicarpae differs from the two other members of
Anthracoidea on sedges of sect. Mitratae, A. microsora (Syd.) Kukkonen and
A. caryophylleae Kukkonen, in having larger spores.
The mean values of the spore length of 17 Japanese specimens of A. microsora
as measured by us fell into a range of 18.8-20.7 um. The mean value of the
spore length of these specimens was 19.6+1.7 tum.
The mean values of the spore length of 18 eastern Asian specimens of
A. caryophylleae (14 Japanese, two Korean, and two from the Sakhalin Island)
as measured by us fell into a range of 18.6-21.7 um. The mean value of the
spore length of these specimens was 20.4+1.7 um. Both mean values of the
spore length of A. microsora and A. caryophylleae differed significantly from the
respective mean of 24.4+2.1 um for A. blepharicarpae.
Anthracoidea spp. nov. (Japan) ... 409
Fics 1-2. Spores of Anthracoidea blepharicarpae on Carex blepharicarpain LM and SEM (Holotype).
Fics 3-4. Spores of Anthracoidea dispalatae on Carex dispalata in LM and SEM (Holotype).
Scale bars: 1, 3 = 10 pum; 2, 4=5 wm.
A10 ... Denchev & al.
Anthracoidea caryophylleae is a species originally described from Europe
(Finland, Kukkonen 1963), where it is a common species (especially in Central
and East Europe, and the Balkan Peninsula). The mean values of the spore
length of European specimens were in a range of 16.9-20.5 um (Kukkonen
1963: 18, Nannfeldt 1979, Vanky 1979: 229, Scholz & Scholz 1988, Denchev
2001) (cfr with the above noted range of 18.6-21.7 tm). It seems that the spores
of the European specimens of A. caryophylleae are shorter than those of the
eastern Asian specimens.
Key to the Anthracoidea species on subgen. Carex sect. Mitratae
1 Spores 18-30 (-34) um long, spore mean length more than 22.5 um
EAE ated Hed RSET LSE Nd Neca 8 tee Aen eg A A. blepharicarpae
1* — Spores 15-25 (-27.5) um long, spore mean length less than 22.0 um ......... 2
2 Spores finely verruculose, warts up to 0.3 um high; profile smooth
OLMnearl VSO? lane Sree ay Rants nab eee a eceea te SRA A. caryophylleae
2* — Spores verruculose to verrucose, warts 0.2-0.6 um high,
affecting the spore profile ....... 0... eee ce eee eee A. microsora
Anthracoidea dispalatae Denchev, T. Denchev & Kakish., sp. nov. Fics 3-4
MycoBank MB 519312
Sorr in ovariis in inflorescentia dispersi, sicut corpora subglobosa vel ovoidea, nigra,
1.8-2 mm longa, in superficie pulverei. Sporaz a fronte visus irregulares, interdum
suborbiculares vel late ellipticae, 19-26 x 16.5-23 (22.3+1.5 x 19.3+1.5) um, a latere visus
11.5-14 um, rufobrunneae vel atro-rufobrunneae; paries inaequaliter incrassatus, 1.5-2.5
(-3.3) um crassus, plerumque sine gibberis internis, interdum 1 gibba interna, sine maculis
lucem refringentibus; superficie verruculosa.
Holotypus in matrice Carex dispalata Boott ex A. Gray: JAPONIA, Honshu, Niigata Pref.,
Gosen-shi (Nakakanbara-gun), 2.V1.1912, leg. K. Yoshino (TSH, sine num.).
EryMo.ocy: the name refers to the host species.
Sori in ovaries, scattered in the inflorescence, as subglobose or ovoid, black,
hard bodies, 1.8-2 mm long, when young covered by a thin membrane, later
becoming exposed; spore mass of the mature sori powdery on the surface.
Sporss flattened, in plane view moderately irregular, sometimes suborbicular or
broadly elliptical in outline, in plane view 19-26 x 16.5-23 (22.341.5 x 19.3+1.5)
um (n = 150), in side view 11.5-14 tm thick, middle to dark reddish brown,
wall slightly unevenly thickened, 1.5-2.5 (-3.3) tm thick, without internal
swellings, sometimes with one, without light-refractive spots; verruculose. In
SEM warts often forming small groups or short rows; the wall between the
warts finely and irregularly punctate. SPORE GERMINATION unknown.
DisTRIBUTION — On Cyperaceae: Carex — subgen. Carex, sect. Anomalae:
Carex dispalata, Asia Japan - Honshu).
Anthracoidea spp. nov. (Japan) ... 411
COMMENTS — Based on Egorova (1999), Carex dispalata is a representative
of sect. Anomalae sensu lato, which includes some smaller sections, described
by Japanese authors (e.g., Glaucaeformes Ohwi, Molliculae Ohwi, Confertiflorae
Franch. ex Ohwi, Dispalatae Ohwi, Alliiformes Akiyama). In a recently
published monograph of China (Dai et al. 2010), Carex dispalata is included
in sect. Confertiflorae. Carex dispalata is distributed in the Far East of Russia,
Sakhalin Island, south Kuril Islands, Japan, Korea, and NE and Central China.
Acknowledgements
We gratefully acknowledge Dr Kalman Vanky (Herbarium Ustilaginales Vanky,
Tubingen, Germany) and Dr Roger G. Shivas (Agri-Science Queensland, Australia) for
critically reading the manuscript and serving as pre-submission reviewers; and Director
and Curator of SAPA (Herbarium of Hokkaido University, Sapporo) for loan of the cited
specimen.
Literature cited
Dai LK, Liang SY, Zhang SR, Tang YC, Koyama T, Tucker GC. 2010. Carex L. 285-461, in ZY Wu
et al. (eds), Flora of China, vol. 23 (Acoraceae through Cyperaceae). Science Press, Beijing, and
Missouri Botanical Garden Press, St. Louis.
Denchev CM. 2001. Classis Ustomycetes (Ordines Tilletiales, Ustilaginales et Graphiolales). 1-286,
in V Fakirova (ed.), Fungi Bulgariae, vol. 4. Editio Academica “Prof. Marin Drinov” & Editio
Pensoft, Sofia. (In Bulgarian with an English summary)
Egorova TV. 1999. The sedges (Carex L.) of Russia and adjacent states (within the limits of the
former USSR). St. Petersburg State Chemical-Pharmaceutical Academy, St. Petersburg &
Missouri Botanical Garden Press, St. Louis. 773 pp.
Kukkonen I. 1963. Taxonomic studies on the genus Anthracoidea (Ustilaginales). Annales Botanici
Societatis Zoologicae Botanicae Fennicae “Vanamo” 34(3): 1-122.
Nannfeldt JA. 1979. Anthracoidea (Ustilaginales) on Nordic Cyperaceae-Caricoideae, a concluding
synopsis. Symbolae Botanicae Upsalienses 22(3): 1-41.
Scholz H, Scholz I. 1988. Die Brandpilze Deutschlands (Ustilaginales). Englera 8: 1-691.
Vanky K. 1979. Species concept in Anthracoidea (Ustilaginales) and some new species. Botaniska
Notiser 132: 221-231.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 413-423 January-March 2011
DOT: 10.5248/115.413
Notes on two species of Boletellus (Boletaceae, Boletales)
from China
NiAn-Kali ZENG??? & ZHU L. YANG**
'Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650204, China
2Department of Pharmacy, Hainan Medical University, Haikou 571101, China
3Graduate University of Chinese Academy of Sciences, Beijing 100039, China
CORRESPONDENCE TO *:
[email protected]
AsstTract — Based on studies of the types and additional materials, Boletellus emodensis
and B. obscurecoccineus are described and illustrated in detail. Strobilomyces annamiticus
is lectotypified and synonymized with B. emodensis; specimens from China regarded as
B. ananiceps are confirmed to represent B. emodensis; B. puniceus and Boletus megasporus,
originally described from southwestern China, are conspecific with B. obscurecoccineus.
Key worps — morphology, revision, taxonomy, type studies
Introduction
Species of Boletellus Murrill are widely distributed and highly diverse in
China, and about twenty-five taxa have been reported from the country (Chiu
1948, 1957; Teng 1963; Bi et al. 1982, 1984, 1997; Wen 1985; Zang 1985; Zang
& Yuan 1999; Zang et al. 1999; Li & Song 2003). Recently, some field and
laboratory observations on the species of genus Boletellus from southern and
southwestern China were made, and several herbarial specimens including
the types of two species were re-examined. ‘The field observations and critical
re-examinations indicate that some purported species of the genus are later
synonyms. Thus, our new findings update characteristics and distributions for
B. emodensis and B. obscurecoccineus.
Materials & methods
Basidiomata were collected during the rainy season (April-September) in southern
and southwestern China. Specimens were described and/or photographed in the
field, dried, and then deposited in the Herbarium of Cryptogams, Kunming Institute
of Botany, Chinese Academy of Sciences (HKAS). Additional collections from the
414 ... Zeng & Yang
Farlow Herbarium, Harvard University (FH), and the Fungal Herbarium of Guangdong
Institute of Microbiology (GDGM) were examined. 5% KOH was used as a mounting
medium for microscopic studies. The notations “basidiospores (n/m/p)” indicate that
the measurements were made on n basidiospores from m basidiomata of p collections.
Dimensions of basidiospores including the ornamentation are given using notation of
the form (a) b-c (d); the range b-c contains a minimum of 90% of the measured values,
and extreme values a and d are given in parentheses. Q refers to the length/breadth
ratio of basidiospores; Q_ refers to the average Q of basidiospores + sample standard
deviation. All line drawings of microstructures were made from rehydrated material.
Taxonomy
Boletellus emodensis (Berk.) Singer, Annls mycol. 40: 19, 1942. Figs. 1-11
= Boletus emodensis Berk., Hook. J. Bot. Kew Gard. Misc. 3: 48, 1851.
= Strobilomyces annamiticus Pat., Bull. Soc. Mycol. Fr. 25: 6, 1909.
= Boletellus annamiticus (Pat.) E.-J. Gilbert, Les Bolets: 107, 1931.
[The description below is based on HKAS 59211, HKAS 59213, GDGM 13229, HKAS
59214, HKAS 59212, HKAS 37832, and HKAS 54741.]
MACROCHARACTERS — BASIDIOMATA medium-sized. Piteus 4.5-9 cm in
diameter, convex to applanate; surface dry, purple to dull crimson, usually
fading to pale fawn in age, finely tomentose when young, then cracking into
large squamules; margin at first extended into a false veil and covering the
pores, then splitting radially, appendiculate with false veil remnants; context
0.8-1.1 cm thick in the center of pileus, yellowish, cyanescent strongly and
rapidly when injured. HyMENoOPHORE poroid, yellow, cyanescent strongly
and rapidly when injured, depressed around apex of stipe; pores 0.1-0.2 cm
in diameter, simple, angular. Stipe central, 6-8 x 0.8-1 cm, cylindric, solid,
firm; surface dry, fibrous, concolorous with the pileus, but apex yellowish; base
usually enlarged and villous with white mycelium; context yellow, cyanescent
strongly and rapidly when injured. ANNULUs absent (Fics. 1-5).
MICROCHARACTERS — Basip1A 34-52 x 11-17 uum, clavate, colorless to yellowish
brown in KOH, 4-spored (occasionally 2- or 3-spored) (Fic. 6). BASIDIOSPORES
[260/13/7] (16-)18-23(-25) x (7-)8-10(-12) pm, Q = (1.70-)1.89-2.75(-2.87),
Q.= 2.28 + 0.24, yellowish to yellowish brown in KOH, elongate-subfusoid
to elongate-ellipsoid, with longitudinal or oblique ridges, 7-9 ridges visible
in lateral view; ridges up to 1-1.5 um in height, round in transverse section,
having distinct transverse striations on the ridges (Fics. 7-9). TUBE TRAMA
made up of thin-walled, colourless to yellowish hyphae 5-13 wm in width.
CHEILOCYSTIDIA 48-66 x 11-16 um, subfusiform to fusiform, thin-walled,
colorless or yellowish to yellowish brown in KOH (Fic. 10), PLEUROCYSTIDIA
70-90 x 11-18 um, subfusiform to fusiform, colorless to yellowish brown in
KOH (Fic. 6), PILEIPELLIs an intricate trichoderm composed of interwoven,
Notes on Boletellus (China) ... 415
Fics. 1-2: Basidiomata of Boletellus emodensis (HKAS 59212). 1. Immature basidioma (HKAS
59215). 2. Fruiting habit on tree stump in forest dominated by Fagaceae, Fujian, China.
Bars = 2 cm.
thin-walled, yellowish to yellowish brown hyphae; terminal cells 19-35 x 7-11
um, with round to obtuse apex (Fic. 11). PILEAL TRAMA made up of thin-
walled, colorless to yellowish hyphae 5-15 tm in diameter. CLAMps absent in
all tissues.
HABIT, HABITAT, DISTRIBUTION — Solitary or gregarious on the ground, tree
stumps or rotten wood in forests dominated by Fagaceae; originally described
from India; then reported from southeast Asia (Corner 1972, Horak 1977),
east Asia (Hongo & Izawa 1994, Chen et al. 1997, Mao 2009, An 1998), and
Australia (Young 2004).
SPECIMENS EXAMINED — VIETNAM. Tonkin: Rives du Kam-ly, 1907, det. N.T.
Patouillard, Eberhardt LBA 161 (FH 3720 pro parte, Strobilomyces annamiticus lectotype
designated here); Vallée du Da-Pounian, 1907, det. N.T. Patouillard, Eberhardt LBA
209 (FH 3720 pro parte, Strobilomyces annamiticus). CHINA. Hainan Province: Baisha
County, Yinggeling Mountain, alt. 747 m, 28 July 2009, N.K. Zeng 384 (HKAS 59211);
same location and date, alt. 841 m, N.K. Zeng 379 (HKAS 59215); Qiongzhong County,
Limushan Mountain, alt. 869 m, 4 August 2010, N.K. Zeng 829 (HKAS 59213); Ledong
County, Jianfengling Mountain, 4 October 1987, T-H. Li s. n. (GDGM 13229, as “B.
ananaeceps” in Bi et al. 1997); Guangdong Province: Zhaoging County, Dinghushan
Mountain, alt. 233 m, 9 August 2010, N.K. Zeng 867 (HKAS 59214); Fujian Province:
Zhangping County, Xingiao Town, Chengkou Village, alt. 357 m, 3 September 2009,
N.K. Zeng 674 (HKAS 59212); Yunnan Province: Jingdong County, Qincaitang, 15
September 1999, Q.B. Wang 282 (HKAS 37832); Jiangcheng County, alt. 1400 m, 29 July
2008, L.P. Tang 510 (HKAS 54741).
COMMENTS — Boletellus emodensis is well characterized by its purple to dull
crimson pileus, a yellow context in both pileus and stipe that is strongly and
rapidly cyanescent in both when injured, longitudinally ridged basidiospores
with fine cross-striations on the ridges observable with the light microscope.
Although B. emodensis is quite common throughout east and southeast Asia, it
was not well characterized until the publication by Corner (1972).
416 ... Zeng & Yang
Strobilomyces annamiticus was described based on collections from Vietnam
(Patouillard 1909) and later transferred to Boletellus by Gilbert (1931). One of
us (ZLY) studied the syntypes of S. annamiticus deposited in Farlow Herbarium,
Harvard University (FH 3720), which consist of two collections, both identified
as S. annamiticus by N.T. Patouillard. One collection (Eberhardt LBA 161) is
composed ofa single fruitbody (Fic. 5). The dried cap is about 1 cm in diameter,
convex, dark chocolate brown, covered with dull chocolate brown tomentose
squamules, and the pileal margin is appendiculate. The stipe is 7 x 0.3 cm,
with the base apparently attached to wood. ‘The basidiospores (Fic. 8) are
[20/1/1] (20-)21-24(-26) x (6.5-)7-8.5 um, Q = 2.63-3.29(-3.69), Q, = 2.95
+ 0.30, yellowish to yellowish brown in KOH, elongate-subfusoid to elongate-
ellipsoid, with longitudinal or oblique ridges, 7-9 ridges visible in lateral view,
with ridges up to 1 um in height, having indistinct transverse striations on the
ridges. The other collection (Eberhardt LBA 209) consists of a dried cap which
is 1.5-2 cm in diameter, convex to applanate, dark to blackish. ‘The stipe is 5 x
0,2-0.4cm, on rotten wood. The basidiospores (Fig. 9) are [20/1/1] (15-)16-18 x
(6.5-)7.5-8.5 pm, Q = (1.76-)1.88-2.33(-2.46), Q., = 2.10 + 0.16, yellowish
brown in KOH, elongate-subfusoid to elongate-ellipsoid, with longitudinal or
oblique ridges, 7-9 ridges visible in lateral view, with ridges up to 1 (1.5) um
in height, round in transverse section, having distinct transverse striations on
ridges.
In the protologue of Strobilomyces annamiticus, Patouillard (1909) cited two
localities that correspond exactly with the localities of the collections Eberhardt
LBA 161 and Eberhardt LBA 209. Eberhardt LBA 161 is designated here as
lectotype. Singer (1945) regarded the two Vietnamese collections as immature
basidiomata of B. emodensis, and S. annamiticus was synonymized with
B. emodensis. With our re-examination of the syntypes and field observation
on other collections, the present authors are convinced that the basidiomata
of the two Vietnamese collections are the same as immature basidiomata of
B. emodensis, because the size of basidiospores of B. emodensis may be variable
at different stages of basidioma development. For example, the basidiospores
of one immature basidioma (HKAS 59215) are [20/1/1] 15-18(-19) x 5-7 um,
with Q = (2.14-)2.29-3.17(-3.20) and Q. = 2.73 + 0.28. They are clearly much
shorter and narrower when compared to mature collections. This explains why
the basidiospores from the two Vietnamese collections are slightly narrower
(and Eberhardt LBA 209 slightly shorter) compared with mature Chinese
material and the holotype (20-24 x 8-10 um) (Pegler & Young 1971: 163)
of B. emodensis, and further confirms that S. annamiticus is a synonym of
B. emodensis, as noted by Singer (1945).
Boletellus ananiceps (Berk.) Singer, originally described from Australia, is
allied to B. emodensis. However, B. ananiceps has been noted to differ from
Notes on Boletellus (China) ... 417
Fias. 3-11: Boletellus emodensis (= B. annamiticus) [3 from HKAS 59215; 4 from HKAS 59212;
5, 8 from Eberhardt LBA 161 of FH 3720 (B. annamiticus); 6, 7, 10, 11 from HKAS 59211; 9 from
Eberhardt LBA 209 of FH 3720 (B. annamiticus)]. 3-5. Basidiomata. 6. Basidia and pleurocystidia.
7-9. Basidiospores. 10. Cheilocystidia. 11. Pileipellis. Bars: 3-5 = 2 cm, 6-11 = 20 um.
418 ... Zeng & Yang
B. emodensis by its longitudinally ridged basidiospores that lack cross-striations
on the ridges (Singer 1955, Bougher & Syme 1998, Halling & Fechner 2011).
In China, B. ananiceps was previously reported from Hainan (Bi et al. 1997)
with three cited collections (GDGM 13229, GDGM 16785, GDGM 15741).
Unfortunately, the voucher specimens GDGM 16785 and 15741 were lost
(Ms. Z.D. Xiao, personal communication). Re-examinations of GDGM
13229 showed that that collection is identical to B. emodensis in its purple to
dull crimson pileus and obvious cross-striations on the basidiospore ridges.
Therefore, whether B. ananiceps occurs in China remains to be confirmed.
Boletellus ananas (M.A. Curtis) Murrill, a species originally described from
USA, is also allied with B. emodensis. However, the pileus of the former is pink
or red when fresh and becomes pale fuscous tan when it fades; the stipe is
never red, as in B. emodensis; the squamae in B. ananas are coarse, while in
B. emodensis usually fine. Furthermore, the ridges on the basidiospores are
broader than those of B. emodensis (Halling 2010). In China, B. ananas was
previously reported from the south of China (Chiu 1948, 1957; Teng 1963;
Zang 1985; Bi et al. 1994). Judging from their descriptions, these reports may
represent B. emodensis. Thus, whether B. ananas occurs in China also needs
confirmation.
Boletellus obscurecoccineus (Hohn.) Singer, Farlowia 2:127, 1945. Fics. 12-22
= Boletus obscurecoccineus Hohn., Sber. K. Akad. Wiss. Wien,
Math.-naturw. KL, Abt. 1, 123: 88, 1914.
= Boletus puniceus W.F. Chiu, Mycologia 40(2): 217, 1948.
= Xerocomus puniceus (W.F. Chiu) EL. Tai, Syll. Fung. Sin.: 815, 1979.
= Boletellus puniceus (W.F. Chiu) X.H. Wang & P.G. Liu, Mycotaxon 84: 128, 2002.
= Boletus megasporus M. Zang, Acta Microbiol. Sin. 20(1): 30, 1980, as “magasporus”.
[The description below is based on FH 2993, HKAS 59208, HKAS 59209, and HKAS
59210.]
MACROCHARACTERS — BasIDIOMATA small to medium-sized. PiLeus 1.5-7 cm
in diameter, convex to applanate; surface dry, pink to pale crimson when fresh,
becoming dark purplish red to dark purple when dried, finely tomentose when
young, then minutely cracked; context yellowish, unchanging in color when
injured. HyMENOPHORE poroid, yellow, unchanging in color when injured,
depressed around apex of stipe; pores 0.1- 0.2 cm in diameter, simple, angular.
STIPE central, 3-5 x 0.2-0.8 cm, cylindric, slightly attenuate upwards, solid,
firm, apex yellowish, middle finely tomentose when young, then fracturing
into pale crimson squamules, with base usually enlarged and villous with white
mycelium; context whitish, unchanging in color when injured. ANNULUs absent
(Figs. 12-16).
MICROCHARACTERS — Basipia 42-55 x 8-12 um, clavate, colorless
to yellowish in KOH, 4-spored (sometimes 2- or 3-spored) (Fic. 17).
Notes on Boletellus (China) ... 419
Fics. 12-13: Basidiomata of Boletellus obscurecoccineus (HKAS 59208). 12. Fruiting habit on soil in
forest dominated by Lithocarpus, Hainan, China. 13. Ventral. Bars = 2 cm.
Basiprosporgs [140/7/4] (14-)14.5-18(-20.5) = (5-)6-8(-9.5) um, Q =
(1.81-)2.00-2.77(-3.30), Q. = 2.32 + 0.26, brownish to pale ochraceous in
KOH, elongate-subfusoid to elongate-ellipsoid, with 7-10 faintly longitudinal
ridges in lateral view, not transversely striate on ridges (Fics. 18-19). TUBE
TRAMA made up of thin-walled hyphae 4-9 um in width, colorless to yellowish
in KOH. CHEILocystTipia 32-87 x 11-17 wm, subfusiform to fusiform, thin-
walled, colorless to yellowish in KOH (Fic. 20). PLEUROCysTIDIA similar to
cheilocystidia (Fic. 17). PILEIPELLIs an epithelioid trichoderm made up of
vertically arranged, ellipsoid, occasionally sphaeropedunculate, thin-walled
(sometimes up to 1 um in thickness), yellowish to yellowish brown hyphae;
terminal cells 22-54(-90) x 9-15(-60) um, with round to obtuse apex (Fics.
21-22). PILEAL TRAMA made up of thin-walled, colorless to yellowish hyphae
6-12 um in diameter. CLAMPs absent in all tissues.
HABIT, HABITAT, DISTRIBUTION — Solitary or scattered on the ground in forests
of Lithocarpus (Fagaceae), occasionally on rotten wood; originally described
from Indonesia (Hohnel 1914: 88), and later reported from east Asia (Hongo
1970, Wen 1985, Chen et al. 1997, An 1998, Wang & Liu 2002, Yuan & Sun
2007), southeast Asia (Corner 1972, Horak 1977) and Australia (May & Wood
1997, Bougher & Syme 1998).
SPECIMENS EXAMINED — INDONESIA. Java: Tjibodas, 1908, leg. EX.R. v. Héhnel,
Boletus 1187 (FH 2993, holotype). Cain. Hainan Province: Baisha County, Yinggeling
Mountain, alt. 943 m, 26 July 2009, N.K. Zeng 328 (HKAS 59208); same location and
date, alt. 968 m, N.K. Zeng 335 (HKAS 59209); same location, alt. 824 m, 28 July 2009,
N.K. Zeng 367 (HKAS 59210).
COMMENTS — Boletellus obscurecoccineus is well characterized by its pink to
pale crimson pileus, faintly longitudinally ridged basidiospores combined with
the broad pores, and non-cyanescent context.
One of us (ZYL) studied the holotype of B. obscurecoccineus, which consists
of two and a half basidiomata. The dried cap is about 3-5 cm in diameter, the
420 ... Zeng & Yang
Fias. 14-22: Boletellus obscurecoccineus (14, 17, 20, 22 from HKAS 59210; 15, 18 from HKAS
59208; 16, 19, 21 from FH 2993, holotype).14-16. Basidiomata. 17. Basidia and pleurocystidium.
18-19. Basidiospores. 20. Cheilocystidia. 21-22. Pileipellis. Bars: 14-16 = 2 cm, 17-22 = 20 um.
Notes on Boletellus (China) ... 421
pileal surface is finely tomentose and dark purplish red to dark purple when
dried, the hymenophore is umber-brown, with pores about 1 mm in diameter,
the stipe (4-5 x 0.4-0.6 cm) attenuates slightly upwards, and the surface
is finely tomentose, whitish to ochraceous, much paler than cap (Fic. 16).
Basidia and cystidia would not rehydrate sufficiently for study. Basidiospores
(Fra. 19) are [21/1/1] (15-)16-20.5 x 7.5-8.5(-9.5) um, Q = 2.00-2.38(-2.47),
Q. = 2.20 + 0.13, brownish to pale ochraceous in KOH, elongate-subfusoid
to elongate-ellipsoid, with 7-10 faint longitudinally ridges in lateral view,
without transverse striations on ridges. The pileipellis (Fic. 21) is an epithelioid
trichoderm made up of vertically arranged, moniliform hyphae with ellipsoid,
occasionally sphaeropedunculate, thin-walled elements, often with yellowish-
brownish vacuolar pigment; terminal cells are 25-50(-90) x 10-15(-60) um,
with round to obtuse apex.
Boletus puniceus was originally described from Yunnan, China (Chiu 1948,
1957). Without examining the type of B. puniceus, Corner (1972) suspected
B. puniceus was conspecific with B. obscurecoccineus. Wang & Liu (2002) re-
examined the type of B. puniceus (HMAS3852) and found the basidiospores to
be [74/1/1] 15-18(-19.3) x (6.3-)6.7-8(-9) um, Q = (1.90-)2.05-2.54(-2.64),
Q_ = 2.30 + 0.16, with faint longitudinal ridges, and the species was transferred
to Boletellus, with Boletus megasporus included as a synonym. ‘The present
type studies showed no essential differences among B. obscurecoccineus,
B. megasporus and B. puniceus, suggesting that they are conspecific.
Mao (2000: Fig. 830) published a photo labelled as Aureoboletus [as
“Austreoboletus”| thibetanus (Pat.) Hongo & Nagas. Judging from the features
of the basidiomata in the photo, it may represent B. obscurecoccineus, as
previously noted by Yang et al. (2003).
Acknowledgments
The authors are very grateful to the following: Dr. Roy E. Halling, New York Botanical
Garden, USA, and Prof. Dr. T.H. Li, Guangdong Institute of Microbiology, China, for
serving as reviewers; Prof. Dr. D.H. Pfister, Farlow Herbarium of Harvard University,
USA, for his allowing the second author access to the specimens in the Herbarium and
use his laboratory to examine the collections; Prof. Dr. T.-H. Li, Ms. C.-Y. Deng & Ms.
Z.D. Xiao, Guangdong Institute of Microbiology, for assisting the first author to study
the Boletellus specimens deposited in the institute; Dr. Z.W. Ge, Associate Prof. L.P. Tang
& Mr. M.I. Hosen, Kunming Institute of Botany of CAS, for their suggestions on writing
this manuscript; Mr. J.Q. Li, Hainan Medical University, for his accompanying the first
author to conduct the field investigation and collection. This study was financed by the
Ministry of Science and Technology of China (2008FY110300-03-1).
Literature cited
An YH. 1998. Notes on Korean Strobilomycetaceae (II) — On Boletellus. Korean J. Mycol. 26(2):
211-229,
422 ... Zeng & Yang
Bi ZS, Lu DJ, Zheng GY. 1982. Basidiomycetes from Dinghu Mountain of China II. Some new
species of Boletaceae (1). Acta Bot. Yunnan. 4: 55-64.
Bi ZS, Li TH, Zheng GY, Li C. 1984. Basidiomycetes from Dinghu Mountain of China III. Some
species of Boletaceae (2). Acta Mycol. Sin. 3(4): 199-206.
Bi ZS, Zheng GY, Li TH. 1994. Macrofungus Flora of Guangdong Province. Guangzhou: Guangdong
Science and Technology Press.
Bi ZS, LiTH, Zhang WM, Song B. 1997. A preliminary agaric flora of Hainan Province. Guangzhou:
Guangdong Higher Education Press.
Bougher NL, Syme K. 1998. Fungi of Southern Australia. Western Australia: University of Western
Australia Press.
Chen CM, Huang HW, Yeh KW. 1997. The boletes of Taiwan (VI). Taiwania 42: 154-160.
Chiu WE. 1948. The boletes of Yunnan. Mycologia 40: 199-231. doi:10.2307/3755085
Chiu WE. 1957. Atlas of Yunnan boletes. Beijing: Science Press.
Corner EJF. 1972. Boletus in Malaysia. Singapore: Government Printer.
Gilbert EJ. 1931. Les Bolets. Paris.
Halling RE. 2010. Identification aid: Boletellus sect. Boletellus. Surveys & revisions in Boletineae.
http://www.nybg.org/bsci/res/hall/boletes/ananas_v_emodensis.html
Halling RE, Fechner NA. 2011. Toward a concept for Boletellus ananiceps. Fungimap Newsletter
A2: 3-4,
Héhnel FXR von. 1914. Fragmente zur Mykologie (XVI. Mitteilung, Nr. 813 bis 875). Sber. K.
Akad. Wiss. Wien, Math.-naturw. KL, Abt. 1, 123: 49-155.
Hongo T. 1970. Notulae mycologicae (9). Mem. Fac. Educ. Shiga Univ., Nat. Sci. 20: 49-54.
Hongo T, Izawa M. 1994. Yama-Kei field books No. 10. Tokyo: Yama-Kei.
Horak E. 1977. Boletellus and Porphyrellus in Papua New Guinea. Kew Bull. 31(3): 645-652.
doi:10.2307/4119416
Li TH, Song B. 2003. Bolete species known from China. Guizhou Sci. 21(1-2): 78-86.
Mao XL. 2000. The macrofungi in China. Zhengzhou: Henan Science and Technology Press.
Mao XL. 2009. Macromycetes of China. Beijing: Science Press.
May TW, Wood AE. 1997. Catalogue and bibliography of Australian macrofungi 1. Basidiomycota
p-p. Fungi of Australia volume 2A. Australian Biological Resources Study: Canberra.
Patouillard NT. 1909. Quelques champignons de 'Annam. Bull. Soc. Mycol. France 25: 1-12.
Pegler DN, Young TWK. 1971. Basidiospore morphology in the Agaricales. Beih. Nova Hedwigia
35: 1-210, pls. 1-53.
Singer R. 1945. The Boletineae of Florida with notes on extralimital species. I. The Strobilomycetaceae.
Farlowia 2: 97-141.
Singer R. 1955. Type studies on Basidiomycetes. VIII. Sydowia 9: 367-431.
Teng SC. 1963. Fungi of China. Beijing: Science Press.
Wang XH, Liu PG. 2002. Notes on several boleti from Yunnan, China. Mycotaxon 84: 125-134.
Wen HA. 1985. New species and new records of genus Boletellus from China. Acta Mycol. Sin. 4:
222-226.
Yang ZL, Wang XH, Binder M. 2003. A study of the type and additional materials of Boletus
thibetanus, Mycotaxon 86: 283-290.
Young T. 2004. A field guide to the fungi of Australia. Sydney: University of New South Wales
Press.
Yuan MS, Sun PQ. 2007. Atlas of Chinese mushrooms. Chengdu: Sichuan Science and Technology
Press.
Notes on Boletellus (China) ... 423
Zang M. 1980. Some new species of Basidiomycetes from the Xizang Autonomous Region of China.
Acta Micro. Sin. 20: 29-34.
Zang M. 1985. Notes on the Boletales from eastern Himalayas and adjacent of China. Acta Bot.
Yunnan. 7: 383-401.
Zang M. 2006. Flora Fungorum Sinicorum. Vol. 22. Boletaceae (1). Beijing: Science Press.
Zang M, Yuan MS. 1999. Contribution to the knowledge of new basidiomycoteous taxa from
China. Acta Bot. Yunnan. 21: 37-42.
Zang M, Chen CM, Sittigul C. 1999. Some new and interesting taxa of Boletales from tropical Asia.
Fungal Sci. 18: 19-25.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 425-433 January-March 2011
DOT: 10.5248/115.425
Aspergillus flavus — primary causative agent of aflatoxins
in dried figs
H. IMcGe Oxtay"’, DILEK HEPERKAN?,
EMRAH YELBOGA?* & NEVIN GUL KARAGULER?**
1TUBITAK Marmara Research Center Food Institute, 41470 Kocaeli Turkey
? Faculty of Chemical and Metallurgical Engineering, Department of Food Engineering,
Istanbul Technical University, 34469 Istanbul Turkey
3 Faculty of Science and Letters, Department of Molecular Biology and Genetics,
Istanbul Technical University, 34469 Istanbul Turkey
“ Molecular Biology-Biotechnology & Genetics Research Center (MOBGAM),
Istanbul Technical University, 34469 Istanbul Turkey
* CORRESPONDENCE TO:
[email protected]
ApsTRAcT — Aspergillus sect. Flavi isolates from Turkish dried figs have been determined
using PCR amplification of the ITS1 and ITS2 rDNA regions. Species were identified
by comparing partial 18S rDNA sequences from 57 different fungal isolates comprising
5 A. parasiticus strains, 1 A. tamarii strain, and 51 A. flavus strains with known ribosomal
sequences using BLAST search. Sequence comparisons between the isolates and reference
cultures showed a 95-99% similarity; morphological and phenotypical character comparisons
of the same strains produced equally close similarities. The sole exception was an aflatoxin
B, and B, producing strain that cannot produce cyclopiazonic acid; this strain, originally
identified as A. flavus, was instead found to represent A. parasiticus.
Key worps — Aspergillus parasiticus, Polymerase Chain Reaction, dried fruit, ITS, CPA
Introduction
The Aspergillus flavus group commonly found in nature is one of the most
widely studied fungal species. Aspergillus flavus, A. parasiticus, A. nomius,
A. pseudotamarii, and A. bombycis produce aflatoxin, a potent carcinogenic
toxin, while A. oryzae, A. sojae, and A. tamarii are non-toxigenic species widely
used in the production of fermentation products throughout Asia (Frisvad et
al. 2007). Although these fungi are commonly used to produce enzymes and
fermentation products, some cause serious problems through contamination
of food and foodstuffs.
Aflatoxins (AFs), naturally occurring secondary metabolites, are potent
hepatotoxic, mutagenic, and carcinogenic toxins causing serious health hazards
426 ... Oktay & al.
in humans and animals. Aflatoxin BiB sta and G, are found predominantly
in food whereas M, and M, aflatoxins are found primarily in animal tissues
and fluids (milk, urine) as the hydroxylated metabolic products of aflatoxins B,
(AFB,) and B, (AFB,) respectively (Richard 2007). Special interest is given to
AFs due to their high occurrence and toxicity. The most toxic aflatoxin known,
AFB,, is cited as a group I carcinogen by the International Agency for Research
on Cancer (IARC 1993). The maximum levels of AFB, and total aflatoxins
allowable in dried fruits as determined by Commission of the European
Communities are 2 and 4ug/kg respectively. Aflatoxigenic fungi occur in such
food commodities as corn, peanuts, cottonseed, nuts, spices, figs, and dried
fruits (Pitt & Hocking 1997), Aflatoxigenic fungi may contaminate foods
throughout several stages (pre-harvest, processing, transportation, storage) of
the food chain (Manonmani et al. 2005). The level of mould infestation and
identification of species are important indicators of raw material quality and
predictors of the potential risk of mycotoxin occurrence (Shapira et al. 1996).
Fungi in foods can be identified using traditional morphological and
phenotypic observations of cultures in different media. However, such methods
are time consuming and laborious and require mycological expertise and
special facilities. Also, because morphological characters can vary over time,
they should be verified by the mycotoxigenic profile of the strains (Samson et
al. 2007). Furthermore, traditional methods do not distinguish toxigenic from
non-toxigenic forms. For these reasons, application of molecular techniques
has become increasingly important in detecting and characterizing potential
contaminants within the food-processing industry. These methods are very
rapid, specific, and sensitive compared to traditional methods.
‘There are two approaches in identifying aflatoxigenic fungi through PCR-
based methodology. The first uses standard PCR to detect aflatoxigenic
fungi in foods. In this technique, the contiguous Internal Transcribed Spacer
(ITS) regions in fungal DNA fungi are amplified, sequenced, and compared
extensively with sequences in GenBank (Hinrikson et al. 2005; Rodrigues et
al. 2007; Gonzalez-Salgado et al. 2008). The second approach is especially
useful for the strains having nearly identical genes, as the PCR reaction
targets six aflatoxin biosynthesis genes, namely; aflatoxin regulatory genes
(AFLR, AFLS), norsolorinic acid reductase (NOR-1 = AFLD), versicolorin A
dehydrogenase (VER-1) sterigmatocystin-o-methyltransferase (OMT-A),
polyketide synthase (pKsA), and ApA-2 in A. flavus and A. parasiticus (Shapira
et al. 1996; Somashekar et al. 2004; Manonmani et al. 2005; Rodrigues et al.
2009). We used the first approach to detect ITS sequences from 57 Aspergillus
sect. Flavi isolates, which had been previously characterized according to their
morphological and phenotypic characters, from Turkish dried figs. This is the
first report of molecular analyses of Aspergillus sect. Flavi strains isolated from
a Turkish agricultural commodity.
Aspergillus flavus in figs (Turkey) ... 427
Materials & methods
Fungal isolates and culture conditions
Fifty-seven strains of A. flavus, A. parasiticus, and A. tamarii, isolated from dried
figs from the west of Turkey (Aegean region), were selected. The isolates had been
previously morphologically and phenotypically identified to species level (Heperkan &
Karbancioglu-Gtiler 2009). All fungal cultures were maintained on slant malt extract
agar (MEA) and stored at 4°C. Incubation was performed at 25°C for 5 days. Cultures
were inoculated with 1 cm diameter mycelial disks cut from the plates and incubated
in 30 ml Erlenmeyer flasks containing 20 ml of Potato Dextrose Broth (PDB) at 25°C
and 150 rpm. Mycelia from 2-day-old cultures were harvested by filtration through
Whatman No.1 paper and kept at -80°C for DNA isolation.
Fungal DNA extraction
Template DNA was extracted from 50-100 mg (wet weight) of fungal mycelia
harvested from freshly growing cultures in PDB under stationary conditions. DNA was
isolated by using ZR fungal / bacterial DNA system (purchased from Zymo Research,
Orange, CA, USA) according to the manufacturer's protocol.
PCR amplification
DNA was amplified by PCR using fungal-specific 188 rDNA primers ITS1 (5’-
TCCGTAGGTGAACCTGCGG-3’) and ITS4 (5’°-TccTCCGCTTATTGATATGC-3’). The PCR
amplification protocol was as follows: 1 cycle of 95°C for 5 min, 30 cycles of a set
including 95°C for 1 min, 55°C for 1 min and 72°C for 1 min 40 s and a final cycle
of 72°C for 10 min. Amplification of fungal DNA was carried out in a total reaction
volume of 50 ul, containing 1 ul of template DNA, 1 pl of each primer, 5 ul of 10 x PCR
buffer, 4 ul of MgCl, (25 mM), 1 pl of dNTPs and 0.5 ul of Taq DNA polymerase. The
PCR reaction was performed using Biometra T Professional Thermocycler (Biometra,
Goettingen, Germany).
DNA sequencing & analysis
Sequencing was carried out using an ABI PRISM 3100-Avant automated sequencer at
the Molecular Biology and Genetics Department, ITU. Both strands of the PCR product
were sequenced with the same primers. The resultant nucleotide sequences were aligned
with MEGA sequence analysis software version 4.0 (Tamura et al. 2007).
Species were identified by comparing the partial 18S rDNA sequences with known
ribosomal sequences using BLAST (Basic Local Alignment Search Tool). Comparisons
of reference strain and isolate sequences were performed using Clustal W alignment
algorithm. Sequence variation and similarity between sampled sequences were
determined with MEGA 4.0 software; sequences were visually confirmed using pairwise
nucleotide alignments.
Results & discussion
ITS regions from 57 Aspergillus sect. Flavi strains were sequenced to identify
the species at the molecular level. ITS regions, located between the 18S and 28S
RNA genes, offer distinct advantages over other molecular regions due to the
existence of approximately 100 copies per genome. Amplification of the ITS
428 ... Oktay & al.
M123 45 678 91011 M 12 13 14 15 16 17 18 19 20 2122 23 M 24 25 26 27 28 29 30 31
beled] Lelel Lelahed «MM laleded lehahed ded bebe Her A ee
were eee wWrer -seeqgeew
M 32 33 34 35 36 37 38 39 40 41 42 M4344 45 46 4748 49 SO 51 525354. M 55 56 S7
Ficure 1. Agarose gel analysis of PCR products from genomic DNA of fungal cultures. Lane M,
DNA molecular size marker (Lambda/HindIID); Lanes 1-7, 9-24, 26-28, 30, 32-35, 37-41, 43-57,
A. flavus; Lanes 8; 25; 31; 36; 42, A. parasiticus; Lane 29, A. tamarii.
M 1234567891011 M 121314 1516 1718 19202122 M 23 2425 26 27 28 2930 31 32
— 600 bp
-———-— “ ——— _——=- t — 600 bp
M 33343536 373839404142 M 43 44 45 46 47 48 49 S50 51 52 53 54 M 55 S6 57
FicurE 2. Agarose gel analysis of PCR amplification products from strains using ITS1-ITS4
primers. Lane M, PhiX174 DNA/BsuRI HAEIII marker; Lanes 1-7, 9-24, 26-28, 30, 32-35, 37-41,
43-57, A. flavus; Lanes 8, 25, 31, 36, 42, A. parasiticus; Lane 29, A. tamarii.
regions from the samples generated PCR products around 600 bp long. FicuREs
1 and 2 show the results of gel electrophoresis for genomic DNA isolation and
PCR amplification, respectively.
A matrix comparing the ITS1 and ITS4 sequence similarities among the four
Aspergillus reference species is depicted in TABLE 1.
Since the strains were previously identified as Aspergillus sect. Flavi using
morphological and phenotypical criteria (Heperkan & Karbancioglu-Gtler
2009), only Aspergillus sect. Flavi species were used for reference. Similarities
between the isolate ITS sequences and the reference strain sequence of the
same Aspergillus species are shown in TABLE 2.
We followed protocols set forth by Gonzalez-Salgado et al. (2008) for
differentiating A. flavus and A. parasiticus species in wheat flour. Although
several PCR-based methods use aflatoxin biosynthetic genes to detect
Aspergillus flavus in figs (Turkey) ... 429
TABLE 1. Matrix of ITS region similarities (%) for Aspergillus reference species
Aspergillus spp.
(isolate codes) / base pairs (bp)
. flavus
oryzae
. parasiticus
. pseudotamarii
A, flavus (ATCC 16883) / 595
A, oryzae (ATCC 4814) / 555
A. parasiticus (NRRL 2999) / 576
A, sojae (IFO 4386) / 576
A. tamarii JCM 2259) / 579
A, pseudotamarii (NRRL 25517) / 598
TABLE 2. Molecular identification of Aspergillus sect. Flavi isolates
ITS1/ITS4 Similarity | Isolate i ITSL/ITS4 : Similarity i Isolate
: sequence : (%) : name : sequence : (%) : name
Nowe: similarities: i Noo similarities 3
(out of 5) (out of 5)
3He3 i i A, tamarii
430 ... Oktay & al.
aflatoxigenic fungi, it has been always a major problem to separate A. flavus
from A. parasiticus, as the latter is always more easily amplified. It is believed
that this might explain the high similarity in the specific primers used to
amplify aflatoxin biosynthesis genes. However, ITS amplification allows us to
differentiate these closely related species with greater sensitivity than single
copy genes. The ITS region, which has been used for phylogenetic analysis
for almost 20 years, offers distinct advantages because it customarily displays
sequence variation between species as well as the minor variations within the
strains of the same species. One disadvantage, however, is that the ITS region
cannot differentiate toxigenic from non-toxigenic species. Potential toxigenicity
of the fungi is better assessed by either monitoring several genes involved in the
toxin biosynthetic pathway or analyzing mycotoxins using HPLC (Urano et al.
1992, Stroka & Anklam 2000), LC-MS (Rundberget & Wilkins 2002), and/or
LC-MS/MS (Spanjer et al. 2008).
Gonzalez-Salgado et al. (2008) were the first to attempt to detect A. flavus
and A. parasiticus using a multicopy region (ITS). We used specific primers to
amplify ITS1 and ITS2 conserved 18S rDNA regions and compared the
results with the reference cultures. Gonzalez-Salgado et al. (2008) initially had
difficulties in differentiating A. flavus from A. oryzae and A. parasiticus from
A. sojae due to the small (1-2 bp) difference separating these species. To
eliminate this problem, we duplicated the amplification of some isolates. The
molecular identifications were tested with 57 different fungal-isolates shown
in TABLE 2. Results compared with the reference cultures showed a 95-99%
similarity.
Henry et al. (2000), Geiser et al. (2007), Sanchez-Hervas et al. (2008), and
Karthikeyan et al. (2009) have all noted the ability of molecular techniques
to differentiate Aspergillus species. For example, Aspergillus sect. Flavi and
Nigri species isolated from cocoa beans were first identified macro- and
microscopically and the identity of the different isolates was confirmed through
5.8S-ITS rDNA sequencing after PCR amplification using the universal
primers ITS4 and ITS5. Aspergillus spp. (including A. flavus and A. tamarii)
and Penicillium spp. thought to represent different species were isolated and
identified by ITS sequencing (Sanchez-Hervas et al. 2008).
Genetic variability among the A. flavus isolates was investigated by PCR
amplification (using ITS1 and ITS4 primers) and sequencing of the ITS1,
ITS2, and 5.88 rRNA regions from A. flavus isolates, yielding products of
approximately 580 base pairs in length. Nucleotide sequences were compared
with A. flavus ITS sequences in the Genbank database. Analysis of the genetic
coefficient matrix derived from the ITS nucleotide sequences from A. flavus
isolates showed that % similarities among the tested A. flavus strains ranged
from a minimum of 12% to a maximum of 99% (Karthikeyan et al. 2009).
Aspergillus flavus in figs (Turkey) ... 431
This molecular approach is also used to identify Aspergillus species from
human exudates in the health sector. For example, A. flavus, A. fumigatus,
and A. terreus — the most frequent causes of invasive mould infections in
immunocompromised patients — have been identified by amplification of
ITS1 and ITS2 conserved regions of 185 and 28S rDNA (Henry et al. 2000).
Clinical application of this approach allowed the earlier diagnosis and selection
of effective antifungal agents for patients with invasive aspergillosis. Most
recently, serial specimens from 26 patients with documented fungal infections
have been investigated by using the PCR-based ITS2 region amplification. The
fungal pathogens identified were different Aspergillus and Candida species,
Rhizopus oryzae and Fusarium oxysporum (Landlinger et al. 2009).
Molecular techniques have also been widely applied in an attempt to
differentiate aflatoxigenic and non-aflatoxigenic strains of Aspergillus species.
Morphological, chemical, and molecular characterizations of 31 Aspergillus sect.
Flavi isolates from Portuguese almonds were used to identify aflatoxigenic and
non-aflatoxigenic strains. Morphological characterization classified 18 isolates
as A. parasiticus and 13 isolates as A. flavus. Aflatoxins and cyclopiazonic acid
(CPA) production of isolates investigated for the chemical characterization
revealed that all A. parasiticus isolates were strong AFB and AFG producers
but did not produce CPA. Furthermore, 8% of A. flavus isolates were found to
produce all 3 mycotoxin groups (i.e., AFB,, AFB,, CPA), while 77% of A. flavus
isolates were classified as atoxigenic. Two genes of the aflatoxin biosynthetic
pathway [AFLD (NoR1), AFLQ (ORD1=ORDA)] were investigated using
molecular techniques. Although the arLD gene did not show any correlation
with aflatoxigenicity, AFLQ did show some correlation. AFLD and AFLQ are not
the only genes to distinguish the toxigenicity of Aspergillus sect. Flavi species.
Three other genes — VER-1, OMT-1, and APA-2 coding for key enzymes and a
regulatory factor in aflatoxin biosynthesis — have been used to detect A. flavus
and A. parasiticus species in grains and foods. Good results have been obtained
only with the DNA of the aflatoxigenic moulds, namely A. parasiticus and
A. flavus (Shapira et al. 1996).
Different food and feed commodities from Mysore City in India have
been examined to isolate aflatoxin-producing fungi and assess aflatoxins in
commodities by targeting the AFLR and omr aflatoxin biosynthesis genes.
Although useful for detecting the A. flavus group, however, this protocol did
not distinguish aflatoxin producers from non-producers (Somashekar et al.
2004). Another Indian study used PCR-based amplification of the aflatoxin
regulatory gene AFLR for rapid detection of aflatoxigenic fungi in groundnuts
and maize (Manonmani et al. 2005).
Our molecular analyses have produced results comparable to those
obtained by the identification of the same strains using morphological and
432 ... Oktay & al.
phenotypical characters by Heperkan & Karbancioglu-Gtiler (2009). We did
detect a difference for one isolate — the aflatoxin B, and B, producer strain
originally identified as A. flavus (isolate 36) was in fact shown by sequence
analyses to represent A. parasiticus (Oktay & Heperkan unpublished data).
The mycotoxigenic character of isolate 36 was re-analyzed with HPLC, which
showed that it produced aflatoxin B, and B, but not CPA, so describing isolate
36 as an aflatoxin B, and B, producer would be more appropriate. Our result
does not agree with related literature and serves as a first indication of an
unusual mycotoxin pattern in A. parasiticus.
In conclusion, the contiguous ITS region is a very useful approach for
verification of morphologically and phenotypically pre-identified Aspergillus
sect. Flavi species.
Acknowledgments
The authors are grateful to Prof. Dr. Vildes M. Scussel (Food Science and Technology
Department, Centre of Agricultural Sciences, Santa Catarina Federal University) and
Assist. Prof. Dr. Fatma Nese Kok (Department of Molecular Biology and Genetics,
Istanbul Technical University) for serving as pre-submission reviewers. The authors also
wish to thank Dr. Shaun Pennycook for nomenclatural review and the Editor-in-Chief
for her excellent contribution to the language.
Literature cited
Frisvad JC, Thrane U, Samson R. 2007. Mycotoxin producers. 135-140, in: Dijksterhuis J, Samson
RA (eds), Food Mycology. CRC press, Taylor and Francis Group. doi: 10.1201/9781420020984.
ch8
Geiser DM, Klich MA, Frisvad JC, Peterson SW, Varga J, Samson RA. 2007. The current status
of species recognition and identification in Aspergillus. Studies in Mycology 59: 1-10. doi:
10.3114/sim.2007.59.01
Gonzalez-Salgado A, Gonzalez-Jaén T, Vazquez C, Patino B. 2008. Highly sensitive PCR-based
detection method specific for Aspergillus flavus in wheat flour. Food Additives and Contaminants
25(6): 758-764. doi: 10.1080/02652030701765715
Henry T, Iwen PC, Hinrichs SH. 2000. Identification of Aspergillus species using Internal transcribed
spacer regions 1 and 2. Journal of Clinical Microbiology 38(4): 1510-1515.
Heperkan D, Karbancioglu-Giiller F. 2009. Determination of Aspergillus section Flavi and their
aflatoxin and cyclopiazonic acid production patterns in naturally dried figs. 77-90, in: M
Appell, DF Kendra, MW Trucksess (eds), Mycotoxin Prevention and Control in Agriculture
[ACS Symposium Series, vol. 1031]. doi: 10.1021/bk-2009-1031.ch006
Hinrikson HP, Hurst SE, de Aguirre L, Morrison CJ. 2005. Molecular methods for the identification
of Aspergillus species. Medical Mycology Supplement 43: 29-37. doi: 10.1080/1369378050006
A722
IARC [International Agency for Research on Cancer]. 1993. Some naturally occurring substances:
food items and constituents, heterocyclic aromatic amines and mycotoxins. Monograph 56.
Lyon International Agency for Research on Cancer. 571 p.
Karthikeyan M, Sandosskumar R, Mathiyazhagan S, Mohankumar M, Valluvaparidasan V, Kumar S,
Velazhahan R. 2009. Genetic variability and aflatoxigenic potential of Aspergillus flavus isolates
Aspergillus flavus in figs (Turkey) ... 433
from maize. Archives of Phytopathology and Plant Protection 42(1): 83-91. doi: 10.1080/
03235400600950961
Landlinger C, Baskova L, Preuner S, Willinger B, Buchta V, Lion T. 2009. Identification of fungal
species by fragmentlength analysis of the internally transcribed spacer 2region. European Journal
of Clinical Microbiology & Infectious Diseases 28: 613-622. doi: 354000602277 18.0020
Manonmani HK, Anand S, Chandrashekar A, Rati ER. 2005. Detection of aflatoxigenic fungi
in selected food commodities by PCR. Process Biochemistry 40: 2859-2864. doi: 10.1016/
j-procbio.2005.01.004
Pitt JI, Hocking AD. 1997. Aspergillus flavus Link. 377-380, in: Fungi and Food Spoilage. 2nd Ed.
Blackie Academic and Professional.
Richard JL. 2007. Some major mycotoxins and their mycotoxicoses-An overview. International
Journal of Food Microbiology 119: 3-10. doi: 10.1016/j.ijfoodmicro.2007.07.019
Rodrigues P, Soares C, Kozakiewicz Z, Paterson RRM, Lima N, Venancio A. 2007. Identification
and characterization of Aspergillus flavus and aflatoxins. 527-534, in: A Méndez-Vilas (ed.),
Communicating Current Research and Educational Topics and Trends in Applied Microbiology.
Formatex Research Center
Rodrigues P, Venancio A, Kozakiewicz Z, Lima N. 2009. A polyphasic approach to the identification
of aflatoxigenic and non-aflatoxigenic strains of Aspergillus section Flavi isolated from
Portuguese almonds. International Journal of Food Microbiology 129: 187-193. doi: 10.1016/
j.ijfoodmicro.2008.11.023
Rundberget T, Wilkins AL. 2002. Determination of Penicillium mycotoxins in foods and feeds
using liquid chromatography-mass spectrometry. Journal of Chromatography A 964: 189-197.
doi: 10.1016/S0021-9673(02)00698-2
Samson RA, Varga J, Witiak SM, Geiser DM. 2007. The species concept in Aspergillus:
recommendations of an international panel. Studies in Mycology 59: 71-73. doi: 10.3114/
sim.2007.59.09
Sanchez-Hervas M, Gil JV, Bisbal F, Ramon D, Martinez-Culebras PV. 2008. Mycobiota and
mycotoxin producing fungi from cocoa beans. International Journal of Food Microbiology 125:
336-340. doi: 10.1016/j.ijfoodmicro.2008.04.021
Shapira R, Paster N, Eyal O, Menasherov M, Mett A, Salomon R. 1996. Detection aflatoxigenic
moulds in grains by PCR. Applied and Environmental Microbiology 62(9): 3270-3273.
Somashekar D, Rati ER, Anand S, Chandrashekar A. 2004. Isolation, enumeration and PCR
characterization of aflatoxigenic fungi from food and feed samples in India. Food Microbiology
21: 809-813. doi: 10.1016/j.fm.2004.01.012
Spanjer MC, Rensen PM, Scholten JM. 2008. LC-MS/MS multi-method for mycotoxins after single
extraction, with validation data for peanut, pistachio, wheat, maize, cornflakes, raisins and figs.
Food Additives and Contaminants 25(4): 472-489. doi: 10.1080/02652030701552964
Stroka J; Anklam E. 2000. Immunoaffinity column cleanup with liquid chromatography using
post-column bromination for determination of aflatoxins in peanut butter, pistachio paste, fig
paste and paprika powder: collaborative study. Journal of AOAC International 83(2): 320-340.
doi: 10.5555/jaoi.2000.83.2.320
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis
(MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599. doi: 10.1093/
molbev/msm092
Urano T, Trucksess MW, Matusik J. 1992. Liquid chromatographic determination of cyclopiazonic
acid in corn and peanuts. Journal of AOAC International 75(2): 319-322.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 435-442 January-March 2011
DOT: 10.5248/115.435
A new species and a new record of Pyxine (Physciaceae)
with norstictic acid from Sao Paulo State, Brazil
PaTRiCIA JUNGBLUTH *, MARCELO PINTO MARCELLI * & KLAUS KALB 3
*UNESP Instituto de Biociéncias, Depto de Botanica,
Distrito de Rubido Jr, Caixa Postal 510, Botucatu-SP, CEP 18618-970, Brazil.
*Instituto de Botanica, Niicleo de Pesquisa em Micologia,
Caixa Postal 3005, Séo Paulo/SP, CEP 01031-970, Brazil
3Lichenologisches Institut Neumarkt, Im Tal 12, D-92318 Neumarkt, Germany
“CORRESPONDENCE TO:
[email protected]
AssTRAcT — In the course of a study of Pyxine species in Sdo Paulo State, Brazil, Pyxine
jolyana was recognized as a new species. It has norstictic acid in the medulla, a rare feature in
South American species. Also, another species with norstictic acid, P. fallax, is recorded for
the first time from the Neotropics. A world key to the Pyxine species that produce norstictic
acid is presented.
Key worps — Pyxine albovirens, P. patellaris, P. retirugella var. capitata, P. retirugella,
lichenized fungi
Introduction
The genus Pyxine differs from other foliose genera in Physciaceae by the
epithecium becoming purple with a solution of potassium hydroxide. It shares
a dark pigmented hypothecium and ascospores of the Dirinaria-type with
Dirinaria, but differs from that genus by the presence of rhizines.
Other important features of the genus are the occurrence of apothecia
with carbonized margins in most species, with a more or less developed and
pigmented internal stipe, the presence of lichexanthone in the upper cortex in
about half of the species and also the frequent pigmentation of the medulla,
generally in the upper layer. These and others characters have been extensively
discussed by Malme (1897), Imshaug (1957), Swinscow & Krog (1975) and
Kalb (1987). About 60 Pyxine species are known worldwide (Kalb 2002); more
than 30 species have been reported from Brazil Jungbluth 2010).
Norstictic acid is present in the medulla of many species. Nevertheless, the
only one with this acid reported for Brazil is P. retirugella Nyl. This species was
436 ... Jungbluth, Marcelli & Kalb
first cited for Brazil by Vainio (1890) followed by Zahlbruckner (1909). Kalb
(1987) had the opportunity to study the material cited by Zahlbruckner (1909)
and discovered it to be P. pungens Zahlbr. The specimens cited by Vainio (1890)
could not be studied and nobody else has mentioned P. retirugella for South
America since Zahlbruckner’s work.
During our studies on the lichenized mycobiota of S40 Paulo State, a new
species with norstictic acid in the medulla was found, which is described below.
Furthermore, P. fallax, another species with norstictic acid, was discovered and
is here reported for the first time for South America.
Material & methods
The specimens studied are from Sao Paulo State, Southeastern Brazil, and were
studied by means of classical lichenological methods. Type specimens were kindly lent
by the curators of H, S and TUR. The nomenclature of the apothecia follows Kalb (1987).
The chemistry of the thalli was determined by traditional color reactions (spot tests) and
thin layer chromatography (TLC) in solvent A and C, following Culberson (1972, 1974),
Huneck & Yoshimura (1996) and Bungartz (2001).
Taxonomy
Pyxine jolyana Jungbluth, Kalb & Marcelli, sp. nov. PLaTE 1
MycoBank 519465
Sicut Pyxine albovirens sed terpenis aliis et acidum norsticticum continenti differt.
Ho.otype: BRAZIL. SAo PauLo State, Municipality of Peruibe, Reserva Ecolégica
Juréia-Itatins, Nucleo Guarauzinho, 24°44'58”"S, 47°02'57”W, 5 m alt., on rock next to
the entrance of the reserve, 26-07-1993, leg. M.P. Marcelli 23690 (SP; isotype in Herb.
Kalb).
EryMo.ocy: The epithet jolyana honours Dr. Carlos Alfredo Joly, the main mentor of
the BIOTA/FAPESP Program of inventory and characterization of the biodiversity of
the Sao Paulo State.
THALLUS orbicular, saxicolous or corticolous, brownish grey, laciniate, 7 cm
diam., closely adnate, 100-150 tm thick. PROXIMAL UPPER SURFACE continuous,
rarely with cracks, smooth to slightly irregular and sometimes with concavities,
dull, plane. DIsTAL UPPER SURFACE continuous, smooth, slightly shiny, plane to
concave, without a darker zone near the tips. UPPER CORTEX 10-20 um thick.
LAcINIAE sublinear, irregularly to rarely dichotomously branched, contiguous
to overlapping laterally, 0.5-1.0 mm wide; apices subtruncate to rounded,
concave, slightly ascendant to adnate; lateral margin smooth to sinuous; axils
acute. PRUINA very rare, farinaceous or forming small patches, subapical.
MACULAE mainly indistinct, sparse, irregularly linear, when marginal more
distinct. PoLysIDIANGIA and IsIDIA absent. SoRALIA frequent, pale yellow,
orbicular to capitate, submarginal; soredia powdery to granular. MEDULLA
cream to pale yellow to salmon above, sulphur yellow below the soralia, lower
Pyxine jolyana sp. nov. (Brazil) ... 437
layer white and very thin, sometimes with K+ reddish to purple pigment
present, 60-80 um thick. ALGAL LAYER continuous, 10-20 um thick. DisTAL
LOWER SURFACE black but paler near the tips, slightly shiny, smooth to rarely
irregular, PROXIMAL LOWER SURFACE black, slightly shiny, smooth to slightly
irregular. LOwER CoRTEX 15-20 um thick. Ru1zINEs of the same colour as the
lower cortex, the apices sometimes becoming paler, mainly simple, numerous,
evenly distributed, to 0.7 mm long. APOTHECIA absent. Pycnipia rare, laminal.
Conipia sublageniform, 3.7-4.0 x ca. 1.0 um.
COLOR TESTS: upper cortex K-, UV+ yellow; pigmented distal upper medulla
K- or K+ yellow turning red, C-, KC-, P+ yellowish orange, sometimes the
color of the medulla just becomes stronger; pigmented proximal upper medulla
K+ yellow turning red, C-, KC-, P+ strong yellow or yellowish orange, with
pigment K+ purple in oldest parts; lower medulla with negative reactions.
TLC: lichexanthone (cortex), norstictic acid, unidentified triterpenes and
pigments (medulla).
DisTRIBUTION— S4o Paulo State, littoral zone, at the municipalities of Peruibe,
Sao Luis do Paraitinga and Ubatuba.
PARATYPES—BRAZIL. SAo PauLo StaTE, Peruibe Municipality, border of the Guarat
River, near to the mouth of the river, 24°22'24"S, 47°00'25"W, 4 m alt., on palm stipe
next to the base of the Faculdade de Ciéncia e Tecnologia Santa Cecilia, windy and
direct sun, 24-07-1988, leg. M.P. Marcelli 4014 (SP); Sao Luis do Paraitinga Municipality,
Parque Estadual da Serra do Mar, Nucleo Santa Virginia, in the beginning of the “Trilha
do Pirapitinga’ footpath, 23°20'17"S, 45°08'45" W, 915 m alt., on a tree at the border of
a shadowy forest, corticolous, 14-I-2007, leg. P. Jungbluth, M.J. Kitaura, L.S. Canéz &
A.A. Spielmann 1637 (SP); Ubatuba Municipality, Parque Estadual da Serra do Mar,
Nucleo Picinguaba, Praia da Fazenda, 23°21'41"S, 44°50'53”W, 1m alt., on twig of
tree at the border of a Restinga forest, near the ocean, 13-I-2007, leg. P. Jungbluth, M.J.
Kitaura, L.S. Canéz & A.A. Spielmann 1566B (SP).
REMARKS — Pyxine jolyana is characterized by the presence of lichexanthone in
the upper cortex, the orbicular to capitate laminal soralia, the yellow to orange
pigments in the upper medulla in distal regions of the thallus and cream to
salmon pigments in proximal regions. Also, some parts result in negative spot
tests, others are K+ yellow turning red (norstictic acid).
It is important to note that in this species the color of the pigmented medulla
is not evenly distributed throughout the thallus, and norstictic acid is not
detected in TLC using just the tips of the laciniae: pieces of proximal parts of
the thallus must be analyzed too, because probably higher concentrations of
this acid are present in the thallus center.
Licking et al. (2008) observed the opposite in several species of the genus
Heterodermia: they noted that norstictic acid was produced only in the lobe tips,
which might lead to misidentifications in chemical tests performed in proximal
parts of the thalli.
438 ... Jungbluth, Marcelli & Kalb
Pyxine jolyana is the only species in the genus with lichexanthone in the
upper cortex and norstictic acid in the medulla. Pyxine fallax and P. retirugella
also have norstictic acid in the medulla, but both can be easily separated from
the present species by the presence of atranorin in the cortex.
Pyxine albovirens (G. Mey.) Aptroot and P. caesiopruinosa (Tuck.) Imshaug
(H!) are morphologically similar to P jolyana but differ in the absence of
norstictic acid.
Crystals on the upper cortex similar to those observed by Kalb (1987)
in South American material of P. caesiopruinosa could also be observed in
P. jolyana.
Pyxine fallax (Zahlbr.) Kalb, Bibliotheca Lichenologica 88: 315 (2004).
= Parmelia fallax Zahlbr., Ann. Mycol. 10: 381. 1912.
Type: Hawaiian Islands, Oahu, Kalimooa Valley, leg. Rock 89 (lectotype: W!).
= Pyxine patellaris Kurok., Bull. Natl. Sci. Mus., Tokyo 12: 689. 1969.
Type: Bonin Islands, between Okumura and Ohgiura, Chichijima Island, along
trail in the forest of Calophyllum inophyllum—Terminalia catappa, alt. 0-100 m, leg.
Hiroshi Inoue 19027 (holotype: TNS).
= Pyxine retirugella var. capitata Zahlbr., in Magnusson &
Zahlbruckner, Ark. f. Bot. 32A(2): 59. 1945.
Type: United States, Hawaii, Kauai, Haena, S. of Hilo. Pandanus forest, 1922, leg.
Skottsberg 1267 (lectotype: S!) (new synonym).
THALLUS orbicular, corticolous, grey to brownish grey, laciniate, 2.0-4.0 cm
diam., adnate. PROXIMAL UPPER SURFACE continuous to cracked, slightly
scrobiculate, slightly shiny, plane. DIsTAL UPPER SURFACE continuous to
cracked, smooth, sometimes with concavities, shiny, slightly convex to convex,
with a darker zone near the tips of a few laciniae. LAcINIAE sublinear, irregularly
branched, contiguous to rarely laterally overlapping, 0.3-1.0 mm wide; apices
rounded, sometimes subtruncate, mainly slightly concave, slightly ascending;
lateral margin crenate to irregular; axils acute. PRUINA often absent or sparse,
farinaceous, subapical. MACULAE distinct, abundant, irregularly linear, rarely
subreticulate, marginal and laminal, starting mainly from the axils, sometimes
developing into fissures. PoLYSIDIANGIA and IsIDIA absent. SORALIA white,
orbicular to capitate, starting as a wart which soon disintegrates apically, but
continuing to expand, elevating the soralia, laminal or submarginal; soredia
farinaceous. MEDULLA white. DISTAL LOWER SURFACE cream to pale brown,
shiny, smooth to papillate. PROXIMAL LOWER SURFACE black, shiny, smooth.
Ruizines black, simple to irregularly branched, frequent, evenly distributed,
up to 0.5mm long. APOTHECIA of obscurascens-type (absent in Brazilian
material), rare, 0.4-1.1 mm wide, disc epruinose, internal stipe distinct, white
(Elix 2009), ascospores 13-17 x 6-8 wm (Kalb 2004, Elix 2009)]. Pycnrp1a few,
laminal. Conipi1a not found [sublageniform, 3.4-3.6 x 0.5 wm (Zahlbruckner
1912, protologue)].
Pyxine jolyana sp. nov. (Brazil) ... 439
PLATE 1. Pyxine jolyana holotype (SP).
a. Part of the holotype.
b. Part of the thallus.
Bars: 5 mm.
440 ... Jungbluth, Marcelli & Kalb
COLOR TESTS: upper cortex K+ yellow, UV-; medulla K+ yellow turning orange,
C-, KC-, P+ orange, UV-; internal stipe K-, P-.
TLC: atranorin (cortex), norstictic acid and unidentified triterpenes
(medulla).
DISTRIBUTION— Australia (Kalb 2004), Hawaiian Islands (Zahlbruckner
1912, Magnusson & Zahlbruckner 1945, as P. retirugella var. capitata), Japan
(Kurokawa 1969, as P. patellaris), Taiwan (Kalb 2004) and South America.
SPECIMEN EXAMINED— BRAZIL. SAo PauLo StaTE, Praia Grande Municipality,
Cidade Ocean District, 24°02’S, 46°30'W, 2 m alt., ca. 1 km after the Iemanja’s statue, 2
km after the Netuno’ statue, in direction of Mongagué Municipality, low Restinga forest,
corticolous, 07-07-1988, leg. M.P. Marcelli 3303 (SP).
REeMARKS— Pyxine fallax is characterized by atranorin in the upper cortex,
orbicular, laminal to sublaminal soralia, white, K+ yellow turning orange, P+
orange (norstictic acid) medulla and obscurascens-type apothecia.
It is notable that in this species the soralia progressively become slightly
elevated through a small base of the upper cortex (almost stalked). The same
was observed in the holotype of P. copelandii Vain. (TUR-Vain.!), which differs
from P. fallax by its longer ascospores (16-22 um; Swinscow & Krog 1975), less
maculate upper cortex and a different terpene array on the TLC plates.
Further similar species with white medulla and norstictic acidare P. retirugella
(H-NYL!), which differs from P fallax by the presence of polysidiangia, and
P. profallax Kalb, which does not produce soredia (Kalb et al. 2009)
Pyxine retirugella var. capitata is found to be a new synonym of P. fallax.
Rogers (1986) proposed it as a synonym of P. retirugella. However the lectotype
of this variety (S!) has orbicular soralia instead of polysidiangia and has the same
triterpene array on TLC plates as P. fallax. Kalb (2004) placed P. retirugella var.
capitata into the synonymy of P. asiatica Vain.; however, P. asiatica does not
have norstictic acid (Kashiwadani 1977, Awasthi 1982, Kalb 2004).
World key to Pyxine with norstictic acid present at least in some parts
of the thallus or apothecia
la. Thallus with isidia, polysidiangia or/and soredia .................0. 0.000000 2
1b. Thallus without vegetative propagules ..... 0... c cece cece eee eens 7
2a. Upper cortex K—, UV+ yellow, with lichexanthone.................... P. jolyana
2b. Upper cortex K+ yellow, UV-, with atranorin 2.0.0... ... 00. cece eee eee 3
3a. Thallus isidiate, without soredia or polysidiangia ............ P. cylindrica Kashiw.
3b. Thallus without isidia, with soredia or polysidiangia .....................000. 4
4a. Maculae and soredia bright red [norstictic acid present only in the
hy potheei vin my. 0.0 bee hn he aantecs aoe ede ats sett moe P. coccifera (Fée) Nyl.
4b. Maculae and soredia absent or with other colors .......... 0.0.0 cece eee ee eee 5
Pyxine jolyana sp. nov. (Brazil) ... 441
5a. Thallus with polysidiangia, without soralia ...................0.04. P. retirugella
5b. Thallus with soralia, without polysidiangia ............ 0.00. e cece eee eee 6
6a. Upper cortex abundantly maculate, ascospores 13-17 um ............... P. fallax
6b. Upper cortex sparsely maculate, ascospores 16-22 um .............. P. copelandii
7a. Medulla white throughout ........... P. convexior (Mill. Arg.) Swinscow & Krog
7b. Medulla at least in part pigmented 2.0.2.0... 0. cece eee eee ees 8
8a. Medulla orange to ochre throughout [norstictic acid present only in the
SPICE GLUT] og cscs sacra read $00 ANE ang ae eT bead bo iE A bas teste eh P. schechingeri Kalb
8b. Medulla pale yellow or cream or orange above, white below.................0.. 9
9a. Internal stipe K+ purple, known only from Africa ............... P. africana Kalb
9b. Internal stipe K—, known only from Asia .................000. P. philippina Vain.
Acknowledgments
The authors wish to thank Dr. Theodore L. Esslinger and Dr. Robert Licking for
the critical revision of the manuscript. We would like to thank the curators of H, S$
and TUR for lending type material to P. Jungbluth and the curators of W and TNS
for the loans to Dr. Kalb. P. Jungbluth is also grateful to FAPESP (Sao Paulo Research
Foundation) for a PhD grant (process 05/53955-1) and for the infrastructure and
logistical support for collecting excursions of the Projeto Tematico Gradiente Funcional
(process 03/12595-7, BIOTA/FAPESP Program) and to IF (Sao Paulo Forest Institut)
for collecting license. M.P. Marcelli thanks CNPq (National Council of Technological
and Scientific Development) for a research grant.
Literature cited
Awasthi DD. 1982. Pyxine in India. Phytomorphology 30(4): 359-379.
Bungartz F. 2001. Analysis of lichen substances. In: http://nhc.asu.edu/lichens/ lichen_info/tlc jsp.
Accessed in 2010, April.
Culberson CE. 1972. Improved conditions and new data for the identification of lichen products by
a standardized thin-layer chromatographic method. Journal of Chromatography (72): 113-125.
doi: 10.1016/0021-9673(72)80013-X
Culberson CF. 1974. Conditions for the use of Merck silica gel 60 F,., plates in the standardized
thin-layer chromatographic technique for lichen products. Journal of Chromatography (97):
107-108. doi:10.1016/S0021-9673(01)97595-8
Elix J. 2009. Pyxine. 517-547, in McCarthy P (ed.), Flora of Australia. Volume 57, Lichens 5. ABRS/
CSIRO Canberra & Melbourne.
Huneck S, Yoshimura I. 1996. Identification of lichen substances. Springer. Berlin. 493 p.
Imshaug HA. 1957. The Lichen Genus Pyxine in North and Middle America. Transactions of the
American Microscopical Society 76(3): 246-269.
Jungbluth P. 2010. Estudos taxonémicos em Physcia (Schreb.) Michx. e Pyxine Fr. PhD thesis.
Instituto de Sao Paulo, Sao Paulo-SP, Brazil. 228 p.
Kalb K, Archer AW, Sutjaritturakan J, Boonpragob K. 2009. New or otherwise interesting lichens V.
Bibliotheca Lichenologica 99: 225-246.
Kalb K. 1987. Brasilianischen Flechten, 1. Die Gattung Pyxine. Bibliotheca Lichenologica 24:
1-89.
442 ... Jungbluth, Marcelli & Kalb
Kalb K. 2002. Pyxine. 437-441, in TH Nash III et al. (eds.), Lichen Flora of the Greater Sonoran
Desert Region. I. Lichens Unlimited, Arizona State University, Tempe, Arizona.
Kalb K. 2004. New or otherwise interesting lichens II. Bibliotheca Lichenologica 88: 301-329.
Kashiwadani H. 1977. On the Japanese species of the genus Pyxine (lichens) (1). Journal of Japonese
Botany 52: 137-144.
Kurokawa S. 1969. Lichens of Chichijima Island of the Bonin Islands collected by Dr. H. Inoue.
Bulletin of the National Science Museum, Tokyo 12: 685-692.
Licking R, del Prado R, Lumbsch HT, Will-Wolf S, Aptroot A, Sipman HJM, Umafia L, Chaves JL.
2008. Phylogenetic patterns of morphological and chemical characters and reproductive mode
in the Heterodermia obscurata group in Costa Rica. Systematics and Biodiversity 6(1): 31-41.
doi: 10.1017/S1477200007002629
Magnusson AH, Zahlbruckner A. 1945. Hawaiian lichens III. The families Usneaceae to Physciaceae.
Index. Arkiv for Botanik 32A(2): 1-89.
Malme B. 1897. Die Flechten der ersten Regnellschen Expedition I. Die Gattung Pyxine (Fr.)
Nylander. Bihang till Svenska Vetenskapsakademiens Handlingar 23(13): 1-52.
Rogers RW. 1986. The genus Pyxine (Physciaceae, lichenized Ascomycetes) in Australia. Australian
Journal of Botany 34: 131-154.
Swinscow TDV, Krog H. 1975. The genus Pyxine in East Africa. Norwegian Journal of Botany 22:
43-68.
Vainio EA. 1890. Etude sur la classification naturelle et la morphologie des Lichens Du Brésil. Pars
prima. Acta Societatis pro Fauna et Flora Fennica 7 (1): I-X XIX, 1-247.
Zahlbruckner A. 1909. Lichenes (Flechten). 85-211, in V Schiffner (ed.), Ergebnisse der botanischen
Expedition der kaiserlichen Akademie der Wissenschaften nach Siidbrasilien, 1901, 2. Band.
Denkschriften der Kaiserlichen Akademie der Wissenschaften 83.
Zahlbruckner A. 1912. Neue Flechten. VI. Annales Mycologici 10: 359-384.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 443-456 January-March 2011
DOI: 10.5248/115.443
Marine fungi from Sarushima Island, Japan,
with a phylogenetic evaluation of the genus Naufragella
MOHAMED A. ABDEL-WAHAB
Department of Botany, Faculty of Science, Sohag University, Sohag 82524, Egypt &
Extremobiosphere Research Center,
Japan Agency for Marine-Earth Science and Technology (AMSTEC),
2-15 Natsushima-cho, Yokosuka, Kanagawa 237-0061, Japan
CORRESPONDENCE TO:
[email protected]
AssTRACT — Twenty-seven fungi (18 ascomycetes, 9 anamorphic fungi) were recorded
from 91 driftwood samples collected from Sarushima Island, Japan. Ceriosporopsis halima,
Corollospora maritima, and Halosphaeria appendiculata occurred most frequently in the fungal
community. Other common fungi include: Remispora maritima, Tirispora sp., Monotosporella
sp. Phoma sp., and Trichocladium achrasporum. Among the 27 fungi collected, 7 are
possibly new to science. Nemania maritima and Panorbis viscosus are new records for Japan.
Phylogenetic analyses of LSU rDNA sequences placed Naufragella delmarensis with Nohea
umiumi ina highly supported clade. Both Naufragella and Nohea have similar morphological
characters that, in combination with the molecular data, support their placement in a
single genus. The new combinations Nohea delmarensis and N. spinibarbata are proposed.
The anamorph-teleomorph connection of Trichocladium achrasporum—Halosphaeriopsis
mediosetigera was supported with molecular data for the first time.
Key worps — ecology, Halosphaeriales, sub-tropics, aquatic fungi
Introduction
Our knowledge of lignicolous marine fungi from coastal areas of Japan is
fragmentary, with only a few studies carried out with wood blocks baits in
oceanic water (Tubaki 1966, 1967, 1969, 1973). These four studies documented
the presence of 25 lignicolous marine fungi, including a new species, Remispora
galerita Tubaki (Tubaki 1967). Sarushima Island, the only natural island in
Tokyo Bay, was a military fort until the Second World War when it was closed
to civilian access. Sarushima Island is now a tourist site and the public has easy
access to the island. As no marine fungi have been reported from this small
island, this study was carried out to document its marine fungal diversity.
444 ... Abdel-Wahab
The genera Nohea and Naufragella are closely similar in their morphology.
Both genera have two types of ascospore appendages: gelatinous and fibrous.
The two genera differ only in the position of the ascospore appendages. Nohea
has gelatinous appendages attached subapically and laterally and two lateral
fascicles of thin hairs. Naufragella has apical gelatinous appendages and a
subapical crown of filaments at each apex below the gelatinous appendages.
Kohlmeyer and Volkmann-Kohlmeyer (1998) opined that the differences
in the positions of the gelatinous appendages (lateral in Nohea vs. apical in
Naufragella) and filaments (on one side in Nohea vs. forming a subapical crown
in Naufragella) are distinctive characters that can be used to separate fungi at
the generic level. Phylogenetic analyses herein were carried out to test whether
the genera Nohea and Naufragella are congeneric. Another closely similar
genus, Remispora, is characterized by its wing-like apical, gelatinous ascospore
appendages that unfold to form long fibrous material in water.
During this study, phylogenetic analyses of LSU rDNA sequences were
carried out to elucidate the relationships among the genera Naufragella, Nohea,
and Remispora as well as among various marine species.
Materials and methods
Collection techniques
Samples of driftwood collected from the intertidal zone of Sarushima Island,
Japan, were placed in clean plastic bags and returned to the laboratory. They were
examined with a dissecting microscope for marine fungi immediately upon return
to the laboratory, placed in sterile humid plastic boxes for incubation, and examined
periodically over 4 months of incubation. Methods used for the preparation of materials
for light microscopy followed those of Jones & Hyde (1988). For each taxon, percent
occurrence was calculated as: (no. of collections) x 100/(no. of samples).
Digital micrographs were obtained with a Nikon Eclipse E800 differential interference
contrast light microscope and “studio viewfinder version 3” (Nikon Corporation, Japan)
digital imaging system. Wood samples bearing fungi were dried at 60 °C for 24 h. To
obtain single-ascospore cultures of the recorded fungi, ascomata were cut open with
a sterile razor blade, and the centrum tissue containing ascospores was removed with
sterile forceps and placed in sterile seawater. Small drops of this ascospore suspension
were placed on GYA (10 g glucose, 1 g yeast extract, 18 g agar in 1 ] seawater) in Petri
dishes and incubated at 25°C in the dark. Germinated ascospores were transferred to
new GYA Petri dishes with sterile forceps and incubated at 25°C in the dark. Dried
fungi and isolated fungal cultures were deposited at the Extremobiosphere Research
Center, Japan Agency for Marine-Earth Science and Technology (JAMSTEC), Japan and
National Institute of Technology and Evaluation, Biological Resource Center (NBRC),
Japan. DNA isolation, PCR reactions, cycling parameters, sequencing, sequence
alignment and phylogenetic analyses were carried out as described by Abdel-Wahab et
al. (2009).
Marine fungi of Sarushima Island (Japan) ... 445
DNA extraction, sequencing, and phylogenetic analysis
DNA was extracted from pure fungal mycelium using the Microbial DNA Extraction
Kit (MOBIO; Mo Bio Laboratories, Carlsbad, CA, USA) according to the manufacturer’s
instructions. Partial LSU ribosomal DNA was amplified using primers LROR and LR7
(Bunyard et al. 1994). PCR reactions, cycling parameters and sequencing were carried
out as described by Abdel-Wahab et al. (2009). Sequences were assembled using
Sequencher 4.2.2 (Gene Codes Corporation). Sequences were aligned with others
retrieved from GenBank using ClustalX (Thompson et al. 1997) and optimized manually.
The positions where one or more species contained a length mutation and ambiguously
aligned regions were not included in the subsequent phylogenetic analysis. Nucleotide
sequence phylogenies were constructed using PAUP* 4.0b10 (Swofford 2002). Maximum
likelihood (ML) analyses (Felsenstein 1981) were performed using heuristic searches with
the random stepwise addition of 100 replicates and tree bisection reconnection (TBR)
rearrangements. The optimal model of nucleotide substitution for the ML analyses was
determined using hierarchical likelihood ratio tests as implemented in Modeltest 3.7
(Posada & Crandall 1998). The model selected as the best fit for LSU rDNA data set was
TrN+I+G. For the bootstrap analyses (Felsenstein 1985), 100 replicates were generated
with 5 random additions and TBR. Maximum parsimony (MP) trees were obtained
by 100 random addition heuristic search replicates using PAUP, and 1000 bootstrap
replicates were performed employing 5 random addition heuristic searches. Posteriori
probability values were obtained by using the MrBayes 3.1.2 (Huelsenbeck & Ronquist
2001, Ronquist & Huelsenbeck 2003) with the GTR+I+G model that was determined
using MrModeltest 2.2 (Nylander 2004). Nodal supports in the Bayesian analyses were
examined by posterior probabilities from five million generations that were run in four
chains with sampling every 100 generations, yielding 50 000 trees, of which the first
12 500 were discarded as “burn in” Five sequences of the LSU rDNA sequences were
generated in this study and were deposited at GenBank and their accession numbers are
shown in Fie. 1.
Results
Twenty-seven fungi (18 ascomycetes and 9 anamorphic fungi) were
identified from 122 fungal collections that were recorded from 91 driftwood
samples collected from Sarushima Island, Japan. Ceriosporopsis halima (17.6
%), Corollospora maritima (43.9 %) and Halosphaeria appendiculata (12.1 %)
occurred most frequently. Other common fungi include: Remispora maritima
(5.5 %), Tirispora sp. (8.8 %), Monotosporella sp. (5.5 %), Phoma sp. (7.7 %) and
Trichocladium achrasporum (5.5 %). Among the 27 fungi recorded during the
present study, 7 fungi (representing 25.9 % of the recorded fungi) are possibly
newto science. Nemania maritima and Panorbis viscosus are reported from Japan
for the first time. Representatives of the Halosphaeriales predominated in the
fungal community, comprising 27 species (59.3 %). Hyphomycetes, represented
by 8 species, comprised the major anamorphic group, and coelomycetes were
represented by one species of Phoma (TABLE 1).
446 ... Abdel-Wahab
TABLE 1. Frequency of occurrence of marine fungi collected from Sarushima Island
FUNGI %
Ascomycota
Botryosphaeria sp.
Ceriosporopsis halima Linder 76
*Ceriosporopsis sp. 1
*Ceriosporopsis sp. 2 (MF 985) 3.3
Corollospora maritima Werderm. 43.9
“Dryosphaera sp.
Halosphaeria appendiculata Linder 2.1
Halosphaeriopsis mediosetigera (Cribb &J.W. Cribb) T.W. Johnson 2.2
Leptosphaeria sp.
Lulworthia grandispora Meyers :
Marinospora calyptrata (MF986) 3.3
*Morakotiella sp. (MF 980) 22
Nemania maritima Y.M. Ju & J.D. Rogers 2.2
Panorbis viscosus (1. Schmidt) J. Campb. et al. 11
Nohea delmarensis (MF982) 11
Remispora maritima (MF988) 55
*Remispora sp. (MF987) it
ctl OA EIN Ry AM Naas hah sh Mien dct Meda ahe die Nariel be A nls
Anamorphic fungi
Cirrenalia macrocephala (Kohlm.) Meyers & R.T. Moore 1.1
Halazoon fuscus (1. Schmidt) Abdel-Wahab et al. 2.2
*Monotosporella sp. (MF984) 5.5
Phoma sp. 77
Trichocladium achrasporum 5.5
Trichocladium melhae E.B.G. Jones et al. 11
Xylomyces sp. dat
Veronaea japonica Arzanlou et al. (MF991) sai
Unknown synnematous fungus 11
*Possibly new fungi
Total numbers: samples = 91; fungal collections = 122; species = 27; ascomycetes = 18;
anamorphic fungi = 9; fungi per sample = 1.3.
Phylogenetic analyses of Halosphaeriales LSU rDNA dataset
The partial LSU rDNA sequences of Marinospora calyptrata, Naufragella
delmarensis, R. maritima, and T. achrasporum were aligned with representatives
of the Halosphaeriales along with representatives of the Microascales and
Xylariales. In total, the dataset included 36 taxa of which 31 belong to
Halosphaeriales, one to Microascales, and four to Xylariales that were used
as outgroup taxa. The dataset consisted of 460 total characters, of which 49
gaps were excluded, 250 characters were constant, 48 variable characters were
parsimony-uninformative, and 113 were parsimony informative characters.
Marine fungi of Sarushima Island (Japan) ... 447
.02
Nimbospora effusa Broom
Phaeonectriella lignicola AY150224
Halosarpheia marina AY227125
Okeanomyces cucullatus AY490787
93/95 Ascosacculus heteroguttulatus AY227122
Aniptodera chesapeakensis U46882
Nais inornata AF539476
Remispora maritima HQ268016
Neptunella longirostris AF539472
Morakotiella salina AY864843
Nohea umiumi U46893
80177 99/100 ' Naufragella delmarensis HQ268017
Natantispora lotica AF396873
Tirispora unicaudata AY150225
Lignincola laevis U46890
Cucullosporella mangrovei AY150219
Antennospora quadricornuta AY090890
Halosarpheia fibrosa AF396872
84/75 Lignincola tropica AF539474
186 Marinospora longissima AF491266
Marinospora calyptrata HQ268015
Halosphaeriales
Ceriosporopsis halima U47844
Magnisphaera spartinae AY150221
Ophiodeira monosemeia U46894
94/100 Ascosalsum cincinnatulum AY150220
Corollospora maritima AF491260
Sagaaromyces abonnis AF539469
Halosphaeriopsis mediosetigera U46887
73/96 |Trichocladium achrasporum HQ268019 (MF41)
Trichocladium achrasporum HQ268018 (MF992)
Haligena elaterophora AY864845
Microascus trigonosporus U47835 | Microascales
Rosellinia corticium DQ840078
78I- wr Fl ‘i
100/100 Daldinia concentrica U47828 Xylariales
90/- Nemania diffusa DQ840076
Xylaria hypoxylon U47841
Fic. 1: Maximum likelihood phylogenetic tree (-In likelihood = 3,008.01) shows relationships
of Marinospora calyptrata, Naufragella delmarensis, Remispora maritima, and Trichocladium
achrasporum and representatives of halosphaeriaceous ascomycetes based on LSU rDNA. The
numbers indicate pp values > 95% (in bold), ML bootstrap and MP bootstrap values > 70%.
Sequences generated during the present study are set in bold font.
The heuristic search generated 24 most parsimonious trees, all 520 steps long,
and with a consistency index of 0.4462, a retention index of 0.6449, and a
rescaled consistency index of 0.2877. Maximum likelihood analysis produced
one tree with an —In likelihood score of 3,008.01 (Fic. 1). Most parsimonious
(MP) and Bayesian analyses produced trees (not shown) similar to the one in
Fre. 1.
AAB8 ... Abdel-Wahab
Taxonomic notes
Naufragella Kohlm. & Volkm.-Kohlm.
Kohlmeyer & Volkmann- Kohlmeyer (1998) established the genus Naufragella
Kohlm. & Volkm.-Kohlm. to accommodate a new fungus, N. delmarensis, and
also transferred Remispora spinibarbata to the new genus. During this study N.
delmarensis was isolated, described, photographed (Fics 2-5), and sequenced.
The genera Naufrageila and Remispora Linder share common morphological
characters. Barghoorn & Linder (1944) established the genus Remispora to
accommodate halosphaeriaceous fungi with exosporic ascospore appendages
that consist of a fibrous component in an amorphous matrix. Fragmentation of
the sheath gives rise to wing-like fibrous polar appendages (Jones & Moss 1978,
Johnson et al. 1984, Jones et al. 2009). Recent phylogenetic analyses revealed
that Remispora is polyphyletic (Jones et al. 2009).
In contrast, Naufragella and Nohea both have two types of appendages:
(a) gelatinous, forming a band or veil at each apex and (b) a crown of delicate
filaments below each apex (Kohlmeyer & Volkmann-Kohlmeyer 1998).
Phylogenetic analyses place the type species of both genera, Nohea umiumi and
Naufr. delmarensis, within a highly supported clade (99/100/100 for ML/MP/
Bayesian pp respectively) that forms a sister group to Morakotiella salina (C.A.
Farrant & E.B.G. Jones) Sakay. and Neptuneila longirostris (Cribb & J.W. Cribb)
K.L. Pang & E.B.G, Jones. I conclude that the genera, Nohea and Naufragella
are congeneric and that, within the Halosphaeriales, ascospore appendage
position is not a reliable character with which to separate fungi at the generic
level, contrary to the opinion of Kohlmeyer & Volkmann-Kohlmeyer (1998).
Naufragella spinibarbata is very similar to Naufr. delmarensis, and the two
species differ only in ascospore dimensions and appendage shape and length.
Naufragella spinibarbata was not available for sequencing and further study
is needed to confirm its phylogenetic relationships but for the time being it
should returned to Nohea.
Based on the morphology and the molecular results presented here, the
following two combinations are proposed:
Nohea spinibarbata (Jorg. Koch) Abdel-Wahab, comb. nov.
MycoBank MB 519505
=Remispora spinibarbata Jorg. Koch, Nordic Journal of Botany 8: 517, 1989.
=Naufragella spinibarbata (Jorg. Koch) Kohlm. & Volkm.-
Kohlm. Systema Ascomycetum 16: 11, 1998.
Nohea delmarensis (Kohlm. & Volkm.-Kohlm.) Abdel-Wahab, comb. nov.
MycoBank MB 519504 FIGS 2-5
= Naufragella delmarensis Kohlm. & Volkm.-Kohlm., Systema Ascomycetum 16: 10, 1998.
Ascomata 230-260 um high, 250-270 um in diam, erumpent to superficial,
ostiolate with short neck, periphysate, coriaceous, hyaline to cream colored,
Marine fungi of Sarushima Island (Japan) ... 449
Fics 2-5: Nohea delmarensis. Differential interference contrast light micrographs.
2. Vertical section through ascoma. 3. Immature ascus. 4-5. Ascospores with elaborate
two types of appendages (Fic. 5, arrowed). Bars: 2 = 50 wm, 3-5 = 5 wm.
solitary or gregarious (Fic. 2). Peridium 12-15 um thick consisting of 4-6 layers
of flattened polygonal cells. Neck 50-90 um high, 40-48 wm in diameter. Asci
58-70 x 18-27 um, 8-spored, thin-walled, clavate, pedunculate, deliquescing at
maturity (Fic. 3). Ascospores 19-21 x 8.5-9 um, one-septate, not constricted at
the septum, ellipsoidal, with tapered ends. Appendages of two types: (1) polar,
A450 ... Abdel-Wahab
gelatinous, forming a cap-like structure at the apex and lying flat against the
lateral wall forming two unequal wings, wings unfurling in water to form long
sticky filaments and (2) sub-polar crown of spines 15-20 tm long (Fics 4-5).
Marinospora calyptrata (Kohlm.) A.R. Caval. Fics 6-10
During the course of this study, the type species of Marinospora, M. calyptrata,
was recorded, described, photographed, isolated and sequenced.
Ascomata 650-850 um high and 900-1150 um wide, deeply immersed with
long neck growing through the substrate to the surface, subglobose to fusiform
or flattened globose. Asci 120-180 x 24-41 um, 8-spored, clavate with beaked
apex, deliquescing at maturity (Fic. 6). Catenophyses present. Ascospores
26-35 x 10-16 um, one-septate, slightly constricted at the septum, ellipsoidal,
hyaline, rough walled (only visible at 1000x). (Fics 7, 9, 10), enclosed ina sheath,
provided with four to five obclavate, tapering appendages. Appendages straight
or curved, one at each ascospore apex and two to three around the mid-septum,
14-26 wm long, 5-8 um wide at base; annulated along appendage length and
bearing a terminal inverted cap (Fics 7-10).
Norte: Marinospora longissima was considered conspecific with M. calyptrata
(Kohlmeyer & Kohlmeyer 1979). However, Jones & Moss (1980) separated the
two species based on the presence of a mucilaginous envelope in M. longissima
and consistently longer apical appendages. Phylogenetic analyses of LSU rDNA
sequences of M. calyptrata and M. longissima confirm that they are distinct
species and this is in agreement with previous study carried by Sakayaroj et al.
(2004).
New morphological features of M. calyptrata observed during this study
include: (1) presence ofaroughened ascospore wall (Fic. 9, arrowed) surrounded
by a mucilaginous layer (Fic. 10, arrowed); (2) ascospore appendages are
annulated along their length (Fic. 7, arrowed). Marinospora calyptrata grouped
consistently with M. longissima and Ceriosporopsis halima, based on molecular
data (Fic. 1).
Remispora maritima Linder Fics 11-16
During the course of this study, the type species of Remispora, R. maritima,
was isolated, photographed, and sequenced.
Ascomata 180-220 um high, 250-310 um in diam, erumpent to superficial,
papillate, ostiolate, coriaceous, hyaline to cream colored (Fic. 11). Peridium
18-24 um thick, consisting of 5-7 layers of flattened polygonal cells (Fic. 12).
Neck 45-70 um high, 60-68 um in diam. Asci 90-120 x 26-48 um, 8-spored,
thin-walled, broadly clavate, pedunculate, deliquescing at maturity (Fic. 13).
Ascospores 25-28 x 10-12 um, one-septate, not constricted at the septum,
ellipsoidal, hyaline, appendaged; at first surrounded by a gelatinous sheath
Marine fungi of Sarushima Island (Japan) ... 451
Fics 6-10: Marinospora calyptrata. 6. Ascus. 7-10. Ascospores with annulations along the
appendages (Fic. 7, arrowed), roughened wall (Fic. 9, arrowed), and gelatinous sheath (Fic. 10,
arrowed). Bars: 6,8 = 10 um, 7,9,10 = 5 um.
that unfolds (Fics 14-15), remaining attached at both ends of the ascospore;
appendages later elongate and forming numerous fiber-like elements embedded
in the gelatinous material (Fic. 16).
Nore: Phylogenetic analyses of ribosomal gene sequences indicate that
Remisporais a polyphyletic genus (Jones et al. 2009). Remispora maritima seems
452 ... Abdel-Wahab
Fics 11-16: Remispora maritima. 11. Section through the ascoma. 12. Section through
part of the ascomata showing peridium structure. 13. Ascus. 14-16. Ascospores.
Bars: 11 = 25 um, 12 = 5 wm, 13-14 = 10 um, 15-16 = 5 um.
to be cosmopolitan in its distribution but occurs more frequently in temperate
regions (Kohlmeyer & Kohlmeyer 1979). In the LSU analyses in this paper,
Remispora maritima was basal to a node containing Aniptodera chesapeakensis,
Ascosacculus heteroguttulatus, Nais inornata, and Okeanomyces cucullatus
(Fic. 1).
Marine fungi of Sarushima Island (Japan) ... 453
Trichocladium achrasporum (Meyers & Moore) Dixon ex Shearer & J.L. Crane
Shearer & Crane (1977) discovered the connection between Halosphaeriopsis
mediosetigera and T. achrasporum through single spore cultural connection.
That anamorph-teleomorph connection is supported at molecular level for the
first time herein. Phylogenetic analyses of LSU rDNA sequences of two isolates
of T. achrasporum that were isolated from Japan (MF992) and Egypt (MF41)
were consistently grouped with the teleomorph H. mediosetigera with high
bootstrap support (73/96/86 for ML/MP/Bayesian pp respectively). Apparently
there are several varieties of T. achrasporum. The type specimen has conidial
dimensions 17-21(-32) x (8-)10-13 (-16) um (Meyers & Moore 1960), while
Kohlmeyer & Volkmann-Kohlmeyer (1991) reported a wider range of conidial
dimensions (-15)20-34(-45) x (8-)10-24 wm. The isolates T. achrasporum
from Egypt and Japan have similar conidial dimensions (14-32 x 8-18 um)
that agree with those of the type specimen.
Goh & Hyde (1999) monographed Trichocladium, accepting 18 species and
describing a number of new species. They referred another 22 Trichocladium
names to other genera, e.g. Bactrodesmium, Hemispora, and Pithomyces. Several
Trichocladium species have been described from aquatic environments (Crane
& Shearer 1978, Kohlmeyer & Volkmann-Kohlmeyer 1995, Hyde & Goh 1998,
1999, Goh & Hyde 1999, Hyde et al. 1999, Jones et al. 2001). Trichocladium
achrasporum differs from the lectotype species, T. asperum Harz, by having
sporodochioid conidiomata (Meyers & Moore 1960). Kohlmeyer & Kohlmeyer
(1979), however, considered that the degree of conidiophore aggregation in
T. achrasporum could not be considered as a sporodochium and so accepted its
relocation in Trichocladium from the genus Culcitalna Meyers & R.T. Moore.
Currently, there are seven marine Trichocladium species (Jones et al. 2009).
Discussion
Ceriosporopsis halima and Corollospora maritima were the most frequently
collected fungi during this study and these results are similar to those of
previous studies that have been carried out in Japan (Tubaki 1966, Nakagiri et
al. 1999). Both fungi are cosmopolitan species that have been recorded from
various continents (Cribb & Cribb 1956, Kohlmeyer & Kohlmeyer 1979, Miller
& Whitney 1981, Lintott & Lintott 1982, Zanial & Jones 1984, Jones 1985,
Shearer & Burgos 1987, Hyde & Jones 1989, Tan & Leong 1992, Abdel-Aziz
2010).
Halosphaeria appendiculata was frequently recorded during the present
study. This species was commonly recorded from San Juan Island (Jones 1985)
and from sea foam samples in Japan (Nakagiri 1989). Although cosmopolitan in
its distribution, H. appendiculata tends to occur more frequently in temperate
water (Kohlmeyer & Kohlmeyer 1979).
454 ... Abdel-Wahab
Acknowledgements
This work was funded by grants from the Japan Society for the Promotion of Science
(SPS) (No. 185701000001 and No. 18-06620). I am very grateful to Dr. Takahiko
Nagahama for his support and guidance during the course of this work and to JSPS
for an award of a postdoctoral fellowship. I would like to thank Prof. Carol Shearer and
Prof. Akira Nakagiri for reviewing the manuscript and for their invaluable comments.
Literature cited
Abdel-Aziz FA. 2010. Marine fungi from two sandy Mediterranean beaches on the Egyptian north
coast. Botanica Marina 53: 283-289. doi:10.1515/BOT.2010.023
Abdel-Wahab MA, Nagahama T, Abdel-Aziz FA. 2009. Two new Corollospora species and one new
anamorph based on morphological and molecular data. Mycoscience 50: 147-155. doi:10.1007/
$10267-008-0466-9
Barghoorn ES, Linder DH. 1944. Marine fungi: their taxonomy and biology. Farlowia 1: 395-467.
Bunyard BA, Nicholson MS, Royse DJ. 1994. A systematic assessment of Morchella using RFLP
analysis of the 28S rRNA gene. Mycologia 86: 762-772. doi:10.2307/3760589
Crane JL, Shearer CA. 1978. Two new species of Trichocladium (Hyphomycetes) from submerged
wood. Mycologia 70: 866-874. doi:10.2307/3759370
Cribb AB, Cribb JW. 1956. Marine fungi from Queensland-II. Papers of the University of
Queensland, Department of Botany 3: 97-107.
Felsenstein J. 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach.
J. Mol. Evol. 17: 368-376. doi:10.1007/BF01734359
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution
39: 783-791. doi:10.2307/2408678
Goh TK, Hyde KD. 1999. A synopsis of Trichocladium species, based on the literature. Fungal
Diversity 2: 101-118.
Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:
754-755. doi:10.1093/bioinformatics/17.8.754
Hyde KD, Goh TK. 1998. Fungi on submerged wood in Lake Barrine, north Queensland, Australia.
Mycological Research 102: 739-749. doi:10.1017/S0953756297005868
Hyde KD, Goh TK. 1999. Fungi on submerged wood in River Coln, the Cotswolds, UK. Mycological
Research 103: 1561-1574. doi:10.1017/S0953756299008989
Hyde KD, Jones EBG. 1989. Ecological observations on marine fungi from the Seychelles. Botanical
Journal Linnean Society 100: 237-254. doi:10.1111/j.1095-8339.1989.tb01720.x
Hyde KD, Goh TK, Lu BS, Alias SA. 1999. Eleven new intertidal fungi from Nypa fruticans.
Mycological Research 103: 1409-1422. doi:10.1017/S0953756299008667
Johnson RG, Jones EBG, Moss ST. 1984. Taxonomic studies of the Halosphaeriaceae: Remispora
Linder, Marinospora Cavaliere and Carbosphaerella Schmidt. Botanica Marina 27: 557-566.
doi: 10.15 15/botm.1984.27.12.557
Jones EBG. 1985. Wood-inhabiting marine fungi from San Juan Island, with special reference to
ascospore appendages. Botanical Journal Linnean Society 91: 219-231. doi:10.1111/j.1095-
8339.1985.tb01146.x
Jones EBG, Hyde KD. 1988. Methods for the study of mangrove marine fungi. 9-27, in Agate,
Subramanian and Vannucci (eds.), Mangrove microbiology; role of microorganisms in nutrient
cycling of mangrove soils and water. UNDP/UNESCO, New Delhi.
Marine fungi of Sarushima Island (Japan) ... 455
Jones EBG, Moss ST. 1978. Ascospore appendages of marine ascomycetes: an evaluation of
appendages as taxonomic criteria. Marine Biology 49: 11-26. doi:10.1007/BF00390726
Jones EBG, Moss ST 1980. Further observations on the taxonomy of the Halosphaeriaceae. Botanica
Marina 23: 483-500. doi:10.1515/botm.1980.23.2.73
Jones EBG, Abdel-Wahab MA, Vrijmoed LLP. 2001. Trichocladium melhae sp. nov., a new tropical
marine fungus. Fungal Diversity 7: 49-52.
Jones EBG, Sakayaroj J, Suetrong S, Somrithipol S, Pang, KL. 2009. Classification of marine
Ascomycota, anamorphic taxa and Basidiomycota. Fungal Diversity 35: 1-187.
Kohlmeyer J, Kohlmeyer E. 1979. Marine mycology: The higher fungi. Academic Press, New York.
Kohlmeyer J, Volkmann-Kohlmeyer B. 1991. Illustrated key to the filamentous marine fungi.
Botanica Marina 34: 1-61. doi:10.1515/botm.1991.34.1.1
Kohlmeyer J, Volkmann-Kohlmeyer B. 1995. Fungi on Juncus roemerianus. I. Trichocladium
medullare sp. novo. Mycotaxon 53: 349-353. doi:10.2307/3760772
Kohlmeyer J, Volkmann-Kohlmeyer B. 1998. Naufragella, a new genus in the Halosphaeriaceae.
Systema Ascomycetum 16: 9-16.
Lintott WH, Lintott E.A. 1982. Lignicolous marine fungi from New Zealand. Mauri. Ora. 10:
73-76.
Meyers SP, Moore RT. (1960). Thalassiomycetes I]. New genera and species of Deuteromycetes.
American Journal of Botany 47: 345-349. doi:10.2307/2439220
Miller JD, Whitney NJ. 1981. Fungi from the Bay of Fundy. I. Lignicolous marine fungi. Canadian
Journal of Botany 59: 1128-1133. doi:10.1139/b81-154
Nakagiri, A. 1989. Marine fungi in sea foam from Japanese coast. IFO Research Communications
14: 52-79.
Nakagiri A, Okane I, Ito T. 1999. Geographical and seasonal distribution of arenicolous marine
fungi along the pacific coast of the Bousou Peninsula. IFO Research Communications 19:
22-33,
Nylander JAA. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology
Center, Uppsala University, Uppsala.
Posada D, Crandall KA. 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics
14: 817-818. doi:10.1093/bioinformatics/14.9.817
Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. doi:10.1093/bioinformatics/btg180
Sakayaroj J, Jones EBG, Chatmala I, Phongpaichit S. 2004. Marine fungi. 107-117, in: Thai fungal
diversity (eds. EBG Jones, M Tanticharoen, KD Hyde). BIOTEC, Thailand
Shearer CA, Burgos J. 1987. Lignicolous marine fungi from Chile. Botanica Marina 30: 455-458.
doi: 10.15 15/botm.1987.30.6.455
Shearer CA, Crane JL. 1977. Fungi of the Chesapeake Bay and its tributaries. VI. Trichocladium
achrasporum, the imperfect state of Halosphaeriopsis mediosetigera, a marine ascomycete.
Mycologia 69: 1218-1223. doi:10.2307/3758950
Swofford DL. 2002. PAUP* 4.0: Phylogenetic analysis using parsimony (*and other methods).
Sinauer, Sunderland, MA.
Tan TK, Leong WE. 1992. Lignicolous fungi of tropical mangrove wood. Mycological Research 96:
413-414. doi:10.1016/S0953-7562(09)81083-6
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The ClustalX windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 25: 4876-4882. doi:10.1093/nar/25.24.4876
456 ... Abdel-Wahab
Tubaki K. 1966. Marine fungi from Japan. Lignicolous group I. Transactions of the Mycological
Society of Japan 7: 73-87.
Tubaki K. 1967. Studies on the Japanese marine fungi. Lignicolous group II. Publications of the
Seto Marine Biological Laboratory 15: 357-372.
Tubaki K. 1969. Studies on the Japanese marine fungi. Lignicolous group HI. Algicolous group and
a general consideration. Annuals Reports of the Institution of Fermentation, Osaka 4: 12-42.
Tubaki K. 1973. Fungi inhabiting in brackish water. Reports of Tottori Mycological Institute, Japan
10: 523-539,
Zanial A, Jones EBG. 1984. Observations on some lignicolous marine fungi from Kuwait. Nova
Hedwigia 39: 569-575.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 457-468 January-March 2011
DOT: 10.5248/115.457
Paraconiothyrium babiogorense sp. nov., anew endophyte
from fir club moss Huperzia selago (Huperziaceae)
‘TULIA BUDZISZEWSKA*, 7WOJCIECH SZYPULA,
3MATEUSZ WILK & ‘MARTA WRZOSEK
‘Department of Plant Systematics and Geography &
’Department of Plant Ecology and Environmental Protection,
University of Warsaw, Al. Ujazdowskie 4, 00-478 Warsaw, Poland
2Department of Biology and Pharmaceutical Botany, Faculty of Pharmacy,
The Medical University of Warsaw, ul. Banacha 1, 02-097 Warsaw, Poland
CORRESPONDENCE TO *: julia.
[email protected]
AssTRACT — Paraconiothyrium is a recently established genus within the order Pleosporales.
Species from this genus are commonly associated with plants but can also be found in soil
samples and be parasitic on fungi. Several isolates of a Paraconiothyrium sp. were obtained
from Huperzia selago in Poland. Strains were characterized based on morphological
characteristics and molecular data (SSU rDNA, ITS1, 5.88 rDNA, ITS2). Based on its unique
morphology and DNA phylogeny, isolates were described as a new species: Paraconiothyrium
babiogorense, which represents the first report of a Paraconiothyrium species from fir club
moss. Comparison of characters with other Paraconiothyrium species is provided as well as a
signature sequence for the new species.
Key worps — Paraphaeosphaeria, Coniothyrium
Introduction
Huperzia selago (= Lycopodium selago L.), fir club moss, is a member of the
Huperziaceae (Rothmaler 1944, 1962). Both gametophytes and sporophytes
of this plant are colonized by endophytic fungi (Higgins et al. 2007, Winther
& Friedman 2008). Recently, some Paraconiothyrium-like, endophytic strains
were isolated from healthy-looking propagules (e.g., bulbils, gemmae) of
Huperzia selago collected in the Babia Géra National Park, Poland.
Paraconiothyrium comprises 9 species to date (Damm et al. 2008). The
genus was established by Verkley (Verkley et al. 2004) to accommodate two
species of Coniothyrium-like anamorphs, Paraconiothyrium minitans (W.A.
Campb.) Verkley and P sporulosum (W. Gams & Domsch) Verkley. The genus
also comprised four newly described species: Paraconiothyrium estuarinum
A58 ... Budziszewska & al.
Verkley & M. da Silva, P brasiliense Verkley, P. cyclothyrioides Verkley, and
P. fungicola Verkley & Wicklow. Damm et al. (2008) later described P. variabile
Riccioni et al. and P africanum Damm et al., and transferred Microdiplodia
hawaiiensis Crous as P. hawaiiense (Cross) Damm et al. as indicated by ITS and
SSU sequence analyses. Paraconiothyrium belongs to the order Pleosporales,
class Dothideomycetes (Verkley et al. 2004, Damm et al. 2008). Based on SSU
and ITS phylogeny, the teleomorph state of Paraconiothyrium belongs probably
to the genus Paraphaeosphaeria s. str. (Camara et al. 2001, Verkley et al. 2004).
Paraconiothyrium is characterized by presence of eustromatic, simple or
complex, rarely pycnidial conidiomata. Conidiogenous cells are discrete or
integrated, phialidic or sometimes percurrent. Conidia are aseptate or one-
septate, thin-walled and generally smooth-walled, hyaline when liberated, later
brown (Verkley et al. 2004).
Most Paraconiothyrium isolates to date have been obtained from woody
plants (Damm et al. 2008). However, P. minitans and P. fungicola can also be
fungicolous (Campbell 1947, Whipps & Gerlagh 1992, Verkley et al. 2004,),
P. sporulosum was found in soil samples (Damm et al. 2008), and P estuarinum
was detected in an estuarine sediment (Verkley et al. 2004). Recently,
P. brasiliense and P. sporulosum were determined as dominant endophytes of
the mistletoe Phoradendron perrottetii (Viscaceae) from Brazil (Abreu et al.
2010). Damm et al. (2008) suggested that Paraconiothyrium was a commonly
occurring fungal genus and that it was more often isolated from warm regions
like South Africa, Italy, Brazil, Papua New Guinea, Hawaii (USA), and Turkey
(Verkley et al. 2004, Crous & Groenewald 2006, Gore & Bucak 2007, Riccioni
et al. 2007).
The aim of the present study was to evaluate the taxonomic position of
Paraconiothyrium-like isolates from H. selago propagules collected from an
alpine site in Babia Géra National Park, using morphological observations and
analysis of ITS and SSU rDNA sequences.
Materials & methods
Isolates
Symptomless Huperzia selago propagules from nine different plant individuals were
collected from one site in Babia Géra National Park (49°34’24”N 19°31’46”E), Beskidy
Mountains, Poland. After transfer to the laboratory, the propagules were cleaned of
remnants of soil and other plant leaves, rinsed in tap water with detergent, and then
surface disinfected according to the protocols of Szyputa et al. (2005). In the first step
propagules were subsequently rinsed for 1 min in the following solutions: 0.01 M
hydrochloric acid (HCl), 5% sodium hypochlorite (NaOCl) and 2.4 mM citric acid.
In the second step 70% ethyl alcohol (C,H,OH) for 1 min, 5% sodium hypochlorite
(NaOCl) for 15 min, and 7% hydrogen peroxide (H,O,) for 10 min were used.
After surface sterilization propagules were plated onto potato-dextrose agar (2%
PDA, Fluka’ Analytical) and synthetic medium with yeast extract (BTL, Lddz, Poland)
Paraconiothyrium babiogorense sp. nov. ... 459
containing 1 g Lt ammonium nitrate (NH,NO,), 1 g L'ammonium sulfate [(NH,),SO,],
4 gL" potassium phosphate dibasic (K,HPO,), 2 g L* potassium phosphate monobasic
(KH,PO,), 1 gL" sodium chloride NaCl, 10 g L' glucose,
1 g L" yeast extract (Difco, USA), and 15 g L'Bacto™ Agar (Becton, Dickinson
and Company, USA). The pH was adjusted to 4.55 prior to sterilization by using 10%
citric acid. The sterilization was carried out in an autoclave at 121° C under increased
pressure of 1 bar for 15 min. The cultures were incubated at room temperature (~17°C)
for 4 weeks. Reference strains of isolated fungi are maintained in herbarium (WA17577,
WA17612-WA17619) and culture collection (CBS128292).
Morphology
‘The strains were studied on 2% Potato Dextrose Agar (PDA, Fluka’ Analytical). Petri
dishes were incubated at room temperature for 2-4 weeks. To enhance sporulation,
autoclaved fir club moss fragments were placed on 2% PDA medium. Growth
characteristics were studied on PDA plates incubated in dark at room temperature.
Sporulating structures were mounted in Lactophenol Mounting Medium (Amann’s fluid;
Stevens 1974) and observed using Nikon Eclipse 600 and Nikon SMZ800 microscopes.
Digital images were recorded with Nikon DX 1200 and Canon EOS 450D. The structures
were measured using Coolview v.1.6.0 software.
DNA extraction & sequencing
Total genomic DNA was extracted from the fresh mycelium grown on PDA plates
using Genomic Mini AX PLANT Kit (DNA-Gdarnsk, Gdynia, Poland). The internal
transcribed spacer region (ITS; ca. 0.5 kb) and fragment of 18S rDNA (SSU rDNA; ca.
1.0 kb) were amplified by PCR. Forward primer ITS1-f and reverse primer ITS4 were
used to amplify the ITS region (Gardens & Bruns 1993). Forward primers 402 (5: Gcr
ACC ACA TCC AAG GAA GGC), 1144 (5°: GCC TGC GGC TTA ATT TGA CTC) and reverse
primers 1308 (5°: cic GTT CGT TAA CGG AAT TAA), R (5°: TGA TCC TTC TGC AGG TTC
ACC) were used to amplify SSU rDNA. PCR protocols followed Korniltowicz-Kowalska
et al. (2006). Forward and reversed sequences were matched using BioEdit Sequence
Alignment Editor v. 7.0.0 (Hall, 1999).
Phylogenetic analysis
Pairwise and global alignments of ITS region and SSU rDNA were performed in
BioEdit Sequence Alignment Editor v. 7.0.0 (Hall, 1999). Phylogenetic trees were
obtained from the data using maximum parsimony (MP), neighbor-joining (NJ)
in PAUP* v. 4.0b10 (Swofford 2002) and Bayesian analysis (BA) in MrBayes v. 3.1.2
(Huelsenbeck & Ronquist 2001). Tree robustness was evaluated by 1000 replicate
bootstrap analysis. The Akaike Information Criterion (AIC) implemented in Modeltest
3.7 (Posada & Crandall 1998) was used to select the model that best fit each dataset.
BLAST searches in GenBank with ITS region sequences were performed using the blastn
algorithm. For phylogenetic analysis Helminthosporium velutinum Link (AF145704) and
Helminthosporium solani Durieu & Mont. (AF163089) for the ITS dataset and Peziza
echinospora P. Karst. (AF006309) for the 18S rDNA dataset were used as outgroups like
in research by Damm et al. (2008). GenBank accession numbers used in these studies
are indicated on the phylogenetic trees.
460 ... Budziszewska & al.
A species specific, signature DNA sequence in the Internal Transcribed Spacer 1
(ITS1) was determined basing on ITS region alignment. The accuracy of characteristic
sequence identification was verified using the BLAST algorithm against the whole
GenBank database.
Results
Morphological observations
Morphological characters are presented in TABLE 1, where they are compared
with other closely related species. They are also presented in the taxonomic
description.
Phylogenetic analysis
The SSU region dataset contained 36 taxa and 933 characters (including
gaps) and 92 characters were parsimony informative. After heuristic search,
three most parsimonious SSU trees (length: 262 steps) were retained and the
strict consensus tree was calculated using bootstrap 50% majority-rule. The ITS
region alignment of 52 taxa contained 522 characters (including gaps), of which
179 characters were parsimony informative. After heuristic search, four most
parsimonious ITS trees (length: 423 steps) were retained, and the strict consensus
tree was calculated using bootstrap 50% majority-rule. The topologies of the
ITS trees using MP and BA were similar (Fics 1 and 2). However, in NJ analysis
P. fungicola was placed in outer position to all other Paraconiothyrium species,
and PB sporulosum, P. minitans, and two Paraphaeosphaeria spp. formed a sister
group separate from the to the remaining Paraphaeosphaeria spp. Although
we did not resolve phylogenetic relationships within the Paraphaeosphaeria/
Paraconiothyrium clade, the main species groups were the same as in Verkley
et al. (2004).
The genetic variability of ITS sequences between different strains of
P. babiogorense was very low (less than 1%). These ITS sequences revealed the
highest similarity to Coniothyrium fuckelii Sacc. (AY904055), Paraconiothyrium
sp. (EU709779), Coniothyrium wernsdorffiae Laubert (AY904058), and
Coniothyrium sp. (GU062312; e-value = 0.0; maximum identity = 95% all).
The SSU sequence of our strain revealed the highest similarity to Bipolaris
sorokiniana (Sacc.) Shoemaker (DQ337383), Paraphaeosphaeria michotii
(Westend.) O.E. Erikss. (AF250817), Paraphaeosphaeria sp. (AB096264), and
Paraconiothyrium sp. (AB303550; e-value = 0.0; maximum identity = 99% all).
The phylogenetic analysis of the SSU dataset confirmed that our isolates
are placed in the Paraconiothyrium/Paraphaeosphaeria clade (Fic. 1) as
defined by Verkley et al. (2004). The phylogenetic tree based on ITS dataset
showed that strains from H. selago are placed on sister branch to two other
Paraconiothyrium sp. from Polish club mosses (Fic. 2). However, without
detailed information on morphology of these two other strains, we decided not
74
0.66
99 |
1.00]
Paraconiothyrium babiogorense sp. nov.... 461
AY642527 Paraconiothyrium fungicola
~ HM623325 Paraconiothyrium babiogorense
AF250821 Paraphaeosphaeria pilleata
EU295653 Paraconiothyrium variabile
60 > AY642522 Paraconiothyrium estuarinum
| AY642523 Paraconiothyrium brasiliense
EU295651 Paraconiothyrium brasiliense
AY642524 Paraconiothyrium cyclothyrioides
AF250817 Paraphaeosphaeria michotii
AY642526 Paraconiothyrium minitans
98 EU295655 Paraconiothyrium hawaiiense
78 | 1.00 EU295656 Paraconiothyrium hawaiiense
0.99
Paraconiothyrium/Paraphaeosphaeria
EU295654 Paraconiothyrium africanum
AY016345 Letendraea helminthicola
AY016338 Bimuria novae-zelandiae
AF120250 Helminthosporium solani
AF120254 Helminthosporium velutinum
U05201 Pleospora herbarum
U43458 Pleospora herbarum
U04205 Leptosphaeria doliolum
U42481 Cucurbitaria berberidis
U43466 Pleospora betae
Pleosporales
U04238 Leptosphaeria maculans
AF250823 Phaeosphaeriopsis agavensis
U04236 Phaeosphaeria nodorum
AY642513 Coniothyrium palmarum
AF250820 Neophaeosphaeria filamentosa
U42484 Herpotrichia diffusa
U42483 Herpotrichia juniperi
AY016354 Trematosphaeria heterospora
——— AY642528 Roussoella hysterioides
AY016355 Westerdykella cylindrica
U42476 Lasiodiplodia theobromae
0.77 AB041248 Guignardia mangiferae
~ U42474 Dothidea insculpta
: AF006309 Peziza echinospora
10
Fic. 1. Strict consensus tree obtained from partial SSU nrDNA sequences data of selected
Dothideomycetes species. Numbers above branches indicate bootstrap support values inferred
by maximum parsimony analysis (1000 replicates; length: 277 steps, CI: 0.661, RI: 0.796,
RC: 0.526, HI: 0.339); numbers under branches indicate Bayesian posterior probability values.
Only values higher than 50% are shown.
462 ... Budziszewska & al.
-/100
1.00
-/96
100/99
1.00
10
Fic. 2. Strict consensus tree obtained from ITS region sequences data of Paraconiothyrium/
Paraphaeosphaeria species. Numbers above branches before slash indicate bootstrap support
values inferred by neighbor-joining analysis (1000 replicates); numbers above branches after
slash indicate bootstrap support values inferred by maximum parsimony analysis (1000
replicates; length: 423 steps, Cl: 0.650, RI: 0.894, RC: 0.581, HI: 0.350); numbers under branches
EF055360 Paraconiothyrium sp.
EF055359 Paraconiothyrium sp.
EU295641 Paraconiothyrium variabile
EU295644 Paraconiothyrium variabile
EU295647 Paraconiothyrium variabile
EU295643 Paraconiothyrium variabile
EU295648 Paraconiothyrium variabile
EU295646 Paraconiothyrium variabile
EU295640 Paraconiothyrium variabile
EU295645 Paraconiothyrium variabile
EU295639 Paraconiothyrium variabile
EU295642 Paraconiothyrium variabile
EU295649 Paraconiothyrium variabile
HQ316927 Paraconiothyrium babiogorense
HQ316928 Paraconiothyrium babiogorense
HQ316929 Paraconiothyrium babiogorense
HQ316930 Paraconiothyrium babiogorense
HQ316931 Paraconiothyrium babiogorense
HQ316932 Paraconiothyrium babiogorense
HQ316933 Paraconiothyrium babiogorense
HQ316934 Paraconiothyrium babiogorense
HM623324 Paraconiothyrium babiogorense
EU709779 Paraconiothyrium sp.
EU935219 Paraconiothyrium sp.
AY642531 Paraconiothyrium brasiliense
EU295637 Paraconiothyrium brasiliense
EU295635 Paraconiothyrium brasiliense
EU295638 Paraconiothyrium brasiliense
EU295636 Paraconiothyrium brasiliense
EU295632 Paraconiothyrium brasiliense
EU295633 Paraconiothyrium brasiliense
EU295634 Paraconiothyrium brasiliense
P. variabile
P. babiogorense
P brasiliense
98/87 AF250817 Paraphaeosphaeria michotii
1.00 AF250821 Paraphaeosphaeria pilleata
100/99 AJ293809 Paraconiothyrium eb | P minitans
1.00 AJ293810 Paraconiothyrium minitans
AJ293814 Paraconiothyrium sporulosum
AJ293815 Paraconiothyrium sporulosum
AY929375 Paraconiothyrium cyclothyrioides
AB096264 Paraphaeosphaeria sp.
AY642530 Paraconiothyrium estuarinum
DQ885896 Paraconiothyrium hawaiiense
DQ885897 Paraconiothyrium hawaiiense
] P. sporulosum
] P hawaiiense
EU295650 Paraconiothyrium africanum
AY642532 Paraconiothyrium fungicola
100/99
0.99
-/99
0.98
100/95
1.00
100/99
1.00
56/62
0.98
65/54
100/90 O81
0.72
59/66
0.98
95/93
1.00
100/96
0.79
98/94
94/85 0.99
0.95
100/99
1.00
51/95
155 0.79
AF439463 Saccharicola taiwanensis
AF439464 Saccharicola taiwanensis
Af439462 Saccharicola taiwanensis
AF455415 Saccharicola bicolor
U04203 Saccharicola bicolor
AF145704 Helminthosporium velutinum
AF 163089 Helminthosporium solani
indicate Bayesian posterior probability values. Only values higher than 50% are shown.
to treat all of them as the same species. Taking into account the phylogenetic
position of strains WA0000017577, WA0000017612-WA0000017619, their
distinct morphological characters, and low ITS sequence similarity to other
Paraconiothyrium representatives (less than 95%), we decided to describe them
as a new, separate species, Paraconiothyrium babiogorense.
Paraconiothyrium babiogorense sp. nov. ... 463
Taxonomy
Paraconiothyrium babiogorense Budziszewska, sp. nov. PLATE 1
MycoBank 519253
Coloniae in PDA ad temp 17°C luteae, reverso brunneae; Conidiomata eustromatica,
complexa, globosa (0.2-)0.3-0.5(-0.9) mm diametro; Cellulae conidiogenae discretae,
phialidicae, ampulliformes, hyalinae vel pallide brunneae, 5-7(-9) x 3-5 jm; Conidia
tempore liberationis hyalina, deinde luteo-fusca, cylindrica vel breviter cylindrica, glabra,
aseptata, interdum uniseptata, guttulata, 1-2(-3) x (7-)8-9(-10) um.
Type: Poland, Babia Gora National Park, Carpathians Mountains (49°34’24”N,
19°31'46"E; WGS84 system) from healthy propagules of H. selago, 10 October 2009,
J. Budziszewska; holotype, WA17577 (dried culture); isotypes, WA17612—-WA17619
(dried cultures); ex-holotype, CBS128292 (lyophylised culture).
SIGNATURE SEQUENCE: 5? CCCCTGGGGGCGTGGGCGTCTCCCGGCGTCCTCTCTCCTG 3”
Erymo.Loey: Named after the place of origin — the Babia Gora National Park, Poland.
Colonies on PDA reach 5 mm after 7 days and 25 mm after 28 days (~17°C,
dark). Colonies are Colonial-Buff to Deep Colonial-Buff and reverse is Honey-
Yellow to Isabella in color (Ridgway 1912). Conidiomata eustromatic, complex,
mostly submerged in the agar, but also superficial on club moss fragments,
globose to subglobose, dark brown to black, ostioles absent, (0.2-)0.3-0.5
(-0.9) mm diam. Conidiophores reduced to conidiogenous cells. Conidiogenous
cell discrete, phialidic, ampulliform, hyaline to pale brown, 3-5 x 5-7(-9)
um. Conidia hyaline when liberated, later pale brown, cylindrical to short-
cylindrical, rounded at both ends, aseptate, sometimes 1-septate, thin and
smooth-walled, with 2-5 oil guttules, 1-2(-3) x (7-)8-9(-10) um.
Host: Huperzia selago (L.) Bernh. ex Schrank & Mart. (Huperziaceae)
DIsTRIBUTION: Southern Poland.
Notss: P babiogorense is most similar to Coniothyrium lycopodinum Sacc.
& Paol., described from Lycopodium annotinum L. However, P. babiogorense
conidia are longer (8-9 um) than those of C. lycopodinum (6 um), and the
two species were isolated from different hosts. The short-cylindrical conidia
with oil guttules of P. babiogorense are also similar to those of P. cyclothyrioides
(Verkley et al. 2004). However, PB babiogorense conidia are larger (1-2 x 8-9
um) and have more (2-5) oil guttules than P. cyclothyrioides. The SSU and ITS
phylogenies also support P. babiogorense as different from P. cyclothyrioides
(Fics. 1 & 2).
Discussion
The signature sequence, low ITS sequence similarity to other Paraconio-
thyrium representatives (95%), distinct morphological characters, and
monophyly support the Huperzia selago isolates as representing a new taxon,
described above as P. babiogorense. The new species fits wellin the concept of the
464 ... Budziszewska & al.
es eer = _ SE-GTXGO-F S0-70 ; ;
CTE G Oe Ca pelle>-T qeotpuréogns oy wo0pypndure eee ‘oneurojsna FOOT “Te 19 Aappied OSE
Patten Ts , S-€ X £-G syatdorp rep 1-0 ; ;
LEEKCIVG mos Pall>T mojrndure 10 ‘asoqop8qns sazoo ‘aqeqided ‘oreurojsna FOO? TP 19 Aap9A mobuns g
we aw 1 2, OV-STXO8-SP cT-€0 r :
gk Gee oy pelleoT qeotpuréogns oy wo0pypndure peed ‘oneurojsna HOOT ‘Te 19 AapHIOA SRAM
= us £9 RSIS SO> 9007 PIeMetIa0Ip, i
selec! fEOe Pelle qeotpuréogns 0} waoyypndure Peete qerprusdd 2 snoln asHatmneit E
5 Shea Pople’ 9-EX BE 90-TO ‘ ;
F-€XG6-G9 yuasqe ‘Aout suLLOgTOp 0} wOFINduTe yeryuas sqerprusdd 8007 ‘Te Je WUE wnuvrnafo J
z 7 c ‘: LEXs-Ge = 90-€0 : {
GAL Se satuTjauros pale? ‘odeys ur ayqeiea eT qerprusdd 800¢ "TP 19 Came] NAPPA
bs ee . S-GEXO-F 7-0 : ;
e-¢ Ko e Mey payee 4aaSGayS ay iments quasqe ianienaca POOT “Te 12 AEPylaA, asuayisp.ig q
P-€XL-P yuasqe paljao- wuoyypndure 0} proac yeryuao ay LbOT Teqdurea suppume q
: i qerprusdd ey
900 > uinsojnaods q
ST-S1X S-GZ yuasqe palja2- asoqgols 0} wuopndure ayeporso qerprusdd PR6I Uesourars
L-G X G-€ S'0-€°0 ‘
6-8 X Z-1 S-Z P? [22-1 Suuitpyduire juasqe swiss Apnys yuasead asuaLosoiqvg q
saTNLLao
(um) azis aod STIa9 # (umn) azis aavHs (Wut) ‘WvId salogas
‘TIE SAONFO OIGINOD TIOILSO “Ad A.L VWOIGINOO AONTATATY
VICINO‘)
‘satsods wintsdyjoiuompsDg WIIIJIP JO sJojereypo yesisoToydiow Jo uostszeduroy t ATaV,
Paraconiothyrium babiogorense sp. nov. ... 465
PLATE 1. Paraconiothyrium babiogorense: a. complex conidiomata immersed in agar medium;
b. conidia; c. longitudinal section of conidiomata; d. conidiomatal wall (arrow indicates
phialidic cell).
genus by the presence of eustromatic, complex conidiomata, discrete, phialidic
conidiogenous cells, and thin-, smooth-walled, hyaline (when liberated) to
brownish spores (Verkley et al. 2004). DNA sequence data from P. babiogorense
also support this species as representing Paraconiothyrium.
Fungal endophytes of Huperzia selago are poorly known. Budziszewska &
Szyputa (2010) identified 13 endophytic speciesin H. selago shoots from different
sites, of which only two were cited by Higgins et al. (2007), who also worked
on this plant. Surprisingly, neither Higgins et al. (2007) nor Budziszewska &
Szyputa (2010) isolated Paraconiothyrium species from fir club moss shoots
when our study isolated P babiogorense from the vegetative reproductive
structures. However, the species could have been overlooked in previous
research, as it is an extremely slow growing fungus that is easily overgrown
by other, faster growing ones. Thus, the presence of a new Paraconiothyrium
species in H. selago shoots should be re-examined.
Although Paraconiothyrium species are relatively common (Damm et al.
2008), this is the first report of one isolated from fir club moss. Interestingly,
Coniothyrium lycopodinum (Saccardo 1892: 267-268), described from leaves of
Lycopodium annotinum from a mountain forest in Siberia, is morphologically
466 ... Budziszewska & al.
similar to our PB babiogorense isolates, at least according to its diagnosis.
Moreover, two Paraconiothyrium sp. isolates, which phylogenetic analysis
indicate are the closest relatives of the isolates from H. selago propagules, were
also isolated from the Polish club mosses Diphasiastrum tristachyum (Pursh)
Holub (EU709779) and Lycopodium clavatum L. (EU935219), suggesting some
degree of host specificity.
As P. babiogorense was isolated from healthy plant tissue, it is not known
whether it could be pathogenic to the host. Interestingly, periodic formation of
the specific vegetative propagules at the shoot apex is a unique feature of some
Huperzia species (Ollgaard 1987, Gola 2008). Moreover, the populations differ
in their strategies of balancing generative and vegetative reproduction with
extensive propagule production in mountain locations in opposition to the
moderate number of propagules produced by lowland plants (Gola 2008). All
P. babiogorense strains were isolated from these vegetative reproductive
structures in alpine H. selago plants, suggesting that it could be vertically
transmitted.
This fact can also explain the low genetic variability in ITS sequences among
P. babiogorense isolates. In fact, although we sampled nine plant ramets, we are
unable to determine how many plant genets there were. Thus, all isolated fungal
strains may actually be vertically transmitted clones of the same individual
and hence should not be treated as different strains. More research on
P. babiogorense and H. selago population structures and genetic variability on
this site are needed to understand the biology of the fungus.
Acknowledgments
The authors thank Dr Gerard J.M. Verkley and Dr Malgorzata Ruszkiewicz-Michalska
for reviewing the manuscript and Dr Pedro W. Crous for his useful comments on the
text. We would also like to thank Babia Géra National Park authorities for permission
to undertake the research in the park. The study was supported by State Committee for
Scientific Research, KBN, through Faculty of Biology, Warsaw University intramural
grant, BW191105, in the year 2010.
Literature cited
Abreu LM, Almeida AR, Salgado M, Pfenning LH. 2010. Fungal endophytes associated with the
mistletoe Phoradendron perrottettii [sic] and its host tree Tapirira guianensis. Mycological
Progress 9(4): 559-566. doi:10.1007/s11557-010-0663-8
Budziszewska J, Szyputa W. 2010. Influence of site conditions on the diversity of endophytic fungi
of clubmoss species Huperzia selago (L.) Bernh. ex Schrank et Mart. Polish Journal of Ecology
58(4): 627-634.
Camara MPS, Palm ME, Berkum P, Stewart EL. 2001. Systematics of Paraphaeosphaeria: a
molecular and morphological approach. Mycological Research 105(1): 41-56. doi:10.1017/
$0953756200003233
Campbell WA. 1947. A new species of Coniothyrium parasitic on sclerotia. Mycologia 39(2):
190-195. doi:10.2307/3755006
Paraconiothyrium babiogorense sp. nov. ... 467
Crous PW, Groenewald JZ. 2006. Microdiplodia hawaiiensis. Fungal Planet, No. 7 (www.
fungalplanet.org/content/descriptions/descriptions_001.htm).
Damm U, Verkley GJM, Crous PW, Fourie PH, Haegi A, Riccioni L. 2008. Novel Paraconiothyrium
species on stone fruit trees and other woody hosts. Persoonia 20: 9-17. doi:10.3767/
003 158508X286842
Gardens M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes: application
to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118. doi:10.1111/
j.1365-294X.1993.tb00005.x
Gola EM. 2008. Reproductive strategies of Huperzia. 5-14, in: E Szczesniak, E Gola (eds), Club
mosses, horsetails and ferns in Poland — resources and protection. Polish Botanical Society &
Institute of Plant Biology, University of Wroclaw.
Gore ME, Bucak C. 2007. Geographical and seasonal influences on the distribution of
fungal endophytes in Laurus nobilis. Forest Pathology 37: 281-288. doi:10.1111/j.1439-
0329.2007.00509.x
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.
Higgins LK, Arnold AE, Miadlikowska J, Sarvate SD, Lutzoni F. 2007. Phylogenetic relationships,
host affinity, and geographic structure of boreal and arctic endophytes from three
major plant lineages. Molecular Phylogenetics and Evolution 42: 543-555. doi:10.1016/
j-ympev.2006.07.012
Huelsenbeck JP, Ronquist F. 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics
17: 754-755. doi:10.1093/bioinformatics/17.8.754
Kornillowicz-Kowalska T, Wrzosek M, Ginalska G, Iglik H, Bancerz R. 2006. Identification and
application of a new fungal strain Bjerkandera adusta R59 in decolorization of daunomycin
wastes. Enzyme and Microbial Technology 38: 583-590. doi:10.1016/j.enzmictec.2005.10.009
Ollgaard B. 1987. A revised classification of the Lycopodiaceae s. lat. Opera Botanica 92: 153-178.
Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics
14: 817-818. doi:10.1093/bioinformatics/14.9.817
Riccioni L, Manning M, Valvassori M, Haegi A, Casonato S, Spinelli R. 2007. A new disease: leader
die-back in Actinidia chinensis “Hort16A’ in Italy. Acta Horticulturae 753: 669-676.
Ridgway R. 1912. Color standards and color nomenclature. Eliborn Classics. Washington.
Rothmaler W. 1944. Pteridophyten-Studien I. Feddes Repertorium 54: 55-82. doi:10.1002/
fedr.19440540106
Rothmaler W. 1962. Uber eininge Diphasium-Arten (Lycopodiaceae). Feddes Repertorium 66:
234-236.
Saccardo PA. 1892. Supplementum universale, pars II. Discomyceteae-Hyphomyceteae. Sylloge
Fungorum 10. 964 p.
Sivanesan A. 1984. The bitunicate ascomycetes and their anamorphs. AR Gantner Verlag. Vaduz.
Stevens RB. 1974. Mycology guidebook. University of Washington Press. Seattle.
Swofford DL. 2002. Phylogenetic analysis using parsimony (PAUP). Version 4. Sunderland,
Massachusetts: Sinauer Associates.
Szypula W, Pietrosiuk A, Suchocki P, Olszowska O, Furmanowa M, Kazimierska O. 2005. Somatic
embryogenesis and in vitro culture of Huperzia selago shoots as a potential source of huperzine
A. Plant Science 168: 1443-1452. doi:10.1016/j.plantsci.2004.12.021
Verkley GJM, da Silva M, Wicklow DT, Crous PW. 2004. Paraconiothyrium, a new genus to
accommodate the mycoparasite Coniothyrium minitans, anamorphs of Paraphaeosphaeria, and
four new species. Studies in Mycology 50: 323-335.
468 ... Budziszewska & al.
Whipps JM, Gerlagh M. 1992. Biology of Coniothyrium minitans and its potential for use in disease
biocontrol. Mycological Research 96: 897-907. doi:10.1016/S0953-7562(09)80588-1
Winther JL, Friedman WE. 2008. Arbuscular mycorrhizal associations in Lycopodiaceae. New
Phytologist 177: 790-801. doi:10.1111/j.1469-8137.2007.02276.x
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 469-480 January-March 2011
DOT: 10.5248/115.469
Additional species of Graphis from Maharashtra, India
GAYATRI CHITALE, URMILA MAKHIJA & BHARATI SHARMA®
Agharkar Research Institute, G.G. Agarkar Road, Pune - 411004, India
* CORRESPONDENCE TO:
[email protected]
ABsTRACT—Our recent investigations of the lichen flora of Maharashtra have brought to
light several new taxa in the family Graphidaceae. Nine species of Graphis with muriform
ascospores are recognized of which two, G. maharashtrana and G. elevativerrucosa, are
described as new to science. One new combination, G. panhalensis is proposed. Two species,
G. galactoderma and G. parilis, are recorded from India for the first time, and G. platycarpa
and G. subducta are reported for the first time from Maharashtra. Graphis sp. 1 is clearly
distinguished from the other species, but is not formally described as new to science as the
material is scanty. A revised key to all species of Graphis from Maharashtra is provided.
KEeyworps—taxonomy, ascomycetes, lichenized fungi
Introduction
The Western Ghats of India form a practically unbroken mountain chain
dominating the western coast of the Indian peninsula for almost 1600 km. They
extend from the mouth of the river Tapti in Gujarat to Kanyakumari, the tip of
South India in Tamil Nadu. The region consists of hills spreading north-south
along the coast traversing the states of Gujarat, Maharashtra, Goa, Karnataka,
Tamil Nadu, and Kerala and enjoys a tropical climate. The Western Ghats,
which are exceptionally biodiverse and occupy a special position in the Indian
subcontinent because of the interesting flora, are one of the richest lichen
sites of India. Thus far, 800 lichen species, including 219 (i.e. 27%) potential
endemics, have been recorded from this region (Singh et al. 2004).
Although a large number of lichens have been recorded from the Western
Ghats of South India, Maharashtra has long been among the least explored
places. During our recent investigations of the lichen flora of Maharashtra,
we recorded several species in the family Graphidaceae, including ten species
of Graphis with transversely septate ascospores and two species of Dyplolabia
(Makhija et al. 2005a), ten species of Hemithecium (Makhija et al. 2005b;
Chitale et al. 2009), three species of Pallidogramme (Chitale et al. 2009), and
eleven species of Diorygma (Sharma & Makhija 2009, Makhija et al. 2009).
470 ... Chitale, Makhija & Sharma
Graphis Adans. (sensu Staiger 2002), a widespread tropical lichen genus with
about 300 species known worldwide (Licking 2009, Lticking et al. 2009), is
characterized by a thallus crustose that is corticolous and epi- or endophloeodal
(rarely saxicolous or foliicolous); a green algal photobiont (Trentepohlia); lirellate
ascomata that are usually elongate, simple or variously branched (rarely short
oryzaeform), and immersed in the thallus or emergent and sessile; a totally
or partially but distinctly carbonized exciple with well developed, convergent,
and entire or crenate-sulcate labia; simple paraphyses that are not thickened
at apices; asci clavate to subcylindrical, (1-)2-4-8-spored, unitunicate, and
ascospores colourless, 3-many trans-septate, or muriform, locules lentiform,
I+ blue violet.
Graphis is represented by 85 species from the Indian subcontinent
(Adawadkar & Makhija 2004, 2006, 2007; Makhija & Adawadkar 2005a,b;
Makhija et al. 2005a, Jagadeesh Ram et al. 2007) and by ten species with trans-
septate ascospores from Maharashtra (Makhija et al. 2005a). In the present paper
we report the occurrence of nine Graphis species with muriform ascospores
from Maharashtra. Two species (G. maharashtrana, G. elevativerrucosa) are
described as new to science. Graphis galactoderma and G. parilis are reported
for the first time from India and G. platycarpa and G. subducta for the first
time from Maharashtra. Graphis panhalensis is proposed as a new combination.
Graphis sp. 1, which is clearly distinct from the other species, is not formally
described as new to science as the material is scanty. A key is provided to all
species of Graphis (both with trans-septate and with muriform ascospores)
now known from Maharashtra,.
Materials & methods
Chemical constituents were identified by thin-layer chromatography using methods
standardized for lichen products (Culberson & Kristinsson 1970, Culberson 1972, White
& James 1985) with the solvent systems benzene-dioxane-acetic acid (180:45:5), hexane-
ethyl ether-formic acid (130:80:20) and toluene-ethyl acetate-formic acid (139:83:8). All
specimens examined are deposited in Ajrekar Mycological Herbarium (AMH).
Taxonomy
Graphis elevativerrucosa Chitale, Makhija & B.O. Sharma, sp. nov. Fic. 8
MycoBank MB 519296
Similis Graphis bilabiata, sed lirellis longioribus, immerses in verrucosus et acid continens
differt.
Holotypus—India. Maharashtra: Sindhudurg District, Amboli, 28.9.1976, PG.
Patwardhan & A.V. Prabhu, 76.1233: AMH.
EryMo.oey: From the Latin elevatus (elevated) and verrucosus (warty): a reference to
highly elevated verruceae.
Graphis in Maharashtra (India) ... 471
Thallus crustose, corticolous, grayish-green to dull brownish-green, distinctly
warty, robust, thick; hypothallus absent. Ascomata lirelline, concolorous with
the thallus, straight to curved, terminally acute, mostly simple, rarely branched
irregularly, 1-9 mm long and 0.1-0.2 mm broad, immersed in verrucae of the
thallus, raised; exciple, convergent, non-striate, present at the base, apically
carbonized, covered with the thalline margin up to the top; hymenium hyaline,
not inspersed, 84-147 um tall, KI-; asci 2-4-spored. Ascospores hyaline,
muriform, ellipsoidal, oblong, 76-109 x 25-29 um, I+ violet.
CHEMISTRY— Constictic, stictic (major), and hypostictic (minor) acids
present.
ADDITIONAL SPECIMENS EXAMINED—INDIA. Manarasutra: Sindhudurg District,
Amboli, RG. Patwardhan & A.V. Prabhu, 76.1258, 76.1259; U.V. Makhija & A.V. Prabhu,
76.1236: AMH
REMARKS— Graphis elevativerrucosa is well characterized by the thick, highly
elevated, conspicuous warts of the thallus, apically carbonized exciple without
striae; 2-4-spored asci, muriform ascospores of 76-109 x 25-29 um and by the
presence of constictic, hypostictic and stictic acids in its thallus.
Graphis elevativerrucosa shares most of the morphological characters with
G. bilabiata Nyl., a species from Ceylon, but the latter has extremely short,
sessile lirellae with a thick lateral thalline margin.
Graphis streblocarpa (Bél.) NyL, a species with immersed to emergent lirellae,
large muriform ascospores, and a smooth to subtuberculate thallus, however,
differs from the present species in prominently immersed ascomata in the
thalline verrucae, 1-2-spored asci, and narrow (15-30 um diam) ascospores.
The new species has been collected in semi-evergreen forest in open places
on the roadsides.
Graphis galactoderma (Zahlbr.) Licking, Lichenologist 41: 436 (2009). Fic. 1
SPECIMENS EXAMINED—INDIA. Manarasutra: Kolhapur District, Panhala, PG.
Patwardhan e& A.V. Prabhu, 74.1083, 74.1094, 74.1113, 74.1121; BG. Patwardhan & C.R.
Kulkarni, 74.1144: AMH
Thallus crustose, corticolous, epiphloeodal, uniform, continuous, pale yellow
to white in colour, smooth to cracked, surrounded by thin, black hypothallus.
Ascomata lirelline, up to 6 mm long and up to 0.2 mm broad, simple to branched
or forked at apices, crowded, emergent to prominent, curved, wavy, flexuous,
blackish, terminally acute or obtuse; lateral thalline margin not bulging, studded
with crystals; exciple 1-4-striate, apically carbonized; hymenium hyaline, not
inspersed, 84-100 pm tall, KI-; asci 8-spored. Ascospores hyaline, muriform,
fusiform-oblong, 34-42 x 16-21 um, I+ violet.
CHEMISTRY—Constictic, stictic (major) and norstictic acid (minor)
present.
472 ... Chitale, Makhija & Sharma
REMARKS— Graphis galactoderma has been collected at ca. 750 m from moist
open forests that get heavy rains during the monsoon. ‘This species, earlier
known from the eastern palaeotropics, is a first report from India.
Graphis insulana (Mill. Arg.) Licking & Sipman, Fieldiana Botany 46(1):
84 (2008). Fic. 2
= Graphina insulana Mill. Arg., Engler Bot. Jahr. 4: 56 (1883).
SPECIMENS EXAMINED—INDIA. MAHARASHTRA: Ratnagiri District, Nerur, A.V.
Prabhu, 75.486, 75.487; Dabhole ghat, A.V. Prabhu e& M. B. Nagarkar, 74.2068: AMH
Thallus crustose, corticolous, whitish-gray to light greenish-gray, smooth,
cracked with the age, delimited by a black hypothalloidal region at the periphery.
Ascomata lirelline, mostly immersed, to rarely slightly emergent, straight to
curved, terminally acute, mostly simple, rarely irregularly branched, up to 11
mm long and up to 0.25 mm broad; exciple convergent, non-striate, laterally
to sometimes completely carbonized, present at the base; hymenium hyaline,
inspersed, 134-168 pm tall, KI-; asci 1-spored. Ascospores hyaline, muriform,
oblong, with more or less rounded ends, 67-118 x 17-29 um, I-.
CHEMISTRY —Norstictic acid present.
REMARKS—Graphis insulana, a widely distributed species in the tropical regions
of the world, was earlier described from Maharashtra as Graphina nylanderi
Patw. & C.R. Kulk. (Patwardhan & Kulkarnil979). It has also been reported
from Karnataka in India.
Graphis maharashtrana Chitale, Makhija & B.O. Sharma, sp. nov. Fic. 3
MycoBank MB 519287
Similis Graphis panhalensis, sed excipulo lateralis nigro, ascosporis minoribus, et acida
consticticum, hyposalazinicum et sticticum continens differt.
Holotypus—India. Maharashtra: Sindhudurg District, on the way to Ajra from Amboli,
10.10.2000, U.V. Makhija & B.A. Adawadkar, 00.168: AMH.
ETYMOLOGY: From the state name Maharashtra.
Thallus crustose, corticolous, endophloeodal, continuous, smooth to cracked,
grayish-white to dirty white, surrounded by a thin black hypothallus. Ascomata
lirelline, short, up to 3 mm longand 0.1mm broad, simple to branched, immersed
to semi-emergent, irregularly curved, flexuous, scattered, concolorous with
the thallus to black, terminally round to acute; exciple 4—5-striate, laterally
carbonized, present at the base, convergent, covered by a thick thalline margin
up to the top; studded with crystals; hymenium hyaline, not inspersed, 34-46
Figure 1-6. Habit: 1. Graphis galactoderma (74.1121: AMH); 2. G. insulana (75.486:AMH);
3. G. maharashtrana (Holotype); 4. G. panhalensis (Holotype); 5. G. parilis (74.1826:AMH);
6. G. platycarpa (74.1826: AMH). Bar =1mm
473
Graphis in Maharashtra (India) ...
474 ... Chitale, Makhija & Sharma
pum tall, KI-; asci 8-spored. Ascospores hyaline, muriform, fusiform-oblong,
without gelatinous sheath, 25-42 x 13-17 um, I+ violet.
CHEMISTRY—Constictic, stictic acids present.
ADDITIONAL SPECIMENS EXAMINED—INDIA. ManarasHTRa: Kolhapur District,
Panhala, 2G. Patwardhan & A.V. Prabhu, 74.1063b, 74.1076; 74.1078, 74.1091; PG.
Patwardhan & C.R. Kulkarni, 74.1095, 74.1101, 74.1129. Nasik District, Anjaneri,
B.C. Behera & G.S. Chitale, 02.232; Saptashringi, B.C. Behera & G.S. Chitale, 02.185.
Pune District, Bhimashankar, B.A. Adawadkar, 97.19; Lonavala, B.C. Behera & B.A.
Adawadkar, 00.87; Khandala, B.C. Behera & V.A. Mantri, 00.88; Lonavala, Walvan Dam,
B.C. Behera, 02.122, 02.123; Malshej Ghat, Neemgiri, UV. Makhija & A.V. Bhosale,
02.14B; Purandar fort, UV. Makhija & A.V. Bhosale, 02.55: AMH
REMARKS— Graphis maharashtrana belongs in a small group (Group 16,
Licking et al. 2009) of taxa with striate, laterally carbonized exciples, clear
hymenium, and muriform ascospores. All species but one within this group
lack lichen secondary metabolites. The exception, G. neoelongata Licking,
differs from the new species in having stictic and norstictic acids and very long
and radiately branched lirellae.
The species can easily be differentiated from the morphologically similar
G. panhalensis in having a laterally carbonized exciple, smaller ascospores of
25-42 x 13-17 wm and constictic and stictic acids. Graphis panhalensis has
apically carbonized exciple and larger ascospores of 45-65 x 12-16 um; it
contains has only stictic acid.
Graphis maharashtrana has been collected from the bark of Mangifera indica
in the dry deciduous forests.
Graphis panhalensis (Patw. & C.R. Kulk.) Chitale, Makhija & B.O. Sharma,
comb. nov. Fic. 4
MycoBank MB 519294
= Graphina panhalensis Patw. & C.R. Kulk., Norw. J. Bot. 26: 47 (1979).
Thallus pale glaucous green, smooth to indistinctly warty; ascomata emergent,
black, simple, curved or flexuous, 0.5-2 mm long, ends subacute; exciple 4-5-
striate, carbonized only at the apices; hymenium not inspersed; asci 8-spored;
ascospores hyaline, muriform, ellipsoid, 45-65 x 12-16 um.
CHEMISTRY—Stictic acid present.
SPECIMEN EXAMINED—INDIA. MAHARASHTRA: Panhala, 13.10.1974, 2G. Patwardhan
& C.R. Kulkarni, 74.1075: AMH (holotype)
REMARKS—Graphis panhalensis, established as Graphina panhalensis by
Patwardhan & Kulkarni (1979) from Maharashtra, is now placed in Graphis
in the new system of Staiger (2002) based on its convergent, well developed
exciple with distinct carbonized areas and colourless ascospores. This species is
known only from its type.
Graphis in Maharashtra (India) ... 475
Graphis parilis Kremph., Flora 59: 422 (1876). Fic. 5
SPECIMENS EXAMINED—INDIA. MAHARASHTRA: Satara District, Mahabaleshwar,
Arther Seat, M.B. Nagarkar & A.V. Prabhu, 74.1765, 74.1769; Lodwick point, M.B.
Nagarkar & A.V. Prabhu, 74.1826, 74.1839, 74.1849, 74.1910, 74.1911; A.V. Prabhu &
M.B. Nagarkar, 74.1823, 74.1824, 74.1825, 74.1827, 74.1835, 74.1872, 74.1927, 74.2952;
Kolhapur District, Panhala, 13.10.1974, BG. Patwardhan e& A.V. Prabhu, 74.1132; Pune
District, Malshej ghat, UV. Makhija & A.V. Bhosale, 02.17: AMH
Thallus crustose, corticolous, epiphloeodal, continuous, smooth to cracked,
or warty, greenish-yellow, surrounded by a thin, black hypothallus. Ascomata
lirelline, up to 10 mm long and 0.2-0.5 mm broad, branched, curved, totally
immersed to semi-emergent, or emergent, flexuous, concolorous with the
thallus, terminally acute; exciple yellowish-brown, present at the base, apically
carbonized, and convergent, 3-8-striate, covered by a thick thalline margin up
to the top, studded with crystals; hymenium hyaline, not inspersed, 84-126(-
136) wm tall, KI-; asci 2-8-spored. Ascospores hyaline, muriform, oblong,
46-76 x 13-17 um, I+ violet.
CHEMISTRY—Stictic acid present.
REMARKS—Graphis parilis, a species earlier reported from Brazil, Canada,
Florida, and Mexico, is here reported from India for the first time.
Graphis platycarpa Eschw., Fl. Brasil. 1:74 (1833). Fic. 6
SPECIMENS EXAMINED—INDIA. MAHARASHTRA: Satara District, Mahabaleshwar,
Arther Seat, M.B. Nagarkar e& A.V. Prabhu 74.1759, 74.1763; Lodwick Point, M.B.
Nagarkar & A.V. Prabhu; A.V. Prabhu & M.B. Nagarkar, 74.1864, 74.1902, 74.1839,
74.1910, 74.1911: AMH
‘Thallus crustose, corticolous, greenish-gray, epiphloeodal, continuous, smooth
to cracked, uneven, rough, surrounded by a thin, black hypothallus. Ascomata
lirelline, 1-3.2 mm long and 0.1-0.25 mm broad, simple to rarely with short
branches, semi-emergent, scattered, concolorous with the thallus, terminally
acute; exciple present at the base, 1-5-striate, carbonized only at tips, converging
at the apical portion, covered by a thick thalline margin up to the top, studded
with crystals; hymenium hyaline, clear, 100-136 um tall, KI-; hypothecium
hyaline to yellowish, 16-20 um thick; asci 8-spored. Ascospores hyaline,
muriform, fusiform-oblong, without gelatinous sheath, 7-14-transverse septa,
lumina lenticular, 59-71 x 13-17 um, I+ violet.
CHEMISTRY— No lichen substances present.
REMARKS— Graphis platycarpa was found in semi-evergreen forest in shady
places. The most similar species, G. glaucorufa Vain., differs from G. platycarpa
by its 1-spored asci.
Graphis platycarpa was earlier known from Manipur, India, and is reported
for the first time from Maharashtra.
476 ... Chitale, Makhija & Sharma
Ficure 7-9. Habit. 7. Graphis subducta (04.89:AMH)); 8. G. elevativerrucosa (Holotype); 9. Graphis
sp. 1. Bar = 1 mm
Graphis subducta Vain., Ann. Acad. Sci. Fenn., ser. A, 15(6): 203 (1921). Fic. 7
SPECIMENS EXAMINED—INDIA. Manarasutra: Kolhapur District, Panhala, PG.
Patwardhan e& A.V. Prabhu, 74.1085, G.S. Chitale, 02.282. Ratnagiri District, Chiplun,
G.S. Chitale, 04.89: AMH
Thallus crustose, corticolous, grayish, flaking, finely cracked, smooth to rough;
hypothallus black. Ascomata lirelline, simple to rarely branched, triradiate,
curved, emergent, up to 1.5 mm long, 0.2-0.5 mm broad; thalline margin
raised, concolorous with the thallus; exciple convergent, 3-4-striate, apically
carbonized; hymenium hyaline, not inspersed, 75-90 «um tall, KI+ blue-violet;
asci 8-spored. Ascospores hyaline, muriform, small, ellipsoidal, 24-33 x 9-12
uum, I+ blue-violet.
CHEMISTRY— Constictic and stictic acids present.
REMARKS— Graphis subducta, a species previously known from the
Philippines and in India from Nagaland, is here reported for the first time from
Maharashtra.
Graphis sp. 1 Fic. 9
SPECIMEN EXAMINED—INDIA. MAHARASHTRA: Satara District, Mahabaleshwar,
Lodwick point, M.B. Nagarkar & A.V. Prabhu, 74.1876, 74.1909: AMH
Thallus crustose, corticolous, epiphloeodal, continuous, smooth to cracked,
uneven, slightly rough, greenish-yellow, surrounded by thin, black hypothallus.
Ascomata lirelline, 1.5-7 mm long and 0.1-0.6 mm broad, simple to sparsely
branched, semi-emergent, irregularly curved, flexuous, intricate, concolorous
with the thallus, terminally acute; exciple 1-5-striate, yellowish-brown,
Graphis in Maharashtra (India) ... 477
carbonized at apices, convergent, covered by a thick brown to blackish thalline
margin up to the top, studded with crystals; hymenium hyaline, not inspersed,
126-176 um tall, KI-; asci 8-spored. Ascospores hyaline, muriform, elliptical-
oblong, 63-101 x 17-21 um, I+ violet.
CHEMISTRY —Stictic acid present.
RemMARKs—lhe present species is distinct in having unusual combination of
large ascospores and chemistry. It is similar to Graphis parilis in respect of
morphological characters and chemistry. However, G. parilis has much smaller
ascospores of 46-76 x 13-17 um. Since our material is rather scanty, we do not
propose a new species.
Key to the species of Graphis from Maharashtra
la. AscOspores trans-septate: 2... 3. tiue qa hoes oa htbaeabal dae ohudweee abs das 2
lb. Ascospores muriform ....... 0... c cece cette een een nnn een ees 11
2a. Proper exciple partially carbonized ....... 0.0... cece ee ee eee 3
2b. Proper exciple completely carbonized including at the base ................. 10
3a. Proper exciple apically carbonized ........ 0... ec cece een eens 4
3b. Proper exciple laterally carbonized down to the base ..................00 000. 5
4a. Thallus verruculose; ascomata black, 0.5-4 mm long; exciple present below,
3-4 striate; ascospores 21-39 x 4-7 um; stictic acid present... G. vittata Mill. Arg.
4b. Ascomata concolorous with the thallus, 0.5-6 mm long, more or less
effuse; exciple entire to 2-4 striate, indistinctly present at the base;
ascospores 21-49 x 4-6 tm; constictic, connorstictic, and norstictic
acids present ................ G. exalbata Nyl. (= G. nerurensis Makhija et al.)
5a. Exciple striate [Ascomata 0.1-7 mm long, black; exciple 2-13-striate,
partially to completely carbonized; ascospores oblong, 12-24-trans-septate,
with one end acute, 25-109 x 4-8 tm; no lichen substances present. ]
Ba aiken tM Beaten Rt agg ht BY Aeca Ball Mia oe Pat G. polystriata Makhija et al.
SD: EXCIplEMOt, State: 6. eset wce tociats epee on als setts Noha teal eghcnad deaual 6 Beans bret 6
6a. Norstictic acid absent [Ascomata 1-8 mm long, black; exciple present
at base, ascospores 5—-8-trans-septate, 20-38 x 5-8 ym; constictic and
stictic acids present .... 0... cece eee eee nee G. modesta Zahlbr.
6b; Norsti¢tic-acid present Sing eens ee eres bleeay edo dea Ok ea Zz
7a. Ascospores less than 50 um long 1.2.6... eect en eee n eens 8
7b. Ascospores more than 50 um long 2.0.0.0... cece cece ence een nena 9
8a. Thallus smooth to minutely warty; ascomata 1-4 mm long, black; exciple
present at base; ascospores 9-11-trans-septate, (20-)30-40 x 6-8 tm;
constictic, norstictic and stictic acids present
P erentaes Set MAR es teleosts salt Baad tp hites whe G. ajarekarii Patw. & C.R. Kulkarni
8b. Thallus smooth to plicate; ascomata 1-2.5 mm long, black; exciple present below;
ascospores 3-10-trans-septate, 17-42 x 5-9 um; constictic and norstictic
ACO Sgn cA MAR ore Sart URSA tl Bove Dash A lnc Su Rete ERS G. librata C. Knight
478 ... Chitale, Makhija & Sharma
9a. Thallus brownish to greenish-grey; ascomata 0.5-6 mm long, concolorous
with the thallus; exciple may or may not be present at the base;
ascospores 8-16-trans-septate, 25-60 x 5-11 um; norstictic acid present
hngshiodaredetcha todos viotasctonty riche seeded e-tietel ecu it G. pyrrhocheiloides (Vain.) Zahlbr.
9b. Thallus whitish; ascomata 1-8 mm long, black; exciple present at base;
ascospores 8-11-trans-septate, 25-50 x 7-10 um; norstictic and
stictic acids present .......... G. cincta (Pers.) Aptroot (= G. guimarana Vain.)
10a. Thallus off white; ascomata 1-5 mm long, black; exciple present at base,
multistriate; ascospores 6-9(-12)-trans-septate, 21-35 x 4-8 um;
no lichen substances present ......... 0.00. cece ee eee eee G. duplicata Ach.
10b. Thallus olivaceous buff to citrine green; ascomata 0.5-3 mm long, black;
exciple present at base, 3-4-striate; ascospores 7—10-trans-septate,
30-45 x 6-10 um; no lichen substances present
US Ae as ees eee Ree G. aurita Eschw. (= G. persulcata Stirt.)
lla. Exciple laterally carbonized 2.0... 0... ccc cece een een ees 12
11b. Exciple apically carbonized ..... 0... cece cette nen een e es 13
12a. Ascomata immersed, to slightly emergent, 0.1-11 mm long; exciple sometimes
completely carbonized, without striae; asci 1-spored; ascospores 67-118 x 17-29
um; norstictic acid present 0.0.0.0... cece eee eee eens G. insulana
12b. Ascomata grayish-white to dirty white to blackish, 0.1-3 mm long, immersed to
semi-emergent; exciple 4—5-striate; ascospores 25-42 x 13-17 um; constictic,
stictic and hyposalazinic acids present .................... G. maharashtrana
13a. Exciple not striate. [Ascomata emergent, 1-8 mm long; asci 2-4-spored,;
ascospores 76-109 x 25-29 um; constictic, hypostictic (trace) and stictic acids
present]. pi oRe saat pais aah g Rese odie cue gp Berges G. elevativerrucosa
MSDE EXCIp Oeste ate- kas. ct tcannctnat natin he chop hetustin aie Pale tegt facta ieat Laat ac ned Suey 14
14a. Ascospores less than 50 um long ......... 0... eee eect e ene es 15
14b. Ascospores more than 50 um long ....... 0... ec ee e ee ne ee 16
15a. Ascomata up to 6 mm long. Thallus pale yellow to white; ascomata 1-6 mm
long, simple to branched, semi-emergent to emergent; exciple, 1-4-striate;
ascospores 34-42 x 16-21 um; constictic, norstictic (trace) and stictic acids
PICSCNt ss he ahaa toh dt oad Pa aN Rd bod Re eae cb tids Jub a bade e 4 G. galactoderma
15b. Ascomata simple to rarely branched, tri-radiate, curved, emergent, 1-1.5 mm
long; exciple 3-4-striate; ascospores 24-33 x 9-12 um; constictic and stictic
AGIAS: PLESEMU ewe rkhes or re yet Tate reage eeloca cei a! PURER Clan G. subducta
16a. Lichen substances absent. [Ascomata 1-3 mm long, simple, or rarely with
short branches, semi-emergent; exciple 1-5 striate; ascospores 59-71 x
PSE WIN] fasts kts ie ack BA Pigness eagnats SERENE hese, ASEM cea, G. platycarpa
16b. Lichen substances present ......... 0. cece cece cnet n ene nen e eens 17
17a. Ascospores up to 100 um long. [Ascomata 1.5-7 mm long, simple to sparsely
branched, semi-emergent; exciple 1-5-striate; ascospores 63-101 x
17-21 um; stictic acid present] ...... 0... eee eee Graphis sp. 1
17b. Ascospores less than 100 um long ....... 0. cece cnet eens 18
Graphis in Maharashtra (India) ... 479
18a. Ascomata concolorous with the thallus, 1-10 mm long, branched, totally
immersed, semi-emergent, or emergent; exciple yellowish-brown, 3-8-striate;
ascospores 46-76 x 13-17 um; stictic acid present.................. G. parilis
18b. Ascomata black, short, 0.5-2.0 mm long, emergent; exciple 4—5-striate;
ascospores 45-65 x 12-16 um; stictic acid present.............. G. panhalensis
Acknowledgments
We are grateful to the Ministry of Environment and forests and the Department of
Science and Technology, Government of India, New Delhi for the financial support. We
also thank Miss Pradnya Khadilkar for preparing illustrations.
Literature cited
Adawadkar B, Makhija U. 2004. A new isidiate species of Graphis from India. Lichenologist 36:
361-363. doi:10.1017/S00242829040 14409
Adawadkar B, Makhija U. 2006. New species and new records of Graphis from India: trans-septate
species with completely carbonized exciples and norstictic acid. Mycotaxon 96: 51-60.
Adawadkar B, Makhija U. 2007. New species and new records of Graphis from India with partially
carbonized exciples and trans-septate ascospores. Mycotaxon 99: 303-326.
Chitale G, Makhija U, Sharma BO. 2009. New combinations and new species in the lichen genera
Hemithecium and Pallidogramme. Mycotaxon 108: 83-92. doi:10.5248/108.83
Culberson CF. 1972. Improved conditions and new data for the identification of lichen products by
a standardized thin-layer chromatographic method. Journal of Chromatography 72: 113-125.
doi: 10.1016/0021-9673(72)80013-X
Culberson CF, Kristinsson H. 1970. A standardized method for the identification of lichen products.
Journal of Chromatography 46: 85-93. doi:10.1016/S0021-9673(00)83967-9
Jagdeesh Ram TAM, Sinha GP, Singh KP. 2007. A new species of Graphis (Graphidaceae) from
India. Lichenologist 39: 231-233. doi:10.1017/S0024282907006482
Liicking R. 2009. The taxonomy of the genus Graphis sensu Staiger (Ascomycota: Ostropales:
Graphidaceae). Lichenologist 41: 319-362. doi:10.1017/S0024282909008524
Liicking R, Archer AW, Aptroot A. 2009. A world wide key to the genus Graphis (Ostropales:
Graphidaceae). Lichenologist 41: 363-452. doi:10.1017/S0024282909008305
Makhija U, Adawadkar B. 2005a. Some additions to the Graphidaceae in the Andaman Islands,
India. Mycotaxon 91: 347-352.
Makhija U, Adawadkar B. 2005b. Some new species of Graphis (Lichenized Ascomycota) from the
Andaman and Nicobar Islands of India. Mycotaxon 91: 369-379.
Makhija U, Dube A, Adawadkar B, Chitale G. 2005a. Some species of lichen genera Dyplolabia and
Graphis from Maharashtra. Geophytology 36(1-2): 61-68.
Makhija U, Dube A, Adawadkar B, Chitale G. 2005b. Five trans-septate species of Hemithecium
from India. Mycotaxon 93: 365-372.
Makhija U, Chitale G, Sharma BO. 2009. New species and new records of Diorygma (Graphidaceae)
from India: species with convergent exciples. Mycotaxon 109: 379-392. doi:10.5248/109.379
Patwardhan PG, Kulkarni CR. 1979. Some new taxa of the family Graphidaceae from western ghats,
southwestern India. Norwegian Journal of Botany 26: 45-52.
Sharma BO, Makhija U. 2009. New species and new reports of Diorygma (lichenized Ascomycotina,
Graphidaceae) from India. Mycotaxon 109: 209-217. doi:10.5248/109.209
Singh KP, Sinha GP, Bujarbarua P. 2004. Endemic lichens of India. Geophytology 33: 1-16.
480 ... Chitale, Makhija & Sharma
Staiger B. 2002. Die Flechtenfamilie Graphidaceae: Studien in Richtung einer natiirlicheren
Gliederung. Bibliotheca Lichenologica 85: 1-526.
White FJ, James PW. 1985. A new guide to microchemical techniques for the identification of lichen
substances. Bulletein British Lichen Society. 57(Suppl.): 1-41.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 481-484 January-March 2011
DOT: 10.5248/115.481
Septobasidium sichuanense sp. nov. (Septobasidiaceae) from China
SUZHEN CHEN” & LIN Guo”
‘Ocean University of China, Qingdao 266003, China
?Key Laboratory of Systematic Mycology and Lichenology Institute of Microbiology,
Chinese Academy of Sciences, Beijing 100101, China
ABsTRACT — A new species, Septobasidium sichuanense, is described. It was collected from
Sichuan Province, China.
Key worps — Pucciniomycetes, Septobasidiales, tawonomy
A species of Septobasidium, recently collected from Sichuan Province, is
described here as new:
Septobasidium sichuanense S.Z. Chen & L. Guo, sp. nov. Figs. 1-7
MycoBank MB 519472
Basidiomata resupinata, 0.4-6.5 cm longa, 0.3-4 cm lata, alba vel cinnamomeo-brunnea,
margine determinata, superficie laevia, in sectione 240-1300 um crassa. Subiculum
brunneum, 15-40 um crassum. Columnae brunneae, primum 30-60 um altae, deinde
120-290 um altae, 15-250 um latae. Strata hyphararum 40-620 um alta. Interdum
hyphae repullulantes, super hymenium stratum hypharum secundum 410-650 um altum
formantes. Hymenium 45-90 um crassum. Basidia cylindrica vel clavata, recta vel curvata,
2-cellularia, 17-27 x 6-7.5 um, hyalina vel brunneola. Sine probasidio. Basidiosporae non
visae. Haustoria ex cellulis globularibus et hyphis irregulariter spiralibus constantia.
Type: On Punica granatum L. (Punicaceae): China, Sichuan, Mianning, alt. 1873
m, 17.1X.2010, Y.R Zhu & L. Guo 368, HMAS 242046 (holotype), associated with
Lepidosaphes sp. (Diaspididae).
Basidiomata on trunks and branches, resupinate, 0.4-6.5 cm long, 0.3-4
cm wide, patches frequently confluent, white or cinnamon-brown; margin
determinate, surface smooth. In section 240-1300 um thick. Subiculum brown,
15-40 um thick. Pillars brown, 30-60 um high in the young stage and 120-290
um high in the older stage, 15-250 um wide. Hyphal layer 40-620 um high.
Hymenial layer 45-90 um thick, sometimes from hymenial layer the fungal
hyphae renew growth to form a second layer, 410-650 um high. Basidia arising
A482 ... Chen & Guo
WA
poe =
10 um
Fic. 1. Basidia of Septobasidium sichuanense (HMAS 242046, holotype).
directly from the hyphae without a probasidial cell, cylindrical or clavate,
often constricted at the septum, straight or curved, 2-celled, 17-27 x 6-7.5
um, hyaline or brownish. Basidiospores not seen. Haustoria consisting of both
globose cells and irregularly coiled hyphae, hyaline.
ADDITIONAL SPECIMEN EXAMINED: On Cotoneaster franchetii Bois (Rosaceae): China,
Sichuan, Yanyuan, Mianya, alt. 3164 m, 13.IX.2010, YF Zhu & L. Guo 322, HMAS
250986.
Septobasidium sichuanense sp. nov. (China) ... 483
——
i 10 um ae
Fics. 2-7. Septobasidium sichuanense (HMAS 242046, holotype).
2. Basidiomata on trunk. 3-4. Sections of basidiomata. 5-6. Basidia (arrows). 7. Haustoria.
A84 ... Chen & Guo
Remarks: Morphologically, Septobasidium sichuanense is similar to
S. patouillardii Burt in having 2-celled basidium but differs in forming rather
regular patches of basidiomata with a smooth surface and not cracked in
the older parts, lacks a purplish tint, and has thick pillars. Septobasidium
patouillardii forms irregular patches with cracks in the older surfaces, is velvety
with a purplish tint, and has slender pillars, 20-54 tm wide and in section is
300-460 um thick.
To date, 29 species of Septobasidium have been reported in China (Sawada
1933, Couch 1938, Teng 1963, Tai 1979, Kirschner & Chen 2007, Lu & Guo
2009a,b,c, 2010a,b,c, Lu et al. 2010), including the new species reported in this
paper.
Acknowledgements
The authors would like to express their deep thanks to Drs Eric H.C. McKenzie
(Auckland, New Zealand) and Shuanghui He (Beijing Forestry University) for serving
as pre-submission reviewers, to Dr. Shaun Pennycook (Auckland, New Zealand) for
nomenclatural review, to Prof. Jianyun Zhuang (Institute of Microbiology, Chinese
Academy of Sciences) for Latin corrections, to Mr Ziyu Cao (Institute of Botany, Chinese
Academy of Sciences) for identifying the host plants, to Prof. Sanan Wu (Beijing Forestry
University) for identifying the scale insect, and to Mrs Xiangfei Zhu for inking in the
line drawing. This study was supported by the National Natural Science Foundation of
China (No. 30499340 and No. 30870016).
Literature cited
Couch JN. 1938. The Genus Septobasidium. Univ. of North Carolina Press, Chapel Hill. 480 p.
Kirschner R, Chen CJ. 2007. New reports of two hypophyllous Septobasidium species from Taiwan.
Fung. Sci. 22: 39-46.
Lu CX, Guo L. 2009a. Septobasidium maesae sp. nov. (Septobasidiaceae) from China. Mycotaxon
109: 103-106. doi:10.5248/109.103
Lu CX, Guo L. 2009b. Two new species of Septobasidium (Septobasidiaceae) from China. Mycotaxon
109: 477-482. doi:10.5248/109.477
Lu CX, Guo L. 2009c. Septobasidium annulatum sp. nov. (Septobasidiaceae) and Septobasidium
kameii new to China. Mycotaxon 110: 239-245. doi:10.5248/110.239
Lu CX, Guo L. 2010a. Three new species of Septobasidium (Septobasidiaceae) from Gaoligong
Mountains in China. Mycotaxon 112: 143-151. doi:10.5248/112.143
Lu CX, Guo L. 2010b. Two new species of Septobasidium (Septobasidiaceae) and S. pallidum new to
China. Mycotaxon 113: 87-93. doi: 10.5248/113.87
Lu CX, Guo L. 2010c. Two new species of Septobasidium (Septobasidiaceae) from Hainan province
in China. Mycotaxon 114: 217-223. doi: 10.5248/114.217
Lu CX, Guo L, Wei JG, Li JB. 2010. Two new species of Septobasidium (Septobasidiaceae) from
southern China. Mycotaxon 111: 269-274. doi:10.5248/111.269
Sawada K. 1933. Descriptive catalogue of the Formosan fungi. Part VI. Rep. Dept. Agric. Govt. Res.
Inst. Formosa 61: 1-99.
Tai FL. 1979. Sylloge Fungorum Sinicorum. Science Press, Beijing. 1527 p.
Teng SC. 1963. Fungi of China. Science Press, Beijing. 808 p.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 485-494 January-March 2011
DOT: 10.5248/115.485
Hypogymnia irregularis (Ascomycota: Parmeliaceae)—
a new species from Asia
Bruce McCungE
Department of Botany and Plant Pathology, Oregon State University,
Corvallis, OR 97331-2902 U.S.A.
CORRESPONDENCE TO:
[email protected]
ABsTRACT — Hypogymnia irregularis is newly described from southwest China, Nepal, Japan,
and Taiwan. Similar in growth form to H. vittata, H. irregularis differs in always lacking soredia
and having staggered, lateral, or almost randomly located perforations in the lower surface. In
contrast, H. vittata usually produces soredia and has perforations more centered in the lower
surface and axils. Hypogymnia vittata is known from Asia, North America, Central America,
and Europe, while H. irregularis is endemic to Asia. Hypogymnia irregularis is postulated as
being the fertile species that is the closest living relative to the sorediate H. vittata. Another
Asian species, H. stricta, can be similar in appearance to H. irregularis and H. vittata, but can
be differentiated both morphologically and chemically from those two.
Key worps — Lecanorales, lichenized ascomycetes, lichenized fungi, Yunnan Province
Introduction
Since the last checklist of lichens in China (Wei 1991), numerous species
of Hypogymnia from Asia have been described or revised (Chen 1994, Elix &
Jenkins 1989, McCune et al. 2002, McCune & Obermayer 2001, Sinha & Elix
2003, Tchabanenko & McCune 2001, Wei & Bi 1998, Wei & Wei 2005, Wei
et al. 2010). But still this center of diversity for Hypogymnia, particularly in
southwestern China, holds additional undescribed species. This paper describes
a species that can be one of the dominant lichens in the high-mountain Abies
forests of southwest China and also occurs in Nepal, Taiwan, and Japan. The
species has not previously been described because of its similarity to esorediate
H. vittata and the recently resurrected H. stricta (Hillmann) K. Yoshida (Yoshida
& Kashiwadani 2001). The new species was, however, keyed in McCune (2009)
as “H. sp. undescribed, close to H. vittata”
Methods
Standard microscopy and chemical spot test methods were applied to over 600
specimens of H. vittata and closely related species, from throughout its range, including
A86 ... McCune
417 specimens of H. vittata s. str. and 149 specimens of the new species described here.
A total of 86 specimens belonging to the new species, 20 of H. stricta, and 92 of H. vittata
s. str. were subjected to thin-layer chromatography (TLC), using standard methods of
Culberson et al. (1981). Fragments of specimens were extracted in acetone at room
temperature, spotted on aluminum-backed silica gel plates (Merck 5554/7 Silica gel 60
F,,,), run in solvent systems A and C of Culberson et al. (1981), lightly brushed with 10%
H,so,, and charred in an oven at 100°C.
Taxonomy
Hypogymnia irregularis McCune, sp. nov. FIGURES 1, 2A-D
MycoBank MB 519394
Ab Hypogymnia vittata differt sorediis absentibus, ascosporis 5-6 x 4-5 um; foraminibus
infernis irregularibus.
TYPE: China: Yunnan Province, Jiaoxi Mountain, north of Kunming, 26.100°N 102.867°E,
3700 m, Abies georgei var. smithii-Rhododendron forest on slopes near hotel, on bark of
Abies, Sept. 2000, McCune 25576 (holotype: KUN; isotypes: H, HMAS-L, OSC, UPS, US)
ETYMOLOGY: irregularis, referring to the irregular arrangement of perforations through
the lower surface.
THALLUS appressed to pendulous, to 10(-30) cm long, branching variable,
including both isotomic and anisotomic portions, lateral budding often present;
texture cartilaginous rather than papery; upper surface white to pale greenish
gray, sometimes with dark mottles, sometimes with black borders, smooth to
weakly rugose, epruinose; lobes 0.5-3(-4) mm wide separate to imbricate,
often arcuate-recurved, width even to slightly expanding distally and near the
nodes, sometimes + pinched at the nodes; lobe width:height ratio 0.5:1 to 2:1;
perforations present on many lobe tips, axils, and lower surfaces, the holes not
rimmed; medulla hollow, both the ceiling and floor of the cavity soon darkening
to brown or dark brown; soredia and isidia lacking; lateral budding or lobules
occasional.
APOTHECIA common, substipitate to stipitate, to 9 mm broad, the receptacle
urn or funnel shaped; stipe hollow; disk brown; spores small, subglobose, 5-6 x
4-5 um; pycnidia common, brown to black; spermatia weakly bifusiform, 5-6
x 0.5-0.7 um; photobiont chlorococcoid.
CHEMISTRY — By TLC the thallus contains atranorin and physodic acid,
usually with 3-hydroxyphysodic and/or vittatolic acids (all four substances
present in the holotype); cortex K+ yellow; medulla K- or K+ slow reddish
brown, KC+ orange-red, P-. Of 86 specimens with TLC results, all had
both atranorin and physodic acid, 70% had 3-hydroxyphysodic acid, and
91% had vittatolic acid. No attempt was made to distinguish atranorin from
chloroatranorin.
SUBSTRATE — On bark and wood of both conifers (especially Abies, Picea,
Sabina, Pinus, and Tsuga, in order of decreasing frequency) and hardwoods
Hypogymnia irregularis sp. nov. (Asia) ... 487
BE Bs
Fic. 1. Hypogymnia irregularis habit and perforations. Arrows indicate examples of dorsal (D),
lateral (L), and ventral (V) perforations (McCune 25576, holotype). Dorsal perforations are
infrequent, lateral perforations occasional, and ventral perforations common. Scale bar 1 mm.
(especially Rhododendron, Quercus, Sorbus, and dwarf bamboo).
DisTRIBUTION — Very common and often locally abundant in southwest
China, especially Yunnan and Sichuan Provinces; infrequent disjuncts in India,
A88 ... McCune
Nepal, and Taiwan. In southwest China, where the species is most abundant, it
occurs primarily between 3000 and 4400 m in elevation, in Abies-Rhododendron
forests above the zone of hardwood dominance.
BRIEF CHARACTERIZATION — Lobes free, short or long, often arcuate-tipped;
long, slender, adventitious lobes often abundant; lobes 0.5-4 mm broad and
internodes often 1-2 cm long; lobes somewhat pinched and swollen or smooth
in profile; ceiling of cavity grayish brown to black; floor brownish black; similar
to H. vittata but no soredia and perforations on lower surface irregularly
arranged or staggered and partly lateral.
SELECTED SPECIMENS EXAMINED — CHINA. SICHUAN PROVINCE: Er Mei Mt., 29.5°N
103.33°E, 2100 m, Tao De Din 1415 (kun); from Ping Wu Co to Jui Zhai Guo, 29.53°N
104°E, 3100 m, Wang Li-song 86-25 1 la (KUN); XINXING Co.: Gongga Mt, Yen Zi Village,
29.67°N 102°E, 3350 m, Xuan Yu 1378 (kuN); KanGpING Co. (as Sikang: Kangting
(Tachienlu), montes orientalis), Harry Smith, s.n. (UPS); LupInG Co.: Gongga Mt, Yen
Zi Village, 29.67°N 102°E, 3250 m, Xuan Yu 1377 (kun); Gongga Mt., Hai Luo Gou,
29.833°N 102.33°E, 2450-3000 m, Wang Li-song 96-16111, 96-17030, 96-16295b, 96-
16213 (kuN); Gongga Mt, 29.42°N 101.83°E, 3000 m, Wang Li-song 96-17242 (KUN);
Mr Yi Co., Ma Long Village, Bei Puo Mt., 26.83°N 102°E, 3100-3600 m, Wang Li-song
83-775 , 83-798, 83-829 (KUN); MuLi Co., E slopes of Ning Lang Mt., 27.83333°N
101.1667°E, 3900 m, Yuan Yu 1845 (kun); Ning-lang village, 27.23°N 100.87°E, 3900
m, Xuan Yu 4268b (kun); from Yi Qu to Wo Ya, 27.83°N 101°E, 2700-3500 m, Wang
Li-song 83-2364, 83-2365 (KUN); W slope of Ning Lang Mt., 27.83°N 101.17°E, 4000 m,
Xuan Yu 1798 (kun); Ya Zhuei forest sta., Jiang Du, 27.83°N 101.33°E, 3450 m, Wang
Li-song 83-1580 (KUN); Yi Qu, 27.83°N 101°E, 3200-3700 m, Wang Li-song 83-2341, 83-
2400 (xuN); NANPING Co., Jiu Zhai Gou, 33°N 103.83°E, 2050-3200 m, Wang Li-song
86-2725,86-2627, 86-2660 (KUN); WENCHUAN Co.: Wo Long Nature Preserve, 30.9°N
103.1°E, 3200 m, Wang Li-song 96-17683 (KUN); YANYUAN Co., Beiling Village, Si Da
Unit, 27.5°N 101.5°E, 3500-3800 m, Wang Li-song 83-1435, 83-1464 (kuN); Daling
Village, Huo Lu Mt., 27.5°N 101.5°E, 3500-4150 m, Wang Li-song 83-1149, 83-1175a,
83-1196, 83-1211, 83-1258, 83-1398 (KUN); XIZANG (TIBET): CHayu Co.: Cawarong,
Song Ta Xue Mt, 28.67°N 97.83°E, 3500 m, Wang Li-song 82-801, 82-805 (kuN); Gyala
Peri N, W above Gyala Peri-N Glacier, 29.9°N 94.87°E, 3820 m, Miehe, G. & S. 94-
215-42/10 (Gzu). YUNNAN PROVINCE: CAOJIAN Co., Zi ben Mt, 25.737°N 99.058°E,
Wang Li-song 00-18901, 00- 18910, 00-18913 (KUN); DALI Co.: Xiao Lin Feng, 25.717°N
100.13°E, Wang H.-c. 4825b (kun); Long-quan-feng Mt., 25.2°N 100.95°E, Wang Han-
che 4364 (kun); top of Long Quan Feng Mt., 25.717°N 100.133°E, Wang H.-C. 1067, 4360
(kun); Yu Jiu Feng, 25.63°N 100.1°E, 3000 m, Sauer 30.154b (kun); trail to Mt. Cang,
25.685°N 100.102°E, 3500 m, McCune 26772, 26775, 26779, 26780, 26787, 26803, 26806,
26795, 26797 (osc); DEQIN Co.: Bei Ma Xue Shan, Ya Kou, 28.383°N 99°E, 4300 m,
Wang Li-song 93-13489 (kuN); Meilishi village, Suola Ya-Kou, 28.63667°N 98.61333°E,
4000-4750 m, Wang Li-song 00-19742, 00-19766 (KUN); Mei Li Xue Mt, Xio-Nang
Village, 28.4°N 98.75°E, 3400 m, Wang Li-song 94-1504] (kuN); FU Gone Co.: Lu Ma
Den Village, Qu Lu Di unit, 27.033°N 98.883°E, 3500 m, Wang Li-song 82-448 (KUN);
Gone SHAN Co., Binzhong Luo to Tong Da Ya Kou, 93.683°N 28.092°E, 3800 m, Wang
Li-song 99-185 10 (KUN); Qinatong, Songtaxue Mt., 28.1883°N 98.5317°E, 3200 m, Wang
Li-song 00-196 13, 00-19615, 00-19619, 00-19628 (KUN); Yen Niu Gu, 27.801°N 98.825°E,
2950 m, Wang Li-song 00-19364, 00-19377 (kuN); Binzhong Luo village, 27.96667°N
Hypogymnia irregularis sp. nov. (Asia) ... 489
McCune 25537
eat. 00008
60000
Wang 96-16213
Follman 509
Fic. 2. Hypogymnia irregularis. A. Apothecia (McCune 25576; scale bar 1 mm.); B. Young
apothecia (McCune 25576); C. Ascospores (Wang 96- 16213; McCune 25576). D, E. Comparison
of position of perforations in the lower surface of Hypogymnia irregularis (D) and H. vittata (E).
Collection numbers are indicated below photos.
490 ... McCune
98.51667°E, 3600 m, Wang Li-song 82-741 (KUN); JIANCHUAN Co.: ridge on trail to
Laojun Shan, 26.6317°N 99.7183°E, 3980 m, McCune 26728, 26729 (osc); San Jiang
Bin Liu area, 26.6625°N 99.7217°E, 3110 m, McCune 26703 (osc); trailhead to Laojun
Shan, 26.6322°N 99.7253°E, 3700-3800 m, McCune 26707, 26715 (osc), Wetmore 88456
(min); LytanG Co.: Jiushijiulongtiam Lake, Maan Mt., 26.6517°N 99.775°E, 3500 m,
Wang Li-song 00-20085, 00-20094, 00-20101, 00-20223 (KUN); Jiutte Villate, Laojun Mt.,
26.65°N 99.77°E, 4000 m, Wang Li-song 99-18732 (kuN); Laojun Mt., Jiushijiulong Lake,
26.6317°N 99.7283°E, 3800-4100 m, Wang Li-song 00-19820, 00-20252, 00-20257, 00-
20278, 00-20288, 00-20289, 00-20319, 00-20324 (kuN); Li-di-ping, 26.85°N 100.267°E,
3200 m, Xi Jian-xun 0165, 0169a (KUN); Yu Long Xue Mt., 27.083°N 100.167°E, Li Xin-
jiang 1494 (kun); Lijiang area (“Likiang”), |, E Rock 115b (US); eastern slopes Likiang
Snow Range, Rock,.F. 11779 (US); Luquan Co., Jiaoxi Mt., 26.083°N 102.133°E, 3700-—
4300 m, Wang Li-song 92-12856, 92-12857, 92-12869, 92-12879, 92-12949, 92-12950,
96-16725, 96-17060, 96-17066 Fan Rei Zhen 3220 (KuN); Jiaoxi Mt., N of Kunming,
26.100°N 102.867°E, 3500-3750 m, McCune 25517, 25518, 25528, 25537a, 25537),
25588, 25600, 25606, 25631, 25653 (osc); WEI X1 Co.: Li-di-ping Village, 27.167°N
99.417°E, 3200 m, Wang Li-song 82-7 (kuN); Ye Zhi Village, Ba-ding, 27.8°N 99.03°E,
3500 m, Wang Li-song 82-264a, Zhang D.-C. 82-83 (KUN); YUNLONG Co.: Zi Ben Shan,
top of ridge, 25.733°N 99.067°E, 3200 m, McCune, 26822 (osc); Xiao Zhongdian, Ji
Sha, 27.417°N 99.733°E, Den Kun-Mei 81-1679 (KUN); Daxue Mt., 28.503°N 99.817°E,
3800 m, Wang Li-song 00-19824 (KUN); Daxue Mt., Ya Kou, 28.667°N 99.834°E, 4270
m, Wang Li-song 93-2751 (KUN); Daxue Mt., 28.567°N 99.817°E, 4400 m, Wang Li-song
01-20740, 01-20796, 01-20800 (KUN); Daxue Mt., 28.579°N 99.821°E, 3350 m, Watson,
M. F. 18 (z); Na Pa, Hai Hou Mt., 27.833°N 99.717°E, 3860 m, Wang Li-song 93-13742
(kun); Tianchi (alpine lake), 27.833°N 99.717°E, 3700 m, Wang Li-song 94-14929 (kun);
Tianchi Lake, 27.617°N 99.633°E, 3900 m, Wang Li-song 01-20888 (KUN); Wengshuei
Village, Daxue Mt., 28.575°N 99.83417°E, 4000 m, Wang Li-song 00-20026, 00-20032
(kun); Xiozhongdian, Tianchi, 27.833°N 99.717°E, Wang Li-song 93- 13683d, f, g (KUN).
JAPAN. Honsuuv: Prov. Shinano, betw. Shibunoyu Hot Spring & Kuroyuridaira, 2400
m, Kashiwadani, Lich. Rar. Crit. Exs. 478 (BM, S, US, WIS); Prov. Kai, lower slopes
on N side of Mt Fuji, near Okuniwa, between 4-gome and 5-gome, 2250 m, McCune
26062, 26069 (OSC). NEPAL. Rolwaling Himal: Mt. Numbur, 3400 m, Yoda 130 (TNs);
S of Kyangen Gompa, Birch wood, 28.2037°N 85.558°E, 3852 m, Sharma et al. L10 (&).
TAIWAN: TaicHunc Co., Between Ssu-yuan & To-chia-tun Mt., Nanhuta Mt., 2700 m,
Kashiwadani 36156 (TNs); Nanhuta Mt., 3000 m, Tateishi s.n., 12 Sep 1984 (TNs); Nantou
Co., Mt. Yu Shan, Tartaka Saddle to Paiyun Hostel, 3000 m, Lai 10325 (US); Toroko NP,
Hehuan Mt, 3200 m, Mikulin T5 (OSC), 2756 m, Mikulin T72 (OSC).
Hypogymnia vittata (Ach.) Parrique FIGURE 2E
SPECIMENS ILLUSTRATED OR MENTIONED — AUSTRIA. Karnten: Gurktaler Alpen,
Severgraben, E von Gnesau, ca. 800 m, 46°48’N 14°4’W, on Alnus incana, 27 Oct 1998,
Zeiner 151 (Gzu, fertile); E Tyrol, southern foothills of Hochvenediger Mts., Follman,
Lich. exs. sel. 509 (osc). CHINA. YUNNAN PROVINCE: Jiaoxi Mt., north of Kunming,
26.100°N 102.867°E, 3700 m, McCune 25623 (osc); Jianchuan Co., San Jiang Bin Liu
area, road to Lao Juen Shan, 3110 m, McCune 26705 (osc). FINLAND. Uusimaa: Espoo,
Nuuksio (Nouks), Hankalahti (Hanklaks), Ahvenlampi, rock face (kallioseinalla), 21
Oct 1934 K. Linkola (u, fertile). Pohjois-Savo (Savonia borealis): Kuopio, Enonlahti,
Enonmaki, rock face (kallion kyless4), 14 Jul 1909 K. Linkola (u, fertile). MEXICO.
Estado de Oaxaca: mountain tops ca. 6 km NW of Ixtlan de Juarez, 2865 m, Esslinger
18225C (NDA).
Hypogymnia irregularis sp. nov. (Asia) ... 491
Discussion
Hypogymnia irregularis often shows an extreme range in lobe width and
length, all in the same thallus (Fig. 1), but it is generally more robust than
H. vittata, with lobes commonly >2 mm wide and internodes >9 mm long.
The arrangement of the perforations in H. irregularis can vary even within a
single specimen from a staggered arrangement of semi-lateral holes to a linear
arrangement of holes centered on the lobes, or even lateral or dorsal holes (Figs
1, 2D).
Both Hypogymnia irregularis and H. stricta (Yoshida & Kashiwadani 2001,
lectotype: TNS!) appear similar to esorediate individuals of the normally
sorediate H. vittata (type: BM! as Parmelia physodes var. vittata Ach.).
Differences among these species are discussed below.
Hypogymnia stricta is currently known from China, Japan, and Taiwan.
In H. stricta the ceiling of the lobe cavity is light brown to white (rarely dark
brown), the upper cortex has faint to prominent transverse cracks, and the
thallus contains 2’-O-methylphysodic acid (see below). In contrast, both
H. irregularis and H. vittata have consistently dark ceilings, except for a whitish
ceiling very near the lobe tips. The perforations of H. stricta are similar to
H. vittata, being rather large and + centered along the midline of the lower
surface of the lobes, both of those differing from the irregularly placed holes in
H. irregularis (Fig. 2D).
The ascospores of H. stricta average 5.5-7.0 x 4.5-5.0 um, slightly longer
than those of H. irregularis which are mostly 5.0-6.0 x 4.0-5.0 tum. The spore
sizes of H. irregularis broadly overlap with H. vittata. Fertile specimens of H.
vittata are rare. Two specimens from Finland had ascospores (4.8-)5.0-6.0
(-6.5) x 4.8-5.2(-5.4) um, similar to Bitter (1901): 4.5-5.8 x 4.5-5.0 um. A
fertile specimen from Austria was barren of ascospores.
Separation of esorediate H. vittata from H. irregularis must rely on the
pattern of the perforations in the lower surface and the presence and abundance
of pycnidia. Although H. vittata typically has large, sparse perforations that are
nearly centered in the lower surface or axils (Fig. 2E), H. irregularis has more
frequent and smaller perforations that are often lateral, irregular in placement
or sometimes staggered from side-to-side (Figs 1, 2D). This character is not,
however, perfect. Even on a single individual of H. irregularis, one can observe
some lobes with centered perforations and others with staggered perforations.
And some specimens of H. irregularis have mainly centered perforations.
Conversely, H. vittata sometimes forms perforations that deviate somewhat
from the midline.
Almost always H. vittata has no pycnidia or only a few, widely scattered
pycnidia, while H. irregularis usually has dense swarms of pycnidia on many
lobes.
492 ... McCune
Because H. irregularis is restricted to Asia, it is not necessary to separate
H. vittata from H. irregularis in most of the World. Hypogymnia vittata is
known from Europe, North America, Central America (Mexico), and Asia
south to New Guinea.
Some specimens from Japan are problematic. There it is common to find
specimens close to H. vittata but without soredia and without the irregular
perforations of H. irregularis. Perforations in the lower surface tend to be large
and centrally aligned. In contrast to usual H. vittata, the esorediate Japanese
material often has dense swarms of pycnidia, suggesting a closer affinity with
H. irregularis. The ultimate disposition of this material requires further study;
for now, it is placed in H. irregularis.
Hypogymnia — stricta typically contains atranorin, physodic, 3-
hydroxyphysodic, and 2’-O-methylphysodic acids (20 specimens with TLC
data). Thus it has a medulla K+ slow reddish brown, KC+ orange red, and
P_. Hypogymnia irregularis can have the same spot tests, or it can be K- when
lacking 3-hydroxyphysodic acid. However, 2’-O-methylphysodic acids was not
found in H. irregularis by TLC, while this substance appears to be constant in
H. stricta.
Hypogymnia vittata is essentially the same as H. irregularis in frequency of
substances by TLC. Of 92 specimens of H. vittata with TLC data (worldwide),
all had both atranorin and physodic acid, 85% had 3-hydroxyphysodic acid (vs.
70% in H. irregularis) and 84% had vittatolic acid (vs. 91% in H. irregularis).
Both species often show an unknown spot just under vittatolic acid in solvent C,
and both commonly have long-wave UV+ unknowns in Culberson’s Rf classes
A5 and C6. Both species show pronounced quantitative variation in vittatolic
acid, ranging from a trace (or not detected) to an obvious major substance.
The Hypogymnia vittata complex (TABLE 1) should prove a fascinating
subject for molecular systematics. All species in this group have large ventral
perforations that lack a raised differentiated rim, predominantly dark lobe
interiors, narrow perpendicular adventitious branches, and a P- medulla
(lacking physodalic and protocetraric acids). The common H. physodes,
while similar to H. vittata in the soralia lining splayed open lobe tips, differs
in the absence of perforations (other than those associated with soredia), the
absence of narrow adventitious branches, and the P+ orange-red medulla from
physodalic acid.
All species in the H. vittata group are Asian, except for H. vittata, which
has spread to other continents. Like other species pairs in Hypogymnia
(H. lophyrea (Ach.) Krog and H. hultenii (Degel.) Krog; H. krogiae Ohlsson and
H. incurvoides Rass.; Miadlikowska et al. 2011), this can be considered another
case of the fertile species having a narrower distribution than the sorediate
counterpart.
Hypogymnia irregularis sp. nov. (Asia) ... 493
TABLE 1. Summary of characters of Hypogymnia vittata and related species.
Hypogymnia ASEXUAL APOTHECIA CEILING OF VITTATOLIC = -2’-O-METHYL-
species REPRODUCTION LOBE CAVITY ACID PHYSODIC
ACID
irregularis none common dark usually no
pectinatula none not seen dark no? no?
pseudobitteriana laminal soredia, rare dark seldom no
schizidia
stricta none common pale no usually
vittata labriform soredia _ rare dark usually no
zeylanica isidia bursting rare dark no no
into soredia
All have narrow perpendicular adventitious branches, are P- (lacking physodalic and protocetraric acids),
have non-rimmed perforations in the lower surface. Only a small number of H. pectinatula have been
tested by TLC, so chemical substances are uncertain.
In addition to the species discussed above, other apparently close relatives of
H. vittata have a diversity of reproductive modes (Table 1): H. pseudobitteriana
(D.D. Awasthi) D.D. Awasthi (widespread in eastern and southern Asia) has
laminal schizidia and soredia, H. zeylanica (R. Sant.) D.D. Awasthi & Kr.P.
Singh (Sri Lanka) has isidia and pustular soredia; and H. pectinatula (Zahlbr.)
Elix (Papua New Guinea, Java, Philippines, and North Borneo) has a frondose
growth form with abundant lateral budding but no other asexual propagules.
All of these share with H. vittata a perforate lower surface, dark ceilings
and floors of the lobe cavity, absence of 2’-O-methylphysodic, physodalic,
and protocetraric acids (medulla P-), and a tendency to produce slender
perpendicular adventitious branches. From this group I exclude those species
with a raised, differentiated rim around the perforations (McCune et al. 2002),
such as the superficially similar H. diffractaica McCune. Last, H. subduplicata
(Rass.) Rass., a sorediate species described from Far East Russia, is very
similar to H. vittata. The chemistry of the type needs to be determined and the
morphology compared with H. vittata.
Acknowledgments
We thank curators of Asu, BM, CANL, COLO, DUKE, E, GZU, H, HMAS-L, KUN, MIN, MSC,
NY, OSC, PC, S, TNS, UBC, UPS, US, and wis who kindly cooperated with loans and visits; and
to Ted Esslinger and André Aptroot for sharing personal collections. I greatly appreciate
Wang Li Song sharing his voluminous collections and cheerful hospitality during two
extended visits, Hiroyuki Kashiwadani, Kozo Yoshida, and Svetlana Tchabanenko for
sharing their collections and knowledge of Hypogymnia, and Olivia Lee for translating
label data and assisting with data entry. Elisa Alphandary, Lalita Calabria, Erin Martin,
and Christina Wesseler assisted with TLC. Thanks to Walter Obermayer and Arve
Elvebakk for reviewing the manuscript and to Teuvo Ahti for helpful suggestions.
A494 ... McCune
Literature cited
Bitter G. 1901. Zur Morphologie und Systematik von Parmelia, Untergattung Hypogymnia.
Hedwigia 40: 171-274.
Chen JB. 1994. Two new species of Hypogymnia (Nyl.)Nyl. (Hypogymniaceae, Ascomycotina). Acta
Mycologica Sinica 13: 107-110.
Culberson CK, Culberson WL, Johnson A. 1981. A standardized TLC analysis of B-orcinol
depsidones. Bryologist 84: 16-29. doi:10.2307/3242974
Elix JA, Jenkins GA. 1989. New species and new records of Hypogymnia (lichenized Ascomycotina).
Mycotaxon 35: 469-476.
McCune B. 2009. Hypogymnia (Parmeliaceae) species new to Japan and Taiwan. Bryologist 112:
823-826. doi:10.1639/0007-2745-112.4.823
McCune B, Obermayer W. 2001. Typification of Hypogymnia hypotrypa and H. sinica. Mycotaxon
79: 23-27.
McCune B, Martin E, Wang LS. 2002. Five new species of Hypogymnia with rimmed holes, from
the Chinese Himalayas. Bryologist 106: 226-234. doi:10.1639/0007-2745(2003) 106[0226:
FNSOHW]2.0.CO;2
Miadlikowska J, Schoch C, Kageyama S, Molnar K, Lutzoni F McCune B. 2011. Hypogymnia
phylogeny, including Cavernularia, reveals biogeographic structure with broader distribution
for asexually reproducing (sorediate) species. Bryologist (in press).
Sinha GP, Elix JA. 2003. A new species of Hypogymnia and a new record in the lichen family
Parmeliaceae (Ascomycota) from Sikkim, India. Mycotaxon 87: 81-84.
Tchabanenko S$, McCune B. 2001. Hypogymnia arcuata and H. sachalinensis, two new
lichens from east Asia. Bryologist 104: 146-150. doi:10.1639/0007-2745(2001) 104[0146:
HAAHST]2.0.CO;2
Wei JC. 1991. An enumeration of lichens in China. International Academic Publishers, Beijing.
Wei JC, Bi WE. 1998. Chemical revision of Hypogymnia hengduanensis. Bryologist 101: 556-557.
Wei XL, Wei JC. 2005. Two new species of Hypogymnia (Lecanorales, Ascomycota) with pruinose
lobe tips from China. Mycotaxon 94: 155-158.
Wei XL, McCune B, Wang LS, Wei JC. 2010. Hypogymnia magnifica (Parmeliaceae), a new lichen
from southwest China. Bryologist 113: 120-123. doi:10.1639/0007-2745-113.1.120
Yoshida K, Kashiwadani H. 2001. Typification of taxa of Hypogymnia (Parmeliaceae) described
from Japan and Sakhalin. Bulletin of the National Science Museum, Tokyo, Series B 27(2,3):
35-46.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 495-500 January-March 2011
DOT: 10.5248/115.495
Marasmius galbinus, a new species from China
Cuun- YING DENG*? & Tar-Hur Lr
‘School of Bioscience and Biotechnology, South China University of Technology,
Guangzhou, 510641, China
’Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application,
Guangdong Institute of Microbiology, Guangzhou 510070, China
CORRESPONDENCE TO:
[email protected]
Asstract — Marasmius galbinus of section Globulares is described and illustrated as a new
species. The type is preserved in the Herbarium of Microbiology Institute of Guangdong
Province (GDGM).
Key worps —diversity, Marasmiaceae, taxonomy
Introduction
Members of Marasmius sect. Globulares possess a hymeniform pileipellis of
smooth (Globulares-type) cells (Wilson & Desjardin 2005). There are about 100
species and varieties in this section worldwide (Singer 1976, 1986; Tan et al.
2009; Wannathes et al. 2009; Antonin et al. 2010).
Until now, no monograph of Marasmius has been published from China,
and only 17 members of section Globulares have been reported from China
(Dai 1979; Bi et al. 1985, 1987, 1994; Li et al. 1994; Zhang 1995; Mao 1998;
Deng & Li 2008). During a survey on the Chebaling Biosphere Reserve in
Shixing County of Guangdong Province, a species was collected, belonging to
section Globulares with a unique combination of features and herein proposed
as a new species.
Materials & methods
Specimens were annotated and photographed in the field, dried in an electric drier,
and then preserved in herbarium. Color terms and notations follow those of Kornerup &
Wanscher (1978). Fungal tissues were mounted in 5% KOH for microscopic examination.
The terms used to describe lamellae spacing refer to the number of lamellae reaching
from the stipe to the pileus margin and do not include the lamellulae, whose spacing
is indicated by the number of series present. Spore statistics include: x, , the arithmetic
496 ... Deng & Li
mean of the spore length by spore width (+ standard deviation) for n spores measured
in a single specimen; Q, the quotient of spore length by spore width in any one spore,
indicated as a range of variation in n spores measured; Q_, the mean of Q-values in
a single specimen; n, the number of spores measured per specimen; s, the number of
specimens involved. Specimens are deposited in Herbarium of Guangdong Institute of
Microbiology (GDGM). Authors of fungal names are cited according to the International
Plant Names Index Authors website (http://www. ipni.org/ipni/authorsearchpage.do).
Genomic DNA was isolated from dried specimens and the ITS1-5.8S-ITS2 segment
from the ribosomal DNA (rDNA) was amplified with primer sets ITS1 (5’-Trcc GTA GGT
GAA CCT GCG G -3’) and ITS4 (5’-Tcc TCC GCT TAT TGA TAT GC -3’) by polymerase chain
reaction (PCR) techniques (White et al. 1990). Amplified products were examined with
agarose gel electrophoresis using a 2kb DNA marker. The amplified PCR products were
directly sequenced and deposited in GenBank.
Taxonomy
Marasmius galbinus T.H. Li & Chun Y. Deng, sp. nov. Fic. 1-2
MycoBank MB 519192
Pileus 8-15 mm latus, campanulatus, late conicus, striatus, hygrophanus, albido-luteolus.
Lamellae adnexae vel subliberae, distantibus. Stipes 15-30 x 0.5-1 mm, aequalis vel
subbulbosus ad basim, non-insititius, apicem albidus vel luteolus, ad basim albo-
strigosus. Basidiosporae 14-16 x 4-5 um, anguste clavatae vel sublacrymoideae, hyalinae,
inamyloideis. Cheilocystidia 29-33 x 6-9 um, clavata vel vesiculosa. Pleurocystidia
nulla. Pileipellis hymeniformis (typi Globularis) ex cellulis clavato-vesiculosis, hyalinis,
membrana tenuitunicata instructa. Trama pilei et lamellarum dextrinoidea. Caulocystidia
10-50 x 4-10 um, cylindraceis, clavatis vel subfusiformibus. Trama pilei et lamellarum
dextrinoidea.
Type: CHINA, GUANGDONG, Chebaling National Nature Reserve. 26 May 2010, Li YJ.,
Huang H. & Deng C.Y. (Holotype, GDGM 27251).
EryMo.ocy: galbinus = greenish yellow; referring to the basidiome color.
PiLeus 8-15 mm wide, obtusely conical when young, convex to campanulate in
age, rugulose at the disc, sulcate to plicate at margin, glabrous, hygrophanous,
disc and striae white to greenish white (3A2), elsewhere yellowish white (2A2,
2B3). ConTEXT yellowish white, thin. LAMELLAE subfree to adnexed, distant
(14-16) with 0-3 series of lamellulae, broad (1-2 mm), yellowish white, non-
marginate, not intervenose. STIPE 15-30 x 0.5-1 mm, central, cylindrical with
or without a sub-bulbous base, hollow, glabrous, non-insititious, apex hyaline
to white, base pale yellow (4A3) to light yellow (4A4, 4A5). Odor and taste not
distinctive.
Basipiospores 14-16 x 4-5 um [x, = 15.68 + 0.7 x 4.6 + 0.5 um, Q =
3.2-3.4, Q. = 3.38 + 0.1, n = 25 spores, s = 1 specimen], clavate to fusoid,
often curved in profile, smooth, hyaline, inamyloid, thin-walled. Basip1a
30-35 x 6-8 um, clavate, 2- or 4-spored. BAsIDIOLEs clavate to cylindrical.
Marasmius galbinus sp. nov. (China) ... 497
a.
Cc e
Fics 1-2: Marasmius galbinus (holotype, GDGM 27251).
1. Basidiomes; 2. a. Basidiospores, b. Pileipellis, c. Cheilocystidia, d. Basidia, e. Caulocystidia.
Bars: 1 = 1 cm; 2 = 10 um.
498 ... Deng & Li
CHEILOCYSTIDIA abundant, lamellar-edge sterile, 29-33 x 6-9 um, irregularly
clavate to ventricose, hyaline, inamyloid, thin-walled. PLEUROCYSTIDIA absent.
PILEIPELLIs a hymeniform layer of Globulares-type cells, 12-21 x 9-12 um,
broadly clavate to pyriform, hyaline, inamyloid, thin to thick-walled, non-
gelatinous. LAMELLAR TRAMA regular; hyphae 2.5-10 um diam., cylindrical,
hyaline, dextrinoid, thin-walled, non-gelatinous. STIPITIPELLIs hyphae 4-10
um diam., parallel, cylindrical, smooth, dextrinoid, thin- to thick-walled,
non-gelatinous. STIPE TRAMA hyphae 3-6 um diam., parallel, cylindrical,
hyaline, smooth, dextrinoid to weakly dextrinoid, thin-walled, non-gelatinous.
CAULOCYSTIDIA 10-50 x 4-10 um, versiform, ranging from irregular cylindrical
to fusoid, clavate or irregular in outline, hyaline, inamyloid, thin- to thick-
walled. Clamp connections present in all tissues.
ECOLOGY AND DISTRIBUTION—Scattered on dicotyledonous leaves or debris in
broad-leaved forest in May; China (Guangdong).
CoMMENTS— The main features of Marasmius galbinus include: ahygrophanous,
striate pileus with (greenish) white disc and striae; distant to subdistant yellowish
white lamellae; large basidiospores with means 15.6 x 4.0 um; the presence of
cheilocystidia and caulocystidia; and the absence of pleurocystidia.
Marasmius galbinus is similar in color to three other yellowish green species,
Asian M. grandiviridis Wannathes et al, American M. rhyssophyllus Mont. ex
Berk. & M.A. Curtis, and African M. staudtii Henn. Marasmius grandiviridis
differs in forming a larger (37-88 mm diam.), plicate pileus and larger
basidiospores (26-30 x 4-5 um) (Wannathes et al. 2009b); M. rhyssophyllus
differs in forming narrow, closely interveined lamellae and smaller basidiospores
(5-6.5 x 3.5-4.5 um) (Pegler 1983); and M. staudtii differs in forming a sulcate
pileus and longer basidiospores (23-26 tum) (Singer 1964).
Macroscopically, the new species resembles the African species M. albido-
cremeus Antonin and South Pacific species M. musisporus Desjardin & E.
Horak. Marasmius albidocremeus is distinct by a whitish or pale cream pileus,
a long and slender stipe (50-90 x 0.5-1.25 mm), larger basidiospores (16.5-23
x 3.5-5.0 um) and well-developed pleurocystidia (Antonin 2003), while M.
musisporus differs by very large basidiospores (30-40 um long) and the absence
of caulocystidia (Desjardin & Horak 1997)
The rDNA-ITS (ITS1-5.8S-ITS2 segment) sequence with 657 bps of the
new species (HQ709445) differs from all other known Marasmius sequences.
Through a Blast search against the GenBank DNA database, only 160 bps
of 5.88 of the sequence can be compared with 998 max scores and 95%
maximal percent identities to those of M. laticlavatus (EU643511, EU643512),
and with 929 max scores and 92% maximal percent identities to those of
M. purpureostriatus (EU935539). The remaining parts (ITS1 and ITS2,
Marasmius galbinus sp. nov. (China) ... 499
occupying about 75.6% of the whole segment) of the sequence are so different
that they are not comparable with the known sequences. Therefore, M. galbinus
is considered distinct.
Acknowledgments
The authors thank Dr. Vladimir Antonin of Brno, Czech Republic and Dennis E.
Desjardin of San Francisco State University, San Francisco, USA for reviewing the
manuscript. This study was supported by the National Natural Science Foundation of
China (No. 30770004, 30870019, 30970023).
Literature cited
Antonin V. 2003. New species of marasmioid genera (Basidiomycetes, Tricholomataceae) from
tropical Africa I. Sect. Epiphilli, Fusicystides, Globulares, Hygrometrici and Neosessiles.
Mycotaxon 85: 109-130.
Antonin V, Ryoo R, Shin HD. 2010. Marasmioid and gymnopoid fungi of the Republic of Korea. 2.
Marasmius sect. Globulares. Persoonia 24: 49-51. doi:10.3767/003158510X496107
Bi ZS, Li TH. 1987. Notes on species of Marasmius from North Guangdong province of China.
Guihaia 7(3): 225-228.
Bi ZS, Zheng GY, Liang JQ, Li C, Li TH. 1985. Taxonomic studies on Marasmius from Dinghu
Mountain of China. Acta Mycologica Sinica 4(1): 41-50. (in Chinese)
Bi ZS, Zheng GY, Li TH. 1994. Macrofungus flora of Guangdong Province. Guangdong Science and
Technology Press, Guangzhou. 879 p. (in Chinese)
Deng CY, Li TH. 2008. Marasmius nigrodiscus, a newly recorded species to China. Mycosystema
27(5): 768-770. (in Chinese)
Desjardin DE, Horak E. 1997. Marasmius and Gloiocephala in the South Pacific Region: Papua New
Guinea, New Caledonia and New Zealand Taxa. Part 1: Papua New Guinea and New Caledonia
Taxa. Part 2: New Zealand Taxa. Bibliotheca Mycologica 168. 152 p.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. 3" ed. London: Methuen. 252 p.
Li TH, Bi ZS, Zheng GY, Zhang WM. 1994. Species of Marasmius from Guangdong and Hainan
province. Acta Mycologica Sinica. 13(4): 249-254. (in Chinese)
Mao XL. 1998. Economic fungi of China. Science Press, Beijing. 762 p. (in Chinese)
Pegler DN. 1983. Agaric flora of the Lesser Antilles. Kew Bulletin Additional Series 9. 668 p.
Singer R. 1964. Marasmius. Flore Iconographique des Champignons du Congo, Fasc. 14: 253-278.
Singer R. 1976. Marasmieae (Basidiomycetes — Tricholomataceae). Flora Neotropica 17: 1-348.
Singer R. 1986. The Agaricales in modern taxonomy. 4" Ed. Koenigstein, Koeltz Scientific Books.
981 p.
Tai FL. 1979. Sylloge Fungorum Sinicorum. Science Press, Beijing, China. 1527 p. (in Chinese)
Tan YS, Desjardin DE, Perry BA, Vikineswary S, Noorlidah A. 2009. Marasmius sensu stricto in
Peninsular Malaysia. Fungal Diversity 37: 9-100.
Wannathes N, Desjardin DE, Hyde KD, Perry BA, Lumyong S. 2009a. A monograph of Marasmius
(Basidiomycota) from Northern Thailand based on morphological and molecular (ITS
sequences) data. Fungal Diversity 37: 209-306.
Wannathes N, Desjardin DE, Lumyong S. 2009b. Four new species of Marasmius section Globulares
from Northern Thailand. Fungal Diversity 36: 155-163.
Wilson AW, Desjardin DE. 2005. Phylogenetic relationships in the gymnopoid and marasmioid fungi
(Basidiomycetes, euagaric clade). Mycologia 97(3): 667-679. doi:10.3852/mycologia.97.3.667
500 ... Deng & Li
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. In: MA Innis, DH Gelfand, JJ Sninsky, TJ White (editors), PCR
Protocols: A guide to Methods and Applications, Academic Press Inc., San Diego: 315-322.
Zhang ST, Mao XL. 1995. Hong Kong mushrooms. Hong Kong: The Chinese University Press, 470
p- (in Chinese)
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 501-504 January-March 2011
DOT: 10.5248/115.501
A new Puccinia on Thymelaea from Turkey
SEVDA KIRBAG &*, M. CATHERINE AIME ?& MuRAT KuRSAT ?
‘Department of Biology, Faculty of Science, Firat University, TR 23119, Elazig, Turkey
"Louisiana State University Agricultural Center, Department of Plant Pathology
& Crop Physiology, Baton Rouge, LA 70803 USA
’Department of Biology, Faculty of Science & Arts, Bitlis Eren University,
TR 13000, Bitlis, Turkey
* CORRESPONDENCE TO:
[email protected]
AssTRAcT — ‘The rust fungus Puccinia salihae sp. nov. is described from Ihymelaea aucheri
in East Anatolia, Turkey, producing aecia, uredinia, and telia. This is the first report of a rust
disease infecting a species of Thymelaea.
Key worps — phytopathogens, Pucciniales, Thymelaeaceae, Uredinales
Introduction
Although many studies on the flora of Turkey have been carried out, the
mycobiota is comparatively less studied (Gobelez 1963; Kirbag 2003, 2004;
Huseyin & Kirbag 2003; Hiiseyin 2004; Bahcecioglu et al. 2009). During surveys
of the parasitic fungi on herbaceous plants in the Elazig province of Turkey a
species of Puccinia Pers. was observed on ‘Thymelaea aucheri, a perennial herb.
The disease was observed on host leaves, fruit, and stems. Disease incidence
was rare, detected only once during three years’ observation. Very few rusts
have been recorded from Thymelaeaceae and none from Thymelaea Mill. (Farr
& Rossman 2010).
Materials & methods
The material for this study was collected from the Elazig-Baskil Province in Turkey
in 2007, from square B7 at an altitude of 1800 m. The typical climate of the region is
Mediterranean, characterized by hot and dry summers and extremely cold and snowy
winters. Field collected specimens were preserved by drying in a plant press according
to established herbarium techniques. The host plant was identified using the flora of
Turkey (Davis 1985). Holotype material is housed at the Firat University Herbarium
(FUH) in Elazig, Turkey; isotype material is housed at the US National Fungus
502 ... Kirbag, Aime & Kursat
Collections, Beltsville, MD USA (BPI). DNA extraction, polymerase chain reaction,
and cycle sequencing of the nuclear ribosomal large subunit (LSU) were performed as
previously described in Aime (2006). A DNA sequence of the LSU has been deposited
in GENBANK, accession number HQ412645.
Results
A 981 bp sequence of the 5’-end of the LSU was obtained. Blast analyses
(Altschul et al. 1997) indicated placement within the Pucciniaceae, with
closest similarities to other members of Puccinia, including P. windsoriae (98%
similarity), P. andropogonis (98%), and P. emaculata (97%).
Taxonomy
Puccinia salihae Kirba’ & Aime sp. nov. Fic 1
MycosBank MB 519019
Aecia in fructus, folia, caulicola, 1 mm longa, 0.2 mm lata, meliaurantiata, cellulae
peridii, sphaeroideae, elipsoideae 20-22.5 x 17.5-20 um, parietibus 6 um. Aeciosporae
sphaeroideae, ovoidaeae, 20-22 x 18-20 um, membrana 1-1.5 um. Uredinia foliacolae,
caulicolae, rarius fructicolae, 1-2 mm longa, 0.1-0.5 mm lata, pulvinata, flaventa.
Urediniasporae globosae 30-35 x 25-27.5 um, membrana 1.5 um crassa, echinulataeae,
poris germinationis 4 dispersis. Telia foliicolae, caulicolae, rarius fructicolae 1-2 mm
longa, 0.1-0.5 lata, black, fuliginea, pulvinata, pulveraceae. Teliosporae elipticae-ovoideae
45-51 x 30-32 um, membrane 1-1.5 um, crassa in apice 4 um, poro superiore apical, poro
inferiore prope septum, crassa caducous stipite, hyaline, 10-25x 5-7.5 um.
TyPE: TURKEY, ELAZIG-BASKIL, Hasan mountain, slope of Hacimustafa village, alt 1800
m on Thymelaea aucheri (Thymelaeaceae), 14 Jul 2007, leg: S. Karbag & M. Kursat
(no:2000) (Holotype FUH 1272). Isotype in BPI (BPI 881123).
ETyMoLoGy: Saliha, in honor of the mother of the first author.
Aecia (Fic 1c) on fruits, leaves and stems, 1 mm long, 0.2 mm wide, whitish
to honey-orange in color, pinnately arranged. Peridial cells (Fic le) honey
colored, irregularly shaped, in cross section spherical to ellipsoid, 20-22.5 x
17.5-20 um, outer wall 1-1.5 um thick, inner wall 4-5 um thick. Aeciospores
spherical to ovoid, 20-22 x 18-20 um, spore wall 1-1.5 um thick. Uredinia
on leaves, stems, rarely on fruits, 1-2 mm long, 0.1-0.5 mm wide, yellowish,
at first covered by epidermis, later rupturing. Urediniospores globoid 30-35
x 25-27.5 um, wall 1.5 um thick, echinulate, germ pores 4, scattered. Telia
(Fic 1d) on leaves, stems rarely on fruits, 1-2 mm long, 0.1-05 mm wide, black,
powdery. Teliospores (Fic 1f) ellipsoid-ovoid 45-51 x 30-32 um, spore wall
brown-chestnut, 1-1.5 um thick, apex slightly thickened up to 4 um, upper pore
apical, lower pore near septum, pedicel hyaline, 10-25 x 5-7.5 um.
ECOLOGY, RANGE & DISTRIBUTION: Known only from Thymelaea aucheri at
the type location. Worldwide, the host plant has been recorded from Turkey,
Syria, Lebanon, and western Iran (Davis 1985).
Puccinia salihae sp. nov. (Turkey) ... 503
Figure 1. Puccinia salihae on Thymelaea aucheri (holotype): a—b. infected host plant; c. aecia;
d. telia; e. peridial cells; f. teliospores.
Discussion
Thymelaeaceae is represented by three genera (Diarthron, Daphne,
Thymelaea) in Turkey (Davis 1985). A single species of rust, Uredo daphnicola
Dietel, has been reported on Thymelaeaceae from Turkey on Daphne oleoides
Schreb. (Kabaktepe & Bahcecioglu 2005). Uredo daphnicola is considered
504 ... Kirbag, Aime & Kursat
synonymous with Melampsora daphnicola (Dietel) Jorst. (Kuprevich &
Transhel 1957), a fungus that is readily distinguished from Puccinia salihae by
its colorless urediniospores and paraphysate uredinia.
Worldwide, there are few rusts recorded from Thymelaeaceae and none
from a species of Thymelaea (Farr & Rossman 2010). Only one other species of
Puccinia, P. gnidiae Doidge on Gnidia microcephala Meisn. from South Africa,
is known to infect a member of the family (Farr & Rossman 2010). In addition
to host genus, P. salihae differs from P. gnidiae primarily by the much larger
urediniospores (30-35 x 25-27.5 um in P. salihae vs. 25-30 x 22.5-25 um in
P. gnidiae) and teliospores (45-51 x 30-32 um in P salihae vs. 30-40 x 25-30
um in PB gnidiae) (Doidge 1939).
Acknowledgments
MCA acknowledges Cindy Park for excellent technical support at the USDA. Elsad
Hiiseyin and Zeliha Bahcecioglu are thanked for helpful corrections and suggestions on
the manuscript.
References
Aime MC. 2006. Toward resolving family-level relationships in rust fungi (Uredinales). Mycoscience
47: 112-122. doi:10.1007/s10267-006-0281-0
Altschul SE, Madden TO, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids
Research 25: 3389-3402. doi:10.1093/nar/25.17.3389
Bahcecioglu Z, Berndt R, Kabaktepe S. 2009. Puccinia ardahanensis sp. nov., a new rust fungus
from Turkey. Sydowia 61: 209-213.
Davis PH, 1985. Flora of Turkey and the East Aegean Islands, Vol 7, Edinburgh Univ. Press.
Edinburgh. doi:10.2307/1219187
Doidge EM. 1939. South African rust fungi, II. Bothalia 3: 487-512.
Farr DF, Rossman AY. 2010. Fungal databases, systematic mycology and microbiology laboratory,
ARS, USDA. Retrieved September 3, 2010, from http://nt.ars-grin.gov/ fungaldatabases/
Gobelez M. 1963. La mycoflore de Turquie. I. Mycopathologia et Mycologia Applicata 19 (4):
296-314.
Hiiseyin E. 2004. Kuehneola uredinis (Uredinales) on Species of Rubus in Turkey. Mycotaxon 90
(1): 149-151.
Hiiseyin E, Karbag S. 2003. A new Puccinia on endemic Phryna. Pakistan Journal of Botany 35 (4):
477-478.
Kabaktepe S, Bahcecioglu Z. 2005. Seven rust species recorded as new to Turkey. Mycotaxon 91:
393-396.
Karbag S. 2003. New records of microfungi for Turkey. Plant Disease Research 18 (1): 94-95.
Karbag S. 2004. New records of microfungi from Turkey. Pakistan Journal of Botany 36 (2):
445-448,
Kuprevich VF, Transhel’ V G. 1957. Cryptogamic plants of the USSR. Vol IV. Rust Fungi: Family
Melampsoraceae. Translated from Russian (1970): Israel Program for Scientific Translations,
Jerusalem. 518 pp.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 505-506 January-March 2011
DOT: 10.5248/115.505
Pucciniastrum enkianthi nom. nov.,
a replacement name for P. hakkodaense
YING- MEI LIANG! & MAKOTO KAKISHIMA”
‘College of Environmental Science and Engineering, Beijing Forestry University,
No.35, Tsinghua Eastern Road, Haidan District, Beijing 100083, China
?Graduate School of Life and Environmental Sciences, University of Tsukuba,
Tsukuba, Ibaraki 305-8572, Japan
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Pucciniastrum hakkodaense (a rust pathogen of Enkianthus) is an illegitimate
later homonym of P. hakkodense (a rust pathogen of Leucothoe). Hence, the replacement
name Pucciniastrum enkianthi is proposed.
Key worps —Naohidemyces, nomen novum, nomenclature, Thekopsora
Pucciniastrum enkianthi Y.M. Liang & Kakish., nom. nov.
MycoBank MB519279
= Pucciniastrum hakkodaense Y.M. Liang & Kakish., Mycotaxon 92: 372. 2005,
nom. illegit. (non PB. hakkodense (S. Ito & Hirats. f.) Jorst. 1958).
EryMo.oey: referring to the host genus Enkianthus.
Pucciniastrum hakkodaense Y.M. Liang & Kakish. was described as a new
species based on specimens on Enkianthus campanulatus (Migq.) G. Nicholson
(Ericaceae) collected in Japan (Liang et al. 2005). However, following ICBN
Art. 53.3 (McNeill et al. 2006), this name must be regarded as an illegitimate
later homonym of Pucciniastrum hakkodense (S. Ito & Hirats. f.) Jorst. 1958
(= Thekopsora hakkodensis S. Ito & Hirats. f. 1927).
Thekopsora hakkodensis was described based on a specimen on Leucothoe
grayana Maxim. (Ericaceae) from Japan (Hiratsuka 1927, 1936). Although
Jorstad (1958) transferred the name to Pucciniastrum, Hiratsuka (1958)
and Hiratsuka et al. (1992) continued to treat this species under its original
name, T: hakkodensis. Subsequently, Sato et al. (1993) established a new genus
Naohidemyces and treated T. hakkodensis as a synonym of the type species,
“Naohidemyces vaccinii” S. Sato et al. (an invalidly published combination
506 ... Liang & Kakishima
based on the illegitimate teleomorph name Melampsora vaccinii G. Winter
1881, non (Alb. & Schwein.) G. Winter 1880). The correct name for this taxon
is Naohidemyces vacciniorum (J. Schrot.) Spooner (Spooner & Butterfill 1999)
based on the earliest legitimate teleomorph name, Melampsora vacciniorum
J. Schrot. 1887.
Pucciniastrum enkianthi (= P. hakkodaense) is morphologically quite
different from Naohidemyces vacciniorum (= P. hakkodense, T. hakkodensis).
Pucciniastrum enkianthi produces its telia underneath the epidermis of the host
whereas N. vacciniorum produces teliospores within epidermal cells of the host.
In addition, their uredinial/telial hosts are not closely related though they are
in the same family, Ericaceae: P enkianthi on Enkianthus;, and N. vacciniorum
on Hugeria, Leucothoe, Oxycoccus, and Vaccinium (Sato et al. 1993, Liang et al.
2005).
Acknowledgements
We gratefully acknowledge Dr Shaun Pennycook (Landcare Research, Auckland, New
Zealand), Dr Paul M. Kirk (CABI-UK, Egham, UK), and Dr. C. M. Denchev (Institute of
Biodiversity and Ecosystem Research, Bulgarian Academy of Sciences, Sofia, Bulgaria)
for their kind suggestions and critically reading the manuscript.
Literature cited
Hiratsuka N. 1927. Studies on the Melampsoraceae of Japan. Jour. Facul. Agric. Hokkaido Imp.
Univ. 21: 1-41.
Hiratsuka N. 1936. A monograph of the Pucciniastreae. Mem. Tottori Agric. Coll. 4: 1-374.
Hiratsuka N. 1958. Revision of taxonomy of the Pucciniastreae. Mem. Fac. Agric. Tokyo Univ.
Educ. 5: 1-167.
Hiratsuka N, Sato S, Katsuya K, Kakishima M, Hiratsuka Y, Kaneko S, Ono Y, Sato T, Harada Y,
Hiratsuka T, Nakayama K. 1992. Rust flora of Japan. Tsukuba Tsupankai, Tsukuba.
Jorstad I. 1958. Nomenclature notes, chiefly on Uredinales. Nytt Mag. Bot. 6: 135-140.
Liang Y-M, Tian C-M, Hiratsuka K, Kakishima M. 2005. A new species of Pucciniastrum on
Enkianthus campanulatus from Japan. Mycotaxon 92: 371-376.
McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH,
Prado J, Silva PC, Skog JE, Wiersema J, Turland NJ. 2006. International Code of Botanical
Nomenclature (Vienna Code). Adopted by the Seventeenth International Botanical Congress,
Vienna, Austria, July 2005. Regnum Vegetabile 146. 568 p.
Sato S, Katsuya K, Hiratsuka Y. 1993. Morphology, taxonomy and nomenclature of Tsuga-Ericaceae
rusts. Trans. Mycol. Soc. Japan 34: 47-62.
Spooner BM, Butterfill G. 1999. Additions to the Uredinales and Ustilaginales of the Azores. Vieraea
27: 173-182.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 507-520 January-March 2011
DOT: 10.5248/115.507
Morphological studies in Dothideomycetes:
Elsinoe (Elsinoaceae), Butleria, and three excluded genera
YANMEI Li’, Halx1A Wu?, HANG CHEN! & KEVIN D. HypDE??*
! International Fungal Research and Development Centre, Key Laboratory of Resource Insect
Cultivation & Utilization State Forestry Administration, The Research Institute of Resource Insects,
Chinese Academy of Forestry, Kunming 650224, PR China
? Visiting Professor, Botany and Microbiology Department, College of Science, King Saud University,
Riyadh 11442, Saudi Arabia
3 School of Science, Mae Fah Luang University Tasud, Muang, Chiang Rai 57100, Thailand
* CORRESPONDENCE TO:
[email protected]
AssTRACT — ‘The types of the genera Beelia, Butleria, Elsinoe, Hyalotheles, and Saccardinula
were examined to revise their familial position. The family Elsinoaceae (type: Elsinoe
canavaliae) is described and its separation from Myriangiaceae is supported. Butleria
inaghatahani has characters similar to Elsinoaceae where it should remain. Beelia suttoniae
appears to be a superficial biotroph on the surface of leaves and thus Beelia should be placed
in Chaetothyriaceae and is most similar to Ainsworthia (= Phaeosaccardinula). Apart from
the oblong to ovoid sessile asci in Hyalotheles dimerosperma, its placement in Elsinoaceae
seems unwarranted, and Hyalotheles should be placed in Dothideomycetes incertae sedis.
Saccardinula guaranitica may be better placed in Microthyriaceae or Brefeldiellaceae, because
its ascomata greatly resemble thyrothecia found in Microthyriaceae and have similarities with
Brefeldiella. Molecular sequence data from fresh collections is required to solve the problem
of familial placement.
Key worps — Ascomycota, morphology, taxonomy
Introduction
We are conducting studies on the Dothideomycetes in order to provide a
natural classification (Zhang et al. 2008, 2009; Wu et al. 2010). As part of this
research, we are restudying the type species of genera placed in the Elsinoaceae,
a poorly known but relatively important family within the Dothideomycetes
(Lumbsch & Huhndorf 2007). The Elsinoaceae presently comprise 10 genera
including Beelia, Butleria, Elsinoe, Hemimyriangium, Hyalotheles, Micularia,
Molleriella, Saccardinula, Stephanotheca, and Xenodium (Lumbsch & Huhndorf
2007). The family is characterized by immersed or erumpent ascomata,
508 ... Li & al.
composed of pale gelatinous thin-walled hyphal or pseudoparenchymatous
cells. Asci are arranged in individual locules, in a single layer or are irregularly
scattered, and are saccate to globose, bitunicate and fissitunicate. Ascospores
are hyaline to brown, septate, or sometimes muriform (Kirk et al. 2001,
2008). The known anamorphs in Elsinoaceae are acervular coelomycetes with
polyphialidic conidiogenous cells (e.g. Sphaceloma anamorphs of Elsinoe)
(Sivanesan 1984), We have thus far examined several taxa within Elsinoaceae
and in this paper report on the type species of Elsinoe and four poorly known
genera: Elsinoe canavaliae (Raciborski 1900), Beelia suttoniae (Stevens 1925),
Butleria inaghatahani (Saccardo 1914), Hyalotheles dimerosperma (Spegazzini
1908), and Saccardinula guaranitica (Spegazzini 1885). Full descriptions of
these taxa and suggestion for their taxonomic placement are provided.
Materials & methods
Type specimens of Elsinoe canavaliae, Beelia suttoniae, Butleria inaghatahani,
Hyalotheles dimerosperma, Saccardinula guaranitica were obtained from ZT & K,
BISH, PAD, LPS and LPS, respectively. Ascomata were rehydrated in 3% KOH prior
to examination and sectioning. Specimens were examined under a stereo microscope
(Leica MZ16A) and fine forceps were used to remove one or two ascomata, which
were mounted in water, Melzer’s, Congo red, or cotton blue reagents. Observations and
photographs were made under the light microscopes (Nikon E800 and Leica DM3000).
Differential interference contrast microscopy was used for some hyaline structures.
Hand sections were cut with a sharp razor blade and thin (8 tm) sections were cut
using a Leica CM1100 freezing microtome. The sections were transferred to a drop of
water or a drop of cotton blue for examination and photography.
Taxonomy
Elsinoaceae Hohn. ex Sacc. & Trotter, Syll. fung. 22: 584 (1913).
Parasitic on leaves causing scabs and anthracnose. Ascomata immersed to
erumpent, round or elongate, usually crustose, composed of pale gelatinous
thin-walled hyphal or pseudoparenchymatous cells, opening by unordered
breakdown of the surface layers. Specialized interascal tissue absent. Asci
arranged in individual locules, in a single layer or irregularly arranged, saccate
to globose, bitunicate, fissitunicate. Ascospores hyaline to brown, septate,
sometimes muriform. Anamorph acervular where known.
Elsinoaceae was validated by Saccardo & Trotter (1913) based on the invalid
non-Latin name “Elsinoéen” published by Hohnel (1909: 373). Héhnel (1909)
regarded Elsinoaceae as a separate family at the same level with Myriangiaceae
among “die Protodiscineen” or “die Plectascineen” Von Arx & Miiller (1975)
extended the family concept and placed Elsinoe with another 15 genera in
Myriangiaceae. Luttrell (1973) used this concept to unite seven additional genera
with Elsinoe in Myriangiaceae. Barr (1979) and Eriksson (1981) maintained
Morphological studies in Dothideomycetes ... 509
the Elsinoaceae as separate from Myriangiaceae, mainly based on habit and
developmental studies. Lumbsch & Huhndorf (2007) placed Elsinoaceae in the
order Myriangiales and this is supported in the studies of Schoch et al. (2006,
2009) and Boehm et al. (2009). Further molecular study is needed to establish
whether Elsinoaceae and Myriangiaceae are distinct families, although the
evidence points towards this (Schoch et al. 2009).
Type GENus: Elsinoe Racib., Paras. Alg. Pilz. Java’s (Jakarta) 1: 14 (1900).
Ascomata parasitic, usually forming scabs or anthracnose on leaves.
Ascomata pulvinate, white or occasionally brown, in section with numerous
locules distributed inside the ascostromata, with numerous asci inside each
locule. Paraphyses absent. Asci 8-spored, bitunicate, globose to subglobose,
without a pedicel. Ascospores hyaline, transseptate or muriform.
ANAMORPH: Sphaceloma spp. Acervuli pseudoparenchymatous from which
hyaline to pale-brown phialidic conidiophores and/or conidiogenous cells
originate. Conidia hyaline, unicellular, ellipsoidal, biguttulate.
Type species: Elsinoe canavaliae Racib., Paras. Alg. Pilze Java's 1: 14 (1900),
as “cavavalliae”. Fic. 1
Ascomata parasitic on leaves, forming scabs on lower surface (Fic. 1A).
Ascomata pulvinate, white or occasionally brown, 1.8-3.3 mm in diam.,
gregarious, immersed or erumpent, irregularly shaped, spreading around the
host veins (Fic. 1B-c), in section with numerous locules distributed inside
the ascostromata, with numerous asci inside each locule, with lower part
of ascomata fusing with the hyaline host cells (Fic. 1p-). Paraphyses not
seen, probably absent. Asci 19-23 x 16-20 tm (mean = 21 x 18 um, n = 10),
8-spored, bitunicate, globose to subglobose, without a pedicel, with a wide but
indistinct ocular chamber (Fic. 1F-H). Ascospores 14-18 x 6-9 um (mean = 15
x 7 tun, n = 10), irregularly arranged, hyaline, ellipsoidal-fusiform, 3-4 septate,
constricted at the central septum, upper part wider with slightly acute ends,
lower part narrow with rounded ends, guttulate (Fic. 11-)).
ANAMoRPE: Sphaceloma.
SPECIMEN EXAMINED: INDONESIA, Java, on leaves of Canavalia gladiata (Savi) DC.
(Fabaceae) leg. Raciborski (ZT Myc 1489, lectotype; K 164015, syntype).
Elsinoe was established by Raciborski (1900) with descriptions of three species
(E. canavaliae, E. antidesmae Racib., E. menispermacearum Racib.). Von Arx
& Miiller (1975) placed Elsinoe in Myriangiaceae based on its immersed or
erumpent, pulvinate or irregular ascomata and being parasitic on the leaves
of higher plants causing scabs. Later, the genus was removed to the family
Elsinoaceae (Barr 1979, Lumbsch & Huhndorf 2007). The more than 141 species
recorded for Elsinoe (www.indexfungorum.org 2010) are generally parasites on
leaves, stems, scale insects or other fungi.
510 ... Li &al.
Fic. 1. Elsinoe canavaliae (lectotype) a. Appearance of ascomata on the host surface of leaves.
B-c. Appearance of ascomata on the leaves showing the irregular shape of scabs. D-E. Vertical
section through ascomata in cotton blue showing the ascomata with numerous asci inside each
locule. F-H. Sessile asci in cotton blue. I-J. Ascospores in cotton blue.
Scale bars: B- c = 5 mm, D- E = 100 um, F-j = 10 um.
This is an important plant pathogenic genus causing scab and anthracnose
of Citrus, Malus, Rubus, Vitis spp. and other hosts and descriptions and disease
symptoms can be found on the worldwide web. It is important however, to
characterize the type of the genus, which is less well known. Elsinoe fawcettii
Bitanc. & Jenkins and E. australis Bitanc. & Jenkins cause scab diseases of
Citrus species (Hanlin 1989; Timmer et al. 1996), and there are many other
important pathogens in this genus. Examples include Elsinoe veneta (Burkh.)
Morphological studies in Dothideomycetes ...511
Jenkins, which causes cane spot of raspberry (Munro 1988); E. dracophylli PR.
Johnston & Beever, which causes spots on Dracophyllum Johnson and Beever
1994); and E. mangiferae Bitanc. & Jenkins (Bitancourt & Jenkins 1946), which
causes mango scab. Elsinoe takoropuku G.S. Ridl. & Ramsfield is a recently
introduced species (Ridley & Ramsfield 2006), but it differs quite markedly
from E. canavaliae as it does not cause scabs on leaves, but forms ascostromata
on twigs with locules each containing single asci. The asci are thought to be
more like the Elsinoe type, although the fungus shares many characters with
Myriangiaceae, illustrating a clear need for molecular studies on this group.
There have been a few molecular studies incorporating strains of Elsinoe.
Schoch et al. (2006, 2009) and Boehm et al. (2009) showed the species to cluster
in the Myriangiales and form a distinct subclade — the Elsinoaceae. However,
since only four Elsinoe specimens and one Myriangium specimen were used
in Schoch et al. (2006) and no Elsinoe specimens were used in Schoch et al.
(2009), the molecular data does not conclusively resolve two separate families
(Elsinoaceae and Myriangiaceae). Swart et al. (2001) analyzed ITS sequence
data of six Elsinoe species — E. banksiae, E. leucospermi, E. proteae, Elsinoe sp.
(from Citrus), Elsinoe sp. (from Banksia), Sphaceloma protearum — in their
research on the taxonomy of species associated with scab disease of Proteaceae;
their molecular analyses supported five species, of which four were described
in that paper. A molecular study of many more Elsinoe species is needed.
Beelia FE Stevens & R.W. Ryan, in Stevens, Bulletin of the Bernice P. Bishop Museum
19: 71 (1925).
Forming colonies on the surface of the leaves. Ascomata black, superficial,
ostiolate, aparaphysate, borne on free, brown, septate, branching mycelium.
Asci bitunicate, broadly ellipsoidal, obovate to saccate, pedicellate. Ascospores
cylindrical, hyaline to straw-coloured, 6-celled.
ANAMorRPHs unknown.
Type species: Beelia suttoniae F. Stevens & R.W. Ryan, in Stevens, Bulletin of the
Bernice P. Bishop Museum 19: 71 (1925). Fic. 2
Ascomata on the upper surface of leaves, scattered beneath and between
darkened mycelial strands (Fic. 2A-B). Ascomata 190-210 tum wide x 115-133
uum high, superficial, globose to subglobose, black, with a flattened base which
is easily removed from the substrate containing numerous asci (Fic. 2c-p).
Peridium 25-30 um wide, up to 39 um wide at the apex, 20 um wide at the base;
comprising two cell types; outer cells brown, thick-walled, textura globulosa,
inner cells thin-walled, lighter, textura angularis (Fic. 2p-E). Paraphyses not
seen, probably absent. Asci 70-89 x 45-55 um (mean = 84.3 x 51.2 um, n = 20),
8-spored, bitunicate, broadly ellipsoidal, obovate to saccate, thick-walled, with
small pointed pedicle, and with ocular chamber up to 24.4 um wide x 14.9 um
512... Li &al.
Fic. 2. Beelia suttoniae (syntype): a. Appearance of ascomata on host leaf scattered beneath and
between darkened mycelium. B. Squash of ascoma in water. c-E. Vertical section through ascoma
showing outer and inner cell types. F-c. Asci. Note the bitunicate appearance and ocular structure
in the extended apex. H-1. Hyaline ascospores with 5-septa. Note the central septum is strongly
constricted and upper part wider.
Scale bars: A— B = 100 pum. c-E = 50 um, F = 25 pm. G = 50 um. H-1 =10 pum.
high (Fic. 2F-G). Ascospores 38-45 x 13-18 um (mean = 42.8 x 14.6 um, n =
20), irregularly arranged, cylindrical, hyaline, 5-septate, strongly constricted at
each septum, central septum very strongly constricted and upper part wider,
smooth-walled, with narrow mucilage sheath (Fic. 2 H-1).
ANAMORPH unknown.
Morphological studies in Dothideomycetes ... 513
SPECIMEN EXAMINED: USA, Hawall, on leaves of Suttonia lanaiensis Mez (Myrsinaceae),
circa 1925, Lanai, no. 421, leg. Munro (BISH 499845, syntype).
Beelia was introduced by Stevens & Ryan (Stevens 1925) and remained
monotypic until B. philippinensis Bat. & C.A.A (Batista & Costa 1959) and B.
plumeria Bat. & Cavalc. (Batista et al. 1967) were added. Stevens (1925) placed
Beelia in the family Microthyriaceae, where it was accepted by Petrak (1953).
Von Arx & Miller (1975) transferred Beelia to the Myriangiaceae based on
its dimidiate ascomata and long (> 30 um) brown ascospores. Hawksworth et
al. (1995) later transferred the genus to the Elsinoaceae, a placement accepted
by Kirk et al. (2001) and Lumbsch & Huhndorf (2007). The taxon appears
to be a superficial biotroph on leaf surfaces, a character shared by genera in
Chaetothyriaceae. As Beelia seems most similar to Ainsworthia (Batista & Ciferri
1962; = Phaeosaccardinula Henn., fide von Arx & Miller 1975) in that family,
we suggest that the genus may belong in Chaetothyriaceae. New collections and
molecular analyses are needed to clarify the familial placement.
Butleria Sacc., Annls mycol. 12(3): 302 (1914).
Forming leaf spots. Ascomata gregarious, superficial, black, subglobose,
with numerous locules distributed at different levels inside the ascomata, with
only one globose to oblong asci inside each locule. Asci 8-spored, bitunicate,
sessile. Ascospores oblong to ovoid, brown, two-celled.
ANAMORPHs unknown.
Type species: Butleria inaghatahani Sacc., Annis mycol. 12(3): 302 (1914). Fie. 3
Forming light, somewhat zonate target spots on leaves (Fic. 3a,c) with
minutely stromatic ascomata forming on the upper surface. Ascomata 81-130
x 60-88 um (mean = 114.4 x 75.2 wm, n = 15), gregarious, superficial, ovoid,
subglobose to globose, black, with numerous locules distributed at different
levels inside the ascomata, with only one globose to oblong asci inside each
locule (Fic. 3B, p-F). Paraphyses not seen. Asci 19-25 x 16-23 um (mean =
22.7 x 19.2 um, n = 15), 8-spored, bitunicate, globose to oblong, sessile, with
small ocular chamber up to 11.8 um wide x 2.9 um high (Fic. 3G-1). Ascospores
8-13 x 4-6 um (mean = 12.1 x 4.8 wm, n = 15), irregularly arranged in rows of 3
or 4, oblong to ovoid, brown, 2-celled, constricted at the central septum, upper
cell slightly larger than lower cell, spinulose (Fic. 3J-k).
ANAMORPH: unknown.
SPECIMEN EXAMINED: BANGLADESH, Comillae District, Krishnapone, associated
with target spots on leaves of Vangueria sp. (Rubiaceae), causing, 8 December 1913, leg.
Inaghataban (PAD 1677, holotype).
Butleriais a monotypic genus established by Saccardo (1914) for B. inaghatahani.
Von Arx & Miiller (1975) referred this genus to Myriangiaceae based on its
small bright ascomata and 2-celled ascospores. Currently, Butleria is placed in
the family Elsinoaceae (Barr 1979; Lumbsch & Huhndorf 2007; Kirk et al. 2001,
514... Li &al.
Boablinie rage bed Sey
Morphological studies in Dothideomycetes ...515
2008). This taxon does appear to be a candidate for Elsinoaceae as it is a parasite
on leaves and has single asci locules scattered throughout a somewhat reduced
but pulvinate ascomata. The ascospores are, however, distinct in being brown.
Here also additional collections and molecular analyses are needed to clarify
family relationships.
Hyalotheles Speg., Revta Mus. La Plata 15(2): 11 (1908).
Forming black spots on the upper surface of leaves. Individual ascomata
scattered, superficial, globose, black. Paraphyses not seen. Asci 8-spored,
bitunicate, oblong to obovoid, without a pedicel. Ascospores irregularly
arranged in 2---3 rows, globose, hyaline, 1-celled, minutely guttulate.
ANAMOoRPH: unknown.
Type species: Hyalotheles dimerosperma Speg., Revta Mus. La Plata 15(2): 11
(1908). Fic. 4
Forming black spots on the upper surface of leaves (Fic. 4a,c).
Individual ascomata scattered, superficial, globose, black, composed of
the hyaline pseudoparenchymatous cells at the edge and brown to dark
pseudoparenchymatous cells at the center (Fic. 48,D-E). Ascomata in section
50-62 x 54-60 um (mean = 56 x 55 um, n = 10) (Fic. 4E-F). Peridium dark to
brown, up to 4-5 um wide (Fic. 4£-F). Paraphyses not seen. Asci 23-28 x 15-
18 um (mean = 26 x 16 um, n = 10), 8-spored, bitunicate, oblong to obovoid,
without a pedicel (Fic. 4c-H). Ascospores 5-7 x 5-7 um (mean = 5.5 x 6. fm,
n = 8), irregularly arranged in 2-3 rows, globose, hyaline, 1-celled, minutely
guttulate (Fic. 41).
ANAMOoRPH: unknown.
SPECIMEN EXAMINED: BRAZIL, Sao PAuLo, Casa do Isolamento, on leaves of Rubus
urticifolius Poir. (Rosaceae), collector unknown (LPS 408, holotype).
Hyalotheles is a monotypic genus introduced by Spegazzini (1908) for H.
dimerosperma. The genus is characterized by ascomata developing on glandular
hairs of the host and spherical ascospores (von Arx & Miiller 1975). Von Arx
& Muller (1975) placed Hyalotheles in the family Myriangiaceae, but later
Barr (1979) transferred the genus to the family “Saccardinulaceae” [an invalid
name]. Lumbsch & Huhndorf (2007) now recognize Hyalotheles in the family
Elsinoaceae. Apart from the oblong to ovoid sessile asci, however, placement
in Elsinoaceae seems unwarranted, and Hyalotheles is better referred to
Dothideomycetes incertae sedis. Additional collections and molecular analyses
are needed to clarify family relationships.
Fi. 3 (left). Butleria inaghatahani (holotype): a, c. Appearance of ascomata in leaf spot. B. Drawing
from herbarium specimen. pD, F. Vertical section through ascomata showing the part connected
to the leaf. E. Vertical section through ascomata (in cotton blue reagent). G-I. Saccate asci.
J-K. Ascospores. Scale bars: c = 1 mm, D-E = 100 tum, F = 50 um, G—-K = 10 um.
516 ... Li &al.
5 ‘Cae
Nyt Pabes by. (pd: eed p,
7 fae |
f ie tal * ) Vue
Fic. 4. Hyalotheles dimerosperma (holotype). a, c. Appearance of ascomata on host surface
of leaf. B. Appearance of the drawing picture from the specimen. p. Ascomata in lactic acid
showing the structure of dark to brown pseudoparenchymatous cells at the center and hyaline
pseudoparenchymatous cells at the edge. E—-F. Vertical section through ascoma in cotton blue.
G-H. Asci in cotton blue. I. Ascospores in cotton blue.
Scale bars: c = 1 mm, D = 100 um, E = 50 pm, F = 100 um, G—H = 10 um.
Morphological studies in Dothideomycetes ...517
Saccardinula Speg., Anal. Soc. cient. argent. 19(6): 257 (1885).
Thalli forming raised black spots on the lower leaf surface. Individual
ascomata gregarious, superficial, very easily removed from host surface, ovoid
to globose, black, with the two different regions; the central region comprising
dark brown radiating cells with the ascomata and the marginal parts comprising
lighter brown radiating cells. Ascomata subglobose, fusing with one or more
ascomata, with a single locule distributed inside each ascoma, with single asci
inside each locule. Paraphyses not seen. Asci 8-spored, bitunicate, globose to
oblong, without pedicel. Ascospores ellipsoid-fusiform, with a few transsepta
and occasional longitudinal septa.
ANAMORPH: unknown.
Typs species: Saccardinula guaranitica Speg., Anal. Soc. cient. argent.
19(6): 258 (1885). Fic. 5
Thalli forming raised 400 um black spots on the lower leaf surface (Fic.
5a-C). Individual thalli gregarious, superficial, very easily removed from host
surface, ovoid to globose, black, with the two different regions; the central
region comprising dark brown radiating cells with the ascomata and the
marginal parts comprising lighter brown radiating cells to 3-7 um in diam.
(Fic. 5B,D-E). Ascomata in section 81-130 um x 60-88 pum, subglobose, fusing
with one or more ascomata, with a single locule distributed inside each ascoma,
with single asci inside each locule (Fic. 5F). Paraphyses not seen. Asci 19-25 x
16-23 um (mean = 22 x 20 um, n = 10), 8-spored, bitunicate, globose to oblong,
without pedicel (Fic. 5c-H). Ascospores 8-13 x 4-6 um (mean = 10 x 5 um, n
= 10), irregularly arranged, ellipsoid-fusiform, 2-3 septate, constricted at the
central septum, one end broadly rounded and slightly pointed at the other end,
hyaline, occasionally with longitudinal septa, guttulate (Fic. 51-J).
ANAMoRPH: unknown.
SPECIMEN EXAMINED: BRAZIL, Borga, Villa Rice, on leaves of Ilex sp., (Aquifoliaceae),
January 1882, leg. B. Balanse (LPS 1469, holotype).
Saccardinula was erected by Spegazzini (1885) for S. guaranitica. Luttrell (1973)
placed this genus in the “Saccardinulaceae” based on its ascostromata grouped
in a radiate, superficial, cellular membrane. Von Arx & Miller (1975) removed
this genus to Myriangiaceae based on its small ascomata, which are pustulate
at the centre, and short (< 20 um) hyaline ascospores, but Barr (1979) retained
the genus in the “Saccardinulaceae.” Lumbsch & Huhndorf (2007) placed
Saccardinula in the family Elsinoaceae.
Re-examination of S. guaranitica shows that the ascomata greatly resemble
the thyrothecia found in Microthyriaceae (Wu et al. 2010), although Brefeldiella
Speg. (Brefeldiellaceae), which occurs on leaves and has ascomata comprising a
wide area of radiating cells anda darker central raised areain which the asci form,
may be more similar (Reynolds & Gilbert 2005). Elsinoaceae is characterized by
518 ... Li &al.
Morphological studies in Dothideomycetes ... 519
round or elongate ascomata composed of pale gelatinous thin-walled hyphal
or pseudoparenchymatous cells and which open by unordered breakdown of
the surface layers (Kirk et al. 2001). Therefore, Saccardinula might better be
placed in either Microthyriaceae or Brefeldiellaceae, or “Saccardinulaceae” could
be validated to accommodate it (Eriksson 1981). Ultimately only molecular
sequence data will solve the problem of familial placement.
Acknowledgments
The Research Institute of Resource Insects, Chinese Academy of Forestry provided
financial support to Yanmei Li PhD’s study. Funds for research were provided by
the Grant for Essential Scientific Research of National Non-profit Institute (no.
CAFYBB2007002). The curators of the following herbaria are thanked for providing
material on loan for this study: ZT, K, BISH, PAD and LPS. We also thank Professor
Xiaoming Chen for financial support. K.D. Hyde acknowledges a research grant from
the Biodiversity Research and Training Program (BRT R253012) and The Thailand
Research Fund (BRG 5280002).
Literature cited
Arx JA von & Miiller E. 1975. A re-evaluation of the bitunicate ascomycetes with keys to families
and genera. Studies in Mycology 9: 1-159.
Barr ME. 1979. A classification of Loculoascomycetes. Mycologia 71: 935-957. doi: 10.2307/37592
Barr ME. 1983. Prodromus to class Loculoascomycetes.
Batista AC, Cifferi R. 1962. The Chaetothyriales. Beihefte zur Sydowia 3: 1-129.
Batista AC, Costa CA. 1959. Estudo analitico e iconografico de espécies de Microthyrium Desm.
Anais da Sociedade de Biologia de Pernambuco 16: 69-78.
Batista AC, Cavalcante W de A, Peres GP. 1967. Novas espécies de Microthyriaceae. Atas Instituto
de Micologia. Universidade do Recife 5: 213-214.
Bitancourt AA, Jenkins AE. 1946. A verrugose da mangueira. Arquivos do Instituto Biolégico, Sao
Paulo 17(13): 205-228.
Boehm EWA, Mugambi GK, Miller AN, Huhndorf SM, Marincowitz S, Spatafora JW, Schoch CL.
2009. A molecular phylogenetic reappraisal of the Hysteriaceae, Mytilinidiaceae and Gloniaceae
(Pleosporomycetidae, Dothideomycetes) with keys to world species Studies in Mycology 64: 49-
83. doi: 10.3114/sim.2009.64.03
Eriksson O. 1981. The families of bitunicate ascomycetes. Opera Botanica 60: 1-220.
Hanlin RT. 1989. Illustrated Genera of Ascomycetes. APS Press. the American Phytopathological
Society St. Paul. Minnesota.
Hawksworth DL, Kirk PM, Sutton BC, Pegler DN. 1995. Ainsworth & Bisby’s dictionary of the
fungi. 8% edn. CAB International. International Mycological Institute.
Héhnel FXR von. 1909. Fragmente zur Mykologie (VI. Mitteilung, Nr. 182 bis 288). Sitzungser. K.
Akad. Wiss. Math.-Naturwiss. K1. Abt. 1.118: 275-452.
Fic. 5 (left). Saccardinula guaranitica (holotype) a, c. Appearance of ascomata on the host surface
of leaf. 8. Drawing from herbarium specimen. D-E. Ascomata in lactic acid showing the two
different regions; the central region comprising dark brown radiating cells and the marginal parts
comprising lighter brown radiating cells. & Vertical section through ascoma. G-H. Asci in cotton
blue reagent. 1-J. Ascospores in cotton blue reagent.
Scale bars: c = 1mm, D = 100 um, E = 50 um, F = 100 um, G-J = 10 pm.
520 ... Li &al.
Johnston PR, Beever RE. 1994. Elsinoé dracophylli sp. nov. New Zealand Journal of Botany 32:
919+520.
Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Ainsworth & Bisby’s dictionary of the fungi. 9®
edn. CAB International, Wallingford, UK.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi.
10® edn. CAB International, Wallingford, UK.
Lumbsch HT, Huhndorf. SM. 2007. Outline of Ascomycota -2007. Myconet 13: 1-58.
Luttrell ES. 1973. Chapter 7. Loculoascomycetes. In: The Fungi, an advanced treatise, Vol. 4A. (eds.
C Ainsworth, FK Sparrow, AS Sussman). Academic Press, New York and London: 135-291.
Munro JM. 1988. Cane spot (Elsinoe veneta) in red raspberry: infection periods and fungicidal
control. Plant Pathology 37: 390-396.
Petrak F. 1953. Die Gattung Beelia Stev. et Ryan. Sydowia 7: 321-324.
Raciborski M. 1900. Parasitische. Algen und Pilze Java's. I. Theil. Staatsdruckerei. Batavia 39p.
Reynolds DR, Gilbert GS. 2005. Epfoliar fungi from Queensland, Australia. Australian Systematic
Botany 18: 265-289. doi: 10.1071/SB04030
Ridley GS, Ramsfield TD. 2006 [“2005”]. Elsinoe takoropuku sp.nov. infects twigs of Pittosporum
tenuifolium in New Zealand. Mycologia 97: 1362-1364. doi: 10.38520/mycologia.97.6.1362
PMid:16722226
Saccardo PA, Trotter A. 1913. Supplementum Universale Pars IX. Sylloge Fungorum 22: 1--1612.
Schoch CL, Shoemaker RA, Seifert KA, Hambleton S, Spatafora JW, Crous PW. 2006. A multigene
phylogeny of the Dothideomycetes using four nuclear loci. Mycologia 98: 1041-1052.
Schoch CL, Crous PW, Groenewald JZ, Boehm EWA, Burgess TI, de Gruyter J, de Hoog GS, Dixon
LJ, Grube M, Gueidan C, Harada Y, Hatakeyama S, Hirayama K, Hosoya T, Huhndorf SM,
Hyde KD, Jones EBG, Kohlmeyer J, Kruys A, Li YM, Licking R, Lumbsch HT, Marvanova L,
Mbatchou JS, Mc Vay AH, Miller AN, Mugambi GK, Muggia L, Nelsen MP, Nelson P, Owensby
CA, Phillips AJL, Phongpaichit S, Pointing SB, Pujade-Renaud V, Raja HA, Rivas Plata E,
Robbertse B, Ruibal C, Sakayaroj J, Sano T, Selbmann L, Shearer CA, Shirouzu T, Slippers
B, Suetrong S, Tanaka K, Volkmamm-Kohlmeyer B, Wingfield MJ, Wood AR, Woudenberg
JHC, Yonezawa H, Zhang Y, Spatafora JW. 2009. A class—-wide phylogenetic assessment of
Dothideomycetes. Studies in Mycology 64: 1-15. doi: 10.3114/sim.2009.64.01
Sivanesan A. 1984. The bitunicate Ascomycetes and their anamorphs.
Spegazzini CL. 1885. Fungi guaranitici. Pugillus I. Anales de la Sociedad cientifica argentina 19(6):
241-265.
Spegazzini CL. 1908. Fungi aliquo paulistani. Revista del Museo de la Plata 15(2): 7-48.
Stevens FL. 1925. Hawaiian fungi. Bulletin of the Bernice P. Bishop Museum 19: 1-189.
Swart L, Crous PW, Kang JC, Mchau GRA. Pascoe I, Palm ME. 2001. Differentiation of species of
Elsinoe associated with scab disease of Proteaceae based on morphology, symptomatology, and
ITS sequence phylogeny. Mycologia 93: 366-379. doi:10.2307/3761658
Timmer LW, Priest M, Broadbent P, Tan M.-K. 1996. Morphological and pathological
characterization of species of Elsinoé causing scab diseases of Citrus. Phytopathology 86:
1032-1038. doi:10.1094/Phyto-86-1032
Wu HX, Li YM, Chen H, Hyde KD. 2010. Studies on Microthyriaceae: some excluded genera.
Mycotaxon 113 :147-156. doi: 10.5248/113.147
Zhang Y, Fournier J, Pointing SB, Hyde KD. 2008. Are Melanomma pulvis—-pyrius and
Trematosphaeria pertusa congeneric? Fungal Diversity 33: 47-60.
Zhang Y, Wang HK, Fournier J, Crous PW, Jeewon R, Pointing SB, Hyde KD. 2009. Towards a
phylogenetic clarification of Lophiostoma/Massarina and morphologically similar genera in the
Pleosporales. Fungal Diversity 38: 225-251.
ISSN (print) 0093-4666 © 2011 Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 521-533 January-March 2011
DOT: 10.5248/111.521
BOOK REVIEWS AND NOTICES
ELsE C. VELLINGA, Book Review Editor*
861 Keeler Avenue, Berkeley CA 94708 U.S.A.
CORRESPONDENCE TO:
[email protected]
INTRODUCTION
Lichens, the genus Amanita, stereoid fungi, rust fungi, and a checklist for the
fungi in Japan are the focus for the book reviews presented here, just an average
anthology of today’s systematic literature. The need to inventory, classify and
describe is as great as ever, or even more pressing in light of the changes in
the environment that take place, and the books reviewed here fill, in their own
small ways, the existing knowledge hole.
This contribution concludes with a list of newly published books to be
included in upcoming BooK REVIEWS AND NOTICES.
ASCOMYCETES
Hypotrachyna (Parmeliaceae, lichenized fungi). By H.J. Sipman, J.A. Elix &
T.H Nash III. 2009. New York Botanical Garden Press, Bronx, New York, NY 10458-
5126, USA; <www.nybgpress.org>. Pp. 179, figs 83, tables 2. [FLORA NEOTROPICA
MonoGraPH 104] ISBN 978-0-89327-502-0. Price: US $ 48.
Works such as this form the backbone of biodiversity inventory and
conservation work. They are of particular importance where they are the
culmination of extensive study and field experience and deal with groups
for which there was previously no contemporary synthetic works in the
region concerned. The tropical American species of this genus of parmelioid
lichens had previously been studied by Hale (1975), who accepted 74 species.
However, from the work of Sipman and a growing band of lichenologists in the
region, it had become clear that there were numerous additional species to be
* Books for consideration for coverage in this column should be mailed to the Book Review Editor
at the address above. All unsigned entries are by the Book Review Editor.
522 ... Vellinga, BOOK REVIEW EDITOR
accommodated. This new monograph almost doubles the number of known
species to 140, of which 37 are new to science, at the same time relegating many
names to synonymy. Hypotrachyna is primarily a tropical genus, although a few
species are known in temperate regions where they tend to occur in somewhat
high-rainfall regions. The neotropics in particular are their centre of diversity,
and 85 of the species treated here are only known from that region.
‘The monograph follows the traditional pattern of an historical overview, a
discussion of morphological and anatomical characters, a rather full account
of the 109 lichen products detected, notes on ecology and biogeography, and a
key. The species are arranged alphabetically with full bibliographical and type
citations (almost all types having been studied by at least one of the authors) for
accepted names and synonyms, descriptions, references to illustrations, details
of chemical characters, a summary of the distribution, details of specimens
or selected specimens examined, and notes concentrating on separation from
other species. Distribution maps are provided in many cases, but the halftone
photographs are mainly of the types of newly described species or lectotypes.
Photographs of more species, especially if they could have been in colour,
would have been a valuable addition to facilitate the use of the monograph
by non-specialists who lack immediate access to the works containing the
listed illustrations. I was pleased to see that the Latin diagnoses were generally
restricted to 2-3 lines but sad that data on the new names had not been deposited
in MycoBank, and consequently reference numbers not included. For me, and
I suspect many potential users, the key, in addition to being presented in the
space-wasting indented and dated format used in other volumes of the series,
places too much emphasis on chemical characters. Is it reasonable to expect
users to have a UV-lamp and potassium hydroxide to hand to get beyond the
second couplet? There is still perhaps too much emphasis on chemical products
in the formulation of species concepts here, and I was disappointed to see the
“fertile species”/"asexual counterparts” concept perpetuated — in all such
supposed cases in macrolichens so far studied in detail by molecular methods
the relationships have proved to be unsound (Crespo & Pérez-Ortega 2009).
Following Hale, conidial characters are not considered taxonomically valuable
and seem not to have been studied in most species, but I was pleased to see
ascospore size differences featured in a few of the species separations — as with
conidia, ascospore characters are much-neglected in macrolichen systematics.
No molecular studies were undertaken in the course of this revision,
and it would have been of interest to know to what extent the more widely
distributed species, such as Hypotrachyna revoluta, are really intercontinental
as opposed to further instances of cryptic speciation as is proven frequent in
other “widespread” parmelioid lichens (Crespo & Lumbsch 2010). I suspect
MycotTaxon 115 Book Reviews ... 523
modifications of species concepts may become necessary in the future in
some cases, but that will be a task for the next generation of researchers who
can proceed from the base now created. Overall, however, this is a scholarly
landmark work on the genus, and one that has been painstakingly compiled
over many years by three of today’s most experienced lichenologists. It can be
unhesitatingly commended as an authoritative account of the current state of
knowledge of this important lichenized genus.
Crespo A, Lumbsch HT. 2010. Cryptic species in lichen-forming fungi. IMA Fungus
1: 167-170.
Crespo A, Pérez-Ortega S. 2009. Cryptic species and species pairs in lichens: a
discussion on the relationship between molecular phylogenies and morphological
characters. Anales del Jardin Botanico de Madrid 66 (S1): 71-81.
Hale ME. 1975. A revision of the lichen genus Hypotrachyna (Parmeliaceae) in
tropical America. Smithsonian Contributions to Botany 25: 1-73.
Davip L HAawKsworTH
Departamento de Biologia Vegetal H, Facultad de Farmacia, Universidad Complutense
de Madrid, Plaza Ramon y Cajal, Ciudad Universitaria, E-20840 Madrid, Spain
The lichen genus Rinodina (Ach.) Gray (Lecanoromycetidae, Physciaceae) in
North America, north of Mexico. By J.W. Sheard. 2010. National Research
Council of Canada, Ottawa, Ontario ON K1A OR6, Canada <pubs@nrcresearchpress.
com>. Pp. viii + 246, figs 182, tables 6. [MONOGRAPH PUBLISHING PROGRAM.] ISBN
978-0-660-19941-2. Price: US $ 89.95.
John Sheard has made the genus Rinodina the primary focus of his systematic
research since he completed his PhD on the British and European species in
1966; after he moved to the University of Saskatchewan in 1968 his attention was
immediately drawn to the North American species — on which he proceeded
to make contributions from time to time while accumulating information for
this work. Early retirement and appointment as an Emeritus Professor of the
University in 2000 has enabled him to bring this major work to fruition. Since
the work of Malme in 1902, ascospore structural differences have become the
fundamental criterion in the classification of the genus. The two developmental
ascospore types (Dirinaria-type, Physcia-type) yield no fewer than 13(-
14) spore types amongst the North American species. Various molecular
studies during the last decade have shown that the genus is paraphyletic (e.g.
Kaschik 2006) with foliose genera of the Physciaceae (e.g. Anaptychia, Physcia,
Physconia) nested within it. While not addressing this issue, Sheard does
reflect on the ancient origins of different groups within the genus in relation to
continental movements, suggesting that a calcicolous group well represented in
Colorado could date back to the Middle Triassic (240-230 Myr). Several other
524 ... Vellinga, BOOK REVIEW EDITOR
biogeographical hypotheses are also put forward for future testing, among
them molecular, and there are detailed discussions of regional diversity and
“floristic” elements that can be recognized within North America.
The introductory chapters include information on the 61 characters assessed
for each specimen studied in detail and recorded in a spreadsheet — a method
rarely used these days but routine during numerical (phenetic) analyses in the
1960s and 1970s. Especially important is the discussion of spore types, and the
illustrations make clear how important it is to observe developing as well as
mature (but not over-mature) ascospores when considering to which category
they should be assigned; here clearing in Melzer’s reagent is recommended for
material less than 2-3 years old. The numerous half-tone photographs in this
section and in the species accounts make these characters much clearer than
line drawings alone, as used in some other regional accounts of the genus. The
chemical products detected are summarized, but these are much less diverse
than in many other lichenized genera. The key is strictly dichotomous, but in
three categories arranged by substratum. In general this will work well, but as
Sheard notes substrate-switches can occur so some caution in their use would
be prudent. Spore types unavoidably feature strongly in the keys. Otherwise
the characters seem clear, although I would have preferred to see maximal and
minimal spore lengths rather than averages used in several couplets.
Species treatments are particularly detailed, especially with respect to
descriptions of anatomical features, and there are the expected notes on ecology,
distribution, and characterization. Lists of specimens examined and also in
many cases distribution maps are provided, the latter with records split into pre-
and post-1960 categories. In all, 96 species are recognized in North America,
of which five are newly described and ten had not previously been reported.
Of these, 36 are evidently endemic. At the same time, no fewer than 30 species,
including 13 first described from North America, are placed into synonymy.
In all cases detailed bibliographic and typification details are presented. Notes
are provided on some excluded species, including the lichenicolous “Rinodina”
insularis, which has Bacidia-type (not Lecanora-type) asci and which Sheard
considers to be best treated as “an aberrant Buellia” for the present. In fact, this
species has now been included in Endohyalina by Giralt et al. (2010), a work
which evidently came out while Sheard’s monograph was in press.
This meticulously produced monograph is a great tribute to Sheard’s almost
lifelong dedication to the genus and to his powers of critical observation. It
should be looked at by others contemplating monographs of crustose lichens
as a standard to aspire to. This revision is sure to remain the pivotal work on
species concepts in the genus for many years to come, even if the genus itself
is eventually divided as a consequence of more intensive molecular work and a
re-examination of generic concepts in the family. The work also has value as a
MycorTaxon 115 Book Reviews ... 525
complement to the several regional revisions of the genus produced in recent
decades (e.g. Mayrhofer & Poelt 1979, Mayrhofer 1984, Giralt 2001, Mayrhofer
& Moberg 2002, Kaschik 2006) and so merits use worldwide to. This is a job
extremely well done in the best taxonomic tradition!
Giralt M. 2001. The lichen genera Rinodina and Rinodinella (lichenized ascomycetes,
Physciaceae) in the Iberian Peninsula. Bibliotheca Lichenologica 79: 1-160.
Giralt M, van den Boom PPG, ElixJA. 2010. Endohyalina, the genus in the Physciaceae
to accommodate the species of the Rinodina ericina-group. Mycological Progress
9: 37-48.
Kaschik M. 2006. Taxonomic studies on saxicolous species of the genus Rinodina
(lichenized ascomycetes, Physciaceae) in the Southern Hemisphere with emphasis
in Australia and New Zealand. Bibliotheca Lichenologica 93: 1-162.
Mayrhofer H. 1984. Die saxicolen Arten der Flechtengattung Rinodina und
Rinodinella in der alten Welt. Journal of the Hattori Botanical Laboratory 55:
327-493.
Mayrhofer H, Moberg R. 2002. Rinodina. Nordic Lichen Flora 2: 41-69.
Mayrhofer H, Poelt J. 1979. Die saxicolen Arten der Flechtengattung Rinodina in
Europa. Bibliotheca Lichenologica 12: 1-186.
Davip L HAWKsworTH
Departamento de Biologia Vegetal H, Facultad de Farmacia, Universidad Complutense
de Madrid, Plaza Ramon y Cajal, Ciudad Universitaria, E-20840 Madrid, Spain
BASIDIOMYCETES
Quelques espéces nouvelles ou mal délimitées d’ Amanita de la sous-section
Vaginatinae. 1° complément a Amaniteae, Fungi Europaei 9. By P. Neville
+ &S. Poumarat. 2009. Fungi non delineati LI-LII. Edizioni Candusso, Via Ottone
Primo 90, 17021 Alassio SV, Italy. <
[email protected]>. Price € 26.00.
During the final illness of the late Professor Pierre Neville and after his death,
several friends and associates generously expended time and effort in the
production of this book. It represents their personal tribute to him, his life,
and his work. It also comprises the extant fragments of the work of Neville and
Poumarat on Amanita subsection Vaginatinae, which I understand to be section
Vaginatae in the sense of Corner and Bas (1962) as revised by Yang (1997). A
publication covering European taxa of Amanita [section Amanita] subsection
Amanitella and subsection Vaginatinae was proposed to follow the extensive
volume on the Amanitaceae [p.p.] of Europe written by Neville and Poumarat
(2004; reviewed in MycoTaxon 92: 474-484). Understandably, the present
volume has a much more restricted scope. It is significant that “Europe” is not
mentioned in the title of the present work. The materials on which the reported
results are based are almost exclusively from France, Italy, and Spain. I found
one collection each from Finland and Switzerland listed as revised material.
526 ... Vellinga, BOOK REVIEW EDITOR
For a book discussing taxa that first appeared in the works of Schaeffer and
Secretan, it is a shortcoming that no German, not to say Bavarian, material was
revised and that only one specimen from Switzerland was studied. As was the
case with the 2004 volume, the conspicuous lack of material from northern
and eastern Europe may raise questions about the accuracy of some species
concepts employed in this work as well as for some claims of novelty.
This work is divided into three parts of which the first two (“Introduction”
and “Matériel et méthodes”) are quite brief and refer the reader to the 2004
volume. The remainder of the work is dedicated to “Présentation des espéces,”
which is divided into four parts: (A.) “Amanita pini” (a slight modification
of the protolog of this taxon), (B.) “Espéces nouvelles” (C.) “Quelques
Vaginatinae déja décrites, liées a un hdte précis,” and (D.) “Les Amanites
cocardées européennes.” There are 26 line drawings of anatomical elements,
and thirty-six photographic plates in color were included at the end of the
book. Overly dark photographs and photographs that are off color were not
adjusted prior to publication. The book lacks an index, but does list the taxa
that are treated at greatest length in the table of contents. The authors do not
follow conventions for presenting their lists of material examined in a manner
organized by countries and by administrative subdivisions of those countries;
as a consequence, their information on material examined is very difficult to
read. The present work contains nine new names and one new combination
in Amanita. Six previously named taxa are treated with some detail. Three
names have lectotypes designated, and one name has a neotype designated.
The new taxa are proposed to be added to the 50 or so that the authors estimate
have been previously treated in Europe, based on certain keys authored by M.
Contu. These keys contain a significant number of infraspecific taxa and several
synonyms; hence, the species count in them is closer to 30.
The new species proposed herein (each listed with the country or countries
from which material examined was collected) are A. betulae (France), A.
coryli (France and Spain), A. fulvoides (France, Italy, and Spain), A. schaefferi
(a single locality in France), and A. subfuliginosa (a single Italian locality).
Amanita avellanea is the new combination at species rank. The authors’ A.
ochraceomaculata (which is extremely close to, if not identical with, A. fulva
as it is widely understood in northern Europe) is presented again without
comparison to any truly similar taxa. Among other previously described taxa
treated in part C are A. pachyvolvata and A. simulans. Amanita umbrinolutea
and A. battarrae are treated in part D.
The authors unfortunately follow the approach of the 2004 volume and
abandon both the use of logic and the treatment of complex and informative
morphological characters such as the detailed anatomy of the lamellae. In fact,
I was unable to find a species treatment in the book that mentions bilateral
MycotTaxon 115 Book Reviews ... 527
divergent lamella trama. Demonstrations of novelty are inadequate and
consider only European taxa that bear some macroscopic similarity with
a given proposed taxon. The authors take little advantage of, and make little
comparison to, extant expert literature. In one case, a modern revision of a
taxon that they treat at length (A. umbrinolutea) is included in their bibliography
but cited briefly with regard to a nomenclatural point and is ignored entirely
with regard to its taxonomic content — even though the authors’ description
differs significantly from that of the prior work. When a prior work treats more
characters than do the authors, the authors select from the prior work only the
information that may be placed in one-to-one comparison with components
of their own description and omit mention of the rest. From the work of Bas
in section Vaginatae they cite only his paper on species concepts (Bas 1977).
Sixteen years of relevant publications by Yang and his co-authors are ignored
entirely. In some critical cases, the authors make unjustified assumptions about
the meaning of the work of other amanitologists such as those just cited. For
example, the authors assume that because they have noted that the cells of the
subhymenium in many species of Amanita inflate to one degree or another as
the hymenium matures, that the researchers who describe the subhymenium
and characters of the subhymenium in the development of Amanita taxonomy
must be unaware of this fact and, hence, have been producing ill-informed,
wrong descriptions. As a consequence of the above-cited issues (among other
problems) the descriptions in the reviewed work are very difficult, if not
impossible, to compare with the descriptions that comprise the main body of
morphological study of the Amanitaceae over the last half century.
Spore data in this work cannot be understood by other workers [unless they
were to have access to the original complete sets of raw spore measurement data]
because, despite including the table from (Bas 1969) relating length/breadth
ratio (Q) ranges to qualitative terms for spore shape, the authors almost always
provide ranges for Q that include values less than 1.0. Hence, their average Q
values are meaningless.
Thorough type revisions will be necessary in order to give meaning to every
name proposed in this work. All type collections are retained in personal
herbaria, as was often the practice in the case of taxa treated in Neville and
Poumarat (2004). I have inquired of Prof. Poumarat concerning the location
of materials revised for the present work as well as the 2004 volume. He kindly
informed me that all the materials of Neville’s herbarium have now been
transferred to Prof. Poumarat’s herbarium, and he is considering where to
deposit them in the future. Great effort has been expended on assembling and
determining the material in the combined herbaria of Neville and Poumarat;
it will be important that the material be well preserved and to know where the
exsiccata can be found.
528 ... Vellinga, BOOK REVIEW EDITOR
The authors’ reasoning in attempting to replace the use of anatomy with
supposed single-tree-genus associations in the diagnoses of their species
is circular. It only means that someone other than the authors must do the
anatomical revision to support the species and create a sufficiently detailed
species concept so that hypotheses concerning plant association, for example,
can become meaningful.
Poor methodology and lack of anatomical character data lead to difficult
situations of which there is a prime example in this book. “Species A’ is defined
by a limited set of anatomical details and the fact that “species A” is associated
with a certain tree genus or genera, let’s call the associates collectively “T” It
happens that many examples of “species A’ have been collected over a number
of years around a single specimen belonging to the T group. It is assumed
that all the specimens (being macroscopically similar and, apparently, sharing
the limited set of microscopic characters used) are all one species. Moreover,
it is assumed without justification that all the basidiomes are produced by a
single mycelium. One set of the few available anatomical characters (spore
size and shape) varies considerably from one collection to another of “species
A? A chart is offered showing a distribution of the average length/width ratio
(the quantitative rendering of “shape”) that is far from a normal distribution
and strongly suggests to me the presence of more than one taxon in the set
of collections. Because the anatomical information has been intentionally
limited in favor of ecological association information and because of the cited
unjustified assumptions related to ecological association, the possibility that
multiple species may be involved is not considered.
This book is nomenclaturally significant. It also brings to light opinion and
information from some southern European publications that are not easily
accessible elsewhere. It should be in libraries for the use of those interested in
revising the taxa discussed and proposed in it.
Bas C. 1969. Morphology and subdivision of Amanita and a monograph of its section
Lepidella. Persoonia 5: 285-579.
Bas C. 1977 [“1976”]. Species concept in Amanita section Vaginatae in H. Clémengon
(ed). The species concept in Hymenomycetes. Bibliotheca Mycologica 61: 79-
103.
Corner EJH, Bas C. 1962. The genus Amanita in Singapore and Malaya. Persoonia
2: 241-304.
Neville P, Poumarat S. 2004. Amaniteae. 1. Fungi Europaei 9. Edizione Candusso.
Yang ZL. 1997. Die Amanita-Arten von Siidwestchina. Bibliotheca Mycologica 170: i-ii,
1-240.
RopuaM E. TuLLoss
P.O. Box 57, Roosevelt, NJ 08555-0057, USA
MycoTaxon 115 Book Reviews ... 529
Stereoid fungi of America. By L. Ryvarden, 2010. Synopsis Fungorum, P.O.Box
95, Blindern, 0314 Oslo, Norway. <
[email protected]>. Pp. 202, figs 65.
[SyNopsis FUNGORUM vol. 28] Price: NOK 280.
Stereum s.l. By A.L. Welden, 2010. New York Botanical Garden Press, Bronx, New
York, NY 10458-5126, USA; <www.nybgpress.org>. Pp. 79, figs. [FLORA NEOTROPICA
MonoGraPH 106] ISBN 0893275042. Price: $ 38.00.
In the previous installment of this journal’s BookREvVIEWs (MycoTAXon 114:
490), David Hawksworth, in noting the paucity of identification keys in a recent
collection of systematic revisions of Dothideomycetes, stated: “Mycologists with
access to superbly equipped and resourced molecular laboratories, supported
by skilled technicians, should not forget that they represent a privileged section
of the potential user-community of systematic works.” If strictly phylogenetic
studies lacking morphological information (noting that not all of the chapters
in the aforementioned collection fit this description) represent one end of a
“utility vs. phylogenetic purity” spectrum, the other must consist of studies that
eschew monophyly entirely to facilitate identification of superficially similar
taxa. Two recent treatments of stereoid fungi of the Americas inhabit the latter
niche.
In thinking of the stereoid fungi (Stereum s.1.), one may be reminded of
former U.S. Supreme Court Justice Potter Stewart’s famous statement about
pornography: “I know it when I see it”” Beyond this initial recognition, however,
the task of identification is considerably more complicated. The characters
uniting the stereoid fungi are quite general ones — effused-reflexed or pileate
basidiomata with a smooth or nearly smooth hymenophore and hyaline,
usually smooth, basidiospores — and further examination reveals a significant
amount of anatomical and micromorphological diversity. Given the dearth of
accessible sources for identification of stereoid fungi, a central starting point for
taxonomic navigation seems justified. The two volumes reviewed here provide
such resources, and in so doing take a decidedly non-phylogenetic approach: a
total of 37 genera representing 18 families and 6 orders (according to current
INDEX FUNGORUM taxonomy) are covered.
The volume by Arthur L. Welden (Tulane University, emeritus), the 106" in
the Flora Neotropica series of monographs, covers 13 stereoid genera having
species in the Neotropics. The author provides a detailed methods section
(including formulae for all macrochemical reagents employed in the study),
a discussion of the phylogenetic affinity of each genus, a synoptic definition
of Stereum s.l. (the author employs this definition with some skepticism, but
it is nonetheless welcome to the reader in defining the limits of the entity to
be discussed), a key to genera, keys to Neotropical species of Coralloderma,
Stereopsis, Cotylidia, Hydnopolyporus, Cymatoderma, Podoscypha, Cystostereum,
530 ... Vellinga, BOOK REVIEW EDITOR
Stereum, and Lopharia s.1., and descriptions of species. The volume is illustrated
by 13 line drawings and 6 distribution maps; the former generally include
macroscopic habit as well as micromorphological sketches. The section on
phylogenetic affinities includes an extended discussion of Cymatoderma and
Podoscypha (together accounting for just over half of the known Neotropical
Stereum s.1.), including detailed discussions of major characters and a
tabular species-level comparison of character state distributions. Taxonomic
novelties presented in this volume include 7 new combinations and one status
reassignment. This handsome and carefully prepared volume reflects a very
high level of scholarship, clearly drawn from both extensive fieldwork and a
thorough knowledge of the literature regarding stereoid fungi.
The volume by Leif Ryvarden (University of Oslo) is intended to be a
compilation of available information to aid in the identification of stereoid fungi
— especially in the Neotropics — rather than a monographic study, though
one new species and 2 new combinations are proposed. Thirty-six genera are
included. The larger number of genera compared to the Welden volume is a
function of broader geographic and taxonomic coverage (temperate as well as
tropical America, and taxa with ornamented and smooth spores, are included);
in other cases it is due to differences in delimitation of genera — for example,
Hjortstamiaand Porostereumare retained withinamore heterogeneous Lopharia,
Aleurocystis magnispora is treated in Stereum, and Cyphellostereum pusiolum is
treated within Cotylidia by Welden. ‘The text provides summary information for
each genus (original citation, brief descriptive synopsis, type species data, and
remarks) and descriptions of each of the treated species, and is accompanied
bya key to genera (albeit incomplete; see below), 22 keys to species, and 75 line
drawings of micromorphological features and in some cases basidiome habit.
Some of the illustrations are provided by the author; others are reprinted from
Corticiaceae of North Europe. There are several typographic errors, including
a misspelling of Licrostroma in the table of contents, discrepancy between
the number of included genera on the back cover (35) vs. table of contents
(36), and reprinted figures that retain internal references to additional figures
from the original text. The first printing lacked the second part (Key B) of the
key to genera, but this problem was corrected in later printings. Despite a few
such errors, this is an excellent volume that compiles an impressive amount of
information, and the identification tools and remarks presented here will prove
valuable to not only those mycologists working in the Americas but on stereoid
fungi in other parts of the world as well.
Both Welden and Ryvarden have opted to present polyphyletic assemblages
of taxa in hopes of providing mycologists in tropical America as well as
students and non-specialists with a central starting point from which to
identify a wide variety of these superficially similar fungi. While this approach
MycoTaxon 115 Book Reviews ... 531
is completely justified given the need for accessible, comprehensive, and up-to-
date taxonomic literature, its ability to provide a catalyst for further, detailed
scientific study of particular monophyletic subgroups is diminished by the lack
of a clear phylogenetic context. Welden’s discussion on “The interrelationships
of the genera of Stereum sl” bridges this gap to a large degree, but the
interested researcher will need to consult a wider variety of sources in order
to understand the broader evolutionary picture for these organisms. Assuming
that mycologists with access to molecular laboratory facilities also have access
to suitable electronic reference materials, and given the greater ability for
electronic databases such as INDEx FUNGORUM and MycoBANK to keep up
with rapidly changing systematic classifications compared to print sources, the
approach taken by both authors seems to be the right one. Both of the volumes
reviewed here will be valuable references for workers with an interest in further
sorting out taxonomic issues within the stereoid fungi and/or identifying
stereoid fungi in the Americas.
Topp W. OsMUNDSON
Berkeley Natural History Museums and
Department of Environmental Science, Policy, & Management,
University of California, Berkeley, CA, USA
Ferrugens: Diversidade de Uredinales do Parque Nacional do Itatiaia, Brasil.
By M. Salazar Yepes & A. Alves de Carvalho Junior. 2010. Technical Books
Eidtora, Rua Gongalves Dias, 89, 2° andar, Sala 208, Centro Rio de Janeiro RJ CEP
20.050-030, Brazil. <www.tbeditora.com.br>. Pp. 201, figs 36. ISBN: 978-85-61368-
18-0. Price: R$ 70.00.
The Parque Nacional do Itatiaia is the oldest national park in Brazil, and part
of the Atlantic forest, well known for its high biodiversity. It is in the provinces
of Rio de Janeiro and Minas Gerais, and covers the higher altitudes (above 500
m asl). This is the area where the two authors have inventoried the rust fungi.
Almost one third ofall the species known for Brazil so far (Hennen et al. 2005) is
present in the park, 171 species in total. The book starts with short introductions
to the park and its vegetation and to rust fungi, followed by the main part with
the descriptions of the species organized by host plant, Pteridophyta first, then
the Magnoliaphyta with all their families. Colour photos of infected plants
and microscope photos of spores and other important features illustrate the
fungi. As expected, the genus Puccinia is the most species rich with 81 species
(this excludes Uromyces with 26 species). The Asteraceae are the plant family
with the highest number of rust fungi. The book continues with a glossary, a
bibliography, an index to the rust species, and per plant species a list of rust
taxa. The different chapters are clearly colour coded on the pages, making it
very easy to find the different subjects.
532 ... Vellinga, BOOK REVIEW EDITOR
‘This is the first book of this kind that I have ever seen with colour illustrations
throughout. It is a well-executed, important contribution to the knowledge of
those fascinating plant pathogenic fungi. | would have loved to see more, and
bigger pictures of the infected plants, and family names as page headers, but
these are just two minor comments. Even though it is written in Portuguese,
the text and descriptions are quite accessible and understandable. All in all a
very nice, well-executed contribution to our knowledge of an important fungal
group.
Hennen JF, Figueiredo MB, de Carvalho AA Jr, Hennen PG, 2005. Catalogue of the
species of plant rust fungi (Uredinales) of Brazil. 490 pp. <www.jbrj.gov.br/>
CHECKLIST
List of fungi recorded in Japan. By Ken Katumoto. 2010. The Kanto Branch of the
Mycological Society of Japan. (Contact: Toru Okuda <
[email protected]>.)
North American distributor: Mycotaxon Ltd., P.O. Box 264, Ithaca, NY 14851-0264,
USA. <
[email protected]>. Pp. xv + 1177. Softcover ed. ISBN 978-4-87974-624-
5. Price (US) $130, postpaid. Hardcover ed. ISBN 978-4-87974-625-2. Price (US)
$220, postpaid. Canada and Mexico delivery add US$25 for postage.
Access to this monumental work is essential for any taxonomist who works with
collections from Japan. Itis indisputably the most comprehensive floristic listing
that I have ever encountered. 1067 pages are, throughout, in small typeface,
alphabetically listing all species by alphabetically ordered generic name, with
the most current familial placement shown for each taxon. The correct names
and authors are all provided with their places of publication in Roman typeface.
Locations of holotypes and isotypes are noted carefully. Anamorphs where
known are clearly identified, allowing quick cross-referencing. Teleomorphs
are similarly cross- referenced to their anamorph names. Nomina rejicienda
under the International Code of Botanical Nomenclature are clearly marked as
such. Even more important, all misapplications are shown as “sensu” a Japanese
author or authors, and crossed referenced to those names. Allin all, a goldmine
of information.
The volume weighs in at almost 4 1/2 pounds in paperback and over
5 pounds in hardcover, and may to some of us be worth its weight in gold.
Though few individuals will be willing to pay the price for a personal copy, the
serious taxonomists among us should do all they can to get their library to buy
a copy. Borrowing a copy on interlibrary loan is scarcely the solution when time
and time again you'll want to consult this.
With all its excellent features, this book has some drawbacks for the non-
Japanese reader. Host names are given by Japanese common name only, and
these in kanji. Common names in kanji are also applied to most accepted
MycoTaxon 115 Book Reviews ... 533
species for Japan. For non-kanji readers, the two indices to Japanese names
of fungi and Japanese names of hosts will prove useless. And, to my mind, the
most serious fault for the non-kanji reader is that later references to each species
are provided, but only non-Japanese journals have these references in Roman
typeface. All Japanese journal names, except for original publication of a name,
are strangely rendered only in kanji. One sees three, four, five or more kanji
characters followed by, for example, 26:65, 1975., leaving the non-Japanese
reader wondering which journal that is. I’m sure our Japanese colleagues will
be frequently emailed to translate such journal titles into Roman characters. |
have suggested to the publishers that they could add a helpful slip-in sheet with
the translations of the names of Japanese journals into Roman typeface.
RICHARD P. Kore
Plant Pathology Herbariumm, Cornell University, Ithaca, NY 14853, USA
Book ANNOUNCEMENTS
Atlas des Cortinaires Vol. 19. By A. Bidaud, P. Moénne-Loccoz, P. Reumaux et X.
Carteret. 2010. Sarl Editions FMDS, 2436 route de Brailles, 38510 Vézeronce-Curtin,
France. <
[email protected]>. Loose leafed in folder. Pp. 131, pl. 64.
Price around € 148.00.
Flora Slovenska Volume 10:2: Mycota (Huby), Ascomycota (Vreckatem huby).
Taphrinales: Protomycetaceae, Taphrinaceae. 2010. Edicia Flora Slovenska, Slovakia.
<www.elegenda.sk>. Pp. 184, pl. 6, figs. ISBN: 978-80-224-1096-0. Price € 11.00.
ISSN (print) 0093-4666 © 2011 Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 534-536 January-March 2011
DOI: 10.5248/111.534
Regional annotated mycobiotas new to www.mycotaxon.com
Mycortaxon is pleased to announce the addition of six new species distribution lists to our
“web-list” page at www.mycotaxon.com//resources/weblists.html, where over 70 checklist
PDFs are available for free download. The content and design of each list is the sole
responsibility of its authors and their three (or more) expert reviewers, after which those
meeting MycorTaxon’s scientific and nomenclatural criteria are accepted for posting. The
authors, titles, and abstracts of our most recently accepted web-lists are provided below.
CENTRAL AMERICA
Nicaragua
Delgado, Gregorio. Nicaraguan fungi: a checklist of hyphomycetes. 31 pp.
ApsTract— A checklist of hyphomycetes (anamorphic fungi) known from
Nicaragua is presented. A total of 194 taxa belonging to 70 genera are listed, including
25 determined only to generic level, 156 to specific level and 13 infraspecific taxa.
They were compiled from scattered records in the literature, the online databases of
the world’s major culture collections and fungal herbaria, and sporadic collections of
plant debris samples carried out in the departments of Managua and Leén in 2008.
14 saprobic genera, 19 species and one forma are recorded for the first time from
Nicaragua. A host and substrate index is also provided, including 99 host plants
belonging to 30 families and 16 host insects belonging to 4 orders. A brief approach
to the history of mycology in the country is presented.
Panama
Piepenbring, Meike, José Camarena, Dario Cruz, Ana Karina Gémez, Yuriza
Guerrero, Tina Antje Hofmann, Roland Kirschner, Mavis de Matas, Loraine
Perez, Délfida Rodriguez, José Ureta, Ivette Vargas & Carl Williams. New
records of fungi pathogenic on cultivated plants in Panama. 11 pp.
ApsTRACT— Knowledge about the geographical distribution of species of
plant pathogenic fungi is fundamental for epidemiology, decision making and
recommendations for their control. For many tropical countries like Panama,
however, checklists are still very incomplete. In the present publication, 20 species of
pathogenic fungi on cultivated plants are cited, with 13 of them and one hyperparasitic
fungus reported for the first time for Panama, mainly in the province of Chiriqui
in the western part of the country. Among these are several rarely reported species:
WEBLISTS NEW TO Mycotaxon ... 535
Asterinella puiggarii on Psidium guajava; Entyloma doebbeleri on Dahlia sp., which is
reported for the first time outside Costa Rica; Mycosphaerella agapanthi-umbellati on
Agapanthus sp., which is recorded for the first time for America; Passalora vanderystii
on Phaseolus vulgaris; and Ustilago affinis on Stenotaphrum secundatum.
SOUTH AMERICA
Brazil
Gumboski, Emerson Luiz & Sionara Eliasaro. Checklist of lichenized fungi of
Santa Catarina State (Brazil). 45 pp.
ABSTRACT— Based on the evaluation of available literature, a list of 355 lichenized
fungi species recorded from Santa Catarina State, Brazil is presented. These species
are distributed among 109 genera and 45 families. Parmeliaceae and Cladoniaceae are
the most diverse families with 69 and 41 species, respectively.
EUROPE
Greece
Polemis, Elias, Dimitris M. Dimou, Leonidas Pountzas, Dimitris Tzanoudakis &
Georgios I. Zervakis. Mycodiversity studies in selected ecosystems of
Greece: 5. Basidiomycetes associated with woods dominated by Castanea
sativa (Nafpactia Mts., central Greece). 16 pp.
ABSTRACT— Very scarce literature data are available on the macrofungi associated
with sweet chestnut trees (Castanea sativa, Fagaceae). We report here the results of
an inventory of basidiomycetes, which was undertaken in the region of Nafpactia
Mts., central Greece. The investigated area, with woods dominated by C. sativa, was
examined for the first time in respect to its mycodiversity. One hundred and four
species belonging in 54 genera were recorded. Fifteen species (Conocybe pseudocrispa,
Entoloma nitens, Lactarius glaucescens, Lichenomphalia velutina, Parasola schroeteri,
Pholiotina coprophila, Russula alutacea, R. azurea, R. pseudoaeruginea, R. pungens, R.
vitellina, Sarcodon glaucopus, Tomentella badia, T. fibrosa and Tubulicrinis sororius)
are reported for the first time from Greece. In addition, 33 species constitute new
habitats/hosts/substrates records.
Italy
Rizzi, Guido, Guido Incerti, Fabrizio Ginaldi, Danijela Kodnik, Serena Viglione
& Paolo Giordani. A contribution to the lichen flora of Sardinia. 27 pages.
AsstTracT— A contribution to the epilithic and epiphytic lichen flora of Sardinia
is presented. Seventy localities from both coastal and mountain areas of western
Sardinia have been investigated during four surveys from 2006 to 2008. In all, 390
taxa have been recorded. Three taxa are new to Italy (Allarthonia hypobela, Bacidia
biatorina, Catillaria subviridis); 25 taxa are new to Sardinia. Pannaria rubiginosa
and Melaspilea ochrothalamia were re-collected after one century. Distribution and
substrata are presented.
536 ... Mycotaxon 115
Mip-EAst
Turkey
Tufan-Cetin, Ozge & Hiiseyin Stimbiil. Lichens of the Képriilti Canyon National
Park in Turkey. 25 pp.
AssTRACT— ‘This is the first comprehensive survey on lichens of the Kopriilii Canyon
National Park. Totally 1266 lichen samples were collected during the field studies
between June 2006 and August 2008 in K6priilii Canyon National Park. 217 lichen
taxa which belong to 8 orders, 28 families and 76 genera were determined from the
research area. Of the determined lichens 203 taxa were recorded for the first time
in the national park. In addition 67 taxa are new records for Antalya and 7 taxa for
Turkey.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
Volume 115, pp. 537-539 January-March 2011
DOT: 10.5248/111.537
NOMENCLATURAL NOVELTIES AND TYPIFICATIONS
PROPOSED IN MYCOTAXON 115
Acaulospora soloidea Vaingankar & B.F. Rodrigues, p. 324
Anthracoidea blepharicarpae Denchev, T. Denchev & Kakish., p. 408
Anthracoidea dispalatae Denchev, T. Denchev & Kakish., p. 410
Aspicilia albosparsa (Werner) S.Y. Kondr. 2002 (lectotypified), p. 264
Aspicilia subfarinosa (J. Steiner) Senkard. & Sohrabi, p. 101
Asteromella nyssae (Cooke) Aa 2002 (lectotypified), p. 317
Calocera bambusicola Sheng H. Wu, p. 165
Chaetomium siamense Pornsuriya & Soytong, p. 21
Ciliochorella buxifoliae Alleg., Eliades & Aramb., p. 179
Coprinopsis neophlyctidospora Raut, Fukiharu & A. Suzuki, p. 230
Crepidotus flavus Capelari, p. 146
Crepidotus longicystidiatus Capelari, p. 150
Gloeocantharellus dingleyae (Segedin) Giachini, p. 187
Gloeocantharellus mamorensis (Singer) Giachini, p. 188
Gloeocantharellus novae-zelandiae (Segedin) Giachini, p. 188
Gloeocantharellus pallidus (Yasuda) Giachini, p. 188
Graphis elevativerrucosa Chitale, Makhija & B.O. Sharma, p. 470
Graphis maharashtrana Chitale, Makhija & B.O. Sharma, p. 472
Graphis panhalensis (Patw. & C.R. Kulk.) Chitale, Makhija & B.O. Sharma, p. 474
Hymenochaete acerosa S.H. He & Hai J. Li, p. 379
Hymenochaete megaspora S.H. He & Hai J. Li, p. 376
Hyphodiscus stereicola Raitv., Partel & K. Példmaa, p. 12
Hypogymnia irregularis McCune, p. 486
Koorchaloma scutiae Alleg., Eliades & Aramb., p. 176
Lecanora farinosa f. subopegraphoides Werner 1956 (lectotypified), p. 101
Lecanora subfarinosa J. Steiner 1921 (lectotypified), p. 101
Lyophyllum fuscobrunneum Dahncke, Contu & Vizzini, p. 66
Lyophyllum impudicum Dahncke, Contu & Vizzini, p. 68
538 ... MYCOTAXON 115
Marasmius galbinus T.H. Li & Chun Y. Deng, p. 496
Mortierellomycotina Kerst. Hoffm., K. Voigt & P.M. Kirk, p. 360
Mycosphaerella nyssicola (Cooke) EA. Wolf 1940 (lectotypified, epitypified), p. 315
Nephroma flavorhizinatum Q. Tian & H.Y. Wang, p. 282
Nohea delmarensis (Kohlm. & Volkm.-Kohlm.) Abdel-Wahab, p. 448
Nohea spinibarbata (J. Koch) Abdel-Wahab, p. 448
Ophiocordyceps laojunshanensis J.Y. Chen, Y.Q. Cao & D.R. Yang, p. 2
Paecilomyces wawuensis Jin He, J.C. Kang & B.X. Lei, p. 305
Paraconiothyrium babiogorense Budziszewska, p. 463
Parmotrema conidioarcuatum Marcelli, Benatti & Elix, p. 74
Parmotrema pycnidiocarpum Benatti, Marcelli & Elix, p. 77
Phaeoclavulina abietina (Pers.) Giachini, p. 189
Phaeoclavulina africana (R.H. Petersen) Giachini, p. 189
Phaeoclavulina angustata (Lév.) Giachini, p. 189
Phaeoclavulina apiahyna (Speg.) Giachini, p. 189
Phaeoclavulina argentea (R.H. Petersen) Giachini, p. 189
Phaeoclavulina articulotela (R.H. Petersen) Giachini, p. 190
Phaeoclavulina camellia (Corner) Giachini, p. 190
Phaeoclavulina campestris (K. Yokoy. & Sagara) Giachini, p. 190
Phaeoclavulina campoi (Speg.) Giachini, p. 190
Phaeoclavulina capucina (Pat.) Giachini, p. 190
Phaeoclavulina cervicornis (A.L. Sm.) Giachini, p. 190
Phaeoclavulina clavarioides (Schild) Giachini, p. 190
Phaeoclavulina cokeri (R.H. Petersen) Giachini, p. 190
Phaeoclavulina curta (Fr.) Giachini, p. 190
Phaeoclavulina cyanocephala (Berk. & M.A. Curtis) Giachini, p. 191
Phaeoclavulina decolor (Berk. & M.A. Curtis) Giachini, p. 191
Phaeoclavulina echinovirens (Corner, K.S. Thind & Dev) Giachini, p. 191
Phaeoclavulina eumorpha (P. Karst.) Giachini, p. 191
Phaeoclavulina flaccida (Fr.) Giachini, p. 192
Phaeoclavulina gigantea (Pat.) Giachini, p 193
Phaeoclavulina glauco-aromatica (R.H. Petersen) Giachini, p. 193
Phaeoclavulina grandis (Corner) Giachini, p. 193
Phaeoclavulina griseobrunnea (Singer) Giachini, p. 193
Phaeoclavulina guadelupensis (Pat.) Giachini, p. 193
Phaeoclavulina guyanensis (Pat.) Giachini, p. 193
Phaeoclavulina insignis (Pat.) Giachini, p. 193
Phaeoclavulina longicaulis (Peck) Giachini, p. 193
NOMENCLATURAL NOVELTIES & TYPIFICATIONS ...
Phaeoclavulina mutabilis (Schild & R.H. Petersen) Giachini, p. 194
Phaeoclavulina ochracea (Bres.) Giachini, p. 194
Phaeoclavulina pancaribbea (R.H. Petersen) Giachini, p.194
Phaeoclavulina quercus-ilicis (Schild) Giachini, p. 194
Phaeoclavulina retispora (Corner) Giachini, p. 194
Phaeoclavulina roellinii (Schild) Giachini, p. 194
Phaeoclavulina sikkimia (S.S. Rattan & Khurana) Giachini, p. 194
Phaeoclavulina subclaviformis (Berk.) Giachini, p. 195
Phaeoclavulina tropicalis (R.H. Petersen) Giachini, p. 195
Phaeoclavulina vinaceipes (Schild) Giachini, p. 195
Phaeoclavulina viridis (Pat.) Giachini, p. 195
Phaeoclavulina zealandica (R.H. Petersen) Giachini, p. 195
Phialophora microspora Y.M. Wu & TY. Zhang, p. 251
Phialophora nielamuensis Y.M. Wu & T-Y. Zhang, p. 253
Phlebiopsis mussooriensis Priyanka, Dhingra & N. Kaur, p. 255
Phyllactinia sebastianiae M.G. Cabrera & Vobis, p. 55
Phyllopsora catervisorediata G.K. Mishra, Upreti & Nayaka, p. 33
Phyllopsora corallina var. subglaucella G.K. Mishra, Upreti & Nayaka, p. 36
Phyllopsora himalayensis G.K. Mishra, Upreti & Nayaka, p. 38
Pilidiella crousii Rajeshkumar, S.K. Singh & Hepat, p. 158
Pilidiella macrospora (Aa) Crous & Van Niekerk, p. 161
Protoparmeliopsis klauskalbii (Sipman) Senkard., p. 288
Puccinia salihae Kirba& & Aime, p. 502
Pucciniastrum enkianthi Y.M. Liang & Kakish., p. 505
= Pucciniastrum hakkodaense Y.M. Liang & Kakish. 2005
non P hakkodense (S. Ito & Hirats. f.) Jorst. 1958
Pyxine jolyana Marcelli, Jungbluth & Kalb, p. 436
Septobasidium sichuanense S.Z. Chen & L. Guo, p. 481
Stachybotrys subreniformis Q.R. Li & Y.L. Jiang, p. 171
Stachybotrys thaxteri D.W. Li, p. 240
Strobilomyces annamiticus Pat. 1909 (lectotypified), p. 415
Tubakia seoraksanensis H.Y. Yun, p 371
Thozetella submersa E.R. Barbosa & Gusmao, p. 328
Turbinellus flabellatus (Berk.) Giachini, p. 196
Turbinellus fujisanensis (S. Imai) Giachini, p. 197
Turbinellus kauffmanii (A.H. Sm.) Giachini, p. 197
Turbinellus stereoides (Corner) Giachini, p.197
539