MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
VOLUME 124 APRIL-JUNE 2013
Chaetomium jatrophae sp. nov.
(Sharma & al. — PLATE 2, p. 122)
ROHIT SHARMA, artist
ISSN (PRINT) 0093-4666 http://dx.doi.org/10.5248/124 ISSN (ONLINE) 2154-8889
MYXNAE 124: 1-368 (2013)
EDITORIAL ADVISORY BOARD
WEN-YING ZHUANG (2003-2014), Chair
Beijing, China
HENNING KNUDSEN (2008-2013), Past Chair
Copenhagen, Denmark
Scott A. REDHEAD (2010-2015)
Ottawa, Ontario, Canada
SABINE HUHNDORE (2011-2016)
Chicago, Illinois, U.S.A.
PETER BUCHANAN (2011-2017)
Auckland, New Zealand
KAREN HANSEN (2013-2018)
Stockholm, Sweden
Published by
MycoTAaxon, LTD.
P.O. BOX 264, ITHACA, NY 14581-0264, USA
www.mycotaxon.com & www.ingentaconnect.com/content/mtax/mt
© Mycotaxon, LTp, 2013
MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
VOLUME 124
APRIL-JUNE, 2013
EDITOR-IN-CHIEF
LORELEI L. NORVELL
[email protected]
Pacific Northwest Mycology Service
6720 NW Skyline Boulevard
Portland, Oregon 97229-1309 USA
NOMENCLATURE EDITOR
SHAUN R. PENNYCOOK
[email protected]
Manaaki Whenua Landcare Research
Auckland, New Zealand
BooK REVIEW EDITOR
ELSE C. VELLINGA
[email protected]
861 Keeler Avenue
Berkeley CA 94708 U.S.A.
CONSISTING OF I-XII + 368 PAGES INCLUDING FIGURES
ISSN 0093-4666 (PRINT) http://dx.doi.org/10.5248/124.cvr ISSN 2154-8889 (ONLINE)
© 2013. MycoTAxon, LTD.
Iv ... MYCOTAXON 124
MY COTAXON
VOLUME ONE HUNDRED TWENTY-FOUR — TABLE OF CONTENTS
COVER SECTION
CEP PELEE ps tech ono Rt Hl vega eRe eect ASicck OGRE eho RI es Re FeA Ten At EL ees cicck “PA aen ad vii
a chy Fea gee The ha a Micah ES I Sea eee Mal SET ed, WAN to Slay rey PU Sry RAS ib
SUDMESSION PIO CCHUTES 3 25 vs Pearich Youbet vss Red i 2. cae aps Mayme mechanic ok a gs Cah x
OP EPEIOCE LOT Roots B Fhe Ayo. tons hE Se eS Se a oy SY 3 eon ay Re xi
RESEARCH ARTICLES
A new Myrmecridium species from Guizhou, China
CHUN- YU JIE, QING-XIN ZHOU, WEN-SHENG ZHAO, YU-LAN JIANG,
KEVIN D. Hype, Eric H.C. MCKENZIE & YONG WANG
The occurrence of Rutstroemia coracina on Quercus ilex leaves in Spain
RICARDO GALAN, FRANCISCO PRIETO-GARCIA,
ANGELES GONZALEZ & CARLOS ENRIQUE HERMOSILLA
Two species of Cladosporium associated with wood discoloration in Korea
YEONGSEON JANG, YOUNG MIN LEE, GyU-HYEOK KIM & JAE-JIN KIM
Phialophora avicenniae sp. nov., a new endophytic fungus
in Avicennia marina in China
YUE-LIAN Liu, PING-GEN XI, XIAO-LAN HE & ZI-DE JIANG
Ramichloridium strelitziae associated with sooty blotch and flyspeck on
Ravenala madagascariensis in China
BAOJUN Hao, WENHUAN LI, CHEN CHEN, Liu GAo, RONG ZHANG,
BAOTONG WANG, GUANGYU SUN & MARK L. GLEASON
Polycoccum anatolicum sp. nov. on Lepraria incana and a key to
Polycoccum species known from Turkey
MEHMET GOKHAN HALICI, HATICE EsRA AKGUL,
CELALEDDIN OzTURK & Emre KILIG¢
Further additions to the macrolichen mycota of Vietnam
UDENI JAYALAL, ANDRE APTROOT, THI THUY NGUYEN,
NGUYEN ANH DZUNG, SANTOSH JOSHI, SOON-OK OH & JAE-SEOUN HuR
Inonotus niveomarginatus and I. tenuissimus spp. nov.
(Hymenochaetales), resupinate species from tropical China
Hat-You Yu, CHANG-LIN ZHAO & YU-CHENG Dal
Arenariomyces truncatellus sp. nov., an ascomycete on driftwood
from the north coast of Zealand, Denmark J. Kocu
New ascomycete records from Guatemala
RosARIO MEDEL, OSBERTH MORALES,
RANULFO CASTILLO DEL MORAL & ROBERTO CACERES
Coleosporium in Europe STEPHAN HELFER
pA
a
39
45
51
61
69
73
87
APRIL-JUNE 2013... V
Septoglomus titan, a new fungus in the Glomeraceae (Glomeromycetes)
from Bahia, Brazil BRUNO ToMIO GoTo,
ADRIANE FREIRE ARAUJO, ANA CRISTINA FERMINO SOARES,
ARAESKA CARENNA DE ALMEIDA FERREIRA, LEONOR COSTA MaIA,
CARLA DA SILVA SOUSA & GLADSTONE ALVES DA SILVA 101
Geoglossaceous fungi in Slovakia 5. Geoglossum uliginosum:
taxonomy and nomenclature
VIKTOR KUCERA, JOHAN NITARE, PAVEL LIZON & JAN GAISLER 111
A new endophytic species of Chaetomium from Jatropha podagrica
ROHIT SHARMA, GIRISH KULKARNI,
MAHESH S. SONAWANE & YOGESH S. SHOUCHE 117
A contribution to the taxonomy of Lyromma (Lyrommataceae,
lichenized Ascomycota) with a species key
ADAM FLAKUS & EDIT FARKAS 127
Scolecobeltrania, an interesting new microfungus from Venezuela
TERESA ITURRIAGA, ROBERTO FERNANDEZ,RAFAEL F. CASTANEDA-RUIZ,
Davip W. MINTER & ALISSON CARDOSO RODRIGUES DA CRUZ 143
A new species of Pisolithus from Spain
Maria P. Martin, FATIMA DURAN, CHERDCHAI PHOSRI & Roy WATLING 149
A reassessment of excavated Tuber species from China based on
morphology and ITS rDNA sequence data
Li FAN, JIN-ZHONG CAo & Yu Li 155
A new species and a new record of the genus Entoloma from China
JiaN-RuI WANG & TOLGOR Bau 165
Russula atroaeruginea and R. sichuanensis spp. nov. from southwest China
Guo-JiE Li, Qt ZHAO, DONG ZHAO, SHUANG-FEN YUE,
SAI-FE1 L1, HUA-AN WEN & XING-ZHONG Liu 173
Five new Terfezia species from the Iberian Peninsula JuaN-JULIAN BoRDALLO,
ANTONIO RODRIGUEZ, JUSTO M. MUNoz-MOHEDANO,
LaAuRA M. Suz, MARIO HONRUBIA & ASUNCION MorTE 189
Hypochnicium pini, a new corticioid basidiomycete in East Asia
YEONGSEON JANG, SUNG WOOK LEE, YOUNG WOON LIM,
Jin SUNG LEE, NILS HALLENBERG & JAE-JIN Kim 209
Taxonomic studies on Mucor inaequisporus, isolated for the first time
in South America
ANDRE Luiz C.M. DE A. SANTIAGO, ANDRE RODRIGUES,
ENzO M. CANEDO & EDSON R. FILHO 219
Molecular phylogeny reveals Megacollybia virosa is a Cantharocybe
T.K. ARUN KUMAR & P. MANIMOHAN 231
New record of Scedosporium dehoogii from India
ROHIT SHARMA, GIRISH KULKARNI,
MAHESH S. SONAWANE & YOGESH S. SHOUCHE 239
vI ... MYCOTAXON 124
Inocybe nitidiuscula and its ectomycorrhizae associated with
Alnus nitida from Galyat, Pakistan S. ILyas, A. RAZAQ & A.N. KHALID
Xerocomus porophyllus sp. nov., morphologically intermediate between
Phylloporus and Xerocomus
WEN-JUAN YAN, Tai-Hutr Li, MING ZHANG & TING LI
Glomus mume and Kuklospora spinosa: two new species of
Glomeromycota from China
BANG-PING CAI, LIANG-DONG GUO, JUN-YU CHEN & QI-XIANG ZHANG
Russula changbaiensis sp. nov. from northeast China
Guo-J1E L1, DONG ZHAO, SAI-FEI LI,
Hual-JUN YANG, Hua-AN WEN & XING-ZHONG LIU
Studies on three rare coprophilous plectomycetes from Italy
FRANCESCO DOVERI, SABRINA SARROCCO & GIOVANNI VANNACCI
Morphological and genetic characterisation of Beauveria sinensis sp. nov.
from China MING-JUN CHEN, Bo Huana,
ZENG-ZHI LI & JOSEPH W. SPATAFORA
The lichen genus Fissurina (Graphidaceae) in Vietnam
SANTOSH JOSHI, THI , THUY NGUYEN, NGUYEN ANH DzuUNG,
UDENI JAYALAL, SOON-OK OH & JAE-SEOUN Hur
Studies of North American macrofungi, 1. Validation of Lactarius rubidus
comb. nov. and Leccinellum quercophilum sp. nov.
MICHAEL Kuo, ANDREW S. METHVEN,
ANDREW M. MINNIS, & Roy E. HALLING
Cladonia dunensis sp. nov. from southern Brazil, with notes on
the genus in beach dune environments EMERSON LuIz GUMBOSKI,
FLAVIO BEILKE & SIONARA ELIASARO
Coniolepiota spongodes (Agaricaceae, Basidiomycota) in
Bangladesh and China Mp. IqBaL HosEN & ZHU L. YANG
Pertusaria albiglobosa, a new lichen from China QIANG REN
Lichenological notes 6: nomenclatural acts
KERRY KNUDSEN & JANA KOCOURKOVA
Phylloporia tiliae sp. nov. from China Li-We!I ZHou
NOMENCLATURE
Nomenclatural novelties proposed in volume 124
247
255
263
269
2%9
301
309
320
333
341
349
353
361
367
APRIL-JUNE 2013... VII
ERRATA FROM PREVIOUS VOLUMES
VOLUME 122
p-30, table, after Lambertella sp.3 For: Leaf of Pinus sp. | READ: Leaf of Pyrola sp.
p-30, table, after Lambertella sp.8 For: Leaf of Pinus sp. READ: Leaf of Pyrola sp.
VOLUME 123
p. ii, lines 12-13 FOR: SEPPO HUHTINEN (2006-2012) Turku, Finland
READ: KAREN HANSEN (2013-2017) Stockholm, Sweden
p. iv, line 12: FOR: Lichenochora tertia
READ: Lichenochora tertia (Phyllochorales):
p. iv, line 22: FOR: Jatropha podarica READ: Jatropha podagrica
p. vi, line 8: FOR: TEODOR T. DENCHEV, HABIB AHMAD & ABDUL NASIR KHALID
READ: TEODOR T. DENCHEV, ABDUL NASIR KHALID & HABIB AHMAD
vill ... MYCOTAXON 124
PUBLICATION DATE FOR VOLUME ONE HUNDRED TWENTY-THREE
MYCOTAXON for JANUARY-MARCH, VOLUME 123 (I-v1 + 1-495)
was issued on August 1, 2013
APRIL-JUNE 2013 ... IX
REVIEWERS — VOLUME ONE HUNDRED TWENTY-FOUR
The Editors express their appreciation to the following individuals who have,
prior to acceptance for publication, reviewed one or more of the papers
prepared for this volume.
M. Catherine Aime
A. Aptroot
Bita Asgari
Timothy J. Baroni
Reinhard Berndt
Janusz Blaszkowski
Wolfgang von Brackel
Matias J. Cafaro
Paul EF Cannon
Cecilia Cristina Carmaran
R.E Castafieda-Ruiz
Pedro Crous
Yu-Cheng Dai
Kanad Das
FR.M. Dugan
Walter Gams
Genevieve M. Gates
Matteo Gelardi
Sergio P. Gorjon
Josep Guarro
Cécile Gueidan
Shouyu Guo
Ian R. Hall
Samuel Hammer
David L. Hawksworth
G. Sybren de Hoog
Vit Hubka
Seppo Huhtinen
K.D. Hyde
Mikael Jeppson
Evan Benjamin
Gareth Jones
Kerry Knudsen
Patrick R. Leacock
Teresa Lebel
James C. Lendemer
De-Wei Li
Tai-Hui Li
Zongqi Liang
Runjin Liu
Laszl6 Lékés
Guo-zhong Lit
Robert Licking
Marcelo P. Marcelli
P. Brandon Matheny
Patrick McCarthy
Eric H.C. McKenzie
Gabriel Moreno
Salvatore Moricca
Sanjeeva Nayaka
Abdul Rehman Niazi
Lorelei L. Norvell
Fritz Oehl
Esteri Ohenoja
Takamichi Orihara
Beatriz Ortiz-Santana
Todd W. Osmundson
Ka-Lai Pang
Shaun R. Pennycook
Evangelina Pérez-Silva
Leif Ryvarden
Jaya Seelan Sathiya Seelan
Ewald Sieverding
José Ivanildo de Souza
Viacheslav Spirin
Iben Margrete Thomsen
Giuseppe Venturella
Long Wang
A.J.S. Whalley
Pat Wolseley
Jian-Ping Xu
Yi-Jian Yao
Xiu-Guo Zhang
Zhongyi Zhang
Li-Wei Zhou
Wen-Ying Zhuang
X ... MYCOTAXON 124
FOUR STEPS TO SUCCESSFUL MYCOTAXON PUBLICATION IN 2013
Prospective MycotTaxon authors should download instructions PDE, review and
submission forms, and other helpful templates by clicking the ‘file download page’ link
on our INSTRUCTIONS TO AUTHORS page before preparing their manuscript. Below is a
summary of our “4-step’ publication process.
1—PEER REVIEW: Email formatted text and illustration files with a2013 MycoTAxon
Reviewer Comments Form to 2-3 experts for peer review. Authors should (i) ask
peer reviewers to return revisions and comment forms to BOTH authors and Editor-
in-Chief <[email protected]> and (ii) follow reviewer suggestions before
sending revised files to the Nomenclature Editor for nomenclatural review.
2—NOMENCLATURAL REVIEW: Email text files (wiTH tables & captions but No
artwork) to the Nomenclature Editor <[email protected]>
for accession and pre-submission review. The Email message MUST include
‘MycotTaxon on the subject line AND all peer reviewer names+Email addresses in
the message. The Nomenclature Editor will assign accession numbers and return
annotated files with a list of needed corrections to the authors and Editor-in-Chief.
3—FINAL SUBMISSION: After consulting experts and revising manuscripts as
needed, send the (i) completed 2013 MycoTaxon submission form; (ii) separate
text files for main text, tables, and legends; and (iii) art files to the Editor-in-Chief
<[email protected]>. Only text and image files prepared for immediate
publication should be sent at this time. The Editor-in-Chief usually acknowledges
manuscripts and thanks expert reviewers within two weeks, but please wait at
least 14 days before sending a follow-up query (without attachments); this helps
us keep Email traffic to a minimum during Mycotaxon publication deadlines or
temporary closures of the editorial office.
4—FINAL EDITORIAL REVIEW & PRESS PREPARATION: Files not ready for publication
will be rejected or returned to authors for further revision; the Editor-in-Chief gives
tentatvely approved manuscripts a final grammatical and scientific review before
converting all files into publishable format. The PDF proof, bibliographic citation,
and nomenclatural entries are sent to all coauthors for final inspection prior to
publication. After PDF conversion, the Editor-in-Chief corrects ONLY processing
or editorial errors prior to publication but will list corrections of author errors in
the Errata of a subsequent volume for no charge. Authors are expected to arrange
payment of page charges and optional open access fees with the Business Manager
<[email protected]> at this time.
MyYcoOTAXON LTD— www.mycotaxon.com
The MycoTaxon Webmaster <[email protected]> posts general and
subscription information, important announcements, and author forms and templates
on the official MycoTaxon site. The server also hosts the regional mycobiota webpage
for free download of distributional annotated species lists.
MYCOTAXON ONLINE— www.ingentaconnect.com/content/mtax/mt
Mycotaxon publishes four 350-500-page volumes a year. Both open access and
subscription articles are offered.
APRIL-JUNE 2013... XI
FROM THE EDITOR-IN-CHIEF
WELCOME KAREN HANSEN! — We wish to announce - somewhat belatedly
- that Sweden's Karen Hansen (Senior Curator, Kryptogambotanik,
Naturhistoriska Riksmuseet, Stockholm) has been elected to MycoTaxon’s
Editorial Advisory Board. She joins Chair Wen-Ying Zhuang (Beijing), Past
Chair Henning Knudsen (Copenhagen), Scott Redhead (Ottawa), Sabine
Huhndorf (Chicago), and Peter Buchanan (Auckland) on the 2013 Board.
Each member serves a six-year term, standing as Chair in the fifth year and
as Past Chair in his or her final year. We apologize profusely for the editorial
(!) lapse leading to the omission of Karen’s name from the masthead (on p. ii)
of Mycotaxon 123, the first volume for 2013.
MycoTaxon 124 — After some deliberation and in an effort to bring the
journal back on schedule this year, we have closed the delayed April-June
2013 volume at 380 pages. The current volume contains 38 papers by 151
authors (representing 26 countries) and revised by 74 expert reviewers.
Within its pages are one new genus and species (Scolecobeltrania from
Venezuela) and 33 other taxa new to science representing Arenariomyces
from Denmark; Beauveria, Entoloma, Glomus, Inonotus, Kuklospora,
Myrmecridium, Pertusaria, Phialophora, Phylloporia, Russula, Tuber, and
Xerocomus from China; Chaetomium from India; Cladonia and Septoglomus
from Brazil; Coleosporium from Europe; Hypochnicium from East Asia;
Leccinellum from the U.S.A.; Lyromma from Bolivia and Brazil; Pisolithus and
Terfezia from Portugal and/or Spain; and Polycoccum from Turkey.
In addition to range extensions and/or new hosts for previously named
taxa, we also offer new combinations in Aspicilia, Cantharocybe, Lactarius,
and Rutstroemia, newly established synonymies and typifications, and
conclusions from recent mycorrhizal (Inocybe) and monographic (Fissurina
in Vietnam, plectomycetes in Italy, ascomycetes in Guatemala) studies.
The next two volumes will also close ‘early’ to ensure that the four 2013
volumes will not spill over into next year. We shall begin 2014 with a much
shorter turn-around time between final submission and publication, and
hope eventually to return to publishing each volume at the beginning of a
quarter rather than well after!
Warm regards,
Lorelei L. Norvell (Editor-in-Chief)
29 September 2013
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.1
Volume 124, pp. 1-8 April-June 2013
A new Myrmecridium species from Guizhou, China
CHUN- YU JIE“, QING-XIN ZHOU™, WEN-SHENG ZHAO’, YU-LAN JIANG’,
KEVIN D. Hype**, Ertc H.C. MCKENZIE° & YONG WANG'*
"Department of Plant Pathology, College of Agriculture, Guizhou University,
Guiyang 550025, China
? Institute of Agro-Food Science & Technology, Shandong Academy of Agricultural Sciences,
Jinan, Shandong 250100, China
* Department of Plant Pathology, China Agricultural University,
Beijing 100193, Peoples Republic of China
* Institute of Excellence in Fungal Research, and School of Science, Mae Fah Luang University,
Chiang Rai, Thailand
° School of Science, Mae Fah Luang University, Chiang Rai 57100, Thailand
° Landcare Research, Private Bag 92170, Auckland, New Zealand
* CORRESPONDENCE TO: [email protected] OR [email protected]
ABSTRACT — A strain of Myrmecridium was isolated from farmland soil in Guizhou
Province, China. The strain produced distinctive obovoid or fusoid conidia that taper to
a subtruncate darkened hilum at the base that distinguished it from other Myrmecridium
species. Phylogenetic analysis of combined ITS1-5.8S-ITS2 and large subunit rDNA
sequences supported this morphological separation. We describe Myrmecridium obovoideum
as new and provide a key to Myrmecridium species.
KEY worps — asexual fungi, hyphomycetes, molecular phylogeny
Introduction
Arzanlou et al. (2007) established Myrmecridium Arzanlou et al. based on its
hyaline mycelium with pale to unpigmented, pimple-like denticles that produce
obovoid or fusiform conidia, tapering towards a narrowly truncate base with a
slightly prominent unpigmented hilum and schizolytic conidial secession. The
genus belongs in Sordariomycetes and comprises three species and two varieties
(Arzanlou et al. 2007; Crous et al. 2011; Crous et al. 2012).
During a survey of anamorphic ascomycetes, we isolated a strain with
characters of Myrmecridium (Arzanlou et al. 2007) from farmland soil in China.
“C.-Y. Jie and Q.-X. Zhou contributed equally to the manuscript and should be considered as
joint first authors
2 ... Jie & al.
Combined ITS and LSU rDNA sequences were generated from the strain
and analyzed to evaluate the morphological findings. Based on morphology
and DNA sequence comparison, the strain is proposed as Myrmecridium
obovoideum. In the present paper, we provide detailed illustrations and a
description of this new species.
Materials & methods
Morphological and cultural studies
The Myrmecridium specimen — from a farmland soil sample collected from Huaxi
District, Guizhou, China, in 2005 —is deposited in the herbarium of the Department
of Plant Pathology, Shandong Agricultural University (HSAUP), and ex-type strains
are conserved in HSAUP and the Herbarium of Plant Pathology, Guizhou University
(HGUP). The specimen was examined in the laboratory and the taxon is described from
cultures grown at 25°C on potato dextrose agar (PDA). Conidia and conidiophores were
placed in a drop of 85% lactic acid and examined and photographed using a Nikon
80i microscope (Nikon Corporation, Japan) at 400x and 1000x magnification. The
taxonomic determinations were made by comparing with descriptions in the literature.
DNA extraction, amplification and DNA sequencing
Genomic DNA was extracted from colonies grown on potato-dextrose agar (PDA),
using the Fungal gDNA Kit GD2416 (Biomiga, CA, USA) following the manufacturer's
instructions. The universal primers ITS1/ITS4 (White et al. 1990) were used for the
ITS region (ITS1-5.8S-ITS2) amplification, and LROR/LR5 were used for a segment
of the large subunit rDNA (Vilgalys and Hester 1990). Amplification reactions were
performed in a Bio-RAD PTC-200 thermocycler in a 25 ul reaction mixture using the
following final concentrations or total amounts: 5 ng DNA, 1 x PCR buffer (20 mM
Tris/HCl pH 8.4, 50 mM KCl), 1 uM of each primer, 2.5 mM MgCl, 0.25 mM of each
dNTP, 0.5 U of Taq polymerase.
The PCR-amplified DNA fragments were fractionated in 1% agarose gels in 0.5x TBE
buffer and visualized by ethidium bromide staining and UV illumination. Sequencing
was performed with an ABI PRISM 3730 DNA autosequencer using either dRhodamine
terminator or Big Dye Terminator chemistry (Life Technologies™, USA). Sequence data
of the isolates used in the study were deposited in GenBank (TaBLE 1). Alignments are
available in TreeBASE (www.treebase.org/treebase-web/home.html) under the study ID
T3733.
Phylogenetic analyses
Preliminary nucleotide sequence alignments were constructed using Clustal X
1.81 (Thompson et al. 1997). A partition homogeneity test (Farris et al. 1994) was
applied to evaluate the feasibility of combining the datasets. Phylogenetic analyses of
LSU sequences and combined ITS and LSU rDNA sequence were computed using
MP analysis in PAUP* (Swofford 2002). In the MP analyses, trees were inferred using
heuristic search option with tree bisection reconnection (TBR) branch swapping and
1000 random sequence additions, maxtrees were 5000, branches of zero length were
collapsed and all parsimonious trees were saved. Measures calculated for parsimony
Myrmecridium obovoideum sp. nov. (China) ... 3
included tree length (TL), consistency index (CI), retention index (RI), and rescaled
consistence index (RC). Bootstrap analyses (Hillis & Bull 1993) were conducted with
1000 replications.
Results
Phylogenetic analysis
Partition homogeneity tests for combining the two (ITS and LSU) gene
regions yielded a P-value of 0.104, and the two gene/regions were combined
based on the tree topologies and P-value (Cunningham 1997, Dettman et
Myrmecridium phragmitis JQ044425
Myrmecridium schulzeri EU041770
Myrmecridium banksiae JX069871
Myrmecridium flexuosum EU041768
Myrmecridium obvoideum sp. nov KC136140
Rhodoveronaea varioseptata EU041813
Gondwanamyces wingfieldi JQ844903
Pseudoidriella syzygii JQ044421
Seiridium banksiae JQ044422
Diaporthe musigena JF951138
100
Phomopsis subordinaria GQ922519
Pleurothecium obovoideum EU041784
Carpoligna pleurothecii JQ429149
Ophiostoma stenoceras AF 484476
Veronaeopsis simplex EU041820
— 10
Fic. 1. One of the two equally most parsimonious trees of the analyzed ITS and LSU rDNA region/
genes (284 of 1485 characters were parsimony informative). Bootstrap support values of less than
50% are not shown. The tree is rooted with Pleurothecium obovoideum.
A ... Jie & al.
; Myrmecridium flexuosum EU041825
Myrmecridium obvoideum sp. nov KC136139
100 |_| Myrmecridium schulzeri EU041827
50 Myrmecridium phragmitis JQ044444
74
Myrmecridium banksiae YX069855
Rhodoveronaea varioseptata EU041870
50
Ophiostoma stenoceras DQ836904
Diaporthe musigena JF951158
99 Phomopsis asparagi AF 439634
75 Seiridium banksiae JQ044442
100 Polyscytalum algarvense GQ303318
100
Pseudophloeospora eucalypti HQ599593
Gondwanamyces wingfieldii JQ844902
tat Pleurothecium obovoideum EU041841
Carpoligna pleurothecii JQ429237
Veronaeopsis simplex EU041877
— 10
Fic. 2. The most parsimonious tree of the analyzed LSU rDNA gene (206 of 844 characters were
parsimony informative). Bootstrap support values of less than 50% are not shown. The tree is
rooted with Veronaeopsis simplex.
al. 2003). The aligned sequence data matrix contained five taxa (including
the outgroup Pleurothecium obovoideum) and 1485 (546 ITS and 839 LSU)
characters, of which 284 were parsimony informative. Two most parsimonious
trees were obtained, with one chosen to represent the topology of the strict
Myrmecridium obovoideum sp. nov. (China) ... 5
consensus tree (Fic. 1; Tree Length (TL) = 380, CI = 0.956, RI = 0.467, HI
= 0.044, and RC = 0.446). In this tree, five Myrmecridium species clustered
together supported by a 100% bootstrap value. Myrmecridium obovoideum
formed a single branch as the sister clade to the other four species with only
56% bootstrap support.
In order to evaluate the relationship of Myrmecridium with other
ascomycetes, we also generated a parsimonious tree (Fic. 2) based on LSU
rDNA gene region. The alignment with 16 taxa (Veronaeopsis simplex as
outgroup) comprised 844 characters, of which 206 were parsimony-informative
[Tree Length (TL) = 628, CI = 0.67, RI = 0.68, HI = 0.33, and RC = 0.45]. Only
one most parsimonious tree was obtained to represent the topology of the strict
consensus tree selected for presentation (Fic. 2). In this tree, the Myrmecridium
group had a close relationship with Rhodoveronaea and Ophiostoma supported
by a credible bootstrap value (74%), which was consistent with Arzanlou et
al. (2007). However, the connection between Rhodoveronaea and Ophiostoma
received weak support (<50%). Meanwhile, the placement of M. obovoideum
was movable, because it showed a closer relationship with M. flexuosum (de
Hoog) Arzanlou et al. supported by 82% bootstrap value, which differed from
the analysis combined ITS and LSU rDNA gene regions.
Taxonomy
Myrmecridium obovoideum Jie, Y.L. Jiang, McKenzie & Yong Wang bis,
sp. nov. Fig. 3
MycoBank MB 804082
Differs from other Myrmecridium species by its conidia with darkened hilum.
Type: China, Guizhou Province, Guiyang, Huaxi District, isolated from farmland soil,
5 November 2005, Y.L. Jiang (Holotype, HSAUP051001; isotype, HGUP0314; GenBank,
KC136140, KC136139).
EryMo_oey: in reference to the conidial shape of this new taxon.
Colonies on PDA at 25°C for 2 weeks reaching 30 mm diam. ‘The surface
effuse, grayish. Mycelium mostly superficial, partly immersed is contradictory
with lacking aerial mycelium. Conidiophores straight to geniculate-
sinuous, unbranched, subhyaline, 1-8-septate, <280 um tall, 3-3.6 um wide.
Conidiogenous cells terminal, integrated, cylindrical, pale or reddish brown
near the base, gradually becoming paler towards the apex, 50-210 um, often
with 1-6 thin septa, forming a rachis with scattered pimple-shaped denticles
less than 1 um long, sometimes fertile part slightly inflated. Conidia solitary,
aseptate, subhyaline, pale brown, thin-walled, smooth to finely verrucose,
surrounded by a wing-like gelatinous sheath, <1.5 um thick, obovoid or fusoid,
(7-)8-9(-10) x (3-)3.5(-4.2) um, tapering to a subtruncate, slightly thickened
hilum; darkened at rounded end.
6 ... Jie & al.
Fic. 3. Myrmecridium obovoideum (HSAUP051001, holotype) on PDA. a-b. Conidiophores.
c. Rachis with pimple-shaped denticles and slightly inflated fertile part. d. Conidia surrounded by
wing-like gelatinous sheaths. e-f. The thin septa of conidiogenous cells. Scale bars: a-c, e-f = 35
um; d= 10 um.
Myrmecridium obovoideum sp. nov. (China) ... 7
Discussion
Our LSU rDNA sequence analysis clustered Myrmecridium with
Rhodoveronaea (sexual state = Annulatascaceae) and Ophiostoma
(Ophiostomataceae) in the Sordariomycetes. Arzanlou et al. (2007) classified
Myrmecridium as “Incertae sedis (Sordariomycetes)”, and our results confirm
this placement, without any indication of a family affinity.
Only M. schulzeri var. tritici (M.B. Ellis) Arzanlou et al. and M. phragmitis
Crous produce septate conidia. Myrmecridium banksiae Crous differs from
M. obovoideum by its larger conidia (9-14 x 2.5-3.5 um); and M. flexuosum
differs by its smaller conidia (5-9 x 3-4 um). The conidia of M. schulzeri (Sacc.)
Arzanlou et al. var. schulzeri (6-12 x 3-4 um) are also larger than those of our
species. In Myrmecridium only M. obovoideum has conidia with a darkened
hilum, which enlarges the taxonomic criteria of Myrmecridium (Arzanlou et
al. 2007). Our ITS and LSU rDNA sequence analyses also confirmed with high
bootstrap value that our species differs from other Myrmecridium species. The
combined morphological and phylogenetic analysis supports M. obovoideum
as a new species.
Key to Myrmecridium species
Las Pile ofconidia ne td atkeneds5 Act, 0 Aeh, chit lead ubai dn Heald tn tnald a aluonttah sal 2
Ibe Hiltom-ofcomidia darketeden 5 fc. 6.5 242.5 nce pale yeh laine Melee Sale ims M. obovoideum
2a; Comidiawithouy septate, .2 Lin. + iden eg dh sees Pieter a Saber a Atnaes garners Abeta Ss Nees 3
2b. Septate conidia frequently-Observed ... guiicieclaicenglaneetlenes M. schulzeri var. tritici
ba. Conidia mostly lessthani 10. pint lone: sti. cea cshee Gta sda negate Gea co Bet wed ale 4
Sb, Conidiarip to P4afimislon es. isptea ras atls tay nll len cette tes tres steele M. banksiae
dace onidia rounded at the bases) fut. fit.ne PO! Wo hal Wet Weer 1 M. flexuosum
4b. Conidia slightly acuminate at the base......................00 0000. M. phragmitis
4c. Conidia tapering to a subtruncate base................ M. schulzeri var. schulzeri
Acknowledgments
The authors are grateful for pre-submission comments and suggestions provided
by Drs. R.E Castafieda-Ruiz and De-Wei Li. This project was supported by the
National Science Foundation of China (No. 31060005) and the Doctors’ Funding of
Guizhou University (no. 2010014). We are indebted to Prof. Tian-Yu Zhang (Shandong
Agricultural University, China) for supplying the culture of this new species.
Literature cited
Arzanlou M, Groenewald JZ, Gams W, Braun U, Shin HD, Crous PW. 2007. Phylogenetic and
morphotaxonomic revision of Ramichloridium and allied genera. Studies in Mycology 58:
57-93. http://dx.doi.org/10.3114/sim.2007.58.03
8 ... Jie & al.
Crous PW, Summerell BA, Shivas RG, Romberg M, Mel'nik VA, Verkley GJM, Groenewald JZ.
2011. Fungal Planet description sheets: 92-106. Persoonia 27: 130-162.
http://dx.doi.org/10.3767/003158511X617561
Crous PW, Summerell BA, Shivas RG, Burgess TI, Decock CA, Dreyer LL, Granke LL, Guest DI,
Hardy GEStJ, Hausbeck MK, Hiiberli D, Jung T, Koukol O, Lennox CL, Liew ECY, Lombard L,
McTaggart AR, Pryke JS, Roets E Saude C, Shuttleworth LA, Stukely MJC, Vanky K, Webster
BJ, Windstam ST, Groenewald JZ. 2012. Fungal Planet description sheets: 107-127. Persoonia
28: 138-182. http://dx.doi.org/10.3767/003158512X652633
Cunningham CW. 1997. Can three incongruency tests predict when data should be combined?
Molecular Biology and Evolution 14: 733-740. http://dx.doi.org/10.1093/oxfordjournals.
molbev.a025813
Dettman JR, Jacobson DJ, Taylor JW. 2003. A multilocus genealogical approach to phylogenetic
species recognition in the model eukaryote Neurospora. Evolution 57: 2703-2720.
http://dx.doi.org/10.1554/03-073
Farris JS, Kallersj6 M, Kluge AG, Bult C. 1994. Testing significance of incongruence. Cladistics 10:
315-320. http://dx.doi.org/10.1111/j.1096-0031.1994.tb00181.x
Hillis DM, Bull JJ. 1993. An empirical test of bootstrapping as a method for assessing confidence in
phylogenetic analysis. Systematic Biology 42: 182-192.
http://dx.doi.org/10.1093/sysbio/42.2.182
Swofford DL. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version
4.0b10. Sinauer Associates, Sunderland, Massachusetts.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The Clustal X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. Academic Press, New York, U.S.A.
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4239-4246.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.9
Volume 124, pp. 9-20 April-June 2013
The occurrence of Rutstroemia coracina on Quercus ilex leaves
in Spain
RICARDO GALAN!*, FRANCISCO PRIETO-GARCIA?’,
ANGELES GONZALEZ? & CARLOS ENRIQUE HERMOSILLA‘
” Department of Life Sciences, University of Alcala, Alcala de Henares, 28871 Madrid, Spain
? Marqués de la Valdavia 13 A, 28400, Collado Villalba, Madrid, Spain
° Prado Ibarra 29, 28270, Colmenarejo, Madrid, Spain
* Francisco Cantera 11, 1° izda., 09200 Miranda de Ebro, Burgos, Spain
* CORRESPONDENCE TO: [email protected]
AxBsTRACT— ‘The authors report new findings of an apparently rare fungus, Rutstroemia
coracina (Rutstroemiaceae). The species grew on old fallen leaves of Quercus ilex subsp.
ballota at different localities in Guadalajara and Madrid provinces (center of Spain) where it
was first collected in 1983 and subsequent years. The apothecia are described and illustrated
in detail. Microscopic studies, including microtome sections, show a clear gel layer in the
ectal excipulum, which allows assignment in the genus Rutstroemia. Since the type material
deposited in PC is so scanty and deteriorated that any future revision will be impossible, an
epitype is selected here.
Key worps— Ascomycota, Helotiales, foliicolous fungi, taxonomy
Introduction
Palmer (1994) was the first to report the presence of Rutstroemia coracina
from the European continent. This species was initially recorded in Algeria and
was documented only by a coloured plate as “Peziza coracina DR. et Lév. in
Durieu (1848: pl. 28 fig. 4) reproduced here as Fic. 1, which depicts apothecia
(on a Quercus ilex leaf) with egg-shaped spores, paraphyses, and asci. Although
no text accompanied the 1848 protologue, the figure caption published in Durieu
(1869: 10) identified the substrate as the undersurface of a dried Q. ilex leaf and
detailed the individual elements included in the figure. Later Saccardo (1889:
237) provided a brief description as Helotium coracinum, apparently based on
the original figure since no microscopic measurements are given and enquiries
by J.T. Palmer with herb. PAD (Universita degli Studi di Padova) ascertained
that there is no exsiccatum under this epithet in Herb. P.A. Saccardo.
10 ... Galan & al.
The first authentic description seems to be by Dennis (1964: 39-40, fig. 12),
who studied the type collection preserved in PC. Reporting ascospores “11-13
x 5-5.5 um’ and an “[e]xcipulum composed of parallel hyphae with glassy
walls,” he transferred the species to Rutstroemia.
Spooner (1981: 283, 285, fig. 22) redescribed the species from a few apothecia
ona Quercus ilex leaf collected by M.C. Clark in 1977 near Somerset, southwest
England, and recombined it in Lanzia, as he failed to find the “glassy walls”
found by Dennis. He reported similar spore measurements to those mentioned
by Dennis for the type.
In 1992, Palmer visited the Allerford plantation between Bossington and
Porlock, Somerset, where Mr. Clark had collected his leaf, and collected
large samples of dead Q. ilex leaves from different parts of the wood, which
subsequently produced apothecia in natural culture. His measurements for the
living spores (in tap water) were 12.4-16.8 (18.4) x 4.8-7.6 (8) um.
Palmer (1994) also restudied the type remnants in PC and found a minute
fragment (approximately haft an apothecium) among the stipes of immature
apothecia on one of the two spiny leaves of the holotype; although it was not
possible to make a detailed study, he managed to draw ovoid spores without
any sign of guttulation (measuring 10.6-13.9 x 4.5-6.5 (7.3) um), one ascus
(measuring 106 x 12 um), and scarce hyphae suspected to be from the gelatinous
layer in the ectal excipulum protruding as obtuse “hairs” (3.3-6.0 um wide) -
reproduced here as Fic. 2. In addition, Palmer (1994: 226-228, figs 1-5) made
good collections in northern Greece in March 1988, mainly on old, fallen leaves
of Quercus coccifera and Q. ilex on Mount Athos and Mount Olympus but also
on a leaf of Quercus pubescens (= Q. humilis) on Mt Athos.
This species was collected and identified for the first time in Spain by
R.G. in 1983 on old, fallen leaves of Quercus ilex subsp. ballota at Tamajon
(Guadalajara province). The identification was later confirmed by Palmer,
who had the opportunity to record the species in subsequent years, including
collections by Dr. A. Raitviir (Palmer & Galan 1999, Galan 2001). The area is
open with scattered trees (intermixed with Juniperus thurifera), and leaf litter is
sparse. More recently, during a field trip through Guadalajara as part of the XIII
Congress of European Mycologists in Alcala de Henares (September, 1999),
several attendees had the opportunity to collect the species in abundance,
including Drs. B. Spooner, M.M. Nauta and H.O. Baral, who kindly provided
us with herbarium samples. More recent findings of the species by two of us
(E.P.G. & A.G.) on old fallen leaves of Quercus ilex subsp. ballota at Colmenarejo
(Madrid province) allow us not only to widen the distribution of Rutstroemia
coracina in Spain but also to complete its description. In addition, Palmer (pers.
comm.) also recorded and identified this species in 1990 on Minorca (Balearic
Islands, Spain) growing on Quercus ilex leaves.
Rutstroemia coracina on Quercus (Spain) ... 11
Fic. 1. Illustration of the type of Peziza coracina Durieu & Léveille,
Expl. Sci. Algérie, Bot. 1: t. 28, f. 4 (1848).
12 ... Galan & al.
From the beginning, Palmer (1994) found it noteworthy that the greyish
green tinges of apothecia in both freshly collected material or that developed
in damp chambers were overlooked in Spanish material, which more closely
resembled the reddish brown color in the original Algerian plate. That might
suggest the existence of two different taxa, but otherwise all specimens appeared
to be microscopically identical.
Since the type material preserved in PC allows no further revision, we
here select as epitype a very rich Spanish collection (about 30 fallen leaves of
Quercus ilex subsp. ballota, bearing ca. 60-70 apothecia) whose habit, colour,
and microscopic features (mainly ascospore shape and size) match the holotype
very well.
There has been continued controversy since Dennis (1964) reported an
“excipulum composed of parallel hyphae with glassy walls.” This was why the
taxon was first combined in Rutstroemia and why Spooner (1981) transferred
the species to Lanzia, remarking, “I have not been able to find glassy walls.”
Spooner later had opportunity to re examine one of the Greek collections (J.T.P.
4418) identified as R. coracina and agreed entirely with Palmer’s identification.
He noted the presence of gelatinized tissue, which made him review the British
material where he found “a gelatinous matrix to the ectal hyphae, something
which I overlooked when referring the species to Lanzia” (B.M. Spooner, in
letter). The microtome sections (Fics 6, 7) of English, Greek, and Spanish
material show a clear gel layer in the ectal excipulum, although the thickness
is not as prominent as in other Rutstroemia spp. and also is somewhat variable
in width from collection to collection. Nonetheless, we feel that the species was
correctly placed in Rutstroemia by Dennis (1964).
Rutstroemia coracina appears to be known only from Algeria (where the
actual type locality is unknown), Britain (Spooner 1981), Greece (Palmer 1994),
France (Palmer, pers. comm.), Turkey [K(M) 49709 Spooner, pers. comm.],
and Spain.
Materials & methods
Measurements of living cells (marked *) were made in tap water or IKI (1% Lugol’s
solution), with dead cells (marked f) in tap water, Melzer’s reagent (MLZ), KOH
2%, and aqueous cresyl blue (CRB) 0.5%. Line drawings were made using a NIKON
Labophot-2 either by hand without the aid of a camera lucida (C.E.H.) or with a drawing
tube incorporated into the light microscope (R.G.) with magnifications up to 1250x.
Photomicrographs were made with using a NIKON Labophot-2 equipped with phase
contrast and camera. Macroscopic pictures of fructifications in fresh state showing the
general habit were taken in situ (by EP.G.) or at the lab (by C.E.H.). Apothecial colours
are cited according to Locquin (1985). Specimens have been deposited in AH and J.T.P.
(personal herbarium of the late Mr. J. Terence Palmer, currently deposited in CUP)
with additional specimens in H.O.B. (personal herbarium of Hans O. Baral, Tubingen,
Germany) and K.
Rutstroemia coracina on Quercus (Spain) ... 13
NATIONAL HERBARIA
J.T.P. Refis WX institute: Museum D'Histo res NaTa@cwe - abbreviation: PC
De Paris:-LReorato (ae he Cevetoeamis, PARIS
ORTOINAL DETERMINATION: PEZIZA CoRAciN« revid.: = RYTIRRORMA CORACIN'A
Leg. Date: Devi
Locality: ALG &RIA Sle eon A RE erst
~ < © (6% 20. Zo
feziza coraciha DAR er Liv. eet Coops ota ice
ker } ae” Deen cee ! 140
, Neletyous in PC - gy ee 3o 4 Ho $0 yo 100 uo Ps : UK
106 ¥l2 prot, : ¥ y .
Ifolety pus comb nites 2 leaves wired se ff |
typical of We Soiny fon of Puenens ile ,
[luce to ao sheet Untlh one Sepavarted. v
a (e\ 2B Kw. we 4 iN
{6 Se He ae depiokd 1s LE in
Z 2
_ Sei 8 ALGE
01, 2& Fig. 4 of Exot, SO —
Serge mitt tling Namely SN
(A)! “Dyer side dawn wnt alam e-
po 8 |
are ee hth tok ee ee : ~
Ow mi z Secuileaat dice QORS ‘
ob D chi den wry
Lore, caine ae
Pert za Coracina de et Lev,
<<
~33.|
Rg V3 “
jaa és
~Phae Be H
R2 5-9
IAB RS -l
Fic. 2. Rutstroemia coracina (holotype, PC): Annotations and drawings by J.T. Palmer showing
excipular hyphae and an ascus (up), ascospores, and “hyphoid” hairs (down).
14 ... Galan & al.
Fic. 3. Rutstroemia coracina (AH 7641, epitype) growing in natural habitat.
Photo EPG. in situ (bar = 10 mm).
=a Pe. see. ee et” a Ora}
Fic. 4. Apothecia of Rutstroemia coracina (C.E.H. 08468) under hi
Photo C.E.H. ex situ (bar = 1 mm).
gh
Rutstroemia coracina on Quercus (Spain) ... 15
Taxonomy
Rutstroemia coracina (Dur. & Lév.) Dennis, Persoonia 3: 39 (1964) Fics. 1-7
= Peziza coracina Dur. & Lév., Expl. Sci. Algérie, Bot. 1: t. 28, f. 4 (1848)
= Helotium coracinum (Dur. & Lév.) Sacc., Syll. Fung. 8: 237 (1889)
= Calycina coracina (Dur. & Lév.) Kuntze, Revis. Gen. Pl. 3(3): 448 (1898)
= Ciboria coracina (Dur. & Lév.) Boud., Hist. Class. Discom. Eur.: 106 (1907)
= Lanzia coracina (Dur. & Lév.) Spooner, Trans. Br. Mycol. Soc. 76: 283 (1981)
Type: Algeria (Holotype, PC). Spain, Madrid, Colmenarejo, UTM 30TVK1489, 885
m a.s.l., on petioles, lower (more exceptionally upper) faces and veins of fallen leaves
of Quercus ilex subsp. ballota, 27.X1.2011, Prieto & Gonzalez, det. R.G. , rev. C.E.H.
(Epitype designated here, AH 7641).
APOTHECIA superficial, scattered, cupulate, stipitate, castaneus to reddish-
brown, merging from darkened areas of the substrate. pisc slightly concave
becoming plane, flesh colour (ie., russus B4f) to yellowish-olivaceous (i.e.,
venetus S2d), tending to darken with age, 0.5-2.0 mm in diameter. RECEPTACLE
cupulate, covered with a sparse and irregular net of brown fibrils, vertically
arranged with adpressed ends, sometimes protruding and giving a fringed
appearance, colour similar to or concolorous with disc and stipe, sometimes
chestnut (with varying reddish brown shades). MARGIN ochre, chestnut to
reddish-brown, crenulate. sTIPE equal in length to or longer than disc diameter,
reddish-brown often almost black at the base, 0.3-3.0(-6.0) mm long. ECTAL
EXCIPULUM composed of three layers: outer zone, 12-38 um thick, formed of
some sparse rows of loosely branched, flexuous, brown hyphae (3.7-5.5 um
in diam. +) arranged parallel to the surface, with thin walls encrusted with
pigment giving a typically banded aspect and protruding as agglutinated
“hairs” on flank and stipe or in groups as “clavate hairs” at the margin to form
teeth; the medial layer of textura oblita, 15-60 um thick, formed of flexuose,
subhyaline to light pale ochre hyphae, arranged parallel or at a low angle to
the surface, with very narrow lumina and strongly gelatinized walls; the inner
zone of imprecise thickness, formed of prismatic to doliform cells (textura
prismatica) and not well delimited from the medullary excipulum, hyphae 5-
10 um (ft) in diameter, with pale chestnut content and thin walls. MEDULLARY
EXCIPULUM well developed, of textura intricata and subhyaline cells with thin,
smooth walls (3-5 um in diam. ft). SUBHYMENIUM compact, poorly developed
and indistinguishable from the medullary area, apart from the brownish colour
and highly intricate texture. asci 8-spored, cylindric-clavate, tapering at base
to form a slender stalk, emerging from croziers, a round, truncate to fissured
apex, with a long pore outlined J+ (deep blue) in both IKI and Melzer’s reagent,
125-152 x11-13 um (*), 110-130(-140) x9-11 um (+). spores biseriate to
uniseriate or irregularly biseriate (in dead state), hyaline, ellipsoid to elliptic-
16 ... Galan & al.
fusoid, slightly inequilateral, regularly unicellular, rarely one to three-septate
when over-mature, exceptionally producing subglobose microconidia (2-2.5
um * diam.) at one or both apices, with high number of globose lipid bodies
(1-2 um) occupying most of the cytoplasm in the living spores (multiguttulate),
forming two large distinct apical drops in dead state by coalescence, measuring
14-17(-18) x 6-7.5 um (*), 12-15(-16.8) x (5—)5.5-6.8(—7.2) um (+). PARAPHYSES
straight, filiform to subclavate ca. 2-2.5 um diam. (*), enlarged to 4—-5.5 um (*)
at the apex, sparsely septate, simple or branched below, equaling or scarcely
exceeding the asci in length, bearing brown to reddish-brown vacuolar contents
(“refractive vacuolar bodies” sensu Baral 1985) in the living state.
ADDITIONAL SPECIMENS EXAMINED: SPAIN, GUADALAJARA, Tamajon, surroundings
of Ermita del Humilladero, on a fallen leaf of Quercus ilex subsp. ballota in an open
mixed wood (with Juniperus thurifera) with scattered trees and leaf litter sparse on
the ground, 18.XI.1983, Galan, Moreno & Checa, det. R.G., rev. Palmer (AH 6235;
duplicate, J.T.P. as permanent slides); on stromatized petioles and veins of fallen old
Quercus ilex subsp. ballota leaves, 3.X1I.1984, Galan, Moreno & Palmer, det. J.T.P. (J.T.P.
4125); 3.XII.1991, Galan & Raitviir, det. R.G. & J.T.P. (AH 6720; duplicate, J.T.P. 4695).
Cifuentes, between Oter and Carrascosa de Tajo, on fallen leaves of Quercus ilex subsp.
ballota, 25.1X.1999, Nauta & Spooner, det. J.T.P. (J.T.P. 4978; duplicates, AH 7334, K).
Mirabueno, surroundings, 1000 m a.s.l., on side and veins of fallen leaves of Quercus ilex
subsp. ballota lying on ground, 24.1X.1999, Baral & Marson, det. Baral, rev. J.T.P. (J. T-P.
4977; duplicates, AH 7335, H.O.B. 6477E). MAprRID, Colmenarejo, UTM 30TVK1489,
885 ma.s.l., on petioles, lower (more exceptionally upper) faces and veins of fallen leaves
of Quercus ilex subsp. ballota, 18.X1.2011, det. R.G. (AH 7640); 11-XII.2011, det. EP, rev.
C.E.H. (C.E.H. 08468). ENGLAND, SoMERSET, between Allerford and Bossington,
on old, fallen leaves of Quercus ilex sampled, (apothecia developed in damp chamber
from 26.[V—30.V.1992), 20.11.1992, Palmer, det. J.T.P., rev. R.G. (J.T.P. 4713; duplicate,
AH 6813); (J. T-P. 4714; duplicate, AH 6812). GREECE, Maceponlia, Athos Mountain,
surroundings of Monastery Iveron, on stromatized fallen leaves of Quercus ilex subsp.
ilex, 25.11.1988, Palmer, det. J.T.P., rev. R.G. (J.T.P. 4415; duplicate, AH 6604).
CoMMENTS—There are at least three additional Rutstroemia species usually
or occasionally reported from decaying Quercus leaves: R. sydowiana (Rehm)
W.L. White (widely distributed at the Mediterranean basin) with “allantoid”
spores (nearly ovoid, with basally bent beaks); R. petiolorum (Roberge ex Desm.)
W.L. White (typically reported on Fagus leaves in Europe but occasionally also
appearing on Quercus leaves) with allantoid to reniform spores with small polar
gel caps; and R. latispora K.S. Thind & Saini, later transferred to Lambertella
(Spooner 1987), found on Quercus incana leaves in the north-west Himalayas,
having asymmetrical and much broader ascospores and longer asci than the two
previous species (Thind & Saini 1968). In addition Rutstroemia “kalevi” Baral
(ined.), which that could be misidentified as R. coracina (despite its Mollisia-
like vacuoles in the paraphyses and narrower spores) grows on stromatized
veins and petioles of Acer spp. in Central Europe (Baral & Marson 2005).
Rutstroemia coracina on Quercus (Spain) ...
Fic. 5. Rutstroemia coracina (AH 7641, epitype): A. Apothecia in their natural habitat (bar =
10 mm); B. Enlarged view of fresh apothecia (bar = 1 mm); C. Cross section of an apothecium
(marginal region) (bar = 50 um); D. Encrusted wall of hyphae of the outer ectal excipulum
(bar = 5 um); E. Hymenium showing asci arising from croziers and paraphyses (bar = 50 um);
F, apex of a mature ascus with an euamyloid ring (bar = 10 um); G. Paraphyses containing
many refractive vacuolar bodies in apical cells (bar = 5 um); H. Free 0-3-septate ascospores,
exceptionally forming small conidia on germ tubes (bar = 20 um). Mountants: tap water,
except fig. F (IKI). Watercolour by C.E.H.
17
18 ... Galan & al.
Rutstroemia coracina on Quercus (Spain) ... 19
Fic. 6 (left). Rutstroemia coracina: A. Radial section of an apothecium (AH 6812; bar = 200 um);
B. Frontal view of the outer ectal excipulum forming marginal teeth (AH 6604; bar = 50 um);
C. Radial section of an apothecium at middle flanks showing a three layered ectal excipulum
(AH 6812; bar = 50 um); D, E, G, H. Asci with ascospores (AH 6235; bar = 20 um for D, G, H;
25 um for E); F. Mature asci, free spores and tips of paraphyses (AH 7641; bar = 25 um). Mountants:
2% KOH (figs. A, B & C); CRB (figs. D & H); MLZ (figs. E & G); tap water (fig. F). Dead state except
fig. F. Photographs by R.G. & C.E.H. (fig. F). Abbreviations: outer (= oee), medial(= mee) and inner
(= iee) layers of the ectal excipulum; medullary excipulum (= me).
Fic. 7 (above). Rutstroemia coracina (AH 6812): A. Radial section of an apothecium (bar = 200 tm);
B. Enlarged view of an apothecium (bar = 100 um), at flank and margin, showing: the outer
(= oee), medial(= mee) and inner (= iee) layers of the ectal excipulum; medullary excipulum
(= me); hymenium (= h). Dead state (KOH 2%). Drawings by R.G. & C.E.H.
20 ... Galan & al.
Acknowledgements
We would like to thank Dr. Richard P. Korf for suggestions and improvement in
English grammar. Also to A. Pueblas of the “Gabinete de Dibujo y Fotografia Cientifica”
at the Alcala University for their invaluable help in the digital preparation of the
photographs. We are grateful to Dr. Scott LaGreca (CUP), Dr. J. Rejos (AH), Dr. B.M.
Spooner & Dr. B. Aguirre-Hudson (K), Mme J. Perreau (PC) for providing institutional
specimens data, and Dr. M.N. Nauta and H.O. Baral for information on Rutstroemia
coracina in their personal herbaria. One author (R.G.) extends his gratitude to the late
Mr. J.T. Palmer for invaluable help with sclerotiniaceous fungi and a lifetime friendship.
Finally, we wish to express our gratitude to Dr. S. Huhtinen and Dr. W.-Y. Zhuang for
reviewing the manuscript and for their useful comments.
Literature cited
Baral HO. 1985. Vital versus herbarium taxonomy: morphological differences between living and
dead cells of Ascomycetes, and their taxonomic implications. Mycotaxon 44: 333-390.
Baral HO, Marson G. 2005. In vivo veritas. Over 10000 images of fungi and plants (microscopical
drawings, water colour plates, photo macro- & micrographs), with materials on vital taxonomy
and xerotolerance. DVD, 3rd edition.
Dennis RWG. 1964. Remarks on the genus Hymenoscyphus S. F. Gray, with observations on sundry
species referred by Saccardo and others to the genera Helotium, Pezizella or Phialea. Persoonia
3: 29-80.
Durieu de Maisonneuve MC. 1848. Exploration Scientifique de Algérie pendant les années 1840,
1841, 1842, Botanique vol. 1(livr. 8): 281-320, pl. 28, 38, 41, 54, 59, 83. Paris: Imprimerie
Impériale.
Durieu de Maisonneuve MC. 1869. Exploration Scientifique de [Algérie pendant les années 1840,
1841, 1842, Botanique, Atlas: 1-39. Paris: Imprimerie Impériale.
Galan R. 2001. Informacion coroldgica relativa a las familias Orbiliaceae y Sclerotiniaceae en la
Peninsula Ibérica e Islas Baleares. Notas a los numeros 1624-1676. 13-14, 101-139, in: F Pando,
JC Hernandez (eds). Bases Coroldgicas de Flora Micoldégica Ibérica. Adiciones y numeros
1572-1765. Madrid (CSIC).
Locquin MV. 1975. Guide des couleurs naturelles. Saint Clément, France.
Palmer JT. 1994. Sclerotiniaceae aus Nordgriechenland. Z. Mykol. 60(1): 225-230.
Palmer JT, Galan R. 1999. Undescribed or poorly known Sclerotiniaceae from the Mediterranean
basin and beyond. XIII Congress of European Mycologists. Book of Abstracts. Alcala de
Henares: 101.
Saccardo PA. 1889. Discomyceteae et Phymatosphaeriaceae. Sylloge Fungorum 8: 3-859.
Spooner BM. 1981. New records and species of British microfungi. Trans. Brit. Mycol. Soc. 76:
265-301.
Spooner BM. 1987. Helotiales of Australasia: Geoglossaceae, Orbiliaceae, Sclerotiniaceae,
Hyaloscyphaceae. Bibliotheca Mycologica 116: 1-711.
Thind KS, Saini SS. 1968. The Helotiales of India VII. Proceedings of the Indian Academy of
Sciences — Plant Sciences 67(4): 141-147.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/124.21
Volume 124, pp. 21-29 April-June 2013
Two species of Cladosporium associated with
wood discoloration in Korea
YEONGSEON JANG, YOUNG MIN LEE, GYU-HYEOK KIM & JAE-JIN K1m*
Division of Environmental Science & Ecological Engineering,
College of Life Sciences & Biotechnology, Korea University
5-1 Anam-dong, Seongbuk-gu, Seoul, 136-701, Korea
*CORRESPONDENCE TO: [email protected]
AxBstTRACT — During our previous study on the diversity of molds inhabiting wood, many
Cladosporium isolates were collected and phylogenetically identified. Among them were
isolates of two species previously unrecorded from Korea. Here, we confirm the isolates as
Cladosporium perangustum and C. ramotenellum and provide descriptions and illustrations
of cultural and microscopic characters on standard media. We draw attention to a broadening
of the range of several characters for C. ramotenellum and to possible alternative phylogenetic
relationships of C. perangustum when comparing our multi-gene analysis with previous
analyses.
KEY worDs — ascomycetes, phylogeny, taxonomy
Introduction
Cladosporium Link is one of the most widely known (ifunder-studied) molds.
It is a cosmopolitan genus with more than 772 names (Dugan et al. 2004) and
recently Bensch et al. (2012) recognized a total of 169 Cladosporium species.
It has been isolated from air, soil, and many other substrates (Schubert et al.
2007, Bensch et al. 2010, 2012). Members are variously known to be saprobic,
endophytic, or plant pathogenic (Schubert et al. 2007, Bensch et al. 2010, 2012).
In Korea, about 20 Cladosporium species have been reported (Min 1985, Shin
& Braun 1995, Shin & Im 1999, Kwon et al. 2000, 2001, Paul & Yu 2008, Korean
Society of Plant Pathology 2009, Bensch et al. 2010). Recently Lee et al. (2012)
phylogenetically examined Cladosporium representatives inhabiting wood
products in Korea and recognized nine Cladosporium species. Among them
were C. perangustum and C. ramotenellum, not previously recorded in Korea.
Here, we confirm their identities by morphology and phylogenetic re-analysis
and provide detailed descriptions and figures for these two Cladosporium
species.
22 ... Jang & al.
Materials & methods
Morphological examination
Four Cladosporium isolates, KUC1462, KUC1767, KUC3027, and KUC5085 studied
by Lee et al. (2012) were used in this study. They were inoculated onto SNA (Synthetic
nutrient-poor agar: KH,PO, 1 g, KNO, 1 g; MgSO,°7H,O 0.5 g; KCI 0.5 g; glucose 0.2
g; sucrose 0.2 g; agar 20 g; distilled water 1000 ml) and cultivated at 25°C for 7 days.
Preparations were mounted in Shear’s solution (CH,COOK 3 g; distilled water 150
ml; glycerin 60 ml; 95% ethanol 90 ml) according to Crous et al. (2009). Microscopic
observations were made using an Olympus BX51 light microscope (Olympus, Tokyo,
Japan) and photos were taken using the same microscope and an Axio Imager Al
microscope (Zeiss, Jena, Germany). For determination of cultural characteristics,
colonies were cultivated on PDA (Potato dextrose agar, Difco), MEA (Malt extract agar:
malt extract 30 g; agar 15 g; distilled water 1000 ml), and OA (Oatmeal Agar, Difco)
at 25°C for 14 days in the dark. The isolates were deposited at the National Institute of
Biological Resources, Incheon, South Korea (KB) with the acronym KUC, which refers
to the Korea University Culture Collections, Korea University, Seoul, South Korea.
Phylogenetic analysis
DNA sequences of four Cladosporium isolates (KUC1462, KUC1767, KUC3027,
KUC5085) from the internal transcribed spacer (ITS), actin (ACT), and translation
elongation factor-la (TEF) regions were obtained from Lee et al. (2012). ITS, ACT,
TEF sequences were aligned separately with the reference sequences from Bensch et
al. (2010) using MAFFT 6.885 (Katoh & Toh 2008). The L-INS-I alignment option was
used for all datasets. Each dataset was manually edited with MacClade 4.08 (Maddison
& Maddison 2005). Gaps were treated as missing. The best-fit model was applied for
each dataset using AIC in MrModeltest 2.3 (Nylander 2004) and the three datasets were
combined. Bayesian analysis was performed with the combined dataset using MrBayes
3.2.1 (Ronquist et al. 2012). Two independent runs (four chains each) of 705,000
generations were performed and every 100th tree was sampled. The first 25% of sampled
trees were discarded and the remaining 75% were used for construction of a 50% major-
rule consensus tree. The graphic representation of the likelihood scores of the sampled
trees was checked. The standard deviation of split frequencies is below 0.01 and the
potential scale reduction factor (PSRF) was close to 1.0. The tree was viewed via FigTree
1.3.1 (http://tree.bio.ed.ac.uk/software/figtree/).
Taxonomy
Cladosporium perangustum Bensch, Crous & U. Braun, Stud. Mycol. 67: 65. 2010.
Fics 1-2
Mycelium internal and superficial; 1.5-4 um wide, septate, sometimes slightly
constricted at septa, sometimes intercalary swellings and constrictions present,
subhyaline or pale olivaceous-brown, smooth or verruculose. Conidiophores
macronematous or micronematous arising terminally and laterally from hyphae,
straight or slightly curved, filiform to narrowly cylindrical-oblong, unbranched,
occasionally branched, conidiophores 14-142 x 2-3.5 um, pale olivaceous-
Cladosporium species discoloring wood (Korea) ... 23
B
Fic. 1. Cladosporium perangustum (KUC1767) grown in 9 cm diam Petri dishes for 14 d at 25°C.
A: PDA. B: MEA. C: OA.
]
Fic. 2. Cladosporium perangustum. A, B. Macro- and micronematous conidiophores (KUC1462).
C. Ramoconidia and conidia (KUC1767). Scale bar = 10 um.
brown, asperulate-verruculose towards the base of conidiophores, at the apex
smooth, sometimes slightly attenuated towards the apex. Conidiogenous cells
integrated, mainly terminal, sometimes also intercalary, narrowly cylindrical-
24 ... Jang & al.
oblong, in intercalary cells loci situated on small peg-like lateral prolongations
or just below the septum, 13-36 um long, with 1-4 apically crowded loci.
Ramoconidia cylindrical-oblong, up to 44 um long, 2.5-3.5 um wide, rarely
septate, base truncate, secondary ramoconidia narrowly ellipsoid to cylindrical-
oblong, 8-21 x 2-3 um (av. + SD: 13.7 + 4.1 x 2.5 + 0.2), with 2-4 distal hila, pale
olivaceous-brown. Conidia numerous, catenate, in branched chains, branching
in all directions, 1-4 conidia in the terminal unbranched part of the chain,
small terminal conidia globose, subglobose or ovoid to obovoid, 2-3.5 x 1.5-2
um (av. + SD: 2.9 + 0.4 x 1.8 + 0.2), intercalary conidia ovoid, limoniform to
ellipsoid, somewhat fusiform, 4-8.5 x 2-3 um (av. + SD: 5.9 + 1.4 x 2.2 + 0.2),
attenuated towards apex and base, with 1-3 distal hila, pale olivaceous-brown.
CULTURE CHARACTERISTICS Colonies on PDA attaining 32-38 mm diam
after 14 d at 25°C, greenish grey to dull green, reverse olive or dark green, fluffy,
floccose or powdery, margins glabrous, whitish, olive grey or pale regular or
somewhat undulate, aerial mycelium loosely floccose or felty, occasionally
numerous small to large prominent exudates formed, sporulation abundant.
Colonies on MEA reaching 20-29 mm diam after 14 d at 25°C, dark green or
brown, reverse olive brown, velvety to floccose, margins white to light yellow,
narrow to broad, regular to undulate, glabrous, aerial mycelium abundantly
formed, sometimes covering most parts of colony surface, loosely to densely
floccose or felty, growth habit plane to sometimes elevated, sporulation
abundant. Colonies on OA 35-49 mm diam after 14 d at 25°C, grey to dark
green, fluffy to felty-floccose, margins colorless or white, up to 2 mm diam,
aerial mycelium abundant, covering large parts of the colony surface, dense,
low to high, white, sporulating profusely.
SPECIMENS EXAMINED: KOREA, GYEONGSANGBUK-DO, Bonghwa-gun, on the surface
of Pinus densiflora log, 05 June 2001 (KB, KUC1462; GenBank JN033481, JN033508,
JN033536); GYEONGSANGNAM-DO, Pusan, on the surface of Pinus radiata log, August
2000 (KB, KUC1767; GenBank JN033468, JN033495, JN033523); INCHEON, on the
log surface of Picea abies, 16 June 2007 (KUC5085; GenBank JN033460, JN033487,
JN033515).
REMARKS — The colony morphology and microscopic features of the isolates
agreed well with the description of C. perangustum (Bensch et al. 2010). The
fungus has been reported from Africa, Asia, Australasia, Europe, and North
America. According to Bensch et al. (2010), Cladosporium exile Bensch et
al. and C. scabrellum Bensch et al. are similar to C. perangustum but C. exile
has longer and wider conidiophores, wider ramoconidia and conidia, and
shorter intercalary conidia. Cladosporium scabrellum differs in having mainly
macronematous, wider conidiophores, and wider secondary ramoconidia.
Compared to the other species studied by Lee et al. (2012), C. perangustum
showed medium discoloration on Pinus densiflora and Pinus radiata.
Cladosporium species discoloring wood (Korea) ... 25
Fic. 3. Cladosporium ramotenellum (KUC3027) grown in 9 cm diam Petri dishes for 14 d at 25°C.
A: PDA. B: MEA. C: OA.
Cladosporium ramotenellum K. Schub., Zalar, Crous & U. Braun, Stud. Mycol. 58:
137. 2007. FIGS 3-4
Mycelium internal and superficial, 1.5-4 um wide, septate, without
swellings and constrictions, hyaline or subhyaline, smooth. Conidiophores
macronematous and micronematous, arising terminally or laterally from
branches of plagiotropous hyphae, straight or slightly flexuous, oblong or
cylindrical, unbranched, sometimes branches often only as short lateral
prolongations, 15-117 x 2-3.5 um, septate, pale olivaceous-brown or brown,
smooth to verruculose. Conidiogenous cells integrated, terminal, sometimes
also intercalary, cylindrical, 15-49 um long, proliferation sympodial, with
few conidiogenous loci, mostly 1-3, loci sometimes situated on small lateral
prolongations. Ramoconidia cylindrical-oblong, up to 46.5 um long, 2-3.5
um wide, usually 0-1-septate, pale olivaceous, smooth or verruculose, with a
broadly truncate base, secondary ramoconidia subcylindrical to cylindrical-
oblong, 12.5-22 x 2-4 um (av. + SD: 18 + 4 x 3.1 + 0.5), pale olivaceous,
apex broadly rounded or slightly attenuated towards apex and base. Conidia
numerous, catenate, in branched chains, branching in all directions, small
terminal conidia numerous, 1-3 conidia in the terminal unbranched part of
Le
Fic. 4. Cladosporium ramotenellum (KUC3027). A, B. Macro- and micronematous conidiophore.
C. Ramoconidia and conidia. Scale bars = 10 um.
26 ... Jang & al.
the chain, globose, subglobose or ovoid, obovoid, 3.5-7 x 2-3 um (av. + SD: 4.3
+ 0.7 x 2.5 + 0.3), intercalary conidia ellipsoid to subcylindrical, or limoniform,
4-11 x 2.5-4(-4.5) um (av. + SD: 6.6 + 1.6 x 3 + 0.3).
CULTURE CHARACTERISTICS Colonies on PDA reaching 41-47 mm diam
after 14 d at 25°C, olive due to abundant sporulation, margins entire, white,
glabrous, aerial mycelium absent or sparse, growth flat with a somewhat folded
and wrinkled colony center, no exudates, sporulation profuse. Colonieson MEA
reaching 46-49 mm diam after 14 d at 25°C, olive, velvety, greyish green to dark
green in reverse, margins entire, colorless, glabrous to feathery, aerial mycelium
sparse, diffuse, growth flat with slightly elevated colony center, prominent
exudates not formed, abundantly sporulating. Colonies on OA attaining 39-41
mm diam after 14 d at 25°C, olivaceous, margin entire, colorless or white, aerial
mycelium sparse, growth flat, without exudates, sporulation profuse.
SPECIMEN EXAMINED: KOREA, on the surface of Chromated Copper Arsenate (CCA)-
treated wood product (Pinus radiata), 2003 (KUC3027; GenBank JN033464, JN033491,
JN033519).
REMARKS — The colony morphology and microscopic features of our isolate
agreed well with the description of C. ramotenellum (Schubert et al. 2007),
although it has smaller intercalary conidia and secondary ramoconidia.
The fungus previously has been reported only from Slovenia. According
to Schubert et al. (2007), C. ramotenellum resembles C. cladosporioides
(Fresen.) G.A. de Vries and C. tenellum K. Schub. et al. but differs from C.
cladosporioides by having narrower conidiophores and conidia. Cladosporium
tenellum possesses conidiophores with numerous conidiogenous loci, and
shorter and wider conidia. Also, C. ramotenellum grows faster in culture than
C. tenellum. Cladosporium ramotenellum showed a discoloration rate similar
to C. perangustum on Pinus densiflora, but a little bit more prominent than
C. perangustum on Pinus radiata (Lee et al. 2012).
Phylogeny
The resulting alignment contained 36 taxa (including the outgroup taxon)
and 481, 139 and 201 characters (including alignment gaps) were used in
the ITS, ACT and TEF partitions, respectively. The model used for ITS was
SYM+G model. For ACT and TEE, HKY+I+G model and GTR+G model were
used, respectively. For the Bayesian analysis, 10,705 trees were obtained from
which the consensus tree and posterior probabilities were calculated (Fic. 5).
The species relationships in the tree were sometimes not as well resolved as
in previous studies, or resolved differently (Bensch et al. 2010, Bensch et al.
2012). The phylogenetic analysis revealed that Cladosporium perangustum
isolates, KUC1462, KUC1767 and KUC5085 were clustered within the
C. perangustum species clade with a high posterior probability value (1.0
Cladosporium species discoloring wood (Korea) ... 27
Cladosporium perangustum KUC1767 (JN033468)
Cladosporium perangustum KUC1462 (JN033481)
Cladosporium perangustum CBS 125996 (HM148121)
Cladosporium perangustum CPC 13870 (HM148142)
1p Cladosporium perangustum CPC 11046 (HM148125)
Cladosporium perangustum KUC5085 (JN033460)
Cladosporium exasperatum CBS 125986 (HM148090)
1f Cladosporium chalastosporoides CBS 125985 (HM148001)
Cladosporium hillianum CBS 125988 (HM148097)
Cladosporium scabrellum CBS 126358 (HM148195)
Cladosporium phyllophilum CPC 13873 (HM148155)
Cladosporium licheniphilum CBS 125990 (HM148111)
Cladosporium varians CBS 126362 (HM148224)
4 Cladosporium chubutense CBS 124457 (FJ936158)
Cladosporium colombiae CBS 274.80B (FJ936159)
Cladosporium pini-ponderosae CBS 124456 (FJ936160)
Cladosporium asperulatum CBS 126340 (HM147998)
Cladosporium myrtacearum CBS 126349 (HM148116)
Cladosporium funiculosum CBS 122128 (HM148093)
Cladosporium pseudocladosporioides CPC 14992 (HM148192)
Cladosporium australiense CBS 125984 (HM147999)
ip Cladosporium cucumerinum CBS 176.54 (HM148078)
Cladosporium subuliforme CBS 126500 (HM148196)
Cladosporium xylophilum CPC 14364 (HM148234)
Cladosporium delicatulum CPC 14363 (HM148088)
Cladosporium inversicolor CPC 14368 (HM148109)
Cladosporium lycoperdinum CBS 274.80C (HM148114)
Cladosporium basiinflatum CBS 822.84 (HM148000)
0.81
0.67,
0.59
0.61., | Cladosporium ramotenellum CPC 12047 (EF679385)
Cladosporium ramotenellum KUC3027 (JN033464)
Cladosporium ramotenellum CPC 12043 (EF679384)
Cladosporium spinulosum CBS 102044 (EF679387)
Cladosporium iridis CBS 138.40 (EF679370)
Cladosporium ossifragi CBS 843.91 (EF679382)
Cercospora beticola CPC 11557 (AY840527)
Fic. 5. 50% majority-rule consensus tree of 10,575 trees resulting from a bayesian analysis of 36
sequences in a combined ITS, ACT, and TEF alignment. Bayesian posterior probabilities 250%
are shown. The tree was rooted to sequences of Cercospora beticola strain CPC 11557. GenBank
Accession numbers of ITS sequences are shown in parentheses.
28 ... Jang & al.
p-p.). In our analysis, C. perangustum was sister to C. exasperatum Bensch et
al., a result differing substantially from the analysis of Bensch et al. (2010). In
our analysis, Cladosporium ramotenellum KUC3027 was monophyletic with
C. ramotenellum CPC 12047, but not with C. ramotenellum CPC 12043 and
CBS 170.54. Also the monophyly of C. ramotenellum KUC3027 and CPC
12047 was weakly supported (61% posterior probability value). Nevertheless,
the cultural and microscopic observations of our C. ramotenellum KUC3027
were consistent with the descriptions of C. ramotenellum (Schubert et al. 2007;
Bensch et al. 2010).
Acknowledgments
This research was supported by Basic Science Research Program through the
National Research Foundation of Korea (NRF) funded by the Ministry of Education
(NRF-2013R1A1A2A10011390) and was funded by the project on survey and excavation
of Korean indigenous species of NIBR under the Ministry of Environment, Republic
of Korea. We are grateful to Dr. Pedro Crous and Dr. FM. Dugan for their valuable
suggestions on the manuscript.
Literature cited
Bensch K, Groenewald JZ, Dijksterhuis J, Starink-Willemse M, Andersen B, Summerell BA, Shin
H-D, Dugan FM, Schroers H-J, Braun U, Crous PW. 2010. Species and ecological diversity
within the Cladosporium cladosporioides complex (Davidiellaceae, Capnodiales). Stud. Mycol.
67: 1-94. http://dx.doi.org/10.3114/sim.2010.67.01
Bensch K, Braun U, Groenewald JZ, Crous PW. 2012. The genus Cladosporium. Stud. Mycol. 72:
1-401. http://dx.doi.org/10.3114/sim0003
Crous PW, Verkleij GJM, Groenewald JZ, Samson RA (eds). 2009. Fungal biodiversity. CBS
Laboratory Manual Series 1. Centraalbureau voor Schimmelcultures, Utrecht, Netherlands.
Dugan FM, Schubert K, Braun U. 2004. Check-list of Cladosporium names. Schlechtendalia 11:
1-103.
Katoh K, Toh H. 2008. Recent developments in the MAFFT multiple sequence alignment program.
Briefings Bioinf. 9: 286-298. http://dx.doi.org/10.1093/bib/bbn013
Korean Society of Plant Pathology. 2009. List of plant diseases in Korea, 5th edn. The Korean
Society of Plant Pathology, Suwon, Korea.
Kwon J-H, Kang S-W, Park C-S. 2000. Occurrence of sword bean scab caused by Cladosporium
cucumerinum in Korea. Mycobiology 28: 54-56.
Kwon J-H, Kang S-W, Park C-S. 2001. Occurrence of strawberry scab caused by Cladosporium
herbarum in Korea. Mycobiology 29: 110-112.
Lee YM, Jang Y, Kim G-H, Kim J-J. 2012. Phylogenetic analysis and discoloration characteristics
of major molds inhabiting woods. Part 3. Genus Cladosporium. Holzforschung 66: 537-541.
http://dx.doi.org/10.1515/hf.2011.184
Maddison D, Maddison W. 2005. MacClade 4: Analysis of phylogeny and character evolution.
Version 4.08. Sinauer Associates, Sunderland, MA, USA.
Min KH. 1985. Some undescribed Cladosporium, Alternaria, Curvularia and Eurotium repens in
Korea. Kor. J. Mycol. 14: 1-8.
Nylander JAA. 2004. MrModeltest v2. Evolutionary Biology Center, Uppsala University, Uppsala,
Sweden.
Cladosporium species discoloring wood (Korea) ... 29
Paul NC, Yu SH. 2008. Two species of endophytic Cladosporium in pine trees in Korea. Mycobiology
36: 211-216. http://dx.doi.org/10.4489/MYCO.2008.36.4.211
Ronquist FE, Teslenko M, Mark P van der, Ayres D, Darling A, Hohna S, Larget B, Liu L,
Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic
inference and model choice across a large model space. Syst. Biol. 61: 539-542.
http://dx.doi.org/10.1093/sysbio/sys029
Schubert K, Groenewald JZ, Braun U, Dijksterhuis J, Starink MS, Hill CF, Zalar P, Hoog GS de, Crous
PW. 2007. Biodiversity in the Cladosporium herbarum complex (Davidiellaceae, Capnodiales),
with standardisation of methods for Cladosporium taxonomy and diagnostics. Stud. Mycol. 58:
105-156. http://dx.doi.org/10.3114/sim.2007.58.05
Shin H-D, Braun U. 1995. Cladosporium alliicola sp. nov. on Allium victorialis var. platyphyllum.
Kor. J. Mycol. 23: 139-143.
Shin H-D, Lee H-T, Im D-J. 1999. Occurrence of German iris leaf spot caused by Cladosporium
iridis in Korea. Plant Pathol. J. 15: 124-126.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/124.31
Volume 124, pp. 31-37 April-June 2013
Phialophora avicenniae sp. nov., anew endophytic fungus
in Avicennia marina in China
YUE-LIAN Liu*?, PING-GEN XI, XIAO-LAN HE! & ZI-DE JIANG"
‘College of Natural Resources and Environment, South China Agricultural University,
Guangzhou 510642, China
Agricultural College, Guangdong Ocean University, Zhanjiang 524088, China
*CORRESPONDING AUTHOR: [email protected]
ABSTRACT — Three isolates of an endophytic fungus were obtained from Avicennia marina.
Morphological and molecular evidence indicates that they are identical and represent a new
species of Phialophora, described here as P. avicenniae. The new species is characterized by
brown colonies, branched conidiophores, and catenulate conidia.
Key worps — Herpotrichiellaceae, ITS sequence, taxonomy
Introduction
The morphologically vaguely delimited hyphomycete genus Phialophora
Medlar is characterized by dark and slow-growing colonies, pigmented
hyphae, solitary or aggregated conidiophores, and flask-shaped phialides
usually with a flaring collarette. The type of Phialophora is P. verrucosa Medlar,
diagnosed by its slow-growing dark olivaceous colonies and usually pigmented
phialides bearing an even darker collarette (Medlar 1915). Phialophora has
been regarded as highly polyphyletic, comprising anamorphs of discomycetes,
pyrenomycetes, and loculoascomycetes (Gams 2000). Gams & Holubova-
Jechova (1976) distinguished sect. Catenulatae with catenate conidia having a
truncate base. Some members of this section and other phialophora-like species
with catenulate conidia, such as Brachyalara straminea Réblova & W. Gams,
Exochalara longissima (Grove) W. Gams & Hol.-Jech., and Infundichalara
microchona (W. Gams) Réblova & W. Gams, have been segregated from
Phialophora by molecular phylogeny analyses and morphological characters
(Bogale et al. 2010; Réblova et al. 2011). Phialophora s. str. is recognized as a
member of the Herpotrichiellaceae (Untereiner et al. 1995).
32 ... Liu & al.
We obtained three isolates of an endophytic fungus from twigs of Avicennia
marina (Forssk.) Vierh. (Acanthaceae) in Zhanjiang, Guangdong Province,
China, in 2007. The taxonomic status of these isolates was determined using
morphological and molecular methods, showing them to represent a new
Phialophora species. The isolates are stored in the laboratory of the Agricultural
College, Guangdong Ocean University, and subcultures at CBS in Utrecht, the
Netherlands.
Materials & methods
Isolates
Healthy twigs (0.4-0.8 cm diam.) of Avicennia marina were thoroughly washed in
running tap water and then sterilized by washing in 75% ethanol for 2 min and 0.1%
mercuric chloride (vw) for 2 min. The twigs were rinsed 3 times in sterile distilled water
and then cut into pieces (0.5 cm in length). The small pieces were evenly spaced in
Petri dishes (9 cm diam) containing a medium (Arnold et al. 2000) consisting of (per
litre distilled water) dextrose 20 g, peptone 10 g and agar 20 g, with addition of 60 mg
streptomycin before pouring the plates. The Petri dishes were incubated at 27°C. Hyphal
tips were transferred to potato dextrose agar (PDA) dishes.
Morphological examination
Three cultures of every isolate grown on PDA plates were investigated for colony
characteristics. Thirty conidia were measured under an OLtympus-BX51 microscope.
Scanning electron microscopy (SEM) was used to observe phialide morphology.
Specimens were flash-frozen (—196°C) in liquid nitrogen under vacuum for cryo-SEM,
transferred to the preparation chamber, and then to the SEM chamber where ice particles
were sublimated (—80°C). Samples were sputter-coated with E-1010 in the preparation
chamber for 75 sec under 2.0 KV at -170°C. Specimens were viewed under 5 KV at
-188°C with a Puitips SL30 scanning electron microscope.
DNA extraction, PCR amplification, DNA sequencing, and phylogenetic analyses
After the isolates were grown and incubated on PDA plates at 27°C for 10 days, the
mycelia were scraped off. Genomic DNA was extracted from the mycelia using SDS
procedure (Lee & Taylor 1990) with a few modifications. The quality and quantity
of DNA were visually assessed by staining with ethidium bromide in 1% agarose gel
electrophoresis. The partial ITS sequences were amplified according to Geiser et al.
(2005) using primers ITS1 and ITS4 (White et al. 1990) in TP600 (TaKaRa PCR Thermal
Cycler Dice). Shanghai Invitrogen Biotechnology Co., Ltd. sequenced the DNA. The ITS
sequences of the isolates were aligned using MEGA version 4.1 (Tamura et al. 2007)
and manually optimized to ensure positional homology. Gaps were considered as
missing data. Seventeen sequences of Phialophora and one sequence of an unidentified
ascomycotan species were downloaded from GenBank, and Capronia semiimmersa
(Herpotrichiellaceae) was chosen as outgroup. A phylogenetic tree was constructed using
the neighbor-joining method of MEGA version 4.1 (bootstrapped 1000 replicates).
Phialophora avicenniae sp. nov. (China) ... 33
Taxonomy
Phialophora avicenniae Yue L. Liu & Z.D. Jiang, sp. nov. Fras. 1-2
MycoBank MB561173
Differs from Phialophora clavispora and P. olivacea by its branching conidiophores and
endophytic habit and from P oxyspora by its ovoid to globose conidia and endophytic
habit.
Type: China, Guangdong Province, Zhanjiang, endophytic in twig of Avicennia marina,
18 April 2007, Liu Yuelian Q37 (Holotype, CBS 130286 [lyophilized culture]; GenBank,
GQ500118).
EryMo.ocy: named after the host genus, Avicennia.
COLONIES initially yeast-like, gradually becoming cottony, brown, reaching 2-3
cm diam. after 5 days at 27°C on PDA plates; reaching 9 cm diam. after 14
Figure 1. Phialophora avicenniae (CBS 1302876). a. Colony; b-f. Conidiophores; g. Phialides;
h-l. Conidial chains. Scale bars: b-f, h-] = 10 um; g = 2 um.
34 ... Liu & al.
FiGuRE 2. Phialophora avicenniae. Conidiophore and conidia. Bar = 10 um.
days and changing from brown to black-brown. HyPHAE hyaline to subhyaline,
smooth; occasionally brown, verrucose, 1.5-3.0 um wide. CONIDIOPHORES
hyaline or brown, branched, rarely simple, septate, smooth, and variable in size.
PHIALIDES usually aggregated on conidiophores, flask-shaped or cylindrical,
hyaline or brown, smooth and thick-walled, 6.5-11 x 1.8-3.5 um. Collarette
somewhat darker than the phialide body, funnel-shaped or flaring, 0.5-1.0 x
0.3-0.5 um. Conip14 catenulate, hyaline or brown, 1-celled, smooth, ovoid to
globose, slightly apiculate at the base, 1.6-2.5 x 1.8-3.5 um. CHLAMYDOSPORES
absent.
TELEOMORPH: unknown
Hasirat: endophytic in twigs of Avicennia marina.
ADDITIONAL CULTURES EXAMINED: CHINA. GUANGDONG PROVINCE, Zhanjiang,
endophytic in twigs of Avicennia marina, 10 August 2007, Liu Yuelian Q44 (CBS 130287;
GenBank, HM055753); Liu Yuelian Q48 (CBS 130288; GenBank, HM055754).
Phialophora avicenniae sp. nov. (China) ... 35
Notes: Phialophora verrucosa, the type of Phialophora, differs from the new
species by olivaceous-black colonies and broadly ellipsoidal conidia adhering
in slimy heads. The new species resembles P. clavispora W. Gams, P. olivacea
W. Gams, and P. oxyspora W. Gams by its catenulate conidia. However,
P. clavispora and P. olivacea have simple conidiophores, and P oxyspora has
fusiform conidia (Gams & Holubova-Jechova 1976). In addition, the new species
is endophytic, while the other three species are so far only known as saprobes.
Phylogenetic analyses
ITS rDNA sequences obtained from the isolates of CBS 130286, CBS
130287, and CBS 130288 were submitted to GenBank and received the
P. olivacea AB190379
P. reptans EUS14699
66
P. europaea EF540756
74
P. sessilis EUS14700
54 P. oxyspora AB190870 clade |
@ CBS 130286 GQ500118.1
@ CBS 130287 HM055753.2
98 | @ CBS 130288 HM055754.1
54 Ascomycota sp. FJ037728
P. japonica AB190378
@ P. verrucosa DQ404353
P. clavispora AB190868
P. chrysanthemi AB190387
8 | en P. intermedia AB190399
P. cyclaminis AB190390
so P. geniculata AB190395
1004 P. alba AB190382 ciate I
53 P. atrovirens AB190383
100 P. foetens AB190394
57 P. cinerescens AB190388
91®© P. mustea JN1I23359
Capronia semiimmersa FJ225726
4
0.1
FiGuRE 3. Phylogenetic tree based on neighbor-joining of ITS sequences, showing the relationships
among Phialophora avicenniae and related species.
36 ... Liu & al.
accession numbers GQ500118, HM055753, and HM055754. BLast (Basic
Local Alignment Search Tool) analysis showed that the ITS sequences are 99%
similar to an unidentified strain labeled “Ascomycota sp. GX6-1C” (GenBank
FJ037728; isolated as an endophyte from an unknown mangrove host in
China) and 79-87% similar to various GenBank isolates of Phialophora spp.
A neighbor-joining analysis shows the relationships of the three strains with
17 other species of Phialophora (Fic. 3). The phylogram also shows that the
unidentified strain forms a monophyletic clade (bootstrap 98%) with the three
P. avicenniae strains, and is probably conspecific.
The Phialophora species shown here form two distinct clades (clade I and
clade II) where P. avicenniae is part of clade I (bootstrap 54%), showing a sister
relationship with P olivacea, P. reptans, P. sessilis, P europaea, and P. oxyspora.
Acknowledgements
We express our sincere thanks to Prof. W. Gams who revised the manuscript and
deposited the strains in CBS. We also thank Prof. Yi-Jian Yao (Key Laboratory of
Systematic Mycology and Lichenology, Institute of Microbiology, Chinese Academy of
Sciences) for reviewing the manuscript. The authors are grateful to Dr. Martina Réblova
(Department of Taxonomy, Institute of Botany, Academy of Sciences, Prihonice, Czech
Republic) for providing valuable suggestions. This study was supported by the National
Science Foundation of China (No. 30870015).
Literature cited
Arnold E, Maynard Z, Gilbert G, Coley PD, Kursar TA. 2000. Are tropical fungal endophytes
hyperdiverse. Ecology Letters 3: 267-274. http://dx.doi.org/10.1046/j.1461-0248.2000.00159.x
Bogale M, Orr MJ, O'Hara MJ, Untereiner WA. 2010. Systematics of Catenulifera (anamorphic
Hyaloscyphaceae) with an assessment of the phylogenetic position of Phialophora hyalina.
Fungal Biology 114: 396-409. http://dx.doi.org/10.1016/j.funbio.2010.02.006
Gams W. 2000. Phialophora and some similar morphologically little-differentiated anamorphs of
divergent ascomycetes. Studies in Mycology 45: 187-199.
Gams W, Holubova-Jechova V. 1976. Chloridium and some other dematiaceous hyphomycetes
growing on decaying wood. Studies in Mycology 13: 62-99.
Geiser DM, Lewis-Ivey ML, Hakiza G, Juba JH, Miller SA. 2005. Gibberella xylarioides
(anamorph Fusarium xylarioides), a causative agent of coffee wilt disease in Africa, is a
previously unrecognized member of the G. fujikuroi species complex. Mycologia 97: 191-201.
http://dx.doi.org/10.3852/mycologia.97.1.191
Lee SB, Taylor JW. 1990. Isolation of DNA from fungal mycelia and single spores. 283-287, in: MA
Innis et al. (eds), PCR protocols: a guide to methods and applications. Academic Press, New
York.
Medlar EM. 1915. A new fungus, Phialophora verrucosa, pathogenic for man. Mycologia 7:
200-203. http://dx.doi.org/10.2307/3753363
Réblova M, Gams W, Stépanek V. 2011. Thenewhyphomycete genera Brachyalara and Infundichalara,
the similar Exochalara and species of Phialophora sect. Catenulatae (Leotiomycetes). Fungal
Diversity 46: 67-86. http://dx.doi.org/10.1007/s13225-010-0077-6
Phialophora avicenniae sp. nov. (China) ... 37
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics
Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599.
http://dx.doi.org/10.1093/molbev/msm092
Untereiner WA, Straus NA, Malloch D. 1995. A molecular-morphotaxonomic approach to
the systematics of the Herpotrichiellaceae and allied black yeasts. Mycological Research 99:
897-913.
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols; a guide to
methods and applications. Academic Press, New York, USA.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.39
Volume 124, pp. 39-45 April-June 2013
Ramichloridium strelitziae associated with sooty blotch and
flyspeck on Ravenala madagascariensis in China
BAojJUN HAo*?, WENHUAN LI**?, CHEN CHEN’, Liu GAo’, RONG ZHANG’,
BAOTONG WANG', GUANGYU SUN" & MARK L. GLEASON?
'State Key Laboratory of Crop Stress Biology in Arid Areas and College of Plant Protection,
Northwest A&F University, Yangling, Shaanxi, 712100, P. R. China
*Department of Plant Pathology, Iowa State University, Ames, Iowa 50011, USA
College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, P. R. China
“CORRESPONDENCE TO: [email protected]
ABSTRACT — ‘The first report of Ramichloridium strelitziae from China is documented. In
a survey of host plants for SBFS fungi, we isolated the fungus from colonies on stems of
Ravenala madagascariensis collected from Haikou, Hainan, China. It is distinguished from
the other species in the genus by morphological characters and phylogenetic analysis based
on ITS sequences.
KEY worps — microfungi, Capnodiales, taxonomy, phylogeny, traveller's palm
Introduction
Sooty blotch and flyspeck (SBFS) are epiphytes that colonize the waxy
cuticle of a wide range of plants in humid regions worldwide. SBFS fungi can
result in a black or sooty appearance leading to cosmetic damage that can cause
significant economic losses (Batzer et al. 2005).
For approximately 70 years, SBFS was viewed as two distinct diseases, each
caused by a single species of fungus. Recently, this concept was revised by
combining morphological characterization with genetic analysis. Presently,
it is evident that SBFS includes a spectrum of intergraded mycelial types and
comprises more than 80 species (Batzer et al. 2008, Frank et al. 2010, Gleason
et al. 2011, Liet al. 2012, Yang et al. 2010).
In this study, we identified one isolate that was described as the first record
of R. strelitziae on stems of Ravenala madagascariensis Sonn. (Strelitziaceae;
traveller's palm) from China based on morphological comparison and
phylogenetic relationships.
# = Joint first authors
AO ... Hao &al.
Materials & methods
Isolates
Ravenala madagascariensis stems with flyspeck signs (Gleason et al. 2011) were
found in Jinniuling Park in Haikou city, Hainan Province (20°00'26"N 110°20'31"E),
China, in October 2011. Thalli on the stem were transferred directly from colonies to
potato dextrose agar (PDA) slants in a sterile environment and cultured at 25°C for 1
month in darkness (Sun et al. 2003). Hyphal tips were then transferred to malt extract
agar (MEA) plates. The isolates were allowed to grow onto an adjacent, sterile cover slip
that had been partially inserted into the agar surface at a 60° angle in order to measure
and observe fungal structures (Li et al. 2011). Microscopic examination was made
after 14 d of incubation. Thirty measurements per relevant microscopic structure were
gathered where possible. Colony descriptions (surface and reverse) were made after 2
weeks of growth on MEA plates at 25+1°C in the dark. The isolate acronym HKLRJ-4
was a temporary laboratory number. Representative dried culture and plant specimens
were deposited in the Fungal Herbarium of Northwest A&F University (HMUABO),
Yangling, Shaanxi Province, China.
DNA extraction, PCR, and phylogenetic analysis
Genomic DNA for polymerase chain reaction (PCR) was obtained according to the
protocol of Li et al. (2011). The primer pair ITS1-F and ITS4 was used to amplify the
internal transcribed spacer (ITS) region of nuclear ribosomal DNA. The PCR reactions
were carried out with Taq polymerase, 1x PCR buffer, 2 mM MgCl, 0.2 mM of each
dNTP, 0.4 uM of each primer, and 2 ul of template DNA, and was made up to a total
volume of 25 ul with sterile water. Reactions were performed on a Bio-Rad PCR System
S1000TM Thermal Cycler. The amplification conditions were: initial denaturation at
94°C for 90 min followed by 35 cycles of denaturation at 94°C for 35 s, annealing at 52°C
for 60 s, extension at 72°C for 1 min, and a final extension step at 72°C for 10 min. The
PCR products were sequenced by Sangon Biotech Co., Shanghai, China.
The ITS nucleotide sequence generated in this study was added to other sequences
with high homology as the result of a BLAST search. Cladosporium bruhnei was used
as the outgroup taxon. Sequences were imported into BioEdit 5.0.9.1 (Hall 1999).
Preliminary alignments were performed using CLUSTAL-X (Thompson et al. 1997),
then manually adjusted. Phylogenetic analysis of aligned DNA sequences was carried
out with PAUP version 4.0b 10 for 32-bit Microsoft Windows (Swofford 2003). Heuristic
searches were performed with 1,000 random sequence additions. Clade stability was
assessed by 1,000 bootstrap replications. Other measures calculated for parsimony
analysis included tree length, consistency index (CI), retention index (RI), rescaled
consistency index (RC) and homoplasy index (HI).
The ITS sequence described in this study is deposited in GenBank as JX502176,
and the alignment and representative tree were deposited in TreeBase (http://purl.org/
phylo/treebase/phylows/study/TB2:S13803).
Results
Phylogenetic analyses
The ITS alignment contained 29 taxa (including the outgroup) and 520
characters including alignment gaps. Of these characters, 266 were constant,
Ramichloridium strelitziae, new for China... 41
62 were variable and parsimony-uninformative, and 192 were parsimony-
informative. One of the 10 equally most parsimonious trees saved from the
maximum parsimony analysis is shown in Fic. 1. From the most parsimonious
tree, two major clades were resolved. One clade, with 100% bootstrap support,
contained fifteen species in Ramichloridium sensu stricto, Uwebraunia,
Dissoconium, and Pseudoveronaea (all in Dissoconiaceae). The other major clade
55 | Ramichloridium apiculatum EU041794
99 | R. mali EF627452
541 'R cucurbitae JQ622087
100
Ramichloridium
R. luteum CPC 18962
R. punctatum CPC 18974
Uwebraunia musae CBS 122454
U. australiensis EF394854
100 Uwebraunia
U. commune DQ302948
U. dekkeri EU851919
Dissoconium aciculare CPC 10805
68 F- D. eucalypti CBS 120039
100 Dissoconium
100) LD. aciculare AF 173308
D. proteae CBS 122900
100 [~ _Pseudoveronaea ellipsoidea CPC 18970
Pseudoveronaea
Pseudoveronaea obclavata CPC 18972
gf Zasmidium angulare JQ622088
Z. nocoxi CBS 125009
541 __ Ramichloridium cerophilum AF050286
Z. xenoparkii CBS 111089
PA Z. lonicericola CPC 11671
go] 2 citri CPC 10522
95} © Z. anthuriicola CBS 118742 Mycosphaerellaceae
100 Z. scaevolicola HM122240
1007 Ramichloridium streliziae CBS 121711
$3 HKLRJ-4
R. musae EU041801
R. biverticillatum EU041796
40 R. australiense EU041795
Cladosporium bruhnei DQ780401
Fic. 1. One of 10 equally parsimonious trees determined from ITS sequences. Bootstrap support
values (>50%) based on 1000 replicates are shown at the node. (CI = 0.6611, RI = 0.8657,
RC = 0.5723, HI = 0.3389). The scale bar shows 10 changes. The tree is rooted to Cladosporium
bruhnei and the new sequence is presented in bold.
42 ... Hao &al.
had a bootstrap value of 100% including twelve species in Ramichloridium sensu
lato and Zasmidium (all in Mycosphaerellaceae). Our isolate (HKLRJ-4) grouped
with Ramichloridium strelitziae (Mycosphaerellaceae) with 100% bootstrap
support, indicating that they might represent the same species.
Morphology and culture characteristics
Ramichloridium strelitziae Arzanlou, W. Gams & Crous, Stud. Mycol. 58: 74. 2007.
Fic. 2
MYcELIvM consisting of smooth, thin-walled, septate, verrucose, pale brown
hyphae, 2-3 um wide. CONIDIOPHORES erect, solitary, arising from creeping
aerial hyphae, subhyaline, later becoming pale brown, thick-walled, 1-3(-4)-
septate, smooth or verruculose, 2 um wide, up to 43 um long. CONIDIOGENOUS
cells terminally integrated, (8-)11-38 um long, subhyaline, later turning
pale brown, fertile part as wide as the basal part, sympodially proliferating,
forming a straight rachis; Scars thickened and darkened, approx. 0.5 um diam.
ConipiA (3.5-)4-5 x (1-)2(-3) um, solitary, aseptate, subhyaline, smooth or
verruculose, oblong, ellipsoidal to clavate, base truncate with unthickened,
non-pigmented hilum.
CULTURAL CHARACTERISTICS — CoLony diameter after 14 d on MEA at
24°C reached 6 mm diam with entire margin and compact, raised, dense aerial
mycelium, surface olivaceous-grey, reverse olivaceous-black.
Host CHARACTERISTICS — On stem surface, shiny, black, sclerotium-like
bodies, round to oval (120-220 um diam) with no visible mycelial mat, densely
arranged (3-5/mm_°). The flyspeck symptom on Ravenala madagascariensis did
not physically damage the plants, but greatly reduced their ornamental value.
Based on phylogenetic analysis and morphological characters of the anamorph,
we identified isolate HKLRJ-4 as Ramichloridium strelitziae.
SPECIMEN EXAMINED: CHINA. HAINAN PROVINCE, Haikou City, Jinniuling Park,
20°00'26"N 110°20'31”E, on stems of Ravenala madagascariensis, Oct 2011, Li WH
(HMUABO HKLRJ-4; GenBank, JX502176).
Discussion
The modern circumscription of Ramichloridium is still heterogenous,
containing species in two _ different families (Dissoconiaceae and
Mycosphaerellaceae), and only species clustering in Capnodiales were
considered to be true Ramichloridium (Arzanlou et al. 2007). According to
Li et al. (2012) and Arzanlou et al. (2007), R. apiculatum (the generic type),
R. cucurbitae, R. indicum, R. luteum, R. mali, and R. punctatum (Ramichloridium
s. str.) clustered with Dissoconium species (all now placed in Dissoconiaceae),
and other Ramichloridium s. lat. species grouped in Mycosphaerellaceae. Our
strain clustered among the mycosphaerellacean species with R. strelitziae.
Ramichloridium strelitziae, new for China... 43
Fic. 2. Ramichloridium strelitziae (HKLRJ-4). A. Signs on stem of Ravenala madagascariensis
with close-up view. B. Colony on MEA after 14 days. C-E Conidiophores. G-H. Conidia. Bars:
C-F = 10um; G-H = 5um.
Arzanlou et al. (2007) reported Ramichloridium strelitziae from leaves of
Strelitzia nicolai in South Africa. The species has also been found in bathrooms
and washing machines and is able to degrade surfactants, soap, and shampoo
(Hamada & Abe 2010). Our results show that R. strelitziae may also be involved
in the sooty blotch and flyspeck complex.
Acknowledgments
This work was supported by National Natural Science Foundation of China
(31170015, 31171797), the 111 Project from Education Ministry of China (B07049), Top
Talent Project of Northwest A&F University and the earmarked fund for Modern Agro-
industry Technology Research System (nycytx-08-04-04). The authors wish to thank
Dr Eric H.C. McKenzie (Landcare Research, Private Bag 92170, Auckland, New Zealand)
and Professor Zhongyi Zhang (College of Plant Protection, Yunnan Agricultural
University, Kunming, Yunnan, China) for reviewing the manuscript.
Literature cited
Arzanlou M, Groenewald JZ, Gams W, Braun U, Shin H-D, Crous PW. 2007. Phylogenetic and
morphotaxonomic revision of Ramichloridium and allied genera. Studies in Mycology 58:
57-93. http://dx.doi.org/10.3114/sim.2007.58.03
44 ... Hao &al.
Batzer JC, Gleason ML, Harrington TC, Tiffany LH. 2005. Expansion of the sooty blotch and flyspeck
complex on apples based on analysis of ribosomal DNA gene sequences and morphology.
Mycologia 97: 1268-1286. http://dx.doi.org/10.3852/mycologia.97.6.1268
Batzer JC, Diaz Arias MM, Harrington TC, Gleason ML, Groenewald JZ, Crous PW. 2008. Four
species of Zygophiala (Schizothyriaceae, Capnodiales) are associated with the sooty blotch and
flyspeck complex on apple. Mycologia 100: 246-258.
http://dx.doi.org/10.3852/mycologia.100.2.246
Frank J, Crous PW, Groenewald JZ, Oertel B, Hyde KD, Phengsintham P, Schroers H-J. 2010.
Microcyclospora and Microcyclosporella: novel genera accommodating epiphytic fungi causing
sooty blotch on apple. Persoonia 24: 93-105. http://dx.doi.org/10.3767/003158510X510560
Gleason ML, Batzer JC, Sun GY, Zhang R, Diaz Arias MM, Sutton TB, Crous PW, Ivanovic
M, McManus PS, Cooley DR, Mayr U, Weber RWS, Yoder KS, Del Ponte EM, Biggs AR,
Oertel B. 2011. A new view of sooty blotch and flyspeck. Plant Disease 95: 368-383.
http://dx.doi.org/10.1094/PDIS-08- 10-0590
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/N'TT. Nucleic Acids Symposium Series 41: 95-98.
Hamada N, Abe N. 2010. Growth characteristics of four fungal species in bathrooms. Biocontrol
Science 15: 111-115. http://dx.doi.org/10.4265/bio.15.111
Li HY, Sun GY, Batzer JC, Crous PW, Groenewald JZ, Karakaya A, Gleason ML. 2011. Scleroramularia
gen. nov. associated with sooty blotch and flyspeck of apple and pawpaw from the Northern
Hemisphere. Fungal Diversity 46: 53-66. http://dx.doi.org/10.1007/s13225-010-0074-9
Li HY, Sun GY, Zhai XR, Batzer JC, Mayfield DA, Crous PW, Groenewald JZ, Gleason ML. 2012.
Dissoconiaceae associated with sooty blotch and flyspeck on fruits in China and the United
States. Persoonia 28: 113-125. http://dx.doi.org/10.3767/003158512X651157
Sun GY, Zhang R, Zhang Z, Zhang M. 2003. Isolation of sooty blotch and flyspeck fungi from apple
surface by picking up the thalli. Acta Phytopathologica Sinica 33: 479-480.
Swofford DL. 2003. PAUP*. Phylogenetic analysis using parsimony (* and other methods). Version
4.0. Sinauer Associates, Sunderland, Massachusetts, USA.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The Clustal_X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 25: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
Yang HL, Sun GY, Batzer JC, Crous PW, Groenewald JZ, Gleason ML. 2010. Novel fungal genera
and species associated with the sooty blotch and flyspeck complex on apple in China and the
USA. Persoonia 24: 29-37. http://dx.doi.org/10.3767/003158510X492101
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.45
Volume 124, pp. 45-50 April-June 2013
Polycoccum anatolicum sp. nov. on Lepraria incana
and a key to Polycoccum species known from Turkey
MEHMET GOKHAN HAtici’, HATICE Esra AKGUL’,
CELALEDDIN OzTURK? & EMRE KILIc?
' University of Erciyes, Faculty of Science, Department of Biology 38039 Kayseri, Turkey
* University of Selcuk, Faculty of Science, Department of Biology 42075 Konya, Turkey
* CORRESPONDENCE TO: [email protected]
ABSTRACT — Polycoccum anatolicum is described as new from the thallus of Lepraria incana
on the trunk of a Prunus sp. in western Turkey and represents the first Polycoccum known to
occur on Lepraria. The new species is typical with its relatively small subglobose ascomata
and verruculose relatively large ascospores. It is compared with similar Polycoccum species,
and a key to Polycoccum species known from Turkey is provided.
Key worps — Ascomycota, lichens, lichenicolous fungi, biodiversity
Introduction
Polycoccum Saut. ex Korb. comprises approximately 50 species of
lichenicolous fungi (Halici et al. 2007a, 2009; Brackel & Berger 2010; Zhurbenko
2010). The type species of the genus is P sauteri Kérb. with lichenicolous
habit on Stereocaulon condensatum Hoftm. Species are characterized by dark
perithecioid ascomata, pseudoparenchymatous exciple, fissitunicate asci with
brown one-septate ascospores, and a hamathecium of persistent, branched
and anastomosing interascal filaments. Following the genus synopsis by
Hawksworth & Diederich (1988), Atienza et al. (2003) recognized 37 species.
Brackel & Berger (2010) described three Polycoccum species occurring on the
lichenised fungus Placopsis.
Attention to the lichenicolous fungi of Turkey has increased since Halici
(2008) published the key to the lichenicolous Ascomycota. Of the 181
lichenicolous species known from Turkey (Halici et al. 2012), ten Polycoccum
species have been identified (Halic1 2008, Halici et al. 2009; Yazici et al. 2011). In
2012, the second author (EA) collected an interesting specimen of Polycoccum
on epiphytic Lepraria incana (L.) Ach. s. lat. from Turkey’s Mediterranean
46 ... Halici & al
Region. After comparison with the described species of the genus, we concluded
that the specimen represents a new species, which we describe here. We also
provide a key to the eleven Polycoccum species now reported from Turkey.
Material & methods
The type of the new species is deposited in Erciyes University Herbarium Kayseri,
Turkey (EUH). Sections were prepared by hand and examined in I [Lugol's iodine
(MERCK 9261) with (KI) and without (I) pre-treatment with 10% KOH], 10% KOH,
and water. Ascospores were measured in water. Ascospore measurements are given as:
(min -) X-sd - X - X+sd (-max.), where ‘min’ and ‘max’ are the extreme values, ‘X’
the arithmetic mean, and ‘sd’ the corresponding standard deviation. The length/breadth
ratio of ascospore is indicated as 1/b and given in the same way. The microphotographs
were taken with a Leica DFC 420 digital microscope camera with a c-mount interface
and with a 5 megapixel CCD. The descriptive notes provided in the key are based on
Turkish specimens examined by the first author (MGH), except for Polycoccum evae,
which is based on the description given by Calatayud & Rico (1995).
Taxonomy
Polycoccum anatolicum Halici & E. Akgiil, sp. nov. FIGURE 1
MycoBank MB804154
Differs from Polycoccum dzieduszyckii by its 8-spored asci and its Lepraria host.
Type: Turkey, Isparta, Siitciiler, Yazili Canyon, 41°48’N 36°31’E, alt. 290 m, on Lepraria
incana on Prunus sp., 18 July 2012, E.Akgiil (Holotype, EUH (MGH 0.3118)).
Erymo.oey: The epithet refers to Anatolia, the Asian part of Turkey, where the type
specimen was collected.
Vegetative hyphae hyaline, scant, very narrow, the infection causing no
visible necrosis in host, but eventually bleaching the infected parts. Ascomata
perithecioid, subglobose, arising singly, in the early stage immersed with only
the ostiole area visible, semi-immersed at maturity, 75-90 um. Ascomatal wall
dark reddish brown, darkest in the upper half, 10—15 um thick, and thickening
in the ostiole region; composed of several layers of compressed cells, 10-15
x 6-8 um, forming a textura angularis. Hamathecium consisting of septate,
branched and anastomosing pseudoparaphyses, 1-2 um thick. Hymenial
gelatin K/I-, I-. Asci arising from the lower part of the ascomatal cavity,
cylindrical to elongate-clavate, shortly stalked, bitunicate, the apex thickened, 8-
spored, (71—)83—91(—103) x (11—)14—18(—21) um (n = 10); wall I-, endoplasm
dextrinoid. Ascospores monostichously arranged in the asci, sole-shaped, apices
rounded, some tending to taper towards the rounded ends, 1-septate, not or
slightly constricted at the septum, upper cell slightly larger, brown, verruculose,
non-halonate, some ascospores multi-guttulate, (25—)26—28—29.5(-32) x
(8.5—)9-10-11(-13) um (n = 30), I/b = (2.2—)2.52—2.76-3(—3.3). Conidiomata
not seen.
Polycoccum anatolicum sp. nov. (Turkey) ... 47
ioe
00pm —|
L S00 pm
Fic. 1. Polycoccum anatolicum (Holotype): A, Habitus; B, Ascoma (in water); C, Ascospores
(in water); D, Asci showing monostichously arranged ascospores (in water); E, Anastomosed
pseudoparaphyses (in methylene blue).
A8 ... Halici & al
ECOLOGY & DISTRIBUTION: Polycoccum anatolicum is currently known
only from the type locality in the Western Mediterranean part of Turkey. The
new species was collected on Lepraria incana on the trunks of Prunus sp. The
species seems to be weakly pathogenic as moderate bleaching was observed in
the infected parts of the host thallus. As the host lichen has a wide distribution,
P. anatolicum may also have a wide distribution.
Notes: Most Polycoccum species are confined to one host species or genus,
and P. anatolicum is the only species known to occur on Lepraria. It is closest
to P. dzieduszyckii (Boberski) D. Hawksw., a species known only on Verrucaria
spp. (and probably other lichens on limestone). Polycoccum dzieduszyckii has
small ascomata (50-100 um) and large verruculose ascospores (25—35(—44) x
8—10(—14) um) (Hawksworth & Diederich 1988, Halici et al. 2007b), but clearly
differs from P. anatolicum in having consistently 2-spored asci and infecting a
different host genus.
Polycoccum opulentum (Th. Fr. & Almgq.) Arnold, a species known on
Polyblastia intercedens (Nyl.) Lonnr., Lecidea plana (J. Lahm) Nyl., and a
sterile lichen on calcareous rocks, has similar sized ascospores (25-28 x
11-14 um) but thicker pseudoparaphyses (3 um), larger ascomata (100-170
um), and hymenial gelatin turning blue in iodine (Hawksworth & Diederich
1988; Atienza et al. 2003). Polycoccum squamarioides (Mudd) Arnold, another
species known on Placopsis spp., has similar sized ascomata (75-100 um) but
narrower ((18—)19-—26 x (5.5—)6—7(—8) um) and smooth-walled ascospores
(Hawksworth & Diederich 1988, Brackel & Berger 2010). Polycoccum evae
Calat. & V.J. Rico is restricted to Dimelaena oreina (Ach.) Norman and has larger
ascomata (100-200 um) and shorter verruculose ascospores ((17—)18—23(—25)
x (6—-)7—10(-11) um) (Calatayud & Rico 1995). Polycoccum crassum Vézda,
a species known on Peltigera spp., has similar sized verruculose ascospores
((25—)30—32(—36) x 8—10(—11) um) but much larger ascomata (300-500 um)
and consistently 4-spored asci (Hawksworth & Diederich 1988; Atienza et al.
2003; Halici et al. 2012).
A key to the Polycoccum species known from Turkey
Mek ASCOSPOLES i OT LOMoee 8 Fhnns Bhat! utattul Mhnsyt Tek mR! etna Leas AL 2
lL. GAscospores S20 Atmos di... a dibete a disnteeg ding ed dintery dente dcnopea’ tin apes diggs Pe)
2 weAscospores'smioothiwalleds .. 034.002 44nctddhed adhe eadead ered den bes 3
2. Ascospores verruculose, 13-14 x 6 um, on Acarospora spp. P. microsticticum
3... “SNOLcatising swellinssion-thehostlichens %. 2.31 d tt het eed he el 4
3. Ascomata c. 200 um, causing swellings on the host lichens.
Ascospores 14—18 x 5—6 um, on Peltigera spp. ........... 0. eee ee P. peltigerae
Polycoccum anatolicum sp. nov. (Turkey) ... 49
4, | Ascomata 100—140 um. Interascal filaments very thin, c. 1.0 um.
Ascospores (11—)12—14.5(—15.5) x (4.5—)5-6 um,
On-Xanthoria sp: ON: COaStall VOCKS 0) ssiew-t teers oracuee ofS athe oa ate tw Bat P. teresum
4, | Ascomata 150-235 um. Interascal filaments thicker. Ascospores
(11—)13.5—15(—16) x 6.5—7 um, on Aspicilia cinerea ................ P. aksoyi
Bim EVSCIBSZSDOEGA Toe Se tee sok eee to eaten ren ee tay Ee eee Neen Neen ee ER 6
5. Asci 2-spored. Ascospores verruculose, 25—28 x 8-11 um,
on endolithic Verrucaria spp. on hard calcareous rocks ....... P. dzieduszyckii
Gimm, ASCISARPOTEd ss kg ea task tees i vleale tele ls + pels § Deals pte Fe OE OG Gt OH ys
6. Asci 4-spored. Ascomata c. 400 um. Hymenial gelatin I+ orange-red.
Ascospore cells + equal in size, verruculose, 24—30 x 8-10 um,
CP PEIISEPAS DIOL ses tod Nes elo ehioer sey hat hy Spotty When Dee Mon bey eede eittinals P. crassum
Tait eh SOON ALA cee LOG) MRT o,f eR ec erat Mel hey Me Me Ay bel aly et al 8
7. Ascomata 75-90 um. Hymenial gelatin I—. Ascospores verruculose,
(25—)26—29.5(—32) x (8.5—)9-11(—13) um, on Lepraria incana ... P. anatolicum
Sepa Vee al alle Fea eet Pattee ARR se, Je Th tcl Bled de lg teil Md eel Wi ssagelt Miacele 9
8. | Ascomata c. 220 um. Hymenial gelatin I+ blue. Ascospores verruculose,
24-27 x 10-13 um, on endolithic Verrucaria spp. ............ P. marmoratum
9. Ascospores verruculose and cells + equal in size ........... 0. ee eee eee eee 10
9. | Ascomata 170-200 um. Ascospores smooth walled and lower cell often
attenuate, 22-23 x 10 um, on Sporastatia testudinea............ P. sporastatiae
10. Ascomata 100-200 um. Ascospores (17—)18—23(—25) x (6—)7—10(—13) pm,
OD TDECLAC TID OP CUIA pseu sot srvtsnbes drstsnben dicts spben-d Wacken drhesekes driep.t-gedhtfebou'y hig boue P. evae
10. Ascomata 180-250 um. Ascospores (25—)28.5—31.5(—34) x (7—)8-9.5 um,
Ol, ACATOSPOTO:CETVING Strate, Bhivarees avs coe timed oe hea or uthhos argent P. acarosporicola
Acknowledgements
The manuscript was reviewed by Kerry Knudsen (USA) and Wolfgang von Brackel
(Germany). This study was financially supported by the Selcuk University Scientific
Research Project Coordinator with the project coded (BAP-12101025).
Literature cited
Atienza V, Calatayud V, Hawksworth DL. 2003. Notes on the genus Polycoccum (Ascomycota,
Dacampiaceae) in Spain, with a key to the species. Lichenologist 35: 125-135.
http://dx.doi.org/10.1016/S0024-2829(03)00014-8
Brackel W, Berger F. 2010. Gall-inducing species of Polycoccum (Ascomycota) on the lichen genus
Placopsis. Herzogia 23: 195-204.
Calatayud V, Rico VJ. 1995. Polycoccum evae (Dothideales), a new lichenicolous fungus on
Dimelaena oreina. Mycotaxon 53: 29-32.
Halici MG. 2008. A key to the lichenicolous Ascomycota (including mitosporic fungi) of Turkey.
Mycotaxon 104: 253-286.
Halici MG, Atienza V, Hawksworth DL. 2007a. Two new Polycoccum species from Turkey.
Mycotaxon 101: 157-163.
50 ... Halici & al
Halici MG, Candan M, Ozdemir Tiirk A. 2007b. New records of lichenicolous and lichenized fungi
from Turkey. Mycotaxon 100: 255-260.
Halic1 MG, Knudsen K, Candan M, Tiirk A. 2009. A new species of Polycoccum (Dothideales,
Dacampiaceae) from Turkey. Nova Hedwigia 89: 431-436.
http://dx.doi.org/10.1127/0029-5035/2009/0089-0431
Halici MG, Candan M, Ozdemir Tiirk A. 2012. A key to the peltigericolous fungi in Turkey.
Mycotaxon 119: 277-289. http://dx.doi.org/10.5248/119.277
Hawksworth DL, Diederich P. 1988. A synopsis of the genus Polycoccum (Dothideales), with a key
to accepted species. Transactions of the British Mycological Society 90: 293-312.
http://dx.doi.org/10.1016/S0007-1536(88)80101-3
Yazic1 K, Etayo J, Aslan A. 2011. A note about lichenicolous fungi from Ardahan (Turkey).
Cryptogamie, Mycologie 32: 429-437.
Zhurbenko MP. 2010. New and interesting lichenicolous fungi from Eurasia. I]. Mycosphere 1:
213-222.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.51
Volume 124, pp. 51-59 April-June 2013
Further additions to the macrolichen mycota of Vietnam
UDENI JAYALAL ', ANDRE APTROOT *, THI THUY NGUYEN ?, NGUYEN ANH
DZUNG 3, SANTOSH JOSHI ', SOON-OK OH ' & JAE-SEOUN Hur **
'Korean Lichen Research Institute, Sunchon National University, Suncheon-540 742, Korea
?ABL Herbarium, Gerrit van der Veenstraat 107, NL-3762 XK Soest, The Netherlands
Biotechnology Center, Tay Nguyen University, 567 Le Duan, Buon Ma Thuot City, Vietnam
“CORRESPONDENCE TO: [email protected]
ABSTRACT — Seven new records of foliose lichens are reported from Chu Yang Sin
National Park of Dak Lak province in Vietnam. Morphological, anatomical and chemical
characteristics are described for Heterodermia obscurata, Hypotrachyna flavida, Leptogium
ulvaceum, Parmotrema sancti-angelii, Parmeliella brisbanensis, Physma byrsaeum, and Sticta
marginifera.
Key worps — tropical, macrolichens, Parmeliaceae, Da Lat Plateau
Introduction
Although larger organisms are well known in the tropics, the fungi and their
lichenized counterparts in tropical forests are less known (Coppins & Wolseley
2002). Aptroot & Sipman (1997) observed that the tropical forest lichens
represent about one-third to one-half of the world’s lichen diversity. Vietnam,
being a moderately large country with the monsoon tropical climate (VARCC
2009), provides a range of conditions to support lichen growth (Nguyen et al.
2010, 2011).
Although the lichen mycota of Vietnam is underworked, recently many
species have been reported or described. Aptroot & Sparrius (2006) provided
the first checklist of Vietnam lichens, which has been followed by new records
of macrolichens by Giao (2009), some findings on foliicolous lichens by Nguyen
et al. (2010, 2011), and reports of some Graphidaceae species by Joshi et al.
(2012).
The Korean Lichen Research Institute (KoLRI) has initiated collaboration
with Tay Nguyen University in Vietnam, which has resulted in the collection
of many lichen specimens, which have been deposited in the herbarium of the
KoLRI. This paper reports seven taxa (in five lichen families) from Chu Yang
Sin National Park, Vietnam.
52 ... Jayalal & al.
Materials & methods
Chu Yang Sin National Park is located in the central highlands of Vietnam in Krong
Bong and Lak Districts of Dak Lak Province. This park is situated within the elevations
ranging from less than 600 m to 2442 m at the summit of Mount Chu Yang Sin with the
area of 58,947 ha. The Park is the largest protected area on the Da Lat Plateau, in the
central highlands (Hughes 2010).
The dominant vegetation type in the Park is broadleaved evergreen forest, covering
over 65% of the area. This forest is dominated by the vascular plant families Fagaceae,
Lauraceae, Meliaceae, and IIliciaceae with a canopy height often in excess of 35 m. The
high altitudinal range and varied topography gives rise to high vascular plant diversity
in different forest types. Montane and submontane forests are at >900 m and lowland
semi evergreen forests at <900 m (Hughes 2010).
Morphological and anatomical investigations were performed under a binocular
dissecting (NIKON SMZ645) and light microscope (Zeiss Scope. Al). Measurements of
all the microscopic features were made on hand-cut thallus and apothecial sections. The
sections were examined by mounting in water, 10% KOH, and Lugol’s iodine solutions.
Ascospore measurements were determined in water. Chemical constituents were identified
by spot tests and thin layer chromatography performed in solvent systems A (toluene:
dioxin:acetic acid 180:45:5) and C (toluene:acetic acid 85:15) (Orange et al. 2010).
Taxonomic descriptions
Heterodermia obscurata (Nyl.) Trevis., Nuovo Gior. Bot. Ital. 1: 114 (1869) Fic.14
Thallus foliose, suborbicular, adnate, 2-6 cm across; lobes narrow, up to 1-2
mm wide, flat; upper surface whitish gray, shiny, epruinose, sorediate; soredia
granular, labriform to capitate on lateral and terminal lobes; lower cortex
absent; lower surface (medulla) felted with yellowish-brown pigment, K+
purple, marginally rhizinate; rhizines black, simple to squarrosely branched;
apothecia not seen.
CHEMISTRY — Cortex K+ (yellow), C-, KC-, P+ (pale yellow); medulla K-,
C-, KC-, P-. TLC: atranorin, chloroatranorin, zeorin.
EcoLoGcy & DISTRIBUTION — Found on sandy rock in broad-leaved
evergreen forest in Chu Yang Sin National Park. According to Moberg & Nash
(2001), this species is growing on tree trunk and mossy rocks in open humid
conditions. Mostly cosmopolitan and has been reported from many countries
in Africa, Asia, Europe, North America, South America, and Oceania (Aptroot
& Feijen 2002, Calvelo & Liberatore 2002, Egea 1996, Eliasaro & Adler 1997,
Elix & McCarthy 1998, Fryday et al. 2001, Gowan & Brodo 1988, Hafellner &
Tiirk 2001, Knezevic & Mayrhofer 2009, Kurokawa 1960, Llimona & Hladun
2001, Lépez—Figueiras 1986, Osorio 1992, Singh & Sinha 2010, Sipman 1993,
Streimann 1986, Tenorio et al. 2002, Wei 1991).
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Chu Yang Sin National Park,
on rock, 12°27'57.0"N 108°20'34.9"E, elev. c. 780 m, 20.04.2012, S.O. Oh, J.S. Hur
VN120185 (KoLRI).
Macrolichens newly recorded for Vietnam ... 53
REMARKS — Heterodermia obscurata (Physciaceae) is characterized by its
robust appearance, labiate soredia, lack of lower cortex, and the rusty-brown
pigmented (K+ purple) lower surface or medulla. According to Moberg & Nash
(2001), this species is closely related to H. speciosa (Wulfen) Trevis., which
differs in having a lower cortex and in lacking yellowish pigmentation. It is also
easily confused with H. japonica (M. Sat6) Swinscow & Krog, which has no
lower cortex and which is white to violet.
Hypotrachyna flavida (Zahlbr.) Hale, Smithson. Contr. Bot. 25: 37 (1975) Fic. 1B
Thallus adnate to loosely attached, coriaceous, green, 4-6 cm across; lobes
sublinear, separate, 2-4 mm wide, margins eciliate; upper surface greenish grey,
emaculate, plane to convex, continuous or irregularly cracked on older lobes;
medulla white; lower surface moderately rhizinate; rhizines long, sparsely
dichotomously branched, often projecting beyond the lobe margins; apothecia
adnate, 1-3 mm in diameter, disc brown, flat to concave; Asci clavate, 8 spored,
spores colour less, 6-8 um; pycnidia not seen.
CHEMISTRY — Cortex K-, C-, KC-, P-; medulla K+ (pale yellowish to
brown), C-, KC-, P+ (orange-red). TLC: usnic acid, protocetraric acid.
EcoLoGy & DISTRIBUTION — Found on a sandy rock in broad-leaved evergreen
forest in Chu Yang Sin National Park. Reported as saxicolous species at somewhat higher
elevations by Hale (1975). This species has previously been reported from Central and
South America (Calvelo & Liberatore 2002, Eliasaro & Adler 1997, Hale 1975, Riddle
1920, Tenorio et al. 2002).
SPECIMEN EXAMINED: VIETNAM. DAK LAK PROVINCE: Chu Yang Sin National Park,
on rock, 12°28'12.3"N 108°20'59.9”E, elev. c. 763 m, 20.04.2012, S.O. Oh, J.S. Hur
VN120120 (KoLRI).
REMARKS — Hypotrachyna flavida (Parmeliaceae) is characterized by a
saxicolous habit and a medulla containing usnic acid and protocetraric acid.
According to Hale (1975), H. flavida is fairly restricted to northern South
America. Externally, this species very closely resembles H. protoboliviana
(Hale) Hale, which differs in its corticolous habitat and medulla containing
barbatic acid.
Leptogium ulvaceum (Pers.) Vain., Ann. Acad. Sci. Fenn., Ser. A, 15(6): 38
(1921) FIG. 1C
Thallus foliose, loosely adnate, 4-8 cm across, bluish gray; lobes rotund,
2-8 mm wide, homiomerous, margins entire, surface smooth to somewhat
rough; isidia, phyllidia absent; lower surface smooth, etomentose, pale bluish
with sparse tufted rhizines; apothecia laminal, shortly pedicellate, 0.5-2
mm diam., disc flat to concave, red brown, exciple smooth to wrinkled, cells
paraplectenchymatous and continuous to below the hypothecium; ascospores
54 ... Jayalal & al.
ellipsoid, muriform, 30-40 x 12-18 um, apices acute to elongate; pycnidia
submarginal; conidia 2-3 um long.
CHEMISTRY — No chemical detected.
ECOLOGY & DiIsTRIBUTION — Found on a sandy rock in a shady place in
broad-leaved evergreen forest in Chu Yang Sin National Park. This species has
previously been reported from Asia, Europe, South America, and Oceania
(Awasthi 1988, Elix & McCarthy 1998, Hafellner 1995, Marcelli 1991).
SPECIMEN EXAMINED: VIETNAM. DAK LAK PROVINCE: Chu Yang Sin National Park,
on rock, 12°26'51.9"N 108°20'18.1"E, elev. c. 816 m, 21.04.2012, S.O. Oh, J.S. Hur
VN120170 (KoLRI).
REMARKS — Leptogium ulvaceum (Collemataceae) is characterized by smooth
upper surface lacking vegetative propagules. This species is morphologically
similar to L. cochleatum (Dicks.) P.M. Jorg. & P. James, which differs in its
periclinally wrinkled thalline exciple.
Parmeliella brisbanensis (C. Knight) P.M. Jorg. & D.J. Galloway, Flora of Australia,
54: 314 (1992) FIG. 1D
Thallus rosette-forming, orbicular, 5-7 cm across, ona thick, black prothallus
projecting 1-2 mm beyond lobe apices, closely appressed to substratum; lobes
narrow, 0.6-1 mm wide, discrete at margins, flat; margins entire, somewhat
thickened, occasionally ascending; upper surface, slightly maculate, smooth,
occasionally striate, grayish when wet, whitish gray when dry, isidiate; isidia
delicate, simple to finger-like, to 0.5 mm tall and 0.1 mm thick, laminal and
marginal; medulla white to blackish, photobiont Nostoc; apothecia, 0.5-2 mm
wide, rounded to contorted; exciples thick, thalline, persistent, crenulate-
striate, concolorous with thallus; disc flat to concave, red-brown; ascospores
simple, ellipsoidal, 10-15 x 8-10 um; pycnidia not seen
CHEMISTRY — No chemical detected.
ECOLOGY & DISTRIBUTION — Found on a sandy rock in a shady place in
broad-leaved evergreen forest in Chu Yang Sin National Park. According to
Jorgensen and Galloway (1992), Parmeliella brisbanensis also occurs on tree
bark in tropical to subtropical rain forests. This species has been recorded from
many countries in the tropics, in Asia, Australia, and Oceania (Elix & McCarthy
1998, Jorgensen & Galloway 1992, Singh & Sinha 2010, Sipman 1993, Wolseley
et al. 2002).
SPECIMEN EXAMINED: VIETNAM. DAK LAK PROVINCE: Chu Yang Sin National Park,
on rock, 12°28'04.4"N 108°20'39.0"E, elev. c. 622 m, 20.04.2012, S. O. Oh, J. S. Hur
VN120046 (KoLRI).
REMARKS: Parmeliella brisbanensis (Pannariaceae) is characterized by its rosette
form, black hypothallus, and finger-like isidiate upper surface. According to
Jorgensen & Galloway (1992), this species is the isidiate counterpart of the
P. mariana (Fr.) P.M. Jorg. & D.J. Galloway complex.
Macrolichens newly recorded for Vietnam ... 55
FiGurE 1: External morphology of Vietnamese lichen specimens (Scale bars = 1 cm). A. Heterodermia
obscurata VN120185 (KoLRI); B. Hypotrachyna flavida VN120120 (KoLRI); C. Leptogium ulvaceum
VN120170 (KoLRI); D. Parmeliella brisbanensis VN120046 (KoLRI); E. Parmotrema sancti-angelii
VN120288 (KoLRI); F. Physma byrsaeum VN120107 (KoLRI); G. Sticta marginifera VN120053
(KoLRI).
Parmotrema sancti-angelii (Lynge) Hale, Phytologia 28: 339 (1974) FIG. 1E
Thallus loosely attached to the substratum, up to 6 cm across; lobes rotund,
4-10 mm wide; margins crinate, ciliate; cilia numerous, simple, 2-4 mm long;
upper surface pale grey, emaculate, smooth, sorediate; soralia marginal, soredia
granular; medulla white, yellowish brown pigments below; lower surface, with
56 ... Jayalal & al.
relatively narrow, smooth, erhizinate marginal zone; rhizines sparse, simple;
apothecia and pycnidia not seen.
CHEMISTRY — Cortex K+ (yellow), C-, KC-, P-; medulla K- C+ (rose),
KC+ (red), P-. TLC: atranorin, chloroatranorin, gyrophoric acid and unknown
compound.
EcoLoGy & DISTRIBUTION — Found on a sandy rock in an open place in
broad-leaved evergreen forest in Chu Yang Sin National Park. A common and
widespread species in the pantropical region (Elix 1994), it has been reported
from Asia, Australia, South America, and Oceania (Calvelo & Liberatore 2002,
Divakar & Upreti 2005, Elix 1994, Elix & McCarthy 1998, Elix & Schumm 2001,
Hale 1974, Kurokawa 1993, Wei 1991, Wolseley et al 2002).
SPECIMEN EXAMINED: VIETNAM. DAK LAK PROVINCE: Chu Yang Sin National Park,
on rock, 12°28'04.4"N 108°20'39.0"E, elev. c. 622 m, 20.04.2012, S.O. Oh, J.S. Hur-
VN120288 (KoLRI).
REMARKS — Parmotrema sancti-angelii (Parmeliaceae) is characterized by an
emaculate upper surface, sorediate margins, yellowish lower medulla, and
brown to black lower surface. This species is very close to P indicum Hale,
which differs in having norlobaridone and in lacking pigmentation on the
lower medulla.
Physma byrsaeum (Ach.) Tuck., Syn. N. Amer. Lich. 1: 115 (1882) FIG. 1F
Thallus foliose, rosulate, adnate, 6-8 cm across, 200-350 um thick; lobes
radiating, oblong 1-5 mm wide; margins entire, thickened, re-curved at the
lobes end; upper surface ridged, somewhat wrinkled, brownish black, lacking
isidia; cortex thin, photobiont Nostoc; lower surface pale brown, rhizinate;
rhizines of interwoven hyphae forming a cushion-like indumentum, whitish
to black; ascomata apothecial, abundant, laminal, sessile, 1-4 mm wide; disc
concave to plane, reddish brown; thalline exciple thick, wrinkled, lobed,
concolorous with thallus; ascospores simple, ellipsoidal, 12-15 x 10-12 um;
episporium, 2-3 um thick; pycnidia laminal, conidia 2-3 um long.
CHEMISTRY — No chemicals detected.
EcoLoGy & DISTRIBUTION — Found on sandy rock in a shady place in
broad-leaved evergreen forest in Chu Yang Sin National Park. Physma byrsaeum
has been reported from many countries in the paleotropics, including Asia,
Australia, Central America, and Oceania (Aptroot & Seaward 1999, Aptroot &
Sipman 1991, Elix & McCarthy 1998, Sipman 1993, Tenorio et al. 2002, Verdon
1992, Wolseley et al. 2002).
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Chu Yang Sin National Park,
on rock, 12°28'12.3"N 108°20'59.9"E, elev. c. 763 m, 20.04.2012, S.O. Oh, J.S. Hur
VN120107 (KoLRI).
REMARKS — Physma byrsaeum (Collemataceae) is characterized by a well-
developed cortical layer and wrinkled thalline apothecial exciple. This species
Macrolichens newly recorded for Vietnam ... 57
is morphologically similar to P pseudoisidiatum Aptroot & Sipman, which is
isidiate.
Sticta marginifera Mont., Annls Sci. Nat., Bot., Sér. 2 18: 265 (1842) FIG. 1G
Thallus palmate to irregularly branched in clumps, 1-2 cm across, arising
from a rooted holdfast; lobes flabellate to irregularly dichotomously branching,
1-3 mm wide, proliferating round to oblong lobules attached to primary lobes
by thin terete stalks; margins entire or irregularly notched, thickened below;
upper surface grayish glaucous when dry, dark blue-black when wet, thin,
papery, smooth, rather fragile, isidiate, phyllidiate and minutely maculate;
isidia marginal, sometimes on the upper surface, styliform to coralloid, to 0.5
mm tall; phyllidia marginal, developing from isidia, to 1 mm tall, irregularly
lobed; photobiont Nostoc; lower surface white to pale at margins, brown
centrally, minutely pubescent; cyphellae scattered, round, to 0.5 mm diam.; pit
membrane white; apothecia not seen.
CHEMISTRY — No chemicals detected.
EcoOLoGy & DisTRIBUTION — Found on sandy rock in a shady place in
broad-leaved evergreen forest in Chu Yang Sin National Park. According to
Galloway (2001), Sticta marginifera prefers humid, deeply shaded habitats in
montane rain forests on different substrates. This species has been recorded
from Asia, Australia, South America, and Oceania (Awasthi 2007, Calvelo &
Liberatore 2002, Elix & McCarthy 1998, Galloway 2001, Streimann 1986).
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Chu Yang Sin National Park,
on rock, 12°28'04.4"N 108°20'39.0"E, elev. c. 622 m, 20.04.2012, S.O. Oh, J.S. Hur
VN120053 (KoLRI).
REMARKS — Sticta marginifera (Lobariaceae) is characterized by the presence
of secondary lobules and the coralloid isidia. According to Galloway (2001),
the similar S. brevipes (Mull. Arg.) Zahlbr. also has similar flabellate lobes with
thickened and revolute apices but does not produce secondary lobules.
Acknowledgements
This work was supported by a grant from the National Research Foundation of Korea
(#2011-0031494) and the Korea National Research Resource Center Program. Authors
are grateful to Ms. Pat Wolseley and Dr. Sanjeeva Nayaka for their valuable comments
on manuscript.
Literature cited
Aptroot A, Feijen FJ. 2002. Annotated checklist of the lichens and lichenicolous fungi of Bhutan.
Fungal Diversity 11: 21-48.
Aptroot A, Seaward MRD. 1999. Annotated checklist of Hong Kong lichens. Tropical Bryology 17:
57-101.
Aptroot A, Sipman H. 1991. New lichens and lichen records from New Guinea. Willdenowia 20:
221-256.
58 ... Jayalal & al.
Aptroot A, Sipman HJM. 1997. Diversity of lichenized fungi in the tropics. 93-106, in KD Hyde
(ed.), Biodiversity of Tropical Microfungi. Hong Kong, Hong Kong University Press.
Aptroot A, Sparrius LB. 2006. Addition to the lichen flora of Vietnam, with an annotated checklist
and bibliography. Bryologist 109(3): 358-371.
http://dx.doi.org/10.1639/0007-2745(2006)109[358:ATTLFO]2.0.CO;2
Awasthi DD. 1988. A key to the macrolichens of India and Nepal. Journ. of Hattori Bot. Lab. 65:
239-242.
Awasthi DD. 2007. A compendium of the macrolichens from India, Nepal and Sri Lanka. 580 p.
Calvelo S, Liberatore S. 2002. Catalogo de los liquenes de la Argentina. Kurtziana 29(2): 7-170.
Coppins BJ, Wolseley P. 2002. Lichens of tropical forests. 113-131, in: R Watling et al. (eds). Tropical
Mycology, Micromycetes. CAB International, Oxon, UK.
Divakar PK, Upreti DK. 2005. Parmelinoid lichens in India (a revisionary study). Bishen Singh
Mahendra Pal Singh, India. 488 p.
Egea JM. 1996. Catalogue of lichenized and lichenicolous fungi of Morocco. Bocconea 6: 19-114.
Eliasaro $, Adler MT. 1997. Two new species and new reports in the Parmeliaceae sensu stricto
(Lichenized Ascomycotina) from Brazil. Mycotaxon 63: 49-55.
Elix JA. 1994. Parmotrema. Flora of Australia 55: 140-162.
Elix JA, McCarthy P. 1998. Catalogue of the lichens of the smaller Pacific Islands. Bibliotheca
Lichenolologica 70: 5-361.
Elix JA, Schumm E 2001. A new species and new records in the lichen family Parmeliaceae
(Ascomycotina) from the Philippines. Mycotaxon 79: 253-260.
Fryday AM, Fair JB, Googe MS, Johnson AJ, Bunting EA, Prather LA. 2001. Checklist of lichens
and allied fungi of Michigan. Contributions to the University of Michigan Herbarium
23: 145-223.
Galloway DJ. 2001. Sticta. Flora of Australia 58A: 78-97.
Giao VTP. 2009. New records of lichens from Vietnam. Science & Technology Development,
12(09): 54-60.
Gowan SP, Brodo IM. 1988. The lichens of Fundy National Park, New Brunswick, Canada.
Bryologist 91(4): 255-325.
Hafellner J. 1995. A new checklist of lichens and lichenicolous fungi of insular Laurimacaronesia
including a lichenological bibliography for the area. Fritschiana 5: 1-132.
Hafellner J, Tiirk R. 2001. Die lichenisierten Pilze Osterreichs eine Checkliste der bisher
nachgewiesenen Arten mit Verbreitungsangaben. Stapfia 76: 1-167.
Hale ME. 1974. Bulbothrix, Parmelina, Relicina and Xanthoparmelia, four new genera in the
Parmeliaceae. Phytologia 28: 479-490.
Hale ME. 1975. A revision of lichen genus Hypotrachyna (Parmeliaceae) in tropical America.
Smithson. Cont. Bot. 25: 1-73.
Hughes R. 2010. The biodiversity of Chu Yang Sin National Park, Dak Lak Province, Vietnam. Bird
Life International in Indochina. Hanoi, Vietnam. 173 p.
Jorgensen P, Galloway DJ. 1992. Pannariaceae. Flora of Australia 54: 272-273.
Joshi S, Jayalal U, Oh SO, Nguyen TT, Dzung NA, Hur JS. 2012. Lichen genus Fissurina Fée
(Graphidaceae) from Vietnam. 173, in: Proceedings of the International Meeting of the
Federation of Korean Microbiological Societies.
Knezevic B, Mayrhofer H. 2009. Catalogue of the lichenized and lichenicolous fungi of Montenegro.
Phyton 48(2): 283-328.
Kurokawa S. 1960. Anaptychia (lichens) and their allies of Japan (3). J. Jpn. Bot. 35: 91-94.
Macrolichens newly recorded for Vietnam ... 59
Kurokawa S. 1993. Nepalese genera and species of the Parmeliaceae with notes on three additional
and rare species. Ann. Tsukuba Bot. Gard. 12: 75-81.
Llimona X, Hladun NL. 2001. Checklist of the lichens and lichenicolous fungi of the Iberian
Peninsula and Balearic Islands. Bocconea 14: 1-581.
Lépez-Figueiras M. 1986. Censo de macroliquenes de los estados Falcon, Lara, Mérida, Tachiray
Trujillo (Venezuela). Facultad de Farmacia, Universidad de Los Andes, Mérida.
Marcelli MP. 1991. Aspects of the foliose lichen flora of the southern-central coast of Sao Paulo
State, Brazil. 151-170, in DJ Galloway (ed.), Tropical lichens: their systematics, conservation,
and ecology. Oxford University Press.
Moberg R, Nash III TH. 2001. Heterodermia. 215, in TH Nash II et al. (eds.), Lichen Flora of the
Greater Sonoran Desert Region.
Nguyen TTT, Joshi Y, Licking R, Wang XY, Nguyen AD, Koh YJ, Hur JS. 2010. Notes on some new
records of foliicolous lichens from Vietnam. Taiwania 55(4): 402-406.
Nguyen TT, Joshi Y, Liicking R, Wang XY, Nguyen AD, Koh YJ, Hur JS. 2011. Seven new records of
foliicolous lichens from Vietnam. Mycotaxon 117: 93-99. http://dx.doi.org/10.5248/117.93
Orange A, James PW, White FJ. 2010. Microchemical methods for the identification of lichens.
British Lichen Society. 101 p.
Osorio HS. 1992. Contribucion a la flora liquénica del Uruguay. XXV. Lichenes publicados entre
1972 a 1991. Anales del Museo Nacional de Historia Natural de Montevideo 2(8): 43-70.
Riddle LW. 1920. Lichens. 522-553, in CF Millspaugh (ed.), The Bahama Flora. NL Britton.
Singh KP, Sinha GP. 2010. Indian lichens an annotated checklist. Botanical Survey of India.
Kolkata.
Sipman HJM. 1993. Lichens from Mount Kinabalu. Tropical Bryology 8: 281-314.
Streimann H. 1986. Catalogue of the lichens of Papua New Guinea and Irian Jaya. Biblioth.
Lichenol. 22: 1-145.
Tenorio LU, Sipman HJM, Licking R. 2002. Preliminary checklist of lichens from Costa Rica.
Version 1.2 http://archive.fieldmuseum.org/ticolichen/checklist.html. [Accessed Nov. 2012].
VARCC. 2009. Vietnam assessment report on climate change. Institute of Strategy and Policy on
Natural Resources and Environment, Vietnam (ISPONRE).
Verdon D. 1992. Physma. Flora of Australia 54: 193-196.
Wei JC. 1991. An enumeration of lichens in China. International Academic Publishers, Beijing.
Wolseley PA, Aguirre-Hudson B, McCarthy PM. 2002. Catalogue of the lichens of Thailand. Bull.
Nat. Hist. Mus. Lond. (Bot.) 32(1): 13-59.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.61
Volume 124, pp. 61-68 April-June 2013
Inonotus niveomarginatus and I. tenuissimus spp. nov.
(Hymenochaetales), resupinate species from tropical China
Hatr-You Yu, CHANG-LIN ZHAO & YU-CHENG Dat
Institute of Microbiology, P.O. Box 61, Beijing Forestry University, Beijing 100083, China
* CORRESPONDENCE TO: [email protected]
ABSTRACT — Two new species are described from tropical Yunnan, southwestern China.
Inonotus niveomarginatus is characterized by resupinate basidiocarps with distinct white
margins, a monomitic hyphal structure, absence of hymenial and hyphoid setae, and
yellowish, thick-walled, ovoid to subglobose basidiospores. Inonotus tenuissimus can be
distinguished from other Inonotus species by the combination of resupinate habit, a mono- to
dimitic hyphal structure, absence of the hymenial and hyphoid setae, and yellowish thick-
walled ellipsoid basidiospores.
Key worps — Hymenochaetaceae, polypore, taxonomy, wood-inhabiting fungi
Introduction
Yunnan Province in southwestern China is one of the biodiversity “hotspots”
in the world and rich with many vascular plants and fungi. Many wood-
decaying fungi have been described from this province (Chen & Cui 2012; Cui
et al. 2009; Dai 2010, 2011; Dai et al. 2002, 2009; He & Dai 2012; Li & Cui
2010, 2013; Yuan & Dai 2008; Zhao et al. 2013). During a systematic survey
of Inonotus P. Karst. species in southwestern China, two resupinate species
were found that lacked hymenial and hyphoid setae and possessed yellowish
thick-walled ovoid to subglobose or ellipsoid basidiospores. These prominent
characters distinguish the two species from all other known Inonotus species,
and they are described here as new.
Materials & methods
The studied specimens were deposited at the herbarium of Institute of Microbiology,
Beijing Forestry University (BJFC). The microscopic procedures were follows as in Cui
& Decock (2013). Sections were studied at magnifications up to 1000x using a Nikon
Eclipse 80i microscope with phase contrast illumination. Drawings were made with the
aid of a drawing tube. Microscopic features, measurements, and illustrations were made
62 ... Yu, Zhao & Dai
from the slide preparations stained with Cotton Blue and Melzer’s reagents. Spores were
measured from sections cut from the tubes. To present the spore size variation, the 5%
of measurements excluded from each end of the range are given in the parentheses;
spine lengths are not included in the basidiospore measurements. Abbreviations include
IKI = Melzer’s reagent, IKI- = negative in Melzer’s reagent, KOH = 5% potassium
hydroxide, CB = Cotton Blue, CB- = acyanophilous, L = mean spore length (arithmetic
average of all spores), W = mean spore width (arithmetic average of all spores), Q =
variation in the L/W ratios between the specimens studied, and n = number of spores
measured from the given number of specimens. Special color terms follow Petersen
(1996).
Taxonomy
Inonotus niveomarginatus H.Y. Yu, C.L. Zhao & Y.C. Dai, sp. nov. Fics 1-2
MycoBank MB805435
Differs from other Inonotus species by its resupinate growth habit, absence of hymenial
and hyphoid setae, and yellowish, thick-walled, ovoid to subglobose basidiospores.
Type: China, Yunnan Province, Xishuangbanna, Jinghong County, Sanchahe Nature
Reserve, on fallen angiosperm trunk, 7.VI.2011, Dai 12318 (holotype, BJFC).
ETYMOLOGY: niveomarginatus (Lat.): refers to the white margin of the basidiocarp.
FruitBopy — Basidiocarps annual, resupinate, cushion-shaped, adnate,
without odor or taste when fresh, becoming corky upon drying, <4 cm long, 2.5
cm wide, 4 mm thick at centre. Pore surface deep olive and margin white when
fresh, dark brown to yellowish brown upon drying; pores circular, 6-8 per mm;
dissepiments thin, entire. Subiculum brown, corky, <1 mm thick. Tubes dull
brown to blackish brown, corky, <3 mm long.
HyPHAL STRUCTURE — Hyphal system monomitic; generative hyphae
simple septate; tissues darkening in KOH.
SUBICULUM — Generative hyphae yellow, thin- to thick-walled with a
wide lumen, frequently septate, very rarely branched, more or less straight,
interwoven, 3-4.5 um in diam.
TuBEs — Generative hyphae yellowish, thin- to thick-walled, frequently
branched and septate, more or less straight, subparallel along the tubes, 2.5-3.5
um in diam. Basidia barrel-shaped, with four sterigmata and a basal simple
septum, 13-16 x 6-8.5 um; basidioles in shape similar to basidia, but slightly
smaller than basidia.
SpoRES — Basidiospores ovoid to subglobose, yellowish, thick-walled,
smooth, occasionally bearing a guttule, IKI-, CB-, (4.5-)4.9-5.7(-6) x (4.2-)
4.5-5.2(-5.5) um, L = 5.35 um, W = 4.95 um, Q = 1.06 (n = 30/1).
REMARKS — Four other Inonotus species — I. costaricensis Ryvarden, I. rigidus
B.K. Cui & Y.C. Dai, I. truncatisporus Corner, and I. venezuelicus Ryvarden —
also are characterized by resupinate basidiocarps, thick-walled colored spores,
Inonotus spp. nov. (China) ... 63
FiGure 1. Inonotus niveomarginatus (holotype). Basidiocarp.
and a lack of both hymenial and hyphoid setae (Corner 1991; Cui et al. 2011;
Ryvarden 1987, 2005). Inonotus costaricensis differs from I. niveomarginatus by
having globose and longer basidiospores (5.5-6.5 um long; Ryvarden 1987).
Inonotus rigidus differs from I. niveomarginatus by its ellipsoid and smaller
64 ... Yu, Zhao & Dai
(a
———N
Lay)
oo
said | \
d
10 um
es
10 pm
FIGURE 2. Inonotus niveomarginatus (holotype) microscopic structures.
a: Basidiospores. b: Basidia and basidioles. c: Hyphae from trama.
d: Hyphae from subiculum.
spores (3.9-4.5 x 2.9-3.7 um; Cui et al. 2011). Inonotus truncatisporus is
distinguished from I. niveomarginatus by its larger pores (4-6 per mm) and
truncate basidiospores (Corner 1991). Inonotus venezuelicus has larger pores
(3-4 per mm), ellipsoid basidiospores (5-6 x 4.5-5 um), and has been found
only in South America (Ryvarden 1987).
Inonotus tenuissimus H.Y. Yu, C.L. Zhao & Y.C. Dai, sp. nov. Figs 3-4
MycoBANnk MB805434
Differs from other Inonotus species by its resupinate basidiocarps, a mono- to dimitic
hyphal structure, absence of hymenial and hyphoid setae, and yellowish, thick-walled,
ellipsoid basidiospores.
Type: China, Yunnan Province, Puer County, Laiyanghe Forest Park, on fallen
angiosperm trunk, 6.V1.2011, Dai 12365 (holotype, BJFC).
ETyMOLOoGy: tenuissimus (Lat.): refers to the very thin subiculum.
Inonotus spp. nov. (China) ... 65
FiGuRE 3. Inonotus tenuissimus (holotype). Basidiocarp.
FRuITBODy — Basidiocarps annual, resupinate, adnate, becoming corky upon
drying, <15 cm long, 7 cm wide, 1.5 mm thick at centre. Pore surface vinaceous
grey to greyish brown when fresh, pale brown upon drying; pores angular, 3-4
per mm; dissepiments thin, entire. Subiculum brown, corky, up to 0.2 mm
thick. Tubes dull brown, corky, <1.3 mm long.
HyPHAL STRUCTURE — Hyphal system mono- to dimitic; generative hyphae,
simple septate; tissues darkening in KOH.
66 ... Yu, Zhao & Dai
BW
<<‘
d
| mencieniiaael
10 ym
4
a
ane
aa
oe)
uae,
Figure 4. Inonotus tenuissimus (holotype) microscopic structures.
a: Basidiospores. b: Basidia and basidioles. c: Hyphae from trama.
d: Hyphae from subiculum.
SUBICULUM — Generative hyphae yellow, thick-walled, frequently septate,
more or less straight, interwoven, 2.5-4.5 um in diam. Some skeletal-like
hyphae similar to generative hyphae, rarely septate.
TuBES — Generative hyphae yellowish, thick-walled, occasionally branched,
rarely septate, subparallel along the tubes, 3-4 um in diam. Some skeletal-like
hyphae similar to generative hyphae, rarely septate. Basidia clavate to barrel-
shaped, with four sterigmata and a basal simple septum, 12-18 x 4.5-6.5 um;
basidioles barrel-shaped, smaller than basidia.
Spores — Basidiospores ellipsoid, yellowish, thick-walled, smooth,
IKI-, CB-, (4-)4.3-5(-5.2) x (3-)3.2-4(-4.2) um, L = 4.8 um, W = 3.6 um,
Q = 1.31-1.38 (n = 90/3).
Inonotus spp. nov. (China) ... 67
ADDITIONAL SPECIMENS EXAMINED: CHINA. YUNNAN PROVINCE, PUER COUNTY,
Laiyanghe Forest Park, on fallen angiosperm branch, 6.VI.2011, Dai 12245 & Dai 12255
(BJFC); 9.VI.2011, Dai 12330 (BJFC).
REMARKS — Inonotus tenuissimus resembles I. venezuelicus in its resupinate
basidiocarps, similar pores, thick-walled and colored spores, and absence of
both hymenial and hyphoid setae. However, I. venezuelicus has greyish pores
when dry, a distinctly monomitic hyphal structure, larger and ellipsoid to ovoid
basidiospores (5-6 x 4.5-5 um), and has been found only in South America
(Ryvarden 2005).
Acknowledgments
We express our gratitude to Dr. Li- Wei Zhou (IFP, China) and Mr. Jaya Seelan Sathiya
Seelan (Clark University, USA) who reviewed the manuscript. The research was financed
by the National Natural Science Foundation of China (Nos. 31070022, 30910103907).
Literature cited
Corner EJH. 1991. Ad Polyporaceas 7. The xanthochroic polypores. Beih. Nova Hedwigia 101:
1-175.
Chen JJ, Cui BK. 2012. Studies on Wrightoporia from China 2. A new species and three new records
from South China. Mycotaxon 121: 333-343. http://dx.doi.org/10.5248/121.333
Cui BK, Decock C. 2013. Phellinus castanopsidis sp. nov. (Hymenochaetaceae) from southern China,
with preliminary phylogeny based on rDNA sequences. Mycological Progress 12: 341-351.
http://dx.doi.org/10.1007/s11557-012-0839-5
Cui BK, Dai YC, Bao HY. 2009. Wood-inhabiting fungi in southern China 3. A new species of
Phellinus (Hymenochaetales) from tropical China. Mycotaxon 110: 125-130.
http://dx.doi.org/10.5248/110.125
Cui BK, Du P, Dai YC. 2011. Three new species of Inonotus (Basidiomycota, Hymenochaetaceae)
from China. Mycological Progress 10: 107-114. http://dx.doi.org/10.1007/s11557-010-0681-6
Dai YC. 2010. Hymenochaetaceae (Basidiomycota) in China. Fungal Diversity 45: 31-343.
http://dx.doi.org/10.1007/s13225-010-0066-9
Dai YC. 2011. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience
52: 69-79. http://dx.doi.org/10.1007/s10267-010-0068-1
Dai YC, Niemela T, Kinnunen J. 2002. The polypore genera Abundisporus and Perenniporia
(Basidiomycota) in China, with notes on Haploporus. Annales Botanici Fennici 39: 169-182.
Dai YC, Cui BK, Yuan HS. 2009. Trichaptum (Basidiomycota, Hymenochaetales) from China with a
description of three new species. Mycological Progress 8: 281-287.
http://dx.doi.org/10.1007/s11557-009-0598-0
He SH, Dai YC. 2012. Taxonomy and phylogeny of Hymenochaete and allied genera of
Hymenochaetaceae (Basidiomycota) in China. Fungal Diversity 56: 77-93.
http://dx.doi.org/10.1007/s13225-012-0174-9
Li HJ, Cui BK. 2010. A new Trametes species from Southwest China. Mycotaxon 113: 263-267.
http://dx.doi.org/10.5248/113.263
Li HJ, Cui BK. 2013. Two new Daedalea species (Polyporales, Basidiomycota) from South China.
Mycoscience 54: 62-68. http://dx.doi.org/10.1016/j.myc.2012.07.005
Petersen JH. 1996. Farvekort. The Danish Mycological Society’s colour-chart. Foreningen til
Svampekundskabens Fremme, Greve. 6 p.
68 ... Yu, Zhao & Dai
Ryvarden L.1987. New and noteworthy polypores from tropical America. Mycotaxon 38:
525-541.
Ryvarden L. 2005. The genus Inonotus, a synopsis. Synopsis Fungorum 21: 1-149.
Yuan HS, Dai YC. 2008. Polypores from northern and central Yunnan Province, southwestern
China. Sydowia 60: 147-159.
Zhao CL, Cui BK, Dai YC. 2013. New species and phylogeny of Perenniporia based on morphological
and molecular characters. Fungal Diversity 58: 47-60.
http://dx.doi.org/10.1007/s13225-012-0177-6
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/124.69
Volume 124, pp. 69-72 April-June 2013
Arenariomyces truncatellus sp. nov., an ascomycete on driftwood
from the north coast of Zealand, Denmark
J. KocuH
GI. Dronninggadrds Allé 12, DK-2840 Holte, Denmark
ABSTRACT — Incubated driftwood from the north coast of Zealand, Denmark, yielded a
new species, Arenariomyces truncatellus, belonging to the Halosphaeriaceae, Ascomycota. The
species is characterized by globose, spiny ascomata formed on wood with asci deliquescing
before spore maturity and 1-septate ascospores with three delicate appendages at each
spore end. The species is compared with A. majusculus, A. parvulus, A. trifurcatus, and
A. triseptatus. A key to the species is provided.
Key worps — higher marine fungi, Microascales, taxonomy
Introduction
Investigations into the incidence and distribution of higher marine fungi
colonizing wood along the Danish coasts were initiated by Héhnk (1955) and
Kohlmeyer (1968). Since then more data have been accumulated and published
in “A check list of higher marine fungi on wood from Danish coasts” (Koch
& Petersen 1996) and further in Petersen (1997), Petersen & Koch (1997a,b),
and Koch et al. (2007). Also added (Koch unpublished) are Corollospora
angusta Nakagiri & Tokura, C. californica Kohlm. & Volkm.-Kohlm., and
C. pseudopulchella Nakagiri & Tokura. In this article, a new species of
Arenariomyces Hohnk (Halosphaeriaceae) is described from the north coast of
Zealand, Denmark.
Material & methods
Driftwood entrapped among stones and wood from the intertidal zone was collected
at Tisvildeleje on the north coast of Zealand, Denmark, in January 2008. Salt content
was around 10-20%. The wood was subsequently incubated at 16-19°C and examined
periodically for fruiting bodies. From the first formed A. truncatellus ascomata,
ascospores were used for inoculation of sterilized pieces of driftwood, on which ascomata
developed over a 4-8 month incubation period at 16-19°C ascomata developed.
70 ... Koch
Arenariomyces truncatellus Jorg. Koch, sp. nov. FIGs 1-5
MycoBAnk 50644
Differs from Arenariomyces majusculus by its smaller ascospores with two cells often
conspicuously different in size and with short delicate appendages.
Type: Denmark, North Zealand, Tisvildeleje (UTM 691000E 6217000N), from
driftwood (Picea sp.), Jan. 2008, Jorg. Koch 998, incubated nine months in humid
chamber (Holotype, CP [piece of conifer wood + slides 1-4]; isotype, CP [remainder
of collection Jorg. Koch 998]). [The original material also contained Dictyosporium
pelagicum (Linder) G.C. Hughes ex E.B.G. Jones and Halosphaeriopsis mediosetigera
(Cribb & W. Cribb) T.W. Johnson. ]
EryMo oey: From the Latin truncatellus = somewhat truncate, referring to the slightly
flattened ends of the ascospores, when appendages are not unfolded.
ASCOMATA on wood (rarely seated with subicula on grains of sand) measured
in situ 78-131-156 um (n = 19) in diam. Globose-subglobose with the basal
part immersed in the outermost layer of the substrate and anchored with brown
tortuous hyphae, often in tufts. Ascomata gregarious, black, shiny when young,
carbonaceous, brittle, covered with scattered brownish black spines, slightly
curved, up to 16 um long and 1.5-2 um wide, but sometimes with a swollen
base 4-8 um wide and 4 um high. Immature ascomata from 20 um in diam. are
covered with spines up to 8 um long. Neither necks nor ostioles were observed.
PERIDIUM membranous, single layered, composed of one layer of flat, on the
outside domed, thick-walled cells forming a textura angularis with edges 3-4-6
um, brownish black in transparent light. SustcuLUM composed of hyaline,
epidermoid cells merging into the thin-walled pseudoparenchyma, globose
or ellipsoidal as free cells (10-20-26 um in diam.), with scattered cytoplasm
and small oil globules filling the centre of young ascomata. In some cells a few
cytoplasmic strands stretching towards the cell wall indicate pit connections to
neighbouring cells.
Asci eight-spored, pyriform, 36-56 x 20-32 um, thin-walled, unitunicate,
deliquescing before maturity of the ascospores, developing from the base of the
ascocarp. No catenophyses or paraphyses. ASCOSPORES 18-21.4—24 x 8-10.2-
12 um (n = 66) measured in seawater (12%), cylindrical, 1-septate, more or less
constricted at the septa, often one cell is shorter and narrower than the other,
hyaline, with three subterminal-terminal appendages at each end. APPENDAGES
attenuate, straight or curved, delicate, up to 12 um long, about 1 um wide at the
base, expanded at right angles to the axis, 120° between each appendage. When
not unfolded the spore ends seem slightly flattened.
SUBSTRATE: Driftwood (conifer wood) between stones (intertidal zone).
Discussion
Jones et al. (2009) recognized the four species A. majusculus Kohlm. &
Volkm.-Kohlm., A. parvulus Jorg. Koch, A. trifurcatus Hohnk, and A. triseptatus
Arenariomyces truncatellus sp. nov. (Denmark) ... 71
Tei ry -
| le
- J
~~ ,
Fic. 1. Arenariomyces truncatellus. Group of ascomata formed on sterilized driftwood
inoculated with ascospores. Scale bar = 160 um.
Fics 2-5. Arenariomyces truncatellus. 2. Young asci. 3. Different stages of immature ascospores
forming an eight-spored cluster indicating an early deliquescing of the ascus wall. 4. Three
ascospores, one germinated after 72 hours in sea water (12%). 5. Part of the peridium with spines
and underlying epidermoid flattened cells. Scale bars: 2-4 = 10 um; 5 = 14 um.
Kohlm. in the genus Arenariomyces. The latest, A. truncatellus, is different from
these with respect to ascospore dimensions, the uneven sized spore cells, and the
short and delicate structure of the appendages. A. truncatellus and A. majusculus
ascomata are formed in the outermost part of the wood substrate and bearing
spines in contrast to A. parvulus, A. trifurcatus, and A. triseptatus. However, the
stability of ascomatal characters in the genus is questioned (on wood / on hard
surfaces, spines / no spines). For example, A. trifurcatus ascomata are sometimes
seen with a few spines and also directly on wood (Koch unpublished). Further
observations of the rare Arenariomyces species could perhaps reveal a similar
variability. But general similarities such as the thin-walled pseudoparenchyma
of the young ascomata, unitunicate asci that deliquesce early before ascospore
maturation, together with the three polar appendages point to A. truncatellus
72 ... Koch
as morphologically well accommodated as a new species in Arenariomyces. It
is recognized that examination of A. truncatellus in the electron microscope,
especially in regard to appendage development, and at the molecular level is
needed to establish its relationship to A. trifurcatus, the type species.
Key to Arenariomyces species
ba-Ascomatamain ly On WOO, of Lie. ade. opal webs hd Ss old by wlth Ate ash talade itty 2
1b. Ascomata mainly.on hard stirfaces.¢< ota. sags sae has blame Os a od ee ee 3
2a ASCOSPOLES ASH MLAS «bt AV oikes dy Foweten dy brwcon dying cdog rs poten dri schon dying op A. majusculus
2bunscospores 214 LO 2a tav: ted aloes 2 ota teed seated See ts es A. truncatellus
Day -ASCOSPOLES" SED CALS lay. ots! cot! atest: shade diet ohale do aha late aha lah! aha linia A. triseptatus
SH AASCOsPOresel Se ptate ew peels eiucten Bbube 4 aude y Bouin y Mouide y Meeede natauele wa Ry wal 4
Aad, BSCOSPOLES Ox 29 D0 D= Goll trea oan fe weehanll oa eee ele Ree RHEL aul A. parvulus
Aby AS COSPOLES 2BASZ, 29 = VG UIT aee sg dives eogdhireseg drt scene eeadrh sea gre aes A. trifurcatus
Acknowledgments
Iam grateful to Iben M. Thomsen and Flemming Rune, both at Forest and Landscape
Denmark (Faculty of Life Sciences, University of Copenhagen) for photographic work,
and to Iben M. Thomsen for preparing the manuscript for printing. Also I am grateful
to Dr. E.B. Gareth Jones and Dr. K.L Pang for reviewing the manuscript and giving
valuable comments.
Literature cited
Hoéhnk W. 1955. Studien zir Brack- und Seewassermykologie V. Héhere Pilze des submersen
Holzes. Veréffentlichungen des Instituts fiir Meeresforschung in Bremerhaven 3: 199-227.
Jones EBG, Sakayaroj J, Suetrong S, Somrithipol S, Pang KL. 2009. Classification of marine
Ascomycota, anamorphic taxa and Basidiomycota. Fungal Diversity 35: 1-203.
Koch J, Petersen KLR. 1996. A checklist of higher marine fungi on wood from Danish coasts.
Mycotaxon 60: 397-414.
Koch J, Pang KL, Jones EBG. 2007. Rostrupiella danica gen. et sp. nov. a Lulworthia-like
marine lignicolous species from Denmark and the USA. Botanica Marina 50: 294-301.
http://dx.doi.org/10.1515/BOT.2007.034
Kohlmeyer J. 1968. Danische Meerespilze (Ascomycetes). Berichten der Deutschen Botanische
Gesellschaft 81: 53-61.
Petersen KLR. 1997. Ultrastructural studies of the marine ascomycete Groenhiella bivestia. Botanica
Marina 40: 71-75. http://dx.doi.org/10.1515/botm.1997.40.1-6.71
Petersen KLR, Koch J. 1997a. Substrate preference and vertical zonation of lignicolous marine fungi
on mooring posts of oak (Quercus sp.) and larch (Larix sp.) in Svanemollen harbour, Denmark.
Botanica Marina 40: 451-463. http://dx.doi.org/10.1515/botm.1997.40.1-6.451
Petersen KLR, Koch J. 1997b. Buxetroldia bisaccata gen. et sp. nov., a marine lignicolous
halosphaeriacean fungus from coastal waters, Denmark. Mycological Research 101: 1524-1528.
http://dx.doi.org/10.1017/S0953756297004383
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.73
Volume 124, pp. 73-85 April-June 2013
New ascomycete records from Guatemala
ROSARIO MEDEL”*', OSBERTH MORALES’,
RANULFO CASTILLO DEL MORAL! & ROBERTO CACERES?
"Instituto de Investigaciones Forestales, Universidad Veracruzana,
Apartado Postal 551, 91070, Xalapa, Veracruz, México
*Departamento de Microbiologia, Facultad de Ciencias Quimicas y Farmacia,
Universidad de San Carlos de Guatemala, Guatemala
* CORRESPONDENCE TO: [email protected] OR [email protected]
ABSTRACT — Thirty-two species of ascomycetes were previously recorded from Guatemala.
This paper describes 12 newly recorded species, representing five orders and twelve
genera. Three previously reported species are redescribed because there are few data in the
Guatemalan literature.
Key worps — Helotiales, Hypocreales, Orbiliales, Pezizales, Xylariales, Central America
Introduction
Guatemala is a country of >108,000 km*. The name Quauhtemallan
(Guatemala) means “land of trees,’ referring to the original wide extent and
diversity of forests. Guatemala has been categorized as biologically mega-
diverse (Tolisano & Lopez 2010), but little is known about the fungal diversity
of this country and adjacent areas. There have been few studies on fungal
diversity, and the knowledge of the ascomycetes is poor; only 33 ascomycetes
species have been reported in previous studies (TABLE 1). The present study is
part of a project that began in 2007 to document the ascomycete diversity of
Guatemala.
Materials & methods
The study was based on a bibliographic revision and additional material collected
mainly from oak forests and cloud forests of the west of Guatemala. The following
literature was used for identifications: Abbot & Currah (1997); Breitenbach & Kranzlin
(1984); Dennis (1954; 1963; 1970; 1978), Glawe & Rogers (1984), Haines & Dumont
(1984); Hsieh et al. (2005); Ju & Rogers (1996); Medel (2002) Medel & Calonge, (2004);
Méndez-Mayboca et al. (2007); Ramamurthi et al. (1957); San Martin et al. (1998), and
7A ... Medel & al.
TABLE 1. Ascomycete species recorded from Guatemala.
(New records in bold font.)
Helotiales
Bisporella citrina This paper
Chlorociboria aeruginascens
(Nyl.) Kanouse ex C.S. Ramamurthi et al. Flores et al. (2012)
C. aeruginosa This paper
Lachnum abnorme This paper
L. brasiliense Haines & Dumont (1984); this paper
L. cyphelloides This paper
L. virgineum This paper
Leotia lubrica (Scop.) Pers. Sommerkamp & Guzman 1990
Trichoglossum farlowii (Cooke) E.J.Durand Flores et al. (2002, 2012)
Hypocreales
Cordyceps melolonthae (Tul. & C. Tul.) Sacc. Flores et al. (2012)
C. militaris (L.) Fr. Flores et al. (2012)
Hypomyces hyalinus (Schwein.) Tul. & C. Tul. Sommerkamp & Guzman (1990)
H. lactifluorum (Schwein.) Tul. & C. Tul. Bran et al. (2003)
Ophiocordyceps gracilis This paper
Orbiliales
Hyalorbilia inflatula This paper
Orbilia juruensis This paper
Pezizales
Aleuria aurantia (Pers.) Fuckel
Cookeina sulcipes (Berk.) Kuntze
Gyromitra infula
Helvella acetabulum
H. crispa (Scop.) Fr.
H. elastica Bull.
H. lacunosa Afzel.
H. macropus (Pers.) P. Karst.
Melastiza chateri (W.G. Sm.) Boud.
Morchella costata (Vent.) Pers.
M. elata Fr.
M. esculenta (L.) Pers.
M. guatemalensis Guzman et al.
Otidea onotica (Pers.) Fuckel
Phillipsia guatemalensis Paden
Pithya cupressina (Batsch) Fuckel
Scutellinia scutellata (L.) Lambotte
Wynnea americana Thaxt.
Xylariales
Annulohypoxylon thouarsianum
Daldinia concentrica
D. fissa Lloyd
D. vernicosa Ces. & De Not.
Diatrypella pulvinata
Phylacia poculiformis (Mont.) Mont.
Poronia pileiformis
Xylaria cubensis (Mont.) Fr.
X. multiplex (Kunze) Fr.
X. polymorpha (Pers.) Grev.
Sommerkamp & Guzman (1990)
Sommerkamp & Guzman (1990)
Bran et al. (2003): this paper
This paper
Bran et al. (2003)
Sommerkamp & Guzman (1990)
Bran et al. (2003); Sommerkamp & Guzman (1990)
Bran et al. (2003); Sommerkamp & Guzman (1990)
Flores et al. (2002)
Sommerkamp & Guzman, (1990)
Bran et al. (2003)
Sommerkamp & Guzman (1990); Bran et al. (2003)
Guzman et al. (1985)
Flores et al. (2002)
Paden 1977
Sommerkamp & Guzman (1990)
Sommerkamp & Guzman (1990)
Flores et al (2002; 2012)
Sharp (1948), Flores et al. (2012); this paper
This paper
Morales et al. (2006)
Bran et al. (2003)
This paper
Sommerkamp & Guzman (1990)
This paper
Sharp (1948)
Sommerkamp & Guzman (1990)
Flores et al. (2012)
Ascomycetes from Guatemala ... 75
Spooner (1987). All material studied was deposited in the mycological collection at XAL
herbarium (Instituto de Ecologia, A.C., Veracruz, Mexico) and duplicate specimens
were deposited in mycological collection MICG (Universidad de San Carlos, Facultad
de Ciencias Quimicas, Guatemala, Guatemala). Microscopic features were examined in
KOH 5% and Melzer’s iodine reagent, and at least 20 measurements of ascospores were
made per collection. Photographs were taken with a Sony Cyber Shot Camera, and some
photographs of spores were cleared of spots, stains and bubbles using Photoshop CS5
software.
Helotiales
Bisporella citrina (Batsch) Korf & S.E. Carp., Mycotaxon 1: 58 (1974) Fic. 1
Apothecia discoid to cupulate shaped, attached to the substrate by a short
stalk. Disc 1 mm diameter. Stalk 0.6 mm long, cylindrical. Hymenium bright
yellow and smooth outer surface. Asci cylindrical, 57-80 x 5-7 um, small pore
blue in Melzer’s reagent. Ascospores elliptical, smooth hyaline, with 2 guttules,
with a single septum when mature, 7-10 x 2-3 um. Paraphyses filiform with
rounded tips, 1-1.5 um thick, hyaline, thin walled.
HABITAT — Gregarious, lignicolous; in cloud forest at 1500 m.
MATERIAL EXAMINED — GUATEMALA. CHIMALTENANGO DEPARTMENT, San Andres
Itzapa Municipality, Aldea La Hierbabuena, 27 June 2007, Medel 1451 (XAL).
The bright yellow apothecia and ascospore size are diagnostic for this species.
Bisporella citrina is widely distributed (Dennis 1970, 1978; Breitenbach &
Kranzlin 1984; Medel & Calonge 2004; Méndez-Mayboca et al. 2007). This
represents a new record for Guatemala.
Chlorociboria aeruginosa (Oeder) Seaver ex C.S. Ramamurthi, Korf &
L.R. Batra, Mycologia 49: 859 (1958) [“1957”] Fic. 2
Apothecia globose to discoid shaped, irregularly distorted, 12 mm diameter,
attached to the substrate by a short central stipe; hymenium smooth, blue-
green. Stalk cylindrical, 0.5 mm long. Asci cylindrical, 8-spored, (57—) 70-80
x 5-6 um, small blue pore in Melzer’s reagent. Ascospores irregularly fusiform,
smooth, hyaline, with 2 guttules, 9-15 x 2-3 um. Paraphyses with rounded tips,
1-1.5 um thick.
HABITAT — Gregarious, lignicolous; in Cupressus forest at 1500 m.
MATERIAL EXAMINED — GUATEMALA. GUATEMALA DEPARTMENT, Universidad
de San Carlos de Guatemala, University Campus, Parque Ecoldgico Las Ardillas, 28
June 2007, Medel 1495 (XAL); CHIMALTENANGO DEPARTMENT, San Andrés Itzapa
Municipality, Aldea la Hierbabuena, 27 June 2007, Medel 1446 (XAL, MICG).
According to Dixon (1975) this species is close to C. aeruginascens, which also
has the same green color but which differs in smaller ascospores (6-10 x 1.5-2
um). Chlorociboria aeruginosa is distributed in North, South, and Central
76 ... Medel & al.
America, China, India, Japan, and the Philippines (Dixon 1975) and Venezuela
(Mardones-Hidalgo & Iturriaga 2011). Despite being a widely distributed
species, in Guatemala the species was not known.
Lachnum abnorme (Mont.) J.H. Haines & Dumont, Mycotaxon 19: 10 (1984)
Fics 3-4
Apothecia discoid, with white hairs, stipe very small and sometimes almost
sessile, 1 mm wide x 0.5 mm tall, hymenium light to dark yellow. Hairs sub-
cylindrical with blunt apex, with coarse granules, hyaline, with 2-3 septa, thin
walled, (40-)60-88 x (3-)3.5-4 um. Asci cylindrical, 8-spored (75-)87-94 x
7-8 um, small blue pore in Melzer’s reagent. Ascospores straight to s-shaped,
hyaline, (38-)40-57 x 2 um. Paraphyses lanceolate, (77-)94-102(-110) x 3-3.5
um, hyaline, 3-4-septate.
HaBITAT — Gregarious, lignicolous; in Cupressus forest at 1500 m.
MATERIAL EXAMINED — GUATEMALA. GUATEMALA DEPARTMENT, Universidad de
San Carlos de Guatemala, University City, Parque Ecolégico Las Ardillas, 28 June 2007,
Medel 1486 (XAL).
The studied specimen fitted well with the descriptions by Dennis (1963),
Haines & Dumont (1984), and Spooner (1987). Lachnum abnorme is widely
distributed in tropical regions of the world: Australia, New Zealand, Chile,
India, Central America, and Costa Rica (Haines & Dumont 1984); Panama
(Piepenbring 2006); and Venezuela (Mardones-Hidalgo & Iturriaga 2011). This
is the first record to Guatemala.
Lachnum brasiliense (Mont.) J.H. Haines & Dumont, Mycotaxon 19: 23 (1984)
Apothecia scattered on bark, light to dark yellow hymenium, 1.2 mm wide
disc, shallow receptacle, shaped cup with a hairy short stalk, white to pale
buff color and a blue-black base. Hairs cylindrical with obtusely rounded tips,
(52-)60-75(-80) x 3-4 um septate, thin walled, granulated. Asci cylindrical,
(66-—)78-82(-84) x 7-9 um, 8-spored, hyaline, small blue pore in Melzer’s
reagent. Ascospores narrowly fusiform, cylindrical, usually slightly curved,
occasionally becoming 3-septate, (30—)32-43 x 2.5-3 um. Paraphyses cylindrical,
(68-)72-91 x 2-3 um, 1-3-septate.
Hasitat — Gregarious, lignicolous; in cloud forest at 1800 m.
MATERIAL EXAMINED — GUATEMALA. CHIMALTENANGO DEPARTMENT, San Andrés
Itzapa Municipality, Aldea La Hierbabuena, 27 July 2007, Medel 1475 (XAL).
The dark to medium yellow ascomata clothed with white hairs and the blue-
black base of the stalk are distinctive characters. Lachnum brasiliense is a
common species in the tropics and has previously reported from Guatemala
(Haines & Dumont, 1984) in pine forest. The material examined was found in
cloud forest.
Ascomycetes from Guatemala ... 77
Figures 1-8. Bisporella citrina: 1, ascospores. Chlorociboria aeruginosa: 2, apothecia. Lachnum
abnorme: 3, ascospores; 4, apothecia. Lachnum cyphelloides: 5, apothecia. Lachnum virgineum:
6, paraphyses in Congo red. Hyalorbilia inflatula: 7, apothecia. Orbilia juruensis: 8, paraphyses.
Bars: 1, 8 = 10 um; 2 = 1 cm; 3, 6 = 20 um; 4, 7 = 2 mm, 5= 1 mm.
Lachnum cyphelloides (Pat.) J.H. Haines & Dumont, Mycotaxon 19: 30 (1984) Fic. 5
Apothecia yellow translucent, disc 1 mm wide x 1.2 mm of height, long
stipitate, small white hairs to almost smooth. Hairs cylindrical, with obtusely
rounded tips, 48-70 x 3-4 um septate, hyaline, thin wall, granulated. Asci
cylindrical 66-67 x 6-7 um, small blue pore in Melzer’s reagent. Ascospores
fusiform, 31-40 x 1.5-2 um hyaline. Paraphyses lanceolate, (68-) 72-91 x 2-3
um hyaline, 1-3-septate.
Hasitat — Gregarious, lignicolous; in cloud forest at 1800 m.
78 ... Medel & al.
MATERIAL EXAMINED — GUATEMALA. GUATEMALA DEPARTMENT, Universidad de
San Carlos de Guatemala, University Campus, Parque Ecoldégico Las Ardillas, 27 July
2005, Medel 1465-A (XAL); 28 July 2005, Medel 1446 (XAL, MICG).
According to Haines & Dumont (1984), L. cyphelloides is covered with white
hair, has a yellow pale disc, and its stipe lacks a blue-black base. The species
is distributed in Central America, northern South America, and the Lesser
Antilles (Haines & Dumont, 1984; Piepenbring 2006). ‘This is first record for
Guatemala.
Lachnum virgineum (Batsch) P. Karst., Bidr. Kann. Finl. Nat. Folk 19: 169 (1871)
Fic. 6
Apothecia concave smooth disc, 1-1.5 mm in diameter, white to creamy
white, and margin enrolled when it dries. Central stipe, covered with white hairs,
1-1.2 mm of height. Hairs cylindrical, with obtusely rounded tips, 75-100 x
4-5 um septate, thin walled, granulated hyaline. Asci cylindrical asci, 8-spored,
34-45 x 4-5um, thin walled, small blue pore in Melzer’s reagent. Ascospores
fusiform, 6-8 x 1.5-2 um, thin walled, hyaline. Paraphyses lanceolate, 70-100
x 5-6 um, septate, hyaline, longer than the asci.
HaBITaT — Gregarious, lignicolous; in tropical forest at 160 m.
MATERIAL EXAMINED — GUATEMALA. ALTA VERAPAZ DEPARTMENT, Coban
Municipality, Ecorregién Lachua, 17 September 2005, Lopez y Quezada 2473 (XAL).
Lachnum virgineum is characterized by apothecia covered by straight, white
granulate hairs. Spooner (1987) reported the species from North and South
America, Europe, North Africa, Central Asia, India, Japan, Papua New Guinea,
and Australia. This is a new record for Guatemala.
Hypocreales
Ophiocordyceps gracilis (Grev.) G.H. Sung, J.M. Sung, Hywel-Jones & Spatafora,
Stud. Mycol. 57:43 (2007)
Stromata with long cylindrical apices terminating in 5 x 3 mm heads, red
ochraceous, with dark dotted perithecial ostioles. Stipe yellow-olive. Asci with
many individual spores, 250-280 x 6 um, pore not blue in Melzer’s reagent.
Ascospores cylindrical, smooth, 7-10 x1-2 um, hyaline, lined chainlike upon
each other within the ascus. Paraphyses not observed.
Hasitat — Solitary, on larvae of Lepidoptera; in cloud forest, 1800 m.
MATERIAL EXAMINED — GUATEMALA. CHIMALTENANGO DEPARTMENT, San Andrés
Itzapa Municipality, Aldea La Hierbabuena, 21 June 2007, Medel 1466 (XAL).
Our specimen was consistent with the descriptions by Mains (1958), Dennis
(1978), and Breitenbach & Kranzlin (1984). Ophiocordyceps gracilis is always
associated with lepidopteran larvae. This is the first report for Guatemala.
Ascomycetes from Guatemala ... 79
Orbiliales
Hyalorbilia inflatula (P. Karst.) Baral & G. Marson, Micologia 2000 (Trento): 44
(2000) Fic. 7
Apothecia less than 1.5 mm wide, orange to yellow color, with rolled margin.
Asci cylindric-clavate, rounded apex, 8-spored, 21-23(-29) x 3-3.5(-4) um,
pore not blue in Melzer’s reagent. Ascospores cylindrical, straight or slightly
curved, rounded ends, 4-8 x 0.8-1 um. Paraphyses cylindrical hyaline, 18-21 x
2(-2.5) um, septate, with apices encrusted to form a thin epithecial layer.
Hasitat — Gregarious, lignicolous; in cloud forest and Cupressus forest at 1800 m.
MATERIAL EXAMINED — GUATEMALA. CHIMALTENANGO DEPARTMENT, San Andrés
Itzapa Municipality, Aldea La Hierbabuena, 27 June 2007, Medel 1467, 1484 (XAL);
GUATEMALA DEPARTMENT, Universidad de San Carlos de Guatemala, University
Campus, Parque Ecoldgico Las Ardillas, 28 June 2007, Medel 1485-B (XAL, MICG).
Our specimen agreed with the description by Spooner (1987). Liu et al. (2006)
note that Hyalorbilia inflatula is widely distributed in China. The species has
also been recorded from Venezuela (Mardones-Hidalgo & Iturriaga 2011). This
is the first report for Guatemala.
Orbilia juruensis Henn., Hedwigia 43: 270 (1904) Fic. 8
Apothecia superficial, sessile or subsessile, disc convex or undulate,
with crenulate margin, translucent orange-yellow, smooth, 1 mm diameter.
Receptacle smooth, concolorous or slightly paler than the disc, thin at the
margin and thicker towards the centre. Asci cylindric-clavate , broadest at the
apex and tapered downwards to a narrow base which is sometimes forked, apex
truncate or obtusely rounded, 29-37 x 3.5-4 um, pore not blue in Melzer’s
reagent. Ascospores straight or slightly inequilateral to fusoid, hyaline, (6-)
7-9(-10) x 1-1.5 um, not septate. Paraphyses capitate, tips up to 3.5-4 um
diameter, 21-30 x 2-3 um, 1-2-septa in the lower part.
HaBITAT — Gregarious, lignicolous; in Cupressus forest at 1500 m.
MATERIAL EXAMINED — GUATEMALA. GUATEMALA DEPARTMENT, Universidad de
San Carlos de Guatemala, University Campus, Parque Ecolédgico Las Ardillas, 28 June
2007, Medel 1491 (XAL).
This species is known form South America, Australasia, and Solomon Island
(Spooner 1987), Argentina (Wright & Wright 2005), and Panama (Piepenbring
2006). This is the first record for Guatemala.
Pezizales
Gyromitra infula (Schaeff.) Quél., Enchir. Fung.: 272 (1886)
Ascoma bilobate or saddle-shaped, generally fused with the stipe. The
hymenium covers the whole surface, which is cinnamon to dark brown. The
80 ... Medel & al.
interior is hollow and whitish. The stipe is smooth, often somewhat furrowed
or pitted, and finely felty towards the base. Asci cylindrical, (140-)150-250 x
15-17 um. Ascospores elliptical, smooth, with 2 guttules, hyaline, 18-22 x 8-10
um. Paraphyses clavate, 80-100 x 7-10 um.
Hasitat — Solitary or gregarious, humicolous; in Pinus-Abies forest, 2900 m.
MATERIAL EXAMINED — GUATEMALA. ToTONICAPAN DEPARTMENT, Totonicapan
Municipality, Mercado municipal de Totonicapan, 18 September 2001, Morales 295
(MICG); 19 August 2006, Morales 561 (MICG); Totonicapan Municipality, Aldea
Panquix, 31 August 2003, Morales 485 (MICG).
The bilobate or saddle-shaped ascoma is characteristic of this species (Abbott
& Currah 1997). Bran et al. (2003) previously reported this species from
Guatemala, and it is also known from Mexico (Medel 2005).
Helvella acetabulum (L.) Quél., Enchir. Fung. 275 (1886)
Ascoma cup-shaped with an irregular margin, 25-50 mm broad; fertile
surface dull brown. Lower surface smooth to subglabrous, light brown with
conspicuous pallid to cream raised ribs extending from the stipe base to middle
of the cup; thick whitish deeply ridged. Asci cylindrical, 200-300 x 14-17 um.
Ascospores broadly elliptical, hyaline, 15-21(-22) x 11-15 um, smooth, with
one guttule. Paraphyses with rounded tips, 5-6 um thick.
Hasitat — Solitary, humicolous; in pine-oak forest at 2300 m.
MATERIAL EXAMINED — GUATEMALA. CHIMALTENANGO DEPARTMENT, Tecpan
Municipality, Mercado municipal de Totonicapan, 7 October 1999, Morales 47 (MICG)
The ridged pale brown apothecium is characteristic of this species (Calonge
& Arroyo 1990, Abbot & Currah 1997). The species is known from Canada
(Abbot & Currah 1997), China (Zhuang 2004), Mexico (Medel & Calonge
2004; Vite-Garin et al. 2006) and Spain (Calonge & Arroyo 1990). This is the
first record for Guatemala.
Xylariales
Annulohypoxylon thouarsianum (Lév.) Y.M. Ju, J.D. Rogers & H.M. Hsieh,
Mycologia 97: 861 (2005) Fics 9-10
Stromata sessile, globose, 12 mm wide x 7 mm high, with papillate ostioles
in the middle ofa deep ring, surface dark brown to black, carbonaceous, context
fibrous woody, radially lined to faintly concentrically zoned grey and brown.
Asci not observed. Ascospores inequilateral narrowly elliptical to slightly
fusoid, light to medium brown, smooth, 23-27 x 6-7 um, with a germ slit spore
length on the flattened side. Paraphyses not seen.
Hasitat — Gregarious, lignicolous; in oak forest.
MATERIAL EXAMINED — GUATEMALA. CHIMALTENANGO DEPARTMENT, Tecpan
Municipality, Astillero Municipal, 21 July 2007, Medel 1436 (XAL).
Ascomycetes from Guatemala ... 81
FiGurEs 9-14. Annulohypoxylon thouarsianum: 9, ascospores in KOH 5%; 10, stromata. Daldinia
concentrica: 11, ascospores in 5% KOH. Diatrypella pulvinata: 12, ascospores in 5% KOH. Poronia
pileiformis: 13, ascus with blue pore + in Melzer’s solution; 14, stromata (ostiole and perithecia).
Bars: 9 = 20 um; 10, 14 = 1 cm; 11 = 15 um; 12 = 10 um; 13 = 40 um.
The species was first recorded from Guatemala by Sharp (1948) as Hypoxylon
malleolus Berk. & Ravenel,, a synonym of A. thouarsianum (Ju & Rogers 1996,
Hsieh et al. 2005). This is a common xylariaceous species with greenish pigments
in KOH and papillate ostioles in the middle of a deep disc (Ju & Rogers 1996;
Medel 2002). The species is also known from Mexico (Pérez-Silva 1987; Medel
2002) and Panama (Piepenbring 2006).
Daldinia concentrica (Bolton) Ces. & De Not., Comm. Soc. Crittog. Ital. 1: 197
(1863) Fic. 11
Stromata, globose circular to oval shaped 20-30 mm wide, sessile and,
attached to the substrate, hard surface, reddish-brown to blackish young,
and finally black. Asci cylindrical, 100-130 x 7-8 um, uniseriate. Ascospores
broadly elliptical to bean shape, dark brown, germ line straight, 13-15 x (6-)
6.5-7 um. Paraphyses not seen.
Hasitat — Gregarious, lignicolous; in oak forest.
MATERIAL EXAMINED — GUATEMALA. CHIMALTENANGO DEPARTMENT, Tecpan
Municipality, Astillero Municipal, 21 July 2007, Medel 1423 (XAL).
82 ... Medel & al.
The important diagnostic characters of this species are the concentric lines in
the stromata, and purple stromatal pigment in 5% KOH (Ju et al. 1997; Rogers
et al. 1999). In Guatemala two species have been cited: D. vernicosa (Bran et al.
2003) and D. fissa (Morales et al. 2006). Daldinia concentrica, not previously
reported for Guatemala, is also known from Mexico (Pérez-Silva 1978) and
Europe, India, New Zealand, Taiwan, and the United States of America (Ju &
Rogers 1997).
Diatrypella pulvinata Nitschke, Pyrenomyc. Germ. 1: 72 (1867) Fic. 12
Stromata pulvinate to oval, ostioles 3-5 sulcate, with endostromatic yellow
whitish tissue. Asci multispored. Ascospores 7-9 x 1.5-2 um, slightly curved
(allantoid), hyaline, with 2 guttules. Paraphyses not seen.
HaBiTaT — Gregarious, lignicolous; in Cupressus forest at 1500 m.
MATERIAL EXAMINED — GUATEMALA. GUATEMALA DEPARTMENT, Universidad de
San Carlos de Guatemala, University Campus, Parque Ecoldégico Las Ardillas, 28 July
2007, Medel 1489 (XAL).
The black sessile and pulvinate stromata with papillate ostioles are typical.
Diatrypella pulvinata is known from Costa Rica, Europe, and the United States
of America (Glawe & Rogers 1984; Chacén & Humafia 2006). This is the first
record for Guatemala.
Poronia pileiformis (Berk.) Fr., Nova Acta R. Soc, Scient. Upsal., Ser. 3, 1: 129
(1851) Fics 13-14
Stromata simple to branched, at the top of the stalk it has a small umbelliform
4-6 mm broad head, beige with dark dots (perithecial ostioles), smooth and
leathery, later becoming hard and brittle. Ostioles papillate. Stipe dark brown to
black, 60-70 mm high x 1-6 mm wide, smooth or ribbed with a thickened base.
Asci cylindrical, 100-130 x 4-5 um, pore blue in Melzer’s reagent. Ascospores
ellipsoid, dark brown, 7-11 x 4-5 um, with a straight germ line as long as the
length of the spore. Paraphyses not seen.
Hasitat — Gregarious, fimicolous, in tropical forest at 160 m.
MATERIAL EXAMINED — GUATEMALA. ALTA VERAPAZ DEPARTMENT, Coban
Municipality, Ecorregién Lachua, 19 September 2005, Lopez y Quezada 2473 (XAL).
This species is distinguished by the simple or branched stromata with a beige
head with black papillate ostioles, growing on dung (Dennis 1957; San Martin
et al. 1998). It is known from Costa Rica, Mexico, Peru, and Philippines. This is
the first record for Guatemala
Discussion
With the new records, there are now 44 ascomycete species known from
Guatemala (TABLE 1). The species encompass 26 genera of which Helvella
Ascomycetes from Guatemala ... 83
(5) and Morchella (4) provided the most records. The Pezizales was the most
diverse order with 11 genera and 18 species. About 50% of the 200 specimens
collected during the last survey in 2007 might represent new records or even
new species.
The continued study of ascomycetes and other fungi from Guatemala
will improve the knowledge of these organisms. This is essential because
deforestation threatens to decrease the fungal biodiversity in this country. Recent
deforestation data from Guatemala indicate a net 2006-2010 deforestation rate
of over 38,000 ha / year (Regalado et al. 2012).
Acknowledgments
The authors thank to M.C. Bran (Universidad San Carlos de Guatemala) for
supporting the expedition to collected the studied material of this study. Thanks to Dr.
Gaston Guzman and Juan Lara (INECOL) for providing literature and facilities to consult
the herbarium, and to the reviewers Dra. Evangelina Pérez Silva (Universidad Nacional
Auténoma de México) and Dra. Cecilia Carmaran (Universidad de Buenos Aires), who
significantly improved this manuscript. Special thanks to Dr. Shaun Penycook for his
critical review.
Literature cited
Abbott SP, Currah RS. 1997. The Helvellaceae: systematic revision and occurrence in Northern and
northwestern North America. Mycotaxon 62: 1-125.
Bran MC, Morales O, Caceres R, Flores R. 2003. Contribucién al conocimiento de los hongos
comestibles de Guatemala. Revista Cientifica de la Facultad de Ciencias Quimicas y Farmacia,
edicion especial 1(1): 5-24.
Breitenbach J, Kranzlin F. 1984. Fungi of Switzerland. Volume 1: Ascomycetes. Luzern, Switzerland:
Verlag Mykologia. 310 p.
Calonge FD, Arroyo I. 1990. Notes on the genus Helvella in Spain. Mycotaxon 39: 203-217.
Chacon S, Humana L. 2006. Dyatripales (Ascomycota) de Costa Rica. Revista Mexicana de
Micologia 23: 37-47.
Dennis RWG. 1954. Some inoperculate discomycetes of tropical America. Kew Bulletin 9: 289-348.
http://dx.doi.org/10.2307/4114399
Dennis RWG. 1957. Further notes on tropical American Xylariaceae. Kew Bulletin 1957: 297-332.
http://dx.doi.org/10.2307/4114428
Dennis RWG. 1963. A redisposition of some fungi ascribed to the Hyaloscyphaceae. Kew Bulletin
17: 319-379. http://dx.doi.org/10.2307/4118967
Dennis RWG. 1970. Fungus flora of Venezuela and adjacent countries. Kew Bulletin Additional
Series 3, Royal Botanical Garden. Kew. England. 531 p.
Dennis RWG. 1978. British Ascomycetes. J. Cramer, Vaduz. 585 p.
Dixon, JR.1975. Chlorosplenium and its segregates. II. The genera Chlorociboria and Chlorencoelia.
Mycotaxon 1: 193-237.
Flores R, Bran MC, Rodriguez E, Morales O, Berdto O, Montes L. 2002. Hongos micorricicos
de bosques de pino y pinabete. Direccién General de Investigacién-DIGI. Universidad de San
Carlos de Guatemala, Guatemala. 50 p.
84 ... Medel & al.
Flores R, Comandini O, Rinaldi AC. 2012. A preliminary checklist of macrofungi of Guatemala,
with notes on edibility and traditional knowledge. Mycosphere 3(1): 1-21.
http://dx.doi.org/10.5943/mycosphere/3/1/1
Glawe DA, Rogers JD. 1984. Diatrypaceae in the Pacific Northwest. Mycotaxon 20: 401-460.
Guzman G, Torres ME, Logemann H, Argueta J, Sommerkamp Y. 1985. Fungi from Guatemala, I.
A new species of Morchella. Mycologia Helvetica 1: 451-459.
Haines J, Dumont K. 1984. Studies in the Hyaloscyphaceae II: the long-spored lignicolous species
of Lachnum. Mycotaxon 19: 1-39.
Hsieh HM, Ju YM, Rogers JD. 2005. Molecular phylogeny of Hypoxylon and closely related genera.
Mycologia 97: 844-865. http://dx.doi.org/10.3852/mycologia.97.4.844
Ju YM, Rogers JD. 1996. A revision of the genus Hypoxylon. Mycologia Memoir 20. APS Press. St.
Paul. MN. 365 p.
Ju YM, Rogers JD, San Martin F. 1997. A revision of Daldinia. Mycotaxon 61: 243-263.
Liu B, Liu XZ, Zhuang WY, Baral HO. 2006. Orbiliaceous fungi from Tibet, China. Fungal Diversity
22: 107-120.
Mains, EB.1958. North American entomogenous species of Cordyceps. Mycologia 50: 169-222.
http://dx.doi.org/10.2307/3756193
Mardones-Hidalgo H, Iturriaga T. 2011. Diversity and substrate partitioning of discomycetes in a
cloud forest in Venezuela. Mycosphere 2:617-625. http://dx.doi.org/10.5943/mycosphere/2/6/2
Medel R. 2002. Nuevos registros de Pyrenomicetes (Ascomycotina) en México. Boletin de la
Sociedad Botanica de México 70: 79-85.
Medel R. 2005. A review of the genus Gyromitra (Ascomycota, Pezizales, Discinaceae) in Mexico.
Mycotaxon 94: 103-110.
Medel R, Calonge FD. 2004. Aportacién al conocimiento de los discomycetes de México, con
especial referencia al género Helvella. Boletin de la Sociedad Micoldgica de Madrid 28:
151-159.
Méndez-Mayboca F, Chacén S, Coronado M, Esqueda M. 2007. Ascomicetes de Sonora; México,
II: Reserva Forestal Nacional y Refugio de fauna silvestre Ajos-Bavispe. Revista Mexicana de
Micologia 25: 33-40.
Morales O, Medel R, Guzman G. 2006. Primer registro de comestibilidad de una especie de Daldinia
(Ascomycota). Revista Mexicana de Micologia 23: 103-105.
Pérez-Silva E. 1978. El género Daldinia (Pyrenomycetes) en México. Boletin de la Sociedad
Mexicana de Micologia 7: 51-58.
Pérez-Silva E. 1987. Distribucién del género Hypoxylon (Pyrenomycetes) de México.Anales del
Instituto de Biologia UNAM, Serie Botanica 54: 1-22.
Piepenbring M. 2006. Check list of Fungi Panama. Puente Bioldgico. Revista Cientifica de la
Universidad Aut6noma de Chiriqui en Panama. Volumen 1: 1-190.
Ramamurthi CS, Korf RP, Batra L.R. 1957. A revision of the North American species of Chlorociboria
(Sclerotiniaceae). Mycologia 49: 854-863. http://dx.doi.org/10.2307/3755807
Regalado O, Villagran X, Pérez G, Castellano E, Martinez G, Incer D. 2012. Mapa de Cobertura
Forestal de Guatemala 2010 y Dinamica de la Cobertura Forestal 2006-2010. INAB, CONAP,
Universidad del Valle de Guatemala, Universidad Rafael Landivar. Guatemala, Guatemala
111p.
Rogers JD, Ju YM, Watling R, Whalley AJS. 1999. A reinterpretation of Daldinia concentrica based
upon a recently discovered specimen. Mycotaxon 52: 507-519.
San Martin F, Lavin P, Pérez-Silva E. 1998. Xilariaceae Fimicolas: Xylaria esquina sp. nov. y nuevos
registros mexicanos Xylaria pileiformis y Poronia erici. Acta Botanica Mexicana 42: 15-23.
Ascomycetes from Guatemala ... 85
Sharp, A. 1948. Some fungi common to the Highlands of Mexico and Guatemala and Eastern
United States. Mycologia 40: 499-502. http://dx.doi.org/10.2307/3755157
Sommmerkamp I. Guzman G. 1990. Hongos de Guatemala II. Especies depositadas en el herbario
de la Universidad de San Carlos de Guatemala. Revista Mexicana de Micologia 6: 179-197.
Spooner, BM. 1987. Helotiales of Australasia, Geoglossaceae, Orbiliaceae, Sclertoiniaceae,
Hyaloscyphaceae. Bibliotheca Mycologica Band 116.711 p.
Tolisano J, Lépez MM. 2010. Guatemala biodiversity and tropical forest assessment. The United
States Agency for International Development (USAID), Washington, D.C. 108 pp.
Vite-Garin MT, Villaruel Ordaz JL, Cifuentes Blanco J. 2006. Contribucién al conocimiento del
género Helvella (Ascomycota: Pezizales) en México: descripcién de especies poco conocidas.
Revista Mexicana de Biodiversidad 77: 143-151.
Wright JE, Wright AM. 2005. Checklist of the mycobiota of Iguazu National Park (Misiones,
Argentina). Boletin de la Sociedad Argentina de Botanica 40: 1-22.
Zhuang WY. 2004. Preliminary survey of the Helvellaceae from Xinjiang, China. Mycotaxon 90:
35-42.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.87
Volume 124, pp. 87-99 April-June 2013
Coleosporium in Europe
STEPHAN HELFER
Royal Botanic Garden Edinburgh, 20A Inverleith Row, Edinburgh EH3 5LR, UK
CORRESPONDENCE TO [email protected]
ABSTRACT — The species of Coleosporium (Uredinales) occurring in Europe are not clearly
differentiated morphologically. Most taxa in Europe have been combined into formae speciales
(fE.spp.) of Coleosporium tussilaginis by the majority of researchers. This study includes the
taxa C. doronici, C. inulae, and C. telekiae as further ff.spp. in C. tussilaginis and redefines
the existing ffspp. campanulae-rapunculoidis and senecionis-silvatici. It is hoped that this
treatment will establish a pragmatic basis on which future taxonomic work can be built.
KEY worps — rust fungi, cryptic species, host specialism
Introduction
Coleosporium Lév. isa genus of Uredinales G. Winter (rust fungi) with the aecial
stage parasitic on two-needle pines (Pinus spp.) and the telial stage on members
of a wide range of angiosperm species. Its distribution is mostly limited to the
northern hemisphere, where it is widespread and common in Europe, Asia, and
North America (Farr & Rossman 2013, GBIF 2013). However, specimens have
also been reported from South America (Arthur 1918, Hennen 2005) and New
Zealand (McKenzie 1998). Their presence on two-needle pines has not been
confirmed in these southern areas and specimens from Chile were reported to
lack the teleomorph, possibly as a result (Arthur 1918). In New Zealand it is
likely that already infected hosts from the northern hemisphere were planted or
intercepted, and there is one reference of introduced Coleosporium rust on an
indigenous species but no infections on two-needle pines have been reported
(McKenzie 1998, Farr & Rossman 2013).
Léveillé established the genus in 1847. In a short note, he devised a system
to bring more clarity into the confusing number of identical names of clearly
distinct species and species with multiple names on account of their occurrence
on a number of host plant species or genera (Léveillé 1847).
The type species is Coleosporium campanulae (lectotype, Laundon 1975).
88 ... Helfer
TABLE 1. Distribution of Coleosporium in host plant families in Europe
PLANT FAMILY Host GENERA Host SPECIES PREDOMINANT HOST GENUS
Asteraceae 35 110 Senecio (34 host taxa)
Campanulaceae 10 82 Campanula (63 host taxa)
Orobanchaceae 8 38 Euphrasia (16 host taxa)
Ranunculaceae 2 9
Pinaceae 1 10
CASUAL HOSTS & MISDETERMINATIONS NOTES
Tropaeolaceae 1 3 non-native plants
Orchidaceae 1 1 border intercept plant
Solanaceae 1 1 South American plants
[Amaranthaceae] [1] [1] ? misidentified host
Amarldccd r Pia seperti
[Boraginaceae] [2] [2] = Melampsorella symphyti
[Caryophyllaceae] [1] [1] = Caeoma coronariae
[Rosaceae] [1] [1] = Pucciniastrum agrimoniae
Most authors agree that the European taxa of Coleosporium are
indistinguishable in their morphology (e.g. Sydow & Sydow 1915, Hylander
et al. 1953, Gdumann 1959, Wilson & Henderson 1966, Boerema & Verhoeven
1972). Therefore, many authors used the host plant identity to distinguish
species (Gdumann 1959, Minkevicius & Ignataviciité 1991, Brandenburger
1994). Many current inventories treat all Coleosporium taxa distinguished in
Europe as a single species and synonymise most of the original species into
Coleosporium tussilaginis (Encyclopedia of Life 2012, Index Fungorum 2012).
However, C. doronici, C. inulae, C. ligulariae, and C. telekiae have never been
formally included in C. tussilaginis, although Hylander et al. (1953) did
synonymise C. ligulariae with C. senecionis. The three remaining taxa are
transferred to C. tussilaginis in the present study.
While some authors do not name the taxa included under C. tussilaginis
(e.g. Majewski & Ruszkiewicz-Michalska 2008, Termorshuizen & Swertz 2011),
others distinguish and name them (e.g., Gdumann 1959, Boerema & Verhoeven
1972, Encyclopedia of Life 2012, Bahcecioglu & Kabaktepe 2012), most often
as formae speciales, i.e., biologically specialised forms (Eriksson 1894, Anikster
1984, Kirk et al 2008; see also the next paragraph below). The latter approach
reflects the host specificity of Coleosporium analysed by extensive inoculation
experiments (e.g., Klebahn 1904, 1924, Gaumann 1959, EURED names 2012).
I follow this approach and extend it to all the European taxa.
Coleosporium in Europe... 89
Formae speciales (ff.spp.) are defined as taxa below the species level which
are morphologically not or hardly distinguishable but are separated by host
plant specificity. Nomenclature at this rank is not covered by the provisions of
the International Code of Nomenclature for algae, fungi, and plants (McNeill
et al. 2012: Article 4 Note 4); therefore in this paper I present them as newly
named taxa, rather than as “comb. nov.’
This study covers the European taxa of Coleosporium on native plants. In
the absence of molecular data, a morphological species concept is applied,
extended by the use of discrete host plant ranges, in defining the sub-specific
taxa of formae speciales, as described above. The aim is to present a pragmatic
and effective basis for specimen sampling for molecular analysis, in order to
generate data for further studies.
Materials & methods
The herbaria of Berlin (B), Paris (PC), Copenhagen (CP), St Petersburg (LE), Beltsville
(BPI) and Edinburgh (E) were consulted in this research. Furthermore information was
acquired from Ziirich and Bern (Helfer et al. 2011) and from databases at Stockholm
(Krypto-S 2012), BPI (Farr & Rossman 2013) and National Herbarium Netherlands
(NHL 2012). Label information was extracted and compared with accepted host plant
taxonomy using the Plant List (2012) database. Geographical information was checked
using Fuzzy Gazetteer (Kohlschiitter 2012) and Google Map (©2012 Google) and
compiled according to the areas in the Atlas Florae Europaeae delimitations of Europe
(Atlas Florae Europaeae 2012). Where reports were from non native or cultivated plants,
this is indicated by the use of square brackets [ ]. Type material for C. telekiae, C. doronici,
and C. ligulariae was obtained from Berlin (B).
Light microscopy: small portions of herbarium specimens were sectioned by hand
and mounted in lactophenol-cotton blue for examination under a Carl Zeiss Axiophot©
microscope with Carl Zeiss Axiocam© digital camera equipment. Measurements were
achieved using the Axiocam software. Urediniospore dimensions as measured by light
microscopy are reported in the following format: (min—) average +/-standard deviation
(-max) length x breadth.
Scanning electron microscopy (SEM): small portions of herbarium specimens were
removed and fastened to aluminium stubs with adhesive carbon tabs. Prior to sputter
coating specimens were examined by a Carl Zeiss Stemi©2000 dissecting microscope,
sorus sizes were measured and images taken with Carl Zeiss Axiocam© digital camera
equipment as above. Specimens were coated with Palladium for 2min resulting in a
deposition of approx 12nm and examined in a Carl Zeiss Supra©55VP SEM at 1-5kV
and 5mm working distance. Measurements were achieved using the Axiocam software
as above. Morphometric data were subjected to statistical analysis using the statistics
package R (R Development Core Team 2011).
Details of the specimens examined are displayed with each taxon. Further information
is available from the EURED specimens (2013) list.
Herbarium label images for B, PC, CP, LE and E used in this study can be viewed at
the EURED website at E (Helfer et al. 2011). This website is continuously added to and
improved.
90 ... Helfer
Results
The herbarium data searches for European taxa of Coleosporium resulted in
249 host plant relationships (TABLE 1), represented in five families. A further
seven taxa in five additional host families had been found on intercepted plants
or as single occurrences and four taxa in three families were misinterpretations.
In the past more than 50 valid names have been used for these rust taxa (EURED
names 2012).
The microscopic examinations of the specimens were inconclusive with
respect to urediniospore dimensions and sorus characters: while statistically
significant differences could be found between most samples involving various
host species there were also significant differences between collections of
the same host/fungus relationship (EURED stats 2012). Furthermore, data
ranges overlapped widely, indicating that urediniospore dimensions and sorus
characters are unsuitable for identification purposes and for the characterisation
or delimitation of taxa in this genus (EURED spores 2012). Similarly, spore
surface characters observed by SEM revealed no distinctive features. It is
therefore concluded that, morphologically, the taxa are all part of the same
species.
Taxa present in Europe
Coleosporium tussilaginis (Pers.) Lév., in Orbigny, Dict. Univ. Hist. Nat.
12: 786 (1849) f.sp. tussilaginis PLaTE 1
= Uredo tussilaginis Pers., Syn. meth. fung. 1: 218 (1801).
= Ustilago tussilaginis Losa, Anales Jard. Bot. Madrid 5: 126 (1945).
ALTERNATE HOSTS: Pinus halepensis, P. mugo, P. nigra, P. pallasiana, P. pinaster,
P. sylvestris (PLATE 1), [PB echinata, P. ponderosa, P. rigida].
Primary Hosts: Tussilago farfara, [Emilia coccinea, Erechtites glomeratus], E. hieraciifolius,
[Euryops acraeus, E. evansii, Kleinia fulgens, K. grandiflora].
EUROPEAN DISTRIBUTION: pan-European.
SPECIMENS EXAMINED:
(as C. sp.) PC0022213.
(as C. tussilaginis) E00458054, E00458055, E00458056, E00458059, E00458060,
E00458061.
UREDINIOSPORE SIZE: (21.7—)28.3+3.2(-39.6) x (15.9-)20.8+ 2.4(-26.6) um.
Notes: Artificial infections were obtained on Tropaeolum minus
(Tropaeolaceae) and Schizanthus grahamii (Solanaceae) (Gaumann 1959);
weak infections were also obtained on plants of Senecio vulgaris (Klebahn
1924), calling into question the biological separation of this taxon from f.sp.
senecionis discussed below. New specimens in many herbaria are deposited as
C. tussilaginis, irrespective of host plant identity.
Coleosporium in Europe... 91
PLATE 1 Aeciospore of Coleosporium tussilaginis on Pinus sylvestris. SEM; bar = 2 um.
Coleosporium tussilaginis f.sp. campanulae-rapunculoidis Boerema & Verh.,
Netherlands J. Pl. Pathol. 78(Suppl. 1): 7 (1972).
= Coleosporium campanulae (Pers.) Fr., Summa Vegetabilium
Scandinaviae: 512 (1849), as “campanulacearum”.
= Coleosporium campanulae-rapunculoidis Kleb., Wirtswechselnde Rostpilze: 365 (1904).
= Coleosporium campanulae-rotundifoliae Kleb., Wirtswechselnde Rostpilze: 366 (1904).
= Coleosporium campanulae-trachelii Kleb., Wirtswechselnde Rostpilze: 366 (1904).
= Coleosporium tussilaginis f.sp. campanulae-rotundifoliae Boerema
& Verh., Neth. Jl Pl. Path. 78(Suppl. 1): 7 (1972).
= Coleosporium tussilaginis f.sp. campanulae-trachelii Boerema
& Verh., Neth. Jl Pl. Path. 78(Suppl. 1): 7 (1972).
ALTERNATE HOstTs: Pinus nigra, P. sylvestris.
Primary Hosts: Adenophora liliifolia, [A. triphylla], Asyneuma giganteum, A. limonifolium,
Campanula alliariifolia, C. alpina, [C. americana], C. barbata, C. baumgartenii,
C. bononiensis, [C. californica], C. carnica, C. carpatica, C. caucasica, C. cervicaria,
C. cespitosa, C. cochleariifolia, C. drabifolia, C. erinus, C. glomerata, [C. grandis],
C. grossekii, C. hagielia, C. hawkinsiana, C. hispanica, C. incurva, C. isophylla,
C. lactiflora, C. lanata, C. latifolia, C. lusitanica, C. lyrata, C. macrorhiza subsp. gypsicola,
92 ... Helfer
C. medium, C. moesiaca, C. patula, C. pelia, C. persicifolia, C. persicifolia subsp.
subpyrenaica, C. pulla, |C. punctata], C. pyramidalis, C. rapunculoides, C. rapunculus,
C. rhomboidalis, C. romanica, C. rotundifolia, C. rumeliana, C. rupestris, C. sarmatica,
C. saxatilis, C. scheuchzeri, C. serrata, C. sibirica, C. sparsa, C. sparsa subsp. sphaerothrix,
C. spathulata, C. speciosa subsp. affinis, C. speciosa, C. stenosiphon, C. stevenii, C. tatrae,
C. tomentosa, C. trachelium, C. transsilvanica, C. versicolor, C. wanneri, Jasione montana,
Legousia hybrida, L. speculum-veneris, [Lobelia cardinalis, L. xalapensis|, Michauxia
campanuloides, M. laevigata, Petromarula pinnata, Phyteuma betonicifolium, P. nigrum,
P. orbiculare, P. scheuchzeri, P. spicatum, [Triodanis perfoliata, Wahlenbergia denticulata].
EUROPEAN DISTRIBUTION: Au, Be, Bel, Br, Bu, Cg, Cs, Ct, Da, EU, Fe, Ga, Ge, Gr, He, Ho,
Hs, Hu, Is, It, La, Lu, Mo, No, Po, Rm, Rus, Se, Sk, Su, Tu, Uk.
SPECIMENS EXAMINED:
(as C. campanulae) E00159053, E00458064, PC0022266, PC0022293, PC0022305,
PC0022308, PC0022317, PC0022324, PC0022354.
UREDINIOSPORE SIZE: (12.0—)20.5+4.8(-30.2) x (9.0-)14.9+3.2(-26.4) um.
Notes: Boerema & Verhoeven (1972) treat this in three separate formae
speciales: f.sp. campanulae-rapunculoidis, f.sp. campanulae-rotundifoliae, and
fisp. campanulae-trachelii. Gaumann (1959) lists several overlapping host
ranges and infections on unrelated angiosperms, such as Tropaeolum minus,
and I see no justification to maintain these three special forms.
Coleosporium tussilaginis f.sp. doronici S. Helfer, f.sp. nov.
MycoBank MB804294
= Coleosporium doronici Namysl., Spraw. Kom. fizyogr.
Akad. Umijetn. Krakowie 45: 125 (1911).
ALTERNATE HOSTS: Pinus sp. (presumed).
PRIMARY Hosts: Doronicum austriacum, D. columnae.
EUROPEAN DISTRIBUTION: Au, Cs, Hu, Po, Rm.
SPECIMENS EXAMINED:
(as C. doronici) B700015048, B700015049, B700015050, B700015051, B700015052,
B700015053, PC0022411, PC0022412.
UREDINIOSPORE SIZE: (10.8-)27.8+3.8(-34.1) x (7.0-)19.143.6(-24.8) um.
Notes: This appears to be a geographically as well as biologically separate
special form on Doronicum sp. (Miller 2003), since its hosts are widely
distributed over Europe (Atlas Florae Europaeae 2012). The report in Gaumann
(1959) that this rust occurs in Spain is based on a misunderstanding of the
geographical name Galicia (“Galizien”), in fact referring to a region in the Tatra
mountain border region of Poland.
Coleosporium tussilaginis f.sp. inulae S. Helfer, f.sp. nov.
MycoBank MB804295
= Uredo erigerontis Req. ex Duby, Bot. Gall. Edn 2: 893 (1830), as “erigeronis”.
= Coleosporium inulae Rabenh., Bot. Zeitung 9: 455 (1851).
= Coleosporium carpesii Sacc., Rivista Period. Lav. Regia
Accad. Sci. Lett. Arti Padova 24: 208 (1874).
Coleosporium in Europe ... 93
= Coleosporium jasoniae Gonz. Frag., Trab. Mus. Nac.
Cienc. Nat. Madrid, é Bot. 9: 23 (1916).
= Coleosporium asterisci-aquatici (Sacc.) Syd. & P. Syd., Ann. mycol. 19: 249 (1921)
ALTERNATE Hosts: Pinus halepensis, P. sylvestris.
PRIMARY HOSTS: Asteriscus aquaticus, Carpesium cernuum, Centaurea hierapolitana,
Dittrichia graveolens, D. viscosa, Inula aschersoniana, I. aspera, I. britannica, I. candida,
I. conyza, I. ensifolia, I. germanica, I. helenioides, I. helenium, I. helvetica, I. heterolepis,
I. hirta, I. methanaea, I. oxylepis, I. parnassica, [I. royleana], I. salicina, I. spiraeifolia,
Jasonia tuberosa.
EUROPEAN DISTRIBUTION: Al, Au, Bl, Bu, Cg, Co, Cs, Ct, Da, Es, Fe, Ga, Ge, Gr, He, Hs,
Hu, It, La, Lu, Mk, No, Po, Rm, Rus, Su, Tu, Uk.
SPECIMENS EXAMINED:
(as C. inulae) E00458051, E00458052, E00458053, E00458063.
(as Uredo erigeronis) PC0022413, PC0022415.
UREDINIOSPORE SIZE: (21.2—)30.3+3.3(-39.5) x (15.7-)23.4+3.1(-30.7) um.
Notes: A special form on most of the genera of tribus Inuleae Cass. of
the Compositae. Significant damage caused by this rust on elecampane (Inula
helenium) grown for medicinal use has been reported in Serbia (Pavlovic et al.
2003).
Coleosporium tussilaginis f.sp. melampyri Boerema & Verh., Netherlands
J. Pl. Pathol. 78(Suppl. 1): 8 (1972).
= Coleosporium melampyri (Rebent.) Kleb., Annls Sci. Nat., Bot., sér. 4, 4: 136 (1854).
ALTERNATE HOstTs: Pinus mugo, P. sylvestris.
PRIMARY HOosTs: Melampyrum arvense, M. nemorosum, M. polonicum Soo, M. pratense,
[Schizanthus sp.].
EUROPEAN DISTRIBUTION: Au, Bel, Br, Cs, Da, Fe, Ga, Ge, He, Ho, Hs, Hu, It, No, Po,
Rm, Rus, Sl, Su.
SPECIMENS EXAMINED:
(as C. euphrasiae) PC0022164.
(as C. melampyri) E00458065, E00458066, E00458067, E00458068.
(as C. tussilaginis) E00458050.
(as C. rhinanthacearum) PC0022434.
UREDINIOSPORE SIZE: (20.6—)25.9+2.6(-32.4) x (13.3-)18.942.2(-24.2) um.
Notes: Heavy infections of Melampyrum have been reported in Finland
(Pohjakallio & Vaartaja 1948). This rust was found to infect cultivated
Schizanthus sp. (Solanaceae) in Sweden (Hylander et al. 1953) and Norway
(Gjaerum 1974); please also see notes to f.sp. rhinanthacearum below.
Coleosporium tussilaginis f.sp. petasitis Boerema & Verh., Netherlands
J. Pl. Pathol. 78(Suppl. 1): 8 (1972).
= Coleosporium petasitidis Lév., Annls Sci. Nat., Bot., sér. 3, 8: 373 (1847).
= Coleosporium petasitis de Bary, Microscopic fungi: 213 (1865).
ALTERNATE HOstTs: Pinus mugo, P. nigra, P. sylvestris.
94 ... Helfer
PRIMARY HOsTs: Petasites albus, P. frigidus, P. frigidus var. palmatus, P. hybridus,
[P japonicus, a naturalized alien in central and northern Europe], P kablikianus,
P. paradoxus, P. radiatus, P. spurius.
European distribution: Au, Br, Bu, Cs, Da, Fe, Ga, Ge, Gr, Hb, He, Ho, It, La, No, Po,
Rm, Rus, Sk, Su.
SPECIMENS EXAMINED:
(as C. petasitis) E00458069, E00458070, E00458071.
UREDINIOSPORE SIZES: (18.4—)26+2.3(-31.6) x (14.3-)20.742.2 (-26.6) um.
Notes: Together with f.sp. senecionis, f.sp. tussilaginis, and f.sp. doronici, this
rust develops on members of the tribus Senecioneae Cass. of the Compositae.
Coleosporium tussilaginis f.sp. pulsatillae Boerema & Verh., Netherlands
J. Pl. Pathol. 78(Suppl. 1): 8 (1972).
= Uredo tremellosa var. pulsatillae F. Strauss, Ann. Wetterauischen
Ges. Gesammte Naturk. 2: 89 (1811) [“1810”].
= Coleosporium pulsatillae (F. Strauss) Fr., Summa Vegetabilium
Scandinaviae: 512 (1849), as “pulsatillarum”.
ALTERNATE Hosts: Pinus sylvestris.
PRIMARY HOSTS: Anemone alpina, A. halleri, A. montana, [A. patens], A. pratensis,
A. pulsatilla, A. slavica, Pulsatilla grandis, P. nigricans.
EUROPEAN DISTRIBUTION: Au, Cs, Da, Fe, Ga, Ge, He, Ho, Hu, It, La, No, Po, Rm, Rus,
Sk, Su, Uk.
SPECIMENS EXAMINED:
(as C. pulsatillae) E00458057, E00458062.
UREDINIOSPORE SIZE: (20.8-)28.7+4.2(-40.3) x (15.5-)19.6+2.2(-24.4) um.
Notes: This special form occurs on members of the Ranunculaceae. Despite
its morphological likeness, many authors (Braun 1981, 1982, Su et al. 2012)
consider this as a separate species. I concur with Boerema & Verhoeven (1972)
in the treatment as a special form, as no reliable distinction can be made using
morphometric methods.
Coleosporium tussilaginis f.sp. rhinanthacearum Boerema & Verh.,
Netherlands J. Pl. Pathol. 78(Suppl. 1): 8 (1972).
= Coleosporium rhinanthacearum (DC) Lév., Annls Sci. Nat., Bot., sér. 3 8: 373 (1847).
= Coleosporium flavum Bonord., Abh. Naturf. Ges. Halle: 186 (1860).
= Coleosporium euphrasiae (Schumach.) G. Winter, Rabenh.
Krypt.-Fl., Edn 2, 1(1): 246 (1881) [“1884”].
ALTERNATE HOstTs: Pinus mugo, P. sylvestris.
Primary HOSTS: Bartsia alpina, |B. lutea, B. trixago], B. viscosa, Euphrasia x reuteri,
E. arctica, E. brevipila, E. hirtella, E. liburnica, E. micrantha, E. minima, E. nemorosa,
E. parviflora, E. pectinata, E. picta subsp. kerneri, E. rostkoviana, E. rostkoviana vat.
fennica, E. salisburgensis, [E. striata], E. tricuspidata, Odontites litoralis, O. purpureus,
O. vulgaris, Orthantha lutea, Parentucellia viscosa, Pedicularis palustris, Rhinanthus
Coleosporium in Europe ... 95
aestivalis, R. alectorolophus, [R. apterus], R. glaber, R. glacialis, R. pulcher subsp. alpinus,
R. riphaeus, R. serotinus.
EUROPEAN DISTRIBUTION: Au, Be, Bel, Br, Bu, Cg, Cs, Da, Fe, Ga, Ge, Hb, He, Ho, Hs,
Hu, It, La, Lu, No, Po, Rm, Rus, Sk, Su, Uk.
SPECIMENS EXAMINED:
(as C. euphrasiae) PC0022172, PC0022176, PC0022178, PC0022200, PC0022420.
(as C. flavum) PC0022202.
(as C. rhinanthacearum) E00458082, PC0022434, PC0022459.
UREDINIOSPORE SIZE: (19.2—)22.9+2.0(-28.4) x (14.1-)17.941.7(-22) um.
Notes - Besides f.sp. melampyri this is the second forma specialis on these
more advanced members of the Orobanchaceae (Tank et al. 2006). In many
herbaria the specimens of rusts on Rhinanthus, Euphrasia, Melampyrum and
related hosts are labelled or arranged under any of the names Coleosporium
euphrasiae, C. melampyri, C. rhinanthacearum, C. tussilaginis.
Coleosporium tussilaginis f.sp. senecionis-silvatici Boerema & Verh.,
Netherlands J. Pl. Pathol. 78(Suppl. 1): 9 (1972)
= Coleosporium senecionis f.sp. senecionis-silvatici Wagner ex
Gaum., in Beitr. KryptogFlora Schweiz 12: 124. 1959.
= Coleosporium senecionis (Pers.) Fr., Summa Vegetabilium Scandinaviae: 512 (1849).
= Coleosporium cacaliae G.H. Otth, Mitt. naturf. Ges. Bern: 179 (1865).
= Coleosporium ligulariae Thiim., Bull. Soc. Imp. Nat. Moscou 52: 140 (1877).
ALTERNATE Hosts: Pinus halepensis, P. mugo, P. nigra, P. pinaster, P. pinea, P. sylvestris.
PRIMARY HOSTS: Adenostyles alliariae, A. alpina, [Delairea odorata, Farfugium japonicum
var. giganteum, Hasteola suaveolens], Jacobaea alpina, J. arnautorum, J. erucifolia subsp.
praealta, J. paludosa, [Ligularia fischeri, L. macrophylla], L. sibirica, Pallenis maritima,
Parasenecio hastatus, Pericallis cruenta, [P. hybrida, Senecio candicans], S. carpetanus,
[S. congestus], S. doria, S. doronicum, S. duriaei, |S. elegans], S. gallicus, |S. glaberrimus],
S. hercynicus, [S. inaequidens], S. incrassatus, S. jacobaea, S. leucanthemifolius,
S. leucanthemifolius subsp. vernalis, [S. leucostachys], S. lividus, S. macrophyllus,
[S. moorei], S. nemorensis, S. ovatus, [S. pulcher], S. pyrenaicus, [S. scandens, S. smithii],
S. squalidus, S. subalpinus, S. sylvaticus, [S. tristis], S. umbrosus, [S. viravira, S. viscidulus],
S. viscosus, S. vulgaris, Tephroseris palustris.
EUROPEAN DISTRIBUTION: Au, Az, Be, BI, Br, Bu, Cg, Co, Cs, Da, Fe, Ga, Ge, Gr, Hb, He,
Ho, Hs, Hu, It, La, Lu, No, Po, Rm, Rus, Sk, Su, Uk.
SPECIMENS EXAMINED:
(as C. cacaliae) PC0022228.
(as C. ligulariae) B700015041, B700015042, B700015044, B700015045, B700015046,
B700015047.
(as C. senecionis) E00458072, E00458073, E00458074, E00458075, E00458076,
E00458077.
UREDINIOSPORE SIZE: (18.6—)25.7£3.2(-37.1) x (11.8-)18.742.2(-26.4) um.
Notes: This is probably a pan-European form. Its distinctness from f.sp.
tussilaginis needs to be confirmed by detailed host range studies or molecular
investigations (see notes there).
96 ... Helfer
Coleosporium tussilaginis f.sp. sonchi Boerema & Verh., Netherlands J. Pl. Pathol.
78(Suppl. 1): 9 (1972).
= Uredo tremellosa var. sonchi F. Strauss, Ann. Wetterauischen Ges. Gesammte
Naturk 2: 90 (1811) [“1810”]; see Hylander et al. (1953).
= Coleosporium sonchi Lév., Annls Sci. Nat., Bot., sér. 4 2: 190 (1854).
= Coleosporium sonchi-arvensis (Pers.) Lév., in Orbigny, Dict. Univ. Hist. Nat. 12: 786 (1849).
ALTERNATE HOstTs: Pinus sylvestris.
PRIMARY HOSTS: Aposeris foetida, Arnoglossum atriplicifolium, Crepis palaestina,
C. tectorum, Dendroseris litoralis, Lactuca muralis, Lapsana communis, Picris cupuligera,
Sonchus arvensis, S. asperl, S. brachyotus, S. oleraceus, S. palustris, S. tenerrimus,
S. uliginosus.
EUROPEAN DISTRIBUTION: Au, Bel, BH, Br, Bu, Cg, Cs, Da, Fe, Ga, Ge, Hb, He, Ho, Hs,
It, La, Lu, No, Po, Rm, Rus, Sk, Su, Uk.
SPECIMENS EXAMINED:
(as C. sonchi) E00458078, E00458079.
(as C. sonchi-arvensis) E00458080.
UREDINIOSPORE SIZE: (15.9—)21.8+2.5(-29.6) x (9.6-)17.2+3.0(-23.9) um.
Notes: This forma specialis is restricted to the tribus Cichorieae Lam. & DC. of the
Compositae.
Coleosporium tussilaginis f.sp. telekiae S. Helfer, f.sp. nov.
MycoBank MB804296
= Coleosporium telekiae Thim., Fungi austriaci exsiccati no. 850 (1873)
ALTERNATE HOsTs: Pinus sp. (presumed)
Primary Hosts: Telekia speciosa, Xerolekia speciosissima.
EUROPEAN DISTRIBUTION: Au, Bu, Cs, [Fe,] Ge, It, [No,] Po, Rm, Sk, Uk.
SPECIMENS EXAMINED:
(as C. telekiae) B700004933, B700010610, B700010611, B700015019, B700015020,
B700015021, B700015022, B700015023, B700015024, B700015026, B700015027,
B700015030, B700015033, B700015034, B700015035, B700015037, B700015038,
B700015039, B700015040, E00458058.
UREDINIOSPORE SIZE: (15.8—)22.6+3.0(-31.8) x (10.6-)17.2+2.4(-24.1) um.
Notes: As well as in its natural range in Eastern Central Europe (Kokes
2004, Dietrich 2009), this rust was recently found on cultivated Telekia speciosa
in Western Norway (Gjaerum et al. 2008).
Discussion
The present study used the host plant taxonomy of the Plant List (2012)
database and revised the host plant spread to at least 239 taxa in 55 genera
represented in 4 angiosperm families as well as ten Pinus species as alternate
hosts (TABLE 1). The most common host family is the Compositae, represented
by 96 genera and 706 taxa worldwide and 35 genera and 110 taxa in Europe (Farr
& Rossman 2013). Kenneth & Palti (1984), who published a detailed study of
Coleosporium in Europe ... 97
the fungus-plant interactions of this family, found that globally Coleosporium
was most widely distributed on the tribe Heliantheae with 14 genera affected
followed by Senecioneae with 11 genera. Members of Heliantheae are not native
in Europe, leaving Senecioneae as the most important host tribe, as is confirmed
in this study.
To date few molecular investigations into Coleosporium have been published.
A total of 32 sequences is currently deposited in GenBank (GeneBank 2013),
mostly of the Asian/North American species C. asterum (Dietel) Syd. & P. Syd.
Maier et al. (2003) compared four accessions of Coleosporium using the nuclear
large subunit ribosomal DNA. In their neighbor joining analysis C. asterum
(synonym Stichopsora asterum Dietel) was clearly separated from C. cacaliae,
C. campanulae, and C. tussilaginis, which were not resolved.
Recent molecular studies have revealed the presence of cryptic species
among morphologically indistinguishable specimens of Melampsora Castagne
(Bennett et al. 2011, Milne et al. 2012), a rust genus of comparable host diversity,
and it is probable that similar speciation is taking place in Coleosporium.
Conclusions
The genus Coleosporium is well defined within the Uredinales. Its taxa,
however, are seriously confused. While host specificity appears to restrict
the host range in some taxa, it does not seem to do so in others. Molecular
taxonomic investigation of Coleosporium taxa is only in its infancy, and new
initiatives are urgently needed to deal with the relationships in this genus.
Acknowlegements
The author acknowledges the support of the herbaria in B, CP, LE, PC, Z+ZT, BERN
for access to specimens. The study was financially supported by SYNTHESYS (for visits
to B [DE-TAF-924] and PC [FR-TAF-5178]) as well as a travel grant from the British
Society for Plant Pathology to visit CP. Thanks are also expressed to Dr Reinhard Berndt
and Prof. Salvatore Moricca for helpful comments during the peer review process and
to the Nomenclature Editor.
Literature cited
Anikster Y. 1984. The formae speciales. 115-130, in: WR Bushnell & AP Roelfs (eds). The Cereal
Rusts. London, Academic Press.
Arthur JC. 1918. Uredinales of the Andes, based on collections by Dr. and Mrs. Rose. Botanical
Gazette 65(5): 460-474.
Atlas Florae Europaeae. 2012. http://www.luomus.fi/english/botany/afe/map/areas.htm (accessed
April 2012).
Bahcecioglu Z, Kabaktepe S. 2012. Checklist of rust fungi in Turkey.
http://www.mycotaxon.com//resources/checklists/Bahcecioglu-v119-checklist.pdf
Bennett C, Aime MC, Newcombe G. 2011. Molecular and pathogenic variation within Melampsora
on Salix in western North America reveals numerous cryptic species. Mycologia 103:
1004-1018. http://dx.doi.org/10.3852/10-289
98 ... Helfer
Boerema GH, Verhoeven AA. 1972. Check-list for scientific names of common parasitic fungi.
Series la: Fungi on trees and shrubs. Netherlands J. Pl. Pathol. 78(Supplement 1).
Brandenburger W. 1994. Die Verbreitung der in den westlichen Landern der Bundesrepublik
Deutchland beobachteten Rostpilze (Uredinales): Eine Bestandsaufnahme nach
Literaturangaben. Regensburg. Mykol. Schriften 3: 1-381.
Braun U. 1981. Vorarbeiten zu einer Rostpilzflora der DDR. Feddes Repert. 92: 95-123.
http://dx.doi.org/10.1002/fedr.19810920105
Braun U. 1982. Die Rostpilze (Uredinales) der Deutschen Demokratischen Republik. Feddes
Repert. 93: 213-331. http://dx.doi.org/10.1002/fedr.19820930303
Dietrich W. 2009. Zweiter Beitrag zur Kenntnis phytoparasitarer Kleinpilze in Sachsen. Boletus
31: 96-107.
Encyclopedia of Life. 2012. http://eol.org/search (accessed April 2012).
Eriksson H. 1894. Ueber die Spezialisierung des Parasitismus bei den Getreiderostpilzen. Ber.
Deutsch. Bot. Ges. 12: 292-331.
EURED names. 2012. http://www.rbge.org.uk/assets/files/science/EURED/CO01.pdf (accessed
April 2012).
EURED specimens. 2013. http://www.rbge.org.uk/assets/files/science/EURED/C04.pdf (accessed
April 2013).
EURED spores. 2012. http://www.rbge.org.uk/assets/files/science/EURED/C06.pdf (accessed
April 2012).
EURED stats. 2012. http://www.rbge.org.uk/assets/files/science/EURED/C05.pdf (accessed April
2012).
Farr DF, Rossman AY. 2013. Fungal databases, Systematic Mycology and Microbiology Laboratory,
ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases (accessed April 2012).
Gaumann E. 1959. Die Rostpilze Mitteleuropas. Bern, Biichler & Co.
GBIF 2013. Global Biodiversity Information Facility. http://data.gbif.org (accessed April 2013).
GeneBank. 2013. http://www.ncbi.nlm.nih.gov/genbank/ (accessed April 2013).
Gjaerum H. 1974. Nordens Rustsopper. Oslo, Fungiflora.
Gjaerum HB, Semb L, Talgo V. 2008. Coleosporium telekiae, a new member of the Norwegian rust
flora. Pl. Health Progr. October PHP-2008-1006-01-BR.
Helfer S, Berndt R, Denchev CM, Moricca S, Scheuer C, Scholler M, St. Quinton JM. 2011. A call
for a renewed and pan-European strategic effort on the taxonomy of rust fungi (Uredinales).
Mycologia Balcanica 8: 78-80.
Hennen JF, Figueiredo MB, Alves RCR, de Carvalho Jr AA, Hennen PG. 2005. Catalogue of the
species of plant rust fungi (Uredinales) of Brazil. Instituto de Pesquisas, Jardim Botanico do Rio
de Janeiro: Rio de Janeiro, Brazil.
Hylander N, Jorstad I, Nannfeldt JA. 1953. Enumeratio uredinearum Scandinavicarum. Opera Bot.
1: 1-102.
Index Fungorum. 2012. http://www.indexfungorum.org/ (accessed April 2012).
Kenneth R, Palti J. 1984. The distribution of downy and powdery mildews and of rusts over tribes
of Compositae (Asteraceae). Mycologia 76: 705-718.
Kirk PM, Cannon PF, Minter DW, Stalpers JA (eds). 2008. Dictionary of the Fungi. Wallingford,
CAB International.
Klebahn H.1904. Die wirtswechselnden Rostpilze. Berlin, Borntrager.
Klebahn H.1924. Kulturversuche mit Rostpilzen 17. Z. Pflanzenkrankh. Gallenk. 34: 289-303.
Kniskern JM, Rausher MD. 2006. Environmental variation mediates the deleterious effects of
Coleosporium ipomoeae on Ipomoea purpurea. Ecology 87: 675-685.
http://dx.doi.org/10.1890/05-1327
Coleosporium in Europe ... 99
Kohlschiitter C. 2012. Fuzzy Gazetteer. http://isodp.hof-university.de/fuzzyg/query (accessed April
2012).
Koke& P. 2004. Prispévek k rozsifeni fytopatogennich plisni (Peronosporales), rzi (Uredinales) a snéti
(Ustilaginales) na Slovensku. 1.Mykologické Listy 90/91: 24-27.
Krypto-S. 2012. —_http://www.nrm.se/english/researchandcollections/collections.179_en.html
(accessed April 2012).
Laundon GE. 1975. Taxonomy and nomenclature notes on Uredinales. Mycotaxon 3: 133-161.
Léveillé JH. 1847. Sur la disposition méthodique des Urédinées. Ann. Sci. Nat. Bot. sér. 3, 8:
369-376.
Maier W, Begerow D, Weifs M, Oberwinkler F. 2003. Phylogeny of the rust fungi: an approach
using nuclear large subunit ribosomal DNA sequences. Canad. J. Bot. 81: 12-23.
http://dx.doi.org/10.1139/b02-113
Majewski T, Ruszkiewicz-Michalska M. 2008. Uredinales. 263-297, in: W Mulenko et al. (eds). A
preliminary checklist of micromycetes in Poland. Krakow, W. Szafer Institute of Botany.
McKenzie EHC. 1998. Rust fungi of New Zealand—an introduction, and list of recorded species.
New Zealand Journal of Botany, 36: 233-271.
McNeill J, Barrie FR, Buck WR, Demoulin V, Greuter W, Hawksworth DL, Herendeen PS, Knapp
S, Marhold K, Prado J, Prud’ homme van Reine WF, Smith GF, Wiersema JH, Turland NJ. 2012.
International Code of Nomenclature for algae, fungi, and plants (Melbourne Code). Koeltz
Scientific Books.
Milne JM, Helfer S, Kirk C, Hollingsworth PM, Ennos RA. 2012. Molecular evidence indicates that
sub-arctic willow communities in Scotland support a diversity of host-associated Melampsora
rust taxa. Fungal Biology 116: 603-612. http://dx.doi.org/10.1016/j.funbio.2012.02.008
Minkevicius A, Ignataviciuteé M. 1991. Lietuvos grybai 5. Rudie¢iai 1. Vilnius, Lietuvos MA
Botanikos institutas, Vilniaus universitetas.
Miller J. 2003. Rost-, Brand- und Falsche Mehltaupilze neu fiir Mahren und tschechisch Schlesien.
Czech Mycol. 55(3/4): 277-290.
NHL. 2012. http://www.nhn.leidenuniv.nl/index.php/databases/ (accessed April 2012).
Pavlovic S, Stojanovic S, Rajkovic S. 2003. Coleosporium inulae (Kunze) Rab. - prouzrokovac rdje
omana (Inula helenium L.). Lekov. Sirovine Zborn. Rad. 23: 89-93.
Plant List. 2012. Version 1. http://www.theplantlist.org/ (accessed April 2012).
Pohjakallio O, Vaartaja O. 1948. Uber Vorkommen und Sporenbildung von Coleosporium melampyri
Kleb. auf verschiedenen Standorten und Wirtspflanzen. Acta Forest. Fenn. 55: 1-15.
R Development Core Team. 2011. R: A language and environment for statistical computing. R
Foundation for Statistical Computing, Vienna. http://www.R-project.org (accessed November
2011).
Su D, Fu JE, Zhou RJ, Yan XR. 2012. Severe outbreak of rust caused by Coleosporium pulsatillae
detected on Pulsatilla spp. in China. Pl. Dis. 96: 768.
http://dx.doi.org/10.1094/PDIS-12-11-1078-PDN
Sydow P, Sydow H. 1915. Monographia Uredinearum. Vol. 3. Leipzig, Borntraeger.
Tank DC, Beardsley PM, Kelchner SA, Olmstead RG. 2006. Review of the systematics
of Scrophulariaceae s.l. and their current disposition. Austral. Sys. Bot. 19: 289-307.
http://dx.doi.org/10.1071/SB05009
Termorshuizen AJ, Swertz CA. 2011. Roesten van Nederland - Dutch rust fungi. Termorshuizen.
Wilson M, Henderson DM. 1966. British rust fungi. Cambridge, University Press.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.101
Volume 124, pp. 101-109 April-June 2013
Septoglomus titan, a new fungus in the Glomeraceae
(Glomeromycetes) from Bahia, Brazil
BRUNO ToMIO GOTO!" »,ADRIANE FREIRE ARAUJO?, ANA CRISTINA FERMINO SOARES’,
ARAESKA CARENNA DE ALMEIDA FERREIRA’, LEONOR Costa Malta},
CARLA DA SILVA SOUSA? & GLADSTONE ALVES DA SILVA;
‘Departamento de Botanica, Ecologia e Zoologia, CB, Universidade Federal do
Rio Grande do Norte, Campus Universitario, 59072-970, Natal, RN, Brazil
*Nucleo de estudo em Microbiologia Aplicada, CCA, Universidade Federal do Recéncavo da Bahia,
Centro, S/N, CEP 44380-000, Cruz das Almas, BA, Brazil
*Departamento de Micologia, CCB, Universidade Federal de Pernambuco,
Av. Prof. Nelson Chaves, S/N, CEP 50670-420, Cidade Universitaria, Recife, PE, Brazil
“CORRESPONDENCE TO: [email protected] & [email protected]. br
ABSTRACT — A new fungus of the Glomeraceae found in the rhizosphere of Agave sisalana
is described under the epithet Septoglomus titan. It forms large glomerospores, (243-)265 x
325(-400) um in diameter. They generally are subglobose and have three spore wall layers:
a semi-persistent short lived sub-hyaline to yellow-brown outer layer (0.5-1.4 um thick), an
adherent smooth light-yellow to orange-brown middle layer (2.5-5.1 um), and a laminate
smooth thick orange brown to dark red brown innermost layer (12.8-19.2 um). Spore size
and colors of the spore wall layers separate this species from other yellow-brown to dark-
brown species.
Key worps — Glomerales, Agavaceae, Glomus group A, crop system, rDNA
Introduction
Approximately 230 species of arbuscular mycorrhizal fungi (AMF;
Glomeromycota) have been described, of which 118 exhibit glomoid spore
development (sensu lato; Oehl et al. 2011a, Estrada et al. 2011). Historically,
identification of the glomoid species was considered extremely difficult because
of the limited morphological characters (Morton 1988), and the molecular
approach has been used to solve the hypothetical separation into different
genera, families, and orders (Walker & Schiifler 2004, 2007, Schiifler & Walker
2010). For this reason recent taxa from different glomeromycotan groups have
been poorly described morphologically (Walker & SchiiBler 2004, Schiifler &
Walker 2010), including groups with diversified morphological data sets such
as Acaulospora, Kuklospora, and Ambispora (Kaonongbua et al. 2010, Kriiger et
102 ... Goto & al.
al. 2011, SchiiBler & Walker 2010). Recently Oehl et al. (2011a,b,c) combined
significant morphological characters with concomitant molecular data to
reorganize the Glomeromycota, especially the groups with glomoid spore
development. This newly available morphological data set is being successfully
used to identify distinct groups with glomoid spores (Estrada et al. 2011,
Furrazola et al. 2011, Goto et al. 2012).
Glomoid species are very commonly found in Brazilian agrosystems (Silva
et al. 2007, Goto et al. 2010, Maia et al. 2010, Nobre et al. 2010) with reports
of many undescribed species (Carrenho et al. 2010) but with new descriptions
rarely available. Studies on AMF diversity in Agave sisalana (common name:
sisal) crop systems in Bahia State, Brazil, have revealed an undescribed species
forming large spores with glomoid development, which we describe here as
Septoglomus titan.
Material & methods
Study areas, soils sampling and soil parameters
Study areas were in the municipalities of Sao Domingos located at 12°48'S 41°37'W,
and Ourolandia located at 10°58'S 41°05'W, both in the semi-arid region of Bahia State,
in the Northeast Brazil. This semi-arid region is characterized by tropical dry climate
(type Am of K6ppen-Geiger; Kottek et al. 2006), with mean annual temperature of 30°C
and precipitation of 400-600 mm. The vegetation was agriculturally managed sisal, a
perennial culture of 40-year-old systems, in a Caatinga biome characterized by low tree
stratum without a continuous canopy, trees and shrubs with thin stems and small or
composite leaves, deciduous in the dry season (Queiroz 2006). The predominant local
geology is characterized by a granite-greenstone formed by the Santa Luz complex,
Archaean basement, and comprises an assemblage of migmatitic gneisses with
subordinate granitoids. The fungus was found in soil samples collected around Agave
sisalana roots in farms of both municipalities. Soil characteristics in Ourolandia were:
pH (CaCl) = 6.4, organic matter = 13 g dm’, available P = 18 mg dm’ and in Sao Domingos
were: pH (CaCL,) = 6.3, organic matter = 32 g dm’, and available P = 58 mg dm’.
AMF bait cultures
The native AMF communities were cultured for two cycles (5 months each) with
Sorghum bicolor, Brachiaria decumbens, and Panicum miliaceum in 500 mL pots
filled with autoclaved sand substrate (250 g per pot) mixed with the natural field soil
as AMF inoculum (250 g per pot), at the greenhouse of the Center for Agricultural,
Environmental and Biological Research, Universidade Federal do Recéncavo da Bahia,
Cruz das Almas, Brazil. Additionally, multiple glomerospores from the new species were
separated and used as infective propagules in single species cultures on S. bicolor. The
new fungus could successfully be propagated in bait cultures together with Acaulospora
scrobiculata, Ambispora appendicula, Claroideoglomus etunicatum, Entrophospora
infrequens, Funneliformis mosseae, Glomus intraradices, G. sinuosum, Paraglomus
brasilianum, and P. occultum. However, no single species cultures were obtained from
the fungus. Glomerospores isolated exclusively from the trap cultures were used for
morphological and molecular analyses.
Septoglomus titan sp. nov. (Brazil) ... 103
Morphological analyses
Spores of the new species were extracted as described in Sieverding (1991). Trap
cultures were established according to Goto et al. (2012) modified by using Hoagland’s
solution without phosphorus. The spores were thereafter mounted in polyvinyl alcohol-
lacto-glycerin (PVLG), in PVLG + Melzer’s reagent, and in water (Brundrett et al. 1994,
Spain 1990). The terminology used is based on recent papers (Furrazola et al. 2011,
Goto & Maia 2006, Goto et al. 2012, Estrada et al. 2011)
Molecular analyses
DNA EXTRACTION: DNA was extracted from three single spores of the new species.
Individual spores on a slide with a drop (5-10 ul) of ultrapure water were crushed with
a needle. The resulting material was used directly in the PCR reactions.
AMPLIFICATION AND SEQUENCING: DNA extract was used as template for a semi-
nested PCR using the primers ITS3 (White et al. 1990) - 28G2 (Silva et al. 2006) and
LR1 (van Tuinen et al. 1998) - 28G2 consecutively. PCR reactions were carried out in a
volume of 50 ul, containing 75 mM Tris-HCl pH 8.8, 200 mM (NH,),SO,, 0.01% Tween
20, 2 mM MgCl, 200 uM each dNTPs, 1 uM of each primer, and 2 units of Taq" DNA
polymerase (Fermentas); cycling parameters were 5 min at 95°C (1 cycle), 45 s at 94°C, 1
min at 55°C, 1 min at 72°C (40 cycles), and a final elongation of 7 min at 72°C following
the last cycle. The amplified products were purified with a PureLink PCR Purification
Kit (Invitrogen), following the manufacturer’s instruction and sequenced. Sequencing
was provided by the Human Genome Research Center (Sao Paulo, Brazil).
SEQUENCE ALIGNMENT: Querying the National Center for Biotechnology Information
databases with the BLASTn program, we verified that the sequences obtained from S.
titan were affiliated with the Glomerales (Glomeromycota) before phylogenetic analysis.
The AM fungal sequences (partial LSU rRNA) obtained in our laboratory were aligned
with other glomeromycotean sequences from the GenBank using the program ClustalX
(Larkin et al. 2007) and edited with the BioEdit program (Hall 1999) to obtain a final
alignment. The sequences were deposited at GenBank under the accession numbers
JQ312667-312669.
PHYLOGENETIC ANALYSES: Maximum parsimony (MP) analysis with 1000 bootstrap
replications was performed using the Phylogenetic Analysis Using Parsimony (PAUP)
program version 4 (Swofford 2003). Bayesian (two runs over 1 x 10° generations with a
burnin value of 2500) and maximum likelihood (1000 bootstrap) analyses were executed,
respectively, in MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003) and PhyML (Guindon &
Gascuel 2003), launched from Topali 2.5. The model of nucleotide substitution (GTR +
G) was estimated using Topali 2.5 (Milne et al. 2004). Sequences from Claroideoglomus
claroideum and C. etunicatum were used as outgroup.
Results
Molecular analyses
Phylogenetic analyses of LSU rRNA gene sequences (Fic. 1) revealed that
the new fungus is a Septoglomus species (former Glomus group Aa3 sensu Oehl
et al. 2011a).
104 ... Goto & al.
Claroideoglomus etunicatum AJ623310
C. claroideum AJ271929
100
100
1.00
0.1
Glomus sinuosum FJ461846
G. intraradices AF396797
G. intraradices AY842577
G. proliferum FM992402
G. proliferum FM992398
G. manihotis AM158947
G. clarum AJ510243
G. clarum AJ510242
Septoglomus deserticola AJ746249
55
53
0.73 72 S. constrictum FJ461827
84
70 1.00
83 S. xanthium AJ849467
D.99)
S. titan JQ312667
100
100
1.00) S. titan JQ312669
3 S. titan JQ312668
1.00
Funneliformis coronatus AF 145739
F. mosseae AY639273
100 F. mosseae AF 145735
100
1.00
F. fragilistratus AF 145747
F. caledonius AJ628059
F. caledonius AJ510239
F. coronatus AF 145740
F, geosporus AF 145742
F. geosporus AF 145743
Fic. 1. Phylogenetic tree of the Glomeraceae based on LSU rDNA analysis and rooted by
Claroideoglomus claroideum and C. etunicatum. Sequences are labeled with database accession
numbers. Support values are from maximum parsimony (MP), maximum likelihood (ML) and
bayesian analyses, respectively. Septoglomus titan sequences are in bold. Only topologies with
250% bootstrap values are shown. (Consistency Index = 0.62; Retention Index = 0.79).
Septoglomus titan sp. nov. (Brazil) ... 105
Fics 2-10. Septoglomus titan. 2. Spore formed on subtending hypha (sh) with three spore wall layers
(SWL1, SWL2, SWL3) continuous with subtending hyphal wall layers. 3-6. Spore wall with three
layers in young and mature spore (SWL1, SWL2 and SWL3). [3, 4. Young spores with inner layer
(SWL3) less pigmented than outer layers (SWL1 and SWL2). 5, 6. Mature spores with inner layer
(SWL3) more pigmented than outer layers (SWL1 and SWL2)] 7, 8. Subtending hyphae slightly
funnel-shaped to slightly constricted and all three spore wall layers continuous with subtending
hyphal wall (SW). 9, 10. Detail of septum formed by sublaminae of laminated inner layer (SWL3)
typical of Septoglomus.
Taxonomic analyses
Septoglomus titan B.T. Goto & G.A. Silva, sp. nov. Fics 2-10
MycoBank MB 564321
Differs from Septoglomus africanum, S. deserticola, and S. xanthium by its larger spores
with 3-layered walls; and from S. constrictum by its thicker 3-layered spore walls.
TyPE: BRAZIL: Bahia, near Ourolandia, in soil cultivated with Agave sisalana, 20.Apr.2011,
B.T. Goto, permanent PVLG slides (Holotype, URM83528; GenBank JQ312667,
JQ312668, JQ312669. Isotypes, URM83529; URM83530; Z+ZT Myc 15119).
ETyMoLoey: titan = in reference to the large spores formed by the new species.
GLOMEROSPORES are yellow brown to orange brown when young to dark red
brown at maturity, formed terminally on hyphae, and globose to sub-globose
(243-)265-375(-400) um or (rarely) oblong to irregular, (225-)245-285 x
308-325(-400) um.
106 ... Goto & al.
SPORE WALL is (15.3—)17.9-23.0(-—25.6) um thick in total, comprising three
smooth layers (SWL1-3). SWL1 is sub-hyaline to light yellow, thin (0.5-1.4 um)
observed in young and mature spores or in the subtending hyphal wall. SWL2
is pigmented, yellow brown to orange brown, unit (2.5-5.1 um); darker than
SWL3 in young spores, SWL2 acquires pigmentation during maturation. The
SWLS3 is dark yellow to yellow brown in young spores becoming orange brown
to dark red brown in mature spores, laminated,12.8-19.2 um thick. Spore wall
layers are continuous with the subtending hyphal wall layers, and the SWL2
and SWL3 pigments continue into the subtending hyphal wall. The three layers
do not stain when exposed to Melzer’s reagent.
SUBTENDING HYPHA (sh) generally present, single, straight, cylindrical to
constricted, light yellow to orange brown, 17.9-33.2 um wide (mean = 25.4 um)
at the spore base. The subtending hyphal wall is 7.6-8.9(-10.2) um thick (mean
8.2 um) near the spore base, tapering to approximately 2.5-5.2 um about 100 um
distant from the spore base; occlusion formed by bridging septum arising from
sublaminae of SWL3, although the pore at the subtending hypha sometimes
appears partly open.
GERMINATION by regrowth of the subtending hypha.
GLOMEROSPORE DEVELOPMENT deduced from spores found in different
developmental stages. The sub-hyaline hyphal wall layer differentiates into
sub-hyaline to yellow, evanescent (SWL1) and unified (SWL2) spore wall
layers after which the laminate layer 3 differentiates with increasing number of
developing sublaminae and becomes pigmented. Finally, the pore is not closed
by introverted thickening of SWL3 but by a bridging septum arising from the
laminate wall layer at the spore base.
ARBUSCULAR MYCORRHIZA FORMATION associated with roots of Sorghum
bicolor (L.) Moench.
DISTRIBUTION — Currently known only from agricultural soils mainly
cultivated with Agave sisalana Perrine (Agavaceae) in Ourolandia and Sao
Domingos, Bahia State (Brazil).
ADDITIONAL COLLECTIONS EXAMINED: BRAZIL: Banta, near SAo Domingos, in soil
cultivated with Agave sisalana, UFRN1895 UFRN1896 UFRN1897.
Discussion
Sequence analyses of the partial LSU rRNA region confirm with high support
that the new species represents a Septoglomus that differs from the four other
described Septoglomus species (Fic. 1). The morphology of the subtending
hyphal structure (Fics 3-8) also supports the new species in Septoglomus as
circumscribed by Oehl et al (201 1a).
Septoglomus africanum (Btaszk. & Kovacs) Sieverd. et al. S. deserticola
(Trappe et al.) G.A. Silva et al., and S. xanthium (Blaszk. et al.) G.A. Silva et al.
Septoglomus titan sp. nov. (Brazil) ... 107
differ from S. titan by their smaller spores with 2-layered walls [S. africanum
(60-)87(—125) um (Blaszkowski et al. 2010); S. deserticola 47-54(-115) x
38-52(-102) um (Trappe et al. 1984); and S. xanthium 20-55 x 45-100 um
(Blaszkowski et al. 2004)]. Although Septoglomus constrictum (Trappe) Sieverd.
et al. also has large (150-330 um) spores, it differs from S. titan by its thinner,
2-layered spore walls with a total thickness of 7-15 um (Trappe 1977, Oehl et
al. 201:1a).
Septoglomus titan is easily distinguished from all other glomoid non-
Septoglomus species by spore wall structure. A few dark species such as Glomus
tenebrosum (‘Thaxt.) S.M. Berch and Funneliformis geosporus (T.H. Nicolson
& Gerd.) C. Walker & A. Schiiéler resemble S. titan. Glomus tenebrosum has
spores with only two spore wall layers (Thaxter 1922, Trappe 1977, Walker
1982). Funneliformis geosporus has spores with three wall layers, but the inner
layer is flexible and thin (<1.0 um), whereas in S. titan the SWL3 is laminated
and thick.
Goto et al. (2012) noted that the spore wall of G. trufemii B.T. Goto et al. was
one of the thickest (7.4-15.5 um) among the glomoid-spored glomeromycotan
species, but S. titan has even thicker spore walls.
Acknowledgements
The authors acknowledge Dr. Janusz Blaszkowski (Department of Plant Protection,
West Pomeranian University of Technology, Szczecin, Poland) and Dr. Fritz Oehl
(Agroscope Reckenholz-Tanikon ART, Zurich, Switzerland) for reviewing the
manuscript and making helpful comments and suggestions and appreciate the
corrections by Dr. Shaun Pennycook (Nomenclature Editor) and suggestions by Dr.
Lorelei Norvell (Editor-in-Chief). This work was supported by: Conselho Nacional
de Desenvolvimento Cientifico e Tecnolégico (CNPq) through Protax (Programa de
Capacitacao em Taxonomia); PPBio (Programa de Biodiversidade do Semiarido) and
INCT-HV (Herbario Virtual da Flora e dos Fungos); FACEPE (Fundacao de Amparo a
Ciéncia e Tecnologia do Estado de Pernambuco); UFRN (Programa de Pés-Graduacgao
em Sistematica e Evolugao); UFPE (Programa de Pés-Graduacao em Biologia de Fungos)
and CAPES-PNPD (Coordenacao de Aperfeigcoamento de Pessoal de Nivel Superior
- Programa Nacional de Pés-Doutorado). The Graduate Program in Microbiologia
Agricola da Universidade Federal do Recéncavo da Bahia is acknowledged for providing
technical support.
Literature cited
Blaszkowski J, Blanke V, Renker C, Buscot F 2004. Glomus aurantium and G. xanthium, new species
in Glomeromycota. Mycotaxon 90: 447-467.
Btaszkowski J, Kovacs GM, Balazs T, Orlowska E, Sadravi M, Wubet T, Buscot FE. 2010. Glomus
africanum and G. iranicum, two new species of arbuscular mycorrhizal fungi (Glomeromycota).
Mycologia 102: 1450-1462. http://dx.doi.org/10.3852/09-302
Brundrett M, Melville L, Peterson L. 1994. Practical methods in mycorrhizal research. University of
Guelph, Mycologue Publications, Guelph, Ontario.
108 ... Goto & al.
Carrenho R, da Costa SMG, Balota EL, Colozzi Filho A. 2010. Fungos micorrizicos arbusculares em
agrossitemas brasileiros. 215-250, in: JO Siqueira et al. (Org.). Micorrizas: 30 anos de pesquisas
mo Brasil. Vol. 1. Lavras: Editora UFLA.
Estrada B, Palenzuela J, Barea JM, Ruiz-Lozano JM, Silva GA, Oelh F. 2011. Diversispora clara
(Glomeromycetes)— a new species from saline dunes in the Natural Park Cabo de Gata (Spain).
Mycotaxon 118: 73-81. http://dx.doi.org/10.5248/118.73
Furrazola E, Torres-Arias Y, Ferrer RL, Herrera RA, Berbara RLL, Goto BT. 2011. Glomus crenatum,
a new ornamented species in the Glomeromycetes from Cuba. Mycotaxon 116: 143-149.
http://dx.doi.org/10.5248/116.143
Goto BT, Maia LC. 2006. Glomerospores, a new denomination for the spores of Glomeromycota, a
group molecularly distinct from Zygomycota. Mycotaxon 96: 129-132.
Goto BT, Silva GA, Yano-Melo AM, Maia LC. 2010. Checklist of the arbuscular mycorrhizal fungi
(Glomeromycota) in the Brazilian semiarid. Mycotaxon 113: 251-254.
http://dx.doi.org/10.5248/113.251
Goto BT, Jardim JG, Silva GA, Furrazola E, Torres-Arias Y, Oehl F. 2012. Glomus trufemii, a new
sporocarpic species from Brazilian sand dunes. Mycotaxon 120: 1-9.
http://dx.doi.org/10.5248/120.1
Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies
by maximum likelihood. System. Biol. 52(5): 696-704.
http://dx.doi.org/10.1080/10635150390235520
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NTT. Nucl. Acids Symp. Ser. 41: 95-98.
Kaonongbua W, Morton JB, Bever JD. 2010. Taxonomic revision transferring species in Kuklospora
to Acaulospora (Glomeromycota) and a description of Acaulospora colliculosa sp. nov. from field
collected spores. Mycologia 102(6): 1497-1509. http://dx.doi.org/10.3852/10-011
Kriger M, Schiiéler A, Walker C. 2011. Acaulospora brasiliensis comb. nov. and
Acaulospora alpina (Glomeromycota) from upland Scotland: morphology, molecular
phylogeny and DNA-based detection in roots. Mycorrhiza 21(6): 577-587.
http://dx.doi.org/10.1007/s00572-011-0361-7
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,
Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and
Clustal X version 2.0. Bioinformatics 23: 2947-2948.
http://dx.doi.org/10.1093/bioinformatics/btm404
Maia LC, Silva GA, Yano-Melo AM, Goto BT. 2010. Fungos micorrizicos arbusculares no bioma
Caatinga. In: Siqueira JO; de Souza FA; Cardoso EJBN; Tsai SM. (Org.). Micorrizas: 30 anos de
pesquisas no Brasil. 1 ed. Lavras: Editora da Universidade Federal de Lavras, p. 311-339.
Milne I, Wright F, Rowe G, Marshal DF, Husmeier D, McGuire G. 2004. TOPALi: Software for
automatic identification of recombinant sequences within DNA Multiple Alignments.
Bioinformatics 20: 1806-1807. http://dx.doi.org/10.1093/bioinformatics/bth155
Morton JB. 1988. Taxonomy of VA mycorrhizal fungi: Classification, nomenclature, and
identification. Mycotaxon 32: 267-324.
Nobre CP, Junior ASLF, Goto BT, Berbara RLL, Nogueira MDC. 2010. Fungos micorrizicos
arbusculares em sistema de aléias no estado do Maranhao, Brasil. Acta Amazonica 40:
641-646.
Oehl F, Silva GA, Goto BT, Sieverding E. 2011a. Glomeromycota: three new genera and glomoid
species reorganized. Mycotaxon 116: 75-120. http://dx.doi.org/10.5248/116.75
Oehl F, Silva GA, Goto BT, Maia LC, Sieverding E. 2011b. Glomeromycota: two new classes and a
new order. Mycotaxon 116: 365-379. http://dx.doi.org/10.5248/116.365
Septoglomus titan sp. nov. (Brazil) ... 109
Oehl F, Sieverding E, Palenzuela J, Ineichen K, Silva GA. 2011c. Advances in Glomeromycota
taxonomy and classification. IMA Fungus 2(2): 191-199.
http://dx.doi.org/10.5598/imafungus.2011.02.02.10
Queiroz LP. 2006. Flowering plants of the Brazilian semi-arid. 45-50, in: LP Queiroz et al. (eds).
Towards Greater Knowledge of the Brazilian Semi-arid Biodiversity. Ministério de Ciéncia
Tecnologia e Inovacao, Brasilia.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19(12): 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Sieverding E. 1991. Vesicular-arbuscular mycorrhiza management in tropical agrosystems.
Deutsche Gesellschaft fiir Technische Zusammenarbeit (GTZ) GmbH, Eschborn, Germany.
Silva GA da, Lumini E, Maia LC, Bonfante P, Bianciotto V. 2006. Phylogenetic analysis of
Glomeromycota by partial LSU rDNA sequences. Mycorrhiza 16: 183-189.
http://dx.doi.org/10.1007/s00572-005-0030-9
Silva LX da, Figueiredo MVB, Silva GA, Goto BT, Oliveira JP, Burity HA. 2007. Fungos Micorrizicos
Arbusculares em Areas de Plantio de Leucena e Sabid no Estado de Pernambuco. Revista
Arvore 31: 427-435.
Schiifler A, Walker C. 2010. The Glomeromycota. A species list with new families and new genera.
Gloucester, UK. 56 p.
Spain JL. 1990. Arguments for diagnoses based on unaltered wall structure. Mycotaxon 38: 71-76.
Swofford DL. 2003. PAUP”. Phylogenetic Analysis Using Parsimony (* and other methods), Version
4, Sinauer Associates, Sunderland, Massachusetts.
Thaxter R. 1922. A revision of Endogonaceae. Proceedings of the American Academy of Art and
sciences:571:291'=351,
Trappe JM. 1977. Three new Endogonaceae: Glomus constrictus, Sclerocystis clavispora, and
Acaulospora scrobiculata. Mycotaxon 6: 359-366.
Trappe JM, Bloss HE, Menge JA. 1984. Glomus deserticola sp. nov. Mycotaxon 20: 123-127.
van Tuinen D, Zhao B, Gianinazzi-Pearson V. 1998. PCR in studies of AM fungi: from primers
to application. 387-399, in: AK Varma (ed.) Mycorrhizal manual. Springer, Berlin Heidelberg
New York.
Walker C. 1982. Species in the Endogonaceae: A new species (Glomus occultum) and a new
combination (Glomus geosporum). Mycotaxon 15: 49-61.
Walker C, Schiifler A. 2004. Nomenclatural clarifications and new taxa in Glomeromycota. Mycol.
Res. 108: 981-982. http://dx.doi.org/10.1017/S0953756204231173
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. Academic Press, San Diego, California.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.111
Volume 124, pp. 111-115 April-June 2013
Geoglossaceous fungi in Slovakia 5.
Geoglossum uliginosum: taxonomy and nomenclature
VIKTOR KUCGERA’ , JOHAN NITARE’, PAVEL LIZON! & JAN GAISLER?
‘Institute of Botany, Slovak Academy of Sciences,
Dubravskad cesta 9, SK-845 23, Bratislava, Slovakia
*Skogsstyrelsen, SE-551 83 Jonkdping, Sweden
>Crop Research Institute Prague, Grassland Research Station,
Rolnickd 6, CZ-460 01, Liberec, Czech Republic
*CORRESPONDENCE TO: [email protected]
ABSTRACT — Geoglossum uliginosum is a new record for Slovakia and second record for
Central Europe. Geoglossum glabrum var. uliginosum is a forgotten and disused name
representing a different fungus with unknown circumscription. Recent collections of
G. uliginosum from Slovakia are described and compared with the Swedish holotype and the
Czech collections, and the nomenclature and distribution of the species are discussed.
Key worps — Geoglossaceae, Scandinavia, conservation
Introduction
During field research of geoglossaceous fungi in non-forested stands in
Slovakia, an interesting species of Geoglossum was collected and identified as
Geoglossum uliginosum. Although collections from the Czech Republic have
already been published (Kucera & Gaisler 2012), the Slovak specimens were
collected and identified first. Geoglossum species are rare in Slovakia, and only
a few taxa had been reported before 2000 when we started our research (Kucera
et al. 2008, 2010, 2012; Kucera 2012). Geoglossaceous fungi, which have been
used in studies evaluating European grasslands (Rald 1985; Nitare 1988; Jordal
1997; McHugh et al. 2001; Adamcik & Kautmanova 2005), are of conservation
interest. In Sweden, Geoglossum uliginosum is treated in a special ‘action plan’
for nature conservation (Nitare 2007).
Materials & methods
Macromorphological characters were observed in fresh material. The
micromorphological structures were observed in dried material using a light microscope
112... Kuéera & al.
with an oil immersion lens. Fragments of fruit-bodies were examined in tap water, 5%
KOH, Melzer’s reagent, and a solution of Congo red in ammonia. Quantitative values
for micromorphological characters are presented as mean + 1 standard deviation of
30 measurements for each character (with minimum/maximum values in parentheses).
Herbarium acronyms are in accordance with Index Herbariorum (Thiers 2013). Voucher
specimens were deposited in herbaria PRM, BRNM, SAV, and UPS. Localities are geo-
referenced and the coordinates are given in the WGS 84 system. The description is based
on collections from Slovakia.
Description of studied Slovak collections
Geoglossum uliginosum Hakelier, Svensk Bot. Tidskr. 61: 422, 1967.
Ascocarps (35-)38-58(-66) mm high, clavate, stipitate, scattered, solitary.
Fertile part (10-—)14-22(-25) x (2-)3-6(-8) mm, usually flattened, lanceolate,
black, occasionally vertically grooved, glabrous. Sterile part 20-40(-50) x 1-3
mm, clearly delimited from the fertile part, cylindrical, black, smooth, viscid
when fresh, + shiny after drying [22 fruitbodies examined]. Asci (143-)
156-189(-214) x (11-)15-20(-24) um, clavate, apex rounded, narrowed, 8-
spored, pore blued in Melzer’s reagent. Spores (48-)59-75(-80) x 4-5(-6) um,
cylindrical, slightly curved, tapering towards one end, dark fuliginous, in one
cluster in the upper part of the ascus, 7-septate, occasionally 5- or 6-septate.
ParAPHYSES Slightly protruding above the asci, fragile, brownish in the apical
part, <9 um diam, remotely septate in the basal portion, closely septate in the
apical part, constricted at the septa. The constrictions occur at every second
septum. The cell pairs form chains and are easily broken off at the constrictions.
One of the cell pairs may be inflated to pyriform or globular form, <6-8 um
diam, especially in the apical part of the paraphyses. Instructive drawings
of paraphyses (and asci and spores) taken from the holotype specimen were
published by Nitare (2007).
HaBitTaT — Peat-bogs and wet meadows in association with Sphagnum
sp., Eriophorum sp., Deschampsia caespitosa, Nardus sp., Molinia caerulea, and
various species of Carex.
DISTRIBUTION — Czech Republic (Kucera & Gaisler 2012), Norway (Fadnes
2008; Nitare 2007), Slovakia (this paper), Sweden (Hakelier 1967; Nitare 1984,
2007; Ohenoja 2000, Turander 2012). Reports from Scotland and Northern
Ireland probably relate to a different species (Nitare 2007).
SPECIMENS STUDIED: SWEDEN, VASTMANLAND, Viker parish, Alvhyttan, Venen,
11.9.1965, N. Hakelier (holotype, UPS BOT: F-013939). SLOVAKIA, BaNnsKkA
Bystrica, Polana Mts., Hrinova, near mountain hotel “Polana’, along the trail to
the top of the Polana hill, 48°37'39.73"N 19°28'01"E, alt. 1304 m, wet meadow with
Deschampsia caespitosa, Eriophorum sp., Sphagnum sp. 27.9.2009, V. Kucera (SAV F-
10162); 6.10.2011, V. Kucera (SAV F-10529).
Geoglossum uliginosum (Slovakia) ... 113
Discussion
NOMENCLATURE — The name Geoglossum uliginosum could potentially
be confused with G. glabrum [var.] 6 uliginosum Pers. (Persoon 1800: 62,
tab. 3 fig. 4). As Persoon’s name was apparently never raised to specific rank,
however, Hakelier’s name is legitimate and not in conflict. G. glabrum var.
uliginosum certainly represents a different taxon because it was described as
having a squamulose stipe, while that of G. uliginosum is completely smooth.
We were unable to locate any specimen labelled either Geoglossum glabrum
var./f. uliginosum or Geoglossum uliginosum in Persoon’s herbarium (L), and
identification of Persoon’s fungus based only on the original (sparse) description
is impossible.
Taxonomy — Geoglossum uliginosum is characterised by having 1) ascocarps
with a slightly slimy-viscid stipe and 2) paraphyses with characteristically
long and easily broken chains of cells (or cell pairs) that are swollen at one or
sometimes both ends. The species grows only in slightly wet grasslands among
Sphagnum. ‘The material from Central Europe (both from Slovak and Czech
Rpublics) does not differ in any essential character from the holotype and other
Swedish collections; minor differences are presented in TABLE 1.
TABLE 1. Comparison of asci and ascospores in Geoglossum uliginosum from different
countries.
AscI (um) ASCOSPORES (ttm) No. oF
COUNTRY
LENGTH WIDTH LENGTH WIDTH SEPTA
(143-)156- (11-)15- (48-)59-
OAR 189(-214) 20(-24) 75(-80) AS(=8) C7
(151-)167- (13-)15- (50-)63-
CZECH REPUBLIC 190(-196) 19(-24) 78(90) 5-7 (5-)7(-9)
SWEDEN 140-175 14.5-17 60-80 4.5-6 7
Specimen data: Slovakia — SAV F-10162, SAV F-10529; Czech Republic — PRM 860478, PRM 860479,
PRM 860480, BRNM 737698, BRNM 737699, SAV F-10531, SAV F-10532 (see Kucera & Gaisler
2012); Sweden — Holotype UPS BOT F-013939 (Hakelier 1967).
CONSERVATION — Geoglossum uliginosum is well known from Scandinavia
(Sweden and Norway) and it was assumed that its distribution is restricted to
slightly wet and unfertilised semi-natural grasslands in the hemiboreal and
southern boreal vegetation zons in Scandinavia (Nitare 2007). Records from
Central Europe are therefore noteworthy.
We expect to find Geoglossum uliginosum in other locations in Central
Europe with habitats similar to those in Polana and Jizerské hory mountains.
The species is apparently rare and should be included in the next edition of the
Red list of Slovakia and Red list of Czech Republic. Currently the species is red-
listed in Sweden (Gardenfors 2010).
114... Kuéera & al.
Semi-natural grasslands are valuable landscape elements with high diversity
of plant and animal life and represent a reservoir of indigenous biodiversity.
Such habitats are critically threatened all over Europe, their number decreasing
mainly due to the fertilization, lack of grazing animals, and industrial pollution
(Newton et al. 2003).
Acknowledgements
We would like to thank Paul Cannon (CABI and Royal Botanic Gardens, Kew, UK)
and Esteri Ohenoja (University of Oulu, Finland), who read and commented on the
manuscript, and Shaun Pennycook (Manaaki Whenua Landcare Research, Auckland,
New Zealand) for his support. Vaclav Kautman, Stanislav Glejdura, and Nikola
Rybarikova are acknowledged for their assistance in the field, and Gerard Thijsse and
the staff of the Nationaal Herbarium Nederland in Leiden for the opportunity to study
Persoon’s herbarium. This study was supported by grant VEGA 2/0062/10 to VK and PL
and grant MZE 0002700604 to JG.
Literature cited
Adam¢ik S., Kautmanova I. 2005. Hygrocybe species as indicators of natural value of grasslands in
Slovakia. Catathelasma 6: 25-34.
Fadnes P. 2008. Kartlegging av sopfloraen i noen naturbeitemarker i Karmoy kommune 2008 HSH
rapport- 2/2008. [accessed 11-6-2012:
http://brage.bibsys.no/hsh/bitstream/URN:NBN:no-bibsys_brage_11012/1/fadnes.pdf].
Gardenfors U. (ed.) 2010. Rédlistade arter i Sverige 2010 - The 2010 Redlist of Swedish species.
Uppsala.
Hakelier N. 1967. Three new Swedish species of Geoglossum. Svensk Bot. Tidskr. 61: 419-424.
Jordal JB. 1997. Sopp i naturbeitemarker i Norge: en kunnskapsstatus over utbredelse, okologi,
indikatorverdi og trusler i et europeisk perspektiv. Trondheim.
Kuéera V. 2012. Geoglossaceous fungi in Slovakia IV. Geoglossum alveolatum, a new species for the
country. Catathelasma 14: 11-14.
Kuéera V, Gaisler J. 2012. First record of Geoglossum uliginosum (Ascomycota, Geoglossales) in the
Czech Republic, Czech Mycol. 64: 135-140.
Kuéera V, Lizon P. 2012. Geoglossaceous fungi in Slovakia III. The genus Geoglossum, Biologia 67:
654—658, http://dx.doi.org/10.2478/s11756-012-0053-6
Kuéera V, Lizon P, Kautmanova I. 2008. Geoglossaceous fungi in Slovakia: rare and new taxa for the
territory. Biologia 63: 482-486. http://dx.doi.org/10.2478/s11756-008-0077-0
Kuéera V, Lizon P, Kautmanova I. 2010. Geoglossoid fungi in Slovakia II. Trichoglossum
octopartitum, a new species for the country. Czech Mycol. 62: 13-18.
McHugh R, Mitchel D, Wright M, Anderson R. 2001. The fungi of Irish grasslands and their value
for nature conservation. Biol. Environm., Proc. Roy. Irish Acad. 101B: 225-242.
Newton AC, Davy LM, Holden E, Silverside A, Watling R, Ward SD. 2003. Status, distribution
and definition of mycologically important grasslands in Scotland. Biol. Conserv. 111: 11-23.
http://dx.doi.org/10.1016/S0006-3207(02)00243-4
Nitare J. 1984. Kartor aver kanda fynd av svarta jordtungor i Sverige. Windahlia 14: 78-94.
Nitare J. 1988. Jordtungor, en svampgrupp patillbakagang i naturliga fodermarker. Svensk Bot.
Tidskr. 82: 341-368.
Geoglossum uliginosum (Slovakia) ... 115
Nitare J. 2007. Atgardsprogram for sumpjordtunga 2007-2011 Geoglossum uliginosum.
http://www.naturvardsverket.se/Documents/publikationer/620-5734-0.pdf [accessed 11-6-2012]
Ohenoja E. 2000. Geoglossaceae Corda. 177-183, in: L Hansen, H Knudsen. (eds), Nordic
Macromycetes, vol. 1. Copenhagen.
Persoon CH. 1800 [“1799”]. Observationes mycologicae, vol. 2. Leipzig.
Rald E. 1985. Voxhatte som indikatorarter for mykologisk vardifulde overdrevslokaliteter. Svampe
Lieadeg,
Thiers B. 2013 [continuously updated]. Index Herbariorum: a global directory of public herbaria
and associated staff. New York Botanical Garden’s Virtual Herbarium [accessed 11-3-2013:
http://sweetgum.nybg.org/ih/].
Turander F. 2012. Sumpjordtunga (Geoglossum uliginosum) och andra jordtungor pa Malmbackarna
i Varmland. Svensk Mykol. Tidskr. 33: 16-20.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.117
Volume 124, pp. 117-126 April-June 2013
A new endophytic species of Chaetomium
from Jatropha podagrica
ROHIT SHARMA’, GIRISH KULKARNI,
MAHESH S. SONAWANE’ & YOGESH S. SHOUCHE!’
"Microbial Culture Collection & *Molecular Biology Unit, National Centre for Cell Science,
NCCS Complex, Ganeshkhind, Pune- 411 007 (Maharashtra), India
* CORRESPONDENCE TO: [email protected]
ABSTRACT — A new endophytic species of Chaetomium from fruits of Jatropha podagrica is
described from Maharashtra State, India. A combined sequence dataset of the ITS region,
LSU rDNA, and $-tubulin genes supports recognition of this fungus as a new species that is
largely concordant with morphological characters. Chaetomium jatrophae is characterized by
spirally coiled, predominantly unbranched, and coarsely roughened terminal ascomatal hairs
and elongate-ellipsoidal ascospores with a subapical or lateral germ pore. It is a mesophilic
Chaetomium species with a temperature maximum of 40+0.2°C.
Key worps — Chaetomiaceae, Euphorbiaceae, phylogeny, taxonomy
Introduction
Chaetomium Kunze (Kunze 1817) (Chaetomiaceae) accommodates more
than a hundred species. Chaetomium species are widespread and found
on various substrates, most with remarkable cellulolytic activity. Some are
pathogenic for humans (Barron et al. 2003, Al-Aidaroos et al. 2007, de Hoog et
al. 2009, Hubka et al. 2011) and others are plant endophytes (Syed et al. 2009).
Chaetomium is a widely studied genus (Ames 1969; von Arx et al. 1986; Gené &
Guarro 1996; Decock & Hennebert 1997; Udagawa et al. 1997; Rodriguez et al.
2002; Wang & Zheng 2005a,b; Asgari & Zare 2011) that is mainly characterized
by superficial ostiolate ascomata covered with hairs. During our biodiversity
survey of endophytic fungi, we isolated 20 strains of fungi from Jatropha
podagrica belonging to 13 species. Two strains belonged to Chaetomium:
C. bostrychodes Zopf (MCC 1019), isolated from a leaf petiole, and a new species
isolated from the fruit of the same plant. This new species is described here as
Chaetomium jatrophae based on morphological and combined phylogenetic
data of three loci.
118 ... Sharma & al.
TABLE 1. Achaetomium and Chaetomium isolates used in phylogenetic analysis.
GENBANK ACCESSION NUMBERS
ie oyu ITS LSU B-TUBULIN
A. strumarium CBS 333.67 (T) AY681204 AY681170 AY681238
C. acropullum CBS 126783 HM365258 HM365258 HM365292
C. ancistrocladum CBS 126784 HM365241 HM365241 HM365290
CBS 126673 HM365242 HM365242 HM365291
C. atrobrunneum CBS 379.66 (T) HM365255 HM365255 HM365294
C. bostrychodes IMI 325809 HM365261 HM365261 HM365296
C. carinthiacum CBS 126669 HM365265 HM365265 HM365299
C. coarctatum CBS 162.62 (T) HM365260 HM365260 HM365281
C. crispatum CBS 152.49 HM365267 HM365267 HM365293
C. cruentum CBS 371.66 (T) HM365266 HM365266 HM365270
C. elatum CBS 126657 HM365236 HM365236 HM365282
CBS 126656 HM365238 HM365238 HM365284
Bet oan a HM365237 HM365237 HM365283
C. funicola IMI 300511 HM365262 HM365262 HM365300
C. globosum CBS 148.51 HM365254 HM365254 HM365269
C. grande CBS 126780 (T) HM365253 HM365253 HM365273
C. indicum CBS 126667 HM365248 HM365248 HM365301
CBS 126668 HM365249 HM365249 HM365302
C. interruptum CBS 126661 HM365245 HM365245 HM365276
CBS 126662 HM365244 HM365244 HM365275
CBS 126660 (T) HM365246 HM365246 HM365277
C. iranianum CBS 126670 (T) HM365257 HM365257 HM365297
C. jatrophae Beaman an 1Q246354 HE981193 - HE981190
C. jodhpurense CBS 280.79 HM365243 HM365243 HM365295
C. madrasense CBS 126663 HM365252 HM365252 HM365274
C. megalocarpum CBS 533.79 HM365259 HM365259 HM365271
CBS 126666 HM365264 HM365264 HM365272
C. murorum CBS 126785 HM365256 HM365256 HM365288
CBS 636.83 HM365268 HM365268 HM365289
C. rectangulare CBS 126659 HM365240 HM365240 HM365286
CBS 126778 (T) HM365239 HM365239 HM365285
C. subaffine CBS 126777 HM365247 HM365247 HM365280
C. truncatulum CBS 126782 (T) HM365263 HM365263 HM365298
C. undulatulum CBS 126776 HM365250 HM365250 HM365278
CBS 126775 (T) HM365251 HM365251 HM365279
Sequences in bold font were generated in this study. (T) = ex-type strain.
CBS = Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands.
IMI = CABI BioScience, Egham, UK.
Chaetomium jatrophae sp. nov. (India) ... 119
Materials & methods
Sampling, fungal isolation and growth
The fungus was isolated from a healthy fruit of Jatropha podagrica, an ornamental
plant, collected from Pune (Pimpri), Maharashtra, India (18°37'07.04"N 73°48'13.43"E).
Various plant parts (leaves, petioles, fruits, flowers, young stems) were used to isolate
various endophytic fungi upon Potato Dextrose Agar (PDA) and Czapek Dox Agar
(CDA). Healthy fruits were harvested with clean blades and immediately dipped in
beakers containing water. The fruits were subsequently washed with tap water (10
min), cut into fragments, washed twice in sterile distilled water (5 min), 70% ethanol
(2-3 min), and 100% ethanol (20-30 sec). The fungal strains were isolated on CDA at
room temperature after 3 d of incubation. Colony growth rate and characteristics were
recorded on 2% MEA (Hi-Media, India) at room temperature (28—30°C) after 7 d in
dark. Growth rate was also measured at different temperatures (20-45°C, at intervals
of 5+0.2°C) on five media including PDA, CDA (Hi-Media, India), PCA (Potato Carrot
Agar), MEA (Malt Extract Agar) and OA (Oatmeal Agar) after 7 d.
Morphological observations and scanning electron microscopy (SEM)
The ascomata and ascospores were studied on slides mounted in water or
lactophenol. The slides were observed under Nikon YS100 microscope (Nikon, Japan).
Microphotographs were taken on Olympus BX53 (Olympus Corporation, Japan)
fitted with ProgRes C5 camera (Jenoptik, USA). Measurements of morpho-taxonomic
characters were recorded and compared with type descriptions of known species (Ames
1969, Tiwari et al. 1977, Wang & Zheng 2005a,b; Asgari & Zare 2011). Fifty readings were
recorded for each measurement using Jenoptik software. Ascomatal hair ornamentation
was determined by scanning electron microscopy (SEM). Dry ascomata were placed on
black double-sided tape on a stub (1 cm diam.), coated with platinum in a Jeol sputter
coater (Jeol-JFC 1600), and then visualized in SEM (Jeol-JSM 6360A) at 10 kV.
DNA extraction
Genomic DNA for amplification of internal transcribed spacer (ITS) region (ITS1-
5.8S-ITS2) was extracted using QIAamp® DNA Mini Kit (Qiagen, Inc., Valencia CA).
Genomic DNA for D1, D2 region of 28S large subunit (LSU) of ribosome and $-tubulin
(BTUB) genes was extracted by crushing fungal mycelia in cetyl trimethylammonium
bromide (CTAB) extraction buffer, pH 8 (Hi-Media, India). Thereafter 20 ul of proteinase
K (20 mg/ml) was added and incubated at 65+0.2°C for 1 h (Baker & Mullin 1994),
followed by addition of 20 ul RNase (10 mg/ml) and further incubation at 65+0.2°C
for 15 min. Chloroform: isoamylalcohol (24:1) was added (500 ul) to the supernatant
collected after centrifugation (8000 rpm, 10 min). The mixture was shaken for 5 min
and centrifuged at 10,000 rpm, 4°C for 15 min. Two volumes of CTAB precipitation
buffer (1% CTAB, 50 mM Tris, pH 8.0, 10 mM EDTA) was added to the supernatant and
kept at room temperature for 1 h. The pellet collected after centrifugation was dissolved
in 500 ul of 1.2 M NaCl and then 500 ul of chloroform: isoamylalcohol (24:1) was added.
Two volumes of absolute alcohol were added to the aqueous phase to precipitate the
DNA (Murray & Thompson 1980, Brandfass & Karlovsky 2008). The quantity of DNA
was measured by the amount of absorbance of the sample at 260 nm on NanoDrop
(ND-1000, Thermo Scientific, USA) and purity was checked on 0.8% agarose gel
electrophoresis.
120 ... Sharma & al.
PCR amplification and DNA sequencing
The ITS-LSU rDNA region was amplified using the 5.88 (CGCTGCGTTCTTCATCG)
and LR7 (TACTACCACCAAGATCT) primers (http://www.botany.duke.edu/fungi/mycolab/
primers.htm). The reaction mixture (25 ul) containing genomic DNA (100 ng), 1X PCR
buffer, 0.2 mM dNTPs, 10-20 pmoles of each primer, and 1 unit of Taq DNA polymerase
was amplified with Gene Amplifier PCR System 9700 (Perkin Elmer, USA) using the
following protocol: initial denaturation at 95°C for 3 min, 35 cycles of 94°C for 1 min,
57°C for 30 sec, 72°C for 2 min, and final extension at 72°C for 10 min. The BTUB gene
was amplified using primers Tl (AACATGCGTGAGATTGTAAGT) and Bt2b (ACCCTCAGTG
TAGTGACCCTTGGC) (O'Donnell & Cigelnik 1997) using the same reaction mixture and
equipment as for the ITS-LSU region using the following protocol: initial denaturation
at 95°C for 3 min, 35 cycles of 94°C for 30 sec, 52°C for 30 sec, 72°C for 30 sec, and
final extension at 72°C for 10 min. Five uL of the PCR amplified product was run on
1.0% agarose gel in 1X TBE buffer (54 g Tris base, 27.5 g boric acid, 20 ml EDTA 0.5
M, pH 8). Electrophoresis was carried out for about 90 min at 80 V. The gel was stained
in 1% ethidium bromide for 15 min and observed under UV illumination. The PCR
products were purified according to Sambrook et al. (1989). The sequencing reactions
were carried out using the ABI PRISM BigDye Terminator Cycle Sequencing Ready
Reaction Kit’ (Perkin Elmer Applied Biosystems Division, Foster City, CA) according to
the manufacturer’s protocol. DNA sequencing was carried out on ABI 3730xl Automated
Sequencer.
Phylogenetic analysis
An NCBI and DDBJ BLASTn search for ITS region (555 bp) was conducted for
sequence similarity (Zhang et al. 2000). The phylogenetic relationships of C. jatrophae and
other Chaetomium species were examined using ITS, LSU, and BTUB gene sequences.
Thirty-three sequences corresponding to 23 Chaetomium species were retrieved from
GenBank along with the outgroup, Achaetomium strumarium (TaBLE 1). The sequences
generated in this study were manually edited using ChromasPro version 1.34. The ITS
region, rDNA LSU, and BTUB gene sequences were analyzed individually and together
in MEGA 5.0. All sequences were aligned by multiple alignments using MUSCLE
program in MEGA 5.0 (Edgar 2004, Tamura et al. 2011). Sequences were analyzed by
maximum parsimony (MP) statistical method using bootstrap method of phylogeny
test (1000 replicates and 10 initial trees) (Tamura et al. 2011). Gaps and missing data
were deleted. MP tree was obtained by close-neighbor-interchange (CNI) on random
trees algorithm (Nei & Kumar 2000). Bootstrap values below 50% were removed from
tree. Sequences were also analyzed by neighbour- joining (NJ) and maximum likelihood
(ML).
Results
Taxonomy
Chaetomium jatrophae Rohit Sharma, sp. nov. PLATES 1-2
MycoBAnk 563940
Differs from Chaetomium atrobrunneum by its larger ascomata with spiraling coarsely
roughened terminal hairs, its peridium of texture intricata, and its ascospores with a
sub-apical to lateral germ pore.
Chaetomium jatrophae sp. nov. (India) ... 121
PLATE 1. Chaetomium jatrophae (MCC 1025). Fic. 1: Mature ascoma, showing terminal coiled
terminal hairs. Fic. 2, 3: Ascomatal hairs (SEM). Fic. 4: Ascospores (SEM). Scale bars: 1 = 100
um; 2,3 = 10 um; 4=5 um.
Type: India, Maharashtra State, Pune, Pimpri, 18°37'07.04"N 73°48'13.43”E, endophytic
in fruit of Jatropha podagrica Hook. (Euphorbiaceae), 25.1V.2011, Rohit Sharma
(Holotype, AMH 9558; ex-type culture, MCC 1025, NFCCI 2596, CBS 134263).
EryMo_ocy: Refers to the host genus Jatropha.
Colonies reaching 60 mm diam. on MEA after 7 d at room temperature
(28-30°C), olivaceous-buff to grayish-sepia with sparse aerial mycelium;
reverse similar in color to colony surface. Mycelium composed of hyaline to
subhyaline, septate, smooth hyphae, 9.0—-9.4 um diam. Ascomata superficial
to immersed, scattered, ostiolate, globose to subglobose, 187.3 (161.1—193.8)
x 151.6 (129.2-161.1) um, brown to dark brown, maturing in 20 d, loosely
attached to mycelium with brown to olivaceous brown rhizoids. Peridium
brown-vinaceous to brown-olivaceous, membranaceous with textura intricata.
Terminal hairs of different length, 312.5 (250.0—375.0) um long, numerous, pale
yellowish-brown to dark brown, straight below and spirally coiled above, 8-11
coils (generally 7—8), 3.9 (3.2—4.8) um wide at the base gradually tapering and
paling towards the apex, hairs forming dense tuft around ostiole, unbranched,
rarely branched, thick walled, coarsely roughened, septate. Lateral hairs straight,
short, coarsely roughened, 56.0 (32.3—83.9) um in length and 3.5 (3.2—4.0) um
122 ... Sharma & al.
PLATE 2. Chaetomium jatrophae (MCC 1025). Fic. 5: Ascomatal hairs. Fic. 6: Ascospores.
Fic. 7: Mature ascomata. Scale bars: 5, 6 = 5 um, 7 = 150 um.
wide at the base. Paraphyses absent. Asci clavate, hyaline, evanescent. Ascospores
one-celled, brown when mature, fusiform or elongate-ellipsoidal, symmetrical
or sometimes asymmetrical, 12.3 (6.5-16.2) x 7.6 (6.5—9.7) um, thick-walled,
with a distinct sub-apical or lateral germ pore. Anamorph absent.
Cultural characteristics
The optimum growth of C. jatrophae was determined as 30+0.2°C (mesophilic
in nature) and its temperature maximum at 40+0.2°C (Fic. 8). The temperature
80
70
60
e
Le —-MEA
s -™-CDA
Z “ —*-OMA
> 30 =<—PCA
= —<PDA
© 20
0 T T T T T T 1
20°C 25°C 30°C 35°C 40°C 45°C
Temperature (°C)
Fic. 8. Temperature-growth relationship of three Chaetomium jatrophae stains on Malt Extract
Agar (MEA), Czapek Dox Agar (CDA), Oatmeal Agar (OA), Potato Dextrose Agar (PDA), and
Potato Carrot Agar (PCA) (mm diam. of 7 d old colonies).
Chaetomium jatrophae sp. nov. (India) ... 123
E C. elatum CBS 126657
— Ec. elatwm CBS 126656
71 'C. elatwm CBS 910.70
C. coarctatum CBS 162.627
C. subaffine CBS 126777
74| 96] (- C. undulatulwn CBS 126776
97° © undulatuhwn CBS 1267757
C. rectangulare CBS 126659
65| 99'C. rectangulare CBS 1267787
96|C. megalocarpum CBS 533.79
621 'C. megalocarpum CBS 126666
C. grande CBS 1267807
99} 8? C. madrasense CBS 126663
55| |C. interruptum CBS 126662
99|| C. interruptum CBS 126661
75 73'C. interruptum CBS 1266607
C. cruentum CBS 371.667
100! C. globosum CBS 148.51
C. carinthiacwn CBS 126669
64 C. iranianwn CBS 1266707
C. truncatulum CBS 1267827
jatrophae CBS 134263
99 C. atrobrunneum CBS 379.66"
9g|C. ancistrocladum CBS 126784
C. ancistrocladum CBS 126673
100] + C. murorwnCBS 126785
94'C. murorum CBS 636.83
C. bostrychodes IMI325809
C. acropullwn CBS 126783
99 C. crispatwn CBS 152.49
C. jodhpurense CBS 280.79
C. funicola IM1300511
100 C. indicum CBS 126667
99'C. indicum CBS 126668
Achaetomium strumarium CBS 333.677
Fic. 9. Maximum parsimony phylogram of Chaetomium jatrophae (MCC 1025) based on combined
dataset of ITS-LSU rDNA-BTUB gene sequences, with Achaetomium strumarium as outgroup.
Bootstrap values > 50% (1000 replicates) are shown; CI = 0.531860, RI = 0.705642, RCI = 0.375302;
gaps and missing data deleted. C. = Chaetomium, (T) = ex-type strain.
maximum is an important physiological character for species differentiation (Li
et al. 2012). The maximum fungal growth occurred primarily on MEA followed
by OA. Ascomata developed after 25-30 d of incubation on MEA.
Molecular analyses
The phylogenetic analysis of 24 taxa of Chaetomium was conducted using
ITS and LSU (D1, D2 region) of rDNA and BTUB gene and sequence data
124 ... Sharma & al.
analyzed individually (not shown) and in combination. The ITS alignment
consisted of 576 bases (438 conserved, 131 variable, 91 parsimony informative,
40 singleton). The maximum parsimony tree had CI = 0.687500 RI = 0.805654
and RCI = 0.553887 (for all sites). The LSU alignment consisted of 386 bases
(361 conserved, 25 variable, 22 parsimony informative, 3 singleton), and the
BTUB gene alignment consisted of 425 bases (209 were conserved, 215 variable,
193 parsimony informative, 22 singleton). The combined data set had 1392 sites
(1008 conserved, 371 variable, 306 parsimony informative, 65 singleton). One
most parsimonious tree is shown in Fic. 9. All phylogenetic analyses (NJ, MP,
ML) supported the novelty of this species.
Discussion
The newly described species, C. jatrophae, is morphologically and
molecularly differentiated from related species. Maximum parsimony
analysis of combined dataset of ITS-LSU rDNA-BTUB gene (Fic. 9) groups
C. jatrophae in a clade with C. atrobrunneum L.M. Ames with 97% bootstrap
support. Although the LSU and BTUB sequence data is unavailable for
C. jabalpurense D.P. Tiwarietal., the ITS sequence analysis (not shown) distinctly
separates C. jatrophae from the morphologically similar C. jabalpurense and
C. perlucidum Sergeeva. Chaetomium jatrophae resembles C. jabalpurense,
C. atrobrunneum, and C. perlucidum mainly by ascospore shape and germ pore.
Nevertheless, C. jabalpurense (Tiwari et al. 1977) can also be distinguished from
C. jatrophae by its larger ascomata (154.7—304.5 x 150.3-297.2 um), narrower
(3.2 um) terminal hairs, spirally coiled lateral hairs, and narrower (5.3—6.2
um diam.) ascospores. Chaetomium atrobrunneum (Ames 1949), also close to
C. jatrophae, is distinguished mainly by smaller ascomata (75—120 um), peridium
of textura angularis, straight seta-like mostly smooth-walled ascomatal hairs,
and fusiform or elongate pyriform ascospores with a slightly subapical germ
pore. Chaetomium perlucidum (Ames 1969) is differentiated from C. jatrophae
by its olive-yellow to pale-brown smaller (105-135 x 100-130 tm) ascomata
and narrower (5.6—6 um diam.) ascospores.
The fact that Chaetomium jatrophae was isolated from Jatropha podagrica,
a xerophytic latex-producing plant may help fungi to survive better than in
outside environment. The occurrence of this Chaetomium species in fruits
suggests that further research is needed to better understand its biology as well
as its obligatory or facultative endophytic nature, and its role as an endophyte in
J. podagrica. However, Syed et al. (2009) pointed that endophytic Chaetomium
species are similar to Chaetomium strains obtained from other substrates (e.g.,
scat, seed, soil) both physiologically (utilizing the same carbon source) and
genetically (similar ITS rDNA sequence data).
Chaetomium jatrophae sp. nov. (India) ... 125
Acknowledgments
The authors are grateful to DBT, India for funding, NCCS, India for laboratory
facilities and Dr. S.V. Shinde (University of Pune, India) for SEM microscopy. We are
also indebted to Dr. Xue-Wei Wang (State Key Laboratory of Mycology, China) and
Dr. Yei-Zeng Wang (National Museum of Natural Science, Taiwan) for their assistance
during preparation of manuscript. Dr. Bita Asgari (Iranian Research Institute of Plant
Protection, Iran) and Dr. Vit Hubka (Charles University, Czech Republic) are also
acknowledged for critical review of the manuscript.
Literature cited
Al-Aidaroos A, Bin-Hussain I, Solh HE, Kofide A, Thawadi S, Belgaumi A, Al-Ahmari A. 2007.
Invasive Chaetomium infection in two immunocompromised paediatric patients. Pediatric
Infectious Disease Journal 26(5): 456-458.
http://dx.doi.org/10.1097/01.inf.000025923090103.ad
Ames LM. 1949. New cellulose destroying fungi isolated from military material and equipment.
Mycologia 41(6): 637-648.
Ames LM. 1969. A monograph of the Chaetomiaceae. United States Army Research and
Development Service. Cramer Publication, New York.
Asgari B, Zare R. 2011. The genus Chaetomium in Iran, a phylogenetic study including six new
species. Mycologia 103(4): 863-882. http://dx.doi.org/10.3852/10-349
Baker DD, Mullin B. 1994. Diversity of Frankia nodule endophytes of the actinorhizal shrub
Ceanothus as assessed by RFLP patterns from single nodule lobes. Soil Biology and Biochemistry
26(5): 547-552. http://dx.doi.org/10.1016/0038-0717(94)90241-0
Barron MA, Sutton DA, Veve R, Guarro J, Rinaldi M, Thompson E, Cagnoni PJ, Moultney K,
Madinger NE. 2003. Invasive mycotic infections caused by Chaetomium perlucidum, a new
agent of cerebral phaeohyphomycosis. Journal of Clinical Microbiology 41(11): 5302-5307.
http://dx.doi.org/10.1128/JCM.41.11.5302-5307.2003
Brandfass C, Karlovsky P. 2008. Upscaled CTAB-based DNA extraction and Real-Time PCR assays
for Fusarium culmorum and F. graminearum DNA in plant material with reduced sampling
error. International Journal of Molecular Sciences 9: 2306-2321.
http://dx.doi.org/10.3390/ijms9 112306
Decock C, Hennebert GL. 1997. A new species of Chaetomium from Ecuador. Mycological Research
101: 309-310. http://dx.doi.org/10.1017/S0953756296002456
de Hoog GS, Guarro J, Gene J, Figueras J. 2009. Atlas of clinical fungi. 3rd ed. Utrecht, The
Netherlands: Centraalbureau voor Schimmelcultures.
Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput.
Nucleic Acids Research 32(5): 1792-1797. http://dx.doi.org/10.1093/nar/gkh340
Gené J, Guarro J. 1996. A new Chaetomium from Thailand. Mycological Research 100: 1005-1009.
http://dx.doi.org/10.1016/S0953-7562(96)80055-4
Hubka V, Mencl K, Skorepova M, Lyskova P, Zalabska E. 2011. Phaeohyphomycosis and
onychomycosis due to Chaetomium spp., including the first report of Chaetomium brasiliense
infection. Medical Mycology 49 (7): 724-733.
http://dx.doi.org/10.3109/13693786.2011.572299
Kunze G. 1817. Zehn neue Pilzgattungen. Mykologische Hefte 1: 1-18.
Li J, Zhao X-M, Wang X-W. 2012. Growth temperature of Chaetomium species and its taxonomic
value (in Chinese). Mycosystema 31(2): 213-222.
126 ... Sharma & al.
Murray MG, Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic
Acids Research 8: 4321-4325.
Nei M, Kumar S. 2000. Molecular evolution and phylogenetics. Oxford University Press, New
York.
O'Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic
lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution
7(1): 103-116.
Rodriguez K, Stchigel A, Guarro J. 2002. Three new species of Chaetomium from soil. Mycologia
94(1): 116-126.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Syed NA, Midgley DJ, Ly PKC, Saleeba JA, McGee PA. 2009. Do plant endophytic and free-living
Chaetomium species differ? Australasian Mycologist 28(2-3): 51-55.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA 5.0: Molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance and
maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
Tiwari DP, Agrawal PD, Lodha AR. 1977. Chaetomium jabalpurense, a new fungus from soil.
Current Science 46: 578-579.
Udagawa S, Toyazaki N, Yaguchi T. 1997. A new species of Chaetomium from house dust.
Mycoscience 38(4): 399-402. http://dx.doi.org/10.1007/BF02461679
von Arx JA, Guarro J, Figueras MJ. 1986. The ascomycete genus Chaetomium. Beihefte zur Nova
Hedwigia 84: 1-162.
Wang X-W, Zheng R-Y. 2005a. Chaetomium acropullum sp. nov. (Chaetomiaceae, Ascomycota),
a new psychrotolerant mesophilic species from China. Nova Hedwigia 80(3-4): 413-417.
http://dx.doi.org/10.1127/0029-5035/2005/0080-0413
Wang X-W, Zheng R-Y. 2005b. Chaetomium ampulliellum sp. nov. (Chaetomiaceae, Ascomycota)
and similar species from China. Nova Hedwigia 81(1-2): 247-255.
http://dx.doi.org/10.1127/0029-5035/2005/0081-0247
Zhang Z, Schwartz S, Wagner L, Miller W. 2000. A greedy algorithm for aligning DNA sequences.
Journal of Computational Biology 7: 203-214. http://dx.doi.org/10.1089/10665270050081478
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.127
Volume 124, pp. 127-141 April-June 2013
A contribution to the taxonomy of Lyromma
(Lyrommataceae, lichenized Ascomycota)
with a species key
ADAM FLAKUS! & EDIT FARKAS?
‘Laboratory of Lichenology, W. Szafer Institute of Botany, Polish Academy of Sciences,
Lubicz 46, PL-31-512 Krakow, Poland
?Institute of Ecology and Botany, Centre for Ecological Research, Hungarian Academy of Sciences,
H-2163 Vacratét, Alkotmany u. 2-4, Hungary
CORRESPONDENCE TO: 'a.flakus@botany. pl, *[email protected]
ABSTRACT — The paper presents a new concept of conidial-ascosporic relationship in the
foliicolous lichenized genus Lyromma and a revised key to species determination. Lyromma
coronatum sp. nov. (Bolivia) is characterized by reduced perithecial appendages composed
of clavate hyphae that form a crown around the ostiole. Lyromma multisetulatum sp. nov.
(Bolivia, Brazil) is characterized by numerous large strongly recurved perithecial appendages
composed of individual acicular hyphae. Undescribed ascosporic states for Lyromma
dolicobelum and L. palmae and conidial states for L. ornatum and L. pilosum are described
based on observations of perithecia and pycnidia for the first time in natural conditions.
Confirmation of a conidial-ascosporic connection for L. nectandrae suggests L. confusum
as a synonym. Lyromma dolicobelum, L. nectandrae, and L. ornatum are reported as new to
Bolivia, and L. pilosum as new to Bolivia and Brazil.
Key worps —Neotropics, new species, South America
Introduction
This is a new contribution to the foliicolous lichens of Bolivia (Flakus &
Liicking 2008) within an inventory aimed to establish knowledge on the
diversity of lichens and allied fungi in the country (e.g. Flakus & Wilk 2006,
Flakus et al. 2008, Flakus 2009, Knudsen & Flakus 2009, Kukwa & Flakus 2009,
Flakus & Kukwa 2012, Flakus et al. 2012, Kukwa et al. 2012).
The foliicolous lichenized genus Lyromma Bat. & H. Maia (Lyrommataceae
Liicking, Chaetothyriales), containing six species accepted by Liicking (2008), is
characterized by globose to short barrel-shaped perithecia and elongate barrel-
shaped pycnidia, sessile on smooth ecorticate thalli of rounded patches formed
by symbiotic relationship with Phycopeltis. Perithecia are composed of a thin
128 ... Flakus & Farkas
layer of irregular dark brown hyphae, and persistent or evanescent paraphyses
comprise the hamathecium. The bitunicate obclavate to saccate asci (I-, KI-)
contain 8 transversely septate fusiform colorless ascospores. Pycnidia (formed
by a thin layer of distinctly parallel dark brown hyphae) produce multiseptate
filiform colourless macroconidia or non-septate bacilliform microconidia.
Mature perithecia and pycnidia both form appendages in the upper part near
ostiole, composed of either individual or agglutinated hyphae (Batista & Maia
1965, Cavalcante et al. 1972, Licking 1992, 2008, Liicking et al. 1998).
Lyromma was established as a monospecific pycnidial genus for L. nectandrae
(Batista & Maia 1965, Liicking et al. 1998). Perithecia were described originally
for L. nectandrae (Licking 1992, Aptroot et al. 1997) and later for L. ornatum
(Licking & Kalb 2000). For a long time, L. nectandrae was the only species
known to produce both perithecia and pycnidia (Liicking 1992, Aptroot et al.
1997). However, a re-examination of the known Lyromma material by Licking
(2008) showed that no single collection contained both perithecia and pycnidia
on the same thallus. Moreover, specimens assigned to L. nectandrae with
perithecia were shown to belong to different taxa described later as L. confusum
and L. pilosum (Liicking 2008). Since ascosporic and conidial states were not
observed on the same thallus, the perithecial and pycnidial morphotypes had
been treated as different species until their taxonomic status could be clarified.
Finally, based on the then-available specimens, Liicking (2008) proposed three
taxa with perithecia and three with pycnidia.
We have been able to study further fresh collections of foliicolous lichens
from Bolivia and Brazil and discovered more and more thalli of the otherwise
rare Lyromma species. These new findings form the basis of our re-evaluation
of the species concept based on conidial-ascosporic relationships.
Material & methods
Morphology and anatomy were examined by using NIKON SMZ800 and a NIKON
EcuipsE 80i (DIC), as well as OLympus SZX9 and Otympus BX50 (DIC) microscopes.
Preparations were studied in water and KOH solution (K), and for ascus structure in
Lugol's iodine solution without (I) or with pre-treatment with KOH (K/J). All anatomical
measurements were made in water.
Handling the sporocarps required great care to establish exact sizes and numbers of
setae. Anatomy, measurements, and number of setae should be examined on sectioned
or squash mounts in water under a compound research microscope.
Results
Lyromma coronatum Flakus & Farkas, sp. nov. PLATE 14, B
MycoBank MB 802289
Differs from other Lyromma species by its reduced perithecial appendages composed of
numerous individual clavate hyphae that form a regular crown around the ostiole.
Lyromma revised taxonomy and key ... 129
Type — Bolivia, Dept. Beni, Prov. Ballivian, near Rio Pircayo, 14°18'56"S 67°26'34"W,
190 m, lowland Amazon forest, 4 Dec. 2004, A. Flakus 4315 (Holotype, KRAM; isotype,
LPB).
EryMoLocy — The species is named after its reduced appendages forming a characteristic
crown around ostiole.
THALLUS foliicolous, epiphyllous, ecorticate, formed by rounded patches,
smooth, 0.4-3 mm wide, olive-green; PHOTOBIONT Phycopeltis, cells rectangular,
12-20 x 4-6 um, arranged in radiate plates; PERITHECIA sessile, globose, 50-100
um in diam., and 50-80 um high, pale brown, around ostiole furnished with
crown of almost reduced appendages; OSTIOLE apical, 20-35 um wide; SETAE
dark brown, almost reduced to 5-7(-12) x (4—)5-7 um, forming a very regular
crown around ostiole, composed of numerous individual clavate, apically
thickened (apical walls c. 1 um thick) hyphae (sometimes branched apically);
PERIDIUM pale brown, 3-5 um thick, composed of rectangular cells (3-5 um
wide), thick walled (c. 1-1.5 um thick), arranged irregularly to almost parallel;
PARAPHYSES Sparse in mature perithecia, simple, c. 1 um thick; ascr bitunicate,
8-spored, 30-50 x 10-15 um; ascosporess fusiform, hyaline, 3-septate, with
slight constrictions at septa, upper second cell usually slightly enlarged, 17-20
x 4-5 um; PYCNIDIA not seen.
DISTRIBUTION & ECOLOGY — The new species is known from two localities
in Bolivia, one of which is located in the protected area Reserva Nacional de
Vida Silvestre Amazonica Manuripi. It grows on leaves of vascular plants in
lowland Amazon forest.
ADDITIONAL SPECIMENS EXAMINED — BOLIVIA. DEpT. PANDO. PRov. MANURIPI,
Reserva Nacional de Vida Silvestre Amaz6onica Manuripi, Bajada colony near Chive
village, near Rio Madre de Dios, 12°24'03"S 68°26'45"W, 170 m, 2006, A. Flakus 6018
(herb. Flakus).
COMMENTS — Lyromma coronatum is characterized mainly by pale brown
perithecia and the presence of reduced perithecial appendages that form a
characteristic crown around the ostiole composed of numerous very short
clavate hyphae. The species can be confused with the ascosporic state of
L. palmae, which produces appendages composed of similar clavate hyphae.
Therefore, we initially regarded the new species as the juvenile form of
L. palmae with not fully developed appendages. However, a detailed study
showed that L. coronatum is mature species with fully developed asci and the
largest ascospores yet known in the Lyromma (Licking 2008). Thus, L. palmae
can be distinguished from the new species by its darker perithecia (especially
in the upper part), and the perithecial appendages that are larger [10-30(-40)
uum long], erect to horizontal, composed of about 20-60 individual hyphae, and
usually grouped in 3-6 brush-shaped appendages (then faintly agglutinated
in basal part). The two species also differ in the size of the photobiont cells
(12-20 x 4-6 um in L. coronatum, and 10-13 x 5-6 um in L. palmae), ascospores
130 ... Flakus & Farkas
(17-20 x 4-5 um in L. coronatum, and 14-18 x 3-5 um in L. palmae), and the
ostiole width (25-35 um in L. coronatum, and 15-20 um in L. palmae).
Lyromma dolicobelum Cavalc., in Cavalcante et al., Publ. Inst. Micol. Univ. Fed.
Pernambuco 647: 39. 1972. PLATE 1C
Type — Brazil. Roraima: Mucajai-Caracarai, II 1962, de Lima 19682 (URM 37178 -
holotype; INPA- isotype).
“Lyromma nectandrae var. dolicobelum” Bat. & Cavalc., in Bezerra et al., Atas Inst.
Micol. Univ. Fed. Pernambuco 5: 386, 389, 397, 409, 421. 1967, nom. nud.
[See Lticking (2008) for a detailed description of pycnidia. ]
THALLUS foliicolous, epiphyllous, ecorticate, formed by rounded patches,
smooth, 2-8 mm wide, olive-green; PHOTOBIONT Phycopeltis, cells rectangular,
10-17 x 4-7 um, arranged in radiate plates; PERITHECIA sessile, subglobose
to globose, 50-80 um in diam., and 60-80 um high, dark brown, around
ostiole furnished with 2-3(-4) setae; sETAE dark brown to black, tubular,
almost horizontal to recurved, 60-200(-300) um long and 20-30 um broad
in basal part, composed of agglutinated hyphae; PERrpIuM dark brown, lower
part slightly paler, 2-4 um thick, 3-5 um thick, composed of rectangular cells
(2-5 um wide), thick walled (c. 1-1.5 um thick), arrangement irregular to
almost parallel; PARAPHYSES sparse in mature perithecia, simple, c. 1 um thick;
ASCI bitunicate, 8-spored, 30-35 x 10-15 um; ascospores fusiform, hyaline,
3-septate, with slight constrictions at septa, 16-18 x 4-5 um.
DISTRIBUTION & ECOLOGY — ‘This species, known previously only from
lowland Amazon forest in Brazil and lowland rainforest in Mexico (Cavalcante
et al. 1972, Licking et al. 1998, Herrera-Campos et al. 2004, Liicking 2008), is
now reported for Bolivia.
SELECTED SPECIMENS EXAMINED — BOLIVIA. DEPT. PANDO. PRov. MANURIPI, Reserva
Nacional de Vida Silvestre Amazénica Manuripi, Puerto Rico village, 11°06'12''S
67°31'14"'W, 191 m, 2006, A. Flakus 6570 (LPB); Prov. FEDERICO ROMAN, near Santa
Cruzito colony, 10°43'03''S 65°55'05''W, 149 m, 2006, A. Flakus 7107, 7160, 7111, 7257,
7127 (KRAM, LPB, herb. Flakus).
ComMENTs — Lyromma dolicobelum is distinguished from all other Lyromma
species by the few but very long appendages, up to 200-300(-400) um long and
composed of agglutinated hyphae.
Lyromma multisetulatum Flakus & Farkas, sp. nov. PLATE 1D; 2A, J
MycoBank MB 802290
Differs from Lyromma pilosum by its more numerous, larger, and strongly recurved
perithecial appendages.
Type — Bolivia, Dept. Santa Cruz, Prov. Guarayos, Reserva Vida Silvestre Rios Blanco y
Negro, Plan de Manejo AISU, 15°01'58"S 62°46'36"W, 242 m, lowland Amazon forest,
24 July 2009, A. Flakus 13961 & P. Rodriguez (Holotype, KRAM; isotype, LPB).
Lyromma revised taxonomy and key... 131
PiaTE 1. Morphology of perithecial appendages of Lyromma. A-B: L. coronatum, reduced, forming
a crown around ostiole (holotype). C: L. dolicobelum, tubular, horizontal to recurved, composed
of agglutinated hyphae. D: L. multisetulatum, setose, recurved, composed of individual acicular
hyphae (holotype). E: L. nectandrae, tubular, horizontal to recurved, composed of agglutinated
hyphae. F—H: L. ornatum, triangular to irregularly lobate (H, deeply divided), horizontal, composed
of agglutinated hyphae. I-J: L. palmae, setose to brush-shaped, erect, composed of individual clavate
hyphae or agglutinated at the base (J, brush-shaped). K: L. pilosum, setose, recurved, composed of
individual hyphae. Scale bars = 25 um.
132 ... Flakus & Farkas
EryMoLocy — The species is named after its strongly recurved appendages produced in
large numbers near the top of perithecia.
THALLUS foliicolous, epiphyllous, ecorticate, formed by rounded patches,
smooth, 1-2 mm wide, olive-green; PHOTOBIONT Phycopeltis, cells rectangular,
18-22 x 6-8 um, arranged in radiate plates; PERITHECIA sessile, subglobose to
globose, 70-80 um in diam., and 70-90 um high, dark brown, around ostiole
furnished with (10-)15-30(-40) setae; seTAE dark brown, septate, strongly
recurved, composed of individual hyphae, 30-50(-60) um long and 3-4 um
broad (2-3 um broad in apical part); PERIDIUM dark brown, lower part slightly
paler, 3-4 um thick, composed of rectangular cells (3-4 um wide), thick walled
(c. 1 um thick), arrangement irregular to almost parallel; PARAPHYSES sparse
in mature perithecia, simple, c. 1 um thick; asci bitunicate, 8-spored, 30-35 x
10-13 um; AscosporEs fusiform, hyaline, 3-septate, with slight constrictions
at septa, 14-18 x 4-5 um; pycnip1a elongate, barrel-shaped with tapering top,
100-130 um high and 80-90 um wide, dark brown, upper part around ostiole
furnished with 15-30 setae; seTAE dark brown, septate, strongly recurved,
composed of individual hyphae, (20-)30-50(-60) um long and 3-4 um broad
(1-2 um broad in apical part); conrp1a (microconidia) bacilliform, non-
septate, 2-5 x 0.8-1.2 um.
DISTRIBUTION & ECOLOGY — The new species is known from the Reserva
Vida Silvestre Rios Blanco y Negro, Bolivia and the Private Nature Conservation
Reserve founded by Karoly Kégl near Sao Paulo, Brazil. It grows on vascular
plant leaves in lowland Amazon forest and Atlantic submontane rainforests.
ADDITIONAL SPECIMENS EXAMINED — BRAZIL. EsTapo SAo Pauto. SAO ROQUE, sobre
la Lagunita, al Norte de la Laguna Sapucaia, ca 850 m, 1995, A. Borhidi s.n. (VBI).
CoMMENTS — Lyromma multisetulatum is characterized by its numerous
[(10-)15-30(-40)], long [30-50(-60) um], and strongly recurved perithecial
appendages, each composed of an individual hypha. It is the first Lyromma
species known to produce microconidia. Perithecia of the most similar species,
L. pilosum, differ in forming less numerous appendages [(5-)10-15] that are
less curved and almost twice as short (10-15 um) (Liicking 2008).
Lyromma nectandrae Bat. & H. Maia, Atas Inst. Micol. Fed. Univ. Pernambuco 2:
360. 1965. PLATE IE
Type — Brazil. Pernambuco: Recife, Dois Irmdos, III 1960, Soares da Silva 13832 (URM
18764 — holotype); Brazil: Amazonas: Manaus, Itacoatiara, VII 1967, Omar 40677 (URM
69375 - epitype, designated by Liicking et al.: 145. 1998).
= Lyromma confusum Licking & Sérus., in Licking, Fl. Neotrop. Monogr. 103: 187. 2008.
Type — Papua New Guinea, Madang prov. Balek Wildlife Reserve, c. 15 km S of Madang
along road to Lae, 5°18'S 145°43’E, c. 20 m, in tropical lowland rainforest, on tree trunk/
on shaded limestone cliff (former coral reef), 29 July 1992, E. Sérusiaux 13555-17 (LG
- holotype!).
Lyromma revised taxonomy and key ... 133
PLaTE 2. Morphology of pycnidial appendages and anatomy of conidia of ae A: L. multi-
setulatum, setose, recurved, composed of individual acicular hyphae (holotype). B-C: L. ornatum,
tubular (simple to furcate), horizontal to recurved, composed of agglutinated hyphae (B, young
pycnidia). D-G: L. palmae, setose, erect, composed of individual clavate hyphae (D, young,
glabrous pycnidium). H-I: L. pilosum, setose, recurved, composed of individual acicular hyphae
(H, young, glabrous pycnidium). J: L. multisetulatum, short, bacilliform microconidia (holotype).
K: L. pilosum, large, filiform macroconidia. Scale bars: A-I, K = 25 um; J = 10 um.
“Lyromma confusum” Liicking, in Herrera-Campos et al.,
Lichenologist 36: 315. 2004, nom. nud.
[For detailed descriptions see Batista & Maia (1965) and Liicking (2008)].
DISTRIBUTION & ECOLOGY — This pantropical species is rather widespread in
the Neotropics, where it is known from Argentina, Brazil, Costa Rica, Ecuador,
French Guyana, Mexico, and Panama (Sipman 1997, Ferraro & Licking 2000,
Herrera-Campos et al. 2004, Liicking 2008), and is now also reported from
Bolivia, where it was found in lowland rainforests.
134 ... Flakus & Farkas
SELECTED SPECIMENS EXAMINED — BOLIVIA. Dept. BENI. PRov. BALLIVIAN, near
Pircayo river, 14°18'56"S 67°26'34"W, 190 m, 2004, A. Flakus 4174.1 (LPB). DEpT.
PANDO. PRov. FEDERICO ROMAN, near Santa Cruzito colony, 10°43'03"S 65°55'05" W,
149 m, 2006, A. Flakus 7193.1, 7298 (KRAM, LPB). DEPT. SANTA Cruz, PRov.
Guarayos, Reserva Vida Silvestre Rios Blanco y Negro, Virgen de Pilar near Chonta
village, 15°38'54"S 62°57'37"W, 229 m, 2009, A. Flakus 13481, 13381.1 & P. Rodriguez
(KRAM, LPB); Plan de Manejo AISU, 15°01'58"S 62°46'36"W, 242 m, 2009, A. Flakus
13911 & P. Rodriguez (LPB). BRAZIL. Estapo ToCANTINS. TONCINOPOLIS, 3 km al
NE de la ciudad, Fazenda de José Borges cerca del Riacho Francisco, 1995, A. Borhidi
s.n. (VBI). ESTADO RIO DE JANEIRO. SERRA DO MANTIQUEIRA, Parque Nacional de
Itatiaia, en el alrededor del Cachueiro Veu da Noiva, ca 1300-1500 m, 1995, A. Borhidi
s.n. (VBI). PAPUA NEW GUINEA. MADANG PROVINCE. PONT DE LA GOGOL RIVER,
route de Lae a env. 15 km de Madang, 5°20’S 145°43’E, 30 m, 1987, J. Lambinon 87/370
(LG); RAMU VALLEY. Brahman, along road to Bundi, 5°46'S 145°21'E, 200 m, 1992, E.
Sérusiaux 14200-2 (LG); FOTHILLS OF FINISTERRE RANGE, along road Madang-Lae, km
39, c. 230 m, 1992, E. Sérusiaux 14303-48 (LG). CENTRAL PROVINCE. N of Brown River,
3 km NE of Hiritano highway, 30-50 m, 1987, J.R. Sloover 87 L 23 (LG). INDONESIA.
BALI. GIANYAR DistTrRIcT, Gununk Kawi, 8°28'S 115°18’E, 1991, 500 m, L. Hoffmann
91-115 (LG).
Comments — Although Liicking (2008) considered the perithecial appendages
of Lyromma confusum morphologically very similar to those on the pycnidia
of L. nectandrae, he treated the two as separate taxa because there was no proof
of a conidial-ascosporic connection. We found thalli bearing pycnidia typical
of L. nectandrae mixed together with perithecia of L. confusum and so regard
L. confusum as a synonym of L. nectandrae.
Mature perithecia of L. nectandrae have 3-5, horn-shaped, recurved
(rarely horizontal), 30-70 um long and 10-15(-20) um broad (at the base)
appendages and are sometimes 2-3-furcate at the ends (Lticking 2008). Young
undeveloped L. nectandrae specimens can be confused with L. ornatum, which
has short perithecial appendages but which can be distinguished from mature
L. nectandrae material by the irregularly lobate to triangular, horizontal (rarely
slightly recurved), comparatively shorter [15-30(-40) um long], perithecial
appendages (Liicking & Kalb 2000, Lticking 2008).
Likewise, the pycnidia of L. nectandrae are morphologically similar to those
of L. ornatum (shown on PLATE 2C) with (2-)3-5 cylindrical to irregular
appendages that are 40-60(-100) um long and 10-15 um broad (at the base)
and may be simple to 2-3-furcate at the ends (Batista & Maia 1965, Liicking
2008).
Lyromma ornatum Licking, Kalb & Sérus., in Liicking & Kalb, Bot. Jahrb. Syst. 122:
39. 2000. PLATE 1F-H; 2B, C
Type — Brasilien. Sao Paulo, Serra do Mar, Serra do Garraozinho, zwischen Mogi das
Cruzes und Bertioga, in einem primaren Regenwald, 23°45'S 46°10'W, 300-600 m,
6.1X.1980, K. Kalb 32601 & G. Plobst (herb. K. Kalb - holotype!).
[For detailed descriptions of the thallus and perithecia, see Licking & Kalb
(2000) and Licking (2008)].
Lyromma revised taxonomy and key ... 135
PycnipiA elongate barrel-shaped with a tapering top, 100-120 um high
and 35-60 um in wide, dark brown, upper part around the ostiole furnished
with 2-4 setae; SETAE dark brown to black, recurved, composed of agglutinated
hyphae, cylindrical to irregular, simple to 2-4-furcate on the ends, 30-80 um
long and 10-20 um broad (at the base); conip1a (macroconidia) filiform,
multiseptate, 50-80 x 0.8-1.2 um.
DISTRIBUTION & ECOLOGY —This species, rather widespread in the
Neotropics, has been reported from Argentina, Brazil, Ecuador, Peru, Mexico,
and Surinam (Ferraro & Liicking 2000, Licking & Kalb 2000, Herrera-Campos
et al. 2004, Liicking 2008). These are the first records from Bolivia, where it is
known only from lowland Amazon forest.
SELECTED SPECIMENS EXAMINED — BOLIVIA. Dept. BENI. PRov. BALLIVIAN near
Pircayo river, 14°18'56"S 67°26'34"W, 190 m, 2004, A. Flakus 4173 (LPB). Dept.
PANDO. PRov. MANuRIPI, Reserva Nacional de Vida Silvestre Amazonica Manuripi,
Bajada colony near Chive village, 12°24'03"S 68°26'45"W, 170 m, 2006, A. Flakus 6019.1
(LPB); Chive village, 12°23'19"S 68°34'39"W, 157 m, 2006, A. Flakus 6407 (KRAM,
LPB); Puerto Rico village, 11°06'12"S 67°31'14"W, 191 m, 2006, A. Flakus 6554, 6565
(KRAM, LPB); Prov. NICOLAS SUAREZ, near Cobija village, 11°02'16"S 68°45'31”"W,
191 m, 2006, A. Flakus 6455, 6457 (KRAM, LPB, herb. Flakus); Prov. MADRE DE Dios,
Reserva Nacional de Vida Silvestre Amazonica Manuripi, Puerto Madre de Dios village,
11°30'56"S 67°16'07"W, 153 m, 2006, A. Flakus 6802, 6865 (KRAM, LPB); Prov.
FEDERICO ROMAN, near Santa Cruzito colony, 10°43'03"S 65°55'05"W, 149 m, 2006,
A. Flakus 7275 (LPB). DEPT. SANTA Cruz. PRov. GuARAYOS, Reserva Vida Silvestre
Rios Blanco y Negro, Virgen de Pilar near Chonta village, 15°38'54"S 62°57'37"W, 229
m, 2009, A. Flakus 13381, 13382 & P. Rodriguez (KRAM, LPB); Plan de Manejo AISU,
130 km from Ascencién de Guarayos village, 15°03'35"S 62°45'20" W, 258 m, 2009, A.
Flakus 13841, 13842 & P. Rodriguez (KRAM, LPB, herb. Flakus). BRAZIL. Estapo
TOCANTINS. TONCINOPOLIS, 3 km al NE de la ciudad, Fazenda de José Borges cerca del
Riacho Francisco, 1995, A. Borhidi s.n. (VBI).
COMMENTS — Studies on a wide range of material show that Lyromma
ornatum exhibits considerable variation in the shape and size of its perithecial
appendages. ‘The species forms 3-6 horizontal to (rarely) slightly recurved
appendages composed of distinctly agglutinated hyphae, which are triangular to
irregularly lobate but sometimes also deeply divided at the apex, 15-30(-40) um
long and 7-15(-20) um broad (at the base). Morphotypes with strongly incised
appendages are externally similar to the perithecia of L. palmae. However,
L. palmae has erect to horizontal appendages, composed of 20-60 clavate hyphae
(apically <4-7 um broad), usually grouped into 3-6 brush-shaped appendages
(then faintly agglutinated at the base). Lyromma nectandrae, another similar
species (see above), has much larger recurved perithecial appendages (30-70
um long) (Lticking 2008).
Only a few poorly developed (probably juvenile) pycnidia were observed
on thalli of L. ornatum together with perithecia typical for the species. They
most closely resemble those of L. nectandrae in having recurved simple to
136 ... Flakus & Farkas
2-4-furcate appendages composed of agglutinated hyphae, but they are less
numerous [2-3(-4)] and shorter (30-80 um long). The relationship between
these two species can be clarified only by studying more complete material or
by molecular analyses.
Lyromma palmae (Cavalc. & A.A. Silva) Licking & Sérus., in Licking et al.,
Lichenologist 30: 136. 1998. PLATE LI, J; 2D-G
= Anconomyces palmae Cavalc. & A.A. Silva, in Cavalcante et al.,
Publ. Inst. Micol. Univ. Fed. Pernambuco 647: 26. 1972.
Type — Brazil. Amazonas: Manaus, Manaus, Rodovia AM-1, km 55, Aug 1961, Carvalho
17065 (URM 29109 - holotype; INPA - isotype); Brazil. Maranhao: Zé Doca, IX 1965,
Peres 25270 (URM 52420 - epitype, designated by Liicking et al.: 136. 1998).
THALLUS foliicolous, epiphyllous, ecorticate, forming rounded patches,
smooth, 0.3-3 mm diam, olive-green; PHOTOBIONT Phycopeltis, cells
rectangular, 8-21 x 4-7 um, arranged in radiate plates; PERITHECIA sessile,
subglobose to globose, 40-80 um in diam., and 40-60 um high, dark brown,
around ostiole furnished with 20-60 individual setae or 3-6 brush-shaped
appendages; sETAE dark brown, erect to horizontal, composed of about 20-60
individual, clavate hyphae, 10-30(-40) um long and (3-)4-6(-7) um broad
(at the apex), setose but usually grouped in 3-6 brush-shaped appendages,
then faintly agglutinated at the base; PERIDIUM dark brown, lower part slightly
paler, 3-4 um thick, composed of rectangular cells (2-3 um wide), thick walled
(c. 1 um thick), arrangement irregular to almost parallel; PARAPHYSES sparse
in mature perithecia, simple, c. 1 um thick; asc bitunicate, 8-spored, 30-35 x
10-14 um; ascospores fusiform, hyaline, 3-septate, with slight constrictions
at septa, second cell from above sometimes slightly enlarged, 14-18 x 3-5 um;
PYCNIDIA elongate barrel-shaped with a tapering top, 100-130 um tall and 40-
55 um wide, dark brown, upper part around the ostiole furnished with 20-25
setae; SETAE dark brown, erect, usually clavate, septate, composed of individual
hyphae, (10-)20-30(-40) um long, 3-4 um broad in basal part and (3-)4-6
(-7) um broad in apical part; conipIA (macroconidia) filiform, multiseptate,
40-100 x 0.8-1.2 um.
DISTRIBUTION & ECOLOGY — This species is known from Argentina, Bolivia,
Brazil, Costa Rica, and Mexico (Cavalcante et al. 1972, Liicking et al. 1998,
Ferraro & Licking 2000, Herrera-Campos et al. 2004, Flakus & Licking 2008,
Liicking 2008). It is found mostly in lowland rainforests, and also in northern
Argentinean forests.
SELECTED SPECIMENS EXAMINED — BOLIVIA. DEPT. BENI. PRov. BALLIVIAN, Nuevos
Reyes colony, 14°13'17"S 67°28'25"W, 190 m, 2004, A. Flakus 3811 (LPB); near Pircayo
river, 14°18'56"S 67°26'34"W, 190 m, 2004, A. Flakus 4174.1, 4195.1 (KRAM, LPB).
Dept. Panpo. Prov. MANnurRIpPI, Reserva Nacional de Vida Silvestre Amazonica
Manuripi, Bajada colony near Chive village, 12°24'03"S 68°26'45"W, 170 m, 2006, A.
Lyromma revised taxonomy and key ... 137
Flakus 5989.3 (KRAM); Puerto Madre de Dios village, 11°27'38"S 67°15'56"W, 166
m, 2006, A. Flakus 6662, 7046 (KRAM, LPB). DEPT. SANTA CRUZ. PRov. GUARAYOS,
Reserva Vida Silvestre Rios Blanco y Negro, Virgen de Pilar near Chonta village,
15°38'54"S 62°57'37"W, 229 m, 2009, A. Flakus 13332, 13491 & P. Rodriguez (KRAM,
LPB); Plan de Manejo AISU, 130 km from Ascencién de Guarayos village, 15°03'35"S
62°45'20"W, 258 m, 2009, A. Flakus 13842.1, 13842.2 & P. Rodriguez (KRAM, LPB); 160
km from Ascencién de Guarayos village near Rio Negro, 14°58'50"S 62°36'19"W, 242 m,
2009, A. Flakus 14021 & P. Rodriguez (herb. Flakus).
ComMENTS — ‘The perithecia of L. palmae are characterized by the erect to
horizontal setae composed of 20-60 clavate hyphae grouped usually into 3-6
brush-shaped appendages, 10-30(-40) um long and (3-)4-7 um broad at the
apex. This distinguishes it from the most similar species, i.e. L. coronatum,
L. ornatum (see also below), and L. pilosum.
The structure of the pycnidia and pycnidial appendages of L. palmae were
variously interpreted before 2008. According to Liicking et al. (1998), the species
was characterized by pycnidia with reduced apical setae, compared to those of,
for example, L. nectandrae or L. dolicobelum. In his subsequent monograph,
Liicking (2008) described L. palmae as having glabrous pycnidia without
appendages. However, the original description and illustration (Cavalcante
et al. 1972: 26, fig. 5), as well as a detailed study of the epitype by Lticking
et al. (1998: 136) established that the species develops small appendages near
the pycnidial apex. The rich collections now available show that L. palmae is
characterized by pycnidia with 20-25 erect usually clavate setae composed of
individual hyphae that are (10-—)20-30(-40) um long, 3-4 um broad at the base,
and (3—)4—6(-7) um broad at the apex (PLATE 2 FE, G). Pycnidia of L. palmae are
somewhat reminiscent of those of L. pilosum but differ in having acicular, horn-
shaped, and strongly recurved appendages (1-3 um broad at the apex).
Lyromma pilosum Liicking, Fl. Neotrop. Monogr. 103: 187. 2008. PLATE 1K; 2H, I, K
Type — Costa Rica. Puntarenas: Monteverde Biological Reserve, 1600-1700 m, Feb
2000, Liicking 00-418 (CR — holotype).
[For a detailed description of the thallus and perithecia, see Licking (2008). ]
PycnipiA elongate barrel-shaped with tapering top, 100-130 um tall and
40-60 um in wide, dark brown, upper part around ostiole furnished with 5-10
setae; SETAE dark brown, acicular, horn-shaped, strongly recurved, septate,
composed of individual hyphae, (10-—)20-30(-40) um long, and 4-5 um broad
(2-3 um broad in apical part); conrp1a (macroconidia) filiform, multiseptate,
40-70 x 0.8-1.2 um.
DISTRIBUTION & ECOLOGY — This species was described from Argentina
and Costa Rica (Liicking 2008). Here we report it from Bolivia and Brazil for
the first time. It grows in northern Argentinean forests, montane forest, lowland
Amazon forest, and Atlantic submontane rainforest.
138 ... Flakus & Farkas
SELECTED SPECIMENS EXAMINED — BOLIVIA. DEPT. PANDO. PRov. MANURIPI, Reserva
Nacional de Vida Silvestre Amazonica Manuripi, Chive village, 12°23'47"S 68°35'28" W,
179 m, 2006, A. Flakus 5900, 5903.2 (KRAM, LPB); Bajada colony near Chive village by
Rio Madre de Dios, 12°24'03"S 68°26'45"W, 170 m, 2006, A. Flakus 5975, 6019.2 (LPB,
herb. Flakus); Prov. NicoLas SUAREZ, near Cobija village, 11°02'16"S 68°45'31"W,
191 m, 2006, A. Flakus 6440 (LPB); Prov. MADRE DE Dios, Reserva Nacional de Vida
Silvestre Amazonica Manuripi, near Puerto Madre de Dios village, near Rio Madre de
Manupare, 11°31'37"S 67°17'29"W, 155 m, 2006, A. Flakus 6719 (KRAM). BRAZIL.
EstapDo SAo PauLo. SAO ROQUE, cascada sobre la Laguna Sapucaia, ca 800 m 1995,
A. Borhidi s.n. (VBI); sobre la Laguna Sapucaia, arriba del camino, ca 850 m, 1995, A.
Borhidi s.n. (VBI).
ComMENTs — Lyromma pilosum was the first species of the genus described as
having short perithecial appendages composed of an individual hypha (Licking
2008). It is most similar to L. multisetulatum and L. palmae, which differ in the
size, shape, and orientation of the perithecial appendages. For more details, see
remarks below those species.
The pycnidia of L. pilosum and L. palmae have similar appendages, each
composed of individual hypha that is 3-5 um broad across the base. Juvenile
pycnidia of both species are smooth (without appendages) and can be
distinguished only in the mature stage. Pycnidia of L. pilosum have 5-10 setae,
which are acicular, strongly recurved, (10—)20-30(-40) um long, and 2-3 um
broad at the apex. In contrast, those of L. palmae produce 20-25 setae, which
are erect, usually clavate, (10—)20-30(-—40) um long, and (3-)4-6(-7) um broad
at the apex.
Key to species of Lyromma based on ascosporic and conidial states
la. Sporocarps perithecia, globose to very short barrel-shaped, usually <100 um high . . .2
1b. Sporocarps pycnidia, elongate barrel-shaped, usually >100 um high............. 8
2a (la). Perithecial appendages (5-)10-30(-60), setose (strongly recurved) to brush-
shaped (erect to horizontal), each composed of individual hypha (sometimes
faintly agglutinated at the base), (5—)10-30(-40) um long and 3-5 um broad
at the base) or almost reduced, forming a crown ................ esse ee eee 5
2b. Perithecial appendages 2-6, horn-shaped or triangular to irregularly lobate,
horizontal to recurved, composed of agglutinated hyphae (sometimes deeply
divided at the apex), 15—200(-300) tum long and 7-30 um broad (at the base) . . . .6
3a (2a). Perithecial appendages reduced, forming a crown, composed of individual
clavate hypha, 5-7(-12) um long and (4—)5-7 um broad
Ci dita ho 4 ce eae en a ee TO enn Te Co Oa toe COR en eo L. coronatum
3b. Perithecial appendages larger, strongly recurved, setose 10-50(-60) um long or
erect to horizontal, composed of 20-60 individual hyphae usually grouped
into 3-6 brush-shaped appendages, 10-30(-40) um long.................... 4
Lyromma revised taxonomy and key ... 139
4a (3b). Perithecial appendages erect to horizontal, composed of 20-60 clavate
hyphae usually grouped into 3-6 brush-shaped appendages (then faintly
agglutinated at the bases), 10-30(-40) um long and (3-)4—7 um broad
bal CHOP OK) tanh snags Mostra N nan eN cal haan hN cwky Carl cot 0) cu cea Wes an L. palmae
4b. Perithecial appendages (5-)10-30(-40) strongly recurved setae composed
of acicular hyphae, 10-50(-60) um long and 2-3 um broad (at the apex)....... 5
5a (4b). Perithecial appendages (5—) 10-15 setae, 10-30(-40) um long ..... L. pilosum
5b. Perithecial appendages (10-)15-30(-40) setae, 30-50(-60) um long
Dice ys alone Sle New salle NeW tells bens olloa bi alls basllbs ns ala basa L. multisetulatum
6a (2b). Perithecial appendages 3-6, triangular to irregularly lobate (sometimes
deeply multi-furcated on the apex), horizontal to rarely slightly recurved,
15-30(-40) um long and 7-15(-20) um broad (at the base) ......... L. ornatum
6b. Perithecial appendages 2-5, cylindrical to irregular, horn-shaped (sometimes
2-3-furcate on the ends), recurved or rarely almost horizontal, 30-200 um
long-and:10225; une broad: Gat the: Dase yy a. ih thie od oie hk g og Ow ae aha ele 7
7a (6b). Perithecial appendages 3-5; 30-70 um long, simple to 2-3-furcate
OMIGEI CMA POX ay cin yk a eee eg didte peg AiO eg: d aber G4 ager PQ abrt-Fo Ober Ss artes L. nectandrae
7b. Perithecial appendages 2-3(—4); 60-200(-300) um long ........... L. dolicobelum
8a (1b). Pycnidia glabrous (when young) or with 5-30 appendages composed of
mdividual- hyphaey3—o- umn broad (atthe base): sss B, stowa at ona Move Bae ava kav 9
8b. Pycnidia with 2-5 appendages composed of agglutinated hyphae,
LO 2 Onin DOA Abate ASO pr wath cm crete ore see ann cos ee owe el entwa sce ciewe ate 11
9a (8a). Appendages 20-25, clavate, erect to almost vertical, (10—)20-30(-40)
uum long and (3—)4-6(-7) um broad (at the apex)................0.. L. palmae
9b. Appendages acicular, horn-shaped, strongly recurved, 1-3 um broad
CAE TTS ARO aes esg Psat od eal s of tose gg amas ersten eM eae RRS ee ae oa, teh EG ate 10
10a (9b). Appendages 5-10, (10—)20-30(-40) um long; macroconidia
filiform, multiseptate, 40-60 x 0.8-1.2 um.... eee eee eee L. pilosum
10b. Appendages 15-30, (20-)30-50(-60) um long; microconidia bacilliform,
THONESe Prater? =a J liis). brea es tesla tase Neusat Ne cae L. multisetulatum
lla (8b). Appendages (2-)3-5, simple to 2—-4-furcate on the ends,
cylindrical to irregular, 30-60(-100) um long and 10-20 um
broad (at the base) ... 0.0.0... cc cece ce eee ee L. nectandrae or L. ornatum
11b. Appendages 2(-3), simple, cylindrical, 200-400 um long and 10-20 um
broad: (atthe bases aby. s dics.eg diou.e z dinsee a diners o dineee a drosee s deed L. dolicobelum
Discussion
During the current study, we discovered undescribed ascosporic states for
Lyromma dolicobelum and L. palmae and conidial states for L. ornatum and
L. pilosum. For the first time in these species both perithecia and pycnidia were
observed associated on the same thallus under natural conditions. A conidial-
140 ... Flakus & Farkas
ascosporic connection for Lyromma nectandrae suggests that L. confusum
should be treated as a synonym of that species. Additionally, two new species
of the genus, Lyromma coronatum and L. multisetulatum, were discovered in
material from Bolivia and Brazil.
Since all Lyromma taxa have very similar thalli, their relationships have
been based on the morphology and anatomy of their sporocarps, with the
most useful characters provided by the variable appendages produced near
the ostiole both in the ascosporic and the conidial states. From our taxonomic
revision of additional, recently collected material, we propose a new concept
of the conidial-ascosporic relationships in this foliicolous genus. Despite the
many differences between perithecia and pycnidia noted by Liicking (2008),
our results show similarities between appendage types that connect ascosporic
and conidial states for each species.
Our hypothesis on the generic circumscription, which is probably temporary
due to the still limited knowledge on this overlooked genus, can be expected to
evolve as new collections and/or molecular sequence data becomes available.
The size of these organisms (with a mean thallus diameter normally <5 mm,
and sporulating structures around 100 um high) also limits further studies. We
hope, however, that our revised key to Lyromma species using both perithecial
and pycnidial characters will encourage further research into this fascinating
foliicolous lichenized genus.
Acknowledgments
We are very grateful to Prof. David Hawksworth (London), Dr. Robert Liicking
(Chicago), and Dr. Shaun Pennycook (Auckland) for reviewing the manuscript, and
for valuable and constructive comments on previous versions of this paper. Mr. Ken
Hudson (Egham) and Dr. David Minter (Egham) are thanked for clarifying bibliographic
problems concerning to cited publications. We are also greatly indebted Prof. Klaus Kalb
(Neumarkt) and Prof. Emmanuél Sérusiaux (Liege) for loan of the type material for
study, Dr. Martin Kukwa (Gdansk) for valuable comments, as well as to Rosa I. Meneses
Q., the Director of Herbario Nacional de Bolivia, Universidad Mayor de San Andrés, La
Paz for generous cooperation. This research received support from the NCN in Poland
for the years 2008-2011 (no. N N303 345335), the NCBiR in Poland under the LIDER
Programme for the years 2010-2013 (no. 92/L-1/09), the W. Szafer Institute of Botany
of the Polish Academy of Sciences through the program supporting research of young
scientists, and the Hungarian Scientific Research Fund (OTKA K81232).
Literature cited
Aptroot A, Diederich P, Sérusiaux E, Sipman HJM. 1997. Lichens and lichenicolous fungi from
New Guinea. Biblioth. Lichenol. 64: 1-220.
Batista AC, Maia HS. 1965. Alguns novos géneros de liquens imperfeitos assinalados no IMUR.
Atas Inst. Micol. Univ. Fed. Pernambuco 2: 351-373.
Lyromma revised taxonomy and key ... 141
Cavalcante WA, Cavalcante AASAS, Leal FB. 1972. Coletanea de liquens imperfeitos. Publ. Inst.
Micol. Univ. Fed. Pernambuco 647: 1-46.
Ferraro LI, Liicking R. 2000. Adiciones a la flora liquénica foliicola de Argentina, Paraguay Oriental
y regiones limitrofes de Brasil. Trop. Bryol. 19: 59-72.
Flakus A. 2009. Aspidothelium lueckingii: a new lichenized fungus from Bolivia. Nova Hedwigia 88:
139-143. http://dx.doi.org/10.1127/0029-5035/2009/0088-0139
Flakus A, Kukwa M. 2012. New species of lichenicolous fungi from Bolivia. Lichenologist 44:
469-477. http://dx.doi.org/10.1017/S0024282912000059
Flakus A, Liicking R. 2008. New species and additional records of foliicolous lichenized fungi from
Bolivia. Lichenologist 40: 423-436. http://dx.doi.org/10.1017/S0024282908007378
Flakus A, Wilk K. 2006. Contribution to the knowledge of the lichen biota of Bolivia. J. Hattori Bot.
Lab. 99: 307-318.
Flakus A, Ahti T, Kukwa M, Wilk K. 2008. New and interesting records of Cladonia and their
lichenicolous fungi from the Andean cloud forest in Bolivia. Ann. Bot. Fenn. 45: 448-454.
Flakus A, Rodriguez Saavedra P, Kukwa M. 2012. A new species and new combinations and
records of Hypotrachyna and Remototrachyna from Bolivia. Mycotaxon 119: 157-166.
http://dx.doi.org/10.5248/119.157
Herrera-Campos MA, Liicking R, Pérez R-E, Campos A, Colin PM, Pefia AB. 2004. The foliicolous
lichen flora of Mexico. V. Biogeographical affinities, altitudinal preferences, and an updated
checklist of 293 species. Lichenologist 36: 309-327.
http://dx.doi.org/10.1017/S0024282904014483
Knudsen K, Flakus A. 2009. Acarospora ramosa (Acarosporaceae), a new effigurate yellow species
from South America. Nova Hedwigia 89(3-4): 349-352.
http://dx.doi.org/10.1127/0029-5035/2009/0089-0349
Kukwa M, Flakus A. 2009. Lepraria glaucosorediata sp. nov. (Stereocaulaceae, lichenized
Ascomycota) and other interesting records of Lepraria. Mycotaxon 108: 353-364.
http://dx.doi.org/10.5248/108.353
Kukwa M, Etayo J, Flakus A. 2012. Plectocarpon stereocaulicola: a new _ lichenicolous
fungus (Ascomycota: Roccellaceae) from Bolivia. Lichenologist 44(4): 479-482.
http://dx.doi.org/10.1017/S0024282912000151
Licking R. 1992. Foliicolous lichens - a contribution to the knowledge of the lichen flora of Costa
Rica, Central America. Beih. Nova Hedwigia 104: 1-179.
Liicking R. 2008. Foliicolous lichenized fungi. Fl. Neotrop. Monogr.103: 1-866.
Liicking R, Kalb K. 2000. Foliikole Flechten aus Brasilien (vornehmlich Amazonien), inklusive
einer Checkliste und Bemerkungen zu Coenogonium und Dimerella (Gyalectaceae). Bot. Jahrb.
Syst. 122: 1-61.
Licking R, Sérusiaux E, Maia LC, Pereira CG. 1998. A revision of the names of foliicolous lichenized
fungi published by Batista and co-workers between 1960 and 1975. Lichenologist 30: 121-191.
http://dx.doi.org/10.1017/S0024282992000124
Matzer M. 1996. Lichenicolous ascomycetes with fissitunicate asci on foliicolous lichens. Mycol.
Pap. 171: i-x, 1-202.
Sipman HJM. 1997. Observations on the foliicolous lichen and bryophyte flora in the canopy of a
semi-deciduous tropical forest. Abstracta Botanica 21: 153-161.
Upadhyay HBP. 1964. Three new hyperparasites for Mazosia phyllosema (Nyl.) A. Zahlbr. from
Amazonas Valley. Publ. Inst. Micol. Univ. Fed. Pernambuco 402: 1-11.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/124.143
Volume 124, pp. 143-148 April-June 2013
Scolecobeltrania,
an interesting new microfungus from Venezuela
TERESA ITURRIAGA', ROBERTO FERNANDEZ’, RAFAEL F. CASTANEDA-RUIZ?,
Davip W. MINTER* & ALISSON CARDOSO RODRIGUES DA CRUZ>*
"Departamento de Biologia de Organismos, Universidad Simon Bolivar,
Apartado 89000 Sartenejas, Baruta, Edo Miranda, Venezuela
?Instituto de Investigaciones Fundamentales en Agricultura Tropical ‘Alejandro de Humboldt’
(INIFAT), Académico Titular de la Academia de Ciencias de Cuba,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P. 17200
‘CABI,Bakeham Lane, Egham, Surrey, TW20 9TY, United Kingdom
°Departamento de Ciéncias Biolégicas, Laboratorio de Micologia, Universidade Estadual
de Feira de Santana, BR116 KMO3, 44031-460, Feira de Santana, Brazil
*CORRESPONDENCE TO: [email protected]
ABSTRACT — A new microfungus collected on dead plant material from the “Cerro El Avila”
mountain range and “Parque Nacional Canaima’ tropical forest in Venezuela is described and
illustrated. Scolecobeltrania vermispora gen. & sp. nov. is characterized by macronematous
branched conidiophores, polyblastic conidiogenous cells, and unicellular vermiform to
sigmoid pale brown conidia with up to 11 hyaline transverse bands.
KEY worpDs — anamorphic fungi, systematics, leaf litter
Introduction
During two mycological surveys of anamorphic fungi in the cloud and
tropical forests in Venezuela, we collected an interesting conspicuous fungus.
It has some characters that are present in Beltrania and some allied genera,
but the conidia differ morphologically from those in all previously described
anamorphic genera of this group. We propose a new genus to accommodate
this new fungus described here.
Plant samples were placed in paper and plastic bags, taken to the laboratory,
and treated according to Castafieda (2005). Mounts of fungal material were
prepared in polyvinyl alcohol-glycerol (8 g in 100 ml of water, plus 5 ml of
glycerol) and diagnostic characters were measured at x1000. Micrographs were
obtained with a Zeiss Axioskop 40.
144 ... Iturriaga & al.
Taxonomy
Scolecobeltrania Iturr., R.F. Castafieda & Rob. Fernandez, gen. nov.
MycoBank MB801469
Differs from Beltraniella by polyfasciate scolecoconidia and from Pseudobeltrania by
setae intermixed with conidiophores and polyfasciate scolecoconidia.
TyPE SPECIES: Scolecobeltrania vermispora Iturr. et al.
Erymotoey: from Scoleco-, referring to conidia with a length/width radio >15:1 +
beltrania, name of a similar anamorphic fungal genus.
CoLoniegs on the natural substratum amphigenous, effuse, coalescent, felted
to compact floccose, forming conspicuous patches, brown to olivaceous or
black. Mycelium superficial and immersed. SETAE erect, straight or sinuate,
septate with or without radially lobed basal cell, smooth or verruculose,
brown. CONIDIOPHORES macronematous, mononematous, erect, branched,
septate, brown to olivaceous, smooth or verruculose. CONIDIOGENOUS CELLS
monoblastic and polyblastic, discrete, determinate or indeterminate, with
holoblastic sympodial proliferations. Conidial secession schizolytic. CONIDIA
scolecosporous, solitary, unicellular, sigmoid, vermiform to long cylindrical,
curved or sinuate, brown to olivaceous, always with several hyaline or subhyaline
transverse bands, smooth or verruculose. Teleomorph unknown.
Scolecobeltrania vermispora Iturr., R.F. Castafieda & Rob. Fernandez, sp. nov.
Figs. 1 -2
MycoBank MB801470
Differs from Beltraniella spp. in its polyfasciate scolecoconidia and from Pseudobeltrania
spp. in its multiseptate setae intermixed with conidiophores and multifasciate
scolecoconidia.
Type: Venezuela, Bolivar State, tropical forest, Luepa, Sector Gran Sabana, Parque
Nacional Canaima, 5°50'N 61°27'W, 880-1250 m alt., on decaying leaves of unidentified
plant, 25.IV.2005, coll. Teresa Iturriaga (Holotype: VEN108367).
ErymMo_oey: Latin, vermispora, referring to worm-shaped conidia.
CoLoniEs on the natural substrate, effuse, felted forming extensive parches, often
coalescence, olivaceous-brown. Mycelium mostly superficial and immersed.
Hyphae septate, 2-4 um diam, profusely branched, densely anastomoses,
sometimes forming a rudimentary stroma with somewhat similar “textura
intricata’, smooth, brown to pale brown. SETAE erect, straight or curved to
sinuate, cylindrical, acerose or lanceolate at the apex, 7-12-septate, 150-250
uum tall, 10-15 um diam. at the radially lobed base, smooth, dark brown below,
brown towards the apex. CONIDIOPHORES macronematous, mononematous,
erect, dichotomous, trichotomous or irregularly branched, forming more or
less a cluster at the high level, arising from superficial hyphae, 20-35 x 10-12
um, smooth, pale brown to pale olivaceous-brown. CONIDIOGENOUS CELLS
Scolecobeltrania vermispora gen. & sp. nov. (Venezuela) ... 145
Fic. 1. Scolecobeltrania vermispora (ex holotype VEN108367).
A-B. Conidia. C. Seta. D. Conidiophores and conidiogenous cells.
Scale bars: A~B, D = 10 um, C=25um.
146 ... Iturriaga & al.
Fic. 2. Scolecobeltrania vermispora (ex holotype VEN108367).
A. Conidia. B. Conidiophore and conidiogenous cells. C. Seta.
Scale bars: A~B = 10 um, C= 25 um.
polyblastic, discrete, cylindrical, but slightly attenuate near the apex, denticulate
with conspicuous denticles, somewhat opaque at the conidiogenous loci,
indeterminate, with several sympodial proliferations, 8-12 x 3-3.5 um, pale
brown. Conip1a solitary, vermiform, sigmoid, attenuate and truncate at the
base, obtuse to rounded at the apex unicellular, 40-65 x5.5-8.5 um, smooth,
dry, fasciate, pale brown to pale olivaceous brown, with (2-)5-11 transverse
hyaline bands across the length of conidial body. Teleomorph unknown.
Scolecobeltrania vermispora gen. & sp. nov. (Venezuela) ... 147
ADDITIONAL SPECIMEN EXAMINED: VENEZUELA, Caracas, “Cerro El Avila’, Parque
Nacional El Avila, 10°33'N 66°51'W, on decaying leaves of Clusia hilariana Schltdl,
20.11.2008, coll. R Fernandez INIFAT 2461.
NoTE: Seifert et al (2011) have provided a key, descriptions, and illustrations of
Beltrania and similar anamorphic genera. Among these fungi the conidiophores
and conidiogenous cells of Beltraniella Subram. and Pseudobeltrania Henn.
are morphologically similar to Scolecobeltrania. Several Beltraniella species
have irregular branched conidiophores with branches arising near the bases
of straight thick-walled dark brown setae; similar conidiophores also occur in
Pseudobeltrania, but it lacks setae. The conidia in Beltraniella are unicellular,
turbinate, and oblageniform (or nearly so) with a hyaline transverse band
frequently arising from separating cells or from conidiogenous loci (Pirozynski
1963, Castafieda Ruiz et al. 1996, Kendrick 2003, Seifert et al. 2011), and
Beltraniella species with supra-equatorial subhyaline or hyaline (pore-like)
spots have recently been segregated into the genus Porobeltraniella (Gusmao
2004). Pseudobeltrania has unicellular biconical olivaceous brown conidia
with a transverse hyaline band near the widest part arising directly from
conidiogenous loci (Heredia et al. 2002). Scolecoconidia with several transverse
hyaline bands originating directly from conidiogenous loci are conspicuous
unique characters that clearly separate Scolecobeltrania from the other genera.
Acknowledgments
The authors express their sincere gratitude to Dr. Xiu-Guo Zhang and Dr. De-Wei
Li for their critical review of the manuscript. The authors are very grateful to Fondo
Nacional de Ciencia, Tecnologia e Innovacion (Fonacit, Venezuela) for funding Project
.N° $1-2001000663 “Sistematica Molecular y Morfoldgica de Hongos Ascomycetes y
Basidiomycetes Presentes en las Sucesiones Fungicas Descomponedoras de Madera en
Bosques Tropicales”; to the Cuban Ministry of Agriculture for facilities. Collecting in
Venezuela has been possible through permits obtained from INPARQUES-0721 and
MARNR- 1-096, institutions to whom we are indebted. The authors thank Drs Uwe Braun,
Pedro Crous, De-Wei Li, and Gregorio Delgado for their generous and valued assistance
with literature not otherwise available. We thank Beatriz Ramos and Aliana Sosa for
technical assistance. We also acknowledge the facility provided by Dr P.M. Kirk and
Drs V. Robert and G. Stegehuis through the Index Fungorum and Mycobank websites.
Dr Lorelei L. Norvell’s editorial review and Dr Shaun Pennycook’s nomenclature review
are greatly appreciated.
Literature cited
Castafieda Ruiz RF. 2005. Metodologia en el estudio de los hongos anamorfos. Anais do V
Congresso Latino Americano de Micologia. Brasilia: 182-183.
Castafieda Ruiz RE, Guarro J, Cano J. 1996. Notes on conidial fungi VII. Two new species of
Beltraniella from Cuba. Mycotaxon 58: 243-251.
Gusmao LFP. 2004. Porobeltraniella gen. nov. to accommodate two species of Beltraniella. Mycologia
96(1): 150-153. http://dx.doi.org/10.2307/3761996
148 ... Iturriaga & al.
Heredia G, Arias RM, Reyes M, Castafieda-Ruiz RE. 2002. New anamorph fungi with rhombic
conidia from Mexican tropical forest litter. Fungal Diversity 11: 99-107.
Kendrick B. 2003. Analysis of morphogenesis in hyphomycetes: new characters derived from
considering some conidiophores and conidia as condensed hyphal systems. Can. J. Bot. 81(2):
75-100. http://dx.doi.org/10.1139/b03-008
Pirozynski, KA. 1963. Beltrania and related genera. Mycological Papers 90: 1-37.
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9: 1-997. http://dx.doi.org/10.3767/003158511X617435
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.149
Volume 124, pp. 149-154 April-June 2013
A new species of Pisolithus from Spain
Maria P. MarRTIN*?, FATIMA DURAN’,
CHERDCHAI PHOSRI? & ROY WATLING?
‘Dept. Micologia, Real Jardin Botanico. CSIC, Plaza de Murillo 2, 28014 Madrid, Spain
’ Biology programme, Pibulsongkram Rajabhat University, Phitsanulok, 65000, Thailand
>Caledonian Mycological Enterprises, Edinburgh EH 4 3 HU, Scotland UK
CORRESPONDENCE TO *: [email protected]
AsstRACT — Pisolithus calongei is described as a new species based on our morphological
observations and comparison of ITS nrDNA sequences.
Key worps — Basidiomycota, Cistus, Boletales, taxonomy, Pisolithus tinctorius
Introduction
During their overview of the donkey dung fungus (Pisolithus Alb. & Schwein.)
from many regions of the world using molecular and classical methods, Phosri
et al. (2012) analysed collections from Europe. All generated molecular trees
grouped Spanish specimens into three clades, of which two represent the classic
Pisolithus tinctorius (Pers.) Coker & Couch and P. arhizus (Scop.) Rauschert.
However, four sequences obtained from Pisolithus specimens associated with
Cistus ladanifer L. (Cistaceae) formed a separate group more closely related to
P. marmoratus (Berk.) E. Fisch. (occurring in Eucalyptus spp. plantations from
Australia, China, and Kenya) than to other Spanish specimens.
Cistaceae is well documented as an ectomycorrhizal phanerogam
family (Harley & Harley 1987), although many species also form VA and
ectendomycorrhizas. Association-forming species are widespread amongst
the larger fungi, e.g. Leccinum arenicola Watling & Redhead, found in North
America with Hudsonia L. (Redhead & Watling 1979), and Terfezia alsheikhii
Kovacs et al., found in Spain with Helianthemum Mill. (Kovacs et al. 2011).
In Europe a number of fungi associate with Helianthemum, including Boletus
spp. (Agueda et al. 2006, 2008; Ponce et al. 2011), Laccaria laccata (Scop.)
Cooke (Torres et al. 1995), and Cortinarius spp. and Hebeloma spp. (Watling
1988; Moreau 2002; Henrici 2003, 2005). Even Astraeus hygrometricus (Pers.)
150 ... Martin & al.
Morgan, a close relative of Pisolithus, has been associated with Cistus in Spain
(Martin 1988, specimens in BCN; M. Jeppson personal collection with duplicate
specimens in E).
Recently, three Pisolithus specimens were collected near Cistus ladanifer
in Spain. Phylogenetic analyses performed according to Phosri et al. (2012)
separated the specimens into two distinctive taxa (Fic. 1): one collection
(MA-Fungi 47734 (duplicates at BH & E): J.C. Campos & E. Ramirez MPM
3320 collectors near El Robledillo, 435-465 m alt. on 4-Dec-2010; GenBank:
HE578142) grouped in the ‘tinctorius’ clade and the other two collections (MA-
Fungi 47732, MA-Fungi 47733) grouped in the “Pisolithus species 3” subclade
from Spain together with sequences AF228641-AF228644 (Diez et al. 2001)
from specimens from Alcala de Henares Univ. Herbarium (AH) and FR748140/
FR748142 (Phosri et al. 2012) from the MJ6192 collection (M. Jeppson personal
herbarium) revised here.
MA-Fungi 47734
P. albus complex
86
56
99 64
88 ——] Pisolithus sp. 8
7 MA-Fungi 47732
ae
83 ; MA-Fungi 47733
99
100
P. abditu.
<—] Pisolithus sp. 1
100 5 P. aurantioscabrosus
indicus
Outgroup
20
Fic. 1. Pisolithus calongei and other Pisolithus spp. One of the 100 most parsimony trees obtained
under heuristic search (PAUP* 4.0b10) using the sequences included in Phosri et al. (2012) and
three newly generated sequences from our Pisolithus collections from Spain. The parsimony
bootstrap values (%) are indicated on the branches. Bar = 20 changes.
Pisolithus calongei sp. nov. (Spain) ... 151
Identification of microscopic features distinctive to MA-Fungi 47732 and
MA-Fungi 47733 associated with C. ladanifer further support our belief that
the specimens represent a new species, which we describe here.
Fic. 2. Pisolithus calongei. a~-b (MA-Fungi 47732): Turbinate gastrocarp. c-d (Holotype, MA-Fungi
47733): Basidiospores (SEM) coarsely ornamented by broad connate structures that form irregular
pyramid-like spines. Scale bars: a = 1 cm; b = 0.5 cm; c-d = 1 um.
Taxonomy
Pisolithus calongei M.P. Martin, Phosri & Watling, sp. nov. Fics 2-3
MycoBANnk MB 563437
Differs from Pisolithus tinctorius and P. arhizus by its turbinate habit and from all
Pisolithus spp. in its ITS nrDNA sequence.
Type: Spain. Avila: Candeleda, Las Atalayas, 30TU-00477, 355 m alt., close to Cistus
ladanifer, 11-Dec-2010, leg. E. Ramirez & J. C. Campos MPM 3319 (Holotype, MA-
Fungi 47733; isotypes, BH, E; GenBank, HE578141).
EryMoLoGcy: Honouring Francisco D. Calonge, who has worked so diligently on the
Iberian gasteromycete flora.
GASTROCARP turbinate, pulvinate, 32-40 mm broad, 28-45 mm high, with
shortened stipe 6-14 x 10-13 mm, with abrupt base, + attached to soil mass,
main primary peridial layer 15-24 mm deep. PERIDIUM irregular, at most 0.5
152... Martin &al.
Fig. 3. Pisolithus calongei (M. Jeppson MJ6192). Turbinate gastrocarp.
mm thick, but soon thinning to show outline of peridioles below, even stretching
to accommodate complete peridioles, finally disintegrating and leaving small
islands of original ferruginous peridium above yellow-ochre peridiole surfaces
or bruising to form lacquer-like blackened smudges. PERIDIOLES 1-1.5 mm
diam. (rarely <2 mm), ochraceous yellow at first, later ferruginous brown,
compressed in uppermost part, often forming in stipe apex or even developing
within the entire stipe to produce irregular rugulose outer surface on the stipe,
concolorous with and non-differentiated from the peridial surface; upper
peridium finally eroding away to expose the disintegrating peridioles as a dry
ferruginous powdery mass. BasipD1osPoREs globose 8.6-11 um diam., coarsely
ornamented with broadly connate structures that form irregular pyramid-like
spines, 1.5 um high, rarely collapsing to give broader structures.
ADDITIONAL SPECIMENS EXAMINED: SPAIN. Avia: Candeleda, Las Atalayas, 30TU-
00477, 350 m alt., close to Cistus ladanifer, 4-Dec-2010, leg. E. Ramirez & J. C. Campos
MPM3318 (MA-Fungi 47732; duplicate, BH; GenBank, HE578140). Huetva: Las
Palmas, 1-Jan-2003, leg. M. Jeppson MJ6192 (M. Jeppson personal herbarium).
Pisolithus calongei is distinctive in the field in its turbinate habit, close fruiting
to the soil-surface and therefore being concealed by the Cistus with which
it is thought to associate. The collectors observed no Pinus species in the
vicinity. The new species may have been overlooked in the past or identified
as P. arhizus or P. tinctorius. Nonetheless, the ITS nrDNA sequence analysis
(Fic. 1) clearly separates P calongei from the other three European species
Pisolithus calongei sp. nov. (Spain) ... 153
(P. arhizus, P. capsulifer (Sowerby) Watling et al., and P. tinctorius), as well as
from the other species previously analyzed: P. albus complex, P abditus Kanch. et
al., P aurantioscabrosus Watling, P indicus Natarajan & Senthil., P marmoratus
(Berk.) E. Fisch., PR microcarpus (Cooke & Massee) G. Cunn., and P orientalis
Watling et al. (Watling et al. 1995, Martin et al. 2002, Kanchanaprayudh et al.
2003a,b, Moyersoen et al. 2003, Reddy et al. 2005, Phosri et al. 2012).
Acknowledgments
We thank M. Jeppson (Sweden) and A.J.S. Whalley (John Moores University, Liverpool)
for presubmission review. Thanks to E. Ramirez, J.C. Campos, and J.C. Zamora for
providing the specimens included in this study, to J. Jeppson for permission to reproduce
Fic. 3 (specimen M. Jeppson MJ6192), and to Y. Ruiz for her technical assistance with
the SEM pictures of the holotype. This work was supported in part by project REN2001-
1842/GLO.
Literature cited
Agueda B, Parladé J, De Miguel AM, Martinez-Pefia F. 2006. Characterization and identification
of field ectomycorrhizae of Boletus edulis and Cistus ladanifer. Mycologia 98(1): 23-30.
http://dx.doi.org/10.3852/mycologia.98.1.23
Agueda B, Parladé J, Fernandez-Toiran LM, Cisneros O, De Miguel AM, Modrego MP, Martinez-
Pefia F, Pera J. 2008. Mycorrhizal synthesis between Boletus edulis species complex and rockroses
(Cistus sp.). Mycorrhiza 18(8): 443-449. http://dx.doi.org/10.1007/s00572-00
Diez J, Anta B, Manjon JL, Honrubia M. 2001. Genetic variability in Pisolithus isolates associated
with native hosts and exotic eucalyptus in the western Mediterranean region. New Phytol.
149(3): 577-587.
Harley JL, Harley EL. 1987. A check-list of mycorrhiza in the British flora. New Phytologist 105(2):
1-102. http://dx.doi.org/10.1111/j.1469-8137.1987.tb00674.
Henrici A. 2003. Notes and records. Field Mycology 4: 30-31.
Henrici A. 2005. Notes and records. Field Mycology 11: 141-143.
Kanchanaprayudh J, Zhou Z, Yomyart S,. Sihanonth P, Hogetsu T, Watling R. 2003a. A new species,
Pisolithus abditus, an ectomycorrhizal fungus associated with dipterocarps in Thailand.
Mycotaxon 88: 463-467.
Kanchanaprayudh J, Zhou Z, Yomyart S, Sihanonth P, Hogetsu T. 2003b. Molecular phylogeny of
ectomycorrhizal Pisolithus fungi associated with pine, Dipterocarp, and Eucalyptus trees in
Thailand. Mycoscience 44: 287-294. http://dx.doi.org/10.1007/s10267-003-0110-7
Kovacs GM, Balazs TK, Calonge FD, Martin MP. 2011. The diversity of Terfezia desert truffles: new
species and a highly variable species complex with intrasporocarpic nrDNA ITS heterogeneity.
Mycologia 103(4): 841-853. http://dx.doi.org/10.3852/10-312.
Martin MP. 1988. Aportacién al conocimiento de las Higroforaceas y los gasteromicetes de
Catalufia. Edicions Especial Societat Catalana de Micologia. Volum 2. 508 p.
Martin F, Diez J, Dell B, Delaruelle C. 2002. Phylogeography of the ectomycorrhizal Pisolithus
species as inferred from nuclear ribosomal DNA ITS sequences. New Phytologist. 153:
345-357. http://dx.doi.org/10.1046/j.0028-646X.2001.00313.x
Moreau P-A. 2002. A la découverte des champignons de zone alpine (numero special). Bulletin
mycologique et botanique Dauphiné-Savoie 167: 5-42.
154 ... Martin & al.
Moyersoen B, Beever RE, Martin F 2003. Genetic diversity of Pisolithus in New Zealand
indicates multiple long-distance dispersal from Australia. New Phytologist. 160(3): 569-579.
http://dx.doi.org/10.1046/j.1469-8137.2003.00908.x
Phosri C, Martin MP, Suwannasai N, Sihanonth P, Watling R. 2012. A new species from SE Asia and
a new combination in Pisolithus. Mycotaxon 120: 195-208. http://dx.doi.org/10.5248/120.195.
Ponce RA, Agueda B, Agreda T, Modrego MP, Aldea J, Fernandez-Toiran LM, Martinez-Pefa F 2011.
Rockroses and Boletus edulis ectomycorrhizal association: realized niche and climatic suitability
in Spain. Fungal Ecology 4(3): 224-232. http://dx.doi.org/10.1016/j.funeco.2010.10.002
Rambaut A. 2002. Se-al: sequences alignment editor v2.0al1. Edinburgh: Inst. Evolutionary
Biology, University of Edinburgh. http://tree.bio.ed.ac.uk/software/
Reddy MS, Singla S, Natarajan K, Senthilarasu G. 2005. Pisolithus indicus, a new species of
ectomycorrhizal fungus associated with Dipterocarps in India. Mycologia 97(4): 838-843.
http://dx.doi.org/10.3852/mycologia.97.4.838
Redhead S, Watling R. 1979. A new psammophilic Leccinum. Canadian Journal of Botany 57:
117-119.
Torres P, Roldan A, Lansac AR, Martin A. 1995. Ectomycorrhizal formation between Cistus
ladanifer and Laccaria laccata. Nova Hedwigia 60(1-2): 311-315.
Watling R. 1988. A mycological kaleidoscope. Transactions of the British Mycological Society.
90(1): 1-28.
Watling R, Taylor A, See LS, Sims K, Alexander I. 1995. A rainforest Pisolithus; its taxonomy and
ecology. Nova Hedwigia 61(3-4): 147-149.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.155
Volume 124, pp. 155-163 April-June 2013
A reassessment of excavated Tuber species from China
based on morphology and ITS rDNA sequence data
Li FAN’, JIN-ZHONG CAO? & Yu LY?’
" College of Life Science, Capital Normal University,
Xisanhuanbeilu 105, Haidian, Beijing 100048, China
? Institute of Mycology, Jilin Agricultural University, Changchun 130118, China
CORRESPONDENCE TO *: [email protected]
ABSTRACT — A composite study was made of the morphology and phylogeny of Chinese
Tuber species that produce ascomata with a cavity at the base (excavated ascomata). One
new species, T: neoexcavatum, was found and is here described. It is characterized by brown
ascomata with distinctly verrucose surface and prosenchymatous peridium. The presence of
T: excavatum in China is still in doubt. A key is provided for all excavated species of Tuber.
Key worps — Ascomycota, molecular analysis, taxonomy, truffle
Introduction
Species of Tuber that produce distinct cavities at the base of ascomata are
often referred to as ‘excavated species. The ascomal surface within the cavity of
such species differs considerably from the surface covering the outer ascomata
(Cao 2010). For example, T. pseudohimalayense (= T: pseudoexcavatum)
produces larger pyramidal warts inside the cavities but smaller ones outside
the cavities, even forming a distinct area with the same large pyramidal
warts in some abnormal ascomata that lack cavities. The only exception is
T: mesentericum Vittad., in which pyramidal warts completely cover the ascomal
surface (Riousset et al. 2001).
Occasionally other Tuber species (e.g., T: nitidum Vittad. and T. taiyuanense
B. Liu in the Rufum group; T. liyuanum L. Fan & J.Z. Cao in the Puberulum
group) produce an umbilicus or a distinct pit at the base of an ascoma, giving
them the appearance of an excavated species. However, these Tuber species
could never be mistaken for excavated species, because there is no clear
difference between the cavity interior and exterior inside and a cavity is not
consistently present within all ascomata in the collection.
156 ... Fan, Cao & Li
Tuber species with true cavities were first described by Vittadini in 1831
(T. excavatum and T. mesentericum) and Quélet in 1880 (T. fulgens). Two Chinese
species — T. pseudoexcavatum (Wang et al. 1998) and T. sinoexcavatum (Fan et
al. 2011) — also produce ascomata with cavities. During intensive investigation
of the Chinese Tuber species with excavated ascomata, the authors found a new
excavated species. Here we describe the new species, discuss all three Chinese
excavated species, and reassess their taxonomic status.
Materials & methods
Morphological studies
Fresh specimens of the new species described here were collected from Baoshan City,
Yunnan Province, P.R. China and deposited in BJTC (Herbarium Biology Department,
Capital Normal University in Beijing). The dried specimens were deposited in BJTC and
HKAS (Herbarium of Cryptogams, Kunming Institute of Botany, Chinese Academy of
Sciences). Macro- and microscopic characters were described from fresh specimens and
rehydrated specimens. Sections were made witha razor blade and mounted in 3% KOH
for observation. Specimens were dried for archival purposes, and permanent slides were
prepared by staining in Melzer’s reagent, rinsing in water and mounting in polyvinyl
lactic glycerol. For scanning electron microscopy (SEM), ascospores were scraped from
fresh or dried gleba onto doubled-sided tape mounted directly on an SEM stub, coated
with gold—palladium, and examined and photographed with a Hitachi S—4800 SEM.
Molecular methods
Samples from herbarium material were crushed by shaking for 3 min at 30 Hz
(Mixer Mill MM 301, Retsch, Haan, Germany) in a 1.5 ml tube together with one 3
mm diameter tungsten carbide ball. Total genomic DNA was then extracted using
the PeqLabE.Z.N.A._Fungal DNA kit following the manufacturer’s protocol. The ITS
regions were amplified with PCR using the primers ITS1/ITS4 (White et al. 1990). PCR
was performed in 50 ul reactions containing DNA template 2 ul, primer (10 uM) 2 ul
each, and 2 x Master Mix (Tiangen Biotech (Beijing) Co. Ltd.) 25 ul. PCR reactions
were run as follows: an initial denaturation at 95 °C for 3 min, followed by 30 cycles at
95 °C for 2 min, 55 °C for 25 s, 72 °C for 2 min and a final extension at 72 °C for 10 min.
The PCR products were sent to Invitrogen Biotechnology Co. Ltd. (Beijing, China) for
purifying, sequencing, and editing. The other sequence data of ITS rDNA included in
this study were downloaded from GenBank. GenBank numbers are shown in TABLE 1.
Phylogenetic analyses
DNA sequences were aligned with Clustal X (Thompson et al. 1997). The alignment
was manually adjusted with Se-Al v.2.03a (Rambaut 2000). The aligned dataset was
analyzed with maximum parsimony (MP) using PAUP*4.0b10 (Swofford 2002).
Maximum parsimony analysis was conducted using heuristic searches with 1000
replicates of random-addition sequence, tree bisection reconnection (TBR) branch
swapping algorithm. All characters were equally weighted and unordered. Gaps were
treated as missing data to minimize homology assumptions. A bootstrap (BS) analysis
was performed with 1000 replicates, each with 10 random taxon addition sequences.
TABLE 1. Sources of sequences for molecular analysis
Tuber neoexcavatum sp. nov. (China) ... 157
GEOGRAPHICAL ITS
SPECIES VOUCHER SPECIMEN GRiGIn
Terfezia boudieri Chatin mot08 Algeria AF276673
DDtb1 Tunisia GU474809
Tuber aestivum Vittad. El Italy AF516788
E17 Italy AY226042
T. borchii Vittad. GB62 Italy HM485342
GB45 Italy HM485344
T. excavatum Vittad. Texc-eu02 France DQ329362
BM100 Spain FJ748899
°T. excavatum HKAS 52006 China GQ217540
T. fulgens Quél. M2435 Italy HM485358
SFI: TUBFUL/041008B Slovenia FN433150
T. magnatum Picco Tm4 Italy AJ586308
_— Italy EU807975
T. melanosporum Vittad. A59 France AF106878
Tm13 France AF132501
T. mesentericum TmsW095-W029 (UPS) Sweden AJ888047
TmsW088-W047 (UPS) Sweden AJ888044
T. neoexcavatum BJTC FAN 184 (Holotype) China JX458715
T. pseudoexcavatum Tpse-yn05 China DQ329374
T. pseudohimalayense BJTC FAN120 China JX458716
T. rufum Picco Morphotype 5 Italy AY940646
1506 Italy AY112894
T. sinoexcavatum BJTC FAN 130 (Holotype) China JX458717
BJTC FAN166 Chinan JX458718
TBR branch swapping was employed. The Bayesian analysis was performed with
MrBayes 3.1.2 (Huelsenbeck et al. 2001; Ronquist & Huelsenbeck 2003) with two sets
of four chains (one cold and three heated) and the stoprule option in effect, halting
the analyses at an average standard deviation of split frequencies of 0.01. The sample
frequency was set to 100, and the first 25% trees were removed as burn-in. Bayesian
posterior probabilities (PP) were obtained from the 50% majority rule consensus of the
remaining trees. Two sequences derived from Terfezia boudieri were used as outgroup.
Results
Molecular phylogenetics
480 of 688 characters were found to be parsimony-informative. The
maximum parsimony analysis of sequences resulted in one most parsimonious
tree (Fic. 1) with a length (TL) = 1422 steps, consistency index (CI) = 0.6582,
retention index (RI) = 0.8002, homoplasy index (HI) = 0.3418, and rescaled
consistency index (RC) = 0.5267.
The phylogenetic analysis (Fic. 1) reveals that the Tuber species with
excavated ascomata are scattered in different clades with strong support.
The new species T. neoexcavatum clusters in a clade with other three other
158 ... Fan, Cao & Li
Tuber fulgens HM485358
Tuber fulgens FN433150
Tuber sinoexcavatum FAN 166
Tuber sinoexcavatum FAN 130
Tuber excavatum GQ217540
Tuber neoexcavatum FAN184
Tuber excavatum FJ748899
Tuber excavatum DQ329362
95
Tuber aestivum AY 226042
100
1.00
Tuber aestivum AF516788
100
1.00)
Tuber mesentericum AJ888047
100
1.00
Tuber mesentericum AJ888044
Tuber magnatum EU807975
100
1.00
Tuber magnatum AJ586308
Tuber borchii HM485344
100
ie Tuber borchii HM485342
Tuber pseudohimalayense FAN120
100
1.00
Tuber pseudoexcavatum DQ329374
80)
1.00
Tuber melanosporum AF 132501
100
70 1.00
T.00 Tuber melanosporum AF 106878
Tuber rufum AY940646
100)
1.00
Tuber rufum AY 112894
Terfezia boudieri GU474809
Terfezia boudieri AF276673
_10
Fic. 1. Phylogeny derived from maximum parsimony analysis of the ITS rDNA sequences of some
Tuber species with real excavated ascomata, using Terfezia boudieri as outgroup. Bootstrap values of
more than 70% from 1000 replications are shown above the respective branches. Bayesian posterior
probabilities are estimated and clades with PP>0.95 (95%) are marked under the branches.
Tuber neoexcavatum sp. nov. (China) ... 159
excavated species: T: excavatum, T. fulgens, and T! sinoexcavatum. Furthermore,
four strongly supported subclades (each represented by two sequences)
correlate exactly with individual taxa as defined using morphological methods,
indicating that the four excavated species are closely related but distinct. The
other two excavated species are in two separate clades: T. pseudohimalayense
grouping with T. melanosporum and T. mesentericum with T: aestivum.
Taxonomy
Tuber neoexcavatum L. Fan &Yu Li, sp. nov. Pre. 2
MycoBank MB 801128
Differs from other Tuber species by its brown ascoma with a distinctly verrucose surface
and prosenchymatous peridium.
Type: China. Yunnan Province, Baoshan City, in soil under forest of P yunnanensis
Franch., 28 Dec. 2011, Jin-Zhong Cao 511 (Holotype, BJTC FAN184).
ETYMOLOGY: neoexcavatum (Lat.), referring to the similarity to Tuber excavatum.
AscoMata hypogenous, subglobose, 3-4 cm in diam., with typical basal cavities
(excavated ascomata), covered with distinctly verrucose warts on the surface,
yellow brown to brown with shadow of olive green; interior cavity surface
covered with many fine, irregular scales and large warts, pale white to yellow-
white when fresh. Odor and flavour not recorded. PERIDIUM 250-350 um thick
including the 100-150 um high verrucose warts, prosenchymatous, composed
of interwoven hyphae, light brown and slightly thick-walled towards the outside,
3-6 um in diam., hyaline and thin-walled towards the inside, 2.5-5 um in diam.
GLEBA yellow brown to brown, with the shadow of olive green at maturity, veins
white to cream white, more or less radiate from the cavity. Asc1 subglobose
or long oval, hyaline, thin walled, 75-100 x 62.5-80 um, with a short stalk,
2-4-spored. Ascosporgs elliptic or long elliptic, occasionally broadly elliptic,
hyaline at first, light brown or brown at maturity, reticulate ornamentation on
the surface, 30-47.5 x 25-30 um excluding the ornamentation, meshes 5-6 um
deep, 2-4 across the spore width.
ADDITIONAL SPECIMEN EXAMINED — CHINA. SICHUAN PROVINCE, HUIDONG
COUNTY, in soil under forest of P armandii and P. yunnanensis, 3 Nov. 2006, Juan Chen
411 (HKAS 52006, as T: excavatum)
COMMENTS — Ascomata of Tuber neoexcavatum resemble those of T. pseudo-
himalayense (= T. pseudoexcavatum), including the color and small distinct
surface warts, but T: neoexcavatum is easily distinguished by its spino-reticulate
ornamented ascospores. Tuber excavatum, T: fulgens, and T. sinoexcavatum also
produce similar ascomata, but T’ excavatum is distinguished by its pale and
smooth or finely papillar ascomata and T! fulgens and T: sinoexcavatum produce
globose or subglobose ascospores. The European species, T: mesentericum, is
also excavated but differs from T: neoexcavatum in its blackish ascomata that
160 ... Fan, Cao & Li
Fic. 2. Tuber neoexcavatum (BJTC FAN184, holotype). a Ascomata; b Asci and ascospores
observed under light microscope; c Ascospore observed under SEM.
are completely covered with large pyramid warts. In addition, the peridium
structure in T: neoexcavatum is typically prosenchymatous, which is completely
(including the verrucose warts) composed of interwoven hyphae. The ITS
rDNA phylogeny (Fic. 1) places T. neoexcavatum sequences within an evidently
independent clade (BP = 97, PP = 1.00) and clearly supports the new species
as independent.
Chen et al. (2008) reported T: excavatum in China based on specimen HKAS
52006 collected in 2006 from Sichuan Province (also see Cao 2010). However,
our ITS rDNA sequence analysis of HKAS 52006 and other excavated Tuber
species (Fic. 1) places sequence GQ217540 (from HKAS 52006) in a clade with
our T. neoexcavatum but not with the T: excavatum sequences from France
and Spain. In examining HKAS 52006, we could find no ascomal surface
and peridial differences between the specimen of Chen et al. (2008) and the
type specimen of T: neoexcavatum. We therefore redetermine HKAS 52006 as
T. neoexcavatum.
As all other reports of T! excavatum in China are not linked to specimens,
there is no firm evidence for T: excavatum being present in China. Whether
T. excavatum occurs in China or not needs further investigation.
Tuber neoexcavatum sp. nov. (China) ... 161
Tuber sinoexcavatum L. Fan & Yu Li, Mycotaxon 116: 352 (2011)
SPECIMENS EXAMINED — CHINA. SICHUAN PROVINCE, PANZHIHUA CITY, under the
soil of Pinus sp., 20 Dec. 2007, De-fu Liu (Holotype, BJTC Fan130); YUNNAN PROVINCE,
Hu1zHE County, in soil under forest, 12 Nov. 2011, Shao-ping Li 005 (BJTC Fan166).
DISTRIBUTION: China: Sichuan Province; Yunnan Province.
CoMMENTS— Tuber sinoexcavatum was originally described from one collection
(BJTC Fan130), but in 2011 an additional specimen (BJTC Fan166) was found
in Yunnan Province, China. The sequence analyses (Fic. 1) support the two
specimens as conspecific. It should be pointed out that the ascospores are near
regularly globose in the type specimen, but in the new specimen about half the
ascospores are subglobose or broadly elliptic. This phenomenon also occurs in
T. latisporum Juan Chen & P.G. Liu and T. subglobosum L. Fan & C.L. Hou (Fan
et al. 2013). The T! latisporum ascospores are broadly elliptic to subglobose,
but also sometimes globose in some ascomata in the same collection, while in
some ascomata T: subglobosum may occasionally produce a large proportion of
broadly elliptic ascospores rather than typical subglobose ones.
Tuber sinoexcavatum is morphologically similar to the European species
T. excavatum, which, however, produces elliptic ascospores. Furthermore, the
peridium in T: sinoexcavatum is normally covered with fine papillary warts
while T. excavatum produces smooth or only finely scurfy warts (Pegler 1993,
Riousset et al. 2001). Another European species, T: fulgens, also produces
globose ascospores, but its ascoma is brightly colored and a small hole opens
to the outside (Lange 1956, Riousset et al. 2001), unlike the large opening in
T. sinoexcavatum. Here also the ITS rDNA sequence analyses strongly support
three separate species (Fic. 1).
Tuber pseudohimalayense G. Moreno, Manjon, J. Diez & Garcia-Mont., Mycotaxon
63: 218 (1997)
= T. pseudoexcavatum Y. Wang, G. Moreno, Riousset, Manjon &
G. Riousset, Cryptog. Mycol. 19(1-2): 115 (1998)
SPECIMENS EXAMINED — CHINA. SICHUAN PROVINCE, HUIZHE COUNTY, in soil under
trees, 19 Oct. 2003, Juan Chen 127 (HKAS 44346); 3 Nov. 2006, Juan Chen 412 (HKAS
52010); 5 Nov. 2006, Juan Chen 416 (HKAS 52017); 20 Oct. 2003, Juan Chen 134 (HKAS
44325); 19 Oct. 2003, Juan Chen (HKAS 44346); in soil under P. armandii, 15 Dec. 2008,
Li Fan 020 (BJTC FAN120); YUNNAN PROVINCE, KUNMING CITY, in soil under forest,
25 Nov. 2002, Zhu-liang Yang 3603 (HKAS 41313); 8 Nov. 2004, Juan Chen 234 (HKAS
47619); 8 Nov. 2002, Juan Chen 287 (HKAS 49744); 9 Mar. 2003, Xing-hua Wang 1477
(HKAS 42399); JINNING CouNTY, in soil under trees, 20 Sep. 2006, Juan Chen 427
(HKAS 52032); YONGSHENG COUNTY, in soil under trees, 29 Oct. 2006, Juan Chen 407
(HKAS 52027); Juan Chen 408 (HKAS 52036).
DISTRIBUTION: China: Sichuan Province; Yunnan Province.
CoMMENTS—Moreno et al. (1997) described T: pseudohimalayense for a
black truffle with spino-reticulate ornamented ascospores. Although the type
162 ... Fan, Cao & Li
specimen was found in a Spanish truffle market, the authors suspected it was
probably imported from China (Moreno et al. 1997). The next year, Wang et
al. (1998) published T. pseudoexcavatum to accommodate a very common
black truffle species in China. It and T. pseudohimalayense produce identical
ascospores, but T: pseudohimalayense is characterized by a distinct cavity at the
ascomal base. Manjon et al. (2009) and Chen & Liu (2011) concluded that the
two ‘species’ were definitely conspecific based on their analysis of molecular
data. As the earlier published name, T. pseudohimalayense has priority over
T. pseudoexcavatum. We have found it is widely distributed in Yunnan and
Sichuan provinces of southwest China during autumn and early winter, and
Song (2005) has cited it from Hunan Province. Its spino-reticulate ascospores
and 1-8-spored asci separate P pseudohimalayense from all other excavated
Tuber species.
Discussion
Six total species of Tuber with excavated ascomata have been described thus
far, including three species from China. As noted above, the European species
T. excavatum has not yet been confirmed in China.
The ITS rDNA-based phylogeny supports four closely related species
— T. excavatum, T. fulgens, T. sinoexcavatum, T. neoexcavatum — within
a well-supported clade and shows that T! pseudohimalayense is close to
T. melanosporum and T. mesentericum is close to T: aestivum. Although Tuber
species with excavated ascomata appear morphologically similar, however,
their rDNA sequence analyses imply that they are definitely polyphyletic.
Key to Tuber species with excavated ascomata
la. Ascomata blackish; surface with pyramidal warts ................ T. mesentericum
1b. Ascomata not blackish; surface smooth, verrucose, or with small warts .......... g
2a. Ascomata distinctly verrucose or with small warts ............ 0.0... e eee eee 3
2b: Ascomata’smooth or minutely verrucose: 1... baa ew ene ee ge eek os 4
3a. Ascospores with spino-reticulate ornamentation ........... T. pseudohimalayense
3b. Ascospores with reticulate ornamentation ..................04. T. neoexcavatum
Ad. ASCOSPOTES THOSE CIM PLIC-< ree tonaeg! 2 wstiete oat eta oe one ies T. excavatum
4b. Ascospores mostly globose or subglobose. ......... 0... e cece eee eee 5
5a. Ascomata golden brown, opening to outside by a small hole............ T. fulgens
5b. Ascomata yellow brown to light brown, typically excavated....... T. sinoexcavatum
Acknowledgments
We are grateful to Prof. Guozhong Li and Dr. Ian Hall for reviewing the manuscript.
The study was supported by the National Natural Science Foundation of China (No.
31270058, 30770005), the Beijing Natural Science Foundation (No. 5072006). We wish
Tuber neoexcavatum sp. nov. (China) ... 163
to extend a special thanks to the Herbarium of Cryptogams, Kunming Institute of
Botany, Chinese Academy of Sciences, for providing specimens.
Literature cited
Cao JZ. 2010. The genus Tuber in China [Dissertation]. Changchun: Jinlin Agricultural University.
86 p.
Chen J, Liu PG, 2011. Delimitation of Tuber pseudohimalayense and T. pseudoexcavatum based on
morphological and molecular data. Cryptogamie Mycologie 32: 83-93.
Chen J, Wang Y, Liu PG. 2008. Two new records of Tuber (Pezizomycetes, Pezizales) from China.
Mycotaxon 104: 65-71.
Fan L, Cao JZ, Liu YY, Li Y. 2011. Two new species of Tuber from China. Mycotaxon 116: 349-354.
http://dx.doi.org/10.5248/116.349
Fan L, Cao JZ, Hou CL. 2013. Tuber subglobosum and Tuber wenchuanense — two new species with
spino-reticulate ascospores. Mycotaxon 123: 95-101. http://dx.doi.org/10.5248/123.95
Huelsenbeck JP, Ronquist F, Nielsen R,Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP.
2001. Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294:
2310-2314. http://dx.doi.org/10.1126/science.1065889
Lange M. 1956. Danish hypogeous fungi. Dansk Bot Arkiv 16: 1-48.
Manjon JL, Garcia-Montero LG, Alvarado P, Moreno G, Di Massimo G. 2009. Tuber
pseudoexcavatum versus T. pseudohimalayense—new data on the molecular taxonomy and
mycorrhizae of Chinese truffles. Mycotaxon 110: 399-412. http://dx.doi.org/10.5248/110.399
Moreno G, Manjon JL, Diez J, Garcia-Montero LG, Di Massimo G. 1997. Tuber pseudohimalayense
sp. nov. an Asiatic species commercialized in Spain, similar to the “Perigord” truffle. Mycotaxon
63: 217-224.
Pegler DN, Spooner BM, Young TWK. 1993. British truffles: a revision of British hypogeous fungi.
UK: Royal Botanic Gardens, Kew. 224 p.
Rambaut A. 2000. Estimating the rate of molecular evolution: incorporating non-contemporaneous
sequences into maximum likelihood phylogenies. Bioinformatics 16: 395-399.
http://dx.doi:10.1093/bioinformatics/16.4.395
Riousset L, Riousset G, Chevalier G, Bardet MC. 2001. Truffes d'Europe et de Chine. Paris: Institut
National de la Recherche Agronomique. 181 p.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Song MS. 2005. Taxonomic and molecular systematic studies on Tuber in China [Dissertation].
Beijing: Graduate School of Chinese Academy of Sciences. 156 p.
Swofford DL. 2002. PAUP” 4.0b10: phylogenetic analysis using parsimony (*and other methods).
Sunderland, Massachusetts: Sinauer Associates.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTALX windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res 24: 4876-4882. http://dx.doi:10.1093/nar/25.24.4876
Wang Y, Moreno G, Riousset LJ, Manjon JL, Riousset G, Fourre G, Di Massimo G, Garcia-Montero
LG, Diez J. 1998. Tuber pseudoexcavatum sp. nov. A new species from China commercialised
in Spain, France and Italy with additional comments on Chinese truffles. Cryptogamie Mycol
192-113-120;
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. San Diego: Academic Press.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.165
Volume 124, pp. 165-171 April-June 2013
A new species and a new record of the genus Entoloma
from China
JiaN-Ru1 WANG & TOLGOR Bau*
Institute of Mycology/Engineering Research Center of
Chinese Ministry of Education for Edible and Medicinal Fungi,
Jilin Agricultural University, Changchun 130118, P.R. China
* CORRESPONDENCE TO: [email protected]
ABSTRACT —Two omphalinoid Entoloma species were collected from Shandong Province in
China. Entoloma shandongense is described as new to science, and E. rusticoides is recorded for
the first time in China. Detailed descriptions and illustrations of the two species are provided.
In addition, molecular phylogenetic analysis based on ITS sequences is also presented.
Key worps —Entolomataceae, new taxon, morphology, taxonomy
Introduction
More than one thousand species of Entoloma have been described worldwide
(Kirk et al. 2008). Major works on this genus have been published in the past
twenty years (Largent 1994, Noordeloos 2004, Noordeloos & Hausknecht 2007,
Gates & Noordeloos 2007, Horak 2008, Noordeloos & Gates 2009, 2012). In
China, 137 species of Entoloma have been recorded, including several new taxa
and new records in recent systematic studies (Li et al. 2008, 2009; He et al. 2010,
2011, 2012, 2013).
Recently, two omphalinoid Entoloma species were collected in Shandong
Province. One with a blue pileus is described as new to science, and the other
represents a first record for China. Morphological characters and the results of
ITS sequence analyses are provided for both species.
Materials & methods
Materials were collected from Shandong province, north China and were deposited
in the Herbarium of Mycology of Ludong University (HMLD). Morphological characters
of the two species were described and illustrated using traditional taxonomic methods.
For morphological studies, color notations follow Kornerup & Wanscher (1978).
Microscopic characters were examined using water to observe the color of the tissues,
166 ... Wang & Bau
5% KOH solution as a mounting solvent, 1% Congo Red solution as a staining agent,
and Melzer’s reagent to detect amyloidy. At least 20 basidiospores, basidia, and cystidia
per specimen were measured.
The molecular confirmation was derived from ITS sequences. DNA was extracted
according to Sun et al. (2009). ITS rDNA was amplified using primers ITS1 and ITS4.
Amplification was performed in 25 uL volumes containing 0.5 uL template DNA,
2.5 uL PCR-buffer (10x), 2 wL Mg2+ (25 mmol/L), 0.2 uL Taq enzyme (5 U/uL), 0.5
uL dNTP mix (10 mmol/L), 0.5 wL of each primer and 17.8 wL ddH,O. The reaction
was carried out with initial denaturation (94°C, 3 min), 35 cycles by the following
conditions: denaturation (94°C, 50s), annealing (50°C, 30s), extension (72°C, 50s), final
extension (72°C, 10min). The PCR amplification products were sequenced by Sangon
Co., Shanghai, China. The target gene sequences were checked using Bioedit (Version
7.0.9; Hall 1999). The final BLASTN was done in Genbank.
Entoloma shandongense T. Bau & J.R. Wang, sp. nov. Fic. 1
MycoBank MB 802463
Differs from Entoloma ater by its blue pileus and its smaller basidiospores.
Type: China, Shandong Province, Dezhou City, Botanical Garden of Dezhou,
2 September 2011, Jian-Rui Wang (Holotype, HMLD 1796; GenBank, KC257440).
EryMo oey: shandongense refers to the type locality, Shandong Province.
BASIDIOMATA small, omphalinoid. Piteus 10-18 mm broad, hemispherical,
depressed in the center to infundibuliform, not hygrophanous, slightly
translucent-striate almost to center, smooth, mostly blue with somewhat purple
tinge (22B5-22B4) over the whole surface, slightly deeper (21C5-21C6) or deep
dull blue-violet (20C5-20C6) in the center, tomentose. LAMELLAE decurrent or
adnate with short decurrent tooth, 1.5-2 mm broad, distant, pale pinkish beige
(7A1-7A2) to pale pinkish red (11A1-11A2); margin entire. LAMELLULAE
present, 2-3 tiers. CONTEXT thin, whitish to pale brown. STIPE central to
somewhat eccentric, 10-15 mm in length, 1-2 mm in width, cylindrical to
subclavate, gradually narrowing towards base, concolorous with lamellae, pale
beige pink, light beige to white at base. ODOR AND TASTE not distinctive.
BASIDIOSPORES 5.6-7.2 X (7.5—)8.3-10(-10.5) um, Q = 1.3-1.5, with obvious
apiculus, 5-8-angled in side view, thick-walled. Basip1a 29-36 x 8-10 um,
clavate, 4-spored, hyaline, thick-walled when mature, homogeneous or with
granular contents. PLEUROCYSTIDIA & CHEILOCYSTIDIA absent. LAMELLAR
TRAMA regular, made up of cylindrical, narrow elements 30-70 x 8-12 um.
PILEIPELLIS a trichoderm of cylindrical hyphae, often narrower than lamellar
hyphae, with terminal elements 30-70 x 5-8 um, pigment intracellular,
plasmatic, dark blue with somewhat purple tinge, sometimes forming clots,
which dissolve in 5% KOH. SuBPELLIS composed of subhyaline or very pale
blue plasmatic pigment. PILEITRAMA made up of cylindrical elements, hyaline,
thin-walled. StrPITIPELLIs composed of hyphae 5-8 um in diameter, hyaline,
Entoloma shandongense sp. nov. (China) ... 167
Zum 8888 21) ;
Fic. 1. Entoloma shandongense (holotype): 1. Basidiomata (in situ).
2. Line drawings: a. Basidiospores; b. Basidia; c. Young basidia; d. Pileipellis; e. Pileitrama.
3. SEM: Basidiospores. Scale bars: 1 = 10 mm; 2 = 10 um.
thin-walled, without intracellular pigment. STIPE TRAMA regular, made up of
longitudinally cylindrical hyphae up to 5-10 um in diameter. CAULOCYSTIDIA
absent. Oleiferous hyphae scattered in lamellar trama and pileal trama. Brilliant
granules abundant in all tissues. CLAMP CONNECTIONS absent.
EcoLocy — on soil in Poa pratensis grassland.
COMMENTARY — ‘The main characteristics of Entoloma shandongense are the
omphalinoid blue pileus, the many-angled to nodulose spores, and the absence
of cystidia and clamp connections.
There are many species with a blue pileus in Entoloma, but they are rarely
omphalinoid. Only E. ater (Hongo) Hongo & Izawa (Hongo 1958) resembles
E. shandongense in its small omphalinoid basidiomata and grassland
association, but the pileus of E. ater is often purplish and its basidiospores
are larger. Some Entoloma species with blue caps lacking the violet hues
have recently been described from China (Li et al. 2009, He et al. 2012), e.g.,
E. azureosquamulosum T.H. Li & Xiao Lan He, E. subaltissimum T.H. Li & Chuan
H. Li, and E. dinghuense T.H. Li & Chuan H. Li. Entoloma azureosquamulosum
168 ... Wang & Bau
differs from E. shandongense in its convex or conical cap and possession of
hymenial cheilocystidia and caulocystidia on the stipe. The spores of Entoloma
subaltissimum are isodiametric and those of E. dinghuense are quadrate, neither
heterodiametric as in E. shandongense.
Other eastern Asian species with blue-violet pilei (e.g., E. cyanonigrum
(Hongo) Hongo, E. violaceum Murrill, E. glutiniceps (Hongo) Noordel. &
Co-David, E. kujuense (Hongo) Hongo) all differ in larger size (pilei often >2 cm
broad) and a dark purplish (not blue) coloration. In addition, E. cyanonigrum
spores are larger (10.4-11.7 x 6.5-9.lum; Katumoto 2010) and E. glutiniceps
spores are isodiametric (7-8 um diam.; Co-David 2009), distinguished from
the smaller ellipsoid spores of E. shandongense. Finally, pleurocystidia and
cheilocystidia, absent in E. shandongense, are present in both E. kujuense
(Hongo 1985) and E. violaceum (Murrill 1917).
Entoloma rusticoides (Gillet) Noordel., Persoonia 11(2): 150, 1981. Fic. 2
BASIDIOMATA small, mycenoid or omphalinoid. PrLeus 8-14 mm broad,
convex to hemispherical, sometimes with a small papilla, becoming depressed
to umbilicate in the center, hygrophanous, translucent-striate almost to
center, smooth, dark gray to umber brown, light beige brown when dry,
finely tomentose, center always whitish fibrillose-scaly, margin incurved and
undulating. LAMELLAE pale beige to pale brown-pink, decurrent; margin entire.
CONTEXT thin, cream-colored to whitish. Stipe central, 10-15 mm in length,
1-1.5 mm in width, cylindrical to subclavate, surface smooth, gray to brown,
whitely tomentose at base. Opor faintly herbaceous, Taste mild.
BASIDIOSPORES (8.2—)8.5-10.5(-11.0) x (7.6—)8.0-10.3(-11.7) um, ellipsoid
to sub-isodiametric, 5-6-angled in side view, thick-walled, straw coloured.
BASIDIA 28-41 x 9.5-10.5(-12) um, cylindrical to clavate, 2 or 4-spored, hyaline,
thick-walled when mature, clampless. PLEUROCYSTIDIA & CHEILOCYSTIDIA
absent. LAMELLAR TRAMA regular, made up of cylindrical elements, 50-100 x
5-15 um. PILEIPELLIS made up of cylindrical elements 8-20 um in diameter,
septa without clamps, occasional hyphal ends slightly inflated, up to 30 um
in diameter, thin-walled, without clamp connections, externally encrusting
pigments brown. STIPITIPELLIS composed of clampless hyphae 8-15 um,
thin-walled, encrusting pigments brown. STIPE TRAMA regular, made up of
longitudinal cylindrical hyphae, up to 5-15 um in diameter, without clamp
connections. CAULOCYSTIDIA absent.
EcoLocy — in soil alongside paths or associated with Poa pratensis or
Cynodon dactylon grasslands.
SPECIMENS EXAMINED — CHINA, SHANDONG PROVINCE, HEZE: Zhaowanghe Garden,
7 August 2011, Jian-rui Wang (HMLD 1442; GenBank, KC257438); LiAoCcHENG:
Dongchanghe, 1 September 2011, Jian-rui Wang (HMLD 1490; GenBank, KC257441).
Entoloma shandongense sp. nov. (China) ... 169
Fic. 2. Entoloma rusticoides (HMLD1442): 1. Basidiomata (in situ).
2. Line drawings: a. Basidiospores; b. Basidia; c. Pileipellis.
Scale bars: 1 = 10 mm; 2 = 10 um.
COMMENTARY — Entoloma rusticoides is similar to E. rhodocylix (Lasch)
M.M. Moser, E. phaeocyathus Noordel., and E. flocculosum (Bres.) Pacioni in
its omphalinoid shape and sub-isodiametric spores. However, E. rhodocylix
(Moser 1978) and E. phaeocyathus (Noordeloos 1985) both have cheilocystidia
in the lamellar edge, and E. flocculosum (Pacioni 1987) differs in its non-striate,
densely floccose-scaly pileus.
Discussion
The morphology-based taxonomic differences of Entoloma shandongense,
E. rusticoides, and related species have been confirmed by ITS sequence
analyses.
The ITS sequence of the E. shandongense holotype is similar to those of
E. platyphylloides (Romagn.) Largent (GenBank JF908003) and E. undatum
(Gillet) M.M. Moser (GenBank JF908007), with higher query coverage values
(<99%) and max identity (>90%) than other GenBank sequences. However,
the three species obviously differ in fruitbody and spore color, shape, and size.
Entoloma platyphylloides, which occurs in Europe, has a brownish pileus >2 cm
in diameter (Kithner & Romagnesi 1954), while E. undatum has a gray-white
pileus and sometimes possesses cheilocystidia (Moser 1978).
Two ITS sequences from the two E. rusticoides specimens are close to
those of E. infundibuliforme Hesler (GenBank HQ179671), E. sericeoides
(J.E. Lange) Noordel. (GenBank JF908006), and E. defibulatum Arnolds &
Noordel. (GenBank JX454928), with higher query coverage values (<98%) and
max identity (<93%) than other GenBank sequences. However, the spores of
E. defibulatum (rounded-angular; Arnolds & Noordeloos 1979) and
170 ... Wang & Bau
E. sericeoides (Noordeloos 1980) are smaller than in E. rusticoides. Entoloma
infundibuliforme has a squamulose pileus and brown cheilocystidia (Hesler
1967) not found in E. rusticoides.
Acknowledgments
We thank Dr. T.H. Li (Guangdong Institute of Microbiology, China) and Dr.
Genevieve Gates (School of Agricultural Science, University of Tasmania, Australia)
for their reviews of the manuscript. We also thank Dr. X.L. He (Sichuan Academy of
Agricultural Sciences, China) for providing valuable suggestions and references in
the study. Financial support for this work was provided by Changjiang Scholars and
Innovative Research Team in University (No. IRT1134).
Literature cited
Arnolds EJM, Noordeloos ME. 1979. New taxa of Entoloma from grasslands in Drenthe, the
Netherlands. Persoonia 10(2): 283-300.
Co-David DLV, Langeveld D, Noordeloos ME. 2009. Molecular phylogeny and spore evolution of
Entolomataceae. Persoonia 23: 147-176. http://dx.doi.org/10.3767/003158509X480944
Gates GM, Noordeloos ME. 2007. Preliminary studies in the genus Entoloma in Tasmania I.
Persoonia 19: 157-226.
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for windows 95/98/NT. Nucleic Acids Symposium Series. 41: 95-98.
He XL, Li TH, Jiang ZD. 2010. Three species of white Entoloma new to China. Mycosystema 29(6):
920-923.
He XL, Li TH, Jiang ZD, Shen YH. 2011. Entoloma mastoideum and E. praegracile — two new
species from China. Mycotaxon 116: 413-419. http://dx.doi.org/10.5248/116.413
He XL, Li TH, Jiang ZD, Shen YH. 2012. Four new species of Entoloma s.l.(Agaricales) from
southern China. Mycological Progress 11(4): 915-925. http://dx.doi.org/10.1007/s11557-012-
0807-0
He XL, Li TH, Xi PG, Jiang ZD, Shen YH. 2013. Phylogeny of Entoloma s.1. subgenus Pouzarella,
with descriptions of five new species from China. Fungal Diversity 58(1): 227-243.
http://dx.doi.org/10.1007/s13225-012-0212-7
Hesler LR. 1967. Entoloma (Rhodophyllus) in southeastern North America. Beihefte zur Nova
Hedwigia 23.
Hongo T. 1958. Notes on Japanese larger fungi (12). Journal of Japanese Botany 33: 47.
Hongo T. 1985. Notes on Japanese larger fungi (23). Journal of Japanese Botany 60: 370-378.
Horak E. 2008. Agaricales of New Zealand 1. Pluteaceae-Entolomataceae. The fungi of New
Zealand. Vol. 5. Fungal Diversity Press, Hong Kong.
Katumoto K. 2010. List of fungi recorded in Japan, The Kanto Branch of the Mycological Society
of Japan.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi. 10th ed. Wallingford,
UK: CAB International.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour, 3rd ed. Eyre Methuen, London.
Kiihner R, Romagnesi H. 1954. Compléments a la ‘Flore Analytique: I. Espéces nouvelles ou
critiques de Rhodophyllus. Revue de Mycologie 19(1): 3-46.
Largent DL. 1994. Entolomatoid fungi of the Pacific Northwest and Alaska. Mad River Press,
USA.
Entoloma shandongense sp. nov. (China) ... 171
Li CH, Deng WQ, Song B, Li TH, Shen YH, Yang WD. 2008. Known species of Entolomataecae
from China and its taxonomic issues. Journal of Fungal Research 6(3): 136-154.
Li CH, Li TH, Shen YH. 2009. Two new blue species of Entoloma (Basidiomycetes, Agaricales) from
South China. Mycotaxon 107: 405-412. http://dx.doi.org/10.5248/107.405
Moser M. 1978. Basidiomyceten II. Teil. Die Rohrlinge und Blatterpilze (Agaricales). Kleine
Kryptogamenflora, 4. Auflage, Band 2b/2.
Murrill WA. 1917. Agaricaceae subtribe Pluteanae. North American Flora 10(2): 77-144.
Noordeloos ME. 1980. Entoloma subgenus Nolanea in the Netherlands and adjacent regions with a
reconnaissance of its remaining taxa in Europe. Persoonia 10(4): 427-534.
Noordeloos ME. 1985. Notulae ad floram agaricinam neerlandicam—X-XI Entoloma. Persoonia
12(4): 457-462.
Noordeloos ME. 2004. Entoloma s.l. Fungi Europaei. Vol. 5a. Edizione Candusso, Italy. 761-1378.
Noordeloos ME, Gates GM. 2009. Preliminary studies in the genus Entoloma in Tasmania II.
Cryptogamie, Mycologie 30: 107-140.
Noordeloos ME, Gates GM. 2012. The Entolomataceae of Tasmania. Fungal Diversity Research
Series 22.
Noordeloos ME, Hausknecht A. 2007. The genus Entoloma (Basidiomycetes, Agaricales) of the
Mascarenes and Seychelles. Fungal Diversity 27: 111-144.
Pacioni G. 1987. I funghi delle aree bruciate nel bacino del Mediterraneo. Micologia e Vegetazione
Mediterranea 2(2): 67-148.
Sun LE, Zhang YH, Pei KQ. 2009. A rapid extraction of genomic DNA from fungi. Mycosystema
28(2): 299-302.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.173
Volume 124, pp. 173-188 April-June 2013
Russula atroaeruginea and R. sichuanensis spp. nov.
from southwest China
Guo-Jrz Li’”, Qi ZHAO?, DONG ZHAO’, SHUANG-FEN YUE",
SAI-FEI L?, HUA-AN WEN™ & XING-ZHONG Liu”
'State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences,
No. 1 Beichen West Road, Chaoyang District, Beijing 100101, China
*University of Chinese Academy of Sciences, Beijing 100049, China
°Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650204, Yunnan, China
‘College of Life Science, Capital Normal University,
Xisihuanbeilu 105, Haidian District, Beijing 100048, China
* CORRESPONDENCE TO: * [email protected] ® [email protected]
ABSTRACT — Two new species of Russula are described from southwestern China based
on morphology and ITS1-5.8S-ITS2 rDNA sequence analysis. Russula atroaeruginea (sect.
Griseinae) is characterized by a glabrous dark-green and radially yellowish tinged pileus,
slightly yellowish context, spores ornamented by low warts linked by fine lines, and numerous
pileocystidia with crystalline contents blackening in sulfovanillin. Russula sichuanensis,
a semi-sequestrate taxon closely related to sect. Laricinae, forms russuloid to secotioid
basidiocarps with yellowish to orange sublamellate gleba and large basidiospores with warts
linked as ridges. The rDNA ITS-based phylogenetic trees fully support these new species.
KEY worps — taxonomy, Macowanites, Russulales, Russulaceae, Basidiomycota
Introduction
Russula Pers. is a globally distributed genus of macrofungi with colorful
fruit bodies (Bills et al. 1986, Singer 1986, Miller & Buyck 2002, Kirk et al.
2008). As ectomycorrhizal symbionts, they play an important beneficial role
in forest ecosystems (Richardson 1970, Bills et al. 1986, Villeneuve et al. 1991,
Claridge & May 1994, Buyck et al. 1996, Gardes & Bruns 1996). China has a
long history of using Russula mushrooms as traditional food and medicine.
Twenty-two medicinal species and 82 edible species have been reported in the
country (Ying et al. 1982, 1987; Wang & Liu 2002; Yang 2002; Wang et al. 2004;
Dai et al. 2009; Li et al. 2010a), and their ectomycorrhizal capacity, population
genetics, and mycochemistry have been studied in recent years (Gao et al. 2001;
174 ... Li & al.
Tan et al. 2001, 2004; Liang et al. 2004; Liu 2004, 2005; Li et al. 2010b; Zhao et
al. 2010). So far, only 14 new species and three new varieties have been reported
from China (Singer 1935; Chiu 1945; Ying 1983, 1989; Bi & Li 1986; Zang &
Yuan 1999; Wen & Ying 2001; Wang et al. 2009; Li et al. 2011, 2012). Although
southwestern China represents one of the world’s biodiversity “hotspots” and
has a high diversity of macrofungi (Yang & Zang 2003; Dai et al. 2004, 2007; Dai
& Yuan 2008), only a few russulacean species have been reported in this region
and the adjacent Himalayas (Wang & Liu 2009, 2010; Das et al. 2010; Buyck &
Atri 2011; Das & Verbeken 2011; Wang et al. 2012). During a systematic survey
of Russula species in southwestern China from 2004 to 2009, two interesting
species were found, which we propose here as new species.
Materials & methods
Specimens were photographed, and the macroscopic characteristics of fresh mature
fruit bodies were recorded under daylight in the field. Specimens were tested chemically
in sulfovanillin (SV) solution. They were then kept 50-60 °C until completely dried and
were subsequently deposited in the Herbarium of Cryptogams, Kunming Institute of
Botany, Chinese Academy of Sciences (HKAS). Color names and codes were assigned
based on Ridgway (1912). Tissues of dried specimens were immersed in 5% KOH for
10-20 seconds to prepare for microscopic observation in Congo Red using a Nikon
E80i microscope with a 100x oil immersion objective lens. Basidiospores were observed
and measured in Melzer’s reagent. Spore measurements do not include apiculus and
ornamentation, and sterigma lengths were excluded from basidium measurements.
Sections from the pileipellis were anticlinally cut through the pileus centre to the
margin. Cystidia with incrustations were observed in distilled water. Scanning electron
microscopic images were captured with an FEI Quanta 200 microscope. Microscopic
observation and statistical citation of measure technicalities follow Yang (2000) and
Wang et al. (2009).
Protocols for DNA extraction, PCR, and sequencing followed those in Li et al.
(2012). The internal transcribed spacer (ITS) regions were amplified with the primer
pairs ITS1/ITS4 (Gardes & Bruns 1993). PCR products were purified with the Bioteke
DNA Purification Kit (Bioteke, Beijing, China). The ITS regions were sequenced with
the ABI 3730 DNA analyzer and ABI Bigdye 3.1 terminator cycle sequencing Kit
(BGI, Beijing, China), and new sequences were deposited in GenBank (see Fic. 5 for
accession numbers). Sequences of representative and closely related Russula taxa, with
an emphasis on samples of the russuloid to secotioid forms (Eberhardt 2002, Miller &
Buyck 2002, Lebel & Tonkin 2007), were selected from GenBank and included in this
analysis. Assembly and editing of sequences of each region were performed with Clustal
X and BioEdit (Thompson et al. 1997, Hall 1999) and were manually adjusted when
necessary. Some poorly aligned terminal sites were excluded from further analysis.
Based on previous results (Lebel & Tonkin 2007), Albatrellus ovinus (Schaeff.) Kotl.
& Pouzar was chosen as outgroup (Ryman et al. 2003). Sequences of datasets including
the ITS1-5.8S-ITS2 region were analyzed with maximum parsimony (MP) and Bayesian
analysis (BA) methods.
Russula spp. nov. (China) ... 175
MP analysis of the phylogenetic relationships were performed in PAUP* v.4.01
(Swofford 2004). Gaps in alignment were treated as missing data, and all sites were treated
as unordered and unweighted. The tree bisection-reconstruction (TBR) algorithm was
performed using with the heuristic search option, and bootstrap analysis was conducted
with 1000 replicates (Felsenstein 1985). Consistency index (CI), retention index (RI),
and tree length (TL) were also calculated. Trees were displayed with Treeview 1.6.6
(Page 1996).
Bayesian analysis was carried out in MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003).
The best-fit model of Bayesian posterior probabilities (PP) were calculated with the
Markov Chain Monte Carlo (MCMC) algorithm (Larget & Simon 1999). One cold and
three heated Markov chains were run for 2,000,000 generations, the trees were sampled
every 100" generation, and the run was terminated once the average standard deviation
of split frequencies fell below 0.01. A discard of 25% trees was set in the Burn-in option
(Hall 2004).
Taxonomy
Russula atroaeruginea GJ. Li, Q. Zhao & H.A. Wen, sp. nov. Figs 1-2
MycoBank MB804644
Differs from Russula aeruginea by its non-fading green pileus lacking scattered rusty
spots and whitish to pale cream spore print.
Type: China. Sichuan Province, Daofu County, 25.VII.2007, Z.W. Ge 1540 (Holotype,
HKAS53626, GenBank JX391970)
ETYMOLOGY: atroaeruginea (Latin) = dark green. The epithet refers to the dark-green
basidioma pileus.
BASIDIOMATA small to medium sized. PiLeus 3-7 cm in diam., first
hemispherical, then convex to applanate, sometimes slightly depressed above
the stipe, blackish-green tinged, intermixed with radial greenish yellow fringe,
Dull Blackish Green (XLI29""'m) at centre, Sepia (XXIX17'"m) when dry, never
viscous; margin incurved first, straight when mature, sometimes undulate, not
striate, Meadow Green (VI35k) to Antique Green (VI33m) with yellowish tinge
of Oil Yellow (V25i) towards the margin, Verona Brown (XXIX13"k) when dry.
LAMELLAE 10-15/cm at the edge, <7 mm wide, adnate to almost free, forked
around the stipe, occasionally near the pileus margin, not interveined, cream
to yellowish, Cream Color (XVI19’f), brittle; edge even, slightly narrowing
towards the pileus margin; lamellulae occasional. StrpE 4-6 x 1-2 cm, central
to slightly eccentric, smooth, not pruinose, cylindrical, ventricose toward the
base, without annulus, whitish, often with pale-greenish tinge, part turning
pale yellow when aged, sometimes with rusty spots, first unchanging, stuffed,
hollow when mature. CONTEXT 3-5 mm thick from the lamellae attachment
to the stipe, compact under pileus, white to whitish, no color change when
bruised, turning slightly pale yellowish in age; taste mild; no distinct odor.
SPORE PRINT whitish to pale cream (Romagnesi Ib-IIa).
176 ... Li & al.
edge sterile. SUBHYMENIUM 15-20 um thick, composed of slender cylindrical
cells 4-7 um wide under basidia and inflated cells (15-)20-35(-45) um in
diam. next to trama. PILEIPELLIS a trichoderm 200-300 um thick, composed
of 4-6 um thick, slender hyaline hyphae without intracellular pigmentation;
pileocystidia numerous, 40-70 um long, sometimes inflating up to 7-10 um
wide, fusiform, with crystal contents but no septa, sharply blackened in SV.
STIPITIPELLIS not well developed, a cutis composed of thin-walled, septate,
cylindrical hyphae 3-6 um wide; caulocystidia absent. CLamp CONNECTIONS
absent in all tissues.
ECOLOGY & DISTRIBUTION: Single or gregarious in conifer forest (Picea spp.)
in July and August in China (Sichuan, Xizang, and Yunnan).
ADDITIONAL SPECIMENS EXAMINED: CHINA, SICHUAN PROVINCE, DAOFU COUNTY,
25.VII.2007, Z.W. Ge 1532 (HKAS53618); YUNNAN PROVINCE, YULONG, Laojunshan,
9. VIII.2008, Q. Zhao 8238 (HKAS55220); XIZANG AUTONOMOUS REGION, CHANGDU
County, Zhuge Village, 31°04'N, 96°58’E, alt. 4200 m, 7.VIII.2003, Z.L. Yang 4305
(HKAS45684).
ComMENTs: Russula atroaeruginea is characterized by its dark-green intermixed
with radially yellowish-tinged (striate) pileus, whitish to pale-cream spore
print, and basidiospores with thin low fine ornamentations (<1.0 um tall).
The dark-green pileus contrasting with the whitish (often green-tinged) stipe
is a good field character, although it is sometimes difficult to distinguish this
species against from the green forest surroundings. This species should be
placed in the Russula sect. Griseinae (Jul. Schaff.) Romagn. based on its mild-
flavored context, pileipellis lacking primordial hyphae and red pigments but
with typical multiseptate (often subulate) hyphal extremities, and unicellular
pileocystidia that blacken in SV.
Romagnesi (1967) recognized 5 greenish tinged species in sect. Griseinae:
R. pseudoaeruginea (Romagn.) Kuyper & Vuure, R. aeruginea Fr., R. medullata
Romagn., R. stenotricha Romagn., and R. anatina Romagn. The morphologically
similar R. aeruginea, R. anatina, R. cyanoxantha f. peltereaui Singer, R. medullata,
and R. pseudoaeruginea have been reported in eastern Asia (Tai 1979, Ying et
al. 1982, Imazeki & Hongo 1989, Ying 1989, Shimono et al. 2004). Russula
pseudoaeruginea, however, has a gray-tinged green olive or somewhat cream and
pale-brown intermixed pileus and an ochreous-cream spore print (Romagnesi
1967, Sarnari 1998); it often grows in temperate to boreal deciduous forests
dominated by Tilia and Quercus spp. (Romagnesi 1967, Hansen & Knudsen
1992), while R. atroaeruginea grows in conifer forests dominated by Picea spp.
in alpine subtropical regions.
Another taxon superficially resembling R. atroaerugineais R. aeruginea,avery
common species originally described from Europe which grows in subalpine
coniferous to mixed forests containing Betula, Pinus, and Picea. However,
R. aeruginea has a green-tinged pileus with a darker pileus centre, whitish
Russula spp. nov. (China) ... 177
1 Re > | . . = ff 4
ps
Fic. 1: Russula atroaeruginea: a. HKAS 45684; b. HKAS 53626 (Holotype)
stipe with rusty spots, a slightly acrid taste, cream-colored spore deposits, and
spores with many fine lines formed by connected low warts (Schaeffer 1952,
Romagnesi 1967, Roger 1981, Woo 1989, Hansen & Knudsen 1992, Sarnari
178 ... Li & al.
1/19/2011 WD
10 um
av ( BN Li i
(UE A\
S(T / GN NNT
Wks, D \S
LICE
Fic. 2: Russula atroaeruginea (HKAS 53626): a. Basidiospores (SEM); b. Basidiospores;
c. Pleurocystidia; d. Basidia; e. Hyphal extremities in pileipellis; f. Pileocystidia; g. Pileipellis
Basip1osPores [80/4/3] (6.3-) 6.8-8.1 (-9.0) x (5.9-) 6.1-7.4 (-7.8) um,
Q = (1.01-)1.04-1.23(-1.32) (Q =1.15 + 0.07), subglobose to broadly ellipsoid
or (sometimes) ellipsoid, verrucose; ornamentation amyloid, composed of
warts mostly fused into fine lines, cristulate to subreticulate, with some isolated
verrucae, <1.0 um high; plage not or indistinctly amyloid. Bastp1a 40-48 x 9-11
um, clavate, inflated towards upper half, 4-(rarely 2-) spored, projecting 7-13
uum beyond hymenium, hyaline in KOH; sterigmata 3-5 um, pointed, straight to
slightly tortuous. PLEUROCYSTIDIA numerous, 72-115 x 9-13 um, originating
in subhymenium, projecting 35-50 um beyond hymenium, thin-walled, clavate
to subfusiform, sometimes with refractive contents; apices subacute to acute, at
times with a moniliform appendage. CHEILOCYSTIDIA not observed; lamellar
Russula spp. nov. (China) ... 179
1998). Russula aeruginea can be distinguished from R. atroaeruginea by its more
or less discolored pileus, which is often spotted with scattered, rusty spots.
Russula atroaeruginea is also easily distinguished from three other species
originally described from France: R. medullata grows under deciduous trees
of Corylus, Populus, Fraxinus, Betula, Fagus, Castanea, and Quercus, has an
ochre (III a, b-c) spore print, spores with isolated warts, and rare pileocystidia
(Romagnesi 1967, Hansen & Knudsen 1992); R. stenotricha has a grayish-green
pileus, slightly spicy lamellae, short obtuse pileipellis terminal cells, and short
wide pileocystidia 25-50 x 5-9 (12) um (Romagnesi 1967, Hansen & Knudsen
1992); and R. anatina has long cystidia 60-130 x 6.7-12 um (Romagnesi
1967).
Also similar to R. atroaeruginea is the green form of R. cyanoxantha
(Schaeff.) Fr. (= R. cyanoxantha f. peltereaui), which differs in its elastic lamellae,
white (Ia) spore mass, basidiospores with scattered low warts that are never
connected with fine lines, and slender cystidia 65-100 x 5.7-7 um (Romagnesi
1967, Roger 1981, Hansen & Knudsen 1992).
Among the Russula species originally described from China, the
morphologically related R. viridirubrolimbata J.Z. Ying differs from R. atro-
aeruginea by its finely rimose pileus, unchanging white context, isolated spore
ornamentations, hyaline pleurocystidia, and a pileipellis without pileocystidia
(Ying 1983).
Russula sichuanensis G.J. Li & H.A. Wen, sp. nov. FIGS 3-4
MycoBAank MB804645
Differs from Macowanites yunnanensis by its larger gastrocarp, dirty white to pale
tinged pileus, cream to yellowish lamellae, and larger basidiospores with larger
ornamentations.
Type: China. Sichuan Province, from Rangtang County to Seda County, banks of Duke
River, 5.VHI.2007, Z.W. Ge1707 (Holotype, HKAS53792, GenBank JX391969)
ErymMo_ocy: Referring to the type locality region.
BASIDIOMATA semi-hypogeous to epigeous, russuloid to secotioid, small.
Piteus 3.1-4.4 cm in diam., irregularly globose to subglobose when young,
hemispheric, barely expanded, sometimes pulvinate when mature, centre slightly
depressed with age, whitish, dirty-white to pale-pinkish tinge of Pale Salmon
Color (XIV9’f) to Pale Flesh Color (XIV7’f), rarely with greenish tinge of Dark
Olive Buff (XL21'”’), intermixed with brown to olivaceous brown tinge of Wood
Brown (XL17"”), Brussels Brown (III15m) when dry; margin whitish to cream,
White (LIII) to Cream color (XVI119’f), often glabrous, dry, slightly viscid when
moist, strongly incurved and indented around the stipe, sometimes slightly
radially rugose, with slightly pinkish tinge of Pale Flesh Color (XIV7’'f), not
striate. CONTEXT <3 mm at the disc, whitish, fragile; odor not distinctive; taste
mild. LAMELLAE/GLEBA 3-6 mm high, sublamellate to lamellate, composed of
180 ... Li & al.
US cn. a = q : vars
Fic. 3: Russula sichuanensis: a. HKAS 45645; b. HKAS 53792 (Holotype)
sinuate, contorted, very crowded, convoluted lamellae, often exposed near the
stipe, cream to yellowish tinge of Pale Orange-Yellow (III15f) when juvenile,
Russula spp. nov. (China) ... 181
ss a = —_
1/19/2011 WD Mag HV _ Det Spot
3:45:19 PM 11.0 mm 2286x 10.0 kKVETD 3.0
MCG Fl
/ y) uy
2 -
NSW
\e,
NLD
NK We g
e
=
10 um
Fic. 4: Russula sichuanensis (Holotype HKAS 53792): a. Basidiospores (SEM); b. Basidiospores;
c. Basidia; d. Hyphal extremities in pileipellis; e. Pileocystidia; f. Caulocystidia; g. Pleurocystidia.
with pale orange tinge of Orange Buff (III15d) to Light Orange- Yellow (II117d)
when mature. STIPE 4.0-6.0 x 1.0-1.5 cm, subcylindrical, surface dry, rugulose
longitudinally, dull, without annulus, slightly attenuate upwards, whitish,
<3 mm at pileus diameter, stuffed first, becoming hollow when old. SpoRE
PRINT Ocher to yellow (Romagnesi IIc-IVa).
BASIDIOSPORES [100/3/2] (8.8—)9.4-14.1(-15.5) x (7.6-)7.9-12.8(-13.1)
um, Q = (1.01—-)1.02-1.26(-1.32), (Q = 1.11 + 0.08), globose to subglobose,
slightly yellowish; ornamentation cristulate to subreticulate, composed of
amyloid warts linked as small crests and ridges, forming a partial to nearly
complete network, rarely intermixed with isolated verrucae, warts often >1 um
high (but no more than 1.5 um); suprahilar plage not well defined. Basip1A
182 ... Li & al.
24-35 x 11-15 um, mostly with two sterigmata 4-7 um long, rarely 4-spored,
claviform to clavate, short and rather voluminous, rarely cylindrical, hyaline,
or sometimes yellow in KOH. PLEuRocystipiA rare, 45-72 x 10-15 um,
distinctly projecting 10-30 um beyond the basidia, ventricose, sometimes
clavate to sphaeropedunculate, thin-walled, rarely thick-walled, often empty,
at times with refringent contents, no reaction in SV. SUBHYMENIUM a 20-35
uum thick cellular layer composed of inflated cells 7-13 um in diam., hyaline,
sometimes pale yellowish in KOH. PILEIPELLIS an ixotrichoderm 125-150
uum thick, slightly gelatinized, composed of thin-walled hyphae 3-6 um wide,
cylindrical, hyaline; pileocystidia septate, clavate to cylindrical, 6-10 um wide,
apex sometimes inflated, with refractive contents. STIPITIPELLIS filamentous
hyphae 3-6 um in diam., intermixed with inflated cells, hyaline, some hyphae
yellowish to pale ocher in KOH; caulocystidia infrequent, 35-44 x 8-11 um,
cylindrical, septate, with round apex. CLAMP CONNECTIONS AND LATICIFEROUS
HYPHAE absent from all tissues.
ECOLOGY & DISTRIBUTION: Single or gregarious in conifer forests (Picea
spp.) at altitude of 3300-3900m during July and August, China (Xizang and
Sichuan).
OTHER SPECIMENS EXAMINED: CHINA, XIZANG AUTONOMOUS REGION, JIANGDA
County, Tongpu Township, 31°35'N, 98°23’E, alt. 3300 m, 2.VIII.2004, Z.L. Yang 4266
(HKAS45645); RrwocHE County, Sangduo Township, 31°05’N, 96°29’E, alt. 3900
m, 11.VIII.2004, Z.W. Ge335 (HKAS46115); ZuoGoNG County, Wangda Township,
alt. 3700 m, 18.VII.2009, Z.L. Yang 5285 (HKAS 57828); SICHUAN PROVINCE, ABA
County, Angiang Township, Ping’ an Village, 11. VIII.2007, Z.W. Ge 1800 (HKAS53885,
GenBank JX391971).
ComMENTSs: Until Russula species were emended by Lebel & Tonkin (2007),
Russula sichuanensis was treated in Macowanites Kalchbr., a widespread
sequestrate genus containing diverse species phylogenetically close to Russula
(Miller et al. 2001, Lebel & Castellano 2002, Eberhardt & Verbeken 2004).
That very little knowledge is available concerning Macowanites in China may
result partly from its semi-hypogeous habit; only M. yunnanensis M. Zang has
been described, based on materials collected from Zixi Mountain, Chuxiong,
Yunnan Province (Zang & Yuan 1999). Its morphology conspicuously differs
from that of R. sichuanensis: M. yunnanensis has a smaller gastrocarp (0.7-1.2
cm broad), a pinkish- to reddish-tinged pileus surface, whitish lamellae, and
smaller basidiospores (10-12.5 x 6-7 um) with 0.3-0.5 um ornamentations
(Zang & Yuan 1999).
Russula_ sichuanensis resembles a medium-sized, distorted or aborted
agaricoid Russula, because it has a curly pileus, a white percurrent stipe often
covered by the pileus, and tightly contorted sinuate cream to yellow lamellae.
Other characters include a cream-tinged pileus (often olivaceous brown at the
centre), a yellowish to orange sublamellate gleba, and stipitate basidiomata.
Russula spp. nov. (China) ... 183
The following microscopical characters are distinctive: the partially reticulate
globose to subglobose basidiospores, short voluminous basidia, very rare
pleurocystidia, and septate pileocystidia with crystal contents. In addition, the
association of R. sichuanensis with Picea spp. in coniferous forests of the eastern
Qinghai-Tibet plateau is a distinctive ecological and biogeographical feature.
A number of species have a similar sublamellate gleba and percurrent stipe:
Macowanites citrinus Singer & A.H. Sm., M. chlorinosmus A.H. Sm. & Trappe,
M. luteolus A.H. Sm. & Trappe, M. subolivaceus A.H. Sm., Russula galbana T.
Lebel, R. kermesina T. Lebel, R. luteirosea (Bougher) T. Lebel, and M. arenicola
S.L. Mill. & D. Mitch. However, M. citrinus, originally described from Idaho
(in the northwestern U.S.A.), differs from R. sichuanensis in having smaller
subglobose to short ellipsoid basidiospores ornamented by conical spines and
short flattened ridges and with a small indistinct suprahilar plage (Pegler &
Young 1979), and M. chlorinosmus (from Oregon, U.S.A.) has a rimose pileus
cutis, a strong chlorine odor, a very unpleasant taste, and basidiospores with
low warts (Smith 1963). Macowanites luteolus (also from Oregon) differs by
its short thin stipe, smaller basidiospores with scattered to close 0.3-0.7 um
ornamentations, subhymenium cells that are hyaline in KOH, and numerous
macrocystidia (Smith 1963). Macowanites subolivaceus (from Idaho) has a
lobed to very irregular pileus margin, a very fragile thin context, basidiospores
7-9 um in diam., and a peridial epicutis consisting of a turf of gelatinous
branched hyphae with 60-200 um long pseudocystidia (Smith 1963). Russula
galbana (from Queensland, northeastern Australia) has smaller basidiomata,
a short slender stipe, and common, dimorphic hymenophoral cystidia with
obtuse or mucronate apices (Lebel & Tonkin 2007); R. kermesina, (from
Nelson, New Zealand) is characterized by its carmine red to dark-red-tinged
pileus, chalk-white gleba, large cystidia not or only slightly projecting beyond
the basidia, and pileipellis without pileocystidia (Label & Castellano 2002).
Russula luteirosa (from western Australia) has a pileus with intermixed cream
to pale yellowish and rosaceous colors, large basidia, and an association
with Allocasuarina, Acacia, and Eucalyptus (Bougher 1997). Macowanites
arenicola (from northwestern Florida, U.S.A.) has a yogurt- or soy sauce-type
odor, smaller broadly elliptical to elliptical spores with low ornamentation
(8.8-10.4 x 6.8-7.2 um, Q = 1.37, verrucae 0.2-0.4 um high), long slender
cystidia (80-120 x 6-7.5 um), and grows in white quartzite sands of costal
scrub forests (Miller 2004).
Russula sichuanensis also shows some superficial affinities with Russula sect.
Laricinae Romagn. for its small-sized basidiocarps, ocher to yellow spore print,
short basidia, rare pleurocystidia, and pluriseptate dermatocystidia (Romagnesi
1985), but its russuloid to secotioid basidiocarps and large basidiospores
obviously distinguish it from the agaricoid sect. Laricinae.
184 ... Li & al.
Albatreilus ovinus AY198202
R adusta AY061652
R ingwa EU019919 Sect. Mgricantinae
R nigricans AY061695
& joetens AY061677 | Sect. Foetentinae
R galbana EU019936
& neerimea EU019915
(—— & albobrunnea EU019918 |
R caerulea AY¥061661 Sect. integroidinae
R xerampelina AY061734 | Sect. Miridantinae
95IL) R. cessans AY061685
& laricina AY061730
R. sichuanensis JX391971 HKAS5S3885 Sect. Larcinae
RX curtipes AY061668
R nauseosa JF908642
R decolorans AY061670 | Sect. Decolorantinae
R alivacea AY061699 |. Sect. Ofvaceinae
R violecea AY061725_— | Sect. Violacinae
R kalimna EU019927
R rubrolutea EU019940
“— RB tapawera EU019935
R purpureofiava EU019917
R wollumbina EU019921
R emetica AY061673 7
R persanguinea EU019916 | Sect. Bmeticinae
R nobilis AF418620
R. exalbicans AF418622 I Sect. Bxalbicantinae
R fellea AY061676 | Sect. Felleinae
-10.99
RX queleti AYO61711 | Sect. Sardoxinae
oe! R aeruginea AF418202
- R grisea AY061679 Sect. Griseinae
R. atroaeruginea TX391970 HEAS53626 Holotype
il eyanoxantha AY061669 | Sect. Indalentinae
Rilicis AY061682 Gare Heternho th
MY R werner? DQ422021 a re Ae aati
R crustosa EW598194
R virescens AY061727
& iterika EU019929
R mustelina AY061693
& vesea AF418610
R rostraticystidia EU019938
& variispora EU019934
R marangania EU019930
100/1 & delica AY061671 | Sect. Plarantinae
R pumicoidea EU019931
| Sect. Virescentinae
| Sect. Heferophyiinae
—— 10 changes
Fic. 5. Phylogenetic relationship tree of Russula species inferred from the dataset of ITS1-5.8S-
ITS2 sequences. Consistency index (CI) = 0.461, retention index (RI) = 0.665, and tree length (TL)
= 1030. MP bootstrap support values (>50%) and PP (>0.94) from Bayesian Analysis are indicated
above or below the branches as MP BS/BA PP. Sectional names are from Romagnesi (1987).
Phylogenetic results
The ITS1-5.8S-ITS2 dataset included sequences representing 44 taxa
representing nine Russula subgenera. ‘The aligned sequence comprised 471
nucleotide sites. In the MP analysis, 195 characters were constant, 69 variable
characters were parsimony-informative, and 207 characters were parsimony-
uninformative. In the ITS phylogenetic tree (Fic. 5), R. atroaeruginea clustered
with R. aeruginea and R. grisea with strong statistical support (98% boot strap,
1.0 posterior probability). A Blast comparison of R. atroaeruginea (JX391970)
and R. aeruginea (AF418612) through the NCBI databank shows a 93% max
identification and 96% coverage. Another ITS blast with R. atroaeruginea
(JX391970) and R. grisea (AY061679) shows a 90% max identification of 99%
coverage, confirming that R. atroaeruginea is related to R. grisea / aeruginea
group in Russula sect. Griseinae. The separation between R. atroaeruginea and
Russula spp. nov. (China) ... 185
R. cyanoxantha is also well supported. These phylogenetic results suggest that
R. atroaeruginea and R. aeruginea are closely related but different species.
The clade in which R. sichuanensis is located is highly supported (Fie. 5).
Members of Russula subgen. Tenellula sect. Larcinae cluster together, suggesting
that R. sichuanensis is closely related to the R. laricina / cessans group. However,
given the lack of stability in the topologies due to GenBank’s limited number of
ITS sequences from closely related secotioid Russula taxa, we hesitate making a
definitive statement about the phylogenetic position of R. sichuanensis. Broader
collections from East Asia, particularly of russuloid to secotioid Russula taxa,
are required in future work.
Acknowledgments
This study was supported by the National Natural Science Foundation of China
(No. 30770013), International Cooperation Program of Ministry of Science and
Technology of the People’s Republic of China (No. 2009DFA31160) and the Hundred
Talents Program of the Chinese Academy of Science. The authors are very grateful to
Dr. Y.C. Dai (Institute of Applied Ecology, Chinese Academy of Sciences) and Dr. J.P. Xu
(Department of Biology, McMaster University) for reviewing the manuscript; Dr. Z.W.
Ge for assistance in specimen collecting; Dr. L.S. Wang, Dr. E.D. Liu, and Dr. H. Peng
(Kunming Institute of Botany, Chinese Academy of Sciences) for the loan of herbarium
specimens; Mr. S. Shi (Institute of Botany, Chinese Academy of Sciences) for providing
references; Ms. X.F. Zhu for inking in line drawings; to Dr. X.L. Wang (Institute of
Microbiology, Chinese Academy of Sciences) for providing advice and suggestions
regarding phylogenetic analysis; Dr. B.A. Jaffee (University of California Davis), Dr.
Z.L. Yang (Kunming Institute of Botany, Chinese Academy of Sciences), Dr. J.Y. Zhuang
(Institute of Microbiology, Chinese Academy of Sciences), Dr. S.R. Pennycook (Landcare
Research) and Dr. L.L. Norvell (Pacific Northwest Mycology Service) for improving
the manuscript; and Dr. C.L. Li and Ms. J.N. Liang (Institute of Microbiology, Chinese
Academy of Sciences) for providing assistance in SEM photography.
Literature cited
Bi ZS, Li TH. 1986. A preliminary report note on Russula species from Guangdong, with a new
species and a new variety. Guihaia 6: 193-199.
Bills GE, Holtzman GI, Miller OK. 1986. Comparison of ectomycorrhizal—basidiomycete
communities in red spruce versus northern hardwood forests of West Virginia. Canadian
Journal of Botany 64: 760-768. http://dx.doi.org/10.1139/b86-098
Bougher NL. 1997. Three new sequestrate Basidiomycetes from western Australia. Mycotaxon 58:
37-48.
Buyck B, Atri NS. 2011. A Russula (Basidiomycota, Russulales) with an unprecedented hymenophore
configuration from northwest Himalaya (India). Cryptogamie Mycologie 32: 185-190.
Buyck B, Thoen D, Watling R. 1996. Ectomycorrhizal fungi of the Guinea-Congo Region.
Proceeding of the Royal Edinburgh, B 104: 313-333.
Claridge AW, May TW. 1994. Mycophagy among Australian mammals. Australian Journal of
Ecology 19: 251-275. http://dx.doi.org/10.1111/j.1442-9993.1994.tb00489.x
Chiu WE. 1945. The Russulaceae of Yunnan. Lloydia 8: 31-59.
186 ... Li & al.
Dai YC, Wei YL, Wang Z. 2004. Wood-inhabiting fungi in southern China 2. Polypores from
Sichuan Province. Ann. Bot. Fennici 41: 319-329.
Dai YC, Yu CJ, Wang HC. 2007. Polypores from eastern Xizang (Tibet), western China. Ann. Bot.
Fennici 44: 135-145.
Dai YC, Yang ZL, Cui BK, Yu CJ, Zhou LW, 2009. Species diversity and utilization of medicinal
mushrooms and fungi in China (Review). International Journal of Medicinal Mushrooms 11:
287-302. http://dx.doi.org/10.1615/IntJMedMushr.v11.i3.80
Das K, Verbeken A. 2011. Three new species of Lactarius (Russulaceae) from Sikkim, India.
Cryptogamie Mycologie 32: 365-381.
Das K, Putte KVD, Buyck B. 2010. New or interesting Russula from Sikkim Himalaya (India).
Cryptogamie Mycologie 31: 373-387.
Eberhardt U. 2002. Molecular kinship analyses of the agaricoid Russulaceae: Correspondence with
mycorrhizal anatomy and sporocarp features in the genus Russula. Mycological Progress 1:
201-223. http://dx.doi.org/10.1007/s11557-006-0019-6
Eberhardt U, Verbeken A. 2004. Sequestrate Lactarius species from tropical Africa: L. angiocarpus
sp. nov. and L. dolichocaulis comb. nov. Mycol. Res. 108: 1042-1052.
http://dx.doi.org/10.1017/S0953756204000784
Felsenstein J. 1985. Confidence intervals on phylogenetics: an approach using bootstrap. Evolution
39:783-791. http://dx.doi.org/10.2307/2408678
Gao JM, Dong ZJ, Liu JK. 2001. A new ceramide from Basidiomycetes Russula cyanoxantha. Lipids
36: 175-280. http://dx.doi.org/10.1007/s11745-001-0704-x
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes—application
to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.
http://dx.doi.org/10.1111/j.1365-294X.1993.tb00005.x
Gardes M, Bruns TD. 1996. Community structure of ectomycorrhizal fungi in a Pinus muricata
forest: above- and below- ground views. Canadian Journal of Botany 74: 1572-1583.
http://dx.doi.org/10.1139/b96-190
Hall BG 2004. Phylogenetic trees made easy: a how-to manual, 2nd edn. Sinauer Associates,
Sunderland.
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/N'TT. Nucleic Acids Symposium Series 41: 95-98.
Imazeki R, Hongo T. 1989. Colored illustrations of mushrooms of Japan Vol. II. Hoikusha Publish
Co., Ltd: Osaka.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi. 10th Edition. CABI
Europe-UK.
Larget B, Simon DL. 1999. Markov chain Monte Carlo algorithms for the Bayesian analysis of
phylogenetic trees. Mol. Biol. Evol. 16: 750-759. http://dx.doi.org/10.1093/oxfordjournals.
molbev.a026160
Lebel T, Castellano MA. 2002. Type studies of sequestrate Russulales II. Australian and New Zealand
species related to Russula. Mycologia 94: 327-354. http://dx.doi.org/10.2307/3761811
Lebel T, Tonkin JE. 2007. Australasian species of Macowanites are sequestrate species of Russula.
Australian Systematic Botany 20: 355-381. http://dx.doi.org/10.1071/SB07007
Li GJ, LiSE Wen HA. 2010a. The Russula species resource and its economic values of China. Acta
Edulis Fungi 17(sppl): 155-160.
Li GJ, Li SEK Wen HA. 2011. Russula zhejiangensis sp. nov. from East China. Cryptogamie Mycologie
32: 127-133.
Li GJ, Li SF, Liu XZ, Wen HA. 2012. Russula jilinensis sp. nov. (Russulaceae) from northeast China.
Mycotaxon 120:49-58. http://dx.doi.org/10.5248/120.49
Russula spp. nov. (China) ... 187
Li MC, Liang JF, Li YC, Feng B, Yang ZL, James TY, Xu JP. 2010b. Genetic diversity of dahongjun,
the commercially important “big red mushroom” from southern China. PLoS ONE 5(5): 1-11.
http://dx.doi.org/10.1371/journal.pone.0010684
Liang Y, Guo LD, Ma KP. 2004. Genetic structure of a population of the ectomycorrhizal fungus
Russula vinosa in subtropical woodlands in southwest China. Mycorrhiza 14: 235-240.
http://dx.doi.org/10.1007/s00572-003-0260-7
Liu JK. 2004. Mycochemistry. China Science & Technology Press: Beijing.
Liu JK. 2005. N-Containing compounds of macromycetes. Chemical Reviews 105: 2723-2744.
http://dx.doi.org/10.1021/cr0400818
Miller SL. 2004. Hypogeous fungi from the southeastern United States 3. The genus Macowanites.
Mycotaxon 89: 283-288.
Miller SL, Buyck B. 2002. Molecular phylogeny of the genus Russula in Europe with a comparison
of modern infrageneric classifications. Mycol. Res. 106: 259-276.
http://dx.doi.org/10.1017/S0953756202005610
Miller SL, McClean TM, Walker JE, Buyck B. 2001. A molecular phylogeny of the
Russulales including agaricoid, gasteroid and pleurotoid taxa. Mycologia 93: 344-354.
http://dx.doi.org/10.2307/3761656
Page RMD. 1996. Treeview: An application to display phylogenetic trees on personal computers.
Comput App! Biosci 12:357-358.
Pegler DN, Young TWK. 1979. The gasteroid Russulales. Transactions of the British Mycological
Society 72: 353-388. http://dx.doi.org/10.1016/S0007-1536(79)80143-6
Richardson MJ. 1970. Studies of Russula emetica and other agarics in Scots pine plantation.
Transactions of the British Mycological Society 55: 217-229.
http://dx.doi.org/10.1016/S0007-1536(70)80006-7
Ridgway R. 1912. Color standards and color nomenclature. Robert Ridgway, Washington.
Roger P. 1981. Mushrooms and other fungi of Great Britain and Europe. Pan Books, London.
Romagnesi H. 1967. Les Russules d’Europe et d'Afrique du Nord. Bordas, Paris
Romagnesi H. 1985. Les Russules d’Europe et d'Afrique du Nord. Reprint with supplement. J.
Cramer, Lehre.
Romagnesi H. 1987. Status et noms nou veaux pour les taxa infragénériques dans le genere Russula.
Doc. Mycol. 18: 39-40.
Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: bayesian phylogenetic inference under mixed
models. Bioinformatics 19:1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Ryman S, Fransson P, Johannesson H, Danell E. 2003. Albatrellus citrinus sp. nov., connected to
Picea abies on lime rich soils. Mycol. Res. 107 (10): 1243-1246.
http://dx.doi.org/10.1017/S0953756203008359
Sarnari M. 1998. Monografia illustrate de genere Russula in Europa. Tomo Primo. AMB, Centro
Studi Micologici, Trento.
Schaeffer J. 1952. Russula Monographie. Klinkhardt, Bad Heilbrunn.
Shimono Y, Kato M, Takamatsu S. 2004. Molecular phylogeny of Russulaceae (Basidiomycetes;
Russulales) inferred from the nucleotide sequences of nuclear large subunit rDNA. Mycoscience
45: 303-316. http://dx.doi.org/10.1007/s10267-004-0189-5
Singer R. 1935. Supplemente zu meiner Monographie der Gattung Russula. Ann. Mycol. 33:
297—332..
Singer R. 1986. The Agaricales in modern taxonomy. 4th ed. Koeltz Scientific Books: Koenigstein.
Smith AH. 1963. New astrogastraceous fungi from the Pacific Northwest. Mycologia 55: 421-441.
http://dx.doi.org/10.2307/3756337
Swofford DL. 2004. PAUP’: Phylogenetic Analysis Using Parsimony and other methods.
Version4.0b10. Sinauer, Sunderland.
Tai FL. 1979. Sylloge fungorum Sinicorum. Science Press, Beijing.
188 ... Li & al.
Tan JW, Dong ZJ, Liu JK. 2001. A sesquiterpenoid from Russula lepida. Acta Botanica Sinica 3:
329-330.
Tan JW, Xu JB, Dong ZJ, Luo DQ, Liu JK. 2004. Nigricanin, the first ellagic acid derived metabolite
from the Basidiomycete Russula nigricans. Helvetica Acta Sinica 87: 1025-1028.
Thompson JD, Gibson TJ, Plewnlak F, Jianmougin F, Higgins DG. 1997. The Clustal X windows
interfaces: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
Wang XH, Liu PG. 2002. Resource investigation and studies on the wild commercial fungi in
Yunnan. Biodiversity 10: 318-325.
Wang XH, Liu PG. 2009. A type study of Lactarius sakamotoi and its presence in China. Cryptogamie
Mycologie 30: 45-51.
Wang XH, Liu PG. 2010. Multifurca (Russulales), a new genus new to China. Cryptogamie
Mycologie 31: 9-16.
Wang XH, Liu PG, Yu FQ. 2004. Color atlas of wild commercial mushrooms in Yunnan. Yunnan
Science and Technology Press, Kunming.
Wang XH, Yang ZL, Li YC, Knudsen H, Liu PG. 2009. Russula griseocarnosa sp. nov.
(Russulaceae, Russulales), a commercially important edible mushroom in_ tropical
China: mycorrhiza, phylogenetic position, and taxonomy. Nova Hedwigia 88: 269-282.
http://dx.doi.org/10.1127/0029-5035/2009/0088-0269
Wang XH, Stubbe D, Verbeken A. 2012. Lactifluus parvigerardii sp. nov., a new link towards
the pleurotoid habit in Lactifluus subgen. Gerardii (Russulaceae, Russulales). Cryptogamie
Mycologie 33: 181-190.
Wen HA, Ying JZ. 2001. Studies on the genus Russula from China II. Two new taxa from Yunnan
and Guizhou. Acta. Mycol. Sinica. 20: 153-155.
Woo B. 1989. Trial field key to the species of Russula in the Pacific Northwest. A macroscopic
field key to selected common species reported from Washington, Oregon, and Idaho. Pacific
Northwest Key Council.
Yang ZL. 2000. Type studies on agarics described by N. Patouillard (and his co-authors) from
Vietnam. Mycotaxon 75: 431-476.
Yang ZL. 2002. On wild mushroom resources and their utilization in Yunnan Province, Southwest
China. Journal of Natural Resources 17: 463-469.
Yang ZL, Zang M. 2003. Tropical affinities of higher fungi in southern China. Acta Botanica
Yunnanica 25: 129-144.
Ying JZ. 1983. A study on Russula viridi-rubrolibata sp. nov. and its related species of subsection
Virescentinae. Acta. Mycol. Sinica. 2: 34-37.
Ying JZ. 1989. Studies on the genus Russula Pers. from China 1. New taxa of Russula from China.
Acta. Mycol. Sinica. 8: 205-209.
Ying JZ, Zhao JD, Mao XL, Ma QM, Xu LW, Zong YC. 1982. Edible mushrooms. Science Press:
Beijing.
Ying JZ, Mao XL, Ma QM, Zong YC, Wen HA. 1987. Icons of medicinal fungi from China. Science
Press: Beijing.
Yuan HS, Dai YC. 2008. Polypores from northern and central Yunnan Province, Southwestern
China. Sydowia 60: 147-159.
Zang M, Yuan MS. 1999. Contribution to the knowledge of new basidiomycetous taxa from China.
Acta Botanica Yunnanica 21:37-42.
Zhao S, Zhao YC, Li SH, Zhao JK, Zhang GQ, Wang HX, Ng TB. 2010. A novel lectin with highly
potent antiproliferative and HIV-1 reverse transcriptase inhibitory activities from the edible
wild mushroom Russula delica. Glycoconj. J. 27: 259-265.
http://dx.doi.org/10.1007/s10719-009-9274-5
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.189
Volume 124, pp. 189-208 April-June 2013
Five new Terfezia species from the Iberian Peninsula
JUAN-JULIAN BORDALLO’, ANTONIO RODRIGUEZ’, JUSTO M. MuNOz-
MOHEDANO’!, LAURA M. Suz 7, MARIO HONRUBIA! & ASUNCION MorRTE"
"Departamento de Biologia Vegetal (Botanica), Facultad de Biologia, Universidad de Murcia,
Murcia, 30100, Spain
? Mycology section, Jodrell Laboratory, Royal Botanic Gardens,
Kew, Richmond, Surrey, TW93DS, UK
* CORRESPONDENCE TO: [email protected]
ABSTRACT — A phylogenetic analysis of Iberian Terfezia collections indicates eight clades, of
which three correspond with previously described species (T: alsheikhii, T. fanfani, T. olbiensis)
and five are described as new species — T. albida, T. eliocrocae, T. extremadurensis, T: pini,
and T: pseudoleptoderma. These results are supported by the morphology of the examined
Terfezia ascomata that were identified by their ecological patterns and chorology, as well as
by phylogenetic analyses. Morphological features and ITS-rDNA sequence analyses from
identified Terfezia specimens are described. A key to these Terfezia species is also provided.
Key worps — desert truffle, hypogeous, mycorrhizal fungi, Pezizaceae
Introduction
The genus Terfezia (Tul. & C.Tul.) Tul. & C.Tul. includes twelve species (Kirk
et al. 2008) of hypogeous ascomycetes formerly placed in the family Terfeziaceae
within the order Pezizales (Trappe 1979). However, based on molecular and
morphological characters, Terfezia is now accepted in the Pezizaceae (Norman
& Egger 1999; Percudaniet al. 1999; Laessoe & Hansen 2007). These hypogeous
fungi are edible and are known as “desert truffles” due to their habitat in
typically arid and semi-arid ecosystems, mostly in the Mediterranean region
(Morte et al. 2009).
Most Terfezia species establish mycorrhizal symbiosis with plants from
family Cistaceae, mainly with perennial and annual Helianthemum species
(Dexheimer et al. 1985; Fortas & Chevalier 1992; Gutiérrez et al. 2003) or with
trees from different phyla (Diez et al. 2002; Taylor et al. 1995). These plants
and their associated fungi play a major role in maintaining Mediterranean
shrub lands and xerophytic grasslands and thus in preventing erosion and
190 ... Bordallo & al.
desertification (Honrubia et al. 1992). This mycorrhizal association is well
adapted to semiarid climates through the physiological mechanism of drought
avoidance (Morte et al. 2000, 2010).
Six Terfezia species have been reported so far from the Iberian Peninsula:
T. claveryi Chatin, T: boudieri Chatin, T: arenaria (Moris) Trappe, T: leptoderma
Tul. & C. Tul., T. olbiensis, and T. alsheikhii. Terfezia claveryi, T. boudieri, and
T. olbiensis have been recorded from basic soils and T: arenaria from acid soils,
but all four in mycorrhizal association with different Helianthemum species.
However, T: leptoderma has been found in association with Tuberaria guttata
L. Fourr. in acid soils, with Cistus in slate-derived soils, and with Quercus ilex
L. and Pinus halepensis Mill. in basic soils (Diez et al. 2002). Isolations from
Cistus, Pinus, and Quercus could belong to distinct species with different host
or/and edaphic specialization. These authors emphasized that the sampling in
these ecosystems is scanty and further study is necessary. Moreover, the small
spores of T: leptoderma specimens collected under pine and evergreen holm
oak fit those of T. olbiensis, which was described as morphologically similar to
T. leptoderma, except for slightly smaller spores and shorter spines (Diez et al.
2002). There is a certain consensus that T: olbiensis is an immature form and a
synonym of T leptoderma (Diez et al. 2002; Moreno et al. 1986).
The main objective of this study was to describe five new Terfezia species. For
this purpose, we conducted classical morphological studies complemented by
phylogenetic analyses based on ITS-rDNA sequences from Terfezia specimens
collected throughout the Iberian Peninsula.
Materials & methods
Fungal specimens
Ascomata of Terfezia spp. were collected in different years and from different
locations in the Iberian Peninsula (Spain and Portugal). The ascomata were collected
from cracks in the soil close to host plants. Characterized and sequenced specimens are
listed in TaBLE 1. Generally, three specimens per collection were used when the material
was fresh. Furthermore, conserved dried material was processed. Soil characters were
obtained from the Spanish Geological Map, according to FAO-CEE, 1998 from the
“Atlas Nacional de Espafia” (IGN). The different host plants were identified using Flora
Ibérica keys (Mufioz-Garmendia & Navarro 1993).
External ascocarp characteristics (shape, colour, appearance) were recorded in detail.
Ascomata were then cut and the morphology of the peridium and gleba was described.
Asci and ascospores were examined using an Olympus BX51 microscope equipped with
a digital camera (Canon PSprol). A minimum of 100 asci, ascospores, and peridial warts
was measured per species. The ascospores of Terfezia eliocrocae and T. pseudoleptoderma
were stained with acid fuchsine solution (0.01% acid fuchsine in acetic acid, ethylene
glycol, and lactic acid, 1:1:1, v/v/v) to improve visualization.
Samples of the collected specimens are stored in the Mycological Herbarium of the
Botany Area of the University of Murcia (MUB).
TABLE 1. Terfezia collections analyzed
CLADE
e
DNDAD UU uu wo Be BP BP BP BP BP BP BPW WW WW WN NO RR RR Re Re Re Re Be eS Re
NNDNNDDAAHATA AHN HD AW
COLLECTION” #
tO9*
tO10*
tO11*
tO17*
tO18
tO19
tO20*
tO21
tL9
tL10*
tL1l
tL12
#*
tO4*
tO7*
tTP1
tTP2*
tL13
#*
ORIGIN 4“ & Host
Belvis (Cc). Tuberaria guttata
Belvis (Cc). T: guttata
Belvis (Cc). T: guttata
Valdecafias (Cc). T. guttata
Valdecafias (Cc). T. guttata
Valdecafias (Cc). T. guttata
Castuera (Ba). T: guttata
Castuera (Ba). T: guttata
Valdecafias (Cc). T. guttata
Valdecafias (Cc). T. guttata
Valdecafias (Cc). T. guttata
Valdecafias (Cc). T. guttata
C. Arafiuelo (Cc). T. guttata
Lorca (Mu). Helianthemum
Lorca (Mu). Helianthemum
Montesihno. Portugal. Cistaceae
Montesihno. Portugal. Cistaceae
Quintana (Ba). Cistaceae
Sieteiglesias (Va). Quercus
Ronquines (Va). Pinus
Ronquines (Va). Pinus
Cornudilla (Bu). Pinus
Cornudilla (Bu). Pinus
Cornudilla (Bu). Pinus
Cornudilla (Bu). Pinus
Madrid. Pinus
Villafranca (Bu). Cistaceae
Villafranca (Bu). Cistaceae
Villafranca (Bu). Cistaceae
Valdecafias (Cc). Pinus
Madrid
Belvis (Cc). T: guttata
Belvis (Cc). T: guttata
Belvis (Cc). T: guttata
Castuera (Ba). Cistaceae
Garrovilla (Cc). T. guttata
Garrovilla (Cc). T. guttata
Garrovilla (Cc). T. guttata
Valdecafias (Cc). T. guttata
Valdecafias (Cc). T. guttata
Cortas Blas (Va). Cistaceae
Quintana (Ba). T. guttata
Quintana (Ba). T. guttata
Cafiaveral (Hu). Cistaceae
Terfezia spp. nov. (Iberia) ... 191
YEAR, COLLECTOR
2009. J. Mohedano
2009. J. Mohedano
2009. J. Mohedano
2009. J. Mohedano
2009. J. Mohedano
2009. J. Mohedano
2009. M. Romero
2009. M. Romero
2007. J. Mohedano
2007. J. Mohedano
2007. J. Mohedano
2007. J. Mohedano
2002. J. Diez
2001. A. Morte
2007. A. Morte
2006. A. Rodriguez
2006. A. Rodriguez
2008. M. Romero
2011. G. Kovacs
2011. G. Kovacs
2003. A. Garcia
1998. A. Garcia
1998. A. Garcia
2008. FE Sainz
2008. FE Sainz
2008. E Sainz
2008. E Sainz
2008. Barriuso et al.
2008. E Sainz
2008. FE Sainz
2008. FE Sainz
2010. J. Mohedano
2008. A. Rincon
2009. J. Mohedano
2009. J. Mohedano
2009. J. Mohedano
2009. M. Romero
2004. A. Mateos
2004. A. Mateos
2004. A. Mateos
2001. J. Mohedano
2001. J. Mohedano
1998. A. Garcia
2009. M. Romero
2009. M. Romero
2002. J. Diez
2002. J. Diez
GENBANK N°
HM056199
HM056200
HMO056201
HM056202
HM056203
HM056204
AF276678
HM056205
HM056206
HM056207
HM056208
HQ698098
HQ698100
HM056209
HM056210
DQ386140
HM056211
HM056212
HM056213
FJ013064
HM056214
HM056215
HM056216
HM056217
HM056218
HM056219
AF396862
AF276676
192... Bordallo & al.
TABLE 1, concluded
CLADE COLLECTION” # ORIGIN “ & Host YEAR, COLLECTOR GENBANK N°
6 #* Madrid. 2008. A. Rincén FJ013087
— #* Valencia. Pinus 2002. J. Diez AF396864
7 tO15* Ballestero (Ab). Helianthemum 2009. A. Rodriguez HM056220
7 tO16* Albacete (Ab). Helianthemum 2009. A. Rodriguez HM056221
7 #* Murcia. Helianthemum 2001. A. Gutiérrez AF387655
8 tO12* Masegoso (Ab). Quercus 2009. A. Rodriguez HM056222
8 tO13 Masegoso (Ab). Quercus 2009. A. Rodriguez
8 tO14* Masegoso (Ab). Quercus 2009. A. Rodriguez HM056223
8 tO34* Santa Espina (Va). Pinus 1998. A. Garcia HM056224
8 tO39* Onteniente (V). Pinus 2009. EF Garcia HM056225
8 #* Murcia. Pinus 2001. Gutiérrez et al AF387656
8 #* — 2002. J. Diez AF276677
8 #* France. Quercus 2002. J. Diez AF396863
— #* Jarada. Morocco 1994. M. Achouri AF301421
= #* C. Arafiuelo (Cc). 2002. J. Diez AF276674
— #* Zeelim. Israel 1996. Bedouins AF092098
* = included in the cladistic analysis; # = external sequence.
S Spanish provinces: Ab: Albacete; Ba: Badajoz; Bu: Burgos; Cc: Cacerese; Hu: Huelva;
Mu: Murcia; V: Valencia; Va: Valladolid.
Macroscopic and microscopic characterization
For identification, ascomata were compared with descriptions from Mattirolo (1900,
1906, 1907, 1922), Lazaro Ibiza (1908), Malencon (1938, 1973), Ceruti (1960), Cerutti et
al. (2003) and keyed according to Montecchi & Lazzari (1993) and Montecchi & Sarasini
(2000). Trappe (1971, 1979), Calonge et al. (1977) and Honrubia et al. (1992) were
also taken into account. The descriptions of Tuber lutescens Lazaro Ibiza (= Terfezia
lutescens (Lazaro Ibiza) Malencon) and T: pallidum Lazaro Ibiza (= T! pallida (Lazaro
Ibiza) Malencon) were also consulted (Lazaro Ibiza 1908, Malencon 1938). In addition,
descriptions of T’ leptoderma, T: fanfani, T. cadevalli Font Quer, T: hafizi Chatin,
T. berberiodora Lesp. ex Tul. & C.Tul., and T. goffartii Chatin were also checked.
DNA analyses
Genomic DNA was isolated from 150-200 mg of the inner gleba of the ascocarps using
the E.Z.N.A. Fungal DNA kit (Omega Bio-Tek, Doraville, GA, USA) and following the
manufacturer's instructions. The Internal Transcribed Spacer (ITS) region of the rDNA,
including the 5.8S ribosomal gene, was amplified using the universal ITS5 and ITS4
primers (White et al. 1990). All PCR amplifications were carried out in a final volume
of 25 uL containing 0.2 mM of each dNTP, 0.6 uM of each primer, 3.75 mM MgCL, 1X
PCR buffer and 1.25 U of Taq DNA polymerase (Invitrogen, California, USA).
PCR reactions were performed in a Mastercycler Gradient thermocycler (Eppendorf,
Hamburg, Germany) with the following cycling parameters: an initial denaturalization
step for 2 min at 94°C, 30 cycles consisting of 30 s at 94°C, 1 min at 65°C, and 1 min at
72°C, and a final extension at 72°C for 4 min.
PCR products were purified using the E.Z.N.A. Cycle-Pure kit (Omega Bio-Tek)
following the manufacturer's instructions. Clean PCR products were sequenced in both
directions at the Molecular Biology Service (University of Murcia). The BioEdit (Hall
Terfezia spp. nov. (Iberia) ... 193
1999) program was used to obtain the consensus sequence of each sample. Sequences
were deposited on GenBank (NCBI) under accession numbers indicated in TaBLE 1.
Phylogenetic analyses
Nucleotide Basic Local Alignment Search Tool (BLAST) searches (megablast) were
used to compare the sequences obtained in this study with other DNA sequences in
GenBank (NCBI, Altschul et al. 1997) to provisionally identify the specimens prior to
phylogenetic analyses. The sequence alignment was carried out with ClustalW (MEGA
software, version 4; Tamura et al. 2007), following the default options. A minimal
manual adjustment was made with the MEGA v.4 editor. Alignments are available in
TreeBase (http://purl.org/phylo/treebase/phylows/study/TB2:S 10906?x-access-code=ea
dd311aaa59cd96424d699af26cb699&format=html)
Evolutionary history was inferred based on the Maximum Parsimony (MP; Eck
& Dayhoff 1966) and the Minimum Evolution (ME; Rzhetsky & Nei 1992) methods
using MEGA v.4. The closest species not belonging to the sister group were selected as
outgroups. The bootstrap consensus tree inferred from 1,000 replicates was taken to
represent the evolutionary history of the taxa analyzed. The branches corresponding
to the partitions reproduced in less than 50% bootstrap replicates were excluded. The
percentages of replicate trees in which the associated taxa clustered together in the
bootstrap test (1000 replicates) are shown next to the branches (Felsenstein 1985).
The MP tree (PLATE 1) was obtained using the Close-Neighbour-Interchange
algorithm at search level 3 with which the initial trees were obtained with the random
addition of sequences (10 replicates). The tree was drawn to scale, and branch lengths
were calculated using the average pathway method (Nei & Kumar 2000). The number
of changes over the whole sequence is presented in units. All positions with gaps and
missing data were eliminated from the dataset (the Complete Deletion option). The final
dataset contained a total of 429 positions, of which 69 were parsimony informative.
The ME tree was drawn to scale, with branch lengths in the same units as those of the
evolutionary distances used to infer the phylogenetic tree. The evolutionary distances
were computed using the Maximum Composite Likelihood method (Tamura et al.
2004) and are presented in the units of the number of base substitutions per site. The
ME tree was searched using the Close-Neighbour-Interchange (CNI) algorithm (Nei &
Kumar 2000) at search level 1. The Neighbour-joining algorithm (Saitou & Nei 1987)
was used to generate the initial tree. All the positions with gaps and missing data were
eliminated from the dataset (the Complete Deletion option). The final dataset contained
a total of 429 positions.
The sequences from T. claveryi, T. boudieri and T: arenaria were chosen as
outgroup.
Phylogenetic results
Sequence analyses of the ITS-rDNA from the examined samples produced
two trees based on the Maximal Parsimony (MP) and the Minimum Evolution
(ME) methods, both with a virtual sampling or bootstrap of 1000 replicas.
In the ME phylogeny, the 38 sequences are clearly distributed in eight well-
separated lines (PLATE 1) that match the eight phenetically described species.
194 ... Bordallo & al.
tO17 Terfezia extremadurensis
tO11Terfezia extremadurensis
tooTerfezia extremadurensis
CLADE 1
AF276678 Tuberaria guttata, acid soils,
spined ascospores
99/83 tL10Terfezia extremadurensis
tO20Terfezia extremadurensis
94/46
‘— tO10Terfezia extremadurensis
CLADE 2
tO7Terfezia eliocrocae Helianthemum spp, basic soils,
reticulated ascospores
99/99 tO4Terfezia eliocrocae
100/100 facet tae alsheikhii CLADE 3
a Cistaceae, acid soils,
99/96 tTP2 Terfezia alsheikhii teliculdted ascospores
91/81 DQ386140
oe CLADE 4
93/90 tO32Terfezia pini Pinus spp, Quercus: app; sandy soils,
spined ascospores
— tO40Terfezia pini
9/81
;——— tL17 Terfezia pseudoleptoderma
tO42Terfezia pseudoleptoderma ices
P Py Cistaceae, sandy soils,
89/81 é
U spined ascospores
> FJO13064
99/97 — tL16Terfezia pseudoleptoderma
AF396862
tL7Terfezia fanfani
CLADE 6
tLiTerfezia fanfani Tuberaria guttata, acid soils,
spined ascospores
97/93 99/97 tO23Terfezia fanfani
tL8Terfezia fanfani
tL14Terfezia fanfani
FJO13087
77
cea AF276676
85/90 tO22
AF396864
tO1STerfezia albida
99/98
48/03 a CLADE 7
tO16Terfezia albida Ctstaceae, marl soils,
[| spined ascospores
AF387655
tO14Terfezia olbiensis
72/55
tO34Terfezia olbiensis
AF276677
97/74
; | CLADE 8
AF396863 Pinus spp, Quercus spp, marl soils,
spined ascospores
'— tO39Terfezia olbiensis
U AF387656
tO12Terfezia olbiensis
AF092098Terfezia boudieri
AF301421Terfezia claveryi
AF276674Terfezia arenaria
rr
0.005
Terfezia spp. nov. (Iberia) ... 195
The MP phylogenetic topology is consistent with that of the ME analysis in
which the same nodes and clusters are reproduced (PLATE 1). The cladogram
distinguishes eight clades (TABLE 2).
TABLE 2. Diagnostic characters of clades and Terfezia spp.
CLADE SPECIES BOOTSTRAP % SOIL Host
1 T. extremadurensis 94 Acid Tuberaria guttata
2 T. eliocrocae 94 Alkaline Helianthemum spp.
3 T. alsheikhii 89 Acid Cistaceae
4 T. pini 91 Acid Pinus spp., Quercus spp.
5 T. pseudoleptoderma 91 Acid Cistaceae
6 T. fanfani 70 Acid Tuberaria guttata
7 T. albida 70 Alkaline Helianthemum spp.
8 T. olbiensis 70 Alkaline Pinus spp., Quercus spp.
Taxonomy
The morphology and distributions of the examined specimens support eight
phenetic species, described below (presented in clade order; PLATE 1).
Terfezia extremadurensis Mufioz-Mohedano, Ant. Rodr. & Bordallo, sp. nov.
MycoBank MBs561591 PLATE 2A,B
Differs from all other spiny-spored Terfezia spp. by its larger spores with wider spines
and its Tuber-like glebal morphology.
Type: Spain, Extremadura, Caceres, Belvis de Monroy, 17 March 2009, leg Mufioz-
Mohedano (Holotype, MUB Fung-0026).
EryMo_oey: referring to Extremadura, the western Spanish region where the species
was first identified
AscomMatTa hypogeous to partially emergent at maturity, 2-5 cm, subglobose,
sometimes furrowed and nodulose, often cracked, often with a small basal
depression, rarely with pseudostipe, cream colour at first, becoming brown,
black spots on the sun-exposed parts or where handled, smooth. PERIDIUM
300-600 um thick, well-defined, concolorous with surface in cross section,
pseudoparenchymatous, composed of subglobose cells, hyalines and thin-
walled in the innermost layers, yellowish and with thicker walls in the outermost
layers. GLEBA solid, fleshy, succulent, whitish at first, soon becoming salmon
pink, darkening with age, greenish grey at maturity, marbled with thin, white,
PiaTE 1. Minimum Evolution (ME) and Maximum Parsimony (MP) consensus tree showing
evolutionary relationships of 38 sequences derived from the ITS-rDNA region. On each branch, %
of 1000 bootstrapping replicates supported by ME is shown first (in bold) and by MP second (in
plain font). Host plant, soil, and ascospore information is presented for each clade. Non-significant
bootstrap values under 70 are not included.
196 ... Bordallo & al.
meandering veins, sometimes arising from the base and inconspicuous in very
mature specimens; frequently with small holes indicating mycophagous activity.
Odour faint, not distinctive. Asci inamyloid, subglobose to ovate, sessile or
short-stipitate, 60-80 x 50-65 um, walls 1-2 um thick, with 6-8 irregularly
disposed spores, randomly arranged in the gleba. Ascospores globose, (21-)
22-26(-27) um diam (median = 24 um) including ornament [(16-)17-19(-20)
um (median = 18 um) without ornament], hyaline, smooth and uniguttulate
at first, by maturity yellow and ornamented with conical, blunt, thick spines,
sometimes truncated, sometimes finger-like, often joined at the base, 3-4(-5)
uum long, 1-3 um wide at the base.
ECOLOGY & DISTRIBUTION — Widely distributed in the western half of
the Iberian Peninsula, common in grassland of Extremadura in sandy, acid
soils, associated exclusively with Tuberaria guttata, from late winter to early
spring. This is the earliest Terfezia species to appear (in March) associated with
T. guttata.
ADDITIONAL COLLECTIONS EXAMINED: SPAIN: EXTREMADURA, CACERES: Valdecajfias,
2007, Mufioz-Mohedano (MUB Fung-0012); 2009, Mufioz-Mohedano (MUB Fung-
0035); Bapayoz: Castuera, 2009, M. Romero (MUB Fung-0036).
CoMMENTS — Terfezia extremadurensis differs from other spiny-spored
Terfezia species in its Tuber-like gleba, with meandering veins of the gleba not
completely surrounding the fertile tissue and not forming pockets as is typical
for all other Terfezia species. Terfezia fanfani, described below, shares the same
habitat but has reddish tones, a different gleba, and smaller spores (19-22 um)
with thin spines 1 um wide at the base.
Clade 1 comprises T: extremadurensis and clearly differs from the other
Terfezia species in the shape of the gleba (reminiscent of Tuber) and the
ascospores with truncated crested spines. As far as we are aware, these two
characteristics have not been described to date for Terfezia. The phylogenetic
analyses clearly support with a high bootstrap value this taxon in an independent
clade (PLATE 1). Despite the similarity of T. lutescens (Malencon 1938) to
T. extremadurensis, the absence of any description of spines with crossed crests
(an undoubtedly visible character) by Lazaro Ibiza (1908) leads us to think that
it is actually a different species. However, we were unable to find the original
samples of Lazaro Ibiza to compare their ITS-rDNA sequences.
Terfezia eliocrocae Bordallo, Morte & Honrubia, sp. nov. PLATE 2C,D
MycoBank MB561592
Differs from other reticulated spored Terfezia spp by its friable and crumbly gleba that
remains milky white when exposed.
Tye: Spain, Murcia, Lorca, Zarzadilla de Totana, 21 April 2007, leg A. Morte (Holotype,
MUB Fung-0015).
Terfezia spp. nov. (Iberia) ... 197
Erymo oey: referring to Eliocroca, old Roman name for the city of Lorca (Murcia,
Spain), and its surrounding area, where the type specimen was collected.
ASCOMATA more or less crushed shapes, roughened, embossed, >5 cm.
Cream colour, blackish aspect when ripe with a rough, cracked texture.
Sticky mycelial remains and pseudo-stipe. PERIpIUM thin, well delimited,
inseparable from the gleba, cream to blackish-brown colour, partially rough
when ripe; pseudoparenchymatous, <200 um thick, cells round, 30 x 15 um;
external layer with hyphal extensions. GLEBA intensely white, remaining white
and not darkening when mature or in contact with air; both fertile and sterile
tissues milky white with small islets of fertile tissue surrounded by very thin
ramified sterile veins. Ascr 8-spored, subglobose, ovoid or pyriform elongated.
Ascosporss spherical with a well-developed reticulum, regular, 17-19 um
diam. including ornamentation; at first hyaline and smooth, in age becoming
yellow with a very marked (<1 um tall) reticulum.
HasBitatT — Growing in grasslands on calcareous soils with Helianthemum
almeriense and H. violaceum (Cistaceae).
ADDITIONAL COLLECTIONS EXAMINED: SPAIN: Murcia: Totana, 2001, A. Morte (MUB
Fung-0005); 2007, A. Morte (MUB Fung-0016).
CoMMENTS — Terfezia eliocrocae (Clade 2), distinguished by inner milky white
colour that persists in contact with air, differs from T: berberiodora (characterized
by hazelnut-shaped ascocarps, an atypical gleba in islets, and a characteristic
flavour of Berberis vulgaris) in its smaller spores and larger ascocarps (Castro
& Freire 1982). Terfezia hafizi also produces slightly reticulate but larger (18-20
um) ascospores (Chatin 1892). The markedly reticulate ascospores distinguish
T. eliocrocae from T. hafizi and T: alsheikhii (see below).
Terfezia alsheikhii Kovacs, M.P. Martin & Calonge, Mycologia 103: 848. 2011.
PLATE 2E,F
AscoMata regular, globose, 0.5-1.5 cm, smooth, firm; no strong odour
detected. PERrpDIuM smooth, thin, inseparable from the gleba; brown-
ochre; pseudoparenchymatous throughout, with thick-walled cells <50 um
in diameter. GLEBA formed by big pinkish islets of fertile tissue, varying
in size and surrounded by a scarce sterile white tissue, stained by brown-
reddish zones when in contact with air. Asci primarily 8-spored, subglobose,
ovoid, pyriform, 60-100 x 40-70 um, sessile or with a short thick peduncle.
Ascosporss spherical, reticulate, 15-18 um diam. (including ornamentation);
at first hyaline, yellow when mature; decorated by an irregular, well-developed
reticulum with thickish (nearly 1 um) net; very mature spores with roundish to
flat warts <2 um x 2 um.
Hasitat — Terfezia alsheikhii grows in sandy acidic soils associated with
cistaceous plants.
198 ... Bordallo & al.
COLLECTIONS EXAMINED: SPAIN: EXTREMADURA, BaADaAjoz: Castuera, 2009, M.
Romero (MUB Fung-0034). PORTUGAL: BRraGANza: Portelo, Montesinho Natural
Park, 2006, A. Rodriguez (MUB Fung-0009).
COMMENTS — Gregarious specimens have been found by raking under Cistus
monspeliensis L. on the border of a forest track.
Terfezia pini Bordallo, Ant. Rodr. & Mufioz-Mohedano, sp. nov. PLATE 2G,H
MycoBank MB561594
Differs from T: fanfani and T: pseudoleptoderma by its spores with long spines joined at
their bases to form a pseudo-reticulum.
Type: Spain, Burgos, Cornudilla, 8 March 2008, leg F. Sainz (Holotype, MUB Fung-
0027).
ETyMo_ocy: referring to pinewoods, its preferred habitat.
AScCOoMATA globose, round, regular, <2 cm diam., smooth, base often with
residual mycelium. PERIDIUM smooth, slightly tomentose, thin, not clearly
delimited and difficult to separate from the gleba, 200-400 um thick; at first
cream colour, becoming ochre, grey in cross-section grey, partially covered
by a whitish film; pseudoparenchymatous, cells thick-walled, <40 um diam.,
pigmented in the outer part. GLEBA initially whitish; when mature, the fertile
tissue forming round islets of various sizes, initially pale pinkish becoming
greenish brown and greyish when very mature and always surrounded by a
sterile tissue of white veins. Asc1 6-8-spored, ovoid, ellipsoid, subglobose,
sessile, 60-90 x 45-60 um, walls lum thick. Ascosporgs spherical with spines,
20-23(-25) um (including ornamentation); initially hyaline and smooth with
a big central drop, when mature, yellowish-ochre and decorated by cylindrical
spines (3-4(-5) x 1 um) with a round tip, joined basally to form crests, often in
a pseudo-reticulum.
EcoLocy— The species grows mainly in sandy pine forests from November
to May. It is rarely observed on the surface and is often found at a depth of 3-5
cm, usually under mosses.
ADDITIONAL COLLECTIONS EXAMINED: SPAIN: CASTILE & LEON, VALLADOLID:
Sieteiglesias, 2003, Aurelio Garcia (MUB Fung-0007); Ronquines, 1998, Aurelio Garcia
(MUB Fung-0010).
COMMENTS — Terfezia pini (represented by Clade 4) is diagnosed by its
occurrence on burnt areas under pine and oak and lack of association with
cistaceous plants and its spore ornamentation comprising long spines joined at
the bases to forma pseudo-reticulum. A high bootstrap value in the phylogenetic
analyses strongly supports its separation from other species (PLATE 1).
The spine crests of T. pini resemble the lamelliform folds of the non-reticulate
episporium of T: cadevalli (Sola 1925), which is distinguished in that it forms
neither a reticulum nor clearly identifiable spines). The larger ascospores of
Terfezia spp. nov. (Iberia) ... 199
PLaTE 2. Terfezia extremadurensis (holotype, MUB Fung-0026): A, ascocarps; B, ascospores.
T. eliocrocae (MUB Fung-0016): C, ascocarps; D, ascospores. T. alsheikhii (MUB Fung-0009):
E, ascocarps; F, ascospores. T. pini (holotype, MUB Fung-0027): G, ascocarps; H, ascospores. Bars
= 10 um.
200 ... Bordallo & al.
T. goffartii (25 um without ornamentation) differentiates that species from
T: pini. Despite the ascocarps of T: pini and T. leptoderma resemble each other,
their spore ornamentations differ: the Tulasne brothers described the spicules
of T. leptoderma as isolated (Tulasnes & Tulasne 1951), not crested nor forming
a sub-reticulum on the spore surface. Moreover, the exclusive preference for
burned oak or pine habitats has not been described for T: leptoderma.
Terfezia pseudoleptoderma Bordallo, Ant. Rodr. & Mufioz-Mohedano, sp. nov.
MycoBank MB561595 PLATE 3A,B
Differs from T. leptoderma by its spore spicules with symmetric bases.
TyPE: Spain, Burgos, Villafranca Montes de Oca, Puerto de la Pedraja, 12 May 2008, leg
E Sainz (Holotype, MUB Fung-0028).
EryMo_oey: referring to the morphological similarity with Terfezia leptoderma.
Ascomarta globose, round, quite regular, <2 cm diam., smooth when immature,
partially rough when mature; initially cream colour, maturing to reddish-
brown. PERtpium smooth or slightly rough, inseparable from the gleba; cream
colour, darkening where exposed to air. GLEBA initially whitish, with the fertile
tissue forming translucent greyish-blue islets surrounded by white veins or
sterile tissue. Asc1 8-spored; globose to ovoid. Ascospores spherical, 19-23
um diam. (including ornamentation), spines separate, blunt, 2-5 um long with
bases asymmetric, <1 um diam.; initially hyaline, yellowing in age.
HABITAT — associated with cistaceous plants near pine and oak forests.
ADDITIONAL COLLECTION EXAMINED: SPAIN: EXTREMADURA, CACERES: Valdecajfias,
2010, Mufioz-Mohedano (MUB Fung-0039).
ComMENTS — The ascocarps of T: pseudoleptoderma (Clade 5) are similar in size
to T: leptoderma, which differs in the symmetric bases of the spore spicules.
In general, we noticed considerable confusion among authors who identify
specimens as T: leptoderma that are much bigger than those described by
Tulasne brothers.
Terfezia fanfani Mattir., Malpighia 14: 71. 1900. PLATE 3C,D
Ascomara globose, round, regular, occasionally lobed, usually with mycelial
remnants, 2-5 cm diam., smooth or slightly rough; firm; usually odourless.
PERIDIUM smooth, slightly rough, inseparable from the gleba, thin, 200-700
um thick; initially white, soon becoming reddish brown, darkening in maturity
with black maculae present in sun-exposed zones exposed; white in cross-
section; pseudo-parenchymatous structure formed by rounded prismatic cells.
GLEBA initially white, then fertile tissue in islets becoming pale pink, then olive
green, finally blackish grey when very mature. The gleba is always surrounded
by white sterile tissue. Asci primarily 8-spored, sessile; subglobose, elongated
Terfezia spp. nov. (Iberia) ... 201
and ovoid, 70-80 x 55-70 um diam. with 1 um thick walls. AscospoREs
spherical with spines, 19-23(-25) um diam. (including ornaments), initially
hyaline, smooth, with a large central drop; in age ochre yellow and decorated
with sharp thin elongated conic spines (2-—)3-4(-5) um long with 1 um diam.
bases (the spines not joined through the bases).
HasitatT — acidic grasslands associated with Tuberaria guttata from the
end of March to the end of April.
COLLECTIONS EXAMINED: SPAIN: EXTREMADURA, CACERES: Belvis, 2009, Mufioz-
Mohedano (MUB Fung-0032); Garrovilla, 2004, A. Mateos (MUB Fung-0008);
Valdecafias, 2001, Mufioz-Mohedano (MUB Fung-0004); Bapayoz: Quintana de Serena,
2009, M. Romero (MUB Fung-0033); CASTILE & LEON, VALLADOLID: Cortas de Blas,
1998, Aurelio Garcia (MUB Fung-0011).
ComMENTS — Terfezia fanfani is recognized by its reddish colour, its growth
with Tuberaria guttata, and its spores decorated with long and isolated spines.
Initially hypogeous, it later it rises to the surface. Sharing both habitat and
fruiting season with T. arenaria, T. fanfani fruits before T. arenaria, usually
preferring saltier and less deep soils.
In size, T. fanfani seems better to match the Clade 6 specimens that we
examined as well as those cited by other authors (Calonge et al. 1977; Ceruti
1960; Janex-Favre et al. 1988; Moreno et al. 1986). Thus for both phylogenetic
and morphological reasons, we believe this species is independent.
Terfezia albida Ant. Rodr., Mufioz-Mohedano & Bordallo, sp. nov. PLATE 3E,F
MycoBank MB561596
Differs from all other spiny-spored Terfezia spp. in its larger ascomata, its white
peridium, and its spermatic odour.
TyPeE: Spain, Albacete, El Ballestero, 2 May 2009, leg A. Rodriguez (Holotype, MUB
Fung-0029).
ETyMo_ocy: referring to the external whitish colour.
Ascomarta hypogeous to partially emergent at maturity, 2-4 cm across, 3-4 cm
high, subglobose to turbinate, pulvinate, often with tapered, sterile base, white
at first, becoming light cream, often black spots on the sun-exposed parts or
where handled, greenish with age on injured areas, smooth. PERIDIUM 200-500
uum thick, poorly delimited, white in cross section, pseudoparenchymatous,
composed of subglobose cells of variable size, hyaline and thin-walled in the
innermost layers, yellowish and with thicker walls in the outermost layers.
GLEBA Solid, fleshy, succulent, white at first, maturing to grayish green pockets
of fertile tissue separated by whitish, sometimes with pink spots, sterile veins.
Spermatic odour, stronger in young specimens. Asc inamyloid, subglobose to
ovate, sessile or short-stipitate, 70-85(-90) x 55-70 um, walls 1 um thick, with
6-8 irregularly disposed spores, randomly arranged in the gleba. AscosPoREs
202 ... Bordallo & al.
globose, (18-)19-22(-23) um diam (median = 20 um) including ornament,
14-17(-18) um (median = 16 um) without ornament, hyaline, smooth and
uniguttulate at first, by maturity yellow ochre and ornamented with conical,
blunt, straight spines, sometimes cylindrical and curved, sometimes truncated,
separate, 2-3 um long, 1-2 um wide at the base, sometimes connected to form
a pseudo-reticulum.
ECOLOGY & DISTRIBUTION— southeastern Iberian Peninsula, limited to arid
and semiarid areas in calcareous alkaline soils, associated with Helianthemum
spp., from late April to mid May.
ADDITIONAL COLLECTIONS EXAMINED: SPAIN: CasTILE-LA MANCHA, ALBACETE:
Albacete, 2009, A. Rodriguez (MUB Fung-0037).
CoMMENTS— Terfezia albida (Clade 7) differs from other spiny-spored Terfezia
species in its larger average size, white peridial colour, and spermatic odour. It
is the only spiny-spored Terfezia species associated with Helianthemum spp.
in alkaline soils. Terfezia eliocrocae (described above) and T! claveryi share the
same habitat but differ in their reticulate spores.
Clade 7 includes taxa with different morphologies, distributions, and host
plants from its sister clade, Clade 8 (where T: olbiensis is found). The two clades
are separated by a 72% bootstrap value (PLATE 1). Only after wide sampling we
were able to place T: albida in Clade 7 (associated with cistaceous plants) and
T. olbiensis in Clade 8 (associated with pine and oak hosts).
Terfezia olbiensis Tul. & C. Tul., G. Bot. Ital.1(2(7-8)): 60. 1845. PLATE 3G,H
AscomatTa globose, round, regular, rarely presents pseudostipe, 2-5 cm
across, smooth. PERrpIuM smooth, inseparable from the gleba, thin, 300-500
um thick, not clearly delimited; initially cream, becoming brown, frequently
with black maculae where exposed to the sun or bruised, white in cross-
section; pseudoparenchymatous structure formed by + rounded thin-walled
hyaline cells of different sizes that yellow and become prismatic towards the
periphery. GLEBA initially white, then fertile tissue forming small grey (later
greenish grey) islets surrounded by salmon-tinged white sterile tissue. Asc1
sessile to occasional on a short thick peduncle, 8-spored, ellipsoidal to ovoid,
citrus-shaped, 60-90 x 50-60 um with 1-2 um thick walls; dextrinoid when
immature. Ascosporgs spherical and spiny, 15-19 um (including ornament)
diam., initially hyaline, smooth, and with a great central drop, when mature
ochre yellow and covered by pointy thin conical 1-2 (-2.5) um long (base = 1
um) spines (some truncated) that are sparse and not joined through the base.
Hasitat — Terfezia olbiensis grows in limestone and clayey pine and oak
woodlands without Helianthemum spp. from mid-March to mid-April. It is the
first Terfezia species to produce ascocarps in limestone soils.
Terfezia spp. nov. (Iberia) ... 203
PLaTE 3. Terfezia pseudoleptoderma (holotype, MUB Fung-0039): A, ascocarps; B, ascospores.
T. fanfani (MUB Fung-0032): C, ascocarps; D, ascospores. T. albida (holotype, MUB Fung-0029):
E, ascocarps; EF, ascospores. T. olbiensis (MUB Fung-0031): G, ascocarps H, ascospores. Bars =
10 um.
204 ... Bordallo & al.
COLLECTIONS EXAMINED: SPAIN: CASTILE-LA MANCHA, ALBACETE: Masegoso, 2009,
A. Rodriguez (MUB Fung-0031); CASTILE & LEON, VALLADOLID: Santa Espina, 1998,
Aurelio Garcia (MUB Fung-0013); VALENCIA: Onteniente, 2009, E Garcia (MUB Fung-
0030).
COMMENTS — Initially hypogeous, T: olbiensis later rises to the surface, where
it remains firm. The fruitbodies usually are parasitized underground by larvae
or eaten by rabbits, probably because they appear early in the year, when there
is greater humidity and less sunlight. The odor is distinctive (somewhat rotten);
the flavour is less than other edible Terfezia species. The most distinguished
characteristic is the reduced length of its spines, always shorter than 2.5 um.
Although similar to T: leptoderma, T. olbiensis has a bigger ascocarp
(hazelnut- to walnut-sized) and smaller ascospores. Clade 8 taxa have different
morphological and distribution characteristics from the other clades, which is
also supported by the phylogenetic analyses with a 72% bootstrap value (PLATE
1). Therefore, we conclude that Clade 8 is formed by T: olbiensis.
Discussion
All the species described herein produce similar sized spiny to reticulate
ascospores, which has led to the belief that they represent only one species. Our
exhaustive comparison of the ascocarps and ascospores and comprehensive
ITS-rDNA sequence analyses support recognition of several species.
Our results agree with those of Diez et al. (2002), who recognized three clades
separated by a high statistical support (89%, 98%) based on morphological
(gleba structure, size of ascospore spicules, ascospore size) and biological
(acidic vs. alkaline soils, cistaceous vs. pine-oak hosts) characters. We propose
Clade 4 for Terfezia pini based on data from Barriuso et al. (2008; see GenBank
DQ386140). Moreover, a new sequence deposited by Rincén (unpublished data:
GenBank FJ013064) belongs to Clade 5. In their later phylogenetic analyses of
Terfezia spp., Ferdman et al. (2005) clearly separate DNA sequences AF276679,
AF276678, AF387657, and AF387648 into two strongly supported different
clades (100/99 bootstrap value) as T: leptoderma and T: olbiensis (Clade 8). This
scenario is contrary to Malencon’s opinion (see Diez et al. 2002, Moreno et al.
1986) that T: olbiensis represents an immature form of T: leptoderma.
The group covering species diagnosed by a spiny episporium (Clades 1,
4, 5, 6, 7 and 8) is paraphyletic, suggesting that episporium ornamentation
is not a homologous character. Therefore, we do not consider episporium
ornamentation a good taxonomic character, in contrast to other authors such
as Mattirolo (1900).
Moreover, although AF396864 was classified as T: leptoderma (Diez et al.
2002), our analyses place it in a different clade by a relatively high bootstrap
value (73/77). More sequences are needed to confirm its identity.
Terfezia spp. nov. (Iberia) ... 205
Our phylogenetic analyses corroborate the conclusion by Diez et al. (2002)
that fungus-host specialization and soil tolerance are the keys that allow us
to separate different species (clades). The monophyly of the proposed clades
(species) (PLATE 1) is congruent with the morphological (PLATEs 1 and 2) and
biological (TABLE 1) data reported for the studied taxa.
Distributed throughout temperate and subtropical regions of the northern
hemisphere, Cistaceae show the highest genus and species diversity in the
Mediterranean floristic region (Guzman & Vargas 2009). The Iberian Peninsula
hosts a high diversity of Cistaceae and high number of mycorrhizal fungal
species. Recent studies suggest that Helianthemum almeriense strongly depends
on the presence of a fungal symbiont in its roots for survival (Morte et al. 2010).
The Iberian Peninsula seems to be a desert truffle reservoir and further study
and sampling are necessary in these ecosystems.
As recently highlighted by Bidartondo et al. (2008), we also emphasize
the importance of an accurate identification of specimens whose DNA
sequences have been subsequently registered in public databases, such as
GenBank. Mistakes made in species identification can lead to erroneous and
false conclusions. Checking the databases with contrasted data is necessary to
prevent the perpetuation of errors when identifying new specimens.
Key to examined Terfezia species
Ascospore measurements include ornamentation.
la. Fertile tissue does not create islets or reticulate ascospores ...........-----2 000 2
1b. Fertile tissue creates islets and spiny ascospores ............0. 0s eee e eee eee ees 3
Za TASCOSPORes: WILLS PINGS 55.5.0 S ca yensqee teens tweens T. extremadurensis (Clade 1)
2D IASCOSPOTESPELGUIAIE it Date tReet D tien Rit Ee ete eee ene ee Ure Fe Rae tit tetsA ae +
3a. Ascospores <20 um and spines <2.5um ..............0006- T. olbiensis (Clade 8)
SUPASCOSP ORES 220 (i yas. wt tor ne nea ek cee Re rane A a MD, RE Rena on, Sac we 5
Aare Vite le Dat Rat Aueet ARG ARO ARE Ne Lae T. eliocrocae (Clade 2)
ABS PHU Olea, | we. ttan h oeatin chain Gaeta ttaa a estan ares atten andeabtin anseablagh are T. alsheikhii (Clade 3)
Dai oo PUES Fs PTI. era lel Neceath Meerastey eamaces teens ste iene te Mera ee ttens cea T. albida (Clade 7)
SU, Spinesero Wille, ft, dh ie ek ole wk old hee ee a Eee Suet) Cte Eos 6
GarCrestedispiiies™ wo. eSuis oe oe ee ee 28 ees 2 ied oh eis Sie T. pini (Clade 4)
OE: SGI ated is pie Set ee hate SR chat late UE hai OR Reto OM et UR Ate le OM en UL, | eel a 7
7a. Spines blunt with asymmetric base; ascomata <2 cm diam
Su Ree sles te dlad x lag Ho Mig sete $e 324 T. pseudoleptoderma (Clade 5)
7b. Spines pointed with symmetric base; ascomata 2-5 cm diam .. T. fanfani (Clade 6)
Acknowledgments
This work has been supported by project CGL2011-29816 (MINECO-FEDER, Spain).
The authors are grateful to Prof. Gabriel Moreno (Univ. Alcala de Henares, Madrid) and
206 ... Bordallo & al.
Prof. Giuseppe Venturella (Universita di Palermo, Italy) for their presubmission reviews
and Dr. Shaun Pennycook and Dr. Lorelei L Norvell for their huge effort and help in the
text edition. They also thank Mr. A. Bordallo for his help with the English revision of
the manuscript.
Literature cited
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids
Res. 25: 3389-3402. http://dx.doi.org/10.1093/nar/25.17.3389
Barriuso J, Ramos Solano B, Santamaria C, Daza A, Gutiérrez Manero FJ. 2008. Effect of inoculation
with putative plant growth-promoting rhizobacteria isolated from Pinus spp. on Pinus pinea
growth, mycorrhization and rhizosphere microbial communities. J. Appl. Microbiol. 105:
1298-1309. http://dx.doi.org/10.1111/j.1365-2672.2008.03862.x.
Bidartondo, MI et al. 2008. Preserving accuracy in GenBank. Science 319: 1616a.
http://dx.doi.org/10.1126/science.319.5870.1616a
Calonge FD, De la Torre M, Lawrynowicz M. 1977. Contribucién al estudio de los hongos hipogeos
de Espafia. Anal. Int. Bot. Cavanilles 34: 15-31
Castro ML, Freire L. 1982. Terfezia berberiodora y T. oligosperma. IV Simposi de Botanica
Criptogamica. Collect. Bot. 13: 441-444. Barcelona.
Ceruti A. 1960. Elaphomycetales et Tuberales. Iconographia Mycologica 28 Suplement 2.
Ceruti A, Fontana A, Nosenzo C. 2003. Le specie europee del genere Tuber: una revisione storica.
Museo Regionale di Scienze Naturali, Torino.
Chatin A. 1892. La truffe. Paris. Academic Press.
Dexheimer J Gerard J, Leduc JP, Chevalier G. 1985. An ultrastructural comparison of mycorrhizal
symbioses of Helianthemum salicifolium-Terfezia claveryi and Helianthemum salicifolium-
Terfezia leptoderma. Can. J. Bot. 63: 582-591.
Diez J, Manjon JL, Martin F. 2002. Molecular phylogeny of the mycorrhizal desert truffles (Terfezia
and Tirmania), host specificity and edaphic tolerance. Mycologia 94: 247-259.
Eck RV, Dayhoff MO 1966. Atlas of protein sequence and structure. National Biomedical Research
Foundation, Silver Springs, Maryland.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evol. 39:
783-791. http://dx.doi.org/10.2307/2408678
Ferdman Y, Aviram S, Roth-Bejerano N, Trappe JM, Kagan-Zur V. 2005. Phylogenetic studies
of Terfezia pfeilii and Choiromyces echinulatus (Pezizales) support new genera for southern
African truffles: Kalaharituber and Eremiomyces. Mycol. Res. 109: 237-245.
http://dx.doi.org/10.1017/S0953756204001789
Fortas Z, Chevalier G. 1992. Effects des conditions de culture sur la mycorrhization de
|’ Helianthemum guttatum par trois espéces de terfez des genres Terfezia et Tirmania d‘ Algerie.
Can. J. Bot. 70: 2453-2460.
Gutiérrez A, Morte A, Honrubia M. 2003. Morphological characterization of the mycorrhiza
formed by Helianthemum almeriense Pau with Terfezia claveryi Chatin and Picoa lefebvrei (Pat.)
Maire. Mycorrhiza 13: 299-307.
Guzman B, Vargas P. 2009. Historical biogeography and character evolution of Cistaceae (Malvales)
based on analysis of plastid rbcL and trnL-trnF sequences. Org. Divers. Evol. 9: 83-99.
http://dx.doi.org/10.1016/j.ode.2009.01.001.
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NTT. Nucl. Acids Symp. Ser. 41: 95-98.
Terfezia spp. nov. (Iberia) ... 207
Honrubia M, Cano A, Molina-Nifirola C. 1992. Hypogeous fungi from Southern Spanish semi-
arid lands. Persoonia 14: 647-653.
Janex-Favre MC, Parguey-Leduc A, Riousset L. 1988. Lascocarpe hypoge d'une terfez francaise
(Terfezia leptoderma Tul., Tuberales, Discomycetes). Bull. Soc. Mycol. France 104: 145-178.
Kirk PM, Cannon P, Minter DW, Stalpers JA. 2008. Dictionary of the fungi, 10" ed. CABI
Publishing, UK.
Kovacs G, Calonge D, Martin MP. 2011. The diversity of Terfezia desert truffles: new species and
a highly variable species complex with intrasporocarpic nrDNA ITS heterogeneity. Mycologia
103: 841-853. http://dx.doi.org/10.3852/10-312
Leessoe T, Hansen K. 2007. Truffle trouble: what happens to the Tuberales. Mycol. Res. 111:
1075-1099. http://dx.doi.org/10.1016/j.mycres.2007.08.004
Lazaro é Ibiza B. 1908. Nuevos tuberaceos de Espafia. Revista Real Academia de las Ciencias
Exactas, Fisicas y Naturales, Madrid.
Malencon G. 1938. Les truffes européenes. Historique, morphogénie, organographie, classification,
culture. Rev. Mycol. 3, Mémoire hors-série 1. 92 p.
Malencon G. 1973. Champignons hypogés du Nord de l'Afrique. I. Ascomycetes. Persoonia 7:
261-288.
Mattirolo O. 1900. Gli ipogei di Sardegna e di Sicilia.Malpighia 14: 39-110, tav. 1.
Mattirolo O. 1906. Prima contribuzione all6 studio délia flora ipogea del Portogallo. Boletim da
Sociedade Broteriana 21: 86-105.
Mattirolo O. 1907. Seconda contribuzione allo studio della flora ipogea del Portogallo. Boletim da
Sociedade Broteriana 22: 227-245.
Mattirolo O. 1922. Osservazioni sopra due ipogei dell Cirenaica e considerazioni intorno ai generi
Tirmania e Terfezia. Reale Accarlemiu Nuzionule dei Lincei 5: 545-569.
Montecchi A, Lazzari G. 1993. Atlante fotografico di fungi ipogei. Associazione Micologica
Bresadola, Centro Studi Micologici, Vicenza.
Montecchi A, Sarasini M. 2000. Funghi ipogei d’Europa. Associazione Micologica Bresadola,
Fondazione Centro Studi Micologici, Trento.
Moreno G, Galan R, Ortega A. 1986. Hypogeous fungi from continental Spain I. Cryptog. Mycol.
722015229,
Morte A, Lovisolo C, Schubert A. 2000. Effect of drought stress on growth and water relations of the
mycorrizhal association Helianthemum almeriens-Terfezia claveryi. Mycorrhiza 10: 115-119.
Morte A, Zamora M, Gutiérrez A, Honrubia M. 2009. Desert truffle cultivation in semiarid
Mediterranean areas. 221-233, in: V Gianinazzi-Pearson, C Azcon (eds). Mycorrhizas:
functional processes and ecological impact, chapter 15. Springer-Verlag, Heidelberg.
Morte A, Navarro-Rédenas A, Nicolas E. 2010. Physiological parameters of desert truffle mycorrhizal
Helianthemun almeriense plants cultivated in orchards under water deficit conditions. Simbiosis
52: 133-139. http://dx.doi.org/10.1007/s13199-010-0080-4
Mufioz-Garmendia F, Navarro C. 1993. Cistaceae. 318-345, in: S Castroviejo (coord.),
Plumbaginaceae (partim)-Cappaceraceae, Flora Ibérica. Plantas Vasculares de la Peninsula
Ibérica e Islas Baleares, vol. III. Servicio de Publicaciones C.S.I.C.
Nei M, Kumar S. 2000. Molecular evolution and phylogenetics. Oxford University Press, New
York.
Norman JE, Egger KN. 1999. Molecular phylogenetic analysis of Peziza and related genera.
Mycologia 91: 820-829. http://dx.doi.org/10.2307/3761535
PercudaniR, Trevisi A, Zambonelli A, Ottonello S. 1999. Molecular phylogeny of truffles (Pezizales:
Terfeziaceae, Tuberaceae) derived from nuclear rDNA sequence analysis. Mol. Phyl. Evol. 13:
169-180
208 ... Bordallo & al.
Rzhetsky A, Nei M. 1992. A simple method for estimating and testing minimum evolution trees.
Mol. Biol. Evol. 9: 945-967.
Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing
phylogenetic trees. Mol. Biol. Evol. 4: 406-425.
Sola J. 1925. Alguns macromicets dels volts de Terrassa (Provincia de Barcelona). Butll. Inst.
Catalana Hist. Nat. 1: 31-44
Tamura K, Nei M, Kumar S. 2004. Prospects for inferring very large phylogenies by using the
neighbor-joining method. Proc. Nat. Acad. Sci. USA 101: 11030-11035.
http://dx.doi.org/10.1073/pnas.0404206101
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis
(MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599. doi:10.1093/molbev/msm092
Taylor FW, Thamage DM, Baker N, Roth-Bejerano N, Kagan-Zur V. 1995. Notes on the Kalahari
desert truffle, Terfezia pfeilii. Mycol. Res. 99: 874-878.
http://dx.doi.org/10.1016/S0953-7562(09)80744-2
Trappe JM. 1971. A synopsis of the Carbomycetaceae and Terfeziaceae (Tuberales). Trans. Brit.
Mycol. Soc. 57: 85-92.
Trappe JM. 1979. The orders, families, and genera of hypogeous Ascomycotina (truffles and their
relatives). Mycotaxon 9: 297-340.
Tulasne LR, Tulasne C. 1851. Fungi hypogaei. Histoire et monographie des champignons hypogés.
Paris.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. San Diego, Academic Press.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/124.209
Volume 124, pp. 209-217 April-June 2013
Hypochnicium pini,
a new corticioid basidiomycete in East Asia
YEONGSEON JANG’, SUNG WOOK LEE’, YOUNG WOON LIM’,
JIN SUNG LEE’, NILS HALLENBERG*‘ & JAE-JIN KIM’*
‘Division of Environmental Science & Ecological Engineering,
College of Life Sciences & Biotechnology, Korea University
5-1 Anam-dong, Seongbuk-gu, Seoul, 136-701, Korea
School of Biological Sciences, Seoul National University, Seoul, 151-747, Korea
National Institute of Biological Resources, Environmental Research Complex,
Incheon, 404-708, Korea
‘Department of Biological and Environmental Sciences,
Box 461, S-405 30 Goteborg, Sweden
*CORRESPONDENCE TO: [email protected]
ABSTRACT — A new species, Hypochnicium pini, is described based on morphological
and molecular characters. This species was collected in Seoul, Korea, and Hubei, China. It
belongs to the H. punctulatum group and has a morphology quite similar to its sister taxon,
H. cremicolor. However, the basidiome thickness, cystidial size, and ITS region sequences
differentiate H. pini from H. cremicolor. Detailed description and illustration of H. pini are
presented and a key to Korean species of Hypochnicium is provided.
Key worps — phylogeny, Polyporales, taxonomy
Introduction
Hypochnicium J. Erikss. is a basidiomycete genus of wood-rotting fungi. It is
characterized by resupinate effused adnate basidiomes, a margin that is usually
not especially differentiated, monomitic hyphal system, hyaline thin- to thick-
walled hyphae, cystidia present or absent, more or less suburniform 4-spored
basidia normally with a basal clamp, and ellipsoid to subglobose smooth or
ornamented basidiospores with thickened cyanophilous walls (Eriksson &
Ryvarden 1976). More than 30 species have been described worldwide, and
a core group around the type, H. bombycinum (Sommerf.) J. Erikss., has been
shown to be monophyletic when Hyphoderma species are used as outgroup
(Paulus et al. 2007; Telleria et al. 2010).
210 ... Jang & al.
Traditionally, northern European Hypochnicium species were subdivided
into six morphological groups (Eriksson & Ryvarden 1976), and within
each group, species delimitation was troublesome because of rather similar
morphological features. Recently, molecular phylogenetic analysis has been
used to delimit species in Hypochnicium. Nilsson & Hallenberg (2003) first
used ITS region sequences to differentiate species within the H. punctulatum
group [H. albostramineum (Bres.) Hallenb., H. cremicolor (Bres.) H. Nilsson &
Hallenb., H. punctulatum (Cooke) J. Erikss., H. wakefieldiae (Bres.) J. Erikss.]
and clearly distinguished the species which complemented morphology and
crossing test results. Several additional species belonging to this complex
have been described: H. cystidiatum Boidin & Gilles from Africa (Boidin &
Lanquetin 1971), H. aotearoae B.C. Paulus et al. from New Zealand (Paulus
et al. 2007), H. guineense Telleria et al. from Equatorial Guinea (Telleria et
al. 2010), and Hypochnicium patagonicum Gorjon & Hallenb. from Chilean
Patagonia (Gorjon & Hallenberg 2012).
Six Hypochnicium species have been reported from Korea: H. bombycinum,
H. detriticum (Bourdot) J. Erikss. & Ryvarden, H. eichleri (Bres. ex Sacc. & P.
Syd.) J. Erikss. & Ryvarden, H. lundellii (Bourdot) J. Erikss., H. punctulatum,
and H. vellereum (Ellis & Cragin) Parmasto (Jung 1991, 1994, 1996; Lim et
al. 2010). Hypochnicium eichleri and H. punctulatum were reported by Jung
(1991, 1996), who identified the species referring to CORTICIACEAE OF NORTH
Europe (Eriksson & Ryvarden 1976). However, Nilsson & Hallenberg (2003)
proved that “H. punctulatum” as described in Eriksson & Ryvarden (1976) was
actually H. cremicolor (‘The type of H. punctulatum has bigger basidiospores
than H. cremicolor). Moreover, H. eichleri has been synonymised with authentic
H. punctulatum. Therefore the Korean report of “H. punctulatum” should be
corrected to H. cremicolor; and the Korean record of H. eichleri should be
updated to H. punctulatum.
Recently, the national biological inventory project (governed by the
National Institute of Biological Resources) is underway in Korea. During the
investigation of indigenous fungi, we found a Hypochnicium specimen sharing
features with H. cremicolor but with smaller cystidia. Our further investigation
revealed two specimens from China with the same deviating characteristics.
Based on morphological and molecular data, we describe these three specimens
as a new species.
Materials & methods
Collection and morphological examination
The corticioid basidiome was collected from Gungsan (Mt.), Seoul, Korea and
air-dried. The dried specimen was used for macro- and microscopic examination.
The specimen was mounted in 1% cotton blue, 5% KOH, 1% phloxine, and Melzer’s
Hypochnicium pini, sp. nov. (Asia) ... 211
reagent (IKI) (Largent et al. 1977) and observed at up to 1000x using Olympus BX51
light microscope. Munsell color (2009) was followed as the color standard. More than
30 basidiospores were examined. The specimen was deposited at National Institute of
Biological Resources, Korea (KB). The Chinese specimens were borrowed from National
Museum of Natural Science, Taiwan (TNM) and examined as above.
Phylogenetic analysis
For the Korean specimen, genomic DNA extraction, ITS region PCR, and
sequencing were carried out according to Jang et al. (2012). For the Chinese specimens,
the revised method of Cenis (1992) was used for genomic DNA extraction. PCR and
sequencing were performed according to Jang et al. (2012). The sequences obtained
in this study were deposited under the GenBank accession no. JX217823, KC282470-
282472. The sequences were proofread and compared with the reference sequences
in GenBank. Closely related Hypochnicium sequences were retrieved from GenBank.
Only one sequence was selected when two or more sequences had the same nucleotides;
H. geogenium (Bres.) J. Erikss. (GenBank AF429426) was included as outgroup based on
the phylogenetic tree in Telleria et al. (2010). The sequences were aligned using MAFFT
6.885 (Katoh & Toh 2008) with L-INS-i method. The aligned dataset was viewed and
manually edited using MacClade 4.08 (Maddison & Maddison 2005). Phylogenetic
tree was constructed using MrBayes 3.2 (Ronquist et al. 2012). Two independent runs
with 8 chains were operated with 1,000,000 generations and every 100th tree was saved.
In this process, the best-fit model was searched by MrModeltest 2.3 (Nylander 2004)
under AIC criterion and GTR + I model was applied. The graphical presentation of log
likelihood value was checked and the first 25% of the trees were discarded. The 50%
majority rule consensus tree was produced with the rest 75% of the trees. The potential
scale reduction factors (PSRF) were reasonably close to 1.0 for all parameters. Posterior
probabilities were calculated to support nodes. The tree was viewed using FigTree 1.3.1
(http://tree.bio.ed.ac.uk/software/figtree/).
Taxonomy
Hypochnicium pini Y. Jang & J,J. Kim, sp. nov. FIGs 1-3
MycoBank MB 800807
Differs from Hypochnicium cremicolor by its thinner basidiome and its smaller cystidia.
Type: Korea. Seoul, Gangseo-gu, Gungsan (Mt.), 37°34'25"N 127°50'25"E, on bark
of Pinus densiflora Siebold & Zucc., 23 Sep 2008, Yeongseon Jang KUC20081023-04
(Holotype, KB NIBRFG0000107453; GenBank JX217823).
ETryMOoLoGcy: Growing on pines (Pinus).
Basidiome resupinate, effused, membranaceous, pale yellow (2.5Y8/2,2.5Y8.5/2)
when dry, up to 0.1 mm thick; hymenophore smooth to porulose (hypochnoid);
margin not differentiated. Hyphal system monomitic; hyphae with clamps,
ramified, hyaline, 3.8-5.8 um wide; subhymenial hyphae thin-walled while
the basal ones are thick-walled, walls up to 1.5 um thick, loosely interwoven.
Cystidia subcylindrical, slightly tapering but with an obtuse apex, enclosed
212 ... Jang & al.
Fic. 1. Hypochnicium pini (NIBRFG0000107453, holotype).
Basidiocarp. Scale bar = 1 cm.
within the hymenium or projecting up to 40 um above the basidial layer, thin-
walled, variable in size, 40-80 x 5.5-8.5 um. Basidia clavate, sinuous, 28-39
x 5.5-7.5 um, with four sterigmata and a basal clamp. Basidiospores broadly
ellipsoid to subglobose, 5.5-6.9 x 4.6-5.9 um, mean 6.1 x 5.2 um, verrucose in
1% cotton blue and 1% phloxine, smooth in 5% KOH, thick-walled, some with
a few guttula, spore wall cyanophilous, IKI-.
ECOLOGY & DISTRIBUTION — China and Korea, on Pinus spp.
Additional specimens examined:
Hypochnicium pini: CHINA, HuBeE1, Wuhan, Mt. Lion, alt. 30 m, 30°29'N 114°21'E,
on trunk of Pinus sp., 12 November 2008, S.H. Wu 0811-75 (TNM F0023763; GenBank
KC282471); Wu 0811-77 (TNM F0023765; GenBank KC282472).
Hypochnicium cremicolor. CHINA, YUNNAN, Tali, Tsangshan, alt. 2800 m, on
trunk of Pinus armandii Franch., 19 October 2000, S.H. Wu & S.C. Wu 0010-180 (TNM
F0012210; GenBank KC282470).
REMARKS — Hypochnicium pini is very similar to H. cremicolor. However,
H. cremicolor has a thicker basidiome (0.1-0.3 um) and larger cystidia (70-150
x 7-10 um; Eriksson & Ryvarden 1976, as “H. punctulatum”). Phylogenetic
analysis also revealed the close relationship between the two species, but there
was sufficient genetic differentiation to separate them (Fie. 3).
Hypochnicium pini, sp. nov. (Asia) ... 213
aD
Fic. 2. Hypochnicium pini (NIBRFG0000107453, holotype).
A, basidia; B, basidiospores; C, cystidia; D, thick-walled basal hyphae.
Phylogeny
The amplified ITS region sequences of Hypochnicium pini NIBRFG0000107453
from Korea, and F0023763 and F0023765 from China were 578 bp. There were
two nucleotide differences between the Korean specimen and the Chinese
specimens of H. pini and the sequences of Chinese specimens were identical.
214 ... Jang & al.
Hypochnicium pini F0023765 (KC282472)
4 Hypochnicium pini F0023763 (KC282471)
Hypochnicium pini NIBRFG0000107453 (JX217823)
4sHypochnicium cremicolor FCUG 160 (AF429425)
Hypochnicium cremicolor FCUG 2151 (AF 429424)
Hypochnicium cremicolor F0012210 (KC282470) II-E
Rael al aotearoae FCUG 3120 (GQ906536)
Hypochnicium aotearoae FCUG 2972 (DQ309071)
Hypochnicium guineensis MA-Fungi 79156 (FN552536)
Hypochnicium cystidiatum FCUG 3086 (DQ658163)
Hypochnicium cystidiatum FCUG 3087 (DQ658164)
Hypochnicium punctulatum FCUG 1065 (AF429413)
4 |Hypochnicium punctulatum FCUG 1921 (AF 429410)
Hypochnicium punctulatum FCUG 1794 (AF 429414)
Hypochnicium punctulatum FCUG 1362 (AF429411)
Hypochnicium wakefieldiae MA-Fungi 79157 (FN552532)
9.991 Hypochnicium wakefieldiae MA-Fungi 23913 (FN552533)
Hypochnicium wakefieldiae MA-Fungi 7675 (FN552531)
$38 Hypochnicium wakefieldiae FCUG 2437 (AF429420)
Hypochnicium wakefieldiae FCUG 2755 (AF429418) II-F
Hypochnicium wakefieldiae FCUG 1709 (AF429419)
espe albostramineum FCUG 269 (AF429422)
0.98
lI-D
Hypochnicium albostramineum FCUG 1865 (AF429421)
Hypochnicium albostramineum FCUG 1772 (AF429423)
Hypochnicium geogenium FCUG 2052 (AF429426)
0.1
Fic. 3. 50% majority rule consensus tree of the Hypochnicium punctulatum group inferred by
ITS region sequences using bayesian analysis. The tree was rooted by H. geogenium FCUG 2052.
Numbers above branches indicate posterior probabilities. H. pini is indicated by bold type.
The clades presented in the tree follow those resolved by Telleria et al. (2010).
By the nucleotide BLAST, the closest match was H. cremicolor FCUG160 from
Denmark AF429425 (93%) and H. cremicolor FCUG2151 from Spain AF429424
(93%) (555 out of 596 positions are identical for Korean specimens and 557
out of 596 positions for Chinese specimens). In order to fully understand the
relationship within the H. punctulatum group, H. pini sequences were aligned
with 22 closely related Hypochnicium sequences obtained from GenBank
including H. cremicolor Wu 0010-180 from China, and with H. geogenium
FCUG2052 as outgroup. The aligned ITS dataset of 25 taxa comprised 586
characters including gaps. The 50% majority rule consensus tree using bayesian
analysis is shown in Fie. 3.
Each species was well resolved in the tree as indicated by high posterior
probability values. Three main groups were recovered which correspond to the
subclades II-D, II-E, and II-F in Telleria et al. (2010). They all have ornamented
basidiospores, but there are just minute morphological characteristics which
distinguish each subclade. Hypochnicium pini was included in subclade
I]-E with four formerly described species - H. aotearoae, H. cremicolor,
H. guineense, and H. cystidiatum. Hypochnicium pini NIBRFG0000107453 from
Hypochnicium pini, sp. nov. (Asia) ... 215
Korea was monophyletic with H. pini F0023763 and F0023765 from China
with high posterior probability (1.0 p.p.); and H. cremicolor Wu 0010-180 from
China was monophyletic with formerly sequenced H. cremicolor FCUG160 and
FCUG 2151, also with high support (1.0 p.p.), and it was 98% similar to them in
BLAST search (588 out of 596 positions are identical).
Discussion
Morphologically, species within II-E clade have similar characteristics.
Hypochnicium pini is characterized by its pale yellow basidiocarp, hypochnoid
hymenophore, thick-walled basal hyphae, one type of cystidium and broadly
ellipsoid to subglobose spores, which are very similar to H. cremicolor (Fics 1,
2). They both have the basal thick-walled hyphae, one type of cystidium, and
ornamented basidiospores which are similar in size [H. pini: 5.5-6.9 x 4.6-5.9
um; and H. cremicolor: (5-)5.5-6.5 (-7.5) x 4.5-5 um (Eriksson & Ryvarden
1976) or 6-6.5 x 5-5.5 um (Nilsson & Hallenberg 2003)]. The hosts of H. pini
are Pinus spp. while H. cremicolor has been reported from both broadleaved and
coniferous trees including Pinus spp. (Eriksson & Ryvarden 1976, Bernicchia
& Gorjén 2010). The obvious morphological differences are the thickness of
basidiome and the size of cystidia (TaBLE 1). Hypochnicium aotearoae and
H. cystidiatum differ from H. pini by having two types of cystidia, and H.
guineense differs by larger basidiospores (Telleria et al. 2010).
TABLE 1. Morphological characteristics of Korean species of Hypochnicium s.1.
SPECIES CYsTIDIA (um) BASIDIA (um) BASIDIOSPORES (Lm)
H. bombycinum (Jung 1994) None 40-50 x 6-8 Smooth, 8-12 x 6-8
H. cremicolor (Jung 1996, as 60-130 x 9-12 25-30 x 6.5-7.5 Ornamented, (5—)6-6.5 x 4.5-5.5
“H. punctulatum”)
H. detriticum (Jung 1994) 60-100 x 6-10 15-20 x5 Smooth, 4.5-6 x 3.5-4
H. lundellii Jung 1994) None 25-30 x 5-6 Smooth, 5.5-6 x 4.5-5
H. pini (this paper) 40-80 x 5.5-8.5 28-39 x 5.5-7.5 | Ornamented, 5.6-6.9 x 4.8-5.9
H. punctulatum (Jung 1991, 90-110 x 6-10 25-35 x 7.5-9 Ornamented, 8-9(-10) x 6-7.5
as “H. eichleri”)
H. vellereum (Lim et al. 2010) None 42-65 x 4-7.42 Ornamented, 6.8-7.4 x 5.7-6.2
In conclusion, we propose that the unknown Hypochnicium species collected
from Gungsan (Mt.) in Korea and from Hubei in China represents a new
species, Hypochnicium pini, minutely distinguished by morphological data, but
with distinct genetic differences towards other species in this complex. We also
update the list of Korean species of Hypochnicium sensu lato (TABLE 1).
216 ... Jang & al.
Key to the Korean species of Hypochnicium s.I.
1 PSV OUE OY SUCIA 4325 aioe cl fata whee ele Saee ole Boe ule See ile Out edie baie s Gedy ahs 2
Ie WILE VS LILA ed ie Ee cis cy a Ere Me Bh a ON aN Soi aha 4
PAS OLES SUNOOL He Aats Pere Ra ata couig Alain Baia hhh hit AM he 2 OM het Pade te Ree. ek 3
2. Spores globose, with irregularly uneven or finely rough surface........ H. vellereum
3. Spores broadly ellipsoid to ovoid, 8-12 x 6-8 um.............000. H. bombycinum
3.. Spores ellipsoid; 5.5=6- 4:5=5: With. see ye ssee yes teye eniege # end Bonet Eee ge H. lundellii
He SPORES: GHIOOUN 2, See 255 le os solave Ws colaps On Salers les 4 Sere el Marty Sle AS H. detriticum
A SPORES OLMAIMeTiLed bat) ied iS ed hed i AU AU AU ALE ALS oe ier oe 5
Ds ppores longer: thyary, 8, iia. Spay 6 eaps Lh aeape Pape Piaget Page H. punctulatum
SES POLES SHOr be Tel MAM Ba Lis 25! Mecwats Mecwantel Mecwn <r etewe (Me secu ee nate ee eae (Ste nt Saath aes 2 6
6. Basidiome 0.1-0.3 mm thick, cystidia 60-130 x 9-12 um............ H. cremicolor
6. Basidiome <0.1 mm thick, cystidia 40-80 x 5.5-8.5 um................0004 H. pini
Acknowledgments
This research was supported by Basic Science Research Program through the National
Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-
2013R1A1A2A10011390) and was funded by the project on survey and excavation of
Korean indigenous species of NIBR under the Ministry of Environment, Republic of
Korea. We are grateful to Dr. Sheng-Hua Wu (National Museum of Natural Science,
Taiwan) for providing Chinese specimens. We are grateful to Dr. Sergio Pérez Gorjon
and Dr. Leif Ryvarden for their valuable suggestions on the manuscript.
Literature cited
Bernicchia A, Gorjén SP. 2010. Corticiaceae s.1. Fungi Europaei 12. Ed. Candusso, Alassio, Italy.
Boidin J, Lanquetin P. 1971. Basidiomycetes Corticiaceae de la Republique Centrafricaine III. Le
genre Hypochnicium. Cah. Maboké 9: 89-93
Cenis JL. 1992. Rapid extraction of fungal DNA for PCR amplification. Nucleic Acids Res. 20: 2380.
http://dx.doi.org/10.1093/nar/20.9.2380
Eriksson J, Ryvarden L. 1976. The Corticiaceae of North Europe. Vol. 4. Fungiflora, Oslo, Norway.
Gorjon SP, Hallenberg N. 2013. Some new species and a first checklist of corticioid fungi
(Basidiomycota) from Chile. Mycol. Progress 12: 185-192.
http://dx.doi.org/10.1007/s11557-012-0824-z
Jang Y, Choi HE, Lim YW, Lee JS, Kim J-J. 2012. The first report of Ceriporia lacerata
(Phanerochaetaceae, Basidiomycota) in Korea. Mycotaxon 119: 397-403.
http://dx.doi.org/10.5248/119.397
Jung HS. 1991. Fungal flora of Ullung island (I) — on some corticioid fungi. Korean J. Bot. 34:
77—90.
Jung HS. 1994. Floral studies on Korean wood-rotting fungi (II) — on the flora of the Aphyllophorales
(Basidiomycotina). Korean J. Mycol. 22: 62-99.
Jung HS. 1996. Taxonomic study on Korean Aphyllophorales (11) — on some unrecorded species.
Korean J. Mycol. 24:228-236.
Katoh K, Toh H. 2008. Recent developments in the MAFFT multiple sequence alignment program.
Briefings Bioinf. 9: 286-298. http://dx.doi.org/10.1093/bib/bbn013
Hypochnicium pini, sp. nov. (Asia) ... 217
Largent DL, Johnson D, Watling R. 1977. How to identify mushrooms to genus III. Microscopic
features. Mad River Press, Eureka, CA, USA.
Lim YW, Lee JS, Jung HS. 2010. Fungal flora of Korea. Basidiomycota: Hymenomycetes:
Aphyllophorales. Volume 1, Number 1. The National Institute of Biological Resources,
publishers, Korea.
Maddison D, Maddison W. 2005. MacClade 4: Analysis of phylogeny and character evolution.
Version 4.08. Sinauer Associates, Sunderland, MA, USA.
Munsell color. 2009. Munsell soil color charts with genuine Munsell color chips. Grand Rapids,
Michigan, U.S.A
Nilsson RH, Hallenberg N. 2003. Phylogeny of Hypochnicium punctulatum complex as inferred
from ITS sequence data. Mycologia 95: 54-60. http://dx.doi.org/10.2307/3761961
Nylander JAA. 2004. MrModeltest v2. Evolutionary Biology Center, Uppsala University, Uppsala,
Sweden.
Paulus B, Nilsson HR, Hallenberg N. 2007. Phylogenetic studies in Hypochnicium (Basidiomycota),
with special emphasis on species from New Zealand. New Zealand J. Bot. 45: 139-150.
http://dx.doi.org/10.1080/00288250709509709
Ronquist F, Teslenko M, Mark P van der, Ayres D, Darling A, Hohna S, Larget B, Liu L, Suchard
MA, Huelsenbeck JP. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model
choice across a large model space. Syst. Biol. 61: 539-542.
http://dx.doi.org/10.1093/sysbio/sys029
Telleria MT, Duefias M, Melo I, Hallenberg N, Martin MP 2010. A re-evaluation of Hypochnicium
(Polyporales) based on morphological and molecular characters. Mycologia 102: 1426-1436.
http://dx.doi.org/10.3852/09-242
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.219
Volume 124, pp. 219-229 April-June 2013
Taxonomic studies on Mucor inaequisporus,
isolated for the first time in South America
ANDRE Luiz C.M. DE A. SANTIAGO’, ANDRE RODRIGUES?,
Enzo M. CANEDO? & EDSON R. FILHO?
‘Universidade Federal Rural de Pernambuco - Unidade Académica de Serra Talhada,
Fazenda Saco, s/n, 56900-000, Serra Talhada, Pernambuco, Brazil
?Universidade Estadual Paulista - UNESP, Departamento de Bioquimica e Microbiologia,
Av. 24A, 1515, Bela Vista, 13506-900, Rio Claro, Sao Paulo, Brazil
>Universidade Federal de Sao Carlos, Departamento de Quimica,
Rodovia Washington Luiz, km 235, 13565-905, Sado Carlos, Sdo Paulo, Brazil
* CORRESPONDENCE TO: [email protected]
ABsTRACT— Mucor inaequisporus (Mucorales, Mucoromycotina) was isolated from Syzygium
cumini, a common introduced tree species in Brazil. It is distinguished from similar species
by producing straight or undulate sporangiophores with randomly distributed irregular
swellings. The columellae are mostly pyriform at 25 °C, but oblong, conic, ellipsoid, and
obovoid columellae were also found. The sporangiospores vary in size and shape, with a
minor proportion exhibiting an irregular shape. ITS-based phylogenetic analyses reveal that
M. inaequisporus is closely related to M. amphibiorum and M. nederlandicus. This species can
grow between 20 and 30 °C with optimal development at 25 °C, but variations in the shape
of sporangiospores and columellae caused by incubation under different temperatures were
observed. No growth was detected at 10 and 40 °C.
Key worps— DNA sequencing, growth rate, zygomycete
Introduction
Mucor Fresen., which belongs to the subphylum Mucoromycotina (Hibbett et
al. 2007), is characterized by the formation of non-apophysate sporangia (with
wet or dry walls when mature) on top of simple or branched sporangiophores
that emerge from the substrate (Benny 2006). Taxa of this genus have been
isolated from soil, dung, decaying fruits, and plants (White et al. 2006, Santiago
& Souza-Motta 2008, Santiago et al. 2011), while others are considered the
causal agent of cutaneous zygomycosis in humans (Alvarez et al. 2011). Several
species are able to produce enzymes with biotechnological applications (Alves
et al. 2002a), and some are used to prepare fermented food (Hesseltine 1983,
Abe et al. 2004).
220 ... Santiago & al.
Previous studies have treated Mucor as polyphyletic and highlighted the
difficulty of establishing subgeneric groups (O’Donnell et al. 2001, Voigt &
Wostemeyer 2001, Jacobs & Botha 2008). Although over 300 species are cited
in the literature (Jacobs & Botha 2008), the actual number of species may range
only from 50 to 75 (Gherbawy et al. 2010). After revising several Mucor species,
Schipper (1978) reduced the proposed taxa to 39 species, four varieties, and
11 forms. Subsequently, another 17 species have been described as new taxa
(Mehrotra & Mehrotra 1979; Mirza et al. 1979, Subrahamanyam 1983, Chen
& Zheng 1986, Schipper 1989, Schipper & Samson 1994, Watanabe 1994, Pei
2000, Alves et al. 2002b, Jacobs & Botha 2008, Alvarez et al. 2011, Madden et
al. 2012).
Mucor inaequisporus was first described by Dade (1937) from Spondias
mombin L. fruits in Aburi, Ghana. Since then, a few records of this species
from several fruits have been reported. Morphologically, M. inaequisporus is
mainly characterized by the highly variable form and size of columellae and
sporangiospores (Schipper 1978).
The present study describes Mucor inaequisporus isolated from a fruit of
Syzygium cumini (L.) Skeels (= Eugenia jambolana Lam.; Myrtaceae), commonly
found in the State of Sao Paulo and known locally as ‘Jambolao’ or ‘Jamelao: We
discuss the influence of temperature, light, and culture media on growth and on
morphology of M. inaequisporus.
Materials and methods
Isolation and morphological identification of M. inaequisporus
Mature fruits of S. cumini were collected on the campus of the Federal University of
Sao Carlos (21°59'02"S 47°52'55"W), Sao Paulo, Brazil. In February 2009 (URM 6532)
and February 2010 (URM 6533), mycelium fragments were removed directly from
growing fruits under a stereomicroscope (Leica EZ4) and transferred to Petri dishes with
potato dextrose agar (PDA) (Benny 2008) supplemented with chloramphenicol (Neo
Fenicol - Neo Quimica) (80 mg L’"). Plates were left on a bench at room temperature
(28 + 2 °C) for 7 days in alternating light and dark periods. The strains were subcultured
in order to obtain pure cultures. Identification was based on macroscopic (color, aspect
and diameter of the colonies) and microscopic characters according to Dade (1937) and
Schipper (1978).
Influence of temperature, culture media, and light on the growth and
morphology of M. inaequisporus
Pure cultures were grown in malt extract agar (MEA) and PDA (Benny 2008) at 15,
20, 25, 30, 35, and 40 °C for 7 days under light and dark periods. Mycelial fragments
were removed from cultures to prepare wet mounts using KOH (3%) and studied
under bright-field microscopy (BFM) (Carl Zeiss Axioscope 40). Color designation
followed Watling (1969). The morphological characteristics were also studied using
Environmental Scanning Electron Microscopy (ESEM). Agar blocks retrieved from
Mucor inaequisporus in South America ... 221
TABLE 1. Cokeromyces and Mucor species included in the molecular analysis
SPECIES ISOLATE GENBANK No.
Cokeromyces recurvatus Poitras CBS 158.507 DQ118986
M. amphibiorum Schipper CBS 763.74" FJ455861
M. bainieri B.S. Mehrotra & Baijal CBS 293.63 JF299222
M. circinelloides Tiegh. CBS 195.68%7 DQ118991
(as M. circinelloides f. circinelloides)
M. ellipsoideus Ed. Alvarez et al. UTHSC 02-2090" FN650647
M. flavus Bainier CBS 230.35 EU484282
M. fragilis Bainier CBS 236.35 FN650655
M. fuscus Bainier CBS 132.227 FN650653
M. genevensis Lendn. CBS 114.087 EU484275
M. guilliermondii Nadson & Filippov CBS 174.277 JF299231
M. hiemalis f. corticola (Hagem) Schipper CBS 106.09 AY243950
M. hiemalis Wehmer f. hiemalis CBS 201.65 DQ118992
M. inaequisporus CBS 255.367 JN206177
CBS 351.50 JN206178
URM 6532 JQ014007
M. indicus Lendn. CBS 226.29" DQ118994
M. irregularis Stchigel et al. CBS 103.937 DQ119006
M. lusitanicus Bruderl. CBS 108.177 FN650644
(as M. circinelloides f. lusitanicus)
M. mucedo Fresen. CBS 109.16 EU484199
M. nederlandicus Vanova CBS 735.70 JF299219
M. nidicola Madden et al. CBS 638.67 JF299220
(as M. hiemalis)
M. piriformis A. Fisch. CBS 169.25 EU484276
M. plumbeus Bonord. CBS 111.07 AF412290
M. racemosus Fresen. CBS 260.68" DQ118996
M. ramosissimus Samouts. CBS 135.65‘7 FN650643
M. variosporus Schipper CBS 837.70' HM623322
M. velutinosus Ed. Alvarez et al. UTHSC 06-1667 FN650652
M. zonatus Milko CBS 148.697 JF299232
CBS = Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; UTHSC = Fungus Testing
Laboratory, University of Texas Health Science Center, San Antonio, Texas, USA; URM = University
Recife Mycology, Recife, Brazil
NT = neotype strain; ’ = type strain
cultures were mounted in microscope slides for direct observation with a scanning
electron microscope (FEI Quanta™ 250).
Phylogenetic analyses
DNA was extracted following Gerardo et al. (2004). Cultures of M. inaequisporus
URM 6532 were cultured in malt broth (2%) at 25 °C for seven days and the mycelium
was freeze-dried and disrupted using liquid nitrogen. Genomic DNA was recovered
using CTAB and purified with 70% ethanol. PCR primer pair ITS4 and ITS5 was used to
amplify the ITS1-5.8S rDNA-ITS2 region (White et al. 1990). Both forward and reverse
sequences were generated in ABI3500 (Applied Biosystems). Sequences were assembled
in Bioedit v. 7.0.5.3 (Hall 1999) and the consensus was aligned with sequences of several
Mucor species retrieved from GenBank using Muscle v. 3.6 (Edgar 2004) (TABLE 1).
A neighbor-joining tree was inferred in MEGA5 (Tamura et al. 2011) under the
222 ... Santiago & al.
a Mucor variosporus
Mucor indicus
100 Re
Mucor ellipsoideus
Mucor nederlandicus
Mucor amphibiorum
Mucor inaequisporus CBS 255.36
99
100] Mucor inaequisporus URM 6532
Mucor inaequisporus CBS 351.50
Mucor fuscus
Mucor genevensis
98 ae Mucor plumbeus
Mucor racemosus
92
Mucor circinelloides
Mucor velutinosus
60
Mucor fragilis
76
Mucor bainien
Mucor ramosissimus
60 |_ Mucor lusitanicus
Mucor flavus
63 Mucor zonatus
Mucor hiemalis
= Mucor irregulans
Mucor hiemalis f. corticola
Mucor hiemalis f. hiemalis
m Mucor mucedo
Mucor pinformis
Mucor guilliermondii
Cokeromyces recurvatus
Mucor inaequisporus in South America ... 223
maximum-composite likelihood algorithm to calculate genetic distances. Robustness
was calculated using 1000 bootstrap pseudo-replicates, and the tree was rooted with
Cokeromyces recurvatus (TABLE 1).
Results
Phylogenetic Analysis
The size of the ITS region of M. inaequisporus URM 6532 is 536 bp. BLASTn
comparisons with sequences deposited at the GenBank revealed that the ITS
sequence of this strain is 92% identical with a sequence labeled as Mucoraceae
LM042 (EF060714), 91% identical with another undescribed Mucor species
(AB638465), 90% identical to the sequence of M. amphibiorum (FJ455861),
95% identical with M. inaequisporus (CBS 255.36), and 100% identical with
M. inaequisporus (CBS 351.50). The phylogenetic relationship among Mucor
species based on the ITS region is illustrated in Fic. 1. Mucor guilliermondii
appears as the basal species, phylogenetically distant from other species in the
genus. Mucor inaequisporus was genetically distant from M. mucedo, the type
species of the genus, and clustered in a well-supported clade (100% bootstrap
value) with M. nederlandicus, M. amphibiorum, M. ellipsoideus, M. variosporus,
and M. indicus. Another well-supported clade (98% bootstrap value) included
M. ramosissimus, M. lusitanicus, M. bainieri, M. fragilis, M. circinelloides,
M. velutinosus, M. plumbeus, M. racemosus, and M. genevensis. Phylogenetic
analysis indicates only distant relatedness within two pairs of morphologically
similar species, M. genevensis/M. hiemalis and M. nederlandicus/M. guilliermondii.
Taxonomy
Mucor inaequisporus Dade, Trans. Br. Mycol. Soc. 21(1): 25. 1937. Pid
Colonies grow rapidly on MEA, filling the entire Petri dish (9 cm diam.
and 10 mm height) after 72 hours at 25 °C in the dark. The colony ranges
from an obverse intense yellow (8G to luteus 51) with yellow to olive-gray
spots, corresponding to sporangia, and reverse yellow (8G), particularly
at the point of inoculum. Rhizoids were short to long (<600 um in length),
poorly branched, with or without septa. A sweet aroma was produced.
SPORANGIOPHORES 9-30 um in diam., with or without yellow droplets, simple
or with long and short sympodial branches (3-10 times, mostly after 6 days of
incubation), erect, undulant, curved, sometimes with one or several randomly
spaced septa and sometimes constricted next to the sporangia; phototropic,
Fic. 1. Neighbor-joining tree of Mucor spp. inferred from the ITS-rDNA region. The maximum-
composite likelihood algorithm was used to calculate genetic distances. Numbers on branches
are bootstrap support values obtained from 1000 pseudo-replicates (values under 50% are not
shown). A sequence of Cokeromyces recurvatus was used to root the tree. Mucor inaequisporus
examined in this work is denoted in bold. Scale bar indicates the number of base substitutions
per site.
224 ... Santiago & al.
with yellow to chestnut contents and with incrusted walls. Some sporophores
exhibit randomly distributed irregular swellings (<47 um in diam.), frequently
gradually tapering towards the base. Sterile branches are common. SPORANGIA
globose and subglobose to lightly depressed, yellow and turn brown with
age, with finely echinulated, transparent and deliquescent walls that are more
persistent in the smaller sporangia, (47.5-)70-130(-180) x (45-)60-120
(-165) um; COLUMELLAE highly variable in shape, frequently pyriform (mostly
in the larger ones), conic or oblong, but also ellipsoid, obovoid, subglobose,
colorless or slightly yellow to chestnut; smooth walled with prominent collars,
(45-)60-100(-140) x (35-)50-80(-120) um; SpoRANGIOsPORES hyaline
with granular contents, highly variable in shape and size: majority elliptical
(sometimes flattened at one side), 5—14(-22.5) x 3.5-10(-15) um, also globose,
subglobose (<15 um diam.), some irregular (<24 x 15 um). CHLAMYDOSPORES
and ZYGOSPORANGIA not observed.
Influence of temperature, culture media and light on the growth and
morphology of M. inaequisporus
Macroscopic and microscopic features on PDA were similar to those on
MEA. The optimum growth temperature was 25 °C (colonies filled the entire
Petri plate after 72 hours) with good growth and sporulation between 15 and
30 °C. Limited growth was recorded at 35 °C and no growth was observed
at 10 and 40 °C. Colonies incubated at 30 °C grew well (9 cm diam. after 72
hours), but were shorter in height (6 mm) and the sporangiophores were more
branched than at 25 °C. The columellae were mainly oblong and conical, rarely
pyriform, and the sporangiospores were irregular in shape, predominantly
globose and subglobose. Colonies incubated at 20 °C reached 9 cm in diam.
after 72 hours. Such colonies were irregularly zonate, at raised in the center
and then touching the entire lid of the Petri dish after 7 days. Abundant twisted
sterile and coiled hyphae were observed in the aerial mycelium. Colonies were
also irregularly zonate at 15 °C, reaching 9 cm diam. and 2 mm in height after
96 hours. Abundant twisted sterile hyphae were also observed in the aerial
mycelium. Influence of light was not detected.
SPECIMENS EXAMINED — BRAZIL, SAo PauLo: Campus of the Federal University of
Sao Carlos, (21°59'02"S 47°52'55"W), on mature fruits of Syzygium cumini, 23.01.2009,
leg. EM. Canedo (URM 6532); 12.02.2010, leg. EM. Canedo (URM 6533).
Hasitat — Growing on fruits of Artocarpus glaucus, Bouea macrophylla,
Diospyros kaki, Flacourtia inermis, Musa paradisiaca, M. sapientum, Spondias
mombin, Syzygium cumini, and Theobroma cacao (Dade 1937, Boedijn 1959,
CBS Database, IMI Database) and in the rhizosphere of root-knot nematode
host plants (Zangeneh et al. 2007).
DISTRIBUTION — Ghana, Indonesia, Iran, Malaysia, and Brazil. This is the
first report for South America.
Mucor inaequisporus in South America ... 225
2, oh 4
peo 2° Fe gre 2
‘ : ee oe » ie
Bo Sate — nce Seg
¥
id
P
ie
ee
yy
+1,
PL. 1. Mucor inaequisporus grown in MEA at 25 °C for 7 days. A. Colony growing in a Petri dish.
B-D. Branched sporangiophores, some with randomly distributed irregular swellings with sporangia
and columellae. E. Single undulate sporangiophore with columella. F Young sporangiophore.
G. Columellae. H-I. Sporangiospores. Scale bars. A = 5 cm; B, D-F, H = 50 um; C, G =100 um;
I=5 um. (A-E, G, H = pictures under BFM; F, I = pictures under ESEM.)
226 ... Santiago & al.
Discussion
Several studies have reported the variability of nucleotide sequences of the
ITS-rDNA region as a reliable indicator to differentiate taxa of Mucorales at
the species level, including taxa of Mucor (Iwen et al. 2002, Schwarz et al. 2006,
Hoffmann et al. 2009). Strain URM 6532 shared an identical ITS sequence with
strain CBS 351.50. According to our phylogenetic analysis, M. inaequisporus
is genetically distinct from other described Mucor species. This species
exhibited low percentages of similarity with M. nederlandicus (91%), with
M. amphibiorum and M. variosporus (90%), and with M. ellipsoideus (89%).
According to Walther et al. (2013), the ITS is a barcode marker for mucoralean
species identification, despite the wide intraspecific variations found for some
taxa. Mucor inaequisporus appears to have some ITS variability because strain
URM 6532 showed a 95% similarity with strain CBS 255.36. Thus, our phylogeny
is in agreement with the phylogeny presented in Walther et al. (2013).
Morphologically, M. inaequisporus is distinguished from other Mucor
species by the production of sporophores that are straight, curved, or undulant,
and with randomly distributed irregular swellings. The columellae are variable
in form, being predominantly pyriform at 25 °C. Sporangiospores are extremely
variable in size and shape at 25 °C. However, some features of our isolate, such
as curved or undulant sporophores with irregular swellings, were not described
by Dade (1937) and Schipper (1978). Columellae sizes reported in the literature
(<100 x 90 um, Dade 1937; 83-75 um, Schipper 1978) were smaller than our
maximum measurements, whereas sporangiospores (<25 x 20 um, Dade 1937;
<30 x 23 um, Schipper 1978) were larger than our maximum measurements.
According to Schipper (1978), different strains of M. inaequisporus may exhibit
variable morphologic and physiologic features.
Our results show that M. inaequisporus exhibited growth from 15 to 30
°C. However, colonies incubated at 30 °C showed an increased number of
branches. The columellae were mostly oblong and conical, rarely pyriform, and
the sporangiospores were mostly globose, subglobose, and irregular in shape,
different from the observed at 25 °C. Schipper (1975, 1976) has noted the
influence of temperature on the shape of columellae and/or sporangiospores in
other Mucor species such as M. plasmaticus Tiegh., M. psychrophilus Milko, and
M. racemosus f. chibinensis (Neophyt.).
We report for the first time the occurrence of M. inaequisporus in Brazil,
thereby expanding the knowledge of Mucorales distribution. Strains URM 6532
and URM 6533 were isolated from a common introduced tree species in Brazil,
S. cumini, which belongs to the Myrtaceae. As this is the first report of a Mucor
species in fruits in this country, this record adds to the twenty-four species
of Mucor that have been isolated from soil and/or dung in Brazil (Santiago
2012).
Mucor inaequisporus in South America ... 227
Acknowledgments
This work was financially supported by Fundacao de Amparo a Ciéncia e Tecnologia
do Estado de Pernambuco (FACEPE). The authors would like to thank Fundacao de
Amparo a Pesquisa do Estado de Sao Paulo (FAPESP) for a scholarship to Enzo M.
Canedo. We are also grateful to Rafael José Vilela, Diogo Xavier Lima and Dr. Luciana
Bueno dos Reis Fernandes for technical assistance. We are in debt to Dra. Maria Inés
Salgueiro Lima for the identification of plant specimens and to Dr. José Ivanildo de
Souza and Dr. Matias Cafaro for manuscript review.
Literature cited
Abe A, Sujaya IN, Sone T, Asano K, Oda Y. 2004. Microflora and selected metabolites of potato
pulp fermented with an Indonesian starter Ragi Tape. Food Technology and Biotechnology
42: 169-173.
Alvarez E, Cano J, Stchigel AM, Sutton DA, Fothergill AW, Salas V, Rinaldi MG, Guarro J.
2011. Two new species of Mucor from clinical samples. Medical Mycology 49: 62-72.
http://dx.doi.org/10.3109/13693786.2010.499521
Alves MH, Campos-Takaki GM, Porto ALF, Milanez AI. 2002a. Screening of Mucor spp. for the
production of amylase, lipase, polygalacturonase and protease. Brazilian Journal Microbiology
33: 325-330. http://dx.doi.org/10.1590/S1517-83822002000400009
Alves MH, Trufem SFB, Milanez AI. 2002b. Taxons de Mucor Fresen. (Zygomycota) em
fezes de herbivoros, Recife, PE, Brasil. Revista Brasileira de Botanica 25: 147-160.
http://dx.doi.org/10.1590/S0100-84042002000200004
Benny GL. 2006. Zygomycetes. http://www.zygomycetes.org. Accessed 12 January, 2012.
Benny GL. 2008. The methods used by Dr. R. K. Benjamin, and other mycologists, to isolate
Zygomycetes. Aliso 26: 37-31.
Boedijn KB. 1959 [“1958”]. Notes on the Mucorales of Indonesia. Sydowia 12: 321-362.
CBS-KNAW Database. http://www.cbs.knaw.nl. Accessed 27 May, 2013.
Chen G-Q, Zheng R-Y. 1986. A new species of Mucor with giant spores. Acta Mycologica Sinica
1: 57-60.
Dade HA. 1937. New Gold Coast fungi. Transactions of the British Mycological Society 21(1-2):
16-28. http://dx.doi.org/10.1016/S0007-1536(37)80003-0
Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput.
Nucleic Acids Research 32: 1792-1797. http://dx.doi.org/10.1093/nar/gkh340
Gerardo NM, Currie CR, Price SL, Mueller UG. 2004. Exploiting a mutualism: parasite specialization
on cultivars within the fungus-growing ants symbiosis. Proceedings of the Royal Society, B:
Biological Sciences 271: 1791-1798. http://dx.doi.org/10.1098/rspb.2004.2792
Gherbawy Y, Kesselboth C, Elhariry H, Hoffmann K. 2010. Molecular barcoding of microscopic
fungi with emphasis on the mucoralean genera Mucor and Rhizopus. 225-265, in: Y Gherbawy
K Voight (eds). Molecular identification of fungi. Berlin Heidelberg, Springer-Verlag.
http://dx.doi.org/10.1007/978-3-642-05042-8_11
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NTT. Nucleic Acids Symposium Series 41: 95-98.
Hesseltine CW. 1983. Microbiology of oriental fermented foods. Annual Review of Microbiology
37: 575-601. http://dx.doi.org/10.1146/annurev.mi.37.100183.003043
Hibbett DS, Binder M, Bischoff JE, Blackwell M, Cannon PE, Eriksson OE, Huhndorf S, James
T, Kirk PM, Licking R, Lumbsch HT, Lutzoni F, Matheny PB, McLaughlin DJ, Powell MyJ,
Redhead S, Schoch CL, Spatafora JW, Stalpers JA, Vilgalys R, Aime MC, Aptroot A, Bauer
228 ... Santiago & al.
R, Begerow D, Benny GL, Castlebury LA, Crous PW, Dai YC, Gams W, Geiser DM, Griffith
GW, Gueidan C, Hawksworth DL, Hestmark G, Hosaka K, Humber RA, Hyde KD, Ironside
JE, Koljalg U, Kurtzman CP, Larsson KH, Lichtwardt R, Longcore J, Miadlikowska J, Miller
A, Moncalvo JM, Mozley-Standridge S, Oberwinkler F, Parmasto E, Reeb V, Rogers JD,
Roux C, Ryvarden L, Sampaio JP, Schiifler A, Sugiyama J, Thorn RG, Tibell L, Untereiner
WA, Walker C, Wang Z, Weir A, Weiss M, White MM, Winka K, Yao YJ, Zhang N. 2007. A
higher-level phylogenetic classification of the fungi. Mycological Research 111: 509-547.
http://dx.doi.org/10.1016/j.mycres.2007.03.004
Hoffmann K, Telle $, Walther G, Eckart M, Kirchmair M, Prillinger H, Prazenica A, Newcombe
G, Délz F, Papp T, Vagvolgyi C, de Hoog S, Olsson L, Voigt K. 2009. Diversity, genotypic
identification, ultrastructural and phylogenetic characterization of Zygomycetes from different
ecological habitats and climatic regions: limitations and utility of nuclear ribosomal DNA
barcode markers. 263-312, in: Y Gherbawy et al. (eds). Current advances in molecular
mycology. New York, Nova Science Publishers, Inc.
IMI Database. http://www.herbimi.info. Accessed 27 May, 1013.
Iwen PC, Hinrichs SH, Rupp ME. 2002. Utilization of the internal transcribed spacer regions
as molecular targets to detect and identify human fungal pathogens. Medical Mycology 40:
87-109. http://dx.doi.org/10.1080/mmy.40.1.87.109
Jacobs K, Botha A. 2008. Mucor renisporus sp. nov., a new coprophilous species from southern
Africa. Fungal Diversity 29: 27-35.
O'Donnell K, Lutzoni FM, Ward TJ, Benny GL. 2001. Evolutionary relationships among mucoralean
fungi (Zygomycota): evidence for family polyphyly on a large scale. Mycologia 93: 286-296.
http://dx.doi.org/10.2307/3761650
Oudemans CAJ. 1898. Contributions a la flore mycologique des Pays-Bas. Nederlands Kruidkunding
Archief 3: 340-536.
Madden AA, Stchigel AM, Guarro J, Sutton D, Starks PT. 2012. Mucor nidicola sp. nov., a novel
fungal species isolated from an invasive paper wasp nest. International Journal of Systematic
and Evolutionary Microbiology 62: 1720-1714. http://dx.doi.org/10.1099/ijs.0.033050-0
Mehrotra BS, Mehrotra BM. 1979 [“1978”]. Another azygosporic species of Mucor from India.
Sydowia 31: 94-96.
Mirza JH, Khan SM, Begun S, Shagufta S. 1979. Mucorales of Pakistan. Faisalabad, University of
Agriculture.
Pei KQ. 2000. A new variety of Mucor variosporus and the validation of M. luteus Linnemann and
M. variosporus Schipper. Mycosystema 19: 10-12.
Santiago ALCM de A. 2012. Zygomycota. 257-261, in: RC Forzza et al. (eds). Catalogo de plantas e
fungos do Brasil, v.1. Rio de Janeiro - Andrea Jakobsson Estudio — Instituto de Pesquisas Jardim
Botanico do Rio de Janeiro.
Santiago ALCM de A, Souza-Motta CM. 2008. Isolation of Mucorales from processed maize (Zea
mays L.) and screening for protease activity. Brazilian Journal of Microbiology 39: 698-700.
http://dx.doi.org/10.1590/S1517-83822008000400019
Santiago ALCM de A, Cavalcanti MAQ, Trufem SFB. 2008. Mucor guilliermondii (Mucorales): a
rare species found in herbivore dung from Neotropics. Mycotaxon 106: 103-108.
Santiago ALCM de A, Trufem SFB, Malosso E, Santos PJP, Cavalcanti MAQ. 2011. Zygomycetes
from herbivore dung in the Ecological Reserve of Dois Irmaos, Northeast Brazil. Brazilian
Journal of Microbiology 42: 89-95.
Schipper MA. 1975. On Mucor mucedo, Mucor flavus and related species. Studies in Mycology 10:
138,
Mucor inaequisporus in South America ... 229
Schipper MA. 1976. On Mucor circinelloides, Mucor racemosus and related species. Studies in
Mycology 12: 1-40.
Schipper MA. 1978. On certain species of Mucor with a key to all accepted species. Studies in
Mycology 17: 1-52.
Schipper MA. 1989. Mucor laxorrhizus. Studies in Mycology 31: 151-155.
Schipper MA, Samson, RA. 1994. Miscellaneous notes on Mucoraceae. Mycotaxon 50: 475-491.
Schwarz P, Bretagne S, Gantier JC, Garcia-Hermoso D, Lortholary O, Dromer F, Dannaoui E.
2006. Molecular identification of Zygomycetes from culture and experimentally infected tissues.
Journal of Clinical Microbiology 44: 340-349.
http://dx.doi.org/10.1128/JCM.44.2.340-349.2006
Subrahamanyam A. 1983. Studies on thermomycology. Mucor thermohyalospora sp. nov. Bibliotheca
Mycologica 91: 421-423.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS: molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance,
and maximum parsimony methods. Molecuar Biology and Evolution 28: 2731-2739.
http://dx.doi.org/10.1093/molbev/msr12
Voigt K, Wéstemeyer J. 2001. Phylogeny and origin of 82 Zygomycetes from all 54 genera of the
Mucorales and Mortierellales based on combined analysis of actin and translation elongation
factor EF-lalpha genes. Gene 270: 113-120. http://dx.doi.org/10.1016/S0378-1119(01)00464-4
Walther G, Pawlowska J, Alastruey-Izquierdo A, Wrzozek M, Rodriguez-Tudela JL, Dolatabadi S,
Chakrabarti A, de Hoog GS. 2013. DNA barcoding in Mucorales: and inventory of biodiversity.
Persoonia 30: 11-47. http://dx.doi.org/10.3767/003158513X665070
Watanabe T. 1994. Two new species of homothallic Mucor in Japan. Mycologia 86: 691-695.
http://dx.doi.org/10.2307/3760541
Watling R. 1969. Colour identification chart. Edinburgh, Scotland, Her Majesty's Stationery
Office.
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: A Guide to
Methods and Applications. New York, Academic Press.
White MM, James TY, O* Donnell KO, Cafaro MJ, Tanabe Y, Sugiyama J. 2006. Phylogeny of the
Zygomycota based on nuclear ribosomal sequence data. Mycologia 98: 872-884.
http://dx.doi.org/10.3852/mycologia.98.6.872
Zangeneh S, Sharifnabi B, Olia M. 2007. New records of Mucorales from Iran. Rostaniha 8(1):
43-66.
Zycha H, Siepmann R, Linnemann G. 1969. Mucorales: eine Beschreibung aller Gattungen und
Arten dieser Pilzgruppe. Lehre, J. Cramer.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.231
Volume 124, pp. 231-238 April-June 2013
Molecular phylogeny reveals Megacollybia virosa
is a Cantharocybe
T.K. ARUN KUMAR’ & P MANIMOHAN?
‘Department of Botany, The Zamorin’s Guruvayurappan College, Kerala, 673014, India
?Department of Botany, University of Calicut, Kerala 673635, India
* CORRESPONDENCE TO: [email protected]
ABSTRACT — Nuclear LSU rDNA sequence analysis unequivocally places an agaric currently
designated as Megacollybia virosa in Cantharocybe. Based on this molecular evidence,
Cantharocybe virosa comb. nov. is proposed. This transfer results in the recognition of a third
distinct species of Cantharocybe. The collections from India form the first record of the genus
outside the North American continent. Phenetically, C. virosa shares with the type species
of the genus, C. gruberi, the clitocyboid habit, distinct cheilocystidia, convex pileus with an
inrolled margin, subdecurrent to decurrent lamellae, thickset stipe, ellipsoid, thin-walled,
hyaline, smooth and inamyloid basidiospores, clamped hyphae, subregular to regular lamellar
trama, a cutis-type pileipellis disrupted to form trichodermal patches, pileipellis hyphae with
plasmatic pigment, and cystidioid terminal cells. A key to the known species is provided.
Key worps — Agaricales, Basidiomycota, systematics, taxonomy
Introduction
Cantharocybe is a little studied agaric genus (Agaricales, Basidiomycota) so
far known only from North and Central America. The genus was described
by Bigelow & Smith (1973) to accommodate a clitocyboid agaric with robust,
yellowish basidiomata, lecythiform or mucronate cheilocystidia, oblong or
subcylindric, smooth, inamyloid basidiospores, and clamped hyphae. The
genus was originally typified by Clitocybe gruberi A.H. Sm. (Smith 1944)
from Idaho based on a single sporocarp but subsequently collected from New
Mexico, California, and Washington as well. According to Bigelow & Smith
(1973), the combination of yellow pigmentation, the unusual cheilocystidia,
and subcylindric basidiospores of this species warranted its transfer from
Clitocybe to a new genus. Cantharocybe remained a monotypic genus for nearly
three decades, but very recently, another species, C. brunneovelutina Lodge
et al., was described from Belize (Ovrebo et al. 2011). Ovrebo et al. (2011)
232 ... Kumar & Manimohan
emended the genus concept by widening the range of states of characters such
as the texture and color of pileus surface and shape of both basidiospores
and cheilocystidia. Although the distinctiveness of Cantharocybe as a genus
is supported by molecular analyses within the Agaricales, the family within
which Cantharocybe should be placed is uncertain (Binder et al. 2010, Ovrebo
et al. 2011). Cantharocybe is currently placed among the basal genera of the
hygrophoroid clade (i.e., Hygrophoraceae) based on molecular analyses with
low support (Binder et al. 2010; Ovrebo et al. 2011).
Repeated collections of an agaric from various parts of Kerala State, India
have been made in the last two decades. As these particular collections defied
identification even to the genus level, it remained unpublished for quite a
long time. Eventually it was described as Megacollybia virosa based solely on
morphology (Manimohan et al. 2010). Lingering doubts about its identity
prompted us to undertake a molecular analysis, which revealed that it is closely
allied to the two species of Cantharocybe mentioned above. The results of our
molecular analysis are presented and discussed here.
Materials & methods
DNA was extracted from authentic material (TENN063483) of Megacollybia virosa
deposited at the Herbarium of the University of Tennessee. Detailed voucher information
is available in Manimohan et al. (2010). DNA was extracted from dried tissue using the
procedure described in Mata et al. (2007). The nuclear large subunit (LSU) ribosomal
RNA region was amplified and sequenced with primers LROR and LR5. Sequences were
edited in Sequencher 4.10.1 (Gene Codes Corp., Ann Arbor, Michigan), the segments
with ambiguous bases trimmed from the ends, and similar sequences were searched
in GenBank with the BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) algorithm.
Initial BLAST queries showed close affinities with Cantharocybe brunneovelutina
(92% sequence identity) and C. gruberi (91% sequence identity). An LSU sequence
dataset was assembled with sequences of taxa that showed >90% similarities with the
newly generated sequence, additional sequences of representative members of genera
(including outgroup Phyllotopsis nidulans (Pers.) Singer) selected based on Ovrebo et
al. (2011), and sequences of representative species of Megacollybia (Hughes et al. 2007)
were downloaded from GenBank and assembled into a dataset. The newly generated
sequence was deposited in GenBank with accession number JX101471.
The LSU sequence dataset was manually aligned in CLUSTALX 2.1 and then
examined in Se-Al 2.0all (Andrew Rambaut, University of Edinburgh, U.K.
http://tree.bio.ed.ac.uk/software/seal). The region analyzed contained a total of 1452 bp.
The alignment was deposited in TreeBase with submission number 12767 (http://purl.
org/phylo/treebase/phylows/study/TB2:S12767). Maximum Parsimony (MP) analysis
was conducted in PAUP* 4.0b10 (Swofford 2002) using a heuristic search option with
TBR branch swapping, 1000 replicates using random step-wise addition, and holding
one tree at each step. All minimal length trees were saved, and maxtrees was set as
unrestricted. Bootstrap analysis (Felsenstein 1985) was carried out to evaluate support for
Cantharocybe virosa comb. nov. (India) ... 233
91 Cantharocybe virosa Jx101471
90 | 2% Cantharocybe brunneovelutina HM588721
Cantharocybe gruberi DQ234540
Hygrocybe pratensis AF261457
Ampulloclitocybe clavipes —U522769
99 Hygrocybe coccinea AM946460
93 Hygrocybe conica 19071739
Camarophyllus griseorufescens GU233423
aa 100 Camarophyllus basidiosus DQ457651
98 Camarophyllus canescens DQ457652
Xeromphalina campanella ay207312
Lichenomphalia umbellifera AF261445
Gliophorus laetus AF261446
88 Cortinarius distans AF261595
92 Cortinarius metallicus ay219582
Chrysomphalina chrysophylla DQ457656
Hygrophorus chrysodon 0Q071733
Hygrophorus sordidus AF042562
98 Megacollybia subfurfuracea EU623750
96 Megacollybia rodmanii £u623792
91 Megacollybia texensis —U623738
88 Megacollybia fusca —U623743
96 Megacollybia platyphylla EU623712
74 94 Megacollybia marginata —u623689
99 | Megacollybia fallax —u623723
81
Megacollybia clitocyboidea —U623679
Phyllotopsis nidulans DQ071736
FiGurRE 1. One of four equally parsimonious trees generated during the phylogenetic analyses of
LSU rDNA sequences. Numbers above branches indicate MP bootstrap values and numbers below
branches indicate BI clade credibility (posterior probability) values. Only values greater than 70%
are shown. GenBank accession numbers are provided.
the branching topologies with a full heuristic search option on 1000 replicates. Bayesian
inference (BI) analysis was done using MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003).
The general time reversible model with gamma distributed rate variation option was
selected. Multiple independent analyses were done for 1 million generations with trees
saved every 100 generations. Options for incremental heating scheme, chain number,
and priors were set to MrBayes default settings. The first 1000 samples were burned
before calculating posterior probabilities.
Manimohan et al. (2010) is followed for the morphological description. Color codes
refer to Kornerup & Wanscher (1978).
234 ... Kumar & Manimohan
Results
Megacollybia virosa is resolved in a clade with C. brunneovelutina and
C. gruberi with strong branch support in both Bayesian and parsimony
analyses (Fic. 1). The analysis also places Hygrocybe pratensis (Fr.) Murrill
(= Camarophyllus pratensis (Fr.) P. Kumm.) as the sister group to Cantharocybe
but with no support. Three species of Camarophyllus (= Cuphophyllus) were
included in the analysis group with species of Xeromphalina, Ampulloclitocybe,
and Hygrocybe. Although a relationship of these taxa with Cantharocybe is
indicated, the placement is not well supported. Eight representative species
of the genus Megacollybia form a distinct clade with strong support in all the
maximum parsimony and maximum likelihood analyses. Cantharocybe virosa
shows no close phylogenetic affinities with members of Megacollybia.
Discussion
DNA sequencing and analysis of the nLSU gene region supports a close
phylogenetic relationship between Megacollybia virosa and the two known
species of Cantharocybe. Although initially described asa species of Megacollybia,
the distinctiveness of M. virosa had been recognized based on its abundant
cheilocystidia of a unique morphology and the distinctive terminal elements of
the pileipellis (Manimohan et al. 2010). The cheilocystidia in M. virosa feature a
clavate, cylindrico-clavate, or ventricose basal part and an upper part extending
into an elongated neck with or without a rounded capitulum (Fic. 2b). While
this unique cystidial morphology is not characteristic of Megacollybia, it is
seen in the type species of Cantharocybe, C. gruberi. Phenetically, apart from
the morphology of cheilocystidia, M. virosa shares the following characters
with Cantharocybe: robust clitocyboid basidiomata (Fic. 2a), convex pileus
with an inrolled margin, subdecurrent to decurrent lamellae, thickset stipe,
ellipsoid, thin-walled, hyaline, smooth and inamyloid basidiospores (Fic. 2c),
clamped hyphae, subregular to regular lamellar trama, a cutis-type pileipellis
disrupted to form trichodermal patches, and pileipellis hyphae with plasmatic
pigment and cystidioid terminal cells. At the same time, it differs from both
C. gruberi and C. brunneovelutina in having a grayish brown pileus surface.
Additionally, C. gruberi differs in having much larger, narrowly elliptic to
oblong basidiospores, whereas C. brunneovelutina has a unique cystidial
morphology with a resemblance to basidia. According to Matheny et al. (2006),
C. gruberi belongs to pluteoid clade and in Moncalvo et al’s (2002) analysis,
the relationships of C. gruberi remained unresolved although it formed a
distinct clade with Camarophyllus pratensis. The placement of Camarophyllus
(= Cuphophyllus) and Cantharocybe in the hygrophoroid clade has been
indicated by Binder et al. (2010) and Ovrebo et al. (2011). The collections of
M. virosa from India form the first report of a Cantharocybe species outside the
North American continent.
Cantharocybe virosa comb. nov. (India) ... 235
Based on the results of the present molecular analysis, the following new
taxonomic combination is proposed:
Cantharocybe virosa (Manim. & K.B. Vrinda) T.K.A. Kumar, comb. nov. Fic. 2
MycoBank MB800480
= Megacollybia virosa Manim. & K.B. Vrinda, Mycotaxon 111: 364. 2010.
BASIDIOMATA medium-sized, fleshy, clitocyboid. Piteus 45-100 mm broad,
convex, becoming broadly convex; surface light brown (6D5), brown (6E4),
grayish brown (7E3), or dark gray (7F8), slightly darker at the center, pruinose
to somewhat granular to the naked eye, with fine appressed scales under a
lens, dry; margin inrolled when very young, becoming incurved and finally
becoming straight, initially entire, becoming fissile with age. LAMELLAE adnate
to decurrent, moderately crowded, with lamellulae in four to eight tiers, up to
9 mm deep, whitish to yellowish white (1A2); edges smooth to finely fimbriate
under a lens. StrpE 20-75 x 5-23 mm, central or at times slightly excentric,
terete to slightly compressed, almost equal with a dilated apex, solid, with
white basal mycelium; surface dull white with fine, light brown (6D5), grayish
FIGURE 2. Cantharocybe virosa (TENN063485, holotype).
a. Basidiomata; b. Cheilocystidium; c. Basidiospore. Scale bars: a = 1 cm; b, c = 10 um.
236 ... Kumar & Manimohan
brown (7E3), or dark gray granular squamules concentrated towards the base
and disappearing easily when handled. ConTEXT <20 mm thick, white. ODOUR
strong and unpleasant. SPORE PRINT white.
BASIDIOSPORES 6.5-11(-12) x 5-7 um, subglobose to ellipsoid, thin-
walled, smooth, with refractive guttules, inamyloid. Basip1a 23-56 x 7.5-11
um, cylindrico-clavate to clavate, thin-walled, hyaline, with granular contents,
4-spored; sterigmata <5 um long. CHEILocystTip1A abundant, 20-63 x 5.5-9
um, clavate, cylindrico-clavate, or ventricose, majority with a small capitellum
on a slender neck up to 35 um long, often septate, thin-walled, hyaline to pale
yellowish, apex sometimes covered with glutinous exudates; edges of lamellae
sterile. PLEUROCYSTIDIA absent. LAMELLAR TRAMA regular to subregular,
hyphae 3-15 um wide, hyaline to pale yellowish, thin-walled, inamyloid.
PILEAL TRAMA interwoven; hyphae 2-20 um wide, slightly inflated, hyaline to
pale yellowish, thin-walled. PILEIPELLIS mostly a cutis of highly interwoven
agglutinated hyphae, occasionally disrupted with trichodermal patches,
hyphae 3-10 um wide, thin- to slightly thick-walled, often with a grayish
brown plasmatic pigment; terminal elements cystidioid, 23-85 x 3-10 um,
similar to cheilocystidia in all aspects, often with a greyish brown plasmatic
pigment. STIPITIPELLIs a highly disrupted and irregular cutis with agglutinated
trichodermal patches of ascending to erect hyphal elements, hyphae 2-21 um
wide, thin- to slightly thick-walled, with gray to dark grayish plasmatic and
membrane pigment; terminal elements cystidioid, similar to cheilocystidia in
all aspects. CLamps frequent on all hyphae.
Hasirat: On soil or on mud walls, often associated with roots of coconut
trees in a tropical climate, solitary or in caespitose clusters, May to August.
SPECIMENS EXAMINED — INDIA, KERALA STATE, CaLicuT District, Puthiyangadi,
31 July 2005, T.K. Arun Kumar AK373 (TENN063483, GenBank, JX101471); 10
August 2005, T.K. Arun Kumar AK378 (TENN063476); 12 June. 2006, T.K. Arun
Kumar AK395 (TENN063485, holotype); 21 June 2006, T.K. Arun Kumar AK397
(TENN063486); THIRUVANANTHAPURAM District, Plamood, 30 May 1998, C.K.
Pradeep TBGT4310 (TENN063480); Vizhinjam, 11 December 2000, C.K. Pradeep
TBGT5249 (TENN063479); 23 May 2002, C.K. Pradeep TBGT5526 (TENN063482);
Muttada, 9 July 2006, K.B. Vrinda TBGT9804 (TENN063481); 28 August 2006, K.B.
Vrinda TBGT9938 (TENN063484).
Key to the species of Cantharocybe
la. Pileus dark brown; cheilocystidia resembling basidia with 1-4 sterigma-like
apical appendages, extending at oblique angles and frequently swollen or
capitate at the apex; basidiospores 9-9.5 x 5.5-6 tum, Belize, Central America
REPO PCa) YabeesTe crag Eh: wal Coke wat Be Oh cata AS cna sow oh Lets cw Rt crt C. brunneovelutina
1b. Pileus yellow or pale grayish brown; cheilocystidia lecythiform or
SOUIS TIES HNALIY, AATIUCE OTALE APEX * Weert, wavy las cln Mre nl ined adhe heyy whem 2
Cantharocybe virosa comb. nov. (India) ... 237
2a. Pileus yellow; basidiospores (13.5)14-15(16) x 3 5.5-6 um, narrowly elliptic to
oblong, western North America (temperate) ...................006. C. gruberi
2b. Pileus pale grayish brown; basidiospores 6.5-11(-12) x 5-7 um, subglobose to
broddh-eéllipsoid: Indias (itopical):. tt esl h ew vee dn we onete « oloveld eatin > A C. virosa
Cantharocybe virosa is known to be toxic, capable of inducing severe gastro-
intestinal upset when eaten (Manimohan et al. 2010). Nothing is known about
the potential toxicity of the two American species.
Acknowledgments
We are greatly indebted to Prof. Karen W. Hughes and Prof. Ronald H. Petersen
for their kind help in sequencing the DNA of Cantharocybe virosa. We thank Dr.
M. Catherine Aime for valuable comments on the identity of the species and for a critical
review of the manuscript. We are also grateful to Dr. P. Brandon Matheny for a critical
review of the manuscript.
Literature cited
Bigelow HE, Smith AH. 1973. Cantharocybe, a new genus of Agaricales. Mycologia 65: 485-488.
http://dx.doi/org/10.2307/3758121
Binder M, Larsson K-H, Matheny PB, Hibbett DS. 2010. Amylocorticiales ord. nov. and Jaapiales
ord. nov.: early diverging clades of Agaricomycetidae dominated by corticioid forms. Mycologia
102: 865-880. http://dx.doi/org/10.3852/09-288
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution
39: 783-791.
Hughes KW, Petersen RH, Mata JL, Psurtseva, NV, Kovalenko AE, Morozova OV, Lickey EB,
Cifuentes Blanco J, Lewis DP, Nagasawa E, Halling RE, Takehashi $, Aime MC, Bau T, Henkel
T. 2007. Megacollybia (Agaricales). Reports of the Tottori Mycological Institute 45: 1-57.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour, 3rd edn. London, Methuen.
Manimohan P, Kumar TKA, Vrinda KB, Pradeep CK. 2010. Megacollybia virosa, a new species with
toxic basidiomata from India. Mycotaxon 111: 363-368. http://dx.doi/org/10.5248/111.363
Mata, JL-, Hughes, KW, Petersen, RH. 2007. An investigation of Omphalotaceae (Fungi: Euagarics)
with emphasis on the genus Gymnopus. Sydowia 58: 191-289.
Matheny PB, Curtis JM, Hofstetter V, Aime MC, Moncalvo JM, Ge ZW, Yang ZL, Slot JC, Ammirati
JE, Baroni TJ, Bougher NL, Hughes KW, Lodge DJ, Kerrigan RW, Seidl MT, Aanen DK, DeNitis
M, Daniele GM, Desjardin DE, Kropp BR, Norvell LL, Parker A, Vellinga EC, Vilgalys R,
Hibbett DS. 2006. Major clades of Agaricales: a multilocus phylogenetic overview. Mycologia
98: 982-995. http://dx.doi/org/10.3852/mycologia.98.6.982
Moncalvo JM, Vilgalys R, Redhead SA, Johnson JE, James TY, Aime MC, Hofstetter V, Verduin SJW,
Larsson E, Baroni TJ, Thorn RG, Jacobsson S, Clémencon H, Miller OK. 2002. One hundred
seventeen clades of euagarics. Mol Phylogenet Evol 23: 357-400. http://dx.doi/org/10.1016/
$1055-7903(02)00027-1
Ovrebo CL, Lodge DJ, Aime MC. 2011. A new Cantharocybe from Belize with
notes on the type of Cantharocybe_ gruberi. Mycologia 103: 1102-1109.
http://dx.doi/org/10.3852/10-360
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574.
238 ... Kumar & Manimohan
Smith AH. 1944. New North American agarics. Mycologia 36: 242-262.
http://dx.doi/org/10.2307/3754821
Swofford DL. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods). 4.
Sunderland, Massachusetts: Sinauer Associates.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.239
Volume 124, pp. 239-245 April-June 2013
New record of Scedosporium dehoogii from India
ROHIT SHARMA’, GIRISH KULKARNI,
MAHESH S. SONAWANE!’ & YOGESH S. SHOUCHE’
"Microbial Culture Collection, National Centre for Cell Science &
?Molecular Biology Unit, National Centre for Cell Science
NCCS Complex, Ganeshkhind, Pune-411 007 (Maharashtra), India
* CORRESPONDENCE TO: [email protected]
ABSTRACT — Three strains of Scedosporium were isolated from Pimpri (Pune), Maharashtra,
India, during a survey of soil fungi in industrial areas. Morphological and sequence (ITS1-
5.8S-ITS2 rDNA) analyses confirm them to be Scedosporium dehoogii (reported here as a new
record for India) and S. apiospermum.
Key worps — disease, Microascaceae, phylogeny, scedosporiosis, taxonomy
Introduction
Scedosporium Sacc. ex Castell. & Chalm. (teleomorph Pseudallescheria
Negroni & I. Fisch.; Microascaceae) are cosmopolitan fungi found in soil,
sewage, and water, some of which can cause infection in humans. Five medically
important Scedosporium species — S. apiospermum Sacc. ex Castell. & Chalm.,
S. aurantiacum Gilgado et al., S. boydii (Shear) Gilgado et al., S. dehoogii, and
S. prolificans (Hennebert & B.G. Desai) E. Guého & de Hoog (Gilgado et al.
2005, 2008) — cause various diseases (broadly termed as scedosporiosis;
Guarro et al. 2006, Cortez et al. 2008) that mostly infect immunocompromised
patients, causing mycetoma, septic arthritis, osteomyelitis, meningitis, brain
abscesses, etc. (Cooley et al. 2007). In India, there have been several reports
of Scedosporium infection (Lingappa & Lingappa 1962, Acharya et al. 2006,
Gopinath et al. 2010, Nath et al. 2010, Mathew et al. 2012). During the present
study we isolated one Scedosporium apiospermum strain and two S. dehoogii
strains. Our survey of the literature and fungal checklists (Bilgrami et al. 1991,
Jamaluddin et al. 2004) indicates that S. dehoogii is a new record for India.
Materials & methods
The fungi were isolated from soil collected from industrial region of Pimpri (Pune),
Maharashtra, India, on 23 December 2011. Isolated strains were cultured on five media
240 ... Sharma & al.
obtained from Hi-Media (India) — 2% malt extract agar (MEA), potato dextrose
agar (PDA), Czapek Dox agar (CDA), potato carrot agar (PCA), oatmeal agar (OA)
— at 10—40+0.2°C in the dark. Morphological characteristics were observed on PDA
at 25+0.2°C (7 d). Cultures have been deposited at the Microbial Culture Collection
(MCC), National Centre for Cell Science, Pune, India as S. apiospermum MCC 1042 and
S. dehoogii MCC 1043 and MCC 1044, and a specimen of MCC 1044 has been deposited
in the Ajrekar Mycological Herbarium (AMH), Agharkar Research Institute, Pune,
India. Microscopic characters were studied in lactophenol stained with cotton blue (Hi-
Media, India) using Nikon YS100 microscope (Nikon, Japan). Microphotographs were
taken on Olympus BX53 (Olympus Corporation, Japan) fitted with ProgRes C5 camera
(Jenoptik, USA). Samples were coated with platinum on Jeol minor coater (Jeol-JFC
1600) for examination on a Jeol-JSM 6360A scanning electron microscope at 10 kV.
Fungal DNA was isolated from pure 7 d old cultures with beads and lysis buffer in 2
ml Eppendorf tubes according to Sharma & Graser (2011). Total DNA was checked on
gel and NanoDrop spectrophotometer (NanoDrop, USA). PCR was conducted with a
Gene Amplifier PCR System 9700 (Perkin Elmer, USA) using ITS1 and ITS4 primers
for ITS1-5.8S-ITS2 region (White et al. 1990). A 25 ul mixture containing 10 U Taq
polymerase buffer (New England Biolabs), 2 mM dNTPs, 10 pM primers, 1 unit Taq
polymerase (New England Biolabs), and 10 ng DNA was amplified following a protocol
of initial denaturation at 94°C for 2 min, 35 cycles of denaturation at 94°C for 1 min,
annealing at 55°C for 1 min and extension at 72°C for 1 min, final extension at 72°C
for 10 min. The PCR product was checked on 1.0% agarose gel and purified by PEG-
NaCl (Polyethylene glycol-NaCl). Sequencing was done on ABI 3730xl Automated
Sequencer using ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit’
(Perkin Elmer Applied Biosystems Division, Foster City, CA). An NCBI Blastn search
for ITS region was conducted for sequence similarity (Altschul et al. 1990). Sequences
of MCC 1042, MCC 1043 and MCC 1044 were generated in lab and other sequences
retrieved from GenBank and deposited in European Molecular Biology Laboratory
(EMBL) database. The sequences were aligned and edited in Clustal W of Molecular
Evolutionary Genetics Analysis (MEGA 5.0) computer program (Higgins et al. 1994,
Tamura et al. 2011). Phylogenetic analyses were done by Kimura 2-parameter model
using Neighbour Joining (NJ) statistical method. Gaps and missing data was removed
by complete deletion option of the software. The bootstrap consensus tree was inferred
from 1000 replicates and bootstrap values <50% were removed from the tree (Saitou &
Nei 1987; Tamura et al. 2011).
Taxonomy
Scedosporium dehoogii Gilgado, Cano, Gené & Guarro, J. Clin. Microbiol. 46(2):
768. 2008. PLATE 1
The PDA colonies, which reached 32 mm diam. after 7 d at 25+0.2°C, were
radially zonate, dense, cottony to lanose, grayish-white to white and with a
whitish lobate or irregular and fimbriate margin; the reverse was yellowish
fading towards margin and with radial zones also visible. Other strain was
effused, white to pale gray, fast growing, 75 mm after 7 d at 25+0.2°C on PDA
Scedosporium dehoogii new to India... 241
Fic. 4. SEM of mycelial mat with conidia. Fic. 5. SEM of sessile conidia. Scale bars: 1-3 = 50 um;
4=10um;5=2 um.
with colorless reverse. Solitary conidiophores were subhyaline smooth-walled,
10—54 x 1-1.4 um, and produced pale brown, obovoid or ellipsoidal, 5.9-6.2 x
3.6—4.4 um conidia. Sessile conidia subhyaline, thick-walled, mostly obovate,
(6.9-)7.3(-7.8) x (3.5-)3.8(-4.0) um. Hyphae hyaline to subhyaline, 1.2-2.5
uum. A teleomorph was not observed even after 60 d of incubation.
DISTRIBUTION & HABITAT: Pimpri (Pune), Maharashtra, India (soil from industrial
area). (First described from garden soil in Barcelona, Spain.)
MATERIAL EXAMINED: INDIA, Manarasutra State, Pimpri (Pune), 18°37(07.04(N
73°48(13.43(E, soil, 23.X1I.2011, Rohit Sharma, culture S9-H (AMH-9561; MCC 1044;
GenBank HF570054); culture S9-D (MCC 1043; GenBank HF570053).
Results & discussion
Both Scedosporium dehoogii strains had similar optimum and maximum
growth temperatures, but the MCC 1043 PDA colonies grew around two times
faster than those of MCC 1044 (PLATE 2). Scedosporium apiospermum MCC
242 ... Sharma & al.
S. dehoogii MCC 1043
70
= 60 ——CDA
8 50
a —™—MEA
>, 40
5 —*- OMA
& 30
Y 20 =—PCA
10 ——PDA
0 ’
10 15.20 25 30 35.40
Temperature (°C)
ma S. dehoogii MCC 1044
50
2 40 —-—CDA
A 30 —a—MEA
Pont
E —— OMA
2 20
é) —— PCA
10 S—PDA
10 15 20 25 30 35 40
Temperature (°C)
PLATE. 2. Temperature-growth relationship of Scedosporium dehoogii MCC 1043 and MCC 1044
on Malt Extract Agar (MEA), Czapek Dox Agar (CDA), Oatmeal Agar (OA), Potato Dextrose Agar
(PDA), Potato Carrot Agar (PCA) (mm diam. of 7-d old colonies).
1042 had an optimum temperature of 35+0.2°C on OMA (15+0.2°C minimum
and 40+0.2°C maximum). The sessile conidia of S. dehoogii MCC 1044 are
narrower than in the ex-type culture CBS 117406 (5—6 um; Gilgado et al. 2008).
ITS sequences of 62 strains retrieved from GenBank were aligned with the
sequences from our S. apiospermum and S. dehoogii strains. Of the 545 bp used
to construct the phylogeny, 434 were conserved, 107 variable, 76 parsimony-
informative, and 31 singletons. The NJ-phylogenetic analysis clustered MCC
1043 and MCC 1044 in the S. dehoogii species group, which forms a separate
branch clearly distinguishing it from other Scedosporium species (PLATE 3).
Scedosporium apiospermum and S. prolificans have been reported several
times from India and are associated with various types of infections in both
immunocompromised and immunocompetent patients (Gopinath et al. 2010,
Nguyen & Raychaudhuri 2011, Patil et al. 2011, Mathew et al. 2012, Kaur et al.
2013, Matlani et al. 2013); however, S. dehoogii is reported for the first time from
Scedosporium dehoogii new to India ... 243
edosporitun apiospenmum THEM 15642 (AJ888403)
edosporium apiospermum RKI 2956/93 (AJ888415)
edosporium apiospennum THEM 15149 (AJ888402)
edospor ium apiospermum THEM 14754 (AJ888399)
edospor itm apiospermum IHEM 14462 (AJ888395)
edospor ium apiospermum FMR. 8535 (AJ888409)
edospor ium apiaspermum FMR. 8534 (AJ888408)
edosporitum apiospermum FMR. 8521 (AJ888430)
Scedosporium apiospermum FMR. 6922 (AJ888390)
edosporium apiospermum FMR 6918 (AJ888433)
edosporium apiospermum FMR 8619 (AJ8884 16)
cedosporium apiospermum FMR. 8625 (AJ888420)
edosporium apiospermium IHEM 14268 (AJ888393)
edosporium apiospermum MUCL 6106 (AJ888404)
‘Scedosporium apiospermum MUCL 8302 (AJ888442)
Scedosporium apiospermum MCC 1042 (HF570052)
\Scedosporiwn apiospermum FMR 6919 (AJ888388)
\Scedosporitun apiospermum FMR. 6920 (AJ888434)
\Scedosporitum apiospermum FMR. 8522 (AJ888431)
\Scedosporiwm apiospermum FMR 8530 (AJ888406)
\Scedosporiwn apiospermum FMR. 8621 (AJ888418)
\Scedosporiwun apiospermwn IHEM 14464 (AJ888396)
\Pseudallesche ria baydii IHEM 14758 (AJ888400)
Scedosporiwm apiospermum IHEM 15144 (AJ888401)
Pseudallescheria fusoidea CBS 106.53 (AJ888428)
Pseudailescheria fusoidea MUCL 14092 (AJ888429)
Pseudallescheria baydii MUCL 18784 (AJ888405)
Pseudallescheria boydii THEM 14467 (AJ888397)
Pseudallescheria boydit THEM 14354 (AJ888437)
Pseudallesche ria ellipsoidea FMR. 8623 (AJ888427)
Pseudallescheria boydii FMR. 8539 (AJ888411)
3q|Pseudallesche ria boydit FMR 7885 (AJ888392)
Pseudallesche ria boydii FMR 4167 (AJ888385)
‘Pseudallescheria boydii FMR. 7884 (AJ888391)}
Pseudallescheria baydii IHEM 14451 (AJ888394)
Pseudallesche ria boydit IHEM 14263 (AJ888436)
Pseudallescheria baydii FMR 8620 (AJ888417)
6\ Pseudallescheria baydii FMR. 8538 (41888443)
Pseudallescheria boydii FMR. 6697 (AJ888387)
Pseudatlescheria boydit FMR. 6694 (AJ888386)
Pseudallescheria baydii FMR. 8537 (AJ888410)
Pseudallesche ria boydit FMR 8540 (AJ888412)
Pseudallescheria boydii RV 43605 (AJ888383)
Pseudallesche ria boydit IHEM 14358 (AJ888438)
Pseudallesche ria boydit IHEM 14638 (AJ888398)
95) Pseudallescheria baydii CBS 101.22 (AJ888435)
Pseudallescheria boydii MUCL 14009 (AJ888422)
Pseudailescheria elipsoidea CBS 418.73 (AJ888426)
da ahaa mirutispora FMR. 4072 (AJ888384)
Pseudallesche ria mirutispora MUCL 29258 (AJ888424)
oo [ipoenalesonets angusta FMR 8541 (AJ888413)
89 Pceudallescheria angusta CBS 254.72 (AJ889414)
Scedosporium dehoogii MCC 1044 (HF570054)
\Scedosporitum dehoogii FMR. 6921 (AJ888389)
\Scedosporitum dehoogii FMR 8532 (AJ888407)
“pascedosporium dehoogii FMR. 8622 (AJ888419)
Scedosporium dehoogii MUCL 8522 (AJ888421)
[— Scedosporium dehoogii MCC 1043 (HF570053)
Scedosporium dehoogii MUCL 20263 (AJ888423)
cedosporium aurantiacwn FMR. 8630 (AJ888440)
cedosporitum aurantiacum IHEM 15458 (AJ88844 1)
9lscedosporium aurantiacum IHEM 15579 (AJ888439)
Scedosporium aurantiacwn RKI 2782/95 (AJ888432)
‘Pseudailescheria africana CBS 311.72 (AJ888425)
‘Scedosporiwn prolificans FMR. 7294 (AJ888444)
100
-—H
0.01
PiaTE. 3. Neighbor-joining tree derived from the ITS region rDNA sequences of Scedosporium spp.
Bootstrap values were calculated from 1000 replications. Bootstrap below 50% were deleted.
244 ... Sharma & al.
India and outside Europe. Isolation of these strains from a single soil sample
is an important factor as there are growing numbers of immunocompromised
patients in Pune, India due to immunopulmonary infections (Salvi & Barnes
2009), AIDS, H1N1, and other viral infections caused by compromised
hygiene in many hospitals. Although Gilgado et al. (2009) has shown that S.
dehoogii is pathogenic to immunocompetent mice, detailed surveys of different
natural and human dominated habitats are required to confirm distribution
of Scedosporium in India as noted by Kaltseis et al. (2009) for Austria and the
Netherlands. Research on secondary fungal infections of immunocompromised
patients may also determine whether the victims are actually succumbing to
secondary infection caused by Scedosporium or similar fungi.
Acknowledgments
The authors thank DBT, India for funding and Director, NCCS, India for laboratory
facilities. Dr. S.V. Shinde, University of Pune, India is acknowledged for SEM microscopy.
Authors also thank Dr. J. Guarro, Universitat Rovira i Virgili, Spain and Dr. G.S. de
Hoog, CBS, Netherlands for reviewing the manuscript and suggestions.
Literature cited
Acharya A, Ghimire A, Khanal B, Bhattacharya S, Kumari N, Kanungo R. 2006. Brain abscess due
to Scedosporium apiospermum in a non-immunocompromised child. Indian Journal of Medical
Microbiology 24(3): 231-232. http://dx.doi.org/10.1186/1471-2334-12-S1-P59
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool.
Journal of Molecular Biology 215: 403-410. http://dx.doi.org/10.1016/S0022-2836(05)80360-2
Bilgrami KS, Jamaluddin, Rizwi MA. 1991. Fungi of India: List and References. Today & Tomorrow
Printers & Publishers, New Delhi, India. 798 p.
Cooley L, Spelman D, Thursky K, Slavin M. 2007. Infection with Scedosporium apiospermum
and S. prolificans, Australia. Emerging Infectious Diseases 13(8): 1170-1177.
http://dx.doi.org/10.3201/eid1308.060576
Cortez KJ, Roilides E, Quiroz-Telles FE, Meletiadis J, Antachopoulos C, Knudsen T, Buchanan W,
Milanovich J, Sutton DA, Fothergill A, Rinaldi MG, Shea YR, Zaoutis T, Kottilil S, Walsh TJ.
2008. Infections caused by Scedosporium spp. Clinical Microbiology Reviews 21(1): 157-197.
http://dx.doi.org/10.1128/CMR.00039-07
Gilgado F, Cano J, Gené J, Guarro J. 2005. Molecular phylogeny of the Pseudallescheria boydii
species complex: proposal of two new species. Journal of Clinical Microbiology 43(10):
4930-4942. http://dx.doi.org/10.1128/JCM.43.10.4930-4942.2005
Gilgado F, Cano J, Gené J, Sutton DA, Guarro J. 2008. Molecular and phenotypic data supporting
distinct species statuses for Scedosporium apiospermum and Pseudallescheria boydii and the
proposed new species Scedosporium dehoogii. Journal of Clinical Microbiology 46(2): 766-771.
http://dx.doi.org/10.1128/JCM.01122-07
Gilgado FE, Cano J, Gené J, Serena C, Guarro J. 2009. Different virulence of the species of the
Pseudallescheria boydii complex. Medical Mycology 47: 371-374.
http://dx.doi.org/10.1080/13693780802256539
Gopinath M, Cherian A, Baheti NN, Das A, Antony M, Sarada C. 2010. An elusive diagnosis:
Scedosporium apiospermum infection after near-drowning. Annals of Indian Academy of
Neurology 13: 213-215. http://dx.doi.org/10.4103/0972-2327.70878
Scedosporium dehoogii new to India... 245
Guarro J, Kantarcioglu AS, Horre R, Rodriguez-Tudela JL, Estrella MC, Berenguer J, de Hoog
GS. 2006. Scedosporium apiospermum: changing clinical spectrum of a therapy-refractory
opportunist. Medical Mycology 44: 295-327. http://dx.doi.org/10.1080/13693780600752507
Higgins D, Thompson J, Gibson T, Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W:
improving the sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research
22(22): 4673-4680. http://dx.doi.org/10.1093/nar/22.22.4673
Jamaluddin, Goswami MG, Ojha BM. 2004. Fungi of India: 1989-2001. Scientific Publishers,
Jodhpur, India. 326 p.
Kaltseis J, Rainer J, de Hoog GS. 2009. Ecology of Pseudallescheria and Scedosporium species in
human-dominated and natural environments and their distribution in clinical samples 47(4):
398-405. http://dx.doi.org/10.1080/13693780802585317
Kaur R, Kashyap B, Bhalla P. 2013. A five-year survey of onychomycosis in New Delhi, India:
epidemiological and laboratory aspects. India Journal of Dermatology 52(1): 39-42.
http://dx.doi.org/10.4103/0019-5154.31923
Lingappa, BT, Lingappa, U. 1962. Isolation of Allescheria boydii Shear from heated Indian soils.
Current Science 31(2): 70-72.
Mathew S, Rao RM, Raghavendra S, Chandramouli BA, Kamble R, Athmanathan S. 2012. Rare case
of multiple brain abscess - Scedosporium apiospermum. BMC Infectious Diseases 12 (Suppl 1):
59. http://dx.doi.org/10.1186/1471-2334-12-S1-P59
Matlani M, Kaur R, Shweta. 2013. A case of Scedosporium prolificans osteomyelitis in an
immunocompetent child, misdiagnosed as tubercular osteomyelitis. Indian Journal of
Dermatology 58(1): 80-81. http://dx.doi.org/10.4103/0019-5154.105319
Nath R, Gogoi RN, Saikia L. 2010. Keratomycosis due to Scedosporium apiospermum. Indian
Journal of Medical Microbiology 28: 414-415. http://dx.doi.org/10.4103/0255-0857.71811
Nguyen CT, Raychaudhuri SP. 2011. Scedosporium infection in a patient with anti- TNFa therapy.
Indian Journal of Dermatology 56(1): 82-83. http://dx.doi.org/10.4103/0019-5154.77560
Patil SS, Kulkarni SA, Udgaonkar US, Magdum VK. 2011. Scedosporium apiospermum otomycosis
in an immunocompetent man. Al Ameen Journal of Medical Science 4(3): 299-302.
Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution 4(4): 406-425.
Salvi SS, Barnes PJ. 2009. Chronic obstructive pulmonary disease in non-smokers. Lancet 374:
733-743. http://dx.doi.org/10.1016/S0140-6736(09)61303-9
Sharma R, Graser Y. 2011. Microsporum. 285-298, in Dongyou Liu (ed.), Molecular detection of
human fungal pathogens. CRC Press, UK.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA 5.0: Molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance and
maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in MA Innis et al. (eds.). PCR Protocols: a guide to
methods and applications. Academic Press, Inc., New York.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.247
Volume 124, pp. 247-254 April-June 2013
Inocybe nitidiuscula and its ectomycorrhizae
associated with Alnus nitida from Galyat, Pakistan
S. Ityas*, A. RAZAQ & A.N. KHALID
Department of Botany, University of the Punjab, Lahore. 54590, Pakistan
*CORRESPONDENCE TO: [email protected]
ABSTRACT — Inocybe nitidiuscula and its ectomycorrhizae are characterized from Pakistan
morphologically and using rDNA internal transcribed spacer sequences. The sequences of
above- and below-ground structures exhibit >97% similarity. This represents a new species
record for Pakistan and the first description of ectomycorrhiza formed by I. nitidiuscula.
Keyworps — alders, euagarics, Himalayan moist temperate forest, morphotype
Introduction
Inocybe (Fr.) Fr. (Agaricales, Basidiomycota) is a large, widely distributed
genus of gilled fungi with more than 500 species worldwide (Kirk et al. 2008).
This genus is characterized by a fibrillose pileus, equal or bulbous stipe,
metuloids or thin walled cystidia, and yellowish brown smooth to angular-
nodulose ellipsoid to amygdaliform spores. Many Inocybe species have thick
walled pleuro-cheilocystidia (metuloids) that others lack (Heim 1931, Kiihner
& Romagnesi 1953, Kiihner 1980, Kuyper 1986, Singer 1986, Stangl 1989,
Kobayashi 2002).
Inocybe species play a very important role in the ecology of coniferous
and deciduous trees by forming ectomycorrhizal associations (Larsson et
al. 2009). The salient features of Inocybe ectomycorrhizae (EcM) are shiny
ramifications, absence of rhizomorphs and cystidia, emanating hyphae
with clamp connections, and a short exploration type (Agerer 2006). EcM
have been reported for Inocybe appendiculata Kihner, I. avellana P. Kumm.,
I. fuscomarginata Kiihner, I. heimii Bon, I. lacera (Fr.) P. Kumm., I. lanuginella
(J. Schrot.) Konrad & Maubl., I. obscurobadia (J. Favre) Grund & D.E. Stuntz,
I. petiginosa (Fr.) Gillet, and I. terrigena (Fr.) Kuyper. So far, ECM have not been
described for I. nitidiuscula with any host plant.
Galyat, a narrow 250,000 acre strip of Himalayan moist temperate forest
(HMTF) northeast of IsLamabad extending on both sides of KPK-Punjab border,
248 ... Ilyas, Razaq & Khalid
is considered the best representative of HMTF with a high species diversity
(JJamal & Khadija 2009, Irshad & Khan 2012). The region is characterized by
mixed vegetation of deciduous and coniferous trees. Niazi (2008) and Niaziet al.
(2006, 2007, 2009, 2010) have reported on previous studies on ectomycorrhizal
fungi from this area.
During fieldwork in Koza Gali and Jhika Gali in Galyat, Inocybe nitidiuscula
was collected along with belowground ectomycorrhizae associated with Alnus
nitida. Anatomical and molecular characterization of both above- and below-
ground parts determined its distribution with coniferous and deciduous
vegetation.
Materials & methods
Basidiomata were collected, photographed and dried in the field. Collected material
was characterized anatomically and using DNA sequence data. For microscopic
observation, free hand sections were stained with Congo Red and Melzer’s reagent.
Drawings were made using a camera lucida attached to a compound microscope.
Soil blocks of 10 x 12 cm under selected trees were dug out and washed to isolate,
characterize, and identify ECM. Morphotypes were characterized morphologically
following Agerer (1987-2006) and have been deposited in the Herbarium of the Botany
Department, University of the Punjab, Lahore (LAH).
DNA was extracted using the Extract-N-Amp™ Plant kit (Sigma, St Louis, MO, USA).
The rDNA internal transcribed spacer (ITS) region was amplified using the primer pair
ITS1F (Gardes et al. 1991) and ITS 4 (White et al. 1990) with denaturation at 94°C for 4
min, followed by 35 cycles of 45 sec at 94°C, 45 sec at 54°C, and 1 min 30 sec at 72°C, anda
final extension at 72°C for 2 min. PCR products from basidiomata and EcM morphotypes
were sent for bidirectional sequencing (Macrogen, Korea). Sequences were queried to
GenBank using the NCBI BLAST interface for sequence comparison and identification
of both basidiomata and fungi on EcM root tips. Sequence alignment and phylogenetic
analysis were performed using Molecular Evolutionary Genetics Analysis (MEGA)
software (Tamura et al. 2011). Maximum Likelihood (ML) optimization was conducted
with a Jukes-Cantor substitution model and Nearest-Neighbor-Interchange (NNI) as
the heuristic search method. Branch support was assessed using 1000 nonparametric
bootstrap replicates. Selected sequences were aligned using Clustal W and corrected
manually. The specimens are deposited in the Herbarium of the Department of Botany,
University of the Punjab, Lahore (LAH) and the Herbarium of Hokkaido University
Museum, Sapporo, Japan (SAPA). Nucleotide sequences are deposited in GenBank as
accession numbers HE862959 (basidiome), and HF565509 (ectomycorrhizal root).
Results
Inocybe nitidiuscula and its ectomycorrhizae were identified morpho-
anatomically and molecularly. The ITS sequences from basidiomata and
EcM morphotypes obtained in the present study exhibited 97-99.8%
sequence identity, with identification confirmed by phylogenetic analysis. In
both maximum likelihood and neighbor-joining methods, all sequences of
Inocybe nitidiuscula mycorrhizae (Pakistan) ... 249
95 ,AM882765.2 Inocybe bulbosissima
FJ904159.1 Inocybe bulbosissima
JF908118.1 Inocybe rimosa
AM882766.2 Inocybe nmosa
FJ904165.1 Inocybe umbrinella
FJ904163.1 Inocybe umbnnella
100 | F3904166.1 Inocybe umbnnella
AM882781.2 Inocybe mimica
FJ904124.1 Inocybe mimica Clade |
FJ904134.1 Inocybe arenicola
AM882772.2 Inocybe perlata
AM882783.2 Inocybe squamata
AM882785.2 Inocybe squamata
AM882779.1 Inocybe flavella
JQ724027.1 Inocybe flavella
°° | AM882782.2 Inocybe flavella
100 , GU234082.1 Mallocybe dulcamara
GU234129.1 Mallocybe dulcamara
HQ650752. 1 Mallocybe terngena
HQ604783.1 Mallocybe terigena
HQ604779.1 Mallocybe terigena Clade Il
HQ604780.1 Mallocybe terrigena
GU980653. 1 Inocybe arthrocystis
93 | GU980654.1 Inocybe arthrocystis
AB211269.1 Inocybe lacera
AB327181.1 Inocybe lacera
AJ893275.1 ectomycormiza Inocybe
39, JF908176.1 Inocybe nitidiuscula
pe AB244791.1 Inocybe nitidiuscula
JF908249.1 Inocybe nitidiuscula
JF908088.1 Inocybe nitidiuscula Clade Il
100 |; Ml HF565508.1 Inocybe nitiduscula SD-2 Pakistan
M HF565509.1 Inocybe nitidiuscula SD-3 Pakistan
89 || HI HE862959.1 Inocybe nitidiuscula KP-17 Pakistan
91 | BM HE863671.1 Inocybe nitidiuscula SD-5 Pakistan
@ HE863670.1 Inocybe nitidiuscula SD4 Pakistan
100
100
Fic. 1. Phylogenetic relationship of I. nitidiuscula (MM) with other members of Inocybe based on
Maximum Likelihood analysis of nrITS sequences. Bootstrap values based on 1000 replicates are
shown above the branches (values <50 are not shown). The analysis included 35 sequences. All
positions containing gaps and missing data were eliminated, yielding a total of 616 nucleotide
positions in the final dataset. Clade I contains members of Inocybe sect. Rimosae, Clade II
members of Inocybe subg. Mallocybe, and Clade III members of Inocybe having metuloid pleuro-
cheilocystidia.
I. nitidiuscula from Pakistan clustered with sequences of I. nitidiuscula (Fie. 1,
clade III) with significant bootstrap support.
Taxonomy
Inocybe nitidiuscula (Britzelm.) Lapl., Dict. Iconogr. Champ. Sup.: 523, 1894. Fie. 2
Prteus 2.2-3.5 cm broad, light brown to dark brown from margins to
centre, conical when young and plano-convex at maturity, sharply umbonate,
shiny, smooth or minutely woolly at very center, umbo dark brown to blackish,
outwards radially fibrous, uniformly aligned brown fibrils move toward margins
which lighten in colour, margins not smooth, somewhat dentate. LAMELLAE
cream to light brown, sinuate in attachment to stipe, margins dentate, lamellulae
two-tiered, alternating with lamellae. Stipe 3.4-5.4 x 0.35-0.42 cm, central,
250 ... Ilyas, Razaq & Khalid
Cc D
Fic. 2: Inocybe nitidiuscula. A. Basidiomata; B. Basidia; C. Basidiospores; D. Metuloids (cheilocystidia
and pleurocystidia). Scale bars: A = 1 cm, B-C = 3.45 um, D = 6.25 um.
light brown, smooth, cylindrical, slightly swollen at base. ODoR not distinctive.
TASTE not recorded.
Basidiospores 10-11 x 6.5-8um, smooth, amygdaliform in side view,
elliptical to ellipsoid in front view, yellowish brown, thick walled, with a
prominent apiculus. Bastp1A 29-31 x 9.0-10.5 um, tetra sterigmate, clavate,
with olive green droplets in 5% KOH. PLeurocystip1a metuloids, 47.0-71.5 x
12.0-17.5 um, abundant, cylindrical to fusiform, contents hyaline to pale yellow
in 5% KOH with thick brown walls, apices heavily encrusted with colourless
crystals. CHEILOCysTIDIA similar to pleurocystidia, abundant, 38-41 x
11.8-13 um, hyaline, clustered, thick walled, with encrusted apices. PILEIPELLIS
a cutis of loosely arranged hyphae, light yellowish-brown, 7-9 um wide. CLAMP
CONNECTIONS abundant in all tissues.
MATERIAL EXAMINED: PAKISTAN: KHYBER PAKHTUNKHWA, Galyat, Ayubia, Koza
Gali, 2250 m a.s.l., gregarious, on moist ground under Alnus nitida, 23 August 2010,
Abdul Razaq, KP-17 (LAH 230817, SAPA 100000; GenBank, HE862959).
Morpho-anatomical description of ectomycorrhizae Fic. 3
ECTOMYCORRHIZAL SYSTEM dichotomous, axis 3-6 x 1.0-1.5 mm., in close
contact with surrounding soil due to gelatinous mantle. UNRAMIFIED ENDS
straight to beaded, 1-2 mm long and 0.5-1 mm in diam.; younger tips creamy
Inocybe nitidiuscula mycorrhizae (Pakistan) ... 251
Fic. 3: Inocybe nitidiuscula A,B. Ectomycorrhizae. C. Outer mantle layer D. Inner mantle layer.
E. Emanating hyphae. Scale bars: A = 5.4 mm, B = 3 mm, C-E= 9 um
white, older tips light brown. Texture of system smooth with shiny luster; host
tissue visible under the sheath. RH1zomMoRpPHs absent. EMANATING HYPHAE
frequent, straight, frequently clamped; clamps large, half or more than a half
252 ... Ilyas, Razaq & Khalid
semicircle; anastomoses H-shaped. Cystip1a absent, COLOR REACTION absent
with lactic acid & KOH.
MANTLE plectenchymatous in all layers. OuTER MANTLE loosely
plectenchymatous with netlike hyphal arrangement (Agerer 1987-2006, type
A), hyphae 2-3 um diameter, lacking clamps and cystidia, transparent, no cell
contents visible, anastomoses present. INNER MANTLE densely plectenchymatous
(Agerer 1987-2006, type A), hyphae 2-3 um diameter, colorless to light
yellowish, cell contents clear, no clamps or cystidia observed (FIG. 3).
MATERIAL EXAMINED: PAKISTAN: KHYBER PAKHTUNKHWA, Galyat (Koza Gali &
Jhika Gali), roots of Alnus nitida, 23 August 2010, Sobia Ilyas, SD-3 (LAH; GenBank,
HF565509).
Discussion
Inocybe is an integral part of almost all ectomycorrhizal communities in
association with coniferous and deciduous trees from different areas of the
world (Cullings et al. 2001, Yamada & Katsuya 2001, Obase 2006, Tedersoo
et al. 2009, Walbert et al. 2010, Kennedy et al. 2011, Ma et al. 2012). Pakistani
forests are well represented by different ectomycorrhizal fungi associated with
wide host range (Niazi 2008, Niazi et al. 2006, 2007, 2009, 2010, Jabeen et al.
2012), but no published data on Inocybe is available even though it seems to
be the most abundant group in this area among all euagarics. Basidiomata of
I. nitidiuscula are also reported from different forests associated with Picea,
Pinus, Larix, Quercus, Corylus, Carpinus, Fagus, Salix, and Dryas but no
description of its mycorrhizae has yet been published (Kuyper 1986).
Inocybe nitidiuscula and I. lacera are closely related as both clustered together
in phylogenetic analyses (Fic. 1, Clade III). Both species produce metuloid
cystidia on lamellar face and edges and form ectomycorrhizal symbioses.
The sequence (HE862959.1) from the I. nitidiuscula Pakistani basidiome
clustered with I. nitidiuscula isolates from other regions of the world. The
Pakistani sequence shows a 94-95% match with I. nitidiuscula (FN550920.1,
HQ604085.1), although its morphological details are same as given by Obase et
al. (2006). The genetic variation may be due to geographic distance.
The I. nitidiuscula ectomycorrhiza is characterized by smooth ramification,
white to light brown color, lack of rhizomorphs and cystidia, prominent
clamped emanating hyphae, and a plectenchymatous mantle. These resemble
the ectomycorrhizae of I. appendiculata associated with Picea and Abies and
I. fuscomarginata associated with Salix spp., except that the ramification type
more closely resembles I. terrigena, reported with Pinus (Agerer 1987-2006).
Phylogenetic analyses are a useful tool for identifying unknown Inocybe
sequences to the species level (Ryberg et al. 2008). Both above- and below-
ground parts of the Pakistani collections cluster in the I. nitidiuscula clade
(Fic.1, Clade III). Although Inocybe has been reported to associate with
Inocybe nitidiuscula mycorrhizae (Pakistan) ... 253
alders (Tedersoo et al. 2009), to our knowledge this is the first report of ECM
of I. nitidiuscula with that host. In one study, Tedersoo et al. (2006) reported
ectomycorrhiza of Inocybe sp. 5 (AJ893275.1) that showed maximum sequence
identity with I. nitidiuscula (AJ534934), although with only 77% sequence
similarity. In our phylogenetic analysis, this sequence clustered in the same clade
as I. nitidiuscula but significantly distant from sequences from Pakistan, Japan,
and Italy. Previous studies have shown that alder ectomycorrhizal communities
tend to be host specific (Rochet et al. 2011). Tedersoo et al. (2009) indicated
that ascomycete EcM symbionts of Alnus might not be host-limited, although
their results suggested high Alnus specificity in basidiomycete symbionts. A
detailed study on Alnus ECM communities from Pakistan will determine the
level of host specificity.
Acknowledgements
We are thankful to Dr. Abdul Rehman Khan Niazi and Dr. Todd Osmundson for
acting as expert reviewers to improve the manuscript and Dr. Takahito Kobayashi,
Curator of SAPA Herbarium, Japan, for the identification of specimens. Higher
Education Commission, Pakistan, provided financial support for this research work.
Literature cited
Agerer R. 1987-2006. Colour atlas of ectomycorrhizae. 1-13" delivery. Einhorn-Verlag Edward,
Dientenurger Schwabisch Gmund, Germany.
Agerer R. 2006. Fungal relationships and structural identity of their ectomycorrhizae. Mycol. Prog.
5: 67-107.
Cullings KW, Vogler DR, Parker VT, Makhija S. 2001. Defoliation effects on the ectomycorrhizal
community of a mixed Pinus contorta Picea engelmannii stand in Yellowstone Park. Oecologia
127: 533-539.
Gardes M, White TJ, Fortin JA, Bruns TD, Taylor JW. 1991. Identification of indigenous and
introduced symbiotic fungi in ectomycorrhizae by amplification of nuclear and mitochondrial
ribosomal DNA. Can. J. Bot. 69: 180-190. http://dx.doi.org/10.1139/b91-026
Heim R. 1931. Le genre Inocybe. Encyclopédie mycologique 1. Lechevalier & Fils, Paris.
Irshad S, Khan S. 2012. Impacts of protection on floral diversity of Himalayan moist temperate
forests of Galyat. Pakistan Journal of Environment 1(4): 119-125.
Jabeen S, Ilyas S, Niazi AR, Khalid AN. 2012. Diversity of ectomycorrhizae associated with Populus
spp. growing in two different ecological zones of Pakistan. Int. J. Agric. Biol. 14: 681-688.
Jamal S, Khadija. 2009. Watershed issues assessment in Galyat. M.Sc. Thesis, Hazara University,
Pakistan.
Kennedy PG, Garibay-Orijel R, Higgins LM, Angeles-Arguiz R. 2011. Ectomycorrhizal fungi in
Mexican Alnus forests support the host co-migration hypothesis and continental-scale patterns
in phylogeography. Mycorrhiza 21: 559-568. http://dx.doi.org/10.1007/s00572-011-0366-2
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi.
10th edn. CAB International, Wallingford, UK.
Kobayashi T. 2002. The taxonomic studies of the genus Inocybe. Nova Hedwigia 124: 1-246.
Kihner R. 1980. Les Hyménomyceteés agaricoides. Bulletin Mensuel de la Société Linnéenne de
Lyon 49: 1-1027.
254 ... Ilyas, Razaq & Khalid
Kiihner R, Romagnesi H. 1953. Flore analytique des champignons supérieurs. (Agarics, Bolets,
Chanterelles). Masson, Paris.
Kuyper TW. 1986. A revision of the genus Inocybe in Europe. I. Subgenus Inosperma and the
smooth-spored species of subgenus Inocybe. Persoonia Suppl. 3: 1-247.
Larsson E, Ryberg M, Moreau PA, Mathiesen AD, Jacobsson S. 2009. Taxonomy and evolutionary
relationships within species of section Rimosae (Inocybe) based on ITS, LSU and mtSSU
sequence data. Persoonia 23:86-98. http://dx.doi.org/10.3767/003158509X475913
Ma D, Zang S, Wan L, Zhang D. 2012. Ectomycorrhizal community structure in chronosequences
of Pinus densiflora in eastern China. African Journal of Microbiology Research 6(32):
6204-6209. http://dx.doi.org/10.5897/AJMR12.902
Niazi AR. 2008. Biodiversity of ectomycorrhizas in conifers from Himalayan moist temperate forests
of Pakistan. Ph.D. Thesis, Department of Botany, University of Punjab, Lahore, Pakistan.
Niazi AR, Iqbal SH, Khalid AN. 2006. Biodiversity of mushrooms and ectomycorrhiza. 1. Russula
brevipes Peck and its ectomycorrhiza, a new record from Himalayan moist temperate forests of
Pakistan. Pakistan J. Bot. 38(4): 1271-1277.
Niazi AR, Khalid AN, Iqbal SH. 2007. Descolea flavoannulata and its ectomycorrhiza from Pakistan's
Himalayan moist temperate forests. Mycotaxon 101: 375-383.
Niazi AR, Iqbal SH, Khalid AN. 2009. Ectomycorrhizae between Amanita rubescens and Himalayan
spruce (Picea smithiana) from Pakistan. Mycotaxon 107:73-80.
http://dx.doi.org/10.5248/107.73
Niazi AR, Khalid AN, Iqbal SH. 2010. New records of ectomycorrhizae from Pakistan. Pakistan J.
Bot. 42(6): 4335-4343.
Obase K, Kobayashi T, Miyamoto T, Tamai Y, Yajima T. 2006. Inocybe nitidiuscula, new to Japan.
Mycoscience 47: 293-297. http://dx.doi.org/10.1007/s10267-006-0304-x
Rochet J, Moreau PA, Manzi S, Gardes M. 2011. Comparative phylogenies and host specialization
in the alder ectomycorrhizal fungi Alnicola, Alpova and Lactarius (Basidiomycota) in Europe.
BMC Evolutionary Biology 11:40. http://dx.doi.org/10.1186/1471-2148-11-40
Ryberg M, Nilsson RH, Kristiansson E, Tépel M, Jacobsson S, Larsson E. 2008. Mining metadata
from unidentified ITS sequences in GenBank: A case study in Inocybe (Basidiomycota). BMC
Evol. Bio. 8: 50. http://dx.doi.org/10.1186/1471-2148-8-50
Singer R. 1986. The Agaricales in modern taxonomy. 4th ed. Koeltz Scientific Books, Koenigstein.
Stangl J. 1989. Die Gattung Inocybe in Bayern. Hoppea 46: 5-388.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS5: Molecular
Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and
Maximum Parsimony Methods. Mol. Bio. Evol. 28: 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
Tedersoo L, SuviT, Larsson E, Koljalg U. 2006. Diversity and community structure of ectomycorrhizal
fungi in a wooded meadow. Mycol. Res. 110: 734-748.
http://dx.doi.org/10.1016/j.mycres.2006.04.007
Tedersoo L, Suvi T, Jairus T, Ostonen I, Polme S. 2009. Revisiting ectomycorrhizal fungi of the
genus Alnus: differential host specificity, diversity and determinants of the fungal community.
New Phytologist 182: 727-735. http://dx.doi.org/10.1111/j.1469-8137.2009.02792.x
Walbert K, Ramsfield TD, Ridgway HJ, Jones EE. 2010. Ectomycorrhiza of Pinus radiata (D. Don
1836) in New Zealand — an above- and below-ground assessment. Australasian Mycologist
29° 7 716.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols. London:
Academic Press.
Yamada A, Katsuya K. 2001. The disparity between the number of ectomycorrhizal fungi and those
producing fruit bodies in a Pinus densiflora stand. Mycol. Res. 105: 957-965.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.255
Volume 124, pp. 255-262 April-June 2013
Xerocomus porophyllus sp. nov., morphologically intermediate
between Phylloporus and Xerocomus
WEN-JUAN YAN, Tal-Hu1 Li’, MING ZHANG & TING LI
State Key Laboratory of Applied Microbiology, South China
(The Ministry—Province Joint Development), Guangdong Institute of Microbiology,
Guangzhou 510070, Guangdong, China
“CORRESPONDENCE TO: [email protected]
ABSTRACT— Xerocomus porophyllus, discovered from Dinghushan Biosphere Reserve in
Guangdong province (southern China), is described as a new species. It is a morphologically
intermediate taxon between Phylloporus and Xerocomus since its hymenophore is lamellate
around the stipe but strongly anastomosing to distinctly faveolate or poroid towards pileus
margin. Molecular analyses of nuclear rDNA ITS and LSU sequences, however, indicate that
it has a closer genetic relationship with Xerocomus than with Phylloporus.
Key worps— Basidiomycota, Boletaceae, Boletales, phylogeny, taxonomy
Introduction
Phylloporus Quél. and Xerocomus Quél. belong to the family Boletaceae
and have a close relationship, whether Phylloporus has been considered as
a primitive group in the family (Corner 1972) or as a derived genus next to
Xerocomus (Binder 1999; Binder & Hibbett 2006). Molecular data have shown
the Xerocomus subtomentosus complex to be closely related to Phylloporus
(Binder 1999). The lamellate hymenophore in Phylloporus and the wide poroid
or tubular one in Xerocomus are still used as the main morphological characters
for differentiating the two genera (Neves & Halling 2010; Neves et al. 2012).
Worldwide, Phylloporus encompasses about 70 named species (Neves et al.
2012), 21 of which have been reported from China (Teng 1963; Zang & Zeng
1978; Li et al. 1992; Bi et al. 1993, 1997; Dai & Li 1994; Zang et al. 1996; Zeng
et al. 2012). However, two Chinese records should be excluded because the
type specimen of Phylloporus scabrosus M. Zang is a Lentinus sp., and Chinese
exsiccatae labelled as “Phylloporus rhodoxanthus” were misidentified (Zeng et
al. 2012).
Although some mycologists have incorporated Xerocomus into Boletus
(Corner 1972, Kirk et al. 2008), other authors still treat it as an independent
256 ... Yan & al.
genus (Watling & Hills 2005, Hills 2008, Neves et al. 2012, Zeng et al. 2012).
Until now, more than 210 species and varieties of Xerocomus have been
registered (www.indexfungorum.org), of which at least 46 species have been
reported from China (Zhang et al. 2012).
Recently, an interesting bolete was recorded in Dinghushan Biosphere
Reserve in Guangdong province (southern China) and found to differ from all
known taxa. Although its hymenophore is consistently lamellate (Phylloporus-
like) around the stipe, it is also obviously faveolate or tubular (Xerocomus-like)
towards the pileal margin. Molecular analyses of nuclear rDNA ITS and LSU
sequences, however, indicated it to have a closer genetic relationship with
Xerocomus than with Phylloporus. Further investigation revealed that it is a new
species to science, and therefore it is formally described here. The holotype is
deposited in the Fungal Herbarium of Guangdong Institute of Microbiology
(GDGM).
Materials & methods
Specimens were annotated and photographed in the field, and dried in an electric
drier. Color descriptions were made according to Kornerup & Wanscher (1978). Tissue
sections were mounted in 5% KOH or 1% Congo Red for microscopic examination.
Dimensions of basidiospores are given using the notation (a—)b-c(-d), where “b-c’
represents 90% or more of the measured values of at least 30 basidiospores, and the
parenthetical ‘a and ‘d’ are the extreme values. Lm refers to the average length of all
basidiospores standard deviation; Wm refers to the average width of all basidiospores
standard deviation; Qm refers to the average Q of all basidiospores standard deviation;
and n refers to the number of spores measured per specimen. Basidiospores were also
observed under a scanning electron microscope (SEM). Light micrographs were taken
using an Olympus BX51 trinocular phase contrast microscope and the scanning electron
micrographs were taken on a Philips FEI-XL30 scanning electron microscope.
Genomic DNA was isolated from dried specimens and the ITS1-5.8S-ITS4 segment
from the ribosomal DNA (rDNA) was amplified with primer sets and ITS1 (5'-crr
GCG TTG ATT ACG-3') and ITS4 (5'-Tcc Tcc GCT TAT TGA TAT GC-3’) by polymerase
chain reaction (PCR) techniques (White et al. 1990). A portion of the nuclear ribosomal
large subunit (nrLSU) was amplified with the primers LR6 (5’-cGc CAG TTC TGC TTA
cc-3') and LROR (5'-acc CGC TGA ACT TAA GC-3’) (Vilgalys & Hester1990). Amplified
products were examined with agarose gel electrophoresis using a 2kb DNA marker.
The amplified fragments were cloned into pCR2.1 TOPO (Invitrogen) to generate, the
vector pCR2.1 TOPO containing the targeting fragment was transformed into its host
Escherichia coli strain JM105 (Lopez-Garcia et al. 2003). The E. coli with the cloned
fragments was sequenced by BGI Company and the data were deposited in GenBank. For
the analysis of phylogenetic placement of the new species, the rDNA sequences of other
related Phylloporus and Xerocomus taxa were downloaded from Genbank. Phylogenetic
tree inferred from LSU rDNA sequences was constructed using maximum likelihood
(ML) in Mega 5.05. Bootstrap analysis was implemented with 1000 replicates.
Xerocomus porophyllus sp. nov. (China) ... 257
a
Fic. 1. Xerocomus porophyllus (GDGM 30303, holotype): a-c. basidiomes; d. pileipellis; e. basidia;
f. basidiospores; g. hymenium with basidia, pleurocystidia and basidiospores; h. pleurocystidium;
i. basidiospores under SEM. Scale bars: a~c = 1 cm; d-h = 10 um.
Taxonomy
Xerocomus porophyllus T.H. Li, WJ. Yan & Ming Zhang, sp. nov. FIGs. 1-2
MycoBank MB 563347
Differs from Phylloporus cingulatus by its larger basidiospores and non-cyanescent
context on exposure; and from all species of Xerocomus s. str. by the largely lamellate
hymenophore near the stipe.
Type: China, Guangdong Province, Zhaoqing City, Dinghushan Biosphere Reserve,
23°10.11'N 112°31.50’E, alt. 300 m a.s.l., 17 May 2012, Tai-Hui Li, Wen-Juan Yan & Hao
Huang (Holotype, GDGM 30303; GenBank KC168089, KC561775).
EryMoLocy: porophyllus refers to the partially poroid and partially lamellate
hymenophore of the new species.
PiLEus 50-80 mm broad, fleshy, convex, becoming plane to revolute with age,
dry, even, subtomentose, matted subtomentose to slightly scurfy, often faintly
and finely rimulose; grayish-ruby (12D5-6, 12E5). FLesH 5-20 mm thick
at stipe, white to buff, sometimes with a very faint pinkish tint, unchanging
258 ... Yan & al.
when injured, with mild odor and flavor. Hymenophore brownish-orange
(5C4-6, 6C5-6), 2-5 mm deep, decurrent, lamellate near the stipe and strongly
anastomosing, poroid or faveolate towards pileus margin, with 48-76 lamellae;
pores 1.5-3 mm wide near pileus margin. STIPE cylindrical, 33-45 mm long,
5-15 mm wide at apex, attenuated at the base, dry, pale yellow to light yellow
(4A3-4), solid when young, becoming hollow with age, with white basal
mycelium; STIPE CONTEXT white (1A1), unchanging or with pale pinkish flush
when exposed.
BASIDIOSPORES (5.5—)7.5-10.5(-12.8) x (4.0-)5.0-5.8(-7.0) um [n = 30,
Lm = 9.57 + 1.17, Wm = 5.15 + 0.86, Qm = 1.79 + 1.41], ellipsoid, smooth
under light microscope but nearly smooth to finely rugulose or weakly bumpy
under SEM, yellow to olivaceous-yellow in KOH, inamyloid in Melzer’s reagent.
Basip1A clavate, 28-34 x 8.0-11 um, 2-4-spored, hyaline; sTERIGMATA (2-)
3-5(-8) um long. PLEUROCysTIDIA 42-68 x 9.0-12.5 um, fusiform, thin-
walled, hyaline. CAULOCysTIDIA and CHEILOCYSTIDIA absent. HYMENOPHORAL
TRAMA subparallel to nearly bilateral with hyphae of the lateral strata loosely
arranged, hyaline, 4.5-19 um broad. PILEIPELLIS composed of tufts of erect
hyphal elements 4-21 um broad, terminal cells 11-55 x 4.5-20 um, clavate,
brownish-yellow to yellowish. CLAMP CONNECTIONS absent in all tissues.
ECOLOGY AND DISTRIBUTION — Solitary or clustered on soil under Schima
superba Gardner & Champ. (Theaceae) in a mixed forest with Pinus massoniana
Lamb. (Pinaceae) and other frondose trees. May to June. Known only from the
type locality in southern China (Guangdong).
COMMENTS — ‘The new species is considered morphologically intermediate
between Phylloporus and Xerocomus because of its dominantly lamellate
hymenophore near the stipe, with the strongly anastomosing gills forming
a faveolate or poroid pattern towards the pileus margin. The nearly smooth
to finely rugulose spores observed under SEM are quite common in both
Phylloporus and Xerocomus subtomentosus complex (Sutara 2008, Neves &
Halling 2010, Zeng et al. 2012), which also implies that the two genera are
closely related.
Many species of Phylloporus have a partially poroid hymenophore. The
species most similar to X. porophyllus is P. cingulatus Corner with strongly
anastomosing lamellae or poroid hymenophore, but differing in the slowly
cyanescent context on exposure and the smaller spores (7.5-9 x 5-5.5 um;
Corner 1970). Among other species of Phylloporus with strongly anastomosing
lamellae or poroid hymenophore are: P albocarnosus Heinem., P. ater (Beeli)
Heinem., P. boletinoides A.H. Sm. & Thiers, P carmineus Heinem., P. fibulatus
Singer et al., P ochraceobrunneus Corner, P. pumilus M.A. Neves & Halling,
P. purpureus var. ambiguus Heinem., and P. testaceus Heinem. & Gooss.-Font.,
which can all be easily distinguished from X. porophyllus by their pileus colors
Xerocomus porophyllus sp. nov. (China) ... 259
OO
MiRY JOS
Wate
Fig. 2. Xerocomus porophyllus (GDGM 30303, holotype): A. basidiomes; B. basidiospores;
C. pileipellis. Scale bars: A-B = 10 um; C = 20 um.
and sizes of basidiospores or basidiomes. Phylloporus albocarnosus has a white
to straw-colored pileus and smaller spores (7-8 x 3-4 um); P. ater is a blackish
species; P. boletinoides shows a color variability ranging from cinnamon-brown
or dark vinaceous-brown to cocoa-brown; P carmineus is a carmine-red
species; P. fibulatus has a much smaller (11-35 mm) and yellow to dull yellow
pileus; P. ochraceobrunneus has fuscous-brown to brownish-yellow pileus and
260 ... Yan & al.
TABLE 1. Sequence identity comparisons of Xerocomus porophyllus
with species of Xerocomus and Phylloporus.
SPECIES SEQUENCE BLAST MAX SCORE
ITS
Xerocomus sp. ? FJ197009.1 : 695
i (88% query coverage)
(85% max identity)
Xerocomus sp. i EU569235.1 P7605
(88% query coverage)
(85% max identity)
Boletus dryophilus : :
ati ation dryophilus) ot
BODES IODINE ng | AY185183.1 686
(= Xerocomus dryophilus)
Phylloporus sp. : JQ003620.1 : 368
Phylloporus sp. : JQ003650.1 : 359
Phylloporus rhodoxanthus DQ533980.1 346
sen Ehylloporus foliiporus : JQO03641 ip Weta Marra
LSU
Xerocomus fennicus : AF514820.1 : 1127
: (100% query coverage)
: (94% max identity)
Xerocomus ripariellus i AF514818.1 aL
(100% query coverage)
: (94% max identity)
Phylloporus centroamericanus : JQ003663.1 1075
Phylloporus purpurellus JQ003672.1 1016
larger spores (11-15 x 4-4.7 um); P. pumilus has a very small (5-9 mm) cocoa
brown or dark-brown pileus; P. purpureus var. ambiguus has a carmine-purple
pileus and larger spores (9.3-12 x 4.2-5.3 um); and P testaceus has a rose-
ochre to deep carmine-brown pileus and much larger spores (11.5-14.0 x
5.0-6.0 um) (Heinemann 1951, 1955, Corner 1970, Singer et al. 1990, Neves
& Halling 2010, Neves et al. 2012). Although some species of Xerocomus, such
as X. armeniacus (Quél.) Quél. (= Xerocomellus armeniacus (Quél.) Sutara)
and_X. chrysenteron (Bull.) Quél. (= Xerocomellus chrysenteron (Bull.) Sutara),
may have a subtomentose and finely rimulose pileus with similar color as
X. porophyllus, their entirely poroid hymenophore is easily differentiated from
the largely lamellate pattern of the latter.
The low max identities of the sequences demonstrate that the species
compared are obviously different, and the higher max scores with the Xerocomus
species also indicate that X. porophyllus has a closer genetic relationship with
Xerocomus than with Phylloporus (TABLE 1). In a phylogenetic tree constructed
with the LSU sequences of the new species, eight Phylloporus species and eight
other Xerocomus species, with Auricularia auricula-judae (Bull.) Queél. as
outgroup, X. porophyllus is grouped with the other Xerocomus species (FIG. 3).
Xerocomus porophyllus sp. nov. (China) ... 261
65 Xerocomus porosporus (AF050645)
33 Xerocomus chrysenieron (AF 514809)
30 Aerocomus pruinatus (AF 050644)
Xerocomus cisalpinus (AF 514814)
63 Xerocomus dryophiius (AF5i4823)
Xerocomus
Xerocomus fennicus (AF514820)
85 Xerocomus ripariellus (AF 514818)
70 Xerocomus rubellus (AF050649)
Xerocomus porophyllus (KC561775)
” Pinytloporus rhodoxanthus (1Q003675)
Piylloporus pelletieri (AF 456818)
60 Piylioporus centroconericanus (1Q003664)
Phylloporus bogoriens is (10003680) Phylloporss
49] 30 Piylloporus belius (1Q003661)
Pinlioporus purpurelius (1Q003672)
Piylioporus orientalis (JQ003701)
Piylioporus rubiginosus (IQ003694)
Auricularia auricula-judae (AF291289) Outgroup
a
0.02
Fic.3. Phylogenetic placement of Xerocomus porophyllus inferred from LSU rDNA data. The
bootstrap values (1000 replicates) are shown next to the branches. Taxa are labeled by their names
and GenBank accession numbers.
Therefore, the novel entity is described as a new species of Xerocomus
according to morphological and molecular analyses.
Acknowledgments
The authors are very grateful to Dr. Beatriz Ortiz-Santana (US-Forest Service,
Northern Research Station, Center for Forest Mycology Research, US) and Dr. Matteo
Gelardi for reviewing the manuscript. The study is supported by the National Natural
Science Foundation of China (No. 30970023, 31070024, 30870019) and the Natural
Science Foundation of Guangdong Academy of Sciences for Young Scholars, China (No.
qnjj201202), Science and Technology Planning Project of Guangdong Province, China
(No. 2012B091100258, 2012B091100072).
Literature cited
Bi ZS, Zheng GY, Li TH. 1993. The macrofungus flora of Chinas Guangdong Province. The Chinese
University Press, Hongkong.
Bi ZS, Li TH, Zhang WM, Song B. 1997. A preliminary agaric flora of Hainan Province. Guangdong
Higher Education Press, Guangzhou. (in Chinese)
Binder M. 1999. Zur molekularen Systematik der Boletales: Boletineae und Sclerodermatineae
subordo nov. Ph.D. University of Regensburg.
Binder M, Hibbett DS. 2006. Molecular systematics and biological diversification of Boletales.
Mycologia 98: 971-981. http://dx.doi.org/10.3852/mycologia.98.6.971
262 ... Yan & al.
Corner EJH. 1970. Phylloporus Quél. and Paxillus Fr. in Malaya and Borneo. Nova Hedwigia 20:
793-822.
Corner EJH. 1972. Boletus in Malaysia. Government Printing Office, Singapore.
Dai XC, Li TH. 1994. Macrofungus flora of Garzé Tibetan Autonomous Prefecture. Sichuan Science
and Technology Press, Chengdu, Sichuan Province. (in Chinese)
Heinemann P. 1951. Champignons recoltes au Congo Belge par Mme M. Goossens-Fontana I.
Boletineae. Bulletin du Jardin botanique de [état a Bruxelles 21: 253-263.
Heinemann P. 1955. Champignons recoltes au Congo Belge par Mme M. Goossens-Fontana I.
Boletineae. Note complementaire 2. Bulletin du Jardin botanique de létat a Bruxelles 25(2):
177. http://dx.doi.org/10.2307/3667063
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi.
10th edition. Wallingford, CAB International.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. Eyre Methuen: London. 252 p.
Li TH, Lai JP, Zhang WM. 1992. The species of Phylloporus known from China—with two new
records to China. Edible Fungi of China 11: 29-30.
Lépez-Garcia P, Philippe H, Gail FE, Moreira D. 2003. Autochthonous eukaryotic diversity in
hydrothermal sediment and experimental microcolonizers at the Mid-Atlantic Ridge.
Proceedings of the National Academy of Sciences of the United States of America 100(2):
697-702. http://dx.doi.org/10.1073/pnas.0235779 100
Neves MA, Halling RE. 2010. Study on species of Phylloporus I: Neotropics and North America.
Mycologia 102: 923-943. http://dx.doi.org/10.3852/09-215
Neves MA, Binder M, Halling R, Hibbett D, Soytong K. 2012. The phylogeny of selected Phylloporus
species, inferred from NUC-LSU and ITS sequences, and descriptions of new species from the
Old World. Fungal Diversity 55: 109-123.
Sutara J. 2008. Xerocomus s. |. in the light of the present state of knowledge. Czech Mycological
60(1): 29-62.
Singer R, Ovrebo CL, Halling RE. 1990. New species of Phylloporus and Tricholomopsis
from Colombia, with notes on Phylloporus boletinoides. Mycologia 82: 452-459.
http://dx.doi.org/10.2307/3760016
Teng SC. 1963. Fungi of China. Science Press. (in Chinese)
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
Watling R, Hills AE. 2005. Boletes and their allies (revised and enlarged edition). British Fungus
Flora. Agarics and boleti. Vol. 1. Royal Botanic Garden, Edinburgh.
White TJ, Bruns TL, Lees, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: M Innis et al. (eds). PCR Protocols: a Guide to
methods and Applications. Academic Press, San Diego, USA.
Zang M, Li B, Xi JX. 1996. Fungi of the Hengduan Mountains. Science Press, Beijing.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.253
Volume 124, pp. 263-268 April-June 2013
Glomus mume and Kuklospora spinosa: two new species of
Glomeromycota from China
BANG-PING CAI’, LIANG-DONG GUO’, JUN-YU CHEN?! & QI-XIANG ZHANG?
‘Xiamen Botanical Garden, Xiamen 361003 China
Systematic Mycology & Lichenology Laboratory, Institute of Microbiology,
Chinese Academy of Sciences, Beijing 100101, China
College of Landscape Architecture of Beijing Forestry University, Beijing 100083 China
*CORRESPONDENCE TO: [email protected]
ABSTRACT — Two new arbuscular mycorrhizal fungal species, Glomus mume (Glomerales)
and Kuklospora spinosa (Diversisporales), were isolated from rhizosphere soil of Prunus mume
in China. Glomus mume resembles G. taiwanense, but differs by its spore walls swelling to a
globose to subglobose structure in or near the middle of the spore apex. Kuklospora spinosa
resembles K. colombiana but differs by the fine spines covering the middle-layer of the outer
spore wall.
KEY worps —morphotaxonomy, Guizhou, Szechwan, HMAS
Introduction
During a survey of arbuscular mycorrhizal fungi associated with Prunus
mume (Siebold) Siebold & Zucc. (Rosaceae) in China, spores of an undescribed
species of Glomus Tul. & C. Tul. were found in the soil samples collected from
the Maolan National Nature Reserve (25°14'-25°18'N 107°56'-108°10'E) of
subtropical woodland in southeast Guizhou province. A second undescribed
species, representing Kuklospora Oehl & Sieverd., was found in the soil samples
collected from the brushy mountain of Muli county (27°58'N 101°15’E) in
Szechwan province. The two arbuscular mycorrhizal fungi are described herein
as Glomus mume and Kuklospora spinosa, based on spore morphology.
Materials & methods
Soils were collected from the rhizosphere of Prunus mume, from 5-20 cm soil depth.
The soil samples of ca. 1000 g were placed in sterilized cotton-cloth bags, labeled, and
+ Prof. Jun-yu Chen, a senior member of Chinese Academy of Engineering, died on 8 June 2012. a
264 ... Cai & al.
air-dried in shade. Then they were cleaned from plant debris, sieved with a 2 mm sieve,
stored at 4°C, until processed.
Spores were isolated according to Gerdemann & Nicolson (1963) with the wet
sieving and decanting method as modified by Daniels & Skipper (1982). Arbuscular
mycorrhizal fungal spores were identified following the descriptions of Schenck &
Pérez (1988), Morton & Redecker (2001), and more recent species descriptions of
Glomeromycota. We follow the classification proposed and summarized by Oehl et al
(2011). Colors were referred to http://invam.caf-wvu.edu/otherinfo/articles/colorchart.
jpg, the INVAM color chart. Specimens were deposited at the Herbarium Mycologicum
Academiae Sinicae (HMAS) in Beijing.
Taxonomy
Glomus mume B.P. Cai, Jun Y. Chen, Q.X. Zhang & L.D. Guo, sp. nov. PLATE 1:A-C
FUNGAL NAME 570036
Differs from Glomus taiwanense by its spore walls swelling to a globose to subglobose
structure, in or near the middle of the spore apex.
Type: China, Guizhou, Libo, Maolan National Nature Reserve, from the rhizosphere of
Prunus mume, 17 Sep. 2005 (Holotype, HMAS143348).
ErymMo.ocy: Referring to the plant species with which this fungus was originally
associated.
SPOROCARPS yellow-brown (20-20-20-0) to dark brown (0-30-40-0), globose
to subglobose, 350-600 x 380-650 um, with spores formed radially in a single,
tightly packed layer around a central plexus of hyphae. Peridium absent. Spores
clavate, cylindro-clavate, triangular or irregular, 90-165 x 30-50 um, tapering
to a cylindric subtending hypha 6-12 um. Chlamydospore wall laminate,
yellow-brown (20-20-20-0) to dark brown (0-30-40-0), 1.5-4 um thick on
the side walls, swelling to a globose to subglobose structure, 13-20 x 15-25 um,
in or near the middle of the spore apex, and thickened to 3-7 um at spore base.
Spore base at hyphal attachment with a small pore, open or occluded by wall
thickening. Reaction to Melzer’s reagent not distinctive.
EcoLocy — Spores of Glomus mume were isolated from soil sampled from
the rhizosphere of Prunus mume growing at 700-800 m a.s.l in the karst forest
area of southwest China (25°19'N 107°57'E). The chemical properties of the soil
sample were: pH 6.62, organic matter 146.27 g.kg’, total N 6.5 g.kg"', organic N
0.51 g.kg’, total P 0.48 g.kg', organic P 0.025 g.kg’, and exchangeable K 0.13
g.kel.
Glomeralean species occurring with G. mume were Claroideoglomus
etunicatum (W.N. Becker & Gerd.) C. Walker & A. Schiissler, Funneliformis
geosporus (T.H. Nicolson & Gerd.) C. Walker & A. Schiissler, Glomus australe
(Berk.) S.M. Berch, G. clavisporum (Trappe) R.T. Almeida & N.C. Schenck, G.
multicaule Gerd. & B.K. Bakshi, G. rubiforme (Gerd. & Trappe) R.T. Almeida &
N.C. Schenck, and Septoglomus deserticola (Trappe et al.) G.A. Silva et al.
Glomus & Kuklospora spp. nov. (China) ... 265
PLATE 1. Glomus mume and morphologically similar species. Glomus mume: A. Broken sporocarp
showing the central hyphal plexus (pl) in Melzer’s reagent; B. Spore in Melzer’s reagent; C. Structure
of the spore wall (sw) in Melzer’s reagent. Glomus clavisporum: D. Portion of the sporocarp. Glomus
taiwanense E. Portion of the sporocarp. Glomus liquidambaris: F. Spores with “paraphysis-like”
structures. Scale bars: A, B, D, E, F = 20 um; C = 10 um.
Kuklospora spinosa B.P. Cai, Jun Y. Chen, Q.X. Zhang & L.D. Guo sp. nov. PLATE 2
FUNGAL NAME 570037
Differs from Kuklospora colombiana by fine spines covering the middle-layer of the
outer spore wall.
Type: China, Szechwan, Muli country, from the rhizosphere of Prunus mume, 5 Sep.
2005 (Holotype, HMAS142950).
266 ... Cai & al.
PLATE 2. Kuklospora spinosa. A. Spore with a distal hypha (hy) in water; B. Spore connections
to the sporiferous saccule (sac) and the cicatrix proximal to saccule (PC) in Melzer’s reagent;
C. Cicatrix proximal to saccule (PC) in Melzer’s reagent; D. Broken spore with three-layered
outer wall (sw1-3), two layers of the middle wall (mw1 & mw2) and the inner wall (iwl & iw2);
iw2 stained by Melzer’s reagent. Scale bars: A, B = 20 um; C, D = 10 um.
Etymo ocy: Latin, spinosa, referring to the ornamentation on the surface of the outer
laminate spore wall layer (sw2).
SPOROCARPS unknown. Spores formed by inflating the hyphal stalk in some
distance to a terminally or intercalary formed sporiferous saccule. Spores
hyaline, subhyaline to yellowish-white (0-10-20-0), globose to subglobose,
100-250 um diam. Spores have three walls: an outer spore wall (sw), a middle
wall (mw) and an inner wall (iw). The outer wall (sw) tri-layered (sw1, sw2 and
sw3): swl hyaline, 1-1.5 um thick, evanescent, usually completely degraded or
sloughed in mature spores; sw2 laminate, yellowish-white (0-10-20-0), 3-5
um thick, covered with fine spines, 2-3 high x 0.5 um in diam, which grow into
swl; sw3 hyaline, 0.5-1 um thick, tightly adherent to sw2, usually separated
from sw2 in Melzer’s reagent, reaction to Melzer's reagent not distinctive. The
middle wall (mw) hyaline, bilayered (mw1 and mw2), thin, less than 1 um thick,
no reaction in Melzer’s reagent. The inner wall (iw) bilayered (iwl and iw2): iwl
membranous, granular, beaded, 0.5-1 um thick, granules sometimes scattering
in crushed spores; iw2 plastic, 0.5-1 um thick, staining pink (0-30-20-0) to
Glomus & Kuklospora spp. nov. (China) ... 267
reddish purple (0—40-60-10) in Melzer’s reagent. Sporiferous saccule hyaline,
globose, 90-150 um diam, collapsing at maturity and leaving a cicatrix proximal
to saccule and a distal hypha or cicatrix. Cicatrix proximal to saccule, 8-15
um diam, distal hypha, 1.5-3 um wide at the spore base. Wall of soporiferous
saccule bilayered, 1.5-3 um thick.
EcoLocy — Spores of Kuklospora spinosa were isolated from soil sampled
under Prunus mume growing at 2450-3100 m a.s.l. in the brushy mountain
of southwest China (27°58’N 101°15'E), The chemical properties of the soil
sample from which G. mume was isolated were: pH 6.48, organic matter 56.32
g.kg', total N 2.5 g. kg’, organic N 0.15 g.kg", total P 0.48 g.kg’, organic P 0.037
g.kg', and exchangeable K 0.2 g.kg".
Glomeralean species occurring in the same samples were Acaulospora
tuberculata Janos & Trappe, Claroideoglomus claroideum (N.C. Schenck &
G.S. Sm.) C. Walker & A. Schiissler, C. luteum (L.J. Kenn. et al.) C. Walker
& A. Schiissler, Diversispora trimurales (Koske & Halvorson) C. Walker &
A. Schissler, Funneliformis geosporus, F. mosseae (T.H. Nicolson & Gerd.)
C. Walker & A. Schiissler, Glomus clavisporum, and Septoglomus deserticola.
Discussion
Glomus mume is morphologically similar to G. clavisporum, G. taiwanense
(C.G. Wu & Z.C. Chen) Y.J. Yao, G. liquidambaris (C.G. Wu & Z.C. Chen) YJ.
Yao, and G. coremioides (Berk. & Broome) D. Redecker & J.B. Morton. The
sporocarpic spores of G. mume can be easily separated from these four species
by the swelling in the middle of the spore apex (PLATE 1A, B). The spore wall
of G. clavisporum is 1-1.5 um thick at the sides, thickened to 17-25 um at the
apex and to 5-8 um at the base (Wu & Chen, 1987; Almeida & Schenck, 1990;
PLaTE 1D). Spore wall of G. taiwanense is 1-1.5 um thick at the sides, thickens
to 4-25 um at the apex and to 1-5.5 um at the base (Wu & Chen, 1987; Almeida
& Schenck, 1990; PLATE 1E). Spore wall of G. liquidambaris is 2-5 um thick at
the sides, thickens to 7.5-25 um at the apex and to 6-10 um at the base, and the
prominent characteristic of this latter species is a “paraphysis-like” structure
protruding from the central plexus of hyphae to the outer part of the sporocarp
(Wu & Chen, 1987; Almeida & Schenck, 1990; PLaTE 1F). Spore wall of
G. coremioides is 2-2.5 um thick, up to 4 um thick near the spore base (Almeida
& Schenck, 1990).
Kuklospora was erected by Sieverding & Oehl (2006), to accommodate
two species previously described in Entrophospora: K. colombiana (Spain &
N.C. Schenck) Oehl & Sieverd. and K. kentinensis (C.G. Wu & Y.S. Liu) Oehl
& Sieverd. Kuklospora spinosa has a morphology typical for the genus based
on the formation of spores within the stalk of the sporiferous saccule and the
presence of a beaded inner wall layer (iw1). Spores of K. spinosa differ clearly
268 ... Cai & al.
from those of K. colombiana and K. kentinensis in size, colour, and outer spore
wall ornamentation.
Acknowledgments
The authors acknowledge the help of Dr. Tiezheng Wei and Yi-Jian Yao, Systematic
Mycology & Lichenology Laboratory, Institute of Microbiology, Chinese Academy of
Sciences, Beijing, China. We especially thank Dr. Ewald Sieverding (Institute of Plant
Production and Agroecology in the Tropics and Subtropics, University of Hohenheim,
Stuttgart, Germany), Prof. Dr. Janusz Blaszkowski (Department of Plant Pathology,
Academy of Agriculture, Szczecin, Poland) and Prof. Dr. Runjin Liu (Institute of
Mycorrhizal Biotechnology, Qingdao Agricultural University, Shandong, China), for
their valuable comments and revisions on the manuscript. We appreciate the corrections
by Shaun Pennycook, Nomenclatural Editor, and suggestions by Lorelei L. Norvell,
Editor-in-Chief. This study was supported in part by the National Natural Science
Foundation of China Grants 30470006, the science and technology item of Xiamen
(3502220072010 and 3502Z20102004).
Literature cited
Almeida RT, Schenck NC. 1990. A revision of the genus Sclerocystis (Glomaceae, Glomales).
Mycologia 82: 703-714. http://dx.doi.org/10.2307/3760157
Daniels HBA, Skipper HD. 1982. Methods for the recovery and quantitative estimation of
propagules from soil. 29-37, in: NC Schenck (ed.). Method and Principles of Mycorrhiza
Research. American Society for Phytopathology. St Paul, Minn.
Gerdemann JW, Nicolson TJ. 1963. Spores of mycorrhizal Endogone species extracted from soil by
wet sieving and decantation. Transactions of British Mycological Society 46: 235-244.
Morton JB, Redecker D. 2001. Two new families of Glomales, Archaeosporaceae and Paraglomeraceae,
with two new genera Archaeospora and Paraglomus, based on concordant molecular and
morphological characters. Mycologia 93(1): 181-195. http://dx.doi.org/10.2307/3761615
Oehl F, Sieverding E, Palenzuela J, Ineichen K, da Silva GA. 2011. Advances in Glomeromycota
taxonomy and classification. IMA Fungus 2: 191-199.
Schenck NC, Pérez Y (eds). 1988. Manual for identification of vesicular-arbuscular mycorrhizal
fungi, INVAM. University of Florida.
Sieverding E, Oehl F. 2006. Revision of Entrophospora and description of Kuklospora and Intraspora,
two new genera in the arbuscular mycorrhizal Glomeromycetes. Journal of Applied Botany and
Food Quality 80: 69-81.
Wu CG, Chen ZC. 1987. The Endogonaceae of Taiwan II. Two new species of Sclerocystis from
Taiwan. Transactions of the Mycological Society of the Republic of China 2(2):73-83.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.269
Volume 124, pp. 269-278 April-June 2013
Russula changbaiensis sp. nov. from northeast China
Guo-Jrz Li’”, DONG ZHAO’, SAI-FEI Li’, HUAI-JUN YANG',
Hua-AN WEN™ & XING-ZHONG Liu!™
'State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences,
No 3 'st Beichen West Road, Chaoyang District, Beijing 100101, China
?University of Chinese Academy of Sciences, Beijing 100049, China
° Shanxi Institute of Medicine and Life Science,
No 61 Pingyang Road, Xiaodian District, Taiyuan 030006, China
CORRESPONDENCE TO *: “[email protected], *[email protected]
Asstract —Russula changbaiensis (subg. Tenellula sect. Rhodellinae) from the Changbai
Mountains, northeast China, is described as a new species. It is characterized by the red tinged
pileus, slightly yellowing context, small basidia, short pleurocystidia, septate dermatocystidia
with crystal contents, and a coniferous habitat. The phylogenetic trees based on ITS1-5.8S-
ITS2 rDNA sequences fully support the establishment of the new species.
Key worps —Russulales, Russulaceae, taxonomy, morphology, Basidiomycota
Introduction
Theworldwide genus of Russula Pers. (Russulaceae, Russulales) is characterized
by colorful fragile pileus, amyloid warty spores, abundant sphaerocysts in a
heteromerous trama, and absence of latex (Romagnesi 1967, 1985; Singer 1986;
Sarnari 1998, 2005). As a group of ectomycorrhizal fungi, it includes a large
number of edible and medicinal species (Li et al. 2010). The genus has been
extensively investigated with a long, rich and intensive taxonomic history in
Europe (Miller & Buyck 2002). Although Russula species have been consumed
in China as edible and medicinal use for a long time, their taxonomy has been
overlooked (Li & Wen 2009, Li 2013). Only 14 new species and three new
varieties have been reported from China (Singer 1935; Chiu 1945; Ying 1983,
1989; Bi & Li 1986; Zang & Yuan 1999; Wen & Ying 2001; Wang et al. 2009; Li et
al. 2011, 2012), and a systematic investigation of the Russulaceae in China has
also been limited until recently (Wang & Liu 2009, 2010; Das et al. 2010; Buyck
& Atri 2011; Das & Verbeken 2011; Wang et al. 2012).
The Changbai Mountain range on the borders of China, Korea, and Russia,
is considered a region highly diverse in macro-fungi (Xie et al. 1986). During
270 ... Li & al.
a foray in the Changbai Mountains, several interesting Russula specimens were
collected; after thorough examination, they are described here as a new species.
Materials & methods
Fresh specimens were photographed using a Sony Cyber Shot DSC-S75 digital camera,
and macroscopic characteristics of only the intact fresh fruitbodies were recorded under
sunlight in the field. After being dried at 50-60 °C in a SIGG Dorrex food dehydrator,
the specimens were deposited in the Mycological Herbarium, Institute of Microbiology,
Chinese Academy of Sciences (HMAS). Small samples of fresh fruit bodies were
dried in silica gel for DNA extraction. Color names and codes follow Ridgway (1912).
Microscopic characters were examined under a Nikon Eclipse 80i microscope according
to Yang (2000), Wang et al. (2009) and Li et al. (2012). Sulfovanillin (SV) solution was
used to test chemical reactions of the rehydrated specimens.
Protocols for DNA extraction, PCR, and sequencing followed those in Li et al. (2012)
and references therein. Sequences of the internal transcribed spacer (ITS) region were
amplified with the primer pairs ITS1/ITS4 (Gardes & Bruns 1993). PCR products were
purified with the Bioteke DNA Purification Kit (Bioteke, Beijing, China). ITS regions
were sequenced with the ABI 3730 DNA analyzer and ABI Bigdye 3.1 terminator cycle
sequencing Kit (BGI, Beijing, China). Sequences obtained were submitted to GenBank
(accession numbers are shown in Fig 3). Other sequences of representative and closely
related Russula taxa (Eberhardt 2002; Miller & Buyck 2002; Li et al. 2011, 2012; Li 2013)
were retrieved from GenBank. Assembly and editing of sequences of each region were
performed with Clustal X and BioEdit (Thompson et al. 1997, Hall 1999) and were
manually modulated when necessary. Some ambiguously aligned terminal sites were
excluded in sequence alignment.
Based on previous phylogenetic works (Eberhardt 2002, Miller & Buyck 2002,
Ryman et al. 2003, Lebel & Tonkin 2007), Albatrellus flettii Morse ex Pouzar and
Gloeocystidiellum aculeatum Sheng H. Wu were chosen as outgroup taxa.
Maximum Parsimony (MP) analysis of the phylogenetic relationships among the
taxa were performed in PAUP* v.4.01 (Swofford 2004). Gaps in alignment were treated
as missing data, and all sites were treated unordered and unweighted. ‘The tree bisection-
reconstruction (TBR) algorithm was performed with the heuristic search option, and
bootstrap analysis was conducted with 1000 replicates (Felsenstein 1985). Consistency
index (CI), retention index (RI), and tree length (TL) were also calculated. Trees were
displayed with Treeview 1.6.6 (Page 1996).
Taxonomy
Russula changbaiensis G.J. Li & H.A. Wen, sp. nov. Fics 1-2
INDEX FUNGORUM IF 550187
Differs from Russula puellula by wider pileocystidia with crystal contents.
Type: China, Jilin Province, Antu County, Erdaobaihe, Heping Forest Farm, 43°07'N
128°54’E, alt. 1014 m, in coniferous forest dominated by Abies nephrolepis, 22.V1I.2010,
L.D. Guo, X. Sun, G.J. Li & L.J. Xie CBS20100344 (Holotype, HMAS262369, GenBank
KC412162); CBS20100431 (Isotype, HMAS262394; GenBank KC412165).
Russula changbaiensis sp. nov. (China) ... 271
Fic. 1: Russula changbaiensis A. Holotype HMAS 262369; B. HMAS 262355.
272.00 al.
EryMoLoey: named after the mountains of the type locality.
BASIDIOMATA small to medium sized, slender and fragile. PILEUS 2-6 cm
in diam., first hemispherical, then convex to applanate, sometimes slightly
depressed above the stipe, or even shallow infundibuliform, Dark Vinaceous
(xxvuil’’) to Corinthian Red (xxv113"’) at centre rarely with small patches of
Pale Yellow-Orange (11115f), glossy, Prussian Red (xxvu5''k) to Indian Red
(xxv113"'k) when dry, viscous when humid; margin incurved first, straight to
slightly up-curled when mature, sometimes undulate and dehiscent, slightly
striate, Pale Vinaceous (xxvul''f) to Hydrangea Pink (xxvitl’'i), Deep
Corinthian Red (xxv113’'i) to Ocher Red (xxvu15''b) when dry; cutis 1/2-3/4
separable from pileus edge, sometimes with small part exfoliating. LAMELLAE
up to 5 mm height in middle, adnate to slightly subfree, rarely forked near
the stipe, slightly interveined, Cream Color (xv119’f), brittle, Naples Yellow
(x19'd) when dry; edge even, narrowing towards the pileus margin, 11-13
pieces per cm in the edge; lamellulae absent. StrpE 3-5 x 1-1.5 cm, central,
smooth, subclavate to cylindrical, sometimes a little ventricose toward the base,
without annulus, White (L111), partly turning Baryta Yellow (1v21f) when aged
and dry, rarely with small Cinnamon (xx1x15’’) spots at the base, not pruinose,
fragile, hollow when mature. CONTEXT 2-4 mm thick at the pileus center,
White (x11), turning slightly Sulphur Yellow (v25f) when old and injured; taste
mild to slightly acrid, moderately acrid in gills; no distinct odor. SPORE PRINT
Pale Cream to Cream (Romagnesi lamb).
BASIDIOSPORES [100/5/5] (6.6-)6.9-7.9(-8.1) x (5.8-)6.0-6.6(-7.3)
um, Q = (1.03-)1.11-1.24(-1.28) (Q =1.19 + 0.05), subglobose to broadly
ellipsoid, verrucose; ornamentation amyloid, composed of warts mostly
fused into fine lines, cristulate to subreticulate, with some isolated verrucae,
less than 1.0 um high; plage distinctly amyloid. Basrp1a 26-34 x 8-13 um,
clavate, inflated towards upper half, 4-spored, projecting 5-10 um beyond
hymenium, hyaline, smooth; sterigmata 2-4 um, pointed, straight to slightly
curved. PLEUROCYSTIDIA few, 43-56 x 6-10 um, originating in subhymenium,
projecting 25-30 um beyond hymenium, thin-walled, clavate to subfusiform,
with refractive contents grayish in SV in middle and lower parts; apices obtuse,
often with a moniliform to papillate appendage. CHEILOCysTIDIA not observed;
lamellar edge sterile. PILEIPELLIS two layered. EprcuTis a trichoderm 150-250
uum thick, composed of 3-4 um thick, slender hyaline hyphae, occasionally
with intracellular pigmentation particles. PILEOCYSTIDIA numerous, 70-130 x
6-8 um, originating in subcutis, clavate, slender, septate, with crystal contents
ash black in SV; apices obtuse. SUBCUTIS a cutis composed of recumbent,
hyaline, 2.5-4 um diam hyphae. TRAMA composed of connective hyphae 2-5
um diam and hyaline, globose to subglobose, 25-40 um diam sphaerocyststs.
STIPITIPELLIS a cutis not well developed, composed of thin-walled, septate,
Russula changbaiensis sp. nov. (China) ... 273
/ Z Zp oNas ss
S 7A SSN
Fic. 2 Russula changbaiensis HMAS 262369 (holotype).
A. Basidiospores (SEM); B. Basidia; C. Pleurocystidia; D. Pileipellis.
cylindrical, hyaline hyphae 3-6 um wide; caulocystidia absent. CLAMP
CONNECTIONS absent in all tissues.
ECOLOGY & DISTRIBUTION: Solitary in conifer and conifer-broadleaf forest
(often has a preference for Abies spp.). DISTRIBUTION: China (Jilin). SEASON:
July.
274 ... Li & al.
OTHER SPECIMENS EXAMINED: CHINA, JILIN PROVINCE, ANTU CouNTY, Hepingyingzi,
43°07'N 128°54’E, alt. 882 m, in mixed coniferous-broadleaf forest, 21.VII.2010, L.D.
Guo, X. Sun, GJ. Li & LJ. Xie CBS20100044 (HMAS262381, GenBank KC412164);
CBS20100514 (HMAS262376, GenBank KC412163); Changbai Mountains Forest
Ecological System Research Center, 43°23''N 128°05’E, alt. 811 m, in mixed coniferous-
broadleaf forest, 25.VII.2010, X. Sun & G.J. Li CBS20100299(HMAS262355, GenBank
KC412161).
Comments: The combination of slender basidiomata, red tinged pileus
with slightly striate margin, separable pileipellis, small basidia, few short
pleurocystidia, and pluriseptate dermatocystidia placed this new species
in sect. Rhodellinae Romagn. in Russula subg. Tenellula Romagn. Russula
changbaiensis is characterized by its slightly yellowing context, cream spore
print, dermatocystidia with crystal contents, and coniferous habitat. The nine
other species with a reddish tinged pileus in sect. Rhodellinae are R. arpalices
Sarnari, R. conviviales Sarnari, R. font-queri Singer, R. impolita (Romagn.) Bon,
R. melzeri Zvara, R. pseudoimpolita Sarnari, R. puellula Ebbesen et al., R. rhodella
E.-J. Gilbert, and R. zonatula Ebbesen & Jul. Schaff. (Romagnesi 1967, 1985;
Sarnari 2005). All are differentiated from R. changbaiensis as follows: Russula
arpalices has a strongly yellowing context and distinctive Pelargonium-like odor;
R. conviviales has an ocher spore print, partly subulate epicutis terminal cells,
and wider pileocystidia (8-12 um, Sarnari 2005) with golden yellow contents;
R. font-queri has obviously yellowish-orange tinged pileus and lamellae, pale red
tinged stipe, yellow spore print, context with a taste of old fruit, longer basidia
(28-50 x 8.5-12.5 um, Romagnesi 1967), and pleurocystidia (40-85 x 7-12 um,
Romagnesi 1967); R. impolita has an opaque pileus cutis, fruity odor, spores
with isolated warts, and finely encrusted dermatocystidia; R. melzeri has an
epicutis composed of large and short hyphal cells growing from a subcutis made
up of sphaerocyst-like cells; R. pseudoimpolita has a velutinous pileus, barely
changing context, ampullaceous pileipellis hyphal terminals, and association
with Quercus; R. puellula has larger hyaline basidia, slender dermatocystidia
(3-6 um, Sarnari 2005), and an association with beech and oak deciduous
forest; R. rhodella has an ocher to pale yellow spore print, and isolated spore
ornamentation; R. zonatula is recognized for its obviously discolored pileus,
yellowish spore print, isolated spore ornamentation, pleurocystidia over 90
um long, and an association with beech forest (Romagnesi 1967, 1985; Sarnari
2005).
Russula taxa with reddish tinged pilei originally described from China are
R. chichuensis W.F. Chiu, R. griseocarnosa X.H. Wang et al., R. handelii Singer,
R. jilinensis G.J. Li & H.A. Wen, R. minutula var. minor Z.S. Bi, R. taliensis
W.E. Chiu, R. pseudovesca J.Z. Ying, R. punicea W.F. Chiu, and R. zhejiangensis
GJ. Li & H.A. Wen. It is easy to discriminate between these species and
R. changbaiensis: R. chichuensis has a white spore print, large pleurocystidia <130
Russula changbaiensis sp. nov. (China) ... 275
um long, and no pileocystidia; R. griseocarnosa differs in the larger pileus (5-12
cm diam.), slightly pinkish stipe, and water-soaked grayish context; R. handelii
has hyaline pleurocystidia and a stipitipellis with numerous caulocystidia; R.
jilinensis has a yellowish green tinged pileus center, mild tasting context, and
ocher to yellow spore print; R. minutula var. minor differs in the small (0.8-2.0
cm) pileus and pileipellis with primordial hyphae but without pileocystidia;
R. taliensis is recognized by its pruinose opaque pileus, yellowish spore print,
and spores with rare and isolated ornamentation; R. pseudovesca can be clearly
perceived by its whitish spore print, numerous pleurocystidia >80 um in
length, and pileocystidia with 0.9-1.8 um thick cell walls; R. punicea has a
strongly acrid context that does not change color when old and injured; and
R changba@ensis KC 412161 HMAS262355
R changbaensis KC 412162 HMAS262369 Holotype
R changbdensis KC 412163 HMAS262376
R changba@ensis KC 412164 HMAS262331
R changbaiensis JX425401 HMAS262394
R odorata AY061698 mubg, feels
R versicolor JX425394 HMAS250966
9 R versicolor JX425372 HMAS131941
R versicolor JX425401 HMAS262394
R versicolor AY061722
R versicolor JX425372 HMAS131941
R nauseosa AY061733
cy) R abiefina EU598179
R solaris AF418627
R pueliuia AY061710
R puellaris AY061709
R messapica AY061692
69 R azurea AY061660
R lilacea AY061731
100 R cessans AY061730
R laricina AY061685
109 R jilinensis HQ693524 HMAS262364
R pilinensis GU966632 HMAS 194253
R curfipes AY061668
100_ R aduiterina AY061651
R cuprea AY061667
81 R meizeri AY061691
R zhejiangensis GQ344559 HMAS 187071
R paludosa AY061703
72 R risigalina AY061713
R furet AY061720
7Q R amoenipes AY061656
R pascua AY061705
R xerampelina AY061734
R nifida AY061696
R sphagnophiia AY061719
R maculata AY061688
100 R auranfiaca AY061658
R rosea AY061686
R lepidicolor AY061687
74) R amethystina AY061653
R rubra AY061717
94 R claroflava AY061665
R vinosa A¥061724
99
75
72 R infegriformis AY061684
100 R velenovskyi AY161721
R pseudointegra AY061708
A flefit AY061733
G aculeafum AY061739
— 5changes
Fic. 3: Phylogenetic relationship tree of Russula changbaiensis and other related Russula species
inferred from the dataset of ITS1-5.8S-ITS2 sequences. Consistency index (CI) = 0.486, retention
index (RI) = 0.647, and tree length (TL) = 842. MP bootstrap support values >50% are indicated
above the branches.
276 ... Li & al.
R. zhejiangensis has a bright red pileus with dark center, dark cream to ocher
spore print, longer (<74 um) pleurocystidia, and a habitat of subtropical
evergreen forest (Singer 1935, Chiu 1945, Bi & Li 1986, Ying 1989, Wang et al.
2009, Li et al. 2011, 2012).
Phylogenetic results
The dataset comprised 38 Russula taxa with particular attention paid to
closely related Russula subg. Tenellula members and other red-capped Russula
species. The sequence length was 534 nucleotides. In the MP analysis of ITS1-
5.8S-ITS2 sequences, 264 characters were constant, 185 variable characters were
parsimony-informative, and 85 characters were parsimony-uninformative.
In the phylogenetic tree (Fic. 3), R. changbaiensis sequences formed a
conspicuous clade, showing enough phylogenetic distance to support them
as an independent taxon. Russula changbaiensis and most members of subg.
Tenellula form a clade with a moderate bootstrap support of 52%, the same
support as cited in Miller & Buyck (2002). The molecular analyses do support
R. changbaiensis within subg. Tenellula. However, the phylogenetic relationships
between R. changbaiensis and other subg. Tenellula taxa are still unclear; no
stable topology can be established because there are so few corresponding
sequences from dependably morphologically identified specimens.
Acknowledgments
The authors are grateful to Dr. T. Lebel (National Herbarium of Victoria, Royal
Botanic Gardens Melbourne) and Dr. K. Das (Botanical Survey of India, Sikkim
Himalayan Regional Centre) for carefully reviewing the manuscript; to Ms. H.M. Li,
Ms. A.R. Yan and Dr. T.Z. Wei (HMAS) for providing the herbarium specimens; to
Ms. X.F. Zhu for inking in line drawings, B.A. Jaffee (University of California Davis),
Dr. S.R. Pennycook (Landcare Research), Dr. L.L. Norvell (Pacific Northwest Mycology
Service), and Dr. J.Y. Zhuang for improving the manuscript; to Dr. L.D. Guo, Dr. X.
Sun, Dr. X.L. Wang, Mr. Z.M. Li, Ms. S.F. Yue, Mr. D. Zhao, Ms. J.X. Yang (Institute
of Microbiology, CAS), Ms. L.J. Xie, Dr. C.-Y. Sun and Ms. J. Zhou (National Institute
of Occupational Health and Poison Control, China CDC) for assistance in collecting
specimens and lab work; to Dr. C.L. Li and Ms. J.N. Liang (Institute of Microbiology,
CAS) in SEM photographing. This project was supported by the National Natural
Science Foundation of China (No. 30770013) and International Cooperation Program
of Ministry of Science and Technology of the People’s Republic of China (No.
2009DFA31160).
Literature cited
Bi ZS, Li TH. 1986. A preliminary note on Russula species from Guangdong, with a new species
and a new variety. Guihaia 6(3): 193-199.
Buyck B, Atri NS. 2011. A Russula (Basidiomycota, Russulales) with an unprecedented hymenophore
configuration from northwest Himalaya (India). Cryptogamie Mycologie 32(2): 185-190.
Russula changbaiensis sp. nov. (China) ... 277
Chiu WE. 1945. The Russulaceae of Yunnan. Lloydia 8: 31-59.
Das K, Verbeken A. 2011. Three new species of Lactarius (Russulaceae) from Sikkim, India.
Cryptogamie Mycologie 32(4): 365-381.
Das K, Putte KVD, Buyck B. 2010. New or interesting Russula from Sikkim Himalaya (India).
Cryptogamie Mycologie 31(4): 37-387.
Eberhardt U. 2002. Molecular kinship analyses of the agaricoid Russulaceae: Correspondence with
mycorrhizal anatomy and sporocarp features in the genus Russula. Mycological Progress 1(2):
201-223. http://dx.doi.org/10.1007/s11557-006-0019-6
Felsenstein J. 1985. Confidence intervals on phylogenetics: an approach using bootstrap. Evolution
39:783-791. http://dx.doi.org/10.2307/2408678
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes—application
to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.
http://dx.doi.org/10.1111/j.1365-294X.1993.tb00005.x
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NTT. Nucleic Acids Symposium Series 41: 95-98.
Lebel T, Tonkin JE. 2007. Australasian species of Macowanites are sequestrate species of Russula.
Australian Systematic Botany 20: 355-381. http://dx.doi.org/10.1071/SB07007
Li GJ. 2013. Taxonomy of Russula from China. PhD dissertation, Institute of Microbiology,
University of Chinese Academy of Sciences, Beijing.
Li GJ, Wen HA. 2009. Research of prospects on taxonomy of Russula in China. Mycosystema 28(2):
303-309.
Li GJ, Li SE Wen HA. 2010. The Russula species resource and its economic values of China. Acta
Edulis Fungi 17(sppl): 155-160.
Li GJ, Li SE Wen HA. 2011. Russula zhejiangensis sp. nov. from East China. Cryptogamie Mycologie
32(2): 127-133.
Li GJ, Li SF, Liu XZ, Wen HA. 2012. Russula jilinensis sp. nov. (Russulaceae) from northeast China.
Mycotaxon 120:49-58. http://dx.doi.org/10.5248/120.49
Miller SL, Buyck B. 2002. Molecular phylogeny of the genus Russula in Europe with a comparison
of modern infrageneric classifications. Mycol. Res. 106(3): 259-276.
http://dx.doi.org/10.1017/S0953756202005610
Page RMD. 1996. Treeview: An application to display phylogenetic trees on personal computers.
Comput Appl Biosci 12:357-358.
Romagnesi H. 1967. Russules d'Europe et d’Afique du Nord. Bordas, Paris.
Romagnesi H. 1985. Les Russules d’ Europe et d’ Afrique du Nord. Reprint with supplement. J.
Cramer, Lehre.
Ridgway R. 1912. Color standards and color nomenclature. Robert Ridgway, Washington.
Ryman S, Fransson P, Johannesson H, Danell E. 2003. Albatrellus citrinus sp. nov., connected to
Picea abies on lime rich soils. Mycol. Res. 107 (10): 1243-1246.
http://dx.doi.org/10.1017/S0953756203008359
Sarnari M. 1998. Monografia illustrate de genere Russula in Europa. Tomo Primo. AMB, Centro
Studi Micologici, Trento.
Sarnari M. 2005. Monografia illustrate de genere Russula in Europa. Tomo Secondo. AMB, Centro
Studi Micologici, Trento.
Singer R. 1935. Supplemente zu meiner monographie der guttung Russula. Ann. Mycol. 33:
297 2392.
Singer R. 1986. The Agaricales in modern taxonomy. 4th ed. Koeltz Scientific Books: Koenigstein.
278 ... Li &al.
Swofford DL. 2004. PAUP’: Phylogenetic Analysis Using Parsimony and other methods.
Version4.0b10. Sinauer, Sunderland.
Thompson JD, Gibson TJ, Plewnlak F, Jianmougin F, Higgins DG. 1997. The Clustal X windows
interfaces: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
Wang XH, Liu PG. 2009. A type study of Lactarius sakamotoi and its presence in China. Cryptogamie
Mycologie 30(1): 45-51.
Wang XH, Liu PG. 2010. Multifurca (Russulales), a genus new to China. Cryptogamie Mycologie
31(1): 9-16.
Wang XH, Yang ZL, Li YC, Knudsen H, Liu PG. 2009. Russula griseocarnosa sp. nov.
(Russulaceae, Russulales), a commercially important edible mushroom in_ tropical
China: mycorrhiza, phylogenetic position, and taxonomy. Nova Hedwigia 88: 269-282.
http://dx.doi.org/10.1127/0029-5035/2009/0088-0269
Wang XH, Stubbe D, Verbeken A. 2012. Lactifluus parvigerardii sp. nov., a new link towards
the pleurotoid habit in Lactifluus subgen. Gerardii (Russulaceae, Russulales). Cryptogamie
Mycologie 33(2): 181-190.
Wen HA, Ying JZ. 2001. Studies on the genus Russula from China II. Two new taxa from Yunnan
and Guizhou. Acta. Mycol. Sinica. 20(2): 153-155.
Xie ZX, Wang Y, Wang B. 1986. Records and maps of the mushrooms in Changbai Mountains. Jilin
Science and Technology Press, Changchun.
Yang ZL. 2000. Type studies on agarics described by N. Patouillard (and his co-authors) from
Vietnam. Mycotaxon 75: 431-476.
Ying JZ. 1983. A study on Russula viridi-rubrolibata sp. nov. and its related species of subsection
Virescentinae. Acta. Mycol. Sinica. 2(1): 34-37
Ying JZ. 1989. Studies on the genus Russula Pers. from China 1. New taxa of Russula from China.
Acta. Mycol. Sinica. 8(3): 205-209.
Zang M, Yuan MS. 1999. Contribution to the knowledge of new basidiomycetous taxa from China.
Acta Botanica Yunnanica 21 (1): 37-42.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.279
Volume 124, pp. 279-300 April-June 2013
Studies on three rare coprophilous plectomycetes from Italy
FRANCESCO DOVERI”*, SABRINA SARROCCO, & GIOVANNI VANNACCI
Department of Agriculture, Food and Environment, University of Pisa,
80 via del Borghetto, 56124 Pisa, Italy
* CORRESPONDENCE TO: [email protected]
ABSTRACT — The concept of plectomycetes is discussed and their heterogeneity emphasised.
Three ascohymenial cleistothecial ascomycetes, collected or isolated from herbivore or
omnivore dung in damp chamber cultures, are described. Emericella quadrilineata and
Lasiobolidium orbiculoides are discussed and compared morphologically with similar taxa.
A key to Lasiobolidium and the related Orbicula is provided. The importance of the second
worldwide isolation of Cleistothelebolus nipigonensis and the difficulties of distinguishing it
from Pseudeurotium species are stressed. The Italian collection of C. nipigonensis from canid
dung is compared with the original strain from wolf, and its epidermoid peridial tissue is
regarded as one of the main morphological differentiating features from Pseudeurotium
ovale. The morphological characteristics of the monospecific genus Cleistothelebolus are
discussed and compared with those of Pseudeurotiaceae and Thelebolaceae, particularly with
Pseudeurotium and Thelebolus. [TS and LSU rDNA sequences of the Cleistothelebolus isolate
support its placement in Thelebolaceae.
Key worps — coprophily, phylogeny, Pyronemataceae, Thelebolales, Trichocomaceae
Introduction
Our twenty-year study on fungi growing on faecal material (Doveri 2004),
both in the natural state and in damp chamber cultures, has allowed us to
record from Italy several species of plectomycetes, which must be regarded as
an assemblage of heterogeneous Ascomycota characterised by small, globose
or subglobose, prototunicate asci, irregularly disposed in a centrum of
cleistothecial or gymnothecial ascomata (Ulloa & Hanlin 2000, Geiser et al.
2006, Stchigel & Guarro 2007, Kirk et al. 2008). Most are pleomorphic, often
with a hyphomycetous asexual state, whose features have a primary taxonomic
value in separating genera and families and in establishing their phylogenetic
relationships. Many are saprotrophic, growing on decaying wood or vegetables,
soil, and dung, while some are parasites of human and mammal tissues
(Udagawa 1987).
280 ... Doveri, Sarrocco & Vannacci
Plectomycetes are found in different orders and families of discomycetes,
pyrenomycetes, and loculoascomycetes (Cain 1956, Benny & Kimbrough
1980). Phylogenetic studies resulting from gene sequencing combined with
cladistics (Sugiyama et al. 1999, Suh & Blackwell 1999) have confirmed their
great heterogeneity.
The aim of this work is to provide a detailed morphological description of
Emericella quadrilineata and Lasiobolidium orbiculoides, two plectomycetous
fungi recently isolated by us from dung, and to analyse their relationships
with similar taxa. We also include an extensive study of the second collection
worldwide of the very rare Cleistothelebolus nipigonensis, attempting to
determine, by morphological, physiological and preliminary molecular data
(ITS and LSU rDNA sequences), its connection with Thelebolaceae Eckblad
and other families with an uncertain position in Leotiomycetes O.E. Erikss. &
Winka.
Material & methods
Collection of Emericella quadrilineata and Lasiobolidium orbiculoides
Specimens of E. quadrilineata (on dried sheep dung) and L. orbiculoides (on dried
goat dung) were collected in the Tuscan archipelago (North Tirreno sea) and placed
in a non-sterilised damp chamber according to Richardson & Watling (1997) and
Richardson (2001) as slightly modified by Doveri (2004). Cultured material, incubated
at room temperature (20-25°C) under natural light but not exposed to direct sunlight,
was examined every day under a stereomicroscope. Ascomata of both species grew
fast, maturing after 7 days incubation, those of E. quadrilineata directly on dung, while
those of L. orbiculoides on blotting paper at the dung base, partly obscured by the thick
meshes of an aerial mycelium. Only three specimens of E. quadrilineata were produced,
which were picked up from dung by a sterile needle, utilised for the microscopic
study, preserved later in a luted slide. Specimens of L. orbiculoides were produced
in a large quantity; however, all the attempts to isolate this fungus in axenic culture
were unsuccessful. Part of the material was utilised for the microscopic study and for
preservation as dried material.
Isolation of Cleistothelebolus nipigonensis
Cleistothelebolus nipigonensis was obtained from dried canid dung collected in
northern Italy, placed in a non-sterilised damp chamber, and cultured following the
same methods utilised for the other two species. Mature ascomata were hardly noticed
after 20 days incubation but, owing to their smallness and staying in hiding, they may
have appeared a few days earlier. Ascomata were picked up from dung by a sterile
needle and crushed on PDA (Potato Dextrose Agar, Difco Lab.) amended by 2 mg L”
streptomycin, for primary isolation. Plates were incubated for 14-15 days at room
temperature (20-25°C) under natural light. After incubation, plates were observed at
the stereomicroscope (up to 100x) and germinating groups of ascospores were selected,
Emericella, Lasiobolidium, & Cleistothelebolus spp. (Italy) ... 281
picked out of the agar and transferred to PDA plates using a glass needle. Pure cultures
on PDA were used to obtain single-spore isolates.
100 ul of a water suspension of ascospores were placed on WA (Water Agar, 15 g
dissolved in 1 L of distilled water) plates by a sterile micropipette and incubated at 25 +
2°C 12h/12h light/darkness. Monoascosporic isolations were transferred to PDA.
Morphological studies
Emericella quadrilineata, L. orbiculoides and C. nipigonensis were examined
microscopically in mounts of water, Congo red, and methyl blue or cotton blue in lactic
acid. Fifty ascospores discharged from mature asci derived from at least two ascomata
were measured in water.
Cultural studies
To assess the effect of different substrates on the growth of C. nipigonensis, a 6 mm
diameter agar disk, collected from the actively growing margin of PDA colonies, was
placed in the centre of 90 mm Petri dishes containing CMA (Corn Meal Agar, Difco
Lab.), MA (Malt Agar, Difco Lab.), NA (Nutrient Agar, Difco Lab.), PDA, V8 agar (Gams
et al. 1998), and Emerson YpSs agar (Yeast protein Soluble starch Agar) (Gams et al.
1998). Five plates of each medium were incubated at 24 + 2°C 12h/12h light/darkness.
Radial growth of the colonies was recorded at different times from the second day of
incubation. Regression and variance analysis of growth curves were performed by using
SigmaPlot package (SPSS Inc., Chicago, IL) and Graphpad Prism 5.02 Software. P<0.05
was assumed as significant level.
Molecular studies
DNA EXTRACTION, AMPLIFICATION AND SEQUENCING — Mycelium for DNA
extraction, produced on PDA plates overlaid with a cellophane membrane at 25°C,
was scraped from the plates with a sterile scalpel, placed in a 1.5 ml tube (0.15 g) and
extracted using the DNeasy® Plant Mini Kit (QIAGEN) according to the manufacturer's
instructions. Polymerase Chain Reaction (PCR) was used to amplify the LSU and the
ITS regions of the nuclear ribosomal DNA, employing the following primers: LROR
and LR3 for the first 650 kb of the LSU gene and ITS1 and ITS4 for the ITS region
(Gardes & Bruns 1993, White et al. 1990). Amplification reaction mixtures contained
25-50 ng of template DNA, GoTaq*Green Master Mix (Promega) 1X and 0.5 mM of
each primer in a volume of 50 uL (Doveri et al. 2010). Amplification was performed in
a GeneAmp® PCR System 2400 (Perkin Elmer) using the following parameters: for LSU
initial denaturation step at 94°C for 5 min, 35 cycles consisting of denaturation at 94°C
for 1 min, annealing at 52°C for 1 min and extension at 72°C for 2 min, final extension
of 72°C for 7 min; for ITS initial denaturation step at 94°C for 1 min, 30 cycles consisting
of denaturation at 94°C for 30 s, annealing at 54°C for 1 min and extension at 72°C for 1
min, final extension of 72°C for 4 min. After the final extension of 72°C, reactions were
held at 4°C. PCR products were purified by the QIAquick PCR Purification Kit (Qiagen)
according to the manufacturer's protocol and submitted to sequencing. Samples to be
sequenced were processed by the DNA Sequence Facility at the Bio Molecular Research
(BMR), Servizio di Sequenziamento —- CRIBI, University of Padova (Italy).
282 ... Doveri, Sarrocco & Vannacci
Results
Cultural studies
Equations resulting from regression analysis obtained for each medium were
all highly significant (R*>0.880, P<0.001). From slopes comparison, growth rate
of Cleistothelebolus nipigonensis on YpSs (a=1.7 mm d") was statistically higher
than on all the other media (P<0.001) (data not shown).
Molecular study
Amplifications produced sequence lengths of about 600 bp (ITS) and 650
bp (LSU). Comparison of our ITS sequence (KC492060) with those deposited
in GenBank resulted in high similarity percentages (96%) with Antarctomyces
Stchigel & Guarro and other uncultured thelebolaceous fungi. Comparison
of the LSU sequence (KC492061) within the same database confirmed the
close relationship between C. nipigonensis and two species of Thelebolus
(T! ellipsoideus and T. globosus, 97% similarity).
Taxonomy and discussion
Emericella quadrilineata (Thom & Raper) C.R. Benj., Mycologia 47: 680, 1955 PL. 1
AscomatTA cleistothecioid, 300-350 um diam., globose, non-ostiolate,
smooth, purple-red but appearing straw coloured and slightly granulose-
reticulate at first sight, as surrounded and obscured by dense yellowish masses
of Hiille cells and sparse hyphae.
HULLE CELLS terminal, globose, exceptionally ellipsoidal, 15-25 um
diam., hyaline in the middle, with yellowish, up to 5 um thick walls, arising
out of hyaline, branched, septate, slightly encrusted hyphae, not forming a
pseudostalk at the peridial base; PERrp1um thin-walled, purple-red, a layer of
firmly pressed, narrow (about 1 um diam.), purple-red hyphae; PARAPHYSES
absent; Asci irregularly disposed, 8-spored, globose to broadly ellipsoidal,
8.5-11 x 8-9 um, thin-walled, lacking an apical apparatus, evanescent;
ASCOSPORES Oblate, globose in frontal view, ellipsoidal in side view, 4-5(-5.5)
x 3-3.5 um, bivalved, hyaline at first, becoming purple-red, smooth, with four
slightly raised equatorial crests, less than 0.5 um wide, seemingly with an entire
margin; ASEXUAL STATE only some hyaline, globose, echinulate conidia, about
3 um diam., observed in association with ascomata.
EcCOLoGY & DISTRIBUTION — Three specimens collected from sheep (Ovis
aries) dung in a damp chamber culture. April. Rare. Known from one island
coastal site in Italy, possibly cosmopolitan. Usually isolated from soil.
SPECIMEN EXAMINED — ITALY, Tuscany, Livorno, Capraia island, 9°49'13"N
43°01'29"E, 50 ma.s.L., 11.IV.2011, leg. L. Levorato (Herbarium F. Doveri 007.12).
Most plectomycetes are distributed in Eurotiomycetidae Doweld, particularly
in Eurotiales G.W. Martin ex Benny & Kimbr. and Onygenales Cif. ex Benny
Emericella, Lasiobolidium, & Cleistothelebolus spp. (Italy) ... 283
C
PLaTE 1. Emericella quadrilineata (Herbarium F. Doveri 007.12): A-B, clusters of Hiille cells
(arrows) around the peridial wall; C, asci with conglobate ascospores; D, asci in different stages of
maturity and some free ascospores; E-F, ascospores. Scale bars: A = 40 um; B-D = 10 um; E = 12
um; F = 8 um.
& Kimbr. Besides the cleistothecial ascomata and evanescent asci, these two
orders share a thin, variously structured, usually brightly coloured or pale
peridium, absence of an hamathecium, and small, usually brightly coloured,
284 ... Doveri, Sarrocco & Vannacci
one-celled, oblate ascospores often with equatorial ornamentations (Kirk et
al. 2008). Blastic phialoconidiogenesis distinguishes Eurotiales (von Arx 1987)
from Onygenales, where a thallic conidiogenesis produces both arthro- and
aleurioconidia (Benny & Kimbrough 1980, Kirk et al. 2008).
In Eurotiales, Trichocomaceae E. Fisch. (= Eurotiaceae Clem. & Shear)
encompasses several genera (including Emericella Berk.) characterised by
brightly coloured ascomata with a cellular or hyphal peridium, often catenulate
asci, usually saturnine (with equatorial crests) ascospores (Benny & Kimbrough
1980, Malloch 1985), and Aspergillus P. Micheli ex Link, Paecilomyces Bainier,
or Penicillium Link asexual states (Malloch & Cain 1972, Kirk et al. 2008). They
are cosmopolitan and usually soil inhabitants or saprotrophs on decaying plants;
some are medically or industrially important as producers of antibiotics or
toxins, sometimes behaving as opportunistic pathogens (Cannon & Kirk 2007)
or agents of food spoilage (Geiser et al. 2006). Molecular phylogenetic studies
(Berbee et al. 1995, Ogawa et al. 1997, Sugiyama 1998) have demonstrated that
Trichocomaceae is monophyletic.
Berkeley (1857) erected Emericella for E. variecolor Berk. & Broome, a
species with purplish long-spiny bordered ascospores and small cleistothecial
ascomata supported by a spongy column, from which numerous threads extend,
terminating in large globose cells. These stromatic (Malloch & Cain 1972),
thick-walled, intercalary or end cells surrounding cleistothecia (Ulloa & Hanlin
2000, Geiser et al. 2006, Kirk et al. 2008) are called “Hiille cells” (Malloch 1985).
In Trichocomaceae they are typical of Fennellia B.J. Wiley & E.G. Simmons and
Emericella; Fennellia has yellow or green, often confluent ascomata, hyaline
or pale ascospores, and often elongated Hiille cells (Wiley & Simmons 1973,
Locquin-Linard 1990, Guarro et al. 2012), and Emericella has usually discrete,
red or purplish to dark brown cleistothecia with a peridium of compressed
hyphae, and oblate, purple-red, orange or violet, rarely pale ascospores usually
ornamented with equatorial ridges. Emericella also has globose Hiille cells and
an Aspergillus asexual state (von Arx 1974, Hanlin 1998, Guarro et al. 2012) of
the so called “A. nidulans group” (Benjamin 1955, Christensen & Raper 1978,
Christensen and States 1982, Pitt & Samson 2007), which is the equivalent
of Aspergillus sect. Nidulantes (Gams et al. 1985). About forty species are
recognised at the present (Guarro et al. 2012) in Emericella; they are airborne
soil inhabitants (Stchigel & Guarro 1997, Samson et al. 2002), rarely growing
elsewhere (Pitt and Samson 2007), thermotolerant, but not thermophilic (Zalar
et al. 2008), and prefer warm climates and dry substrata (Samson & Mouchacca
1974). Some are opportunistic pathogens, uncommon agents of animal and
human infections (Balajee et al. 2007, Verweij et al. 2008).
Emericella quadrilineata is characterised by rapid growth in culture,
comparatively large ascomata, 8-spored asci, and smooth purple-red ascospores
Emericella, Lasiobolidium, & Cleistothelebolus spp. (Italy) ... 285
with four low equatorial crests (Thom & Raper 1939). According to Balajee et
al. (2007) and Verweij et al. (2008) the number of these inconspicuous crests
can be detected only by electron microscopy, but we think it can be detected
also by careful focusing under a light microscope.
Emericella acristata (Fennell & Raper) Y. Horie, E. miyajii Y. Horie, and
E. parvathecia (Raper & Fennell) Malloch & Cain are morphologically
indistinguishable from E. quadrilineata (Guarro et al. 2012) and possibly the
same species: E. acristata was originally described without equatorial crests
(Fennell & Raper 1955) but others have cited two (Ismail et al. 1995) or four low
crests (Horie et al. 1996, Guarro et al. 2012); E. miyajii has four inconspicuous
crests, and E. parvathecia has two (Raper & Fennel 1965).
The closely related E. nidulans (Eidam) Vuill. var. nidulans is also
morphologically indistinguishable from E. quadrilineata except for having
ascospores with two equatorial crests. Molecular studies that support
microscopic examinations have helped separate the two species (Verweij et al.
2008, Matsuzawa et al. 2012). Emericella quadrilineata, usually isolated from
soil (Thom & Raper 1939), has been also isolated sometimes from herbal drugs
(Horie 1979), once from white wine (Stchigel et al. 1999), and now from dung.
It is an opportunistic pathogen (Balajee et al. 2007), agent of onychomycosis
(Gugnaniet al. 2004) and rarely causes invasive aspergillosis (Drakos et al. 1993,
Verweij et al. 2008). Emericella nidulans, which is thermotolerant (Chen and
Chen 1991), cellulolytic (Reese & Downing 1951), possibly ligninolytic (Bull &
Carter 1973), and opportunistically pathogenic (Balajee et al. 2007, Verweij et
al. 2008) has been isolated not only from plants (Benjamin 1955), rotting wood
(Eidam, 1883, Lumley et. al. 2000), and soil (Chen & Chen 1991) but also from
rabbit (Benjamin 1955) and barking deer (Piasai & Manoch 2009) dung, goat
droppings, pellets of free-living birds, and fresh human faeces (Domsch et al.
1993).
We know very few records of other Emericella species from dung, apart from
E. foveolata Y. Horie from armadillo (Horie et al. 1996) and E. rugulosa (Thom
& Raper) C.R. Benj. from rat (Jeamjitt et al. 2007). Aspergillus recurvatus Raper
& Fennell, lacking a sexual state but related to Emericella as belonging to the
nidulans-group (Raper & Fennell 1965), was isolated from lizard dung.
Lasiobolidium orbiculoides Malloch & Benny, Mycologia 65: 655, 1973 PL. 2-3
Ascomara cleistothecioid, 200-500 um diam., globose to broadly ellipsoidal,
semi-membranous, yellowish at first, becoming yellow-ochraceous, finally
brownish, granulose due to protruding groups of peridial cells, fully covered by
dense flexuous, <4 mm long hairs.
PERIDIUM two-layered, pseudoparenchymatous: endostratum with textura
angularis composed of pale, thin-walled, polygonal cells, 5-8 um diam.,
286 ... Doveri, Sarrocco & Vannacci
exostratum thin, weakly dextrinoid, with textura globulosa—angularis composed
of thick-walled, yellowish brown cells, 12-28 x 11-22 um, interspaced with
some irregularly lobed cells; Hairs arising from the outermost exoperidial cells,
6-7.5 um diam., yellowish, smooth, thick-walled (up to 3 um), wavy, sometimes
slightly coiled, sparsely septate, more densely septate at their base, with rounded
tips and an usually swollen, bulbous, sometimes lobed base, 10-20 um diam;
PARAPHYSES apparently scarce and short, soon vanishing, mixed with asci, 2-3
um diam., not enlarged at the apex, septate, often branched in the lower portion,
filled with a few pigments; Ascr irregularly disposed, ephemeral, unitunicate,
non-amyloid, inoperculate, 8-spored, cylindrical, 80-90 x 10-11 um, thin-
walled, rounded at the apex, without an apical apparatus, with a very short,
slightly lobate stalk; ascospores regularly uniseriate, oblate, 11-12.5 x 9.5-11
x (7.5)8.5-10 um, globose to subglobose in frontal view, broadly ellipsoidal in
side view, hyaline to pale yellowish, smooth, thick-walled, uninucleate, with a
de Bary bubble in aqueous media, forming a powdery mass at maturity, when
asci disintegrate; ASEXUAL STATE unknown.
EcoLocy & DIsTRIBUTION — Hundreds of gregarious, superficial specimens
collected from blotting paper at the base of goat (Capra hircus) dung in a damp
chamber culture. April. Rare. Known from one island coastal site in Italy,
possibly cosmopolitan, also known from other herbivore dung, exceptionally
from soil.
SPECIMEN EXAMINED — ITALY, Tuscany, Livorno, Capraia island, 9°49'13"N
43°01'29"E, 50 ma.s.L., 11.IV.2011, leg. L. Levorato (Herbarium F. Doveri 006.12).
Malloch & Cain (1971) erected the monospecific genus Lasiobolidium,
describing L. spirale as a non-stromatic plectomycete with cleistothecial
ascomata, a differentiated peridium with helically coiled appendages, ephemeral
clavate asci, and hyaline, ellipsoidal ascospores. Malloch & Benny (1973) later
described a second species, L. orbiculoides, so called for its strong resemblance
to the monospecific genus Orbicula Cooke.
Lasiobolidium and Orbicula were initially placed (Malloch & Cain 1971,
Malloch & Benny 1973, Benny & Kimbrough 1980) in Eoterfeziaceae G.F.
Atk., now regarded as a plectomycete family with an uncertain position in
Pezizomycotina O.E. Erikss. & Winka (Cannon & Kirk 2007, Kirk et al. 2008,
Lumbsch & Huhndorf 2010). Jeng & Krug (1976) later transferred the genera
to the tribe Theleboleae Korf (= Thelebolaceae) of Pyronemataceae Corda
(Pezizales J. Schrot.), but phylogenetic studies (Hansen et al. 2005, Hansen
PLATE 2. Lasiobolidium orbiculoides (Herbarium FE. Doveri 006.12): A-B, ascomata (arrows) in
culture; C-D, details of exoperidium; E, free ascospores between paraphyses (black arrows) and
an immature ascus (white arrow); FE uniseriate ascospores inside a thin-walled (arrows) 8-spored
ascus. Scale bars: A = 100 um; B = 500 um; C, E= 10 um; D = 15 um; F= 8 um.
Emericella, Lasiobolidium, & Cleistothelebolus spp. (Italy) ... 287
288 ... Doveri, Sarrocco & Vannacci
PLatE 3. Lasiobolidium orbiculoides (Herbarium FE. Doveri 006.12): A-D, details of hairs
and some free ascospores; E, ascospores containing de Bary bubbles in aqueous medium;
F-G, ascospores. Scale bars: A = 10 um; B—D = 15 um; E = 50 um; F-G = 12 um.
Emericella, Lasiobolidium, & Cleistothelebolus spp. (Italy) ... 289
& Pfister 2006, Perry et al. 2007) place them in Pyronemataceae, a family of
apothecioid discomycetes, with a minority of cleistothecial fungi evolved from
an apothecial ancestor (Hansen et al. 2005).
Lasiobolidium orbiculoides is characterised by fast growth in culture,
wavy peridial hairs, cylindrical short-stalked asci, and oblate medium-sized
ascospores. The morphological characteristics of our collection fully match the
protologue, and its ascospores contain a large de Bary bubble when mounted
in aqueous media, a feature also reported by others (Janex-Favre & Locquin-
Linard 1979, Bell 2005).
The main differences between L. orbiculoides, six other recognised Lasiobolidium
species (Kirk et al. 2008), and Orbicula parietina (Schrad.) S. Hughes are
reported in the following key, partly based on Yaguchi et al. (1996) and Guarro
et al. (2012):
Worldwide key to Lasiobolidium and Orbicula
la Asctcylindrical aAscosp ones -Uniseriate ia. sae aga yang Haga eg hae Haas Haale 2
1b. Asci subglobose to claviform. Ascospores biseriate to conglobate, ellipsoidal ..... 4
2a. Ascospores broadly ellipsoidal, 11-12 x 8-9 um (Moustafa & Ezz-Eldin
NSD sou a8 saeas trash Sere san beres fe ste, Meas Soaca aa, AEE auleseTace lest lios Sree Rates L. aegyptiacum
PB ASCOUSDOPES OD EIEG oon enw tsce a cob ximsnee Mapiavttong # wots» Mote bead sattgenst Lane detent dale 3
3a. Cleistothecia usually not flattened at their bases. Peridium thin, appearing
one-layered, covered all over with hairy, wavy or sometimes irregularly coiled
appendages. Asci short- or non-stalked. Ascospores 11-12.5 x 9.5-11 x
8.5-10 um (9.8-14 x 9-12 um; Malloch & Benny 1973). From dung,
rarely from soil and vegetable material ....................044. L. orbiculoides
3b. Cleistothecia often with a flattened base. Peridium thicker, two-layered. Hairy
appendages hyphoid, present at the base only. Asci long-stalked. Ascospores
8-10.5 x 8-10.5 x 7-9 um (7-13 x 8-10 um; Hughes 1951). From several kinds
obduirs omveretabbleaiate nial yt aaa eu wah wi Og ow oes od gn ase O. parietina
4a, Ascospores. longer than TO prince yx, gave 5 we eek 9 ware ongdcye Pccege Pega Vkaeae Baa Een 5
AG AScosporessshOrters 2.720. <0 acetate ee mee wR ae OR, ee A, RR RN Re AN SB RRB, 6
5a. Hairs straight or somewhat flexuous, nodulose, septate, 2.5-3 um diam. Asci
subglobose or broadly clavate. Ascospores slightly warted, 18-24 x 12-18 um
(Yaouchivet dl -1996) SRTOnY SOU. ve. 2a «wad ket dig eh ict he nt sae L. gracile
5b. Hairs helically coiled, non-septate, 5-10.5 um diam. Asci clavate. Ascospores
smooth, 12-17 x 9-12 um (Malloch & Cain 1971). From dung, once from
wesetablest of ir rcs 0. aan nf ake clack atk ee ene ae ow bs L. spirale
6a. Hairs helical, non-septate. Ascospores 8-9 x 5-6 um (Locquin-Linard 1983). From
Poatland Shee prune Fe ks eee oa «lat Mes le oe Eo pa L. helicoideum
Ob Tarts-diflerentisrshapes cr. bbe. ew ke, Sos hey eee e ee A ey eh they eh ahs thee Ae dite hea ag 7.
290 ... Doveri, Sarrocco & Vannacci
7a. Hairs uncinate, not septate. Ascospores 8-10 x 5.5-7 um (Locquin-Linard 1983).
Fromrgazelleccit GAs em oR, Oc el 0A. ti Secdars ule trite tags we te L. recurvatum
7b. Hairs wavy, septate. Ascospores 9-10 x 5.5-7 um (Locquin-Linard 1983). From
camel-aird. other ting ulate dune ioe ie. Me eee Wei meena nie oe L. fallax
Guarro et al. (2012) regard L. aegyptiacum Mustafa & Ezz-Eldin is ‘practically
indistinguishable from L. orbiculoides, but Mustafa & Ezz-Eldin (1989)
originally described L. aegyptiacum with broadly ellipsoidal ascospores, quite
different from the oblate ascospores of the latter.
Although Lasiobolidium is regarded as coprophilous (Kirk et al. 2008) only
L. fallax Locgq.-Lin., L. helicoideum Locq.-Lin., and L. recurvatum Locq.-Lin.
have been isolated solely from dung (Locquin-Linard 1983, Abdullah & Alutby
1999). Lasiobolidium orbiculoides has been recorded from deer (Malloch &
Benny 1973), gazelle (Janex-Favre & Locquin-Linard 1979), donkey (Abdullah
& Alutby 1999), goat (Elshafie 2005), and possibly marsupial dung (Bell 2005)
as well as from cultivated soil (Horie et al. 1992). Moustafa & Sharkas (1982)
proved the cellulolytic activity of L. orbiculoides isolated from soil and grown
in culture on filter paper. Its growth in our culture on blotting paper around
the dung base confirms this activity. Simple or compound cellulose is found in
plants and their derivatives, soil, and dung, so it is understandable that some
cellulolytic fungi can develop on all these substrata without distinction, and it
is possible that all other Lasiobolidium species are cellulolytic.
Cleistothelebolus nipigonensis Malloch & Cain, Can. J. Bot. 49: 851,1971 PL. 4-5
COLONIES ON EMERSON YPSs medium attaining 60 mm diam. at 18 days,
doughy-waxy, pink, with thin and soft concentric rings, which are more patent
and brown shaded in the centre, margin even, reverse deeper pink, with clearly
outlined central rings due to the presence of immersed, brown ascomata (YpSs
medium resulted the best medium, suggesting complex nutrient requirements);
COLONIES ON PDA and V8 juice morphologically similar to colonies on YpSs;
CoLoniges ON MA with radial soft grooves and with a wavy and sublobate
margin, reverse deeper pink with more patent concentric rings and radial
grooves; COLONIES ON NA very pale pink, with an indented margin; ASCOMATA
cleistothecioid, globose, pale to dark brown at maturity, smooth, membranous,
60-80 um diam.
PLATE 4. Cleistothelebolus nipigonensis (DS 26817): A, ascomata on dung in a damp chamber;
B, ascoma in water; C-L, colonies at room temperature 18 days incubation in Petri dishes (C-D, in
Emerson YpSs agar; E-F, in PDA; G-H, in MA; I-J, in V8 agar; K-L, in NA; D, F, H, J, L, reverses).
Scale bars: A = 40 um; B = 30 um; C-F, K-L = 20 mm; G-J = 15 mm.
Emericella, Lasiobolidium, & Cleistothelebolus spp. (Italy) ... 291
292 ... Doveri, Sarrocco & Vannacci
PERIDIUM two-layered, pseudoparenchymatous, the inner layer hyaline,
the outer brown, both a textura epidermoidea of irregularly lobed, thin-walled
cells, 4-10 x 3-8 um, sometimes interspaced with spots of textura angularis;
INTERASCAL TISSUE absent; Ascr not born from croziers, irregularly disposed,
evanescent, unitunicate, inoperculate, non—amyloid, 8-spored, 10-14 x 9.5-10
um, globose or broadly ellipsoidal or even broadly clavate, then short-stipitate;
ASCOSPORES conglobate, 5-5.5 x 3.5-4 um, usually broadly ellipsoidal with
rounded ends, but also broadly ovoidal (Q = 1.37-1.42; Q average = 1.39),
sometimes hardly inequilateral, hyaline to pale yellow, thin-walled, lacking both
germ pores and de Bary bubbles; AsEXxuAL sTaTE filamentous, lacking phialides:
HYPHAE 1-3 um diam., thin-walled, hyaline, wavy, densely septate, splitting at
septa into swollen arthrospore-like cells in older colonies, branched, with long
or even short branches at right angles, sometimes diverticulate, often swollen
at the septa up to 5 um diam., abundantly vacuolate, with vacuoles particularly
observable in Congo red; conrp1A 3.5-7 x 2-3 um, 1-celled, smooth, hyaline,
thin-walled, cylindrical to ellipsoidal, with a truncate pedicel, born from very
small, cylindrical conidiophores along the upper hyphal side or at the apex of
short branches, usually budding.
EcoLocy & DIsTRIBUTION — More than fifty, gregarious or often crowded
and confluent, superficial specimens, collected from canid (possibly fox) dung
in a damp chamber culture. July. Very rare, known from one mountain site
(1300 m a.s.l.) in Italy, and from wolf (Canis lupus) dung of the type locality in
Ontario (Canada).
SPECIMEN EXAMINED — ITALY, VENETO, Vicenza, Roana, Cesuna, 11°27'29"N
45°50'21"E, 6.VII.2008, leg. R. Cerello and G. Robich (DS 26817; GenBank KC492060,
KC492061).
The name Cleistothelebolus means “Thelebolus developing cleistothecia and
emphasises the resemblance between these two coprophilous genera, which
usually share ascoma and ascospore shape, size, and colour. Sharp differences,
however, are noticeable, such as the presence of blastoconidia, production of
true cleistothecia, irregularly disposed ephemeral asci, lack of an interascal
tissue, and mesophily in Cleistothelebolus Malloch & Cain (Malloch & Cain
1971) versus no or a simple asexual state with production of arthrospores,
cleistohymenial apothecioid ascomata, persistent asci, presence of paraphyses,
and psychrophily (de Hoog et al. 2005) in Thelebolus Tode.
Coprotiella Jeng & J.C. Krug (Thelebolaceae) is similar to Cleistothelebolus
but differs in having larger and light coloured ascomata, a peridium ofa textura
PLATE 5 (right). Cleistothelebolus nipigonensis (DS 26817): A, free clustered conidia (white arrow)
and anamorph hyphae with short conidiophores bearing conidia (black arrow); B, detail of the
anamorph with some budding conidia (arrows); C, detail of exoperidial textura epidermoidea;
D, exoperidial pocket of textura angularis (white arrow) beneath some free ascospores and pale
Emericella, Lasiobolidium, & Cleistothelebolus spp. (Italy) ... 293
7 i
PONE Pr VeRy OLA
P we *
© iba LO Sy
“Sars, co No Ne
Z hale alee ee
a
a
a 2
endoperidial cells (black arrow); E, ascospores; F, an empty ascus (arrow), asci with ascospores,
and free ascospores; G, 8-spored asci. Scale bars: A = 25 um; B, F = 15 um; C, G = 10 um; D = 20
um; E = 12 um.
294 ... Doveri, Sarrocco & Vannacci
angularis to globulosa, globose ascospores with a conspicuous de Bary bubble,
and in lacking an asexual state (Jeng & Krug 1976).
We agree with Malloch & Cain (1971) that Cleistothelebolus has a striking
morphological resemblance to Pseudeurotium J.EH. Beyma, the type genus
of Pseudeurotiaceae Malloch & Cain. This family is characterised by non-
stromatic, usually dark cleistothecial ascomata with a pseudoparenchymatous
peridium, (sub)globose, thin-walled, ephemeral asci, lacking apical apparatus
and irregularly arranged in the centrum, absence of interascal tissue, and small
usually smooth one-celled ascospores lacking germ pores. Pseudeurotiaceae,
which have a hyphomycetous, phialidic (Acremonium- or Stilbella-like) or
sympodial (Sporothrix- or Teberdinia-like) asexual state, can be isolated from
wood, soil, or dung (Malloch & Cain 1970, Kirk et al. 2001, Cannon & Kirk
2007, Stchigel & Guarro 2007). Pseudeurotium, with its superficial, dark, globose
ascomata, a peridium with a textura angularis, brown ascospores at maturity,
and a sympodial asexual state, differs from Connersia Malloch, Leuconeurospora
Malloch & Cain, and Pleuroascus Massee & E.S. Salmon. Connersia has
hyaline, ellipsoid-reniform, inaequilateral ascospores (Booth 1961, von Arx
1987) and lacks conidia (Malloch 1974); the psychrophilic, cephalothecoid
Leuconeurospora has ridged to reticulate ascospores (Malloch & Cain 1970, von
Arx et al. 1988), and Pleuroascus has ascomata with helical appendages and
hyaline ascospores (Massee & Salmon 1901, Malloch & Benny 1973, Barrasa &
Moreno 1984). Pseudogymnoascus Raillo, included in Pseudeurotiaceae by Wang
et al. (2006), is easily differentiated from Pseudeurotium by its gymnothecial
ascomata, fusoid ascospores, and a Geomyces Traaen asexual state (Rice &
Currah 2006).
Pseudeurotium ovale, with ovoidal-broadly ellipsoidal ascospores (Stolk
1955), differs from the majority of recognised Pseudeurotium species (Sogonov
et al. 2005) such as P. bakeri C. Booth, P. desertorum Mouch., P. macroglobosum
Matsush., P luteolum Matsush., and P. zonatum J.F.H. Beyma, which have
spherical ascospores (Beyma 1937; Routien 1957; Booth 1961; Mouchacca 1971;
Matsushima 1975, 1996). Pseudeurotium ovale differs also from P. irregulare
Lodha and P. jaipurense Lodha, which have irregularly ovoidal or subglobose
ascospores (Lodha 1971). The ascospore shape and size in P. ovale are similar
to those of Cleistothelebolus nipigonensis, which, however, can be distinguished
by a “lighter colored peridium, less complex ascogenous system, and lack of
phialides” (Malloch & Cain 1971). Based on our collection C. nipigonensis and
numerous reports on P. ovale (Stolk 1955, Booth 1961, Udagawa 1965, Ahmad
& Sultana 1973, Dennis 1981, Eriksson 1992, de Hoog et al. 2000), we will note
some additional differences between these two taxa. Cleistothelebolus ascomata
are smaller (15-80 versus 90-250 um diam.), asci are larger (9-14 x 8-10.5
versus 7-9 x 6.5-8 tm) and often short-stipitate (rather than globose to broadly
Emericella, Lasiobolidium, & Cleistothelebolus spp. (Italy) ... 295
ovoid or ellipsoid), and the peridium is two- instead of one-layered. The nature
of the Cleistothelebolus peridium is particularly noticeable: in our collection it is
formed of a TEXTURA EPIDERMOIDEA, not unmentioned but clearly depicted in
the protologue (Malloch and Cain 1971). A pseudoparenchymatous peridium
was also described in P ovale but depicted as a TEXTURA ANGULARIS (Stolk 1955,
Udagawa 1965, de Hoog et al. 2000). The habitat of the two species also differs:
originally isolated from nematode cysts (Stolk 1955), P ovale has been isolated
from soil (Udagawa 1965), grass, wood chips, and decaying algae (Richardson
2004), but only rarely from dung (Ahmad & Sultana 1973, Eriksson 1992),
whereas the only two C. nipigonensis collections come from wolf (the holotype)
and fox (ours) dung.
Based on morphological (Kimbrough & Korf 1967, Eckblad 1968)
and ultrastructural studies (Brummelen 1998), the Thelebolaceae were
accommodated in Pezizales, but the placement was later questioned by rDNA
sequence data (Momol & Kimbrough 1994, Momol et al. 1996). Thelebolus
and related genera were excluded from Pezizales based on morphological
and ultrastructural (Samuelson & Kimbrough 1978, Kimbrough 1981) and
molecular phylogenetic studies (Landvik et al. 1998, Mori et al. 2000, Gernandt
etal. 2001, Hansen et al. 2005). Molecular analysis of the nuclear SSU rDNA gene
(de Hoog et al. 2005) confirmed the placement of Thelebolus, Caccobius Kimbr.,
and Ascozonus (Renny) E.C. Hansen within the separate family Thelebolaceae
(Thelebolales PF. Cannon), near the leotialean fungi and far from those orders
to which they were assigned previously. Thelebolaceae now are considered allied
with the Leotiomycetes, as stated in a recent study by Hansen & Pfister (2006)
on the molecular systematics of Pezizomycetes O.E. Erikss. & Winka.
Cleistothelebolus was originally placed with Lasiobolidium, Orbicula, and
other cleistothecial fungi, in Eoterfeziaceae (Malloch & Cain 1971, Benny
& Kimbrough 1980), a family with an uncertain position in Ascomycota
morphologically similar to Pseudeurotiaceae but with an unknown asexual
state (Kirk et al. 2001, Cannon & Kirk 2007).
Cleistothelebolus was later transferred (Jeng & Krug 1976) to Pyronemataceae
trib. Theleboleae, which on the whole is the equivalent of the current
Thelebolaceae.
Landvik et al. (1997) suggested that genera other than Thelebolus belonging
to small pezizalean families with uncertain affinities (like Cleistothelebolus)
might be related to Leotiales and noted that further phylogenetic analyses
are needed to explain the relationships of Cleistothelebolus, which Malloch
& Cain (1971) originally regarded as probably evolved from Thelebolaceae.
Lumbsch & Huhndorf (2007, 2010) suggested placing Cleistothelebolus within
Pyronemataceae, but further phylogenetic studies are needed there as well.
Our ITS and LSU sequence analyses support Cleistothelebolus nipigonensis in
Thelebolaceae.
296 ... Doveri, Sarrocco & Vannacci
Acknowledgements
The authors wish to thank Prof. J. Guarro, Prof. Kevin Hyde, and the MycoTaxon
editors for critical revision of the manuscript, Gianni Robich and Lucia Levorato for
providing part of the material studied, and Maurizio Forti for technical support.
Literature cited
Abdullah SK, Alutby SD. 1999. Additions to coprophilous fungi of Iraq V: Cleistothecial
ascomycetes. J. Basrah Res. 18: 81-90.
Ahmad §, Sultana K. 1973. Contributions to the fungi of West Pakistan XVI. Biologia 19: 1-26.
Balajee SA, Houbraken J, Verweij PE, Hong SB, Yaghuchi T, Varga J, Samson RA. 2007. Aspergillus
species identification in the clinical setting. Stud. Mycol. 59: 39-46.
http://dx.doi.org/10.3114/sim.2007.59.05
Barrasa JM, Moreno G. 1984. Hongos coprofilos de Espafia III. An. Jard. Bot. Madrid 41: 3-17.
Bell A. 2005. An illustrated guide to the coprophilous ascomycetes of Australia. CBS Biodiversity
series 3, Utrecht.
Benjamin CR. 1955. Ascocarps of Aspergillus and Penicillium. Mycologia 47: 669-687.
http://dx.doi.org/10.2307/3755578
Benny GL, Kimbrough JW. 1980. A synopsis of the orders and families of plectomycetes with keys
to genera. Mycotaxon 12: 1-91.
Berbee ML, Yoshimura A, Sugiyama J, Taylor JW. 1995. Is Penicillium monophyletic ? An evaluation
of phylogeny in the family Trichocomaceae from 18S, 5.8S and ITS ribosomal DNA sequence
data. Mycologia 87: 210-222. http://dx.doi.org/10.2307/3760907
Berkeley MJ. 1857. Introduction to cryptogamic botany. London.
Beyma FH van. 1937. Beschreibung einiger neuer Pilzarten aus dem “Centraalbureau voor
Schimmelcultures” Baarn (Holland). Zentbl. Bakt. Parasitke, Abt. II, 96: 411.
Booth C. 1961. Studies of Pyrenomycetes: VI. Thielavia, with notes on some allied genera. Mycol.
Pap. 83: 1-15.
Brummelen J van. 1998. Reconsideration of relationships within the Thelebolaceae based on ascus
ultrastructure. Persoonia 16: 425-469.
Bull AT, Carter BLA. 1973. The isolation of tyrosinase from Aspergillus nidulans, its kinetic and
molecular properties, and some consideration of its activity in vivo. J. Gen. Microbiol. 75:
61-73. http://dx.doi.org/10.1099/00221287-75-1-61
Cain RE. 1956. Studies in coprophilous ascomycetes II. Phaeotrichum, a new cleistocarpous genus
in a new family, and its relationships. Can. J. Bot. 34: 675-687.
http://dx.doi.org/10.1139/b56-049
Cannon PF, Kirk PM. 2007. Fungal families of the world. CABI UK, Centre Egham.
Chen GY, Chen ZC. 1991. Thermophilic and thermotolerant fungi in Taiwan (III). Taiwania 36:
211-219.
Christensen M, Raper KB. 1978. Synoptic key to Aspergillus nidulans group species and related
Emericella species. Trans. Br. Mycol. Soc. 71: 177-191.
http://dx.doi.org/10.1016/S0007-1536(78)80097-7
Christensen M, States JS. 1982. Aspergillus nidulans group: Aspergillus navahoensis, and a revised
synoptic key. Mycologia 74: 226-235. http://dx.doi.org/10.2307/3792888
de Hoog GS, Guarro J, Gené J, Figueras MJ. 2000. Atlas of clinical fungi, 2nd edition. Centraalbureau
voor Schimmelcultures, Utrecht.
de Hoog GS, Gottlich E, Platas G, Genilloud O, Leotta G, Brummelen J van. 2005. Evolution,
taxonomy and ecology of the genus Thelebolus in Antarctica. Stud. Mycol. 5: 33-76.
Emericella, Lasiobolidium, & Cleistothelebolus spp. (Italy) ... 297
Dennis RWG. 1981. British Ascomycetes, 2nd edition. J. Cramer, Vaduz.
Domsch KH, Gams W, Anderson T-H. 1993. Compendium of soil fungi, vol. 1. IHW, Verlag.
Doveri F. 2004. Fungi Fimicoli Italici. AMB-Fondazione Studi Micologici, Vicenza.
Doveri F, Sarrocco S, Pecchia S, Forti M, Vannacci G. 2010. Coprinellus mitrinodulisporus, a new
species from chamois dung. Mycotaxon 114: 351-360. http://dx.doi.org/10.5248/114.351
Drakos PE, Nagler A, Or R, Naparstek E, Kapelushnik J, Engelhard D, Rahav G, Neemean D, Slavin
S. 1993. Invasive fungal sinusitis in patients undergoing bone marrow transplantation. Bone
Marr. Transpl. 12: 203-208.
Eckblad FE. 1968. The genera of the operculate Discomycetes. Nytt. Mag. Bot. 15: 1-192.
Eidam E. 1883. Zur Kenntniss der Entwicklung bei den Ascomyceten. Beitr. Biol. Pflan. 3:
377-423.
Elshafie AE. 2005. Coprophilous mycobiota of Oman. Mycotaxon 93: 355-357.
Eriksson OE. 1992 The non-lichenized pyrenomycetes of Sweden. SBT, Lund.
Fennell DI, Raper KB. 1955. New species and varieties of Aspergillus. Mycologia 47: 68-89.
http://dx.doi.org/10.2307/3755757
Gams W, Christensen M, Onions AH, Pitt JI, Samson RA. 1985. Infrageneric taxa of Aspergillus.
55-62, in: RA Samson, JI Pitt (eds). Advances in Penicillium and Aspergillus Systematics.
Plenum Press, New York and London.
Gams W, Hoekstra ES, Aptroot A. 1998. CBS course of mycology, 4th edition. Centraalbureau
Schimmelcultures. Bearn, Delft.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes
- application to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.
http://dx.doi.org/10.1111/j.1365-294X.1993.tb00005.x
Geiser DM, Gueidan C, MiadlikowskaJ, Lutzoni F, KauffF, Hofstetter V, Fraker E, Schoch CL, Tibell L,
Untereiner WA, Aptroot A. 2006. Eurotiomycetes: Eurotiomycetidae and Chaetothyriomycetidae.
Mycologia 98: 1053-1064. http://dx.doi.org/10.3852/mycologia.98.6.1053
Gernandt DS, Platt JL, Stone JK, Spatafora JW, Holst-Jensen A, Hamelin RC, Kohn LM. 2001.
Phylogenetics of Helotiales and Rhytismatales based on partial small subunit nuclear ribosomal
DNA sequences. Mycologia 93: 915-933. http://dx.doi.org/10.2307/3761757
Guarro J, Gené J, Stchigel AM, Figueras MJ. 2012. Atlas of soil ascomycetes. CBS Biodiversity Series
10, Utrecht.
Gugnani HC, Vijayan VK, Tyagil P, Sharmal S, Stchigel AM, Guarro J. 2004. Onychomycosis due to
Emericella quadrilineata. J. Clin. Microbiol. 42: 914-916.
http://dx.doi.org/10.1128/JCM.42.2.914-916.2004
Hanlin RT. 1998. Illustrated genera of ascomycetes, vol. II. APS Press, St. Paul, Minnesota.
Hansen K, Pfister DH. 2006. Systematics of the Pezizomycetes-the operculate discomycetes.
Mycologia 98: 1029-1040. http://dx.doi.org/10.3852/mycologia.98.6.1029
Hansen K, Perry BA, Pfister DH. 2005. Phylogenetic origins of two cleistothecial fungi, Orbicula
parietina and Lasiobolidium orbiculoides, within the operculate discomycetes. Mycologia 97:
1023-1033. http://dx.doi.org/10.3852/mycologia.97.5.1023
Horie Y. 1979. New or interesting Emericella from herbal drugs. Trans. Mycol. Soc. Japan 20:
481-491.
Horie Y, Udagawa S, Abdullah SK. 1992. Taxonomic study on soil-borne ascomycetes from Iraq. J.
Nat. Hist. Mus. Inst. Chiba. 2: 31-36.
Horie Y, Miyaji M, Nishimura K, Franco MF, Coelho KIR. 1996. New and interesting species of
Emericella from Brazilian soil. Mycoscience 37: 137-144.
http://dx.doi.org/10.1007/BF02461338
298 ... Doveri, Sarrocco & Vannacci
Hughes SJ. 1951. Studies on micro-fungi. VIII. Orbicula and Lilliputia. Mycol. Pap. 42: 1-27.
Ismail MA, Abdel-Sater MA, Zohri AA. 1995. A synoptic key to species of the Aspergillus nidulellus—
Emericella assemblage common to Egypt. Mycotaxon 53: 391-405.
Janex-Favre MC, Locquin-Linard M. 1979. Le développement et la structure des ascocarpes du
Lasiobolidium orbiculoides Malloch et Benny (Ascomycete périsporié et plectascé). Rev. Mycol.
43: 373-391.
Jeamjitt O, Manoch L, Visarathanonth N, Chamswarng C, Watling R, Sharples GP, Kijjoa A. 2007.
Coprophilous ascomycetes in Thailand. Mycotaxon 100: 115-136.
Jeng RS, Krug JC. 1976. Coprotiella, a new cleistocarpous genus of the Pyronemataceae with
ascospores possessing de Bary bubbles. Mycotaxon 4: 545-550.
Kimbrough JW. 1981. Cytology, ultrastructure, and taxonomy of Thelebolus (Ascomycetes).
Mycologia 73: 1-27. http://dx.doi.org/10.2307/3759621
Kimbrough JW, Korf RP. 1967. A synopsis of the genera and species of the tribe Theleboleae
(= Pseudoascoboleae). Am. J. Bot. 54: 9-23. http://dx.doi.org/10.2307/2440883
Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Dictionary of the fungi, 9th edition. CAB
International, Wallingford.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi, 10th edition. CAB
International, Wallingford.
Landvik S, Egger KN, Schumacher T. 1997. Towards a subordinal classification of the Pezizales
(Ascomycota): phylogenetic analyses of SSU rDNA sequences. Nord. J. Bot. 17: 403-418.
http://dx.doi.org/10.1111/j.1756-1051.1997.tb00337.x
Landvik S, Kristiansen R, Schumacher T. 1998. Phylogenetic and structural studies in the
Thelebolaceae. Mycoscience 39: 49-56. http://dx.doi.org/10.1007/BF02461578
Locquin-Linard M. 1983. Trois nouvelles especes coprophiles de Lasiobolidium Malloch et Cain
(Ascomycetes, Eoterfeziaceae). Crypt. Mycol. 4: 283-290.
Locquin-Linard M. 1990. Fennellia monodii, nouvelle espece d'ascomycete coprophile de zones
arides africaines. Mycotaxon 39: 9-15.
Lodha BC. 1971. Studies on coprophilous fungi IV. Some cleistothecial Ascomycetes. J. Indian Bot.
Soc. 50: 196-208.
Lumbsch HT, Huhndorf SM. 2007. Outline of Ascomycota - 2007. Myconet 13: 1-58.
Lumbsch HT, Huhndorf SM. 2010. Outline of Ascomycota 2009. Fieldiana 1: 1-42.
Lumley TC, Abbott SP, Currah RS. 2000. Microscopic ascomycetes isolated from rotting wood in
the boreal forest. Mycotaxon 74: 395-414.
Malloch D. 1974. Connersia rilstonii. Fungi Canadenses n° 32. Biosystematics Research Institute,
Agriculture Canada, Ottawa.
Malloch D. 1985. The Trichocomataceae: relationships with other Ascomycetes. 365-382, in
RASamson, JI Pitt (ed.). Advances in Penicillium and Aspergillus systematics. Plenum Press,
New York and London.
Malloch D, Benny GL. 1973. California ascomycetes: four new species and a new record. Mycologia
65: 648-660. http://dx.doi.org/10.2307/3758265
Malloch D, Cain RE. 1970. Five new genera in the new family Pseudeurotiaceae. Can. J. Bot. 48:
1815-1825. http://dx.doi.org/10.1139/b70-267
Malloch D, Cain RF. 1971. Four new genera of cleistothecial ascomycetes with hyaline ascospores.
Can. J. Bot. 48: 1815-1825. http://dx.doi.org/10.1139/b70-267
Malloch D, Cain RF. 1972. The Trichocomataceae: ascomycetes with Aspergillus, Paecilomyces, and
Penicillium imperfect states. Can. J. Bot. 50: 2613-2628. http://dx.doi.org/10.1139/b72-335
Massee G, Salmon ES. 1901. Researches on coprophilous fungi. Ann. Bot. 15: 313-357.
Emericella, Lasiobolidium, & Cleistothelebolus spp. (Italy) ... 299
Matsushima T. 1975. Icones microfungorum a Matsushima lectorum. Kobe, Japan.
Matsushima T. 1996. Matsushima Mycological Memoirs 9. Kobe, Japan.
Matsuzawa T, Tanaka R, Horie Y, Hui Y, Abliz P, Yaguchi T. 2012. The correlation among molecular
phylogenetics, morphological data, and growth temperature of the genus Emericella, and a new
species. Mycoscience 53: 433-44.
Momol EA, Kimbrough JW. 1994. Phylogenetic analysis of selected genera of Pezizales inferred
from 5.8S rDNA, ITS1 and ITS2 sequences. Syst. Ascom. 13: 1-12.
Momol EA, Kimbrough JW, Eriksson OE. 1996. Phylogenetic relationships indicated by 18S rDNA
sequence analysis. Syst. Ascom. 14: 91-100.
Mori Y, Sato Y, Takamatsu S. 2000. Molecular phylogeny and radiation time of Erysiphales
inferred from the nuclear ribosomal DNA _ sequences. Mycoscience 41: 437-447.
http://dx.doi.org/10.1007/BF02461662
Mouchacca J. 1971. Pseudeurotium desertorum sp.nov. Rev. Mycol. 36: 123-127.
Moustafa AF, Ezz-Eldin EK. 1989. Lasiobolidium aegyptiacum, a new ascomycete from Egyptian
soils. Mycol. Res. 92: 376-378. http://dx.doi.org/10.1016/S0953-7562(89)80084-X
Moustafa AF, Sharkas MS. 1982. Fungi associated with cellulose decomposition in the tidal mud-
flats of Kuwait. Mycopath. 78: 185-190. http://dx.doi.org/10.1007/BF00466074
Ogawa H, Yoshimura A, Sugiyama J. 1997. Polyphyletic origins of species of the anamorphic genus
Geosmithia and the relationships of the cleistothecial genera: evidence from 18S, 5S and 28S
rDNA sequence analyses. Mycologia 89: 756-771. http://dx.doi.org/10.2307/3761132
Perry BA, Hansen K, Pfister DH. 2007. A phylogenetic overview of the family Pyronemataceae
(Ascomycota, Pezizales). Mycol. Res. 111: 549-571.
http://dx.doi.org/10.1016/j.mycres.2007.03.014
Piasai O, Manoch L. 2009. Coprophilous ascomycetes from Phu Luang Wildlife Sanctuary and
Khao Yai National Park in Thailand. Kasetsart J. (Nat. Sci.) 43: 34-40.
Pitt JI, Samson RA. 2007. Nomenclatural considerations in naming species of Aspergillus and its
teleomorphs. Stud. Mycol. 59: 67-70. http://dx.doi.org/10.3114/sim.2007.59.08
Raper KB, Fennell DI. 1965. The genus Aspergillus. Baltimore.
Reese ET, Downing MH. 1951. Activity of the Aspergilli on cellulose, cellulose derivatives, and
wool. Mycologia 43: 16-28. http://dx.doi.org/10.2307/3755543
Rice AV, Currah RS. 2006. Two new species of Pseudogymnoascus with Geomyces anamorphs
and their phylogenetic relationship with Gymnostellatospora. Mycologia 98: 307-318.
http://dx.doi.org/10.3852/mycologia.98.2.307
Richardson MJ. 2001. Diversity and occurrence of coprophilous fungi. Mycol. Res. 105: 387-402.
http://dx.doi.org/10.1017/S0953756201003884
Richardson MJ. 2004. Coprophilous fungi from Iceland. Acta Bot. Isl. 14: 77-102.
Richardson MJ, Watling R. 1997. Keys to fungi on dung. British Mycological Society, Stourbridge.
Routien JB. 1957. Fungi isolated from soils. Mycologia 49: 188-196. http://dx.doi.
org/10.2307/3755629
Samson RA, Mouchacca J. 1974. Some _ interesting species of Emericella and
Aspergillus from Egyptian desert soil. Antonie van Leeuwenhoek 40: 121-131.
http://dx.doi.org/10.1007/BF00394559
Samson RA, Hoekstra ES, Frisvad JC, Filtenborg O. 2002. Introduction to food- and airborne fungi,
6th edition. CBS, Utrecht.
Samuelson DA, Kimbrough JW. 1978. Asci of the Pezizales IV: The apical apparatus of Thelebolus.
Bot. Gaz. 139: 346-361. http://dx.doi.org/10.1086/337010
300 ... Doveri, Sarrocco & Vannacci
Sogonov MV, Schroers HJ, Gams W, Dijksterhuis J, Summerbell RC. 2005. The hyphomycete
Teberdinia hygrophila gen.nov., sp.nov. and related anamorphs of Pseudeurotium species.
Mycologia 97: 695-709. http://dx.doi.org/10.3852/mycologia.97.3.695
Stchigel AM, Guarro J. 1997. A new species of Emericella from Indian soil. Mycologia 89: 937-941.
http://dx.doi.org/10.2307/3761114
Stchigel AM, Guarro J. 2007. A reassessment of cleistothecia as a taxonomic character. Mycol. Res.
111: 1100-1115. http://dx.doi.org/10.1016/j.mycres.2007.02.008
Stchigel AM, Cano J, Guarro J. 1999. A new species of Emericella and a rare morphological variant
of E. quadrilineata. Mycol. Res. 103: 1057-1064.
Stolk AC. 1955. The genera Anixiopsis Hansen and Pseudeurotium van Beyma. Antoine van
Leeuwenhoek 21: 65-79. http://dx.doi.org/10.1007/BF02543800
Sugiyama J. 1998. Relatedness, phylogeny, and evolution of the fungi. Mycoscience 39: 487-511.
http://dx.doi.org/10.1007/BF02460912
Sugiyama J, Ohara A, Mikawa T. 1999. Molecular phylogeny of onygenalean fungi based on small
subunit (SSU) and large subunit (LSU) ribosomal DNA sequences. Stud. Mycol. 47: 5-23.
SuhSO, Blackwell M. 1999. Molecular phylogeny of the cleistothecial fungi placedin Cephalothecaceae
and Pseudeurotiaceae. Mycologia 91: 836-848. http://dx.doi.org/10.2307/3761537
Thom C, Raper KB. 1939. The Aspergillus nidulans group. Mycologia 31: 653-669.
http://dx.doi.org/10.2307/3754337
Udagawa S. 1965. Notes on some Japanese Ascomycetes II. Trans. Mycol. Soc. Japan 6: 78-90.
Udagawa S. 1987. Geographical distribution of the pleomorphic plectomycetes in Asia and their
teleomorph-anamorph connections. 9-28, in: J Sugiyama (ed.). Pleomorphic fungi: the diversity
and its taxonomic implications. Kodansha, Tokyo. Elsevier, Amsterdam.
Ulloa M, Hanlin RT. 2000. Illustrated dictionary of mycology. APS Press, St. Paul, Minnesota.
Verweij PE, Varga J, Houbraken J, Rijs AJMM, VerduynLunel FM, Blijlevens NMA, Shea YR, Holland
SM, Warris A, Melchers WJG, Samson RA. 2008. Emericella quadrilineata as cause of invasive
aspergillosis. Emerg. Infect. Dis. 14: 566-572. http://dx.doi.org/10.3201/eid1404.071157
von Arx JA. 1974. The genera of fungi sporulating in pure culture, 2nd edition. J. Cramer, Vaduz.
von Arx JA. 1987. A re-evaluation of the Eurotiales. Persoonia 13: 273-300.
von Arx JA, Figueras MJ, Guarro J. 1988. Sordariaceous ascomycetes without ascospore ejaculation.
Beih. Nova Hedwigia 94: 1-104.
Wang Z, Johnston PR, Takamatsu S, Spatafora JW, Hibbett DS. 2006. Toward a phylogenetic
classification of the Leotiomycetes based on rDNA data. Mycologia 98: 1065-1075.
http://dx.doi.org/10.3852/mycologia.98.6.1065
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. Academic Press, New York.
Wiley BJ, Simmons EG. 1973. New species and a new genus of plectomycetes with Aspergillus
states. Mycologia 65: 934-938. http://dx.doi.org/10.2307/3758529
Yaguchi T, Someya A, Udagawa S. 1996. A new species of Lasiobolidium from Californian soil.
Mycoscience 37: 255-259. http://dx.doi.org/10.1007/BF02461295
Zalar P, Frisvad JC, Gunde-Cimerman N, Varga J, Samson RA. 2008. Four new species
of Emericella from the Mediterranean region of Europe. Mycologia 100: 779-795.
http://dx.doi.org/10.3852/08-078
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.301
Volume 124, pp. 301-308 April-June 2013
Morphological and genetic characterisation of
Beauveria sinensis sp. nov. from China
MING-JUN CHEN’, Bo HUANG", ZENG-ZHI LI’ & JOSEPH W. SPATAFORA ?
"Anhui Provincial Key Laboratory of Microbial Control, Anhui Agricultural University,
West Changjiang Road 130, Hefei, Anhui 230036, China
? Department of Botany and Plant Pathology, Oregon State University,
Corvallis, Oregon 97331, U.S.A
* CORRESPONDENCE TO: [email protected]
ABSTRACT —Beauveria sinensis sp. nov. was isolated from a larva of Geometridae
(Lepidoptera) collected from Tiantangzhai, Anhui province, China. It is characterized by
elongated ellipsoidal to cylindrical conidia, solitary conidiogenous cells that are cylindrical
or with slightly swollen bases, white to pale pink colony in culture, and small mycelial pellets
consisting of curved hyphae. Phylogenetic analyses of translation elongation factor-1 alpha
(TEF), RNA polymerase II largest subunit (RPB1), and RNA polymerase II second largest
subunit (RPB2) sequence data support it as a unique species and sister to B. sungii. It does not,
however, form a monophyletic group with other elongated ellipsoidal to cylindrical conidia-
producing species in Beauveria. Type isolates and holotype are deposited in the Research
Center for Entomogenous Fungi of Anhui Agricultural University (RCEF).
KEY worpDs —Ascomycetes, taxonomy, entomopathogenic fungi
Introduction
Beauveria Vuill. is a globally distributed genus of soil-borne and
entomopathogenic hyphomycetes. It is of particular interest as a model
system for the study of entomopathogenesis and the biocontrol of pest insects
(Rehner & Buckley 2005). Beauveria species are characterized by whorled
conidiophores and dense clusters of sympodial and globose or flask-shaped
short conidiogenous cells with apical denticulate rachi that give rise to one-
celled hyaline conidia. Conidial shape in Beauveria can be globose, ellipsoidal,
cylindrical, or comma-shaped.
Recent phylogenetic analyses of Beauveria inferred from partial sequences
of RNA polymerase II largest subunit (RPB1), RNA polymerase II second
largest subunit (RPB2), translation elongation factor-1 alpha (TEF) genes, and
the Bloc nuclear intergenic region (Bloc) resolved 12 clades, each of which
302 ... Chen &al.
includes one recognized species (Rehner et al. 2011). Since then Zhang et al.
(2013) have described B. lii Sheng L. Zhang & B. Huang from China, a species
with large cylindrical to ellipsoidal conidia. In Beauveria, there are eight species
with ellipsoidal, cylindrical, or comma-shaped conidia: B. amorpha (Hohn.)
Minnis et al., B. asiatica S.A. Rehner & Humber, B. brongniartii (Sacc.) Petch,
B. caledonica Bissett & Widden, B. lii, B. malawiensis S.A. Rehner & Aquino
de Muro, B. sungii S.A. Rehner & Humber, and B. vermiconia de Hoog & V.
Rao (Bissett & Widden 1988, de Hoog & Rao 1975, Rehner et al. 2006, 2011;
Samson & Evans 1982, Shimazu & Hashimota 1988, Zhang et al. (2013). Five
species with globose to subglobose conidia include the type of the genus,
B. bassiana (Bals.-Criv.) Vuill., and B. australis S.A. Rehner & Humber,
B. kipukae S.A. Rehner & Humber, B. pseudobassiana S.A. Rehner & Humber,
and B. varroae S.A. Rehner & Humber (Rehner et al. 2011).
Recently, we isolated a Beauveria with elongated ellipsoidal to cylindrical
conidia from Anhui province, China, infecting Geometridae larvae. ‘The isolate
possessed unique cultural and morphological characteristics and did not form
a monophyletic group with other Beauveria species that produce cylindrical
conidia. We concluded that it represents a new species and describe it here as
B. sinensis.
Materials & methods
Collection of specimens and isolation
An entomogenous specimen (TTZ070716-26) was collected from Tiantang zhai,
Jinzhai county, Anhui province, China, in July 2007. The host was identified as belonging
to Geometridae (Lepidoptera). Strain RCEF3903 was isolated from this collected
specimen on SDAY (1% w/v peptone, 4% w/v dextrose, 0.2% w/v yeast, 1.5% w/v agar)
medium.
Strain identification
Morphological characteristics are based on cultures incubated on quarter-strength
SDAY (SDAY/4) at 25 °C for 14 d. The isolated fungus was examined using classical
mycological techniques based on growth rate as well as macroscopic and microscopic
characteristics. The ex-type culture and a dried-culture holotype specimen has been
deposited in the Research Center for Entomogenous Fungi, Anhui Agriculture
University, Hefei, Anhui, China (RCEF).
DNA extraction, PCR and sequencing
Conidia were inoculated onto SDAY medium overlaid with a disc of sterilized
cellophane. After incubating at 25 °C for approximately 7 days, genomic DNA was
extracted from the mycelia scraped from the cellophane using modified CTAB method
(Gardes & Bruns 1993, Spatafora et al. 1998). The extracted DNA was stored in sterile
distilled water to a final concentration of 1-2 ng ul’ and stored at -20 °C.
To perform phylogenetic analysis of the isolated Beauveria strains (Zhang et al. 2013;
Rehner et al. 2011), the partial sequences of three nuclear loci, including TEF, RPB1,
Beauveria sinensis sp. nov. (China) ... 303
and RPB2, were amplified as described by Rehner & Buckley (2005) and Rehner et al.
(2011). After purifying PCR product using EasyPure quick gel extraction kit (TransGen
Biotech), DNA sequencing was performed at Sangon Company (Shanghai, China) and
the resulting sequences of RCEF3903 were submitted to GenBank.
Sequence alignment and phylogenetic analyses
DNA sequences generated in this study were assembled and edited using Codoncode
Aligner (version 3.6.1). Sequences of TEE, RPB1, and RPB2 from 69 taxa ( 68 Beauveria
isolates and one Isaria tenuipes strain as outgroup ) based on the results of Zhang et
al. (2013), Rehner & Buckley (2005), and Rehner et al. (2006) were downloaded form
GenBank. Multiple sequence alignments for TEF, RPB1, and RPB2 constructed using
Clustal X 1.81 (Thompson et al. 1997) were concatenated into a single file using the
program Mafft (Katoh et al. 2002), and MEGA was used to output a Nexus file for
phylogenetic analysis. The datasets were analysed using both maximum parsimony
(MP) and Bayesian algorithms.
PAUP* 4.0b10 (Swofford 2002) was used to perform maximum parsimony analyses
on the combined dataset of TEF, RPB1, and RPB2 with 1000 replicates of heuristic
search of random sequence additions, branch swapping algorithm by tree bisection-
reconnection (TBR) and MulTrees on. Insertions and deletions were minimized by
direct examination and treated as missing data. Ambiguously aligned sequence regions
were excluded from the data matrix before analysis. Branch support was estimated by
bootstrapping using 1000 replicates with full heuristic search (Felsenstein 1985). Clades
with bootstrap values =70% were considered strongly supported by the data.
Bayesian analyses were conducted with an online version of MrBayes 3.0b4
(Huelsenbeck et al. 2001) through the CIPRIS web portal. 1,000,000 Markov Chain
Monte Carlo (MCMC) generations were performed with four chains (three cold, one
heated) and trees were saved every 100 generations for a total of 100,000 trees. Analyses
were repeated two times and converged close to the same value (the standard deviation
of split frequencies about 0.005) and first 25% of trees were discarded as burn-in. The
consensus tree with the support values for each branch constituting their posterior
probability (=95% were considered as significantly supported by the data) was combined
into a single tree file. Posterior probabilities for branches receiving =95% support are
reported below the respective branches on the single best tree from the Bayesian analysis
(Fic. 1). The bootstrap values for branches supported in =70% are listed above branches
iBiGs
Results
For RCEF3903, PCR amplification yielded TEF, RPB1, and RPB2 amplicons
of 1714 bp, 2866 bp, and 2118 bp. The combined alignment of the above
genes included a total of 6698 characters. After ambiguously aligned positions
excluded, the final alignment comprised 6028 bp (TEF: 1004; RPB1: 2860;
RPB2: 2164), of which 771 were parsimony informative. Maximum parsimony
analysis of 70 taxa dataset yielded 48 equally most-parsimonious trees of 2018
tree length with consistency indices (CI) of 0.7096 and retention indices (RI)
of 0.9091. One of nine equally most-parsimonious trees is shown in Fic. 1 with
304 ... Chen &al.
bootstrap values =70% above the relevant branches. Bayesian analysis resulted
in the same topology as the MP analysis shown in Fie. 1.
The phylogenetic analysis of combined data set well supported RCEF3903
as a sister group to the B. sungii clade containing seven individuals. All isolates
from this clade produced ellipsoidal or oblong conidia in culture (Rehner et
al. 2011), and RCEF3903 differs from these seven isolates in conidial size. The
molecular data and analyses also suggest a wide relationship of RCEF3903 with
B. caledonica group, B. amorpha group, B. malawiensis group and B. lii.
Taxonomy
Beauveria sinensis Ming J. Chen, Z.Z. Li & B. Huang, sp. nov. PLATES 2-7
MycoBank MB 801325
Differs from all other Beauveria species by its pale pink colony and production of
mycelial pellets consisting of curved hyphae.
Type: China, Anhui Province, Jinzhai County, isolated from a larva of Geometridae, July
2007, coll. Mingjun Chen (Holotype, RCEF3903-DAC1; ex-type culture RCEF3903;
GenBank HQ270151, JX524283, JX524284).
EryMo_oey: sinensis, for the country of origin, China.
Colony on SDAY/4 attaining a diameter of 23-31 mm after 14 days at 25 °C,
aerial mycelium white, dense and cottony at first, slowly becoming pale pink and
producing considerable amounts of mycelial pellets on older portions, regular
in the margin, reverse light yellow-brown, odor indistinct. The mycelial pellets
attaining 95.0-150.0 um in diameter after 14 days at 25 °C, and consisting of
curved hyphae. Typical hyphae hyaline, smooth-walled, septate, branched,
1.8-2.5 um diam., curved mycelium a little slighter. Conidiophores arising on
aerial hyphae, similar to aerial hyphae, mostly simple. Conidiogenous cells
mostly borne on conidiophores, occasionally on aerial mycelium, solitary,
flask-shaped to cylindrical, 8.5-20.0 x 1.6-3.0 um, tapering into a long slender
denticulate rachis, geniculate or irregularly bent, 5.0-10.0 x 0.5-0.6 um.
Conidia elongate ellipsoidal to cylindrical, one-celled, hyaline, smooth, 3.0-5.0
x 1.5-2.0 um (L™ = 4.1 um, W™ = 1.7 um, Q™ = 2.4), chlamydospores absent.
Teleomorph not observed.
Discussion
We tried to amplify the Bloc loci of B. sinensis several times with Bloc
primers described by Rehner et al. (2011), but failed to get its PCR production.
The phylogenetic relationship among the Beauveria inferred from three nuclear
loci was mainly consistent with those inferred from four nuclear loci (Rehner
et al. 2011). Furthermore, Rehner et al. (2011) emphasized that each of the four
loci used to reconstruct the phylogeny of Beauveria was effective for accurate
diagnosis of all 12 species based on multiple species-specific phylogenetically
Beauveria sinensis sp. nov. (China) ... 305
RCEF3903 =~ 8B. sinensis
98/100 ARSEF1685
ARSEF5689
| ARSEF7043 ssh
100°TOO"| ARSEF7044 B. sungit
ARSEF7280
-/100 ARSEF7281
ARSEF7279
ARSEF1567
| ARSEF 2567
100/100 | aRSEF8024 B. caledonica
00/100 ARSEF2251
ARSEF7117
ARSEF 4302
ARSEF2922 —» JB. vermiconia
ARSEF1969
ARSEF4149
100/100 ARSEFBS518a B. amorpha
ARSEF7542
100) ABSEF2641
/ ARSEF4384 B. asiatica
ARSEF4850
00/100_ ARSEF4580
ARSEF4598 B. australis
ARSEF4622
99/100 ARSEF617
ARSEF979
00/100 ARSEFJe276
ARSEF985
ARSEF4362
ARSEF4363
ARSEF7516
ARSEF7517
oO ARSEF2271
ARSEF 2831 B. brongniartii
ARSEF7376
| ARSEF6213
| ARSEF6214
100/160 k ARSEF6215
| ARSEF7058
| ARSEF10277
| ARSEF10280
ARSEF7268
ARSEF10278
~ ARSEF300
100/106 ARSEF1811
ARSEF1848
100/100 ARSEF1040 B. bassiana
ARSEF 1478
ARSEF751
ARSEF 1564
saoeret ARSEF7518 i
ARSEF7032 —> B. kipukae
ARSEF2694
Ais ARSEF8257 B. varroae
100/1 ARSEF8259
RCEF5500 ——» 2 Ji
ARSEF1855
ARSEF3216
ARSEF3529
ARSEF4933 4,
100/100 ARSEF3220 B. pseudobassiana
ARSEF3405
ARSEF7242
ARSEF2997
ARSEF6229
100/100 | ARSEF4755 . .
ARSEF7760 B. malawiensis TIsaria tenuipes
ARSEF17613
ARSEF7260
¢ 4 250 changes
Fic. 1. A single tree from the maximum parsimony analysis showing phylogenetic relationships
among species of Beauveria inferred from a combined dataset of TEF, RPB1, and RPB2 data.
Bootstrap values =70% and posterior probabilities =95% are labeled above and below the
appropriate branches.
306 ... Chen & al.
Fics 2-7. Beauveria sinensis. 2. Colony on SDAY/4, showing mycelial pellets. 3. Typical hyphae.
4, Mycelial pellets. 5. Conidiophores, conidiogenous cells, and conidia. 6. Curved hyphae.
7. Phialide and conidia. Scale bars: 2 = 50 mm; 3, 5, 6, 7 = 10 um; 4 = 30 um.
informative nucleotide characters. Therefore, the position of B. sinensis in the
tree from the combined analysis of RPB1, RPB2, and TEF data is reasonable
and reliable.
In culture, B. sinensis is distinguishable by a pale pink colony and production
of mycelial pellets consisting of curved hyphae. Most species of Beauveria are
white to buff on solid media except B. malawiensis, whose colonies become
light pink in older portions. Mycelial pellets consisting of curved hyphae are
formed by B. sinensis isolates but are unknown in any other Beauveria species.
Subcultured for five generations, the isolates still produced significant amounts
of mycelial pellets. The unique stable growth behavior may prove to be of
taxonomic value in Beauveria, with additional isolates discovered.
In Beauveria, there were three species with ellipsoidal conidia (B. brongniartii,
B. asiatica, and B. sungii) and four species with elongate ellipsoidal to cylindrical
conidia similar to the new species (B. amorpha, B. caledonica, B. malawiensis,
and B. lii). TABLE 1 provides a comparative summary of the main characters
of B. sinensis and the other four species with elongate ellipsoidal to cylindrical
conidia. Microscopically, B. sinensis is distinguished by conidiogenous cell
shape from B. amorpha, B. caledonica, and B. malawiensis, all of which produce
whorls of conidiogenous cells with globose to subglobose bases. Beauveria
malawiensis is further distinguished by its short and thick rachis, B. amorpha
Beauveria sinensis sp. nov. (China) ... 307
TABLE 1. Morphological comparisons of Beauveria spp. with
elongated ellipsoidal to cylindrical conidia.
COLONY CONIDIA CONIDIAL SHAPE CONIDIOGENOUS CELL
SPECIES
(um)
B. amorpha White to yellow 3.5-5 x Cylindrical, Whorled, globose to
1.5-2 often flattened subglobose base,
on one side or basal part 2-4 um
slightly curved
B. caledonica White to cream 3-5 x Ellipsoidal to Simple to whorled, swollen
to dull buff 1-1.8 cylindrical base, 2.6-4.2 x 1.6-3.3 um
B. lii White to cream 3.1-10.1x — Ellipsoidal to Solitary, occasionally
1.4-3.6 cylindrical, tight clusters of
occasionally 2-3, base ellipsoidal to
obovoid cylindrical 4.8-9.0 pm
B. malawiensis White to pale 3.7-4.5 x Cylindrical Whorled, base globose to
pink, slightly 1.3-1.9 obpyriform, 2.0-6.6 um
zonate
B. sinensis White to pale 3-5 x Elongate Solitary, slightly or no
pink, curved 1.5-2 ellipsoidal to swollen base, 8.2-20
mycelium in cylindrical x 1.6-3.0 um
mycelial pellet
has a characteristically shaped conidium that is often slightly curved or flattened
on one side (Samson & Evans 1982), and B. lii produces the largest conidia
(Zhang et al. 2013).
In the Bayesian analysis and maximum parsimony of TEF, RPB1, and RPB2
sequence data, Beauveria sinensis was the sister species to B. sungii group
according to Rehner et al. (2011), and was distinct from other Beauveria
species with cylindrical conidia. Thus, the phylogenetic studies also supported
the recognition of Beauveria sinensis as a distinct species.
Acknowledgments
We are grateful to Prof. Z.Q. Liang and Dr. L. Wang for reviewing the manuscript.
We also thank Drs. Shengli Zhang and Yue Cai for their kind help with molecular work.
This work was supported by the Natural Science Foundation of China (No.31200114
and 31070009).
Literature cited
Bissett J, Widden P. 1988. A new species of Beauveria isolated from Scottish moorland soil.
Canadian Journal of Botany 66(2): 361-362. http://dx.doi.org/10.1139/b88-057
de Hoog GS, Rao V. 1975. Some new hyphomycetes. Persoonia 8: 207-212.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution
38: 783-791. http://dx.doi.org/10.2307/2408678
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for Basidiomycetes
application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
http://dx.doi.org/10.1111/j.1365-294X.1993.tb00005.x
Huelsenbeck JP, Ronquist F. 2001. Mr Bayes: Bayesian inference of phylogeny. Bioinformatics 17:
754-755. http://dx.doi.org/10.1093/bioinformatics/17.8.754
308 ... Chen & al.
Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple sequence
alignment based on fast Fourier transform. Nucleic Acids Research 30(14): 3059-3066.
http://dx.doi.org/10.1093/nar/gkf436
Rehner SA, Buckley E. 2005. A Beauveria phylogeny inferred from nuclear ITS and EF1-alpha
sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia
97(1): 84-98. http://dx.doi.org/10.3852/mycologia.97.1.84
Rehner SA, Aquino de Muro M, Bischoff JE 2006. Description and phylogenetic placement of
Beauveria malawiensis sp. nov. (Clavicipitaceae, Hypocreales). Mycotaxon 98: 137-145.
Rehner SA, Minnis AM, Sung G-H, Luangsa-Ard JJ, Devotto L, Humber RA. 2011. Phylogeny
and systematics of the anamorphic, entomopathogenic genus Beauveria. Mycologia 103(5):
1055-1073. http://dx.doi.org/10.3852/10-302
Samson RA, Evans HC. 1982. Two new Beauveria spp. from South America. Journal of Invertebrate
Pathology 39(1): 93-97. http://dx.doi.org/10.1016/0022-2011(82)90162-8
Spatafora JW, Kohlmeyer BV, Kohlmeyer J. 1998. Independent terrestrial origins of the
Halosphaeriales (marine Ascomycota). American Journal of Botany 85: 1569-1580.
http://dx.doi.org/10.2307/2446483
Shimazu M, Mitsuhashi W, Hashimoto H. 1988. Cordyceps brongniartii sp. nov., the teleomorph of
Beauveria brongniartii. Transactions of the Mycological Society of Japan 29: 323-330.
Swofford DL. 2003. PAUP”: phylogenetic analysis using parsimony (*and other methods). Version
4. Sunderland, Massachusetts: Sinauer Associates.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The Clustal X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acid Research 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
Zhang SL, He LM, Chen X, Huang B. 2013 [“2012”]. Beauverialiisp. nov. isolated from Henosepilachna
vigintioctopunctata. Mycotaxon 121: 199-206. http://dx.doi.org/10.54248/121.199
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.309
Volume 124, pp. 309-321 April-June 2013
The lichen genus Fissurina (Graphidaceae) in Vietnam
SANTOSH JOSHI’, THI THUY NGUYEN’, NGUYEN ANH DZUNG?’,
UDENI JAYALAL’, SOON-OK OH!’ & JAE-SEOUN HurR*™*
‘Korean Lichen Research Institute, Sunchon National University, Suncheon-540 742, Korea
Biotechnology Center, Tay Nguyen University, 567 Le Duan, Buon Ma Thuot City, Vietnam
CORRESPONDENCE TO *: [email protected]
ABSTRACT — Nine species of Fissurina from Vietnam are briefly commented on. Fissurina
dumastii, FE dumastioides, F. instabilis, E rubiginosa, and F. undulata are recorded as new
for the Vietnam lichen biota. Characteristic morpho-anatomical and chemical features are
described and summarized in an artificial key to all known taxa of Fissurina from Vietnam.
Key worps — Chu Yang Sin National Park, corticolous, graphidoid, taxonomy
Introduction
Fissurina Fée (Ascomycota: Ostropales) accommodates species with mostly
slit-like lirellae (Staiger 2002; Archer 2009). The diagnostic characters of the
genus includes a pale to yellow-brown to olive green (rarely whitish), mostly
smooth and glossy thallus, fissurine, simple to branched, immersed to prominent
lirellae, uncarbonized or rarely carbonized proper exciple, clear hyaline non-
amyloid hymenium, 1-8-spored asci, and hyaline, oval or narrowly to broadly
ellipsoid, trans-septate to muriform, amyloid to non-amyloid, thick-walled,
mostly halonate ascospores (Archer 2009; Sharma et al. 2012). Fissurina occurs
in the tropics and presently comprises more than 100 species worldwide. Many
species have recently been added to the genus as a consequence of a molecular
and phylogenetic revision of the Graphidaceae (Rivas Plata et al. 2012; Sharma
et al. 2012).
Aptroot & Sparrius (2006) recorded four Fissurina species — F. marginata
(=F elaiocarpa), F. egena, EF incrustans, and E radiata —from different Botanical
Gardens and National Parks of Vietnam. During a recent field excursion to
Chu Yang Sin National Park (Vietnam), several interesting graphidoid taxa
were collected, including five new records of Fissurina for Vietnam: F. dumastii,
F. dumastioides, F. instabilis, F. rubiginosa, and F. undulata. Among the Fissurina
310 ... Joshi & al.
species in the country, F dumastioides and F. rubiginosa produce stictic acid,
whereas the others lack secondary metabolites.
This report is a preliminary attempt to assess the taxonomy of fissurine
lichen species known so far from Vietnam. The synopsis clarifies the current
status of the genus within the country and confirms the high diversity of
graphidoid taxa in tropical rain forests. Diagnostic characters are studied from
the available material. Unfortunately, many of the samples were either immature
or collected in low frequency and many others that could increase the diversity
considerably were sterile. In the following account nine reports of Fissurina are
briefly described and summarized in an artificial key.
Materials & methods
Material deposited in the herbarium of the Korean Lichen Research Institute
(KoLRI) was examined morphologically, anatomically, and chemically. The morphology
of thallus and the ascomata were observed using a SMZ-168 dissecting microscope.
Thin hand-cut sections mounted in tap water, in lactophenol cotton blue, in 5% KOH,
or in Lugol’s solution were observed under a Olympus BX50 compound microscope.
Chemical spot tests and TLC (using solvent system C & A) were performed according
to Orange et al. (2010).
Taxonomic descriptions
Fissurina dumastii Fée, Essai Crypt. Ecorc.: xc, 1825. Piya
Thallus corticolous, epiperidermal, corticate, to ca. 250 um thick, glossy,
smooth, continuous to uneven, greenish grey, pale green or olivaceous to dull
green; cortex 15-30 um thick; algal layer well developed, continuous, 20-35 um
thick; medulla indistinct, mostly endophloeodal, studded with crystals; calcium
oxalate crystals small to moderately large, clustered or scattered; prothallus
distinct, white. Vegetative propagules not seen.
Ascocarps numerous, lirelliform, + conspicuous, immersed to erumpent,
indicated by a thin line between two lips, sometimes slightly open, slightly
raised and paler than the thallus, straight, curved or sinuous, often branched,
0.6-2 x 0.2-0.25 mm, dumastii-type (Staiger 2002); disc slit-like, narrow
to sometimes open in mature apothecia, flesh-colored. Thalline margin
concolorous with the thallus or slightly paler, thin to thick, + incurved or
straight, 10-40 um thick. Proper exciple brownish to dark brown, ca. 15-50
um thick. Epihymenium hyaline, indistinct, with greyish or brownish granules,
<10 um high. Hymenium hyaline, clear, to ca. 50-95 um high, I-. Paraphyses
straight to bent, + interwoven, unbranched, with slightly thickened tips,
moderately to distinctly conglutinated, 1-2 um thick. Subhymenium indistinct
to hyaline, ca. 20 um high. Asci clavate, 8-spored, ca. 65-80 um, I-. Ascospores
uniseriate, hyaline, becoming mottled or brown in late maturity, transversely
Fissurina in Vietnam ... 311
a a ea SS *
PLaTE 1. Fissurina dumastii. A. Habit. B. Ascus with ascospores. C. Ascospores.
Scale bars: A = 2 mm; B = 25 um; C = 10 um.
septate, oblong to ellipsoidal, with + rounded to narrowly rounded to subacute
ends, thick walled, halonate, 15-18 x 4-9 um, with 4 lenticular to + round
locules, I+ blue violet.
CHEMISTRY: K-, PD-, C-; no lichen compound detected in TLC.
DISTRIBUTION & ECOLOGY: This species has a pantropical distribution
and was previously reported from Queensland, New South Wales, Indonesia,
312 ... Joshi & al.
Solomon Islands, and Brazil (Staiger 2002; Archer 2006, 2009). In Vietnam
it was collected from tree trunks of an evergreen forest in the Chu Yang Sin
National Park at an altitude of ca. 600 m.
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Chu Yang Sin National Park,
12°28'04.4"N 108°20'39.0"E, alt. ca. 622 m, on tree trunk, 20 April 2012, Hur, Oh &
Nguyen 120282 (KoLRI).
REMARKS: Fissurina dumastii seems close to E insidiosa C. Knight & Mitt. in
having trans-septate ascospores and thallus lacking chemical substances, but
differs in thallus and apothecial morphology. Fissurina insidiosa has distinct
verrucose-bullate thallus and labiate lirellae. Moreover, the ascospores of
F. dumastii show distinct amyloidity, absent in E insidiosa. Another species
belonging to the dumastii species complex is F. analphabetica Common &
Licking, but it has very small delicate lirellae (0.3-0.5 mm) and comparatively
smaller ascospores of 15 x 7 um (Licking et al. 2011). Fissurina egena also has
roof-like apothecial margins but differs in its muriform ascospores.
Fissurina dumastioides (Fink) Staiger, Biblioth. Lichenol. 85: 161, 2002. PL. 2
Thallus corticolous, epiperidermal, corticate, to ca. 250 um thick, glossy,
smooth, continuous to uneven, green to olive-green; cortex 15-25 um thick;
algal layer well developed, continuous, 20-30 um thick; medulla indistinct,
mostly endophloeodal, studded with crystals; calcium oxalate crystals small to
moderately large, clustered or scattered; prothallus distinct, white. Vegetative
propagules not seen.
Ascocarps numerous, lirelliform, + conspicuous, immersed to erumpent,
indicated by a thin line between two lips, sometimes broadly open, slightly
raised and paler than the thallus, straight, curved or sinuous, often branched,
<5 mm long and 0.2-0.3 mm wide with recurved margins, dumastii-type
(Staiger 2002); disc narrow, open in mature apothecia, greyish to flesh-colored.
Thalline margin concolorous with the thallus or slightly paler, thin to thick, +
incurved or straight, 10-40 um thick. Proper exciple brownish to dark brown,
ca. 15-50 um thick. Epihymenium hyaline, indistinct, with greyish or brownish
granules, <10 um high. Hymenium hyaline, clear, to ca. 50-90 um high, I-.
Paraphyses straight to bent, + interwoven, unbranched, with slightly thickened
tips, moderately to distinctly conglutinated, 1-2 um thick. Subhymenium
indistinct to hyaline, ca. 20 um high. Asci clavate, 8-spored, ca. 60-80 um, I-.
Ascospores uniseriate, hyaline, becoming mottled or brown in late maturity,
transversely septate, oblong to ellipsoidal, with + rounded to narrowly rounded
to subacute ends, thick walled, halonate, 15-20 x 4-9 um, with 4 lenticular to
+ round locules, I+ blue violet.
Fissurina in Vietnam ... 313
PLATE.2. Fissurina dumastioides. Habit. Scale bar: 2 mm
CHEMISTRY: K+ yellow, PD+ yellow-orange, C-; stictic acid detected in
EGE
DISTRIBUTION & ECOLOGY: The species is known to occur in Puerto Rico
and India (Fink 1927, Sharma et al. 2012), and has now been identified from
Vietnam. It was collected from trees in an evergreen tropical forest of the Chu
Yang Sin National Park at an altitude between 700-800 m.
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Chu Yang Sin National Park,
12°27'57.0"N 108°20'34.9"E, alt. ca. 780 m, on tree trunk, 21 April 2012, Hur, Oh &
Nguyen 120267-1 (KoLRI).
REMARKS: Fissurina dumastioides resembles FE dumastii morphologically and
anatomically, but differs in containing stictic acid as thallus compound.
Fissurina egena (Nyl.) Nyl., Sert. Lich. Trop.: 13, 1891
This taxon is morphologically similar to FE cingalina (Nyl.) Staiger, with a
ochre, yellow-grey, yellowish green, slightly rough or warty thallus (Staiger
2002). However, F. egena can be distinguished from E cingalina in its immersed
lirellae with roof-like margins and concealed to slightly exposed disc, its
8-spored asci, its muriform, amyloid, 15-23 x 7-10 um ascospores and the lack
of secondary metabolites.
It has been reported from Singapore, North and South America, and Vietnam
(Staiger 2002; Aptroot & Sparrius 2006).
314 ... Joshi & al.
Fissurina elaiocarpa (A.W. Archer) A.W. Archer, Telopea 11:71, 2005.
= Fissurina marginata Staiger, Bibliotheca Lichenologica 85: 144, 2002.
This species is characterized by a olive green, slightly subtuberculate, glossy
thallus, conspicuous, sessile, straight, curved or sinuous, unbranched, ca. 1-8
x 4 mm ascomata, scarcely open lip, reddish brown proper exciple, 150-200
um high hymenium, 4-5 x 3-4 locular, 21-28 x 13-18 um large, amyloid
ascospores and absence of secondary metabolites (Archer 2009).
Aptroot & Sparrius (2006) reported this species from Vietnam as
F marginata and collected it from a secondary mountain forest of Ba Vi National
Park (Hanoi Province), at a 1200-1300 m altitude. The species has a worldwide
distribution and is found in Africa, Australia, South and Western America, and
Western Indian Ocean (Staiger 2002).
Fissurina incrustans Fée, Essai Crypt. Ecorc.: 60, 1825.
This species is characterized by a beige green, smooth to warty thallus,
elongate to short (1-4 x 0.3-0.4 mm), sinuous, branched ascomata, erumpent
labia, gaping disc, poorly developed proper exciple, usually intermingled with
bark substratum, 8-spored asci, muriform, amyloid ascospores of 15-28 x
7-13 um and absence of secondary compounds. It closely resembles F. egena
in having similar-sized muriform amyloid ascospores and a thallus lacking
chemical compounds, but F. incrustans has erumpent lirellae more similar to
the ones found in Platythecium than the ones found in Fissurina (Staiger 2002;
Licking et al. 2011).
The species has been reported in Vietnam from a secondary mountain forest
in Ba Vi National Park by Aptroot & Sparrius (2006). It is also found in South
America (Staiger 2002).
Fissurina instabilis (Nyl.) Nyl., Sert. Lich. Trop.: 36, 1891. Pig3
Thallus corticolous, epiphloeodal, corticate, <300 um thick, glossy, smooth,
continuous to + verrucose (due to bark texture), non-rimose, green, olive green
to pale green; cortex 35-45 um thick; algal layer well developed, continuous,
densely integrated with crystals, <215 um thick; medulla indistinct, mostly
endophloeodal, integrated with crystals; calcium oxalate crystals small to
moderately large, clustered or scattered; prothallus indistinctly black. Vegetative
propagules not seen.
Ascocarps numerous, lirelliform, inconspicuous, immersed to + erumpent,
indicated by a thin line between two lips (labia), sometimes slightly open,
slightly raised, curved or sinuous, often branched, <10 x 0.6 mm, globulifica-
type (Staiger 2002); labia entire, paler than the thallus; disc slit-like, narrow,
scarcely open in mature apothecia, flesh-colored. Thalline margin concolorous
with the thallus, thick, tincurved or straight, 180-215 um thick. Proper
Fissurina in Vietnam ... 315
PLATE 3. Fissurina instabilis A. Habit. B. Cross section of apothecia. C. Ascospores.
Scale bars: A = 2 mm; B = 100 um; C = 20 um.
exciple well developed, brownish to reddish brown, superficially exposed as a
red-brown lining, ca. 30-55 um thick. Epihymenium hyaline, indistinct, with
greyish or brownish granules, 3-6 um high. Hymenium hyaline, clear, to ca.
75-100 um high, I-. Paraphyses straight to bent, +interwoven, unbranched,
316 ... Joshi & al.
with slightly thickened tips, moderately to distinctly conglutinated, 1-2
um thick. Subhymenium distinct, hyaline, ca. 40-50 um high. Asci clavate,
8-spored, ca. 65-80 um, I-. Ascospores uni- or biseriate, hyaline, muriform,
oblong to ellipsoidal, with + rounded ends, thick walled, 13-20 x 7-11 um,
with 3-4(-5) x 1-2 tround locules, I+ blue violet.
CHEMISTRY: K-, PD-, C-; no lichen compound detected in TLC.
DISTRIBUTION & ECOLOGY: This species has a Pacific distribution (Staiger
2002). In Vietnam it was collected from tree trunks in an evergreen forest of the
Chu Yang Sin National Park at an altitude between 700-800 m.
SPECIMENS EXAMINED: VIETNAM. Dak LAK PROVINCE: Chu Yang Sin National Park,
12°27'57.0"N 108°20'34.9"E, alt. ca. 780 m, on tree trunk, 21 April 2012, Hur, Oh &
Nguyen 120132 (KoLRD); 12°28'12.3"N 108°20'59.9"E, alt. ca. 763 m, on tree trunk, 20
April 2012, Hur, Oh & Nguyen 120087 (KoLRI).
REMARKS: Fissurina instabilis resembles EF confusa Common & Licking and
EF. globulifica (Nyl.) Staiger in having the same thallus morphology, globulifica-
type lirellae, and muriform amyloid ascospores but F. confusa and E globulifica
produce psoromic acid and EF globulifica has smaller globose (10 x 10 um)
ascospores (Liicking et al. 2011).
Fissurina radiata Mont., Annls Sci. Nat., Bot., sér. 2, 18: 280, 1842.
This species differs from other Fissurina species in having aggregated, mostly
radiate ascomata forming a pseudostroma, inconspicuous and gaping labia,
amyloid, 4-locular ascospores of 15 x 7 um, and a thallus lacking secondary
metabolites (Liicking et al. 2011). It is comparable to material described from
Florida as Fissurina aggregatula Common & Liicking (Licking et al. 2011),
which differs in having conspicuous labia and a concealed disc, sparsely
branched aggregated lirellae, and non-amyloid ascospores.
Fissurina radiata has been reported from the Botanical Garden (Bach Thao
Park) in Hanoi City in Vietnam at an altitude between 50-60 m (Aptroot &
Sparrius 2006). It has a distribution in tropical regions of America (Licking et
al. 2011), Malaysia, Singapore, and Taiwan.
Fissurina rubiginosa (Fée) Staiger, Biblioth. Lichenol. 85: 148, 2002. PL. 4
Thallus corticolous, epiphloeodal, corticate, <350 um thick, glossy, smooth,
continuous, non-rimose, green, olive green to pale green; cortex 30-50 um thick;
algal layer well developed, continuous, densely integrated with crystals, <200
um thick; medulla indistinct, mostly endophloeodal, studded with crystals;
calcium oxalate crystals small to moderately large, clustered or scattered;
prothallus indistinctly black. Vegetative propagules not seen.
Ascocarps numerous, scattered, lirelliform, inconspicuous, immersed,
indicated by a thin line, sometimes slightly open, slightly raised and paler than
Fissurina in Vietnam ... 317
el >
4
* in -
2 EE a5 Y
> ee (Seq
aS! .
Pate 4. Fissurina rubiginosa. A. Habit. B. Cross section of apothecia. C. Ascospores.
Scale bars: A = 2 mm; B = 100 um; C = 30 um.
the thallus, straight, curved or sinuous, often branched, <2 x 0.25 mm, dumastii-
type; disc slit-like, narrow, scarcely open in mature apothecia, flesh-colored.
Thalline margin concolorous with thallus, thick, +incurved or straight, 75-150
um thick. Proper exciple well developed, pale to reddish brown, intermingled
with bark cells, <75 um thick. Epihymenium hyaline, indistinct, with greyish
318 ... Joshi & al.
or brownish granules, 10-15 um high. Hymenium hyaline, clear, <120-150
um high, I-. Paraphyses straight to bent, tinterwoven, unbranched, with
slightly thickened tips, moderately to distinctly conglutinated, 1-2 um thick.
Subhymenium indistinct, hyaline, ca. 25-30 um high. Asci clavate, 8-spored,
ca. 65-80 um, I-. Ascospores uni- or biseriate, hyaline, muriform, oblong to
ellipsoidal, with trounded ends, thick walled, 20-27 x 10-12 um, with 6-8 x
2-3 + round locules, I-.
CHEMIstTRY: K-, PD-, C-; no lichen compound detected in TLC.
DISTRIBUTION & ECOLOGY: The species is found in French Guiana, USA
and India (Sharma et al. 2012), but is now also reported from Vietnam where it
was and collected from tree trunks in an evergreen forest of the Chu Yang Sin
National Park at an altitude between 700-800 m.
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Chu Yang Sin National Park,
12°28'12.3"N 108°20'59.9"E, alt. ca. 763 m, on tree trunk, 20 April 2012, Hur, Oh &
Nguyen 120246 (KoLRI).
REMARKS: This species is close to F elaiocarpa. Their thallus morphology is
similar and they both have muriform ascospores, although the spores are
comparatively larger (18-32 x 13-19 um) and I+ blue in F elaiocarpa. Another
closely related taxon, Fissurina aff. elaiocarpa, resembles F. rubiginosa in
having muriform, I- ascospores of similar size (25 x 15 um), but differs in
labiate ascomata and verrucose thallus. The description above does not agree
with that of E rubiginosa provided by Sharma et al. (2012), which describes
a brown, cracked and rough thallus and much smaller lirellae (0.4-0.6 mm).
However, the investigated sample shares some main characteristics with
F. rubiginosa, such as dumastii-type lirellae and non-amyloid ascospores.
Because of insufficient material, we provisionally identify our specimen from
Vietnam as F rubiginosa.
Fissurina undulata (Mill. Arg.) M. Nakan. & Kashiw., Bull. natn. Sci. Mus.,
Tokyo, B 29: 87, 2003. PL. 5
Thallus corticolous, epiphloeodal, corticate, to ca. 400 um thick, glossy,
verrucose to smooth, continuous, non-rimose or slightly cracked due to bark
texture, green, olive green to pale green or dull green; cortex 25-45 um thick;
algal layer well developed, continuous, densely integrated with crystals, <100
um thick; calcium oxalate crystals small to moderately large, clustered or
scattered; medulla indistinct, mostly endophloeodal, studded with crystals;
prothallus not seen. Vegetative propagules not seen.
Ascocarps numerous, scattered, lirelliform, inconspicuous, immersed,
indicated by a thin line, sometimes slightly open, slightly raised and paler
than the thallus, straight, curved or sinuous, often branched, <2 x 0.3 mm,
dumastii-type; disc slit-like, narrow, scarcely open in mature apothecia, flesh-
Fissurina in Vietnam ... 319
PiaTE 5. Fissurina undulata. A. Habit. B. Cross section of apothecia. C. Ascospores.
Scale bars: A = 2 mm; B = 200 um; C = 30 um.
colored. Thalline margin concolorous with thallus, thick, +incurved or straight,
50-100 um thick. Proper exciple poorly to well developed in mature fruits,
hyaline to pale, reddish brown when intermingled with bark cells, <30 um
thick. Epihymenium hyaline, indistinct, with greyish or brownish granules.
Hymenium hyaline, clear, to ca. 60-100 um high, I-. Paraphyses straight to
bent, +interwoven, unbranched, with slightly thickened tips, moderately to
320 ... Joshi & al.
distinctly conglutinated, 1-2 um thick. Subhymenium indistinct, hyaline, ca.
20-30 um high. Asci clavate, 8-spored, ca. 70-95 x 12-15 um, I-. Ascospores
uni- or biseriate, hyaline, muriform, oblong to ellipsoidal, with trounded ends,
thick walled, gelatinous sheath present, 22-32(-35) x 10-13 um, with 6-12 x
2-4 locules, I-; locules tround to angular.
CHEMIstTRY: K-, PD-, C-; no lichen compounds detected in TLC.
DISTRIBUTION & ECOLOGY: The species is found in Japan (Nakanishi 1966),
but is now also reported from Vietnam where it was collected from tree trunks
in an evergreen forest in Chu Yang Sin National Park at an altitude between
700-800 m.
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Chu Yang Sin National Park,
12°28'12.3"N 108°20'59.9"E, alt. ca. 763 m, on tree trunk, 20 April 2012, Hur, Oh &
Nguyen 120247 (KoLRI).
REMARKS: The above description is based on a specimen with mostly immature
fruits, which appear more similar to E undulata than to F. inabensis (Vain.)
M. Nakan. & Kashiw. (erroneously cited as F fujisanensis (Kashiw. & M.
Nakan.) M. Nakan. & Kashiw. in Nakanishi et al. 2003). Both FE undulata and
F. inabensis produce stictic acid and have similar-sized ascospores (21-30 x
10-14 um for E inabensis). However, a thin thallus, a well developed proper
exciple, crenate labia, a medulla with gonidia and 2-3-celled ascospores
clearly separate FE inabensis from F undulata (Nakanishi 1966). Although the
descriptions of F. undulata by Nakanishi (1966), Nakanishi et al. (2003), and
Sharma et al. (2012) differ in the number of ascospores per ascus (8-spored asci
sensu Nakanishi vs. 1-spored asci sensu Sharma), our material agrees well with
a species with 8-spored asci. Moreover, the ascospore size (30-38 x 15-18 um)
of FE. undulata is in conflict with the ascospore size of species with 1-spored asci.
A further revision of E undulata would be necessary, as it seems closely related
to EF inabensis, particularly in immature stages (Nakanishi 1966). Pending some
more collections, the Vietnamese material is placed in F undulata.
Key to Fissurina species recorded from Vietnam
1A VPA ES COMEATINITIG SECU ACIG Ys as nets Sanaa ntiy Shane NOY es nae iced ees co Peta ash Rena dat 2,
Ib. Thallus lacking secondary metabolites. on... seu .eic state alan ie ples ole od ee On ae :
2a. Ascospores trahsversely septate § 0... saw Hee eee eee cea F. dumastioides
20, ASCOSPORES TIUTTOTI, 9 kM nie Uh taalg oh eee em bile ORR OR ee Oh ces F. rubiginosa
BdwASCOSpOTes transversely: Septaie: ety Lote Maile pele anita da tal denial eos abulkhi Ne weet Be abate 4
SRA SCOS POET ORTISA 2.2, sundae tte, Wide anaes eekly Weg ht AE Ga Ae ER, oer 5
4a. Lirellae mostly aggregated, radiate, forming a pseudostroma ........... F, radiata
4b. Lirellae disperse, solitary, branched, non-radiate..................... F, dumastii
5a. Ascospores non-amyloid, 22-32(-35) x 10-13 um................0. F. undulata
SDs NSCOSPOTES CHSUITICE Vea TTI ON Ge ol bay la ela clits tan dle a la dle glial eabandl a eacch eo Seater 6
Fissurina in Vietnam ... 321
6a. Lirellae immersed, fissurine, roof like margins,
ASCOSPOLES DADS F IOs ITN rhe stey WAS00h Achy eins heh er tech etek ples hp F egena
6b. Lirellae immersed to erumpent or prominent, labiate......................202. 7
7a. Lirellae immersed to + erumpent, ascospores 13-20 x 7-ll um ...... F. instabilis
7D; Lireliae. erunip enitiato:proindn Cite Ai). 0 0! occleedaind ore taind adler -« geen ne cesne Meee a Mae 8
8a. Thallus + smooth, proper exciple poorly developed,
ascospores 5 =28 9% FT 5: Wins ou chy a6: sdeg Sp tea yep tee keg tee hg F. incrustans
8b. Thallus verrucose, proper exciple well developed,
ASCOSPOTES ALS oT S= ISNT ine es ves Meaty Noahs oat, Headly ve F. elaiocarpa
Acknowledgments
This work was supported by a grant from the National Research Foundation of Korea
(#2011-0031494) and the Korea National Research Resource Center Program. Authors
are grateful to Dr. Robert Licking, Dr. Laszlé L6kGs, and Dr. Cecile Gueidan for their
valuable comments on the manuscript. Santosh Joshi also thanks Dr André Aptroot for
providing the lichen checklist of Vietnam, and helpful suggestions.
Literature cited
Aptroot A, Sparrius LB. 2006. Addition to the lichen flora of Vietnam, with an annotated checklist
and bibliography. Bryologist 109(3): 358-371.
http://dx.doi.org/10.1639/0007-2745(2006)109[358:ATTLFO]2.0.CO;2
Archer AW. 2006. The lichen family Graphidaceae in Australia. Bibliotheca Lichenologica 94:
1-191.Archer AW. 2009. Graphidaceae. 84-194, in: PM McCarthy, B Kuchlmayr (eds). Flora of
Australia, Vol. 57 (Lichens 5). Canberra & Melbourne: ABRS/CSIRO.
Archer AW. 2009. Graphidaceae. 84-194, in: PM McCarthy, B Kuchlmayr (eds). Flora of Australia,
Vol. 57 (Lichens 5). Canberra & Melbourne: ABRS/CSIRO.
Fink B.1927. New species of lichens from Porto Rico, I. Graphidaceae. Mycologia 19(4): 206-221.
http://dx.doi.org/10.2307/3753982
Liicking R, Seavey F. Common RS, Beeching SQ, Breuss O, Buck WR, Crane L, Hodges M,
Hodkinson BP, Lay E, et al. 2011. The lichens of Fakahatchee Strand Preserve State Park,
Florida: Proceedings from the 18th Tuckerman workshop. Bulletin of the Florida Museum of
Natural History 49(4):127-186.
Nakanishi M. 1966. Taxonomical studies on the family Graphidaceae of Japan. Journal of Science of
the Hiroshima University, Series B, 11(2): 51-126.
Nakanishi M, Kashiwadani H, Moon KH. 2003. Taxonomical notes on Japanese Graphidaceae
(Ascomycotina), including some new combinations. Bull. natn. Sci. Mus., Tokyo, B 29(2):
83-90.
Orange A, James PW, White FJ. 2010. Microchemical methods for the identification of lichens.
British Lichen Society, London.
Rivas Plata E, Licking R, Lumbsch TH. 2012. A new classification of the family Graphidaceae
(Ascomycota: Lecanoromycetes: Ostropales). Fungal Diversity 52: 107-121. http://dx.doi.
org/10.1007/s132225-011-0135-8
Sharma BO, Khadilkar P, Makhija U. 2012. New species and new combinations in the
lichen genera Fissurina and Hemithecium from India. Lichenologist 44(3): 339-362.
http://dx.doi.org/10.1017/S0024282911000752
Staiger B. 2002. Die Flechtenfamilie Graphidaceae. Studien in Richtung einer natiirlicheren
Gliederung. Bibliotheca Lichenologica 85: 1-526.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.323
Volume 124, pp. 323-332 April-June 2013
Studies of North American macrofungi, 1.
Validation of Lactarius rubidus comb. nov.
and Leccinellum quercophilum sp. nov.
MICHAEL Kuo,’* ANDREW S. METHVEN,”
ANDREW M. MINNIS,? & Roy E. HALLING4
‘Department of English & *Department of Biological Sciences, Eastern Illinois University,
600 Lincoln Avenue, Charleston IL 61920 USA
>Center for Forest Mycology Research, Northern Research Station, USDA-U.S. Forest Service,
One Gifford Pinchot Dr., Madison WI 53726 USA
‘Institute of Systematic Botany, The New York Botanical Garden,
2900 Southern Boulevard, Bronx NY 10458 USA
* CORRESPONDENCE TO: [email protected]
ABSTRACT — Two mycorrhizal taxa are described: Lactarius rubidus from the west coast
and Leccinellum quercophilum from eastern North America. Lactarius rubidus is a new
combination for Lactarius fragilis var. rubidus, here validated after a previous invalid
publication. Leccinellum quercophilum is a new species. Detailed macro- and microscopic
descriptions, ITS and LSU sequences, illustrations of microscopic features, and plates are
presented for each species; a type study of Lactarius fragilis var. rubidus is also provided.
Key worps — Boletaceae, Boletales, Russulaceae, Russulales, taxonomy
Introduction
The North American macrofungi known as Lactarius fragilis var. rubidus and
Leccinum griseum (also sometimes known as Leccinum carpini) are commonly
collected fungi for which currently applied names are unsatisfactory. The west
coast fungus Lactarius fragilis var. rubidus, which differs substantially from the
eastern North American type variety in morphology, ecology, and geographic
distribution, merits taxonomic rank as a species. Leccinum griseum is a
European fungus clearly distinct from the North American entity frequently
bearing its name in herbaria. Here we describe Leccinellum quercophilum, a
North American bolete sometimes identified as Leccinum griseum, as a new
species and validate the combination Lactarius rubidus to apply to Lactarius
fragilis var. rubidus.
324 ... Kuo & al.
Materials & methods
Both fresh basidiomes and herbarium specimens were studied. Colors were recorded
and codified following Kornerup & Wanscher (1967), or the Online Auction Color
Chart (www.onlineauctioncolorchart.com — abbreviated “OAC” herein). Microscopic
features were studied using hand sections of fresh material, and of dried specimens
rehydrated in water after immersion in 90% alcohol. Sections were mounted in 2% KOH
and Melzer’s reagent, and viewed using an Olympus BX51 microscope. Specimens are
deposited in herbaria and cited according to Thiers (2012).
DNA from each taxon was extracted from small hymenium-bearing pieces of
dried basidiocarp following the methods of Lindner & Banik (2009). Protocols for ITS
amplification, sequencing, sequence editing, and other related procedures followed
Lorch et al. (2013) with the following modifications: denaturing for 40 s, annealing at 53
°C for 40 s, and extension for 90 s in the 30 PCR cycles. LSU sequences were obtained
with the same protocols using the primers LROR (Moncalvo et al. 2000) and either LR5
or LR7 (Vilgalys & Hester 1990). Newly generated DNA sequences were deposited in
GenBank and compared with available sequences via GenBank BLAST searches.
Taxonomy
Lactarius rubidus (Hesler & A.H. Sm.) Methven, comb. & stat. nov. PLATE 1
MycoBank MB803100
= Lactarius fragilis var. rubidus Hesler & A.H. Sm., N. Amer. Sp. Lactarius: 505. 1979.
“Lactarius rubidus” Methven, Agaricales (Gilled Fungi) of California,
10, I: 67. 1997, nom. inval. [provisional name].
PiLEus 2-8 cm broad, convex to plane, disc shallowly depressed, occasionally
umbonate; margin incurved to decurved, glabrous; surface glabrous, dry to
moist, rugose to rugulose, azonate, light brown (6D7-5) to brown (7D8-5), or
reddish brown (8D8-6), negative with the application of 15% KOH; context up
to 5 mm thick at the disc, light orange (5A4-2), unstaining on exposure; odor of
maple syrup or fenugreek when dried; taste not distinctive. LAMELLAE adnate
to subdecurrent, close to distant, narrow, rarely forked, light orange (5A4-2,
6A4-3), not marginate, unstaining where cut. STIPE 2-7 cm x 4-10(-15) mm,
terete, equal; surface glabrous, dry, not scrobiculate, brownish orange (6C7-5)
to light brown (7D7-5); white to light orange tomentum at the base; context
hollow, concolorous with the pileal context, unstaining on exposure. LATEX
whey-like, not copious, unstaining, unchanging, taste not distinctive.
BASIDIOSPORES white to pale yellow (4A3-2) in mass, 6-8(-8.5) x 6-7.5
um, globose to subglobose; amyloid ornamentation a broken to partial or
nearly complete reticulum 0.5-1 um high. Basip1a 35-55 x 7.5-12.5 um,
tetrasterigmate. CHEILOCYSTIDIA 25-35 x 6-9 um, clavate. MACROCYSTIDIA
not observed. PILEIPELLIs an epithelium composed of clavate to vesiculose cells
in short chains, tangled in age, dry. PILEUS TRAMA heteromerous, sphaerocysts
in rosettes, lactiferous hyphae inconspicuous. STIPITIPELLIS a simple cutis with
Lactarius rubidus validated & Leccinellum quercophilum sp. nov. ... 325
PiaTE 1: Lactarius rubidus, M. Kuo 01131106 (NY). Basidiocarps (top), basidiospores (middle),
and pileipellis (bottom). Scale bars = 10 um. [For additional illustrations see Hesler & Smith (1979:
Fig. 247, basidiospores) and Methven (1997: Pl. 2, basidiocarps).]
scattered projecting hyphal tips, stipe cortex heteromerous, sphaerocysts in
rosettes.
ECOLOGY & DISTRIBUTION — Scattered, gregarious, or caespitose in duff,
in coastal coniferous-deciduous forests in apparent association with Quercus
agrifolia, Notholithocarpus densiflorus, and Pseudotsuga menziesii. Common.
September through February. California, Oregon, and Washington.
COLLECTIONS EXAMINED — UNITED STATES. CALIFORNIA: MARIN County, 10
Dec 1982, ASM 2261 (EIU); 19 Dec 1984, ASM 3523 (EIU); 27 Dec 1984, ASM 3632
326 ... Kuo & al.
(EIU). MENDOCINO County, 30 Apr 1983, CM Bern, ASM 2456 (EIU); 13 Dec 1990,
ASM 6523 (EIU). SAN MaTEO County, 17 Dec 1984, ASM 3600 (EIU); 12 Jan 1985, H
Saylor 2297 (EIU); 13 Jan 2005, M Kuo 01130522 (NY); 13 Jan 2011, M Kuo 01131106
(NY, GenBank ITS KC691205, LSU KC691206). SonoMA Counry, 02 Feb 2003, M Kuo
02200309 (NY). OREGON: POLK County, 14 Nov 1970, AH Smith 79939 (MICH 23242,
paratype); 14 Nov 1970, AH Smith 79942 (MICH 11133, holotype).
ComMENTs — Lactarius rubidus is characterized by the reddish brown, azonate,
dry to moist pileus, whey-like latex, the maple syrup or fenugreek odor when
dried, and globose basidiospores with a broken to partial or nearly complete
amyloid reticulum. Lactarius fragilis (Burl.) Hesler & A.H. Sm. var. fragilis,
known from eastern North America, differs in having a snuff brown to burnt
umber pileus, subdistant yellowish lamellae, and globose basidiospores with
heavier deposits of amyloid ornamentation that form a partial to complete
reticulum. Lactarius rubidus has frequently been misidentified as L. camphoratus
(Bull.) Fr. However, L. camphoratus is a European and eastern North American
species featuring a red brown pileus, close to crowded pale pinkish cinnamon
lamellae, milk-white latex, and broadly ellipsoid basidiospores with amyloid
ornamentation of isolated spines and nodulose ridges forming at most a
broken reticulum. Lactarius rubidus is a popular edible commonly called the
“candy cap” by collectors (Kuo 2007). Wood et al. (2012) recently determined
quabalactone III to be the source of the maple syrup odor of L. rubidus.
ITS sequence comparisons via GenBank BLAST searches indicate L. rubidus
is not conspecific with European and North American L. camphoratus. Lactarius
cf. rubidus (GenBank DQ822820.1 from a basidiocarp and GU180303.1
from a Pinus muricata root tip; Peay et al. 2007) and unidentified samples
GenBank AF323116.1 from a Pinus muricata root (Wurzberger et al. 2001)
and DQ273391.1 from a Notholithocarpus densiflorus root (Bergemann &
Garbelotto 2006), all from California, appear to represent L. rubidus at 99%
sequence identity.
In Methven (1997: 67), the combination “Lactarius rubidus (Hesler & A.H.
Sm.) Methven” appeared with a citation of its forthcoming publication as
“Mycotaxon (in press). 1998” but was not validly published since it was merely
proposed in anticipation of future acceptance of this taxon at the species rank
(ICN Art. 36.1, McNeill et al. 2012). The subsequent Mycotaxon publication
did not occur, and the combination Lactarius rubidus has not been validly
published elsewhere since. A record for “Lactarius rubidus Arora 1991” appears
in Index Fungorum (www.indexfungorum.org) but no further information is
provided; a similar record appears in the MycoBank database (www.mycobank.
org), again without any supporting publication information. David Arora’s
(1991) field guide, All That the Rain Promises and More: a Hip Pocket Guide to
Western Mushrooms is the only plausible basis we have been able to discover for
these website entries. Since Arora treats the species as “Lactarius fragilis, listing
Lactarius rubidus validated & Leccinellum quercophilum sp. nov. ... 327
“other names” as “Lactarius fragilis var. rubidus, L. rubidus, without citing
taxon authorities or providing full and direct references to any of the names as
required for publishing a new combination, his book cannot be considered a
valid publication of Lactarius rubidus. We validate the combination here.
STUDY OF THE HoLotype — The holotype of Lactarius fragilis var. rubidus
is held in the University of Michigan Herbarium (MICH 11133) and was
collected by A.H. Smith (79942) on “rotten wood” in the Van Duzer Corridor,
Polk County, OR; it consists of several well preserved basidiomes with a strong
odor of fenugreek. BASIDIOSPORES 6.5-8.5 x 6-7.5 um, globose to subglobose,
ornamentation a partial to more or less complete reticulum 0.5-1 um high,
with scattered free ends and rare isolated elements, plage conspicuous and
lacking amyloid debris. Bastp1a 35-50 x 7.5-12.5 um, clavate, tetrasterigmate.
CHEILOCYSTIDIA not clearly differentiated. MACROCysTIDIA not observed.
PILEIPELLIS an epithelium composed of vesiculose or irregularly shaped
inflated cells in short chains, at times aggregated into mounds, especially in age.
PiLEus TRAMA heteromerous. STIPITIPELLIS a dry, simple cutis of interwoven
hyphae with scattered, projecting, pyriform to subfusiform hyphal tips 25-35
x 7.5-15 um.
Leccinellum quercophilum M. Kuo, sp. nov. PLATE 2
MycoBank MB802407
Differs from Leccinum griseum by its bluish green staining on the pileus and stipe, its
creamy whitish tubes, its context staining gray when sliced, and its association with
Quercus in eastern North America.
TyPeE: United States, Illinois, Coles County, Charleston, under Quercus alba on a lawn,
12 July 2008, coll. M Kuo 07120801 (Holotype, NY; GenBank ITS KC691207, LSU
KC691208).
ErymMo oey: from a combination of the Latin Quercus = oak, and the Greek otAoc =
friend; “oak-loving”
PILEus 3-9 cm broad; convex; dry; glabrous; dull orangish brown (OAC 749) to
medium yellow-brown (OAC 707, 715); rugulose-pitted when young, becoming
conspicuously areolate; without an overlapping sterile margin; discoloring bluish
green marginally with age; surface negative with the application of ammonia
or FeSO,, negative to yellowish with 15% KOH. HyMENopPHORE tubulose;
depressed at the stipe. TUBES 1-2 cm deep, creamy whitish (contrasting with
the pore surface), discoloring slowly blackish when sliced; pores 1-3 per mm at
maturity, round becoming angular with maturity, whitish or medium grayish
brown (OAC 736) when young, becoming yellowish brown to brownish;
discoloring greenish in places with age; bruising slowly dark brown, with or
without a bluish stage. StrpE 5-9 cm x 8-20 mm; equal, or tapered slightly to
apex, or slightly ventricose; dry; whitish underneath fine, tiny scabers that are
whitish apically and brown below; the scabers arranged in vague longitudinal
328 ... Kuo & al.
lines, darkening somewhat with age but not blackening; bruising or staining
greenish to bluish basally; basal mycelium whitish. CONTEXT whitish, staining
grayish to gray within 15-30 minutes of being sliced, with or without a faintly
pinkish stage; sometimes staining bluish in the stem base when sliced; pinkish
to negative with the application of ammonia, negative to greenish with FeSO,,
gray to greenish gray with 15% KOH. Opor AND TASTE not distinctive.
BASIDIOSPORES 15-18(-28) x 5-7.5 um; fusiform; ochraceous in 2%
KOH; inamyloid; aseptate; smooth. Basip1a 25-30 x 9-12 um; clavate;
tetrasterigmate. PLEUROCYSTIDIA 25-40 x 8-12 um; occasional or frequent;
fusoid-ventricose; thin-walled; smooth; hyaline to ochraceous or golden in 2%
KOH. CHEILocystTipia 35-50 x 5-10 um; fusoid-ventricose to mucronate,
subclavate, or irregular; thin-walled; smooth or roughened; ochraceous to golden
in 2% KOH. CauLocystTIDIA 30-50 x 10-15 um; mostly fusoid-ventricose but
occasionally ventricose-rostrate, or lageniform; apices occasionally mucronate;
thin-walled; smooth; hyaline to ochraceous in 2% KOH. PILEIPELLIS a
trichodermium of septate hyphae; hyaline to ochraceous or brownish in 2%
KOH; terminal elements subglobose to clavate or irregular, 25-50 um wide.
ECOLOGY & DISTRIBUTION — Scattered to gregarious under oaks; appearing
in hardwood forests and in urban settings (lawns, cemeteries, etc.); summer
and early fall; currently known from Illinois and Michigan.
ADDITIONAL COLLECTIONS EXAMINED — UNITED STATES. ILiinots: Cotes County,
20 Jun 2010, M Kuo 06201003 (NY). MicHIGAN: LIVINGSTON County, Aug 1972, AH
Smith 84011 (MICH 35770, as Leccinum griseum); WASHTENAW COUNTY, 16 Sep 1940,
AH Smith 15410 (MICH 35774, as Leccinum griseum).
ComMENts — Leccinellum quercophilum can be identified by its association
with oaks, the dull brown or yellowish brown rugulose-pitted cap that becomes
conspicuously areolate, the fine brown scabers, the green and blue staining,
and the trichoderm pileipellis. It has been thought to represent the European
species Leccinum griseum (Quél.) Singer (=Gyroporus griseus Quél.) by various
North American authors, including Smith & Thiers (1971: 214). However, the
name Leccinum griseum is problematic (Lannoy & Estades 1995; den Bakker
& Noordeloos 2005). Regardless of its correct name, this European species,
sometimes listed as Leccinum carpini (R. Schulz) D.A. Reid (Lannoy & Estades
1995) or Leccinum pseudoscabrum (Kallenb.) Sutara (den Bakker & Noordeloos
2005), is primarily associated with Carpinus and does not stain blue or green
(except very rarely in the base of the stem). Also, the European species has
yellowish tubes when young and flesh that stains deep violet when sliced
(Lannoy & Estades 1995; den Bakker & Noordeloos 2005)—a difference noted
by Smith & Thiers (1971). On the basis of these morphological differences,
we recognize the North American species as new and have selected an epithet
reflecting its association with oaks.
Lactarius rubidus validated & Leccinellum quercophilum sp. nov. ... 329
PLATE 2: Leccinellum quercophilum, M. Kuo 07120801 (NY; holotype). Basidiocarps (top),
pileipellis elements (bottom left), cheilocystidia (middle right), and basidiospores (bottom right).
Scale bars = 10 um.
Leccinellum Bresinsky & Manfr. Binder was erected in 2003 (Bresinsky &
Besl 2003) to accommodate Leccinum species with a yellow hymenophore and
a trichoderm-like pileipellis. Boletus nigrescens Richon & Roze (nom. illegit.;
= Leccinellum nigrescens (Singer) Bresinsky & Manfr. Binder) was designated
as the type of the genus. Bresinsky & Besl (2003) included Leccinum carpini and
L. griseum among eight existing species they accepted in Leccinellum, but the
nomenclature and taxonomy warrant review. Although the hymenophore of
Leccinellum quercophilum is not yellow, it falls within Leccinellum as defined in
Bresinsky & Besl (2003) on the basis of its pileipellis.
330 ... Kuo & al.
GenBank BLAST searches with an ITS sequence of Leccinellum quercophilum
reveal that the closest matches include Leccinum carpini |AF454588.1 (The
Netherlands)], Leccinum crocipodium (Letell.) Watling [AF454589.1 (Belgium),
JN021053.1 (France), JF908325.1 unpublished (Italy), and AF454590.1 (The
Netherlands)], and Leccinum talamancae Halling et al. [AY544779.1 (Costa
Rica)] as labeled and numbered in GenBank with published citations (den
Bakker et al. 2004a,b; Dentinger et al. 2011). The >3% difference in sequence
identity supports Leccinellum quercophilum as a distinct species. Morphological
differences also separate these taxa. As noted above, the European species
associated with Carpinus has yellowish young tubes, flesh that turns violet
when sliced, and does not stain blue or green; Leccinum crocipodium has a
yellow hymenophore and does not stain green (den Bakker & Noordeloos
2005); Leccinum talamancae is less areolate and features flesh that turns slowly
pink to reddish orange in the pileus and stipe apex when exposed (Halling
1999). Our own additional unpublished alignments and phylogenetic analyses,
along with the ITS tree in Lebel et al. (2012a,b), support generic placement in
Leccinellum. Further research will determine whether Leccinellum as presently
circumscribed is or is not supported phylogenetically.
Acknowledgments
We are grateful to Timothy J. Baroni and Patrick R. Leacock for serving as pre-
submission reviewers and for their helpful comments on the manuscript; Darvin
DeShazer also provided helpful commentary. We thank the University of Michigan
Herbarium (MICH) for kindly lending specimens, and the William and Linda Steere
Herbarium of the New York Botanical Garden (NY) for processing deposits. We also
thank Henk den Bakker, Dana Ringuette, Barbara Thiers, Jean Toothman, and Sue
Yocum for invaluable assistance in various aspects of this study. The U.S. Forest Service,
Northern Research Station, Center for Forest Mycology Research provided funds for
DNA sequencing. We thank Kyah Norton of the CFMR for providing expert technical
support. Support to REH from the National Science Foundation, via grants DEB
#9972018, DEB #0414665, and DEB #1020421, is gratefully acknowledged.
Literature cited
Arora D. 1991. All that the rain promises and more: a hip pocket guide to western mushrooms.
Berkeley: Ten Speed Press.
Bergemann SE, Garbelotto M. 2006. High diversity of fungi recovered from the roots of mature
tanoak (Lithocarpus densiflorus) in northern California. Canadian Journal of Botany 84:
1380-1394. http://dx.doi.org/10.1139/b06-097
Bresinksy A, Besl H. 2003. Beitrage zu einer Mykoflora Deutschlands: Schlussel zur
Gattungsbestimmung der Blatter-, Leisten- und Rohrenpilze: mit Literaturhinweisen zur
Artbestimmung. Regensburger mykologische Schriften. Regensburg: Verlag der Gesellschaft.
den Bakker HC, Noordeloos ME. 2005. A revision of European species of Leccinum Gray and notes
on extralimital species. Persoonia 18: 511-587.
Lactarius rubidus validated & Leccinellum quercophilum sp. nov. ... 331
den Bakker HC, Gravendeel B, Kuyper TW. 2004a. An ITS phylogeny of Leccinum and an
analysis of the evolution of minisatellite-like sequences within ITS1. Mycologia: 96: 102-118.
http://dx.doi.org/10.2307/3761992
den Bakker HC, Zuccarello GC, Kuyper ThW, Noordeloos ME. 2004b. Evolution and host specificity
in the ectomycorrhizal genus Leccinum. New Phytologist 163: 201-215.
http://dx.doi.org/10.1111/j.1469-8137.2004.01090.x
Dentinger BTM, Didukh MY, Moncalvo J-M. 2011. Comparing COI and ITS as DNA barcode
markers for mushrooms and allies (Agaricomycotina). PLoS ONE 6(9): e25081.
http://dx.doi.org/10.1371/journal.pone.0025081
Halling RE. 1999. New Leccinum species from Costa Rica. Kew Bulletin 54: 747-753.
http://dx.doi.org/10.2307/4110871
Hesler LR, Smith AH. 1979. North American species of Lactarius. Ann Arbor, University of
Michigan Press.
Kornerup A, Wanscher JH. 1967. Methuen Handbook of Colour. 2"¢ ed. London, Methuen.
Kuo M. 2007. 100 edible mushrooms. Ann Arbor, University of Michigan Press.
Lannoy G, Estades A. 1995. Monographie des Leccinum d Europe. La Roche-sur-Foron, Federation
Mycologique Dauphine-Savoie.
Lebel T, Orihara T, Maekawa N. 2012a. The sequestrate genus Rosbeeva T. Lebel & Orihara gen. nov.
(Boletaceae) from Australasia and Japan: new species and new combinations. Fungal Diversity
52: 49-71. http://dx.doi.org/10.1007/s13225-011-0109-x
Lebel T, Orihara T, Maekawa N. 2012b. Erratum to: The sequestrate genus Rossbeevera T. Lebel &
Orihara gen. nov. (Boletaceae) from Australasia and Japan: new species and new combinations.
Fungal Diversity 52: 73. http://dx.doi.org/10.1007/s13225-011-0118-9
Lindner DL, Banik MT. 2009. Effects of cloning and root-tip size on observations of fungal ITS
sequences from Picea glauca roots. Mycologia 101: 157-165. http://dx.doi.org/10.3852/08-034
Lorch JM, Lindner DL, Gargas A, Muller LK, Minnis AM, Blehert DS. 2013. A culture-based
survey of fungi in soil from bat hibernacula in the eastern United States and its implications
for detection of Geomyces destructans, the causal agent of bat white-nose syndrome. Mycologia
105: 237-252, http://dx.doi.org/10.3852/12-207
McNeill J, Barrie FR, Buck WR, Demoulin V, Greuter W, Hawksworth DL, Herendeen PS, Knapp
S, Marhold K, Prado J, Prud’ homme van Reine WF, Smith GF, Wiersema J, Turland NJ (Eds.).
2012. International Code of Nomenclature for algae, fungi, and plants (Melbourne Code).
Adopted by the Eighteenth International Botanical Congress, Melbourne, Australia, July 2011.
Regnum Vegetabile 154. ARG Gantner Verlag KG.
Methven AS. 1997. The Agaricales of California. 10. Russulaceae II. Lactarius. Eureka, CA, Mad
River Press.
Moncalvo J-M, Lutzoni FM, Rehner SA, Johnson J, Vilgalys R. 2000. Phylogenetic relationships of
agaric fungi based on nuclear large subunit ribosomal DNA sequences. Systematic Biology 49:
278-305. http://dx.doi.org/10.1093/sysbio/49.2.278
Peay KG, Bruns TD, Kennedy PG, Bergemann SE, Garbelotto M. 2007. A strong species-area
relationship for eukaryotic soil microbes: island size matters for ectomycorrhizal fungi. Ecology
Letters 10: 470-480. http://dx.doi.org/10.1111/j.1461-0248.2007.01035.x
Smith AH, Thiers HD. 1971. The boletes of Michigan. Ann Arbor, University of Michigan Press.
Thiers B. 2012 [continuously updated]. Index Herbariorum: a global directory of public herbaria
and associated staff. New York Botanical Garden's Virtual Herbarium.
http://sweetgum.nybg.org/ih/ [accessed November 2012].
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
332 ... Kuo & al.
Wood WE, Brandes JA, Foy BD, Morgan CG, Mann TD, DeShazer DA. 2012. The maple syrup
odour of the “candy cap” mushroom, Lactarius fragilis var. rubidus. Biochemical Systematics
and Ecology 43: 51-53. http://dx.doi.org/10.1016/j.bse.2012.02.027
Wurzburger N, Bidartondo MI, Bledsoe CS. 2001. Characterization of Pinus ectomycorrhizas
from mixed conifer and pygmy forests using morphotyping and molecular methods. Canadian
Journal of Botany 79: 1211-1216. http://dx.doi.org/10.1139/cjb-79-10-1211
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/124.333
Volume 124, pp. 333-340 April-June 2013
Cladonia dunensis sp. nov. from southern Brazil,
with notes on the genus in beach dune environments
EMERSON LUIZ GUMBOSKI'*, FLAVIO BEILKE” & SIONARA ELIASARO?
' Programa de Pés-Graduacdo em Botanica, Universidade Federal do Rio Grande do Sul,
Av. Bento Goncalves, 9500, Agronomia, Porto Alegre, RS, 91501-970, Brazil
? Rua Roberto Ponick, 292, Bairro Bom Retiro, Joinville, SC, 89223-250, Brazil
* Departamento de Botanica, Universidade Federal do Parana,
Setor de Ciéncias Biologicas, Curitiba, PR, 81531-980, Brazil
* CORRESPONDENCE TO: [email protected]
ABSTRACT — Cladonia dunensis is described. The new species resembles C. celata in the
corticate and scyphose podetia that are simple at first before branching fastigiately but
differs in forming squamulose podetia and producing psoromic acid. Seven Cladonia species
are reported for the first time from beach dune environments in the coastal plain of Santa
Catarina State, southern Brazil.
Key worps — Ascomycota, Cladoniaceae, dimorphic thallus, lichens, taxonomy
Introduction
In the Brazilian coastal areas, sand dune habitats are covered by herbaceous,
arbustive and arboreal vegetation types named restinga vegetation (Araujo
1992). The lichenized restinga mycota has been intensively studied in the last
decade, primarily within arbustive-arboreal vegetation (e.g., Benatti & Marcelli
2008, 2009; Dal-Forno & Eliasaro 2010 a,b; Donha & Eliasaro 2006; Marcelli
& Benatti 2011; Martins & Marcelli 2011). However, there is no information
about species that colonize the beach dune environments in Brazil (Marcelli
1998).
Cladonia P. Browne, the largest genus in Cladoniaceae with c. 400 species
(Stenroos et al. 2002; Burgaz & Ahti 2009), is frequent and abundant in
arbustive restinga vegetation (Ahti 2000; Gumboski & Eliasaro 2012a,b), and
some species can colonize other adjacent environments.
As a part of a survey of the Cladoniaceae in the coastal region of southern
Brazil (Gumboski & Eliasaro 2012a,b) we present a first report on Cladonia
species found in the beach dune environment in Brazil, one of which is new to
science. Descriptions, comments and illustrations are presented.
334 ... Gumboski, Beilke & Eliasaro
Materials & methods
The specimens were collected in depressions between beach dunes in the Municipality
of Imbituba, Santa Catarina State, Brazil (Fic. 1). Specimens were examined using
standard stereoscopic (20-50x) and light microscopic (400-1000x) techniques. Sections
of primary thallus, podetia, and pycnidia were mounted in water. Chemical constituents
were identified by spot tests, under UV light, and thin layer chromatography using
solvent system C (Orange et al. 2001) and by comparison with authentic samples.
Taxonomy
Cladonia dunensis Gumboski, Beilke & Eliasaro, sp. nov. Fic. 2
MycoBank MB 804907
Differs from Cladonia celata by its squamulose podetia and by its production of psoromic
acid.
Type: Brazil. Santa Catarina State: Municipality of Imbituba, 28°17'57"S 48°42'14"W,
sea level, on acid soil in depressions between dunes, 19 Feb 2010, E. Gumboski & FE
Beilke 1750 (Holotype, UPCB; isotypes, ICN, JOI).
Erymo.oey: The epithet refers to the habitat of this species.
Primary thallus evanescent, lobate squamules, 1.0-3.0 mm long, 0.5-1.2 mm
wide, planes, not divided, smooth margins, without rhizines, esorediate; upper
surface greenish to whitish, corticate, smooth, not pruinose, without pycnidia,
lower surface white, ecorticate, smoothly arachnoid; cortex 40-70 um, medulla
110-420 um. Podetia 0.8-2.0 cm tall, 0.4-0.9 mm thick, greenish to brownish,
scyphose, irregularly branching, at first simple then finally fastigiate mainly
dichotomously, but with irregular branches common on podetial sides; scyphi
sometimes deformed at margin, <1.2 mm wide; surface corticate and verrucose,
sometimes cracked (some cracks can reveal the white medulla below), without
soredia or granules, schizidia and squamules present, lobate squamules <0.5
mm long; cortex 20-50(-80) um, medulla 50-120 um, hyaline stereome, 130-
190 um, papillate central canal, 270-500 um wide. Hymenial disks common,
globose, apical on podetia, pale brown to brownish, immature, ascospores not
seen. Pycnidia rare, brow to blackish, to 0.2 mm wide, slime and conidia not
seen.
CuHemistry: Thallus K-, C-, KC-, UV-. Psoromic acid [major] and 2’-O-
demethylpsoromic acid [minor] detected by TLC.
ECOLOGY AND DISTRIBUTION: The new species is known only on sandy soil
in depressions between dunes, where it usually grows intermixed with other
Cladonia species, such as C. ramulosa, C. didyma, and C. merochlorophaea.
This area, characterized by acidity and high humidity, develops an herbaceous
vegetation that is often used for cattle grazing and is periodically burned, as
observed in November 2011; thus the species is endangered.
ADDITIONAL SPECIMENS EXAMINED: BRAZIL. SANTA CATARINA STATE: Municipality
of Imbituba, 28°17'57"S 48°42'14"W, sea level, 19 Feb 2010, E. Gumboski & F. Beilke
1754b (JOD).
Cladonia dunensis sp. nov. (Brazil) ... 335
FiGure 1. The studied area: dunes from Municipality of Imbituba, Santa Catarina State, Brazil.
FiGuRE 2. Cladonia dunensis (holotype). Scale bar = 1 cm.
336 ... Gumboski, Beilke & Eliasaro
REMARKS: The new species is characterized by the evanescent primary
squamules, short, corticate, scyphose and squamulose podetia, at first simple
then branching fastigiately, by the brownish ascomata, and the psoromic acid
production.
According to the infrageneric classification suggested by Stenroos et al.
(2002), Cladonia dunensis probably belongs in supergroup Cladonia based on its
squamulose primary thallus, sparsely branched corticate podetia, unperforated
axils, and brownish ascomata.
Cladonia dunensis resembles C. celata A.W. Archer in similar podetia (Archer
1984, 1992). However, C. dunensis has squamulose podetia with schizidia and
contains psoromic acid, while C. celata has podetia without schizidia and
squamules and produces fumarprotocetraric acid. These two species also
exhibit disjunct geographic distributions, with C. celata occurring at 450-1100
m in Australia (Archer 1984), whereas C. dunensis is known only from the type
locality at sea level in dune environments in southern Brazil.
Cladonia fruticulosa Kremp. differs morphologically in having a persistent
primary thallus up to 5(-10) mm long and 2(-3) mm wide with crenate-incised
to deeply divided squamules, moderately branching podetia with variably
smooth or roughly corticate to partly or almost totally sorediate surfaces, and
is found at 440-3800 m (Swinscow & Krog 1988; Stenroos 1988).
The specimens of Cladonia ochracea found in the studied area are quite
similar to C. dunensis, but C. ochracea has scyphose to capitate podetia,
produces fumarprotocetraric acid and grows up to 3.5 cm tall.
Psoromic acid is very rare in Cladonia species from Brazil. Gumboski &
Eliasaro (2012a,b) recorded 23 species from restinga vegetation and rocky
shores from southern Brazil, and none of them produced this compound. Ahti
(2000) recorded 180 species from Brazil and psoromic acid was detected in
only some specimens of C. acuminata (Ach.) Norrl., C. cartilaginea Mill. Arg.,
and C. dactylota Tuck. Both C. acuminata and C. cartilaginea have ascyphose
podetia that have a granulose-sorediate surface in C. acuminata (Ahti 2000)
and are decorticate in C. cartilaginea (Herb. ICN, M. Fleig 3416, 6041). In
Cladonia dactylota the primary thallus is persistent, sometimes sorediate, and
the podetia, although scyphose, have sorediate surface with tuberculose soralia
below the scyphi or on podetial stalks (Ahti 2000; Herb. ICN, M. Fleig 5191,
5969).
The six other species found in beach dune environments are:
Cladonia crispatula (Nyl.) Ahti, Lichenologist 9: 14. 1977.
ECOLOGICAL NOTES: Specimens were found mainly between herbs and
isolated from other species on sandy soil. The specimens are smaller and
Cladonia dunensis sp. nov. (Brazil) ... 337
less frequent when compared to those seen in arbustive restinga vegetation
(Gumboski & Eliasaro 2012b).
SPECIMENS EXAMINED: BRAZIL. SANTA CATARINA STATE: Municipality of Imbituba,
28°17'S 48°42’W, sea level, 19 Feb 2010, E. Gumboski & FE. Beilke 1754a, 1755 (JOI); 10
Nov 2011, E. Gumboski, F. Beilke & S. Eliasaro 3020, 3027 (JOI).
DISTRIBUTION: Occurs from sea level to 2000 m. Recorded only from South
America: Brazil, Paraguay and Uruguay (Ahti 2000).
See Ahti (2000), Gumboski & Eliasaro (2012b) for descriptions.
Cladonia didyma (Fée) Vain., Acta Soc. Fauna Fl. Fenn. 4: 137. 1887.
ECOLOGICAL NOTES: The most frequent species found in the beach dunes,
growing on sandy soil in open sites or between herbs. Usually intermixed with
C. ochracea and C. ramulosa specimens.
SPECIMENS EXAMINED: BRAZIL. SANTA CATARINA STATE: Municipality of Imbituba,
28°17'S 48°42'W, sea level, 19 Feb 2010, E. Gumboski & EF. Beilke 1751 (JOI); 10 Nov
2011, E. Gumboski, F. Beilke & S. Eliasaro 3017, 3022 (JOI).
DISTRIBUTION: Cosmopolitan, from sea level to 3000 m (Ahti 2000). Recorded
from Oceania, Asia (Vainio 1887), Africa (Doidge 1950), North America
(Fulford 1937), Central America (Vainio 1887), and South America in Argentina
(Calvelo & Liberatore 2002), Bolivia (Ahti 2000), Brazil (Krempelhuber 1876,
as C. muscigena), Chile (Crombie 1876, as C. melanodes), Colombia, Ecuador
(Ahti 2000), Guyana (Sipman 1990), and Paraguay, Peru, Suriname, Trinidad &
Tobago, Uruguay, Venezuela (Ahti 2000).
See Ahti (2000), Ahti & Hammer (2002), Gumboski & Eliasaro (2012b) for
descriptions.
Cladonia latiloba Ahti & Marcelli, Fl. Neotrop., Monogr. 78: 249. 2000.
ECOLOGICAL NOTES: Only little thalli of this species were found. The
specimens were growing on sandy soil in open sites without vegetation cover
around them and usually isolated from other species of Cladonia.
SPECIMENS EXAMINED: BRAZIL. SANTA CATARINA STATE: Municipality of Imbituba
28°17'S 48°42'W, sea level, 19 Feb 2010, E. Gumboski & F. Beilke 1756, 1755 (JOI); 10
Nov 2011, E. Gumboski, FE. Beilke & S. Eliasaro 3018, 3019, 3026 (JOI).
DISTRIBUTION: Recorded only from Brazil, at sea level (Fleig et al. 1995; Ahti
2000).
See Ahti (2000), Gumboski & Eliasaro (2012a) for descriptions.
Cladonia merochlorophaea Asahina, J. Jap. Bot. 16: 713. 1940.
ECOLOGICAL NOTES: The specimens were represented by scattered podetia,
almost always intermixed with C. ochracea and C. ramulosa specimens on
sandy soil in open places.
338 ... Gumboski, Beilke & Eliasaro
SPECIMENS EXAMINED: BRAZIL. SANTA CATARINA STATE: Municipality of Imbituba,
28°17'S 48°42’'W, sea level, 19 Feb 2010, E. Gumboski & EF. Beilke 1749 (JOI); 10 Nov
2011, E. Gumboski, F. Beilke & S. Eliasaro 3021, 3025 (JOI).
DISTRIBUTION: According to Ahti (2000), this species usually occurs in high
altitudes from 900 to 4100 m. Recorded from Oceania (Galloway 1985), Asia
(Ahti 1976), Europe (Asahina 1940), North America (Archer 1992), and South
America in Brazil (Fleig et al. 1995), Colombia (Flakus et al. 2008), Peru, and
Venezuela (Ahti 2000).
See Ahti (2000), Burgaz & Ahti (2009), Gumboski & Eliasaro (2012a) for
descriptions.
Cladonia ochracea L. Scriba, Cladon. Exs.: no. 1006. 1923.
ECOLOGICAL NOTES: Usually growing intermixed with C. didyma and
C. ramulosa specimens on sandy soil in open places. A few specimens were
found growing on decaying logs and on an anthill between herbs.
SPECIMENS EXAMINED: BRAZIL. SANTA CATARINA STATE: Municipality of Imbituba,
28°17'S 48°42’'W, sea level, 19 Feb 2010, E. Gumboski & EF. Beilke 1752 (JOI); 10 Nov
2011, E. Gumboski, F. Beilke & S. Eliasaro 3023, 3028 (JOI).
DISTRIBUTION: Occurs from sea level to 1900 m (Ahti 2000). Recorded only
from South America in Argentina (Ahti 2000), Brazil (Osorio & Fleig 1991),
and Paraguay and Uruguay (Ahti 2000).
See Fleig et al. (1995), Ahti (2000), Gumboski & Eliasaro (2012a) for
descriptions.
Cladonia ramulosa (With.) J.R. Laundon, Lichenologist 16: 225. 1984.
ECOLOGICAL NOTES: The specimens were mainly found as scattered podetia
usually growing intermixed with C. didyma and C. ochracea specimens on
sandy soil in open places.
SPECIMENS EXAMINED: BRAZIL. SANTA CATARINA STATE: Municipality of Imbituba,
28°17'S 48°42'W, sea level, 19 Feb 2010, E. Gumboski & F. Beilke 1748, 1753 (JOI); 10
Nov 2011, E. Gumboski, F. Beilke & S. Eliasaro 3024 (JOI).
DISTRIBUTION: Cosmopolitan (Burgaz & Ahti 2009), occurring from sea level
to 2000 m (Ahti 2000). Recorded from Oceania, Asia, Europe, Africa, North
America, Central America (Vainio 1894, as C. pityrea), and South America
in Argentina (Ferraro & Ahti 1987), Brazil (Osorio & Fleig 1988), Colombia,
Paraguay (Ahti 2000), Peru (Vainio 1894, as C. pityrea), and Uruguay and
Venezuela (Ahti 2000).
See Ahti (2000), Burgaz & Ahti (2009), Gumboski & Eliasaro (2012a) for
descriptions.
Cladonia dunensis sp. nov. (Brazil) ... 339
Acknowledgments
We are grateful to Dr. Alan W. Archer, Dr. Lidia I. Ferraro, Dr. Soili Stenroos, and
Msc. Celso Voos Vieira for providing a valuable bibliography and for discussions with
the first author and to the reviewers Dr. Marcelo Pinto Marcelli, Dr. Samuel Hammer,
and Dr. Shaun R. Pennycook for all the comments and suggestions. The authors also wish
to thank CAPES (Coordenadoria de Aperfeigoamento do Pessoal do Ensino Superior)
for granting a Mastership to Gumboski and to Beilke.
Literature cited
Ahti T. 1976. The lichen genus Cladonia in Mongolia. Jour. Jap. Bot. 51: 365-373.
Ahti T. 2000. Cladoniaceae. Flora Neotropica 78. Organization for Flora Neotropica and New York
Botanical Garden, Bronx.
Ahti T, Hammer S. 2002. Cladonia. 131-158, in: TH Nash et al. (eds). Lichen Flora of the Greater
Sonoran Desert Region. I. Lichens Unlimited, Arizona State University, Tempe, Arizona.
Araujo DSD. 1992. Vegetation types of sandy coastal plains of tropical Brazil: a first approximation.
337-347, in: U Seeliger (ed.). Coastal plant communities of Latin America. Academic Press,
New York.
Archer AW. 1984. Three new Australian lichens: Cladonia celata, C. praetermissa and C. wilsonii.
Muelleria 5: 271-275.
Archer AW. 1992. Cladoniaceae. Flora Australia 54: 107-152.
Asahina Y. 1940. Chemismus der Cladonien unter besonderer Beriicksichtigung der Japanischen
Arten I. Cladonia chlorophaea und verwandte Arten. J. Jap. Bot. 16: 709-727.
Benatti MN, Marcelli MP. 2008. Espécies de Parmotrema (Parmeliaceae, Ascomycetes liquenizados)
com maculas reticulares do litoral centro-sul do Estado de Sao Paulo, Brasil. Hoehnea 35(1):
75-90.
Benatti MN, Marcelli MP. 2009. Espécies de Parmotrema (Parmeliaceae, Ascomycetes liquenizados)
com medula pigmentada do litoral centro-sul do Estado de Sao Paulo. Hoehnea 36(4):
597-612.
Burgaz AR, Ahti T. 2009. Cladoniaceae. Flora Liquenoldgica Ibérica. Vol. 4. Sociedad Espanola de
Liquenologia, Madrid. 111 p.
Calvelo S, Liberatore S. 2002. Catalogo de los liquenes de la Argentina. Kurtziana 29(2): 7-170.
Crombie JM. 1876. On the lichens collected by Prof. R.O. Cunningham in the Falkland Islands,
Fuegia, Patagonia and the Island of Chiloe during the voyage of H.M.S. Nassau 1867-1869.
Journ. Linn. Soc. 15: 222.
Dal-Forno M, Eliasaro S. 2010a. Four new species of Graphis (Ostropales: Graphidaceae) from
Brazil. Lichenologist 42: 77-81. http://dx.doi.org/10.1017/S002428290999034X
Dal-Forno M, Eliasaro S. 2010b. Two new species of Graphidaceae (lichenized Ascomycota) from
Brazil. Mycotaxon 112: 15-20. http://dx.doi.org/10.5248/112.15
Donha CG, Eliasaro S. 2006. Two new species of Parmotrema (Parmeliaceae, lichenized Ascomycota)
from Brazil. Mycotaxon 95: 241-245.
Ferraro LI, Ahti T. 1987. Contribucion al conocimiento del genero Cladonia (Cladoniaceae--
Liquenes) de Argentina y regiones limitrofes. Bonplandia 6(1): 57-69.
Flakus A, Ahti T, Kukwa M, Wilk K. 2008. New and interesting records of Cladonia and their
lichenicolous fungi from the Andean cloud forest in Bolivia. Ann. Bot. Fenn. 45: 448-454.
Fleig M, Ahti T, Stenroos S. 1995. A familia Cladoniaceae (liquens) no Rio Grande do Sul, Brasil.
Napaea 11: 1-29.
340 ... Gumboski, Beilke & Eliasaro
Galloway DJ. 1985. Flora of New Zealand lichens. P.D. Hasselberg, Government Printer, Wellington.
662 p.
Gumboski EL, Eliasaro S. 2012a. Espécies de Cladonia P. Browne (Cladoniaceae, Ascomycota) do
Supergrupo Cladonia em restingas e cost6es rochosos dos Estados do Parana e de Santa Catarina,
Brasil. Hoehnea 39(2): 315-337. http://dx.doi.org/10.1590/S2236-89062012000200010
Gumboski EL, Eliasaro S. 2012b. Espécies de Cladonia P. Browne (Cladoniaceae, Ascomycota) dos
Supergrupos Cocciferae, Crustaceae e Perviae em restingas e cost6es rochosos dos Estados do
Parana e de Santa Catarina, Brasil. Acta Bot. Bras. 26(3): 619-631.
http://dx.doi.org/10.1590/S0102-33062012000300011
Krempelhuber A. 1876. Lichenes brasilienses collecti a D.A. Glaziou in provincia brasiliensi Rio
Janeiro. Flora 59: 56-63.
Marcelli MP. 1998. History and current knowledge of Brazilian lichenology. 25-45, in: MP
Marcelli, MRD Seaward (eds). Lichenology in Latin America: History, Current Knowledge and
Applications. CETESB - Companhia de Tecnologia de Saneamento Ambiental — Estado de Sao
Paulo, Sao Paulo, Brazil.
Marcelli MP, Benatti MN. 2011. Espécies de Parmotrema (Parmeliaceae, Ascomycota) do litoral
centro-sul do Estado de Sao Paulo V. Grupo quimico alectorénico. Rev. Bras. Bot. 34(3):
261-283. http://dx.doi.org/10.1590/S0100-8404201 1000300003
Martins SMA, Marcelli MP. 2011. Specific distribution of lichens on Dodonaea viscosa L. in the
restinga area of Itapua State Park in Southern Brazil. Hoehnea 38(3): 397-411.
Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.
British Lichen Society.
Osorio HS, Fleig M. 1988. Contribution to the lichen flora of Brazil. XX. Additional records from
Sao Francisco de Paula, Rio Grande do Sul State. Comunicaciones Botanicas del Museo de
Historia Natural de Montevideo 5(85): 1-7.
Osorio HS, Fleig M. 1991. Contribution to the lichen flora of Brazil. XXVIII. Lichens from northern
Santa Maria, Rio Grande do Sul State. Comunicaciones Botanicas del Museo de Historia
Natural de Montevideo 5(96): 1-7.
Sipman HJM. 1990. Lichenotheca Latinoamericana a museo botanico berolinensi edita, fasciculum
primum. Willdenowia 19: 543-551.
Stenroos S. 1988. The family Cladoniaceae in Melanesia. 3. Cladonia sections Helopodium, Perviae
and Cladonia. Ann. Bot. Fenn. 25(2): 117-148.
Stenroos S, Hyvonen J, Myllys L, Thell A, Ahti T. 2002. Phylogeny of the genus Cladonia s.lat.
(Cladoniaceae, Ascomycetes) inferred from molecular, morphological, and chemical data.
Cladistics 18: 237-278. http://dx.doi.org/10.1111/j.1096-0031.2002.tb00151.x
Swinscow TDV, Krog H. 1988. Macrolichens of East Africa. British Museum, London.
Vainio EA. 1887. Monographia Cladoniarum universalis. I. Acta Soc. Fauna Fl. Fenn. 4: 1-509.
Vainio EA. 1894. Monographia Cladoniarum universalis. II. Acta Soc. Fauna Fl. Fenn. 10: 1-498.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.341
Volume 124, pp. 341-347 April-June 2013
Coniolepiota spongodes (Agaricaceae, Basidiomycota)
in Bangladesh and China
Mb. IQBAL HOSEN”? & ZHU L. YANG?
'Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650201, Yunnan, P. R. China
*University of Chinese Academy of Sciences, Beijing 100049, P. R. China
CORRESPONDENCE TO: ‘[email protected]; '’[email protected]
AsBsTRACT — The genus Coniolepiota is recorded for the first time from Bangladesh and
China. Coniolepiota spongodes is characterized by its gray lilac to purple floccose basidiomata
and relatively small smooth ellipsoid to oblong basidiospores. A detailed morphological
description, photographs and line drawings, with confirmation of the phylogenetic position
of newly reported taxon are provided herein.
Key worps — Agaricales, Asian fungus, ITS-nrLSU, morphology, new record
Introduction
Coniolepiota Vellinga, a genus of family Agaricaceae recently described
from tropical Asia, harbors a single relatively well-known species, C. spongodes
(Vellinga et al. 2011). During studies of the higher fungi (Hosen & Ge 2011;
Hosen et al. 2013), collections of C. spongodes were made for the first time
from Bangladesh. A study of the Bangladesh and Chinese materials is provided
here.
Materials & methods
Morphological studies
Collections were made along roadsides in forests of Shorea robusta Gaertn.
(Dipterocarpaceae) in Bangladesh, and from tropical China. Fresh specimens were
described and photographed in the field. Dried specimens were deposited in the
Herbarium of Kunming Institute of Botany, Chinese Academy of Sciences, Yunnan,
China (KUN-HKAS), and in the Herbarium of Agarics Flora, Department of Plant
Pathology, Faculty of Agriculture, Sher-e-Bangla Agricultural University, Dhaka,
Bangladesh (SHAF).
342 ... Hosen & Yang
Microscopic observations were made in 5% aqueous KOH, and structures drawn
by free hand. The notations “(n/m/p)’ indicate that the measurements were made on ‘n’
basidiospores from ‘m basidiomata of ‘p’ collections with a minimum of 20 basidiospores
per basidioma. Dimensions of basidiospores are presented in the following form
Coniolepiota spongodes HM488756, HM488774; Thailand
Coniolepiota spongodes -, KC871015; China
100 } Coniolepiota spongodes KC625531, KC625530; Bangladesh
97 Coniolepiota aff. spongodes HM488757, -; Thailand
Heinemannomyces splendidissima HM488760, HM488769
96
Agaricaceae sp. HM488761, HM488770
100
65 Eriocybe chionea HM488752, HM488773
76
Clarkeinda trachodes HM478750, HM488771
Chlorophyllum brunneum AY083205, AF482886
100
100 Chlorophyllum rachodes AY081236, AY176345
Chlorophyllum molybdites AY243617, U85303
91
Leucoagaricus americanus AY 176407, AF482891
99
Leucoagaricus meleagris AF482867, AF482890
100
Micropsalliota sp. HM488762, HM488768
100
74
Allopsalliota geesterani AF482857, AF482888
Macrolepiota dolichaula HM125522, JN940269
100
Macrolepiota procera JQ683110, AM946456
Lycoperdon pyriforme AY854075, NG0O27553
0.1
Tubaria vinicolor DQ536417, DQ536415
FicureE 1. A phylogenetic tree generated from the combined ITS-nrLSU dataset of Agaricaceae
using maximum likelihood (ML) method. Posterior probabilities from Bayesian inference (BI)
(>0.97) are indicated as thick branches and bootstrap values derived from ML (BS>60%) are shown
above the branches at nodes. Newly generated sequences for Coniolepiota spongodes are highlighted
in boldface with red color. GenBank accessions ITS and nrLSU are provided after the species name
and unavailable sequence is marked as hyphen sign.
Coniolepiota spongodes in Bangladesh & China ... 343
(a—)b-c(—d); in which ‘b-c’ contains at least 90% of the measured values and extreme
values ‘a and ‘d’ are setin parentheses.Q_ =Q+SD;Q refers to the ratio of individual spore,
Q__ refers to the average Q of basidiospores, and SD is the standard deviation.
Molecular procedures and phylogenetic analysis
The protocol for DNA extraction followed those of Doyle & Doyle (1987). ITS1/
ITS4 (White et al. 1090) and LROR/LRS (Vilgalys & Hester 1990) primer pairs were
used for the amplification of internal transcribed spacer (ITS) and the large subunit
nuclear ribosomal RNA (nrLSU) regions, respectively. PCR amplification, sequencing
and sequence alignment, Maximum Likelihood (ML) and Bayesian Inference (BI)
methods followed those in Hosen et al. (2013). Phylogenetic analysis was conducted on
the combined dataset of the ITS and the nrLSU.
Molecular results
Two sequences were newly generated in this study and are deposited in
GenBank. The combined ITS-nrLSU dataset consisted of 1689 nucleotide
sites (including gaps). In this dataset, 1116 characters were constant, while
573 characters were variable, of which 211 were parsimony uninformative
and 362 were parsimony informative. Parsimony analysis resulted in one
most parsimonious tree of 1329 steps, with Consistency Index (CI) = 0.634,
Retention Index (RI) = 0.590 and Rescaled Consistency Index (RC) = 0.374.
Tree topologies obtained from both ML and BI methods of phylogenetic
analysis were almost identical. Sequences from collection of C. spongodes made
from Bangladesh fall in a highly supported clade with those described from
northern Thailand (Fic. 1).
Taxonomy
Coniolepiota spongodes (Berk. & Broome) Vellinga, Mycologia 103: 502, 2011.
Figs 2, 3
BASIDIOMATA solitary, medium-sized. PILEus 40-80 mm broad, plano-
convex to applanate with slightly inflexed margin, covered with lilac to purple-
gray powdery velar warts at young stage which remain in some areas especially
in the center, but in outer zone sometimes disappearing, showing the pallid
to whitish background; warts thick at center, becoming spread out towards
margin, sometimes with powdery warts hanging over the margin. LAMELLAE
14 x 4 mm, free and remote from the stipe, crowded with lamellulae, pallid
cream to pale yellowish. StrpE 25-50 x 6-10 mm, central, cylindrical, usually
slightly tapering upward, glabrous and pallid white at apex but the remaining
parts covered with powdery lilac warts as on pileus, base slightly swollen and
covered with whitish mycelium, hollow. ANNULUs present, thin membranous
and easily detachable. CONTEXT 7 mm thick at the center of the pileus, dull
white to slightly pale purplish.
344 ... Hosen & Yang
FIGURE 2. Coniolepiota spongodes. a—b. Basidiomata show gray lilac velar coverings on the surface
of pileus and stipe. c. Hymenophore showing free, crowded, pallid to cream-white lamellae with
powdery warts hanging over the margin. d. Gray lilac velar coverings disappearing from the
surface of the pileus and stipe at maturity and/or handing. (a = HKAS 77576; b = HKAS 60246;
c = SHAF 5; d= HKAS 77574). Photos: a, c, d, Md. Iqbal Hosen; b, Zai- Wei Ge.
BasIpiospores [80/4/4] 4-5(-6) x (2.8-)3-3.2(-3.5) um [Q = 1.43-1.57,
Q_ = 1.52 + 0.127], ellipsoid to somewhat oblong, hyaline to pale yellowish,
dextrinoid, inamyloid, nearly rounded apex, smooth, slightly thick-walled,
without germ pore. BAsip1a 12-20 x 5-7 um, cylindro-clavate to clavate,
hyaline to pale yellowish in H,O, thin-walled, tetrasporic but occasionally 2- or
3-spored. CHEILOCYSTIDIA 20-26 x 6-9 um, clavate to clavulate, some cylindro-
clavate, hyaline, thin-walled, smooth, without encrustations, not abundant,
scattered and sometimes hard to find. PLEUROCysTIDIA not observed. PILEUS
COVERING a powdery layer made up of irregularly shaped cylindrical cells,
three dimensional (T-shaped), some anastomosing (H-shaped), individual
elements 20-50 x 4-10 um, hyaline, smooth, without incrusting pigments,
refractive connecting points often present at the septate portion or near to the
ending points of the pileal hyphae. STIPE COVERING similar to those of pileus
but refractive connecting points is less common. CLAMP CONNECTIONS absent
in all tissues.
Coniolepiota spongodes in Bangladesh & China... 345
10 pm
\
XY
——
FIGURE 3. Coniolepiota spongodes. a. Basidiospores. b. Basidia at different stages of development;
c. Stipe covering elements; d. Pileus covering elements; e. Cheilocystidia. (a = HKAS 77575;
b-e = HKAS 77576).
346 ... Hosen & Yang
Hasit & DIsTRIBUTION — Solitary or in small groups of two along roadsides
in forests of S. robusta, in Bangladesh. Known also from Sri Lanka, Thailand,
Singapore, Malaysia, tropical China.
SPECIMENS EXAMINED — BANGLADESH. RanGpvur Division: Thakurgaon, Pirganj,
Thumnia Sal Baghan, 70 ma.s.l., 18 July 2011, M.I. Hosen 239a (HKAS 77574; GenBank
KC625530, KC625531); 18 June 2012, M.I. Hosen 373 (HKAS 77575); Dinajpur, Birganj,
Singra Forest, 60 m a.s.l., 1 July 2013, M.I. Hosen 708 (SHAF 5); DHaka DIVISION:
Tangail, Madhupur, Madupur National Park, 20 m a.s.l, 3 August 2012, M.I. Hosen 561
(HKAS 77576). CHINA. YUNNAN PROVINCE: Luxi, Santai Mountain, 1200 m a.s.1., 29
July 1979, Zheng Wen Kang 79078 (HKAS 4848); Menhai, Mangao Nature Reserve,
1250 m a.s.l., 16 August 1991, Zhu L. Yang 1590 (HKAS 24071); Ruili, Nongdao, 1130
m a.s.l., 31 July 2003, Luo Hong 92 (HKAS 43631); HAINAN PROVINCE: Wuzhishan,
Wuzhishan Nature Reserve, 1867 m a.s.l., 1 August 2010, Z.W. Ge 2570 (HKAS 60246;
GenBank KC871015).
COMMENTS — Coniolepiota spongodes is restricted to southeast and south Asia.
It is an attractive species for mushroom pickers as it can be readily recognized by
the purplish to gray lilac coverings of the pileus and stipe surface. Distinguishing
microscopic characters include the absence of abundant cheilocystidia, small
smooth ellipsoid to oblong basidiospores, cylindrical elements in the pileal
and stipe coverings, and absence of clamp connections in all tissues. Vellinga,
who established Coniolepiota as an independent genus in Agaricaceae based
on morphological and molecular evidence, presented the full synonymy of
C. spongodes (Vellingaetal. 2011). According to Pegler (1972, 1986) basidiospores
of C. spongodes are dextrinoid, which was confirmed by our study. The Chinese
materials of C. spongodes also bear the same features that were observed in
Bangladesh specimens: pileus and stipe coverings gray purple, basidiospores
measuring [4/4/80] 4—5.5 x (2.5-)3-3.5(-4.0) um [Q = 1.41-1.67, Q. = 1.52
+ 0.118], ellipsoid, colorless, dextrinoid, inamyloid, slightly thick-walled, and
without germ pore. Vellinga et al. (2011) reported that the basidiospores from
Thai collections are pale or barely weakly dextrinoid in Melzer’s reagent.
Phylogenetically, C. spongodes nests within the Agaricus s.l. clade based
on multi-gene analysis with four different loci (ITS, nrLSU, tefl-a, and rpb2;
Vellinga et al. 2011). Coniolepiota spongodes is closely related to the colored-
spored genera Agaricus L., Heinemannomyces Watling, and Clarkeinda Kuntze
(Vellinga et al. 2011). In our molecular analysis H. splendidissima Watling
is strongly supported to be sister group to Coniolepiota with ML (96%) and
BI (1.0) values, followed by Agaricaceae sp., Eriocybe chionea Vellinga and
Clarkeinda trachodes (Berk.) Singer (Fic. 1). Vellinga et al. (2011) described
the genus Coniolepiota to include collections of C. spongodes from Malaysia,
Singapore, and Thailand. A collection from Thailand (ECV 3613), described as
having pink-tinges to the pileus and stipe, was designated as C. aff. spongodes
but not formally named. Minor differences in cheilocystidia shape and color
of basidiomata were possibly due to environmental variation. Inclusion of our
Coniolepiota spongodes in Bangladesh & China ... 347
Bangladesh and Chinese collections in phylogenetic analysis of ITS-nrLSU
support the recognition of a single species in the genus rather than two distinct,
sister species.
Acknowledgments
This study was supported by the Knowledge Innovation Program of the Chinese
Academy of Sciences (No. KSCX2-EW-Z-9). Dr. Zai-Wei Ge (China) is gratefully
acknowledged for providing photo of C. spongodes. The authors are grateful and sincere
thanks to Dr. Teresa Lebel (Australia) and Dr. Takamichi Orihara (Japan) for their
critical revision, comments, and reviewing this manuscript prior to submission.
Literature cited
Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue.
Phytochem. Bull. 19: 11-15.
Hosen MI, Feng B, Wu G, Zhu XT, Li YC, Yang ZL. 2013. Borofutus, a new genus of Boletaceae
from tropical Asia: phylogeny, morphology and taxonomy. Fungal Divers. 58(1): 215-226.
http://dx.doi.org/10.1007/s13225-012-0211-8
Hosen MI, Ge ZW. 2011. Clarkeinda trachodes (Agaricales, Basidiomycetes), first record from
Bangladesh. Mycotaxon 118: 331-336. http://dx.doi.org/10.5248/118.331
Pegler DN. 1972. A revision of the genus Lepiota from Ceylon. Kew Bull. 27: 155-202.
http://dx.doi.org/10.2307/4117880
Pegler DN. 1986. Agaric flora of Sri Lanka. Kew Bull. add. Series 12: 1-519.
Vellinga EC, Sysouphanthong P, Hyde KD. 2011. The family Agaricaceae: phylogenies and two new
white-spored genera. Mycologia 103(3): 494-509. http://dx.doi.org/10.3852/10-204
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. J. Bacteriol. 172: 4238-4246.
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a guide to
methods and applications. Academic, San Diego.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/124.349
Volume 124, pp. 349-352 April-June 2013
Pertusaria albiglobosa, a new lichen from China
QIANG REN
College of Life Science, Shandong Normal University, Jinan, 250014, China
CORRESPONDENCE TO: [email protected]
ABSTRACT — Pertusaria albiglobosa is described as new, based on collections from Shaanxi
province in China. The species is characterized by the white thallus, spherical verrucae,
asci with 2 smooth-walled ascospores, and the presence of 2'-O-methylperlatolic acid and
4,5-dichlorolichexanthone. It grows on rotten mosses in alpine meadow at elevations of
3570-3760 m.
Key worps — Pertusariaceae, Pertusariales, lichenized fungi, western China
Introduction
Species of Pertusaria DC. colonize almost all habitats. The apothecial
structure, the number and structure of the ascospores and the chemistry are
the diagnostic characters in identification of Pertusaria species (Oshio 1968,
Dibben 1980, Archer 1997, Schmitt & Lumbsch 2004). In China, the genus
received little attention until Zhao et al. (2004) published an annotated key to
the revised taxa of Pertusaria from China in which 41 species and 4 varieties
were accepted. A recent study of the Pertusaria specimens collected from
Qinling Mountains in western China revealed a new species, described here.
Materials & methods
All specimens examined are preserved in SDNU (the Lichen Section of Botanical
Herbarium, Shandong Normal University). An Olympus SZ 51stereomicroscope and
Olympus CX 21 compound microscope were routinely used for the morphological
and anatomical examinations. Colour reactions (spot tests) were made using standard
methods (Orange et al. 2001). The chemical constituents were identified using thin layer
chromatography (TLC) (Culberson 1972) and gradient-elution high performance liquid
chromatography (HPLC) (Lumbsch 2002).
Pertusaria albiglobosa Q. Ren, sp. nov. PLATE 1
MycoBank MB 804971
Differs from Pertusaria trochiscea by its 2-spored asci, its production of 2'-O-
methylperlatolic acid, and its lack of stictic acid.
350 ... Ren
a
Pate 1. Pertusaria albiglobosa (J.Zh. Zhao 899, SDNU). A. Thallus; B. Apothecium, cross-section;
C-D. Asci with 2 ascospores. Bars: A = 1 mm; B & C= 100 um; D = 50 um.
Type: China. Shaanxi: Taibai Co., Mt. Qinling, Baxiantai, 33°67'N 107°58’E, alt. 3760 m,
5 Aug. 2005, J.Zh. Zhao 899 (Holotype, SDNU).
Erymo oey: Latin albiglobosa, referring to the colour of the thallus and the shape of
the fertile verrucae.
THALLUS white or whitish-gray, episubstratal, thin or fairly thick, the margin
entire and unzoned; suRFACE tuberculate, matt and continuous; IsIDIA AND
SOREDIA absent. VERRUCAE numerous, crowded or well dispersed, but
occasionally fused, (0.5-)0.7-1.0(-1.2) mm in diameter, concolorous with
the thallus, persistently closed and appearing as a spherical protuberance;
Pertusaria albiglobosa sp. nov. (China) ... 351
OSTIOLES single, black. APOTHECIA 1 (occasionally 2-3) per verruca, the fruit
center hyaline; EPITHECIUM brown, K+ violet, hypothecium hyaline, hymenium
colorless, 325-450 um thick. Asci clavate or cylindric; AscosPORES 2 per ascus,
uniseriate, ellipsoid to fusiform (at times deformed), 63-135(-163) x 30-55
um, the spore wall double, smooth, 7.5-10 um thick, and usually trimmed, the
end wall 12.5-17.5 um thick. Pycnrp1a unknown.
SPOT TESTS — cortex: all chemical tests negative, UV-; medulla: all chemical
tests negative.
SECONDARY METABOLITES — 4,5-dichlorolichexanthone and 2’-O-
methylperlatolic acid (HPLC).
EcoLocy — Pertusaria albiglobosa is a muscicolous species occurring in
alpine meadows. It is known only from Shaanxi province (western China) at
elevations of 3570-3760 m.
ADDITIONAL SPECIMENS EXAMINED — CHINA. SHAANXI: Taibai Co., Mt. Qinling,
Wengong Temple, alt. 3570 m, 5 Aug. 2005, Ch.L Wang & F. Yang TBW052 (SDNU); alt.
3600 m, 5 Aug. 2005, Sh.X. Guo & YJ. Li QL004 (SDNU)); Baxiantai, alt. 3767 m, 5 Aug.
2005, Sh.X. Guo & X.L. Shi QL191 (SDNU).
Comments — Pertusaria albiglobosa is characterised by the matte white thallus,
spherical verrucae, 2-spored asci, smooth-walled spores, and chemistry. In
morphology and habitat, this species is very similar to P trochiscea Norman and
Megaspora verrucosa (Ach.) L. Arcadia & A. Nordin, which differ in number
of ascospores per ascus and the chemistry: P trochiscea produces 4 spores
per ascus and 4,5-dichlorolichexanthone and stictic acid, and M. verrucosa
produces 8 spores per ascus and no lichen products. Pertusaria saximontana
Wetmore also has a similar anatomy and chemistry but is readily distinguished
by the shiny gray thallus, wide blackish discs usually surrounded by an eroded
inner verrucal margin, smaller ascospores, and its habitats. Pertusaria signyae
@Ovstedal, which might be confused with the new species, is also a muscicolous
(also saxicolous) species with 2 smooth spores per ascus, but it has isidia and
contains 2’-O-methylperlatolic acid only.
Acknowledgements
The author is grateful to Prof. Jack Elix (Australian National University) for his help in
confirming the chemistry and to Dr. Alan W. Archer (Royal Botanic Gardens, Australia)
for professional advice. The author thanks Drs. André Aptroot (ABL Herbarium, Soest,
The Netherlands) and Shouyu Guo (Institute of Microbiology, CAS) for presubmission
review. This study was supported by the National Natural Science Foundation (nos.
31100011 & 31093440).
Literature cited
Archer AW. 1997. The lichen genus Pertusaria in Australia. Bibliotheca Lichenologica 69: 1-249.
Culberson CE. 1972. Improved conditions and new data for the identification of lichen products
by a standardized thin-layer chromatographic method. Journal of Chromatography A 72:
113-125. http://dx.doi.org/10.1016/0021-9673(72)80013-X
352... Ren
Dibben MJ. 1980. The chemosystematics of the lichen genus Pertusaria in North America North of
Mexico. Publications in Biology and Geology, Milwaukee Public Museum 5: 1-162.
Lumbsch HT. 2002. Analysis of phenolic products in lichens for identification and taxonomy.
281-295, in: I Kranner et al. (eds). Protocols in Lichenology. Berlin: Springer Verlag.
Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.
London: British Lichen Society.
Oshio M. 1968. Taxonomical studies on the family Pertusariaceae of Japan. Journal of Science of
the Hiroshima University, Series B, Div. 2 (Botany) 12: 81-151.
Schmitt I, Lumbsch HT. 2004. Molecular phylogeny of the Pertusariaceae supports secondary
chemistry as an important systematic character set in lichen-forming ascomycetes. Molecular
Phylogenetics and Evolution 33: 43-55. http://dx.doi.org/10.1016/j.ympev.2004.04.014
Zhao ZT, Ren Q, Aptroot A. 2004. Anannotated key to the lichen genus Pertusariain China. Bryologist
107(4): 531-541. http://dx.doi.org/10.1639/0007-2745(2004)107[531:AAKTTL]2.0.CO;2
Zhurbenko MP, Lumbsch HT. 2006. Pertusaria christae is a synonym of P. saximontana.
Lichenologist 38(5): 487-490. http://dx.doi.org/10.1017/S0024282906005767
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/124.353
Volume 124, pp. 353-359 April-June 2013
Lichenological notes 6: nomenclatural acts
KERRY KNUDSEN” & JANA KOCOURKOVA?’
'The Herbarium, Department of Botany and Plant Sciences, University of California,
Riverside, CA 92521-0124, U.S.A.
*Department of Ecology, Faculty of Environmental Sciences, Czech University of Life Sciences,
Prague, Kamycka 129, Praha 6 - Suchdol, CZ-165 21, Czech Republic
CORRESPONDENCE TO: '’[email protected] & [email protected]
ABSTRACT — Lecanora peltastictoides is transferred to Aspicilia. Thelenella americana is
treated as Melanophloea americana and T: montana as M. montana. Sarcogyne athroocarpa
is treated as a synonym of Acarospora badiofusca and a lectotype is designated. Pleopsidium
stenosporum is treated as a synonym of P. flavum.
Key worps — Acarosporaceae, Joshua Tree National Park, Thelocarpaceae
The species
Acarospora badiofusca (Nyl.) Th. Fr., Nova Acta Regiae Soc. Sci. Upsal.,
Ser. 3: 3 190 (1861).
= Lecanora badiofusca Nyl., Herb. Mus. Fenn.: 110 (1859).
Type: Ad saxa granitica in Lapponia, Nylander s.n. (H-NYL! holotype).
= Sarcogyne athroocarpa H. Magn., Ann. Crypt. Exot. 7: 137 (1935) [“1934”], syn. nov.
Tye: U.S.A., Colorado, Boulder Co., Sugar Loaf, 2743 m, on granite, Aug. 1898, Morgan
s.n., Lichenes Boreali-Americani 227 (FH! holotype, destroyed by sampling?; COLO!
L-79776, lectotype designated here).
The holotype collection of Sarcogyne athroocarpa has only a Lecidea
species remaining, and the Sarcogyne is presumed to have been destroyed by
sampling. In COLO we have discovered a syntype of S. athroocarpa, originally
identified by W.A. Weber, which we designate as a lectotype. Unfamiliar with
extremely reduced forms of A. badiofusca in North America at high elevations,
H. Magnusson, who described the reduced dispersed apothecia of A. badiofusca
as an endolithic Sarcogyne, suggested that its sterile areoles represented another
“Acarospora” species (Magnusson 1935). As with A. badiofusca, the hymenium
is low (60-70 um) and the perithecial crown (exciple) is brown (it often becomes
354 ... Knudsen & Kocourkova
blackened in many specimens). Therefore, we place Sarcogyne athroocarpa in
synonymy with A. badiofusca.
"ty
PLATE 1. Aspicilia peltastictoides (Knudsen et al. 14420, UCR),
Coxcomb Mountains, Joshua Tree National Park. (Tim Wheeler, photo). Scale bar = 1 mm.
Aspicilia peltastictoides (Hasse) K. Knudsen & Kocourk., comb. nov. PLATE 1
MycoBank MB 803946
= Lecanora peltastictoides Hasse, Bryologist 17: 63 (1914).
Type: U.S.A., California, Palm Springs, on granite, 1901, Hasse 861 (FH!, holotype)
In 1914, the pioneer California lichenologist H.E. Hasse (1836-1915)
described Lecanora peltastictoides from granite in the Sonoran Desert in Palm
Springs, California. During the revision of Lecanora for the Sonoran Lichen
Flora, no specimens besides the type were seen, and the species remained
unrevised but recognized as an Aspicilia (Knudsen 2003; Ryan et al. 2004).
During our inventory of Joshua Tree National Park, we collected five specimens
of Lecanora peltastictoides in the Mojave and Sonoran Deserts.
Lecanora peltastictoides is an Aspicilia with small ascospores (mostly 12-13
x 9-10 um), eight per ascus, a white striated thallus, black pruinose apothecia
with elevated crenulate margins, and no secondary metabolites. No conidia have
been observed. It occurs on granite, usually on softer decaying rock at Joshua
Tree National Park. There are only two other Aspicilia species in California
with similar sized ascospores. Both species, A. brucei Owe.-Larss. & A. Nordin
and A. cinerea (L.) K6rb., can easily be distinguished from A. peltastictoides
Lichenological notes 6... 355
by their production of norstictic acid. Aspicilia peltastictoides looks similar
to two other lichen species in southern California, Acarospora strigata (Nyl.)
Jatta and Lecanora utahensis H. Magn. The polyspored asci easily distinguish
A. strigata from A. peltastictoides. An older name for A. strigatain North America
is A. peltasticta Zahlbr., which explains the etymology of the specific name of
peltastictoides. Lecanora utahensis has been confused with A. peltastictoides
not only because they look similar, but because they both have similar sized
ascospores (Knudsen & Lendemer 2006; Knudsen 2012). Lecanora utahensis,
a member of the Lecanora dispersa group (Sliwa 2007), differs especially in the
production of isousnic acid and the Lecanora-type ascus stain. We regard both
A. peltastictoides and L. utahensis as rare in California.
ADDITIONAL SPECIMENS EXAMINED — U.S.A., California, Riverside Co., Little San
Bernardino Mountains, Berdoo Canyon, 1025 m, rare on granite along wash, 7 Dec.
2010, Knudsen 12869.2 & Harding (UCR); upper Covington Flats, 1426 m, on granite,
9 Nov. 2011, Knudsen 14043 & Kocourkova (UCR); SAN BERNARDINO Co., 49 Palms
Canyon, 844 m, on granite boulder in palm oasis, 29 Dec. 2010, Knudsen 13469 (UCR);
Coxscomb Mountains, 635 m, on decaying granite boulder, 7 Dec. 2011, Knudsen et al.
14420 (UCR).
Melanophloea americana K. Knudsen & Lendemer, Opusc. Philolich. 9: 61 (2011).
= Thelenella americana (K. Knudsen & Lendemer) Aptroot, Lichenologist 44: 504 (2012).
Type: U.S.A., Pennsylvania, Montgomery Co., Pennypack Watershed, on silicate rock,
Nov. 1987, A. Aptroot 21376 (NY! holotype; ABL[n.v.], BR[n.v.], isotypes).
Melanophloea montana P.M. McCarthy, Australas. Lichenol. 62: 26 (2008).
= Thelenella montana (P.M. McCarthy) Aptroot, Lichenologist 44: 506 (2012).
Type: Australia, Queensland, Atherton Tableland, Tully Falls, on siliceous rock, 7 August
2006, McCarthy 2520 (CANB, holotype, n.v.).
Melanophloea (Thelocarpaceae) contains three species. The type of the genus
is M. pacifica P. James & Vézda, described from the Solomon Islands (James
& Vézda 1971). The saxicolous M. montana was described from Australia
(McCarthy 2008), and the saxicolous M. americana was described from
eastern North America (Knudsen et al. 2011). Recently Aptroot & Schumm
(2012) transferred M. americana and M. montana from the Thelocarpaceae
to Thelenella in the Thelenellaceae. Melanophloea americana and M. montana
differ from Thelenella species in the following important characters that were
overlooked by these authors:
1. Melanophloea americana and M. montana have Thelocarpon-like ascomata
that are apothecioid with an inner wall that is an incurving exciple, reducing
the size of the hymenial disc (clearly visible when wetted), and an outer wall
that is basically a thalline margin (Salisbury 1966; Horakova 1998; Knudsen
& Lumbsch 2007; McCarthy 2008; Knudsen et al. 2011). In M. americana and
356 ... Knudsen & Kocourkova
M. pacifica, algae are scattered between the outer and inner walls, extending
up from the algal layer in the thallus. This apothecioid fruiting body differs
fundamentally from the single-walled perithecia of Thelenella species
(Mayrhofer & Poelt 1985; Mayrhofer 2002; Orange et al. 2009).
2. Melanophloea americana and M. montana differ from Thelenella species in
having apothecioid ascomata with distinct outer and inner walls. The outer or
thalline wall of the ascomata in the Melanophloea species is melanized, with the
melanization of the outer thalline wall possibly protecting the algae beneath.
The inner wall (an incurving exciple) is hyaline. Aptroot & Schumm (2012)
misinterpreted the outer wall of M. americana as a clypeus, which we define as
a wall in corticolous species formed of fungal and bark cells, not the melanized
wall of a saxicolous fungus containing no distinct substrate particles and which
is basically thalline (Nash et al. 2002). Thelenella has single-walled perithecia,
also without a clypeus using the definition we accept (Mayrhofer & Poelt 1985;
Mayrhofer 2002; Orange et al. 2009).
3. Melanophloea americana and M. montana have hyaline simple ascospores
in polyspored asci with a K/I+ blue stain, while all Thelenella taxa have
2-8-spored asci with a K/I- stain and large muriform or submuriform spores
(Mayrhofer & Poelt 1985; Mayrhofer 2002; Orange et al. 2009).
Based on these characters we reject the emendation of Thelenellaceae proposed
by Aptroot & Schumm (2012). The speculations of Aptroot & Schumm (2012)
about the evolutionary development of polyspory are not relevant in this case
because M. americana and M. montana are not Thelenella species.
The radical emendation of Thelenella by Aptroot & Schumm (2012) lacks
not only convincing morphological evidence but molecular support. While
we are open to the possibility that M. americana and M. montana are not
congeneric with M. pacifica, to radically emend another genus and family
lacking molecular data and strong morphological support is speculative
and undermines nomenclatural stability. That molecular data are required
to confirm their hypothesis is reinforced by the fact that M. americana and
M. montana differ from Thelenella in significant morphological characters.
Until these further results are obtained, we treat T. americana and T: montana
as members of Melanophloea using the names M. americana and M. montana.
It should be noted that Aptroot & Schumm (2012) cited inaccurate type
collections for Melanophloea americana. When the name M. americana was
introduced, the type collection was clearly stated to be Aptroot 21376 (with
the holotype deposited at NY). A second collection from the same site as the
holotype, Aptroot 21389, was used by NY curator R.C. Harris to produce
the microscopic images for the protologue to preserve the holotype material.
Although Aptroot 21389 was cited in the figure caption in the protologue, it
was inadvertently omitted from list of additional specimens examined. This
Lichenological notes 6 ... 357
collection (Aptroot 21389) is a paratype or a topotype of M. americana, but it is
not an isotype as stated by Aptroot & Schumm (2012: 504), because a separate
collection number clearly indicates it does not represent part of the same
gathering as the type. The holotype of M. americana consists of a large rock,
with abundant and well developed thalli and ascomata. Although the quality
of a specimen is irrelevant from a nomenclatural standpoint, this particular
collection was selected as the type because of its exemplary condition compared
with the other available material.
PLATE 2. Pleopsidium flavum (Knudsen 12911, UCR), Joshua Tree National Park.
(Tim Wheeler, photo). Scale bar = 1 mm.
Pleopsidium flavum Korb., Syst. Lich. Germ.: 113 (1855). PLATE 2
TyPeE: Switzerland, Schaerer, Lich. Helvet. exs. No. 335, sub Parmelia flava a oxytona
(GZU, neotype, designated by Hafellner 1993, n.v.).
= Lecanora stenospora Stizenb. ex Hasse, Bull. Torrey Bot. Club 24: 447. 1897, syn. nov.
= Acarospora stenospora (Stizenb. ex Hasse) Hue, Nouv.
Arch. Mus. Hist. Nat., Sér. 5, 1: 161 (1909).
= Acarospora stenospora (Stizenb. ex Hasse) Zahlbr., Cat.
Lich. Univ. 5: 108 (1928), nom. illeg. superf.
= Pleopsidium stenosporum (Stizenb. ex Hasse) K.
Knudsen, Opusc. Philolich. 9: 79 (2011).
Type: U.S.A., California, [Los Angeles or San Bernardino Co.] San Gabriel Mountains,
above 800 m, on unknown rock type with some HCl+ inclusions, 1895, Hasse s.n. (NY!
[Hasse Herb. No. 3682], neotype designated Knudsen 2011).
358 ... Knudsen & Kocourkova
Lecanora stenospora was described from the San Gabriel Mountains in
southern California. The holotype was missing from ZT and a neotype
from NY was designated. The name was transferred to Pleopsidium based
on its distinctive Pleopsidium-type ascus stain (Knudsen 2011). Due to the
dispersed thallus, wandering lines of areoles, and a possible difference in the
production of secondary metabolites, P. stenosporum was tentatively treated as
a separate species from P. flavum. Field studies in Joshua Tree National Park
and Yosemite National Park by the first author, as well as in Montana by Tim
Wheeler, convinced us that the normally contiguous and effigurate thallus
of P. flavum will become dispersed or form long lines of areoles, especially
when growing in shaded overhangs or if infected with Lichenostigma saxicola
K. Knudsen & Kocourk. Michalova (2012), who investigated the neotype for
secondary metabolites, detected acaranoic acid, a substance typically present
with rhizocarpic acid in P flavum. Since P. stenosporum does not differ from
P. flavum in thallus morphology or secondary metabolites, it is treated as a
synonym of P. flavum, which is common in North America.
Acknowledgments
We thank our reviewers, J.C. Lendemer (NY) and P.M. McCarthy (Australia). The
work of Kerry Knudsen was supported by a co-operative agreement between Joshua
Tree National Park and the University of California at Riverside. The work of Jana
Kocourkova was supported financially by the Kontaxr H, Program of International
Cooperation in Research and Development for scientific cooperation between the
CR and USA, LH 11057 from Ministry of Education, Youth and Sports. We thank for
their help the curators of COLO, FH, and ZT. We thank Tim Wheeler (Montana) for
discussion about Pleopsidium and for the figures.
Literature cited
Aptroot A, Schumm F, 2012. The genus Melanophloea, an example of convergent evolution towards
polyspory. Lichenologist 44: 501-509. http://dx.doi.org/10.1017/S0024282912000035
Hafellner J. 1993. Acarospora und Pleopsidium - zwei lichenisierte Ascomycetengattungen
(Lecanorales) mit zahlreichen Konvergenzen. Nova Hedwigia 56: 281-305.
Horakova J. 1998. Distribution and ecology of the genus Thelocarpon (Lecanorales, Thelocarpaceae)
in the Czech Republic. Czech Mycology 50: 271-302.
James PW, Vézda A. 1971. Melanophloea P. James & Vézda, a new lichen genus. Lichenologist 5:
89-91. http://dx.doi.org/10.1017/S0024282971000112
Knudsen K. 2003. Type specimens: investigations and observations. Bulletin of the California
Lichen Society 10(2): 36-38.
Knudsen K. 2011. A preliminary study of Pleopsidium stenosporum (Stizenb. ex Hasse) K. Knudsen.
Opuscula Philolichenum 9: 77-83.
Knudsen K. 2012. Notes on the California Lichen Flora # 4. Bulletin of the California Lichen
Society 19(1): 4-7.
Knudsen K, Kocourkova J. 2012. Lichenological notes 3: Sarcogyne plicata in California. Mycotaxon
118: 423-431. http://dx.doi.org/10.5248/118.423
Lichenological notes 6 ... 359
Knudsen K, Kocourkova J. 2013 [“2012”]. Lichenological notes 5: neotypification of Sarcogyne
magnussonii (Acarosporaceae). Mycotaxon 121: 139-145. http://dx.doi.org/10.5248/121.139
Knudsen K, Lendemer JC. 2006. Changes and additions to the North American lichen mycota — V.
Mycotaxon 95: 309-313.
Knudsen K, Lumbsch HT. 2007 [“2008”]. Thelocarpon. 301-302, in: TH Nash III et al. (eds). Lichen
Flora of the Greater Sonoran Desert Region. Volume 3. Lichens Unlimited, Arizona State
University, Tempe.
Knudsen K, Lendemer JC, Harris RC. 2011. Lichens and lichenicolous fungi - no. 15: miscellaneous
notes on species from eastern North America. Opuscula Philolichenum 9: 45-75.
Magnusson AH. 1935 [“1934”]. On the species of Biatorella and Sarcogyne in America. Annales de
Cryptogamie Exotique 7: 115-145.
Mayrhofer H. 2002. Thelenella. 479-481, in: TH Nash III et al. (eds). Lichen Flora of the Greater
Sonoran Desert Region. Volume 1. Lichens Unlimited, Arizona State University, Tempe.
Mayrhofer H, Poelt J. 1985. Die Flechtengattung Microglaena sensu Zahlbruckner in Europa.
Herzogia 7: 13-79.
McCarthy P. 2008. A new species of Melanophloea ( Thelocarpaceae) from north-eastern Queensland.
Australasian Lichenology 62: 26-28.
Michalova M. 2012. Chemistry of lichens of southwest Mojave Desert. 101 p., Ms [Dipl. Pr.; depon.
in: Faculty of Environmental Sciences, Czech University of Life Sciences, Praha]. [Duplicate
copy in library of New York Botanical Garden].
Nash III TH, Ryan BD, Gries C, Bungartz F. 2002. Lichen Flora of the Great Sonoran Desert Region.
Volume 1. Lichens Unlimited, Arizona State University, Tempe. 532 p.
Orange A, Purvis OW, James PW. 2009. Thelenella Nyl. (1855). 877-879, in: CW Smith et al. (eds).
The Lichens of Great Britain and Ireland. British Lichen Society, Natural History Museum Pub.,
UK.
Ryan BD, Lumbsch HT, Messuti MI, Printzen C, Sliwa L, Nash III TH. 2004. Lecanora. 176-286, in:
TH Nash II/ et al. (eds). Lichen Flora of the Greater Sonoran Desert Region. Volume 2. Lichens
Unlimited, Arizona State University, Tempe.
Salisbury G 1966. A monograph of the lichen genus Thelocarpon Nyl. Lichenologist 3: 175-196.
http://dx.doi.org/10.1017/S0024282966000197
Sliwa L. 2007. A revision of the Lecanora dispersa complex in North America. Polish Botanical
Journal 52(1): 1-70.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/124.361
Volume 124, pp. 361-365 April-June 2013
Phylloporia tiliae sp. nov. from China
L1-WEI ZHOU
State Key Laboratory of Forest and Soil Ecology, Institute of Applied Ecology,
Chinese Academy of Sciences, Shenyang 110164, PB. R. China
CORRESPONDENCE TO: [email protected]
ABSTRACT — A new species, Phylloporia tiliae, is described and illustrated from Hunan
Province, China. It is distinguished from other Phylloporia species by its combination of a
perennial habit, pileate basidiocarps, a crusted pileal surface with tomentose margin, minute
pores, and a monomitic hyphal system.
Key worps — Hymenochaetaceae, Hymenochaetales, polypore, taxonomy
Introduction
Phylloporia Murrill was erected for P. parasitica Murrill, growing on living
leaves (Murrill 1904). Most species of this genus have been found on living
trees and also sometimes on dead wood (Zhou & Dai 2012). The genus has a
worldwide distribution (Ryvarden & Johansen 1980, Gilbertson & Ryvarden
1987, Ryvarden & Gilbertson 1994, Nufez & Ryvarden 2000, Dai 2010, 2012),
and includes a total of 24 species (Zhou & Dai 2012, Decock et al. 2013).
Phylloporia is a monophyletic genus within the Hymenochaetaceae
(Valenzuela et al. 2011, Zhou & Dai 2012). All Phylloporia species share
abundant thick-walled tiny colored basidiospores and lack setae (Wagner &
Ryvarden 2002, Ipulet & Ryvarden 2005, Douanla-Meli et al. 2007, Cui et al.
2010, Valenzuela et al. 2011, Zhou & Dai 2012); however, this genus is highly
diverse in morphology and life strategy (see Zhou & Dai 2012 for detail).
Cui et al. (2010) reported two new species of Phylloporia from South China.
Recently, Zhou & Dai (2012) described five new species from all over China
based on morphological and phylogenetic evidence and provided a key to
worldwide species thus far accepted in Phylloporia. However, there are still a
number of Chinese specimens that show generic characters but have not been
identified to species level. One of these is described and illustrated here as
Phylloporia tiliae.
362 ... Zhou
Materials & methods
The holotype specimen was deposited at the herbarium of Institute of Applied
Ecology, Chinese Academy of Sciences, Shenyang, P.R. China (IFP). The microscopic
procedure follows Zhao et al. (2013). The following abbreviations are used:
IKI = Melzer’s reagent, IKI- = inamyloid and non-dextrinoid, CB = Cotton Blue,
CB(+) = weakly cyanophilous, KOH = 5% potassium hydroxide, L = mean basidiospore
length (arithmetic average of all basidiospores), W = mean basidiospore width
(arithmetic average of all basidiospores), Q = variation in the L/W ratios between the
specimens, and n = number of basidiospores measured/number of specimens measured.
Sections prepared in IKI, CB and KOH solutions were studied using a Nikon Eclipse
80i microscope at magnifications up to x1000. When presenting the basidiospore size
variation, the upper and lower 5% of measurements are excluded from the range and the
extreme values are presented in parentheses. Line drawings were made with the aid of a
light tube. Special color terms follow Petersen (1996).
Taxonomy
Phylloporia tiliae L.W. Zhou, sp. nov. FIGURE 1
MycoBank MB 804993
Differs from Phylloporia pectinata in its monomitic hyphal system and narrower
basidiospores.
Type: China. Hunan Province, Zhangjiajie, Tianmenshan National Forest Park, on living
Tilia (Malvaceae), 19.V1II.2010, Yuan 5491 (holotype, IFP).
ErymMo_oey: tiliae (Lat.): refers to the host genus.
BASIDIOCARPS perennial, pileate, single, without odor or taste when fresh.
PrLEI dimidiate, projecting up to 7.5 cm, 5.5 cm wide, and 2 cm thick at base.
PILEAL SURFACE glabrous, crust, mouse-grey, azonate; MARGIN tomentose,
obtuse, curry-yellow to yellowish brown, a distinct groove between margin and
other part of the pileal surface. PORE SURFACE honey-yellow, glancing; STERILE
MARGIN distinct, curry-yellow, up to 1 mm wide; Porgs circular, 9-12 per mm;
DISSEPIMENTS thin, entire. CONTEXT duplex when juvenile, up to 6.5 mm thick,
with a black line, the lower context woody hard, yellowish brown, up to 2.5
mm thick, upper context as a tomentum, soft corky, cinnamon-buff, yellowish
brown, up to 4 mm thick, the black line becoming a crust with age. TUBEs
yellowish brown, woody, each layer up to 1 mm long.
HYPHAL SYSTEM monomitic; GENERATIVE HYPHAE simple septate; tissue
becoming reddish brown in KOH but otherwise unchanged. CONTEXTUAL
HYPHAE pale yellowish to yellowish, slightly thick- to thick-walled with a wide
lumen, rarely branched, frequently simple septate, straight, regularly arranged,
2.5-4.5 um in diam; HYPHAE IN TOMENTUM yellowish brown, slightly thick-
walled, occasionally branched, frequently simple septate, loosely interwoven,
2-5 um in diam; HYPHAE IN THE BLACK ZONE (CRUST) dark brown, distinctly
thick-walled with a narrow lumen, strongly agglutinate, interwoven. TRAMAL
Phylloporia tiliae sp. nov. (China) ... 363
oOo Cc CG G
Figure 1. Phylloporia tiliae (holotype).
a: Basidiospores. b: Basidia and basidioles.
c: Hyphae from trama. d: Hyphae from the lower context.
HYPHAE hyaline, thin-walled to yellowish, thick-walled with a wide to narrow
lumen, rarely branched, frequently simple septate, more or less straight,
subparallel along the tubes, 2-4 um in diam. SETAE absent; cysTrp1A absent;
CYSTIDIOLES absent. Basip1A barrel-shaped with four sterigmata and a simple
septum at the base, 4-6 x 3-4.5 um; BASIDIOLES dominant, similar to basidia
in shape, but slightly smaller. Basip1osporss ellipsoid, yellowish, thick-walled,
smooth, IKI-, CB(+), (2.8-)3-3.4(-3.5) x (1.9-)2-2.5(-2.6) um, L = 3.17 um,
W = 2.29 um, Q = 1.38 (n = 30/1).
REMARKS: Phylloporia tiliae has thick-walled tiny colored basidiospores
and lacks setae, fulfilling the morphological characters of Phylloporia. The
new species is characterized by the combination of a perennial habit, pileate
basidiocarps, a crusted pileal surface with tomentose margin, small pores, and
a monomitic hyphal system.
Macroscopically, Phylloporia crataegi L.W. Zhou & Y.C. Dai, P. ephedrae
(Woron.) Parmasto, P gutta L.W. Zhou & Y.C. Dai, P. pectinata (Klotzsch)
364 ... Zhou
Ryvarden, and P_ ribis (Schumach.) Ryvarden share perennial pileate
basidiocarps with P tiliae. However, P. crataegi, P. ephedrae, P. gutta, and P. ribis
have larger pores (<9 per mm; Wagner & Ryvarden 2002, Zhou & Dai 2012).
Phylloporia pectinata has pores (8-10 per mm) similar in size to those of
P. tiliae, and both species also share a black crust at the old part of pileal surface
and duplex context; however, P. pectinata has a zonate and sulcate pileal surface
with acute margin and (more importantly) a dimitic hyphal system and wider
basidiospores (3 um wide; Wagner & Ryvarden 2002).
Phylloporia fontanesiae L.W. Zhou & Y.C. Dai also has small pores (10-12 per
mm) and a monomitic hyphal system like P. tiliae, but its annual habit, zonate
sulcate pileal surface with acute margin, and shorter basidiospores (2.6-3 um
long; Zhou & Dai 2012) distinguish it from P. tiliae. In addition, P. fontanesiae
was found on living Fontanesia (Oleaceae) in temperate China in Henan (Zhou
& Dai 2012) and Shandong (data unpublished) provinces.
Phellinus minisporus B.K. Cui & Y.C. Dai, which was described from southern
China and has similar pores, differs from Phylloporia tiliae in its resupinate
habit, abundant hymenial setae, and smaller basidiospores (Cui et al. 2009).
Some Phylloporia species often inhabit living trees, affecting leaves, twigs,
branches, and trunk bases, and have an exclusive host-specificity (Zhou &
Dai 2012). This phenomenon exists in certain species of Inonotus linteus
complex as well (Tian et al. 2003). Therefore, it is important to record the host
information when collecting specimens of Phylloporia and even other genera
in Hymenochaetaceae.
Acknowledgements
Dr. Deepika Kumari (Xinjiang Institute of Ecology and Geography, Chinese Academy
of Sciences, China) is thanked for improving this manuscript. I express my gratitude
to Prof. Yu-Cheng Dai (Beijing Forestry University, China) and Dr. Viacheslav Spirin
(Helsinki University, Finland) who reviewed the manuscript before final submission.
The research was financed by the National Natural Science Foundation of China (Project
No. 31200015).
Literature cited
Cui BK, Dai YC, Bao HY. 2009. Wood-inhabiting fungi in southern China 3. A new species of
Phellinus (Hymenochaetales) from tropical China. Mycotaxon 110: 125-130.
Cui BK, Yuan HS, Dai YC. 2010. Two new species of Phylloporia (Basidiomycota, Hymenochaetaceae)
from China. Mycotaxon 113: 171-178. http://dx.doi.org/10.5248/113.171
Dai YC. 2010. Hymenochaetaceae (Basidiomycota) in China. Fungal Divers. 45: 131-343.
http://dx.doi.org/10.1007/s13225-010-0066-9
Dai YC. 2012. Polypore diversity in China with an annotated checklist of Chinese polypores.
Mycoscience 53: 49-80. http://dx.doi.org/10.1007/s10267-011-0134-3
Decock C, Amalfi M, Robledo G, Castillo G. 2013. Phylloporia nouraguensis, an undescribed
species on Myrtaceae from French Guiana. Cryptogam. Mycol. 34: 15-27.
http://dx.doi.org/10.7872/crym.v34.iss1.2013.15
Phylloporia tiliae sp. nov. (China) ... 365
Douanla-Meli C, Ryvarden L, Langer E. 2007. Studies of tropical African pore fungi (Basidiomycota,
Aphyllophorales): three new species from Cameroon. Nova Hedwigia 84: 409-420.
http://dx.doi.org/10.1127/0029-5035/2007/0084-0409
Gilbertson RL, Ryvarden L. 1987. North American polypores 2. Fungifora, Oslo. pp. 434-885.
Ipulet P, Ryvarden L. 2005. New and interesting polypores from Uganda. Syn. Fungorum 20:
87-99.
Murrill WA. 1904. The Polyporaceae of North America-IX. Bull. Torrey Bot. Club 31: 593-610.
Nujiez M, Ryvarden L. 2000. East Asian polypores 1. Ganodermataceae and Hymenochaetaceae.
Syn. Fungorum 13: 1-168.
Petersen JH. 1996. Farvekort. The Danish Mycological Society’s colour-chart. Foreningen til
Svampekundskabens Fremme, Greve. 6 p.
Ryvarden L, Gilbertson RL. 1994. European polypores 2. Syn. Fungorum 7: 388-743.
Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Fungiflora, Oslo. 636 p.
Tian XM, Yu HY, Zhou LW, Decock C, Vlasak J, Dai YC. 2013. Phylogeny and taxonomy of the
Inonotus linteus complex. Fungal Divers. 58: 159-169.
http://dx.doi.org/10.1007/s13225-012-0202-9
Valenzuela R, Raymundo T, Cifuentes J, Castillo G, Amalfi M, Decock C. 2011. Two undescribed
species of Phylloporia from Mexico based on morphological and phylogenetic evidence. Mycol.
Prog. 10: 341-349. http://dx.doi.org.10.1007/s11557-010-0707-0
Wagner T, Ryvarden L. 2002. Phylogeny and taxonomy of the genus Phylloporia (Hymenochaetales).
Mycol. Prog. 1: 105-106. http://dx.doi.org/10.1007/s11557-006-0009-8
Zhao CL, Cui BK, Dai YC. 2013. New species and phylogeny of Perenniporia based on morphological
and molecular characters. Fungal Divers. 58: 47-60.
http://dx.doi.org/10.1007/s13225-012-0177-6
Zhou LW, Dai YC. 2012. Phylogeny and taxonomy of Phylloporia (Hymenochaetales): new species
and a worldwide key to the genus. Mycologia 104: 211-222. http://dx.doi.org/10.3852/11-093
ISSN (print) 0093-4666 © 2013 Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/124.367
Volume 124, pp. 367-368 April-June 2013
NOMENCLATURAL NOVELTIES AND TYPIFICATIONS
PROPOSED IN MYCOTAXON 124
Arenariomyces truncatellus Jorg. Koch, p. 70
Aspicilia peltastictoides (Hasse) K. Knudsen & Kocourk., p. 354
Beauveria sinensis Ming J. Chen, Z.Z. Li & B. Huang, p. 304
Cantharocybe virosa (Manim. & K.B. Vrinda) T.K.A. Kumar, p. 235
Chaetomium jatrophae Rohit Sharma, p. 120
Cladonia dunensis Gumboski, Beilke & Eliasaro, p. 334
Coleosporium tussilaginis f.sp. doronici S. Helfer, p. 92
Coleosporium tussilaginis f.sp. inulae S. Helfer, p. 92
Coleosporium tussilaginis f.sp. telekiae S. Helfer, p. 96
Entoloma shandongense T. Bau & J.R. Wang, p. 166
Glomus mume B.P. Cai, Jun Y. Chen, Q.X. Zhang & L.D. Guo, p. 264
Hypochnicium pini Y. Jang & J.J. Kim, p. 211
Inonotus niveomarginatus H.Y. Yu, C.L. Zhao & Y.C. Dai, p. 62
Inonotus tenuissimus H.Y. Yu, C.L. Zhao & Y.C. Dai, p. 64
Kuklospora spinosa B.P. Cai, Jun Y. Chen, Q.X. Zhang & L.D. Guo, p. 265
Lactarius rubidus (Hesler & A.H. Sm.) Methven, p. 324
Leccinellum quercophilum M. Kuo, p. 327
Lyromma coronatum Flakus & Farkas, p. 128
Lyromma multisetulatum Flakus & Farkas, p. 130
Myrmecridium obovoideum Jie, Y.L. Jiang, McKenzie & Yong Wang bis, p. 5
Pertusaria albiglobosa Q. Ren, p. 349
Phialophora avicenniae Yue L. Liu & Z.D. Jiang, p. 33
Phylloporia tiliae L.W. Zhou, p. 362
Pisolithus calongei M.P. Martin, Phosri & Watling, p. 151
Polycoccum anatolicum Halici & E. Akgiil, p. 46
Russula atroaeruginea G,J. Li, Q. Zhao & H.A. Wen, p. 175
Russula changbaiensis G.J. Li & H.A. Wen, p. 270
Russula sichuanensis G.J. Li & H.A. Wen, p. 179
368 ... MYCOTAXON 124
Rutstroemia coracina (Dur. & Lév.) Dennis 1964 (epitypified), p. 15
Sarcogyne athroocarpa H. Magn. 1935 (lectotypified), p. 353
Scolecobeltrania Iturr., R.F. Castafieda & Rob. Fernandez, p. 144
Scolecobeltrania vermispora Iturr., R.E Castafieda & Rob. Fernandez, p. 144
Septoglomus titan B.T. Goto & G.A. Silva, p. 105
Terfezia albida Ant. Rodr., Mufioz-Mohedano & Bordallo, p. 201
Terfezia eliocrocae Bordallo, Morte & Honrubia, p. 196
Terfezia extremadurensis Mufhioz-Mohedano, Ant. Rodr. & Bordallo, p. 195
Terfezia pini Bordallo, Ant. Rodr. & Mufioz-Mohedano, p. 198
Terfezia pseudoleptoderma Bordallo, Ant. Rodr. & Mufioz-Mohedano, p. 200
Tuber neoexcavatum L. Fan &Yu Li, p. 159
Xerocomus porophyllus T.H. Li, WJ. Yan & Ming Zhang, p. 257
bad taxonomy
7)
can KILL