MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
VOLUME 129(1) JULY-SEPTEMBER 2014
Ypsilomyces elegans gen. & sp. nov.
(Almeida & Gusmao— Fie. 2, p. 184)
Davi AUGUSTO CARNEIRO DE ALMEIDA, artist
ISSN (PRINT) 0093-4666 http://dx.doi.org/10.5248/129(1) | ISSN (ONLINE) 2154-8889
MYXNAE 129(1): 1-214 (2014)
EDITORIAL ADVISORY BOARD
Scott A. REDHEAD (2010-2015), Chair
Ottawa, Ontario, Canada
WEN-YING ZHUANG (2003-2014), Past Chair
Beijing, China
SABINE HUHNDORE (2011-2016)
Chicago, Illinois, U.S.A.
PETER BUCHANAN (2011-2017)
Auckland, New Zealand
BRANDON MATHENY (2013-2018)
Knoxville, Tennessee, U.S.A.
KAREN HANSEN (2014-2019)
Stockholm, Sweden
Published by
MycoTaxon, LTD.
P.O. BOX 264, ITHACA, NY 14581-0264, USA
www.mycotaxon.com & www.ingentaconnect.com/content/mtax/mt
© Mycotaxon, LTD, 2014
MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
VOLUME 129(1)
OCTOBER-DECEMBER 2014
EDITOR-IN-CHIEF
LORELEI L. NORVELL
Pacific Northwest Mycology Service
6720 NW Skyline Boulevard
Portland, Oregon 97229-1309 USA
NOMENCLATURE EDITOR
SHAUN R. PENNYCOOK
Manaaki Whenua Landcare Research
Auckland, New Zealand
BooK REVIEW EDITOR
ELSE C. VELLINGA
861 Keeler Avenue
Berkeley CA 94708 U.S.A.
CONSISTING OF I-X + 214 PAGES INCLUDING FIGURES
ISSN 0093-4666 (PRINT) http://dx.doi.org/10.5248/129(1).cvr ISSN 2154-8889 (ONLINE)
© 2014. MycoTAxon, LTD.
Iv ... MYCOTAXON 129(1)
MY COTAXON
VOLUME ONE HUNDRED TWENTY-NINE(1) — TABLE OF CONTENTS
COVER SECTION
TTRT 5. oa Beng tock APOE AEs rah ee Pak, tates sted th 5 re es Led eee eke vi
PCV IW CNS A occu ches od ahaae aed oh ted pede Prkce ose Meek aae vad ena aed peice cereale tale iad east 4 vii
SUDIMISSION PrOCCUIT Cs 2 S245. ieh ea tag to DR ORAS AT Ee ep he cada Viii
TBO NOATE CLE OE wi ate Mel con So aber PSRTGL dl cP tet Nea, Sod op Where Pade Gea st tees ix
RESEARCH ARTICLES
Beltraniella species associated with leaf litter of the Atlantic Forest
in southern Bahia, Brazil Marcos VINI{cIUS OLIVEIRA Dos SANTOS,
FLAVIA RODRIGUES BARBOSA, DILZE MARIA ARGOLO MAGALHAES,
EDNA DorA MARTINS NEWMAN LUZ, & JOSE LUIZ BEZERRA
Neofomitella polyzonata gen. et sp. nov., and N. fumosipora and
N. rhodophaea transferred from Fomitella
Hal-J1ao Li, XING-CHUN LI, JOSEF VLASAK, & YU-CHENG DAI
A new species of Uromyces from Turkey ZELIHA BAHCECIOGLU
Cladosporium species from hypersaline environments
as endophytes in leaves of Cocos nucifera and Vitis labrusca
RAFAEL JOSE VILELA DE OLIVEIRA, THAIS EMANUELLE FEIJO DE LIMA,
GLADSTONE ALVES DA SILVA, & MARIA AUXILIADORA DE QUEIROZ CAVALCANTI
Aschersonia narathiwatensis sp. nov. from southern Thailand
SUCHADA MONGKOLSAMRIT, ARTIT KHONSANIT,
WASANA NOISRIPOOM, PAGMADULAM BALDOR], & J. JENNIFER LUANGSA-ARD
South Florida microfungi: Linkosia longirostrata, a new hyphomycete
on paurotis palm GREGORIO DELGADO
Taxonomy and phylogeny of Heterobasidion in South Korea
YEONGSEON JANG, SEOKYOON JANG, YOUNG WOON LIM,
CHANGMU KIM, & JAE-JIN KIM
Two new combinations and a new record of Zasmidium
from China FENGYAN ZHAI, W.H. HsIgH, YINGJIE Liv, & Y.L. Guo
New reports of Gymnopus from Pakistan based on
ITS sequences M. SABA & A.N. KHALID
First report of Callistosporium luteoolivaceum from
Western Himalaya, Pakistan M. SaBA & A.N. KHALID
Gastroboletus thibetanus: a new species from China
SHU-RONG WANG, Qi WANG, DE-LI WANG, & YU LI
21
33
41
47
DL
63
ies
#9
JULY-SEPTEMBER 2014... V
Biogeographical patterns in pyrenomycetous fungi and their taxonomy.
4. Hypoxylon and the southern United States
LARISSA N. VASILYEVA & STEVEN L. STEPHENSON 85
Rhizophagus natalensis, a new species in the Glomeromycota
JANUSZ BLASZKOWSKI, GERARD CHwaT, ANNA GORALSKA, & BRUNO T. GOTO 97
A new species of Nawawia from Malaysia, with a synopsis
of the genus TEIK-KHIANG Gou, WalI-Yip Lau, & KAH-CHENG TEO 109
The Entolomataceae of the Pakaraima Mountains of Guyana 6:
ten new species and a new combination in Nolanea Terry W. HENKEL,
M. CATHERINE AIME, DAVID L. LARGENT, & TIMOTHY J. BARONI 119
Two new species of Xylaria and X. diminuta new to China
Gu Huang, LIN Guo, & NA Liu 149
Erysiphe magnoliicola, a new powdery mildew on Magnolia
SUNG-EUN CHO, SUSUMU TAKAMATSU,
JAMJAN MEEBOON, & HYEON-DONG SHIN 153
Phoma recepii sp. nov. from the Caloplaca cerina group in Turkey
MEHMET GOKHAN HALICcI, MEHMET CANDAN,
MituHat GULLU, & AHMET OZCAN 163
Geastrum from the Atlantic Forest in northeast Brazil —
new records for Brazil JULIETH DE OLIVEIRA Sousa,
BIANCA DENISE BARBOSA DA SILVA, & IURI GOULART BASEIA 169
Ypsilomyces, a new thallic genus of conidial fungi from the semi-arid
Caatinga biome of Brazil Davi AUGUSTO CARNEIRO DE ALMEIDA
& Luis FERNANDO PASCHOLATI GUSMAO 181
Agaricus taeniatus sp. nov., a new member of Agaricus sect. Bivelares
from northwest China Sal-Fer Li, Ya-Li X1, Cal-X1A QI,
QIAN-QIAN LIANG, SHENG-LONG WEI, GUO-JIE LI,
DoNG ZHAO, SHAO-JIE Li, & HUA-AN WEN 187
Macrolepiota distribution extends to the montane temperate forests
of Pakistan MUHAMMAD FIAz, SANA JABEEN, AMNA IMRAN,
HaBIB AHMAD, & ABDUL NASIR KHALID 197
Hyphodontia dhingrae sp. nov. from India
SAMITA, S.K. SANYAL, & G.S. DHINGRA 209
NOMENCLATURAL NOVELTIES AND TYPIFICATIONS PROPOSED IN
MYCOTAXON 129(1) 25.3
v1 ... MYCOTAXON 129(1)
ERRATA FROM PREVIOUS VOLUMES
VOLUME 128
p.99, line 11 FOR: Penicillium citreonigrum
p.100, Table 2, line 9 FOR: MTCC 3019
p.100, Table 2, line 11 FOR: Penicillium citreonigrum
p.114, bottom line For: C,D=50 wm
READ: Penicillium chrysogenum
READ: MTCC 3017
READ: Penicillium chrysogenum
READ: C, D, F = 50 um
PUBLICATION DATE FOR VOLUME ONE HUNDRED TWENTY-EIGHT
MYCOTAXON for APRIL-JUNE, VOLUME 128 (I-1x + 1-208)
was issued on August 21, 2014
JuLYy-SEPTEMBER 2014... VII
REVIEWERS — VOLUME ONE HUNDRED TWENTY-NINE (ONE)
The Editors express their appreciation to the following individuals who have,
prior to acceptance for publication, reviewed one or more of the papers
prepared for this issue of MycoTaxon 129.
Vladimir Antonin
J.L. Azevedo
José Luiz Bezerra
Wolfgang von Brackel
Uwe Braun
Mehmet Candan
R.E Castaneda-Ruiz
Michael Castellano
Santiago Chacon
Johannes C. Coetzee
Yu-Cheng Dai
Kanad Das
Antonio Hernandez Gutiérrez
Ian Robert Hall
Nils Hallenberg
Richard A. Humber
Bryce Kendrick
Kerry Knudsen
T.K. Arun Kumar
David P. Lewis
De-Wei Li
Shuyan Liu
Hayato Masuya
Juan Luis Mata
Wieslaw Mulenko
Lorelei L. Norvell
Fritz Oehl
Clark L. Ovrebo
Shaun R. Pennycook
Ronald H. Petersen
Amy Y. Rossman
Alvaro Figueredo Dos Santos
B.M. Sharma
Gladstone Alves da Silva
Michal TomSovsky
Clement Tsui
Larissa Vasilyeva
Else C. Vellinga
Nadja Santos Vitoria
Felipe Wartchow
Anthony J.S. Whalley
Bayram Yildiz
Rui-Lin Zhao
Li-Wei Zhou
vill ... MYCOTAXON 129(1)
FOUR STEPS TO SUCCESSFUL MYCOTAXON PUBLICATION IN 2014
Prospective MycotTaxon authors should download instructions PDF, review and
submission forms, and other helpful templates by clicking the ‘file download page’ link
on our INSTRUCTIONS TO AUTHORS page before preparing their manuscript. Below is a
summary of our “4-step’ publication process.
1—PEER REVIEW: Email formatted text and illustration files with a2014 MycoTAxon
Reviewer Comments Form to 2-3 experts for peer review. Authors should (i) ask
peer reviewers to return revisions and comment forms to BOTH authors and Editor-
in-Chief <
[email protected]> and (ii) follow reviewer suggestions before
sending revised files to the Nomenclature Editor for nomenclatural review.
2—NOMENCLATURAL REVIEW: Email text files (wirH tables & captions but No
artwork) to the Nomenclature Editor <
[email protected]>
for accession and pre-submission review. The Email message MUST include
‘MycoTaxon on the subject line AND all peer reviewer names+Email addresses in
the message. The Nomenclature Editor will assign accession numbers and return
annotated files with a list of needed corrections to the authors and Editor-in-Chief.
3—FINAL SUBMISSION: After consulting experts and revising manuscripts as
needed, send the (i) completed 2014 MycoTaxon submission form; (ii) separate
text files for main text, tables, and legends; and (iii) art files to the Editor-in-Chief
<
[email protected]>. Only text and image files formatted for immediate
approval should be sent at this time. The Editor-in-Chief usually acknowledges
manuscripts and thanks expert reviewers within two weeks, but please wait at
least 14 days before sending a follow-up query (without attachments); this helps
us keep Email traffic to a minimum during Mycotaxon publication deadlines or
temporary closures of the editorial office.
4—FINAL EDITORIAL REVIEW & PRESS PREPARATION: Files not ready for publication
will be rejected or returned to authors for further revision; the Editor-in-Chief gives
tentatvely approved manuscripts a final grammatical and scientific review before
converting all files into publishable format. The PDF proof, bibliographic citation,
and nomenclatural entries are sent to all coauthors for final inspection prior to
publication. After PDF conversion, the Editor-in-Chief corrects ONLY processing
or editorial errors prior to publication but will list corrections of author errors in
the Errata of a subsequent volume for no charge. Authors are expected to arrange
payment of page charges and optional open access fees with the Business Manager
MyYcOTAXON LTD— www.mycotaxon.com
The Mycotaxon Webmaster <
[email protected]> posts general and
subscription information, important announcements, and author forms and templates
on the official MycoTaxon site. The server also hosts the regional mycobiota webpage
for free download of distributional annotated species lists.
MYCOTAXON ONLINE— www.ingentaconnect.com/content/mtax/mt
Mycotaxon publishes quarterly. Both open access and subscription articles are
offered.
JULY-SEPTEMBER 2014 ... IX
FROM THE EDITOR-IN-CHIEF
THE ‘ISSUE’ ISSUE — Mycotaxon has always prided itself on being able to deliver
complete volumes quarterly, making it an exception in the world of periodical journals.
We based our nomenclature on the fact that any individual publication containing over
400 pages merited the name ‘volume. In the past year or so, however, what the editorial
office calls a ‘perfect storm’ of misfortune — bad health, the need for page charges, and
proliferation of competing online alternatives — has produced a temporary publications
bottleneck leading to fewer pages. In an effort to speed up our quarterly delivery, we
have decided to publish every three months regardless of size, assigning issue numbers
to smaller publications as needed. Welcome, therefore, to Mycotaxon 129(1). We hope
to deliver the remainder of this volume [Mycotaxon 129(2)] shortly!
INSTRUCTIONS TO AUTHORS: SIMPLIFIED! — Instructions are the bane of author and
editor alike. Authors too often find them picky and/or incomprehensible, while editors
despair because few follow the guidelines that they have spent too much time fine-
tuning. At the moment, we all agree that MycoTaAxon instructions are too long to
help anyone. The blame for this rests (alas) squarely on my editorial shoulders, which
are now straightening to chop, cut, and simplify so that our authors can spend far less
time changing font sizes and margins and much more time on research. Stay tuned for
further developments.
MYCOTAXON 129(1) contains 22 papers by 82 authors (representing 15 countries) and
revised by 45 expert reviewers.
Within its pages are two new genera (Neofomitella from China and Ypsilomyces
from Brazil) and 30 species new to science representing Agaricus, Gastroboletus, and
Xylaria from China; Aschersonia from Thailand; Erysiphe from South Korea and Japan;
Hyphodontia from India; Hypoxylon and Linkosia from the U.S.A.; Nawawia from
Thailand; Nolanea from Guyana; Phoma and Uromyces from Turkey; and Rhizophagus
from Brazil.
In addition to new combinations in Neofomitella and Zasmidium, we also offer
range extensions of Callistosporium, Gymnopus, and Macrolepiota species to Pakistan
and Geastrum species to Brazil as well as conclusions from an excellent taxonomic and
phylogenetic study of Heterobasidion in South Korea.
Warm regards,
Lorelei L. Norvell (Editor-in-Chief)
11 November 2014
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.1
Volume 129(1), pp. 1-6 July-September 2014
Beltraniella species associated with leaf litter
of the Atlantic Forest in southern Bahia, Brazil
MARCOS VIN{CIUS OLIVEIRA DOS SANTOS’ ,
FLAVIA RODRIGUES BARBOSA’, DILZE MARIA ARGOLO MAGALHAES?,
EpNnA DorA MARTINS NEWMAN Luz’, & JOSE LuIzZ BEZERRA*™
‘Departamento de Micologia, Universidade Federal de Pernambuco,
Av. Prof. Nelson Chaves, s/n°, Recife, PE, 50670-901, Brasil
?Instituto de Ciéncias Naturais, Humanas e Sociais, Universidade Federal de Mato Grosso, Avenida
Alexandre Ferronato, 1200, Setor Industrial, Sinop, MT, 78557-267, Brasil
*Setor de Fitopatologia, Centro de Pesquisas do Cacau, Comissao Executiva do Plano da Lavoura
Cacaueira, Rod. Ilhéus-Itabuna, km 22, Ilhéus, BA, 45662-000, Brasil
‘Centro de Ciéncias Agrarias e Biolégicas, Universidade Federal do Recéncavo da Bahia,
Rua Rui Barbosa, 710, Cruz das Almas, BA, 44.380-00, Brasil
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Two species of Beltraniella, B. botryospora and B. portoricensis, were found to be
associated with the leaf litter of representative plants of the Atlantic Forest (Inga thibaudiana,
Myrcia splendens, Pera glabrata) in the Reserva Biolégica de Una, municipality of Una, Bahia
State, Brazil. A description and illustration are provided for B. botryospora, reported here
for the first time from the Americas. A key to Beltraniella species cataloged in Brazil is also
presented.
Key worps — conidial fungi, taxonomy, Fabaceae, Myrtaceae, Peraceae
Introduction
Beltraniella was proposed in 1952 by Subramanian with the type species
B. odinae Subram., found in India on leaf litter of Odina wodier Roxb.
(Subramanian 1952). The genus is characterized by setiform conidiophores and
polyblastic sympodial denticulate conidiogenous cells. Conidia are turbinate or
biconic and often caudate (Ellis 1971).
Beltraniella species are typically found on decomposing fallen leaves on
the ground and other natural substrates (Polishook et al. 1996, Marques et al.
2007, Shirouzu et al. 2009, Magalhaes et al. 2011) in tropical and subtropical
2 ... Santos & al.
regions (Kirk 1981). Some species correspond to the anamorphic stage of the
ascomycetes Pseudomassaria Jacz. or Leiosphaerella Hohn. (Kirk et al. 2008).
Currently, approximately 20 species are described in Beltraniella (Shirouzu
et al. 2010, Priya et al. 2011), of which four have been cataloged in Brazil:
B. amoena R.F. Castaneda et al., B. japonica Matsush., B. portoricensis, and
B. fertilis Heredia et al. (Gusmao et al. 2001, Marques et al. 2007, Magalhaes et
al. 2011). Beltraniella portoricensis and B. fertilis have been previously listed as
associated with plants endemic to the Atlantic Forest (Magalhaes et al. 2011).
The present study aimed to identify Beltraniella species associated with the leaf
litter from three common representative plant species from the Atlantic Forest
in the Reserva Bioldgica de Una, municipality of Una, Bahia State, Brazil.
Materials & methods
The materials were collected in September 2011 and April 2012 in the Reserva
Biologica de Una (an Atlantic Forest Conservation Unit), municipality of Una, Bahia
State, Brazil. Five specimens of three representative Atlantic Forest tree species were
marked and identified in the field as Inga thibaudiana DC. (Fabaceae), Myrcia splendens
(Sw.) DC. (Myrtaceae), and Pera glabrata (Schott) Poepp. ex Baill. (Peraceae). The leaf
litter of these trees was collected at different stages of decomposition, stored in Kraft
paper bags, and sent to the laboratory of Fungal Diversity of the Centro de Pesquisas
do Cacau (CEPEC), Comissao Executiva do Plano da Lavoura Cacaueira (CEPLAC),
Ilhéus, Bahia State, Brazil.
In the laboratory, the samples were placed in pre-perforated plastic containers and
washed gently for one hour in running water so that the water did not hit them directly,
thus allowing impurities to be removed. The washed samples were placed in moist
chambers, observed after 72 h with a stereomicroscope, and monitored periodically for
30 days. The reproductive structures of the microfungi were removed with a histological
needle and placed in a permanent mounting medium containing polyvinyl-lacto-
glycerol (PVLG) resin (Silva & Grandi 2011).
The prepared fungal slides were observed using a light microscope, and the species
were identified by morphological comparison with specific literature (Ellis 1971, Seifert
et al. 2011). Photomicrographs were taken with a Sony Cyber-shot 16.2 megapixel
digital camera. Subsequently, the permanent slides were deposited in the Mycological
Collection of CEPEC.
Taxonomy
Beltraniella botryospora Shirouzu & Tokum., Fungal Diversity 43: 88 (2010) PLATE 1
CoLonligs amphigenous, effused, dark-brown. MycELIuM immersed in the
substrate. SETAE subulate, arising from lobed basal cells, single, erect, straight
or slightly curved, simple, septate, verrucose, dark-brown, 112-380 x 4-8
um. CONIDIOPHORES macronematous, mononematous, with two forms: long
conidiophores arising from lobed basal cells, setiform, single, erect, straight
Beltraniella in Brazil ... 3
\||
¥
|
PLaTE 1. Beltraniella botryospora. A, B. Verrucose setae; C. Long conidiophore; D, E. Short
conidiophores; F—H. Conidia; I, J. Separating cells. Scale bars: A-C = 10 um; D-J = 5 um.
or slightly curved, simple or rarely branched in the apical region, septate,
verrucose, dark-brown, lighter in the apical region, 170-432 x 5-9.4 um, and
short conidiophores single or in groups with long conidiophores, erect, straight
or slightly curved, simple or branched, septate, smooth, pale brown, 8-20 x 4-6
um. CONIDIOGENOUS CELLS terminal, cylindrical, 6-12 x 4-6 um, polyblastic,
integrated, sympodial, denticulate, pale brown. SEPARATING CELLS ellipsoid
to subglobose, 7-10 x 2.6-4 um, smooth, subhyaline, with one denticle on
each end. Conip1a originated directly from conidiogenous cells in the long
conidiophores and from separating cells in short conidiophores, turbinated,
obovate to obpyriform, subhyaline, 0-septate, 18-24.6 x 4.6-9 um, with a
supraequatorial subhyaline transverse band.
SPECIMENS EXAMINED — BRAZIL. Banta: Una, on decaying leaves of Myrcia
splendens, 22/TX/2011, M.V.O.dos Santos 1360 (CEPEC 2361); on decaying leaves of
4 ... Santos & al.
Pera glabrata, 22/1X/2011, M.V.O.dos Santos 1361 (CEPEC 2362); on decaying leaves of
Inga thibaudiana, 2/1V/2012, M.V.O.dos Santos 1362 (CEPEC 2363).
GEOGRAPHICAL DISTRIBUTION — Japan (Shirouzu et al. 2010), Brazil (this paper).
Comments — Beltraniella botryospora was previously described as associated
with living and dead leaves of Quercus acuta Thunb. and Q. salicina Blume in
Japan (Shirouzu et al. 2010). In Brazil, B. botryospora is now being reported
in association with the leaf litter of three trees belonging to different families,
none closely related to Fagaceae, clearly indicating its adaptability to a wide
range of substrates.
The specimen’s characters are consonant with the original description
(Shirouzu et al. 2010). However, in the original description, the setae were
larger (140-550 um), the conidiophores were shorter (12-30 um), and the
conidiogenous cells were larger (10-20 um), while the separating cells (5 um
diam.) and conidia (7.5-10 um diam.) were narrower. Young and immature
structures were not considered for measuring the dimensions of the setae.
Beltraniella botryospora is similar to B. fertilis due to the presence of setae,
two types of conidiophores (long setiform conidiophores and short non-
setiform conidiophores) with fertile apices, and turbinate conidia (Heredia et
al. 2002). However, the conidiophores of B. fertilis branch more than once at the
apex, whereas branching is rare in B. botryospora (Shirouzu et al. 2010); also,
B. fertilis has smaller setae and narrower conidia (Heredia et al. 2002).
Beltraniella botryospora is also similar to B. portoricensis, which differs by
producing only one type of conidiophore (short non-setiform conidiophores;
Pirozynski & Patil 1970).
This is the first record of Beltraniella botryospora in the Americas.
Beltraniella portoricensis (F. Stevens) Piroz. & S.D. Patil, Can. J. Bot. 48: 575 (1970)
DESCRIPTION AND ILLUSTRATION: Ellis (1971, as Ellisiopsis gallesiae), Gusmao
& Grandi (1996).
SPECIMENS EXAMINED — BRAZIL. BAutA: Una, on decaying leaves of Inga thibaudiana,
22/1X/2011, M.V.O.dos Santos 1363 (CEPEC 2364); on decaying leaves of Pera glabrata,
22/1X/2011, M.V.O.dos Santos 1364 (CEPEC 2365); on decaying leaves of Myrcia
splendens, 22/1X/2011, M.V.O.dos Santos 1365 (CEPEC 2366).
GEOGRAPHICAL DISTRIBUTION — Cosmopolitan.
ComMMENTS — No previous records were found of associations between
B. portoricensis and the three plants studied, and this is the first record of this
taxon for the county of Una. Beltraniella portoricensis was found only in the
first sampling. This species is commonly found in the leaf litter of various plants
occurring in tropical, subtropical, and temperate regions (Grandi & Gusmao
2002) and appears to be adaptable regarding substrate (Hyde et al. 2007).
Beltraniella in Brazil ... 5
Key to Beltraniella species cataloged in Brazil
bas Setaé.and separating CEUs presente soko n whee urn Mice ite dee ote ie 8 oe ie eS oad 2,
IbeSetae and-separatinia-céll oa bSentee. i. he chon Me dogs date eit de aonpeertee B. japonica
Day SeuLOriMcONnidiopHhOres ADSeMN bd Ly ala'y Manele sm ibbly wh bhig nh beig oh dace Beeaans Ricci B 3
PBs SeueOrm CONIMIOPMOFeS: PTESEN TEs hs cet Al set NT cle h treet een tate edna ees vata -
3a. Setae smooth; separating cells clavate, often remaining attached on the conidial
(BEER eh die ie. ein aetie ares tie civ roe A averse ler geet eh comes Cov B. amoena
3b. Setae verrucose; separating cells oval to fusiform ................ B. portoricensis
4a. Conidiophore, simple or rarely branched at apex, with branching occurring
once at most, up to 560 um long; setae up to 550 um long; separating cells
SUDSIODOSE 10 OM OIG 4.6 seieg db wntondrh sabe arte aeheg drt peda dels pobed dle 2cdad doh Sekt B. botryospora
4b. Conidiophore, branched at the apex more than once, up to 328 um long;
setae up to 202 um long; separating cells obovoid.................... B. fertilis
Acknowledgements
We thank the Coordenagao de Aperfeigoamento de Pessoal de Nivel Superior
(CAPES) for the grant awarded to the first author and the Conselho Nacional de
Desenvolvimento Cientifico e Tecnolégico (CNPq) for grants awarded to the last two
authors; the Reserva Bioldgica de Una, the Programa de Pés-Graduag¢ao em Biologia de
Fungos (PPGBF) of the Universidade Federal de Pernambuco (UFPE) and José Lima
da Paixao for assisting us in the sampling; and the Comissao Executiva do Plano da
Lavoura Cacaueira (CEPLAC) for providing the laboratory to conduct the research. The
authors also thank Drs. Alvaro Figueredo dos Santos and Nadja Santos Vitoria for the
pre-submission review for our manuscript.
Literature cited
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew.
Grandi RAP, Gusmao LFP. 2002. Hyphomycetes decompositores do folhedo de Tibouchina pulchra
Cogn. Revista Brasileira de Botanica 25: 79-87.
http://dx.doi.org/10.1590/S0100-84042002000100010
Gusmao LFP, Grandi RAP. 1996. Espécies do grupo Beltrania (hyphomycetes) associadas a folhas
de Cedrela fissilis Vell. (Meliaceae), em Maringa, PR, Brasil. Hoehnea 23: 91-102.
Gusmao LFP, Grandi RAP, Milanez AI. 2001. Hyphomycetes from leaf litter of Miconia cabussu in
the Brazilian Atlantic rain forest. Mycotaxon 79: 201-213.
Heredia G, Arias RM, Reyes M, Castafeda-Ruiz R. 2002. New anamorph fungi with rhombic
conidia from Mexican tropical forest litter. Fungal Diversity 11: 99-107.
Hyde KD, Bussaban B, Paulus B, Crous PW, Lee S, McKenzie EHC, Photita W, Lumyong
S. 2007. Diversity of saprobic microfungi. Biodiversity and Conservation 16: 7-35.
http://dx.doi.org/10.1007/s10531-006-9119-5
Kirk PM. 1981. New or interesting microfungi II. A preliminary account of microfungi colonizing
Laurus nobilis leaf litter. Transactions of the British Mycological Society 77: 457-473.
http://dx.doi.org/10.1016/S0007-1536(81)80093-9
Kirk PM, Cannon PF, Minter DW, Stalpers JA (eds). 2008. Dictionary of the Fungi, 10th edition.
CAB International, Wallingford.
6 ... Santos & al.
Magalhaes DMA, Luz EDMN, Magalhaes AF, Santos Filho LPdos, Loguercio LL, Bezerra JL.
2011. Riqueza de fungos anamorfos na serapilheira de Manilkara maxima, Parinari alvimii
e Harleyodendron unifoliolatum na Mata Atlantica do Sul da Bahia. Acta Botanica Brasilica
25: 899-907. http://dx.doi.org/10.1590/S0102-33062011000400017
Marques MFO, Barbosa FR, Gusmao LFP, Castafieda-Ruiz RF, Maia LC. 2007. Conidial fungi from
the semi-arid Caatinga biome of Brazil. Cubasina microspora sp. nov., a note on C. albofusca,
and some new records for South America. Mycotaxon 102: 17-23.
Pirozynski KA, Patil SD. 1970. Some setose hyphomycetes of leaf litter in south India. Canadian
Journal of Botany 48: 567-581.
Polishook JD, Bills GE, Lodge DJ. 1996. Microfungi from decaying leaves of two rain forest trees in
Puerto Rico. Journal of Industrial Microbiology 17: 284-294.
http://dx.doi.org/10.1007/BF01574703
Priya SW, Nagaveni HC, Kunwar IK, Manoharachary IK. 2011. A new pathogenic species of
Beltraniella from India. Journal of Mycology and Plant Pathology 41: 20-23.
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes.
CBS Biodiversity Series 9. 997 p.
Shirouzu T, Hirose D, Fukasawa Y, Tokumasu S. 2009. Fungal succession associated with the decay
of leaves of an evergreen oak, Quercus myrsinaefolia. Fungal Diversity 34: 87-109.
Shirouzu T, Hirose D, Tokumasu S, To-Anun C, Maekawa N. 2010. Host affinity and phylogenetic
position of a new anamorphic fungus Beltraniella botryospora from living and fallen leaves of
evergreen oaks. Fungal Diversity 43: 85-92. http://dx.doi.org/10.1007/s13225-010-0037-1
Silva P, Grandi RAP. 2011. A newspecies of Thozetella (anamorphic fungi) from Brazil. Cryptogamie,
Mycologie 32: 359-363. http://dx.doi.org/10.7872/crym.v32.iss4.2011.359
Subramanian CV. 1952. Fungi imperfecti from Madras—III. Beltraniella gen. nov. Proceedings of
the Indian Academy of Sciences, Section B, 36: 223-228.
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.7
Volume 129(1), pp. 7-20 July-September 2014
Neofomitella polyzonata gen. et sp. nov., and
N. fumosipora and N. rhodophaea transferred from Fomitella
Hat-Jr1Ao Li”, XING-CHUN LI’, JOSEF VLASAK3, & YU-CHENG Dal'*
' Institute of Microbiology, Beijing Forestry University, Beijing, 100083, China
? National Institute of Occupational Health and Poison Control,
Chinese Center for Disease Control and Prevention, Beijing, 100050, China
° Biology Centre of the Academy of Sciences of the Czech Republic,
Branisovské 31, CZ-370 05 Ceské Budéjovice, Czech Republic
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Phylogenetic analysis based on ITS, nLSU, and RPB2 sequences revealed
that Fomitella in the current sense belonged to two distantly related subclades in the core
polyporoid clade. Fomitella in a narrow sense is proposed for the type species, F. supina,
and Neofomitella gen. nov. is proposed for Fomitella fumosipora and F. rhodophaea and a
new species N. polyzonata. Neofomitella differs from Fomitella by its distinctly crusted
basidiocarps with the cuticle developing from base to margin. Illustrated descriptions of the
new genus and species are provided. The main morphological differences between Fomitella,
Neofomitella, and related genera are discussed, and an identification key to Neofomitella is
also provided.
Key worps — phylogeny, Polyporaceae, Polyporales, Basidiomycota, taxonomy
Introduction
Fomitella Murrill, typified by E supina (Sw.) Murrill, was erected as
a monotypic genus by Murrill (1905). Subsequently, F fumosoavellanea
(Romell) Murrill [ Trichaptum fumosoavellaneum (Romell) Rajchenb. &
Bianchin.], E fumosipora, FE. rhodophaea, and F. malaysiana (Corner) T. Hatt.
& Sotome were transferred to the genus (Murrill 1908; Hattori 2005; Hattori
& Sotome 2013). Hattori (2005) emended the generic concept of Fomitella
as follows: basidiocarps annual to perennial, effused-reflexed to distinctly
pileate, pileal surface glabrous to minutely tomentose, context firm-fibrous
to corky, light orange to pale brown, with a dark agglutinated crust; hyphal
system trimitic with clamped generative hyphae, skeletal and binding hyphae
well differentiated, negative in Melzer’s reagent; cystidia absent; basidiospores
8 ... Li & al.
ellipsoid to cylindrical, colorless, thin-walled, smooth, and negative in Melzer’s
reagent; causing a white rot.
On-going studies on the diversity of wood-rotting fungi in eastern China
have produced several new species (Dai & Cui 2005; Cui & Dai 2008a,b; Cui
et al. 2007, 2008; He & Dai 2012; Wang et al. 2009, 2011; Cao et al. 2012),
and additional study on the specimens from this area recently revealed an
undescribed species. Phylogenetic analysis clustered our undescribed species
with Fomitella fumosipora and FE. rhodophaea as a clade separated from E
supina. Therefore, we propose a new genus Neofomitella to accommodate the
new species and two new combinations from Fomitella.
Materials & methods
Morphological studies
The studied specimens were deposited at the herbaria of the Institute of Microbiology,
Beijing Forestry University (BJFC) and Institute of Applied Ecology, Chinese Academy
of Sciences (IFP). The microscopic procedure follows Cui & Zhao (2012). To present
the basidiospore size variation, 5% of measurements were excluded from each end of
the range and were given in parentheses. In the text the following abbreviations were
used: IKI = Melzer’s reagent, IKI- = both inamyloid and non-dextrinoid, KOH = 5%
potassium hydroxide, CB = Cotton Blue, CB- = acyanophilous, L = mean spore length
(arithmetic average of all spores), W = mean spore width (arithmetic average of all
spores), Q = variation in the L/W ratios between the specimens studied, n = number
of spores measured from given number of specimens. Special colors follow Petersen
(1996).
Molecular study and phylogenetic analysis
Dried specimens were used for molecular study. CTAB rapid Plant genome
extraction kit-DN14 (Aidlab Biotechnologies Co. Ltd, Beijing) was used to extract DNA,
according to the manufacturer's instructions with some modifications. ITS region was
amplified with primer pair ITS5 and ITS4 (White et al. 1990), nLSU region with primer
pair LROR and LR7 (http://www.biology.duke.edu/fungi/mycolab/primers.htm), and
RPB2 with primer pair fRPB2-f5F and bRPB2-7.1R (Liu et al. 1999; Matheny 2005). The
PCR procedures were: (1) for ITS — initial denaturation at 95°C for 3 min, followed by
35 cycles at 94°C for 40 s, 54°C for 45 s and 72°C for 1 min, and a final extension of 72°C
for 10 min; (2) for nLSU — initial denaturation at 94°C for 1 min, followed by 35 cycles
at 94°C for 30 s, 50°C for 1 min and 72°C for 1.5 min, and a final extension of 72°C for
10 min; and (3) for RPB2 — initial denaturation at 94°C for 2 min, followed by 10 cycles
at 94°C for 40 s, 60°C for 40 s and 72°C for 2 min, then followed by 37 cycles at 94°C
for 45 s, 55°C for 1.5 min and 72°C for 2 min, and a final extension of 72°C for 10 min.
The PCR products were directly sequenced in Beijing Genomics Institute, China, with
the same primers.
Other reference sequences for our phylogenetic analysis were selected from Binder
et al. (2005), Justo & Hibbett (2011), Miettinen & Rajchenberg (2012), and BLAST
searches in GenBank (TABLE 1). These sequences were sampled from Polyporales with
Neofomitella gen. nov. ... 9
TABLE 1. Polyporalean and outgroup taxa used in phylogenetic analysis.
(Sequences generated in this study are in bold.)
SPECIES SAMPLE NUMBER ITS NLSU RPB2
Abundisporus pubertatis Dai 11927 KC867398 KC867494 KF274654
Abundisporus violaceus MUCL38617 FJ411100 FJ393867 =
Climacodon septentrionalis AFTOL-ID 767 AY854082 AY684165 AY780941
Coriolopsis aspera Cui 6702 KC867353 KC867476 KF274658
Cui 6725 KC867356 KC867477 KF274659
Coriolopsis brunneoleuca Dai 12087 KC867416 KC867435 KF274656
Dai 12180 KC867414 KC867432 KF274655
Coriolopsis byrsina FP-105050-Sp JN165001 JN164788 JN164871
Coriolopsis cf. caperata CR22 JN164999 JN164789 JN164870
Ryvarden 45481 KC867399 KC867428 KF274657
Coriolopsis retropicta Dai 9870 KC867404 KC867443 KF274653
Coriolopsis rigida BJFC12680 KC867381 KC867454 KF274664
Coriolopsis sanguinaria Cui 5444 KC867387 KC867463 —
Dai 9314 KC867390 KC867467 —
Coriolopsis sp. BRFM1125 JX082370 — —
BRFM1126 JX082371 — —
Coriolopsis strumosa Dai 10642 JX559278 JX559303 JX559312
Dai 10657 KC867371 KC867491 KF274650
Daedaleopsis confragosa Cui 9732 JX569731 JX569748 KEF274647
Daedaleopsis sinensis Dai 11431 JX569732 JX569749 KF274648
Datronia mollis RLG6304sp JN165002 JN164791 JN164872
Datronia scutellata RLG9584T JN165004 JN164792 JN164873
Dentocorticium sulphurellum T609 JN165015 JN164815 JN164875
Donkioporia expansa P188 HM536087 HM536052 HM536102
Earliella scabrosa PR1209 JN165009 JN164793 JN164866
Fomes fomentarius Cui 8020 JX290073 JX290070 —
Fomitella supina JV0610 KF274645 KF274646 —_
Nunez 1183 KF274644 _— —
Ryvarden 39027 KF274643 — _
Fomitopsis pinicola AFTOL-ID 770 AY854083 AY684164 AY786056
Funalia gallica BJFC12697 KC867379 KC867453 =
RLG-7630-sp JN165013 JN164814 JN164869
Funalia trogii RLG-4286-Sp JN164993 JN164808 JN164867
Ganoderma tsugae AFTOL-ID 771 DQ206985 AY684163 DQ408116
Grifola sordulenta AFTOL-ID 562 AY854085 AY645050 AY786058
Hexagonia apiaria Cui 6447 KC867362 KC867481 KF274660
Hexagonia glabra Cui 8468 JX559277 JX559302 JX559311
Dai 10991 JX569733 JX569750 KF274649
Lignosus rhinocerotis PEN94 JQ409359 AB368074 AB368132
Lopharia cinerascens FP-105043-sp JN165019 JN164813 JN164874
Megasporia major Cui 10253 JQ314366 JQ780437 JX559314
Megasporoporiella subcavernulosa Cui 9252 JQ780378 JQ78041 JX559315
Microporus affinis Cui 7714 JX569739 JX569746 KF274661
Microporus flabelliformis Dai 11574 JX569740 JX569747 KF274662
Microporus xanthopus Cui 8284 JX290074 JX290071 JX559313
Neofomitella fumosipora Cui 8816 JX569734 JX569741 —
Dai 10777 JX569735 JX569742 —
Neofomitella polyzonata Dai 10419 JX569738 JX569745 KF274663
Dai 10420 JX569736 JX569743 —
Dai 11360 JX569737 JX569744 _—
Neofomitella rhodophaea TFRI 414 EU232216 EU232300 —
Perenniporia corticola Cui 1465 JN048759 JN048779 KF274651
Perenniporia tenuis Wei 2783 JQ001858 JQ001848 KF274652
Phlebia radiata FPL6140 AY854087 AF287885 AY218502
Polyporus grammocephalus WD2343 AB587626 AB368089 AB368146
Polyporus varius WD2347 AB587636 AB368111 AB368168
Pseudofavolus cucullatus WD2157 AB587637 AB368114 AB368170
Trametes betulina HHB-9942-sp JN164983 JN164794 JN164860
Trametes elegans FP-105679-sp JN164944 JN164799 JN164861
Trametes polyzona BKW-004 JN164978 JN164790 JN164856
Trametes sanguinea PR-SC-95 JN164982 JN164795 JN164858
Trametes suaveolens FP-102529-sp JN164966 JN164807 JN164853
Trametes versicolor FP-135156-sp JN164919 JN164809 JN164850
Trametopsis cervina TJV-93-216-sp JN165020 JN164796 JN164877
Boletopsis leucomelaena AFTOL-ID 1527 DQ484064 DQ154112 GU187820
Hydnellum geogenium AFTOL-ID 680 DQ218304 AY631900 DQ408133
10... Li &al.
the aim of providing representatives for all major clades within the order, concluded by
Larsson et al. (2004), Binder et al. (2005) and Larsson (2007). Boletopsis leucomelaena
(Pers.) Fayod and Hydnellum geogenium (Fr.) Banker were selected as outgroup (Justo
& Hibbett 2011). Phylogenetic analysis for each single gene was carried out, and we
got similar topologies to combined dataset in both MP and Bayes analyses. So in the
paper we showed the result from the combined dataset that received higher support
values. This combined dataset was aligned using Clustalx 1.83 (Chenna et al. 2003)
and manually edited as necessary. Sequence alignment was deposited at TreeBase
(submission ID 14418).
Maximum parsimony (MP) analysis was performed using PAUP* 4.0b10 (Swofford
2002) with gaps treated as missing data. Trees were generated using 100 replicates of
random stepwise addition of sequence and tree-bisection reconnection (TBR) branch-
swapping algorithm. All characters were given equal weight. Branch support for all
parsimony analysis was estimated by performing 1 000 bootstrap (BP) replicates
(Felsenstein 1985) with a heuristic search of 10 random-addition replicates for each
bootstrap replicate.
The best-fit model of nucleotide substitution was selected by hierarchical likelihood
ratio tests (hALRT, Huelsenbeck & Crandall 1997; Posada & Crandall 2001) implemented
in the MrModelTest 2.2 (Posada & Crandall 1998; Nylander 2004). Following this
model, MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003) was used for Bayesian inference
(BI). Eight Markov chains were run from random starting tree for 3,000,000 generations
and sampled every 100 generations. The first one-fourth of the trees, which represented
the burn-in phase of the analysis, were discarded, while the last three-fourths were used
for calculating Bayesian posterior probabilities (BPPs) in the consensus tree. Confident
branch support is defined as BPPs not less than 0.95 and bootstrap values above 50%.
Results
Molecular phylogeny
The combined dataset included 66 samples with 66 ITS, 62 nLSU, and
51 RPB2 sequences, representing 50 species and two collections not identified
to species level from the main clades of Polyporales, as well as two species from
Thelephorales as outgroup. MP analysis yielded eight equally parsimonious
trees (tree length = 9 153, CI = 0.283, RI = 0.520, RC = 0.147, HI = 0.717). The
best model for the alignment was estimated as “GTR+1+G”. BI resulted in an
average standard deviation of split frequencies 0.005127. The topologies from
MP and BI were similar, and only the BI tree was presented along with the
BP from MP analysis (Fic. 1). In the phylogenetic analysis, sampled species of
Fomitella formed two subclades within the core polyporoid clade. One subclade
comprised Fomitella supina, the generic type, and two unidentified collections
(labelled as Coriolopsis) from French Guiana (BPP = 1.00, MP = 100%;
Fic. 1), while the second subclade included E fumosipora, F. rhodophaea and our
undescribed species (BPP = 1.00, MP = 96%; Fia. 1). Taken the morphology into
consideration together, we propose a new genus, Neofomitella, to accommodate
Neofomitella gen. nov.... 11
1.00/1007 HexagoniaglabraDai 10991 core polyporoid clade
1.00/10 © Hexagonia glabra Cui 8468 i
. Daedaleopsis confragosa Cui 9732
Daedaleopsis sinensis Dai 11431
Coriolopsis strumosa Dai 10642
1.00/100| Coriolopsis strumosaDai 10657
1.00/100; Coriolopsis aspera Cui 6702
.00/ Coriolopsis aspera Cui 6725
Hexagoniaapiaria Cui 6447
Foes fomentarius Cui 8020
EarliellascabrosaPR1209
1.00/82) Coriolopsis sp BRFM1125 . sey
Coriolopsis sp BRFM1126 |Fomitetta ABER Y
Fomitella supinaNunez 1183 ; L
Foinitellasupina Ryvarden 39027 Fomitella supina
Fomitella supinaJV0610
Coriolopsis rigida BIFC 12680
Coriolopsis sanguinaria Cui 5444
Coriolopsis sanguinaria Dai 9314
Funalia gallica RLG7630sp
1.00/74 ; Funaliatrogii RLG4286sp
1.00100 FimaliagallicaBJFC 12697
0.97/92 Neofomitella fiimosipora Dai 10777
1.00/96] | 1.00/100|! Neofomitella finosipora Cui 8816
1.00/10 Neofomnitellarhodophaea TFRI414 2 .
, C | Neofomitella polyzonataDai 10420 Neofomitella
1.00/8 CM! Neofomitella polyzonataDai 11360
0.92/- Neofomitella polyzonataDai 10419
} 1.00/100; Microporus affinis Cui 7714
= Mier c >Hiformis Dai 1157-
Toortod Microporus flabelliformis Dai 11574
Microporus xanthopus Cui 8284
Lignosus rhinocerotis PEN94
1.00/100 Coriolopsis cf. caperata CR22
1.00/72 Coriolopsis cf. caperata Ryvarden 45481
1.00/-} 1.00/70) Coriolopsis brunmeoleucaDai 12180
1.00;.[ |!000 Coriolopsis brunmeoleucaDai 12087
i Coriolopsis retropicta Dai 9870
1.00/4 Megasporiamajor Dai 10253
ie | 1.90/95 — Abundisports violacetis MUCL38617
1.00/5
1.00/94
Abundisporus pubertatis Dai 11927
ay Coriolopsis byrsina FP-105050-sp
LT Perenniporiacorticola Cuil465
sll Peremiporia tenuis W ei 2783
Ganoderina tsugae AFTOL-ID 771
DonkioporiaexpansaP 188
0.98/67 1.00/9 Datronia mollis RLG6304sp
1.00/100 DatroniascutellataRLG9584T
Polyporus varitts WD2347
00/58 Pseudofavolus cucullattis WD2157
Polyporus grammocephalis WD2343
Megasporoporiellasubcavernulosa Cui 9252
1.00/1Q0
0.99!
0.99/64
0 ai- fn .00/100 Trametes suaveolens FP-102529-sp
1.00/8 qd Trametes versicolor FP-135156-sp
pee Trametes betulina HHB9942sp
0.99/98 S Trametes polyzonaBKW 004
Trametes elegans FP-105679-sp
Trametes sanguinea PRSC95
DentocorticiumsulphurelhinT609 :
core polyporoid clade
aC? 1.00/100 Lopharia cinerascens FP-105043-sp
Grifola sordulenta AFTOL-ID 562 IGrifolaclade
Polyporales 0.99/63 Climacodon septentrionalis AFTOL-ID 767
1.00/100 00/100 Trametopsis cervina TIV-93-216-sp | Phlebioid clade
PhiebiaradiataFPL6140
Fomitopsis pinicola AFTOL-ID 770 lAntrodiacdade
Hydnellium geogenitim AFTOL-ID 680
Boletopsis leucomelaenaAFTOL-ID 1527
Fic. 1. Phylogram of polyporalean taxa obtained from Bayesian inference of the combined dataset
of ITS, nLSU, and RPB2. Bayesian posterior probabilities more than 0.95 and bootstrap values
above 50% are indicated above or below the branches. The scale bar represents estimated number
of changes per site.
the second subclade; we transfer the two Fomitella species to the new genus and
describe our new species as N. polyzonata. Phylogenetically, the Neofomitella
subclade clusters with a Microporus subclade (Fie. 1).
12°. Li Sak
Taxonomy
Neofomitella Y.C. Dai, Hai J. Li & Vlasak, gen. nov.
MycoBank MB 804799
Differs from Fomitella by its distinctly crusted basidiocarps with the cuticle developing
from base to margin and from Microporus by its buff, yellowish brown, brown to pale
grey context.
TYPE SPECIES — Polyporus rhodophaeus Lév.
EryMoLocy — Neofomitella (Lat.): referring to the morphological similarity to
Fomitella.
Basidiocarps annual or perennial, pileate, sessile or effused-reflexed. Pileal
surface yellowish-brown, brown, orange-brown, reddish-brown, fuscous to
almost black, usually concentrically zonate or sulcate, glabrous to velutinate.
Context buff, yellowish brown, brown to pale grey, corky to hard corky, with a
dark agglutinated crust developing from base to margin. Pore surface usually
white, cream to pale buff when fresh, pale brown to yellowish-brown when dry.
Hyphal system trimitic with clamped generative hyphae, skeletal and binding
hyphae well differentiated, negative in Melzer’s reagent. Cystidia absent.
Basidiospores oblong ellipsoid to cylindrical, hyaline, thin-walled, smooth,
IKI-, CB-, tissue turn into black in KOH. Growing usually on angiosperm
wood and causing a white rot.
Neofomitella fumosipora (Corner) Y.C. Dai, Hai J. Li & Vlasak, comb. nov. Fic. 2a
MycoBank MB 804803
=Trametes fumosipora Corner, Beih. Nova Hedwigia 97: 106 (1989).
=Fomitella fumosipora (Corner) T. Hatt., Mycoscience 46: 309 (2005).
SPECIMENS EXAMINED — CHINA. GUANGDONG PROVINCE, SHIXING COUNTY,
Chebaling Nature Reserve, fallen angiosperm trunk, 25 Jun 2010, B.K. Cui 8816 (BJFC
7756); 23 Nov 2010, B.K. Cui 8715, 8717 (BJFC 7657, 7659); HAINAN PROVINCE,
CHANGJIANG County, Bawangling Nature Reserve, fallen angiosperm trunk, 8 May
2009, Y.C. Dai 10777 (BJFC 5021). MALAYSIA. NEGERI SEMBILAM, Pasoh For. Res.,
5 Dec 1998, T. Hattori (BJFC: ex. TFM ex. FE 19017); PENANG, Penang Hill, alt. 500-750
m, 13 Dec 2002, T. Hattori (BJFC: ex. TFM ex. F. 20477).
Neofomitella polyzonata Y.C. Dai, Hai J. Li & Vlasak, sp. nov. Fras 2b,<c, 3
MycoBank MB 804804
Differs from Neofomitella fumosipora and N. rhodophaea by its distinctly velutinate
pileal surface and larger pores.
Type — China, Jiangxi Province, Fenyi County, Dagang Mountain, on fallen trunk
of Cyclobalanopsis blakei (Skan) Schottky (Fagaceae), 18 Sep 2008, Y.C. Dai 10419
(holotype, BJFC 4668).
ETyMoLocy — polyzonata (Lat.): referring to the multiple zones on the pileal surface.
Neofomitella gen. nov. ... 13
Fic. 2. Neofomitella and Fomitella basidiocarps. a: N. fumosipora. b, c: N. polyzonata.
d, e: N. rhodophaea. f: FE. supina.
FruiITBopy — Basidiocarps annual, pileate, sessile, usually imbricate, without
odor or taste when fresh, hard corky to woody hard and light in weight upon
drying. Pilei applanate, semicircular to dimidiate, up to 6 cm long, 10 cm wide
and 6 mm thick at base. Pileal surface buff-yellow, curry-yellow, cinnamon,
orange-brown to reddish brown, with one or more vinaceous brown, dark blue
14... Li &al.
[pr
\ Ve A
D Me
|§
os
<s=9
Cre)
Cc
10 um
tella polyzonata (drawn from the holotype).
es. b: Basidia and basidioles. c: Cystidioles.
e from trama. e: Hyphae from context.
=
Fic. 3. Neofom
a: Basidiospo
a 3
d: Hyph:
y velutinate, concentrically zonate; white to cream
eading from the base with age. Margin cream, buff
e or slightly wavy. Pore surface cream to buff when
—
to almost black zones, fine
a
outgrowth occasionally sp
~
to buff-yellow, usually acu
Neofomitella gen. nov. ... 15
fresh, buff to yellowish brown when dry or bruised; sterile margin indistinct,
white to cream, up to 0.5 mm wide; pores round, 3-4 per mm; dissepiments
thin, entire. Context buff to yellowish brown, hard corky, azonate, up to 3 mm
thick, a more or less dark agglutinated crust present as black zones in context
towards upper surface. Tube layer concolorous with pore surface, up to 3 mm
long.
HyPHAL STRUCTURE — Hyphal system trimitic; generative hyphae bearing
clamp connections; skeletal and binding hyphae IKI-, CB-; tissue turning into
black in KOH.
CONTEXT — Generative hyphae in context infrequent, colorless, thin-
walled, moderately branched, 1.5-3 um in diam; skeletal hyphae in context
dominant, colorless to pale yellowish brown, thick-walled with a narrow
lumen to subsolid, occasionally branched, straight, more or less regularly
arranged, 3-5 um in diam; binding hyphae in context abundant, colorless to
pale yellowish brown, thick-walled with a narrow lumen to subsolid, flexuous,
frequently branched, interwoven, 1-2.5 um in diam.
TuBEs — Generative hyphae infrequent, colorless, thin-walled, moderately
branched, 1.2-2 um in diam; skeletal hyphae in trama dominant, colorless
to pale yellowish brown, thick-walled, occasionally branched, more or less
straight, interwoven, 2.4-4 um in diam; binding hyphae in trama colorless to
pale yellowish brown, thick-walled with a narrow lumen to subsolid, flexuous,
frequently branched, interwoven, 1-2 um in diam. Cystidia absent, while
cystidioles present, fusoid to tubular, sometimes tips of cystidioles branched
and septate, colorless, thin-walled, 22-34 x 2.5-4.5 um; basidia clavate, bearing
four sterigmata and a basal clamp connection, 18-24 x 3.5-5 um; basidioles in
shape similar to basidia, but distinctly smaller.
Spores — Basidiospores cylindrical, colorless, thin-walled, smooth, IKI-,
CB-, (3.8-)3.9-5 x (1.8-)1.9-2.1(-2.5) um, L = 4.34 um, W = 2.04 um, Q = 2.13
(n = 9/1).
TYPE OF ROT —White rot.
ADDITIONAL SPECIMENS EXAMINED — CHINA. FUJIAN PROVINCE, Wuyi Mountains,
Longfenggu Forest Park, on fallen angiosperm trunk, 27 Aug 2006, B.K. Cui 4124
(BJFC 485, IFP 1196); Wuyishan Nature Reserve, Taoyuanyu, on fallen angiosperm
trunk, 24 Aug 2006, Y.C. Dai 7376 (IFP 11887); HUNAN PROVINCE, SHIMEN COUNTY,
Hupingshan Nature Reserve, on fallen angiosperm trunk, 16 Sep 2009, Y.C. Dai 11360
(BJFC 7283); JIANGXI PROVINCE, FENy1I County, Dagang Mountain, on fallen trunk of
Cyclobalanopsis blakei, 18 Sep 2008, Y.C. Dai 10420 (BJFC 4669).
Neofomitella rhodophaea (Lév.) Y.C. Dai, Hai J. Li & Vlasak, comb. nov. Fics 2d,e
MycoBank MB 804800
= Polyporus rhodophaeus Lév., Ann. Sci. Nat., Bot., 3e Sér., 2: 190 (1844).
= Fomitella rhodophaea (Lév.) T. Hatt., Mycoscience 46: 305 (2005).
16... Li &al.
SPECIMENS EXAMINED — JAPAN. KAGOSHIMA PREF., KIMOTSUKI-GuN, Uchindura,
Oct 1962, K. Aoshima (BJFC: ex. O 10866); Tokyo, Meguro, 15 Oct 1943 (BJFC: ex.
TFM F-10861); MALAYSIA. NEGERI SEMBILAN, Pasoh, Sembilan For. Nat. Res., 25 Dec
1997, T. Hattori (BJFC: ex. TFM 18313).
OTHER SPECIMENS EXAMINED — Fomitella supina (Fic. 2f): BRAZIL. ALAGOAS
STATE, PILAR MuNICcIPALITY, Reserva Particular do patrimonio Natural (PPPN) Sao
Pedro, on dead hardwood, Oct 2000, B. Tatiana, N. Gibertoni 357 (BJFC: ex. O 10849).
COLOMBIA. DEPT. DE ANTIOQUIA, MUNICIPIO CALDAS FINCA, alt. 1700 m, 25 Jun
1978, L. Ryvarden 16 590 (BJFC: ex. O 10769). GUATEMALA. Lago Atitlan, on hard
wood, J. Vlasak JV0610. PANAMA. Ensenada de Santa Cruz. Parque Nac. de Coiba,
17 Nov 1996, M. Nunez 1183 (BJFC: ex. O 10770). PUERTO RICO. Toro Negro,
Commonwealth For., on deciduous wood, 24 Jun 1996, L. Ryvarden 39 027 (BJFC: ex.
O 10772).
Discussion
The new genus Neofomitella is composed of two distinct lineages, one
comprising Neofomitella rhodophaea and N. fumosipora and the other
N. polyzonata, newly described from China. The main morphological characters
of Fomitella supina and the three Neofomitella species are presented in
TABLE 2. Like Neofomitella polyzonata, N. fumosipora has more or less brown
basidiocarps; however, it has a glabrous pileal surface and smaller pores
(7-9 per mm; Hattori 2005). All three Neofomitella species show distinctly
crusted basidiocarps with a cuticle that develops from base to margin
(Fic, 2a-e). In F. supina the cuticle also develops from the base but does not
usually extend to the very margin (Fie. 2f).
Neofomitella is phylogenetically close to several Microporus species (Fic. 1).
Although Microporus also has a trimitic hyphal system, colorless, thin-
walled, smooth, non-dextrinoid, inamyloid basidiospores, its species usually
produce stipitate basidiocarps with a white to cream context (Gilbertson &
Ryvarden 1986; Nunez & Ryvarden 2001). Its type species, M. perula P. Beauv.
[= M. xanthopus (Fr.) Kuntze], also has an encrusted pileal surface, but its
centrally or laterally stipitate and usually infundibuliform basidiocarps,
distinctly small pores, and white context (NUufiez & Ryvarden 2001) clearly
differentiate it from Neofomitella species.
Morphologically, Coriolopsis shares many features with Fomitella and
Neofomitella, such as a more or less brown context, trimitic hyphal system
with clamped generative hyphae, colorless basidiospores, and causing a white
rot (Gilbertson & Ryvarden 1986; Nufez & Ryvarden 2001; Hattori 2005).
However, phylogenetic analysis shows Coriolopsis as polyphyletic with its type
species, Polyporus occidentalis Klotzsch [= Coriolopsis occidentalis (Klotzsch)
Murrill; = Trametes polyzona (Pers.) Justo], clustering within the Trametes
clade and distinctly separated from Fomitella and Neofomitella (Fic. 1).
Neofomitella gen. nov. ... 17
TaBe 2. Main morphological characters of Fomitella and Neofomitella species.
BASIDIOCARPS* PORES BASIDIOSPORES CYSTIDIOLES? DISTRIBUTION*
SPECIES
(/mm) (um)
F supina A/P, 5-7 6.5-9 x 2.4-3.5, - T/S,
V then G C America, Africa
N. fumosipora A/P,G 6-10 3-4 x 1.7-2.2, + T/S,
C/OE Asia
N. polyzonata A, V 3-4 3.9-5 x 1.9-2.1, + S/WT,
C China
N. rhodophaea = A/P,G 7-8 3.5-4.5 x 2.5-3, - T, also S/WT,
OE Asia, Africa
"A = annual, P = perennial, G = glabrous, V = velutinate; *C = cylindrical, OE = oblong-ellipsoid;
34 = presence, — = absence; *T = tropics, S = subtropics, WT = warm-temperate.
The transfer of this taxon to Trametes was suggested by Corner (1989) and
validated by Justo & Hibbett (2011). Coriolopsis strumosa (Fr.) Ryvarden usually
has encrusted basidiocarps that are similar to Neofomitella, but C. strumosa has
a soft corky, olivaceous-brown, umber or hazel-brown context and distinctly
larger basidiospores (7-10 x 3-4 um; Nunez & Ryvarden 2001; Li 2013).
Funalia species cluster in the same clade with Fomitella. Both genera share
trimitic hyphal system and more or less similar basidiospores, but Funalia
species usually produce a strongly tomentose to hispid pileal surface, a white,
cream to straw colored context, and cyanophilous skeletal hyphae (Niemela et
al. 1992; Dai 1996).
Hexagonia has pileate brown basidiocarps, tissues that darken in KOH, a
trimitic hyphal system, and colorless thin-walled basidiospores similar to those
in Fomitella and Neofomitella (Nuitez & Ryvarden 2001). However, Hexagonia
species usually have larger hexagonal pores and distinctly larger basidiospores
(usually longer than 10 um; Gilbertson & Ryvarden 1986; Nufiez & Ryvarden
2001).
No sequences of Fomitella malaysiana are available at present. The distinctly
encrusted pileal surface (Hattori & Sotome 2013) indicates that this species
may belong to Neofomitella. Further molecular studies are needed to resolve its
taxonomic and phylogenetic position.
Key to species of Neofomitella
LMP ORSS SAA APSA y bs, Fests aes aee .aoea ap aes wote See Sone Shs Sune See Sane a N. polyzonata
TL POKES OS LOsP CEN IN “ie tle sew at as Semel as Seas Senn ey ail nn Ney selon Noein eae tech at nabeny als 2
2; Basidiospores hy7 2 2M WIS ah it20 itn Pied Wee Eee eT ae N. fumosipora
2; Basidiospores2;5=3 pind WIE is i.e. 4 gd ice gd nace dg Heer ed Heer Ed Heer dd Hat N. rhodophaea
18 ... Li &al.
Acknowledgments
We express our gratitude to Drs. Michal TomSovsky (Mendel University in Brno,
Czech Republic) and Li-Wei Zhou (IFP, China) who reviewed the manuscript. Great
thanks to Drs. Hai-Sheng Yuan (IFP, China) and Shuang-Hui He (BJFU, China) for
help in field collections. Special thanks are due to Dr. Tsutomu Hattori (FFPRI, Japan),
Prof. Leif Ryvarden (O, Norway) and Dr. Tatiana B. Gibertoni (URM, Brazil) for loan
of specimens. The research is supported by the National Natural Science Foundation
of China (Project No. 31093440), the Program for New Century Excellent Talents in
University (NCET-11-0585), and the institutional support RVO: 60077344 of the Czech
Academy of Sciences to J. Vlasak.
Literature cited
Binder M, Hibbett DS, Larsson KH, Larsson E, Langer E, Langer G. 2005. The
phylogenetic distribution of resupinate forms across the major clades of mushroom-
forming fungi (Homobasidiomycetes). Systematics and _ Biodiversity 3: 113-157.
http://dx.doi.org/10.1017/S1477200005001623
Cao Y, Wu SH, Dai YC. 2012. Species clarification of the prize medicinal Ganoderma mushroom
“Lingzhi”. Fungal Diversity 56: 49-62. http://dx.doi.org/10.1007/s13225-012-0178-5
Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD. 2003.
Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Research
31: 3497-3500. http://dx.doi.org/10.1093/nar/gkg500
Corner, EJH. 1989. Ad Polyporaceas 6. The genus Trametes. Beihefte zur Nova Hedwigia 97: 1-197.
Cui BK, Dai YC. 2008a. Skeletocutis luteolus sp. nov. from southern and eastern China. Mycotaxon
104: 97-101.
Cui BK, Dai YC. 2008b. Wood-rotting fungi in eastern China 2. A new species of Fomitiporia
(Basidiomycota) from Wanmulin Nature Reserve, Fujian Province. Mycotaxon 105: 343-348.
Cui BK, Zhao CL. 2012. Morphological and molecular evidence for a new species of
Perenniporia (Basidiomycota) from Tibet, southwestern China. Mycoscience 53: 365-372.
http://dx.doi.org/10.1007/s10267-011-0180-x
Cui BK, Dai YC, Decock C. 2007. A new species of Perenniporia (Basidiomycota, Aphyllophorales)
from eastern China. Mycotaxon 99: 175-180.
Cui BK, Yuan HS, Dai YC. 2008. Wood-rotting fungi in eastern China 1. Polypores from Wuyi
Mountains, Fujian Province. Sydowia 60: 25-40.
Dai YC. 1996. Changbai wood-rotting fungi 7. A check list of the polypores. Fungal Science 11:
79>105.
Dai YC, Cui BK. 2005. Two new species of the Hymenochaetaceae from eastern China. Mycotaxon
94: 341-347.
Felsenstein J. 1985. Confidence intervals on phylogenies: an approach using the bootstrap.
Evolution 39: 783-791.
Gilbertson RL, Ryvarden L. 1986. North American polypores 1. Abortiporus—Lindtneria. Fungiflora,
Oslo. 433 p.
Hattori T. 2005. Type studies of the polypores described by E.J.H. Corner from Asia and
West Pacific Areas 7. Species described in Trametes (1). Mycoscience 46: 303-312.
http://dx.doi.org/10.1007/s10267-005-0250-z
Hattori T, Sotome K. 2013. Type studies of the polypores described by E.J.H. Corner from Asia
and West Pacific areas VIII. Species described in Trametes (2). Mycoscience 54: 297-308.
http://dx.doi.org/ 10.1016/j.myc.2012.10.008
Neofomitella gen. nov. ... 19
He SH, Dai YC. 2012. Taxonomy and phylogeny of Hymenochaete and allied genera of
Hymenochaetaceae (Basidiomycota) in China. Fungal Diversity 56:77-93.
http://dx.doi.org/10.1007/s13225-012-0174-9
Huelsenbeck JP, Crandall KA. 1997. Phylogeny estimation and hypothesis testing using
maximum likelihood. Annual Review of Ecology, Evolution, and Systematics 28: 437-466.
http://dx.doi.org/10.1146/annurev.ecolsys.28.1.437
Justo A, Hibbett DS. 2011. Phylogenetic classification of Trametes (Basidiomycota, Polyporales)
based on a five-marker dataset. Taxon 60: 1567-1583.
Larsson KH. 2007. Re-thinking the classification of corticioid fungi. Mycological Research 111:
1040-1063. http://dx.doi.org/10.1016/j.mycres.2007.08.001
Larsson KH, Larsson E, Koljalg U. 2004. High phylogenetic diversity among corticioid
homobasidiomycetes. Mycological Research 108: 983-1002.
http://dx.doi.org/10.1017/S0953756204000851
Li HJ. 2013. Taxonomy and phylogeny of Trametes and related genera in China. PhD thesis, Beijing
Forestry University. Beijing.
Liu YL, Whelen S, Hall BD. 1999. Phylogenetic relationships among ascomycetes: evidence
from an RNA polymerase II subunit. Molecular Biology and Evolution 16: 1799-1808.
http://dx.doi.org/ 10.1093/oxfordjournals.molbev.a026092
Matheny PB. 2005. Improving phylogenetic inference of mushrooms with RPB1 and RPB2
nucleotide sequences (Inocybe; Agaricales). Molecular Phylogenetics and Evolution 35: 1-20.
http://dx.doi.org/ 10.1016/j.ympev.2004.11.014
Miettinen O, Rajchenberg M. 2012. Obba and Sebipora, new polypore genera related to
Cinereomyces and Gelatoporia (Polyporales, Basidiomycota). Mycological Research 11: 131-147.
http://dx.doi.org/ 10.1007/s11557-010-0736-8
Murrill WA. 1905. The Polyporaceae of North America 11. A synopsis of the brown pileate species.
Bulletin of the Torrey Botanical Club 32: 353-371.
Murrill WA. 1908. Polyporaceae. North American Flora 9(2): 73-132.
Niemela T, Kotiranta H, Penttila R. 1992. New records of rare and threatened polypores in Finland.
Karstenia 32: 81-94.
Nunez M, Ryvarden L. 2001. East Asian polypores 2. Polyporaceae s. lato. Synopsis Fungorum
14: 170-522.
Nylander JAA. 2004. MrModeltest 2.2. Program distributed by the author. Evolutionary Biology
Centre, Uppsala University.
Petersen JH. 1996. Farvekort. The Danish Mycological Society's colour-chart. Foreningen til
Svampekundskabens Fremme, Greve. 6 p.
Posada D, Crandall KA. 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics
14: 817-818.
Posada D, Crandall KA. 2001. Selecting the best-fit model of nucleotide substitution. Systematic
Biology 50: 580-601. http://dx.doi.org/ 10.1080/106351501750435121
Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/ 10.1093/bioinformatics/btg180
Ryvarden L, Gilbertson RL. 1993. European polypores. Synopsis Fungorum 6: 1-741.
Swofford DL. 2002. PAUP: Phylogenetic analysis using parsimony, version 4.0b10. Sinauer
Associates, Inc. Publishers, Sunderland.
Wang B, Dai YC, Cui BK, Du P, Li HJ. 2009. Wood-rotting fungi in eastern China 4. Polypores from
Dagang Mountains, Jiangxi Province. Cryptogamie, Mycologie 30: 233-241.
2072. elsecall:
Wang B, Cui BK, Li HJ, Du P, Jia BS. 2011. Wood-rotting fungi in eastern China 5. Polypore
diversity in Jiangxi Province. Annales Botanici Fennici 48: 237-246.
http://dx.doi.org/10.5735/085.048.0304
White TJ, Bruns TD, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols, a guide to
methods and applications. Academic, San Diego.
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.21
Volume 129(1), pp. 21-23 July-September 2014
A new species of Uromyces from Turkey
ZELIHA BAHCECIOGLU
Department of Biology, Faculty of Science and Art, Inonu University,
TR 44280, Malatya, Turkey
*CORRESPONDENCE TO: Zeliha.
[email protected]
ABSTRACT — A new species of Uromyces on Myosotis sp. (Boraginaceae) is described from
Turkey. As far as is known, no Uromyces has previously been described on this host genus.
Uromyces myosotidis sp. nov. is described and illustrated in this paper.
Key worps —Anatolia, new taxon, Puccineaceae, Basidiomycota
Introduction
Among the approximately 351 species of rust fungi recorded for Turkey,
74 species and one variety of Uromyces have been reported (Bahcecioglu &
Kabaktepe 2012). Recently, an unknown Uromyces specimen was collected in
the country on Myosotis; it is described here as a new species, U. myosotidis.
Materials & methods
The host specimen was collected from Adiyaman Province in 2012, prepared
according to established herbarium techniques, and identified from the relevant
botanical literature (Davis 1965, 1978; Davis et al. 1988; Grau 1978). Spores were
scraped from the dried host specimen and mounted in lactophenol. The preparations
were examined with an Olympus CX31 light microscope. Analysis LS Starter software
was used to measure at least 30 spores for each spore state. The specimen is preserved in
the herbarium of Inonu University (INU), Turkey.
Taxonomy
Uromyces myosotidis Bahc. sp. nov. Fic. 1
MycoBank 804880
Differs from Uromyces tairae by its smaller teliospores and urediniospores.
Type: Turkey, Adryaman Province, 10-12 km between Adiyaman and Celikhan,
1500-1600 m, on Myosotis sp. (Boraginaceae), 6 June 2012, Zeliha Bahcecioglu 3888
(Holotype, INU).
ErymMo_oey: from Myosotis, the host genus.
22 ... Bahcecioglu
10 um
Fic. 1. Uromyces myosotidis (holotype). Teliospores and urediniospore.
Pycnia and aecia not seen. Uredinia and telia often mixed together,
hypophyllous, covered by epidermis, small, scattered, brown. Urediniospores
14-16 x 13-16 um globoid, subgloboid, walls 1.5-2 um thick, brown, smooth
or finely sparsely echinulate, with 2-3 equatorial pores. Teliospores 14-22 x
12-18 um, globoid, subgloboid; walls <5-8 um apiculus, dark brown, smooth.
Pedicels <56 um long, broken, hyaline.
Discussion
As far as is known, no Uromyces has previously been described on Myosotis.
Uromyces myosotidis differs from Uromyces spp. determined on other genera of
Boraginaceae in teliospore and urediniospore form and size. Uromyces tairae
Hirats. f. on Messerschmidia (= Tournefortia) has larger teliospores (25-38 x
20-28 um) and urediniospores (22-30 x 17-25 um; Hiratsuka 1940). Uromyces
permeritus Cummins and U. dolichosporus Dietel & Holw. on Tournefortia have
ellipsoid, long fusiform, or long clavate teliospores (Holway 1897; Cummins
1940). Uromyces heliotropii Sred. on Heliotropium has larger teliospores
(21-25 x 18-22 um) with an apical pore (Ul’yanishchev et al. 1985; Kuprevich
& Ul’yanishchev 1975).
Acknowledgments
This work was supported by the BAP of Inonu University, project numbers 2010/104.
Thus many thank BAP of Inonu University, also thanks Prof. Dr. Bayram Yildiz Balikesir
University, Balikesir (Turkey), for help with identification of host and Dr. Mehmet
Candan for presubmission expert reviews and Dr. Brian Spooner (Kew garden) for
helpful suggestions.
Uromyces myosotidis sp. nov. (Turkey) ... 23
Literature cited
Bahcecioglu Z, Kabaktepe S. 2012. Checklist of rust fungi in Turkey. Mycotaxon 119: 494.
http://www.mycotaxon.com//resources/checklists/Bahcecioglu-v119-checklist.pdf
Cummins GB. 1940. Uredinales of New Guinea. Mycologia 32: 32-375.
http://dx.doi.org/10.2307/3754317
Davis PH. 1965. Flora of Turkey and the East Aegean Islands. Vol. 1. Edinburgh. University Press.
Davis PH. 1978. Flora of Turkey and the East Aegean Islands. Vol. 6. Edinburgh. University Press.
Davis PH, Mill RR, Tan K. 1988. Flora of Turkey and the East Aegean Island. Vol. 10 (Suppl.).
Edinburgh: University Press.
Grau J. 1978. Myosotis L. 264-280, in: PH Davis (ed.). Flora of Turkey and the East Aegean Islands.
Vol. 6. Edinburgh: University Press.
Hiratsuka N. 1940. Uredinales collected in Korea. Bot. Mag. Tokyo 54: 427-432.
Holway EWD. 1897. Mexican Fungi. Bot. Gaz. 24: 23-38. http://dx.doi.org/10.1086/327549
Kuprevich VF, Ulyanishchev VI. 1975. The key for determination of rust fungi of the USSR. Minsk.
[in Russian]
Ulyanishchev VI, Babayan DN, Melia MS. 1985. Key to the rust fungi of Transcaucasia. Baku.
[in Russian |
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.25
Volume 129(1), pp.25-31 July-September 2014
Cladosporium species from hypersaline environments as
endophytes in leaves of Cocos nucifera and Vitis labrusca
RAFAEL JOSE VILELA DE OLIVEIRA ', THAIS EMANUELLE FEIJO DE LIMA,
GLADSTONE ALVES DA SILVA, & MARIA AUXILIADORA DE QUEIROZ CAVALCANTI”
Departamento de Micologia, Universidade Federal de Pernambuco,
Rua Nelson Chaves, s/n, Cidade Universitaria, Recife, 50670-901, Brazil
ABSTRACT — Cladosporium dominicanum and C. halotolerans were isolated in Pernambuco,
Brazil, from healthy leaves of Cocos nucifera and Vitis labrusca, respectively. This is the first
report of these species as endophytes and the first record of C. dominicanum for Brazil.
Key worps —ITS, phylogenetic analysis, tropical plants
Introduction
Cladosporium was originally described by Link in 1816, and Cladosporium
herbarum was selected from amongst Link's original species by Clements &
Shear (1931) as the generic type (see also Bensch et al. 2010). With over 772
taxa, Cladosporium is one of the largest hyphomycete genera (Dugan et al.
2004). Bensch et al. (2012), who analyzed the genus phylogenetically, created
an identification key and described 169 species. Cladosporium species are
commonly found as plant and human pathogens and are also decomposers of
food, paints, textiles, and organic matter (Ellis, 1971, 1976, Kwon et al. 2001;
Liu et al. 2001). They occur as endophytes in plants of tropical regions (Costa
et al. 2012) and are the most frequent endophytic fungi in some plants (Bezerra
et al. 2012).
Cladosporium halotolerans is saprobic on various substrates and has been
isolated in hypersaline water from subtropical regions, indoor environments,
arctic ice, human and animal lesions, plants, rock, window frames, and
mycorrhizal roots (Bensch et al. 2012). Cladosporium dominicanum was first
isolated from hypersaline water and was also found as a saprobe on the surface
of fruits (Bensch et al. 2012).
26 ... Oliveira & al.
Here we report the first records of C. dominicanum as an endophyte in leaves
of Cocos nucifera (and its first occurrence from Brazil) and of C. halotolerans as
an endophyte in the leaves of Vitis labrusca.
Materials & methods
During February 2010 (dry season), healthy mature leaves of Vitis labrusca were
collected from forest areas of the municipalities of Sao Vicente Férrer, Pernambuco, and
in May 2012 (dry season), healthy mature leaves of Cocos nucifera were collected from
forest areas of the municipalities of Goiana, Pernambuco.
Sterilization, isolation, and identification
In the laboratory, each leaf was washed gently in running water and soap. Leaf
discs were cut with a sterile metallic cork punch (6 mm diam.), decontaminated with
70% alcohol for 30 sec and sodium hypochlorite solution (NaOCl) at 2% for 2.5 min,
and twice washed with sterilized distilled water in order to remove the hypochlorite
excess (Petrini 1996; modified technique). Six surface sterilized discs were transferred
in triplicate to each Petri dish containing malt extract agar (MEA) + chloramphenicol
(50 mg.L"') to prevent bacterial growth. The plates were incubated at room temperature
(28 + 2°C) and observed daily during 15 days for colony development. For asepsis
control, 50 uL of water, used to remove hypochlorite, was plated in MEA to confirm
surface disinfection (Pereira et al. 1993). Species identification was based on macro- and
microstructural characteristics of the colony, according to Bensch et al. (2012). For each
species (Cladosporium halotolerans and C. dominicanum), one isolate was deposited in
the URM Culture Collection of the Universidade Federal de Pernambuco.
Molecular analyses
The fungi biomass was obtained from cultures grown on malt agar contained in test
tubes and kept at 28°C for up to six days. All mycelium was removed from the test tube
with the aid of a platinum loop; the material was transferred to 2 ml micro-tubes with
screw caps to which were added 0.5 g of glass beads with two different diameters in the
1:1 ratio (acid-washed, 150-212 um and 425-600 um; Sigma, U.S. sieve). The material
was crushed by stirring at high speed in a FastPrep.
Genomic DNA was extracted according to Gées-Neto et al. (2005). The material
was washed with chloroform : isoamyl alcohol (24:1) and following homogenization of
the material in CTAB buffer at 2%, besides isopropanol precipitation, washing in 70%
ethanol, and re-suspended in 50 uL of ultrapure water.
Primers ITS1 and ITS4 (White et al. 1990) were used to amplify the ITS region.
PCR reactions were carried out in 50 wL volumes containing 75 mM Tris-HCl pH 8.8,
200 mM (NH,),SO,, 0.01% Tween 20, 2 mM MgCl, 200 uM each dNTPs, 1 uM of
each primer, and 2 units of Taq DNA polymerase (Fermentas, Maryland, USA); cycling
parameters were 5 min at 95°C (1 cycle), 45s at 94°C, 1 min at 60°C, 1 min at 72°C
(39 cycles), and a final elongation of 7 min at 72°C.
The final amplicons were purified with the PureLink PCR Purification Kit
(Invitrogen). Sequencing was provided by the Human Genome Research Center (Sao
Paulo, Brazil). Sequence data were compared to gene libraries (EMBL and GenBank)
using BLASTn. The new sequences deriving from the species were deposited in the
NCBI database under the accession numbers KJ000286 and KJ000287.
Cladosporium spp. in Cocos nucifera & Vitis labrusca (Brazil) ... 27
Phylogenetic analyses
The phylogeny was reconstructed by sequences of the ITS1+5.8s+ITS2 rDNA gene.
The fungal sequences were aligned in ClustalX (Larkin et al. 2007) and edited with the
BioEdit program (Hall 1999). Prior to phylogenetic analysis, the model of nucleotide
substitution was estimated using Topali 2.5 (Milne et al. 2004). Bayesian analysis
(two runs over 1 x 10° generations with a burnin value of 2500) were performed in
MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003), and maximum likelihood analysis (1000
bootstrap) was performed in PhyML (Guindon & Gascuel 2003), launched from Topali
2.5, using the GIR + I+ G model. Neighbor-joining (established with the models cited
above) and maximum parsimony analyses were performed using PAUP*4b10 (Swofford
2003) with 1000 bootstrap replications.
The phylogenetic tree described in Zalar et al. (2007) was used as reference.
Results
Taxonomy
Cladosporium halotolerans Zalar, de Hoog & Gunde-Cim., Stud. Mycol. 58: 172.
2007.
PotaTo DEXTROSE AGAR: Colonies after 14 days of culture at 25°C, presenting
a growth of 53 mm, dark grayish green, reverse dark green. Conidiophores
erect, lateral or terminal, olive to brown, septate, smooth, branched, 10-77.5
x 2.5-5 um. Conidia in tandem, smooth, olive to brown, non-septate, globose,
subglobose, or shortly limoniform (majority), slightly rough, 1.25-3.75 x
2.5-3.75 um. Conidiogenous cells undifferentiated. Branch-primary conidia
rare, with <2 distal scars; branch-secondary conidia, 0-1 septum (no majority),
with <3 distal scars, 7.5-27.5 x 2.5-3.75 um.
Matt AGar: Colonies after 14 days of culture at 25°C, presenting a growth
of 59 mm, dark green grayish yellowish to dark green, reverse dark green.
Conidiophores erect, lateral or terminal, olive to brown, septate, smooth,
branched, 13-190 x 2.5-6.25 um. Conidia in tandem, smooth, olive to brown,
non-septate, globose to subglobose, 2.5-5 x 1.25-2.5 um. Conidiogenous cells
undifferentiated. Branch-primary conidia (2.5 x 2.5-3 um) with up to 2 distal
scars; branch-secondary conidia, 0-1 septum (no majority), with <2-3 distal
scars, 3-22.5 x 2.5-3.75 um.
MALT + 5% NACL: Colonies after 14 days of culture at 25°C, presenting
a growth of 50 mm, dark grayish green, reverse dark green, and with little
sporulation. Conidiophores erect, lateral or terminal, olive to brown, septate,
smooth, branched, 15-212.5 x 2.5 um. Conidia in tandem, smooth, olive to
brown, non-septate, globose (majority) to limoniform, rough 2.5-5 x 1.25-3.75
uum. Conidiogenous cells undifferentiated. Branch-primary conidia present;
branch-secondary conidia, 0-1 septum, with up to 3 (mostly 2) distal scars,
10-25 x 3.75 um.
28 ... Oliveira & al.
SPECIMEN EXAMINED: BRAZIL. PERNAMBUCO: Sao Vicente Férrer, in healthy mature
leaves of Vitis labrusca L. cv. Isabel, Feb 2010, T.E.R Lima (URM6963; GenBank
KJ000286).
Notes: Cladosporium halotolerans is known from Africa, Arctic, Asia,
Australasia, Europe, North America, and Central and South America. This is
the first recorded occurrence of the species as an endophyte.
Cladosporium dominicanum Zalar, de Hoog & Gunde-Cim., Stud. Mycol. 58: 169.
2007.
PotaTo DEXTROSE AGAR: Colonies after 14 days of culture at 25°C, presenting
a growth of 31 mm, green olive, velvety, reverse dark gray. Conidiophores
erect, lateral or terminal, olive to brown, slightly verrucose, septate, branched
or unbranched, 36-245 x 2-2.5 um. Conidiogenous cells undifferentiated.
Conidia in tandem, slightly verrucose, light brown, not septate, ovoid, 3.7-5.58
x 2.7-3.2 um. Ramoconidia rarely formed; secondary cylindrical ramoconidia,
0-1 septate 14-28 x 2.5-3 um.
MALT AGAR: Colonies after 14 days of culture at 25°C, presenting a growth of
34 mm, dark green, velvety, grooved, reverse dark gray. Conidiophores erect,
lateral or terminal, olive to brown, slightly verrucose, septate, branched or
unbranched, 50-160 x 2-2.5 um. Conidiogenous cells undifferentiated. Conidia
in tandem, slightly verrucose, light brown, non-septate, ovoid, 3.7-5.58 x
2.7-3.2 um. Ramoconidia rarely formed; secondary cylindrical ramoconidia,
0-1 septate, 12-19 x 2.5-3 um.
MALT + 5% NACL: Colonies after 14 days of culture at 25°C, presenting
a growth of 40 mm, light green, grooved, reverse dark gray. Conidiophores
erect, lateral or terminal, olive to brown, slightly verrucose, septate, branched
or unbranched, 45-107.5 x 2-2.5 um. Conidiogenous cells undifferentiated.
Conidia in tandem, slightly verrucose, light brown, non-septate, ovoid, 3.7-4.8
x 2.7-3.2 um. Ramoconidia rarely formed, secondary cylindrical ramoconidia,
0-1 septate, 10-22.5 x 2.5-3 um.
SPECIMEN EXAMINED: BRAZIL. PERNAMBUCO: Goiana, in healthy mature leaves of
Cocos nucifera L., May 2012, R.J.V. Oliveira (URM6962; GenBank KJ000287).
Notes: Cladosporium dominicanum was previously known from Asia (Iran) and
Central America (Dominican Republic). This is the first recorded occurrence
of the species for South America (Brazil) and as an endophyte.
Molecular & phylogenetic analysis
The sequences generated from our fungal isolates grouped firmly in
Cladosporium. Our isolate URM6962 (from leaves of Cocos nucifera) formed a
clade with sequences from C. dominicanum, and isolate URM6963 (from leaves
of Vitis labrusca) formed a clade with sequences from C. halotolerans (Fic. 1).
Cladosporium spp. in Cocos nucifera & Vitis labrusca (Brazil) ... 29
: C. cladosporioides DQ780408/EXF-321
199) C. cladosporioides DQ780409/EXF-780
oe °°! ©. cladosporioides AY213640/CBS 170.54 neotype
ee C. spinulosum DQ780406/EXF-334
1.00! C. subinflatum DQ780405/EXF-343
—| C. tenuissimum DQ780397/EXF-452
PY C. tenuissimum DQ780398/EXF-563
54 C. oxysporum DQ780393/EXF-710
3] 24 C. oxysporum DQ780392/EXF-697
4.00 32
0.98 & C. oxysporum DQ780391/EXF-711
e5 28) C. psychrotolerans DQ780387/EXF-326
4
099} 121. psychrotolerans DQ780386/EXF-391
99 | C: fusiforme DQ780390/CBS 452.71
C. fusiforme DQ780389/EXF-397
"IC. fusiforme DQ780388/CBS 119414
991 C. velox DQ780361/CBS 119417
1.90 C. velox DQ780360/EXF-471
C. dominicanum DQ780355/EXF-720
C. dominicanum DQ780357/CPC 11683 holotype
0.80
87 1001 C. dominicanum KJ000287/URM6962
83
87 °°! C. dominicanum DQ780354/EXF-727
C. dominicanum DQ780353/CBS 119415
C. sphaerospermum DQ780343/CBS 193.54 neotype
891 C. sphaerospermum DQ780350/CBS 109.14
71 100
Be C. sphaerospermum DQ780348/EXF-738
C. sphaerospermum DQ780344/EXF-739
C. halotolerans DQ780364/CBS 119416 holotype
C. halotolerans DQ780368/EXF-380
93 | C. halotolerans KJ000286/URM6963
95 7 C. halotolerans DQ780366/EXF-646
; C. halotolerans DQ780367/EXF-703
Fa C. salinae DQ780375/EXF-322
Re C. salinae DQ780374/CBS 119413
Cercospora beticola AY840527/CPC 11557
Change
0.02
Fic. 1. Phylogenetic reconstruction of the sphaerospermum complex in Cladosporium obtained
from sequences of the ITS region. Sequences are labeled with their GenBank accession numbers.
Support values (from top) are from neighbor-joining (NJ), maximum parsimony (MP), maximum
likelihood (ML) and Bayesian analyses. Only bootstrap values of at least 50% are shown.
In their review of Cladosporium, Bensch et al. (2012) showed that
C. halotolerans and C. dominicanum belong to the C. sphaerospermum complex
and are grouped close together.
30 ... Oliveira & al.
In the Blastn analysis, our C. dominicanum sequence (KJ000287) showed
100% identity with sequence DQ780353 of the C. dominicanum ex-holotype
culture (EXF752 = CBS 119415) and with two sequences (KC763352,
KC845931) from Chinese isolates labelled “C. sphaerospermum”. However, as
sequence DQ780343 of the C. sphaerospermum neotype (CBS 193.54) showed
only 97% identity with the sequence of our isolate URM6962, we conclude that
sequences KC763352 and KC845931 in fact represent C. dominicanum.
In the Blastn analysis, our C. halotolerans sequence (KJ000286) showed
100% identity with sequence DQ780364 of the C. halotolerans ex-holotype
culture (EXF572 = CBS 119416) and with 24 databank sequences labelled either
“C. cladosporioides” (EF577236, AY361968, AB456576) or “C. sphaerospermum”
(AB572909, AB572908, AB572903, AB572897, JN084018, AY625063,
AM182174, AM182171, AM182168, AM176749, AM176685, EU759978,
EU823317, JX156365, KC009836, JX839460, HQ263345, HQ248189,
GU017501, JN253512, JN253512). However as sequence HM148003 of the
C. cladosporioides neotype (CBS 17054) showed only 98% identity and the
C. sphaerospermum neotype sequence showed only 96% identity with
the sequence of our isolate URM6963, we conclude that the 24 database
sequences probably represent C. halotolerans and not C. cladosporioides or
C. sphaerospermum.
Acknowledgments
The authors thank Dr. José Luiz Bezerra and Dr. Jodo Lucio Azevedo for
presubmission critical review. Special acknowledgements to Dr. Shaun Pennycook and
Dr. Lorelei Norvell for their additional important corrections and suggestions to the
manuscript. The authors also acknowledge the financial support provided by Conselho
Nacional de Desenvolvimento Cientifico e Tecnoldgico (CNPq).
Literature cited
Bensch K, Groenewald JZ, Dijksterhuis J, Starink-Willemse M, Andersen B, Shin H-D, Dugan
FM, Schroers H-J, Braun U, Crous PW. 2010. Species and ecological diversity within the
Cladosporium cladosporioides complex (Davidiellaceae, Capnodiales). Studies in Mycology 67.
96 p. http://dx.doi.org/10.3114/sim.2010.67.01
Bensch K, Braun U, Groenewald JZ, Crous P.W. 2012. The genus Cladosporium. Studies in Mycology
72. 401 p. http://dx.doi.org/10.3114/sim0003
Bezerra JDP, Santos MGS, Svedese VM, Lima DMM, Fernandes MJS, Paiva LM, Souza-Motta
CM. 2012. Richness of endophytic fungi isolated from Opuntia ficus-indica Mill. (Cactaceae)
and preliminary screening for enzyme production. World Journal of Microbiology and
Biotechnology 28: 1989-1995. http://dx.doi.org/10.1007/s11274-011-1001-2
Clements FE, Shear CL. 1931. The genera of fungi. New York: H.W. Wilson Co. 496 p.
Costa IPMW, Assuncaéo MMC, Lima TEE, Oliveira RJV, Cavalcanti MAQ. 2012. Checklist of
endophytic fungi from tropical regions. Mycotaxon 119: 493.
http://www.mycotaxon.com/resources/checklists/costa_v119_checklist.pdf
Cladosporium spp. in Cocos nucifera & Vitis labrusca (Brazil) ... 31
Dugan FM, Schubert K, Braun U. 2004. Check-list of Cladosporium names. Schlechtendalia 11.
103 p.
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew.
England. 608 p.
Ellis MB. 1976. More dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew.
England. 507 p.
Go6es-Neto A, Loguercio-Leite C, Guerrero RT. 2005. DNA extraction from frozen field-collected
and dehydrated herbarium fungal basidiomata: performance of SDS and CTAB-based methods.
Biotemas 18: 19-32.
Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies
by maximum likelihood. Systematic Biology 52(5): 696-704.
http://dx.doi.org/10.1080/10635150390235520
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.
Kwon JH, Kang SW, Kim JS, Park CS. 2001. Scab of tea (Thea sinensis) caused by Cladosporium
herbarum in Korea. Plant Pathology Journal 17: 350-353.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,
Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and
Clustal X version 2.0. Bioinformatics 23: 2947-2948.
http://dx.doi.org/10.1093/bioinformatics/btm404
Link HF. 1816. Observationes in ordines plantarum naturales HI. Magazin der Gesellschaft
Naturforschender Freunde Berlin 7: 37-38.
Liu CH, Zou WX, Lu H, Tan RX. 2001. Antifungal activity of Artemisia annua endophyte against
phytopathogenic fungi. Journal of Biotechnology 88(3): 277-282.
http://dx.doi.org/10.1016/S0168-1656(01)00285-1
Milne I, Wright EK Rowe G, Marshall DF, Husmeier D, McGuire G. 2004. TOPALi: Software
for automatic identification of recombinant sequences within DNA multiple alignments.
Bioinformatics 20: 1806-1807. http://dx.doi.org/10.1093/bioinformatics/bth155
Pereira JO, Azevedo JL, Petrini O. 1993. Endophytic fungi of Stylosanthes. Mycologia 85: 362-364.
http://dx.doi.org/10.2307/3760696
Petrini O. 1996. Ecological and physiological aspects of host specific and endophytic fungi.
87-100, in: SC Redlin, LM Carris (Eds). Endophytic fungi in grasses and woody plants. St Paul:
American Phytopathological Society Press.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19(12): 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Sutton BC.1991. Notes on deuteromycetes II. Sydowia 43: 264-280.
Swofford DL. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (* and other methods),
Version 4. Sinauer Associates, Sunderland, Massachusetts.
White TJ, Bruns T, Lee S, Taylor L. 1990. Amplification and direct sequencing of fungal RNA genes
for phylogenetics. 315-322, in MA Innis et al. (eds). PCR protocols. a guide to methods and
applications. Academic Press, San Diego.
Zalar P, Hoog GS de, Schroers H-J, Crous PW, Groenewald JZ, Gunde-Cimerman N. 2007.
Phylogeny and ecology of the ubiquitous saprobe Cladosporium sphaerospermum, with
descriptions of seven new species from hypersaline environments. Studies in Mycology 58:
157-183. http://dx.doi.org/10.3114/sim.2007.58.06
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.33
Volume 129(1), pp. 33-40 July-September 2014
Aschersonia narathiwatensis sp. nov. from southern Thailand
SUCHADA MONGKOLSAMRIT”™, ARTIT KHONSANIT', WASANA NOISRIPOOM'’,
PAGMADULAM BALDOR)’, & J. JENNIFER LUANGSA-ARD*
‘BIOTEC, NSTDA Science Park,
113 Paholyothin Road, Klong 1, Klong Luang, Pathum Thani, Thailand
?Institute of Biology, Mongolian Academy of Sciences, Ulaanbaatar-51, Mongolia
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Aschersonia narathiwatensis was isolated from whitefly nymphs (Hemiptera)
collected at Hala-Bala Wildlife Sanctuary in Narathiwat Province, Thailand. This species has
circular flattened-discoid brown to dark brown stroma and non-fragmenting ascospores.
A comparison of macro-and microscopic characters among similar species is given.
Phylogenetic analyses of nuclear ribosomal large subunit (LSU) and translation elongation
factor 1-a (TEF-1la) support recognizing this fungus as a new species.
Key worps — morphology, phylogenetics, taxonomy
Introduction
Aschersonia Mont. is a genus of entomopathogenic fungi that attack scale
insects (Coccidae, Hemiptera) or white flies (Aleyrodidae, Hemiptera) of which
several species are reported from tropical and subtropical regions (Montagne
1848; Petch 1921; Mains 1959a,b; Chaverri et al. 2008; Mongkolsamrit et al. 2009,
2011; Qiu et al. 2009, 2010; Qiu & Guan 2010). Research on entomopathogenic
fungi has been conducted under the biodiversity studies program to further
our knowledge of these fungi in Thailand. Here we describe a new Aschersonia
species from a tropical rainforest in southern Thailand.
Materials & methods
Surveys and collections were made during the rainy season in Hala-Bala Wildlife
Sanctuary, which is located at the southernmost tip of peninsular Thailand on the
international border with Malaysia. Pure cultures were made from isolations from
the teleomorphic state following Mongkolsamrit et al. (2009). Sections of the stroma
prepared by using a freezing microtome were mounted in distilled water and in cotton
blue in lactophenol (Heritage et al. 1996). Observation of the microscopic characters
34 ... Mongkolsamrit & al.
(e.g., perithecia, ascospores and asci) were made using a light microscope. The color
of fresh specimens and cultures were compared with the colors from standard code
of Kornerup & Wanscher (1962). A voucher specimen and culture were deposited in
BIOTEC Bangkok Herbarium (BBH) and BIOTEC Culture Collection, Thailand.
Genomic DNA was extracted from each sample with cetyltrimethyl-ammonium
bromide (CTAB) according to Mongkolsamrit et al. (2009). PCR amplification was done
TABLE 1. List of fungi used in molecular analyses.
(Newly generated sequences set in bold.)
GENBANK
SPECIES VOUCHER/ISOLATE
LSU EF1-a
Aschersonia badia BBH 14255 = BCC 8105 DQ518752 KC713630
BBH 32386 = BCC 55524 — KF016991
A. calendulina *BBH 17344 = BCC 20309 GU552154 KF016993
BBH 17325 = BCC 20306 GU552148 KF016994
*BCC 9483 DQ384938 DQ384962
A. luteola *BBH 13011 = BCC 19360 GU552155 GU552147
BBH 14277 = BCC 9481 DQ384945 DQ384974
BBH 14078 = BCC 7865 DQ384946 DQ384975
A. minutispora BBH 17373 = BCC 20635 GU552149 DQ552143
BBH 14143 = BCC 7959 GU552150 —
BBH 12951 = BCC 17487 GU552151 GU552144
A. narathiwatensis *BBH 31120 = BCC 49495 KC713633 KC713628
*BBH 31120 = BCC 49498 KF016998 —
*BBH 31120 = BCC 49499 KF016999 KF016992
A. samoensis BBH 14540 = BCC 8775 DQ384944 DQ384972
*BCC 8237 DQ384937 DQ384977
*NHJ 4093 AF327381 —
Balansia henningsiana GAM 16112 AY489715 AY489610
Epichloe elymi C. Schardl 760 AY986924 AY986951
Moelleriella phyllogena PC. 554 = CUP 067784 EU392609 EU392673
P.C. 555 = CUP 067785 EU392610 EU392674
M. raciborskii 193-901b = ARSEF 7661 EU392611 EU392676
M. umbospora PC. 457 = CUP 067816 AY986904 AY986929
Samuelsia geonomis P.C. 614 = CUP 067857 EU392638 EU392692
S. mundiveteris BBH 24706 = BCC 31750 GU552157 GU552142
BBH 26961 = BCC 40021 GU552152 GU552145
BBH 26961 = BCC 40022 GU552153 GU552146
S. rufobrunnea P.C. 613 = CUP 067858 AY986918 AY986944
* Living cultures isolated from ascospores.
Aschersonia narathiwatensis sp. nov. (Thailand) ... 35
in 50 ul volumes consisting of 1x PCR buffer, 200 uM of each of the four dNTPs, 2.5
mM MgCl2, 1 U Taq DNA polymerase (Promega, Madison, Wisconsin), and 0.5 uM of
each primer. The amplification of the partial gene region of the large subunit nuclear
ribosomal DNA (LSU) used primers LRORf and LR5r (Vilgalys & Sun 1994) and the
translation elongation factor 1-a (TEF-la) was amplified with primers EF-la: 983f
(Carbone & Kohn 1999) and 2218r (Rehner 2001). After amplification in a MJ Research
é A. calendulina BCC20309
99 |L A. calendulina BCC20306
A. calendulina BCC9483
A, narathiwatensis BCC49495
95
98_| 4. narathiwatensis BCC49499
A. narathiwatensis BCC49498
<50
99 A, badia BCC55524
<50
A. badia BCC8105
68 A. samoensis BCC8237
My 64 |¢ A. samoensis NHJ4093
Aschersonia (teleomorph A. samoensis BCC8775
Hypocrella sensu lato)
Ny 97 (4: luteola BCC19360
100 97| | A. luteola BCC7865
A. luteola BCC9481
71 | 4: minutispora BCC7959
98 A. minutispora BCC17487
a A, minutispora BCC20635
96 S. mundiveteris BCC40021
100 |' S. mundiveteris BCC40022
100 S. mundiveteris BCC31750
91
87 S. geonomis P.C.614
S. rufobrunnea P.C.613
100 |4 phyllogena P.C.555
100 M. phyllogena P.C.554
69 M. umbospora P.C.457
M. raciborskii 193-901b
Epichloe elymi
Balansia henningsiana
10 changes
PLATE 1. Phylogenetic relationship of Aschersonia narathiwatensis and related species based on
maximum parsimony analysis of the LSU and EF-1 a. Numbers above each branch represent
bootstrap support from 1000 replicates. [S. = Samuelsia; M. = Moelleriella]
36 ... Mongkolsamrit & al.
DNA Engine ALD1244 thermal cycler following the procedure described in Sung et al.
(2001), the PCR products were purified with a QIAquick PCR Purification Kit (Qiagen
GmbH, Hilden, Germany), following the manufacturer’s instructions. Purified PCR
products were sent to Macrogen Inc. Korea for sequencing. Sequences were proofread
manually and assembled using BioEdit v. 7.0.4 (Hall 1999), and deposited in GenBank
(TABLE 1). Sequences were aligned with Clustal W incorporated in BioEdit, and
alignments were refined manually by direct examination. Maximum parsimony analysis
was performed on the combined dataset of LSU and tef-1a sequences in PAUP 4.0b10
using random addition sequence (10 replications) where gaps were treated as missing
data. Bootstrap analysis was performed using maximum parsimony criterion in 1000
replication samples. Balansia henningsiana GAM 16112 and Epichloe elymi C. Schardl
760 were used as outgroup taxa.
Results
Molecular analysis
LSU sequences were obtained from three isolates, and tef-la sequences
from six isolates. Twenty-four LSU-related sequences and 19 TEF-1la-related
sequences from GenBank were used to construct a phylogenetic tree. Of the
1652 characters in the combined alignment, 268 characters were parsimony
informative. Maximum parsimony analyses of this data set yielded one
parsimonious tree (tree length 698; CI = 0.610, RI = 0.797, RC = 0.486, HI = 0.390)
as shown in PLATE 1. The phylogenetic tree shows that three teleomorphic
isolates assigned to our new species (BCC 49495, BCC 49498 and BCC 49499)
belong to the genus Aschersonia with a strong bootstrap support of 100%.
Taxonomy
Aschersonia narathiwatensis Mongkols., Khonsanit & Luangsa-ard, sp. nov.
MycoBank MB 803933 PLATE 2
Differs from A. calendulina by its brown to dark brown stromata and shorter ascospores.
Type — ‘Thailand: Narathiwat Province, Headquarter Trail, Hala-Bala Wildlife
Sanctuary, on whitefly nymphs (Hemiptera) on underside of dicotyledonous leaf, 24
Aug. 2011, A. Khonsanit (Holotype, BBH 31120; ex-holotype cultures BCC 49495
[GenBank, KC713633, KC713628], BCC 49498 [GenBank, KF016998], BCC 49499
[GenBank, KF016999, KF016992].
ErymMo.ocy — referring to Narathiwat Province, the collection location.
TELEOMORPH: Hypocrella
STROMATA circular, flattened-discoid, brown to dark brown, 5E7, <1-3 mm
diam and 0.5-1 mm high, margin undulate, base slightly constricted; internally
hyaline to whitish-coloured. Hypothallus membranous, slight or thickened,
0.5-1 mm thick, pale yellow. Perithecia crowded, immersed, 200-430 x
100-200 um, elongate flask-shaped, ostioles slightly projecting, translucent
Aschersonia narathiwatensis sp. nov. (Thailand) ... 37
PLATE 2. Aschersonia narathiwatensis: A-C. Stromata on infected whitefly nymph hosts; D. Cross
section of stroma showing perithecia; E, F Mature ascus with developing asci; G. Whole ascospores;
H. Sporulating colony on PDA at 20°C after 4 wk.
dark-brown. Asci 8-spored, <200 x 10-12 um. Ascospores whole, non-
fragmenting, 80-100 x 1.5-2 um, blunt at upper end tapering to base.
CULTURAL CHARACTERISTICS Ascospores germinating within 24 h on PDA.
Colonies on potato dextrose agar (PDA) slow-growing, attaining a diam of
5 mm in 4 wk. Optimal temperature 20-25°C, with no growth at <5°C and
>35°C. Stromatic colonies pale brown, forming moderately compact stromata.
Conidial masses pale brown, 4C6, appearing as abundant slimy masses from
immersed pycnidia scattered over surface.
ComMENnts: In this study, the anamorphic generic name Aschersonia is used
based on the recent major changes in fungal nomenclature requiring only one
scientific name per fungal species (Hawksworth 2011; Taylor 2011; Gams et al.
2012; McNeill et al. 2012). Described earlier in 1848, Aschersonia has priority
over the teleomorphic generic name, Hypocrella Sacc. (1878). In this study,
Hypocrella is treated as the teleomorph of Aschersonia.
38 ... Mongkolsamrit & al.
Aschersonia narathiwatensis was been found only at Hala-Bala Wildlife
Sanctuary in southern Thailand. Despite several attempts to find it in different
seasons of the year, the anamorphic state of this species was not found in the
field. The teleomorphic characters are presented and compared with other
Thai species representing Hypocrella sensu lato (TABLE 2). The teleomorphic
state of A. narathiwatensis is similar to that of A. calendulina reported from
Thailand by Mongkolsamrit et al. (2009) in having flattened discoid stromata
but differs in the color and size of the stromata. Aschersonia narathiwatensis has
brown to dark brown stromata while those of A. calendulina are bright orange.
The ascospores of A. narathiwatensis are somewhat shorter than those of
A. calendulina (TABLE 2). In the phylogenetic analysis, A. narathiwatensis and
A. calendulina form a clade with 95% support. Both morphological characters
and phylogenetic analysis of the partial gene regions of LSU and tef-1a support
A. narathiwatensis as a new species.
TABLE 2. Morphological comparison of Aschersonia teleomorphs in Thailand.
STROMATAL STROMATAL ASCI ASCOSPORES REFERENCE
SPECIES
SHAPE COLOUR (um) (um)
A. calendulina Flattened Bright <180 x 130-150 x Mongkolsamrit
discoid orange 10-12 1.5-2 et al. (2009)
A. luteola Discoid to Yellow <170 x 75-120 x Mongkolsamrit
stud-shaped 75-8 2 et al. (2009)
A. narathiwatensis Flattened Brown <200 x 80-100 x This study
discoid 10-12 1.5-2
Abana a Discoid to Rust 140-180 60-90 x Hywel-Jones &
: stud-shaped orange x 8 4-5 Evans (1993)
Acknowledgments
The authors would like to thank Dr. Amy Y. Rossman (Systematic Mycology &
Microbiology Laboratory, Beltsville, MD, USA) and Dr. Richard A. Humber (USDA-
ARS Biological Integrated Pest Management Research Unit, Ithaca, NY, USA) for their
comments and suggestions to improve this manuscript. We also would like to thank
Prof. Morakot Tanticharoen, Dr. Kanyawim Kirtikara, and Dr. Lily Eurwilaichitr for
their support of the program, ‘Biodiversity studies of entomopathogenic fungi in
Thailand.” We are grateful to Mr. Soonthorn Todam and the staff at Hala-Bala Wildlife
Sanctuary for their kind cooperation.
Literature cited
Carbone I, Kohn LM. 1999. Method for designing primer sets for speciation studies in filamentous
ascomycetes. Mycologia 91: 553-556. http://dx.doi.org/10.2307/3761358
Aschersonia narathiwatensis sp. nov. (Thailand) ... 39
Chaverri P, Liu M, Hodge KT. 2008. A monograph of entomopathogenic genera Hypocrella,
Moelleriella and Samuelsia gen nov. (Ascomycota, Hypocreales, Clavicipitaceae), and their
anamorphs in the Neotropics. Studies in Mycology 60: 1-66.
http://dx.doi.org/10.3114/sim.2008.60.01
Gams W, Humber RA, Jaklitsch W, Kirschner R, Stadler M. 2012. Minimizing the chaos
following the loss of Article 59: Suggestions for a discussion. Mycotaxon 119: 495-507.
http://dx.doi.org/10.5248/119.495
Hall TA, 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.
http://www.mbio. ncsu.edu/bioedit/bioedit.html [Accessed 13 Feb 2005].
Hawksworth DL, Crous PW, Redhead SA, Reynolds DR, Samson RA, Seifert KA, Taylor JW,
Wingfield MJ, et al. 2011. The Amsterdam declaration on fungal nomenclature. IMA Fungus 2:
105-112. http://dx.doi.org/10.5598/imafungus.2011.02.01.14
Heritage J, Evans EGV, Killington RA. 1996. Introductory microbiology. Cambridge University
Press. Cambridge. http://dx.doi.org/10.1017/CBO9781139170635
Hywel-Jones NL, Evans HC. 1993. Taxonomy and ecology of Hypocrella discoidea and its anamorph
Aschersonia samoensis. Mycological Research 97: 871-876.
http://dx.doi.org/10.1016/S0953-7562(09)81165-9
Kornerup A, Wanscher JH. 1962. Reinhold color atlas. Reinhold Publishing Corporation, New
York. 224 p.
Mains EB. 1959a. North American species of Aschersonia parasitic on Aleyrodidae. J. Insect Pathol.
1: 43-47,
Mains EB. 1959b. Species of Aschersonia (Sphaeropsidales). Lloydia 22(3): 215-221.
McNeill J, Barrie FR, Buck WR, Demoulin V, Greuter W, Hawksworth DL, Herendeen PS, Knapp
S, Marhold K, Prado J, Pru? homme van Reine WF, Smith GE, Wiersema JH, Turland NJ (eds),
2012. International Code of Nomenclature for algae, fungi, and plants (Melbourne Code)
adopted by the Eighteenth International Botanical Congress Melbourne, Australia, July 2011
(Regnum Vegetabile No. 154). Koeltz Scientific Books, Konigstein.
Mongkolsamrit S, Luangsa-ard JJ, Spatafora JW, Sung GH, Hywel-Jones NL. 2009. A combined
ITS rDNA and beta-tubulin phylogeny of Thai species of Hypocrella with non-fragmenting
ascospores. Mycological Research 113:684-699. http://dx.doi.org/10.1016/j.mycres.2009.02.004
Mongkolsamrit $, Nguyen TT, Tran NL, Luangsa-ard JJ. 2011. Moelleriella pumatensis, a new
entomogenous species from Vietnam. Mycotaxon 117: 45-51. http//dx.doi.org/10.5248/117.45
Montagne JPFC. 1848. Sixiéme centurie de plantes cellulaires exotiques nouvelles. Cryptogamae
Taitenses. Annales des Sciences Naturelles Botanique, Série 3, 10: 106-136.
Petch T. 1921. Studies in entomogenous fungi. II. The genera of Hypocrella and Aschersonia. Annals
of the Royal Botanic Gardens Peradeniya 7: 167-278.
Qiu JZ, Guan X. 2010. A new species of Aschersonia (Clavicipitaceae, Hypocreales) from China.
Mycotaxon 111: 471-475. http://dx.doi.org/10.5248/111.471
Qiu JZ, Ma HE, Wang YY, Guan X. 2009. Two Aschersonia species from Fujian new to China.
Mycosystema 28(1): 60-63.
Qiu JZ, Sun CY, Guan X. 2010. A new pathogen of scale insects, Aschersonia fusispora sp. nov.
(Clavicipitaceae) from Guangxi Province, China. Mycotaxon 113: 81-85.
http://dx.doi.org/10.5248/113.81
Rehner SA. 2001. Primers for Elongation Factor 1-alpha (EFl-alpha). Available from:
http://ocid.nacse.org/research/deephyphae/EF 1 primer.pdf
AO ... Mongkolsamrit & al.
Sung G-H, Spatafora JW, Zare R, Hodge KT, Gams W. 2001. A revision of Verticillium sect.
Prostrata 11. Phylogenetic analyses of SSU and LSU nuclear rDNA sequences from anamorphs
and teleomorphs of the Clavicipitaceae. Nova Hedwigia 72: 311-328.
Taylor JE. 2011. One fungus = one name: DNA and fungal nomenclature twenty years after PCR.
IMA Fungus 2: 113-120. http://dx.doi.org/10.5598/imafungus.2011.02.02.01
Vilgalys R, Sun BL. 1994. Ancient and recent patterns of geographic speciation in the oyster
mushroom Pleurotus revealed by phylogenetic analysis of ribosomal DNA sequences. Proc Natl
Acad Sci USA 91: 4599-4603. http://dx.doi.org/10.1073/pnas.91.10.4599
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.41
Volume 129(1), pp. 41-46 July-September 2014
South Florida microfungi: Linkosia longirostrata,
a new hyphomycete on paurotis palm
GREGORIO DELGADO
EMLab Pe&K North Phoenix, 1501 West Knudsen Drive, Phoenix, AZ 85027, U.S.A.
* CORRESPONDENCE TO:
[email protected]
Asstract — Linkosia longirostrata sp. nov. is described and illustrated from rachides of
dead leaves of Acoelorrhaphe wrightii collected in southeastern Florida, U.S.A. The fungus is
distinct in having no or very reduced 1-2-septate conidiophores, smooth or slightly verrucose
determinate or occasionally percurrent conidiogenous cells, and narrowly obclavate to
long obclavate rostrate finely roughened 9-18-distoseptate conidia with 0-2 dark brown
constrictions and a long slender straight rostrum with 0-5 intercalary nodular swellings.
Differences and similarities with morphologically similar Linkosia species are discussed.
Key worps — anamorphic Ascomycota, palm fungi, Sporidesmium, taxonomy
Introduction
While examining collections of dead plant debris from south Florida, several
interesting Sporidesmium-like taxa were found colonizing decaying parts of
native or introduced palm trees. One clearly fits within Linkosia A. Hern.-Gut.
& B. Sutton (Hernandez-Gutiérrez & Sutton 1997, Wu & Zhuang 2005) in
having distoseptate conidia and very reduced or absent conidiophores. After
a detailed comparison with previously described Linkosia species, the fungus
was found to differ in several morphological features and therefore is described
here as new.
Materials & methods
Samples of dead leaves of Acoelorrhaphe wrightii (Griseb. & H. Wendl.) H. Wendl. ex
Becc. (paurotis palm; Arecaceae) were collected from a forested area in central Broward
County, Florida, U.S.A., in 2010. The samples were cut into small pieces and placed
in plastic bags for later processing and examination according to Cannon & Sutton
(2004). Fungal structures were mounted in lacto-cotton blue and 100 measurements
were made at 1000x magnification whenever possible. Minimum, maximum, 5th and
95th percentiles were calculated for all measurements using Microsoft Excel 2007, with
42 ... Delgado
extreme values given in parentheses when different from percentiles. Microphotographs
were taken using an Olympus BX-45 microscope and edited using Adobe Photoshop.
The type specimen and other specimen including semi-permanent slides are deposited
in the Herbarium of the U.S. National Fungus Collections (BPI).
Taxonomy
Linkosia longirostrata G. Delgado, sp. nov. PLATE 1
MycoBank MB809951
Differs from Linkosia coccothrinacis in having very reduced 1-2-septate conidiophores,
occasionally percurrent conidiogenous cells, and larger finely roughened long obclavate-
rostrate conidia with more distosepta and a rostrum with 0-5 intercalary nodular
swellings.
Type — U.S.A. Florida, Broward Co., Plantation, Plantation Heritage Park, Anne Kolb
Memorial Trail, 26°06’25”N 80°13’19”W, on rachides of dead leaves of Acoelorrhaphe
wrightii, 30.V.2010, coll. G. Delgado (Holotype: BPI 884152H).
EryMoLocy — longirostrata, from the Latin longus (long) and rostratus (beaked),
referring to the long conidial rostrum
COLONIES effuse, hairy, brown. MyceLium superficial, composed of branched,
septate, pale brown to brown hyphae, 2-3 um wide. CONIDIOPHORES absent
or very reduced, erect, straight, 1-2-septate, dark brown, often with a lobed
base, 19-30(-37) um long, 7-15 um wide at base. CONIDIOGENOUS CELLS
monoblastic, integrated, terminal, determinate or occasionally percurrent,
solitary, simple, subcylindrical or lageniform, smooth or slightly verrucose,
tapering toward the truncate apex, brown to dark brown, 13-22 x 6-11 um,
3.5-5 um wide at the apex, with 0-1 ampulliform, brown, rarely 1-septate
proliferation. CONIDIAL SECESSION schizolytic. Conip14 holoblastic, straight or
slightly curved, narrowly obclavate to long obclavate rostrate, 9-18-distoseptate
with 0-4 pigmented distosepta, pale brown, darker toward the apex, sometimes
with 0-2 dark brown constrictions, finely rough, (73-)91-158(-172) um long
(including rostrum), 6.5-12 um wide; basal cell cylindrical or conico-truncate,
dark brown to blackish brown, 6-11 x 3.5-5 um; rostrum slender, straight,
pale brown to brown, subhyaline at the tip, <82 um long, with 0-5 intercalary,
nodular swellings, 3-5 um wide. TELEOMORPH unknown.
ADDITIONAL SPECIMEN EXAMINED — U.S.A. Florida, Broward Co., Plantation, Plantation
Heritage Park, Anne Kolb Memorial Trail, 26°06’25”N 80°13’19’W, on rachides of dead
leaves of Acoelorrhaphe wrightii, 30.V.2010, coll. G. Delgado (BPI 884154H).
Discussion
Hernandez-Gutiérrez & Sutton (1997) introduced Linkosia in the context
of a morphology-based reassessment of Sporidesmium Link that emphasized
conidial septation, conidiophore presence or absence, and conidiophore
proliferation (Subramanian 1992). The type species, Sporidesmium coccothrinacis
Linkosia longirostrata sp. nov. (U.S.A.) ... 43
PLaTE 1. Linkosia longirostrata (holotype, BPI 884152H): A. Conidia. B. Conidiophores, conidiogenous
cells with or without proliferations, and mature and immature conidia. Scale bars = 30 um.
A
44 ... Delgado
A. Hern.-Gut. & J. Mena (= Linkosia coccothrinacis; Hernandez-Gutiérrez
& Sutton 1997), is a peculiar hyphomycete characterized by conidiophores
reduced to a single monoblastic conidiogenous cell and distoseptate conidia
(Hernandez-Gutiérrez & Mena 1994). Subsequently, nine additional species
have been described or transferred to the genus based on differences in conidial
morphology including shape, number of distosepta, dimensions, wall texture
and presence or absence of apical appendages (Almeida et al. 2014, Castaneda
et al. 2000, Ma et al. 2011, Wu & Zhuang 2005, Zhang et al. 2009). Multigene-
sequence data indicate that Linkosia, as well as other morphologically
circumscribed Sporidesmium-like genera, are polyphyletic (Shenoy et al. 2007,
Iturriaga et al. 2008). The few phylogenetic studies conducted on this generic
complex have revealed the diverse or uncertain affinities of Linkosia species
within the Sordariomycetes (Shenoy et al. 2006, Yang et al. 2010). The genus
needs to be redefined in the light of molecular data but very few sequences are
currently available in GenBank and one (attributed to L. fusiformis W.P. Wu)
is apparently a contaminant (Summerbell et al. 2011). For that reason and in
the absence of a culture isolate and molecular data, the present fungus is placed
in Linkosia for diagnostic purposes, following the traditional morphological
approach.
Linkosia longirostrata is morphologically unique among Linkosia species.
Conidiogenous cells, which are slightly verrucose or smooth, are usually
determinate but sometimes proliferate percurrently at least once to form an
ampulliform proliferation at the apex which can be either 0- or 1-septate, a
feature not previously seen in any other Linkosia species but present in the
morphologically similar genus Stanjehughesia Subram. (Castaneda & Kendrick
1990, McKenzie 1995). The conidia are narrowly obclavate but mostly long
obclavate rostrate with a long slender straight rostrum where up to 5 nodular
swellings form at intervals along its length. These swellings apparently relate
to different stages of rostrum elongation. The conidial tip, usually tapering
to 1.5-2 um, widens to 3-5 um diam. and is at first rounded, after which the
rostrum elongates to a certain length, gradually tapers, darkens, and widens
again at a further point to form a new swelling, giving the rostrum a knotty
appearance. One or two constrictions with a distinct dark brown band are
often present at some distosepta, and sometimes the conidium between the
constriction and basal cell turns dark brown as well. Also a few distosepta (up to
four in certain conidia) appear pigmented and darker than the others. Younger
conidia are smooth, but older ones are finely roughened with basal cells that
are cylindrical or conico-truncate and distinctly dark brown to blackish brown.
Linkosia coccothrinacis (A. Hern.-Gut. & J. Mena) A. Hern.-Gut. & B. Sutton
(Hernandez-Gutiérrez & Sutton 1997), a saprobe on dead leaves of a palm tree
found in Cuba, is morphologically similar, sharing dark brown constrictions, a
Linkosia longirostrata sp. nov. (U.S.A.) ... 45
few pigmented distosepta, and conico-truncate darker basal cells. Its conidia,
however, are smaller (43.7-71.5 x 7-10.6 um) and smooth and have only 4-7
distosepta and a short rostrum without swellings.
Additionally, conidiophores in L. longirostrata are absent or present, and
when present they are very reduced, usually 1- but occasionally 2-septate
and often with a lobed base. Three Linkosia species were originally described
as producing short 0-2-septate conidiophores: L. ponapensis (Matsush.)
R.F. Castafieda et al. (Matsushima 1981, as Sporidesmium ponapense), L. refugia
(B. Sutton & Pascoe) D.A.C. Almeida & Gusmao, and L. canescens (B. Sutton &
Pascoe) D.A.C. Almeida & Gusmao (Sutton & Pascoe 1988, as Janetia refugia and
J. canescens), while the remaining species have only lageniform or ampulliform
conidiogenous cells that form directly on the superficial mycelium (Santa Izabel
et al. 2013, Wu & Zhuang 2005). Linkosia ponapensis is clearly separated from
L. longirostrata by its cylindrical conidiogenous cells and shorter (34-50(-70)
um) naviculiform conidia with (3—)5-7(-9) distosepta and an apical 6-25 um
long subulate appendage. Linkosia refugia is distinguished from L. longirostrata
by its very rarely branched conidiophores and smaller (31-37 x 7-8 um)
obpyriform 4-6-distoseptate conidia that gradually taper towards an obtuse
paler apex but are not distinctly rostrate. In L. canescens, conidiogenous cells
are mono- or polyblastic, bearing a single or 2-3 denticulate conidiogenous
loci per cell; therefore, despite the presence of distoseptate conidia, this fungus
is not considered congeneric with Linkosia as presently circumscribed and is
better retained in Janetia M.B. Ellis (Ellis 1976, Goh & Hyde 1996).
Acknowledgments
I am grateful to Drs. A. Hernandez-Gutiérrez (Universidade Federal do Para) and
De-Wei Li (Connecticut Agricultural Experiment Station) for serving as presubmission
reviewers and their many helpful comments on the manuscript. Thanks are also due
to Dominick Shannon (USDA) for depositing specimens in BPI and Elsa Delgado for
assistance in the field. Joshua Cox and Dr. Kamash Ramanathan (EMLab P&K) are
gratefully acknowledged for provision of laboratory facilities and financial support.
Literature cited
Almeida DAC, Miller AN, Gusmao LFP. 2014. New species and combinations of conidial
fungi from the semi-arid Caatinga biome of Brazil. Nova Hedwigia 98: 431-447.
http://dx.doi.org/10.1127/0029-5035/2013/0162
Cannon P, Sutton B. 2004. Microfungi on wood and plant debris. 217—239, in: G Mueller et al. (eds).
Biodiversity of fungi: inventory and monitoring methods. Elsevier Academic Press, Burlington.
Castafieda RE, Kendrick B. 1990. Conidial fungi from Cuba: I. University of Waterloo Biol. Ser.
33.61 p.
Castaneda RF, Decock C, Saikawa M, Gené J, Guarro J. 2000. Polyschema obclaviformis sp.
nov., and some new records of hyphomycetes from Cuba. Cryptog. Mycol. 21: 215-220.
http://dx.doi.org/10.1016/S0181-1584(00)01051-4
46 ... Delgado
Ellis MB. 1976. More dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew.
Goh TK, Hyde KD. 1996. Janetia curviapicis, a new species, and an emended description of the
genus. Mycologia 88: 1014-1021. http://dx.doi.org/10.2307/3761066
Hernandez-Gutiérrez A, Mena J. 1994. Sporidesmium coccothrinacis Hernandez & Mena, sp. nov.
Bol. Soc. Micol. Madrid 19: 313-314.
Hernandez-Gutiérrez A, Sutton BC. 1997. Imimyces and Linkosia, two new genera segregated
from Sporidesmium sensu lato, and redescription of Polydesmus. Mycol. Res. 101: 201-209.
http://dx.doi.org/10.1017/S0953756296002419
Iturriaga T, Hawksworth DL, Crane JL. 2008. ‘Sporidesmium lichenicola’ sp. nov., a new lichenicolous
fungus on Leptogium from Venezuela. Mycologia 100: 392-396.
http://dx.doi.org/10.3852/06-166R
Ma J, Ma LG, Zhang YD, Zhang XG. 2011. Three new hyphomycetes from southern China.
Mycotaxon 117: 247-253. http://dx.doi.org/10.5248/117.247
Matsushima T. 1981. Matsushima mycological memoirs no. 2. Published by the author, Kobe.
McKenzie EHC. 1995. Dematiaceous hyphomycetes on Pandanaceae. 5. Sporidesmium sensu lato.
Mycotaxon 56: 9-29.
Santa Izabel TS, Cruz ACR, Gusmao LFP. 2013. Conidial fungi from the semi-arid Caatinga
biome of Brazil. Ellisembiopsis gen. nov., new variety of Sporidesmiella and some notes on
Sporidesmium complex. Mycosphere 4: 156-163. http://dx.doi.org/10.5943/mycosphere/4/2/1
Shenoy BD, Jeewon R, Wu WP, Bhat DJ, Hyde KD. 2006. Ribosomal and RPB2 DNA sequence
analyses suggest that Sporidesmium and morphologically similar genera are polyphyletic.
Mycol. Res. 110: 916-928. http://dx.doi.org/10.1016/j.mycres.2006.06.004
Shenoy BD, Jeewon R, Hyde KD. 2007. Impact of DNA sequence-data on the taxonomy of
anamorphic fungi. Fungal Diversity 26: 1-54.
Subramanian CV. 1992. A reassessment of Sporidesmium (hyphomycetes) and some related taxa.
Proc. Nat. Acad. Sci. India B58: 179-190.
Summerbell RC, Gueidan C, Schroers HJ, de Hoog GS, Starink M, Arocha Rosete Y, Guarro J,
Scott JA. 2011. Acremonium phylogenetic overview and revision of Gliomastix, Sarocladium,
and Trichothecium. Stud. Mycol. 68: 139-162. http://dx.doi.org/10.3114/sim.2011.68.06
Sutton BC, Pascoe IG. 1988. Some dematiaceous hyphomycetes from branches and phyllodes of
Acacia in Australia. Aust. Syst. Bot. 1: 127—138. http://dx.doi.org/10.1071/SB9880127
Wu WP, Zhuang W. 2005. Sporidesmium, Endophragmiella and related genera from China. Fungal
Diversity Press, Hong Kong.
Yang HL, Sun GY, Batzer JC, Crous PW, Groenewald JZ, Gleason ML. 2010. Novel fungal genera
and species associated with the sooty blotch and flyspeck complex on apple in China and the
USA. Persoonia 24: 29-37. http://dx.doi.org/10.3767/003158510X492101
Zhang K, Ma LG, Zhang XG. 2009. A new hyphomycete species from Guangxi, China. Mycotaxon
108: 123-125. http://dx.doi.org/10.5248/108.123
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/129.47
Volume 129(1), pp. 47-56 July-September 2014
Taxonomy and phylogeny of Heterobasidion
in South Korea
YEONGSEON JANG’, SEOKYOON JANG’, YOUNG WOON LIM’,
CHANGMU KIM? & JAE-JIN Kim’*
‘Division of Environmental Science & Ecological Engineering,
College of Life Sciences & Biotechnology, Korea University,
145 Anam-ro, Seongbuk-gu, Seoul, 136-701, Korea
School of Biological Sciences, Seoul National University, Seoul, 151-747, Korea
National Institute of Biological Resources, Environmental Research Complex,
Incheon, 404-708, Korea
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — ITS and TEF gene sequences from eleven basidiome collections from South
Korea and one mycelial culture were analyzed to infer the phylogeny of Korean Heterobasidion
species. Comparison of morphological characters with phylogenetic analyses revealed
that specimens previously recorded as ‘H. annosum’ and ‘H. araucariae’ in fact represent
H. ecrustosum, while those recorded as “H. insulare’ represent H. orientale. The two species
currently recognized in South Korea are described and illustrated.
Key worps — Basidiomycota, Bondarzewiaceae, polypore
Introduction
Heterobasidion Bref. is a well-known polypore genus that includes the
destructive tree pathogen, H. annosum (Fr.) Bref. The genus is characterized
by resupinate to pileate basidiocarps, a dimitic hyphal system with mostly
simple septate generative hyphae and dextrinoid skeletal hyphae, and finely
asperulate inamyloid basidiospores (Gilbertson & Ryvarden 1986). In addition,
its skeletal hyphae are cyanophilous in Cotton Blue (Dai & Korhonen 2009).
Until recently, five species — H. annosum, H. araucariae P.K. Buchanan,
H. insulare (Murrill) Ryvarden, H. pahangense Corner, and H. rutilantiforme
(Murrill) Stalpers — were accepted, but both H. annosum and H. insulare have
been found to represent species complexes (Korhonen 1978, Dai et al. 2002), so
that now eleven Heterobasidion species are recognized (Dai & Korhonen 1999,
48 ... Jang & al.
Tokuda et al. 2009, Dai & Korhonen 2009, Otrosina & Garbelotto 2010). Dai et
al. (2003), Tokuda et al. (2009), and Dai & Korhonen (2009) accept H. australe
Y.C. Dai & Korhonen, H. ecrustosum, H. linzhiense Y.C. Dai & Korhonen,
H. orientale, and H. parviporum Niemela & Korhonen in northeast Asia (China
and Japan).
In Korea, Lee (1988), Lee & Jung (2006), and Paul et al. (2012) have reported
three Heterobasidion species: H. annosum, H. araucariae, and H. insulare.
Heterobasidion insulare was reported (as Fomitopsis insularis) from a conifer
trunk (Lee 1988), H. annosum was found at the base of Pinus rigida (Lee &
Jung 2006), and H. araucariae was found as an endophyte from roots of red
pepper, Capsicum annuum (Paul et al. 2012). However, as none of these three
species had previously been reported for northeast Asia, re-examination of
those materials was required.
In this study, we list the Heterobasidion species in South Korea and describe
the morphological characteristics for specimens collected in the country and,
when possible, for voucher specimens from previous studies. In addition, we
analyzed sequences from the internal transcribed spacer rDNA (ITS) and
translation elongation factor 1-alpha (TEF). The ITS was selected because it is
used for barcoding fungal species (Schoch et al. 2012), and the TEF has been
used to infer species relationships within Heterobasidion (Ota et al. 2006, Paul
et al. 2012). We describe and illustrate the two accepted species and compare
their key characters with the Heterobasidion species in northeast Asia.
Materials & methods
Collection and morphological examination
The basidiocarps of Heterobasidion spp. identified by Lee & Jung (2006) and
materials deposited in Seoul National University Fungal Collection (SFC) and the Korea
University Culture Collection (KUC) were used in this study (TABLE 1). The macro- and
microscopic characteristics of the specimens were examined according to Jang et al.
(2013). Color codes in the descriptions follow Munsell (2000).
Phylogenetic analysis
Genomic DNAs were extracted according to Jang et al. (2013) from the materials
in TaBLe 1. PCR reactions for ITS regions were performed using Accupower
PCR Premix Kit (Bioneer, Korea) with the primers ITSIF/ITS4 according to
Jang et al. (2013). TEF region was amplified using the same kit with the primers,
EF1-728F (5’-cATCGAGAAGTTCGAGAAGG-3’) /EF1-1567R (5 ’-ACHGTRCCRATACCACC-
RATCTT-3’) and the PCR conditions: an initial denaturation step of 95°C for 7 min,
followed by 35 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 1 min, with an
elongation step of 72°C for 7 min at the end. The DNA was sequenced by the Macrogen
sequencing service (Seoul, Korea). Sequences obtained in this study were deposited
in GenBank, NCBI; the accession numbers are shown in TABLE 1. The ITS sequences
Heterobasidion in South Korea... 49
TABLE 1. The Korean Heterobasidion specimens and their ITS and TEF sequences used
in this study.
Cbnerne ORIGINAL SPECIMEN NO." GENBANK ITS GENBANK TEF
DETERMINATION No. No.
H. ecrustosum H. annosum KUC20080904-43 _ —
H. annosum KUC20110916-44 KF218829 —
H. annosum KUC20111001-14 KEF218830 KF154267
H. annosum KUC20120810-11 KF218831 KF154268
H. annosum KUC20120810-14 KF218832 KF154269
H. araucariae CNU081069 JQ691621> JQ691622>
H. annosum SFC 20020927-11 — —
H. annosum SFC 20120820-01 KF218834 KF154270
H. orientale H. insulare KUC20081030C-04 KF218828 —
H. insulare KUC20121019-01 — KF154271
H. insulare KUC20121019-30 KF218833 KF154272
H. insulare KUC20121123-14 — KF154273
“Examined basidiocarps now deposited in National Institute of Biological Resources (KB);
H. ecrustosum CNU081069 is a mycelial isolate from Paul et al (2012).
> Sequences retrieved from GenBank, NCBI.
were aligned with the Heterobasidion sequences from Dalman et al. (2010). TEF
sequences were aligned with the sequences from Ota et al. (2006) and Paul et al. (2012).
The sequence alignment, model selection, and Bayesian phylogenetic analyses were
performed according to Jang et al. (2013).
Results & discussion
Morphological comparisons
Although the voucher specimens of “Heterobasidion insulare’ in Lee (1988)
were not available, we feel that his fungus represents H. orientale based on
his description and colored illustration of the basidiocarps. He described the
basidiocarps as sessile and 2.5-5 x 4-8 x 1-1.5 cm; the pileus had a brick-red
surface and white to cream margin. The 1.5-3 mm context was white to cream,
the tubes were 1 cm with round to labyrinthiform pores, and the spores were
subglobose and 4-5 um long. In contrast, H. insulare has a mostly light brown
pileus surface and round to angular (not labyrinthiform) pores (Tokuda et al.
2009). In addition, other specimens formerly known as ‘H. insulare’ (TABLE 1)
are actually H. orientale: Tokuda et al. (2009) note that specimens previously
recognized as H. insulare in China and Japan represent H. orientale and that
H. insulare is known only from the type specimen found in the Philippines.
Re-examination ‘Heterobasidion annosum’ specimen SFC 20020927-11
from Lee & Jung (2006) revealed that it represents instead H. ecrustosum,
50 ... Jang & al.
and the species description in Lee & Jung (2006) is quite similar to that of
H. ecrustosum by Tokuda et al. (2009). Furthermore, all specimens previously
identified as ‘H. annosum’ have been since identified as H. ecrustosum (TABLE 1).
Dai et al. (2003) showed that H. annosum has not been found from eastern Asia
and Altai region and that Russia represents its easternmost distribution.
‘Heterobasidion araucariae from Paul et al. (2012) was found as an
endophyte. The cultural characteristics of H. araucariae and H. ecrustosum are
similar. The data of Paul et al. (2012) for their ‘H. araucariae’ (conidiophores
<300 x 5.5-10.5 um; conidia 4-11.5 x 2-7 um) lie within the data range of
Tokuda et al. (2009) for H. ecrustosum (conidiophores <300 x 4-10 um; conidia
3.2-17.1 x 2.9-12 um), but only partially overlap the data range of Buchanan
(1988) for authentic H. araucariae (conidiophores <400 x 5.5-13.5 um; conidia
5-16 x 3-13.5 um). Authentic H. araucariae has been found only in Australia,
New Zealand, and Fiji (Buchanan 1988; Ota et al. 2006; Tokuda et al. 2009), and
Tokuda et al. (2009) consider it a species restricted to the southern hemisphere.
Phylogeny
Among the 11 specimens examined in this study, ITS gene region sequences
were obtained from seven specimens (594-627 bp) and TEF gene region
sequences from seven specimens (718-774 bp) (TABLE 1). No sequence was
amplified from KUC20080904-43 and SFC 20020927-11. The phylogenetic
analyses supported our morphological conclusions that the examined
‘H. annosum and ‘H. araucariae’ specimens represent H. ecrustosum and that
the examined ‘H. insulare’ specimens represent H. orientale.
Bayesian analysis of ITS sequences (not presented) was congruent with the
tree from Dalman et al. (2010). No intraspecific ITS sequence variation was
found in Korean H. ecrustosum and H. orientale. Heterobasidion ecrustosum
was monophyletic with H. araucariae and our H. ecrustosum ITS sequences
were 99% similar (5 positions different) to H. araucariae from Australia and
New Zealand (GenBank FJ627521, FJ627522, FJ627526, and FJ627527).
Heterobasidion orientale was monophyletic and sister to the H. araucariae/
H. ecrustosum clade.
The TEF gene region tree (Fic. 1) showed a topology similar to that of Ota
et al. (2006) except that Japanese isolates of H. parviporum did not form a
separate clade but were positioned on the basal part of the clade comprising
H. occidentale, H. abietinum, and H. parviporum. Korean H. orientale
collections produced two different TEF sequences although they were collected
from the same location; their basal position within the H. orientale clade was
supported with high posterior probability (1.0 p.p.). Heterobasidion orientale
Heterobasidion in South Korea... 51
‘North American S-group’ B1142, Mexico (AY273391)
‘North American S-group’ Tc122.11, USA (AY273387)
‘North American S-group’ Bc3.3, Canada (AY273388)
06 ‘North American S-group’ Faf10.2, USA (AY273386)
Heterobasidion abietinum Faf7.1, Italy (AY273385)
1 Heterobasidion abietinum Faf4.6, Italy (AY273383)
Heterobasidion abietinum Faf8.5, Italy (AY273382)
Heterobasidion abietinum OH2.8.c6, Switzerland (AY273380)
Heterobasidion parviporum B1314, China (AY273393)
1 Heterobasidion occidentale
Heterobasidion abietinum
0.78
Heterobasidion parviporum FSE.3, Finland (AY273368)
0.54 L_ Heterobasidion parviporum B1295, China (AY273392)
‘Heterobasidion annosum’ \WD1212, Japan (AB255540)
‘Heterobasidion annosum’ HF419, Japan (AB255571)
‘Heterobasidion annosum’ HF594S1, Japan (AB255575)
‘Heterobasidion insulare’ \WD142, Japan (AB255547)
‘Heterobasidion insulare’ WD651, Japan (AB255548)
‘Heterobasidion insulare’ WWD825, Japan (AB255549)
‘Heterobasidion insulare’ WD1981, Japan (AB255570)
‘Heterobasidion insulare’ \WWD2154, Japan (AB255550)
‘Heterobasidion insulare’ HF 448, Japan (AB255551)
‘Heterobasidion insulare’ HF449, Japan (AB255552)
4 Heterobasidion orientale KUC20121019-30, Korea (KF154272)
Heterobasidion orientale KUC20121123-14, Korea (KF154273)
Heterobasidion orientale KUC20121019-01, Korea (KF154271)
‘Heterobasidion sp.’ WD1945, Japan (AB255553)
0.961 _ ‘Heterobasidion sp.’ WD2107, Japan (AB255554)
‘Heterobasidion sp.’ WD2220, Japan (AB255555)
Heterobasidion ecrustosum KUC20120810-14, Korea (KF154269)
Heterobasidion ecrustosum KUC20120810-11, Korea (KF154268)
085! _ Heterobasidion ecrustosum KUC20111001-14, Korea (KF154267)
0.96. ‘Heterobasidion araucariae’ CNU081069, Korea (JQ691622)
Heterobasidion ecrustosum SFC20120820-01, Korea (KF154270)
Heterobasidion araucariae ICMP9529, New Zealand (AB255556)
Heterobasidion araucariae ICMP9533, New Zealand (AB255557)
0.96
Heterobasidion parviporum
0.9
Heterobasidion orientale
0.82
0.91
0.8
Heterobasidion ecrustosum
a Heterobasidion araucariae
Heterobasidion annosum P16.4, Sweden (AY273397) I Heterobasidion annosum
‘North American P-group’ P32.1, USA (AY273396) I Heterobasidion irregulare
0.1
Fic. 1. 50% major-rule consensus tree of Korean Heterobasidion spp. and allies using TEF region
sequences. The tree, containing 36 taxa and 258 characters, was constructed from 15,000 trees
produced by Bayesian analysis and was mid-point rooted. Posterior probabilities >50% are given.
Korean specimens are shown in bold type. For each node, the former names, isolate numbers, and
localities are given, and the species names accepted by recent studies (Tokuda et al. 2009, Otrosina
& Garbelotto 2010) are presented on the right side of the tree. GenBank accession numbers are
provided in parentheses.
KUC20121019-30 and KUC20121123-14 were 98% similar to Japanese isolates
(254 out of 258 sequences matched), and KUC20121019-01 was 96% similar (247
out of 258 sequences matched). Korean H. ecrustosum collections (including
‘H. araucariae CNU081069 from Paul et al. 2012) had 100% identical TEF
sequences and were sister to Japanese H. ecrustosum isolates with moderate
support (0.8 p.p.). The H. ecrustosum clade again clustered with authentic
H. araucariae with high support (1.0 p.p.). Korean H. ecrustosum collections
were 98% similar to Japanese H. ecrustosum (245 out of 251 sequences matched)
and 97% similar to H. araucariae (242 out of 249 sequences matched).
52 ... Jang & al.
Taxonomy
Fic. 2. Heterobasidion orientale (KUC20121019-01). A, B. Basidiocarp. Scale bar = 1 cm.
C. Microscopic features. a, basidiospores; b, basidia; c, generative hyphae from trama; d, skeletal
hyphae from trama; e, generative hyphae from subiculum; f, skeletal hyphae from subiculum.
Heterobasidion orientale Tokuda, T. Hatt. & Y.C. Dai,
Mycoscience 50: 193. 2009. Fic. 2
BASIDIOCARPS annual, sessile, solitary to imbricate, <7 x 5 x 2 cm. Pileus
broadly attached to the substrate, dimidiate, applanate to elongated. Pileus
surface glabrous, sometimes radially rugose when dry, zonate with dusky red
(10R3/3) to dark red (7.5R3/6) in the middle, yellow (10YR7/6) to very pale
brown (10YR8/2-3) near the margin. Pileus margin acute. Pore surface very
pale brown (10YR8/4) to yellow (10YR7/6-8, 10YR8/6-8). Pores round to
angular or labyrinthiform, 2-4/mm, dissepiments eroded. Sterile margin 0.5
mm wide or absent. Context corky, very pale brown (10YR8/2), 1-2 mm thick.
Tubes 3-6 mm deep, concolorous with context.
HYPHAL SysTEM dimitic; generative hyphae without clamp connection and
skeletal hyphae.
CONTEXT generative hyphae without clamp connections, hyaline, thin to
slightly thick-walled, IKI-, 2.0-3.5 um in diameter; skeletal hyphae abundant,
hyaline, thick-walled, dextrinoid, 4.5-6.5 um in diameter.
TUBES generative hyphae without clamp connections, hyaline, thin-walled,
IKI-, 2-2.5 um in diameter; skeletal hyphae abundant, hyaline, thick-walled,
weakly dextrinoid, 3-5 um in diameter; cystidia none; basidia barrel-shaped,
4-sterigmate, slightly constricted in the middle, 17-29 x 5-7 um.
BASIDIOSPORES globose to subglobose, hyaline, finely asperulate, IKI-,
(4.6-)4.8-6.7 x 3.9-5.4(-5.8) um, L = 5.6 um, W = 4.5 um (n = 88/3).
DISTRIBUTION — China, Japan, and Korea.
Heterobasidion in South Korea... 53
SPECIMENS EXAMINED: KOREA, KYEONGGI-DO, Mt. Bori, 37°39’06’N 127°32’02’E,
on Pinus densiflora Siebold & Zucc., 30 October 2008, Yeongseon Jang (KB,
KUC20081030C-04). GANGWON-DO, Mt. Odae, 37°43’59”N 128°35’23’E, on unknown
wood, 19 October 2012, Yeongseon Jang (KB, KUC20121019-01); 37°44’13”N
128°35’16”E, Abies holophylla Maxim., 19 October 2012, Yeongseon Jang (KB,
KUC20121019-30); 37°44’30”N 128°35’03”E, on unknown wood, 23 November 2012,
Yeongseon Jang (KB, KUC20121123-14).
REMARKS — The basidia of Korean H. orientale specimens are larger than those
given by Tokuda et al. (2009).
Fic. 3. Heterobasidion ecrustosum (KUC20110916-44). A, B. Basidiocarp. Scale bar = 1 cm.
C. Microscopic features. a, basidiospores; b, basidia; c, generative hyphae from trama; d, skeletal
hyphae from trama; e, generative hyphae from subiculum; f, skeletal hyphae from subiculum.
Heterobasidion ecrustosum Tokuda, T. Hatt. & Y.C. Dai, Mycoscience 50: 196. 2009.
FIG. 3
BASIDIOCARPS annual, sessile, solitary to imbricate, <6 x 3.5 x 2 cm. Pileus
broadly attached to the substrate, dimidiate, applanate to convex, somewhat
inrolled when dry. Pileus surface glabrous, usually rough, subzonate to
azonate, radially sulcate in one specimen (KUC20110916-44), very pale
brown (10YR8/3-4) to yellow (10YR8/6) or reddish yellow (SYR6/8), with
crust at the base or without crust, crust dark yellowish brown (10YR3/4) to
very dark brown (10YR2/2) or dark reddish brown (5YR3/4). Pileus margin
rounded. Pore surface very pale brown (10YR8/2-4) or pale to light yellowish
brown (10YR6/4-6/6), pores round to angular, sometimes elongated, 2-3/mm,
dissepiments entire. Sterile margin narrow, concolorous with the pore surface,
0.5-1.5 mm wide, or absent. Context corky, very pale brown (5YR8/2-3), 2-5
mm thick. Tubes concolorous with the context, 1-7 mm deep.
HYPHAL SYSTEM dimitic; generative hyphae without clamp connections and
skeletal hyphae.
54 ... Jang & al.
CONTEXT generative hyphae without clamp connections, hyaline, thin to
thick-walled, IKI-, 2.5-5 um in diameter; skeletal hyphae abundant, hyaline,
dextrinoid, thick-walled, 3.5-5.5 um in diameter.
TUBES generative hyphae without clamp connections, hyaline, thin walled,
IKI-, 2.0-4.5 um in diameter; skeletal hyphae abundant, hyaline, dextrinoid,
thick-walled, 3-5.5 um in diameter; cystidia none; basidia barrel-shaped,
4-sterigmate, 17-26 x 4.5—7 um.
BASIDIOSPORES globose to subglobose, hyaline, finely asperulate, IKI-,
4,.9-6.9(-7.7) x (3.7-)4.1-5.9(-6.5) um, L = 5.9 um, W = 5.0 um (n = 99/3).
DISTRIBUTION — China, Japan, and Korea.
SPECIMEN EXAMINED: KOREA, SEOUL, Mt. Cheonggye, 37°25’47”N 127°02’51”E,
on the branch of wood, 4 September 2008, Yeongseon Jang (KB, KUC20080904-43).
Heonilleung, 37°28’03”N 127°05’00’E, on the stump of Pinus densiflora, 16 September
2011, Yeongseon Jang (KB, KUC20110916-44). JEOLLABUK-DO, Gochang, 35°27’35”N
126°30’51”E, on unknown wood, 1 October 2011, Yeongseon Jang (KB, KUC20111001-
14). JEOLLANAM-DO, Wando arboretum, 34°23’05”N 126°39’07”E, on unknown wood,
10 August 2012, Yeongseon Jang (KB, KUC20120810-11); on unknown wood, 10
August 2012, Yeongseon Jang (KB, KUC20120810-14). CHUNGCHEONGBUK-DO, Mt.
Songni, on Pinus rigida Mill., 27 September 2002, Jin Sung Lee (KB, SFC 20020927-11).
CHUNGCHEONGNAM-DO, Mt. Gaya, on Pinus densiflora, 20 August 2012, Young Woon
Lim (KB, SFC 20120820-01).
REMARKS — The ranges of basidia and basidiospore sizes of Korean H. ecrustosum
specimens overlap with those given by Tokuda et al. (2009), but Korean
specimens tend to have larger basidia and basidiospores.
We confirm that there are only two Heterobasidion species — H. ecrustosum
and H. orientale — in South Korea and compare their characteristics with other
northeastern Asian Heterobasidion species in TABLE 2. Because we analyzed
TABLE 2. Key characteristics of Heterobasidion species in northeast Asia.
BASIDIOCARPS PORES BASIDIOSPORES SUBSTRATES
SPECIES
(tum)
H. australe Perennial Mostly round, 4.1-6.2 x Keteleeria, Picea,
(Dai & Korhonen occasionally 3.3-5.5 Pinus, Pseudolarix,
2009) angular, 4-5/mm Tsuga
H. ecrustosum Annual Angular to round, 4,.9-7.7 x Pinus
(this study) 2-3/mm 3.7-6.5
H. linzhiense Annual Angular, 2-4/mm 5-10 x Abies, Picea
(Dai et al. 2007) 4-10
H. orientale Annual Angular to round 4.6-6.7 x Abies, Pinus
(this study) or labyrinthiform, 3.9-5.8
2-4/mm
H. parviporum Mostly Round, regular, 3.3-5.6 x Abies, Larix, Picea,
(Tokuda et al. 2009) perennial 4-7/mm 2.9-4.8 Pinus, Populus, Tsuga
Heterobasidion in South Korea... 55
only a limited number of specimens, there might be other species present in this
region. Thus, further studies are needed to determine the complete diversity of
Heterobasidion in South Korea.
Acknowledgments
This research was supported by Basic Science Research Program through the National
Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-
2013R1A1A2A10011390) and was funded by the project on survey and excavation of
Korean indigenous species of NIBR under the Ministry of Environment, Republic of
Korea. We are much obliged to Dr. Yu-Cheng Dai and Dr. Hayato Masuya for their
valuable suggestions on the manuscript.
Literature cited
Buchanan PK. 1988. A new species of Heterobasidion (Polyporaceae) from Australasia. Mycotaxon
a2) 3257337.
Dai YC, Korhonen K. 2009. Heterobasidion australe, a new polypore derived from the Heterobasidion
insulare complex. Mycoscience 50: 353-356. http://dx.doi.org/10.1007/s10267-009-0491-3
Dai YC, Korhonen K. 1999. Heterobasidion annosum group S identified in north-eastern China.
European Journal of Forest Pathology 29: 273-279.
http://dx.doi.org/10.1046/j.1439-0329.1999.00153.x
Dai YC, Vainio EJ, Hantula J, Niemela T, Korhonen K. 2002. Sexuality and intersterility within the
Heterobasidion insulare complex. Mycological Research 106: 1435-1448.
http://dx.doi.org/10.1017/S0953756202006950
Dai YC, Vainio EJ, Hantula J, Niemela T, Korhonen K. 2003. Investigations on Heterobasidion
annosum s. lat. in central and eastern Asia with the aid of mating tests and DNA fingerprinting.
Forest Pathology 33: 269-286. http://dx.doi.org/10.1046/j.1439-0329.2003.00328.x
Dalman K, Olson A, Stenlid J. 2010. Evolutionary history of the conifer root rot fungus
Heterobasidion annosum sensu lato. Molecular Ecology 19: 4979-4993.
http://dx.doi.org/10.1111/j.1365-294X.2010.04873.x
Gilbertson RL, Ryvarden L. 1986. North American polypores I. Fungiflora, Oslo.
Jang Y, Lee SW, Lim YW, Lee JS, Hattori T, Kim J-J. 2013. The genus Wrightoporia in Korea.
Mycotaxon 123: 335-341. http://dx.doi.org/10.5248/123.335
Korhonen K. 1978. Intersterility groups of Heterobasidion annosum. Communicationes Instituti
Forestalis Fenniae 94: 1-25.
Lee JS, Jung HS. 2006. Taxonomic study on Korean Aphyllophorales (5) - on some unrecorded
genera and species. Mycobiology 34: 166-175. http://dx.doi.org/10.4489/MYCO.2006.34.4.166
Lee JY. 1988. Coloured Korean mushrooms. Vol. 1. Academy Press. Seoul, Korea.
Munsell Color. 2000. Munsell soil color charts. Gretag Macbeth, New Windsor, NY.
Ota Y, Tokuda S, Buchanan PK, Hattori T. 2006. Phylogenetic relationships of Japanese species of
Heterobasidion—H. annosum sensu lato and an undetermined Heterobasidion sp. Mycologia
98: 717-725. http://dx.doi.org/10.3852/mycologia.98.5.717
Otrosina WJ, Garbelotto M. 2010. Heterobasidion occidentale sp. nov. and Heterobasidion irregulare
nom. nov.: A disposition of North American Heterobasidion biological species. Fungal Biology
114: 16-25. http://dx.doi.org/10.1016/j.mycres.2009.09.001
Paul NC, Deng JX, Shin KS, Yu SH. 2012. Molecular and morphological characterization
of endophytic Heterobasidion araucariae from roots of Capsicum annuum L. in Korea.
Mycobiology 40: 85-90. http://dx.doi.org/10.5941/MYCO.2012.40.2.85
56 ... Jang & al.
Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W, Fungal Barcoding
Consortium. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal
DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences 109:
6241-6246. http://dx.doi.org/10.1073/pnas.1117018109
Tokuda S, Hattori T, Dai YC, Ota Y, Buchanan PK. 2009. Three species of Heterobasidion
(Basidiomycota, Hericiales), H. parviporum, H. orientale sp. nov. and H. ecrustosum sp. nov.
from East Asia. Mycoscience 50: 190-202. http://dx.doi.org/10.1007/s10267-008-0476-7
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.57
Volume 129(1), pp. 57-61 July-September 2014
Two new combinations and a new record of Zasmidium
from China
FENGYAN ZHAI, W.H. Hsien’, YINGJIE Liu’, & YINGLAN Guo?
' Henan Institute of Science and Technology, Xinxiang 453003, China
? Department of Plant Pathology, National Chung Hsing University,
Taichung, Taiwan, Republic of China
° Institute of Microbiology, Chinese Academy of Science, Beijing 100101, China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Stenella gynurae is recombined as Zasmidium gynurae, and S. bougainvilleae as
Z. bougainvilleae; these species are described, illustrated and discussed. Zasmidium salicis is
also reported as new to China.
Key worps —morphology, Mycosphaerellaceae, reallocation, taxonomy
Introduction
The type species of Stenella Syd., S. araguata Syd., which is characterized by
pileate condiogenous loci and hila, is placed by molecular sequence analyses
in Teratosphaeriaceae. In contrast, most other previous Stenella species have
planate Cercospora-like scars and hila and belong in Mycosphaerellaceae,
where they agree morphologically and cluster phylogenetically with the type
of Zasmidium Fr.; they have therefore been transferred to Zasmidium (Braun
et al. 2010a,b). Here we transfer two additional Stenella species, S. gynurae and
S. bougainvilleae, which coincide morphologically with the current concept of
Zasmidium. Another Zasmidium species, Z. salicis, is reported as new to China.
Taxonomy
Zasmidium gynurae (Sawada & Katsuki) W.H. Hsieh, Y.L. Guo & EY. Zhai,
comb. nov. FIG. 1
MycoBank MB 808069
= Cercospora gynurae Sawada & Katsuki, Spec. Publ. Coll.
Agric., Nat. Taiwan Univ. 8: 218, 1959.
= Stenella gynurae (Sawada & Katsuki) Goh & W.H. Hsieh,
Cercospora Similar Fungi Taiwan: 88, 1990.
58 ... Zhai & al.
Fic. 1. Zasmidium gynurae (NYU-PPE, holotype).
Conidiophores and conidia. Scale bar = 10 um.
Leaf spots circular, greyish, without distinct margin, 3.0-5.0 mm diam.
Fruiting hypophyllous. Primary mycelium immersed. Secondary mycelium
superficial; hyphae subhyaline to pale olivaceous, septate, branched, finely
verruculose, 1.0-2.0 um diam. Secondary conidiophores arising as lateral
branches from external hyphae. Stromata none. Primary conidiophores
emerging through stomata, 1-6-fasciculate, or arising as solitary branches
from superficial hyphae, pale olivaceous to pale brown, paler towards the apex,
irregular in width, straight to 1-2-geniculate, rarely branched, round to conical
at the apex, 1-6-septate, 20.0-70.0(-230.0) x 2.5-3.5 um. Conidial scars
conspicuously thickened, 0.5-1.0 um wide. Conidia cylindrical, catenate, later
verruculose, subhyaline to pale olivaceous, straight to slightly curved, round to
conical at the apex, obconical to obconically truncate at the base, 2-6-septate,
18.0-60.0 x 2.5-3.5 um; hila small but conspicuously thickened.
COLLECTION EXAMINED: CHINA. TaIwAN PROVINCE, Changhua County, on leaves
of Gynura bicolor (Willd.) DC. (Compositae), 14 XII 1909, coll. K. Sawada (NYU-PPE,
holotype).
DISTRIBUTION: China.
Zasmidium bougainvilleae (J.M. Yen & Lim) Y.L. Guo, W.H. Hsieh & EY. Zhai,
comb. nov. FIG.2
MycoBank MB 808070
= Stenella bougainvilleae J.M. Yen & Lim, Mycotaxon 16: 96, 1982.
Leaf spots amphigenous, circular to subcircular, 1.0-4.0 mm diam.,
sometimes confluent, olivaceous-brown to pale brown, surrounded by a pale
Zasmidium combs. nov. (China) ... 59
Fic. 2. Zasmidium bougainvilleae (HMAS 242906).
Conidiophores and conidia. Scale bar = 20 um.
brown to grayish brown margin, with 1-2 times zonate and pale yellow to pale
grayish brown halo on the upper surface, paler on the lower surface. Fruiting
hypophyllous. Primary mycelium immersed. Secondary mycelium superficial;
hyphae emerging through stomata or from the base of primary conidiophores,
or directly from the apex of conidiophores, pale olivaceous to olivaceous,
branched, septate, verruculose, with lateral secondary conidiophores,
1.5-3.0 um diam. Stromata none or small, formed only by several brown
cells. Primary conidiophores emerging through stomata, 2—8-fasciculate, or
up to 25-fasciculate on small stromata, moderately olivaceous-brown to pale
brown, paler towards the apex, irregular in width, narrower towards the apex,
branched, straight to strongly curved, 0-3-geniculate, conical at the apex,
1-6-septate, sometimes constricted at the septa, 25.0-68.0 x 3.0-4.0 um.
Secondary conidiophores olivaceous-brown to moderately olivaceous-brown,
unbranched, erect or curved, 0-3-septate, 15.0-48.0 x 2.5-4.0 um. Conidial
scars small but conspicuously thickened, 0.8-1.3 um wide. Conidia cylindrical
to slightly obclavate-cylindrical, pale olivaceous, catenate, straight to slightly
curved, finely verruculose, indistinctly 2-14-septate, obtuse to conical at
the apex, obconical to subtruncate at the base, with small but conspicuously
thickened hila, 15.0-68.0(-110.0) x 2.0-3.5 um.
COLLECTIONS EXAMINED: CHINA. HAINAN PROVINCE, Lingshui, on leaves of
Bougainvillea glabra Choisy (Nyctaginaceae), 11 IV 2011, coll. Y.L. Guo, no. HN345
(HMAS 242906). TArwAN PROVINCE, Changhua County, on leaves of Bougainvillea
spectabilis Willd., 23 X 1985, coll. T.K. Goh (NCHUPP-184).
60 ... Zhai & al.
DISTRIBUTION: China, Singapore.
Notes: Hsieh & Goh (1990: 248) described Z. bougainvilleae on Bougainvillea
spectabilis from Taiwan as leaf spots absent or merely indefinite yellowish
discoloration, with shorter conidiophores (primary conidiophores 20.0-40.0
x 3.0-5.0 um, secondary conidiophores 5.0-15.0 x 2.0-4.0 um), and longer
conidia (20.0-110.0 x 2.5-4.0 um). The morphological characters of our
collection on B. glabra from Hainan are fairly similar to those described by
Yen & Lim (1982) on B. spectabilis from Singapore (primary conidiophores
30.0-90.0 x 3.0-4.0 um, conidia 20.0-65.0 x 2.5-4.0 um).
Zasmidium salicis (Chupp & H.C. Greene) Kamal & U. Braun, Cercosporoid Fungi
of India: 248, 2010.
= Cercospora salicis Chupp & H.C. Greene, Am. Midland Naturalist 41: 757, 1949.
= Stenella salicis (Chupp & H.C. Greene) Crous & U. Braun, Mycotaxon 78: 342, 2001.
Leaf spots amphigenous, punctiform to irregular, 0.5-3.0 mm diam., often
angular, limited by veins, brown to blackish brown on the upper surface,
blackish brown on the lower surface. Fruiting amphigenous. Mycelium
internal. Stromata substomatal, subglobose, brown, 10.0-26.0 um diam.
Conidiophores arising from the upper cells of stromata, emerging through
stomata, 3-25 per fascicle, pale olivaceous-brown, uniform in color, irregular
in width, verruculose, straight to geniculate-sinuous, 0-4-geniculate, mostly
unbranched, 0-2-septate, 8.0-28.0 x 2.5-5.0 um. Conidial scars darkened
and thickened, 2.0-2.5 um wide. Conidia cylindrical, cylindrical-obclavate,
solidary, pale olivaceous to olivaceous-brown, finely verruculose with age,
straight to moderate curved, obtuse at the apex, subtruncate at the base,
1-7-septate, 15.5-96.0 x 2.5-5.0 um, hila thickened and darkened.
COLLECTION EXAMINED: CHINA. JILIN PROVINCE, Changchun, on leaves of Salix
matsudana Koidz. (Salicaceae), 7 July 2006, coll. YJ. Liu & EY.Zhai 6178 (HMJAU
30005).
DISTRIBUTION: China, North America, Brazil.
Notes: This is the first report of Zasmidium salicis from China.
Chupp & Greene described Cercospora salicis from North America on Salix
alba L. (Greene 1949; Chupp 1954). The holotype was re-examined by Crous
& Braun (2001), who reallocated it to Stenella based on verruculose superficial
hyphae and conidia. Kamal and Braun subsequently transferred the species to
Zasmidium (Kamal 2010).
The conidiophores and conidia of our Chinese specimen are fairly similar
to those of Z. salicis on Salix sp. in North America in shape and size but
differ in lacking verruculose external mycelium, with the North American
material having larger stromata (<50 um wide), 1-3-septate and somewhat
Zasmidium combs. nov. (China) ... 61
larger conidiophores (15-45 x 4-6 um), and 1-6-septate and slightly smaller
conidia (20-60 x 3-4.5 um). The development of verruculose superficial
hyphae is a basic feature of Zasmidium and well developed in most species,
but may occasionally be absent (Crous & Braun 2003). A few species without
any superficial mycelium have been assigned to this genus, e.g., Zasmidium
hymenocallidis (U. Braun & Crous) U. Braun & Crous and Z. macluricola R.G.
Shivas et al. (Shivas et al. 2009, Braun et al. 2010a).
Mycovellosiella salicis Deighton et al. (Deighton 1974) parasitic on Salix
tetrasperma Roxb. is morphologically similar to Zasmidium salicis but differs
in lacking obvious leaf spots and stromata and forming hypophyllous and
diffusely fruiting, paler (pale olivaceous), and longer (<80 um) conidiophores,
and paler (pale olivaceous) catenate conidia. Mycovellosiella salicis has been
reallocated to Passalora salicis (Deighton et al.) U. Braun & Crous (Crous &
Braun 2003).
Acknowledgments
The study was financed by the “Knowledge Innovation Program” of the Chinese
Academy of Sciences - Flora Cryptogamarum Sinicarum Compilation and Research
Foundation (Grant No. KSCXZ-EW-Z-9) and the National Natural Science Foundation
of China (Grant No. 31100013). We express our deep appreciation to Dr. Uwe Braun
and Shu-Yan Liu for their valuable suggestions, kind help, and their earnest assistance
in the course of submission of this manuscript.
Literature cited
Braun U, Crous PW, Schubert, K, Shin, H-D. 2010a. Some reallocations of Stenella species to
Zasmidium. Schlechtendalia 20: 99-104.
Braun U, Freire F, Urtiaga R. 2010b. New species and new records of cercosporoid hyphomycetes
from Brazil, New Zealand and Venezuela. Polish Botanical Journal 55: 281-291.
Crous PW, Braun U. 2001. A reassessment of the Cercospora species described by C. Chupp:
specimens deposited at BPI, Maryland, U.S.A. Mycotaxon 78: 327-343.
Crous PW, Braun U. 2003. Mycosphaerella and its anamorphs: 1. Names published in Cercospora
and Passalora. CBS Biodiversity Series No. 1. 569 p.
Deighton FC. 1974. Studies on Cercospora and allied genera. V. Mycovellosiella Rangel, and a new
species of Ramulariopsis. Mycological Papers 137. 76 p.
Greene HC. 1949. Notes on Wisconsin parasitic fungi XIII. The American Midland Naturalist
41: 740-758. http://dx.doi.org/10.2307/2421783
Hsieh WH, Goh TK. 1990. Cercospora and similar fungi from Taiwan. Maw Chang Book Company.
Taichung Taiwan R.O.C. 367 p.
Kamal. 2010. Cercosporoid fungi of India. Dehra Dun: Bishen Singh Mahendra Pal Singh. 351 p.
Shivas RG, Young AJ, Braun U. 2009. Zasmidium macluricola. Fungal Planet 39. Persoonia
23: 190-191.
Yen JM, Lim G. 1982. Studies on parasitic fungi from South East Asia, 45. Parasitic fungi from
Malaysia, 22. Mycotaxon 16(1): 96-98.
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.63
Volume 129(1), pp. 63-72 July-September 2014
New reports of Gymnopus from Pakistan
based on ITS sequences
M. SABA* & A.N. KHALID
Department of Botany, University of the Punjab
Quaid-e-Azam Campus, Lahore, 54590, Pakistan
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Specimens of Gymnopus luxurians and G. menehune from Pakistan are
characterized morphologically and using nrDNA internal transcribed spacer sequences.
These fungal species represent new records for South Asia. A key to the Gymnopus species
known from Pakistan is provided.
Key worps — Abbottabad, Collybia, Khyber Pakhtoonkhaw, Marasmiaceae, saprobic fungi
Introduction
Gymnopus (Pers.) Roussel was monographed by Antonin & Noordeloos
(1997) and many mushrooms from Collybia sections Vestipedes and Levipedes
have now been transferred into this genus (Antonin & Noordeloos 1997).
Gymnopus consists of delicate to semi-fleshy mushrooms commonly found
on leaf and woody litter in tropical to temperate ecosystems, and Gymnopus
sect. Vestipedes is characterised by a hairy or tomentose stipe surface and a
simple pileus epicutis without a Rameales- or Dryophila-structure (Antonin &
Noordeloos 1997). Ecologically, Gymnopus species are considered important in
recycling nutrients (Singer 1986; Mata & Ovrebo 2009).
Five Gymnopus species have previously been reported from Pakistan
(under their Collybia synonyms): Gymnopus confluens (Pers.) Antonin et al.,
G. dryophilus (Bull.) Murrill, G. fusipes (Bull.) Gray, G. erythropus (Pers.)
Antonin et al. (as C. kuehneriana), and G. peronatus (Bolt.) Gray (Ahmad 1980;
Iqbal & Khalid 1996; Shibata 1992; Sultana et al. 2011). During a collecting trip
for macrofungi in Khyber Pakhtoonkhaw in 2012, many mushroom species
were collected. Amongst them, three specimens belonging to Gymnopus sect.
Vestipedes were identified as G. luxurians and G. menehune, which are new
records from subtropical pine forests of Pakistan.
64 ... Saba & Khalid
TABLE 1. ITS-rDNA sequences of Gymnopus and Omphalotus spp.
used in the phylogenetic analysis
TAXON
G. biformis
G. confluens
G. cylindricus
G. dryophilus
G. erythropus
G. fibrosipes
G. fusipes
G. gibbosus
G. luxurians
G. menehune
G. mesoamericanus
G. polygrammus
G. readiae
G. subcyathiformis
G. subpruinosus
O. illudens
O. olearius
O. olivascens
COUNTRY
Costa Rica
Costa Rica
Russia
Costa Rica
Costa Rica
Italy
Czech Republic
Slovakia
USA
Costa Rica
France
Austria
Pakistan
Pakistan
USA
Switzerland
Pakistan
Costa Rica
Costa Rica
Puerto Rico
Not given
New Zealand
New Zealand
Puerto Rico
Dominican Republic
USA
USA
USA
France
USA
GENBANK #
DQ450064
DQ450063
AY256697
HM240527
AY256696
DQ450057
JX536157
JX536158
DQ449996
DQ449998
AF505763
AY842953
AY256710
AF505777
AY263437
AY263438
KF803760
KF803761
AY256709
DQ450022
KF803762
JN182864
AY263426
DQ450036
AF505768
DQ450028
AY842954
DQ450034
HQ533036
DQ450041
DQ450042
DQ450026
DQ450027
AY313271
AY313277
AY313281
COLLECTION/
VOUCHER #
TFB7843
TFB7820
TENN58242
UBC F19677
TENN58024
TENN58024
BRNM707149
BRNM712600
SAV X12002
WTU JFA12910
TENN56660
PR23TN
TENN59217
TENN59300
AWW66
AWW95
MSM#001
MSM#002
TENN57910
TENN50619
MSM#003
Not given
DED5866
TENN58106
NYBG REH7379
TENN56589
PR 2542TN
TENN53687
PDD95844
TENN58130
TENN59550
TENN56242
TENN59477
TENN54507
culture 9061b
TENN55337
Gymnopus in Pakistan ... 65
Materials & methods
Basidiomata were collected, photographed, vouchered, dried under fan heater,
and characterized morphologically. Specimen sections were mounted in 5% KOH for
observation under a biological microscope (MX4300H, Meiji Techno Co., Ltd., Japan).
Phloxine was used to increase contrast of structures, and Melzer’s reagent was used to
test for dextrinoidity of basidiospores.
Measurements of anatomical features (basidiospores, basidia, cystidia, pileus hyphae,
and stipe hyphae) are presented from at least 20 measurements made with an ocular
micrometer and 100x oil-immersion objective; basidiospore abbreviations include
x = arithmetic mean of length and width for all spores measured and Q = length divided
by width. Line drawings were made with a camera lucida. Color designations are from
Munsell (1975) colour system.
Genomic DNA was extracted from a small piece of pileus by a modified CTAB
method (Bruns 1995). The internal transcribed spacers (ITS1 and ITS2) and 5.8S
region of the nuclear ribosomal RNA gene were amplified with the primer pairs ITS1F/
ITS4 (White et al. 1990; Gardes & Bruns 1993) using the Extract-N-Amp plant DNA
extraction Kit (Sigma-Aldrich, St. Louis, MO, USA). PCR was carried out under the
following cycling parameters: initial denaturation (94 °C for 1 min), 35 cycles (94 °C
for 1 min, 53 °C for 1 min, and 72 °C for 1 min), and final extension 72 °C (8 min).
Amplified PCR products were sent for purification and bidirectional sequencing to
Macrogen (Korea). Two sequences each of Gymnopus luxurians and G. menehune and
other related sequences were retrieved from the Genbank and aligned by Muscle using
the default setting in Molecular Evolutionary Genetics Analysis (MEGA) software
(Tamura et al. 2011). Sequences were manually edited and assembled using BioEdit
(www.mbio.ncsu.edu/bioedit/bioedit.html). Following Dentinger et al. (2011) for
complete ITS sequences, all sequences were trimmed with the conserved motifs 5’-(...
GAT) CATTA- and -GACCT (CAAA...)-3’ and the alignment portion between them
was included in the analysis. All positions containing gaps and missing data were
eliminated. A phylogenetic tree was constructed with the Maximum Likelihood (ML)
algorithm and Jukes & Cantor (1969) model of nrITS sequences and nearest-neighbor-
interchange (NNI) as ML heuristic search method using MEGAS5 software (Tamura et
al. 2011). Phylogeny was tested by bootstrap value of 1000 replicates, and corresponding
bootstrap values >50 % are cited in the tree. Sequences of Omphalotus spp. were used
as outgroup based on results reported by Moncalvo et al. (2002) and Mata et al. (2004).
Sequences generated for this study were submitted to Genbank. A complete list of
taxa used in this phylogenetic is shown in TaBLE 1. Percent identities (PID) and DNA
divergence were calculated by DNAStar.
Taxonomy
Gymnopus luxurians (Peck) Murrill, N. Amer. Fl. 9(5): 362 (1916). Fic. 1
PILEUS 19-29 mm diam, convex when young, expanding with age to plane,
flat, thin (collybioid), slightly umbonate; margin recurved or uplifted, flexuous,
striate; surface dull, fibrillose; brown, dark brown or reddish brown (10R5/10),
margin fading to pale brown to brown or buff (10R6/12). LAMELLAE adnexed,
66 ... Saba & Khalid
Fic. 1. Gymnopus luxurians (MSM#001; MSM #002). (A-C) Basidiomes. (D) Basidiospores.
(E) Basidia and basidioles. (F) Cheilocystidia. (G) Caulocystidia. (H) Pileipellis. Scale bars:
A-C = 2 cm; D-F = 10 um; G-H = 20 um.
indented or notched, close to subdistant, white at first (SYR9/2), pale grayish
(S5YR8/6) at maturity. STIPE 13-25 mm, central, subequal, often with subbulbous
Gymnopus in Pakistan ... 67
base, hollow, striate, buff (2.5YR6/8) when young, base dark brown (10R2/6).
RHIZOMORPHS white, numerous, branched. Odor and taste not recorded.
BASIDIOSPORES 4.2-5 X 5.3-9.4 um [x = 4.6 x 7.6 um, Q = 1.65], oblong to
ellipsoid in profile, apiculus present, smooth, thin-walled, hyaline in KOH,
inamyloid. Basip1a 5.6-8 x 19-28.3 um, clavate, 2-spored basidia abundant,
4-spored also present, thin-walled, hyaline in KOH; sterigmata 2-4 um.
BASIDIOLES subclavate, abundant. PLEUROCYSTIDIA absent. CHEILOCYSTIDIA
4-8 x 18-32 um, clavate or cylindrical, hyaline, thin-walled. PILEIPELLIS a
cutis, hyphae cylindrical, 6-14 um, thin-walled, weakly to heavily encrusted
with annular brown pigments, brown in KOH. Stipe hyphae cylindrical, 5-10
um, non-encrusted, hyaline to pale yellow in KOH. CauLocystip1a cylindrical,
hyaline, thin-walled 9-14 x 53-124 um. CLAMP CONNECTIONS present in all
tissues.
MATERIAL EXAMINED: PAKISTAN, KHYBER PAKHTOONKHAW, Abbottabad, Shimla,
under Pinus roxburghii Sarg., 14 September 2012, Malka Saba & Abdul Nasir Khalid,
MSM #001 (LAH; GenBank KF803760); MSM #002 (LAH; GenBank KF803761).
COMMENTS: Gymnopus luxurians is a widely distributed species. It is
characterized by brown or reddish brown convex pileus, slightly umbonate with
striate margin, oblong to ellipsoid basidiospores, and cylindrical caulocystidia.
It is frequently collected on woody debris across the continental United States
and has been reported from Europe (Breitenbach & Kranzlin 1991), Hawaii
(Desjardin et al. 1999), Dominican Republic (Mata et al. 2006), Costa Rica, and
Panama (Mata & Ovrebo 2009). Gymnopus luxurians represents a new record
for Pakistan.
Gymnopus luxurians falls in G. subsect. Vestipedes (Antonin & Noordeloos
1997). Other Gymnopus species from this subsection reported from Pakistan
include G. confluens. (Ahmad 1980; Shibata 1992; Sultana et al. 2011),
G. peronatus (Sultana et al. 2011), and G. menehune (see below). Gymnopus
confluens is similar to G. luxurians in being reported from pine forests during
the same season of the year but can be separated by the presence of thin and
crowded lamellae and a whitish fuzz on the stipe that becomes noticeable as the
fungus matures (Kuo 2013). Gymnopus peronatus can be distinguished by its
remarkably distant gills and densely woolly-strigose stipe with white to yellow
hairs (Antonin & Noordeloos 1997).
Gymnopus menehune Desjardin, Halling & Hemmes,
Mycologia 91(1): 173 (1999). Fic. 2
PILEus 10-14 mm diam., convex to plano-convex and slightly umbilicate
when young, infundibuliform, umbilicate at maturity, reddish brown (10R3/8)
or brown fading near margin to grey or pale brown (5YR9/2); margin
decurved, straight or flaring, uplifted, eroded, striate; surface dull, glabrous.
LAMELLAE adnate to decurrent, ascending, close, with 3-6 series of lamellulae,
68 ... Saba & Khalid
off-white to pale orange white (10R8/4). Stipe 23-32 mm, central, equal,
hollow, pubescent to tomentose, buff color near proximal end, brown to dark
brown (10R2/6) at distal end. RHIZOMORPHS numerous, white, branched.
Odor and taste not recorded. BAsip1osporeEs elongate to ellipsoid in profile,
3-4,2(-5.4) x (-5.5)7-9 um [x = 4.6 x 8.1 um, Q = 1.76], smooth, thin-walled,
hyaline in KOH with cytoplasmic contents, inamyloid. Basrpra clavate, 6.3-
7(-8) x 18.8-24 um, commonly 2-spored, occasionally 4-spored; Sterigmata
up to 4.9 um. BASIDIOLEs clavate or fusoid, abundant. PLEUROCysTIDIA absent.
CHEILOCYSTIDIA broadly clavate or irregular in outline, sometimes lobed,
thin-walled, 5-7 x 20-30 um, rarely observed. PILEIPELLIS a cutis, hyphae
3.7-6.3 diam., cylindrical with outgrowths or a few diverticula, thin-walled,
weakly encrusted with brown pigments, terminal cells non-encrusted, lobed,
pale brown in KOH, inamyloid. Strpz hyphae 5.9-6.4 um, cylindrical, parallel,
thin-walled, hyaline to pale brown in KOH, inamyloid. CAuLocysTIDIA 5-6 x
31-54 um, cylindrical to sinuous, hyaline, thin-walled. Clamp CONNECTIONS
present in all tissues.
MATERIAL EXAMINED: PAKISTAN, KHYBER PAKHTOONKHAW, Mansehra, Dadar,
under Pinus roxburghii, 15 September, 2012, Malka Saba & Abdul Nasir Khalid, MSM
#003 (LAH; GenBank KF803762).
COMMENTS: Gymnopus menehune is diagnosed by its convex to plano-convex,
umbilicate pileus, pubescent to tomentose stipe, and elongate to ellipsoid
basidiospores. According to Desjardin et al. (1999) there are voluminous lobed
cheilocystidia in G. menehune, but cheilocystidia were rarely observed in our
Pakistan collection. The species was described first from Hawaii (Desjardin et
al. 1999) and later from Indonesia (Wilson et al. 2004). Gymnopus menehune
represents a new record for Pakistan.
Gymnopus menehune falls in G. subsect. Vestipedes (Antonin & Noordeloos
199%):
Phylogenetic analysis
Sequencing of the nrITS region of Gymnopus luxurians yielded fragments
of 800 base pairs while G. menehune yielded 830 base pairs. Initial BLAST
analysis of nucleotide sequences showed collections MSM#001 and MSM#002
with 100% and 99% maximum identity with Gymnopus luxurians (GenBank
AY256709, DQ480106, DQ450022), while collection MSM#003 showed
97% maximum identity with G. menehune (GenBank JN182864, AY263426,
AY263444, DQ450043, AY263443).
Sequences of closely related taxa were retrieved from Genbank for
phylogenetic analysis. In addition to the three new Pakistani sequences of
G. luxurians and G. menehune, the analysis included 30 other Gymnopus sequences
from GenBank, and three Omphalotus sequences as outgroup (TABLE 1).
Gymnopus in Pakistan ... 69
pe NE
Fic. 2. Gymnopus menehune (MSM #003). (A-B) Basidiomes. (C) Basidiospores. (D) Basidia and
basidioles. (E) Cheilocystidia. (F) Stipe elements and caulocystidia. (G) Pileipellis. Scale bars:
A-B = 2 cm; C-E = 10 um; F-G = 20 um.
F ee
After removing and editing ambiguities from the aligned sequences, a
total of 948 positions were in the final dataset. Of these, 508 characters were
conserved, 418 were variable, 380 were parsimony informative, and 32 were
singletons.
Clade I, and II (Fic. 3) included species of Gymnopus subsect. Vestipedes,
Clade III species characteristic of G. sect. Gymnopus, and clade IV species of
G. subsect. Levipedes. Pakistani sequences (=) generated in this study clustered
with their respective morphological species, each one with strong bootstrap
value. Gymnopus luxurians appears in a clade distinct from G. menehune.
70 ... Saba & Khalid
66 pM Gymnopus_menehune_KF803762
36 JL. Gymnopus_menehune_JN182864
92 Gymnopus_menehune_AY263426
Gymnopus_subcyathiformis_DQ450041
99! Gymnopus_subcyathiformis_DQ450042
Gymnopus_mesoamericanus_DQ450036
100 ! Gymnopus_mesoamericanus_AF505768
74 Gymnopus_confluens_AY256697 Clade |
100 & Gymnopus_confluens_HM240527
Gymnopus_readii_DQ450034
99 100 § Gymnopus_readiae_HQ533036
100 , Gymnopus_cylindricus_AY256696
Gymnopus_cylindricus_DQ450057
Gymnopus_biformis_DQ450064
100 Gymnopus_biformis_DQ450063
= 100; Gymnopus_subpruinosus_DQ450026
84 Gymnopus_subpruinosus_DQ450027
Gymnopus_polygrammus_DQ450028
98 !Gymnopus_polygrammus_AY842954
5 100) Gymnopus_fibrosipes_AF505763
Gysnnopas -Nprosipes NV hese Clade II
100 = Gymnopus_gibbosus_AY263437
31 Gymnopus_gibbosus_AY263438
i Gymnopus_luxurians_KF803760
Gymnopus_luxurians_DQ450022
97 | Hl Gymnopus_luxurians_KF803761
Gymnopus_luxurians_AY256709
100 y Gymnopus_fusipes_AY256710 Clade III
Gymnopus_fusipes_AF505777
ain 100 yGymnopus_dryophilus_JX536158
Gymnopus_dryophilus_JX536157 Clade IV
98 Gymnopus_erythropus_DQ449998
100 ke Gymnopus_erythropus_DQ449996
Omphalotus_illudens_AY313271
100 Omphalotus_olearius_AY313277 Outgroup
Omphalotus_olivascens_AY313281
oo.
Fic. 3. Molecular phylogenetic analysis of Gymnopus sequences by the Maximum Likelihood
method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the
evolutionary history. The percentage of trees in which the associated taxa clustered together is
shown next to the branches. New sequences reported in this study (#).
The percentage similarity, calculated by DNAStar, of Gymnopus luxurians
showed 100% identity and 0% genetic divergence with G. luxurians sequences
AY256709 and DQ450022, and G. menehune showed 99.9% identity and
Gymnopus in Pakistan ... 71
0.1% divergence with G. menehune sequences JN182864 and AY263426; this
supports the results of the BLAST analysis and the phylogenetic tree.
Key to the Gymnopus spp. in Pakistan
1. Pileipellis a transition between cutis and trichoderm and comprising lobed
(often coralloid) elements, similar to a Dryophila-structure.......... G. fusipes
1. Pileipellis usually a simple cutis with some weakly to distinctly coralloid or
diverticulate terminal elements, without Dryophila-structure ............... Z
Ze SUPE STO OU te, Mace bee ace be ees eae Le aes comes oats omic: Ciao, mes, Lee, Lome, 3
Da ADE AEN OF COMTER LOSE rn tp | Mecwuty eiecwartyl teawn ee stan see tara ee eenk Wee Hora Gears weit ees 4
3. Pileus dark red brown at centre, much paler yellow brown to yellow red
LOWAPOSHNIQESIN 0!) asses oeasre 2 sete earings tease apogee eat ee G. erythropus
3. Pileus with ochre brown tinges, especially at centre, translucently striate
uujaveo Hialitiie Palins es.. er ocne Red ees weeetntenGd times Miateres MAN esuce Ste G. dryophilus
4a. Pileus convex when young, expanding with age to plane, flat, thin (collybioid),
slightly umbonate; lamellae adnexed, close to subdistant; basidiospores
oblongite ellipsdid:4=5: 659s SUI ag hike a ete at ae oe ae we Oe G. luxurians
4b. Pileus convex to plano-convex and slightly umbilicate when young,
infundibuliform, umbilicate at maturity; lamellae adnate to decurrent,
close; basidiospore elongate to ellipsoid, 3-5.5 x 5.5-9 um........ G. menehune
4c. Pileus convex with an incurved margin when young, becoming broadly convex,
bell shaped or nearly flat; lamellae narrowly attached to the stem or free,
crowded or close; basidiospores lacrymoid to elliptical or nearly fusoid,
SSDS OA ROSMAN 4 1a, ese Sei ya et dai dal oh lr da ey oak G. confluens
4d. Pileus convex then flattened, often with a low, broad umbo, tan to darker brown;
lamellae adnexed to free, crowded; basidiospores elongate, 3-4 x 7-9 um
LANs ste dently, etYiNi, seein, aelysMsy aetpaha 4 Uelwshs 4 oekvibe!y Witwahe 6 signe. oth aiba shee G. peronatus
Acknowledgments
We are cordially grateful for Higher Education Commission (HEC) for funding this
project under Phase II, Batch I, Indigenous PhD fellowships program for 5000 scholars.
We are highly indebted to Dr. Juan Luis Mata (Department of Biology, University of
South Alabama, USA) and Dr. Amy Rossman (Systematic Mycology and Microbiology
Laboratory, USDA-ARS, Beltsville, USA) for critically reviewing the manuscript. We are
thankful to all lab fellows for accompanying us on the field trip. I am cordially thankful
to Dr. Samina Sarwar (Lahore College for Women University) for her help and guidance
preparing the phylogeny.
Literature cited
Ahmad S. 1980. A contribution to the Agaricales of Pakistan. Bulletin of Mycology 1: 35-89.
Antonin V, Noordeloos M. 1997. A monograph of Marasmius, Collybia and related genera in
Europe. Part 2: Collybia, Gymnopus, Rhodocollybia, Crinipellis, Chaetocalathus and additions to
Marasmiellus. Libri Botanici 17. 256 p.
72 ... Saba & Khalid
Breitenbach J, Kranzlin F. 1991. Fungi of Switzerland. Vol. 3. Boletes and agarics, first part. Verlag
Mykologia, Luzern. 361 p.
Bruns TD. 1995. Thoughts on the processes that maintain local species diversity of ectomycorrhizal
fungi. Plant and Soil 170: 63-73. http://dx.doi.org/10.1007/BF02183055
Dentinger BTM, Didukh MY, Moncalvo JM. 2011. Comparing COI and ITS barcode markers for
mushrooms and allies (Agaricomycotina). PLoS One 6(9): e25081.
http://dx.doi.org/10.1371/journal.pone.0025081
Desjardin DE, Halling RE, Hemmes DE. 1999. Agaricales of the Hawaiian Islands. 5. The genera
Rhodocollybia and Gymnopus. Mycologia 91: 166-176. http://dx.doi.org/10.2307/3761206
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for Basidiomycetes:
application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
http://dx.doi.org/10.1111/j.1365-294X.1993.tb00005.x
Iqbal SH, Khalid AN. 1996. Materials for the fungus flora of Pakistan. I. Checklist of agarics, their
distribution and association with the surrounding vegetation. Science International (Lahore)
8(1): 51-64.
Jukes TH, Cantor CR. 1969. Evolution of protein molecules. 21-132, in: HN Munro (ed.).
Mammalian Protein Metabolism. Academic Press, New York.
Kuo M. 2013. Gymnopus confluens. Retrieved from the MushroomExpert.com.
http://www.mushroomexpert.com/gymnopus_confluens.html
Mata JL, Ovrebo CL. 2009. New reports and illustrations of Gymnopus for Costa Rica and Panama.
Fungal Diversity 38: 125-131.
Mata JL, Hughes KW, Petersen RH. 2006. An investigation of Omphalotaceae (Fungi: Euagarics)
with emphasis on the genus Gymnopus. Sydowia 58: 191-289.
Moncalvo JM, Vilgalys R, Redhead SA, Johnson JE, James TY, Aime MC, Hofstetter V, Verduin SJW,
Larsson E, Baroni TJ, Thorn RG, Jacobsson S, Clémencon H, Miller OK. 2002. One hundred
and seventeen clades of Euagarics. Molecular Phylogenetics and Evolution 23: 357-400.
Munsell ™. 1975. Soil color charts. Baltimore.
Shibata H. 1992. Higher basidiomycetes from Pakistan. Cryptogamic Flora of Pakistan 1: 145-164.
Singer R. 1986. The Agaricales in modern taxonomy. 4th edn. Koeltz, Koenigstein. 980 p.
Sultana K, Rauf CA, Riaz A, Naz F, Irshad G, Haque MI. 2011. Checklist of agarics of Kaghan valley
- 1. Pakistan Journal of Botany 43(3): 1777-1787.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. Molecular evolutionary
genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony
methods. Molecular Biology and Evolution 28(10): 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a guide to
methods and applications. Academic, New York.
Wilson AW, Desjardin DE, Horak E. 2004. Agaricales of Indonesia. 5. The genus Gymnopus from
Java and Bali. Sydowia 56(1): 137-210.
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.73
Volume 129(1), pp. 73-77 July-September 2014
First report of Callistosporium luteoolivaceum
from Western Himalaya, Pakistan
M. SABA* & A.N. KHALID
Department of Botany, University of the Punjab
Quaid-e-Azam Campus, Lahore, 54590, Pakistan
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Callistosporium luteoolivaceum was collected from pure pine forests of Western
Himalaya, Pakistan, and identified based on morphological characters and nrDNA ITS
sequences. It is characterized by dull yellow or olive yellow pilei, lamellae, and stipes that
turn reddish brown with age and basidiospores that turn purplish in KOH. This species is
new to the mycobiota of Pakistan.
Key worps — Abbottabad, Basidiomycota, Khyber Pakhtoonkhaw, saprobic fungi,
Tricholomataceae
Introduction
Geographically, the areas of Pakistan and Indian-held Kashmir fall within
the Western Himalaya. The climate ranges from tropical at the base of the
mountains to permanent ice and snow at the highest elevations. The Himalayan
forests have been reliably identified as a ‘biodiversity hotspot; a global priority
for the conservation of biodiversity (Wikramanayake et al. 2002; Qamar et al.
2011).
During a 2012 mushroom collecting trip in pure pine forests inthe Himalayan
range, many species of saprobic macrofungi were collected. Amongst them,
Callistosporium luteoolivaceum was identified morphologically and molecularly
as a new record from Pakistan. This very variable species occurs worldwide
in temperate or tropical forests mostly outside of boreal and subalpine
regions (Redhead 1982). According to Kuo (2006) this little mushroom is a
decomposer found primarily on dead conifer wood. No Callistosporium species
has previously been reported from Pakistan.
Materials & methods
Basidiomata were collected, photographed, vouchered, dried under fan heater
and characterized morphologically. Specimen sections were mounted in 5% KOH for
7A ... Saba & Khalid
observation under a MX4300H biological microscope (Meiji Techno Co., Ltd., Japan).
Phloxine was used to increase contrast of structures, and Melzer’s reagent was used to
test for dextrinoidity of basidiospores.
Measurements of morphological features (basidiospores, basidia, cystidia, and
pileus and stipe hyphae) were taken from at least 20 measurements made with an ocular
micrometer and 100x oil-immersion objective, where x = arithmetic mean of spore
length and width for all spores measured, and Q = spore length divided by spore width.
Line drawings were made with camera lucida. Color designations are from Munsell
(1975). The collection was conserved in the Herbarium of the Department of Botany,
University of the Punjab, Lahore, Pakistan (LAH).
Genomic DNA was extracted from a small piece of pileus by a modified CTAB
method (Bruns 1995). The internal transcribed spacers (ITS1 and ITS2) and the 5.8S
nuclear ribosomal gene were amplified with primer pairs ITS1F/ITS4 (White et al.
1990; Gardes and Bruns 1993) using the Extract-N-Amp plant DNA extraction Kit
(Sigma-Aldrich, St. Louis, MO, USA). PCR cycling parameters were as follows: initial
denaturation (94 °C for 1 min), 35 cycles (94 °C for 1 min, 53 °C for 1 min, and 72
°C for 1 min), and final extension 72 °C (8 min). Amplified PCR products were sent
for purification and bidirectional sequencing to Macrogen (Republic of Korea). One
C. luteoolivaceum sequence and other related sequences were retrieved from GenBank
and aligned by Muscle using default setting in Molecular Evolutionary Genetics Analysis
(MEGA) software (Tamura et al. 2011). Sequences were manually edited and assembled
using BioEdit (www.mbio.ncsu.edu/bioedit/bioedit.html). Following Dentinger et al.
(2011) for complete ITS sequences, all sequences were trimmed with the conserved
motifs 5’-(...GAT) CATTA- and -GACCT (CAAA...)-3’ and the alignment portion
between them were included in analysis. A sequence generated for this study was
submitted to GenBank. Percent Identities (PID) and DNA divergence were calculated
by Megalign (DNA Star Inc.).
Taxonomy
Callistosporium luteoolivaceum (Berk. & M.A. Curtis) Singer, Lloydia 9: 117
(1946). Fics 1, 2
PILEus 27-31 mm diam., convex to plano-convex, flat, thin (collybioid);
margin straight or flaring, smooth; surface dull, smooth, olive yellow near
margin (5YR7/10); disc moderately indented, dark brown (5YR1/4) at the
center. LAMELLAE regular, adnate, close to crowded, pale yellow or olive yellow
(SYR7/8); margin wavy. STIPE 55-58 mm, central, equal, hollow, striate, pale
yellow to olive yellow (S5YR7/8); annulus absent; volva absent. RHIZOMORPHS
white, few. ODOR AND TASTE not recorded. BASIDIOSPORES 4.6-6.6 x 3-4.5 um
[x = 5.2 x 3.8 um, Q = 1.36], ellipsoid in profile, smooth, thin-walled, purplish
in KOH, apiculus present; BAstp1A 16.9-24.5 x 5.4—7.8 um, clavate, two to four
spored, thin-walled, some turning deep purple in KOH; sterigmata 2.8-4.2
um. Trama hyphae, parallel, thin-walled, hyaline in KOH. CHEILOCYSTIDIA
12-26.6 x 4.7-8 um, clavate or cylindrical, hyaline, thin-walled. PLEURO-
Callistosporium luteoolivaceum in Pakistan ... 75
Callistosporium luteoolivaceum (MSM #004, LAH). Basidiomes. Scale bars = 7 mm.
CYSTIDIA absent. PILEIPELLIS a cutis; hyphae cylindrical, 4-6 um, thin-walled,
hyaline in KOH, some with brown pigments; pileal cystidia clavate, 34-61 x
5.1-8.2 um, thin walled, hyaline in KOH. Stipe hyphae cylindrical, 3.5-17 um,
hyaline in KOH. All structures inamyloid. CLamp CONNECTIONS absent.
MATERIAL EXAMINED: PAKISTAN, KHYBER PAKHTOONKHAW, Abbottabad, Shimla,
under Pinus roxburghii Sarg., 14 September 2012, MSM #004 (LAH; GenBank
KJ101607).
Discussion: Callistosporium luteoolivaceum was first described from eastern
North America. It is taxonomically complicated, and its variable characters and
wide world distribution has resulted in its being described many times as a new
taxon. Redhead (1982) critically examined C. elaeodes Bon, C. favrei Singer, C.
graminicolor Lennox, C. luteofuscum Singer, C. luteofuscum var. major Singer,
C. majus Singer, and C. xanthophyllum (Malencon & Bertault) Bon and reduced
them to synonymy under C. luteoolivaceum because their distinguishing
features intergrade. Despite the intergradations of critical characters, there
remains a great diversity of forms within the broad species concept which when
viewed individually appear quite distinct from one another (Redhead 1982).
76 ... Saba & Khalid
—
D Rass
Callistosporium luteoolivaceum (MSM #004, LAH).
(A) Basidia. (B) Basidiospores. (C) Stipe elements. (D) Pileipellis and pileal cystidia.
Scale bars: A = 10 um; B = 4.5 um; C, D = 17.5 um.
Our collection is in remarkable agreement with the description provided by
Redhead (1982). This is the first report of C. luteoolivaceum from Pakistan. It
has been reported from North and South America, Europe, and Asia (Hongo
1981; Horak 1987; Manimohan & Leelavathy 1989; Redhead 1982; Singer
1970). This species is listed among the rare and notable macrofungi of British
Columbia (Redhead 1997: 6-8).
Sequencing of the nrITS region of C. luteoolivaceum yielded fragments of 690
base pairs when its PCR product was sequenced. Initial blast analysis showed
our Pakistani sequence (GenBank KJ101607) with 97% maximum identity
with C. xanthophyllum (GenBank JF907781; AF325667) and C. luteoolivaceum
(GenBank AF325666). Further analysis reinforced the blast results, showing
Callistosporium luteoolivaceum in Pakistan ... 77
97.5% identity and 0.5% genetic divergence between our Pakistani sequence
and the C. luteoolivaceum sequence (GenBank AF325666).
Acknowledgments
We are highly indebted to Higher Education Commission (HEC), Pakistan, for
funding this project under Phase II, Batch I, Indigenous PhD fellowships program
for 5000 scholars. We are cordially grateful to Dr. Juan Luis Mata (Dept. of Biology,
University of South Alabama, USA) and Dr. Vladimir Antonin (Moravian Museum,
Czech Republic) for critically reviewing the manuscript and their valuable comments.
We are thankful to all lab fellows for accompanying us on field trip.
Literature cited
Bruns TD. 1995. Thoughts on the processes that maintain local species diversity of ectomycorrhizal
fungi. Plant and Soil 170: 63-73.
Dentinger BTM, Didukh MY, Moncalvo JM. 2011. Comparing COI and ITS barcode markers for
mushrooms and allies (Agaricomycotina). PLoS One 6(9): e25081.
http://dx.doi.org/10.1371/journal.pone.0025081
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for Basidiomycetes: application
to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.
Hongo T. 1981. Notulae mycologicae (17). Mem. Fac. Educ. Shiga Univ. Nat. Sci. 31: 33-36.
Horak E. 1987. Agaricales from Yunnan, China, I. Trans. Myc. Soc. Japan 28: 171-188.
Kuo M. 2006. Callistosporium luteo-olivaceum. Retrieved from the MushroomExpert.Com website:
http://www.mushroomexpert.com/callistosporium_luteo-olivaceum.html.
Manimohan P, Leelavathy KM. 1989. Some agarics new to India. Sydowia 41: 200-208.
Munsell ™. 1975. Soil color charts. Baltimore.
Qamar FM, Ali H, Ashraf S, Daud A, Gillani H, Mirza H, Rehman HU. 2011. Distribution and
habitat mapping of key fauna species in selected areas of Western Himalaya, Pakistan. Journal
of Animal and Plant Sciences 21(2S): 396-399.
Redhead SA. 1982. The systematics of Callistosporium luteo-olivaceum. Sydowia 35: 223-235.
Redhead SA. 1997. Macrofungi of British Columbia: requirements for inventory. Res. Br., B.C. Min.
For., and Wildl. Br., B.C. Min. Environ., Lands & Parks, Victoria, B.C. Working Paper 28/1997.
119 p.
Singer R. 1970. Omphalinae (Clitocybeae - Tricholomataceae, Basidiomycetes). Fl. Neotrop. Monogr.
3: 3-84.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. Molecular evolutionary
genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony
methods. Mol. Biol. Evol. 28(10): 2731-2739.
Wikramanayake E, Dinerstein E, Loucks CJ, Olson DM, Morrison J, Lamoureux J, McKnight M,
Hedao P. 2002. Terrestrial ecoregions of the Indo-Pacific: a conservation assessment. Island
Press, Washington DC. 643 p.
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a guide to
methods and applications. Academic, New York.
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.79
Volume 129(1), pp. 79-83 July-September 2014
Gastroboletus thibetanus: a new species from China
SHU-RONG WANG", Qi WANG’, DE-LI WANG’, & Yu L1’?*
' Institute of Grassland Science, Northeast Normal University, and Key Laboratory of
Vegetation Ecology, Ministry of Education, Changchun, 130024, China
? Engineering Research Center of Chinese Ministry of Education for Edible and Medicinal Fungi,
Jilin Agricultural University, 2888 Xincheng Street, Changchun, 130118, China
ABSTRACT— Gastroboletus thibetanus sp. nov. is reported from Tibet, China. It was collected
under Abies forrestii var. smithii and is characterized by pale green-yellow to coral red
basidiomata, a percurrent columella, and relatively large basidiospores.
Key worps— Basidiomycota, Boletaceae, Boletales, macrofungi, taxonomy
Introduction
Gastroboletus Lohwag (Boletaceae, Boletales, Basidiomycota) is a small
genus that is widely distributed in temperate regions (Kirk et al. 2008). It is
characterized by hypogeous, sequestrate Boletus-like basidiomata that have
a poorly developed or absent stipe with irregularly arranged tubes (usually
covered by persistent membranes) and elliptical to spindle-shaped, smooth,
brown to golden brown spores. Spore dispersal depends primarily on animal
mycophagy (Nouhra et al. 2002). Gastroboletus has been reported from North
and South America, Asia, South Africa, Western Europe, and eastern Australia
(Cazares & Trappe 1991; Horak 1977; Lohwag 1926; Nouhra & Castellano
1995; Nouhra et al. 2002; Singer & Smith 1964; Smith & Singer 1959; Trappe &
Castellano 2000; Thiers & Trappe 1969; Thiers 1979, 1989; Zang 1995). Thiers
(1989) divided Gastroboletus sensu lato into several genera to reflect their
phylogeny more correctly. Nouhra et al. (2002) provided a comprehensive key
to all known Gastroboletus species.
Mt. Sejila, which is located in Tibet, China, is geographically isolated due to
its high altitude and poor road access. Its fungal flora has been poorly studied,
with only a few Cortinarius species previously reported (Teng et al. 2011). In an
attempt to help rectify this, macrofungal field surveys were carried out in 2012
80 ... Wang & al.
FiGuRE 1. Gastroboletus thibetanus (HMJAU 30001, holotype). A. basidioma; B. vertical section of
basidioma, showing gleba and columella. Scale bars = 2 cm.
and 2013. Here we describe a particularly interesting hypogeous sequestrate
species, which we propose as G. thibetanus sp. nov.
Materials & methods
Specimens were collected at Mt Sejila, Tibet, under Abies forrestii var. smithii, the
dominant species in the coniferous forest with Larix and Picea and with Rhododendron
occasionally found in the understory (Xu 1995). The acidic brown soil has a pH of
4.9. All specimens are deposited in the Herbarium of Mycology of Jilin Agricultural
University (HMJAU), China. Macroscopic characters were described based on fresh
and dried material. Color names follow Kornerup & Wanscher (1978). For light
microscopic observations, free-hand sections of the specimens were mounted in 5%
KOH solution on glass slides. Forty randomly selected basidiospores were measured
under 1000x magnification. The basidiospore surfaces were observed by scanning
electron microscope after coating with gold (Bozzolla & Russell 1999).
Taxonomic description
Gastroboletus thibetanus Shu R. Wang & Yu Li, sp. nov. FIGS 1, 2
MycoBank MB 807041
Differs from Gastroboletus ruber and G. molinae by its larger basidiospores and the
absence of cystidia.
Type: China. Tibet, Lenzhi, Mount Sejila, 29°40’22.54”N 94°43’11.20’E, on soil under
Abies forrestii var. smithii Viguié & Gaussen, 26 July 2012, Wang Shu-Rong T10020
(Holotype, HMJAU 30001).
Gastroboletus thibetanus sp. nov. (China) ... 81
FIGURE 2. Gastroboletus thibetanus. A. vertical section through the peridium and gleba of a
basidioma; B. peridial structure; C. parallel hyphae in trama; D. basidia and basidiospores;
E. basidiospores, showing yellowish color and thick walls; F SEM micrograph of basidiospores,
showing smooth surface. Scale bars: A = 100 um; B, C = 50 um; D, E = 20 um; F = 5 um.
ErymMo_ocey: Referring to Tibet Autonomous Region, where the holotype was collected.
BASIDIOMATA depressed-globose to reniform, 6-40 mm across when dried,
10-48 mm across when fresh, surface smooth, sometimes cracked-areolate
on top, “light green-yellow” to “coral red” (1A7—1A8, 9A7—9B7), becoming
somewhat grayish yellow with age. GLEBA 5—23 mm broad, olive brown (4E5),
with empty chambers and a prominent columella, changing bluish on bruising
or exposure. COLUMELLA 7-15 mm broad, yellow to reddish-brown (2A8,
4A8) when fresh, sordid yellowish when dried, truncate to dendroid, with
narrow, radiating branches, extended below as a reddish-brown sterile base,
usually arising from yellowish rhizomorphs, changing bluish when bruised or
exposed. Odor fruity to mushroomy.
PERIDIUM 60-150 um thick, yellow-brown. PERIDIAL HYPHAE 3-18
um diam., surface smooth, thin-walled, yellowish, more or less appressed,
sometimes interwoven, slightly gelatinous to floccose in KOH. HYPHAE BELOW
PERIDIUM 2.0-4.5 um diam., surface smooth, yellow-brown, thin-walled, loose
and subparallel with the peridium. TRAMA olive brown, consisting of loose,
subparallel hyphae (2.0—5.0 um thick). COLUMELLAR HYPHAE 3.0-6.0 um
diam., thick-walled, pale yellow to pale brown, loose and rarely dichotomously
branched. Basrp1a cylindrical, 2-4-spored, 25-36 x 10-14 um; sterigmata
82 ... Wang & al.
3.7—5 um long and 1.5—3 um thicker at base. Bastp1osporEs ellipsoid, smooth,
thick-walled, yellowish in KOH, 11-23.5 x 7.5-12 um, L/W ratio = 1.64-1.94,
Average = 1.80 + 0.02, symmetrical, basal apiculus prominent. CystTrp1a and
CLAMP CONNECTIONS not seen.
Hasirat: Epigeous or subhypogeous on soil under Abies forrestii var. smithii.
ADDITIONAL SPECIMENS EXAMINED: CHINA. TiBET, LENzHI, Mount Sejila,
29°40'22.54”N 94°43’11.20’E, 11 August 2013, coll. Wang Shu-Rong T50457 (HMJAU
30002); 29°40’22.64’N 94°43’10.22”E, 11 August 2013, coll. Wang Shu-Rong 150467
(HMJAU 30005); 29°40’22.50”N 94°43’10.44”E, 4 October 2013, coll. Li Shu T18269
(HMJAU 30006).
Discussion
The combined characters of the pale green-yellow to coral red basidiomata
that become bluish on bruising or exposure, percurrent columella, relatively
large (11-23.5 x 7.5-12 um) thick-walled basidiospores, and the absence of
cystidia are diagnostic for G. thibetanus. Gastroboletus thibetanus belongs to
G. sect. Gastrosubtomentosi based on the red overtones of the basidiomata, dry
peridial surface, and structure of the peridium (Thiers 1989).
The color and size of G. thibetanus basidiomata are somewhat similar to
those of G. ruber and G. molinae reported from U.S.A. (Cazares & Trappe 1991;
Nouhra et al. 2002). The two American species differ from G. thibetanus by
smaller basidiospores (8—20 x 4—6 um and 11-20 x 5—8 um, respectively) and
the presence of cystidia. In addition, G. ruber always occurs in coniferous forests
dominated by Tsuga spp. (Zeller 1939, Molina et al. 1992) while G. molinae is
associated with Quercus chrysolepis (Nouhra et al. 2002).
Gastroboletus thibetanus also resembles G. citrinobrunneus, G. dinoffii, and
G. doii by tissues that turn blue on bruising or exposure. Both G. citrinobrunneus
and G. dinoffii, reported from California, U.S.A, are readily distinguished by
their larger basidiomata and smaller basidiospores (Nouhra & Castellano 1995;
Thiers 1979). Gastroboletus doii (from New Caledonia) can be differentiated by
pale dull brown to ochre basidiomata, presence of cystidia, and a volva (Zang
1995). The type species of Gastroboletus, G. boedijnii from China (Lohwag
1926), is easily separated from G. thibetanus by the presence of cystidia and
smaller (11-14 x 4—5.5 um) basidiospores (Smith & Singer 1959).
Acknowledgments
We express our deep appreciation to Dr. M. A. Castellano (USDA, Forest Service,
Northern Research Station, Corvallis, Oregon, U.S.A) and Dr. Ian R. Hall (Truffles &
Mushrooms (Consulting) Ltd., Dunedin, New Zealand), who critically reviewed the
manuscript and provided invaluable suggestions. The first author is very grateful to Dr.
M. Kakishima (Jilin Agricultural University, China) and Dr. E. Nagasawa (The Tottori
Mycological Institute, Japan) for their improvement of the manuscript. This work was
Gastroboletus thibetanus sp. nov. (China) ... 83
supported by the Fungal Diversity Investigation and Key Technology in Sustainable Use
of Rare Fungi in Tibet fund (No. 2012BAC01B04).
Literature cited
Bozzolla JJ, Russell LD. 1999. Electron microscopy: principles and techniques for biologists. 2nd
ed. Jones & Bartlett Learning.
Cazares E, Trappe JM. 1991. Alpine and subalpine fungi of the Cascade Mountains. 3. Gastroboletus
ruber comb. nov. Mycotaxon 42: 339-345.
Horak E. 1977. New and rare boletes from Chile. Bol. Soc. Argentina Bot. 18: 97-109.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,
10th edn. Wallingford, CAB International.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. Eyre Methuen, London.
Lohwag H. 1926. Zur Entwicklungsgeschichte und Morphologie der Gastromyceten. Beihefte zum
Botanischen Centralblatt, 2. Abt., 42: 117-334.
Molina R, Massicotte H, Trappe JM. 1992. Specificity phenomena in mycorrhizal symbioses:
community-ecological consequences and practical implications. 357-423, in: MF Allen (ed.).
Mycorrhizal functioning: an integrative plant-fungal process. Chapman & Hall, New York.
Nouhra E, Castellano MA. 1995. NATS truffle and truffle-like fungi 3: Gastroboletus dinoffii sp. nov.
Mycotaxon 55: 179-183.
Nouhra E, Castellano MA, Trappe JM. 2002. NATS truffle and truffle-like fungi 9: Gastroboletus
molinai [sic] sp. nov. (Boletaceae, Basidiomycota), with a revised key to the species of
Gastroboletus. Mycotaxon 83: 409-414.
Singer R, Smith AH. 1964. Studies on secotiaceous fungi X. Additional data on Gastroboletus.
Mycologia 56: 310-313. http://dx.doi.org/10.2307/3756548
Smith AH, Singer R. 1959. Studies on secotiaceous fungi. IV. Gastroboletus, Truncocolumella, and
Chamonixia. Brittonia 11: 205-223. http://dx.doi.org/10.2307/2805006
Teng LJ, Xu AS, Liu XJ. 2011. The resources of Cortinarius in Sejila Mountain of Mountain of Tibet.
Edible Fungi of China 5: 002.
Thiers HD. 1979. New and interesting hypogeous and secotioid fungi from California. Beihefte zur
Sydowia 8: 381-390.
Thiers HD. 1989. Gastroboletus revisited. Memoirs of the New York Botanical Garden 49: 355-359.
Thiers HD, Trappe JM. 1969. Studies in the genus Gastroboletus. Brittonia 21: 244-254.
http://dx.doi.org/10.2307/2805576
Trappe JM, Castellano MA. 2000. New sequestrate Ascomycota and Basidiomycota covered by the
Northwest Forest Plan. Mycotaxon 75: 153-179.
Xu FX. 1995. Study on the forest ecosystem in Tibet. Shenyang. Liaoning University Press.
[in Chinese].
Zang M. 1995. A new species of the genus Gastroboletus from New Caledonia. Mycotaxon 54:
407-412.
Zeller SM. 1939. New and noteworthy gasteromycetes. Mycologia 31: 1-32.
http://dx.doi.org/10.2307/3754429
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.85
Volume 129(1), pp. 85-95 July-September 2014
Biogeographical patterns in pyrenomycetous fungi and their
taxonomy. 4. Hypoxylon and the southern United States
LARISSA N. VASILYEVA! & STEVEN L. STEPHENSON?
‘Institute of Biology and Soil Science, Far East Branch of the Russian Academy of Sciences,
Vladivostok 690022, Russia
*Department of Biological Sciences, University of Arkansas, Fayetteville, Arkansas 72701, USA
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — A biogeographic region with a peculiar species composition and located in the
southern states of the United States is discussed. It is proposed that this region is a part of
a possible Caribbean center of fungal biodiversity. Hypoxylon confertisilvae, H. ilicinum, H.
meridionale, H. minicroceum, and H. rolingii are described as species new to science.
Key worps — Ascomycota, distribution, Xylariaceae
Introduction
A group of the southern states of the United States (Arkansas, Alabama,
Florida, Louisiana, Mississippi, Missouri, and Texas) represent a region of
considerable interest with respect to the biogeography of pyrenomycetous
fungi. First, one can observe typical species that are known only from
southeastern North America, including such examples as Biscogniauxia
atropunctata (Schwein.) Pouzar and Diatrype atlantica Lar.N. Vassiljeva on
Quercus spp., Diatrype tremellophora Ellis on Magnolia spp., and Diatrype
virescens (Schwein.) M.A. Curtis on Fagus grandifolia. Second, there are species
that occur mainly in the southern states listed above, with one example being
Camillea signata (S.C. Jong & C.R. Benj.) Lzessge et al. The same preference
for this region is observed in Biscogniauxia schweinitzii Y.M. Ju & J.D. Rogers,
Rosellinia glandiformis Ellis & Everh., and R. langloisii Ellis & Everh.
Over a period of several years (2006-11) surveys for pyrenomycetous fungi
were carried out in a number of localities in this region, mostly in Arkansas
(the Buffalo National River Park, the Ouachita Mountains Biological Station,
and the Ozark National Science Center) and Texas (the Big Thicket National
Preserve). The survey results combined with literature data suggest a very
specific center of fungal biodiversity.
86 ... Vasilyeva & Stephenson
The southern United States as part of a possible Caribbean center
of fungal biodiversity
Some species reported for Mexican border regions—Biscogniauxia arima
FE San Martin et al., Hypoxylon lividipigmentum F. San Martin et al., and
Annulohypoxylon thouarsianum var. macrosporum (F. San Martin et al.) Y.M.
Ju et al. also have been found in Texas (Big Thicket National Preserve). Several
species have distributions that extend from the southern United States to
northern South America. Thus, Hypoxylon venezuelense Y.M. Ju & J.D. Rogers,
described originally from Venezuela (Ju & Rogers 1996), also has been found
in Texas (Fic. 1). Hypoxylon rickii Y.M. Ju & J.D. Rogers is known from French
Guiana, Mexico, and St. John (U.S. Virgin Islands) as well as from Louisiana
(Fic. 2). Other Caribbean islands seem to share species of pyrenomycetous
fungi with adjacent continental areas, such as Vivantia guadalupensis J.D.
Rogers et al., described originally from Guadeloupe (Rogers et al. 1996) and
later found in Texas (Fie. 3).
There are additional data from some other biogeographic comparisons
that support an independent Caribbean center of fungal biodiversity. We have
previously discussed the “Asa Gray disjunction,’ a well-known distribution
pattern that exists for many organisms, including fungi (Vasilyeva &
Stephenson 2010). This pattern, which is characteristic of species occurring
both in northeastern North America and northeastern Asia, is represented by
‘sibling’ species that replace each other in these two widely separated world
regions.
Unexpectedly, a southern parallel to the “Asa Gray disjunction” was found
to exist between southeastern Asia (tentatively consisting of the Indochina
Peninsula, southern provinces of China, and the Malay Archipelago) and the
region in and around the Caribbean Sea and the Gulf of Mexico (Fic. 5). When
efforts are made to identify species collected in the Indo-Malayan center of
biodiversity (Vasilyeva et al. 2012), the other species they most closely resemble
often appear to be those reported from Mexico, the southern United States, or the
Caribbean coast of South America. Sometimes, the morphological resemblance
is so high that the species from the eastern and western hemispheres differ in
only one or two features. (The same phenomenon is observed for the species
involved in the northern “Asa Gray disjunction.”) For example, Biscogniauxia
schweinitzii from the southern United States and B. lithocarpi Lar.N. Vassiljeva
et al. from northern Thailand have strikingly similar asci and ascospores but
differ in their stromata. Hypoxylon rubroargillaceum Lar.N. Vassiljeva et al. is
similar to H. flavoargillaceum J.H. Mill. (known from Colombia and Venezuela)
but differs in ascal tips that do not turn blue in Melzer’s reagent and the presence
of granules immediately beneath the surface and among the perithecia that are
not yellowish-brown but bright-red.
Hypoxylon spp. nov. (U.S.A.) ... 87
Fics. 1-5. 1. Hypoxylon venezuelense: A. Stroma (VLA P-2605), B. Collection localities;
2. Hypoxylon rickii: A. Stroma (VLA P-2607), B. Collection localities; 3. Vivantia guadalupensis:
A. Stroma (VLA P-2448), B. Collection localities; 4A-B. Stromata of Hypoxylon subchlorinum
(VLA P-2604); 5. Tentative location of the Caribbean and Indo- Malayan centers of fungal diversity.
Scale bars: 1A = 1.5 mm; 2A = 9 mm; 3A = 4.5 mm; 4A-B = 2.5 mm. [The maps modified to show
our data are taken from the web sites <http://www.biomedcentral.com> (Fics 1B, 2B, 3B) and
<http://www.designus.com/vector-world-map> (Fic. 5).]
88 ... Vasilyeva & Stephenson
Such morphological similarities shown by species associated with eastern
and western centers of biodiversity is not surprising, given that molecular
studies also pull together exactly such species from those areas. Thus, the
most interesting and relevant xylariaceous phylogenetic tree (Hsieh et al.
2005) clusters together several species (Hypoxylon crocopeplum Berk. & M.A.
Curtis, H. dieckmannii Theiss., H. erythrostroma J.H. Mill., H. fendleri Cooke,
and H. haematostroma Mont.) from both Mexico (the Caribbean center) and
Taiwan (the Indo-Malayan center). While this might support conspecificity of
specimens from the western and eastern hemispheres, the specimens could
just as easily be assigned to different species, as has been done for Hypoxylon
lividicolor Y.M. Ju & J.D. Rogers from Taiwan and H. lividipigmentum from
Mexico, two taxa that also cluster together with the same level of support
(Hsieh et al. 2005) and which we have already (Vasilyeva & Stephenson
2010) suggested might represent a vicarious pair of species. The pantropical
distribution of a number of species as well as the species concepts themselves
might have to be reconsidered in the light of the existence of more restricted
biogeographic centers of biodiversity.
Supporting data from non-pyrenomycetous fungi
The peculiar species composition of the fungal assemblages found in the
southern United States and the occurrence of many species in only some
portions of the Caribbean have been emphasized by basidiomycete specialists.
For some of these, Wu & Mueller (1997) described a “Florida-Texas distribution
pattern.” The extensive literature on fleshy basidiomycetes described from Texas
(Lewis & Ovrebo 2009) lists a number of species known only from Texas [e.g.,
Boletus lewisii (Both) Bessette et al., Clitocybe texensis H.E. Bigelow, Cortinarius
lewisii O.K. Mill., Megacollybia texensis R.H. Petersen & D.P. Lewis, Russula
lewisii Buyck, R. texensis Buyck et al.] or species more widely distributed in
the southern United States bordering the Caribbean Sea. Thus, Phylloporus
boletinoides A.H. Sm. & Thiers is known from Alabama, Florida, and Texas
(Singer et al. 1990), whereas Amanita westii (Murrill) Murrill has been reported
from Florida, Mississippi and Texas (Tulloss & Lewis 1994).
More recent information on basidiomycetes restricted to countries adjacent
to the Caribbean Sea has been published. For example, Ganoderma ravenelii
Steyaert is known from the southeastern states and Mexico (Torres-Torres &
Guzman-Davalos 2008). Guzman-Davalos (2002) indicated that only 13% of
Mexican Gymnopilus species are distributed worldwide, whereas the remaining
87% occur in only Mexico, in the United States and Mexico, in the United States,
Mexico, and Cuba, or in Mexico and Central America. A number of agarics and
boletes occur primarily in the montane oak forests of Costa Rica and Colombia
(Halling & Mueller 2002). Lodge et al. (2002) note that “49 species of Hygrocybe,
Hypoxylon spp. nov. (U.S.A.) ... 89
Camarophyllopsis and Cuphophyllus are found in southeastern United States,
excluding species in common with the Lesser Antilles, Trinidad and Venezuela”
and that “58.8% (10/17) of the 38 southern Caribbean species would eventually
be found in the Greater Antilles.” Here the reference to “Caribbean species”
surely indicates the existence of a special center of fungal biodiversity.
There are even some data on vicarious species in the Caribbean and Indo-
Malayan centers of diversity. As such, Trogia venenata Zhu L. Yang et al. was
described recently from southern China counterbalanced by a closely related
Neotropical species [Trogia buccinalis (Mont.) Pat.], described originally from
Guyana (Yang et al. 2012).
Possible resurrection of some species
At present, the names of some species reported from the southeastern
United States have been reduced to synonyms, but their biogeographic
distributional pattern suggests a separate taxonomic identity. For example,
Hypoxylon epiphaeum Berk. & M.A. Curtis, which is restricted to Magnolia
spp., was reported [as a variety of H. investiens (Schwein.) M.A. Curtis] for
Alabama, Florida, Georgia, Louisiana, New Jersey, New York, North Carolina,
South Carolina, and West Virginia (Miller 1961). The species also has been
found twice in Texas (both on Magnolia virginiana L. from the David Lewis
property near Bleakwood in Newton Co. and the Turkey Creek Unit of the Big
Thicket National Preserve), but H. epiphaeum is treated by Ju & Rogers (1996)
as a synonym of H. monticulosum Mont., a fungus commonly reported from the
tropics and subtropics on different kinds of wood. Granted, the two species share
some similarities (e.g., papillate ostioles, ascospore size, perispore dehiscent
in 10% KOH). One Big Thicket specimen lacked KOH-extractable pigments
and so resembled H. monticulosum, while another (seemingly younger)
specimen displayed dark-livid to dark-vinaceous pigments. We differentiate
H. epiphaeum from H. monticulosum by the possession of glomerate stromata
with an underlying orange-red subiculum (Fic. 6) and purple pigments in the
young stages and its association with Magnolia species in the southeastern
United States. Unfortunately, the holotype of “H. epiphaeum” in Kew has
stromata characteristic of H. monticulosum, leaving the fungus associated with
Magnolia without a proper name so that a new name should be proposed for a
common species.
Another example is Hypoxylon subchlorinum Ellis & Calk. (Fic. 4), described
originally from Florida and also found in Georgia and Texas. Ju & Rogers
(1996, p. 124) cite the name H. subchlorinum under H. fuscum (Pers.) Fr.,
although they admit, “additional study might further subdivide this species.”
They accept a rather wide ascospore length range (8-20 um) for H. fuscum,
whereas northern temperate specimens usually have ascospores 12-15 um long
90 ... Vasilyeva & Stephenson
(Miller 1961). Hypoxylon subchlorinum has smaller ascospores and differently
shaped stromata. There is also a discrepancy between the original description of
H. subchlorinum and its type specimens. Ellis & Everhart (1888) described the
stromata as yellow and the ascospores as 7-8 um long. However, the ascospores
are 8-10.5 um long in both holotype and one isotype of H. subchlorinum
(both parts of exsiccate North American Fungi 2115: Florida, Jacksonville,
1886, Calkins, W.W., corticated wood). A piece of the same exsiccate studied
in Herbarium of Michigan University was characterized by the flattened and
rounded stromata also observed in the material from the Big Thicket. The
Texas material was primarily from Carpinus virginiana Mill., but very similar
stromata were found in a specimen of H. subchlorinum on Celtis from Louisiana
(Farlow Herbarium: St. Martinville, 28 Jan 1889, A.B. Langlois). This species,
which seems to be a characteristic representative of Florida, Louisiana, and
Texas should be segregated from the “H. fuscum” complex.
A third candidate in need of resurrection is Hypoxylon mulleri J.H. Mill.,
described originally from Puerto Rico (Miller 1933) and later found in Florida
(Miller 1961) and Texas (Big Thicket National Preserve). Its name has been
suggested as synonymous with H. placentiforme Berk. & M.A. Curtis, but based
on material collected in Texas, the shiny black stromata with conspicuous
perithecial mounds of H. mulleri differ from the brown vinaceous and very
smooth stromata of H. placentiforme. The H. placentiforme concept of Ju &
Rogers (1996), which accepts 8.5-18.5 um long ascospores, seems rather broad;
such a range is very unusual, given the nature of repetitive variability within
the Hypoxylon (cf. Vasilyeva & Stephenson 2010: Table 2). It would appear
that the range has been ‘synthesized’ from several different taxonomic entities,
and indeed, the synonyms cited under H. placentiforme have been applied
to taxa with narrower ascospore ranges (Miller 1961, Whalley & Taligoola
1978). Prominent examples are H. sclerophaeum var. macrosporum (ascospores
14-20 um long) and H. sclerophaeum var. microsporum (ascospores 7.5-12 um
long), whereas the lectotype of H. placentiforme [K(M)125651] from Cuba has
ascospores 11-15 um long.
Taxonomy
Hypoxylon confertisilvae Lar.N. Vassiljeva & S.L. Stephenson, sp. nov. Fic. 6C
MycoBank MB 808385
Differs from Hypoxylon fuscum by its finely papillate stromatal surface and KOH-
extractable pigments between cinnamon and umber.
TypE—USA, Texas, Big Thicket National Preserve, Turkey Creek Unit, Kirby Nature
Trail, on bark of Acer sp., 4 Apr 2011, L. Vasilyeva (VLA P-2601).
EryMoLocy—refers to the “thick forest” implying the place of collection (Big Thicket
National Preserve)
Hypoxylon spp. nov. (U.S.A.) ... 91
ee yr
Fic. 6. Stromata: A-B. “Hypoxylon epiphaeum” (VLA P-2454); C. Hypoxylon confertisilvae;
D. Hypoxylon ilicinum; E. Hypoxylon meridionale; F. Hypoxylon croceum from the Great Smoky
Mountains National Park (VLA P-1617); G. Hypoxylon minicroceum; H. Hypoxylon rolingii. Scale
bars: A-B = 1.5mm; C = 1.7 mm; D = 2.4mm; E= 4.5 mm; F=1mm;G=1.7 mm;H =2.4mm.
STROMATA hemispherical to pulvinate, discrete 2-4 mm diam., with finely
conspicuous perithecial mounds; surface dark-vinaceous; tissue black
immediately beneath surface and among the perithecia, with KOH-extractable
pigments between cinnamon (62) and umber (9). Perithecia 100-150 um diam.,
ostioles black and finely papillate. Ascr in spore-bearing part 85-90 x 6-7 um,
stalks 30-40 um, with apical ring bluing in Melzer’s iodine reagent, discoid,
0.3-0.5 um high, 2.5-3 um broad. Ascosporss light brown, unicellular,
elongated-ellipsoid, almost equilateral, 12-15 x 4.5-5 um, germ slit not
observed, perispore indehiscent in 10% KOH.
ComMMENTS— This species is similar to Hypoxylon fuscum in stromatal shape
and color but differs with respect to the stromatal surface and KOH-extractable
pigments. It also is similar to H. minicroceum (see below) in ascospore shape
and color and the KOH-extractable pigments but differs in the stromatal shape
and the larger ascospores.
92 ... Vasilyeva & Stephenson
Hypoxylon ilicinum Lar.N. Vassiljeva & S.L. Stephenson, sp. nov. Fig. 6D
MycoBank MB 808386
Differs from Hypoxylon fuscum by its smaller ascospores and luteous KOH-extractable
pigments.
TypE—USA, Texas, Big Thicket National Preserve, Jack Gore Baygall Unit, Blue Hole
Trail, on branches of Ilex sp., 11 Apr 2011, L. Vasilyeva (VLA P-2593).
EryMoLoGy—refers to the association with branches of Ilex sp.
STROMATA hemispherical to pulvinate, discrete 2-4 mm diam. or confluent,
with inconspicuous or slightly conspicuous perithecial mounds; surface livid-
vinaceous to dark-vinaceous; light brownish granules immediately beneath
surface and among the perithecia, with KOH-extractable pigments luteous.
PERITHECIA spherical, 200-300 um diam., ostioles umbilicate. Asc in the
spore-bearing part 75-80 x 6-7 um, stalks 35-40 um, with an apical ring
bluing in Melzer’s iodine reagent, discoid, 0.3-0.5 um high, 2.5-3 um broad.
Ascosporss brown, unicellular, ellipsoid-inequilateral, 8-12.5 x 4.5-5.5 um,
with a straight germ slit extending the length of the spore on the concave side;
perispore dehiscent in 10% KOH.
CoMMENTS—This species resembles H. fuscum in shape and color of the
stromata but differs in having smaller ascospores and KOH-extractable
pigments. It also is similar to H. porphyreum Granmo in general appearance
(Granmo 1999: Fig. 31) and ascospore size, but pigments of H. porphyreum are
said to be “brown with a greenish tone” in 10% KOH. Moreover, H. porphyreum
is found only on Quercus in Norway and Sweden. Another similar species is
H. vinosopulvinatum Y.M. Ju et al. from Taiwan (Ju et al. 2004), which has
pulvinate stromata of the same color, similar KOH-extractable pigments,
comparably sized ascospores, and a perispore dehiscent in 10% KOH. However,
H. vinosopulvinatum has rather conspicuous perithecial mounds and a germ
slit on the convex side of the ascospore. The two species—H. ilicinum and
H. vinosopulvinatum—could be considered vicarious, replacing each other in
the Caribbean and Indo- Malayan centers of fungal biodiversity.
Hypoxylon meridionale Lar.N. Vassiljeva & S.L. Stephenson, sp. nov. Fic. 6E
MycoBank MB 808387
Differs from Hypoxylon dieckmannii by its larger and darker, as well as strongly
inequilateral, ascospores.
TypE—USA, Texas, Big Thicket National Preserve, Big Sandy Creek Unit, Woodlands
Trail, on wood, 3 Apr 2011, L. Vasilyeva (VLA P-2602).
EryMoLoGcy—refers to the south (of the United States).
STROMATA widely effused, with slightly conspicuous perithecial mounds,
surface brown vinaceous; cream-whitish granules immediately beneath
surface, with grayish sepia (108) pigments. PERITHECIA spherical, 200-300 um
Hypoxylon spp. nov. (U.S.A.) ... 93
diam., ostioles umbilicate. Asc1 not observed. Ascospores brown, ellipsoid-
inequilateral, 8-12(12.5) x 4-4.5 um, with a slightly oblique germ slit less than
the length of the spore, perispore indehiscent in 10% KOH.
ComMMENTS—The species is similar to H. dieckmannii, which can also possess
brown vinaceous stromata with grayish sepia KOH-extractable pigments,
6.5-10(11) um long ascospores, and a perispore indehiscent in 10% KOH.
Hypoxylon dieckmannii has been reported from Brazil, French Guiana, Mexico,
and Louisiana (New Orleans) in the United States, so its occurrence in Texas
could be expected. However, the specimen from the Big Sandy Creek Unit—
with a similar stromatal surface, pigments, and indehiscent perispore—has
longer (although overlapping) ascospores (10-12 um) that do not fall into the
characteristic ascospore range for H. dieckmannii. In addition, Miller (1961:
33, Fig. 48) described H. dieckmannii as having 6-8 um long ascospores and
illustrated these as small and light brown; their shape (almost equilateral
and ellipsoid) also differs from the ascospores of Texas specimens, which
are darker and strongly inequilateral. It also should be noted that the fresh
stromata produced an olivaceous pigment in NaOH, a feature that suggests
H. anthochroum Berk. & Broome, but H. meridionale differs from H.
anthochroum in having an indehiscent perispore.
Hypoxylon minicroceum Lat.N. Vassiljeva & S.L. Stephenson, sp. nov. Fic. 6G
MycoBank MB 808388
Differs from Hypoxylon croceum by its smaller stromata and KOH-extractable pigments.
TypE—USA, Texas, Big Thicket National Preserve, Jack Gore Baygall Unit, Blue Hole
Trail, rotten wood, 11 Apr 2011, L. Vasilyeva (VLA P-2591).
EryMoLoGcy—refers to the similarity with Hypoxylon croceum.
STROMATA glomerate to effuse-pulvinate, with conspicuous to almost naked
perithecial mounds; surface fuscous; dark brown woody tissue immediately
beneath surface and among the perithecia, with KOH-extractable pigments
between umber (9) and cinnamon (62). PERITHECIA spherical, (100-)120-150
um diam., ostioles papillate. Asci in spore-bearing part 80-95 x 4.5-5 um,
stalks 17-20 um, with apical ring bluing in Melzer’s iodine reagent, discoid,
0.5-0.7 um high, 1.5-2 um broad. Ascosporss light brown, unicellular,
narrow-ellipsoid, almost equilateral, 10-12.5 x 4-4.5 um, with a straight germ
slit the length of the spore; perispore indehiscent in 10% KOH.
ComMMENTS— The stromata of H. minicroceum resemble those of H. croceum
J.H. Mill. (Fic. 6F) but are much smaller. Both species have comparable
ascospore size and a perispore indehiscent in 10% KOH, but they differ in
their KOH-extractable pigments. Hypoxylon croceum has been reported
from a restricted area in the southeastern United States (Georgia, North
94 ... Vasilyeva & Stephenson
Carolina, Ohio, and Tennessee) and also has been reported from Venezuela
(Ju & Rogers 1996). When the perithecial mounds are not very prominent,
H. minicroceum is similar to H. submonticulosum Y.M. Ju & J.D. Rogers but
differs in the cinnamon KOH-extractable pigments and ascospore shape. With
respect to its small and inconspicuous stromata, H. minicroceum is similar to
H. inconspicuum J.D. Rogers & Y.M. Ju, described originally from Costa Rica
(Ju et al. 2005), which differs in a number of features (smaller ascospores, dark
vinaceous KOH -extractable pigments and umbilicate ostioles).
Hypoxylon rolingii Lar.N. Vassiljeva & S.L. Stephenson, sp. nov. Fic. 6H
MycoBAnk MB 808389
Differs from Hypoxylon crocopeplum by its very thin stromata of a different color and the
KOH-extractable pigments.
TypE—USA, Texas, Big Thicket National Preserve, large palmetto area along Little Pine
Island Bayou, on dead branches, 8 Apr 2011, L. Vasilyeva (VLA P-2590).
EryMoLoGcy—after the volunteer Paul Roling, who provided assistance to researchers in
the Big Thicket National Preserve.
STROMATA effused-pulvinate, with conspicuous perithecial mounds, very thin
(about 0.15-0.2 mm); surface bay (6) or dark-vinaceous (82), with dark tissue
immediately beneath surface and among perithecia, with fresh KOH-extractable
pigments chestnut (40) or sepia (63), but umber (9) or cinnamon (62) after
the slides dry up. PERITHECIA spherical, 150-200 um diam., ostioles black and
very faintly papillate. Asci in the spore-bearing part 70-75 x 5-6 um, stalks
25-30 um long, with an apical ring bluing in Melzer’s iodine reagent, discoid,
0.5-0.7 um high, 1.5-2 um broad. Ascosporss light brown, unicellular,
ellipsoid, almost equilateral, 10-13.5 x 4-5 um, with a straight germ slit
extending the length of the spore; perispore indehiscent in 10% KOH.
ComMMENTS— The stromata are very thin but are somewhat reminiscent of
those in H. crocopeplum in having rather conspicuous perithecia mounds. In
many other respects (e.g., color of surface and KOH-extractable pigments,
indehiscent perispore), H. rolingii differs from H. crocopeplum.
Acknowledgments
We express our thanks to the personnel of the Big Thicket National Preserve, Buffalo
National River Park, Ouachita Mountains Biological Station, and the Ozark National
Science Center for providing an opportunity to collect at these localities. We also thank
Dr. Santiago Chacon (Instituto de Ecologia, México) and David Lewis (Newton, TX) for
serving as presubmission reviewers.
Literature cited
Ellis JB, Everhart BM. 1888. Synopsis of the North American species of Hypoxylon and Nummularia.
Journal of Mycology 4: 85-93. http://dx.doi.org/10.2307/3752760
Hypoxylon spp. nov. (U.S.A.) ... 95
Granmo A. 1999. Morphotaxonomy and chorology of the genus Hypoxylon (Xylariaceae) in
Norway. Sommerfeltia 26: 1-81.
Guzman-Davalos L. 2002. Tropical brown- and black-spored Mexican agarics with particular
reference to Gymnopilus. 61-71, in: R Watling et al. (eds). Tropical Mycology: Vol. 1.
Macromycetes. CABI Publishing, Wallingford.
Halling RE, Mueller GM. 2002. Agarics and boletes of Neotropical oakwoods. 1-10, in: R Watling
et al. (eds). Tropical Mycology: Vol. 1. Macromycetes. CABI Publishing, Wallingford.
Hsieh JM, Ju YM, Rogers JD. 2005. Molecular phylogeny of Hypoxylon and closely related genera.
Mycologia 97: 844-865. http://dx.doi.org/10.3852/mycologia.97.4.844
Ju YM, Rogers JD. 1996. A revision of the genus Hypoxylon. Mycologia Memoir 20: 1-365.
Ju YM, Rogers JD, Hsieh HM. 2004. New Hypoxylon species and notes on some names associated
with or related to Hypoxylon. Mycologia 96: 154-161. http://dx.doi.org/10.2307/3761997
Ju YM, Rogers JD, Hsieh HM. 2005. New Hypoxylon and Nemania species from Costa Rica and
Taiwan. Mycologia 97: 562-567. http://dx.doi.org/10.3852/mycologia.97.2.562
Lewis DP, Ovrebo CL. 2009. Mycological literature on Texas fleshy Basidiomycota, two new
combinations, and new fungal records for Texas. Journal of the Botanical Research Institute
of Texas 3: 257-271.
Lodge DJ, Baroni TJ, Cantrell SA. 2002. Basidiomycetes of the Greater Antilles project. 45-60, in:
R Watling et al. (eds). Tropical Mycology: Vol. 1. Macromycetes. CABI Publishing, Wallingford.
Miller JH. 1933. Some new species of Hypoxylon. Mycologia 25: 321-329.
http://dx.doi.org/10.2307/3754100
Miller JH. 1961. A monograph of the world species of Hypoxylon. University of Georgia Press,
Athens. 158 p.
Rogers JD, Ju YM, Candoussau F. 1996. Biscogniauxia anceps comb. nov. and Vivantia guadalupensis
gen. et sp. nov. Mycological Research 100: 669-674.
http://dx.doi.org/10.1016/S0953-7562(96)80196-1
Singer R, Ovrebo CL, Halling RE. 1990. New Species of Phylloporus and Tricholomopsis from
Colombia, with notes on Phylloporus boletinoides. Mycologia 82: 452-459.
http://dx.doi.org/10.2307/3760016
Torres-Torres MG, Guzman-Davalos L. 2008. Taxonomic status and new localities for Ganoderma
ravenelii. Mycotaxon 103: 33-40.
Tulloss RE, Lewis DP. 1994. Amanita westii - taxonomy and distribution. A rare species from states
bordering the Gulf of Mexico. Mycotaxon 50: 131-138.
Vasilyeva LN, Stephenson SL. 2010. Biogeographical patterns in pyrenomycetous fungi and their
taxonomy. 1. The Grayan disjunction. Mycotaxon 114: 281-303.
http://dx.doi.org/10.5248/114.281
Vasilyeva LN, Stephenson SL, Hyde KD, Bahkali AH. 2012. Some stromatic pyrenomycetous fungi
from northern Thailand - 1. Biscogniauxia, Camillea and Hypoxylon (Xylariaceae). Fungal
Diversity 55: 65-76. http://dx.doi.org/10.1007/s13225-011-0150-9
Whalley AJS, Taligoola HK. 1978. Species of Hypoxylon from Uganda. Transactions of the Botanical
Society of Edinburgh 42: 93-98. http://dx.doi.org/10.1080/03746607808685328
Wu QX, Mueller GM. 1997. Biogeographic relationships between the macrofungi of temperate
eastern Asia and eastern North America. Canadian Journal of Botany 75: 2108-2116.
http://dx.doi.org/10.1139/b97-922
Yang ZL, Li YC, Shi GQ, Zeng G. 2012. Trogia venenata (Agaricales), a novel poisonous species
which has caused hundreds of deaths in southwestern China. Mycological Progress 11:
937-945. http://dx.doi.org/10.1007/s11557-012-0809-y
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.97
Volume 129(1), pp. 97-108 July-September 2014
Rhizophagus natalensis,
a new species in the Glomeromycota
JANUSZ BLASZKOWSKI’ , GERARD CHWAT’,
ANNA GORALSKA’ & BRUNO T. GOTO?
‘Department of Ecology and Protection of Environment, West Pomeranian University of Technology
in Szczecin, Szczecin, Stowackiego 17, PL-71434 Szczecin, Poland
’Departamento de Botanica, Ecologia e Zoologia, CB, Universidade Federal do Rio Grande do Norte,
Campus Universitario, 59072-970, Natal, RN, Brazil
‘CORRESPONDENCE TO: janusz.
[email protected]
AsstRract — Morphological and histochemical studies of spores and phylogenetic analyses
of LSU and SSU nrDNA sequences have indicated that a fungal species found in maritime
dunes of the Parque Estadual das Dunas de Natal “Journalista Luiz Maria Alves” located
in Natal, Brazil, represents an undescribed species of Rhizophagus. The new species,
R. natalensis, forms spores singly or (sometimes) in loose clusters in soil. Its spores are pastel
yellow to light yellow and globose to subglobose [(75-)101(-133) um diam] or (rarely) ovoid
(50-70 x 63-79 um) and have one subtending hypha with a pore that is open or occluded by a
septum. Its spore wall comprises four layers: (1) a semi-permanent hyaline layer forming the
spore surface, (2) a permanent hyaline unit layer, (3) a laminate pastel yellow to light yellow
layer, and (4) a flexible hyaline layer. Layers 1 and 3 stain in Melzer’s reagent.
Key worps — arbuscular mycorrhizal fungi, molecular phylogeny, tropical ecosystem
Introduction
Arbuscular mycorrhizal fungi (AMF) of the phylum Glomeromycota live
in symbiosis with ca. 70-90% of land plants growing in different habitats
(Smith & Read 2008, Brundrett 2009). Sand dunes are especially favorable
sites for development of AMF, mainly due to the sparse populations of other
microorganisms competing for nutrients produced by living plants and the
rare occurrence of AMF microparasites (Blaszkowski 1994, Dalpé 1989, Koske
1987, Lee & Koske 1994, Tadych & Blaszkowski 2000). On the other hand, the
existence of plants growing in extremely poor and harsh dune sites may well
depend highly on the establishment of such symbioses, in that AMF frequently
increase the supply of nutrients to plants and decrease their sensitivity to
98 ... Blaszkowski & al.
different abiotic and biotic stresses (Bothe et al. 2010, Sch6nbeck 1978, Dehn &
Schiiepp 1989, Grifhoen & Ernst 1989, Smith & Read 2008).
The approximately 250 AMF species that have been described (Schiifler &
Walker 2010) probably represent less than 5% of world’s AMF species (Kriiger
et al. 2009). Of the described species ca. 62% produce glomoid spores, i.e.,
spores similar in mode of formation, spore wall structure, and subtending
hyphal characters to those of Glomus macrocarpum Tul. & C. Tul. (type species
of the genus Glomus; Clements & Shear 1931).
Glomoid spores are produced by AMF of the genus Rhizophagus P.A. Dang.
in the family Glomeraceae Piroz. & Dalpé (Redecker et al. 2013; Schiifler &
Walker 2010). Long after Dangeard (1896) described Rhizophagus, Gerdemann
& Trappe (1974) synonymized the genus with Glomus. Recently, however,
Schiifler & Walker (2010) resurrected Rhizophagus based on both the original
description of its type species, R. populinus P.A. Dang., stating that the fungus
produced spores abundantly inside roots, and the phylogenetic sequence
analyses of Rhizophagus and other AMF that tend to form intraradical spores.
We studied the morphological and histochemical characters of glomoid
spores extracted from a pot trap culture inoculated with rhizosphere soil and
root fragments of an unrecognized grass colonizing maritime sand dunes of the
Parque Estadual das Dunas de Natal “Journalista Luiz Maria Alves” located in
Natal, Brazil. Our research suggested that we had found an undescribed species
similar to R. fasciculatus (Thaxt.) C. Walker & A. Schiissler. Later phylogenies
inferred from analyses of sequences of the large (LSU) and small (SSU) subunit
genes support our original hypothesis that the two fungi represent different
species. The Brazilian fungus is described below as R. natalensis.
Materials & methods
Establishment and growth of trap and single-species cultures,
extraction of spores, and staining of mycorrhiza
Spores examined in this study derived from a pot trap culture. The trap culture was
established to obtain living spores and to initiate sporulation of specimens that may
not have sporulated in the field collections (Stutz & Morton 1996). Methods used to
establish the trap culture, growth conditions, and spore extraction follow Blaszkowski et
al. (2012). The growing substrate of the trap culture was the field-collected rhizosphere
soil and roots of the plant species sampled mixed with autoclaved coarse-grained sand
(1:1 v/v).
Eight single-species cultures were also established and grown as given in Blaszkowski
et al. (2012). The single cultures were set up with ca. 10 spores and small clusters of
spores (5-12) attached by a common mycelium. Unfortunately, all cultures failed.
Microscopy and nomenclature
Morphological features of spores and their wall structure were determined after
examining at least 100 spores mounted in water, lactic acid, polyvinyl alcohol/lactic
Rhizophagus natalensis sp. nov. (Poland) ... 99
acid/glycerol (PVLG; Omar et al. 1979), and a mixture of PVLG and Melzer’s reagent
(1:1, v/v). Glomerospores at all developmental stages were mounted in PVLG and
PVLG+Melzer’s reagent, then covered with a cover slip, crushed to varying degrees by
applying pressure to the cover slip, stored at 65°C for 24 h to clear their contents from oil
droplets, and examined under an Olympus BX 50 compound microscope equipped with
Nomarski differential interference contrast optics. Microphotographs were recorded on
a Sony 3CCD color video camera coupled to the microscope.
Spore structure terminology follows Stiirmer & Morton (1997) and Walker (1983).
Spore color was examined under a dissecting microscope on fresh specimens immersed
in water. Color names are from Kornerup & Wanscher (1983). Nomenclature of fungi
and the authors of fungal names are from Index Fungorum (http://www.indexfungorum.
org/AuthorsOfFungalNames.htm). Voucher specimens were mounted in PVLG and
a mixture of PVLG and Melzer’s reagent (1:1, v/v) on slides and deposited in the
Department of Ecology and Protection of Environment (DEPE), West Pomeranian
University of Technology in Szczecin, Szczecin, Poland, and in the herbarium at
Universidade Federal do Rio Grande do Norte (UFRN) in Natal, Rio Grande do Norte,
Brazil.
DNA extraction, polymerase chain reaction and DNA sequencing
Crude DNA was isolated from 3-8 single spores crushed with a needle in ultra
clean water on sterile microscope slides under a dissecting microscope. Amplification,
cloning, and sequencing procedures followed Btaszkowski et al. (2012). The large subunit
nrDNA gene (partial) of the fungus newly described here was amplified using the
primers LR1 (Tuinen et al. 1998) and FLR2 (Trouvelot et al. 1999) and then the primers
28G]1 and 28G2 (Silva et al. 2006), and SSU nrDNA gene (partial) was amplified with the
primers AML1 and AML2 (Lee et al. 2008) as described in Blaszkowski et al. (2012). The
segment spanning SSU (partial), internal transcribed region (ITS1, 5.8S and ITS2, full),
and LSU (partial) nrDNA of Septoglomus africanum (Blaszk. & Kovacs) Sieverd. et al.,
S. furcatum Blaszk. et al., S. fuscum Blaszk. et al., and S. xanthium (Blaszk. et al.) G.A.
Silva et al. were amplified using a nested procedure and the SsUmAf-LSUmAr primer
pair for the first nested PCR and the SSUmCf-LSUmBr primer pair for the second
nested PCR, as suggested by Kriiger et al. (2009). Representatives of sequences have
been deposited in GenBank (KJ210823-KJ210828).
Sequence alignment and phylogenetic analyses
The glomeromycotan origin of the sequences was initially tested by BLAST (Zhang
et al. 2000) search. To determine the generic affiliation of our new species we performed
pilot phylogenetic analyses separately with all LSU and SSU sequences and those
representing all recognized glomeromycotan genera with glomoid spores available
in GenBank and published by Kriiger et al. (2012). The results of the SSU sequence
analyses are not presented here. The final data set used to generate the LSU tree in Fic.
9 comprised six sequences from our new species, three sequences each from known
Rhizophagus spp. and one to three sequences, published or obtained by us, from 12
other species in the Glomeraceae. Sequences representing Claroideoglomus claroideum
(N.C. Schenck & G.S. Sm.) C. Walker & A. Schiissler served as outgroup in all analyses.
The LSU and SSU sequences were aligned with PRANK, with the ,, option invoked
100 ... Btaszkowski & al.
to fix already inferred indels at their place and avoid another indel being inferred in
an overlapping position during the second recursion of the algorithm (Léytynoja &
Goldman 2008). Overhanging sequence fragments of both termini were trimmed.
Bayesian (BI) analyses were performed with MrBayes 3.1 (Huelsenbeck & Ronquist
2001, Ronquist & Huelsenbeck 2003), and maximum likelihood (ML) analyses with
PHYML (Guindon & Gascuel 2003). Before the analyses the best-fit substitution models
for the alignments were estimated by the Akaike information criterion (AIC) using
TOPALI v. 2.5 (Milne et al. 2004). In the BI analyses of both LSU and SSU sequences
the model employed was GTR + G, and TrN + G was applied in the ML analyses of
both types of sequences. In the BI analyses the Markov chain was run for 5,000,000
generations, sampling in every 500 steps with a burn-in at 3000. In the ML analyses the
transition/transversion ratio for DNA models and the gamma distribution parameter
were estimated. Six substitution rate categories were set. Topology and branch lengths
and rate parameters were optimized. Support of branches in the ML analyses was
estimated in bootstrap analyses with 1000 replicates. The details of the analyses are
available on request. Phylogenetic trees were visualized and edited in MEGA5 (Tamura
et al. 2011).
Taxonomy
Rhizophagus natalensis Btaszk., Chwat & B.T. Goto, sp. nov. Fics 1-8
MycoBAank MB 808282
Differs from Rhizophagus irregularis in spore color and shape and the number and
phenotypic and histochemical characters of the spore wall layers.
Type: Brazil, Rio Grande do Norte, Natal, Parque Estadual das Dunas de Natal
“Journalista Luiz Maria Alves’, under an unrecognized grass colonizing maritime sand
dunes, 12 Sept. 2012, J. Blaszkowski 3381 (Holotype, DEPE; GenBank KJ210823), J.
Blaszkowski 3382-3384 (Isotypes, DEPE; GenBank KJ210824-KJ210828).
ErymMo_oey. Latin, natalensis, referring to the ‘Natal’ dunes from which the species was
collected.
SPOROCARPS unknown.
GLOMEROSPORES formed singly, sometimes in loose clusters, in soil;
developing blastically at the tip of sporogenous hyphae either directly from
mycorrhizal extraradical hyphae (single spores) or branched from a parent
hypha continuous with a mycorrhizal extraradical hypha (spores in clusters).
Clusters 160-989 x 180-1200 um with 2-14 spores. Spores pastel yellow (3A4)
to light yellow (3A5); globose to subglobose; (75-)101(-133) um diam; rarely
ovoid; 50-70 x 63-79 um; with one subtending hypha.
Fics. 1-8. Rhizophagus natalensis spores (differential interference microscopy). 1. Spores in loose
cluster. 2-5. Spore wall layers (swl) 1-4; note the unstained layer 4 in Fic. 4 and the swollen layer 1
in Fic. 5. 6. Spore wall layers (swl) 1-4 continuous with subtending hyphal wall layers (shwl) 1-4;
note shwl4 extending along the inner surface of shw]3. 7. Spore wall layers (swl) 1-4, of which layer
4 forms a curved septum (s) in the subtending hyphal (sh) lumen. 8. Subtending hyphal wall layers
(shwl) 1-3 continuous with spore wall layers 1-3; shwll and swll are not visible. Fics 1, 2, 6, 7, in
PVLG; Fics 3-5, 8, in PVLG+Melzer’s reagent.
Rhizophagus natalensis sp. nov. (Poland) ... 101
/
20 pm Attn 10 ym
102 ... Blaszkowski & al.
SPORE WALL consists of four layers: layer 1, forming the spore surface, semi-
permanent, hyaline, (1.0-)2.4(-5.3) um thick, slowly deteriorating with age,
usually present as a more or less decomposed structure even in older spores;
sometimes swelling and becoming up to 8.3 um thick; layer 2, a unit layer,
permanent, smooth, hyaline, (0.8-)1.1(-1.5) um thick; layer 3 laminate, smooth,
pastel yellow (3A4) to light yellow (3A5), (6.3-)8.7(-14.0) um thick, consisting
of laminae up to 0.8-1.0 um thick, frequently easily separating from each other
in crushed spores; and layer 4 flexible, smooth, hyaline, (0.8-)1.3(-2.0) um
thick, usually separating from the lower surface of layer 3 in crushed spores.
Layers 1 and 3 stain reddish white (9A2) to greyish red (10C5) and brownish
violet (11D8) to violet brown (11E8) in Melzer’s reagent, respectively.
SUBTENDING HYPHA pastel yellow (3A4) to light yellow (3A5); straight or
recurved, cylindrical to funnel-shaped, sometimes slightly constricted at the
spore base; (16.0-)20.8(-29.8) tum wide at the spore base. Wall of subtending
hypha pale pastel yellow (3A4) to light yellow (3A5); (7.3-)9.4(-14.3) um thick
at the spore base; continuous with spore wall layers 1-4. Pore (1.5-)2.4(-3.3)
um diam, open when spore wall layer 4 develops from subtending hyphal wall
layer 4 arising far below the spore base and extending along the inner surface of
subtending hyphal wall layer 3 or occluded by a curved septum continuous with
spore wall layer 4 and open or occluded from the reasons mentioned above and
gradually narrowing due to thickening of wall layer 3 of the subtending hypha
towards the centre of its lumen.
GERMINATION unknown.
MYCORRHIZAL ASSOCIATIONS — In the field R. natalensis was associated with
roots of an unrecognized plant species of Poaceae that colonized the Atlantic
Ocean sand dunes in the Parque Estadual das Dunas de Natal “Journalista
Luiz Maria Alves” (5°46’S, 35°12’W), one of the largest urban conservation
areas with dune vegetation in Brazil. In a trap culture inoculated with the
rhizosphere soil and root fragments of the plant, the fungus lived in symbiosis
with Plantago lanceolata and sporulated abundantly. However, R. natalensis
stopped producing spores after ca. two years of growing of this culture. All
attempts to establish single-species cultures from spores extracted from the
trap culture failed.
PHYLOGENETIC POSITION — In BI and NJ trees with LSU sequences the
R. natalensis clade obtained high values of statistical support and was sister to
Fic. 9. 50% majority rule consensus phylogram of AMF species inferred from a Bayesian analysis
of LSU nrDNA sequences of our new species and 33 other species, including Claroideoglomus
claroideum as outgroup. The new species is shown in boldface. The fungal names are followed by
GenBank accession numbers. The Bayesian posterior probabilities >0.50 and ML and NJ bootstrap
values =50% are shown near the branches, respectively. Bar indicates 0.5 expected change per site
per branch.
Rhizophagus natalensis sp. nov. (Poland)
0.98/100 reeptogiomus xanthium KF 154775
S. xanthium KF 154774
0.99/91 ILS. xanthium KF154772
S. fuscum KF060316
0.83/59 S. fuscum KF060314
4/100 Al S. fuscum KF060315
S. furcatum KFO60310
0.92/77| +S. furcatum KF060312
S. furcatum KFO60311
1/100] | |S. africanum KF060307
1/99 Rey S. africanum KF060306
0.55/5 NS S. africanum KF060304
os S. constrictum FJ461827
0.66/5 1S. constrictum JF439167
1/99 S. constrictum JF439176
1/96 S. deserticola JQ048859
4/99 S. deserticola JQ048857
S. deserticola JQ048925
ee S. viscosum KC182038
0.54/- S. vscosum KC182036
S. viscosum KC182037
1/99 Funneliformis caledonius FN547496
1/99 F. caledonius FN547499
F. caledonius FN547494
PASE F. coronatus FM876797
_|LF. coronatus FM876794
1/99-F| LF. coronatus FM876796
0.74/64 F. mosseae FN547476
F. mosseae FN547486
1/96 LF. mosseae FN547474
Glomus macrocarpum FR750526
1/10G G. macrocarpum FR750532
G. macrocarpum FR750535
Sclerocystis sinuosa FJ461846
0.97/99. Rhizophagus intraradices FM865577
R. intraradices FM865606
R. intraradices FM865559
R. clarus FM865538
R. clarus FM865541
0.58/100
1/9
11007 | «OLR. clarus FM865543
R. proliferus FM992390
0.99/8 R. proliferus FM992398
4/100 R. fasciculatus FR750071
Fig R. fasciculatus FR750072
R. fasciculatus FR750073
R. arabicus KF 154766
R. arabicus KF 154767
0.75/6 i R. proliferus FM992401
1/6 R. arabicus KF 154765
0.98/79 R. irregularis FR750112
naaie R. irregularis FM865550
R. irregularis FM992377
R. natalensis KJ210823 holotype
R. natalensis KJ210824
R. natalensis KJ210825
R. natalensis KJ210826
R. natalensis KJ210827
R. natalensis KJ210828
1/99
Claroideoglomus claroideum FR750058
| ee |
FkQ3
104 ... Blaszkowski & al.
a clade with R. irregularis (Blaszk. et al.) C. Walker & A. Schiissler (Fic. 9). In
BI and ML trees with SSU sequences R. natalensis was strongly supported as
monophyletic and sister to a clade comprising R. fasciculatus, R. intraradices
(N.C. Schenck & G.S. Sm.) C. Walker & A. Schissler, R. irregularis, and
R. vesiculiferus (Thaxt.) C. Walker & A. Schissler distributed into two subclades
(data not shown).
DISTRIBUTION & HABITAT — Spores of R. natalensis were found only
in one pot trap culture inoculated with a mixture of the rhizosphere soil
and root fragments of an unrecognized plant species of Poaceae growing in
maritime sand dunes of the Parque Estadual das Dunas de Natal “Journalista
Luiz Maria Alves” located in Natal, Brazil. Data on the climate, vegetation and
soil chemical properties of the dunes in which R. natalensis occurred were
described previously (Goto et al. 2012).
Spores of R. natalensis were not found in either ca. 3000 field-collected soils
and ca. 3000 pot trap cultures representing different regions of Europe, Africa,
Asia, Cuba, and the U.S.A. (Blaszkowski, pers. observ.).
However, BLAST queries indicated that the R. natalensis LSU sequences we
obtained were 99% similar to: (1) five LSU sequences (FR871319, FR871318,
FR871325, FR871323, FR871320) of AMF colonizing roots and rhizosphere
soils of Brachypodium retusum (Pers.) P. Beauv. and Bromus rubens L. growing
in semiarid degraded area located in the natural ecological park “Vicente
Blanes” in Molina de Segura, Province of Murcia, southern Spain (Torrecillas
et al. 2012); (2) an LSU sequence (EF066656) of an AMF coming from soil
collected under Medicago spp. cultivated in a Mediterranean fallow land located
at the Mas d’Imbert, France (Pivato et al. 2007); and (3) 55 SSU sequences of
uncultured AMF from, e.g., Spain (Alguacil et al. 2012; Torrecillas et al. 2012).
This suggests that R. natalensis has a wide world distribution.
Discussion
The distinguishing morphological and histochemical characters of R. natalensis
are its light yellow, relatively large spores with a four-layered spore wall, of which
layers 1 and 3 stain intensively in Melzer’s reagent. In addition, based on DNA
sequence analyses, the species is phylogenetically unique.
Our LSU sequence analyses indicate that R. natalensis is most closely
related to R. irregularis (see “Phylogenetic position” above and Fic. 9). Mature
R. irregularis spores are frequently hyaline (vs. no mature hyaline spores in
R. natalensis) and ovoid to oblong or irregular with deep local depressions
(Blaszkowski 2012; Blaszkowski et al. 2008; vs. usually globose to subglobose
without depressions). The spore wall of R. irregularis comprises three (vs. four)
layers, of which layer 1 frequently is highly thickened at the spore top and
forming a cap-like swell (vs. no such thickening), a laminate innermost layer
Rhizophagus natalensis sp. nov. (Poland) ... 105
(vs. a flexible innermost layer 4), and the only spore wall component (vs. layers
1 and 3) that stains in Melzer’s reagent. The subtending hypha of R. irregularis
spores is 0.6-2.5-fold narrower and has a 1.7-4.9-fold thinner wall at the spore
base and its pore may be open or closed by a septum, but the septum forms
some innermost laminae of the laminate spore wall layer 3 (vs. spore wall layer
4 in R. natalensis). In addition, R. irregularis tends to form spores in oblong
clusters inside roots and in soil, because the spores arise either terminally from
or intercalary inside sporogenous hyphae developing from spore wall layer
1 of an earlier fully differentiated parent spore or/and a branch of the parent
hypha continuous with a mycorrhizal extraradical hypha (Blaszkowski 2012;
Blaszkowski et al. 2008; vs. no such mode of spore formation in R. natalensis).
SSU sequence analyses also support a close relationship of R. natalensis with
R. fasciculatus, R. intraradices, and R. vesiculiferus (data not shown). Intact
R. natalensis spores observed under low and high microscope magnifications
are almost morphologically and histochemically identical to those of
R. fasciculatus. Both species form spores singly and in clusters and the spores are
similar in color and size and stain intensively in Melzer’s reagent (Blaszkowski
2012; Morton, http://invam.wvu.edu/). Examination of spores crushed in
PVLG and PVLG+Melzer’s reagent readily separates both species. The spore
wall of R. fasciculatus is 3-layered (lacking layer 2 of the 4-layered wall of
R. natalensis). Spore wall layer 1 of R. natalensis, forming the spore surface, is
semi-permanent (vs. permanent in R. fasciculatus), may be 2.0-2.9-fold thicker,
sometimes swells up to 8.3 um thick, thereby showing its plasticity (vs. no such
behaviour), and may stain more intensively in Melzer’s reagent (vs. reddish
white; Blaszkowski 2012). In addition, the laminae of the laminate structural
spore wall layer 3 of R. natalensis are ca. 2-fold thicker than those of the
laminate structural spore wall layer 2 of R. fasciculatus (<0.5 um thick) and the
R. natalensis laminae frequently separate from each other in crushed spores (vs.
usually remaining adherent in R. fasciculatus). Finally, the subtending hypha
of R. natalensis spores is less regular in shape (cylindrical to funnel-shaped vs.
cylindrical in R. fasciculatus), has a 5.2-6.5-fold thicker wall at the spore base,
and its pore may be open or occluded by a septum continuous with spore wall
layer 4 (vs. closed by a septum continuous with spore wall layer 3).
Freshly mature spores of R. intraradices usually are light yellow with a
greenish tint (Blaszkowski 2012, Morton http://invam.wvu.edu/, Stirmer &
Morton 1997) lacking in R. natalensis spores. The spore wall of R. intraradices
is 1.3-1.8-fold thinner, comprises only three (vs. four) layers of which only
the laminate layer 3 (vs. layers 2-4) is permanent, and only spore wall layer 1
(vs. layers 1 and 3) stains in Melzer’s reagent. In addition, the subtending hypha
of R. intraradices spores is less regular in shape (cylindrical to slightly flared vs.
cylindrical to funnel-shaped) and 1.2-1.6-fold narrower at the spore base; its
106 ... Btaszkowski & al.
wall is 1.8-2.2-fold thinner at the spore base and its pore is open (vs. open or
closed by a septum).
Rhizophagus vesiculiferus is most clearly separated from R. natalensis by
the formation of sporocarps with a peridium-like layer of thin-walled vesicles
(Berch & Fortin 1984, Gerdemann & Trappe 1974). In addition, R. vesiculiferus
spores are ca. 1.6-fold smaller, their spore wall is 2-layered (vs. 4-layered) and
2.2-2.9-fold thinner, and their subtending hypha is ca. 1.7-fold narrower with
an open pore (vs. open or occluded by a septum).
Acknowledgements
The authors acknowledge Dr. Fritz Oehl (Agroscope, Federal Research Institute for
Sustainability Sciences, Plant-Soil Interactions, Ziirich, Switzerland) and Dr. Gladstone
Alves da Silva (Departamento de Micologia, CCB, Universidade Federal de Pernambuco,
Av. Prof. Nelson Chaves s/n, Recife, PE, Brazil) for reviewing the manuscript and making
helpful suggestions. We also appreciate the corrections and suggestions by Dr. Shaun
Pennycook (Nomenclature Editor) and Dr. Lorelei Norvell (Editor-in-Chief). This study
was supported in part by Polish National Centre of Science, grants no. 05/B/NZ8/00498
and 07/N/NZ8/02363 and the Fundacao de Amparo a Ciéncia e Tecnologia do Estado
do Rio Grande do Norte (FAPERN-PPP) and CASADINHO UFRN/FIOCRUZ (Process
N® 552577/2011-1), which provided a financial support to J. Blaszkowski as “visiting
professor”.
Literature cited
Alguacil MM, Torrecillas E, Roldan A, Diaz G, Torres MP. 2012. Perennial plant species from
semiarid gypsum soils support higher AMF diversity in roots than the annual Bromus rubens.
Soil Biol. Biochem. 49: 132-138. http://dx.doi.org/10.1016/j.soilbio.2012.02.024
Berch SM, Fortin JA. 1984. Some sporocarpic Endogonaceae from eastern Canada. Can. J. Bot. 62:
170-180. http://dx.doi.org/10.1139/b84-029
Blaszkowski J. 1994. Arbuscular fungi and mycorrhizae (Glomales) of the Hel Peninsula, Poland.
Mycorrhiza 5: 71-88. http://dx.doi.org/10.1007/BF00204022
Blaszkowski J. 2012. Glomeromycota. W. Szafer Institute of Botany, Polish Academy of Sciences,
Krakow.
Blaszkowski J, Czerniawska B, Wubet T, Schafer T, Buscot F, Renker C. 2008. Glomus irregulare, a
new arbuscular mycorrhizal fungus in the Glomeromycota. Mycotaxon 106: 247-267.
Blaszkowski J, Kovacs GM, Gaspar BK, Balazs TK, Buscot FE, Ryszka P. 2012. The arbuscular
mycorrhizal Paraglomus majewskii sp. nov. represents a new distinct basal lineage in
Paraglomeraceae (Glomeromycota). Mycologia 104: 148-156. http://dx.doi.org/10.3852/10-430
Bothe H, Turnau K, Regvar M. 2010. The potential role of arbuscular mycorrhizal fungi in
protecting endangered plants and habitats. Mycorrhiza 20: 445-457.
http://dx.doi.org/10.1007/s00572-010-0332-4
Brundrett MC. 2009. Mycorrhizal associations and other means of nutrition of vascular plants:
understanding the global diversity of host plants by resolving conflicting information and
developing reliable means of diagnosis. Plant Soil 320: 37-77.
http://dx.doi.org/10.1007/s11104-008-9877-9
Clements FE, Shear CL. 1931. The genera of fungi. Hafner Publishing Co., New York, USA.
http://dx.doi.org/10.5962/bh1 title.54501
Rhizophagus natalensis sp. nov. (Poland) ... 107
Dalpé Y. 1989. Inventaire et repartition de la flore endomycorhizienne de dunes et de rivages
maritimes du Quebec, du Nouveau-Brunswick et de la Nouvelle-Ecosse. Naturaliste Canadien
116: 219-236.
Dangeard PA. 1896. Une maladie du peuplier dans louest de la France. Le Botaniste 5: 38-43.
Declerck S$, Cranenbrouck S, Dalpé Y, Séguin $, Grandmougin-Ferjani A, Fontaine J, Sancholle M.
2000. Glomus proliferum sp. nov.: a description based on morphological, biochemical, molecular
and monoxenic cultivation data. Mycologia 92: 1178-1187. http://dx.doi.org/10.2307/3761485
Dehn B, Schiiepp H. 1989. Influence of VA mycorrhizae on the uptake and distribution of heavy
metals in plants. Agric. Ecosys. Environm. 29: 79-83.
http://dx.doi.org/10.1016/0167-8809(90)90258-F
Gerdemann JW, Trappe JM. 1974. The Endogonaceae in the Pacific Northwest. Myc. Memoir 5:
1-76.
Goto BT, Jardim JG, Silva GA da, Furrazola E, Torres-Arias Y, Oehl FE. 2012. Glomus trufemii
(Glomeromycetes), a new sporocarpic species from Brazilian sand dunes. Mycotaxon 120: 1-9.
http://dx.doi.org/10.5248/120.1
Griffioen WA, Ernst WHO. 1989. The role of VA mycorrhiza in the heavy metal tolerance of
Agrostis capillaris L. Agric. Ecosys. Environm. 29: 173-177.
http://dx.doi.org/10.1016/0167-8809(90)90258-F
Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by
maximum likelihood. Syst. Biol. 52:696-704. http://dx.doi.org/10.1080%2F10635150390235520
Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:
754-755. http://dx.doi.org/10.1093/bioinformatics/17.8.754
Kornerup A, Wanscher JH. 1983. Methuen handbook of colour. 3rd ed. London: Eyre Methuen.
Koske RE. 1987. Distribution of VA mycorrhizal fungi along a latitudinal temperature gradient.
Mycologia 79: 55-68. http://dx.doi.org/10.2307/3807744
Kriger M, Stockinger H, Kriiger C, SchiSler A. 2009. DNA-based species level detection of
Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi. New Phytol. 183:
212-223. http://dx.doi.org/10.1111%2Fj.1469-8137.2009.02835.x
Kriger M, Kriiger C, Walker C, Stockinger H, Schiiéler A. 2012. Phylogenetic reference data for
systematics and phylotaxonomy of arbuscular mycorrhizal fungi from phylum to species level.
New Phytol. 193: 970-984. http://dx.doi.org/10.1111/j.1469-8137.2011.03962.x
Lee PJ, Koske RE. 1994. Gigaspora gigantea: parasitism of spores by fungi and actinomycetes.
Mycol. Res. 98: 458-466. http://dx.doi.org/10.1016/S0953-7562(09)81205-7
Lee J, LeeS, Young PW. 2008. Improved PCR primers for the detection and identification ofarbuscular
mycorrhizal fungi. FEMS Microbiol. Ecol. 65: 339-349. http://dx.doi.org/10.1111/j.1574-6941
Loytynoja A, Goldman N. 2008. An algorithm for progressive multiple alignment of sequences
with insertions. Proc. Natl. Acad. Sci. U.S.A. 102: 10557-10562.
http://dx.doi.org/10.1073/pnas.0409137102
Milne I, Wright F, Rowe G, Marshal DF, Husmeier D, McGuire G. 2004. TOPALi: Software for
automatic identification of recombinant sequences within DNA Multiple Alignments.
Bioinformatics 20: 1806-1807. http://dx.doi.org/10.1093/bioinformatics/bth155
Omar MB, Bollan L, Heather WA. 1979. A permanent mounting medium for fungi. Bull. Br. Mycol.
Soc. 13: 31-32. http://dx.doi.org/10.1016/S0007-1528(79)80038-3
Pivato B, Mazurier S, Lemanceau P, Siblot S, Berta G, Mougel C, Tuinen D van. 2007. Medicago
species affect the community composition of arbuscular mycorrhizal fungi associated with
roots. New Phytol. 176: 197-210. http://dx.doi.org/0.1111/j.1469-8137.2007.02151.x
Redecker D, SchiiBler A, Stockinger H, Stiirmer SL, Morton JB, Walker C. 2013. An evidence-based
consensus for the classification of arbuscular mycorrhizal fungi (Glomeromycota). Mycorrhiza:
published online. http://dx.doi.org/10.1007/s00572-013-0486-y
108 ... Btaszkowski & al.
Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Schonbeck F. 1978. Einfluss der endotrophen Mykorrhiza auf die Krankheitsresistenz hoherer
Pflanzen. Z. PflKrankh. PflSchutz. 85: 191-196.
Schiifler A, Walker C. 2010. The Glomeromycota. A species list with new families and new genera.
Schiifler A., Walker C. Gloucester, Published in libraries at Royal Botanic Garden Edinburgh,
Kew, Botanische Staatssammlung Munich, and Oregon State University.
http://dx.doi.org/10.5248/116.75
Silva GA da, Lumini E, Maia LC, Bonfante P, Bianciotto V. 2006. Phylogenetic analysis of
Glomeromycota by partial LSU rDNA sequences. Mycorrhiza 16: 183-189.
http://dx.doi.org/10.1007/s00572-005-0030-9
Smith SE, Read DJ. 2008. Mycorrhizal symbiosis. 3rd ed. San Diego: Academic Press.
Stiirmer SL, Morton JB. 1997. Developmental patterns defining morphological characters in spores
of four species in Glomus. Mycologia 89: 72-81. http://dx.doi.org/10.5248/116.75
Stutz JC, Morton JB. 1996. Successive pot cultures reveal high species richness of arbuscular
mycorrhizal fungi in arid ecosystems. Can. J. Bot. 74: 1883-1889.
http://dx.doi.org/10.5248/116.75
Tadych M, Blaszkowski J. 2000. Arbuscular fungi and mycorrhizae (Glomales) of the Stowinski
National Park, Poland. Mycotaxon 74: 463-483.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS: molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and
maximum parsimony methods. Mol. Biol. Evol. 28: 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
Torrecillas E, Alguacil MM, Roldan A. 2012. Differences in the AMF diversity
in soil and roots between two annual and perennial gramineous plants co-
occurring in a Mediterranean, semiarid degraded area. Plant Soil 354: 97-106.
http://dx.doi.org/10.1007/s11104-011-1047-9
Trouvelot S, Tuinen D van, Hijri M, Gianinazzi-Pearson V. 1999. Visualization of ribosomal
DNA loci in spore interphasic nuclei of glomalean fungi by fluorescence in situ hybridization.
Mycorrhiza 8: 203-206. http://dx.doi.org/10.1007/s005720050235
Tuinen D van, Zhao B, Gianinazzi-Pearson V. 1998. PCR in studies of AM fungi: from primers to
application. 387-400, in: AK Varma (ed.). Mycorrhizal manual. Springer, Berlin Heidelberg
New York.
Walker C. 1983. Taxonomic concepts in the Endogonaceae: spore wall characteristics in species
descriptions. Mycotaxon 18: 443-455.
Zhang Z, Schwartz S, Wagner L, Miller W. 2000. A greedy algorithm for aligning DNA sequences.
J. Comput. Biol. 7: 203-14. http://dx.doi.org/10.1089/10665270050081478
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.109
Volume 129(1), pp. 109-118 July-September 2014
A new species of Nawawia from Malaysia,
with a synopsis of the genus
TEIK-KHIANG GOHn”*, WaI-Y1P LAU, & KAH-CHENG TEO
Centre for Biodiversity Research, Faculty of Science, Universiti Tunku Abdul Rahman,
Bandar Barat, 31900 Kampar, Perak, Malaysia
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Nawawia quadrisetulata sp. nov., collected from submerged wood in Malaysia,
is described and illustrated. It differs from other Nawawia species in having conidia with
4(-5) distal setulae. A synopsis of species in the genus is provided.
KEY worps — dematiaceous hyphomycete, lignicolous fungi, mitosporic fungi, saprotroph,
taxonomy
Introduction
The anamorphic genus Nawawia was introduced by Marvanova (1980)
based on Clavatospora filiformis Nawawi (Nawawi 1973), a hyphomycete found
on submerged decaying twigs and petioles. The genus is characterized by having
conidiophores that are dematiaceous, thick-walled, septate, percurrently
proliferating, and bearing a terminal phialide with distinct collarette and
producing unicellular hyaline conidia that are turbinate-tetrahedral to
obpyramidal in shape, with their blunt corners at the distal end each provided
with a distinct hair-like appendage. ‘There are five reported species of Nawawia
(Index Fungorum 2014): three from Malaysia (Crous et al. 2009, Kuthubutheen
et al. 1992, Nawawi 1973), one from South Africa (Hyde et al. 1996), and one
from Russia (Mel'nik & Hyde 2006). Hyde et al. (1996) described N. dendroidea,
a synnematous species, and compared it with Chalarodes McKenzie and
Phialosporostilbe Mercado & J. Mena. A sporodochial species occurring on
leaves, N. malaysiana, was described by Crous et al. (2009).
During a survey of fungal diversity from submerged wood in Malaysia,
we found an undescribed species of Nawawia, which is proposed here as
110 ... Goh, Lau, & Teo
N. quadrisetulata sp. nov. Its holotype is conserved at the herbarium of the
Centre for Biodiversity Research, Faculty of Science, Universiti Tunku Abdul
Rahman (Perak campus), Kampar, Malaysia (UTAR). The ultrastructural
features of the conidia were studied under the scanning electron microscope
(FESEM, Model: JSM-6701F, JEOL, Japan). A synopsis of the six species in the
genus is provided.
Taxonomy
Nawawia quadrisetulata Goh, W.-Y. Lau & K.C. Teo, sp. nov. Figs 1-35
MycoBank MB807053
Differs from other species of Nawawia in having conidia with 4(-5) distal setulae but
no basal setula.
Type: Malaysia. Perak, Menglembu, Bukit Kledang, on submerged wood, 10 November
2013, Wai-Yip Lau (Holotype, UTAR(M)-0004).
Erymo oey: quadrisetulata, refers to the conidium that usually bears four setulae.
Co.onigs on the natural substratum effuse, hairy, dark brown, with glistening
mass of conidia at the tip of conidiophores. Mycelium partly immersed and
partly superficial, composed of pale brown, septate hyphae 2-3 um wide.
Stroma absent or meager (<40 um wide). CoNIDIOPHORES cylindrical to
slightly clavate, single or in small groups, erect, straight, unbranched, thick-
walled, smooth, medium to dark brown, becoming paler towards the apex,
often proliferating percurrently, 3—7 septate, 50-280 um long, 5-8.5 um
wide. CONIDIOGENOUS CELLS integrated, terminal, phialidic, medium brown,
smooth, cylindric-clavate 17-50 um long, 6.5—-10 um wide at the widest part;
collarettes proliferating without progression. Conip1a hyaline, aseptate,
smooth, thin-walled, 4(—5)-setulate, guttulate, obpyramidal, viewed from side
turbinate-triangular, with 4(-5) blunt protruding edges at the broader distal
end, viewed from above 4-lobed or cruciform with blunt protruding corners
(bearing four setulae, one at each corner) and sometimes 5-lobed or stellate
(bearing five setulae, one at each protruding corner), 30—-37.5 um long and
22.5—32.5 um wide, base obconically truncate, with a depressed hilum 5—7.5
um wide; setulae stiff, hyaline, 30—57.5 um long, ca. 0.5 um wide.
CoMMENTS— ‘The conidia of this species bear 4—5 setulae at the distal end,
and thus they are unique in shape. At least 100 conidia of this species were
examined; the majority (93%) had 4 setulae and a few (7%) had 5 setulae. We
have attempted unsuccessfully to grow this species in culture, using single-spore
isolation method described by Goh (1999). Isolated conidia were inoculated
to water agar, malt extract agar, cornmeal agar, and oatmeal agar, but none
germinated.
Nawawia quadrisetulata sp. nov. (Malaysia) ... 111
2
1 *12 13
Figs 1-13. Nawawia quadrisetulata (holotype). 1. Colonies on natural substratum.
2, 3. Conidiophores. 4. Conidia under bright-field microscopy. 5, 6. Conidia under differential
interference contrast (DIC) microscopy. 7. Conidiophore percurrent proliferation (arrowed).
8-13. Conidiogenous cell showing sequential development of conidia. Scale bars: 1 = 100 um;
2, 3,5 = 50 wm; 4, 6-13 = 20 um.
A synopsis of the six species is presented in TABLE 1. Four of the previously
described species (Nawawia dendroidea K.D. Hyde et al., N. filiformis (Nawawi)
112 ... Goh, Lau, & Teo
Fics 14-19. Nawawia quadrisetulata (holotype): conidia under DIC microscopy. 14. Quadrisetulate
conidia. 15. Side-view of a conidium. 16. A conidium with a yellowish mass of oil in the cell.
17. A quadrisetulate conidium. 18. A conidium with 5 setulae; arrow points to the basal hilum
of another conidium in the vicinity. 19. Conidia, with one conidium showing the basal hilum
(arrowed). Scale bars = 20 um.
Marvanova, N. nitida Kuthub. et al., and N. sasae-kurilensis Melnik & K.D.
Hyde) have tetrahedral to obpyramidal conidia with 3 distal setulae (Hyde et
Nawawia quadrisetulata sp. nov. (Malaysia) ... 113
Fics 20-22. Nawawia quadrisetulata (holotype): SEM. 20. Colonies on surface of the natural
substratum. 21. Conidiophores and conidia on natural substratum. 22. Phialide and percurrent
proliferation (arrowed). Scale bars: 20 = 50 um; 21, 22 = 20 um.
al. 1996; Kuthubutheen et al. 1992; Marvanova 1980; Mel'nik & Hyde 2006).
Conidia of N. malaysiana Crous & S.S. Lee are 5-lobed and bear 4 distal setulae
114 ... Goh, Lau, & Teo
Fics 23-26. Nawawia quadrisetulata (holotype): SEM. 23. Conidia produced from conidiophores.
Arrow points to a conidium with 5 setulae. 24, 25. Quadrisetulate conidia produced at the apex
of conidiophores. 26. Conidiophores showing the terminal phialides. Scale bars: 23-25 = 20 um;
26 =5 um.
plus a basal setula (Crous et al. 2009), whereas N. quadrisetulata conidia lack
a basal setula. Moreover, N. malaysiana differs from the other five species in
being sporodochial, producing conidia that are distinctly smaller and fusoid
to ellipsoid in side-view, and it was isolated from the apex of a conidiomatal
Nawawia quadrisetulata sp. nov. (Malaysia) ... 115
Fics 27-30. Nawawia quadrisetulata (holotype): SEM. 27. Conidium with the corners yet to form
the setulae. 28. Conidia; arrow points to one that have 5 setulae. 29. Conidium attached to the apex
of conidiophore. 30. A 5-setulate conidium (arrowed) at the opening of phialide. Scale bars =
5 um.
spore mass of a foliicolous Satchmopsis species. Compared with the other five
Nawawia species, N. malaysiana is atypical and its taxonomic placement in the
genus is doubtful.
Under the scanning electron microscope (SEM), the conidial hilum of
N. quadrisetulata is depressed and has a distinct rim, suggesting that the
116 ... Goh, Lau, & Teo
Figs 31-35. Nawawia quadrisetulata (holotype): SEM. 31. Conidia; arrow points to position
of hilum. 32. Phialide of conidiophore. 33, 34. Conidia showing the basal hilum (arrowed).
35. Conidial hilum. Scale bars: 31 = 20 um; 32-34 = 10 um; 35 = 5 um.
conidial secession is rhexolytic, whereas the conidial hilum in N. dendroidea
appeared to be flush with the obconically truncate base (Hyde et al. 1996),
suggesting a schizolytic conidial secession. In the other four Nawawia spp.,
hilum morphology was neither reported in detail nor studied under the SEM.
Among the six Nawawia species, only N. nitida has conidiogenous cells that
are doliiform and with distinctly flared collarettes similar to those found in
117
Nawawia quadrisetulata sp. nov. (Malaysia) ...
TABLE I. Synopsis of Nawawia species
SPECIES
N. dendroidea
N. filiformis
N. malaysiana
N. nitida
N. quadrisetulata
N. sasae-kurilensis
* MEA = malt extract agar; OMA = oatmeal agar
CONIDIOPHORES
Synnematous;
350-800 x
3-6 Um
Solitary;
70-315 x
4-8 um
Sporodochial;
10-40 x
3-4 Um
Solitary, short,
bearing doliiform
phialides;
25-75 x
10-12 um
Solitary or
fasciculate;
50-280 x
5.5-10 um
Solitary,
160-240 x
5-10 um
CONIDIA
Round-tetrahedral or obpyramidal;
mostly with 3 apical setulae
(4-8 tm long);
10-12 x 8-10 um
Turbinate to triangular; mostly with
3 apical setulae (15-34 tm long);
13-18 x 14-18 Um; with a Chloridium
synanamorph in culture
5-lobed; with 4 apical & 1
basal setulae (3—9 tm long);
4—6 x 4-6 um
Round-tetrahedral or obpyramidal;
with 3 apical setulae
(38-74 um long);
29-35 x 20-26 um
4—5-lobed; mostly with 4
apical setulae (30—57.5 [um long);
30-37.5 x 22.5-32.5 um
Round-tetrahedral; with 3
apical setulae (4—6 um long);
10-14 x 8-11.5 um
IN VITRO
CULTURE
Attempts
unsuccessful
Growth on
MEA’
Growth on
MEA and
OMA’
Attempts
unsuccessful
Attempts
unsuccessful
Not reported
SUBSTRATUM
Submerged wood
Submerged petioles
and twigs
Associated with
Satchmopsis sp, on
Eucalyptus leaf
Submerged twigs
Submerged wood
Dead culm of
Sasa kurilensis
(Russian bamboo)
ORIGINAL
LOCALITY
Australia
Malaysia
Malaysia
Malaysia
Malaysia
Russia
REFERENCE
Hyde et al. 1996
Nawawi 1973,
Marvanova 1980
Crous et al. 2009
Kuthubutheen
et al. 1992
This paper
Me?nik & Hyde
2006
118 ... Goh, Lau, & Teo
species of Obeliospora Nawawi & Kuthub. (Nawawi & Kuthubutheen 1990).
A Chloridium synanamorph (producing ellipsoid, non-setulate spores) was
reported in cultures of N. filiformis (Nawawi 1973, Wu & McKenzie 2003), but
synanamorphs are not known in the other five Nawawia species.
Acknowledgements
The authors are grateful to the Universiti Tunku Abdul Rahman (UTAR) for
financial support (IPSR/RMC/UTARRF/2012-C2/G04) to study the diversity of fungi in
Malaysia. We would like to thank the two peer reviewers of this paper, Dr. R.E Castaneda
Ruiz (Instituto de Investigaciones Fundamentales en Agricultura Tropical (INIFAT),
Cuba) and Dr. Clement K.M. Tsui (Department of Forest Sciences, University of British
Columbia, Canada) for their valuable comments on the manuscript. Mr. Ooh Keng Fei
(Faculty of Science, UTAR—Perak Campus) is thanked for his technical assistance in
the scanning electron microscopy. Thanks are extended to Miss Loh Bao Yee in the
faculty for her technical assistance in photographing the fungi.
Literature cited
Crous PW, Groenewald JZ, Lee SS. 2009. Nawawia malaysiana. Fungal Planet 41, Persoonia
23: 194-195.
Goh TK. 1999. Single-spore isolation using a hand-made glass needle. Fungal Diversity 2: 47-63.
Hyde KD, Goh TK, Steinke T. 1996. Nawawia dendroidea, a new synnematous hyphomycete
from submerged Phragmites in South Africa. Mycological Research 100: 810-814.
http://dx.doi.org/10.1016/S0953-7562(96)80026-8
Index Fungorum. 2014. http://www.indexfungorum.org/names/Names.asp (Accessed 23 Sep.
2014).
Kuthubutheen AJ, Liew GM, Nawawi A. 1992. Nawawia nitida sp. nov. (hyphomycetes) and
further records of Nawawia filiformis from Malaysia. Canadian Journal of Botany 70: 96-100.
http://dx.doi.org/10.1139/b92-013
Marvanova L. 1980. New or noteworthy aquatic hyphomycetes: Clavatospora, Heliscella, Nawawia
and Heliscina. Transactions of the British Mycological Society 75: 221-231.
http://dx.doi.org/10.1016/S0007-1536(80)80083-0
Mel'nik VA, Hyde KD. 2006. Nawawia sasae-kurilensis sp. nov. from the Russian Far East.
Mikologiya i Fitopatologiya 40: 411-414.
Nawawi A. 1973. Clavatospora filiformis sp. nov., an aquatic hyphomycete from Malaysia.
Transactions of the British Mycological Society 61: 390-393.
http://dx.doi.org/10.1016/S0007-1536(73)80163-9
Nawawi A, Kuthubutheen AJ. 1990. Obeliospora, a new genus of setose, phialosporus hyphomycetes
with appendaged conidia. Mycotaxon 37:395-400.
Wu WP, McKenzie EHC. 2003. Obeliospora minima sp. nov. and four other hyphomycetes with
conidia bearing appendages. Fungal Diversity 12: 223-234.
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.119
Volume 129(1), pp. 119-148 July-September 2014
The Entolomataceae of the Pakaraima Mountains of Guyana 6:
ten new species and a new combination in Nolanea
TERRY W. HENKEL*!, M. CATHERINE AIME?’,
DavIip L. LARGENT’, & TIMOTHY J. BARONI?
‘Department of Biological Sciences, Humboldt State University, Arcata, California, USA. 95521
*Department of Botany & Plant Pathology, Purdue University,
West Lafayette, Indiana, USA. 47907
’Department of Biological Sciences, State University of New York—College at Cortland,
New York, USA. 13045
*CORRESPONDENCE TO:
[email protected]
AxsstRact — Eleven Nolanea species are described from Guyanese collections. The
West African N. acuta comb. nov. is reported for the first time from the Neotropics, and
N. alboproxima, N. applanata, N. clavata, N. claviformis, N. concentrica, N. furcata, N. mimiae,
N. rava, N. sinuolata, and N. subsulcata are new to science. All of these species occur in
tropical rainforests, either in Upper Potaro River Basin in Guyanas Pakaraima Mountains
or in the interior lowlands, and are presumed forest litter saprotrophs. Macromorphological,
micromorphological, and habitat data and comparisons with similar taxa are provided for
each. The genus Nolanea has not been previously reported from Guyana.
Key worps — Agaricales, Agaricomycetes, Guayana Highlands, Guiana Shield, saprotrophic
fungi
Introduction
Species in the cosmopolitan genus Nolanea (Fr.) P. Kumm. are easily
recognized as members of the Entolomataceae (Agaricales) due to their pink-
pigmented basidiospores that are angular in all views. Fries (1821) erected
Agaricus “tribus” Nolanea for pink-spored agarics with a mycenoid stature,
and his concept, with refinements based primarily in micromorphological
characters, has been accepted by many later agaricologists at either generic (e.g.
Largent 1994; Largent & Baroni 1988; Dennis 1953, 1970; Pegler 1983, 1997) or
subgeneric (Noordeloos 1980, 1992, 2004) rank.
Here we apply the generic concept of Nolanea sensu Largent (1994)
diagnosed by mycenoid or collybioid (rarely tricholomatoid) basidioma stature;
120 ... Henkel & al.
typically glabrous (rarely innately appressed fibrillose) pileus; the pileipellis
typically a cutis with 1-4 uninflated hyphal layers overlying the more inflated
hyphae of the outer pileal trama; long-celled hyphal elements typically present
in the pileal, lamellar, and stipe tramas; lipoid globules, brilliant granules, and
pseudocystidia absent; clamp connections typically absent (occasionally rare
or very scarce in the pileipellis); and a +5 urea concentration. Morphologically
similar Inocephalus species can be most readily distinguished from Nolanea by
a pileipellis that intergrades imperceptibly into the pileal trama, a 0 or 0.5 urea
concentration, and (for most Inocephalus species) the combination of abundant
lipoid bodies in the tramal hyphae, pseudocystidia in the hymenium, clamp
connections in the pileipellis, and a distinctly fibrillose or squamulose pileus
(Largent 1994).
The few molecular systematics studies published on Entolomataceae have
proved rather equivocal regarding the status of Nolanea at the generic or
subgeneric levels (e.g., Co-David et al. 2009; Baroni & Matheny 2011; He et
al. 2013). Other preliminary molecular data support entolomatoid fungi with
Nolaneas morphological diagnostic characters as a genus (Bergemann &
Largent unpubl.). Given the current lack of clear, molecular-based resolution
of genera within the Entolomataceae, we have used morphology to distinguish
and describe the new taxa presented here.
New World tropical and subtropical entolomatoid species meeting the
diagnostic requirements of Nolanea sensu Largent (1994) have been found
in the Lesser and Greater Antilles (Murrill 1911; Pegler 1983), Trinidad and
Venezuela (Dennis 1953, 1970), Brazil (Pegler 1997), and elsewhere in South
America (Horak 1977).
We report here eleven Nolanea species for the first time from Guyana.
One, Nolanea acuta comb. nov., was previously known from Gabon in West
Africa; the other ten species are described as new to science: N. alboproxima,
N. applanata, N. clavata, N. claviformis, N. concentrica, N. furcata, N. mimiae,
N. rava, N. sinuolata, and N. subsulcata.
Materials & methods
Specimens were collected from the Upper Potaro River Basin during the May-
August rainy seasons of 2000, 2003, 2005, 2007, 2009, 2010, and 2011 and the December
rainy seasons of 2004 and 2009. The collecting area is located within a 15 km radius
of a permanent base camp at 5°18’04.8’N 59°54’40.4’W, elevation 710-750 m, in
an undulating valley approximately 15 km east of Mt. Ayanganna (2200 m) and is
densely forested with a mosaic of primary Dicymbe-dominated and mixed forests of
the Eschweilera—Licania association (Henkel 2003). Additional collections were made
during the May-June 2011 rainy season from Guyanas Upper Demerara River Basin
at Mabura Ecological Reserve within 2 km of a field station located at 5°09’19.0’N
58°41'58.9’W, elevation 100 m, in monodominant stands of Dicymbe altsonii.
Nolanea spp. nov. (Guyana) ... 121
Methods for field descriptions, microscopic analyses, and image capture follow
Largent et al. (2008). The formula for Amman’ solution is cited in Largent et al. (1977).
Fungi were field-dried with silica gel. Color designations follow Kornerup & Wanscher
(1978) with color plates noted in parentheses (e.g., 447). Specimens were deposited
in the following herbaria: BRG, HSU, and PUL (Holmgren et al. 1990). Microscopic
structures were measured as previously described (Largent 1994; Largent et al. 2008).
Statistics determined include means of basidiospore length and width + standard
deviations; E = quotient of length by width indicated as a range variation in n objects
measured; Q = the mean of E-values; n = number of objects measured.
Taxonomy
Nolanea acuta (Romagn. & Gilles) Largent, comb. nov. PLATE 1
MycoBank MB 519978
= Rhodophyllus acutus Romagn. & Gilles, Beih. zur Nova Hedwigia 59: 542 (1979)
PiLEus 21-32 mm broad, broadly convex with acute umbo; umbo and part
of surrounding disc dark yellowish brown (5F8) because of appressed radial
fibrils, background color lighter, maturing overall to light blond (4C3), non-
hygrophanous; margin slightly inturned, somewhat rimose-frayed, not striate
or translucent-striate. LAMELLAE subclose, subthick, very finely adnexed,
becoming pinkish from spores (6B4); lamellulae 3 between lamellae, in 2 tiers.
STIPE 70-85 x 3 mm wide at apex, 6 mm at base, tapered upward, whitish with
appressed brown longitudinal fibrils. BAsaL MYCELIUM scant, white, appressed
felty. STIPE CONTEXT white, stuffed. Opor and TASTE none.
BasiprospoREs distinctly 5-7-angled in profile, dorsal and ventral views,
heterodiametric in all views, 7.8-11.3 x 5.2-7.5 um (mean = 9.7 + 0.83 x 6.7 + 0.59
um; E = 1.3-1.8, Q = 1.43 + 0.09; n = 30); hilar appendage distinct. BastpIa
clavate, slightly to strongly tapered at the base, 27.7-33.1 x 7-10 um (mean =
30.2 + 1.8 x 8.6 + 0.88 um; E = 3.0-4.4, Q = 3.53 + 0.30; n = 11), 4-sterigmate.
CHEILOCYSTIDIA AND PLEUROCYSTIDIA absent. LAMELLAR TRAMA of long-
celled, parallel to subparallel hyphae (not measured). PILEIPELLIS a cutis of
uninflated hyphae that are 3.2-10.7 um wide and rarely uplifted; TERMINAL
CELLS cylindric to cylindro-clavate, 33.6-73.8 um long. PILEUS TRAMA
HYPHAE inflated beneath the pileipellis, 5-20 um wide, elsewhere 5-40 um
wide. STIPITIPELLIS a cutis; hymenial clusters and caulocystidia absent.
PIGMENTATION uniform, light to medium brown in the cytoplasm of the
pileipellis; incrusted hyphae absent. REFRACTIVE HYPHAE abundant in the
pileus trama. CLAMP CONNECTIONS absent. MICROCHEMICAL REACTIONS in
Amman solution: hymenial elements strongly cyanophilic.
ECOLOGY, RANGE, DISTRIBUTION — Scattered on soil in Dicymbe corymbosa
forest in the Upper Potaro River Basin of Guyana; originally described from
Gabon.
122 ... Henkel & al.
-
- v o. 8
- . :
“ “ a
iS A “« , a - o
; 4 “3 —* ,
PLaTE 1. Nolanea acuta (Aime 1314). A. Basidia. B. Basidiospores. C. Pileipellis. Bars = 10 um.
SPECIMEN EXAMINED. GUYANA. REGION 8: POTARO-SIPARUNI. Pakaraima Mountains.
Upper Potaro River Basin, ~15 km east of Mt. Ayanganna, environs of base camp
located on Potaro River one km upstream from confluence with Whitewater Creek at
5°18'04.8’N 59°54’40.4’W, elevation 710-750 m; vicinity of base camp, on soil, 21 June
2000, Aime 1314 (BRG; PUL).
ComMEnts — Nolanea acuta is distinguished by its combination of relatively
large basidiomata, a dark yellowish brown acutely umbonate pileus, clavate
stipe with brownish longitudinal fibrils on a whitish ground, heterodiametric
basidiospores averaging 9.7 x 6.7 um (Q = 1.4), cytoplasmic pigmentation,
and lack of hymenial cystidia. Rhodophyllus acutus from Gabon (Romagnesi &
Gilles 1979) is morphologically identical to Guyanese N. acuta, justifying the
new combination. The discovery of N. acuta in Guyana constitutes a significant
intercontinental range extension for the species.
Nolanea spp. nov. (Guyana) ... 123
Nolanea acuta is similar to N. solstitialis (Fr.) BD. Orton [= Entoloma
solstitiale (Fr.) Noordel.] in pileus and stipe size, shape, and colors, basidiospore
shape and size, and lack of cheilocystidia, but N. solstitialis can be distinguished
by its translucent-striate hygrophanous pileus and smooth glabrous stipe
(Noordeloos 1980, 1992, 2004).
Because of its basidioma colors, acutely umbonate pileus, and lack of
cheilocystidia, Nolanea acuta resembles members of a species complex centered
around N. papillata Bres., including N. pseudopapillata Pegler [= N. papillata
sensu Dennis. non Bresadola], N. mammifer (Romagn.) Pegler [= Rhodophyllus
mammifer Romagn.], and N. apiculata Petch [= Entoloma acuminatum E. Horak].
All these species differ from N. acuta primarily by their externally encrusting
pileipellis pigments (Dennis 1970; Horak 1980; Pegler 1983).
Nolanea alboproxima Largent, Aime & T.W. Henkel, sp. nov. PLATE 2
MycosBank MB 519972
Differs from Nolanea proxima by its whitish overall coloration, heterodiametric
basidiospores and lack of incrusting pigment in the pileus tramal hyphae.
Type: Guyana. Region 8: Potaro-Siparuni. Pakaraima Mountains. Upper Potaro River
Basin, ~20 km east of Mt. Ayanganna, Tadang Base Camp 2 km south of Potaro River
at 5°16’14.5”N 59°50’39.1”W, elevation 710-750 m; vicinity of base camp, 21 December
2009, Henkel 9116 (BRG, holotype; HSU, isotype).
Erymo oey: albus (L. adj.) = white; referring to the whitish pileus color that differentiates
N. alboproxima from N. proxima.
PILEus 6-16.5 mm broad, 3-4.5 mm high, broadly convex to plano-convex to
plane, somewhat flattened across apex and subumbilicate, glabrous, translucent
striate from disc to margin, overall pale orangish white (4A2-4A3) to greyish
orange (4B4-4B5) with age, moist; disc hygrophanous with medium grey cast;
margin irregularly crenulate. LAMELLAE subclose, subthin, adnexed to barely
adnate, 3-5 mm long, 0.5-2.0 mm tall, off-white at first (4A1-4A2), developing
slight pinkish overtones (~5A3) with age; margins concolorous, nearly smooth
under hand lens; lamellulae consistently 3 between lamellae, 0.5-2 mm long,
in 2 tiers. STIPE 25-53 x 1-2 mm at apex, 2-4 mm at base, tapering upward,
translucent, off-white (4A1-4A2) to pale light yellow (4A4), slightly yellowing
(3A3-3A4) where handled, glabrous, hollow. BasAL MYCELIUM scant, white,
and hispid at extreme base. ODOR none; TASTE not noted.
BasIpIosPorEs distinctly 5-6(-7)-angled and heterodiametric in profile
view, 7.7-10.8 x 5.3-7.8 um (mean = 9.3 + 0.7 x 6.8 + 0.57 um; E = 1.2-1.7,
Q = 1.38; n = 58). Basip1A clavate and tapering to a long, slender base, 30.0-
42.8 x 7.1-13.1 um (mean = 35.0 + 4.0 x 9.3 + 1.5 um; E = 2.3-5.2, Q = 3.9 +
0.86; n = 24), 2-4-sterigmate, abundant on the lamella edge. CHEILOCYSTIDIA
and PLEUROCYSTIDIA absent. LAMELLAR TRAMA Subparallel, relatively narrow;
composed of long-celled hyphae, these 39.5-186.1 x 11.1-16.8 um, poorly
124 ... Henkel & al.
_— _ ae, ie
PLATE 2. Nolanea alboproxima (holotype; Henkel 9116). A. Basidiomata. B. Pileipellis. C. Basidia.
D. Basidiospores. Bars: A = 10 mm; B-D = 10 um.
separating. PILEIPELLIS a shallow cutis of 1-3 uninflated hyphal layers; hyphae
4-6 um wide; TERMINAL CELLS cylindric to cylindro-clavate, 45.9-180.9 x 4.2-6.7
um. PILEAL TRAMA HYPHAE inflated beneath the pileipellis, 10-14 um wide,
elsewhere 96.8-273.4 x 8.6-24.8 um. STIPITIPELLIS a cutis; CAULOCYSTIDIA
absent. REFRACTIVE HYPHAE abundant in the stipe trama, rare in the pileus
trama, absent in the lamellar trama. PIGMENTATION minimal, apparently
cytoplasmic, and not incrusting in the pileipellis. CLamP CONNECTIONS absent.
ECOLOGY, RANGE, DISTRIBUTION — Scattered on humus or seed husks
in Dicymbe spp. forests; known only from the Upper Potaro River Basin of
Guyana during the December-January rainy season.
ADDITIONAL SPECIMEN EXAMINED. GUYANA. REGION 8: POTARO-SIPARUNI.
Pakaraima Mountains. Upper Potaro River Basin, ~15 km east of Mt. Ayanganna,
environs of base camp located on Potaro River one km upstream from confluence with
Nolanea spp. nov. (Guyana) ... 125
Whitewater Creek at 5°18’04.8’N 59°54’40.4’W, elevation 710-750 m; on buried seed
husk, 2 January 2004, Aime 2416 (BRG; PUL).
ComMENtTs — Nolanea alboproxima is distinguished by its small, plano-
convex, pale yellowish white, translucent-striate pileus, pale yellow stipe,
heterodiametric spores averaging 9.3 x 6.8 um, and its lack of hymenial cystidia.
Even though the basidioma colors are reminiscent of those predominant in
Alboleptonia, N. alboproxima fits well in Nolanea because it combines a thin
pileal cutis, inflated cells in the outermost pileal trama, and lack of clamp
connections. Its overall aspect resembles an off-white form of N. proxima
Largent or N. cetrata (Fr.) P. Kumm. Isodiametric basidiospores and externally
encrusted pileus tramal hyphae distinguish N. proxima from N. alboproxima.
Nolanea cetrata has similarly shaped and sized basidiospores but can be
separated from N. alboproxima by its yellowish brown pileus, silvery striate
stipe, bisterigmate basidia, and distinctive cytoplasmic or vacuolar pigment
(Largent 1994).
Several other species representing other entolomatoid genera share similar
basidioma color, basidiospore size, lack of odor, and lack of clamp connections
with Nolanea alboproxima. Of these, Entoloma purum E. Horak & Desjardin
from Hawaii is distinguished by its suede-like to pubescent pileus, trichodermial
pileipellis, and much smaller basidiomata (pileus 4-10 mm broad, stipe 3-5 x
0.5-0.7 mm; Horak & Desjardin 1993). Entoloma proprium E. Horak from New
Caledonia can be separated by its fimbriate lamellae, distinctive cheilocystidia,
incrusting pigments, and abundant refractive hyphae (Horak 1980).
Rhodophyllus vetulus Romagn., R. tortilis Romagn., and R. subsericellus
Pat. [= R. platypus Romagn, nom. illegit] from Madagascar and R. flexuosipes
Romagn. & Gilles from Gabon resemble N. alboproxima. Rhodophyllus vetulus,
although with a small pileus, resembles an Entoloma s. str. as it lacks inflated
hyphae in the outer pileus trama and the stipe is >4 mm broad at the apex.
Rhodophyllus tortilis is distinctive because of its leathery, somewhat scabrous
pileus lacking striations, and overall lack of yellow tones in the basidiomata.
Rhodophyllus subsericellus has a finely pilose, opaque pileus without striations
(Romagnesi 1941, as R. platypus). Rhodophyllus flexuosipes is distinguished
by its <70 mm long flexuous stipe and <35 mm broad campanulate pileus
(Romagnesi & Gilles 1979).
Nolanea applanata Largent & T.W. Henkel, sp. nov. PLATE 3
MycoBank MB 519974
Differs from Entoloma bakeri by its brownish orange, translucent-striate pileus and
hollow stipe.
Type: Guyana. Region 8: Potaro-Siparuni. Pakaraima Mountains. Upper Potaro River
Basin, ~15 km east of Mt. Ayanganna, environs of base camp located on Potaro River
126 ... Henkel & al.
one km upstream from confluence with Whitewater Creek at 5°18’04.8”N 59°54’40.4” W,
elevation 710-750 m; 17 August 2007, Henkel 8872 (BRG, holotype; HSU, isotype).
Etymo oey: applanatus (L. adj.) = flat, referring to the pileus shape.
Piteus 45-55 mm broad, planate to upturned, with a low umbo, brownish
orange (5C5) throughout, hygrophanous, becoming lighter first over disc and
then outwards along radial striations, translucent-striate throughout except
over the disc; surface appearing glabrous and moist throughout, under hand
lens with extremely fine appressed radial fibrils; margin crenulate, irregularly
splitting 1 or 2 times. LAMELLAE subdistant, subthick, abruptly adnexed,
20.5-24 mm long, 4-4.8 mm tall, pinkish tan (4A4—5A4); margins concolorous,
finely and irregularly eroded under hand lens; lamellulae 1-2 between lamellae,
1-4 mm long. STIPE 62-97 x 4-7 mm (centrally), equal over apical %, enlarging
evenly over lower % to 9-11 mm wide at base, concolorous with pileus, glabrous
to finely appressed fibrillose under hand lens over upper half, cartilaginous and
twisting, with a hollow core. BASAL MYCELIUM scant, white, of matted hyphae.
OpDoR none; TASTE minimal, slightly mealy.
BASIDIOSPORES distinctly 6-7(-8)-angled with the apex rounded and
consistently heterodiametric in profile and dorsiventral views, 9.9-12.6 x
6.2-8.2 um, (mean = 10.9 + 0.6 um x 7.1 + 0.5 um; E = 1.4-1.8, Q=1.5 + 0.1;
n = 26). BasipiA clavate, 36.3-47.3 x 6.5-12.2 um, (mean = 43.8 + 2.9 um x
9.7 + 1.3 um, E = 3.5-4.9(-6.4), Q = 4.58 + 0.7; n = 13), 2- or 4-sterigmate.
LAMELLAR TRAMA nearly parallel; hyphal cells very long, 149.4-542.8 x
9.0-18.4 um; subhymenium narrow. CHEILOCYSTIDIA AND PLEUROCYSTIDIA
absent. PILEIPELLIS a cutis, 1-4 hyphal layers thick; hyphae 2-8 um wide. PILEAL
TRAMA HYPHAE inflated beneath the pileipellis, 8-18 um wide, elsewhere very
long-celled, 205-807 x 16.7-34.8 um. STIPITIPELLIS a cutis; hymenial clusters
and caulocystidia absent. REFRACTIVE HYPHAE abundant immediately beneath
the pileipellis, present but indistinct in the subhymenium, rare in the lamellar
and stipe tramas. PIGMENTATION cytoplasmic, not incrusting in the pileipellis.
CLAMP CONNECTIONS absent.
ECOLOGY, RANGE, DISTRIBUTION — Occurring in a pair on root mat in
Dicymbe corymbosa forest on sandy soils; known only from the type locality in
the Upper Potaro River Basin of Guyana.
ComMENTS — Nolanea applanata is distinguished by its dull flesh-tan to
brownish orange, glabrous, hygrophanous, planate to upturned <55 mm
broad pileus that is translucent-striate from disc to margin, concolorous stipe
that is twisted, tapering upward, 60-97 x 4-7 mm (apex) to 9-11 mm (base),
6-8-angled basidiospores that average 10.9 x 7.1 um, and absence of hymenial
cystidia. Despite the rather large basidiomata, N. applanata fits well in Nolanea
with its thin cuticular pileipellis, distinctly inflated outer pileal trama hyphae,
Nolanea spp. nov. (Guyana) ... 127
ef foc. tae , 2 OQ
PLaTE 3. Nolanea applanata (holotype; Henkel 8872). A. Basidiomata. B. Pileipellis. C. Hymenium,
basidia, and lamellar trama. D. Basidiospores. Bars: A = 10 mm; B-D = 10 um.
very long-celled tramal hyphae in the pileus and stipe, as well as the translucent-
striate pileus and twisted-striate, cartilaginous stipe.
While Entoloma bakeri Dennis from Martinique, Guadeloupe, and
Trinidad is similar to N. applanata in basidioma size and stature, basidiospore
dimensions, and absence of clamp connections, it can be distinguished by its
cream-colored, silky-striate, innately fibrillose pileus and solid stipe (Pegler
1983).
Nolanea clavata Largent & T.W. Henkel, sp. nov. PLATE 4
MycoBank MB 519975
Differs from Entoloma conicoumbonatum by its lack of incrusting pigments on the
hyphae of the pileipellis and pileus trama and basidiospores with a higher length/width
quotient.
128 ... Henkel & al.
tk ©
Pate 4. Nolanea clavata (holotype; Henkel 8870). A. Basidiomata. B. Pileipellis. C. Basidia.
D. Basidiospores. Bars: B = 10 mm; A, C, D = 10 um.
Type: Guyana. Region 8: Potaro-Siparuni. Pakaraima Mountains. Upper Potaro River
Basin, ~15 km east of Mt. Ayanganna, environs of base camp located on Potaro River
one km upstream from confluence with Whitewater Creek at 5°18’04.8”N 59°54’40.4” W,
elevation 710-750 m; vicinity of base camp, 17 August 2007, Henkel 8870 (BRG,
holotype; HSU, isotype).
ErymMo_oey: clavatus (L. adj.) = club-shaped, referring to the stipe shape.
PiLEus 26-28 mm broad, 16-21 mm high, narrowly to broadly conic with
rounded to subumbonate apex, dull greyish brown to dark brown (6E4-6F4)
Nolanea spp. nov. (Guyana) ... 129
throughout, slightly darker brown over disc (6F5), appressed radially fibrillose
throughout, fibrils more compact over disc but hardly erect, somewhat shiny
macroscopically, opaque, not hygrophanous, silky under hand lens, dry to
submoist; margin broadly undulating forming coarse irregular ridges between
wide radial furrows; extreme edge crenulate and lighter greyish brown (~6C3).
LAMELLAE subclose, subthick, deeply adnexed, 11.5-12.0 mm long, 4-5 mm
tall, dull dirty pink; margins concolorous and smooth; lamellulae 1-2 between
lamellae, 1-3 mm long. Stipe 33-50 mm x 3-4 mm (centrally), equal over
apical %, enlarging evenly over lower % to 6-8 mm, forming a subbulbous,
rounded base, light grey brown (6C2-6D2) throughout but lighter over basal
bulb, appearing silky sericeous, smooth but with fine longitudinal striations
under hand lens. BASAL MYCELIUM a fine white bloom at extreme base. ODOR
none; TASTE strongly farinaceous.
BASIDIOSPORES distinctly 5-6-angled, apex rounded and heterodiametric in
profile and dorsiventral views, 8.7-11.9 x 5.7-8.2 (mean = 10.2 + 0.7 x 6.9 +0.5
um; E = 1.4-1.7,Q =1.5 + 0.1; n= 30). Basip1a (2-)4-sterigmate, short clavate,
tapering basally, 31.1-41.0 x 8.5-12.3 um (mean = 34.9 + 2.9 um x 10.6 + 1.1
um; E = 2.9-3.9, Q = 3.3 + 0.2; n = 14). CHEILOCYSTIDIA and PLEUROCYSTIDIA
absent. LAMELLAR TRAMAL HYPHAE subparallel and broad; cells 72.2-166.6 x
11.2-19.9 um, E= 4.7-11.2. PILEIPELLIs a cutis, 1-4 hyphal layers thick; hyphae
1.5-6 um wide; upturned hyphal ends rare to absent. PILEUS TRAMAL HYPHAE
slightly interwoven, inflated beneath the pileipellis, 15-20 um wide, elsewhere
53.6-132.7 x 15.4-32.4 um (E = 1.9-5.0). STIPITIPELLIS a cutis; hymenial
clusters and caulocystidia absent. STIPE TRAMA HYPHAE long and broad,
104.8-412.2 x 13.5-24.6 um, (E = 4.3-30.5). PIGMENTATION not observed in
water mounts, not obvious in 3% KOH, likely cytoplasmic and uniform in the
suprapellis of the pileus; not obvious in the stipitipellis. REFRACTIVE HYPHAE
in radial section abundant in the pileal trama near the subhymenium; rare to
absent elsewhere. CLAMP CONNECTIONS absent.
ECOLOGY, RANGE, DISTRIBUTION — Solitary on humic layer of forest floor
under Dicymbe corymbosa; known only from the type locality in the Upper
Potaro River Basin of Guyana.
Comments — Nolanea clavata is distinguished by its relatively large basidioma
with conical, subumbonate, grey brown to dark brown, radially appressed-
fibrillose pileus, clavate, light grey brown stipe, strongly farinaceous taste,
absence of hymenial cystidia, and heterodiametric, 5-6-angled basidiospores
averaging 10.2 x 6.9 um. The radially appressed-fibrillose, tall, conic pileus and
clavate stipe of N. clavata are reminiscent of species of the entolomatoid genus
Inocephalus. However, N. clavata lacks lipoid globules and clamp connections,
features typical of Inocephalus species, and has a thin pileipellis of repent hyphae
overlying distinctly inflated tramal hyphae, features diagnostic for Nolanea.
130 ... Henkel & al.
Because of the similar pileus shape and color, basidiospore size, and lack
of cheilocystidia, N. clavata resembles Entoloma substrictior (Singer) E. Horak
from Argentina and Chile and Entoloma cystopus (Berk.) Sacc. from India and
Malaysia. However, E. substrictior has much larger basidiomata with a <50 mm
broad strongly striate pileus with a rugose surface (Horak 1977). Entoloma
cystopus is also much larger, with a pileus up to 45 mm broad and stipe up to
140 mm long, and becomes pale livid yellow when dry (Horak 1980). Entoloma
conicoumbonatum Hesler resembles N. clavata in basidioma size and colors and
has similarly shaped basidiospores, but differs in having incrusting pigments
on the hyphae of the pileipellis and pileus trama and basidiospores with an
E = 1.1-1.3 and Q = 1.15 (Hesler 1967; Noordeloos 1988).
Nolanea claviformis Largent & Aime, sp. nov. PLATE 5
MycoBank MB 805593
Differs from all described species of Nolanea by its light brown, concentrically ridged
pileus, orange-white lamellae, dark brown stipe, clavate cheilocystidia, and two types of
pileus pigment.
Type: Guyana. Region 10: Upper Demerara-Berbice. Mabura Ecological Reserve: ~100
m northwest of Mabura field station at 5°09’19.0”N 58°41’58.9’W, elevation 100 m; in
Dicymbe altsonii monodominant stand #1, 23 May 2011, Aime 4279 (BRG, holotype;
PUL, isotype).
ErymMo_oey: claviformis (L. adj.) = club-shaped, referring to the clavate cheilocystidia.
Prteus 7-25 mm diam, 7-17 mm high, campanulate-conical, concentrically
ridged with a broad umbo, satiny light brown (5D4), felty, with appressed
longitudinal silky fibrils under hand lens; margin suggestively striate, crimped,
and felty. LAMELLAE 2 mm tall, narrow, adnate, close to crowded, orange white
(5A2); margins broadly scalloped under hand lens; lamellulae numerous,
difficult to count. STIPE 25-69 x 1.5-2.5 mm, equal, concolorous with pileus,
silky; pruina scant at apex under hand lens. BASAL MYCELIUM appressed, white,
extending upward. ConTEXT thin, hollow in stipe. BRUISING REACTIONS none.
ODOR none; TASTE none, mealy in texture.
BasIDIosPoRES distinctly 4-5(-6)-angled in all views, isodiametric
in polar view, isodiametric to heterodiametric in profile view, 7.3-10.9 x
6.8-8.6 um (mean = 9.0 + 0.8 x 7.5 + 0.48 um, E = 1.0-1.4, Q = 1.20 + 0.10;
n = 31). Basrp1a clavate to cylindro-clavate, 28.2-42.5 x 9.5-13.0 um (mean
= 35.2 + 4.8 x 10.7 + 1.2 um, E = 2.9-3.9, Q = 3.28 + 0.4; n = 7), 4-sterigmate.
CHEILOCYSTIDIA abundant, forming a sterile layer, clavate, colorless, 41.4-57.6
x 8.7-15.7 um (E = 4.0-4.8; n = 6). PLEUROCySTIDIA absent. LAMELLAR TRAMA
HYPHAE subparallel, cells relatively short and broad, 50.8-130.0 x 9-14.0
um (n = 4). PILEIPELLIS a cutis, 4-5 hyphal layers thick; hyphae 2.0-7.5 um
wide; TERMINAL CELLS cylindric to cylindro-clavate, narrow. PILEAL TRAMA
HYPHAE slightly inflated beneath the pileipellis; cells 65.9-128.2 x 8.7-14.6 um,
Nolanea spp. nov. (Guyana) ... 131
PiaTE 5. Nolanea claviformis (holotype, Aime 4279). A. Basidiomata. B. Basidiospores. C. Cheilo-
cystidia. D. Pileipellis. E. Caulocystidia. Bars: A = 10 mm; B-D = 10 um.
elsewhere up to 20 um wide. STIPITIPELLIS a cutis between scattered hymenial
clusters at the apex; TERMINAL CELLS in hymenial clusters clavate, colorless,
132 ... Henkel & al.
similar to basidia but more narrow, 30.9-43.4 x 4.7-12.2 um (E = 3.6-6.6,
Q = 5.0; n = 5). STIPE TRAMA HYPHAE long; cells 72.3-768.4 x 13.9-30.1 um
(n = 4). REFRACTIVE HYPHAE absent. PIGMENTATION minutely to distinctly
incrusting the walls of the more slender hyphae in the pileal trama, faintly
cytoplasmic in the pileipellis hyphae. CLAMP CONNECTIONS absent.
ECOLOGY, RANGE, DISTRIBUTION — Scattered on litter of forest floor in
Dicymbe altsonii forests on sandy soils; known only from the type locality at
Mabura Ecological Reserve, Guyana.
Comments — Nolanea claviformis is characterized by its concentrically ridged
pileus, narrow crowded lamellae, and two types of pigment in the pileipellis.
Refer to the comments sections for N. sinuolata and N. concentrica for
discussions of species similar to N. claviformis.
Nolanea concentrica Largent & T.W. Henkel, sp. nov. PLATE 6
MycosBank MB 519976
Differs from Nolanea bicoloripes by its abundant cheilocystidia and much shorter stipe.
Type: Guyana. Region 8: Potaro-Siparuni. Pakaraima Mountains. Upper Potaro River
Basin, 15-20 km east of Mt. Ayanganna, Tadang Base Camp 2 km south of Potaro River
at 5°16’14.5”N 59°50’39.1”W, elevation 710-750 m; vicinity of base camp, 19 December
2009, Henkel 9106 (BRG, holotype; HSU, isotype).
ETYMOLOGY: concentricus (L. adj.) = ringed, referring to the concentrically ridged,
umbonate pileus umbo.
PiLEus 18 mm broad, 7 mm tall, broadly conic with concentrically ridged umbo,
apex submammilate but rounded, brown (6D5-6D6), slightly darker (6E6) over
disc, shiny sericeous and moist throughout, finely translucent-striate over outer
2/3; margin finely roughened. LAMELLAE subthin, crowded, adnate, 8.3 mm
long, 1.5-2.0 mm tall, pink; margins concolorous, roughened-cystidiate under
hand lens. StrpE 42 mm x 1.5 mm, equal, tan brown (5C4-5C5) throughout,
smooth with fine suberect fibrils under hand lens. BasAL MYCELIUM lacking.
Opor mildly fungoid; TasTE not obtained.
BASIDIOSPORES distinctly 4—-5-angled in all views, isodiametric in polar
view, in profile and dorsiventral views isodiametric to heterodiametric, 6.5-9.0
x 5.1-6.9 um (mean = 7.7 + 0.64 x 6.0 + 0.52 um; E = 1.13-1.61, Q=1.3 + 0.13;
n = 28). Basip1a cylindro-clavate, 24.2-30.6 x 6.7-9.5 um (mean = 27.4 + 2.0 x
8.1 + 0.8 um; E = 3.4 + 0.47, Q = 2.8-4.2; n = 13), tapering abruptly near base to
1.5-4.6 um wide, 4-sterigmate; sterigmata 1.9-4.3 um long. CHEILOCYSTIDIA
abundant, forming a sterile layer, hyaline, broadly aciculate to obclavate at first,
ultimately long ventricose-rostrate, 34.4-121.9 x 5.8-16.1 um (mean = 79.3 x
10.3 um; E = 7.75, Q = 5.9-9.6; n = 10). PLEUROCysTIDIA absent. LAMELLAR
TRAMA HYPHAE subparallel, cells relatively short and broad, 69.8-121.7 x
10.1-13.7 um. PILEIPELLIs a cutis, 4-5 hyphal layers thick; hyphae 2.0-6.2 um
Nolanea spp. nov. (Guyana) ... 133
PLATE 6. Nolanea concentrica (holotype; Henkel 9106). A. Basidioma and pilei. B. Basidiospores.
C. Basidium. D. Pileipellis and pileal trama. E. Cheilocystidia. Bars: A = 10 mm; B-D = 10 um.
134 ... Henkel & al.
wide; TERMINAL CELLS cylindric to cylindro-clavate. PILEAL TRAMA HYPHAE
beneath the pileipellis slightly inflated, 8.7-14.6 um wide; cells elsewhere
50.9-128.2 x 6.7-13.8 um. STIPITIPELLIS not studied. REFRACTIVE HYPHAE
absent. PIGMENTATION minutely incrusting the more slender hyphae in
the pileal trama, faintly cytoplasmic within the pileipellis hyphae. CLamp
CONNECTIONS absent.
ECOLOGY, RANGE, DISTRIBUTION — Solitary on litter of forest floor in mixed
Dicymbe spp. forest; known only from the type locality in the Upper Potaro
River Basin of Guyana.
ComMEnts — Nolanea concentrica is distinguished by its dark brown, broadly
conic pileus that is shiny sericeous, finely translucent-striate, and submammilate
with a concentrically ridged umbo, crowded narrow lamellae, smooth equal
stipe, abundant broadly aciculate to ventricose-rostrate cheilocystidia, and
4-5-angled basidiospores averaging 7.7 x 6.0 um. Nolanea bicoloripes Largent
& Thiers from western North America is similar to N. concentrica in the
distinctive, concentrically ridged, umbonate, silky-sericeous pileus, narrow
equal stipe, and some micromorphological features, but differs in its longer
(<140 mm) stipe and lack of cheilocystidia (Largent 1994).
Both N. claviformis and the sympatric N. concentrica have a concentrically
ridged or beveled pileus, white lamellae, 4-5-angled basidiospores, and
incrusting and cytoplasmic pigments in the pileipellis. Nolanea claviformis is
distinguished by its clavate cheilocystidia, larger (~9.0 x 7.5 um) basidiospores,
and larger (28.3-42 5 x 9.5-12.0 um) basidia. See the comments under
N. sinuolata for additional information.
Nolanea subsolstitialis Largent from Washington, N. infula (Fr.) Gillet from
the Netherlands and Sweden, and N. solstitialis from Europe also have small
basidiospores, a beveled or concentrically ridged pileus, and a subpellis that
is only slightly inflated and lack clamp connections. However, all three species
lack cheilocystidia and have different stipe dimensions than N. concentrica. In
addition, N. solstitialis has a distinct, abundant external incrusting pigment,
N. solstitialis has intracellular pigment, and N. infula possesses both pigment
types (Noordeloos 1980; Largent 1994).
Nolanea furcata Largent & T.W. Henkel, sp. nov. PLATE 7
MycoBank MB 805594
Differs from Entoloma infula var. chlorinosum by its non-papillate pileus, faint chlorine
odor, and abundant cheilocystidia.
Type: Guyana. Region 8: Potaro-Siparuni. Pakaraima Mountains. Upper Potaro River
Basin, 15-20 km east of Mt. Ayanganna, Tadang Base Camp 2 km south of Potaro River
at 5°16'14.5”N 59°50’39.1”W, elevation 710-750 m; 0.5 km SW of Tadang Base Camp,
24 December 2009, Henkel 9139 (BRG, holotype; HSU, isotype).
Nolanea spp. nov. (Guyana) ... 135
PLATE 7. Nolanea furcata (holotype; Henkel 9139). A. Basidiomata. B. Hymenophore.
C. Basidiospores. D. Basidia. E. Pileipellis and pileus tramal hyphae with external encrustations.
E. Cheilocystidia. Bars: A, B = 10 mm; C-F = 10 um.
136 ... Henkel & al.
ErymMo_oey: furcatus (L. adj.) = forked, referring to the irregularly forked lamellae.
PitEus broadly conic with subacute to rounded apex, 13-23 mm broad, 7-16
mm tall, greyish brown (6E3-E4), hygrophanous to lighter greyish brown
(5D2-D3) over disc, appearing smooth macroscopically; surface under hand
lens a dense, very fine fibrillose mat, this uniform throughout with no erect
elements evident, not translucent-striate; margin slightly inrolled, otherwise
entire and light grey; moist. LAMELLAE thin, crowded, adnate with a decurrent
tooth, 6.5-15 long, 1-2 mm tall, forking irregularly, white to light pink (6A1-A2);
margins concolorous, highly roughened-cystidiate under hand lens; lamellulae
numerous, too crowded to count. STIPE subequal, tapering very slightly toward
apex, 74-87 mm x 3-4 mm (centrally), base 4-6 mm, concolorous with the
pileus over upper %, smooth, finely longitudinally fibrillose under hand lens.
BASAL MYCELIUM over basal % of stipe a dense, white fibrillose mat. PILEUS
CONTEXT light grey. STIPE CONTEXT grey, hollow. BRUISING REACTIONS none.
Opor faintly of detergent or chlorine; TASTE pleasantly fungoid.
BASIDIOSPORES distinctly (4-)5-angled and _ subisodiametric to
heterodiametric in profile view, 6.6-8.4 x 5.1-7.2 um (mean = 7.5 + 0.4 x
6.0 + 0.5 um; Q = (1.09-)1.14-1.46, E = 1.26 + 0.1; n = 25). Basrp1a clavate,
strongly tapered basally, 27.6-35.6 x 5.8-11.1 um (mean = 30.8 + 2.3 x 8.5 + 1.6
um; Q = 2.95-5.1, E = 3.8 + 0.8; n = 12); base 2.7-5.2 um wide; 4-sterigmate;
sterigmata 1.4-3.2 um long. CHEILOCysTIDIA abundant, forming a sterile layer
on the gill edge, uniformly cylindro-clavate, colorless, 47.9-74.3 x 3.7-5.9 um.
PLEUROCYSTIDIA absent. LAMELLAR TRAMA HYPHAE subparallel, relatively
slender and uniform in width; cells 54.8-112.2 x 3.7-6.1 um. PILEIPELLIS
a cuticular layer of largely repent, entangled, relatively narrow hyphae;
TERMINAL CELLS cylindro-clavate, 20.1-49.3 x 4.1-9.3 um (n = 11). PILEAL
TRAMA HYPHAE beneath the pileipellis slightly to distinctly inflated; cells
38.0-134.4 x 6.2-13.8 um (n = 8), not measured elsewhere. STIPITIPELLIS with
an entangled hyphal layer similar to the pileipellis, with hymenial clusters at the
stipe apex; TERMINAL CELLS abundant, somewhat opaque, similarly-shaped as,
but longer than the cheilocystidia, 20-137.8 x 3.2-6.3 um (n = 7). REFRACTIVE
HYPHAE abundant in the pileal trama, absent in the lamellar trama and the
subhymenium. PIGMENTATION of two types in the pileipellis: uniformly
cytoplasmic and faintly brownish and with external encrustations; pileus trama
hyphae strongly externally encrusted. CLAMP CONNECTIONS absent.
ECOLOGY, RANGE, DISTRIBUTION — Scattered on litter of forest floor in
mixed Dicymbe spp. forest; known only from the type locality in the Upper
Potaro River Basin of Guyana.
ComMENtTs — Nolanea furcata is distinguished by its conic, dark brownish
grey, hygrophanous, opaque pileus, narrow, crowded, irregularly forked
lamellae that are white initially, faintly detergent-like or chlorine-like odor,
Nolanea spp. nov. (Guyana) ... 137
abundant cylindro-clavate cheilocystidia and caulocystidia, cytoplasmic and
externally incrusted pigment in the pileipellis, and relatively small (~7.5 x
6.0 um) 4—5-angled basidiospores. Entoloma infula var. chlorinosum (Arnolds
& Noordel.) Noordel. from Europe shares a dark brown pileus and stipe, the
two types of pileipellis pigments, somewhat similarly shaped basidiospores,
and chorine-like odor but fundamentally differs from N. furcata in its
papillate pileus, persistent and much stronger chlorine-like odor, and lack
of cheilocystidia (Noordeloos 1992). For additional information on Nolanea
species similar to N. furcata, refer to the comments for N. sinuolata.
Nolanea mimiae Largent & Aime, sp. nov. PLATE 8
MycosBank MB 805595
Differs from Nolanea mammosa var. venezuelana by its non-papillate pileus and presence
of pleurocystidia.
Type: Guyana. Region 8: Potaro-Siparuni. Pakaraima Mountains. Upper Potaro River
Basin, ~15 km east of Mt. Ayanganna, environs of base camp located on Potaro River
one km upstream from confluence with Whitewater Creek at 5°18’04.8”N 59°54’40.4” W,
elevation 710-750 m; up Potaro River from base camp on line to Lance's plot near
Blackwater Creek, 25 July 2010, Aime 4024 (BRG, holotype; PUL, isotype).
Erymo oey: In honor of Mimi Chin, long-time Guyana field assistant and finder of the
type collection.
PitEus 19 mm broad, 11 mm tall, conical, lacking an umbo, glabrous
macroscopically but faintly appressed-fibrillose under hand lens, opaque, not
hygrophanous, not translucent striate, dark brown (6E7), slightly darker over
the disc; margin crenulate and lighter. LAMELLAE subthin, close, adnate, 13
mm long, 3 mm tall, pale yellow (4A3) initially, later with pink spots; margins
concolorous with face, roughened-cystidiate under hand lens. StrPE 60 mm x
1.5 mm, equal, dark yellowish brown (5F8), glabrous, inserted; trama hollow.
BASAL MYCELIUM lacking. BRUISING REACTIONS none. Opor indistinct; TASTE
none at first, then somewhat soapy.
Basipiospores distinctly 5-angled, isodiametric to heterodiametric
in profile view, 8.4-10.9 x 6.7-8.8 um (mean = 9.8 + 0.6 x 7.8 + 0.5 um;
E = 1.1-1.5, Q = 1.26 + 0.10; n = 34). Basrp1a cylindro-clavate, 27.6-32.0 x
10.5-13.5 pm (mean = 30.0 + 1.5 x 11.7 + 1.0 um, E = 2.2-2.9, Q = 2.6 + 0.3;
n = 6), 4-sterigmate. CHEILOCYSTIDIA scattered to abundant, colorless,
lageniform, 27.4-68.8 x 6.4-18.4 um (E = 3.6-5.8; n = 9). PLEUROCYSTIDIA
infrequent to scattered, similar in shape to cheilocystidia, 26.4-64.1 x 5.0-14.1
um (E = 2.4-10.5; n = 14). LAMELLAR TRAMA HYPHAE subparallel; cells 187.4-
480.6 x 8.6-29.5 um (n = 4). PILEIPELLIS a cutis, 5-7 hyphal layers thick; hyphae
3.7-8.1 um wide; TERMINAL CELLS cylindro-clavate, 26.9-37.1 x 2.5-7.6 um
(E = 4.4-10.8; n = 5). PILEAL TRAMA HYPHAE beneath the pileipellis slightly
inflated, 5.7-14.3 um wide; cells elsewhere inflated, relatively long and tapered
138 ... Henkel & al.
Pate 8. Nolanea mimiae (holotype; Aime 4024). A. Basidioma. B. Basidiospores. C. Cheilocystidia.
D. Pileipellis. E. Cytoplasmic pigments in the pileipellis hyphae. Bars: A = 10 mm; B-E = 10 um.
at both ends, 53.7-394.1 x 15.3-30.2 um (n = 7). STIPITIPELLIS at the apex
with rare clusters of basidia, and rare terminal cells, these slightly out-turned,
cylindro-clavate, 30.8-42.6 x 3.4-6.2 um (n = 4), elsewhere a cutis. STIPE
TRAMAL HYPHAE 56.9-377.8 x 10.9-23.9 um (n = 7). REFRACTIVE HYPHAE
glistening in 3% KOH, abundant in the pileal trama, absent in the lamellar
trama; not studied in the stipe trama. PIGMENTATION cytoplasmic in the hyphae
Nolanea spp. nov. (Guyana) ... 139
of the pileipellis, in the form of abundant dark brown, plaque-like agglutinated
clots, absent in all other tissues. CLAMP CONNECTIONS absent.
ECOLOGY, RANGE, DISTRIBUTION — Solitary on litter of forest floor in mixed
Dicymbe spp. forest; known only from the type locality in the Upper Potaro
River Basin of Guyana.
ComMENts — Nolanea mimiae is distinguished by its conical, non-umbonate,
opaque, non-hygrophanous, dark brown pileus, pale yellow lamellae, dark
yellowish brown stipe, scattered lageniform cheilocystidia and pleurocystidia,
cytoplasmic pigment in the pileipellis, and nearly heterodiametric 5-angled
basidiospores averaging 9.8 x 7.8 um. These characters, along with the
cytoplasmic pigment in the form of plaques or clots, and the mild then soapy
taste, make N. mimiae unique among previously described Nolanea species.
Nolanea mammosa var. venezuelana Dennis from Venezuela [= Rhodophyllus
venezuelanus (Dennis) Singer from Chile] and Entoloma taedium E. Horak
from Chile are somewhat similar to N. mimiae because of their lageniform
cheilocystidia and basidioma colors. Nolanea mammosa var. venezuelana
differs from N. mimiae by its papillate pileus and lack of pleurocystidia (Singer
1969; Dennis 1970). Entoloma taedium differs by its distant pallid lamellae, lack
of pleurocystidia, and cytoplasmic pigment in the cheilocystidia (Horak 1977).
Nolanea rava Largent & Aime, sp. nov. PLATE 9
MycoBank MB 805596
Differs from Entoloma acutopallidum by its greyish yellow pileus, 5-6-angled
basidiospores, obclavate to rostrate-ventricose cheilocystidia, and abundant
pleurocystidia.
Type: Guyana. Region 10: Upper Demerara-Berbice. Mabura Ecological Reserve: ~100
m northwest of Mabura field station at 5°9’19.0”N 58°4’58.9”W, elevation 100 m; in
Dicymbe altsonii monodominant stand #1, 27 May 2011, Aime 4312 (BRG, holotype;
PUL, isotype).
EryMo.oey: ravus (L. adj.) = greyish-yellow, referring to the color of the pileus and
stipe.
PriLEus 13 mm broad, 10 mm tall, conical with a tiny, nipple-like umbo that is 1
mm long, dry, silky, at first greyish yellow (4B4), remaining so on the disc and
umbo, elsewhere becoming pale greyish yellow (4B3), hygrophanous, shallowly
sulcate and translucent-striate to disc, glabrous; margin decurved, broadly
undulating in outline. LAMELLAE thin, close, adnexed, 11.5 mm long, 3-5 mm
tall, flesh-colored (6B3) with masses of concolorous basidiospores visible under
hand lens; margins entire, concolorous and undulating; lamellulae 3-5 between
lamellae. Stipe 37 x 2 mm at apex, 3 mm base, somewhat flattened and tapered
from base to apex, glabrous but obscurely longitudinally striate under hand
lens, greyish yellow (4B4) like the mature pileus disc. BASAL MYCELIUM absent.
140 ... Henkel & al.
, a, —- . ew
Pate 9. Nolanea rava (holotype; Aime 4312). A. Basidioma. B. Basidiospores. C. Hymenium with
basidia. D. Pileipellis and pileal trama. E. Cheilocystidia. Bars: A = 10 mm; B-D = 10 um.
CONTEXT not examined. BRUISING REACTIONS yellowish near the pileus
margin. ODOR none; TASTE not obtained.
Nolanea spp. nov. (Guyana) ... 141
BasIpDIospores distinctly 5-6-angled in all views, isodiametric to
heterodiametric in profile and dorsiventral views, angles at times somewhat
rounded, 9.4-11.9 x 7.6-9.8 um (mean = 10.5 + 0.6 x 8.5 + 0.49 um; E = 1.0-1.3,
Q = 1.24 + 0.08; n = 34). BasrpiA cylindro-clavate, hardly tapered, 29.8-43.0 x
10.5-13.5 um (mean = 36.8 + 3.7 x 11.6 + 0.9 um; E = 2.4-3.6, Q = 3.2 + 0.4;n
= 12); 4-sterigmate; sterigmata up to 5.0 um long. CHEILOCysTip1A abundant,
colorless, obclavate to rostrate-ventricose, base rounded, 26.7-62.0 x 9.0-26.8
um (mean = 42.7 + 11.9 x 15.3 + 6.1 um; E = 1.9-4.9, Q = 3.0 + 1.1; n = 8);
rostrum 8.2-35.9 um long x 4.3-11.6 um wide at the base, 2.0-5.2 um wide
at the apex. PLEUROCysTIDIA abundant, similar in shape but longer than the
cheilocystidia, colorless, 26.5-88.8 x 12.5-25.2 um (mean = 49.8 + 19.1 x 18.5
+ 4.2 um, E = 1.6-3.4, Q = 2.6 + 0.6; n = 11). LAMELLAR TRAMA HYPHAE long
and tapered at both ends; cells 53.4-498.7 x 8.3-25.4 um (n = 9). PILEIPELLIS
a cutis, 2-3 hyphal layers thick; hyphae 4.0-7.5 um wide; TERMINAL CELLS
cylindric and at times somewhat swollen at the apex. PILEAL TRAMA HYPHAE
slightly inflated beneath the pileipellis, 10.3-14.3 um wide; cells overall 44.2-
270.5 x 3.4-14.3 um (n = 6). STIPITIPELLIS a cutis; hymenial elements and
distinct terminal cells absent. STIPE TRAMA HYPHAE not studied. REFRACTIVE
HYPHAE absent. PIGMENTATION minimal, cytoplasmic in the pileipellis and
stipitipellis. CLaMP CONNECTIONS absent.
ECOLOGY, RANGE, DISTRIBUTION — Solitary on litter of forest floor in
Dicymbe altsonii forests on sandy soils; known only from the type locality at
Mabura Ecological Reserve, Guyana.
Comments — Nolanea rava is distinguished by its conical, acutely umbonate,
silky, hygrophanous, translucent-striate greyish yellow pileus and concolorous
stipe, nearly obclavate to rostrate-ventricose cheilocystidia and pleurocystidia,
nearly heterodiametric 5-6-angled basidiospores averaging 10.5 x 8.5 um,
and general lack of microscopic pigmentation. This combination of characters
makes N. rava unique among previously described Nolanea species.
The overall basidioma aspect of Nolanea acuta resembles that of Entoloma
acutopallidum E. Horak & Cheype from French Guiana (Horak & Cheype
2008). Entoloma acutopallidum differs from N. rava by its orangish clay-colored
pileus, white stipe, cuboid basidiospores, clavate to vesiculose cheilocystidia,
and lack of pleurocystidia.
Nolanea sinuolata Largent, Aime & T.W. Henkel, sp. nov. PLATE 10
MycosBank MB 805597
Differs from all described species of Nolanea by its nearly concolorous dark brown
pileus, lamellae, and stipe, cylindro-clavate cheilocystidia and caulocystidia that are
slightly wavy to sinuous in outline, and externally encrusted pigment on the hyphal
walls of the pileipellis and lamellar trama.
142 ... Henkel & al.
Type: Guyana. Region 8: Potaro-Siparuni. Pakaraima Mountains. Upper Potaro River
Basin, ~15 km east of Mt. Ayanganna, environs of base camp located on Potaro River
one km upstream from confluence with Whitewater Creek at 5°18’04.8”N 59°54’40.4” W,
elevation 710-750 m; 1 km NE of base camp, sandy zone E of Benny’s Ridge, 29 August
2009, Henkel 8900 (BRG, holotype; HSU, isotype).
EryMo_oey: sinuolatus (L. adj.) = faintly waved, referring to the cheilocystidia that are
faintly wavy or sinuous in outline.
PitEus 11-24 mm broad, 5-12 mm tall, broadly conic with broadly rounded
and flattened umbo, initially dark brown (6F4-6F5) throughout, then lighter
concolorous (6E6 or 5E6) on the umbo and paling to light brown (5D6) toward
the margin, glabrous macroscopically, under hand lens a contiguous mat with
minute suberect elements over disc, moist, outer 1-2 mm of margin with
faint translucent striations; marginal edge decurved, entire in areas, elsewhere
very finely crenulate. LAMELLAE subthin, subcrowded, adnate, brown at first
(concolorous with the pileus), then with pinkish overtones (5C4), finally dirty
dull pink (6A2-6B2) with basidiospore maturation; margins whitish, densely
cystidiate under hand lens; lamellulae 1-2 between lamellae, 0.5-3 mm long.
STIPE 50-71 x 1.5-1.75 mm, equal, glabrous macroscopically, very finely
twisting longitudinally striate under hand lens with a whitish basal bloom,
otherwise dark yellowish brown (5F8) becoming dark brown (6F5-6F6)
throughout, inserted, cartilaginous, hollow. BASAL MyCELIUM whitish and
scant. ODorR none or faintly spermatic; TASTE not obtained.
Basip1ospores distinctly 5-6-angled in all views, in profile view
isodiametric to heterodiametric, 6.7-9.5 x 5.3-7.9 um (mean = 8.1 + 0.6 x
6.8 + 0.5 um; E = 1.0-1.4, Q = 1.21 + 0.1 subisodiametric; n = 47). BAsip1a
cylindro-clavate and hardly tapered, rather narrow, 24.2-40.3 x 6.2-9.9 um
(mean = 34.0 + 4.3 x 8.0 + 1.12 um; E = 3.2-5.8, Q = 4.33 + 0.81; n = 17),
4-sterigmate. CHEILOCYSTIDIA abundant, forming a sterile layer, colorless,
narrowly cylindro-clavate and wavy to sinuous in outline, occasionally with a
capitulate apex, 26.6-73.2 x 3.7-8.2 um (mean = 49.7 + 12.6 x 6.1 + 1.18 um; E
= 3.9-12.8, Q = 7.23 + 2.2;n = 22). PLEUROCYSTIDIA absent. LAMELLAR TRAMA
subparallel to parallel, composed of broad hyphae, these 56-86 x 10-19 um,
along with narrow hyphae, these 83-85 x 7.2-7.4 um (n = 9). PILEIPELLIS a
cutis but with a few loosely entangled clusters of cylindro-clavate terminal cells,
semi-erect on the disc, repent elsewhere; TERMINAL CELLS near disc 26.5-70.2
x 4.0-9.8 um (mean = 43.8 + 12.40 x 6.4 + 2.22 um; E = 4.61-14.32, Q =7.41
+ 2.89; n = 12), near margin 51.2-88.2 x 4.0-7.0 um (n/1 = 3). PILEAL TRAMA
HYPHAE beneath the pileipellis rather short-celled and somewhat inflated; cells
38.9-138.8 x 7.0-17.9 um (n = 9, not studied elsewhere). STIPITIPELLIS with
abundant clusters of caulocystidia, these similar in shape to the cheilocystidia;
CAULOCYSTIDIA 28.8-77.9 x 3.4— 6.2 um (mean = 45.5 + 13.37 x 4.7 + 0.99 um;
E = 5.0-13.5, Q = 9.9 + 2.7;n = 12). STIPE TRAMA HYPHAE broad in the center;
Nolanea spp. nov. (Guyana) ... 143
PLaTE 10. Nolanea sinuolata (holotype; Henkel 8900). A. Basidioma. B. Basidiospores. C. Pileus
tramal hyphae with external encrustations. D. Cheilocystidia. E. Caulocystidia. Bars: A = 10 mm;
B-E = 10 um.
cells 81.0-228.0 x 13.5-20.3 um (n = 5) and narrow near the stipitipellis; cells
168.3-223.2 x 3.0-3.5 um (n= 5). REFRACTIVE HYPHAE absent. PIGMENTATION
obvious and dark brown in 3% KOH in spot plates, dark brown in microscopic
144 ... Henkel & al.
sections, distinct and encrusting on the outer portions of the hyphae in the
pileipellis, pileus trama, and lamellar trama. CLAMP CONNECTIONS absent.
ECOLOGY, RANGE, DISTRIBUTION — Solitary on litter of forest floor in mixed
Dicymbe spp. forest; known only from the Upper Potaro River Basin of Guyana.
ADDITIONAL SPECIMEN EXAMINED. GUYANA. REGION 8: POTARO-SIPARUNI.
Pakaraima Mountains. Upper Potaro River Basin, ~15 km east of Mt. Ayanganna,
environs of base camp located on Potaro River one km upstream from confluence with
Whitewater Creek at 5°18’04.8’N 59°54’40.4’”W, elevation 710-750 m; vicinity of base
camp, | July 2003, Aime 2280 (BRG; PUL).
ComMENnts — Nolanea sinuolata is diagnosed by its conic, broadly umbonate,
dark brown pileus, brown, thin crowded lamellae, dark brown stipe, encrusted
pigment on the pileus tramal hyphae, cylindro-clavate cheilocystidia with
faintly wavy to sinuate sides, and 5-6-angled basidiospores averaging 8.1 x
6.8 um. Nolanea sinuolata, N. furcata, N. claviformis, and N. concentrica (all
described here as new) share the following features: a dark brown, conic or
conic-campanulate, macroscopically glabrous but sericeous to faintly fibrillose
pileus with a rounded, submammilate umbo; thin, close to crowded lamellae;
a tough, cartilaginous stipe concolorous with the pileus; basidiospore shape;
presence of cheilocystidia; an only slightly inflated subpellis; encrusted pigment
on the outer hyphal walls of the pileipellis; and lack of clamp connections.
Among these species, N. sinuolata can be diagnosed by the brown lamellae
when young, the encrusted pigment on lamellar tramal hyphae, cylindro-
clavate cheilocystidia with slightly wavy walls and occasionally capitulate apex,
the absence of cytoplasmic pigment in the pileipellis, and the lack of concentric
ridges in the pileus. Nolanea furcata is distinguished by the white lamellae
that fork toward the margin, the abundant tomentum covering the basal 4%
of the clavate stipe, the chlorine odor, and a cytoplasmic pileipellis pigment.
Nolanea claviformis and N. concentrica have a concentrically ridged or beveled
pileus, white lamellae, and also have a cytoplasmic pigment in the hyphae of
the pileipellis. Nolanea claviformis is distinguished from N. concentrica by
the clavate cheilocystidia, larger (~9.0 x 7.5 um) basidiospores, and larger
(28.3-42 5 x 9.5-12.0 um) basidia. Nolanea concentrica has aciculate to
rostrate-ventricose cheilocystidia, smaller (~7.7 x 6.0 um) basidiospores, and
smaller (24.2-30.6 x 6.7-9.5 um) basidia.
Nolanea subsulcata Largent & T.W. Henkel, sp. nov. PLATE 11
MycosBank MB 519977
Differs from Entoloma guatopoanum by its glabrous pileus and stipe.
Type: Guyana. Region 8: Potaro-Siparuni. Pakaraima Mountains. Upper Potaro River
Basin, ~15 km east of Mt. Ayanganna, environs of base camp located on Potaro River
one km upstream from confluence with Whitewater Creek at 5°18’04.8”N 59°54’40.4” W,
elevation 710-750 m; vicinity of base camp in Dicymbe forest, 1 June 2005, Henkel 8825
(BRG, holotype; HSU, isotype).
Nolanea spp. nov. (Guyana) ... 145
PLaTE 11. Nolanea subsulcata (holotype; Henkel 8825). A. Basidiomata. B. Pileipellis. C. Basidia.
D. Basidiospores. Bars: A = 10 mm; B-D = 10 um
EtyMo.Loey: sub- and sulcatus (L. adj.) = somewhat grooved, referring to the pileus
surface texture.
PrLeus 16-22 mm broad, 5-10 mm tall, broadly conic with low, rounded umbo,
brownish orange (6C4 “red-haired”-7C4) throughout, hygrophanous over disc
with age, striate to subsulcate over outer 4/5, more smooth over immediate disc;
surface glabrous and nearly translucent when fresh, under hand lens appearing
finely longitudinally appressed-fibrillose, disc with no distinct vestiture, moist;
margin finely and irregularly crenulate at sulcations; PILEUS TRAMA extremely
thin, less than 1 mm throughout. LAMELLAE subthin, subdistant, adnexed,
brownish orange (7C4); margins concolorous, smooth; lamellulae 1 between
lamellae, 1-2 mm long. St1rpE 56-80 x 2-2.5 mm, equal, light greyish orange
(6B3 “flesh”-6B4), appearing smooth but with fine appressed longitudinal
fibrils under hand lens, cartilaginous. BASAL MYCELIUM absent. OpoR and
TASTE not noted.
BasIp1osPorREs distinctly 6-8-angled in profile, dorsal, and ventral views,
sides slightly concave, heterodiametric, 8.2-12.3 x 5.1-7.2 um, (mean = 9.7 +
146 ... Henkel & al.
0.9 x 6.4 + 0.51 um; E = 1.3-1.8, Q= 1.5 + 0.14; n = 31). Basrp1a subcylindric
to subclavate, barely tapering toward base, 26.9-37.3 x 5.7-10.6 um, (mean =
30.0 + 3.0 x 8.3 + 1.2 um; E = 2.7-4.8, Q = 3.7 + 0.63; n = 13), 2 or 4-sterigmate.
CHEILOCYSTIDIA AND PLEUROCYSTIDIA absent. LAMELLAR TRAMA Subparallel,
composed of broad, long-celled hyphae (not measured). PILEIPELLIS a cutis
of 1-3 uninflated hyphal layers; hyphae 3.2-10.0 um wide; TERMINAL CELLS
cylindric to cylindro-clavate, 31.0-74.2 um long. PILEUS TRAMA HYPHAE
beneath the pileipellis moderately inflated, 5-18 um wide, elsewhere 5-40
um wide. STIPITIPELLIS a cutis, lacking hymenial clusters or caulocystidia.
REFRACTIVE HYPHAE abundant in the pileus trama, scattered in the lamellar
trama. PIGMENTATION cytoplasmic, faintly evident in 3% KOH. CLamp
CONNECTIONS absent.
ECOLOGY, RANGE, DISTRIBUTION — Solitary on humic litter layer of forest
floor in Dicymbe corymbosa forest; known only from type locality in the Upper
Potaro River Basin in Guyana.
ComMENtTs — Nolanea subsulcata is distinguished by its broadly conic,
umbonate, subsulcate, translucent-striate, hygrophanous pileus with a
paler crenulate margin; equal stipe; overall brownish orange to flesh colors
throughout; lack of hymenial cystidia and clamp connections; and 6-8-angled,
heterodiametric basidiospores averaging 9.7 x 6.4 um. Entoloma guatopoanum
(Dennis) E. Horak [= Leptonia guatopoana Dennis] from Venezuela, which also
has a sulcate-striate similarly colored pileus and heterodiametric basidiospores
measuring 9-11 x 6-8 um and lacks hymenial cystidia and clamp connections,
can be distinguished from N. subsulcata by its pruinose pileus and its white,
minutely pruinose stipe with hyaline downy hairs (Horak 1977). Rhodophyllus
lutensis Romagn. & Gilles from Gabon has similarly sized, shaped, and colored
basidiomata but differs from N. subsulcata in its non-hygrophanous, non-
striate pileus, and much smaller (7-8.2 x 5-6 um) basidiospores (Romagnesi
& Gilles 1979).
Acknowledgments
This research was made possible by grants from the National Geographic Society's
Committee for Research and Exploration and NSF DEB-0918591 to TWH, and an
Explorer’s Club Exploration and Field Research Grant to MCA. Dillon Husbands
functioned as Guyanese local counterpart and assisted with field collecting, descriptions,
and specimen processing. Mimi Chin, C. Andrew, L. Williams, V. Joseph, F Edmund,
and L. Edmund provided field assistance in Guyana. Research permits were granted
by the Guyana Environmental Protection Agency. Our special thanks go to Drs. Ron
Petersen and Clark Ovrebo for their critical comments and revisions, and Dr. Shaun
Pennycook for nomenclatural edits. This paper is number 206 in the Smithsonian
Institution's Biological Diversity of the Guiana Shield Program publication series.
Nolanea spp. nov. (Guyana) ... 147
Literature cited
Baroni TJ, Matheny PB. 2011. A re-evaluation of gasteroid and cyphelloid species of Entolomataceae
from Eastern North America. Harvard Papers in Botany 16: 293-310.
http://dx.doi.org/10.3100/0.25.016.0205
Co-David D, Langeveld D, Noordeloos ME. 2009. Molecular phylogeny and spore evolution of
Entolomataceae. Persoonia 23: 147-176. http://dx.doi.org/10.3767/003158509X480944
Dennis RWG. 1953. Les Agaricales de l’Ile de la Trinité. Rhodosporae-Ochrosporae. Bulletin de la
Société Mycologique de France 69: 145-198.
Dennis RWG. 1970. Fungus flora of Venezuela and adjacent countries. Kew Bulletin Additional
Series 3: 1-531.
Fries E. 1821. Systema mycologicum, vol. 1. Lundae: Ex Officina Berlingiana.
He XL, Li TH, Xi PG, Jiang ZD, Shen YH. 2013. Phylogeny of Entoloma s.l. subgenus Pouzarella,
with descriptions of five new species from China. Fungal Diversity 58: 227-243.
http://dx.doi.org/10.1007/s13225-012-0212-7
Henkel TW. 2003. Monodominance in the ectomycorrhizal Dicymbe corymbosa (Caesalpiniaceae)
in Guyana. Journal of Tropical Ecology 19: 417-437.
http://dx.doi.org/10.1017/S0266467403003468
Hesler LR. 1967. Entoloma in southeastern North America. Beihefte zur Nova Hedwigia 23: 1-196.
Holmgren PK, Holmgren NH, Barnett LC. 1990. Index Herbariorum I: the herbaria of the world.
Regnum Vegetabile 120: 1-693.
Horak E. 1977. Entoloma in South America I. Sydowia 30: 40-111.
Horak E. 1980. Entoloma (Agaricales) in Indomalaya and Australasia. Beihefte zur Nova Hedwigia
65: 1-352.
Horak E, Cheype J-L. 2008. Entoloma acutopallidum and Entoloma pileofibrosum: Two new species
from French Guiana. Bulletin de la Société Mycologique de France 124: 287-298.
Horak E, Desjardin DE. 1993. Agaricales of the Hawaiian Islands. 2. Notes on some Entoloma
species. Mycologia 85: 480-489. http://dx.doi.org/10.2307/3760708
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. 3" ed. Chichester, Richard Clay
Ltd.
Largent DL. 1994. Entolomatoid Fungi of the Western United States and Alaska. Eureka, Mad River
Press Inc.
Largent DL, Baroni TJ. 1988. How to identify mushrooms to genus VI: modern genera. Eureka,
Mad River Press Inc.
Largent DL, Johnson D, Watling R. 1977. How to identify mushrooms to genus III: microscopic
features. Eureka, Mad River Press Inc.
Largent DL, Henkel TW, Aime MC, Baroni TJ. 2008. The Entolomataceae of the Pakaraima
Mountains of Guyana I: four new species of Entoloma s. str. Mycologia 100: 132-140.
http://dx.doi.org/10.3852/mycologia.100.1.132
Murrill, WA. 1911. The Agaricaceae of tropical North America IV. Mycologia 3: 271-282.
http://dx.doi.org/10.2307/3753496
Noordeloos ME. 1980. Entoloma subgenus Nolanea in the Netherlands and adjacent regions with a
reconnaissance of its remaining taxa in Europe. Persoonia 10: 427-534.
Noordeloos ME. 1988. Entoloma in North America. The species described by L.R. Hesler,
A.H. Smith, and S.J. Mazzer. Cryptogamic Studies 2: 1-164.
Noordeloos ME. 1992. Entoloma s. |. Fungi Europaei 5: 1-760.
Noordeloos ME. 2004. Entoloma s. |. Fungi Europaei 5A: 761-1378.
148 ... Henkel & al.
Pegler DN. 1983. Agaric flora of the Lesser Antilles. Kew Bulletin Additional Series 9: 1-668.
Pegler DN. 1997. The agarics of Sao Paulo, Brazil. London, Royal Botanic Garden Kew.
Romagnesi H. 1941. Les Rhodophylles de Madagascar (Entoloma, Nolanea, Leptonia, Eccilia,
Claudopus). Prodrome a une Flore Mycologique de Madagascar 2: 1-164.
Romagnesi H, Gilles G. 1979. Les Rhodophylles des foréts cétiéres du Gabon et de la Céte d'Ivoire
avec une introduction générale sur la taxonomie du genre. Beihefte zur Nova Hedwigia
59: 1-649.
Singer R. 1969. Mycoflora australis. Beihefte zur Nova Hedwigia 29: 1-405.
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.149
Volume 129(1), pp. 149-152 July-September 2014
Two new species of Xylaria and X. diminuta new to China
Gu HuaANnG?? LIN Guo"™*, & NA Liv?
'State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences,
Beijing 100101, China
*Henan University of Technology, College of Biological Engineering, Zhengzhou 450001, China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT —Two new species, Xylaria beilschmiediae on fallen fruit of Beilschmiedia
percoriacea (Lauraceae) and Xylaria foliicola on dead leaves, are described. Xylaria diminuta
is new to China. All specimens were collected from Yunnan Province in China.
KEY worps —Ascomycota, pyrenomycetous fungi, Xylariaceae, taxonomy
Four fruit-inhabiting Xylaria species have previously been recorded in China:
X. byttneriae G. Huang et al., X. culleniae Berk. & Broome, X. ianthinovelutina
(Mont.) Fr., and X. liquidambaris J.D. Rogers et al. (Teng 1963, Tai 1979, Rogers
1979, Huang et al. 2014). In this paper we describe two new Xylaria species and
report X. diminuta as a new record from China.
Xylaria beilschmiediae G. Huang & L. Guo, sp. nov. Figs 1-3
FUNGAL NAME FN570101
Differs from Xylaria himalayensis in its perithecia immersed within a stroma, overlain
with dark brown outer peeling layer.
Type: China, Yunnan, Jinghong, Guanping, alt. 870 m, on fallen fruit of Beilschmiedia
percoriacea C.K. Allen (Lauraceae), 18.X.2013, G. Huang, L. Guo & W. Li 285 (HMAS
269888, holotype).
ErymMo oey: From Beilschmiedia, the genus of the plant serving as a substrate.
Stromata cylindrical, unbranched, with a sterile apex, 12-25 x 1-2 mm, fertile
parts 3-10 mm long, on pubescent stipes; surface blackish, immersed perithecia,
overlain with dark brown outer peeling layer, with perithecial mounds; interior
white. Perithecia subglobose or ellipsoid, 330-500 um diam; ostioles papillate.
Asci with eight ascospores arranged in uniseriate manner, cylindrical, 138-165
um total length, 6-8 um broad, the spore-bearing parts 75-88 um long, with an
150 ... Huang, Guo, & Liu
apical ring staining blue in Melzer’s iodine reagent, hat-shaped, 3-4 um high,
2-3 um broad. Ascospores brownish or brown, ellipsoid-inequilateral, smooth,
(11-)12-14 x 4-5(-6) um, with straight germ slit much less than spore-length.
ComMENts: Xylaria beilschmiediae is similar to X. himalayensis Narula &
Rawla, which differs in producing stromata with protruding perithecia, in
lacking an outer peeling layer, and which occurs on dead angiosperm fruits
(Narula et al. 1985).
Xylaria foliicola G. Huang & L. Guo, sp. nov. Fics 4-6
FUNGAL NAME FN570102
Differs from Xylaria hainanensis in its vertically cracked stromal surface and hairless
plicate stipes.
Type: China, Yunnan, Jinghong, Dadugang, alt. 1250 m, on dead leaves, 20.X.2013, G.
Huang, L. Guo & W. Li 259 (HMAS 253028, holotype).
Erymo.oey: The epithet refers to the substrate (leaves) that the fungus inhabits.
Stromata cylindrical, unbranched, occasional branched, with a sterile greyish
apex, overall 23-35 mm x 1-2 mm, fertile parts 7-18 mm long, on plicate
stipes; surface black, overlain with outer peeling layer, with perithecial mounds;
interior white. Perithecia subglobose or ellipsoid, 400-650 um diam; ostioles
papillate. Asci with eight ascospores arranged in uniseriate manner, cylindrical,
120-137 um total length, 5-9 um broad, the spore-bearing parts 56-68 um
long, with an apical ring staining blue in Melzer’s iodine reagent, inverted
hat-shaped, 2-3 um high, 1.5-2.5 um broad. Ascospores brownish or brown,
ellipsoid—-inequilateral, smooth, (8.5-)9-11 x 4-6 um, with straight germ slit
along the length of the spore.
ComMENTs: Xylaria foliicola is similar to X. hainanensis Y.F. Zhu & L. Guo,
which differs in having smooth stromata without vertical cracks on the surface,
tomentose stipes, shorter asci (65-70 um overall with 35-45 um long spore-
bearing parts; Zhu & Guo 2011).
Xylaria diminuta F. San Martin & J.D. Rogers, Rev. Mex. Micol. 13: 63, 1998. Fics 7-8
Stromata cylindrical, unbranched (occasionally branched), with a sterile
apex, overall 12-40 mm x 0.8-1 mm, fertile parts 12-14 mm long, on plicate
stipes; surface black, smooth, with perithecial mounds; interior white.
Perithecia subglobose or ellipsoid, 270-430 um diam; ostioles papillate. Asci
Fics 1-3. Xylaria beilschmiediae (HMAS 269888, holotype). 1. Stromata on fruit; 2. Stromatal
surface; 3. Asci and ascospores. Fics 4-6. Xylaria foliicola (HMAS 253028, holotype). 4. Stromata
on dead leaf; 5. Stromatal surface; 6. Asci and ascospores. Fics 7-8. Xylaria diminuta (HMAS
269887). 7. Stroma on dead leaf; 8ace. Asci and ascospores.
Xylaria spp. nov. (China) ... 151
152 ... Huang, Guo, & Liu
with eight ascospores arranged in uniseriate manner, cylindrical, 73-82 um
total length, 4-6 um broad, the spore-bearing parts 32-45 um long, with an
apical ring staining blue in Melzer’s iodine reagent, rectangle, 1.5-2 um high,
1-1.5 um broad. Ascospores brownish or brown, ellipsoid-inequilateral,
smooth, (5.5—)6-8 x 3-3.5(-4) um, with straight germ slit spore-length.
SPECIMEN EXAMINED: CHINA, YUNNAN, Jinghong, Dadugang, alt. 1250 m, on dead
leaves, 20.X.2013, G. Huang, L. Guo & W. Li 254 (HMAS 269887).
REMARKS: The Chinese specimen agrees morphologically with the original
description of Xylaria diminuta, except that the type specimen has shorter
(5-13 mm) stromata and a shorter apical ring (1-1.3 um long; San Martin et
al. 1998).
Acknowledgements
The authors would like to express their deep thanks to Prof. Anthony J.S. Whalley
(Liverpool, UK) and Dr. L. Vasilyeva (Vladivostok, Russia) for serving as pre-submission
reviewers, to Dr. Shaun Pennycook (Auckland, New Zealand) for nomenclatural review,
and to Prof. Zhenyu Li (Institute of Botany, Chinese Academy of Sciences) for identifying
the host plant. This study was supported by the foundation of Project of the Knowledge
Innovation Program of the Chinese Academy of Sciences (No. KSCX2-EW-Z-9).
Literature cited
Huang G, Guo L, Liu N. 2014. Xylaria byttneriae sp. nov. from Yunnan Province in China.
Mycosystema 33: 567-570.
Narula AM, Rawla GS, Kaushal SC. 1985 [“1984”]. Two new species of Xylaria (Pyrenomycetes)
from India. Willdenowia 14(2): 409-411.
Rogers JD. 1979. Xylaria magnoliae sp. nov. and comments on several other fruit-inhabiting species.
Can. J. Bot. 57: 941-945. http://dx.doi.org/10.1139/b79-115
San Martin, Rogers JD, Lavin P. 1997. Algunas especies de Xylaria (Pyrenomycetes, Sphaeriales)
habitantes en hojarasca de bosques mexicanos. Rev. Mex. Micol. 13: 58-69.
Tai FL. 1979. Sylloge Fungorum Sinicorum. Science Press, Beijing. 1527 p.
Teng SC. 1963. Fungi of China. Science Press, Beijing. 808 p.
Zhu YF, Guo L. 2011. Xylaria hainanensis sp. nov. (Xylariaceae) from China. Mycosystema
30: 526-528.
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.153
Volume 129(1), pp. 153-161 July-September 2014
Erysiphe magnoliicola, a new powdery mildew on Magnolia
SUNG-EUN CHO’, SUSUMU TAKAMATSU’,
JAMJAN MEEBOON”?, & HYEON-DONG SHIN'*
‘Division of Environmental Science and Ecological Engineering, Korea University,
Seoul, 136-701, Korea
*Department of Bioresources, Graduate School, Mie University, Tsu 514-8507, Japan
*Department of Agriculture, 50 Phaholyothin Rd., Ladyao, Chatuchak, Bangkok 10900, Thailand
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — A new powdery mildew species of Erysiphe sect. Microsphaera, collected on
three species of Magnolia, is here described, illustrated, and named as E. magnoliicola sp. nov.
Introduction of a new species is supported by phylogenetic analyses of ITS and 28S rDNA of
Korean and Japanese collections of this fungus. A comparison of and a synoptic key to the
four species of Erysiphe sect. Microsphaera known on Magnolia spp. are provided.
Key worps — Erysiphaceae, Erysiphe magnifica, Magnoliaceae, molecular phylogeny
Introduction
Powdery mildews (Erysiphaceae, Ascomycota) are plant pathogenic fungi
that are holobiotrophic parasites on leaves, stems, flowers, and fruits. These
pathogens cause moderate to serious damage on nearly 10,000 species of
angiosperms (Braun et al. 2002, Glawe 2008). Braun (1987) introduced a
classification of the Erysiphaceae that split the family into 18 genera, including
Erysiphe, Microsphaera, and Uncinula. Later Braun & Takamatsu (2000)
reduced the genera Microsphaera and Uncinula to synonymy with Erysiphe s.
lat. based on phylogenetic analyses and proposed two new non-phylogenetic
sections: E. sect. Uncinula (Lév.) U. Braun & Shishkoff and E. sect. Microsphaera
are characterized by having chasmothecial appendages with dichotomously
branched tips.
Three species of Erysiphe sect. Microsphaera — E. magnifica (U. Braun)
U. Braun & S. Takam., E. magnoliae (Sawada) U. Braun & S. Takam., and
E. bulbosa (U. Braun) U. Braun & S. Takam. — have been recorded on Magnolia
spp. Erysiphe magnifica is a well-known species infecting Magnolia species in
North and South America, eastern Asia, and Europe (Braun 1987 & 1995,
154 ... Cho & al.
Glawe 2003, Braun & Cook 2012, Farr & Rossman 2014). Erysiphe magnoliae
is known from Japan and Korea as the causal agent of powdery mildew on
M. obovata (Nomura 1997, Braun & Cook 2012, Takamatsu et al. 2013). This
species is clearly distinguished from E. magnifica by having conidiophore foot-
cells with inflated bases, and the status of E. magnoliae as a separate species has
recently been confirmed by molecular data (Takamatsu et al. 2013). Erysiphe
bulbosa, endemic to China, was recorded on M. liliiflora (Braun 1988; Wang
1987). This fungus can be differentiated from E. magnifica and E. magnoliae by
having chasmothecial appendages with a distinct swelling at the base.
During a field survey of phytopathogenic fungi carried out after the
publication of comprehensive descriptions of powdery mildews in Korea (Shin
1988, 2000), a new powdery mildew species was found on Magnolia species. In
a previous study, it was suggested that E. magnoliae has unique characteristics
compared to other powdery mildew species described on Magnolia (Takamatsu
et al. 2013). However, this study, which focused on E. magnoliae, was not a
comprehensive study of Magnolia powdery mildews.
We describe our new species found in Korean and Japanese specimens based
on morphological characters and molecular analyses and discuss relationships
with closely related powdery mildew fungi infecting Magnolia species.
Materials & methods
The fungus was detached from the infected leaves and mounted in a few drops
of distilled water on a glass slide for light microscopy. The morphology of the fungal
structures was examined in bright field and differential interference contrast (DIC)
light microscopy, using an Olympus BX51 microscope (Olympus, Tokyo, Japan) for
measurements and a Zeiss AX10 microscope equipped with AxioCam MRc5 (Carl
Zeiss, G6ttingen, Germany) for photographs. The measurements were performed at
100x, 200x, 400x, and 1000x magnifications. Voucher specimens were deposited in
the Korea University Herbarium (KUS), Korea; and the Mie University Mycological
Herbarium (MUMH), Japan.
Genomic DNA was extracted from chasmothecia using the Chelex 100 as previously
described (Walsh et al. 1991, Hirata & Takamatsu 1996). The 28S rDNA (including
domains D1 and D2) and internal transcribed spacer (ITS) rDNA (ITSI, 5.8S, ITS2)
regions were amplified by the polymerase chain reaction (PCR), and then sequenced
directly (Takamatsu et al. 2009). The sequences were edited using the DNASTAR
computer package version 5.05 (Lasergene, Madison, WI, USA) and resulting sequences
were deposited in GenBank under the accession numbers of KJ567065-KJ567075.
Additional sequences of Erysiphe spp. were retrieved from GenBank. Alignments were
done with an online version of MAFFT 7 (Katoh & Standley 2013). Maximum likelihood
analyses were performed using PhyML 3.0 (Guindon & Gascuel 2003). The best fitting
substitution models were determined with jModelTest 2.1.4 (Darriba et al. 2012). The
branches of the inferred tree were tested by the bootstrap analysis of 1000 replicates.
The phylogenetic tree generated from the ITS analysis was deposited in TreeBASE
(http://www.treebase.org/) under the accession number of $15516.
Erysiphe magnoliicola sp. nov. (Japan, Korea) ... 155
Taxonomy
Erysiphe magnoliicola S.E. Cho, S. Takam. & H.D. Shin, sp. nov. FIG. 1
MycoBank MB 808247
Differs from Erysiphe magnifica by its longer conidiophore foot-cells and its smaller
number of chasmothecial appendages and from E. magnoliae by its conidiophore foot-
cells with a cylindrical base.
Fic. 1. Erysiphe magnoliicola. A-C: Conidiophores. D: Conidia. E: Appressoria. F: Surface view of
a conidium showing angular/rectangular wrinkling pattern. G: Chasmothecium containing several
asci. H: Appendage. I: Asci containing 4-6 ascospores. Scale bars: A~D, H-I = 50 um; E-F = 10 um;
G = 100 um.
156 ... Cho & al.
Type: 38°11’31”N 128°21’44”E, on Magnolia sieboldii K.Koch (Magnoliaceae), 24
September 2012, H.D. Shin & S.E. Cho (Holotype, KUS-F26977; GenBank KJ567072,
KJ567065).
Erymo.oey: The epithet is derived from the host plant genus.
CoLoniges amphigenous, thinly effused or conspicuous, forming circular
to irregular white patches. HyPHAE straight or almost so, hyaline, septate,
branched, 4-8 um wide. HyPpHAL APPRESSORIA well developed, moderately
lobed to multi-lobed, solitary or in opposite pairs. CONIDIOPHORES arising
from the upper part of mother cells, 85-137 x 8.5-10 um, producing conidia
singly, followed by 2 to 3 cells. FooT-cELLs mostly straight or almost so, slightly
sinuous at the base, relatively long, 42.5-70 um. Conrp1a formed singly,
hyaline, ellipsoidal to oval, 32.5-42.5 x 17.5-21.3 um with a length/width ratio
of 1.6-2.5, lacking fibrosin bodies, producing germ tubes on perihilar position,
with an angular/rectangular wrinkling pattern on the surface. CHASMOTHECIA
amphigenous, mostly hypophyllous, cauligenous, gregarious, dark brown,
spherical, 100-140 um diam., containing 4—7 asci. PERIDIUM CELLS irregularly
polygonal or rounded, 10-25 um wide. APPENDAGES equatorial, 6-10, mostly
aseptate, rarely 1l-septate, 4-5 times regularly dichotomously branched,
0.5-1 times as long as the chasmothecial diam., 70-100 x 7.5-9 um, tips
distinctly recurved, brown at the base, becoming paler toward the tip. Asc1
obovoid to ellipsoid or saccate, mostly short-stalked, 57.5-70 x 40-45 um,
containing 3-6 spores per ascus. ASCOSPORES hyaline, oblong-ovoid, 20-27.5
LQ 1225200.
ADDITIONAL SPECIMENS EXAMINED —
On Magnolia sieboldii: KOREA, PYEONGCHANG, Byeongnae-ri, 13 Sep. 1999, H.D. Shin
(KUS-F16655); HONGCHEON, Bukbang-myeon, 29 Sep. 2000, H.D. Shin (KUS-F17710);
17 Sep. 2001, H.D. Shin (KUS-F18474); 11 Oct. 2002, H.D. Shin (KUS-F19252); 9
Sep. 2007, H.D. Shin (KUS-F22848); Nae-myeon, 20 Aug. 2012, H.D Shin & S.E. Cho
(KUS-F26833); Suwon, Seodun-dong, 5 Nov. 2004, H.D. Shin (KUS-F20960); 20 Sep.
2005, H.D. Shin (KUS-F21395); NAMYANGJU, Experimental Farm of Korea University,
19 Oct. 2005, H.D. Shin (KUS-F21546; GenBank KJ567072, KJ567065); Sudong-myeon,
13 Aug. 2012, H.D. Shin & S.E. Cho (KUS-F26807); GANGNEUNG, Seongsan-myeon,
29 Aug. 2011, H.D. Shin & S.E. Cho (KUS-F26035); 3 Oct. 2012, H.D. Shin & S.E.
Cho (KUS-F27041); GAPYEONG, Seolak-myeon, 23 Aug. 2012, H.D. Shin & S.E. Cho
(KUS-F26843); InjJE, Yongdae-ri, 24 Sep. 2012, H.D. Shin & S.E. Cho (KUS-F26977);
GYEONGJU, Forest Environment Research Institute, 8 Oct. 2012, H.D. Shin & S.E. Cho
(KUS-F27077).
On Magnolia liliiflora Desr.. KOREA, Suwon, Seodun-dong, 17 Oct. 1997, H.D.
Shin (KUS-F14447); 4 Oct. 1999, H.D. Shin (KUS-F16918); 16 Oct. 2008, H.D. Shin
(KUS-F23831); 19 Oct. 2011, H.D. Shin & S.E. Cho (KUS-F26353); 14 Aug. 2012, H.D.
Shin & S.E. Cho (KUS-F26821); 11 Oct. 2012, H.D. Shin & S.E. Cho (KUS-F27100);
Jinju, Gajwa-dong, 15 Oct. 2003, H.D. Shin (KUS-F19903; GenBank KJ567074,
KJ567069); 1 July 2004, H.D. Shin (KUS-F20383); Jesu, Jeju-si, 13 Nov. 2003, H.D. Shin
Erysiphe magnoliicola sp. nov. (Japan, Korea) ... 157
(KUS-F20074); 23 Oct. 2012, H.D. Shin & S.E. Cho (KUS-F27154); GYEONGJU, Forest
Environment Research Institute, 17 Jun. 2011, H.D. Shin (KUS-F25786); SEOUL, Korea
Forest Research Institute, 13 Oct. 2012, H.D. Shin & S.E. Cho (KUS-F27111; GenBank
KJ567073, KJ567067).
On Magnolia denudata Desr.: JAPAN, Giru PREFECTURE, Sekigahara-cho, 8 Nov. 2011,
S. Takamatsu & J. Meeboon (MUMH5501; GenBank KJ567075, KJ567068).
Phylogenetic analyses
ADDITIONAL SPECIMENS SEQUENCED - Erysiphe magnifica: JAPAN, AICHI
PREFECTURE, Nagoya-shi, Higashiyama Botanical Garden, on Magnolia liliiflora, 13
Oct. 2011, S. Takamatsu & J. Meeboon (MUMH5353; GenBank KJ567070, KJ567066).
On Magnolia sp.. ARGENTINA, BUENOs AIRES, Japanese Garden, on Magnolia sp., 12
Mar. 2004, S. Takamatsu (MUMH2539; GenBank KJ567071).
Based on the molecular phylogenetic trees generated from the PhyML analyses,
sequences generated from four isolates of E. magnoliicola (the Korean holotype,
two other Korean isolates, and one Japanese isolate) formed an independent
ITS clade with 99% bootstrap support, and an independent 28S clade with 87%
bootstrap support (Fics 2-3). This lineage was separated from E. magnoliae and
E. magnifica in ITS and 28S trees. Both phylogenetic analyses clearly support
E. magnoliicola as an independent species.
Discussion
Erysiphe magnifica, described from the United States, has been recorded on
Magnolia spp. throughout the world, including Korea and Japan (Braun & Cook
2012, Farr & Rossman 2014). It has also been found on lotus, Nelumbo nucifera
Gaertn. (Nelumbonaceae), in a glasshouse in Germany and the identity of this
unusual collection has been confirmed based on morphological characteristics
and molecular sequence analysis (Kirschner 2010). Erysiphe magnifica differs
from E. magnoliicola by its shorter conidiophore foot-cells (15-45 um) and
its more numerous chasmothecial appendages (5-23; Braun & Cook 2012).
Erysiphe magnoliae, which has been reported on M. obovata in Korea and
Japan, is clearly distinguished from E. magnoliicola by having conidiophores
with shorter (15-25 um) basally inflated foot-cells (Takamatsu et al. 2013).
Erysiphe bulbosa is quite distinct from other species on Magnolia spp., and
unique in having chasmothecial appendages with swollen bases (Braun 1988);
the anamorph of E. bulbosa is still unknown.
Although E. magnoliicola is phylogenetically close to E. magnoliae, the
sequence analyses (Fics 2-3) clearly distinguish two species and support the
hypothesis that they have diverged from a common ancestor; E. magnoliae
is sister to the E. magnoliicola clade with BS values of 89% (ITS) and 82%
(28S). Erysiphe magnifica, which is not closely related to E. magnoliae and
E. magnoliicola, may have developed independently from a separate lineage.
158 ... Cho & al.
KJ567073 E. magnoliicola ex Magnolia liliiflora (Korea)
99 |KJ567074 E. magnoliicola ex M. liliiflora (Korea)
KJ567072 E. magnoliicola ex M. sieboldii (Korea) — Type
KJ567075 E. magnoliicola ex M. denudata (Japan)
JX235968 E. magnoliae ex M. obovata (Japan)
JX235964 E. magnoliae ex M. obovata (Korea)
95° JX235966 E. magnoliae ex M. obovata (Korea)
AB016048 E. macleayae
AB104516 E. betae
EF592611 E. cruciferarum
AF298542 E. trifoliorum
GU361636 E. pisi
AB015921 E. lespedezae
AF011298 E. convolvuli
g9f_ AB104522 E. polygoni
AB000942 E. heraclei
JN603995 E. heraclei
99 r AFO11311 E. platani
JQ365943 E. platani
GU195046 E. magnifica ex M. liliiflora (Germany)
- GU195045 E. magnifica ex Nelumbo nucifera (Germany)
KJ567070 E. magnifica ex M. liliiflora (Japan)
KJ567071 E. magnifica ex Magnolia sp. (Argentina)
AF011312 E. magnifica ex M. liliiflora (U.S.A)
AF298545 E. castaneigena
AB292724 E. hypogena
AB292720 E. epigena
AB015915 E. pseudolonicerae
JN564751 E. alphitoides
EF672350 E. alphitoides
JN564765 E. quercicola
AB015917 E. ligustri
86 "AB295458 E. syringae-japonicae
AB015928 E. juglandis
72
78
9
—" 0.02
Fic. 2. Phylogenetic relationship between Erysiphe sequences and some reference isolates retrieved
from GenBank, inferred by PhyML using the ITS rDNA region. Numbers above the branches
represent the bootstrap values of over 70% obtained from 1000 bootstrap replicates. New sequences
are indicated with bold font. Bar = number of nucleotide substitutions per site.
Erysiphe magnoliicola sp. nov. (Japan, Korea) ... 159
AB475109 E. clandestina
AB480230 E. kenjiana
AB701304 E. japonica
JQ220158 E. asiatica
99|AB252459 E. arcuata
AB252473 E. arcuata
AB022389 E. pulchra var. japonica
79 AB571057 E. ligustri
AB571060 E. syringae-japonicae
AB022405 E. aquilegiae var. ranunculi
AB102942 E. pisi
JX235967 E. magnoliae ex Magnolia obovata (Japan)
JX235966 E. magnoliae ex M. obovata (Japan)
KJ567068 E. magnoliicola ex M. denudata (Japan)
871 KJ567067 E. magnoliicola ex M. liliiflora (Korea)
KJ567069 E. magnoliicola ex M. liliiflora (Korea)
KJ567065 E. magnoliicola ex M. sieboldii (Korea) — Type
78 AB022382 E. friesii var. dahurica
AB022391 E. heraclei
AB571048 E. syringae
GU198953 E. magnifica ex Nelumbo nucifera (Germany)
KJ567066 E. magnifica ex M. liliiflora (Japan)
AB271785 E. abbreviata
99 |AB292720 E. epigena
AB292722 E. epigena
77| JAB237811 E. alphitoides
AB257431 E. hypophylla
98} AB292691 E. quercicola
AB292694 E. quercicola
AB292716 E. hypophylla
AB329673 Neoerysiphe galeopsidis
82
> 0201
Fic. 3. Phylogenetic relationship between Erysiphe sequences and some reference isolates retrieved
from GenBank, inferred by PhyML using the 28S rDNA region. Numbers above the branches
represent the bootstrap values of over 70% obtained from 1000 bootstrap replicates. New sequences
are indicated with bold font. Bar = number of nucleotide substitutions per site.
Molecular analyses of E. bulbosa have not yet been performed and are urgently
required to address the phylogenetic relationships of powdery mildews on
Magnolia.
Magnolia is a large genus, with about 210 species in Magnoliaceae subfam.
Magnolioideae, including M. liliiflora and M. denudata native to China and
M. sieboldii native to eastern Asia (China, Japan, and Korea; Azuma et al. 1999).
These species are planted as ornamental trees throughout the world. Sequences
160 ... Cho & al.
KJ567070 (Fic. 2) and KJ567066 (Fic. 3) came from a specimen of E. magnifica
on M. liliiflora collected in the American Magnolia Garden in Higashiyama
Botanical Garden, Nagoya, Japan. It has been suggested that the tree might
have been imported from the United States and planted in the Japanese garden
for ornamental purpose. ITS sequences retrieved from E. magnifica collections
on M. liliiflora in North America, Argentina, and Germany and on N. nucifera
in Germany have already been reported (Fic. 2). Erysiphe magnifica has been
recorded on four Magnolia species (M. kobus, M. obovata, M. liliiflora, and
M. sieboldii) in Korea (Shin 2000, Korean Society of Plant Pathology 2009).
Although Lee (1975) recorded E. magnifica on M. kobus, no herbarium material
has been preserved, and one of us (HDS) has not found any powdery mildews
on M. kobus during his over 30 years’ of field-work in Korea. Therefore, presence
or identity of E. magnifica on M. kobus in Korea is obscure. Recently, powdery
mildew caused by E. magnoliae (previously known as M. magnifica in Korea)
on M. obovata in Korea and Japan was re-examined morphologically and
phylogenetically (Takamatsu et al. 2013). We introduce Erysiphe magnoliicola
as a new species on M. liliiflora and M. sieboldii in this study and confirm
E. magnoliae and E. magnoliicola as causative agents of powdery mildews on
Magnolia spp. in East Asia.
Key to species of Erysiphe sect. Microsphaera on Magnolia spp.
1. Chasmothecial appendages distinctly swollen at the base .............. E. bulbosa
1. Chasmothecial appendages not swollen at the base .............. 00.0.0 e eae ps
2. Foot-cells of conidiophores inflated at the base ...................4. E. magnoliae
2. Foot-cells of conidiophores not inflated at the base ................... 022000 3
3. Foot-cells of conidiophores relatively short (15-40 um); chasmothecia with
S525 ChASMOLNECial APPEHMAGES” nse win cteb, wlmeiden acide allnata « chovatare rat E. magnifica
3. Foot-cells of conidiophores relatively long (42.5-70 um); chasmothecia with
G=10ichasmothecial*appendages: te wnwtoe Met 5 ule. 2 ations atleast E. magnoliicola
Acknowledgements
The authors thank Uwe Braun (Martin Luther University, Halle, Germany) and
Wieslaw Mulenko (Maria Curie-Sklodowska University, Lublin, Poland) for serving as
pre-submission reviewers. This work was supported by the BK21 Plus program in 2013
funded by National Research Foundation of Korea (NRF) and a grant from the Institute
for Fermentation, Osaka, Japan.
Literature cited
Azuma H, Thien LB, Kawano S. 1999. Molecular phylogeny of Magnolia (Magnoliaceae) inferred
from cpDNA sequences and evolutionary divergence of the floral scents. J. Plant Res. 112:
291-306. http://dx.doi.org/10.1007/PL00013885
Braun U. 1987. A monograph of the Erysiphales (powdery mildew). Beih. Nova Hedwigia 89: 1-700.
Erysiphe magnoliicola sp. nov. (Japan, Korea)... 161
Braun U. 1988. Microsphaera bulbosa nom. nov. Mycotaxon 31: 171.
Braun U. 1995. The powdery mildews (Erysiphales) of Europe. G. Fischer, Jena.
Braun U, Cook RTA. 2012. Taxonomic manual of the Erysiphales (powdery mildews). CBS
Biodiversity Series No.11. CBS, Utrecht.
Braun U, Takamatsu S. 2000. Phylogeny of Erysiphe, Microsphaera, Uncinula (Erysipheae) and
Cystotheca, Podosphaera, Sphaerotheca (Cystotheceae) inferred from rDNA ITS sequences:
some taxonomic consequences. Schlechtendalia 4: 1-33.
Braun U, Cook RTA, Inman AJ, Shin HD. 2002. The taxonomy of the powdery mildew fungi.
13-55, in: RR Bélanger et al. (eds). The powdery mildews: a comprehensive treatise. American
Phytopathological Society Press, St. Paul, USA.
Darriba D, Taboada GL, Doallo R, Posada D. 2012. jModelTest 2: more models, new heuristics and
parallel computing. Nat. Methods 9(8): 772. http://dx.doi.org/10.1038/nmeth.2109
Farr DE, Rossman AY. 2014. Fungal databases. Syst. Mycol. Microbiol. Lab., Online publication,
ARS, USDA. Retrieved January 17, 2014.
Glawe DA. 2003. First report of powdery mildew of Magnolia caused by Microsphaera
magnifica (Erysiphe magnifica) in the Pacific Northwest. Plant Health Progress (online).
http://dx.doi.org/10.1094/PHP-2003-0512-02-HN
Glawe DA. 2008. The powdery mildews: a review of the world’s most familiar (yet poorly known)
plant pathogens. Annu. Rev. Phytopathol. 46: 27-51.
http://dx.doi.org/10.1146/annurev.phyto.46.081407.104740
Guindon S, Gascuel O. 2003. A simple, fast and accurate algorithm to estimate large phylogenies by
maximum likelihood. Syst. Biol. 52: 696-704. http://dx.doi.org/ 10.1080/10635 150390235520
Hirata T, Takamatsu S. 1996. Nucleotide diversity of rDNA internal transcribed spacers extracted
from conidia and cleistothecia of several powdery mildew fungi. Mycoscience 37: 283-288.
http://dx.doi.org/10.1007/BF02461299
Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Mol. Biol. Evol. 30(4): 772-780. http://dx.doi.
org/10.1093/molbev/mst010
Kirschner R. 2010. First record of Erysiphe magnifica on lotus, a host outside the Magnoliales.
Mycol. Prog. 9: 417-424. http://dx.doi.org/10.1007/s11557-009-0651-z
Korean Society of Plant Pathology. 2009. List of plant diseases in Korea. 5th ed. Suwon, Korea.
Lee HJ. 1975. Unrecorded causal organisms of Korean powdery mildews (IV). Bull. Hyosong
Women’s Coll. 16: 439-449.
Nomura Y. 1997. Taxonomical study of Erysiphaceae of Japan. Yokendo Ltd., Tokyo, Japan.
Shin HD. 1988. Erysiphaceae of Korea. Thesis, Department of Agricultural Biology, Graduate
School of Seoul National University.
Shin HD. 2000. Erysiphaceae of Korea. National Institute of Agricultural Science and Technology,
Suwon, Korea.
Takamatsu S, Heluta V, Havrylenko M, Divarangkoon R. 2009. Four powdery mildew species with
catenate conidia infect Galium: molecular and morphological evidence. Mycol. Res. 113(1):
117-129. http://dx.doi.org/10.1016/j.mycres.2008.09.006
Takamatsu S, Cho SE, Meeboon J, Shin HD. 2013. Revisiting Erysiphe magnoliae with morphological
and molecular data. Sydowia 65: 13-20.
Walsh PS, Metzger DA, Higuchi R. 1991. Chelex 100 as a medium for simple extraction of DNA for
PCR-based typing from forensic material. BioTechniques 10: 506-513.
Wang AQ. 1987. A new genus of powdery mildew. Acta Mycologica Sinica 6: 74-76.
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.163
Volume 129(1), pp. 163-168 July-September 2014
Phoma recepii sp. nov. from the Caloplaca cerina group
in Turkey
MEHMET GOKHAN HAticr’, MEHMET CANDAN?,
MrrHat GULL, & AHMET OZCAN*
' University of Erciyes, Faculty of Science, Department of Biology 38039 Kayseri, Turkey
? University of Anadolu, Faculty of Science, Department of Biology Eskisehir, Turkey
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Phoma recepii is described from the apothecia of epiphytic Caloplaca cerina and
C. monacensis in the western part of Turkey. The new species is characterized by having the
narrowest conidia amongst the lichenicolous Phoma species. Phoma caloplacae is reported
from Turkey for the first time.
Key worps — biodiversity, coelomycetes, lichens, mitosporic fungi, Teloschistaceae
Introduction
Phoma Sacc. comprises approximately 220 species, most of which are
plant pathogens, endophytes, or saprophytes (Boerema et al. 2004). Within
this large genus, 23 species are obligately lichenicolous (Hawksworth 1981,
Hawksworth & Cole 1994, Diederich et al. 2007, Brackel 2008, Kondratyuk et
al. 2010, Lawrey et al. 2012). According to Lawrey et al. (2012), the multilocus
phylogeny of Phoma places this genus in the Phaeosphaeriaceae (Pleosporales,
Dothideomycetes).
Of the 182 species of lichenicolous fungi known from Turkey (Halic: et al.
2012), only one Phoma species, P. peltigerae (P. Karst.) D. Hawksw. on Peltigera
spp., has been reported from the country (Candan et al. 2010; Halici et al.
2012). During the Turkish Teloschistales project we discovered a new Phoma
species on the apothecia of Caloplaca cerina and C. monacensis, and found
P. caloplacae for the first time in Turkey.
Material & methods
Sections were prepared by hand and examined in I [Lugol’s iodine (MERCK 9261) with
(KI) and without (I) pre-treatment with 10% KOH], 10% KOH, cotton blue, and water.
164 ... Halici & al.
Conidia and pycnidia, which were measured in water, are given as: (min-)X-sd-X-
X+sd(-max.), where ‘min’ and ‘max. represent the extreme values, “X’ the arithmetic
mean, and ‘sd’ the corresponding standard deviation. The microphotographs were
taken with a Leica DFC 420 digital microscope camera with a c-mount interface and
with a 5 megapixel CCD. The type of the new species is deposited in Erciyes University
Herbarium Kayseri, Turkey (EUH).
Taxonomy
Phoma recepii Halici & Candan, sp. nov. FIGURE 1
MycoBank MB 810538
Differs from all lichenicolous Phoma species in having the narrowest conidia.
Type: Turkey, Denizli, south-east of Honaz Mount National Park, northwest of Tavas,
37°A1’N 29°15’E, alt. 1750 m, Juniperus communities, calcareous motherrock, on
apothecia of Caloplaca monacensis on Juniperus sp., 5 July 2012, M.G. Halici & M. Candan
(Holotype, EUH (MGH 0.3441)).
Erymotocy: The epithet honors Recep Yazicioglu, the former governor of Denizli
Province, who was known as “Super Governor” by the public and was killed in a traffic
accident in 2 September 2003.
Conidiomata pycnidial, first immersed in the apothecia of the host lichen
(Caloplaca cerina, C. monacensis), but at maturity becoming partially erumpent,
scattered, black in macroscopical view, in section brown in lower parts and dark
brown in the upper parts, covered by a hyaline gelatinous sheath, subglobose to
almost globose, (50—)54.5—62-69(—80) x (42—)46.5—50-55(—65) um (n = 20),
ostiolate, ostiole c. 10 um diam; pycnidial wall 8-14 um thick, composed of
2-3 layers of pseudoparenchymatous cells, mainly polyhedral but some globose,
outer cells brown, about 4.5—7.5 x (3-)4—5(—6.5) um, inner ones hyaline,
4—7 um thick. Cells near the ostiole have a darker brownish tinge. Conidiogenous
cells lining the inner wall of the pycnidial cavity, short ampulliform to
subglobose, hyaline, smooth-walled, 6-9 x 3.5-5.5 um, conidiogenesis
enteroblastic. Conidia abundantly produced, arising singly, narrowly ellipsoid
to almost bacilliform, rounded at the ends, hyaline, simple, smooth-walled,
2.5-—3-3.5 x 1 um (n = 100).
ADDITIONAL SPECIMEN EXAMINED: TURKEY, Manisa, Akhisar, south-west of Dagdere
Village, 38°58’N 28°01’E, alt. 855 m, Juniperus communities, calcareous motherrock, on
apothecia of Caloplaca cerina on Juniperus sp., 30 July 2012, M.G. Halici & M. Candan
(MGH 0.3443).
ECOLOGY & DISTRIBUTION: Phoma recepii is currently known only from
two localities in the inner parts of Aegean Region, Turkey on the apothecia
Fic. 1. Phoma recepii (Holotype, MGH 0.3441): A, B, Infected apothecial discs of the host lichen
Caloplaca monacensis; C, F, Pycnidia immersed in the hymenium of the host lichen (F in cotton
blue); D, Conidia; E, Surface view of pycnidial wall; G, Conidiogenous cells making a line inside
the pycnidia.
Phoma recepii sp. nov. (Turkey) ... 165
166 ... Halici & al.
Fic. 2. Phoma caloplacae (MGH 0.7216): A, Infected apothecial disc of the host lichen Caloplaca
stillicidiorum; B, Conidiogenous cells and conidia.
of Caloplaca cerina and Caloplaca monacensis on bark of Juniperus spp. at
high elevations (850-1750 m). The species seems to be weakly pathogenic
in the beginning, as the infected apothecial discs of the host lichen become
discoloured and brownish. Also as seen in the section, ascospore production
appears to be inhibited in infected parts of the hymenium. Finally it completely
damages the infected apothecia of the host lichen. As the host lichen has a wide
distribution in the northern hemisphere, P. recepii may have a similarly wide
distribution.
Notes: Four Phoma species (P. caloplacae, P. fuliginosa, P. pisutii, P. xantho-
mendozae) have previously been described on the apothecia of members of
the Teloschistales, all of which have longer and wider conidia than P. recepii
(TABLE 1).
Similar to P recepii, P. caloplacae D. Hawksw. grows in the hymenium of
Caloplaca cerina but clearly differs from P. recepii in producing subglobose
conidia (Hawksworth 1981). We also collected P caloplacae in the central
part of Anatolia on apothecia of Caloplaca stillicidiorum (FiGuRE 2), which
represents a new species record for Turkey:
PHOMA CALOPLACAE SPECIMENS EXAMINED: TURKEY, Kaysert, Incesu, Godkdag,
Western slopes of Mount Erciyes, 38°34’N 35°19’E, alt. 1750 m, crevices of siliceous
rocks, on apothecia of Caloplaca stillicidiorum on mosses, 24 July 2003, M.G. Halic1
(MGH 0.7216); Konya, Seydisehir, Seydisehir-Beysehir highway, NW of Nohuttas
Position, 37°29’N 31°49’E, alt. 1200 m, crevices of siliceous rocks, on apothecia of
Caloplaca stillicidiorum on mosses, 14 June 2013, M.G. Halici & M. Candan (MGH
0972.17):
Phoma fuliginosa M.S. Cole & D. Hawksw., described on the apothecia of
Xanthomendoza trachyphylla from USA (Nebraska), has larger and longer
conidiogenous cells and conidia (Hawksworth & Cole 2004). Phoma pisutii
Phoma recepii sp. nov. (Turkey) ... 167
TABLE 1. Comparison of Phoma species growing on Teloschistales members
CONIDIOMATA CONIDIOGENOUS CONIDIA REFERENCE
SPECIES
(uum) CELLS (um) (um)
Hawk h
P. caloplacae 50-130 5-6 4-7 Heh i
5-7.5 x 5-6.5 x Hawksworth & Cole
P. fuligi 50-75
fuliginosa ale 3 (1994)
3.5-4.5 x 4-7 x Kondratyuk et al.
P pisutii 110-17
paar ee 2:523;5 gag (2010)
P recepii Anke rate ae mee Present paper
she 42-65 3.5-5.5 «1 Pap
5-10 x 4.5-8.5 x Lawrey et al.
P 140-1
xanthomendozae 0-160 25-35 3-4.5 (2012)
S.Y. Kondr. et al., described on Xanthomendoza ulophyllodes from Ukraine
and USA, has much larger pycnidia and wider conidia (Kondratyuk et al.
2010). Phoma xanthomendozae Diederich & Freebury, recently described on
Xanthomendoza hasseana and X. montana from Canada, has much larger
pycnidia and wider conidia (Lawrey et al. 2012).
Phoma recepii has the narrowest conidia among the lichenicolous Phoma
species. Phoma lecanorina Diederich, which has pycnidia immersed in the
host thallus of Lecanora expallens, has longer and slightly wider conidia
(3.2-5 x 1.2-1.6 um) and smaller pycnidia (15-60 um; Diederich 1986).
Phoma puncteliae Diederich & Lawrey, described on Punctelia rudecta from
USA, has smaller pycnidia (40-60 um) and wider conidia ((2.3—)2.5—3(—3.1)
x (1.9-)2-2.4(—2.5) um; Lawrey et al. 2012). Phoma everniae D. Hawksw., a
minute species known on older basal fronds of Evernia prunastri in UK, has
smaller pycnidia ((20—)30(-—35) um in diam.) and longer and slightly wider
conidia (4.5-5 x 1-1.5 um; Hawksworth 1994). Phoma dubia (Linds.) Sacc.
& Trotter, a species known on Usnea spp. in New Zealand, has longer and
slightly wider conidia (3.5-5 x 1.5—2 um) and possesses golden brown cells
with thicker walls near the ostiole (Hawksworth 1981).
Acknowledgements
The manuscript was reviewed prior to submission by Kerry Knudsen (USA) and
Wolfgang von Brackel (Germany). This study was financially supported by TUBITAK
(111T927 coded project) and FDA-2013-4422 coded Erciyes University project.
Literature cited
Boerema GH, Gruyter J de, Noordeloos ME, Hamers MEC. 2004. Phoma identification manual.
Differentiation of specific and infra-specific taxa in culture. CABI Publishing, Wallingford, UK.
Brackel W. 2008. Phoma ficuzzae sp. nov. and some other lichenicolous fungi from Sicily, Italy.
Sauteria 15: 103-120.
168 ... Halici & al.
Candan M, Halici MG, Ozdemir Tiirk A. 2010. New records of peltigericolous fungi from Turkey.
Mycotaxon 111: 149-153. http://dx.doi.org/10.5248/111.149
Diederich P. 1986. Lichenicolous fungi from the Grand Duchy of Luxembourg and surrounding
areas. Lejeunia 119: 1-26.
Diederich P, Kocourkova J, Etayo J, Zhurbenko M. 2007. The lichenicolous Phoma species
(coelomycetes) on Cladonia. Lichenologist 39: 153-163.
Halici MG. 2008. A key to the lichenicolous Ascomycota (including mitosporic fungi) of Turkey.
Mycotaxon 104: 253-286.
Halici MG, Candan M, Ozdemir Tiirk A. 2012. A key to the peltigericolous fungi in Turkey.
Mycotaxon 119: 277-289. http://dx.doi.org/10.5248/119.277
Hawksworth DL. 1981. The lichenicolous coelomycetes. Bulletin of the British Museum (Natural
History), Botany 9: 1-98.
Hawksworth DL. 1994. Notes on British lichenicolous fungi: VII. Lichenologist 26: 337-347.
Hawksworth DL, Cole MS. 2004. Phoma fuliginosa sp. nov., from Caloplaca trachyphylla in
Nebraska, with a key to the known lichenicolous species. Lichenologist 36: 7-13.
Kondratyuk S, Karnefelt I, Goward T, Galloway D, Kudratov I, Lackovi¢ova A, Lisicka E, Guttova
A. 2010. Diagnoses of new taxa. 435-445 in: AM Oksner (ed.). Flora li8aynikiv Ukraini y dvoch
tomach, Tom 2, Vypusk 3. Kiiv, Naukovo Dumka.
Lawrey JD, Diederich P, Nelsen MP, Freebury C, Van den Broeck D, Sikaroodi M, Ertz D. 2012.
Phylogenetic placement of lichenicolous Phoma species in the Phaeosphaeriaceae (Pleosporales,
Dothideomycetes). Fungal Diversity 55: 195-213.
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/129.169
Volume 129(1), pp. 169-179 July-September 2014
Geastrum from the Atlantic Forest in northeast Brazil —
new records for Brazil
JULIETH DE OLIVEIRA SOUSA™, BIANCA DENISE BARBOSA DA SILVA?,
& TURI GOULART BASEIA3
‘Programa de Pés Graduagao em Sistematica e Evolucao, Universidade Federal do Rio Grande do
Norte, Campus Universitario, PO Box 59072-970, Natal, RN, Brazil
?Programa de Pés Graduacdo em Biologia de Fungos, Universidade Federal de Pernambuco,
Depto. Micologia, Centro de Ciéncias Biolégicas, Av. Nelson Chaves,
PO Box 50670-420, Recife, PE, Brazil
*Departamento de Botanica, Ecologia e Zoologia, Universidade Federal do Rio Grande do Norte,
Campus Universitario, PO Box 59072-970, Natal, RN, Brazil
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Expeditions to remnants of the Brazilian Atlantic Forest in the Northeast Region
resulted in three noteworthy Geastrum species. Geastrum morganii and G. quadrifidum are
reported for the first time from Brazil, while G. albonigrum is reported for the second time in
South America. Detailed descriptions with taxonomic observations, photos of basidiomes in
situ, and SEM photos are provided.
KEY worps — Geastraceae, Geastrales, gasteroid fungi, taxonomy, biodiversity, neotropics
Introduction
The Atlantic Forest domain that covers most of the east South American
coast represents one of the most extensive rainforests on the continent
(Tabarelli et al. 2005). This biome, a biodiversity hotspot with a wide range
of fungal species, is considered the second most threatened domain on the
planet (Brooks et al. 2006, Myers et al. 2000). Northeastern Brazil encompasses
four of the five centers of endemism that occur in the Brazilian Atlantic Forest
and includes the most degraded sectors of this domain, harboring dozens of
endangered species (Tabarelli et al. 2006).
In Brazil, knowledge of the gasteroid fungi in the Atlantic Forest has
increased over the last ten years so that currently more than 40 gasteroid species
have been recorded for this biome in the Northeast Region (Baseia 2004, 2005;
170 ... Sousa, Silva, & Baseia
BRAZIL BRAZILIAN NORTHEAST REGION
» Rio Grande do Norte
@ PEDN - Natal
SI RPPN - Mata Estrela - Baia Formosa
250 500 1 nite Km
| | |
FiGuRE 1. Map of Brazil’s Northeast Region showing the remnants of Atlantic Rainforest studied.
Baseia et al. 2003a,b, 2006; Baseia & Calonge 2005, 2006, 2008; Leite & Baseia
2007; Leite et al. 2007a,b; Silva et al. 2007, 2013; Fazolino et al. 2008, 2010;
Gurgel et al. 2008; Trierveiler-Pereira & Baseia 2009, 2011; Trierveiler-Pereira
et al. 2009, 2010, 2011a; Barbosa et al. 2011; Cruz et al. 2012).
Sixteen Geastrum species have previously been reported from the
northeastern Brazilian Atlantic Forest: G. coronatum Pers., G. elegans Vittad.,
G. entomophilum Fazolino et al., G. fimbriatum Fr., G. fornicatum (Huds.)
Hook., G. hieronymi Henn., G. hirsutum Baseia & Calonge, G. javanicum
Lév., G. lageniforme Vittad., G. lloydianum Rick, G. ovalisporum Calonge &
Mor.-Arr., G. saccatum Fr., G. schweinitzii (Berk. & M.A. Curtis) Zeller, G.
setiferum Baseia, G. rusticum Baseia et al., and G. triplex Jungh. These species
were collected in various ecosystems including riparian, sand dunes, ‘Restinga,
and coastal tableland. This work provides additional knowledge about Geastrum
in Brazil.
Material & methods
Field expeditions were conducted during the rainy seasons of 2010 and 2012 to
two Atlantic Forest remnants in Rio Grande do Norte State of northeastern Brazil
(Fic.1): ‘Parque Estadual Dunas de Natal’ (PEDN) (5°50’31.23”S 35°11’39.21”W)
and the ‘Reserva Particular do Patriménio Natural Mata Estrela (RPPN Mata Estrela)
(6°22’27.56”S 35°1’24.87”W). Tissues containing basidiospores, eucapillitium, and
exoperidial hyphae were mounted in 5% KOH and then examined with an Olympus
BX41 optical microscope, and scanning electron microscopy (SEM) was used to observe
in detail basidiospore ornamentation, the eucapillitium, and the endoperidial surface
Geastrum species new for Brazil ... 171
with a Phillips XL30-ESEM electronic microscope; preparation for SEM observation
followed Silva et al. (2011). All measurements include basidiospore ornamentation.
Basidiospore abbreviations follow Bates (2004): n = number of randomly measured
basidiospores; x = mean + standard deviation of basidiospore diameter and height
(including ornamentation); Q_ = mean height/width quotient. Color descriptions were
based on Kornerup & Wanscher (1978). All collected specimens were deposited in the
Herbarium of the Federal University of Rio Grande do Norte, Natal, Brazil (UFRN).
Taxonomy
Geastrum albonigrum Calonge & M. Mata, Bol. Soc. Micol. Madrid 28: 332 (2004).
PLATE 1
Unexpanded basidiome epigeous, globose to subglobose, 10-16 x 9-13 mm,
surface hairy, brown (6E4) to dark brown (6E4), not encrusted with debris;
rhizomorph <30 mm long, persistent. Expanded basidiome saccate, 10-13 x
17-26 mm. Exoperidium splitting into 5-7 revolute rays, non-hygroscopic.
Mycelial layer grayish brown (6D3) to dark brown (6F4), hairy, not encrusted,
peeling away in irregular patches with age exposing the fibrous layer. Fibrous
layer white (4A1) to yellowish white (4A2), coriaceous, thick, glabrous, with
rhizomorph attached. Pseudoparenchymatous layer dark brown (6F4, 6F3),
glabrous to rimose, peeling away in irregular patches. Endoperidial body
subglobose 11-13 x 10-11.5 mm, sessile, glabrous, dark brown (7F3), lightly
pruinose, apophysis absent. Peristome fibrillose becoming lacerated with age,
not delimited, concolorous with the endoperidium. Gleba grayish brown (7F2).
Basidiospores globose to subglobose, 3.8-5 x 3.8-5 um [x = 4.6 + 0.2 x 4.6 +
0.4 um, Q_ = 1.01, n = 30], brownish, verrucose; warts short cylindrical with
rounded tips; apiculus inconspicuous. Eucapillitium 2.5-5 um diam., walls
straight, encrusted, lumen present, surface verrucose, brown. Mycelial layer
composed of sinuous-walled hyphae, 2.5-5 um diam., lumen absent, brownish.
Fibrous layer composed of straight-walled hyphae, 2.5-5 um diam., greenish
yellow to hyaline, lumen absent. Pseudoparenchymatous layer composed of
thin-walled (<1 um) hyphal cells, subglobose to pyriform hyphae, 26.6-53.3 x
16.5-34.2 um, hyaline to yellowish.
SUBSTRATE: Sandy soil covered with litter and decaying wood.
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO NorTE: Baia Formosa, RPPN Mata
Estrela, 14.VII.2011, leg. J.O. Sousa & B.D.B. Silva (UFRN-Fungos 1745); 14.VII.2011,
leg. B.D.B. Silva & J.O Sousa (UFRN-Fungos 1747).
DISTRIBUTION: Central America: Costa Rica (Calonge & Mata 2004); North America:
Mexico (Calonge & Mata 2004); South America: Brazil, Mato Grosso State (Treirveiler-
Pereira et al. 2011b), Rio Grande do Norte State (this paper).
TAXONOMIC REMARKS: Geastrum albonigrum is characterized by the
pseudoparenchymatous layer and black endoperidium, white fibrous layer
172 ... Sousa, Silva, & Baseia
Magn 9 /-———4_ 2m
15000x
PLATE 1. Geastrum albonigrum. 1. Fresh basidiomes (UFRN-Fungos 1745). 2. Basidiome
showing the rhizomorph (UFRN-Fungos 1747). 3. Eucapillitium (SEM) (UFRN-Fungos 1745).
4. Basidiospores (SEM) (UFRN-Fungos 1745).
with adhering rhizomorphs, and ephemeral hairy mycelial layer. Geastrum
coronatum, G. lloydianum, and G. ovalisporum also exhibit dark endoperidia,
but these species differ by arched basidiomes, pedicellate endoperidia with
apophysis, and delimited peristomes (Ponce de Leon 1968, Sunhede 1989,
Calonge et al. 2000, Bates 2004). Geastrum hirsutum has immature basidiomes
very similar to those of G. albonigrum, being globose to subglobose with their
surfaces covered with hairs. However, G. hirsutum exhibits distinctly expanded
basidiomes with smaller basidiospores (2.5-3 um), persistent mycelial layer,
a delimited peristome, grayish endoperidium and the presence of a well-
developed subiculum (Calonge & Mata 2004, Baseia & Calonge 2006). Geastrum
fimbriatum is also a closely related species, distinguished by the light brown
to grayish brown endoperidium, hairless mycelial layer with incrustations,
and rhizomorphs that are absent in the expanded basidiome (Sunhede 1989,
Bates 2004, Calonge & Mata 2004). Our SEM image of the eucapillitium
demonstrating a verrucose surface and photos of the fresh expanded basidiome
augment the protologue of G. albonigrum. This constitutes a second report
for South America and a first report for northeastern Brazil for Geastrum
albonigrum.
Geastrum species new for Brazil ... 173
PLATE 2. Geastrum morganii. 5-6. Fresh basidiome (UFRN- Fungos 1793) - (UFRN- Fungos
1744). 7. Basidiospores (SEM) (UFRN- Fungos 1793). 8. Surface of the endoperidium (SEM)
(UFRN- Fungos 1793).
Geastrum morganii Lloyd, Myc. Writ. 1: 80 (1901). PLATE 2
Unexpanded basidiome epigeous, lageniform, subglobose to irregular, 24 x
16 mm, surface papery to rugulose, brown (6E4) to yellowish brown (5D5), not
encrusted, rhizomorph not observed. Expanded basidiome saccate to arched,
9-28 x 10-62 mm. Exoperidium splitting into 6—7 rays, revolute to arched,
elongated with slender tips, non-hygroscopic. Mycelial layer brown (6E5) to
dark brown (6F5), papery, not encrusted, persistent or peeling away with age.
Fibrous layer yellowish white (4A2) to white orange (5A2), coriaceous, rigid.
Pseudoparenchymatous layer dark brown (7F4), thick (<3 mm when fresh),
peeling away in irregular patches from the base of the rays, forming longitudinal
cracks or a collar-like structure surrounding the endoperidium. Endoperidial
body globose to subglobose, 6—24 x 7-26 mm, sessile, with protruding hyphae,
orange brown (5C3) to light brown (6D4), apophysis absent. Peristome
irregularly plicate, not delimited, conical, with 5-11 irregular folds, 2-4 mm
high, lighter or darker than the endoperidium. Gleba dark brown (7F3).
Basidiospores globose to subglobose, 3.8-6(-6.9) x 3.8-6(-6.8) um [x = 5.3 +
0.4 5.2+0.4 um, Q = 1.03, n = 30], dark brown, strongly verrucose; verrucae
174 ... Sousa, Silva, & Baseia
long and columnar with plane tips, slightly truncated; apiculus inconspicuous.
Eucapillitium 2.5—6 um diam., walls sinuous thin (<1 um), surface encrusted,
verrucose, yellowish white. Mycelial layer composed of thick (>1 um) sinuous-
walled hyphae, 2.5-4.0 um diam., lumen absent, clamp connections present,
yellowish. Fibrous layer composed of straight-walled hyphae, 2.5-5 um diam.,
lumen absent, hyaline to slightly greenish. Pseudoparenchymatous layer
composed of thin-walled (<1 um) hyphal cells, oval, ellipsoid to pyriform,
29.2-82.5 x 20-42 um, hyaline to slightly brownish. Endoperidium with
protruding hyphae agglutinated.
SUBSTRATE: Sandy soil covered with litter.
SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO NorTE: Baia Formosa, RPPN Mata
Estrela, 14.VII.2010, leg. B.D.B. Silva, J.O. Sousa & IG. Baseia (UFRN-Fungos 1744);
14.VII.2011, leg. J.O. Sousa & B.D.B Silva (UFRN-Fungos 1746); 14.VII.2012, leg. J.O.
Sousa, B.D.B. Silva & J.C. Bezerra (UFRN-Fungos 1793); Serra Negra do Norte, Estacao
Ecoldgica do Serid6, 19.IV.2008, leg. E.P Fazolino, B.B.B. Silva & J.J.S. Oliveira (UFRN-
Fungos 816).
DISTRIBUTION: Africa: Congo (Dissing & Lange 1962); Central America: Costa Rica
(Calonge & Mata 2006); Europe: France (Sunhede 1989); North America: United States
(Coker & Couch 1928), Hawaii (Hemmes & Desjardin 2011); South America: Argentina
(Caffot et al. 2013), Brazil (this paper).
TAXONOMIC REMARKS: This species is characterized by its non-delimited,
irregularly plicate peristome, a mycelial layer lacking incrustations, saccate
to arched basidiomes, and a sessile endoperidium (Hemmes & Desjardin
2011, Sunhede 1989). Some G. morganii basidiomes may develop a collar-
like structure around the endoperidium as in G. triplex, but the latter is
distinguished by the delimited fibrillose peristome and basidiomes larger
than 25-150 mm (Sunhede 1989). Geastrum morganii is also very similar to
G. elegans, which differs by its distinctly delimited peristome witha larger number
of regular folds (10-20), a mycelial layer encrusted with debris, and a slightly
pruinose endoperidium (Sunhede 1989, Bates 2004, Calonge & Mata 2006).
Geastrum reticulatum Desjardin & Hemmes from Hawaii is morphologically
similar but differs from G. morganii in the immature basidiomata with hyphae
projecting above the surface, as well as a regularly plicate peristome that is
distinctly delimited and depressed in the endoperidium (Hemmes & Desjardin
2011). Geastrum episcopale F. Kuhar & L. Papin., which can be confused with
G. morganii, has smaller basidiospores (approximately 2.2 um in diam.),
calcium oxalate crystals on the endoperidium and a magenta exoperidium
and purple endoperidium (Kuhar & Papinutti 2009). Calonge (1998) considers
G. morganii as the American form of G. badium Pers., but Sunhede (1989)
regards them as different species. This is the first report of G. morganii from
Brazil.
Geastrum species new for Brazil... 175
Magn
15000x
Magn
15000x
PLATE 3. Geastrum quadrifidum (UFRN-Fungos 1748). 9-11. Basidiospores (SEM). 10-12. Dry
basidiomes.
Geastrum quadrifidum Pers., Neues Mag. fiir die Bot. 1: 86 (1794). PLATE 3
Unexpanded basidiome not observed. Expanded basidiome fornicate, 11 x
26 mm. Exoperidium splitting into 5 rays, fornicate, adhering to the mycelial
layer, non-hygroscopic. Mycelial layer yellowish white (4A2), felted, encrusted
with organic matter and sand, persistent, forming a cup under the basidiome.
Fibrous layer white orange (5A2), papery, thin. Pseudoparenchymatous layer
brown (6E5), rigid, peeling away in irregular patches with age to expose the
fibrous layer. Endoperidial body subglobose, 8 x 9 mm, stalked, brownish
orange (5C3), slightly pruinose. Stalk 1.5 mm high, distinct, lighter than the
endoperidium. Apophysis reduced, concolorous with the endoperidium.
Peristome fibrillose, distinctly delimited, delimitation white orange (5A2),
mammiform, concolorous with to darker than endoperidium. Gleba dark
brown (6F4). Basidiospores globose to subglobose, 3.8-6.3 um x 3.8-6 um
[x=5.4+0.5x5+0.7,Qm = 1.1, n= 30], brownish, densely verrucose; verrucae
long, columnar, truncate, with planar or confluent tips; apiculus prominent,
176 ... Sousa, Silva, & Baseia
surrounded by columnar processes. Eucapillitium 1.9-6.3 um diam., thick
sinuous walls (>1 um), encrusted, lumen absent, surface glabrous, yellowish
brown. Mycelial layer composed of thin hyphae, <1 um diam., hyaline. Fibrous
layer composed of thin straight-walled (<1 um) hyphae, 2.5-6.8 um diam.,
lumen absent, hyaline to slightly yellowish. Pseudoparenchymatous layer
composed of collapsed thick-walled (>1 um) hyphal cells, subglobose to oval,
brownish.
SUBSTRATE: Sandy soil.
SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO Norte: Natal, Parque Estadual Dunas
do Natal, 3.IV.2012, leg. J.O. Sousa, R.H.S.E. Cruz & J.C Bezerra (UFRN-Fungos 1748).
DISTRIBUTION: Africa: South Africa (Bottomley 1948); Asia: Japan (Kasuya et al. 2011);
Europe: Spain (Calonge 1998), England (Pegler et al. 1995, Demoulin & Marriott 1981),
Norway (Eckblad 1995), Estonian, Finland, Latvia, Sweden, Norway, (Sunhede 1989);
North America: United States (Bates 2004), Hawaii: (Smith & Ponce de Leon 1982);
South America: Argentina (Soto & Wright 2000), Brazil (this paper).
TAXONOMIC REMARKS: Geastrum quadrifidum is characterized by the fornicate
basidiome, a small (4-6) number of rays, a mycelial layer forming a cup on
the expanded basidiome, and a distinctly delimited fibrillose peristome (Bates
2004, Sunhede 1989). Geastrum minimum Schwein. is distinguished by larger
(5-11) number of rays, a densely pruinose endoperidium, and basidiomes that
are frequently not fornicate (Bates 2004, Sunhede 1989). Geastrum quadrifidum
also resembles G. fornicatum, which differs by its larger basidiomes (<40
mm wide), a non-delimited peristome, basidiospores with rarely confluent
warts, and an endoperidium with projecting hyphae (Bates 2004, Sunhede
1989). Another closely related species, G. leptospermum G.F. Atk. & Coker,
is distinguished by the smaller basidiomes (2-3 mm wide) (Bates 2004). The
also similar G. welwitschii Mont. is distinguished by its indistinctly delimited
peristome and a mycelial layer lacking incrustations (Calonge 1998). This is the
first report of G. quadrifidum from Brazil.
Acknowledgments
The authors gratefully acknowledge the CTPETRO-INFRA and FINEP/LIEM for
their collaboration with scanning electron microscopy. The authors express their thanks
to Johannes C. Coetzee (Cape Peninsula University of Technology, Bellville, South
Africa) and Felipe Wartchow (Universidade Federal da Paraiba, Brazil) for reviewing
the manuscript. This work was financed by the Coordenacao de Aperfeigoamento
de Pessoal de Nivel Superior (CAPES) and Conselho Nacional de Desenvolvimento
Cientifico e Tecnolédgico (CNPq).
Literature cited
Barbosa MMB, Silva, MP, Cruz, RHSF, Calonge, FD, Baseia IG. First report of Morganella compacta
(Agaricales, Lycoperdaceae) from South America. Mycotaxon 116: 381-386.
http://dx.doi.org/10.5248/116.381
Geastrum species new for Brazil ... 177
Baseia IG. 2004. Contribution to the study of the genus Calvatia (Lycoperdaceae) in Brazil.
Mycotaxon 88: 107-112.
Baseia IG. 2005. Some notes on the genera Bovista and Lycoperdon (Lycoperdaceae) in Brazil.
Mycotaxon 91: 81-86.
Baseia IG, Calonge FD. 2005. Aseroé floriformis, a new phalloid with a sunflower-shaped receptacle.
Mycotaxon 91: 169-172.
Baseia IG, Calonge FD. 2006. Geastrum hirsutum: a new earthstar fungus with a hairy exoperidium.
Mycotaxon 95: 301-304.
Baseia IG, Calonge FD. 2008. Calvatia sculpta, a striking pufftball occurring on Brazilian sand
dunes. Mycotaxon 106: 269-272.
Baseia IG, Cavalcanti MA, Milanez, AI. 2003a. Additions to our knowledge of the genus Geastrum
(Phallales: Geastraceae) in Brazil. Mycotaxon 85: 409-416.
Baseia IG, Gibertoni TB, Maia, LC. 2003b. Phallus pygmaeus, a minute species from a Brazilian
tropical rain forest. Mycotaxon 85: 77-80.
Baseia IG, Calonge FD, Maia LC. 2006. Notes on the Phallales in Neotropics. Boletin de la Sociedad
Micoldgica de Madrid 30: 87-93.
Bates ST. 2004. Arizona members of the Geastraceae and Lycoperdaceae (Basidiomycota, Fungi).
Master’s Thesis. Arizona State University, Tempe.
Bottomley AM. 1948. Gasteromycetes of South Africa. Bothalia 4: 473-810.
Brooks TM, Mittermeier RA, Fonseca GAB, Gerlach J, Hoffmann M, Lamoreux JE, Mittermeier
CG, Pilgrim JD, Rodrigues ASL. 2006. Global biodiversity conservation priorities. Science 13:
58-61. http://dx.doi.org/10.1126/science.1127609
Cabral TS, Silva BDB, Marinho P, BaseiaIG. 2014. Geastrum rusticum (Geastraceae, Basidiomycota),
a new earthstar fungus in the Brazilian Atlantic rainforest - a molecular analysis. Nova
Hedwigia 98: 265-272. http://dx.doi.org/10.1127/0029-5035/2013/0158
Caffot MLH, Robledo G, Dominguez LS. 2013. Gasteroid mycobiota (Basidiomycota) from Polylepis
australis woodlands of central Argentina. Mycotaxon 123-491.
http://dx.doi.org/10.5248/123.491
Calonge FD. 1998. Gasteromycetes. I. Lycoperdales, Nidulariales, Phallales, Sclerodermatales,
Tulostomatales. Flora Mycologica Iberica 3: 1-271.
Calonge FD, Mata M. 2004. A new species of Geastrum from Costa Rica and Mexico. Boletin de la
Sociedad Micoldgica de Madrid 28: 331-335.
Calonge FD, Mata M. 2006. Adiciones e Correcciones al Catalago de Gasteromycetes da Costa Rica.
Boletin de la Sociedad Micoldgica de Madrid 30: 111-119.
Calonge FD, Moreno-Arroyo B, Gémez J. 2000. Aportacion al conocimiento de los Gasteromycetes,
Basidiomycotina, de Bolivia (América del Sul). Geastrum ovalisporum sp. nov. Boletin de la
Sociedad Micoldgica de Madrid 25: 271-275.
Coker WC, Couch JN. 1928. The Gasteromycetes of the eastern United States and Canada.
University of North Carolina Press, Chapel Hill, 283 p.
Cruz RHSEF, Barbosa M, Baseia IG. 2012. Cyathus badius and C. earlei reported from Brazilian
Atlantic rain forest. Mycotaxon 121: 365-369. http://dx.doi.org/10.5248/121.365
Demoulin V, Marriott JVR. 1981. Key to the Gasteromycetes of Great Britain. Bulletin of the British
Mycological Society 15: 37-56.
Dissing H, Lange M. 1962. Gasteromycetes of Congo. Bulletin du Jardin Botanique de lEtat 32:
325-416.
Eckblad FE. 1955. The Gasteromycetes of Norway. The epigean genera. Nytt Magasin for Botanikk
4: 19-86.
178 ... Sousa, Silva, & Baseia
Fazolino EP, Calonge FD, Baseia IG. 2008. Geastrum entomophilum, a new earthstar with an
unusual spore dispersal strategy. Mycotaxon 104: 449-453.
Fazolino EP, Trierveiler-Pereira L, Calonge FD, Baseia IG. 2010. First records of Clathrus
(Phallaceae, Agaricomycetes) from the Northeast Region of Brazil. Mycotaxon 113: 195-202.
http://dx.doi.org/10.5248/113.195
Gurgel FE, Silva BDB, Baseia IG. 2008. New records of Scleroderma from Northeastern Brazil.
Mycotaxon 105: 399-405.
Hemmes DE, Desjardin DE. 2011. Earthstars (Geastrum, Myriostoma) of the Hawaiian Islands
including two new species, Geastrum litchiforme and Geastrum reticulatum. Pacific Science 65:
477-496. http://dx.doi.org/10.2984/65.4.477
Kasuya T, Hosaka K, Sakamoto H, Uchida A, Hoshino T, Kakishima M. 2011. New records of Geastrum
from Japanese sand dunes. Mycotaxon 118: 1-15. http://dx.doi.org/10.5248/118.1
Kornerup A, Wansher JE. 1978. Methuen handbook of colour, 3rd edn. Eyre Methuen, London. 252 p.
Kuhar F, Papinutti L. 2009. Geastrum episcopale: a new noticeable species with red-violet
exoperidium. Mycologia 101: 535-538. http://dx.doi.org/10.3852/08-029
Leite AG, Baseia IG. 2007. Novos registros de Geastraceae Corda para o Nordeste Brasileiro.
Sitientibus. Série Ciéncias Biolégicas 7: 178-183.
Leite AG, Calonge FD, Baseia IG. 2007a. Additional studies on Geastrum from Northeastern Brazil.
Mycotaxon 101: 103-111.
Leite AG, Silva BDB, Aratijo RS, Baseia IG. 2007b. Espécies raras de Phallales (Agaricomycetidae,
Basidiomycetes) no Nordeste do Brasil. Acta Botanica Brasilica 21: 119-124.
Myers N, Mittermeier RA, Mittermeier CG, Fonseca GAB, Kent J. 2000. Biodiversity hotspots for
conservation priorities. Nature 403: 853-858. http://dx.doi.org /10.1038/35002501
Pegler DN, Lessoe T, Spooner BM. 1995. British puffballs, earthstars, and stinkhorns. Royal
Botanic Gardens, Kew. 211 p.
Ponce de Leon P. 1968. A revision of the family Geastraceae. Fieldiana Botany 31: 302-349.
Silva BDB, Calonge FD, Baseia IG. 2007. Studies on Tulostoma (Gasteromycetes) in the Neotropics.
Some Brazilian species. Mycotaxon 101: 47-54.
Silva BDB, Sousa JO, Baseia IG. 2011. Discovery of Geastrum xerophilum from the Neotropics.
Mycotaxon 118: 355-359. http://dx.doi.org/10.5248/118.355
Silva BDB, Cabral TS, Marinho P, Ishikawa NK, Baseia IG. 2013. Two new species of Geastrum
(Geastraceae, Basidiomycota) from Brazil. Nova Hedwigia 96: 445-456.
Smith CW, Ponce de Leon P. 1982. Hawaiian gasteroid fungi. Mycologia 74: 712-717.
Soto MK, Wright JE. 2000. Taxonomia del genero Geastrum (Basidiomycetes, Lycoperdales) em
la Provincia de Buenos Aires, Argentina. Boletin de la Sociedad Argentina de Botanica 34:
185-201.
Sunhede S. 1989. Geastraceae (Basidiomycotina). Morphology, ecology, and systematics with
special emphasis on the North European species. Synopsis Fungorum 1. 534 p.
Tabarelli M, Pinto LP, Silva JMC, Hirota M, Bedé L. 2005. Challenges and opportunities for
biodiversity conservation in the Brazilian Atlantic Forest. Conservation Biology 19: 695-700.
Tabarelli M, Melo MDVC, Lira OC. 2006. Nordeste e Estados do Nordeste, menos Sergipe.
149-164. In: M. Campanili& M. Prochnow (eds.). Mata Atlantica: Uma rede pela floresta.
Brasilia, Rede de ONGs da Mata Atlantica (RMA).
Trierveiler-Pereira L, Baseia IG. 2009. Revision of the Herbarium URM IV. Nidulariaceae
(Basidiomycota). Nova Hedwigia 89: 361-369.
Geastrum species new for Brazil ... 179
Trierveiler-Pereira L, Baseia IG. 2011. Contribution to the knowledge of gasteroid fungi
(Agaricomycetes, Basidiomycota) from the state of Paraiba, Brazil. Revista Brasileira de
Biociéncias 9: 167-173.
Trierveiler-Pereira L, Bezerra KMT, Bezerra JL, Baseia IG. 2009. First records of Geastraceae and
Nidulariaceae (Basidiomycota, Fungi) from Bahia, Northeastern Brazil. Biociéncias (Porto
Alegre), 7: 316-319.
Trierveiler-Pereira L, Kreisel H, Baseia IG. 2010. New data on puffballs (Agaricomycetes,
Basidiomycota) from the Northeast Region of Brasil. Mycotaxon 111: 411-421.
http://dx.doi.org/10.5248/111.411
Trierveiler-Pereira L, Calonge FD, Baseia IG. 2011a. New distributional data on Geastrum
(Geastraceae, Basidiomycota) from Brazil. Acta Botanica Brasilica 25: 577-585.
Trierveiler-Pereira L, Gomes-Silva AC, Baseia IG. 2011b. Observations on gasteroid Agaricomycetes
from the Brazilian Amazon rainforest. Mycotaxon 118: 273-282.
http://dx.doi.org/10.5248/118.273
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.181
Volume 129(1), pp. 181-186 July-September 2014
Ypsilomyces, a new thallic genus of conidial fungi
from the semi-arid Caatinga biome of Brazil
Davi AUGUSTO CARNEIRO DE ALMEIDA* &
Luis FERNANDO PASCHOLATI GUSMAO
Universidade Estadual de Feira de Santana,
Av. Transnordestina, S/N - Novo Horizonte, 44036-900. Feira de Santana, BA, Brazil
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — During research on conidial fungi from the semi-arid region of Brazil, a unique
specimen was collected on decaying leaves. Ypsilomyces elegans gen. et sp. nov. is characterized
by macronematous mononematous conidiophores occurring on pseudoparenchymatous
tissue, terminal conidiogenous cells extending percurrently, and thallic septate Y-shaped
subhyaline conidia. Descriptions, illustrations, and comments are provided.
Key worps — biodiversity, hyphomycetes, tropical microfungi
Introduction
Studies conducted in the semi-arid region of Brazil in the beginning of this
century have revealed several novel taxa and new records of conidial fungi
(Barbosa & Gusmao 2005, Barbosa et al. 2007, 2013, Cruz et al. 2007, 2012,
Gusmao et al. 2008, Almeida et al. 2011, 2012, 2013, Santa Izabel et al. 2013).
The Program of Research on Biodiversity in the Brazilian semi-arid (PPBIO)
has contributed to the knowledge on biodiversity of fungi in Brazil by funding
the majority of the aforementioned researches. Although several new taxa of
fungi have been reported, this region continues to be a rich source of novel
taxa.
During a survey of conidial fungi on plant debris in an area of extreme
biological importance in the Brazilian semi-arid region (Velloso et al. 2002), an
interesting specimen was found. Since its morphological features did not match
any known genera of conidial fungi, a new genus is established herein.
Materials & methods
Samples of decaying leaves were collected at Serra da Fumaga, Pindobacu, Bahia
state, during August-December 2008. Description of the study area and methods for
182 ... Almeida & Gusmao
specimen collection, isolation, and morphological examination are provided in Almeida
et al. (2011). Fungal structures were measured using a BX51 Olympus microscope
equipped with bright field and Nomarski interference optics; images were photographed
with a DP25 Olympus digital camera and processed using Adobe Photoshop CS6 and
Image J. Drawings were made directly from digital images using the technique described
by Barber & Keane (2007). The holotype specimen was deposited in the Herbarium of
Universidade Estadual de Feira de Santana (HUEFS). An attempt was made to cultivate
the fungus but unfortunately we did not have success.
Taxonomy
Ypsilomyces D.A.C. Almeida & Gusmao, gen. nov. FIGS. 1, 2
MycoBank MB 807123
Differs from Biflagellospora, Diademospora, Diplocladiella, Iyengarina, Vanterpoolia, and
Weufia by thallic conidiogenesis.
TYPE SPECIES: Ypsilomyces elegans D.A.C. Almeida & Gusmao
Erymo.oecy: from the Latin, ypsilon, referring to the Y-shaped conidia and the Greek,
myces, referring to fungus.
CONIDIOPHORES macronematous, mononematous, unbranched or branched,
cylindrical, erect, straight or flexuous, septate, smooth, pale brown to brown.
STROMATA pseudoparenchymatous, brown to dark brown. CONIDIOGENOUS
cells terminal, cylindrical, smooth, pale brown, with enteroblastic percurrent
extension that produce fertile branches, which forming thallic-arthric conidia
after disarticulation. Conrp1A thallic-arthric, single, dry, smooth, septate,
usually more or less dichotomous branched, Y-shaped, furcated or cylindrical,
subhyaline, produced after disarticulation of the fertile branches.
Ypsilomyces elegans D.A.C. Almeida & Gusmao, sp. nov. FIGS 1, 2
MycoBank MB 807124
Differs from Diplocladiella scalaroides and Iyengarina elegans by its holothallic,
subhyaline, usually 1-septate conidia.
Type: Brazil, Bahia, Pindobacu, Serra da Fumaga, on decaying leaf of an unidentified
monocotyledonous plant, 18.XII.2008, D.A.C. Almeida (holotype HUEFS 155081).
Erymo_oey: Latin, elegans, meaning elegant.
CONIDIOPHORES macronematous, mononematous, grouped, unbranched
or branched, cylindrical, erect, straight or flexuous, septate, thick walled,
smooth, brown at base, pale brown towards the apex, 22.5-425 x 3.5-6 um,
arising from dark brown, pseudoparenchymatous stromata. CONIDIOGENOUS
CELLS terminal, cylindrical, thin-walled, smooth, pale brown, with several
enteroblastic percurrent extension which produce fertile dichotomous
branches, that form conidia by thallic-arthric disarticulation. Conip1a thallic-
arthric, single, dry, smooth, 1(-3)-septate, asymmetric, branched, Y-shaped,
Ypsilomyces elegans gen. & sp. nov. (Brazil) ... 183
A F
Fic. 1. Ypsilomyces elegans (holotype HUEFS 155081): A. Conidiophore and conidia on leaf
surface. B. Short conidiophores with conidia and base of long conidiophores. C. Conidiogenous
cells with conidia. D. Short conidiophores with conidia. E. Unbranched conidium disarticulating
from conidiophore apex. F. Conidiogenous cells with conidia and showing percurrent extension.
G-J. Conidia. Scale bars: A = 50 um; B, D = 20 um; C = 15 um; E, F = 10 um; G-J = 5 um.
184 ... Almeida & Gusmao
Fic. 2. Ypsilomyces elegans (holotype HUEFS 155081): A: General aspect. B: Conidia.
Ypsilomyces elegans gen. & sp. nov. (Brazil) ... 185
rarely simple or furcate, subhyaline, guttulate, 27-60 x 2.5-5 um; branches
subulate, 14-51 x 2-5 um.
ComMENts: Other fungi characterized by Y-shaped conidia include
Biflagellospora Matsush., Diademospora B.E. Séderstr. & Baath, Diplocladiella
G. Arnaud ex M.B. Ellis, Iyengarina Subram., Vanterpoolia A. Funk, Weufia
Bhat & B. Sutton and Ypsilina J. Webster et al. Ypsilomyces differs from all
these genera by its thallic conidiogenesis and by producing conidiophores on a
pseudoparenchymatous stroma. Except for Weufia (with tretic conidiogenesis;
Bhat & Sutton 1985), all aforementioned genera produce conidia holoblastically.
Vanterpoolia also produces pseudoparenchymatous stromata, but the stroma
is reduced in Ypsilomyces, whereas in Vanterpoolia it forms a well developed
sporodochium (Funk 1982). Moreover, Vanterpoolia produces conidia in
acropetal chains. Ypsilomyces can also be diagnosed by its conidiogenous cells
that extend percurrently among successive productions of fertile dichotomous
branches, which form thallic-arthric conidia after disarticulation. Diplocladiella
and Biflagellospora differ by the sympodial extension of their conidiogenous
cells (Matsushima 1975, Ellis 1976, Sivichai & Hywel-Jones 1999). Although
the conidiogenous cells of Iyengarina can also extend percurrently, its conidia
are produced holoblastically (Kuthubutheen & Nawawi 1992). Other distinctive
characteristics of Ypsilomyces are the conidiophores that vary greatly in length
(22.5-425 um) and which are pale brown and short when young and basally
dematiaceous and long when old. In contrast, Diademospora and Ypsilina have
inconspicuous conidiophores (Séderstrém & Baath 1979, Descals et al. 1998).
Acknowledgments
The authors thank Dr. Rafael F. Castafieda Ruiz and Dr. Bryce Kendrick for critically
reviewing the manuscript. The authors thank the Program of Research of Biodiversity
in the Brazilian Semi-arid (PPBIO Semi-arid/Ministry of Technology and Science -
proc. 554718/2009-0) for financial support. The first author thanks the Brazilian Federal
Agency for Support and Evaluation of Graduate Education (CAPES) for scholarships
and LFPG extends thanks to National Council for Scientific and Technological
Development (CNPq proc. 305413/2011-2).
Literature cited
Almeida DAC, Santa Izabel TS, Gusmao LFP. 2011. Fungos conidiais do bioma Caatinga I. Novos
registros para o continente americano, Neotrdépico, América do Sul e Brasil. Rodriguésia 62(1):
43-53.
Almeida DAC, Barbosa FR, Gusmao LFP. 2012. Alguns fungos conidiais aquaticos-facultativos do
bioma Caatinga. Acta Botanica Brasilica 26: 924-932.
http://dx.doi.org/10.1590/S0102-33062012000400021
Almeida DAC, Cruz ACR, Marques MFO, Gusmao LFP. 2013. Conidial fungi from the semi-arid
Caatinga biome of Brazil. New and interesting Zanclospora species. Mycosphere 4(4): 684-692.
http://dx.doi.org/10.5943/mycosphere/4/4/4
186 ... Almeida & Gusmao
Barber PA, Keane PJ. 2007. A novel method of illustrating microfungi. Fungal Diversity 27(1):
1-10.
Barbosa FF, Gusmao LFP. 2005. Two Speiropsis species (anamorphic fungi-hyphomycetes) from
Bahia State, Brazil. Acta Botanica Brasilica 19: 515-518.
http://dx.doi.org/10.1590/S0102-33062005000300012
Barbosa FR, Gusmao LFP, Castaneda-Ruiz RF, Marques MFO, Maia LC. 2007. Conidial fungi from
the semi-arid Caatinga biome of Brazil. New species Deightoniella rugosa and Diplocladiella
cornitumida with new records for the neotropics. Mycotaxon 102: 39-49.
Barbosa FR, Huzefa AR, Shearer CA, Gusmao LFP. 2013. Some freshwater fungi from the Brazilian
semi-arid region, including two new species of hyphomycetes. Cryptogamie, Mycologie. 34 (3):
243-258. http://dx.doi.org/10.7872/crym.v34.iss2.2013.243
Bhat DJ, Sutton BC. 1985. New and interesting hyphomycetes from Ethiopia. Transactions of the
British Mycological Society 85(1): 107-122. http://dx.doi.org/10.1016/S0007-1536(85)80160-1
Cruz ACR, Gusmao LFP, Castaneda-Ruiz RF. 2007. Conidial fungi from the semi-arid Caatinga
biome of Brazil. Subramaniomyces pulcher sp. nov. and notes on Sporidesmium circinophorum.
Mycotaxon 102: 25-32.
Cruz ACR, Gusmao LFP, Castaneda-Ruiz RE, Stadler M, Minter DW. 2012. Zelodactylaria,
an interesting new genus from semi-arid northeast Brazil. Mycotaxon 119: 241-248.
http://dx.doi.org/10.5248/119.241
Descals E, Marvanova L, Webster J. 1998. New taxa and combinations of aquatic hyphomycetes.
Canadian Journal of Botany 76(9): 1647-1659. http://dx.doi.org/10.1139/b98-111
Ellis MB. 1976. More dematiaceous hyphomycetes. Kew, UK, Commonwealth Mycological
Institute.
Funk A. 1982. Vanterpoolia, a new genus of sporodochial hyphomycetes. Canadian Journal of
Botany 60(6): 973-975. http://dx.doi.org/10.1139/b82-122
Gusmao LFP, Leao-Ferreira SM, Marques MFO, Almeida DAC. 2008. New species and
records of Paliphora from the Brazilian semi-arid region. Mycologia 100(2): 306-309.
http://dx.doi.org/10.3852/mycologia.100.2.306
Kuthubutheen AJ, Nawawi A. 1992. New litter-inhabiting hyphomycetes from Malaysia:
Isthmophragmospora verruculosa, Iyengarina asymmetrica, and Iyengarina furcata. Canadian
Journal of Botany 70: 101-106. http://dx.doi.org/10.1139/b92-014
Matsushima T. 1975. Icones microfungorum a Matsushima lectorum. Kobe, Published by the
author.
Santa Izabel TS, Cruz ACR, Gusmao LFP. 2013. Conidial fungi from the semi-arid Caatinga biome
of Brazil. Ellisembiopsis gen. nov., new variety of Sporidesmiella and some notes of Sporidesmium
complex. Mycosphere 4(2): 156-163. http://dx.doi.org/10.5943/mycosphere/4/2/1
Sivichai $, Hywel-Jones NL. 1999. Biflagellospora (aero-aquatic hyphomycetes) from submerged
wood in Thailand. Mycological Research 103(7): 908-914.
http://dx.doi.org/10.1017/S0953756298007928
Sdderstrém B, Baath E. 1979. Diademospora ramigera gen. et sp. nov. from coniferous forest soil.
Transactions of the British Mycological Society 72(2): 340-342.
http://dx.doi.org/10.1016/S0007-1536(79)80057-1
Velloso AL, Sampaio EVSB, Pareyn FGC. 2002. Ecorregides propostas para o Bioma Caatinga.
Recife, APNE / Nature Conservancy do Brasil.
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.187
Volume 129(1), pp. 187-196 July-September 2014
Agaricus taeniatus sp. nov., anew member of
Agaricus sect. Bivelares from northwest China
SAI-FEI Lr’, YA-LiI X13, CAI-X1A QI3, QIAN-QIAN LIANG},
SHENG-LONG WEI}, GUO-JIE LI” *, DONG ZHAO’,
SHAO-JIE L1"“’, & Hua-AN WEN?”
' State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences,
No 31st Beichen West Road, Chaoyang District, Beijing 100101, China
? University of Chinese Academy of Sciences, Beijing 100049, China
* Gansu Engineering Laboratory of Applied Mycology, Hexi University,
846th Huancheng North Road, Ganzhou District, Zhangye 734000, Gansu, China
ABSTRACT—Agaricus taeniatus from Qilian Mountains, northwest China, is described as
a new species. It is distinguished by its larger basidia and basidiospores, band-like velar
remnants on the stipe surface, and persistent single rings with eroded edges. ITS1-5.8S-ITS2
rDNA sequence analyses fully support the establishment of the new species within A. sect.
Bivelares.
Key worps —Agaricales, Agaricaceae, phylogeny, taxonomy
Introduction
Agaricus L. is a genus with nearly 400 species comprising both edible and
poisonous species (Bas 1991). It has a long history and has been subdivided
into different taxonomic groups (Moller 1950, Heinemann 1978, Cappelli
1984, Singer 1986, Parra 2008). Kauffman (1919) first described Agaricus sect.
Bivelares (Kauffman) L.A. Parra as a section of Psalliota typified by P. rodmanii
(Peck) Kauffman [= A. bitorquis (Quél.) Sacc.]. Later studies reorganized this
section (Heinemann 1978, Wasser 1980, Challen et al. 2003, Didukh et al.
2004) and characterized its species by negative Schaffer and KOH reactions,
red discoloration of the context, and a mild or indistinct odor (Parra 2008). The
species most widely consumed, A. bisporus (J.E. Lange) Imbach, is included in
this section (Kerrigan et al. 2008).
188 ... Li & al.
The taxonomy of Agaricus has been studied intensively in Europe, America,
and southeast Asia (Hotson & Stuntz 1938; Freeman 1979a, 1979b; Heinemann
1956; Kerrigan 1985, 1989, 2005; Chen et al. 2012; Zhao et al. 2012a, 2012b).
Despite China's long history of Agaricus consumption, its taxonomy remains
little studied, and only a few Agaricus species have thus far been described from
China (Chiu 1973, Li 1990). In our effort to further Agaricus taxonomy in the
country, we collected specimens from the Qilian Mountains, an area of high
macrofungal diversity (Xi et al. 2011). As a result of our research, we present
here a new species of A. sect. Bivelares.
Materials & methods
Photos were taken and main morphological characters were recorded in situ. Other
macrocharacters and chemical tests were carried out immediately after the specimens
were brought back to the laboratory. Color names and codes follow Ridgway (1912).
Specimens were air-dried overnight in a dehydrator prior to microscopic examination.
Tissues were hand-sectioned and rehydrated in 5% KOH. Particular attention was paid
to the basidia, basidiospores, and cystidia and the anatomy of the pileipellis, annulus,
and band-like remnants on the stipe surface. Line drawings were prepared from
tissues stained with Congo red. For basidiospores, (n/m/p) refers to n spores from m
basidiocarps of p specimens, with dimensions given as (a—)b-c(-d), with b-c including
90% of the measured values between the extreme values shown in parentheses. Sterigma
lengths are not included. Q = spore length/width quotient in side view; avQ = average
Q + standard deviation. Specimens cited were deposited in Mycological Herbarium,
Institute of Microbiology, Chinese Academy of Sciences (HMAS).
DNA extractions were made with a DNA extraction kit (Plant Genomic DNA Rapid
Extraction kit, BioTeke, China). Internal transcribed spacers (ITS) were amplified by
PCR reactions with primers ITS1/ITS4 (White et al. 1990, Gardes & Bruns 1993), and
sequenced by SinoGenoMax Co. Ltd. Sequences obtained were deposited in GenBank.
Sequences of representative and closely related Agaricus taxa were retrieved
from GenBank. Sequences were aligned using BioEdit (Hall 1999) and MAFFT
(http://www.ebi.ac.uk/Tools/msa/mafft/ Katoh & Toh 2010). The alignment has been
submitted to TreeBase (submission ID 15563).
Maximum-likelihood (ML) analysis was performed in PhyML3.0 (Guindon et al.
2010), via the ATGC bioinformatics platform (http://www.atgc-montpellier.fr/phyml/).
The GTR substitution model was selected with 6 substitution rate categories to
account for rate heterogeneity across sites. Likelihood was increased by using the SPR
tree improvement. The analysis included 100 bootstrap replicates. Bayesian analyses
were performed using MrBayes v3.1.2 (Ronquist & Huelsenbeck 2003) under the
estimated evolutionary model. Six simultaneous Markov chains were run for 1,000,000
generations and trees were sampled every 100th generation. The first 2,000 resulting
trees were discarded as burn-in and the remaining 8,000 trees were used for calculating
the posterior probabilities in the majority rule consensus tree. Trees were visualized in
FigTree v1.4.0 (http://tree.bio.ed.ac.uk/software/figtree/).
Agaricus taeniatus sp. nov. (China) ... 189
HMAS269875 A. taeniatus
HMAS253018 A. taeniatus
HMAS253010 A. faeniatus Holotype
792 HIMAS269880 A. taeniatus
1
AM930983 Agaricus sp. b
EU257802 A. subsubensis SupaC ch, Sect.
Hortenses
EU257804 A. bitorquis Bivelares
95/100 p EU257801 A. agrinferus
re EU131640 A. subfloccosus
AM930981 A. bisporus
98/100 Sento AF432896 A. devoniensis
AF432889 A. subperonatus
74/86, EU258676 A. cupressophilus
68/77 Baie ee, ew et Subsect.
EU363033 A. tlaxcalensis Cupressorum
AF432904 A. cupressicola
94/109 AF432880 4. bernardii Sect.
ee ee A. gennadii Chitonioides
AY484677 A. fuscovelatus Sect.
AY484676 A. lilaceps Sanguinolenti
98/100 - DQ185562 A. moelleri
78/93
78/-
98/100
Sect.
AY899271 A. xanthodermus Xanthodermatei
JN664955 A. aff. trisulphuratus
0.02
Fic. 1. Phylogenetic tree of Agaricus spp. generated from a maximum-likelihood analysis based
on the ITS nrDNA sequence. Bootstrap support values (>50%) followed by Bayesian posterior
probability values (>50%) are given at the internodes. ‘The tree is rooted by A. aff. trisulphuratus.
Sequences generated in this study shown in bold.
Results
The ITS alignment comprised 22 sequences representing 19 Agaricus taxa.
Agaricus aff. trisulphuratus Berk., representing A. subg. Lanagaricus Heinem.,
was chosen as outgroup (Zhao et al. 2012b). The ML tree, which showed a
topology identical to Bayesian tree, was selected to show the phylogeny of the
new species (Fic. 1). The new taxon is well supported with good bootstrap and
posterior probability values and is sister to the subclade of A. subsubensis and
Agaricus sp. (AM930983).
Taxonomy
Agaricus taeniatus Sai F. Li, Shao J. Li & H.A. Wen, sp. nov. FIGs 2-4
FUNGAL NAMES FN 570120
Differs from other species of Agaricus sect. Bivelares by its larger basidia and
basidiospores, band-like velar remnants on the stipe surface, and persistent single rings
with eroded edges.
190 ... Li & al.
Fic. 2. Agaricus taeniatus habit.
A. HMAS253016; B. HMAS253010 (holotype); C. HMAS269876; D. HMAS269875.
Type: China, Gansu Province, Minle County, Haichaoba, 38°23’50.03”N 100°40’02.90’E,
alt. 2593 m, in forest dominated by Picea crassifolia, 10 August 2013, S.E. Li, Y.L. Xi,
C.X. Qi & Q.Q. Liang QLS60 (Holotype, HMAS253010; GenBank KJ623317); QLS15
(Isotype, HMAS253017; GenBank KJ623319).
EryMo oy: refers to the band-like velar remnants on the stipe surface.
PiLEus 6-17 cm diam., irregularly hemispheric with a flat top when young,
then expanding to plano-convex, and finally applanate and marge wavy; surface
covered with fibril or fibrillose squamules, adpressed, Cinnamon (XXIX15”)
to Mikado Brown (XXIX13”i) upon a barely discernible background,
squamules patch-like on the disc, decreasing in size towards the margin; edge
appendiculate; no discoloration on bruising. CONTEXT 7-20 mm thick from
the centre of pileus to margin, firm, white, becoming Orange-Pink (II11f) at
the disc, Jasper Red (XIII3’) at the lamellar/context interface. LAMELLAE free,
6-8 mm broad, 13-24/cm at the edge, white when young, maturing from light
pink, light brown, brown and to finally dark brown. ANNULUS 6-17 mm broad,
persistent, single, thick near the stipe and thinner toward an eroded edge, upper
surface striate, lower surface fibrillose-woolly, having obvious cortinate fibrils
Agaricus taeniatus sp. nov. (China) ... 191
20 um
10 pm
Fic. 3. Agaricus taeniatus (HMAS253010, holotype).
A. Basidia; B. Basidiospores; C. Hyphae from band-like remnants; D. Cheilocystidia.
at the stipe, generally superior, white. StrpE 2-6 x 7-22 cm, cylindrical, + equal
or (sometimes) distinctly bulbous with pointed base, solid, surface covered
with small, appressed squamules above annulus, heavily floccose-fibrillose
below annulus, white overall, Eosine Pink (Ild) around some squamules,
bruising Ferruginous (XIV9’i); veils decorating stipe in a series of complete or
partial transverse bands concolorous with the surface squamules, discernible
when young; context white, becoming Vinaceous-Rufous (XIV7’i) when cut at
192 ... Li & al.
(
Vl
VIE VAF
Le
Wisc
NE
\
=3 V9),
IT
cA
'S,
Fic. 4. Agaricus taeniatus (HMAS253010, holotype).
A. Hyphae from pileipellis; B. Hyphae from annulus.
the stipe base of stipe, Pale Flesh (XIV7’f) above base. Opor indistinct. TASTE
pleasant.
MACROCHEMICAL REACTIONS: KOH and Schaffer reaction negative.
Agaricus taeniatus sp. nov. (China) ... 193
Basiprospores [120/8/8] (5.1-)5.7-7.1(-8.4) x (6.1-)6.8-8.6(-10.7) um,
average 6.3 x 7.6 um, Q = (1.04—)1.11-1.30(-1.38), avQ = 1.20 + 0.07, subglobose
to broadly ellipsoid, without germ pore, thick-walled, smooth, dark brown
when mature. Basrp1a 8-11(-12) x (32—)33-41(-42) um, clavate, 4-spored;
sterigmata 2.5-4.6 um long. CHEILOCYSTIDIA clavate to cylindrical, sometimes
flexuose, usually septate with 1-3 basal septa, hyaline, smooth; terminal
elements measuring (5-)6-9(-10) x (16-)18-38(-45) um. PLEUROCYSTIDIA
absent. PILEIPELLIS a cutis, composed of hyphae 3-14 um diam., cylindrical,
hyaline, smooth, not or slightly constricted at the septa; terminal cells 3-9 x
33-154 um, slightly attenuated toward apex. ANNULUS HYPHAE 4-14 um diam.,
cylindrical or irregularly cylindrical, inflated or constricted at some places of
the hyphae, hyaline, smooth, not constricted, slightly constricted, or inflated
at the septa; terminal cells 4-16 x 39-270 um, slightly or sometimes obviously
inflated toward apex. BAND-LIKE REMNANTS composed of hyphae 2.3-6.6 um
diam., cylindrical, hyaline, smooth; terminal cells 4-9 x 83-163 um, slightly
attenuated toward apex. CLAMP CONNECTION not observed.
Hasit: Scattered or solitary in fluffy soil covered with lush moss in Picea
crassifolia Kom. forest.
ADDITIONAL SPECIMENS EXAMINED: CHINA, GANSU PROVINCE, Minle County,
Haichaoba, 38°23’50.03”N 100°40’02.90’E, alt. 2593 m, 6 August 2013, S.E. Li,
Y.L. Xi, CX. Qi & Q.Q. Liang QLS04 (HMAS253016; GenBank KJ623318); Sunan
County, Kangle, 38°48’22.02”N 99°55’58.57”E, alt. 2766 m, 8 August 2013, S.F.
Li, Y.L. Xi, CX. Qi & QQ. Liang QLS20 (HMAS269876; GenBank KJ623321);
QLS21 (HMAS269875; GenBank KJ623322); QLS28 (HMAS253018; GenBank
KJ623323); Haichaoba, 10 August 2013, S.F. Li, Y.L. Xi, C.X. Qi & Q.Q. Liang
QLS64 (HMAS269880; GenBank KJ623320); QLS65 (HMAS253019; GenBank
KJ623324).
Discussion
The brownish pileus squamules, superior annulus with veil remnants,
reddish discoloration when cut, indistinct odor, and negative KOH and Schaffer
reactions place A. taeniatus in A. subsect. Hortenses Heinem. (Kerrigan et al.
2008), which the ITS-based phylogeny supports.
Among the species of this section, the squamulose pileus and single
annulus of A. taeniatus easily separate it from A. bitorquis and A. devoniensis
P.D. Orton, both of which have a smooth pileus surface and double rings.
Agaricus subperonatus (J.E. Lange) Singer, which shares similar pileus
characters and a stipe with complete or incomplete transverse bands, differs
from A. taeniatus by forming a double-edged annulus that is <5 mm broad and
slightly fibrillose on the underside (Bohus 1975, Parra 2008).
A stipe decorated with heavily floccose-fibrillose squamules and a series
of complete or incomplete transverse bands are characters that easily separate
A. taeniatus from other species of A. subsect. Hortenses characterized by a
194 ... Li & al.
relatively simple stipe surface (e.g., A. maleolens FH. Moller, A. subfloccosus
(J.E. Lange) Hlavacek, A. agrinferus Kerrigan & Callac, and A. tlaxcalensis
Callac & G. Mata). Additional differences are: A. maleolens has stems with
few ochraceous spots or small ochre squamules towards the base (Cappelli
1984, Lacheva & Stoichev 2004); A. subfloccosus occasionally has sparse
woolly remnants on glabrous stipes (Parra 2008); A. agrinferus has glabrous to
minutely floccose stipes sometimes with fibrillose zones below (Kerrigan et al.
2008); and A. tlaxcalensis has a longitudinally fibrillose and silky stipe surface
(Kerrigan et al. 2008).
Agaricus cupressicola Bon & Grilli has been placed into different sections:
either A. sect. Bivelares based on phylogenetic analysis (Kerrigan 2008) or
A. sect. Sanguinolenti based on morphology (Parra 2008). This species differs
from A. taeniatus by its much smaller basidiocarps, relatively strongly rufescent
context, and thin annulus with an almost smooth lower surface.
Microscopically, A. taeniatus is easily separated from A. bisporus by its
4-spored basidia and from A. cupressophilus Kerrigan (3.7-3.9 x 4.6 um) and
A. devoniensis subsp. bridghamii Kerrigan (5.0-5.5 x 5.9-6.6 um) by its much
larger spores and longer cheilocystidia (19-23 um in the two latter taxa).
A. cupressophilus and A. devoniensis subsp. bridghamii are further distinguished
by smaller pilei (3-7.5 cm diam.) and shorter stipes (1-2 x 4-8 cm) (Kerrigan
et al. 2008). Agaricus subedulis Heinem. differs from A. taeniatus in forming
shorter (<33 um) basidia, wider (>9 um) cheilocystidia, and irregularly shaped
cheilocystidia with constricted ends (Heinemann 1956).
The phylogeny (Fic. 1) shows A. taeniatus most closely related to
A. subsubensis Kerrigan and Agaricus sp. (AM930983). Agaricus taeniatus
resembles A. subsubensis in the brownish pileus, reddish discoloration
when sectioned and a series of thin broken ring-like remnants on the stipe.
However, A. subsubensis has shorter (24-30 um) basidia, a much less robust
(0.5-1.5 x 0.5-4.5 cm) stipe, and a much more narrow, indistinct, band-like
annulus (Kerrigan et al. 2008). Agaricus sp. (AM30983), collected from Lake
Baikal district in southern Siberia, Russia, has been tentatively identified as
A. balchaschensis Samgina & G.A. Nam but lacks sufficient taxonomic data
for a positive identification (Hildén et al. 2013); A. balchaschensis differs from
A. taeniatus in forming a stouter stipe (7-8 x 10-14 cm), movable annulus, a
context that more strongly discolors (orange to cherry red) upon exposure, and
shorter (23-34 um) basidia (Samgina & Nam 1989).
Acknowledgments
The authors are grateful to Dr. R.L. Zhao and Dr. Kanad Das for reviewing the
manuscript; to Dr. R.W. Kerrigan and L.A. Parra for providing phylogenetic and
documental information of related species; to Dr. X.G. Zhang for improving the
manuscript; to Ms. H.M. Lii, Ms. A.R. Yan and Dr. T.Z. Wei for providing the herbarium
Agaricus taeniatus sp. nov. (China) ... 195
specimens; to Ms. L.T. Zhang for assistance in lab work; to Mr. L. Su, Ms. Y.M. Li for
assistance in phylogenetic analyses.
Literature cited
Bas C. 1991. A short introduction to the ecology, taxonomy and nomenclature of the genus
Agaricus. 21-24, in: LJLD van Grievsen (ed.). Genetics and breeding of Agaricus. Proceedings
of the First International Seminar on Mushroom Science. Wageningen, Pudoc.
Bohus G. 1975. Agaricus studies, V. (Basidiomycetes, Agaricaceae). Annales Historico Naturales
Musei Nationalis Hungarici 67: 37-40.
Cappelli A. 1984. Agaricus L.: Fr. (Psalliota Fr.). Saronno. Libreria editrice Biella Giovanna.
Challen M, Kerrigan RW, Callac P. 2003. A phylogenetic reconstruction and emendation of
Agaricus section Duploannulatae. Mycologia 95(1): 61-73. http://dx.doi.org/10.2307/3761962
Chen J, Zhao RL, Karunarathna SC, Callac P, Raspé O, Bahkali AH, Hyde KD. 2012. Agaricus
megalosporus: a new species in section Minores. Cryptogamie Mycologie 33(2): 145-155.
http://dx.doi.org/10.7872/crym.v33.iss2.2012.145
Chiu WE. 1973. Ten new species of agarics from Yunnan. Acta Microbiology Sinica 13(2): 129-135.
Didukh M, Wasser SP, Nevo E. 2004. New data on rare and debatable species of the family
Agaricaceae (Fr.) Cohn. Ukrayins’k. Bot. Zhurn. 61(1): 89-99.
Freeman AEH. 1979a. Agaricus in North America: type studies. Mycotaxon 8: 1-49.
Freeman AEH. 1979b. Agaricus in the southeastern United States. Mycotaxon 8: 50-118.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes-
application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
http://dx.doi.org/10.1111/j.1365-294X.1993.tb00005.x
Grilli E. 1988. Il genre Agaricus L.: Fr. in Abruzzo, I. Agaricus cupressicola Bon & Grilli. Micologia
e Vegetazione Mediterranea 3(2): 111-129.
Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. 2010. New algorithms and
methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML
3.0. Systematic Biology 59(3): 307-321. http://dx.doi.org/10.1093/sysbio/syq010
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.
Heinemann P. 1956. Champignons récoltés au Congo belge par Mme M. Goossens-Fontana, II.
Agaricus Fr. s.s. Bull. Jard. Bot. PEtat Bruxelles 26: 1-127.
Heinemann P. 1978. Essai d’une clé de determination des genres Agaricus et Micropsalliota.
Sydowia 30: 6-37.
Hildén K, Makela MR, Lankinen P, Lundell T. 2013. Agaricus bisporus and related Agaricus species
on lignocellulose: production of manganese peroxidase and multicopper oxidases. Fungal
Genetics and Biology 55: 32-41. http://dx.doi.org/10.1016/j.fgb.2013.02.002
Hotson JW, Stuntz DE. 1938. The genus Agaricus in western Washington. Mycologia 30: 204-234.
http://dx.doi.org/10.2307/3754557
Katoh K, Toh H. 2010. Parallelization of the MAFFT multiple sequence alignment program.
Bioinformatics 6(15): 1899-1900. http://dx.doi.org/10.1093/bioinformatics/btq224
Kauffman CH. 1919. The Agaricaceae of Michigan. Lansing MI, Wynkoop Hallenbeck Crawford
Co., State Printers. http://dx.doi.org/10.5962/bhl.title.58545
Kerrigan RW. 1985. Studies in Agaricus II: new species from California. Mycotaxon 20: 419-434.
Kerrigan RW. 1989. Studies in Agaricus IV: new species from Colorado. Mycotaxon 34: 119-128.
Kerrigan RW. 2005. Agaricus subrufescens, a cultivated edible and medicinal mushroom, and its
synonyms. Mycologia 97: 12-24. http://dx.doi.org/10.3852/mycologia.97.1.12
196 ... Li & al.
Kerrigan RW, Callac P, Parra LA. 2008. New and rare taxa in Agaricus section Bivelares
(Duploannulati). Mycologia 100(6): 876-892. http://dx.doi.org/10.3852/08-019
Lacheva MN, Stoichev GT. 2004. New species of the genus Agaricus (Agaricaceae) for Bulgaria.
Mycologia Balcanica 1: 35-40.
Li Y. 1990. New species and records of the genus Agaricus from China. Acta Botanica Yunnanica
12(2): 154-160.
Moller FH. 1950. Danish Psalliota species, I-II. Friesia 4: 1-60.
Parra LA. 2008. Agaricus L.: Allopsalliota Nauta & Bas. Fungi Europaei, vol. 1. Alassio, Edizioni
Candusso.
Ridgway R. 1912. Color standards and nomenclature. Washington, Robert Ridgway.
http://dx.doi.org/10.5962/bh1.title.62375
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Samgina DI., Nam GA. 1989. Novyi vid iz roda Agaricus L.: Fr. Izvestiya Akademii Nauk Kazakhskoi
SSR, Seriya Biologicheskaya 156: 78-80.
Singer R. 1986. The Agaricales in modern taxonomy. 4th ed. Koenigstein, Koeltz Scientific Books.
http://dx.doi.org/10.2307/1219523
Wasser SP. 1980. Flora Fungorum RSS Ucrainicae. Kiev, Naukova Dumka.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. San Diego, Academic.
Xi YL, Wang ZJ, Yu HP, Wei SL. 2011. Preliminary research on macro-fungi of Qilian Mountain
National Nature Reserve. Edible Fungi of China 30(4): 7-13.
Zhao RL, Desjardin DE, Callac P, Parra LA, Guinberteau J, Soytong K, Karunarathna S, Zhang Y,
Hyde KD. 2012a. Two species of Agaricus sect. Xanthodermatei from Thailand. Mycotaxon 122:
187-195. http://dx.doi.org/10.5248/122.187
Zhao RL, Hyde KD, Desjardin DE, Raspé O, Soytong K, Guinberteau J, Karunarathna S, Callac
P. 2012b. Agaricus flocculosipes sp. nov., a new potentially cultivatable species from the
palaeotropics. Mycoscience 53: 300-311. http://dx.doi.org/10.1007/s10267-011-0169-5
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.197
Volume 129(1), pp. 197-208 July-September 2014
Macrolepiota distribution extends to the
montane temperate forests of Pakistan
MUHAMMAD F1IAZ', SANA JABEEN*, AMNA IMRAN’,
HaBiB AHMAD’, & ABDUL NASIR KHALID?
‘Department of Botany & *Department of Genetics,
Hazara University, Mansehra, Pakistan
*Department of Botany, University of the Punjab,
Quaid-e-Azam Campus-54590, Lahore, Pakistan
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Basidiomata of Macrolepiota dolichaula and M. excoriata were collected
from mixed coniferous forests in Pakistan. The species were identified using ITS nrDNA
sequence analyses and morphological and anatomical characters. Detailed morphological
and anatomical descriptions and illustrations are provided along with results of molecular
phylogenetic analysis. Both species are regarded as new records for Pakistan, and this report
considerably extends their known distribution.
Key worps — Agaricaceae, basidiomata, Basidiomycota, saprotrophic
Introduction
Macrolepiota was established by Singer (1948). Currently, there are about
33 species recognized in the genus worldwide (Kirk et al. 2008; Ge et al. 2010,
2012), of which several are edible (Ding & Huang 2003). Representatives of
the genus typically have large fleshy basidiomata, a pileal surface covered by
squamules composed of long subcylindric elements, white to cream lamellae,
and a prominent annulus. The basidiospores are relatively big and thick-walled
with a germ pore covered by a hyaline cap, and stipe squamules are often visible
as colored bands in mature specimens (Singer 1948; Vellinga 2003; Vellinga et
al. 2003). Some Macrolepiota species have been transferred to Chlorophyllum
Massee, which differs from Macrolepiota s. str. by the presence of pileal
squamules made up of a hymenodermal layer, spore germ pores that are either
absent or truncated, and a smooth stipe (Vellinga & Kok 2002).
198 ... Fiaz & al.
Macrolepiota species are saprotrophic and grow in the soil litter layers that
contain mostly fresh leaves (Vellinga 2004). Some species, such as M. excoriata
and M. phaeodisca Bellu, have a restricted distribution (Courtecuisse & Duhem
1994; Nauta & Vellinga 1995; Candusso & Lanzoni 1990), although the exact
distribution is still unknown for many species. Macrolepiota procera (Scop.)
Singer is the only species that has been reported from Pakistan (Ahmad et al.
1997).
The present study focuses on M. dolichaula and M. excoriata, newly
recorded from Pakistan from two different areas of Khyber Pakhtunkhawa
(KPK) Province. Macrolepiota dolichaula has been previously reported from
China (Chiu 1948; Shao & Xiang 1981; Zang et al. 1996; Bi et al. 1994, 1997;
Ge et al. 2010, 2012), East Africa (Pegler 1977), eastern Australia (Grgurinovic
1997; Vellinga 2003), India (Manjula 1983; Natarajan & Manjuk 1983), Sri
Lanka (Pegler & Rayner 1969), Thailand (Ge et al. 2010), and Vietnam (Kiet
1998; Yang 2000). Macrolepiota excoriata is native to Europe and has also been
reported from India (Kumari 2012), Israel (Barseghyan et al. 2012), South
Africa (Doidge 1950), Turkey (Afyon & Yagiz 2004; Dogan & Oztiirk 2006),
China (Teng 1996; Mao 2000; Ge et al. 2010), and North America and South
Africa (http://www.gbif.org/). The correct identity of some of these records,
however, requires confirmation.
Materials & methods
Sampling site description
The two sampling sites are situated in the Mansehra and Swat districts of Khyber
Pakhtunkhwa.
Mansehra district is located at the eastern border of the KPK. Mountain ranges,
plains, valleys, and numerous lakes and rivers are the main features, with the Kunhar
and Siran rivers among the largest in the area. The climate is warm in summer and cold
in winter, although the northern high mountainous region remains cold in summer due
to snow cover. Evergreen and deciduous trees are well represented. Pinus wallichiana
A.B. Jacks. and Pinus roxburghii Sarg. are dominant tree species, while Juglans regia L. is
the most common broadleaf tree (Mustafa 2003).
The Swat valley, which lies in northern Khyber Pakhtunkhwa, is surrounded by
mountains that are offshoots of the Hindu Kush. The Swat River is formed by the joining
of the Ushu and Utrot rivers, which descend from the Hindu Kush Mountains. Kalam,
a village along the upper reaches of the Swat River, is known for its waterfalls, lakes, and
lush green hills dominated by Cedrus deodara (Roxb. ex D. Don) G. Don forests, Pinus
spp., and Quercus sp. The climate is moist temperate to dry temperate (Champion et al.
1965). Following the standard classification of Pakistan's forests (Champion et al. 1965),
Shah & Khan (2006) classify the Swat forest type as belonging to “montane temperate
forest.”
Macrolepiota species new to Pakistan ... 199
Morphological & anatomical characterization
Fresh basidiomata were collected and catalogued, described morphologically, and
photographed using a Nikon D70S digital camera. Color codes follow Munsell Soil
Color Charts (1975). The specimens were dried under a fan heater. The specimens
were mounted in 5% KOH solution for examination of basidia, cystidia, spores, pileal
elements and stipe hyphae under a MX4300H microscope (Meiji Techno Co., Ltd.,
Japan). Anatomical features were measured with a Carl Zeiss Jena ocular micrometer.
Basidiospore dimensions follow the format [n/m/p = n basidiospores measured from
m fruit bodies of p collections], length x width (1 x w), and avQ (= average |/w ratio
of all spores). Line drawings were made using Lerrz Wetzlar Camera Lucida. Voucher
specimens were deposited in either the Herbarium, Department of Botany, University
of the Punjab, Lahore, Pakistan (LAH) or the Herbarium Hazara University, Dhodial,
Pakistan (HUP).
Molecular characterization
A small piece (2 mg) of lamellae was kept in 2% CTAB buffer. DNA was extracted using
modified CTAB method following Bruns (1995). The nrDNA ITS regions were amplified
using ITS1F (CTTGGTCATTTAGAGGAAGT) and ITS4 (TCCTCCGCTTATTGATATGC) primers
under standard conditions (Gardes & Bruns 1993) Agarose Gel Electrophoresis was
performed to visualize PCR products in Gel Documentation System (UVtec. Avebury
House, Cambridge CB4 1QB UK) at default settings. The products were sent to Macrogen
Inc. (Korea) to perform sequencing using the same pair of primers. The consensus
sequence was generated from the sequences obtained using both primers. A BLAST
search was used to retrieve nucleotide sequences from GenBank (http://www.ncbi.nlm.
nih.gov/), with the closest matching sequences selected from the initial blast. The most
closely related species were also included in the final data set. ClustalW was used to
align sequences in MEGA software. The sequences were trimmed with the conserved
motifs 5’-(...GAT)CATTA... and ...GACCT(CAAA...)-3’, and the alignment portion between
them was included in phylogenetic analysis. Maximum likelihood (ML) analysis was
performed using Jukes-Cantor model and nearest neighbor interchange as ML heuristic
search method in MEGAS software to test the phylogeny at 1000 bootstraps. The rDNA-
ITS divergence was reconstructed using MegAlign (DNAStar). Sequences generated in
this study were submitted to GenBank (KJ013326; KJ643333; KJ643334).
Taxonomy
Macrolepiota dolichaula (Berk. & Broome) Pegler & R.W. Rayner, Kew Bull. 23: 365
(1969). FIG. 1
BASIDIOMATA medium to large with long stipe. PILEUs <13.5 cm diam.,
fleshy, convex to plano-convex, white (5Y9/2), with inwardly projected margins,
umbonate, covered with minute, pallid, yellowish brown (10YR5/6) squamules,
crowded at centre, become minute and sparse towards margins; disc yellowish
brown (10YR5/6); margins rough, fragile at maturity; context thick and white
(5Y9/2). LAMELLAE free, crowded, white (5Y9/2) when young, becoming off-
200 ... Fiaz & al.
—_—$<“—=
SSS
FicurE 1: Macrolepiota dolichaula (FM-22). A-D. Basidiomata; E. Basidia; F. Basidiospores;
G. Cheilocystidia; H. Hyphae from pileus. Scale bars: A = 3 cm; B-D = 4.5 cm; E = 13 um;
F=9 um; G= 10 um; H= 15 um.
white to cream (2.5Y8/4) at maturity. LAMELLULAE few in general. STIPE <26
cm long, gradually tapering towards the apex, diam. 0.5 cm towards the pileus
and <1.3 cm towards the base, farinose, mostly glabrous, off-white to cream
(2.5Y8/4), scabrous just below the annulus, with brown (10YR7/6) scales; base
bulbous, <2 cm in diam. ANNULUS ascending, whitish (2.5Y8/4), superior,
membranous, moveable. Odor and taste not recorded.
Macrolepiota species new to Pakistan ... 201
BASIDIOSPORES [50/1/1] 9.4-15.6 x 7.5-11.3 um (average = 12.5 x 9.4 um),
avQ = 1.33, ovoid to broadly ellipsoid, ellipsoid, hyaline in 5% KOH, reddish
brown in Melzer’s reagent, with a germ pore on the rounded apex with a
hyaline cap; apiculus 1-1.5 um high. Basip1a 29-39.6 x 9.9-14.4 um, clavate
to subclavate, thin-walled, hyaline in 5% KOH, 4-spored. PLEUROCYSTIDIA
absent. CHEILOCYSTIDIA 18.4—28.4 x 7.1-12.8 um, clavate, thin walled, hyaline.
SQUAMULES on pileus consisting of cylindric to subcylindric, branched,
clampless hyphae, 3-10 um in diam., terminal elements cylindric to slightly
attenuating towards the tip, hyaline to yellowish brown vacuolar pigment.
CLAMP CONNECTIONS occasional at basidial bases.
MATERIAL EXAMINED—PAKISTAN, MANSEHRA DisTRICT, Khabbal Paien, 1450 m asl,
on soil under Pinus wallichiana, August 2009, Muhammad Fiaz FM-22 (HUP MFM-
331; GenBank KJ643334).
Macrolepiota excoriata (Schaeff.) Wasser, Ukr. Bot. Zh. 35: 516 (1978) Fic. 2
BASIDIOMATA medium to large. PILEUs <8 cm in diameter, fleshy, convex
to plano-convex with smooth margins, slightly umbonate, white to off white
(2.5Y8/4), covered with furfuraceous brownish squamules (10YR5/6), which
become sparse toward margin; disc smooth, brownish (10YR5/6), margins
rough and fragile. LAMELLAE free, <9 mm broad, crowded with 1-2 tiers of
short lamellulae, white to off white (2.5Y8/4). Stipe 7.3-14.5 cm long, diam.
0.4 cm towards the point of attachment and 0.7 cm towards the base, with
abruptly bulbous base <1.7 cm diam., central, hollow, fibrillose, white to off
white (2.5Y8/4), cylindrical, white to off-white (2.5Y8/4), covered with minute
brownish (10 YR 5/6) squamules above the annulus. ANNULUS persistent,
descending, whitish (2.5Y8/4), membranous, superior, about 3 cm below the
stipe apex. CONTEXT white, not changing when bruised. Odor and taste not
recorded.
BASIDIOSPORES [50/2/2] 12.7-18.4 x 11.1-12 um (average = 15.7 x 11.5 um),
avQ = 1.36, ellipsoid to ovoid with one or many guttules, thick-walled (0.8 um),
smooth, off-white or pale yellow in 5% KOH, light brown to reddish brown in
Melzer’s reagent, with rounded apex; germ pore visible; apiculus prominent.
BASIDIA 40.3-47.4 x 16.0-18.6 um (average = 43.6 x 17.2 um), at base 5.7 um
wide on average, clavate, guttulate, thin-walled, commonly 4-spored, hyaline
to off-white or pale yellow in KOH; sterigmata 6 um long. PLEUROCYSTIDIA
absent. CHEILOCYSTIDIA 29.3-32.1 x 11.1-13.9 um (average = 31 x 11.9
um), base 5 um, thin-walled, hyaline to off-white or pale yellow in 5% KOH,
clavate. SQUAMULES made up of filamentous, branched, cylindrical, clampless,
hyphae 3.3-16 um in diam. with yellowish pigment; terminal segments
32.5-153.4 x 6.3-12.5 um. STIPE HYPHAE thin walled, hyaline to cream. CLamp
CONNECTIONS not observed.
202 ... Fiaz & al.
FiGURE2: Macrolepiota excoriata(FM-305 [A-D];F2;K3-1[E-I]).A-D. Basidiomata;E. Basidia;
E Cheilocystidia; G. Basidiospores; H. Hyphal squamules; I. Hyphae from pileipellis. Scale bars:
A, C, D=3 cm; B= 2 cm; E= 10 um; F = 9 um; G = 8 um; H = 18 um; I = 21 um.
MATERIAL EXAMINED—PAKISTAN, MANSEHRA DisTRICT, Khabbal Paien, Dub, 1700
m asl, on soil under Pinus wallichiana, July 2009, Muhammad Fiaz FM-305 (HUP
MFM-332; GenBank KJ643333); SwaT DistricT, Kalam, 2070 m asl, on soil under
Cedrus deodara, 4 September 2013, Sana Jabeen F2; K3-1 (LAH-SJ1-2013; GenBank
KJ013326).
Macrolepiota species new to Pakistan ... 203
Phylogeny
The nrITS sequences of Macrolepiota excoriata comprised 750-753 (ITS1F
primer) and 760-769 (ITS4 primer) base pairs; a consensus sequence of 654
base pairs was obtained by trimming the motif of both sequences. Macrolepiota
dolichaula sequences comprised 1390 (ITSIF primer) and 768 (ITS4 primer)
base pairs. The BLAST of M. excoriata (KJ013326) revealed that it was 99%
identical to JQ683100, JQ683089, HM246504, AF482840, AY243606, and
JQ683118 with 100% query cover and 0.0 E value; M. dolichaula was100%
identical to AF482839 with 100% query cover and 0.0 E value. Published
sequences from different Macrolepiota sections were included to reconstruct
the phylogeny with Leucoagaricus barssii (Zeller) Vellinga as outgroup. The
analysis revealed three major clades within Macrolepiota (Fic. 3; /macrolepiota,
/macrosporae, /volvatae), which correspond to sections Macrolepiota,
Macrosporae, and Volvatae in earlier studies (Vellinga et al. 2003; Ge et al. 2010).
Within /macrolepiota, M. dolichaula, M. detersa, M. procera, M. colombiana,
M. fuliginosa, M. subcitrophylla and M. clelandii clustered with 58% bootstrap
support; within /macrosporae, M. phaeodisca, M. konradii, M. mastoidea,
M. subsquarrosa, M. orientiexcoriata, and M. excoriata clustered with 97%
bootstrap support; and within /volvatae, the two volvate species, M. eucharis
and M. velosa, clustered with 100% bootstrap support.
Discussion
Macrolepiota is a monophyletic group in accordance with ITS based findings
(Vellinga et al. 2003). In present study, all three clades recovered by the ITS data
set received strong bootstrap support. Morphological characters also support
separation of these clades.
Macrolepiota dolichaula (KJ643334) from Pakistan clustered with similar
specimens in sect. Macrolepiota, which is characterized by a complex annulus,
relatively big (usually 14-20 um) ovoid-ellipsoid spores, frequent clamp
connections at the bases of the cheilocystidia and basidia, and a long stipe (Bon
1996). Within this section, the stipe surface usually has fine brown squamules,
but Macrolepiota dolichaula with a farinose stipe surface is an exception.
The pileus within this section usually forms plate-like squamules, but again
M. dolichaula is an exception, with its pileus covered by minute, pallid
squamules.
In the phylogenetic analysis, the M. dolichaula specimen from Pakistan
shared a 100% identity with HM125516 (China) and AF482839 (Australia),
99.7% identity with AY083193 (Australia), and 99.6% identity with HM125517
(China). All analyzed M. dolichaula sequences form a sister clade with
M. detersa (Fia. 3).
204 ... Fiaz & al.
@ M_dolichaula_KJ643334
M_dolichaula_HM125520
M_dolic haula_HM125522
M_dolishaula_HM125519
M_dolic haula_HM125515
100 M_dolichaula_HM125521
M_dolichaula_JN180325
611| M_dolichaula_HM125523
M_dolichaula_HM125518
M_dolic haula_HM125517
98 M_dolic haula_HM125516
M_dolic haula_AF 482839
M_dolichaula_AY083193
M_detetsa_{as"M_sp"}, AY 243586
M_detersa_(as"M_sp"} AY243587
M_detersa_HM125510
100 | M_detersa_JN180324
53 M_detersa_fas"M_sp'). AF482851
M_detersa_JN1&0323
M_aff_procera_AY243591
M_procera_HM125514
M_procera_HM125513
M procera_L&5310
M_procera_AY248588
M_procera_AY 243589
EL M_procera_AF 482848
58 ypc HM125512
97
‘macrolepicta
L_ pros
62 | M_procera_AY243590
M_procera_HM125511
M_solombiana_U&5311
M_fuliginosa_AY243598
99 M_rhodospertna_AY243596
58 B M_fuliginosa_AF 482841
M_fuliginosa_AY 243597
66 M_sp_AY243595
M_sp_AY243594
87 M_sp_AY243593
ba M_sp_AF482852
g6 |M_sp_AY243592
100 - M_subsitrophylla_JN180821
M_subeitrophylla_JN180822
M_clelandi_AY083194
M_cllandi_AY0&3196
7 M_clelandi_AY0&3202
M_clelandi_AY083194
53 M_clelandi_AY0&3195
M_clelandi_AY0&3196
100 M_clelandil_AY083203
M_clelandii_AY083201
M_clelandi_AY0&3200
M_clelandi_AF482838
M_clelandi_AY0&3198
M_phaeodisca_AF482847
M_excoriata_JO683100
M_excoriata_(as"M_heimii'_AY243606
M_excoriata_HM246504
oof M | excoriata_JOQG83089
@ M_excoriafa_KJ649333
M_excoriata_AF 482840
97 aq | M_excoriata_AY249607
@ M_excoriata_KJ013326
M_ortientiexcoriata_HM1 25524
M_otientiexcoriata_HM1 25524
M_otientiexcoriata_HM1 25528
M_orientiexcoriata_(as"M_sp")_AF482850
37 |6| |M | orientiexcoriata_] HM1 25528
Mt Orientiexcoriata_| HM125527
M_otientiexcoriata_HM1 25525
M_otientiexcoriata_HM125526
M_konradii_AY 243603
57 M_tmastoidea_(as"M_psammophila'| AY243600
M_tmastoidea_AY243604
ae 27 |] M_korradii_AY243601
M_konradii_AY 243602
M_subsquartosa_AY243605
M_mastoidea_EU681783
M_mastoidea_HKAS50194
M_tmastoidea_KF668312
M_tastoidea_HM125529
97 | M_mastoidea_HM125531
M_tastoidea_HM125532
M_mastoidea_HM125530
M_tastoidea_(as"M_psammophila'}_ AY 243599
M_mastoidea_AF 482644
46 | M_mastoidea_{as"M_excoriata")_U85313
M_mastoidea_(as"M_gracilenta") MGU85314
M_eucharis_AF 482854
M_Velosa_AF 482853
100 M_velosa_HM125509 | /VoWvatae
#1 Oo M_velosa_JN1 80320
55
/macrosporae
Leucoagaricus_barssii_AF295931 _]Out group
0.02
Macrolepiota species new to Pakistan ... 205
FiGurE 3 (left): Molecular phylogenetic analysis of Macrolepiota spp. inferred by using the
Maximum Likelihood method. Sequences generated from Pakistan are marked with @. Genbank
accession numbers of all the taxa are given. The percentage of trees in which the associated taxa
clustered together at 1000 bootstraps is shown next to the branches. The tree is drawn to scale,
with branch lengths measured in the number of substitutions per site. The analysis involved
93 nucleotide sequences. There were a total of 712 positions in the final dataset.
Macrolepiota excoriata is closely related to M. orientiexcoriata Z.W. Ge
et al. but forms a separate subclade within /macrosporae. Macrolepiota sect.
Macrosporae is characterized by a long stipe, a simple annulus, and rare clamp
connections. The species within this clade have furfuraceous fine squamules
with rarely branched, light brown cylindrical hyphae. Macrolepiota excoriata
(KJ013326) and M. excoriata (KJ643333) from Pakistan shared a 99.9% identity
and clustered with M. excoriata from Israel (JQ683089, JQ683100, JQ683089),
Italy (HM246504), the Netherlands (AF482840), the United Kingdom
0° 20° 40° 60° 5 Bin 120° 140°
fon sm GF TPs
ait Z {eax Mea
td 2 7 \ bees 1) L oud
A oN + \' —~2
&S aa cy
Te ‘ RY } MS
J A 3 ~ é
ny Fina | USSR
y le atl
60° Of
C a f }
n° : jt
e vo WL Q
oy \ \\\
e 17 . \C
i +t \
/ r: lA
—@ \ ; China ee f MY
K )Fe@e- NSS Aer , ‘ad ae :
40 ( Jy a ae 8 paeat y f, Pan 40°
) (Spain/ Soy. Turkey Ry | 5“t-5,_f y
je / Mediterranean Sa Le ee , e Ae) Korea }
mage —t OS J ASIA PS pal
' Jeut Afghanistani@@® (
/ a Biel fy 7 7 _ \
‘at: ———_/ | \ A Fan .
fw / ptr | ew’ A Be ——.
SA . 3 \ . 7
- Algeria r stael ee \Pakistan,./ ager
(\ yen Libya | NG ie foc A arbi a = f
} | \4 TN nd India. f f
fsk™ “tf /~ LA \ Saudi Arabia x gay ON a ee
aoe. T ‘ ; et GE les oth 20
a \Mai _) | h ; / vel te
Oi ave / ” , Av \ 7 —ihailaad i}
eal fF ~~") Sudan / I : \ ( \ ~~ \ us
\ 2 ae oo Say d / > \ Vf S
eras ot ; (tae 2% :
*< } ; /Nigeria fe J Nae of \ / ({ : | fe
\A7 lame \ c it ey | é
x i Et ) As |
\ ay oe Gee ee a 7? of Sri Banka ens Fi
o° { ) / / A -¢ Kenya/ A : eat \ pM pear x ar
\- Y (Mast Asie} he T(E OAKS
\¢ ) * Singapore i we >
\ _ T bi »v \
ia Tanzania ~~, 2 {
7 a ng oa GQ )--
LY i
) T i ' o—~, N\
y Angola. — A \ - -| f\
} } “2 ) | fA “vo é ( &,
\ OE / / i Le
si : \ Zimbabwe L { | : y, : 50°
ek ome Ae ot i ‘
yah pees} \ ¢ f \
hi Ay UJ g
LS Crees ‘ AUSTRALIA _ )
‘South “Aftica / f
|S ee .
Ly
oO 20° 40° 60" gor 100° 120° 1400~_
FiGurE 4: Map showing distribution of Macrolepiota dolichaula (x) and M. excoriata (@). Open
dots (O) represent reports of M. excoriata without voucher specimens.
206 ... Fiaz & al.
(AY243606), and France (AY243607) with 99.7-99.9% identity and 0.2-0.3%
genetic divergence.
Many Macrolepiota species have relatively small distribution areas
(Courtecuisse & Duhem 1994; Nauta & Vellinga 1995; Candusso & Lanzoni
1990). Occurrence of M. dolichaula and M. excoriata in KPK, Pakistan extends
the known distributions of these species considerably (Fic. 4). These two species
were found in two different habitats dominated by obligatory mycorrhizal tree
species. Mansehra district, KPK, lies in the moist temperate region dominated
by Pinus wallichiana where the forest floor is dominated by different grass
species. These coniferous forests are very similar to those in other parts of the
northern temperate zone of Europe and America (Champion et al. 1965). Swat
district, KPK, falls in the dry temperate region dominated by Cedrus deodara
forests, in which there is no understory vegetation.
Although Macrolepiota species are generally very regional and are not
widely distributed, M. dolichaula is an exception. We still lack enough data on
the full distribution of these fungi to be able to predict their occurrence (or
non-occurrence) in a certain area.
Acknowledgements
We are sincerely thankful to Dr. Else C. Vellinga (University of California, Berkeley,
USA) for critically reviewing the manuscript, valuable suggestions to improve the map
and acting as presubmission reviewer. Thanks to Dr. Zai-Wei Ge (Kunming Institute
of Botany, Chinese Academy of Sciences, P. R. China) for his useful suggestions to
improve the manuscript. We are also thankful to Dr. T. K. Arun Kumar (The Zamorin’s
Guruvayurappan College, India) for acting as presubmission reviewer. We are highly
indebted to Higher Education Commission (HEC), Pakistan for financial assistance
under Indigenous PhD Fellowships (Phase II).
Literature cited
Afyon A, Yagiz D. 2004. Macrofungi of Sinop Province. Turkish J. Bot. 28: 351-360.
Ahmad S. Iqbal SH, Khalid AN. 1997. Fungi of Pakistan. Sultan Ahmad Mycological Society,
Pakistan. 248 p.
Barseghyan GS, Kosakyn A, Isikhuemhen OS, Didukh M, Wasser SP. 2012. Phylogenetic analysis
within genera Morchella (Ascomycota, Pezizales) and Macrolepiota (Basidiomycota, Agaricales)
inferred from rDNA ITS and EF-1a sequences. JK Misra et al. (eds.). Systematics and evolution
of fungi (ed. 1). Science Publishers.
Bi ZS, Zheng GY, Li TH. 1994. Macrofungus flora of Guangdong Province. Guangdong Science and
Technology, Guangdong. 879 p. [in Chinese].
Bi ZS, Li TH, Zhang WM, Song B. 1997. A preliminary agaric flora of Hainan Province. Guangdong
Higher Education, Guangzhou. 388 p. [in Chinese].
Bon M. 1996. Die Grofpilzflora von Europa 3. Lepiotaceae. Eching: IHW- Verlag.
Bruns TD. 1995. Thoughts on the processes that maintain local species diversity of ectomycorrhizal
fungi. Pl. Soil 170: 63-73. http://dx.doi.org/10.1007/BF02183055
Macrolepiota species new to Pakistan ... 207
Candusso M, LanzoniG. 1990. Lepiota s.1. Fungi europaei 4. Saronno, Italy: Giovanna Biella. 743 p.
Champion HG, Sethi SK, Khattak GM. 1965. Forest types of Pakistan. Pakistan Forest Institute.
Peshawar, Pakistan. 233 p.
Chiu WE. 1948. The Amanitaceae of Yunnan. Sci. Rept. Natl. Tsing Hua Univ. Ser. B., Biol. and
Psychol. Sci 3(3): 165-178.
Courtecuisse R, Duhem B. 1994. Guide des champignons de France et d'Europe. Lausanne:
Delachaux et Niestlé. 478 p.
Ding ZQ, Huang SZ. 2003. Characteristics and high-yield culture technique of Macrolepiota
procera. Edible Fungi 4: 33 [in Chinese].
Dogan HH, Oztiirk, C. 2006. Macrofungi and their distribution in Karaman Province, Turkey.
Turk. J. Bot. 30: 193-207.
Doidge EM, 1950. The South African fungi and lichens. Bothalia 5: 1-1094.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for Basidiomycetes: application
to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.
Ge ZW, Yang ZL, Vellinga EC. 2010. The genus Macrolepiota (Agaricaceae, Basidiomycota) in
China. Fungal Diversity. 45: 81-98. http://dx.doi.org/10.1007/s13225-010-0062-0
Ge ZW, Chen ZH, Yang ZL. 2012. Macrolepiota subcitrophylla sp. nov., a new species with yellowish
lamellae from southwest China. Mycoscience 53: 284-289.
http://dx.doi.org/10.1007/S10267-011-0167-7
Grgurinovic CA. 1997. Larger fungi of South Australia. Botanic Gardens of Adelaide and State
Herbarium and Flora and Fauna of South Australia Handbooks Committee, Adelaide.
Kiet TT. 1998. Preliminary checklist of macrofungi of Vietnam. Feddes Repert. 109: 257-277.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. (eds) 2008. Dictionary of the fungi, 10th edn. CABI,
Wallingford.
Kumari B. 2012. Diversity, sociobiology and conservation of lepiotoid and termitophilous
mushrooms of north west India. PhD Dissertation. Punjabi University, Patiala, India.
Manjula B. 1983. A revised list of the agaricoid and boletoid basidiomycetes from India and Nepal.
Proc. Indian Acad. Sci. (Plant Sciences) 92: 81-213.
Mao XL. 2000. The macrofungi in China. Henan Science and Technology, Zhengzhou. 719 p. [in
Chinese].
Munsell Soil Color Charts. 1975. Munsell Color Co., Baltimore, MD.
Mustafa G. 2003. Mansehra, an introduction. Gazetteer of the Hazara District.
Natarajan K, Manjuk B. 1983. South Indian Agaricales XII - Lepiota. Bibliotheca Mycologica
91: 563-581.
Nauta MM, Vellinga EC. 1995. Atlas van Nederlandse paddestoelen. Rotterdam, Brookfield:
A.A. Balkema. 352 p.
Pegler DN, Rayner RW. 1969. A contribution to the agaric flora of Kenya. Kew Bulletin 23: 347-412.
Pegler DN. 1977. A preliminary agaric flora of east Africa. Kew Bulletin Additional Series, London
6: 1- 615.
Shah GM, Khan MA. 2006. Check list of medicinal plants of Siran Valley Mansehra-Pakistan,
Ethnobotanical Leaflets 10: 63-71.
Shao LP, Xiang CT. 1981. The study on the Macrolepiota spp. in China. J. NE Forestry Inst. 4: 35-38.
Singer R. 1948. New and interesting species of Basidiomycetes. Pap. Mich. Acad. Sci., Arts Lett.
32: 103-150.
Teng SC. 1996. Fungi of China. Mycotaxon Ltd, Ithaca, New York.
Vellinga EC. 2003. Chlorophyllum and Macrolepiota (Agaricaceae) in Australia. Austr. Syst. Bot.
16: 361-370.
208 ... Fiaz & al.
Vellinga EC. 2004. Ecology and distribution of lepiotaceous fungi (Agaricaceae) - A Review. Nova
Hedwigia 78: 273-299.
Vellinga EC, Kok RPJ de. 2002. Proposal to conserve the name Chlorophyllum Massee against
Endoptychum Czern. Taxon 51: 563-564.
Vellinga EC, Kok RPJ de, Bruns TD. 2003. Phylogeny and taxonomy of Macrolepiota (Agaricaceae).
Mycologia 95: 442-456.
Yang ZL. 2000. Type studies on agarics described by N. Patouillard (and his co-authors) from
Vietnam. Mycotaxon 75: 431-476.
Zang M, Li B, Xi JX. 1996. Fungi of Hengduan mountains. Science, Beijing. [in Chinese]
ISSN (print) 0093-4666 © 2014. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.209
Volume 129(1), pp. 209-211 July-September 2014
Hyphodontia dhingrae sp. nov. from India
SAMITA, S.K. SANYAL , & G.S. DHINGRA
Department of Botany, Punjabi University, Patiala 147 002, India
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — A new corticioid species with a hydnoid hymenophore, Hyphodontia dhingrae,
is described in association with an angiospermous host from Uttarakhand state in India.
Key worps — Agaricomycetes, Bageshwar, Kausani, Hymenochaetales, Schizoporaceae
While conducting fungal forays in Kausani area of district Bageshwar,
Uttarakhand, India, Samita & Sanyal collected an unknown corticioid fungus on
angiospermous wood. The study revealed distinct macroscopic and microscopic
features such as hydnoid basidiocarps with very long spines (up to 6 mm), two
types of cystidial elements, and ellipsoid thin-walled inamyloid basidiospores.
Comparison with available literature (Eriksson & Ryvarden 1976, Rattan 1977,
Langer 1994, Dhingra 2005, Xiong et al. 2009, 2010, Bernicchia & Gorjén 2010,
Gorjon 2012) showed it to be an undescribed species in the genus Hyphodontia.
The material was also analyzed by Prof. Nils Hallenberg, who supported the
description of a new species within Hyphodontia.
Hyphodontia dhingrae Samita & Sanyal, sp. nov. Fries 1-12
MycoBank MB808470
Differs from Hyphodontia arguta by its strongly hydnoid hymenophore and narrower
basidiospores.
Type: India, Uttarakhand: Bageshwar, Kausani, on angiospermous wood, 03 September
2011, Samita 5199 (PUN, holotype).
Erymotoey: In honor of Gurpaul Singh Dhingra, Professor, Department of Botany,
Punjabi University, Patiala, India.
Basidiocarp resupinate, adnate, effused, <300 um thick in section excluding
aculei; hymenial surface cream colored with an orange tint to pale orange
when fresh, light orange white to light brownish orange on drying, hydnoid;
aculei densely aggregated, cylindrical to conical or slightly flattened, up to 6
210 ... Samita, Sanyal, & Dhingra
08H OOD® mh OA g & EN g
4 BP a s Me v
Ong
3 10um
\ Ip as
NAY 4
LSAVAWSOLLME
LS a
—— — —s <——S
— ———S=
———
S ———F os =
>
——————_——— a
SSS 2085 ——
——_—
son eae ——
10um
~~ wee
oS ae 20 pm
<=>
\ q
e - ;
a’ ™., >.
~~ ~ =
a Me oe 1 12
PLaTE 1. Hyphodontia dhingrae (holotype). 1. Fresh basidiocarp. 2. Dried basidiocarp.
3. Basidiospores. 4. Basidia. 5. Generative hyphae. 6. Capitate cystidia. 7. Lagenocystidia.
8. Vertical section through basidiocarp. 9. Generative hyphae and Basidiospores. 10. Capitate
cystidium. 11. Lagenocystidia. 12. Section through spine.
Hyphodontia dhingrae sp. nov. (India) ... 211
mm long and 1 mm wide at the base; margins thinning, paler concolorous
to indeterminate. Hyphal system monomitic; generative hyphae, septate,
clamped; basal hyphae <5 um wide, parallel to the substrate, sparsely branched,
thin- to somewhat thick-walled; subhymenial hyphae <2.5 um wide, frequently
branched and interwoven, thin-walled; tramal hyphae in the centre of the
aculei up to 4.5 um wide, running parallel, densely united, with thickened
walls and sparsely septated, without crystalline aggregations. Capitate cystidia
21-47 x 4.5-8 um scattered in the hymenium, thin- to somewhat thick-
walled, with basal clamp. Lagenocystidia 35-40 x 4-6 um, very frequent in the
hymenial region, consisting of hyphal ends abruptly ending into a needle like
portion, apically encrusted, thin-walled. Basidia 22-28 x 3.5-4.5 um, clavate,
4-sterigmate, with basal clamp; sterigmata <4 um long. Basidiospores 4.3-5.3
x 2.5-3 um, ellipsoid, smooth, thin-walled, with oily contents, acyanophilous,
inamyloid.
REMARKS— Hyphodontia dhingrae is closely related to H. arguta in having a
similar type of lagenocystidia, but H. arguta differs in having an odontioid
hymenophore with 0.5-2 mm long spines and wider basidiospores (3.5-5 um;
Eriksson & Ryvarden 1976: 609).
Acknowledgements
The authors thank Head, Department of Botany, Punjabi University, Patiala, for
providing research facilities, Prof. Nils Hallenberg (Gothenburg, Sweden) for expert
comments and peer review, and Prof. B.M. Sharma (Department of Plant Pathology,
COA, CSKHPAU, Palampur, H.P., India) for peer review.
Literature cited
Bernicchia A, Gorjon SP. 2010. Corticiaceae s.l. Fungi Europaei 12. Edizioni Candusso. Alassio.
Italia. 1008 p.
Dhingra GS. 2005. Genus Hyphodontia John Eriksson in the Eastern Himalaya. J. Ind. Bot. Soc.
84; 118-122.
Eriksson J, Ryvarden L. 1976. The Corticiaceae of North Europe. Vol. 4. Hyphodermella —- Mycoacia.
Oslo. pp. 549-886.
Gorjon SP. 2012. Some species of Hyphodontia s.1. with encrusted cystidial elements. Mycosphere
3(4): 464-474. http://dx.doi.org/10.5943/mycosphere/3/4/10
Langer E. 1994. Die Gattung Hyphodontia John Eriksson. Bibliotheca Mycologica 154. 298 p.
Rattan SS. 1977. The resupinate Aphyllophorales of the North Western Himalayas. Bibliotheca
Mycologica 60. 427 p.
Xiong HX, Dai YC, Wu SH. 2009. Three new species of Hyphodontia from Taiwan. Mycol. Progress
8: 165-169. http://dx.doi.org/10.1007/s11557-009-0587-3
Xiong HX, Dai YC, Wu SH. 2010. Two new species of Hyphodontia from China. Mycologia 102(4):
918-922. http://dx.doi.org/10.3852/09-139
ISSN (print) 0093-4666 © 2014 Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/129.213
Volume 129(1), pp. 213-214 July-October 2014
NOMENCLATURAL NOVELTIES AND TYPIFICATIONS
PROPOSED IN MYCOTAXON 129(1)
Agaricus taeniatus Sai F. Li, Shao J. Li & H.A. Wen, p. 189
Aschersonia narathiwatensis Mongkols., Khonsanit & Luangsa-ard, p. 36
Erysiphe magnoliicola S.E. Cho, S. Takam. & H.D. Shin, p. 155
Gastroboletus thibetanus Shu R. Wang & Yu Li, p. 80
Hyphodontia dhingrae Samita & Sanyal, p. 209
Hypoxylon confertisilvae Lar.N. Vassiljeva & S.L. Stephenson, p. 90
Hypoxylon ilicinum Lar.N. Vassiljeva & S.L. Stephenson, p. 92
Hypoxylon meridionale Lar.N. Vassiljeva & S.L. Stephenson, p. 92
Hypoxylon minicroceum Lar.N. Vassiljeva & S.L. Stephenson, p. 93
Hypoxylon rolingii Lar.N. Vassiljeva & S.L. Stephenson, p. 94
Linkosia longirostrata G. Delgado, p. 42
Nawawia quadrisetulata Goh, W.Y. Lau & K.C. Teo, p. 110
Neofomitella Y.C. Dai, Hai J. Li & Vlasak, p. 12
Neofomitella fumosipora (Corner) Y.C. Dai, Hai J. Li & Vlasak, p. 12
Neofomitella polyzonata Y.C. Dai, Hai J. Li & Vlasak, p. 12
Neofomitella rhodophaea (Lév.) Y.C. Dai, Hai J. Li & Vlasak, p. 15
Nolanea acuta (Romagn. & Gilles) Largent, p. 121
Nolanea alboproxima Largent, Aime & T.W. Henkel, p. 123
Nolanea applanata Largent & T.W. Henkel, p.125
Nolanea clavata Largent & T.W. Henkel, p. 127
Nolanea claviformis Largent & Aime, p. 130
Nolanea concentrica Largent & T.W. Henkel, p. 132
Nolanea furcata Largent & T. W. Henkel, p. 134
Nolanea mimiae Largent & Aime, p. 137
Nolanea rava Largent & Aime, p. 139
Nolanea sinuolata Largent, Aime, & T.W. Henkel, p. 141
Nolanea subsulcata Largent & T.W. Henkel, p. 144
Phoma recepii Halici & Candan, p. 164
214 ... MYCOTAXON 129(1)
Rhizophagus natalensis Blaszk., Chwat & B.T. Goto, p. 100
Uromyces myosotidis Bahg., p. 21
Xylaria beilschmiediae G. Huang & L. Guo, p. 149
Xylaria foliicola G. Huang & L. Guo, p. 150
Ypsilomyces D.A.C. Almeida & Gusmao, p. 182
Ypsilomyces elegans D.A.C. Almeida & Gusmao, p. 182
Zasmidium gynurae (Sawada & Katsuki) W.H. Hsieh, Y.L. Guo & FY. Zhai, p. 57
Zasmidium bougainvilleae (J.M. Yen & G. Lim) Y.L. Guo, W.H. Hsieh & EY. Zhai, p. 58
bad taxonomy
@}
can KILL