MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
VOLUME 122 OCTOBER-—DECEMBER 2012
Humicola chlamydospora sp. nov.
(Wu & Zhang— Fie. 1, p. 172)
YUE-MING WU, artist
ISSN (PRINT) 0093-4666 http://dx.doi.org/10.5248/122 ISSN (ONLINE) 2154-8889
MYXNAE 122: 1-494 (2012)
EDITORIAL ADVISORY BOARD
HENNING KNUDSEN (2008-2013), Chair
Copenhagen, Denmark
SEPPO HUHTINEN (2006-2012), Past Chair
Turku, Finland
WEN-YING ZHUANG (2003-2014)
Beijing, China
ScoTT A. REDHEAD (2010-2015)
Ottawa, Ontario, Canada
SABINE HUHNDORE (2011-2016)
Chicago, Illinois, U.S.A.
PETER BUCHANAN (2011-2017)
Auckland, New Zealand
Published by
MycoTaxon, LTD.
P.O. BOX 264, ITHACA, NY 14581-0264, USA
www.mycotaxon.com & www.ingentaconnect.com/content/mtax/mt
© Mycotaxon, LTp, 2012
MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
VOLUME 122
OCTOBER-—DECEMBER, 2012
EDITOR-IN-CHIEF
LORELEI L. NORVELL
Pacific Northwest Mycology Service
6720 NW Skyline Boulevard
Portland, Oregon 97229-1309 USA
NOMENCLATURE EDITOR
SHAUN R. PENNYCOOK
Manaaki Whenua Landcare Research
Auckland, New Zealand
BooK REVIEW EDITOR
ELSE C. VELLINGA
861 Keeler Avenue
Berkeley CA 94708 U.S.A.
CONSISTING OF I-XII + 494 PAGES INCLUDING FIGURES
ISSN 0093-4666 (PRINT) http://dx.doi.org/10.5248/122.cvr ISSN 2154-8889 (ONLINE)
© 2012. MycoTAxon, LTp.
IV ... MYCOTAXON 122
MYCOTAXON
VOLUME ONE HUNDRED TWENTY-TWO — TABLE OF CONTENTS
COVER SECTION
TEAL ep Resse ep Recah cae Wade yg de ERe tn age MR ee BOP ales 'y ota po Wet tbe viii
Ee VTOMVCT Stara rrtloy anes onc tor BMD ted Here ewe enEM eS PRD, ey 0 TED beg pm, BCE Telerik oly ete ix
SUDHTISSION-PTOCCUATCS. ori 0 bey cts Bb bes lem lec neay Sie fea e ame ee x
bay Oye SAAC od Oe LLC) pag RY ARG AP CIRO AO AIS ea Aan TAN I TR a xi
RESEARCH ARTICLES
Hypoxylon from China - 2: H. dengii sp. nov. and H. crocopeplum
new to China Hai-xia Ma, Larissa Vasilyeva & Yu Li
Corticioid basidiomycetes on the bark of living trees
from Porto Alegre, Brazil
César Luiz M. Rodriguest & Rosa T. Guerrerot
Hymenoscyphus pseudoalbidus, the correct name for Lambertella albida
reported from Japan Yan-Jie Zhao, Tsuyoshi Hosoya, Hans-Otto Baral,
Kentaro Hosaka & Makoto Kakishima
New records of Scleroderma (Sclerodermataceae, Agaricomycetes)
from Pakistan N. Yousaf, A.N. Khalid & A.R. Niazi
Aphyllophoroid fungi from Sonora, México 2. New records from
Sierra of Alamos-Rio Cuchujaqui Biosphere Reserve Ricardo Valenzuela,
Tania Raymundo, Cony Decock & Martin Esqueda
Passalora acrocomiae sp. nov. and Exosporium acrocomiae from
the palm Acrocomia aculeata in Puerto Rico Eduardo Guatimosim,
Henrique Jorge Pinto & Robert Weingart Barreto
A new Stigmella species associated with Lycium leaf spots
in northwestern China Yan Wang, Xiu-Rong Chen & Cheng-De Yang
Tuber sinoaestivum sp. nov, an edible truffle from southwestern China
Jie-Ping Zhang, Pei-Gui Liu & Juan Chen
Two new Ellisembia species from Hainan and Yunnan, China
Shou-Cai Ren, Jian Ma & Xiu-Guo Zhang
Lichenized and lichenicolous fungi new to Babia Gora National Park
(Poland, Western Carpathians) Pawel Czarnota & Michal Wegrzyn
Resupinate polypores from mixed ombrophilous forests in southern Brazil
25
43
51
61
69
73
83
89
Mauro C. Westphalen & Rosa Mara Borges da Silveira 111
Coltricia australica sp. nov. (Hymenochaetales, Basidiomycota)
from Australia Li-Wei Zhou & Leho Tedersoo 123
OCTOBER-—DECEMBER 2012... V
Four new rust taxa on Asteraceae from Central Alborz,
northern Iran Faezeh Aliabadi & Mehrdad Abbasi 129
Microfungi from Portugal: Minimelanolocus manifestus sp. nov.
and Vermiculariopsiella pediculata comb. nov.
Margarita Hernandez-Restrepo, Rafael FE Castafieda-Ruiz,
Josepa Gené, Josep Guarro, David W. Minter & Marc Stadler 135
Geastrum species of the La Rioja province, Argentina Francisco Kuhar,
Valeria Castiglia & Leandro Papinutti 145
Myxomycetes from China 16: Arcyodes incarnata and Licea retiformis
newly recorded for China Bo Zhang & Yu Li 157
Tuber microverrucosum and T. huizeanum — two new species with
reticulate ascospores from China Li Fan, Cheng-Lin Hou & Yu Li 161
Three new species of Humicola from the Qinghai-Tibet Plateau Area,
China Yue-Ming Wu & Tian-Yu Zhang 171
A new species of Calonectria causing leaf disease of water lily in China
Jun-Jie Xu, Shao-Yuan Qin, Yuan-Yuan Hao, Jun Ren,
Ping Tan, Ali H. Bahkali, Kevin D. Hyde & Yong Wang 177
Two species of Agaricus sect. Xanthodermatei from Thailand
Rui-Lin Zhao, Dennis E. Desjardin, Philippe Callac,
Luis A. Parra, Jacques Guinberteau, Kasem Soytong,
Samantha Karunarathna, Ying Zhang & Kevin D. Hyde 187
Hymenochaete in China. 4. H. parmastoi sp. nov. and H. ustulata
new to China Shuang-Hui He & Hai-Jiao Li 197
Phylogenetic systematics of the Gigasporales
Gladstone Alves da Silva, Leonor Costa Maia & Fritz Oehl 207
Pleurotus eryngii var. elaeoselini, first record from Romania
Vasilica Claudiu Chinan & Giuseppe Venturella 221
A new species of Hypoderma with periphysoids
Chun-Tao Zheng, Feng Zhou, Ke Li& Ying-Ren Lin 225
Yeast species from soil and fallen leaves new for the mycobiota of Israel
Dmytro M. Gotman, Solomon P. Wasser & Eviatar Nevo 231
A new record of the desert truffle Picoa lefebvrei in Saudi Arabia
Abdulhakim Bawadekji, Maria Letizia Gargano,
Alessandro Saitta & Giuseppe Venturella 243
Coccomyces hubeiensis, a new fungus of Rhytismatales from China
Meng-Shi Yang, Ying-Ren Lin, Lan Zhang & Xiao- Yan Wang 249
A microfungus from Costa Rica: Ticosynnema gen. nov.
Rafael F. Castafieda-Ruiz, Maria M. Granados, Melissa Mardones,
Marc Stadler, David W. Minter, Margarita Hernandez-Restrepo,
Josepa Gené & Josep Guarro 255
VI ... MYCOTAXON 122
First record of Amanita dunensis in Italy
Lorenzo Pecoraro & Dario Lunghini 261
A new species of Scopinella from Pampas grass in Argentina
Romina M. Sanchez, Lucrecia Giordano,
Freda E. Anderson & M. Virginia Bianchinotti 265
Development and morphology of Lysurus cruciatus
(Phallomycetidae, Phallaceae) - an addition to the Indian mycobiota
S. Abrar, S. Swapna & M. Krishnappa 271
New Anthracoidea, Tilletia, and Ustilago records for Turkey
Sanli Kabaktepe & Zeliha Bahcecioglu 283
A new species of Coccomyces (Rhytismatales, Ascomycota)
on Ilex elmerrilliana Shi-Juan Wang, Yan-Ping Tang,
Ke Li & Ying-Ren Lin 287
New Asian records and morphological variation in Fibrodontia brevidens
(Basidiomycota) Eugene Yurchenko & Sheng-Hua Wu 293
Caloplaca gyrophorica (lichenized Ascomycota), a new saxicolous
lichen species from India
Yogesh Joshi, T.A.M. Jagadeesh Ram & G.P. Sinha 303
Seven dark-fruiting lichens of Caloplaca from China
Guo-Li Zhou, Zun-Tian Zhao, Lei Lu,
De-Bao Tong, Min-Min Ma & Hai-Ying Wang 307
Boletus atlanticus sp. nov., a new species of section Luridi from
coastal dunes of NW Spain
Jaime B. Blanco-Dios & Guilhermina Marques 325
An efficient protocol for DNA extraction from Meliolales and
the description of Meliola centellae sp. nov. Danilo B. Pinho,
Andre |. Firmino, Walnir G. Ferreira Jr. & Olinto 1. Pereira 333
Tuber sinosphaerosporum sp. nov. from China
Li Fan, Jin-Zhong Cao & Yu Li 347
Terriera angularis sp. nov. on Illicium simonsii from China
Feng Zhou, Xiao-Yan Wang, Lan Zhang & Ying-Ren Lin 355
A new species of Mycena sect. Sacchariferae from the Iberian
cushion-shaped Genisteae Juan Carlos Zamora & Santiago Catala 361
Myxomycete history and taxonomy:
highlights from the past, present, and future Harold W. Keller 367
Synonymy of Suillus imitatus, the imitator of two species
within the S. caerulescens/ponderosus complex
Nhu H. Nguyen, Jennifer F. Kerekes,
Else C. Vellinga & Thomas D. Bruns 388
OCTOBER-DECEMBER 2012... VII
Phylogenetic relationships and the newly discovered sexual state of
Talaromyces flavovirens, comb. nov.
Cobus M. Visagie, Xavier Llimona, Jordi Vila,
Gerry Louis-Seize & Keith A. Seifert 399
Two interesting cantharelloids from Nan and Kanchanaburi Provinces,
Thailand Sunadda Yomyart, Roy Watling, Cherdchai Phosri,
Jittra Piapukiew & Prakitsin Sihanonth 413
Lichens newly recorded from the South Korean coast
Lu-Lu Zhang, Xin-Yu Wang, Zun-Tian Zhao & Jae-Seoun Hur 421
Polyporus submelanopus sp. nov. (Polyporales, Basidiomycota)
from Northwest China Hui-Jun Xue & Li-Wei Zhou 433
A new species of Clitopilus from southwestern China
Wang-Qiu Deng, Tai-Hui Li & Ya-Heng Shen 443
Arthrinium rasikravindrii sp. nov. from Norway
Shiv M. Singh, Lal S. Yadav, Paras N. Singh,
Rahul Hepat, Rahul Sharma & Sanjay K. Singh 449
New records of Ochrolechia and Placopsis from the
Hengduan Mountains, China Tong-li Gao & Qiang Ren 461
Nomenclatural notes on lichen genera Leucodecton and Myriotrema
(Graphidaceae) in India Santosh Joshi, Dalip K. Upreti & Biju Haridas 467
Three non-hairy species of Leptogium from China
Hua-Jie Liu, Jing Cao, Shuai Guan & Qing-Feng Wu 483
MYCOBIOTAS ONLINE
Checklist of the Argentine Agaricales 5. Agaricaceae
N. Niveiro & E. Alberté 491
NOMENCLATURE
Nomenclatural novelties proposed in volume 122 493
PUBLICATION DATE FOR VOLUME ONE HUNDRED TWENTY-ONE
MYCOTAXON for JuLY-SEPTEMBER, VOLUME 121 (I-x1I + 1-502)
was issued on January 8, 2013
vul ... MYCOTAXON 122
ERRATA FROM PREVIOUS VOLUMES
VOLUME 121
p. V, line 19
p. vu, line 15
p-3, table footnotes
p.5, footnote line 2
p.7, Fic. 1 legend, line 3
p.10, line 2"¢ from bottom
p.17, line 26
p.199, line 3
p.233, lines 21 & 33
p-238, line 4
p-268, line 6
p. 394, line 16
p-409, line 9
: Ling-ming He,
: nephrosteranic
FOR: hymenodermioid
For: Alnus incana
: LING-MING HE,
: Henkel et al. 2011
FOR: (Smith et al. 2011)).
FOR: Leucoagaricus cretaceus
FOR: recognized seven genera
FOR: columbiana
READ:
READ:
READ:
READ:
READ:
READ:
READ:
READ:
READ:
READ:
READ:
READ:
READ:
Ling-min He,
nephrosterinic
basidiomata
hymenodermoid
section).
Alnus incana
IB19980446
LING-MIN HE,
Henkel et al. 2012
(Smith et al. 2011).
Leucocoprinus cretaceus
recognized eight genera
colombiana
OCTOBER-DECEMBER 2012... IX
REVIEWERS — VOLUME ONE HUNDRED TWENTY-TWO
The Editors express their appreciation to the following individuals who have,
prior to acceptance for publication, reviewed one or more of the papers
prepared for this volume.
Vagn Alstrup
Vladimir Antonin
André Aptroot
Arne Aronsen
Boris Assyov
Juliano M. Baltazar
Timothy J. Baroni
Scott T. Bates
Peter Buchanan
Gregory Bonito
Dimitar Bojantchev
Uwe Braun
Mehmet Candan
Rafael F. Castafieda Ruiz
Vagner Gularte Cortez
Bao-Kai Cui
Cvetomir M. Denchev
Maria Martha Dios
Pradeep K. Divakar
Uno H. Eliasson
Sydney Everhart
Genevieve M. Gates
Zai-Wei Ge
Sergio P. Gorjon
Ying-Lan Guo
Shou- Yu Guo
Anna Guttova
Laura Guzman-Davalos
Ian Robert Hall
Shuang-Hui He
Antonio Hernandez-
Gutiérrez
Ottmar Holdenrieder
Virupakshagouda
Hosagoudar
Kentaro Hosaka
Jae-Seoun Hur
Bryce Kendrick
Sergey Kondratyuk
Martin Kukwa
Deepika Kumari
Richard P. Korf
De-Wei Li
Taihui Li
Xiao- Yong Liu
Laszlo Lék6s
Clarice Loguercio-Leite
Guozhong Lit
Maria P. Martin
Eric H.C. McKenzie
David W. Minter
Gabriel Moreno
Maria Alice Neves
Lorelei L. Norvell
Silvano Onofri
Beatriz Ortiz-Santana
Shaun R. Pennycook
Stephen W. Peterson
Orlando F. Popoff
Relf L. Price
Mario Rajchenberg
Eimy Rivas Plata
Giovanni Robich
Amy Y. Rossman
Rob Samson
Conrad Schoch
Dartanha J. Soares
Viacheslav Spirin
Larissa Trierveiler-Pereira
Andriy Sibirny
Ewald Sieverding
Kotzue Sotome
Alberto M. Stchigel
Giuseppe Venturella
Annemieke Verbeken
Paul A. Volz
John Walker
Xiang-Hua Wang
Felipe Wartchow
A.J.S. Whalley
Zhu-Liang Yang
Ming Ye
Bayram Yildiz
Hai-Sheng Yuan
Alessandra Zambonelli
Georgios I. Zervakis
Xiu-Guo Zhang
Zun-Tian Zhao
x ... MYCOTAXON 122
FOUR EASY STEPS TO SUCCESSFUL MYCOTAXON PUBLICATION IN 2013
Prospective Mycoraxon authors should download instructions PDF, review and
submission forms, and other helpful templates by clicking the ‘file download page’ link
on our INSTRUCTIONS TO AUTHORS page before preparing their manuscript. Below is a
summary of our “4-step’ publication process.
1—PEER REVIEW: Email formatted text and illustration files with a2013 MycoTaxon
Reviewer Comments Form to 2-3 experts for peer review. Authors should (i) ask
peer reviewers to return revisions and comment forms to BOTH authors and Editor-
in-Chief <
[email protected]> and (ii) revise the files according to reviewer
suggestions before sending text files to the Nomenclature Editor for nomenclatural
review.
2—NOMENCLATURAL REVIEW: Email text files (wiTH tables & captions but No
artwork) to the Nomenclature Editor <
[email protected]>
for accession and pre-submission review. The Email message MUST include
‘Mycotaxon’ on the subject line AND all peer reviewer names+Email addresses in
the message. The Nomenclature Editor will assign accession numbers and return
annotated files with a list of needed corrections to the authors and Editor-in-Chief.
3—FINAL SUBMISSION: After again consulting experts and revising manuscripts as
needed, send the (i) completed 2013 MycoTaxon submission form; (ii) separate
text files for main text, tables, and legends; and (iii) art files to the Editor-in-Chief
<
[email protected]>. Only text and image files prepared for immediate
publication should be sent at this time. The Editor-in-Chief usually acknowledges
manuscripts and thanks expert reviewers within two weeks, but please wait at
least 14 days before sending a follow-up query (without attachments); this helps
us keep Email traffic to a minimum during Mycotaxon publication deadlines or
temporary closures of the editorial office.
4—FINAL EDITORIAL REVIEW & PRESS PREPARATION: Files not ready for publication
will be rejected or returned to authors for further revision; the Editor-in-Chief gives
tentatvely approved manuscripts a final grammatical and scientific review before
converting all files into publishable format. The PDF proof, bibliographic citation,
and nomenclatural entries are sent to all coauthors for final inspection prior to
publication. After PDF conversion, the Editor-in-Chief corrects only processing or
editorial errors prior to publication, but corrections of author errors are listed in
the Errata of a subsequent volume for no charge. If authors have selected the open
access option, they are asked to arrange payment of page charges with the Business
Manager <
[email protected]> at this time.
MyYcoTAXxON LTD— www.mycotaxon.com
The Mycotaxon Webmaster <
[email protected]> posts general and
subscription information, important announcements, and author forms and templates
on the official MycoTaxon site, which also hosts the regional mycobiota webpage for
free download of distributional annotated species lists.
MYCOTAXON ONLINE— www.ingentaconnect.com/content/mtax/mt
Mycotaxon publishes four 500-page volumes a year. Both open access and
subscription articles are offered.
OCTOBER-DECEMBER 2012... XI
FROM THE EDITOR-IN-CHIEF
MycoTaxon 122 — Closing our ‘book’ on 2012, the October-December
volume proposes one new genus (Ticosynnema) from Costa Rica and names
species new to science representing Agaricus from Thailand; Arthrinium from
Norway; Boletus, Minimelanolocus, and Mycena from Portugal and Spain,
Calonectria, Clitopilus, Coccomyces, Ellisembia, Humicola, Hymenochaete,
Hypoderma, Hypoxylon, Polyporus, Stigmella, Terriera, and Tuber from China;
Caloplaca from India; Coltricia from Australia; Dendrothele and Meliola from
Brazil; Minimelanolocus from Portugal; Passalora from Puerto Rico; Puccinia
from Iran; and Scopinella from Argentina.
In addition to range extensions of previously named taxa, we also offer
regional monographs (most with keys) on Corticiaceae on living bark
(posthumously published by Rodrigues and Guerrero) and resupinate
polypores in Brazil, Geastrum in Argentina, Leptogium in China, Leucodecton
and Myriotrema in India, and Scleroderma in Pakistan.
One papers multigene phylogenies support a recent morphologically
based reclassification of the Gigasporales. Another explores phylogeny and a
newly discovered sexual state for Talaromyces flavovirens comb. nov. while a
third examines development in Lysurus from egg to fully hatched and a fourth
provides a fascinating review of myxomycetes from fossil to Eppendorf tube.
A special thanks to four UC Berkeley authors who have solved a mystery
that has puzzled this editor for over 30 years: how does one differentiate two
Suillus imitatus varieties, Suillus caerulescens, and S. ponderosus in the field?
Placing the two varieties into synonymy with an explanation of how one might
separate S. caerulescens from S. ponderosus without recourse to DNA work is a
restful and much appreciated outcome indeed!
MyYcoTAXON 123 — Weare pleased to report that the first 2013 volume should
be only slightly delayed. Revisions of final submissions for the next volume will
begin in a few days, and we hope — somewhat optimistically — to publish the
January-March volume in April.
Warm regards,
Lorelei Norvell (Editor-in-Chief)
26 February 2013
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.1
Volume 122, pp. 1-5 October-December 2012
Hypoxylon from China - 2: H. dengii sp. nov.
and H. crocopeplum new to China
Hali-x1A MA’”’, LARISSA VASILYEVA? & Yu LI**
' Institute of Tropical Bioscience and Biotechnology,
Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China
? Institute of Mycology, Jilin Agricultural University, Changchun 130118, China
> Institute of Biology & Soil Science, Far East Branch of the Russian Academy of Sciences,
Vladivostok 690022, Russia
* CORRESPONDENCE TO:
[email protected]
ABSTRACT—Hypoxylon dengii (Xylariales, Xylariaceae) is described from China as a new
species, and H. crocopeplum is reported for the first time from the Chinese Mainland. The
morphological descriptions and photographs of stromata and microstructures are provided
based on the Chinese collections.
KEY worDs—Ascomycota, pyrenomycetous fungi, taxonomy
Introduction
The members of the genus Hypoxylon are important components of forest
ecosystems, where they grow on wood and decompose woody structures
(Merrill et al. 1964, Rajagopalan 1966, Rogers 1979, Sutherland & Crawford
1981, Whalley 1985, Chapela & Boddy 1988, Wei et al. 1992). Publications
dealing with descriptions and illustrations of Hypoxylon species from China are
scanty (Teng 1963, Tai 1979, Abe & Liu 1995). A further study of this genus has
yielded one species new to science and another new to the Chinese Mainland.
Illustrated descriptions of these two species are provided in this paper.
Materials & methods
The studied specimens are deposited at the Herbarium of Mycology of Jilin
Agricultural University (HMJAU). Microscopic features and measurements were made
from slide preparations mounted in water, 10% KOH, and Melzer’s iodine reagent. The
photographs of asci, ascal apical ring, and ascospores were taken by using a VHX-600E
microscope of the Keyence Corporation. The photographs of stromatal surface were
taken with a ZSA30w microscope and S70 Canon camera. External stromatal colors
were recorded and coded according to Rayner (1970). The methods of collecting,
preservation, and identification of the examined specimens follow Ju & Rogers (1996).
2... Ma, Vasilyeva & Li
Pi. 1 Hypoxylon dengii: a. Stromata; b. Stromatal surface; c. Ascospores;
d. Asci. Scale bars: a = 0.5 mm, b = 0.2 mm, c = 15 um, d = 20 um.
Taxonomy
Hypoxylon dengii H.X. Ma, Lar.N. Vassiljeva & Yu Li, sp. nov. PL..1,
MycoBank MB 563782
Differs from Hypoxylon jecorinum by its larger ascospores and straight germ slit and
from H. crocopeplum by its usually indehiscent perispore, smaller ascospores, and
straight germ slit.
Type: China, Guangdong Province, Chebaling Nature Reserve, on the bark of a fallen
branch, 26 June 2010, He S.-H. (Holotype, HMJAU 22432).
Erymo ocy: The species is named in honor of Prof. Shu-Qun Deng, the first Chinese
mycologist, who reported Hypoxylon from China.
STROMATA effused-pulvinate, plane, with conspicuous perithecial mounds,
0.5-1 mm thick; surface yellow brown to rust, orange granules immediately
beneath surface and between perithecia, with KOH-extractable pigments
orange to scarlet; the tissue below the perithecial layer black, inconspicuous.
Perithecia ovoid to short tubular, 0.1-0.3 x 0.2-0.6 mm; ostioles lower than the
stromatal surface. Asci 65-80 x 5.5-7 um long in the spore-bearing portions,
the stipes 28.5-58.5 um long, with apical ring bluing in Melzer’s iodine reagent,
discoid, 0.5-1 um high x 1-1.5 um broad. Ascospores brown to dark brown,
unicellular, ellipsoid-inequilateral, with narrowly to broadly rounded ends,
(10-)10.5-11.5(-12.5) x 5-6.5 um, with straight germ slit slightly less than
spore length; perispore infrequently dehiscent in 10% KOH.
ADDITIONAL SPECIMEN EXAMINED: CHINA, YUNNAN PROVINCE, Kunming, on the
bark of a fallen branch, 2 September 2010, Ma H.-X. (HMJAU 22624).
Hypoxylon dengii sp. nov. (China) ... 3
ComMENTs — Hypoxylon dengii differs from H. jecorinum Berk. & Ravenel,
which has smaller ascospores (8-9.5 x 4-5 um) and a straight or slightly
sigmoid germ slit Ju & Rogers 1996).
Another similar species, H. crocopeplum, is distinguished by the dehiscence
of almost every ascospore in 10% KOH, a larger ascospore size (see below), and
a straight or slightly sigmoid germ slit.
In stromatal morphology and KOH-extractable pigments, H. dengii is also
resembles H. subcrocopeplum Y.M. Ju & J.D. Rogers, which has longer narrower
spores (11-15 x 4.5-5.5 um) and an indehiscent perispore (Ju & Rogers
1996).
Hypoxylon crocopeplum Berk. & M.A. Curtis, Grevillea 4: 49. 1875. Pi. 2
STROMATA effused-pulvinate, plane, with conspicuous perithecial mounds,
0.4-2.5 cm long x 0.2-1.5 cm broad x 0.5-1 mm thick; surface yellow brown to
rust, orange-red granules immediately beneath surface and between perithecia,
with orange KOH-extractable pigments; the tissue below the perithecial layer
black, inconspicuous. Perithecia ovoid, 0.1-0.3 x 0.2-0.5 mm; ostioles lower
than the stromatal surface. Asci 77-95 x 8-10 um long in the spore-bearing
parts, the stipes 55-70 um long, with apical ring bluing in Melzer’s iodine
reagent, discoid, 0.5-0.8 um high x 0.8-1.5 um broad. Ascospores brown to
dark brown, unicellular, ellipsoid-inequilateral, with broadly rounded ends,
(11.5-)12-14(-14.5) x 6-7.5 um, with straight or sigmoid germ slit spore-
length; perispore dehiscent in 10% KOH.
BAY Coa\\Y f
RSA ay WE c d
‘ \
ye x
+ Note
SS 5 ~
=~ Lee
- = as!
LA
— Ra ~
Pi. 2 Hypoxylon crocopeplum: a. Stromata; b. Stromatal surface; c. Asci;
d. Ascospores. Scale bars: a= 4mm, b = 1 mm, c = 15 um, d= 10 um.
4 ... Ma, Vasilyeva & Li
SPECIMENS EXAMINED: CHINA, GUANGZHOU PROVINCE, Chebaling Nature Reserve,
on the bark of a fallen branch, 26 June 2010, Ma H.-X. (HMJAU 20215); YUNNAN
PROVINCE, Mengla County, on the bark of a fallen branch, 14 August 1994, Liu P.-G.
(HKAS 28660).
ComMENTs — Hypoxylon crocopeplum is widely distributed in the tropics and
subtropics and has been reported in many areas including Africa, Australia,
Brazil, India, Mexico, U.S.A, Thailand, and Taiwan. Our collections match the
eastern North American type in thin stromata with inconspicuous black basal
tissue and conspicuous perithecial mounds. Miller (1961) and Ju & Rogers
(1996) considered some H. crocopeplum specimens to have thicker stromata
with tubular to long tubular perithecia and a conspicuous black basal tissue
beneath the perithecial layer, while Hsieh et al. (2005) felt that such specimens
represented H. polyporoideum Berk. ex Cooke.
Hypoxylon crocopeplum somewhat resembles H. cinnabarinum (Henn.) Y.M.
Ju & J.D. Rogers in stromatal morphology and H. subcrocopeplum in stromatal
morphology and KOH-extractable pigments. However, H. cinnabarinum has
nearly equilateral ascospores and a perispore that is usually indehiscent in 10%
KOH (Ju & Rogers 1996), and H. subcrocopeplum ascospores are indehiscent.
Hypoxylon crocopeplum is also somewhat similar to H. jecorinum, which has
smaller ascospores 8-9.5(-11) x 4-5 um.
Acknowledgments
We greatly appreciate Dr. A.J. Whalley of Liverpool John Moores University and Dr.
Shuang-hui He of Institute of Microbiology, Beijing Forestry University for reviewing
presubmitted manuscript and giving helpful comments and suggestions. This study was
supported by the National Natural Science Foundation of China (grant no. 30770005)
and the Start-up Costs for Doctors in Institute of Tropical Bioscience and Biotechnology,
Chinese Academy of Tropical Agricultural Sciences. We are also grateful to Institute
of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural
Sciences for funding in the project entitled “The Project of the Basic Scientific Research
by the Central Public Welfare Institutes” We thank Dr. Pei-gui Liu (Kunming Institute
of Botany, Chinese Academy of Sciences) who collected the fungus. We also thank
Dr. Hua Peng and Dr. Li-song Wang (Kunming Institute of Botany, Chinese Academy of
Sciences), for loan of specimen.
Literature cited
Abe Y, Liu Z. 1995. An annotated list of xylariaceous and diatrypaceous fungi collected from Mt.
Fengyangshan and Mt. Baishanzu, Zhejiang Prov. in East China. Bull Nat Sci Mus Tokyo, Ser.
B. 21: 75-86.
Chapela IH., Boddy L. 1988. Fungal colonization of attached beech branches II. Spatial and
temporal organization of communities arising from latent invaders in bark and functional
sapwood, under different moisture regimes. New Phytologist 110: 47-57.
http://dx.doi.org/10.1111/j.1469-8137.1988.tb00236.x
Hypoxylon dengii sp. nov. (China) ... 5
Hsieh HM, Ju YM, Rogers JD. 2005. Molecular phylogeny of Hypoxylon and related genera.
Mycologia 97(4): 844-865. http://dx.doi.org/10.3852/mycologia.97.4.844
Ju YM, Rogers JD. 1996. A revision of the genus Hypoxylon. American Phytopathological Society
Press, St. Paul, Minnesota. 365 p.
Merrill W, French DW, Wood FA. 1964. Decay of wood by species of the Xylariaceae. Phytopathology
54: 56-58.
Miller JH. 1961. A monograph of the World Species of Hypoxylon. University of Georgia Press:
Athens, USA. 158 p.
Rajagopalan C. 1966. Studies on four species of wood rotting fungi. Transactions of the Kansas
Academy of Sciences 68: 541-552. http://dx.doi.org/10.2307/3627468
Rayner RW. 1970. A mycological color chart. Kew: Commonwealth Mycological Institute, 34 p. +
2 charts.
Rogers JD. 1979. The Xylariaceae: systematic, biological and evolutionary aspects. Mycologia
71: 1-42. http://dx.doi.org/10.2307/3759218
Sutherland JB, Crawford DL. 1981. Lignin and glucan degradation by species of Xylariaceae.
Transactions of the British Mycological Society 76: 335-337.
http://dx.doi.org/10.1016/s0007-1536(81)80159-3
Tai FL. 1979. Sylloge fungorum Sinicorum. Science Press, Peking. 1527 p.
Teng SQ. 1963. Fungi of China. Science Press, Peking. 808 p.
Wei DL, Chang SC, Wei YH, Lin YW, Chuang CL, Jong SC. 1992. Production of cellulolytic enzymes
from the Xylaria and Hypoxylon species of Xylariaceae. World Journal of Microbiology and
Biotechnology 8: 141-146. http://dx.doi.org/10.1007/BF01195834
Whalley AJS. 1985. The Xylariaceae: some ecological considerations. Sydowia 38: 369-382.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.7
Volume 122, pp. 7-23 October-December 2012
Corticioid basidiomycetes on the bark of living trees
from Porto Alegre, Brazil '
CESAR Lu1z M. RODRIGUEST & ROSA T. GUERREROTT
Programa de Pés-Graduacdo em Botanica, Departamento de Botanica,
Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil
* CORRESPONDENCE TO Vagner G. Cortez (
[email protected]),
Juliano M. Baltazar (
[email protected])
AxsstRact —'The species of Corticiaceae s.l. growing on the bark of living trees in the
Metropolitan Region of Porto Alegre, Rio Grande do Sul State, Brazil, were studied. Dendrothele
syspora is described as a new species, based on morphology and development of spores,
and the new combination Dendrodontia bispora is proposed. Five species of Dendrothele
and one of Xenosperma represent new records for Brazil. Descriptions, illustrations, and an
identification key are included.
Key worps — Aphyllophorales, new taxa, systematics, wood decay fungi
Introduction
Corticiaceae s.l. includes lignicolous fungi with many species producing
basidiomata that develop on dead branches or woody material lying on the
ground. However, it also includes species that develop on bark of living trees.
Corticioid species were first reported from Rio Grande do Sul State (Brazil) by
Rick (1959). Some of his materials were reviewed by Hjortstam & Ryvarden
(1982) and Rajchenberg (1987). Since then, only Maluf & Guerrero (1993),
Nietiedt & Guerrero (2000), and Sobestiansky (2005) have contributed
significantly to this mycota.
In this work we present and discuss species belonging to genera that occupy a
specialized habitat, i.e., the exposed bark of living trees: Dendrodontia Hjortstam
& Ryvarden, Dendrothele Hohn. & Litsch., and Xenosperma Oberw.
"From the PhD thesis by Rodrigues, who had almost completed this paper with Guerrero shortly
before his untimely death. t Deceased, 18 December 2008. ++Deceased 28 February 2012
*The paper presented here was prepared for publication by Vagner G. Cortez and Juliano M.
Baltazar.
8 ... Rodriguest & Guerrerot
Materials & methods
The species treated are part of a survey of Corticiaceae s.l. carried out in four hills
located within 60 km of one another. Except for Dendrodontia bispora, which was
collected in an urban park, all collections were gathered in native forests surrounding
Porto Alegre municipality (Rio Grande do Sul State, Brazil) during 2001-04. The
vegetation in the sampled areas consists of seasonal semi-deciduous forests with
10-20 m tall hygrophilous to mesophilous communities. Specimens, analyzed macro-
and microscopically following usual techniques, are deposited in the herbarium ICN
(Universidade do Rio Grande do Sul, Departamento de Botanica).
Taxonomy
Key to species of Corticiaceae s.|. on bark of living trees in the
Metropolitan Region of Porto Alegre, Rio Grande do Sul, Brazil
ately bial Sy Sten CUA ith 5 hn Reh Rae ie aR ao as Dendrodontia bispora
Ibsblyphal systemaMOnoniitic yf bosc-g dh octon dyes keg dr eaeteg dye zcheg Frese tr scbwdibnpboo dpe’ 2
Dai Veudia 1 EOSeUty . ots o 5 5 ole x p vkalbs cates y Setalicete Salalah Setting Selanne alates «lel lea 3
ZI Y SUV Aca SENN NREL RAPT al EN aia ole ok AAG sk AAR od CO ad SIM heer cach heect 4
SA OMMECIA CAM ALE 8 84 Ose R dhe Ee FARO! ABE! LS te Dendrothele capitulata
SU, Cystidia tUSHOLiN’s yg dit eddie eg dpe dd peered pacrdd Herd S hart Dendrothele alliacea
4a. Basidiospores asteriform, with 3 or more projections .................. 000 aes 5
AbSBaAsidto spOves-AULSCEN Te, ect ce aela ey Ree Bea ee hha Rc hor oR Raa he sO 6
5a. Dendrohyphidia present, hyphae 1.5-2 um diam. ....... Dendrothele asterospora
5b. Dendrohyphidia lacking, hyphae 2.0-3 um diam. ......... Xenosperma murrillii
6a. Basidiospores lageniforny 22 oe Fees nse tv mnie ee nate mene & Dendrothele syspora
6b. Basidiospores spherical or subspherical .......... 0... eee ee eee eee eee E
7a. Surface of basidiomata with projections ................ Dendrothele griseocana
7b: Suriace-of basidiomata: smooth «1... . 26.0 4s ta.sy eats sey bess oS aoe on ae PRG 8
84. Basidiospores >15: wim CaM soc. ss wee oe ease ots ced ots od ote Dendrothele mangiferae
Sb, Basidiospores:<15 yun darth, wi... oo. scieee + steeein + wtoee le «was Dendrothele incrustans
Descriptions
Dendrodontia bispora (Burds. & Nakasone) Guerrero & C.L.M. Rodrigues,
comb. nov. PLATE 1
MycoBank MB 564698
= Dendrothele bispora Burds. & Nakasone, Mycotaxon 17: 253, 1983.
= Brunneocorticium bisporum (Burds. & Nakasone) Nakasone, Botany 87: 879, 2009.
= Brunneocorticium pyriforme Sheng H. Wu, Mycologia 99: 306, 2007.
BASIDIOMATA effuse, forming confluent patches 4 x 1 cm, 50-100 um thick,
closely adnate; HYMENIAL SURFACE smooth; MARGIN abrupt, pubescent,
sometimes with a dark brown line along the edge.
Dendrothele syspora sp. nov. (Brazil) ... 9
}
6
ya
$1)
Opps
PLATE 1. Dendrodontia bispora.
A: generative hypha. B: skeletal hyphae. C: dendrohyphidia. D: young basidium.
E: mature basidia. F: basidiospores. Scale bar: 10 um.
HYPHAL SYSTEM dimitic; GENERATIVE HYPHAE thin-walled, 3-4 um in diam.,
finely encrusted, clamped; SKELETAL HYPHAE thick-walled, slightly brownish,
sometimes flexuous and branched. Cystip1a lacking; DENDROHYPHIDIA
branched, tortuous, 2-3 um in diam. Basrp1a clavate, 25-40 x 7-10 um, thin-
walled, clamped at base, with 2 sterigmata, 8-10 x 2-3 um; BASIDIOSPORES
ellipsoid to ovoid, smooth, thin-walled, sometimes with droplets, 13-16.5 x
6-8 um.
10 ... Rodriguest & Guerrerot
DISTRIBUTION — China, Guadeloupe, Mauritius, Réunion, Taiwan, USA
(Nakasone et al. 2009), and southern Brazil.
SPECIMENS EXAMINED — BRAZIL. R10 GRANDE DO SUL: Porto Alegre, Parque
Farroupilha, on Britoa guazumifolia (Myrtaceae), 03.XII.1992, leg. R.T. Guerrero (ICN
97664); 12.X.2001, leg. R.T. Guerrero (ICN 102781); 31.11.2004, leg. R.T. Guerrero
(ICN 102780).
REMARKS — Dendrodontia was described based on a dimitic hyphal system with
branched brownish skeletal hyphae and the presence of hyaline dendrohyphidia
as main features (Hjortstam & Ryvarden 1980). Burdsall & Nakasone (1983)
described Dendrothele bispora with a dimitic hyphal system, emphasizing its
brownish skeletal hyphae as unique in the genus.
In their study of Dendrothele, Boidin et al. (1996) suggested excluding
D. bispora from the genus based on its dimitic hyphal system and suggested
its placement in Dendrodontia. Recently, Nakasone et al. (2009) transferred
this species to Brunneocorticium Sheng H. Wu within the euagarics clade,
reducing B. pyriforme to synonymy. Larsson (2007) and Wu et al. (2007) placed
Dendrodontia in the polyporoid clade, but Wu et al. (2007) included only one
unidentified specimen of Dendrodontia in their analyses.
Considering that Dendrothele bispora does not agree in important features
with the concept of Dendrothele and that sequences of more specimens of
Dendrodontia spp. (particularly of the type species D. bicolor (P.H.B. Talbot)
Hjortstam & Ryvarden) are needed to assess the phylogenetic relationships
of that genus, we prefer to transfer the species to Dendrodontia based on
morphological evidence.
Dendrothele alliacea (Quél.) RA. Lemke, Persoonia 3: 366, 1965. PLATE 2
BASIDIOMATA resupinate, white to ochraceous, smooth, pruinose under the
lens, 120-150 um thick, in rounded patches less than 1 cm in diam., sometimes
confluent.
HYPHAL SYSTEM monomitic; GENERATIVE HYPHAE irregular, 1-3 um in
diam., straight, clamps somewhat difficult to see. LEPTOCYSTIDIA numerous,
fusiform 20-32 x 8-12 um, slightly thick-walled ca. 1 um thick, sometimes
bearing an apical filamentous appendix; DENDROHYPHIDIA slender 1-2 um
wide bearing short branches and covered by crystals. BAsip1A clavate, 37-42 x
6-7 um, tapering towards the base, clamps hardly visible, with four sterigmata,
4.5-7 um; BASIDIOSPORES ellipsoid, smooth, somewhat thick-walled, 9-13 x
5-7 um, sometimes with granular content, with distinct apiculus, IKI-.
DISTRIBUTION — Canada, South Africa, USA (Lemke 1964), Europe
(Bernicchia & Gorjon 2010), Russia (Ghobad-Nejhad 2011), Uruguay
(Hjortstam & Ryvarden 2007), and southern Brazil.
Dendrothele syspora sp. nov. (Brazil) ... 11
PLATE 2. Dendrothele alliacea.
A: generative hyphae. B: dendrohyphidia. C: leptocystidia. D: mature and immature basidia.
E: basidiospores. Scale bar: 10 um.
SPECIMENS EXAMINED — BRAZIL. R10 GRANDE DO SUL STATE: Guaiba, Morro Sao
Maximiano, 09.XII.2003, leg. C. Rodrigues 989 (ICN); Sapucaia do Sul, Morro Sapucaia,
18.X1I.2003, leg. C. Rodrigues 1018 (ICN).
REMARKS — Numerous fusiform leptocystidia are noticeable in this species.
They are also found in D. acerina (Pers.) P.A. Lemke, from which D. alliacea
differs by its ellipsoid spores. Our specimens have basidiospores that are a
bit smaller than those mentioned by Boidin et al. (1996) but similar to the
dimensions reported by Eriksson & Ryvarden (1975).
12 ... Rodriguest & Guerrerot
PLaTE 3. Dendrothele asterospora.
A: hyphae. B: young basidia. C: mature basidia. D: basidiospores. Scale bar: 10 um.
Dendrothele asterospora Boidin & Langq., Bull. Soc. Mycol. Fr. 112: 94, 1996.PLATE 3
BASIDIOMATA white to cream, in rounded patches ca. 0.5 cm wide, 40-50
um in vertical section, covered by crystals.
HyPHAL SYSTEM monomitic; GENERATIVE HYPHAE slender, tortuous,
1.5-2 um wide, clamps difficult to see. Cystrp1a lacking; DENDROHYPHIDIA
shortly branched. Basrp1a cylindric to urniform, 17-21 x 7-8 um, frequently
bearing a projection that extends as a hypha, with four sterigmata 6-7 um long;
BASIDIOSPORES asteriform with 5 tips, 10-16 um between the opposite tips,
thin-walled, IKI-.
DISTRIBUTION — Central African Republic, Réunion (Boidin et al. 1996, the
latter sub aff.), and southern Brazil.
SPECIMEN EXAMINED — BRAZIL: R10 GRANDE DO SUL STATE: Sapucaia do Sul, morro
Sapucaia, on Cabralea canjerana (Meliaceae), 17.1V.2003, leg. C. Rodrigues 755 (ICN).
Dendrothele syspora sp. nov. (Brazil) ... 13
REMARKS — ‘This species is similar to species of Xenosperma because of the
basidia with lateral projections that resemble pleurobasidia, and pluriapiculate
basidiospores, but the presence of dendrohyphidia, chalky consistency and
habit points towards its placement in Dendrothele. ‘This is the first report of
D. asterospora since its original description.
PiatE 4. Dendrothele capitulata.
A: hyphae. B: cystidia. C: basidia. D: basidiospores. Scale bar: 10 um.
Dendrothele capitulata Boidin & Langq., Bull. Soc. Mycol. Fr. 112: 99, 1996. PLATE 4
BASIDIOMATA white to pale salmon, in patches, isolated or confluent, with a
calcareous consistency, fragile and friable, often covered by cristals.
HYPHAL SYSTEM monomitic; GENERATIVE HYPHAE 2-3 um _ wide,
without clamps. Cystip1a lacking; DENDROHYPHIDIA irregularly branched;
LEPTOCYSTIDIA capitate, numerous, stem 3-4 um in diam. and spherical apex
7-9 um in diam. Basip1A utriform, 40-50 x 8-10 um, with four sterigmata,
14 ... Rodriguest & Guerrerot
7 um long; BASIDIOSPORES spherical, some subspherical, 8-12.5 um in diam.,
thick-walled, smooth, with a distinct apiculus, IKI-.
DISTRIBUTION — Guadeloupe and southern Brazil.
SPECIMENS EXAMINED — BRAZIL: R10 GRANDE DO SUL STATE: Guaiba, Morro Sao
Maximiano, on Luehea divaricata (Malvaceae), 30.1.2003, leg. C. Rodrigues 687 (ICN);
13.V.2003, leg. C. Rodrigues 783 (ICN).
REMARKS — This species is easily recognized by its large capitate cystidia and
spherical spores as described and illustrated by Boidin et al. (1996). This is the
second record since its original description.
Dendrothele griseocana (Bres.) Bourdot & Galzin, Bull. Soc. Mycol. Fr. 28: 354,
1913 [“1912”]. PLATE 5
BASIDIOMATA white to ochraceous, effuse, sterile papillae visible under the
lens, 40-60 um long and distant 100 um from each other.
|
ee a
ei fr
PLaTE 5. Dendrothele griseocana.
A: dendrohyphidia. B: basidia. C: basidiospores. Scale bar: 10 um.
Dendrothele syspora sp. nov. (Brazil) ... 15
HyYPHAL SYSTEM monomitic; GENERATIVE HYPHAE hardly observed, tortuous,
thin-walled, clamps difficult to see. Cystip1a lacking; DENDROHYPHIDIA
numerous, richly branched, covered by crystalline matter. Basip1A clavate
when young, 25-30 x 6-7 um with a medial constriction at maturity, with
2 sterigmata; BASIDIOSPORES ellipsoid to subspherical, smooth, slightly thick-
walled, 8.5-10 x 7-9 um, IKI-.
DISTRIBUTION — Canada, USA (Nakasone 2006), Europe (see Bernicchia
& Gorjon 2011), Mexico, Uruguay (Hjortstam & Ryvarden 2007), Russia
(Ghobad-Nejhad 2011), and southern Brazil.
SPECIMEN EXAMINED — BRAZIL. R10 GRANDE DO SUL: Guaiba, Morro Sao Maximiano,
09.XII.2003, leg. C. Rodrigues 1003 (ICN).
REMARKS — Dendrothele griseocana was traditionally considered to be a
variable species. However, Nakasone (2006) resolved this species complex
and characterized D. griseocana mainly by the presence of hyphal pegs, simple
septa, and basidia with 2 sterigmata, segregated from D. americana Nakasone
and D. tanzaniana Nakasone by their clamped generative hyphae and basidia
with 4 sterigmata.
Dendrothele griseocana was first reported for Rio Grande do Sul State by
Rick (1959).
Dendrothele incrustans (P.A. Lemke) P.A. Lemke, Persoonia 3: 366, 1965. PLATE 6
BASIDIOMATA white, formed by confluent patches 2-5 mm wide each,
50-100 um thick; adherent, with an indistinct margin.
HYPHAL SYSTEM monomitic; SUBICULUM densely crystalline; GENERATIVE
HYPHAE clamped, irregular and thin-walled, 1-2 um in diam. Cystipia lacking;
DENDROHYPHIDIA 1-3 um wide. Basip1A clavate to suburniform, slightly
swollen at the bases, 35-45 x 11-13 um, with four sterigmata 11-13 um long;
BASIDIOSPORES spherical, sometimes with guttulae, 9-12 um in diam., apiculus
often conspicuous, IKI-.
DISTRIBUTION — Argentina, Guadeloupe, (Hjortstam & Ryvarden 2007),
Canada, USA (Lemke 1964), Russia (Ghobad-Nejhad 2011), and southern
Brazil.
SPECIMENS EXAMINED — BRAZIL. R10 GRANDE DO SUL STATE: GUAIBA,
Morro SAO MAXIMIANO, ON MATAYBA ELAEAGNOIDES (SAPINDACEAE),
18.]II.2003, LEG. C. RODRIGUES 607 (ICN); 15.[X.2003, LEG. C.
RODRIGUES 882; 15.1X.2003, LEG. C. RODRIGUES 894 (ICN).
REMARKS — ‘The diagnostic features of D. incrustans are the lack of cystidia
and the large spherical basidiospores with prominent apiculi. Our specimens
have basidiospores slightly larger than the 8-11 um reported by Gilbertson &
Blackwell (1987) and basidia larger than 25-30 x 8-11 um as cited by Lemke
(1964).
16 ... Rodriguest & Guerrerot
PLATE 6. Dendrothele incrustans.
A: hypha. B: dendrohyphidium. C: basidia. D: basidiospores. Scale bar: 10 um.
Dendrothele mangiferae Boidin & Duhem, Bull. Soc. Mycol. Fr. 112: 106, 1996.
PLATE 7
BASIDIOMATA white, occurring in irregular, rounded, small patches ca. 1 cm,
80-170 um thick.
HYPHAL SYSTEM monomitic; GENERATIVE HYPHAE 2-3 um in diam.,
irregularly arranged, clamped. DENDROHYPHIDIA thin, 1-2 um wide, poorly
branched, tips resembling a cauliflower. Basip1a subcylindrical, containing
oil droplets, 110-130 x 18 um, with 45 um long sterigmata, 25-30 x 5-6 um,
immature basidia multilayered by repetition; BAstpIosPpoREs spherical to
subspherical 18-25 x 17-23 um, sometimes with oil droplets and a distinctive
apiculus, smooth in KOH and finely spiny in Melzer’s solution, IKI-.
Dendrothele syspora sp. nov. (Brazil) ... 17
PLatE 7. Dendrothele mangiferae.
A: hyphae. B: dendrohyphidia. C: young repetitive basidium. D: mature basidia.
E: basidiospores. Scale bars: 10 um.
DISTRIBUTION — Costa Rica (Gorjén 2012), Mauritius, Réunion (Boidin et
al. 1996), and Southern Brazil.
SPECIMEN EXAMINED — BRAZIL. R10 GRANDE DO SUL STATE: Guaiba, Morro Sao
Maximiano, on Cedrela fissilis (Meliaceae), 13.V.2003, leg. C. Rodrigues 791 (ICN).
REMARKS — Dendrothele mangiferae has the largest basidia and basidiospores
among the Dendrothele species discussed here. These features, which agree with
the description by Boidin et al. (1996), make it easy to identify. Since its original
description, D. mangiferae has been reported only from Costa Rica and now
from southern Brazil.
18 ... Rodriguest & Guerrerot
Dendrothele syspora C.L.M. Rodrigues & Guerrero, sp. nov. PLATE 8
MycoBank MB 564699
Speciei Dendrothele magninavicularis differt hyphae sine fibulae; dendrohyphida
cum projecturis spinulosis; 2 sterigmatigmatis bisporatis; sporae primo conjugatis, in
maturitatem secedentibunt.
TYPE: Brazil. Rio Grande do Sul State: Viamao, Parque Estadual de Itapua, Morro
da Grota, on Allophylus edulis (A. St.-Hil.) Niederl. (Sapindaceae), 27.X.2003, leg.
C. Rodrigues 924 (Holotype, ICN).
EryMo_osey: sy = pref. Gr., together, with, joined; spora = L., spore.
BASIDIOMATA in patches irregularly rounded, 3-7 mm wide, sometimes
confluent, white to pale ochraceous, 100-150 um in vertical section, texture
chalky, cracking; MARGIN indistinct, often thinning out, pruinose.
HYPHAL SYSTEM: monomitic; GENERATIVE HYPHAE 2-3 um in diam.,
simple-septate. Cystrp1a lacking; DENDROHYPHIDIA with the last branches
short and with spiny projections, 1.5-3 um in diam. Basrp1a: irregularly
cylindrical, 34-54 x 9-12 um, enlarged at the basis, slightly sinuous, somewhat
pinched at the middle, smooth, thin-walled, with 2 sterigmata 12-12 x 3-4
lum; BASIDIOSPORES navicular to lageniform, 17-24 x 7-8 um, with a median
constriction (4 x 5 um wide), straight or curved, rarely with 1 or 2 drops, often
none, smooth, thin-walled, apiculus in the broadest tip, IKI-.
DISTRIBUTION — Known from three localities in Rio Grande do Sul,
southern Brazil.
ADDITIONAL SPECIMENS EXAMINED — BRAZIL. R10 GRANDE DO SUL STATE: Guaiba,
Morro Sao Maximiano, on Ocotea puberula (Lauraceae), 09.XII.2003, leg. C. Rodrigues
998 (ICN); Sapucaia do Sul, Morro Sapucaia, 18.X1.2003, leg. C. Rodrigues 1015 (ICN);
leg. C. Rodrigues 1025 (ICN); leg. C. Rodrigues 1031 (ICN); Viamao, Parque Estadual
de Itapua, Morro da Grota, on Allophylus edulis, 11.V1.2004, leg. C. Rodrigues 1081
(ICN); leg. C. Rodrigues 1098 (ICN).
REMARKS — ‘This species presents the habit and substrate typical for
Dendrothele species. The spores are larger than any other known species with
median constriction in the genus (Nakasone & Burdsall 2011, Gorjén et al.
2011). Sterigmata and basidiospores, however, are rarely observed during their
development. At first, sterigmata are born separately, but as they elongate, the
tips grow toward each other and produce basidiospores that remain aligned
together along their length. The spores are released together and remain joined
for a short time before becoming separated. Basidiospore germination has not
been observed.
Dendrothele syspora seems to belong to a recently described group of species
with navicular basidiospores, including D. cymbiformis Nakasone & Burds.,
D. magninavicularis Nakasone & Burds., and D. navicularis Nakasone & Burds.
from New Zealand (Nakasone & Burdsall 2011) and D. latinavicularis Gorjon
from the Patagonian Andes forests of Argentina (Gorjon et al. 2011). Dendrothele
Dendrothele syspora sp. nov. (Brazil) ... 19
{ Me)
C
Pate 8. Dendrothele syspora.
A: hyphae. B: dendrohyphidia. C: basidia in different stages of development. D: basidiospores.
Scale bar: 10 um.
latinavicularis differs from D. syspora by the shorter and wider basidiospores,
which thus appear broadly navicular. Both D. cymbiformis and D. navicularis
have smaller basidiospores, while D. magninavicularis basidiospores are almost
the same size as those in D. syspora. Dendrohyphidia differ in these species:
they are hyphoid in D, cymbiformis and D. navicularis but have short branches
and spiny projections in D. magninavicularis and D. syspora. Dendrothele
syspora is unique in this group by having simple septate generative hyphae and
2-sterigmate basidia.
20 ... Rodriguest & Guerrerot
Species of this group were found on different hosts: D. latinavicularis was
always found in bark of living Saxegothaea conspicua Lindl., an endemic
southern South American conifer (Gorjén et al. 2011); D. cymbiformis
was reported from bark of living Dracophyllum scoparium Hook. f. and
D. magninavicularis from bark of living Melicytus ramiflorus J.R. Forst. &
G. Forst. [subsp. ramiflorus], both New Zealand endemic angiosperms. On the
other hand, both D. navicularis and D. syspora were found in bark of several
different living angiosperms native to their respective geographic regions.
ot
0A di
os oo
PLATE 9. Xenosperma murrillii.
A: hypha. B: basidia. C: basidiospores. Scale bar: 10 um.
Be
Xenosperma murrillii Gilb. & M. Blackw., Mycotaxon 28: 400, 1987. PLATE 9
BASIDIOMATA in patches 0.3-1.0 mm wide, sometimes confluent, white
to ochraceous, 70-150 um thick, fragile, cracking, texture chalky; MARGIN
determinate, abrupt.
Dendrothele syspora sp. nov. (Brazil) ... 21
HYPHAL SYSTEM monomitic; GENERATIVE HYPHAE clamped, 2-3 um in
diam., thin-walled. Cystip1a and DENDROHYPHIDIA lacking. Basrp1a pleural,
30-40 x 9-10 um, with a medium constriction, 4-sterigmate; BASIDIOSPORES
asteriform, 17-18(-21) x 14-18 um, with 5 projections of which one is larger
than the others and curved, 1-3-gutulate.
DISTRIBUTION — USA (Gilbertson & Blackwell 1987) and southern Brazil.
SPECIMENS EXAMINED — BRAZIL. R10 GRANDE DO SUL STATE: Guaiba, Morro Sao
Maximiano, on Enterolobium contortisiliquum (Mimosaceae), 15.VIUI.2001, leg. C.
Rodrigues 445 (ICN); 03.1X.2002, leg. C. Rodrigues 657 (ICN); Ipse, 13.V.2003, leg. C.
Rodrigues 802 (ICN); Porto Alegre, Parque Farroupilha, VI.1994, leg. R. T. Guerrero
(ICN 102261); on Bauhinia forficata (Caesalpiniaceae), VIII.1994, leg. R. T. Guerrero
(ICN 102318); Salvador do Sul, on branch of unidentified angiosperm, 07.III.1982,
leg. R. T. Guerrero (ICN 56138); Sapucaia do Sul, Morro Sapucaia, 17.IV.2003, leg. C.
Rodrigues 746 (ICN); on Allophylus edulis, 12.V1I.2003, leg. C. Rodrigues 857 (ICN);
Viamao, Parque Estadual de Itapua, 20.X.1984, leg. R. T. Guerrero (ICN 56150).
REMARKS — Xenosperma murrillii differs from X. ludibundum (D.P. Rogers
& Liberta) Oberw. ex Julich, which has 2-sterigmate basidia and smaller
basidiospores (Oberwinkler 1965). Xenosperma pravum Boidin & Gilles differs
by having 6-sterigmate basidia (Boidin & Gilles 1989).
Discussion
Although Dendrothele species are frequently reported from temperate
regions (Lemke 1964, Eriksson & Ryvarden 1975, Greslebin & Rajchenberg
1998) where Corticiaceae s.l. has been intensively studied, they also occur
in tropical and subtropical regions where their diversity is poorly known.
Boidin et al. (1996) described D. asterospora, D. capitulata, and D. mangiferae
for Mauritius, Réunion, Guadeloupe, and the Central African Republic. The
materials treated in this study were collected in similar climatic regions.
Other species reported here are cited both for temperate and tropical/
subtropical regions. While the broad northern temperate distribution of many
wood-decaying species is well established (Gilbertson 1980), more studies are
needed to determine their distribution in the tropics.
Another interesting aspect of this study is the discovery of several rarely
reported species occurring on substrates different from those previously cited.
This includes X. murrillii, known only from the bark of Juniperus virginiana L.
in the type locality. Investigation of fungi on fast-drying juniper bark, revealed
that some species also grew on hardwood trees (Gilbertson & Blackwell 1987).
Perhaps, host distributions are more variable in other regions where these
fungi occur. The distinctive fast-drying habitat in which these fungi occur will
facilitate their collection and improve their knowledge regarding distribution
and host range.
22 ... Rodriguest & Guerrerot
Acknowledgments
The authors thank the pre-submission reviewers, Dr. Mario Rajchenberg (Centro
Forestal CIEFAP, Argentina) and Dr. Sergio Pérez Gorjén (Spain). We also thank Nhu
H. Nguyen for correcting the Latin diagnosis. The ‘Coordenacao de Aperfeigoamento de
Pessoal de Nivel Superior” (CAPES) provided financial support.
Literature cited
Bernicchia A, Gorjon SP. 2010. Corticiaceae s.l. Fungi Europaei vol. 12. Edizioni Candusso, Italia.
Boidin J, Gilles G. 1989. Basidiomycetes Aphyllophorales de lle de la Réunion XV. Famille des
Xenasmataceae Oberw. Bull. Soc. Mycol. Fr. 105: 151-162.
Boidin J, Lanquetin, P, Duhem B. 1996. Contribution a la connaissance du genre Dendrothele
(Basidiomycotina, Aphyllophorales). Bull. Soc. Mycol. Fr. 112: 87-126.
Burdsall Jr HH, Nakasone KK. 1983. Species of effused Aphyllophorales (Basidiomycotina) from the
southeastern United States. Mycotaxon 17: 253-268.
Eriksson J, Ryvarden L. 1975. The Corticiaceae of North Europe. Vol. 3. Oslo, Fungiflora.
Ghobad-Nejhad M. 2011. Updated checklist of corticioid and poroid basidiomycetes of the Caucasus
region. Mycotaxon 117: 508 (abstract) + 70 pp. (accessioned 05/03/12) at
http://www.myco-lich.com/mycology-of-iran/basidiomycota/caucasus-region/checklists
Gilbertson RL. 1980. Wood-rotting fungi of North America. Mycologia 72: 1-49.
http://dx.doi.org/10.2307/3759417
Gilbertson RL, Blackwell M. 1987. Notes on wood-rotting fungi on junipers in the Gulf Coast
region. II. Mycotaxon 28: 369-402.
Gorjon SP. 2012. First record of Dendrothele mangiferae (Agaricales, Basidiomycota) from the
Neotropics. Mycotaxon 119: 137-140. http://dx.doi.org/10.5248/119.137
Gorj6én SP, Greslebin A, Rajchenberg M. 2011. Dendrothele latenavicularis sp. nov. (Agaricales,
Basidiomycota) from the Patagonian Andes. Mycotaxon 117: 101-108.
http://dx.doi.org/10.5248/117.101
Greslebin A, Rajchenberg M. 1998. Corticioid Aphyllophorales (Basidiomycota) from the Patagonian
Andes Forests of Argentina 3. The genus Dendrothele. Mycotaxon 67: 469-486.
Hjortstam K, Ryvarden L. 1980. Studies in tropical Corticiaceae (Basidiomycetes) I. Mycotaxon 10:
269-287.
Hjortstam K, Ryvarden L. 1982. Studies in tropical Corticiaceae (Basidiomycetes) IV. Type studies
of taxa described by J. Rick. Mycotaxon 15: 261-276.
Hjortstam K, Ryvarden L. 2007. Checklist of corticioid fungi (Basidiomycotina) from the tropics,
subtropics, and the southern hemisphere. Syn Fungorum 22: 27-146.
Larsson K-H. 2007. Re-thinking the classification of corticioid fungi. Mycol Res 111: 1040-1063.
http://dx.doi.org/10.1016/j.mycres.2007.08.001
Lemke PA. 1964. The genus Aleurodiscus (sensu lato) in North America. Can. J. Bot. 42: 723-766.
http://dx.doi.org/10.1139/b64-066
Maluf RW, Guerrero RT. 1993. Estudo biossistematico de espécies da familia Peniophoraceae
(Basidiomycetes) no Rio Grande do Sul. Insula (22): 39-82.
Nakasone KK, Burdsall Jr HH. 2011. The genus Dendrothele (Agaricales, Basidiomycota) in New
Zealand. New Zealand J. Bot. 49: 107-131. http://dx.doi.org/10.1080/0028825X.2010.512636
Nakasone KK, Hibbett DS, Goranova G. 2009. Neocampanella, a new corticioid fungal genus, and a
note on Dendrothele bispora. Botany 87: 875-882. http://dx.doi.org/10.1139/B09-046
Nietiedt SA, Guerrero RT. 2000. Familia Corticiaceae (s.l.) - Novas citacoes para o Brasil. Iheringia,
Bot. 54: 45-56.
Dendrothele syspora sp. nov. (Brazil) ... 23
Oberwinkler F. 1965. Primitive Basidiomyceten: revision einiger Formenkreise von Basidienpilzen
mit plastischer Basidie. Sydowia 19: 1-93.
Rajchenberg M. 1987. Type studies of Polyporaceae (Aphyllophorales) described by J. Rick. Nordic
J. Bot. 7: 553-568. http://dx.doi.org/10.1111/j.1756-1051.1987.tb02023.x
Rick J. 1959. Basidiomycetes Eubasidii in Rio Grande do Sul - Brasilia 3. Thelephoraceae. Iheringia,
Bot. 4: 61-124.
Sobestiansky, G. 2005. Contribution to a macromycete survey of the states of Rio Grande do Sul
and Santa Catarina in Brazil. Braz. Arch. Biol. Technol. 48(3): 437-457.
Wu SH, Wang DM, Tschen E. 2007. Brunneocorticium pyriforme, a new corticioid fungal genus and
species belonging to the euagarics clade. Mycologia 99: 302-309.
http://dx.doi.org/10.3852/mycologia.99.2.302
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.25
Volume 122, pp. 25-41 October-December 2012
Hymenoscyphus pseudoalbidus, the correct name for
Lambertella albida reported from Japan
YAN-JIE ZHAO'™, TSUYOSHI Hosoya’, HANS-OTTO BARAL’,
KENTARO HOSAKA’? & MAKOTO KAKISHIMA'
' Faculty of Life and Environmental Science, Tsukuba University,
1-1-1 Tennodai, Tsukuba, Ibaraki 305-0821, Japan
? Department of Botany, National Museum of Nature and Science,
4-1-1 Amakubo, Tsukuba, Ibaraki 305-0005, Japan
> Blaihofstr. 42, D-72074 Tiibingen, Germany
* CORRESPONDENCE TO: zhaoyanjiel
[email protected]
Asstract — Recent molecular analyses separate Hymenoscyphus pseudoalbidus (causal
agent of ash dieback in Europe) from the morphologically scarcely distinguishable H. albidus.
Hymenoscyphus albidus was reported (as “Lambertella albida”) on petioles of Fraxinus
mandshurica in Japan. Phylogenetic analysis in the present study shows Japanese “L. albida”
to be conspecific with H. pseudoalbidus but with a higher genetic variability compared
to European isolates. The presence of croziers at the ascus base was found to be a clear
distinguishing character of H. pseudoalbidus. Our phylogenetic analysis of the combined ITS
and LSU-D1/D2 dataset supports Hymenoscyphus as more appropriate than Lambertella for
H. pseudoalbidus. As the Hymenoscyphus clade includes members with two major characters
(presence of substratal stroma and brown ascospores) currently used to circumscribe
Lambertella, the generic delimitation of Lambertella requires redefinition.
Key worps — Chalara fraxinea, Helotiaceae, Rutstroemiaceae
Introduction
Ash dieback, an emerging infectious disease of common ash (Fraxinus
excelsior), has reached epidemic levels in Central Europe during the last two
decades (Bakys et al. 2009; Kowalski 2006). Since the first disease report
around 1992 in Poland, ash dieback has spread into 22 European countries
(Timmermann et al. 2011). The causal agent, Chalara fraxinea T. Kowalski
was first described in Poland (Kowalski 2006). Later, its teleomorph was
found and tentatively identified as Hymenoscyphus albidus (Gillet) W. Phillips
(Kowalski & Holdenrieder 2009). Further research revealed that H. albidus was
a complex of two species, and the ash dieback pathogen was described as a new
26 ... Zhao & al.
taxon Hymenoscyphus pseudoalbidus Queloz et al., separated from H. albidus
based on differences in ITS rDNA, calmodulin gene (CAL), and translation
elongation factor 1-a gene (EF1-a), as well as substantial differences in inter-
simple sequence repeat anchored PCR (ISSR-PCR) fingerprinting (Queloz et
al. 2011). The genetic distinction between H. albidus and H. pseudoalbidus was
later confirmed by population genetic studies (Bengtsson et al. 2012, Gross
et al. 2011, Husson et al. 2011). Queloz et al. (2011) indicated that the two
species are indistinguishable in apothecial morphology except for a tendency
toward slightly longer ascospores in H. pseudoalbidus. In fact, measurements
in the two species overlapped, making it virtually impossible to distinguish
H. pseudoalbidus from H. albidus based on ascospore size (Queloz et al. 2011).
However, recent morphological studies of European materials revealed a
sharp difference in the ascus base that permits unequivocal distinction between
H. albidus and H. pseudoalbidus (Baral & Bemmann, in prep.). The importance
of ascal croziers in helotialean fungi was discovered by White (1942, 1943,
1944). Although many later workers neglected this discovery, a number of
studies have confirmed that the presence or absence of ascal croziers is a stable
characteristic that clearly distinguishes between closely allied species (e.g.,
Baral 1984; Huhtinen 1989).
Carpenter (1981) transferred Hymenoscyphus albidus to Lanzia based on the
presence of a conspicuous substratal stroma. The transfer to Lambertella (Korf
1982) was based on the presence of some brown spores in the studied specimen
(R.P. Korf, pers. comm.), and this recombination was confirmed when Japanese
material was studied by Hosoya et al. (1993), who likewise found the ascospores
to become brown prior to germination. Although these two characters were
also recognized in the teleomorph classification of Chalara fraxinea, Kowalski
& Holdenrieder (2009), who followed European usage to classify the species in
Hymenoscyphus, did not place the species in Lambertella.
Lambertella albida (Gillet) Korf was reported as a new record for Japan by
Hosoya et al. (1993) from petioles of Fraxinus mandshurica, a common ash in
northeastern Asia. The asexual reproductive structure was also obtained in pure
culture of Japanese material, but the authors regarded it as having a spermatial
function. Since conidiophores have never been reported for H. albidus, and
H. pseudoalbidus was considered morphologically indistinguishable from H.
albidus, the taxonomic status of “L. albida” as reported from Japan needs to be
reconsidered.
The aims of the present research were: 1) to clarify whether Japanese
“L. albida” belongs to H. albidus or H. pseudoalbidus based on molecular
phylogeny; 2) to examine if the presence of croziers is appropriate to separate
the two species; 3) to clarify whether Hymenoscyphus or Lambertella is more
appropriate for Japanese specimens currently known as “L. albida”.
Hymenoscyphus pseudoalbidus in Japan ... 27
Materials & methods
Specimens and strains
Thirty-one specimens were analyzed, which include nine “L. albida” specimens from
Japan, sixteen further specimens classified as Lambertella spp., four specimens classified
as Hymenoscyphus spp., and two Lachnum species as outgroup (TABLE 1). Japanese
isolates were obtained from single spores, using a Skerman’s micromanipulator (Skerman
1968). Three L. albida” isolates of (FC-1445, FC-2793, FC-2799) were maintained on
potato dextrose agar (PDA, Nissui, Tokyo, Japan) slants and deposited in Biological
Resource Center, National Institute of Technology and Evaluation (NITE-BRC, Japan).
Observation of ascal base and anamorph
The bases of asci were examined for the presence of croziers or simple septa in
Japanese specimens previously identified as “L. albida”. Apothecial fragments were
mounted in either water + 1% phloxine B solution or 5-10% KOH + Congo Red and
strongly squashed.
In order to observe the anamorph, isolates were incubated on malt extract agar
(MEA, 20 g malt extract, 20 g agar, 1000 ml distilled water) at room temperature up to
1 month.
DNA extraction, PCR amplification and sequencing
Isolates were cultivated in 2 ml of 2% malt extract broth (20 g malt extract, 1000
ml distilled water) for 2 weeks to obtain mycelium. Genomic DNA of isolates was
obtained from about 50 mg of frozen mycelia using a DNeasy Plant Mini Kit (Qiagen,
Mississauga, ON, Canada) following the manufacturer's instruction. Genomic DNA
from apothecia was extracted using the modified Cetyltrimethylammonium bromide
(CTAB) extraction following glass milk purification methods as summarized by Hosaka
(2009) and Hosaka & Castellano (2008). Briefly, samples were ground in liquid nitrogen
using mortar and pestle, incubated in CTAB buffer (2% CTAB, 100 mM Tris pH 8.0,
20 mM EDTA, 1.4 M NaCl) at 65°C for 1 hour, and proteins were removed using the
mixture of chloroform: isoamylalcohol (24: 1). The materials were further purified
using 6M sodium iodine buffer (1M Tris pH 6.8, 2M Na,SO,) with glass milk, washed
with ethanol/buffer solution (10 mM Tris pH 7.4, lmM EDTA, 100 mM NaCl, 50%
EtOH), and finally eluted in 100 ul Tris-EDTA buffer (TE, 10 mM Tris-HCl pH 8.0,
1 mM EDTA).
The internal transcribed spacer regions (ITS-5.8S), the LSU-D1/D2 region of the
large subunit rDNA gene (28S rDNA), the calmodulin gene (CAL) and translation
elongation factor 1- a (EF1-a) were sequenced using primer pairs ITS1F and ITS4 or
ITS1 and ITS4 (White et al. 1990), NL1 and NL4 (O'Donnell 1993), Cal-228F and Cal-
737R (Carbone & Kohn 1999), EF1-728F and EFla_R (Carbone & Kohn 1999, Griinig et
al. 2007), respectively. PCR reactions were performed using 10 ul reaction volumes each
containing: 0.5 ul genomic DNA, 0.25 ul of each primer (10 uM), 0.05 wl (0.25 unit) of
ExTaq DNA polymerase (TaKaRa, Tokyo, Japan), 5.0 ul deoxynucleotide triphosphate
(dNTP) mixture containing 2.5 mM each dNTP and ExTaq buffer containing 2 mM
Mg”** (adding 3.95 ul distilled water to get 10 pl reaction volumes). Amplifications were
performed for ITS-5.8S and D1/D2 region with preliminary denaturation at 94°C for
28 ... Zhao & al.
3 min, 35 amplification cycles (94°C for 1 min, 52°C for 30 s and 72°C for 1 min),
followed by a final extension at 72°C for 7 min. For both CAL and EF1-c regions, the
annealing temperature was set at 54°C for 30s. PCR products were electrophoresed in
1% agarose gels stained with ethidium bromide and visualized under UV light. PCR
products were then purified using an ExoSAP-IT purification kit (USB, Cleveland, OH,
USA) following the manufacturer's instruction.
Sequencing was carried out using the Big Dye Terminator Cycle Sequencing Kit on
the DNA auto sequencer 3130x (Applied Biosystems Inc., Norwalk, CT, USA), following
the manufacturer’s instructions. Sequences were assembled and edited by SeqMan
(Lasergen v6 DNAstar), and congruent sequences obtained from both strands were
saved. A total of 92 sequences generated from this study were deposited in GenBank
(TABLE 1).
Phylogenetic analyses
The obtained DNA sequences were aligned by Clustal W using the default parameters
(Thompson et al. 1994) and edited manually when necessary using BioEdit ver. 7.0.5.2
(Hall 1999). Ambiguous regions having gaps were excluded from the analyses by
checking the alignment in BioEdit. Each of the three datasets (ITS-5.88, CAL and EF1-
a) including all sequences of European H. albidus and H. pseudoalbidus used in the
analyses of Queloz et al. (2011) and Japanese “L. albida” species were analyzed, rooted
with other Hymenoscyphus species as used in the analyses of Queloz et al. (2011) (H.
scutula, H. fructigenus, H. caudatus, H. serotinus for ITS-5.8S; H. fructigenus for CAL
and EF1-c ). 103 sequences downloaded from GenBank shown in Fic. 1-3 were used. A
combined sequence data set (ITS-5.8S and D1/D2 region) was also analyzed, including
seven “L. albida”, 24 Lambertella species, nine Hymenoscyphus species, and rooted with
Lachnum abnorme and Lachnum virgineum.
Maximum parsimony (MP) and maximum likelihood (ML) methods were used
to analyze all four datasets. The combination of these two methods was suggested as
a supportive way when constructing a phylogenetic tree (Kolaczkowski & Thornton
2004). The MP analyses were performed using PAUP version 4.0b10 (Swofford 2002).
Heuristic searches were conducted with tree bisection-reconnection branch swapping
algorithm (TBR), random sequence additions, and with Multrees option on. Bootstrap
values (BP) of the most parsimonious trees were obtained from 1000 replications.
The ML analyses were conducted using GARLI version 0.951 (Zwickl 2006). The
analyses were conducted using the GIR+G+I model (six general time reversible
substitution rates, assuming gamma rate heterogeneity and a proportion of invariable
sites), with model parameters estimated over the duration of specified runs. The tree
topology with the highest likelihood was inferred from 10 independent runs from random
starting trees. The “stopgen” parameters were set to 50,000,000 and other parameters
were set to default values. Bootstrap analyses were done using 1000 replications with the
same parameters as the initial tree search. The data matrix and trees have been deposited
in TreeBASE (http://purl.org/phylo/treebase/phylows/study /TB2:S12500).
Genetic variation analysis
DnaSP Version 4.0 software (Librado & Rozas 2009) was used to investigate the
genetic diversity among the European and Japanese populations of H. pseudoalbidus.
ee — — gZcSoLav gecsoLav ‘JoIg oueseN ‘TYs-epor) 61O00b-4-SNL TCLT-OA
. TURIO “A
‘ds : 2g edosoH] (sdiyftyd ‘M)
6 == eee remem omen Georeen —auienn oop pungues
S j ‘Jolg euuUNy ‘eurnsyesy TT T-d-SNL OOT-Od : ;
ee umouyuy, Bee CET ore ruin guineas eae is aeeanein aa ene ra siey ‘qd (yosieg)
¢ = = SLz7SoLav SezSoLav ; €8SQ1-d-SNL LETT-OA WNIUIBALA WNUYIVDT
a un8-Tureyeresiysy “Ok:
3 Pere rere rere r errr ere Perera rere rere rere rere rererererere rere rr rer reer ecer rere reer rarer ere re rere rererererererrrerrrrrrrrirsry Oo IWOISUILLIDY Fede reer eee reneseaeneseeses Ge a ee eee Baie MKS | Ae ea eRe Gia eg) Vag fee yuoun¢y wanes
aS — — blLe7SoLav vecSsoLav snxvjojoyday J ereMerey 6099T-4-SNL QIT?-0d 2» sauTeHY *H’[ (UO)
xs ‘UNS-TUIeyeIesIysy :
ag pe ae a rent ele Stn Mie DR on, are ae, un He en trie eben ee ee Ae Ge AAA A Races mee Adee etl, Met ickarece rahe Merb acts enn eM aoe nate hs gaaiecaes AN dda held Oo
ec Somerert sores A en Neat ee eM CEE TE GR st FED] MOTT 5. OEE AS EOD) OEOOE SN EGON es axuge eds Saud Osoueuny..
3 — — zZ7SoLav z€zSoLav UI9}$ SSBIDy ‘Jaig ouesey ‘TYys-epac L€00v-d-SNL LeLt-oa 1 ‘ds Bes Gtetnaionia
4 eee rere errr ere rere ee ee ree rere ere ee rere eerreeerrer ere rere reer rere rere ere rere reer ee ere ee eee eerie ee reer ere ree eer errr errr eee erreec cere sere ter eee Peer er eee rrret eS Teer IT Teeter eT T ee eee eee er Ea TTTETTITe Teer rete reer ee eeee rete rere eee eee eee eee ve Srrerrrerere rere rercirrr tries S$ r wdc (S13 Finaee
= — — tLcSoLav TEcTSoLav = VN Bore wnsvgsay
Be Sct ee meee oe ea pera sr SU SOU DIET x
2 =) = LozSoLav of 7S oLav — — WN b6FT-Od
- — — 69cSoLav 6zzSoLav — — VN €6VT-Od
= ih aa gotSoLav gzzSoLav —_— - VN Z6VT-Od ulys ‘dH 28 Ue Di
x = oe Q9eSOLEY LETS OLEY nn ee en ee ey ce WN. vevcnsntenen EORTOH,_, SPUOM NAS styfosoUsuNET
— — oLzSoLav ttSoLav Pqort4 OY O@TT-d-SNL €60T-O04 APTN). Sea reef
2 OSyuUIL) JO Fea] ‘TYSeUI-OY-EpeMO], 2 snyddosouamAyy
setuseeeuannntensennanntnsnnnuase sesetsnnensnne erecyeere es ee a rags ee eas ee sees wean pe praise nara seine
LizSoLav ttzSoLav bozSoLav — bzzSoLav ‘Jorg oursey “errepesng L1g/T-d-SNL WN
gtzSoLav o1zSoLav €9zSoLav— ss ExzSoLav ‘Jold OurseN ‘eirepesng vLoob-d-SNL VN
€1zSoLav LotSoLav ogzSolav — oztSoZav ‘Je1d OplepfoH ‘esowyD TS00F-d-SNL 664c-0a
zIcSoLav gozSoLav 6SzSoLav 61zSoLaVv ‘fold OprexpjoH ‘Weqny €voor-d-SNL £627-Od
GtzSoLav 6ozSoLav = gSzSoZav—s gu. tSoZav ‘Jord oursey ‘errepesng TQLTI-d-SNL SvVT-Od
bpizsoLav gozsoLav 9zSolav — tzzSoZav ‘Jold OurseN ‘errepesng €OSTI-d-SNL VN
— — — — ‘Jolg oueseN ‘Tys-epa- 7907 S-4-SNL VN
- —s = _ sid OPPePIOH 0907 S-d-SN.L
TYS-TeUloyeUo], VN
vounyspuvut (.YPIQY vyjaj4aquivT,,
= — i ‘JoIg OprexpyoH ‘eqnyz TQOTS-4-SNL se) snpiqwwopnasd
ixPedd snyddasouamA yy
zQOTSOLAV TTTSOLAV 0 3]019q VN
D- Td TvO cata SL ALVULSANS KLITVOO'T] NaWIOddS ‘pc caeban Saloadds
"ON NOISSHOOV ANVGNAL) quod
‘Apnys yuaseid oy} ul pasn ssouonbeas pur ‘sainynd sind ‘suawdeds | aATAVI,
30 ... Zhao & al.
LSz7SoLav
9SzSoLav
‘Juasaid Jou sayeTOST UsYM UOTIeI}X9 WNC JOF pasn aiam erayjody ‘ajqeytear jou :WN ,
Meter cee
2g SuURNYZ “AM
— = L6zS OLAV gtoOov-4-SNL VN (NO *H'S) sisuauvuund
— — 96cSoLav ds snuig Jo yueig $€00v-4-SNL VN VIJ2JAaqQuiv T
Te a ei aeteeniad SMUT TOE ha, feel ee REN Ee DOs TOGA IRNIE Bic ce RNa Ra Rata RNC lh cid a
— = v6cSoLav pagaol Z700v-d-SNL VN L ds vyjaqsaquu T
VIIJaULDD JO Je]
voiuodvl
DqnIny Jo JeaT
‘Jolg ojoureuINy
‘TYs-TYNyALY]
obzSoLav
LyzSoLav
Sv7SoLav
br7SoLav
€vz7SoLav
thzSoLav
tvzSoLav
obzSoLav
vaiuodvl
DIS] JO BONA
‘Jog emeseury
‘TYys-eIeMePO
odo], “ny-epodryD
oAVOL, “My-epodryD
— — 6gzSoZLav
a a ggzSoLav
= = SgcSoLav
<2 i 9gzSoLav
— — LgzSoLav
bgzsoLav
— — €gzSoLav
— — 7QtTSOLAV
— — TgzSoLav
— — ogzSoLav
— — 6Lz7SOLav
0-TSH TVO cd-Td
"ON NOISSHOOV INVGNAL)
6¢z7SoZLav
SLI
snatuodvl
SNJOTVIY JO JeIT
ALVULSANS
oAYO], ‘ny-oAUNG
KLITVOOT
€€QZLT-d-SNL O€CI-Od z ‘ds vyajsaquy yt
VN V689 -OUAN
LSTTE-A-SNL O6TT-Od
QTOO€-d-SNL S861-Od
¥669¢-A-SNL SbQz7-Od
VN O6hT-Oa4 1 ‘ds vyajsaquvT
VN 6ghT-Od
VN 88hT-Od
VN Lgvt-oa
VN £906 -OUdN
ZOVOE-A-SNL 6g€7t-Od WHOH S2M
-1UL09 DIJAJAIQUIDT
aan.LIno
NHWI0adS SHIOddS
aund
ponunuor) [ ATaVy,
Hymenoscyphus pseudoalbidus in Japan ... 31
The alignments of the ITS region, and the portion of CAL and EF1l-a regions were
separately compared without deletions, and the genetic diversity parameter Pi was
calculated.
Results
Taxonomic reconsideration of Japanese “Lambertella albida” based on three loci
The aligned ITS-5.8S rDNA dataset comprised 454 bp, and 11 ambiguously
aligned sites (site nos. 100-102, 336-343) were excluded from the analyses. Three
most parsimonious trees were obtained [tree length (TL): 67 steps, consistency
index (CI): 0.8060, retention index (RI): 0.9615, rescaled consistency index
(RC): 0.7750]; one is shown in Fic. 1. The ML analysis yielded an optimal tree
with the best likelihood (log likelihood = -1051.7137), topologically congruent
with this MP tree, which highly supported monophyly of the ingroup. In the
ingroup, two major clades were supported with high BP (BP >80%) confirming
Queloz et al. (2011); Japanese materials were included in the strongly supported
(92/90% ML BP/MP BP) clade with European H. pseudoalbidus.
The aligned CAL dataset comprised 460 bp, and 18 ambiguously aligned
sites (site nos. 38-42, 72-74, 82, 176-177, 201, 216-217, 247-250) were
excluded from the analyses. One of the 10 MP trees obtained (TL: 28 steps, CI:
0.9286, RI: 0.9888, RC: 0.9182) is shown in Fic. 2. The ML tree (log likelihood
= -1110.7132) showed the same topology with one MP tree. Here also two
major clades were highly supported and Japanese materials were included in
the European H. pseudoalbidus clade with high support.
The aligned EF1-a dataset comprised 553 bp with 31 ambiguously aligned
sites (site nos. 35-36, 86-87, 121-127, 221-228, 233-239, 453-456) excluded
from further analysis. Only one parsimonious tree (Fic. 3) was obtained
(TL: 28 steps, CI: 0.8929, RI: 0.9779, RC: 0.8732). The ML tree (log likelihood =
-1145.5894) did not show any topological conflict with the MP tree. Also, two
major clades were obtained, one consisting of European H. albidus with high
support and the other (including Japanese “L. albida” and H. pseudoalbidus)
that was moderately supported (61/-%). In the latter clade, five out of six
Japanese “L. albida” materials grouped with European H. pseudoalbidus with
high support (97/97%).
Morphology of Japanese “Lambertella albida”
The presence of croziers at the base of asci was observed in all nine Japanese
“L. albida” specimens (Fic. 4). White (1944) observed the absence of croziers in
the type of H. albidus; Baral (Baral & Bemmann,in prep.) observed the presence
of croziers in the type of H. pseudoalbidus, and he and Bemmann examined
numerous European materials (including some specimens treated by Queloz et
al. 2011) morphologically. The presence of basal croziers was found to be a clear
distinguishing character between the two taxa (Baral & Bemmann,jin prep.).
32 ... Zhao & al.
IGU586922 Hymenoscyptus pseudodbidus
IGU536923 H ymenoscyphus pseudodlbidus
IGU536924 H ymenoscyphus pseudodbidus
IGU586925 Hymenoscyphus pseudoalbidus
FJ597975 Hymenoscyphus pseudoalbidus
AB705221 “Lambertella albida” TNS-F-12503
'4B505220 “Lambertella albida” FC-2799
GU586921 Hymenoscyphus pseudoalbidus
AB705219“Lambertella albida” FC-2793
AB705222 “Lambertella albida” TNS-F-52061
|AB705223 “Lambertella albida” TNS-F-40074
AB705218 “Lambertella albida” FC-1445
AB705224“Lambertella albida” TNS-F-17817
JP
EU
JP
GU586901 Hymenoscyphus pseudoalbidus
IGU586902 H ymenoscyphus pseudoalbidus
IGU586903 H ymenoscyphus pseudoalbidus
IGU536904 H ymenoscyphus pseudoalbidus
(GU586905 H ymenoscyphus pseudoalbidus
IGU586906 Hymenoscyphus pseudoalbidus
I
100/99 |
Fic. 1. One of three most parsimonious trees based on ITS rDNA sequences from Japanese
“Lambertella albida” and European Hymenoscyphus albidus and H. pseudoalbidus. Numbers
above the branches are maximum parsimony (MP) bootstrap values (BP) followed by maximum
likelihood (ML) BP >50% in 1000 replications. Tree length: 67 steps; consistency index: 0.8060;
retention index: 0.9615; rescaled consistency index: 0.7750. EU: European materials; JP: Japanese
materials
GU586963 Hymenoscyphus pseudoalbidus
GU586968 Hymenoscyphus pseudoalbidus
GU586967 Hy menoscy phus pseudoalbidus
GU586964 Hymenoscy phus pseudoalbidus
GU586970 Hymenoscy phus pseudoalbidus
62/65 | Gus36962 Hymenoscyphus pseudoalbidus
GU586969 Hy menoscy phus pseudoalbidus
GU586965 Hy menoscy phus pseudoalbidus
GU586966 Hy menoscy phus pseudoalbidus
AB705209“Lambertella albida” FC-1445
97/97
88/92
AB705213“Lambertella albida” FC-2799
GU586959 Hymenoscyphus albidus
GU586960 Hy menoscy phus albidus
GU586958 Hymenoscy phus albidus
GU586957 Hy menoscyphus albidus
98/98 | GUS86955 Hymenoscyphus albidus
GU586956 Hymenoscy phus albidus
GU586953 Hymenoscyphus albidus
GU586954 Hy menoscy phus albidus
GU586961 Hymenoscy phus albidus
GU586971 Hymenoscyphus fiuctigenus
H
1
GU586963 Hymenoscy phus pseudoalbidus
GU586968 Hy menoscy phus pseudoalbidus
GU586967 Hymenoscyphus pseudoalbidus
GU586964 Hy menoscy phus pseudoalbidus
GU586970 Hy menoscy phus pseudoalbidus
62/65 | Gu536962 Hymenoscyphus pseudoalbidus
GU586969 Hymenoscy phus pseudoalbidus
GU586965 Hymenoscy phus pseudoalbidus
GU586966 Hy menoscy phus pseudoalbidus
AB705209*“Lambertella albida” FC-1445
88/92
AB705213“Lambertella albida” FC-2799
GU586959 Hymenoscyphus albidus
GU586960 Hymenoscy phus albidus
GU586958 Hy menoscy phus albidus
GU586957 Hymenoscyphus albidus
98/981 GU586955 Hymenoscyphus albidus
GU586956 Hy menoscy phus albidus
GU586953 Hymenoscyphus albidus
GU586954 Hymenoscyphus albidus
GU586961 Hymenoscyphus albidus
GU586971 Hymenoscyphus fructigenus
Le
1
100/99 | 4B705216“Lambertella albida” TNS-F-40074
AB705212“Lambertella albida” FC-2793
AB705214"Lambertella albida” TNS-F-12503
AB705217"Lambertella albida” TNS-F-17817
Hymenoscyphus pseudoalbidus in Japan ... 33
EU
Fic. 2. One of ten most parsimonious
trees based on CAL gene sequence
data of Japanese “Lambertella albida”
with European Hymenoscyphus
albidus and H. __ pseudoalbidus.
Numbers above the branches are
bootstrap values (BP) in maximum
parsimony analysis (MP) followed
by BS from maximum likelihood
(ML) >50% in 1000 replications. Tree
length: 28 steps; consistency index:
0.9286; retention index: 0.9888;
rescaled consistency index: 0.9182.
EU: European materials; JP: Japanese
materials
EU
100/99 | AB705216“Lambertella albida” TNS-F-40074
AB705212“Lambertella albida” FC-2793
AB705214“Lambertella albida” TNS-F-12503
AB705217“Lambertella albida” TNS-F-17817
Fic. 3. Maximum parsimony tree
Jp based on EF1-a gene sequences from
Japanese “Lambertella albida” and
European Hymenoscyphus albidus and
H. pseudoalbidus. Numbers above the
branches are maximum parsimony
(MP) bootstrap values (BP) followed
by maximum likelihood (ML) BP
>50% in 1000 replications. Tree
length: 28 steps; consistency index:
0.8929; retention index: 0.9779;
rescaled consistency index: 0.8732. “-
”: BP <50%; EU: European materials;
JP: Japanese materials
34 ... Zhao & al.
Fic. 4. Representative photos of croziers at the base of asci observed in Japanese materials of
Hymenoscyphus pseudoalbidus. Mounted in 1% phloxine B solution (A. TNS-F-12503; B. TNS-F-
52061). Scale = 20 um
The conidia and conidiophores of Chalara fraxinea were obtained on MEA,
but conidia did not germinate in any of the isolates during the prolonged
incubation up to one month at room temperature.
Results from the above molecular, morphological, and cultural analyses
all indicate that Japanese “L. albida” materials should be re-identified as
H. pseudoalbidus.
Comparison of genetic variation between Japanese and European materials
Japanese H. pseudoalbidus showed a higher genetic variation compared with
European H. pseudoalbidus and H. albidus in all the three genes, whereas no
genetic difference was observed within European H. pseudoalbidus for CAL
and EF1-a genes, and within European H. albidus for CAL gene. (TABLE 2).
Comparison of nucleotide characters between Japanese and European materials
Nucleotide differences in the EFl-a, CAL and ITS genes were found between
European H. pseudoalbidus and H. albidus (Queloz et al. l.c.). Although most
nucleotides from Japanese H. pseudoalbidus populations matched those from
European H. pseudoalbidus populations, some positions deviated. Unexpectedly,
these deviating positions consistently showed the same nucleotides as H. albidus.
EFl-a gene nucleotides were most diverse among Japanese H. pseudoalbidus
materials (TABLE 3). When comparing the 22 positions in which European
H. pseudoalbidus differed from H. albidus, Japanese material showed
concordance with H. pseudoalbidus in 7 positions, while the remaining 15
positions showed variation within Japanese materials. Thereby, each position
that differed from European H. pseudoalbidus showed the nucleotide that
characterized H. albidus. This phenomenon occurred mainly in positions
included in the definition (protologue) of H. pseudoalbidus (Queloz et al. 2011),
but also in 4 additional positions (232-235 in TABLE 3) that were not included
35
Hymenoscyphus pseudoalbidus in Japan ...
‘snpiqv ‘H 7WH ‘snpiqjvopnasd "H :qH ‘esouede{ :g{ sueadoimg :q¥q Suonruyep jo NE :N <(enso]o}01d) snpiqvopnasd ‘Y Jo UOTTUYEp ay} Ul pepnpuT suOTIsog =X ,
dvd : avo L L 3) 5 5) dvd Vv 5) re) Vv L a @ Vv D 5) f3) Vv fe) t3) VH na
dvd : avo L L Vv 3) a advo Vv a fe) 3) L e) re) Vv 2) L fe) a) L 6627-04
iT Vv 3) L Vv Vv ) 5 2) iL A 5 a) Vv a) f) 2) L e) a ZIgZt-d-SNL :
a Vv 9 it Vv Vv 3) i) 9 iL L i) fe) Vv 9 D 9 L > 4a ‘COSTI-d-SNL : aH
L Vv 9 9 3) Vv i) i) 9 1 L D fe) Vv i 9 3 a S- iia "6 Le-0d fal
L Vv a) a) 3) Vv 3) 3) a) L L ) 9 > . f) it 2 ie $LOOF EL SNL |
12 ae Beans on crn i fons Beatty lll ee ie a nl on @ aa
L : V¥ Geom vo: vy am Peo: «6LlUflUL Oe vo: lL Oo: «6 Oe 6LlfV: dH na
SE : vet 3 €€% : TET : ESH : ODT : Tht : QET + OFT : ETT : STC : TIt : 661 : THT : GBT +: OBVT : QghT : EhT : Let : 68 : Lo : OF : NOLLISOg
N N : N i N f A G KR EF AR FG KR EAR |G KR ER GF KR ER EP RG KR ER GF KR PE KR EF KR ERG REAR: NOLLINIAIQ
‘snpiqy ‘H ueodoing pue
‘( Dplgy vpyjaj4aquvT,,) snpiqjpopnasd ‘fF asouede ‘snpiqvopnasd ‘YH ueadoing ul suostzedurod sproapnu ous 10-1 Jq “¢ ATAVI,
(Z=U) TZ000°0 (9=U) 881700 (6=") 00000°0 0-TAT
eA iie ION Ea Sas yh a RO OO A OR aat
(Sz=U) 96000°0 (Z=") Z8700°0 (S¢=U) F€000°0 SLI
VH ueadoing dH asouede( dH ueadoing
DOT
(td) Avszoarp apyosponN
‘snpiqv ‘H ueadoing pue
‘(_ vplgy vyjajsaquvT,,) snpiqjpopnasd ‘FY asouede{ ‘snpiqyvopnasd ‘YH uesdoing jo sutesjs usamyaq (1g) AJSIOATP 9PIJOITONN "7 ATAV,
36 ... Zhao & al.
in the protologue. One strain (FC-2799) shared 14 nucleotides with H. albidus
and 8 with H. pseudoalbidus, suggesting it is intermediate between these two
species (Fic. 3, TABLE 3).
However, strain FC-2799 and four other Japanese materials concurred with
H. pseudoalbidus in all 21 CAL gene positions where the European H. pseudo-
albidus differed from H. albidus. Within these positions, some Japanese
specimens showed variation at position 244 (specimens: TNS-F-40043, TNS-
F-12503) and position 266 (specimen: TNS-F-12503) where they shared,
instead, nucleotides with H. albidus. Further CAL region variation was noted
at positions where European H. albidus and H. pseudoalbidus do not differ.
In the ITS rDNA, Japanese materials concurred with European H. pseudo-
albidus except for two positions (site nos. 83, 124) at which all Japanese materials
showed the character of H. albidus.
Generic taxonomy of Hymenoscyphus pseudoalbidus
The combined ITS-5.8S and D1/D2 dataset comprised 1183 bp (582 bp for
ITS-5.8S rDNA, 601 bp for D1/D2), and 15 ambiguously aligned ITS sites (site
nos. 80-81, 107-113, 127, 140-141, 206, 581-582) and 17 ambiguously aligned
D1/D2 sites (site nos. 583-596, 781-782, 850) were excluded from the analysis.
One of the 16406 equally parsimonious trees obtained (TL: 67 steps, CI: 0.8060,
RI: 0.9615, RC: 0.7750) is shown in Fic. 5. The ML tree (log likelihood = -
6682.1630) did not show any topological conflict with the MP trees. In the MP
consensus tree and the best ML tree, two major clades were generated, one
strongly supported (100/100%) and the other moderately supported (77/80%).
The more strongly supported clade was composed solely of Lambertella
species, including the type species L. corni-maris. The other clade included the
Hymenoscyphus species and L. yunnanensis; H. pseudoalbidus grouped here
with H. fructigenus (type species of Hymenoscyphus) with 99% BP support.
This phylogenetic analysis shows H. pseudoalbidus as more distantly related to
the Lambertella core group (including the type) and more closely related to the
Hymenoscyphus core group (including the type).
Discussion
Based on the rapid expansion and high intensity of ash dieback in Europe,
H. pseudoalbidus was considered as an invasive alien organism (Husson et al.
2011; Queloz et al. 2011; Timmermann et al. 2011). However, until now its
Fic. 5. One of 16406 most parsimonious trees inferred from combined dataset of ITS and D1-
D2 sequences showing the relationship of Japanese Hymenoscyphus pseudoalbidus with other
Hymenoscyphus* and Lambertella species. Numbers above the branches are maximum parsimony
(MP) bootstrap values (BP) followed by maximum likelihood (ML) BP >50% in 1000 replications.
Tree length: 67 steps; consistency index: 0.8060; retention index: 0.9615; rescaled consistency
index: 0.7750. “-”: BP <50%.
Hymenoscyphus pseudoalbidus in Japan ...
FC-1488 Lambertella corni-maris
FC-1489 Lamb ertella corni-maris
FC-1487Lambertella corni-maris
FC-1490 Lamb ertella corni-maris
95/ FC-2674 Lambertella corm-maris
, FC-2389 Lamertella comi-maris
100/100
FC-1230Lambertella sp.2
100/100 FC-2726 Lamb ertella sp.3
TNS-F-40038Lambertella sp.5
TNS-F-40036Lambertella sp.4
FC-1985Lambertella sp. 1
100/100 |Fc.2645Lambertella sp.1
FC-1190Lambertella sp. 1
58/51
94/99
100/100 FC-2675 Lamb ertella sp. 1
100/100 TNS-F-40026Lambertella sp.6
TNS-F-40027Lambertella sp.7
89/- TNS-F-40031Lambertella sp.8
FC-2718Lambertella advenula
100/- FC-2722Lambertella advenula
FC-1007Lambertella advenula
FC-2727Hymenoscyphus sp.1
98/-
FC-1093Hymenoscyphus ginkgonis
100/100 FC-1494Hymenoscyphus ginkgonis
FC-1491 Hymenoscyphus ginkgonis
77/80 | 83/- FC-1493Hymenoscyphus ginkgonis
| FC-1492Hymenoscyphus ginkgonis
991100) TNS-F-40028Lambertella yunnanensis
90/-'TNS-F-40035Lambertella yunnanensis
FC-2725 Hymenoscyphus sp.2
95/97 98/91 FC-2375Hymenoscyphus fructigenus
FC-2676 “Hymenoscyphus herb arum”
FC-2793Hymenoscyphus pseudoalbidus
99/99 TN-S-F-12503Hymenoscyphus pseudoalbidus
100/100] |FC-2799 Hymenoscyphus pseudoalbidus
FC-1445 Hymenoscyphus pseudo abidus
TNS-F-52061 Hymenoscyphus pseudo albidus
TNS-F-40074 Hymenoscyphus pseudo albidus
TN-S-F-17817 Hymenoscyphus pseudoalbidus
FC-2137Lachnum virgineum
FC-2118Lachnum abnorme
20
37
38 ... Zhao & al.
origin has remained uncertain. Field inoculations showed that Fraxinus ornus,
closely related to many Asian ash species, is less susceptible to infection than
the European common ash, F. excelsior (Krautler & Kirisits 2011), leading
Queloz et al. (2011) to suggest a possible Asian origin for the ash dieback
pathogen. In addition, E mandshurica, a northeastern Asian ash ornamental
introduced in Europe, was only slightly affected by ash dieback in southeastern
Estonia (Drenkhan & Hanso 2010). It must be mentioned, however, that
F. mandshurica is not closely related to FE ornus but is, instead, close to
FE. excelsior (Wallander 2008). Pathogenicity of H. pseudoalbidus to indigenous
ash has not been reported in Japan.
To clarify the origin of the pathogen, population genetic studies based
on polymorphic microsatellite markers, have shown that H. pseudoalbidus
possesses low genetic variation among and within populations (Bengtsson et
al. 2012, Gross et al. 2011). The genetic homogeneity of European H. pseudo-
albidus can be explained by the founder effect (characteristic of invasive
populations established by a small number of individuals). In the present study,
Japanese H. pseudoalbidus showed a higher genetic variation than European
populations, and Japanese populations were more basal in the phylogenetic
analyses. Together with a very low susceptibility of local Fraxinus, this does not
contradict an Asian origin for H. pseudoalbidus. In order to unravel the origin
of H. pseudoalbidus, however, further genetic comparisons of populations from
other Asian regions are needed.
Comparison of the ITS, CAL and EF1l-a gene nucleotides has shown the
European H. pseudoalbidus and H. albidus to be extremely stable and with clear
differences in various positions. Although Japanese H. pseudoalbidus shared
most characters with the European H. pseudoalbidus, some nucleotide positions
varied. Especially in the EFl-a gene, strain FC-2799 appeared intermediate
between H. pseudoalbidus and H. albidus. Records of H. albidus in Japan are
unknown up to now, and the reason for the intermediate nucleotide patterns
needs further study. Possibly the mixed nucleotide positions in Japanese
materials suggests a common ancestor of H. albidus and H. pseudoalbidus from
eastern Asia.
Hosoya et al. (1993) was the first to report the presence of an anamorphic
structure in H. pseudoalbidus, based on Japanese material. At the time, the
authors regarded the structure as spermatia due to its minute size and the fact
that conidial germination was not observed. In the present study, the absence of
conidial germination was again noted (on MEA). This suggests that the asexual
state of H. pseudoalbidus does not contribute to its long-range dispersal and
that pathogen dispersal is limited to ascospores, as previously suggested (e.g.
Gross et al. 2011, Timmermann et al. 2011, Gross et al. 2012).
Hymenoscyphus pseudoalbidus in Japan ... 39
Lambertella was chiefly characterized by the presence of a substratal stroma
and ascospores that may become brown at various stages of spore development
(Dumont 1971, Korf & Zhuang 1985). Our current phylogenetic analysis (Fic.
5) places Lambertella species in both of the two major clades, suggesting that
the genus is not monophyletic. The molecular phylogeny of Holst-Jensen et
al. (1997) also suggested polyphyly in Lambertella. Korf (1982) transferred
Hymenoscyphus albidus to Lambertella because it has the major morphological
characters of Lambertella (Hosoya etal. 1993). Both substratal stroma and brown
ascospores were observed in H. pseudoalbidus by Kowalski & Holdenrieder
(2009), but the authors retained this fungus in Hymenoscyphus.
Our phylogenetic analyses situate H. pseudoalbidus in the Hymenoscyphus
group, suggesting that Hymenoscyphus is the more appropriate genus to
accommodate this fungus at present. This is in concordance with morphological
characteristics, such as the Hymenoscyphus-type of ascus apical ring and the
heteropolar scutuloid ascospores in H. pseudoalbidus (Baral & Bemmann, in
prep.). The Hymenoscyphus clade also contains H. ginkgonis, another species
with a substratal stroma and ascospores becoming brown when germinated
(although these characters were not mentioned by Han & Shin, 2008). In
conclusion, the two major characters (presence of substratal stroma and brown
ascospores) currently used to circumscribe the genus Lambertella seem to have
resulted from convergent evolution, and the generic delimitation of Lambertella
needs to be reconsidered.
Acknowledgments
The authors would like to express their thanks to Prof. R.P. Korf (Cornell University,
US.A.) and Prof. O. Holdenrieder (Institute of Integrative Biology, Switzerland) for
serving as pre-submission reviewers and for their valuable suggestions. This project is
supported by the integrated research on biodiversity of interspecies relationships in the
National Museum of Nature and Science, and Grant-in-Aid for Scientific Research (C)
22570102.
Literature cited
Bakys R, Vasaitis R, Barklund P, Thomsen IM, Stenlid J. 2009. Occurrence and pathogenicity of
fungi in necrotic and non-symptomatic shoots of declining common ash (Fraxinus excelsior) in
Sweden. Eur. J. Forest Res.128: 51-60. http://dx.doi.org/10.1007/s10342-008-0238-2
Baral HO. 1984. Taxonomische und okologische Studien tiber die Koniferen bewohnenden
europaischen Arten der Gattung Lachnellula Karsten. Beitrage Kenntnis Pilze Mitteleuropas
1: 143-156.
Baral HO, Bemmann M (in prep.). A light-microscopical study of Hymenoscyphus albidus, H.
pseudoalbidus and related stroma-forming species, including the non-foliicolous H. serotinus.
Bengtsson SBK, Vasaitis R, Kirisits T, Solheim H, Stenlid J. 2012. Population structure of
Hymenoscyphus pseudoalbidus and its genetic relationship to Hymenoscyphus albidus. Fungal
Ecol. 5: 147-153. http://dx.doi.org/10.1016/j.funeco.2011.10.004
AO ... Zhao & al.
Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in filamentous
ascomycetes. Mycologia 91: 553-556. http://dx.doi.org/10.2307/3761358
Carpenter SE. 1981. Monograph of Crocicreas (Ascomycetes, Helotiales, Leotiaceae). Mem. New
York Bot. Gdn. 33: 1-290.
Drenkhan R, Hanso M. 2010. New host species for Chalara fraxinea. New Disease Reports 22: 16.
http://dx.doi.org/10.5197/j.2044-0588.2010.022.016
Dumont KP. 1971. Sclerotiniaceae Il. Lambertella. Mem. N. Y. Bot. Gdn. 22: 1-178.
Gross A, Griinig CR, Queloz V, Holdenrieder O. 2011. A molecular toolkit for population genetic
investigations of the ash dieback pathogen Hymenoscyphus pseudoalbidus. For. Path. 42:
252-264. http://dx.doi.org/10.1111/j.1439-0329.2011.00751.x
Gross A, Zaffarano PL, Duo A, Griinig CR. 2012. Reproductive mode and life cycle of the
ash dieback pathogen Hymenoscyphus pseudoalbidus. Fungal Genet. Biol. 49: 977-986.
http://dx.doi.org/10.1016/j.fgb.2012.08.008
Griinig CR, Brunner PC, Duo A, Sieber TN. 2007. Suitability of methods for species recognition
in the Phialocephala fortinii-Acephala applanata species complex using DNA analysis. Fungal
Genet. Biol. 44: 773-788. http://dx.doi.org/10.1016/j.fgb.2006.12.008
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NTT. Nucleic Acids Symposium Series 41:95-98.
Han JG, Shin HD. 2008. Hymenoscyphus ginkgonis sp. nov. growing on leaves of Ginkgo biloba.
Mycotaxon 103: 189-195.
Holst-Jensen A, Kohn ML, Schumacher T. 1997. Nuclear rDNA Phylogeny of the Sclerotiniaceae.
Mycologia 86: 885-899. http://dx.doi.org/10.2307/3761109
Hosaka K. 2009. Phylogeography of the genus Pisolithus revisited with some additional taxa from
New Caledonia and Japan. Bull. Natn. Mus. Nat. Sci., Ser. B 35: 151-167.
Hosaka K, Castellano MA. 2008. Molecular phylogenetics of Geastrales with special emphasis on
the position of Sclerogaster. Bull. Natn. Mus. Nat. Sci., Ser. B 34: 161-173.
Hosoya T, Otani Y, Furuya K. 1993. Materials for the fungus flora of Japan (46). Trans. Mycol. Soc.
Japan 34: 429-432.
Huhtinen S. 1989. A monograph of Hyaloscypha and allied genera. Karstenia 29: 45-252.
Husson C, Scala B, Caél O, Frey P, Feau N, Ioos R, Margais B. 2011. Chalara fraxinea is an invasive
pathogen in France. Eur. J. Plant Pathol. 130: 311-324.
http://dx.doi.org/10.1007/s10658-011-9755-9
Kolaczkowski B, Thornton JW. 2004. Performance of maximum parsimony and likelihood
phylogenetics when evolution is heterogeneous. Nature 431: 980-984.
http://dx.doi.org/10.1038/nature02917
Korf RP. 1982. New combination and a new name for discomycetes illustrated by Boudier in the
Icones Mycologicae. Mycotaxon 14: 1-2.
Korf RP, Zhuang WY. 1985. A synoptic key to the species of Lambertella (Sclerotiniaceae), with
comments on a version prepared for TAXADAT, Anderegg’s computer program. Mycotaxon
24: 361-386.
Kowalski T. 2006. Chalara fraxinea sp. nov. associated with dieback of ash (Fraxinus excelsior) in
Poland. Forest Pathol. 36: 264-270. http://dx.doi.org/10.1111/j.1439-0329.2006.00453.x
Kowalski T, Holdenrieder O. 2009. The teleomorph of Chalara fraxinea, the causal agent of ash
dieback. Forest Pathol. 39: 304-308. http://dx.doi.org/10.1111/j.1439-0329.2008.00589.x
Krautler K, Kirisits T. 2011. The ash dieback pathogen Hymenoscyphus pseudoalbidus is associated
with leaf symptoms on ash species (Fraxinus spp.). IUFRO 2011 WP 7.02.02 Global Change
and Forest Diseases: New Threats, New Strategies: p.102.
Hymenoscyphus pseudoalbidus in Japan ... 41
Librado P, Rozas J. 2009. DnaSP v5: A software for comprehensive analysis of DNA polymorphism
data. Bioinformatics 25: 1451-1452. http://dx.doi.org/10.1093/bioinformatics/btp187
O’Donnell K. 1993. Fusarium and its near relatives. 225-233, in: DR Reynolds, JW Taylor (eds).
The fungal holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics.
CAB International, Wallingford.
Queloz V, Griinig CR, Berndt R, Kowalski T, Sieber TN, Holdenrieder O. 2011. Cryptic speciation
in Hymenoscyphus albidus. For. Path. 41: 133-142.
http://dx.doi.org/10.1111/j.1439-0329.2010.00645.x
Skerman VBD. 1968. A new type of micromanipulator and microforge. J. Gen. Microbiol. 54:
287-297.
Swofford DL. 2002. PAUP*: phylogenetic analysis using parsimony and other methods (*PAUP
version 4.0 beta 10). Sinauer, Sunderland.
Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position specific gap penalties and
weight matrix choice. Nucleic Acids Res. 22: 4673-4680.
http://dx.doi.org/10.1093/nar/22.22.4673
Timmermann V, Borja I, Hietala AM, Kirisits T, Solheim H. 2011. Ash dieback: pathogen spread
and diurnal patterns of ascospore dispersal, with special emphasis on Norway. OEPP/EPPO
Bulletin 41: 14-20.
Wallander E. 2008. Systematics of Fraxinus (Oleaceae) and evolution of dioecy. Plant Syst. Evol.
273: 25-49.
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: A guide to
methods and applications. Academic Press, Inc.: New York.
White WL. 1942. Studies in the genus Helotium, I - A review of the species described by Peck.
Mycologia 34: 154-179.
White WL. 1943. Studies in the genus Helotium, III - history and diagnosis of certain European and
North American foliicolous species. Farlowia 1: 135-170.
White WL. 1944. Studies in the genus Helotium, IV - some miscellaneous species. Farlowia 1:
599-617.
Zwickl DJ. 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological
sequence datasets under the maximum likelihood criterion. Ph.D. dissertation, The University
of Texas at Austin.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.43
Volume 122, pp. 43-50 October-December 2012
New records of Scleroderma species
(Sclerodermataceae, Agaricomycetes) from Pakistan
N. YousAr*, A.N. KHALID & A.R. NIAZI
Department of Botany, University of the Punjab, Quaid-e-Azam Campus, Lahore, 54590, Pakistan
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — During a survey of gasteroid basidiomycetes from Pakistan, three Scleroderma
species (S. areolatum, S. chevalieri, S. dictyosporum) have been identified that represent new
records from Pakistan. A key to the known Scleroderma species from Pakistan is presented.
Key worps — Boletales, earth balls, fungal taxonomy, Khyber Pakhtun Khwa, Nathia gali,
Neelum valley
Introduction
Scleroderma Pers. is an extensively studied genus (Guzman 1970, Sims et
al. 1997, Kasuya et al. 2002, Baseia & Galvao 2002, Yoshimi 2000, 2002). This
genus comprises 30 species worldwide, most of which occur in North America
(Guzman 1970, Kirk et al. 2008). Scleroderma species are thick-skinned earth
balls that are separated primarily based on basidiospore characters (Sims et al.
1995). These gasteroid basidiomycetes form ectomycorrhizal associations with
various trees and have a definite opening from which they eject their spores
(Marshall 1904, Jeffries 1999).
Five Scleroderma species have been recorded previously from Pakistan
(Ahmad et al. 1997). Continuing the survey of gasteroid basidiomycetes from
Pakistan (Khalid & Iqbal 1996, 2004, Sultan et al. 2001, Razzaq & Shahzad 2004,
2007, Iqbal et al. 2006, Sultana et al. 2007, Moreno et al. 2009), we collected
and identified three more Scleroderma species, which we describe here as an
addition to the gasteroid mycota of Pakistan.
Materials & methods
Slides were prepared by mounting a smear of spores in a drop of 5% KOH, lacto-
phenol and trypan blue. Spore ornamentation was observed under oil immersion (100x)
objective. Spore size was determined by measuring the diameter of at least forty spores
A4 ... Yousaf, Khalid & Niazi
including the ornamentation and then calculating the mean. Only mature spores were
selected for the measurements. Peridium thicknesses, glebal color, surface ornamentation
of basidiomata were also observed using 10x hand lens. Drawings were made with the
help of camera lucida and measurements were taken using ocular micrometer.
Taxonomy
Scleroderma areolatum Ehrenb., Sylv. mycol. berol. 15: 27 (1818) Fig. 1
BASIDIOMATA epigeous, <30 mm broad, 25 mm high, subglobose, attached
to the substratum by a thick mycelial base, forming a pseudostipe; pseudostipe
Fic. 1: Scleroderma areolatum. A. Basidiomata. B. Basidiospore. C. Exoperidial hyphae. D. Meso-
peridial hyphae. E. Endoperidial hyphae. E Tramal hyphae. Scale bars: A = 0.5 cm; B = 3.5 um;
C = 28 um; D, F= 14 um; E= 18 um.
Scleroderma spp. new to Pakistan ... 45
tough, often two basidiomata arise from the same tuft of mycelium.
RHIZOMORPHS white, thick, growing individually or in small groups. PERIDIUM
thin, <lmm thick, pale yellow to brown; basal portion smooth, without scales,
off white to pale yellow, upper part with brown spots like scales, dehiscence by
tearing away the apical portion. GLEBA powdery, dark purplish.
Basip1ospores brown, globose, echinulate, never reticulate, 12-18 um
in diam., echines <2.5 um long. TRAMAL HypuHaeE rarely septate, branched,
hyaline, with few amorphous material encrusted, <5.5 um wide, wall thickness
<1 um. ExoperiIpIuM composed of aseptate, branched hyphae, <7 um wide,
wall thickness <2.5 um. MESOPERIDIUM composed of aseptate, branched
hyphae, wall encrusted, <7 um wide, wall thickness 2.6 um. ENDOPERIDIUM
composed of septate, branched hyphae, <6.6 um wide, wall thickness <2.8 um.
SPECIMEN EXAMINED: PAKISTAN: KHYBER PAKHTUN Kuwa, Khanspur, Ayubia, ca.
2575 maz.s.L, solitary on ground, in Himalayan moist temperate forest, 12 Aug. 2007, N.
Yousaf NYG04 (LAH 120807).
ComMENTs: The ectomycorrhizal S. areolatum is a poisonous species (Yamada
& Katsuya 1995, Mason et al. 2000, Chen et al. 2006a,b) that is characterized
by non-reticulate, densely echinulate basidiospores, a distinctive diagnostic
feature, as other Scleroderma spp. examined have reticulate and sub-reticulate
basidiospores. Scleroderma areolatum is widely distributed in Asia, Australia,
Europe, North America, and South America (Lu et al. 1999, Giachini et al.
2000, Kasuya et al. 2002, Barroetavenia et al. 2005, Chen et al. 2006b).
Scleroderma chevalieri Guzman, Ciencia Méx. 25: 202 (1967) Fig. 2
BASIDIOMA epigeous, 45 mm broad, 40 mm high, subglobose, attached to
the substratum via a tuft of mycelium, latter some time aggregated to form
pseudostipe. RHIZOMORPHS white, thick. PERIDIUM <1 mm thick, hard, rough,
covered with patches of scales, mature specimen cracked at the upper portion,
dehiscence by the irregular splitting of the peridium. GLEBA pulverulent, pale
yellow, brown to olivaceous.
BasIp1ospores brown, globose, echinulate, partially reticulate or sub
reticulate, 11-17 um in diam., echines <3 um long. TRAMAL HyPHAE aseptate,
branched, hyaline, with clamp connections, <5.3 um wide, wall thickness <1.3
um. EXOPERIDIUM composed of septate, unbranched hyphae; <8.8 um wide,
wall thickness <2.0 um. MESOPERIDIUM composed of aseptate, unbranched
hyphae, clamp connections rarely present; <9.5 um wide, wall thickness <2.4
uum. ENDOPERIDIUM composed of aseptate, unbranched hyphae, <9.5 um wide,
wall thickness 2.5 um.
SPECIMEN EXAMINED: PAKISTAN: KHYBER PAKHTUN Kuwa, Nathia Gali, ca. 2501 m
a.s.l., in groups, on ground, under Abies pindrow in Himalayan moist temperate forest,
25 Aug. 2006, N. Yousaf NYGO3 (LAH 250806).
46 ... Yousaf, Khalid & Niazi
Fic. 2: Scleroderma chevalieri. A. Basidiome (weathered). B. Basidiospores. C. Exoperidial hyphae.
D. Mesoperidial hyphae. E. Tramal hyphae. F. Endoperidial hyphae. Scale bars: A = 0.8 cm; B = 3.5
um; C = 16 um; D = 18 um; E = 10 um; F = 24 um.
Comments: Like other members of Scleroderma, S. chevalieri has a hard,
tough peridium and is characterized by a subglobose basidioma with short
pseudostipe. It has large ornamented basidiospores with a sub-reticulum and
peridium <1 mm thick. Scleroderma sinnamariense Mont. and S. stellatum Berk.,
also have a similar peridial thickness and partially reticulate spores. However,
S. sinnamariense has a colored peridium with lemon yellow to black scales and
smaller spores, and S. stellatum has a star-shaped opening and smaller spores
(Sims et al. 1995).
Scleroderma spp. new to Pakistan ... 47
Fic. 3: Scleroderma dictyosporum. A. Basidiome. B. Basidiospores. C. Exoperidial and mesoperidial
hyphae. D. Endoperidial hyphae. Scale bars: A = 0.6 cm; B = 3.5 um; C = 28 um; D = 10 um.
Scleroderma dictyosporum Pat., Bull. Soc. Mycol. Fr. 12: 135 (1896) Fic. 3
BASIDIOMATA epigeous, <30 mm broad and 30 mm high, globose to sub-
globose, dull brown, with well-developed mycelial base often produced into
a pseudostipe; several fruit bodies arising from a single stalk. PERIpDIUM <1
mm thick, tough, relatively smooth, elastic, brittle in dried specimen cuticle
A8 ... Yousaf, Khalid & Niazi
breaking into scales; scales black, thin, denser on top, spot-like; dehiscence by
an irregular rupturing of an apical part. GLEBA firm, compact, powdery with
age, grayish to sepia, lighter towards the center.
Basipiospores brown, globose, echinulate-reticulate, 12-15 tm in diam.,
echines <4 um long, young spores without reticulum, nurse cells prominent
in the mount. TRAMAL hyphae hyaline, thin-walled, with clamp connections.
EXOPERIDIUM composed of fascicles of erect hyphae, dark orange to brown,
<6.5 um, thick-walled, encrusted. MEsopERIDIUM with globose elements,
hyaline (yellowish in mass), <6 um in diam., thin-walled, mixed with long
hyaline hyphae. ENDOPERIDIUM composed of septate, branched, hyaline
hyphae, surrounding the gleba, hyphae <6 um wide, thin-walled.
SPECIMEN EXAMINED: PAKISTAN: KHYBER PAKHTUN Kuwa, Naran (Kaghan valley),
ca. 3350 ma.s.l., solitary on sandy soil, 23 Sep. 2009, N. Yousaf NYGO1 (LAH 230909).
ComMENTs: Scleroderma dictyosporum is an ectomycorrhizal species (Mukerji
et al. 2000, Rai et al. 2009) and is distinguished by its globose basidioma
with shorter pseudostipe, thin peridium (<lmm), echinulate-reticulate
basidiospores (12.5-15.0 um) with echines <4 um. This species is close to
S. fuscum (Corda) E. Fisch., but the latter has smooth peridium, absence of
stipe and larger basidiospores (<17 um).
Key to Scleroderma species from Pakistan
Le Basicdiosporeswetic ulate +0. vasa vaste none Noaute vonte lend tne Bmiah dig oa ea we p
1b. Basidiospores echinulate or verrucose, never reticulate ..................-2000- 5
2a. Basidiospores partially, to subreticullate oon. fiF va ceiet 8 eine Benes Yt ane eee et ale 3
2beBasidiospores‘completely reticulation #ut.s9 Fut et.. une thee tae Oe eat at a 4
3a. Basidiospores 11-17 «sm in diam., echines <3.0 umlong............. S. chevalieri
3b. Basidiospores 5-8 ttm in diam., echines <lum long............. S. sinnamariense
4a. Basidiospores 12-15 um in diam., echines <4 um long............ S. dictyosporum
4b. Basidiospores 11-16 um in diam., echines <1 um long................. S. bovista
5a. Basidiospores. 8=13 wi, . ya. os tas ¢ steno ities steals sine (Mlgale oa Gale e¥ gos Ee 6
Dbe basidiospores larger, OTS ui FG yi Bec sa. Page let Setgd load Page loa Mugs ieadtrede baba ade baka kh 7
6a. Basidiospores 8-13 tm, echines >1 um long...................00. S. verrucosum
6b. Basidiospores 8.5-12 um, echines <1 um long.................. 0. eee eee S. cepa
7a. Basidiospores 12-18 tm, echines >2.5 um long..................06. S. areolatum
7b. Basidiospores 10-14 um, echines <1.5 um long...................004 S. flavidum
Acknowledgements
The authors are thankful to Dr. Taiga Kasuya (Laboratory of Plant Parasitic Mycology,
University of Tsukuba, Japan) for helping in the verification of Scleroderma areolatum.
We are also grateful to Prof. G. Moreno of the Dpt. Biologia Vegetal (Botanica), Fac.
Scleroderma spp. new to Pakistan ... 49
Biologia, Univ. Alcala Henares, Madrid, Spain and Ms. Larissa Trierveiler Pereira
in the Department of Botany, Biosciences Institute, UFRGS, Brazil for suggestions
of improvements of earlier versions of the manuscript and acting as pre submission
reviewers. This work was financially supported by Higher Education Commission
(HEC), Pakistan under the “Indigenous Ph.D. Fellowship Scheme 5000 Batch VI”.
Literature cited
Ahmad §S, Iqbal SH, Khalid AN. 1997. Fungi of Pakistan. Sultan Ahmad Mycological Society of
Pakistan, Lahore.
Barroetavenia C, Rajchenberg M, Cazares E. 2005. Mycorrhizal fungi in Pinus ponderosa introduced
in Central Patagonia (Argentina). Nova Hedwigia 80(3-4): 453-464.
Baseia IG, Galvao TCO. 2002. Some interesting gasteromycetes (Basidiomycota) in dry areas from
North Eastern Brazil. Acta Botanica Brasilica 16(1): 1-8.
http://dx.doi.org/10.1590/S0102-33062002000100002
Chen YL, Dell B, Malajczuk N. 2006a. Effect of Scleroderma spore density and age on mycorrhiza
formation and growth of containerized Eucalyptus globulus and E. urophylla seedlings. New
Forests 31(3): 453-467. http://dx.doi.org/10.1007/s11056-005-0880- 1
Chen YL, Kang LH, Malajczuk N. Dell B. 2006b. Selecting ectomycorrhizal fungi for inoculating
plantations in south China: effect of Scleroderma on colonization and growth of exotic
Eucalyptus globulus, E. urophylla, Pinus elliottii, and P. radiata. Mycorrhiza 16(4): 251-259.
http://dx.doi.org/10.1007/s00572-006-0039-8
Giachini AJ, Oliveira VL, Castellano MA, Trappe JM. 2000. Ectomycorrhizal fungi in Eucalyptus
and Pinus plantations in Southern Brazil. Mycologia 92(6): 1166-1177.
http://dx.doi.org/10.2307/3761484
Guzman G. 1970. Monografia del género Scleroderma Pers. emend. Fr. Darwiniana 16: 233-407.
Iqbal SH, Kasuya T, Khalid AN, Niazi AR. 2006. Lysurus pakistanicus, a new species of Phallales
from Pakistan. Mycotaxon 98: 163-168.
Jeffries P. 1999. Scleroderma. 187-200, in: JWG Cairney, SW Chambers (eds). Ectomycorrhizal
fungi: Key genera in profile. Springer, Berlin.
Kasuya T, Guzman G, Ramirez-Guillén F, Kato T. 2002. Scleroderma laeve (Gasteromycetes,
Sclerodermatales), new to Japan. Mycoscience 43(6): 475-476.
Khalid AN, Iqbal SH.1996. New gasteromycetes from Pakistan. Sultania 1: 97-102.
Khalid AN, Iqbal SH. 2004. Calvatia ahmadii sp. nov., from Pakistan. Pakistan Journal of Botany
36: 669-671.
Kirk PM, Cannon PF, Minter DW, Staplers JA. 2008. Ainsworth and Bisby’s dictionary of the fungi.
Wallingford: CAB International.
Lu X, Malajczuk N, Brundrett M, Dell B. 1999. Fruiting of putative ectomycorrhizal fungi under
blue gum (Eucalyptus globulus) plantations of different ages in Western Australia. Mycorrhiza
8(5): 255-261. http://dx.doi.org/10.1007/s005720050242
Marshall NL. 1904. The mushroom book. Doubleday, Page & Company.
Mason PA, Ingleby K, Munro RC, Wilson J, Ibrahim K. 2000. The effect of reduced phosphorus
concentration on mycorrhizal development and growth of Eucalyptus globulus Labill. seedlings
inoculated with 10 different fungi. Forest Ecology and Management 128: 249-258.
Moreno G, Khalid AN, Alvarado P. 2009. A new species of Phallus from Pakistan. Mycotaxon 108:
457-462. http://dx.doi.org/10.5248/108.457
Mukerji KG, Chamola BP, Singh J (eds). 2000. Mycorrhizal biology. Springer, Science. 336 p.
50 ... Yousaf, Khalid & Niazi
Rai M, Bridge PD (eds). 2009. Applied mycology. CABI. 318 p.
Razzaq A, Shahzad S. 2004. Pisolithus tinctorius, a new record from Pakistan. Pakistan Journal of
Botany 36(2): 449-451.
Razzaq A, Shahzad S. 2007. Geastrum sessile and G. vulgatum, new records from Pakistan. Pakistan
Journal of Botany 39(6): 2193-2194.
Sims KP, Watling R, Jeffries P. 1995. A revised key to the genus Scleroderma. Mycotaxon 56:
403-420.
Sims K, Watling R, Cruz R de la, Jeffries P. 1997. Ectomycorrhizal fungi of the Philippines:
a preliminary survey and notes on the geographic biodiversity of the Sclerodermatales.
Biodiversity and Conservation 6: 45-58. http://dx.doi.org/10.1023/A:1018371515051
Sultan A, Nazir K, Ayub N. 2001. Some common species of fleshy macromycetes (Discomycetes,
Gasteromycetes and Agaricales) from Margalla hills national park and adjacent areas. Pakistan
Journal of Botany 33(special Issue): 709-721.
Sultana K, Gul M, Firdous SS, Asghar R. 2007. Hymenomycetes from Multan District. Pakistan
Journal of Botany 39(2): 651-657.
Yamada A, Katsuya K. 1995. Mycorrhizal association ofisolates from sporocarpsand ectomycorrhizas
with Pinus densiflora seedlings. Mycoscience 36(3): 315-323.
http://dx.doi.org/10.1007/BF02268607
Yoshimi S. 2000. Gasteromycetes (Basidiomycota) in the Fukiage Gardens of the Imperial Palace,
Tokyo (in Japanese with English summary). Memoirs of the National Science Museum Tokyo
34: 321-326.
Yoshimi S. 2002. Taxonomic study of the Japanese taxa of Scleroderma Pers. (in Japanese with
English summary). Nippon Kin Gakkai Kaiho 43(1): 3-18.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.51
Volume 122, pp. 51-59 October-December 2012
Aphyllophoroid fungi from Sonora, México 2. New records from
Sierra de Alamos-Rio Cuchujaqui Biosphere Reserve
RICARDO VALENZUELA’, TANIA RAYMUNDO’,
Cony DECOCK? & MARTIN ESQUEDA?*
‘Laboratorio de Micologia, Departamento de Botanica, Escuela Nacional de Ciencias Bioldgicas,
I.P.N. Apartado Postal 256, Centro Operativo Naranjo, Col. Santa Maria,
México, D.E 02600, México
*Mycothéque de l'Université catholique de Louvain (MUCL, BCCM"),
Earth and Life Institute-Mycology, Université catholique de Louvain,
Croix du Sud 3, 1348 Louvain-la-Neuve, Belgium
°Centro de Investigacién en Alimentacion y Desarrollo,
A.C. Apartado Postal 1735, Hermosillo, Sonora 83000, México
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Gyrodontium sacchari, Leiotrametes menziesii, Phellinus glaucescens, and
P. shaferi are described as new records from México. The specimens were collected on dead or
living wood in tropical deciduous forest in the Sierra de Alamos-Rio Cuchujaqui Biosphere
Reserve located in Sonora State, México.
Key worps — Trametes, taxonomy, chorology
Introduction
The Sierra de Alamos—Rio Cuchujaqui Biosphere Reserve has an extension
of 92,899 ha and is located in south of State of Sonora, México. It presents an
extraordinary biological richness, with approximately 1100 species of plants
distributed in xerophilous scrub, tropical deciduous forest and oak-pine forest
(CONANP 2007). The aphyllophoroid fungi are heterogeneous groups of several
taxa of macrofungi that are very abundant in this region, mainly on live and
dead wood. In this study four species are described for the first time for México:
Gyrodontium sacchari (Coniophoraceae, Boletales), Phellinus glaucescens and
P. shaferi (Hymenochaetaceae, Hymenochaetales), and Leiotrametes menziesii
(Polyporaceae, Polyporales).
Materials & methods
The examined specimens were collected from Sonora State in September 2006 and
are deposited in ENCB Herbarium with duplicate in CESUES. Herbarium ENCB is
52 ... Valenzuela & al.
abbreviated according to Thiers (2012). Morphological examinations followed protocols
outlined by Ryvarden (1991) and Cifuentes et al. (1986). Keys in parentheses after
colors in basidioma descriptions follow the Methuen Handbook of Colour (Kornerup
& Wanscher 1978). Measurements of anatomical characters were taken from rehydrated
tissues in 5% aqueous KOH and amyloid reactions were taken with Melzer’s reagent.
Longitudes and latitudes were obtained with GPS etrex (garmin). Line drawings were
made to scale using a camera lucida attached to a light microscope. The macro-photos
were taken with a Nikon Coolpix 4300.
Taxonomy
Gyrodontium sacchari (Spreng.) Hjortstam, Mycotaxon 54: 186, 1995. FIGS 1-5
BASIDIOMES annual, 40-50 mm broad and up to 100 mm long, resupinate to
effuse-reflexed, subpileate to pileate, fleshy to spongy, easily separable from the
substratum. PILEUS poorly to well development, conchate in some parts, soft to
spongy, white. MARGIN obtuse and thick in pileus, acute at effused parts, sterile,
membranaceus, spongy to cottony, white, width, up to 12 mm. HYMENOPHORE
tuberculate appearance in young parts, aculeate to distinctly hydnoid in mature
parts; aculei mainly flattened, some cylindrical, up to 5 mm long, yellow
(2-3A8), sulphur yellow (1A5), olive yellow (2-3D8) to olive green (3D7),
reddish-brown (8E8) when the spores covering the surface. CONTEXT or
subiculum up to 5 mm thick, soft to spongy, cottony, white.
HYPHAL SYSTEM monomitic; GENERATIVE HYPHAE simple septate, hyaline
to yellowish in KOH, inamyloid, simple to branched, mainly thin-walled,
some thick-walled, 2.4-8 um diam. HYMENOPHORAL TRAMA with parallel to
subparallel hyphae, hyaline to yellowish in KOH, simple to slightly branched,
thin-walled, 2.4-4.8 um diam. CONTEXTUAL HYPHAE slightly interwoven,
hyaline in KOH, simple to branched, thin to thick-walled, 4-8 um diam. CLAMP
CONNECTIONS absent. CYSTIDIA absent. BASIDIA 10.8-15 X 4-6.4 um, clavate,
hyaline in KOH, tetra-spored, sterigmata up to 3 um long. BASIDIOSPORES
4-5.6 x 2.4-3.2 um, ellipsoid to elongate, yellowish brown in KOH, inamyloid
to weak dextrinoid, thick-walled, smooth.
ECOLOGY & DISTRIBUTION— Gyrodontium sacchari grows on live legume
wood in tropical deciduous forests, causing a brown rot. Carlier et al. (2004)
mentioned that this pantropical species has been recorded on all continents. It
is known from Ethiopia, Tanzania, and Zimbabwe in Africa (Hjortstam 1987,
Carlier et al. 2004), Thailand (Carlier et al. 2004) in Asia, from Guadeloupe,
Brazil (Hjortstam 1995) and French Guyana (Carlier et al. 2004) in South
America. In México it was found in the municipality of Alamos, Sonora State.
REPRESENTATIVE SPECIMEN EXAMINED — MEXICO. Sonora: municipality of Alamos,
Palo Injerto (27°02'50.9"N 108°43'57.9"W) elev. 425 m, 13.1X.2006, R. Valenzuela 13068
(ENCB, CESUES).
Aphyllophoroid fungi new for Mexico ... 53
Fics 1-10: Gyrodontium sacchari: 1. Basidiospores. 2. Basidia. 3. Hyphae of hymenophoral trama.
4-5. Basidiomes. Leiotrametes menziesii: 6. Basidiospores. 7. Basidia. 8. Hyphae of hymenophoral
trama. 9-10. Basidiomes.
54 ... Valenzuela & al.
CoMMENTS— Gyrodontium sacchariis characterized by a resupinate to an effuse-
reflexed basidiome, yellow to olive green hydnoid hymenophore, monomitic
hyphal system with simple septate generative hyphae, and small thick-walled
smooth yellowish brown basidiospores. The monotypic Gyrodontium can be
confused with Serpula species, but the meruloid hymenophore and clamped
generative hyphae easily separate both genera (Hjortstam 1987). Phylogenetic
analysis indicates that Gyrodontium and Coniophora share clampless generative
hyphae and are related, but Coniophora has a smooth hymenophore and forms
exclusively resupinate basidiomes (Carlier et al. 2004).
Leiotrametes menziesii (Berk.) Welti & Courtec., Fungal Diversity 55: 60, 2012
FIGs 6-10
BASIDIOMES annual, 60-120 x 30-70 x 10-30 mm, pileate-sessile, imbricate,
connate, corky in consistency. pILEUS dimidiate to broadly attached, conchate,
semicircular, velutinous to glabrous, azonate or with narrow zones to the
margin, whitish, pale yellow (4A2, 4A3) to ochraceous yellow (5C7) with
brownish grey (5D7) in young specimens, ochraceous yellow (5C7), orange
grey (5B2), grayish orange (5B3), brown (6E4) with spots grayish brown (6E3),
brownish gray (6E2) to gray (6E1) in mature specimens. MARGIN sterile, thin,
acute, lobed in some specimens, recurved, whitish to brown (6E8) or dark
brown (7F4); pale gray (5D1) to black in dry specimens. HYMENOPHORE poroid,
white to cream color (4A3), with tones straw yellow (4A4) in some parts, gray
(5D1) or pale brown (6D3) in others; porEs rounded to irregular in shape, 5-7
per mm, with the dissepiments entire to slightly lacerated; TUBES up to 10 mm
deep, concolorous with the pores. CONTEXT up to 20 mm thick, homogeneous,
dense, zonate, white to pale yellow (4A2, 4A3).
HYPHAL SYSTEM trimitic, GENERATIVE HYPHAE with clamp connections,
hyaline in KOH, inamyloid, simple to branched, thin-walled, 2.4-3.2 um in
diam.; SKELETAL HYPHAE hyaline in KOH, inamyloid, unbranched, thick-
walled to solid, 3.2-6.4 um in diam., some swollen up to 10 um broad;
BINDING HYPHAE hyaline in KOH, inamyloid, thin-walled to thick-walled, very
branched, 2.4-4 um diam. HYMENOPHORAL TRAMA with interwoven hyphae,
generative hyphae hyaline, thin-walled, simple to slightly branched, 2.4-3.2
um wide; skeletal hyphae yellowish hyaline, unbranched, thick-walled, 3.2-5.6
um broad; binding hyphae hyaline in KOH, inamyloid, thin-walled to thick-
walled, very branched, 2.4—4 um diam. CONTEXTUAL HYPHAE Very interwoven,
generative hyphae hyaline, simple to branched, thin-walled, 2.4-3.2 um wide;
skeletal hyphae hyaline, unbranched, thick-walled to solid, 3.2-6.4 um in
broad; binding hyphae hyaline in KOH, inamyloid, thin-walled to thick-walled,
very branched, 2.4—4 um diam. STERILE CELLS absent. BASIDIA 12-16 x 4.8-6.4
um, clavate, tetra-spored, hyaline in KOH, with sterigmata up to 4 um long.
Aphyllophoroid fungi new for Mexico ... 55
BASIDIOSPORES 4.4-6.4 x 1.5-2.4 um, cylindrical, hyaline in KOH, inamyloid,
thin-walled, smooth.
ECOLOGY & DISTRIBUTION— Leiotrametes menziesii grows on dead legume
wood in tropical deciduous forests and causes a white rot. Ryvarden & Johansen
(1980) regard this species, widely distributed in Africa, Asia, Australia, and
Pacific Islands, as paleotropical. It has been cited (as Trametes menziesii) from
Malaysia (Corner 1989), Papua New Guinea (Quanten 1997), and (in South
America) Costa Rica (Carranza & Ruiz-Boyer 2005), Guyana (Aime et al.
2003), and Martinique (Welti et al. 2012). The most northernmost report of
L. menziesii is from two sites in Sonora state, México.
REPRESENTATIVE SPECIMEN EXAMINED — MEXICO. SONORA: municipality
of Alamos, El Aguaje (26°56'45.9"N 108°45'48.9"W) elev. 450 m, 14.1X.2006, R.
Valenzuela 13106 (ENCB, CESUES); El Platanar, (26°59'26.7"N 108°40'40.4"W) elev.
635 m, 14.1X.2006, R. Valenzuela 13137 (ENCB, CESUES).
CoMMENTS— Leiotrametes menziesii is very variable in basidiome size, shape,
and color, but it can be distinguished by the numerous gray tones (mainly
towards the base) in mature specimens and spore size. Quanten (1997)
mentioned the size differences for basidiospores cited by Cunningham (1965),
Ryvarden & Johansen (1980), and Corner (1989), and the Mexican specimens
are very close to or within the range given by these authors. The morphological
features of Mexican specimens agree with those given by Ryvarden & Johansen
(1980) and Quanten (1997).
Phellinus glaucescens (Petch) Ryvarden, Norw. Jour. Bot. 19: 234, 1972. Figs 11-15
BASIDIOMESs perennial, 80-100 x 45-60 x 5-8 mm, resupinate, becoming
widely effused, adnate, corky. MARGIN sterile, up to 1 mm wide, dark brown
(6F5) to black with age, matted, fimbriate. HYMENOPHORE poroid, cracked with
age, PORES circular to angular, 6-8(-9) per mm, grayish brown (7D3-4) (8D3),
light brown (6D8), golden brown (5D7), yellowish brown (5E7), cocoa brown
(6E6), umber (6F6) to dark brown (6F7), iridescent, light brown (6D5) when
moved, edges thin and entire; TUBES up to 7 mm deep, indistinctly stratified,
tough to woody, yellowish brown (5E7), cocoa brown (6E6) to reddish brown
(8E8). CONTEXT or subiculum up to 1 mm thick, yellowish brown (5E8) to
reddish brown (8E8), fibrous, tough, azonate.
HYPHAL SYSTEM dimitic, GENERATIVE HYPHAE simple septate, hyaline to
pale yellow in KOH, simple to slightly branched, thin-walled, 1.6-3.2 um in
diam; SKELETAL HYPHAE yellowish brown to reddish brown, unbranched or
with rare branched, thick-walled, 3.2-5.6 um in diam. HYMENOPHORAL TRAMA
with parallel to subparallel hyphae, generative hyphae hyaline to pale yellow
in KOH, thin-walled to thick-walled, simple to slightly branched, 2.4-4 um
wide; skeletal hyphae yellowish brown to reddish brown in KOH, unbranched,
56 ... Valenzuela & al.
thick-walled, 3.2-5 um in diam. CONTEXTUAL TRAMA with slightly interwoven
hyphae, generative hyphae hyaline in KOH, simple to scarcely branched, thick-
walled, 1.6-2.4 um wide; skeletal hyphae pale yellow in KOH, unbranched, thick-
walled, 2.4-3.2 um in diam. HYMENIAL SETAE 14-20 X 4.8-6.4 um, ventricose to
ventricose-rostrate, reddish brown to dark brown, thick-walled. Basip1A 10-14
x 5.6-6.4 um, clavate, tetra-spored, hyaline in KOH. Basip1ospores 4-4.8 x
3.2-4.0 um, broadly ellipsoid to subglobose, pale yellow to yellowish brown in
KOH, inamyloid, slightly thick-walled, smooth.
ECOLOGY & DISTRIBUTION— Solitary, growing on dead angiosperm wood
in tropical deciduous forests. This species is also known from Africa and Asia
(Ryvarden & Johansen 1980, Larsen & Lombard 1988, Larsen & Cobb-Poulle,
1990). The first record from the Americas is in México, where P. glaucescens was
found in the State of Sonora.
REPRESENTATIVE SPECIMEN EXAMINED — MEXICO. SONORA: municipality of
Alamos, El Sabinito (27°00'5.5”N 108°48'14.2" W) elev. 377 m, 16.1X.2006, R. Valenzuela
13173, 13175 (ENCB, CESUES).
CoMMENTS— Within Phellinus, P. glaucescens belongs to the resupinate species
complex, from which it is separated by the combination of basidiome color,
small pores, the presence of hymenial setae, and spore size, shape, and color. A
similar species that has been cited from the area, Inonotus tropicalis (M.J. Larsen
& Lombard) T. Wagner & M. Fisch. (Raymundo et al. 2009), has a resupinate
basidiome, small pores, and similar basidiospores but is distinguished by its
annual to biennial fruiting pattern, fasciculate or clustered hymenial setae, and
a monomitic to pseudodimitic hyphal system.
Phellinus shaferi (Murrill) Ryvarden, Norw. Jour. Bot. 19: 235, 1972. Fics 16-20
BASIDIOMES perennial, 90-140 x 40-70 x 4-7 mm, resupinate, widely
effused, adnate, tough to woody. MARGIN sterile, up to 1 mm wide, brownish
yellow (5C7), golden brown (5D7) to light brown (6D8), dark brown (6F5)
to black with age, matted, fimbriate. HYMENOPHORE poroid, cracked with
age, PORES circular to angular, 5-6 per mm, yellowish brown (5E7) to reddish
brown (8E8), dark brown (6F7) with age, edges thin and entire; TUBES up to
3 mm deep, tough to woody, yellowish brown (5E7) to reddish brown (8E8).
CONTEXT or subiculum up to 1 mm thick, yellowish brown (5E8) to reddish
brown (8E8), fibrous, tough, azonate.
HYPHAL SYSTEM dimitic, GENERATIVE HYPHAE simple septate, hyaline to
pale yellow in KOH, simple to slightly branched, thin-walled, 2.4-3.2 um in
diam; SKELETAL HYPHAE golden brown to reddish brown, unbranched, thick-
walled, 2.4-5.0 um in diam. HYMENOPHORAL TRAMA with slightly interwoven
hyphae, generative hyphae hyaline to pale yellow in KOH, thin-walled, simple
to slightly branched, 2.4-3.2 um wide; skeletal hyphae golden brown to reddish
Aphyllophoroid fungi new for Mexico ... 57
Fics 11-20: Phellinus glaucescens: 11. Basidiospores. 12. Hymenial setae. 13. Hyphae of
hymenophoral trama. 14-15. Basidiomes. Phellinus shaferi: 16. Basidiospores. 17. Cystidioles. 18.
Hymenial setae. 19. Hyphae of hymenophoral trama. 20. Resupinate basidiome.
58 ... Valenzuela & al.
brown in KOH, unbranched, thick-walled, 3.2-5 um in diam. CONTEXTUAL
TRAMA with slightly interwoven hyphae, generative hyphae hyaline to pale
yellow in KOH, simple to scarcely branched, thick-walled, 1.6-2.4 um wide;
skeletal hyphae yellowish brown in KOH, unbranched, thick-walled, 2.4-4.0
um in diam. HYMENIAL SETAE 16-22.4 X 5.6-9.6 um, ventricose to ventricose-
rostrate, reddish brown to dark brown, thick-walled. CySTIDIOLES 24-26 x
7.2-8.8 um, subulate to ventricose-rostrate, hyaline in KOH. BAsip1a not
observed. BASIDIOSPORES 4-4.8 x 3.2-4.0 um, subglobose, pale yellow to rusty
brown in KOH, inamyloid, thin-walled, smooth.
ECOLOGY & DISTRIBUTION — Solitary, growing on dead angiosperm wood
in tropical deciduous forests. Previously known from Montserrat in the West
Indies, Panama, and Venezuela (Ryvarden 2004), in México P. shaferi was found
in Sonora State.
REPRESENTATIVE SPECIMEN EXAMINED — MEXICO. SONORA: municipality of
Alamos, El Aguaje (26°56'45"N 108°45'48”W) elev. 462 m, 14.IX.2006, R. Valenzuela
13099 (ENCB, CESUES).
ComMMENTS— Phellinus shaferi is characterized by its resupinate basidiomes,
pore size and shape, and basidiospore size and color. It is separated from
P. glaucescens by small pores (6-8 per mm). We follow Ryvarden (2004) in
placing this taxon in Phellinus, until molecular studies confirm whether it
would be better retained in Fuscoporella.
Acknowledgments
We wish to express our gratitude to Dr. Gabriel Moreno and Dr. Clarice Loguercio-
Leite for reviewing the manuscript and their useful comments. We also express our
gratitude to SEMARNAT- CONACYT (Grant 2002-C01-0409) for their financial
support. Valenzuela and Decock acknowledge the financial support from CONACyT
(México) and FNRS (Belgium), in the framework of the bilateral cooperation agreement
that allowed fieldwork in México, and a research visit of R. Valenzuela and T. Raymundo
at MUCL in 2011. R. Valenzuela and T. Raymundo thank COFAA and IPN for the
financial support for their research in the project SIP-20121207 and UNAM (PAPPIT)
for financial support in the project IN- 207311. Cony Decock gratefully acknowledges
the financial support received from the Belgian State-Belgian Federal Science Policy
(contract BCCMC3/10/003). Silvia Bautista Hernandez from the ENCB (IPN), kindly
prepared the final version of drawing lines. Aldo Gutierrez (CIAD) kindly prepared the
final version of the pictures and text.
Literature cited
Aime MC, Henkel TW, Ryvarden L. 2003. Studies in neotropical polypores 15: new and interesting
species from Guyana. Mycologia 95: 614-619. http://dx.doi.org/10.2307/3761937
Carlier FX, Bitew A, Castillo G, Decock C. 2004. Some Coniophoraceae (Basidiomycetes, Boletales)
from Ethiopian highlands: Coniophora bimacrospora, sp. nov. and a note on the phylogenetic
relationships of Serpula similis and Gyrodontium. Cryptogamie Mycologie 25(3): 261-275.
Aphyllophoroid fungi new for Mexico ... 59
Carranza J, Ruiz-Boyer A. 2005. Checklist of polypores of Costa Rica. Revista Mexicana de
Micologia 20: 45-52.
Cifuentes J, Villegas M, Pérez-Ramirez L. 1986. Hongos. In: Lot A, Chiang F (compiladores).
Manual de Herbario. Consejo Nacional de la Flora de México, A.C., México, D.E
CONANP [Comisién Nacional de Areas Naturales Protegidas]. 2007. Reserva de Biosfera Sierra de
Alamos — Rio Cuchujaqui. http://conanp.gob.mx [accessed March 2012].
Corner EJH. 1989. Ad Polyporaceas VI. The genus Trametes. Beihefte zur Nova Hedwigia 97:
1-197.
Cunningham GH. 1965. Polyporaceae of New Zealand. N. Zealand Dept. Sci. Industr. Res. Bull.
164: 1-304.
Hjortstam K. 1987. Studies in tropical Corticiaceae (Basidiomycetes) VII. Specimens from East
Africa collected by L. Ryvarden. I. Mycotaxon 28: 19-37.
Hjortstam K. 1995. Two new genera and some new combinations of corticioid fungi (Basidiomycotina,
Aphyllophorales) from tropical and subtropical areas. Mycotaxon 54: 183-193.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. 3" ed. Eyre Methuen, London.
Larsen MJ, Cobb-Poulle LA. 1990. Phellinus (Hymenochaetaceae). A survey of the world taxa.
Synopsis Fungorum 3: 1-206.
Larsen MJ, Lombard FF. 1988. Studies in the genus Phellinus I. The identity of Phellinus rickii with
notes on its facultative synonyms. Mycologia 80: 72-76. http://dx.doi.org/10.2307/3807495
Quanten E. 1997. The polypores (Polyporaceae s.1.) of Papua New Guinea. Opera Botanica Belgica
11. National Botanic Garden of Belgium, Meise. 352 p.
Ryvarden L. 1991. Genera of polypores. Nomenclature and taxonomy. Synopsis Fungorum 5:
1-363.
Ryvarden L. 2004. Neotropical polypores. Introduction, Ganodermataceae & Hymenochaetaceae.
Synopsis Fungorum 19: 1-229.
Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Fungiflora, Oslo. 636 p.
Thiers, B. 2012 [continuously updated]. Index Herbariorum: a global directory of public herbaria
and associated staff. New York Botanical Garden's Virtual Herbarium. [accessed February 2012:
http://sweetgum.nybg.org/ih/ ].
Welti S, Moreau PA, Favel A, Courtecuisse R, Haon M, Navarro D, Taussac S, Lesage-Meessen L.
2012. Molecular phylogeny of Trametes and related genera, and description of a new genus
Leiotrametes. Fungal Diversity 55: 47-64. http://dx.doi.org/10.1007/s13225-011-0149-2
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.61
Volume 122, pp. 61-67 October-December 2012
Passalora acrocomiae sp. nov. and Exosporium acrocomiae
from the palm Acrocomia aculeata in Puerto Rico
EDUARDO GUATIMOSIM, HENRIQUE JORGE PINTO
& ROBERT WEINGART BARRETO*
Departamento de Fitopatologia, Universidade Federal de Vicosa
Vicosa, Minas Gerais, 36570-000, Brazil
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Collections determined by J.A. Stevenson as Cercospora acrocomiae |= Exosporium
acrocomiae] from leaf spots of Acrocomia media [= A. aculeata] in Puerto Rico were re-
examined. Two different fungi were identified: a previously unnoticed authentic cercosporoid
taxon that we describe herein as Passalora acrocomiae and Exosporium acrocomiae, which we
illustrate here for the first time and for which we designate a lectotype to substitute for the
missing holotype.
Key worps —Arecaceae, phytopathogens, reappraisal, taxonomic novelties
Introduction
Acrocomia aculeata (Jacq.) Lodd. ex Mart. (Arecaceae) is a thorny medium
sized neotropical palm (Scariot & Lleras 1995). We present a reappraisal of
the available specimens of a fungus collected on A. media [= A. aculeata] in
Puerto Rico at the beginning of the 20" century. This dematiaceous fungus
has been placed in two disparate genera, Cercospora and Exosporium. Firstly
a description was given by Stevenson (1917) of the fungus as Cercospora
acrocomiae. Chupp (1954) later described the same fungus, annotating it
as “plainly an Exosporium,? Accepting Chupp’s opinion, Stevenson (1975)
recombined the taxon as Exosporium acrocomiae. The original Stevenson and
Chupp descriptions are very similar and fit best into the present concept of
Exosporium. A re-examination of the original material was undertaken to
confirm its placement in that genus.
Materials & methods
All relevant specimens were obtained as loans from BPI and CUP herbaria. Samples
were examined under a dissecting microscope and freehand sections of fungal structures
62 ... Guatimosim, Pinto & Barreto
or fungal structures scraped from colonized plant surfaces were mounted in lactic
acid or lacto-fuchsin. Observations of fungal structures and measurements, as well as
preparation of line drawings and photographs, were performed with an Olympus BX 51
light microscope fitted with a drawing tube and an Olympus E330 digital camera. Plates
were organized with CorelDraw X5. Wherever possible, 30 measurements of structures
from each fungus were made.
Taxonomy
Exosporium acrocomiae (J.A. Stev.) Chupp ex J.A. Stev.,
Contrib. Reed Herb. 23: 516, 1975. PLATE 1
MycoBank MB477989
= Cercospora acrocomiae J.A. Stev., Ann. Rep. Insular
Exp. Stat. Porto Rico 1916-17: 89, 1917.
ORIGINAL DESCRIPTION (Stevenson 1917: 89-90): “Primary spots amphigenous, few,
1-8 per pinnz: but areas between finally dying so as to make large continuous areas:
regular, oval, with definite margins neither raised nor sunken, .8-1.5, rarely 2 cm. long
by 3-6 mm. broad, rarely wider, at first red brown, then tricoloured, a central oval gray
area (.5-3 mm. x 2-6 mm.), enclosed by a dark-brown band, 2-3 mm. wide, with an
outer more or less irregular red-brown area, often no completely encircling the central
portions. Conidal [sic] fascicles hypophyllous, numerous, confined to the central gray
area, often in two distinct lines; conidiophores many to each fascicle, brown to olive
brown, 1-2 septate, erect to reclining, concolorous with the conidia, 32-70 x 5-8 mu.
Conidia 3-9 septate, long clavate, sometimes slightly curved, apical cell rounded, brown,
often constricted at the septze, 55-120 x 8-12 mu.”
SUPPLEMENTARY DESCRIPTION (Chupp 1954: 428): “Pinnae of older leaves are affected,
so that part or the whole leaf may finally be killed, single spots 8-20 x 3-6 mm., or
coalescing into large irregular areas, often with a central oval gray area enclosed by a dark
brown band, with an outer irregular reddish brown area; fruiting chiefly hypophyllous;
stromata dark to black, 40-100y in diameter; fascicles very dense; conidiophores dark
fuligeneous brown, septate, not geniculate, straight, curved, or tortuous, sometimes
wider near the tip or irregular in width, not branched, spore scars absent or indistinct,
4-8 x 30-70; conidia dark fuligeneous brown, straight to slightly curved, clavato-
cylindric to slightly attenuated toward the tip, obtuse ends, septa distinct, 3-9 in number,
5-10 (812) x 30-120 p?
Type: PUERTO RICO, Rio Piedras, on leaves of Acrocomia media |= A. aculeata], July
1917, J.A. Stevenson 6604 (Holotype, not located, presumed lost); 14 Feb. 1912, J.R.
Johnston [Stevenson 4206, 4206A] (Paratype = Lectotype designated here, BPI 432400;
isolectotypes, BPI 432402, CUP 039018).
Lesions on leaves subcircular to elliptic, with pale brown edges and paler
centre, 1.2-2.0 x 0.3-0.60 cm. Internal mycelium indistinct. External mycelium
absent. Stroma sub-epidermal, subglobose, erumpent, composed of dark brown
textura angularis, smooth. Conidiophores hypogenous, in dense fascicles
(of up to 20 conidiophores per fascicle), sub-cylindrical, straight to slightly
PLaTE 1. Exosporium acrocomiae. A: Leaf spot symptoms on leaves; B—C: Hypogenous caespituli;
D: Conidia and conidiophores; E-I: Conidia; J-K: Detail of conidiogenous loci. Bars: 20 um.
63
Exosporium & Passalora on Acrocomia aculeata ...
Ra
os
WlEs>
fy
CEL
s
64 ... Guatimosim, Pinto & Barreto
curved, occasionally geniculate at the apex, 40-70 x 4-5 um, 3-5 (mainly 3)-
septate, unbranched, thick-walled, pale brown to olivaceous-brown, smooth.
Conidiogenous cells terminal, integrated, sub-cylindrical, 10-32 x 5-7 um,
pale brown, smooth. Conidiogenous loci almost inconspicuous, one per cell,
1.0-2.0 um diam, thickened, not darkened. Conidia solitary, cylindrical,
30-100 x 5-10 um, truncate at the base, apex rounded, 3-9-distoseptate, 2-3
um diam at base, guttulate, pale brown to olivaceous-brown, smooth.
ADDITIONAL MATERIAL EXAMINED: PUERTO RICO, Rio Piedras, on Acrocomia media,
29 Jan. 1917, J.A. Stevenson 6175 (BPI 432399); 15 Jul. 1914, J.A. Stevenson No. 2090
(BPI 432397, 432398, 432401).
Passalora acrocomiae Guatimosim & R.W. Barreto, sp. nov. PLATE 2
MycoBank MB801218
Differs from Passalora eitenii by its denser cespituli, stromata of textura intricata, smaller
conidiophores, and absence of percurrently proliferating conidiogenous cells.
Type: Puerto Rico, Rio Piedras, on leaves of Acrocomia media [= A. aculeata], 15 Jul.
1914, J.A. Stevenson No. 2090 (Holotype, BPI 432397; isotypes, BPI 432398, 432401).
ErymMo_oey: from the host genus.
Lesions on leaves subcircular to elliptic, with pale brown edges and paler centre,
0.90-2.30 x 0.3-0.60 cm. Internal mycelium branched, 2.5 um diam., septate,
subhyaline. External mycelium absent. Stroma sub-epidermal, erumpent,
subglobose, 100-157 x 87-113 tm, composed of dense textura intricata,
pale brown, smooth. Conidiophores hypogenous, in dense fascicles (up to 20
conidiophores per fascicle), confined to the central gray area, often in two parallel
distinct lines, sub-cylindrical, straight to slightly curved, 90-105 x 5-7 um,
1-3-septate, unbranched, eguttulate, pale brown, smooth but with a distinctly
roughened apex. Conidiogenous cells terminal, integrated, sub-cylindrical,
37-55 x 6-8 um, pale brown, roughened. Conidiogenous loci conspicuous,
one per cell, discoid, 1.5-4 um diam. Conidia solitary, subcylindrical to slightly
clavate, obconically truncate at the base, apex rounded, 35-68 x 8-13 um,
1-3-septate, diam 2-4 um at base, hila somewhat thickened and darkened-
refractive, guttulate, pale brown to olivaceous-brown, mostly smooth but with
a distinctly roughened apex.
Discussion
Based on examination of the holotype (Stevenson 6604) and other original
collections, Chupp (1954) indicated that Stevenson’s Cercospora acrocomiae
was “plainly an Exosporium,” but did not publish a valid new combination.
Stevenson (1975) accepted Chupp’s opinion, and published the valid combination
Exosporium acrocomiae. The genus Exosporium Link (type species, E. tiliae
Link) is characterized by having typically darkened, thickened and prominent
conidiogenous loci (scars) and conidial hila. After careful examination of the
Exosporium & Passalora on Acrocomia aculeata ... 65
PLATE 2. Passalora acrocomiae. A-B: Hypogenous caespituli; C-D: Conidia and conidiophores.
Bars: 20 um; E: Detail of the upper part of a conidiophore (note distinctly roughened apex).
Bar: 5 um.
original collections of C. acrocomiae (all from the same locality, including
paratypes collected in 1912 and 1914 and an additional collection in 1917), we
concluded that, in fact, two different fungi are present associated with the leaf
spots on A. aculeata in Puerto Rico.
One is ubiquitous and is recognized as the fungus described by both authors,
although neither Stevenson nor Chupp published illustrations of their fungus.
66 ... Guatimosim, Pinto & Barreto
Although this fungus does not have the prominent, dark and thickened scars of
many other Exosporium species, it still is adequately placed in Exosporium.
The second fungus associated with the A. aculeata leaf spots represents a
novel species unnoticed by Stevenson and Chupp. This fungus is present only
in three herbarium specimens from one Stevenson paratype collection, where
it is much less common than E. acrocomiae. This new taxon bears the typical
features of cercosporoid fungi now placed, under the current concept for this
group, in Passalora (Crous & Braun 2003). Hence, the source of the confusion
that emerged during the present study was the combined occurrence of two
fungi on the same kind of lesions on one paratype collection of C. acrocomiae.
An additional complication is that, to the best of our knowledge, the
holotype of E. acrocomiae is now lost; a search in all potential deposit sites for
the holotype (BPI, CUP, ILL, ILS, UPRRP) failed to uncover this critical type
specimen. Therefore, we chose one of the two paratypes (Stevenson 4206 = BPI
432400) as lectotype for E. acrocomiae.
It is interesting that a similar leaf spot was collected in Brazil during an
ongoing study of the mycobiota of A. aculeata involving a third hyphomycete
— also belonging to Passalora but clearly distinct from P acrocomiae (pers.
obs.). Probably this palm species reacts to attack by different pathogenic fungi
by forming similar leaf spots.
Two Exosporium species have already been described on members of the
Arecaceae: Exosporium pulchellum Sacc. on Areca catechu L.and Orania palindan
(Blanco) Merr., both in the Philippines (Trotter 1931: 994-995; Teodoro 1937);
E. stilbaceum (Moreau) M.B. Ellis on Elaeis guineensis Jacq. in Africa and Asia;
and Elaeis sp. in Africa (Ellis 1971; Turner 1971; Pirozynski 1972; Liu 1977).
These two species have much longer conidiophores (<220 um long) and thicker
scars. Additionally E. stilbaceum forms conidia in chains and conidiophores
arranged in synnemata (Ellis 1971).
There is only one Passalora described on the Arecaceae: P. eitenii R.B.
Medeiros & Dianese on the Brazilian native palm Syagrus comosa (Matt.)
Mart. Passalora eitenii differs morphologically P acrocomiae by its sparser
caespituli, stromata of textura angularis, larger conidiophores, and percurrently
proliferating conidiogenous cells (Medeiros & Dianese 1994).
The search for a clarification of the status of Exosporium on A. aculeata
resulted in confirming its identity in this genus and the unexpected discovery
of an overlooked species of Passalora.
Acknowledgments
The authors wish to acknowledge Fundacao de Amparo a Pesquisa do Estado de
Minas Gerais (FAPEMIG) and Coordenacao de Aperfeigcoamento de Pessoal de Nivel
Superior (CAPES) for financial support, A. Rossman and A. Minnis (USDA) for helping
with the literature and herbarium search, U. Braun (Martin-Luther-Universitat, Halle)
Exosporium & Passalora on Acrocomia aculeata ... 67
and A. Hernandez-Gutiérrez (Universidade Federal do Para, Belem) for presubmission
reviews of the manuscript, and BPI for the loan of specimens.
Literature cited
Chupp C. 1954. A monograph of the fungus genus Cercospora. Published by the author, Ithaca.
Crous PW, Braun U. 2003. Mycosphaerella and its anamorphs: 1. Names published in Cercospora
and Passalora. Centraalbureau voor Schimmelcultures, Utrecht.
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew.
Liu PSW. 1977. A supplement to a host list of plant diseases in Sabah, Malaysia. Phytopathol. Pap.
21: 1-49.
Medeiros RB, Dianese JC. 1994. Passalora eitenii sp. nov. on Syagrus comosa in Brazil and a key to
Passalora species. Mycotaxon 51: 509-513.
Pirozynski KA. 1972. Microfungi of Tanzania. I. Miscellaneous fungi on oil palm. Mycol. Pap. 129:
Tse
Scariot A, Lleras E. 1995. Flowering and fruiting phenologies of the palm Acrocomia aculeata:
patterns and consequences. Biotropica 27: 168-173. http://dx.doi.org/10.2307/2388992
Stevenson JA. 1917. Report of the Department of Pathology and Botany. Annual Report of the
Insular Experiment Station of Porto Rico 1916-17: 37-98.
Stevenson JA. 1975. The fungi of Puerto Rico and the American Virgin Islands. Contribution of
Reed Herbarium No. 23. Baltimore.
Teodoro NG. 1937. An enumeration of Philippine Fungi. Technical Bulletin of the Department of
Agriculture Commonwealth. Manila 4: 1-585.
Trotter A. 1931. Supplementum universale, pars X. Sylloge Fungorum, vol. 25. Patavia. 1093 p.
Turner PD. 1971. Microorganisms associated with oil palm (Elaeis guineensis Jacq.). Phytopathol.
Pap. 14: 1-58.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.69
Volume 122, pp. 69-72 October-December 2012
A new Stigmella species associated with Lycium leaf spots
in northwestern China
YAN WANG *”, XIU-RONG CHEN ** & CHENG-DE YANG
‘College of Pratacultural Science, Gansu Agricultural University;
Key Laboratory of Grassland Ecosystem (Gansu Agricultural University),
Ministry of Education; Sino-U.S. Center for Grazingland Ecosystem Sustainability,
Lanzhou 730070, China
*Gansu College of Traditional Chinese Medicine, Lanzhou 730000, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — A new anamorphic species Stigmella lycii on Lycium chinense is described and
illustrated from Chinese material and compared with all known species of this genus. ‘This is
the first report of Stigmella species in China.
KEY worps — coelomycete, taxonomy
Introduction
While investigating medical plant diseases in Gansu province, China, during
2004 and 2011, a species of Stigmella Lév. was discovered that caused large,
circular, necrotic leaf spots on Lycium chinense Mill. in Jingtai county. Severe
infections caused by this pathogenic fungus usually resulted in premature leaf
and fruit fall. Based on careful morphological examination, we determined that
this pathogen represented a new species of Stigmella.
Materials & methods
The fungal specimens were cut by hand with a razor blade to make thin sections
of conidiomata for microscopical observation. The sections were mounted in water
and lactophenol cotton blue on slides. Morphological characteristics of pycnidia,
conidiogenous cells and conidia were carefully examined using light microscopy. For
scanning electron microscope (SEM) examinations, shortly after collection 5 mm
squares of fresh leaf tissue containing conidiomata were fixed overnight at 4°C in
2.5% glutaraldehyde in 0.1M phosphate buffer (pH 7.2), washed with glutaraldehyde
buffer, dehydrated in a 50-70-80-90-100% ethanol series for 15 min each, dehydrated
in acetone, critical point dried, sputter-coated with gold, and examined in a JSM-6380
operating at 30 kV. The examined specimens were deposited in the Herbarium of Gansu
Agriculture University (HGAU).
70 ... Wang, Chen & Yang
aor
| Ae PAS ae 2
ba
PLATE 1. Stigmella lycii. A. Leaf lesion. Arrow indicating a single stroma. B-C. Section through a
pycnidium with a layer of conidiogenous cells bearing conidia (B, by light microscopy; C, by SEM).
D-F. Muriform conidia, by light microscopy. G-H. Muriform conidia, by SEM. Bars: A = 400 um;
B = 50 um; C-F = 8 um.
Taxonomy
Stigmella lycii X.R. Chen & Yan Wang, sp. nov. PLATE 1.
MycoBank MB 800236
Differt ab omnibus speciebus Stigmellae pycnidiis distincte majoribus et conidiis quoque
majoribus.
Type: China, Gansu province, Jingtai county, Damiao village, on leaves of Lycium
chinense Mill. (Solanaceae), 22 October 2011, X.R. Chen & Y. Wang (Holotype, HGAU,
Herbarium of Gansu Agriculture University).
ErymMo.oey: Epithet derived from the host genus.
Early lesions on leaves visible as small, round, pale brown leaf spots, gradually
becoming larger necrotic blotches, somewhat zonate, with distinct margins, 2-8
mm diam. Lower leaves falling prematurely due to severe infections. Mycelium
entirely immersed in the leaf tissue, septate, branched, hyaline to pale brown.
Conidiomata pycnidial, immersed, erumpent at maturity, subglobose, blackish,
161-172 um diam, with thin walls up to 10 um diam, composed of one to three
layers of small, pale brown to dark brown cells and an inner textura prismatica
with thin-walled paler cells. Ostiole indefinite. Conidiogenous cells holoblastic,
determinate, discrete, doliiform to ampulliform, hyaline, smooth, formed from
the inner cells of the pycnidial wall. Conidia hyaline when young, at maturity
pale olive-brown and muriform, oval, ellipsoid, pyriform, irregular and
mulberry-shape, 19.9-52.8 x 12.8-32.9 um, composed of 12-35 cells. Conidial
cells small, irregular, subglobose, pale yellowish, 2.6-11.5 x 2.6-11.0 um.
Discussion
The coelomycetous genus Stigmella has an intricate history. Its type species,
S. dryina Lév. (Demidow 1842), was placed in the ‘Phyllostictei’ by Fuckel
Stigmella lycii sp. nov. (China) ... 71
(1870), along with representatives of Coniothyrium Corda, Phoma Sacc.,
Darluca Castagne, and other genera. Saccardo (1878) assigned ‘Stigmella dryina
(Corda) Lév (an incorrect author citation) to hyphomycetes, a practice followed
by subsequent authors. Bubak (1914) was the first to recognize the pycnidial
structure of S. dryina. Hughes (1952), who conducted the first modern revision
of Stigmella based on its type species, concluded from original descriptions that
most species attributed to this genus were hyphomycetes and not congeneric
with S. dryina. Sutton (1980) published a later description of the genus.
The two other species accepted in Stigmella are S. effigurata (Schwein.)
S. Hughes (= S. dryina; = S. dryophylla (Corda) Lindau; see Hughes 1958) and
the Indian S. tirumalensis Bagyan. et al. (Bagyanarayana et al. 1992). Based on
conidioma structure, conidiogenesis, and conidial morphology, the recently
collected Chinese fungus can clearly be allocated to Stigmella where it represents
a third species, S. lycii, that is easily distinguished from the other species by
much larger pycnidia and conidia with a distinctive cellular composition
(TABLE 1).
TABLE 1. Comparison of Stigmella effigurate, S. tirumalensis, and S. lycii
S. effigurata S. tirumalensis S. lycii
PYCNIDIA <100 um 40-100 um, 172-162 um
rarely $200 um
CONIDIA 12-20 x 7-10 um; 10-14 (-21) x 6-9 20-53 x 13-33 um,
6 transverse + variable um; <4 transverse comprising 12-35 small cells
longitudinal septa & 0-3 longitudinal (2.6-11.5 x 2.6-11 pm)
septa
Host/ Leaves of Quercus spp., Leaves of Leaves of
DISTRIBUTION Atriplex suberecta, Cassine glauca] Lycium chinense |
Chenopodium sp., India China
Eugenia sp., Senecio
mesogrammoides,
Stephania abyssinica |
Africa, Asia, Europe
Acknowledgements
The authors are grateful to Uwe Braun (Martin-Luther-University, Halle (Saale),
Germany) and Guo-Zhong Lu (Dalian Nationalities University, China) for critical
comments, corrections, and pre-submission reviews and appreciate the preliminary
species evaluation by Yong-Liang Wei (Gansu Agricultural University, China). This
study has been supported by the Gansu Herbal Medicine Industry Research Foundation,
project GYC11-01.
Literature cited
Bagyanarayana G, Braun U, Jagadeeswar P. 1992. Three new phytoparasitic fungi from India.
Mycotaxon 45: 105-108.
72... Wang, Chen & Yang
Bubak F. 1914. Ein Beitrag zur Pilzflora von Tirol und Istrien. Annales Mycologici 12: 215-219.
Demidow AN. 1842. Voyage dans la Russie Meridionale et al Crimeé, par Hongarie et al Moldavie.
Vol. 2. Paris.
Fuckel L. 1870. Symbolae mycologicae. Beitrag zur Kenntnis der rheinischen Pilze. Jahrbticher des
Nassauischen Vereins fiir Naturkunde 23-24: 1-459.
Hughes SJ. 1952. Studies on micro-fungi. XIV. Stigmella, Stigmina, Camptomeris, Polythrincium
and Fusicladiella. Mycological Papers 49: 1-25.
Hughes SJ. 1958. Revisiones hyphomycetum aliquot cum appendice de nominibus rejiciendis.
Canadian Journal of Botany 36(6): 727-836. http://dx.doi.org/10.1139/b58-067
Saccardo PA. 1878. Fungi veneti novi vel critici vel mycologicae Venetae addendi, Series VIII.
Michelia 1(2): 239-275.
Sutton BC. 1980. The Coelomycetes. Commonwealth Mycological Institute, Kew.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.73
Volume 122, pp. 73-82 October-December 2012
Tuber sinoaestivum sp. nov.,
an edible truffle from southwestern China
JiE-PING ZHANG*?, PEI-Gul Liu” & JUAN CHEN”?
' Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650201, Yunnan, China
? Graduate University of Chinese Academy of Sciences, Beijing 100049, China
> Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences &
Peking Union Medical College, Beijing 100194, P. R. China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Anew Tuber species, T. sinoaestivum, is described from southwestern China based on
morphological and molecular analyses. The new species, which was found fruiting in association
with Pinus armandii, has been previously misidentified as T. aestivum (=T: uncinatum). Although
morphologically quite similar, T. sinoaestivum differs from the European species by more
globose ascospores ornamented with a shallower reticulum. ITS sequence analyses show
only 92% similarity between the two species, further supporting the taxonomic separation of
T: sinoaestivum from T: aestivum.
Key worps —black truffles, Pezizales, phylogeny, taxonomy
Introduction
Chinese black truffles have attracted much scientific and commercial
interest since their export to Europe in the beginning of 1990s. Four black
truffle taxa have previously been reported from China: Tuber indicum complex,
T: formosanum, T. pseudohimalayense, and T: aestivum (Chen et al. 2005; Chen
& Liu 2011; Hu 1992; Manjon et al. 2009; Song et al. 2005; Wang et al. 1998,
2006; Zhang et al. 2005). The high morphological similarity between Chinese
and European black truffles has prompted intensive investigations on species
recognition and phylogenies (Bonito et al. 2010; Douet et al. 2004; Jeandroz et
al. 2008; Paolocci et al. 1997; Roux et al. 1999). Previous studies indicate that a
number of major Tuber clades are distributed across both China and Europe,
yet species within the two regions appear to be distinct from each other.
T. aestivum Vittad. (= T: uncinatum Chatin), a renowned culinary species
in Europe, is widely distributed across Nordic and Mediterranean regions
(Jeandroz et al. 2008). This species was reported as a new Chinese record
74 ... Zhang, Liu & Chen
based on ascomata sold at mushroom markets in Huidong, Sichuan (Chen
et al. 2005; Song et al. 2005). Both identifications relied on morphological
comparison with European collections, and spore size and ornamentation
differences were regarded as mere intraspecific variations. In their worldwide
phylogeny of Tuber, Jeandroz et al. (2008) did not include Asian T: aestivum
material, leaving open the true identity of the Chinese collections. In recent
years, more T. aestivum-like ascomata have been found in southwestern China.
Morphological and ITS-rDNA and £-tubulin sequence comparisons of these
Chinese truffles with European collections indicate that the Chinese material
differs from T: aestivum and should be described as a new species.
Materials & methods
Morphological examination
Macroscopic characters are based on fresh and dried specimens. Descriptions and
spore parameters follow Yang & Zhang (2003). Slides were made with a razor blade from
dried ascomata and mounted in 5% KOH. Micro-morphological features were examined
under a Nikon E400 microscope (10 x 100). At least 100 spores were measured from each
ascoma and included asci containing different numbers of spores. For scanning electron
microscopy (SEM), ascospores were scraped from dried ascoma gleba and mounted
in distilled water on a cover glass. After air drying the cover glasses were directly
attached to a SEM stub with double-sided tape and then coated with gold-palladium.
The treated materials were examined and photographed with an AMRAY 1000B SEM.
All specimens cited are deposited in the Herbarium of Cryptogams, Kunming Institute
of Botany, Chinese Academy of Science (KUN-HKAS).
Molecular methods
Six truffle collections from China and seventeen from Europe were selected for
phylogenetic analysis (TABLE 1). Total DNA was extracted from gleba dried with silica-
gel using a modified CTAB procedure of Doyle & Doyle (1987). The ITS5 (forward)
and ITS4 (reverse) primers were used to amplify the internal transcribed spacer regions
(ITS-rDNA) of the nuclear ribosomal DNA (White et al. 1990) and Bt2a (forward) and
Btspect (reverse) primers were used for the 6-tubulin gene (Glass et al. 1995; Paolocci et
al. 2004). The amplifications used 2 ul DNA template solutions in final volume of 25 ul. The
final solution contained 10 mM Tris-HCl (pH 9.0), 50 mM KCI, 2 mM MgCL, 200 uM of
each dNTP, 0.2 uM of each primer and 3 U Taq Polymerase (Takara Biotechnology, Dalian
Co. Ltd., China). The cycling parameters were an initial denaturation at 95 °C for 5 min,
followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 52 °C (for ITS and 49
°C for B-tubulin) for 90 s and extension at 72 °C for 2 min, then a final extension at 72 °C
for 10 min. PCR products were visualized through gel electrophoresis on a 1% agarose
gel and purified with Watson's purification kit. Sequencing was performed with ABI
Prism BigDye terminator cycle sequencing kit v3.1 on an ABI PRISM 3730 automatic
sequencer. DNA sequences were edited and aligned with BioEdit Version 5.0.9 (Hall
1999) and Clustal X with manual adjustment where necessary. Maximum parsimony
(MP) analysis was conducted with PAUP* 4.0b4a (Swofford, 2002) using heuristic
Tuber sinoaestivum sp. nov (China) ... 75
TABLE 1 Tuber sequences used in phylogeny.
(Bold font = sequences newly generated in this study.)
VOUCHER GENBANK IDENTIFICATION GENBANK LOCALITY
LABEL #ITS # 6-tubulin
—— T. malenconii T. malenconii FM205597 —— Spain
—— T. malenconii T. malenconii FM205596 —— Spain
E2 T. aestivum T. aestivum AF516781 AF516801 Italy
E61 T. aestivum T. aestivum AF516783 AF516812 Italy
E60 T. aestivum T. aestivum AF516789 AF516804 Italy
E5 T. uncinatum T. aestivum AF516791 AF516809 Italy
E24 T. uncinatum T. aestivum AF516792 AF516807 Italy
E17 T. uncinatum T. aestivum AY226042 AY 206632 Italy
HKAS44347 T. aestivum T. sinoaestivum GU979038 GU979152 China
HKAS44322 T. aestivum T. sinoaestivum GQ217542 GU979150 China
HKAS70291 T. aestivum T. aestivum JQ348410 JQ348402 Sweden
HKAS70292 T. aestivum T. aestivum JQ348411 JQ348401 Sweden
HKAS70296 T. aestivum T. aestivum JQ348412 JQ348404 France
HKAS70297 T. aestivum T. aestivum JQ348413 JQ348403 France
HKAS59111 T. sinoaestivum T. sinoaestivum JN896352 JQ348409 China
HKAS59100 T. sinoaestivum T. sinoaestivum JN896356 JQ348408 China
HKAS59101 T. sinoaestivum T. sinoaestivum JN896357 JQ348406 China
HKAS59102 T. sinoaestivum T. sinoaestivum JN896358 JQ348407 China
HKAS70294 T. mesentericum T. mesentericum JQ348414 JQ348405 France
M13 T. mesentericum T. mesentericum AF516793 AY170363 ——
Mi T. mesentericum T. mesentericum AF516794 AY 170364 ——
G02 T. magnatum T. magnatum AJ586251 AJ586430 Croatia
B6 T. magnatum T. magnatum AJ586271 AJ586428 Italy
search with multi-trees setting on and tree bisection reconnection (TBR) branch
swapping with 1000 search replicates, each replicate with random sequence addition.
No ambiguous characters were excluded from the analyses. Gaps were treated as missing
data. Character states were treated as equally weighted and unordered. Tuber magnatum
was selected as outgroup based on previous analyses, and T! sinoaestivum, T: aestivum,
T: mesentericum, and T: malenconii comprised the ingroup taxa.
Results
Taxonomy
Tuber sinoaestivum J.P. Zhang & P.G. Liu, sp. nov. Figs 1-5
MycoBank MB 563565
Differs from Tuber aestivum by its more globose spores with thicker walls and shallower
ornamentation mesh.
Type: China, Sichuan Province, Huidong County, Gaji mountain, 26°29'N 102°31’E, alt.
2280 m, in Pinus armandii Franch. forest, 25 Nov. 2009, JP Zhang 153 (holotype KUN-
HKAS 59105).
76 ... Zhang, Liu & Chen
Fics 1-5. Tuber sinoaestivum. 1: Fresh ascomata; 2: Pseudoparenchymatous tissue of outer layer
of peridium; 3: Intricately interwoven hyphae of inner layer of peridium; 4: Ascospores; 5: SEM of
ascospore, showing the reticulate ornamentation.
ETyMOLoGy: sinoaestivum (Lat.) referring to its Chinese origin and its relationship to
European T. aestivum.
Ascomarta subglobose, 1.5-3(-6) cm in diam., blackish to black, conspicuously
covered with low, polygonal warts; warts 3-6-sided, 2-4 mm transverse, about
2 mm high, apex pointed. PERIDruM 100-620 um thick, consisting of two
Tuber sinoaestivum sp. nov (China) ... 77
layers; the outer layer 50-300 um thick, pseudoparenchymatous, composed
of subglobose or subangular cells; cells dark to yellowish brown, 7-15 x 6-12
um, thick-walled; the inner layer 50-350 um thick, pale yellow or hyaline,
interwoven hyphae 2-5 um diam., forming an intricate texture. Gleba whitish
at first when young, then becoming yellowish or brown gradually, marbled with
numerous, narrow, white branching veins. Asci (51-)55-88(-124) x (33-)40-
72(-75) um (excluding stalk), subglobose, ellipsoid or variable in shape, sessile
or with a short stalk, the stalk (6—)10-25(-50) x 5-15(-16) um, 1-6(—7)-spored.
Ascospores globose, subglobose, (17—)20-41(-47) x (15-)17-30(-35) um
[Q =1.04-1.50(-1.57), Q =1.15 + 0.09], spore walls 2-4 um thick, yellowish-
brown at maturity, ornamented with a more or less irregular reticulum 2-5 um
deep; meshes variable, usually (7-)8-21(-22) x (4-)5-19(-20) um, commonly
1-3 meshes in the transverse diam. and 2-4 meshes in the longitudinal direction.
Odor unique with pleasant fragrance, taste a bit sweet for its mild aroma.
HABIT AND HABITAT: hypogenous, symbiotic with P armandii, maturing
from October to December or later.
DISTRIBUTION: known only from southwestern China.
ADDITIONAL SPECIMENS EXAMINED: Tuber sinoaestivum - CHINA: SICHUAN
PROVINCE, HurponG County, Daqiao mountain, 26°29'N 102°31’E, alt. 2250 m, 26
Nov. 2009, JP Zhang 158 (KUN-HKAS 59108); JP Zhang 156 (KUN-HKAS 59110);
19 Oct 2003, J Chen 129 (KUN-HKAS 44322). Gaji market, 23 Oct 2003, J Chen 141
(KUN-HKAS 44347). Gaji mountain, 26°29’N 102°31’E, alt. 2280 m, 25 Nov. 2009, JP
Zhang 143 (KUN-HKAS 59095); JP Zhang 152 (KUN-HKAS 59104). Haiba mountain,
26°29'N 102°31'E, alt. 2300 m, 23 Nov. 2009, JP Zhang 140 (KUN-HKAS 59100); JP
Zhang 141 (KUN-HKAS 59099); JP Zhang 144 (KUN-HKAS 59096); JP Zhang 149
(KUN-HKAS 59098). Yezu mountain, 26°29'N 102°31’E, alt. 2300 m, 27 Oct. 2009, JP
Zhang 65 (KUN-HKAS 59101); JP Zhang 66 (KUN-HKAS 59102).
Tuber aestivum - ENGLAND: Hedben Bridge forest, 6 Aug. 2010, PG Liu (KUN-
HKAS 70301, 70302). FRANCE: 2006, Y Wang (KUN-HKAS 70293, 70294, 70295);
Lacoste, 46090 Le Montat, P Sourzat (KUN-HKAS 70296); La Devéze, 46090 Cours,
P Sourzat (KUN-HKAS 70297). ITALY: Valle Fiorano (Modena), 10 Dec. 1984, A
Zambonelli (KUN-HKAS 70298, 70299, 70300). SWEDEN: IsLAND OF GOTLAND,
middle part of island, 8 Nov. 2003, C Wedén (KUN-HKAS 70290, 70291, 70292).
Phylogeny
Twenty-three samples were used for phylogenetic analysis. The homogeneity
test for the conjoint analysis of ITS-rDNA and 6-tubulin did not detect
conflict between the ITS-rDNA and £-tubulin analyses, which allowed for a
concatenated alignment and analysis. The alignment includes 1107 characters,
of which 951 are constant, 149 are parsimony informative, and 7 are parsimony
uninformative. Parsimony analysis generated one MP tree, with tree length =
360, CI = 0.928, RI = 0.968, RC = 0.898, and HI = 0.072.
In the concatenated analysis, the twenty-three samples grouped into three
well-supported clades (Fic. 6): Clade I included all the Chinese materials
78 ... Zhang, Liu & Chen
100 Tuber malenconii
T. malenconii
HKAS44322
HKAS44347
100 HKAS59100 Clade I
HKAS59101 T. sinoaestivum
64
HKAS59102
100
HKASS9111
HKAS70291
at 95 | HKAS70292
E24
96 ES
HKAS70296
Clade 1
Eee T. aestivum/uncinatum
81 100 64
E61
E2
E17
87
E60
HKAS70294
100
nt Clade LI
M13 T. mesentericum
B6 T: magnatum
GO2 T. magnatum
—— 10 changes
Fic. 6. Phylogenetic relationships of Tuber sinoaestivum and T: aestivum inferred from maximum
parsimony (MP) analysis of ITS and $-tubulin sequences. MP Bootstrap values greater than 70%
are indicated at nodes.
analyzed (T. sinoaestivum), Clade I] included T: aestivum/uncinatum from
Europe, and Clade II was represented by three T: mesentericum samples. Clade
I formed a sister clade with Clade II. The same tree topology was obtained from
the single gene ITS-rDNA and 6-tubulin analyses but with different bootstrap
values: the ITS-rDNA analysis shows 99% and 100% bootstrap support for the
T. aestivum/uncinatum and T. sinoaestivum clades respectively, whereas the
6-tubulin analysis indicates only 61% and 69% support. All analyses suggest
a close relationship between T. sinoaestivum and T. aestivum/uncinatum,
T. mesentericum, and T: malenconii but support a clear separation between the
Chinese and the three European species.
Tuber sinoaestivum sp. nov (China) ... 79
Discussion
In the molecular phylogenetic tree, European T. aestivum collections (and
others annotated as T’ uncinatum) grouped together into clade II with 99%
bootstrap support. The taxonomic relationship between T! aestivum and
T. uncinatum has been subject to debate, with some regarding them as two
species (Chevalier et al. 1994; Mello et al. 2002; Riousset et al. 2001) and others
treating T’ uncinatum asa morphological variation of T: aestivum (Sin et al. 1995;
Trappe 1979), or perhaps two extremes of a morphological species-complex
(Gandeboeuf et al. 1994; Pacioni et al. 1993; Urbaneli et al. 1998). Based on
current research and our studies, we accept T. aestivum and T: uncinatum as a
single widespread species with highly variable morphological and ecological
characters. In addition, the phylogenetic trees suggest that “genetic variation”
is not great. A previous multi-gene (ITS-rDNA, B-tubulin, EFl-a) analysis
of sixty T: aestivum or T. uncinatum samples from Italy and other European
countries has also supported T: uncinatum and T: aestivum as a single species
(Paolocci 2004). A subsequent study by Wedén (2004) has drawn the same
conclusion.
Tuber aestivum was initially reported from China as a new record because of
its morphological resemblance to the European T’ aestivum (Chen et al. 2005;
Song et al. 2005). The Chinese collections that we studied are morphologically
similar to the European T! aestivum in that both have black ascomata with
conspicuous polygonal warts and reticulate spores. Such morphological
similarity is mirrored in our ITS-rDNA and 6-tubulin sequence analysis
rooted by T: magnatum (Bonito et al. 2010; Jeandroz et al. 2008). However,
after observing several European T. aestivum collections, we found that despite
their almost identical macrocharacters, the two species are easily distinguished
by spore shape. Tuber sinoaestivum spores are more globose (Fic. 7) as shown
by the parameters in T. sinoaestivum [Q = (1.00-)1.04-1.40(-1.43), Q=1.15 +
0.11] in contrast to those in T: aestivum [Q = (1.03-)1.10-1.50(-1.65), Q =1.29
+ 0.13]. Furthermore, T. sinoaestivum spores have much thicker (2-4 um) walls
and shallower (<5 um) meshes compared with the thinner walls (normally
<2 um thick) and higher (4-8 um) meshes in T: aestivum. Chen et al. (2005)
and Song et al. (2005) also noticed these differences but failed to use them
for specific discrimination. European mycologists also noted the more globose
spores in the Chinese T. sinoaestivum, but regarded it as a separate taxon
(Zambonelli et al. 2012). Although T’ aestivum is regarded as a widespread
species with high morphological variation, the differences in T! sinoaestivum
exceed the variation accepted for T: aestivum.
Until now, T. sinoaestivum has been found only from very limited localities
in southwestern China. In the local Sichuan markets, it is often found mixed
with collections representing the T. indicum complex. Zambonelli et al. (2012)
80 ... Zhang, Liu & Chen
25 30
Length
¢ Tuber aestivum ® T. sinoaestivum
Fic. 7. Ascospore dimensions of Tuber aestivum and T. sinoaestivum; each point represents the
mean values for 30 ascospores from a single ascocarp.
reported T. sinoaestivum (as “T: aestivum s.l”) as being sold in an Italian
market. The very small number cited suggests that it could be mixed with
fruiting bodies of T. indicum complex, a truffle intensively commercialized
internationally. Potential introduction into T: sinoaestivum ecosystems cannot
be excluded, as has occurred with T: indicum (Bonito et al. 2010; Murat et al.
2008), and precautions should be taken to avoid unwanted species invasions.
Nevertheless, the culinary traits of T. sinoaestivum can still be commercially
valuable. Accordingly, we suggest that when this truffle is traded, it should be
classified and explicitly labeled T. sinoaestivum to emphasize its geographical
origin and thus avoid confusion with T: aestivum and T. indicum complex. This
will be significant for both the sustainable development and conservation of
truffle biodiversity.
Acknowledgements
We are grateful for the two peer reviewers, Dr. Gregory Bonito and Dr. Kentaro
Hosaka, who critically reviewed the manuscript and provided invaluable suggestions.
We thank Dr. Yun Wang (New Zealand Institute for Plant & Food Research Limited,
New Zealand) and Dr. Christina Wedén (Department of Medicinal Chemistry, Uppsala
University, Sweden) for providing samples, literature, and comments. Dr. X.H. Wang
and Dr. FQ. Yu (Kunming Institute of Botany, Chinese Academy of Sciences, China)
helped to improve the manuscript. Prof. Alessandra Zambonelli (Department of Food
Protection and Valorization, Faculty of Agriculture, University of Bologna, Italy) and
Pierre Sourzat (Lycée professionnel agricole de Cahors-Le Montat, France) generously
loaned European samples of T: aestivum. This study was financed by the National
Tuber sinoaestivum sp. nov (China) ... 81
Science Foundation of China (No.30470011, 30770007, 30800005), International
Cooperation Yunnan Program of Innovation to Strengthen Provinces by Science &
Technology (No. 2009AC013), the Joint Founds of the National Science Foundation
of China and Yunnan Province Government (No.U0836604), and Key Laboratory of
Biodiversity and Biogeography, Kunming Institute of Botany, Chinese Academy of
Sciences (No.0806361121), as well as the Knowledge Innovation Program of the Chinese
Academy of Sciences (No.KSCX2-YW-G-025).
Literature cited
Bonito GM, Gryganskyi AP, Trappe JM, Vilgalys R. 2010. A global meta-analysis of Tuber ITS
rDNA sequences: species diversity, host associations and long-distance dispersal. Mol. Ecol.
19(22): 4994-5008. http://dx.doi.org/10.1111/j.1365-294X.2010.04855.x
Bonito GM, Trappe JM, Donovan S, Vilgalys R. 2010. The Asian black truffle Tuber indicum can
form ectomycorrhizas with North American host plants and complete its life cycle in non-
native soils. Fungal Ecol. 4: 83-93. http://dx.doi.org/10.1016/j.funeco.2010.08.003
Chen J, Liu PG. 2011. Delimitation of Tuber pseudohimalayense and T. pseudoexcavatum based on
morphological and molecular data. Cryptogamie Mycol. 32(1): 83-93.
Chen J, Liu PG, Wang Y. 2005. Notes on Tuber aestivum (Tuberaceae, Ascomycota). Acta Botanica
Yunnanica 27(4): 385-389.
Douet JP, Castroviejo M, Mabru D, Chevalier G, Dupré C, Bergougnoux F, Ricard JM, Médina B.
2004. Rapid molecular typing of Tuber melanosporum, T. brumale and T. indicum from tree
seedlings and canned truffles. Anal. Bioanal. Chem. 379: 668-673.
http://dx.doi.org/10.1007/s00216-004-2643-9
Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure from small quantities of fresh leaf
tissues. Phytochem. Bull. 19: 11-15.
Glass NL, Donaldson GC. 1995. Development of primer sets designed for use with the PCR
to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microb. 61:
1323-1330.
Guevara G, Bonito G, Cazares E, Rodriguez JA, Vilgalys R. 2008. Tuber regimontanum, new species
of truffle from Mexico. Rev. Mex. Micol. 26: 17-20.
Hu HT. 1992. Tuber formosanum sp. nov. and its mycorrhizal associations. Journal of the
Experimental Forest of National Taiwan University 6: 79-86.
Jeandroz S, Murat C, Wang YJ, Bonfante P, Le Tacon F. 2008. Molecular phylogeny and
historical biogeography of the genus Tuber, the ‘true truffles. J. Biogeogr. 35(5): 815-829.
http://dx.doi.org/10.1111/j.1365-2699.2007.01851.x
Kers LE. 2003. Tryfflarna Tuber aestivum och T. mesentericum i Sverige. Sven. Bot. Tidskr. 97:
157-175.
ManjonJL, Garcia- Montero LG, Alvarado P, Moreno G, Di Massimo G. 2009. Tuber pseudoexcavatum
versus T. pseudohimalayense - new data on the molecular taxonomy and mycorrhizae of Chinese
truffles. Mycotaxon 110: 399-412. http://dx.doi.org/10.5248/110.399
Murat C, Zampieri E, Vizzini A , Bonfante P. 2008. Is the Perigord black truffle threatened
by an invasive species? We dreaded it and it has happened! New Phytol. 178: 699-702.
http://dx.doi.org/10.1111/j.1469-8137.2008.02449.x
Pacioni G, Pomponi G. 1991. Genotypic patterns of some Italian populations of the Tuber aestivum
- T. mesentericum complex. Mycotaxon 42: 171-179.
Paolocci F, Rubini A, Granetti B, Arcioni S. 1997. Typing Tuber melanosporum and Chinese
black truffle species by molecular markers. FEMS Micobiol. Lett. 153: 255-260.
http://dx.doi.org/10.1016/S0378-1097(97)00226-7
82 ... Zhang, Liu & Chen
Paolocci F, Rubini A, Riccioni C, Topini K Arcioni S. 2004. Tuber aestivum and Tuber uncinatum:
two morphotypes or two species? FEMS Micobiol. Lett. 235: 109-115.
http://dx.doi.org/10.1016/j.femsle.2004.04.029
Pegler DN, Spooner BM, Young TWK. 1993. British truffles. A revision of British hypogeous fungi.
Royal Botanic Garden, Kew.
Roux C, Séjalon-Delmas N, Martins M, Parguey-Leduc, Dargent R, Bécard G. 1999. Phylogenetic
relationships between European and Chinese truffles based on parsimony and distance analysis
of ITS sequences. FEMS Micobiol. Lett. 180: 147-155.
http://dx.doi.org/10.1016/S0378-1097(99)00474-7
Sin KS, Park JS, Yoshimi S. 1995. Note on Tuber aestivum subsp. uncinatum (newly recorded in
Korea). Korean J. Mycol. 23: 10-13.
Song MS, Cao JZ, Yao YJ. 2005. Occurrence of Tuber aestivum in China. Mycotaxon 91: 75-80.
Swofford DL. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods), 4.0b4a.
Sunderland, Massachusetts: Sinauer Associates.
Trappe JM, Castellano MA. 1991. Keys to the genera of truffles (Ascomycetes). MclIlvainea 10:
47-65.
Wang Y, Moreno G, Riousset LJ, Manjon JL, Riousset G, Fourre G, Di Massimo G, Garcia- Montero
LG, Diez J. 1998. Tuber pseudoexcavatum sp. nov., a new species from China commercialized
in Spain, France and Italy with additional comments on Chinese truffles. Cryptogamie Mycol.
£9: IN3—120;,
Wang YJ, Tan ZM, Zhang DC, Murat C, Jeandroz S, Le Tacon F. 2006. Phylogenetic and populational
study of the Tuber indicum complex. Mycol. Res. 110: 1034-1045.
http://dx.doi.org/10.1016/j.mycres.2006.06.013
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a guide to
methods and applications. New York: Academic Press.
Yang ZL, Zhang LE. 2003. Type studies on Clitocybe macrospora and Xerula furfuracea var. bispora.
Mycotaxon 88: 447-454.
Zambonelli A, Iotti M, Piattoni F. 2012. Chinese Tuber aestivum sensu lato in Europe.The open
Mycology Journal. 6: 22-26.
Zhang LF, Yang ZL, Song DS. 2005. A phylogenetic study of commercial Chinese truffles and their
allies: taxonomic implications. FEMS Micobiol. Lett. 245: 85-92.
http://dx.doi.org/10.1016/j.femsle.2005.02.028
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.83
Volume 122, pp. 83-87 October-December 2012
Two new Ellisembia species from Hainan and Yunnan, China
SHOU-CAI REN”, JIAN MA’? & XIU-GUO ZHANG"
‘Department of Plant Pathology, Shandong Agricultural University, Taian, 271018, China
*Zaozhuang Vocational College, Zaozhuang, 277800, China
Asstract — Ellisembia heritierae sp. nov. on Heritiera littoralis and E. pistaciae sp. nov. on
Pistacia chinensis are described and illustrated from specimens collected in tropical forests in
Hainan and Yunnan Provinces, China. They are compared with closely related taxa.
KEY worpDs —anamorphic fungi, systematics, taxonomy
Introduction
Subramanian (1992) established Ellisembia Subram. typified by E. coronata
(Fuckel) Subram. to accommodate those taxa previously described in
Sporidesmium that have distoseptate conidia borne terminally on determinate
or percurrently extending conidiogenous cells. The genus Imicles Shoemaker &
Hambl. was later merged into Ellisembia by Wu & Zhuang (2005). More than
40 Ellisembia species have been described, mostly from rotten wood and dead
branches of various plants (Subramanian 1992, McKenzie 1995, 2010, Goh &
Hyde 1999, Mena-Portales et al. 2000, Zhou et al. 2001, Wu & Zhuang 2005,
Heuchert & Braun 2006, Ma et al. 2008, 2011b).
The lignicolous mycota is very rich in tropical and subtropical forests of
Hainan and Yunnan Provinces (Dai & Cui 2006, Dai & Li 2010, Ma et al. 2010,
2011a, Cui et al. 2011, Zhang et al. 2011). During ongoing surveys of tropical
forest microfungi in the two regions, two new Ellisembia species were found.
The type specimens are deposited in the Herbarium of the Department of
Plant Pathology, Shandong Agricultural University (HSAUP) with isotypes in
the Mycological Herbarium, Institute of Microbiology, Chinese Academy of
Sciences (HMAS).
Ellisembia heritierae S.C. Ren & X.G. Zhang, sp. nov. FIG. 1
MycoBank MB 800477
Differs from Ellisembia ellipsoidea in its wider conidia with fewer distosepta and non-
extending conidiogenous cells.
84 ... Ren, Ma & Zhang
4
Fic. 1. Ellisembia heritierae. Conidiophores, conidiogenous cells and conidia.
Type: China. Hainan Province: tropical forest of Xishuangbanna, on decaying branches
of Heritiera littoralis Aiton (Sterculiaceae), 30 October 2011, Sh.C. Ren (Holotype
HSAUP H0062; isotype HMAS 243417).
EryMoLoey: in reference to the host genus, Heritiera.
COLONIES on natural substrate effuse, dark brown to black, hairy. Mycelium
partly superficial, partly immersed in the substratum, composed of branched,
septate, pale brown, smooth-walled hyphae, 1.5-3 um wide. CONIDIOPHORES
distinct, single or in groups, erect, unbranched, straight or flexuous, cylindrical,
brown, smooth, 4—7-septate, 80-110 um long, 5-6.5 um wide. CONIDIOGENOUS
CELLS monoblastic, integrated, terminal, cylindrical, brown, smooth,
determinate. Conidial secession schizolytic. Conrp1a holoblastic, solitary,
acrogenous, ellipsoidal, rounded at the apex, truncate at the base, smooth-
Ellisembia heritierae & E. pistaciae spp. nov. (China) ... 85
walled, brown to pale brown, 4-distoseptate, 35-40 um long, 12-14.5 um wide
in the broadest part, 2.5-3.5 um wide at the truncate base.
Comments - Ellisembia heritierae resembles E. ellipsoidea W.P. Wu in
producing ellipsoidal conidia, but can be differentiated from E. ellipsoidea
(conidia 40-45 x 10-11 um, 7-8-distoseptate) by its wider conidia with
fewer distosepta. In addition, conidiogenous cells of E. ellipsoidea have up to 3
lageniform to ampulliform percurrent extensions, while those of E. heritierae
have no extensions.
Fic. 2. Ellisembia pistaciae. Conidiophores, conidiogenous cells and conidia.
Ellisembia pistaciae S.C. Ren & X.G. Zhang, sp. nov. FIG. 2
MycoBank MB 800478
Differs from previously described Ellisembia species in its flask-shaped conidia with a
subhyaline multiseptate rostrum.
86 ... Ren, Ma & Zhang
Type: China. Hainan Province: tropical forest of Bawangling, on decaying branches
of Pistacia chinensis Bunge (Anacardiaceae), 30 October 2011, Sh.C. Ren (Holotype
HSAUP H8620; isotype HMAS 243418).
EryMoLoey: in reference to the host genus, Pistacia.
COLONIES on natural substrate effuse, brown, hairy. Mycelium partly superficial,
partly immersed in the substratum, composed of branched, septate, pale
brown, smooth-walled hyphae, 2-4 um wide. CoNIDIOPHORES distinct, single
or in groups, erect, unbranched, straight or flexuous, cylindrical, brown to dark
brown, smooth, 3-8-septate, 70-125 um long, 4.5-6 um wide. CONIDIOGENOUS
CELLS monoblastic, integrated, terminal, cylindrical, brown, smooth,
determinate. Conidial secession schizolytic. Conrp1a holoblastic, solitary,
acrogenous, flask-shaped, rostrate, smooth-walled, brown, rostrum pale brown
to subhyaline, 8-10-distoseptate, 50-65 um long (rostrum included), 13-14.5
um wide in the broadest part, 3.5-4 um wide at the truncate base, rostrum
25-40 um long, 6-8 um wide.
Comments - Ellisembia pistaciae is unique in having determinate conidiogenous
cells and flask-shaped conidia with a multiseptate, pale coloured rostrum
measuring 25-40 x 6-8 um.
Acknowledgments
The authors express gratitude to Dr Bryce Kendrick and Dr Eric H.C. McKenzie for
serving as pre-submission reviewers and for their valuable comments and suggestions.
This project was supported by the National Natural Science Foundation of China (Nos.
31093440, 30499340, 30770015) and the Ministry of Science and Technology of the
People’s Republic of China (Nos. 2006FY120100, 2006FY110500-5).
Literature cited
Cui BK, Du P, Dai YC. 2011. Three new species of Inonotus (Basidiomycota, Hymenochaetaceae)
from China. Mycol. Prog. 10: 107-114. http://dx.doi.org/10.1007/s11557-010-0681-6
Dai YC, Cui BK. 2006. Two new species of Wrightoporia (Basidiomycota, Aphyllophorales) from
southern China. Mycotaxon 96: 199-206.
Dai YC, Li HJ. 2010. Notes on Hydnochaete (Hymenochaetales) with a seta-less new species
discovered in China. Mycotaxon 111: 481-487. http://dx.doi.org/10.5248/111.481
Goh TK, Hyde KD. 1999. Fungi on submerged wood and bamboo in the Plover Cove Reservoir,
Hong Kong. Fungal Divers. 3: 57-85.
Heuchert B, Braun U. 2006. On some dematiaceous lichenicolous hyphomycetes. Herzogia 19:
11-21.
Ma J, Zhang K, Zhang XG. 2008. Two new Ellisembia species from Hainan, China. Mycotaxon 104:
141-145.
Ma LG, Ma J, Zhang YD, Zhang XG. 2010. A new species of Spadicoides from Yunnan, China.
Mycotaxon 113: 255-258. http://dx.doi.org/10.5248/113.255
Ma LG, Ma J, Zhang YD, Zhang XG. 2011a. Taxonomic studies of Endophragmiella from southern
China. Mycotaxon 113: 255-258. http://dx.doi.org/10.5248/117.279
Ellisembia heritierae & E. pistaciae spp. nov. (China) ... 87
Ma J, Ma LG, Zhang YD, Zhang XG. 2011b. Three new hyphomycetes from southern China.
Mycotaxon 117: 247-253. http://dx.doi.org/10.5248/117.247
McKenzie EHC. 1995. Dematiaceous hyphomycetes on Pandanaceae. 5. Sporidesmium sensu lato.
Mycotaxon 56: 9-29.
McKenzie EHC. 2010. Three new phragmosporous hyphomycetes on Ripogonum from an
‘ecological island’ in New Zealand. Mycotaxon 111: 183-196.
Mena-Portales J, Delgado-Rodriguez G, Heredia-Abarca G. 2000. Nuevas combinaciones para
especies de Sporidesmium sens. lat. Bol. Soc. Micol. Madrid 25: 265-269.
Subramanian CV. 1992. A reassessment of Sporidesmium (hyphomycetes) and some related taxa.
Proc. Indian Nat. Sci. Acad. B 58: 179-190.
Wu WP, Zhuang WY. 2005. Sporidesmium, Endophragmiella and related genera from China. Fungal
Divers. Res. Ser. 15: 1-351.
Zhang YD, Ma J, Wang Y, Ma LG, Castafieda-Ruiz RE, Zhang XG. 2011. New species and record of
Pseudoacrodictys from southern China. Mycol. Prog. 10: 261-265.
http://dx.doi.org/10.1007/s11557-010-0696-z
Zhou DQ, Hyde KD, Wu XL. 2001. New records of Ellisembia, Penzigomyces, Sporidesmium and
Repetophragma species on bamboo from China. Acta Botanica Yunnanica 23(1): 45-51.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.89
Volume 122, pp. 89-110 October-December 2012
Lichenized and lichenicolous fungi new to
Babia Gora National Park (Poland, Western Carpathians)
PAWEL CZARNOTA’ & MICHAEL WEGRZYN’
"Department of Agroecology and Landscape Architecture, Faculty of Biology and Agriculture,
University of Rzeszéw, Cwikliniskiej 2, 35-601 Rzeszéw, Poland
*Zdzislaw Czeppe Department of Polar Research and Documentation, Institute of Botany,
Jagiellonian University, Kopernika 27, PL-31-501 Krakow, Poland
CORRESPONDENCE TO *:
[email protected]
ABSTRACT — 46 lichenized fungi and 1 lichenicolous fungus new to the Babia Gora Massif, a
Polish and Slovak transborder mountain range, the highest in the flysch Western Carpathians,
are presented here. Taxonomic and ecological remarks, as well as the distribution of some
noteworthy taxa in other Carpathian ranges, are included. Helocarpon crassipes is reported
in detail for the first time from the Western Beskidy Mts and Leptogium intermedium is
rediscovered in the Polish Carpathians.
Key worps — lichen diversity, lichen biota, lichens, Biosphere Reserve
Introduction
The Babia Gora Massif, the highest mountain range (1725 m a.s.l.) of the
Western Beskidy Mts (part of the Western Carpathians), is located on the
Polish-Slovak border. The main part of this transborder range belongs to Poland
and is covered by the Biosphere Reserve of UNESCO MAB. Since the whole
Babia Gora Massif has a unique and valuable natural character, an extension
of the Reserve into Slovakia part is planned. The Protected Landscape Area
‘Horna Orava has covered the Slovak portion of the Massif since 1979, while
the Polish side is almost entirely included within the Babia Gora National Park
since 1954. Different nature conservation methods on both sides of the massif
are nonetheless linked by compatible protection regimes.
The natural environment of the Carpathians was extensively exploited
throughout the whole of the 18th and early 19th centuries, with mass
deforestation and replacement by spruce monocultures on the degraded areas
contributing to an impoverished epiphytic lichen biota. Moreover, excessive
grazing of large cattle herds in the alpine and subalpine zones caused the
destruction of terrestrial lichens, important components of alpine grasslands.
90 ... Czarnota & Wegrzyn
The diversity of plant communities, forming vegetation zones from the lower
forest zone to the alpine zone in the Babia Gora Massif, and especially relics of
ancient upper spruce montane forests, continues to have a direct impact on the
unique character of the lichen biota of the massif, which includes 350 species of
both lichenized and lichenicolous fungi (Bielczyk 2004; Czarnota 2007; Kukwa
et al. 2010).
The first reports on lichens of the Babia Gora Massif are by Stein (1872,
1873), whose data are repeatedly cited in the summary studies by Rehman
(1879) and Boberski (1886). These contain information on some macrolichens
(e.g. Usnea longissima, Sticta sylvatica) no longer recorded in this area, despite
intensive lichenological studies were made by Suza (1951), Tobolewski (1966)
and Nowak (1998). Other minor works referring mainly to the ‘Atlas of the
geographical distribution of lichens in Poland’ and detailed history of all studies
on lichens in the Babia Gora Massif are provided by Bielczyk (2004). In the
first decade of this century, the area of Babia Gora NP has once more become
a site of lichenological interest, with new reports of lichens from this region
(Wegrzyn 2002; 2004). Except for the contributions by Lisicka (1980) on two
Umbilicaria species and Guttova (2001) on Microcalicium disseminatum, there
are no additional published data from the Slovak side of Babia Géra Massif.
The known lichen diversity of the neighbouring lower flysch ranges of
Western Beskidy Mts (Kiszka 1967; Nowak 1998; Czarnota 2010) suggests
that the biodiversity is probably much greater in the Babia Géra Massif than
published; indeed, our current lichenological results significantly extend the
list by 47 taxa. However, we did not make a detailed exploration of all available
lichen habitats in 2007-10 but focused on lichens occupying standing and
fallen spruce ‘dead wood’ (including wind-throws) within the strictly protected
area and investigated lichen diversity within 520 permanent plots regularly
distributed throughout the park, including the highest alpine zone.
Materials & methods
All collections except one were made in Babia Gora National Park. Lichens were
identified by standard microscopy, with Lepraria, Cladonia and some sterile sorediate
species checked through thin-layer chromatography (TLC) in solvent C according
to Orange et al. (2001). Apothecial hand-made sections were mounted in water and
anatomical structures were measured in KOH. Spot test reactions of apothecial
pigments were studied in KOH and NaClO, and ascus types as well as medulla in IKI.
Nomenclature follows MycoBank Fungal Databases (http://www.mycobank.org).
Examined materials and selected habitat notes are given for all taxa, while
distributional, ecological and taxonomic notes are included for more noteworthy and
rare species. The P. Czarnota collections are deposited in the Gorce National Park (GPN)
herbarium while M. Wegrzyn collections are in the Jagiellonian University herbarium
in Krakow (KRA).
Abbreviations: fs no. = forest section number; * = lichenicolous fungus.
Lichenized and lichenicolous fungi (Poland) ... 91
The species
Absconditella delutula (Nyl.) Coppins & H. Kilias
SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, SE slope of Kepa hill,
fs no. 25c [49°34'29.4"N 19°33'41.3"E], alt. 1360 m, 26.8.2009, leg. P. Czarnota 6339
(GPN); E slope of Sokolica hill, fs no. 17b [49°35'15.1"N 19°34'26.2"E], alt. 1140 m,
9.6.2009, leg. P. Czarnota 6046 (GPN); NE slope of Sokolica hill fs no. 5b close to 'Dolny
Plaj tourist track [49°35'26.8"N 19°34'14.9"E], alt. 1040 m, 10.6.2009, leg. P. Czarnota
5991 (GPN); 'Gorny Plaj’ tourist track, near Mokry Staw lake, fs no. 18b [49°35'25.18"N
19°33'57.2"E], alt. 1040 m, 10.11.2010, leg. M. Wegrzyn 4153 (KRA).
ECOLOGY & DISTRIBUTION: Based on both the present study and previous investigations
in other Polish ranges (Czarnota unpubl.), A. delutula seems not infrequent on sandstone
pebbles over root systems of recent conifer wind-throws in montane forests. Sometimes
it occurs on decaying wood (Pisut et al. 2007; Malicek et al. 2010).
This ephemeral species has been found several times in Poland (Czarnota &
Kukwa 2008a). The new sites extend its range in the Western Carpathians where it has
previously been reported from both Polish (Gorce, Beskid Wyspowy Mts) and Czech
(Moravskoslezké Beskydy) areas (Czarnota & Kukwa 2008a; Malicek et al. 2010).
Anisomeridium polypori (Ellis & Everh.) M.E. Barr
SPECIMEN EXAMINED: POLAND, MALOPOLSKA PROVINCE, N of Markowe Szczawiny
shelter house, fs no. 74b [49°35'48.7"N / 19°31'12.6"E], alt. 880 m, on decaying bark
of roots of fallen Picea abies within Carpathian beech forest, 2.7.2009, leg. P. Czarnota
6120 (GPN).
Biatora chrysantha (Zahlbr.) Printzen
SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of massif, near
Rybny Potok stream, fs no. 59a [49°36'53.2"N / 19°32'15.3"E], alt. 750 m, on Alnus
glutinosa bark, 4.8.2010, leg. M. Wegrzyn 4214 (KRA); NE slope of Sokolica, fs no. 17b
[49°35'15.0"N / 19°34'17.09"E], alt. 1200 m, on Sorbus aucuparia bark, 9.6.2009, leg. M.
Wegrzyn 3169 (KRA).
ECOLOGY & DISTRIBUTION: B. chrysantha prefers old, natural forests, where it is found at
the base of older trees and on over-growing bryophytes in high precipitation sites.
This species has been found in Poland several times in the Carpathians (Faltynowicz
2003) and Western Pomerania (Kukwa & Szymczyk 2006). Close to Babia Gora Massif
it was reported only from Wielka Racza Mt. (Nowak 1998). In Europe its distribution
is defined as suboceanic, since it is widely distributed in Scandinavia, Finland and the
British Isles (Printzen & Palice 1999), but it is also recorded in the central, mountainous
part of Europe (e.g. Coppins et al. 1998, 2005; Kiszka & Koscielniak 1998; Printzen &
Palice 1999; Pisut et al. 2007).
Biatora helvola Korb. ex Hellb.
SPECIMEN EXAMINED: E slope of Sokolica hill, fs no. 25a [49°35'08.8"N / 19°34'05.9"E],
alt. 1280 m, on Sorbus aucuparia bark within upper montane spruce forest, 9.6.2009, leg.
P. Czarnota 6026 (GPN).
Biatora veteranorum Coppins & Sérus. PLATE 1A
= Catillaria alba Coppins & Vézda
This species is almost exclusively cited in the literature as Catillaria alba
(Palice 1999; Fletcher & Coppins 2009), since it has only recently been
92 ... Czarnota & Wegrzyn
transferred to Biatora (as B. veteranorum nom. nov., non B. alba Hepp) on
the basis of its phylogenetic affinity to several other Biatora taxa (Sérusiaux et
al. 2010). Vézda (1993) originally noted in the protologue that as this species
does not belong to the genus Catillaria sensu stricto, the name Catillaria alba
should be treated rather tentatively. Indeed, the 1-septate, ellipsoid ascospores,
ascus tholus with a darker tube and non-amyloid conical ocular chamber,
unpigmented apical caps of paraphyses, small bacilliform conidia, and the
usual presence of short-stalked pycnidia suggest that the species may belong
to another genus within, for example, Pilocarpaceae (Sérusiaux et al. 2010).
Such pycnidia are almost unknown in Biatora except for B. ligni-mollis T. Sprib.
& Printzen, which forms rather sessile, globose, and never white pruinose
pycnidia, whereas in B. veteranorum they are distinctly stalked, elongated, and
almost white from distinct pruina. The ‘core’ pycnidial wall in B. veteranorum
is white to pale beige, contrasting with the orange or slightly brown pycnidial
pigmentation in B. ligni-mollis. Such pycnidial characters of major diagnostic
importance for B. veteranorum, which is often found in only in the asexual
stage. Stalked, pale pycnidia are also present in several Micarea species, e.g.,
M. doliiformis (Coppins & P. James) Coppins & Sérus., M. hedlundii Coppins,
M. pycnidiophora Coppins & P. James, M. stipitata Coppins & P. James, and
M. tomentosa Czarnota & Coppins (Coppins 1983; Czarnota 2007; Sérusiaux
et al. 2010), but there they are at most whitish tomentose and never pruinose.
Moreover, all these species differ from B. veteranorum in their external thallus.
All B. veteranorum specimens from the Babia Gora Massif have abundant
apothecia, which are also white pruinose due to minute crystals confined to
the epithecium.
SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of Diablak Mt.,
fs no. 23a [49°34'55"N / 19°31'10.7"E], alt. 1270 m, 7.8.2009, leg. P. Czarnota 6265
(GPN); N slope of Sokolica hill, fs no. 7a [49°35'21.0"N / 19°33'12.9"E], alt. 1060 m,
21.7.2009, leg. P. Czarnota 6225 (GPN); N slope of Diablak Mt., fs no. 10g [49°34'57.3"N
/ 19°31'51.6"E], alt. 1180 m, 3.7.2009, leg. P. Czarnota 6172 (GPN). POLAND.
PODKARPACKIE PROVINCE, Bieszczady Mts, Bieszczadzki National Park, Sianki forest
district, fs no. 781, on wood of a decaying Abies alba stump, mixed forest dominated by
Picea abies, 19.6.2002, leg. P. Czarnota 2872 (GPN).
ECOLOGY & DISTRIBUTION: B. veteranorum prefers slightly decayed wood of decorticated
higher conifer snags within dense mixed and spruce montane forests, especially in lower
zones, where it usually occupies shady niches.
This species has previously only been reported from Poland twice, both from the
Polish Western Carpathians (Czarnota 2003, 2010; as Catillaria alba). The new records
PiaTE. 1. Habits of several noteworthy species. A - Biatora veteranorum [|Czarnota 6225 (GPN)];
B - Elixia flexella |Czarnota 6266 (GPN)]; C - Lecanora sarcopidoides [Czarnota 4199 (GPN)];
D - Lecanora subintricata [Czarnota 6062 (GPN); E - Leptogium intermedium |Wegrzyn 4151
(KRA)]; F - cross section of thallus of Leptogium intermedium [Wegrzyn 4151 (KRA)]; G - Lecidea
leprarioides [Czarnota 6177 (GPN)]; H - Trapeliopsis glaucolepidea [Czarnota 6012 (GPN)].
Lichenized and lichenicolous fungi (Poland) ... 93
ane
4
r SOE) WN ANG
} a Mh: fe
94 ... Czarnota & Wegrzyn
from Babia Gora Massif and Bieszczady Mts in Eastern Carpathians extend its range to
the entire Polish part of this mountain range. B. veteranorum was also recorded in the
Ukrainian Carpathians (Kondratyuk & Coppins 2000).
Calicium glaucellum Ach.
SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of Sokolica hill
fs no. 7a [49°35'21.0"N / 19°33'12.9"E], alt. 1060 m, 21.7.2009, leg. P. Czarnota 6226
(GPN); ibid., [49°35'25.9"N / 19°33'12.2"E], alt. 1055 m, 21.7.2009, leg. P. Czarnota 6235
(GPN)); ibid., fs no. 24a, below Brona Pass [49°35'07.3"N / 19°30'41.4"E], alt. 1250 m,
21.8.2009, leg. P. Czarnota 6311 (GPN); S slope of Kepa hill, fs no. 26h [49°34'07.8"N /
19°33'12.8"E], alt. 1290 m, 17.7.2009, leg. P. Czarnota 6078 (GPN); N slope of Diablak
Mt., fs no. 10g [49°34'58.2"N / 19°31'45.7”E], alt. 1180 m, 3.7.2009, leg. P. Czarnota
6140 (GPN); N slope of Babia Gora Massif, Czatoza Forest, fs no. 16a [49°35'42.0"N /
19°28'49.7"E], alt. 1200 m, 23.6.2009, leg. M. Wegrzyn 3792 (KRA).
ECOLOGY & DISTRIBUTION: Similar to several other Calicium species, C. glaucellum is
found on decaying wood of decorticated conifer trunks within different montane forests
up to the timber line.
Although Tobolewski (1966) focused on species of the former Caliciaceae during
his explorations of Babia Gora, he did not report this currently quite common epixylic
lichenized fungus. However, in the Tobolewski key to Calicium (Nowak & Tobolewski
1975), it was likely to be confused with C. abietinum Pers.
Candelariella aurella (Hoftm.) Zahlbr.
SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, S slope of Diablak Mt.,
above the Rajsztag road, fs no. 99h [49°33'45.1"N / 19°43'46.8"E], alt. 905 m, on concrete
of old building ruins, 11.6.2008, leg. M. Wegrzyn 4106 (KRA).
Chaenothecopsis nigra Tibell
SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope of Diablak Mt.,
fs no. 10g [49°34'56.3"N / 19°31'55.2”E], alt. 1170 m, 3.7.2009, leg. P. Czarnota 6133 &
6134 (GPN)); ibid., [49°34'58.0"N / 19°31'52.1"E], alt. 1170 m, 3.7.2009, leg. P. Czarnota
6161 (GPN); below Brona Pass, fs no. 24a, [49°35'10.1"N / 19°30'47.1”E], alt. 1240 m,
14.7.2009, leg. P. Czarnota 6188 (GPN).
ECOLOGY & DISTRIBUTION: Most specimens were collected on free-living algae
Stichococcus in association with Chaenotheca stemonea on bark of dead spruces at trunk
bases, but it was also found on Stichococcus over soil in root-system underhangs of fallen
Picea abies; all collections were within upper montane spruce forest.
This species is often included in lists of lichenicolous fungi (e.g. Bielczyk 2003), but it
is also sometimes lichenized (Giavarini & Coppins 2009) as in this case. From Poland C.
nigra has been reported only twice (Faltynowicz 2003), including a record from Western
Beskidy Mts (Bielczyk 2003) lacking details.
Cladonia cenotea (Ach.) Schaer.
SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, S slope of Kepa hill, fs no.
26h [49°34'09.3"N / 19°33'03.2"E], alt. 1365 m, 17.7.2009, leg. P. Czarnota 6085 (GPN);
N slope of the massif below Brona pass, fs no. 24a [49°35'01.0"N / 19°30'33.5"E], alt.
1330 m, 3.7.2010, leg. M. Wegrzyn 4005 (KRA).
ECOLOGY & DISTRIBUTION: Common in the Polish Carpathians (Faltynowicz 2003;
Bielczyk 2003), this species is found on decaying wood of roots, soil, and plant debris in
upper montane spruce forests.
Lichenized and lichenicolous fungi (Poland) ... 95
Cladonia gracilis (L.) Willd.
SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, S slope of Gowniak hill,
Wolarnia, fs no. 28f [49°34'14.3"N / 19°32'13.0"E], alt. 1575 m, on soil, 10.7.2010, leg. M.
Wegrzyn 4171 (KRA); close to Gowniak hill, fs no. 21f [49°34'32.18"N / 19°32'27.24"E],
alt. 1620 m, on soil, 27.8.2009, leg. M. Wegrzyn 3286 (KRA).
ECOLOGY & DISTRIBUTION: This very common species in lowland Scots pine forests is
also recorded in subalpine and alpine zones of mountain regions in Europe.
In the Tatra Mts alpine meadows are dominated by C. gracilis and C. amaurocraea
(Florke) Schaer. is rare (Osyczka & Wegrzyn 2005), but the situation is reversed in the
Babia Gora Massif (Wegrzyn unpubl.). Because C. amaurocraea and C. macroceras
(Delise) Ahti are morphologically very similar to C. gracilis in this region, species
determination requires more attention, including investigation of their secondary
metabolites (Osyczka & Wegrzyn 2005).
Cladonia grayi G. Merr. ex Sandst.
SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, S of Sokolica hill, fs no. 25c
[49°34'58.3"N / 19°33'48.3"E], alt. 1290 m, on humus over root system of fallen Picea
abies within upper montane spruce forest, 1.7.2009, leg. P. Czarnota 6114 (GPN).
Cladonia norvegica Tonsberg & Holien
SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, E slope of Sokolica hill, fs
no. 25a [49°35'07.9"N / 19°34'06.4”E], alt. 1290 m, on roots of fallen Picea abies within
upper montane spruce forest, 9.6.2009, leg. P. Czarnota 6011 (GPN).
DISTRIBUTION: The species is rare in Poland. Osyczka (2011) confirms its presence in
the Tatra Mts, the Pieniny Mts, and the region of the Puszcza (Primeval) Augustowska
and Puszcza Knyszynska forests in northeast Poland.
Cladonia ochrochlora Flérke
The encountered specimen consists of several subulate and scyphose podetia.
Generally, C. ochrochlora is characterized by areolate cortication with cortex
especially well developed basally but sometimes extending upwards to near the
apices or even inside narrow scyphi. The surface without cortex is covered by
farinose to granular soredia (e.g. Ahti 2000; James 2009). This description can
be applied to the specimen examined; however, some of the gathered podetia
are almost totally areolate-corticate, partly richly squamulose, and produce
only scattered granulose soredia. The specimen was fertile, with most of the
podetia terminating in pale brown contiguous apothecia.
SPECIMEN EXAMINED: POLAND. MAEOPOLSKA PROVINCE, N foot of Diablak Mt.,
Stonow, fs no. 50b [49°36'21.1"N / 19°33'3.8"E], alt. 770 m, on decaying wood, 21.5.2010,
leg. M. Wegrzyn 4008 (KRA).
ECOLOGY & DISTRIBUTION: This species has previously been rather frequently reported
from the Polish Carpathians (see Bielczyk 2003), but not from the Babia Gora Massif.
The specimen was overgrowing decayed spruce wood.
Diploschistes muscorum (Scop.) R. Sant.
SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, the main ridge of massif,
close to Géwniak hill, fs no. 21f [49°34'27.84"N / 19°32'12.99"E], alt. 1680 m, on base-
rich soil between calcareous sandstones, 27.8.2009, leg. M. Wegrzyn 4215 (KRA).
96 ... Czarnota & Wegrzyn
Elixia flexella (Ach.) Lumbsch PLATE 1B
SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope of Diablak Mt.,
close to Suchy Stawek, fs no. 23a [49°34'55"N / 19°31'10.7"E], alt. 1270 m, leg. P. Czarnota
6266 (GPN); SE slope of Kepa hill, fs no. 25c [49°34'20.9"N / 19°33'52.9"E], alt. 1200
m, 17.7.2009, leg. P. Czarnota 6063 (GPN); below Brona Pass, fs no. 24a [49°35'09.3"N /
19°30'51.6"E], 1235 m, 14.7.2009, leg. P. Czarnota 6195 (GPN); N slope of Diablak Mt.,
fs no. 10g [49°34'58.2"N / 19°31'45.7"E], alt. 1180 m, 3.7.2009, leg. P. Czarnota 6141
(GPN).
ECOLOGY & DISTRIBUTION: Quite common on decaying wood of decorticated Picea
abies trunks and fallen spruce roots within the upper montane spruce forest, E flexella is
known elsewhere in the Polish Western Carpathians (Bielczyk 2003).
*Endococcus propinquus (Kérb.) D. Hawksw.
SPECIMENS EXAMINED (both on sterile epilithic lichens): POLAND. MALoPoLska
PROVINCE, SE slope of Kepa hill, fs no. 25c [49°34'21.8"N / 19°33'52.0"E], alt. 1210 m,
17.7.2009, leg. P. Czarnota 6072 (GPN); N slope of Sokolica hill, fs no. 18b [49°35'26.5"N
/ 19°34'02.4"E], alt. 1050 m, 10.6.2009, leg. P. Czarnota 6049 (GPN).
ECOLOGY & DISTRIBUTION: This lichenicolous fungus is probably common in the
Babia Gora Massif; it grows on various epilithic lichens over sandstone rocks above the
timberline but is also found within montane forests.
Fuscidea pusilla Tonsberg
Since Tonsberg (1992) described this species from Scandinavia, its
distribution has markedly increased in Europe, despite its being found only in
a sterile, usually overlooked or hardly distinguishable, form. The presence of
divaricatic acid as the major diagnostic secondary substance appears sufficient
for distinguishing E pusilla from several other morphologically similar species:
Ropalospora viridis (Tonsberg) Tonsberg, Mycoblastus fucatus (Stirt.) Zahlbr.,
Fuscidea arboricola Coppins & Tonsberg, and Buellia griseovirens (Turner
& Borrer ex Sm.) Almb. Ropalospora viridis, also sterile (except a few fertile
reports; Tonsberg 1992), differs almost only in the presence of perlatolic acid
and thus is not UV+ bluish-white (contrasting with E pusilla, which contains
divaricatic acid). The other three species, which also contain substances other
than divaricatic acid, are easily detected in simple spot tests such as: P+ ginger
from fumarprotocetraric acid (M. fucatus and F. arboricola) and K+ yellow
turning to brownish-red and P+ yellow to yellow-orange due to norstictic acid
and substances of stictic acid complex in B. griseovirens. (Sometimes this K+
reaction is almost invisible, as the norstictic acid concentration is below the
detection limit, but then characteristic norstictic acid crystals can be observed
in the slide preparation.) Lendemer (2011) provides excellent morphological
and chemical comparisons of F. pusilla and R. viridis supported by colour
figures.
SPECIMENS EXAMINED (selected): POLAND. MALopoLsKA PROVINCE, N slope of
Diablak Mt., fs no. 22a [49°34'51.3"N / 19°31'41.6"E], alt. 1220 m, 7.8.2009, leg. P.
Lichenized and lichenicolous fungi (Poland) ... 97
Czarnota 6273 (GPN)); E slope of Sokolica hill, fs no. 25a [49°35'07.9"N / 19°34'06.4"E],
alt. 1290 m, 9.6.2009, leg. P. Czarnota 6010 (GPN); N slope of Diablak Mt., fs no. 10g
[49°34'56.3"N / 19°31'55.2"E], alt. 1170 m, 3.7.2009, leg. P. Czarnota 6165 (GPN); E
slope of Sokolica hill, fs no. 25a [49°35'08.2"N / 19°34'07.4"E], alt. 1280 m, 9.6.2009, leg.
P. Czarnota 6201 (GPN); S slope of Kepa hill, fs no. 26h [49°34'07.8"N / 19°33'02.5"E],
alt. 1365 m, 17.7.2009, leg. P. Czarnota 6214 (GPN); S of Sokolica hill, fs no. 25c
[49°35'01"N / 19°33'47.6"E], alt. 1285 m, 1.7.2009, leg. P. Czarnota 6104 (GPN).
ECOLOGY & DISTRIBUTION: Fuscidia pusilla has rarely been reported (normally as an
epiphyte of deciduous trees) from the Polish and Ukrainian Carpathians (Bielczyk 2003;
Koscielniak & Kiszka 2003; Kondratyuk & Coppins 2000), but in the Babia Géra Massif
it is found as a common lichenized fungus on wood of dead decorticated spruces, snags
and wind-throws.
The species has not been reported from the British Isles (Gilbert et al. 2009), whereas
another divaricatic acid-producing sorediate Fuscidia, F. lightfootii (Sm.) Coppins & P.
James, is well known there. An assumption that both species may represent the same
taxon and that F. pusilla is only a morph of F. lightfootii (Gilbert et al. 2009) has no
molecular support. A mtSSU rDNA phylogeny of Fuscideaceae shows that the two
species are not closely related (Bylin et al. 2007).
Helocarpon crassipes Th. Fr.
= Micarea crassipes (‘Th. Fr.) Coppins
Although molecular evidence suggests that H. crassipes is better treated
in the separate genus Helocarpon Th. Fr. (Andersen & Ekman 2005), it is still
sometimes placed in Micarea Fr. (Coppins 2009). Indeed, the ‘micareoid’
photobiont, sparingly branched and anastomosed paraphyses, ascus structure,
and mixture of Cinereorufa-green, Melaena-red, and Melaenida-red apothecial
pigments (Meyer & Printzen 2000) are phenotypic features found in some
representatives of Micarea s. lat. (Coppins 1983). Micarea assimilata (Nyl.)
Coppins in particular resembles H. crassipes in apothecial pigmentation,
lack of secondary substances, and ecology. Both species are terricolous and
have an arctic-alpine distribution (Coppins 1983), but they differ at least in
the thallus and apothecial structure. Micarea assimilata forms thick, slightly
convex areoles intermixed with cephalodia of its additional photobiont, Nostoc,
while the H. crassipes thallus is composed of small, + globose, often coralloid
areoles, with only a chlorococcoid photobiont. Young H. crassipes apothecia
are marginate and constricted below hypothecium forming the distinct stalked
base in contrast to the M. assimilata apothecia, which are never marginate
and shortly stalked. Sterile forms of H. crassipes markedly resemble thalli of
M. leprosula and M. submilliaria (Nyl.) Coppins and can grow together in alpine
regions. However, both these species produce easily detected metabolites,
namely gyrophoric acid and argopsin in M. leprosula (C+ red, Pd+ ginger)
and alectorialic acid in M. submilliaria (Pd+ yellow), and their thallus areoles
are very fragile. Furthermore, both species differ from H. crassipes in their
apothecial characters and spore septation (for more details see Czarnota 2007).
Although Micarea appears not to be monophyletic (Andersen & Ekman 2005)
98 ... Czarnota & Wegrzyn
and phenetically not congeneric with Helocarpon, H. crassipes may represent
Micarea in its classical sense by Coppins (1983), as many other representatives
are morphologically distantly related to the ‘core’ Micarea prasina group.
However, in the mtSSU sequence-based phylogenetic tree of Lecanorales,
H. crassipes nests outside the former Micareaceae. We therefore prefer to retain
the species in the separate genus Helocarpon.
SPECIMEN EXAMINED: POLAND. MAEOPOLSKA PROVINCE, Gowniak hill, by tourist
track [49°34'34"N / 19°32'39"E], alt. 1608 m, on soil and decaying bryophytes,
11.11.2005, leg. P. Czarnota 4600 (GPN).
ECOLOGY & DISTRIBUTION: ‘This terricolous species occurs frequently in the alpine
zone of the Tatra Mts (Bielczyk 2003; Czarnota unpubl.). Its presence in the Babia Gora
Massif was noted by Czarnota (2007), but without locality details. Formerly Helocarpon
crassipes was often recognized as Lecidea assimilata, under which name it is filed in some
Polish herbaria (see Czarnota 2007).
Lecanora chlarotera Nyl.
SPECIMENS EXAMINED (selected; each on a different deciduous tree): POLAND.
MALOPOLSKA PROVINCE, S slope of Diablak Mt., near the Pl-Sk boundary
[49°33'23.47"N / 19°31'47.59"E], alt. 1200 m, 14.5.2008, leg. M. Wegrzyn 3844 (KRA);
Zawoja Markowa, fs no. 72a [49°36'14.2"N / 19°31'13.0"E], alt. 740 m, 11.7.2010,
leg. M. Wegrzyn 4159 (KRA); N slope of massif, W of Sulowa Cyrhla glad, fs no. 71a
[49°35'49.4"N / 19°31'36.9"E], alt. 870 m, 5.8.2010, leg. M. Wegrzyn 4160 (KRA).
Lecanora expallens Ach.
SPECIMENS EXAMINED (selected): POLAND. MALopoLskKa PROVINCE, N slope of
Diablak Mt., fs no. 23a, close to Suchy Stawek [49°34'55"N / 19°31'10.7"E], alt. 1270 m,
7.8.2009, leg. P. Czarnota 6268 (GPN); N slope of Sokolica hill, fs no. 7a [49°35'25.6"N /
19°33'06.9"E], alt. 1055 m, 25.8.2009, leg. P. Czarnota 6328 (GPN); S slope of Kepa hill,
fs no. 26h [49°34'09.3"N / 19°33'09.2"E], alt. 1315 m, 17.7.2009, leg. P. Czarnota 6060
(GPN); ibid., [49°34'07.8"N / 19°33'12.8"E], alt. 1290 m, 17.7.2009, leg. P. Czarnota 6080
(GPN).
ECOLOGY & DISTRIBUTION: This usually sterile species is frequently reported from the
Polish Carpathians (Bielczyk 2003) primarily as an epiphyte on deciduous trees. In
Babia Gora Massif as in other higher ranges of the Western Carpathians, however, it
frequently grows also on hard wood of decorticated dead spruces within upper montane
forests (Czarnota unpubl.).
Lecanora saligna (Schrad.) Zahlbr. var. saligna
SPECIMENS EXAMINED (on decaying wood, bark of snags and roots of fallen spruces):
POLAND. Matopo ska PROVINCE, N of Markowe Szczawiny shelter house, fs no.
74b [49°35'48.7"N / 19°31'12.6"E], alt. 880 m, 2.7.2009, leg. P. Czarnota 6121 (GPN);
below Brona Pass, fs no. 24a, [49°35'44.0"N / 19°31'10.3”E], alt. 940 m, 2.7.2009, leg. P.
Czarnota 6131 (GPN); SE slope of Kepa hill near the Chodnik Parkowy trail, fs no. 27f
[49°34'04.2"N / 19°33'02.1"E], alt. 1350 m, 28.5.2009, leg. M. Wegrzyn 3235 (KRA).
Lecanora sarcopidoides (A. Massal.) Hedl. PLATE 1C
SPECIMEN EXAMINED: POLAND. MAEOPOLSKA PROVINCE, below Brona Pass, fs no.
24a [49°35'10.8”"N / 19°30'45.7”E], alt. 1240 m, 14.7.2009, leg. P. Czarnota 6194 (GPN).
Lichenized and lichenicolous fungi (Poland) ... 99
Lecanora subintricata (Ny1.) Th. Fr. PLATE 1D
This species usually develops an endoxylic thallus (Edwards et al. 2009), but
occasionally a form with a thick, warted, slightly yellowish thallus is encountered
as elsewhere in the Polish Carpathians (Czarnota 2010). It differs from other
morphologically similar Lecanora species (e.g. L. sarcopidoides, L. saligna,
endoxylic forms of L. conizaeoides Nyl. ex Cromb., L. albellula (Nyl.) Th. Fr.) in
its chemistry (presence of only usnic acid) and smaller ascospores. Apothecia of
L. subintricata are variously shaped and pigmented, and the presence of a more
or less developed amphithecium depends on their ontogeny and ecological
conditions. They are mostly concave, olive-grey and slightly yellowish-green
at least in the margin, but sometimes apothecia of L. subintricata in similar
circumstances are olive-brown to brown and often convex and immarginate,
resembling those found in L. saligna var. saligna or some forms of L. phaeostigma
(Korb.) Almb. Some apothecia can also be slightly pruinose, as in L. sarcopidoides,
which, however, has larger ascospores and pseudoplacodiolic acid as the major
substance. Lecanora conizaeoides is easily distinguished by P+ ginger reaction
(fumarprotocetraric acid) in its apothecial margin. The presence of brialmontin
1 as an additional minor secondary compound (Edwards et al. 2009) was not
detected in the tested Polish L. subintricata specimens.
SPECIMENS EXAMINED (selected): POLAND. MALOpPOLsKA PROVINCE, N slope of
Sokolica, fs no. 18c [49°35'15.3"N / 19°33'49.7"E], alt. 120 m, 26.8.2009, leg. P. Czarnota
6335 (GPN); below Brona Pass, fs no. 24a, [49°35'06.6"N / 19°30'43.4”E], alt. 1260 m,
21.8.2009, leg. P. Czarnota 6284 (GPN); SE slope of Kepa hill, fs no. 25c [49°34'21.7"N /
19°33'51.9"E], alt. 1210 m, 17.7.2009, leg. P. Czarnota 6081 (GPN); S slope of Kepa hill,
fs no. 26h [49°34'07.7"N / 19°33'01.9"E], alt. 1365 m, 17.7.2009, leg. P. Czarnota 6067
(GPN).
ECOLOGY & DISTRIBUTION: First modern records of L. subintricata for Poland were
recently confirmed in the Gorce Mts (Czarnota 2010). Both there and in the Babia Gora
Massif, L. subintricata is very common, mostly occupying decayed decorticated spruce
wood, especially frequent in the upper spruce forests much destroyed by the activity
of the bark beetle Ips typographus. In the Polish Western Carpathians, L. subintricata
prefers hard wood exposed to the light and with L. expallens, L. phaeostigma, non-
lichenized Mycocalicium subtile (Pers.) Szatala, and Strangospora moriformis appears to
be one of the first common colonizers of this substrate.
Lecidea leprarioides Tonsberg PLATE 1G
This species, which recently was reported from Gorce Mts as new for Poland
(Czarnota 2010), was collected previously in other Carpathian regions as Lecidea
turgidula Fr. or L. turgidula var. pulveracea ‘th. Fr. (Czarnota unpubl.). Indeed,
L. leprarioides and L. turgidula often have almost identical apothecia, especially
when the thallus of L. leprarioides is less developed and the L. turgidula apothecia
are whitish to bluish pruinose. In such cases secondary compound analyses help
differentiate the usually inconspicuously endosubstratal L. turgidula (which
produces placodiolic acid) and distinctly sorediate L. leprarioides (which
100 ... Czarnota & Wegrzyn
contains pseudoplacodiolic acid, rarely present in other lichens; Tonsberg 1992).
Similar sorediate thalli, often found in similar habitats in the Carpathians, may
also form in L. nylanderi (Anzi) Th. Fr. and diminutive examples of Ochrolechia
microstictoides Rasanen. However, both species are usually sterile, in contrast to
the usually fertile L. leprarioides, which is easily distinguished by its immarginate,
convex, bluish-grey apothecia immersed within sorediate patches. All species
differ markedly in their chemistry: L. nylanderi contains divaricatic acid and
O. microstictoides variolaric and lichesterinic acids. Furthermore, their soredia are
thicker and more granular, and thus their thalli are less farinose than the thallus
of L. leprarioides. Another similar, usually sterile, sorediate epiphyte growing
on acidic bark, which also sometimes serves as substrate for L. leprarioides, is
Cliostomum leprosum (Rasanen) Holien & Tonsberg. ‘This species is, however,
rare (reported mainly from N Europe; Golubkov & Kukwa 2006) and its major
compounds are atranorin and caperatic acid (Tonsberg 1992). For an excellent
description of L. leprarioides and similarities to other morphologically related
taxa, see also Tonsberg (1992) and Aptroot et al. (2009).
SPECIMENS EXAMINED (selected): POLAND. MALopoLskKA PROVINCE, N slope of
Sokolica hill, fs no. 18c [49°35'13.7"N / 19°33'48.3"E], alt. 1200 m, 26.8.2009, leg. P.
Czarnota 6302 (GPN); N slope of Diablak Mt., fs no. 21b [49°35'04.6"N / 19°32'15.3"E],
alt. 1160 m, 3.7.2009, leg. P. Czarnota 6156 (GPN); below Brona Pass, fs no. 24a
[49°35'10.2"N / 19°30'50.4"E], alt. 1230 m, 14.7.2009, leg. P. Czarnota 6177 (GPN);
SE slope of Sokolica hill near the Chodnik Parkowy trail, fs no. 25c [49°34'44.0"N /
19°33'51.5"E], alt. 1380 m, 24.5.2009, leg. M. Wegrzyn 3823 (KRA); ibid., [49°34'51.7"N
/ 19°34'06.5"E], alt. 1300 m, 24.5.2009, leg. M. Wegrzyn 4152 (KRA).
ECOLOGY & DISTRIBUTION: Lecidea leprarioides is a common lichenized fungus usually
found on decayed wood of conifer snags, but sometimes it also grows directly on bark
of spruces, more particularly within destroyed parts of upper montane spruce forests,
similar to Lecanora subintricata.
Lepraria eburnea J.R. Laundon
SPECIMENS EXAMINED (selected): POLAND. MALOPOLsKA PROVINCE, N slope
of Sokolica hill, fs no. 18c [49°35'13.7"N / 19°33'48.5"E], alt. 1200 m, 26.8.2009, leg.
P. Czarnota 6349 (GPN)); ibid., fs no. 6d [49°35'34.6"N / 19°33'34.5"E], alt. 990 m,
25.8.2009, leg. P. Czarnota 6319 (GPN); E slope of Kepa hill, fs no. 25c [49°34'21.8"N /
19°33'52.0"E], alt. 1210 m, 17.7.2009, leg. P. Czarnota 6073 (GPN).
ECOLOGY & DISTRIBUTION: On tree bark, decaying wood, and sandstone rocks in the
lower and upper zones of Babia Gora Massif.
Lepraria jackii Tonsberg
This species is differentiated from other Lepraria species by an almost mealy
thallus that is shared only by L. toensbergiana, from which it differs only
chemically (Bayerova et al. 2005).
SPECIMENS EXAMINED (selected): POLAND. MALOPOLSKA PROVINCE, N slope of
Diablak Mt., fs no. 22a [49°34'51.3"N / 19°31'41.6"E], alt. 1220 m, 7.8.2009, leg. P.
Czarnota 6272 (GPN)); E slope of Sokolica hill, fs no. 25a [49°35'08.8"N / 19°34'05.9"E],
Lichenized and lichenicolous fungi (Poland) ... 101
alt. 1280 m, 9.6.2009, leg. P. Czarnota 6053 (GPN); ibid., fs no. 18c [49°35'7.4"N /
19°33'52.5"E], alt. 1350 m, 6.6.2009, leg. M. Wegrzyn 3261 (KRA); SE slope of Kepa
hill, fs no. 25c [49°34'20.9"N / 19°33'52.9"E], alt. 1200 m, 17.7.2009, leg. P. Czarnota
6064 (GPN); N slope of massif, below Dolny Plaj forest road, fs no. 57g [49°35'39.3"N /
19°32'51.6"E], alt. 900 m, 8.5.2010, leg. M. Wegrzyn 4146 (KRA).
ECOLOGY & DISTRIBUTION: This anamorphic lichenized fungus seems to be the most
common Lepraria in the Western Carpathians. In addition to the Babia Gora Massif,
many sites occur in the Gorce Mts (Czarnota & Kukwa 2001), Beskid Sadecki Mts
(Kukwa & Sliwa 2005), and Tatra Mts (Kukwa 2004) where it usually grows on conifer
bark, decaying stumps and snags, and roots of fallen trees.
Lepraria rigidula (B. de Lesd.) Tonsberg
SPECIMEN EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope Diablak Mt.,
Sulowa Cyrhla glade [49°36'04.9"N / 19°32'14.4"E], alt. 840 m, on bark of Salix sp.,
3.5.2010, leg. M. Wegrzyn 4156 (KRA).
ECOLOGY & DISTRIBUTION: Although rather common in Poland (Kukwa 2006), L.
rigidula has been thus far recorded only from one locality in the Babia Gora Massif.
It may be more frequent here, especially on the bark of solitary or roadside deciduous
trees at foot of the massif or in old orchards, as data suggest from other West Carpathian
ranges (e.g. Kukwa & Sliwa 2005).
Leptogium intermedium (Arnold) Arnold PLATE 18, F
This cyanolichen from the study area has a small thallus composed of
numerous spreading squamules up to 3 mm in width, but most do not exceed
1.5 mm. Vertical sections of the thallus are distinctly heteromerous, consisting
of dense single-layered zones of large (5-10 tum) cells in the upper and lower
cortex surrounding loosely interwoven fungal hyphae in the medulla. Individual
lobe margins are sometimes deeply cut. Their upper surface is unwrinkled and
brownish-grey when dry. Concave apothecia are very numerous, <1.5 mm
diam.; thalline margin distinct, beige, paler than the brownish disc.
L. intermedium mostly resembles diminutive specimens of L. gelatinosum
(With.) J.R. Laundon, which, however, has larger lobes distinctly wrinkled at
the upper surface and more brownish apothecial discs (Jorgensen 1994).
The material presented above differs slightly from the species description
by Jorgensen (1994) and Gilbert & Jorgensen (2009) in the size of squamules
and apothecia, which are larger here. Furthermore, in the Polish specimen the
upper thallus surface is rather smooth, in contrast to the weakly wrinkled lobes
given as a diagnostic feature for L. intermedium.
SPECIMEN EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope of massif, Czatoza
Forest, fs no. 16a [49°35'44.7"N / 19°28'57.2"E], alt. 900 m, on the base of a mossy
old beech within ancient Carpathian beech forest, 29.10.2008, leg. M. Wegrzyn 4151
(KRA).
ECOLOGY & DISTRIBUTION: This species is widespread in Europe (Jorgensen 1994;
Gilbert & Jorgensen 2009) but has been reported only twice in Poland from the Gorce
Mts in the Carpathians (Czarnota 1997) and the Gory Kaczawskie Mts in the Sudetes
102 ... Czarnota & Wegrzyn
(Kossowska 2008), where it was found on a clayey soil overlying calcareous sandstone
and on mossy rocks in deeply shaded places (Czarnota 1997; Kossowska 2008). In the
Babia Gora Massif, L. intermedium occurs on the base of a mossy old beech in the
best conserved fragment of an ancient Carpathian beech forest in this massif. Such a
substrate is rarely reported elsewhere.
Although L. intermedium was discovered in the Polish Carpathians no more than 20
years ago (Czarnota 1997), reports from the Gorce Mts should be regarded as historical.
The 1997 flood completely destroyed all known L. intermedium sites in localities
that region. Its new Babia Gora Massif locality may be the only site left in the Polish
Carpathians.
Micarea byssacea (Th. Fr.) Czarnota, Guz.-Krzemin. & Coppins
SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of Sokolica hill, fs
no. 18b [49°35'21.5"N / 19°33'39.1"E], alt. 1120 m, on decaying wood of decorticated
Picea abies within a montane spruce-fir forest, 10.6.2009, leg. P. Czarnota 6005 (GPN).
ECOLOGY & DISTRIBUTION: Recently segregated from the Micarea micrococca complex,
this species is characterized in detail by Czarnota & Guzow-Krzeminska (2010). It is
poorly known under the name M. byssacea, but is probably a more common epixylic
or epiphytic lichenized fungus in lowland forests; in the Western Carpathians it is
widespread, but uncommon (Czarnota unpubl.).
Micarea leprosula (Th. Fr.) Coppins & A. Fletcher
SPECIMEN EXAMINED: POLAND. MAEOPOLSKA PROVINCE, Gowniak hill, by tourist
track [49°34'34"N / 19°32'39"E], alt. 1608 m, on soil, decaying bryophytes, plant debris
and terricolous lichens in alpine zone, 11.11.2005, leg. P. Czarnota 4598 (GPN).
ECOLOGY & DISTRIBUTION: This terricolous alpine species was reported several times from
the Polish Western Beskidy Mts, but its large population is located in the neighbouring
Tatra Mts (Czarnota 2007). For taxonomic notes see also under Helocarpon crassipes.
Micarea lithinella (Nyl.) Hedl.
SPECIMENS EXAMINED (selected; all on sandstone shaded pebbles): POLAND.
MALOPOLSKA PROVINCE, SE slope of Kepa hill, fs no. 25¢ [49°34'29.6"N / 19°33'40.4"E],
alt. 1360 m, 26.8.2009, leg. P. Czarnota 6351 (GPN); SE slope of Sokolica, fs no. 25c
[49°34'51.7"N / 19°34'06.5"E], alt. 1300 m, 24.5.2009, leg. M. Wegrzyn 3170 (KRA); N
slope of Sokolica hill, fs no. 18¢ [49°35'16.0"N / 19°33'54.0"E], alt. 1200 m, 6.6.2009,
leg. M. Wegrzyn 4155 (KRA); N slope Diablak Mt., W of Sulowa Cyrhla, fs no. 70c
[49°35'56.7"N / 19°31'35.4"E], alt. 830 m, 5.8.2010, leg. M. Wegrzyn 4158 (KRA).
ECOLOGY & DISTRIBUTION: ‘This epilithic species is a common early colonizer of
sandstone pebbles over root systems of wind-throws within montane forests, as indicated
recent studies in other ranges of the Western Carpathians (Czarnota unpubl.).
Micarea nowakii Czarnota & Coppins
SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, below Brona Pass, fs no.
24a [49°35'09.6"N / 19°30'49.1"E], alt. 1235 m, 14.7.2009, leg. P. Czarnota 6212 (GPN);
N slope of Sokolica, fs no. 18¢ [49°35'15.0"N / 19°33'49.7"E], alt. 1200 m, 26.8.2009,
leg. P. Czarnota 6307 (GPN); E slope of Sokolica hill, fs no. 25a [49°35'08.8"N /
19°34'05.9"E], alt. 1280 m, 9.6.2009, leg. P. Czarnota 6023 (GPN); S slope of Kepa hill,
fs no. 26h [49°34'09.3"N / 19°33'03.2"E], alt. 1365 m, 17.7.2009, leg. P. Czarnota 6086
(GPN).
Lichenized and lichenicolous fungi (Poland) ... 103
ECOLOGY & DISTRIBUTION: This recently described species (Czarnota 2007), a member
of the Micarea prasina group (Czarnota & Guzow-Krzeminska 2010), appears to be an
early colonizer of decorticated logs of spruce wind-throws in the upper montane zone of
Babia Gora Massif. It prefers well-lit places, especially forest areas destroyed by the bark
beetle Ips typographus. The present data extend the range of M. nowakii to other parts
of Western Carpathians, being additional to its first discoveries in the Gorce Mts and
Beskid Maly Mts (Czarnota 2007).
A realistic world distribution of M. nowakii is as yet unknown due to its phenetic
similarity to M. denigrata, M. misella, and dark coloured morphotypes of M. prasina.
It differs from M. denigrata by its usually simple and shorter ascospores and lack of
gyrophoric acid, from M. misella by its wider conidia (similar to M. denigrata) and the
presence of micareic acid, and from M. prasina by its usually numerous black, barrel-like
and aggregated pycnidia, and lack of thallus composed of goniocysts. M. nowakii is also
reported from Sweden (Svensson & Westberg 2010).
Peltigera leucophlebia (Nyl.) Gyeln.
SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of Diablak hill, fs
no. 22m [49°34'23.2"N / 19°31'32.0"E], alt. 1620 m, on plant debris in Salix silesiaca
community, 7.8.2009, leg. M. Wegrzyn 3198 (KRA).
ECOLOGY & DISTRIBUTION: This arctic-boreal-alpine species is widespread in the
northern hemisphere but is very rare in the Western Carpathians, except in the
subalpine and alpine zones of the Tatra Mts (Lisické 2005). From other Polish parts
of the Western Carpathians, it has only been reported on three occasions growing in
lower forested mountain zones (Bielczyk 2003). In the Babia Gora Massif, P. leucophlebia
occurs above timberline, where terricolous and mossy habitats are much more suitable
for the species.
Physcia caesia (Hoffm.) Hampe ex Fiirnr.
SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, NW slope of Mala Babia
Gora hill, Czarna Cyrhel glade [49°35'50.0"N / 19°29'8.8"E], alt. 880 m, on concrete,
23.6.2009, leg. M. Wegrzyn 4253 (KRA).
Physcia tenella (Scop.) DC.
SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of Diablak Mt.,
Sulowa Cyrhla glade [49°36'04.9"N / 19°32'14.4"E], alt. 840 m, on bark of Salix sp.,
3.5.2010, leg. M. Wegrzyn 4162 (KRA).
Physconia grisea (Lam.) Poelt
SPECIMEN EXAMINED: POLAND. MAEOPOLSKA PROVINCE, N foot of Diablak
Mt., Zawoja Markowa, fs no. 72d [49°36'29.8"N / 19°31'03.5"E], alt. 740 m, on bark of
roadside Fraxinus excelsior, 14.5.2010, leg. M. Wegrzyn 4219 (KRA).
Placynthiella oligotropha (J.R. Laundon) Coppins & P. James
SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, below Brona Pass,
fs no. 24a [49°35'10.8"N / 19°30'50.5”E], alt. 1230 m, 14.7.2009, leg. P. Czarnota 6173
(GPN); ibid., [49°35'10.1"N / 19°30'47.1”E], alt. 1240 m, 14.7.2009, leg. P. Czarnota
6202 (GPN); N foot of Diablak Mt., Zawoja Markowa, fs no. 77a [49°36'13.8"N /
19°30'22.5"E], alt. 815 m, 6.8.2010, leg. M. Wegrzyn 4217 (KRA).
ECOLOGY & DISTRIBUTION: In the Babia Gora Massif this terricolous species prefers
well-lit soil over root systems of wind-throws, similar to those in other ranges of Western
104 ... Czarnota & Wegrzyn
Carpathians (Czarnota unpubl.). In these habitats it is a frequent member of a pioneer
lichen biota.
Porina chlorotica (Ach.) Mill. Arg.
SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, N of Markowe Szczawiny
shelter house, fs no. 73b [49°35'49.3"N / 19°31'13.1”E], alt. 880 m, on sandstone pebble
under root system of fallen Picea abies within Carpathian beech forest, 2.7.2009, leg. P.
Czarnota 6125 (GPN).
Porpidia soredizodes (Lamy) J.R. Laundon
SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope of Diablak Mt.,
fs no. 22a [49°34'54"N / 19°31'39.9"E], alt. 1220 m, 7.8.2009, leg. P. Czarnota 6250
(GPN); ibid., [49°34'36.6"N / 19°31'23.00"E], alt. 1370 m, 21.6.2009, leg. M. Wegrzyn
3323 (KRA); ibid., fs no. 10g [49°34'56.7"'N / 19°31'54.8"E], alt. 1170 m, 3.7.2009, leg. P.
Czarnota 6145 (GPN).
ECOLOGY & DISTRIBUTION: This saxicolous species is frequent in the Polish Western
Carpathians on various acidic rocks (Jablofska 2010). However, since it resembles
Porpidia tuberculosa (Sm.) Hertel & Knoph, also abundant there, correct determination
of both species requires analyses of their secondary compounds. In the Babia Gora
Massif, P. soredizodes has been found on sandstone rocks in forested zones.
Psilolechia clavulifera (Nyl.) Coppins
SPECIMENS EXAMINED (selected): POLAND. MALopoLskKA PROVINCE, N slope of
Diablak Mt., fs no. 22a [49°34'46.4"N / 19°31'34.3”E], alt. 1300 m, 7.8.2009, leg. P.
Czarnota 6275 (GPN); N slope of Sokolica hill, fs no. 7a [49°35'27.1"N / 19°33'28.5"E],
alt. 1090 m, 21.7.2009, leg. P. Czarnota 6248 (GPN)); E slope of Sokolica hill, fs no. 25a
[49°35'09.5"N / 19°34'05.8"E], alt. 1280 m, 9.6.2009, leg. P. Czarnota 6029 (GPN); SE
of Sokolica hill, fs no. 25c [49°34'21.4"N / 19°33'52.4"E], alt. 1210 m, 17.7.2009, leg. P.
Czarnota 6216 (GPN)); ibid., [49°34'51.7"N / 19°34'06.5"E], alt. 1300 m, 24.5.2009, leg.
M. Wegrzyn 3183 (KRA).
ECOLOGY & DISTRIBUTION: Recently Czarnota & Kukwa (2008b) presented a modern
distribution of P. clavulifera in Poland that shows the best habitats as being roots, soil,
and acidic rocks under root systems of wind-throws. The same is also observed in the
Babia Gora Massif, confirming the species as an early colonizer of such habitats.
Pycnora praestabilis (Nyl.) Hafellner
In Central Europe, P. praestabilis is reported as a separate species resembling
the Scandinavian P. xanthococca; however the phenetic characters are not so
distinct. In the Western Carpathians, P. praestabilis very frequently grows
in association with P. sorophora, which is sorediate and usually sterile but
chemically similar. Some morphs of both species seem to be transient and the
small conidial size differences regarded as diagnostic (Timdal 1984) are not
necessarily convincing in identification. Moreover, pycnidia are not always
present in P sorophora; thus, separation of the species will probably rely on
future molecular evidence. Here, P praestabilis is recognized only as a fertile,
non-sorediate Pycnora morphotype.
Lichenized and lichenicolous fungi (Poland) ... 105
SPECIMENS EXAMINED (selected): POLAND. MALOpPOLsKA PROVINCE, N slope of
Diablak Mt., fs no. 22a [49°34'44.5"N / 19°31'32.2"E], alt. 1335 m, 7.8.2009, leg. P.
Czarnota 6256 (GPN); below Brona Pass, fs no. 24a [49°35'10.1"N / 19°30'47.2"E],
alt. 1240 m, 14.7.2009, leg. P. Czarnota 6178 (GPN); S of Sokolica hill, fs no. 25c
[49°34'58.2"N / 19°33'48.6”E], alt. 1285 m, 1.7.2009, leg. P. Czarnota 6110 (GPN); SE
slope of Géwniak hill, fs no. 27f [49°34'4.2"N / 19°33'02.1"E], alt. 1350 m, 28.5.2009,
leg. M. Wegrzyn 3362 (KRA).
ECOLOGY & DISTRIBUTION: In the Babia Géra Massif, P. praestabilis frequently occurs
on wood of decorticated Picea abies trunks, but mostly within well-lit upper montane
spruce forest destroyed by the activity of the bark beetle Ips typographus.
Pycnora sorophora (Vain.) Hafellner
SPECIMENS EXAMINED (selected): POLAND. MALopo ska PROVINCE, N slope of
Diablak Mt., fs no. 23a [49°34'44.6"N / 19°31'17.6"E], alt. 1330 m, 7.8.2009, leg. P.
Czarnota 6269 (GPN); N slope of Sokolica hill, fs no. 7a [49°35'22.6"N / 19°33'07.5"E],
alt. 1080 m, 25.8.2009, leg. P. Czarnota 6331 (GPN); below Brona Pass, fs no. 24a
[49°35'10.1"N / 19°30'47.2"E], alt. 1240 m, 14.7.2009, leg. P. Czarnota 6179 (GPN); S
of Sokolica hill, fs no. 25c [49°34'58.2"N / 19°33'48.6"E], alt. 1285 m, 1.7.2009, leg. P.
Czarnota 6111 (GPN); SE slope of Kepa hill, fs no. 25g [49°34'32.9"N / 19°33'30.1"E],
alt. 1440 m, 18.9.2010, leg. M. Wegrzyn 4212 (KRA).
ECOLOGY & DISTRIBUTION: In the Babia Gora Massif, P. sorophora is more frequent than
P. praestabilis, occupying similar woody habitats, as well as the bark of Norway spruces,
but is not strictly confined to upper montane stands (see above).
Strangospora moriformis (Ach.) Stein
SPECIMENS EXAMINED (selected): POLAND. MALOPOLSKA PROVINCE, E slope of
Sokolica hill, fs no. 25a [49°35'02.8"N / 19°34'05.6”E], alt. 1220 m, 1.7.2009, leg. P.
Czarnota 6112 (GPN)); ibid., [49°35'09.6"N / 19°34'08.6"E], alt. 1265 m, 9.6.2009, leg.
P. Czarnota 5989 (GPN); below Brona Pass, fs no. 24a [49°35'10.5"N / 19°30'47.4"E],
alt. 1240 m, 14.7.2009, leg. P. Czarnota 6191 (GPN); N slope of Diablak Mt., fs no. 22a
[49°34'48.2"N / 19°31'34.1”E], alt. 1270 m, 7.8.2009, leg. P. Czarnota 6260 (GPN); E of
Markowe Szczawiny shelter house, fs no. 10d [49°35'26.0"N / 19°29'44.5"E], alt. 1105 m,
4.9.2010, leg. M. Wegrzyn 4154 (KRA).
ECOLOGY & DISTRIBUTION: Strangospora moriformis was formerly rarely reported from
Western Carpathians, including the Tatra Mts (Bielczyk 2003, Lisicka 2005), but recent
investigations show that this species is common in dead (destroyed by the bark beetle)
parts of upper montane spruce forests throughout the Polish Western Beskidy Mts
(Czarnota unpubl.). It is an early colonizer of such natural woody substrates associated,
for example, with Mycocalicium subtile, Lecanora subintricata, and Lecidea turgidula. It
is interesting that this species has not been found in similar habitats in the Polish Tatra
Mts, despite recent intensive field explorations.
Trapelia corticola Coppins & P. James
SPECIMENS EXAMINED (selected): POLAND. MALOPOLSKA PROVINCE, N slope of
Sokolica hill, fs no. 18b [49°35'21.5"N / 19°33'39.1”E], alt. 1120 m, 10.6.2009, leg. P.
Czarnota 6006 (GPN); N of Markowe Szczawiny shelter house, fs no. 74b [49°35'48"N
/ 19°31'12.4"E], alt. 890 m, 2.7.2009, leg. P. Czarnota 6129 (GPN); SE slope of Sokolica
hill, fs no. 25c, [49°34'51.7"N / 19°34'06.5"E], alt. 1300 m, 24.5.2009, leg. M. Wegrzyn
3171 (KRA).
106 ... Czarnota & Wegrzyn
ECOLOGY & DISTRIBUTION: A modern distribution of this sterile, sorediate species in
Poland is presented by Czarnota & Kukwa (2009); based on this and recent field data,
T. corticola seems to be common throughout the Western Carpathians (Czarnota
unpubl.) but is usually found in ancient or natural forest communities with abundant
standing or fallen ‘dead wood.
Trapelia obtegens (Th. Fr.) Hertel
SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, S of Sokolica hill, fs no.
25c [49°35'01.9"N / 19°33'55.8"E], alt. 1260 m, 1.7.2009, leg. P. Czarnota 6089 (GPN);
ibid., [49°34'51.7"N / 19°34'06.5"E], alt. 1300 m, 24.5.2009, leg. M. Wegrzyn 3178
(KRA); SE slope of Kepa hill, fs no. 25c, [49°34'48.0"N / 19°34'06.8"E], alt. 1290 m,
16.9.2009, leg. P. Czarnota 6352 (GPN).
ECOLOGY & DISTRIBUTION: This epilithic early colonizer is usually found on acidic rocks
in well-lit places. In forested parts of the Western Carpathians, including the Babia Gora
Massif, T: obtegens is mostly confined to small sandstone pebbles lying on root systems
of wind-throws.
Trapeliopsis glaucolepidea (Nyl.) Gotth. Schneid. PLATE 1H
This species is recognized under two different morphotypes: (1) as T. glauco-
lepidea forming more or less distinct squamules with lip-shaped soralia and (2)
as T. percrenata (Nyl.) Gotth. Schneid. producing punctiform soralia at a very
early thallus developmental stage and thus never distinctly squamulose. Recent
ITS analyses (Palice & Printzen 2004) support previous assumptions that
both morphotypes could be conspecific (Palice 1999). In tropical populations
T. glaucolepidea was found to be usually squamulose and often fertile but in
Europe both phenetic forms are found and are almost exclusively sterile (Palice
& Printzen 2004). It is interesting that European squamulose forms occur in
regions with high precipitation (western Europe and mountains in the Central
Europe) growing on a strongly decayed wood or humus, while the “T: percrenata’
morphotypes occur on somewhat harder wood or are sometimes epiphytic and
much more widespread in European lowlands.
The small, almost only sorediate stage of the species mostly resembles
Trapelia corticola, another lichen found in similar habitats throughout Europe.
The two morphologically similar species are composed of separate, punctiform,
bright green to whitish-green soralia but differ in their chemistry. Trapelia
corticola produces gyrophoric acid, which can be detected in the simple spot
test reaction C+ red, while Trapeliopsis glaucolepidea soralia are C-. There are
also ‘soraliate’ epixylic Micarea prasina forms that may resemble the punctiform
T. glaucolepidea morphotypes (Czarnota unpubl.). In such cases, both species
can be also identified based on their chemistry, although the micareic acid
present in M. prasina is only detected by chromatography. The squamulose
forms of T: glaucolepidea are very similar to the young thalli of many Cladonia
taxa that often grow together in the same place. Here the presence of lip-shape
soralia diagnoses T: glaucolepidea.
Lichenized and lichenicolous fungi (Poland) ... 107
SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope of Diablak Mt.,
fs no. 23b [49°34'57.6"N / 19°31'13.2"E], alt. 1265 m, 7.8.2009, leg. P. Czarnota 6278
(GPN); E slope of Sokolica hill, fs no. 25a [49°35'07.9"N / 19°34'06.4”E], alt. 1290 m,
9.6.2009, leg. P. Czarnota 6012 (GPN).
ECOLOGY & DISTRIBUTION: On the Polish side of the Carpathians, T: glaucolepidea
has been reported only four times from the neighbouring Gorce Mts and Tatra Mts
(Czarnota & Kukwa 2004; Czarnota 2010), but it is a widespread species, known also
from the Slovak and Ukrainian Carpathians (Palice & Printzen 2004; Palice et al. 2006;
Vondrak et al. 2010). In the Babia Gora Massif, it is found on humus and strongly
decayed wood over root systems of up-ended spruces in natural upper montane spruce
stands. Only the squamulose morphotype has been observed there and in the Tatra Mts,
whereas the ‘T. percrenata’ form dominates in the Gorce Mts. In the first two ranges
T. glaucolepidea has been recorded above 1200 m a.s.l., while in Gorce Mts its localities
do not exceed 1020 m.
Trapeliopsis pseudogranulosa Coppins & P. James
SPECIMENS EXAMINED (selected): POLAND. MALOpPOLSKA PROVINCE, N slope of
Sokolica hill, fs no. 6d [49°35'27.7"N / 19°33'42.5"E], alt. 1060 m, 25.8.2009, leg. P.
Czarnota 6294 (GPN); ibid., fs no. 7a [49°35'24.3"N / 19°33'12.7"E], alt. 1060 m,
21.7.2009, leg. P. Czarnota 6228 (GPN); N of Markowe Szczawiny shelter house, fs no.
73b [49°35'49.3"N / 19°31'13.1"E], alt. 880 m, 2.7.2009, leg. P. Czarnota 6127 (GPN).
ECOLOGY & DISTRIBUTION: A common species throughout the Carpathians, being
mostly found in the Babia Gora Massif on decaying wood of wind-throws in shady and
moist forests.
Acknowledgements
We would like to thank Jézef Omylak (Director of the Babia Gora National Park)
for permission to research lichen biota in the National Park area and Tomasz Lamorski
for help in conducting fieldwork and invaluable advice. We are also grateful to Dr
Piotr Osyczka (Krakéw) for his assistance in determining some Cladonia and Lepraria
species by TLC, to Natalia Gucwa for tireless assistance in the field and the herbarium,
and to Prof. Mark Seaward (Bradford, UK) for linguistic corrections and valuable
improvements. We are greatly indebted also to Dr Anna Guttova (Slovakia, Bratislava)
and Dr Vagn Alstrup (Denmark, Copenhagen) for valuable criticism of the manuscript.
This research was supported by the Polish Ministry of Science and Higher Education,
grants No. N N305 306835 (P. Czarnota) and N N305 2779 33 (M. Wegrzyn).
Literature cited
Ahti T. 2000. Cladoniaceae. Flora Neotropica Monograph 78: 1-362.
Andersen HL, Ekman S. 2005. Disintegration of the Micareaceae (lichenized Ascomycota): a
molecular phylogeny based on mitochondrial rDNA sequences. Mycological Research 109(1):
21-30. http://dx.doi.org/10.1017/S0953756204001625
Aptroot A, Gilbert OL, Hawksworth DL, Coppins BJ. 2009. Lecidea Ach. (1803). 502-519, in: CW
Smith et al. (eds), The Lichens of Great Britain and Ireland. British Lichen Society, London..
Bayerova $, Kukwa M, Fehrer J. 2005. A new species of Lepraria (lichenized ascomycetes) from
Europe. Bryologist 108: 131-138.
http://dx.doi.org/10.1639/0007-2745(2005)108[131:ANSOLL]2.0.CO;2
Bielczyk U. 2003. The lichens and allied fungi of the Polish Western Carpathians. 23-232, in: U
Bielczyk (ed.), The lichens and allied fungi of the Polish Carpathians — an annotated checklist,
108 ... Czarnota & Wegrzyn
Biodiversity of the Polish Carpathians. W. Szafer Institute of Botany, Polish Academy of
Sciences, Krakow.
Bielczyk U. 2004. Rdoznorodnosé gatunkowa porost6w Babiogérskiego Parku Narodowego.
285-314, in: BW Woloszyn et al. (eds), Babiogorski Park Narodowy. Monografia przyrodnicza,
Wydawnictwo i Drukarnia Towarzystwa Slowakow w Polsce, Krakéw.
Boberski W. 1886. Systematische Ubersicht der Flechten Galiziens. Verh. Zool.-Bot. Ges. Wien 36:
243-286.
Bylin A, Arnerup J, Hogberg N, Thor G. 2007. A phylogenetic study of Fuscideaceae using mtSSU
rDNA. Bibliotheca Lichenologica 96: 49-60.
Coppins BJ. 1983. A taxonomic study of the lichen genus Micarea in Europe. Bull. Brit. Mus. Nat.
Hist. 11: 17-214.
Coppins BJ. 2009. Micarea Fr. (1825). 583-686, in: CW Smith et al. (eds), The Lichens of Great
Britain and Ireland. British Lichen Society, London..
Coppins BJ, Kondratyuk S, Khodosovtsev A, Zelenko S, Coppins A, Wolseley P, Virchenko V. 1998.
Diversity of lichens and bryophytes in Regional Landscape Park ‘Stuzhytsia (Ukrainian part
of the international biosphere reserve ‘Eastern Carpathians’). 139-161, in: S Kondratyuk, BJ
Coppins (eds), Lobarion lichens as indicators of the primeval forests of the Eastern Carpathians,
Darwin International Workshop, 25-30 May 1998, Kostrino. Phytosociocentre, Kiev.
Coppins BJ, Kondratyuk SYa, Khodosovtsev AYe, Zelenko SD, Wolseley PA. 2005. Contribution to
lichen flora of Ukrainian Carpathians. Chornomors’ki Bot. J. 1: 5-23.
Czarnota P. 1997. Micarea synotheoides, M. hedlundi (Micareaceae) and Leptogium intermedium
(Collemataceae), three lichens new to Poland. Fragm. Flor. Geobot. 42(2): 489-494.
Czarnota P. 2003. Notes on some new and noteworthy lichens from southern Poland. Graphis
Scripta 14: 18-26.
Czarnota P. 2007. The lichen genus Micarea (Lecanorales, Ascomycota) in Poland. Polish Bot. Stud.
232 T1199,
Czarnota P. 2010. Krytyczna lista porostéw i grzybéw naporostowych Gorcow. Ochrona Beskidéw
Zachodnich 3: 55-78.
Czarnota P, Guzow-Krzeminska B. 2010. A phylogenetic study of the Micarea prasina-group
shows that Micarea micrococca includes three distinct lineages. Lichenologist 42: 7-20.
http://dx.doi.org/10.1017/S0024282909990211
Czarnota P, Kukwa M. 2001. Lichens of the genera Lepraria and Leproloma from the Gorce Mts
(Western Carpathians, Poland) and note on lichenicolous fungus Paranectria oropensis found
on Leproloma membranaceum. Polish Bot. J. 46: 199-206.
Czarnota P, Kukwa M. 2004. Some sorediate lichens and lichenicolous fungi new to Poland. Graphis
Scripta 15: 24-32.
Czarnota P, Kukwa M. 2008a. Contribution to the knowledge of some poorly known lichens in
Poland. I. The genus Absconditella. Folia Cryptog. Estonica 44: 1-7.
Czarnota P, Kukwa M. 2008b. Contribution to the knowledge of some poorly known lichens in
Poland. II. The genus Psilolechia. Folia Cryptog. Estonica 44: 9-15.
Czarnota P, Kukwa M. 2009. Contribution to the knowledge of some poorly known lichens in
Poland. III. Trapelia corticola and the genus Vezdaea. Folia Cryptog. Estonica 46: 25-31.
Edwards B, Aptroot A, Hawksworth DL, James PW. 2009. Lecanora Ach. in Luyken (1809).
465-502, in: CW Smith et al. (eds), The Lichens of Great Britain and Ireland. British Lichen
Society, London.
Faltynowicz W. 2003. The lichens, lichenicolous and allied fungi of Poland. An annotated checklist.
Biodiversity of Poland 6. W. Szafer Institute of Botany, Polish Academy of Sciences, Krakow.
435 p.
Fletcher A, Coppins BJ. 2009. Catillaria A. Massal. (1852). 282-288, in: CW Smith et al. (eds), The
Lichens of Great Britain and Ireland. British Lichen Society, London.
Giavarini V, Coppins BJ. 2009. Chaenothecopsis Vain. (1927). 303-307, in: CW Smith et al. (eds),
The Lichens of Great Britain and Ireland. British Lichen Society, London.
Lichenized and lichenicolous fungi (Poland) ... 109
Gilbert OL, Jorgensen PM. 2009. Leptogium (Ach.) Gray (1821).541-551, in: CW Smith et al. (eds),
The Lichens of Great Britain and Ireland. British Lichen Society, London.
Gilbert OL, Purvis OW, Skjoldahl LH, Tonsberg T. 2009. Fuscidea V. Wirth & Vézda (1972).
407-411, in: CW Smith et al. (eds), The Lichens of Great Britain and Ireland. British Lichen
Society, London.
Golubkov VV, Kukwa M. 2006. A contribution to the lichen biota of Belarus. Acta Mycol. 41:
155-164.
Guttova A. 2001 Zaujimavejsie floristické nalezy. Bull. Slov. Bot. Spoloén. 23: 1-208.
Jabtonska A. 2010. The lichen genus Porpidia in Poland III. Herzogia 23: 217-228.
James PW. 2009. Cladonia P. Browne (1756). 309-338, in: CW Smith et al. (eds), The Lichens of
Great Britain and Ireland. British Lichen Society, London.
Jorgensen PM. 1994. Further notes on European taxa of the lichen genus Leptogium, with emphasis
on the small species. Lichenologist 26: 1-29.
Kiszka J. 1967. Porosty Beskidu Slaskiego. Rocznik Naukowo-Dydaktyczny WSP w Krakowie,
Prace z botaniki 28: 5-91.
Kiszka J, KoScielniak R. 1998. The flora of lichens in the Polish Eastern Carpathians. 82-101,
in: S Kondratyuk, BJ Coppins (eds), Lobarion lichens as indicators of the primeval forests
of the Eastern Carpathians, Darwin International Workshop, 25-30 May 1998, Kostrino.
Phytosociocentre, Kiev.
Kondratyuk SYa, Coppins BJ. 2000. Basement for the lichen monitoring in Uzhansky National
Nature Park, Ukrainian Part of the Biosphere Reserve “Eastern Carpathians. Roczniki
Bieszczadzkie 8: 149-192.
Koscielniak R, Kiszka J. 2003. The lichens and allied fungi of the Polish Eastern Carpathians.
233-294, in: U Bielczyk (ed.), The lichens and allied fungi of the Polish Carpathians - an
annotated checklist, Biodiversity of the Polish Carpathians. W. Szafer Institute of Botany, Polish
Academy of Sciences, Krakow.
Kossowska M. 2008. Lichens growing on calcareous rocks in the Polish part of the Sudety
Mountains. Acta Bot. Siles. Monogr. 3: 1-110.
Kukwa M. 2004. Porosty z rodzaju Lepraria w Tatrzanskim Parku Narodowym. Parki nar. Rez.
Przyr, 2323~12,,
Kukwa M. 2006. The lichen genus Lepraria in Poland. Lichenologist 38: 293-305.
http://dx.doi.org/10.1017/S0024282906005962
Kukwa M, Sliwa L. 2005. The genus Lepraria (lichenized Ascomycota) in the Beskid Sadecki Mts
(West Carpathians, S Poland). Polish Bot. J. 50: 163-184.
Kukwa M, Szymezyk R. 2006. Stanowiska porostu Mycobilimbia epixanthoides (Ascomycota
lichenisati) na pétnocy Polski. Fragm. Flor. Geobot. Ser. Polonica 13: 429-432.
Kukwa M, Czarnota P, Perz P. 2010. New or interesting records of lichenicolous fungi from Poland
VIII. Herzogia 23: 111-119.
Lendemer J.C. 2011. A review of the morphologically similar species Fuscidea pusilla and
Ropalospora viridis in eastern North America. Opuscula Philolichenum 9: 11-20.
Lisicka E. 1980. Flechtenfamiie Umbilicariaceae Fée in der Tschechoslowakei. Biol. Prace Slov.
Akad. Vied 26: 1-151.
Lisicka E. 2005. The lichens of the Tatry Mountains. VEDA, Slovak Academy of Sciences, Bratislava.
439 p.
Malicek J, Palice Z, Kocourkova J, Miller A. 2010. Contribution to the lichen flora of the Beskydy
Protected Lanscape Area. Bryonora 46: 56-66.
Meyer B, Printzen C. 2000. Proposal for a standardized nomenclature and characterization of
insoluble lichen pigments. Lichenologist 32: 571-583.
http://dx.doi.org/10.1006/lich.2000.0294
Nowak J. 1998. Porosty Beskidéw Wyspowego i Zywieckiego, Pasma Jalowca i Masywu Babiej
Gory. Monogr. Bot. 83: 55-131.
Nowak J, Tobolewski Z. 1975. Porosty polskie. PWN, Warszawa-Krakow. 1177 p.
110 ... Czarnota & Wegrzyn
Orange A, James PW, White FJ. 2001. Microchemical Methods for the Identification of Lichens.
British Lichen Society, London. 101 p.
Osyczka P. 2011. The genus Cladonia, group Cocciferae, in Poland. Herzogia 24: 209-227.
Osyczka P, Wegrzyn M. 2005. Arktyczno-alpejski gatunek porostu Cladonia amaurocraea w Tatrach
[An arctic-alpine lichen species Cladonia amaurocraea in the Tatra Mts.]. Fragm. Flor. Geobot.
Ser. Polonica 12: 157-163.
Palice Z. 1999. New and noteworthy records of lichens in the Czech Republic. Preslia 71:
289-336.
Palice Z, Printzen C. 2004. Genetic variability in tropical and temperate populations of Trapeliopsis
glaucolepidea: Evidence against long-range dispersal in a lichen with disjunct distribution.
Mycotaxon 90: 43-54.
Palice Z, Guttova A, Halda JP. 2006. Lichens new for Slovakia collected in the National Park
Muranska planina (W Carpathians). 179-192, in: A Lackovicova et al. (eds.), Central European
lichens — diversity and threat. Mycotaxon Ltd., Ithaca.
Pisut I, Lackovi¢ova A, Guttova A, Palice Z. 2007. New lichen records from Bukovské vrchy Mts
(NE Slovakia). Acta Mycol. 42: 267-280.
Printzen C, Palice Z. 1999. The distribution, ecology and conservational status of the lichen genus
Biatora in central Europe. Lichenologist 31: 319-333.
Rehman A. 1879. Systematyczny przeglad porostéw znalezionych dotad w Galicji Zachodniej
opracowany na podstawie wiasnych i cudzych spostrzezen. Spraw. Komisji Fizjogr. PAU 13:
3-66.
Sérusiaux E, Brand AM, Motiejunaite J, Orange A, Coppins BJ. 2010. Lecidea dolliformis belongs
to Micarea, Catillaria alba to Biatora, and Biatora ligni-mollis occurs in Western Europe.
Bryologist 113: 333-344. http://dx.doi.org/10.1639/0007-2745-113.2.333
Stein B. 1872. Flechten der Babia Gora. Verhandl. des bot. Vereins f. Brand. 14: 94-97.
Stein B. 1873. Uber zwei in diesem Jahre von ihm botanische Excursionennach der Babia Gora.
Jahresber. Schles. Ges. Vaterl. Cult. 50: 119-123.
Suza J. 1951. Ligejniky Babia Gory a vrchovi8t v prilehlé Oravské panvi (slovenské Casti). Lichens
de Babia Gora et des tourbiéres du bassin voisin de Orava (Slovaquie). Sbornik Klubu
prirodovédeckého v Brné 29: 147-156.
Svensson M, Westberg M. 2010. Additions to the lichen flora of Fennoscandia. Graphis Scripta 22:
55-37?
Timdal E. 1984. The genus Hypocenomyce (Lecanorales, Lecideaceae), with special emphasis on the
Norwegian and Swedish species. Nordic J. Bot. 4: 83-10.
http://dx.doi.org/10.1111/j.1756-1051.1984.tb01979.x
Tobolewski Z. 1966. Rodzina Caliciaceae (Lichenes) w Polsce. Poznanskie Towarzystwo Przyjacidt
Nauk, Wydzial Matematyczno-Przyrodniczy. Prace Komisji Biologicznej 24 (5): 1-106.
Tonsberg T. 1992. The sorediate and isidiate, corticolous, crustose lichens in Norway. Sommerfeltia
14: 1-331.
Vondrak J, Palice Z, Khodosovtsev A, Postoyalkin S. 2010. Additions to the diversity of rare or
overlooked lichens and lichenicolous fungi in Ukrainian Carpathians. Chornomors’ki Bot. J.
6: 6-34.
Vézda A. 1993. Lichenes Rariores Exsiccati. Fasc. 6. Brno.
Wegrzyn M. 2002. Nowe stanowiska Fellhanera subtilis na potudniu Polski. Fragm. Flor. Geobot.
Ser. Polonica. 9: 388-389.
Wegrzyn M. 2004. Porosty epifityczne, epiksyliczne i epigeiczne pietra kosodrzewiny na Babiej
Gorze. Fragm. Flor. Geobot. Ser. Polonica 11: 355-363.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.111
Volume 122, pp. 111-122 October-December 2012
Resupinate polypores from mixed ombrophilous forests
in southern Brazil
Mauro C. WESTPHALEN* & ROSA MARA BORGES DA SILVEIRA
Universidade Federal do Rio Grande do Sul, Departamento de Botanica
Av. Bento Goncalves, 9500, 91501-970, Porto Alegre, RS, Brazil
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — During a survey of polypore fungi in the municipality of Sao Francisco de Paula,
Rio Grande do Sul State, Brazil, 24 resupinate species were identified. Trechispora mollusca,
Antrodia variiformis, Diplomitoporus venezuelicus, and Flaviporus subundatus, rare species in
Brazil, are fully described, discussed and illustrated. Comments are also given on Fomitiporia
maxonii, recorded for the first time from Rio Grande do Sul State. An identification key and
a checklist of the species are presented.
Key worps — Polyporaceae, fungal diversity, neotropics
Introduction
Polypore fungi are characterized by a tubular hymenophore and being
predominantly xylophilous, but they can also grow on soil or plant litter and
therefore are extremely important in nutrient and energy cycling (Webster &
Weber 2007). Wood-decay fungi can be divided into two large groups —white
rot fungi that decompose cellulose, hemicellulose, and lignin and brown rot
fungi that decompose only cellulose and hemicellulose. Wood decay fungi may
cause damage when they attack wood, reducing its commercial value, and when
they parasitise species of economic interest, causing a slump in productivity
(Wright & Alberté 2006).
In polypores, both macro and microscopic characters are highly variable.
Macroscopically, basidiomes can be resupinate or pileate, but transitions
between these forms can also be observed (Ryvarden 1991). Although macro-
and microscopic characters are very important in the characterization of taxa,
polypores do not forma monophyletic group, and several cases of morphological
convergence exist (Hibbett & Binder 2002).
Since Rick’s pioneer study of macroscopic fungi, including polypores,
in the state of Rio Grande do Sul (Fidalgo 1962, Rick 1960), several other
112 ... Westphalen & Silveira
taxonomic studies have been undertaken in the State on that group (Silveira &
Guerrero 1991, Groposo & Loguercio-Leite 2002, Coelho et al. 2006, Reck &
Silveira 2008). Silveira et al. (2008) surveyed the pileate polypores from the Sao
Francisco de Paula National Forest. Our survey of resupinate polypore species
of Sao Francisco de Paula continues this study, while expanding knowledge of
fungi in the region.
Materials & methods
Most examined specimens were collected from April 2009 to October 2010 in the
mixed ombrophilous forest of the municipality of Sao Francisco de Paula, in northeastern
Rio Grande do Sul State, southern Brazil. Specimens previously collected in the region
were also included in this study. The mixed ombrophilous forest is characterized by
subtropical vegetation with the presence of the coniferous tree Araucaria angustifolia
(Bertol.) Kuntze. The municipality of Sao Francisco de Paula is located about 900m
above sea level and has an area of 3274 km”. The climate in the region is of the Cfb type,
according to Képpen Classification, with rainfall high in all months (average of 2252
mm) and average annual temperature of 14.5 °C (Mota 1951, Backes 1999).
The basidiomes collected were analyzed macroscopically and later dried at room
temperature. For microscopy analysis, freehand sections of the basidiomes were
mounted on microscope slides with 3% KOH solution and 1% phloxine solution.
Amyloid or dextrinoid reactions were observed in Melzer’s reagent. Drawings of the
microstructures were made with the aid ofa drawing tube. All specimens were deposited
at ICN herbarium (Universidade Federal do Rio Grande do Sul, Brazil).
Taxonomy
Key to species of resupinate polypores recorded in Sao Francisco de Paula
Lay TAs) Wal sey Stetiner i OFTEN ed oma Fe tens 2b tema Ae Miwa Ra tl ewn i tau et ook Ra aun esta ny 2.
LB Five all Syste rich Ce Tele et fae pce tt eat ge iota tle deg yee gt W ge tg Pee 7
2a. Generative hyphae with clamps $s... 2.0 fnew ch oc oe ch hw chs ae ely ew eg ae 3
2b-Genetative hyphaesimple septate mes samed aah Ailes Ailes det dhlcrrele fe ol het te 4
3a. Encrusted cystidia present in the hymenium ................ Trechispora regularis
DBDs Cy Stila ASEM Utes: xnsys hearts, Becwaces eawa-apl Hawn ce came Ae atau ee cheese Trechispora mollusca
4a. Basidiomes white to cream, very fragile, basidiospores cylindrical ... Ceriporia viridans
4b. Basidiomes isabelline to pinkish, tough, basidiospores globose to subglobose ....5
5a. Cystidia absent in the trama and hymenium, only with encrusted hyphal ends
PLESelit WAS CIssepiMMeN iss ds gow ss gnc era eens Bane Rigidoporus crocatus
Sb.-Gystidia present in the trama-or hymenium oi. oe. es ee on ee ae oe 6
6a. Pore surface pale orange-pink to vivid pink, becoming smoke gray to dark brown
after drying, cystidia usually present in the trama and hymenium, basidiospores
SUE SO DOS sey ak aha ach carn acl eh ted ach Sat ale fed de ca a Sed bd Rigidoporus vinctus
6b. Pore surface cream to isabelline, becoming only slightly darker after drying,
cystidia restricted to the trama, basidiospores globose ..... Rigidoporus undatus
Resupinate polypores in southern Brazil ... 113
7a. Generative hyphae with simple'septa: + s.a5...6..<55Gu chee seen thee ow 8
7b. -Genetative: hyphae swith Clans? teehee eae eh ob ga ew age cee Hanae Rd gel 12
8a. Basidiomes pinkish, not becoming black in KOH, basidiospores very small
CBSO DAG EI) oon PN es He ca sipt tere AUD oral Weve Set eva: Flaviporus subundatus
8b. Basidiomes in shades of brown, becoming black in KOH, basidiospores larger . . . .9
9a. Basidiospores non-dextrinoid, ellipsoid, rusty brown ...... Fulvifomes umbrinellus
9b. Basidiospores dextrinoid, globose, hyaline to pale yellow ...................2. 10
OARS et aerlaC KM ak ok Shik tothe Se edad dete pia Fomitiporia maxonii
LGD: Seles UCSC Sas f0 , Fne a hae Marsa Say RecA he 8 aM Rl oO ee eG A gt 11
lla. Pores 7-10/mm, basidiospores 3.5-5.0 um in diam., setae 11-27 um
LOTS say Sarg hite cetera tense oh oy eae mers rae meen Phellinus bambusarum
11b. Pores 2-5/mm, basidiospores 4.5-7 um in diam., setae 12-40 um
HOT res FS Bese. aster ee: Seats aah, te ayes ea a nace ge Fomitiporia sanctichampagnatii
12a. Basidiospores ornamented, 10-15 um long ........... Pachykytospora papyracea
12b. Basidiospores smooth, less than 10 um long ........... eee eee ee eee 13
13a. Basidiomes perennial, basidiospores dextrinoid, truncate and
fini Kempe hr tle eri ei Ra Rides Paki hs Perenniporia medulla-panis
13b. Basidiomes annual, basidiospores non-dextrinoid, different shaped and
gAEY CE es NecU Lats EO Ry oe ORs oy UM rc REN ct a ee i ct Uy Coe ey Sc 14
PAde GUSETADTCSELIE cual t cee dn uae da. ncoeae ond o ebans tela cth lanl ood ahd sk amas ett ahdss aes 15
LAs eV Stie Asa SCTE Mes alates Mpeeeastin Bernenres Batwabiy Aetaaely Belwet fe Micaela enna apnatd oth ENN waite 17
15a. Pore surface yellowish becoming red when bruised, cystidia finely encrusted
Peres, COT oe i ee. ee oe ee ee ee 2 Junghuhnia carneola
16a. Pore surface cinnamon to brick-red, basidiospores narrowly ellipsoid to
SUDO YMC EICAL Stes we Ne Mee al iia Smelly seve mPOMie oe nle Bek Junghuhnia meridionalis
16b. Pore surface cream to pale orange-pink, basidiospores broadly ellipsoid to
ras) (6 Mie Bch i cee TO ea OU Ce ce Wa ake ae i ete Junghuhnia nitida
17a. Pore surface lilac grey, vegetative hyphae dextrinoid, basidiomes
reddetiing the substrate. .c.. 2. bones Pete ee Tinctoporellus epimiltinus
17b. Pore surface white to beige, vegetative hyphae nondextrinoid,
basidiomes not reddening the. substrate. scum ays pica chet 5 ten di peben dh pcben hrs fed ght fad 18
18a. Vegetative hyphae weakly amyloid and dissolving in KOH Cinereomyces lindbladii
18b. Vegetative hyphae negative in Melzer’s reagent and not dissolving in KOH ..... 19
19a. Scattered hyphae with an apical cap of crystals, spores 0.5-1 um wide,
IPRA CMDR gs eR ot Bay Be Re ee BR te ep ght Moy oi J Meee Mon eee a at eo he Sidera lenis
19b. No hyphae with encrusted cap, spores wider, ellipsoid to cylindrical .......... 20
20a. Pores 6-9/mm, basidiospores 1-2 um wide ......... Diplomitoporus venezuelicus
20b. Pores 1-5/mm, basidiospores more than 2 um wide ................-22 000s 21
114... Westphalen & Silveira
21a. Causing a white rot, basidiospores ellipsoid, capitate cystidioles present
Erste VANE TOT FA ree Roe co eM thay thes SAV ut oatd 9 MoE Leite ste PoutNon cp tatties based 22
21b. Causing a brown rot, basidiospores cylindrical, capitate cystidioles absent ..... 23
22a. Pores mostly irregular, 1-3/mm, basidiospores 5-6.5 x 3-4 um
Ohi d PE EO one Pepe Lee LORE Tee hee Pen: Schizopora paradoxa
22b. Pores regular, 3-5/mm, basidiospores 3.5-5 x 2.5-3.5 um ... Schizopora flavipora
23a. Pores mostly round to angular, sometimes slightly split and elongated,
basidiospores 8-12 X 3.5-5 UM 1... eee eee eee cee eee ee Antrodia albida
23b. Pore surface mostly irpicoid to daedaleoid, pores strongly split,
basidiospores 6.5-10 x 2-4. uM .... eee eee eee eee Antrodia variiformis
Antrodia albida (Fr.) Donk, Persoonia 4(3): 339, 1966
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sado Francisco de Paula,
FLONA, 18.V.2009, leg. M.C. Westphalen 183/09 (ICN 154265); 25.1X.2009, leg. M.C.
Westphalen 258/09 (ICN 154353); CPCN Prdé-Mata, 29.V.2009, leg. M.C. Westphalen
204/09 (ICN 154266), leg. M.C. Westphalen 213/09 (ICN 154267), leg. M.C. Westphalen
214/09 (ICN 154268).
Antrodia variiformis (Peck) Donk, Persoonia 4(3): 340, 1966 Fics 1-3, PLATE 1
BASIDIOMES annual, resupinate, adnate, effused, separable, <1.5 mm thick,
corky and brittle; margin sharp, cream colored, narrow, <1 mm wide; pore
surface at first beige, drying cork colored, pale cinnamon or light brown, pores
irregular, distinctly split and sinuous, irpicoid to daedaloid, 1-3 per mm; tubes
cream to pale brown, <1 mm deep; subiculum cream to beige, often forming
a darker cinnamon to brownish zone in the regions where in contact with the
substrate, <0.5 mm thick.
HYPHAL SYSTEM dimitic; generative hyphae with clamps, thin-walled,
hyaline, 2-4 um wide; skeletal hyphae dominant, thick-walled to almost solid,
hyaline to yellowish, straight, unbranched to dichotomously branched, 3-6 um
wide, IKI-; cystidia absent, scattered fusoid cystidioles present. Basidia clavate,
Fic. 1-3. Antrodia variiformis .
1. Basidiospores. 2. Generative hyphae. 3. Skeletal hyphae.
Resupinate polypores in southern Brazil... 115
oo
v
Ry
‘
PLATE 1. Basidiome of Antrodia variiformis. Scale bar = 1 cm
4-sterigmate. Basidiospores cylindrical, hyaline, smooth, thin-walled, (6-)6.5-
10 x (2-)2.5-4 um.
SUBSTRATA: Fallen logs of an undetermined angiosperm.
DISTRIBUTION: Previously recorded from North America, Europe and
Africa. This is the first record of the species from South America.
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, Hotel
Veraneio Hampel, 26.V.2008, leg. M.A. Reck s.n. (ICN 154706). CANADA. QUEBEC,
Gaspé county, Kelly's Camp, VHI.1936, leg. C.G. Riley s.n. (S F6828)
REMARKS: Antrodia variiformis is characterized by the irregular irpicoid to
daedaleoid hymenophore with large pores and the beige to cork-colored pore
surface. Antrodia albida is a similar species differentiated by the white to cream
basidiomes when fresh with more regular pores. The specimen of A. variiformis
collected in Rio Grande do Sul State has a fully resupinate basidiome, but the
species can be effused-reflexed or, more rarely, sessile (Gilbertson & Ryvarden
1986). The specimen examined from S herbarium is very similar to ours,
but it has lifted margins forming, in some regions, small brown pilei. The
spore size, mainly the length, of the Brazilian collection also differs from the
descriptions given by other authors. Gilbertson & Ryvarden (1986) described
the basidiospores of A. variiformis as 8-12 x 3-4.5 um, Ryvarden & Johansen
(1980) measured them 8-10(-11) x 2.5-4 um, while according to Niemela
116 ... Westphalen & Silveira
(1985) they are 8-9 x 2.8-3 um. In the S herbarium specimen the basidiospores
were also slightly shorter, 7-8.5 x 2.5-3.5 um. We believe that this variation
in the spore size is normal within the species, especially when comparing
collections from different regions of the world. As all the other characteristics
of the collected specimen are the same as those of A. variiformis, we identified
it as such.
Ceriporia viridans (Berk. & Broome) Donk, Meddn Bot. Mus. Herb. Rijhs Universit.
Utrecht. 9: 171, 1933
SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN
Pré-Mata, leg. M.C. Westphalen 345/11, 07.V.2011 (ICN 170625).
Cinereomyces lindbladii (Berk.) Jiilich, Biblioth. Mycol. 85: 400, 1982
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,
18.V.2009, leg. M.A. Reck 073/09 (ICN 154359); 22.V1.2009, leg. M.C. Westphalen
244/09 (ICN 154275); 25.1X.2009, leg. M.C. Westphalen 254/09 (ICN 154360), leg. M.C.
Westphalen 257/09 (ICN 154361).
Diplomitoporus venezuelicus Ryvarden & Iturr., Mycol. 95(6): 1069, 2003 Fics 4-7
BASIDIOMES annual, resupinate, adnate, forming more or less confluent
patches on the substrate, <1.5 mm thick, soft and somewhat watery when fresh
becoming rigid upon drying; marginal sterile zone white to cream, very narrow,
a &
oe kit
oO oe
(ome |
(MS
Q s
|
eee
Oe
: ————
a —
Fic. 4-7. Diplomitoporus venezuelicus.
4, Basidiospores. 5. Hyphal pegs. 6. Generative hyphae. 7. Skeletal hyphae.
Resupinate polypores in southern Brazil ... 117
<0.15 mm wide; pore surface white to cream drying beige to straw-colored,
pores regular, round to angular, 6—9 per mm, tubes concolorous with the pore
surface, <1.5 mm deep; subiculum white to cream, very thin, <0.35 mm thick.
HYPHAL SYSTEM dimitic; generative hyphae with clamps, hyaline and thin-
walled, 2—3 um in diam.; skeletal hyphae dominating, hyaline and thick-walled,
mostly unbranched, 2—4 um in diam.; hyphal pegs scattered in the hymenium,
difficult to observe. Basidia clavate, 4-sterigmate; basidiospores cylindrical,
hyaline, thin-walled, smooth, (3.5—)4—4.5 x1-1.5(-—2) um.
SUBSTRATA: Fallen logs of an undetermined angiosperm.
DISTRIBUTION: Known from Venezuela, Colombia and Brazil.
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN
Pré-Mata, leg. M.C. Westphalen 347/11, 07.V.2011 (ICN 170624). COLOMBIA. Dpt.
MAGDALENHA, Sierra Nevada de Santa Marta, Reserva Forestal San Lorenzo, leg. L.
Ryvarden 16195, 17-19.V1.1978 (O 918147).
REMARKS: Diplomitoporus venezuelicus is characterized by the white to cream
resupinate basidiomes with small pores and the small cylindrical basidiospores.
The specimen examined has a few hyphal pegs, although these are sometimes
difficult to observe. ‘This is the first report of hyphal pegs for this species.
Flaviporus subundatus (Murrill) Ginns, Canad. J. Bot. 58(14): 1587, 1980 Fics 8-10
BASIDIOMES annual to perennial, resupinate, adnate, <3 mm thick, tough
when fresh, very hard and resinous when dried, usually cracking into pieces;
margin very narrow to absent; pore surface flesh-colored to pinkish, pores
regular, circular to angular, 8-10 per mm; tubes concolorous with the pore
surface, $2.5 mm thick; subiculum very thin to absent, ochraceous to brownish,
<0.5 mm thick.
HYPHAL SYSTEM dimitic, hyphae strongly agglutinated; generative hyphae
with simple septa, hyaline, thin to thick-walled, 2.5-5 um in diam.; skeletal
hyphae dominating, hyaline, thick-walled, unbranched, <5.5 um_ thick.
a ol an
el == NK
Ss
08 LP EF”
Fic. 8-10. Flaviporus subundatus.
8. Basidiospores. 9. Generative hyphae. 10. Skeletal hyphae
5 yum
©
Q
118 ... Westphalen & Silveira
Cystidia present, embedded in the trama and very difficult to separate, usually
seen only as large club-like crystalline structures. Basidia clavate, 4-sterigmate;
basidiospores very small, subglobose to broadly ellipsoid, hyaline, thin-walled,
smooth, 2.5-3 x 2-2.5 um.
SuBSTRATA: Fallen logs of an undetermined angiosperm.
DISTRIBUTION: Pantropical.
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, Hotel
Veraneio Hampel, leg. M.C. Westphalen 312/10, 27.I1I.2010 (ICN 154701). CUBA.
GUANTANAMO, Baracoa, El Yunque Mountain, leg. L.M. Underwood & ES. Earle 1168,
III/1903 (BPI US0243504, isotype of Poria subundata).
REMARKS: Flaviporus subundatus can be easily identified by the resinous-hard
resupinate basidiomes, pinkish color, very small pores and basidiospores,
generative hyphae with simple-septa, and incrusted cystidia embedded in
the trama. Ryvarden (2007) recently transferred this species from Flaviporus
Murrill to Junghuhnia Corda. However, both genera (sensu typorum) are
characterized by the presence of clamp-connections in the generative hyphae.
The basidiome color and absence of clamp-connections in F subundatus are
features that come close to those of Rigidoporus, but the latter usually has a
monomitic hyphal system and larger basidiospores. We consider that neither
Flaviporus nor Junghuhnia are appropriate to accommodate this species and
that further study involving molecular data is necessary to resolve its generic
placement.
Fomitiporia maxonii Murrill, N. Amer. Fl. 9(1): 11, 1907
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula,
FLONA, 24.IV.2009, leg. M.C. Westphalen 161/09 (ICN 154308); CPCN Pré-Mata,
26.1X.2009, leg. M.C. Westphalen 270/09 (ICN 154374), leg. M.C. Westphalen 272/09
(ICN 154375).
REMARKS: Fomitiporia maxonii is very similar to F. punctata (P. Karst.) Murrill
[= Phellinus punctatus (P. Karst.) Pilat], differing only by basidiospore size
(FE. maxonii, 5-6.5 x 4.5-6 um; F. punctata, 6.5-8.5 x 5.5-7 um). Ryvarden (1985)
considered them to be synonymous. However, more recently, phylogenetic
studies by Decock et al. (2007) show that they represent two different taxa and
that EF maxonii is widely distributed in the neotropics, including Brazil. Even
though this is the first confirmed record of the species from Rio Grande do
Sul, it is probable that many collections from the State identified as Phellinus
punctatus actually represent F maxonii.
Fomitiporia sanctichampagnatii G. Coelho, R.M. Silveira & Rajchenb., Fung.
Diversity 36: 3, 2009
SPECIMENS EXAMINED: BRAZIL. RIO GRANDE DO SUL, Sao Francisco de Paula, CPCN
Pré-Mata, 06.V1.2006, leg. G. Coelho 493-1 (ICN 139201), leg. G. Coelho 493-2 (ICN
139202), leg. G. Coelho 493-3 (ICN 139203).
Resupinate polypores in southern Brazil ... 119
Fulvifomes umbrinellus (Bres.) Y.C. Dai, Fung. Diversity 45: 203, 2010
SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,
26-II-2010, leg. M.C. Westphalen 305/10 (ICN 154665); CPCN Pro-Mata, 26.1X.2009,
leg. M.C. Westphalen 266/09 (ICN 154373).
Junghuhnia carneola (Bres.) Rajchenb., Revista Invest. Agropec. 19: 45, 1984
SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL: Sao Francisco de Paula, CPCN
Pro-Mata, 14.XI.2009, leg. M.C. Westphalen 289/09 (ICN 154468).
Junghuhnia meridionalis (Rajchenb.) Rajchenb., Austral. Syst. Bot. 16(4): 477, 2003
SPECIMEN EXAMINED: BRAZIL. RIO GRANDE DO SUL, Sado Francisco de Paula,
FLONA, 22.V1.2009, leg. M.C. Westphalen 238/09 (ICN 154290); 26-III-2010, leg. M.C.
Westphalen 295/10, (ICN 154659); leg. M.C. Westphalen 303/10 (ICN 154660).
Junghuhnia nitida (Pers.) Ryvarden, Persoonia 7(1): 18, 1972
SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN
Pro-Mata, 30.V.2009, leg. M.C. Westphalen 222/09 (ICN 154296); FLONA, 22.VI.2009,
leg. M.C. Westphalen 236/09 (ICN 154294), leg. M.C. Westphalen 241/09 (ICN
154295).
Pachykytospora papyracea (Cooke) Ryvarden, Norweg. J. Bot. 19: 233, 1972
SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sado Francisco de Paula, CPCN
Pré-Mata, 29.V.2009, leg. M.C. Westphalen 219/09 (ICN 154302); 26.IX.2009, leg. M.C.
Westphalen 265/09 (ICN 154369); 26-III-2010, leg. M.C. Westphalen 302/10 (ICN
154663).
Perenniporia medulla-panis (Jacq.) Donk, Persoonia 5(1): 76, 1967
SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN
Pré-Mata, 30.V.2009, leg. M.C. Westphalen 224/09 (ICN 154303).
Phellinus bambusarum (Rick) M.J. Larsen, Synopsis Fung. 3: 40, 1990
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,
24.1V.2009, leg. M.C. Westphalen 179/09 (ICN 154305); CPCN Pré-Mata, 29.V.2009,
leg. M.C. Westphalen 217/09 (ICN 154306); 26.[X.2009, leg. M.C. Westphalen 264/09
(ICN 154372).
Rigidoporus crocatus (Pat.) Ryvarden, Occas. Pap. Farlow Herb. Cryptog. Bot. 18:
13, 1983
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN
Pré-Mata, 29.V.2009, leg. M.C. Westphalen 218/09 (ICN 154320); 07.X.2010, leg. M.C.
Westphalen 338/10 (ICN 154703); FLONA, 22.V1.2009, leg. M.C. Westphalen 231/09
(ICN 154316), leg. M.C. Westphalen 248/09 (ICN 154317), leg. M.C. Westphalen 253/09
(ICN 154319).
Rigidoporus undatus (Pers.) Donk, Persoonia 5(1): 115, 1967
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,
24.1V.2009, leg. M.C. Westphalen 148/09 (ICN 154297); CPCN Pr6-Mata, 26.VI.2010,
leg. M.C. Westphalen 335/10 (ICN 154695).
120 ... Westphalen & Silveira
Rigidoporus vinctus (Berk.) Ryvarden, Norweg. J. Bot. 19: 143, 1972
SPECIMEN EXAMINED: BRAZIL. RIO GRANDE DO SUL, Sao Francisco de Paula, FLONA,
24.1V.2009, leg. M.C. Westphalen 153/09 (ICN 154315).
Schizopora flavipora (Berk. & M.A. Curtis) Ryvarden, Mycotaxon 23: 186, 1985
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,
24.1V.2009, leg. M.C. Westphalen 151/09 (ICN 154280); 18.V.2009, leg. M.C. Westphalen
187/09 (ICN 154281); 25.1X.2009, leg. M.C. Westphalen 259/09 (ICN 154380); CPCN
Pré-Mata, 26.1X.2009, leg. M.C. Westphalen 269/09 (ICN 154381); 26.VI.2010, leg.
M.C. Westphalen 337/10 (ICN 154691).
Schizopora paradoxa (Schrad.) Donk, Persoonia 5(1): 104, 1967
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,
18.V.2009, leg. M.C. Westphalen 184/09 (ICN 154282); CPCN Pr6-Mata, 29.V.2009, leg.
M.C. Westphalen 208/09 (ICN 154283); 30.V.2009 leg. M.C. Westphalen 228/09 (ICN
154284); 26.1X.2009, leg. M.C. Westphalen 274/09 (ICN 154382).
Sidera lenis (P. Karst.) Miettinen, Mycol. Progr. 10(2): 136, 2011
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sado Francisco de Paula,
FLONA, 18.V.2009, leg. M.C. Westphalen 182/09 (ICN 154321), leg. M.C. Westphalen
188/09 (ICN 154322); 22.V1.2009, leg. M.C. Westphalen 234/09 (ICN 154323), leg. M.C.
Westphalen 245/09 (ICN 154324); CPCN Pr6é-Mata, 29.V.2009, leg. M.C. Westphalen
220/09 (ICN 154325); 26.IX.2009, leg. M.C. Westphalen 268/09 (ICN 154383).
Tinctoporellus epimiltinus (Berk. & Broome) Ryvarden, Trans. Brit. Mycol. Soc. 73:
193.1979
SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, Hotel
Veraneio Hampel, 27.III.2010, leg. M.C. Westphalen 317/10 (ICN 154671).
Trechispora mollusca (Pers.) Liberta, Canad. J. Bot. 51(10): 1878, 1974 Fras 11-12
BASIDIOMES annual, resupinate, adnate, <1 mm thick, very soft and fragile,
separable from the substrata; marginal sterile zone white, cottony, arachnoid or
fimbriate, sometimes slightly rhizomorphic, narrow to wide; pore surface white
when fresh, drying cream, pores irregular, circular to angular, sinuous, split
in some parts, 2-6 per mm; tubes concolorous with the pore surface, fragile,
<1 mm thick; subiculum white to light cream, very thin, soft and fibrous,
continuous with the trama.
HyYPHAL SYSTEM monomitic; generative hyphae with clamps, thin-walled,
branched, often ampullate at the septa, sometimes incrusted with small
granules, 2-6 um in diam., IKI-; cystidia and other sterile elements absent.
Basidia clavate to cylindrical, 4-sterigmate; basidiospores ovoid to ellipsoid,
hyaline, thin-walled, echinulate, 3.5-4.5 x 2.5-3.5 um.
SuBsTRATA: Fallen logs of an unknown angiosperm.
DISTRIBUTION: Circumglobal.
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN
Pré-Mata, 26.1X.2009, leg. M.C. Westphalen 276/09 (ICN 154386), leg. M.C. Westphalen
277/09 (ICN 154387).
Resupinate polypores in southern Brazil ... 121
12
-
i hy ES
arenes
ora esa foe
Fic. 11-12. Trechispora mollusca.
11. Basidiospores. 12. Generative hyphae.
REMARKS: Trechispora mollusca is characterized by very fragile basidiomes with
cottony margins and sinuous pores. Microscopically it has a monomitic hyphal
system and ornamented spores. It is very similar to T’ regularis, differing only
in the absence of cystidia in the hymenium. Trechispora mollusca was recently
recorded as new to Brazil by Drechsler-Santos et al. (2008), but their Brazilian
specimen deposited in FLOR herbarium has effused-reflexed basidiomes
and a flexible consistency. After microscopic examination, we identified it as
Junghuhnia undigera (Berk. & M.A. Curtis) Ryvarden. Therefore, we consider
the ICN material cited above as the first record of T: mollusca from Rio Grande
do Sul State and Brazil.
Trechispora regularis (Murrill) Liberta, Canad. J. Bot. 51(10): 1878, 1974
SPECIMEN EXAMINED: BRAZIL. RIO GRANDE DO SUL, Sao Francisco de Paula, FLONA,
22.V1.2009, leg. M.C. Westphalen 246/09 (ICN 154329).
Acknowledgements
CAPES (Brazil) is acknowledged for financial support. We also wish to thank
MSc. Marisa de Campos Santana for assistance with the line drawings and Dr. Maria
Alice Neves (Universidade Federal de Santa Catarina, Brazil) and Dr. Peter Buchanan
(Landcare Research, New Zealand) for the critical review.
Literature cited
Backes A. 1999. Condicionamento climatico e distribuicéo geografica de Araucaria angustifolia
(Bertol.) Kuntze no Brasil - II. Pesquisas - Botanica 49: 31-51.
Coelho G, Silveira RMB, Rajchenberg M. 2006. A new Gloeoporus species growing on bamboo
from southern Brazil. Mycologia 98: 821-827. http://dx.doi.org/10.3852/mycologia.98.5.821
122 ... Westphalen & Silveira
Decock C, Figueroa SH, Robledo G, Castillo G. 2007. Fomitiporia punctata (Basidiomycota,
Hymenochaetales) and its presumed taxonomic synonyms in America: taxonomy and
phylogeny of some species from tropical/subtropical areas. Mycologia 99(5): 733-752.
http://dx.doi.org/10.3852/mycologia.99.5.733
Drechsler-Santos ER, Groposo C, Loguercio-Leite C. 2008. New records of lignocellulolytic fungi
(Basidiomycetes) from the Atlantic Rain Forest in State of Santa Catarina, Brazil. Hoehnea
35(1): 57-61.
Fidalgo O. 1962. Rick, o pai da micologia brasileira. Rickia 1: 1-11.
Gilbertson RL, Ryvarden L. 1986. North American polypores, vol. 1, Abortiporus - Lindtneria.
Fungiflora, Oslo.
Groposo C, Loguercio-Leite C. 2002. Fungos polipordides (Basidiomycetes) da Reserva Biolédgica
Tancredo Neves, Cachoeirinha, Rio Grande do Sul, Brasil. Iheringia, Série Botanica 57: 39-59
Hibbett SD, Binder M. 2002. Evolution of complex fruiting-body morphologies in
homobasidiomycetes. Proceedings of Royal Society of London 269: 1963-1969.
Mota FS. 1951. Estudos do clima do Estado do Rio Grande do Sul, segundo o sistema de W. Koppen.
Revista Brasileira de Geografia 13(2): 275-284.
Niemela T. 1985. Mycoflora of Poste-de-la-Baleine, Northern Quebec. Polypores and the
Hymenochaetales. Naturaliste Canadien 112: 445-472.
Reck MA, Silveira RMB. 2008. Ordem Polyporales (Basidiomycota) no Parque Estadual de Itapua,
Viamao, Rio Grande do Sul. Revista Brasileira de Biociéncias 6(3): 301-314.
Rick J. 1960. Basidiomycetes eubasidii in Rio Grande do Sul, Brasilia. Iheringia 7: 193-296.
Ryvarden L. 1985. Type studies in the Polyporaceae 17. Species described by W.A. Murrill.
Mycotaxon 23: 169-198.
Ryvarden L. 1991. Genera of polypores: Nomenclature and taxonomy. Synopsis Fungorum 5:
1-363.
Ryvarden L. 2007. Studies in Neotropical Polypores 23. New and interesting wood-inhabiting fungi
from Belize. Synopsis Fungorum 23: 32-50
Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Fungiflora, Oslo.
Silveira RMB, Guerrero RT. 1991. Aphyllophorales polipordides (Basidiomycetes) do Parque
Nacional de Aparados da Serra, RS. Boletim do Instituto de Biociéncias 48: 1-147.
Silveira RMB, Reck, MA, Graf LV, Nogueira De Sa FE. 2008. Polypores from a Brazilian pine forest in
Southern Brazil: pileate species. Hoehnea 35: 619-630.
Webster J, Weber WS. 2007. Introduction to Fungi. 5 ed. Cambridge University Press, New York.
Wright J, Alberté E. 2006. Hongos de la regién Pampeana, II: Hongos sin laminillas. L.O.L.A.,
Buenos Aires.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.123
Volume 122, pp. 123-128 October-December 2012
Coltricia australica sp. nov.
(Hymenochaetales, Basidiomycota) from Australia
L1I-WEI ZHOU! & LEHO TEDERSOO”
'State Key Laboratory of Forest and Soil Ecology, Institute of Applied Ecology,
Chinese Academy of Sciences, Shenyang 110164, P. R. China
?Institue of Ecology and Earth Sciences and Natural History Museum, University of Tartu,
14A Ravila, 50411 Tartu, Estonia
“ CORRESPONDENCE TO:
[email protected]
ABSTRACT — Coltricia australica sp. nov. is described and illustrated from Tasmania, Australia.
It is characterized by its annual and centrally stipitate basidiocarps with concentrically zonate
and glabrous pilei when dry, angular pores of 3-4 per mm, and ellipsoid, thin- to thick-
walled, smooth, pale yellowish, and cyanophilous basidiospores. This species is terrestrial in
angiosperm forests.
Key worps — Hymenochaetaceae, polypore, taxonomy
Introduction
Coltricia Gray, typified by C. connata Gray [= C. perennis (L.) Murrill], is a
cosmopolitan genus of Hymenochaetales and has been well studied in Africa
(Ryvarden & Johansen 1980), Asia (NUfez & Ryvarden 2000, Dai & Cui 2005,
Dai et al. 2010, Dai 2010, 2012, Dai & Li 2012, Baltazar & Silveira 2012),
Europe (Ryvarden & Gilbertson 1993), Neotropics (Ryvarden 2004, Baltazar et
al. 2010), and North America (Gilbertson & Ryvarden 1986). Coltricia differs
from other genera in Hymenochaetales by the combination of annual stipitate
and fragile (when dry) basidiocarps, a monomitic hyphal system, and colored
slightly to distinctly thick-walled smooth basidiospores (Dai 2010).
Coltriciella Murrill, the most morphologically similar genus to Coltricia,
differs by its ornamented basidiospores (Dai 2010). Recent molecular data
confirmed that the two genera are closely related in a strongly supported clade,
but the monophyly of both genera remains unresolved (Wagner & Fischer
2002, Larsson et al. 2006).
Most species of Coltricia and Coltriciella are terrestrial or associate with
strongly decayed wood. Despite the woody fruitbody texture and phylogenetic
124 ... Zhou & Tedersoo
placement within the Hymenochaetales comprising mostly white-rot agents of
wood, several species of the two genera have been reported to be ectomycorrhizal
(EcM) symbionts of different trees based on both morphological and molecular
evidence (Thoen & Ba 1989, Tedersoo et al. 2007, 2010).
The stipitate and terrestrial species of Phylloporia Murrill, in particular
P. minutispora Ipulet & Ryvarden, P. spathulata (Hook.) Ryvarden, and P. verae-
crucis (Berk. ex Sacc.) Ryvarden, are frequently misidentified as Coltricia and
Coltriciella in the field, but Phylloporia spp. have smaller basidiospores (<4.5
um long and <3.5 um wide, Zhou & Dai 2012). However, a reliable delimitation
between Phylloporia and Coltricia is still unknown; for example, Coltricia
stuckertiana (Speg.) Rajchenb. & J.E. Wright with typical Coltricia characters
clusters within the Phylloporia clade (Valenzuela et al. 2011).
During a field trip in Australia, a specimen of Coltricia was collected and
originally labeled as “C. cf. cinnamomea”. Molecular evidence (Tedersoo et al.
2007) and careful microscopic examination revealed it to differ from described
species and to represent a new Coltricia species. Description and drawings of
the microscopic structures of this new species are provided.
Materials & methods
The studied specimen was deposited at the herbaria of University of Tartu (TU)
and Beijing Forestry University (BJFC). The microscopic procedure follows Dai (2010).
A Nikon Eclipse 80i microscope at magnification up to x1000 was used to study the
sections prepared in IKI (Melzer’s reagent), KOH (5% potassium hydroxide) and CB
(Cotton Blue) solutions. When presenting the variation in the size of the spores, 5% of
measurements were excluded from each end of the range and are given in parentheses.
The following abbreviations are used: IKI- = negative in Melzer’s reagent, CB+ =
cyanophilous, L = mean spore length (arithmetic average of all spores), W = mean spore
width (arithmetic average of all spores), Q = variation in the L/W ratios between the
specimens and n = number of spores measured from the given number of specimens.
Line drawings were made with the aid of a light tube. Special color terms follow Petersen
(1996).
Taxonomy
Coltricia australica L.W. Zhou, Tedersoo & Y.C. Dai, sp. nov. FIGURE 1
MycoBank MB 800364
Differs from Coltricia cinnamomea in its slightly smaller basidiospores and narrower
contextual hyphae.
Type: Australia. Tasmania, Southwest Conservation Area, Warra Long-Term Ecological
Research site, ground in mixed forest of Eucalyptus and Nothofagus, 8.V1II.2006
(holotype, TU 103694; isotype, BJFC; European Nucleotide Archive accession number,
AM412243 for nLSU).
EryMo_oey: australica (Lat.): refers to the country of Australia.
Coltricia australica sp. nov. (Australia) ... 125
==) —————
SS
t . ) }
C=
2 d
10 um —
10 ym
FiGurRE 1. Coltricia australica (holotype).
a: Basidiospores. b: Basidia and basidioles. c: Hyphae from trama. d: Hyphae from context.
BASIDIOCARPS annual, centrally stipitate, gregarious. PILEUS more or less
circular, infundibuliform, up to 3 cm in diam., 3 mm thick at centre. PILEAL
SURFACE cinnamon to greyish brown, concentrically zonate, when dry with
radial wrinkled ridges, glabrous; margin thin, acute, curving down when dry.
PoRE SURFACE reddish brown to greyish brown; pores angular, 3-4 per mm;
dissepiments thin, entire. CONTEXT dark brown, coriaceous, up to 1 mm thick.
TuBEs yellowish brown, paler than the context, fragile when dry, up to 2 mm
long. St1PE yellowish brown, matted, up to 3 cm long and 2 mm in diam.
HyPHAL SYSTEM monomitic; GENERATIVE HYPHAE simple septate; tissue
becoming reddish brown in KOH but otherwise unchanged. CONTEXTUAL
126 ... Zhou & Tedersoo
HYPHAE pale yellowish to golden brown, thick-walled with a wide lumen,
regularly branched and septate, straight, regularly arranged, 3.5-6.5 um in
diam.; hyphae in the stipe similar to those in context. TRAMAL HYPHAE pale
yellowish to golden brown, thick-walled with a wide lumen, occasionally
branched, regularly septate, straight, subparallel along tubes, 2.9-5.5 um
in diam. Basip1a clavate, with four sterigmata and a simple septum at the
base, 14-21 x 6-7.8 um; basidioles in shape similar to basidia, but slightly
smaller. Bastp1ospores broadly ellipsoid to ellipsoid, pale yellowish, thin- to
thick-walled, smooth, IKI-, CB+, (5.5-)6-7.3(-7.4) x (4-)4.1-5.2(-5.3) um,
L = 6.54 um, W = 4.77 um, Q = 1.37 (n = 30/1).
REMARKS: The holotype specimen of C. australica 'TU103694 was subjected
to sequence analysis of both nuclear large subunit ribosomal DNA (nLSU)
and internal transcribed spacer (ITS) regions as described in Tedersoo et al.
(2007). The ITS fragment was probably too long to yield a PCR product, but a
1009-nucleotide nLSU sequence was easily obtained. nLSU-based phylograms
suggested that this specimen is closely related to a Coltricia specimen [MEL
(Melbourne Royal Botanical Gardens Herbarium) 2059672, AM412244] also
from Australia (Tedersoo et al. 2007) but unavailable for examination. Other
Coltricia and Coltriciella species were phylogenetically well segregated from the
two Australian specimens.
Coltricia australica macroscopically resembles C. cinnamomea (Jacq.)
Murrill, C. perennis, C. pyrophila (Wakef.) Ryvarden, C. subperennis Y.C. Dai
[nom. illegit.], and C. weii Y.C. Dai by sharing a central stipe, similar pores
(3-4 per mm), and ellipsoid basidiospores (Dai 2010).
Coltricia cinnamomea is distinguished by slightly larger basidiospores
(TABLE 1) and wider contextual hyphae (6-10 um in diam., Dai 2010).
Coltricia perennis has longer basidiospores (TABLE 1) and wider contextual
hyphae (6-9 um in diam., Dai 2010) than C. australica. In the field, it is easy to
differentiate the two species: C. perennis grows on gymnosperm forest floors
(Gilbertson & Ryvarden 1986, Ryvarden & Gilbertson 1993, Baltazar et al.
2010, Dai 2010), while C. australica inhabits angiosperm forests.
Coltricia pyrophila differs from C. australica in its smaller basidiospores
(TABLE 1) and loosely interwoven tramal hyphae (Dai 2010).
Coltricia subperennis is distinguished from C. australica by its larger
basidiospores (TABLE 1) and narrower tramal hyphae (3-4 um in diam., Dai
2010).
When dry, Coltricia weii has dark reddish to umber pileal surface and umber
pore surface (Dai 2010), which are paler than those in C. australica. In addition,
the basidiospores are weakly cyanophilous in C. weii (Dai 2010) but strongly
cyanophilous in C. australica.
Coltricia australica sp. nov. (Australia) ... 127
TABLE 1. Comparison of basidiospore sizes of six similar Coltricia species
based on Dai (2010) and specimen examined in the present study.
SPECIES BASIDIOSPORES [L x W]
C. australica 6.54 x 4.77 um, Q = 1.37
C. cinnamomea 7.18 x 5.25 um, Q = 1.34-1.39
C. perennis 7.41 x 4.70 um, Q = 1.49-1.67
C. pyrophila 5.20 x 3.82 um, Q = 1.36
C. subperennis 8.25 x 5.70 um, Q = 1.42-1.47
C. weii 6.36 x 4.98 um, Q = 1.22-1.35
Acknowledgements
We express our gratitude to MSc. Juliano M. Baltazar (Universidade Federal do Rio
Grande do Sul, Brazil) and Dr. Shuang-Hui He (Beijing Forestry University, China) who
reviewed the manuscript. MSc. Chang-Lin Zhao (Beijing Forestry University, China) is
thanked for help in drawings. The research was financed by the National Natural Science
Foundation of China (Project Nos. 30910103907 and 31200015). L.T. acknowledges
financial support from the Estonian Science Foundation (grant 9286).
Literature cited
Baltazar JM, Ryvarden L, Gibertoni TB. 2010. The genus Coltricia in Brazil: new records and two
new species. Mycologia 102: 1253-1262. http://dx.doi.org/10.3852/09-227
Baltazar JM, Silveira RMB. 2012. A new name for a Coltricia (Basidiomycota) from India. Mycotaxon
119: 385-389. http://dx.doi.org/10.5248/119.385
Dai YC. 2010. Hymenochaetaceae (Basidiomycota) in China. Fungal Divers. 45: 131-343.
http://dx.doi.org/10.1007/s13225-010-0066-9
Dai YC. 2012. Polypore diversity in China with an annotated checklist of Chinese polypores.
Mycoscience 53: 49-80. http://dx.doi.org/10.1007/s10267-011-0134-3
Dai YC, Cui BK. 2005. Two new species of Hymenochaetaceae from eastern China. Mycotaxon 94:
341-347,
Dai YC, Li HJ. 2012. Type studies on Coltricia and Coltriciella described by E. J. H. Corner from
Southeast Asia. Mycoscience 53: 337-346. http://dx.doi.org/10.1007/s10267-011-0174-8
Dai YC, Yuan HS, Cui BK. 2010. Coltricia (Basidiomycota, Hymenochaetales) in China. Sydowia
625 Lia21¢
Gilbertson RL, Ryvarden L. 1986. North American polypores 1. Fungifora, Oslo. 433 p.
Larsson K-H, Parmasto E, Fischer M, Langer E, Nakasone KK, Redhead SA. 2006. Hymenochaetales:
a molecular phylogeny for the hymenochaetoid clade. Mycologia 98: 926-936.
http://dx.doi.org/10.3852/mycologia.98.6.926
Nujiez M, Ryvarden L. 2000. East Asian polypores 1. Ganodermataceae and Hymenochaetaceae.
Syn. Fungorum 13: 1-168.
Petersen JH. 1996. Farvekort. The Danish Mycological Society's colour-chart. Foreningen til
Svampekundskabens Fremme, Greve. 6 p.
Ryvarden L. 2004. Neotropical polypores 1. Syn. Fungorum 19: 1-229.
Ryvarden L, Gilbertson RL. 1993. European polypores 1. Syn. Fungorum 6: 1-387.
128 ... Zhou & Tedersoo
Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Fungiflora, Oslo. 636 p.
Tedersoo L, Suvi T, Beaver K, Saar I. 2007. Ectomycorrhizas of Coltricia and Coltriciella
(Hymenochaetales, Basidiomycota) on Caesalpiniaceae, Dipterocarpaceae and Myrtaceae in
Seychelles. Mycol. Prog. 6: 101-107. http://dx.doi.org/10.1007/s11557-007-0530-4
Tedersoo L, May TW, Smith ME. 2010. Ectomycorrhizal lifestyle in fungi: global diversity,
distribution, and evolution of phylogenetic lineages. Mycorrhiza 20: 217-263.
http://dx.doi.org.10.1007/s00572-009-0274-x
Thoen D, Ba AM. 1989. Ectomycorrhizas and putative ectomycorrhizal fungi of Afzelia africana
Sm. and Uapaca guineensis Mill. Arg. in southern Senegal. New Phytol. 113: 549-559.
Valenzuela R, Raymundo T, Cifuentes J, Castillo G, Amalfi M, Decock C. 2011. Two undescribed
species of Phylloporia from Mexico based on morphological and phylogenetic evidence. Mycol.
Prog. 10: 341-349. http://dx.doi-org.10.1007/s11557-010-0707-0
Wagner T, Fischer M. 2002. Proceedings towards a natural classification of the worldwide taxa
Phellinus s.l. and Inonotus s.l., and phylogenetic relationships of allied genera. Mycologia 94:
998-1016. http://dx.doi.org/10.2307/3761866
Zhou LW, Dai YC. 2012. Phylogeny and taxonomy of Phylloporia (Hymenochaetales): new species
and a worldwide key to the genus. Mycologia 104: 211-222. http://dx.doi.org/10.3852/11-093
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.129
Volume 122, pp. 129-134 October-December 2012
Four new rust taxa on Asteraceae from Central Alborz,
northern Iran
FAEZEH ALIABADI & MEHRDAD ABBASI
Iranian Research Institute of Plant Protection, Department of Botany
Yaman street, Tehran, 19395-1454, Iran
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — During the study of the rust mycobiota of Central Alborz, four new taxa (two
species and two varieties) were found: Puccinia artemisiae-chamaemelifoliae on Artemisia
chamaemelifolia, P. crepidis-asadbarensis on Crepis asadbarensis, P. jaceae var. elbursensis on
Centaurea behen, and P. punctiformis var. karajensis on Cirsium arvense.
Key Worps — Fungi, Pucciniales, taxonomy, mycology
Introduction
The Central Alborz, located in the middle Alborz chain, is situated at
35°00'-36°30'N 50°20'-53°10'E and contains several peaks above 3000 m
(Gitasshenasi 2004). Due to its varied topography and climate, this area has a
remarkable diversity of vegetation (Klein 1994). The rust mycobiota of Central
Alborz has not yet been intensively studied. The Asteraceae harbor a wide range
of rust fungi, especially species of the genus Puccinia. In Iran, so far 66 Puccinia
spp. have been reported on hosts of 44 asteraceous genera. During the course
of studies on the rust mycobiota of Central Alborz, several Puccinia spp. on
asteraceous plants have been identified. Four of them proved to be new and are
described in this paper.
Materials & methods
Several rust-infected plant specimens were collected from different parts of the
Central Alborz region in northern Iran. All specimens were studied macroscopically
and microscopically. Color, shape and structure of sori of all infected specimens were
carefully examined by an Olympus stereomicroscope. Glycerine-Lactic acid was used
in preparing microscopic slides. All preparations were studied by an Olympus BH2
Nomarski Differential Interference Contrast Microscope (DIC) at magnifications of x
400 and x 1000. 50 spores per specimen were randomly selected and measured. All
130 ... Aliabadi & Abbasi
specimens are deposited in the Fungal Reference Collection of the Ministry of Jihad-e
Agriculture (IRAN) located at Iranian Research Institute of Plant Protection, Tehran.
Taxonomy
PLaTE 1. Puccinia artemisiae-chamaemelifoliae on Artemisia chamaemelifolia: A. urediniospores;
B. teliospores. Scale bars = 20 um.
Puccinia artemisiae-chamaemelifoliae Aliabadi & M. Abbasi, sp.nov. = PLATE 1
MyYcoBANK MB 564231
Differs from Puccinia absinthii s. lat. by its smaller teliospores with a smaller length/
width ratio.
Type: On Artemisia chamaemelifolia Vill.: Iran, Tehran Prov., Central Alborz, Haraz
road, Hareh village, 3 km after village, alt. 2000-2200 m, II+III, 5 August 1993, leg.
J.Fatehi, M.Abbasi & Z.Ghanbari (holotype, IRAN 14660 F).
EryMo ocy: referring to the host species.
SPERMOGONIA and AECIA not observed. UREDINIA epiphyllous and caulicolous,
yellowish brown, round to oval-oblong, semi-compact; urediniospores
27.5-32.5(-37.5) x (20-)22.5-25(-27.5) um, globoid to ovoid, wall yellowish
brown, 1.5-2.5 um thick, echinulate, with 3(-4) equatorial germ pores covered
with hyaline papillae. TEL1a mostly epiphyllous and caulicolous, blackish
brown, round to oblong, semi-compact; teliospores (37.5-)40-47.5(-50) x
(22.5-)25-30 um, ellipsoid, broadly obovoid, clavate or oblong, wall 2.5-5
um thick at the sides and sometimes up to 7.5 um apically, chestnut-brown,
finely and densely verrucose, verrucae more visible on the upper cell of the
spore and becoming smaller towards the hilum, germ pore of the upper cell
approximately apical and of the lower cell below the septum, pedicel hyaline,
persistent, up to 90 um long.
CoMMENTS — Based on Braun’s revision (Braun 1981), the rust on A. chamae-
melifolia is close to P. absinthii s. lat. but differs from it in having smaller
Puccinia spp. nov. (Iran) ... 131
teliospores and a smaller teliospore length/width ratio. Puccinia artemisiae-
chamaemelifoliae teliospores have a mean length of 43.5 um and a mean width of
27.5 um, giving a mean length/width ratio of 1.6. However the mean teliospore
length for P absinthii is greater than 45 um and its teliospore L/W ratio is
1.7-2.1 (Braun 1981). The only Puccinia species reported on A. chamaemelifolia
is P chamaemelifoliae published by Viennot-Bourgin (1958); according to the
original description, only the uredinial state was present, with urediniospores
21-29 x 19-23 um, i.e., smaller than those of P artemisiae-chamaemelifoliae.
: ee
oe _
\ael
PLATE 2. Puccinia crepidis-asadbarensis on Crepis asadbarensis: A. aeciospores; B. urediniospores;
C. teliospores. Puccinia jaceae var. elbursensis on Centaurea behen: D. urediniospores. Scale bars:
A-B, D=10 um, C=20 um.
Puccinia crepidis-asadbarensis Aliabadi & M. Abbasi, sp. nov. PLATE 2A-C
MycoBank MB 564233
Differs from Puccinia crepidis-pygmaeae by its larger urediniospores and teliospores.
Type: On Crepis asadbarensis Bornm. ex Rech.f.: Iran, Tehran Prov., Central Alborz
between Shemshak to Dizin, alt. 2800 m, I+II+III, 11 July 1994, leg. M.Abbasi (holotype,
IRAN 14662 F).
EryMo_oey: referring to the host species.
SPERMOGONIA unknown. AEcIA localized, in clusters; aeciospores 17.5-20
(-22.5) x 12.5-17.5 um, mostly polygonal, wall hyaline, 1-1.5 um thick, finely
verrucose. UREDINIA amphigenous, round, pulverulent, brown, rupturing the
epidermis; urediniospores (20-)22.5-30(-32.5) x (17.5-)20-25(-27.5) um,
132 ... Aliabadi & Abbasi
globoid, ellipsoid or obovoid, wall echinulate, 1.5-2.5 um thick, somewhat
thicker at germ pores, germ pores 2(-3), equatorial. TELIA amphigenous,
round, pulverulent, black, rupturing the epidermis; teliospores (30—)32.5-40
(-42.5) x 22.5-27.5 um, broadly ellipsoid or oblong, rounded at both ends, wall
finely verrucose, 2.5 um thick, germ pore of the upper cell apical or subapical,
rarely close to the septum, and that of the lower cell close to the septum or
equatorial.
ADDITIONAL SPECIMENS EXAMINED: On Crepis asadbarensis: IRAN, TEHRAN PROv.,
Central Alborz, Firoozkuh, Gaduk towards Doab, 20 km of Doab, Zagh-Bolagh
Mountains, alt. 2300-2600 m, I+III, 30 June 1991, leg. FTermeh & M.Mousavi (IRAN
14661 F); Shahrestanak, near Gilkola spring, alt. 2500 m, I+II+III, 12 August 1993, leg.
M.Abbasi, J.Fatehi & O.Foitzik (IRAN 11174 F).
COMMENTS — On the basis of the identification key published by Braun
(1981), P. crepidis-asadbarensis is close to P. crepidis-pygmaeae but differs in
having larger urediniospores (mostly >25 um in diam.) and teliospores (32-40
um long). Puccinia crepidis-pygmaeae urediniospores are mostly 20-25 um
long and teliospores 24-31 x 19-24 um (Braun 1981). The host plant, Crepis
asadbarensis, endemic to the Alborz area, belongs to section Berinia (Rechinger
et al. 1977); no rust has previously been reported on plant species from this
section in Iran.
Puccinia jaceae var. elbursensis Aliabadi & M. Abbasi, var. nov. PLATE 2D
MycoBank MB 564234
Differs from Puccinia jaceae var jaceae by its urediniospores with larger smooth patches
around the germ pores.
Type: On Centaurea behen L.: Iran, Tehran Prov., around Karaj, Gholgholak Spring,
II+III, 22 May 1998, leg. M.Abbasi (holotype, IRAN 14667 F).
EryMoLoey: referring to the mountain range near the type locality.
SPERMOGONIA and AECIA not seen. UREDINIA amphigenous, round, pulverulent,
cinnamon-brown, surrounded by the ruptured epidermis; urediniospores
25-32(-37.5) x 20-27.5 um, mostly ellipsoid or globoid, wall echinulate,
1.5-2.5 um thick, yellowish brown, germ pores 2(-3), supraequatorial, with
smooth patches around the germ pores, up to 18 um diam. TELIA amphigenous,
round, scattered, sometimes with a central sorus surrounded by an encircling
group of sori (arranged in concentric circles), pulverulent, blackish brown;
teliospores (35-)37.5-45(-52.5) x 22.5-27.5 um, broadly ellipsoid, wall 2-3
um thick, slightly thicker at pores, verrucose, sometimes verrucae arranged in
more or less evident longitudinal rows, germ pore of the upper cell subapical
and that of the lower cell approximately equatorial, germ pores covered by
minute, verrucose papillae.
ADDITIONAL SPECIMENS EXAMINED — On Centaurea behen: IRAN, TEHRAN PRov., 25
km of NE of Tehran, Latian dam, II+III, August 1968, leg. M.Iranshahr (IRAN 14666 F);
Puccinia spp. nov. (Iran) ... 133
Karaj-Chalus road, Kondor village, in an orchard, alt. 1800 m, II+IH, 17 June 1997, leg.
M.Abbasi et al. (IRAN 14668 F).
COMMENTS — To judge from Braun (1981), P. jaceae is delimited from P. hieracii
by teliospores with a mean width >25 um and urediniospores with smooth
patch <10 um. This rust species is restricted to Centaurea spp. (Braun 1981).
Interestingly, all three rust samples on C. behen we studied had teliospores with
a mean width >25 um (similar to P jaceae) but urediniospores with smooth
patches >10 um (different from P jaceae), leading us to describe the new variety,
P. jaceae var. elbursensis.
Re-examination of the P jaceae specimen on Centaurea macrocephala
Puschk. ex Willd. (IRAN 13722 F) reported by Donyadoost-Chalan et al. (2009)
showed urediniospores with smooth patches <10 um, identifying it as P. jaceae
var. jaceae in agreement with Braun (1981).
PLaTE 3. Puccinia punctiformis var. karajensis on Cirsium arvense: A. urediniospores; B. cross-
section of uredinium. Scale bars = 20 um.
Puccinia punctiformis var. karajensis Aliabadi & M. Abbasi, var. nov. PLATE 3
MycoBank MB 564235
Differs from Puccinia punctiformis var. punctiformis by its dimorphic urediniospores.
Type: On Cirsium arvense (L.) Scop.: Iran, Tehran Prov., Karaj-Chalus road, 2 km S
of Asara, around the river, alt.1750 m, O+II+III, 30 June 1999, leg. M.Abbasi et al.
(holotype, IRAN 14659 F).
EryMo_oey: referring to the general type locality.
SPERMOGONIA crowded, amphigenous, in large clusters, honey-colored.
UREDINIOID AECIA mostly hypophyllous and on the stems, systemic, scattered
over the whole surface of the leaf, round to oblong, pulverulent, reddish brown;
urediniospores of two types, normal urediniospores 23-31 x 23-27 um, wall
echinulate, 1.5-2 um thick, mostly globoid or broadly ellipsoid, with (2-)3
equatorial germ pores; large urediniospores 33-37(-44) x 32-37(-44) um,
globoid, with 5-8(-10) scattered germ pores. TELIA chiefly hypophyllous, rarely
epiphyllous and on stems, round to oblong, pulverulent, sometimes covered
134 ... Aliabadi & Abbasi
by the plant epidermis, black or brownish black; teliospores 34-40 x 21-26
uum, mostly ellipsoid to broadly ellipsoid or obovoid, rounded at both ends or
slightly narrowed basally, wall 1.5-2.5 um thick, chestnut-brown, scattered
and finely verrucose, germ pore apical in upper cell, in lower cell close to the
pedicel, pedicels short.
ComMENTS — Puccinia punctiformis var. karajensis differs from P. punctiformis
var. punctiformis in having dimorphic urediniospores with a second type of
unusually large spores with 5-8 scattered germ pores. We observed cross-
sections of uredinia with larger spores sitting on pedicels surrounded by normal
urediniospores. Study of 12 Iranian P. punctiformis herbarium specimens from
5 different provinces (IRAN 12389, 9560, 11625, 11776, 4011, 8371, 4010, 6851,
1866, 13752, 15114, 15115 F) and specimens from Turkey (IRAN 6847 F) and
Finland (IRAN 4482 F) showed no dimorphic urediniospores.
Acknowledgments
We acknowledge the help of Bahereh Javadi, Research Scientist at the Iranian
Research Institute of Plant Protection for identifying host plants. We also appreciate
the comments of expert referees, Dr. John Walker (Australia) and Prof. Cvetomir M.
Denchev (Bulgaria).
Literature cited
Braun U. 1981. Vorarbeiten zu einer Rostpilzflora der DDR. Feddes Reportorium 92: 95-123.
http://dx.doi.org/10.1002/fedr.49 10920105
Donyadoost-Chalan M, Abbasi M, Rezaee S. 2009. The rust mycobiota of Arasbaran Protected
area, NW of Iran. Rostaniha 10: 178-192.
Gitashenasi. 2004. General map of Central Albourz. Scale 1:200000. Gitashenasi Geographical &
Cartographic Institute.
Klein JC. 1994. La végétation altitudinale de lAlborz Central (Iran): entre les régions
iranotouranienne et euro-sibérienne. Institut Francais de Recherche en Iran, Téhéran.
Rechinger KH, Lack HW, Van Soest JL. 1977. Compositae I1-Lactuceae. Flora Iranica, No. 122.
Akademische Druck- und Verlagsanstalt, Graz, Austria.
Viennot-Bourgin G. 1958. Contribution a la connaissance des champignons parasites de I’ Iran.
Annal. Epiphyt. 2: 97-210.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.135
Volume 122, pp. 135-143 October-December 2012
Microfungi from Portugal: Minimelanolocus manifestus sp. nov.
and Vermiculariopsiella pediculata comb. nov.
MARGARITA HERNANDEZ-RESTREPO’ , RAFAEL FE, CASTANEDA- RUIZ’,
JOSEPA GENE’ , JOSEP GUARRO’, DAvID W. MINTER? & MARC STADLER‘
'Unitat de Micologia, Facultat de Medicina Ciéncies de la Salut, Universitat Rovira i Virgili, 43201
Reus, Tarragona, Spain
?Instituto de Investigaciones Fundamentales en Agricultura Tropical ‘Alejandro de Humboldt’
(INIFAT), Académico Titular de la Academia de Ciencias de Cuba,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P.
°CABI, Bakeham Lane, Egham, Surrey, TW20 9TY, United Kingdom
‘Department of Microbial Drugs, Helmholtz-Center for infection Research,
Inhoffenstrasse 8,38124 Braunschweig, Germany
*CORRESPONDENCE TO:
[email protected]
ABSTRACT —Two microfungi from a forest in Portugal are described and illustrated. The new
species Minimelanolocus manifestus is distinguished by polyblastic, integrated, sympodial
conidiogenous cells, and solitary, cymbiform, (2—)3-septate, smooth conidia with pale brown
middle cells and subhyaline end cells. A new combination Vermiculariopsiella pediculata is
proposed for Gyrothrix pediculata.
KEY worDs — anamorphic fungi, systematics, leaf litter
During the Iberian mycobiota study's twenty-fifth mycological foray, held
in “Lagoas de Bertiandos” (Ponte de Lima, Minho province) Portugal, two
interesting and unusual anamorphic fungi were collected. Individual samples
of plant material were placed in paper and plastic bags, taken to the laboratory,
and treated according to Castafieda-Ruiz (2005). Mounts were prepared in
polyvinyl alcohol-glycerol (8 g in 100 ml of water, plus 5 ml of glycerol) and
measurements made at a magnification of x1000. Photomicrographs were
obtained with a Zeiss AXIO imager M1 microscope (Gottingen, Germany). The
fungus was isolated into pure culture by transferring single conidia observed
under a stereo microscope onto potato-carrot agar (PCA) in Petri dishes, then
incubated at 25°C under daylight, 12 h alternating cycles of light/dark. Colour
notations in parentheses are from Kornerup & Wanscher (1978). The species
are described below.
136 ... Hernandez-Restrepo & al.
Fic 1. Minimelanolocus manifestus (ex holotype HAL 2450 F). a. Conidia. b. Conidiophore,
conidiogenous cell and conidium. c. Conidiogenous cells. d. Conidiogenous cells and conidia.
Scale bars = 10 um.
Minimelanolocus manifestus sp. nov. (Portugal) ... 137
Taxonomy
Minimelanolocus manifestus Hern.-Rest., R.F. Castafieda, Gené & Guarro, anam.
sp. nov. Figs 1, 2
MycoBank MB800026
Differs from Minimelanolocus spp. by conidia cymbiform to subfusiform, (2-)3-septate,
with central cells pale brown and end cells subhyaline.
TYPE: Portugal, Minho province, “Lagoas de Bertiandos’, 41°46’N 8°38'W, FMR 12182,
on rotten leaf of unidentified plant, 9 November 2011, R.E Castafieda, M. Hernandez-
Restrepo, J. Gené & J. Mariné-Gené (Holotype: HAL 2450 F).
ErymMo_oey: Latin, manifestus, meaning evident, clear manifest.
CoLonies on the natural substratum, effuse, hairy, brown to dark brown.
Mycelium superficial and immersed. Hyphae septate, branched, 2-4 um
diam., smooth, pale brown to brown. CONIDIOPHORES macronematous,
Fic 2. Minimelanolocus manifestus (ex holotype HAL 2450 F).
Conidiogenous cells and conidia. Scale bar = 10 um.
138 ... Hernandez-Restrepo & al.
mononematous, erect, straight, sometimes slightly sinuate towards the apex,
simple, 4-8-septate, smooth, 130-200 x 4-5 um, brown at the base, elsewhere
pale brown. CONIDIOGENOUS CELLS polyblastic, terminal, pale brown, 20-70
x 4-5 um, integrated, indeterminate, with several sympodial proliferations
bearing inconspicuous scars. Conidial secession schizolytic. Conrp1a solitary,
smooth, dry, acropleurogenous, cymbiform to subfusiform, fimbrillate at the
base, obtuse at the apex, (2—)3-septate, (21-)25-29 x 5-6 um, with central cells
pale brown and end cells subhyaline. Teleomorph unknown.
NoTE: Castaneda et al. (2001) established the genus Minimelanolocus with M.
navicularis (R.F. Castafieda) R.F. Castafieda as type species to accommodate
one new species and eleven combinations derived from Pseudospiropes M.B.
Ellis, Helminthosporium Link, and Belemnospora P.M. Kirk. Subsequently, the
following nine additional species were described: M. camelliae H.B. Fu & X.G.
Zhang, M. chimonanthi Y.D. Zhang & X.G. Zhang, M. endospermi Jian Ma &
X.G. Zhang, M. linderae Jian Ma & X.G. Zhang, M. machili K. Zhang & X.G.
Zhang, M. magnoliae K. Zhang & X.G. Zhang, M. mori Jian Ma & X.G. Zhang,
M. olivaceus R.F. Castafieda & Guarro, and M. pterocarpi Jian Ma & X.G. Zhang
(Castaneda et al. 2003, Ma et al. 2008, 2011, Zhang et al. 2009, 2010). Among
the known species, M. manifestus most closely resembles M. linderae and M.
navicularis, but M. linderae has ellipsoidal or cylindrical conidia, 26-35 x
7-9 um, which are mostly 4-septate and rarely 3-septate, while M. navicularis
possesses navicular to sub-rhombic conidia, 20-25 x 6-8 um, which are
(2—)3(-5)-septate, with brown to dark brown central cells and subhyaline end
cells. All three species can be easily differentiated.
Vermiculariopsiella pediculata (J.L. Cunn.) Hern.-Rest., R.F. Castafieda, Gené &
Guarro, comb. nov. Figs 3-5
MycoBank MB800053
= Gyrothrix pediculata J.L. Cunn., Mycologia 66(1): 123 (1974).
Anamorphic fungus. CoLonizs on the natural substratum effuse, blister-
shaped to sporodochial, hairy, whitish, amphigenous. Mycelium superficial
and immersed. Hyphae septate, frequently anastomosing, 1-3 um diam. SETAE
erect, cylindrical, 110-220 x 4-6 um, but wider, 5-9 um diam at the base, with
alternate, irregular to imperfect dichotomous branches, the branches being
attenuate, coiled to whip-like, curved, septate, smooth, brown below, and pale
brown at the apex. CONIDIOPHORES comprised solely of conidiogenous cells.
CONIDIOGENOUS CELLS monophialidic, discrete, ampulliform to subulate,
sometimes very close packed forming a cespitose layer, pale brown at the base,
subhyaline at the apex, 14-15 x 3-4 um, with a distinct, narrow, refractive
collarette. ConrpIA asymmetrical, sub-fusiform to navicular or sub-oblong,
attenuate, somewhat apiculate, curved at the apex, tumid, somewhat irregular,
Minimelanolocus manifestus sp. nov. (Portugal) ... 139
Fic 3. Vermiculariopsiella pediculata (ex nature HAL 2447 F). a. Conidia. b, c. Conidiogenous cells.
d-f. Setae. Scale bars = 10 um.
eccentrically and inconspicuously fimbrillate at the base, unicellular, hyaline,
smooth, 5-9 x 2 um, produced seriately and obliquely from the conidiogenous
loci, forming a white cirrhus or pseudochains in snow-like masses.
SPECIMEN EXAMINED: PORTUGAL, MINHO PROVINCE, “Lagoas de Bertiandos’,
41°46'N 8°38'W, FMR 12187, on rotten leaf of unidentified plant, 9 November 2011, R.F.
Castafieda, M. Hernandez-Restrepo, J. Gené & J. Mariné-Gené (HAL 2447 F).
CoLonigs on PCA, attaining 21-30 mm after 7 days at 25°C, floccose, raw
umber (5F8) with yellowish white (4A2) and numerous white pustules
somewhat pulvinate formed by conidial cirrhus. SETAE similar to those on
the natural substratum, 100-149 x 4-6 um. Hyphae septate, subhyaline to
very pale brown, 1-2 um diam, smooth. ConipiopHoREs comprised solely
of conidiogenous cells. CONIDIOGENOUS CELLS monophialidic, subulate to
ampulliform, slightly sinuate or curved, very pale brown at the base, hyaline
140 ... Hernandez-Restrepo & al.
Fic 4. Vermiculariopsiella pediculata (ex culture HAL 2451 F). a. Colonies on PCA (obverse and
reverse, respectively) at 25°C after 7 days. b, c. Conidia. d. Conidiogenous cells. Scale bars = 10
yum.
towards the apex, 19-28 x 3-4 um. Conip1A asymmetrical obclavate to long
obovoid, oblong or irregular, obtuse, slightly curved or subuncinate at the apex,
inflated, tumid, eccentrically fimbrillate at the base, hyaline, 19-28 x 3-4 um,
smooth-walled, produced axially at the conidiogenous cell apex in a long white
cirrhus or pseudocatenate.
CULTURES DEPOSITED: (ex HAL 2447 F) HAL 2451 E CBS 132484, FMR 12187.
Note: Nakagiri & Ito (1991) illustrated the conidiogenous cells and conidium
ontogeny from Gyrothrix circinata (Berk. & M.A. Curtis) S. Hughes and
regarded conidial production as “phialides type”; the authors interpreted the
whorled arrangement of conidia at the conidiogenous cell apex as resulting
Minimelanolocus manifestus sp. nov. (Portugal) ... 141
Fic 5. Vermiculariopsiella pediculata (ex culture on PCA, HAL 2451 F).
Conidia and conidiogenous cells. Scale bar = 10 um.
from mucilaginous material produced by and accumulated at the tip of each
conidiogenous cell. Crous et al. (1996), working with Gyrothrix verticiclada
(Goid.) S. Hughes & Piroz., illustrated inconspicuous annellations at the
conidiogenous cell apices produced after enteroblastic percurrent proliferations.
The aggregated conidia forming a whitish, more or less uniform layer at the
base of each seta is clearly the result of a conidial ontogeny with successive
enteroblastic percurrent or sympodial proliferations occurring near the apex
142 ... Hernandez-Restrepo & al.
of each conidiogenous cell, but the number of conidia produced by this way is
apparently limited and can be differentiated from the conidia produced from a
“phialide” as described by Kirk et al. (2008).
Wu et al. (1997) suggested that conidiogenous cells in Ceratocladium,
Circinotrichum, and Gyrothrix are not typical “phialides” Cunningham (1974)
described and illustrated the conidiogenous events on Gyrothrix pediculata
from cultures on corn meal agar. This pattern of ontogeny was classified as
conidial development type 18 (conidium ontogeny holoblastic, delimitation
by 1 septum, schizolytic secession, maturation by diffuse wall-building,
percurrent and sympodial enteroblastic conidiogenous cell proliferation below
the previous locus and delimiting septum, the second and subsequent conidia
formed from proliferations, but with no observed reduction in length of the
conidiogenous cells). Setose conidiomata with branched setae and similar
conidial ontogeny can be found in Vermiculariopsiella Bender [V. cornuta
(V. Rao & de Hoog) Nawawi, Kuthub. & B. Sutton, V. cubensis (R.F. Castaneda)
Nawawi, Kuthub. & B. Sutton, V. microsperma (Hohn.) R.F. Castafieda & W.B.
Kendr., and V. ramosa (B. Sutton) Nawawi, Kuthub. & B. Sutton]. As “phialides”
were described for the conidiogenous cells in Vermiculariopsiella by Morgan-
Jones et al. (1972), Nawawi et al. (1990) and Keshavaprasad et al. (2003), the
transfer of G. pediculata to Vermiculariopsiella is clearly supported and agrees
with the generic concept.
Acknowledgments
The authors express their sincere gratitude to Dr Xiu-Guo Zhang and Dr De-Wei Li
for their critical review of the manuscript. This study was supported by the Ministry of
Science and Innovation of Spain, grant CGL 2011-27185. We thank the Cuban Ministry
of Agriculture and Dr Adolfo Rodriguez Nodals (INIFAT) for facilities. We thank M.
Caraballo and B. Ramos for technical assistance. We thank Drs U. Braun, De-Wei Li, V.
Melnik, P.W. Crous, R. Singh, and M.A. D’Souza for their generous and valued assistance
with literature not otherwise available. We also acknowledge the facilities provided by
Dr P.M. Kirk and Drs V. Robert and G. Stegehuis through the Index Fungorum and
Mycobank websites. Dr Lorelei L. Norvell’s editorial review and Dr Shaun Pennycook’s
nomenclature review are greatly appreciated.
Literature cited
Castafieda-Ruiz RF. 2005. Metodologia en el estudio de los hongos anamorfos. 182-183, in: Anais
do V Congresso Latino Americano de Micologia. Brasilia.
Castafieda-Ruiz RE, Heredia G, Reyes M, Arias RM, Decock C. 2001. A revision of the genus
Pseudospiropes and some new taxa. Cryptog. Mycol. 22: 3-18.
http://dx.doi.org/10.1016/S0181-1584(01)01057-0
Crous PW, Seifert KA, Castafieda-Ruiz RE.1996. Microfungi associated with Podocarpus leaf litter
in South Africa. S. Afr. J. Bot. 62: 89-98.
Cunningham JL. 1974. A new Gyrothrix in culture and key to species. Mycologia 66: 122-129.
http://dx.doi.org/10.2307/3758461
Minimelanolocus manifestus sp. nov. (Portugal) ... 143
Keshavaprasad TS, D’Souza M, Bhat DJ. 2003. Vermiculariopsiella Bender: Present status of species
diversity. 503-511, in: Frontiers of fungal diversity in India. International book distributing
Co., Lucknow, India.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi. 10° ed. CAB
International, Wallingford, UK.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour 3" ed. E. Methuen, London.
Ma J, Zhang K, Zhang XG. 2008. Two new species of the genus Minimelanolocus in China.
Mycotaxon 104: 147-151.
Ma J, Ma L-G, Zhang Y-D, Castafieda-Ruiz RF, Zhang XG. 2011a. Pseudospiropes linderae sp. nov.
and notes on Minimelanolocus (both anamorphic Strossmayeria) new to China. Nova Hedwigia
93: 465-473. http://dx.doi.org/10.1127/0029-5035/2011/0093-0465
Ma J, Zhang Y-D, Ma L-G, Zhang XG. 2011b. Two new Minimelanolocus species from southern
China. Mycotaxon 117: 131-135. http://dx.doi.org/10.5248/117.131
Morgan-Jones G, Nag Raj TR, Kendrick B. 1972. Icones generum coelomycetum V. Univ. Waterloo
Biol. Ser. 7: 1-52.
Nawawi A, Kuthubutheen AJ, Sutton BC. 1990. New species and combinations in Vermiculariopsiella
(hyphomycetes). Mycotaxon 37: 173-182.
Wu W, Sutton BC, Gange AC. 1997. Description of Avesicladiella gen. nov. (hyphomycetes) for two
undescribed leaf litter microfungi. Mycoscience 38: 11-15. http://dx.doi.org/10.5248/109.95
Zhang K, Fu HB, Zhang XG. 2009. Taxonomic studies of Minimelanolocus from Yunnan, China.
Mycotaxon 109: 95-101. http://dx.doi.org/10.5248/109.95
Zhang Y-D, Ma J, Ma L-G, Zhang XG. 2010. A new species of Minimelanolocus from Fujian, China.
Mycotaxon 114: 373-376. http://dx.doi.org/10.5248/114.373
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.145
Volume 122, pp. 145-156 October-December 2012
Geastrum species of the La Rioja province, Argentina
FRANCISCO KUHAR*, VALERIA CASTIGLIA & LEANDRO PAPINUTTI
Laboratorio de Micologia Experimental, DBBE, Facultad de Ciencias Exactas y Naturales,
Ciudad Universitaria, (C1428EHA) Ciudad de Buenos Aires, Argentina.
* CORRESPONDENCE TO:
[email protected]
ABSTRACT—A survey of Geastrum species from arid lands in the La Rioja province
(northwestern Argentina) recovered fourteen species previously unreported from the
province: G. arenarium, G. campestre var. famatinum, G. corollinum, G. fimbriatum, G.
floriforme, G. glaucescens, G. hieronymi, G. aff. lloydianum, G. pampeanum, G. pampeanum vat.
pallidum, G. parvistriatum, G. rufescens, G. saccatum, and G. schmidelii. Of these, new records
are G. corollinum for Argentina, G. arenarium for South America, and G. parvistriatum for
the Americas, and G. campestre var. famatinum is proposed as a new variety. Each taxon
is described, and photographs of basidiomes and SEM micrographs illustrating spores are
provided for selected taxa.
Key worps— Geastrales, mycobiota, Phallomycetidae, taxonomy
Introduction
The genus Geastrum (earthstars) is characterized by subspherical to
spherical basidiomes having a central axis (columella) surrounded by a mass
of fertile tissue (gleba) contained within an inner (endoperidium) and outer
(exoperidium) layer. Spores are liberated through a single apical pore (in the
endoperidium) surrounded by a highly variable structure called the peristome.
At maturity, the exoperidium splits into a variable number of rays, which give
Geastrum basidiomes their characteristic star-shape. These exoperidial rays
serve to protect the endoperidial body and facilitate spore dispersal. With their
unique morphology, Geastrum species represent the evolution of one of the
more specialized basidiome forms found among the gasteroid fungi.
The present paper focuses on Geastrum species that were collected during
survey of gasteroid fungi of the La Rioja province of northwestern Argentina.
La Rioja belongs to the Monte biogeographical province, which is defined
as a xeric biome (80-200 mm annual rainfall) based on its vegetation and
146 ... Kuhar, Castiglia & Papinutti
physiognomy (Roig 1998; Roig-Jufent 2001). The predominant vegetation
is a shrub steppe, which is a characteristic endemic flora mainly represented
by vascular plant species in the Zygophyllaceae (e.g., Larrea, Bulnesia, and
Plectrocarpa). Each Geastrum taxon recovered in the survey is described and
discussed, and selected taxa are illustrated.
Materials & methods
This work is based on specimens collected by L. Papinutti and G. Rolén and deposited
in the University of Buenos Aires Herbarium (BAFC). Capillitial threads and spores
were observed under light (mounted in KOH 3% w/v) or scanning electron (Zeiss DSM
982 Gemini) microscopy. At least 20 measurements were made to estimate the size
of microscopic and macroscopic elements. Macroscopic measures were made on dry
basidiomes. All spore measurements citing the diameter include the ornamentation.
Colors were described in well-preserved dry specimens and indicated following Maerz
& Paul (1930). Bates (2004), Dominguez de Toledo (1989), Sunhede (1989), Soto &
Wright (2000), Ponce de Leon (1968), Calonge (1998) and Zamora & Calonge (2007)
were used as standard references in the determination of collections.
Taxonomy
Geastrum arenarium Lloyd, Geastrae: 28 (1902, as“ Geaster arenarius”). Fics lc, 2a
Mature basidiomes 20-30 mm wide; exoperidium arched, splitting
in 10-12 subequal arching, revolute, hygroscopic rays; mycelial layer
encrusting fine particles of debris and sand; fibrous layer creamy white (2A1);
pseudoparenchymatous layer whitish to pallid brown (14C7) when immature,
rimulose in age; endoperidial body 5-12 mm wide almost sessile, globose,
slightly pruinose, pallid brown (14C7); apophysis reduced; peristome fibrillose,
conical, delimited, darker, concolorous, or lighter than the surrounding
endoperidium; gleba brown (7H10), cottony.
Spores globose, 2.5-3.7 um wide, verrucose, with a short apiculus that is
difficult to discern due to the dense covering of mammiform verrucae.
SPECIMEN EXAMINED—ARGENTINA. La_ Rioja: Miranda, 28°28'33.68"S
67°42'27.55"W, gregarious on abundant leaf litter under Prosopis sp. (Mimosaceae),
27.111.2008, leg. L. Papinutti & G. Rolén (BAFC 51925).
ComMENTs—Although most basidiomes exhibited hygroscopic rays, sub-
hygroscopic rays were also observed. A very short stalk was observed in some
dry specimens similar to North American material described by Bates (2004;
referred to by the author as “+ sessile”), while other specimens were entirely
sessile. Geastrum arenarium may be confused with other hygroscopic species,
G. corollinum and G. floriforme, from La Rioja. However, these taxa have larger
spores than G. arenarium and a mycelial layer not strongly encrusted with sand
and debris. This is the first record of this species for Latin America.
Geastrum in Argentina ... 147
Re
aX A
FIGURE. 1: a. G. corollinum. b. G. floriforme. c. G. arenarium. d. G. parvistriatum. e. G. saccatum. f.
G. hieronymi. g. G. campestre var. famatinum. h. G. glaucescens. Scale bars = 1 cm.
148 ... Kuhar, Castiglia & Papinutti
Sv
fo Bs
ye his a é
y DENS See BR “
FiGurRE. 2: SEM micrographs of spores. a. G. arenarium. b. G. hieronymi. c. G. glaucescens.
d. G. parvistriatum. e. G. aff. lloydianum. f. G. pampeanum var. pampeanum. Scale bars: a, c-f = 4
um; b = 2 um.
Figure. 3: SEM micrographs of G. campestre var. famatinum spores.
Scale bars: a= 1 um; b = 5 um.
Geastrum in Argentina... 149
Geastrum campestre var. famatinum Kuhar & Papinutti, var. nov. Fics 1g, 3
MycoBank MB 563048
Differt a typo Geastri campestris magnitudine sporarum valde minore.
Type: Argentina. La Rioja: Famatina Department, Pituil, 28°34'47.94"S 67°27'59.42"W
under Prosopis sp., 27.11.2008, leg. L. Papinutti & G. Rolén, (holotype,, BAFC 51926).
ErymMo_oey: from the name of the geographic department of the type locality.
Expanded basidiomes 20-35 mm wide; exoperidium arched, splitting in 9-12
subequal rays, revolute and curving under the endoperidial body, weakly
hygroscopic; mycelial layer encrusted with abundant debris, peeling off toward
the ray tips with age but persisting in the rest of the endoperidium; fibrous
layer light colored (12G7) and smooth; pseudoparenchymatous layer dirty
dark brown (8E8), peeling off of the fibrous layer in an irregular manner;
endoperidial body 10-18 mm wide globose with a very short stalk, verrucose
and slightly pruinose, grey (14A3), laterally compressed in some specimens;
apophysis visible; peristome definite, plicate, conic, concolorous with the
surrounding endoperidium; gleba dark brown (8A11), cottony.
Spores globose, 3.5-4.2 um wide, verrucose.
ComMENTS— This collection agrees very precisely with published descriptions
of G. campestre, but the spores are much smaller than those measured by
Sunhede (1989; 6.5-8 um), Ponce de Leén (1968; 5-6 um) and Bates (2004;
6.4-8 um). Dominguez de Toledo (1989), in her prospection of Cérdoba and
La Pampa provinces (Argentina), reported some collections of G. campestre
having, on average, half the spore size than is typical for this species. Soto
& Wright (2000), who described very similar basidiomes, treated them as
G. ambiguum due to the smaller spore size. Sunhede (1989), who carefully
studied type material of G. ambiguum deposited at Kew, concluded that it
is a synonym of G. campestre. Another similar species is G. smithii, which
differs from G. campestre in having spores more densely covered with shorter
verrucae, a rimose pseudoparenchymatous layer, and a peristome surrounded
by a depressed area. The granulose endoperidium is a striking characteristic
that clearly differentiates G. campestre from other similar species. Since the
La Rioja collection fits the macromorphological description of G. campestre
reported in Sunhede (1989) but with considerably smaller spores, we propose
this as a new variety.
Geastrum corollinum (Batsch) Hollds, Gasteromyc. Ungarns: 62 (1904, as “Geaster
corollinus”). Rig: Ta
Basidiomes small to very small 6-19 mm wide; exoperidium saccate to slightly
arched, very hard in old specimens, splitting into 8-11 strongly hygroscopic
rays that cover the endoperidial body; mycelial layer encrusting debris but soon
peeling off; fibrous layer whitish grey (5A8); pseudoparenchymatous layer very
150 ... Kuhar, Castiglia & Papinutti
persistent, turning brown to dark brown (8L6) in old specimens; endoperidial
body sessile, globose, greyish beige (12B4); peristome fibrillose, delimited;
mature gleba brown (7A11).
Spores globose, 4.0-5.0 um wide, verrucose, with some verrucae coalescing
at their apices; apiculus distinct.
SPECIMENS EXAMINED—ARGENTINA. La Rroja: Santa Cruz, 28°28'35.11"S
67°41'54.45"W, gregarious on abundant leaf litter under Prosopis sp., 27.III.2008, leg. L.
Papinutti & G. Rolon (BAFC 51927); 28°28'42.14"S 67°42'32.31" W, among litter under
Prosopis sp., 27.11.2008, leg. L. Papinutti & G. Rolon (BAFC 51928); 28°28'42.15"S
67°42'49.79"W, on abundant leafy litter under Prosopis sp. near a dry river, 28.11.2008,
leg. L. Papinutti & G. Rolon (BAFC 51929).
ComMENTS— Although fruit body size is homogeneous within each of our
collections, the variation among different collections is high. Sunhede (1989)
clearly illustrates the variability of this character. Geastrum corollinum and
G. glaucescens are the most frequent species found in our survey of this province.
This is the first report of G. corollinum for Argentina.
Geastrum fimbriatum Fr., Syst. Mycol. 3(1): 16 (1829, as “Geaster fimbriatus”).
Basidiomessmallto medium sized 20-25 mm wide; exoperidium often saccate,
splitting from about the middle in 6-10 non-hygroscopic to sub-hygroscopic
rays with light margins; mycelial layer encrusting debris but peeling off in some
specimens; fibrous layer light beige (4C7) on both sides in fresh specimens,
becoming denuded and whitish in older ones; pseudoparenchymatous layer
becoming brownish in age (7A11); endoperidial body 9-11 mm wide greyish
brown (8C11), sessile, globose to depressed globose; peristome fibrillose, not
delimited, sometimes slightly protruding; gleba brown (8L6).
Spores globose, 3.5-4.0 um wide, verrucose with <0.4 um long columnar
verrucae; capillitial hyphae thick walled.
SPECIMEN EXAMINED—ARGENTINA. La_ Rioja: Guanchin, 29°09'40.98"S
67°39'40.37"W, gregarious, on finely particulated debris of diverse plant species,
27.111.2008, leg. L. Papinutti & G. Rolén (BAFC 51930).
COMMENTS—Geastrum fimbriatum, one of the most widely distributed species
in the genus, has been cited in Europe (Sunhede 1989; Calonge 1998), North
America (Bates 2004), and Latin America (Leite et al. 2007; Pereira et al. 2009;
Calonge et al. 2005), including Argentinas Buenos Aires province (Soto &
Wright 2000). This is the first record for La Rioja province.
Geastrum floriforme Vittad., Monog. Lycoperd.: 23 (1842, as “Geaster floriformis”).
Fic. 1b
Basidiomes small to very small, 5-10 mm wide, hypogeous prior to
opening; exoperidium saccate to slightly arched when fresh, very hard when
dry, splitting in about 6-11 strongly hygroscopic rays, these covering the
Geastrum in Argentina... 151
endoperidial body in the dry state; mycelial layer encrusting debris but peeling
off early in the development of the basidiome; fibrous layer greyish (4A1);
pseudoparenchymatous layer very persistent, turning brown (8L6) to dark
brown in old specimens; endoperidial body 3-6 mm wide, sessile light brown
(14E7); peristome fibrillose not delimited; apophysis absent; gleba brown
(7A11).
Spores globose, 5.0-5.5 um wide, verrucose with short irregularly shaped
verrucae; apiculus distinct.
SPECIMEN EXAMINED— ARGENTINA. La Rioja: Santa Cruz, 29°20'45.54"S
67°42'22.16"W, on Larrea divaricata and Baccharis sp. leaf litter, 27.11.2008, leg. L.
Papinutti & G. Rol6n (BAFC 51931).
ComMMENTS—In Argentina G. floriforme was documented from Cordoba and
Catamarca provinces (Dominguez de Toledo, 1989) and Buenos Aires province
(Soto & Wright 2000). This is a first record for La Rioja.
Geastrum glaucescens Speg., An. Mus. Nac. Bs. As. 23: 14
(1912, as “Geaster’). Fics 1h, 2c
Mature basidiomes 11-24 mm wide; exoperidium weakly arched, splitting in
9-10 subequal involute sub-hygroscopic rays; mycelial layer encrusted with fine
debris, fibrous layer whitish; pseudoparenchymatous layer greyish beige in age
(5A8), breaking tangentially at the base of the rays; pseudoparenchymatous layer
and endoperidial body covered with abundant persistent white mesoperidial
matter; endoperidial body 5-10 mm wide, stalked, globose, surface slightly
pruinose, concolorous with the inner exoperidial surface (7A10 to 6A7); stalk
white, 1 mm long; apophysis absent; peristome plicate, conical, delimited,
concolorous to dark brown at the very tip; gleba brown (7H12), cottony.
Spores globose, 3.5-4.5 um wide, with a short apiculus that is difficult to
discern due to the covering of short mammiform verrucae.
SPECIMENS EXAMINED— ARGENTINA. La Roja: Santa Cruz, 29°20'45.54"S
67°42'22.16"W, solitary, on leaf litter of Larrea divaricata and Baccharis sp., 27.I11.2008,
leg. L. Papinutti & G. Rolon (BAFC 51932); Chilecito, 29°09'11.20"S 67°29'34.18"W,
abundant, gregarious, on leaf and particulated debris under Prosopis sp., 15.IV.2009,
leg. L. Papinutti & G. Rolén (BAFC 51933); Chamical, 30°20'18.74"S 66°20'23.79"W,
on leaf litter of L. divaricata, 2.IV.2007, leg. L. Papinutti & G. Rol6n (BAFC 51934);
30°22'21.10"S 66°17'03.90"W, on leaf litter of Prosopis sp., 2.IV.2007, leg. L. Papinutti &
G. Rolén (BAFC 51935).
ComMENTS— As Soto & Wright (2000) stated, G. glaucescens resembles small
basidiomes of G. striatum; however, that species lacks the ring-like apophysis
and has larger distinctly ornamented spores. Another similar species found in
La Rioja is G. parvistriatum, which can be distinguished by larger basidiome
size, larger spores with a less densely distributed ornamentation, and a
subglobose, flattened, or ovoid endoperidial body. The G. parvistriatum stipe is
152 ... Kuhar, Castiglia & Papinutti
much longer and darker than in G. glaucescens. Geastrum minimum also shows
similarities but differs from G. glaucescens in its a strongly arched exoperidium,
fibrillose peristome, less pruinose endoperidial surface, conspicuous apophysis,
and larger spore size. This is the first record of G. glaucescens from La Rioja,
although Spegazzini’s type collection was collected in Buenos Aires province.
Geastrum hieronymi Henn., Hedwigia 36: 211 (1897, as “Geaster”). Fics 1f, 2b
Basidiomes medium sized 30-70 mm wide when fully open; exoperidium
splitting from the middle (or deeper in some specimens) into mostly 6-8
acute rays, sometimes revolute, but not hygroscopic; mycelial layer persistent,
brown, encrusting debris; fibrous layer light beige (11B3) when denuded;
pseudoparenchymatous layer dark brown when dry (8H7); endoperidial
body 20-30 mm wide, dirty bronze grey (15C8), subglobose, with a short
stalk, asperate; apophysis prominent; peristome not delimited, fibrillose; gleba
bordeaux (8L12).
Spores globose, 3.5-4.5 um wide, verruculose.
SPECIMEN EXAMINED— ARGENTINA. La Rioja: Miranda, 29°20'51"S 67°42'22.16" W,
on abundant leaf litter and twigs of Prosopis sp., 27.11.2008, leg. L. Papinutti & G. Rol6n
(BAFC 51936).
ComMENTS— This is the first report of G. hieronymi from La Rioja.
Geastrum aff. lloydianum Rick, Brotéria 5: 27 (1906, as “Geaster lloydianus”). Fic. 2e
Basidiomes 35-40 mm wide; exoperidium splitting into 7-9 acute subequal
rays, not hygroscopic; mycelial layer encrusted with sand; fibrous layer
ochraceous (14G8); pseudoparenchymatous layer umber (8H12), cracking and
seceding in places; endoperidial body 15-20 mm wide, subpedicellate or almost
sessile, light beige (5A9), depressed globose, distinctly pitted and roughened
but not truly warted or tomentose; apophysis absent; peristome sulcate, conical,
acute, concolorous or darker than the endoperidium; gleba umber (7H11).
Spores globose, 3.0-4.0 um wide, dark brown, finely verruculose.
SPECIMEN EXAMINED— ARGENTINA. La_ Rioja: Safiogasta, 29°18'43.88"S
67°35'37.95"W, on soil with scarce organic matter, 25.III.2008, leg. L. Papinutti & G.
Rolén (BAFC 51937).
COMMENTS— Our spores agree in size with the cited descriptions, but differ in
the type of ornamentation illustrated for this species by Coker & Couch (1928),
which showed sparse minute verrucae. We regard this collection as Geastrum
aff. lloydianum, but SEM images of the spores from the type material are needed
to clarify this determination. Another key character for this species is the dark
endoperidial body (Ponce de Leon 1968); but a recent report of G. lloydianum
with a yellowish brown endoperidial surface (Trierveiler-Pereira et al. 2011)
suggests that this character can be highly variable.
Geastrum in Argentina... 153
Geastrum pampeanum Speg., Anal. Mus. Nac. Bs. As. 6: 192 (1899,
as “Geaster pampeanus”) var. pampeanum. Fic. 2f
Basidiome 25 mm wide, saccate; exoperidium membranaceous, delicate,
splitting in 5 rays, these helicoidally twisted at tips in the dry state and partially
covering the endoperidial body; mycelial layer sand colored, not encrusted with
debris; fibrous layer light beige (12C5); pseudoparenchymatous layer dark hazel
brown (8H12); endoperidial body 16 mm wide, sessile, hazel brown at maturity
(14B7); peristome fibrillose, delimited, concolorous with the surrounding
endoperidial body; apophysis absent; gleba dark brown (8L11).
Spores globose, 4.5-5.5 um wide, verrucose with regular long (<1 um)
columnar verrucae.
SPECIMEN EXAMINED— ARGENTINA. La_ Ruoja: Chilecito, 29°09'11.20"S
67°29'34.18" W, solitary, on leaf and particulate debris under Prosopis sp., 20.11.2006, leg.
L. Papinutti (BAFC 51939).
ComMENTS— ‘his is the first record of this variety from La Rioja province.
Geastrum pampeanum var. pallidum Speg., Anal. Mus. Nac. Bs. As. 6: 192 (1899,
as “Geaster pampeanus var. pallida”).
Mature basidiomes 12-29 mm wide, saccate; exoperidium non-hygroscopic
splitting into about 5-10 rays; mycelial layer, slightly encrusted with fine
debris; fibrous layer creamy white (2A1); pseudoparenchymatous layer dark
beige (8E12); endoperidial body 6-10 mm wide, sessile, brown at maturity
(7C10); peristome fibrillose, delimited, slightly conic but depressed in dry state,
concolorous with the surrounding endoperidial body; apophysis absent; gleba
dark beige (8C11).
Spores globose, 3.2-4.5 um wide, verrucose with conical to columnar
verrucae.
SPECIMEN EXAMINED— ARGENTINA. La_ Rioja: Chilecito, 29°09'11.20"S
67°29'34.18" W, gregarious, on leaf and particulate debris under Prosopis sp., 20.11.2006,
leg. L. Papinutti (BAFC 51938).
ComMENTS— This is the first record of this variety from La Rioja province.
Geastrum parvistriatum J.C. Zamora & Calonge, Bol. Soc. Micol.
Madrid 31: 140 (2007). Figs 1d, 2d
Mature basidiomes 20-40 mm wide; exoperidium non-hygroscopic, arched,
splitting into 8-11 subequal, acute rays; mycelial layer encrusted with abundant
debris; fibrous layer sand colored (12D6); pseudoparenchymatous layer brown
(7C9), smooth, peeling off to expose the fibrous layer; endoperidial body
8-15 mm wide, stalked, grey to lead (7C7), smooth and always pruinose; stalk
1.5-2.5 mm high, dark brown; apophysis visible in some basidiomes; peristome
conical, plicate-sulcate, well delimited and darker than the endoperidium;
gleba brown (8C10).
154 ... Kuhar, Castiglia & Papinutti
Spores globose, 4.3-5.7 um wide, verrucose with long verrucae that are
frequently coalescent at their apices.
SPECIMEN EXAMINED— ARGENTINA. La Rioja: Santa Cruz, 28°28'35.11"S
67°41'54.45"W, on abundant Prosopis sp. leaf litter, 27.1II.2008, leg. L. Papinutti & G.
Rolén (BAFC 51940).
CoMMENTS—There are no differences between the accurate description of
Zamora & Calonge (2007) and our material. Our collections were also made
on sandy soil, as were the Spanish type material. This is the first report of
G. parvistriatum from the Americas, although G. striatum (and perhaps
G. schmidelii) specimens there should be re-evaluated in light of Zamora &
Calonge (2007).
Geastrum rufescens Pers., Syn. Meth. Fung.: 134 (1801).
Basidiome medium sized, 25 mm wide; exoperidium non-hygroscopic,
arched to saccate, splitting from the middle into 8 rays with light margins;
mycelial layer encrusted with abundant debris; fibrous layer whitish to pale beige
(13D5) only visible in the denuded margins of the rays; pseudoparenchymatous
layer becoming brownish in age (1419); endoperidial body 10 mm wide, globose
to depressed globose, light brown (14E6) when dry; stalked, apophysis present,
peristome fibrillose, not delimited, neither protruding nor thickened; gleba
dark brown (8L6).
Spores globose, 3.5-5.0(-6.0) um wide, verrucose with long columnar
verrucae; capillitial hyphae thick walled.
SPECIMEN EXAMINED— ARGENTINA. La_ Rtoja: Chilecito, 29°09'11.20"S
67°29'34.18"W, on abundant Prosopis sp. leaf litter under Ephedra triandra, 21.11.2006,
leg. L. Papinutti & G. Rolén (BAFC 51941).
ComMENTS—Although our collection contains just one specimen, the perfectly
preserved basidiome exactly fits the descriptions cited above. Soto & Wright
(2000) have already reported G. rufescens from Buenos Aires province, and this
is the first report of the species from La Rioja.
Geastrum saccatum Fr., Syst. Mycol. 3(1): 16. (1828, as “Geaster saccatus”). Fic. le
Basidiomes typically small though some are medium sized, 19-31 mm wide;
exoperidium splitting to about the middle into 6-8(-12) rays of variable shape,
often recurved under the whole basidiome; mycelial layer whitish when not
covered with debris; fibrous layer beige (14K9); pseudoparenchymatous layer
at first white to grey, but soon turning beige to almost dark brown (8H10),
relatively thick, papery, sometimes with longitudinal cracks in older specimens,
peeling off at the margins with age; endoperidial body (3.5-)5-20(-24) mm
wide, globose to depressed globose, sessile or subsessile, pale grey to light beige
(14A5) smooth; apophysis lacking; peristome finely fibrillose, mammiform
Geastrum in Argentina... 155
to almost flat, delimited, concolorous or darker than the endoperidium and
sometimes surrounded by a light colored zone; gleba brown (8H9).
Spores globose, 4.5-6.0 um wide, ornamented with short columnar verrucae
(some apically coalescent).
SPECIMENS EXAMINED— ARGENTINA. La_ Rioja: Miranda, 29°20'45.54"S
67°42'22.16" W, on Prosopis sp. leaf litter, 27.11.2008, leg. L. Papinutti & G. Rol6n (BAFC
51942, 51944); Safiogasta, 29°18'43.88"S 67°35'37.95"W, on finely particulated debris,
27.111.2008, leg. L. Papinutti & G. Rolén (BAFC 51943).
ComMENTS— Although collected in the same locality, the endoperidium color
differs in G. saccatum BAFC 51944 and BAFC 51942. Nevertheless, Sunhede
(1989) described this character as highly variable in this species. This is the first
record of G. saccatum from La Rioja province.
Geastrum schmidelii Vittad., Monog. Lycoperd.: 13. (1842, as “Geaster”).
Expanded basidiomes 18-28 mm wide; exoperidium arched, splitting in
10-12 slightly hygroscopic subequal revolute rays; mycelial layer encrusting
debris, peeling off in aged specimens; fibrous layer light colored (13B4);
pseudoparenchymatous layer brown (7A9), peeling off irregularly; endoperidial
body stalked, globose, papery to finely pruinose, grey to brown (7C9), stalk up
to 2.5 mm, often laterally compressed; apophysis reduced; peristome delimited,
plicate, conic, darker than the surrounding endoperidium; gleba cottony,
brown (8L7).
Spores globose, 4.5-7.0 um wide, verrucose.
SPECIMEN EXAMINED— ARGENTINA. La_ Rioja: Safiogasta, 29°18'51.43"S
67°35'37.36" W, on abundant leaf litter of diverse herbaceous plant species, 27.III.2008,
leg. L. Papinutti & G. Rolén (BAFC 51945).
ComMENTS—Although the collected material (BAFC 51945) matches the
description of Sunhede (1989), some expanded basidiomes exceed the upper
limit indicated in his work and in Bates (2004). This is the first record of
G. schmidelii for La Rioja province.
Acknowledgments
We wish to express our gratitude to Dra. Maria M. Dios and Dr. Scott T. Bates for
reviewing the manuscript and offering useful comments. We thank Guillermo Rolén
for the technical assistance with the figures. This study was supported by a grant from
Consejo Nacional de Investigaciones Cientificas y Técnicas (CONICET) and Universidad
de Buenos Aires, Argentina.
Literature cited
Bates ST. 2004. Arizona members of the Geastraceae and Lycoperdaceae (Basidiomycota, Fungi).
Masters thesis. Arizona State University, Tempe.
Calonge FD. 1998. Gasteromycetes, I. Lycoperdales, Nidulariales, Phallales, Sclerodermatales,
Tulostomatales. Flora Mycologica Iberica. Ed. J. Cramer. 271 p.
156 ... Kuhar, Castiglia & Papinutti
Calonge FD, Mata M, Carranza J. 2005. Contribucidn al catalogo de los Gasteromycetes
(Basidiomycotina, Fungi) de Costa Rica. Anales del Jardin Botanico de Madrid 62: 23-45.
http://dx.doi.org/10.3989/ajbm.2005.v62.i1.26
Coker WC, Couch JN. 1928. The Gasteromycetes of the Eastern United States and Canada. Chapel
Hill, The University of North Carolina Press.
Dominguez de Toledo LS. 1989 Contribucién al conocimiento de Gasteromycetes del centro de
Argentina. Doctoral Dissertation. Universidad Nacional de Cérdoba, Cordoba.
Leite AG, Calonge FD, Baseia IG. 2007. Additional studies on Geastrum from northeastern Brazil.
Mycotaxon 101: 103-111.
Maerz A, Paul MR. 1930. Dictionary of color, 1st edition. McGraw Hill Co, New York.
Ponce de Leon P. 1968. A revision of the family Geastraceae. Fieldiana Bot 31: 302-349.
Roig A. 1998. Vegetacion de la Patagonia. Coleccién Cientifica INTA 8: 48-166.
Roig-Jufent S, Flores G, Claver $, Debandi G, Marvaldi A. 2001. Monte Desert (Argentina):
insect biodiversity and natural areas. Journal of Arid Environments 47: 77-94.
http://dx.doi.org/10.1006/jare.2000.0688
Soto M, Wright JE. 2000. Taxonomia del género Geastrum (Basidiomycetes, Lycoperdales) en la
provincia de Buenos Aires, Argentina. Boletin de la Sociedad Argentina de Botanica 34:
185-202.
Sunhede S. 1989. Geastraceae (Basidiomycotina) morphology, ecology, and systematics with
emphasis on the North European species. Synopsis Fungorum 1: 1-534.
Trierveiler-Pereira L, Silva AC, Baseia IG. 2009. Notes on gasteroid fungi of the Brazilian Amazon
rainforest. Mycotaxon 110: 73-80. http://dx.doi.org/10.5248/110.73
Trierveiler-Pereira L, Calonge FD, Baseia I. 2011. New distributional data on Geastrum (Geastraceae,
Basidiomycota) from Brazil. Acta Botanica Brasilica 25: 577-585.
http://dx.doi.org/10.1590/S0102-33062011000300010
Zamora, J.C.; Calonge, ED. (2007). Geastrum parvistriatum, una nueva especie encontrada en
Espana. Bol. Soc. Micol. Madrid 31: 139-149.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.157
Volume 122, pp. 157-160 October-December 2012
Myxomycetes from China 16:
Arcyodes incarnata and Licea retiformis,
newly recorded for China
Bo ZHANG? & Yu L1'*
‘Engineering Research Center of Chinese Ministry of Education for Edible and Medicinal Fungi,
Jilin Agricultural University, 2888 Xincheng Street, Changchun City, P. R. China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Two new records for China, Arcyodes incarnata and Licea retiformis, are
reported in this paper. Materials collected from Yunnan and Fujian province are described
and illustrated by scanning electron micrographs. Those specimens are deposited in the
Herbarium of Mycological Institute of Jilin Agricultural University (HMJAU), Changchun,
China.
KEY worDs —taxonomy, slime molds, SEM
Introduction
Our examination of previous myxomycete collections has revealed two
new records for China. One is in Arcyodes, which is currently accepted as a
monotypic genus. The other is in Licea, which now comprises about 71 species
(Kirk et al. 2008, Lado 2001, 2012-14), of which 13 are reported for mainland
China (Chou 1937; Li & Li 1989, 1994; Li 2005) and 11 for Taiwan (Liu et al.
2002).
Materials & methods
Fruiting bodies and microscopic structures were examined using light and scanning
electron microscopes (Martin & Alexopoulos 1969; Lietal. 1993, Li& Li1995). Permanent
slides were mounted in Hoyer’s reagent (Martin & Alexopoulos 1969). Colored slides
were prepared according to Robbrecht (1974) by spreading the capillitium in a drop of
94% alcohol, determining color after one minute, and then mounting in Hoyer’s reagent.
Color terms are given according to the Flora of British Fungi (1969). The specimens are
deposited in the Herbarium of the Mycological Institute, Jilin Agricultural University
(HMJAU).
158 ... Zhang & Li
Taxonomy
PLaTE 1. Arcyodes incarnata: A, fruiting bodies. B, inner surface of peridium. C, D, part of the
capillitium and spores. E, spore. Scale bars: A = 1 mm; B, E= 2um; C = 5 um; D = 10 um.
Arcyodes incarnata (Alb. & Schwein.) O.F. Cook, Science, N.Y. 15: 651, 1902. Pr. 1
SPOROCARPS aggregated, sessile, crowded and heaped, 0.5-0.7 mm in diam.,
fawn, fading to dull ochraceous. HyPOTHALLUS inconspicuous. PERIDIUM
single, membranous, somewhat opalescent, persistent, irregularly dehiscent
above, yellow to colourless by transmitted light, inner surface with many
prominent warts, low irregular ridges, sometime forming a net with small
protuberances. COLUMELLA absent. CAPILLITIUM tubular, elastic, branched
and anastomosed, pale yellow by transmitted light, mostly 4 um in diam., with
numerous inflations, decorated with many cogs and irregular edges, sometimes
with a faint reticulation. Spores free, pale pink in mass, yellowish pale to
colourless by transmitted light, 7-9.5 um in diam., globose to subglobose,
densely warted, with scattered groups of more prominent warts.
SPECIMEN EXAMINED: CHINA, Yunnan Province, Puer, on the bark surface of a dead
log, 28 August 2011, Zhang Bo1101 (HMJAU10301).
COMMENTS: Arcyodes incarnata, which has been recorded from North America,
Europe, and Africa (Martin & Alexopoulos 1969, Lado 1994), is apparently rare
in Asia. The Yunnan specimen has slightly larger spores than the type specimen
Two myxomycetes new to China... 159
(6-8 um in diam.). However, the Yunnan and type specimen are similar in
habitat on dead logs, a pale pink spore mass, faintly reticulate capillitium, and
pale copper-colored sporocarps.
Acc.V Spot Magn ~ Det) WWDxFkp ¢ Acc:V . Maan Det WD» Exp
a20.0 kV 3.0 “4660x . SE TY 3 a y 2 20.0 kV 3
in
0G NESE, 11:3"1
PLATE 2. Licea retiformis: A, B, fruiting bodies. C, part of peridium. D, spore. Scale bar: A = 1 mm.
Licea retiformis Nawawi, Trans. Br. mycol. Soc. 60(1): 153, 1973. Pu2
FRUCTIFICATIONS plasmodiocarps, gregarious, reticulation 0.6-3 mm in
extension, pale yellowish brown, fading to pale brown. PLASMODIOCARPS
90-100 um in diameter, appearing smooth on the surface. HYPOTHALLUS
inconspicuous. PERIDIUM single, membranous, firm, translucent. DEHISCENCE
by longitudinal slit, decorated with loose small mesh. COLUMELLA absent.
CAPILLITIUM absent. Spores free, pale ochraceous in mass, yellowish pale
to colourless by transmitted light, subglobose to ovate, 9-11 x 8.5-12.5 um,
densely warted.
SPECIMENS EXAMINED: CHINA, Fujian Province, Fuzhou, on the bark surface of a dead
log, 9 July 2010, Li Ming0031 (HMJAU10302); Li Ming0042 (HMJAU10303).
ComMENTs: This is the only Licea species with reticulate plasmodiocarps. Licea
retiformis, which has been reported from Japan (Yamamoto 1998), Malaysia
(Nawawi 1973), and Taiwan (Liu el at. 2002), is here newly recorded from
mainland China. The two Fujian specimens have slightly shorter spores than
the type specimen (9.3-13.5x8.5-12.5 um, Nawawi 1973).
160 ... Zhang & Li
Acknowledgments
We thank Professors. Guozhong Lii and A.J.S. Whalley for their valuable revisions
and kind help. This study was supported by funds from the Ministry of Agriculture of
China.
Literature cited
Chou ZH. 1937. Notes on myxomycetes from China. Bull. Fan. Men. Inst. Biol. 7: 257-278.
Cook OF. 1902. Types and synonyms. Science 15: 646-656.
http://dx.doi.org/10.1126/science.15.382.646
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi.
10th ed. CAB International, Wallingford. 771 p.
Lado C. 1994. A checklist of myxomycetes of the Mediterranean countries. Mycotaxon 52(1):
117-185.
Lado C. 2001. Nomenmyx: a nomenclatural taxa base of myxomycetes. Cuadernos de Trabajo de
Flora Micoldgica Ibérica 16. 224 p.
Lado C. 2012-14. An online nomenclatural information system of Eumycetozoa.
http://www.nomen.eumycetozoa.com
Li Y. 2005. Liceales in China. Chinese Science Press. 126 p.
Li Y, Li HZ. 1989. Myxomycetes from China I: A checklist of myxomycetes from China. Mycotaxon
35(2): 429-436.
Li Y, Li HZ. 1994. Myxomycetes from China XII: A new species of Licea. Mycosystema 7:
133-135.
Li Y, Li HZ. 1995. Myxomycetes from China III: Description of a new species, Cribraria media, and
discussion of the relationship between Creibraria and Dictydium. Mycotaxon 53: 69-80.
Li Y, Chen SL, Li HZ. 1993. Myxomycetes from China X: Additions and notes to Trichiaceae from
China. Mycosystema 6: 107-112.
Liu CH, Chen YF, Chang JH, Yang FH. 2002. Myxomycetes of Taiwan. Three new records. Taiwania
47(3): 179-185.
Martin GM, Alexopoulos CJ. 1969. The myxomycetes. University of Iowa Press. Iowa. 561 p.
http://dx.doi.org/10.2307/1218569
Nawawi A. 1973. New species of Licea from Malaysia. Tans. Br. Myc. Soc. 60: 153-155.
http://dx.doi.org/10.1016/S0007-1536(73)80072-5
Robbrecht E. 1974. The genus Arcyria Wiggers in Belgium. Bull. Jard. Bot. Nat. Belg. 44: 303-353.
http://dx.doi.org/10.2307/3667676
Royal Botanic Garden, Edinburgh. 1969. Flora of British Fungi: colour identification chart.
Edinburgh, H.M. Stationery Office. 6 p.
Yamamota Y. 1998. The Myxomycetes biota of Japan. Toyo Shorin Publishing Co., Ltd., Tokyo,
Japan. 700 p.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.161
Volume 122, pp. 161-169 October-December 2012
Tuber microverrucosum and T. huizeanum —
two new species from China with reticulate ascospores
Li FAN’, CHENG-LIN Hou & Yu Lr?
" College of Life Science, Capital Normal University,
Xisanhuanbeilu 105, Haidian, Beijing 100048, China
? Institute of Mycology, Jilin Agricultural University, Changchun 130118, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Two new species of Tuber are described and illustrated. Tuber microverrucosum
is recognized by its brown verrucose ascomata, blackish gleba, and broadly ellipsoid to
subglobose ascospores with a large-meshed regular reticulum. Tuber huizeanum is diagnosed
by its brown glabrous ascomata, brown gleba, and broadly ellipsoid ascospores with a regular
reticulum. Molecular phylogenetic analysis supports the erection of the two new species.
Key worps — Ascomycota, truffle, taxonomy
Introduction
Truffles are abundant in some regions of China (Garcia-Montero et al. 2010,
Wang & Liu 2011, Chen et al. 2011a,b) from which more than 20 species have
been described during the 25 years since Liu described Tuber taiyuanense
B. Liu in 1985 (Liu 1985; Wang 1988; Wang & Li 1991; Wang et al. 1998; Wang
& He 2002; Tao et al. 1989; Chen et al. 2005; Chen & Liu 2007). Of these more
than half are considered valid species (Cao 2010). That there are likely more
new species awaiting discovery in China is confirmed by our ongoing research
(Fan et al. 2011, 2012a,b). We describe and illustrate here two additional new
species from Yunnan.
Materials & methods
Morphological studies
Truffles were collected from Huize County and a mushroom market in Kunming,
Yunnan Province. Macroscopic characters were described from fresh specimens.
Microscopic characters were described from razor-blade sections of fresh specimens
162 ... Fan, Hou & Li
TABLE 1. Tuber specimens used in molecular studies
VOUCHER CounTRY OF REFERENCE ITS
SPECIES NAME
SPECIMEN ORIGIN
T. borchii Vittad. GB62 Italy Bonito et al. 2010 HM485342
GB45 Italy Bonito et al. 2010 HM485344
T. canaliculatum Gilkey JT23942 USA From GenBank GQ221456
(unpublished)
OSC59072 USA Bonito et al. 2010 HM485347
T. foetidum Vittad. ZB-2489 Hungary Halasz et al. 2005 AJ557544
ZB3454 Finland Orczan et al. 2010 FN568055
T. gardneri Gilkey TK1779 USA From GenBank AY558808
(unpublished)
T. huizeanum BJTC FAN144 China This paper JN870100
BJTC FAN186 China This paper JQ910651
T. linsdalei Gilkey L63 USA Bonito et al. 2010 HM485370
T. liui AS. Xu HKAS 48269 China Chen & Liu 2007 DQ898182
T. maculatum Vittad. FHS-390 Serbia Marjanovic et al. FM205649
2010
K(M) 17936 — Brock et al. 2009 EU784428
T. microverrucosum BJTC FAN142 China This paper JN870099
T. puberulum TL11885 Denmark Tedersoo et al. 2006 AJ969626
Berk. & Broome
BI-32 Hungary Halasz et al. 2005 AJ557537
T. separans Gilkey ZB-32 Hungary Halasz et al. 2005 HM485388
JT32463 Mexico From GenBank GQ221448
(unpublished)
T. scruposum R. Hesse CMI-UNIBO Armenia From GenBank DQ011846
2192 (unpublished)
CMI-UNIBO Armenia From GenBank DQ011845
2201 (unpublished)
T. zhongdianense X.Y. HKAS 45388B China Chen & Liu 2007 DQ898186
He et al.
Wang0299 China Chen & Liu 2007 DQ898187
T. melanosporum Vittad. A59 France From GenBank AF106878
(unpublished)
— — Roux et al. 1999 AF132501
mounted in 3% KOH, Melzer’s reagent, or 0.1% (w/v) cotton blue in lactic acid. The
specimens are deposited in BJTC (Biology Department Herbarium, Capital Normal
University). For scanning electron microscopy (SEM), spores were scraped from the
dried gleba, placed onto doubled-sided tape, mounted directly on an SEM stub, coated
with gold-palladium, and then examined and photographed with a HITACHI S-4800
SEM.
Tuber spp. nov. (China) ... 163
Molecular methods
Herbarium samples were crushed by shaking for 3 min at 30 Hz (Mixer Mill MM
301, Retsch, Haan, Germany) ina 1.5 ml tube together with one 3 mm diameter tungsten
carbide ball. Total genomic DNA was then extracted using the PeqLabE.Z.N.A._ Fungal
DNA kit following the manufacturer's protocol. The ITS region was amplified with
PCR using the primers ITS1/ITS4 (White et al. 1990). PCR was performed in 50 ul
reactions containing DNA template 2 ul, primer (10UM) 2 ul each, 2 x Master Mix
(Tiangen Biotech (Beijing) Co. Ltd.) 25 ul. PCR reactions were run as follows: an initial
denaturation at 95°C for 3 min, followed by 30 cycles at 95°C for 2 min, 55°C for 25 s,
72°C for 2 min, and a final extension at 72°C for 10 min. The PCR products were sent
to Invitrogen Biotechnology Co. Ltd. (Beijing, China) for purifying, sequencing, and
editing. The other sequence data of ITS rDNA included in this study were downloaded
from GenBank. GenBank numbers are shown in TABLE 1.
Phylogenetic analyses
DNA sequences were aligned with Clustal X (Thompson et al. 1997) and manually
adjusted with Se-Al v.2.03a (Rambaut 2000). The aligned dataset was analyzed with
maximum parsimony (MP) using PAUP*4.0b10 (Swofford 2002). MP analysis was
conducted using heuristic searches with 1000 replicates of random-addition sequence,
tree bisection reconnection (TBR) branch swapping algorithm. All characters were
equally weighted and unordered. Gaps were treated as missing data to minimize
homology assumptions. A bootstrap (BS) analysis was performed with 1000 replicates,
each with 10 random taxon addition sequences. TBR branch swapping was employed.
The Bayesian analysis was performed with MrBayes 3.1.2 (Huelsenbeck et al. 2001;
Ronquist & Huelsenbeck 2003) with two sets of four chains (one cold and three heated)
and the stoprule option in effect, halting the analyses at an average standard deviation
of split frequencies of 0.01. The sample frequency was set to 100, and the first 25% trees
were removed as burn-in. Bayesian posterior probabilities (PP) were obtained from the
50% majority rule consensus of the remaining trees. Two sequences derived from Tuber
melanosporum (AF132501, AF106878) were used as outgroups.
Results
Molecular phylogenetics
343 of 634 characters were found to be parsimony-informative. Maximum
parsimony analysis produced one most parsimonious tree (FiG.1) with a length
(TL) of 907 steps, consistency index (CI) of 0.7310, retention index (RI) of
0.8501, and rescaled consistency index (RCI) of 0.6214 (for all sites).
ITS sequence-based phylogenies (Fic. 1) group the new Tuber
microverrucosum in a clade with T! foetidum with moderate support (BS = 74,
PP = 0.99). The two T. huizeanum sequences grouped in a clade with strong
support (BS = 99, PP = 1.00) and were sister (but with very low support) to
T. zhongdianense.
164 ... Fan, Hou & Li
+00 Tuber puberulum AJ969626
400 Tuber puberulum AJ557537
a8 1 |, Tuber borchii HM485344
1S) 4 8871 Tuber borchii HM485342
Tuber separans HM485388
ee Tuber separans GQ221448
7-| 99) Tuber huizeanum JQ910651
Tuber huizeanum JN870100
89 | 400 Tuber zhongdianense DQ898187
0.95-¥! 4%
gel Tuber zhongdianense DQ898186
Wee Tuber liui DQ898182
400 Tuber latisporum DQ898185
99 1! Tuber latisporum DQ898183
oN Tuber foetidum AJ557544
ooas| | Tuber foetidum FN568055
Tuber microverrucosum JQ870099
99 EN Tuber maculatum FM205649
Tuber maculatum EU784428
Tuber gardneri AY558808
aS +00 Tuber scruposum DQ011846
99 1 | Tuber scruposum DQ011845
Tuber linsdalei HM485370
400 Tuber canaliculatum HM485347
1 | Tuber canaliculatum GQ221456
Tuber melanosporum AF132501
Hated melanosporum AF 106878
Fic. 1. Phylogeny derived from maximum parsimony analysis of the ITS rDNA sequences of some
Tuber species with reticulate ornamentations on the ascospore surface, using T: melanosporum as
outgroups. Bootstrap values of more than 70% (BP = 70) from 1000 replications are shown above
the respective branches. Bayesian posterior probabilities (PP) were estimated and clades with PP >
0.95 (95%) are marked under the branches.
Tuber spp. nov. (China) ... 165
Taxonomy
Tuber microverrucosum L. Fan & C.L. Hou, sp. nov. Fig. 2 a-d
MycoBank MB 563657
Differs from other Tuber species with reticulate ascospores by its brown verrucose
ascomata, blackish gleba, and broadly ellipsoid ascospores.
Type: China. Yunnan Province, Kunming, from the Kunming mushroom market. 20
Jan. 2011, Jin-Zhong Cao 105 (Holotype, BJTC FAN142).
ETYMOLOGY: microverrucosum (Lat.), referring to the minute verrucose surface of the
ascomata.
AscomMa globose or irregular subglobose, 2.2 cm in diam., light brown to brown
when fresh, the surface glabrous and distinctly minute verrucose, the places
without verrucose show gray-brown or pale gray. Odor slight when young
and middle pungent after maturity. PERrpIuM 250-400 um thick including
the verrucose, two layers; outer layer pseudoparenchymatous, composed
of subglobose and angular cells (7.5-)10-20(-25) um in diam, with slightly
thickened walls, yellowish-brown towards the surface; inner layer texture
intricate, the hyphae hyaline and thin walled, 5-7.5 um in diam. GLEBA white
at first, then brown to dark brown and blackish at maturity, marbled with larger
and rare pale white veins which originate from all of the peridium. Ascr ovate
or subglobose, sessile, 75-100 x 50-75 um, (1-)2-4(-6)-spored. ASCOSPORES
broadly ellipsoid to subglobose, a few globose, at first hyaline, becoming brown
to dark brown at maturity, thick-walled 2.5-3 um, surface ornamented with
regular reticulum, 4-6(-7.5) um high, 25-32.5 x 20-27.5 um, Q = 1.10-1.25,
in 2-6-spored asci, and 37.5-42.5 x 27.5-32.5 um, Q = 1.30-1.36, in 1-spored
asci, excluding the ornamentation, the meshes large and variable in size, usually
3-4 meshes across the width.
ComMENTs — Tuber microverrucosum is distinguished by its brown ascomata
with minutely distinct verrucose surface, blackish gleba, and broad ellipsoid to
subglobose ascospores covered with regular deep reticulum.
Two European species, Tuber foetidum and T: scruposum, are similar to the
new species. Tuber foetidum differs in having a smooth or indistinctly verrucose
peridium, a pale brown gleba and yellow-brown ascospores (Pegler 1993),
whereas T. scruposum has a distinct verrucose peridium, and narrow elliptical
ascospores (Lange 1956).
Several North American species that also have verrucose ascomata and
reticulate ascospores include T: canaliculatum, T. linsdalei, T: longisporum
Gilkey, and T’ gardneri. Tuber canaliculatum differs in large (>50 um long)
ascospores (Gilkey 1954), while T: linsdalei has subglobose ascospores and a
reticulum with numerous small meshes (“alveoli small and numerous’; Gilkey
166 ... Fan, Hou & Li
1954). Long ellipsoid ascospores distinguish Tuber longisporum and T. gardneri
from T: microverrucosum.
ITS sequence analyses (Fic. 1) support erection of T: microverrucosum. Tuber
microverrucosum and T. foetidum grouped in the same clade with moderate
support value (BS = 74, PP = 0.99), indicating that they are closely related but
morphologically quite distinct.
Tuber huizeanum L. Fan & Yu Li, sp. nov. FIG. 2 e-i
MycoBank MB 563658
Differs from other Tuber species by its brown glabrous ascomata, brown colored gleba,
and very broadly ellipsoid ascospores with a regular reticulum.
Type: China. Yunnan Province, Huize County, in soil under conifers, 28 Dec. 2011, Jin-
Zhong Cao 513 (Holotype, BJTC FAN186).
EryMo_oey: huizeanum (Lat.), referring to the type locality of the new species.
ASCOMATA 1.5-2.0 cm, subglobose, solid, surface smooth, glabrous, sometimes
with a few furrows, white to yellow-white at first, light brown to brown at
maturity. Odor slight, not pungent. PERrpIum 350-400 um thick, two layers;
outer layer 100-150 um, pseudoparenchymatous, composed of subangular
or subglobose cells mostly 10-25(55) um, with slightly thickened and light
yellowish walls, hypha-like hairs absent from the outermost cells; inner layer
composed of intricately interwoven hyphae, hyaline, thin-walls, branch, septate,
2.5-5 um, intermixed with a few of hyphae up to 10 um in diam. GLEBA brown
at maturity, marbled with large and rare, branch white veins coming from
the peridium. Asc1 subglobose, ellipsoid or irregular, hyaline, slightly thick-
walled, 80-115 x 75-100 um, sessile, 1-4-spored. Ascospores subglobose to
very broad ellipsoid, a few of globose, light brown to yellow-brown at maturity,
27.5-42.5 x 25-40 um, Q = 1.06-1.15, in 2-4-spored asci, and 50-55 x 42.5-45
um, Q = 1.10-1.25, in 1-spored asci, excluding ornamentation; ornamentation
regularly alveolate reticulum, 3-5 um high, the meshes generally 4-8(10) across
the spore width.
ADDITIONAL MATERIAL EXAMINED: CHINA. YUNNAN PROVINCE, Kunming, from the
Kunming mushroom market. 20 Jan. 2011, Jin-Zhong Cao 107 (BJTC FAN144).
ComMENTS — Three species from China are similar to the new species. Tuber
zhongdianense has similarly colored ascomata and shaped ascospores as
T. huizeanum. However, T. zhongdianense ascomata are obviously puberulent
with two types of hairs and the ascospore reticulum is only 2.5 um high (He
et al. 2004). These two characters clearly distinguish the two species. Tuber
liui differs by its large (38-71 x 27-40 um) and ellipsoid to long ellipsoid
ascospores (Xu 1999) and a peridium with hypha-like hairs. Tuber latisporum
is differentiated by its white ascomata, blackish gleba, red brown ascospores,
and a peridium covered with hypha-like hairs.
Tuber spp. nov. (China) ... 167
Fic. 2. Tuber microverrucosum (BJTC FAN142, holotype): a. Ascoma; b-c. Asci and ascospores
observed under light microscope; d. Ascospore observed under SEM. Tuber huizeanum (BJTC
FAN186, holotype): e-f. Ascoma; g-h. Asci and ascospores observed under light microscope;
i. Ascospore observed under SEM.
168 ... Fan, Hou & Li
The similar European T’ puberulum can be separated by its ascomata with
abundant surface hairs and globose ascospores. Tuber borchii has similar
ascospores but differs by its dark chocolate brown mature gleba and puberulent
peridium. The North American T! separans is distinguished by its inconspicuous
glebal veins (Gilkey 1954).
Phylogenetic analyses (Fic. 1) support the erection of T’ huizeanum. The
morphologically similar T! huizeanum and T. zhongdianense form a sister
relationship in the phylogeny but with low support (Fic. 1).
Acknowledgments
We are grateful to Prof. Zhu-Liang Yang (Kunming Institute of Botany of the Chinese
Academy of Sciences) and Dr. Ian R. Hall (Truffles and Mushrooms (Consulting) Ltd,
New Zealand) for reviewing the pre-submitted manuscript. The study was supported by
the National Natural Science Foundation of China (Nos. 30770005 and 30870008), and
the Beijing Natural Science Foundation (No. 5122003).
Literature cited
Bonito GM, Gryganskyi AP, Trappe JM, Vilgalys R. 2010. A global meta-analysis of Tuber ITS
rDNA sequences: species diversity, host associations and long-distance dispersal. Molecular
Ecology 19: 4994-5008. http://dx.doi.org/10.1111/j. 1365-294X
Brock PM, Doring H, Bidartondo MI. 2009. How to know unknown fungi: the role of a herbarium.
New Phytol. 181: 719-724. http://dx.doi.org/10.1111/j.1469-8137.2008.02703.x
Cao JZ. 2010. The genus Tuber in China [Dissertation]. Changchun: Jinlin Agricultural University.
86 p.
Chen J, Liu PG. 2007. Tuber latisporum sp. nov. and related taxa, based on morphology and DNA
sequence data. Mycologia 99: 475-481. http://dx.doi.org/10.3852/mycologia.99.3.475
Chen J, Liu PG, Wang Y. 2005. Tuber umbilicatum, a new species from China, with a key to the
spinose-reticulate spored Tuber species. Mycotaxon 94: 1-6.
Chen J, Guo SX, Liu PG. 2011a. Species recognition and cryptic species in the Tuber indicum
complex. PLoS ONE 6(1): e14625. http://dx.doi.org/10.1371/journal.pone.0014625
Chen J, Deng XJ, Chen JY, Qiao P, Zhang JP, Wan S, Wang R, Liu PG. 2011b. A checklist of the
genus Tuber (Pezizales, Ascomycota) in China. Journal of Fungal Research 9: 243-254.
Fan L, Cao JZ, Liu YY, Li Y. 2011. Two new species of the genus Tuber from China. Mycotaxon 116:
349-354. http://dx.doi.org/10.5248/116.349
Fan L, Hou CL, Cao JZ. 2012a [“2011”]. Tuber sinoalbidum and T. polyspermum — new species
from China. Mycotaxon 118: 403-410. http://dx.doi.org/10.5248/118.403
Fan L, Cao JZ, Zheng ZH, Li Y. 2012b. Tuber in China: T: microspermum and T. microspiculatum
spp. nov. Mycotaxon 119: 391-395. http://dx.doi.org/10.5248/119.xxx
Garcia-Montero LG, D1‘az P, Di Massimo G, Garcia-Abril A. 2010. A review of research on Chinese
Tuber species. Mycological Progress 9: 315-335. http://dx.doi.org/10.1007/s11557-009-0647-8
Gilkey HM. 1954. Taxonomic notes on Tuberales. Mycologia 46: 783-793.
Halasz K, Bratek Z, Szego D, Rudnoy S, Racz I, Lasztity D, Trappe JM. 2005. Tests of species
concepts of the small, white, European group of Tuber spp. based on morphology and
rDNA ITS sequences with special reference to Tuber rapaeodorum. Mycol. Prog. 4: 281-290.
http://dx.doi.org/10.1007/s11557-006-0132-6
He XY, Li HM, Wang Y. 2004. Tuber zhongdianense sp.nov. from China. Mycotaxon 90:213-216.
Tuber spp. nov. (China) ... 169
Huelsenbeck JP, Ronquist F, Nielsen R. Bollback JP. 2001. Bayesian inference of phylogeny and its
impact on evolutionary biology. Science 294: 2310-2314.
http://dx.doi.org/10.1126/science.1065889
Lange M. 1956. Danish hypogeous fungi. Dansk Bot. Arkiv. 16: 1-48.
Liu B. 1985. New species and new records of hypogeous fungi from China (I). Acta Mycologica
Sinica 4(2): 84-89.
Marjanovié Z, Grebenc T, Markovic M, Glisi¢é A, Milenkovié M. 2010. Ecological specificity and
molecular diversity of truffles (genus Tuber) originating from mid-west of the Balkan Peninsula.
Sydowia 62: 67-87.
Orczan KA, Turunen O, Merenyi Z, Rudnoy S, Bratek Z, Shamekh S. 2010. Tuber foetidum found
in Finland. Mycotaxon 114: 127-133. http://dx.doi.org/10.5248/114.127
Pegler DN, Spooner BM, Young IWK. 1993. British truffles: a revision of British hypogeous fungi.
UK: Royal Botanic Gardens, Kew, p1-216.
Rambaut A. 2000. Estimating the rate of molecular evolution: incorporating non-contemporaneous
sequences into maximum likelihood phylogenies. Bioinformatics 16: 395-399. http://dx.doi.
org/10.1093/bioinformatics/16.4.395
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models, Bioinformatics 19:1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Roux C, Sejalon-Delmas N, Martins M, Parguey-Leduc A, Dargent R. Becard G. 1999. Phylogenetic
relationships between European and Chinese truffles based on parsimony and distance analysis
of ITS sequences. FEMS Microbiol. Lett. 180: 147-55.
http://dx.doi.org/10.1111/j.1574-6968.1999.tb08789.x
Swofford DL. 2002. PAUP”, phylogenetic analysis using parsimony. (*and other methods), version
4. Sunderland, MA, USA, Sinauer Associates.
Tao K, Liu B, Zhang DC. 1989. A new species of the genus Tuber from China. Journal of Shanxi
University (Nat. Sci. Ed.) 12: 215-218.
Tedersoo L, Hansen K, Perry BA, Kjoller R. 2006. Molecular and morphological diversity of
pezizalean ectomycorrhiza. New Phytol. 170: 581-596.
http://dx.doi.org/10.1111/j.1469-8137.2006.01678.x
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTALX windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
Wang Y. 1988. First report of study on Tuber species from China. Atti del II Congresso Internazionale
sul Tartufo, Spoleto, Nov. 24-27: 45-50.
Wang Y, He XY. 2002. Tuber huidongense sp. nov. from China. Mycotaxon 83: 191-194.
Wang Y, Li ZP. 1991. A new species of Tuber from China. Acta Mycologica Sinica 10: 263-265.
Wang Y, Liu PG. 2011. Verification of Chinese names of truffles and their conservation in natural
habitats. Plant Diversity and Resources 33: 625 -642.
Wang Y, Moreno G, Riousset LJ, Manjon JL, Riousset G, Fourre G, Di Massimo G, Garcia- Montero
LG, Diez J. 1998. Tuber pseudoexcavatum sp. nov. A new species from China commercialised
in Spain, France and Italy with additional comments on Chinese truffles. Cryptogamie Mycol.
19-113—-120.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a Guide to
Methods and Applications. Academic Press, San Diego.
Xu AS. 1999. A taxonomic study of the genus Tuber in Xizang. Mycosystema 18: 361-365.
Zhang LF, Yang ZL, Song DS. 2005. A phylogenetic study of commercial Chinese truffles and their
allies: taxonomic implications. FEMS Microbiol. Lett. 245: 85-92.
http://dx.doi.org/10.1016/j.femsle.2005.02.028
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.171
Volume 122, pp. 171-175 October-December 2012
Three new species of Humicola
from the Qinghai-Tibet Plateau Area, China
YUE-MING Wu & TIAN-YU ZHANG
Department of Plant Pathology, Shandong Agricultural University, Taian, 271018, China
Key Laboratory of Agricultural Microbiology, Shandong Province, Taian, 271018, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Three new species from soil in China, Humicola chlamydospora, H. tuberculata,
and H. verruculosa, are described and illustrated. The type specimens (dried cultures) and
living cultures are deposited in the Herbarium of Shandong Agricultural University, Plant
Pathology (HSAUP). Isotypes are kept in the Herbarium of Institute of Microbiology,
Academia Sinica (HMAS).
KEY worps — dematiaceous hyphomycetes, soil fungi, taxonomy
Introduction
During a survey of dematiaceous soil hyphomycetes in China, several unusual
species of Humicola were collected, of which three are described and illustrated
here as new. Humicola, a genus established by Traaen (1914), is characterized
by possession of micronematous or semi-macronematous conidiophores that
are cylindric or slightly inflated. The conidiogenous cells swell apically to
form globose to ovoid aleuriospores. Of the 66 taxa listed by Index Fungorum
(2012), many are infraspecific, and Seifert et al. (2011) estimate that the genus
may contain only 20 valid species.
Cultures were examined after 7 days growth on potato dextrose agar (PDA)
(De Bertoldi 1976).
Humicola chlamydospora Y.M. Wu & T.Y. Zhang, sp. nov. FIG. 1
MycoBank MB 563897
Differs from Humicola alopallonella by its multinucleate conidia and from H. nivea by
its smaller and smooth conidia.
Type: China, Tibet: Xigaze, from mountain soil, altitude 2300 m, 14 Sept. 2007, Y.M. Wu
(Holotype HSAUP II 1337; isotype HMAS 196265).
Erymo oey: The epithet refers to the chlamydospores of this species.
172 ... Wu & Zhang
Fic. 1. Humicola chlamydospora (ex holotype).
Conidia, conidiophores, conidiogenous cells and intercalary chlamydospores. Scale bars = 25 um.
CoLonligs on PDA at 26°C for 7 days 5-7 cm diam., effuse, velvety, brown to
dark brown. Mycelium superficial or immersed; hyphae branched, septate,
smooth, subhyaline to light brown, 3-4 um wide. ConrDIOPHORES subhyaline
to light brown, mononematous, micronematous, septate, smooth, 5-7 um wide.
Conipia solitary, globose, smooth, golden yellow, thick-walled, (16—)18(-20)
um diam., containing 8-10 oil droplets. Chlamydospores globose, intercalary.
Phialospores not seen.
ComMENTs — Morphologically, H. chlamydospora resembles H. alopallonella
Meyers & R.T. Moore (Meyers & Moore 1960) and H. nivea De Bert. (De
Bertoldi 1976). The new species differs from H. alopallonella in having many
oil droplets in the conidia and from H. nivea, which has rough walled, smaller
conidia (8.9-9.4 um diam.).
Humicola spp. nov. (Qinhai-Tibet Plateau ... 173
a Sn)
Fe |
AER X
<U.6. GE
NGAYS 5,
%.
Ss
by SAE?
Ninn eg
S
Fic. 2. Humicola tuberculata (ex holotype).
Conidia, conidiophores and conidiogenous cells. Scale bars = 25 um.
Humicola tuberculata Y.M. Wu & T.Y. Zhang, sp. nov. FIG. 2
MycoBank MB 563888
Differs from Humicola nivea and H. rugosa by its tuberculate conidia with only a single
nucleus.
Tye: China, Tibet: Shannan, from grassland soil, altitude 3500 m, 9 June 2007, Y.M. Wu
(Holotype HSAUP II 0509; isotype HMAS 196266).
Erymo.ocy: The epithet refers to the tuberculate conidia of this species.
Co.tontgs on PDA at 26°C for 7 days 4-5 cm diam., effuse, velvety, greyish
brown to dark brown. Mycelium superficial or immersed; hyphae branched,
septate, smooth, subhyaline to light brown, 1-2 um wide. CONIDIOPHORES
subhyaline, mononematous, micronematous, septate, smooth, 1-2 um wide.
Conlipli< solitary, globose, tuberculate, golden-yellow, thin-walled, (6-)8(-9)
um diam. Phialospores not seen.
ComMENTS — Humicola tuberculata resembles H. nivea and H. rugosa De Bert.
(De Bertoldi 1976) in conidial size but differs from these two species in its
tuberculate conidia lacking oil droplets.
174 ... Wu & Zhang
Fic. 3. Humicola verruculosa (ex holotype).
Conidia, conidiophores and conidiogenous cells. Scale bars = 25 um.
Humicola verruculosa Y.M. Wu & T.Y. Zhang, sp. nov. FIG. 3
MycoBank MB 563893
Differs from Humicola dimorphospora and H. piriformis by its larger, ellipsoidal and
verrucose conidia.
Type: China, Tibet: Xigaze, from a mountain soil, altitude 2300 m, 14 Sept. 2007, Y.M.
Wu (Holotype HSAUP II 1332; isotype HMAS 196264).
Erymo.oey: The epithet refers to the verruculose conidia.
CoLonigs on PDA at 26°C for 7 days 4-5 cm diam., effuse, velvety, brown to
dark brown. Mycelium superficial or immersed: hyphae branched, septate,
smooth, subhyaline to light brown, 3-5 um wide. ConrpiopHorgs reduced
to conidiogenous cells on side of hyphae, mononematous, micronematous,
subhyaline to light brown, smooth, 4-7 um wide. Conrp1a solitary, ellipsoidal
or ovoid, with a scar at the base, produced singly on the sides of hyphae or
on short lateral conidiophores, verruculose, pale yellowish brown to yellowish
brown, 8-12 x 5-8 um. Chlamydospores globose, intercalary. Phialospores not
seen.
Humicola spp. nov. (Qinhai-Tibet Plateau ... 175
ComMENTs — Morphologically, H. verruculosa is similar to H. dimorphospora
Roxon & S.C. Jong (Roxon & Jong 1974) and H. piriformis De Bert. (De Bertoldi
1976), but its conidia are larger than those of H. dimorphospora (3-5 um
diam.) and H. piriformis (7-7.2 x 7.1-7.5 um). Our new species is additionally
distinguished from those two species by its ellipsoidal conidia with verrucose
conidial wall.
Acknowledgments
The authors are grateful for pre-submission comments and suggestions provided
by Dr Eric McKenzie and Prof. Y.L. Guo. This project was supported by the National
Science Foundation of China (no. 30970011 & 30499340).
Literature cited
De Bertoldi M. 1976. New species of Humicola: an approach to genetic and biochemical
classification. Can. J. Bot. 54: 2755-2768.
Index Fungorum. 2012. http://www.indexfungorum.org/Names/Names.asp; accessed 22 Mar.
2012.
Meyers SP, Moore RT. 1960. Thalassiomycetes II. New genera and species of deuteromycetes. Amer.
J. Bot. 47: 345-349.
Roxon JE, Jong SC. 1974. A new pleomorphic species of Humicola from Saskatchewan soil. Can.
J. Bot. 52: 517-520.
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series. CBS-KNAW Fungal Biodiversity Centre, Utrecht, Netherlands. 997 p.
Traaen EA. 1914. Untersuchungen tiber die Bodenpilze aus Norwegen. Nyt. Mag. Naturvid. 32:
20-121. http://dx.doi.org/10.1016/S0007-1536(61)80031-4
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.177
Volume 122, pp. 177-185 October-December 2012
A new species of Calonectria causing leaf disease
of water lily in China
JUN-JIE Xu', SHAO- YUAN QIN’, YUAN-YUAN HAO, JUN REN?, PING TAN’,
Att H. BAHKALI‘, KEVIN D. HypDE>4+ & YONG WANG”?
‘College of Life Sciences, Linyi University, Linyi, 276005, China
*Department of Plant Pathology, College of Agriculture, Guizhou University,
Guiyang 550025, China
°Kenli County Agricultural Technology Extension and Service Center, Dongying, 257500, China
‘King Saud University, College of Science, Botany and Microbiology Department,
PO. Box 2455, Riyadh 1145, Saudi Arabia
“Institute of Excellence in Fungal Research, School of Science, Mae Fah Luang University, Chiang
Rai, Thailand
*CORRESPONDENCE TO:
[email protected]
AsBsTRACT — A species of Calonectria, isolated from a leaf spot of water lily (Nymphaea
tetragona) in Guiyang, Guizhou Province, China was shown to be pathogenic by applying
Koch’s postulates. Identification based on morphological characters and a comparison of
sequences from beta-tubulin and translation elongation factor 1 alpha (TEF1) genes supported
its status as a new species. Calonectria nymphaeae sp. nov. is introduced and compared with
similar taxa.
Key worps — ITS sequences, taxonomy, hyphomycetes
Introduction
During a survey of hyphomycetes in Guizhou Province, China, various taxa
were isolated from different plant hosts. Two strains isolated from a leaf spot
of water lily had branched conidiophores and a stipe extension terminating
in characteristic vesicles, producing cylindrical, 1-multi-septate conidia;
these morphological characteristics are typical of Cylindrocladium Morgan
(anamorphic Calonectria De Not.) (Crous & Wingfield 1994, Crous 2002).
In culture the strain also produced a Calonectria teleomorph. Recent studies
have largely improved our understanding of the phylogeny and systematics
among Calonectria and allied genera (Lombard et al. 2010a,b,c, Doveri et al.
2010). Lombard et al. (2010c) provided dichotomous and synoptic keys to all
Calonectria species currently recognized.
178 ... Xu & al.
The Calonectria species isolated from Nymphaea tetragona is described
as a new species, C. nymphaeae. It is illustrated with light micrographs and
its uniqueness is confirmed in a phylogram generated from beta-tubulin
and translation elongation factor 1 alpha (TEF1) sequence data, which are
the regions that provide most valuable insights into relationship between all
Calonectria species (Schoch et al. 2000, 2001, Crous 2002, Henricot & Culham
2002). Koch's postulates also confirmed that this new taxon was the causal agent
of leaf disease of water lily.
Materials & methods
Morphological and cultural studies
Diseased leaves of Nymphaea tetragona growing in a pond in Huaxi, Guiyang
city, Guizhou Province, China were collected in clean plastic bags and returned to
the laboratory. Small tissue pieces (each approximately 5 x 5 mm) were cut from the
boundary between healthy and infected parts of leaves, which were previously surface
disinfected with 0.5% NaOCl. The pieces were plated onto malt extract agar (2% w/v;
MEA; Biolab, Midrand, South Africa) and incubated at 25°C for 7 days under continuous
near-UV light. Mycelia grew from the infected samples and were transferred to fresh
MEA plates. Cultural characteristics and morphology were determined on MEA, and
carnation leaf agar (CLA) [1% water agar (10 g/L) with autoclaved carnation leaves
placed onto the medium] (Gams et al. 1998) and incubated for 7 days at 25°C under
continuous near-UV light, to promote sporulation. A water solution of 60% (v/v) lactic
acid without a color dye was used as the mounting medium. Slides were examined under
oil immersion with a UB200i microscope (Chongqing UOP Photoelectric Technology,
China) at 1000x magnification. Dried cultures of this species were deposited in the Plant
Pathology Herbarium of Guizhou University (HGUP). Living cultures were deposited
in HGUP and Centraalbureau voor Schimmelcultures (CBS).
DNA sequencing and alignment
DNA was extracted from mycelium using CTAB method. Three loci including
fragments of the ITS, B-tubulin (BT), and translation elongation factor 1 alpha (TEF1)
gene regions were sequenced. Primers used to sequence these regions were ITS1
and ITS4 (White et al. 1990) for ITS region, Tl (O'Donnell & Cigelnik 1997) and
CYLTUBIR (Crous et al. 2004) for the BT region, and EF1-728F (Carbone & Kohn
1999) and EF2 (O’Donnell et al. 1998) for the TEF1 region. Reaction mixtures contained
5 uL of 10 x ThermoPol reaction buffer [200 mM Tris-HCl, pH 8.3, 100 mM KCl, 100
mM (NH,),SO,, 20 mM MgSO, and 1% Triton X-100], 5 uL of 10 mM MgSO,, 20 ng
template genomic DNA, 4 pM of each primer, 4 uL of 2.5 mM dNTPs, 2.5 U of AmpliTaq
polymerase, and total volume was adjusted to 50 uL with deionized water. The PCR
amplified DNA fragments were fractionated in 1% agarose gels in 0.5 x TBE buffer, and
DNA was visualized by ethidium bromide staining and UV illumination. Sequencing
was performed with an ABI PRISM 3730 DNA autosequencer using either dRhodamine
terminator or Big Dye Terminator chemistry (Applied Biosystems, 850 Lincoln Centre
Drive, Foster City, California). The DNA sequences of isolates HGUP100003 and
Calonectria nymphaeae sp. nov. (China) ... 179
HGUP100004 in ITS, BT and TEF1 regions generated in this study were submitted to
GenBank (JF499828, JN984864, JN984866, JN984865, JX546573 and JX546579). The
ITS sequences comparison with published sequences was performed using a BLAST
search.
Phylogenetic analyses
The combined BT and TeEF1 DNA sequence of HGUP100003 was primarily aligned
with the ClustalX (Thompson et al. 1997). Alignments files are available in TreeBASE
(www.treebase.org/treebase-web/home.html) with study ID 12047. We built up the
phylogenetic tree based on combined BT and TEF1 gene regions using the MP (Maximum
Parsimony) by PAUP* 4.0b10 (Swofford 2002) and Bayesian methods by MrBayes v3.1.1
(Ronquist & Huelsenbeck 2003). A partition homogeneity test (Farris et al. 1994) was
applied to evaluate the feasibility of combining the datasets. In the MP analyses, trees
were inferred using a heuristic search option with tree bisection reconnection (TBR)
branch swapping and 1000 random sequence additions replicates, maxtrees were 100,
branches of zero length were collapsed and all parsimonious trees were saved. Measures
calculated for parsimony included tree length (TL), consistency index (CI), retention
index (RI) and rescaled consistence index (RC). Bootstrap analyses (Hillis & Bull 1993)
were based on 1000 replications.
The model of evolution in Bayesian analysis was TPM2uf+G estimated by jModelTest
0.0.1 (Posada 2008). A Markov Chain Monte Carlo (MCMC) algorithm was used to
generate phylogenetic trees with Bayesian probabilities using MrBayes v3.1.1 for the
BT and TEF1 sequence datasets. Two independent runs of four MCMC chains were run
simultaneously from random trees for 1,010,000 generations and sampled every 100
generations for the combined analysis of the gene partitions. Both runs converged on
the same likelihood score and tree topology, and the first 2500 trees were discarded as
the burn-in phase of each analysis. Posterior probabilities were determined from the
remaining 7600 trees.
Pathogenicity test
Pathogenicity of this fungus was determined by inoculating healthy leaves of
N. tetragona with 5 mm diameter mycelial plugs, cut from the margins of 10-day-
old actively growing cultures; the control was treatment with sterile agar plugs. Both
inoculated and control plants were kept in a moist chamber at 25°C for 4 days, and
observed for symptom development. Infected leaves were collected and the fungus was
reisolated in MEA medium and compared with the original isolate.
Results
Phylogenetic analysis
Our initial BLAST searches identified DNA sequences of isolates
HGUP100003 and HGUP100004 to be most closely related to those of
Calonectria eucalypti. The alignment sequences indicated the ITS sequence
of this fungus was 99.6% identical (only two base pairs difference) to four
sequences (GQ280631, GQ280632, GQ280633, GQ280634) of C. eucalypti with
499-bp characters. Sequence GQ280633 originated from the C. eucalypti ex-
180 ... Xu & al.
C. colombiensis CBS 112221
C. chinensis CBS 112744
C. crousiana CMW 27249
C. crousiana CMW 27249
C. multiseptata CBS 112682
77 99 C. pseudoreteaudii CBS 123694
100 C. reteaudii CBS 112144
92 C. terrae-reginae CBS 112151
C. queensiandica CBS 112146
C. pteridis CBS 111793
C. eucadoriae CBS 111394
97 C. brachiatica CBS 123700
C. brassicae CBS 111869
C. spathulata CBS 112689
89
96
C. colombiana CBS 115638
lll a C. pauciramosa CMW 30823
87 C. zuluensis CMW 9188
C. polizzii CMW 7804
C. cerciana CBS 123639
C. morganii CBS 110666
75 C. insulare CBS 114558
Cc. macroconidialis CBS 114880___
7 €Mw27209
cMmw27213 C. pseudocolhounii
cMmw27214
HGUP100003
i HGUP100004
| cMw27254
C. pseudocolhounii
C. nymphaeae sp. nov
C. nymphaeae sp. nov 82
C. fujianensis
Mw?27257 C. fujianensis
CMWw27263
cMw14890
aan re ~cwwia4aa
cBS29379 i
C. cothounii
C. eucalypti
C. eucalypti
81 CBS114704
10
Fic. 1 One parsimonious tree based on combined sequences of BT (beta-tubulin) and tefl
(translation elongation factor 1 alpha) for Calonectria nymphaeae and 24 other Calonectria species
downloaded from GenBank. C. colombiensis (CBS 112221) and C. chinensis (CBS 112744) serve
as outgroups. The detailed phylogenetic relationships between C. nymphaeae, C. fujianensis,
C. eucalypti, and C. pseudocolhounii are shown in the amplified part of the bottom right corner.
Bootstrap values = 50% are shown above or below branches. Thickened branches indicate Bayesian
PPS 95%.
type strain (CMW 18444); therefore we originally identified our two isolates as
C. eucalypti.
However, C. eucalypti is a species complex and our Calonectria isolates were
revealed as a cryptic species following comparisons of sequences of BT and
TEF1 gene regions. Partition homogeneity tests for combinations of the two
gene regions used, yielded a P-value of 0.001. Based on the tree topologies and a
P-value of 0.001 (Cunningham 1997, Dettman et al. 2003), the two gene regions
were combined. The aligned sequence data matrix contained 27 taxa, including
2 outgroups and 1024 characters. Among them, BT has 515 characters, and
TEF1 has 509 characters. Of these, 294 were parsimony informative. Ten most
parsimonious trees were obtained, one to represent the topology of the strict
consensus tree selected for presentation (Fic. 1). The tree was described as
follows: Tree Length (TL) = 833, CI = 0.6423, RI = 0.8012, HI = 0.3577, and
RC = 0.5146. In this parsimonious tree, 25 species of Calonectria resided in a
strongly supported large monophyletic clade with a bootstrap value of 100%.
Calonectria nymphaeae sp. nov. (China) ... 181
Among them, two isolates of C. nymphaeae clustered together with a 86%
supported value. Calonectria nymphaeae, C. pseudocolhounii, C. eucalypti,
C. colhounii, and C. fujianensis are related species supported by a high bootstrap
value (100%). However, only C. fujianensis showed a closer relationship with
C. nymphaeae with a moderate bootstrap value (62%), and C. nymphaeae and
C. eucalypti are distant.
The topology in Bayesian analysis was nearly identical to that of the MP
analyses. The Bayesian trees are therefore not shown, but the statistically
supported clades (posterior probabilities = 0.95) are marked with a thickened
line in the parsimony tree (Fie. 1).
Taxonomy
Calonectria nymphaeae Yong Wang bis, S.Y. Qin, P. Tan & K.D. Hyde, sp. nov.
MycoBank MB 800112 Fic. 2
Differs from Calonectria pseudocolhounii and C. fujianensis by its slightly larger
macroconidia and its longer, narrower ascospores.
Type: China, Guizhou Province, Guiyang, Huaxi, Huaxi Garden, in a pond, from the
diseased leaves of Nymphaea tetragona Georgi (Nymphaeaceae), dried sporulating
MEA medium cultures, July 2010, S.Y. Qin (Holotype, HGUPd100003; isotype, CBS;
ex-type living cultures—HGUP 100003, CBS 131802; GenBank—JF499828, JN984864,
JX546573).
EryMo_oey: in reference to the host from which the fungus was isolated.
Ascomata solitary or in groups, orange to red, becoming red-brown with
age, perithecial; in section, apex and body yellow to orange, base red-brown,
subglobose to ovoid, 360-450 um high, 320-380 um diam. Peridium rough,
consisting of 2 thick-walled layers; outer layer of textura globulosa, 30-60 um
wide; becoming more compressed towards inner layer of textura angularis,
13-16 um wide; becoming thin-walled and hyaline towards the center, outer
cells 28-35 x 10-18 um; inner cells 10-13 x 5-7 um, ascomata base up to
90-100 um wide, consisting of dark red, angular cells, merging with an erumpent
stroma, cells of the outer wall layer continuing into the pseudoparenchymatous
cells of the erumpent stroma. Asci 4-spored, clavate, 100-145 x 12-16 um,
tapering to a long thin stalk. Ascospores aggregated in the upper third of the
ascus, hyaline, guttulate, fusoid with rounded ends, straight to slightly curved,
2-3-septate, not or slightly constricted at the septa, 51-71 x 5.5-6.5 um (av.
= 66 x 6.0 um). Cultures homothallic. Conidiophores with a stipe bearing a
penicillate suite of fertile branches, stipe extensions, and terminal vesicles. Stipe
septate, hyaline, smooth, 250-300 x 3-4.5 um; stipe extensions septate, straight
to flexuous, 120-240 um long, 3-5 um wide at the apical septum, terminating
in a clavate vesicle, 3-5 um diam. Conidiogenous apparatus 50-100 um long,
and 30-70 um wide; primary branches aseptate or 1-septate, 18-28 x 4-5
182 ... Xu & al.
A
Fic. 2 Calonectria nymphaeae: A-B. cultures on MEA; C. macroconidiophore; D. fertile branches;
E. clavate vesicle; F. macroconidium; G-H. macroconidia stained by cotton blue; I. perithecium; J.
asci; K. ascospore. Scale bars: C-E = 50 um; F-H = 20 um; J-I = 100 um; K = 15 um.
Calonectria nymphaeae sp. nov. (China) ... 183
Fic. 3 A: Naturally occurring symptoms on Nymphaea tetragona caused by Calonectria nymphaeae;
B: Symptoms on N. tetragona leaves by inoculation.
um; secondary branches aseptate, 9-15 x 3-4 um; tertiary branches aseptate,
6-12 x 2.5-3.5 um, each terminal branch producing 2-4 phialides; phialides
doliiform to reniform, hyaline, aseptate, 9-12 x 2.5-3 um; apex with minute
periclinal thickening and inconspicuous collarette. Macroconidia cylindrical,
rounded at both ends, straight, 55-63 x 5.3-6.3 um (av. = 61 x 5.9 um), 3-4-
septate, lacking a visible abscission scar, held in parallel cylindrical clusters by
colourless slime.
ADDITIONAL SPECIMEN EXAMINED: CHINA, GUIZHOU PROVINCE, Guiyang, Huaxi,
in a pond, from diseased leaves of Nymphaea tetragona, August 2011, Y. Wang,
(HGUP100004; GenBank—JF984866, JN984865, JX546579).
ComMENTs: Calonectria nymphaeae is similar to species in the C. colhounii
complex (Chen et al. 2011) that all have yellow ascomata, (1-)3-septate
ascospores, and clavate vesicles in the anamorph state. Calonectria nymphaeae
is morphologically most similar to C. pseudocolhounii S.E. Chen et al. and
C. fujianensis S.E. Chen et al. However, the macroconidia of C. nymphaeae
are slightly larger than those of C. pseudocolhounii (av. 60 x 4.5 um) and
C. fujianensis (av. 52.5 x 4.5 um). The ascospores of C. nymphaeae are longer but
narrower than those of C. pseudocolhounii (av. 56 x 6.5 um) and C. fujianensis
(av. 55.5 x 6.8 um). In addition, C. pseudocolhounii and C. fujianensis were
isolated from terrestrial hosts (Eucalyptus dunnii and E. grandis), while
C. nymphaeae was isolated from a hydrophyte.
Pathogenicity test
Following mycelial inoculation, N. tetragona leaves exhibited dark brown
to black necrotic spots (Fic. 3B) after 4 days, which were very similar to those
of natural infection (Fic. 3A). C. nymphaeae was successfully reisolated from
the artificially inoculated leaves of N. tetragona, thus establishing proof of
pathogenicity. Controls remained healthy and the leaves did not yield any
microorganisms at 4 days.
184 ... Xu & al.
Discussion
The phylogenetic results indicate that ITS sequence data poorly resolves
closely related species of Calonectria, while BT and TEF1 sequence data are more
effective DNA markers for phylogenetic analyses. In our study, morphological
comparison indicated that C. nymphaeae possessed some unique characters that
differ from related species. The phylogenetic analyses based on BT and TEF1
regions confirmed that the two C. nymphaeae isolates clustered together as an
independent branch with creditable bootstrap (86%) and posterior probabilities
values (1.00) (Fic. 1). The clade including C. nymphaeae, C. pseudocolhounii,
C. eucalypti, C. colhounii, and C. fujianensis was supported by high statistical
values (BP 100%, PP 1.00), which is consistent with morphological comparison.
By combining morphology and phylogeny we conclude that C. nymphaeae is a
novel species. Koch's postulates showed the taxon to be the causal agent of the
leaf spot disease of N. tetragona. According to Peerally (1991), Cylindrocladium
hawksworthii Peerally (anamorphic Calonectria hawksworthii L. Lombard
et al.) was the pathogen of a common foliage disease on Nymphaea lotus in
Mauritius. However, C. nymphaeae produces conidia with 3-4 septa, but those
of Cylindrocladium hawksworthii have only 1 septum. The phylogenetic analyses
also proved these two pathogens were not the same species.
Acknowledgments
The authors are grateful for pre-submission comments and suggestions provided
by Drs. E.H.C. McKenzie, J.Z. Zhang and Conrad Schoch. This project was supported
by the Doctors’ Funding of Guizhou University (no. 2010014) the National Science
Foundations of China (no. 31060005 and 31040005). The Global Research Network for
Fungal Biology and King Saud University are also thanked for support.
Literature cited
Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in filamentous
ascomycetes. Mycologia 91: 553-556. http://dx.doi.org/10.2307/3761358
Chen SF, Lombard L, Roux J, Xie YJ, Wingfield, MJ, Zhou XD. 2011. Novel species of Calonectria
associated with Eucalyptus leaf blight in Southeast China. Persoonia 26: 1-12.
http://dx.doi.org/10.3767/003158511X555236
Crous PW. 2002. Taxonomy and pathology of Cylindrocladium (Calonectria) and allied genera. APS
Press, St. Paul, Minnesota, U.S.A.
Crous PW, Wingfield MJ. 1994. A monograph of Cylindrocladium, including anamorphs of
Calonectria. Mycotaxon 51: 341-435.
Crous PW, Groenewald JZ, Risede J-M, Simoneau P, Hywel-Jones NL. 2004. Calonectria species
and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Studies in
Mycology 50: 415-430.
Cunningham CW. 1997. Can three incongruence tests predict when data should be combined?
Molecular Biology and Evolution 14: 733-740.
http://dx.doi.org/10.1093/oxfordjournals.molbev.a025813
Calonectria nymphaeae sp. nov. (China) ... 185
Dettman JR, Jacobson DJ, Taylor JW. 2003. A multilocus genealogical approach to phylogenetic
species recognition in the model eukaryote Neurospora. Evolution 57: 2703-2720.
http://dx.doi.org/10.1554/03-073
Doveri F, Pecchia S, Sarrocco S, Minnocci A, Vannacci G. 2010. Rodentomyces, a new hypocrealean
genus from Italy. Fungal Diversity 42: 57-69. http://dx.doi.org/10.1007/s13225-010-0028-2
Farris JS, Kallersjo M, Kluge AG, Bult C. 1994. Testing significance of incongruence. Cladistics 10:
315-320. http://dx.doi.org/10.1111/j.1096-0031.1994.tb00181.x
Gams W, Hoekstra ES, Aptroot A (eds). 1998. CBS Course of mycology. 4° ed. CBS, Baarn,
Netherlands.
Henricot B, Culham A. 2002. Cylindrocladium buxicola, a new species affecting Buxus spp., and its
phylogenetic status. Mycologia 94: 980-997. http://dx.doi.org/10.2307/3761865
Hillis DM, Bull JJ. 1993. An empirical test of bootstrapping as a method for assessing confidence in
phylogenetic analysis. Systematic Biology 42: 182-192.
http://dx.doi.org/10.1093/sysbio/42.2.182
Lombard L, Crous PW, Wingfield BD, Wingfield MJ. 2010a. Species concepts in Calonectria
(Cylindrocladium). Studies in Mycology 66: 1-14. http://dx.doi.org/10.3114/sim.2010.66.01
Lombard L, Crous PW, Wingfield BD, Wingfield MJ. 2010b. Multigene phylogeny and mating tests
reveal three cryptic species related to Calonectria pauciramosa. Studies in Mycology 66: 15-30.
http://dx.doi.org/10.3114/sim.2010.66.02
Lombard L, Crous PW, Wingfield BD, Wingfield MJ. 2010c. Phylogeny and systematics of the genus
Calonectria. Studies in Mycology 66: 31-69. http://dx.doi.org/10.3114/sim.2010.66.03
O’Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic
lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7:
103-116. http://dx.doi.org/10.1006/mpev.1996.0376
O’Donnell K, Kistler HC, Cigelink E, Ploetz RC. 1998. Multiple evolutionary origins of the fungus
causing Panama disease of banana: concordant evidence from nuclear and mitochondrial
gene genealogies. Proceedings of the National Academy of Science USA 95: 2044-2049.
http://dx.doi.org/10.1073/pnas.95.5.2044
Peerally A. 1991. Cylindrocladium hawksworthii sp. nov., pathogenic on water-lily in Mauritius.
Mycotaxon 40: 367-376.
Posada D. 2008. jModelTest: phylogenetic model averaging. Molecular Biology and Evolution 25:
1253-1256. http://dx.doi.org/10.1093/molbev/msn083
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Schoch CL, Crous PW, Wingfield MJ, Wingfield BD. 2000. Phylogeny of Calonectria and selected
hypocrealean genera with cylindrical macroconidia. Studies in Mycology 45: 45-62.
Schoch CL, Crous PW, Wingfield BD, Wingfield MJ. 2001. Phylogeny of Calonectria based
on comparisons of $-tubulin DNA sequences. Mycological Research 105: 1045-1052.
http://dx.doi.org/10.1016/S0953-7562(08)61966-8
Swofford DL. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version
4.0b10. Sunderland, Massachusetts: Sinauer Associates.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The Clustal X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
White TJ, Bruns T, Lee S, Taylor J, 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. New York: Academic Press, U.S.A.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.187
Volume 122, pp. 187-195 October-December 2012
Two species of Agaricus sect. Xanthodermatei from Thailand
Rut-LiIn ZHAO’, DENNIS E. DESJARDIN?, PHILIPPE CALLAC3, Luts A. PARRA‘,
JACQUES GUINBERTEAU?, KASEM SOYTONG*®, SAMANTHA KARUNARATHNA‘,
YING ZHANG?! & KEVIN D. HypDE®”®
'Key Laboratory of Forest Disaster Warning and Control in Yunnan Province, College of Forestry,
Southwest Forestry University, Kunming, Yunnan Province 650224, PR China
?Department of Biology, San Francisco State University, San Francisco, California, 94132, USA
7INRA, UR1264, Mycologie et Sécurité des Aliments, 33883 Villenave d’Ornon, France
‘Avda. Padre Claret 7, 5° G, 09400 Aranda de Duero, Burgos, Spain
°Faculty of Agricultural Technology, King Mongkut’s Institute of Technology Ladkrabang (KMITL),
Ladkrabang, Bangkok 10520, Thailand
°Institute of Excellence in Fungal Research, School of Science, Mae Fah Luang University,
Chiang Rai, Thailand
7International Fungal Resource and Development Centre,
The Research Institute of Resources Insects Chinese Academy of Forestry,
Bailongsi, Kunming, Yunnan Province 650224, PR China.
’King Saud University, College of Science, Botany and Microbiology Department,
Riyadh 1145, Saudi Arabia
* CORRESPONDENCE TO:
[email protected]
ABSTRACT —Agaricus murinocephalus is described and illustrated as a new species. This
taxon, presently known only from Thailand, is characterized by a context that generally does
not discolor on exposure, the lack of a phenolic odor, a cap covered by very fine, appressed,
dark grey squamules outside the grey disc on a whitish background, and a broken collar-like
annulus. Agaricus endoxanthus, previously reported from South America, Europe, and Asia,
is recorded for the first time in Thailand. Morphological and published molecular analyses
place both taxa in A. sect. Xanthodermatei based on.
Key worps —Basidiomycota, Agaricaceae, new species, taxonomy, tropics
Introduction
Agaricus is a genus that comprises many edible species but also includes a
small number of species that are toxic if eaten. These toxic taxa do not generally
cause death but may cause gastrointestinal upsets. Most toxic species are
members of A. sect. Xanthodermatei (Parra 2008).
188 ... Zhao & al.
Agaricus sect. Xanthodermatei was established by Singer (1948) with
the type species A. xanthodermus Genev. Recent molecular phylogenetic
analyses of samples from Europe and North America showed the section to
be monophyletic (Callac & Guinberteau 2005, Challen et al. 2003, Gem et al.
2004, Kerrigan et al. 2005). Inclusion of tropical species in molecular analysis
by Zhao et al. (2011) also confirmed monophyly of the group. Agaricus sect.
Xanthodermatei is characterized mainly by its chemical reactions as all section
members have a negative Schaffer reaction and bright yellow positive KOH
reaction (Parra 2008). Other important features shared by many taxa in sect.
Xanthodermatei are a transient yellowing discoloration in the pileus surface
and stipe base when bruised or cut, phenolic or iodine-like odors, and toxic
compounds that can cause gastrointestinal disorders in humans. Surprisingly
A. biannulatus Mua et al., a recently published new species in this section has
neither yellow context discoloration nor a phenolic or iodine-like odor (Parra
et al. 2011). Sect. Arvenses and sect. Minores (also with yellow staining species)
can be distinguished from sect. Xanthodermatei by their more persistent color
change, positive Schaffer reaction, anise seed or almond-like odors, and lack
toxic compounds causing gastrointestinal upset when ingested (Parra 2008).
As part of our ongoing studies of macrofungi in northern Thailand (Van de
Putte et al. 2010), including Agaricus (Zhao et al. 2011) and its relatives (Zhao
et al. 2010), we describe here two A. sect. Xanthodermatei species from the
region: one a newly proposed species and the other a first record for Thailand.
Materials & methods
Collections were made in forests and grassy areas in northern Thailand between
2004 and 2010. Specimens were photographed in situ and gathered and wrapped in
aluminum foil or kept separately in a box in order to avoid mixing or crushing, and
returned to the laboratory for treatment. Odor and color change upon bruising were
recorded when collecting. Descriptions of other macrocharacters, chemical tests, and
further photography of fresh samples were carried out as soon as possible after return
from the field, generally following Largent (1986). Color terminology follows Kornerup
& Wanscher (1978). Specimens were dried overnight in a food drier, sealed in plastic
bags, and deposited in the BIOTEC Bangkok Herbarium (BBH), with duplicates in the
H.D. Thiers Herbarium at San Francisco State University (SFSU). Herbarium acronyms
follow Thiers (http://sweetgum.nybg.org/ih continuously updated).
Micromorphological features were documented from examination of dried
specimens according to Largent (1986). Particular attention was given to the anatomy
of the pileipellis, stipitipellis and partial veil, and features of the hymenophoral trama,
basidiospores, basidia and cystidia. Measurements of anatomical features (spores,
basidia and cheilocystidia) are presented based on at least 20 measurements, and include
x, the mean of length by width + SD, Q, the quotient of basidiospore length and width,
and Qm, the mean of Q-values + SD. The phylogenetic relationships of the two species
included herein are published in Zhao et al. (2011).
Agaricus murinocephalus sp. nov. (Thailand) ... 189
PLATE 1. Agaricus murinocephalus (Holotype BBH 19560): A. Longitudinal section of
basidiocarp; B. Basidiospores, basidia and cheilocystidia; C. Pileipellis hyphae; D. Annulus
hyphae. Scale bars: A = 10 mm; B-D = 10 um.
Taxonomy
Agaricus murinocephalus R.L. Zhao, Desjardin & K.D. Hyde, sp.nov. PL. 1, 3A-E
MycoBank MB564460
Differs from other species of Agaricus sect. Xanthodermatei by its lack of (or very slight)
yellow context discoloration on exposure, lack of phenolic or iodine-like odor, pileus disc
with very fine grey squamules on a white background, and broken collar-like annulus.
190 ... Zhao & al.
Type: Thailand. Chiang Mai Prov., Mae Taeng, Ban Mae Sae village, on Hwy 1095
near 50 km marker, 19°14.599'N 98°39.456’E, altitude 962 m, 10 June 2006, coll. Todd
Osmundson ZRL3044 (Holotype, BBH 19560; isotype SFSU; GenBank, JF691555).
EryMo_oey: from murinus = mouse-grey, and cephalus = headed; referring to the grey-
colored pileus.
PILEus 30 mm diam. when young, then expanding to 50-55 mm diam., convex
with distinct broad umbo; margin deflexed, splitting with age, never uplifted;
surface dry, covered with fibrils or very finely squamulose; disc generally
greyish brown (5F5) to black or sometimes with greenish tones; ornamentation
disrupted towards the whitish margin and appearing minutely pulverulent on
a whitish background. CONTEXT 3 mm thick at disc, white. LAMELLAE free,
crowded, with 4 series of lamellulae, 5-6 mm broad, ventricose, at first white,
then light orange grey (6B2), later greyish brown (8D3), finally dull brown
to dark brown. St1pE 40-70 x 4-5 (apex) x 5-10 (base) mm, cylindrical to
subclavate above a bulbous base, hollow; surface smooth, silky, white. ANNULUS
2 mm broad, collar-like, broken, ephemeral, white. ODor pleasant. Surfaces
of stipe and pileus staining reddish-brown on touching; context lacking color
change or very slightly discoloring yellow at the base of stipe on cutting.
MACROCHEMICAL REACTIONS KOH reaction bright yellow; Schaffer reaction
negative.
BASIDIOSPORES 5.5-7 X 3-4 um, [x = 6 + 0.4 x 3.5 + 0.3 um, Q = 1.4-2.0,
Q. = 1.75 + 0.35, n = 20], elongate-ellipsoid, without germ pore, smooth,
brown. Basip1A 12-19 x 6-8 um, hyaline, smooth, 4-spored. CHEILOCYSTIDIA
scattered, 9-24 x 8-13 um, pyriform to broadly clavate, hyaline, smooth.
PLEUROCYSTIDIA absent. PILEIPELLIS a cutis formed from hyphae 5-10 um
diam., some constricted at septa, cylindrical, walls hyaline, containing brown
vacuolar pigment. ANNULUS composed of hyphae of 4-7 um diam. that are
smooth, hyaline and branched.
Hasir solitary or scattered in small groups in open areas of forest.
ADDITIONAL MATERIAL EXAMINED: THAILAND, CHIANG Rat PRov., Mae Sai, Doi
Tung, 3 August 2006, coll.: Rui-lin Zhao ZRL3092 (BBH 19608, SFSU).
Agaricus endoxanthus Berk. & Broome, J. Linn. Soc. Bot. 11: 548. 1871. PL. 2, 3F-H
PILEus 65 mm diam., convex to plano-convex; disc with a broad, flattened
or slightly depressed umbo; pileus margin exceeding the lamellae as a white
edge; surface dry, covered by brownish-grey (8E2) to grey (8E5) fibrils,
radially fissured exposing the underlying white context that turns pink in wet
conditions; at disc fibrils darker and aggregated into small, scattered fibrillose
squamules. CONTEXT firm, white. LAMELLAE free, crowded, with 10 or more
series of lamellulae, up to 4 mm broad, straight or ventricose, greyish red to
dull red (8C3) when young, brown to dark brown (8F4) with age; edges paler
than the sides. Stipe 60 x 4-12 mm, cylindrical below, with a slightly tapered
Agaricus murinocephalus sp. nov. (Thailand) ... 191
PLATE 2. Agaricus endoxanthus (BBH 19611): A. Cheilocystidia; B. Basidiospores and
basidia; C. Pileipellis hyphae. Scale bars: A-B = 10 um; C = 25 um.
apex: base slightly swallowed with white rhizomorphs, hollow; surface both
above and below the annulus glabrous, brownish grey (8E2). ANNULUS superior,
persistent, pendent, single, up to 11 mm broad; lower surface slightly floccose;
edge entire, white, and sometimes with brown granules. Opor indistinct, not
phenolic or almond-like. Base of stipe and centre of disc strongly staining
yellow on cutting, without color change on touching.
MACROCHEMICAL REACTIONS KOH reaction yellow; Schaffer reaction
negative.
Spores 5-6 x 3-4 um [x=5.4 + 0.6 x 3.5 +0.5 um, Q=1.25-2,Q_=1.55+0.45,
n= 20], ellipsoid with attenuate apex in most cases, without germ pore, smooth,
brown. Basip1A 12-17 x 5-7 um, clavate, 4-spored. CHEILOCYSTIDIA (9-)11-
17 x 8-12 um, rarely seen in old specimens, mostly pyriform, some turbinate
192 ... Zhao & al.
or subsphaerical, hyaline, smooth. PLEUROCysTIDIA absent. PILEIPELLIS a
cutis, composed of cells variable in size and shape, many 25-44 x 17-25 um,
others 17-25 x 5-7.5 um, distinctly constricted at the septa, with dark brown
vacuolar pigments. ANNULUS composed of hyphae of 5-7.5 um diam., which
are hyaline, smooth and curved. STIPITIPELLIS with hyphae similar to those of
the pileipellis, but slightly smaller.
Hasit solitary in soil, in open areas of forest.
MATERIAL EXAMINED: THAILAND, CHIANG Mal Prov., Mae Taeng Dist., Ban Pha
Deng Village, 19°17.123'N 98°44.009’E, elev. 900 m., 13 August 2006, coll.: Rui-lin Zhao
ZRL3095 (BBH 19611, SFSU; see also Zhao et al. 2011).
Discussion
Although some morphological characters of A. murinocephalus, such as
the slightly reddish-brown discoloration on bruising of the pileus and the
lack of typical phenolic odor are not typical for A. sect. Xanthodermatei, the
molecular phylogenetic position (Zhao et al. 2011), negative Schaffer reaction,
positive KOH reaction, and pileipellis hyphae with vacuolar pigments support
this new species in this section. Furthermore, the previous molecular work
separates this new species from A. endoxanthus, A. microvolvatulus Heinem.,
A. xanthodermulus Callac & Guinb., A. xanthodermus, and A. xanthosarcus
Heinem. & Gooss.-Font. Specimen NTF61 (see sp. 39 in the Zhao et al. 2011
phylotree) represents another possible species sister to A. murinocephalus
that our molecular analyses show as a different new species. A complete
morphological and molecular characterization of specimen NTF61 will be
presented in another paper.
The context in A. murinocephalus either does not stain yellow or discolors
only slightly on exposure. Most sect. Xanthodermatei species stain distinctly
yellow after being cut, especially at the stipe base of the stipe, e.g. A. bulbillosus
Heinem. & Gooss.-Font., A. endoxanthus, A. iodosmus Heinem., A. moelleri
Wasser, A. menieri Bon, A. pseudopratensis (Bohus) Wasser, A. xanthodermus,
A. xanthosarcus (Cappelli 1984, Heinemann 1956a, 1978; Kerrigan 1986, Nauta
2001). In some species, such as A. phaeolepidotus (RH. Moller) RH. Moller,
A. californicus Peck, or A. hondensis Murrill, a weak yellow or rubescent
discoloration occurs on cutting, however all taxa have a phenolic odor and lacka
dark greyish pileus (Cappelli 1984, Kerrigan 1986, Nauta 2001) that characterize
A. murinocephalus. Agaricus biannulatus, a recently published species (Parra et
al. 2011) in this section also lacks a yellow context discoloration and phenolic
or iodine-like odor, but differs from A. murinocephalus in a two-layered
annulus consisting of two distinct separate limbs. Agaricus volvatulus Heinem.
& Gooss.-Font. and A. placomyces Peck are morphologically similar to our new
species in that both have blackish pilei and a bulbous stipe. Agaricus volvatulus,
however, has a distinct phenolic odor and its pileus is darkly pigmented overall,
Agaricus murinocephalus sp. nov. (Thailand) ... 193
PLATE 3. Agaricus murinocephalus: A-C. Holotype BBH 19560; D-E. BBH 19608. Agaricus
endoxanthus (BBH 19611): E Basidiomata; G. Cheilocystidia; H. Pileipellis hyphae.
194 ... Zhao & al.
while A. placomyces has an elastic annulus that may remain attached to the
pileus margin even after pileus expansion (Heinemann 1978, 1980; Kerrigan
et al. 2005).
Agaricus endoxanthus is another species with dark appressed squamules
on the pileus, a large membranous-floccose annulus, small spores and
cheilocystidia, and vacuolar pigments in the pileipellis hyphae (Pegler 1977,
1986; Heinemann 1980). An ITS1+2 sequence of material from Thailand
(sample ZRL3095, GenBank JF691554; Zhao et al. 2011) is nearly identical
to that of A. endoxanthus (GenBank DQ182511) reported in Kerrigan et al.
(2005). The fact that only two heteromorphisms separate the two sequences
helped us select the appropriate epithet for the Thai material.
Agaricus endoxanthus is similar to A. pseudoniger Heinem. & Gooss.-Font.
from Congo and Agaricus rotalis K.R. Peterson et al. from Hawaii (Peterson et
al. 2000). Agaricus pseudoniger differs in having a brownish-black pileus and
larger cheilocystidia (18-30 x 9.5-18.5 um; Heinemann 1980, 1956b). Agaricus
rotalis is morphologically nearly indistinguishable from A. endoxanthus (cf.
comparison in Kerrigan et al. 2005), but they differ by three heteromorphisms
in their ITS1+2 sequences.
Acknowledgments
We thank the National Natural Science Foundation of China (Project ID: 31000013
to Ruilin Zhao), Key Laboratory of Forest Disaster Warning and Control in Yunnan
Province (Project ID: ZK09A107), the Bio-Asie project “Inventory and taxonomy of
Agaricus species in Thailand, Laos, Malaysia and Yunnan (China); domestication and
evaluation of species of nutritional or medicinal interest’, and BRN grant (BRN049/2553)
is acknowledged for support to study the taxonomy of potentially edible mushrooms in
Thailand. We thank the USA National Science Foundation (PEET-grant DEB-0118776 to
Desjardin) for partial support of Zhao and Desjardin. The Global Research Network for
Fungal Biology and King Saud University are also thanked for support. Drs. Annemieke
Verbeken, Xianghua Wang, and Zai-Wei Ge are thanked for helping us in preparing the
final submission.
Literature cited
Callac P, Guinberteau J. 2005. Morphological and molecular characterization of two novel species
of Agaricus section Xanthodermatei. Mycologia 97: 416-424.
http://dx.doi.org/10.3852/mycologia.97.2.416
Cappelli A. 1984. Agaricus L.: Fr. (Psalliota Fr.). Libreria editrice Biella Giovanna, Saronno.
Challen MP, Kerrigan RW, Callac P. 2003. A phylogenetic reconstruction and emendation of
Agaricus section Duploannulatae. Mycologia 95(1): 61-73. http://dx.doi.org/10.2307/3761962
Geml J, Geiser DM, Royse DJ. 2004. Molecular evolution of Agaricus species based on ITS and LSU
rDNA sequences. Mycol. Prog. 3(2): 157-176. http://dx.doi.org/10.1007/s11557-006-0086-8
Heinemann P. 1956a. Champignons récoltés au Congo belge par Mme M. Goossens-Fontana, II.
Agaricus Fr. s.s. Bull Jard Bot Brux 26: 1-127.
Agaricus murinocephalus sp. nov. (Thailand) ... 195
Heinemann P. 1956b. Sur divers facteurs agissant sur la formation des primordiums de Agaricus
edulis en culture pure, VIlle Congrés de Bot., C R des séances et rapports et rapports et comm.
déposées lors du Congres. dans les sect. 18, 19 et 20: 48-50.
Heinemann P. 1978. Essai d'une clé de determination des genres Agaricus et Micropsalliota. Sydowia
30: 6-37.
Heinemann P. 1980. Les genres Agaricus et Micropsalliota en Malaisie et en Indonésie. Bull Jard Bot
Nat Belg 50: 3-68.
Kerrigan RW. 1986. Agaricales of California. Vol. 6. Agaricaceae. Mad River Press, Eureka.
California.
Kerrigan RW, Callac P, Guinberteau J, Challen MP, Parra LA. 2005. Agaricus section Xanthodermatei:
a phylogenetic reconstruction with commentary on taxa. Mycologia 97: 1292-1315.
http://dx.doi.org/10.3852/mycologia.97.6.1292
Kornerup A, Wanscher JH. 1978. Methuen handbook of color. Third Edition. Eyre Methuen,
London.
Largent DL. 1986. How to identify mushrooms to genus, vols 1-5. Mad River Press, Eureka,
California.
Nauta MM. 2001. Agaricus L. and Allopsalliota Naunta et Bas. 23-62, in: ME Noordeloos et al. (eds).
Flora Agaricina Neerlandica, Vol. 5, Family Agaricaceae. Lisse, A.A. Balkema Publishers.
Parra LA. 2008. Agaricus L. Allopsalliota Nauta & Bas, Edizioni Candusso, Alassio.
Parra LA, Mua A, Cappelli A, Callac P. 2011. Agaricus biannulatus sp. nov., a new species of the
section Xanthodermatei collected in Sardinia and Sicily. Micol. Veget. Medit. 26 (1): 3-20.
Pegler DN. 1977. A preliminary agaric flora of east Africa. Kew Bull 6: 1-615.
Pegler DN. 1986. Agaric flora of Sri Lanka. Kew Bull 12: 1-519.
Peterson KR, Desjardin DE, Hemmes DE. 2000. Agaricales of the Hawaiian Islands.6. Agaricaceae
I. Agariceae: Agaricus and Melanophyllum. Sydowia 52(2): 204-257.
Singer R. 1948. Diagnoses Fungorum Novorum Agaricalium. Sydowia 2: 26-42.
Van de Putte K, Nuytinck J, Stubbe D, Le HT, Verbeken A. 2010. Lactarius volemus sensu lato
(Russulales) from northern Thailand: morphological and phylogenetic species concepts
explored, Fungal Divers. 45: 99-130. http://dx.doi.org/10.1007/s13225-010-0070-0
Zhao RL, Desjardin DE, Soytong K, Perry BA, Hyde KD. 2010. A monograph of Micropsalliota
in Northern Thailand based on morphological and molecular data. Fungal Divers. 45: 33-79.
http://dx.doi.org/10.1007/s13225-010-0050-4
Zhao RL, Karunarathna S, Raspé O, Parra LA, Guinberteau J, Moinard M, Kesel AD, Barroso G,
Courtecuisse R, Hyde KD, Guelly AK, Desjardin DE, Callac P. 2011. Major clades in tropical
Agaricus. Fungal Divers. 51: 279-296. http://dx.doi.org/10.1007/s13225-011-01360-7
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.197
Volume 122, pp. 197-205 October-December 2012
Hymenochaete in China. 4.
H. parmastoi sp. nov. and H. ustulata new to China
SHUANG-HuI HE” & HaI-Jiao LI
Institute of Microbiology, P.O. Box 61, Beijing Forestry University, Beijing 100083, China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Hymenochaete parmastoi is described as new to science. It is similar to H. minor
and H. rhabarbarina, but morphological and molecular (ITS rDNA sequences) evidence
show that they are distinct from each other. Hymenochaete ustulata, which was collected
from Guangdong Province, southern China, is newly recorded in China. It is characterized
by anatomical structure (in sect. Paragymnochaete and with abundant crystals). Illustrated
descriptions of these two species are provided.
Key worps — Hymenochaetaceae, phylogeny, taxonomy, wood-inhabiting fungi
Introduction
The poroid wood-inhabiting fungi in China have been intensively studied
during the last decade (Yuan & Dai 2008a,b; Dai 2010, 2011, 2012; Cui et al.
2011; Dai & Cui 2011; Zhou & Dai 2012), but the corticioid fungi are still
poorly studied. As a contribution to the studies of the corticioid fungi in China,
a project dealing with the taxonomy and phylogeny of the genus Hymenochaete
Lév. (Léveillé 1846) is in progress and several intensive surveys in south and
southwest China have been carried out since 2010. Among the 1000 specimens
collected, several new species and Chinese new records have been found (He &
Li 2011a,b, 2012a,b, He & Dai 2012).
More recently, careful morphological study and molecular analysis of some
Hymenochaete specimens from several provinces and autonomous regions
in temperate and subtropical areas of China indicate that they represent an
undescribed species, which we describe here as H. parmastoi.
One additional specimen collected from Guangdong Province is identified
as H. ustulata, a rare species new to Chinese fungal flora. This is the first
report outside its type locality. Illustrated descriptions of these two species are
provided in this paper.
198 ... He & Li
Materials & methods
MorRPHOLOGICAL STUDIES: Voucher specimens are deposited in the herbarium of
Beijing Forestry University (BJFC), and the microscopic procedure follows Dai (2010).
In presenting the size range of spores and setae, 5% of the measurements were excluded
from each end of the range, and the measurements were given in parentheses. In the
text the following abbreviations are used: L = mean spore length (arithmetical average
of all spores), W = mean spore width (arithmetical average of all spores), Q = variation
in the L/W ratios between the specimens studied (quotient of the mean spore length
and the mean spore width of each specimen), n = the number of spores measured from
given number of specimens. IKI stands for Melzer’s reagent, KOH for 5% potassium
hydroxide, and CB is the abbreviation of Cotton Blue in lactic acid. IKI- = inamyloid
and nondextrinoid, CB- = acyanophilous. Special color terms follow Petersen (1996).
DNA EXTRACTION AND SEQUENCING: The F-130 Phire® Plant Direct PCR Kit (Finnzymes,
Finland) was employed for DNA extraction and PCR amplification from herbarium
specimens according to the manufacturer's instructions. Approximately 700 base pairs
of the ITS rDNA were amplified with primers ITS5 (GGA AGT AAA AGT CGT AAC AAG
G) and ITS4 (tcc Tcc GcT TAT TGA TAT GC; White et al. 1990), using the following
procedure: initial denaturation at 98°C for 5 min, followed by 39 cycles of 98°C for 5 s,
58°C for 5 s and 72°C for 5 s, and a final extension of 72°C for 10 min. DNA sequencing
was performed at Beijing Genomics Institute, and all new sequences were deposited in
GenBank (http://www.ncbi.nlm.nih.gov).
PHYLOGENETIC ANALYSIS: The phylogeny was inferred from the ITS sequences of 51
Hymenochaete species. Pseudochaete corrugata (Fr.) $.H. He & Y.C. Dai and P. tabacina
(Sowerby) T. Wagner & M. Fisch. were selected as outgroups. The sequences were aligned
using the ClustalX 1.83 (Chenna et al. 2003). Alignments were optimized manually in
BioEdit 7.0.5.3 (Hall 1999). Maximum parsimony analysis were performed using PAUP*
4.0b10 (Swofford 2002). Gaps in the alignments were treated as missing data. Trees
were generated using 100 replicates of random stepwise addition of sequence and tree-
bisection reconnection (TBR) branch-swapping algorithm, with all characters given
equal weight. Branch supports for all parsimony analysis were estimated by performing
1000 bootstrap replicates (Felsenstein 1985) with a heuristic search of 10 random-
addition replicates for each bootstrap replicate. The tree length (TL), consistency
indices (CI), retention indices (RI), rescaled consistency indices (RC) and homoplasy
index (HI) were calculated for each tree generated. Trees were figured in Treeview 1.6.6
(Page 1996).
Taxonomy
Hymenochaete parmastoi S.H. He & Hai J. Li, sp. nov. Fics 1-2
MycoBank MB 800487
Differs from other Hymenochaete species by its yellowish brown basidiocarps, encrusted
setae, and ellipsoid to ovoid basidiospores.
Type: China. Xizang Autonomous Region, Bomi County, on fallen angiosperm trunk,
20.IX.2010, He 367 (holotype, BJFC; GenBank, JQ780061).
Hymenochaete parmastoi sp. nov. (China) ... 199
Fic. 1. Basidiocarps of Hymenochaete parmastoi (holotype).
Erymo_oey: honoring Erast Parmasto, 1928-2012, eminent Estonian mycologist and
author of many significant papers on Hymenochaete.
FruITBoby: Basidiocarps annual, effused, closely adnate, coriaceous, first as
small round or irregular colonies, later confluent up to 15 cm or more in longest
dimension, 50-250 um thick in section. Hymenophore smooth, cinnamon
to clay-buff, not cracked or with numerous deep crevices with age; margin
thinning out, distinct, whitish to yellowish when juvenile, becoming indistinct,
concolorous with hymenophore surface when mature.
HyPHAL STRUCTURE: Hyphal system monomitic; generative hyphae without
clamp connections; tissue darkening but otherwise unchanged in KOH.
SUBICULUM: Tomentum and cortex absent. Hyphal layer locally present,
thin. Generative hyphae hyaline to yellowish brown, thin- to thick-walled with
a wide lumen, septate, usually branched at a right angle, loosely to densely
interwoven, 2-4 um in diam.
STRATIFIED HYMENIUM: Hyphae in this layer similar to those in subiculum,
yellowish brown, thick-walled, more or less agglutinated, interwoven, 2-3
um in diam. Setal layer composed of 1-3 rows of overlapping setae. Setae
not numerous, scattered, subulate, reddish brown, with acute tips, projecting
up to 30 um above the hymenium, (30-)40-75(-95) x (5-)6-10 um, usually
enmeshed in thick hyphal sheath, this usually slightly or heavily encrusted with
yellowish or brownish amorphous matters in the tip part. Cystidia and hyphidia
absent, but hyphal ends sometimes present in the hymenium, some encrusted
200 ... He & Li
Ne
b
“10pm
Fic. 2. Microscopic structures of Hymenochaete parmastoi (drawn from the holotype).
a: Basidiospores. b: Basidia and basidioles. c: Setae.
with amorphous matters. Basidia clavate, with four sterigmata and a simple
septum at base, walls thickening at basal part, 15-20 x 3-4.8 um; basidioles in
shape similar to basidia, but slightly smaller.
Spores: Basidiospores ellipsoid to ovoid, hyaline, thin-walled, smooth, IKI-
, CB-, (3.8-)4-5.5(-6) x (2.5-)2.6-3.2(-3.5) um, L = 4.84 um, W = 2.94 um,
Q = 1.55-1.76 (n = 210/7).
ADDITIONAL SPECIMENS EXAMINED: CHINA. ANHUI PRov., Huangshan County,
Yellow Mountain National Park, on fallen twig of Rhododendron, 20.X.2010, He 431
(BJFC); GUANGxI AUTONOMOUS REGION, Xing’an County, Maoershan Nat. Res., on
fallen angiosperm twig, 19.VIII.2011, He 867 (BJFC; GenBank, JQ780063); GuIzHoU
Prov., Leishan County, Leigongshan Nat. Res., on fallen angiosperm twig, 24.VIHI.2010,
He 266 (BJFC), He 277 (BJFC; GenBank, JQ780064); X1IZANG AUTONOMOUS REGION,
Linzhi County, Lulang, on fallen angiosperm twig, 24.1X.2010, He 388 (BJFC; GenBank,
JQ780062), He 391 (BJFC); Gadinggou, on fallen angiosperm twig, 25.IX.2010, He 402
(BJFC); YUNNAN Prov., Zhanyi County, Zhujiangyuan Forest Park, on dead angiosperm
tree, 11.V1I.2011, He 725 (BJFC); Chuxiong, Zixishan Forest Park, on fallen angiosperm
trunk, 11.VI.2011, He 741 (BJFC).
Hymenochaete ustulata G.A. Escobar ex J.C. Léger,
Cryptog. Mycol. 11: 309, 1990 Fics 3-4
FRuITBoby: Basidiocarps annual, effused, closely adnate, coriaceous, first as
small colonies, later confluent up to 5 cm or more in longest dimension, 100-150
Hymenochaete parmastoi sp. nov. (China) ... 201
Fic. 3. Basidiocarps of Hymenochaete ustulata (He 104).
um thick in section. Hymenophore smooth or with scattered small tubercles,
vinaceous brown to reddish brown when fresh, becoming pale mouse-gray to
vinaceous gray after dry, usually not cracked; margin thinning out, indistinct,
paler or concolorous with hymenophore surface.
HyPHAL STRUCTURE: Hyphal system monomitic; generative hyphae without
clamp connections; tissue darkening but otherwise unchanged in KOH.
SuBICULUM: Tomentum and hyphal layer absent. Cortex well developed,
composed of strongly agglutinated hyphae, 20-70 um thick.
STRATIFIED HYMENIUM: Generative hyphae yellowish brown, thick-walled,
agglutinated, 2-3.5 um in diam. Setal layer thickening, composed of several
rows of overlapping setae. Agglomerates of crystals frequently present in
the setal layer and subhymenium, 10-30(-50) um in diam. Setae numerous,
subulate, reddish brown, with acute tips, some enmeshed with a thin hyphal
sheath, projecting up to 40 um above the hymenium, (30-)45-70(-75) x 5-9
um. Cystidia and hyphidia absent. Basidia clavate, with four sterigmata and a
simple septum at base, walls thickening at basal part, 15-18 x 3-4 um; basidioles
in shape similar to basidia, but smaller.
Spores: Basidiospores ellipsoid, hyaline, thin-walled, smooth, IKI-, CB-,
4-5 x 2.2-2.8 um, L = 4.42 um, W = 2.49 um, Q = 1.78 (n = 30/1).
SPECIMEN EXAMINED: CHINA. GUANGDONG PRov., Shixing County, Chebaling Nat.
Res., on rotten angiosperm trunk, 24.VI.2010, He 104 (BJFC; GenBank, JQ780066).
202 ... He & Li
ee ae
CS aay EE
Si Cen
Gy: “Gps Gw
Ah Sey ee ont
10 um
10 ym
Fic. 4. Microscopic structures of Hymenochaete ustulata (drawn from He 104).
a: Basidiospores. b: Basidia and basidioles. c: Setae.
Phylogenetic results
Seven ITS sequences were newly obtained in this study (GenBank accession
numbers JQ780061-JQ780067). The alignment of the ITS sequences of 53
taxa resulted in 786 sites with 398 parsimony informative characters. One
strict consensus tree was yielded from the analysis with TL = 2056, CI = 0.428,
RI = 0.645, RC = 0.276 and HI = 0.572 (Fic. 5). The strict consensus tree placed
Hymenochaete taxa well apart from the outgroups, with H. parmastoi strongly
supported (bootstrap value = 100%) as a separate lineage and confirming
H. parmastoi as phylogenetically distinct from any sampled species. The tree
also showed H. parmastoi closely related to H. minor S.H. He & Y.C. Dai and
H. ustulata closely related to H. rhabarbarina (Berk.) Cooke.
Discussion
Hymenochaete parmastoi is characterized by yellowish brown basidiocarps,
encrusted setae, and ellipsoid to ovoid basidiospores. In both morphological
and phylogenetic aspects, H. parmastoi seems very close to H. minor (with a
100% bootstrap value), which also has setae encrusted with amorphous matter.
However, H. minor differs from H. parmastoi by its shorter setae (25-50 um)
and smaller basidiospores (3-4.5 x 1.7-2 um; He & Dai 2012). Moreover,
H. parmastoi grows mostly in temperate areas, while H. minor seems to be a
tropical species.
Hymenochaete parmastoi sp. nov. (China) ... 203
H. parmastoi He277 JQ780064*
100] 77, parmastoi He867 JQ780063*
100| | 4. parvnastoi He388 JQ780062*
H. parmastoi He367 JQ780061*
62] 140) K minor He933 JQ279555
H. minor He941 JQ279557
H. megaspora He302 JQ279553
1007 4. rhododendricola He392 JQ279576
H. rhododendricola He389 JQ279577
72y— H. ochromarginata Hed? JQ279579
100) 4. rubiginosa He1049 JQ716407
H. tasmanica He449 JQ279582
55- H. paucisetigera Cur?845 JQ279560
100\- 77 asetosa Dail0756 JQ279559
H. odontoides Dail1635 JQ279563
H. fuiva He640 JQ279565
H. yunnanensis He709 JQ279571
96 H, anomaia JQ279566 He592
H. luteobadia He8 JQ279569
H. separabilis He460 JQ279572
81 H. rhabarbarina He280 JQ279574
H. ustulata Hel04 JQ780066*
H. ulmicola He864 JQ780065*
98r H. adusta He207 JQ279523
H. subjerruginea Cui 8122 JQ279521
H. xerantica Cui 9209 JQ279519
H. berteroi He133 JQ279524
H. rheicolor He503 JQ279530
og | WOO H. attenuata He28 JQ279526
H. villosa He537 JQ279528
61 64-- H. setipora Cui6301 JQ279515
961'— 7 porioides Cui7609 JQ279517
H. cyclolameliata Cur?39 JQ279513 3
H. nanospora He475 JQ279531
H. acerosa He338 JQ279543
H, fuliginosa He785 JQ279545
64 H. cinnamomea He755 JQ279548
H. minuscula He253 JQ279546
H. epichiora He525 JQ279549
H. unicolor He468a JQ279551
97 H. huangshanensis He432 JQ279533
H., longispora He101 JQ279536
H. senatoumbrina He349 JQ279540
H. tenuis He779 JQ279538
H. muroiana Hel72 JQ279541
100 1007 H. floridea He536 JQ279597
100 H. sphaericola He303 JQ279599
H. cruenta He766 JQ279595
95 H. legeri He1028 JQ?780067*
H. spathulata He685 JQ279591
52 100 H. innexa He555 JQ279584
H. tropica He661 JQ279588
72 100_+ H. duportii CBS939.96 DQ404386
zc H. hydnoides He245 JQ279590
H. sphaerospora He691 JQ279593
H. murina He569 JQ716406
Pseudochaete corrugata He761 JQ279606
10 Pseudochaete tabacina He390 JQ279610
Fic. 5. Strict consensus tree obtained from Maximum Parsimony analysis of ITS sequences of
Hymenochaete. Pseudochaete corrugata and P. tabacina were used as outgroups. Newly generated
sequences are those with *. Parsimony bootstrap values (>50%) are shown.
204 ... He & Li
Two other species, H. rhabarbarina and H. rhododendricola S.H. He & Hai J.
Li, also have setae encrusted with amorphous matter. However, H. rhabarbarina
differs from H. parmastoi by its well-developed hyphal layer, encrusted hyphae,
and longer setae (60-100 um; Parmasto 2001), while H. rhododendricola has
longer setae (80-130 um) and larger basidiospores (6-7 x 4-5 um; He & Li
2011a) than H. parmastoi. These two morphologically close allies are distantly
related to the H. parmastoi clade in the phylogram.
Hymenochaete ustulata was previously reported only in Brazil. The species
is diagnosed by its anatomical structure, which contains a well-developed
cortex without a hyphal layer (sect. Paragymnochaete) and an abundance of
crystal agglomerates. The similar H. separata G. Cunn. can be separated by its
smaller setae (35-45 x 6-7 um) and larger basidiospores (5-6.5 x 3-3.5 um;
Escobar 1978; Parmasto & Gilbertson 2005). Hymenochaete dissimilis G. Cunn.
shares similar setae, basidiospores, and agglomerated crystals but differs from
H. ustulata in its thicker basidiocarps (<750 um) and lack of cortex (Cunningham
1957; Léger 1998).
He & Dai (2012) conducted a taxonomic and phylogenetic study of
Hymenochaete and allied genera in China in which they combined five species
of Hydnochaete Bres. and Cyclomyces Kunze ex Fr. in Hymenochaete and
transferred five species of Hymenochaete were transferred to Pseudochaete
T. Wagner & M. Fisch. (nom. illegit., non Pseudochaete West & G.S. West
[Chlorophyta]). Including the two species reported in this paper, a total of 55
Hymenochaete species have been recorded in China (He & Dai 2012; He & Li
2012b).
Acknowledgments
The authors would like to express their deep thanks to Drs. Hai-Sheng Yuan (Institute
of Applied Ecology, Chinese Academy of Sciences) and Xiao-Yong Liu (Institute of
Microbiology, Chinese Academy of Sciences) for serving as pre-submission reviewers
and to Prof. Yu-Cheng Dai (Institute of Applied Ecology, Chinese Academy of Sciences)
for improving the manuscript. This study was supported by the National Natural Science
Foundation of China (No. 31000006).
Literature cited
Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD. 2003. Multiple
sequence alignment with the Clustal series of programs. Nucleic Acids Res 31: 3497-3500.
http://dx.doi.org/10.1093/nar/gkg500
Cui BK, Du P, Dai YC. 2011. Three new species of Inonotus (Basidiomycota, Hymenochaetaceae)
from China. Mycol Prog 10: 107-114. http://dx.doi.org/10.1007/s11557-010-0681-6
Cunningham GH. 1957. Thelephoraceae of New Zealand XIV - The genus Hymenochaete. Trans
Roy Soc New Zealand 85: 1-51.
Dai YC. 2010. Hymenochaetaceae (Basidiomycota) in China. Fungal Divers 45: 131-343.
http://dx.doi.org/10.1007/s13225-010-0066-9
Hymenochaete parmastoi sp. nov. (China) ... 205
Dai YC. 2011. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience
52: 69-79. http://dx.doi.org/10.1007/s10267-010-0068-1
Dai YC. 2012. Polypore diversity in China with an annotated checklist of Chinese polypores.
Mycoscience 53: 49-80. http://dx.doi.org/10.1007/s10267-011-0134-3
Dai YC, Cui BK. 2011. Fomitiporia ellipsoidea has the largest fruiting body among the fungi. Fungal
Biol 115: 813-814. http://dx.doi.org/10.1016/j.funbio.2011.06.008
Escobar GA. 1978. Contribution towards a monograph of the neotropical species of Hymenochaete.
Ph. D. dissertation, University of Washington. University Microfilms, Ann Arbor. 227 p.
Felsenstein J. 1985. Confidence intervals on phylogenetics: an approach using bootstrap. Evolution
39: 783-791. http://dx.doi.org/10.2307/2408678
Hall TA. 1999. Bioedit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids Symp Ser 41: 95-98.
He SH, Dai YC. 2012. Taxonomy and phylogeny of Hymenochaete and allied genera of
Hymenochaetaceae (Basidiomycota) in China. Fungal Divers 56: 77-93.
http://dx.doi.org/10.1007/s13225-012-0174-9
He SH, Li HJ. 2011a. Hymenochaete rhododendricola and H. quercicola spp. nov. (Basidiomycota,
Hymenochaetales) from Tibet, southwestern China. Nord J Bot 29: 484-487.
http://dx.doi.org/10.1111/j.1756-1051.2011.01217.x
He SH, Li HJ. 2011b. Two new species of Hymenochaete (Hymenochaetales) from China. Mycotaxon
115: 375-382. http://dx.doi.org/10.5248/115.375
He SH, Li HJ. 2012a [“2011”]. Hymenochaete in China. 2. A new species and three new records
from Yunnan Province. Mycotaxon 118: 411-422. http://dx.doi.org/10.5248/118.411
He SH, Li HJ. 2012b. Hymenochaete in China 3. Three species new to China from Guangxi
Autonomous Region and Jilin Province. Mycosystema 31: (in press)
Léger JC. 1998. Le genre Hymenochaete Léveillé. Biblioth Mycol 171: 1-319.
Léveillé JH. 1846. Descriptions de champignons de l’herbier du Muséum de Paris. Ann Sci Nat Bot,
de ser, 58111167.
Page RMD. 1996. TreeView: an application to display phylogenetic trees on personal computers.
Comput Appl Biosci 12: 357-358.
Parmasto E. 2001. Hymenochaetoid fungi (Basidiomycota) of North America. Mycotaxon 79:
107-176.
Parmasto E, Gilbertson RL. 2005. The genus Hymenochaete (Basidiomycota, Hymenomycetes) in the
Hawaiian Islands. Mycotaxon 94: 189-214.
Petersen JH. 1996. Farvekort. The Danish Mycological Society's colour-chart. Foreningen til
Svampekundskabens Fremme, Greve. 6 p.
Swofford DL. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods). Version
4.0b10. Sinauer Associates, Sunderland, Massachusetts.
White TJ, Bruns TD, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols, a guide to
methods and applications. Academic, San Diego.
Yuan HS, Dai YC. 2008a. Two new species of Junghuhnia (Basidiomycota, Polyporales), and a key to
the species of China. Nordic J Bot 26: 96-100.
http://dx.doi.org/10.1111/j.1756-1051.2008.00169.x
Yuan HS, Dai YC. 2008b. Polypores from northern and central Yunnan Province, Southwestern
China. Sydowia 60: 147-159.
Zhou LW, Dai YC. 2012. Phylogeny and taxonomy of Phylloporia (Hymenochaetales): new species
and a worldwide key to the genus. Mycologia 104: 211-222. http://dx.doi.org/10.3852/11-093
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.207
Volume 122, pp. 207-220 October-December 2012
Phylogenetic systematics of the Gigasporales
GLADSTONE ALVES DA SILVA’, LEONOR CosTA MAIA! & FRITZ OEHL?
"Departamento de Micologia, CCB, Universidade Federal de Pernambuco,
Av. Prof. Nelson Chaves s/n, Cidade Universitaria, 50670-420, Recife, PE, Brazil
Federal Research Institute Agroscope Reckenholz-Tanikon ART, Organic Farming Systems,
Reckenholzstrasse 191, CH-8046 Ziirich, Switzerland
“CORRESPONDENCE TO:
[email protected]
AsstRract — ‘The classification, phylogeny, and evolutionary pathways of the Gigasporales
are re-evaluated based on concomitant morphological and molecular phylogenetic analyses.
Only Cetraspora was not supported in the morphology-based tree, while Quatunica formed
a monophyletic group with its sister genus Dentiscutata. Only a few taxa were not completely
supported in the SSU rDNA phylogenetic analyses, namely Dentiscutata and Fuscutata
(Dentiscutataceae) and Racocetra and Cetraspora (Racocetraceae). However, all trees generated
by the LSU, SSU (rDNA), and $-tubulin genes supported the existence of the families with
strong support for all genera represented in the LSU rDNA and 6-tubulin analyses. In
conclusion, the current classification of the Gigasporales has a strong morphological and
molecular congruency.
Key worps — Glomeromycetes, gigasporoid, scutellosporoid
Introduction
The arbuscular mycorrhizal (AM) fungi form a symbiotic association
with plants, being the most important mutualism between plants and fungi
in the nature. These fungi are grouped in the phylum Glomeromycota, in
which the order Gigasporales (Oehl et al. 2011a) with 54 currently described
species (TABLE 1) forms a clade of outstanding interest and particularity for
taxonomic, phylogenetic, and ecological reasons. Fungi in this order were
grouped according to their spore formation mode on sporogenous cells and
phylogenetic analyses of the rDNA and 6-tubulin genes (Oehl et al. 2011a).
Besides, members of Gigasporales do not form vesicles in the colonized roots
but rather form auxiliary cells in mycorrhizospheric soils. Recently, Dotzler et
al. (2006) reported ~400 million year-old fossil scutellosporoid spores with very
structures similar to those in Gigasporales (bulbous bases, germinal walls, and
208 ... Silva, Maia & Oehl
TABLE 1. Species in Gigasporales”*
Dentiscutataceae F.A. Souza et al.
Dentiscutata biornata (Spain et al.) Sieverd. et al.
D. cerradensis (Spain & J. Miranda) Sieverd. et al.
D. colliculosa B.T. Goto & Oehl
D. hawaiiensis (Koske & Gemma) Sieverd. et al.
D. heterogama (T.H. Nicolson & Gerd.) Sieverd.
et al.
D. nigerita Khade
D. nigra (J.F. Redhead) Sieverd. et al.
D. reticulata (Koske et al.) Sieverd. et al.
D. scutata (C. Walker & Dieder.) Sieverd. et al.
Fuscutata aurea Oehl et al.
EF heterogama Oehl et al.
FE. rubra (Stiirmer & J.B. Morton) Oehl et al.
EF, savannicola (R.A. Herrera & Ferrer) Oehl et al.
E trirubiginopa (X.L. Pan & G. Yun Zhang) Oehl
et al.
Quatunica erythropus (Koske & C. Walker) EA.
Souza et al.
Gigasporaceae J.B. Morton & Benny
Gigaspora albida N.C. Schenck & G.S. Sm.
G. alboaurantiaca W.N. Chou
G. candida Bhattacharjee et al.
G. decipiens I.R. Hall & L.K Abbott
G. gigantea (T.H. Nicolson & Gerd.) Gerd. &
Trappe
G. margarita W.N. Becker & IR. Hall
G. ramisporophora Spain et al.
G. rosea T.H. Nicolson & N.C. Schenck
Intraornatosporaceae B.T. Goto & Oehl
Intraornatospora intraornata (B.T. Goto & Oehl)
B.T. Goto et al.
C. pellucida (T.H. Nicolson & N.C. Schenck) Oehl
et al.
C. striata (Cuenca & R.A. Herrera) Oehl et al.
Racocetra alborosea (Ferrer & R.A. Herrera) Oehl
et al.
R. beninensis Oehl et al.
R. castanea (C.Walker) Oehl et al.
R. coralloidea (Trappe et al.) Oehl et al.
R. fulgida (Koske & C. Walker) Oehl et al.
R. gregaria (N.C. Schenck & T.H. Nicolson) Oehl
et al.
R. minuta (Ferrer & R.A. Herrera) Oehl et al.
R. persica (Koske & C. Walker) Oehl et al.
R. tropicana Oehl et al.
R. undulata T.C. Lin & C.H. Yen
R. verrucosa (Koske & C. Walker) Oehl et al.
R. weresubiae (Koske & C. Walker) Oehl et al.
Scutellosporaceae Sieverd. et al.
Orbispora pernambucana (Oehl et al.) Oehl et al.
O. projecturata (Kramad. & C. Walker) Oehl et al.
Scutellospora arenicola Koske & Halvorson
S. aurigloba (I.R. Hall) C. Walker & EE. Sanders
S. calospora (T.H. Nicolson & Gerd.) C. Walker &
EE. Sanders
S. crenulata R.A. Herrera et al.
S. dipapillosa (C. Walker & Koske) C. Walker &
EE. Sanders
S. dipurpurescens J.B. Morton & Koske
S. spinosissima C. Walker & Cuenca
S. tricalypta (R.A. Herrera & Ferrer) C. Walker &
EE. Sanders
*The nomenclature and its authorities are based on
Goto et al. (2009, 2010, 2011, 2012), Khade (2010),
Lin & Yen (2011), Mello et al. (2012), Oehl et al.
(2008, 2010, 2011b,d), Silva et al. (2008), and Tchabi
et al. (2009).
Placement of S. spinossisima is tentative because its
germ shield morphology and phylogeny are not yet
sufficiently resolved and need re-analysis.
Paradentiscutata bahiana Oehl et al.
P. maritima B.T. Goto et al.
Racocetraceae Oeh| et al.
Cetraspora armeniaca (Btaszk.) Oehl et al.
C. gilmorei (Trappe & Gerd.) Oehl et al.
C. helvetica Oehl et al.
C. nodosa (Blaszk.) Oehl et al.
germination shields). This discovery indicates diversification of Gigasporales
earlier than suggested by other researchers (Phipps & Taylor 1996, Redecker
et al. 2000).
Until 2008 little attention was given to Gigasporales classification, although
some problems regarding the monophyly and position of Gigaspora and
Scutellospora had been discussed earlier (Kramadibrata et al. 2000, Souza et al.
2005, Silva et al. 2006). Studying the morphological phylogeny of AM fungi,
Morton (1990) reported Gigaspora as basal to the former Scutellospora, and
his results were supported by ontogenetic studies (Bentivenga & Morton 1995,
Morton 1995, Franke & Morton 1994) and fatty acid profiles (Bentivenga &
Phylogeny of the Gigasporales ... 209
Morton 1996). On the other hand, molecular phylogenetic analyses increasingly
demonstrated that Gigaspora might be monophyletic with Scutellospora basal
and polyphyletic (Simon et al. 1993, Souza et al. 2005, Redecker & Raab 2006).
Based on concomitant morphological and molecular phylogenetic analyses,
Oehletal. (2008) confirmedthe former Scutellosporaas polyphyleticand proposed
four families (Dentiscutataceae, Gigasporaceae, Racocetraceae, Scutellosporaceae)
and seven genera (Cetraspora, Dentiscutata, Fuscutata, Gigaspora, Quatunica,
Racocetra, Scutellospora) within the sporogenous cell forming AM fungi, ice.
the Gigasporales. Countering this revision of Scutellospora, Morton & Msiska
(2010) reported that such segregation destabilized the taxonomy of the group,
proposing that beside the former Gigaspora and Scutellospora, only one genus
(Racocetra) described by Oehl et al. (2008) was valid. However, Kriiger et al.
(2012) provided support for some more genera described by these authors, and
a several recent studies with a broader database (e.g. Goto et al. 2010, 2011,
2012, Oehl et al. 2010, 2011b) sustain the revision by Oehl et al. (2008).
Currently, Gigasporales comprises five families (Dentiscutataceae,
Gigasporaceae, Intraornatosporaceae, Racocetraceae, Scutellosporaceae) and
ten genera (Cetraspora, Dentiscutata, Fuscutata, Gigaspora, Intraornatospora,
Orbispora, Paradentiscutata, Quatunica, Racocetra, Scutellospora) (Oehl et
al. 2008, 2011b, Goto et al. 2012). We wish here to evaluate the classification,
phylogeny, and evolutionary pathways in Gigasporales.
Materials & methods
Morphological phylogenetic analyses
As in Morton & Msiska (2010), we selected just 27 species from Gigasporales and 23
characters to construct a matrix for the morphological phylogenetic analysis. In general,
characters and the plesiomorphic and apomorphic character states were defined and
coded as in Morton & Msiska (2010). We did not include the Intraornatosporaceae
or Intraornatospora, Orbispora, and Paradentiscutata in our morphological analysis,
because these taxa were described after the Morton & Msiska (2010) study.
The phylogenetic analysis and tree construction were performed using Phylogenetic
Analysis Using Parsimony (PAUP 4.0b10) (Swofford 2003). The matrix-generated data
were calculated by maximum parsimony (MP). Acaulospora mellea and A. laevis served
as outgroups.
Evolutionary phylogenetic terms used in this study (from Wiley et al. 1991)
include (1) homoplastic = a character shared by two taxa that does not meet the
criteria of homology (i.e., the character does not derive from a common ancestor), (2)
plesiomorphic = ancestral character state and apomorphic = derived character state, (3)
synapomorphy = a derived character state shared by a group of species with evidence
of a common ancestor, (4) symplesiomorphy = an ancestral character state shared by a
group of species but useless for phylogenetic analyses since clearly representing common
ancestry for all the fungi being analyzed.
210 ... Silva, Maia & Oehl
Molecular phylogenetic analyses
Partial sequences of rRNA (SSU and LSU) and 6-tubulin genes were analyzed
independently to reconstruct the phylogeny of the Gigasporales. Only B-tubulin exon
regions were analyzed, with introns excluded.
Sequences (all obtained from the National Center for Biotechnology Information-
NCBI) were aligned with ClustalX (Larkin et al. 2007) and edited with BioEdit (Hall
1999) to obtain a final alignment.
Prior to phylogenetic analysis, the nucleotide substitution model was estimated using
Topali 2.5 (Milne et al. 2004). Bayesian (two runs over 1 x 10° generations with a burnin
value of 2500) and maximum likelihood (1000 bootstrap) analyses were executed,
respectively, in MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003) and PhyML (Guindon
& Gascuel 2003), launched from Topali 2.5. Neighbor-joining (established with the
same model used to construct the Bayesian tree) and maximum parsimony analysis
were performed using PAUP*4b10 (Swofford 2003) with 1000 bootstrap replications.
Pacispora scintillans sequences were used as outgroup for the SSU and LSU rRNA
analyses, and Acaulospora mellea was outgroup for $-tubulin analysis.
Results
Molecular phylogenetic analysis
All LSU, SSU (rDNA), and B-tubulin gene trees support the families described
in the Gigasporales (Fics 1-3). The LSU rDNA sequence-based phylogenies
support all ten genera (Fic. 1), and the B-tubulin tree supports all genera with
species included in the analysis (Fic. 2). Only the SSU rDNA phylogenetic
tree did not fully support a few taxa in the Dentiscutataceae and Racocetraceae
(Fic. 3) with no separation shown between Dentiscutata and Fuscutata or
Racocetra and Cetraspora.
Morphological phylogenetic analyses
The morphology-based phylogeny supported Gigasporaceae and
Dentiscutataceae (F1Gc.4). However, Scutellosporaceae and Racocetraceae grouped
together in a monophyletic clade. Our morphological analyses, which included
only the same data and taxa used by Morton & Msiska (2010), did excluded
taxa described since 2010: Orbispora, Intraornatospora, Paradentiscutata,
and Intraornatosporaceae. Of all genera considered, only Cetraspora was
not supported. Fuscutata, Gigaspora, Racocetra, and Scutellospora were
monophyletic, and Quatunica formed a monophyletic group with Dentiscutata
(Fic. 4).
Discussion
All LSU, SSU (rDNA) and £-tubulin phylotrees supported the existence
of the gigasporalean families with strong support for all genera shown by the
LSU rDNA and 6-tubulin analyses. As the LSU region is believed to give the
best resolution for Gigasporales (Souza et al. 2005, Oehl et al. 2008, 2011b),
Pacispora scintillans FM876832
P. scintillans FM876831
93
89
97
0.99
84
92
96
0.99
0.99
0.1
Phylogeny of the Gigasporales ...211
Scutellospora calospora FJ461864
S. calospora FJ461865
S. dipurpurescens FJ461868
S. calospora EU346867
S. calospora EU252109
100, Orbispora pernambucana JQ340917
100| O. pernambucana JQ340918
100} O. pernambucana JF965445
1.00) ©. pernambucana JF965446
O. pernambucana HQ871519
Racocetra fulgida FJ461870
R. gregaria AJ510232
R. coralloidea FJ461866
R. persica FJ461880
R. alborosea JN689226
R. tropicana GU385898
R. castanea Y12076
R. verrucosa AY900507
R. verrucosa AY900508
Cetraspora nodosa FM876833
| C. nodosa FM876836
C. helvetica HM565946
C. helvetica HM565945
C. helvetica HM565944
C. pellucida AY639323
C. pellucida AY639261
C. gilmorei FN547608
C. gilmorei FN547606
C. gilmorei FN547603
C. gilmorei FN547618
Dentiscutata nigra AY900496
D. nigra AY900497
D. nigra AY900495
D. nigra AY900494
Quatunica erythropus AM040357
Q. erythropus AM040353
Q. erythropus AM040355
Q. erythropus AM040351
Q. erythropus AM040352
Fuscutata aurea JN971067
F. aurea JN971068
F. aurea JN971066
F. heterogama FJ461875
F. heterogama FJ461873
F. heterogama FJ461876
F. heterogama FJ461872
G. roseaY 12075
G. rosea AM040350
G. albida FJ461861
G. margarita AF396782
G. margarita AF396783
G. decipiens FJ461862
G. gigantea AY900506
G gigantea AY900504
Intraornatospora intraornata JN971072
|. intraornata JN971074
|. intraornata JN971073
I. intraornata JN971075
Paradentiscutata bahiana JN971069
92 P. bahiana JN971071
98 P. bahiana JN971070
99 P. maritima JN971081
00), P. maritima JN971078
P. maritima JN971077
P. maritima JN971079
P. maritima JN971080
P. maritima Jn971076
Fic. 1. Phylogenetic reconstruction of the Gigasporales obtained from partial LSU rDNA sequences.
The NJ, ML, and Bayesian analyses were performed with GTR+G nucleotide substitution model.
Sequences are labeled with database accession numbers. Support values are (from up to down)
from neighbor-joining (NJ), maximum parsimony (MP
), maximum likelihood (ML), and Bayesian
analyses. Only topologies with 250% bootstrap values are shown. (Consistency Index = 0.55;
Retention Index = 0.84).
212 ... Silva, Maia & Oehl
A. foveata FJ174304
A. mellea FJ174303
400 S. dipurpurescens FJ807705
100
84
0.99L_ S. calospora FJ174268
C. pellucida FJ174269
we R. castanea AJ717326
82
76
aon 1.00 R. fulgida FJ174273
100 abel
1.00 Pe
rs R. verrucosa FJ174270
0.53
84 R. gregaria FJ174271
1.00) — R. persica FJ174272
54 R. coralloidea FJ807707
G. margarita FJ174278
G. decipiens FJ174277
4.00] ; G gigantea FJ174276
G. albida FJ174275
57 G. rosea FJ174274
Q. erythropa FJ807706
83 F, heterogama FJ174320
-- F. heterogama FJ174317
F. heterogama FJ174325
F. heterogama FJ174315
0.01
Fic. 2. Phylogenetic reconstruction of the Gigasporales obtained from partial B-tubulin sequences.
The NJ, ML, and Bayesian analyses were performed with GTR+G+I nucleotide substitution model.
Sequences are labeled with database accession numbers. Support values are (from up to down)
from neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian
analyses. Only topologies with 250% bootstrap values are shown. (Consistency Index = 0.63;
Retention Index = 0.68).
Phylogeny of the Gigasporales ... 213
Pacispora scintillans AJ619951
P. scintillans AS619940
Orbispora projecturata AJ242729
90
rir F Scutellospora aurigloba AJ276092
- 5. Scutellospora spinosissima AJ306437
_ S. calospora AJ306445
S. calospora AJ306443
Gigaspora decipiens U96146
aoe G. margarita AM181143
‘00 m G gigantea EF014362
1:89 G. gigantea Z14010
G. albida Z14009
G. albida AJ852599
a G. rosea X58726
30 Dentiscutata colliculosa GQ376067
0.99} 44 .
99 D. reticulata AJ871272
5 x D. reticulata AJ871273
D. cerradensis AB041344
D. cerradensis AB041345
96] - Fuscutata heterogama AJ852609
4.00 ~ © heterogama AY635832
Racocetra weresubiae AJ306444
=~ R. fulgida AS306435
4.00 R. castanea AF038590
R. gregaria AJ871275
R. gregaria AJ871274
R. alborosea JQ080259
R. tropicana GU385897
ggr— Cetraspora gilmorei AJ276094
87
81 C. pellucida 214012
1.00
C. nodosa AJ306436
0.01
Fic. 3. Phylogenetic reconstruction of the Gigasporales obtained from partial SSU rDNA sequences.
The NJ, ML, and Bayesian analyses were performed with GTR+G+I nucleotide substitution model.
Sequences are labeled with database accession numbers. Support values are (from up to down)
from neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian
analyses. Only topologies with 250% bootstrap values are shown. (Consistency Index = 0.68;
Retention Index = 0.74).
214 ... Silva, Maia & Oehl
we conclude that the current classification by Oehl et al. (2011c) and Goto et
al. (2012) has a strong morphological and molecular congruency and support.
The SSU rDNA phylogenetic analysis did not completely support only a few
taxa — Dentiscutata and Fuscutata (Dentiscutataceae) and Racocetra and
Cetraspora (Racocetraceae), which confirms the analyses of Oehl et al. (2008)
using a similar database. In the morphology-based tree, only Cetraspora was
not supported while Quatunica formed a monophyletic group with its sister
genus Dentiscutata. We argue that this might correspond to the fact that
Cetraspora lacks any unique morphological character and shares (for example)
the number of spore walls with several other genera as well as the germination
shield color and structure with related genera. Thus far, Quatunica has only one
important character (spore wall numbers) that separates it morphologically
from Dentiscutata species. The fact that Quatunica is monospecific gives it a
low analytical weight.
Of the 23 morphological characters analyzed by Morton & Msiska (2010),
we regard eight (1, 2, 3, 4, 6, 8, 11, 12) as synapomorphies that are identical for
all gigasporalean species, thereby leaving just 15 characters to divide clades in
the order. Among these, Morton & Msiska (2010) report variation in character
21 (germination shield color) between isolates from the same species, which
could prevent using this character in phylogenetic analyses, due to its instability.
However, we argue that these authors might have included immature spores
with germination shields that were not completely differentiated or very old
spores in their observations. They might also have considered similar spores
from more than one species that represent different phylogenetic clades (e.g.
Cetraspora pellucida, Fuscutata savannicola, and Dentiscutata scutata). We also
believe that although species show a typical germination shield pattern, natural
exceptions may occur in some individuals, due to several reasons such as a
malformation.
Morton & Msiska’s (2010) characters 9 (spore size), 10 (spore color), and 13
(outer layer surface of the gigasporoid spore wall) do not pass a homology test,
because there is no congruence with other characters among the taxa (de Pinna
1991). Moreover, characters 9 and 10 are quantitative, and the most obvious
character filter for cladistic analysis rejects continuous or quantitative attributes.
Bentivenga et al. (1997) reported significant variation in the average of spore
size and color in a single Glomus clarum isolate after generations of selection
pressure for some phenotypic characters. Bever & Morton (1999) also observed
average variation in Cetraspora pellucida spore size and shape in five single-spore
cultures from a single isolate population. None of these characters contributed
significantly to synapomorphies within the Gigasporales, being homoplastic
with a consistency index (CI) below 0.4. Character 14 was synapomorphic for
the genus Dentiscutata, although the CI was also below 0.4.
Phylogeny of the Gigasporales ... 215
Acaulospora mellea
A. laevis
Cetraspora nodosa
: Scutellospora spinosissima
Foad - S. calospora
12 3 4 6 8 1112141617 20 22 22:25 Se aungiona
Orbispora projecturata
C. armeniaca
10
23 [C. pellucida
Fuscutata heterogama
Character state 3
@ =0 Pree F. rubra
mw =1
A =2 5 21 Dentiscutata cerradensis
@ =3
@=4 D. scutata
14
D. biornata
9 17 22 23 9 14
D. nigra
10 10 5
D. reticulata
1014 | 9
Quatunica erythropus
13 16 17 18 20
Gigaspora albida
G rosea
7 1519 G gigantea
9 G. decipiens
Wig margarita
Racocetra fulgida
14-8 R. castanea
R. weresubiae
16 20
R. verrucosa
R. persica
10 R. coralloidea
10 5 R. gregaria
Fic. 4. Phylogenetic reconstruction of the Gigasporales based on 23 morphological characters.
(Tree length = 63 steps; Consistency Index = 0.49; Retention Index = 0.77).
Some characters (7 and 19) that serve to separate Gigaspora from other
gigasporalean taxa do not help solve the polyphyletic former Scutellospora
groups. Thus, of 23 characters used by Morton & Msiska (2010), just ten are
phylogenetically helpful in separating monophyletic groups. Most of these
characters are related to germination shield, hyphal color, and germinal wall
characteristics.
Despite the Morton & Msiska (2010) criticism of the LSU-SSU
interdependence, they used two interdependent morphological characters
216 ... Silva, Maia & Oehl
(16—number of germinal walls and 20—germination shield position) to group
Racocetra taxa. In addition, this genus is grouped by the more ancestral character
state (as coded by the authors) that clearly represents a symplesiomorphy, which
does not provide evidence of common ancestry (Wiley et al. 1991). We conclude
that Morton & Msiska (2010) erred when coding these character states.
Evolutionary line in the Gigasporales
Ontogenetic data (Franke & Morton 1994; Morton 1995; Bentivenga &
Morton 1995, 1996) led readers to believe that Gigaspora might be basal to
the former Scutellospora. However, several molecular studies (Oehl| et al. 2008,
2010, 2011b, Goto et al. 2010; 2012) demonstrated that the former Scutellospora
evolved first in the Gigasporales. The report of 400 million year-old fossil
specimens with germination shields by Dotzler et al. (2006) suggested that the
presence of germination shield is ancestral in Gigasporales. The low number
of gigasporoid species related to scutellosporoid (sensu lato) species also
suggests that Gigaspora diverged after other members. Finally, we understand
the capacity of repeated germination of Gigaspora species (Maia & Kimbrough
1993) from <1000 germ warts randomly distributed on the spore wall inner
surface as a evolutionary progression compared with single germination events
from 1-24 germ tube initiations found on the germination shield periphery of
scutellosporoid (sensu lato) species.
The molecular phylogenetic trees suggest that spore wall loss has occurred
three times during the evolutionary history of Gigasporales [Scutellospora,
Cetraspora (3) > Racocetra, Intraornatospora (2) > Gigaspora (1)], while at
least once an additional wall was acquired [Dentiscutata (3) > Quatunica (A)].
However, even the germinal wall was lost in Gigaspora leaving only the innermost
warty germination layer, and germination in this genus is related to this specific
layer. Intraornatospora with one germinal wall with a rudimentary appearing
germination shield (Goto et al. 2012) is close phylogenetically to Gigasporaceae.
This genus forms a particular ornamentation on the inner surface of the outer
spore wall (Goto et al. 2009) in the form of tubercular projections resembling
the germ warts in Gigaspora. Since Intraornatospora germination has not yet
been observed, it is not possible to infer whether germination occurs from the
germination shield or tuberculate projections.
The increasing complexity of the germination shield structure can be observed
in the gigasporalean evolutionary line. Clearly, the simple shield states (germ
orbs = mono-lobed, germ violins = bi-lobed) are ancestral. The presence of
color in the germination shield is a derivative state (shared by Dentiscutataceae
species and the related Paradentiscutata), whereas this structure is clearly
hyaline in the basal branch (Orbispora, Scutellospora).
Phylogeny of the Gigasporales ... 217
Final considerations
The classification proposed by Morton & Msiska (2010) was based solely
on morphological data that were not correctly interpreted. The authors did not
consider their own molecular phylogenetic data, which supported almost all
families and genera proposed by Oehl et al. (2008). Moreover, the Gigasporales
classification suggested by Morton & Msiska (2010) does not reflect natural
groups and leaves Scutellospora polyphyletic. Thus, we do not accept the
analysis and assumptions by Morton & Msiska (2010), who misinterpreted
some morphological characters, leading to misanalysis in the morphological
phylogeny of the Gigasporales.
The low number of informative morphological characters in Gigasporales
(until now) have not permitted a reliable morphology-based phylogeny. While
we work to find more informative phylogenetic characters and reconstruct
a reliable evolutionary history for Gigasporales, we should investigate the
gigasporalean phylogeny using molecular tools.
Our current phylogenetic analyses demonstrate that all families and almost
all genera proposed by Oehl et al. (2008) are monophyletic. Molecularly, generic
relationships in the Dentiscutataceae are not yet completely understood but will
be clarified once sequences of more species from this family are available. We
believe that the classification by Oehl et al. (2008; 2011b) with implementation
of Goto et al. (2012) is reliable and indicate the need for clarification of generic
relationships in the Dentiscutataceae.
Acknowledgments
The authors acknowledge, in special, the valuable comments and revisions of Felipe
Wartchow and Ewald Sieverding on the manuscript and appreciate the corrections by
Shaun Pennycook, Nomenclatural Editor, and suggestions by Lorelei L. Norvell, Editor-
in-Chief. This work was supported by: Conselho Nacional de Desenvolvimento Cientifico
e Tecnoldgico (CNPq) that provided research grants to Leonor C. Maia (INCT-Herbario
Virtual da Flora e dos Fungos/Sisbiota/Protax) and FACEPE (Fundacgao de Amparo a
Ciéncia e Tecnologia do Estado de Pernambuco) which provided financial support to
G.A. Silva and a grant to FE Oehl as ‘visiting professor’
Literature cited
Bentivenga SP, Morton JB. 1995. A monograph of the genus Gigaspora, incorporating
developmental patterns of morphological characters. Mycologia 87: 719-731.
http://dx.doi.org/10.2307/3760818
Bentivenga SP, Morton JB. 1996. Congruence of fatty acid methyl ester profiles and morphological
characters of arbuscular mycorrhizal fungi in Gigasporaceae. Proceedings of the National
Academy of Sciences, USA 93: 5659-5662. http://dx.doi.org/10.1073/pnas.93.11.5659
Bentivenga SP, Bever JD, Morton JB. 1997. Genetic variation of morphological characters within a
single isolate of the endomycorrhizal fungus Glomus clarum (Glomaceae). American Journal of
Botany 84: 1211-1216. http://dx.doi.org/10.2307/2446044
218 ... Silva, Maia & Oehl
Bever, JD, Morton JB. 1999. Heritable variation and mechanisms of inheritance of spore shape
within a population of Scutellospora pellucid, an arbuscular mycorrhizal fungus. American
Journal of Botany 86: 1209-1216. http://dx.doi.org/10.2307/2656768
de Pinna MCC. 1991. Concepts and tests of homology in the cladistic paradigm. Cladistics 7:
367-394. http://dx.doi.org/10.1111/j.1096-0031.1991.tb00045.x
Dotzler N, Krings M, Taylor TN, Agerer R. 2006. Germination shields in Scutellospora
(Glomeromycota: Diversisporales, Gigasporaceae) from the 400 million-year-old Rhynie chert.
Mycological Progress 5: 178-184. http://dx.doi.org/10.1007/s11557-006-0511-z
Franke M, Morton JB. 1994. Ontogenetic comparisons of arbuscular mycorrhizal fungi
Scutellospora heterogama and Scutellospora pellucida: revision of taxonomic character concepts,
species descriptions, and phylogenetic hypotheses. Canadian Journal of Botany 72: 122-134.
http://dx.doi.org/10.1139/b94-017
Goto BT, Maia LC, Silva GA, Oehl F. 2009. Racocetra intraornata, a new species in
the Glomeromycetes with a unique spore wall structure. Mycotaxon 109: 483-491.
http://dx.doi.org/10.5248/109.483
Goto BT, Silva GA, Maia LC, Oehl E 2010. Dentiscutata colliculosa, a new species in the
Glomeromycetes from Northeastern Brazil with colliculate spore ornamentation. Nova Hedwigia
90: 383-393. http://dx.doi.org/10.1127/0029-5035/2010/0090-0383.
Goto BT, Silva GA, Maia LC, Souza RG, Coyne D, Tchabi A, Lawouin L, Hountondji F, Oehl F. 2011.
Racocetra tropicana, a new species in the Glomeromycetes from tropical areas. Nova Hedwigia
92: 69-82. http://dx.doi.org/10.1127/0029-5035/2011/0092-0069
Goto BT, Silva GA, Assis DMA, Silva DKA, Souza RG, Ferreira ACA, Jobim K, Mello CMA, Vieira
HEE, Maia LC, Oehl F. 2012. Intraornatosporaceae, (Gigasporales), a new family with two new
genera and two new species. Mycotaxon: 119: 117-132. http://dx.doi.org/10.5248/119.117
Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies
by maximum likelihood. Systematic Biol. 52: 696-704. http://dx.doi.org/10.1080/1063515039
0235520.
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NTT. Nucl. Acids Symp. Ser. 41: 95-98.
Khade SW. 2010. Dentiscutata nigerita - a new species of arbuscular mycorrhizal fungi from India.
Mycosphere 1: 241-247.
Kramadibrata K, Walker C, Schwarzott D, SchiiBler A. 2000. A new species of Scutellospora with a
coiled germination shield. Annals of Botany 86: 21-27.
http://dx.doi.org/10.1006/anbo.2000.1146
Kriiger M, Kriiger C, Walker C, Stockinger H, Schiifler A. 2012. Phylogenetic reference data for
systematics and phylotaxonomy of arbuscular mycorrhizal fungi from phylum to species level.
New Phytologist 193: 970-984. http://dx.doi.org/10.1111/j.1469-8137.2011.03962.x
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,
Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and
Clustal X version 2.0. Bioinformatics 23: 2947-2948.
http://dx.doi.org/10.1093/bioinformatics/btm404
Lin T-C, Yen C-H. 2011. Racocetra undulata, a new species in the Glomeromycetes from Taiwan.
Mycotaxon 116: 401-406. http://dx.doi.org/10.5248/116.401
Maia LC, Kimbrough JW. 1993. Ultrastructural studies of the spore wall of Gigaspora albida
(Glomales). Mycologia 85: 883-889. http://dx.doi.org/10.2307/3760669
Mello CMA, Silva GA, Vieira HEE, Silva IR, Maia LC, Oehl F. 2012. Fuscutata aurea, a new species in
the Glomeromycetes from cassava and maize fields in the Atlantic rain forest zone of Northeastern
Brazil. Nova Hedwigia 95: 267-275. http://dx.doi.org/10.1127/0029-5035/2012/0037
Phylogeny of the Gigasporales ... 219
Milne I, Wright F, Rowe G, Marshal DF, Husmeier D, McGuire G. 2004. TOPALi: Software for
Automatic Identification of Recombinant Sequences within DNA Multiple Alignments.
Bioinformatics 20: 1806-1807. http://dx.doi.org/10.1093/bioinformatics/bth155
Morton JB. 1990. Evolutionary relationships among arbuscular mycorrhizal fungi in the
Endogonaceae. Mycologia 82: 192-207. http://dx.doi.org/10.2307/3759848
Morton JB. 1995. Taxonomic and phylogenetic divergence among five Scutellospora species
(Glomales, Zygomycetes) based on comparative developmental sequences. Mycologia 87:
127-137. http://dx.doi.org/10.2307/3760955
Morton JB, Msiska Z. 2010. Phylogenies from genetic and morphological characters do not support
a revision of Gigasporaceae (Glomeromycota) into four families and five genera. Mycorrhiza 20:
483-496. http://dx.doi.org/10.1007/s00572-010-0303-9
Oehl F, de Souza FA, Sieverding E. 2008. Revision of Scutellospora and description of five new genera
and three new families in the arbuscular mycorrhiza-forming Glomeromycetes. Mycotaxon 106:
311-360.
Oehl F, Jansa J, Souza FA de, Silva GA. 2010. Cetraspora helvetica, a new ornamented
species in the Glomeromycetes from Swiss agricultural fields. Mycotaxon 114: 71-84.
http://dx.doi.org/10.5248/114.71
Oehl F, Silva GA, Goto BT, Maia LC, Sieverding E. 2011a. Glomeromycota: two new classes and a
new order. Mycotaxon 116: 365-379. http://dx.doi.org/10.5248/116.365
Oehl FE, Silva DKA, Maia LC, Ferreira NM, da Silva GA. 2011b. Orbispora gen. nov.,
ancestral in the Scutellosporaceae of the Glomeromycetes. Mycotaxon 116: 161-169.
http://dx.doi.org/10.5248/116.161
Oehl F, Sieverding E, Palenzuela J, Ineichen K, Silva GA. 2011c. Advances in Glomeromycota
taxonomy and classification. IMA Fungus 2: 191-199.
http://dx.doi.org/10.5598/imafungus.2011.02.02.10
Oehl F£, Silva GA, Goto BT, Sieverding, E. 2011d. New recombinations in Glomeromycota.
Mycotaxon 117: 429-434. http://dx.doi.org/10.5248/117.429
Phipps J, Taylor TN. 1996. Mixed arbuscular mycorrhizae from the Triassic of Antarctica. Mycologia
88: 707-714. http://dx.doi.org/10.2307/3760964
Redecker D, Kodner R, Graham LE. 2000. Glomalean fungi from the Ordovician. Science 289:
1920-1921. http://dx.doi.org/10.1126/science.289.5486.1920
Redecker D, Raab P. 2006. Phylogeny of the Glomeromycota (arbuscular mycorrhizal fungi): recent
developments and new gene markers. Mycologia 98: 885-895.
http://dx.doi.org/10.3852/mycologia.98.6.885
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Silva DK da, Freitas NO, Maia LC, Oehl F. 2008. Scutellospora pernambucana, a new fungal species
in the Glomeromycetes with a characteristic germination orb. Mycotaxon 106: 361-370.
Silva GA da, Lumini E, Maia LC, Bonfante P, Bianciotto V. 2006. Phylogenetic analysis of
Glomeromycota by partial LSU rDNA sequences. Mycorrhiza 16: 183-189.
http://dx.doi.org/10.1007/s00572-005-0030-9
Simon L, Bousquet J, Levesque RC, Lalonde M. 1993. Origin and diversification of endomycorrhizal
fungi and coincidence with vascular land plants. Nature 363: 67-69.
http://dx.doi.org/10.1038/363067a0
Souza FA, Declerck S, Smit E, Kowalchuk GA. 2005. Morphological, ontogenetic and molecular
characterization of Scutellospora reticulata (Glomeromycota). Mycol. Res. 109: 697-706.
http://dx.doi.org/10.1017/S0953756205002546
220 ... Silva, Maia & Oehl
Swofford DL. 2003. PAUP”. Phylogenetic Analysis Using Parsimony (* and other methods), Version
4, Sinauer Associates, Sunderland, Massachusetts.
Tchabi A, Hountondji FE, Lawouin L, Coyne D, Oehl F. 2009. Racocetra beninensis from sub-Saharan
savannas: a new species in the Glomeromycetes with ornamented spores. Mycotaxon 110: 199-
209. http://dx.doi.org/10.5248/110.199
Wiley EO, Siegel-Causey D, Brooks DR, Funk VA. 1991. The compleat cladist: a primer of
phylogenetic procedures. University of Kansas Press, Lawrence, Kansas.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.221
Volume 122, pp. 221-224 October-December 2012
Pleurotus eryngii var. elaeoselini, first record from Romania
VASILICA CLAUDIU CHINAN”™ & GIUSEPPE VENTURELLA?
'Faculty of Biology, Alexandru Ioan Cuza University
Bd. Carol I, No. 20A, 700505, Iasi, Romania
*Dipartimento di Biologia Vegetale e Biodiversita, Universita di Palermo,
Via Archirafi 38, I-90123 Palermo, Italy
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Pleurotus eryngii var. elaeoselini, on Laserpitium latifolium roots, is reported in
Romania for the first time. A description and illustrations of this variety are provided.
KEY worpDs — taxonomy, Pleurotaceae, Apiaceae
Introduction
Pleurotus eryngii var. elaeoselini was described by Venturella et al. (2000) from
Sicily (Italy), growing on Elaeoselinum asclepium (L.) Bertol. subsp. asclepium.
Subsequently, Venturella (2002) reported the variety from Spain, associated
with other plants in Apiaceae: Thapsia villosa L. and Elaeoselinum gummiferum
(Desf.) Tutin. Unpublished data from one co-author (G. Venturella) widen the
distribution (i.e. France, Switzerland, Malta, Slovenia and Ukraine) of this taxon
(Frc. 1). In Romania, data on the P eryngii species complex are scarce, and only
P. eryngii (DC.) Quél. on Eryngium spp. roots has been reported (Salageanu &
Salageanu 1985). Identification of P eryngii var. elaeoselini in Romania, collected
on Laserpitium latifolium roots, adds new data to the existing knowledge of this
fungus. Laserpitium latifolium is also known as a host for P. eryngii var. eryngii
(Zervakis & Balis 1996). Zervakis et al. (2001), discussing the occurrence of
Pleurotus nebrodensis (Inzenga) Quél. on L. latifolium, stated that P. nebrodensis
should be associated only with Cachrys ferulacea (L.) Calest.
Materials & methods
The P. eryngii var. elaeoselini basidiomata, collected during 2006-11 in the Stanisoarei
Mountains (Eastern Carpathians), Romania, were described and photographed in the
habitat. The material was preserved by drying and deposited in the Herbarium of the
Alexandru Ioan Cuza University of Iasi (I). Duplicates of I-137264 and I-137266 are kept
222 ... Chinan & Venturella
FiGurReE 1. Distribution of Pleurotus eryngii var. elaeoselini in Europe.
ES (Spain), FR (France), CH (Switzerland), IT (Italy), MT (Malta),
SI (Slovenia), RO (Romania), UA (Ukraine).
in Herbarium Mediterraneum Panormitanum (PAL). For microscopical examination,
sections were mounted in 5% KOH and Congo red solution. The species was monitored
during annual field trips in 2007-11.
Taxonomy
Pleurotus eryngii var. elaeoselini Venturella, Zervakis & La Rocca,
Mycotaxon 76: 420 (2000) Fic. 2
Basip1oMaTA fleshy, 40-110 mm high. Pireus 40-120 mm in diameter,
hemispherical to convex when young, low convex to depressed when mature;
whitish, white-cream tolightbeige, with alutaceous tones; smooth, often lacerated
in small appressed areolae; margin deeply involute in young basidiomata, then
straight, sometimes lobate. LAMELLAE deeply decurrent, arcuate, up to 10 mm
broad, in young basidiomata with evident anastomoses on the stipe, whitish
to light cream, sometimes grayish-white in young basidiomata, edge entire,
concolorous. SPORE DEPOSIT white.
STIPE 25-85 x 6-20 mm, central to eccentric, concolorous with the pileus,
filled and firm, irregularly cylindrical, straight to slightly curved, base attenuate
Pleurotus eryngii var. elaeoselini, new to Romania... 223
FIGURE 2. Pleurotus eryngii var. elaeoselini basidiomata in habitat
(Photo: V.C. Chinan).
and sometimes radicating, lightly pruinose in the young basidiomata, then
smooth, glabrous. CONTEXT compact, fibrous, white in pileus and stipe, odor
and taste fungoid.
BasIpIA 4-spored, 34-48 x 8-10 um, sterigmata 4-5 um. BASIDIOSPORES
8-12(-13) x 4-5.5 um, cylindrical-ellipsoid, apiculate, smooth, hyaline;
cheilocystidia 40-60 x 8-12 um, club-shaped.
HABITAT/SUBSTRATE/PHENOLOGY. Mountain meadow (alt. 620-750 m),
calcareous soil, on Laserpitium latifolium roots, single or in groups, autumn
(September-October).
SPECIMENS EXAMINED: ROMANIA, EASTERN CARPATHIANS: Stanisoarei Mountains,
Neamt County, near Potoci village, mountain meadow, GPS: 46°56'14.55"N
26°07'43.86"E, alt. 620-750 m, on Laserpitium latifolium L. roots (Apiaceae), 6 Oct.
2006, 10 Oct. 2007, 19 Oct. 2008, 17 Sept. 2010, 13 Oct. 2011, coll. V. Chinan (I 137262;
I 137263; I 137264, PAL 001/ROM; I 137265; I 137266, PAL 002/ROM).
Discussion
Pleurotus eryngii var. elaeoselini is a rare taxon in Europe. In Romania it
was found on L. latifolium roots in a meadow in the Stanisoarei Mountains
(Eastern Carpathians). This is the first record of this variety for Romania and
the Carpathian Mountains. Annual field trips, carried out between 2007 and
2011, confirmed its presence in the same place every year from September
to October. Although it was first found in Italy only on E. asclepium subsp.
asclepium (Venturella et al. 2000), data from Spain (Venturella 2002) show that
224 ... Chinan & Venturella
this variety is linked to more than one species in the Apiaceae. The Romanian
collections of P. eryngii var. elaeoselini on L. latifolium confirm this conclusion.
Zervakis et al. (2001) previously discussed the presence of Pleurotus on
Laserpitium spp., noting that Pleurotus strains growing on Laserpitium spp. in
central Europe and northern Italy show identical microscopic characteristics
with P. eryngii var. elaeoselini and that these differ from P. nebrodensis.
The macroscopic and microscopic attributes of the Romanian specimens fit
the description by Venturella et al. (2000). Confusion with P nebrodensis is
excluded, as its host plant, C. ferulacea, is not known in Romania.
The Romanian population of P. eryngii var. elaeoselini apparently fruits only
in autumn, during September and October. In Italy, it is reported fruiting in
both autumn and spring (Venturella et al. 2000), while in Spain the variety has
been found only in spring (Venturella 2002).
Acknowledgements
The authors wish to thank Vladimir Antonin (Czech Republic), Georgios I. Zervakis
(Greece), and Shaun Pennycook (New Zealand) for critically reviewing the manuscript.
Literature cited
Salageanu G, Salageanu A. 1985. Determinator pentru recunoasterea ciupercilor comestibile,
necomestibile si otravitoare din Romania. Edit. Ceres, Bucuresti.
Venturella G. 2002. On the real identity of Pleurotus nebrodensis in Spain. Mycotaxon 84:
445-446.
Venturella G, Zervakis G, La Rocca S. 2000. Pleurotus eryngii var. elaeoselini var. nov. from Sicily.
Mycotaxon 76: 419-427.
Zervakis G, Balis C. 1996. A pluralistic approach on the study of Pleurotus species, with emphasis
on compatibility and physiology of the European morphotaxa. Mycol. Res. 100(6): 717-731.
http://dx.doi.org/10.1016/S0953-7562(96)80205-X
Zervakis GI, Venturella G, Papadopoulou K. 2001. Genetic polymorphism and taxonomic
infrastructure of the Pleurotus eryngii species-complex as determined by RAPD analysis,
isozyme profiles and ecomorphological characters. Microbiology 147: 3183-3194.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.225
Volume 122, pp. 225-230 October-December 2012
A new species of Hypoderma with periphysoids
CHUN-TAO ZHENG’, FENG ZHOU’, KE LP? & YING-REN LIN”
"School of Life Science & ? School of Forestry & Landscape Architecture,
Anhui Agricultural University, West Changjiang Road 130, Hefei, Anhui 230036, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Hypoderma mirabile, a new species found on fallen leaves of Litsea elongata in
China, is described and illustrated. This taxon is distinctive within the genus by the presence
of periphysoids, unbranched curved paraphyses, and a unique covering stroma.
Key worps — foliicolous fungi, morphological characteristics, taxonomy
Introduction
Hypoderma De Not. is one of the earliest described genera of Rhytismatales.
It was established by De Notaris (1847) and proposed as conserved name by
Cannon & Minter (1983). Héhnel designated Hypoderma rubi (Pers.) DC. as
the lectotype species of the genus in 1917, and this viewpoint was subsequently
accepted (Darker 1967; Cannon & Minter 1986; Korf 1988). Johnston (1990)
emphasised the significance of the developmental and structural characters
of the ascomatal sterile tissues rather than the ascospore shape to revise and
expand the concept of Hypoderma. This genus is characterized by the presence
of a preformed dehiscence mechanism, subcuticular ascomata, paraphyses that
are never swollen, and ascospores that vary in shape.
Hypoderma is the third-largest genus in the Rhytismataceae (Rhytismatales,
Leotiomycetes, Ascomycota), and of the 54 species known worldwide, many are
widely distributed in the temperate and tropical zones (Kirk et al. 2008). The
study of Hypoderma in China began in 1924 with the description of a new taxon,
Hypoderma strobicola f. cunninghamiae Keissl., subsequently raised to species
rank in 1947 as H. handelii Petr. (Keissler 1924; Petrak 1947). Afterwards, 13
additional species have been reported from China (Teng 1963; Tai 1979; Lin
& Hou 1994; Lin et al. 2004; Liang et al. 2005; Hou et al. 2005, 2007; Hou &
Piepenbring 2006; Wang et al. 2007).
226 ... Zheng & al.
Up to now, 5 species representing Lophodermium and Coccomyces in
Rhytismatales have been recorded on Litsea, but no Hypoderma species has yet
been reported on this plant genus (Farr & Rossman 2012).
Materials & methods
Macroscopic appearance was described under the dissecting microscope at 10-50x
magnification. After rehydration of reference material in water for ca 10 min, 8-15 um
thick sections of mature fruitbodies were cut using a freezing microtome (YD-202, Yidi
Medical Appliance Factory, Jinhua, Zhejiang, China). Sections were mounted in lactic
acid or cotton blue with pretreatment in water for the observations of ascomatal and
conidiomatal outlines in vertical section. The colours of various structures were observed
in water. Gelatinous sheaths surrounding ascospores and paraphyses were examined in
water or 0.1% (w/v) cotton blue in lactic acid. Measurements were made from more
than 30 asci, ascospores, and paraphyses for each specimen using material mounted in
5% KOH or Melzer’s reagent. Line and point integrated illustrations of external shape
and internal structures of fruitbodies were drawn using a microscopic painting device
(Panasoianic XSJ-2, Japan).
The type specimen is deposited in the Forest Fungi Dried Reference Collection of
Anhui Agricultural University, China (AAUF).
Taxonomy
Hypoderma mirabile Y.R. Lin & C.T. Zheng, sp. nov. FIGs 1-5
MycoBank MB 800352
Differs from Hypoderma rubi and H. cordylines by the presence of periphysoids, smaller
asci and ascospores, unbranched, curved paraphyses, and a distinct covering stroma.
Type: China, Anhui, Tiantangzhai, Xibianwa, alt. 950 m, on fallen leaves of Litsea
elongata (Wall. ex Nees) Benth. & Hook. f. (Lauraceae), 7 June 2007, J.J. Han & Y.R. Lin
2197 (Holotype, AAUF 68305).
ErymMo.oey: mirabile (Latin = fantastic), referring to the morphological peculiarity of
this fungus which has unique periphysoids.
Cotoniegs on both sides of leaves, forming distinct irregular, yellow-brown
paler areas, 7-12 mm diam.
ZONE LINES somewhat frequent, dark brown, thin, surrounding or partly
surrounding the pale areas, not always conspicuous.
ConipiomaTaA on both sides of leaves, scattered, occasionally coalescent.
In surface view, conidiomata 150-250 um diam., rounded or subrounded,
somewhat raising the substratum surface, dark brown to black, but lighter
coloured in immature conidiomata, with a surrounded black perimeter line,
discharging spores through an inconspicuous central ostiole. In vertical
section, conidiomata subcuticular. UPPER WALL poorly developed, composed
of textura epidermoidea with tiny, thin-walled cells. BASAL WALL 3-7 um
thick, comprised of textura globulosa-angularis. SUBCONIDIOGENOUS LAYER
Hypoderma mirabile sp nov, (China) ... 227
pe
Y
fa
re
ta
Se
ie
eee
Fics 1-5. Hypoderma mirabile on Litsea elongata. 1. Fruitbodies and a zoneline observed under a
dissecting microscope. 2. Conidioma in vertical section. 3. Portion of ascoma in median vertical
section. 4. Ascoma in median vertical section. 5. Paraphyses, asci, and ascospores.
228 ... Zheng & al.
ca 6 um thick, consisting of 3—4(-5) layers of hyaline, thin-walled angular
cells. CONIDIOGENOUS CELLS 8-14 x 2-3.5 um, cylindrical, tapering towards
the apex, proliferating sympodially or occasionally proliferating percurrently.
Conip1a 4-6 x 1-1.5 um, cylindrical, hyaline, unicellular.
AscoMarta in similar positions to conidiomata on the substratum, scattered
over the pale areas. In surface view, ascomata 1000-1700 x 500-650 um, elliptical
to elongated-elliptical, straight or somewhat curved, ends rounded or obtuse,
black, slightly raising the substratum surface, opening by a single longitudinal
split 3/4—4/5 the length of the ascoma. Lips moderately developed. In median
vertical section, ascomata subcuticular. COVERING STROMA 20-30 um thick
near the opening, increasing to 50-55 um thick not far away from the base,
composed of dark brown textura angularis-epidermoidea with thick-walled
cells 5-8 um diam., connecting to the basal stroma. Lips with a layer of cells
7-14 x 3-4 um, cylindrical, thin-walled, hyaline, 0-1(-2)-septate. Periphysoids
lined on the inner face of the covering stroma, 15-18 x 2-3 um, cylindrical,
straight or curved, frequently swelling at the top, hyaline, 0-2-septate. BASAL
STROMA 5-8 um thick, dark brown, consisting of 1-2 layers of angular, thick-
walled cells. SUBHYMENIUM moderately developed, 10-22 um thick, comprised
of hyaline textura porrecta with a region of colourless, gluey textura angularis
with thin-walled cells 11-14 um diam. at the edge of the ascoma. PARAPHYSES
125-140 x 1-1.5 um, filiform, aseptate, unbranched, often curved but not
swollen at the apex, covered with a 0.5-1 um thick gelatinous coating. Asc
ripening sequentially, 80-120 x 8.5-12 um, cylindrical-clavate, long-stalked,
thin-walled, apex rounded, without circumapical thickening, J-, 8-spored.
Ascosporss biseriate or irregularly arranged, confined to upper half of the
ascus, 12-19 x 2.2-3 um, cylindrical to cylindrical-clavate or clavate, hyaline,
aseptate, with a gelatinous sheath ca 1 um thick.
HOST SPECIES, HABITAT AND DISTRIBUTION: Producing conidiomata and
ascomata on fallen leaves of Litsea elongata. Known only from the type locality,
Anhui Province, China.
ComMENTS — ‘The periphysoidal layer is a structure similar to the lip cells
present in some other species of Rhytismatales. This structure supposedly
helps the covering stroma open when wet and close upon drying (Sherwood
1980). Except for a few Coccomyces and Lophodermium species (Johnston
1986; Sherwood 1980; Spooner 1990, 1991; Lin 1998; Lin et al. 2002), most
rhytismatalean taxa, especially Hypoderma species, lack periphysoids. We
recognize H. mirabile as a new species mainly due to its obvious periphysoidal
layer.
Hypoderma rubi, which produces macroscopically similar ascomata,
conidiomata, and zone lines and similarly shaped asci and ascospores, differs
from H. mirabile in its covering stroma without periphysoids and sharply
Hypoderma mirabile sp nov, (China) ... 229
narrowing from the edge of the opening, septate branched paraphyses, asci
(87-130 x 12-14.5 um), and ascospores [(16—)20-24(-30) x 2.5-3.5 um]
lacking an obvious gelatinous sheath (Cannon & Minter 1986).
The similar H. cordylines P.R. Johnst. is distinguished from H. mirabile by its
covering stroma composed of angular cells that thins gradually or more or less
abruptly toward the outside ascomal edge, well-developed lips, loosely circinate
paraphyses tips, larger asci (90-140 x 11-16 um) slightly thickened at the apex,
uniform elliptic ascospores, the absence of an upper wall in the conidiomata,
and much longer conidia (5-9 um) (Johnston 1990).
From our observations, it seems likely that this new species is a weak parasite
or a saprobe.
Acknowledgments
The authors thank the National Natural Science Foundation of China (No. 30870014,
31270065) and the Specialized Research Fund for the Doctoral Program of Higher
Education of China (No. 20070364002) for financial support. Thanks are also given to
Dr D.W. Minter and Dr M. Ye for critically revising our manuscript.
Literature cited
Cannon PF, Minter DW. 1983. The nomenclacural history and typification of Hypoderma and
Lophodermium. Taxon 32: 572-583. http://dx.doi.org/10.2307/1221727
Cannon PF, Minter DW. 1986. The Rhytismataceae of the India subcontinent. Mycol. Pap. 155:
1-123.
Darker GD. 1967. A revision of the genera of the Hypodermataceae. Can. J. Bot. 45: 1399-1444.
http://dx.doi.org/10.1139/b67-145
De Notaris G. 1847. Prime linee di una nuova disposizione de Pirenomiceti Isterini. Giorn. Bot.
Ital. 2(2-8): 5-52.
Farr DF, Rossman AY. 2012. Fungal Databases, Systematic Mycology and Microbiology Laboratory.
ARS, USDA [http://nt.ars-grin.gov/fungaldatabases/fungushost/FungusHost.cfm (viewed
online on 5 April, 2012)].
Hou CL, Piepenbring M. 2006. Five new species of Hypoderma (Rhytismatales, Ascomycota)
with a key to Hypoderma species known from China. Nova Hedwigia 82: 91-104.
http://dx.doi.org/10.1127/0029-5035/2006/0082-0091
Hou CL, Liu L, Piepenbring M. 2007. A new species of Hypoderma and description of H.rubi
(Ascomycota) from China. Nova Hedwigia 84: 487-493.
http://dx.doi.org/10.1127/0029-5035/2007/0084-0487
Hou CL, Lin YR, Piepenbring M. 2005. Species of Rhytismataceae on needles of Juniperus spp. from
China. Can. J. Bot. 83: 37-46. http://dx.doi.org/10.1139/b04-149
Johnston PR. 1986. Rhytismataceae in New Zealand 1. Some foliicolous species of Coccomyces de
Notaris and Propolis (Fries) Corda. New Zealand J. Bot. 24: 89-124.
http://dx.doi.org/10.1080/0028825X.1986.10409723
Johnston PR. 1990. Rhytismataceae in New Zealand 3. The genus Hypoderma. New Zealand J. Bot.
28: 159-183. http://dx.doi.org/10.1080/0028825X.1990.10412355
Keissler K. 1924. Fungi novi Sinenses a Dr. H. Handel-Mazzetti lect II.. Anzeig. Akad. Wiss. Wein,
Math. Nat. Kl. 61: 10-13.
230 ... Zheng & al.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,
10th ed. CAB International. Wallingford. 771 p.
Korf RP. 1988. Report (N. S. 1) of the Committee for fungi and lichens on proposals to conserve
and/or reject names. Taxon 37: 450-463. http://dx.doi.org/10.2307/1222170
Liang YM, Tian CM, Cao ZM, Yang JX, Kakishima M. 2005. Hypoderma qinlingense sp. nov. on
Sabina squamata from China. Mycotaxon 93: 309-313.
Lin YR. 1998. Studies on Coccomyces de Notaris and Neococcomyces gen. nov. in China.
[Ph.D.thesis; in Chinese]. Northeast Forestry University. Harbin. 95 p.
Lin YR, Hou CL. 1994. A new combination of genus Ploioderma on cones and needles of
Cunninghamia lanceolata [in Chinese]. Acta Mycologica Sinica. 13: 178-180.
Lin YR, Hou CL, Xu ZS, Li K. 2002. Two new species of Lophodermium (Rhytismatales, Discomycetes)
[in Chinese]. 147-150, in: Anhui Plant Pathology Society et al. (eds.), Tactics and future of
integrated pest management. Chinese Agricultural Science Press. Beijing.
Lin YR, Wang SJ, He YE, Ye GB. 2004. Two new taxa of Hypoderma [in Chinese]. Mycosystema
25: 1113,
Petrak EF. 1947. Kritische Studien tiber chinesische Pilze. Sydowia 1: 332-377.
Sherwood MA. 1980. Taxonomic studies in the Phacidiales: The genus Coccomyces (Rhytismataceae).
Occ. Pap. Farlow Herb. Crypt. Bot. 15: 1-120.
Spooner BM. 1990. Coccomyces and Propolis (Rhytismatales) from Mt Kinabalu, Borneo. Kew
Bulletin 45: 451-484. http://dx.doi.org/10.2307/4110513
Spooner BM. 1991. Lophodermium and Hypoderma (Rhytismatales) from Mt Kinabalu, Sabah. Kew
Bulletin 46: 73-100. http://dx.doi.org/10.2307/4110745
Tai FL. 1979. Sylloge Fungorum Sinicorum [in Chinese]. Science Press. Beijing. 1527 p.
Teng SC. 1963. Fungi of China [in Chinese]. Science Press. Beijing. 808 p.
Wang SJ, Liu HY, Chen L, Liu YB, Lin YR. 2007. Two new species of Rhytismataceae [in Chinese].
Mycosystema 26: 161-164.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.231
Volume 122, pp. 231-241 October-December 2012
Yeast species from soil and fallen leaves
new for the mycobiota of Israel
Dmytro M. GOTMAN’, SOLOMON P. WASSER”? & EVIATAR NEVO!
"Institute of Evolution and Department of Evolutionary and Environmental Biology,
Faculty of Natural Sciences, University of Haifa, Mount Carmel, Haifa 31905, Israel
°M. G. Kholodny Institute of Botany of the National Academy of Science of Ukraine,
2 Tereshchenkivska St., Kyiv 01601, Ukraine
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — We investigated the species diversity of yeasts from soil and fallen leaves of
Israel based on sequencing of the D1/D2 domain of 26S rDNA. Seven new yeast records
found for Israel were Apiotrichum nothofagi, Cryptococcus carnescens, C. phenolicus,
C. terreus, Komagataella pastoris, Rhodosporidium lusitaniae, and Schwanniomyces
occidentalis.
Key worps — Ascomycota, Basidiomycota, Middle East, molecular methods
Introduction
The biodiversity of yeasts in Israel has not been studied well. There has not
been any critical research regarding the biodiversity of this group of fungi.
One thorough investigation was done at the “Evolution Canyon” microsite
in Mount Carmel by Nagornaya et al. (2003). Some selective studies were
dedicated to the biodiversity of yeasts in hypersaline water habitats (Butinar et
al. 2005). Yarrowia lipolytica was found together with Rhodotorula glutinis on
salt-excreting leaves of Atriplex halimus plants in the central Negev Highlands
of Israel (Zvyagilskaya et al. 2001). Many yeast species were collected in
vineyards in the Coastal Plain of Israel (Zahavi et al. 2002), and Metschnikowia
fructicola was first described from grape surfaces in Israel (Kurtzman & Droby
2001). Metschnikowia reukaufii was isolated from pollen of Asclepias syriaca
(Eisikowitch et al. 1990). Clavispora lusitaniae was first described from citrus
essence in Israel (Rodrigues de Miranda 1979). Several yeast species have been
recorded on mites, in citrus products and organic acid media, on Zea mays, and
on grapefruit (Smith 1986, Steiman et al. 1997, Schena et al. 2000, Boekhout et
al. 2003, Savchenko et al. 2010, Kurtzman et al. 2011).
232 ...Gotman, Wasser & Nevo
Forty-two yeast species are reported in the literature from Israel: 24
ascomycetes (in 15 genera and eight families) and 18 basidiomycetes (in nine
genera and eight orders).
We investigated yeast species diversity of soil and fallen leaves based on
sequencing of the D1/D2 domain of 26S ribosomal DNA in order to achieve
better insight into the biodiversity of yeast species in Israel.
Materials & methods
Collection site
Soil and fallen leaves samples were collected in En Ziwan, 33°11'09"N 35°79'10"E,
Golan Heights; Carmel National Park, 32°75'00"N 35°02'70"E, Carmel Mount; and
Kefar Kisch, 32°65'32"N 35°45'06"E, Lower Galilee.
Isolation techniques
To isolate the yeasts from soil and fallen leaves, 10 g of each sample was diluted in 100
ml of sterile double-distilled water and placed on the orbital shaker for one hour at 150
rpm at room temperature. After shaking, each sample was diluted decimally; 0.15 ml of
each dilution was spread on acidified yeast-malt (YM) agar (1% glucose, 0.5% peptone,
0.3% yeast extract, 0.3% malt extract, and 2% agar) pH 3.7-3.8, or YM agar containing
chloramphenicol (0.01%) and sodium propionate (0.2%) for suppression of bacterial and
mold growth. The plates were incubated at 25°C for 3-7 days. Representative colonies
of each morphology type were picked and streaked onto new YM agar plates. The purity
of yeast cultures was ascertained using light microscopy. Color names follow Rayner
(1969). The yeast cultures were stored at 4°C in YM agar plates. They are available from
culture collection of the Institute of Evolution, University of Haifa (HAI, Haifa, Israel).
For long-term preservation they were frozen at -80°C in 25% glycerol YM medium.
Molecular-biological methods
Yeasts were identified taxonomically using molecular-biological methods. DNA
was extracted according to Hoffman & Winston (1987) with Gottschling (http://labs.
fherc.org/gottschling/Yeast%20Protocols/qgprep.html) and Dunham (http://dunham.
gs.washington.edu/MDyeastDNAprep.htm) modifications. DNA concentration
was measured using the NanoDrop®ND-1000 spectrophotometer (NanoDrop
Technologies, Montchanin, Delaware, U.S.A.). The concentration of DNA was adjusted
to 10 ng/ul for further applications. Diluted DNA (10ng/ul) was used as a PCR template.
The D1/D2 domain of the large subunit (26S) of ribosomal DNA (rDNA) was amplified
on GeneAmp® PCR System 9700 (Applied Biosystems, USA) using primers NL1 (5'-
GCATATCAATAAGCGGAGGAAAAG) and NL4 (5’-GGTCCGTGTTTCAAGACGG) (O’Donnell
1993), and ABgene® Thermo Scientific 2X ReddyMix PCR Master Mix w/1.5 mM
MgCl (Applied Biosystems, California, USA). PCR cycling conditions included initial
denaturation (95°C for 5 min), 5 extension cycles (94°C for 45 s, primer annealing at
55°C for 45 s, primer extension at 72°C for 1 min), 29 denaturation cycles (95°C for
30 s, primer annealing at 60°C for 30 s, primer extension at 72°C for 1 min), and a
final elongation step at 72°C for 10 min. PCR products were visualized in 1.5% agarose
gel, stained with GelRedTM Nucleic Acid Gel Stain, 10,000x in water (Biotium, Inc.,
Yeasts new to Israel ... 233
Hayward, California), and viewed under UV. PCR products were cleaned using an
ExoSAP-IT (USB Corp.) following the manufacturer's instructions.
The PCR products were sent to the Technion (Israel Institute of Technology, The
Bruce Rappaport Faculty of Medicine) Medicine Lab for sequencing, which was
performed on 3130xl Genetic Analyzer (Applied Biosystems, USA) using the PCR
primers and Big Dye® Terminator v 1.1 Cycle (Applied Biosystems, USA). We identified
the yeast species in a BLAST search. BLASTN 2.2.26+ program was to align sequences
and compare them with type strains, percentage of query coverage, and max identity
(Zhang et al. 2000). All sequences were registered in GenBank.
Results
Analysis of the 26S rDNA D1/D2 sequences revealed seven yeast species
not previously reported for Israel, of which two are ascomycetes (K. pastoris,
S. occidentalis) and five are basidiomycetes (A. nothofagi, C. carnescens, C. phenolicus,
C. terreus, R. lusitaniae).
Apiotrichum nothofagi C. Ramirez & A.E. Gonzalez, Mycopathologia
88(2-3): 76 (1984) [as “Apiotricum” ]. FIG?
Type: Chile, Futrono, in evergreen rainy Valdivian forest, from decayed wood of
Nothofagus obliqua, 1980, A. Gonzalez (IJFM 6018).
= Rhodotorula nothofagi C. Ramirez & A.E. Gonzalez, Mycopathologia 91(3):
171 (1985), nom. illegit. [superfluous sp. nov., based on same type].
= Rhodotorula nothofagi (C. Ramirez & A.E. Gonzalez) Roeijmans, Eijk & Yarrow,
Mycotaxon 35(2): 406 (1989), nom. illegit. [superfluous, later homonym].
CELLS after 3 days growth on YM agar at 25°C subglobose to ellipsoid, 3-4
x 6-11 um, occurring mostly singly or in pairs. Budding predominantly polar.
CoLonlies white and smooth.
SPECIMENS EXAMINED — ISRAEL. CARMEL Mownrt, Haifa, Carmel National Park,
32°75'18"N 35°02'69"E, 18.XII.2010, from fallen needles of Pinus halepensis, leg. D.M.
Gotman (HAI-Y-35; GenBank JQ581048); LowER GALILEE, Kefar Kish, 32°65'32”N
35°45'06"E, 22.XII.2010, from fallen leaves of Ceratonia siliqua, leg. D.M. Gotman
(HAI-Y-81; GenBank JQ581049).
ComMENTSs - Apiotrichum nothofagi belongs to the Curvibasidium clade of
Microbotryomycetes. A single strain IJFM 6018 (CBS 8166) was isolated in
1980 from decayed wood of Nothofagus obliqua. In 1984, Ramirez & Gonzalez
described a new taxon, Apiotrichum nothofagi, citing JFM 6018 as type culture.
The following year, they published Rhodotorula nothofagi as a new species,
also citing IJFM 6018 as type culture, rendering R. nothofagi a superfluous
and illegitimate name (ICBM [Vienna Code] Art. 52.1). Apparently unaware
that R. nothofagii had already been validly published by Ramirez & Gonzalez,
Roeijmans et al. (1989) recombined A. nothofagi as Rhodotorula nothofagi, a
comb. nov. that is also a superfluous and illegitimate later homonym. We cite
this taxon here under its only legitimate name, Apiotrichum nothofagi, but it
234 ...Gotman, Wasser & Nevo
requires a nom. nov. in Rhodotorula, since both existing Rhodotorula names
are illegitimate.
DISTRIBUTION - Europe, North America, South America (Gadanho et al. 2003,
Maksimova & Chernov 2004, Villa-Carvajal et al. 2004, Langdon et al. 2005, Rodrigues
et al. 2009, Golubev & Tomashevskaya 2010).
Cryptococcus carnescens (Verona & Luchetti) M. Takash. et al., Int. J. Syst. Evol.
Microbiol. 53(4): 1192 (2003) FIG. 2
CELLS after 3 days growth on YM agar at 25°C single, ellipsoidal or
subglobose, 3-7 um; budding monopolar. CoLontzs [D]-colored, smooth.
SPECIMEN EXAMINED — ISRAEL. GOLAN HEIGHTS, En Zivan, 33°11'09"N 35"79'10"E,
11.1.2011, from fallen leaves of Quercus boissieri, leg. D.M. Gotman (HAI-Y-183;
GenBank JQ317682).
COMMENTS - Cryptococcus carnescens belongs to the Tremellales
(Tremellomycetes).
DISTRIBUTION — Europe, Asia, Antarctica (Gadanho et al. 2003, Wuczkowski et al. 2005,
Butinar et al. 2007, Connell et al. 2008, Golubev & Tomashevskaya 2010, Li et al. 2010,
Loque et al. 2010, Kurtzman et al. 2011, Baleiras-Couto et al. 2012).
Cryptococcus phenolicus A. Fonseca et al., Can. J. Microbiol. 46(1): 24 (2000) Fie. 3
CELLS after 3 days growth on YM agar at 25°C single, globose, 4-8 um in
diam; budding monopolar. Cotonizs [B]-colored with glossy and smooth
surfaces.
SPECIMEN EXAMINED — ISRAEL. GOLAN HEIGHTS, En Zivan, 33°11'16"N 35"79'10"E,
11.1.2011, from grassland soil, leg. D.M. Gotman (HAI-Y-158; GenBank JQ581045).
ComMEntTs - This species belongs to the Filobasidiales lineage. Based on its
ability to degrade phenol, C. phenolicus may be used to assimilate different
aromatic compounds (Fonseca et al. 2000).
DISTRIBUTION — Europe, Asia, South America, Africa (Hong et al. 2002, Cornelissen et
al. 2003, Zachow et al. 2009, Vreulink et al. 2010, Mestre et al. 2011).
Cryptococcus terreus Di Menna, J. Gen. Microbiol. 11: 195 (1954) FIG. 4
CELLS after 3 days growth on YM agar at 25°C single, mainly globose, 5-11
um in diam; budding monopolar. Cotontgs [C/E]-colored, with glossy smooth
surfaces.
SPECIMEN EXAMINED — ISRAEL. GOLAN HEIGHurTs, En Zivan, 33°11'16"N 35"79'10"E,
11.1.2011, from grassland soil, leg. D.M. Gotman (HAI-Y-162; GenBank JQ581046).
Comments - This species is also in the Filobasidiales lineage with C. phenolicus
and was isolated from the same habitat. Apparently, C. terreus is a soil inhabitant.
As with C. phenolicus, C. terreus can assimilate phenol and phenol-related
compounds (Bergauer et al. 2005). Cryptococcus terreus, C. fuscescens, and
C. phenolicus are the main cryptococcal soil inhabitants (Kurtzman et al. 2011).
Yeasts new to Israel ... 235
Fics 1-4. Yeast cells after two days of growing on YM medium, dark field light microscopy.
1. A. nothofagi; 2. C. carnescens; 3. C. phenolicus; 4. C. terreus.
Scale bar = 10 um.
DISTRIBUTION — Europe, Asia, North America, South America, Oceania (Ba et al. 2000;
Slavikova &Vadkertiova 2000; Hong et al. 2002, 2006; Maksimova & Chernov 2004;
Mankowski & Morrell 2004; Bergauer et al. 2005; Langdon et al. 2005; Borelli et al. 2006;
Lynch & Thorn 2006; Vishniac 2006; Rodrigues et al. 2009; Singh et al. 2009; Wang et al.
2009; Golubev & Tomashevskaya 2010; Mestre et al. 2011).
Komagataella pastoris (Guillierm.) Y. Yamada et al., Biosc., Biotechn.,
Biochem. 59(3): 444 (1995) Fic. 5
CELLS after 3 days growth on YM agar at 25°C spherical to ovoid, 2-6 um,
occurring singly or in pairs; budding polar. COLONIEs white, mucoid.
SPECIMEN EXAMINED — ISRAEL. CARMEL Mount, Haifa, Carmel National Park,
32°75'03"N 35°02'77"E, 18.X11.2010, from soil under Quercus calliprinos, leg. D.M.
Gotman (HAI-Y-67; GenBank JQ581044).
236 ...Gotman, Wasser & Nevo
Fics 5-7. Yeast cells after two days of growing on YM medium, dark field light microscopy.
5. K. pastoris; 6. R. lusitaniae; 7. S. occidentalis.
Scale bar = 10 um.
ComMENnts - K. pastoris represents Phaffomycetaceae in the Saccharomycetales.
The major habitats of K. pastoris are tree exudates and decomposing wood.
Phylogenetically, it is very close to K. phaffii and K. pseudopastoris, having no
differences in fermentation and growth, but only in D1/D2 LSU rRNA gene
sequences (Kurtzman 2005). They also were isolated from tree exudates and
rotted wood. K. pastoris has a strong biotechnological potential as a recombinant
protein production system (Heyland et al. 2010).
DISTRIBUTION — Europe, North America, South America, Africa (Phaff & Knapp 1956;
Faparusi 1981; Lachance et al. 1982, 1995; Spencer et al. 1995; Dlauchy et al. 2003).
Yeasts new to Israel ... 237
Rhodosporidium lusitaniae A. Fonseca & J.P. Samp., Syst. Appl. Microbiol.
15(1): 48 (1992) FIG. 6
CE.LSafter 3 days growth on YM agar at 25°C single, cylindrical to bacilliform,
3-4 x 9-11 um; budding polar. CoLontzs apricot colored, smooth.
SPECIMEN EXAMINED — ISRAEL. CARMEL Mownrt, Haifa, Carmel National Park,
32°75'00"N 35°02'70"E, 18.X1I.2010, from fallen leaves of Quercus calliprinos, leg. D.M.
Gotman (HAI-Y-58; GenBank JQ581047).
ComMENTS - Rhodosporidium lusitaniae is classified in Sporidiobolales
(Microbotryomycetes).
DISTRIBUTION — Europe (Bergauer et al. 2005), where it is restricted to Austria, Israel,
and Portugal.
Schwanniomyces occidentalis Klécker, Meddn Carlsberg Lab. 7: 276 (1909) Fic. 7
CELLS after several days growth on YM agar at 25°C globose to ovoid, 5-11
um in diam., singly or in pairs and small chains; budding polar. COLONIES
white, smooth.
SPECIMEN EXAMINED — ISRAEL. LOWER GALILEE, Kefar Kish, 32°65'45"N 35°44'44"E,
22.XII.2010, from soil, leg. D.M. Gotman (HAI-Y-90; GenBank JQ581050).
Comments - Almost all known strains of this species in the Debaryomycetaceae
(Saccharomycetales) have been isolated from soil. Schwanniomyces occidentalis,
which is regarded as an important “non-conventional” yeast with potential
biotechnological value, has a good capacity for starch degradation. Several
genetic models were developed for the production of heterologous proteins
from S. occidentalis (Spencer et al. 2002).
DISTRIBUTION — Europe, Asia, North America (Capriotti 1957, Phaff et al. 1960, Urano
et al. 2002, Slavikova &Vadkertiova 2003, Boby et al. 2008).
Discussion
Our research has revealed seven yeast species new for Israeli mycobiota.
Four were found in soil (C. phenolicus, C. terreus, K. pastoris, S. occidentalis),
one on fallen leaves of Quercus boissieri (C. carnescens), and one on fallen
leaves of Quercus calliprinos (R. lusitaniae). Apiotrichum nothofagi was isolated
both from fallen leaves of Ceratonia siliqua and from fallen needles of Pinus
halepensis. Five species are new for the Middle East. Only C. terreus and
S. occidentalis were previously recorded in Egypt (Youssef & Eldin 1998, El-
Assal et al. 2011).
Worldwide, Cryptococcus terreus and Schwanniomyces occidentalis have been
isolated from various soil types and have wide geographical distribution. The
cosmopolitan C. carnescens has been found on different substrates all over the
world. Besides soil, C. carnescens has been isolated from grape surface, seawater,
marine microalgae, leaves, needle litter, and even from such extreme habitats as
238 ...Gotman, Wasser & Nevo
glacial ice. Soil and leaf litter are the main habitats for Rhodosporidium lusitaniae,
which may possibly inhabit the entire Mediterranean region in addition to
Israel and Portugal; its connection with Mediterranean forest ecosystems can
be traced. Komagataella pastoris, associated with tree exudates in deciduous
forests, has been recorded in different parts of the world. In Israel it was found
in soil (under oak), an unusual habitat for the species; yeast cells may possibly
have entered the soil from decayed oak wood. ‘The habitat of A. nothofagi is not
so clear, as the species has been recorded only a few times, mainly associated
with forest litter and decayed wood. This species has also been isolated from
seawater and blueberry fruit.
Acknowledgments
We are grateful to Dr. Andriy Sibirny (Lviv, Ukraine), Dr. Paul Volz (Jacksonville, FL,
USA) for critically reviewing of the manuscript, and to Dr. Kyria Boundy-Mills (Davis,
USA) for useful comments to the paper. We would like to express our deep thanks to Dr.
Shaun Pennycook (Auckland, New Zealand) for the nomenclature review of the article.
Literature cited
Ba AS, Phillips SA, Anderson JT. 2000. Yeasts in mound soil of the red imported fire ant. Mycol.
Res. 104: 969-973. http://dx.doi.org/10.1017/S0953756299002385
Baleiras-Couto MM, Gomes AS, Casal M, Duarte FL. 2012. Survey of yeast diversity during wine
bottling processes using restriction analysis of 26S ribosomal DNA (rDNA). Aust. J. Grape
Wine Res. 18: 39-42. http://dx.doi.org/10.1111/j.1755-0238.2011.00167.x
Bergauer P, Fonteyne P-A, Nolard N, Schinner F, Margesin R. 2005. Biodegradation of phenol and
phenol-related compounds by psychrophilic and cold-tolerant alpine yeasts. Chemosphere 59:
909-918. http://dx.doi.org/10.1016/j.chemosphere.2004.11.011
Boby VU, Balakrishna AN, Bagyaraj DJ. 2008. Interaction between Glomus mosseae and soil yeasts
on growth and nutrition of cowpea. Microbiol. Res. 163: 693-700.
http://dx.doi.org/10.1016/j.micres.2006.10.004
Boekhout T, Theelen B, Houbraken J, Robert V, Scorzetti G, Gafni A, Gerson U, Sztejnberg A. 2003.
Novel anamorphic mite-associated fungi belonging to the Ustilaginomycetes: Meira geulakonigii
gen. nov., sp. nov., Meira argovae sp. nov. and Acaromyces ingoldii gen. nov., sp. nov. Int. J. Syst.
Evol. Microbiol. 53: 1655-1664. http://dx.doi.org/10.1099/ijs.0.02434-0
Borelli BM, Ferreira EG, Lacerda ICA, Franco GR, Rosa CA. 2006. Yeast populations associated
with the artisanal cheese produced in the region of Serra da Canastra, Brazil. World J. Microbiol.
Biotechnol. 22: 1115-1119. http://dx.doi.org/10.1007/s11274-006-9151-3
Butinar L, Santos S, Spencer-Martins I, Oren A, Gunde-Cimerman N. 2005. Yeast diversity in
hypersaline habitats. FEMS Microbiol. Lett. 244: 229-234.
http://dx.doi.org/10.1016/j.femsle.2005.01.043
Butinar L, Spencer-Martins I, Gunde-Cimerman N. 2007. Yeasts in high Arctic glaciers: the
discovery of a new habitat for eukaryotic microorganisms. Antonie van Leeuwenhoek 97:
277-289. http://dx.doi.org/10.1007/s10482-006-9117-3
Capriotti A. 1957. New Blastomycetes isolated from soils of Spain I: Schwanniomyces castellii nov.
spec. Arch.Mikrobiol. 26: 434-438. http://dx.doi.org/10.1007/BF00407592
Connell L, Redman R, Craig S, Scorzetti G, Iszard M, Rodriguez R. 2008. Diversity of
soil yeasts isolated from South Victoria Land, Antarctica. Microb. Ecol. 56: 448-459.
http://dx.doi.org/10.1007/s00248-008-9363-1
Yeasts new to Israel ... 239
Cornelissen $, Botha A, Conradie WJ, Wolfaardt GM. 2003. Shifts in community composition
provide a mechanism for maintenance of activity of soil yeasts in the presence of elevated
copper levels. Can. J. Microbiol. 49: 425-432. http://dx.doi.org/10.1139/w03-057
Dlauchy D, Tornai-Lehoczki J, Fulop L, Péter G. 2003. Pichia (Komagataella) pseudopastoris sp.
nov., a new yeast species from Hungary. Antonie van Leeuwenhoek 83: 327-332.
http://dx.doi.org/10.1023/A:10233 18829389
Eisikowitch D, Kevan PG, Lachance MA. 1990. The nectar-inhabiting yeasts and their effect on
pollen germination in common milkweed, Asclepias syriaca L. Isr. J. Bot. 39: 217-225.
El-Assal SED, Abd-alla SM, Abou Seada MN. 2011. Molecular and biochemical studies of some
yeast strains. Afr. J. Biotechnol. 10: 1309-1319.
Faparusi SI. 1981. Sugars identified in raphia palm wine. Food Chem. 2: 81-86.
http://dx.doi.org/10.1016/0308-8146(81)90052-2
Fonseca A, Scorzetti G, Fell JW. 2000. Diversity in the yeast Cryptococcus albidus and related species
as revealed by ribosomal DNA sequence analysis. Can. J. Microbiol. 46: 7-27.
http://dx.doi.org/10.1139/cjm-46-1-7
Gadanho M, Almeida JMGCE, Sampaio JP. 2003. Assessment of yeast diversity in a marine
environment in the south of Portugal by microsatellite-primed PCR. Antonie van Leeuwenhoek
84: 217-227. http://dx.doi.org/10.1023/A:1026038213195
Golubev WI, Tomashevskaya MA. 2010. Yeast fungi in Picea abies (L.) Karst. needle litter.
Microbiology 79: 385-389. http://dx.doi.org/10.1134/S002626171003015X
Heyland J, Fu J, Blank LM, Schmid A. 2010. Quantitative physiology of Pichia pastoris during
glucose-limited high-cell density fed-batch cultivation for recombinant protein production.
Biotechnol. Bioeng. 107: 357-368. http://dx.doi.org/10.1002/bit.22836
Hoffman C, Winston F. 1987. A ten-minute DNA preparation from yeast efficiently releases
autonomous plasmids for transformation of Escherichia coli. Gene 57: 267-272.
http://dx.doi.org/10.1016/0378-1119(87)90131-4
Hong SG, Lee KH, Bae KS. 2002. Diversity of yeasts associated with natural environments in Korea.
J. Microbiol. 40: 55-62.
Hong SG, Lee KH, Kwak J, Bae KS. 2006. Diversity of yeasts associated with Panax ginseng.
J. Microbiol. 44: 674-679.
Kurtzman CP. 2005. Description of Komagataella phaffii sp. nov. and the transfer of Pichia
pseudopastoris to the methylotrophic yeast genus Komagataella. Int. J. Syst. Evol. Microbiol. 55:
973-976. http://dx.doi.org/10.1099/ijs.0.63491-0
Kurtzman CP, Droby S. 2001. Metschnikowia fructicola, a new ascosporic yeast with potential for
biocontrol of postharvest fruit rots. System. Appl. Microbiol. 24: 395-399.
http://dx.doi.org/10.1078/0723-2020-00045.
Kurtzman CP, Fell JW, Boekhout T. 2011. The yeasts - a taxonomic study. 5th edn. Elsevier
Science.
Lachance MA, Mencalf BJ, Starmer WT. 1982. Yeast from exudates of Quercus, Ulmus, Populus,
and Pseudotsuga: new isolations and elucidation of some factors affecting ecological specifity.
Microb. Ecol. 8: 191-198. http://dx.doi.org/10.1007/BF02010452
Lachance MA, Gilbert DG, Starmer WT. 1995. Yeast communities associated with Drosophila
species and related flies in an eastern oak-pine forest: a comparison with western communities.
J. Ind. Microbiol. 14: 484-494. http://dx.doi.org/10.1007/BF01573963
Langdon D, Hildebrand PD, Traquair JA. 2005. Yeasts of lowbush blueberry: potential biocontrol
agents for blueberry diseases. Can. J. Plant Pathol. 27: 471.
Li S-H, Cheng C, Li Z, Chen J-Y, Yan B, Han B-Z, Reeves M. 2010. Yeast species associated with
wine grapes in China. Int. J. Food Microbiol. 138: 85-90.
http://dx.doi.org/10.1016/j.ijfoodmicro.2010.01.009
240 ... Gotman, Wasser & Nevo
Loque CP, Medeiros AO, Pellizzari FM, Oliveira EC, Rosa CA, Rosa LH. 2010. Fungal
community associated with marine macroalgae from Antarctica. Polar Biol. 33: 641-648.
http://dx.doi.org/10.1007/s00300-009-0740-0
Lynch MDJ, Thorn RG. 2006. Diversity of basidiomycetes in Michigan agricultural soils. Appl.
Environ. Microbiol. 72: 7050-7056. http://dx.doi.org/10.1128/AEM.00826-06
Maksimova IA, Chernov IY. 2004. Community structure of yeast fungi in forest biogeocenoses.
Microbiology 73: 474-481. http://dx.doi.org/10.1023/B:MICI.0000036994.21650.3a
Mankowski ME, Morrell JJ. 2004. Yeasts associated with the infrabuccal pocket and colonies of the
carpenter ant Camponotus vicinus. Mycologia 96: 226-231. http://dx.doi.org/10.2307/3762058
Mestre MC, Rosa CA, Safar SVB, Libkind D, Fontenla SB. 2011.Yeast communities associated
with the bulk-soil, rhizosphere and ectomycorrhizosphere of a Nothofagus pumilio
forest in northwestern Patagonia, Argentina. FEMS Microbiol. Ecol. 78: 531-541.
http://dx.doi.org/10.1111/j.1574-6941.2011.01183.x
Nagornaya S, Babich T, Podgorsky V, Beharav A, Nevo E, Wasser S. 2003. Yeast interslope divergence
in soils and plants of “Evolution Canyon’, Lower Nahal Oren, Mount Carmel, Israel. Isr. J. Plant
Sci. 51: 55-57. http://dx.doi.org/10.1560/RMNC-XLYU-456X-V6E5
O'Donnell K. 1993. Fusarium and its near relatives. 225-233, in: DR Reynolds, JW Taylor (eds).
The Fungal Holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics.
CAB International, Wallingford, UK.
Phaff HJ, Knapp EP. 1956. The taxonomy of yeasts found in exudates of certain trees and other
natural breeding sites of some species of Drosophila. Antonie van Leeuwenhoek 22: 117-130.
http://dx.doi.org/10.1007/BF02538319
Phaff HJ, Miller MW, Cooke WB. 1960. A new species of Schwanniomyces: Schwanniomyces alluvius.
Antonie van Leeuwenhoek 26: 182-188. http://dx.doi.org/10.1007/BF02539003
Rayner R. 1969. Flora of British fungi: colour identification chart. Edinburg, Her Majesty's
stationery office.
Rodrigues A, Cable RN, Mueller UG, Bacci M, Pagnocca FC. 2009. Antagonistic interactions
between garden yeasts and microfungal garden pathogens of leaf-cutting ants. Antonie Van
Leeuwenhoek 96: 331-342. http://dx.doi.org/10.1007/s10482-009-9350-7
Rodrigues de Miranda L. 1979. Clavispora, a new yeast genus of the Saccharomycetales. Antonie van
Leeuwenhoek 45: 479-483. http://dx.doi.org/10.1007/BF00443285
Savchenko KG, Heluta VP, Wasser SP, Nevo E. 2010. Smut fungi of Israel: a preliminary check-list.
Mycologia Balcanica 7: 111-116.
Schena L, Ippolito A, Zahavi T, Cohen L, Droby S. 2000. Molecular approaches to assist the
screening and monitoring of postharvest biocontrol yeasts. Eur. J. Plant Pathol. 106: 681-691.
http://dx.doi.org/10.1023/A:10087 16018490
Singh V, Praveen V, Banga J, Tripathi CKM. 2009. Antimicrobial activities of microbial strains
isolated from soil of stressed ecological niches of Eastern Uttar Pradesh, India. Indian J. Exp.
Biol. 47: 298-303.
Slavikova E, Vadkertiova R. 2000. The occurrence of yeasts in the forest soils. J. Basic Microbiol. 40:
207-212. http://dx.doi.org/10.1002/1521-4028(200007)40:3<207::AID-JOBM207>3.0.CO;2-H
Slavikova E, Vadkertiova R. 2003. The diversity of yeasts in the agricultural soil. J. Basic Microbiol.
43: 430-436. http://dx.doi.org/10.1002/jobm.200310277
Smith M. 1986. Zygoascus hellenicus gen. nov., sp. nov., the teleomorph of Candida hellenica
(= C. inositophila = C. steatolytica). Antonie van Leeuwenhoek 52: 25-37.
http://dx.doi.org/10.1007/BF00402684
Yeasts new to Israel ... 241
Spencer DM, Spencer JFT, Fengler E, Defigueroa LI. 1995. Yeast associated with algarrobo trees
(Prosopis spp.) in northwest Argentina: preliminary report. J. Ind. Microbiol. 14: 472-474.
http://dx.doi.org/10.1007/BF01573960
Spencer JFT, Ragout de Spencer AL, Laluce C. 2002. Non-conventional yeasts. Appl. Microbiol.
Biotechnol. 58: 147-156. http://dx.doi.org/10.1007/s00253-001-0834-2
Steiman R, Guiraud P, Sage L, Seigle-Murandi F. 1997. Soil mycoflora from the Dead Sea Oases of
Ein Gedi and Einot Zuqim (Israel). Antonie Van Leeuwenhoek 72: 261-270.
http://dx.doi.org/10.1023/A:1000441705073
Urano N, Ueno R, Kimura S. 2002. Isolation of aquatic yeasts and their bioremedial application in
fisheries. Fish. Sci. 68: 639-640.
Villa-Carvajal M, Coque JJR, Alvarez-Rodriguez ML, Uruburu F, Belloch C. 2004. Polyphasic
identification of yeasts isolated from bark of cork oak during the manufacturing process of cork
stoppers. FEMS Yeast Res. 4: 745-750. http://dx.doi.org/10.1016/j.femsyr.2004.01.007
Vishniac HS. 2006. A multivariate analysis of soil yeasts isolated from a latitudinal gradient. Microb.
Ecol. 52: 90-103. http://dx.doi.org/10.1007/s00248-006-9066-4
Vreulink JM, Stone W, Botha A. 2010. Effects of small increases in copper levels on culturable
basidiomycetous yeasts in low-nutrient soils. J. Appl. Microbiol. 109: 1411-1421.
http://dx.doi.org/10.1111/j.1365-2672.2010.04770.x
Wang GH, Xu YX, Jin J, Liu JD, Zhang QY, Liu XB. 2009. Effect of soil type and soybean genotype
on fungal community in soybean rhizosphere during reproductive growth stages. Plant Soil
317: 135-144. http://dx.doi.org/10.1007/s11104-008-9794-y
Wuczkowski M, Metzger E, Sterflinger K, Prillinger H. 2005. Diversity of yeasts isolated from litter
and soil of different natural forest sites in Austria. Die BodenKultur 56: 201-208.
Youssef YA, Eldin AK. 1998. Airborne spores of opportunistic fungi in the atmosphere of Cairo,
Egypt. Grana 27: 89-92. http://dx.doi.org/10.1080/00173138809427737
Zachow C, Berg C, Mueller H, Meincke R, Komon-Zelazowska M, Druzhinina IS, Kubicek CP,
Berg G. 2009. Fungal diversity in the rhizosphere of endemic plant species of Tenerife (Canary
Islands): relationship to vegetation zones and environmental factors. ISME J. 3: 79-92.
http://dx.doi.org/10.1038/ismej.2008.87
Zahavi T, Droby S, Cohen L, Weiss B, Ben-Arie R. 2002. Characterization of the yeast flora on the
surface of grape berries in Israel. Vitis 41: 203-208.
Zhang Z, Schwartz S, Wagner L, Miller W. 2000. A greedy algorithm for aligning DNA sequences.
J. Comput. Biol. 7: 203-214. http://dx.doi.org/10.1089/10665270050081478
Zvyagilskaya R, Andreishcheva E, Soares M, Khozin I, Berhe A, Persson B. 2001. Isolation and
characterization of a novel leaf-inhabiting osmo-, salt-, and alkali-tolerant Yarrowia lipolytica
yeast strain. J. Basic Microbiol. 41: 289-303.
http://dx.doi.org/10.1002/1521-4028(200110)41:5<289::AID-JOBM289>3.0.CO;2-S
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.243
Volume 122, pp. 243-247 October-December 2012
A new record of the desert truffle Picoa lefebvrei in Saudi Arabia
ABDULHAKIM BAWADEKJI’, MARIA LETIZIA GARGANO?’,
ALESSANDRO SAITTA? & GIUSEPPE VENTURELLA”*
‘Northern Borders University, Faculty of Science,
Arar, P.O. Box 1631, Kingdom of Saudi Arabia
?Dipartimento di Biologia Ambientale e Biodiversita,
Via Archirafi 38, I-90123 Palermo, Italy
*CORRESPONDENCE TO: giuseppe.venturella@unipa. it
ABsTRACT — A new record of Picoa lefebvrei from Saudi Arabia is reported accompanied by
notes on its taxonomy, ecology, and distribution.
Key worps — truffle, drip irrigation, Arar
Introduction
Hypogeous mushrooms named desert truffles are commercialized in Saudi
Arabia under the local name of faqaa [including khalasi, which belongs to
Terfezia (Tul. & C. Tul.) Tul. & C. Tul., and zubaidi, which is used for species
of Tirmania Chatin]. Local populations appreciate desert truffles for their
nutritional and sensory qualities (Bokhary & Parvez 1988). Picoa lefebvrei or
bird truffle (known locally as hober) was first reported by Bokhary & Parvez
(1988; as Phaeangium lefebvrei Pat.) from Harrat al Harra in Al Jouf Province
(northern Saudi Arabia). During winter and spring field excursions in the
eastern sector of Northern Borders Province, the senior author (A. Bawadekji)
discovered a new locality in Saudi Arabia for P. lefebvrei.
Materials & methods
The investigation was carried out from November to March during 2010-12. The
habitat was recorded and the collected samples were identified by examining the peridium
and gleba. Ascospores were examined in water under a Leica DMLB microscope.
Nomenclature follows MycoBank (http://www.mycobank.org). The collection is
deposited in the newly established Herbarium of the Department of Biological Sciences,
Northern Borders University, Kingdom of Saudi Arabia (here cited as KSA); a duplicate
is stored in the Herbarium Mediterraneum Panormitanum in Palermo (PAL).
244 ... Bawadekji & al.
——
Fic. 1: Picoa lefebvrei.
a. Habitat of growth. b. A typical outgrowth of the soil. c. Ascomata. d. Detail of peridium.
Picoa lefebvrei in Saudi Arabia ... 245
Fic. 1: Picoa lefebvrei.
a. Ascus and ascospores. b. Peridial hyphae.
Species description
Picoa lefebvrei (Pat.) Maire, Ann. Mycol. 4: 332. 1906. FIGS 1, 2
Ascomata irregularly globose, surface shining when ripe, hypogeous and
semi-hypogeous, growing in groups, 0.5-8 cm diameter, brown-ochre, covered
by numerous and small irregular warts, 1-2 mm wide, ca. 1 mm tall, sparse.
Peridium 0.5 mm thick, pseudoparenchymatic, with angular-subglobose
elements bearing septate hairs, ochre-brown to brown, filled with fine granules,
246 ... Bawadekji & al.
thick-walled, 100-120 x 8-10 um. Cylindrical hyaline hyphae are present under
the subglobose cells layer. Odour Terfezia-like, not as strong at the beginning
of fruiting season (November to mid-January), becoming more intense as
the air and soil temperatures increase. Gleba firm, whitish, veins more or less
evident. Asci ellipsoidal, with 6-8 spores, 50-110 x 50-75 um, encompassed
in the trama, with a long peduncle, then subglobose and shortly pedunculate.
Ascospores disorderly arranged in the ascus (Fic. 2), subglobose to broadly
ellipsoidal, 25-30 x 20-25 um, hyaline with a big guttule when unripe, then pale
olive and covered by tiny, rounded, cyanophilous warts.
SPECIMENS EXAMINED: SAUDI ARABIA. NORTHERN BORDERS PROVINCE, Muayala
Natural Reserve, 15 km south of Arar, 30°54'24"N 40°59'56"E, 552 m, on pastures, on
calcareous and sandy soils with neutral pH reaction and low levels of organic matter, 10
Jan 2010 (provisional number KSA 001), 20 Dec 2011 (provisional number KSA 002),
13 Jan 2012 (PAL 001/KSA), coll. A. Bawadekji.
Ecology
Picoa lefebvrei fruits from January to April in North Africa and Middle
East during years of adequate rainfall (Alsheikh & Trappe 1983). In Kuwait
the species is confined to gypsiferous and calcareous gravelly deserts, where it
is dug out and eaten by several species of migrating birds (Alsheikh & Trappe
1983).
Bokhary & Parvez (1988) regarded some ecological factors as favorable for
production of desert truffles. In particular they considered rainfall as important
for fructification of Terfezia and Picoa species. Morte et al. (2009), who stressed
the importance of irrigation in cultivating desert truffles, pointed out that
irrigation should be applied first at the end of the summer during dry years
when rainfall is less than 150 mm and next at the beginning of the fruiting
season in very dry years. It is interesting to note that the collection sites for
P. lefebvrei in Muayala Natural Reserve experience drip irrigation of ca. 150
mm of water per year, while the mean annual rainfall value for this locality is
only 40 mm.
Discussion
Picoa lefebvrei was originally placed in the genus Phaeangium Pat. because of
spore ornamentation and tomentose peridium not present in other Picoa species
(Alsheikh & Trappe 1983). Ammarellou et al. (2011) through phylogenetic ITS
and 28s rDNA sequence analyses demonstrated that P. lefebvrei belongs to
the Geopora-Tricharina clade of the Pyronemataceae (Pezizales, Ascomycota),
placing Phaeangium lefebvrei in Picoa Vittad. based on its close morphological
and genetic relationship with the type species, Picoa juniperis Vittad. Our
macro- and micro-morphological observations of P. lefebvrei are in accord
with Ammarellou et al. (2011) and confirm its placement in Picoa.
Picoa lefebvrei in Saudi Arabia ... 247
The new collection locality for P. lefebvrei is 15 km south of the city of Arar,
in Northern Borders Province. Because the locality reported by Bokhary &
Parvez (1988) is 400 km away in Al Jouf Province, our new finding constitutes
a significant extension to the distribution of P. lefebvrei in Saudi Arabia.
Furthermore, the ecological features of the investigated area help identify a
correct and sustainable management protocol for establishing good practices
for commercial cultivation of P. lefebvrei for trade and to halt desertification
processes.
Acknowledgements
The authors wish to thank Profs. Alessandra Zambonelli (Bologna, Italy) and
Georgios I. Zervakis (Athens, Greece) for critically reviewing the manuscript and for
their help with linguistic revision. We also wish to thank Eng. Saleh Hussein Sughaier
and Eng. Saleh Eid Al-Naiem from the Directorate General for Agriculture at Northern
Borders Province (Arar, Kingdom of Saudi Arabia) for their valuable help in installing
the drip irrigation system at Muayala Natural Reserve.
Literature cited
Alsheikh AM, Trappe JM. 1983. Taxonomy of Phaeangium lefebvrei, a desert truffle eaten by birds.
Canadian Journal of Botany 61(7): 1919-1925. http://dx.doi.org/10.1139/b83-204
Ammarellou A, Smith ME, Tajick MA, Trappe JM. 2011. The phylogenetic placement of Picoa, with
a first report on Picoa lefebvrei (Pat.) Maire (= Phaeangium lefebvrei) from Iran. International
Journal of Environmental Research 5(2): 509-514.
Bokhary HA, Parvez S. 1988. Desert truffles “Al-Kamah” of the Kingdom of Saudi Arabia. 2.
Additional contributions. Arab Gulf Journal of Scientific Research, B. Agricultural and
Biological Sciences 86(1): 103-112.
Morte A, Zamora M, Gutiérrez A, Honrubia M. 2009. Desert truffle cultivation in semiarid
Mediterranean areas. 221-233, in: C Azcén-Aguilar et al. (eds). Mycorrhizas. Functional
processes and ecological impact. Springer-Verlag, Berlin, Heidelberg.
http://dx.doi.org/10.1007/978-3-540-87978-7_15
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.249
Volume 122, pp. 249-253 October-December 2012
Coccomyces hubeiensis,
a new fungus of Rhytismatales from China
MENG-SHI YANG’, YING-REN LIN?’, LAN ZHANG! & XIAO- YAN WANG!
' School of Life Science &? School of Forestry & Landscape Architecture,
Anhui Agricultural University, West Changjiang Road 130, Hefei, Anhui 230036, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT —A new fungus found on fallen leaves of Rhododendron erubescens from the
Shennongjia forestry region of Hubei Province, China, is described as Coccomyces hubeiensis.
This species differs from C. dentatus by its asci with subtruncate-conical apices, paraphyses
branched near the top, infrequent zone lines, and the absence of conidiomata. The type
specimen is deposited in the Reference Collection of Forest Fungi of Anhui Agricultural
University, China (AAUF).
Key worps —Rhytismataceae, morphology, Ericaceae
Introduction
Coccomyces De Not., established by de Notaris in 1847, is now placed in the
Rhytismatales (Leotiomycetes, Ascomycota) (Kirk et al. 2008). Coccomyces taxa
are characterized by polygonal or more or less circular ascomata that open by
several radiate or irregular splits, cylindrical to clavate asci, and filiform, long-
fusiform, or clavate ascospores, often with gelatinous sheaths (Sherwood 1980;
Cannon & Minter 1986; Johnston 1986, 2000; Spooner 1990; Lin et al. 1994; Jia
et al. 2012). External shape, size, and ascomal openings, ascal shape and size,
and the shape of paraphyses at the apex are regarded as the most important
taxonomic characters (Johnston 1986; Lin 1998).
Twenty-five Coccomyces species have been reported in China (Korf &
Zhuang 1985; Lin 1998; Hou et al. 2006, 2007; Jia et al. 2012; Zheng et al. 2012)
since Teng (1934) first recorded C. dentatus on Quercus and Castanea and
C. delta on Lauraceae. Recently, a new Coccomyces species was found on fallen
leaves of Rhododendron erubescens in the Shennongijia forestry region, Hubei
Province.
Materials & methods
Mature ascomata with macroscopic characteristics of Rhytismataceae were selected
from the collected specimens. We observed external shape, size, color, the opening
250 ... Yang & al.
mechanisms of ascomata, and zone line characteristics using a stereoscope with 10-50x
magnification.
The fruitbodies were rehydrated in water for 10 min, and 10-15 um thick sections
of the ascomata were cut using a freezing microtome. Microscopic examinations were
mounted in water, 5% KOH, Melzer’s reagent, or 0.1% (w/v) cotton blue in lactic acid.
For observing the outlines of ascomata in vertical section, sections were mounted in
lactic acid or cotton blue with pretreatment in water. The gelatinous matrix surrounding
ascospores and paraphyses was observed in water or cotton blue in lactic acid. The
color of internal structures was observed in water. Measurements and drawings of asci,
ascospores, and paraphyses were made using material mounted in 5% KOH or Melzer’s
reagent and from 30 ascospores, asci, and paraphyses for each specimen. Illustrations
of external shapes and internal structures of the ascomata were prepared using the
Panasoianic XSJ-2 microscope drawing device.
Taxonomy
Coccomyces hubeiensis Y.R. Lin & M.S. Yang, sp. nov. FIGS 1-5
MycoBank MB800351
Differs from Coccomyces dentatus by its branched paraphyses and asci with subtruncate-
conical apices and from C. cyclobalanopsis by its lack of excipulum and periphysoids.
Type: China, Hubei, Shennongjia forestry region, Xiaolongtan, alt. 1300m, on fallen
leaves of Rhododendron erubescens Hutch. (Ericaceae), 9 July 2010, Y.R. Lin, J.L. Chen &
Q. Zheng 2385 (AAUF 68493).
ErymMo.oey: hubeiensis, referring to the province where the specimen was collected.
ZONE LINES black-brown, infrequent, surrounding the bleached spots.
CONIDIOMATA not observed.
Ascomarta on both sides of the fallen leaves, but predominantly on the upper
side, sparsely scattered in light grey-white, subcircular or irregular bleached areas
15-25 mm diam. without obvious edges. In surface view, ascomata triangular
to pentagonal, 570-950 um diam., shining black, moderately raising above the
surface of leaf but flat or slightly hollow in the centre portion, with an obvious
preformed dehiscence mechanism, opening by 3-5 radial splits which extend
nearly to the edge of ascoma to expose the light yellow-brown hymenium.
Lips absent. In median vertical section, ascomata intraepidermal. COVERING
STROMA 30-35 um thick near the opening, composed of black-brown textura
epidermoidea or angularis with thick-walled cells 4-7 um diam., aliform cells
mainly existing near the inner layer of the covering stroma, becoming thinner
towards the edge gradually and extending to the basal stroma. ExcipuULUM
absent. BASAL STROMA 10-18 um thick, consisting of textura angularis with 2-3
rows of black-brown, thick-walled cells 4-6 um diam. Colorless, thin-walled,
large angular cells 6-12 um diam. exist between the covering stroma and basal
stroma. INTERNAL MATRIX STROMA poorly developed, comprised of hyaline,
gelatinised textura intricata. SUBHYMENIUM 15-20 um thick, composed of
pied
Coccomyces hubeiensis sp. nov. (China) ...
df Or) oe:
BES
Sc
| ;
As) My SHB
LAK on
ay ’S ye
oS
50um
Fics 1-5. Coccomyces hubeiensis on Rhododendron erubescens. 1. Habit on a leaf. 2. Detail of
ascomata and a zone line. 3. Ascoma in median vertical section. 4. Portion of ascoma in median
asci and ascospores.
vertical section. 5. Paraphyses,
252 ... Yang & al.
colorless textura porrecta-intricata. PARAPHYSES filiform, 90-150 x 1.5-2 um,
septate, the tips gradually swollen to 2.5-3 um, rarely curved or branched, and
sometimes forming epithecium above the asci, enveloped in mucus 0.8—1.2 um
thick. Asci ripening sequentially, cylindric-clavate, 80-120 x 7.5-10 um, apex
subtruncate-conical, without circumapical thickening, thin-walled, somewhat
long-stalked, J-, 8-spored. AscosporEs arranged in a fascicle, filiform, 65-102
x 1.5-1.8 um, hyaline, aseptate, gradually tapered to the round distal end, with
a gelatinous sheath ca 1 um thick.
HOsT SPECIES & DISTRIBUTION: producing ascomata on fallen leaves of
Rhododendron erubescens; known only from the type locality, Hubei, China.
COMMENTS—Coccomyces dentatus is closely related to C. hubeiensis in the
shape of asci and in the absence of lips, periphysoids, and excipulum, but differs
in ascomata that are quadrate to hexagonal, black zone lines, the presence of
abundant conidiomata, and paraphyses that are apically unbranched and do not
form an epithecium (Sherwood 1980). Coccomyces coronatus is distinguished
from the new species by its orbicular or polygonal ascomata, short-stalked larger
asci (100-130 x 11-13 um), and shorter and wider ascospores (60-80 x 2—2.5
um) (Sherwood 1980). Coccomyces hubeiensis resembles C. cyclobalanopsis in
the shape and size of ascomata, paraphyses, and ascospores as well as in the
color of the exposed hymenium. However, C. cyclobalanopsis differs in having
small abundant bleached spots, a covering and basal stroma consisting of a
textura globulosa, and an extremely well-developed excipulum arising from the
inner layer of the covering stroma (Lin et al. 2000).
Acknowledgments
The authors are grateful to the National Natural Science Foundation of China (No.
31270065), and the Specialized Research Fund for the Doctoral Program of Higher
Education of China (No. 20070364002) for financial support. We would like to express
our deep thanks to Dr. D.W. Minter and Dr. M. Ye for reviewing the manuscript
and providing valuable suggestions and to J.L. Chen and Q. Zheng for the field
investigations.
Literature cited
Cannon PF, Minter DW. 1986. The Rhytismataceae of Indian subcontinent. Mycol. Pap. 155:
1-123.
Hou CL, Piepenbring M. 2007. Two new species of Rhytismataceae on twigs of conifers from
Yunnan Province, China. Mycotaxon 102: 165-170.
Hou CL, Kirschner R, Chen CJ. 2006. A new species and new records of Rhytismatales from Taiwan.
Mycotaxon 95: 71-79.
Jia GJ, Lin YR, Hou CL. 2012 [“2011”]. A new species of Coccomyces (Rhytismatales, Ascomycota)
from Mt. Huangshan, China. Mycotaxon 118: 231-235. http://dx.doi.org/10.5248/118.231
Johnston PR. 1986. Rhytismataceae in New Zealand 1. Some foliicolous species of Coccomyces de
Notaris and Propolis (Fries) Corda. New Zealand J. Bot. 24: 89-124.
Coccomyces hubeiensis sp. nov. (China) ... 253
Johnston PR. 2000. Rhytismatales of Australia: the genus Coccomyces. Aust. Syst. Bot. 13: 199-243.
http://dx.doi.org/10.1071/SB98034
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,
10th ed. CAB International. Wallingford. 771 p.
Korf RP, Zhuang WY. 1985. Some new species and new records of Discomycetes in China.
Mycotaxon 22: 483-514.
Lin YR. 1998. Studies on Coccomyces de Notaris and Neococcomyces gen. nov. in China.
[Ph.D. thesis; in Chinese]. Northeast Forestry University. Harbin. 98 p.
Lin YR, Liu HY, Tang YP, Hu BE. 1994. Two new species of the genus Coccomyces from China
[in Chinese]. Acta Mycol. Sin. 13: 8-12.
Lin YR, Li ZZ, Huang CC, Xiang CT. 2000. Studies on the genus Coccomyces from China II
[in Chinese]. Mycosystema 19: 297-301.
Sherwood MA. 1980. Taxonomic studies in the Phacidiales: The genus Coccomyces (Rhytismataceae).
Occ. Pap. Farlow Herb. Crypt. Bot. 15: 1-120.
Spooner BM. 1990. Coccomyces and Propolis (Rhytismatales) from Mt Kinabalu, Borneo. Kew
Bulletin 45: 451-484. http://dx.doi.org/10.2307/4110513
Teng SC. 1934. Notes on Discomycetes from China. Sinensia 5: 431-465.
Zheng Q, Lin YR, Yu SM, Chen L. 2012 [“2011”]. Species of Rhytismataceae on Lithocarpus spp.
from Mt Huangshan, China. Mycotaxon 118: 311-323. http://dx.doi.org/10.5248/118.311
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.255
Volume 122, pp. 255-259 October-December 2012
A microfungus from Costa Rica: Ticosynnema gen. nov.
RAFAEL FE. CASTANEDA-RuI1z', MARIA M. GRANADOS?’,
MELISSA MARDONES?, MARC STADLER‘, DAVID W. MINTER>,
MARGARITA HERNANDEZ-RESTREPO’, JOSEPA GENE® & JOSEP GUARRO®
"Instituto de Investigaciones Fundamentales en Agricultura Tropical ‘Alejandro de Humboldt’
(INIFAT), Académico Titular de la “Academia de Ciencias de Cuba”,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P.17200
?Centro de Investigaciones en Proteccién de Cultivos (CIPROC), Universidad de Costa Rica
°Escuela de Biologia, Universidad de Costa Rica
‘Department of Microbial Drugs, Helmholtz-Center for infection Research,
Inhoffenstrasse 8,38124 Braunschweig, Germany
*Bakeham Lane, Egham, Surrey, TW20 9TY, United Kingdom
°Unitat de Micologia, Facultat de Medicina Ciéncies de la Salut, Universitat Rovira i Virgili,
43201 Reus, Spain
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Ticosynnema carranzae gen. & sp. nov., a new microfungus collected on the
twig of an unidentified plant, is described and illustrated. It is distinguished by synnematous
determinate conidiomata, monoblastic integrated determinate conidiogenous cells, and solitary,
3-4-septate, oblong, cylindrical to vermiform, brown conidia that secede rhexolytically.
KEY worpDs — anamorphic fungi, systematics, leaf litter
During an ascomycete-basidiomycete workshop field course at the VII Latin-
American Mycological Congress, more than 100 samples of dead plant material
colonized by anamorphic fungi were collected in a dry forest at the wildlife
station in Santa Rosa National Park, Guanacaste, Costa Rica. Among these
samples a conspicuous synnematous fungus was collected, which is herein
described and illustrated.
Taxonomy
Ticosynnema R.F. Castafieda, Granados & Mardones, anam. gen. nov.
MycoBank MB800232
Differs from Leuliisinea by brown to black conidiomata and determinate conidiogenous
cells, from Endophragmiella by synnematous conidiomata and determinate
256 ... Castafieda-Ruiz & al.
conidiogenous cells, and from Kramasamuha by synnematous conidiomata and
unbranched filaments.
TYPE SPECIES: Ticosynnema carranzae R.F. Castafieda et al.
EryMo.oey: Tico-, is an indigenous word for Costa Rica, -synnema, referring to the
type of conidioma of this anamorphic fungus.
Anamorphic fungi. CONIDIOMATA on the natural substratum synnematous,
scattered, determinate, dark brown to black. Mycelium superficial and
immersed. CONIDIOPHORES macronematous, mononematous, erect, septate,
loosely packed or compact, brown to dark brown. CONIDIOGENOUS CELLS
monoblastic, integrated, determinate, terminal. Conidial secession rhexolytic.
Conip1a solitary, acrogenous, cylindrical, vermiform to oblong, with a
conspicuous basal frill produced by the rhexolytic fracture of the wall of the
conidiogenous cells, septate, foveate, smooth or verruculose, pale brown to
brown. Teleomorph unknown.
Note: Ticosynnema superficially resembles Leuliisinea Matsush., but has
percurrent proliferating, annellate conidiogenous cells and hyaline conidiomata.
In fact, the two genera are similar only with respect to rhexolytic conidial
secession (Matsushima 1985, Seifert et al. 2011). Endophragmiella B. Sutton
and Kramasamuha Subram. & Vittal (Seifert et al. 2011) also produce conidia
by rhexolytic fracture of the monoblastic conidiogenous cells, but both lack
synnematous conidiomata. Endophragmiella has percurrent conidiogenous
cell proliferations while such proliferations are absent in Ticosynnema and
Kramasamuha. In addition, short sympodial or verticillate branches are present
in Kramasamuha (Subramanian & Vittal 1973, Seifert et al. 2011).
Ticosynnema carranzae R.F. Castafieda, Granados & Mardones,
anam. sp. nov. Fies 1,2
MycoBank MB800231
Differs from Leuliisinea bambusicola by having brown to black conidiomata and
determinate conidiogenous cells, from LEndophragmiella spp. by synnematous
conidiomata and determinate conidiogenous cells, and from Kramasamuha sibika by
synnematous conidiomata and unbranched filaments.
Type: Costa Rica, Guanacaste, Santa Rosa National Park, wildlife station, 10°52 N 85°35
W, on living twig of unidentified plant, 15 July 2011, coll. Dr. Aida Vasco Palacios,
C11/51 (Holotype, HAL 2454 F).
ETyMoLocy: Latin, carranzae, named in honor of Dr. Julieta Carranza, a Costa
Rican mycologist, for her contribution to Latin-American mycological progress and
development.
ConipioMarTa on the natural substratum synnematous, determinate, scattered,
erect, dark brown to black, 250-600 um tall, 40-70 um wide. STtipE composed
of parallel hyphal filaments (conidiophores), multi-septate, straight, cylindrical,
closely packed at the base and loosely towards the apex, black or dark brown
Ticosynnema carranzae gen. & sp. nov. (Costa Rica) ... 257
Fic. 1. Ticosynnema carranzae (ex holotype HAL 2454 F): a. Conidiomata. b. Conidiogenous cells.
c. Attached conidium. d-e. Conidia. Bars = 20 um (a) and 10 um (b-e).
258 ... Castafieda-Ruiz & al.
Fic. 2. Drawing of Ticosynnema carranzae (ex holotype HAL 2454 F):
a. Conidia. b. Conidiogenous cells. Bars = 10 um.
below, brown or pale brown above, smooth, 5-8 um diam. Mycelium partly
immersed and partly superficial. Hyphae septate, branched, smooth, pale brown,
2-4 um diam. CONIDIOGENOUS CELLS monoblastic, terminal, determinate,
integrated, brown to pale brown, 17-25 x 4-5 um. Conidial secession rhexolytic.
Conip1a solitary, acrogenous, oblong, cylindrical, vermiform, 3-4-septate,
foveate to verruculose, 35-45 x 11-12 um, brown to dark brown, dry, with end
cells usually markedly different; basal cell hemispherical, slightly narrower at
the first septum, with an evident pale brown frill 1.5-2.5 um long; apical cell
somewhat obtuse. Teleomorph unknown.
Ticosynnema carranzae gen. & sp. nov. (Costa Rica) ... 259
Acknowledgments
The authors express their sincere gratitude to Dr. Xiu-Guo Zhang and Dr. De-Wei
Li for their critical review of the manuscript. We also thank Dr. Aida Vasco Palacios
for provide the specimens collected in Costa Rica. We thank Prof. Dr. Uwe Braun for
facilities through HAL accession numbers. The authors are deeply indebted to the
Universidad de Costa Rica and the Cuban Ministry of Agriculture for facilities. We also
thank Mirtha Caraballo and Beatriz Ramos for technical assistance. We acknowledge
the facilities provided by Dr. P.M. Kirk and Drs. V. Robert and G. Stegehuis through the
IndexFungorum and Mycobank websites. Dr. Lorelei L. Norvell’s editorial review and
Dr. Shaun Pennycook’s nomenclature review are greatly appreciated.
Literature cited
Castafieda-Ruiz RF. 2005. Metodologia en el estudio de los hongos anamorfos. 182-183, in: Anais
do V Congresso Latino Americano de Micologia. Brasilia.
Matsushima T. 1985. Matsushima Mycological Memoirs 4. Kobe published by the author, 68 p.
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes.
CBS Biodiversity Series 9: 1-997.
Subramanian CV, Vittal BPR. 1973. Three new hyphomycetes from litter. Can. J. Bot. 51: 1127-
1132. http://dx.doi.org/10.1139/b73-142
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.261
Volume 122, pp. 261-263 October-December 2012
First record of Amanita dunensis in Italy
LORENZO PECORARO! & DARIO LUNGHINI ”
"Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences,
Riia St. 181, 51014 Tartu, Estonia
*Dipartimento di Biologia Ambientale, Universita di Roma “La Sapienza”
Ple Aldo Moro 5, 00185 Roma, Italy
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Amanita dunensis is recorded for the first time in Italy. It was collected in the
sandy dunes of Macchiagrande Natural Reserve near Rome (Central Italy). This finding
extends the geographic distribution of the species, previously recorded only in France and
Spain.
KeY worpbs — in situ conservation, rare Amanita species, Latium littoral
Introduction
During mycological research aimed at improving knowledge of the fungal
biodiversity in Macchiagrande Natural Reserve (Pecoraro & Lunghini 2003,
Pecoraro et al. 2003), observations were carried out from November 1996 to
January 2001 in different ecosystems included in this area.
The main object of our study was the sand dunes, one of the most interesting
natural components in the research area. These dunes, which are the inner
core of the coastal dune system, lie in the junction between the evergreen
mediterranean maquis shrubs and sand dune environment. Their vegetation
is typical of Mediterranean bush, but due to the relative abiotic parameters,
species here exhibit a xeromorphic habit (e.g., Quercus ilex L., Pistacia lentiscus
L., Arbutus unedo L., Cistus incanus L., C. salviifolius L., Phillyrea latifolia L..,
P. angustifolia L., Smilax aspera L., Juniperus phoenicea L., J. oxycedrus L.). On
the other hand, truly sandy and open areas of the dune system are distinguished
by psammophilous vegetation with Pancratium maritimum L., Ammophila
littoralis (P. Beauv.) Rothm., and Eryngium maritimum L.
In this ecosystem in November 1999 we collected Amanita dunensis, a
species remarkable due to its rarity and limited geographical distribution.
262 ... Pecoraro & Lunghini
Materials & methods
The species was identified based on macro- and microscopic observations on fresh
basidiomata, following the descriptions of Heim (1963) and Bon & Andary (1983).
Notes on morphological characters and ecological conditions were recorded in the field,
and samples were taken to the laboratory for microscopic examination. The specimens
are deposited in the Herbarium D.L. of Rome (ROHB).
Results and discussion
Amanita dunensis R. Heim ex Bon & Andary, Doc. Mycol. 13(50): 13. 1983.
“Amanita phalloides f. dunensis” R. Heim, Rev. Mycol. (Paris) 28: 9. 1963, nom. inval.
Pileus 70 mm diam., applanate, not very fleshy, margin finely striate,
overall color light grey with slight green tinge. Lamellae white, rather serrate,
subadnate; lamellulae present. Stipe 140 x 20-25 mm, slender, subcylindrical,
not bulbous, covered with sand over 2/3, whitish. Annulus present but very
degraded when collected. Volva saccate, tough and resilient, whitish. Flesh
whitish, with cadaverous odour, with application of sulfovanillin turning first
intense violet-red, then brown.
Basidiospores 9-11.5(12) x 6.5-8 um, amyloid, ellipsoid to elongate-
ellipsoid. Basidia 50-60 x 10-12 um, clavate, 2- or 4-spored, without clamp
connections. Subhymenial trama subcellular.
SPECIMENS EXAMINED: ITALY. Latium, Macchiagrande Natural Reserve, Fiumicino
(Rome), 04/11/1999, leg. L. Pecoraro & D. Lunghini (ROHB D.L. 796).
Heim (1963) first described Amanita dunensis from France (Vendée) as
A. phalloides f. dunensis (nom. inval., lacking a Latin description and type);
subsequently the taxon name was validated at the rank of species by Bon &
Andary (1983). This rare Amanita species has been reported in Spain by Castro
(1998).
We collected A. dunensis in November 1999 for the first time in Italy, within
the Macchiagrande Natural Reserve along the Latium littoral toward northern
Rome.
A rare species with sabulicolous habit, A. dunensis is characterized by a
slender aspect, non-bulbous stipe, very well-developed saccate volva, subcellular
subhymenial trama, and ellipsoid to elongate-ellipsoid spores (Heim 1963, Bon
& Andary 1983). It is the only known Amanita species with both a striate cap
margin and amyloid spores. Traditionally, a striate margin in Amanita has been
associated with inamyloid spores (Garcin 1984).
Amanita dunensis differs morphologically from A. phalloides (Fr.) Link in the
more ellipsoid spores and distinctly striate cap margin and from A. phalloides
var. larroquei F. Massart & Beauvais (Massart 1984, Neville & Poumarat 2004)
by a different stipe : pileus ratio, absence of marginal pileus striations, the
obvious bulbous stipe, and the pine-wood habitat.
Amanita dunensis in Italy ... 263
The finding of A. dunensis in Italy extends its geographic distribution and
emphasizes the ecological importance of the Macchiagrande Natural Reserve
as an important center for conservation of rare fungal species.
Acknowledgments
We would like to thank Dr. Marco Contu, who confirmed the species identification
and Prof. Giuseppe Venturella and Prof. Silvano Onofri for reviewing this article.
L. Pecoraro is funded by the Estonian Science Foundation and the European Social
Fund (Mobilitas Postdoctoral Research Grant MJD135).
Literature cited
Bon M, Andary C. 1983. Amanita dunensis Heim ex Bon et Andary sp. nov. Doc. Mycol. 13(50):
13-14.
Castro ML. 1998. Annotated check list of the Amanitaceae (Agaricales, Basidiomycotina) of the
Iberian Peninsula and Balearic Islands. Mycotaxon 67: 227-245.
Garcin R. 1984. Les Amanites Européennes. FMDS, Frangy.
Heim R. 1963. Sur trois Amanites de la Flore Frangaise. Rev. de Mycol. 28: 3-10.
Massart F. 1984. Approche du genre Amanita. Observations effectuées en Gironde de 1959 a 1982.
Soc. Linn. Bordeaux, Bordeaux. 138 p.
Neville P, Poumarat S. 2004. Amaniteae. Amanita, Limacella & Torrendia. Fungi Europaei 9.
1119 p.
Pecoraro L, Lunghini D. 2003. Indagini micologiche nella Riserva Naturale di Macchiagrande:
aspetti micofloristici ed ecologici. Micol. e Veget. Medit. 18(1): 21-42.
Pecoraro L, Perrone L, Lunghini D. 2003. Alcuni funghi fimicoli 0 graminicoli del litorale laziale.
Boll. AMER 59-60(2): 55-65.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.265
Volume 122, pp. 265-270 October-December 2012
A new species of Scopinella from pampas grass in Argentina
ROMINA M. SANCHEZ, LUCRECIA GIORDANO,
FREDA E. ANDERSON & M. VIRGINIA BIANCHINOTTI*
Centro de Recursos Naturales Renovables de la Zona Semiarida,
Universidad Nacional del Sur Camino,
La Carrindanga Km 7, B8000FWB, Bahia Blanca, Argentina
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — A previously undescribed species of the genus Scopinella was found during
a survey of the fungi associated with Cortaderia selloana (Poaceae) in Argentina. The
ascospores are strongly asymmetrical and have the shape of a truncated pyramid with a
convex quadrangular base. This peculiar ascospore shape sets this species, described here as
new, apart from the others of the genus. This is the second record of Scopinella from South
America.
KEY woRDS — ascomycete, grasses, saprophytic fungi
Introduction
Cortaderia selloana (pampas grass) is a perennial tussock-forming grass
species native to Argentina, Brazil, Chile, Paraguay, and Uruguay (Astegiano
et al. 1995). Its huge tussocks are very conspicuous and become attractive
when they flower to produce showy feathery inflorescences. Pampas has been
introduced in many regions of the world as a garden plant, dryland forage, soil
amendment, and windbreaks. In some of these regions, it has become invasive
(Pausas et al. 2006). The grass has become a particularly serious weed in New
Zealand, where the feasibility of subjecting it to biological control is being
explored (Bellgard et al. 2010).
Most records of fungal species associated with C. selloana are the result of
studies performed in the countries where it has been introduced (Bellgard et al.
2010, Farr & Rossman 2012, McKenzie et al. 2007, Medd et al. 2003). Studies
are now being conducted in Argentina to learn about the associated mycobiota
present in its native distribution area.
During a survey of the fungi associated with C. selloana leaves in Buenos
Aires province, a new species of Scopinella Lév. was discovered.
266 ... Sanchez & al.
The genus Scopinella is characterized by ascomata with long necks and
globose bodies, evanescent asci, and cuboid-ellipsoidal ascospores with two
prominent longitudinal germ slits (Cannon & Hawksworth 1982, Stchigel et al.
2006). Scopinella is a small genus comprising seven species that grow on either
fungi or plant substrates. It belongs to Hypocreales, where at present it cannot
be assigned to any family (Lumbsch & Huhndorf 2010).
The shape of the ascospores of the specimen found on C. selloana distinguishes
it from the other Scopinella species, so we describe it here as new.
Materials & methods
Partially senescent leaves of Cortaderia selloana were carefully inspected under a
Wild M5A stereomicroscope. Sections bearing fruiting bodies were hand-made with a
razor blade and mounted in either distilled water alone or with the addition of phloxine.
Measurements were made in water. A Leica DM2000 dissecting microscope with a Leica
EC3 camera was used to capture micromorphological images. For scanning electron
microscopy intact ascomata were dehydrated in a 10-95% graded acetone series for
fifteen minutes in each step, followed by three changes in absolute acetone. After critical
point drying, the specimens were mounted on aluminum stubs, sputter coated with
gold-palladium, and viewed with a LEO EVO 40 Scanning Electron Microscope (SEM).
Recently collected leaves with the fungus were pressed and preserved in “Bahia Blanca
Biologia” Herbarium (BBB). The herbarium acronym follows Thiers (2012).
Scopinella pyramidospora R.M. Sanchez, L. Giord., F. Anderson & Bianchin.,
sp. nov. PLATE 1
MycoBank MB800633
Diacnosis: Differs from all other Scopinella species by its strongly asymmetrical,
pyramidal ascospores.
Type: Argentina, Buenos Aires Province, Provincial Route No. 205, Km 308, (36°06'43"S
60°58'22"W): on senescent leaves of Cortaderia selloana (Schult. & Schult. f.) Asch. &
Graebn. (Poaceae), 4.VII.2011, coll. FE Anderson (HOLOTYPE, BBB [MVB 1501]).
EtyMo.oey: from the Greek Trvpapidoc = pyramidal and OTLOpOsG: spore.
AscoMarta solitary to gregarious, superficial, settled on a dense mass of brown
hyphae, globose to subglobose, with long necks, brown to black when dry, brown
to paler brown at base when mounted in water, 106-150 um high, 106-225 um
wide, peridial cells forming textura intricata. NEcKs cylindrical, 206-313 um
long, 31-75 um wide at base, ostiolum 19-38 um wide, cells of neck disposed in
textura porrecta. PARAPHYSES moniliform, ramified, septate, hyaline, 4-7 um
wide. AScI 8-spored, unitunicate, clavate to globose, short-stipitate, evanescent,
13-28 x 10-16 um. Ascosporss 1-celled, strongly asymmetrical, resembling
a truncated pyramid with quadrangular, somewhat convex, base, rounded
vertices, smooth-walled at optical level, verruculose under SEM (>7,000x)
with a dark brown median band, paler at ends, germ slits occasionally present,
7.5-9.5 x 5.5-8.5 um (x = 8.4 x 6.7, n = 60). ANAMORPH not known.
Scopinella pyramidospora sp. nov. (Argentina) ... 267
” nig F ,” = }
: a XS 4 8
Pate 1: Scopinella pyramidospora: 1. Ascomata on the substrate (arrows). 2. Close-up of an ascoma.
3. Apex of the ascomata neck (SEM, 4500x). 4. Eight-spored ascus. 5. Asymmetrical ascospores in
various views. 6-7. Ascospore germ slits (arrows). 8. Ascospores (SEM, 7000x). 9. Lateral view of a
pyramidal ascospore (SEM, 10000x). 10. Detail of ascospore wall (SEM, 20000x). Bars: 1 = 200 um;
2 = 50 um; 3 = 10 um; 4, 6-7 = 5 um; 5 = 7 um; 8 = 4 um; 9 = 3 um; 10 = 2 um.
DISTRIBUTION— Argentina, known only from the type collection.
CoMMENTS— Scopinella pyramidospora differs from all other species of the
genus in having strongly asymmetrical, pyramidal ascospores. Ascospore
268 ... Sanchez & al.
asymmetry is best visualized by moving the microslide in three dimensions
when mounted in water. Germ slits were seen only once under optical
microscopy. This suggests that they are not as conspicuous and/or common
as in the other species of the genus. Although the spore size falls in the range
of S. caulincola (Fuckel) Malloch, ascospores of the latter are strongly flattened
bilaterally and almost rectangular in surface view (as shown in von Arx &
Miiller 1954). The ascomata of S. caulincola have much longer necks, up to
2 mm long, with subhyaline short bristles at the apex (fide von Arx & Miller
1954). Ascomatal necks of S. pyramidospora are glabrous.
Discussion
Scopinella was erected by Léveillé (1847) to accommodate the single species
S. barbata (Pers.) Lév. Saccardo (1891) added a second species, S. pleiospora (J.
Schrét.) Sacc., originally described as Melanospora pleiospora. The genus was
then ignored for almost a century until Hawksworth (1975) reestablished it by
recognizing the synonymy between S. barbata and Chaetoceratostoma hispidum
Turconi & Maffei. Hawksworth (1975) considered Scopinella to be monospecific
and did not include Saccardos S. pleiospora. Malloch (1976a,b) added three
species to the genus (S. caulincola, S. solani, S. sphaerophila) and provided a key
to differentiate these additions and the original S. barbata. Two more species
were added, S. gallicola by Tsuneda & Hiratsuka (1981) and S. musciformis by
Stchigel et al. (2006). No reference was made to Scopinella pleiospora in any of
these studies. We failed to access type or authenticated material and presume
the type material of S. pleiospora has been lost.
Scopinella species fall into two ecological groups. One comprises species
growing on other fungi (S. gallicola and S. sphaerophila), and the other
saprobic species, usually growing on plant substrates (S. barbata, S. caulincola,
S. musciformis, S. pyramidospora, and S. solani). Scopinella pleiospora was
described growing on rabbit dung. Scopinella pyramidospora and S. solani are
the only two species of the genus known to occur on grasses. Scopinella solani
was found growing on dead leaves of Poa nevadensis in North America (Malloch
1976a) and on overwintered inflorescences of Brachypodium pinnatum, Dactylis
glomerata, and Elytrigia repens in Slovakia (Pastircak & Pastir¢akova 2007).
Scopinella solani differs from S. pyramidospora in having longer ascomatal
necks (300-500 um), narrower asci (7-11.5 um), and symmetrical and smaller
ascospores (4.5-6.5 x 3.8-5.8 Lm).
Scopinella species are difficult to cultivate, and the species from Cortaderia
selloana was no exception. All attempts to isolate it on artificial media failed.
Because of this, and the fact that the available material is at present very scarce,
it was decided against performing any molecular work. To our knowledge the
only species that have been cultivated are S. gallicola (Tsuneda & Hiratsuka
Scopinella pyramidospora sp. nov. (Argentina) ... 269
1981) and S. solani (Zhang & Blackwell 2002). Tsuneda & Hiratsuka (1982)
found that for S. gallicola both growth and fructification were stimulated in
dual culture with other fungi.
Phylogenetic studies have been performed on S. solani, the only species that
has been sequenced. Zhang & Blackwell (2002) set S. solani in a distinct clade
in Hypocreales apart from Melanospora in contrast with what was previously
accepted (Hawksworth 1975).
Scopinella was reported in Argentina and South America for the first time
with the finding of S. solani on bark of Geoffroea decorticans (Bianchinotti
1998). This is the second record of the genus from this region.
Acknowledgments
This work was funded by “National Biocontrol Collective’ and “Future Forests
Research,’ New Zealand. Lucrecia Giordano is a fellow at CIC. MVB is a researcher at
CONICET. Amy Rossman and Alberto Stchigel are thanked for acting as pre-submission
reviewers and for their helpful comments.
Literature cited
Arx JA von, Miller E. 1954. Die Gattungen der amerosporen Pyrenomyceten. Beitr. Krypttfl.
Schweiz 11 (1): 1-434.
Astegiano ME, Anton AM, Connor HE. 1995. Sinopsis del género Cortaderia (Poaceae) en
Argentina. Darwiniana 33: 43-51.
Bellgard SE, Winks CJ, Than DJ, Aliaga CC. 2010. Natural enemies of the South American pampas
grasses Cortaderia spp. in New Zealand. 215-218, in SM Zydenbos (ed.), Proceedings of the
17th Australasian Weeds Conference. New Zealand Plant Protection Society.
Bianchinotti MV. 1998. Contribucién al conocimiento de la micobiota argentina. Micromicetes
sobre Geoffroea decorticans (Leguminosae). III. Bol. Soc. Argent. Bot. 33: 149-155.
Cannon PF, Hawksworth DL. 1982. A re-evaluation of Melanospora Corda and similar
pyrenomycetes, with a revision of the British species. Bot. J. Linn. Soc. 84: 115-160.
http://dx.doi.org/10.1111/j.1095-8339.1982.tb00363.x
Farr DF, Rossman AY. 2012. Fungal databases. Systematic Mycology and Microbiology Laboratory,
ARS, USDA. http://nt.ars-grin.gov./fungaldatabases/ [accessed: 16 April 2012].
Hawksworth DL. 1975. Chaetoceratostoma Turc. & Maffei, a genus to be rejected. Trans. Brit.
Mycol. Soc. 64: 447-453. http://dx.doi.org/10.1016/S0007-1536(75)80143-4
Léveillé DM. 1847. Mycologie, Mycétologie. 454-496, in: C Orbigny. Dictionnaire Universel
Histoire Naturelle 8.
Lumbsch HT, Huhndorf SM. 2010. Part one. Outline of Ascomycota—2009. Myconet 14: 1-42.
Malloch D. 1976a. Scopinella solani. Fungi Canadenses 82.
Malloch D. 1976b. Scopinella sphaerophila. Fungi Canadenses 83.
McKenzie EHC, Thongkantha S, Lumyong S. 2007. Zygosporium bioblitzi sp. nov. on dead leaves of
Cortaderia and Dracaena. N.Z. J. Bot. 45: 433-435.
http://dx.doi.org/10.1080/00288250709509724
Medd RW, Murray GM, Pickering DI. 2003. Review of the epidemiology and economic importance
of Pyrenophora semeniperda. Australas. Plant Pathol. 32: 539-550.
http://dx.doi.org/10.1071/AP03059
270 ... Sanchez & al.
Pastircak M, Pastircakova K. 2007. Scopinella solani on graminicolous hosts in Slovakia and the
Czech Republic. Mycotaxon 102: 383-387.
Pausas JG, Lloret F, Vila M. 2006. Simulating the effects of different disturbance regimes on
Cortaderia selloana invasion. Biol. Conservation 128: 128-135.
http://dx.doi.org/10.1016/j.biocon.2005.09.022
Saccardo PA. 1891. Supplementum universale, pars I. Sylloge Fungorum 9. 1141 p.
Stchigel AM, Umania L, Guarro J, Mata M. 2006. Two new ascomycetes from rainforest litter in
Costa Rica. Mycologia 98: 815-820. http://dx.doi.org/10.3852/mycologia.98.5.815
Thiers B. 2012 [continuously updated]. Index Herbariorum: a global directory of public herbaria
and associated staff. New York Botanical Garden's Virtual Herbarium. http://sweetgum.nybg.
org/ih/ [accessed: February 2012].
Tsuneda A, Hiratsuka Y. 1981. Scopinella gallicola, a new species from rust galls of Endocronartium
harknessii on Pinus contorta. Canad. J. Bot. 59: 1192-1195. http://dx.doi.org/10.1139/b81-163
Tsuneda A, Hiratsuka Y. 1982. Commensal relationship between Scopinella gallicola and
Cladosporium sp. Rept. Tottori Mycol. Inst. (Japan) 20: 63-69.
Zhang N, Blackwell M. 2002. Molecular phylogeny of Melanospora and similar pyrenomycetous
fungi. Mycol. Res. 106: 148-155.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.271
Volume 122, pp. 271-282 October-December 2012
Development and morphology of Lysurus cruciatus —
an addition to the Indian mycobiota
S. ABRAR, S. SWAPNA & M. KRISHNAPPA*
Department of Post Graduate Studies and Research in Applied Botany, Kuvempu University,
Shankaraghatta-577451, Karnataka, India
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Lysurus cruciatus (Phallomycetidae, Phallaceae) produces a basidiome with a
long receptacle terminating in conical arms that branch initially and interconnect at their tips
to support gleba on lateral surfaces. Its development from primordia to mature basidiome
has been microscopically examined. Fructification begins as a small protuberance that
differentiates into a series of layers and with gelatinization develops into an egg. The matured
fruitbody stands up with an expanded receptacle. Lysurus cruciatus is a new record for the
India mycobiota.
Key worps — hymenium, intermediate tissue, medulla, ontogeny, peridial tissues
Introduction
Although morphology and taxonomy of phalloids have been frequently
studied throughout the last century, their developmental characters have
rarely been examined (e.g., Burt 1896, Fischer 1910a, Atkinson 1911, Petch
1911, Cleland & Cheel 1917, White 1944, Flegler & Hooper 1980, Saenz et al.
1983, Zang & Peterson 1989, Abrar et al. 2007). In India, studies on Phallaceae
associated with basidioma development are very scanty as previous reports
were mainly focused on documentation (Narasimhan 1932, Ahmed 1939, Apte
2005), and there are no reports of Lysurus from India (Jamaluddin et al. 2004).
The tropical genus Lysurus is saprobic (Schaffer 1975, Lodge & Cantrell
1995) and morphologically characterized by short columnar arms (Teng 1996)
attached to the apical margin of a cylindrical receptacle (Fischer 1886) that
emerges from a ruptured peridium (Zang & Peterson 1989). The gleba, which
is located on the lateral surfaces of receptacle arms (Miller et al. 1991, Beltran-
Tejera et al. 1998, Cortez et al. 2011), emits a fetid odor (Burk et al. 1982).
Lysurus cruciatus is commonly known as lizard’s claw stinkhorn in U.S.A.
(Arora 1986).
272 ... Abrar, Swapna & Krishnappa
KARNATAKA
75°O'O"E 75°30'O"E
SHIMOGA DISTRICT t
N
=
2)
co)
ise)
°
+
-
14°0'O"N
13°30'0"N
13°30'0"N
@ HANIYA (Sampling site)
75°O'O"E 75°30'0"E |
Fic. 1. Lysurus cruciatus sampling location in Haniya, Shimoga district, India.
Lysurus cruciatus in India ... 273
In this report of a new record of L. cruciatus from the Indian subcontinent,
we focus on the developmental stages of the fruitbody.
Materials & methods
Primordia and sequentially matured basidioma of L. cruciatus were collected from
a site in the Western Ghats, Karnataka (Fic. 1). Macroscopic characters were described
from observations of fresh material; color notations are from Kornerup & Wanscher
(1981). The primordia from different stages were fixed in Pfeiffer’s solution containing
absolute methanol and 40% formalin (w/v) in equal proportions. All measurements
were made in 3% KOH. Free hand sections of primordial stained with 1% lactophenol
cotton blue and 1% phloxine were mounted on glass slides and examined under the
stereo and optical microscopes. Cited collections are deposited in the Applied Botany
Herbarium, Kuvempu University, Shankaraghatta, Shimoga District, Karnataka, India
(KUABSAK).
Taxonomic description
Lysurus cruciatus (Lepr. & Mont.) Henn., Beibl. Hedwigia 41: 172, 1902 Fics. 2, 34
MycoBANnk 100531
IMMATURE FRuiT BoptEs (‘eggs’) 45-60 mm in diam., spherical to obovoid,
white (1A1) always arising from white (1Al) mycelium cord buried under
the soil. RECEPTACLE consisting of a stipe and apical branches or arms. STIPE
85-100 x 20-25 mm, cylindrical, narrowly obconical, hollow, 3-4 mm thick,
longitudinally grooved and transversely ribbed, white (1A1), composed
of a pseudoparenchyma with cells of 19.2-30.5 x 17-31.6 um, globose to
subglobose. RECEPTACLE ARMS 25-40 x 6-8 mm (lengths variable within the
same sporome), 4-6 (usually 5), conical, constricted at the top, hollow, a deep
marked groove running along the whole abaxial surface of arms, transversely
wrinkled in outer surface, initially fused at their tips, then free tending to curve
slightly away from the axis of the receptacle, outer concave surface smooth,
white, inner convex surface transversely rugulose, with pseudoparenchyma
cells of 16.5-25.6 um diam., globose to subglobose. GLEBA in the inner convex
surface of the arms, brown to grayish brown (6E2-6E3), gradually deliquescing,
unpleasant stinkhorn odor. Votva 35-40 x 20-25 mm, saccate, thick, white
(1A1), with aerolations, composed of scattered hyphae 2.4-3.6 um wide, stipe
and volva separated by a clear jelly. MycELIAL corps proliferating from the
base, several white. BasipiosporEs 4-4.5 x 1.5-2 um, elliptic to oblong, thin-
walled, smooth, hyaline.
ECOLOGY & DISTRIBUTION: Gregarious growing in areca nut plantations in
the tropical zone. Fruiting from July to October with a peak in August. Also
known from America, Asia, Australia, Africa. Introduced in Europe.
SPECIMENS EXAMINED — INDIA, KARNATAKA, Western Ghats, Shimoga district, Haniya,
4 km from Hosanagar taluk, 13°52'58"N 75°03'27’E, alt. 742 m, S. Abrar, S. Swapna, &
274 ... Abrar, Swapna & Krishnappa
M. Krishnappa, 28.VII.2007 (KUABSAK-MSH10); 21.VII.2008 (KUABSAK-MSH30);
08.X.2009 (KUABSAK-MSH102).
Developmental stages FIGS. 3B-F, 4
EGG PHASE: Initially small (0.5 mm diam.) white (1A1) swellings form at
the end of mycelial strands. The 1-2 mm diam. primordia or young sporoma
(YS) differentiate into a central medulla (M) and peripheral cortex (C). As
differentiation continues, primary volva-gel (VG) forms from the medulla while
the cortical cells fold inward (IF) four to six times. These infoldings differentiate
and enlarge into lobes (L). The enlarging lobes gradually compress cortical cells
to form a layer of intermediate tissue (IT) 2-4 mm in diam. The infoldings or
clefts (CF) increase at the junction of intermediate tissue and medulla with the
differentiation of peridial plates (PP) (4-5 mm in diam.). The external medullary
region differentiates into palisade tissue (PT), comprising the primordium of
the gleba (G) and develops sequentially to form enlarged clefts (ECF) (5-6 mm
diam). Intermediate tissue continuously thickens along the clefts to initiate
formation of receptacle arms (IRA) while the medullary tissue thickens to form
the initials of the receptacle (IR) (6-8 mm diam.). The gleba enlarges (EG)
(8-10 mm diam.) with the complete transformation of palisade tissue. The
gleba primordium further differentiates hyphae that form the evenly arranged
probasidial tips and later matures to form hymenium and trama layers. The
continuous glebal development along distorted peridial plates breaks the volva-
gel, which corresponds to receptacle arms (RA) (10-20 mm in diam.). The gleba
gelatinization (GG) and the development of pseudoparenchymatous tissue of
receptacle (R) (20-40 mm diam.) increases the size of the egg. The gleba is then
reduced (RG) as grooves (GR) form outside each receptacle arm (40-45 mm
diam.). Maturation proceeds with further differentiation of pseudoparenchyma
in the receptacle wall and receptacle arms and with the continuous production
of basidiospores from the pseudohymenial layer.
During development, the primordial cortex gives rise to the outer skin
(peridium), peridial plates, and receptacle, while the volva-gel and gleba derive
from the medulla. Before rupture, the mature egg differentiates into outer skin
and inner volva-gel that encloses the gleba, receptacle, and receptacle arms.
Complete development and differentiation of the various egg parts up through
basidiospore formation occurs in 6-13 days.
After final internal development (basidiospore production), eggs become
epigeous from an initial hypogeous state. Before rupture, the pre-differentiated
Fic. 2. Lysurus cruciatus (KUABSAK-MSH 30). A, Mature receptacle. B, Receptacle with transverse
and longitudinal grooves. C, Pseudoparenchymatous tissue of receptacle. D, A groove underneath
arm. E, Arms united at their tips. EF Pseudoparenchymatous tissue of an arm. G, An arm with
external longitudinal furrow. Scale bars: a, E= 1cm; B, D = 5mm; C = 30m; F = 20 um; G = 3mm.
Lysurus cruciatus in India ... 275
276 ... Abrar, Swapna & Krishnappa
sporome within the egg is surrounded by a pale grayish gelatinous mucilage.
A crack occurs, tearing at the apical portion (corresponding to the tip of the
arms) of the egg.
RECEPTACLE PHASE: ‘The receptacle elongates through the crack due to
osmosis and cell elongation. The receptacle expands freely in 2-4 seconds with
the autolysis of the gleba upon the receptacle arms (closely compressed together
in the egg stage). The peridium is retained as a volva with mycelial strands at
the base. The arms are set free with the moistening of the gleba, after which the
gleba deliquesces and becomes fetid (Fulton 1889). Insects especially associated
with carrion are attracted towards the sticky gleba. The mature phalloid
basidiome, which lasts for 20-34 hrs, then autodigests and disintegrates. Under
favorable environmental conditions, the dispersed basidiospores germinate to
form mycelium. Development proceeds with the formation of eggs and the life
cycle continues.
Discussion
Although Corda (1842) placed the genus Lysurus in a new family, Lysuraceae
(as “Lysuroideae”), which he separated from Clathraceae, many 20" century
mycologists treated Lysuraceae under Clathraceae (Cunningham 1944, Dring
1980, Zeller 1949). Fungal classification resulting from the Assembling the
Fungal Tree of Life (AFTOL) project revealed Phallaceae and Clathraceae as
separate families with Lysuraceae more closely related to Phallaceae than to
Clathraceae (Hosaka et al. 2006). Lysuraceae fruitbodies resemble Clathraceae
in having sutures dividing the gelatinous layer but differ in the long receptacles
that are stipitate, longer than the arms arising from the receptacles, and with a
gleba always tending to migrate to the exterior part of the arms (cf. the gleba
in Clathraceae being attached only to the interior face of the arms). Currently,
Lysurus is placed under Phallaceae, order Phallales, subclass Phallomycetidae.
The phylogenetic position of Phallales indicates that that stinkhorns are derived
from truffle-like fruitbodies (Hosaka et al. 2006, Hibbett et al. 2007).
In Aseroe arachnoidea E. Fisch., the peridial plates are produced radially
from gleba (Fischer 1910b) whereas in Protubera sp., Phallus impudicus L.,
and Ithyphallus tenuis E. Fisch., the plates develop from the columella (Fischer
1887, Gadumann & Dodge 1928). In Mutinus bambusinus (Zoll.) E. Fisch., the
plates develop from the apical part of the undeveloped cap (Fischer 1886) and
in Clathrus delicatus Berk. & Broome the junction of the cortical tissue and
clefts give rise to the peridial suture (Swapna et al. 2010). In Lysurus cruciatus,
it develops from the junction of the intermediate tissue and medulla.
Fic. 3. Lysurus cruciatus. A, Basidiospores. B, Epigeous egg. C, D, Crack occurring at the apical
portion of the egg. E, Expanded receptacle from egg. F, Insects feeding on gleba. Scale bars: a = 5m;
B, C= 1cm; D-F = 2 cm.
27h.
Lysurus cruciatus in India...
278 ... Abrar, Swapna & Krishnappa
In A. arachnoidea, jelly begins to form as the stalk primordium develops
(Fischer 1910b), while in Protubera sp., Mutinus caninus (Huds.) Fr., and
I. tenuis jelly formation begins during formation of the young fruiting body
(Gaumann & Dodge 1928; Fischer 1886). In L. cruciatus and C. delicatus, the
jelly is formed by the differentiation of medulla (Swapna et al. 2010).
In Simblum sphaerocephalum Schltdl. thick strands of tissue form the central
branches that run radially outwards from the center and fuse into volva-
jelly at the middle of one of the receptacle meshes (Conard 1913). In Aseroe
arachnoidea the branches are borne from the central strand (Fischer 1910b)
but in Protubera sp., are initiated from the columella. In M. caninus, the cap
forms from a central intertwined portion whereas in Phallus impudicus, the cap
develops from intermediate tissue (Gdumann & Dodge 1928). In I. tenuis the
stalk develops before forming a cap at its apex (Fischer 1886). In C. delicatus,
the branches arise from the hyphal knots (Swapna et al. 2010) whereas in
L. cruciatus the intermediate tissue constantly thickens to form receptacle
arms.
The glebal chambers of Aseroe rubra Labill. develop by formation of
pseudoparenchyma cells, after which trama plates are fused together and the
spore mass develops horizontally around the mouth of the attached stalk
(Fischer 1910b). In M. caninus the gleba develops during formation of the
primordial plates followed by the trama and hymenium (Gaumann & Dodge
1928). In I. tenuis the apex of the head wrinkles to form trama wherein it
extends as a dense palisade layer and bulges to form the hymenium. Later the
trama assumes a gelatinous texture and sporulation initiates (Fischer 1886). In
C. delicatus the palisade tissue transforms into gelatinized columella and the
trama adheres tightly in developing receptacle, before the basidiospores form
(Swapna et al. 2010). In L. cruciatus the external medullary region differentiates
into palisade tissue constituting the glebal primordium. The gleba enlarges with
differentiation of the probasidial tips and matures to form pseudohymenium,
trama, and basidiospores.
According to Mycobank, six Lysurus species are currently accepted.
Lysurus cruciatus and L. gardneri Berk. both produce white to pale cream
columnar receptacle, which distinguish them from Lysurus mokusin (L.) Fr.,
characterized by well marked white to reddish angular fluted receptacle. In
L. mokusin, the receptacle arms lie directly on the glebal columella in contrast to
the arms separated with deep grooves in L. cruciatus. Lysurus periphragmoides
(Klotzsch) Dring is unique having subglobose to ovoid clathrate network of
arms with mostly pentagonal to hexagonal meshes that are at first yellow and
then orange red (Dring 1980). Lysurus pakistanicus S.H. Iqbal et al. resembles
L. periphragmoides in its white to yellowish hollow, narrowly obconical receptacle
but differs from the latter by an irregularly oblong or globose apex formed by
Lysurus cruciatus in India ... 279
ROSA ortaans ;
wea oo
BSA RAT, date
Pea TSTe
Sey
ke
War
ay
Fics. 4. Sporoma development of Lysurus cruciatus (KUABSAK-MCH 30). A, Primordium. B, Different-
ation of medulla and cortex. C, Differentiation of volva-gel. D, Cortical cells forming infoldings.
E, Formation of lobes. F Formation of intermediate tissue and peridial plates. G, Formation of
palisade tissue. H, Initiation of receptacle and receptacle arms. I, Development and gelatinization
of gleba. J, Formation of grooves and reduction of gleba. ABBREVIATIONS: C = Cortex, CF = Cleft,
ECF = Enlarged cleft, EG = Enlarged gleba, G = Gleba, GG = Gelatinization of gleba, GR = Groove,
IF = Infolding, IR = Initiation of receptacle, IRA = Initial of receptacle arm, IT = Intermediate tissue,
L = Lobe, M = Medulla, PP = Peridial plate, PT = Palisade tissue, R = Receptacle, RA = Receptacle
arm, RG = Reduction of glebal mass, VG = Volva-gel, YS = Young sporoma.
280 ... Abrar, Swapna & Krishnappa
a clathrate network of anastomosing arms, irregular to cylindrical with up to
10 meshes that is rosy to orange pink at maturity; in L. pakistanicus the gleba
fills the entire interior of the arms and extends outwards in the meshes (Iqbal et
al. 2006). Lysurus corallocephalus Welw. & Curr. is entirely different, with erect
appendages that are usually dark or flushed pink above and white to buff or
yellowish below and which have simple or forked with slender intersections.
Lysurus cruciatus differs from the other known Lysurus species by the
uniquely transversely rugulose glebiferous surface. The glebiferous region is
villose and lamellate in L. gardneri, slightly keeled on both outer and inner
surfaces in L. pakistanicus and L. periphragmoides, and corrugated on the sides
and flat on the inner surface L. periphragmoides is (Dring 1980, Iqbal et al. 2006).
The gleba is on the lateral surface of the arms in L. mokusin and distributed on
the exterior of polygonal meshes in L. corallocephalus (Dring 1980).
In L. gardneri the stalk divides at the apex and does not bear any glebiferous
layer for 2-4 mm from the base of the arm. Each arm is well marked and
borne on its own stalk with a narrow zone, with the sterile base appearing as
a furrow down the outer face (Petch 1911). The diameter of the arms at 3 mm
above the stalk region increases to 6 mm in the glebiferous region. The gleba of
L. cruciatus runs along the groove in the intersection without any sterile base.
The diameter of the arms is almost the same through its length. The glebal
content is comparatively less in L. cruciatus compared to L. gardneri, which
is more concentrated in the center of the arms with a bulging appearance and
reduced towards the tips.
Acknowledgment
We are grateful to the University Grant Commission (UGC), New Delhi for funding
the project. We also thank Mr. K.N. Shankar Narayan Bhat and Mr. K.S. Vinayaka, from
Haniya in Hosanagar Taluk (Karnataka) for their help during the field studies. We thank
Drs. Vagner G. Cortez (Universidade Federal do Parana, Brazil) and Laura Guzman-
Davalos (Departamento de Botanica y Zoologia, Universidad de Guadalajara, México)
for critical review of the manuscript.
Literature cited
Abrar S, Swapna S, Krishnappa M. 2007. Dictyophora cinnabarina. Current Science 92:
1219-1220.
Ahmed S. 1939. Higher fungi of Punjab plains. Journal of Indian Botanical Society 11: 248-254.
Apte D. 2005. First record of Clathrus delicatus Berkeley & Broome (1873) from Sanjay Gandhi
National Park. Journal of Bombay Natural History Society 102: 135-136.
Arora D. 1986. Mushrooms demystified: a comprehensive guide to fleshy fungi. Ten Speed Press,
California. 959 p.
Atkinson GE. 1911. The origin and taxonomic value of the veil in Dictyophora and Ithyphallus.
Botanical Gazette 50: 1-20 + 7 pl.
Beltran-Tejera E, Bafares-Baudet A, Rodriguez-Armas JI. 1998. Gasteromycetes of the Canary
Islands: some noteworthy new records. Mycotaxon 68: 439-453.
Lysurus cruciatus in India ... 281
Burk WR, Flegler SL, Hiss WM. 1982. Ultrastructure studies of Clathraceae and Phallaceae
(Gasteromycetes) spores. Mycologia 74: 166-168. http://dx.doi.org/10.2307/3792646
Burt EA. 1896. The development of Mutinus caninus (Huds.) Fr. Annals of Botany 10(39):
343-372.
Cleland JB, Cheel E. 1917. Notes on the early stage of the development of Lysurus gardneri (Lysurus
australiensis). Journal of Royal Society New South Whales 51: 364-365.
Conard HS. 1913. Structure of Simblum sphaerocephalum. Mycologia 5: 264-273.
http://dx.doi.org/10.2307/3753269
Corda ACJ. 1842. Icones fungorum hucusque cognitorum.Vol. 5. 92 p
Cortez VG, Baseia IG, Silveira RMB. 2011. Gasteroid mycobiota of Rio Grande do Sul State,
Brazil: Lysuraceae (Basidiomycota). Acta Scientiarum. Biological Sciences 33: 87-92.
http://dx.doi.org/10.4025/actascibiolsci.v33il.6726.
Cunningham GH. 1944. The Gasteromycetes of Australia and New Zealand. Dunedin, New Zealand.
236 pp + 36 pl.
Dring DM. 1980. Contributions towards a rational arrangement of the Clathraceae. Kew Bulletin
35: 1-96. http://dx.doi.org/10.2307/4117008
Fischer E. 1886. Versuch einer systematischen Ubersicht tiber die bisher bekannten Phalloideen.
Jahrbuch des K6niglichen Botanischen Gartens und des Botanischen Museums zu Berlin 4:
197.
Fischer E. 1910a. Beitrage zur Morphologie und Systematic der Phalloideen. Annales Mycologici
8: 314-322.
Fischer E. 1910b. Die fruchtkérper-entwicklung von Aseroé. 595-614, in: Treube MM (eds),
Annales du Jardin botanique de Buitenzorg, supp. 3(2) & 4. EJ Brill, Leide.
Flegler SL, Hooper GR. 1980. Ultrastructure and development of Mutinus caninus and the occurrence
of eight spored basidium. Mycologia 72: 1001-1014. http://dx.doi.org/10.2307/3759739
Fulton TW. 1889. The dispersion of the spores of fungi by the agency of insects with special
reference to the phalloidei. Annals of Botany 3: 207-239.
Gaumann EA, Dodge CW. 1928. The comparative morphology of fungi. Mc Graw Hill, New York.
701 pp.
Hibbett DS, Binder M, Bischoff JE, Blackwell M, Cannon PF, Eriksson OE, Huhndorf S, James T,
Kirk PM, Licking R, Lumbsch HT, Lutzoni FE, Matheny PB, Mclaughlin DJ, Powell MJ, Redhead
S, Schoch CL, Spatafora JW, Stalpers JA, Vilgalys R, Aime MC, Aptroot A, Bauer R, Begerow
D, Benny GL, Castlebury LA, Crous PW, Dai YC, Gams W, Geiser DM, Griffith GW, Gueidan
C, Hawksworth DL, Hestmark G, Hosaka K, Humber RA, Hyde KD, Ironside JE, Koljalg U,
Kurtzman CP, Larsson KH, Lichtwardt R, Longcore J, Miadlikowska J, Miller A, Moncalvo
JM, Mozley-Standridge S$, Oberwinkler FE, Parmasto E, Reeb V, Rogers JD, Roux C, Ryvarden
L, Sampaio JP, Schiissler A, Sugiyama J, Thorn RG, Tibell L, Untereiner WA, Walker C, Wang
Z, Weir A, Weiss M, White MM, Winka K, Yao YJ, Zhang N. 2007. A higher-level phylogenetic
classification of the Fungi. Mycological Research 111: 509-547.
http://dx.doi.org/10.1016/j.mycres.2007.03.004
Hosaka K, Bates ST, Beever RE, Castellano MA, Colgan III W, Dominguez LS, Nouhra ER, Gem J,
Giachini AJ, Kenney SR, Simpson NB, Spatafora JW, Trappe JM. 2006. Molecular phylogenetics
of the gomphoid-phalloid fungi with an establishment of the new subclass Phallomycetidae and
two new orders. Mycologia 98: 949-959. http://dx.doi.org/10.3852/mycologia.98.6.949
Iqbal SH, Kasuya T, Khalid N, Niazi AR. 2006. Lysurus pakistanicus, a new species of Phallales from
Pakistan. Mycotaxon 98: 163-168.
Jamaluddin, Goswami MG, Ojha BM. 2004. Fungi of India (1989-2001). Scientific publishers,
Jodhpur. 326 pp.
282 ... Abrar, Swapna & Krishnappa
Kornerup A, Wanscher JH. 1981. Methuen handbook of colour, 3rd ed. Eyre Methuen, London.
252:pp.-
Lodge DJ, Cantrell S. 1995. Fungal communities in wet tropical forests: variation in time and space.
Canadian Journal of Botany 73: 1391-1398. http://dx.doi.org/10.1139/b95-402
Miller OK, Ovrebo CL, Burk WR. 1991. Neolysurus: a new genus in the Clathraceae. Mycological
Research 95: 1230-1234. http://dx.doi.org/10.1016/S0953-7562(09)80016-6
Narasimhan MJ. 1932. The Phalloideae of Mysore. Journal of Indian Botanical Society 11:
248-254.
Petch T. 1911. Further notes on Colus gardneri (Berk.) Fischer. Transactions of the British
Mycological Society 6: 121-132. http://dx.doi.org/10.1016/S0007-1536(17)80020-6
Saenz JA, Carranza J, Gomez VS. 1983. Estudio comparativo al microscopio de luz y al microscopio
electrénico de barrido de Laternea triscapa, Laternea pusilla y Ligiella rodrigueziana. Revista de
Biologia Tropical 31: 327-331.
Schaffer RL. 1975. The major groups of Basidiomycetes. Mycologia 67:1-18.
http://dx.doi.org/10.2307/3758222
Swapna S, Abrar S, Manoharachary C, Krishnappa M. 2010. Development and morphology
of Clathrus delicatus (Phallomycetidae, Phallaceae) from India, Mycotaxon 114: 319-328.
http://dx.doi.org/10.5248/114.319
Teng SC. 1996. Fungi of China. Mycotaxon, New York. 586 p.
White NH. 1944. The development of Lysurus sulcatus (Cooke & Massee). Transaction of the British
Mycological Society 27: 29-35. http://dx.doi.org/10.1016/S0007-1536(44)80005-5
Zang M, Peterson RH. 1989. Endophallus, a new genus in the Phallaceae from China. Mycologia 81:
486-489. http://dx.doi.org/10.2307/3760091
Zeller SM. 1949. Keys to the orders, families and genera of the Gasteromycetes. Mycologia 41:
36-58. http://dx.doi.org/10.2307/3755271
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.283
Volume 122, pp. 283-285 October-December 2012
New Anthracoidea, Tilletia, and Ustilago records for Turkey
SANLI KABAKTEPE & ZELIHA BAHCECIOGLU
Department of Biology, Faculty of Science and Art, Inonu University,
TR 44280, Malatya, Turkey
*CORRESPONDENCE TO: Zeliha.
[email protected]
ABSTRACT — Three smut taxa, Anthracoidea angulata on Carex hirta, Tilletia lolii on Lolium
perenne, and Ustilago serpens on Elymus elongatus, are reported for the first time from Turkey.
The morphological and microscopical features of these fungi are described based on the
collected materials.
Key worps — Anatolia, Ardahan, Kars, Ustilaginales
Introduction
The smut fungi (Ustilaginales) are parasites of cereals and other cultivated
and natural plants, comprising more than 1400 species in approximately 70
genera (Vanky 1994).
In the last decade, reports of new records of smut fungi have greatly increased
in Turkey, and 55 smut species in 9 genera have been determined for the country
(Bahcecioglu & Yildiz 2005; Bahcecioglu et al. 2006; Bremer et. al. 1952; Kirbag
2003; Kabaktepe & Bahcecioglu 2006; Petrak 1953; Sahin & Tamer 1998; Sert
et. al. 2004; Sert 2009). Further smut research is required, as this number is far
less than the total number of potential host plants in Turkey.
This paper presents smut species collected from Kars and Ardahan provinces
in northeast Turkey.
Materials & methods
Specimens were collected during the field studies in 2006-09 from Kars and Ardahan
Provinces in Turkey. The host specimens were prepared according to established
herbarium techniques. Spores were scraped from dried host specimens and mounted in
lactophenol. The preparations were examined with an Olympus CX31 light microscope
and micrographs taken with a Olympus E-330 camera. Analysis LS Starter software was
used to measure at least 30 spores for each spore state. Host names follow Davis (1965-85)
284 ... Kabaktepe & Bahcecioglu
and Davis et al. (1988). Specimens are deposited in the Inonu University Herbarium
(INU), Turkey. The smut species were identified using relevant literature (Mordue &
Ainsworth 1984; Vanky 1994) concerning smut fungi in Europe.
Taxonomy
Anthracoidea angulata (Syd.) Boidol & Poelt, Ber. bayer. bot. Ges. 36: 23 (1963)
Sori in inflorescence. Spores, angular dark brown, 12-20 x 15-28 um wall
irregularly thickened, 1.5-5 um, verruculose.
A new smut species for Turkey, A. angulata is also known on Carex hirta
from Europe and on C. melanostachya Willd. from Asia.
SPECIMENS EXAMINED — On Carex hirta L. (Cyperaceae). TURKEY: Kars, 10 km
from Sarikamis to Horosan, 2010 m, 22.09.2006, Sanli Kabaktepe 4653 (INU 8549);
ARDAHAN, Yalnizcam mountains, Bilbilan plateau, 2400 m, 18.07.2007, Sanli Kabaktepe
5422 (INU 8550).
Tilletia lolii Auersw. ex G. Winter, Rabenh. Krypt.-Fl. Ed. 2, 1(1): 109 (1881)
Sori in ovaries, covered by epidermis. Spores, globose to subglobose, 16-24
um, light brown, wall reticulate, reticulations 2-5 um wide 1.5-4 um deep.
Sterile cells, few, globose, subglobose, 10-20 um, hyaline, wall 1-2 um.
New for Turkey, T. lolii is also known from Asia, Europe, and New Zealand.
SPECIMENS EXAMINED - On Lolium perenne L. (Poaceae). TURKEY: ARDAHAN, Posof,
2-4 km east of Kursuncavus village, 1720 m, 28.08.2008, Sanli Kabaktepe 6544 (INU
8552).
Ustilago serpens (P. Karst.) B. Lindeb., Symb. bot. upsal. 16(2): 133 (1959)
Sori in leaves, covered with epidermis. Spores globose, ellipsoidal 11-20 um,
dark brown, wall 0.5-1 um, verruculose.
New for Turkey, U. serpens is also known from Europe, Asia, North America,
and New Zealand.
SPECIMEN EXAMINED - On Elymus elongatus (Host) Runemark (Poaceae). TURKEY:
Kars, 13 km from Kagizman to Kars, 1350 m, 11.06.2007, Sanli Kabaktepe 4918 (INU
8551).
Acknowledgments
We are indebted to TUBITAK (Project no. TBAG-106T260) for financial support.
We also thank Dr. Bayram Yildiz and Dr. Mehmet Candan for presubmission expert
reviews
Literature cited
Bahcecioglu Z, Yildiz B. 2005. A study on the microfungi of Sivas Province. Turkish J. Bot. 29:
23-44.
Bahcecioglu Z, Kabaktepe S, Yildiz B. 2006. Microfungi isolated from plants in Kahramanmaras
Province, Turkey. Turkish J. Bot. 30: 419-434.
Anthracoidea, Tilletia, and Ustilago spp. new to Turkey ... 285
Bremer H, Karel G, Biyikoglu K, Goksel N, Petrak, F. 1952. Beitrage zur Kenntnis der parasitischen
Pilze der Turkei V. Revue de la Faculte des Sciences de I Universite d Istanbul, Seri B. 17(2):
161-181.
Davis PH. 1965-85. Flora of Turkey and East Aegean Islands, Vols 1-9. Edinburgh University
Press, Edinburgh.
Davis PH, Mill RR, Tan K. (eds). 1988. Flora of Turkey and the East Aegean Islands, Vol.
10(supplement). Edinburgh University Press, Edinburgh.
Kabaktepe S, Bahcecioglu Z. 2006. Microfungi identified from the flora of Ordu Province in Turkey.
Turkish J. Bot. 30: 251-265.
Kirbag S. 2003. Two new records for the mycoflora of Turkey. Turkish J. Bot. 27(2): 153-154.
Mordue JEM, Ainsworth GC. 1984. Ustilaginales of the British Isles. London, Commonwealth
Mycological Institute.
Petrak E 1953. Neue Beitrage zur Pilzflora der Tiirkei. Sydowia 7: 14—15.
Sahin N, Tamer AU. 1998. Smut species determined in Turkey. J. Turk. Phytopath. 27(2-3): 151-
156.
Sert HB. 2009. Additions to rust and smut fungi of Turkey. Phytoparasitica 37: 189-192. http://
dx.doi.org/10.1007/s12600-009-0023-x
Sert HB, Sumbul H, Isiloglu M. 2004. Phytopathogenic fungi new for Southern Anatolia, Turkey.
Phytoparasitica 32(4): 402-408.
Vanky 1994. European smut fungi. New York, NY USA, Gustav Fischer.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.287
Volume 122, pp. 287-291 October-December 2012
A new species of Coccomyces (Rhytismatales, Ascomycota)
on Ilex elmerrilliana
SHI-JUAN WANG, YAN-PING TANG, KE LI & YING-REN LIN"
School of Forestry & Landscape Architecture, Anhui Agricultural University,
West Changjiang Road 130, Hefei, Anhui 230036, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT —Coccomyces ilicis sp. nov. is described, illustrated, and compared with similar
taxa. This fungus was collected from fallen leaves of Ilex elmerrilliana in Mt Huangshan of
Anhui Province, China. It differs from the closest relatives, C. noosanus and C. limitatus, by
its much wider asci and the absence of an excipulum and epithecium. The type specimen
is deposited in the Reference Collection of Forest Fungi of Anhui Agricultural University,
China (AAUF).
Key worps — Rhytismataceae, taxonomy, Aquifoliaceae
Introduction
Coccomyces De Not. is a large genus of Rhytismataceae, for which 116
species were recorded by Kirk et al. (2008) plus a few recently added. Thus far
25 Coccomyces species have been reported for China (Jia et al. 2012; Zheng et
al. 2012). Teng (1934) published the first records for China, C. dentatus (J.C.
Schmidt) Sacc. and C. delta (Kunze) Sacc. Most subsequent Chinese reports
have been made by Lin and Hou (Lin et al. 1994, 1999, 2000a, b, c, 2001; Hou
et al. 2006; Hou & Piepenbring 2007; Jia et al. 2012; Zheng et al. 2012). In this
paper, we describe another new Coccomyces species from China on fallen leaves
of Ilex elmerrilliana.
Materials & methods
Mature fruit bodies were selected from collected specimens. Macroscopic appearance
was described from dried reference collection material under a dissecting microscope at
10-50x magnification. After rehydration in water, fruitbodies were cut using a freezing
microtome into 8-15 um thick vertical sections, which were mounted in lactic acid or
cotton blue for observing the outlines of ascomata and conidiomata. Gelatinous sheaths
surrounding ascospores and paraphyses were examined in water or 0.1% (w/v) cotton
288 ... Wang & al.
blue in lactic acid. The colours of diversified structures and ascospore contents were
observed in water. Measurements and drawings were made using materials mounted in
5% KOH and from ca 30 asci, ascospores, and paraphyses for each specimen.
Taxonomy
Coccomyces ilicis S.J. Wang & Y.R. Lin, sp. nov. FIGs 1-6
MycoBank MB 800353
Differs from C. noosanus and C. limitatus by the absence of an excipulum and epithecium,
and by having much wider asci.
Type: China, Anhui, Mt Huangshang, Zuishi, alt. ca 700 m, on leaves of Ilex elmerrilliana
S.Y. Hu (Aquifoliaceae), 11 September 2004, S.J. Wang & Y.R. Lin 1878 (Holotype, AAUF
67986).
Erymo.ocy: The specific epithet refers to the host genus.
Cotonigs on both sides of leaves, forming irregular, yellowish-white paler
spots.
ZONE LINES frequent, grey-brown or black, thin, entirely or partly surrounding
the paler spots.
ConipioMara in similar positions to ascomataon the substratum, scattered or
crowded, sometimes coalescent, mostly on both sides of the zone lines. In surface
view, conidiomata disparate in dimensions, 45-180 um diam., rotund, black-
brown in the centre and the perimeter line of the conidioma, yellowish-brown
to grey-black elsewhere, somewhat raising the leaf surface, discharging spores
through 1 to 2 apical ostioles. In vertical section, conidiomata intraepidermal,
double lens-shaped. UPPER WALL 6-9 um thick, yellowish-brown but dark
brown near the ostiole(s), consisting of disparately sized angular cells. BAsAL
WALL extremely well developed, 12-22 um thick, black-brown, consisting of
3-4 layers of thick-walled angular cells ca 3 um diam. SUBCONIDIOGENOUS
LAYER 5—10(-22) um thick, composed of nearly colourless, thin-walled angular
cells. CONIDIOGENOUS CELLS 10-15 x 2-3 um, cylindrical, slightly tapering
towards the apex, holoblastic sympodially proliferating. Conip1a 3-5 x 1-1.5
um, cylindrical or subclavate, hyaline, aseptate.
AscoMaTa developing on both sides of leaves, scattered, rarely 2 to 3
coalescent, in irregular, yellowish-white bleached spots. In surface view,
ascomata 600-1250 um diam., triangular or quadrangular, black-brown to
black, shiny, edge defined, moderately raising the substrate surface, with an
obvious performed dehiscence mechanism, opening by 3-4 radial splits nearly
extend to the edge of ascoma, to expose waxy-yellow hymenium. Lips absent.
In median vertical section, ascomata intraepidermal. COVERING STROMA 25-35
um thick near the opening, slightly thinner towards the edge, connecting to the
basal stroma, comprised of textura angularis-globulosa with dark brown, thick-
walled cells 4-6 um diam. Few periphysoids near opening slit. BasAL STROMA
Coccomyces ilicis sp. nov. (China) ... 289
PLTACLILLLT AIPA AAA
Poon Anos gc tf0 {\ PP INIA 14
GANyeoagy
Wi
§ (( typ pf
Fics 1-6. Coccomyces ilicis on Ilex elmerrilliana. 1. A leaf bearing fruitbodies. 2. Conidiomata and
ascomata observed under a dissecting microscope. 3. Ascoma in median vertical section. 4. Portion
of ascoma in median vertical section. 5. Paraphyses, asci and ascospores. 6. Conidioma in vertical
section.
290 ... Wang & al.
20-25 um thick, composed of textura angularis-globulosa with 2—3(-4) layers
of black-brown, thick-walled cells 5-8 um diam. INTERNAL MATRIX STROMA
14-25 um thick, consisting of hyaline, gluey textura intricata. ExcIiPULUM
absent. SUBHYMENIUM 15-22 um thick, comprised of hyaline textura angularis
and porrecta. PARAPHYSES 130-160 x 1-1.2 um, filiform, septate, not branched,
increasing to 3.5—5 um at clavate, fusoid or calabash-like apex, covered with
a ca 0.5 um thick gelatinous matrix but not forming an epithecium. AscI
ripening sequentially, 95-130 x 5-7 um, clavate, apex rounded or subacute,
short-stalked, thin-walled, J-, 8-spored. Ascospores arranged fasciculately,
tapering towards the base, 65-95 x 1-1.2 um, filiform, hyaline, aseptate,
covered by a gelatinous sheath ca 0.5 um thick.
ECOLOGY & DISTRIBUTION: Producing conidiomata and ascomata on fallen
leaves of Ilex elmerrilliana. Known only from the type locality, Anhui, China.
COMMENTS —Coccomyces is widely distributed globally and associated
with a wide spectrum of plants in 61 families, particularly Ericaceae, Fagaceae,
and Lauraceae (Sherwood 1980). Of 24 species of Rhytismatales reported to
associate with Aquifoliaceae, only two belong in Coccomyces: C. yerbae Speg.
and C. radiatus Sherwood (Farr & Rossman 2012). They, however, differ
morphologically from C. ilicis (Sherwood 1980; Johnston 1994).
Coccomyces noosanus P.R. Johnst. resembles C. ilicis macroscopically and
microscopically but differs in having a well-developed, compact periphysoid
layer, much narrower asci (4.5-5.5 um), wider ascospores (1.5 um), and the
presence of an excipulum and epithecium (Johnston 2000). Coccomyces limitatus
(Berk. & M.A. Curtis) Sacc. is also close to C. ilicis, but has smaller ascomata
(500-1000 um diam.), a paraphysis-like excipulum, an obvious epithecium,
and narrower asci (4.5-5.5 um) (Johnston 2000; Lin et al. 2000c).
Acknowledgments
The authors are grateful to Dr D.W. Minter and Dr M. Ye for serving as pre-
submission reviewers, and to Dr Y.H. He for identifying the associated plant. This study
was supported by the National Natural Science Foundation of China (No. 30870014,
31270065).
Literature cited
Farr DF, Rossman AY. 2012. Fungal Databases, Systematic Mycology and Microbiology Laboratory.
ARS, USDA; viewed online on 25 April 2012 at
http://nt.ars-grin.gov/fungaldatabases/fungushost/new_frameFungusHostReport.cfm.
Hou CL, Piepenbring M. 2007. Two new species of Rhytismataceae on twigs of conifers from
Yunnan Province, China. Mycotaxon 102: 165-170.
Hou CL, Kirschner R, Chen CJ. 2006. A new species and new records of Rhytismatales from Taiwan.
Mycotaxon 95: 71-79.
Jia GJ, Lin YR, Cheng LH. 2012 [“2011”]. A new species of Coccomyces (Rhytismatales, Ascomycota)
from Mt Huangshan, China. Mycotaxon 118: 231-235. http://dx.dio.org/10.5248/118.231
Coccomyces ilicis sp. nov. (China) ... 291
Johnston PR. 1994, Ascospore sheaths of some Coccomyces, Hypoderma and Lophodermium species
(Rhytismataceae). Mycotaxon 52: 221-239.
Johnston PR. 2000. Rhytismatales of Australia: the Genus Coccomyces. Australian Systematic
Botany 13: 199-243,
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s Dictionary of the Fungi
10" edn, CAB International. Wallingford. 771 p.
Lin YR, Liu HY, Tang YP, Hu BE. 1994. Two new species of the genus Coccomyces from China (in
Chinese). Acta Mycol. Sin. 13: 8-12.
Lin YR, Li ZZ, Chen Y, Li Z, Wu WJ. 1999. A new species of Rhytismatales, Coccomyces occultus sp.
nov. (in Chinese). Journal of Anhui Agricultural University 26: 37-39.
Lin YR, Li ZZ, Liu HY, Xiang CT. 2000a. Studies on the genus Coccomyces from China I (in
Chinese). Mycosystema 19: 157-160.
Lin YR, Li ZZ, Huang CC, Xiang CT. 2000b. Studies on the genus Coccomyces from China II (in
Chinese). Mycosystema 19: 297-301.
Lin YR, Li ZZ, Xie YS, Liang SW. 2000c. Studies on the genus Coccomyces from China III (in
Chinese). Mycosystema 19: 449-453.
Lin YR, Li ZZ, Xu ZS, Wang JR, Yu SM. 2001. Studies on the genus Coccomyces from China IV (in
Chinese). Mycosystema 20: 1-7.
Sherwood MA. 1980. Taxonomic studies in the Phacidiales: The genus Coccomyces (Rhytismataceae).
Occas. Pap. Farlow Herb. Cryptog. Bot. 15: 1-120.
Teng SC. 1934. Notes on Discomycetes from China, Sinensia 5: 431-465.
Zheng Q, Lin YR, Yu SM, Chen L. 2012 [“2011”]. Species of Rhytismataceae on Lithocarpus spp.
from Mt Huangshan, China. Mycotaxon 118: 311-323. http://dx.doi.org/10.5248/118.311
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.293
Volume 122, pp. 293-301 October-December 2012
New Asian records and morphological variation in
Fibrodontia brevidens (Basidiomycota)
EUGENE YURCHENKO”! & SHENG-HUA Wu?
‘Department of Biotechnology, Paleski State University,
Pushkin str. 4, BY-225710, Pinsk, Belarus
*Department of Botany, National Museum of Natural Science,
Taichung, Taiwan 404, Republic of China
* CORRESPONDENCE TO:
[email protected]
Asstract — Fibrodontia brevidens (Trechisporales) is reported for the first time from
Taiwan, mainland China, and Vietnam. Asian specimens are compared morphologically with
collections from Venezuela. Morphological variation in the species is discussed. Most variable
features within the specimens are encrustation of projecting skeletal-like hyphae (from totally
naked to richly encrusted) and spore size. Nevertheless, the single morphospecies concept
of E brevidens is retained. Basidioma photographs, microscopical drawings, and scanning
electron microscopic photographs of crystalline deposits on skeletal-like hyphae of this
species are provided.
KEY worps — corticioid, Hyphodontia, SEM, taxonomy
Introduction
Fibrodontia brevidens (Pat.) Hjortstam & Ryvarden (Hydnodontaceae,
Trechisporales) is a presumably not rare but little collected pantropical corticioid
fungus. It has been reported previously from Africa (Rwanda; Ryvarden 1978),
Sunda Archipelago (Brunei; Hjortstam et al. 1998), Caribbean Archipelago
(Guadeloupe; Nakasone 2003), and South America (Ecuador - Langer 1994;
Venezuela - Hjortstam et al. 2005; Brazil - Hjortstam & Ryvarden 2007, S.P.
Gorjon, pers. comm.; Uruguay - Martinez & Nakasone 2010). Although there
have been numerous studies on the corticioid fungi of mainland China and
Taiwan summarized in two recent checklists (Wu 2010, Dai 2011), E brevidens
has not been reported earlier for either country.
Morphological descriptions of FE brevidens were published by Ryvarden
(1978; as Hyphodontia africana Ryvarden), Langer (1994; as Hyphodontia
brevidens (Pat.) Ryvarden), and Nakasone (2003; type of Acia sericea Pat.).
294 ... Yurchenko & Wu
The most prominent feature of this species (and the genus in general) are the
numerous long parallel moderately flexuous thick-walled hyphae (usually
yellowish in mass) that constitute the core of hymenophoral aculei and project
at their apices. They have been referred to variously as thick-walled hyphae
(Ryvarden 1978), skeletal hyphae (Eriksson et al. 1981, Jung 1987), tubular
tramacystidia (Langer 1994), tramal cystidia or pseudocystidia (Nakasone
2003), or pseudoskeletal hyphae (Bernicchia & Gorjén 2010). Similarly, the
Fibrodontia hyphal system has been described as semi-dimitic (Ryvarden 1978),
dimitic (Eriksson et al. 1981), or pseudodimitic (Langer 1994, Bernicchia &
Gorjén 2010). An argument for dimiticism is the presence of skeletal hyphae
in sterile hyphal textures of the type species, F gossypina Parmasto (Eriksson
et al. 1981, Fig. 542). We use the term “skeletal-like hyphae” to refer to these
structures in the present paper.
Materials & methods
The reference specimens, collected during 1991-2000 in Asia and South America,
are stored in TNM, O, and MSK herbaria (acronyms according to Index Herbariorum,
http://sweetgum.nybg.org/ih/). Microscopic structures were measured in material
mounted in 3% KOH water solution, and the spore quotient (spore length/width ratio)
excludes the apiculus. Encrustations were studied in Melzer’s reagent and/or distilled
water. The hymenial surface was photographed with Nikon Coolpix P6000 digital
camera, while encrusting crystals were photographed with a Hitachi SU 1510 scanning
electron microscope.
Results & discussion
Critical study of the collections storedin TNM confirms Fibrodontia brevidens
as a new record for Taiwan, mainland China, and Vietnam. Taiwanese records
are based on two localities, one in central Taiwan and the other on Orchid
Island in the Philippine Sea near the southeast Taiwan coast. Two mainland
China records represent one site in central Sichuan Province and a second in
the extreme south of Yunnan Province. The Vietnamese localities lie in the
northern part of the country in the mountains around Ha Noi. ‘The habitats
correspond to tropical (from near sea level) and warm subtropical vegetation
(up to 1600 maz.s.l.).
Langer (1994) regarded the crystals on skeletal-like hyphae as a common
feature in Fibrodontia. However, only one (TNM F8714 from Orchid
Island) of eight Asian specimens examined had skeletal-like hyphae richly
encrusted by characteristic flattened crystals and visible in KOH. To resolve
the taxonomic position of specimens with naked hyphae, we compared their
general morphology with F. brevidens specimens from Venezuela collected by
L. Ryvarden.
Fibrodontia brevidens in Asia... 295
- =— - =
e483, Ae
eh inn rc
é &* po ee:
Fe ee da -&
~~ * _s
Fic. 1. Fibrodontia brevidens. Details of basidiomata: a, TNM F8714 (Orchid Island, Taiwan);
b, TNM F24714 (central Taiwan); c, TNM F9008 (Vietnam). Scale bars = 1 mm.
Hymenophore color has been said to vary in FE brevidens from white or
cream (Langer 1994) to ochraceous (Hjortstam et al. 1998) and greyish orange
(Nakasone 2003). However, the Asian and South American specimens we
examined were yellowish with olive tinges and not especially variable in color.
The hymenophore consists of 50-150 um tall aculei, which also were not too
variable in density and shape (Fie. 1).
The encrustations on skeletal-like hyphae in Asian specimen TNM F8714
resemble those in both Venezuelan specimens (O 37539, O 40434; Fia. 2e,
f, h, i). The other Asian specimens have totally naked to unclearly or poorly
encrusted skeletal-like hyphae where the crystals were not tablet-shaped and
296 ... Yurchenko & Wu
Fic. 2. Fibrodontia brevidens. Microscopical elements (TNM F24714): a, vertical section through
basidioma; b, vertical section through an aculeus (in KOH solution); c, part of aculeal core (in
water). TNM F4188: d, upper parts of skeletal-like hyphae (in water). TNM F8714, skeletal-like
hyphae: e, f, in lower part; g, naked one; h, collected in emerging cluster. O 37529: i, skeletal-like
hyphae. Scale bars: a = 0.2 mm; b-i = 10 um.
Fibrodontia brevidens in Asia ... 297
often only observed in Melzer’s reagent or water preparations (Fic. 2b-d).
The “encrusted” specimens varied from seldom completely naked (Fic. 2g) to
richly encrusted skeletal-like hyphae. Such variability within a single specimen
is also inferred from the published descriptions and illustrations of E brevidens
(Ryvarden 1978, Langer 1994 - specimen Rammeloo 3929) and F. gossypina
(Eriksson et al. 1981). Nakasone (2003) provided no data on encrustations
on tramacystidia in Hyphodontia brevidens. We thus attribute the degree of
encrustation to intraspecific variation, partly explained by the developmental
stage of each cluster of skeletal-like hyphae.
The shape of the crystals on skeletal-like hyphae in Fibrodontia is
characterized as tablet-like and partly cuff-like (Langer 1994). However, as
their shape is poorly interpreted using light microscopy alone, we compared
the two E brevidens skeletal-like hyphal morphotypes (clearly encrusted vs.
naked) under the scanning electron microscope. Our SEMs demonstrated
that the number and shape of crystals depend on the age of sample examined.
The “encrusted” morphotype produced younger aculei with subacicular
loosely attached tablet-shaped crystals (Fic. 3a) and older aculei encrusted
by numerous tablet-shaped, slate-shaped, and small-sized prismatic crystals
(Fic. 3b,c); here no circularly girdling crystals were observed. In the ‘naked’
E. brevidens morphotype, we observed absolutely no encrustations in younger
basidioma patches (Fic. 3d), while older aculei contained some skeletal-like
hyphae very slightly roughened from scarce minute crystals (Fic. 3e); scattered
and loosely attached semi-tablet-shaped crystals were also detected (Fic. 3f).
Published descriptions and our examinations indicate a notable spore size
variation within E brevidens. A Venezuelan specimen (O 37539) produced the
smallest spores (3.5-4 x 2.5-3.5 um), and a specimen from Sichuan (TNM
F12152; Fic. 5) produced the largest (4.5-5.2 x (3-)3.5-4 um). Previously
published spore sizes vary from 3.5-4 um in diam (Ryvarden 1978) to 4.5-5(-
5.5) x 3.5-4.5 um (Nakasone 2003).
The large-spored samples from Sichuan and central Taiwan were also
distinguished by narrower, more flexuous, loosely arranged skeletal-like hyphae.
A large-spored (3.7-4.5(-5) x 3.2-3.5 um) sample from Taiwan (TNM F24714)
had capitate hyphal ends in the subiculum similar to those in Hyphodontia
(Xylodon) species, a character not previously noted for Fibrodontia (Fic. 4b).
Between collections, spore shape (predominantly broadly ellipsoid and ovoid in
F. brevidens) was less variable than spore size. Spore quotients within a studied
specimen varied from 1 to 1.4; TNM F8714 contained some dorsoventrally
flattened spores (ellipsoid in lateral view), with a length : width ratio of 1.6.
Basidial morphology in Fibrodontia brevidens differs from that in
Hyphodontia s. 1., which we consider an additional argument for placing
Fibrodontia in the trechisporoid clade. Basidia in F brevidens are initially
298 ... Yurchenko & Wu
Fic. 3. Scanning electron microscopic images of projecting skeletal-like hyphae and their
encrustations in Fibrodontia brevidens. TNM F8714: from younger (a) and older (b, c) basidioma
patches. TNM F24714: from younger (d) and older (e, f) basidioma patches. The main crystal
shapes are marked: m - minute, powder-like; p — prismatic, sa - semi-acicular; s - slate-like;
sc — semi-cuff-shaped; st - semi-tablet-shaped; t - tablet-shaped. Scale bars = 10 um.
Fibrodontia brevidens in Asia ... 299
Fic. 4. Fibrodontia brevidens. Microscopical elements (TNM F24714): a, subicular hyphae;
b, capitate hyphal ends from subiculum; c, basidioles and subhymenial hyphae; d, basidia.
Scale bar = 10 um.
300 ... Yurchenko & Wu
Fic. 5. Fibrodontia brevidens. Basidiospore variation: a, TNM F8714 (Taiwan, Orchid Island); b,
TNM F4188 (China, Yunnan); c, O 37539 (Venezuela); d, TNM F24714 (central Taiwan); e, TNM
F12152 (China, Sichuan). Scale bar = 5 um.
ovoid, becoming urniform and basally swollen, then more or less utriform with
somewhat wavy divaricate sterigmata, and ultimately shrinking and distorted
(Fic. 4d).
Except for the encrustations on skeletal-like hyphae and smaller spores
(Fic. 5c), we found no significant differences between South American and
Asian specimens. From our own observations on variation in FE brevidens as
well as morphological data by other authors, we regard all studied material as
one morphospecies.
SPECIMENS EXAMINED — CHINA: SICHUAN, Chingchenghoushan (Qing Cheng Hou
Shan), Feichuankou, 900 m a.s.l., on naked dead wood, S.H. Wu & S.C. Wu, 13.X.2000,
Wu 0010-113 (TINM-F 12152); YUNNAN, Shishuangbanna (Xishuangbanna), Nabanho,
600 m a.s.l., on bamboo stem, coll. S.H. Wu & J.Y. Tseng, 16.VIII.1995, Wu 9508-282
(TNM F4188); on bamboo stem, coll. S.-H. Wu & J.Y. Tseng, 16. VHI.1995, Wu 9508-297
(TNM F4203). TAIWAN: Nantou County, Luku Hsiang, Sunlinksea, 1600 m a.s.L.,
on decorticated branch of angiosperm species, coll. $.H. Wu, 11.X.1991, Wu 911011-
16 (TNM F24714; dup. in MSK); TarrunG County, Orchid Island, Yunghsing Farm,
on dead branch of angiosperm species, coll. SH. Wu & J.Y. Tseng, 30.IV.1997, Wu
9704-179 (ITINM F8714). VENEZUELA: Estapo MIRANDA, Sartenejas, Univ. Simon
Bolivar, on dead, partly corticated hardwood, coll. L. Ryvarden, 10.V1.1995 (O 37539);
EstaDO AMAZONAS, Yutajé, on dead naked angiosperm wood, coll. L. Ryvarden, 12-
19.V1.1997 (O 40434). VIETNAM: Ha Not, Tam Dao National Park, 1050 m a.s.l., on
bamboo trunk, coll. SH. Wu & S.Z. Chen, 1.VII.1998, Wu 9807-15 (TINM F9007); on
dead bamboo stem, coll. S.H. Wu & S.Z. Chen, 1.VII.1998, Wu 9807-16 (TNM F9008);
Ha Tay PROVINCE, Ba Vi National Park, 650 m a.s.1., on bamboo stem, coll. S.-H. Wu &
S.Z. Chen, 4.VII.1998, Wu 9807-96 (TNM F9081).
Fibrodontia brevidens in Asia... 301
Acknowledgements
The authors are grateful to Dr S.P. Gorjén (Centro de Investigacién y Extensién
Forestal Andino Patagénico, Esquel, Argentina) and Dr V. Spirin (Botanical Museum,
University of Helsinki, Finland) for presubmission review of the manuscript. We
acknowledge the curator of University of Oslo Mycological Herbarium, Dr K.-H. Larsson,
for kindly providing us a loan of Fibrodontia brevidens, collected in Venezuela. The
authors thank Ms. S.Z. Chen (TNM), for the help in managing the reference collections,
and Ms. S.K. Hu (Department of Geology, National Museum of Natural Science) for
SEM assistance. The research was supported financially from National Science Council
of ROC (Taiwan) (grant NSC 100-2811-B-178-001) and by National Museum of Natural
Science, ROC (Taiwan).
Literature cited
Bernicchia A, Gorjén SP. 2010. Corticiaceae s. |. (Fungi Europaei). Edizioni Candusso. 1008 p.
Dai YC. 2011. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience
52: 69-79. http://dx.doi.org/10.1007/s10267-010-0068-1
Eriksson J, Hjortstam K, Ryvarden L. 1981. The Corticiaceae of North Europe. Vol. 6: Phlebia -
Sarcodontia. Fungiflora, Oslo. Pp. 1049-1276.
Hjortstam K, Ryvarden L. 2007. Checklist of corticioid fungi (Basidiomycotina) from the tropics,
subtropics, and the southern hemisphere. Synopsis Fungorum 22: 27-146.
Hjortstam K, Roberts PJ, Spooner BM. 1998. Corticioid fungi from Brunei Darussalam. Kew Bull.
53(4): 805-827. http://dx.doi.org/10.2307/4118870
Hjortstam K, Ryvarden L, Iturriaga T. 2005. Studies in corticioid fungi from Venezuela II
(Basidiomycotina, Aphyllophorales). Synopsis Fungorum 20: 42-78.
Jung HS. 1987. Wood-rotting Aphyllophorales of the southern Appalachian spruce-fir forest. Bibl.
Mycol. 119: 1-260.
Langer E. 1994. Die Gattung Hyphodontia John Eriksson. Bibl. Mycol. 154: 1-298.
Martinez S, Nakasone KK. 2010. New records and checklist of corticioid Basidiomycota from
Uruguay. Mycotaxon 114: 481-484.
Nakasone KK. 2003. Type studies of resupinate hydnaceous Hymenomycetes described by
Patouillard. Cryptogamie, Mycol. 24(2): 131-145.
Ryvarden L. 1978. Studies in the Aphyllophorales of Africa 6. Some species from eastern Central
Africa. Bull. Jard. Bot. Nat. Belg. 48(1/2): 79-117. http://dx.doi.org/10.2307/3667919
Wu SH. 2010. Survey of corticioid fungi in Taiwan, to 2010. Fung. Sci. 25(1): 49-60.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.303
Volume 122, pp. 303-306 October-December 2012
Caloplaca gyrophorica (lichenized Ascomycota),
a new saxicolous lichen species from India
YOGESH JosHt, T.A.M. JAGADEESH RAM? & G.P. SINHA*”
"Department of Botany, Kumaun University, S. S. J. Campus,
Almora 263601, Uttarakhand, India
Botanical Survey of India, Andaman & Nicobar Regional Centre, Port Blair 744102, India
Botanical Survey of India, Central Regional Centre, Allahabad 211002, Uttar Pradesh, India
ABSTRACT — A gyrophoric acid-containing Caloplaca species is reported from India for the
first time. Caloplaca gyrophorica was found growing over rocks in temperate regions of Neora
Valley National Park, Darjeeling, India. It is compared with the other three known gyrophoric
acid-containing Caloplaca species and with the morphologically similar C. hueana.
Key worps — depside, parietin, taxonomy, Teloschistaceae
Introduction
Gyrophoric acid, an orcinol para-depside, is reported from a number of
lichens, but its presence in Caloplaca ‘Th. Fr. is so far confined to only three
species: C. bogilana Y. Joshi & Hur, C. subflavorubescens Y. Joshi & Hur, and
C. brownlieae S.Y. Kondr. et al. (Joshi et al. 2010; Lumbsch et al. 2011). While
investigating a specimen from Neora Valley National Park in the Eastern
Himalaya, the authors found gyrophoric acid along with parietin as major
compound. This is the first time that gyrophoric acid has been reported from
an Indian Caloplaca species. When compared with other known gyrophoric
acid-containing Caloplaca species, the specimen was found to differ entirely
from those and hence described as new to science.
Materials & methods
Studied specimens are deposited at BSA and LWG. Description and photographs
of external morphology are based on air-dried material observed under a dissecting
stereomicroscope (Nikon SMZ645). Sections were made with a razor blade under the
stereomicroscope and mounted in lactophenol cotton blue. Anatomical descriptions
304 ... Joshi, Jagadeesh Ram & Sinha
are based on these preparations under a compound microscope (Nikon Eclipse E200).
Ascospores were measured at 400x in water mounts; only free ascospores lying outside
the asci were measured. A K+ purple reaction indicates the absence of the parietin
complex, and a K+ red reaction indicates its presence. Secondary metabolites were
identified by TLC as described by White & James (1985) and Orange et al. (2001) using
solvent systems C and D. Mycological terms follow Kirk et al. (2008).
Taxonomy
Caloplaca gyrophorica Jagadeesh, Y. Joshi & G.P. Sinha, sp. nov. Fic. 1
MycoBank MB 800479
Similis C. hueana sed differt in non-inspersum hymenium, grandior sporae et C+ rubescens
thallus (acidum gyrophoricum).
Type: India. West Bengal: Darjeeling district, Kalimpong subdivison, Neora Valley
National Park, Aloobari, 27°07'33.1"N 88°42'55.2"E, alt. 2479 m, on exposed siliceous
rocks, 17 May 2008, T.A.M. Jagadeesh Ram 4356 (holotype, BSA; isotype, LWG).
EryMoLoGcy — ‘The specific epithet refers to the presence of gyrophoric acid in the
species.
THALLUS crustose, saxicolous, areolate to subsquamulose; areoles confluent
to scattered, yellowish brown to grayish brown, yellowish gray (when wet), +
rounded to ellipsoid or irregular, 0.2-0.5 mm wide; cortex thin, 7.5 um thick,
paraplectenchymatous, necral layer absent; algal layer continuous; medulla
hyaline, of densely interwoven hyphae, with crystals. HyPOTHALLUS brownish
black, scattered throughout and between the areoles.
APOTHECIA numerous, scattered to + aggregated, rounded to somewhat
angular, sessile to adnate, distinctly constricted at base, 0.3-0.5(-0.8) mm
diam., lecanorine; disc brownish orange, yellowish orange (when wet), plane
to convex, epruinose; margin concolorous to thallus, thin, smooth, uneven
by age, slightly emergent from the disc. EPIHYMENIUM yellowish brown,
10-15.5(-25) um thick, K+ red. Hymentum hyaline, not inspersed, (49-)
52.5-60(-75) um high, I+ blue. HypoTHecium hyaline, (30-)75-87.5(-100)
um thick, paraplectenchymatous. THALLINE EXCIPULUM up to 90 um thick,
with algae, without crystals. PROPER EXCIPULUM hyaline, thin. PARAPHYSES
branched and anastomosing, 1-1.5 um wide, tips not swollen. Asct clavate, 8-
spored, 48-58 x 13-15 um. Ascosporss biseriate, hyaline, ellipsoid, polarilocular,
(10-)11.5-14(-16) x 7-10 um, isthmus 2.5-3.75 um. PYCNIDIA not seen.
CHEMISTRY — Spot test reactions: thallus K-, C+ red, KC+ red, P-.
Epihymenium K+ red, C-. TLC: gyrophoric acid and parietin.
ECOLOGY & DISTRIBUTION — Found growing over exposed siliceous rocks
at ca 2400 m in Neora Valley National Park, Eastern Himalaya. Temperatures
range from subzero to 20°C. The hilly slopes are covered by bushy secondary
vegetation with some parts cultivated prior to the 1992 park establishment.
Caloplaca gyrophorica sp. nov. (India) ... 305
FiGuRE 1: Caloplaca gyrophorica. Habit. Scale bar = 5 mm.
REMARKS — Caloplaca gyrophorica is characterized by an areolate to
subsquamulose grayish brown thallus, brownish orange lecanorine apothecia
with concolorous margins, and gyrophoric acid and parietin as major chemical
constituents.
Morphologically the new species is most likely to be confused with the
saxicolous Caloplaca hueana B. de Lesd., which differs in its inspersed
hymenium, much smaller spores (8.5-11(-12) x 5.1-8.5 um; Wetmore 1996),
tropical distribution, and lack of gyrophoric acid.
The saxicolous species C. bogilana, differs from C. hueana in a grayish
areolate thallus, simple to furcate paraphyses with swollen tips, numerous
pycnidia, a maritime distribution, and atranorin and lecanoric acid present
in most collections (Joshi et al. 2010). Caloplaca subflavorubescens differs in
a strictly corticolous habit, a squamulose to subfruticose yellowish green to
grayish green thallus, septate paraphyses, and the presence of 7-chloroemodin,
emodin, fragilin, and atranorin; moreover, gyrophoric acid is present only
rarely and absent from the common C. subflavorubescens chemotype (Joshi et
al. 2010). The saxicolous C. brownlieae differs from C. hueana in having pinkish
orange or cinnabarine areoles and immersed to slightly erumpent apothecia
and containing ovoic acid, lecanoric acid, xanthorin, and erythroglaucin
(Lumbsch et al. 2011).
306 ... Joshi, Jagadeesh Ram & Sinha
Acknowledgments
This work was supported by a grant from the Ministry of Environment & Forests,
New Delhi under AICOPTAX scheme. The authors (TAMJR and GPS) are thankful
to Director Botanical Survey of India, Kolkata for facilities. One of the authors (YJ)
is thankful to Head, Dept. of Botany, S.S.J. Campus, Almora for providing laboratory
facilities to work. The authors are thankful to Drs Laszlé L6k6s and Jae-Seoun Hur for
reviewing the manuscript and providing valuable comments.
Literature cited
Joshi Y, Wang XY, Yamamoto Y, Koh YJ, Hur J-S. 2010. A first modern contribution to Caloplaca
biodiversity in South Korea: two new species and some new country records. Lichenologist
42(6): 715-722. http://dx.doi.org/10.1017/S00242829 10000368
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi.
10" ed. Wallingford, Oxon., CAB International.
Lumbsch HT, et al. 2011. One hundred new species of lichenized fungi: a signature of undiscovered
global diversity. Phytotaxa 18: 1-127.
Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.
British Lichen Society, London.
Wetmore CM. 1996. The Caloplaca sideritis group in North and Central America. Bryologist 99:
292-314. http://dx.doi.org/10.2307/3244301
White FJ, James PW. 1985. A revised guide to microchemical techniques for the identification of
lichen substances. British Lichen Society Bulletin 57(supplement): 1-41.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.307
Volume 122, pp. 307-324 October-December 2012
Seven dark fruiting lichens of Caloplaca from China
Guo-Li ZHOU", ZUN- TIAN ZHAO”, LEI LU?, DE-BAo TONG’,
MIn-MIN Ma’ & HaI-YING WANG"*
‘College of Life Sciences, Shandong Normal University, Jinan, 250014, P. R. China
Shandong Provincial Key Laboratory of Microbial Engineering, School of Food and Bioengineering,
Shandong Polytechnic University, Jinan, 250353, P. R. China
*These authors contributed equally.
*CORRESPONDENCE TO:
[email protected]
ABSTRACT —Detailed taxonomic descriptions with photos are presented for seven dark
fruiting Caloplaca species found in China. Caloplaca albovariegata, C. atrosanguinea, and
C. diphyodes are apparently new to Asia, C. bogilana, and C. variabilis are new to China, and
C. conversa and C. pulicarioides are new to northern China.
Key worps —Ascomycota, Teloschistales, Teloschistaceae
Introduction
The large cosmopolitan genus Caloplaca (Teloschistaceae, Teloschistales,
Lecanoromycetes, Ascomycota) was established by Theodor Fries in 1860 (Kirk
et al. 2008). Caloplaca is characterized by a totally immersed to subfruticose
crustose thallus, typically teloschistacean ascus, polarilocular ascospores, and
various anthraquinones or no substances (Poelt & Pelleter 1984, Sochting &
Olecha 1995). The genus reportedly comprises more than 500 species worldwide
(Kirk et al. 2008), but only 59 species are known in China (Abbas et al. 1996,
Aptroot & Seaward 1999, Arocena et al. 2003, Wei 1991, Xahidin et al. 2010,
Zhao & Sun 2002).
During our study of Lecanora Ach. in China, six Caloplaca species with
black apothecial discs and one with a red-brown apothecial disc were found.
Of these, five species are new to China. Descriptions with photos of important
characters of these species are provided here.
Materials & methods
The specimens studied are preserved in SDNU (Lichen Section of Botanical
Herbarium, Shandong Normal University). Morphological and anatomical characters
308 ... Zhou & al.
were examined under a COIC XTL7045B2 stereomicroscope and OLtympus CX41
polarizing microscope. Lichen substances were identified using the standardized thin
layer chromatography techniques (TLC) with solvent system C (Orange et al. 2010).
Photos were taken under OLtympus SZX16 and BX61 with DP72.
Terms applied to Caloplaca apothecial structures of are shown below in Fie. 1.
Pe ee ee
~~
~
_
+ » ° | a.
é f ; a
Y . \
- yy d *\) f bh Hee
*. . fs, Pwr vy
- ee ‘cs Dh elses eeeee i ©
a . ., sah
he }
ep oe
ae, ~ s
Oats e
Weg ae
a ‘s eS a ee.
Ven oe
toe ;
F ree
a he
‘ “a5
> \o =
« ee mY oe cae |
Figure 1. Terms applied to apothecial structures in Caloplaca: At = amphithecium;
Ex = inner exciple; Eh = epihymenium; Hy = hymenium; Sh = subhymenium.
Bar = 20um.
Taxonomic descriptions
Caloplaca albovariegata (B. de Lesd.) Wetmore, Mycologia 86: 816
(1995 [“1994”]) FIGS 2;:3
MorpuHo.oey — Thallus saxicolous, crustose, greenish gray to blackish gray,
stipitate areolate); cortex with crystals in some places; medulla with obvious
crystals; algal layer clustered; prothallus not seen. Apothecia lecanorine,
sessile; disc black, epruinose; inner exciple black at the top; amphithecium
with very thick algal layer and obvious crystals; epihymenium brown, without
crystals; hymenium and subhymenium hyaline. Ascus 8-spored; ascospores
polarilocular, ellipsoid, 15-20 x 7.5-10 um, isthmus 2-4.5 um; paraphyses
simple, with 1-2 somewhat swollen apical cells. Pycnidia not observed.
CHEMISTRY — Epihymenium K+ light purple, C-; amphithecial cortex and
top of inner exciple K+ purple, C+ purple. Thallus and medulla K-, C-, KC-,
P-. Secondary metabolites: no lichen substances detected by TLC.
Caloplaca spp. new to China ... 309
¥ =
4N,
es
‘
* = AS ol
~~ * 4 , ' :
Pai Rg
FiGuRE 2. Caloplaca albovariegata (Wang 20124075, SDNU). A: Thallus; B: Apothecium; C: Thallus
section showing clustered algal layer and crystals in cortex and medulla. Scale bars: A = 2 mm;
B = 500 um; C = 50 um.
DISTRIBUTION — Caloplaca albovariegata has been reported from western
North America (Wetmore 1995, 2007). New to China and Asia.
SPECIMEN EXAMINED: CHINA. SHANXI, NINGwu country, Mt. Luya, alt. 2500 m, on
rock, 26 Aug. 2011, H.Y. Wang 20124075 (SDNU).
ComMENts — Caloplaca peliophylla resembles C. albovariegata in the stipitate
areolate thallus but differs in the shiny olive brown thallus and lighter brown
apothecial discs. The similar C. atroalba, C. diphyodes, C. ursina, and C. variabilis
310... Zhou & al.
+
\
Tay heey W)
t = ; ee
PT ins
yt F
Dias!
FiGurE 3. Caloplaca albovariegata (Wang 20124075, SDNU). A: Apothecium section; B: Amphi-
thecium with obvious crystals; C: K+ reaction in epihymenium, amphithecial cortex, and top of
inner exciple; D: C+ reaction in amphithecial cortex and top of inner exciple; E: 8-spored ascus;
F: Polarilocular ascospores; G: Simple paraphyses with 1-2 somewhat swollen apices. Scale bars:
A-F = 20 um; G = 10 um.
differ by having non-stipitate or only partly stipitate areolate thalli. See further
discussion under C. variabilis.
Caloplaca atrosanguinea (G. Merr.) I.M. Lamb, Natl. Mus. Canada Bull. 132: 305
(1954) Fics 4,5
MorpHo.tocy — ‘Thallus corticolous, crustose, light grey; cortex with
indistinct crystals; medulla with obvious crystals; algal layer even; prothallus not
Caloplaca spp. new to China... 311
PF ew,
FicurE 4. Caloplaca atrosanguinea (Zhao 20116843A, SDNU). A: Thallus; B: Even algal layer
and crystals in cortex and medulla; C: Apothecium section; D: Crystals in amphithecium
and epihymenium; E: C+ reaction in epihymenium and top of inner exciple; F: K+ reaction in
epihymenium, amphithecial cortex, and top of inner exciple. Scale bars: A = 250 um; B = 50 um;
C-F = 20 um.
seen. Apothecia lecanorine, sessile; disc black or somewhat brown, epruinose;
inner exciple black at the top; amphithecium with crystals; epihymenium dark
black, with crystals; hymenium and subhymenium hyaline. Ascus 8-spored;
ascospores polarilocular, ellipsoid, 10-12.5 x 6.2-7.5 um, isthmus 2-3 um;
paraphyses simple to branched at the top, with 2-3 swollen apical cells. Pycnidia
present, ostiole black; conidia bacilliform, 3.5-6.3 x 0.8—1 um.
312 Fhou-seal:
FigurRE 5. Caloplaca atrosanguinea (Zhao 20116843A, SDNU). A: 8-spored ascus; B: Simple to
branched paraphyses with 2-3 swollen apical cells; C: Polarilocular ascospores; D: Bacilliform
conidia. Scale bars = 10 um.
CHEMISTRY — Epihymenium K+ reddish then purple, C+ reddish purple
(Fic. 4E); top of inner exciple K+ reddish then purple, C+ reddish purple;
amphithecial cortex K+ light purple, C-. Thallus and medulla K-, C-, KC-, P-.
Secondary metabolites: no lichen substances detected by TLC.
DISTRIBUTION — Caloplaca atrosanguinea has been reported from North
America (McCune 1984, Wetmore 1995, 2007). New to China and Asia.
SPECIMEN EXAMINED: CHINA. XINJIANG, URuMai CounTY, Nanshan-Bayi Forest farm,
alt. 1775 m, on bark, 26 Jun. 2005, J.Z. Zhao 20116843A (SDNU).
ComMENTs — Caloplaca parvula resembles C. atrosanguinea in corticolous
habitat and dark colored epihymenium but is distinguished by K- epihymenium
and tissues and ascospores with a very narrow (1-1.5 um) isthmus (McCune
1984). Caloplaca floridana and C. pollinii resemble C. atrosanguinea in
corticolous habitat and the K+ purple epihymenium. However, C. floridana
has an epihymenium without crystals and ascospores with a wider isthmus
(5.5-7 um; Wetmore 1995), and C. pollinii has a patchily yellow-brown
hymenium and four lichen substances (parietin, emodin, fallacinol, fallacinal).
Caloplaca spp. new to China... 313
Caloplaca bogilana Y. Joshi & Hur, The Lichenologist 42: 716 (2010) Fics 6, 7
MorpuHo.oecy — thallus saxicolous, crustose, areolate, grayish-white, glossy,
thick; cortex and medulla with obvious crystals; algal layer even; prothallus
not seen. Apothecia lecanorine, sessile; disc brown to black, epruinose; top
of inner exciple concolorous with disc; amphithecium with obvious crystals;
epihymenium orange-brown, with concolorous crystals; hymenium and
subhymenium hyaline. Ascus 8-spored; ascospores polarilocular, ellipsoid, 10-
FiGurRE 6. Caloplaca bogilana (Cheng 20120490B, SDNU). A: Thallus; B: Even algal layer and
crystals in cortex and medulla; C: Apothecium section; D: Obvious crystals in amphithecium
and orange-brown crystals in epihymenium; E: C+ reaction in epihymenium; F: K+ reaction in
epihymenium. Scale bars: A = 500 um; B = 50 um; C-F =20 um.
314... Zhou &al.
aloes lel Teele a
314 i
mee
2
cm1
nit
0
254 nm 365nm = sunlight 365nm
before acid after acid and heating
FiGurE 7 Caloplaca bogilana (Cheng 20120490B, SDNU). A: 8-spored ascus; B: Polarilocular
ascospores; C: Long ellipsoid conidia; D: Simple to branched paraphyses; E: TLC result. Scale bars
= 10 um.
12.5 x 4.0-6.3 um, isthmus 3.5-5.0 um; paraphyses simple to branched at the top.
Pycnidia numerous, ostiole black; conidia long ellipsoid, 3.0—4.5 x 1.1-1.6 um.
CHEMISTRY — Epihymenium K+ red, C+ red; amphithecium and top of
inner exciple K-, C-. Thallus and medulla K+ yellow, C+ red, KC+ red, P-.
Secondary metabolites: atranorin, gyrophoric and lecanoric acids, + parietin.
DISTRIBUTION — Caloplaca bogilana has been reported previously only
from coastal areas of Bogil Island in South Korea (Joshi 2010), while we found
it from both coastal and inland areas in China.
Caloplaca spp. new to China... 315
SPECIMENS EXAMINED: CHINA. LIAONING, BerPIAo city, Mt. Dahei, alt. 1300 m, on
rock, 14 Aug. 2011, Y.L. Cheng 2012490B (SDNU), 20120489B (SDNU); SHANDONG,
YANTAI CITY, Mt. Kunyu, alt. 400 m, on rock, 12 Jun. 2010, Y.L. Cheng 20128005
(SDNU).
ComMENTS — Caloplaca subleptozona resembles C. bogilana in having an
areolate thallus and atranorin but differs in its biatorine apothecia with pruinose
discs and UV+ thallus.
Caloplaca conversa (Kremp.) Jatta, Syll. Lich. Ital.: 254 (1900) Fics 8, 9
MorpHo.oey — Thallus saxicolous, crustose, ivory-white to grayish-white,
areolate, pruinose; cortex and medulla with obvious crystals; algal layer even;
FiGurE8. Caloplaca conversa (Wang 20122965, SDNU). A: Thallus; B: Pruina and apothecia in
thallus, showing; C: Even algal layer and crystals in cortex and medulla. Scale bars: A = 2 mm;
B = 400 um; C = 100um.
316... Zhou &al.
FiGuRE 9. Caloplaca conversa (Wang 20122965, SDNU). A: Apothecium section; B: Crystals in
amphithecium; C: K+ reaction in epihymenium, amphithecial cortex, and top of inner exciple;
D: C+ reaction in epihymenium, amphithecial cortex, and top of inner exciple; E: Simple paraphyses
with 4--6 swollen apical cells; F: 8-spored ascus; G: Polarilocular ascospores; H: Pyriform conidia.
Scale bars: A, B = 50 um; C, D = 20 um; E-H = 10 um.
prothallus not seen. Apothecia lecanorine, immersed or adnate; disc black,
epruinose; inner exciple black at the top; amphithecium with obvious crystals;
epihymenium brown, without crystals; hymenium and subhymenium hyaline.
Ascus 8-spored; ascospores polarilocular, ellipsoid, 10-15 x 4-6.5 um, isthmus
2-4.5 um (Fics 9F, G); paraphyses simple, with 4-6 swollen apical cells. Pycnidia
present, ostiole black; conidia pyriform, 3-4 x 2-2.5 um.
Caloplaca spp. new to China... 317
CHEMISTRY — Epihymenium, top of inner exciple, and amphithecial cortex
K+ weakly purple, C+ purple. Thallus and medulla K-, C-, KC-, P-. Secondary
metabolites: no lichen substances detected by TLC.
DISTRIBUTION — Caloplaca conversa has been reported from Europe, North
America, and Hong Kong, China (Aptroot & Seaward 1999, Breuss 1988,
Wetmore 1995, 2007). New to northern China.
SPECIMENS EXAMINED: CHINA. INNER MONGOLIA, Ba Yan Hot, Mt. Helan, alt. 1500
m, on rock, 19 Aug. 2011, H.Y. Wang 20122965 (SDNU), 20122520 (SDNU); 19 Aug.
2011, P.M. Wang 20123717 (SDNU), 20123333 (SDNU); alt. 1800 m, on rock, 19 Aug.
2011, H.Y. Wang 20123141B (SDNU); alt. 2000 m, on rock, 19 Aug. 2011, D.B. Tong
20123046 (SDNU); Wulate Hougi, Mt. Helan, alt. 1600 m, on rock, 16 Aug. 2011, D.B.
Tong 20123522 (SDNU), 20122837 (SDNU), 20122460 (SDNU), 20123568 (SDNU),
20123471 (SDNU); 17 Aug. 2011, P.M. Wang 20123635 (SDNU), 20123618 (SDNU),
20123902B (SDNU), 20123109 (SDNU); 17 Aug. 2011, X.R. Kou 20123673 (SDNU); alt.
1700 m, on rock, 17 Aug. 2011, X. R. Kou 20123898 (SDNU), 20123676 (SDNU); Wulate
Hougi, Mt. Hebashige, alt. 1600 m, on rock, 16 Aug. 2011, H.Y. Wang 20123003 (SDNU),
20123017 (SDNU), 20122966 (SDNU), 20123977 (SDNU), 20123518A (SDNU).
ComMENTs — Caloplaca alociza and C. chalybaea resemble C. conversa in
black sunken apothecia. However, C. alociza has + immersed thallus and larger
ascospores (15-18 x 7-8 um) (Wilk & Flakus 2006), while C. chalybaea has a
black-brown to lead-grey thallus with conspicuous black prothallus and mature
apothecia with blue pruina. The also similar C. conciliascens differs in having an
indistinct thallus, lecideine apothecia with brownish red discs, and a blackish
green top of inner exciple.
Caloplaca diphyodes (Nyl.) Jatta, Syll. Lich. Ital.: 259 (1900) Fics 10, 11
MorpHo.ocy — ‘thallus saxicolous, crustose, off-white, areolate; cortex
with somewhat crystals; medulla with obvious crystals; algal layer even;
prothallus not seen. Apothecia lecanorine, sessile; disc black, epruinose; inner
exciple black at the top; amphithecium with obvious crystals; epihymenium
dark brown, without crystals; hymenium and subhymenium hyaline. Ascus
8-spored; ascospores polarilocular, ellipsoid, 12.5-15 x 6-8 um, isthmus 3-4
um; paraphyses simple, with 3-6 swollen apical cells. Pycnidia present, usually
on marginal areoles, ostiole black, margin white; conidia filiform, 15—17.5x
0.6—0.7 um.
CHEMISTRY — Epihymenium, top of inner exciple, and amphithecial cortex
K+ purple, C+ weakly purple. Thallus and medulla K-, C-, KC-, P-. Secondary
metabolites: no lichen substances detected by TLC.
DISTRIBUTION — Caloplaca diphyodes has been reported from Europe
(Coste 2005, Magnusson 1937). New to China and Asia.
SPECIMENS EXAMINED: CHINA. INNER MONGOLIA, Ba Yan Hot, Mt. Helan, alt. 1300m,
on rock, 19 Aug. 2011, H.Y. Wang 20122508 (SDNU), 20122519 (SDNU), 20122615
318 ... Zhou & al.
Figure 10. Caloplaca diphyodes (Wang 20122508, SDNU). A: Thallus; B: Even algal layer and
crystals in cortex and medulla; C: Apothecium section; D: Crystals in amphithecium; E: K+ reaction
in epihymenium, amphithecial cortex, and top of inner exciple; F: C+ reaction in epihymenium,
amphithecial cortex, and top of inner exciple. Scale bars: A = 2 mm; B-F = 20 um.
(SDNU), 20122664A (SDNU), 20123015A (SDNU), 20123253 (SDNU); 19 Aug. 2011,
P.M. Wang 20123824A (SDNU); 19 Aug. 2011, X.R. Kou 20123879 (SDNU); 19 Aug.
2011, D.B. Tong 20122781A (SDNU).
ComMMENTS — Caloplaca atroalba and C. ursina resemble C. diphyodes in
a nonstipitate areolate thallus and entirely raised black epruinose apothecia.
However, C. atroalba has ascospores with a narrower isthmus (1.5-3 um;
Wetmore 1995), paraphyses with slightly swollen apical cells, and a weakly K+
Caloplaca spp. new to China... 319
FiGurE 11. Caloplaca diphyodes (Wang 20122508, SDNU). A: 8-spored ascus; B: Polarilocular
ascospores; C: Simple paraphyses with 3-6 swollen apical cells; D: Filiform conidia. Scale bars =
10 um.
purple epihymenium while C. ursina has a K- epihymenium and amphithecial
cortex.
Caloplaca pulicarioides Aptroot, Trop. Bryol. 17: 69 (1999) Fig. 12
MorpHo.ocy — ‘Thallus corticolous, crustose, white to greenish white,
areolate; cortex with indistinct crystal; medulla with obvious crystals; algal
layer even; prothallus not seen. Apothecia lecanorine, adnate to immersed; disc
brown to red-brown, epruinose; top of inner exciple concolorous with disc;
amphithecium with obvious crystals; epihymenium brown, without crystals;
hymenium and subhymenium hyaline. Ascus 8-spored; ascospores polarilocular,
ellipsoid, 7.5-10 x 4-5 um, isthmus 1.5-2.5 um; paraphyses simple to branched
at the top, without swollen cells. Pycnidia present, numerous, ostiole brown to
red-brown; conidia bacilliform, 2.5—-3.5 x 0.8-1.2 um.
CHEMISTRY — Epihymenium, top of inner exciple, and amphithecium
K-, C-. Thallus and medulla K-, C-, KC-, P-. Secondary metabolites: two
unknown substances (S-1, S-2) detected by TLC.
DISTRIBUTION — Caloplaca pulicarioides has been reported from Africa and
Hong Kong, China (Aptroot & Seaward 1999, Seaward & Aptroot 2003). New
to northern China.
SPECIMENS EXAMINED: CHINA. SHANDONG, RONGCHENG COUNTY, Mt. Chengshan,
alt. 50 m, on bark, 20 Jul. 2011, L. Li 20116198 (SDNU), 20127916 (SDNU), 20116529
(SDNU), 20116525A (SDNU), 20116544A (SDNU), 20116630A (SDNU); 20 Jul. 2011,
H.Y. Wang 20116103A (SDNU), 20116537A (SDNU), 20116538B (SDNU), 20116534A
(SDNU), 20116533 (SDNU), 20116532 (SDNU), 20116199 (SDNU), 20116535
(SDNU); Yantai city, Mt. Kunyu, alt. 300 m, on bark, 9 Jun. 2010, Y.L. Cheng 20127923
(SDNU).
ComMMENTS — Caloplaca pulicarioides superficially resembles species of the
Lecanora pulicaris-group, but its polarilocular ascospores place it in Caloplaca.
320 ... Zhou & al.
254 nm 365nm sunlight 365nm
before acid after acid and heating
Ficure 12. Caloplaca pulicarioides (Li 20116198, SDNU). A: Thallus; B: Even algal layer and crystals
in cortex and medulla; C: Apothecium section; D: Crystals in amphithecium; E: 8-spored ascus;
F: Polarilocular ascospores; G: Simple to branched paraphyses without swollen cells; H: Bacilliform
conidia; I: TLC result (S-3 = Atranorin; S-4 = Norstictic acid). Scale bars: A = 500 um; B = 50 um;
C, D = 20 um; E-H = 10 pm.
Caloplaca spp. new to China... 321
The morphologically similar C. homologa and C. trilocularis differ in their
consistently 3-loculate ascospores.
Caloplaca variabilis (Pers.) Mill. Arg., Mém. Soc. Phys. Hist. nat. Genéve 16(2): 387
(1862) Fics 13, 14
MorpHo.oey — Thallus saxicolous, crustose, gray to blackish gray, partly
stipitate areolate; cortex with crystals in some places; medulla with crystals;
algal layer clustered; prothallus not seen. Apothecia lecanorine, sessile, round
FiGurRE 13. Caloplaca variabilis (Wang 20124114, SDNU). A: Thallus; B: Apothecial margin with
thick pruina; C: Clustered algal layer and crystals in cortex and medulla. Scale bars: A = 2 mm;
B = 250 um; C = 50 um.
322%. Zhourecal.
mm Cpa» ane
FicurE 14. Caloplaca variabilis (Wang 20124114, SDNU). A: Apothecium section; B: Crystals
in amphithecium; C: K+ reaction of epihymenium and top of inner exciple; D: C+ reaction of
epihymenium and top of inner exciple; E: 8-spored ascus; F: Polarilocular ascospores; G: Simple
to branched paraphyses with 2-4 somewhat swollen apical cells; H: Pyriform conidia. Scale bars:
A-D = 50 um; E-H = 10 um.
to angular; disc black, sometimes pruinose; top of inner exciple concolorous
with disc; amphithecium with thick pruina, thick algal layer, and crystals;
epihymenium dark brown, without crystals; hymenium and subhymenium
hyaline. Ascus 8-spored; ascospores polarilocular, ellipsoid, 15-20 x 7.5-10
um, isthmus 2-3 um; paraphyses simple to branched at the top, with 2-4
somewhat swollen apical cells. Pycnidia present, numerous, ostiole black;
conidia pyriform, 3—4x 1.5—2 um.
Caloplaca spp. new to China ... 323
CHEMISTRY — Epihymenium and top of inner exciple K+ weakly purple, C+
weakly purple; amphithecium K-, C-. Thallus and medulla K-, C-, KC-, P-.
Secondary metabolites: no lichen substances detected by TLC.
DISTRIBUTION — Caloplaca variabilis has been reported from Asia, Europe,
and North America (Fryday 2004, Wetmore 1995, 2007, Yazici et al. 2008). New
to China.
SPECIMEN EXAMINED: CHINA. SHANXI, NINGWU counrTy, Mt. Luya, alt. 2500 m, on
rock, 26 Aug. 2011, H.Y. Wang 20124114 (SDNU).
CoMMENTS — Caloplaca atroalba, C. diphyodes, and C. ursina resemble
C. variabilis but differ in their nonstipitate areolate thalli and non-pruinose
apothecia. Caloplaca atroalba and C. diphyodes have even algal layers, and
C. atroalba is further distinguished by ascospores with a poorly formed isthmus.
Caloplaca ursina has a K- epihymenium and thallus cortex.
Acknowledgements
This present study was supported by the National Natural Science Foundation
of China (31070010), and the Natural Science Foundation of Shandong Province
(ZR2010CQ038). We are grateful to Dr. A. Aptroot (ABL Herbarium, Soest, the
Netherlands) and Dr. Shou-Yu Guo (State Key Laboratory of Mycology, Institute of
Microbiology, Chinese Academy of Sciences, Beijing, China) for presubmission reviews.
We especially thank Dr. A. Aptroot for assistance in specimen identification.
Literature cited
Abbas A, Wu J, Jiang Y. 1996. Five lichen species new to China. Acta Mycologica Sinica 15(3):
232-233.
Aptroot A, Seaward MRD. 1999. Annotated checklist of Hongkong lichens. Tropical Bryology 17:
57-101.
Arocena JM, Zhu LP, Hall K. 2003. Mineral accumulations induced by biological activity on granitic
rocks in Qinghai Plateau, china. Earth Surface Processes and Landforms 28(13): 1429-1437.
http://dx.doi.org/10.1002/esp.591
Coste C. 2005. Lichens et communautés lichéniques hydrophiles et subhydrophiles saxicoles-
calcifuges du département du Tarn (France). Bulletin de la Société Botanique du Centre Ouest
36: 577-596.
Breuss O. 1988. Neue und bemerkenswerte Flechtenfunde aus Tenerife (Kanarische Inseln). Linzer
Biologische Beitrage 20(2): 829-845.
Fryday AM. 2004. A new species of Fuscopannaria with a green photobiont, and other taxonomic
innovations and new records of lichenized-fungi from Alaska. Bryologist 107(2): 173-179.
http://dx.doi.org/10.1639/0007-2745(2004)107[0173:ANSOFW]2.0.CO;2
Joshi Y, Wang XY, Yamamoto Y, Koh YJ, Hur JS. 2010. A first modern contribution to Caloplaca
biodiversity in South Korea: two new species and some new country records. Lichenologist
42(6): 715-722. http://dx.doi.org/10.1017/S00242829 10000368
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi, 10th edition. Cromwell
Press, Townbridge, UK.
Magnusson AH. 1937. New or interesting Swedish lichens IX (no. 76-88). Botaniska Notiser. 1937:
124-140.
324 ... Zhou & al.
McCune B. 1984. Lichens with oceanic affinities in the Bitterroot Mountains of Montana and Idaho.
Bryologist 87: 44-50. http://dx.doi.org/10.2307/3242881
Orange A, James PW, White FJ. 2010. Microchemical Methods for the Identification of Lichens.
2nd edition. London: British Lichen Society.
Poelt J, Pelleter U. 1984. Zwergstrauchige Arten der Flechtengattung Caloplaca. Plant Systematics
and Evolution 148: 51-88. http://dx.doi.org/10.1007/BF00984570
Seaward MRD, Aptroot A. 2003. Lichens of Silhouette Island (Seychelles). Bibliotheca Lichenologica
86: 423-439,
Sechting U, Olecha M. 1995. The lichen genus Caloplaca in polar regions. Lichenologist 27:
463-471. http://dx.doi.org/10.1016/S0024-2829(95)80006-9
Wei JC 1991. An enumeration of lichens in China. International Academic Publishers, Beijing.
313 p.
Wetmore CM. 1995 [“*1994”]. The lichen genus Caloplaca in North and Central America with
brown or black apothecia. Mycologia 86(6): 813-838. http://dx.doi.org/10.2307/3760596
Wetmore CM. 2007. Caloplaca. 179-220, in: TH Nash III et al. (eds). Lichen Flora of the Greater
Sonoran Desert Region. Vol. III. Lichens Unlimited, Arizona State University, Tempe.
Wilk K, Flakus A. 2006. Four species of Caloplaca (Teloschistaceae, lichenized Asocmycota) new to
Poland. Mycotaxon 96: 61-71.
Xahidin H, Abbas A, Wei J. 2010. Caloplaca tianshanensis (lichen-forming Ascomycota), a new
species of subgenus Pyrenodesmia from China. Mycotaxon 114: 1-6.
http://dx.doi.org/10.5248/114.1
Yazic1 K, Aptroot A, Etayo J, Aslan A, Guttova A. 2008. Lichens from the Batman, Mardin,
Osmaniye, and Sivas regions of Turkey. Mycotaxon 103: 141-144.
Zhao ZT, Sun LY. 2002. Three new records of the lichen genus Caloplaca from China. Mycosystema
21(1): 135-136.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.325
Volume 122, pp. 325-332 October-December 2012
Boletus atlanticus sp. nov., a new species of section Luridi
from coastal dunes of NW Spain
JAIME B. BLANCO-DIOS' & GUILHERMINA MARQUES?
‘Centro de Formacion e Experimentacion Agroforestal de Lourizan,
Conselleria de Medio Rural, Xunta de Galicia, P.O. Box 127, 36080 Pontevedra, Spain
? CITAB- Universidade de Trds-os-Montes e Alto Douro, Departamento de Agronomia,
5000-801 Vila Real, Portugal
CORRESPONDENCE TO: '
[email protected], *gmarques@utad. pt
ABSTRACT—Boletus atlanticus, found in coastal sand dunes in Galicia (NW of Spain) under
Cistus salviifolius and maritime pines (Pinus pinaster), is described as a new species from
section Luridi based on morphology. Morphological description, drawings of microscopic
characters, and color pictures of the basidiomata are presented. A discussion about other
close taxa of section Luridi is also outlined.
Key worps— Basidiomycota, Boletales, taxonomy, Iberian Peninsula, Europe
Introduction
Mycological studies carried out in recent decades in the dunes ecosystems
of Galicia (NW of Spain, Iberian Peninsula) along the Atlantic coast in sand-
dominated areas with natural coastal vegetation and forested mainly with
maritime pine (Pinus pinaster Aiton) have revealed several new species to
science, including Gyroporus ammophilus (Castro & Freire 1989, 1995),
Agaricus freirei (Blanco-Dios 2001), and Leucocoprinus castroi (Blanco-Dios
2003). Recently, in tertiary or gray dunes with vegetation dominated by Cistus
salviifolius L. (Cistaceae) and a few maritime pines, several specimens of a
Boletus species were collected. We determined from a detailed morphological
study that the specimens belong in sect. Luridi Fr. based on their orange pores
and variable blueing of the exposed yellow flesh.
After extensively reviewing the European and extra-European species
of section Luridi, we concluded that this taxon does not correspond to
any previously described species and describe it as a new species: Boletus
atlanticus.
326 ... Blanco-Dios & Marques
Materials & methods
The specimens were collected, documented and preserved using standard methods.
Morphological descriptions are based on fresh material and analysis of photographs of
fresh specimens. Microscopic observations were recorded both from fresh material and
dried specimens rehydrated in 3% KOH. We used a solution of 1% Congo Red in water
to observe cystidia (pleuro-, cheilo-, and caulocystidia) and Melzer’s reagent to examine
basidiospores, pileipellis and stipitipellis. Spore size is presented as (Min)(mean - SD)-
(mean + SD)(Max), where Min = the lowest value measured, Max = the highest value,
followed by the mean spore lengths and widths (Xm); Q = spore length : width ratios;
and the mean volume (Vm) was determined using the formula Vm = 41/3 a’b, where a is
the radius of the minor axis and b the radius of the major axis (Breitenbach & Kranzlin
1991).
The maximum and minimum values and the length/width ratio (Q) of the pileipellis
terminal cells were determined by sampling between the centre and the margin
(Ladurner & Simonini 2003) in the superior layer of young sporocarps, as recommended
by Singer (1965) and Mufioz (2005). Microscopical structures were documented by
color microphotographs and line drawings on a light microscope equipped with a
digital camera and a drawing tube device. The collected material has been deposited in
the mycological herbarium LOU-Fungi (Centro de Investigacién Forestal de Lourizan,
Pontevedra, Spain).
Taxonomy
Boletus atlanticus Blanco-Dios & G. Marques, sp. nov. PLATE 1, FIG. 1
MycosBank MB 803460
Boletus luridus similis sed differt pileo ab rosaceo ad aurantiaco vel flavo et margo cremeo,
pori primum aurantiaco et ochraceo, denique aurantiaco-ferrugineo, stipes ut cuticula
flava, nisi in inferiore tertio, purpureo-rubro, sporis leviter plus grandis, caulocystidiis
multiformis.
Type: Spain, A Corufia, Santa Uxia de Ribeira, Aguifio, near of Penisqueira beach,
29TMH9708, 10 m, in tertiary or gray dunes, under Cistus salviifolius and Pinus pinaster,
29.X.2005, leg. F. Romano, J. Sampedro, A. Sampedro & J.B. Blanco-Dios (Holotype,
LOU-Fungi 19418).
Erymo oy: the species epithet refers to the Atlantic Ocean coast of NW Spain where
the specimens were found.
PiLEus 65-155 mm broad, hemispheric to convex in age, smooth, glabrous,
slightly viscid in wet weather; more intensely coloured when young, ranging
from pink to orange on the disc, fading with age, becoming light brown on
the disc and with various shades of pink, orange and yellow toward the cream
colored margin, margin undulate and slightly projecting. When bruised, pileus
surface changes to deep blue, greyish blue or greenish and, finally, to black
blue. HYMENOPHORE tubulose, tubes 8-15 mm long, adnate, yellow, changing
to blue slowly when bruised or exposed. Pores small, compressed, oval (more
abundant, 0.4-0.7 mm per pore) or triangular (less numerous and larger,
Boletus atlanticus sp. nov. (Spain) ... 327
Pate. 1. Boletus atlanticus (holotype). Habit.
Photo by Jaime B. Blanco-Dios.
1.2-1.4 mm per pore), pale orange to yellow ochre when young, becoming
orange to rust at maturity, staining intense greenish gray when handled. STIPE
60-130 x 15-55 mm, usually shorter than the diameter of the pileus, attenuate,
napiform or fusiform, bright yellow except in the basal third that is reddish to
purple, with a long and irregular orange reticulum, except in the upper portion
of the stipe (1-2 cm long) where the reticulum is yellow and very fine. Stipe
surface changes to blue or grayish blue when bruised. ConTExtT firm, soft at
maturity, yellow, changing to blue, grayish blue or greenish blue when exposed,
except in the lower part where garnet and purple colours dominate. SMELL
agreeable, more intense in the pileus, generally not distinctive or, sometimes,
with garlic smell. TasTE agreeable with unctuous texture. Edibility unknown.
CHEMICAL REACTIONS: Melzer’s reagent: positive in the flesh (deep blue); formol
(35%): grayish-blue in the pileus, pores and stipe, almost not visible in the flesh;
FeSO4 (10%): gray to greenish in the pileus, stipe and flesh, predominantly gray
in the pores. SPORE PRINT deep olive-brown.
BASIDIOSPORES (10.5-)11.5-14(-15.5) x (4.5-)5.2-6.7(-7.3) um, Xm =
12.7 x 6 um, Q = 1.6-2.6(-3), Vm = 240 um’, (n = 100), ellipsoid to fusoid,
smooth, guttulate, thick-walled, ochre gray in 3% KOH, dextrinoid in Melzer’s.
BASIDIA 20.5-35 x 5.5-14.5 um, 4-spored, rarely 2-spored, sterigmata 2.5-3.5
328 ... Blanco-Dios & Marques
Q
Sy
ED
e
L>O
cee YE
A I
»
.
;
De
WW
A
ie
;
a a ae
i
C
Fic. 1. Boletus atlanticus (holotype).
a. basidiospores; b. basidia; c. cheilocystidia; d. caulocystidia; e. pileipellis. Scale bars = 10 um.
Boletus atlanticus sp. nov. (Spain) ... 329
um long, clavate, numerous basidioles. CHEILOCYSTIDIA AND PLEUROCYSTIDIA
18-37 x 6.5-13 um, smooth and thin-walled, clavate or sphaeropedunculate,
ochre, brown, orange to gray in 3% KOH. PILEIPELLis a trichoderm consisting
of interwoven hyphae 2.5-7 um broad, long, subcylindric, septate, thin-walled,
with brown or gray-brown intracellular pigment in 3% KOH and ochre or
ochre-gray in Melzer’s; terminal cells 33.5-73 x 4-7.5 um, Q = 5.3-12.7, long,
subcylindric to subfusiform with a rounded or acuminate apex. STIPITIPELLIS
consisting of interwoven hyphae 1.5-6.5 um wide, ochre, brown to gray in 3%
KOH and in Melzer’s. CAULOBASIDIA 24.5-55.5 x 6.5-17 um, 4-spored, rarely
2-spored, sterigmata 3-6 um long, clavate. CAULOCYSTIDIA 28.5-52.5 x 10-21
um, smooth and thin-walled, versiform: clavate, fusiform-capitate, lageniform,
sphaeropedunculate, pyriform-mucronate or urceolate, ochre, brown, orange
to gray in 3% KOH. Basa HYPHAE of stipe with a strong positive reaction
amyloid. No CLAMP CONNECTIONS observed.
ECOLOGY AND DISTRIBUTION- On coastal sand dunes under Cistus salviifolius
and maritime pines (Pinus pinaster). Known only froma single locality in Spain.
October-November.
ADDITIONAL COLLECTIONS EXAMINED: SPAIN: A CORUNA: SANTA UxiA DE RIBEIRA,
Aguifio, near of Penisqueira beach, 29TMH9708, 10 m, in tertiary or gray dunes,
under Cistus salviifolius and Pinus pinaster, 28.X.2005, leg. EF Romano, J. Sampedro
& A. Sampedro (LOU-Fungi 19417); 5.X1.2005, leg. J.B. Blanco-Dios, E.M. Boullosa,
I.M. Blanco-Boullosa & M.E Blanco-Boullosa (LOU-Fungi 19419); 11.X1.2008, leg. J.B.
Blanco-Dios (LOU-Fungi 19434).
COMMENTS. Possession of orange pores and flesh changing to blue with variable
intensity when sectioned places Boletus atlanticus in section Luridi (Mufioz
2005). This new species is morphologically characterized by a combination of
(1) pileus color variably pink, orange, salmon, and yellow with a cream margin,
(2) ovoid or triangular pores, (3) bright yellow stipe with the basal third reddish
to purple and covered by an orange reticulum from apex to base except at the
top of the upper yellow portion, (4) stipe context varying from garnet to purple
in the basal third to half or basal third, (5) the pileus, stipe, and flesh staining
gray to green (gray in the pores) with FeSO, (6) habitat in coastal dunes under
Cistus salviifolius and Pinus pinaster, (7) spore Q = 1.6-2.6(-3) and Vm = 240
um’, and (8) versiform caulocystidia.
Among the morphologically similar species in sect. Luridi with a similarly
colored pileus, orange or red pores, stipe with or without reticulum, and context
bluing quickly and intensely when bruised or exposed, the closest European
taxa are B. comptus Simonini, B. luridus Schaeff. s.1., B. luteocupreus Bertéa &
Estadeés, and B. rhodopurpureus Smotl. f. rhodopurpureus.
Boletus comptus differs from B. atlanticus in pileus color (variably gray,
brown, pink, red, orange, and yellow), reticulum absent or limited to the stipe
apex (and then variably yellow, orange, red, and brown), the basal stipe punctate
330 ... Blanco-Dios & Marques
with reddish brown spots, red mature pores, exposed flesh reddening (and then
only on the stipe) or not changing color, and habitat in Quercus spp. forests.
Microscopically, the basidiospores of B. comptus are smaller ((9.5-)10.5-13.1
(-14.8) x (4.3-)4.8-5.9(-6.5) um) and the caulocystidia are predominantly
pyriform or clavate (Simonini 1992, Mufoz 2005, Péric & Péric 2006).
Boletus atlanticus should also be compared with B. luridus s.1., widespread
in Europe and also reported for Africa, Asia and North America (Smith &
Thiers 1971, Thiers 1975, Both 1993, Zang 1999, Bessette et al. 2000, Binder &
Hibbett 2004, Mufioz 2005), which differs in pileus color (predominantly ochre
and brown in var. luridus; red in var. rubriceps (Maire) Dermek; and orange or
ochre-orange in var. queletiformis J. Blum), red pores, a red reticulum restricted
to 2/3 of the stipe, and orange-red flesh that is red-purple only at the stipe
base and fades to yellow-olive after exposure. Boletus luridus, a typical species
from broad-leaved forests in calcareous soils, also differs microscopically in its
slightly smaller spores [(12-)12.3-13.9(-14.2) x 5-5.9(-6.4) um], caulocystidia
that are fusiform, utriform, or lageniform, and a pileipellis composed of short
end cells (Mufioz 2005).
Boletus luteocupreus has a chrome-yellow pileus (sometimes with pinkish
tones) becoming ochre-orange with age, a delayed (a few hours) red-coppery or
brown-coppery staining reaction, variably reddish pores, a yellow-orange stipe
that is red or red-carmine toward the base and almost completely covered with
a blood-red reticulum, an association with deciduous forests in acidic soils,
smaller spores [(10.4-)10.9-12.3(-12.9) x 4.5-5.3(-5.9) um], and fusiform or
lageniform caulocystidia (Mufioz 2005).
Boletus rhodopurpureus f. rhodopurpureus, known also in Asia (Zang 1999;
Binder & Hibbett 2004), is distinguished by a pink, purple to red vinaceous
pileus, sporocarps with red pores when young and red-orange in age (except at
the yellow-orange margin), a yellow or yellow-orange stipe that is red-orange
toward the base with garnet or red purple context only at the base and with a red
fine reticulum limited to the apex, and a habit in broad-leaved forests (mainly
Quercus spp.) in acidic soils. It is differentiated microscopically by smaller
spores (11.8-13.6(-14.2) x (4.8-)5.1-5.7(-6) um), and fusiform caulocystidia
(Mufioz 2005).
Among extra-European taxa, B. atlanticus is morphologically similar to B.
floridanus (Singer) Murrill and B. sinicus W.F. Chiu.
Boletus floridanus, reported from North and Central America (from North
Carolina and Tennessee, south to Florida, Texas, Mexico, and Belize), is
characterized by a grayish-red, intense red to vinaceous pileus, yellow tubes
with red pores, a red markedly reticulated stipe, pale to bright yellow context,
a habit in broad-leaved (especially oak) forests, and longer narrower spores
(12.8-18 x 4-5.6 um) (Both 1993; Bessette et al. 2000, 2007; Ortiz et al. 2007).
Boletus atlanticus sp. nov. (Spain) ... 331
Boletus sinicus, described from Yunnan (China), has a fibrillose scaly garnet
brown pileus, deep red pores, a concolorous (or apically yellow) stipe reticulated
with prominent red veins, white or yellowish flesh, and smaller spores (7.5-11
x 4.5-5.5 um) (Chiu 1948, 1957; Wang et al. 2004).
Acknowledgements
We would like to thank the Sampedro Romano family (Fina, José, and Alfonso)
(Aguifio, Spain) for sending us the first specimens. The authors are grateful to Drs
Ernst E. Both (deceased) and Xiang-Hua Wang for kindly sending relevant literature.
Drs. Beatriz Ortiz-Santana and Timothy J. Baroni are thanked for critically reviewing
an earlier draft of this paper. Amancio Castro is gratefully acknowledged for technical
assistance. Finally we express the most sincere thanks to the direction and members of
the Centro de Investigacion Forestal de Lourizan (Conselleria de Medio Rural, Xunta de
Galicia) for conserving the herbarium LOU-Fungi.
Literature cited
Bessette AE, Roody WC, Bessette AR. 2000. North American boletes. A color guide to the fleshy
pored mushrooms. Syracuse University Press, New York, USA. 400 pp.
Bessette AE, Roody WC, Bessette AR, Dunaway DL. 2007. Mushrooms of the southeastern United
States. Syracuse University Press, New York, USA. 373 pp.
Binder M, Hibbett D. 2004 Toward a global phylogeny of the Boletales.
www.clarku.edu/faculty/dhibbett/boletales_stuff/Boletales_Target_list_2004.doc
Blanco-Dios JB. 2001. Agaricales des dunes de Galice (Nord-Ouest de Espagne) I: Agaricus freirei,
sp. nov. Doc. Mycol. 31 (121): 27-34.
Blanco-Dios JB. 2003. Estudios sobre el género Leucocoprinus Pat. en la Peninsula Ibérica (II).
Leucocoprinus castroi, sp. nov. Revista Catalana de Micologia, 25: 41-47.
Both EE. 1993. The boletes of North America. A compendium. Buffalo Museum of Science. Buffalo,
New York. 436 pp.
Breitenbach J, Kranzlin F. 1991. Champignons de Suisse. Tome 3. 364 pp.
Castro ML, Freire L. 1989. Gyroporus castaneus (Bull: Fr.) Quél. var. ammophilus Castro et Freire,
var. nov. Anales Jard. Bot. Madrid 45(2): 549.
Castro ML, Freire L. 1995. Gyroporus ammophilus, a new poisonous bolete from the Iberian
Peninsula. Persoonia 16(1): 123-126.
Chiu WE. 1948. The boletes of Yunnan. Mycologia 40: 199-231.
Chiu WE. 1957. Atlas of the Yunnan boletes. Beijing: Science Press. 154 pp.
Ladurner H, Simonini G. 2003. Xerocomus s.l. Fungi Europaei 8. 527 pp.
Mufioz JA. 2005. Boletus s.l. (excl. Xerocomus): Strobilomycetaceae, Gyroporaceae, Gyrodontaceae,
Suillaceae, Boletaceae. Fungi Europaei 2 [2nd edition]. 952 pp.
Ortiz-Santana B, Lodge DJ, Baroni TJ, Both EE. 2007. Boletes from Belize and the Dominican
Republic. Fungal Diversity 27: 247-416.
Péric B, Péric O. 2006. Boletus comptus Simonini, primo ritrovamento nel Montenegro e ulteriore
delimitazione della variabilita cromatica. Rivista di Micologia 49(3): 235-242.
Simonini G. 1992. Boletus comptus sp. nov. Rivista di Micologia. 35(3): 195-208.
Singer R. 1965. Die Rohrlinge, Teil I. Die Boletaceae. Die Pilze Mitteleuropas, Band V. 131 pp +
21 pl.
332 ... Blanco-Dios & Marques
Smith AH, Thiers HD. 1971. The boletes of Michigan. University of Michigan Press, Ann Arbor.
428 pp.
Thiers HD. 1975. California mushrooms. A field guide to the boletes. Hafner Press, New York. 261
PPp-
Wang X, Liu P, Yu F. 2004. Color atlas of wild commercial mushrooms in Yunnan. Yunnan Science
and Technology Press. 136 pp.
Zang M. 1999. An annotated check-list of the genus Boletus an its sections from China. Fungal
Science 14(3,4): 79-87.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.333
Volume 122, pp. 333-345 October-December 2012
An efficient protocol for DNA extraction from Meliolales
and the description of Meliola centellae sp. nov.
DANILO B. PINHO’, ANDRE L. FIRMINO’,
WALNIR G. FERREIRA-JUNIOR? & OLINTO L. PEREIRA”
‘Departamento de Fitopatologia, Universidade Federal de Vicosa &
?Departamento de Botanica, Universidade Federal de Vicosa,
Vigosa CEP 36570-000 Minas Gerais Brazil
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — ‘The first black mildew fungus associated with Apiaceae is collected from
the state of Minas Gerais, Brazil. The new species is described, illustrated, and compared
morphologically with species reported on hosts belonging to the related Araliaceae.
Additionally, two efficient methods for extracting DNA from biotrophic fungi are described.
Phylogenetic 28S rDNA sequence analyses confirm Meliolales as a distinct order within
Sordariomycetes.
Key worps — Ascomycetes, medicinal plant, Meliolaceae, tropical fungi, phylogeny
Introduction
Centella asiatica is a native plant of tropical Asia and commonly grows in
humid areas in many tropical regions. This plant was introduced in Brazil
and grows as a weed in the lawns of gardens in the southern and southeastern
regions (Kissmann & Groth 1999). Brazilian researchers have paid relatively
little attention to fungi associated with C. asiatica. Among the 20 fungal
species described on this host worldwide, only three are reported from
Brazil: Capnodium brasiliense Puttemans, Septoria asiaticae Speg., and Vitalia
setofasciculata Bat. et al. (Farr & Rossman 2012, Mendes & Urben 2012).
During recent surveys of black mildew fungi in Brazil, several species
were recorded on representatives of Anacardiaceae, Asteraceae, Bignoniaceae,
Burseraceae, Euphorbiaceae, Fabaceae (Caesalpinioideae and Papilionoideae),
Piperaceae, and Sapindaceae (Pinho et al. 2009, 2012; Macedo et al. 2010; Silva
et al. 2012). The present work includes the description of a new species collected
on C. asiatica.
334 ... Pinho &al.
Black mildew fungi infect plant species from numerous botanical families and
are widely distributed in the tropics and subtropics (Hansford 1961, Hosagoudar
1996). As these fungi are strictly obligate biotrophs and must interact with
living plant cells for growth and reproduction, they are usually host specific
or have a very narrow host range (Hansford 1961; Hosagoudar 1996). Thus,
attempts to grow species of Meliolales in pure culture have not been successful,
making their DNA extraction challenging (Hansford 1961, Hosagoudar
1996, Vitoria et al. 2010). The development of an efficient protocol for DNA
extraction from this fungal group would allow the taxonomic value of different
morphological characters to be determined and might reveal discriminatory
differences previously overlooked (Saenz & Taylor 1999, Lumbsch & Huhndorf
2007, Rodriguez & Piepenbring 2007, Vitoria et al. 2010).
In the present paper we provide a detailed account of the black mildew
fungus found on C. asiatica and describe it as a new Meliola species based on
its morphology and purported host specificity. In addition, we present two
efficient DNA extraction methods from biotrophic fungi and the phylogenetic
relationship of Meliolales based on 28S rDNA nucleotide sequences.
Materials & methods
Morphology
Centella asiatica plants were found covered with black colonies on both sides of the
leaves during September 2009 in the “Mata da Dendrologia’, a fragment of secondary
tropical seasonal semi-deciduous montane forest, a component of the Brazilian Atlantic
forest in the campus of the Universidade Federal de Vicosa, Vicosa, Minas Gerais, Brazil.
Symptomatic leaves were collected, photographed, and dried in a plant press. Fresh
samples examined under an Olympus SZ40 stereomicroscope were promptly recognized
as a meliolaceous fungus. Representative structures were either scraped with a scalpel or
removed with an adhesive tape and mounted in lactophenol. Slides containing the fungal
structures were examined and photographed under an Olympus BX 51 light microscope
equipped with an Olympus e-volt 330 digital camera. Illustrations were prepared with
a drawing tube and finalized with the method described by Barber & Keane (2007). For
scanning electron microscopy, air-dried material was directly mounted and coated by a
thin layer of gold in a sputter coater (Balzers® model FDU 010) for 2 min. Photographs
were made with a Carl-Zeiss Model LEO VP 1430 scanning electron microscope (SEM).
Biometric data was based on 30 measurements of structures. A representative specimen
was deposited in the local herbarium at the Universidade Federal de Vicosa (Herbarium
VIC).
DNA extraction
To obtain a representative fungal DNA, ca. 50 fertile perithecia of Asteridiella obesa
(Speg.) Hansf., Irenopsis heveae Hansf., Meliola centellae, and M. vernaliae D.B.Pinho &
O.L.Pereira were examined under a stereomicroscope to check for possible contamination
by other fungi. They were removed with the aid of a fine glass needle and placed into
Meliola centellae sp. nov. (Brazil) ... 335
a microcentrifuge tube (1.5 ml) containing 5 ul of double distilled water and stored at
-20°C for later use. Total genomic DNA was extracted by using Wizard’ Genomic DNA
Purification Kit (Promega Corporation, WI, U.S.A.) with some adjustments as follows:
Fungal samples were processed by freezing the sample with liquid nitrogen and
grinding it into a fine powder using a microcentrifuge tube pestle. The crushing continued
after adding 100 ul Nuclei Lysis Solution + 100 mg polyvinylpyrrolidone. After 500 ul
of the same solution was added, the sample mixture was vortexed at high speed for 3-5
seconds to wet the tissue. The samples were incubated at 65°C for 15 minutes. After the
solution was cooled at -20°C for 5 min, 200 ul Protein Precipitation Solution was added,
mixed in a vortex at high speed for 20 seconds, and centrifuged for 10 min at 14000 rpm.
The supernatant (about 600 ul) containing the DNA was transferred to a clean 1.5 mL
microcentrifuge tube containing 600 ul of cold isopropanol. The solution was mixed by
inversion until thread-like DNA strands formed a visible mass and then stored at -20°C
for 24 hours. The next day the solution was centrifuged at 14000 rpm for 5 min, and the
supernatant was discarded. 600 ul cold ethanol was added to the pellet and centrifuged
at 14000 rpm for 5 min. This ethanol step was repeated again to wash the DNA. After
the ethanol was removed, the tube was put upside down over clean towel paper and the
pellet was air dried for 30 min. As a final step, the pellet was re-suspended in 20 ul DNA
Rehydration Solution and 3 ul RNase Solution was added and mixed by inverting the
tube, which was incubated at 37°C for 1 hour. The sample was then stored at —-20°C for
later use.
Direct amplification
For direct amplification of the 28S rDNA, ca. 20 clean (free of mycoparasites) fertile
perithecia were removed using a fine glass needle and placed into a 0.2 ml microcentrifuge
tube containing 3 ul double distilled water (Jaklitsch & Voglmayr 2012). After soaking in
the water, the samples were squashed with a sterile forceps to release their contents and
mixed in a vortex at high speed for 1 min. We also tested the protocol from Vitoria et
al. (2010), replacing 3 yl double distilled water by 3 yl Cell Lysis Buffer (0.05M NaOH,
0.25% [w/v] SDS). The samples were frozen for 15 min at -20°C and thawed in a water
bath at 80°C for 15 min, modifying the protocol in Griffin et al. (2002). This process
was repeated three times using crushed dry ice and thawing in a water bath. When the
solution cooled, the ingredients for PCR reactions were added.
PCR amplification and DNA sequencing
For each 25 ul PCR reaction we used 12.5 ul Dream Taq TM PCR Master Mix 2X
(MBI Fermentas, Vilnius, Lithuania), 1 ul each of 10 uM forward and reverse primers
(Invitrogen, Carlsbad, EUA), 1 ul dimethyl sulfoxide (DMSO, Sigma-Aldrich, St. Louis,
MO, U.S.A.), 5 wl 100x (10 mg/mL) Bovine Serum Albumin (BSA, Sigma-Aldrich,
St. Louis, MO, U.S.A.), 2 ul genomic DNA, and nuclease-free water to bring the total
volume to 25 ul.
Theprimers LROR(5’-ACCCGCTGAACTTAAGC-3 )andLR5(5’-TCCTGAGGGAAACTTCG-
3’) and ITS1 (5’°-TCCGTAGGTGAACCTGCGG-3’) and ITS4 (5’°-TCCTCCGCTTATTGATATGC-
3’) were used to amplify the partial 28S rDNA and ITS, respectively (Vilgalys & Hester
1990, White et al. 1990). Amplifications began with an initial denaturation at 95°C for
5 min, followed by 40 cycles of denaturation at 94°C for 1 min, annealing at 53°C for
336 ... Pinho &al.
TABLE 1. Genbank accession numbers of 28S rDNA sequences derived from strains
used in the phylogenetic analysis.
SPECIES VOUCHER 28S RDNA
Aphysiostroma stercorarium ATCC 62321 AF543792
Apiospora bambusae ICMP 6889 DQ368630
A. setosa ICMP 4207 DQ368631
Appendiculella lozanellae MP3432 DQ508302
Asteridiella sp. 1 PPMP 796 EF094839
Asteridiella obesa VIC31239 JX096809
Balansia henningsiana AEG 96-27A AY545727
Camarops petersii JM1655 AY3 46265
C. tubulina SMH4614 AY 346266
C. ustulinoides SMH1988 AY346267
Ceratocystiopsis manitobensis CW13792 DQ294358
C. minima CMW162 DQ294361
Ceratocystis fimbriata CBS 374.83 AF221009
Chaetosphaeria ovoidea SMH 2605 AFO64641
Claviceps paspali CBS 110.22 U47826
Coniochaeta leucoplaca JONG 54 FJ167399
C. ostrea AFTOL-ID 915 DQ470959
C. velutina UAMH 10912 EU999180
Coniochaetidium savoryi TRTC 51980 AY346276
Cornipulvina ellipsoides — DQ231441
Cryphonectria parasitica CMW 13749 AF277132
Diaporthe phaseolorum CBS 435.87 U47830
Diatrype disciformis CBS 197.49 U47829
Discostroma botan HHUEF 4642 DQ368629
Endomeliola dingleyae PDD 98304 GU138866
Faurelina elongata CBS 126.78 DQ368625
Gelasinospora tetrasperma ATCC 96230 AY346281
Gnomonia ribicola CBS 115443 DQ368626
Grosmannia grandifoliae CMW703 DQ294399
G. penicillata CMW470 DQ294385
Halosarpheia fibrosa JK5132C U46886
Halosphaeria appendiculata CBS 197.60 U46885
Hypocrea pallida GJS89-83 U00740
H. schweinitzii CBS 243.63 U47833
Hypomyces polyporinus CBS 168.89 AF543793
Irenopsis sp. VIC31752 JX096807
Melanochaeta hemipsila SMH 2125 AY346292
Meliola centellae VIC31244 JQ734545
M. variaseta DRJ 54 EFO94840
M. vernaliae VIC31240 JX096808
Nectria cinnabarina IAM 14568 AF193237
Neurospora crassa CBS 709.71 AY681158
Ophiostoma lunatum CMW10564 DQ294355
O. nigrocarpum CMW651 DQ294356
O. piliferum CBS129.32 AY281094
Meliola centellae sp. nov. (Brazil) ... 337
TABLE 1, concluded
SPECIES VOUCHER 28S RDNA
O. ulmi CBS 298.87 DQ368627
Plagiostoma euphorbiae CBS 340.78 AF277131
Poroconiochaeta discoidea SANK 12878 AY346297
Pyxidiophora arvernensis AFTOL-ID 2197 FJ176894
Seiridium cardinale ATCC52521 AF382377
Sordaria fimicola CBS 723.96 AF132330
S. macrospora ATCC 36709 AY346301
Valetoniellopsis laxa CBS 191.97 AY015635
Valsa ceratosperma AR3426 AF408387
Valsonectria pulchella SMH1193 AY 346304
Xylaria acuta AFTOL-ID 63 AY544676
X. hypoxylon CBS 499.80 U47841
45s, extension at 72°C for 2 min and a final extension of 7 min at 72°C. PCR products
were analyzed on 2% agarose electrophoresis gels stained with GelRed™ (Biotium Inc.,
Hayward, CA, U.S.A.) in a 1x TAE buffer and visualized under UV light to check for
amplification size and purity. PCR products were purified and sequenced by Macrogen
Inc., South Korea (http://www.macrogen.com). The nucleotide sequences were edited
with the DNA Dragon software (Hepperle 2011). All sequences were checked manually
and nucleotides with ambiguous positions were clarified using primer sequences in both
directions. Obtained sequences were deposited in GenBank (www.ncbi.nlm.nih.gov).
Phylogenetic analysis
For phylogenetic analysis, 28S rDNA sequences from additional species were
retrieved from GenBank (TABLE 1). Consensus regions were compared against GenBank’s
database using Mega BLAST program. The closest hit sequences and representatives of
selected Sordariomycetes (Boliniales, Chaetosphaeriales, Coniochaetales, Diaporthales,
Hypocreales, Meliolales, Microascales, Ophiostomatales, Sordariales, and Xylariales)
were obtained from Genbank (www.ncbi.nlm.gov) to help clarify the phylogenetic
relationship of Meliolales within the class. All sequences were downloaded in FASTA
format and aligned using the multiple sequence alignment program MUSCLE (Edgar
2004) built in MEGA v. 5 software (Tamura et al. 2011). Alignments were checked and
necessary manual adjustments were made. All ambiguously aligned regions within
dataset were excluded from the analysis. Gaps (insertions/deletions) were treated as
missing data. The resulting alignment was deposited in TreeBASE (http://www.treebase.
org/) (accession number $12768).
Bayesian inference (BI) analysis employing a Markov Chain Monte Carlo method
(MCMC) was performed. Before launching BI, the best nucleotide substitution models
were determined with MrMopELTEstT 2.3 (Posada & Buckley 2004). After calculation of
likelihood scores, models were selected according to the Akaike Information Criterion
(AIC). The general time-reversible evolution model (Rodriguez et al. 1990) was used,
including estimation of invariable sites and assuming a discrete gamma distribution
with six rate categories (GTR+1+G). The alignment was phylogenetically analyzed on
CIPRES webportal (Miller et al. 2010) using MrBayes v.3.1.1 (Ronquist & Huelsenbeck
338 ... Pinho & al.
Coniochaetidium savoryi
oo Poroconiochaeta discoidea ‘
Coniochaeta velutina Coniochaetales
Coniochaeta leucoplaca
Coniochaeta ostrea
Ophiostoma piliferum
am ophiostoma ulmi
83! L Ophiostoma lunatum
999] '— Ophiostoma nigrocarpum :
Ceratocystiopsis manitobensis Ophi ostomatales
Ceratocystiopsis minima
Grosmannia penicillata
oe ~ Grosmannia grandifoliae
: Chaetosphaeria ovoidea Chaetosphaerial
Melanochaeta hemipsila aelospnaeriales
Sordaria fimicola
Sordaria macrospora ‘
Neurospora crassa Sordariales
Gelasinospora tetrasperma
Camarops petersii
Camarops tubulina | Boliniales
0,99)
2
Camarops ustuliniodes
9g-— Cornipulvina ellipsoides
0,95 Asteridiella sp.1
9.5] Endomeliola dingleyae
nae Arent lozanellae Meliolales
,; Meliola variaseta
0,99 |______________ Mgliofa centellae
|________ Asteridiella obesa
Irenopsis sp.
Diaporthe phaseolorum
eG romonia ribicola j
Valsa ceratosperma Diaporthales
Plagiostoma euphorbiae
ee Cryphonectria parasitica
Diatrype disciformis
Seiridium cardinale
Discostroma botan A
Xylaria hypoxylon xy lariales
Xylaria acuta
Apiospora bambusae
079 Apiospora setosa
| Valsonectria pulchella
Balansia henningsiana
-—— Claviceps paspali
Nectria cinnabarina
Valetoniellopsis laxa Hypocreales
Hypocrea schweinitzii
Aphysiostroma stercorarium
Hypocrea pallida
Hypomyces polyporinus
ee Halosphaeria appendiculata
a Halosarpheia fibrosa '
a2 mes Ceratocystis fimbriata Microascales
Faurelina elongata
Pyxidiophora arvernensis
0,82
Fic. 1. Phylogenetic tree inferred from Bayesian Analysis of 28S rDNA Sordariomycetes sequences.
Bayesian posterior probability of >70% are indicated above the nodes and bold lines indicate
posterior probabilities of 1.00. The species in study are in bold. The tree is rooted with Pyxidiophora
arvernensis,
2003). Four MCMC chains were run simultaneously, starting from random trees for
10,000,000 generations. Trees were sampled every 1000" generation for a total of 10,000
trees. The first 2500 trees were discarded as the burn-in phase of each analysis. Posterior
probabilities (Rannala & Yang 1996) were determined from a majority-rule consensus
tree generated with the remaining 7500 trees. Convergence of the log likelihoods was
analyzed with TRACER v. 1.4.1 (Rambaut & Drummond 2003); no lack of convergence
was detected. Trees were visualized in FigTree (Rambaut 2009) and exported to graphics
programs. Pyxidiophora arvernensis (Breton & Faurel) N. Lundq. was used as outgroup
in these analyses.
Meliola centellae sp. nov. (Brazil) ... 339
Results
Meliola centellae Pinho & O.L. Pereira, sp. nov. Fics 2-3
MycosBank MB519037
Differs from Meliola pectinata by its smaller ascospores and longer mycelial setae.
Type: Brazil, Minas Gerais, Mata da Dendrologia, on living leaves of Centella asiatica
(L.) Urb. (Apiaceae), 16 September 2009, D.B. Pinho (Holotype, VIC 31244).
Erymo.oey: The epithet refers to the host genus, Centella.
BEELI FORMULA 3112.3232. Colonies black, minute, amphigenous, mostly
epiphyllous, initially scattered but becoming confluent with age, dense, 1-3 mm
diameter. Hyphae dark brown, septate, straight to sub-straight, branching usually
opposite at acute angles, bearing appressoria and conidiogenous cells. Hyphal
cells 11-21 x 5-9 um. Appressoria opposite or alternate, antrorse, straight to
curved; stalk cells dark brown, cylindrical to cuneate, 2.5-5 x 5-7.5 um, head
Fic 2. Meliola centellae on Centella asiatica. A. General view of abaxial (left) and adaxial (right)
colonies on leaf surface. B. Perithecium. C. Mycelial setae. D. Appressoria. E. Mixed appressoria
and phialides. EF Ascospores. Bars: B, C = 50 um; D-F = 25 um.
340 ... Pinho &al.
cells dark brown, globose to ovate, slightly attenuated at the apex, rounded,
entire, 7.5-12.5 x 5-10 um. Phialides light brown, mixed with appressoria,
opposite, ampulliform, 12.5-25 x 6-9 um. Mycelial setae dark brown, simple,
straight, apex acute, 5-12 septate, 218-430 x 7.5-10 um. Perithecia brown,
globose, scattered, black, 152-247 um diameter. Asci evanescent. Ascospores
hyaline inside the ascus, becoming grey or brown with age, dark brown or grey
at maturity, cylindrical to ellipsoid, rounded at the tips, 4-septate, constricted
at the septa, 32-39.5 x 9.5-12.5 um.
MOLECULAR ANALYSES: The PCR-amplified fragments were obtained by
direct amplification and extraction with Wizard Genomic DNA Purification.
Both protocols were found suitable for DNA extraction of meliolaceous fungi.
On the other hand, the protocol from Vitoria et al. (2010) was not appropriate
for Meliola spp. The amplification of the partial 28S rDNA revealed sequences
of ca. 700 bp. Although the ITS sequences were not used in phylogenetic
analysis, they were lodged in GenBank (Accession No. KC252606-KC252608)
for future studies and identification purposes. The manually adjusted alignment
contained 57 strains (including the new species described here). Of the 467
characters used in the phylogenetic analysis, 209 were parsimony-informative,
252 were variable, and 207 were conserved. The Bayesian Inference tree
confirms Meliolales as a distinct order within Sordariomycetes.
Discussion
Centella asiatica belongs to Apiaceae subfam. Mackinlayoideae, which is
somewhat intermediate between Apiaceae sensu lato and Araliaceae (Plunkett
et al. 2004, Oskolski & Wyk 2010). Because no other black mildew fungus has
been reported on hosts in the Apiaceae, we compared the C. asiatica fungus
with Meliola spp. occurring on taxa in Araliaceae.
Of the 19 species and four infraspecific taxa of Meliola known on Araliaceae
(Hansford 1961, Hosagoudar et al. 1995, Hosagoudar 1996, Hosagoudar &
Archana 2009), none matched M. centellae. Six taxa (M. acanthopanacis W.
Yamam., M. araliicola W. Yamam., M. didymopanacis var. stevensii Hansf., M.
schefflerae Hansf., M. payakii Hosag., and M. pectinata Hohn.) have straight
simple mycelial setae (like M. centellae) but differ in several other traits
(Hansford 1961, Hosagoudar 1996). Meliola pectinata matches the first four
characters of the M. centellae Beeli formula but has larger ascospores and
shorter mycelial setae. Meliola acanthopanacis, M. araliicola, M. didymopanacis
Fic 3. Meliola centellae on Centella asiatica. A. SEM photographs of the perithecia and mycelial
setae (B). C. Ascospores. D. Asci with two immature ascospores. E, F. Superficial hyphae with
two-celled oppositely and alternately positioned lateral appressoria. G. Mycelial setae. H. Detail of
mycelial setae with acute apex. I. Superficial hyphae with phialides and appressoria. Bars: A= 100
um; B= 20 um; C-I = 30 um.
Meliola centellae sp. nov. (Brazil) ... 341
Cc
342 ... Pinho &al.
var. stevensii, and M. payakii also have larger ascospores than M. centellae.
Meliola centellae is also very similar to M. schefflerae but also produces larger
ascospores (45—51 x 17-19 um; Hansford 1961, Hosagoudar 1996). In addition,
the similar M. heteroseta Hohn. and M. dichotoma var. kusanoi (Henn.) Hansf.
are distinguished from the new species by larger ascospores and dichotomously
branched mycelial setae (Hansford 1961). We therefore propose Meliola
centellae for the first Meliola species (and the first Meliolaceae) recorded on a
member of the Apiaceae.
Although mycologists in several laboratories tried to isolate DNA from
meliolalean fungi, only a few attempts have been successful (Rodriguez &
Piepenbring 2007). The Meliolales are a non-culturable group frequently
contaminated by numerous other fungi. It is thought that the dark pigment
of their thick cell walls might also interfere with DNA isolation (Rodriguez &
Piepenbring 2007). Although the Vitoria et al. (2010) method has been reported
as suitable for extracting DNA from ascomata, we found it inappropriate for
Meliola spp. Here we successfully extracted DNA from Meliolales through direct
amplification and extraction with Wizard Genomic DNA Purification kit.
Successful direct amplification of fungal DNA have been published previously
for Xylariales and Meliolales (Saenz & Taylor 1999, Rodriguez & Piepenbring
2007, Jaklitsch & Voglmayr 2012), but adding the freezing/thawing steps
probably improved the process. This is commonly used for most species that
possess rigid cell walls and resist lysis techniques by compromising the integrity
of the cell wall (Griffin et al. 2002). The extraction with Wizard Genomic DNA
Purification kit is described herein as the first successful protocol for isolating
and purifying DNA from Meliolales. This procedure allows amplification of
multiple gene regions.
Of the several papers revising the systematics of the Sordariomycetes
(Spatafora et al. 2006, Zhang et al. 2006, Lumbsch & Huhndorf 2007, Tang et
al. 2007, Schoch et al. 2009), only Saenz & Taylor (1999) included members of
the Meliolales. Their phylogeny grouped Meliolales in a distinct clade close to
Sordariales and thus showed that phylogenetic analysis of molecular characters
confirmed previous morphologically based classifications placing Meliolales in
the Sordariomycetes. The most widely used gene sequences for phylogenetic
studies have been 28S rDNA genes because of their easy amplification due their
high copy number and the availability of numerous universal primers (Miller
& Huhndorf 2005, Tang et al. 2007). The present paper confirms that Meliolales
comprises a monophyletic order within Sordariomycetes (Fic. 1). Although the
presence of dark perithecia and inamyloid asci indicate that Meliolales belong
to the subclass Sordariomycetidae (Zhang et al. 2006), the phylogenetic position
of the order is still uncertain because the phylogeny inferred from the 28S
rDNA datasets are the least supported (Tang et al. 2007). Miller & Huhndorf
Meliola centellae sp. nov. (Brazil) ... 343
(2005) propose that increased taxon sampling will improve resolution in many
clades and that phylogenetic support will increase through the incorporation
of additional genes. This clearly indicates the need for extensive taxon sampling
and further investigation of DNA sequences in order to better clarify the
phylogeny of the Meliolales.
Acknowledgments
The authors wish to thank Drs. Dartanha José Soares (Empresa Brasileira de Pesquisa
Agropecuaria, EMBRAPA Algodao, Campina Grande, Brazil) and Virupakshagouda
B. Hosagoudar (Tropical Botanic Garden and Research Institute, Palode 695562,
Tiruvananthaparum, Kerala, India) for reviewing the manuscript and CNPq (Conselho
Nacional de Desenvolvimento Cientifico e Tecnoldgico) for financial support.
Literature cited
Barber PA, Keane PJ. 2007. A novel method of illustrating microfungi. Fungal Diversity 27: 1-10.
Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput.
Nucleic Acids Research 32: 1792-1797. http://dx.doi.org/10.1093/nar/gkh340
Farr DF, Rossman AY. 2012. Fungal Databases, Systematic Mycology and Microbiology Laboratory,
ARS, USDA. Available at: http://nt.ars-grin.gov/fungaldatabases/ [Verified 10 February 2012].
Griffin, DW, Kellogg CA, Peak KK, Shinn EA. 2002. A rapid and efficient assay for extracting DNA
from fungi. Letters in Applied Microbiology: 34: 210-214.
http://dx.doi.org/10.1046/j.1472-765x.2002.01071.x
Hansford CG. 1961. The Meliolineae. A Monograph. Beiheth. Sydowia 2: 1-806.
Hepperle D. 2011. DNA Dragon 1.4.1 - DNA Sequence Contig Assembler Software. Available at:
http://www.dna-dragon.com/ [Verified 15 November 2011].
Hosagoudar VB. 1996. Meliolales of India. Botanical Survey of India, Calcutta. 363 p.
Hosagoudar VB, Archana GR. 2009. Host range of meliolaceous fungi in India. Journal of
Threatened Taxa 1: 269-282.
Hosagoudar VB, Sarbhoy AK, Agarwal DK, Khan MK. 1995. Meliolaceae exsiccatae in herbarium
cryptogamae Indiae orientalis. Mycotaxon 56: 347-386.
Jaklitsch WM, Voglmayr H. 2012. Phylogenetic relationships of five genera of Xylariales and
Rosasphaeria gen. nov (Hypocreales). Fungal Diversity 52: 75-98.
http://dx.doi.org/10.1007/s13225-011-0104-2
Kissmann KG, Groth D. 1999. Plantas infestantes e nocivas. 2 ed. Sao Paulo, SP, Basf. 978 p.
Lumbsch HT, HuhndorfSM. 2007. Whatever happened to the Pyrenomycetes and Loculoascomycetes?
Mycological Research 111: 1064—1074. http://dx.doi.org/10.1016/j.mycres.2007.04.004
Macedo DM, Pinho DB, Barreto RW, Cuda JP, Pereira OL. 2010. Black mildew fungi (Meliolaceae)
associated with Schinus terebinthifolius (Brazilian pepper tree) in Brazil. Mycotaxon 114:
429-437. http://dx.doi.org/10.5248/114.429
Mendes MAS, Urben AF. 2012. Fungos relatados em plantas no Brasil, Laboratorio de
Quarentena Vegetal. Brasilia, DF: Embrapa Recursos Genéticos e Biotecnologia. Available at:
http://pragawall.cenargen.embrapa.br/aiqweb/michtml/fgbanco01.asp [Verified 10 Febr. 2012].
Miller NA, Huhndorf SM. 2005. Multi-gene phylogenies indicate ascomal wall morphology
is a better predictor of phylogenetic relationships than ascospore morphology in the
Sordariales (Ascomycota, Fungi). Molecular Phylogenetics and Evolution 35: 60-75.
http://dx.doi.org/10.1016/j.ympev.2005.01.007
344 ... Pinho &al.
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway for inference
of large phylogenetic trees. 1-8, in: Proceedings of the Gateway Computing Environments
Workshop (GCE), 14 Nov. 2010, New Orleans, LA.
Oskolski AA, Van Wyk BE. 2010. Wood and bark anatomy of Centella: scalariform perforation
plates support an affinity with the subfamily Mackinlayoideae (Apiaceae). Plant Systematics and
Evolution 289: 127-135. http://dx.doi.org/10.1007/s00606-010-0338-6
Pinho DB, Pereira OL, Nicoli A, Honorato-Junior J, Braganga CAD. 2009. Black mildew disease on
the neotropical medicinal shrub Pothomorphe umbellata in Brazil, caused by Irenopsis tortuosa
var. potomorphes. Australasian Plant Disease Notes 4: 84-86.
Pinho DB, Pereira OL, Firmino AL, Silva M, Ferreira-Junior WG, Barreto RW. 2012. New
Meliolaceae from the Brazilian Atlantic Forest 1. Species on hosts in the families Asteraceae,
Burseraceae, Euphorbiaceae, Fabaceae and Sapindaceae. Mycologia 104: 121-137.
http://dx.doi.org/10.3852/10-260
Plunkett GM, Chandler GT, Lowry PP, Pinney SM, Sprenkle TS. 2004. Recent advances in
understanding Apiales and a revised classification. South African Journal of Botany 70:
371-381.
Posada D, Buckley TR. 2004. Model selection and model averaging in phylogenetics: advantages of
Akaike information criterion and Bayesian approaches over likelihood ratio tests. Systematic
Biology 53: 793-808. http://dx.doi.org/10.1080/10635150490522304
Rambaut A. 2009. FigTree 1.2.2. Available at: http://tree.bio.ed.ac.uk/software/figtree/ [Verified 15
January 2012]
Rambaut A, Drummond A. 2003. Tracer MCMC trace analysis tool. Oxford, UK: University of
Oxford. Available at: http://tree.bio.ed.ac.uk/software/tracer/ [Verified 15 January 2012]
Rannala B, Yang Z. 1996. Probability distribution of molecular evolutionary trees: a new method of
phylogenetic inference. Journal of Molecular Evolution 43: 304-311.
http://dx.doi.org/10.1007/BF02338839
Rodriguez D, Piepenbring M. 2007. Two new species of Appendiculella (Meliolaceae) from Panama.
Mycologia 99: 544-552. http://dx.doi.org/10.3852/mycologia.99.4.544
Rodriguez F, Oliver JF, Marin A, Medina JR. 1990. The general stochastic model of nucleotide
substitutions. Journal of Theoretical Biology 142: 485-501.
http://dx.doi.org/10.1016/S0022-5193(05)80104-3
Ronquist F, Heulsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Saenz GS, Taylor JW. 1999. Phylogenetic relationships of Meliola and Meliolina inferred
from nuclear small subunit rRNA sequences. Mycological Research 103: 1049-1056.
http://dx.doi.org/10.1017/S0953756298008211
Schoch CL, Sung G-H, Lopez-Giraldez F, Townsend JP, Miadlikowska J, Hofstetter V, Robbertse B,
Matheny B, Kauff K Wang Z, Gueidan C, Andrie RM, Trippe K, Ciufetti LM, Wynns A, Fraker
E, Hodkinson BP, Bonito G, Groenewald JZ, Arzanlou M, Hoog GS, Crous PW, Hewitt D,
Pfister D, Peterson K, Gryzenhout M, Wingfield MJ, Aptroot A, Suh S-O, Blackwell M, Hillis
DM, Griffith GW, Castlebury LA, Rossman A, Lumbsch HT, Licking R, Biidel B, Rauhut A,
Diederich P, Ertz D, Geiser DM, Hosaka K, Inderbitzin P, Kohlmeyer J, Volkmann-Kohlmeyer
B, Mostert L, O’Donnell K, Sipman H, Rogers JD, Shoemaker R, Sugiyama J, Summerbell RC,
Untereiner W, Johnston PR, Stenroos S, Zuccaro A, Dyer PS, Crittenden PD, Cole MS, Hansen
K, Trappe JM, Yahr R, Lutzoni F, Spatafora JW. 2009. Ascomycota Tree of Life: A phylum-wide
phylogeny clarifies the origin and evolution of fundamental reproductive and ecological traits.
Systematic Biology 58: 224-239. http://dx.doi.org/10.1093/sysbio/syp020
Meliola centellae sp. nov. (Brazil) ... 345
Silva M, Barreto RW, Pereira OL. 2012. Fungal pathogens of ‘cat’s claws’ from Brazil for biocontrol
of Macfadyena unguis-cati. Mycotaxon 119: 181—195. http://dx.doi.org/10.5248/119.181
Spatafora JW, Sung GH, Johnson D, Hesse C, O'Rourke B, Serdani M, Spotts R, Lutzoni F,
Hofstetter V, Miadlikowska J, Reeb V, Gueidan C, Fraker E, Lumbsch T, Lucking R, Schmitt I,
Hosaka K, Aptroot A, Roux C, Miller AN, Geiser DM, Hafellner J, Hestmark G, Arnold AE,
Budel B, Rauhut A, Hewitt D, Untereiner WA, Cole MS, Scheidegger C, Schultz M, Sipman
H, Schoch CL. 2006. A five-gene phylogeny of Pezizomycotina. Mycologia 98: 1018-1028.
http://dx.doi.org/10.3852/mycologia.98.6.1018
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS5: Molecular
evolutionary genetics analysis using Maximum Likelihood, Evolutionary Distance,
and Maximum Parsimony Methods. Molecular Biology and Evolution 28: 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
Tang, AMC, Jeewon R, Hyde KD. 2007. Phylogenetic utility of protein (RPB2, beta-tubulin) and
ribosomal (LSU, SSU) gene sequences in the systematics of Sordariomycetes (Ascomycota,
Fungi). Antonie Van Leeuwenhoek 91: 327-349. http://dx.doi.org/10.1007/s10482-006-9120-8
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4239-4246.
Vitoria NS, Bezerra JL, Gramacho KP. 2010. A simplified DNA extraction method for PCR analysis
of Camarotella spp. Brazilian Archives of Biology and Technology 53: 249-252.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. (Eds.) PCR
Protocols: A guide to methods and applications. San Diego, California, USA. Academic Press.
pp. 315-322.
Zhang N, Castlebury LA, Miller AN, Huhndorf SM., Schoch CL, Seifert KA., Rossman AY,
Rogers JD, Kohlmeyer J, Volkmann-Kohlmeyer B, Sung GH. 2006. An overview of the
systematics of the Sordariomycetes based on a four-gene phylogeny. Mycologia 98: 1076-1087.
http://dx.doi.org/10.3852/mycologia.98.6.1076
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.347
Volume 122, pp. 347-353 October-December 2012
Tuber sinosphaerosporum sp. nov. from China
Li FAN”, JIN-ZHONG CAO? & Yu Lr?’
" College of Life Science, Capital Normal University,
Xisanhuanbeilu 105, Haidian, Beijing 100048, China
? Institute of Mycology, Jilin Agricultural University, Changchun 130118, China
* CORRESPONDENCE TO:
[email protected]
ABsTRACT — A new white truffle species from China is described and illustrated. Tuber
sinosphaerosporum is characterized by its white ascomata and globose ascospores ornamented
with large reticulum meshes. The new species, supported by ITS sequence analysis, offers
commercial value due to its moderate to relatively large size and possibly high yield in
China.
KEY worDs —Ascomycota, taxonomy
Introduction
The number of Tuber species in China has increased considerably over the
last thirty years (Liu 1985, Wang 1988, Wang & Li 1991, Wang et al. 1998, Wang
& He 2002, Tao et al. 1989, Hu 1992, Xu 1999, He et al. 2004, Hu & Wang 2005,
Chen et al. 2005, Chen & Liu 2007, Cao 2010, Fan et al. 2011, 2012a,b), and
new species are still being found. In December 2010, about a kilo of fresh white
truffles growing under Corylus sp. was collected from Baoshan City of Yunnan
Province; they had a strong but pleasant aroma of garlic, typical of white truffles.
Subsequently, another white truffle was collected from Chenggong County
near Kunming City of Yunnan that was morphologically similar to the Baoshan
specimens but grew under conifers. Detailed morphological observation and
molecular research confirm that the collections from both locations represent
a single undescribed species.
Materials & methods
Morphological studies
Truffles were collected from Baoshan City and Chenggong County, Yunnan Province.
Macroscopic characters were described from fresh specimens. Microscopic characters
were described from razor-blade sections of fresh specimens mounted in 3% KOH,
348 ... Fan, Cao & Li
TABLE 1 Tuber specimens and sequence numbers used in molecular studies.
SPECIES NAME VOUCHER ORIGIN ITS REFERENCE
T. borchii Vittad. GB62 Italy HM485342 Bonito et al. 2010
GB39 Unknown HM485343 Bonito et al. 2010
GB45 Italy HM485344 Bonito et al. 2010
T. borchii var. HKAS 520005 China GQ 217541 GenBank
sphaerospermum
Malengon
T. californicum Harkn. L4AB7 Unknown EF411102 Morris et al. 2008
JT22590 USA HM485351 Bonito et al. 2010
JT28058 USA HM485346 Bonito et al. 2010
T. latisporum HKAS 30838B China DQ898185 Chen & Liu 2007
Juan Chen & PG. Liu
HKAS42380 China DQ898184 Chen & Liu 2007
HKAS44315 China DQ898183 Chen & Liu 2007
T. melanosporum Vittad. A59 France AF106878 From GenBank
TM13 France AF132501 Roux et al. 1999
T. oligospermum (Tul. & MA: FUNGI: 41010A Spain FM205506 GenBank
C. Tul.) Trappe
MA: FUNGI: 41010B Spain FM205507 GenBank
MA: FUNGI: 28388B Spain FM205508 GenBank
MA: FUNGI: 28389 Spain FM205509 GenBank
T. puberulum TL11885 Denmark AJ969626 Tedersoo et al. 2006
Berk. & Broome
TL3857 Denmark AJ969625 Tedersoo et al. 2006
BI-32 Hungary AJ557537 Halasz et al. 2005
T. sinosphaerosporum BJTC FAN135 China JX092086 This study
(HOLOTYPE)
BJTC FAN136 China JX092087 This study
T. sphaerosporum Gilkey JT12487 USA FJ809853 Bonito et al. 2010
JT19772 USA FJ809854 Bonito et al. 2010
JT12487 USA GQ221449 From GenBank
OSC75864 USA HM485390 From GenBank
Melzer’s reagent, or 0.1% (w/v) cotton blue in lactic acid. The specimens are deposited
in BJTC (Biology Department Herbarium, Capital Normal University). For scanning
electron microscopy (SEM), spores were scraped from the dried gleba, placed on to
doubled-sided tape, mounted directly on an SEM stub, coated with gold—palladium, and
then examined and photographed with a HITACHI S-4800 SEM.
Molecular methods
Herbarium samples were crushed by shaking for 3 min at 30 Hz (Mixer Mill MM
301, Retsch, Haan, Germany) ina 1.5 ml tube together with one 3 mm diameter tungsten
carbide ball. Total genomic DNA was then extracted using the PeqLabE.Z.N.A._ Fungal
DNA kit following the manufacturer's protocol. The ITS region was amplified with
PCR using the primers ITS1/ITS4 (White et al. 1990). PCR was performed in 50 ul
reactions containing DNA template 2 ul, primer (10UM) 2 ul each, 2 x Master Mix
(Tiangen Biotech (Beijing) Co. Ltd.) 25 ul. PCR reactions were run as follows: an initial
Tuber sinosphaerosporum sp. nov. (China) ... 349
Tuber sphaerosporum FJ809853
100 0.85 Tuber sphaerosporum GQ221449
1.00 77 Tuber sphaerosporum FJ809854
0.89 Tuber sphaerosporum HM485390
nee Tuber californicum HM485351
a Tuber californicum HM485346
0.79 Tuber californicum EF411102
91 Tuber latisporum DQ898184
100|9-99 Tuber latisporum DQ898185
190 Tuber latisporum DQ898183
0.83 100 Tuber oligospermum FM205506
100) 1.00 Tuber oligospermum FM205507
oer 1.00) 400) Tuber oligospermum FM205508
1.00 Tuber oligospermum FM205509
Tuber borchii var sphaerospermum GQ217541
is 100 Tuber sinosphaerosporum JX092086
1.00 Tuber sinosphaerosporum JX092087
Tuber puberulum AJ969625
100 Tuber puberulum AJ969626
ot 1,08 Tuber puberulum AJ557537
7.00 Tuber borchii HM485342
100 Tuber borchii HM485343
Tuber borchii HM485344
Tuber melanosporum AF 132501
Tuber melanosporum AF106878
Fic. 1. Phylogeny derived from maximum parsimony ITS rDNA sequence analysis of some Tuber
species with reticulate ascospore ornamentation using T: melanosporum as outgroup. Bootstrap
values of >70% from 1000 replications are shown above the respective branches. Clades with
Bayesian posterior probabilities (PP) estimated >0.70 (70%) are marked under the branches.
denaturation at 95°C for 3 min, followed by 30 cycles at 95°C for 2 min, 55°C for 25 s,
72°C for 2 min, and a final extension at 72°C for 10 min. The PCR products were sent
to Invitrogen Biotechnology Co. Ltd. (Beijing, China) for purifying, sequencing, and
editing. The other sequence data of ITS rDNA included in this study were downloaded
from GenBank. GenBank numbers are shown in TABLE 1.
Phylogenetic analyses
DNA sequences were aligned with Clustal X (Thompson et al. 1997). The alignment
was manually adjusted with Se-Al v.2.03a (Rambaut 2000). The aligned dataset was
analyzed with maximum parsimony (MP) using PAUP*4.0b10 (Swofford 2002).
Maximum parsimony analysis was conducted using heuristic searches with 1000
replicates of random-addition sequence, tree bisection reconnection (TBR) branch
swapping algorithm. All characters were equally weighted and unordered. Gaps were
treated as missing data to minimize homology assumptions. A bootstrap (BS) analysis
was performed with 1000 replicates, each with 10 random taxon addition sequences.
TBR branch swapping was employed. The Bayesian analysis was performed with
MrBayes 3.1.2 (Huelsenbeck et al. 2001; Ronquist and Huelsenbeck 2003) with two sets
of four chains (one cold and three heated) and the stoprule option in effect, halting
the analyses at an average standard deviation of split frequencies of 0.01. The sample
frequency was set to 100, and the first 25% trees were removed as burn-in. Bayesian
posterior probabilities (PP) were obtained from the 50% majority rule consensus of
the remaining trees. Two sequences derived from Tuber melanosporum were used as
outgroup.
350 ... Fan, Cao & Li
Results
Molecular phylogenetics
279 of 612 characters were found to be parsimony-informative. Maximum
parsimony analysis resulted in one most parsimonious tree (Fic.1) with a
length (TL) of 510 steps, consistency index (CI) of 0.7804, retention index (RI)
of 0.8948 and rescaled consistency index (RCI) of 0.6983 (for all sites).
The ITS sequence phylogeny (Fic. 1) revealed that sequences from the two
Yunnan collections (Tuber sinosphaerosporum) were the same and grouped in
a clade with strong support (BS = 100, PP = 1.00). They appear to form a sister
relationship with T. borchii and T. oligospermum but with very low support.
Taxonomy
Tuber sinosphaerosporum L. Fan, J.Z. Cao & Yu Li, sp. nov. FIG. 2
MycoBank MB800677
Differs from other Tuber species in its fresh white ascomata and regular globose
ascospores covered by a reticulate ornamentation that is 2-4 meshes across the spore
width.
Type: China. Yunnan Province, Baoshan City, under the soil near Corylus sp. 11 Dec.
2010, De-fu Liu (Holotype, BJTC FAN135; GenBank, JX092086))
ETYMOLOGY: sinosphaerosporum (Lat.), referring to a Chinese species resembling the
American Tuber sphaerosporum.
AscoMaATa irregularly globose or lobed, often convolute and with several
deep furrows, 1.5-5.5 cm in diam., white or whitish-cream or pale yellow
white when fresh, yellow whitish or light yellow brown after dried, the surface
poorly puberulent at least at furrows. Odor faint when young, but of strong
garlic when mature. PERIDIUM 250-300 um thick, with two layers: outer layer
100-150 um thick, pseudoparenchymatous, composed of subglobose and
angular cells 7.5-17.5 um in diam., with slightly thickened walls, yellowish-
brown towards the surface; inner layer 150-200 um thick, texture intricate, the
hyphae thin-walled, hyaline, 2.5-5 um in diam. Hairs hypha-like, arising from
the superficial cells in places, 10-40 x 2.5-5(-7.5) um, hyaline or yellowish,
usually thin-walled, 1-2 septate, cylindric and obtuse at the apex. GLEBA white
at first, becoming yellow-brown to brown at maturity, marbled with large
and rare, branched, white veins originating from various points of the inner
peridium. Asci globose, subglobose or broadly ellipsoid, sessile, 75-125 x
62.5-85 ym, 1-4-spored. Ascospores regularly globose, hyaline at first,
becoming yellow brown to brown at maturity, ornamentation regular reticulum,
20-42.5 um in 2-4-spored asci and 40-45 um in 1-spored asci in diam.
excluding the ornamentation, the meshes large and variable in size, 5.0—7.5 um
high, usually 2-4 meshes across the spore width.
Tuber sinosphaerosporum sp. nov. (China) ... 35.1
pe PANG #2 es 7GA
) PE :/ £ oC
ta? '‘2C.
ny et CHAM ‘iy
Fic. 2. Tuber sinosphaerosporum (BJTC FAN135, holotype). a. Soil adhering to the ascomal
surface makes them appear brown; b-c. Asci and ascospores observed under light microscope;
d. Ascospore observed under SEM.
ADDITIONAL SPECIMENS EXAMINED: CHINA, YUNNAN PROVINCE, CHENGGONG
County, under soil of conifers, 18 Dec. 2010, Jin-zhong Cao (BJTC FAN136; GenBank,
JX092087).
ComMENTS — Tuber sinosphaerosporum is similar to American T: sphaerosporum
in the appearance of ascospores, but the American species differs in its
glabrous brown ascomata and dark gleba (Gilkey 1939, 1954). The peridium of
T. sphaerosporum is composed of “variable cells, the large and small intermixed,
somewhat pseudoparenchymatous or often prosenchymatous” (Gilkey 1954),
whereas T: sinosphaerosporum has typical pseudoparenchymatous peridium.
The molecular study (Fic. 1) also demonstrated a considerable separation.
The other Tuber species with regular globose ascospores, such as T: californicum
from North America, Tuber borchii var. sphaerospermum from Europe, and
T. oligospermum from Europe and North Africa, are distinguished from
T. sinosphaerosporum by their reticulum meshes numbering 5-7 across the
ascospore width (Gilkey 1939, 1954, Riousset et al. 2001). Phylogenetic
analyses (Fic. 1) support T: sinosphaerosporum as a distinct species. The
352 ... Fan, Cao & Li
T. sinosphaerosporum sequences form a sister relationship with T: borchii and
T. oligospermum, but the very low support value indicates they are closely
related but distinct.
Tuber sinosphaerosporum could be a potential commercial species in the
international white truffle market because of its significant larger ascocarp size
(medium to relatively large) and strong but pleasant aroma. According to the
local people, T: sinosphaerosporum could be expected to have a high cropping
yield in Yunnan Province.
Acknowledgments
We are grateful to Prof. Anthony Whalley and Prof. Tai-Hui Li for reviewing the
pre-submitted manuscript. The study was supported by the National Natural Science
Foundation of China (No. 30770005, 30870008), the Beijing Natural Science Foundation
(No. 5122003).
Literature cited
Bonito GM, Gryganskyi AP, Trappe JM, Vilgalys R. 2010. A global meta-analysis of Tuber ITS
rDNA sequences: species diversity, host associations and long-distance dispersal. Molecular
Ecology 19: 4994-5008. http://dx.doi.org/10.1111/j. 1365-294X
Cao JZ. 2010. The genus Tuber in China [Dissertation]. Changchun: Jinlin Agricultural University.
86 p.
Chen J, Liu PG. 2007. Tuber latisporum sp. nov. and related taxa, based on morphology and DNA
sequence data. Mycologia 99: 475-481. http://dx.doi.org/10.3852/mycologia.99.3.475
Chen J, Liu PG, Wang Y. 2005. Tuber umbilicatum, a new species from China, with a key to the
spinose-reticulate spored Tuber species. Mycotaxon 94: 1-6.
Fan L, Cao JZ, Liu YY, Li Y. 2011. Two new species of the genus Tuber from China. Mycotaxon 116:
349-354. http://dx.doi.org/10.5248/116.349
Fan L, Hou CL, Cao JZ. 2012a [“2011”]. Tuber sinoalbidum and T. polyspermum — new species
from China. Mycotaxon 118: 403-410. http://dx.doi.org/10.5248/118.403
Fan L, Cao JZ, Zheng ZH, Li Y. 2012b. Tuber in China: T: microspermum and T: microspiculatum
spp. nov. Mycotaxon 119: 391-395. http://dx.doi.org/10.5248/119.391
Gilkey HM. 1939. Tuberales of North America. Oregon State Mon.1: 1-63.
Gilkey HM. 1954. Taxonomic notes on Tuberales. Mycologia 46: 783-793.
Halasz K, Bratek Z, Szego D, Rudnoy S, Racz I, Lasztity D, Trappe JM. 2005. Tests of species
concepts of the small, white, European group of Tuber spp. based on morphology and
rDNA ITS sequences with special reference to Tuber rapaeodorum. Mycol. Prog. 4: 281-290.
http://dx.doi.org/10.1007/s11557-006-0132-6
He XY, Li HM, Wang Y. 2004. Tuber zhongdianense sp.nov. from China. Mycotaxon 90: 213-216.
Hu HT. 1992. Tuber formosanum sp. nov. and its mycorrhizal associations. Quart. J. Exp. Forest.
Nat. Taiwan Univ. 6: 79-86.
Hu HT, Wang Y. 2005. Tuber furfuraceum sp. nov. from Taiwan. Mycotaxon 93: 155-157.
Liu B. 1985. New species and new records of hypogeous fungi from China (I). Acta Mycologica
Sinica 4(2): 84-89.
Morris MH, Smith ME, Rizzo DM, Rejmanek M, Bledsoe CS. 2008. Contrasting ectomycorrhizal
fungal communities on the roots of co-occurring oaks (Quercus spp.) in a California woodland.
New Phytol. 178: 167-176. http://dx.doi.org/10.1111/j.1469-8137.2007.02348.x
Tuber sinosphaerosporum sp. nov. (China) ... 353
Rambaut A. 2000. Estimating the rate of molecular evolution: incorporating non-contempor-
aneous sequences into maximum likelihood phylogenies. Bioinformatics 16: 395-399.
http://dx.doi.org/10.1093/bioinformatics/16.4.395
Riousset L, Riousset G, Chevalier G, Bardet MC. 2001. Truffes d’Europe et de Chine. Institut
National de la Recherche Agronomique, Paris. 181 p.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models, Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Roux C, Sejalon-Delmas N, Martins M, Parguey-Leduc A, Dargent R, Becard G. 1999. Phylogenetic
relationships between European and Chinese truffles based on parsimony and distance analysis
of ITS sequences. FEMS Microbiol. Lett. 180: 147-155.
http://dx.doi.org/10.1111/j.1574-6968.1999.tb08789.x
Swofford DL. 2002. PAUP*, phylogenetic analysis using parsimony (*and other methods), version
4. Sunderland, MA, USA, Sinauer Associates.
Tao K, Liu B, Zhang DC. 1989. A new species of the genus Tuber from China. Journal of Shanxi
University (Nat. Sci. Ed.) 12: 215-218.
Tedersoo L, Hansen K, Perry BA, Kjoller R. 2006. Molecular and morphological diversity of
pezizalean ectomycorrhiza. New Phytol. 170: 581-596.
http://dx.doi.org/10.1111/j.1469-8137.2006.01678.x
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTALX windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
Wang Y. 1990. First report of study on Tuber species from China. Atti del II Congresso Internazionale
sul Tartufo, Spoleto, Nov. 24-27, 1988: 45-50.
Wang Y, He XY. 2002. Tuber huidongense sp. nov. from China. Mycotaxon 83: 191-194.
Wang Y, Li ZP. 1991. A new species of Tuber from China. Acta Mycologica Sinica 10: 263-265.
(in Chinese).
Wang Y, Moreno G, Riousset LJ, Manjon JL, Riousset G, Fourre G, Di Massimo G, Garcia-Montero
LG, Diez J. 1998. Tuber pseudoexcavatum sp. nov. A new species from China commercialised
in Spain, France and Italy with additional comments on Chinese truffles. Cryptogamie Mycol.
19: 113-120.
Xu AS. 1999. A taxonomic study of the genus Tuber in Xizang. Mycosystema 18: 361-365.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.355
Volume 122, pp. 355-359 October-December 2012
Terriera angularis sp. nov. on IIlicium simonsii from China
FENG ZHOU!, XIAO-YAN WANG!, LAN ZHANG! & YING-REN LIN”
' School of Life Science & ? School of Forestry & Landscape Architecture,
Anhui Agricultural University, West Changjiang Road 130, Hefei, Anhui 230036, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Terriera angularis, a new species of Terriera that develops on leaves of
Illicium simonsii, was collected from Shennongjia forestry region of Hubei Province, China.
Description, illustration, and comments are given for this fungus. The type collection is
deposited in the Reference Collection of Forest Fungi of Anhui Agricultural University,
China (AAUF).
Key worps — Rhytismatales, morphological character, taxonomy
Introduction
Eriksson (1970) erected the segregate monotypic genus Terriera B. Erikss.
for the type species T. cladophila (Lév.) B. Erikss. (syn. Hysterium cladophilum
Lév.), which develops on twigs of Vaccinium myrtillus L. Johnston (2001), who
monographed the monocotyledon-inhabiting Lophodermium species, divided
Lophodermium into five groups, equating group B with Terriera because its
morphology was closer to T: cladophila than to the type species of Lophodermium.
Of the 24 species included in Terriera (MycoBank, www.mycobank.org/), seven
have been reported from China: T: camelliae, T: coacervata, T: huangshanensis,
T. illiciicola, T: petrakii, T. rotundata, and T: simplex (Chen et al. 2012, Gao et al.
2012, Song et al. 2012, Yang et al. 2011, Zheng et al. 2012).
Recently, during investigations of the Rhytismatales from Shennongijia
forestry region of Hubei Province, China, a new Terriera species was
discovered.
Materials & methods
Mature and immature ascomata were selected from the collected specimen.
Macroscopic features were observed under a hand lens and stereoscope. Reference
collection material was rehydrated in water for 15 min, and 10-15 um thick fruitbody
sections were cut bya freezing microtome (YD-1508-IH, China). For observing ascomatal
356 ... Zhou & al.
outlines in vertical section, sections were mounted in lactic acid or cotton blue with
pretreatment in water. The colors of the various structures and ascospore contents were
observed in water. Gelatinous sheaths surrounding ascospores and paraphyses were
examined in water or 0.1% (w/v) cotton blue in lactic acid. Measurements were made
from material mounted in 5% KOH or Melzer’s reagent and from 30 asci, ascospores,
and paraphyses for each specimen. Line and point integrated illustrations of external
shapes and internal structures of fruit bodies were drawn using a microscopic drawing
tube (Panasoianic XSJ-2, Japan).
Taxonomy
Terriera angularis Y.R. Lin, F. Zhou & Xiao Y. Wang, sp. nov. FIGS 1-5
MycoBanxk MB800350
Differs from Terriera minor by its triangular to quadrangular, rarely elliptical, mature
ascomata, and its narrower ascospores not quite tapering to both ends.
Type: China, Hubei, Shennongjia forestry region, Guanmenshan, alt. ca 1300 m, on
leaves of Illicium simonsii Maxim. (Schisandraceae), 9 July 2010, G.J. Jia & Y.R. Lin 2511
(Holotype, AAUF 68619).
EryMo_oey: angularis (Latin) = angular, referring to the external shape of the ascomata.
Co.toniEs only hypophyllous, forming irregular, large bleached spots each with
an obvious edge.
ZONE LINES absent.
CONIDIOMATA not observed.
Ascomata hypophyllous, clustered, sometimes confluent in groups of two
or three. In surface view, ascomata triangular to quadrangular, rarely elliptical,
diameter or length 350-720 um, the edge defined, grey-black to black except
sometimes for a paler region at ends, with conspicuously black perimeter
line, shiny, moderately raised above the surface of the substratum, opening by
3-4 radial splits or a longitudinal split. Young ascomata almost concolorous
with substratum surface, with dark brown perimeter line, usually rotund or
elliptical, preformed opening mechanism often appearing as a longitudinally
hollow zone. In median vertical section, ascomata subepidermal with
epidermal cells becoming filled with fungal tissue as ascoma develops. Lips not
observed. COVERING STROMA 22-30 um thick, connecting to the basal stroma,
consisting of dark brown textura angularis with thick-walled cells 3-6 um
diam. A short, ca 12 um thick extension, comprised of strongly black and brittle
tissue with no obvious cellular structure, adjacent to the top of the covering
stroma. EXCIPULUM very poorly developed, arising from the inner layer of the
covering stroma. BASAL STROMA Slightly concave, 10-22 um thick, dark brown,
composed of 2—4 rows of 3.5—7 um diam., angular, thick-walled cells. Colorless
to light grey-brown textura prismatica 35-45 um thick existing between the
covering and basal stromata. SUBHYMENIUM 12-20 um thick, consisting of
Terriera angularis sp. nov. (China) ... 357
Fics 1-5. Terriera angularis on Illicium simonsii. 1. Habit on leaf. 2. Detail of ascomata, immature
ascomata (top left). 3. Portion of ascoma in median vertical section. 4. Ascoma in median vertical
section. 5. Paraphyses, asci and ascospores.
358 ... Zhou & al.
textura angularis-porrecta. PARAPHYSES filiform, 1.8-2 tm wide, aseptate,
gradually or suddenly swollen to 4 um or branching once at the apex, covered
with a ca 1 um thick mucous coating. Asci maturing sequentially, cylindrical,
the apex round or slightly acute, 105-130 x 5.5-6.5 um, thin-walled, J-,
8-spored, with spores arranged in a fascicle. Ascospores filiform, 70-90 x
1-1.2 um, hyaline, aseptate, not quite tapering to the round base, enveloped in
a 0.8-1 um thick gelatinous sheath.
ECOLOGY & DISTRIBUTION: Ascomata on fallen leaves of Illicium simonsii.
Known only from the type locality, Hubei, China.
CoMMENTS— Terriera angularis is very similar to T: minor (Tehon) P.R. Johnst.
in the way ascomata are embedded and in ascal shape and size. However,
T: minor produces oblong to oblong-elliptic ascomata with a black flattened area
lining both sides of the single longitudinal slit-like opening, wider ascospores
(1.5-2 um) tapering slightly to both ends, paraphyses branching 2-3 times in
upper 30-40 um, and a faint to well-developed paler zone along the future line
of the immature ascoma opening (Johnston 1988, 1989a, b).
Terriera cladophila is easily distinguished from the new species by its
subcuticular circular to elliptical ascomata, subhymenium consisting of textura
angularis and textura intricata, wider asci (6-9 um), and brown diffuse zone
lines (Minter 1996).
Acknowledgments
We are grateful to Dr D.W. Minter and Dr M. Ye for invaluable suggestions and
critically reviewing the manuscript, to Mr GJ. Jia for the field investigations. This study
was supported by the National Natural Science Foundation of China (No. 31270065,
31170019), and the Specialized Research Fund for the Doctoral Program of Higher
Education of China (No. 20070364002).
Literature cited
Chen JL, Lin YR, Hou CL, Wang SJ. 2012 [“2011”]. Species of Rhytismataceae on Camellia spp.
from the Chinese mainland. Mycotaxon 118: 219-230. http://dx.doi.org/10.5248/118.219
Eriksson B. 1970. On Ascomycetes on Diapensales and Ericales in Fennoscandia. 1. Discomycetes.
Symb. Bot. Upsal. 19(4): 1-71.
Gao XM, Zheng CT, Lin YR. 2012. Terriera simplex, a new species of Rhytismatales from China.
Mycotaxon 120: 209-213.
Johnston PR. 1988. An undescribed pattern of ascocarp development in some non-coniferous
Lophodermium species. Mycotaxon 31: 383-394.
Johnston PR. 1989a. Lophodermium (Rhytismataceae) on Clusia. Sydowia 41: 170-179.
Johnston PR. 1989b. Rhytismataceae in New Zealand 2. The genus Lophodermium on indigenous
plants. New Zealand J. Bot. 27: 243-274.
Johnston PR. 2001. Monograph of the monocotyledon-inhabiting species of Lophodermium.
Mycol. Pap. 176: 1-239.
Terriera angularis sp. nov. (China) ... 359
Minter DW. 1996. Terriera cladophila. IMI Descr. Fungi & Bact. no. 1296.
Song JF, Liu L, Li YY, Hou, CL. 2012. Two new species of Terriera from Yunnan Province, China.
Mycotaxon 119: 329-335. http://dx.doi.org/10.5248/119.329
Yang ZZ, Lin YR, Hou CL. 2011. A new species of Terriera (Rhytismatales, Ascomycota) from
China. Mycotaxon 117: 367-371. http://dx.doi.org/10.5248/117.367
Zheng Q, Lin YR, Yu SM, Chen L. 2012 [“2011”]. Species of Rhytismataceae on Lithocarpus spp.
from Mt Huangshan, China. Mycotaxon 118: 311-323. http://dx.doi.org/10.5248/118.311
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.361
Volume 122, pp. 361-368 October-December 2012
A new species of Mycena sect. Sacchariferae
from the Iberian cushion-shaped Genisteae
JUAN CARLOS ZAMORA? & SANTIAGO CATALA”?
‘Real Jardin Botanico, CSIC, Pza. de Murillo 2. E-28014, Madrid, Spain
?Instituto Agroforestal Mediterraneo, Universidad Politécnica de Valencia,
Camino de Vera s/n. E-46022, Valencia, Spain
*Institut Cavanilles de Biodiversitat i Biologia Evolutiva, Universitat de Valencia,
C/ Catedratico Beltran 2, E-46980, Paterna (Valencia), Spain
* CORRESPONDENCE TO:
[email protected]
ABSTRACT— Mycena acanthophila, collected from several localities in Spain, is described
as a new species. It specialises by growing on dead branches of two spiny, cushion-shaped
species of Leguminosae. A complete description, drawings, and microphotographs showing
the morphological characters are accompanied by comparisons with morphologically related
taxa.
Key worps— acanthocysts, Echinospartum, Erinacea, nomenclature, taxonomy
Introduction
Mycena sect. Sacchariferae was first published as a nomen nudum by Kithner
(1938) and later validated by Singer (1962). This section is characterised by
the presence of acanthocysts in the pileipellis, which form a subhymeniform
layer on primordials and remain as terminal hyphal cells of the hyphae
when the pileipellis becomes a cutis with age. Desjardin (1995) subdivided
sect. Sacchariferae into three provisional stirps, Amparoina, Adscendens, and
Alphitophora), based on the presence or absence of cherocytes, caulocystidial
morphology, and the presence or absence of a basal disc.
Maas Geesteranus & de Meijer (1998) added another stirps named Fuscinea,
close to Alphitophora but with brownish contents in the acanthocysts of the
pileipellis.
According to Robich (2003), only seven species of sect. Sacchariferae have
been found in Europe: M. adscendens Maas Geest., M. alphitophora (Berk.)
Sacc., M. cecidiophila A.P. Berg et al., M. corynephora Maas Geest., M. nucicola
Huijsman, M. occulta Harmaja, and M. querciramuli Robich. Here, we describe
an apparently common new species from the Iberian Peninsula with a very
362 ... Zamora & Catala
specific habitat: dead branches of Echinospartum and Erinacea, two spiny
cushion-shaped genera in tribe Genisteae.
Materials & methods
Specimens were collected in the field and photographed when fresh with a Canon
EOS 50D. The macromorphological study was based on both fresh specimens and
photographs. The micromorphological study was performed mostly on air-dried
basidiomata, rehydrated with commercial ammonia or 3% KOH, and stained with
Congo Red. Melzer’s reagent was used for testing amyloid and dextrinoid reactions.
Measurements were all taken in ammonia solution with a Jeulin light microscope, under
a 100x immersion oil objective and 10x oculars. The hilar appendix was excluded for
basidiospore measurements, as well as excrescences for the other elements. The range
of dimensions outside the parentheses is provided after manually rejecting 5% of the
highest and lowest values, while the extremes are provided between parentheses. The Q
coefficient is calculated as length/breadth. Drawings were done by direct observation.
Dehydrated samples with absolute ethanol were dried by the critical point technique for
the scanning electron microscopy (SEM) study, which was done with a Hitachi S-4100
microscope. GPS data are according to the World Geodetic System datum, WGS84.
Studied specimens are deposited in the herbaria AH (Universidad de Alcala, Alcala de
Henares, Madrid), and VAL (Faculty of Biological Sciences, Universitat de Valencia,
Valencia), which acronyms follow Thiers (2012). Terminology follows that of Desjardin
(1995).
Mycena acanthophila J.C. Zamora & Catala, sp. nov. PLATES 1-3
MycoBank MB 564491
Differs from other species in Mycena sect. Sacchariferae by its yellowish basidiomata,
pliciform lamellae, and clamped hyphae.
Type: Spain, Aragon, Huesca, Jaca, San Juan de la Pefia, 42°30'18"N 0°38'13"W, alt.
1125 m, on Echinospartum horridum branches, 11-X-2010, J. Hernanz, J.C. Zamora & S.
Catala (holotypus, AH 40678; isotypus, VAL_MYCO 939).
Erymo oey: From the Greek axavOo<, spine, and giAog, friend, due to the habitat and
association with Echinospartum and Erinacea.
MACROCHARACTERS— PILEvus broadly conical to hemispherical at first, soon
broadly convex and with or without an umbo, finally plane or with the margin
slightly recurved in over-mature basidiomata; 0.4-1.7 mm diam.; granulose;
bright yellow in young basidiomata, pale yellow with a more coloured disc when
mature. STIPE central, filiform, cylindrical to slightly bulbous but never with a
basal disc; 0.5-4 x 0.08-0.16 mm; dry, with a granulose surface; bright yellow
when young, paler when mature. LAMELLAE often present in medium-sized
to large basidiomata, adnate to more or less decurrent, 0-6, pliciform, never
reaching the margin, pale yellowish to almost white; lamellar edge concolorous
with faces, smallest basidiomata often with a smooth hymenophore; lamellulae
absent in all cases. SMELL absent. TasTE not recorded.
Mycena acanthophila sp. nov. (Spain) ... 363
# ADA ee
PLaTE 1—Mycena acanthophila macroscopic features. A, some basidiomata of the holotype
collection. B, basidioma showing well-developed lamellae. C, detail of the granulose pileus
surface, due to the presence of acanthocysts. D, basidioma with almost smooth hymenophore.
(Photographers, A: S. Catala; B, C & D: J. Hernanz)
MICROCHARACTERS— BASIDIOSPORES subglobose to broadly ellipsoid,
rarely globose or ellipsoid, often subamygdaliform to citriform (both ends
slightly pointed), (7.5-)8-10 x (6-)6.5-8 um, Q= 1.06-1.35(-1.42), amyloid;
hilar appendix about 0.5 um long. Basip1a 4-spored (rarely a few 2-spored),
mostly 22-31 x 9.5-11.5 um, but sometimes a low percentage of basidia
with a root-like base, then up to 40 um long; sterigmata 3.5-5 um long.
CHEILOCYSTIDIA present in basidiomata with more or less developed lamellae,
claviform, 13.5-22 x 8.5-12 um, covered with 1-3 um long excrescences in the
upper half. PLEUROCYSTIDIA not seen. LAMELLAR TRAMA hyphae 2-6 um wide.
PILEIPELLIS composed of 5-8.5 um wide hyphae and inflated cells <11 um wide
with excrescences on the upper side; acanthocysts protruding among hyphae,
broadly clavate to sphaeropedunculate, 12-25 x 8-15 um, covered with 1-3.5
(-4.5) um long excrescences. PILEITRAMA hyphae 2.5-8 um wide (broader
near the margin). CAuLocystTip1A claviform, short- to long-stalked, 12-40 x
6.5-12.5 um, densely covered with 1-3.5(-5) um long excrescences; sometimes
up to 120 um long, thin- to somewhat thick-walled, smooth hairs appearing
at the base, inconstant. STIPITIPELLIS hyphae 1.5-5 um, densely covered with
364 ... Zamora & Catala
1-3 um long excrescences. STIPITITRAMA hyphae 2.5-10 um wide. Pileus and
lamellar context more or less dextrinoid, stipe context strongly dextrinoid.
CLAMP CONNECTIONS present in most structures, but often inconspicuous, best
seen in subhymenium.
ECOLOGY & DISTRIBUTION— The ecology and distribution of M. acanthophila
are linked with those of its Echinospartum and Erinacea hosts. Cushion-shaped
communities of Echinospartum horridum (Vahl) Rothm. and Erinacea anthyllis
Link dominate high level mountains on calcareous soils and are subject to some
drought. Echinospartum horridum is an endemic species from northern Iberian
Peninsula to southern France, while Erinacea anthyllis is widely distributed in
the Iberian Peninsula, southern France, and northern Africa (Talavera 1999).
Both hosts are able to grow under hard conditions, like strong winds, drought,
poorly developed soils, and cold (Bonet et al. 2009).
Despite these stressful conditions, the microclimate created inside the
cushion is suitable for basidiomata development, where a few fungal species
can fruit. From an ecological standpoint, the new species can be considered
highly specialised. We observed that M. acanthophila grows only inside
cushions, and we never found it on the most exposed dead branches. What
is more, basidiomata quickly dry up when extracted from the cushion when
humidity is not extremely high. The species is very common in its habitat, so
future records are to be expected in any place where the hosts are present and
may even associate with other species of spiny pulvinular Genisteae.
ADDITIONAL SPECIMENS EXAMINED— SPAIN. ARAGON: Huesca, Arguis, monte
Peirdé, 42°20'N 1°42’W, alt. 1500 m, on Echinospartum horridum branches, 16-X-
2010, J. Hernanz (AH 40679); Huesca, Caldearenas, puerto de Monrepés, 42°20'36"N
0°23'38"W, alt. 1280 m, on E. horridum branches, 12-X-2010, J.C. Zamora, J.C. Campos
& S. Catala (AH 40680); Castiello de Jaca, pista de las Blancas, 42°39'03"N 0°34'25"W,
alt. 1145 m, on E. horridum branches, 11-X-2010, J. Hernanz, J.C. Zamora & S. Catala
(AH 40681); Fanlo, 42°35'28"N 0°01'17"W, alt. 1380 m, on E. horridum branches, 12-
XII-2010, J. Hernanz (AH 40682); Jaca, Pefia de Oroel, 42°31'N 0°31'W, alt. 1670 m,
on E. horridum branches, 14-X-2010, J. Hernanz (AH 40683); Jaca, carretera de Navasa
a Oroel, 42°31'16"N 0°28'55"W alt. 1060 m, on E. horridum branches, 11-X-2010, J.
Hernanz, J.C. Zamora & S. Catala (AH 40684); Jaca, San Juan de la Pefia, 42°30'25”"N
0°39'01"W, alt. 1250 m, on E. horridum branches, 10-X-2010, J.C. Zamora, S. Catala,
J. Hernanz & P.P. Daniéls (AH 40685); 13-XII-2010, J. Hernanz, AH 40686; 42°30'N
0°40'W, alt. 1260 m, on E. horridum branches, 12-X-2010, J. Hernanz (AH 40687);
42°30'40"N 0°39'47"W, alt. 1275 m, on E. horridum branches, 11-XII-2010, J. Hernanz
(AH 40688); 42°30'41.5"N 0°39'51.2"W, alt. 1270 m, 28-XII-2010, J. Hernanz (AH
40689); 42°30'18"N 0°41'04"W, alt. 1330 m, on E. horridum branches, 13-XII-2010,
J. Hernanz (AH 40690); Santa Cruz de la Serdés, San Juan de la Pefia, 42°30'54"N
0°41'10"W, alt. 1118 m, on E. horridum branches, 13-XII-2010, J. Hernanz (AH 40691);
Torla, puerto de Cotefablo, 42°36'56"N 0°12'07"W, alt. 1510 m, on E. horridum branches,
12-XIJ-2010, J. Hernanz (AH 40692); Villanua, fuente del Paco, 42°04'13"N 0°03'13"W,
alt. 1190 m, on E. horridum branches, 10-X-2010, J.C. Zamora & S. Catala (AH 40693);
Yebra de Basa, Santa Orosia, 42°30'N 0°15'W, alt. 1530 m, on E. horridum branches, 15-
Mycena acanthophila sp. nov. (Spain) ... 365
PLaTE 2— Mycena acanthophila microscopic features. A, hyphae of the pileipellis and protruding
acanthocysts. B, morphological variation of some detached acanthocysts. C, basidiospores.
D, cheilocystidia. E, basidia, including one with a root-like base. F, caulocystidia at the middle part
of the stipe. G, caulocystidia at the stipe base, with inconstant smooth hairs. Scale bar = 10 um.
366 ... Zamora & Catala
X-2010, J. Hernanz (AH 40694); Yésero, puerto de Cotefablo, 42°36'57"N 0°12'34"W,
alt. 1420 m, on E. horridum branches, 12-XII-2010, J. Hernanz (AH 40695). CASTILLA
LA MANCHA: GUADALAJARA, embalse de Alcorlo, 41°00'36.5"N 3°01'19.8"W, alt. 940
m, on Erinacea anthyllis branches, 28-XI-2010, J.C. Campos & J. Hernanz (AH 40696);
Somolinos, Sierra de la Pela, 41°15'20.3"N 3°01'19.8"W, alt. 1300 m, on E. anthyllis
branches, 8-I-2011, J. Hernanz (AH 40697). COMUNIDAD VALENCIANA: CASTELLON,
El Toro, Sierra de el Toro, 39°54'44.87"N 0°48'39.50"W, alt. 1464 m, on E. anthyllis
branches, 15-X-2010, G. Salva & S. Catala (VAL_MYCO 940). NAVARRA: Lumbier,
subida Leyre-Arangoiti, 42°38'40.9"N 1°11'48.9"W, alt. 1340 m, on E. anthyllis branches,
31-XII-2010, J. Hernanz (AH 40698).
CoMMENTS— Mycena acanthophila is placed in sect. Sacchariferae, stirps
Alphitophora based on the pileipellis with acanthocysts, absence of cherocytes,
presence of caulocystidia that are densely covered by small warts or spinules,
and a stipe without a basal disc (Desjardin 1995). It is well characterised
macroscopically by its tiny size, yellowish colouration, comparatively short
stipe, and reduced (sometimes absent) lamellae; the often subamygdaliform to
citriform basidiospores are also quite unusual.
Two species in sect. Sacchariferae with a reduced hymenophore,
M. echinocephala (G.F. Atk.) Desjardin and M. cylindrospora A.H. Sm., also
belong to stirps Alphitophora. Mycena echinocephala, known only from the
holotype, differs by the smooth caulocystidia terminated by a spinulose cell [but
Desjardin (1993) observed only an amorphous apex when studying the type],
unclamped hyphae, different basidiospores, and white basidiomata. Mycena
cylindrospora can be distinguished by unclamped hyphae, absence of hymenial
cystidia, different basidiospores, smooth hymenophore, infundibuliform pilei at
maturity, and white basidiomata. Both species grow on Rhododendron leaves.
Very few taxa in this section have been described with a yellowish
colouration. Perhaps the most similar, Mycena chloroxantha Singer, is easily
distinguished by the presence of cherocytes in the pileipellis (which places it
in stirps Amparoina), well-developed close lamellae, ellipsoid basidiospores,
very long caulocystidia, and absence of clamp connections. What is more, var.
chloroxantha exhibits a well-developed, costate basal disc, which is absent in
var. appalachienensis Desjardin (Desjardin 1995).
More recently described species in stirps Alphitophora — M. dissimilis,
M. pistacea, M. hylophila, and M. umbratilis (Maas Geesteranus & de Meijer
1997, 1998) — all differ in well-developed lamellae, non-yellow basidiomata,
and different anatomical features, particularly basidiospores. In addition,
M. dissimilis and M. pistacea lack clamp connections.
Finally, the only two previously known European species of stirps
Alphitophora, M. alphitophora and M. corynephora, are readily distinguished
by larger white to greyish white basidiomata, well-developed lamellae,
basidiospore shape and size (mostly pip-shaped to ellipsoid in M. alphitophora
and subglobose in M. corynephora), and much longer caulocystidia that confer
Mycena acanthophila sp. nov. (Spain) ... 367
PLaTE 3— Mycena acanthophila SEM photographs. A: pileus margin showing the pileipellis with
acanthocysts. B, 4-sterigmate basidia. C, cheilocystidium. D, caulocystidium. E, attachment of stipe
with the substratum. F, detail of the stipe base. Scale bars: A = 20 um; B, C = 3 um; D = 4 um;
E=50 um; F = 10 um.
a puberulous to hirsute appearance to the stipe surface (Desjardin 1995, Robich
2003).
Acknowledgments
The authors are grateful to all the collectors, especially J. Hernanz for providing
most of the studied material and macrophotographs. We are indebted to A. Aronsen
368 ... Zamora & Catala
(Norway) and G. Robich (Italy) for their invaluable reviews of the manuscript. We also
thank Helen Warburton for kindly checking the English wording, and David Lazaro and
Eva Barreno for their assistance and financial support with the SEM.
Literature cited
Bonet FJ, Zamora R, Gastén A, Molina C, Bariego P. 2009. Matorrales pulvinulares ordfilos
europeos meridionales. In: VV.AA., Bases ecoldgicas preliminares para la conservacion de los
tipos de habitat de interés comunitario en Espafia. Madrid: Ministerio de Medio Ambiente, y
Medio Rural y Marino. 122 pp.
Desjardin DE. 1993. Notes on Mycena cylindrospora and Eomycenella echinocephala. Mycologia
85(3): 509-513. http://dx.doi.org/10.2307/3760711
Desjardin DE. 1995. A preliminary accounting of the worldwide members of Mycena sect.
Sacchariferae. Bibliotheca Mycologica 159: 1-89.
Kihner R. 1938. Le genre Mycena. (Fries). Etude cytologique et systématique des espéces d’Europe
et d’Amérique du Nord. Encyclopéde Mycologique 10: 1-710.
Maas Geesteranus RA, de Meijer AAR. 1997. Mycenae paranaenses. Kon. Ned. Akad. Wet. Verh.,
Afd. Nat., Tweede Reeks 97: 1-164.
Maas Geesteranus RA, de Meijer AAR. 1998. Further Mycenas from the state of Parana, Brazil.
Persoonia 17(1): 29-46.
Robich G. 2003. Mycena d’Europa. Associazione Micologica Bresadola, Trento.
Singer R. 1962. Diagnoses Fungorum novorum Agaricalium II. Sydowia 15: 45-83.
Talavera S. 1999. Cytiseae. In: S Talavera et al. (eds.) Flora iberica 7(1). Real Jardin Botanico, CSIC,
Madrid.
Thiers B. 2012 [continuously updated]. Index Herbariorum: A global directory of public herbaria
and associated staff. New York Botanical Garden's Virtual Herbarium.
http://sweetgum.nybg.org/ih/
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.369
Volume 122, pp. 369-387 October-December 2012
Myxomycete history and taxonomy:
highlights from the past, present, and future
HAROLD W. KELLER*
Botanical Research Institute of Texas, 1700 University Drive, Fort Worth, Texas 76107-3400
University of Central Missouri, Department of Biology and Earth Science,
Warrensburg, Missouri 64093, U.S.A.
*CORRESPONDENCE TO:
[email protected]
ABSTRACT—'The past myxomycete legacy covers fruiting bodies preserved in fossil amber
more than 35 million years ago and early contributions by Linnaeus, de Bary, and the
Listers at the British Museum of Natural History (BM), among whom the Listers introduced
monographs, striking watercolors, and more narrow species concepts. Macbride and Martin
(University of Iowa) published illustrated myxomycete monographs with broader species
concepts. The transfer of the ~9500 specimen Iowa myxomycete collection to the United
States National Fungus Collections (BPI) is outlined and ~234 type specimens are listed.
Also covered is Lados recent NoMENMyx and the online resource nomen.eumycetozoa.com,
which offers ~900 names for accepted myxomycete species. The current status of the BM and
BPI myxomycete collections is noted, and Didymium saturnus provides an example of data
associated with myxomycete specimens in the American Type Culture Collection. Problematic
taxa are recommended for DNA sequencing to help clarify phylogenetic relationships.
Key worps—fossils, herbarium, Marie L. Farr, plasmodial slime molds, systematics
The legacy of the past
MyYXOMYCETES PRESERVED IN AMBER— Myxomycetes have a fossil past
that dates back to stalked sporangia of Stemonitis splendens Rostaf. that are
well preserved in Baltic amber from the Tertiary Period and Eocene Epoch
approximately 35 to 40 million years ago (Domke 1952; Keller & Everhart 2008).
Fossilized stalked sporangia of Arcyria sulcata Dorfelt & A.R. Schmidt were also
found in Baltic amber from the Eocene (Dorfelt et al. 2003; Dorfelt & Schmidt
2006; Keller & Everhart 2008). The general habit of these myxomycetes are so
similar to present-day species that it is apparent that morphology has changed
little in 40 million years. Given the advanced fruiting body development
observed in these fossils, we can assume myxomycetes have been around much
longer than 40 million years.
370 ... Keller
One can imagine the dominant coniferous forests of Pinus succinifera
(Goépp.) Conw. that thrived in a warmer subtropical climate and profusely
produced resin that accumulated in cracks inside the tree, under the bark, or
in wounds around the tree base. This resin eventually flowed and dripped on
decaying vegetation, trapping myxomycete fruiting bodies along with a variety
of arthropods and plants. The accumulation of Baltic resin (succinite) resulted
from millions of years of deposition. As rivers flowed through these forests, this
resinous material was carried to form today’s deltaic deposits along the Baltic
seacoasts at present-day Estonia, Latvia, and Lithuania. However, the Baltic
amber region also includes adjacent areas in Denmark, England, the Frisian
Islands, Germany, Norway, Poland, Russia (in an area called Samland, in the
Kaliningrad Oblast), and Sweden.
Fossil records of fragile myxomycete structures are rare due to the transitory
life cycle stages that appear briefly on surface substrata and weather away
in a relatively short time. Nevertheless, the excellent state of preservation in
myxomycete sporangia representing the Stemonitales and Trichiales suggests
that their geological past might extend to the Paleocene some 65 million years
ago when a warmer tropical climate still prevailed.
The 90-94 million year-old New Jersey Cretaceous amber deposits contain
the mushroom pileus and stalk of Archaeomarasmius leggetti Hibbett et al.
that resembles present-day Marasmius and Marasmiellus mushrooms that
are marcescent, persisting and reviving under moist conditions, instead
of putrescent, like many fleshy macrofungi (Hibbett et al. 1995; Hibbett et
al. 1997; Hibbett et al. 2003). This geological time period has the same tree
species and climatic conditions that should also support myxomycete fossils.
Discovery of the more ephemeral myxomycete sporangia is remote, and
calcareous members of the Physarales, the largest and presumably the most
morphologically advanced myxomycetes, never have been recorded in the fossil
record. However, wherever they are found, amber deposits should be screened
by a competent taxonomist for myxomycete fossils to avoid misidentification
of confusing and similar looking calicioid lichens (Keller & Everhart 2008). The
geological and historical recorded past should be included as part of any review
about the myxomycetes.
EARLY STUDENTS OF THE MyxomycetTes— ‘The first literature on myxomycetes
dates back to 1654 with Pankow’s (sometimes spelled Panckow) figure and
illustration of the species now known as Lycogala epidendrum (L.) Fr. Although
Linnaeus SPECIES PLANTARUM, published in 1753, is the nomenclatural
starting point for the Myxomycetes, his treatment of them was best summed up
by Martin & Alexopoulos (1969: 18): “Linnaeus, to be sure, knew little about the
fungi or slime molds, and cared less.” Carl Linnaeus (1701-78), who considered
Myxomycete history and taxonomy... 371
the myxomycetes to be gasteromycetous fungi (puffballs), was undoubtedly
influenced by the appearance of Lycogala as a miniature puffball. Martin (1966)
provides a more detailed account and review of these early students of the
myxomycetes.
The 1800s were marked by a better understanding of the myxomycete life
cycle by Heinrich Anton de Bary (1831-88) and the taxonomic advances by
his student Jozef Thomasz Rostafinsky (1850-1928). Earlier myxomycete
taxonomists had relied primarily on the striking variation of macroscopic
characteristics, whereas Rostafinsky (1874, 1875, 1876) ushered in use of
microscopic characters that would largely influence later description and
classification of the Myxomycetes. De Bary has been called the founding father
of plant pathology and mycology, which also embraces myxomycology. He was
the first to demonstrate myxomycete spore germination and the subsequent
stages of myxamoebae, swarm cells, plasmodia, and fruitbody development. De
Bary’s observations provided the microscopic evidence that led to removal of
the Myxomycetes from the fungal Gasteromycetes and the coinage of the name
Mycetozoa (Martin 1958; Everhart & Keller 2008).
ARTHUR AND GULIELMA LISTER, MYXOMYCETES, AND THE BRITISH MUSEUM
(NATURAL HISTORY, NOW THE NATURAL History MuseuM)— ‘The lives of the
Listers (father Arthur, 1830-1908 and daughter Gulielma, 1860-1949) spanned
119 years. In the main, their world monographs [1894, 1911 (second edition),
1925 (third edition)] follow Rostafinsky’s classification. The Lister publications
stand as a landmark in myxomycete taxonomy, influencing many regional
treatises that appeared over the following 50 years. More attention is given to
the range of environmental conditions and the remarkable extent to which
these factors may influence the appearance and structures of the developing
fruiting body. Even so, they recognized 274 species, 101 varieties, and one form
for a total of 376 taxa. The more than 60-year influence of the Listers as world
authorities on myxomycete taxonomy, especially throughout Europe, resulted
in a more frequent use of variety to designate differences in habit, color, and
structural microscopic changes in fruiting body morphology. The 128 color
and 94 black-and-white plates by Gulielma Lister in the 1925 edition are
without equal and stand as a lasting tribute to her artistic skill. Because many
species in 53 genera are illustrated in color, they can be easily ‘picture-keyed’
and correctly identified. The Listers’ valuable type myxomycete specimens are
deposited in the collections at The Natural History Museum (BM) formerly the
British Museum (Natural History), London, United Kingdom.
MACBRIDE, MARTIN, MYXOMYCETES, AND THE UNIVERSITY OF IowA— The
1900s highlighted the active research of Thomas Huston Macbride (1848-1934)
and George Willard Martin (1886-1971), who served on the faculty at the
372 ... Keller
University of Iowa (U.S.A.). Their lifetime professional careers spanned almost
100 years (1878-1971) in the Department of Botany at the university. Their
field collections, laboratory research, and publications were based largely
on specimens housed in the University of lowa Myxomycete Collection that
also included collections of Bethel, Bilgram, Ellis, Farlow, Gilbert, Hagelstein,
Harvey, Morgan, Plunkett, Rex, Shimek, and Wingate from America and
of Brandza, Japp, Meylan, and Sydow from Europe. Collections were also
contributed by O.F Cook (Liberia) and the Listers (who corresponded and
exchanged specimens with Macbride).
The world monograph, “The Myxomycetes” by Macbride and Martin was
published in 1934 shortly after Macbride’s death. The preface by Macbride
reads:
To assist in meeting such inquiry and interest is the purpose of this book. For
this edition it has been to the writer’s great pleasure and advantage to have
the assistance of his colleague, Dr. G. W. Martin: the introduction and general
editing of the text is his. By enlarging our field of inquiry, the number of species
presented has been greatly enlarged. New plates were needed, — all our plates are
new! To the young botanists of our continent and to our contributors around
the world, the present volume is especially devoted. May they fare well! T.H.M.
The monograph includes 21 plates and 568 figures, all in black and white. Gladys
Baker prepared the habit sketches and a number of her diagrams were made
from paraffin sections. Spores, capillitia, and other microscopic structures were
drawn by Martin in pencil aided by a camera lucida and using an apochromatic
oil immersion lens at a uniform magnification of 1200x to facilitate comparison
of these critical characters.
Comparison of the final monographs by Macbride & Martin (1934) with
the Listers (Lister 1925) show a trend away from subspecific taxa. Indeed, the
Martin introduction emphasizes this trend:
Decision as to the limits of species and genera must necessarily be a matter
of personal judgment, and this is perhaps more apparent in the slime molds,
because of their obvious responsiveness to environmental conditions while the
fructifications are forming, than in most other groups. We have felt justified
in applying a distinctive specific name to any form which shows reasonable
constancy under varying conditions, even though occasional intermediate
forms may appear. The multiplication of varieties has nearly if not quite reached
the saturation point. Many of the varieties listed in the literature are obviously
merely growth forms; some are doubtless autonomous species. If the latter,
they will eventually be recognized as such; if the former, it would seem better
to modify the diagnosis of the species to accommodate them, rather than to
multiply names.
The 1934 book recognized a total of 59 genera, 366 species, and 40 varieties.
Subjective interpretation was used in some cases to tabulate a variety designation
Myxomycete history and taxonomy ... 373
Fic. 1. Thomas Huston Macbride (1848-1934)
(Courtesy THE SCIENTIFIC MONTHLY)
because it is not clear whether Macbride merely mentioned the variety name in
passing or actually recognized the variety as distinct. In any case the number of
varieties is greatly reduced from previous myxomycete authors.
Macbride (Fic. 1), who was heralded as a passionate conservationist and
served as the first president of the Iowa Park and Forestry Association, also
established the Iowa Lakeside Laboratory at Lake Okoboji in 1909 (Martin
1935). Among the many other honors too numerous to mention are the
facts that Macbride served as the tenth president of The University of lowa
(1914-1916) and that the building housing the University of lowa Museum of
Natural History now bears the name of Macbride Hall, dedicated in his honor
shortly after his death in 1934 (Martin 1935).
Progress in the present
MARTIN, ALEXOPOULOS, AND THE UNIVERSITY OF IOWA MyYXOMYCETE
COLLECTION— ‘The tradition of myxomycology at the University of Iowa
has involved three outstanding myxomycologists, Macbride, Martin, and
Alexopoulos. The world monograph “The Myxomycetes” by Martin &
Alexopoulos (1969) was another milestone in myxomycete nomenclature and
taxonomy. These two myxomycologists worked as a team when Martin was
374 ... Keller
in retirement and Constantine John Alexopoulos (1907-86) was Chairman of
the Department of Botany at the University of Iowa and later served on the
faculty at the University of Texas. This book is based on the Macbride—Martin
Collection at the University of Iowa that also includes additional numerous
collections of C. J. Alexopoulos, Travis E. Brooks, William Bridge Cook, and
Donald T. Kowalski.
Perusal and tabulation ofall species descriptions yields 53 genera, 425 species,
and 2 varieties. The trend here again is away from sub-specific designations, as
emphasized by the following:
One fact should be stressed. The plasmodium may develop its characteristic
fruiting stage in less than 24 hours. If this occurs under conditions which cause
unduly rapid drying or if repeated rains check the process, great variation may
be induced. Under such influences, species which ordinarily have stalks may be
sessile or nearly so, or the stalks may be inordinately long; sporangiate species
may form plasmodiocarps; aethalioid forms may approach the sporangiate
type; the characteristics and disposition of limy secretions may be altered; spore
maturation may be checked, resulting in spore-like bodies which are much
larger than fully matured spores. Cold weather, and particularly frosts, may
induce similar alterations. Such variations are in large part responsible for the
extensive synonymy found in the group. Great caution is indicated in describing
as new specimens that are the result of such environmental responses. They
are not “abnormal”; they are natural responses of the organisms involved to
particular stimuli and must be so regarded. Giving them taxonomic status as
named varieties serves only to complicate the nomenclature and to extend the
meaning of the category variety beyond its legitimate significance. (Martin &
Alexopoulos 1969: 3)
This rather long quotation captures the essence of Martin’s lifelong approach
to the taxonomy of the Myxomycetes. This trend in America toward taxonomic
conservatism, broader species concepts, and recognition of fewer species was
categorized as “species lumping” and those in Europe who had narrow species
concepts and described many new species, often based on single collections
and limited specimens, were categorized as “species splitters” (Bisby 1953).
All41 plates and 367 figures show individual images of habits and microscopic
characters of crystals, capillitium, and spores that represent a composite set of
morphological features. Spores, magnified at 1000x, lack the detail of today’s
scanning electron microscopic images. Spore ornamentation and other spore
characters used in keys relied on high dry power (430x), not the oil immersion
lens. This is not apparent in the book text but is what I observed when I was
a graduate student during the monograph’s preparation. All color illustrations
were made by Ruth McVaugh Allen using colored pencils.
The moist chamber culture technique that was introduced at the University of
Iowa Mycology Laboratory by Gilbert & Martin (1933) has led to the discovery
Myxomycete history and taxonomy... 375
Fic. 2. George Willard Martin (1886 -1971)
(Frederick W. Kent, Iowa City, photographer)
376 ... Keller
of many new tiny myxomycetes found on the bark of living trees. Echinostelium
de Bary, represented by only a single species, E. minutum de Bary, in 1874,
increased to five species in 1969 (Martin & Alexopoulos 1969). Macbrideola,
a genus named after T.H. Macbride by Gilbert (1934), described two new tiny
species, M. scintillans H.C. Gilbert and M. decapillata H.C. Gilbert, obtained
from the bark of living trees through moist chamber culture. Thirty-five years
later Macbrideola was represented by five species (Martin & Alexopoulos
1969).
The chronicle of Martin's life by Lentz & Benjamin (1971) and Wells & Lentz
(1973) was augmented by a personal account by Keller (1996). As a United States
Army Lieutenant during World War I, Martin was slightly wounded by artillery
fire while gathering intelligence on the battlefield during shelling and assaults
by the Americans and Germans. During World War I he served as Chief of
the Biological Laboratory at the Army Quartermaster Depot in Jeffersonville,
Indiana. The Botanical Society of America recognized his extraordinary
research and service and he was part of the first group to receive the Certificate
of Merit. He served as Director of the Lakeside Laboratory in Iowa from 1928 to
1934. A charter member of the Mycological Society of America, Martin became
its first Vice President in 1933 and President in 1944 and also served as Editor-
in-Chief of MycoLocia from 1950 to 1957. His experience teaching English
courses at Rutgers University and his command of narrative text undoubtedly
contributed to his 37-year tenure as the editor of the University of Iowa Studies
in Natural History from 1934 until his death. The picture of Professor Martin
(Fic. 2) was taken about the time of his retirement as head of the Department
of Botany in 1955.
He was selected by the North American Flora project as author of The
Myxomycetes published by the New York Botanical Garden (Martin 1949). The
subsequent world monograph, (Martin & Alexopoulos 1969) is still considered
the most authoritative work on the subject. This book along with his lifelong
research on myxomycetes were cited as the basis for the Henry Allan Gleason
Award given in 1970 to Professor Martin by the New York Botanical Garden for
an outstanding recent publication in the fields of plant taxonomy, plant ecology,
or plant geography.
During the course of his career he published more than 140 separate
titles that included journal papers and books and spanning different groups
from dinoflagellates to fungi. The broad spectrum of fungi treated included
pathogenic imperfects, water molds, ascomycetes, the Agaricales, the resupinates
of the Homobasidiomycetidae, bird’s nest fungi, soil fungi, and tropical fungi
from his trips to Colombia, Galapagos Islands, and Panama. Many collections
were made of jelly fungi (Tremellales) and true slime molds (Myxomycetes)
while serving as a world authority for these two groups. Most of his papers
Myxomycete history and taxonomy ... 377
were single-authored and his practice of not attaching his name as a coauthor
to student-authored papers was followed until his death. Professor Martin was
a research mentor for approximately 47 doctoral students (Wells & Lentz 1973),
who represented a living testament to his impact on fungi, myxomycetes, and
all who knew him professionally.
At the time of Professor Martin’s death in 1971, the Macbride—Martin
Myxomycete Collection at the University of lowa numbered approximately
9500 specimens. In a letter dated March 22, 1977 I was informed by Dr. Robert
L. Hulbary, Professor and Chairman of the Department of Botany, that the
decision not to fill the faculty position held by Professor Martin had resulted in
the transfer of the Macbride-Martin Collection of Myxomycetes, January, 1977
to the United States National Fungus Collections (BPI) located at Beltsville,
Maryland.
The summer of 1972, I was asked to curate the entire myxomycete collection
and compile a list of type specimens. Type specimens were kept in a separate
herbarium case that included specimens in boxes as well as microscope slides
carefully wrapped in tissue paper inside boxes and all were labeled as types.
A list of approximately 235 types (specimens and microscope slides) was
prepared from the names taken from the box labels and arranged alphabetically
by genus and species. In the following list, authors’ names have been corrected
and presented as standard abbreviations, where necessary. The following types
are now held in BPI:
Amaurochaete comata G. Lister & M. Brandza, A. ferruginea T. Macbr. & G.W. Martin, A.
minor Sacc. & Ellis, A. trechispora T. Macbr. & G.W. Martin; Arcyria annulifera Torrend
(slide only), A. corymbosa M.L. Farr & G.W. Martin, A. magna Rex; Badhamia armillata
Nann.-Bremek., B. cinerascens G.W. Martin, B. dearnessii Hagelst., B. gracilis (T. Macbr.)
T. Macbr., B. iowensis T. Macbr., B. viridescens Meyl.; Calonema aureum Morgan, C.
luteolum Kowalski; Ceratiomyxa morchella A.L. Welden; Clastoderma pachypus Nann.-
Bremek. (slide only); Comatricha acanthodes Alexop. (slide only), C. aggregata MLL.
Farr, C. amoena Nann.-Bremek., C. brachypus (Meyl.) Meyl., C. caespitosa Sturgis,
C. extendens Hagelst., C. longipila Nann.-Bremek., C. martinii Alexop. & Beneke, C.
mirabilis R.K. Benj. & Poitras, C. nodulifera Wollman & Alexop., C. peritricha Nann.-
Bremek., C. reticulata H.C. Gilbert, C. rispaudii Hagelst., C. shimekiana T. Macbr.,
C. subcaespitosa Peck, C. suksdorfii Ellis & Everh., C. synsporos Alexop.; Diachea
silvipluvialis M.L. Farr, D. thomasii Rex; Diacheopsis depressa K.S. Thind & T.N. Lakh.;
Dianema aggregatum Kowalski, D. andersonii Morgan, D. harveyi Rex, D. nivale (Meyl1.)
G. Lister; Dictydium rutilum G. Lister; Diderma antarcticum (Speg.) Sturgis (slide
only), D. brooksii Kowalski, D. cinereum Morgan, D. corrugatum 'T.E. Brooks & H.W.
Keller, D. darjeelingense K.W. Thind & H.S. Sehgal, D. indicum K.S. Thind & HLS. Sehgal,
D. mussooriense K.S. Thind & Manocha, D. nigrum Kowalski, D. platycarpum Nann.-
Bremek., D. roanense (Rex) T. Macbr., D. rugosum (Rex) T. Macbr., D. subcaeruleum
Kowalski, D. subdictyospermum (Rostaf.) G. Lister, D. subincarnatum Kowalski;
Didymium aurantipes T.E. Brooks & Kowalski, D. discoideum K.S. Thind & H.S. Sehgal,
D. floccosum G.W. Martin, K.S. Thind & Rehill, D. fulvum Sturgis, D. labyrinthiforme
378 ... Keller
G.W. Martin, Lodhi & N.A. Khan, D. leoninum Berk. & Broome, D. nivicola Meyl.,
D. orthonemata H.W. Keller & T.E. Brooks, D. ovoideum Nann.-Bremek., D. parietale G.W.
Martin & T.E. Brooks, D. rugulosporum Kowalski, D. saturnus H.W. Keller, D. synsporon
T.E. Brooks & H.W. Keller, D. verrucosporum A.L. Welden; Echinostelium cribrarioides
Alexop., E. elachiston Alexop.; Enerthenema melanospermum T. Macbr. & G.W. Martin,
E. syncarpon Sturgis; Hemitrichia karstenii (Rostaf.) Lister, H. montana (Morgan)
T. Macbr., H. obrussea Meyl., H. paragoga M.L. Farr; Lamproderma biasperosporum
Kowalski, L. cristatum Meyl., L. fusiforme Kowalski, L. gulielmae Meyl., L. pulchellum
Meyl., L. robustum Ellis & Everh., L. splendens Meyl., L. tuberculospora M.L. Farr,
L. verrucosum G.W. Martin, K.S. Thind & Sohi; Leocarpus fulvus T. Macbr.; Lepidoderma
crustaceum Kowalksi; Licea applanata Kowalski, L. biforis Morgan, L. denudescens Keller
& Brooks (paratype: TEB2502, as L colloderma ined.). L. erecta K.S. Thind & Dhillon,
L. fimicola Dearn. & Bisby, L. pedicellata (H.C. Gilbert) H.C. Gilbert, L. perexigua T.E.
Brooks & H.W. Keller, L. pseudoconica T.E. Brooks & H.W. Keller, L. pumila G.W. Martin
& R.M. Allen, L. punctiformis G.W. Martin, L. scyphoides T.E. Brooks & H.W. Keller,
L. synsporos Nann.-Bremek. (slide only), L. tuberculata G.W. Martin; Lycogala exiguum
Morgan; Macbrideola decapillata H.C. Gilbert, M. scintillans H.C. Gilbert; Metatrichia
horrida Ing; Oligonema aeneum P. Karst., O. fulvum Morgan; Orthotricha microcephala
Wingate; Paradiacheopsis cribrata Nann.-Bremek. (slide only); Perichaena brevifila
T.E. Brooks & H.W. Keller, P quadrata T. Macbr., P. syncarpon T.E. Brooks; Physarina
echinospora K.S. Thind & Manocha; Physarum auripigmentum G.W. Martin, P. bethelii
G. Lister, P confertum T. Macbr., P. dictyosporum G.W. Martin, P. galbeum Wingate,
P. limonium Nann.-Bremek., P- maculatum T. Macbr., P. mennegae Nann.-Bremek.,
P. metallicum Berk., P. mortonii T. Macbr., P. nicaraguense T. Macbr., P. nudum T. Macbr.,
P. oblatum T. Macbr., P pulcherrimum Berk. & Ravenel, P. retisporum G.W. Martin,
KS. Thind & Rehill, PB rubronodum G.W. Martin, P. serpula Morgan, P. spinulosum
K.S. Thind & H.S. Sehgal, P. tessellatum G.W. Martin & MLL. Farr, P. tropicale T. Macbr.,
P. variabile Rex, P. variegatum K.S. Thind & Dhillon; Schenella microspora G.W. Martin,
S. simplex T. Macbr.; Stemonitis carolinensis T. Macbr., S. herbatica Peck, S. inconspicua
Nann.-Bremek., S. morganii Peck, S. mussooriensis G.W. Martin, K.S. Thind & Sohi,
S. nigrescens Rex, S. smithii T. Macbr., S. uvifera T. Macbr., S. virginiensis Rex, S. webberi
Rex; Trichia andersonii Rex, T. cascadensis H.C. Gilbert, T. crateriformis G.W. Martin,
T. erecta Rex, T: mirabilis Nann.-Bremek., T. reniformis Peck; Tubifera papillata G.W.
Martin, K.S. Thind & Sohi; Wilczekia evelinae Meyl.
Marie L. FARR AND THE UNITED STATES NATIONAL FUNGUS COLLECTIONS—
Farr received her doctorate from the University of Iowa in 1957 under the
direction of Professors G.W. Martin and C.J. Alexopoulos. Thereafter, she
spent her professional career at BPI (1958-89), during that time accumulating
myxomycete collections from South American countries and the Caribbean
Islands between the Tropics of Cancer and Capricorn, a geographic area
designated as the Neotropics (Farr 1976). This led to the publication of No.
16 of the Flora Neotropica Monographic Series, a volume devoted to the
Myxomycetes. The approximately 280 myxomycete species recorded in Flora
Neotropica 16 also includes myxomycetes from Florida state (U.S.A.). This
myxomycete monograph includes not only the standard dichotomous keys but
also offers the first available synoptic keys for the identification of myxomycete
species.
Myxomycete history and taxonomy ... 379
It is especially appropriate here to recognize Farr’s publications, travels, and
collections in the Caribbean Islands and Brazil. She collected myxomycetes
during 16 months (1954-55) on the Caribbean island of Jamaica, after which
she published an artificial identification key to 26 genera of Jamaican slime-
moulds and separate keys to 104 species and 4 varieties (Farr 1957). Recife and
the Institute of Mycology at the University of Recife in Brazil was the location
of the IMUR herbarium where Farr studied myxomycetes and published a list
of 21 genera and 67 species during a stay of several months (Farr 1960). She
followed this with an illustrated key to the myxomycetes of South America
published in English (Farr 1968) that was the principal South American
resource for myxomycete identification. She also participated in the Bredin-
Archbold-Smithsonian Biological Survey of Dominica in 1966 that resulted
in 500 myxomycete specimens collected in the field (63 from moist chamber
cultures), representing 96 myxomycete taxa (Farr 1969).
The first field guide to myxomycetes was written by Farr as part of the How
to Know Pictured Key Nature Series launched by Harry E. Jaques in 1937 at
Iowa Wesleyan University (Farr 1981). This spiral-bound paperback, even
though out of print, is still an excellent source for beginners to identify the
more common myxomycete species with dichotomous keys.
Farr updated the Martin & Alexopoulos 1969 monograph in 1983 to provide
more current references and information in the introductory topical sections, to
reclassify some subclasses, families, and genera, and to add keys and discuss 47
genera under a new title, THE GENERA OF MyxomyYceTEs (Martin et al. 1983).
The 41 plates and 367 figures are the same as those published in the previous
world monograph (Martin & Alexopoulos 1969).
Many collections from Dr. D.H. Mitchel and $.W. Chapman, mostly from
higher elevations in Colorado, were deposited at the Denver Botanic Garden and
BPI in cooperation with Farr (Mitchel et al. 1980). A lifetime of contributions
by Dr. Farr to myxomycete taxonomy merits special recognition.
CaRLos LADO AND NOMENMyx— In 2001, Lado published NomMENmyx,
which involved the monumental task of searching the literature for names of
myxomycete species. Of the 4000 names applied to various myxomycete taxa
he uncovered, 900 are current names for accepted species. These names are now
in a database that can be updated over time with the addition of new names
and which has been developed into the online resource nomen.eumycetoza.
com. Another welcome future addition will be information on types assigned
to each myxomycete taxon, the herbarium where the type was deposited, and
the transcription of the original description, its geographical distribution, its
substratum, and synoptic keys.
Lado (2001) recognized 57 generaand approximately 900 species. Comparison
of subspecific taxa was not included but the number of genera closely parallels
380 ... Keller
that of Nannenga-Bremekamp (1991). As NoMENmy*x is strictly a compilation
of names that did not involve examination of type specimens, some taxa listed
may not represent legitimate myxomycete species; thus rigorous type studies
will help refine myxomycete taxonomy. Fortunately some generic names more
familiar to students of myxomycetes have been conserved in their more recent
usage, including Amaurochaete conserved against Lachnobolus, Ceratiomyxa
conserved against Famintzinia, Hemitrichia conserved against Hyporhamma,
Reticularia conserved over Enteridium, and Tubifera conserved over Tubulifera.
All taxonomists are urged to peruse all previous myxomycete names to avoid
publishing duplicate names for species new to science.
The promise of the future
MyYXOMYCETES AND HERBARIA— Preservation of myxomycete collections
in the past usually involved exposure to para-dichlorobenzene (PDB) and/
or naphthalene (organic chemical compounds present in mothballs) used to
protect against insects, mites, and fungal contaminants. The Macbride-Martin
Collection at the University of lowa was treated with mothballs for many years
before concerns that PDB was a potential carcinogen. Furthermore, Gray &
Alexopoulos (1968: 228), recommend PDB for use “...in the herbarium case
or drawer in which the specimens are stored.’ This was standard practice for
many herbaria of the mid-twentieth century. However, combination of age
and treatment with organic agents appears to fragment DNA in older type
myxomycete specimens, which impedes DNA amplification for taxonomic
molecular studies.
Schenella simplex T. Macbr. was considered a myxomycete for more than 100
years until light microscopy, scanning electron microscopy, and DNA analysis
revealed it to be a fungal gasteromycete (Estrada-Torres et al. 2005). The
holotype specimen (BPI 839197) was included in a morphological comparison
with specimens recently collected in Mexico. DNA extraction was successful for
one Mexican specimen, and its nuclear profile most closely matched the fungus
Geastrum saccatum Fr. whose sequence differed greatly from true myxomycete
sequences. Attempts to extract and analyze DNA from the holotype specimen
(BPI 839197) using the same molecular techniques were unsuccessful, as the
DNA had fragmented and deteriorated over time, either due to age or external
treatment with PDB or both (Dennis Miller pers. comm.).
Odell & Perkins (1976) observed that PDB adversely affects life cycle stages
of Didymium squamulosum (Alb. & Schwein.) Fr. by placing PDB crystals on
Petri dish lids, inverting the culture dish, and noting that myxamoebae died in
18 hours leaving ghost-like remnants on the agar surface. Similar treatment of
plasmodia stopped protoplasmic streaming within 40 seconds and caused death
after 20 minutes. Additional experiments showed that spores from sporangia
Myxomycete history and taxonomy... 381
of Comatricha nigra (J.F. Gmel.) J. Schrot., Trichia varia (J.F. Gmel.) Pers., and
T. favoginea (Batsch) Pers. collected on decaying wood showed a consistent
reduction in the percentage of germinated spores when exposed to vapor from
PDB crystals. Furthermore, after exposure to PDB, spores were abnormally
wrinkled and distorted in shape. These experiments also showed that the
percentage of spore germination decreased markedly after only three months.
Odell & Perkins (1976) concluded that PDB should not be used in herbarium
cases where myxomycete fruiting bodies are stored. Thus, more recently,
herbarium managers have had discussions about using type specimens for
possible molecular analysis. There is special concern that tiny fruiting bodies
of many myxomycete species should not be subjected to destructive techniques
used for DNA analysis.
More recent policy changes at BPI will require proof of experience and
protocols before granting permission for specimens to be destructively sampled
(Amy Rossman, pers. comm.). One possible option is to select an epitype from
more recently collected specimens similar to the Schenella collections from
Mexico (Estrada-Torres et al. 2005). Future molecular techniques may also be
developed that can overcome the barriers of age caused by fragmented DNA.
If at all possible, myxomycete type specimens should be deposited in
national herbaria that can provide long-term curation and make specimens
available to the scientific community. The Natural History Museum (BM) still
has a standing policy that specimens, including types, are generally not sent
on loan; however, applications to request “invasive sampling” if approved can
result in the loan of a small fragment of a fruiting body for SEM observation or
DNA extraction. There is justifiable concern that myxomycete fruiting bodies
are too small, brittle, and subject to possible damage when sent by mail.
THE LISTER MYXOMYCETE COLLECTION AT BM— The majority of the Lister
Myxomycete Collection is housed at BM but a substantial number of specimens
are also deposited at the Herbarium, Royal Botanic Garden, Kew (K). Plans are
in place to make more information on myxomycete specimens at both BM and
K more easily accessible to users. The future of the Lister specimens currently
involves the British Mycological Society (BMS) because it is the owner (including
copyrights) of the notebooks with the originals of the plates for the monograph
and many more unpublished sketches and partly colored illustrations. These
notebooks are kept at BM but are administered independently by the library
team and not by the Botany Department, which owns and curates only the
specimens and microscopic slides. Label information and macro-images of the
types will become available on the Internet within the next two years (Holger
Thiis, pers. comm.). Consultation with appropriate curators is encouraged to
coordinate access to the Lister illustrations and specimens.
382 ... Keller
THE UNITED STATES NATIONAL FUNGUS COLLECTIONS (USNFC)— The USNFC
has a herbarium, a library and extensive databases and web resources that serve
as a national and international resource. It is managed under the Systematic
Mycology and Microbiology Laboratory (SMML), a federal laboratory of the
US Department of Agriculture. There is a good overview of the resources with
links to each at http://nt.ars-grin.gov/sbmlweb/fungi/index.cfm. The direct link
to the database search pages is found at http://nt.ars-grin.gov/fungaldatabases.
The USNFC herbarium, referred to as BPI (BPI = Bureau of Plant
Industry), houses more than one million specimens. About 760,000 herbarium
specimens have already been entered into the specimen database, including the
Uredinales (rusts, 186,925), Agaricales sensu lato (45,637 specimens; 718 types),
Ustilaginales (smuts, 31,175), Polyporales (polypores, 91,976), Deuteromycetes
(imperfect fungi, 127,298), Ascomycetes (172,723), and C.G. Lloyd collections
(57,086, including myxomycetes) and thus covering most fungi important to
agriculture.
BPI is constantly growing and the database is updated accordingly. The
BPI Myxomycete Collection, now numbering between 50,000 and 60,000,
ranks as the largest in the world. These specimens have been bar-coded (with
12,532 records indexed) and are available on-line at http://nt.ars-grin.gov/
fungaldatabases/specimens/specimens.cfm.
The Myxomycete Collection of C.J. Alexopoulos at the University of Texas
was transferred to BPI and contains specimens from the state of Texas, U.S.A.,
Costa Rica, and Greece, along with the D.R. Reynolds collections from the
southeastern Asian countries of Thailand, Burma, and the Philippines. The
entire Brooks Myxomycete Collection was also transferred to BPI. Many other
collectors have deposited myxomycete collections at BPI, but in far fewer
numbers.
THE AMERICAN TYPE CULTURE COLLECTION— ‘The importance of spore-
to-spore culture of myxomycetes and the deposit of living cultures with the
United States American Type Culture Collection (ATCC) provides future
source materials for scientific experimentation, genetic discovery, and species
validation. Good myxomycete taxonomic practice should include the spore-
to-spore cultivation of proposed new taxa (See also “Importance of Spore-to-
Spore Cultivation and Living Cultures - A Biological Standard,” Keller 1996).
The mission of ATCC (wwwatcc.org), a private nonprofit biological
resource center and research organization, is to acquire, authenticate, preserve,
develop, standardize, and distribute biological materials and information
for the advancement and application of scientific knowledge. The ATCC
Myxomycete Collection (excluding <50 protostelid and >400 dictyostelid
strains) is represented by 36 species and slightly less than 200 strains, including
the following:
Myxomycete history and taxonomy... 383
Arcyria elaterensis Mulleavy, Badhamia gracilis (T. Macbr.) T. Macbr., Clastoderma
debaryanum A. Blytt, Comatricha laxa Rostaf., Cribraria violacea Rex, Diachea
leucopodia (Bull.) Rostaf., Didymium difforme (Pers.) Gray, D. iridis (Ditmar) Fr.,
D. nigripes (Link) Fr., D. squamulosum (Alb. & Schwein.) Fr., Echinostelium arboreum
H.W. Keller & T.E. Brooks, E. coelocephalum 'T.E. Brooks & H.W. Keller, E. minutum
de Bary, Metatrichia vesparium (Batsch) G.W. Martin & Alexop., Physarum cinereum
(Batsch) Pers., P. compressum Alb. & Schwein., P didermoides (Pers.) Rostaf.,
P. flavicomum Berk., P. melleum (Berk. & Broome) Massee, P. polycephalum Schwein.,
P. pusillum (Berk. & M.A. Curtis) G. Lister, P rigidum (G. Lister) G. Lister, P roseum
Berk. & Broome, Stemonitis flavogenita E. Jahn, Willkommlangea reticulata (Alb. &
Schwein.) Kuntze
Each accessioned strain is assigned an ATCC number with associated
information about the live culture and the origin of the collection. Didymium
saturnus H.W. Keller is presented as an example (Keller 1970):
ATCC Number, Order this item, 64178", Organism, Didymium saturnus H.W. Keller,
Designations, HWK 132, Isolation, Oat straw, lowa, Depositors, H.W. Keller, Biosafety
Level, 1, Shipped, frozen, Growth Conditions, ATCC medium: Corn meal agar, half-
strength, Temperature: 24.0°C, Duration: grown with Escherichia coli ATCC 23437,
Permit/Forms, In addition to the MTA mentioned above, other ATCC and/or regulatory
permits may be required for the transfer of this ATCC material. Anyone purchasing
ATCC material is ultimately responsible for obtaining the permits. Please click here for
information regarding the specific requirements for shipment to your location, Type
Strain, yes, References, 13457: Keller HW. Didymium saturnus, a new myxomycete
occurring on straw stacks. Mycologia 62: 1061-1066, 1970. Three other collections
are also available as live, two-membered cultures deposited by HWK as ATCC 64199
Badhamia rhytidosperma H.W. Keller & Schokn. (Keller & Schoknecht 1989c); ATCC
64200 Didymium annulisporum H.W. Keller & Schokn. (Keller & Schoknecht 1989a);
ATCC 64201 Badhamia spinispora (Eliasson & N. Lundq.) H.W. Keller & Schokn. (Keller
& Schoknecht 1989b). Hardcopy books are no longer available thus relevant information
can be accessed online or by telephone. Deposit of myxomycete live cultures still is
possible and relevant information can be found at the ATCC website. Specific criteria can
be viewed online but consideration should be given as follows: “The expected demand or
need for all potential deposits is reviewed and prioritized with input from the scientific
community and is now a key factor in our acquisition protocol.”
DNA SEQUENCING OF PROBLEMATIC MYXOMYCETE TAXA— Future directions
using DNA sequencing techniques will surely unlock many phylogenetic
mysteries among the five myxomycete orders (Echinosteliales, Liceales, Trichiales,
Stemonitales, Physarales) plus a number of genera difficult to classify. Some of
these perplexing myxomycete taxa are monotypic (monospecific) genera with
a distinctive suite of characters. Several examples will serve to pinpoint the
taxonomic problems and to suggest a priority list of taxa that should receive a
higher priority for DNA sequencing.
Minakatella longifila G. Lister is a monotypic genus that has resided in the
Trichiales since described in 1921 within Arcyriaceae, a family with tubular
(hollow) capillitial threads; the Listers (1925) considered Minakatella close to
384 ... Keller
Perichaena. Martin and Alexopoulos (1969) included the genus in Dianemaceae
(Dianemataceae), emphasizing the apparent solid character of the capillitial
threads. After ultrastructural evidence showed clearly that the capillitial
threads of Minakatella were hollow, it was therefore transferred to the family
Trichiaceae (Keller et al. 1973).
Nannenga-Bremekamp (1982) used polarized light and the birefringent
property of spores and capillitium that triggered taxonomic changes for
Minakatella. The lack of birefringence of the capillitial threads led to removal of
Minakatella from Trichiales and establishment of a new family, Minakatellaceae,
in the Liceales. Birefringence of the capillitium using the Nannenga-Bremekamp
data is not constant (present and absent) within Trichiales, however, as
demonstrated by Arcyria and Perichaena capillitial threads with little or no
birefringence and Trichia and Hemitrichia with the highest measured levels
of birefringence, all genera are still retained in the Trichiales. Ing (1999: 365)
does not follow Nannenga-Bremekamp’s taxonomy, although he recognized
her taxonomic rank of the Minakatellaceae in the Trichiales. This is an extreme
example of the application of “tyranny of a character” or “taxonomic tinkering”
that has led to taxonomic confusion, proliferation of families, and the need for
DNA analysis to help solve the final disposition of questionable taxa.
More taxa that should be considered a higher priority for DNA analysis
because of uncertain taxonomic position are: Kelleromyxa fimicola (Dearn.
& Bisby) Eliasson, Listerella paradoxa E. Jahn, Protophysarum phloiogenum
M. Blackw. & Alexop., and Trabrooksia applanata H.W. Keller. These taxa
are rare and seldom collected, for example, the occurrence of fruiting bodies
of K. fimicola on herbivorous dung, L. paradoxa on Cladonia lichens, and
T. applanata on the bark of living trees (especially Juniperus virginiana L.). This
requires due diligence to find specimens in specific habitats capable of yielding
positive results for DNA analysis. More taxa that would help clarify generic
positions include Barbeyella minutissima Meyl., Calomyxa metallica (Berk.)
Nieuwl., Cornuvia serpula (Wigand) Rostaf., Badhamiopsis ainoae (Yamash.)
T.E. Brooks & H.W. Keller, Erionema aureum Penz., Leocarpus fragilis (Dicks.)
Rostaf., and Physarella oblonga (Berk. & M.A. Curtis) Morgan. These and
other taxa would provide valuable information for species currently granted
an uncertain taxonomic status. The future of myxomycete biosystematics will
depend more and more on DNA analysis, and I hope this will come sooner
rather than later.
Acknowledgments
Portions of this paper were presented as an invited address at the Seventh
International Congress on the Systematics and Ecology of Myxomycetes held at
Recife, Brazil, in September 2011 and appeared in the Abstract Volume distributed to
participants. I wish to express my sincere appreciation to Professor Dr. Laise de Holanda
Myxomycete history and taxonomy... 385
Cavalcanti, Universidade Federal de Pernambuco, Chair of ICSEM7 for the invitation
to present a tree canopy biodiversity graduate credit course, a myxomycete workshop,
organize and present round table discussions, and the opportunity for discourse with
myxomycologists from throughout the world. This paper is dedicated to my research
mentor and doctoral thesis advisor, Professor George W. Martin, who instilled in me
the desire to learn more about the taxonomy of the myxomycetes through his scholarly
example. My thanks go to Holger Thiis, (Curator of Lichens and Myxomycetes, Botany
Department, The Natural History Museum, Great Britain) for current information on the
Lister Collection and policy matters at BM. Amy Rossman, Director of BPI, and Shannon
Dominick, Scientific Collections Coordinator (Herbarium BPI, Systematic Mycology &
Microbiology Laboratory), contributed current information about collections. Anita N.
Phillips, Lead Microbiology Specialist, provided invaluable assistance concerning the
ATCC and is the contact person for the Eumycetozoan Special Collection (ESC). The
ESC houses all myxomycetes, protostelids, and dictyostelids within the Mycology and
Protistology Collections. Figure 1 photographic image of Thomas H. Macbride was
taken from The Scientific Monthly and George W. Martin Figure 2 was taken from a
print made by Frederick W. Kent Photography, Iowa City, Iowa. I want to thank my
former students and reviewers who suggested improvements in content, organization,
and sentence syntax.
Literature cited
Bisby GR. 1953. An introduction to the taxonomy and nomenclature of fungi. 2" edition.
Commonwealth Mycological Institute, Kew, Surrey, United Kingdom.
Domke W. 1952. Der erste sichere Fund eines Myxomyceten im Baltischen Bernstein (Stemonitis
splendens Rost. fa. Succini fa. nov. foss.). Mitteilungen aus dem Geologischen Staatsinstitut in
Hamburg. 21: 154-161.
Dorfelt H, Schmidt AR. 2006. An archaic slime mould in Baltic amber. Paleontology. 49:
1013-1017. http://dx.doi.org/10.1111/j.1475-4983.2006.00582.x
Dorfelt H, Schmidt AR, Ullmann P, Wunderlich J. 2003. The oldest fossil myxogastroid slime
mould. Mycological Research 107: 123-126. http://dx.doi.org/10.1017/S0953756202007025
Estrada-Torres A, Gaither TW, Miller DL, Lado C, Keller HW. 2005. The myxomycete genus
Schenella: morphological and DNA sequence evidence for synonymy with the gasteromycete
genus Pyrenogaster. Mycologia 97: 139-149. http://dx.doi.org/10.3852/mycologia.97.1.139
Everhart SE, Keller HW. 2008. Life history strategies of corticolous myxomycetes: the life cycle,
fruiting bodies, plasmodial types, and taxonomic orders. Fungal Diversity 29: 1-16.
Farr ML. 1957. A checklist of Jamaican slime-moulds (Myxomycetes). Bulletin of the Institute of
Jamaica, Science Series, 7: 1-67.
Farr ML. 1960. The myxomycetes of the IMUR herbarium, with special reference to Brazilian
species. Instituto de Micologia, Recife Publication 184. Recife, Brazil.
Farr ML. 1968. An illustrated key to the myxomycetes of South America, with special reference to
Brazil. Rickia 3: 43-88.
Farr ML. 1969. Myxomycetes from Dominica. Contributions from the United States National
Herbarium 37(6): 399-440.
Farr ML. 1976. Flora Neotropica, Monograph 16, Myxomycetes. New York Botanical Garden, NY.
Farr ML. 1981. How to know the true slime molds. The Pictured Key Nature Series, Wm. C. Brown
Company Publishers, Dubuque, Iowa.
386 ... Keller
Gilbert HC. 1934. Three new species of Myxomycetes. University of Iowa Studies in Natural History.
Contributions from the Botanical Laboratories. 16: 153-159.
Gilbert HC, Martin GW. 1933. Myxomycetes found on the bark of living trees. University of Iowa
Studies in Natural History, Papers on Iowa fungi IV. 15(3): 3-8.
Gray WD, Alexopoulos CJ. 1968. Biology of the Myxomycetes. The Ronald Press Company. New
York.
Hibbett DS, Grimaldi D, Donoghue MJ. 1995. Cretaceous mushrooms in amber. Nature 377: 487.
http://dx.doi.org/10.1038/377487a0
Hibbett DS, Grimaldi D, Donoghue MJ. 1997. Fossil mushrooms from Miocene and Cretaceous
ambers and the evolution of homobasidiomycetes. American Journal of Botany 84: 981-991.
http://dx.doi.org/10.2307/2446289
Hibbett DS, Grimaldi D, Donoghue MJ. 2003. Another fossil agaric from Dominican amber.
Mycologia 95: 685-687. http://dx.doi.org/10.2307/3761943
Ing B. 1999. The Myxomycetes of Britain and Ireland, an identification handbook. The Richmond
Publishing Co. Ltd. England.
Keller HW. 1970. Didymium saturnus, a new myxomycete occurring on straw stacks. Mycologia 62:
1061-1066. http://dx.doi.org/10.2307/3757619
Keller HW. 1996. Biosystematics of Myxomycetes: a futuristic view. Plenary Address. 23-37, in:
Second International Congress on the Systematics and Ecology of Myxomycetes (ICSEM2).
Real Jardin Botanico, CSIC. Madrid, Spain.
Keller HW, Everhart SE. 2008. Myxomycete species concepts, monotypic genera, the fossil record,
and additional examples of good taxonomic practice. Revista Mexicana de Micologica 27:
9-19.
Keller HW, Schoknecht JD. 1989a. Life cycle of a new annulate-spored species of Didymium.
Mycologia 81: 248-265. http://dx.doi.org/10.2307/3759707
Keller HW, Schoknecht JD. 1989b. Spore-to-spore culture of Physarum spinisporum and its transfer
to Badhamia. Mycologia 81: 631-636. http://dx.doi.org/10.2307/3760139
Keller HW, Schoknecht JD. 1989c. Spore-to-spore cultivation of a new wrinkled-reticulate-spored
Badhamia. Mycologia 81: 783-789. http://dx.doi.org/10.2307/3759883
Keller HW, Aldrich HC, Brooks TE. 1973. Corticolous myxomycetes II: notes on Minakatella
longifila with ultrastructural evidence for its transfer to the Trichiaceae. Mycologia 65:
768-778. http://dx.doi.org/10.2307/3758516
Lado C. 2001. NomeNnmyx. a nomenclatural taxabase of myxomycetes. Cuadernos de Trabajo de
Flora Micoldgica Ibérica 16: 1-221.
Lentz PL, Benjamin CR. 1971. George Willard Martin. Mycopathologia et Mycologia Applicata
45: 7-15.
Lister A. 1894. A monograph of the Mycetozoa: a descriptive catalogue of the species in the
Herbarium of the British Museum, 78 plates, each two separate units designated A and B and
with 51 woodcuts. First Edition, Printed by order of the trustees, British Museum of Natural
History, Cromwell Road S.W., London.
Lister A. 1911. A monograph of the Mycetozoa: a descriptive catalogue of the species in the
Herbarium of the British Museum, 200 plates, two to a page, numbered separately, and with 56
woodcuts. Second Edition revised by Gulielma Lister, Printed by order of the trustees, British
Museum of Natural History, Cromwell Road S.W., London.
Lister A. 1925. A monograph of the Mycetozoa: a descriptive catalogue of the species in the
Herbarium of the British Museum, Introduction xiii-xxxii, 223 plates, two to a page, numbered
separately, and with 56 woodcuts. Third Edition revised by Gulielma Lister, Printed by order of
the trustees, British Museum of Natural History, Cromwell Road S.W., London.
Myxomycete history and taxonomy ... 387
Macbride TH, Martin GW. 1934. The Myxomycetes: a descriptive list of the known species with
special reference to those occurring in North America. 21 plates. Habit sketches by Gladys
Baker. The Macmillan Company, New York, New York..
Martin GW. 1935. Thomas Huston Macbride, an appreciation. The Scientific Monthly 40:
284-286.
Martin GW. 1949. Fungi: Myxomycetes, Ceratiomyxales, Liceales, Trichiales, Stemonitales, Physarales.
North American Flora 1(1): 1-190.
Martin GW. 1958. The contribution of de Bary to our knowledge of Myxomycetes. The Iowa
Academy of Science 65: 122-127.
Martin GW. 1966. The genera of Myxomycetes. University of lowa Studies in Natural History 20(8):
132.
Martin GW, Alexopoulos CJ. 1969. The Myxomycetes. Color illustrations by Ruth McVaugh Allen.
41 plates and 367 figures. Iowa City: University of Iowa Press.
Martin GW, Alexopoulos CF, Farr ML. 1983. The genera of Myxomycetes. Iowa City: University of
Iowa Press.
Mitchel DH, Chapman SW, Farr ML. 1980. Notes on Colorado fungi IV: Myxomycetes. Mycotaxon
10(2): 299-349.
Nannenga-Bremekamp NE. 1982. Notes on myxomycetes. XXI, the use of polarized light as an aid
in the taxonomy of the Trichiales. Proceedings of the Koninklijke Nederlandse Akademie van
Wetenschappen, Series C, 85: 541-562.
Nannenga-Bremekamp NE. 1991. A guide to temperate myxomycetes. An English translation by A.
Feest and Y. Burggraaf of De Nederlandse Myxomyceten. Biopress Limited, Bristol, England.
Odell DE, Perkins ME. 1976. The effect of para-dichlorobenzene on myxomycetes. Bulletin of the
British Mycological Society 10: 86-87.
Pankow T. 1654. Herbarium portatile oder Behendes Krauter-und Gewachs-Buch. Berlin.
Rostafinsky JT. 1874. Sluzowce (Mycetozoa) Monografia. Towar. Nauk Scist. 5(4): 1-215.
Rostafinsky JT. 1875. Sluzowce (Mycetozoa) Monografia. Towar. Nauk Scist. 6(1): 217-432.
Rostafinsky JT. 1876. Sluzowce (Mycetozoa) Monografia. Dodatek (Appendix). Towar. Nauk Scist.
8: 1-43. 1876.
Wells K, Lentz PL. 1973. George Willard Martin. Mycologia 65: 985-998.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.389
Volume 122, pp. 389-398 October-December 2012
Synonymy of Suillus imitatus, the imitator of two species
within the S. caerulescens/ponderosus complex
Nuvu H. NGUYEN, JENNIFER FE. KEREKES,
Ese C. VELLINGA & THOMAS D. BRUNS
Department of Plant and Microbial Biology, University of California, Berkeley
111 Koshland Hall #3102, Berkeley CA, 94720-3102, U.S.A.
“CORRESPONDENCE TO:
[email protected]
AsBstTRAcT—Identification of three species of Suillus, S. caerulescens, S. ponderosus, and
S. imitatus, has always been difficult because of overlapping and non-discrete morphological
characters. To solidify the identification of these taxa, we compared the nucleotide sequences
from the internal transcribed spacer region (ITS) of the type specimens of S. caerulescens,
S. ponderosus, S. imitatus var. imitatus, and S. imitatus var. viridescens with field collected
specimens which we identified as S. caerulescens, S. ponderosus, and S. imitatus in northern
California. Based on ITS sequence identity and phylogenetic inference, specimens of
S. caerulescens and S. ponderosus formed well-supported clades with the holotype of the
respective species. However, S. imitatus var. imitatus fits within the S. caerulescens clade
and S. imitatus var. viridescens fits within the S. ponderosus clade. Therefore, we synonymize
S. imitatus var. imitatus with S. caerulescens and S. imitatus var. viridescens with S. ponderosus,
and show that the species can indeed be recognized morphologically based on annulus
characteristics.
Key worps—bolete, phylogenetics
Introduction
Suillus Gray is a large ectomycorrhizal genus in the Boletales with about 170
known species (Index Fungorum and Mycobank); about half of those species
are found in North America (Bessette et al. 2000) and about 40 species in the
western United States (Smith 1979). The four taxa in this study, S. caerulescens,
S. ponderosus, S. imitatus var. imitatus, and S. imitatus var. viridescens (all within
section Boletinus), are restricted to the North American west coast. Smith &
Thiers (1964) described S. caerulescens, S. ponderosus, and S. imitatus as three
distinct species based mainly on texture of the annulus/annulus remnant and
pileus color. Later, Smith & Trappe (1972) described S. imitatus var. viridescens
from western Oregon based on the strong greening reactions of cut tissue in the
390 ... Nguyen & al.
TABLE 1. Morphological comparisons of four Suillus taxa. *
S. caerulescens
S. ponderosus
S. imitatus
var. imitatus
S. imitatus
var. viridescens
HOLOTYPE MICH12297 MICH12305 MICH12300 MICH12301
(Smith 48733) (Smith 20204) (Smith 48732) (Smith 78754)
PILEUS SIZE 6-14 cm 9-25 cm 4-12 cm 4-12(-15) cm
PILEUS COLOR Vinaceous, Deep vinaceous Orange cinnamon to Reddish orange,
ochraceous tawny brown to dingy cinnamon ferruginous, dull
to ochraceous testaceous to cinnamon
buff rufous to cream-
buff
alysis eee Serge ae sag VP oe mee ae aa ate
si SLE dit aed emer ie le hu
STIPE SIZE 2.5-8 x 9-14 x 3.5-6 x 3-9 x
mat 2 ay My cn Oe OO IMR Cr” RS I SS Rl
STIPE STAINING Base slowly blue Surface blue Base surface Surface blue
when cut to greenish (1/2-1/3) quickly and/or green in
blue when cut moist (not dry)
AEE) Re ects Ds ok ies Boe andes Ma Sadist mela etter Ae nce te tok Ae SC ater hed
ANNULUS Band-like, Membranous, Band-like, dingy Wide band with
fibrillose, reddish- pallid, staining buff-orange slimy
pallid to white, cinnamon, brownish, felty- edge, fragmentary
not gelatinous gelatinous tomentose (edges in age
with some gluten)
SPORES 8-ll x 8-10(-12) x 7-9 x 8-11 x
p etEPOLE DN, | L: Rs ae ae ee! ae att ee aa Fre ethereal oe tins tht
SPORES 7.6-10.2 x 6-8.4 x 7-10 x 7-11 x
(as measured) 4-4.4 um 4-4,2 um 4-4.5 um 4-4.4 um
* Adapted from Smith (1979), Smith & Thiers (1964), and Smith & Trappe 1972. Spore dimensions
are reported based on the literature and as measured in this study.
stipe and the strong green colored specimens in the field. TABLE 1 provides an
overview of the morphological characteristics of these four taxa.
The four taxa are recognized in monographs and western guidebooks (e.g.
Arora 1986, Bessette et al. 2000, Smith & Thiers 1964, Thiers 1967, 1975).
Suillus caerulescens and S. ponderosus are very common mycorrhizal associates
of Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco), while S. imitatus was
described as a spruce associate (Smith & Thiers 1964) and is listed in modern
field guides as occurring in mixed conifer forests in the Pacific Northwest
(Bessette et al. 2000). In many years, fruit bodies belonging to the caerulescens/
ponderosus complex can be found in great abundance in coastal California
forests. As a result, it is not unusual to come across these taxa and to be faced
with the challenge of identifying them correctly. In the field, we rely heavily on
annulus characters to differentiate between species (Fic. 1), but this is a short-
lived, developmental character that can be altered or at least obscured by age
Suillus imitatus & the S. caerulescens-ponderosus complex ... 391
FiGure 1. Suillus caerulescens (A) and S. ponderosus (B):
Comparison of veil and other morphological characters.
and weather. Prof. Harry Thiers used to joke that in dry weather all specimens
had a dry annulus and were called S. caerulescens and in wet weather the annuli
were more gelatinous and the species was called S. ponderosus.
In contrast, the name S. imitatus is rarely applied to California material,
except to those collections that have a greenish tint and are referred to as
S. imitatus var. viridescens (Arora 1986). ‘The original description of S. imitatus
var. imitatus compared it primarily with S. lakei (Murrill) A.H. Sm. &
Thiers, but field guides usually compare it with S. caerulescens from which it
is distinguished with difficulty, by its supposedly slightly shorter spores and
slightly more orangish pileus (Thiers 1975, Arora 1986, Bessette et al. 2000).
Suillus lakei, another Douglas-fir associate closely related to the caerulescens/
ponderosus complex (Kretzer et al. 1996), is easily distinguished by its reddish,
fibrillose pileus. To help sort out the species present in our area, we combined
existing GenBank ITS sequences with newly acquired ITS sequences from the
holotypes and multiple collections of caerulescens/ponderosus complex.
Materials & methods
Our field collections were obtained from northern California (TABLE 2). We obtained
distribution information from our field-collected specimens, those deposited in the
University and Jepson Herbarium at the University of California, Berkeley (UC), photos
deposited in the online database Mushroom Observer that have clear identification, and
available checklists for Arizona (Bates 2006), Montana (C. Cripps pers. comm.), and the
Intermountain Region (Piep 2003). These sources combined to provided an acceptable
account for the overall natural distribution of the species studied here.
We extracted DNA from freshly collected specimens (UC 1861375-UC 1861389)
using a modified Sigma Extract-N-Amp kit (Sigma Aldrich, St. Louis, MO). For
392 ... Nguyen & al.
TABLE 2. Specimens sequenced in this study.
SPECIES COLLECTION COLLECTION HERBARIUM GENBANK
? DATE : LOCATION* # i #
S. caerulescens 3 Dec. 2006 CA: San Francisco Bay area UC 1861383 JQ958308
3 Dec. 2006 CA: San Francisco Bay area UC 1861384 JQ958309
3 Dec. 2006 CA: San Francisco Bay area UC 1861385 JQ958310
: 3Dec.2006 : CA: Marin Co., Mill Valley,
Natt Seley WE ee Mt Tamalpais te ite! Me hee
: 3Dec.2006 : CA: Marin Co., Mill Valley,
ed Ae ated me neat ee ni ie MeN ELON Lee ee eae | naa Me
: 3Dec.2006 : CA: Marin Co., Mill Valley,
eres gi dete deel whet ar eM aloe eae Ltn SISE og se ln aah ee a aM
: 3Dec.2006 = CA: Marin Co., Mill Valley,
: i Mt. Tamalpais UC 1861389 JQ958314
: 19 Nov. 2006 i CA: Mendocino Co., JDSF,
: ? Co. Rd 409 & Little Lake Rd., i UC 1861378 : JQ958315
39.3256 N 123.7372 W i :
S. ponderosus 19 Nov. 2006 CA: Mendocino Co., JDSE,
: : Co. Rd 409 & Little Lake Rd., i UC 1861375 : JQ958320
39.3256 N 123.7372 W : 2
19 Nov. 2006: CA: Mendocino Co., JDSK,
: : Co. Rd 409 & Little Lake Rd., UC 1861376 i JQ958321
39.3256 N 123.7372 W : :
: 19 Nov. 2006 CA: Mendocino Co., JDSE,
: : Co. Rd 409 & Little Lake Rd., i UC 1861377 : JQ958322
39.3256 N 123.7372 W i :
: 19 Nov. 2006 i CA: Mendocino Co., JDSF,
: ? Co. Rd 409 & Little Lake Rd., i UC 1861379 : JQ958323
39.3256 N 123.7372 W i :
: 19 Nov. 2006 : CA: Mendocino Co., JDSF,
: Co. Rd 409 & Little Lake Rd., | UC 1861380 : JQ958324
39,3256 N 123.7372 W
19 Nov. 2006 CA: Mendocino Co., JDSE,
: : Co. Rd 409 & Little Lake Rd., UC 1861381 i JQ958325
39.3256 N 123.7372 W : :
19 Nov. 2006 CA: Mendocino Co., JDSE,
: : Co. Rd 409 & Little Lake Rd., i UC 1861382 : JQ958326
39.3256 N 123.7372 W i :
S. caerulescens, : 9 Oct.1954 : WA: Pierce Co,
re. holotype 6. Oitete eden By aiSpenaway Pay, Se ee ees
S. imitatus var. 9 Oct. 1954 mie abet
Mt. Rainier National Park, ! MICH 12300 : JQ958317
Power House Woods : :
S. imitatus var. : 2Oct.1970 : OR: Lincoln Co., near Otis, i :
viridescens, holotype Van Duzer Corridor CHAZ SOT ag 0339810
S. ponderosus, : 24 Oct. 1944 } OR: Clackamas Co., i :
holotype i : Rhododendron palaces : a
imitatus, holotype
*Location abbreviations: JDSF = Jackson Demonstration State Forest.
‘Herbarium codes: UC = University and Jepson Herbaria, University of California, Berkeley;
MICH = University of Michigan Herbarium.
Suillus imitatus & the S. caerulescens-ponderosus complex ... 393
Suillus imitatus var. imitatus HOLOTYPE MICH12300, JQ958317
Suillus caerulescens HOLOTYPE MICH12297, JQ958316
Suillus caerulescens UC1861378, JQ958315
Suillus caerulescens UC1861384, JQ958309
Suillus caerulescens UBC F16304, EU486453
Suillus caerulescens UC 1861385, JQ958310
Suillus caerulescens UC 1861383, JQ95830
Suillus caerulescens UC 1861388, Q958313
Suillus caerulescens TDB-1028, L54096
Suillus caerulescens UC 1861386, JQ95831 1
Suillus caerulescens UC1861389, JQ958314
Suillus caerulescens UC1861387, JQ958312
Uncultured Suillus BJPO864T, JF792515
Uncultured ectomycorrhiza UBCOCS235, EF218818
Uncultured Suillus BUP1648T, JF792516
Suillus lakei clone Simb156s19A, EU557325
Suillus lakei isolate 140.2, DQ365643
Suillus lakei HDT-44112, L54086
Suillus lakei OUC97024, DQ367917
Uncultured Suillus UBCOFE582B, GU452528
Uncultured Suillus 1_117P3, JQ393127
Suillus amabilis N-5387, AF166499
Suillus ponderosus UC 1861375, JQ958320
Suillus imitatus var. viridescens HOLOTYPE 12301, JQ958319
Suillus ponderosus HOLOTYPE MICH12305, JQ958318
Suillus ponderosus UC1861379, JQ95832
Suillus ponderosus UC1861377, JQ958322
Suillus ponderosus UC1861380, JQ958324
Suillus ponderosus UC1861376, JQ958321
Suillus ponderosus UC1861382, JQ958326
Suillus ponderosus UC 1861381, JQ958325
Suillus spectabilis TDB-641, L5410
96/100
100/100
100/100
0.0080
Figure. 2. ITS-sequence based maximum likelihood tree of the Suillus species in this study.
Maximum likelihood followed by maximum parsimony bootstraps provide statistical support for
branches with >50% support. Each sequence contains the isolate/specimen number followed by a
GenBank accession number. Suillus spectabilis served as the outgroup.
specimens that had been stored in a herbarium, it was necessary to obtain high quality
DNA so we used a standard CTAB buffer lysis followed by chloroform extraction
and ethanol precipitation. DNA was extracted from the following herbarium type
specimens: MICH 12305, MICH 12297, MICH 12300 and MICH 12301. Herbarium
abbreviations are according to Thiers (2012; continuously updated). For field/recently
collected specimens, we used the standard fungal specific primers ITSIF (Gardes &
Bruns 1993) and ITS4 (White et al. 1990). For herbarium specimens with degraded
DNA we amplified the ITS gene in two segments when necessary. We used standard ITS
and Suillus ITS specific primers (ITS-2S and ITS-3S) in various combinations: ITS1F
and ITS2S or ITS2 and ITS3S or ITS3 and ITS4 (Bruns et al. 2010). Sequences were
produced using the standard BigDye Terminator v3.1 Kit and ran on an ABI Prism 3700
Genetic Analyzer (Life Technologies).
394 ... Nguyen & al.
We examined each automated sequence and manually interpreted and corrected
ambiguous bases using Sequencher (Gene Codes Corporation). These sequences were
deposited in GenBank under accession numbers (JQ958308-JQ958326). Using BLAST
we gathered from GenBank all sequences similar to the species mentioned as of April
24, 2012: S. lakei (GenBank L54086, DQ365643, DQ367917, EF218818, AF166499,
GU452528, JF792516, EU557325, JQ393127, JF792515), S. caerulescens (GenBank
154096, EU486453), and S. spectabilis (Peck) Kuntze (GenBank L54104) was used as
an outgroup species. We aligned the sequences manually and analyzed the alignment
using the maximum likelihood model GT[RGAMMA in RAxML (Stamatakis 2006).
Maximum likelihood bootstrap was performed using the RAxML online BlackBox
interface (Stamatakis et al. 2008). Maximum parsimony bootstrap was performed
using PAUP v.4.0b6 with 1000 replicates (Swofford 2001). Corrected distances between
sequences were found using the Kimura 2-parameter in PAUP (Swofford 2001).
Results & discussion
We obtained full length ITS coverage for three of the four type specimens
along with the 15 specimens that we collected for this study. We were able
to obtain only the ITS1 and ITS2 regions of the S. caerulescens holotype
MICH12297. We combined the sequences generated with GenBank sequences
of S. lakei, and the outgroup sequence from S. spectabilis. The matrix contained
32 taxa, 613 characters, and 30 parsimony informative characters. The resulting
maximum likelihood tree is shown in Fic. 2.
To our surprise specimens that we had determined as S. caerulescens and
S. ponderosus based on annulus differences (Fic. 1) separated into two clades
with good statistical support (Fic. 2). Despite the morphological similarities
between these two species, S. caerulescens is sister not to S. ponderosus, but to
S. lakei. Together these three species form a clade with moderately high support
(85%) based on an analysis of 40 Suillus taxa (data not shown). From these
results, we conclude that annular characters, when present, are a reliable way to
separate S. caerulescens from S. ponderosus (TABLE 1, Fi. 2).
In contrast, S. imitatus sequences did not fall within their own clade but fit
within the clades for the two other species: Suillus imitatus var. imitatus within
the S. caerulescens clade, and S. imitatus var. viridescens within the S. ponderosus
clade. At least so far, morphologically defined Suillus species separate fairly well
by ITS, but we know from other taxa that not all species may be distinguished
by differences within the ITS region (Manian et al. 2001, Bruns et al. 2010).
This prompts the question of whether there are morphological reasons to
suspect that one or both S. imitatus varieties might be distinct at the species
level. Interestingly, in the discussion that followed separation of the S. imitatus
varieties, Smith & Thiers (1964) and Smith & Trappe (1972) initially thought
that S. imitatus var. imitatus might represent S. caerulescens and S. imitatus
var. viridescens might be S. ponderosus. They decided instead to recognize two
Suillus imitatus & the S. caerulescens-ponderosus complex ... 395
taxa separated by pileus color and spore size differences. The shorter spores for
S. imitatus var. imitatus reported by Smith & Thiers (1964) and cited in many
later references were given as 7-9 x 4—4.5 um. Although this overlaps the lower
end of the spore range given for S. caerulescens (8-11 x 3-5 um), it could indicate
a subtle distinction. However, we re-measured the spores of the type collection
as 7-10 x 4-4.5 um, which now puts the var. imitatus spores within the center
of the range for S. caerulescens, S. ponderosus, and S. imitatus var. viridescens.
The orangish pileus color of S. imitatus var. imitatus certainly overlaps the
highly plastic pileus colors seen in S. caerulescens and S. ponderosus, and the
greenish tint of S. imitatus var. viridescens could easily be environmentally
induced, much as the aqua colors seen in the stipe of Leccinum species (den
Bakker & Noordeloos 2005). For these reasons we see no compelling argument
to maintain either variety of S. imitatus as a separate taxon and so synonymize
var. imitatus with S. caerulescens and var. virescens with S. ponderosus.
Suillus lithocarpi-sequoiae was described by Singer (1960) from Muir Woods,
Marin County, California. The descriptions for this species fit well within our
current concept of S. ponderosus. The type specimen (Singer N 1531) was
deposited in Fundacion Miguel Lillo, Argentina (LIL). Unfortunately, the type
specimen could not be located and is assumed lost. Singer placed (1962) and
maintained (1975, 1986) this species in Pulveroboletus, even though Smith &
Thiers (1964) and Thiers (1975) thought it better placed in Suillus. The species
was never encountered again at the type locality, despite repeated search efforts
(Thiers 1975). For these reasons we consider the name S. lithocarpi-sequoiae
doubtful.
Below is an updated taxonomy, and emended diagnoses for S. caerulescens
and S. ponderosus.
Taxonomy
Suillus caerulescens A.H. Sm. & Thiers, Contr. Monogr. N. Amer. Suillus: 36, 1964.
FIGURE 1A
Ho.Lotype: MICH12297 (A.H. Smith 48733); GENBANK nrITS JQ958316.
= Suillus imitatus A.H. Sm. & Thiers var. imitatus, Contr. Monogr. N. Amer. Suillus: 40, 1964.
HoLotypPe: MICH 12300 (A.H. Smith 48732); GENBANK nrITS JQ958317
These two names were validly published at the same time and therefore have
equal priority. However, we have chosen to retain the name S. caerulescens over
S. imitatus because of its broader use in many research articles, guidebooks,
and Internet web pages.
CHARACTERISTICS—Annulus band-like, fibrillose to felty-tomentose, white to
dingy pallid, staining brownish, not gelatinous to slightly gelatinous with some
gluten along the edges.
396 ... Nguyen & al.
Suillus ponderosus A.H. Sm. & Thiers, Contr. Monogr. N. Amer. Suillus: 38, 1964.
FIGuRE 1B
Ho.otype: MICH12305 (A.H. Smith 20204); GENBANK nrITS JQ958318
= Suillus imitatus var. viridescens A.H. Sm. & Trappe, Mycologia 64: 1151, 1972.
Ho.Lotype: MICH12301 (A.H. Smith 78754); GENBANK nrITS JQ958319
CHARACTERISTICS—Annulus membranous and band-like, buff-orange to
reddish-cinnamon, gelatinous to highly gelatinous and slimy along the edge.
ComMMENTS— Both species seem to occur within the host range of Douglas
fir (P. menziesii). Suillus caerulescens occurs from coastal northern California
north to British Columbia (Canada) and Montana, and in Arizona. It has also
been found in the northern Sierra Nevada at lower elevations where P menziesii
occurs (E.C. Vellinga pers. obs.). There is one report of its occurrence in
northern San Diego County, CA, on Palomar Mountain (Mushroom Observer
2012: 61662). However, Pseudotsuga macrocarpa (Vasey) Mayr rather than
P. menziesii occurs there. Unfortunately this material was not available for study.
Suillus ponderosus occurs in coastal areas from northern California (north of
Monterey Bay) to northern Oregon, but it is unclear whether it occurs in the
Sierra Nevada. Suillus lakei, sister to S. caerulescens, occurs in coastal northern
California, north into Montana, British Columbia, and Alberta (Canada) and
in patchy areas of the Rocky Mountains in Colorado, Utah, New Mexico and
Arizona (Mushroom Observer, Piep 2003, Bates 2006). This wide distributional
range may explain the ITS variations seen in Fic. 2.
To understand ITS genetic variability within and among the three species in
this study, we determined the intraspecific and interspecific percent sequence
similarity based on the corrected Kimura 2-parameter. Together with the type
specimens, all sequences within each of the three clades show high intraspecific
similarity: S. caerulescens (99.8-100%), S. ponderosus (99.5-100%), S. lakei
(98.4-100%). However, the interspecific similarity can be as high as 98.8%
among species: S. caerulescens (93.8-98.8%), S. ponderosus (93.8-96.8%), S.
lakei (94.3-98.8%). This is another case in which strict ITS similarity [the 97%
sequence similarity that serves as a proxy for operational taxonomic unit (OTU)
separation in ecological studies] does not necessarily correctly differentiate
species. Further study is necessary to determine the ITS genetic variability for
the whole genus Suillus. However, based just on what we already observed here,
caution is needed when using the broad implementation of the 97% unilateral
separation for all taxa (reflected in Hibbett et al. 2011, and references therein).
We strongly recommend that a phylogenetic framework be used for species
delimitation in studies using DNA sequences.
Suillus imitatus & the S. caerulescens-ponderosus complex ... 397
Acknowledgements
We thank the Herbarium at the University of Michigan for providing loans of type
specimens and the two reviewers, Boris Assyov and Dimitar Bojantchey, for their useful
comments to improve the manuscript. Support for this research was provided by the
NSF-GRFP to NHN and a Sonoma County Mycological Association (SOMA) Graduate
Scholarship to JFK.
Literature cited
Arora D. 1986. Mushrooms demystified. 2"* Ed. Ten Speed Press, Hong Kong.
Bakker HC den, Noordeloos ME. 2005. A revision of European species of Leccinum Gray and notes
on extralimital species. Persoonia 18: 511-587.
Bates ST. 2006. A preliminary checklist of Arizona macrofungi. Canotia 2: 47-78.
Bessette A, Roody WC, Bessette AR. 2000. North American boletes: a color guide to the fleshy
pored mushrooms. Syracuse University Press, Syracuse.
Bruns TD, Grubisha LC, Trappe JM, Kerekes JF, Vellinga EC. 2010. Suillus quiescens, a new species
commonly found in the spore bank in California and Oregon. Mycologia 102: 438-446.
http://dx.doi.org/10.3852/09-149
Gardes M, Bruns TD. 1993. ITS Primers with enhanced specificity for Basidiomycetes — application
to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.
http://dx.doi.org/10.1111/j.1365-294X.1993.tb00005.x
Hibbett DS, Ohman A, Glotzer D, Nuhn M, Kirk P, Nilsson RH. 2011. Progress in molecular and
morphological taxon discovery in Fungi and options for formal classification of environmental
sequences. Fungal Biol. Rev. 25: 38-47. http://dx.doi.org/10.1016/j.fbr.2011.01.001
Kretzer A, Li Y, Szaro TM, Bruns TD. 1996. Internal transcribed spacer sequences from 38
recognized species of Suillus sensu lato: phylogenetic and taxonomic implications. Mycologia
88: 776-785.
Manian S, Sreenivasaprasad S, Bending GD, Mills PR. 2001. Genetic diversity and interrelationships
among common European Suillus species based on ribosomal DNA sequences. FEMS
Microbiol. Letters 204: 117-121.
Mushroom Observer. 2012. http://mushroomobserver.org.
Piep MB. 2003. Macrofungi checklist for the Intermountain region.
http://herbarium.usu.edu/resources_checklists_fungal.htm
Singer R. 1960 ['1959’]. New and interesting species of Basidiomycetes VII. Mycologia 51:
578-594.
Singer R. 1962. The Agaricales in modern taxonomy. 2" Ed. J. Cramer, Weinheim
Singer R. 1975. The Agaricales in modern taxonomy. 3" Ed. J. Cramer, Vaduz
Singer R. 1986. The Agaricales in modern taxonomy. 4" Ed. Koeltz Scientific Books, Koenigstein
Smith AH. 1979. The genus Suillus in the western United States. Mycotaxon 9: 285-296.
Smith AH, Thiers HD. 1964. A contribution toward a monograph of the genus Suillus. Ann Arbor,
Publ. by author.
Smith AH, Trappe JM. 1972. The higher Fungi of Oregon’s Cascade Head Experimental Forest and
vicinity: I. The genus Phaeocollybia (Agaricales) and notes and descriptions of other species in
the Agaricales. Mycologia 64: 1138-1153.
Stamatakis A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with
thousands of taxa and mixed models. Bioinformatics 22: 2688-2690.
http://dx.doi.org/10.1093/bioinformatics/btl446
398 ... Nguyen & al.
Stamatakis A, Hoover P, Rougemont J. 2008. A rapid bootstrap algorithm for the RAxML Web-
Servers, Systems Biology 75: 758-771. http://dx.doi.org/10.1080/10635150802429642
Swofford DL. 2001. PAUP*. Phylogenetic Analysis Using Parsimony (* and other methods), version
4.Sinauer Associates Inc, Sunderland.
Thiers HD. 1967. California boletes III. The genus Suillus. Madrofo 19: 148-160.
Thiers HD. 1975. California mushrooms — a field guide to the boletes. Hafner Press, New York.
Thiers B. 2012 [continuously updated]. Index Herbariorum: A global directory of public herbaria
and associated staff. New York Botanical Garden's Virtual Herbarium.
http://sweetgum.nybg.org/ih/ [accessed 15 May 2012]
White T, Bruns TD, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in MA Innis et al. (eds.), PCR protocols - a guide to
methods and applications. San Diego, Academic Press.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.399
Volume 122, pp. 399-411 October-December 2012
Phylogenetic relationships and the newly discovered sexual state
of Talaromyces flavovirens, comb. nov.
Cosus M. VISAGIE”?, XAVIER LLIMONA}, JORDI VILA3,
GERRY LOUIS-SEIZE' & KEITH A. SEIFERT?
"Biodiversity (Mycology), Eastern Cereal and Oilseed Research Centre
Ottawa, Ontario, KIA 0C6, Canada
*Department of Microbiology, University of Stellenbosch
Stellenbosch, 7600, South Africa
*Departament de Biologia Vegetal (Botanica), Universitat de Barcelona
Diagonal 643, E-08028 Barcelona, Spain
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Typical Talaromyces ascomata were observed on dry Quercus suber leaf litter
amongst the characteristic synnemata of Penicillium aureocephalum, and they appear to
represent the sexual state of the latter species. The species is a synonym of the older Lasioderma
flavovirens, and we propose the new combination Talaromyces flavovirens. Lectotype and
epitype specimens are designated for this name. The defining characters of the asexual state
include yellow, short-stalked, mycetozoan-like synnemata with an unusual, almost closed
terminal head of penicillate conidiophores intermixed with sinuous hyphae, and dark green
conidia. Ascomata could not be induced in culture, but PCR amplifications of mating-type
genes indicate the species is heterothallic. In nature, ascocarp initials appear to be antheridia
coiled around clavate ascogonia, similar to those of T. flavus, and the thick-walled, spiny
ascospores are also similar to those of T: flavus. ITS barcodes and B-tubulin sequences place T:
flavovirens ina clade with T! apiculatus, T: flavus, T: funiculosus, T. galapagensis, T: pinophilus,
T. macrosporus, and seven other species.
KEYworRps — anamorph-teleomorph connections, DNA _ barcoding, hyphomycetes,
Trichocomaceae.
Introduction
Penicillium aureocephalum was described as a new species of synnematous
hyphomycete from Catalonia, Spain (Muntafiola-Cvetkovi¢ et al. 2001). It
typically occurs on Quercus suber and Cistus salviifolius leaf litter, producing
synnemata that resemble stalked mycetozoan sporangia. Although difficult
to observe without micro-dissection, the synnemata have symmetrical
400 ... Visagie & al.
conidiophores typical of Talaromyces (formerly referred to as Penicillium subg.
Biverticillium), with long, thin acerose phialides and a phialide:metulae length
ratio of about 1:1 (Pitt 1979). In culture on malt extract agar, P aureocephalum
typically produces hirsute yellow structures that resemble ascomata of
Talaromyces, but they do not mature, even after months of incubation
(Muntanola-Cvetkovi¢ et al. 2001).
A subsequent study of the distribution of P. aureocephalum in Spain yielded
abundant collections on Quercus leaves (Llimona et al. 2006). On some
specimens, ascocarps resembling those of Talaromyces, with prolate spiny
ascospores, were observed among the synnemata. Subsequent isolations from
these asciresultedin the production ofsynnemata cultivation of P aureocephalum
in the pure cultures. This, the habitat specificity and the sometimes intertwined
biverticillate conidiophores and asci led to our conclusion that the ascomata
represent the sexual stage of P. aureocephalum.
Montagne (1845) described the monotypic genus Lasioderma, with its type
species L. flavovirens collected on Quercus suber leaf litter from Algeria. The
original description reads, “Peridium e turbinato obpyriforme e floccis septatis
ramosis laxe intricatis contextum, subpersistens. Spore minute, numerosisime,
contiguze, olivaceze in centro evanescente peridii conglutinate.” The species
diagnosis adds only a few details, “stipite rufo statim in capitulum globosum
luteum dilatato,” then refers to an ‘ic. ined’ The color illustration was published
the following year in Flore d'Algérie Durieu (1846). The corresponding Flore
dAlgérie text (Durieu 1848) presented an essentially identical diagnosis,
additional details of a location near la Calle, Algeria (ie. on the Mediterranean
coast), details of an earlier Spanish collection made in 1824 by Durieu (selected
as lectotype below), an earlier unpublished manuscript name (“Cephalotrichum
flavovirens Durieu,’ not to be confused with the validly published name
Cephalotrichum flavovirens (Alb. & Schw.) Nees), and clarification of how
Lasioderma differed from Trichoderma.
The original and expanded descriptions (Montagne 1845, Durieu 1848), color
plate (Durieu 1846; reproduced in MycoBank MB120473), specific habitat, and
geographical location are all suggestive of P aureocephalum. Its specific habitat
and the striking morphological similarities between the Durieu (1846) sketch
and P. aureocephalum synnemata led us to believe that they might be the same
fungus. The suspicion was confirmed by our examination of authentic material
in PC, from which we selected the lectotype below.
Seifert et al. (2012) reviewed the historical literature on Lasioderma, tracing
its fate through Saccardo’s (1886) and Lindau’s (1900) hyphomycete compilations
until it was deflected into the Basidiomycetes by Héhnel (1910) and then largely
forgotten. We rediscovered the name because of its inclusion in the host index
by Oudemans (1920). Because Lasioderma is an older name than Talaromyces,
Teleomorph of Talaromyces flavovirens comb. nov. ... 401
and Lasioderma is also the current name of a genus of beetles, Seifert et al.
(2012) proposed the conservation of Talaromyces over Lasioderma. However,
L. flavovirens remains a valid species name, predating P aureocephalum by
more than 150 years. The recent move to single name nomenclature has placed
Penicillium subg. Biverticillium in synonymy with Talaromyces (Houbraken
& Samson 2011). Therefore, in this paper we introduce the new combination
Talaromyces flavovirens and report our efforts to document the connection of
the newly recognized sexual stage and its better-known synnematous stage. To
supplement the recent phylogenetic analysis of Talaromyces by Samson et al.
(2011), we also present the results of ITS and B-tubulin sequencing of multiple
strains of this fungus, demonstrating its coherence as a phylogenetic species
and confirming its relationships with other asexual Talaromyces species.
Materials & methods
Cultures
Quercus suber leaf litter with visible colonies of T. flavovirens was collected in
Catalonia, Spain by XL and his collaborators. Cultures were isolated from conidial
masses from these specimens by KAS. Dried specimens are deposited in the Canadian
National Mycological Herbarium (DAOM) and the cultures in the Canadian Collection
of Fungal Cultures (CCFC) under accession numbers DAOM 236381-DAOM 236383.
Morphology
The fungus was characterized from its natural habitat (Q. suber leaves) and by using
standardized cultivation techniques on Czapek Yeast Autolysate agar (CYA), Difco Malt
Extract agar (MEA; Pitt 1979, Okuda et al. 2000) and Yeast Extract Sucrose agar (YES,
Frisvad & Samson 2004). Spore suspensions were prepared in semi-solid 0.2% agar with
0.05% Tween80 and inoculated onto 9 cm Petri dishes in three-point pattern using a
micropipette. All plates were incubated in the dark for 7 days at 25°C, with additional
CYA plates incubated at 5 and 37°C. Color names and alphanumeric codes used in the
species description refer to Kornerup & Wanscher (1966). Microscopic characters were
photographed using an Olympus BX50 compound microscope, or an Olympus SZX12
dissecting microscope, with an Evolution MP digital microscope camera operated by
ImagePro 6.0. Composite habit photographs were produced using CombineZM (Hadley
2006). Conidiophore morphology was examined from both synnemata on the Quercus
leaves and cultures grown on MEA.
Phylogeny
DNA was extracted using the UltraClean™ Microbial DNA Isolation Kit (MoBio
Laboratories Inc.). ITS barcodes (Schoch et al. 2012) and partial $-tubulin genes were
amplified using Illustra pureTaq Ready-To-Go™ PCR Beads (GE Healthcare) with
primers ITS1 and ITS4 (White et al. 1990), and Bt2a and Bt2b (Glass & Donaldson
1995). The PCR profile had an initial denaturing step of 95°C for 3 min followed by 35
cycles of 95°C for 1 min, annealing at 56°C for 45 sec and elongation at 72°C for 1 min,
followed by a final elongation step at 72°C for 7 min. PCR products were sequenced
using the same primers, with the Big Dye Terminator Cycle Premix Kit and products
402 ... Visagie & al.
run on an ABI PRISM™ 310 DNA automated sequencer (Applied Biosystems). Contigs
were assembled and edited in CodonCode Aligner v3.7.1.1 (Codon Code Corporation).
GenBank accession numbers are included on Fic. 1.
The ITS sequences of the T: flavovirens strains were compared to a database of
Talaromyces spp. compiled from Samson et al. (2011). Reference strains of closely
related and other synnema-producing species were included in a more focussed analysis
of the B-tubulin gene region. Both data sets were aligned using MAFFT v6.850b (Katoh
et al. 2009) using the L-INS-i option. Sequence analysis was done in PAUP*v4.0b10
(Swofford 2002). The BioNJ method was chosen for calculating a single tree for each
data set (Gascuel 1997), with Trichocoma paradoxa chosen as suitable outgroup for
the ITS analysis and a clade of synnema-producing species for the §-tubulin analysis.
Bootstrap support was calculated using a 1000 replicates.
Teleomorph-anamorph connection and mating experiments
Various approaches were used to prove the connection between the sexual and
asexual structures on the newly collected specimens. Cultures were isolated from
conidial masses from Quercus suber leaves, and ascospore isolates were also attempted.
Anticipating that ascospores might be more heat resistant than conidia, we prepared
spore suspensions prepared from both ascomata and synnemata in a semi-solid
agar solution (Pitt 1979). Individual suspensions were exposed to temperatures at 5°
increments from 50-70°C, for either 15 or 30 min. Unheated suspensions were used
as a positive control. After heating, spore suspensions were plated out onto MEA and
incubated for 7 days at 25°C, after which plates were inspected for growth.
All cultures were grown on CYA, MEA and Oatmeal agar (OA), and on 2% water
agar with twigs or leaves of Q. macrocarpa in 9 cm Polystyrene Petri dishes sealed with
Parafilm. Further, the strains DAOM 236381-236383 and IBT 27044 were crossed in all
possible combinations on OA, and on 2% water agar with Q. macrocarpa leaves. After
several months of incubation at RT under ambient light, the Parafilm was removed to
allow the agar to dry out (Lopez-Villavicencio et al. 2010), in an attempt to mimic the
species’ arid natural habitat.
Mating-type genes were amplified from all strains using the primers MAT1-1b and
MAT1-2b with a touchdown PCR (Lopez- Villavicencio et al. 2010). The PCR profile had
an initial denaturing step at 95°C for 5 min, followed by 30 cycles of denaturing at 95°C
for 30 sec, annealing starting at 60°C (decreased -0.5°C for every cycle until 50°C) for 30
sec, elongation at 72°C for 1 min, followed by a final elongation step at 72°C for 7 min
(Lopez-Villavicencio et al. 2010). To confirm the presence or absence of the MAT1 and
MAT2 genes, products were run on a 1% agarose gel. In addition, representative strains
containing the putative MAT genes were sequenced to confirm results, using the same
sequencing protocol described above. MAT1 and MAT2 sequences were deposited in
GenBank with accession numbers JX091392-JX091394.
FiGuRE 1. Phylogenetic trees showing the relationships of Talaromyces flavovirens within —
Talaromyces. Trichocoma paradoxa was chosen as outgroup in the ITS phylogeny (left). For the
B-tubulin phylogeny (right), only close relatives were included in the data set. The phylogeny was
rooted to other synnema-producing Talaromyces species. Numbers above thick branches represent
bootstrap values above 80%. (7 = ex-type strain; * = synnemata producer).
Clade 1
92
—
Teleomorph of Talaromyces flavovirens comb. nov. ... 403
JX013912 T. flavovirens DAOM236381* —~
JX013913 T. flavovirens DAOM236382*
= JX013914 T. flavovirens DAOM236383*
JX013915 T. flavovirens DAOM236384*
JX013916 T. flavovirens' IBT27044*
JN899389 T. aculeatus' CBS100105
~~ GQ337428 T. pinophilus NRRL58691
||- JN899382 T. pinophilus'’ CBS631.66
— JN899358 T. galapagensis' CBS751.74
- JN899375 T. apiculatus' CBS312.59
-— JN899312 T. ruber CBS196.88
‘— JN899367 T. verruculosus' CBS388.48
-- JN899360 T. flavus’ CBS310.38
~ JN899385 T. siamensis CBS475.88
- JN899332 T. intermedius’ CBS152.65
-- JN899314 T. viridulus' CBS252.87
JN899319 T. calidicanius' CBS112002*
F JN899317 T. primulinus' CBS321.48
JN899341 T. diversus' CBS320.48
-— AB176617 T. euchlorocarpius' CBMFA0942
‘— JN899362 T. panamensis' CBS128.89*
‘— JN899344 T. marneffe” CBS388.87
98
JX091373 T. flavovirens DAOM236381*
JX091374 T. flavovirens DAOM236382*
a2! JX091375 T. flavovirens DAOM236384*
JX091376 T. flavovirens" IBT27044*
JX091377 T. flavovirens DAOM236383*
\___. JX091379 T. siamensis' CBS475.88
JX091378 T. apiculatus' CBS312.59
JX091388 T. galapagensis' CBS751.74
JX091380 P. liani’ CBS225.66
JX091381 T. pinophilus’ CBS631.66
-~——— JX091382 T. macrosporus' CBS317.63
JX091383 T. funiculosus\" CBS272.86
-— HQ156944 T. calidicanius' CBS112002*
L—. JX091384 T. duclauxii CBS322.48
EU021663 T. flavus' NRRL2098
JX091389 T. marneffei' CBS388.87
JX091385 T. viridulus' CBS252.87
|______. JX091387 T. intermedius’ CBS152.65
HQ149327 T. panamensis' CBS128.89*
JX091390 T. coalescens” CBS103.83*
PS roses T. cecidicola KAS504*
98 FJ753290 T. ramulosus' DAOM241660
GU385736 T. chloroloma’ DAOM241016*
>———. JX091391 T. dendriticus' CBS660.80*
‘____ HQ156950 T. pseudostromaticus' CBS470.70*
HQ156947 T. palmae’ CBS442.88*
—— 0.01 substitutions/site
Synnemata producing clade
— JN899372 T. purpurogenus' CBS286.36 yw
Seay"
JN899377 T. funiculosus' CBS272.86 og
aie JN899339 T. dendriticus' CBS660.80*
“— JN899371 T. pseudostromaticus' CBS470.70*
JN899366 T. coalescens' CBS103.83*
AY787844 T. cecidicola’ DAOM233329*
FJ160273 T. chloroloma’ DAOM241016*
EU795706 T. ramulosus' DAOM241660*
oe T. purpureus' CBS475.71
FJ160266 T. ptychoconidium' DAOM241017
JN899322 P. mirabile’ CBS624.72
JN899381 P. purpurogenum var. rubrisclerotium™ CBS270.35
JN899346 T. minioluteus' CBS642.68
JN899350 T. udagawae™ CBS579.72
5 aia JN899383 T. erythromellis' CBS644.80
FJ160264 T. solicola’ DAOM241015
JN899345 T. allahabadensis' CBS453.93
-- JN899379 T. loliensis' CBS643.80
\— JN899318 T. islandicus' CBS338.48
JN899365 T. brunneus’ CBS227.60
JN899324 T. radicus' CBS100489
JN899352 T. wortmannii’ CBS391.48
JN899343 T. variabilis' CBS385.48
AB176638 T. sublevisporus' CBMFA0939
JN899361 T. tardifaciens'’ CBS250.94
jl JN899353 T. rotundus' CBS369.48
82
‘—— JN899340 T. phialosporus' CBS233.60
‘—— JN899374 T. rugulosus' CBS371.48
JN899370 T. piceus' CBS361.48
JN899396 T. palmae’ CBS442.88*
JN899398 Trichocoma paradoxa CBS788 83
— 0.005 substitutions/site
404 ... Visagie & al.
Results
Isolations from both synnemata and ascomata yielded conidiomata of the
asexual state. Because of their small sizes, we could not confidently separate
ascospores from conidia under the dissecting microscope, but all attempted
ascospore isolations yielded the same synnemata that occurred in conidium-
derived isolates. The resulting colonies are described below in the Taxonomy
section.
Amplification of ITS barcodes resulted in amplicons about 600 bp long.
The aligned data set of Talaromyces species was 471 bp long. Talaromyces
flavovirens was resolved as a subclade of cladel, as described by Samson et al.
(2011). Bootstrap supports were low for branches within this clade. Because
B-tubulin is very difficult to align across the whole genus, we restricted our
analysis of this gene to close relatives identified by the ITS analysis, and we
included other synnema-producing species as out groups. §-tubulin amplicons
were about 500 bp long, but the confidently aligned portion of the data set was
only 391 bp long. Branch lengths were longer than for the ITS phylogeny, but
bootstrap support was still low. ITS and 6-tubulin analyses resulted in different
tree topologies. Although the sister group relationships differed between the
two phylogenies, both analyses portrayed T: flavovirens as a phylogenetically
distinct and coherent species.
No ascomata were observed in uncrossed or crossed cultures of T. flavovirens.
All strains produced the characteristic yellow, hirsute structures described by
Muntanola-Cvetkovic¢ et al. (2001), but no ascocarp initials or ascospores were
observed. Amplification and sequencing of the MAT genes showed that T:
flavovirens is heterothallic, with DAOM 236382 having the MAT1 gene and
other strains possessing the MAT2 gene.
The temperature gradient experiment did not reveal any difference in heat
tolerance between ascospores and conidia, and thus was unhelpful in confirming
the relationship of the two morphs. In both kinds of spore suspensions, positive
controls grew within 7 days. Both ascospores and conidia were killed at 65°C
with a 15 min exposure.
Taxonomy
Talaromyces flavovirens (Durieu & Mont.) Visagie, Llimona & Seifert, comb. nov.
MycoBank MB800438 PLATES 1, 2
= Lasioderma flavovirens Durieu & Mont., Annls Sci. Nat., Bot., 3e sér., 4: 364. 1845.
TyPeE: Spain, Madrid, Parque del Retiro, on dead leaves of Quercus ilex, Nov. 1824, M.C.
Durieu de Maisonneuve (lectotype designated here, PC 0088796); Spain, Catalonia,
Gerona, Selva de Mar, 5.XII.1999, X. Llimona (epitype designated here, BCC 473 =
BCN 473 ; ex-epitype culture IBT 27044 = CBS 102801).
= Penicillium aureocephalum Munt.-Cvetk., Hoyo & Gémez-Bolea, Fungal Diversity 7: 73.
2001.
Teleomorph of Talaromyces flavovirens comb. nov. ... 405
PLATE 1. Talaromyces flavovirens as it occurs in nature. a,b. Quercus suber leaves containing the
characteristic yellow synnemata and orange gymnothecia of T: flavovirens. c,d. Gymnothecia on
Quercus suber. e,f. Heavy walled spinose ascospores. g,h. Synnemata produced on Quercus suber.
i. Conidiophores in synnema with typical capitulum. j. Ellipsoidal heavy walled conidia produced.
Scale bars: d = 100 um; e,f,j = 10 um; h = 1000 um; i = 50 um.
406 ... Visagie & al.
Type: SPAIN, Catalonia, Gerona, Selva de Mar, 5.XII.1999, X. Llimona (holotype of
Penicillium aureocephalum, BCC 473 = BCN 473; ex-type culture IBT 27044 = CBS
102801)
IN NATURE — ASCOMATA deep golden yellow, often with a reddish pigment,
globose to subglobose, 150-380 um diam, soft, covered by a loose network of
hyphae, with a synnema-like stalk connecting ascomata to leaves, 50-100 x
15-50 um. Presumed ascocarp initials badly deteriorated, but similar in shape
to those of Talaromyces flavus and T. macrosporus as illustrated by Stolk &
Samson (1972), with antheridia coiled around clavate ascogonia. ASCOSPORES
abundantly produced, prolate, spiny, with a thick wall that appears double-
layered, yellow, (4—)4.5-6(-7) x 3-4, (mean + stdev = 5.1 + 0.43 x 3.5 + 0.2)
um, mean width/length ratio = 0.69 + 0.06, n = 95. SYNNEMATA similar in
appearance to stipitate myxostelid sporangia, with a yellow stalk 400-750 um
high, 100-250 um wide at the base, and a terminal head 250-300 um diam
comprised of conidiophores and conidia, covered with a bright yellow layer of
interwoven sterile hyphae, adding an additional 90-160 um. CONIDIOPHORES
mostly biverticillate, with very few subterminal branches occurring, dimensions
and other features similar to those described below for cultures, but with
metulae consistently diverging at broader angles, perhaps a consequence of the
presumably older age of the synnemata on the observed specimens.
IN CULTURE — On CYA at 25°C after 7 pays — Colonies 11-13 mm, low,
planar; texture velutinous; mycelia white; conidiogenesis moderate, conidia
dark green (29F6-29F7) in mass; exudate absent, soluble pigment absent;
margins narrow (1-2 mm), subsurface, entire; reverse Greyish Green (30D5)
under inoculum, Greyish Green (30B3) elsewhere, fading into a Greenish
White (30A2) margin. After prolonged incubation, colonies develop a brick
red reverse. On MEA at 25°C after 7 pays — Colonies 28-31 mm, low, zonate;
texture velutinous, appearing almost granular; sometimes dominated by
sterile Sulphur Yellow (1A5) mycelia that mask conidial areas; conidiogenesis
moderately dense to dense, conidia Dark Green (29F8) in mass; exudate absent,
soluble pigment absent; margins wide, 4-6 mm, subsurface, entire; reverse
Light Yellow to Reddish Yellow (4A5-4A6) at colony centres, fading to Pale
Yellow (2A3-2A4) near margins when aerial mycelia are present, or in colonies
lacking aerial mycelium with zonate rings of Greyish Green (30E5) and Greyish
Yellow (1B4). After prolonged incubation, colonies produce synnemata similar
in appearance to those seen in nature, differing by having shorter stipes; often
so densely packed that individual synnemata cannot be distinguished, and
conidial heads then seeming confluent. After prolonged incubation, yellow
hirsute structures produced, which resemble sterile ascomata. On YES at
25°C after 7 pays — Colonies 18-21 mm, low, planar; mycelia white; texture
velutinous, with poorly developed funicles; conidiogenesis dense, conidia in
Teleomorph of Talaromyces flavovirens comb. nov. ... 407
BES
PLATE 2. Talaromyces flavovirens as it occurs in culture. a. Colonies grown for 7 days at 25 °C on CYA,
MEA and YES from left to right (top row = obverse, bottom row = reverse). b. Colony texture on MEA
after 7 days. c. Colony texture on MEA after prolonged incubation showing synnemata produced being
covered by the sterile yellow capitulum. d. Colonies on CYA after prolonged incubation, becoming
brick red. e. Synnemata produced on MEA after prolonged incubation. f-j. Typical conidiophores.
k. Ellipsoidal heavy walled conidia. Scale bars: e = 50 um; j (applies to f-k) = 10 um.
408 ... Visagie & al.
mass Greyish Turquoise (24E4—24E6); exudate absent, soluble pigment absent;
margins narrow (3 mm), low, entire; reverse Dark Brown (6F8) at colony centre,
fading to Light Brown (6D8) nearing the Greyish Green (30D5) margin, in
some strains brown shades lacking, then similarly colored to MEA. On CYA at
5°C after 7 pays — no growth. On CYA at 37°C after 7 pays — no growth.
Synnemata as described above for the natural substrate. Conidiophores
closely packed together, mostly biverticillate although terverticillate branching
is not uncommon, smooth walled, 95-325 x 2-3 um; 2-3 basal branches
sometimes present, branches varying greatly in length, 10-35 x 2-3 um;
metulae 4-6 per stipe or branch, cylindrical, forming angles of 25-70°, 9-15
x 2-3 um. Phialides acerose, in nature with a greenish pigment, in culture
pigmentation less obvious, 5-8 per metula, 8-10.5(-11.5) x 2-3 um. Conidia
prolate, rough-walled, connective scars often visible, 2.5-3.5 x 2-2.5 (mean +
stdev = 2.98 + 0.16 x 2.3 + 0.13) um, mean width/length = 0.75 + 0.05, n = 71,
with ‘giant’ conidia sometimes present, up to 4.5-5.5 x 3.5-4 um.
Hasirat: Leaves of Quercus suber, Q. ilex, and Cistus salviifolius.
DISTRIBUTION: Spain, Algeria.
ADDITIONAL SPECIMENS EXAMINED: SPAIN, CATALONIA, Port de la Selva, Girona,
Font Clareta, on leaves of Quercus suber, 3.1.2006, X. Llimona (DAOM 236381, BCN
14.000); Selva de Mar, Girona, 3.1.2006, X. Llimona (DAOM 236382, BCN 14.003); same
location, 31.XII.2006, X. Llimona (DAOM 242312); Barraca den Rabert, Pau, Girona,
31.XII.2005, X. Llimona (DAOM 236383, BCN 14.006); VALENCIA, Xovar, Alt Palacia,
on leaves of Q. suber, 29.X1.2005, X. Llimona, J. Vila, F. Teiedor (DAOM 236384, BCN
14.009). EXTREMADURA, Finca Las Cansinas, Monfragiie, Cacera, on leaves of Q. suber,
14.X1.1986, R. Galano no. 507 (DAOM 242311).
Discussion
Talaromyces flavovirens is distinguished from other synnematous Talaromyces
species (T! calidicanius, T. chloroloma, T. cecidicola, T. coalescens, T. dendriticus,
T. palmae, T. panamensis, T. pseudostromaticus, and T. ramulosus) by the
characteristic yellow, short stalked, mycetozoa-like synnemata produced both
in nature and in culture. The yellow color is caused by an almost peridium-like
hyphal covering of the conidial head, which is much denser than the aerial
mycelium that sometimes covers conidiophores of other Talaromyces species.
Ascomata have so far only been observed in nature, with ascocarps eventually
producing thick walled, spiny ascospores. The ecology of T: flavovirens, as
described by Llimona et al. (2006), is rather specific. The species occurs on
dead leaves of Quercus suber, rarely Q. ilex, and Cistus salviifolius, which have
not fallen from trees by normal senescence, but rather by physical events such
as wildfires, hail or breaking of branches. These leaves are thus killed with
their full complement of nutrients, apparently favouring the growth of this
fungus. The currently known distribution suggests that this is a moderately
thermotolerant, Mediterranean species.
Teleomorph of Talaromyces flavovirens comb. nov. ... 409
The 1824 specimen from Madrid collected by M.C. Durieu de Maisonneuve
(PC 0088796) on leaves of Quercus ilex probably represents the Spanish
material mentioned by Durieu (1848) and is designated as lectotype of
L. flavovirens above. The Algerian specimens from la Calle reported by Durieu
(1848) were also examined (PC088798, PC0088795), but lack ascomata. It is
possible to infer that Montagne (1845) based the description in the protologue
on both Algerian and Spanish material, because in the Flore dAlgérie (1848,
p. 398), an 1824 collection by Durieu from Madrid is mentioned. Observations
of the lectotype by XL demonstrated the occurrence of both ascospores and
conidia on this specimen, making it a suitable lectotype for this pleiomorphic
species. The alternative, lectotypification using the 1846 illustration, would be
less desirable given the lack of conclusive evidence of ascomata. We designated
the holotype of P aureocephalum as the epitype of T! flavovirens to stabilize the
synonymy of these two names.
We were unable to prove unequivocally the genetic connection between the
putative asexual and sexual states of T. flavovirens but feel that the evidence
is convincing. Ascomata were never observed in our single spore derived
strains or crossed cultures, although structures that could be interpreted as
unfertilized ascomata were sometimes produced. Amplification and sequencing
of the mating type genes confirmed that T’ flavovirens is heterothallic, with
individual isolates containing either the MAT1 or MAT2 genes, never both.
A recent paper reported the development of a sexual stage for T. pinophilus
(Lépez-Villavicencio et al. 2010), a close relative of T: flavovirens, induced only
after media dried out. The similarity with the arid habitat of T. flavovirens is
interesting, but in our experiments slow drying of the colonies did not induce
maturation of the putative ascoma initials.
Comparatively large, prolate ascospores with thick spiny walls were observed,
a character also typical for T: flavus and T: macrosporus. Ascospore sizes were
thought to be useful for distinguishing T’ flavus (3-5 x 2.2-3.5 um) and
T. macrosporus (5-6.5 x 3.5-5.2 um) (Stolk & Samson 1972), but T. flavovirens
with its broader size range (4-7 x 3-4 um) complicates this distinction. Based
on ascospores alone, T: flavovirens is difficult to distinguish from T. flavus
and T. macrosporus, but the distinctiveness of its synnematous morph makes
identification simple.
Based on morphological similarities between the sexual states of T: flavovirens,
T. macrosporus, and T: flavus, they were expected to be close relatives in the
phylogenetic analyses. Talaromyces flavovirens is resolved in clade 1 of Samson
et al. (2011), which has little variation in the ITS barcodes. This results in a
weak phylogenetic signal, confirming only that T flavovirens itself forms a
coherent clade with bootstrap support. The B-tubulin gene has more sequence
variation than the ITS and thus provides better species resolution. In the
410 ... Visagie & al.
6-tubulin phylogeny, T. flavovirens was resolved as a close relative of
T. apiculatus’, T. galapagensis, T: siamensis*, and two small clades containing
Penicillium liani, Talaromyces funiculosus’, T. macrosporus, and T. pinophilus’.
Amongst these close relatives, are species that lack a known sexual state, marked
with *. Based on asexual structures, these species are easily distinguished
from T. flavovirens. Concerning the sexually competent species in this clade,
T. flavus and T: macrosporus are discussed in the previous paragraph. Otherwise,
T. galapagensis has the most similar ascomata but it produces ascoma initials
that are thin hyphae (Samson & Mahoney 1977). Its ascospores, although
similarly ornamented, are much bigger (7-10 x 5.5-8 um) than those of
T. flavovirens. Other species that produce synnemata are resolved as distant
relatives to T: flavovirens. Interestingly though, a clade of synnemata producers
occurs in the B-tubulin analysis (Fic. 1). This clade occurs in analyses of other
genes as well, and some kind of fungus-insect relationship was hypothesized
for some of these species (Seifert et al. 2004, Visagie et al. 2009). This idea is
being investigated more carefully in our continuing studies of these species.
Acknowledgements
This study was part of an overseas visit by the first author, made possible by funding
from the South African Biosystematics Initiative, NRF. The fieldwork by X. Llimona in
Catalonia was funded by the Institut d’Estudia Catalans (PT2008-S0206). We are grateful
to the curators of PC and DAOM for allowing us to examine specimens in their care,
JC Frisvad for providing us with the ex-type culture of P aureocephalum, RA Samson
and JAMP Houbraken for providing ex-type B-tubulin sequences, and K Jacobs for her
support of the senior author's participation in this project. The authors are grateful for
reviews by SW Peterson and RA Samson.
Literature cited
Durieu de Maisonneuve MC. 1846. Lasioderma flavo-virens DR. et Montg. Exploration scientifique
de lAlgérie, Botanique 1(4): t.20 f.4.
Durieu de Maisonneuve MC. 1848. Exploration scientifique de lAlgérie, Botanique 1(10):
361-400.
Gascuel O, 1997 BIONJ: An improved version of the NJ algorithm based on a simple model of
sequence data. Molecular Biology and Evolution 14: 685-695.
http://dx.doi.org/10.1093/oxfordjournals.molbev.a025808
Glass NL, Donaldson GC. 1995. Development of primer sets designed for use with the PCR
to amplify conserved genes from filamentous Ascomycetes. Applied and Environmental
Microbiology 61:1323-1330.
Hadley A. 2006. CombineZ, version 5. Published by the author. www.hadleyweb.pwp
Hohnel F von. 1910. Fragmente zur Mykologie (X. Mitteilung, Nr. 468 bis 526). Sitzungsberichte
der Kaiserlichen Akademie der Wissenschaften Math.-naturw. Klasse Abt. I. 119: 393-394.
Houbraken J, Samson RA. 2011. Phylogeny of Penicillium and the segregation of Trichocomaceae
into three families. Studies in Mycology 70: 1-51.
Katoh K, Asimenos G, Toh H. 2009. Multiple alignment of DNA sequences with MAFFT. Methods
Mol Biol 537: 39-64. http://dx.doi.org/10.1007/978-1-59745-251-9_3
Teleomorph of Talaromyces flavovirens comb. nov.... 411
Kornerup A, Wanscher JH. 1966. Methuen handbook of color. Denmark, Sankt Jorgen Tryk.
Lindau G. 1900. Hyphomycetes. In: A Engler, K Prantl (eds). Die natirlichen Pflanzenfamilien
1(1**): 415-517, 558-559.
Llimona X, Vila J, Garcia-Porta TM, Tejedor F. 2006. Penicillium aureocephalum Munt.-Cvetk.,
Hoyo et Gémez-Bolea, un interessant Ascomicet anamorfic amb aspecte de mixomicet.
Distribucid, ecologia i fenologia. Revista Catalana de Micologia 28: 47-56.
L6épez-Villavicencio M, Aguileta G, Giraud T, Vienne DMD, Lacoste S$, Couloux A, Dupont J, 2010
Sex in Penicillium: Combined phylogenetic and experimental approaches. Fungal Genetics and
Biology 47: 693-706. http://dx.doi.org/10.1016/j.fgb.2010.05.002
Montagne JPFC. 1845. Cinqui¢me Centurie de plantes cellulaires exotiques nouvelles. Décades VII
a X. Annales des Sciences Naturelles, Botanique, 3e Sér., 4: 346-367.
Muntanola-Cvetkovic M, Hoyo P, Gémez-Bolea A. 2001. Penicillium aureocephalum anam. sp. nov.
Fungal Diversity 7: 71-79.
Okuda T, Klich MA, Seifert KA, Ando K. 2000. Media and incubation effects on morphological
characteristics of Penicillium and Aspergillus. 83-99, in: RA Samson, JI Pitt (eds). Integration
of modern taxonomic methods for Penicillium and Aspergillus classification. Amsterdam,
Harwood academic publishers.
Oudemans CAJA. 1920. Enumeratio systematica fungorum in omnium herbarum Europaearum
organis diversis hucusque observatorum mentione facta fontium litterariorum diagnoses
eorum figurasque proferentium. Vol. 2. Nijhof, The Hague.
Pitt JI. 1979. The genus Penicillium and its teleomorphic states Eupenicillium and Talaromyces.
London, Academic Press Inc.
Saccardo PA. 1886. Sylloge Hyphomycetum. Sylloge Fungorum 4. 807 p.
Samson RA, Mahoney P. 1977. Talaromyces galapagensis sp.nov. Transactions of the British
Mycological Society 69: 158-160.
Samson RA, Yilmaz N, Houbraken J, Spierenburg H, Seifert KA, Peterson SW, Varga J,
Frisvad JC. 2011. Phylogeny and nomenclature of the genus Talaromyces and taxa
accommodated in Penicillium subgenus Biverticillium. Studies in Mycology 70: 159-183.
http://dx.doi.org/10.3114/sim.2011.70.04
Schoch CL, Seifert KA, HuhndorfS, Robert V, Spouge JL, Levesque CA, Chen W, Fungal Barcoding
Consortium. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal
DNA barcode marker for Fungi. PNAS 109: 6241-6246.
http://dx.doi.org/10.1073/pnas.1117018109
Seifert KA, Hoekstra ES, Frisvad JC, Louis-Seize G. 2004. Penicillium cecidicola, a new species on
cynipid insect galls on Quercus pacifica in the western United States. Studies in Mycology 50:
or 523.
Seifert KA, Frisvad JC, Houbraken J, Llimona X, Peterson SW, Samson RA, Visagie CM. 2012.
(2051) Proposal to conserve the name Talaromyces over Lasioderma (Ascomycota). Taxon
61(2): 461-462.
Stolk AC, Samson RA. 1972. The genus Talaromyces: studies on Talaromyces and related genera II.
Studies in Mycology 2: 1-65.
Swofford, D. L. 2002. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods).
Version 4. Sinauer Associates, Sunderland, Massachusetts.
Visagie CM, Roets F, Jacobs K. 2009. A new species of Penicillium, P. ramulosum sp. nov., from the
natural environment. Mycologia 101: 888-895. http://dx.doi.org/10.3852/08-149
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a guide to
methods and applications. San Diego, Academic Press.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.413
Volume 122, pp. 413-420 October-December 2012
Two interesting cantharelloids
from Nan and Kanchanaburi Provinces, Thailand
SUNADDA YOMYART’, ROY WATLING’, CHERDCHAI PHOSRI’,
JITTRA PIAPUKIEW* & PRAKITSIN SIHANONTH>**
"The Institute for the Promotion of Teaching Science and Technology,
924 Sukhumvit Road, Klong Toei, Bangkok, Thailand
*Caledonian Mycological Enterprises,
Crelah 26 Blinkbonny Ave, Edinburgh EH4 3 HU, Scotland, UK
*Department of Biology, Faculty of Science and Technology,
Pibulsongkram Rajabhat University, Phitsanulok, Thailand
‘Department of Botany & °Department of Microbiology, Faculty of Science,
Chulalongkorn University, Bangkok, Thailand
* CORRESPONDENCE TO:
[email protected]
ABSTRACT —Two cantharelloid fungi are recorded and described from Nan and
Kanchanaburi Provinces, Thailand. Cantharellus atratus, a new record for Thailand, is
recombined in Craterellus based on molecular studies. Although previously known from
Peninsular Malaysia, Pterygellus polymorphus var. minor represents a new record for
Thailand.
KEY worps — ectomycorrhizal fungi, ecology, dipterocarps, taxonomy
Introduction
Nan Province is situated in northern Thailand where dipterocarp forests
predominate. Several excursions over a two-year period were made to compare
macromycetes of a woodland in Veingsa District with a study area in Sisawat
District, Kanchanaburi Province, in western Thailand. Two cantharelloids
collected during this work are described herein.
Materials & methods
Collections
The Nan locality consisted of seasonal dipterocarp forest dominated by Shorea
obtusa Wall. and S. siamensis Mig. accompanied by Dipterocarpus tuberculatus Roxb.,
D. obtusifolius Teijsm. ex Mig. and a major understorey of diverse graminoids. The forest
overstorey in Kanchanaburi Province is dominated by S. siamensis and D. tuberculatus and
414 ... Yomyart & al.
an understorey primarily composed of Cycas siamensis Miq. and diverse graminoids. The
collected specimens were dried in silica gel and deposited in Bangkok, Chulalongkorn
University, Microbiology Department (BCUM ND1)
DNA analysis
Genomic DNA extracted from fresh basidiomes with cetyltrimethylammonium
bromide (CTAB) as described in Zhou et al. (1999). DNA was amplified in a 50 ul reaction
mixture that contained 1 yl of DNA template, 1x buffer [16 mM (NH,),SO,, 67 mMTris-
HCI (pH 8.8 at 25°C), 0.01% Tween-20], 2.0 mM MgCl, 250 uM dNTPs (Bioline Ltd,
London, UK), 20 pmol ITS1F (Gardes & Bruns 1993) and ITS4 (White et al. 1990), and 2.5
U BIOTAQ polymerase (Bioline Ltd, London, UK). The PCR cycle comprised an initial
denaturation step at 94°C for 5 min followed by 38 cycles of 94°C for 1 min, 51°C for
1 min and 72°C for 1 min, anda final extension at 72°C for 5 min ona TP600TaKaRa PCR
Thermal Cycler Dice™ (Takara Bio Inc., Japan). The PCR product was sub-cloned with
Takara Cloning Kits (Takara Bio Inc., Japan) following the manufacturer's instructions.
Plasmid DNA was extracted from transformed cells suspended in 50 ul sterile water in
a 1.5 ml tube that was incubated in boiling water for 5 min. The supernatant was PCR
amplified with primers ITS1 and ITS4. After confirming fragment insertion on agarose
gels, the inserts were sequenced using Thermo Sequenase Pre-mixed Cycle Sequencing
Kits (Amersham International plc. Buckinghamshire, England) using primers Texas
Red M13F and T7 following the manufacturer’s instructions. The sequences obtained,
including the complete ITS regions, were registered in DDBJ. A blast homology search
was conducted in DDBJ/EMBL/GenBank database using Blastn. Phylogenetic analysis
was performed with Neighbor-Joining method using PAUP 4.08b (Swofford 1999).
SEM observation
Fresh specimens were prepared for the scanning electron microscope by fixation in
2.5% glutaraldehyde 0.1 M phosphate buffer at pH 7.2 for 2 hr at 5°C. Specimens were
then rinsed twice in phosphate buffer for 10 min and once in distilled water for 10 min.
The specimens were dehydrated in a 30, 50, 70 and 95% ethanol series for 10 min each
followed by three changes of absolute ethanol for 10 min each. Specimens were dried in
a critical point dryer (Balzers model CPD 020). The dried samples were fixed to brass
stubs with double sided sticky tape and then coated with gold in a sputter coater (Balzer
model SCD 040). Specimens were observed under SEM (JEOL model JSM 5410LV)
with an accelerating voltage of 15 kV. Photographs were recorded by computer.
Taxonomy
Craterellus atratus (Corner) Yomyart, Watling, Phosri, Piapukiew & Sihan.,
comb. nov. FIG. 1
MycoBank No. MB 563344
= Cantharellus atratus Corner, Ann. Bot. Mem. 2: 62, 1966.
PitEus 8-9 mm dark fuliginous black, not perforated but depressed at
centre, appearing fibrillose-zoned when fresh, centrally stipitate (although
limb broader on one side), margin wavy slightly fimbriate. StipE 7-9 x 0.75-1
mm greyish buff throughout, darker downwards to slightly swollen at base
Craterellus atratus comb. nov. (Thailand) ... 415
> Y
Je Bhar S
a.)
a
ws
©
-
x :
5
> 1 D *
oe
MSkU #1ga@,908 lpm 2669 fo
x
Fic. 1. Craterellus atratus. A: Pair of basidiomes. B: Distribution of basidiomes in study area.
C: Scanning electron micrograph showing variable number of basidiospores on hymenium.
D: High magnification scanning electron micrograph, showing ellipsoid basidiospore shape with
smooth wall. Scale bars: A, B = 1 cm; C = 10 um; D = 1 um.
416 ... Yomyart & al.
NJ
Pterygellus polymorphus var. minor (AB445116)
100
Pseudocratereilus sinuosus (GU590932)
100
Uncultured Cantharetlus (FR852287)
89
Cantharellus atratus (AB445115)
Craterellus lutescens (AY082606)
83
Craterelius fallax (GU590925)
100
100 Craterelius fallax (GU590927)
100
Craterellus cornucopioides (UDB000053)
Craterellus tubaeformis (UDB001527)
100
Craterellus tubaeformis (UDB002389)
ae Cantharelius appalachiensis (HQ386220)
93 Cantharellus cibarius (DQ200926)
hay 400 Cantharellus cibarius (HQ270128)
Cantharellus lateritius (HQ270121)
100
74
Cantharellus sp. (HM776721)
Canthareflus minor (HQ270119)
Clavutina cinerea (UDB001532)
Clavulina rugosa (UDB001533)
—— 0.05 substitutions/site
Craterellus atratus comb. nov. (Thailand) ... 417
embedded in sandy, surface passing irregularly into a pale grey, smooth to very
faintly wrinkled hymenium which commences uniformly dark greyish buff but
then becomes darker. FLESH concolorous.
BASIDIOSPORES 9 x 6-7 um, ellipsoid, smooth, thin-walled with minute
guttules, inamyloid. Basip1A 4-6-spored. CysTip1A absent. CLAMp-
CONNECTIONS rare.
SPECIMEN EXAMINED: THAILAND, NAN PROVINCE, VEINGSA DistTRICT, locality, on
bare ground in dipterocarp forest, 29 July 2006, coll. Sihanonth (BCMU ND1, GenBank
AB445115).
Corner (1966), who described this species from the type collection from Rio
de Janeiro, Brazil, also recorded it from Pernambuco, Brazil, and Brunei. Our
material agrees with the pickled collection held in Edinburgh as a collection
sent by Singer from Pernambuco, Brazil. Singer misidentified the Pernambuco
collection as the Venezuelan Craterellus orinocensis Pat. & Gaillard, a much
larger fungus reaching 8 cm high and 2-3 cm wide, allied with Cr. cornucopioides
(L.) Pers. (Patouillard & Gaillard 1888) and possibly, as Heinemann (1958)
suggests, a variety of Cr cornucopioides. Singer's Pernambuco material is a
rather small (pileus 2 cm diam) cantharelloid fungus and resembles a minute,
smooth version of the widespread temperate Cr. tubaeformis (Fr.) Queél.
(= C. infundibuliformis (Scop.) Fr.). Unlike Cr. tubaeformis, Cr. atratus shows
no hint of yellow in the stipe. Corner (1966) originally included C. atratus
in Cantharellus subg. Phaeocantharellus, but Donk (1969) indicated that the
name Cantharellus sect. Leptocantharellus Peck has priority for this group.
Subsequent molecular studies (Feibelman et al. 1997, Dahlman et al. 2000)
have shown that core species in this group are more closely allied to Craterellus
than to the Cantharellus cibarius consortium and should therefore be accepted
in Craterellus (Fic. 2), and we therefore propose the new combination,
Cr. atratus.
Pterygellus polymorphus var. minor Corner, Ann. Bot. Mem. 2: 170, 1966. Fic. 3
PiLEus 0.5-3 cm plane or plano-convex & simple at first then almost
multipileate from deep incisions, rich, clear chrome-yellow but more
ochraceous yellow towards centre in older specimens, deeply depressed,
minutely scurfy roughened especially towards margin, smoother inwards and
minutely fibrillose; margin uniform when young then soon wavy and flanged,
becoming even more so with age and almost dichotomously lobed, irregularly
Fic. 2. A neighbor-joining tree showing placement of Craterellus atratus (AB445115) and
Pterygellus polymorphus var. minor (AB445116). Clavulina cinerea and Clavulina rugosa were
used as outgroups. Numerical values on branched are the bootstrap values as percentage bootstrap
replication from a 1000 replicate analysis. The scale bar indicates 0.05 of the genetic distance
between samples.
418 ... Yomyart & al.
-
e
' a - vt ; , F
Peek 83.569. pea un
Fic. 3. Pterygellus polymorphus var. minor. A: cluster of basidiomes in study area. B: Scanning
electron micrograph showing four basidiospores attached to basidia. C: High magnification
scanning electron micrograph of basidiospores, showing smooth wall and ellipsoid shape. Scale
bars: A = 1 cm; B = 10 um; C = 5um.
incised, wavy and toothed with fimbriate extensions. STIPE rich carrot colour
to chrome yellow, darkening downwards, quite short compared with extension
of hymenial surface. HYMENIUM smooth, lacking even minute wrinkles except
at pileus margin, whitish or ivory as if frosted, quite deep and irregular and
fimbriate, yellow towards basal regions. FLEsH thin, pale yellow with a possible
faint pinkish cast.
Craterellus atratus comb. nov. (Thailand) ... 419
BASIDIOSPORES 8-9 x 6-7 um ellipsoid to broadly ellipsoid, smooth, hyaline,
thin-walled, non-amyloid. Basip1a 4-spored. CystTip1a absent. CLAMP-
CONNECTIONS absent.
SPECIMEN EXAMINED: THAILAND, KANCHANBURI PROVINCE, SISAWAT DISTRICT,
locality, on soil troops in dipterocarp forest, 20 October 2007, coll. Sihanonth (BCMU
KD1, GenBank AB445116).
Although agreeing in all microscopic characters with P polymorphus Corner var.
polymorphus, the small size of the basidiomes in the Kanchanaburi collections
places them in P polymorphus var. minor, a small fungus described from the
Reservoir Jungle, Singapore, and differing from the type variety in its smaller
size, being only slightly over 10 mm maximum. Corner (1966) described
the typical variety as growing on soil in woodland in Pahang and Kedah,
Malaysia. Our material agrees with both figures and coloured illustrations of
P. polymorphus var. minor as well as with an excellent colour photograph in The
Mycologist, portraying material collected in New Guinea (Verbeken & Walleyn
1999). Superficially the fungus approaches Craterellus aureus Berk. & M.A.
Curtis in outward appearance, except that but the pileus is not perforate.
Our material also resembles Pseudocraterellus luteus (Pat.) D.A. Reid,
a similar species that Corner (1966) suggested might be compared with
P. polymorphus. Indeed, all our collections are very close to Ps. luteus except for
the prominent fimbriate pileus margin present in our material. The basidiome
colour also differs, being more yellowish than orange when fresh before finally
fading to brownish in Ps. luteus whilst P polymorphus is an intense yellow-
orange (especially in the stipe) when young before fading to an ochraceous
yellow. Pterygellus is a stereoid-like fungus and differs from Pseudocraterellus
in the lack of secondary septation and in the thickened hyphal walls. Pterygellus
polymorphus sequence analysis places the fungus on a branch close to
Pseudocraterellus sinuosus (Fr.) Corner, as indicated in Fie. 2.
Acknowledgements
We wish to thank Professor Anthony J.S. Whalley and Dr. Maria P. Martin on their
valuable critical comments on the manuscript. This work was financially supported
by the Thailand Research Fund through the Royal Golden Jubilee Ph.D. program to
S. Yomyart and P. Sihanonth under research project no. 2.B.CU/47/N.1 and a part of
Graduate School Chulalongkorn University Thesis Grant.
Literature cited
Corner EJH. 1966. A monograph of the cantharelloid fungi. Annales of Botany Memoirs 2:
L=259.
Dahlman M, Danell E, Spatafora JW. 2000. Molecular systematics of Craterellus: cladistic analysis
of nuclear LSU rDNA sequence data. Mycol. Res. 104: 388-394.
http://dx.doi.org./10.1017/S0953756299001380
Donk MA. 1969. Notes on Cantharellus sect. Leptocantharellus. Persoonia 5: 265-284.
420 ... Yomyart & al.
Feibelman TP, Doudrick RL, Cibula WG, Bennett JW. 1997. Phylogenetic relationships within the
Cantharellaceae inferred from sequence analysis of the nuclear large subunit rDNA. Mycol. Res.
101(12): 1423-1430. http://dx.doi.org./10.1017/S0953756297004115
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycete applications
to the identification of mycorrhizae and rusts. Mol. Ecol. 1: 113-118.
http://dx.doi.org./10.1111/j.1365-294X.1993.tb00005.x
Heinemann P. 1958. Champignons recoltres au Congo Belge par Madame M. Goossens-Fontana.
III. Cantharellineae. Bull. Jardin Bot.de LEtat, Bruxelles 28(4): 385-438.
Patouillard N, Galliard MA. (1888) Champignons de Vénézuéla et principalement de la région du
Haut-Orénoque récoltés par. M.A.Galliard Bulletin Sociéte de Mycologique de France 4: 7-46
Reid DA. 1962. Notes on fungi which have been referred to the Thelephoraceae sensu lat. Persoonia
2 (2): 109-169. A monograph of stipitate stereoid fungi. Nova Hedwigia Beihefte 18: 1-382.
Swofford DL. 1999, PAUP*. Phylogenetic analysis using parsimony (and other methods), version
4.08b8. Sinauer Associates, Sunderland, MA, USA.
Verbeken A, Walleyn R. 1999. Is Pterygellus mycorrhizal with a euphorbia? Mycologist 13: 37.
White TJ, Bruns T, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal rna
genes for phylogenetics. 315-322, in: MA Innes et al. (eds). PCR protocols. A guide to methods
and applications. San Diego, California: Academic Press, Inc.
Zhou Z, Miwa M, Hogetsu T. 1999. Analysis of genetic structure of a Suillus grevillei population in
a Larix kaempferi stand by polymorphism of inter-simple sequence repeat (ISSR). New Phytol.
144: 55-63.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.421
Volume 122, pp. 421-432 October-December 2012
Lichens newly recorded from the South Korean coast
Lu-Lu ZHANG", XIN-YU WANG” ?*, ZUN-TIAN ZHAO? & JAE-SEOUN Hur”
" College of Life Sciences, Shandong Normal University Jinan, 250014, P. R. China
? Korean Lichen Research Institute, Sunchon National University, Sunchon, 540-742, Korea
°Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,
Chinese Academy of Sciences, Yunnan 650204, China
* These authors contributed equally to this work
ABSTRACT — Twelve new records of lichen species are reported from the southwestern coast
of South Korea. Among them, ten are crustose lichens and two are macrolichens. Caloplaca
yuchiorum and Lecidea varians are reported for the first time from Asia. The coastal rocky
area offers great potential for the discovery of new or previously unrecorded crustose lichens
in the country.
Key worps — biodiversity, taxonomy, maritime, saxicolous, lichenized fungi
Introduction
The southwestern coast of South Korea where we conducted most of our
research is mainly composed of rocks surrounded by thousands of small rocky
islands (PL. 1). In contrast to macrolichens, which have been studied thoroughly
(Park 1990), crustose lichens are poorly studied in South Korea. Because the
rocky coast area harbors a rich diversity of crustose lichens (Joshi et al. 2009,
2011), we focused the study in this area and found many species that have not
been reported previously for the country.
Most of the new records reported in this study were growing on coastal
rocks, while only a few of them were on bark. Due to the difficulty of collecting
lichens on rock, saxicolous lichens are still poorly studied, compared with the
terricolous or corticolous ones. In addition, no expert has studied such crustose
genera as Acarospora A. Massal., Ochrolechia A. Massal., or Pertusaria DC. in
the region, so that future new discoveries might be found within the crustose
lichen groups, especially those occurring in the coastal rocky region.
Materials & methods
Specimens were collected from the western and southwestern coast of South Korea
in 2011. Samples were hand-sectioned under Nikon SMZ645 dissecting microscope
422 ... Zhang & al
125° 130°E
PLATE 1. Collection sites for lichens newly recorded from South Korea.
and observed under Nikon E200 microscope using standard microscopical techniques.
Lichen substances were identified using standardized thin layer chromatography
techniques (TLC) with C system (Orange et al. 2010). The specimens are lodged at
herbarium of Lichen & Allied Bioresource Center, Korean Lichen Research Institute
(KoLRI), Sunchon National University, Korea.
New lichen records for South Korea... 423
The new records
Acarospora veronensis A. Massal., Ric. auton. lich. crost.: 29 (1852). Piz2A
Thallus medium brown to dark brown, of dispersed areoles, thinly scattered
in lines following cracks, or in places as contiguous groups; areoles 0.2-1.0 mm
wide, rounded or angular by compression, occasionally slightly lobulate, flat or
slightly convex, matt or shiny. Medulla white; lower surface corticated, white to
light brown. Apothecia numerous, deeply immersed, round to angular, 0.2-0.4
mm in diam., 1-3 per areole, sometimes confluent, sessile, concave, crater-
like, of same color as thallus or reddish brown; epihymenium yellowish brown;
hymenium hyaline 60-100 um high; subhymenium and hypothecium hyaline;
Asci cylindrical, more than 100 spores per ascus; Ascospores hyaline, simple,
narrowly to broadly ellipsoid, 3-6 x 1.5-2 um.
SPOT TESTS — thallus: K-, C-, KC-, P-.
SECONDARY METABOLITES — none detected.
SPECIMEN EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, seaside,
34°43.515'N 127°53.678’E, alt. 16 m, on rock, 28 Apr. 2011, Hur 110244 (KoLRI).
COMMENTS — Acarospora veronensis is similar to A. impressula, which has
more punctiform, less concave apothecia.
Reported from Europe, North & Central America, and Asia (Smith et al.
2009), A. veronensis is new to South Korea.
Bacidia egenula (Nyl.) Arnold, Flora 53: 472 (1870). PL. 2B
Thallus gray-green to yellowish green, crustose, thin to thick. Apothecia flat
or slightly convex, 0.2-0.6(-0.8) mm in diam.; disc bluish gray to dull black,
epruinose; exciple olive-green at the outer edge, hyaline interior; epihymenium
olive-green to blue-green, K-, N+ reddish; hymenium hyaline, colorless, 35-50
um tall; hypothecium brown to reddish brown in upper part, colorless below.
Ascospores hyaline, 3- to 7-septate or indistinctly septate acicular, clavate or
long-bacilliform, straight or slightly curved, 25-40 x 1.5-2.5 um.
SPOT TESTS — thallus: K-, C-, KC-, P-.
SECONDARY METABOLITES — none detected.
SPECIMEN EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, Changseun
Island, 34°51.856'N 127°57.715'E, alt. 4 m, on rock, 29 Apr. 2011, Hur 110289 (KoLRI).
ComMENTsS — Bacidia egenula is similar to B. arnoldiana and B. viridescens
but B. arnoldiana can be distinguished by 1-3-septate spores and a colourless
epihymenium and B. viridescens differs by its colourless hypothecium and
larger thallus granules (80-120 um diam).
Reported from Europe, North America, and Asia (Smith et al. 2009),
B. egenula is new to South Korea.
424 ... Zhang & al
Buellia prospersa (Nyl.) Riddle, Brooklyn Bot. Gard. Mem. 1: 114 (1918). Pi,2c
Thallus crustose, epilithic, thin to moderately thin, continuous, surface
smooth and rimose, slightly roughened, yellowish gray to light gray, epruinose,
without soredia or isidia, prothallus absent; medulla white. Apothecia lecideine,
0.5-1.0 mm in diameter, sessile, disc black and plane, epruinose, with black
and smooth margin; exciple narrow, inner hyphae hyaline, with darkened outer
part; epihymenium brown, hymenium hyaline, paraphyses simple or branched.
Asci clavate, Bacidia-type, 8-spored, ascospores brown, ellipsoid with obtuse
ends, l1-septate, 10-15 x 6-8 um. Pycnidia not seen.
SPOT TESTS — thallus: K-, C-, KC-, P-.
SECONDARY METABOLITES — no compounds or with norstictic acid,
connorstictic acid and several xanthones (UV+ orange).
SPECIMENS EXAMINED — SOUTH KOREA. JEONNAM: WANDO couNTY, Cheongsan
Island, 34°09.187'N 126°52.821’E, alt. 2 m, 23 Jun. 2011, Hur 110711 (KoLRI); SHINAN
COUNTY, Palgseun Island, 34°47.790'N 126°10.173’E, alt. 1 m, on rock, 2 Jun. 2011, Hur
110389 (KoLRI); Heuksan Island, 34°40.901'N 125°26.671’E, alt. 3 m, 21 Jun. 2011, Hur
110530 (KoLRI).
ComMENTsS — Buellia prospersa is easily separated from other Korean Buellia
species by its yellowish surface (UV+ orange) and growth only on the coastal
siliceous rocks.
Cosmopolitan but restricted to coastal areas (Nash et al. 2007), B. prospersa
is new to South Korea.
Caloplaca yuchiorum Lendemer & C.A. Morse, J. Torrey Bot. Soc. 137: 328 (2010).
PL, 2D
Thallus gray-white, rimose-areolate, areoles plane, smooth, upper surface
postulate, and pustules broken and forming soredia; prothallus black. Apothecia
immersed to subimmersed, up to 0.7 mm, with only proper margin or with
additional thalloid margin, proper margin black when prominent; disc dark
brown to black, flat; exciple with or without algae; epihymenium light brown
with blue-green, K+ light violet, N+ violet; hymenium 65-85 um, with oil
droplets; hypothecium hyaline, with oil droplets. Ascospores hyaline, 2 locules,
ellipsoid, (9-)11-18 x (4-)4.5-7 um, isthmus at least 1/3 of spore length.
Pycnidia present, immersed, conidia bacilliform, 3.5-4.5 x 1-1.2 um.
SPOT TESTS — cortex: K+ yellow, C-, N-; medulla: K-, C-, N-.
SECONDARY METABOLITES — atranorin (thallus), anthraquinone pigment
(epihymenium).
SPECIMENS EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, Changseun
Island, 34°51.891'N 127°57.705'E, alt. 2 m, on rock, 29 Apr. 2011, Hur 110280 (KoLRI);
TONGYEONG CITY, Salyang Island, 34°50.590'N 128°12.137’E, alt. 28 m, on rock, 20 Apr.
2011, Hur 110028 (KoLRI). JEONAM: JINDO COUNTY, seaside, 34°32.910'N 126°18.697'E,
alt. 3 m, on rock, 3 Jun. 2011, Hur 110462 (KoLRI).
New lichen records for South Korea... 425
PLATE 2. Habit of newly recorded lichens. A. Acarospora veronensis, Hur 110244; B. Bacidia
egenula, Hur 110289; C. Buellia prospersa, Hur 110598; D. Caloplaca yuchiorum, Hur 110284;
E. Lecanora melacarpella, Hur 110352; F. Lecanora pseudistera, Hur 110466. Scale bars: B = 1 mm;
A, C-F =5 mm.
ComMENTS — Caloplaca yuchiorum is very similar to C. diplacia, which differs
in having a sorediate thallus with a pale prothallus, smaller apothecia (0.3-1.0
mm wide), and an epihymenium with an anthraquinone pigment that reacts
K + magenta.
Reported from North America (Lendemer & Morse 2010), C. yuchiorum is
new to South Korea and Asia.
426 ... Zhang & al
Lecanora melacarpella Mill. Arg., Bull. Herb. Boissier 3: 633 (1895) PL. 2E
Thallus whitish to grayish white, crustose, uniform, continuous or dispersed
verrucose to verruculose, epruinose; margins indefinite or definite, sometimes
with a whitish prothallus. Apothecia sessile, constricted at base, 0.6-1.5 mm
diam.; discs brown to dark brown, epruinose; margins smooth to verruculose
or verrucose, prominent. Amphithecium with small K-soluble and large
crystals; parathecium hyaline with small K-soluble crystals; epithecium without
crystals, with a 2 um high hyaline layer above; hymenium hyaline, 65-85 um
tall; hypothecium hyaline, inspersed with oil droplets. Ascospores ellipsoid,
(9-)10.5-13.5 (-15.5) x (5.5-) 7.5-8.5 um.
SPOT TESTS — thallus: K+ yellow, C-, KC-, Pd+ light orange.
SECONDARY METABOLITES — atranorin, zeorin, unidentified triterpenoid
(minor).
SPECIMENS EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, Mt.
Mangeun, 34°51.076'N 127°49.605’E, alt. 165 m, 29 Apr. 2011, Hur 110144 (KoLRI).
JEONAM: JINDO COUNTY, Jeob-do Island, 34°23.091'N 126°18.250’E, alt. 2 m, 3 Jun. 2011,
Hur 110516 (KoLRI); SHINAN CounTY, Palgeum Island, 35°47.734'N 126°10.219’E, alt. 2
m, 2 Jun. 2011, Hur 110352 (KoLRI).
COMMENTS — Lecanora melacarpella is similar to L. gangaleoides, which is
diagnosed by gangaleoidin and a thicker, verrucose thallus.
Reported from Australasia and India (Lumbsch & Elix 2004, Galloway
2007), L. melacarpella is new to South Korea.
Lecanora pseudistera Nyl., Flora 55: 354 (1872). PL. 2F
Thallus yellowish gray or whitish gray, crustose to subsquamulose, surface
smooth and epruinose, without soredia, verrucose-areolate or dispersed-
areoles. Apothecia 0.4-1.5(-2.0) mm in diam., red-brown to brown, plane,
epruinose, subimmersed to sessile; margins concolorous with thallus, thin
or thick, persistent, entire or flexuose, even and entire; amphithecium with
large crystals insoluble in K; epithecium without crystals, red-brown to
orange-brown; hymenium hyaline, c. 60 um high, paraphyses with a clear cap;
subhymenium hyaline, c. 20 um. Ascospores, hyaline, simple, ellipsoid, 9-15 x
5-7 um. Pycnidia not seen.
SPOT TESTS — thallus: K+ yellow, C-, KC-, P+ light orange.
SECONDARY METABOLITES — atranorin, 2’-O-methylperlatolic acid.
SPECIMEN EXAMINED — SOUTH KOREA. JEONAM: JINDO COUNTY, Seaside, 34°32.910'N
126°18.697’E, alt. 3 m, on rock, 2 Jun. 2011, Hur 110461, 110466 (KoLRI).
ComMENTS — Lecanora pseudistera is very similar to L. campestris, which has
small crystals in the amphithecium and lacks 2’-O-methylperlatolic acid.
Reported from Europe, the Americas, Asia, South Africa, and Australasia
(Lumbsch & Elix 2004), L. pseudistera is new to South Korea.
New lichen records for South Korea ... 427
Lecanora strobilina (Spreng.) Kieff., Bull. Soc. Hist. Nat. Metz 19: 72 (1895). PL. 3a
Thallus greenish gray to yellowish gray, crustose, without soredia, poorly
developed or granular-warted with areoles or rimose; areoles convex, 0.1
— 0.2 mm in diameter; Apothecia rounded or slightly irregular in outline,
rarely single, mostly densely crowded, 0.30-0.40 mm in diam.; disc yellowish
ochre to orange-brown, flat to moderately or rarely strongly convex, dull,
finely white pruinose; margin white, pale gray or more rarely of same color
as the thallus. Amphithecium present, with an algal layer filled with small
granules; epihymenium orange-brown; hymenium hyaline, (35-)40-50 um
tall; subhymenium hyaline. Ascospores hyaline, simple, narrowly ellipsoid,
(8.5-)10.6-12.4(-16.5) x (3—)3.3-3.8(-4.5) um.
SPOT TESTS — thallus: K-, C-, KC-, P-.
SECONDARY METABOLITES — usnic acid, decarboxysquamatic acid, +
zeorin.
SPECIMEN EXAMINED — SOUTH KOREA. JEONAM: JINDO COUNTY, Jeob-do Island,
34°23.091'N 126°18.250'E, alt. 2 m, on the Pinus bark from the coastal region, 3 Jun.
2011, Hur 110513 (KoLRI); Hachodo Island, 34°16.592'N 126°04.215’E, alt. 22 m, on the
Pinus bark from the coastal region, 23 Aug. 2011, Hur 110854 (KoLRI); SHINAN COUNTY,
Bogil Island, 34°09.275'N 126°34.740’E, alt. 3 m, on the Pinus bark from the coastal
region, 23 Jun. 2011, Hur 110635 (KoLRI); Palgeum Island, 35°47.790'N 126°10.173’E,
alt. 1 m, on the Pinus bark from the coastal region, 2 Jun. 2011, Hur 110392 (KoLRI).
Comments — Lecanora strobilina is very similar to L. confusa but distinguished
by absence of xanthones and lower hymenium (not exceeding 70 um).
Reported from Europe, Macaronesia, North America, Asia, and Africa
(Smith et al. 2009), L. strobilina is new to South Korea.
Lecidea varians Ach., Syn. Meth. Lich.: 38 (1814). PL. 3B
Thallus grayish green to yellowish green, thin, without soredia, mostly
continuous, sometimes warted-aerolate, rimose or rarely endosubstratal thallus.
Apothecia small and rounded, 0.15-0.4 mm in diam., often in groups of 3-5,
sessile; disc brown to reddish brown, with or without white pruina, plane to
weakly convex; margin weakly prominent and soon excluded or lacking from
the beginning; exciple brown at the outer edge, hyaline interior; epihymenium
brown; hymenium hyaline, 50-70 um high, subhymenium and hypothecium
hyaline. Asci Lecanora-type, ascospores hyaline, simple, ellipsoid to broadly
ellipsoid, 8-13 x (4-)5-7 um.
SPOT TESTS — thallus: K+ yellow, C-, P-, UV+ orange.
SECONDARY METABOLITES — atranorin, xanthones.
SPECIMEN EXAMINED — SOUTH KOREA. GYEONGNAM: TONGYEONG CITY, Salyang
Island, 34°51.045'N 128°12.364’E, alt. 45 m, on the Prunus bark from the coastal region,
20 Apr. 2011, Hur 110035 (KoLRI).
428 ... Zhang & al
Comments — Although L. varians does not belong to Lecidea s. str., we retain
it here because its generic position is still unclear.
Reported from North America and Europe (Nash et al. 2004), L. varians is
new to South Korea and Asia.
Ochrolechia tartarea (L.) A. Massal., Ric. auton. lich. crost.: 30 (1852). PL..3¢
Thallus pale to dark gray, often very thick, to 3 mm or more, surface soft,
powdery-tartareous, often with numerous irregular warts forming an uneven
corrugate crust, sometimes with a paler zoned margin and a pale prothallus.
Apothecia usually frequent, immersed and closed at first, becoming rounded
or irregular, scattered or crowded, sessile; thalline exciple thick, wavy; disc to
5 mm diam., pale brown to dull orange-pink, concave to flat, the surface often
scabrose-roughened; epihymenium granular, the granules dissolving in K;
hymenium 200-300 um; hypothecium light yellow. Ascospores (30-) 40-70 x
20-40 um, broadly ellipsoid.
SPOT TESTS — cortex and medulla: K-, C+ pink, KC+ red, Pd-; apothecial
disc C+ red.
SECONDARY METABOLITES — gyrophoric acid, lecanoric acid.
SPECIMENS EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, Mt.
Daebang, 34°51.006'N 127°59.427'E, alt. 87 m, on rock, 20 Apr. 2011, Hur 110274
(KoLRI). JEonAm: WANDO Country, Cheongsan Island, 34°09.187'N 126°52.821’E, alt. 2
m, on rock, 23 Jun. 2011, Hur 110733 (KoLRI).
CoMMENTS — Its tartareous C+ pink thallus distinguishes O. tartarea from the
morphologically similar O. parella, which produces a thallus that is fissured
and C + yellow.
Reported from Europe, Macaronesia, North America, Asia, Africa, and
subantarctic (Galloway 2007, Smith et al. 2009), O. tartarea is new to South
Korea.
Pertusaria flavicans Lamy, Bull. Soc. bot. Fr. 25: 427 (1878). PL. 3D
Thallus crustose, epilithic, rather thick, surface roughened, irregularly
coarsely warted, usually continuous, slightly rimose to areolate, yellowish gray
to light yellowish; areoles irregular in shape or rounded, flat or sometimes
slightly convex, <1 mm in diameter, sometimes papillae present; prothallus
absent; yellow soralia on the surface, abundant, 0.5-1 mm in diameter, often
gathered in the central part of the thallus, color paler than the thallus, coarsely
granular; isidia absent. Apothecia and pycnidia not seen.
Spot TESTS — thallus: K-, C+ orange, KC+ orange, P-.
SECONDARY METABOLITES — norstictic acid, salazinic and xanthones (UV+
orange).
New lichen records for South Korea ... 429
PLATE 3. Habit of newly recorded lichens. A. Lecanora strobilina, Hur 110513; B. Lecidea varians,
Hur 110035; C. Ochrolechia tartarea, Hur 110274; D. Pertusaria flavicans, Hur 110259; E. Ramalina
sekika, Hur 110645; F. Xanthoparmelia congensis, Hur 110949. Scale bars = 5 mm.
SPECIMENS EXAMINED — SOUTH KOREA. GYEONGNAM: TONGYEONG CITY, Salyang
Island, 34°51.016’N 128°11.985’E, alt. 300 m, on rock, 20 Apr. 2011, Hur 110050
(KoLRI). JEonAm: WANDO country, Cheongsan Island, 34°12.218'N 126°54.357'E, alt. 5
m, on rock, 23 Jun. 2011, Hur 110757 (KoLRI). JEONBUK: GUNSAM CITY, Shinsi Island,
35°49.091'N 126°28.159’E, alt. 141 m, on rock, 22 Aug. 2011, Hur 110780 (KoLRI).
430 ... Zhang & al
ComMEnts — Pertusaria flavicans is easily recognized by its yellowish (UV+
orange) thallus, yellow soralia, and growth only in the coastal rocks.
Reported from Europe, Macaronesia, and Asia (Smith et al. 2009), Pertusaria
flavicans is new to South Korea.
Ramalina sekika Asahina, Journ. Jap. Bot. 17: 138 (1941). PL. 3E
Thallus growing on the rock, fruticose, erect and forming tufts, attached by a
basal holdfast, surface dull yellowish green or grayish green, turning brownish
near the base, 1-3 cm long, with a few branches; branch 2-5 mm wide,
flattened and solid, wider in the middle part, irregularly branched near the tips;
surface rather scabrid, covered with numerous pseudocyphellae surrounded by
granules, the other side of the surface often smooth and yellowish; cortex thin,
composed of thick-walled hyphae, medulla white; Apothecia and pycnidia not
found.
SPOT TESTS — cortex: K-, C-, KC+ yellow; medulla: K-, C-, KC+ pale red.
SECONDARY METABOLITES — usnic, sekikaic, 4’-O-demethylsekikaic and
+salazinic acids.
SPECIMENS EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, seaside,
34°48.853'N 127°49.698’E, alt. 2 m, on rock, 28 Apr. 2011, Hur 110219 (KoLRI). JEONAM:
YEONGGWANG COUNTY, West seaside, 35°19.635'N 126°22.695’E, alt. 2 m, on rock, 1
Jun. 2011, Hur 110299 (KoLRI); WANDo county, Cheongsan Island, 34°09.187'N
126°52.821'E, alt. 2 m, on rock, 23 Jun. 2011, Hur 110707 (KoLRI).
ComMENTS — Ramalina sekika usually grows together with R. pollinaria; both
species have similar habitat and morphology, but R. pollinaria has fine soralia
on the surface and marginal part, while R. sekika has rough surface covered
with pseudocyphellae and usually contains salazinic acid.
Reported from China and Japan (Asahina 1941, Wei 1991), Ramalina sekika
is new to South Korea.
Xanthoparmelia congensis (J. Steiner) Hale, Phytologia 28: 486 (1974). PL. 3F
Thallus foliose, tightly adnate on the rock, 2-5 cm broad, dark yellowish
green in the central part, turning light yellow-green near the tips; lobes rather
narrow, sublinear, 0.2-0.6 mm wide, sometimes branched, tips subrounded to
rounded; upper surface shiny, covered with dense globose isidia, <0.1 mm in
diameter, paler than the thallus, mainly in the central part of the thallus, tip part
sometimes bursting open but not becoming sorediate, without any branches;
medulla white; lower surface black and shiny, plane and smooth, black rhizines
sparse, simple, c. 0.3 mm long; Apothecia and pycnidia not seen.
SPOT TESTS — cortex: K-, C-, KC-, P+ orange; medulla: K+ yellow to red,
C-, KC-, P+ orange.
SECONDARY METABOLITES — stictic acid (major), constictic, cryptostictic,
norstictic, menegazziaic and usnic acid.
New lichen records for South Korea... 431
SPECIMENS EXAMINED — SOUTH KOREA. JEONAM: GOHONG COUNTY, Wenaro Island,
34°27.236'N 127°31.153’E, alt. 8 m, on rock, 24 Aug. 2011, Hur 110219 (KoLRI). SHINAN
COUNTY, Heuksan Island, 34°39.882'’N 125°26.189’E, alt. 5 m, on rock, 21 Jun. 2011, Hur
110557 (KoLRI).
CoMMENTs — Compared with other Korean Xanthoparmelia species, X. congensis
is relatively small in size and found only in the seaside rocks. It might be
confused with X. orientalis, which also has the black lower surface, which is
distinguished by its larger lobes (1-2. 5 mm) and different chemical compounds
(usnic acid, salazinic acid, consalazinic acid, and trace of norstictic acid).
Reported from Mexico, South Africa, Australia, India and China (Hale
1990), Xanthoparmelia congensis is new to South Korea.
Acknowledgements
This work was supported by a grant from Korea National Research Resource Center
Program (Grant 2010-0000660), Korean Forest Service Program (KNA 2010) through
Korea National Arboretum, and the founding of key laboratory, CAS (KLBB-201210).
We thank Dr. Sergey Kondratyuk (M.H. Kholodny Institute of Botany, Kiev, Ukraine)
and Dr. Shou-Yu Guo (Institute of Microbiology, Chinese Academy of Sciences, Beijing,
China) for kindly reviewing this paper.
References
Asahina Y. 1941. Lichenologische Notizen XVI. Journal of Japanese Botany 17: 136-143.
Galloway DJ. 2007. Flora of New Zealand Lichens. Manaaki Whenua Press, Lincoln. 1046 p.
Hale ME. 1990. A synopsis of the lichen genus Xanthoparmelia (Vainio) Hale (Ascomycotina,
Parmeliaceae). Smithsonian Contributions to Botany 74: 1-250.
http://dx.doi.org/10.5479/si.0081024X.74
Joshi Y, Wang XY, Lee MY, Byun BK, Koh YJ, Hur JS. 2009. Notes on some new records of macro-
and micro-lichens from Korea. Mycobiology 37: 197-202.
http://dx.doi.org/10.4489/MYCO.2009.37.3.197
Joshi Y, Nguyen TT, Wang XY, L6kés L, Koh YJ, Hur JS. 2011. Contribution to the lichen mycota of
South Korea. Mycotaxon 116: 61-74. http://dx.doi.org/10.5248/116.61
Lendemer JC, Morse CA. 2010. Caloplaca yuchiorum (Teloschistaceae, lichenized Ascomycota), a
new sorediate species from North America. Journal of the Torrey botanical Society 137(4):
327-332. http://dx.doi.org/10.3159/10-RA-025.1
Lumbsch HT, Elix JA. 2004. Lecanora. Pp. 12-62, in: PM McCarthy, K Mallett (eds). Flora of
Australia, Vol. 56A, Lichens 4. ABRS and CSIRO Publishing.
Nash TH III, Ryan BD, Diederich P, Gries C, Bungartz F (eds). 2004. Lichen flora of the greater
Sonoran desert region, Vol. 2. Lichens Unlimited, Arizona State University, Tempe, Arizona.
742 p.
Nash TH II, Ryan BD, Gries C, Bungartz F (eds). 2007. Lichen flora of the greater Sonoran desert
region, Vol. 3. Lichens Unlimited, Arizona State University, Tempe, Arizona. 567 p.
Orange A, James PW, White FJ. 2010. Microchemical methods for the identification of lichens. 2nd
edition. London: British Lichen Society.
Park YS. The macrolichen flora of South Korea. 1990. Bryologist 93: 105-160.
http://dx.doi.org/10.2307/3243619
432 ... Zhang & al
Smith CW, Aptroot A, Coppins BJ, Fletcher A, Gilbert OL, James PW, Wolseley PA (eds). 2009. The
lichens of Great Britain and Ireland. Natural History Museum Publications, in association with
The British Lichen Society. 1046 p.
Wei JC. 1991. An enumeration of lichens in China. International Academic Publishers, Beijing.
2TOMD:
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.433
Volume 122, pp. 433-441 October-December 2012
Polyporus submelanopus sp. nov. (Polyporales, Basidiomycota)
from Northwest China
HuI-JUN XUE*? & LI-WEI ZHOU"
'State Key Laboratory of Forest and Soil Ecology, Institute of Applied Ecology,
Chinese Academy of Sciences, Shenyang 110164, P. R. China
*Graduate University of the Chinese Academy of Sciences, Beijing 100049, PB. R. China
* CORRESPONDENCE TO:
[email protected]
ABsTRACT — Polyporus submelanopus, collected from Qinghai Province, Northwest China,
is described and illustrated based on both morphological and phylogenetic analyses. It is
characterized by a terrestrial habit, black-stipitate basidiocarps, circular to angular pores,
two kinds of generative hyphae bearing simple septa and clamp connections respectively,
and cylindrical smooth hyaline basidiospores. Morphologically, P. submelanopus belongs
to the melanopus group and resembles P melanopus in sharing similar pilei with a shallow
central depression, circular to angular pores, basidiospores, and a terrestrial habit. However,
P. melanopus has smaller pores, thicker and entire dissepiment, fusoid cystidioles, and
clamped generative hyphae only. The differences between P. submelanopus and P. badius,
P. xinjiangensis, and P. tubaeformis are discussed as well. Phylogenetic ITS sequence analysis
supports P submelanopus within the melanopus group but distinctly separate from other
sampled species of this group.
Key worps —Polyporaceae, polypore, taxonomy, wood-inhabiting fungi
Introduction
Polyporus P. Micheli ex Adans., type genus of the Polyporaceae, is a well-
known polypore genus. It is characterized by typical formation of stipitate to
substipitate basidiocarps, a dimitic hyphal system with arboriform skeleto-
binding hyphae, smooth cylindrical to subellipsoid inamyloid basidiospores,
and causing a white rot (Gilbertson & Ryvarden 1987, Nunez & Ryvarden
1995).
Nunez & Ryvarden (1995) divided all 32 species of Polyporus into six
morphological groups without taxonomic rank: Admirabilis, Dendropolyporus
[= Dendropolyporus (Pouzar) Jiilich], Favolus (= Favolus Fr.), Polyporellus
(= Polyporellus P. Karst.), Melanopus (= Melanopus Pat.), and Polyporus.
The melanopus group is characterized by coriaceous and _ black-stipitate
434 ... Xue & Zhou
basidiocarps, skeleto-binding hyphae mostly with narrow lumen but solid when
mature, medium to large basidiospores (6-12 x 2-4 um), and growth on dead
woods except for the terrestrial Polyporus melanopus (Pers.) Fr. Since Nufiez
& Ryvarden (1995), some species have been newly described and/or emended
based on morphology (Dai et al. 2003, 2007c, 2009; Sotome et al. 2007; Dai
2012a) or combined morphological and phylogenetic evidence (Sotome et al.
2011).
China is a vast area with varied landscapes and forests inhabited by a high
diversity of wood-decaying fungi. More than 1,200 poroid, corticioid, and
hydnoid taxa have been recorded in China (Dai 2011, 2012b). Polyporus species
have been repeatedly documented from different parts of the country (Dai et
al. 2003, 2004, 2007a,b,c,d, 2009; Dai & Penttila 2006; Cui et al. 2008; Li et al.
2008; Yuan & Dai 2008; Wang et al. 2011), with 36 total species recorded before
this study (Dai 2012b). However, many specimens deposited at the herbarium
of Institute of Applied Ecology, Chinese Academy of Sciences (IFP), are still
not identified to species level. During the re-examination of these specimens,
we found two that match the Polyporus concept but were distinct from any
known species based on both morphological and phylogenetic analyses. They
are described and illustrated here as Polyporus submelanopus.
Materials & methods
The studied specimens are deposited at IFP, China, and Botanical Museum, Finnish
Museum of Natural History (H), Helsinki. The microscopic procedure follows Dai
(2010). Sections were studied at magnifications up to x1000 using a Nikon Eclipse 80i
microscope and phase contrast illumination. Measurements are made from sections
stained with Cotton Blue. In this text, CB stands for Cotton Blue, CB+ for cyanophilous,
CB- for acyanophilous, IKI for Melzer’s reagent, IKI- for negative in Melzer’s reagent,
and KOH for 5% potassium hydroxide. In presenting the variation in the size of the
basidiospores, 5% of measurements were excluded from each end of the range and
given in parentheses. The meanings of other abbreviations are as follows: L = mean
basidiospore length (arithmetic average of all basidiospores), W = mean basidiospore
width (arithmetic average of all basidiospores), Q = variation in the L/W ratios between
the specimens studied, and n = number of basidiospores measured from given number
of specimens. Drawings are made with the aid of a drawing tube. Special color terms
follow Anonymous (1969) and Petersen (1996).
ITS sequences were obtained from herbarium specimens using Phire’ Plant Direct
PCR Kit (Finnzymes Oy, Finland). The primers ITS5 and ITS4 (White et al. 1990)
were used to perform PCR amplifications and subsequent sequencing reactions. Four
newly generated sequences were deposited at GenBank (accession numbers JQ964422-
JQ964425). Other ITS sequences were downloaded from GenBank (TaBLE 1). Polyporus
grammocephalus Berk. and P. pseudobetulinus (Murashk. ex Pilat) Thorn et al. were
selected as outgroup (Kriger et al. 2006). The procedure of phylogenetic analysis was as
below. Firstly, nucleotide sequences were aligned using ClustalX 2.0 (Larkin et al. 2007)
Polyporus submelanopus sp. nov. (China) ... 435
TABLE 1. ITS sequences from Polyporus used in the phylogenetic analysis
SPECIES VOUCHER No.’ ORIGIN GENBANK No.
P. badius - Japan AB587625
- USA AF516558
= USA AF516559
P. guianensis Mont. = Argentina AF516564
- Venezuela AF516566
P leprieurii Mont. - Costa Rica AF516567
P. melanopus = Argentina AF516568
- Argentina AF516569
- Austria AF518759
H 6003449 Finland JQ964422
H 6029190 Finland JQ964423
P. mikawai Lloyd - China AF516570
P. submelanopus IFP 004953 China JQ964424
— (holotype) IFP 004946 China JQ964425
P. tubaeformis - UK AF511438
- UK AF511439
- USA AF511440
ad USA AF511441
= USA AF511442
= Norway AF511443
P. varius (Pers.) Fr. , Germany AF516574
- Germany AF516575
= Russia AF516576
- USA AF516577
- USA AF516578
~ USA AF516579
- USA AF516580
- Japan AB587636
P. grammocephalus - Japan AB587626
P. pseudobetulinus - Japan AB587644
*Provided only for specimens newly sequenced in this study.
with defaulted parameters; secondly, the best-fit evolutionary models for maximum
likelihood (ML) analysis and Bayesian analysis were estimated by jModelTest (Guindon
& Gascuel 2003, Posada 2008) based on corrected Akaike information criterion; finally,
following the optimal models, maximum likelihood (ML) and Bayesian trees were
constructed using PhyML 3.0 (Guindon & Gascuel 2003) and Mrbayes3.2 (Ronquist et
al. 2012), respectively. The ML tree was tested with 100 bootstrap replicates. For Bayesian
analysis, two independent rums were employed. Each run performed a Metropolis-
coupled Markov chain Monte Carlo analysis with four chains for 1,000,000 generations.
Trees were saved per 100th generation. The value of burn-in was set to discard the first
25% trees, and other trees were used to compute a 50% consensus tree and calculate
Bayesian posterior probability.
436 ... Xue & Zhou
Taxonomy
Polyporus submelanopus H.J. Xue & L.W. Zhou, sp. nov. FIG. 1
MycoBAnk MB 800237
Differs from Polyporus melanopus in having two kinds of generative hyphae (one with
simple septa and one with clamp connections), slightly larger pores, thinner and lacerate
dissepiments, and no fusoid cystidioles.
Tye: China, Qinghai Province, Huzhu County, Beishan Forest Farm, on ground in forest
of Picea, 1.1X.2003 Dai 5015 (holotype IFP 004946; GenBank sequence JQ964425).
EryMo.ocy: submelanopus (Lat.): somewhat similar to Polyporus melanopus.
BASIDIOMES: Basidiocarps annual, terrestrial, centrally or laterally stipitate,
solitary. Pilei sometimes slightly infundibuliform, up to 6.2 cm in diam, and
8 mm thick. Pileal surface cinnamon-buff to vinaceous, glabrous, sometimes
wrinkled and faintly zonate when dry; margin acute, concolorous with pileus,
curved down when dry. Pore surface straw-yellow to honey-yellow; pores
circular to angular, 2-3 per mm; dissepiments thin, lacerate. Context white to
cream, soft corky when dry, up to 6 mm thick. Tubes cream to straw-yellow,
decurrent on about three fifths of one side of the stipe with obviously boundary,
up to 2 mm long. Stipe bearing a fuscous to black cuticle, corky, up to 7 cm
long, and 8 mm in diam.
HyPHAL STRUCTURE: Hyphal system dimitic; two kinds of generative hyphae
with one type bearing only simple septa and the other with clamp connections at
each septum; skeletal hyphae arboriform, IKI-, weakly CB+; tissue unchanged
in KOH.
CONTEXT: Generative hyphae common, thin-walled, occasionally branched,
3.5-4 um in diam; arboriform skeletal hyphae frequent, thick-walled with a
wide lumen, moderately branched, aseptate, interwoven, up to 7 um in diam.
TUBES: Generative hyphae frequent, hyaline, thin-walled, frequently
branched and simple septate, clamp connection frequent on the generative
hyphae near the basidia, 1.5-3.5 um in diam; arboriform skeletal hyphae
common, thick-walled with a wide to narrow lumen, moderately branched,
aseptate, interwoven, 1.5-3.2 um in diam; cystidia and cystidioles absent;
basidia clavate, but narrower towards the base, hyaline, thin-walled, bearing
a basal clamp connection and four sterigmata, 24-33 x 5-8 um; basidioles in
shape similar to basidia, but slightly smaller.
STIPE: Generative hyphae scanty; arboriform skeletal hyphae dominant,
thick-walled with a narrow or wide lumen, moderately branched, aseptate,
strongly interwoven, 1.5-7 um in diam. Hyphae in black crust similar to those
in stipe.
Spores: Basidiospores cylindrical, hyaline, thin-walled, smooth, bearing a
large guttule. IKI-, CB-, (7.8-—)8-10(-10.5) x 3-3.9(-4) um, L = 8.95 um, W = 3.38
um, Q = 2.63-2.67 (n = 60/2).
Polyp
SOON
Gp y/o
In avd
WAN Eris
[7 \\
»
LL
orus submelanopus sp. nov. (China) ... 437
a
ENS
5 ym
is
Cc
Op
A\at
SA] 5
Fic. 1. Polyporus submelanopus (holotype).
: Basidi : Basidia and basidioles.
spores. b: B
a: Basidiospores.
c: Hyphae from context. d: Hyphae from trama.
438 ... Xue & Zhou
ADDITIONAL SPECIMEN EXAMINED: CHINA, QINGHAI PROVINCE, HuzZHU COUNTY,
Beishan Forest Farm, on ground in forest of Picea, 1.[X.2003 Dai 4997 (IFP 004953;
GenBank sequence JQ964424).
REMARKS: Polyporus submelanopus is characterized by a terrestrial habit,
centrally or laterally black-stipitate basidiocarps, straw-yellow to honey-yellow
pore surface, circular to angular pores, two types of generative hyphae bearing
either simple septa or clamp connections, and cylindrical basidiospores with a
large guttule. Its black stipe and medium basidiospore size match the concept
of the melanopus group (Nufiez & Ryvarden 1995).
Polyporus melanopus resembles P. submelanopus in its similar pileus with a
shallow central depression, circular to angular pore shape, basidiospores, and
terrestrial habit. However, P. melanopus has slightly smaller pores (3-4 per mm,
Gilbertson & Ryvarden 1987; 3-5 per mm, Bernicchia 2005; 3-4(-5) per mm,
Boulet 2007), thicker and entire dissepiments, fusoid cystidioles, and generative
hyphae bearing clamp connections only (Gilbertson & Ryvarden 1987).
Polyporus badius (Pers.) Schwein., a species with simple-septate generative
hyphae, is distinguished from P submelanopus in darker pilei and smaller
pores (5-8 per mm, Nufiez & Ryvarden 1995). In addition, P. badius is a wood-
inhabiting species rather than a terrestrial one.
Polyporus xinjiangensis J.D. Zhao & X.Q. Zhang, originally described from
China, has generative hyphae bearing simple septa like P submelanopus but
produces no generative hyphae with clamp connections (Dai et al. 2007b);
P. xinjiangensis further differs in its wood-inhabiting habit and slightly shorter
basidiospores (7.1-8.5 um long, Dai et al. 2007b).
Macroscopically, P. submelanopus shares similar infundibuliform pilei, a
straw-yellow to pale brownish pore surface, and sharp margin with P tubaeformis
(P. Karst.) Ryvarden & Gilb., which is distinguished by possession of cystidioles
and smaller pores [6-9(-10) per mm, (n = 150/5)] and basidiospores [(5.8-)
6-7.8(-8.2) x (2.1-)2.3-3.2(-3.5) um, L = 6.49 um, W = 2.75 um, Q = 2.27-2.50
(n = 150/5), Dai 1996]. Besides, P tubaeformis has only clamped generative
hyphae and grows on wood rather than ground.
Our ITS dataset had 694 characters. Its best-fit evolutionary models for ML
and Bayesian analyses were estimated as TrN + G and HKY + G, respectively.
The phylogenetic tree (Fic. 2) formed of most members of melanopus group
clusters P submelanopus as a distinct clade within this group. Although
we unfortunately failed to obtain an ITS sequence from P. xinjiangensis, the
ecological habit and morphological differences above are enough to distinguish
P. submelanopus from P. xinjiangensis.
Fic. 2. The phylogenetic tree inferred from ITS sequences of the members of Melanopus group.
Topological structure was from ML analysis. The statistical values both above 75% of bootstrap
value and 0.95 of Bayesian posterior probability are indicated.
Polyporus submelanopus sp. nov. (China) ... 439
P. tubaeformis AF511439
P. tubaeformis AF511438
P. tubaeformis AF511443
P. tubaeformis AF511440
96/1.00
P. tubaeformis AF511441
P. tubaeformis AF511442
P. melanopus JQ964423
tan P. melanopus JQ964422
P. melanopus AF 518759
P. melanopus AF 516569
P. melanopus AF 516568
95/1.00 P. badius AB587625
P. badius AB516559
P. badius AB516558
P. submelanopus JQ964425
100/1.00| P submelanopus JQ964424
P. guianensis AF516566
100/1.00
90/1.00 P. guianensis AF516564
P. leprieurii AF516567
94/1.00- P. varius AF516576
P. varius AF516574
100/1.00 100/1.00) | P varius AB587636
P. varius AF516575
P. varius AF516580
P. varius AF516579
P. varius AF516578
P. varius AF516577
P. mikawai AF516570
P. grammocephalus AB587626
aL P. pseudobetulinus AB587644
0.05
440 ... Xue & Zhou
The ITS tree also shows that the current concept of P. melanopus is not
monophyletic. Five ITS sequences of P melanopus formed two clades according
to the specimens’ origins. One clade comprised three European isolates, while
two isolates from Argentina formed the other clade. Moreover, P. melanopus
was described as a diverse species in pore and basidiospore size (Gilbertson &
Ryvarden 1987, Bernicchia 2005, Niemela 2005, Kriiger et al. 2006, Boulet 2007).
Therefore, more investigations are needed to clarify the exact circumscription
of P. melanopus.
Acknowledgements
We express our gratitude to Drs. Deepika Kumari (Directorate of Mushroom
Research, India), Bao-Kai Cui (Beijing Forest University, China), and Kozue Sotome
(Tottori University, Japan) who reviewed the manuscript prior to submission. The
research was financed by the National Natural Science Foundation of China (Project
No. 30910103907).
Literature cited
Anonymous. 1969. Flora of British fungi. Colour identification chart. Her Majesty’s Stationery
Office, London. 1 p.
Bernicchia A. 2005. Polyporaceae s.]. fungi Europei vol. 10. Edizioni Candusso, Alassio. 808 p.
Boulet B. 2007. Défauts et indices de la carie des arbres. 2e Edition. Les publications du Québec,
Québec. 317 p.
Cui BK, Yuan HS, Dai YC. 2008. Wood-rotting fungi in eastern China 1. Polypores from Wuyi
Mountains, Fujian Province. Sydowia 60: 25-40.
Dai YC. 1996. Changbai wood-rotting fungi 5. Study on Polyporus mongolicus and P. tubaeformis.
Annales Botanici Fennici 133: 153-163.
Dai YC. 2010. Hymenochaetaceae (Basidiomycota) in China. Fungal Diversity 45: 131-343.
http://dx.doi.org/10.1007/s13225-010-0066-9
Dai YC. 2011. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience
52: 69-79. http://dx.doi.org/10.1007/s10267-010-0068-1
Dai YC. 2012a. Two new polypores from tropical China, and renaming two species of Polyporus
and Phellinus. Mycoscience 53: 40-44. http://dx.doi.org/10.1007/s10267-011-0135-2
Dai YC. 2012b. Polypore diversity in China with an annotated checklist of Chinese polypores.
Mycoscience 53: 49-80. http://dx.doi.org/10.1007/s10267-011-0134-3
Dai YC, Penttila R. 2006. Polypore diversity of Fenglin Nature Reserve, northeastern China.
Annales Botanici Fennici 43: 81-96.
Dai YC, Yuan HS. 2007. Type studies on polypores described by G. Y. Zheng and Z. S. Bi. from
southern China. Sydowia 59: 25-31.
Dai YC, Yuan HS. 2010. Type studies on polypores described by J. D. Zhao. Annales Botanici
Fennici 47: 113-117.
Dai YC, Harkénen M, Niemela T. 2003. Wood-inhabiting fungi in southern China 1. Polypores
from Hunan Province. Annales Botanici Fennici 40: 381-393.
Dai YC, Wei YL, Wang Z. 2004. Wood-inhabiting fungi in southern China 2. Polypores from
Sichuan Province. Annales Botanici Fennici 41: 319-329.
Dai YC, Cui BK, Yuan HS. 2007a. Notes on polypores from Gansu and Qinghai Province, Northwest
China. Cryptogamie Mycologie 28: 177-187.
Polyporus submelanopus sp. nov. (China) ... 441
Dai YC, Wei YL, Yuan HS, Huang MY, Penzina T. 2007b. Polypores from Altay and Tian Mts. in
Xinjiang, northwest China. Cryptogamie Mycologie 28: 269-279.
Dai YC, Yu CJ, Wang HC. 2007c. Polypores from eastern Xizang (Tibet), western China. Annales
Botanici Fennici 44: 135-145.
Dai YC, Cui BK, Huang MY. 2007d. Polypores from eastern Inner Mongolia, northeastern China.
Nova Hedwigia 84: 513-520. http://dx.doi.org/10.1127/0029-5035/2007/0084-0513
Dai YC, Yuan HS, Wang HC, Yang F, Wei YL. 2009. Polypores (Basidiomycota) from Qin Mts. in
Shaanxi Province, Central China. Annales Botanici Fennici 46: 54-61.
Gilbertson RL, Ryvarden L. 1987. North American polypores 2. Megasporoporia — Wrightoporia.
Fungiflora, Oslo. pp. 434-885.
Guindon S, Gascuel O. 2003. A simple, fast and accurate method to estimate large phylogenies by
maximum-likelihood. Systematic Biology 52: 696-704.
http://dx.doi.org/10.1080/10635150390235520
Kriiger D, Petersen RH, Hughes KW. 2006. Molecular phylogenies and mating study data in
Polyporus with special emphasis on group “Melanopus” (Basidiomycota). Mycological Progress
5: 185-206. http://dx.doi.org/10.1007/s11557-006-0512-y
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,
Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and
Clustal X version 2.0. Bioinformatics 23: 2947-2948.
http://dx.doi.org/10.1093/bioinformatics/btm404
Li J, Xiong HX, Dai YC. 2008. Polypores from Shennongjia Nature Reserve in Hubei Province,
Central China. Cryptogamie Mycologie 29: 267-277.
Niemela T. 2005. Polyporus, lignicolous fungi. Norrlinia 13: 1-320. [in Finnish, with English
summary]
Nujiez M, Ryvarden L. 1995. Polyporus (Basidiomycotina) and related genera. Synopsis Fungorum
10: 1-85.
Petersen JH. 1996. Farvekort. The Danish Mycological Society’s colour-chart. Foreningen til
Svampekundskabens Fremme, Greve. 6 p.
Posada D. 2008. jModelTest: Phylogenetic model averaging. Molecular Biology and Evolution 25:
1253-1256. http://dx.doi.org/10.1093/molbev/msn083
Ronquist F, Teslenko M, van der Mark P, Ayres D, Darling A, Hohna S, Larget B, Liu L, Suchard
MA, Huelsenbeck JP. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model
choice across a large model space. Systematic Biology 61: 539-542.
http://dx.doi.org/10.1093/sysbio/sys029
Sotome K, Hattori T, Kakishima M. 2007. Polyporus phyllostachydis sp. nov. with notes on other
rhizophilic species of Polyporus (Basidiomycota, Polyporaceae). Mycoscience 48: 42-46.
http://dx.doi.org/10.1007/s10267-006-0328-2
Sotome K, Hattori T, Ota Y. 2011. Taxonomic study on a threatened polypore, Polyporus
pseudobetulinus, and a morphologically similar species, P subvarius. Mycoscience 52: 319-326.
http://dx.doi.org/10.1007/s10267-011-0111-x
Wang B, Cui BK, Li HJ, Du P, Jia BS. 2011. Wood-rotting fungi in eastern China 5. Polypore
diversity in Jiangxi Province. Annales Botanici Fennici, 48: 237-246.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322 in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. Academic Press, San Diego.
Yuan HS, Dai YC. 2008. Polypores from northern and central Yunnan Province, Southwestern
China. Sydowia 60: 147-159.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.443
Volume 122, pp. 443-447 October-December 2012
A new species of Clitopilus from southwestern China
WANG-Q!1u DENG, Tal-Hu1 Li, Ya-HENG SHEN
Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application,
Guangdong Open Laboratory of Applied Microbiology & State Key Laboratory of Applied
Microbiology (Ministry—Guangdong Province Jointly Breeding Base), South China,
Guangdong Institute of Microbiology, Guangzhou 510070, China
“CORRESPONDENCE TO:
[email protected]
ABSTRACT — Clitopilus ravus is described and illustrated as a new species from southwestern
China. It is characterized by its tawny gray or grayish brown to brown tomentose pileus,
absence of pleuro- and cheilocystidia, subfusiform to amygdaliform basidiospores with
4-5 prominent longitudinal ridges, and cylindric or clavate terminal cells of the pileipellis
filled with brown non-encrusting intracellular pigment. Comparisons with similar taxa and
photographs and drawings of its macroscopical and microscopical characters are provided.
KEY worpDs — taxonomy, Entolomataceae, macrofungi
Introduction
The genus Clitopilus (Fr. ex Rabenh.) P. Kumm. traditionally encompasses
three sections: Clitopilus, Pleurotelloides, and Scyphoides. Section Clitopilus is
characterized by its medium-sized to rather large basidiomata, distinct and
persistent stipe, spores with mostly six reinforced longitudinal angles and
usually 10-14 um long (Singer 1986). Seven species have been reported in sect.
Clitopilus: C. prunulus (Scop.) P. Kumm., C. lignyotus Hongo, C. quisquiliaris
(P. Karst.) Noordel., C. paxilloides Noordel., C. griseobrunneus T.J. Baroni &
Halling, C. amygdaliformis Zhu L. Yang, and C. chrischonensis Musumeci et
al. (Singer 1946; Hongo 1954; Noordeloos 1982, 1993; Baroni & Halling 2000;
Yang 2007; Vizzini et al. 2011).
We describe and illustrate here a new species of sect. Clitopilus discovered
during re-examination of Clitopilus specimens collected from Yunnan
Province.
Materials & methods
Specimens were annotated and photographed in the field, and dried in an electric
drier. Color description was according to Kornerup & Wanscher (1978). We examined
444 ... Deng, Li & Shen
spores, basidia, and cystidia in 5% KOH or 1% Congo Red and the pileipellis in 5% KOH.
Basidiospore dimensions follow the notation (a—)b-c(-d), with at least 25 basidiospores
measured and with the range b-c representing 90% or more of the measured values
and the extreme values ‘a’ and ‘d’ given in parentheses. Abbreviations are L_ = average
length of all basidiospores + sample standard deviation, W., = average width of all
basidiospores + sample standard deviation, Q = individual basidiospore length/width
ratio, Q. = average Q of all basidiospores + sample standard deviation, and n = number
of spores measured per specimen.
Micrographs were taken using an Olympus BX51 trinocular phase contrast
microscope and a Philips FEI-XL30 scanning electron microscope. The dried studied
specimens are deposited in the Herbarium of Cryptogams, Kunming Institute of Botany,
Chinese Academy of Sciences (KUN, with HKAS numbers).
Taxonomy
Clitopilus ravus W.Q. Deng & T.H. Li, sp. nov. FIG. 1
MycoBank MB 800634
Differs from C. griseobrunneus by its much smaller basidiospores and non-encrusting
pigment in pileipellis.
Type: China, Yunnan Province, Jingdong County, Ailaoshan National Nature Reserve,
14 July 2008, Yanchun Li 1213 (Holotype, HKAS 56067).
ETyMOLOGy: ravus refers to the tawny gray or grayish brown color of pileus and stipe.
PiLEus 30-40 mm broad, convex at first, then applanate, tawny gray or grayish
brown to brown (6D3, 6D-E5); brown (6E5) overall under lens, tomentose;
margin incurved, not striate. LAMELLAE white but soon pale flesh-pink to pink
(7A1-2), decurrent, close to crowded; edges concolorous and even; lamellulae
numerous. STIPE paler than pileus to partially concolorous with pileus, orange
gray (6B2), brownish orange (6C3) to light brown (6D4), with white (6A1)
cottony mycelium at the base, 35-45 mm long, 4-6 mm thick at the apex, 7-12
mm thick at the base, tomentose, inconspicuously striate, central to slightly
eccentric, often slightly curved, cylindrical, usually broadening towards base.
CONTEXT white (6A1), unchanging when bruised or exposed to air.
BASIDIOSPORES 11-13(-14) x (5-)5.5-6.5(-7) um, (n = 25, L. = 12.02/+
/0.96, W_ = 6.06/+ 0.46, Q = (1.57—)1.83-2.33(-2.80), Q_ = 1.99 + 0.25), slightly
pinkish to nearly colorless and hyaline, slightly thick-walled, amygdaliform
or subfusiform with longitudinal ridges in profile and face views, angular
in polar view with 4-5 facets separated by obvious rounded ridges. BAsrD1A
(22-)27-35 x 10-13 um, clavate, hyaline, 4-spored; sterigmata 2.5-3.0 um
long. SUBHYMENIUM composed of hyphal elements 5-9 um in diam. LAMELLAR
TRAMA composed of cylindric, hyaline hyphae 2-6 um in diam. PLEUROCYSTIDIA
and CHEILOCYSTIDIA absent. PILEIPELLIS a trichoderm composed of repent,
cylindric or inflated, 5-11 tm wide hyphae; terminal cells cylindric or clavate,
Clitopilus ravus sp. nov. (China) ... 445
Fic. 1: Clitopilus ravus (holotype).
A. Basidiomata.
B. Basidiospores in LM (x1000). c. Basidiospores under SEM. p. Basidia. E. Pileipellis.
446 ... Deng, Li & Shen
15-38 x 5-11 um; brown, intracellular, non-encrusting pigments, some hyphae
have thickened walls. Clamp connections absent in all tissues.
ECOLOGY & DISTRIBUTION — Solitary or scattered on soil under broadleaf
trees.
COMMENTS — Clitopilus ravus is characterized by its tawny gray or grayish brown
to brown tomentose pileus, absence of pleuro- and cheilocystidia, subfusiform
to amygdaliform basidiospores with 4-5 prominent longitudinal ridges, and
pileipellis cylindric or clavate terminal pileipellis cells filled with brown non-
encrusting intracellular pigment. We place the new species in Clitopilus sect.
Clitopilus based on its well-developed stipe and large basidiospores with fewer
than 7 prominent longitudinal ridges (Singer 1986).
Basidiomes are easily distinguished from the white or pale grayish
basidiomata of C. prunulus, C. amygdaliformis and C. chrischonensis. With
C. lignyotus, C. quisquiliaris, C. paxilloides, and C. griseobrunneus, the new
species represents the fifth gray or brown member of sect. Clitopilus. Although
somewhat similar to C. ravus in color and stature, C. lignyotus is distinguished
by a clitocybe-like or (often) phylloporus-like appearance and slightly smaller
basidiospores (9.5-13 x 4.5-6.0 um) with 6 longitudinal ridges (Hongo 1954).
Clitopilus quisquiliaris differs distinctly in its reddish brown or fuscous brown
pileus and smaller basidiospores (8-9.5 x 4.0-5.0 um) (Noordeloos 1982;
Hansen & Knudsen 1992); C. paxilloides has a weakly hygrophanous gray-
brown pileus with numerous gray-brown spots, a strongly tapering stipe base,
and obviously encrusted hyphae in the pileipellis (Noordeloos 1993); and
C. griseobrunneus has much larger basidiospores (9.7-16.9 x 5.7-7.9 um) with
(5-) 6 (-7) longitudinal ridges and encrusted hyphae in the pileipellis (Baroni
& Halling 2000).
Acknowledgments
The authors are grateful to Prof. Zhu L. Yang (Kunming Institute of Botany of the
Chinese Academy of Sciences, KIB) and Dr. Genevieve M. Gates (University of Tasmania)
who reviewed the manuscript, and also to Dr. Yan-Chun Li (KIB) for providing the
photo of the fruiting body in this study. The research was supported by the National
Natural Science Foundation of China (Project Nos. 30970023, 31170026, 30499340 and
31070024), and the Foundation of Guangdong Academy of Sciences, China for 2008
Outstanding Young Science and Technology Talents.
Literature cited
Baroni TJ, Halling RE. 2000. Some Entolomataceae (Agaricales) from Costa Rica. Brittonia 52:
121-135. http://dx.doi.org/10.2307/2666502
Hansen L, Knudsen H. 1992. Nordic Macromycetes. Vol. 2. Polyporales, Boletales, Agaricales,
Russulales. Nordsvamp, Copenhagen.
Hongo T. 1954. Note on Japanese larger fungi (5). Journal of Japanese Botany 29(3): 87-92.
Clitopilus ravus sp. nov. (China) ... 447
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. Eyre Methuen: London.
Noordeloos ME. 1982. Studies in Entoloma 1-5. International Journal of Mycology and Lichenology
1(1): 49-60.
Noordeloos ME. 1993. Studies in Clitopilus (Basidiomycetes, Agaricales) in Europe. Persoonia 15:
241-248.
Singer R. 1946. The Boletineae of Florida with notes on extralimital species IV. The lamellate
families (Gomphidiaceae, Paxillaceae and Jugasporaceae). Farlowia 2: 427-567.
Singer R. 1986. The Agaricales in modern taxonomy. 4th ed. Koeltz Scientific Books: Koenigstein
(Germany).
Vizzini A, Musumeci E, Ercole E, Contu M. 2011. Clitopilus chrischonensis sp. nov. (Agaricales,
Entolomataceae), a striking new fungal species from Switzerland. Nova Hedwigia 92(3-4):
425-434. http://dx.doi.org/10.1127/0029-5035/2011/0092-0425
Yang ZL. 2007. Clitopilus amygdaliformis, a new species from tropical China. Mycotaxon 100:
241-246.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.449
Volume 122, pp. 449-460 October-December 2012
Arthrinium rasikravindrii sp. nov.
from Svalbard, Norway
SHIV M. SINGH’, LAL S. YADAV’, PARAS N. SINGH’, RAHUL HEPAT’,
RAHUL SHARMA? & SANJAY K. SINGH?*
"National Centre for Antarctic and Ocean Research, Vasco Da Gama, Goa, India
?National Facility for Culture Collection of Fungi, MACS’ Agharkar Research Institute,
G.G. Agarkar Road, Pune, India
CORRESPONDENCE TO *:
[email protected]
ABSTRACT — Arthrinium rasikravindrii sp. nov. was isolated from soil collected in the arctic
archipelago Svalbard, Norway. The new species, distinguished by morphological and in
vitro cultural characters, forms dark brown lenticular conidia with hyaline equatorial germ
slits together with balloon-shaped, anomalous conidia uncommon in the morphologically
similar A. phaeospermum. Additionally, internal transcribed spacer (ITS) rDNA sequence
analyses support this species as distinct within Arthrinium. Isolates previously identified as
A. phaeospermum from China and Japan are re-determined as A. rasikravindrii.
Kry worps — anamorphic fungi, Ny-Alesund, phylogeny, taxonomy
Introduction
The study of fungal diversity in soils from Svalbard, Norway (Elvebakk et
al. 1996, Aarnzes 2002, Kurek et al. 2007), has led to the discovery of novel
genera and species from this region (Pang et al. 2008, 2009). During research
of the soil mycobiota of this Arctic region, a previously unknown Arthrinium
was isolated from a soil sample. Arthrinium Kunze was established in 1817
with A. caricicola Kunze as the type species (Kunze 1817). The genus currently
comprises about 31 species worldwide (Kirk et al. 2008), of which 13 have been
reported from Svalbard (Aarnzes 2002). Most Arthrinium species produce dark,
non-septate, mostly lenticular conidia with a hyaline rim or germ slit. Since
Ellis (1965, 1971, 1976) extensively treated the genus, several species have
been added (Calvo & Guarro 1980, Larrondo & Calvo 1990, 1992). This paper
describes and illustrates another new Arthrinium species isolated from arctic
soil near Svalbard, Norway.
450 ... Singh & al.
Materials & methods
Sampling site
The soil sample was collected from Ny-Alesund (78°55’N 11°56’E) on the west
coast of Spitsbergen, the largest island in the Svalbard archipelago. Topographically,
Ny-Alesund includes east and west glaciers, terminal moraines, and glacial streams
and rivers flowing towards Kongsfjord. The sampling site was situated near an Austre
Broggerbeen glacier (78°55.082'N 11°51.527'E). Mean temperatures are -14°C in the
coldest month (February) and 5°C in the warmest month (July-August) (Nygaard
2009). The loose soil texture supports a tundra vegetation (Klimowicz & Uziak 1998).
Isolation, pure culture, and microscopic examination
The soil was sampled from the surface to 5 cm depth from the Ny-Alesund region
during the first (2007) Indian Arctic expedition. The samples were placed in sterile
ampoules (Hi-media) and stored at -20°C until studied. For the isolation of fungi, 1
gm of soil sample was taken and serially diluted up to 10’ (Waksman 1916). A soil
suspension (1 ml) was used as inoculum on four different culture media — Martin's
Rose Bengal medium (MRB), Malt Extract Agar (MEA), Corn Meal Agar (CMA), and
Potato Dextrose Agar (PDA). The plates were incubated at 15°C for 10 days. Colonies
showing different morphological features were purified and transferred onto PDA
slants for further study. Sporulating cultures were identified based on morphology
using standard literature (Ellis 1971, 1976, Carmichael et al. 1980, Domsch et al. 1980,
Larrondo & Calvo 1990, 1992). We recorded and photographed microscopic details from
specimens mounted in lactophenol-cotton blue and distilled water using an OLympus
CX-41 microscope. Fungal structures were measured with an ocular micrometer. A pure
culture is deposited in the National Fungal Culture Collection of India (NFCcI-wpcM
932), MACS’ Agharkar Research Institute, Pune, India.
Polymerase chain reaction (PCR) and sequencing
Total DNA was extracted from a culture grown on a PDA plate for two weeks at
15°C by the high salt DNA extraction method of Aljanbi & Martinez (1997) using Fast
Prep-24 tissue homogenizer (MP Biomedicals GmbH, Germany). ITS fragments were
amplified using primer pairs ITS4 and ITS5 (White et al. 1990). PCR was performed
in a 25 ul reaction using 2 ul template DNA (10-20 ng), 0.5 U Taq DNA polymerase
(Genei, Bangalore, India), 2.5 ul 10X Taq DNA polymerase buffer, 0.5 ul 200 uM of
each dNTP (Genei, Bangalore, India), 0.5 ul 10 pmol primer, H,O (Sterile Ultra Pure
Water, Sigma) qsp 25 ul. Amplification was performed on an Eppendorf Mastercycler
(Eppendorf, Hamburg, Germany) using the following parameters: 5 min step at 95°C,
followed by 30 cycles of 1 min at 95°C, 30s at 56°C, and 1 min at 72°C for ITS region
amplification, then a final 7 min extension step at 72°C. The PCR products were purified
with Axygen PCR cleanup kit (Axygen Scientific Inc, CA, USA) and sequenced using
the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA). The
cycle sequencing products were run on an ABI Avant 3100 automated DNA sequencer
(Applied Biosystems, USA).
Sequence alignment and phylogenetic analysis
Sequence alignment of internal transcribed spacer and 5.8S regions of Arthrinium
sp. (NECCI 2144) was performed using the Clustal W option of the software Molecular
Arthrinum rasikravindrii sp. nov. ... 451
TABLE 1. Percent ITS sequence similarity of Arthrinium rasikravindrii
with Genbank sequences from related Arthrinium species.
CULTURE GENBANK POSITIONS ; TOTAL SIM. W
SPECIES i # : # : withbase : ALIGNED : NFCCI2144
: : changes : SEQUENCE BP : (%)*
A. rasikravindrii i NECCI 2144 i 326454 ss i - i -
ei eeitn : 67 : 503 86.7
pence IMI 326877 AB220242 64 521 87.7
Gees & Calvo CBee 720 AB220252 65 522 87.5
OE ice IMI 326875 AB220243 62 521 88.0
See ae MAFF 236534 AB220270.1 34 347 90.2
A. serenense Larrondo
& Calvo CBS 498.90 AB220240 52 503 89.6
ero Te PARTY A, See Me OCT RA owe VI BO Wile hie gle es Lan el eee Me Anta Ore Bs cles ord,
(Speg.) MB. Ellis CBS 334.86 AB220257 52 503 89.6
sg eer ATCC 76288 AB220238 52 503 89.6
Nigrospora sphaerica : i i
(Sacc.) E.W. Mason 9038 t GRONIO77 © : i
* ITS1-5.8S-ITS2 sequence of NFCCI 2144 was subjected to pairwise alignment using Clustal W.
* Designated as Arthrinium phaeospermum in Genbank
452 ... Singh & al.
Evolutionary Genetics Analysis (MEGA) software v5.0. (Tamura et al. 2011). The
manually edited sequence of NFCcI 2144 was deposited in the NCBI nucleotide sequence
database (JF326454) and subjected to a NCBI BLAST search. The partial ITS sequences
were aligned using Clustal W together with homologous ITS sequences retrieved from
Genbank of the same and related species of Arthrinium (TABLE 1). Due to inconsistent
sequence lengths, portions of the ITS1 and ITS2 were excluded from the analysis. To
calculate the sequence divergence for ITS, the matrix was analyzed with the Neighbour
Joining method (Saitou & Nei 1987) using the Kimura-2 parameter model (Kimura
1980) and Maximum Parsimony method (Tamura et al. 2011). The bootstrap consensus
tree (Felsenstein 1985) was inferred from 1000 replicates, with all gaps and missing data
eliminated from the dataset (Complete Deletion option).
Taxonomy
Arthrinium rasikravindrii Shiv M. Singh, L.S. Yadav, P.N. Singh, Rahul Sharma &
S.K. Singh, sp. nov. FIGS 1, 21-P
MycoBank MB 800216
Differs from Arthrinium phaeospermum by its larger lenticular conidia and its production
of a second elongate type of conidia.
Type: Norway, Svalbard, Spitsbergen, NyAlesund, 78°55’N 11°56’ E, from soil, 27.07.2010,
leg. S.M.Singh, (Holotype, amu 9435 [dried colony on PDA]; ex-type culture, NFCCI
2144; GenBank JF326454).
Erymo.ocy: The specific epithet refers to Dr Rasik Ravindra, director of the
National Centre for Antarctic & Ocean Research and leader of the first Indian Arctic
Expedition.
Conidiophores arising from swollen basal cells, micro-semi-macronematous,
mononematous, straight or flexuous, unbranched, septate, smooth, thin-walled,
hyaline to sub-hyaline, 5-90 x 1—-1.5 um. Conidia arising acropleurogenously,
dimorphous i) lenticular, ovoid in face view, 10-15 x 6.0-10.5 um (n = 50);
ii) elongate to clavate conidia, 15-25 x 7.5—-10 um (n = 50), smooth, double-
walled, brown to pale olivaceous with prominent truncate base and equatorial
germ slit.
Optimum temperature for growth 15-18°C for the arctic holotype (but 25°C
for isolates from China and Japan). Colonies on PDA, medium to fast growing,
45-70 mm in 7 days at 18°C (arctic isolate) or 25°C with white, floccose aerial
mycelium, reverse uncolored, yellow bright to buff (Rayner 1970). Colony of
MAFF410785 slow growing 17.0 mm in 7 days at 25°C, raised dense cottony
unusually different from other strains. Colony pattern differing among all
four strains tested. Individual strains on OA, PCA, and MEA with similar
morphology as on PDA. Sporulation observed after 7 days to 45 days on PCA,
as dark pinhead spots in the aerial mycelium near the periphery and later the
centre of the colony.
TELEOMORPH: not observed.
DISTRIBUTION—China, Japan, Norway.
Arthrinum rasikravindrii sp. nov. ... 453
|
X
—
16kVU XS; 666 Sim 8666 16 36 SEI faku x1:5
Fic. 1. Arthrinium rasikravindrii (NFccI 2144"). a: 7-day old colony on PDA. B-c: Conidia
attached to conidiophores. p: Enlarged anomalous and lenticular conidia. E-F: Conidium and
conidia under SEM.
ADDITIONAL MATERIAL EXAMINED—JAPAN: Fukushima, isolated from leaf of Coffea
arabica, 'T. Sato (MAFEF305708); Chiba, isolated from wood tissue of Pinus thunbergii,
T. Kobayasi (MAFF410785); T. Hasegawa (NBRC6575, I1FO6575).
454 ... Singh & al.
ADDITIONAL SEQUENCED ISOLATES—CHINA: Dalian, isolated from submerged wood
collected from marine coast (DLEN2008007); isolated as endophytes from Oryza
granulata (L10-2-2, L3-4-2). JAPAN: Hiroshima, isolated from stubble of Triticum
aestivum, T. Aoki (MAFF236535, an authentic A. phaeospermum strain).
Discussion
Based on morphological characters and ITS sequence similarity (NCBI
BLAST search), the Arctic isolate was determined to belong to Arthrinium.
Most Arthrinium species produce lenticular conidia. As the new species
abundantly produces conidia that are lenticular but also elongate, it differs from
any previously described Arthrinium species, which rarely or never produce
elongate conidia.
The nrcc12144 ITS region comprised a 534 bp nucleotide sequence with 222
ITS1 bp, 150 5.88 bp, and 160 ITS2 bp. A BLASTn search against the Genbank
DNA database with this ITS sequence showed maximum similarity (99%)
with ambiguous A. phaeospermum strains (HM008624.1 query coverage 93%;
HM008625.1 query coverage 94%), 97% similarity with A. aureum (AB220246.1
query coverage 88%; AB220251.1 query coverage 87%), and only 90% similarity
with the isotype strain from A. phaeospermum (AB220283.1 query coverage
88%).
A previous study by Khan et al. (2009) of A. phaeospermum involving 16
Genbank sequences showed considerable variability among the deposited
sequences. Our search of Genbank for A. phaeospermum ITS sequences as
revealed 25 accessions. A Neighbor Joining tree constructed using these 24
sequences + NFCCI2144 revealed three groups. Our Arctic isolate clustered
with six A. phaeospermum sequences including 1F06575, MAFF410784,
and MAFF305708, which are not monophyletic with the ex-isotype strain of
A. phaeospermum cxBs142.55. Examination of strain 1F06575 revealed the
anomalous conidia characteristic of A. rasikravindrii and measuring 9.5-22.5
um x (6.5-)8.5-14.5(-10) um. Morphological examination of Marr410785
and MAFF305708 (Fic. 21-L, 0, P) belonging to clade Ia (Fic. 3) and clade IIb
(Fic. 4) also showed conidial morphology typical of A. rasikravindrii. Their
ITS sequences showed a 99.4% and 99.8 % similarity, respectively, to the
A. rasikravindrii ex-type strain.
Phylogenetic analysis of 10 related species of Arthrinium using neighbor-
joining method (Fic. 3) placed Arthrinium spp. into three clades: clade I contains
two subclades — Ia with A. rasikravindrii and Ib with two A. aureum strains —
Fic. 2. A-H. Arthrinium phaeospermum (MAFF 236535). A-D, F-H: variously shaped conidia—
typical lenticular, globose, and narrow elongated. £: conidiophores. 1-p. Arthrinium rasikravindrii.
I-L (MAFF 305708): lenticular, globose, and anomalous conidia. M-N (IFO 6575): lenticular, globose,
and anomalous conidia. o0-P (MAFF 410784): globose and anomalous conidia.
455
Arthrinum rasikravindrii sp. nov. ...
456 ... Singh & al.
AB220273.1 Arthrinium rasikravindrii MAFF 410785
HM008625.1 Arthrinium rasikravindrii L10-2-2
HM008624.1 Arthrinium rasikravindrii L3-4-2
AB220272.1 Arthrinium rasikravindrii MAFF 305708
JF326454 Arthrinium rasikravindrii NFCCI2144 T
AB220266.1 Arthrinium rasikravindrii IFO 6575
GU266274.1 Arthrinium rasikravindrii DLEN2008007
AM220246.1 Arthrinium aureum IMI252326
82! AB220251.1 Arthrinium aureum CBS 244.86
AB220252.1 Arthrinium marii CBS 497.90
AB220243.1 Arthrinium mediterranei IMI 326875
AB220242.1 Arthrinium hispanicum IMI 326877
AB220258.1 Apiospora montagnei CBS 301.49
ag | AJ279447.1| Arthrinium phaeospermum CBS 463.83 II
AB220257.1 Arthrinium sacchari CBS 334.86
qq |, AB220256.1 Arthrinium phaeospermum CBS 142.55 isotype |>
AB220240.1 Arthrinium serenense CBS 498.90
AB220238.1 Arthrinium saccharicola ATCC 76288
AB220241.1 Arthrinium euphorbiae IMI 285638b
GU566268.1 Arthrinium arundinis G41
Il
AB220253.1 Arthrinium puccinioides CBS 549.86
GQ919077 Nigrospora sphaerica 9038
0.02
Fic. 3. Neighbor joining tree (1000 bootstrap replications) showing phylogenetic relationship of
Arthrinium rasikravindrii NEFcci 21447 and 22 ITS sequences deposited in Genbank of authentic
strains of 13 Arthrinium species. The tree scale (0.02) represents evolutionary distances in units of
base substitutions per site as computed by Kimura-2 parameter method. Bootstrap values more
than 50 are shown. Gaps are treated as missing data and eliminated from dataset during tree
construction. Nigrospora sphaerica (GQ919077.1) was taken as outgroup.
clade II includes the most species (8), and clade III comprises A. euphorbiae and
an Arthrinium strain wrongly identified as A. arundinis (Apiospora montagnei)
that is non-monophyletic with the authentic strain of Apiospora montagnei CBS
301.49 (clade Ila). Strain 106575 and five others are considered to represent
A. rasikravindrii rather than A. phaeospermum as listed in Genbank because
they cluster with the holotype isolate and are distant from the isotype strain
cBS142.55 of A. phaeospermum (TABLE 1).
Acombinedanalysis of Arthrinium spp. (Fic.4)includingallA. phaeospermum
accessions was consistent with Fic. 3 except that A. phaeospermum strains were
distributed in three major clusters suggesting fungal sequences incorrectly
| nano
0.02
Arthrinum rasikravindrii sp. nov. ... 457
AJ279456.1| Arthrinium phaeospemmum A3
ba AJ279447.1| Arthrinium phaeospermum CBS 463.83
AB220257.1 Arthrinium sacchari CBS 334.86
HQ914944.1| Arthrinium phaeospemum OUCMBIII091005
AB220238.1 Arthrinium saccharicola ATCC 76288
AB220283.1| Arthrinium phaeospermum MUCL 8362
AB220271.1| Arthrinium phaeospermum MAFF 236535
AB220256.1| Arthrinium phaeospermum CBS 142.55
AB220267.1| Arthrinium phaeospermum IFO 31950
HQ914942.1| Arthrinium phaeospemum OUCMBI101209
AB220240.1 Arthrinium serenense CBS 498.90 T I
AB220270.1| Arthrinium phaeospermum MAFF 236534
$i HM222950.1| Arthrinium phaeospermum A218
AB220261.1| Arthrinium phaeospermum DSM 62039
FJ478101.1| Arthrinium phaeospermum XSD08044
AB220269.1| Arthrinium phaeospermum MAFF 235494 | b
EU326184.1| Arthrinium phaeospermum XSD-91
¥ HM222956.1| Arthrinium phaeospermum A229
EU326200.1| Arthrinium phaeospermum XSD-132
907 AM220246.1 Arthrinium aureum IMI 252326
AB220251.1 Arthrinium aureum CBS 244.86 T
AM220272.1 Arthrinium rasikravindrii MAFF 305708
98) |. JF326454 Arthrinium rasikravindrii NFCCI 2144 Il
HM008625.1 Arthrinium rasikravindrii L10-2-2
80 | 4B220266.1 Arthrinium rasikravindrii IFO6575
GU266274.1 Arthrinium rasikravindrii DLEN2008007
AB220273.1 Arthrinium rasikravindrii MAFF 410785
HM008624.1 Arthrinium rasikravindrii L3-4-2
AB220258.1 Apiospora montagnei CBS 301.49 T
DQ865110 Arthrinium phaeospermum 63/2.4
34] AB220252.1 Arthrinium mari CBS 497.90 T
6 FJ462766.1| Arthrinium phaeospermum 157 Il
AB220243.1 Arthrinium mediterranei IM! 326875
AB220242.1 Arthrinium hispanicum IMI 326877
AB220241.1 Arthrinium euphorbiae IMI 285638b | IV
GU566268.1 Arthrinium arundinis G41 | V
AB220253.1 Arthrinium puccinioides CBS 549.86
Cc
la
a
GQ919077 Nigrospora sphaerica 9038
Fic. 4. Neighbor joining phylogenetic tree (1000 bootstrap replications) constructed using ITS
sequences of NFCCI 2144" and 24 accessions deposited in Genbank as Arthrinium phaeospermum
plus accessions of 13 Arthrinium spp. ‘The tree scale (0.02) represents evolutionary distances in
units of base substitutions per site as computed by Kimura-2 parameter method. Bootstrap values
more than 50 are shown. Gaps are treated as missing data and eliminated from dataset during tree
construction.
assigned to A. phaeospermum. Two strains designated as A. phaeospermum
belonging to clade III in Fic 4 may also have been misidentified because they
are not monophyletic with the A. phaeospermum ex-isotype culture cBs142.55
but group instead with A. hispanicum, A. marii, and A. mediterranei. Also three
‘A. phaeospermum in Fic 4 clade Ic represent an undescribed species.
458 ... Singh & al.
Arthrinium rasikravindrii differs morphologically from A. phaeospermum
in having larger conidia and producing a second type of conidia, also seen
in an unidentified species of Arthrinium by Adelantado et al. (2010) and
the Arthrinium state of Apiospora montagnei by Minter (1985). Additionally
A. phaeospermum forms narrowly elongated pale brown conidia (Fic. 24-D,
F-H) not seen in any of the examined A. rasikravindrii strains (Fics 1,
21-p). Although A. phaeospermum and the Arthrinium state of Apiospora
montagnei form anomalous conidia like A. rasikravindrii, these occur only
rarely. Genetically, A. rasikravindrii differs in 51 positions (10.2%) from
A. phaeospermum cBs142.55 out of the 503 nucleotides in the ITS region.
Arthrinium rasikravindrii differs from A. aureum having conidia 14-30 x
10-15 um, and these species differ in the ITS region at 12 nucleotide positions
(2.4%). All other species are more than 10% distant from A. rasikravindrii
in the ITS region. None of the known Arthrinium species of form elongate
truncate conidia (referred to as anomalous conidia by Adelantado et al. 2010)
in abundance except A. rasikravindrii (Fic. 1B-D) and the Arthrinium state of
Apiospora montagnei that is genetically (>10%) distant from A. rasikravindrii
and A. phaeospermum.
Acknowledgments
We are indebted to Dr. Amy Rossman (USDA-ARS, Beltsville, USA) and Dr.
Rafael F. Castafieda Ruiz (Instituto de Investigaciones Fundamentales en Agricultura
Tropical ‘Alejandro de Humboldt (INIFAT), Santiago de Las Vegas, C. Habana, Cuba)
for reviewing the manuscript. We are grateful to Curators of NITE Biological Resource
Centre (NBRC, Chiba, Japan) and Genetic Resource Centre (National Institute of
Agrobiological Sciences (NIAS), Tsukuba, Japan) for kindly providing fungal cultures
for study. We are highly grateful to Dr. Rasik Ravindra (Director, National Centre for
Antarctic & Ocean Research, Goa (contribution no. 32/2012), and Director, MACS’
Agharkar Research Institute, Pune, India) for encouragement and facilities. The authors
are also thankful to Department of Science and Technology (DST), Govt. of India, New
Delhi) for providing financial support for setting up a National Facility for Culture
Collection of Fungi (No. SP/SO/PS-55/2005) at MACS’ARI.
Literature cited
Aarnes JO. 2002. Katalog over makro- og mikrosopp angitt for Norge og Svalbard. Synopsis
Fungorum 16. 412 p.
Adelantado C, Arosemena EL, Calvo MA. 2010. Electronic microscopy of the genus Arthrinium,
A study model for the knowledge of dematiaceous fungi. 116-127, in: A Mendez- Vilas, J Diaz
(eds.) Microscopy, Science Technology, Applications and Education Vol.1, Formatex Research
Centre, Badajoz, Spain.
Aljanabi SM, Martinez I. 1997. Universal and rapid salt extraction of high quality genomic DNA for
PCR based techniques. Nucl. Acids Res. 25: 4492-4693.
http://dx.doi.org/10.1093/nar25.22.4692
Arthrinum rasikravindrii sp. nov. ... 459
Carmichael JW, Kendrick WB, Conners IL, Sigler L. 1980. Genera of hyphomycetes. The University
of Alberta Press, Canada. 386 p.
Calvo MA, Guarro J. 1980. Arthrinium aureum sp. nov. from Spain. Transactions of British
Mycological Society 75: 156-157.
Domsch KH, Gams W, Anderson TH. 1980. Compendium of soil fungi. Academic Press, London.
Elvebakk A, Gjaerum HB, Sivertsen S. 1996. Myxomycota, Oomycota, Chytridiomycota, Zygomycota,
Ascomycota, Deuteromycota, Basidiomycota, Uredinales and Ustilaginales. 207-259, in: A
Elvebakk, P Prestrud (eds). A catalogue of Svalbard plants, fungi, algae and cyanobacteria. Part
4. Fungi II. Norsk Polarinstitutt Skrifter 198, Oslo, Norway.
Ellis MB. 1965. Dematiaceous hyphomycetes. IV. Mycol. Pap.103: 1-46.
Ellis MB. 1971. Dematiaceous hyphomycetes. CAB International, Kew, England.
Ellis MB. 1976. More dematiaceous hyphomycetes. CAB International, Kew, England.
Felsenstein J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution
39: 783-791. http://dx.doi.org/10.2307/2408678
Khan SA, Hamayun M, Kin H, Yoon H, Seo J, Choo Y, Lee I, Kim S, Rhee I, Kim J. 2009. A new
strain of Arthrinium phaeospermum isolated from Carex kobomugi Ohwi is capable of gibberellin
production. Biotechnol. Lett. 31: 283-287. http://dx.doi.org/10.1007/s10529-008-9862-7
Kimura M. 1980. A simple method for estimating evolutionary rate of base substitutions through
comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111-120.
http://dx.doi.org/10.1007/BF01731581
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth and Bisby’s dictionary of the fungi,
10" ed. CABI Publishing, Wallingford.
Klimowicz Z, Uziak S. 1988. Soil-forming processes and soil properties in Calypsostranda,
Spitsbergen. Polish Polar Research 9: 61-71.
Kunze G. 1817. Zehn neue Pilzgattungen. Mykologische Hefte 1: 1-18.
Kurek E, Kornijjozwicz-Kowalska T, Sjomka A, Melke J. 2007. Characteristics of soil filamentous
fungi communities isolated from various micro relief forms in the high Arctic tundra (Bellsund
region, Spitsbergen). Polish Polar Research 28: 57-73.
Larrondo JV, Calvo MA. 1990. Two new species of Arthrinium from Spain. Mycologia 82(3):
396-398. http://dx.doi.org/10.2307/3759915
Larrondo JV, Calvo MA. 1992. New contributions to the study of the genus Arthrinium. Mycologia
84(3): 475-478. http://dx.doi.org/10.2307/3760203.
Minter DW. 1985. A re-appraisal of the relationships between Arthrinium and other hyphomycetes.
Proceedings of Indian Academy of Sciences (Plant Sci.) 94(2-3): 281-308.
Nygaard E.J. 2009. Ny-Alesund, International Arctic Research and Monitoring Station at 79°N.
Ny-Alesund: Kings Bay AS.
Pang KL, Chiang MWL, Vrijmoed LLP. 2008. Havispora longyearbyenensis gen. et sp. nov. : an
arctic marine fungus from Svalbard, Norway. Mycologia 100: 291-295.
http://dx.doi.org/10.3852/mycologia.100.2.291
Pang KL, Chiang MWL, Vrijmoed LLP. 2009. Remispora spitsbergenensis sp. nov., a marine
lignicolous ascomycete from Svalbard, Norway. Mycologia 101: 531-534.
http://dx.doi.org/10.3852/08-003
Rayner RW. 1970. A mycological colour chart. CMI, Kew, Surrey, UK.
Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution 4:406-425.
460 ... Singh & al.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS5: Molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum
parsimony methods. Molecular Biology and Evolution 28: 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
Waksman SA. 1916. Do fungi live and produce mycelium in the soil? Science, n.s. 44: 320-322.
http://dx.doi.org/10.1126/science.44.1131.320
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in MA Innis et al. (eds.) PCR protocols: a guide to
methods and applications. Academic Press, New York.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.461
Volume 122, pp. 461-466 October-December 2012
New records of Ochrolechia and Placopsis
from the Hengduan Mountains, China
TONG-LI GAO & QIANG REN*
College of Life Science, Shandong Normal University, Jinan, 250014, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT—Based on specimens collected in the Hengduan Mountains, Ochrolechia
laevigata is recorded as new to Asia, O. africana as new to China, and Placopsis gelida as new
to mainland China.
Key worps — Ochrolechiaceae, Trapeliaceae, taxonomy, Yunnan
Introduction
Ochrolechia A. Massal. (Ochrolechiaceae, Pertusariales, Ascomycota), a
widespread genus of crustose lichens, comprises about 60 species worldwide
(Verseghy 1962; Howard 1970; Brodo 1987, 1991; Lumbsch et al. 2003; Kirk
et al. 2008; Kukwa 2009, 2011). In China, 25 species have been reported (Wei
1991, Jia & Zhao 2003, Jia et al. 2008), of which 18 are known from Southwest
China. During our study of lichens collected from the Hengduan Mountains,
we recorded O. africana for the first time from China and O. laevigata for
the first time from Asia. We also collected in the same area Placopsis gelida,
reported here as new to mainland China.
Materials & methods
The specimens studied are preserved in SDNU (Lichen Section of Botanical
Herbarium, Shandong Normal University). The morphological and anatomical
characters of the specimens were examined under a stereomicroscope (Olympus
SZ) and a polarizing microscope (Olympus CX21). The lichen substances were
identified using the standardized thin layer chromatography techniques (TLC)
with C system (Orange et al. 2010) and mercury cadmium telluride [MCT]
crystal analysis. Photographs were taken of the morphology with an Olympus
SZX16 stereomicroscope and of the anatomy with an Olympus BX61 compound
microscope with DP72.
462 ... Gao & Ren
New records
Ochrolechia africana Vain., Ann. Univ. Fenn. Aboénsis, ser. A, 2(3): 3.1926. Fic. 1
MorPHOoLoGy — THALLUS crustose, yellowish grey to grey, thin to thick
and verruculose to verrucose; ISIDIA AND SOREDIA absent; APOTHECIA sessile,
numerous, 1.0-1.8 mm in diam.; Disk light yellowish pink to light orange, with
white and scabrose pruina; THALLINE MARGIN usually concolorous with the
thallus, margins thick, dull, smooth, often prominent; EPITHECIUM pale brown;
HYMENIUM 220-330 um high; HyPOTHECIUM 35-40 um high; EXCIPULUM
PROPRIUM 15-25 um; AMPHITHECIUM with a thick, well-developed medulla,
sometimes with small crystals, and thin cortex (30 um thick); ALGAL LAYER
virtually continuous below hymenium or sometimes sparse; Asci 8-spored;
ASCOSPORES simple, ellipsoid, 55-62.5 x 30-32.5 um; PYCNIDIA absent.
Spot TEsTs — Thallus cortex K-, C-, KC-; medulla K-, C+ red, KC+ red;
apothecial disk K+ yellow, C+ red, KC+ red; apothecial margin cortex K-, C-,
KC-; apothecial margin medulla C+ red; thallus UV-.
SECONDARY METABOLITES — Gyrophoric acid with traces of lecanoric and
4-O-methylhiascic acids.
DISTRIBUTION & HABITAT — Ochrolechia africana is a pantropical species,
reported from southeastern coastal plain, tropical and subtropical areas in
Figure 1. Ochrolechia africana [Z.J. Ren 20113910]. A. Thallus. B. Apothecia. C. Apothecial section.
D. Crystals in apothecial section. Scale bars: A = 1 mm; B = 0.3 mm; C, D = 100 um.
Ochrolechia & Placopsis spp. new to China ... 463
North and South America, Asia, Australia, and southern Africa (Awasthi &
Tewari 1987, Brodo 1991, Aptroot & Feijen 2002, Roemer et al. 2004). The
species grows on wood and the bark of deciduous trees.
SPECIMEN EXAMINED — CHINA. YUNNAN. LYIANG CouNTY, Mt. Laojun, alt. 2800 m,
on bark, 5 Nov. 2009, Z.J. Ren 20113910 (SDNU).
ComMENTs — Ochrolechia africana is characterized by small, pruinose
apothecia with smooth apothecial margins, a C+ red medulla due to the
production of hiascic acids, and a C- negative amphithecial cortex. The species
may be confused with O. mexicana, which can be distinguished by a C+ red
apothecial cortex, a usually more pruinose disk, and the absence of an excipular
ring around the disk (Brodo 1991).
Ochrolechia laevigata (Rasainen) Verseghy ex Kukwa, Lichen Genus Ochrolechia in
Europe: 132. 2011. Fic. 2
MorPHOLOGY — THALLUS crustose, yellow to pale yellow, shiny, very thin,
continuous, thin to moderately thick, not verrucose; APOTHECIA circular,
shallow saucer-shaped, usually regular in outline, 1.0-2.4 mm in diam., sessile,
light orange, epruinose; THALLINE MARGIN 0.2-0.6 mm thick, entire, smooth,
always concolorous with the thallus; EpIrHEcriuM faintly brownish; HYMENIUM
300-340 um high; HyPoTHECIUM about 90 um high, gray; AMPHITHECIUM
medulla lax, alga layer almost absent, or sometimes only in upper lateral
margins not below hypothecium; cortex 45 um thick laterally, expanding to
100 um at base; EXCIPULUM PROPRIUM distinct below hypothecium, 50-60 um
thick; Asc1 6-8 spored; ascospores simple, ellipsoid, 70-75 x 32.5-40 um;
PYCNIDIA absent.
Spot TESTS — Thallus cortex K+ yellow, C+ red, KC+ red; medulla K-, C+
red, KC+ red; apothecial disk K-, C+ red, KC+ red; apothecial margin cortex
K+ yellow, C+ red, KC+ red; margin medulla C+ faintly red.
SECONDARY METABOLITES — Gyrophoric acid with a trace of lecanoric
acid.
DISTRIBUTION & HABITAT — Ochrolechia laevigata, which has been
previously reported only from the west coast of North America (Brodo 1991,
Brodo et al. 2003), grows on deciduous trees.
SPECIMENS EXAMINED — CHINA. YUNNAN. LIJIANG COUNTY, Mt. Laojun, alt. 4000 m,
on bark, 5 Nov. 2009, Q. Tian 20100498, 20100502 (SDNU).
ComMENTS —Ochrolechia laevigata, which is characterized by a thin thallus,
apothecial margins almost without an algal layer, and a distinct excipulum
proprium, resembles O. oregonensis and O. subpallescens morphologically, but
O. oregonensis has a thick, verruculose to verrucose thallus while O. subpallescens
has a continuous algal layer under the hymenium (Brodo 1991). Although our
Chinese specimen does not contain olivetoric and 4-O-demethylmicrophyllinic
464 ... Gao & Ren
FiGuRE 2. Ochrolechia laevigata [Q. Tian 20100498]. A. Thallus. B. Crystals in thallus section.
C. Algal layer section. D. Excipulum proprium below hypothecium. Scale bars: A = 2 mm; B = 50
um; C, D = 100 um.
acids, it agrees morphologically with the description given by Brodo (1991).
The chemical variation of the species may be greater than previously reported
and should be studied further.
Placopsis gelida (L.) Linds., Trans. Linn. Soc. London 25: 536. 1866. Fic. 3
MorpHo.Locy — THALLUS dull grey, cream, pinkish or pale brown, forming
rosettes; LARGE CENTRAL with cracked to rimose-areolate part, with radiating
marginal lobes, 0.4-1.3 mm wide; suRFACE with pinkish to grey-brown,
epruinose, CEPHALODIA deeply plicate, 0.4-4 mm in diam.; sORALIA farinose
green-grey to grayish, generally delimited by a sharply defined and slightly
raised margin; APOTHECIA 0.7-1.8 mm in diam., sessile, pinkish to yellow-
brown, often with whitish pruinose; ascr 8-spored, cylindrical, thin walled;
ASCOSPORES colourless, simple, ellipsoid, 15-17.5 x 8-10 um.
Spot TESTs — Thallus cortex K-, C+ red, KC+ red; medulla K-, C+ red,
KC+ red; apothecial disk K-, C+ red, KC+ red; apothecial margin cortex K-,
C+ red, KC+ red.
SECONDARY METABOLITES — Contains only gyrophoric acid.
DISTRIBUTION & HABITAT — Placopsis gelida is a widespread, saxicolous,
oceanic to arctic species, reported from both the northern and southern
Ochrolechia & Placopsis spp. new to China ... 465
FicureE 3. Placopsis gelida [Z.T. Zhao 20127934]. A. Thallus. B. Apothecial section. C. Asci and
ascospores. Scale bars: A = 2 mm; B =50 um; C = 10 um.
hemispheres (Galloway 2007, Smith et al. 2009). It has been previously reported
from Taiwan.
SPECIMEN EXAMINED —CHINA. YUNNAN. DALI county, Mt. Cang, alt. 3100 m, on
bark, 22 Nov. 2009, Z.T. Zhao 20127934 (SDNU).
ComMENTS —Placopsis gelida is characterized by the matte upper surface, pale
eroded soralia, deeply lobed cephalodia, and gyrophoric acid as the only major
substance. The species is similar to P lambii, which can be separated by its shiny
surface, non-lobate cephalodia, and soralia that are usually blackish, sometimes
capitate, and greenish (Galloway 2007).
Acknowledgements
This present study was supported by the National Natural Science Foundation of
China (31100011), The authors thank Dr. Martin Kukwa (Gdansk University) and
Prof. Shou-Yu Guo (Key Laboratory of Systematic Mycology & Lichenology, Institute
of Microbiology, Chinese Academy of Sciences, Beijing, China) for presubmission
reviews.
Literature cited
Aptroot A, Feijen FJ. 2002: Annotated checklist of the lichens and lichenicolous fungi of Bhutan.
Fungal Diversity 11: 21-48.
Awasthi DD, Tewari R. 1987. Lichen genus Ochrolechia from Indian subcontinent. Kavaka 15(1-2):
2a Dit.
Brodo IM. 1987. Studies of the genus Ochrolechia. 1. A new classification for Pertusaria subplicans
and P. rhodoleuca. Canadian Journal of Botany 66: 1264-1269.
http://dx.doi.org/10.1139/b88-181
Brodo IM. 1991. Studies of the genus Ochrolechia. 2. Corticolous species of North America.
Canadian Journal of Botany 69: 733-772. http://dx.doi.org/10.1139/b91-099
Brodo IM, Sharnoff SD, Sharnoff S. 2003. Lichens of North America. New Haven and London, Yale
University Press.
Galloway DJ. 2007. Flora of New Zealand. Lichens. Revised second edition including lichen-
forming and lichenicolous fungi. Lincoln: Manaaki Whenua Press.
Gilbert OL, Purvis OW. 2009. Placopsis (Nyl.) Linds. (1867). 710-711, in: CW Smith et al. (eds).
The lichens of Great Britain and Ireland. London, British Lichen Society.
466 ... Gao & Ren
Howard GE. 1970. The lichen genus Ochrolechia in North America in north of Mexico. The
Bryologist 73: 93-130. http://dx.doi.org/10.2307/3241590
Jia ZF, Zhao ZT. 2003. A preliminary study of the lichen genus Ochrolechia in China. Mycosystema
22(1): 30-34.
Jia ZF, Ren Q, Zhao ZT. 2008. Ochrolechia pallentiisidiata, a new species from China. Mycotaxon
106: 233-236.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi. 10th Edition. Egham,
CABI Bioscience, CAB International.
Kukwa M. 2009. The lichen genus Ochrolechia in Poland III with a key and notes on some taxa.
Herzogia 22: 43-66.
Kukwa M. 2011. The lichen genus Ochrolechia in Europe. Gdansk: Fundacja Rozwoju Uniwersytetu
Gdanskiego.
Lumbsch HT, Messuti MI, Nash TH IIL. 2003. Ochrolechia splendens (Pertusariaceae), a new species
from southwestern North America. Lichenologist 35(5-6): 387-391.
http://dx.doi.org/10.1016/S0024-2829(03)00057-4
Roemer J, Nash III TH, Lumbsch HT, Messuti MI. 2004. Ochrolechia. 381-387, in TH Nash III et
al. (eds). Lichen Flora of the Greater Sonoran Desert Region, Vol. 2. Tempe, Lichens Unlimited,
Arizona State University.
Orange A, James PW, White FJ. 2010. Microchemical methods for the identification of lichens. 2nd
edition. London: British Lichen Society.
Verseghy K. 1962. Die Gattung Ochrolechia. Beihefte zur Nova Hedwigia 1: 1-146.
Wei JC. 1991. An enumeration of lichens in China. Beijing: International Academic Publishers.
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.467
Volume 122, pp. 467-482 October-December 2012
Nomenclatural notes on the lichen genera
Leucodecton and Myriotrema (Graphidaceae) in India
SANTOSH JOSHI’, DALIP K. UPRETI** & BIJU HARIDAS?
'Lichenology Laboratory, CSIR-National Botanical Research Institute
Rana Pratap Marg, Lucknow - 226 001, India
?Microfungi & Lichens Unit, Tropical Botanical Garden and Research Institute Palode,
Thiruvananthapuram -695562, India
*CORRESPONDENCE TO:
[email protected]
ABSTRACT —Nine species of Leucodecton and nine species of Myriotrema are recorded
for India. The recently resurrected Leucodecton accommodates species earlier placed in
Leptotrema, Myriotrema, or Thelotrema, which were segregated based primarily on medullary
chemistry such as stictic and norstictic acids, although Myriotrema retains species with a
prosoplectenchymatous cortex and psoromic or protocetraric acid chemosyndromes.
This contribution includes new synonyms, changes in generic placement, new species
distributions, and new records. Leucodecton compunctum and L. subcompunctum are new
records for India.
Key worps — thelotremoid, lepadinoid, taxonomy, delimitation, tropical, Western Ghats
Introduction
The evolving taxonomic and phylogenetic studies on crustose lichens
have resolved numerous worldwide nomenclature fluxes and revealed many
traditionally classified families as poly- or paraphyletic. This has improved the
generic delimitation of Graphidaceae, the largest and core tropical microlichen
family (Hale 1974, 1978, 1980, 1981; Frisch 2006; Staiger 2002; Rivas Plata
et al. 2012). Rivas Plata et al. (2010) revised ca. 16 genera of thelotremoid
Graphidaceae and provided a comprehensive account of more than 260 species
excluding taxa of the Ocellularia-Myriotrema-Stegobolus clade.
Singh & Sinha (2010) cited 130 thelotremoid lichen species from India, of
which the core group includes Chapsa, Chroodiscus, Diploschistes, Fibrillithecis,
Leptotrema, Leucodecton, Melanotrema, Myriotrema, Nadvornikia, Ocellularia,
Reimnitzia, Stegobolus, Thelotrema, Topeliopsis, and Wirthiotrema. Species
delimitation within the genera is based on various morpho-anatomical
468 ... Joshi, Upreti & Haridas
differences represented by thallus and apothecial morphology, photobiont,
presence or absence of lateral paraphyses/fibrils and columella, ascospore color,
excipulum anatomy and carbonization, substratum, and crystal arrangement
(Frisch et al. 2006; Mangold et al. 2009; Rivas Plata et al. 2010).
Based on recent collections and the available literature (Nagarkar et al. 1986,
1987, 1988; Patwardhan & Kulkarni 1977a,b; Patwardhan & Nagarkar 1980;
Patwardhan & Makhija 1980; Patwardhan et al. 1985; Sethy et al. 1987; Awasthi
1991, 2000; Frisch et al. 2006; Mangold et al. 2009; Rivas Plata et al. 2010;
Singh & Sinha 2010), the present study provides a synopsis of the systematics,
taxonomy, and distribution pattern of the lichen genera Leucodecton and
Myriotrema in India according to the current generic classification within the
Graphidaceae.
Materials & methods
We examined and re-determined specimens from Andaman & Nicobar Islands,
Andhra Pradesh, Assam, Kerala, Orissa, Tamil Nadu and West Bengal that were stored
in the herbarium of the National Botanical Research Institute (LWG). We also studied
recent samples collected by one author (Haridas) from different localities in Western
Ghats, India. Morpho-anatomical characters were studied using a LAaBOMED D1GIZOOoM
stereomicroscope and Leica DM500 light microscope. Thin hand-cut sections of
apothecia and thallus were mounted in plain water, cotton blue, 10% KOH, and iodine
solutions and observed under a compound microscope. For secondary metabolites
identification spot tests, calcium hypochlorite (C) and paraphenylenediamine (PD)
were also applied when needed. TLC (solvent system A & C) was performed following
Orange et al. (2001).
We assembled preliminary information on Indian thelotremoids from the literature
(Nagarkar et al. 1986, 1987, 1988; Patwardhan & Kulkarni 1977a,b; Patwardhan &
Nagarkar 1980; Patwardhan & Makhija 1980; Patwardhan et al. 1985; Sethy et al. 1987;
Awasthi 1991, 2000; Singh & Sinha 2010). Earlier generic concepts and identification
keys were revised according to recent world monographs based on modern concepts
and classification (Frisch et al. 2006; Mangold et al. 2009; Rivas Plata et al. 2010).
Taxonomy
Leucodecton A. Massal., Atti Reale Ist. Veneto Sci. Lett. Arti, ser. 3, 5: 325, 1860.
The recently resurrected genus Leucodecton, originally introduced for a
single species, L. compunctum, currently contains ca. 19 species worldwide.
This includes five species each for Africa (Frisch 2006) and Australia (Mangold
et al. 2009) and six from India, with one (L. tarmuguliense) apparently endemic
for the country (Singh & Sinha 2010), although additional sampling is needed
to confirm the endemism of this species. By adding three more taxa, our re-
evaluation of the Indian thelotremoids brings to nine the number of Leucodecton
species represented in the country. Taxonomic and systematic revision of the
Leucodecton and Myriotrema (India) ... 469
thelotremoid Graphidaceae has broaden the generic delimitations so that
the genus now accommodates several stictic and norstictic acid-containing
species earlier placed in Leptotrema, Myriotrema, and Thelotrema. Leptotrema
is separated from Leucodecton based on its apically thickened asci and thick-
walled ascospores, while Myriotrema has parallel hyphae with radiating tips in
the proper exciple and belongs to a separate molecular clade (Frisch et al. 2006).
Thelotrema, on the other hand, acquires a periphysoidal excipulum. Leucodecton
has been re-introduced to accommodate species characterized by apothecioid
ascomata and a + free proper exciple of distinctly paraplectenchymatous
hyphae lacking radially oriented tips, markedly interwoven and often scarcely
branched paraphyses, absence of lateral paraphyses, + muriform brown usually
I- ascospores, and presence of stictic or norstictic acids (Frisch 2006; Mangold
et al. 2009; Rivas Plata et al. 2010).
Key to Leucodecton species recorded from India
la’ <Ascospores-10=50jprm long, (2) 48 per-ascus.: 4%. ce oh eaweee sana chy weve eh naaras takes 2
Ib... ~Ascospores’250;umilong, 14 perascusess ooo wa ey Gly eee ae yee hae Be bad 6
Ja. “Nokstictic acid present’. sts 5 Baki 25a Maye. Sleage lage lege a L. occultum
Zr SlichiodClatpresenty tut Am tate Um al. Uebel Ate, ded, Swe ed Uo Oe 3
3a. Apothecia often aggregated in whitish pseudostromata,
thallustecorticate:! 2.0. ee. . sas kono Stl F seals + Oaalt saa os L. glaucescens
3b. Apothecia solitary (sometimes numerous),
thallus corticate (loose to irregular or prosoplectenchymatous)............... 4
4a. True cortex present, thallus hard to crystalline,
ASCOSWOLESA Fa? 70295) Mt VA. eu ia che oe deed oan Reid ons L. compunctum
4b. True cortex absent, thallus loose, + dull,
ASCOSPONES 2040 MINT LOM GG 2. FB Paes pat at ak age ok Pans tet toe cleaned teas eee fe)
5a. Apothecia lepadinoid with free excipulum................. L. subcompunctum
5b. Apothecia myriotremoid, with + fused excipulum ............... L. fissurinum
Od." “ASCOSPORES FENIAIING NY ALINE oS. once Weds Bau aely nudes peude L. anamalaiense
6b:.~ Ascospores\ brownion maturity so. vas sk si ale stb ele pete Oo sae od a dk 28 7
7a. Apothecia myriotremoid to ocellularioid, thallus with irregular
CIUSIEES OM CiyStalsen stake uate vee ey emcee ties web reed L. tarmuguliense
7b. Apothecia porinoid to myriotremoid, thallus often with large
GO HANATIAT CIUGSTET SOT CLV SEA IC. We aba Me sich ae ty be See ba Ried ered hog ecar gM aes 8
8a. Apothecia porinoid (to indistinctly myriotremoid or lepadinoid with
an apically free exciple), narrow pore surrounded by dark ring
tas lpg Ro A le eg cet, She en See ee L. compunctellum
8b. Apothecia myriotremoid with narrow pore, thallus with small + irregularly
dispersed crystals, narrow pore surrounded by white ring......... L, nuwarense
470 ... Joshi, Upreti & Haridas
Leucodecton anamalaiense (Patw. & C. R. Kulk.) Rivas Plata & Liicking,
Lichenologist 42: 184, 2010.
Patwardhan & Kulkarni (1977b) first described this species from Anamalai
hills in Kerala as Thelotrema anamalaiense. However the lepadinoid
apothecia, brownish excipulum lacking lateral paraphyses, 2-4-spored asci,
muriform hyaline ascospores of 50-80 x 15-20 um, and presence of stictic
acid chemosyndrome agree well with Leucodecton, to which it was recently
transferred. The closely related L. nuwarense differs only in small ascospores
that turn brown at late maturity (Rivas Plata et al. 2010).
Leucodecton compunctellum (Nyl.) Frisch, Biblioth. Lichenol. 92: 155, 2006.
= Leptotrema microglaenoides (Vain.) Zahlbr., Cat. Lich. Univers. 2: 637, 1923
= Leptotrema elachistoteron (Leight.) Patw. & C. R. Kulk, Norweg. J. Bot. 24: 128, 1977
= Leptotrema oligosporum (Mill. Arg.) Patw. & Makhija, Bryologist 83: 368, 1980
= Myriotrema elachistoteron (Leight.) Hale, Mycotaxon 11: 133, 1980
= Myriotrema reclusum (Leight.) Hale, Mycotaxon 11: 135, 1980
The species is diagnosed by pale yellowish-grey to straw colored, finely
rugose to verrucose surface thallus with large columnar clusters of crystals, a
fused proper exciple, porinoid apothecia with very small pores (ca. 0.05 mm),
1-4-spored asci, and brown ascospores up to 140 um long.
Leucodecton compunctellum has previously been reported from India as
Leptotrema elachistoteron, L. microglaenoides, L. oligosporum, Myriotrema
elachistoteron, and M. reclusum (Patwardhan & Makhija 1980; Nagarkar et al.
1986; Awasthi 1991; Singh & Sinha 2010; Mangold et al. 2010). Its distribution
ranges from Andaman Islands to Karnataka and Kerala.
SPECIMENS EXAMINED—INDIA. ANDAMAN & NICOBAR ISLANDs: Unknown Island,
near evergreen forest compound, on bark, 23.04.1961, A. Singh 79745 (LWG); KERALA:
Idukki district, I.C.R.I. campus, Myladumpara, alt. ca. 1200 m, on bark of tree,
01.03.1984, D.D. Awasthi & G. Awasthi 84.116 (LWG).
Leucodecton compunctum (Ach.) A. Massal., Atti Inst. Veneto Sci. lett., Arti, ser. 3,
5: 32571860; PLATE 1A
Thallus corticolous, epiphloeodal, greenish-grey to yellowish-green or olive-
green, glossy, crystalline, smooth, continuous, 114-142 um thick. True cortex
well developed, 15-25 um thick. Prothallus indistinct, brownish. Photobiont
layer inspersed with crystals largely dispersed to aggregate. Medulla indistinct
to endophloeodal. Apothecia solitary, immersed, perithecioid, round, small to
ca. 1.0 mm in diam. Pore minute, round, blackish, 0.2-0.3 um in diam. Margin
thick, entire, often brighter than the thallus. Disc not visible from above. Proper
exciple, pale yellowish to brownish, laterally 20-25 um reaches up to 62(-80)
um in the bottom. Epihymenium hyaline, without granules, 10-20 um high.
Hymenium clear, 150-200 um high. Paraphyses simple, +straight, delicate,
conglutinate apically, 1-2 um thick. Asci 8-spored, clavate, 50-70 x 15-20 um.
Leucodecton and Myriotrema (India) ... 471
Ascospores becoming brown at early maturity, muriform, 6-13 x 4-6 loculate,
oblong to subglobose, 23-27(-33) x 11-14(-16) um in size, endospore thick, I-.
CHEMISTRY: K+ reddish, C-, PD+ orange; stictic acid chemosyndrome
detected in TLC.
ECOLOGY & DISTRIBUTION: Worldwide, L. compunctum is widely distributed in the
tropics, although not recorded from Africa (Frisch et al. 2006). Newly recorded for India,
it is known from tropical evergreen forests of Western Ghats above 1000 m, spreading
in large thallus patches closely associated with L. subcompunctum and Wirthiotrema
glaucopallens (Nyl.) Rivas Plata & Kalb.
SPECIMEN EXAMINED— INDIA. KERALA: Kollam district, Rosemala, on bark,
27.06.2006, Biju Haridas 06-009582 (LWG).
REMARKS: Leucodecton compunctum is characterized by a rather glossy smooth
to crystalline thallus, immersed perithecioid apothecia with minute pores, and
brown muriform ascospores. It is readily distinguished from Leptotrema wightii
(Taylor) Mull. Arg. in lacking red anthraquinone crystals and from Leucodecton
compunctellum and L. subcompunctum in having smaller ascospores. Moreover,
L. subcompunctum has lepadinoid apothecia. Leucodecton compunctum may
sometimes be confused with Wirthiotrema glaucopallens excluding pore
structures; W. glaucopallens is further distinguished by a Myriotrema-type
prosoplectenchymatous cortex with internal splitting (Rivas Plata et al. 2010).
Leucodecton fissurinum (Hale) Frisch, Biblioth. Lichenol. 92: 156, 2006.
A regularly fissured areolate thallus, compact surface, fused to incompletely
free proper exciple bordering the rounded pore as a brownish ring, and
myriotremoid apothecia are the major characters separating L. fissurinum from
the closely related L. subcompunctum. Further differences are the 8-spored asci
and brown muriform (3-10 x 1-3 septate) ascospores of 20-40 x 9-13 um.
The species has been recorded at higher altitudes from Africa (Frisch 2006)
and Sri Lanka (Hale 1981). In India this species was reported as Myriotrema
fissurinum (Awasthi 1991; Singh & Sinha 2010) and is distributed mostly in the
south, including Karnataka, Kerala, Tamil Nadu, and West Bengal.
SPECIMENS EXAMINED—INDIA. Kerata: Idukki district, [IC.RI. campus,
Myladumpara, alt. ca. 1200 m, on bark, 01.03.1984, D.D. Awasthi & G. Awasthi 84.103
(LWG-LWU); Tamit Napv: Nilgiri Hills, Avalanche, Hatchery Shola, alt. ca. 2100 m,
on bark, 23.12.1971, K.P. Singh 71.564 (LWG-LWU); West BENGAL: Eastern Himalaya,
Darjeeling district, Rangit river valley, Rangit, near the bridge, alt. ca. 600 m, on bark,
08.03.1967, D.D. Awasthi & M.R. Agarwal 67.185 (LWG-LWU).
Leucodecton glaucescens (Ny].) Frisch, Biblioth. Lichenol. 92: 164, 2006.
This taxon can easily be recognized by the chroodiscoid-lepadinoid apothecia
aggregated in whitish pseudostromata, + free proper exciple, 8-spored asci, and
small brown muriform ascospores mostly under 20 x 10 um.
472 ... Joshi, Upreti & Haridas
Awasthi (1991) reported the species as Myriotrema glaucescens. The closely
related L. phaeosporum, L. subcompunctum, and L. fissurinum have a loosely
corticate thallus, mostly solitary apothecia, and comparatively larger ascospores.
L. glaucescens occurs in tropical forests of Karnataka, Kerala, and Tamil Nadu.
SPECIMENS EXAMINED— INDIA. KERALA: Palghat district, M.C.L. mines area, Walayar
forest, alt. ca. 300 m, on bark, 22.03.1985, D.D. Awasthi, R. Tewari & R. Mathur
85.35, 85.3 (LWG-LWU)); Idukki district, Munnar, Rajamallay area, alon border of tea
plantation, alt. ca. 1500-1600 m, on bark, 24.03.1985, D.D. Awasthi, R. Tewari & R.
Mathur 85.55 (LWG-LWU); on way Myladumpara to Munnar, Chinnakanal area, alt. ca.
1350 m, on bark, 02.03.1984, D.D. Awasthi & G. Awasthi 84.251 (LWG-LWU).
Leucodecton nuwarense (Hale) Frisch, Biblioth. Lichenol. 92: 155, 2006.
The species is recognized by a pale greenish-grey uneven cracked thallus
containing stictic acid chemosyndrome, numerous immersed apothecia, free
proper exciple, 2-spored asci, and brown muriform ascospores of 42-55 x
10-15 um.
Originally included in Indian thelotremoid group as Leptotrema nuwarense
and Myriotrema nuwarense from South Andaman (Nagarkar et al. 1986;
Awasthi 1991), L. nuwarense is close to L. anamalaiense, which is distinguished
by consistently hyaline and somewhat larger ascospores.
Leucodecton occultum (Eschw.) Frisch, Biblioth. Lichenol. 92: 157, 2006.
= Leptotrema compunctum (Ach.) NyL., Flora 71: 527, 1888
= Leptotrema norstictideum Patw. & Nagarkar, Biovigyanam 6(1): 5, 1980
This species is described for an ecorticate fissured thallus in different shades
of pale and yellow (greenish or grey), immersed to slightly emergent ascomata
with a free proper exciple, small brown submuriform or muriform (5-9 x
1-5 septate), thick-walled ascospores (20-40 x 10-17 um), and presence of
norstictic acid chemosyndrome.
Awasthi & Singh (1975) and Patwardhan & Kulkarni (1977a) cited
L. occultum as Leptotrema compunctum, and Patwardhan & Nagarkar (1980)
as Leptotrema norstictideum. In India the species is found in the Andaman and
Nicobar Islands, Andhra Pradesh, Assam, Kerala, Madhya Pradesh, Meghalaya,
Orissa, Tamil Nadu, and West Bengal. It is the only norstictic acid (major)
containing species of Leucodecton.
SPECIMENS EXAMINED—INDIA. ANDHRA PRADESH: Vishakhapatnam, Simhachadam
area in cashew plantation, on bark of Mango tree, 06.03.1986, D.D. Awasthi, G. Awasthi,
R. Mathur & P. Srivastava 86.240, 86.248 (LWG-LWU); KERALA: Trivandrum Botanical
and Zoological Garden, on bark, 08.05.1979, D.D. Awasthi, D.K. Upreti & U. Mishra
79.898 (LWG-LWU); Orissa: Ganjam district, on way to Seranga, on bark of Pongamia
tree, 03.03.1986, D.D. Awasthi, G. Awasthi, R. Mathur & P. Srivastava 86.128 (LWG-
LWU); WEsT BENGAL: 24 Parganas district, Sunderban, Sajanakholi forest office, on
bark, May 1975, K. N. Roychowdhury 3871, 3862, 3875, 3879 (LWG-CAL).
Leucodecton and Myriotrema (India) ... 473
PLATE 1. New Leucodecton records from India.
A. Leucodecton compunctum. B. Leucodecton subcompunctum.
Scale bars: A = 1 mm; B= 2 mm.
474 ... Joshi, Upreti & Haridas
Leucodecton subcompunctum (Nyl.) Frisch, Biblioth. Lichenol. 92: 162, 2006.
PLATE 1B
Thallus corticolous, epiphloeodal, olive-grey to olive-brown, fissured to
areolate, + glossy, loose, irregularly corticate, crystalline surface. Prothallus
brownish. Photobiont layer well developed, with inclusions of calcium oxalate
crystals, up to 50 um thick. Medulla largely endophloeodal. Apothecia dispersed,
immersed, rounded to angular, up to 1.0 mm wide pore. Disc blackish, usually
covered with white pruina. Proper exciple free to partly fused, pale fawn to
sometimes hyaline, 15-25 um thick. Epihymenium unpigmented, up to 10
um high. Hymenium clear, 100-120 um high. Subhymenium 10-20 um high.
Paraphyses simple, straight, 1.5-2.0 um thick, tips slightly thickened, adspersed
with grayish granules. Asci 8-spored, narrowly clavate, 80-100 x 10-20 um in
size. Ascospores brown, muriform, 3-8 x1-3 septate, 15-35 x 10-20 um in
size, I-.
CHEMISTRY: K+ reddish, PD+ orange, C-. Stictic acid chemosyndrome
detected in TLC.
ECOLOGY & DISTRIBUTION: Previously known from tropical, sub-tropical to
temperate regions in Africa, Asia, and Australia (Frisch 2006), L. subcompunctum
is reported for the first time from India from the tropical evergreen forests of
Western Ghats (Kerala and Tamil Nadu). It can grow in shade but is found
mostly in open sub-temperate forests and avoids humid environment.
SPECIMENS EXAMINED— INDIA. KERALA: Idukki district, Kallar Munnar Hills, alt. 1140
m, on bark, 14.02.1975, A. Singh & M. Ranjan 103044 (LWG); Trivendrum, ABP, way to
Pongalappara, alt. 1150 m, on bark, 26.04.2006, Biju Haridas 06-009580 (LWG); TaMIL
Naov: Nilgiri Hills, Kodanad, tea estate area, alt. ca. 2019 m, on bark, 31.12.1970, D.D.
Awasthi & K.P. Singh 70.1447, 70.1500 (LWG-LWU); In the shola near tea estate, alt. ca.
2010 m, on bark, 31.12.1970, D.D. Awasthi & K.P. Singh 70.1499 (LWG-LWU); Salem
district, Yercaud, Shevaroy Hills, near Shevaroy temple, alt. 1600 m, on bark, 29.12.1990,
D.K. Upreti & Hariharan 202308 (LWG); Palni Hills, Kodaikanal, near Shola, alt. ca.
1800 m, on bark, 13.12.1970, K.P. Singh, 70.849 (LWG-LWU).
REMARKS: Frisch (2006) considered L. subcompunctum a lowland species
and separated it from the customarily high elevation L. fissurinum based on
altitudinal range and certain minor diagnostic differences. But the recent field
survey together with the re-examination of preserved material indicates that
in India L. subcompunctum occurs at significantly higher altitudes in montane
forests. However, the compact crystalline irregularly fissured to areolate thallus
and lepadinoid apothecia with free excipula separate L. subcompunctum from
L. fissurinum. Leucodecton phaeosporum (Nyl.) Rivas Plata & Liicking, which
resembles L. subcompunctum in having a loose and irregular cortex, differs in
columnar crystal arrangement in the thallus and comparatively small ascospores
of 15-25 um.
Leucodecton and Myriotrema (India) ... 475
Leucodecton tarmuguliense (Sethy, Nagarkar & Patw.) Frisch, Biblioth. Lichenol.
92: 155, 2006.
The species is characterized by a pale yellowish-grey to olivaceous thallus
containing stictic acid chemosyndrome, prominent apothecia, a fused proper
exciple, 2-spored asci and brown muriform ascospores of 70-93 x 15-23
uum. Sethy et al. (1987) described this species as Leptotrema tarmuguliense
from south Andaman, which was accommodated in Myriotrema (Awasthi
1991) until the recent thelotremoid taxonomic reclassification. The species
is well separated from the closely related L. compunctellum by its prominent
(emergent) apothecia and irregular clusters of crystals. An Indian endemic,
L. tarmuguliense is reported thus far only from Andaman and Nicobar Islands.
Myriotrema Fée, Essai Crypt. Ecorc. 1: xlix, 103, 1825.
The genus, recognized as a section in Thelotrema (Salisbury 1978), was
reestablished by Hale (1980, 1981) to accommodate species that lack lateral
paraphyses and have non-carbonized proper exciples. Frisch et al. (2006) later
revised Myriotrema for six species in Africa and Mangold et al. (2009) for
17 species in Australia. Worldwide ca. 25 Myriotrema species were recognized
prior to emendation by Rivas Plata et al. (2010), who circumscribed the
genus to emphasize the internally splitting prosoplectenchymatous cortex
and production of psoromic and protocetraric chemosyndromes. In India
the genus was represented by 24 species (Awasthi 1991, 2000), subsequently
reduced to 15, including three endemics (Singh & Sinha 2010). Due to the
most recent generic classification, most Myriotrema taxa have been transferred
to Chapsa, Leucodecton, Ocellularia, Thelotrema, and Wirthiotrema, with
some reduced to synonymy. Currently Myriotrema is represented in India
by nine species (including one endemic) featuring psoromic acid as a major
chemical constituent with some species containing protocetraric acids and
unknown compounds. Other diagnostic characters include an internally
splitting prosoplectenchymatous cortex, small myriotremoid apothecia,
prosoplectenchymatous proper exciples with radiating tips, and an absence of
lateral paraphyses.
Key to Myriotrema species recorded from India
la. <Ascospores: muriform to.submiurifornyr i245 onl d ai cied en slnt eck ed ee 2
1b. | Ascospores transversely septate (sometimes with 1 vertical septum)........... 5
BAY ASCOSPORES DLO WATS, a. Uke actcy Wachee Wey ase ee RS ae 2. M. desquamans
2b... “Ascospotes hyaline: 4)0s09 dist ad bs 8d peg had tcled doped def de Mehta a eects 3
ja, terehen SubstancesaDsent.\ set). b set Stone ent en Mo a ee M. subconforme
SU; sLichen'substances*presenti(psoroimicacidy. 3. ts0 0. tt te ee eee ee a
476 ... Joshi, Upreti & Haridas
4a. Asci 4-8-spored, ascospores small, 15-25 x 7-10 um ............ M. rugiferum
4b. Asci 1-spored, ascospores large, 140-240 x 24-50 um.......... M. masonhalei
5a. ‘Thallus containing protocetraric acid present ............... M. pertusarioides
Spy ihallins lackenisprOtecetratic- acide Pesca tautisne ee eawscen cranks teewe cee ala ara Pear get ee ar 6
6a. Apothecia usually emergent, psoromic acid
GIVE HYOSVTIGTONIG agate wes ona wes oeaesgis cane si orecndee orca te M. glaucophaenum
6b. Apothecia immersed to raised, chemistry variable ......................000. 7
7a. “lhallusveontaining olivacétmianknowin: 1.958 yh dt ed ln M. olivaceum
7b. Thallus containing psoromic acid chemosyndrome .................000e 000s 8
8a. Thallus glossy, + free proper exciple,
ascospores usually with 1 vertical septum.................... M. clandestinum
8b. Thallus fissured, areolate, + fused proper exciple,
ascospores consistently transversely septate................... M. microporum
Myriotrema clandestinum (Fée) Hale, Mycotaxon 11: 133, 1980.
= Ocellularia terebratula (Nyl.) Mull. Arg., Mém. Soc. Phys. Genéve 29(8): 12, 1887
The species is characterized by pale greenish to olivaceous corticate
continuous glossy thallus, immersed apothecia, + free proper exciple, small
hyaline transversely 5-6-septate (with one vertical septum) ascospores of 10-27
x 6-8 um, and the presence of psoromic acid.
Myriotrema clandestinum, reported from India by Nagarkar et al. (1988)
as Ocellularia terebratula, has been included in the synonymy of Myriotrema
clandestinum by Mangold et al. (2009). It has a wide distribution in India and
collected from Andaman & Nicobar Islands, Arunachal Pradesh, Karnataka,
Kerala, Maharashtra, and Meghalaya.
SPECIMENS EXAMINED—INDIA. KERALA: Mallapuram district, Wynad area, Thakarpadi,
A. Singh & M. Ranjan, alt. 450 m, on bark 102217 (LWG); Trivendrum Peppara Wildlife
Sanctuary, on bark, 19.10.2006, Biju Haridas, 06-009586 (LWG); Kollam, Rosemala,
27.6.2006, on bark, B. Hardas, 06-009585 (LWG); Tami NApbu: Palni Hills, Perumal
to Palni road side, via short-cut road, alt. 1350-1500 m., on bark, 15.12.1970, K.P. Singh
70.984 (LWG).
Myriotrema desquamans (Mill. Arg.) Hale, Mycotaxon 11: 133, 1980.
= Leptotrema irosinum (Vain.) Zahlbr., Cat. Lich. Univ. 2: 635, 1923
The taxon is characterized by a glossy corticate thallus, small-pored
immersed perithecioid ascomata, a fused proper exciple, and brown muriform
(5-11 x 1-6 septate) ascospores of 20-35 x 8-18 um.
In India the species was reported as Leptotrema desquamans by Patwardhan
& Makhija (1980) and L. irosinum by Patwardhan & Kulkarni (1977a). The
species shows close affinity with Wirthiotrema and forms a non-inspersed
counterpart of W. trypaneoides (Nyl.) Rivas Plata & Liicking (Rivas Plata et al.
Leucodecton and Myriotrema (India) ... 477
2010). In India the species is known from Andaman & Nicobar Islands and
Kerala.
Myriotrema glaucophaenum (Kremp.) Hale, Mycotaxon 11: 133, 1980.
The greenish to yellowish-grey thallus, + free proper exciple, emergent
apothecia, 8-spored asci, transversely 1-7 septate (with single vertical septum)
hyaline ascospores of 10-20 x 5-8 um, and presence of psoromic acid are the
characteristic features of the species. The closely related M. microporum and
M. clandestinum with psoromic acid differs in having a fissured thallus and a
fused proper exciple, respectively. Myriotrema glaucophaenum is unusual in its
Thelotrema-like ascomata that lack lateral paraphyses (Mangold et al. 2009).
Patwardhan & Kulkarni (1977a) reported the species from Kerala as Ocellularia
glaucophaena.
SPECIMEN EXAMINED—INDIA. KERALA: Trivendrum, ABP, Athirumala Pathalamathy,
alt. 1200 m, on bark, 25.04.2006, Biju Haridas 06—009587 (LWG).
Myriotrema masonhalei (Patw. & C. R. Kulk.) Hale, Mycotaxon 11: 134, 1980.
The species is diagnosed by the dark greenish glaucous, wrinkled to warty
thallus, immersed apothecia, a pale-brown fused proper exciple carbonized
at apices, l-spored asci, and oblong-ellipsoid, large (140-240 x 24-50 um)
ascospores.
This psoromic acid containing species is described from Maharashtra by
Patwardhan & Kulkarni (1977) as Thelotrema masonhalei and has also been
reported from Kerala and Karnataka in Western Ghats in India (Singh & Sinha
2010).
Myriotrema microporum (Mont.) Hale, Mycotaxon 11: 134, 1980.
The taxon is readily recognized by a thick areolate fissured dark dull-
grey thallus, numerous small apothecia, a + fused proper exciple, 8-spored
asci, transversely 2-4-septate hyaline ascospores of 10-18 x 5-8 um, and the
presence of psoromic acid chemosyndrome.
Myriotrema microporum shares the same chemical constituents with
M. clandestinum and M. glaucophaenum but differs in the distinctly fissured,
areolate thallus and slightly small transversely septate ascospores. Earlier it was
reported as Ocellularia micropora from Assam, Karnataka, Kerala, Orissa, Tamil
Nadu, and West Bengal (Nagarkar et al. 1988, Singh & Sinha 2010). The species
is found in Western Ghats, eastern Himalayas, and Eastern Ghats in India.
SPECIMENS EXAMINED—INDIA. Assam: North Cachar Hills district, Haflong, on
bark, D.K. Upreti & Jayshree Rout 05-002992 (LWG); KERALa: Idukki district, I.C.R.I.
campus, Myladumpara, alt. ca. 1200 m, on bark, 01.03.1984, D.D. Awasthi & G. Awasthi
84.118, 84.148 (LWG-LWU); on bark of Vateria indica, 01.03.1984, D.D. Awasthi &
G. Awasthi 84.128 (LWG-LWU); Myladumpara to Munnar, Chinnakanal area, alt. ca.
478 ... Joshi, Upreti & Haridas
1350 m, on bark, 02.03.1984, D.D. Awasthi & G. Awasthi 84.228, 84.248 (LWG-LWU);
Santhampara area, alt. ca. 1200 m, on bark, 02.03.1984, D.D. Awasthi & G. Awasthi
84.177 (LWG-LWU); Kallar Munnar Hills, alt. 1140 m, on bark, 14.02.1975, A. Singh
& M. Ranjan 103065 (LWG)); Travancore, Quilon, on bark, 10.08.1953, O.A. Héeg 2580
(LWG-AWAS); Orissa: Ganjam district, on way to Seranga, on bark of Pongamia tree,
03.03.1986, D.D. Awasthi, G. Awasthi, R. Mathur & P. Srivastava 86.127 (LWG-LWU);
TAMIL NADv: Palni Hills, Perumal to Palni road side, via short cut road, alt. 1350-1500
m, on bark, 15.12.1970, K.P. Singh 70.981 (LWG-LWU); Tiger Shola area, along the
road, alt. ca. 1650 m, on bark, 15.12.1970, K.P. Singh 70.1028 (LWG); Shembaganur to
Periakulum, via short cut road, alt. 1650-1800 m, on bark, 14.12.1970, K.P. Singh 70.935
(LWG-LWU).
Myriotrema olivaceum Fée, Essai Crypt. Ecorc. 1: 103, 1825.
The taxon is distinguished by the thallus compound “olivacea unknown,’ a
light greenish-grey to ashy grey smooth fissured areolate thallus, free proper
exciple, 8-spored asci, and small (10-15 x 5-7 um) transversely 2-4-septate
ascospores.
The unusual chemical compounds separate the species from the closely
related M. microporum, which has similar apothecial morpho-anatomical
characters. Nagarkar et al. (1986) reported M. olivaceum (as Ocellularia olivacea)
from Andaman and Nicobar Islands, the only sites reported for India.
Myriotrema pertusarioides (Nagarkar, Sethy & Patw.) D.D. Awasthi, Biblioth.
Lichenol. 40: 3, 1991.
The species is characterized by a pale to yellowish-grey warty thallus,
numerous emergent basally constricted apothecia, a fused reddish-yellow
proper exciple, 8-spored asci, and 15-18 x 10-12 um ascospores with single
transverse and vertical septa.
Nagarkar et al. (1986) described this protocetraric acid-containing species
(as Leptotrema pertusarioides) from the Andaman and Nicobar Islands, where it
appears endemic. However, further taxonomic study is needed, as its apothecial
morphology is unusual for the genus, and it resembles Ocellularia bahiana
(Ach.) Frisch in having protocetraric acid.
Myriotrema rugiferum (Harm.) Hale, Mycotaxon 11: 135, 1980.
This morphologically variable taxon is characterized by a pale-olive to
greyish and greenish-white thick corticate thallus, small immersed apothecia,
a free proper exciple, 4-8-spored asci, and small (15-25 x 7-10 um) hyaline
submuriform (3-6 x 0-3 septate) ascospores. Similar to M. masonhalei,
M. rugiferum contains psoromic acid but differs in having 1-spored asci and
large ascospores. Myriotrema rugiferum has been collected only from tropical
forests of Kerala in India.
Leucodecton and Myriotrema (India) ... 479
SPECIMENS EXAMINED—INDIA. Kerata: Idukki district, [IC.RI. campus,
Myladumpara, alt. ca. 1200 m, on bark, 01.03.1984, D.D. Awasthi & G. Awasthi 84.136,
84.73, 84.83 (LWG-LWU).
Myriotrema subconforme (Nyl.) Hale, Mycotaxon 11: 135, 1980.
Distinguishing features include a pale-olive to greyish-green or greenish-grey
verruculose rather fragile corticate thallus with numerous crystals inclusions,
a free proper exciple, 8-spored asci, and small (10-20 x 6-9 um) submuriform
(3-5 x 1-3 septate) ascospores.
Myriotrema subconforme appears most closely related to M. album Fée,
M. clandestinum, M. myrioporum (Tuck.) Hale, and M. endoflavescens Hale
ex Liicking in lacking thallus compounds. However, all three species differ
from M. subconforme in their mostly transversely septate ascospores, and
M. endoflavescens has a yellow-pigmented medulla (Lumbsch et al. 2011). The
submuriform species, M. rugiferum, contains psoromic acid and has slightly
larger (ca. 0.4 mm) apothecia (Mangold et al. 2009).
Nagarkar et al. (1987) reported M. subconforme (as Thelotrema subconforme)
from Andaman and Nicobar Islands. Reexamination of certain unidentified
preserved specimens from Kerala has extended the range of this species to
Western Ghats.
SPECIMENS EXAMINED—INDIA. KERALA: Palghat district, M.C. mines area, Walayer
forest, alt. ca. 300 m, on bark, 22.03.1985, D.D. Awasthi, R. Tewari & R. Mathur 85.8
(LWG-LWU); Kollam district, rosemala, on bark, 28.06.2006, Biju Haridas 06-009588
(LWG); Trivendrum, ABP, way to Pongalappara, alt. 1145 m, on bark, 26.04.2006, Biju
Haridas 06-009625 (LWG); Tamit Napv: Nilgiri Hills, Awalanche, in Shola near forest
rest house, alt. ca. 2100 m, on bark, 04.01.1971, D.D. Awasthi & K.P. Singh 71.247 (LWG-
LWU).
Discussion
The Graphidaceae flourish well in India and offer a remarkable diversity in
Andaman & Nicobar Islands, eastern Himalayas, and Western Ghats. Of the 18
taxa studied here, 14 species (seven each of Leucodecton and Myriotrema) occur
in Western Ghats, followed by nine (four Leucodecton and five Myriotrema)
reported from Andaman & Nicobar Islands and four species (two each of
Leucodecton and Myriotrema) from eastern Himalayas. Eastern Ghats harbours
Leucodecton occultum and Myriotrema microporum whereas central India is
represented by Leucodecton occultum. Despite the variations in macro-habitat,
tree species, trunk girth, bark texture, and other microclimate variables, it is
noteworthy that thelotremoid lichens exhibit a uniform pattern of association
with other lichens on different trees of tropical rain forests in India. Although
placed in significantly different clades by molecular analysis, Leucodecton and
Myriotrema especially show morphological similarities and share habitats
480 ... Joshi, Upreti & Haridas
over a broad (300-2100 m) altitudinal range. Leucodecton mostly inhabits the
wide tree trunks and associates with other porinoid or lepadinoid species (e.g.,
Myriotrema, Ocellularia, Thelotrema and Wirthiotrema) in comparatively dry
but shaded undisturbed to semi-disturbed mature secondary lowland forests.
Ecorticate taxa retain their rough texture that easily distinguishes them from
neighbouring corticate taxa. However, the corticate shiny hard texture of
certain Leucodecton taxa is so close to some Myriotrema and Ocellularia species
that field identification is difficult. Superficially, the thallus and apothecial
structures in some Leucodecton species (e.g., L. compunctellum) are enough
similar to those in certain Myriotrema species that chemical tests are needed
for correct determination.
Thelotremoid lichens in India are in great need of systematic revision due
to remaining taxonomic and nomenclatural problems. In certain cases the
taxonomically functional characters for species differentiation are not very
sharp (Staiger et al. 2006, Rivas Plata & Lumbsch 2011). In particular, delimiting
species based on ascospore color changing progressively from hyaline to brown
during development is overemphasized, as for Leucodecton anamalaiense,
L. compunctellum, and L. nuwarense. Differentiation between L. compunctellum
and L. nuwarense is based broadly on crystal arrangement and color of the pore
margins, with separation of the two dependent on rather similar characteristics
of apothecia, pore structures, size, and thallus texture (Rivas Plata et al. 2010).
Further, L. fissurinum is treated as a separate species based on such minor
taxonomic features as a regularly fissured thallus and myriotremoid apothecia
with + fused exciple. The closely related L. subcompunctum, which also exhibits
a fissured thallus, does have a diagnostic lepadinoid apothecial morphology.
Likewise, Myriotrema clandestinum differs from M. microporum in its somewhat
smooth thallus, + fused proper exciple, and ascospores with a single vertical
septum. The closely related M. microporum has a fissured thallus, + free proper
exciple, and transversely septate ascospores within the range of M. clandestinum
(Mangold et al. 2009). Species delimitation based on vertical septum as
suggested by Salisbury (1978) has little taxonomic significance. Moreover,
characters like a fissured thallus, a more or less free to fused excipulum, the
arrangement or abundance of crystals, or the involvement of a periderm layer
in the apothecial margins (Frisch 2006; Mangold et al. 2009; Rivas Plata et al.
2010) seem to have little taxonomic importance and should be considered
ecologically influenced variations. Nonetheless, it might be beneficial to know
whether such morphological variations result from genetic differentiation or
phenotypic plasticity (Rivas Plata & Lumbsch 2011, Rivas Plata et al 2011).
The unrevised taxa, M. masonhalei and M. pertusarioides, both with 1-spored
asci, are currently placed in Myriotrema. Occurrence of a single spore is rare
in Myriotrema. Furthermore, the ascospore size in M. masonhalei is unusually
Leucodecton and Myriotrema (India) ... 481
large for Myriotrema, while the basally constricted emergent apothecia in
M. pertusarioides seems more characteristic of Ocellularia, indicating that
both species need further analysis for proper placement. Several thelotremoid
taxa have uncertain positions in either molecular or traditional taxonomic
classification, suggesting that they need to be split into several different taxa or
delimited more broadly to resolve ambiguities at the generic or species levels.
Acknowledgements
We are grateful to the Director of the CSIR-National Botanical Research Institute,
Lucknow, for providing necessary facilities, and the Ministry of Environment and
Forests, New Delhi, for financial support. One of the authors (DKU) also acknowledges
CSIR 12th Five year Plan project (BSC 0106) for financial assistance. Authors are grateful
to Dr. Eimy Rivas Plata and Dr. Pradeep K. Divakar for their thorough observation and
valuable comments on the manuscript. Santosh Joshi thanks Dr. Sanjeeva Nayaka for
helpful suggestions in manuscript preparation.
Literature cited
Awasthi DD. 1991. A key to microlichens of India, Nepal and Sri Lanka. Bibliotheca Lichenologica
40: 1-337.
Awasthi DD. 2000. Lichenology in Indian subcontinent: a supplement to “A Handbook of Lichens”.
Bishen Singh Mahendra Pal Singh, DehraDun, India.
Frisch A. 2006. Contribution towards a new systematic of the lichen family Thelotremataceae |. The
lichen family Thelotremataceae in Africa. Bibliotheca Lichenologica 92: 3-370.
Frisch A, Kalb K, Grube M. 2006. Contribution towards a new systematic of the lichen family
Thelotremataceae. Bibliotheca Lichenologica 92: 1-556.
Hale ME Jr. 1974. Morden-Smithsonian expedition to Dominica: The lichens (Thelotremataceae).
Smithsonian Contributions to Botany 16: 1-46.
Hale ME Jr. 1978. A revision of the lichen family Thelotremataceae in Panama. Smithsonian
Contributions to Botany 38: 1-60.
Hale ME. Jr. 1980. Generic delimitation in the lichen family Thelotremataceae. Mycotaxon 11:
130-138.
Hale ME. Jr. 1981. A revision of the lichen family Thelotremataceae in Sri Lanka. Bulletin of the
British Museum (Natural History), Botany Series 8: 227-332.
Lumbsch HT, Ahti T, Altermann S, Paz ADG, Aptroot A, Arup U, et al. 2011. One hundred new
species of lichenized fungi: a signature of undiscovered global diversity. Phytotaxa 18: 1-127.
Mangold A, Elix JA, Lumbsch HT. 2009. Thelotremataceae. Flora of Australia 57: 195-420.
Nagarkar MB, Sethy PK, Patwardhan PG. 1986. Materials for a lichen flora of the Andaman
Islands-I. Mycotaxon 27: 71-82.
Nagarkar MB, Sethy PK, Patwardhan PG. 1987. Material for a lichen flora of the Andaman Islands-
V. Mycotaxon 29: 335-343.
Nagarkar MB, Sethy PK, Patwardhan PG. 1988. Lichen genus Ocellularia (Family Thelotremataceae)
from India. Biovigyanam 14: 24-43.
Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.
British Lichen Society.
Patwardhan PG, Kulkarni CR. 1977a. A contribution to our knowledge of the lichen flora of India
I: Family Thelotremataceae. Kavaka 5: 1-17.
482 ... Joshi, Upreti & Haridas
Patwardhan PG, Kulkarni CR.1977b. Some new taxa of the family Thelotremataceae from Western
Ghats, SW India. Norwegian Journal of Botany 24: 127-131.
Patwardhan PG, Makhija U. 1980. Nomenclatural note on three species of Anthracothecium.
Bryologist 83: 368-369. http://dx.doi.org/10.2307/3242453
Patwardhan PG, Nagarkar MB. 1980. Notes on some lichens from north east India II: family
Thelotremataceae. Biovigyanam 6: 1-10.
Patwardhan PG, Sethy PK, Nagarkar MB. 1985. A contribution to our knowledge of the lichen
family Thelotremataceae from South India. Biovigyanam 11: 133-140.
Rivas Plata E, Lumbsch HT. 2011. Parallel evolution and phenotypic disparity in lichenized
fungi: a case study in the lichen-forming fungal family Graphidaceae (Ascomycota:
Lecanoromycetes: Ostropales). Molecular Phylogenetics and Evolution 61: 45-63.
http://dx.doi.org/10.1016/j.ympev.2011.04.025
Rivas Plata E, Liicking R, Sipman HJM, Mangold A, Kalb K, Lumbsch HT. 2010. A worldwide key
to the thelotremoid Graphidaceae, excluding the Ocellularia-Myriotrema-Stegobolus clade. The
Lichenologist 42(2): 139-185. http://dx.doi.org/10.1017/S0024282909990491
Rivas Plata E, Hernandez JE, Licking R, Staiger B, Kalb K, Caceres MES. 2011. Graphis is two genera
- a remarkable case of parallel evolution in lichenized Ascomycota. Taxon 60(1): 99-107.
Rivas Plata E, Liicking R, Lumbsch HT. 2012. A new classification for the family Graphidaceae
(Ascomycota: Lecanoromycetes: Ostropales). Fungal Diversity 52(1): 107-121.
http://dx.doi.org/10.1007/s13225-011-0135-8
Salisbury G. 1978. Thelotrema Achariana et Feeana. Nova Hedwigia 29: 405-427.
Sethy PK, Nagarkar MB, Patwardhan PG. 1987. Materials for a lichen flora of the Andaman
Islands-III. Mycotaxon 28(1): 191-198.
Singh KP, Sinha GP. 2010. Indian lichens: an annotated checklist. Botanical Survey of India. Shiva
Offset Press, DehraDun, Uttarakhand.
Staiger B. 2002. Die Flechtenfamilie Graphidaceae. Studien in Richtung einer natiirlicheren
Gliederung. Bibliotheca Lichenologica 85: 1-526.
Staiger B, Kalb K, Grube M. 2006. Phylogeny and phenotypic variation in the lichen family
Graphidaceae (Ostropomycetidae, Ascomycota). Mycological Research 110: 765-772.
http://dx.doi.org/10.1016/j.mycres.2006.05.003
ISSN (print) 0093-4666 © 2012. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/122.483
Volume 122, pp. 483-490 October-December 2012
Three non-hairy species of Leptogium
from China
Hua-Jige Liu’, JING Cao, SHUAI GUAN & QING-FENG Wu
College of Life Sciences, Hebei University, Baoding, 071002, China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Leptogium javanicum is reported as new to China, and L. austroamericanum
and L. sessile are reported as new to mainland China. Descriptions and comments for the
three species and a key to the non-hairy species known from mainland China are presented.
KEY worps — taxonomy, Ascomycota, Peltigerales, Collemataceae, lichenized fungi
Introduction
The lichen genus Leptogium (Ach.) Gray comprises about 189 species
worldwide (Kirk et al. 2008). Of the 34 species reported for China, 22 have been
recorded from the mainland (Wei 1991, Wang et al. 2010, Liu & Guan 2012).
Eight out of 17 non-hairy species have been recognized in mainland China:
Leptogium azureum (Sw. ex Ach.) Mont., L. cochleatum (Dicks.) P.M. Jorg. & P.
James, L. cyanescens (Pers.) K6rb., L. denticulatum Malme, L. lichenoides (L.)
Zahlbr., L. moluccanum (Pers.) Vain., L. plicatile (Ach.) Leight., and L. subazureum
A. Dube & Makhija (Aptroot et al. 2002, Wei 1991).
In this paper, three additional non-hairy species belonging to the genus are
reported. Leptogium javanicum is new to China, and L. austroamericanum and
L. sessile are new to mainland China.
Material & methods
The specimens studied are housed in the Herbarium of Nanjing Normal University
(NNU), the Herbarium of Cryptogams, Kunming Institute of Botany, Academia Sinica
(KUN-L), and Lichen section of Herbarium of Mycology, Academia Sinica (HMAS-
L). A dissecting microscope (Motic SMZ-140) and a light microscope (Motic B2) were
used for the morphological and anatomical studies. A microtome was routinely used for
frozen sections. Photographs were taken with BX51 fluorescence microscope.
484 ... Liu & al.
New records
Leptogium austroamericanum (Malme) C.W. Dodge, Ann. Mo. Bot. Gdn 20: 419
(1933) Fie. 1A-B
THALLUS foliose, 3-8 cm in diam; UPPER SURFACE grey-blue when dry, with
distinct wrinkles, somewhat shiny; LoBEs orbicular, spreading to erect, 4-10
mm broad, the margin entire to irregularly dentate to isidiate; Is1D1A terete,
simple, laminal to marginal, dense, crowded; LOWER SURFACE Similar to upper
surface.
THALLuS 100-150 um thick when moist, with single-layered cortex on
both sides; UPPER CORTEX cells 3-5 um in diam.; LOWER CORTEX cells 4-7 um
in diam.; PHOTOBIONT Nostoc in chains, spherical, 5-6 um in diam.; hyphae
irregularly interwoven.
APOTHECIA not seen.
Corticolous or muscicolous.
SPECIMENS EXAMINED: CHINA. ZHEJIANG PROVINCE, Mt. Jiulongshan, alt. 570 m, on
moss, 28 Apr. 1987, S.F. Chen Z0193 (NNU); GUANGXI PROVINCE, Longsheng County,
on bark, 21 Aug. 1964, M. Zang 776 (NNU); GUANGDONG PROVINCE, Nanxiong
City, alt. 700 m, on moss, 12 May 1978, A.T. Liu 780087 (NNU); YUNNAN PROVINCE,
Yingjiang County, alt. 1200 m, on moss, 20 Jun. 1981, X.Y. Wang, X. Xiao & J.J. Su 3121
(HMAS-L: 031791).
REMARKS — Leptogium austroamericanum is muscicolous or corticolous in
montane forests from Southeast and Southwest China at elevations of 570-1200
m. It has been reported from North America, Australia, New Zealand, India,
and Taiwan (Sierk 1964, Verdon 1990, Galloway 1999, Awasthi & Akhtar 1979,
Aptroot et al. 2002). It is new to mainland China.
Our materials, while similar to those reported in North America in
morphology and anatomy, have thinner lobes (100-250(-300) um in North
America). They are also similar to those reported in Australia, but the latter
often have squamuliform isidia that were not found in our materials. The
materials in New Zealand have isidia granular at first, then become terete and
simple, and are coralloid-branched when mature, while in our materials the
isidia are always terete and simple. Our materials also differ from those found
in India in having larger thalli (1.5-3 cm in India), thicker lobes (60-150 um
in India), and different isidia (terete and simple to branched and squamuliform
in India).
Fic. 1. Leptogium austroamericanum (M. Zang 776, NNU). A. Thallus with isidia. B. Thallus
cross-section, showing corticated surfaces. Leptogium javanicum (L.S. Wang 05-24176, KUN-L).
C. Thallus with apothecia. D. Thallus cross-section, showing corticated surfaces. E. Apothecial
cross-section. F. Vertical section of the central apothecium. G. Ascus with 8 ascospores. Scale bars:
A, C= 1 cm; B, D-F = 100 um; G = 50 um.
Leptogium spp. new to China... 485
486 ... Liu & al.
The species is similar to L. cyanescens in the colour of the thallus, numerous
simple isidia, and rare apothecia. However, in L. cyanescens the thallus is
smooth, not wrinkled. Another closely related species, L. propaguliferum,
produces flattened phyllidia instead of terete isidia.
Leptogium javanicum Mont., Syll. Gen. Sp. Crypt.: 379 (1856) Fic. 1C-G
THALLUuS 4-7 cm in diam., foliose, outline irregular, crisp; UPPER SURFACE
grey-blue when dry, glabrous, smooth, slightly roughened to striate, without
wrinkles, dull; Lopes 3-5 mm broad, often suberect, the margin wavy, entire
to irregularly lacerate, upturned or downturned; 1stp14 and LOBULES absent;
LOWER SURFACE similar to the upper surface, but with sparse, brown to blackish,
1.5-3.0 mm long rhizines. APOTHECIA abundant, dense, laminal to marginal,
1-3 mm in diam., distinctly stalked, at the apex of dome-shaped, vertically
furrowed (when dry) lobes; pisc plane to concave, red-brown; THALLINE
EXCIPLE glabrous, concolorous with the thallus.
THALLuS 20-50 um thick; coRTEX cells on both sides consisting of a single
layer of globular, isodiametrical cells, 5-8 um in diam.; PHOTOBIONT Nostoc in
chains, spherical, 4-6 um in diam.; HYPHAE irregularly interwoven.
APOTHECIA 300-350 um thick; THALLINE EXCIPLE euparaplectenchymatous,
50-100 um at margin, consisting of 4-6 layers of subglobose to ellipsoid
cells; LOWER CORTEX below the apothecium 100-150 wum_ thick,
euparaplectenchymatous, consisting of 7-8 layers of subglobose to ellipsoid,
thin-walled cells; PROPER EXCIPLE not seen; HYMENIUM cir. 130 um high;
SUBHYMENIUM 20-30 um high; ascus clavate, 100-120 x 15-25 um, with
8 ascospores; Ascospores submuriform, ellipsoid, 10-20 x 8-12 um, 3-5
septate transversely, 1 septate longitudinally, obtuse to slightly acute at both
ends.
Corticolous.
SPECIMENS EXAMINED: CHINA. YUNNAN PROVINCE, Pu’er City, alt. 1420 m, 18 Jan.
2005, L.S. Wang 05-24176 (KUN-L), 05-24195 (KUN-L); Menghai County, 11 Oct.
1974, X.J. Li 487 (KUN-L 3558).
REMARKS — Leptogium javanicum is corticolous in montane forests in Yunnan,
Southwest China, at an elevation of about 1400 m. It has been reported in India
(Awasthi & Akhtar 1979), Nepal, the Galapagos Islands, (Bungartz 2008), and
Australia (Verdon 1992). It is new to China.
The Chinese materials are similar to those reported in the Galapagos, but
with smaller ascospores (22-30 x 10-15 um in the Galapagos), less wrinkled
upper surface and furrowed apothecial stalks. It is also similar to those reported
in Australia (Verdon 1992) in having furrowed, hollow stalks that attach to the
upper apothecial margins, but our materials have smaller ascospores (25-35
Leptogium spp. new to China... 487
x 13-15 um in Australia) and less-wrinkled and thinner thalli (60-120 um in
Australia).
Leptogium javanicum can be readily recognized by its apothecia at the apex
of the dome-shaped lobes and its suberect lobes. It also somewhat resembles
L. verrucosum with respect to the thallus colour and poorly developed proper
exciple. However, L. verrucosum has larger ascospores (15-32 x 6-12 um) and
a warty thallus owing to the presence of numerous pycnidia.
Leptogium sessile Vain., Ann. Acad. Sci. Fenn., Ser. A 6(7): 108 (1915) Fic. 2
THALLUS 2-6 cm in diam., foliose; UPPER SURFACE grey-blue when dry,
with distinct wrinkles, shiny; LoBEs orbicular, 5-10 mm broad, the margin
entire and downturned; Istp1a absent; LOWER SURFACE similar to upper
surface. APOTHECIA common, + dense, laminal to submarginal, sessile, 1-2
mm in diam.; pisc plane to concave, red-brown; THALLINE EXCIPLE wrinkled,
concolorous with the thallus.
THALLUuS 170-450 um thick; coRTEX cells on both sides consisting ofa single
layer of globular, isodiametrical cells, 4-5 um in diam.; PHOTOBIONT Nostoc in
chains, spherical, 4-6 um in diam.; HYPHAE irregularly interwoven.
APOTHECIA 550-700 um thick; THALLINE EXCIPLE 4-5 um thick at margin,
consisting of a single-layered, thin-walled, subglobose cells, 4-5 um in diam.,
and an algal layer with loosely to somewhat densely interwoven hyphae; PROPER
EXCIPLE euparaplectenchymatous, 70-120 um thick; HYMENIUM 175-225 um
high; sUBHYMENIUM 50-70 um high; ascus clavate, 100-125 x 10-15 um;
Ascosporgs 8 per ascus, submuriform to muriform, ellipsoidal, 25-35 x 8-13
um, 3-7 septate transversely, 1-2 septate longitudinally.
Corticolous.
SPECIMENS EXAMINED: CHINA. ANHUI PROVINCE, Mt. Huangshan, on bark, 7 Sept.
1974, J.N. Wu & T. Xiang, 740078 (NNU); YUNNAN PROVINCE, Lvchun County, on
moss, 15 May. 1975, XJ. Li, 74-1724 (KUN-L); Ruili City, on bark, 30 Nov. 1980, Y.M.
Jiang, 587-2 (HMAS-L 031787); Weixi County, alt. 2100 m, on bark, 13 July. 1981, X.Y.
Wang, X. Xiao & J.J. Su, 3699 (HMAS-L 031771).
REMARKS — Leptogium sessile is mainly corticolous in montane forests of
Southwest and Southeast China. This species has been reported from North
America and Taiwan (Sierk 1964, Aptroot et al. 2002). It is new to mainland
China.
Our materials are similar to those reported in North America, but with
somewhat thinner lobes (300-500 um thick in North America), and narrower
ascospores (23-35 x 12-16 um in North America). Although the North American
materials have ascospores with 0-2 longitudinal septa (Sierk 1964), no such septa
were found in our materials from China.
A488 ... Liu & al.
Leptogium spp. new to China... 489
Leptogium sessile resembles L. corticola in having a distinctly wrinkled upper
surface, sessile apothecia, and an euparaplectenchymatous proper exciple.
However, L. sessile can be separated by its larger ascospores (16-26 x 10-13 um
in L. corticola) and downturned lobe margins.
Key to the non-hairy Leptogium species in mainland China
1
10
Thallus dark brownish black, often with a reddish tinge.............. L. plicatile
Whallitsere year Ble: os oi on cote baci aie te ete, PY ernie ete Sate hs Neer eAlerts Sk 2
DEUS A STATA: xy aM Ree, ts, lst, hel» Bein wliecl » beesEh pat eet 9 eee Oy arnt» at 3
a Dee OFTESe ake) MIs CaN: Ph AMINE TORR MIE EEA DE On” SLUR), NEVO SURE TOU? SON YOR), SER SRC Rae (RO 5
Stay AE TCA Ly oo Si ae soe 5 deere 9 ne hE ere, PM iene, OS rene cen ht Nid d teNlgn, ble A
Isidia SquammulifOrint:. wi seoa ci 26.0% woot spe ols aie old iat iat L. denticulatum
Thallus pale to dark grayish blue to olive green; isidia granular-furfuraceous,
cylindrical to clavate to lobulate, often branched................. L. cyanescens
Thallus grey-blue; isidia terete, simple................... L. austroamericanum
Pirablerse Stine tly -we RMT Le 5 ef ne ty Sakina toy Reel ay lay afta bead! wAanade ote wide 6
Thallussmoboth-to'sliohtly roushened sc eed, ae kek are hes need ae ae nalgoaa hes 8
Thallus with erect to semi-erect lobes, sometimes forming a dense
CerV/a tou PANNE A AMET a ARE OLRM ch RE On, FAN REM TO, STOR ane cto Raed L. lichenoides
Thallus with numerous, overlapping lobes forms elegant, spreading patches ....7
Lobes distinctly thicker (170-450 um) ........ 02. eee eee eee eee L. sessile
Lobes thinneri(1O0=1S0: pint): oe 2a ns tan in ate te hee L. cochleatum
Apothecia distinctly stalked, at the apex of dome-shaped, vertically furrowed
Gultencd iy) TOROS. o nakee woe ees we low es alec y Mee tice o aigkage v eeioas ¥ eeaee BAe L. javanicum
Apothecia:sessilewot shortly-stipitate occ 2 22a 8 ein chs Sete, te Sele tie Nese lnc nog win tah le 9
Spores larger (25740 % TORTS WIV) he chee ed niin aiiied beatae grew L. subazureum
Spores simalleri(h6=25 x GSPN), eek it ee NE OE PL oe RT oe BEE 2 10
Thallus grey to lead grey, lobes 40-60 um thick................ L. moluccanum
Thallus blue to blue-grey, lobes 50-100 um thick .................. L. azureum
Fic. 2. Leptogium sessile (HMAS-L: 031771). A. Thallus with apothecia. B. Thallus cross-section,
showing corticated surfaces. C. Hymenium with asci. D. Vertical section of the central apothecium
showing euparaplectenchymatous proper exciple with medulla below. E. Thalline margin, showing
euparaplectenchymatous proper exciple and thalline exciple. F Apothecial cross-section. G. Ascus
with 8 ascospores. Scale bars: A = 1 cm; B-F = 100 um; G = 10 um.
A490 ... Liu & al.
Acknowledgements
This study was supported by National Natural Science Foundation of China (31093440,
31000239) and Natural Science Foundation of Hebei Province (C2010000268). The
authors are indebted to Prof. Per M. Jorgensen (University of Bergen) for his kind help
in the identification of Leptogium javanicum. Thanks go to Prof. Jiang-Chun Wei and
Ms. Hong Deng (Institute of Microbiology, Chinese Academy of Sciences), and Mr. Li-
Song Wang (Kunming Institute of Botany, Chinese Academy of Sciences) for sending the
specimens on loan. Thanks go to both Profs. Jae-Seoun Hur (Korean Lichen Research
Institute, Sunchon National University) and Zun-tian Zhao (College of Life Sciences,
Shandong Normal University) for reading and improving the manuscript and for acting
as presubmission reviewers.
Literature cited
Aptroot A, Sparrius LB, Lai MJ. 2002. New Taiwan macrolichens. Mycotaxon 84: 281-292.
Awasthi DD, Akhtar P. 1979. The lichen genus Leptogium (sects. Leptogium, Leptogiopsis and
Homodium) in India. Geophytology 8(2): 189-204.
Bungartz F. 2008. Cyanolichens of the Galapagos Islands - the genera Collema and Leptogium.
Sauteria 15: 139-158.
Galloway DJ. 1999. Notes on the lichen genus Leptogium (Collemataceae, Ascomycota) in New
Zealand. Nova Hedwigia 69(3-4): 317-355.
Kirk PM, Cannon PF, Minter DW, Stalpers JA (eds). 2008. Ainsworth & Bisby’s dictionary of the
fungi. 10th edition. CAB International, Wallingford Oxon. 771 p.
Liu HJ, Guan S. 2012. A new hairy species of Leptogium (Collemataceae) from China. Mycotaxon
119: 413-417. http://dx.doi.org/10.5248/119.413.
Sierk HA. 1964. The genus Leptogium in North America, north of Mexico. Bryologist 67: 245-317.
Verdon D. 1990. New Australasian species and records in the genus Leptogium S. Gray (lichenized
Ascomycotina: Collemataceae). Mycotaxon 37: 413-440.
Verdon D. 1992. Leptogium. Flora of Australia 54: 173-192.
Wang HY, Ren Q, Li HM, Wang HY, Zhao ZT. 2010. Five lichens of Leptogium new to China.
Mycotaxon 111: 161-166. http://dx.doi.org/10.5248/111.161
Wei JC. 1991. An enumeration of lichens in China. International Academic Publishers, Beijing,
China. 278 p.
ISSN (print) 0093-4666 © 2012 Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.491
Volume 122, pp. 491 October-December 2012
Regional annotated mycobiotas new to the Mycotaxon website
ABSTRACT — MycorTaxon is pleased to announce another new species distribution list to
our ‘weblist’ page. The “Checklist of the Argentine Agaricales 5. Agaricaceae” by Niveiro &
Albert6 brings to 100 the free access mycobiotas now available through the MycoTaxon
webpage <http://www.mycotaxon.com/resources/weblists.html>.
SOUTH AMERICA
Argentina
N. Niveiro & E. Alberté. Checklist of the Argentine Agaricales 5. Agaricaceae. 25 pp.
Axsstract — A checklist of species belonging to the family Agaricaceae
(Agaricomycetes) in Argentina is provided. The list includes all species published up
to 2011. Of the 13 genera and 171 species represented, Agaricus and Lepiota have
the greatest number of species names recorded (85 and 37 respectively) followed by
Leucoagaricus (13 species), Leucocoprinus (8) Cystolepiota (7), Macrolepiota (7), and
Cystoderma (4). The remaining genera — Cystoagaricus, Micropsalliota, Chlorophyllum,
Cystodermella, Pheolepiota — are represented by fewer than 3 species each.
ISSN (print) 0093-4666 © 2012 Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/122.493
Volume 122, pp. 493-494 Ooctober-November 2012
NOMENCLATURAL NOVELTIES AND TYPIFICATIONS
PROPOSED IN MYCOTAXON 122
Agaricus murinocephalus R.L. Zhao, Desjardin & K.D. Hyde, p. 189
Arthrinium rasikravindrii Shiv M. Singh, L.S. Yadav, P.N. Singh,
Rahul Sharma & S.K. Singh, p. 452
Boletus atlanticus Blanco-Dios & G. Marques, p. 326
Calonectria nymphaeae Yong Wang bis, S.Y. Qin, P. Tan & K.D. Hyde, p. 181
Caloplaca gyrophorica Jagadeesh, Y. Joshi & G.P. Sinha, p. 304
Clitopilus ravus W.Q. Deng & T.H. Li, p. 444
Coccomyces hubeiensis Y.R. Lin & M.S. Yang, p. 250
Coccomyces ilicis S.J. Wang & Y.R. Lin, p. 288
Coltricia australica L.W. Zhou, Tedersoo & Y.C. Dai, p. 124
Craterellus atratus (Corner) Yomyart, Watling, Phosri,
Piapukiew & Sihan., p. 414
Dendrodontia bispora (Burds. & Nakasone) Guerrero
& C.L.M. Rodrigues, p. 8
Dendrothele syspora C.L.M. Rodrigues & Guerrero, p. 18
Ellisembia heritierae S.C. Ren & X.G. Zhang, p. 83
Ellisembia pistaciae S.C. Ren & X.G. Zhang, p. 85
Exosporium acrocomiae (J.A. Stev.) Chupp ex J.A. Stev. 1975
(lectotypified), p. 62
Geastrum campestre var. famatinum Kuhar & Papinutti, p. 149
Humicola chlamydospora Y.M. Wu & 'T.Y. Zhang, p. 171
Humicola tuberculata Y.M. Wu & T.Y. Zhang, p. 173
Humicola verruculosa Y.M. Wu & T.Y. Zhang, p. 174
Hymenochaete parmastoi S.H. He & Hai J. Li, p. 198
Hypoderma mirabile Y.R. Lin & C.T. Zheng, p. 226
Hypoxylon dengii H.X. Ma, Lar.N. Vassiljeva & Yu Li, p. 2
Lasioderma flavovirens Durieu & Mont. 1845
(lectotypified, epitypified), p. 404
Meliola centellae Pinho & O.L. Pereira, p. 339
Minimelanolocus manifestus Hern.-Rest., R.F. Castafieda, Gené & Guarro, p. 137
Mycena acanthophila J.C. Zamora & Catala, p. 362
494 ... MYCOTAXON 122
Passalora acrocomiae Guatimosim & R.W. Barreto, p. 64
Polyporus submelanopus H.J. Xue & L.W. Zhou, p. 436
Puccinia artemisiae-chamaemelifoliae Aliabadi & M. Abbasi, p. 130
Puccinia crepidis-asadbarensis Aliabadi & M. Abbasi, p. 131
Puccinia jaceae var. elbursensis Aliabadi & M. Abbasi, p. 132
Puccinia punctiformis var. karajensis Aliabadi & M. Abbasi, p.133
Scopinella pyramidospora R.M. Sanchez, L. Giord., F Anderson
& Bianchin., p. 266
Stigmella lycii X.R. Chen & Yan Wang, p. 70
Talaromyces flavovirens (Durieu & Mont.) Visagie, Llimona
& Seifert, p. 404
Terriera angularis Y.R. Lin, F. Zhou & Xiao Y. Wang, p. 356
Ticosynnema R.F. Castaneda, Granados & Mardones, p. 255
Ticosynnema carranzae R.F. Castafieda, Granados & Mardones, p. 256
Tuber huizeanum L. Fan & Yu Li, p. 166
Tuber microverrucosum L. Fan & C.L. Hou, p. 165
Tuber sinoaestivum J.P. Zhang & P.G. Liu, p. 75
Tuber sinosphaerosporum L. Fan, J.Z. Cao & Yu Li, p. 350
Vermiculariopsiella pediculata (J.L. Cunn.) Hern.-Rest., R.E. Castafieda,
Gené & Guarro, p. 138
bad taxonomy
@}
can KILL