MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY e& NOMENCLATURE
VOLUME 134 (2) APRIL-JUNE 2019
Geopora ahmadii sp. nov.
(Saba & al.— Fies1 & 2; pp. 382, 383)
ISSN (PRINT) 0093-4666 https://doi.org/10.5248/134-2 ISSN (ONLINE) 2154-8889
MYXNAE 134(2): 223-412 (2019)
EDITORIAL ADVISORY BOARD
BRANDON MATHENY (2013-2019), Chair
Knoxville, Tennessee, U.S.A.
KAREN HANSEN (2014-2021)
Stockholm, Sweden
ELSE C. VELLINGA (2019-2022)
Berkeley, California, U.S.A.
Topp OsMUNDSON (2019-2023)
La Crosse, Wisconsin, U.S.A.
ISSN 0093-4666 (PRINT)
ISSN 2154-8889 (ONLINE)
MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
APRIL-JUNE 2019
VOLUME 134 (2)
https://doi.org/10.5248/134-2
EDITOR-IN-CHIEF
LORELEI L. NORVELL
[email protected]
Pacific Northwest Mycology Service
6720 NW Skyline Boulevard
Portland, Oregon 97229-1309 USA
NOMENCLATURE EDITOR
SHAUN R. PENNYCOOK
[email protected]
Manaaki Whenua Landcare Research
Auckland, New Zealand
MyYcoTAxONn, LTD. © 2019
www.mycotaxon.com &
www.ingentaconnect.com/content/mtax/mt
P.O. BOX 264, ITHACA, NY 14581-0264, USA
IV ... MYCOTAXON 134(2)
MYCOTAXON
VOLUME ONE HUNDRED THIRTY-FOUR (2) — TABLE OF CONTENTS
134-2: CONTENTS, NOMENCLATURAL UPDATES, ERRATA, PEERS, EDITORIAL
Nomenclatural novelties Ot ypifications ... .. sah. osx poles He ke ees vii
PVT CES Mme Oh 5 ean Sa rags citer AM yah ACO Pea e eet «athe Oe ix
EPR a5 are ah hei eo Ek otek ark ah Lik ati hele + Riri eet EARL toot te EE x
TROVE ESO REOR © co. Red aecgs ving Bes ernest coat echeseaic A la Th dee Hari ean as xi
LAWL SUOHAESSTONSPTOCCIULE a5 Sy satis, alcklack Sethayd hs PUG Deneck efechnd tate AI xiii
TAXONOMY
Volvate Macrolepiota from Brazil: Macrolepiota dunensis sp. nov.,
M. sabulosa var. velistellaris var. nov., and observations on
M. pulchella DALINE SOARES FREITAS & NELSON MENOLLI JR. 223
Inocybe caroticolor from oak forests of Pakistan
A. NASEER, S. GHANI, A. R. Nrazi, A.N. KHALID 241
Sporidesmium horizontale sp. nov. from China
CoNnG-ConcG AI, JI-WEN XIA, XIU-GUO ZHANG, YUN GENG, L1-Guo Ma 253
Sporidesmiella corniformis sp. nov. from China
CoNnG-CongG AI, JI-WEN XIA, XIU-GUO ZHANG, YUN GENG, LI-Guo Ma 257
New records of Amandinea and Buellia from China
ZUN-TIAN ZHAO, XIAO ZHANG, JIE-MENG Fu, LING Hu 261
Introduction of subfamily names for four clades in
Cladoniaceae and Peltigeraceae (Lecanoromycetes)
H. THORSTEN LUMBSCH & STEVEN D. Leavitt 271
Cacumisporium fusiforme sp. nov. from Jiangxi, China
ZHAO-HuAN Xu, Kal ZHANG, XIU-GUO ZHANG,
RAFAEL F. CASTANEDA-RUIZ, JIAN Ma 275
Acarospora squamulosa, the correct name for A. peliocypha
KERRY KNUDSEN, LINDA IN ARCADIA, JANA KocourKovA 281
Megalaria yunnanensis sp. nov. from Yunnan, China
CHUN-XIAO WANG, XIAO ZHANG, CHUAN-FENG ZHENG, LING Hu 289
The conserved type of Lichen fuscatus [= Acarospora fuscata]
KERRY KNUDSEN, JIRi MALICEK, JANA KOCOURKOVA 295
Beltraniopsis cyclobalanopsidis sp. nov. from Guizhou, China
ZHONG-JIU XIAO, XIAO-XIA LI, CHANG-HoNG CHu,
TinG Liu, ZHENG-ZHENG Lu, PEI- YONG SonG 301
APRIL-JUNE 2019... V
Perichaena acetabulifera sp. nov. from Juarez City, Mexico
Marcos LizARRAGA, GABRIEL MORENO, IRAIS FLORES-ROMERO 307
Gliocladiopsis wuhanensis sp. nov. from China
NI-PinG ZHAI, ZI-QUAN SUN, YA-LONG ZHANG, RUI ZANG,
CuaAo Xu, YUE-HuaA GENG, MENG ZHANG 313
Four new records of Haematomma from Southern China
RONG TANG, XIAO ZHANG, CHUN-XIAO WANG, Lu-LU ZHANG 321
Cordana meilingensis and C. lushanensis spp. nov. from Jiangxi, China
CoNnG-ConcG AI, JIAN Ma, KAI ZHANG,
RAFAEL F. CASTANEDA-Ruiz, X1U-GuUO ZHANG 329
Coprophilous fungi from Brazil: new records for the Neotropics
ROGER ER. MELO, DANIEL B.P. Do Monte, NICOLE H.B. GONDIM,
LEONOR C. Mata, ANDREW N. MILLER 335
Two Heterostelium species newly recorded from China
Pu Liu, SHUNHANG ZHANG, XIAOYAN ZHOU, JIANJUN ZHAO, Yu Li 353
Pseudocercospora meliosmicola sp. nov. and three new Pseudocercospora
records from China Qian ZHAO, Bao-Ju Li, YAN-X1A SHI,
XUE-WEN XIE, A-L1 CHAI, YING-LAN Guo 359
Heteroplacidium compactum reported as a genus new to China
XIANG-MIN CHENG, Da-LE Liu, XIN-LI WEI, JIANG-CHUN WEI 369
Geopora ahmadii sp. nov. from Pakistan
M. Sasa D. HAELEWATERS, T. ITURRIAGA,
T. ASHRAB, A.N. KHALID, D.H. PFISTER 377
Seychellomyces sinensis sp. nov. from China
MIN Qiao, Hua ZHENG, ZHE ZHANG, ZE-FEN Yu 391
Ramaria flavescentoides sp. nov. with clamped basidia from Pakistan
MUHAMMAD Hanlr, ABDUL NASIR KHALID, RONALD L. EXETER 399
MycosBioTa (FUNGA) NEW TO THE MYCOTAXON WEBSITE
Aphyllophoroid fungi in Teide National Park
(Tenerife, Canary Islands) [summary]
ESPERANZA BELTRAN-TEJERA, JESUS LAURA RODRIGUEZ-ARMA,
MIGUEL JONATHAN Diaz ARMAS, LUIS QUIJADA 407
BOOK REVIEWS AND NOTICES ELSE VELLINGA 409
vi ... MYCOTAXON 134(2)
PUBLICATION DATE FOR VOLUME ONE HUNDRED THIRTY-FOUR (2)
MYCOTAXON for JANUARY-MARCH 2019 (I-xII + 1-222)
was issued on March 27, 2019
APRIL-JUNE 2019... VII
NOMENCLATURAL NOVELTIES AND TYPIFICATIONS
PROPOSED IN MYCOTAXON 134(2)
Beltraniopsis cyclobalanopsidis Z.J. Xiao & Xiao X. Li
[FN 570598], p. 306
Cacumisporium fusiforme Z.H. Xu, Jian Ma, X.G. Zhang & R.F. Castaneda
[MB 829269], p. 276
Cordana lushanensis C.C. Ai, Jian Ma, X.G. Zhang & R.E Castaneda
[LIF 555814], p. 332
Cordana meilingensis C.C. Ai, Jian Ma, X.G. Zhang & R.F Castafieda
[IF 555813], p. 330
Gliocladiopsis wuhanensis Meng Zhang, N.P. Zhai & Y.H. Geng
[MB 825569], p. 316
Geopora ahmadii Saba, T. Ashraf, Khalid & Pfister
[MB 822666], p. 382
Lichen squamulosus Schrad. 1797 (lectotypified), p. 282
Lobarioideae Lumbsch & S.D. Leav.,
[MB 830563], pe272
Macrolepiota dunensis D.S. Freitas & Menolli
[MB 823088], p. 228
Macrolepiota sabulosa var. velistellaris D.S. Freitas & Menolli
[MB 823089], p.234
Megalaria yunnanensis C.X. Wang & L. Hu
[MB 829259], p. 290
Nephromatoideae Lumbsch & S.D. Leav.,
[MB 830564], p. 272
Perichaena acetabulifera Lizarraga, G. Moreno & Flores-Rom.
[MB 829449], p. 308
Pseudocercospora meliosmicola Y.L. Guo, Qian Zhao & Y.X. Shi
[MB 823728], p. 364
Ramaria flavescentoides Hanif & Khalid
[MB 823965], p. 402
Seychellomyces sinensis Z. F. Yu & Hua Zheng
[MB 829084], p. 395
Sporidesmiella corniformis L.G. Ma, C.C. Ai & X.G. Zhang,
[MB 830544], p. 258
Vul ... MYCOTAXON 134(2)
Sporidesmium horizontale L.G. Ma, C.C. Ai & X.G. Zhang
[[MB 830543], p. 254
Squamarinoideae Lumbsch & S.D. Leav.,
[MB 830561], p. 272
Stereocauloideae Lumbsch & S.D. Leav.,
[MB 830562], p. 272
APRIL-JUNE 2019...
REVIEWERS — VOLUME ONE HUNDRED THIRTY-FOUR (2)
The Editors express their appreciation to the following individuals who
have, prior to acceptance for publication, reviewed one or more of the
papers prepared for this issue.
Laise de Holanda Cavalcanti Andrade
Ditte Bandini
Annarosa Bernicchia
Uwe Braun
Irwin M. Brodo
Rafael FE. Castahteda-Ruiz
Maria Martha Dios
John A. Elix
Ana Esperanza Franco Molano
Masoomeh Ghobad-Nejhad
Shouyu Guo
Rosanne Healy
Brendan Hodkinson
Sana Jabeen
Ze-Feng Jia
Alfredo Justo
Gintaras Kantvilas
John C. Landolt
Steve Leavitt
James C. Lendemer
De-Wei Li
Jian Ma
Li-Guo Ma
Josiane Santana Monteiro
Lorelei L. Norvell
Shaun R. Pennycook
Christian Printzen
Jun-Zhi Qiu
Leif Ryvarden
Matthew E. Smith
Steven L. Stephenson
Andrei Tsurykau
Nadja Santos Vitoria
Ping Zhang
Ying Zhang
Ix
x ... MYCOTAXON 134(2)
ERRATA
Mycotaxon now includes within this section not only errata from past volumes but
also corrections of mistakes in the current issue that were present in approved author
input files but not detected by authors until after PDF conversion. PDFs will be corrected
at deadline for no charge only when they result from editorial error or when authors
agree to pay $40 per correction. This section accommodates all other corrections.
VOLUME 134 (1)
p- 120, line 2-3 DELETE: Mains 1954
VOLUME 134 (2) [CURRENT ISSUE]
p. 225, line 17 FOR: “F The nrITS region was amplified ...”
READ: “The nrITS region was amplified ...”
p. 314, line 8 FOR: wheat-straw.; READ: wheat-straw;
p- 316, line 26 for: COLONIES read: COLONIES
(the first letter in ‘Colonies’ should be in black font)
APRIL-JUNE 2019... XI
FROM THE EDITOR-IN-CHIEF
NEW TO THE EDITORIAL ADvIsORY BOARD—We are pleased to announce the
appointment of two new editorial board members. Former Mycotaxon Book
Review Editor and University of California researcher, Dr. ELSE C. VELLINGA (who
still consents to deliver reviews on a gratifyingly regular basis), is well known to
agaricologists through her numerous contributions to the taxonomy of ‘lepiotaceous
fungi and as contributing editor to the FLORA AGARICINA NEERLANDICA series.
Well-schooled in phylogenetic analysis as well as biodiversity and field-work, Else
is an active member of the North American Mycoflora Project. Mycologist Dr.
Topp OsmMuUNDSsON, Associate Professor of Biology at the University of Wisconsin
Lacrosse, also participates in the North American Mycoflora Project. He offers
expertise in systematics, biogeography, bioinformatics, DNA barcoding, and
molecular phylogenetics and consistently receives high ratings from his students.
The new appointees join Dr. P. BRANDON MATHENY (University of Tennessee,
Knoxville USA) and Dr. KAREN HANSEN (Curator, Swedish Museum of Natural
History (S), Stockholm, Sweden). The newly reconstituted board, which advises
MycoTaxon on editorial matters, will elect an two additional members this year.
ELIMINATION OF ‘MyCOBANK, “‘INDEXFUNGORUM, “FUNGAL NAME’ PRECEDING
IDENTIFIERS—Members of the Nomenclature for Fungi Committee have
discussed the custom of associating numerical fungal identifiers with the name of
the assigning database. Because each number is unique, it is not really necessary
to designate the issuing nomenclatural registry. Even though your editors and
many researchers find such database designations helpful, we agree that it is not
necessary to precede an identifier with both name and initials. MycoTAxon has
decided to compromise, and henceforth we will cite only the abbreviations FN, IF,
and MB, replacing the redundancies FUNGAL NAME FN, INDEXFUNGORUM IF, and
MycoBank MB. This allows us to focus properly on the number—the formal (and
unique) identifier.
NOT NECESSARILY “FIRST COME, FIRST SERVE’—Your volunteer two-person
editorial team has long tried to review manuscripts in the order in which they
are received. Although we view ‘fast-tracking’ manuscripts as inherently unfair,
the Ep1ror-IN-CHIEF has recently begun urging the NOMENCLATURE EDITOR—
our first line of defense against incompetent submissions—to ‘cherry-pick’ well-
prepared work from later submissions to fill out an issue in a timely manner. The
situation became even more urgent last year: after we eliminated required page
charges, our submissions trebled. For that reason, Shaun, MycoTaxon’s primary
defensive lineman, announces our revised review policy:
“We attempt to review manuscripts in the order in which they were accessioned.
However, in order to meet publication deadlines, badly written and poorly
prepared manuscripts that do not follow MycotTaxon’s formatting instructions
xl ... MYCOTAXON 134(2)
(and thus require time-consuming editorial reviews) may be set aside in favour of
well-presented manuscripts that can be reviewed quickly and easily,’
THE ERRATUM AND HOW IT BREEDS — We have all experienced the embarrassment
of not seeing an error until it pops out on the page of a published manuscript. We
all (including this Ep1ror-1N-CHIEF) make mistakes, and it seems only reasonable
to expect them to be corrected when reported prior to publication. From 2004-2009
your Editor spent considerable time at the close of each issue reprocessing PDFs
when authors ‘suddenly’ discovered an error that had been in their own text files
throughout the entire review process. In 2011, after publication had sometimes been
delayed by a week or more while she opened six or more files, corrected mistakes and
entries, re-processed PDF proofs, and corresponded with the authors and the press,
she announced that we would EITHER publish corrections of errors the authors
should have seen in the errata of later volumes for no charge OR correct editorial
conversion error prior to publication, also at no charge. Having encountered a
number of rather major author errors, this year we initiated a third alternative:
authors may pay $40 to have any major author error corrected at press time.
We now offer a fourth alternative: to issue corrections of minor author errors in
the same issue in which the paper is published. This option both saves considerable
editorial time at deadline and provides the correct text promptly at no charge.
MYCOTAXON 134(2) contains 22 papers by 88 authors (representing 10 countries)
as revised by 32 expert reviewers and the editors.
The 2019 April-June MycoTaxon proposes 4 new subfamilies—Lobarioideae,
Nephromatoideae, Squamarinoideae, Stereocauloideae—in the Lecanoromycetes plus
15 other taxa new to science representing Beltraniopsis, Cacumisporium, Cordana,
Gliocladiopsis, Megalaria, Pseudocercospora, Seychellomyces, Sporidesmiella, and
Sporidesmium from CHINA; Geopora and Ramaria from PAKISTAN; Macrolepiota
from BRAZIL; and Perichaena from Mexico. We also publish the lectotypification
of Lichen squamulosus, basionym of Acarospora squamulosa.
New range extensions reported include Amoebozoa: Heterostelium for
CHINA; Ascomycetes: coprophils for BRAzIL and Pseudocercospora for CHINA;
Basidiomycetes: Inocybe for Paxistan; and the lichens Amandinea, Buellia,
Haematomma, and Heteroplacidium for CHINA.
Also included are keys to Beltraniopsis and Cacumisporium species, a list of new
GenBank sequences from the newly conserved holotype Lichen fuscatus (basionym
of Acarospora fuscata), and a summary of the new funga covering aphyllophoroid
fungi of the Canary Islands, uploaded to the MycoTaxon mycobiota website in May.
Warm regards,
Lorelei L. Norvell (Editor-in-Chief)
Shaun R. Pennycook (Nomenclature Editor)
28 June 2019
APRIL-JUNE 2019 ... XIII
2019 MyYCOTAXON SUBMISSION PROCEDURE
Prospective MycoTaxon authors should download the MycotTaxon 2019 guide,
review & submission forms, and MycoTaxon sample manuscript by clicking the ‘file
download page’ link on our INSTRUCTIONS TO AUTHORS page before preparing their
manuscript. This page briefly summarizes our “4-step’ submission process.
1—PEER REVIEW: Authors first contact peer reviewers (two for journal papers;
three for mycobiota/fungae) before sending them formatted text & illustration
files and the appropriate 2019 MycoTaxon journal or weblist reviewer comment
form. Experts return revisions & comments to BoTH the Editor-in-Chief
<[email protected]> and authors. ALL co-authors MUST correct and proof-
read their files before submitting them to the Nomenclature Editor.
2—NOMENCLATURAL REVIEW: Authors email all ERROR-FREE text & illustration
files to the Nomenclature Editor <[email protected]>.
Place first author surname + genus + ‘MycorTaxon’ on the subject line, and
(required) attach a completed sUBMISSION FORM. The Nomenclature Editor will
(i) immediately assign the accession number and (ii) after a few weeks return his
notes and suggested revisions to the author(s) and Editor-in-Chief.
3—FINAL SUBMISSION: All coauthors thoroughly revise and proof-read files
to prepare error-free text and images ready for immediate publication. Poorly
formatted copy will be rejected or returned for revision. They email the final
manuscript to the Editor-in-Chief <[email protected]>, adding the
accession number to the message and all files, which include a (i) revised 2019
submission form, all (ii) text files and (iii) jpg images, and (iv) FN, IE or MB identifier
verifications for each new name or typification. The Editor-in-Chief acknowledges
submissions within two weeks of final submission but requests authors to wait at
least 14 days before sending a follow-up query (without attachments).
4—FINAL EDITORIAL REVIEW & PUBLICATION: The Editor-in-Chief conducts a
final grammatical and scientific review and returns her editorial revisions to all
expert reviewers and coauthors for final author approval. Author-approved files
are placed in the publication queue.
The PDF proof and bibliographic & nomenclatural index entries are sent to all
coauthors for final inspection. After PDF processing, the Editor-in-Chief corrects
ONLY PDF editorial/conversion and index entry errors; corrections of all other
errors are listed in the ERRATA of a subsequent issue for no charge. Authors will pay
fees for mycobiota uploads, optional open access, and correction of major author
errors to the Business Manager <[email protected]> at this time.
MyYcoTAXxON LTD— www.mycotaxon.com
The Mycotaxon Webmaster <[email protected]> posts announcements,
subscription & publication information, and author forms & templates on the official
MycotTaxon site. Our server also hosts the mycobiota webpage for free download of
Fungae (regional annotated species lists).
MYCOTAXON ONLINE— www.ingentaconnect.com/content/mtax/mt
The MycotTaxon journal publishes four quarterly issues per year. Both open access
and subscription articles are offered.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 223-239
https://doi.org/10.5248/134.223
Volvate Macrolepiota from Brazil: M. dunensis sp. nov.,
M. sabulosa var. velistellaris var. nov.,
and observations on M. pulchella
DALINE SOARES FREITAS*” & NELSON MENOLLI JR.”
' Depto de Ciéncias e Matematica (DCM) / Biologia,
Instituto Federal de Educacdo, Ciéncia e Tecnologia de Sao Paulo (IFSP),
Campus Sao Paulo, Rua Pedro Vicente 625, 01109-010 Sao Paulo, SB, Brazil
? Nucleo de Pesquisa em Micologia, Instituto de Botanica,
Av. Miguel Stefano,3687, Agua Funda, CEP: 04301-012, Sao Paulo, SP, Brazil
“ CORRESPONDENCE TO: [email protected]
ABSTRACT—Taxonomic and phylogenetic studies of volvate Macrolepiota specimens
collected from Atlantic Forest in Northeast and Southeast Brazil are presented based
on morphological and molecular (nrITS) data. Macrolepiota dunensis and M. sabulosa
var. velistellaris are proposed as new taxa, and additional observations are presented
about M. pulchella, a species previously known from Brazil. Macrolepiota dunensis and
M. pulchella clustered in the clade corresponding to M. sect. Volvatae. Macrolepiota
sabulosa var. velistellaris was placed together with non-volvate M. sabulosa var. sabulosa,
close to another volvate taxon (M. rhodosperma var. velicopia), and together with species
classified in M. sect. Macrolepiota. Our phylogenetic results provide additional evidence
that the volva, which is not restricted to members of M. sect. Volvatae, evolved more than
once in the genus.
Key worps—Agaricaceae, Lepiotella, Neotropics, South America, Volvolepiota
Introduction
Macrolepiota Singer (Agaricaceae) was proposed by Singer (1948) to
accommodate specimens characterized by giant basidiospores that are
metachromatic in Cresyl blue, a white to cream spore print, and hyphae
with clamp connections. Singer (1959) proposed Volvolepiota Singer for the
224 ... Freitas & Menolli
illegitimate genus Lepiotella Rick (Rick 1938), separated from Macrolepiota
by the presence of a distinct volva. At present morphological and molecular
data (Vellinga 2003; Vellinga & al. 2003) treat Macrolepiota and Volvolepiota
as synonyms, with Macrolepiota restricted to specimens that in addition to
Singer’s diagnostic characters (1948, 1986) possess a trichodermal pileus
covering composed of long and often thick-walled elements, a stipe covered
with hymeni-trichodermal patches often arrayed in colored bands, and
basidiospores with a rounded apex and a germ pore covered by a hyaline cap.
The current concept of Macrolepiota also includes sequestrate species (Lebel &
Syme 2012). Supported by nrITS sequence analyses, Ge & al. (2010) proposed
Macrolepiota sect. Volvatae Z.W. Ge & al. to accommodate volvate species with
small amygdaliform-ellipsoid basidiospores and no clamp connections.
Morphological and molecular studies support the existence of only five
volvate Macrolepiota, distributed mainly in tropical regions: M. brunnescens
Vellinga from Argentina (Vellinga & Yang 2003; Singer 1959 as Volvolepiota
albida); M. eucharis Vellinga & Halling from Australia (Vellinga 2003);
M. pulchella from Brazil (Vellinga & Yang 2003, de Meijer 2006; Rick 1938,
1961, as Lepiotella brunnea; Singer 1954, 1959, Heinemann & de Meijer 1996,
Bononi & al. 1981, as V. brunnea); M. rhodosperma var. velicopia Vizzini &
Contu from Italy (Vizzini & al. 2011); and M. velosa Vellinga & Zhu L. Yang
from China (Vellinga & Yang 2003).
Ge & al. (2010), who included the volvate species Macrolepiota velosa
and M. eucharis in M. sect. Volvatae, suggested that M. brunnescens and
M. pulchella might also belong to this section. The description of a volvate
taxon (M. rhodosperma var. velicopia) not phylogenetically related to
M. sect. Volvatae representatives (Vizzini & al. 2011) provoked a new discussion
about recognizing a natural classification of M. sect. Volvatae based on velar
structures.
The only volvate Macrolepiota recorded from Brazil is M. pulchella, known
from the southern and southeastern states of Rio Grande do Sul (Rick 1938,
1961, as L. brunnea; Singer 1954, 1959, as V. brunnea), Sao Paulo (Bononi &
al. 1981, as V. brunnea), and Parana (de Meijer 2006; Heinemann & de Meijer
1996, as V. brunnea).
Here we report morphological and molecular data for three volvate
Macrolepiota taxa based on specimens collected in the Atlantic Forest of Rio
Grande do Norte (Northeast Brazil) and Sao Paulo (Southeast Brazil). Two—
M. dunensis and M. sabulosa var. velistellaris—are described as new, and we
discuss the taxonomy and phylogenetic position of the third, M. pulchella.
Macrolepiota dunensis sp. nov., M. sabulosa var. velistellaris var. nov. (Brazil) ... 225
Materials & methods
Morphological studies
The macroscopic and ecological descriptions are based upon collector's notes
from fresh materials. Color terms follow Kiippers (1979). For microscopic analyses,
sections of lamellae, pileus covering, and stipe were moistened in 70% ethanol and
rehydrated in 5% KOH. Reagents used were Congo red to stain hyaline structures,
Cresyl blue to test metachromasy, and Melzer’s reagent to test basidiospore amyloidy.
Microscopic illustrations were made with the aid of a drawing tube attached
to an Olympus BX50 compound microscope. For basidiospore measurements,
cc 9D
[a/b/c] indicates “a” basidiospores measured from “b” basidioma(ta) taken from
“c’ collection(s); Q = length/width quotients from all measured basidiospores,
Qm = average of all computed Q values; Lm (Wm) = average of lengths (widths)
of all measured basidiospores. At least 20 basidiospores from each basidioma were
measured in profile view. Basidiospore shape terminology follows Bas (1969), and
descriptive terms for other morphological features follow Vellinga (1988) and
Vellinga & Noordeloos (2001). The terminology of vegetation types is according to
Veloso & al. (1991), and the herbarium acronyms follow Thiers (2018).
Molecular methods and phylogenetic analyses
DNA extraction, PCR, and sequencing methods followed Justo & al. (2011a,b).
F The nrITS region was amplified and sequenced using the primer pair ITS-1 and
ITS4 (White & al. 1990; Gardes & Bruns 1993). The newly generated sequences were
phylogenetically analysed with other DNA sequences of the main representatives of
Macrolepiota available in GenBank and Leucoagaricus leucothites (Vittad.) Wasser and
L. nympharum (Kalchbr.) Bon as outgroup. GenBank accession numbers and other
collection information for the sequences used in molecular analyses are given in Fic. 1.
Our alignment matrix, generated by MAFFT 7 (http://mafft.cbrc.jp/alignment/server/;
Katoh & Toh 2008) with auto strategy, was visually examined and manually corrected
using Geneious 7.0.6 (Kearse & al. 2012).
To identify the best nucleotide evolution model, we used the AlICc criterion -
Akaike Information Criterion corrected (Hurvich & Tsai 1991) in PartitionFinder
2.1.1 (Lanfear & al. 2017). After separating the ITS region into ITS1+ITS2 and
5.88, we estimated the evolution model for each partition. Maximum Likelihood
(ML) analysis was performed in RAxML v8.2.X (Stamatakis 2014) using the
GTR+G model with a rapid bootstrap analysis with 1000 replicates and search for
the best-scoring ML tree. The Bayesian inference (BI) analysis was performed with
MrBayes v3.2.6 (Ronquist & al. 2012) in the CIPRES Science Gateway 3.1 (Miller &
al. 2010) using two partitions with the TVM+G model for ITS1+ITS2 and the JC
model for 5.88, with two independent runs, four simultaneous independent chains,
and 10,000,000 generations with a sample frequency every 5000 generation. The
following abbreviations are used for statistical data: Bootstrap (BS) and Posterior
Probability (PP).
226 ... Freitas & Menolli
Results & discussion
We would prefer to sample additional collections with a broader
morphological variation to support our new taxa and to provide more
information about the ontogeny and distribution. Nonetheless, because only
five volvate Macrolepiota are currently known and because morphological
and molecular characters support our material as different taxa, we propose
new taxa here to advance Macrolepiota research: M. dunensis as a new
species and M. sabulosa var. velistellaris as a new variety that distinguished
from M. sabulosa var. sabulosa mainly by the presence of a distinct volva on
the stipe base.
Phylogeny
Both ML and BI analyses established the phylogenetic positions of the
three Brazilian volvate Macrolepiota taxa. The ML tree (Fic. 1) organized
the Macrolepiota species in three main clades corresponding to the sections
indicated by Ge & al. (2010)—M. sect. Macrolepiota, M. sect. Macrosporae
(Singer) Bon, and M. sect. Volvatae.
The clade corresponding to Macrolepiota sect. Volvatae includes
sequences from M. dunensis, M. eucharis, M. pulchella, M. velosa, and
other unidentified collections from Brazil and related to M. pulchella. All
identified specimens in this clade possess a distinct volva on the stipe base.
Macrolepiota pulchella clustered with other three sequences of unidentified
specimens from Brazil in a well-supported (100% BS, 1 PP) clade (Fazolino
Perez & al. 2018), with M. dunensis and M. eucharis on an external branch.
Although we still need to review the morphology of the unidentified
collections reported by Fazolino Perez & al (2018) as Macrolepiota sp. 3, our
molecular results indicate that they are most likely M. pulchella. The level of
sequence divergence among M. pulchella and Macrolepiota sp. 3 is up to 1%
and is represented by three different base pairs, with an additional different
base pair in Macrolepiota sp. 3 KY927723 and four ambiguous base pairs in
M. pulchella MC4411.
The other new volvate Macrolepiota (M. sabulosa var. velistellaris) clusters
in the M. sect. Macrolepiota clade with sequences of the non-volvate typical
variety of M. sabulosa Fazolino & R.M. Silveira from Brazil (Fazolino Perez
& al. 2018), and sequences of M. cyanolamellata Fazolino & al. from Brazil
(Fazolino Perez & al. 2018) and M. clelandii Grgur. from Australia and New
Zealand (Vellinga 2003, Vellinga & al. 2003). Although the sequence from
M. sabulosa var. velistellaris is 100% identical to that from the holotype
of M. sabulosa (and its autonymous variety M. sabulosa var. sabulosa)—
Macrolepiota dunensis sp. nov., M. sabulosa var. velistellaris var. nov. (Brazil) ... 227
HM246501 M. procera f fuliginosa*™
0.99/-] HM246503 M. procera f. permixta***
0.97/- HM246502 M. procera f. fuliginosa***
HM125511 M. procera
0.98/93) Aya edad M. procera
90 M. procera
Pevborsie M. procera
0.97/85 AY243588 M. procera
AY243591 M. aff. procera
1/96] HM125514 M. procera
HM125513 M. procera
1/100
0.98/-
HM246505 M. rhodosperma var. velicopia***
HM246507 M. rhodosperma***
HM246506 M. rhodosperma var. velicopia***
AY243598 M. rhodosperma**™*
1/98 | AY243597 M. thodosperma™**
0.98/- AF482841 M. rhodosperma**™*
0.98/75 AY243596 M. rhodosperma***
: U85311 M. colombiana
102 AY083196 M. clelandii
AY083198 M. clelandii
1/100] AY083195 M. clelandii
AY083202 M. clelandii
AF482838 M. clelandii
U85314 M. mastoidea***
U85313 M. mastoidea**™*
0.94/- | ay243599 M. mastoidea***
AF482844 M. mastoidea
HM125529 M. mastoidea
HM125531 M. mastoidea
HM125532 M. mastoidea
AY243603 M. konradii
AY243602 M. konradii
AY243601 M. konradii
0: 9304 AY243003 M. subsquarrosa
we, HM125524 M. orientiexcoriata
"4 HM125528 M. orientiexcoriata
y 1/100 Mic? AF482850 M. orientiexcoriata***
Pos AF482847 M. phaeodisca
182° agg | 8¥243607 M. excoriata
AF482840 M. excoriata
HM246504 M. excoriata
acrosporae
1/99
lacrolepiota sect.
1/100
0.98/90
0.92/71
AF482854 M. eucharis
1/100 0.97/100 NRE 1989 M. velosa
{82853 M. velosa
0.98/90, | Pears M. velosa
IN944095 M. velosa
HM125509 M. velosa
KJ524569 M. velosa
1/100 AF482865 Leucoagaricus nympharum
@ AF482868 Leucoagaricus leucothites
0.06
1/100] | M125518 M. dolichaula
HM125510 M. detersa
1100 - AY243586 M. detersa**
AF482851 M. detersa**
AF243587 M. detersa**
KY927721 Macrolepiota sp.
0.96/93] KY927722 Macrolepiota sp.
KY927723 Macrolepiota sp.
MC4411 M. pulchella
JJSO386 M. pulchella
NMJ161 M. dunensis
HM125521 M. dolichaula
HM125523 M. dolichaula
AF482839 M. dolichaula
AY083193 M. dolichaula
KY927715 M. sabulosa
1100] NMJ185 M. sabulosa var. velistellaris
1/100 KY927716 M. sabulosa
127714 M. cyanolamellata
1100 yoo M. cyanolameliata
Fig. 1. Bayesian Inference tree of Macrolepiota based on nrITS data and rooted with
Leucoagaricus leucothites and L. nympharum. The sequences generated in this work are in bold.
Support values (PP >0.90 and BS >70%) are shown above the node branches. *** indicates taxon
names modified according to Vizzini & al. (2011).
KY927715, we prefer to propose a new variety based on the morphological
differences discussed below.
Vizzini & al. (2011) described another volvate Macrolepiota taxon,
M. rhodosperma var. velicopia, which differs from the autonymous variety,
M. rhodosperma var. rhodosperma, primarily by the presence of a volva on
the stipe base. Macrolepiota rhodosperma var. velicopia, which clusters in
the M. sect. Macrolepiota clade, is not phylogenetically related to M. sect.
Volvatae. Vizzini & al. (2011) noted that the presence of a volva on the
stipe base is a character that developed independently over the evolution of
228 ... Freitas & Menolli
Macrolepiota species, suggesting that recognition of M. sect. Volvatae based
solely on the presence of volva is an artificial classification. Additionally, Ge
& al. (2010) highlighted the relatively small (usually <15 um) amygdaliform-
ellipsoid basidiospores and absence of clamp connections as additionally
diagnostic of M. sect. Volvatae. The position of M. sabulosa var. velistellaris
outside M. sect. Volvatae supports the view of Vizzini & al. (2011) regarding
the homoplasy of the volva within Macrolepiota.
Our sequence analyses also separate Macrolepiota dunensis and M. sabulosa
var. velistellaris from all known and sequenced volvate Macrolepiota taxa and
present for the first time molecular data for M. pulchella, the only volvate
Macrolepiota species previously recorded from Brazil. It is important to note
that our phylogeny was generated only from nrITS data and that the internal
position and the actual relationships of the sampled taxa may differ when
more markers are used.
Taxonomy
Macrolepiota dunensis D.S. Freitas & Menolli, sp. nov. FIGS 2A,D, 3
MB823088
Differs from Macrolepiota pulchella by its shorter stipe, its lack of triangular patches
or squamules on the pileus disc, its smooth and non-encrusted cheilocystidia, and its
shorter terminal elements in the pileus covering.
Type—Brazil. Rio Grande do Norte: Natal, Parque Estadual Dunas de Natal, Geology
trail, 12 July 2010, Menolli Jr. & al. NMJ161 (Holotype, SP466944; GenBank
MG136892).
ETYMOLOGY—dunensis is the Latinized form of dune, for the sand dune area in an
Atlantic Forest fragment where the holotype was collected.
Piteus 50 mm diam., plano-concave, with an obtuse umbo, dark brown
(N,,A,.M.,) at center, fully covered with appressed fibrils up to two-thirds of
the radius, slightly lighter (N,,A..M.,) elsewhere and with the innate fibrils
dissociating radially on cream background. LAMELLAE free, ventricose, crowded,
cream colored, with lamellulae. Stipe 55 x 3(apex)/7(base) mm, central, brown
(N.,A,.M.,) and slightly lighter at the apex, covered by inconspicuous zigzag
bands mainly on central part, tapering upwards and enlarged at base, fibrous
and slightly striate longitudinally. ANNULUs lost but with clear mark on the
central stipe. Votva limbate, membranous with a cottony base, dirty white to
light brown at the margin (N,,A,,M,,). CONTEXT, ODOR, TASTE, AND SPORE
PRINT COLOR not recorded.
Macrolepiota dunensis sp. nov., M. sabulosa var. velistellaris var. nov. (Brazil) ... 229
Fic. 2. A, D. Macrolepiota dunensis (holotype, SP466944). B, E. Macrolepiota pulchella
(B = SP466949; E = SP381606). C, E Macrolepiota sabulosa var. velistellaris (holotype,
SP466945). Scale bars = 1 cm. Photos: A, D = N. Menolli Jr.; B = J.J.S. Oliveira; C, F = I.G. Baseia;
E = M. Capelari.
BASIDIOSPORES [25/1/1] 9.0-12.0 x 6.0-8.0 um (Q = 1.4-1.8; Qm = 1.6;
Lm = 10.7 um; Wm = 6.8 um), ellipsoid to elongate, smooth, thick-walled,
hyaline, with an apical central truncate germ pore covered bya hyaline cap, some
with an inconspicuous apiculus, dextrinoid in Melzer’s and metachromatic
in Cresyl blue. Basrp1a 26-31 x 11.2-13.0 um, clavate, hyaline, thin-walled
to slightly thickened at the apex, 2-, 3-, and 4-spored in equal abundance.
CHEILOCYSTIDIA 32-47 x 7.5-11.2 um, cylindrical to narrowly clavate,
hyaline, thin-walled to slightly thickened towards the apex. HYMENOPHORAL
TRAMA irregular composed of thin-walled hyphae, 10.0-16.2 um diam.,
hyaline. PILEUS TRAMA hyphae thin-walled, 8.7-16.2 um diam., with light
brown content. PILEUS COVERING an intricate trichoderm, composed of
cylindrical elements with light brown content, thin-walled, terminal elements
77-171 x 5.0-7.5 um. STIPITIPELLIS hyphae thin-walled, 6.2-12.5 um diam.,
filled with light brown content. Votva hyphae undifferentiated, septate, loosely
interwoven, 2.5-10.0 um diam., thin-walled, colorless to slightly yellowish.
No CLAMP CONNECTIONS seen in all parts examined.
230 ... Freitas & Menolli
0
IO ae
Wi ed
SALT AG
‘. a WANK
‘on;
WN \
tN N\
Fic. 3. Macrolepiota dunensis (holotype, $P466944). A. Basidiospores; B. Basidia; C. Cheilocystidia;
D. Pileipellis elements. Scale bars = 10 um. Line drawings: D.S. Freitas.
EcoLtocy & DisTRIBUTION—Solitary on sandy soil. In a fragment of
shrubby-arboreal stratum on dunes, part of the Atlantic Forest domain in a
‘restinga (tropical coastal vegetation) area.
ComMMENTS—Macrolepiota dunensis is characterized by a dark brown pileus
fully covered with appressed fibrils up to two-thirds from the center and with
no velar remnants on the surface, a short stipe, cheilocystidia with slightly
thickened walls towards the apex, and short individual terminal elements in the
pileus covering. These and other additional morphological characters allied to
the phylogenetic position of the sampled taxa (Fic. 1), distinguish M. dunensis
from the other volvate Macrolepiota as discussed below.
Macrolepiota pulchella differs in its pileus with triangular brown-gray
squamules at center, longer (<130 mm) stipe, apical annulus, white membranous
volva, slightly shorter (18-40 um) cheilocystidia with verrucose apices, and
pileus covering composed of some pyriform and wider (23-40 um diam.)
hyphae or sometimes walls encrusted with brown pigments (Heinemann & de
Meijer 1996).
Macrolepiota eucharis differs in its pileus with black squamules on a brown-
gray background, longer stipe (<140 mm), slightly larger (10.8-15.5 x 7.1-9.1
um) basidiospores, and pileus surface with shorter and wider (20-80 x 6.0-14
um) terminal elements (Vellinga 2003).
Macrolepiota dunensis sp. nov., M. sabulosa var. velistellaris var. nov. (Brazil) ... 231
Macrolepiota brunnescens differs in its broader (<120 mm) pileus partly
covered by white woolly-membranous veil remnants, longer (115 mm) white
stipe, longer (35-44 um) basidia that have (sometimes) a brown resinous
encrustation or (rarely) brown contents, and an apparent absence of cystidia
(Singer 1959).
Macrolepiota velosa differs in its pileus surface with some purplish squamules
and white to dirty white universal veil patches, much longer (100-170 mm)
purplish brown tinged stipe, longer and narrower (44-68 x 4.5-7.5 um)
cheilocystidia with refractive apices and grayish-granular contents, and pileus
covering with wider (25 um diam.) terminal elements (Vellinga & Yang 2003).
Macrolepiota rhodosperma var. velicopia differs in its larger (<150 mm
diam.) pileus with white to dirty white membranous velar patches on the
surface; much longer (<180 mm) stipe; larger ((13—)13.5-15(-16.5) x 9-10.5(-
11.2) um) basidiospores; variously shaped cheilocystidia (narrowly clavate to
sub-fusiform, lageniform, utriform, or cylindrical) that are sometimes apically
capitulate, basally septate, or (rarely) with apical excrescences; and in the pileus
covering much longer (<250 um) individual terminal elements with several
secondary septa (pseudosepta) and some very thick-walled (1.5-2 um) hyphae
(Vizzini & al. 2011).
Finally, our other newly described taxon, M. sabulosa var. velistellaris, is
distinguished by its slightly rimose pileus surface cracking into very small
squamules towards the margin, slightly longer (95 mm) and distinctly
squamulose stipe, uniformly thin-walled cheilocystidia, and stipe covering with
distinct and ascendant terminal elements (see complete taxonomic description
below).
Macrolepiota pulchella de Meijer & Vellinga, Mycotaxon 85:184, 2003. FIGs 2B,E, 4
= Lepiotella brunnea Rick, Lilloa 2: 251. 1938.
= Volvolepiota brunnea (Rick) Singer, Bol. Soc. Arg. Bot. 8: 12. 1959.
“Chlorophyllum pulchellum” Gimenes & Capelari, [unpublished master’s thesis]. 2007.
Piteus 32-68 mm diam., conic to convex, light brown (A,,M_C,;
N,oAy™M,,.) to slightly greyish brown (N,,Y,,M,,), dark brown (A,.M,,C
60° 40 80° 50 90 “80?
N,,Y<)@,.) on the entire and prominent umbo, margin entire or sometimes
with inconspicuous velar remnants, surface completely scaly on fibrillose
background and covered with dark brown (A,,M.,C_,; N,,Y,,.M,,) scales (larger
at center, smaller toward the edge). Context white, 3.5 mm thick. LAMELLAE
free, remote, crowded, white to light cream (N,,Y,,M,,), with lamellulae. Stipe
232 ... Freitas & Menolli
Fic. 4. Macrolepiota pulchella (SP466949). A. Basidiospores; B. Basidia; C. Cheilocystidia;
D. Pileipellis elements. Scale bars = 10 um. Line drawings: D.S. Freitas.
75-135 x 3-3.5(apex)/5-10(base) mm, central, dark brown at base and slightly
lighter towards the apex, covered by inconspicuous zigzag bands mainly on
central part, almost cylindrical or slightly tapering upwards with a subbulbous
base, fibrous. ANNULUS apical, membranous, whitish upperside with brown
edge, margin slightly splitting. VoLvA saccate, membranous with a cottony
base, entire white. ODOR AND TASTE not recorded. SPORE PRINT white.
BASIDIOSPORES [187/9/9] (8.7—)9.0-13.7(-15.0) x (6.2-)7.5-10.0(-11.2)
um (Q = 1.1-2.0; Qm = 1.5; Lm = 12.2 um; Wm = 8.4 um), subglobose,
broadly ellipsoid, ellipsoid, elongate, smooth, thick-walled, hyaline, with a
slightly truncate germ pore covered by a hyaline cap, some with inconspicuous
apiculus, dextrinoid in Melzer’s and metachromatic in Cresyl blue. Basip1a
22-40 x 7.5-15.0 um clavate, hyaline, thin-walled or slightly thickened at apex,
2-3-4-spored. CHEILOCYSTIDIA 27-55 x 6.2-10.0 um, cylindrical to slightly
clavate, hyaline, thin-walled, some apically encrusted. HYMENOPHORAL TRAMA
irregular, hyphae thin-walled, 3.7-16.2 um diam., hyaline. PILEUs TRAMA
hyphae thin-walled, 3.7-18.7 um diam., hyaline to slightly light brown. PILEus
COVERING an intricate trichoderm, composed of thin-walled apically rounded
cylindrical elements with light brown contents, terminal elements 72-157 x
5.0-7.5 um; toward the center intermixed with clavate or pyriform elements.
STIPITIPELLIS hyphae thin-walled, 3.7-18.7 um diam., with brown contents.
Votva hyphae undifferentiated, 2.5-8.7 um diam., thin-walled, septate, loosely
interwoven, colorless. CLAMP CONNECTIONS not seen in all parts examined.
EcoLocy & DisTRIBUTION—Solitary on soil. In a ‘seasonal semi-deciduous
forest’ fragment, part of the Atlantic Forest domain.
SPECIMENS EXAMINED—BRAZIL. SAO PAULO STATE: Sao Paulo: Itapecerica da
Serra, 10 July 1997, A.M. Gugliotta AMG945 (SP466950); 24 July 1997, M. Capelari
Macrolepiota dunensis sp. nov., M. sabulosa var. velistellaris var. nov. (Brazil) ... 233
& A.M. Gugliotta MC3955 (SP466951); Parque Estadual das Fontes do Ipiranga,
9 October 2001, U.C. Peixoto PEFI13/2001 (SP381604); 21 September 2005,
C. Puccinelli & U.C. Peixoto CP 161 (SP466948); 3 October 2006, C. Puccinelli
CP193 (SP381606); 13 August 2006, L.J. Gimenes LJG130/06 (SP381605); 13
November 2007, Menolli Jr. & FE. Karstedt NMJ155 (SP466946); 19 October 2011,
J.J.S. Oliveira & P.O. Ventura JJSO386 (SP466949; GenBank MG136891); Parque
Estadual da Cantareira, 23 October 2008, M. Capelari & L.A.S. Ramos MC4411
(SP466947; GenBank MG136894).
CoMMENTS— The morphological features observed in new and old collections
confirm the occurrence of M. pulchella from Sao Paulo state, Southeast Brazil,
as first noted by Bononi & al. (1981, as V. brunnea). However, the collection
recorded by Bononi & al. (1981) does not represent M. pulchella; Macrolepiota
sp. (SP61013) has much larger basidiospores (13.5-16.5 x 9.0-12.0 um;
Q= 1.3-1.6 um; Qm = 1.4 um; Lm = 14.9 um; Wm = 10.6 um), a longer
(approx. 315 mm) stipe, and no evidence of a volva (or any velar remnants)
on the stipe base.
In addition to the Sao Paulo state record, Gimenes (2007) recorded
M. pulchella (as “Chlorophyllum pulchellum”) from the same area—Parque
Estadual das Fontes do Ipiranga—where we found most of our collections.
Gimenes (2007) justified the transfer to Chlorophyllum based on an unresolved
LSU sequence analysis and the morphology of the pileus covering (described
as hymenidermal) and basidiospores (described as lacking the characteristic
hyaline cap on the germ pore). However, our revision of the collections
studied by Gimenes (2007) plus our examination of new collections and
the molecular support confirms the identity of all materials as Macrolepiota
pulchella.
The most complete morphological study of M. pulchella was published
by Heinemann & de Meijer (1996) based on a unique basidioma (de
Meijer 2935) from Parana state in South Brazil. They also cited three other
collections, drawing attention to minor morphological variations such as
the pileus color, context, and squamules; stipe base shape; stability of the
annulus; and a volva that can be inconspicuous.
Compared to our M. pulchella collections, Heinemann & de Meijer
(1996) reported smaller basidiospores ((8.6-)9.41-10.3 x 5.8-6.19(-6.8)
um) and shorter basidia (24-26 um) and cheilocystidia (18-40 um), with
the cheilocystidia (4-8(-10) um diam.) sometimes narrowly lanceolate or
slightly verrucose at apex. They also described the pileus covering as:
“. in the center, palisadic, formed of erect hyphae, 5-10 um diam., with some
much larger, e.g. 23-40 um broad, pyriform elements which are seen at various
234 ... Freitas & Menolli
distance from surface; this structure is covered with a layer, 10-35 um thick,
made up of cylindrical, + radially oriented hyphae, 3-7 um diam., originating
probably from the underlying structure and constituting a general veil; in the
periphery, squamules made of cylindrical parallel hyphae, 6-11 um diam., wall
with brown incrusted pigment.’
We wish to highlight that among our specimens we observed the characteristic
trichodermal pileus covering with long, non-encrusted terminal elements
(72-157 x 5.0-7.5 um). We also noted i) only 2—spored basidia in NMJ155,
(23.7-27.5 x 10.0-12.5 um) similar in size to those described by Heinemann
& de Meijer (1996), and basidiospores ((9.5—)10.0-—11.5(-12.0) x 7.5-9.0 um)
slightly smaller than the other collections; ii) in JJSO386, the presence of
clavate to pyriform elements in the pileus disc covering; and iii) in JJSO386,
apically encrusted cheilocystidia possibly corresponding to what Heinemann
& de Meijer (1996) described as “slightly verrucose,’ which, however, does
not seem to be a constant character for the species.
Considering that Heinemann & de Meijer (1996) based their description
on a single collection, we feel we have accurately described additional
morphological characters for M. pulchella while providing the first molecular
data to contribute to a phylogeny of volvate Macrolepiota from Brazil.
Additional morphological examinations are needed to confirm the identity
of the specimens named by Fazolino Perez & al. (2018) as Macrolepiota sp. 3,
but our molecular analyses suggest they represent M. pulchella, which would
be a first record of M. pulchella from Rio Grande do Norte state in Northeast
Brazil.
Macrolepiota sabulosa var. velistellaris D.S. Freitas & Menolli, var. nov.
MB 823089 FIGS 2C,F, 5
Differs from the non-volvate autonymous variety Macrolepiota sabulosa var. sabulosa
by the presence of a distinct volva on the stipe base.
Type—Brazil. Rio Grande do Norte: Baia Formosa, Mata Estrela, Reserva Particular
de Patrimonio Natural Mata Estrela, 14 July 2010, Menolli Jr. & al. NMJ185 (Holotype,
SP466945; GenBank MG136893).
EryMoLocy—veli (L. for veil), referring to the presence of a volva and velar
remnants on the stipe base; stellaris (L. for star-shaped), referring to both the star-like
arrangement of the pileus squamules and Mata Estrela (Star Forest), the private area
where the holotype was collected.
PILEUS 62 mm, plano-convex, with an inconspicuous umbo, dark brown
(N,,A,.M,,) at center, covering slightly rimose and cracking into very small
squamules on one-third distant from the umbo before dissociating radially
Macrolepiota dunensis sp. nov., M. sabulosa var. velistellaris var. nov. (Brazil) ... 235
Fic. 5. Macrolepiota sabulosa var. velistellaris (holotype, SP466945). a. Basidiospores; b. Basidia;
c. Cheilocystidia; d. Pileipellis elements. Scale bars = 10 um. Line drawings: D.S. Freitas.
towards the margin into fibrils on cream background. LAMELLAE free,
crowded, white, with lamellulae. StipE 95 x 6(apex)/7(base) mm, central,
almost cylindrical, covered throughout with small scales forming distinct
zigzag bands that concolourous with the pileus disc, lighter at the apex.
ANNULUS apical, membranous, movable, whitish upperside with brown edge.
Votva limbate, membranous with a cottony base, dirty white. CONTEXT,
ODOR, TASTE AND SPORE PRINT COLOR not recorded.
BASIDIOSPORES [25/1/1] 9.5-12.0 x 6.0-8.0 um (Q = 1.3-1.8; Qm = 1.5;
Lm = 10.7 um; Wm = 6.9 um), ellipsoid to elongated, rarely broadly ellipsoid,
smooth, thick-walled, hyaline, with distinctive apiculus and an apical
central truncate germ pore covered by a hyaline cap, dextrinoid in Melzer’s
and metachromatic in Cresyl blue. Basrp1a 29-36 x 11.0-14.0 um, clavate,
hyaline, thin-walled, 2-3-4-spored. CHEILOCYSTIDIA 25-45 x 7.5-10.0 um,
cylindrical to narrowly clavate, hyaline, thin-walled, sometimes in clusters.
HYMENOPHORAL TRAMA irregular, hyphae thin-walled, 5.0-12.5 um diam.,
hyaline. PILEUS TRAMA hyphae thin-walled, 6.2-11.2 um diam., hyaline to
brownish. PILEUS COVERING an intricate trichoderm, composed of thin-
walled cylindrical elements with light brown content, terminal elements
measuring 118-193 x 5.0-8.7 um. SriprTrpELLis hyphae thin-walled,
5.0-11.2 umdiam., filled with light brown content; terminal elements elongated,
conspicuous, ascendant, 6.2-11.2 um diam. Votva hyphae undifferentiated,
septate, moderately branched, loosely interwoven, thin-walled, 3.7-10.0 um
diam., colorless to slightly yellowish. CLAMP CONNECTIONS not seen in all
parts examined.
236 ... Freitas & Menolli
EcoLocy & DIsTRIBUTION—Solitary on soil. In a ‘dense ombrophilous
forest’ fragment within the Atlantic Forest domain.
CoMMENTS—Macrolepiota sabulosa var. velistellaris is proposed as new based
on the presence of a distinct volva on the stipe base. Fazolino Perez & al.
(2018) described M. sabulosa based on two collections from the same state
in Northeast Brazil where we collected the new variety. They distinguished
M. sabulosa from M. pulchella due to the presence of a volva on M. pulchella,
a character neither shown in their illustrations nor mentioned in the
protologue of M. sabulosa. Additionally, M. sabulosa var. sabulosa has more
robust basidiomata (pileus 130-140 mm, stipe 165-175 x 11-12 mm), shorter
terminal elements in the pileus covering (28-63.5 x 5.5-8.5 um), and clamp
connections on hyphal septa in the stipe context and at the bases of basidia,
basidioles, and cheilocystidia (Fazolino Perez & al. 2018).
Macrolepiota sabulosa var. velistellaris morphologically differs from
M. dunensis as previously discussed in the notes under M. dunensis, as
well as from M. pulchella, M. eucharis, M. brunnescens, M. velosa, and
M. rhodosperma vax. velicopia.
Macrolepiota pulchella has differently arranged pileus squamules,
cheilocystidia with a slightly verrucose apex, and a stipe surface composed
of brown hyphae (3-9 um diam.) in a pseudoparenchyma under a palisade
structure (no mention of distinct or ascendant terminal elements; Heinemann
& de Meijer 1996).
Macrolepiota eucharis is distinguished by its brown-gray pileus
background, longer stipe (<140 mm), slightly larger (10.8-15.5 x 7.1-9.1 um)
basidiospores, mostly 4-spored basidia, slightly fusiform and slightly thick-
walled cheilocystidia, and wider (<14 um diam.) terminal pileipellis elements
(Vellinga 2003).
Macrolepiota brunnescens has a broader (<120 mm) pileus covered by a
woolly whitish membrane, undecorated and initially white stipe, encrusted
and pigmented basidia, and (apparently) no cystidia (Singer 1959).
Macrolepiota velosa differs in its purplish tinged pileus squamules, much
longer (100-170 mm) stipe, longer and narrower (44-68 x 4.5-7.5 um)
cheilocystidia with a distinct apex, and shorter (<100 um) pileipellis terminal
elements (Vellinga & Yang 2003).
Macrolepiota rhodosperma var. velicopia has a much broader (<150 mm
diam.) pileus covered with white universal veil remnants, muchlonger(<180mm)
stipe with a fringed annulus, larger ((13—)13.5-15(-16.5) x 9-10.5(-11.2) um)
Macrolepiota dunensis sp. nov., M. sabulosa var. velistellaris var. nov. (Brazil) ... 237
basidiospores, differently shaped cheilocystidia (varying among narrowly
clavate to sub-fusiform, lageniform, utriform or cylindrical), longer (<250
um) pileipellis elements that are normally thick-walled (1.5-2 tm thick) and
provided with internal pseudosepta (Vizzini & al. 2011).
Acknowledgments
The authors thank Dr. Alfredo Justo (New Brunswick Museum, Saint John
NB, Canada) and Dr. Ana Esperanza Franco-Molano (Universidad de Antioquia,
Medellin, Colombia) for critical review of the manuscript; Dr. Shaun R. Pennycook
for nomenclature review; Dr. Iuri Goulart Baseia for all the assistance during
the expeditions to the state of Rio Grande do Norte; Dr. Tarciso S. Filgueiras (1N
MEMORIAM) for help with the Latin names for the new taxa; and Alicia G. Knudson
for the English review. They also acknowledge financial support from FAPESP
(Fundagao de Amparo a Pesquisa do Estado de Sao Paulo-grant 04/04319-2), CAPES
(Coordenagao de Aperfeigoamento de Pessoal de Nivel Superior-PNADB grant
23038.000043/2010-43), CNPq (Conselho Nacional de Desenvolvimento Cientifico
e Tecnoldgico — PIBIC fellowship for D.S. Freitas).
Literature cited
Bas C. 1969. Morphology and subdivision of Amanita and a monograph of its section Lepidella.
Persoonia 5: 285-579.
Bononi VLR, Trufem SFB, Grandi RAP. 1981. Fungos macroscépicos do Parque Estadual das
Fontes do Ipiranga, Sao Paulo, Brasil, depositados no Herbario do Instituto de Botanica de Sao
Paulo. Rickia 9: 37-53.
de Meijer AAR. 2006. Preliminary list of macromycetes from the Brazilian State of Parana. Boletim
do Museu Botanico Municipal 68: 1-55.
Fazolino Perez E, Suaza Blandon SC, Alves-Silva G, Lechner BE, Silveira RMB. 2018. Taxonomy
and phylogeny of Macrolepiota: two new species from Brazil. Mycologia 110: 930-940.
https://doi.org/10.1080/00275514.2018.1500848
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes—
application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
https://doi.org/10.1111/j.1365-294X.1993.tb00005.x
Ge ZW, Yang ZL, Vellinga EC. 2010. The genus Macrolepiota (Agaricaceae, Basidiomycota) in
China. Fungal Diversity 45: 81-98. https://doi.org/10.1007/s13225-010-0062-0
Gimenes LJ. 2007. A tribo Leucocoprineae (Agaricaceae) no Parque Estadual das Fontes do
Ipiranga, Sao Paulo, SP, Brasil. [Unpublished Master’s Dissertation], Instituto de Botanica de
Sao Paulo. 84 p.
Heinemann P, de Meijer AAR. 1996. The status of Volvolepiota Sing. Bulletin du Jardin Botanique
National de Belgique 65: 405-412. https://doi.org/10.2307/3668462
Hurvich CM, Tsai C-L. 1991. Bias of the corrected AIC criterion for underfitted regression and
time series models. Biometrika 78: 499-509. https://doi.org/10.1093/biomet/78.3.499
Justo A, Vizzini A, Minnis AM, Menolli Jr N, Capelari M, Rodriguez O, Malysheva E, Contu M,
Ghignone S, Hibbett DS. 2011la. Phylogeny of the Pluteaceae (Agaricales, Basidiomycota):
taxonomy and character evolution. Fungal Biology 115: 1-20.
https://doi.org/10.1016/j.funbio.2010.09.012
238 ... Freitas & Menolli
Justo A, Minnis AM, Ghignone S, Menolli Jr N, Capelari M, Rodriguez O, Malysheva E,
Contu M, Vizzini A. 2011b. Species recognition in Pluteus and Volvopluteus (Pluteaceae,
Agaricales): morphology, geography and phylogeny. Mycological Progress 10: 453-479.
https://doi.org/10.1007/s11557-010-0716-z
Katoh K, Toh H. 2008. Recent developments in the MAFFT multiple sequence alignment program.
Briefings in Bioinformatics 9: 286-298. https://doi.org/10.1093/bib/bbn013
Kearse M, Moir R, Wilson A, Stones-Havas S$, Cheung M, Sturrock S, Buxton S, Cooper A,
Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. 2012. Geneious basic:
an integrated and extendable desktop software platform for the organization and analysis of
sequence data. Bioinformatics 28: 1647-1649. https://doi.org/10.1093/bioinformatics/bts199
Kiippers H. 1979. Atlas de los colores: mas de 5500 matices con su caracterizacion y las instrucciones
para su mezcla. Editorial Blume, Barcelona.
Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B. 2017. PartitionFinder 2: new
methods for selecting partitioned models of evolution for molecular and morphological
phylogenetic analyses. Molecular Biology and Evolution 34: 772-773.
https://doi.org/10.1093/molbev/msw260
Lebel T, Syme A. 2012. Sequestrate species of Agaricus and Macrolepiota from Australia: new
species and combinations and their position in a calibrated phylogeny. Mycologia 104:
496-520. https://doi.org/10.3852/11-092
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES science gateway for inference of
large phylogenetic trees. In: Proceedings of the Gateway Computing Environments Workshop
(GCE). New Orleans, Louisiana. 8 p. https://doi.org/10.1109/GCE.2010.5676129
Rick J. 1938. Agarici Riograndenses II. Lilloa 2: 251-316.
Rick J. 1961. Basidiomycetes Eubasidii no Rio Grande do Sul, Brasilia. Iheringia 8: 296-450.
Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Héhna S, Larget B, Liu L,
Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayesian phylogenetic
inference and model choice across a large model space. Systematic Biology 61: 539-542.
https://doi.org/10.1093/sysbio/sys029
Singer R. 1948. New and interesting species of Basidiomycetes. II. Papers of the Michigan Academy
of Sciences 32: 103-150.
Singer R. 1954. [“1953”] Type studies on Basidiomycetes VI. Lilloa 26: 57-159.
Singer R. 1959. Dos generos de hongos nuevos para Argentina. Boletin de la Sociedad Argentina
de Botanica 8: 9-13.
Singer R. 1986. The Agaricales in modern taxonomy. 4th edition. Koenigstein: Koeltz Scientific
Books.
Stamatakis A. 2014. RAxML Version 8: a tool for phylogenetic analysis and post-analysis of large
phylogenies. Bioinformatics 30: 1312-1313. https://doi.org/10.1093/bioinformatics/btu033
Strongman DB, Wang J, Xu S. 2010. New trichomycetes from western China. Mycologia 101:
174-184.
Thiers B. 2018 [continuously updated]. Index Herbariorum: a global directory of public herbaria
and associated staff. New York Botanical Garden's Virtual Herbarium. Accessed Aug 2018:
http://sweetgum.nybg.org/ih/
Vellinga EC. 1988. Glossary. 54-64, in: C Bas & al. (eds). Flora Agaricina Neerlandica, vol. 1. A.A.
Balkema Publishers, Amsterdam/Brookfield.
Vellinga EC. 2003. Chlorophyllum and Macrolepiota (Agaricaceae) in Australia. Australian
Systematic Botany 16: 361-370. https://doi.org/10.1071/sb02013
Vellinga EC, Noordeloos ME. 2001. Glossary. 6-11, in: ME Noordeloos & al. (eds). Flora Agaricina
Neerlandica, vol. 5. A.A. Balkema Publishers, Lisse/Abingdon/Exton/Tokyo.
Macrolepiota dunensis sp. nov., M. sabulosa var. velistellaris var. nov. (Brazil) ... 239
Vellinga EC, Yang ZL. 2003. Volvolepiota and Macrolepiota—Macrolepiota velosa, a new species
from China. Mycotaxon 85: 183-186.
Vellinga EC, Kok RPJ, Bruns TD. 2003. Phylogeny and taxonomy of Macrolepiota (Agaricaceae).
Mycologia 95: 442-456. https://doi.org/10.1080/15572536.2004.11833089
Veloso HP, Rangel-Filho ALR, Lima JCA. 1991. Classificagao da vegetacao brasileira adaptada a
um sistema universal. Rio de Janeiro: IBGE, Departamento de Recursos Naturais e Estudos
Ambientais.
Vizzini A, Contu M, Ghignone S, Vellinga E. 2011. A new volvate Macrolepiota (Agaricomycetes,
Agaricales) from Italy, with observations on the M. procera complex. Mycotaxon 117: 149-164.
http://dx.doi.org/10.5248/117.149
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis & al. (eds). PCR Protocols:
a guide to methods and applications. San Diego, Academic Press.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 241-251
https://doi.org/10.5248/134.241
Inocybe caroticolor from oak forests of Pakistan
A. NASEER’*, S. GHANT’, A. R. NiAzi’, A. N. KHALID?
"Centre for Undergraduate Studies & ’ Department of Botany,
University of the Punjab, Quaid-e-Azam Campus-54590, Lahore, Pakistan
* CORRESPONDENCE TO: [email protected]
ABSTRACT—Basidiomata of Inocybe caroticolor were collected from two different Quercus
forests in Swat, KP, Pakistan. Based on morphology and molecular phylogenetic analyses
of ITS and 28S rDNA regions, these basidiomata were found to represent I. caroticolor
and placed within the Inocybe viscata group. Our I. caroticolor specimens are molecularly
supported as conspecific with specimens from China and represent a first species record from
Pakistan.
Key worps—GenBank, Himalayan, Inocybaceae, LSU
Introduction
The genus Inocybe (Fr.) Fr. UInocybaceae) is distributed worldwide and
covers a wide geographical range from tropical to arctic-alpine regions (Favre
1955; Horak 1979, 1980, 1981, 1987; Kihner 1988; Buyck & Eyssartier 1999;
Watling 2001; Matheny & al. 2003; Jacobsson 2008). As one of the larger
ectomycorrhizal genera in Agaricales, Inocybe is an important component
of ectomycorrhizal temperate and boreal forest communities in alpine and
arctic habitats (Cripps & al. 2010, Kokkonen & Vauras 2012).
Between 70% and 80% of the species in Inocybaceae have been described
in associations primarily with ectomycorrhizal plant families Fagaceae,
Pinaceae, and Salicaceae (Kirk & al. 2008). Quercus (oak), an important
genus in the Fagaceae, is also known as the ‘king of trees’ due to its vital
ecological role. In Pakistan, oaks are among the dominant vascular plants
of the Himalayas, ranging from the subtropical to the sub-alpine zones
242 ... Naseer &al.
(Shrestha 2003). Himalayan oaks are evergreen, mostly gregarious, medium-
to large-sized trees distributed at elevations of 800-3800 m a.s.l. throughout
the Himalayan region. According to Alamgir (2004), established oak forests
cover approximately 16,800 ha, making Quercus an important genus in
temperate regions in Pakistan. Swat lies in Himalaya and its mycoflora is
poorly known.
More than 850 Inocybe species have been reported worldwide (Matheny
& al. 2009, 2012; Kobayashi & Onishi 2010; Horak & al. 2015; Jabeen & al.
2016). This number is increasing; during 2015-18 newly described species
of Inocybaceae included 100 from Australia (Matheny & Bougher 2017),
19 from New Zealand (Horak 2018), 17 from India (Latha & Manimohan
2017), and 13 from Thailand and Malaysia (Horak & al. 2015). Species
are also regularly being described in northern and southern Europe (e.g.,
Kokkonen & Vauras 2012; Esteve-Raventés & al. 2015, 2016, 2017; Bizio
& al. 2016; Franchi & al. 2016; Vauras & Larsson 2016). Inocybe has been
widely explored throughout Asia in China (Fan & Bau 2013, 2014), India
(Vrinda & al. 1996, 1997; Pradeep & Vrinda 2007, 2010; Latha & Manimohan
2015, 2016, 2017; Tibpromma & al. 2017), Japan (Kobayashi & Courtecuisse
1993, 2000; Kobayashi & Hongo 1993; Kobayashi 2009; Kobayashi & Onishi
2010), and the Himalayas (Horak 1981). Only a few studies of the genus,
however, have been undertaken in Pakistan. Since Ahmad & al. (1997)
published their first report of Inocybe from Pakistan, 29 Inocybe species have
been reported from different parts of the country (Ilyas & al. 2013, Saba &
al. 2015, Jabeen & al. 2016, Faroogi & al. 2017, Naseer & al. 2018, Ullah &
al. 2018), of which four—I. ahmadii Faroogi & al., I. kohistanensis Jabeen &
al., I. pakistanensis Z. Ullah & al., and I. shawarensis Naseer & Khalid—were
described as new to science (Jabeen & al. 2016, Farooqi & al. 2017, Naseer &
al. 2018, Ullah & al. 2018).
During 2014-16 we collected specimens on field research trips while
studying fungal communities associated with the oak forests of Pakistan. At
that time we encountered in Swat an Inocybe species previously unknown
from Pakistan. Its bright red carrot color easily distinguished this fungus
in the field, and in the laboratory, we identified it as Inocybe caroticolor.
Here we present a taxonomic description of our new Pakistani collections
with the results of our ITS1-5.8S-ITS2 and 28S rDNA sequence analyses
phylogenetically placing this species in the Inocybe viscata group of Inocybe
clade (Matheny & Bougher 2017).
Inocybe caroticolor from oak forests (Pakistan) ... 243
Material & methods
Collection & morphological examination
Specimens were collected from two different locations from the moist temperate
forest of Toa, Swat as described in Naseer & al. (2017) and Shawar Valley as described
in Naseer & al. (2018). These forests are dominated by Quercus incana Roxb. nom. illeg.
[= Q. oblongata D. Don] and to a lesser extent Q. dilatata Royle. Gross morphological
characters were recorded in the field and photographed using a Nikon D70S digital
camera. Basidiomata were wrapped in aluminium foil and kept separately in a
collection box to avoid mixing or crushing. Specimens were dried, sealed in plastic bag,
and deposited in Lahore Herbarium, Department of Botany, University of the Punjab,
Lahore, Pakistan (LAH). Colors were designated by mColorMeter. For anatomical
examination, tissues from lamellae, pileipellis and stipitipellis were mounted on glass
slides and observed in Phloxine (1%), Melzer’s reagent, and KOH (5%) for pigmented
hyphae and walls of cystidia using a Meiji Techno MX4300H microscope. Dimensions
were measured for basidiospores, basidia and other elements from basidiomata under
the light microscope equipped with a camera lucida.
Molecular phylogenetic analyses
DNA was extracted from lamellae of basidiomata following a modified CTAB
method (Bruns 1995). The ITS region was amplified using primer pairs ITS1F/ITS4
(White & al. 1990) and the nrDNA 28S region using primer pairs LROR/LR5 (Vilgalys
& Hester 1990). Amplification parameters proceeded with an initial denaturation step
at 94°C for 4 min, followed by 34 cycles of 94°C for 40 sec, 55°C (ITS) or 52°C (28S)
for 40 sec, and 72°C for 1 min, and a final elongation step at 72°C for 8 min. The
PCR products were purified, and Macrogen (South Korea) conducted bidirectional
sequencing. The consensus sequences were subjected to BLAST, and compared with
available GenBank sequences. The newly generated sequences were aligned with the
closest matching NCBI sequences using MUSCLE v3.6 (Edgar 2004) and manually
adjusted where necessary. ML tree generation and bootstrap analyses were performed
for combined ITS and 28S data set on CIPRES Gateway (Miller & al. 2010). A maximum
likelihood (ML) tree was inferred using RAxML-HPC2 v8.1.11 (Stamatakis 2014) with
a GTR + gamma model of nucleotide substitution. One thousand bootstrap iterations
were performed with rapid bootstrapping. Significant support was considered to be
=70%. Sequences generated in this study were submitted to GenBank.
Taxonomy
Inocybe caroticolor T. Bau & Y.G. Fan, Mycotaxon 123: 170 (2013) Figs 1, 2
BASIDIOMATA small. PrLEus 12-32 mm diam., bright red (2.4YR 3.1/9.3)
in centre becoming yellowish (0.5Y 6.3/7) with patches of reddish orange;
conical when young, then plano-convex, with an obtuse umbo, slightly
rimulose, surface dry with appressed squamules over disc, radially fibrillose,
244 ... Naseer &al.
Fic. 1. Inocybe caroticolor. Basidiomata.
A, B. LAH35266; C, D. LAH35268; E-G. LAH35269.
Scale bars: A, B, E= 0.7 cm; C, D, F = 0.33.cm; G = 0.5 cm
rimose, margins inrolled (young) to incurved (mature). LAMELLAE light
yellow (4.6Y 8.9/4.2) when young to yellowish orange (2.6YR 2.5/5.4)
when mature, numbering 45-60, regularly arranged, adnexed, slightly
close to crowded, 2-3 mm deep, edges even, smooth; lamellulae %4 length
of lamellae, single-tiered and alternating with lamellae. Stipe 32 x 4 mm,
central, cylindrical, with subbulbous to non-marginate bulbous base,
fibrillose, pruinose entire length, densely so at apex, longitudinally striate;
yellow (4Y 6.2/6.5) in the middle region, and reddish orange (2.4YR 3.1/9.3)
at apex, basal tomentum white.
Inocybe caroticolor from oak forests (Pakistan) ... 245
F
Es
Fic. 2. Inocybe caroticolor (LAH35266). A. Basidia; B. Basidiospores;
C. Cheilocystidia; D. Pleurocystidia; E. Caulocystidia with paracystidia; F. Pileipellis.
Scale bars: A = 7.90 um; B = 4.39 um; C = 9.54 um; D, E = 14 um; F = 6.7 um.
246 ... Naseer & al.
BasiprosporEs [n/b/p = 60/3/3], (6.3-)6.5-9.3(-9.5) x (4.5-)4.7-6.0
(-6.1) um, mean = 7.5 x 5.2 um, Q = (1.43-)1.47-1.58(-1.61), pale brown
in 5% KOH, weakly to strongly nodulose. Basrp1A 25-36 x 5-8 um, clavate,
4-spored, with yellowish pigments. PLEUROCysTIDIA 47-63 x 12-15 um,
fusiform, with crystalliferous apex, yellow in 5% KOH, thick walled, obtuse
base. CHEILOCYSTIDIA 48-62 x 12-15 um, fusiform, some cylindrical.
CAULOCYSTIDIA 49-75 x 9-13 um, variably shaped, abundant, thin-walled.
PILEIPELLIS 0.2-6.5 um, a cutis of cylindrical hyphae, smooth, pigmented,
thin-walled. STIPITIPELLIs 2—4.5 um, a cutis composed of regularly arranged
hyphae, filamentous, smooth, thin- to moderately thick-walled. CLamp
CONNECTIONS present.
MATERIAL EXAMINED: , Toa, 2100 m a.s.l, on soil under Quercus oblongata, 15 July
2015, Arooj Naseer, Abdul Rehman Niazi & Abdul Nasir Khalid AST47 (LAH35266;
GenBank MH473148, MH536985); , Shawar Valley, 2100 m a.s.l, solitary on soil
under Q. dilatata and Q. oblongata 14 July 2014, Arooj Naseer & Abdul Nasir Khalid
ASSW11 (LAH35268; GenBank MH473144, MH536984); 15 Aug 2015, Arooj
Naseer & Abdul Nasir Khalid ASS6 (LAH35267; GenBank MH473145, MH536986);
25 August 2014, Arooj Naseer & Abdul Nasir Khalid ASSW29 (LAH35269; GenBank
MH473146, MH536983).
Molecular phylogenetic characterization
Sequencing of the ITS PCR products from Inocybe caroticolor specimens
yielded 580-745 base pairs. NCBI BLAST searches of consensus sequences
from four collections showed these sequences as 99% identical with Inocybe
caroticolor (JX025772, JX025773 and JX025774) from China (100% query
coverage; 0.0 E value). These sequences also showed a 93% identity with
Inocybe sp. TR198-03 (KP636865) from Papua New Guinea.
Sequencing of the 28S PCR products yielded 867-980 base pairs.
Consensus sequences of the 835 base pairs BLAST searched at NCBI showed
97% identity with Inocybe sp. REH7418 (JN974931) from an oak forest in
Costa Rica and Inocybe sp.TR132-05 (KP171061) and Inocybe sp. TR88-06
(JN974992) from Castanopsis forests in Papua New Guinea with 100% query
cover and 0.0 E value.
Sequences representing the Inocybe viscata group (Inocybe clade; Matheny
& Bougher 2017), Indian species in a related clade (Latha & Manimohan
2017), and Auritella dolichocystis as outgroup were selected for preparation
of the ITS/28S-based phylogram. Our newly generated sequences clustered
with sequences from China with strong bootstrap value (Fic 3).
Inocybe caroticolor from oak forests (Pakistan) ... 247
Pakistan
Inocybe_caroticolor_ YGFan2011139
84|| Inocybe_caroticolor_YGFan2010216 China
Inocybe_caroticolor_YGFan2011123
Inocybe_sp_TR198_03
Inocybe_sp_CR1
Inocybe_sp_REH7418
Inocybe_sp_REH7965
Inocybe_sp_TR132-05
Inocybe_sp_TR88-06
Inocybe_kurkuriya_CAL1352
Inocybe_torresiae_PBM3722
Inocybe_torresiae_PBM2157
Inocybe_flavosquamulosa_CAL1355
Inocybe_floccosistipitata_CAL1256
Inocybe_sp_ZT10106
400) Inocybe_viscata_PBM3445
Inocybe_viscata_PBM3213
Inocybe_viscata_TENNO66
Inocybe_torresiae_PBM3722
Inocybe_insulana_CAL1258
Auritella_dolichocystis
0.5
Fic. 3. ML phylogram of Inocybe caroticolor in the I. viscata group based on combined ITS and
28S nrDNA as generated with RAxML with 1000 bootstrap iterations. The letters in bold refer to
sequences generated in this study, and sequences from Pakistan are highlighted in green.
Discussion
Inocybe caroticolor is characterized by the bright reddish carrot color
of the basidiomata, nodulose basidiospores, and thick-walled hymenial
cystidia. It can be easily recognized in the field by its bright red color,
distinct aromatic odor, and entirely pruinose stipe. ITS sequence analysis
clustered sequences from our Pakistani collections phylogenetically with
those reported from China by Fan & Bau (2013), while the 28S phylogeny
supported separation of the sequences from Pakistan in a separate clade
from the sequences from Inocybe sp. TR88.06, Inocybe sp. TR132.05, and
Inocybe sp. TR198.03 as observed in the ITS-based phylogram. However,
as no other 28S-based sequences were present in GenBank, they were not
included in a 28S-based phylogram.
The Pakistani collection of I. caroticolor differs somewhat morphologically
from Chinese collection, which Fan & Bau (2013) described with a smaller
248 ... Naseer & al.
pileus and brighter red carrot color. In China, I. caroticolor has been found
in association with Quercus variabilis Blume except for one collection found
under Pinus yunnanensis Franch. (Fan & Bau 2013). During this study,
all four collections from Pakistan were associated with Q. oblongata and
Q. dilatata forests, indicating a strong preference for Quercus. This hypothesis
is strengthened by the presence of other oak-specific species in the same
clade (Matheny & Bougher 2017).
Our collections represent first record of Inocybe caroticolor for Pakistan.
This species also exhibits a strong attraction for different oak species. In
Pakistan, oak forests are being cut extensively for burning fuel and thus
subject to decline. The presence of this unusual species may help develop an
awareness of the need to conserve, establish, and reclaim these oak forests.
Acknowledgements
We are sincerely grateful to Dr. Brandon Matheny (University of Tennessee,
Knoxville, USA) for his phylogenetic analyses and comments on an earlier version
of this paper. We are thankful to Dr. Ditte Bandini (Wiesenbach, Germany) and
Dr. Sana Jabeen (University of Education, Lahore, Pakistan) for their helpful
comments to improve this manuscript.
Literature cited
Ahmad S, Iqbal SH, Khalid AN. 1997. Fungi of Pakistan. Lahore, Pakistan: Sultan Ahmad
Mycological Society.
Alamgir KG. 2004. A study on the conditions, use, management and trends of major forest types
in Chitral District. Report on Chitral Conservation Strategy and IUCN Sarhad Program, 111 p.
Bizio E, Ferisin G, Dovana F. 2016. Inocybe costinitii, a new species from the Istrian coast.
Micologia e Vegetazione Mediterranea 31(2): 95-102.
Bruns TD. 1995. Thoughts on the processes that maintain local species diversity of ectomycorrhizal
fungi. Plant and Soil 170: 63-73. https://doi.org/10.1007/BF02183055
Buyck B, Eyssartier G. 1999. Two new species of Inocybe (Cortinariaceae) from African woodland.
Kew Bulletin 54: 675-681. https://doi.org/10.2307/4110863
Cripps CL, Larsson E, Horak E. 2010. Subgenus Mallocybe (Inocybe) in the Rocky Mountain alpine
zone. North American Fungi 5(5): 97-126. https://doi-org/10.2509/naf2010.005.0057
Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput.
Nucleic Acids Research 32: 1792-1797. https://doi.org/10.1093/nar/gkh340
Esteve-Raventés F, Moreno G, Bizio E, Alvarado P. 2015. Inocybe flavobrunnescens, a new species
in section Marginatae. Mycological Progress 14:14 [12 p.].
https://doi.org/10.1007/s11557-015-1036-0
Esteve-Raventds F, Moreno G, Alvarado P, Olariaga I. 2016. Unraveling the Inocybe praetervisa
group through type studies and ITS data: Inocybe praetervisoides sp. nov. from the
Mediterranean region. Mycologia, 108(1): 123-134. https://doi.org/10.3852/15-053
Esteve-Raventés F, Rodriguez-Campo FJ, Alvarado P. 2017. Fungal Planet 603 - 20 June
2017. Inocybe parvicystis FJ. Rodr.-Campo & Esteve-Rav., sp. nov. Persoonia 38: 338-339.
https://doi.org/10.3767/003158517X698941
Inocybe caroticolor from oak forests (Pakistan) ... 249
Fan YG, Bau T. 2013. Two striking Inocybe species from Yunnan Province, China. Mycotaxon
123: 169-181.https://doi.org/10.5248/123.169
Fan YG, Bau T. 2014. Inocybe miyiensis, a new two-spored species in section Marginatae from
China. Nova Hedwigia 98: 179-185. https://doi.org/10.1127/0029-5035/2013/0135
Farooqi A, Aqdus F, Niazi AR, Jabeen S, Khalid AN. 2017. Inocybe ahmadii sp. nov. and a new
record of I. leptocystis from Pakistan. Mycotaxon 132: 257-269.
https://doi.org/10.5248/132.257
Favre J. 1955. Les champignons supérieurs de la zone alpine du Parc National Suisse. Ergebnisse
der Wissenschaftlichen Untersuchung des Schweizerischen Nationalparkes 5:1-212.
Franchi P, Marchetti M, Papetti C. 2016. Inocybe tiliae, una nuova specie della Sezione
Marginatae. Rivista di Micologia 59: 99-121.
Horak E. 1979. Astrosporina (Agaricales) in Indomalaya and Australasia. Persoonia 10: 157-205.
Horak E. 1980. Inocybe (Agaricales) in Indomalaya and Australasia. Persoonia 11: 1-37.
Horak E. 1981. On Himalayan species of Astrosporina and Inocybe (Agaricales). Persoonia 11:
303-310.
Horak E. 1987. Astrosporina in the alpine zone of the Swiss National Park (SNP) and adjacent
regions. 205-234, in Arctic and Alpine Mycology II, Eds., G.A. Laursen, J.E Ammirati, S.A.
Redhead, Plenum Press, New York. 364p. https://doi.org/10.1007/978-1-4757-1939-0_14
Horak E. 2018. Agaricales (Basidiomycota) of New Zealand. 2. Brown spored genera p.p. Fungi
of New Zealand/Nga Hekaheka 0 Aotearoa, vol. 6. Westerdijk Biodiversity Series 16. 205 p.
Horak E, Matheny PB, Desjardin DE, Soytong K. 2015. The genus Inocybe (Inocybaceae,
Agaricales, Basidiomycota) in ‘Thailand and Malaysia. Phytotaxa 230: 201-238.
https://doi.org/10.11646/phytotaxa.230.3.1
Ilyas S, Razaq A, Khalid AN. 2013. Inocybe nitidiuscula and its ectomycorrhizae with Alnus
nitida from Galyat, Pakistan. Mycotaxon 124: 247-254. https://doi.org/10.5248/124.247
Jabeen S, Ahmad I, Rashed A, Khalid AN. 2016. Inocybe kohistanensis, a new species from Swat,
Pakistan. Turkish Journal of Botany 40: 312-318. https://doi.org/10.3906/bot- 1501-17
Jacobsson S. 2008. Key to Inocybe. 868-906, in: H Knudsen, J Vesterholt (eds.). Funga Nordica.
Agaricoid, boletoid and cyphelloid genera. Nordsvamp, Copenhagen.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the Fungi (10th edn). CABI,
Wallingford. 771 p.
Kobayashi T. 2009. Notes on the genus Inocybe of Japan: IV. Species having metuloids collected
from Hokkaido, Honshu, and Kyushu. Mycoscience 50: 203-211.
https://doi.org/10.1007/s10267-008-0472-y
Kobayashi T, Courtecuisse R. 1993. Two new species of Inocybe from Japan. Mycotaxon 46:
24-33),
Kobayashi T, Courtecuisse R. 2000. Two new species of Inocybe, section Marginatae (Agaricales,
Cortinariaceae) from Japan. Mycoscience 41: 161-166. https://doi.org/10.1007/BF02464326
Kobayashi T, Hongo T. 1993. Inocybe flocculosa rediscovered in Japan. Transactions of the
Mycological Society of Japan 34: 507-510.
Kobayashi T, Onishi S. 2010. Inocybe sericella, a new species of Inocybe sect. Inocybe
[= Cortinatae] from Kobe, Japan. Nova Hedwigia 90: 227-232.
https://doi.org/10.1127/0029-5035/2010/0090-0227
Kokkonen K, Vauras J. 2012. Eleven new boreal species of Inocybe with nodulose spores.
Mycological Progress 11: 299-341. https://doi.org/10.1007/s11557-011-0783-9
Kuhner R. 1988. Diagnoses de quelques nouveaux Inocybes récoltés en zone alpine de la Vanoise
(Alpes frangaises). Documents Mycologiques 19(74): 1-27.
250 ... Naseer & al.
Latha KPD, Manimohan P. 2015. Inocybe griseorubida, a new species of Pseudosperma clade
from tropical India. Phytotaxa 221(2): 166-174. http://doi.org/10.11646/phytotaxa.221.2.6
Latha KPD, Manimohan P. 2016. Five new species of Inocybe (Agaricales) from tropical India.
Mycologia 108: 110-122. https://doi.org/10.3852/14-358
Latha KPD, Manimohan P. 2017. Inocybes of Kerala. Spore Print Books, Calicut. 181 p.
Latha KPD, Manimohan P, Matheny PB. 2016. A new species of Inocybe representing the
Nothocybe lineage. Phytotaxa 267: 40-50. https://doi.org/10.11646/phytotaxa.267.1.4
Matheny PB, Bougher NL. 2017. Fungi of Australia, Inocybaceae. Canberra & Melbourne.
Matheny PB, Aime MC, Henkel TW. 2003. New species of Inocybe from Dicymbe forests of
Guyana. Mycological Research 107: 495-505. https://doi.org/10.1017/s0953756203007627
Matheny PB, Aime MC, Bougher NL, Buyck B, Desjardin DE, Horak E, Kropp BR, Lodge
DJ, Trappe JM, Hibbett DS. 2009. Out of the Palaeotropics? Historical biogeography and
diversification of the cosmopolitan mushroom family Inocybaceae. Journal of Biogeography
36: 577-592. https://doi.org/10.1111/j.1365-2699.2008.02055.x
Matheny PB, Aime MC, Smith ME, Henkel TW. 2012. New species and reports of Inocybe
(Agaricales) from Guyana. Kurtziana 37: 23-39.
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway for inference
of large phylogenetic trees. In: Proceedings of the Gateway Computing Environments
Workshop (GCE) 14 Nov. 2010. Institute of Electrical and Electronics Engineers, New
Orleans, LA. 8 p. https://doi.org/10.1109/GCE.2010.5676129
Naseer A, Khalid AN, Niazi AR. 2017. Phylloporus brunneiceps from Pakistan. Mycotaxon
132(3): 685-693. https://doi.org/10.5248/132.685
Naseer A, Khalid AN, Smith ME. 2018 [“2017”]. Inocybe shawarensis sp. nov. in the Inosperma
clade from Pakistan. Mycotaxon 132(4): 909-918. https://doi.org/10.5248/132.909
Pradeep CK, Vrinda KB. 2007. Some noteworthy agarics from Western Ghats of Kerala. Journal
of Mycopathological Research 1: 1-14.
Pradeep CK, Vrinda KB. 2010. Ectomycorrhizal fungal diversity in three different forest types
and their association with endemic, indigenous and exotic species in the Western Ghats
forests of Thiruvananthapuram district, Kerala. Journal of Mycopathological Research
48(2): 279-289.
Saba M, Ahmad I, Khalid AN. 2015. New reports of Inocybe from pine forests in Pakistan.
Mycotaxon 130: 671-681. https://doi.org/10.5248/130.671
Shrestha BB. 2003. Quercus semecarpifolia Sm. in the Himalayan region: ecology, exploitation and
threats. Himalaya Journal of Science 1: 126-128.
Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large
phylogenies. Bioinformatics 30: 1312-1313. https://doi.org/10.1093/bioinformatics/btu033
Tibpromma S, Hyde KD, Jeewon R. et al. 2017. Fungal diversity notes 491-602:
taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 83: 1-292.
https://doi.org/10.1007/s13225-017-0378-0
Ullah Z, Jabeen S, Ahmad H, Khalid AN. 2018. Inocybe pakistanensis, a new species in section
Rimosae s. str. from Pakistan. Phytotaxa 348(4): 279-288.
http://doi.org/10.11646/phytotaxa.348.4.4
Vauras J, Larsson E. 2016 (“2015”). Inocybe caprimulgi and I. lacunarum, two new nodulose- spored
species from Fennoscandia. Karstenia 55: 1-18. https://doi.org/10.29203/ka.2015.465
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
https://doi.org/10.1128/jb.172.8.4238-4246.1990
Inocybe caroticolor from oak forests (Pakistan) ... 251
Vrinda KB, Pradeep CK, Joseph AV, Abraham TK. 1996. A new Inocybe (Cortinariaceae) from
Kerala State, India. Mycotaxon 57: 171-174.
Vrinda KB, Pradeep CK, Mathew S, Abraham TK. 1997. Inocybe purpureoflavida sp. nov.
(Cortinariaceae) from Western Ghats of Kerala State, India. Mycotaxon 64: 1-6.
Watling R. 2001. An unusual Inocybe sp. from West Africa. Czech Mycology 52: 329-334.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. In: Innis, MA, Gelfand DH, Sninsky JJ, & White TJ, (Eds.)
PCR Protocols: a guide to methods and applications. Academic Press, San Diego, California,
315-322. https://doi.org/10.1016/b978-0-12-372180-8.50042-1
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 253-256
https://doi.org/10.5248/134.253
Sporidesmium horizontale sp. nov. from China
ConG-Conc At’, JI-WEN XIA', XIU-GUO ZHANG’,
YUN GENG?“, L1-Guo Ma?®
' Shandong Provincial Key Laboratory for Biology of Vegetable Diseases and Insect Pests,
College of Plant Protection, Shandong Agricultural University,
Taian, Shandong, 271018, China
’ Biotechnology Research Center, Shandong Academy of Agricultural Sciences,
Jinan, Shandong, 250100, China
° Shandong Key Laboratory of Plant Virology, Institute of Plant Protection,
Shandong Academy of Agricultural Sciences, Jinan, Shandong, 250100, China
“CORRESPONDENCE TO: “ [email protected], ® [email protected]
ABSTRACT—A new species, Sporidesmium horizontale, is described and illustrated from
specimens collected on dead branches in China. This fungus is characterized by horizontal,
obclavate, 4—5-septate, versicolored conidia with short rostra.
Key worps—anamorphic fungi, hyphomycete, Pleosporomycetidae, taxonomy
Introduction
Sporidesmium was erected by Link (1809) and typified with S. atrum Link.
Ellis (1971) defined the genus as having integrated, terminal, monoblastic
conidiogenous cells with acrogenous, solitary, transversely septate or
distoseptate conidia. Subramanian (1992) redefined the generic concept of
Sporidesmium in a stricter sense as simple conidiophores, determinate or
with irregular extending proliferations, and solitary, gangliar, acrogenous
and euseptate conidia. Wu & Zhuang (2005) expanded the generic concepts
to include fungi with typically lageniform, doliiform, or nodose, percurrently
extending conidiophores. Since then 31 new species have been described in the
genus, most of which were found on rotten wood, dead branches, or decaying
254 ... Ai & al.
leaves of various plants (e.g., Ma & Zhang 2007; Ma & al. 2012; Xia & al. 2017;
Yang & al. 2018; Zhang & al. 2008, 2017).
A new hyphomycete representing the genus of Sporidesmium was found
during research on saprobic fungi in China. Specimens are deposited in
the Herbarium of Department of Plant Pathology, Shandong Agricultural
University, Taian, Shandong, China (HSAUP) and the Mycological Herbarium,
Institute of Microbiology, Chinese Academy of Sciences, Beijing, China
(HMAS).
Taxonomy
Sporidesmium horizontale L.G. Ma, C.C. Ai & X.G. Zhang, sp. nov. FIG. 1
MB 830543
Differs from other Sporidesmium species by its horizontal, obclavate, 4—5-septate,
versicolored, and smooth conidia with a short, subhyaline rostrum.
Type: China, Yunnan Province, Xishuangbanna Tropical Botanical Garden, on dead
stems of an unidentified broadleaf tree, 2 Nov. 2011, L.G. Ma (Holotype, HSAUP
H2133; isotype, HMAS 146148).
Erymo coey: horizontale, referring to the conidia with horizontal growth.
COLONIES on natural substrate effuse, brown to dark brown, hairy. Mycelium
partly superficial, partly immersed in the substrate, composed of septate, pale
brown, smooth, 3.0-4.5 um diam. hyphae. ConIDIOPHORES macronematous,
mononematous, unbranched, erect, straight to flexuous, cylindrical, smooth,
thick-walled, brown to dark brown, 5-10-septate, 90-175 um long, 6-13.5 um
diam. at the base and 3-4.5 um diam. at the tapered apex. CONIDIOGENOUS
CELLS holoblastic, monoblastic, brown, cylindrical, smooth, thick-walled, 5-6.5
x 17-21.5 um. Conidial secession schizolytic. Conip14 solitary, horizontal on
the conidiophores, obclavate, thick-walled, brown, pale brown on the basal and
upper cells, smooth, 4—5-euseptate, 41-59 x 16-18 um, with a short, subhyaline
rostrum at the apex, sometimes embedded in a drop of mucilage.
CoMMENTS—Sporidesmium horizontale is unique in the genus by developing
conidia in a horizontal orientation, an unusual phenomenon that cannot be
explained at present. The species can also be separated from other Sporidesmium
species by its horizontal, obclavate, 4—5-septate, and versicolored conidia with
short, subhyaline rostra.
Acknowledgments
The authors express gratitude to Dr. Rafael EF Castafeda-Ruiz (Alejandro de
Humboldt, INIFAT, Cuba) and Dr. De-Wei Li (Connecticut Agricultural Experiment
Sporidesmium horizontale sp. nov. (China) ... 255
' cy
a@
20um 20um
Fic. 1. Sporidesmium horizontale (holotype, HSAUP H2133).
A. Conidiophores, conidiogenous cells, conidia; B. Conidia.
Station Valley Laboratory, USA) for serving as pre-submission reviewers and for
their valuable comments and suggestions. This project was supported by National
Key R&D Program of China (2017YFD0201700), Young Talents Training Program
of Shandong Academy of Agricultural Sciences (CXGC2018E04), National Natural
Science Foundation of China (31400019, 31230001, 31093440), and the Ministry of
Science and Technology of the People’s Republic of China (2006FY 120100).
Literature cited
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew,
Surrey, England.
Link HE 1809. Observationes in ordines plantarum naturales. Dissertatio I. Magazin der
Gesellschaft Naturforschenden Freunde Berlin 3: 3-42.
Ma J, Zhang XG. 2007. Two new species of Sporidesmium from Yunnan, China. Mycotaxon 101:
73-76.
Ma J, Ma LG, Zhang YD, Xia JW, Zhang XG. 2012. New species and record of Sporidesmium
from southern China. Mycotaxon 119: 17-25. https://doi.org/10.5248/119.17
Subramanian CV. 1992. A reassessment of Sporidesmium (hyphomycetes) and some related taxa.
Proceedings of the Indian National Science Academy, Part B Biological Sciences 58: 179-189.
256 ... Ai & al.
Wu WP, Zhuang WY. 2005. Sporidesmium, Endophragmiella and related genera from China.
Fungal Diversity Research Series 15. 351 p.
Xia JW, Li HH, Zhang XG. 2017. Two new species of hyphomycetes from southern China.
Mycosystema 36: 1483-1486. https://doi.org/10.13346/j.mycosystema.170140
Yang J, Maharachchikumbura SSN, Liu JK, Hyde KD, Jones EBG, Al-Sadi AM, Liu ZY. 2018.
Pseudostanjehughesia aquitropica gen. et sp. nov. and Sporidesmium sensu lato species from
freshwater habitats. Mycological Progress 17: 591-616.
https://doi.org/10.1007/s11557-017-1339-4
Zhang K, Ma J, Zhang XG. 2008. Taxonomic studies of Sporidesmium from Hainan, China.
Mycotaxon 104: 165-169.
Zhang H, Dong W, Hyde KD, Maharachchikumbura SSN, Hongsanan S, Bhat DJ, Al-Sadi
AM, Zhang D. 2017. Towards a natural classification of Annulatascaceae-like taxa:
introducing Atractosporales ord. nov. and six new families. Fungal Diversity 85: 75-110.
https://doi.org/10.1007/s13225-017-0387-z
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 257-260
https://doi.org/10.5248/134.257
Sporidesmiella corniformis sp. nov. from China
ConG-Conc At’, JI-WEN XIA’, XIU-GUO ZHANG’,
YUN GENG?“, L1-Guo Ma?®
‘Shandong Provincial Key Laboratory for Biology of Vegetable Diseases and Insect Pests,
College of Plant Protection, Shandong Agricultural University,
Taian, Shandong, 271018, China
*Biotechnology Research Center, Shandong Academy of Agricultural Sciences,
Jinan, Shandong, 250100, China
*Shandong Key Laboratory of Plant Virology, Institute of Plant Protection,
Shandong Academy of Agricultural Sciences,
Jinan, Shandong, 250100, China
“CORRESPONDENCE TO: “[email protected], *[email protected]
ABSTRACT—A new species, Sporidesmiella corniformis, is described and illustrated from
specimens collected on decaying branches in China. This fungus is characterized by clavate
to cuneiform, 2-distoseptate, pale brown conidia with 4-8 short horns.
Key worps—anamorphic fungi, hyphomycete, Melanommataceae, taxonomy
Introduction
Numerous microfungi collected in tropical and subtropical forests in China
have recently been reported (Ma & al. 2016a, b). In our continual mycological
surveys on wood-inhabiting fungi in China, an anamorphic fungus with
morphological features typical of Sporidesmiella Kirk (1982) was collected.
However, this fungus is morphologically different from the currently described
Sporidesmiella species and is therefore proposed as new.
Specimens are deposited in the Herbarium of the Department of Plant
Pathology, Shandong Agricultural University, Taian, Shandong, China
(HSAUP) and the Mycological Herbarium, Institute of Microbiology, Chinese
Academy of Sciences, Beijing, China (HMAS).
258 ... Ai & al.
Materials & methods
Samples of partially decomposed woody debris collected were placed in separate
polyethylene bags for transport to the laboratory. Samples were incubated, examined,
and processed periodically following the methods described in Ma & al. (2012a).
Conidia and conidiophores were measured and photographed using a DP 27 camera
attached to a Olympus BX 53 microscope equipped with a 60x oil immersion objective.
Then photographic plate was prepared using Adobe Photoshop CSS.
Taxonomy
Sporidesmiella corniformis L.G. Ma, C.C. Ai & X.G. Zhang, sp. nov. FIG. 1
MB 830544
Differs from Sporidesmiella cornuta by its bigger, 2-distoseptate conidia with much
shorter, more numerous horns; and from S. coronata by its 2-distoseptate, wider conidia
with longer, more numerous horns.
Type: China, Yunnan Province, Xishuangbanna National Forest Park, on dead branches
of an unidentified broadleaf tree, 12 Oct. 2011, L.G. Ma (Holotype, HSAUP H2058;
isotype, HMAS 146151).
Erymo ocy: corniformis, referring to the conidial shape.
COLONIES on natural substrate effuse, brown to dark brown, hairy. Mycelium
partly superficial, partly immersed in the substrate, composed of septate, pale
brown, smooth, 1.5-3.0 um diam. hyphae. ConIDIOPHORES macronematous,
mononematous, simple, unbranched, erect, straight to slightly flexuous,
cylindrical, smooth, thick-walled, brown to dark brown, 4-11-septate,
55-175 x 3.5-5 um. CONIDIOGENOUS CELLS integrated, terminal, holoblastic,
monoblastic, brown, cylindrical, smooth, thick-walled, percurrently extended,
with 0-5 cylindrical extensions towards the apex. Conidial secession schizolytic.
ConIDIA acrogenous, solitary, clavate to cuneiform, thick-walled, pale brown,
smooth, 2-distoseptate, 21-35 um long, 11.5-17.0 um wide at the apex, 2.5-3.5
um wide at the truncate base, apex with 4-8 short horns 2.0-7.5 um long; cell
lumina reduced, less so in the basal cell, the basal cell darker and basal septum
convex and deeply pigmented.
ComMMENTS—Sporidesmiella was erected by Kirk (1982) with S. claviformis
P.M. Kirk as the type species. The genus is characterized by acrogenous,
solitary, distoseptate conidia seceding schizolytically from integrated, terminal,
monoblastic, percurrent, or rarely sympodially extended conidiogenous cells
on macronematous, mononematous, solitary conidiophores. Although it shares
some resemblance to Coronospora (Ellis 1971), the latter genus is distinguished
by polyblastic, sympodial, cicatrized conidiogenous cells bearing euseptate
conidia. Both Yanna & al. (2001) and Ma & al. (2012b) reviewed Sporidesmiella
Sporidesmiella corniformis sp. nov. (China) ... 259
Fic. 1. Sporidesmiella corniformis (holotype, HSAUP H2058). A. Conidiophores, conidiogenous
cells and conidia; B. Conidiophore with conidiogenous cell; C. Conidia.
and provided a key to the accepted species. Hitherto, 38 species have been
discovered, of which 12 were described from China.
Sporidesmiella corniformis is most similar to S. cornuta Kuthub. & Nawawi
and S. coronata (B. Sutton) P.M. Kirk. Sporidesmiella cornuta differs by its
conidia that are 2-3-distoseptate, cylindrical to cuneiform, 24-29 um long
and 8-13 um diam. towards the apex and 4-5 um diam. at the base and with
(2—)3(-4) acuminate horns that are 10-24 um long (Kirk 1982). Sporidesmiella
260 ... Ai & al.
coronata can be separated by its conidia, which are 2-3-distoseptate, 6-7.5
um diam. towards the apex and with 4 short (<4 um) horns (Kuthubutheen &
Nawawi 1993).
Acknowledgments
The authors express gratitude to Dr. Rafael E Castafeda-Ruiz (Alejandro de
Humboldt, INIFAT, Cuba) and Dr. De-Wei Li (Connecticut Agricultural Experiment
Station Valley Laboratory, USA) for serving as pre-submission reviewers and for their
valuable comments and suggestions. This project was supported by National Key R&D
Program of China (2016YFD0300700), Young Talents Training Program of Shandong
Academy of Agricultural Sciences (CXGC2018E04), National Natural Science
Foundation of China (31400019, 31230001, 31093440), the Ministry of Science and
Technology of the People’s Republic of China (2006FY120100), and Natural Science
Foundation of Shandong Province (BS2015SW020).
Literature cited
Ellis MB. 1971. Dematiaceous hyphomycetes. X. Mycological Papers 125. 30 p.
Kirk PM. 1982. New or interesting microfungi. VI. Sporidesmiella gen. nov. (hyphomycetes).
Transactions of the British Mycological Society 79: 479-489.
https://doi.org/10.1016/s0007-1536(82)80040-5
Kuthubutheen AJ, Nawawi A. 1993. Three new and several interesting species of Sporidesmiella
from submerged litter in Malaysia. Mycological Research 97: 1305-1314.
https://doi.org/10.1016/s0953-7562(09)80162-7
Ma LG, Ma J, Zhang YD, Castafieda-Ruiz RF, Zhang XG. 2012a. New species and records
of Heteroconium (anamorphic fungi) from southern China. Mycoscience 53: 466-470.
https://doi.org/10.1007/s10267-012-0190-3
MaJ, Zhang YD, Ma LG, Castaneda-Ruiz RF, Zhang XG. 2012b. Three new species of Sporidesmiella
from southern China. Mycoscience 53: 187-193. https://doi.org/10.1007/s10267-011-0152-1
Ma J, Zhang K, Zhang XG, Castafeda-Ruiz RF. 2016a. Three new species of Spadicoides from
Lushan Mountain, China. Mycological Progress 15: 43 [8 p.].
https://doi.org/10.1007/s11557-016-1185-9
Ma YR, XiaJW, Gao JM, Li XY, Castafieda-Ruiz RE, Zhang XG, Li Zhuang. 2016b. Atrokylindriopsis,
a new genus of hyphomycetes from Hainan, China, with relationship to Chaetothyriales.
Mycological Progress 14: 77 [5 p.]. https://doi.org/10.1007/s11557-015-1071-x
Yanna, Ho WH, Hyde KD, McKenzie EHC. 2001. Sporidesmiella oraniopsis, a new species of
dematiaceous hyphomycete from North Queensland, Australia and synopsis of the genus.
Fungal Diversity 8: 183-190.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 261-269
https://doi.org/10.5248/134.261
New records of Amandinea and Buellia from China
ZUN-TIAN ZHAO™, XIAO ZHANG”, JIE-MENG Fu’, LING Hu”
'Key Laboratory of Plant Stress Research, College of Life Sciences &
? Institute of Environment and Ecology
Shandong Normal University, Jinan, 250014, PR. China
“CORRESPONDENCE TO: [email protected]
ABSTRACT—Otur research has revealed two species of Amandinea (A. occidentalis and
A. polyspora) and two species of Buellia (B. morsina and B. penichra), which we report
for the first time from China. Descriptions of morphological and chemical characters are
provided with the known distribution of each species.
Key worps—Caliciaceae, Caliciales, corticolous, lichen-forming fungi, taxonomy
Introduction
Amandinea M. Choisy ex Scheid. & M. Mayrhofer and Buellia De Not.
(Caliciaceae, Caliciales, Lecanoromycetes, Ascomycota) are closely related
genera characterized by a crustose thallus, apothecial ascomata, (4-)8
(—many)-spored asci, and brown 1-septate or (sub)muriform ascospores,
with or without oil droplets in the hymenium (Foucard & al. 2002, Coppins
& al. 2009). Amandinea can best be distinguished by the filiform conidia,
ascospores with or without inner wall thickenings and clearly ornamented
outer walls, and often lacking secondary metabolites detected by TLC,
while species of Buellia s. lat. have bacilliform conidia and usually contain
secondary compounds detectable by TLC (Coppins & al. 2009, Elix &
Kantvilas 2013a,b, Giralt & al. 2015). Amandinea is represented by 81
species and Buellia 454 species worldwide (Giralt & Nordin 2002; Kirk &
al. 2008; Senkardesler 2010; Giralt & al. 2011, 2015; Lumbsch & al. 2011;
*X1A0 ZHANG & ZUN-TIAN ZHAO contributed equally to this research.
262 ... Zhao, Zhang & al.
Giralt & van den Boom 2012; Fryday & Arcadia 2012; Tonsberg & al. 2012,
Elix & Kantvilas 2013a,b, 2016a,b; Kondratyuk & al. 2013, 2015, 2016; Elix &
al. 2015, 2017a,b, 2018; Blaha & al. 2016; Mayrhofer & al. 2016; Elix 2017a,b;
Elix & Mayrhofer 2017, 2018). In China, only one Amandinea species and
53 Buellia species have been reported (Wei 1991, Watanuki & al. 2017,
Wang & al. 2018).
This paper contributes to the knowledge of Amandinea and Buellia in
China and affords accurate data for the Lichen Flora of China project. In
this study we have identified four species new to the country: Amandinea
occidentalis, A. polyspora, Buellia morsina, and B. penichra.
Materials & methods
The specimens studied are preserved in the Lichen Section of Botanical Herbarium,
Shandong Normal University, Jinan, China (SDNU). The specimens were examined
morphologically and anatomically under a COIC XTL7045B2 stereo-microscope
and a Olympus CX41 polarizing microscope. We tested the thallus and medulla of
each specimen with K (10% aqueous KOH solution), C (aqueous CINaO solution),
and I (Lugol's iodine) for identification. Lichen substances were identified using
standardized thin-layer chromatography techniques (TLC) with system C (Orange &
al. 2010). The lichens were photographed using Olympus SZX16 and BX61 microscope
with a DP72 lens.
Taxonomy
Amandinea occidentalis Elix & Kantvilas,
Australas. Lichenol. 72: 9 (2013) FIG. 1A—D
Thallus crustose, smooth, thin, areolate, pale greyish to white, esorediate.
Prothallus present, but not apparent. Medulla white, I-. Apothecia black,
0.2-0.5 mm diam., sessile, epruinose, lecideine with a well developed
margin, weakly concave at first, then plane to convex, scattered or crowded.
Proper exciple dark brown, 50-70 um wide; epihymenium olive-brown,
K-; hymenium hyaline, inspersed with oil droplets; paraphyses simple;
hypothecium dark brown, K-. Asci (4—)8-spored, Bacidia-type. Ascospores
soon olive-brown, 1-septate, at first of the Physconia-type, then of the Buellia-
type, broadly fusiform to ellipsoid, 23-28 x 9-11 um, not constricted at the
septum. Pycnidia not observed.
Fic. 1 Amandinea occidentalis (Wang 20181068, SDNU). A: Thallus with apothecia;
B: Apothecium section; C: Ascus containing Physconia-type ascospores; D: Ascus containing
Buellia-type ascospores. Amandinea polyspora (Cheng 20120079, SDNU). E: Thallus with
apothecia; F: Apothecium section, without oil droplets in hymenium G: Ascus and ascospores;
H: Ascospores.
263
Amandinea & Buellia species new to China...
40um
*
pe N Ger
AAs GALES
Nee
Pret ae
264 ... Zhao, Zhang & al.
CHEMISTRY— Thallus K-, C-. No chemical substances detected by TLC.
SPECIMEN EXAMINED: CHINA. YUNNAN, Shangri-La, Mt. Tianbao, alt. 3700 m, on bark,
17 Aug. 2018, Chunxiao Wang 20181068 (SDNU).
DISTRIBUTION—Australia (Western Australia, New South Wales) (Elix &
Kantvilas 2013a; McCarthy 2018). New to China.
COMMENTS—Our specimens are similar to previously published
descriptions, except that the holotype has larger (0.2-1.2 mm) apothecia
and usually 4-spored asci (Elix & Kantvilas 2013a). Amandinea occidentalis
is characterized by the areolate thallus, Physconia-type to Buellia-type
ascospores, a hymenium inspersed with oil droplets, and the absence of lichen
substances. This species morphologically resembles A. lignicola var. australis
Elix & Kantvilas, which is distinguished by often having a subsquamulose
thallus, 8-spored asci with smaller ascospores (11-20 x 5-8 um), and a non-
inspersed hymenium (Elix & Kantvilas 2013a).
Amandinea polyspora (Willey) E. Lay & P.E. May,
Bryologist 100(2): 164 (1997) FIG. 1E-H
Thallus corticate, smooth, thin, pale brown to yellowish brown,
esorediate; medulla white, I-. Apothecia lecideine, black, 0.2-0.5 mm diam.,
sessile, epruinose, flat to convex, margin present at first but soon excluded.
Proper exciple narrow, dark brown, 20-30 um wide; epihymenium brown,
pigmentation continuous with the outer exciple; hymenium hyaline, not
inspersed with oil droplets; paraphyses simple to moderately branched,
swollen at upper part, with a brown pigmented cap; hypothecium reddish
brown. Asci Bacidia-type, mostly 16-spored, occasionally 32-spored.
Ascospores soon brown, 1-septate, Buellia-type, oblong to ellipsoid, not
constricted, 10-13(-15) x 4-5 um. Pycnidia not seen.
CHEMISTRY— Thallus K+ yellow, C-. Atranorin (trace) detected by TLC.
SPECIMEN EXAMINED: CHINA. JILIn, Helong, Mt. Zengfeng, alt. 1600 m, on bark, 19 Aug.
2011, Yuliang Cheng 20120079 (SDNU).
DIsTRIBUTION—Amandinea polyspora has been reported from Korea
(Kondratyuk & al. 2013) and from western, eastern, and southeastern USA
(Bungartz & al. 2007). New to China.
COMMENTS—Our specimens are similar to the protologue descriptions
(Bungartz & al. 2007). Amandinea polyspora is characterized by the small
ascospores and the polysporous asci. Buellia schaereri De Not. has similarly
small ascospores but differs in its consistently 8-spored asci and bacilliform
Amandinea & Buellia species new to China... 265
conidia, unlike the filiform conidia characteristic of A. polyspora (Bungartz
& al. 2007).
Buellia morsina A. Nordin, Symb. Bot. Upsal. 33(1): 74 (2000) Fig. 2A-C
Thallus crustose, smooth, rimose to areolate, brownish to grey, esorediate.
Prothallus absent. Medulla white, I-. Apothecia lecideine, 0.7-1.5 mm
diam.; sessile, disk black, epruinose, concave in young then flat; margin
black, obvious in young apothecia. Proper exciple dark brown, 50-100 um
wide; epihymenium dark brown, K-, C-. hymenium colorless, 80-125 um,
not inspersed with oil droplets. Hypothecium dark brown. Asci 8-spored;
ascospores soon brown, submuriform to muriform, 20-30 x 10-13 um.
Pycnidia not observed.
CHEMISTRY—Thallus K+ yellow turning red. Norstictic acid, atranorin
and connorstictic acid (trace) detected by TLC.
SPECIMEN EXAMINED: CHINA. YUNNAN, Luquan, Mt. Jiaozi, alt. 3600 m, on bark, 4 Nov.
2012, Hui Zhang 20129415 (SDNU).
DISTRIBUTION—Buellia morsina has previously been reported from Mexico
(Bungartz & al. 2007). New to China.
COMMENTS—Our specimens are similar to previously published
descriptions, except that the protologue describes smaller apothecia (0.2-1.2
mm) and the presence of a black prothallus (Bungartz & al. 2007). Buellia
morsina is characterized by its submuriform to muriform ascospores and
the presence of norstictic acid, atranorin, and connorstictic acid (trace). Its
thallus morphology, secondary chemistry, and exciple anatomy are similar
to B. lauri-cassiae (Fée) Mill. Arg., which is distinguished by its smaller,
3-septate spores (Nordin 2000, Giralt & Nordin 2002, Bungartz & al. 2007).
Buellia penichra (Tuck.) Hasse, Contr. U.S. Natl. Herb. 17: 122 (1913) Fig. 2D-F
Thallus corticate, smooth, greyish white, rimose to dispersed areolate.
Prothallus black. Medulla white, I-. Apothecia lecideine, black, round, 0.4-
0.8 mm diam., sessile, dispersed, flat at first soon convex, disc epruinose;
margin black, distinct in young apothecia, later excluded. Proper exciple
brown, pigmentation continuous with the outer exciple; epihymenium
brown to dark green; hymenium hyaline, inspersed with oil droplets,
paraphyses simple with distinct apical cap; hypothecium dark brown to
dark green. Asci 8-spored, ascospores submuriform, pale green then brown,
broadly fusiform to ellipsoid, 25-28 x 10-13 um. Pycnidia not observed.
CHEMISTRY—Thallus K+ yellow, C-. Atranorin detected by TLC.
266 ... Zhao, Zhang & al.
20m
Fic. 2 Buellia morsina (Zhang 20129415, SDNU). A: Thallus with apothecia; B: Apothecium
section; C: Ascus and ascospores. Buellia penichra (Wang 20181108, SDNU). D: Thallus with
apothecia; E: Apothecium section; F: Ascospores, showing stages of development.
SPECIMENS EXAMINED: CHINA. YUNNAN, Shangri-La, Mt. Tianbao, alt. 3790 m, on
bark, 17 Aug. 2018, Chunxiao Wang 20181131 (SDNU)); alt. 3845 m, on bark, 17 Aug.
2018, Chunxiao Wang 20181108 (SDNU).
Amandinea & Buellia species new to China ... 267
DIsTRIBUTION— Western North America (Rocky Mountains) (Bungartz &
al. 2007). New to China.
CoMMENTS—The protologue describes Buellia penichra as containing
atranorin and sometimes placodiolic acid (Bungartz & al. 2007), but our
specimens contain only atranorin. This species is characterized by the
submuriform spores lacking a perispore and presence of atranorin. Buellia
penichra might be confused with B. muriformis A. Nordin & Tonsberg on
the basis of its ascospores lacking a perispore, but B. muriformis differs in its
secondary chemistry (containing placodiolic acid, atranorin, isousnic acid,
brialmontin 1 and brialmontin 2) and larger (25-39 x 13-18 um) ascospores
(Nordin 1999).
Acknowledgements
The authors thank Dr. John A. Elix (Australian National University, Canberra) and
Dr. Shou-Yu Guo (State Key Laboratory of Mycology, Chinese Academy of Sciences,
Beijing) for guidance in specimen identification and presubmission reviews. We also
thank Shu-Kun Yan and other laboratory members for assistance during this study.
This investigation was supported by the Emergency Management Project of National
Natural Science Foundation of China (31750001), the National Natural Science
Foundation of China (31600100) and the Scientific Research Foundation of Graduate
School of Shandong Normal University (SCX201945).
Literature cited
Blaha J, Mayrhofer H, Elix JA. 2016. Five new saxicolous species of Amandinea (Ascomycota,
Physciaceae) from New Zealand and southern Australia. Australasian Lichenology 79: 35-49.
Bungartz F, Nordin A, Grube U. 2007. Buellia De Not. 113-179, in: TH Nash III & al. (eds).
Lichen Flora of the Greater Sonoran Desert Region, vol. 3. Tempe, Lichens Unlimited,
Arizona State University.
Coppins BJ, Scheidegger C, Aptroot A. 2009. Buellia de Not. (1846). 238-239, in: CW
Smith & al. (eds). The lichens of Great Britain and Ireland. London, British Lichen Society.
https://doi.org/10.1017/S0024282909990521
Elix JA. 2017a. Two new species and new records of buellioid lichens (Caliciaceae, Ascomycota)
from Macquarie Island. Australasian Lichenology 81: 6-11.
Elix JA. 2017b. Three new species and eight new records of saxicolous buellioid lichens (Caliciaceae,
Ascomycota) from New Zealand's Subantarctic Islands. Australasian Lichenology 81: 68-78
Elix JA, Kantvilas G. 2013a. New taxa and new records of Amandinea (Physciaceae, Ascomycota) in
Australia. Australasian Lichenology 72: 3-19.
Elix JA, Kantvilas G. 2013b. New taxa and new records of Buellia sensu lato (Physciaceae,
Ascomycota) in Australia. Australasian Lichenology 73: 24-44.
Elix JA, Kantvilas G. 2016a. Amandinea coniops (Physciaceae, Ascomycota) and its mimics in
Tasmania and New Zealand. Australasian Lichenology 78: 22-31.
Elix JA, Kantvilas G. 2016b. New species and new records of buellioid lichens (Ascomycota,
Physciaceae) in Tasmania. Australasian Lichenology 79: 26-34.
268 ... Zhao, Zhang & al.
Elix JA, Mayrhofer H. 2017. New species and new records of buellioid lichens (Physciaceae,
Ascomycota) from New Zealand. Telopea 20: 75-84. https://doi.org/10.7751/telopea1 1334.
Elix JA, Mayrhofer H. 2018. Three new species and ten new records of buellioid lichens (Ascomycota,
Caliciaceae) from New Zealand. Australasian Lichenology 82: 68-79.
Elix JA, Malcolm WM, Knight A. 2015. New records and new combinations of buellioid lichens
(Physciaceae, Ascomycota) from New Zealand. Australasian Lichenology 77: 36-41.
Elix JA, Kantvilas G, McCarthy PM. 2017a. Thirteen new species and a key to buellioid lichens
(Caliciaceae, Ascomycota) in Australia. Australasian Lichenology 81: 26-67.
Elix JA, Mayrhofer H, McCarthy PM. 2017b. New species and a new record of buellioid lichens
(Physciaceae, Ascomycota) from Australia. Australasian Lichenology 80: 28-37.
Elix JA, Mayrhofer H, Rodriguez JM. 2018. Two new species, a new combination and four new
records of saxicolous buellioid lichens (Ascomycota, Caliciaceae) from southern South America.
Australasian Lichenology 83: 3-13.
Foucard T, Mayrhofer H, Moberg R, Nordin A. 2002. Nordic lichen flora, vol. 2. Svenska Botaniska
Foreningen.
Fryday AM, Arcadia L. 2012. Typification and revised basionym for Fuscidea lygaea, and a new
name for Amandinea lecideina. Graphis Scripta 24(2): 40-44.
Giralt M, Nordin A. 2002. Buellia triseptata in the Iberian Peninsula. Lichenologist 34(2): 89-94.
https://doi.org/10.1006/lich.2002.0375
Giralt M, van den Boom PPG. 2012. Checklist and three new species of lichens and lichenicolous
fungi of the Algarve (Portugal). Sydowia 64(2): 149-208.
Giralt M, van den Boom PPG, Elix JA. 2011. Amandinea myrticola, a new corticolous species from
Portugal. Lichenologist 43(3): 193-197. https://doi.org/10.1017/S0024282911000120
Giralt M, van den Boom PPG, Elix JA. 2015. Amandinea lobarica, a new corticolous species from
Guatemala, with notes on some additional Amandinea taxa. Lichenologist 47(4): 257-268.
https://doi.org/10.1017/S00242829 15000158
Kirk PM, Cannon PF, Minter DW, Stalpers JA (eds). 2008. Dictionary of the fungi, 10th edition.
CAB International, Wallingford.
Kondratyuk SY, Lékés L, Tschabanenko S, Moniri MH, Farkas E, Wang SY, Oh SO, Hur JS. 2013.
New and noteworthy lichen-forming and lichenicolous fungi. Acta Botanica Hungarica
55(3-4): 275-349. https://doi.org/10.1556/abot.55.2013.3-4.9
Kondratyuk SY, Lékés L, Farkas E, Oh SO, Hur, JS. 2015. New and noteworthy lichen-
forming and lichenicolous fungi 3. Acta Botanica Hungarica 57(3-4): 345-382.
https://doi.org/10.1556/034.57.2015.3-4.7
Kondratyuk SY, L6kés L, Halda JP, Upreti DK, Mishra GK, Moniri MH, Farkas E, Park
JS, Lee BG, Liu D, Woo JJ, Jayalal RGU, Oh SO, Hur, JS. 2016. New and noteworthy
lichen-forming and lichenicolous fungi: 5. Acta Botanica Hungarica 58(3-4): 319-396.
https://doi.org/10.1556/abot.58.2016.3-4.7
Lumbsch T, Ahti T, Altermann S, Arup U & al. 2011. One hundred new species of lichenized fungi:
a signature of undiscovered global diversity. Phytotaxa 18(1). 127 p.
Mayrhofer H, Ropin K, Elix JA. 2016. Two new corticolous species of Amandinea (Ascomycota,
Physciaceae) from New Zealand. Australasian Lichenology 78: 11-12.
McCarthy PM. 2018. Checklist of the lichens of Australia and its island territories. Australian
Biological Resources Study, Canberra. Version 17 May 2018.
https://www.anbg.gov.au/abrs/lichenlist/introduction. html
Nordin A. 1999. Buellia species with pluriseptate spores: new and unrecorded species in North
America. Bryologist 102(2): 249-264. https://doi.org/10.2307/3244364
Amandinea & Buellia species new to China ... 269
Nordin A. 2000. Taxonomy and phylogeny of Buellia species with pluriseptate spores
(Lecanorales, Ascomycotina). Symbolae Botanicae Upsalienses 33(1). 117 p.
Orange A, James PW, White FJ. 2010. Microchemical methods for the identification of lichens.
2nd edition. London, British Lichen Society.
Senkardesler A. 2010. Additions and corrections of types in the genus Buellia s. lat. (Physciaceae)
described by J. Steiner. Lichenologist 42(4): 439-448.
https://doi.org/10.1017/S0024282910000241
Tonsberg T, Nordin A, Tibell L. 2012. Amandinea lignicola, a new species from the Pacific coast
of North America. Graphis Scripta 24(2): 60-64.
Wang QD, Liu FY, Wu XH, Zhao X, Jia ZF. 2018. Buellia taishanensis sp. nov. and new Buellia
records from Mt. Tai, China. Mycosystema 133: 165-172. https://doi.org/10.5248/133.165
Watanuki O, Hara K, Harada H, Komine M, Fuji S. 2017. Buellia numerosa and B. subnumerosa,
two new species of the lichen genus Buellia (Caliciaceae) from Japan. Bryologist 120(1):
25-36. https://doi.org/10.1639/0007-2745-120.1.025
Wei JC. 1991. An enumeration of lichens in China. Beijing, International Academic Publishers.
278 p.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 271-273
https://doi.org/10.5248/134.271
Introduction of subfamily names for four clades in
Cladoniaceae and Peltigeraceae (Lecanoromycetes)
H. THORSTEN LUMBSCH! & STEVEN D. LEAVITT?
' Science & Education, The Field Museum,
1400 S Lakeshore Dr, Chicago, IL 60605-2496
? Department of Biology and M.L. Bean Life Science Museum, Brigham Young University,
Provo, UT 84602, USA
* CORRESPONDENCE TO: [email protected]
ABSTRACT—In a recent proposal for a classification of orders and families in
Lecanoromycetidae and Ostropomycetidae based on a temporal approach, Squamarinaceae and
Stereocaulaceae were synonymized with Cladoniaceae, and Lobariaceae and Nephromataceae
with Peltigeraceae. Since these four synonymized families represent easily recognized,
monophyletic lineages and are well-established names, we here propose to accept them at
subfamilial rank, as Lobarioideae, Nephromatoideae, Squamarinoideae, and Stereocauloideae.
Key worps—classification, Lecanorales, Peltigerales, phylogeny, taxonomy
Introduction
Recently we proposed a revised classification of orders and families in the two
major subclasses of Lecanoromycetes, Lecanoromycetidae and Ostropomycetidae
(Kraichak & al. 2018) based on a temporal banding approach (Avise & Johns
1999, Kraichak & al. 2017). This classification proposal differed at the family
level from other recently proposed classifications (Jaklitsch & al. 2016; Lucking
& al. 2016, 2017; Lumbsch & Huhndorf 2010; Wijayawardene & al. 2018) in
accepting some clades at family level (such as Diploschistaceae, Thelotremataceae,
and Varicellariaceae) while synonymizing other clades previously accepted
as families within older families. The latter clades represented monophyletic
lineages but were shown to have diverged more recently than 111-235 Mya,
272 ... Lumbsch & Leavitt
which was the temporal band identified for the family rank. Four of the
families synonymized in Kraichak & al. (2018) have been widely used names,
and, hence, we suggest they should be accepted at subfamily rank. This allows
recognition of these well-established and monophyletic clades while avoiding
confusion due to incomparable ranks of clades.
Below we formally propose new subfamilies for the previously accepted
families Lobariaceae, Nephromataceae, Squamarinaceae, and Stereocaulaceae.
With the description of these subfamilies, Cladonioideae will become an
available name for Cladoniaceae s.str. (i.e., excluding Squamarinoideae and
Stereocauloideae) and Peltigeroideae for Peltigeraceae s.str. (i.e., excluding
Lobarioideae and Nephromatoideae).
Taxonomy
Cladoniaceae Zenker, in Goebel & Kunze, Pharmac. Waarenk. 1(3): 124 (1827).
Squamarinoideae Lumbsch & S.D. Leav., stat. nov.
MB 830561
BASIONYM: Squamarinaceae Hafellner, Beih. Nova Hedwigia 79: 342 (1984).
Stereocauloideae Lumbsch & S.D. Leav., stat. nov.
MB 830562
BASIONYM: Stereocaulaceae Chevall., Fl. Gén. Env. Paris 1: 596 (1826).
Peltigeraceae Dumort., Comment. Bot.: 68 (1822).
Lobarioideae Lumbsch & S.D. Leav., stat. nov.
MB 830563
BastonyM: Lobariaceae Chevall., Fl. Gén. Env. Paris 1: 609 (1826).
Nephromatoideae Lumbsch & S.D. Leav., stat. nov.
MB 830564
BastonyM: Nephromataceae Wetmore ex J.C. David & D. Hawksw.,
Syst. Ascom. 10: 15 (1991).
Acknowledgements
We wish to thank Dr. Brendan Hodkinson (Janssen Research & Development,
Spring House, PA USA) and Dr. Christian Printzen (Senckenberg Research Institute,
Frankfurt/Main, Germany) for reviewing this manuscript.
Literature cited
Avise JC, Johns GC. 1999. Proposal for a standardized temporal scheme of biological classification
for extant species. Proceedings of the National Academy of Science of the United States of
America 96: 7358-7363. https://doi.org/10.1073/pnas.96.13.7358
Cladoniaceae & Peltigeraceae: new subfamilies ... 273
Jaklitsch WM, Baral HO, Liicking R, Lumbsch HT. 2016. Syllabus of plant families —
A. Engler’s Syllabus der Pflanzenfamilien, Part 1/2 Ascomycota. Gebr. Borntraeger
Verlagsbuchhandlung. 322 p.
Kraichak E, Crespo A, Divakar PK, Leavitt SD, Lumbsch HT. 2017. A temporal banding
approach for consistent taxonomic ranking above the species level. Scientific Reports
7:2297 [7 p.]. https://doi.org/10.1038/s41598-017-02477-7
Kraichak E, Huang JP, Nelsen M, Leavitt SD, Lumbsch HT. 2018. A revised classification
of orders and families in the two major subclasses of Lecanoromycetes (Ascomycota)
based on a temporal approach. Botanical Journal of the Linnean Society 188: 233-249.
https://doi.org/10.1093/botlinnean/boy060
Liicking R, Hodkinson BP, Leavitt SD. 2016. The 2016 classification of lichenized fungi in
the Ascomycota and Basidiomycota - approaching one thousand genera. Bryologist 119:
361-416. https://doi.org/10.1639/0007-2745-119.4.361
Liicking R, Hodkinson BP, Leavitt SD. 2017. Corrections and amendments to the 2016
classification of lichenized fungi in the Ascomycota and Basidiomycota. Bryologist 120:
58-69. https://doi.org/10.1639/0007-2745-120.1.058
Lumbsch HT, Huhndorf SM. 2010. Myconet volume 14. Part one. Outline of Ascomycota—2009.
Fieldiana Life and Earth Sciences 1: 1-42. https://doi.org/10.3158/1557.1
Wijayawardene NN, Hyde KD, Lumbsch HT, Liu JK, Maharachchikumbura SSN, Ekanayaka
AH, Tian Q, Phookamsak R. 2018. Outline of Ascomycota: 2017. Fungal Diversity 88:
167-263. https://doi.org/10.1007/s13225-018-0394-8
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 275-279
https://doi.org/10.5248/134.275
Cacumisporium fusiforme sp. nov.
from Jiangxi, China
ZHAO-HUAN XU’, KAI ZHANG}, XIU-GUO ZHANG‘,
RAFAEL FE, CASTANEDA-RUuiIZz, JIAN Ma’?*
' College of Agronomy & Jiangxi Key Laboratory for Conservation & Utilization of Fungal Resources,
Jiangxi Agricultural University, Nanchang, Jiangxi 330045, China
> Department of Landscaping, Shandong Yingcai University, Jinan, 250104, China
‘Department of Plant Pathology, Shandong Agricultural University,
Taian, Shandong 271018, China
° Instituto de Investigaciones Fundamentales en Agricultura Tropical Alejandro de Humboldt
(INIFAT), Académico Titular de la Academia de Ciencias de Cuba,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P. 17200
* CORRESPONDENCE TO: [email protected]; [email protected]
ABSTRACT—A new species, Cacumisporium fusiforme, is described and illustrated from a
specimen collected on dead branches of an unidentified broadleaf tree in Jiangxi, China. The
fungus differs from other described Cacumisporium species in its conidial shape and size.
A key to Cacumisporium species is provided.
KEY worDs—asexual fungi, hyphomycetes, saprobes, taxonomy
Introduction
Cacumisporium Preuss, was established by Preuss (1851) forasingle species
C. tenebrosum Preuss. The genus is diagnosed by differentiated, unbranched,
septate conidiophores and solitary, acropleurogenous, euseptate, pigmented
conidia that secede schizolytically from polyblastic, integrated, terminal,
flattened or inconspicuous denticulate conidiogenous cells after several
holoblastic sympodial elongations on enteroblastic percurrent regenerated
portions of the conidiophores (Goos 1969, Tsui & al. 2001, Castafeda-
Ruiz & al. 2007a,b, Wongsawas & al. 2009, Seifert & al. 2011). Saccardo
276 ... Xu & al.
(1877) recombined C. tenebrosum as Acrothecium tenebrosum (Preuss)
Sacc., but Acrothecium is now treated as an unaccepted genus based on an
unidentifiable type (Hughes 1958, Seifert & al. 2011). In modern literature,
Cacumisporium tenebrosum is treated as a junior synonym of C. capitulatum
(Corda) S. Hughes [= Helminthosporium capitulatum Corda; = Acrothecium
capitulatum (Corda) Ferraris] (Mangenot 1953, Hughes 1958, Sutton 1973,
Seifert & al. 2011). Eight other species have been published in Cacumisporium
(Mercado-Sierra & Castaneda-Ruiz 1987, Castaneda-Ruiz & Kendrick 1991,
Kirk 1992, Tsui & al. 2001, Castafteda-Ruiz & al. 2007a,b, Wongsawas &
al. 2009, Rambelli & Raimondo 2014). However, “C. oceanicum” Rambelli
is invalid (Index Fungorum 2018), and C. curvularioides R.F. Castaneda
& W.B. Kendr. has been synonymised with C. pleuroconidiophorum
(Davydkina & Melnik) R.F. Castafeda & al. (Castafteda-Ruiz & al. 2007a),
leaving Cacumisporium currently with seven valid taxa. The criteria used to
delimit species are based primarily on conidial shape, size, septation, and
pigmentation (Kirk 1992; Tsui & al. 2001; Castafteda-Ruiz & al. 2007a,b;
Wongsawas & al. 2009). A key to Cacumisporium species was provided by
Castafieda-Ruiz & al. (2007b).
The forests of Jiangxi have a rich fungal diversity, and many anamorphic
fungi have been discovered there (Ma & Zhang 2015, Ma & al. 2016, Xu & al.
2017). During an ongoing mycological survey in these forests, an interesting
hyphomycete with morphological features of Cacumisporium was collected
on dead branches. It was found to be distinct from previously described taxa
and is therefore proposed as new to science. The specimens are conserved in
the Herbarium of the Department of Plant Pathology, Jiangxi Agricultural
University, Nanchang, China (HJAUP).
Cacumisporium fusiforme Z.H. Xu, Jian Ma, X.G. Zhang &
R.F. Castaneda, sp. nov. Fic. 1
MB 829269
Differs from Cacumisporium sigmoideum by its smaller, 3(-4)-euseptate, fusiform
conidia with a rounded apex.
Type: China, Jiangxi Province, Jiulianshan National Nature Reserve, on dead branches
of an unidentified broadleaf tree, 3 November 2014, J. Ma (Holotype, HJAUP M0307).
EryMo .oey: refers to the fusiform conidial shape.
CoLonigs on the natural substratum effuse, hairy, brown to dark brown.
Mycelium partly superficial, partly immersed, composed of branched, septate,
smooth, subhyaline to pale brown hyphae. CoONIDIOPHORES macronematous,
Cacumisporium fusiforme sp. nov. (China) ... 277
TT)
UT
TTT
cand a Nh O00
Fic. 1. Cacumisporium fusiforme (holotype, HJAUP M0307).
A-C. Conidiophores, conidiogenous cells, and conidia; D. Conidia.
mononematous, simple, erect, straight or flexuous, smooth, septate, cylindrical,
often with 1-2 enteroblastic percurrent extensions, dark brown at the base,
pale brown or subhyaline at the apex, 73-185 x 4-7 um. CONIDIOGENOUS
CELLS polyblastic, integrated, terminal, sympodial elongated, with flattened
or inconspicuous denticles at the conidiogenous loci, brown, pale brown to
subhyaline, 35-61.5 x 5.5-6.5 um. Conidial secession schizolytic. CONIDIA
solitary, acrogenous, fusiform, occasionally curved, 3(-4)-euseptate, end
cells subhyaline or pale brown to pale yellow, middle cells yellow-brown,
smooth, 23.5-33.5 x 7.5-9 um, apex rounded, base truncate, 2-2.5 um wide,
accumulating in brown, somewhat mucilaginous masses.
COMMENTS —Among Cacumisporium species, C. fusiforme is most similar to
C. sigmoideum Mercado & R.F. Castafieda, which is distinguished by its falcate,
mostly sigmoid, 3-euseptate, larger (26-41 x 7.6-10.2 um) conidia with an
acute apex (Mercado-Sierra & Castaneda-Ruiz 1987).
278 ... Xu & al.
Key to Cacumisporium species
1. Conidia 1-euseptate, versicolorous, ovoid,
S268 1416 MIN tes eo es ead eee eine a eines che a ete ret C. uniseptatum
1. Conidia 3(—4)- or 7-euseptate, botuliform, fusiform, obturbinate,
sigmoid, obovoid to broadly ellipsoid... 2.1 ..s. x eeays vehex seer se ages ees 2
2. Conidia 7-euseptate,
narrowly ellipsoid to somewhat fusiform, 26-32 x (3-)4(-5) um ... C. spooneri
DEA OMICER SS (Se AC UISCDLAUE! <5 We ren tha tl run i, bes Seed a Wo sed We bracdg te See Ma ts erent =a Sree aba drser ath Pee 3
3. Conidia rugose to verrucose,
obovoid to broadly ellipsoid, 28-35 x 14-20 um ................. C. rugosum
Du Ae UNA CIO OMI Tereyors 5S." aan, sual a ge esl gp Seo ok ye em Agee oad gh SOLE sy OL ee SL Lg ae 4
4, Conidia botuliform, 16-22 x 4.5-5um ........ eee eee eee eee C. capitulatum
4. Conidia obturbinate, sigmoid or fusiform, at least 6 um diam. .................. 5
5. Conidia concolorous, broad fusiform, sometimes navicular or
somewhat ellipsoid, 12-17 x 6-8 UM ........ eee eee ee eee C. tropicale
Se GONidiasVersiCOlOe wy oh. 8. 2c bon we ely een Ee eth Reig ee 2 eee ee Ree A 5 8 6
6. Conidia with one swollen cell strongly pigmented,
1s PA Se Gf osates 1G egCbect Sc PAE CRORE ae AOR RN C. pleuroconidiophorum
6. Conidia with two cells strongly pigmented ............. 00. cee eee ee eee eee eee 7
7. Conidia fusiform, 23.5-33.5 x 7.5-9 um, 3(-4)-euseptate,
CUMS REE OLB 0G Cot lez) BT 4g SMe cosine Fae Ral eh pe PE RE Ra ete Ae a C. fusiforme
7. Conidia falcate, mostly sigmoid, 26-41 x 7.6-10.2 tum, 3-euseptate,
MiCLinweloty: (e101 02270) < en Me ee, Ineeeal. eee ceeeeets Sen eR eine C. sigmoideum
Acknowledgments
The authors express gratitude to Dr. D.W. Li (The Connecticut Agricultural
Experiment Station Valley Laboratory, Windsor CT, USA) and Dr. J.S Monteiro (Museu
Paraense Emilio Goeldi, Belém, Brazil) for serving as pre-submission reviewers and to
Dr. Shaun Pennycook for nomenclatural review and Dr. Lorelei L. Norvell for editorial
review. This project was supported by the National Natural Science Foundation of
China (Nos. 31360011, 31870016), and the Education Department of Jiangxi Province
of China (No. GJJ160357).
Literature cited
Castafieda-Ruiz RE, Kendrick B. 1991. Ninety-nine conidial fungi from Cuba and three from
Canada. University of Waterloo Biology Series 35. 132 p.
Castaneda-Ruiz RF, Heredia-Abarca G, Arias RM, Saikawa M, Minter DW, Stadler M. 2007a.
Anamorphic fungi from submerged plant material: Phaeomonilia pleiomorpha, P. corticola and
Cacumisporium pleuroconidiophorum. Mycotaxon 100: 327-336.
Castaneda-Ruiz RF, Gusmao LFP, Guarro J, Stchigel AM. 2007b. Two new anamorphic fungi from
Brazil, Cacumisporium tropicale and Acrodictys irregularis. Mycotaxon 102: 91-99.
Cacumisporium fusiforme sp. nov. (China) ... 279
Hughes SJ. 1958. Revisiones hyphomycetum aliquot cum appendice de nominibus rejiciendis.
Canadian Journal of Botany 36(6): 727-836. https://doi.org/10.1139/b58-067
Index Fungorum. 2018. Fungal names search [accessed 25 December 2018].
http://www.indexfungorum.org/names/Names.asp
Kirk PM. 1992. New or interesting microfungi XVI. Hyphomycetes from the British Isles.
Mycotaxon 43: 231-236.
MaJ, Zhang XG. 2015. A preliminary report of dematiaceous hyphomycetes from dead branches in
Jiangxi Province. Biological Disaster Science 38(4): 290-293.
Ma J, Xia JW, Zhang XG. 2016. Three new species of Hemicorynespora and Solicorynespora from
southern China. Mycotaxon 131: 263-268. https://doi.org/10.5248/131.263
Mangenot F. 1953. Sur quelques hyphales dematiées lignicoles. Revue de Mycologie 18: 133-148.
Mercado-Sierra A, Castafteda-Ruiz RF. 1987. Nuevos o raros Hifomicetes de Cuba. I. Especies de
Cacumisporium, Gueda, Rhinocladium, y Veronaea. Acta Botanica Cubana 50: 1-7.
Preuss CGT. 1851. Uebersicht untersuchter Pilze, besonders aus der Umgegend von Hoyerswerda.
Linnaea 24: 99-153.
Rambelli A, Raimondo FM. 2014. Interesting dematiaceous hyphomycetes on Lodoicea
maldivica dead fragments. Plant Biosystems 148(3): 467-472.
https://doi.org/10.1080/11263504.2013.785449
Saccardo PA. 1877. Fungi italici autographice delineati. Michelia 1(1): 73-100.
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Sutton B. 1973. Hyphomycetes from Manitoba and Saskatchewan, Canada. Mycological Paper
132. 143 p.
Tsui CKM, Goh TK, Hyde KD, Hodgkiss IJ. 2001. New species or records of Cacumisporium,
Helicosporium, Monotosporella and Bahusutrabeeja on submerged wood in Hong Kong
streams. Mycologia 93(2): 389-397. https://doi.org/10.2307/3761660
Wongsawas M, Wang HK, Hyde KD, Lin FC. 2009. Two new hyphomycetes from submerged
wood collected in China. Sydowia 61(2): 345-351.
Xu ZH, Hu DM, Luo YQ, Ma J. 2017. Three species of Linkosia and Spadicoides new to China.
Mycotaxon 132: 243-250. https://doi.org/10.5248/132.243
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 281-287
https://doi.org/10.5248/134.281
Acarospora squamulosa, the correct name for A. peliocypha
KERRY KNUDSEN’ , LINDA IN ARCADIA’, JANA KOCOURKOVA’
* Department of Ecology, Faculty of Environmental Sciences, Czech University of Life Sciences,
Prague, Kamycka 129, Praha 6 - Suchdol, CZ-165 00, Czech Republic
’*Kastri, 22013, Arkadias, Greece
* CORRESPONDENCE TO: [email protected]
ABSTRACT—The epithet of the species widely known as Acarospora “peliscypha” should be
restored to its original orthography, A. peliocypha. The oldest name for this species is Lichen
squamulosus, which has priority. Lichen squamulosus is lectotypified. Acarospora squamulosa
replaces the later name A. peliocypha. Acarospora squamulosa is reported for continental
North America from Baffin Island, Nunavut Territory, Canada.
KEY worpDs—Acarospora rugulosa, nomenclature, priority, taxonomy
Introduction
Although stability in nomenclature is desirable, it is not always achievable.
Improvements in the understanding of taxonomy often necessitate changes in
names, and the molecular revolution has caused, and will continue to cause,
massive changes to the taxonomy of lichenized fungi, with corresponding
changes in names. Another source of instability can be the need to achieve
consensus about names. Consensus is achieved by applying the rules of the
International Code of Nomenclature, as those rules are accepted throughout
the botanical and mycological community, but “consensus” and “stability” come
into conflict in cases where the rules imply that a commonly used name is not
the correct one. In such cases, a judgment must be made about whether to accept
a change in name or to invoke the cumbersome procedure of conservation
to preserve the more familiar usage. In this paper we resurrect the name
Acarospora squamulosa for the species currently known as A. peliocypha, which
282 ... Knudsen, Arcadia, Kocourkova
frequently occurs in the literature as A. “peliscypha’, a misspelling published by
Theodore Fries (1860) based on the orthographic variant Parmelia pelioscypha
listed by Wallroth (1831: 474). The orthographic variants A. peliocypha and
A. pelioscypha are essentially synonyms: the first element from Greek pelios
(meAtoc) means “black; dark,’ and the alternative second elements are either
from scyphos (oxv@oc) meaning “cup” or from cyphos (kv@dc) meaning
“curved; the round of a cup.” Since both variants are authentic, the original
version peliocypha is not a correctable error and must be accepted.
The oldest epithet for this species is Schrader’s squamulosus, which Acharius
and other early 19" century authors accepted as having priority. It is unfortunate
that the later epithet “peliscypha” was taken up following Fries’s work. We do
not consider that conservation would be appropriate in this case. We prefer to
follow the Code of Nomenclature (which seems to us a matter of justice, too)
and resurrect the older epithet.
Material & methods
Specimens from GZU, H, M and the private herbaria of Kocourkova & Knudsen
(hb. K&K) and Jiti Malicek (hb. Mali¢ek) were studied using standard microscopy
and spot tests. Specimens were sectioned by hand and measurements were made
in water. Amyloid reactions of the hymenium were studied in fresh undiluted
Merck Lugol’s solution (IKI) following Knudsen & Kocourkova (2018). The
excellent description by A.H. Magnusson (1929) was revised. Macrophotographs
were taken using an Olympus DP74 digital camera mounted on Olympus SZX
7 stereomicroscope equipped with PRO-SZM1-Focus Drive Motorization for
stacking pictures and stacked using the Olympus DeepFocus 3.4 module. The figure
plates were processed with QuickPhoto Camera 3.2 software fitted with Promicra
Publisher Module and eventually refined with Adobe Photoshop CS4 Extended ver.
Dlg.
Taxonomy
Acarospora squamulosa (Schrad.) Trevis., Rivista Period. Lav. Regia Accad.
Sci. Lett. Arti Padova 1: 263. 1853. Fic. 1
= Lichen squamulosus Schrad., Ann. Bot. (Usteri) 22: 84. 1797.
TYPE: Systematische Sammlung Cryptogamischer Gewachse, Fascicle I, no.
153, Germany. Niedersachsen, Harz, on rocks (lectotype designated here,
M! MBT385224; isolectotypes, GOTE! L!).
= Parmelia squamulosa (Schrad.) Ach., Methodus, sect. post.: 181. 1803.
= Parmelia peliocypha Wahlenb., in Acharius, Methodus, suppl.: 40. 1803.
Type: Norway. Lappland, Nord Cap, on rocks, Wahlenberg s.n. [type not
seen or located].
= Acarospora peliocypha (Wahlenb.) ‘Th. Fr. [as “peliscypha”], Lich. Arct.: 89. 1860.
Acarospora peliocypha a synonym of Acarospora squamulosa ... 283
Fic. 1. Acarospora squamulosa (lectotype, Schrader No. 15, M): A. Subsquamulose imbricate
thallus with apothecia; B. Crustose areolate thallus; C. Detail of apothecia with thalline margin and
rugulose disc. Scale bars: A, B = 1 mm; C = 500 um.
THALLUS of areoles quite variable in size, as small as 0.5 mm and up to 3 mm
diam., 100-500 um thick, broadly attached, becoming sometimes lobulate
and subsquamulose and sometimes imbricate, replicating by division. Upper
284 ... Knudsen, Arcadia, Kocourkova
surface dark to light brown or reddish brown, shiny or matte, epruinose. Lower
surface brown. Epicortex lacking or thin. Cortex 30-50 um thick, upper layer
brown, lower layer hyaline, cells round, 3-5 um diam. Algal layer continuous
to thin and scattered, 50-200 um thick, algal cells 6-15 um diam. Medulla
thickening corresponding with areole size, hyphae thin-walled, 2-3 um diam.
APOTHECIA usually 1 per areole, beginning immersed and (usually)
becoming elevated in a thalline margin or expanding and thus reducing
the areole to a thalline margin (pseudo-lecanorine), <1 mm diam., the disc
epruinose, usually rugulose, usually round. Parathecium expanding around disc
10-30 um without excluding thalline margin, 30-60 um diam. Epihymenium
15-30 um thick, coherent, brown to yellowish brown. Hymenium (including
epihymenium but not accretions on disc surface) 100-120(-130) um tall,
hymenial gel IKI+ blue to red (hemiamyloid). Paraphyses 1.5-2 um diam. at
mid-level, apices unexpanded or expanded <3 um. Asci 70-90 x 16-20 um,
100-200 ascospores per ascus. Ascospores 3-6 x 1-2 um. Subhymenium
25-50 um thick, IKI+ blue (euamyloid). Hypothecium 10-30 um tall. Pycnidia
inconspicuous, ca. 100 x 60 um, ampuliform conidiogenous cells 10-15 um
tall, conidia mostly 2 x 1 um. Gyrophoric acid in cortex, C+, KC+ pinkish red
in thin section, rarely cortical parts lacking a distinct reaction.
SELECTED SPECIMENS EXAMINED: CANADA. Nunavut. Baffin Island, Head of Clyde
Fiord, on gneiss rock below a gyrfalcon nest, July 1950, M.E. Hale Jr. 372 (H). CZECH
REPUBLIC, CENTRAL BOHEMIA, Distr. Rakovnik, Krivoklatsko Protected Landscape
Area, Hracholusky, Certova skdéla Nature Reserve, 49°59’52.535”N, 13°47’27.885’E,
345 m, on top of high outcrop above Berounka River, 14 July 1997, J. Kocourkova 3727
(hb. K&K), Nezabudické skakly nature reserve, 50°1’10.02”N 13°51’2.34’E, 255 m, on
spilite, 11 April 1996, J. Kocourkova 9855 (hb. K&K), Roztoky, Na Babé Nature Reserve,
50°1'50.676”N, 13°52’18.069”E, 290 m, on steep rocky slope above Berounka River, on
rhyolite, 17 June 1997, J. Kocourkova 8471 (hb K&K), Tytovice, Tytov National Nature
Reserve, Tytovické skaly, w-facing rocks above Berounka River, 49°58’59”N 13°47'39’E,
330-420 m, on volcanic rock, 11 Jan. 2018, J. Mali¢ek 12585 (hb Malicek). WESTERN
BoHEMIA. Distr. Plzem-sever, Nectiny, Preitenstein castle ruins, s- to sw-facing
rocks below the castle, 49°57’37”N, 13°09’41”E., 550-580 m, on on spilite basalt, 13
April 2014, J. Malicek 7697 (hb Malicek). FINLAND. JAmsA, Seppola, 21 April 1934,
A. Horkiverr (H); Turku, Ruissalo Kalliolla, on rock, 19 July 1922, V. Rasanen (H);
Kavipja, on rock, 3 June 1908, K. Linkola (H). NORWAY. OppLanp, Ringebu, near
the village, on boulders in stone fence, 28 June 1925, A.H. Magnusson, Lichenes selecti
scandinavici No 67 (H, GZU). SWEDEN. SGDERMANLAND, Flemingsberg parish,
ca. 800 meters S of Masmo and just E of Lake Albysjon, 40 m, on S-facing exposed
siliceous rock, 59°14’30”N 17°52’49”E, 10 April 2009, M. Westberg TU-3 (hb. K&K, 2
specimens). RUSSIAN FEDERATION. KurkyokI! [KuRKIYEK1/Kypxuexu], on schist, 8
August 1935, V. Rasanen (H). ORENBURG REGION, Mednogorsk district, 14 km NE of
Mednogorsk, vicinity of Yumaguzino the 2"¢ village, 51°32’41”N 58°38’50’E, 357 m, on
basalt outcrops, 30 May 2013, A. Paukov (hb. K & K).
Acarospora peliocypha a synonym of Acarospora squamulosa ... 285
ECOLOGY & DISTRIBUTION. Asia, Europe, North America, on various siliceous
rock, on gneiss, rhyolite and basalt including spilite (Magnusson 1929,
Golubkova 1988).
Discussion. Schrader’s exsiccatae Systematische Sammlung Cryptogamischer
Gewachse were published in two fascicles in 1796 and 1797. According to
Sayre (1969), they did not include any descriptive text, although schedae for
each fascicle were published in volumes 20 (1796) and 22 (1797) of Usteri'’s
Annalen der Botanik. According to Stafleu & Cowan (1985), the schedae
were also published in 1796 and 1797 as independent publications. It is not
known therefore, whether the journal contains preprints or reprints, but we
have assumed the former. We have not been able to consult the independent
publications but assume that their text is word-for-word identical with the
journal.
The name Lichen squamulosus was validly published in the journal adjacent
to the number “153”, an unambiguous reference to number 153 in the exsiccata.
The name must therefore be typified on number 153 in the exsiccata. Because
the exsiccata was issued in multiple copies, and we cannot be sure that each
number represents a single gathering, a lectotype should be designated. We
were able to locate only three specimens of number 153, one in the herbarium
of Munich (M), one in Leiden (L), and one in Gottingen (GOET). The
specimen in M is 7 cm in diameter and is designated here as the lectotype, as
it can be easily studied without any damage. The specimen in L is too scanty
for non-destructive microscopic and chemical examination, but does appear to
belong to the same species, and is acceptable as an isolectotype. The specimen
in GOET, which is smaller than the specimen in M and identified by F. Arnold
who also did spot tests, is also an excellent isolectotype.
The lectotype and isolectotypes belong to the species widely known as
either Acarospora “peliscypha” or A. peliocypha. Theodore Fries cited several
names in synonymy, but as they are not validly published, proposed at an infra-
specific rank, or cited with “p.p.” or “?’, his name is legitimate (Fries 1860).
The correct spelling of Fries’s epithet should be peliocypha, because he based
his combination on Parmelia peliocypha Wahlenb., which he miscited as P
“peliscypha.” Acharius (1803) himself considered Parmelia peliocypha to be
merely a synonym of Parmelia squamulosa; but Wahlenberg, who named P.
peliocypha, regarded it as referring to a good species. ICN (Shenzhen) Art. 36.1,
Ex 3 (Turland & al. 2018) supports the name as validly published. We could
not locate Wahlenberg’s collection at BM, H, UPS, or S or in the literature.
Magnusson (1929) did not state that he actually saw Wahlenberg’s specimens,
286 ... Knudsen, Arcadia, Kocourkova
only that Wahlenberg eventually incorporated P. peliocypha “for the most part”
into his concept of Lichen cervinus Wahlenb., which may explain the lack of
annotated peliocypha type material. We choose not to neotypify the name
P. peliocypha, because we believe a type may well be found among Wahlenberg
specimens of L. cervinus. It is also possible the type actually represents the
morphologically similar species currently known as Acarospora rugulosa Korb.
We base our synonymy on the consensus of Acharius (1803), Arnold (1880),
and Magnusson (1929) that Wahlenberg applied P peliocypha to the species
known as L. squamulosus.
As often happened in 19" century, names were often based on one-
line descriptions without examining the types. In this case the name Lichen
squamulosus was misapplied to the species A. macrospora A. Massal. ex Bagl.
(Magnusson 1929). In his discussion of the nomenclature of A. macrospora,
Magnusson stated that L. squamulosus in Schrader’s type was “for the most
part” the species later called Parmelia peliocypha, but he wrote “to not cause
perpetual confusion it is best to let this name sink into oblivion” (Magnusson
1929). It seems fairer that we not propose to conserve the name P. peliocypha
but recognize the nomenclatural priority of Lichen squamulosus and not let it
sink into oblivion. We oppose conservation because E. Acharius, F. Arnold,
and A.H. Magnusson all recognized L. squamulosus as the same species as
P. peliocypha (Acharius 1803, Arnold 1880, Magnusson 1929). Magnusson
arbitrarily decided to accept the name P peliocypha even though he recognized
that the taxon was originally called L. squamulosus.
Acarospora squamulosa is an arctic and montane species in Europe, although
it has been collected at elevations as low as 255 m in the Czech Republic
(Magnusson 1929). Collections have been identified by A.H. Magnusson
from Fennoscandia to Russia in Europe (Magnusson 1929). Golubkova (1988)
reported A. squamulosa in eastern Siberia in Asia, and Magnusson (1929)
reported the species from Greenland in North America. We identified a
specimen from Canada during this study but have seen no other specimens
of A. squamulosa from continental North America. The taxon reported as A.
“peliscypha” from California and the Sonoran region is rare and represents an
undescribed species that needs further study (Knudsen 2007; for picture see
Knudsen & al. 2017).
Acarospora squamulosa can be confused with A. rugulosa [= A. montana
H. Magn.]. Acarospora rugulosa has a higher hymenium (110-)125-140(-175)
uum vs. 100-120(-130) um in A. squamulosa, and phylogenetic analysis supports
A. squamulosa and A. rugulosa as distinct species (Westberg & al. 2015). The
Acarospora peliocypha a synonym of Acarospora squamulosa ... 287
two species can be identified accurately only by hymenium height, as they share
overlapping morphological characters. Acarospora rugulosa is on the North
American lichen checklist (Esslinger 2018) but we have yet to confirm this report.
Acknowledgements
We thank our reviewers, James Lendemer (The New York Botanical Garden,
Bronx, USA) and Andrei Tsurykau (F Skorina Gomel State University, Belarus),
and the curators of GOTE, GZU H, L, and M. We also thank T. Ahti, M. Appelhans,
R. Bijmoer, A. Nordin, C. Schollaard, and H.J.M. Sipman for assistance in locating
isolectotypes. We thank J. McNeill, J. Mali¢ek and A. Tsurykau for their assistance and
the late J.R. Laundon for bringing this problem to our attention. The work of Kerry
Knudsen and Jana Kocourkova was financially supported by the grant Environmental
Aspects of Sustainable Development of Society 42900/1312/3166 from the Faculty of
Environmental Sciences, Czech University of Life Sciences, Prague.
Literature cited
Acharius E. 1803. Methodus qua omnes detectos lichenes. Supplementum. Leipzig. 52 p.
Arnold F, 1880. Lichenologische Fragmente. XXII. Flora (Regensburg) 63: 371-385.
Esslinger TL. 2018. A cumulative checklist for the lichen-forming, lichenicolous and allied fungi
of the continental United States and Canada. Version#22. Opuscula Philolichenum 17: 6-268.
Fries TM. 1860. Lichenes arctoi. Uppsala. 298 p.
Golubkova N. 1988. The lichen family Acarosporaceae Zahlbr. in the U.S.S.R. Leningrad: Nauka.
(In Russian). 136 p.
Knudsen K. 2007. Acarospora. 1-38, in: TH Nash III & al. (eds). Lichen Flora of the Greater
Sonoran Desert Region. Volume 3. Lichens Unlimited, Arizona State University, Tempe.
Knudsen K, Kocourkova J. 2018. Two new calciphytes from Western North America, Acarospora
brucei and Acarospora erratica (Acarosporaceae). Opuscula Philolichenum 17: 342-350.
Knudsen K, Lendemer JC, Schultz M, Kocourkova J, Sheard JW, Pigniola A, Wheeler T. 2017.
Lichen biodiversity and ecology in the San Bernardino and San Jacinto Mountains in southern
California (U.S.A.). Opuscula Philolichenum 16: 15-138.
Magnusson AH. 1929. A monograph of the genus Acarospora. Kungliga Svenska Vetenskaps-
Akademiens Handlingar 7(4). 400 p.
Sayre G. 1969. Cryptogamae exsiccatae: an annotated bibliography of published exsiccatae of Algae,
Lichenes, Hepaticae, and Musci. Memoirs of the New York Botanical Garden 19. 174 p.
Stafleu FA, Cowan RS. 1985. Taxonomic literature, 2nd edition, vol. 5: Sal-Ste. The Hague &
Boston. 1066 p.
Turland NJ, Wiersema JH, Barrie FR, Greuter W, Hawksworth DL, Herendeen PS, Knapp S,
Kusber WH, Li DZ, Marhold K, May TW, McNeill J, Monro AM, Prado J, Price MJ, Smith GF
(eds). 2018. International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code)
adopted by the Nineteenth International Botanical Congress Shenzhen, China, July 2017.
Regnum Vegetabile 159. Glashiitten: Koeltz Botanical Books. 254 p.
Wallroth FG. 1831. Flora cryptogamica germaniae, vol. 1. Filices, lichenastra, muscos et lichenes.
Nuremberg. 654 p.
Westberg, M, Millanes AM, Knudsen K, Wedin M. 2015. Phylogeny of the Acarosporaceae
(Lecanoromycetes, Ascomycota, Fungi) and the evolution of carbonized ascomata. Fungal
Diversity 70: 145-158. https://doi.org/10.1007/s13225-015-0325-x
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 289-294
https://doi.org/10.5248/134.289
Megalaria yunnanensis sp. nov. from Yunnan, China
CHUN-XIAO WANG’, XIAO ZHANG’, CHUAN-FENG ZHENG’, LING Hu?*
'Key Laboratory of Plant Stress Research, College of Life Sciences &
?Institute of Environment and Ecology,
Shandong Normal University, Jinan, 250014, P. R. China
* CORRESPONDENCE TO: [email protected]
ABSTRACT—Megalaria yunnanensis from southern China is described as a new species.
The lichen is diagnosed by its bi-layered exciple, presence of atranorin, zeorin, and
fumarprotocetraric acid in the thallus, ascospore size (20-25 x 5—7.5 um), and the lack of
indentations from the cell lumina into the center of the spore septum.
Key worps —East Asia, Lecanorales, lichenized fungi, Ramalinaceae, taxonomy
Introduction
Megalaria (Ramalinaceae) was erected for the single species M. grossa
(Pers. ex Nyl.) Hafellner (Hafellner 1984). The genus is recognized by its
crustose thallus, biatorine apothecia, greenish to dark purple epihymenium,
(2—)8-spored ascus, Lecanora-, Bacidia-, or Biatora-type asci, and 1-septate,
ellipsoidal to subglobose, colourless, thick-walled ascospores (Ekman &
Tonsberg 1996; Brodo & al. 2001: 428-429; Galloway 2004; Lendemer 2007;
Sanderson 2009; Fryday & Lendemer 2010; McCarthy & Elix 2016; McMullin
& Lendemer 2016).
Megalaria contains about 48 species worldwide (Lendemer & al. 2016,
McMullin & Lendemer 2016, McCarthy & Elix 2016, Su & Ren 2017, Elix &
McCarthy 2018). In China, only two species, M. hainanensis Q. Ren and M.
laureri (Hepp ex Th. Fr.) Hafellner have been reported (Su & Ren 2017). During
our study of the lichen flora of Mt. Wuliang in Jingdong county, Yunnan
province, China, we collected a species of Megalaria new to science.
290 ... Wang & al.
Materials & methods
The specimens were collected in Yunnan Province, China, and are preserved in
Lichen Section of the Botanical Herbarium, Shandong Normal University, Jinan,
China (SDNU). The specimens were examined morphologically using a COIC
XTL7045B2 stereo-microscope and anatomically with an Olympus CX41 polarizing
microscope and photographed under Olympus SZX16 and BX61 with DP72. Thallus
and medulla were tested with K (a 10% aqueous solution of potassium hydroxide),
C (a saturated solution of aqueous sodium hypochlorite) for identification. Lichen
substances were identified using standardized thin layer chromatography techniques
(TLC) with system C (Orange & al. 2001).
Total genomic DNA was extracted with DNeasy Plant Mini Kit according to
the manufacturer’s instructions and purified with PCR quick-spin™ PCR Product
Purification Kit. The ITS1-5.8S-ITS2 regions were amplified in a C1000TM automatic
thermocycler using primers ITS1IF (Gardes & Bruns 1993) and ITS4 (White & al.
1990) in a 50 uL volume containing 5 units of 1 ul Taq DNA Polymerase (Sangon
Biotech), 5 uL ITS buffer, 37.2u] ddH20, 0.8 uL 10 uM F primer solution, 0.8 uL
10 uM R primer solution, 3.2 uL 2.5 mM per dNTP solution, and 2 uL genomic
DNA. PCR thermal cycling parameters were initial denaturation at 98°C for 2 min,
followed by 35 3-step cycles (98°C for 10 s, 54°C for 10 s, 72°C for 1 min), and
a final 5 min extension at 72°C. PCR products were sanger-sequenced by Sangon
Biotechnology Company.
All raw sequences were assembled and edited using SeqMan 7.0. The ITS data
set comprised two newly generated sequences from the holotype and a paratype of
our new species and eight relevant ITS sequences of Megalaria (plus two outgroup
sequences) downloaded from GenBank. The sequences were aligned in MAFFT
version 7 (Katoh & al. 2005) with the parameters set to default values. Ambiguous
regions were excluded using Gblocks (Talavera & Castresana 2007) with default
settings. There were 479 positions total in the final dataset. Maximum likelihood
(ML) was used to reconstruct the phylogenetic tree (Fic. 2). Biatora subduplex
(Nyl.) Printzen and B. meiocarpa (Nyl.) Arnold were used as outgroup (McMullin
& Lendemer 2016). All characters were equally weighted and treated as unordered.
Taxonomy
Megalaria yunnanensis C.X. Wang & L. Hu, sp. nov. Fie. 1
MB 829259
Differs from Megalaria albocincta by its longer ascospores and its lack of indentations
from the cell lumina into the center of the spore septum.
Type: China. Yunnan province, Jingdong county, Mt. Wuliang, 24°24’02”N 100°45’44”E,
alt. 2200 m, on bark, 7 Aug. 2017, R. Tang 20170963 (Holotype, SDNU; GenBank
MK348528).
ErymMo.oey: The specific epithet yunnanensis refers to Yunnan province, where this
species was found.
Megalaria yunnanensis sp. nov. (China) ... 291
Before acid After acid
y | |e
= > |
7 4 ,
ey ai
fanmail : - a - ‘
/ 10 pm | 365nm 2S4am | 365nm ra R
Fic. 1. Megalaria yunnanensis. (Holotype, SDNU (Tang 20170963)). A. Thallus and apothecia;
B. Apothecial section; C. Asci and ascospores; D. Amyloid reaction of ascus, Biatora-type; E.
Ascospores; F. TLC chromatograms (R = Lethariella cladonioides).
THALLUS crustose, verrucose protuberance, corticolous, white, without
soredia. APOTHECIA biatorine, adnate, circular in outline, 0.38-1 mm
diam., margins pale, waxy white, becoming excluded with age; piscs black,
flat, not pruinose, occasionally with few crystals. Epihymenium dark green
to black, 22.5—52.5 um tall, K-, N+ red; hymenium hyaline, 50—67.5 um tall,
K-, N-; subhymenium colourless to red-brown or black, 37.5—50 um tall,
K+ red, N+ red-brown to red; hypothecium black, 25-65 um tall, K-,
N+ red; paraphysis hyaline, simple, easily free, I+ blue. Ascr 8-spored,
45—-62.5 x 11.25-15 um, Biatora-type. Ascosporgs ellipsoid, colourless,
thick walled, 1-septate, not halonate, 20—25 x 5—7.5 um (n = 32). PYCNIDIA
not seen.
CHEMISTRY—Cortex and medulla K+ yellow, C-, KC-; thallus UV-;
atranorin, zeorin, and fumarprotocetraric acid detected by TLC.
ADDITIONAL SPECIMENS EXAMINED: CHINA. YUNNAN, Jingdong, Mt. Wuliang,
24°24’02”N 100°45’44”E, alt. 2200 m, on bark, 7 Aug. 2017, R. Tang 20170805,
292 ... Wang & al.
GenBank MK348527; 20170806; 20170820; 20170838; 20170856; 20170870;
20170896; 20170904; 20170918; 20170923; 20170926; 20170956; 20170962;
20170966 (SDNU).
DIsTRIBUTION—The type specimen was collected from Mt. Wuliang,
Jingdong, Yunnan, which has a subtropical monsoon climate. The average
annual temperature, relative humidity, and rainfall are 18.3°C, 77%, and
108.7 cm. This species grows on bark and is known only from the type
locality.
Discussion
Megalaria yunnanensis is similar to M. albocincta (Degel.) Tonsberg,
M. alligatorensis Lendemer, M. anaglyptica (Kremp.) Fryday & Lendemer, and
M. pulverea (Borrer) Hafellner & E. Schreiner, all of which are characterized
by a bi-layered exciple with a prosoplectenchymatous outer layer and an
inner layer composed of a textura intricata with large intercellular spaces
and a thalline chemistry of atranorin, zeorin, and fumarprotocetraric acid.
However, the other four species are separated from M. yunnanensis by
their shorter or smaller ascospores—M. albocincta: 13-17 x 6.5—8.5 um,
M. alligatorensis: 12-14 x 3.8-5.5 um, M. anaglyptica: 17-22 x 4-6 um,
and M. pulverea: 10—16(—19) x 4.5—6.5 um (Ekman & Tonsberg 1996, Kalb
2007, Sanderson 2009, Lendemer & al. 2016).
Furthermore, M. albocincta has two-sided indentations from the cell
lumina into the center of the spore septum (Ekman & Tonsberg 1996);
M. alligatorensis has a Bacidia-type ascus and greenish-blue thallus that
forms small circular patches (Lendemer & al. 2016); M. anaglyptica has a
thick granular thallus and dirty greyish brown subhymenium (Kalb 2007);
and M. pulverea has a sorediate granular thallus and bigger apothecia
(0.5—2.2 mm diam.; Sanderson 2009).
As shown in Fic. 2, M. yunnanensis is sister to M. pulverea, but the
genetic distance (Kimura 2-parameter model) between these two species is
quite large (0.198—0.207). Interestingly, a sterile sorediate species M. alleniae
Lendemer & McMullin from southeastern North America (McMullin
& Lendemer 2016) is chemically similar to M. yunnanensis, but our new
species obviously differs from M. alleniae morphologically and molecularly
(with a 0.212 genetic distance separating M. alleniae and M. yunnanensis).
Acknowledgements
The authors thank Dr. J.C. Lendemer (Institute of Systematic Botany, New York
Botanical Garden, Bronx, New York, USA) and Dr. Shou- Yu Guo (State Key Laboratory
Megalaria yunnanensis sp. nov. (China) ... 293
MK348527 Megalaria yunnanensis
MK348528 Megalaria yunnanensis [T]
KX660735.1 Megalaria pulverea
FR799227.1 Megalaria pulverea
KX132969.1 Megalaria pulverea
KX660734.1 Megalaria alleniae
AF282074.1 Megalaria grossa
FR799225.1 Megalaria grossa
FR799224.1 Megalaria grossa
FR799226.1 Megalaria grossa
KP314369.1 Biatora subduplex
AM292667.1 Biatora meiocarpa
0. 050
Fic. 2. Molecular phylogenetic tree illustrating the position of Megalaria yunnanensis in
Megalaria s.l. based on ITS sequences. Biatora species were selected as the outgroup. Maximum
likelihood bootstrap support values >50% are shown on nodes.
of Mycology, Institute of Microbiology, CAS, Beijing) for presubmission reviews and
providing great help during the study. We also thank Dr. Alan M. Fryday (Michigan
State University, USA) for providing suggestions and useful literature during the study.
This work was supported by Emergency Management Project of National Natural
Science Foundation of China (31750001), the National Natural Science Foundation of
China (31400015), the National Natural Science Foundation of China Youth Science
Foundation (31600100), and the Scientific Research Foundation of the Graduate
School of Shandong Normal University (SCX201945) .
294 ... Wang & al.
Literature cited
Brodo IM, Sharnoff SD, Sharnoff S. 2001. Lichens of North America. Yale University Press, New
Haven & London. 795 p.
Ekman S, Tonsberg T. 1996. A new species of Megalaria from the North American
West Coast, and notes on the generic circumscription. Bryologist 99: 34-42.
https://doi.org/10.2307/3244435
Elix A, McCarthy M. 2018. Ten new lichen species (Ascomycota) from Australia. Australasian
Lichenology 82: 20-59.
Fryday AM, Lendemer JC. 2010. Reassessment of the genus Catillochroma (lichenized
Ascomycota, Ramalinaceae). Lichenologist 42: 587-600.
https://doi.org/10.1017/S0024282910000320
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes—
application to identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
Galloway DJ. 2004. New lichen taxa and names in the New Zealand mycobiota. New Zealand
Journal of Botany 42: 105-120. https://doi.org/10.1080/0028825X.2004.95 12893
Hafellner J. 1984. Studien in Richtung einer natiirlicheren Gliederung der Sammelfamilien
Lecanoraceae und Lecideaceae. Beihefte zur Nova Hedwigia 79. 241-371.
Kalb K. 2007. New or otherwise interesting lichens. III. Bibliotheca Lichenologica 95: 297-316.
Katoh K, Kuma K, Toh H, Miyata T. 2005. MAFFT version 5: improvement in accuracy of multiple
sequence alignment. Nucleic Acids Research 33: 511-518. https://doi.org/10.1093/nar/gkil98
Lendemer JC. 2007. Megalaria beechingii (lichenized Ascomycota), a new species from eastern
North America. Opuscula Philolichenum 4: 39-44.
Lendemer JC, Harris RC, Ruiz AM. 2016. A review of the lichens of the Dare Regional
Biodiversity Hotspot in the Mid-Atlantic Coastal Plain of North Carolina, eastern North
America. Castanea 81: 1-77. https://doi.org/10.2179/15-073R2
McCarthy M, Elix A. 2016. A new species of Megalaria (lichenized Ascomycota, Ramalinaceae)
from north-eastern Queensland, Australia. Australasian Lichenology 79: 20-25.
McMullin RT, Lendemer JC. 2016. Megalaria allenae [sic] (Ramalinaceae), a new sorediate
species from southeastern North America previously confused with M. pulverea. Bryologist
119(3): 290-297. https://doi.org/10.1639/0007-2745-119.3.290
Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.
British Lichen Society, London. 101 p.
Sanderson NA. 2009. Megalaria. 565-567, in: CW Smith & al. (eds). The Lichens of Great
Britain and Ireland. British Lichen Society, London.
Su QX, Ren Q. 2017. A new species of Megalaria (Ascomycota, Ramalinaceae) and M. laurerinew
to mainland China Phytotaxa 313(1): 147-150. https://doi.org/10.11646/phytotaxa.313.1.13
Talavera G, Castresana J. 2007. Improvement of phylogenies after removing divergent and
ambiguously aligned blocks from protein sequence alignments. Systematic Biology 56:
564-577. https://doi.org/10.1080/10635150701472164
White TJ, Bruns T, Lee S, Taylor JW. 1990. 38-Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis & al. (eds).
PCR Protocols: a Guide to Methods and Applications. San Diego, CA: Academic Press.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 295-300
https://doi.org/10.5248/134.295
The conserved type of Lichen fuscatus [= Acarospora fuscata]
KERRY KNUDSEN’, JIRi MALICEK?, JANA KOCOURKOVA’
* Department of Ecology, Faculty of Environmental Sciences, Czech University of Life Sciences,
Prague, Kamycka 129, Praha 6 - Suchdol, CZ-165 00, Czech Republic
? The Czech Academy of Sciences, Institute of Botany,
Zamek 1, CZ-252 43 Pruhonice, Czech Republic
*CORRESPONDENCE TO: [email protected]
ABSTRACT—The conserved type of Lichen fuscatus, the basionym of Acarospora fuscata, is
described, and two genes, ITS and mrSSU, are made available through GenBank for further
phylogenetic research.
Key worps—Acarospora gallica, A. variegata, nomenclature, taxonomy
Introduction
Acarospora fuscata is the most common species of the genus in Europe
(Magnusson 1929). In crustose lichen communities on siliceous rock, its pale
brown color is distinctive, and it is often collected. But despite A. fuscata being
common, it did not have a designated type or legitimate name (Arcadia & al.
2015). Because the taxon is common and the name A. fuscata is in wide use,
a formal proposal was made to conserve the name Lichen fuscatus Schrad.
(Arcadia & al. 2015) and has been accepted (May 2017). A modern conserved
type that could be sequenced was designated that matched the species concept
of A.H. Magnusson, who did the most extensive study of the species in Europe
(Magnusson 1929). The taxon’s most typical phenotype was collected in central
Europe to serve as conserved type. In this paper, we present a description of
the conserved holotype and isotypes and designate GenBank sequences to aid
in the identification and phylogenetic study of A. fuscata and other Acarospora
taxa containing gyrophoric acid that have been confused with it.
296 ... Knudsen, Mali¢ek, Kocourkova
Material & methods
The description is based only on the conserved holotype and isotypes. Specimens
were studied with standard microscopy. Measurements were made in water. Undiluted
fresh Merck Lugol’s (IKI) was used to test amyloid reactions of thin squashed sections
of apothecia following Knudsen & Kocourkova (2018). Ascus structure was studied
with IKI with or without pretreatment with KOH (Hafellner 1993). Thin-layer
chromatography (TLC) was used to verify the presence of secondary metabolites
(Orange & al. 2001).
DNA was extracted from the holotype (Kocourkova 8499, S) using the Invisorb
Spin Plant Mini Kit. The fungal ITS rDNA and mitochondrial SSU were amplified with
the following primers: ITS1F (Gardes & Bruns 1993) and ITS4 (White & al. 1990), and
mrSSU1 and mrSSU3R (Zoller & al. 1999). PCR reactions of nrITS and mtSSU were
prepared for a 20 ul final volume containing 14 ul double-distilled water, 4 ul MyTaq
polymerase reaction buffer, 0.2 ul MyTaq DNA polymerase, 0.4 tl of each of the 25 mM
primers, and 1 ul of the sample. Amplifications of both loci comprised an initial 1 min
denaturation at 95 °C; 35 cycles of 1 min at 95 °C, 1 min at 56 °C, 1 min at 72 °C; anda
final 7 min extension at 72 °C. The PCR products were visualized on a 0.8% agarose gel
and cleaned with ExoSAP-IT, according to Thermo Fisher Scientific protocols. Both
newly produced sequences, ITS (MK178225) and mrSSU (MK178225), were checked
in BioEdit 7.2.5 (Hall 1999).
Macrophotographs were taken with an Olympus DP74 camera mounted on
an Olympus SZX 7 stereomicroscope equipped with PRO-SZM1-Focus Drive
Motorization for stacking pictures and stacked using the Olympus DeepFocus 3.4
module. The figure plates were processed with QuickPhoto Camera 3.2 software fitted
with Promicra Publisher Module and eventually refined with Adobe Photoshop CS4
Extended ver. 11.0. The type locality picture was taken with Panasonic DMC LX5.
Taxonomy
Acarospora fuscata (Schrad.) Arnold,
Flora 53 (30-31): 469. 1871 [“1870"]. Fic. 1
= Lichen fuscatus Schrad., Spic. Fl. Germ.: 83. 16 Mai-5 Jun 1794, nom. cons. prop.
Type: Czech Republic. West Bohemia, Distr. Tachov, between Mezholezy and Racov,
Prirodni park Sedmihofi (Natural Park), 49°37’53”N 12°51’41”E, 524 m, granite
outcrops in Pinus sylvestris forest, 1 Oct. 2014, J. Kocourkova 8499 & K. Knudsen (S,
conserved holotype, designated in Arcadia & al. 2015; B, FH, KRAM, GZU, H, NY,
PRA, UCR, UPS, conserved isotypes).
THALLUS indeterminate of areoles, often contiguous, occasionally imbricate,
covering areas sometimes more than a meter wide, or dispersed, sometimes
forming lines along fractures in the rock. Areoles irregular in shape, often
lobulate with edges free and often with a black margin, sometimes reduced
to lecanorine-like apothecia, broadly attached to the substrate, replicating
by division, 0.1-3.0 mm wide, up to 1 mm thick. Upper surface pale brown,
Lichen fuscatus conserved ... 297
Fic. 1. Lichen fuscatus (conserved holotype, J. Kocourkova 8499, S): A. Habit of the areolate thallus
with apothecia; B. Marginal sublobate areole with sunken apothecia; C. Detail of areoles with
apothecia. Scale bars: A = 2 mm; B, C = 500 um.
epruinose, matte, smooth. Lower surface light or dark brown, corticate under
the margins, becoming black through melanization. Epicortex thin (<10 um
298 ... Knudsen, Maliéek, Kocourkova
thick) or absent. Cortex 25-50 um thick, upper layer yellow brown, lower layer
hyaline, paraplectenchymatous, with cells 3-5 um diam., perpendicularly
arranged and usually distinct, containing crystals visible in polarized light.
Algal layer 50-100 um thick, uninterrupted by hyphal bundles, with cells
5-12 um diam. Medulla forming a thick mycelial base (gomphate), 0.1-0.8
mm thick, not distinctly stipitate, the outer surface usually carbonized,
medullary hyphae intricate, thin-walled, septate, 3-4 um thick.
APOTHECIA solitary or up to 10 per areole, immersed, punctiform
0.1-0.3 um or expanding <0.6 mm wide, disc round or irregular, reddish-
brown, darker than the thallus, epruinose, smooth or rough. Parathecium
10-20 um diam., not expanding around the disc. Epihymenium 10-15 um
thick, reddish-yellow, coherent. Hymenium (80-—)100-—120(-140) um high,
paraphyses (1.0-)1.5-2.0 um diam. at mid-level, not branching, septate,
often with oil drops, with the apices barely expanded or capitate, 3-5 um
diam., hymenial gel IKI+ red or blue turning red (hemiamyloid). Asci 60-90
x 15-18 um, ascus stain Acarospora-type, ascospores 4.0—5.0 x 1.5-2.0 um,
narrowly ellipsoid to ellipsoid. Subhymenium 30-60 um thick, IKI+ blue
(euamyloid). Hypothecium 10-20 um thick. Pycnidia 100-110 x 60-70 um,
conidiogenous cells ampulliform, conidia 1.0-2.0 x 0.5-1.0 um. Secondary
metabolite: gyrophoric acid in cortex, C+, KC+ pinkish red in thin section.
Sequences available in GenBank: ITS (MK178225) and mrSSU (MK178225).
ECOLOGY & SUBSTRATE— The conserved type was collected at a low (310 m)
elevation in full sunlight in Pinus sylvestris forest, where it covered the tops
of granite outcrops without other associated lichens (Fic. 2)
COMMENTS— Using our description and simple spot tests many specimens
of A. fuscata can now be easily identified. Our description based on the
conserved type does not differ significantly from the descriptions of
Magnusson (1929) or Fletcher & al. (2009), except with respect to hymenium
height. In the type the hymenium measures (80-)100-120(-140) um,
varying 60 um in height depending on apothecial size. Magnusson (1929)
gives a height of (70—)85-100 um, a range of 30 um. The British flora cites
(70—)80-120 um, a range of 50 um (Fletcher & al. 2009).
Nonetheless, Acarospora fuscata exhibits a wide phenotypic variability
in Europe, which led to the description of nine forms and one variety
(Magnusson 1929). Now that we have gene sequences available from the
conserved type of A. fuscata, unusual specimens can be verified with
molecular analyses. Additional sequences can also be made from the
conserved type or matching specimens, so that researchers can finally
Lichen fuscatus conserved ... 299
Fic. 2. Acarospora fuscata type locality in West Bohemia, Czech Republic
establish if A. fuscata is polymorphic or a complex of several semi-cryptic
or cryptic taxa. Candidates for a full genomic study can be selected that
might reveal whether there is horizontal gene transfer with other Acarospora
species. In Europe, the current taxonomic circumscriptions of A. gallica
H. Magn. and A. variegata H. Magn. can also be revised. The British
submontane taxon “A. peliscypha” sensu auct. Brit., included in A. fuscata,
can be analyzed as well as pruinose specimens (Fletcher & al. 2009). The
name A. fuscata, like other old European names, was applied to brown C+
red Acarospora taxa around the world. Additionally, collections from North
America, Australia, or Asia identified as A. fuscata can be revised (Knudsen
2007, McCarthy & Elix 2017, Ohmura & Kashiwadani 2018).
Acknowledgements
We thank our reviewers, Gintaras Kantvilas (Tasmanian Herbarium, Tasmanian
Museum and Art Gallery, Australia) and Andrei Tsurykau (F. Skorina Gomel State
University, Belarus). The work of Kerry Knudsen and Jana Kocourkova was financially
supported by the grant Environmental Aspects of Sustainable Development of Society
(42900/1312/3166) from the Faculty of Environmental Sciences, Czech University of
Life Sciences, Prague. The contribution by Jifi Mali¢ek was supported by the Long-
Term Research Development Project RVO 67985939.
300 ... Knudsen, Malicek, Kocourkova
Literature cited
Arcadia L, Knudsen K, Westberg M. 2015. (2341) Proposal to conserve the name Lichen fuscatus
Schrad. (Acarospora fuscata) against L. fuscatus Lam. with a conserved type (lichenised
Ascomycota: Acarosporaceae). Taxon 64: 168-169. https://doi.org/10.12705/641.7
Fletcher A, James PW, Purvis, OW. 2009. Acarospora A. Massal. (1852). 125-132, in: CW Smith
& al. (eds.) The lichens of Great Britain and Ireland. London: British Lichen Society.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes.
Application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
https://doi.org/10.1111/j.1365-294X.1993.tb00005.x
Hafellner J. 1993. Acarospora und Pleopsidium - zwei lichenisierte Ascomycetengattungen
(Lecanorales) mit zahlreichen Konvergenzen. Nova Hedwigia 56: 281-305.
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.
Knudsen K. 2007 [“2008”]. Acarospora. 1-38, in: TH Nash III & al. (eds). Lichen Flora of the
Greater Sonoran Desert Region. Volume 3. Lichens Unlimited, Arizona State University,
Tempe, Arizona.
Knudsen K, Kocourkova J. 2018. Two new calciphytes from western North America, Acarospora
brucei and Acarospora erratica (Acarosporaceae). Opuscula Philolichenum 17: 342-350.
Magnusson AH. 1929. A monograph of the genus Acarospora. Kungliga Svenska Vetenskaps-
Akademiens Handlingar, ser. 3, 7. 400 p.
May TW. 2017. Report of the Nomenclature Committee for Fungi: 20. Taxon 66: 483-495.
https://doi.org/10.12705/662.15
McCarthy P, Elix JA. 2017. Two new species and a new record of Acarosporaceae (lichenized
Ascomycota) from eastern Australia. Australasian Lichenology 80: 16-27.
Ohmura Y, Kashiwadani H. 2018. Checklist of lichens and allied fungi of Japan. National
Museum of Nature and Science Monographs 49. 140 p.
Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.
London: British Lichen Society. 101 p.
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. 315-322, in: PCR Protocols: a Guide
to Methods and Applications. MA Innes & al. (eds): Academic Press, New York.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Zoller S, Scheidegger C, Sperisen C. 1999. PCR primers for the amplifications of mitochondrial
small subunit ribosomal DNA of lichen-forming Ascomycetes. Lichenologist 31: 511-516.
https://doi.org/10.1006/lich.1999.0220
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 301-305
https://doi.org/10.5248/134.301
Beltraniopsis cyclobalanopsidis sp. nov.
from Guizhou, China
ZHONG-J1U XIAO? , XIAO-XIA Li}, CHANG-HONG CHU °,
TrnG Liu*?, ZHENG-ZHENG Lu’, PEI- YONG SONG’?
"College of Biological & Agricultural Science & Technology &
* College of Resources & Environment,
Zunyi Normal University, Zunyi, Guizhou 563002, China
* Key Laboratory of Regional Characteristics for Conservation & Utilization
of Plant Resource in Chishui River Basin, Zunyi, Guizhou, 563002, China
* CORRESPONDENCE TO: [email protected]
ABSTRACT—A new species, Beltraniopsis cyclobalanopsidis, is described and illustrated from
a specimen collected on dead twigs of Cyclobalanopsis stewardiana |= Quercus stewardiana]
in Guizhou Province, China. The fungus is characterized primarily by its longer, setiform
conidiophores with inflated apexes. A dichotomous key to Beltraniopsis species is provided.
Key worps—anamorphic fungi, lignicolous fungi, taxonomy
Introduction
Batista & Bezerra (1960) erected Beltraniopsis based on the type species,
Beltraniopsis esenbeckiae Bat. & J.L. Bezerra. The genus is characterized by
macronematous, simple or branched setiform conidiophores and polyblastic,
discrete, sympodial extended, denticulate conidiogenous cells with separating
cells that produce solitary, acropleurogenous, aseptate, biconic, smooth, brown
conidia.
Beltraniopsis currently contains ten valid species found as saprobes on rotten
leaves (Matsushima 1971, 1993; Pirozynski 1972; Castafieda-Ruiz & Arnold
1985; Rambelli & Ciccarone 1985; Gusmao & al. 2000; Castafieda Ruiz & al.
2006; Crous & al. 2014; Lin & al. 2017). A survey of saprobic microfungi on
302 ... Xiao & al.
dead twigs from a subtropical forest in Guizhou Province, China, has revealed a
previously undescribed Beltraniopsis species. The specimen is deposited in the
Mycological Herbarium of Zunyi Normal College, Zunyi, China (HMZNC).
Beltraniopsis cyclobalanopsidis Z.J. Xiao & Xiao X. Li, sp. nov. FIG. 1
FN570598
Differs from all other Beltraniopsis species by its longer setiform conidiophores inflated
rather abruptly at the apical cell.
Type: China, Guizhou Province: Xishui National Nature Reserve, saprobic on dead twigs
of Cyclobalanopsis stewardiana (A. Camus) Y.C. Hsu & H.W. Jen [= Quercus stewardiana
A. Camus], 6 Jun. 2018, X.X. Li (Holotype, HMZNC 0450).
ErymMo_oey: Latin, referring to the substrate genus Cyclobalanopsis.
CoLonigs on dead twigs effuse, velutinous, brown to dark brown. Mycelium
partly superficial and immersed in the substrate, composed of branched, septate,
pale brown to brown, cylindrical, smooth-walled hyphae. CoNIDIOPHORES
macronematous, mononematous, setiform, sometimes becoming fertile at the
apex, erect, slightly flexuous, unbranched or mostly branched in the lower-
middle part, thick-walled, cylindrical, 13-25-septate, smooth or sometimes
the lower-middle part with verrucose, arising from flat, radially lobed basal
cells, brown to dark brown at the lower part, pale brown to hyaline at the
upper part, 420-1110 um long, 5.5-7.5 um diam. at the base, tapering to
the upper part, but apical cell inflated rather abruptly, rounded, thin-walled,
hyaline, 2.2-4.5 um diam. CONIDIOGENOUS CELLS polyblastic, mostly discrete
intercalary, sometimes terminal, integrated, located in the lower-middle
part of conidiophores, sympodial extended, 1-3-denticulate apex, smooth,
ampulliform, flask-shaped, pale brown, 9.5-12.5 um long, 5.5-7 um diam. in
the broadest part. SEPARATING CELLS ellipsoidal to ovoid, thin-walled, smooth,
hyaline, denticulate apex, 7-10.5 um long, 4.5-5.5 um diam. in the broadest
part. Conrp1A solitary, biconic to broad navicular, smooth, light brown,
constricted at the supra-equatorial zone with subhyaline transverse band,
29-35 x 5.5-7.5 um, apex rostrate, 0.5-1.5 um wide, base obtuse.
COMMENTS—Based on the synopsis and key to Beltraniopsis species, B. cyclo-
balanopsidis is superficially similar to B. longiconidiophora C.G. Lin & K.D.
Hyde and B. miconiae Gusmao & Grandi. Beltraniopsis longiconidiophora
Fic. 1. Beltraniopsis cyclobalanopsidis (holotype, HMZNC 0450). A. Conidiophores arising
from twig surface; B, C. Conidiophores, conidiogenous cells, separating cells, and conidia;
D. Conidiophore with broken upper part; E. Conidiogenous cells, separating cells, and conidia;
EF. Conidia arising from conidiogenous cells; G. Inflated apex of the conidiophores; H. Conidia.
Beltraniopsis cyclobalanopsidis sp. nov. (China) ... 303
304 ... Xiao & al.
differs from B. cyclobalanopsidis by its shorter setiform conidiophores
(100-680 um) tapering to a pointed apex and by its shorter conidia (18-29 um;
Lin & al. 2017); and B. miconiae differs by its much shorter setiform
conidiophores (77-147 um) with a slightly inflated apical cell (2-3.5 um)
and by its smaller separating cells (6-8 x 3-4.6 um; Gusmao & al. 2000).
Key to Beltraniopsis species
b-Seuuorin coMmdigphoréacuteat the apen s 03! chr oa Macnee s heb wrdldeg parti ath gra Hutt ye dle 2
1. Setiform conidiophore rounded or inflated at the apex ...................0006. 6
Zesetiiorn: conidiophorde-verrucosé: .. 2545.02 44 5a soa sees spare ke B. asperisetifera
De SO LIGEM COMI ATO PMOL STOO HS a: Fe gk accel £2. veal Ep. cect Op incest Ep tace epee EP aoe Es 3
3; Setiform branched-conidiophore apex not fertile ss 24.28 foe ft Bite Binds £08 4
3. setiform unbranchéd:conidiophoreapexfertile os os eae ee ihe 5
AxGonidians=8, piigiiaiit, whan, cet etal ae et ae Bala otto ate B. longiconidiophora
4 Gohidia4-5unr diat. «2% < yee et eget ered cig e ee loce 8 ey nae wy Ig, CRS B. ramosa
Se Gonidia 20=25 KAS60M » «obs. dat nnn eaeatnee gente ened B. esenbeckiae
psConidia 22-28: X 6, 54805 (iy hack tat Aeeiak Malek Mae nt Male coe let ey B. tanzaniensis
6. Setiform conidiophore rounded at the apex ........ 0... cece cece eee eee eee di
6. Setitom conidiophore inflated atthe apexes. lates, satan wee nate + tees oe 9
7. Conidia without rostrum and transverse band ................-..0-- B. aquatica
7. Conidia with rostrum and transverse band ............ 0... cece eee eee eens 8
8. Conidia 30-37 x 9 um, separating cells 4-4.5x 4m ................ B. fabularis
8. Conidia 30-33 x 7-8 um, separating cells 7-10 x 4-6 um _............ B. neolitseae
9. Conidia without rostrum and transverse band ................... B. rhombispora
SsConidia with rostrum and transverse band, « ..k,..12hc Fads cee Soselers Lodesere Peon ee Bakes 10
10. Setiform conidiophore 77-147 um long ............ 0. cece eee B. miconiae
10. Setiform conidiophore 420-1110 um long ................... B. cyclobalanopsidis
Acknowledgments
The authors express gratitude to Dr. R.E Castafeda Ruiz (Alejandro de
Humboldt—INIFAT, Havana, Cuba) and Dr. Jian Ma (Jiangxi Agricultural
University, Nanchang, China) for serving as pre-submission reviewers and for their
valuable comments and suggestions. Dr. Lorelei L. Norvell’s editorial review and
Dr. Shaun Pennycook’s nomenclature review are greatly appreciated. This project
was supported by the National Natural Science Foundation of China (Ne.31600030),
Science and Technology Project of Guizhou Province (NeLKZS[2014]20 and
Ne[2017]1206), Guizhou Provincial Department of Education Foundation
(NEQJHKY[2018]032, NeQJGF[2017]158, Ne[2010]087, NeQSZHZ[2012]146
and NZYRCPYJH[2016]9, Guizhou Science and Technology Cooperation Plan
(No. LH[2015]7031).
Beltraniopsis cyclobalanopsidis sp. nov. (China) ... 305
Literature cited
Batista AC, Bezerra JL. 1960. Beltraniopsis - novo género de fungos dematiaceae. Publicacdes do
Instituto de Micologia da Universidade do Recife 296: 1-13.
Castaneda RF, Arnold GRW. 1985. Deuteromycotina de Cuba. I. Hyphomycetes. Revista del Jardin
Botanico Nacional Universidad de la Habana 6: 47-67.
Castaneda Ruiz RF, Minter DW, Stadler M, Saikawa M, Camino-Vilaré M. 2006. Anamorphic
fungi from submerged leaves in Cuba: Brevicatenospora enteroproliferata gen. et sp. nov. and
Beltraniopsis aquatica sp. nov. Mycotaxon 96: 151-158.
Crous PW, Shivas RG, Quaedvlieg W, et al. 2014. Fungal Planet description sheets: 214-280.
Persoonia 32: 184-306. https://doi.org/10.3767/003158514X682395
Gusmao LFP, Grandi RAP, Milanez AI. 2000. A new species of Beltraniopsis from Brazil, with a key
to the known species. Mycological Research 104: 251-253.
https://doi.org/10.1017/S0953756299001239
Lin CG, Hyde KD, Lumyong S, McKenzie EHC. 2017. Beltrania-like taxa from Thailand.
Cryptogamie, Mycologie 38: 301-319. https://doi.org/10.7872/crym/v38.iss3.2017.301
Matsushima T. 1971. Microfungi of the Solomon Islands and Papua-New Guinea. Published by the
author: Kobe, Japan.
Matsushima T. 1993. Matsushima mycological memoirs no. 7. Published by the author: Kobe,
Japan.
Pirozynski KA. 1972. Microfungi of Tanzania. I. Miscellaneous fungi on oil palm. I. New
hyphomycetes. Mycological Papers 129. 64 p.
Rambelli A, Ciccarone C. 1985. Two new dematiaceous hyphomycetes from humid tropic forest
litter. Giornale Botanico Italiano 119: 291-294. https://doi.org/10.1080/11263508509426684
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 307-312
https://doi.org/10.5248/134.307
Perichaena acetabulifera sp. nov. from Juarez City, Mexico
Marcos LIzARRAGA!', GABRIEL MORENO? , IRAIS FLORES-ROMERO!
" Dpto. Ciencias Quimico Bioldgicas, ICB, Univ. Auténoma de Ciudad Juarez,
Anillo Envolvente Pronaf y Estocolmo s/n, Ciudad Juarez, Chihuahua, México
? Dpto. Ciencias de la Vida (Botanica), Facultad de Ciencias, Univ. de Alcala,
Alcala de Henares, 28805 Madrid, Spain
" CORRESPONDENCE TO: [email protected]
AsBstTRAcT—Perichaena acetabulifera is described as a new species of myxomycete that
fruited profusely in moist chamber cultures on bark samples collected from Populus deltoides
and Ulmus pumila growing in urban areas of Juarez City, Chihuahua, Mexico. Photographs of
its diagnostic macroscopic and microscopic features are provided.
Key worps—Amoebozoa, myxobiota, SEM, taxonomy, Trichiales, Trichiaceae
Introduction
The city of Juarez is located in the northern part of the Mexican state of
Chihuahua, adjacent to El Paso (Texas) and Las Cruces (New Mexico), both in
the United States. The city has an extreme climate, with temperatures ranging
from 25 to 40°C in the summer and -4 to 13°C in the winter. In the spring, it
is frequently lashed by strong winds that reach speeds up to 100 km/h. The
dominant vegetation surrounding the city consists of xerophytic shrubs, with
species of Larrea (Zygophyllaceae), Yucca (Agavaceae), Opuntia (Cactaceae), and
Prosopis (Mimosaceae) as the prominent taxa, while the city interior contains a
large number of ornamental plants in several recreational parks and gardens.
These include species of Cupressus, Thuja, Pinus, Morus, Populus, Fraxinus,
Salix, Melia, Nerium, Vitex, Platanus, Tamarix, Chilopsis, and Quercus. Several
studies are being carried out to determine which myxomycetes develop on the
bark of these urban plants, and the first results were published by Lizarraga &
al. (2015, 2018).
308 ... Lizarraga, Moreno, Flores-Romero
Perichaena Fr. is characterized by its fructifications: sessile, stipitate or
short plasmodiocarps. Generic characters include a simple peridium with
a membranous inner surface and a granular and fragile outer surface that
sometimes is crusted with calcium oxalate. The spores are yellow or reddish
brown. The capillitium, which comprises tubular filaments with irregular or
regular constrictions, is superficially ornamented with warts or spines and
lacks spirals and birefringence (Nannenga-Bremekamp 1991). Although the
absence of spiral-like bands in the capillitium is the most distinctive character
separating Perichaena from Trichia Haller and Oligonema Rostaf., some species
lacking a capillitium are placed within Perichaena, including P. heterospinispora
Novozh. & al. (Novozhilov & al. 2008), P. taimyriensis Novozh. & Schnittler
(Novozhilov & Schnittler 2001), B pachyderma D.W. Mitch. & al. (Mitchell &
al. 2011), and Perichaena nigra D. Wrigley & al. (Lado & al. 2014).
According to Lado (2018), 34 species are currently recognized worldwide, of
which 13 have been recorded for Mexico (Moreno & al. 2007, Estrada-Torres &
al. 2009, Rojas & al. 2010, Mitchell & al. 2011, Lizarraga & al. 2016).
Materials & methods
Samples for light microscopy were mounted in Hoyer’s medium. Macroscopic
photographs were taken with a Nikon SM2800 microscope, micrographs were
obtained with a Nikon Eclipse 2000 microscope, and SEM micrographs were taken
with a Zeiss DSM-950 microscope after critical point drying and sputtering, following
Moreno & al. (2015). The specimens are stored in the Herbarium, Universidad de
Alcala, Madrid, Spain (AH) and the Herbarium, Instituto de Ciencias Biomédicas,
Universidad Autonoma de Ciudad Juarez, Chihuahua, México (UACJ). Nomenclature
follows Lado (2018).
Taxonomy
Perichaena acetabulifera Lizarraga, G. Moreno & Flores-Rom., sp.nov. — PLATE 1
MB 829449
Differs from Perichaena vermicularis by its peridial inner surface and capillitium
producing ocelli and craters.
Type. Mexico: Chihuahua, Juarez City, Biomedic Science Institute (Spanish acronym:
ICB), on bark of Ulmus pumila L., placed into moist chamber 19-VIII-2015, obtained
22-IX-2015, leg. I. Flores-Romero & M. Lizarraga (Holotype, AH 49096; isotype, UACJ
2789).
Erymo oey: acetabulifera from the Latin acetabulum, referring to a shallow concave
vessel used as a cruet (and therefore the name given by Plinio to the suckers of an
octopus) and fer/fero meaning to carry. The name draws attention to the resemblance of
the capillitium and internally ornamented peridium to the suckers of octopus tentacles.
Perichaena acetabulifera sp. nov. (Mexico) ... 309
PLATE 1 Perichaena acetabulifera (holotype, AH 49096): 1. Fructifications; 2. Detail of fructifications;
3-5. Capillitium by LM; 6. Spores; 7. Detail of the inner surfaces of peridium by SEM; 8-10. Detail
of capillitium with craters by SEM; 11-12. Spores by SEM; 13. Detail of spore ornamentation by
SEM. Scale bars: 1, 2 = 1 mm; 3-6 = 10 um; 7-12 = 2 um; 13 = 1 um.
310 ... Lizarraga, Moreno, Flores-Romero
FRUCTIFICATIONS scattered to gregarious, sessile, occasionally substipitate,
globose, subglobose to short plasmodiocarpic, in this case somewhat
sinuous, occasionally centrally depressed, to 0.8-1.5 x 0.2-0.6 mm. Stipe
absent, occasionally with a blackish-brown small base up to 0.1 mm total
height. PERrp1uM simple, membranous, olivaceous yellow, inner part with
papillae and small crests and craters that project over the surface. The
outer surface granulose with deposits of amorphous material, brownish to
olivaceous brown. HyPOTHALLUS absent or barely noticeable. CAPILLITIUM
2-6 um in diam., somewhat abundant in the sample studied, formed by
filaments with irregular edges, branched, with ocellus-like structures and
craters, giving it a pitted appearance under OM. By SEM a capillitium
lacking spines and reticulum can be observed, with rare and minute
warts, and isolated small ocelli and craters of variable size, <2.5 um in
diam., resembling the suckers of an octopus. Spores 11-14(-16) um in
diam., ochraceous in mass, yellowish ochre by OM, globose, subglobose to
oval, with a paler area, with sparse and irregular warts. By SEM the spore
ornamentation is formed by warts with a flattened apex or bacula, unevenly
distributed over the surface.
OTHER MATERIAL EXAMINED: MEXICO. CHIHUAHUA, Juarez City: Federal Public
Park El Chamizal, on the bark of Ulmus pumila, placed into moist chamber 18-VIII-
2015, obtained 29-IX-2015, leg. I. Flores-Romero & M. Lizarraga (UAC] 2827); on
bark of Populus deltoides Marshall, placedinto moist chamber 16—VIII-2016, obtained
30-VIII-2016 (UACJ 3317); obtained 20-IX-—2016 (UAC]J 3318, AH 49095); obtained
27-IX-2016 (UACJ 3319); obtained 17—X—2016 (UACJ 3320, AH 49100; UAC] 3321)
obtained 18—X-2016 (UACJ 3322); obtained 31—X-—2016 (UACJ 3323); obtained
10—XI-2016( UAC] 3324); obtained 1 1—XI-2016 (UAC] 3325); obtained 10—XII-2016
(UAC] 3326). Institutes of Engineering, Technology, Architecture, Art and Design
(IIT-IADA), on bark of Ulmus pumila, placed into moist chamber 19-VIII-2016,
obtained 14—X-2016, leg. I. Flores-Romero & M. Lizarraga (UAC] 3327; UACJ 3328).
Institute of Biomedical Sciences, on bark of Ulmus pumila, placed into moist chamber
19-VIII-2015, obtained 14-IX-2015, leg. I. Flores-Romero & M. Lizarraga (UACJ
2717); obtained 21-IX-2015 (UACJ 2773); obtained 22-IX-2015 (UACJ 2790, AH
49097); Populus deltoides, obtained 22—XI-2016, leg. I. Flores-Romero & M. Lizarraga
(UAC) 3329, AH 49099); obtained 6—-IX-2017 (UACJ 3307); obtained 13-IX-2017
(UACJ 3330); placed into moist chamber 9-IV-2018, obtaining fructifications
23-IV-2018 (UACJ 3063, AH 49098).
OBSERVATIONS—Perichaena acetabulifera is characterized by its sporocarpic
to plasmodiocarpic fructifications and especially by its papillate peridium
with isolated ocelli and craters, and a capillitium also with ocelli and craters,
with rare warts visible only by SEM. The morphologically closest species are
described below.
Perichaena acetabulifera sp. nov. (Mexico) ... 311
Perichaena vermicularis (Schwein.) Rostaf. is similar to the new species in
its plasmodiocarpic fructifications, spore measurements, and the presence
of papillae on the inner peridial and capillitial surfaces (Rammeloo 1981),
but it lacks the ocelli and craters found in the new species.
Perichaena areolata Rammeloo is a foliicolous species with short
sporothecae and craters and ocelli in the capillitium, similar to the new
species. However, it can be separated its spherical areolated sporothecae,
inner peridial surface lacking craters and ocelli (Rammeloo 1981), and its
capillitium ornamented by spines or small appendixes.
Perichaena poronema Yu Li & H.Z. Li is distinguished by its globose
sporothecae that are sometimes pulvinate, its circumscissile dehiscence by
a definite preformed lid, its minutely warted and incompletely reticulated
capillitium that is occasionally covered with holes, and small (8.75-9.5 um
in diam.) spores (Li & al. 1990).
Perichaena stipitata Lado & al. is a succulenticolous species that shares
with P. acetabulifera the presence of craters or ocelli on the inner peridium,
but which can be distinguished by its stalked fructifications and an inner
peridium lacking papillae and crests but with dense ocelli and craters.
Moreover, the capillitium has holes but lacks craters and ocelli.
Acknowledgements
We wish to express our gratitude to A. Priego and J.A. Pérez (Electron Microscopy
Service, University of Alcala) for their invaluable help in producing the SEM
images. We also thank Luis Monje and A. Pueblas (Department of Drawing and
Scientific Photography, Alcala University) for their help in the digital preparation
of the photographs, and we are grateful to J. Rejos, curator of the AH herbarium,
for his assistance with the examined specimens in the present study. We want to
express our gratitude to S.L. Stephenson (University of Arkansas, Fayetteville, USA)
and M.M. Dios (Universidad Nacional de Catamarca, Argentina) for reviewing
this manuscript. We also thank Shaun Pennycook and Luis Parra for their help
in choosing the specific epithet and D. Lépez-Pefia and H. Singer for their help
with the manuscript translation. M. Lizarraga extends his thanks to Antonio de la
Mora Covarrubias and Alberto Constance (DCQB-ICB, Universidad Autonoma of
Ciudad Juarez) for their economic support. I. Flores-Romero thanks CONACYT
for the scholarship given to carry out her master’s studies.
Literature cited
Estrada-Torres A, Wrigley de Basanta D, Conde E, Lado C. 2009. Myxomycetes associated with
dry land ecosystems of the Tehuacan-Cuicatlan Valley Biosphere Reserve, Mexico. Fungal
Diversity 36: 17-56.
312 ... Lizdrraga, Moreno, Flores-Romero
Lado C. (2018) An online nomenclatural information system of Eumycetozoa. Real Jardin
Botanico, CSIC. Madrid, Spain. Available from: http://www.nomen.eumycetozoa.com
(accessed 14 June 2018)
Lado C, Wrigley de Basanta D, Estrada-Torres A, Garcia-Carvajal E. 2014. Myxomycete diversity
of the Patagonian Steppe and bordering areas in Argentina. Anales del Jardin Botanico
de Madrid 71(1): e006 [35 p.]. https://doi.org/10.3989/ajbm.2394
Li Y, Li HZ, Wang Q, Chen S. 1990. Myxomycetes from China VII: new species and new records
of Trichiaceae. Mycosystema 3: 93-98.
Lizarraga M, Moreno G, Escobar-Zapata S. 2015. Myxomycetes del area urbana de Ciudad
Juarez, Chihuahua, México. Boletin de la Sociedad Micolégica de Madrid 39: 83-92.
Lizarraga M, Moreno G, Esqueda M. 2016. New records of myxomycetes from México.
Mycotaxon 131: 511-520. https://doi-org/10.5248/131.511
Lizarraga M, Moreno G, Flores-Romero I, Jiménez-Vega FE. 2018. A new species of Physarum
(Myxomycetes) from Chihuahua, Mexico. Boletin de la Sociedad Micoldgica de Madrid
42: 21-26.
Mitchell DW, Moreno G, Lizarraga M. 2011. A new species of coprophilous Perichaena from
New Mexico. Boletin de la Sociedad Micoldgica de Madrid 35: 103-108.
Moreno G, Lizarraga M, Illana C. 2007. Catalogo de los myxomycetes de México. Boletin de la
Sociedad Micoldgica de Madrid 31: 187-229.
Moreno G, Castillo A, Deschamps JR, Giménez G, Hladki A, Lopez- Villalba A. 2015. Critical
revision of some myxomycetes deposited in the Buenos Aires Herbaria BAFC, BA and the
Tucuman Herbarium LIL. IV. Boletin de la Sociedad Micoldgica de Madrid 39: 129-140.
Nannenga-Bremekamp NE. 1991. A guide to temperate myxomycetes. Biopress Limited, Bristol,
England. 409 p.
Novozhilov YK, Schnittler M. 2001. A new coprophilous species of Perichaena (Myxomycetes)
from the Russian Arctic (the Taimyr Peninsula and the Chukchi Peninsula). Karstenia 40:
117-122. https://doi.org/10.29203/ka.2000.360
Novozhilov YK, Zemlyanskaya IV, Schnittler M, Stephenson SL. 2008. Two new species of
Perichaena (Myxomycetes) from arid areas of Russia and Kazakhstan. Mycologia 100(5):
816-822. https://doi.org/10.3852/08-047
Rammeloo J. 1981. Flore illustrée des champignon d’Afrique centrale. Trichiales (Myxomycetes).
Fascs. 8-9. Ministére de Agriculture, Meise; Jardin Botanique National de Belgique.
Rojas C, Stephenson SL, Estrada-Torres A, Valverde R, Morales O. 2010. New records of
myxomycetes from high-elevation areas of Mexico and Guatemala. Mycosphere 1: 73-82.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 313-319
https://doi.org/10.5248/134.313
Gliocladiopsis wuhanensis sp. nov. from China
N1-PING ZHAI, ZI-QUAN SUN, YA-LONG ZHANG, RUI ZANG,
CHAO Xu, YUE-Hua GENG’, MENG ZHANG’
College of Plant Protection, Henan Agricultural University,
95 Wenhua Street, Zhengzhou, Henan 450000, China
* CORRESPONDENCE TO: [email protected], [email protected]
ABSTRACT—A new species, Gliocladiopsis wuhanensis, was isolated from soil collected
in Hubei Province, China. A combination of ITS, HIS3, and TUB2 DNA sequences were
analyzed to evaluate its phylogenetic status. Phylogenetically G. wuhanensis is closely related
to G. guangdongensis. Morphologically, G. wuhanensis can be distinguished from related
species by its tertiary conidiophore branching.
KEY worps—asexual fungi, hyphomycetes, multiple gene, subtropics, taxonomy
Introduction
Gliocladiopsis S.B. Saksena was established with the type G. sagariensis
S.B. Saksena, characterized by densely penicillate and branched conidiophores
(Saksena 1954, Lombard & al. 2015). Crous & Wingfield (1993) synonymized
the type species under G. tenuis (Bugnic.) Crous & M.J. Wingf. based on
morphological studies; however, accurate identification of the Gliocladiopsis
species based on morphology alone is difficult (Liu & Cai 2013). Through
analyzing the ITS, TUB2, His3, 28S LSU, and TEFl-a DNA loci, Lombard
& Crous (2012) found G. sagariensis and G. tenuis phylogenetically distinct
and described five new species. Although its teleomorph was described as
Glionectria Crous & C.L. Schoch (Schoch & al. 2000), the “anamorphic” name
Gliocladiopsis has nomenclatural priority and is now the accepted generic name
under “One Fungus: One Name”. Gliocladiopsis currently comprises 14 species
(Index Fungorum 2018) mostly soilborne (Lombard & al. 2015) except for
314 ... Zhai & al.
G. guangdongensis F. Liu & L. Cai (Liu & Cai 2013) and G. aquaticus Y.Z. Lu &
al. (Hyde & al. 2018) isolated from decaying wood in freshwater.
Materials & methods
Isolation
Soil samples from different regions were investigated using a dilution plate
method: sterilized water agar medium cooled to 45 °C was mixed with 100
uL ampicillin sodium (100 ng/uL), and poured into a sterile plate with sterile
wheat-straw.; for each soil sample, three plates were evenly coated with a 200 uL
soil suspension diluted 100 times, incubated ca. 3 wks at 25 °C in a biochemical
incubator, and observed under stereomicroscope. Single spores were selected and
transferred to PDA and synthetic nutrient-poor agar (SNA) (Nirenburg 1981) to
obtain pure cultures. The fungi were examined morphologically on slides prepared
with lactic acid glycerin. Measurements and descriptions of microscopic structures
were made using a Nikon Eclipse 80i light microscope. One isolate was identified
as representing Gliocladiopsis, from which more than 30 conidiogenous cells and
30 conidia were randomly selected for measurement. A dried culture specimen and
living cultures were deposited in the Herbarium of Henan Agricultural University,
Zhengzhou, China (HEAC).
DNA extraction, PCR amplification & sequencing
Total genomic DNA was extracted from fresh mycelia using the CTAB method
(Doyle & Doyle 1990). PCR amplification primers used were: ITS region—universal
primers ITS1 and ITS4 (White & al. 1990); partial 6-tubulin gene—T1 (O’Donnell
& Cigelnik 1997) and CYLTUBIR (Crous & al. 2004); partial Histone H3 gene—
CYLH3F and CYLH3R (Crous & al. 2004). The DNA was amplified using 20 uL
volumes containing 1 wL 50 ng/uL genomic DNA, 1 uL each of 10 uM primers, 10
uL Premix Ex Taq (Version 2.0, TaKaRa, containing 0.625 U DNA polymerase, 200
mM dNTP, and 1.5 mM Mg”*), and 7 uL ddH,O. The amplification protocol in an
Eppendorf Mastercycler gradient thermal cycler followed an initial denaturation
step of 5 min at 94 °C with 35 cycles of 45 s at 94 °C, 30 s at 58 °C, and 1min at
72 °C and a final elongation step of 10 min at 72 °C concluding with incubation at
4 °C. PCR products were examined on 1% agarose gel and sequenced on an ABI
3730XL automated DNA Analyzer by Sangon Biotech (Shanghai) Co, Ltd.
Sequence alignment & phylogenetic analyses
DNA sequences generated by each primer set were emended using SeqMan
v. 7.1.0 in the DNASTAR Lasergene core suite software. Sequences were aligned
and edited manually using MEGA v6.0 (Tamura & al. 2013) and then blasted in
GenBank. Gene sequences of 39 strains were downloaded from NCBI, including the
outgroup Calonectria brachiatica (CBS 123700) and C. brassicae (CBS 111869). The
Bayesian Inference (BI) phylogenetic tree generated with MrBayes v.3.1.2 with the
Gliocladiopsis wuhanensis sp. nov. (China) ... 315
Markov Chain Monte Carlo (MCMC) consisted of 4 runs (Ronquist & Huelsenbeck
2003), with each run analyzing 4 chains analyzed with 10 million generations (trees
sampled every 1000 generations, a sample frequency of 100, stopping when average
standard deviation of split frequencies reached below <0.01, and a burn-in of 25%
(Huelsenbeck & Ronquist 2001; Ronquist & Huelsenbeck 2003). Trees were viewed
in FigTree v. 4.0, then modified using Adobe Illustrator CS6 and saved in Adobe
Photoshop in JPG format. Newly generated sequences were deposited in GenBank.
g710.78f0- curvata CBS 111194 (JQ666122/ JQ666012 / JQ666050)
eolieG. curvata CBS 112935 (JQ666127 / JQ666017 / JQ666051)
-10.8-—G. curvata CBS 112365 (JQ666126/ JQ666016 / JQ666050)
G. curvata CBS 110840 (JQ666121 / JQ666011 / JQ666045)
10.98) G. forsbergii BRIP 60984 (KX274036/KX274053 / KX274070)
69/0.9814G. forsbergii BRIP 61349a (KX274037 / KX274054 | KX274071)
62/0.80,¢G. whileyi BRIP 64430 (KX274052/ KX274069 / KX274086)
ovyG. guangdongensis LC1340 (KC7776124/ KC776120/ KC776122)
seit} 'G. guangdongensis LC1349 (KC7776125/ KC776121 | KC776123)
| LG. wuhanensis HEAC17307 (MH169602 / MH255786 / MH024520)
G. pseudotenuis CBS 114763 (JQ666139 /JQ666029 / JQ666062)
9aLG. pseudotenuis CBS 116074 (JQ666140 / JQ666030 / AF220981)
. peggii BRIP 54049 (JN243766/ JN243767 / JN243765)
10.60 G. peggii BRIP 60983 (KX274038 / KX274065 / KX274083)
a G. peggii BRIP 63709b (KX274046 / KX274056 / KX274073)
1)4/0.97,G. peggii BRIP 60987 (KX274040 / KX274062 / KX274074)
40.6G. peggii BRIP 60988 (KX274043 / KX274063 / KX274082)
G. mexicana CBS 110938 (JQ666137 / JQ666027 / JQ666060)
100nlG. mexicana CBS 111131 (JQ666138/ JQ666028 / JQ666061)
9010-75] 1G. irregularis CBS 111142 (0666124 / JQ666024 / JQ666057)
gaiif O- irregularis CBS 111176 (JQ666135 / JQ666025 / JQ666058)
G. irregularis CBS 114667 (JQ666136 / JQ666026 / JQ666059)
a G. irregularis CBS 755.97 (JQ666133 / JQ666023 / AF220977)
7110.85 ] ,G. sumatrensis CBS 111198 (10666143 / JQ666033 / JQ666065)
gti [4 | G. sumatrensis CBS 111213 (JQ666144 / JQ666034 / JQ666066)
9710.73} go] FG. Sumatrensis CBS 111368 (JQ666145 / JQ666035 / AF220978)
G. sumatrensis CBS 754.97 (JQ666142/ JQ666032 / JQ666064)
G. indonesiensis CBS 116090 (JQ666132/ JQ666022 / JQ666056)
G. tenuis CBS 111961 (JQ666146 / JQ666036 / JQ666067)
G. tenuis CBS 111964 (JQ666147 / JQ666037 / JQ666068)
100 1G. tenuis CBS 114147 (J666148 / 0666038 / JQ666069)
G. tenuis CBS 114148 (JQ666149/ JQ666039 / JQ666070)
7110.9 G. tenuis IMI 68205 (JQ666150/ JQ666040 / AF220979)
Gliocladiopsis sp. 1 CBS 111038 (JQ666151 / JQ666041 / JQ666071)
sor S: elghollii CBS 116104 (JQ666131 / JQ666021 / JQ666055)
se] 1G. elghollii CBS 206 94 (JQ666130 / JQ666020 / JQ666054)
100! G. sagariensis CBS 199 55 (JQ666141 / JQ666031 / JQ666063)
G. aquaticus MFLUCC 17-1841 (MG574421 | MG734182/ MG543924)
gaitG. aquaticus MFLUCC 17-2028 (MG574422 / MG734183 / MG543925)
1001 Calonectria brassicaeCBS 111869 (AF232857 / DQ190720 / GQ280576)
Calonectria brachiaticaCBS 123700 (FJ696388 / FJ696396 (GQ280555)
8710.97
0.04
Fic. 1. Maximum-likelihood (ML) Gliocladiopsis tree obtained from the combined DNA sequence
data from three loci (internal transcribed spacer region, histone H3, and f-tubulin). Calonectria
brachiatica (CBS 123700) and C. brassicae (CBS 111869) were included as the outgroup. Bootstrap
support values >50 %, and Bayesian posterior probability values >0.95, are shown at the nodes
(BS/PP). Branches supported by BS = 100 % and PP = 1 are depicted as black thickened lines.
Ex-type strains are in bold.
316... Zhai & al.
Phylogenetic results
Amplicons of approximately 400-600 base pairs were determined for
TUB2 (489 bp), HIS3 (477 bp), and ITS (461 bp). The phylogenetic analysis
comprised 15 ingroup and two outgroup [Calonectria brachiatica (CBS
123700), C. brassicae (CBS 111869)] taxa. The combined data set comprised
1427 characters, including 35 gaps and 775 constant characters. Analysis
of the 305 parsimony-informative characters yielded one tree (Fic. 1).
GTR+I+G was the model selected for Bayesian analysis and Maximum
Likelihood (ML). The tree (Fic. 1) divides Gliocladiopsis isolates into two
main clades, the first (PP = 1) containing the extype G. sagariensis strain
(CBS 199.55), two G. elghollii strains (CBS 206.94, CBS 116104), and two
G. aquaticus strains (MFLUCC 17-1811, MFLUCC 17-2028), and the second
(PP = 0.73) containing the other 12 Gliocladiopsis species: (G. curvata,
G. forsbergii, G. guangdongensis, G. indonesiensis, G. irregularis, G. mexicana,
G. peggii, G. pseudotenuis, G. sumatrensis, G. tenuis, G. whileyi, and
G. wuhanensis.) on the main branch.
Taxonomy
Gliocladiopsis wuhanensis Meng Zhang, N.P. Zhai & Y.H. Geng, sp. nov. FIG. 2
MB 825569
Differs from Gliocladiopsis guangdongensis, G. curvata, G. forsbergii, and G. whileyi by its
tertiary conidiophore branching and its longer conidia.
Type: China, Hubei Province, Wuhan, from potato farm soil, 15 Jul. 2017, Niping Zhai
(Holotype, HEAC17056 [dried culture]; ex-type living culture, HEAC17307; GenBank
MH024520, MH169602, MH255786).
EryMoLoey: wuhanensis, referring to the city where the type was collected.
CoLonlgs on the SNA effuse, velvet or powdery, whitish to yellow, reverse
green, reaching 6 cm diam. in two wks at 25 °C; mycelium mostly superficial
or immersed, hyphae smooth, septate, branched, hyaline, 1.0-5 um.
CONIDIOPHORES penicillate, without stipe extensions and terminal vesicles,
pale brown, smooth, primary branches aseptate or 1-septate, 13.0-38.5 x
2.0-4.5 um; secondary branches aseptate, 9.5-30.5 x 2.0-4.5 um; tertiary
branchesaseptate, 2.5-13.0 x 1.0-2.5um. CONIDIOGENOUS CELLS polyblastic,
hyaline to light brown, 13.0-37.5 x 2.0-3.5 um. ConipIA single, smooth,
hyaline, cylindrical, straight or slightly curved, 0-1-septate, 13.5-18.5 x
2.0-2.5 um. TELEOMORPH unknown.
Gliocladiopsis wuhanensis sp. nov. (China) ... 317
Fic. 2. Gliocladiopsis wuhanensis (ex-type culture). A, B. Sporulation phenotype on PDA after 10 d;
C, D. Colonies on SNA after 10 d (C = top view, D = reverse view); E-I, K. Penicillate conidiophores;
J, L, M. Conidia. Scale bars = 10 um.
Discussion
Gliocladiopsis wuhanensis is morphologically similar to G. guangdongensis,
G. curvata L. Lombard & Crous, G. forsbergii L.E. Parkinson & al., and
G. whileyi L.E. Parkinson & al. However, G. guangdongensis differs by its
binary conidiophore branching and its shorter conidia (13.5-16 um; Liu &
Cai 2013); G. curvata differs by its quaternary conidiophore branching and
its shorter, wider conidia (17-21 x 3-5 um; Lombard & Crous 2012), and
G. forsbergii and G. whileyi differ by their quaternary conidiophore branching
and their shorter conidia (15.5-19 um and 17-21 um; Parkinson & al. 2017).
Phylogenetically, Gliocladiopsis wuhanensis is closely related to G. guang-
dongensis. However, for the HIS3 gene, G. wuhanensis is separated by 12
bp from G. guangdongensis, greater than that from G. forsbergii (10 bp) and
G. whileyi (9 bp), suggesting that they are phylogenetically more distant.
318 ... Zhai & al.
The known Gliocladiopsis species were isolated from different habitats
(roots of diseased plants, plant litter, water, or soil) (Lombard & Crous 2012).
Gliocladiopsis species occur quite often in soil associated with plant roots.
Dann & al. (2012) conducted tests on plant roots, but the pathogenicity was
not clear, and possibly they were mainly saprobic.
Acknowledgements
The author would like to thank the reviewers, De-Wei Li (The Connecticut
Agricultural Experiment Station Valley Laboratory, CT USA) and Ying Zhang
(Institute of Microbiology, Beijing Forestry University, P.R. China), for their valuable
comments. We also thank the curator of CABI Bioscience for making the ex-type
strain of G. tenuis available for study.
This study was financially supported by NSFC 31770029, 31400129 &
18IRTSTHN021. The authors declare no potential conflict of interest for this study.
Literature cited
Crous PW, Wingfield MJ. 1993. A re-evaluation of Cylindrocladiella, and a comparison with
morphologically similar genera. Mycological Research 97: 433-448.
https://doi.org/10.1016/S0953-7562(09)80131-7
Crous PW, Groenewald JZ, Riséde JM, Simoneau P, Hywel-Jones NL. 2004. Calonectria species
and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Studies
in Mycology 50: 415-430. https://doi.org/10.3114/sim.55.1.213
Dann EK, Cooke AW, Forsberg LI, Pegg KG, Tan YP, Shivas RG. 2012. Pathogenicity studies
in avocado with three nectriaceous fungi, Calonectria ilicicola, Gliocladiopsis sp. and
Ilyonectria liriodendri. Plant Pathology 61: 896-902.
https://doi.org/10.1111/j.1365-3059.2011.02579.x
Doyle JJ, Doyle JL. 1990. Isolation of plant DNA from fresh tissue. Focus 12: 13-15.
Huelsenbeck JP, Ronquist F 2001. MRBAYES: Bayesian inference of phylogenetic trees.
Bioinformatics 17: 754-755. https://doi.org/10.1093/bioinformatics/17.8.754
Hyde KD, Chaiwan N, Norphanphoun C, Boonmee S, Camporesi E & al. 2018. Mycosphere
notes 169-224. Mycosphere. 9(2): 271-430. https://doi.org/10.5943/mycosphere/9/2/8
Liu F, Cai L. 2013. A novel species of Gliocladiopsis from freshwater habitat in China.
Cryptogamie, Mycologie 34: 233-241. https://doi.org/10.7872/crym.v34.iss2.2013.233
Lombard L, Crous PW. 2012. Phylogeny and taxonomy of the genus Gliocladiopsis. Persoonia
28: 25-33. https://doi.org/10.3767/003158512X635056
Lombard L, van der Merwe N, Groenewald J, Crous P. 2015. Generic concepts in Nectriaceae.
Studies in Mycology 80: 189-245. https://doi.org/10.1016/j.simyco.2014.12.002
Nirenburg HI. 1981. A simplified method to identify Fusarium spp. occurring on wheat.
Canadian Journal of Botany 59: 1599-1609. https://doi.org/10.1139/b81-217
O'Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a
monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics
and Evolution 7: 103-116. https://doi.org/10.1006/mpev.1996.0376
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. https://doi.org/10.1093/bioinformatics/btg180
Gliocladiopsis wuhanensis sp. nov. (China) ... 319
Saksena SB. 1954. A new genus of Moniliaceae. Mycologia 46: 660-666.
https://doi.org/10.1080/00275514.1954.12024402
Schoch CL, Crous PW, Wingfield MJ, Wingfield BD. 2000. Phylogeny of Calonectria and
selected hypocrealean genera with cylindrical macroconidia. Studies in Mycology 45:
45-62. https://doi.org/10.3114/sim.2010.66.03
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular Evolutionary
Genetics Analysis version 6.0. Molecular Biology and Evolution 30: 2725-2729.
https://doi.org/10.1093/molbev/mst197
White TJ, Bruns T, Lee S, Taylor J, 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis & al. (eds),
PCR protocols: a guide to methods and applications. Academic Press, Orlando.
https://doi.org/10.1016/b978-0-12-372180-8.50042-1
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 321-328
https://doi.org/10.5248/134.321
Four new records of Haematomma
from Southern China
RONG TANG *, XIAO ZHANG *, CHUN-XIAO WANG, LU-LU ZHANG *
Key Laboratory of Plant Stress Research, College of Life Sciences
Shandong Normal University, Jinan, 250014, P. R. China
* CORRESPONDENCE TO: [email protected]
ABSTRACT—Haematomma accolens, H. collatum, H. fenzlianum, and H. flexuosum are
reported as new for China; and H. fenzlianum is also new for Asia. Detailed taxonomic
descriptions with photos are provided for the four species.
Key worps—East Asia, Haematommataceae, Lecanorales, lichenized Ascomycota, taxonomy
Introduction
Haematomma A. Massal., introduced by Massalongo in 1852, is a genus of
crustose lichens with blood-red apothecia having thallus-coloured margins
and transversely septate to muriform ascospores. For the most part, species
of Haematomma are found in the tropics and subtropics (Staiger & Kalb
1995, Brodo & al. 2008), so it is not surprising that in China Haematomma
is mainly distributed in the southern provinces, where the terrain is diverse
with plains, basins, and plateaus, dominated by tropical subtropical monsoon
climate and with high temperatures and abundant rain in summer and mild
temperatures with less rain in winter. With its diverse climate types (tropical,
subtropical, temperate, and cold temperate) and plant ecosystems (tropical rain
forest, evergreen broadleaf forest, deciduous broadleaf forest, coniferous forest,
meadow, desert, etc.), and altitudes of 72-6740 m, Yunnan Province has an
especially rich range of lichen species.
* RONG TANG & XIAO ZHANG contributed equally to this research.
322 ... Tang, Zhang & al.
In the world monograph of Haematomma by Staiger & Kalb (1995), only
one species is mentioned as occurring in China: H. rufidulum (Fée) A. Massal.
Previously, H. fauriei Zahlbr. and H. puniceum (Ach.) A. Massal. had been
recorded from China (Zahlbruckner 1930, Xu 1989), but as we have been unable
to find any specimens of these two species to verify the reports, we cannot
confirm their Chinese occurrence. Since 1995, four other species have been
added to the Chinese list: H. africanum (J. Steiner) C.W. Dodge, H. caperaticum
Brodo & al., H. persoonii (Fée) A. Massal., and H. wattii (Stirt.) Zahlbr. (Wei
1991, Aptroot & Sparrius 2003, Obermayer 2004, Tang & al. 2018), to which
we here add another four species: H. accolens, H. collatum, H. fenzlianum, and
H. flexuosum based primarily on recently collected material from Southern
China. Hopefully, this paper will provide the basis for further research.
Materials & methods
The specimens studied are housed in: Lichen Section of the Botanical
Herbarium, Shandong Normal University (SDNU); Kunming Institute of Botany,
Chinese Academy of Sciences (KUN-L); Sectio Lichenum, Herbarium Mycologici
Academiae Sinicae (HMAS-L); and Lichen Herbarium of the College of Life Sciences,
Liaocheng University (LCU). The macro- and micromorphological characters of the
specimens were examined under an Olympus SZ51 stereomicroscope and Olympus
CX21 polarizing microscope. Both thallus and medulla were tested with K (a 10%
aqueous solution of potassium hydroxide) and C (a saturated solution of aqueous
sodium hypochlorite). The lichen substances were identified using standardized
thin layer chromatography techniques (TLC) with solvent system C (Orange & al.
2010). Photos of the voucher specimens were taken under Olympus SZX16 and
BX61 with DP72.
Taxonomic descriptions
Haematomma accolens (Stirt.) Hillmann,
Repert. Spec. Nov. Regni Veg. 49: 34 (1940) Fic. 1A-E
Thallus crustose, smooth or roughened, slightly cracked, without isidia or
soredia, pale yellowish white; prothallus present, white. Apothecia red, sessile
or constricted at base, dispersed or crowded, smooth, epruinose, 0.4-1.0
mm diam., margin distinct, smooth; epihymenium orange-red, K+ purple,
dissipating; hymenium hyaline, 75-90 um tall; hypothecium hyaline; asci
clavate, 8-spored; ascospores persistently colorless, parallel in ascus, several-
septate, fusiform, with 7-12 cells in optical view, 38-60 x 3-4(-5) um. Pycnidia:
not observed.
CHEMISTRY—Cortex and medulla K+ yellow, C-, KC-, IKI-. Atranorin,
placodiolic acid, and haematommone detected by TLC.
Haematomma spp. new to China... 323
Hasitat—Growing on the bark of shrubs trees (e.g., Betula and Michelia)
at elevations of 400-1230 m and in China usually growing together with
Phaeographis spp..
DiIsTRIBUTION—North, Central, and South America, Africa, Australia, Asia
(Staiger & Kalb 1995, Brodo & al. 2008). New to China.
SPECIMENS EXAMINED: CHINA. GUANGDONG, Shixing, Lulang, Che eight Ling National
Nature Reserve, alt. 400 m, on bark, 14 May 2015, Zefeng Jia GD15156 (LCU); YUNNAN,
Dali Co., Nanjian, Gonglang Village, Yangjiehe, alt. 1230 m, on bark, 15 Jun. 2012, Wang
Li-song, Wang Xin-yu & Liu Dong 12-34410A, 12-34410C (KUN-L).
COMMENTS—Haematomma accolens is characterized by the 7-12-celled
ascospores and K+ purple epihymenium. The description of the Chinese
material is similar to previously published descriptions of H. accolens,
although Brodo & al. (2008) reported the spores with (5-)6-8(-12) cells.
Haematomma accolens is morphologically similar to H. flexuosum, but they
have a different chemistry: H. accolens contains atranorin, placodiolic acid, and
haematommone, whereas H. flexuosum contains atranorin, isoplacodiolic acid,
isopseudoplacodiolic acid, and haematommone.
Haematomma collatum (Stirt.) C.W. Dodge,
Beih. Nova Hedwigia 38: 41 (1971) Fic. 1F-J
Thallus crustose, continuous, rugose or rimose, without isidia or soredia,
yellowish white; prothallus usually present, white. Apothecia rounded, orange-
red, sessile or constricted at base, dispersed, smooth, (0.5-)0.8-1.5 mm diam.,
margin distinct, crenulate, usually prominent above disk; epihymenium orange
to orange-red, K+ red; hymenium hyaline, 80-95 um tall; hypothecium hyaline
or slightly yellowish, K-; paraphyses branched and anastomosing; asci clavate,
8-spored; ascospores persistently colorless, twisted in ascus, multiseptate,
fusiform, curved, with 10-14 cells in optical view, locules sometimes not equal
in size, the tail cell longer than middle cells, (53-)65-75 x 4-5 um. Pycnidia:
not observed.
CHEMISTRY—Cortex and medulla K+ yellow, C-, KC-, IKI-. Atranorin,
sphaerophorin, isosphaeric acid (minor), and russulone detected by TLC.
Hasitat—Growing on bark at elevations of 670-2500 m. The specimen
from Yunnan was found in a moist evergreen broadleaf forest; compared with
other Haematomma spp. in this area, H. collatum grows very well. We also find
that, in China, H. collatum likes to grow in the same environment as lichens in
the Graphidaceae.
DISTRIBUTION—Central and South America, Africa, Australia, Asia Minor
(Staiger & Kalb 1995; Brodo & al. 2008). New to China.
324 ... Tang, Zhang & al.
Haematomma spp. new to China... 325
SPECIMENS EXAMINED: CHINA. YUNNAN, Jingdong, Mt. Ailao, 24°32’29”N
101°01’37”E, alt. 2500 m, on bark, 5 Aug. 2017, R. Tang & al. 20170319 (SDNU);
HAINAN, Mt. Wuzhi, 18°46’N 109°31’E, alt. 670 m, on bark, 28 Jun. 2008, Jia Zefeng.
119392 (HMAS-L).
CoMMENTS—Haematomma collatum can be characterized by its crenulate
apothecial margins, 10-14-celled ascospores, medullary sphaerophorin,
and epithecial russulone. The Chinese material closely matches previously
published descriptions (Staiger & Kalb 1995). This species and H. persoonii
contain the same chemical substances, but H. persoonii has ascospores with
fewer (6-8) cells (Brodo & al. 2008).
Haematomma fenzlianum A. Massal.,
Mem. Reale Ist. Veneto Sci. 10: 58 (1861) Fic. 2A-E
Thallus thick, crustose, rugose or rimose, areolate, without isidia or soredia,
dull yellowish white; prothallus not seen. Apothecia rounded, deep reddish,
sessile or constricted at base, dispersed, smooth, epruinose, 0.5(-0.8)—2.0
mm diam., margin distinct, crenulate or flexuose, usually prominent above
disk; epihymenium orange-red, K+ red; hymenium hyaline, 70-75 um tall;
hypothecium hyaline or pale yellowish; asci clavate, 8-spored; ascospores
persistently colorless, multiseptate, fusiform, straight or slightly curved, with
(3-)4-7 cells in optical view, (30-)33-43(-48) x 4.5-5 um. Pycnidia: not
observed.
CHEMISTRY—Cortex and medulla K+ yellow, C-, KC-. Atranorin,
sphaerophorin, isosphaeric acid, and russulone detected by TLC.
DISTRIBUTION—Europe, Africa, Australasia, America (Staiger & Kalb 1995,
Nash & al. 2004, Brodo & al. 2008). New to China, and new to Asia.
HasitatT—Growing on non-calcareous rock. Haematomma fenzlianum has
rarely been collected in China, probably because it likes to grow in dry exposed
areas, such as those occurring in North America and Argentina; comparable
habitats are rare in southern China.
SPECIMEN EXAMINED: CHINA. YUNNAN, Lijiang, Yupang, alt. 2600 m, on rock, 15 Aug.
1982, Wang Li-song 82-1081 (KUN-L).
COMMENTS—Haematomma fenzlianum is characterized by its thick thallus
and 4-7-celled ascospores, and by its substrate. The Chinese material
Fic. 1. Haematomma accolens (LCU-L Jia GD15156). A. Thallus; B. Apothecium; C. Apothecium
section; D. Ascus; E. Ascospores. Haematomma collatum (HMAS-L Jia 119392). F. Thallus;
G. Apothecium; H. Apothecium section; I. Ascus; J. Ascospores.
326 ... Tang, Zhang & al.
closely matches previously published descriptions (Staiger & Kalb 1995).
Haematomma fenzlianum is the only saxicolous species of Haematomma in
China. Haematomma ochroleucum (Neck.) J.R. Laundon is also saxicolous but
differs in containing zeorin and being abundantly sorediate (vs. H. fenzlianum
which lacks zeorin and (usually) soredia).
Haematomma flexuosum Hillmann,
Repert. Spec. Nov. Regni Veg. 49: 35 (1940) Fic. 2F-J
Thallus crustose, continuous, rugose or rimose, roughened, without isidia
or soredia, yellowish white; prothallus present, white. Apothecia rounded, deep
reddish, sessile or constricted at base, dispersed, smooth, 0.4-0.8 mm diam.,
margin distinct, even with disk; epihymenium red, K+ purple, dissipating;
hymenium hyaline, 63-70 um tall; hypothecium hyaline or pale yellowish,
K-; paraphyses branched and anastomosing; asci clavate, 8-spored; ascospores
persistently colorless, multiseptate, fusiform, curved or straight, with 5-7 cells
in optical view, (35-)50-63 x 4-5 um. Pycnidia: not observed.
CHEMISTRY—Cortex and medulla K+ yellow, C-, KC-. Atranorin,
isoplacodiolic acid, isopseudoplacodiolic acid, and haematommone detected
by TLC.
DISTRIBUTION—Central and South America, Africa, Australia, West Indies
(Staiger & Kalb 1995; Brodo & al. 2008). New to China.
Hasitat—Growing on bark around 1000 m above sea level. We found this
species growing together with H. rufidulum.
SPECIMENS EXAMINED: CHINA. YUNNAN, Najian, Mt. Manhai, 24°42’57”N
100°25’17’E, alt. 1266 m, on bark, 30 Jun. 2015, X. Ye & W.C. Wang 15-47956(A), 15-
47956(D) (KUN-L). YUNNAN, Luxi, Mt. Santai, 24°26’N 98°35’E, alt. 1340 m, on bark,
28 Jun. 1980, Jiang Yu-mei 051540 (HMAS-L).
COMMENTS—Haematomma flexuosum is characterized by 5-7-celled
ascospores and by its special chemistry. The Chinese material closely matches
the description by Staiger & Kalb (1995). Haematomma matogrossense
Kalb & Staiger is similar but differs by having 8-14-celled spores and by
containing methylisopseudoplacodiolic acid and isopseudoplacodiolic acid
(rather than 5-7 cells and isoplacodiolic acid and isopseudoplacodiolic acid
in H. flexuosum).
Fic. 2. Haematomma fenzlianum (KUN-L Wang 82-1081). A. Thallus; B. Apothecium;
C. Apothecium section; D. Ascus; E. Ascospores. Haematomma flexuosum (KUN-L Ye
15-47956(D)). F. Thallus; G. Apothecium; H. Apothecium section; I. Ascus; J. Ascospores.
Scale bars: A= 5 mm;B=1 mm.
O20
Haematomma spp. new to China...
328 ... Tang, Zhang & al.
Acknowledgements
We thank Dr. Irwin Brodo (Canadian Museum of Nature, Ottawa, Canada),
Dr. S. Y. Guo (State Key Laboratory of Mycology, Chinese Academy of Sciences,
Beijing, China) and Dr. John Elix (Australian National University, Canberra,
Australia) for providing great guidance during the study. Thank Dr. Li-song Wang
(Kunming Institute of Botany, China), Dr. Ze-feng Jia (Liaocheng University, College
of Life Sciences, China) and Dr. Hong Deng (State Key Laboratory of Mycology,
Institute of Microbiology, Chinese Academy of Sciences, Beijing, China) for
sending specimens to us. This work was supported by the National Natural Science
Foundation of China Youth Science Foundation (31600100), and Emergency
management project of National Natural Science Foundation of China (31750001).
Literature cited
Aptroot A, Sparrius LB. 2003. New microlichens from Taiwan. Fungal Diversity 14: 1-50.
Brodo IM, Culberson, WL, Culberson, CE. 2008. Haematomma (Lecanoraceae) in North and
Central America, including the West Indies. Bryologist 111: 363-423.
https://doi.org/10.1639/0007-2745(2008)111[363:hlinac]2.0.co;2
Nash TH, Ryan BD, Diederich P, Gries C, Bungartz F. 2004. Lichen flora of the Greater Sonoran
Desert Region, vol. 2. Tempe, Lichens Unlimited.
Obermayer W. 2004. Additions to the lichen flora of the Tibetan region. Bibliotheca
Lichenologica 88: 479-526.
Orange A, James PW, White FJ. 2010. Microchemical methods for the identification of lichens.
2nd edition. London, British Lichen Society.
Staiger B, Kalb K. 1995. Haematomma-Studien: I. Die Flechtengattung Haematomma.
Bibliotheca Lichenologica 59. 198 p.
Tang R, Yan SK, Sun MJ, Zhang LL. 2018. New records of Haematomma and Ophioparma from
China. Mycotaxon 133: 175-181. https://doi.org/10.5248/133.175
Wei JC. 1991. An enumeration of lichens in China. Beijing, China. International Academic
Publishers.
Xu BS. 1989. Cryptogamic flora of the Yangtze Delta and adjacent regions. Shanghai Scientific
and Technical Publishers: 158-266.
Zahlbruckner A. 1930. Lichenes. Symbolae Sinicae, vol. 3. 254 p.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 329-334
https://doi.org/10.5248/134.329
Cordana meilingensis and C. lushanensis spp. nov.
from Jiangxi, China
ConG-Conc AI’, JIAN Ma*3, KAI ZHANG‘,
RAFAEL FE. CASTANEDA-RUIZ*, XIU-GUO ZHANG’*
"Department of Plant Pathology, Shandong Agricultural University,
Taian, Shandong 271018, China
College of Agronomy, Jiangxi Agricultural University, Nanchang, Jiangxi 330045, China
"Jiangxi Key Laboratory for Conservation and Utilization of Fungal Resources,
Jiangxi Agricultural University, Nanchang, Jiangxi 330045, China
‘Department of Landscaping, Shandong Yingcai University, Jinan, Shandong 250104, China
‘Instituto de Investigaciones Fundamentales en Agricultura Tropical Alejandro de Humboldt
(INIFAT), Académico Titular de la Academia de Ciencias de Cuba,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P. 17200
*CORRESPONDENCE TO: [email protected]
ABSTRACT—Two new anamorphic fungi, Cordana meilingensis and C. lushanensis,
were collected from dead branches in Jiangxi Province, China. Cordana meilingensis is
characterized by its oblong or cylindrical, medially 1-septate, brown, smooth conidia with
a prominent hilum. Cordana lushanensis is distinguished by its ellipsoidal to obovoid, pale
brown, aseptate, smooth conidia with a prominent basal scar. They are described, illustrated,
and compared with similar taxa.
KEY worDs—asexual fungi, Cordanaceae, Cordanales, hyphomycetes, taxonomy
Introduction
Preuss (1851) established Cordana with three species, without designating
a type species, and subsequently added a fourth species (Preuss 1853).
However, Saccardo (1886) redescribed Cordana, retaining only one species,
C. pauciseptata Preuss, which thus effectively became the type species
(Hughes 1958, Seifert & al. 2011; epitypified by Hernandez-Restrepo &
330... Ai & al.
al. 2014). Cordana is mainly characterized by distinct, simple or sparely
branched conidiophores, and solitary, acropleurogenous, 0-1-septate conidia
seceding schizolytically from polyblastic, integrated, terminal and becoming
also intercalary, sympodial conidiogenous cells with small denticles, the
conidia are ellipsoidal, ovoid, obovoid, pyriform or cylindrical, often with
a prominent hilum (Ellis 1971, Markovskaja 2003). Castafieda-Ruiz & al.
(1999) reviewed 17 species of Cordana and provided a comparative table that
distinguished 11 accepted Cordana species. However, Markovskaja (2003)
regarded C. miniumbonata R.F. Castaheda & al. as a problematic species
due to its conidial shape and septation mode. Cordana currently contains
19 recognized species (Hernandez-Restrepo & al. 2014), distinguished
primarily by conidial features including shape, size, septation, pigmentation,
ornamentation, and presence or absence of a synanamorph (Castafeda-Ruiz
& al. 1999, Markovskaja 2003, Hernandez-Restrepo & al. 2014).
During our continuing survey (2005-18) of microfungi from plant debris
in the forests of southern China, two species referable to the genus Cordana
were collected on dead branches in Jiangxi Province. A close examination of
the two fungi showed that they have significant differences from previously
described Cordana species and are therefore proposed as new to science.
Cordana meilingensis C.C. Ai, Jian Ma, X.G. Zhang & R.F. Castafieda, sp.nov. Fic. 1
IF 555813
Differs from Cordana johnstonii, C. uniseptata, and C. versicolor by its smaller oblong
or cylindrical, medially 1-septate, concolorous conidia; and from C. mercadoana by its
larger, medially 1-septate, brown conidia.
Type: China, Jiangxi Province: Meiling National Park, on dead branches of an
unidentified broadleaf tree, 8 October 2013, J. Ma (Holotype, HJAUP M0144).
EryMoLoGey: refers to the locality where the type specimen was found.
CoLonligs on the natural substratum effuse, brown to dark brown. Mycelium
partly superficial, partly immersed, composed of branched, septate, smooth,
subhyaline to pale brown hyphae. CONIDIOPHORES macronematous,
mononematous, unbranched, erect, straight or flexuous, cylindrical, smooth,
septate, brown to dark brown, paler towards the apex, 73-185 x 4-5 um,
occasionally swollen at the base, 5.5-9 um diam. CONIDIOGENOUS CELLS
polyblastic, integrated, terminal and intercalary, with subhyaline and slightly
prominent scars, cylindrical. Conidial secession schizolytic. CoNrp1A
solitary, acropleurogenous, dry, medially 1-septate, often slightly constricted
at the septa, oblong or cylindrical, brown, smooth, 10-13 x 5.5-7 um, with a
prominent hilum, 0.5-1 x 0.5 um.
Cordana meilingensis & C. lushanensis spp. nov. (China) ... 331
=
vg
D
=
204m
20um
=
=
4 i
aq
Fic. 1. Cordana meilingensis (holotype, HHAUP M0144).
A. Conidia; B-F. Conidiophore with conidia.
20nm
COMMENTS—Cordana meilingensis resembles C. johnstonii M.B. Ellis,
C. uniseptata L. Cai & al., C. versicolor D.J. Soares & R.W. Barreto, and
C. mercadoana Hern.-Restr. & al. in conidial shape (TaBLE 1). However,
C. johnstonii has larger broadly ellipsoidal conidia and grows only on
plants in the genus Musa (Ellis 1971); C. uniseptata produces larger broadly
ellipsoidal, asymmetrically 1-septate, versicolored conidia (Cai & al. 2004);
C. versicolor differs by its larger broadly ellipsoidal conidia with a paler basal
cell and is parasitic on Canna denudata Roscoe [= C. paniculata Ruiz & Pav.]
332 ... Ai &al.
(Soares & al. 2005); and C. mercadoana differs by its smaller, versicolored,
0-1-septate conidia (Hernandez-Restrepo & al. 2014).
TABLE 1. Comparisons of conidia and substrates of Cordana meilingensis
and similar species
CONIDIA
SPECIES SS = Lk SUBSTRATE,
SHAPE SIZE(um) COLOR SEPTATION
C. johnstonii! Broadly 20-30 x Uniform Medially Parasitic on
ellipsoidal 12-18 1-septate Musa spp.
a ae Chonan eS a Ee Gia Mane? Oe ee
cylindrical 5.5-7 1-septate dead branches
“Co mercadoana® Oblong, 6-10x Variable 0-I-septate Saprobicon
obovoid, or 3-4 dead twig
cylindrical
ane? Saye ee nT ee aa ASG eae
ellipsoidal 8.5-11.5 1-septate on bamboo
Beye ave Pr epee Bees sparrata cotta eaaees Mai ee pesca eile
ellipsoidal 10-15 1-septate Canna
denudata
Data from ' Ellis (1971); ? Hernandez-Restrepo & al. (2014); * Cai & al. (2004); *Soares & al. (2005)
Cordana lushanensis C.C. Ai, Jian Ma, X.G. Zhang & R.F. Castafieda, sp. nov. Fic. 2
IF 555814
Differs from Cordana verruculosa by its larger smooth conidia; from C. semaniae and
C. solitaria by its smaller ellipsoidal to obovoid, pale brown conidia with a prominent
basal scar; and further from C. solitaria by lacking a Bispora-like synanamorph.
Type: China, Jiangxi Province: Lushan (Mount Lu), on dead branches of an
unidentified broadleaf tree, 8 November 2017, J. Ma (Holotype, HHAUP M5406).
EryMo_oey: refers to the locality where the type specimen was found.
Co.onigs on the natural substratum effuse, brown to dark brown. Mycelium
partly superficial, partly immersed, composed of branched, septate, smooth,
subhyaline to pale brown hyphae. CoNIDIOPHORES macronematous,
mononematous, simple or branched, erect, straight to flexuous, cylindrical,
with intercalary nodes, 7-14 um diam, brown, paler toward the apex, smooth,
<240 x 6.5-7.5 um. CONIDIOGENOUS CELLS integrated, polyblastic, terminal
and intercalary, with subhyaline small denticles, proliferations percurrent,
cylindrical to lageniform. Conidial secession schizolytic. Conip1a solitary,
acropleurogenous, dry, 0-septate, ellipsoidal to obovoid, pale brown, smooth,
5.5-8 x 2.5-4 um, with a prominent basal scar, 0.3-0.5 um diam.
Cordana meilingensis & C. lushanensis spp. nov. (China) ... 333
000
000
00
DU
10nm
Fic. 2. Cordana lushanensis (holotype, HHAUP M5406).
A. Colonies on natural substratum; B—D. Conidiophores and conidia; E. Conidia.
ComMENTs - Among the known species, only C. semaniae Davydkina & al.,
C. solitaria V. Rao & de Hoog, and C. verruculosa Hern.-Restr. & al. resemble
C. lushanensis in producing aseptate conidia. However, C. verruculosa differs
by its smaller (3-5.5 x 2-3.5 um) verruculose conidia (Hernandez-Restrepo
& al. 2014); C. semaniae differs by its larger (21-27 x 9-15 um) obovoid black
conidia with an acute basal cell (Davydkina & Melnik 1989); C. solitaria differs
by its broader (4.5-6.5 um diam) obovoid conidia with a slightly papillate base,
and the presence of a Bispora-like synanamorph (Rao & de Hoog 1986).
Acknowledgments
The authors express gratitude to Dr. De-Wei Li (The Connecticut Agricultural
Experiment Station Valley Laboratory, Windsor CT, USA) and Dr. Li-Guo Ma
(Institute of Plant Protection, Shandong Academy of Agricultural Sciences, Jinan,
China) for serving as pre-submission reviewers and to Dr. Shaun Pennycook for
nomenclatural review. This project was supported by the National Natural Science
Foundation of China (No. 31360011, 31870016), and the Jiangxi Province Department
of Education, China (No. GJJ160357).
Literature cited
Cai L, McKenzie EHC, Hyde KD. 2004. New species of Cordana and Spadicoides from decaying
bamboo culms in China. Sydowia 56(2): 222-228.
334 ... Ai &al.
Castafeda-Ruiz RF, Iturriaga T, Guarro J. 1999. A new species of Cordana from Venezuela.
Mycotaxon 73: 1-8.
Davydkina TA, Mel'nik VA. 1989. Two new hyphomycetes from the genera Cordana and
Pyriculariopsis. Mikologiya i Fitopatologiya 23(2): 110-113.
Ellis MB. 1971. Dematiaceous hyphomycetes. X. Mycological Papers 125. 30 p.
Hernandez-Restrepo M, Gené J, Mena-Portales J, Cano J, Madrid H, Castaneda-Ruiz RF, Guarro
J. 2014. New species of Cordana and epitypification of the genus. Mycologia 106(4): 723-734.
https://doi.org/10.3852/13-122
Hughes SJ. 1958. Revisiones hyphomycetum aliquot cum appendice de nominibus rejiciendis.
Canadian Journal of Botany 36: 727-836.
Markovskaja S. 2003. A new species of Cordana from Lithuania. Mycotaxon 87: 179-185.
Preuss CGT. 1851. Ubersicht untersuchter Pilze, besonders aus der Umgegend von Hoyerswerda.
Linnaea 24: 99-153.
Preuss CGT. 1853. Ubersicht untersuchter Pilze, besonders aus der Umgegend von Hoyerswerda.
Linnaea 25: 723-742.
Rao VG, de Hoog GS. 1986. New or critical hyphomycetes from India. Studies in Mycology 28.
84 p.
Saccardo PA. 1886. Sylloge hyphomycetum. Sylloge Fungorum 4. 807 p.
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Soares DJ, Nechet KL, Barreto RW. 2005. Cordana versicolor sp. nov. (dematiaceous hyphomycete)
causing leaf-spot on Canna denudata (Cannaceae) in Brazil, with observations on Cordana
musae. Fungal Diversity 18: 147-155.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 335-352
https://doi.org/10.5248/134.335
Coprophilous fungi from Brazil:
new records for the Neotropics
ROGER ER. MELoO”™, DANIEL B.P. DO MONTE’, NICOLE H.B. GONDIM’,
LEONOR C. MAtA', ANDREW N. MILLER?
' Universidade Federal de Pernambuco, Departamento de Micologia,
Av. da Engenharia, s/n, 50740-600, Recife, Brazil
? University of Illinois at Urbana-Champaign, Illinois Natural History Survey,
1816 S. Oak St., Champaign, IL 61820, USA
* CORRESPONDENCE TO: [email protected]
ABSTRACT— Twelve ascomycetes associated with herbivore dung, collected throughout an
edaphic and climatic gradient from the Atlantic Forest complex to the semi-arid Caatinga
in Pernambuco, Northeastern Brazil, represent new records: Ascobolus castaneus, Arnium
hirtum, Cercophora anisura, Chaetomium citrinum, C. spirale, Coniochaeta philocoproides,
Coprotus albidus, and Delitschia vulgaris are new records for the Neotropics; Cercophora
sordarioides, Chaetomium cochliodes, Sordaria lappae, and Thelebolus microsporus are new
records for Brazil. Ascobolus castaneus is recorded for the second time worldwide, revealing
a much wider geographical distribution for a species previously reported only from China.
Descriptions and updated geographic distributions are presented, and information regarding
the records is discussed.
KEY worps—Ascomycota, dung fungi, taxonomy
Introduction
Coprophilous fungi constitute a rich and diverse ecological group of
saprobes especially adapted to withstand conditions and use resources available
in herbivore dung (Kirschner & al. 2015). These fungi can be found in dung
of many herbivores, domesticated or wild, all over the world and throughout
the year (Richardson 2001). Fungi on dung are represented mainly by
members of Ascomycota (e.g., Ascobolaceae, Lasiosphaeriaceae), Mucoromycota
336 ... Melo & al.
(e.g., Pilobolaceae, Mucoraceae), and Basidiomycota (e.g., Coprinaceae,
Psathyrellaceae). As in other ecological groups, a gradient ranging from
specialized species to opportunistic saprobes can be found in coprophilous
fungal communities (Newcombe & al. 2016). Despite this, the coprophilous
mycobiota retains some similarity and shows somewhat regular patterns of
occurrence and abundance throughout continents and time (Basumatary &
McDonald 2017). The Brazilian coprophilous mycobiota is poorly known,
and recent works have focused on the taxonomy and distribution of the most
common genera and in establishing regional and national checklists (Calaca
& al. 2014; Melo & al. 2012, 2017; Souza & al. 2017). As most coprophilous
species are restricted to their substrates, their geographical distribution is only
known where such inventories have been conducted, and some species thought
to be restricted to temperate regions are being reported in the tropics as well.
This work presents the first report of twelve records of Ascomycota associated
with herbivore dung, all new records either for the Neotropics, South America,
or Brazil.
Materials & methods
A total of 270 dung samples from goat, cattle, and horse were sampled between
2011 and 2013 from three animal precincts: (1) Universidade Federal Rural de
Pernambuco, Veterinary Medicine Department, Recife (8°00°54”S 34°56’59”W),
(2) Instituto Agronémico de Pernambuco (IPA), Caruaru (8°01’59”S 36°06’59”W),
and (3) Instituto Agronémico de Pernambuco (IPA), Serra Talhada (7°54’59”S
38°17'00”W). These areas are located along a latitudinal transect of ~420 km in the
state of Pernambuco, Northeastern Brazil and encompass two biomes: the Atlantic
Rainforest to the east and the semiarid Caatinga to the west. Additional material,
from Rio Grande do Sul state, were also received. Fresh dung samples were collected
in clean plastic bags, taken to the laboratory, and incubated in moist chambers at
room temperature (28 + 2 °C) for at least 75 days under alternating natural light
and dark periods. The material was observed directly on the substrata with the aid
of a stereomicroscope, and ascomata (with or without their asexual morphs) were
mounted in water, lactic acid, or lactophenol with cotton blue for identification
under light microscopy.
Species were identified according to Ames (1961), Brummelen (1967),
Kimbrough & al. (1972), von Arx & al. (1986), Bell (1983, 2005), Doveri (2004),
Lundqvist (1972), and Richardson & Watling (1997). Careful review of the literature
and national database searches were conducted to access information regarding
previous records of coprophilous ascomycetes in Brazil. All voucher material was
deposited at the Herbarium Padre Camille Torrend, Departamento de Micologia,
Universidade Federal de Pernambuco, Recife, Brazil (URM). Additional information
regarding all records and deposited specimens, along with high quality micrographs,
Coprophils new for Brazil ... 337
are available at the INCT - Herbario Virtual da Flora e dos Fungos database website
(http://inct.florabrasil.net).
Taxonomy
Dothideomycetes, Pleosporales, Delitschiaceae
Delitschia vulgaris Griffiths, Mem. Torrey Bot. Club 11: 104 (1901) FIG. 1A-C
PsEUDOTHECIA immersed, scattered, obpyriform, dark brown to black,
1275-1450 x 350-460 um, with body adorned with light brown to golden,
thin, flexuous, simple or branched hyphoid hairs with a slightly thickened wall,
septate, about 1.5-2 um diam., <150 um long; NEcK long, cylindrical, black,
with papilliform rounded apex, 690-725 x 165-210 um, tomentose; Asci
8-spored, cylindrical, fissitunicate, uniseriate, 275-300 x 20-25.5 um, with
rounded apices and short stipe; AscosporEs 2-celled, with a medial septum,
oblong-ellipsoid to fusoid, weakly constricted, with slightly narrowed ends,
light brown when young, becoming dark brown at maturity, smooth, 32.5-37.5
x 13-15 um; germ slits longitudinal, spanning the entire length of each cell.
SPECIMENS EXAMINED—BRAZIL. PERNAMBCUO: Recife, Universidade Federal Rural de
Pernambuco (UFRPE), on horse dung, 13.11.2012, R-ER. Melo s.n. (URM86772a, b, c).
DIsTRIBUTION—Europe (Sweden), North America (Canada, USA), Oceania
(Australia). This is the first record for the Neotropics.
ComMENtTs—The Delitschia vulgaris material from Brazil presents larger
ascospores compared to the material cited by Luck-Allen & Cain (1975).
Considering Delitschia species with tomentose pseudothecia and ascospores
with a transverse septum, D. araneosa Cain is similar to D. vulgaris, but differs
by its slightly narrower ascospores (10-11 um; Luck-Allen & Cain 1975).
Leotiomycetes, Thelebolales, Thelebolaceae
Coprotus albidus (Boud.) Kimbr., Amer. J. Bot. 54: 22 (1967) FIG. 1D, E
APOTHECIA scattered, globose to lenticular, subhyaline to creamy-yellow,
translucent, 300-600 um diam., sessile, glabrous; MARGIN rounded, entire and
smooth; Disk concolorous with the receptacle, scurfy to slightly villose due
to the ascal protrusions; MEDULLARY EXCIPULUM with intricate cells (textura
intricata); ECTAL EXCIPULUM composed of elongated cells, 7.5-10 um diam.;
PARAPHYSES cylindrical, becoming clavate towards the apex, enlarged to
5-6.5 tum wide, unbranched, septate, without visible refractive globules or
pigments; Asci 32-spored, clavate, with ascospores irregularly disposed,
80-110 x 22.5-30 um, with a rounded apex; Ascospores 1-celled, ellipsoid
338 ... Melo & al.
to elongated-ellipsoid, with tapered ends, hyaline, smooth, (7.5-)10-12.5 x
5-7.5(-10) um, mostly with a de Bary bubble.
SPECIMEN EXAMINED—BRAZIL. R10 GRANDE Dv SOL: Santana do Livramento, Area
de Protegao Ambiental do Ibirapuita, on horse dung, 13.VI.2015, Xavier de Lima s.n.
(URM92164).
DiIsTRIBUTION—Europe (Denmark, England, Finland, France). This is the first
record for the Neotropics.
ComMMENTS—The material described here matches closely C. albidus as
described by Kimbrough & al. (1972). Among Coprotus species with whitish to
translucent apothecia bearing 32-spored asci and growing on dung, C. albidus
can be confused with C. rhyparobioides (Heimerl) Kimbr., which presents larger
asci (120-175 x 50-75 um) and longer ascospores (13.5-17.5 x 7-8 um), as
well as paraphyses frequently branched toward apices (Kimbrough & al. 1972).
Thelebolus microsporus(Berk. & Broome) Kimbr.,
Ann. Rep, Inst. Ferment. Res. Osaka: 50 (1967) FIG. 15, G
APOTHECIA scattered to gregarious, with cleistohymenial development
pattern, initially globose to obpyriform, becoming cupulate to lenticular,
exposing the disk later in the telohymenial phase, white to pale yellow,
becoming yellowish to pale luteous, 95-250 um diam., sessile, glabrous;
MARGIN rounded, entire and smooth; pisk concolorous with the receptacle,
almost smooth; HYMENIUM ~45-100 um thick; MEDULLARY EXCIPULUM and
hypothecium undifferentiated; ectal excipulum composed of intertwined thick
hyphae (textura epidermoidea), 7.5-12.5 um diam.; PARAPHYSES cylindrical,
branched, septate, 2-3 um wide at the base, without visible refractive globules
or pigments, branched close to its base and conspicuously broadened towards
apices, enlarged up to 6 um diam.; Asci 8-spored, cylindric-clavate, irregularly
biseriate or uniseriate, 80-95 x 10-25 um, with a short stipe, rounded above;
Ascosporss 1-celled, ellipsoid, with rounded ends, hyaline, smooth, 7.5-10
x 3-5 um, occasionally with a de Bary bubble close to one end (absent when
mounted in water).
SPECIMENS EXAMINED—BRAZIL. PERNAMBUCO: Caruaru, Instituto Agrondmico de
Pernambuco (IPA), on cattle dung, 16.X.2011, R-ER. Melo s.n. (URM86783); on horse
dung, 13.V1I.2012, R.ER. Melo s.n. (URM86784); Serra Talhada, Instituto Agronémico
de Pernambuco (IPA), on goat dung, 21.IX.2011, R.ER. Melo s.n. (URM86785).
DISTRIBUTION—Antarctica, Europe (Austria, Denmark, England, Estonia,
Faroe Islands, France, Germany, Ireland, Netherlands, Norway, Sweden,
Switzerland, Ukraine), North America (Canada USA), Oceania (Australia,
New Zealand), South America (Argentina). This is the first record for Brazil.
Coprophils new for Brazil ... 339
COMMENTS—Some measurements of the Brazilian material of Thelebolus
microsporus, such as ascospore length and width, showed slight variation
compared with material cultivated by Hoog & al. (2005) from Antarctica.
This species differs from other 8-spored members of Thelebolus mainly by its
developmental pattern: the apothecia expose their asci late in the mesohymenial
or telohymenial phase, resulting in a typical apothecioid morphology, in
contrast with species such as T: globosus Brumm. & de Hoog, which forms
globose apothecia.
Pezizomycetes, Pezizales, Ascobolaceae
Ascobolus castaneus Teng, Sinensia 11: 109 (1940) FIG. 1H-J
APOTHECIA usually gregarious, with eugymnohymenial development
pattern, initially globose to subglobose, becoming scutellate to discoid when
mature, at first yellowish-brown, later chestnut brown, drying rust brown to
finally blackish, 0.8-2 mm diam., sessile, almost glabrous; margin rounded,
smooth, bending outwards with age; Disk at first concave and yellow in
maturation, finally convex, concolorous with the receptacle, smooth to slightly
villose, not furfuraceous; HYPOTHECIUM 30-47.5 um thick, mostly with
strongly compact, isodiametric cells (textura angularis); ECTAL EXCIPULUM
composed of irregular ellipsoid cells, becoming more globose towards the
margins (textura globosa near the margin, textura angularis near the base),
30-50 um wide; PARAPHYSES cylindrical, branched, septate, 2-3 um diam. at
the base, with brownish intercellular pigment, slightly to not enlarged at the
apex; AscI 8-spored, cylindric-clavate, irregularly biseriate or uniseriate, 120-
175 x 15-17.5 um, with a short stipe, rounded above; Ascosporgs 1-celled,
ellipsoid, with rounded ends, at first hyaline, then brown to reddish brown,
smooth, 21.5-26.5 x 11.5-12.5 um.
SPECIMEN EXAMINED—BRAZIL. PERNAMBUCO: Recife, Universidade Federal de
Pernambuco, on horse dung, 06.V1.2017, D.B.P. Monte s.n. (URM92165).
DISTRIBUTION— Asia (China). This is the first record for the Neotropics.
CoMMENTS—Ascobolus castaneus is distinguished by its chestnut brown
mature apothecia and completely smooth ascospores. It can be confused
with other common members of A. sect. Gymnascobolus Brumm., such as A.
scatigenus (Berk. & M.A. Curtis) Brumm., when young—both present similar
apothecia up to the mesohymenial phase but can be immediately distinguished
when mature. Ascobolus scatigenus has relatively large receptacles, white to
pale luteous, furfuraceous disks composed of protruding asci with ellipsoid
340 ... Melo & al.
ascospores (22-24.5 x 10-15 um according Melo & al. 2014), usually with a
single to few oblique epispore fissures. The material was collected in situ on
horse dung and not observed in moist chamber incubation like the others
mentioned in this work. The ascospores are smaller than those in the Chinese
material described by Van Brummelen (1972; 15-19.5 x 7.5-9 um).
Sordariomycetes, Coniochaetales, Coniochaetaceae
Coniochaeta philocoproides (Griffiths) Cain,
Univ. Toronto Stud., Biol. Ser. 38: 65 (1934) FIG. 1K-O
PERITHECIA Scattered to gregarious, partially immersed, subglobose to
obpyriform, brown to dark brown, 325-410 x 310-390 um; NECK short,
papilliform, occasionally indistinct; PER1IDrIUM membranaceous, opaque,
dark brown, becoming dark brown to finally black towards the neck; Hairs
dark brown to black, rigid, usually straight, simple, thick-walled, non-septate,
becoming thinner at the apex, abundant at the neck; Asci 32-spored, cylindric
to cylindric-clavate, irregularly triseriate to tetraseriate, 112-120 x 14-20 um,
with a short stipe, rounded above; Ascosporss 1-celled, variable in length,
ellipsoid to oblong in frontal view, conical in lateral view, light brown to golden
when young, becoming dark brown at maturity, smooth, 7.5-12(-22) x 57.5 um,
with a lateral straight germ slit through the entire length of the spore, without
conspicuous gelatinous sheath; CoNrDIoPpHORES hyaline, simple or branched,
septate; CONIDIOGENOUS CELLS enteroblastic, hyaline, consisting of discrete
phialides, ampulliform to lageniform, 10-15(-22.5) x 2.5-3 um, with
cylindrical collarettes, 1-2 um long; Conip1a not observed.
SPECIMEN EXAMINED—BRAZIL. PERNAMBUCO: Caruaru, Instituto Agrondmico de
Pernambuco (IPA), on horse dung, 28.11.2013, R-ER. Melo s.n. (URM86634).
DISTRIBUTION—Europe (Norway), North America (USA), and Oceania (New
Zealand). This is the first record for the Neotropics.
ComMENTS— The specimen from Brazil matches closely the material described
by Asgari & al. (2007). Coniochaeta philocoproides, a rare species reported on
herbivore dung, is one of the few documented multispored species in this genus.
Asci of C. polymegasperma M.J. Richardson are 64-spored, and its ascospores
are longer (13-16.5 um) and larger (9.5-13.5 um) than C. philocoproides.
Figure 1. Brazilian dung fungi: Delitschia vulgaris. A. pseudothecium on dung; B. ascus; C. mature
ascospore, with two visible germ slits, once at each cell. Coprotus albidus. D. apothecia on dung;
E. mounted apothecium, with asci in different developmental stages. Thelebolus microsporus.
E apothecia on dung; G. ascospores. Ascobolus castaneus. H. apothecia on dung; I. hymenium,
Coprophils new for Brazil... 341
with asci in different developmental stages; J. ascospores. Coniochaeta philocoproides.
K. perithecium on dung; L, M, N. ascospores from the same ascus, considerably different in length;
O. phialide. Arnium hirtum. P. perithecia on dung; Q. perithecial hairs; R. mature ascospores.
Scale bars: A = 750 um; B, E = 20 um; C, J = 10 um; D = 500 um; F = 100 um; G = 7.5 um; H =
mm; I = 25 um; K = 200 um; L-O = 5 um; P = 400 um; Q = 2.5 um; R= 15 um.
342 ... Melo & al.
Coniochaeta hansenii (Oudem.) Cain is reported with 64-128-spored asci and
slightly different ascospore measurements (6-9 x 5-9 um) (Asgari & al. 2007).
Sordariomycetes, Sordariales, Lasiosphaeriaceae
Arnium hirtum (E.C. Hansen) N. Lundgq. & J.C. Krug,
Symb. Bot. Upsal. 20(1):218 (1972) FIG. 1P—-R
PERITHECIA scattered to isolated, semi-immersed to superficial, obpyriform,
690-930 x 480-540 um, reddish brown to dark brown, translucent, covered
by hyphoid, slender, flexuous hairs, septate, 2-2.5 um thick; NECK cylindrical
to conical, opaque, 150-165 x 130-140 um, tomentose, neck hairs more
rigid and setose, <7 um long, becoming thinner towards the apex; PERIDIUM
membranaceous, subopaque to olivaceous brown, darkening towards the neck
to finally black, 3-layered—outer peridial layer composed of large, inflated,
angular cells, thick-walled, 5-10 um diam., forming a short palisade that
resembles inflated perithecial hairs; PARAPHYSES interspersed with the asci,
ventricose, persistent or collapsing; Asc1 8-spored, cylindric to cylindric-
clavate, 350-400 x 25.5-35.5 um, usually persistent, with rounded apex and
a long stipe; Ascosporgs at first fusoid to ellipsoid, hyaline, later becoming
ochraceous to olivaceous brown, with several oil droplets, and finally dark
brown, bicaudate; 35-47.5 x 18.5-22.5 um, with an eccentric germ pore; APICAL
CAuDA single, 7.5-9 um diam., becoming thinner towards its apex, up to 42.5
um long, usually persistent in mountings, longitudinally striped, covering the
germ pore; BASAL CAUDA similar in morphology, slightly thinner and longer,
5-6 um wide at the base when not inflated, up to 50 um long, persistent or
collapsing when mounted.
SPECIMENS EXAMINED— BRAZIL. PERNAMBUCO: Serra Talhada, Instituto Agronémico
de Pernambuco (IPA), on goat dung, 24.X.2011, R-ER. Melo s.n. (URM86719); ,
Universidade Federal Rural de Pernambuco (UFRPE), on horse dung, 23.11.2012, R-ER.
Melo s.n. (URM86720).
DiIsTRIBUTION—Africa (Morocco), Europe (Belgium, England, Denmark,
France, Germany, Ireland, Norway, Scotland, Sweden) and North America
(USA). This is the first record for the Neotropics.
COMMENTS—Arnium species are distinguished from other dark-coloured
perithecial dung ascomycetes by their unicellular ascospores with gelatinous
caudae at both ends. Arnium hirtum presents a wide array of morphological
variation, having as its main characteristics the substrate (herbivore dung) and
the ascospore morphology: equilateral, non-septate and bicaudate (35-47.5
x 18.5-22.5 um). The present material fits well with the description of the
Coprophils new for Brazil ... 343
European specimens (Lundqvist 1972), with similar measurements and general
morphology. It is a common species in Europe, but rare outside that continent,
although more surveys will probably reveal new records for tropical areas.
Cercophora anisura N. Lundq., Symb. Bot. Upsal. 20(1): 91 (1972) FIG. 24, B
PERITHECIA isolated, semi-immersed, obpyriform, subglobose or conical,
480-515 x 350-400 um, light brown to golden, translucent, covered by hyphoid,
flexuous, occasionally branched hairs, about 2 um thick; NECK cylindrical to
conical, opaque, carbonaceous, dark brown to finally black close to the apex,
100-110 x 80-100 um, adorned with tufts of short, inflated and agglutinated
hairs, 2-2.5 um thick, septate, concolorous with the peridium in the lower
part of the perithecium; PERIDIuM pseudo-parenchymatous, membranaceous,
subopaque, darkening towards the neck to finally black, 3-layered—outer
peridial layer composed of angular to rounded cells, thin-walled, 4-9 um
diam.; PARAPHYSES interspersed with the asci, ventricose, persistent or
collapsing; Asci 8-spored, cylindric-clavate, 175-225 x 17.5-25 um, with a
long stipe and tapered apex, thickened, simple apical ring present; subapical
globule subglobose to ellipsoid, smooth to slightly verrucose, 4-5 um diam.;
Ascosportss at first cylindrical vermiform to slightly sigmoid, hyaline, with
several oil droplets, occasionally geniculate at the base, non-septate, smooth,
bicaudate, later becoming swollen in the upper part and finally 2-celled after
the formation of a transverse septum, delimiting the region of the spore that
will become the pigmented head cell above, and another part for the hyaline
pedicel below, irregularly biseriate to triseriate; HEAD CELL ellipsoid, truncated
at the base, non-septate, brown to dark brown, smooth, 15-19 x 7.5-8 um with
an eccentric germ pore; PEDICEL cylindrical, hyaline, occasionally geniculate
near the base, usually collapsing, 30-35 x 4-5 tum; APICAL CAUDA single,
cylindrical to conical, tapering towards the apex, 10-20 um long, 2-2.5 um
diam. at the base, usually collapsing; BASAL CAUDA similar in morphology,
thicker and longer, 20-28.5 x 3-3.5, usually collapsing.
SPECIMENS EXAMINED—BRAZIL. PERNAMBUCO: Recife, Universidade Federal Rural de
Pernambuco (UFRPE), on horse dung, 11.XIJ.2012, R.ER. Melo s.n. (URM86721a, b, c).
DISTRIBUTION—Europe (Sweden). This is the first record for the Neotropics.
ComMENTS— The Brazilian material was sparse and little information regarding
its morphological variation is presented here. Cercophora anisura was proposed
by Lundqvist (1972) in his monographic treatment of the Nordic Sordariaceae
from material on cattle dung in Sweden. The species can be confused with
C. mirabilis Fuckel, one of the most common Cercophora on herbivore dung,
344 ... Melo &al.
which differs by its larger perithecia (650790 x 340475 um), longer inflated
hairs (2-3.5 um), and ascospores with even caudae (Lundqvist 1972). In our
material of C. anisura, mature ascospores with multiseptate pedicels, ascospores
with both cells pigmented, and ascospores without the transverse septum were
commonly observed.
Cercophora sordarioides (Speg.) N. Lundg.,
Symb. Bot. Upsal. 20(1): 112 (1972) FIG. 2C-E
PERITHECIA scattered to isolated, semi-immersed to superficial, obpyriform,
subglobose or conical, 650-850 x 550-600 um, olivaceous to golden, translucent,
glabrous; NECK conical to slightly cylindrical, opaque, carbonaceous, dark
brown to finally black close to the apex, 200-350 x 190-200 um; PERIDIUM
pseudo-parenchymatous, membranaceous, subopaque, darkening towards the
neck to finally black, 3-layered—outer peridial layer with angular to rounded
cells, thin-walled, 7-10(-12.5) um diam.; PARAPHYSES interspersed with the
asci, filiform, persistent or collapsing; Asc 8-spored, clavate, 155.5-185 x
17.5-25 um, with a long stipe and tapered apex, thickened, simple apical ring
present; subapical globule subglobose to globose, smooth to slightly verrucose,
4-5.5 um diam.; Ascosporgs at first cylindrical to sigmoid, hyaline, with
several oil droplets, occasionally geniculate at the base, non-septate, smooth,
bicaudate, later becoming swollen in the upper part and finally 2-celled after
the formation of a transverse septum, delimiting the region of the spore that
will become the pigmented head cell above, and another part for the hyaline
pedicel below, irregularly biseriate to triseriate; HEAD CELL ellipsoid, truncated
at the base, usually with an eccentric transverse septum, brown to dark
brown, smooth, 17.5-22.5 x 7.5-11 um with a apical or subapical germ pore;
PEDICEL cylindrical, hyaline, occasionally geniculate near the base, persistent
or collapsing, 45.5-49 x 29.5-31 um; APICAL CAUDA single, cylindrical,
tapering towards the apex, 27.5-55 um long, 2.5-3 um wide at the base, usually
collapsing; BASAL CAUDA similar in morphology.
SPECIMEN EXAMINED—BRAZIL. PERNAMBUCO: Caruaru, Instituto Agrondmico de
Pernambuco (IPA), Caruaru, on horse dung, 23.X1.2012, R-ER. Melo. s.n. (URM86728).
DISTRIBUTION—Europe (Sweden). This is the first record for the Neotropics.
COMMENTS—Cercophora sordarioides is regarded as a rare species. It was
reported from Argentina by Spegazzini. The key characteristics are the
glabrous, olivaceous to dark-yellow perithecia with thin-walled peridial
cells and ascospores with septate head cells. The Brazilian material presents
longer pedicels in relation to Argentine material (37-38 um), as described in
Lundqvist (1972).
Coprophils new for Brazil ... 345
Sordariomycetes, Sordariales, Chaetomiaceae
Chaetomium citrinum Udagawa & T. Muroi,
Trans. Mycol. Soc. Japan 22: 15 (1981) FIG. 2F-H
PERITHECIA scattered to isolated, superficial, subglobose to obovoid,
yellowish to greenish in mass, dark brown when isolated, 250-300 x 240-280 um,
attached to the substrate by weakly pigmented rhizoids, light brown to brown,
thin-walled, dichotomously branched, non-septate, flexuous, usually smooth,
2.5-2.8 um diam.; TERMINAL HAIRS of one type — numerous, septate, wavy
to loosely coiled, forming distant and weakly organized coils along its length,
making 2-3 convolutions, 2.4-3 um diam., with almost constant diameter in
each turn towards the apex, light brown to golden, becoming less pigmented
close to the apex, extending up to 400(-450) um, markedly punctate in all its
extension, clustered above to form a strongly compact sporiferous head above
the perithecium, ellipsoid to columnar; LATERAL Hairs slightly similar in
morphology — numerous, long, filiform, tortuous, smooth, sparsely septate,
thin-walled, light brown to golden, slightly less pigmented than the terminal
hairs, 1.9-2.4 um, extending up to 350 um; PERIDIUM pseudo-parenchymatous,
membranaceous, fragile, with flattened, angular to elongate, slightly thick-
walled cells; Asci 8-spored, clavate, spore-bearing part 9-12.5 um diam., with a
short stipe, evanescent; ASCosPorREs variable in shape, ellipsoid, long-ellipsoid,
ovoid, fusoid to limoniform, biapiculate or not, dark brown when mature,
smooth or with superficial cracklings, 7.4-10.6 x 4.8-6.5 um.
SPECIMENS EXAMINED—BRAZIL. PERNAMBUCO: Caruaru, Instituto de Pesquisas
Agronémicas, on goat dung: 27.11.2012, R.ER. Melo s.n. (URM86708), 25.V1.2012, R.ER.
Melo s.n. (URM86709a, 86709b), Recife, Universidade Federal Rural de Pernambuco
(UFRPE), on goat dung, 16.1V.2012, R-ER. Melo s.n. (URM86710).
DISTRIBUTION— Asia (Japan), North America (Canada). This is the first record
for the Neotropics.
COMMENTS—Chaetomium citrinum presents a striking diagnostic feature of
greenish-yellow perithecia, especially when occurring in groups. Ascospore
shapes are quite variable in this species, even irregular or with protuberances. It
is a rarely encountered species of Chaetomium. The present material has larger
perithecia than the Japanese strain (160-250 um), as described by von Arx &
al. (1986).
Chaetomium cochliodes Palliser, N.Amer. Fl. 3(1): 61 (1910) FIG. 21-K
PERITHECIA scattered to isolated, superficial, subglobose to doliform,
grayish in stereomicroscopy, dark brown to black when mounted, 310-340
346 ... Melo & al.
x 280-295 um, attached to the substrate by hyaline, thin-walled rhizoids,
1.5-2.5 um diam.; TERMINAL HAIRS of two types — (1) initially straight,
from the proximal end until up to half of its length, becoming loosely spaced
and coiled toward the apex, making 3-4 convolutions and progressively
smaller in diameter (“corkscrew” type), brown to golden, becoming less
pigmented close to the apex, extending up to 300 um above the sporiferous
head, 5-7.5 um diam., smooth to roughened, without conspicuous septa,
loosely clustered to form a weakly compact sporiferous head above the
ascoma; (2) wavy, thinner, flexuous, septate, not forming coils, projecting
above the sporiferous head, usually intertwined with the coiled hairs,
markedly roughened, olivaceous brown to pale brown, up to 3 um diam.;
LATERAL HAIRS numerous, long, filiform, tortuous, smooth, septate, thin-
walled, light brown to golden, slightly less pigmented than the terminal hairs,
3.5-5.5 um, extending <200 um, slightly bulbous at the base; PERrpIUM
pseudo-parenchymatous, membranaceous, fragile, with flattened, angular
to slightly elongate, slightly thick-walled cells, 7.5-15 um diam.; Asc1
8-spored, clavate, spore-bearing part 30-40 x 15-22.5 um, with a short stipe,
evanescent; AscosporEs limoniform, biapiculate, light brown to olivaceous
brown when mature, smooth, 8.5-10 x 7-8 um.
SPECIMENS EXAMINED—BRAZIL. PERNAMBUCO: Serra Talhada, Instituto Agronémico
de Pernambuco (IPA), on goat dung, 16.V.2012, R-ER. Melo s.n. (URM8671 1a, b, c).
DIsTRIBUTION—Africa (South Africa), Asia (India, Japan, Nepal),
Europe (Belgium, England, Netherlands, Norway), North America
(Canada, USA), and South America (Argentina). This is the first record
for Brazil.
COMMENTS—Chaetomium cochliodes is a common species in indoor
air samples, occasionally reported in herbivore dung. The material
examined in Brazil was consistent with the protologue description:
terminal hairs of two types: one long, simple, becoming coiled above the
sporiferous head, and the other type septate, wavy, usually rough-walled.
It can be confused with C. globosum Kunze, a common species with wide
circumscription, but differing by the thinner terminal hairs (3.5-4.5 um)
and larger ascospores (9-12 x 7.5-8 um) (Ames 1961).
FiGuRE 2. Brazilian dung fungi: Cercophora anisura. A. perithecium on dung; B. ascospore.
Cercophora sordarioides. C. perithecia on dung; D. ascal apical globule; E. mature ascospore.
Chaetomium citrinum. F. perithecia on dung; G. mounted perithecium; H. ascospores.
Chaetomium cochliodes. 1. mounted perithecium; J. perithecial rhizoids; K. ascospores.
Coprophils new for Brazil ... 347
Chaetomium spirale. L. perithecium on dung; M. coiled terminal hair; N. ascospores. Sordaria
lappae. O. perithecia on dung; P. mounted perithecium; Q. ascospore. Scale bars: A, F = 250 um;
B= 7.5 um; C = 750 um; D, K, Q=5 m; E, M = 15 um; G = 100 um; H, J, N = 10 um; I = 150 um;
L, P = 50 um; O = 300 um.
348 ... Melo & al.
Chaetomium spirale Zopf,Nova Acta Acad. Caes. Leop.-Carol.
German. Nat. Cur. 42(5): 275 (1881) FIG. 2L-N
PERITHECIA Scattered to isolated, superficial, globose to ovoid, grayish
in stereomicroscopy, dark brown when mounted, 150-175 x 150-165 um,
attached to the substrate by weakly pigmented, light brown to brown, thin-
walled rhizoids, 2.5-3 um diam.; TERMINAL HAIRS of one type—initially
curved from the proximal end until up to half of its length, becoming
strongly coiled toward the apex, making 7-12 (usually nine) convolutions,
<30 um diam., progressively smaller in diameter towards the apex
(“corkscrew” type), olivaceous brown to golden, usually not becoming less
pigmented close to the apex, extending up to 350 um above the sporiferous
head, 2.5—-5 um diam.., finely punctate to verrucose, loosely clustered to form
a weakly compact sporiferous head above the perithecium; LATERAL HAIRS
scarce, filiform, tortuous, smooth to slightly punctate, usually setose, light
brown to golden, slightly less pigmented than the terminal hairs, 3.5-4 um,
extending up to 150 um, slightly bulbous at the base; PERIDIUM pseudo-
parenchymatous, membranaceous, fragile, with flattened, angular, slightly
thick-walled cells, 4.5-12 um diam.; Asci 8-spored, clavate, spore-bearing
part 32.5-37 x 7.5-12.5 um, with a short stipe, evanescent; ASCOSPORES
subglobose to limoniform, weakly biapiculate, light brown to olivaceous
brown when mature, smooth, 8.5-9 x 5.5—7.5 um.
SPECIMEN EXAMINED—BRAZIL. PERNAMBUCO: Caruarru, Instituto Agronoémico
de Pernambuco (IPA), Caruaru, on goat dung, 7.X.2011, R.ER. Melo s.n.
(URM867 16).
DISTRIBUTION—Africa (Egypt, Iraq, Kenya, Kuwait, Libya, Swaziland,
Sudan, Tanzania, Zambia), Asia (India, Japan, Malaysia), Europe (Czech
Republic, England), North America (USA) and Oceania (Australia, New
Zealand, Papua New Guinea). Probably worldwide. This is the first record
for the Neotropics.
CoMMENTS—Among similar Chaetomium species that present coiled
“corkscrew” terminal hairs with convolutions progressively decreasing in
diameter toward the apex, C. spirale differs from C. convolutum Chivers by
its smaller, more globose perithecia and by the terminal hairs with more
convolutions (7-12). It also differs from C. cochliodes by lacking a second
type of terminal hair besides the coiled ones, and from C. aterrimum Ellis
& Everh. ex Palliser in which the terminal hairs are uniform in diameter.
The material presented here fits well the description provided by Ames
(1961).
Coprophils new for Brazil ... 349
Sordariomycetes, Sordariales, Sordariaceae
Sordaria lappae Potebnia, Ann. Mycol. 5: 13 (1907) FIG. 20-Q
PERITHECIA usually scattered, rarely isolated, semi-immersed to
superficial, obpyriform to slightly obovoid, brown to golden, 475-550 x
300-315 um, translucent, glabrous; neck cylindrical to papilliform, opaque,
carbonaceous, dark brown to finally black close to the apex, 150-170
x 140-150 um; PERIDIUM pseudo-parenchymatous, membranaceous,
subopaque, darkening towards the neck to finally black—outer peridial
layer with angular cells, thick-walled, 7.5-17.5 um long, occasionally
inflated; PARAPHYSES not observed; Ascr 8-spored, cylindrical, 160-190
x 16-17.5 um, with a short stipe and tapered apex; AscosporeEs obovoid
to subglobose, light brown to golden when young, dark brown when
mature, smooth, 18-22.5 x 15-17.5 um, guttulate, with a basal germ pore,
surrounded by a thin, hyaline gelatinous sheath except at the germ pore.
SPECIMENS EXAMINED—BRAZIL. PERNAMBUCO: Recife, Universidade Federal
Rural de Pernambuco (UFRPE), on horse dung, 04.IV.2012, R.ER. Melo s.n.
(URM86770a, b).
DIsTRIBUTION—Africa (Kenya, Tanzania, Uganda, Zaire), Europe (Czech
Republic, England, Finland, France, Italy, Russia, Sweden), North America
(Canada, USA) and South America (Argentina, Colombia). Possibly
worldwide. This is the first record for Brazil.
CoMMENTS—‘Sordaria lappae, although recorded in many countries, is of
difficult determination. Sordaria fimicola (Roberge ex Desm.) Ces. & De
Not. differs from S. lappae by its less brightly coloured peridium and less
inflated cells and by its smaller and less apically rounded ascospores (15-
22.5 x 10-12.5 um) (Lundqvist 1972). The material from Brazil presents
slightly wider ascospores when compared to the material described by
Lundqvist (13-15 um; 1972).
Discussion
Recent surveys and inventories examining understudied substrates in
tropical areas has led to novel information on the geographical distribution
of fungal species. Coprophilous fungi as an ecological group are considered
to occur worldwide, but their occurrence is closely tied to herbivore
occurrence, so the factors that determine their geographical range are still
subject to discussion. Considering that the discovery of new fungal records
is quite frequent, this group may serve as an indicator of the advances
in taxonomical and ecological knowledge in a region. In the present
350 ... Melo & al.
study, representatives of three major ascomycete groups were recorded.
Sordariomycetes represents a large clade, including non-lichenized
ascomycetes with perithecial ascomata (Zhang & al. 2006). Arnium hirtum
is known from Africa, Europe, and North America. The new record for
South America suggests that this species may have a worldwide distribution.
Members of Chaetomium, recently studied by Wang & al. (2016), were
reported for the first time in South America. Although not specialized
on dung, these fungi can be common in cellulose-rich substrates, and
incubation in moist chambers could subvert limiting factors that would
otherwise prevent its sampling and identification. Leotiomycetes contains
mostly forms formerly known as inoperculate discomycetes: apothecial
ascomycetes with asci with a non-operculum apical apparatus (Wang & al.
2006). Thelebolales is the main group of this class that occurs on herbivore
dung. The discovery of Coprotus albidus updates the Coprotus species from
Brazil recently studied by Melo & al. (2015a). Among the Pezizomycetes,
usually regarded as “operculate discomycetes,’ Ascobolaceae species are the
most well known on herbivore dung. The Ascobolus castaneus record is the
most significant for the group, considering that A. castaneus was previously
recorded only from China. Similarly, Syncephalis Tiegh. & G. Le Monn., a
zygosporic mycoparasite of coprophilous ascomycetes previously recorded
only in Taiwan, produced in Brazil two second worldwide records: S. clavata
(Melo & al. 2011) and S. obliqua (Melo & al. 2015b). The coprophilous
mycobiota of Brazil is obviously rich and diverse, and further studies will
increase our understanding of their patterns of occurrence, distribution,
and substrate not only in South America but on other continents as well.
Acknowledgments
The authors thank Laise de Holanda Cavalcanti Andrade (Universidade Federal
de Pernambuco, Brazil) and Nadja Santos Vitéria (Universidade do Estado da Bahia,
Brazil) for helpful suggestions and pre-submission review of the manuscript. The
authors would also like to thank the Coordenacao de Aperfeigoamento de Pessoal de
Nivel Superior (CAPES) and the Conselho Nacional de Desenvolvimento Cientifico
e Tecnolégico (CNPq-Ciéncia sem Fronteiras; INCT-Herbario Virtual da Flora e
dos Fungos). L.C. Maia acknowledges the research fellowship and grants provided
by CNPq (INCT-HVFFE, Protax, Sisbiota).
Literature cited
Ames LM. 1961. A monograph of the Chaetomiaceae. U.S. Army, Research and Development,
Washington DC. 125 p.
Coprophils new for Brazil... 351
Asgari B, Zare R, Gams W. 2007. Coniochaeta ershadii, a new species from Iran, and
a key to well-documented Coniochaeta species. Nova Hedwigia 84: 175-187.
https://doi.org/10.1127/0029-5035/2007/0084-0175
Basumatary SK, McDonald HG. 2017. Coprophilous fungi from dung of the greater one-
horned rhino in Kaziranga National Park, India and its implication to paleoherbivory and
paleoecology. Quaternary Research 88: 14-22. https://doi.org/10.1017/qua.2017.34
Bell A. 1983. Dung fungi: an illustrated guide to coprophilous fungi in New Zealand. Victoria
University Press, Wellington. 88 p.
Bell A. 2005. An illustrated guide to the coprophilous Ascomycetes of Australia. CBS Biodiversity
Series 3. 172 p.
Brummelen J van. 1967. A world-monograph of the genera Ascobolus and Saccobolus
(Ascomycetes, Pezizales). Persoonia Supplement 1. 260 p.
Calaga FJS, Silva NC da, Xavier-Santos S. 2014. A checklist of coprophilous fungi
and other fungi recorded on dung from Brazil. Mycotaxon mycobiota [22 p.]
http://www.mycotaxon.com/resources/checklists/calaca_v128_checklist.pdf [Abstract:
Mycotaxon 128: 205. https://doi.org/10.524 8/128.205].
Doveri F. 2004. Fungi fimicoli Italici. Associazione Micologica Bresadola, Trento. 1104 p.
Hoog GS de, Géttlig E, Platas G, Genilloud O, Leotta G, Brummelen J van. 2005. Evolution,
taxonomy and ecology of the genus Thelebolus in Antarctica. Studies in Mycology 51: 33-76.
Kimbrough JW, Luck-Allen ER, Cain RF. 1972. North American species of Coprotus ( Thelebolaceae:
Pezizales). Canadian Journal of Botany 50: 957-971. https://doi.org/10.1139/b72-116
Kirschner R, Hsu T, Tuan NN, Chen CL, Huang SL. 2015. Characterization of fungal and
bacterial components in gut/fecal microbiome. Current Drug Metabolism 16(4): 272-283.
https://doi: 10.2174/1389200216666 150812124625
Luck-Allen ER, Cain RE 1975. Additions to the genus Delitschia. Canadian Journal of Botany
53(17): 1827-1887.
Lundqvist N. 1972. Nordic Sordariaceae s.lat. Symbolae Botanicae Upsalienses 20(1). 374 p.
Melo RFR, Santiago ALCMA, Cavalcanti MAQ. 2011. Syncephalis clavata (Zoopagales,
Zygomycetes), a first record from the Neotropics. Mycotaxon 116: 113-136.
https://doi.org/10.5248/116.133
Melo RER, Bezerra JL, Cavalcanti MAQ. 2012. Diversity of coprophilous ascomycetes from
captive wild animals in Dois Irmaos State Park, Brazil. Nova Hedwigia 94: 153-162.
https://doi.org/10.1127/0029-5035/2012/0094-0153
Melo RER, Miller AN, Santiago ALCMA, Maia LC. 2014. The genera Ascobolus and Saccobolus
(Ascobolaceae, Pezizales) in Brazil. Mycosphere 4: 363-454.
https://doi.org/10.5943/mycosphere/5/6/9
Melo RER, Miller AN, Maia LC. 2015a. Coprotus (Thelebolaceae, Thelebolales) in herbivore dung
from Brazil. Nova Hedwigia 101: 35-48. https://doi.org/10.1127/nova_hedwigia/2014/0232
Melo RFR, Maia LC, Santiago ALCMA. 2015b. The discovery of Syncephalis obliqua
(Zoopagomycotina, Zoopagales) in the Neotropics. Mycotaxon 130: 1165-1169.
https://doi.org/10.5248/130.1165
Melo RFR, Maia LC, Miller AN. 2017. Coprophilous ascomycetes with passive ascospore
liberation from Brazil. Phytotaxa 295: 159-172. https://doi.org/10.11646/phytotaxa.295.2.4
Newcombe G, Campbell J, Griffith D, Baynes M, Launchbaugh K, Pendleton R. 2016. Revisiting
the life cycle of dung fungi, including Sordaria fimicola. PLoS ONE 11(2): e0147425 [11 p.].
https://doi.org/10.1371/journal.pone.0147425
352 ... Melo & al.
Richardson MJ. 2001. Diversity and occurrence of coprophilous fungi. Mycological Research
105: 387-402. https://doi.org/10.1017/s0953756201003884.
Richardson MJ, Watling R. 1997. Keys to fungi on dung, 2nd ed. Stourbridge, British
Mycological Society. 68 p.
Souza CAF de, Lima DC, Gurgel LMS, Santiago ALCMA. 2017. Coprophilous Mucorales (ex
Zygomycota) from three areas in the semi-arid of Pernambuco, Brazil. Brazilian Journal of
Microbiology 48: 79-86. https://doi.org/10.1016/j.bjm.2016.09.008
von Arx JA, Guarro J, Figueras MJ. 1986. The ascomycete genus Chaetomium. Beihefte zur
Nova Hedwigia 84. 162 p.
Wang Z, Johnston PR, Takamatsu S, Spatafora JW, Hibbett DS. 2006. Toward a phylogenetic
classification of the Leotiomycetes based on rDNA data. Mycologia 98: 1065-1075.
https://doi.org/10.1080/15572536.2006.11832634
Wang XW, Houbraken J, Groenewald JZ, Meijer M, Andersen B, Nielsen KF, Crous PW, Samson
RA. 2016. Diversity and taxonomy of Chaetomium and chaetomium-like fungi from indoor
environments. Studies in Mycology 84: 145-224.
https://doi.org/10.1016/j.simyco.2016.11.005
Zhang N, Castlebury LA, Miller AN, Huhndorf SM, Schoch CL, Seifert KA, Rossman AY,
Rogers JD, Kohlmeyer J, Volkmann-Kohlmeyer B, Sung GH. 2006. An overview of the
systematics of the Sordariomycetes based on a four-gene phylogeny. Mycologia 98: 1076-1087.
https://doi.org/10.3852/mycologia.98.6.1076
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 353-357
https://doi.org/10.5248/134.353
Two Heterostelium species newly recorded from China
Pu Liu, SHUNHANG ZHANG, XIAOYAN ZHOU, JIANJUN ZHAO, Yu LI*
Engineering Research Center of Chinese Ministry of Education for Edible and
Medicinal Fungi, Jilin Agricultural University, Changchun, 130118, P. R. China
* CORRESPONDENCE TO: [email protected]
ABSTRACT—Two species of dictyostelid cellular slime molds new to China (Heterostelium
anisocaule and H. arachnoideum) were isolated from samples of soil/humus collected in East
China. Descriptions and illustrations based on these isolates are provided.
Key worps—Amoebozoa, taxonomy, forest soils
Introduction
Dictyostelid cellular slime molds (dictyostelids) are key components of the
soil microbiota and play a role in maintaining the balance that exists between
bacteria and other organisms (Raper 1984). Dictyostelids have been reported
from several localities in China (He & Li 2010; Liu & Li 2012a,b, 2014, 2017;
Liu & al. 2019), but there are relatively few reports of this group from East
China (Yeh & Chien 1983, Hagiwara & al. 1985, Zhao & al. 2017). East China
includes Shandong Province, Jiangsu Province, Anhui Province, Zhejiang
Province, Jiangxi Province, Fujian Province, Shanghai, and Taiwan. Two species
of dictyostelids, reported originally from the Southern Hemisphere, were
isolated from samples of soil/humus collected from this region. Descriptions
and illustrations based on these isolates are provided herein.
Materials & methods
Samples were collected during 2012 from Jiangsu Province, Fujian Province, and
Taiwan. Each sample consisted of 30-50 g of soil/humus and was placed in a sterile
whirl-pack plastic bag. Each sample bag was numbered and the sample itself preserved
354 ... Liu & al.
at 4 °C in the herbarium of the Mycological Institute of Jilin Agricultural University,
Changchun, China (HMJAU). Isolation methods followed Cavender & Raper (1965),
with some minor modifications outlined by Liu & al. (2019). Isolates were identified
with reference to Raper (1984) and following the new classification system of Sheikh
& al. (2018). The characteristic stages in the life cycle, including cell aggregation and
the formation of pseudoplasmodia and sorocarps, were observed under a Zeiss Axio
Zoom V16 dissecting microscope with a 1.5x objective and 10x ocular. Slides with
sorocarps were prepared with water as the mounting medium. Features of spores,
sorophores, and sorocarps were observed and measured using a Zeiss Axio Imager A2
light microscope with 10x ocular and 10, 40, and 100x (oil) objectives. Photographs
were taken with Zeiss Axiocam 506 color microscope camera. Spores from these plates
were frozen in HL 5 media (Cocucci and Sussman 1970) and stored at — 80 °C in
HMJAU.
Taxonomy
Heterostelium anisocaule (Cavender &al.) S. Baldauf, S. Sheikh & Thulin,
Protist 169: 14. 2018. PLATE 1a-e
When cultured at 23 °C on non-nutrient agar with Escherichia coli,
sorocarps white, erect to prone, solitary to clustered, prostrate, phototropic,
normally 3-9 mm. Sorophores asymmetrical, sinuous, with 1-7 whorls, each
whorl comprising 1-4 branches. Sorophore tips and the upper portion of the
sorophore consist of one tier of cells, bases round. Terminal sori white, globose,
commonly 60-160 um in diam. Lateral sori white, globose, 15-85 um in diam.
Spores elliptical 5-9.5x3-5.5 um, with unconsolidated granules. Aggregations
of the “violaceum” type.
SPECIMEN EXAMINED— CHINA, JIANGSU PROVINCE, Jintan, Mao Mountains, soil
(S2593) collected in broadleaf forest, 19 Aug. 2012, Liu & al.; isolated in 2014 (HMJAU
MRI174).
ComMMENTS—Heterostelium anisocaule was first isolated from a sample
collected in a podocarp/broadleaf forest in Northland, New Zealand. This
species has a wide range of temperature adaptation (18-30 °C). Variations in
temperature and light exposure result in a considerable variation in sorocarp
size. The optimum temperature is 22-23 °C (Cavender & al. 2002).
Heterostelium arachnoideum (Vadell & Cavender) S. Baldauf, S. Sheikh &
Thulin, Protist 169: 14. 2018. PLATE 1f-n
When cultured at 23 °C on non-nutrient agar with E. coli, sorocarps
white, erect to prone, sometimes prostrate, solitary to clustered, with slightly
phototropic growth, 5-14 mm or more. Sorophores asymmetrical, with 3-20
whorls, each whorl with 2-5 uneven branches. The lower portion of the
Two Heterostelium spp. new for China... 355
PLATE 1. Heterostelium anisocaule: a, b. Sorocarps; c. Aggregation; d. Sorophores and branches;
e. Spores. Heterostelium arachnoideum: f, g, i. Sorocarps; h. Aggregation; j, k. Sorophore tip;
1. Sorophores and branches; m. Sorophore base; n. Spores. Scale bars: a, b, f, g = 1 mm; c,h = 100 um;
d, j, k= 20 um; e, n= 5 um; i = 0.5 mm; 1 = 50 um; m = 30 um.
sorophore sometimes with secondary whorls. Sorophore tips consist of one
tier of cells, sinuous, becoming tangled together to form a delicate spider-
web-like structure, especially sometimes without sori present. Bases clavate,
356 ... Liu & al.
irregular. Terminal sori white, globose, commonly 30-135 um in diam. Lateral
sori white, globose, commonly 20-50 um in diam. Spores elliptical or oblong,
mostly 5.5-8x3-4.5, with unconsolidated polar granules. Aggregations of the
“violaceum” type. Late sorogens sometimes curved.
SPECIMEN EXAMINED- SPECIMEN EXAMINED: CHINA, JIANGSU PROVINCE, Yixing, soil
(S2570) collected in broadleaf forest, 22 Aug. 2012, Liu & al.; isolated in 2014 (HMJAU
MRI175). FUJIAN PROVINCE, Fuzhou, Gu Mountain, soil (S2031) collected in mixed
forest, 11 Mar. 2012, Liu & al.; isolated in 2014 (HMJAU MR209). Tatwan, Yilan,
Lotung Sports Park, soil (S2936) collected in humus, 11 Sep. 2012, Liu & al.; isolated in
2014 (HMJAU MR210).
ComMMENTS—Heterostelium arachnoideum was originally isolated from soil litter
collected from three sites within Iguazu National Park, Misiones, Argentina.
This species is characterized by its spider web-like terminal sorophores (Vadell
& Cavender 2007).
Acknowledgments
We wish to express our appreciations to two peer reviewers Prof. Steven L.
Stephenson (University of Arkansas, USA) and Prof. John C. Landolt (Shepherd
University, WV USA) for their valuable comments relating to this manuscript. This
study was supported by the National Natural Science Foundation of China (No.
31870015, 31300016), Science and Technology Development Program of Jilin Province
(No. 20180101273JC), 111 Project (No. D17014), and the Science and Technology
Research Programs of the Education Department of Jilin Province in the Thirteenth
Five-Year Plan (No. JJKH20180671KJ).
Literature cited
Cavender JC, Raper KB. 1965. The Acrasiae in nature. I. Isolation. American Journal of Botany
52: 294-296.
Cavender JC, Stephenson SL, Landolt JC, Vadell EM. 2002. Dictyostelid cellular slime moulds
in the forests of New Zealand. New Zealand Journal of Botany 40: 235-264.
https://doi.org/10.1080/0028825X.2002.9512786
Cocucci, $.M., Sussman, M., 1970. RNA in cytoplasmic and nuclear fractions of cellular slime
mold amebas. Journal of Cell Biology 45: 399-407. https://doi.org/10.1083/jcb.45.2.399
Hagiwara H, Yeh ZY, Chien CY. 1985. Dictyostelium macrocephalum, a new dictyostelid cellular
slime mold from Taiwan. Bulletin of the National Science Museum, Series B, 11: 103-108.
He XL, Li Y. 2010. A new species of Dictyostelium from Tibet, China. Mycotaxon 111:
287-290. https://doi.org/10.5248/111.287
Liu P, Li Y. 2012a. Dictyostelids from Heilongjiang Province, China. Nova Hedwigia 94(1-2):
265-270. https://doi.org/10.1127/0029-5035/2012/0094-0265
Liu P, Li Y. 2012b. New records of dictyostelids from China. Nova Hedwigia 94(3-4): 429-436.
https://doi.org/10.1127/0029-5035/2012/0010
Liu P, Li Y. 2014. Dictyostelids from Jilin Province, China. I. Phytotaxa 183(4): 279-283.
https://doi.org/10.11646/phytotaxa.183.4.7
Two Heterostelium spp. new for China ... 357
Liu P, Li Y. 2017. Dictyostelids from Jilin Province, China. II. Phytotaxa 323(1): 077-082.
https://doi.org/10.11646/phytotaxa.323.1.6
Liu P, Zou Y, Li Shu, Stephenson SL, Li Y. 2019. Two new species of dictyostelid cellular slime
molds in high-elevation habitats on the Qinghai-Tibet Plateau, China. Scientific Reports
9:5 [13 p.]. https://doi.org/:10.1038/s41598-018-37896-7
Raper KB. 1984. The Dictyostelids. Princeton University Press, Princeton, New Jersey.
Sheikh S, Thulin M, Cavender JC, Escalante R, Kawakami S, Lado C, Landolt JC,
Nanjundiah V, Queller DC, Strassmann JE, Spiegel FW, Stephenson SL, Vadell
EW, Baldauf SL. 2018. A new classification of the dictyostelids. Protist 169: 1-28.
https://doi.org/10.1016/j.protis.2017.11.001.
Vadell EM, Cavender JC. 2007. Dictyostelids living in the soils of the Atlantic Forest, Iguazu
region, Misiones, Argentina: description of new species. Mycologia 99(1): 112-124.
https://doi.org/10.1080/15572536.2007.11832606
Yeh ZY, Chien CY. 1983. Cellular slime molds in Taiwan I: Four newly recorded species.
Biological Bulletin of National Taiwan Normal University 18: 69-86.
Zhao M, Liu P, An Y, Yao Y, Li Y. 2017. Dictyostelium annularibasimum (Dictyosteliaceae,
Dictyostelida), a new purple species from China. Nova Hedwigia 104(1-3): 351-358.
https://doi.org/info:doi/10.1127/nova_hedwigia/2016/0381
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 359-367
https://doi.org/10.5248/134.359
Pseudocercospora meliosmicola sp. nov. and
three new Pseudocercospora records from China
QIAN ZHAO’, BAo-Ju Li’, YAN-XIA SHIT’,
XUE-WEN XIE’, A-LI CHAI’, YING-LAN GUO?*
"Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences,
Beijing 100081, PR. China.
? Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, PR. China
* CORRESPONDENCE TO: [email protected]
ABSTRACT—A new species, Pseudocercospora meliosmicola, and three new records, P. deglupta,
P. eucalyptigena, and P. infuscans, are reported from China. Descriptions, illustrations, and
discussions of the species concerned are provided. The examined specimens are deposited
in HMAS.
Key worps—biodiversity, cercosporoid fungi, Meliosma parviflora, Mycosphaerellaceae,
taxonomic novelty
Introduction
Pseudocercospora Speg. (Spegazzini 1910), with more than 1600 names
recorded, represents the largest genus of cercosporoid hyphomycetes. The genus
comprises plant pathogens either causing distinct necrotic spots or forming
effuse fungal colonies without any definite spots, on leaves, stems, flowers, and
fruits. Some species are known to cause severe diseases on important crops,
which is also reflected in plant quarantine regulations. On the other hand,
some have been used as biological control agents of weeds (Den Breeyen &
al. 2006). More than 400 Pseudocercospora species have been reported from
China (Liu & Guo 1998). Here we propose Pseudocercospora meliosmicola on
Meliosma parviflora as a new species, and report P. deglupta, P. eucalyptigena,
and P infuscans as new records for China.
360 ... Zhao & al.
Taxonomy
Pseudocercospora deglupta Crous, Mycol. Mem. 21: 127, 1998. FIG. 1
Leaf spots amphigenous, subcircular to angular, without definite margin,
1-5 mm wide, confluent, pale gray to gray to brown, with a pale gray to
pale olivaceous brown halo on the upper surface, pale grayish brown to
pale brown on the lower surface. Fruiting hypogenous. Mycelium internal.
Stromata absent or well-developed, substomatal, subglobose, dark brown,
20-40 um diam. Conidiophores few, emerging through stomata, or in dense
fasciculate, olivaceous brown to dark olivaceous brown, paler towards
the apex, regular in width, cylindrical, unbranched or branched, smooth
ey
<20in een Sen BES SEE VEL oe,
Vy
ok ee ae Oe
By
Fic. 1 Pseudocercospora deglupta (HMAS 247119).
a. Conidia; b. Conidiophores. Scale bar = 25 um.
Pseudocercospora meliosmicola sp. nov. (China) ... 361
to finely verruculose, straight to curved, obtuse to conical at the apex,
1-7-septate, 20-60(-80) x 3.2-5.4 um. Conidiogenous loci inconspicuous,
unthickened and not darkened. Conidia solitary, obclavate-cylindrical to
cylindrical, olivaceous to moderately olivaceous brown, straight to cured,
finely verruculose, obtuse at the apex, obconically truncate at the base, hila
neither thickened not darkened, 3-10-septate, 32-90 x 3-4.5 um.
SPECIMEN EXAMINED: On living leaves of Eucalyptus globulus Labill. (Myrtaceae):
CHINA, YUNNAN PROVINCE, Fenglu, 27.IX.1987, coll. Guo Y.L. no. 1141 (HMAS
247119).
Notes: Pseudocercospora basitruncata Crous on Eucalyptus sp. is similar
to P. deglupta, but differs in having amphigenous fruiting, sympodially
or percurrently proliferating conidiogenous cells, and paler (hyaline to
olivaceous) and narrower conidia (25—70(-90) x 2.5-3(-3.5) um; Crous
1998).
Pseudocercospora eucalyptigena U. Braun, Fungal Diversity 8: 42, 2001. FIG. 2
Leaf spots amphigenous, irregularly angular, without definite margin,
1-4.5 mm wide, vein-limited, often confluent, yellowish brown to brown
on the upper surface, pale brown to graying brown on the lower surface.
Fruiting hypogenous. Mycelium internal and external; hyphae pale
olivaceous to olivaceous, branched, smooth, septate, 2-3 um wide. Stromata
absent or small, substomatal, subglobose, olivaceous brown, 10-30 um diam.
Conidiophores few, emerging through stomatal, loose fasciculate or arising
singly as lateral branches from external mycelial hyphae, pale olivaceous
to pale olivaceous brown, paler towards the apex, irregular in width, not
branched, straight to curved, 0-1-geniculate, denticulate, obtuse to conical
at the apex, 0-1(-2)-septate, primary conidiophores 8-35 x 2.5-3.5 um,
secondary conidiophores (arising from superficial hyphae) 5-25 x 2.5-3.5 um.
Conidiogenous loci inconspicuous, unthickened and not darkened. Conidia
solitary, cylindrical to cylindrical-obclavate, pale olivaceous, straight to
strongly curved, acute to obtuse at the apex, subtruncate to obconically
truncate at the base, hila neither thickened nor darkened, indistinctly
3-12-septate, 35-80(-100) x 2-3 um.
SPECIMEN EXAMINED: On living leaves of Eucalyptus sp. (Myrtaceae): CHINA,
TAIWAN, Taibei, 20.VII.1926, coll. Sawada K., no. 9196 (HMAS 05196).
Notes: Pseudocercospora cubae Crous, P. deglupta Crous, and P. denticulata
Crous on Eucalyptus sp. all differ from P eucalypticola in having finely
verruculose conidiophoresand conidia. Additionally, P cubae differsin having
362 ... Zhao & al.
Fic. 2 Pseudocercospora eucalyptigena (HMAS 05196).
a. Conidia; b. Conidiophores; c. Stroma. Scale bar = 25 um.
sympodially or percurrently proliferating conidiogenous cells (Crous 1998);
P. deglupta possesses longer and wider conidiophores (60-120 x 4-6 um)
and wider conidia (3.0-4.0(-4.5 um); Crous 1998); and P denticulata has
amphigenous fruiting, larger stromata (60 um wide, 30 um high), and darker
(moderately brown), wider conidiophores (3-5 um; Crous 1998).
Pseudocercospora meliosmicola sp. nov. (China) ... 363
Pseudocercospora infuscans (Ellis & Everh.) U. Braun,
Monogr. Cercosp. Ramul. Allied Gen. 2: 402, 1998. FIG. 3
MISAPPLIED: Pseudocercospora toxicodendri sensu Liu & Guo (1989)
Leaf spots amphigenous, subcircular to angular, 1-4 mm wide, grayish
white to red-brown on the upper surface, yellowish brown to pale red-
brown on the lower surface. Fruiting hypogenous. Mycelium internal and
40 um
Fic. 3 Pseudocercospora infuscans (HMAS 60028).
a. Conidia; b. Conidiophores; c. Stroma. Scale bar = 40 um.
364 ... Zhao & al.
external, subhyaline, branched, smooth, septate, 2-3 um diam. Stromata
absent. Conidiophores 2-5, emerging through stomata or arising singly as
lateral branches from external mycelial hyphae, olivaceous to pale olivaceous
brown, uniform in color, irregular in width, branched, geniculate, denticulate,
straight to curved, rounded to conical at the apex, 1-7-septate, sometimes
constricted, 6.5-125 x 3-5.5 wm. Conidiogenous loci inconspicuous,
unthickened and not darkened. Conidia solitary, cylindrical to cylindrical-
obclavate, pale olivaceous, straight to curved, obtuse at the apex, obconically
truncate at the base, hila neither thickened not darkened, 2-11-septate,
30-120 x 3-6.5 um.
SPECIMENS EXAMINED: On living leaves of Rhus chinensis Mill. (Anacardiaceae):
CHINA, HUNAN PRovINcE, Longshan, 28.VIII.1958, coll. Chen Q.T., Liang LS.
no. 135 (HMAS 55957); no. 143 (HMAS 55958). SICHUAN PROVINCE, Emeishan,
17.X.1958, coll. Song M.H. no. 235 (HMAS 60028).
Notes: Guo & Liu (1989) introduced the combination Pseudocercospora
toxicodendri (Ellis) X.J. Liu & Y.L. Guo (= Cercospora toxicodendri Ellis)
and erroneously applied this name to Pseudocercospora collections on Rhus
chinensis Mill. in China. Based on examination of the type material, Braun
(1998) revealed that C. toxicodendri represents a species of Cercosporella,
reallocated Cercospora infuscans to Pseudocercospora, and emphasized that
the Chinese collections, erroneously assigned to P. toxicodendri, agree with
P. infuscans, although the conidia are somewhat narrower (3-5.5 um), and
the conidia longer (to 120 um) compared to North American samples, which
are characterized by broader (3-8 um) conidiophores and shorter (30-70)
conidia (Braun 1998). The re-examination of the Chinese collections on
R. chinensis cited under “specimens examined” showed that they should be
properly referred to as Pseudocercospora infuscans as emphasized by Braun
(1998) and Braun & al. (2016).
Pseudocercospora meliosmicola Y.L. Guo, Qian Zhao & Y.X. Shi, sp. nov. FIG. 4
MB 823728
Differs from Pseudocercospora sabiae by its longer, denticulate conidiophores and
its paler, longer conidia.
Type: China, Zhejiang Province, Hangzhou, on living leaves of Meliosma parviflora
Lecomte (Sabiaceae), 27.1X.1961, coll. Ma Qi-ming, Liu Xi-jin 581 (Holotype,
HMAS 168350).
EryMo.ocy: Derived from the host genus Meliosma.
Leaf spots amphigenous, circular to angular, 1-6 mm wide, often confluent,
red-brown, dark brown to almost black, with a pale olivaceous brown halo
Pseudocercospora meliosmicola sp. nov. (China) ... 365
SES ye
Soa
7 VE EER? Ringe
re, Ee Pes eae
Fic. 4 Pseudocercospora meliosmicola (holotype, HMAS 168350).
a. Conidia; b. Conidiophores; c. Stroma. Scale bar = 25 um.
on the upper surface, olivaceous brown to pale brown, with an olivaceous
brown halo on the lower surface. Fruiting amphigenous. Mycelium
internal and external; hyphae olivaceous, branched, smooth, septate,
2-2.5 um wide. Stromata substomatal, only a few brown globose cells to
well-developed, subglobose, dark brown, 20-40 um diam. Conidiophores
few, emerging through stomata, loose to dense fasciculate or arising
singly as lateral branches from external mycelial hyphae, olivaceous to
pale olivaceous brown, uniform in color, irregular in width, straight to
geniculate-curved, branched, smooth, rounded to conical at the apex,
0-1-septate, 8-35 x 3-3.5(-4) um. Conidiogenous cells cylindrical, 8-24
366 ... Zhao & al.
um long, conidiogenous loci inconspicuous, unthickened, not darkened.
Conidia solitary, cylindrical to narrowly obclavate-cylindrical, olivaceous
to very pale olivaceous brown, smooth, straight to curved, obtuse at the
apex, obconically truncate at the base, hila neither thickened nor darkened,
indistinctly 3-7(-10)-septate, 25-70(-85) x 2.5-3.5 um.
Notes: Cercosporoid fungi previously reported on hosts in Sabiaceae
include Pseudocercospora sabiae Y.L. Guo & W.X. Zhao on Sabia sp. (Guo
& Zhao 1989) and Cercospora meliosmae Y.L. Guo & Li Xu on Meliosma
sp. (Guo & Xu 2004). Pseudocercospora sabiae is distinguished from
P. meliosmicola by its epigenous fruiting habit; conidiophores that are
darker (olivaceous to pale brown), denticulate, and longer (15-162 um);
and conidia that are obclavate to cylindrical, paler (pale olivaceous), and
longer and slightly wider (40-112.5 x 3-4.3 um; Guo & Zhao 1989). Its
placement in another genus clearly separates Cercospora meliosmae from
Pseudocercospora meliosmicola.
Acknowledgments
This work was supported by the Project for Fundamental Research on Science
and Technology, Ministry of Science and Technology of China (No. 2013FY110400);
Science and Technology Innovation Program, Chinese Academy of Agricultural
Sciences (CAAS-ASTIP-IVFCAAS); Key Laboratory of Horticultural Crops
Genetic Improvement, Ministry of Agriculture in China (IVF2017ZF01). We
express our deep appreciation to Dr. U. Braun (Martin Luther Universitat, Halle,
Germany) and Prof. S.Y. Guo (Institute of Microbiology, Chinese Academy of
Sciences, Beijing) for their valuable suggestions, kind help, and assistance in the
course of submission of this manuscript. We are grateful to Ms. X.F. Zhu for inking
line drawing.
Literature cited
Braun U. 1998. A monograph of Cercosporella, Ramularia and allied genera (phytopathogenic
hyphomycetes). Eching: Ihw- Verlag 2: 402 p.
Braun U, Crous PW, Nakashima C. 2016. Cercosporoid fungi (Mycosphaerellaceae)
5. Species on dicots (Anacardiaceae to Annonaceae). IMA Fungus 7(1): 161-216.
https://doi.org/10.5598/imafungus.2016.07.01.10
Crous PW. 1998. Mycosphaerella spp. and their anamorphs associated with leaf spot diseases of
Eucalyptus. Mycologia Memoirs 21: 170 p.
Den Breeyen A, Groenewald JZ, Verkley GJM, Crous PW. 2006. Morphological and molecular
characterisation of Mycosphaerellaceae associated with the invasive weed, Chromolaena
odorata. Fungal Diversity 23: 89-110.
Guo YL, Liu XJ. 1989. Studies on the genus Pseudocercospora in China I. Mycosystema 2:
225-240.
Pseudocercospora meliosmicola sp. nov. (China) ... 367
Guo YL, Xu L. 2004. A new species of Cercospora causing leaf spot of Meliosma sp.
Mycosystema 23: 18-19.
Guo YL, Zhao WX. 1989. Studies on hyphomycetes of Zhangjiajie in Hunan I. Pseudocercospora.
Acta Mycologica Sinica 8: 118-122.
Liu XJ, Guo YL. 1998. Flora fungorum sinicorum vol. 9: Pseudocercospora. Beijing: Science
Press.
Spegazzini CL. 1910. Mycetes argentinenses (Series V). Anales del Museo Nacional de Historia
Natural de Buenos Aires 20: 329-467.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 369-376
https://doi.org/10.5248/134.369
Heteroplacidium compactum
reported as a genus new to China
XIANG-MIN CHENG", DA-LE Lru*3, XIN-L1I WEI*’?, JIANG-CHUN WEI’?
"State Key Laboratory of Mycology, Institute of Microbiology,
Chinese Academy of Sciences, Beijing 100101, China
? University of Chinese Academy of Sciences, Beijing 100049, China
> College of Life Sciences, Southwest Forestry University, Kunming 650224, China
* CORRESPONDENCE TO: [email protected]
ABSTRACT—Three specimens of Heteroplacidium compactum (Verrucariaceae), isolated
from arid areas in Northwest China, were identified by morphological and phylogenetic
comparisons with other species, including species of Endocarpon and Placidium (common
verrucariaceous genera in the same area). This is the first report of Heteroplacidium from
China.
Key worps—desert, ITS, lichen, morphology, taxonomy
Introduction
Breuss (1996) separated four genera—Anthracocarpon, Clavascidium,
Heteroplacidium, and Involucropyrenium—from Catapyrenium Flot. s. lat.
(Verrucariaceae) based on morphological characters. Neocatapyrenium
H. Harada, Placidium A. Massal., and Scleropyrenium H. Harada are
also morphologically related (Prieto & al. 2010b) but are independent
monophyletic lineages within Verrucariaceae, according to phylogenetic
analyses (Gueidan & al. 2007, 2009; Prieto & al. 2010b).
Endocarpon Hedw. (Verrucariaceae) was relatively common during
our field survey in the arid region of Northwest China (Yang & Wei 2008,
Zhang & al. 2017a), but no species of Heteroplacidium Breuss was recorded.
Heteroplacidium, which grows primarily on soil and rock in warm temperate
370 ... Cheng & al.
Inner Mongolia
@ Sampling
Fic. 1. Heteroplacidium compactum collection sites in China.
regions, is characterized by a crustose-areolate to squamulose thallus, a
paraplectenchymatous or subparaplectenchymatous cortex, and clavate
asci with biseriate ascospores (Prieto & al. 2010a); twelve species have been
accepted (Knudsen & al. 2014). We report Heteroplacidium in China for the
first time, based on three specimens of H. compactum.
Material & methods
Phenotypic analysis
All Heteroplacidium samples were collected from Ningxia Hui Autonomous
Region and Inner Mongolia (Fic. 1) and are preserved in the Lichen Section of
Herbarium Mycologicum Academiae Sinicae, Beijing, China (HMAS-L). Zeiss
Stemi SV11 dissecting and Zeiss Axioskop 2 plus compound microscopes were
used for morphological examinations.
DNA extraction, amplification, sequencing
DNA was extracted from our three fresh specimens of Heteroplacidium (TABLE 1)
following the modified CTAB method (Rogers & Bendich 1988). The internal
transcribed spacer of nuclear ribosome DNA (nrDNA ITS), the standard DNA
barcoding marker (Schoch & al. 2012), was chosen as the genetic marker. Primers
LR1 (Vilgalys & Hester 1990) and ITS1 (White & al. 1990) were used. Reactions
were carried out in 50 uL reaction volume comprising 3 uL total DNA, 1 uL each
primer (10 uM), 25 uL 2xTaq MasterMix (CWBIO) and 20 uL ddH,O. The DNA
was amplified in a Biometra T-Gradient thermal cycler as follows: initial heating for
5 min at 95 °C; 35 cycles of 30s at 94 °C, 30s at 56 °C, and 90 s at 72 °C; ending witha
final extension of 8 min at 72 °C, after which the samples were kept at 4 °C. Negative
controls were prepared for each amplification series. PCR products were purified
using a CWBIO gel extraction kit following the manufacturer's instructions.
Heteroplacidium new to China... 371
Sequence alignment and phylogenetic tree construction
PCR products from the three putative Heteroplacidium specimens were
sequenced using ABI 3730 XL Sequencer. Additional sequences of Endocarpon
(3 spp.), Heteroplacidium (4 spp.), and Placidium (3 spp.) were downloaded from
GenBank (TaBLE 1) with the Endocarpon sequences selected as outgroup. The
sequences were aligned using ClustalW Multiple Alignment (Thompson & al.
1994) in BioEdit 7.2.5 (Hall 1999). The program Gblocks v0.91b (Castresana
2000, Talavera & Castresana 2007) was used to delimit and remove regions
of alignment uncertainty, using options for a “less stringent” selection on
the Gblocks web server (http://molevol.cmima.csic.es/castresana/Gblocks_
server.html). We confirmed the phylogenetic position of Heteroplacidium
sp. represented by our three specimens by subjecting the alignment to a
maximum likelihood (RAxML) analysis; nodal support was assessed using
1000 bootstrapping pseudoreplicates with RAxML-HPC v. 8.2.6 (Stamatakis
2014) and MrBayes v.3.2.6 (Huelsenbeck & Ronquist 2001, Ronquist &
Huelsenbeck 2003) on the CIPRES Science Gateway (http://www.phylo.org).
In the ML and Bayesian analyses, substitution models for ITS were estimated
using jModelTest-2.1.9 (Guindon & Gascuel 2003, Darriba & al. 2012). Based
TABLE 1. Specimens and sequences of Endocarpon, Heteroplacidium, and Placidium
used in the phylogenetic analysis
SPECIES VOUCHER ORIGIN GENBANK No.
E. adscendens CG671 Switzerland KF959777
E. pusillum CG470 _ JQ927447
E. tenuissimum Lendemer 29447 USA KM371592
Lendemer 27013 USA KM371593
H. acervatum LI 271015 Spain GU228954
M. Prieto 399 Spain GU228955
H. compactum M. Prieto 1701 Spain GU228952
M. Prieto 1607 Spain GU228949
XL2017117 China MH930459*
ALS2018002 China MH930460*
ALS2018036 China MH930461*
H. congestum LI 552268 USA GU228950
LI 297536 USA GU228951
H. divisum LI 218428 Italy GU228953
P pilosellum M. Prieto 3 Spain GU228993
VEL_PLG Slovakia KY981585
P. podolepis LI 297365 Argentina GU228956
P. squamulosum M. Prieto 336 Spain GU228994
* = sequences newly generated for this study by the authors
372 ... Cheng & al.
on these results, we used the TrN+I+G model with 1000 pseudoreplicates in the
ML analysis, and two parallel Markov chain Monte Carlo (MCMC) runs were
performed in MrBayes, each using 8 million generations and sampling every
1000 steps. A 50% majority-rule consensus tree was generated from the combined
sampled trees of both runs after discarding the first 25% as burn-in. Tree files
were visualized with FigTree v.1.4.2 (http://tree.bio.ed.ac.uk/software/figtree/).
Endocarpon adscendens KF959777
100/1.00 Endocarpon tenuissimum KM371592
100/1.00
80y-- Endocarpon tenuissimum KM371593
Endocarpon pusillum JQ927447
Heteroplacidium acervatum GU228955
100/1.00
85/0.97 Heteroplacidium acervatum GU228954
Heteroplacidium divisum GU228953
94/0.99 95/1.b0 Heteroplacidium congestum GU228950
Heteroplacidium congestum GU228951
88/0 9a7— @ Heteroplacidium compactum MH930461
Heteroplacidium compactum GU228952
0D/4|.00
00/1.00
--/D195 - Heteroplacidium compactum GU228949
@ Heteroplacidium compactum MH930460
93/0|97
@Heteroplacidium compactum MH930459
Placidium podolepis GU228956
100/1.00
Placidium squamulosum GU228994
100/1.00
Placidium pilosellum KY981585
D9/0.99
Placidium pilosellum GU228993
0.07
Fic. 2. The maximum likelihood tree of Endocarpon, Heteroplacidium, and Placidium
species based on ITS sequences. The numbers in each node represent bootstrap support
(BS) and posterior probability (PP) values. Bootstrap values 275 and posterior probability
values 20.95 were plotted on the branches of the RAxML tree. Except for the three samples
of Heteroplacidium compactum marked by the solid circle “@®% all other sequences were
downloaded from GenBank. Scale bar = 0.07 substitution per site.
Heteroplacidium new to China... 373
Phylogenetic and species delimitation analyses
The aligned matrix contained 455 unambiguous ITS nucleotide
positions. The phylogenetic tree (Fic. 2) included 10 taxa representing three
genera within Verrucariaceae. Heteroplacidium formed a well-supported
monophyletic clade (BS = 94, PP = 0.99) with the distinct species clearly
separated. Our three Chinese specimens all grouped with Spanish sequences
of H. compactum.
Taxonomy
Heteroplacidium compactum (A. Massal.) Gueidan & Cl. Roux,
Bull. Inf. Ass. Franc. Lichén. 33(1): 25, 2008. Fic. 3
THALLUS areolate, areoles 0.6-1.8 mm diam., angular to rounded, flat
to slightly convex; upper surface dark brown to black, dull to somewhat
shiny.
THALLUS LAYER $300 um thick; upper cortex paraplectenchymous,
12.5-37.5 um thick; algal layer 62.5-150 um thick, cells 12.5-17.5 um diam;
medulla 112.5-187.5 um thick; lower cortex paraplectenchymous, 10-12.5
um thick or not clearly delimited. RHIZOHYPHAE simple, intersecting,
é
Fic. 3. Heteroplacidium compactum (HMAS-L 140900): A. Habit of thallus; B. Anatomical
structure of thallus; C. Perithecia in thallus; D. Ascospores; E. Separate areole with abundant
rhizines tangling with soil particles. Scale bars: A = 1 mm; B = 20 um; C = 100 um; D = 50 um;
E=0.5 mm.
374 ... Cheng & al.
4.5-7.5 um diam. PERITHECIA nearly spherical, 300-500 um diam, exciple,
pale darkening with age. Ascr clavate, 52.5-62.5 x 15-17.5 um. ASCOSPORES
simple, ellipsoid, 12.5-17.5 x 10-12.5 um. PYCNIDIA not seen.
SPECIMENS EXAMINED. CHINA. INNER MONGOLIA: 39°28’22”N 101°04’04”E,
1563 m alt., on sand, 5 June 2018, D.L. Liu & al. ALS2018002 (HMAS-L 0141672;
GenBank MH930460); 39°32’31”N 101°06’34’”E, 1478 m alt., on sand, 5 June
2018, D.L. Liu et al. ALS2018036 (HMAS-L 0141671; GenBank MH930461).
NinGxia: Zhongwei City, Cui Liu Gou. 37°24’35”N 104°35’09”E, 1577 m
alt., on sand, 15 July 2017, D.L. Liu & R.D. Liu XL2017117 (HMAS-L 140900;
GenBank MH930459).
DISTRIBUTION: Heteroplacidium compactum has previously been reported
from Asia (Mongolian People's Republic; Pakistan), Europe, and northern
Africa (Breuss 1994; Prieto & al. 2010a). In China, it is now known from
arid desert areas in Inner Mongolia and Ningxia.
Discussion
The characters of Chinese H. compactum are essentially similar to the
previous descriptions (Breuss 1994; Prieto & al. 2010a) in the areolate
thallus, dark brown upper surface, paraplectenchymous upper and
lower cortex, and the shape and size of the perithecia and asci. Among
the differences noted are a thinner thallus (300 um versus 600 um) and
broader ascospores (10-12.5 um versus 8-10 um). Furthermore, pycnidia
were not seen in the Chinese materials.
In the arid desert area of China, Endocarpon is quite common and
comprises a key component of biological soil crust communities (BSC).
The biodiversity reported for these Chinese BSCs includes several newly
described Endocarpon species (Yang & Wei 2008, Zhang & al. 2017a) with
the predominant species, E. pusillum, studied physiologically (Zhang &
Wei 2011), ecologically (Ding & al. 2013), and genomically (Wang & al.
2014, 2015, Li & Wei 2016, Zhang & al. 2017b). Heteroplacidium (with
Dermatocarpon-type pycnidia) is clearly different from Endocarpon (with
Endocarpon-type pycnidia).
The most similar genus to Heteroplacidium is Placidium A. Massal.,
which is also characterized by Dermatocarpon-type pycnidia, but the
two genera have differently sized thallus squamules (Heteroplacidium
0.3-3 mm diam; Placidium 2-8(-15) mm diam). In the phylogenetic tree
(Fic. 2), Heteroplacidium is most closely related to Placidium, clustering
in a well-supported clade (BS = 100, PP = 1) and relatively distant from
Endocarpon.
Heteroplacidium new to China... 375
Acknowledgments
This research was funded by one of National Key Research and Development
Program of China (2016YFE0203400) and the National Natural Science
Foundation of China (31770022, 31470149). The authors sincerely thank the two
peer reviewers, Dr. Steve Leavitt (Brigham Young University, USA) and Dr. Ze-
Feng Jia (Liaocheng University, China), for giving constructive suggestions and
kindly help in making careful modifications. Ms. H. Deng gave considerable
assistance during our studies in HMAS-L.
Literature cited
Breuss O. 1994. Uber einige wenig bekannte Verrucaria-Arten (Lichenes, Verrucariaceae).
Osterreichische Zeitschrift fiir Pilzkunde 3: 15-20.
Breuss O. 1996. Ein verfeinertes Gliederungskonzept fiir Catapyrenium (lichenisierte Ascomyceten,
Verrucariaceae). Annalen Naturhistorischen Museums in Wien 98 B Suppl.: 35-50.
Castresana J. 2000. Selection of conserved blocks from multiple alignments for their use
in phylogenetic analysis. Molecular Biology and Evolution 17(4): 540-552. https://doi.
org/10.1093/oxfordjournals.molbev.a026334
Darriba D, Taboada GL, Doallo R, Posada D. 2012. jModelTest 2: more models, new heuristics
and parallel computing. Nature Methods 9(8): 772. https://doi.org/10.1038/nmeth.2109
Ding LP, Zhou QM, Wei JC. 2013. Estimation of Endocarpon pusillum carbon budget in the
Tengger Desert based on its photosynthetic rate. Science China Life Sciences 56(9): 848-855.
https://doi.org/10.1007/s11427-013-4526-9
Gueidan C, Roux C, Lutzoni F 2007. Using a multigene phylogenetic analysis to assess
generic delineation and character evolution in Verrucariaceae (Verrucariales, Ascomycota).
Mycological Research 111(10): 1145-1168. https://doi.org/10.1016/j.mycres.2007.08.010
Gueidan C, Savic S, Thiis H, Roux C, Keller C, Tibell L, Prieto M, Heidmarsson S, Breuss
O, Orange A, Fréberg L, Wynns AA, Navarro-Rosinés P, Krzewicka B, Pykala J, Grube
M, Lutzoni F. 2009. Generic classification of the Verrucariaceae (Ascomycota) based on
molecular and morphological evidence: recent progress and remaining challenges. Taxon
58: 184-208. https://doi.org/10.1002/tax.581019
Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate
large phylogenies by maximum likelihood. Systematic Biology 52(5): 696-704.
https://doi.org/10.1080/10635 150390235520
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium Serie 41: 95-98.
Huelsenbeck JP, Ronquist F. 2001. MrBayes: Bayesian inference of phylogenetic trees.
Bioinformatics 17(8): 754-755. https://doi.org/10.1093/bioinformatics/17.8.754
Knudsen K, Breuss O, Kocourkova J. 2014. A new lichenicolous Heteroplacidium (Verrucariaceae)
from the deserts of southern California. Opuscula Philolichenum 13: 26-33.
Li H, Wei JC. 2016. Functional analysis of thioredoxin from the desert lichen-forming fungus,
Endocarpon pusillum Hedwig, reveals its role in stress tolerance. Scientific Reports 6: 27184.
https://doi.org/10.1038/srep27184
Prieto M, Aragon G, Martinez I. 2010a. The genus Catapyrenium s. lat. (Verrucariaceae)
in the Iberian Peninsula and the Balearic Islands. Lichenologist 42(6): 637-684.
https://doi.org/10.1017/S0024282910000319
Prieto M, Martinez I, Aragon G, Otalora MAG, Lutzoni F. 2010b. Phylogenetic study of
Catapyrenium s. str. (Verrucariaceae, lichen-forming Ascomycota) and related genus
Placidiopsis. Mycologia 102(2): 291-304. https://doi.org/10.3852/09-168
376 ... Cheng & al.
Rogers SO, Bendich AJ. 1988. Extraction of DNA from plant tissues. A6: 1-10, in: Gelvin SB,
Schilperoort RA (eds). Plant Molecular Biology Manual. Kluwer Academic Publishers,
Boston. https://doi.org/10.1007/978-94-017-5294-7_6
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. https://doi.org/10.1093/bioinformatics/btg180
Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA & al. 2012. Nuclear
ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for
fungi. Proceedings of the National Academy of Sciences of the United States of America
109(16): 6241-6246. https://doi.org/10.1073/pnas.1117018109
Stamatakis A. 2014. RAxML Version 8: A tool for phylogenetic analysis and post-analysis of large
phylogenies. Bioinformatics 30: 1312-1313. https://doi.org/10.1093/bioinformatics/btu033
Talavera G, Castresana J. 2007. Improvement of phylogenies after removing divergent and
ambiguously aligned blocks from protein sequence alignments. Systematic Biology 56(4):
564-577. https://doi.org/10.1080/10635150701472164
Thompson J, Higgins D, Gibson T. 1994. CLUSTAL W: improving the sensitivity of
progressive multiple sequence alignment through sequence weighting, position-specific
gap penalties and weight matrix choice. Nucleic Acids Research 22(22): 4673-4680.
https://doi.org/10.1093/nar/22.22.4673
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
https://doi.org/10.1128/jb.172.8.4238-4246.1990
Wang YY, Liu B, Zhang XY, Zhou QM, Zhang T, Li H, Yu YF, Zhang XL, Hao XY, Wang M,
Wang L, Wei JC. 2014. Genome characteristics reveal the impact of lichenization on lichen-
forming fungus Endocarpon pusillum Hedwig (Verrucariales, Ascomycota). BMC Genomics
15:34 [18 p.]. https://doi.org/10.1186/1471-2164-15-34
Wang YY, Zhang XY, Zhou QM, Zhang XL, Wei JC. 2015. Comparative transcriptome analysis of
the lichen-forming fungus Endocarpon pusillum elucidates its drought adaptation mechanisms.
Science China Life Sciences 58: 89-100. https://doi.org/10.1007/s11427-014-4760-9
White T, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis & al. (eds). PCR
protocols: a guide to methods and applications. San Diego, CA. Academic Press.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Yang J, Wei JC. 2008. The new lichen species Endocarpon crystallinum from semiarid deserts in
China. Mycotaxon 106: 445-448.
Zhang T, Wei JC. 2011. Survival analyses of symbionts isolated from Endocarpon pusillum
Hedwig to desiccation and starvation stress. Science China Life Sciences 54(5): 480-489.
https://doi.org/10.1007/s11427-011-4164-z
Zhang T, Liu M, Wang YY, Wang ZJ, Wei XL, Wei JC. 2017a. Two new species of
Endocarpon (Verrucariaceae, Ascomycota) from China. Scientific Reports 7:7193 [11 p.].
https://doi.org/10.1038/s41598-017-07778-5
Zhang YL, Li H, Wang YY, Wei JC. 2017b. The calcium-binding protein EpANN from the
lichenized fungus Endocarpon pusillum enhances stress tolerance in yeast and plants,
Fungal Genetics and Biology 108: 36-43. https://doi.org/10.1016/j.fgb.2017.09.003
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 377-389
https://doi.org/10.5248/134.377
Geopora ahmadii sp. nov. from Pakistan
M. SaBA"?”3, D,. HAELEWATERS?*, T. ITURRIAGA?>>,
T. ASHRAF’, A.N. KHALID’, D.H. PFISTER?
“Department of Plant Sciences, Quaid-i-Azam University,
Islamabad, 45320, Pakistan
?Department of Botany, University of the Punjab,
Quaid-e-Azam Campus, Lahore 54590, Pakistan
*Farlow Reference Library and Herbarium of Cryptogamic Botany, Harvard University,
Cambridge, MA 02138, USA
*Faculty of Science, University of South Bohemia, 37005 Ceské Budéjovice, Czech Republic
°*Plant Pathology and Plant-Microbe Biology Section, School of Integrative Plant Science,
College of Agriculture & Life Sciences, Cornell University, Ithaca, NY 14853, USA
*CORRESPONDENCE TO: [email protected]
ABSTRACT—A new species, Geopora ahmadii, is described and illustrated based on material
from Punjab, Pakistan. This species is characterized by sessile, cup- to saucer-shaped, partly
immersed apothecia with whitish to grayish hymenial surfaces; broad ellipsoid, mostly
uniguttulate ascospores; and brown excipular hairs. Phylogenetic analyses of the nrDNA ITS
region with maximum parsimony, maximum likelihood, and Bayesian inference methods
reveal that G. ahmadii is distinct from other described Geopora species. A collection
previously identified as Geopora arenosa from Rawalakot, Pakistan, likely represents a second
locality of G. ahmadii.
KEY worps—Ascomycota, hypogeous fungi, Pezizales, Pyronemataceae, taxonomy
Introduction
Geopora Harkn. (Pyronemataceae, Pezizales) is characterized by (1)
ascomata that occur entirely or partially below ground and are covered
with brown, septate excipular hairs; (2) a whitish, grayish, or yellowish-
gray hymenium; and (3) smooth, mostly uniguttulate ascospores. Because
ascomata appear infrequently and are hypogeous at some developmental
378 ... Saba & al.
stage, Geopora specimens are infrequently collected. Species delimitation
is additionally challenging due to the scarcity of distinctive morphological
characters, with measurement ranges overlapping among species (Tamm &
al. 2010, Guevara-Guerrero & al. 2012, Flores-Renteria & al. 2014).
Identification of Geopora species has relied primarily on ascospore
shape and size, position of apothecia in the ground, and the length of
excipular hairs (Burdsall 1965, 1968; Tamm & al. 2010; Flores-Renteria
& al. 2014). Molecular analyses by Tamm & al. (2010) showed that well
supported clades are not congruent with morphological species concepts.
The combination of molecular and morphological data is considered the
most reliable approach to define species in this genus (Southworth & Frank
2011, Guevara-Guerrero & al. 2012, Flores-Renteria & al. 2014).
Perry & al. (2007) studied the phylogenetic relationships of
Pyronemataceae. Using LSU ribosomal DNA (rDNA) sequence data, they
suggested that Geopora is monophyletic. Hansen & al. (2013) determined
that Geopora was sister to Tricharina in the larger Scutellinia—Trichophaea
lineage. Neither study included species representing Phaeangium Pat. or
Picoa Vittad. Stielow & al. (2013) suggested that Geopora was paraphyletic
including species of both Phaeangium and Picoa. They also found that
Geopora pellita (Sacc.) T. Schumach. was phylogenetically isolated from
other Geopora species and created the new genus Hoffmannoscypha Stielow
& al. to accommodate this taxon.
During our studies of ectomycorrhizal fungi, we found Geopora
specimens growing in groups on damp soil in Punjab, Pakistan. Molecular
phylogenetic analysis ofthe ITS rDNA region combined with morphological
evaluation support the recognition of our collections as a new species. ‘This
species is described, illustrated, and compared with other Geopora species.
Materials & methods
Morphological studies
Ascomata were collected and dried in a food dehydrator at 39 °C for 7-9 hours.
Shape, texture, and dimensions of important characters were recorded from fresh
ascomata. Colors were compared to the Munsell Soil Color Charts (1975). Dried
voucher specimens are deposited at the University of the Punjab Herbarium, Lahore,
Pakistan (LAH) and the Farlow Herbarium, Harvard University, Cambridge, MA,
USA (FH).
Sections of specimens were mounted in water and Congo red in ammonia (0.3%
in commercial ammonia cleaner) to increase contrast for microscopic observations.
Micromorphological analysis, photographs, and measurements were made
Geopora ahmadii sp. nov. (Pakistan) ... 379
using an Olympus Bx40 light microscope with Olympus XC50 digital camera
and Microsuite Special Edition software 3.1. Sections were made using a freezing
microtome. Measurements include the typical range with extremes given in
parentheses. Q values (length/width ratios) are given for ascospores.
DNA extraction, PCR amplification, DNA sequencing
Genomic DNA was extracted from a small piece of an ascoma by a modified
CTAB method (Gardes & Bruns 1993). The internal transcribed spacer region
(ITS1+5.8S+ITS2) of the nuclear ribosomal RNA gene was amplified using the
primer pair ITSIF and ITS4 (White & al. 1990, Gardes & Bruns 1993) and the
RED Extract-N-Amp PCR ReadyMix. PCR cycling parameters comprised initial
denaturation (94° C for 1 min), 35 cycles (94 °C for 1 min, 53 °C for 1 min, and
72 °C for 1 min), and final extension 72 °C (8 min). Amplified PCR products
were outsourced to Macrogen, (Seoul, Republic of Korea) for purification and
bidirectional sequencing.
Sequence alignment & phylogenetic analyses
Geopora sequences downloaded from GenBank included those studied by
Tamm & al. (2010) and sequences representing recently described species—
G. cercocarpi D. Southw. & J.L. Frank, G. gilkeyae (Burds.) G. Guevara & al.,
G. pinyonis Flores-Rent. & Gehring, and G. tolucana G. Guevara & al. (Flores-
Renteria & al. 2014, Guevara-Guerrero & al. 2012, Southworth & Frank 2011).
Tarzetta catinus (Holmsk.) Korf & J.K. Rogers and Trichophaea hybrida (Sowerby)
T. Schumach. (Pyronemataceae, Pezizales) were selected as the outgroup because
they are closely related to Geopora (Perry & al. 2007).
Manually edited sequences were assembled in BioEdit v7.2.6 (www.mbio.
ncsu.edu/bioedit/bioedit.html). All sequences were trimmed with the conserved
motifs 5’-(...GAT)CATTA- and —-GACccT(CAAA...)-3" (Dentinger & al. 2011), and
the alignment portions between them were included in the analysis. Sequences
retrieved from NCBI GenBank were aligned by Muscle v3.7 (Edgar 2004) with
default parameters using Molecular Evolutionary Genetics Analysis (MEGA)
software (Tamura & al. 2011).
Maximum parsimony (MP) analysis was performed with PAUP 4.0b on
XSEDE (Swofford 1991), available on the Cipres Gateway v3.3 (Miller & al. 2010).
All characters were equally weighted and gaps were treated as missing data. The
heuristic search option with tree-bisection-reconnection (TBR) branch swapping
and 1000 random sequence additions were used to infer trees. Clade robustness
was assessed using a bootstrap analysis with 500 replicates (Felsenstein 1985).
A maximum likelihood (ML) analysis was carried out with RAxML XSEDE on
the Cipres Gateway, using the general time-reversible (GTR) model of nucleotide
substitution (Stamatakis & al. 2008). Nodal support was determined from 1000
bootstrap replicates.
Bayesian analysis was done with a Markov chain Monte Carlo (MCMC)
coalescent approach implemented in Beast v1.8.2 (Drummond & Rambaut 2007),
380 ... Saba & al.
TABLE 1. Geopora isolates and outgroup included in phylogenetic analyses
[Clade designations sensu Tamm & al. 2010]
ORIGINAL ID
Tarzetta catinus
Trichophaea
hybrida
G. cercocarpi
G. cercocarpi
G. pinyonis
G. pinyonis
G, tolucana
G. tolucana
G. ahmadii
G. ahmadii
G. arenicola
G. sp.
G. arenicola
G. foliacea
Ectomycorrhizal
Ectomycorrhizal
Ectomycorrhizal
uncultured
G. cf. sepulta
G. cooperi
G. cooperi
G. cooperi
G. gilkeyae
G. arenicola
G. arenicola
G. arenicola
G. arenicola
G. arenicola
G. arenicola
G. arenicola
G. sepulta
CLADE
IX
IX
IX
IX
IX
IX
~
wm Ms RM OM
VI
VI
Vill
Vill
VIII
VIII
VI
VII
COUNTRY
Estonia
Estonia
USA, OR
USA, OR
USA, AR
USA, AR
Mexico
Mexico
Pakistan
Pakistan
Estonia
Estonia
Estonia
Estonia
France
France
Spain
Estonia
USA, CA
Estonia
Estonia
Estonia
Estonia
Estonia
Estonia
Estonia
Estonia
VOUCHER
TAAM 192291
TAAM 192334
SOC 1590
SOC 1590
DGB 27586
DGB 27586
ITCV 1081
ITCV 1081
MSM#0091 [T]
MSM#00163
TAAM 192329
TAAM 192324
TAAM 192330
TAAM 192323
ECM 2
ECM 95
Riv-4
TAAM 113526
101GA
108GC
109GC
src515
TAAM 188666
TAAM 188339
TAAM 117708
TAAM 188293
TAAM 188292
TAAM 135060
TAAM 116784
TAAM 192311
GENBANK
FM206478
FM206477
HQ283090
NR121491
KF768653
KF768652
HQ184961
HQ184960
KY805995
KY805996
FM206473
FM206471
FM206472
FM206470
AJ410862
AJ410865
EF484934
FM206476
AF387651
AF387649
AF387650
DQ974731
FM206449
FM206446
FM206460
FM206440
FM206439
FM206433
FM206462
FM206432
REFERENCE
Tamm & al. 2010
Tamm & al. 2010
Southworth & Frank 2011
Southworth & Frank 2011
Flores-Renteria & al. 2014
Flores-Renteria & al. 2014
Guevara-Guerrero & al. 2012
Guevara-Guerrero & al. 2012
This paper
This paper
Tamm & al. 2010
Tamm & al. 2010
Tamm & al. 2010
Tamm & al. 2010
El Karkouri & al. 2004
El Karkouri & al. 2004
Rincon & al. 2007
Tamm & al. 2010
Gutierrez & al. (unpubl.)
Gutierrez & al. (unpubl.)
Gutierrez & al. (unpubl.)
Smith & al. 2007
Tamm & al. 2010
Tamm & al. 2010
Tamm & al. 2010
Tamm & al. 2010
Tamm & al. 2010
Tamm & al. 2010
Tamm & al. 2010
Tamm & al. 2010
Geopora ahmadii sp. nov. (Pakistan) ... 381
ORIGINAL ID CLADE COUNTRY VOUCHER GENBANK REFERENCE
G. sepulta Vil Estonia TAAM 192333 FM206431 Tamm &al. 2010
G. foliacea Vv Finland H RS-34685 FM206428 Tamm &al. 2010
G. foliacea Vv Finland H RS-29584 FM206424 Tamm &al. 2010
G. cervina V Finland H RS-17984 FM206426 ‘Tamm & al. 2010
G. cervina VI Estonia TAAM 192232 FM206420 ‘Tamm &al. 2010
G. tenuis VI Estonia TAAM 192302 FM206429 ‘Tamm & al. 2010
G. sp. VI Tajikistan TAAM 116668 FM206475 Tamm &al. 2010
G. tenuis IV Estonia TAAM 188326 FM206397. Tamm & al. 2010
G. tenuis IV Finland H RS-09584 FM206402. Tamm &al. 2010
G. tenuis IV Estonia TAAM 188331 FM206396 ‘Tamm &al. 2010
G. cervina IV Estonia TAAM 192293 FM206401 ‘Tamm &al. 2010
G. cervina Ill Estonia TAAM 117479 FM206413 ‘Tamm &al. 2010
G. cervina Ill Finland H RS-07186 FM206406 ‘Tamm &al. 2010
G. cervina Il Estonia TAAM 117884 FM206409 ‘Tamm &al. 2010
G. cervina Il Estonia TAAM 192321 FM206410 ‘Tamm &al. 2010
G. arenicola Ill Estonia TAAM 117952 FM206412 ‘Tamm &al. 2010
G. cervina II Estonia TAAM 188304 FM206417 ‘Tamm &al. 2010
G. cervina II Estonia TAAM 117898 FM206419 ‘Tamm &al. 2010
G. arenicola II Estonia TAAM 188517 FM206418 ‘Tamm &al. 2010
G. cervina I Finland H RS-06986 FM206387 ‘Tamm &al. 2010
G. cervina I Estonia TAAM 188655 FM206390 ‘Tamm &al. 2010
G. cervina I Estonia TAAM 117854 FM206391 ‘Tamm &al. 2010
G. cervina I Estonia TAAM 117659 FM206389 ‘Tamm & al. 2010
with an uncorrelated lognormal relaxed clock for rate variation across the tree.
A Bayesian skyride coalescent tree GMRF prior with the GITR+I+G model of
nucleotide substitution was used in all simulations, with a randomly generated
starting tree. Four independent runs of 10 million generations were undertaken.
Tracer v1.6.0 (Drummond & Rambaut 2007) was used to check the effective
sample size (ESS), and burn-in values were adjusted to achieve a net ESS of at least
200. Upon removal of a portion of each run as burn-in, log files and trees files
were combined in LogCombiner v.1.8.2. Finally, a consensus tree (0% burn-in) was
generated using TreeAnnotator v1.8.2 and visualized in FigTree v1.4.2.
Sequences of Geopora ahmadii generated during this study were submitted to
GenBank. Accession numbers for the sequences downloaded from GenBank and
those sequenced during this study are given in TABLE 1.
382 ... Saba & al.
Taxonomy
Geopora ahmadii Saba, T. Ashraf, Khalid & Pfister, sp. nov. Fics 1, 2
MB 822666
Differs from Geopora arenicola by its partly immersed apothecia that are larger in
diameter, cupulate when young but saucer-shaped when older, by its broadly ellipsoid
ascospores, and by its ITS sequence with 49-52 autapomorphies.
Type: Pakistan, Punjab, Lahore, University of the Punjab, Department of Botany,
Botanical Garden, 31°29’56”N 74°17'57’E, 6 March 2009, leg. M. Saba, T. Ashraf &
A.N. Khalid, MSM#0091 (Holotype, LAH 310019; GenBank KY805995).
EryMo.Locy: Named in honor of Dr. Sultan Ahmad (1910-1983), eminent pioneering
mycologist in Pakistan.
APOTHECIA partly immersed in soil, sessile, fleshy, cup-shaped at early stages
and saucer-shaped at older stages when becoming thin, flat-discoid, <15-25
mm in diameter and 4 mm deep when fresh; when dry shrinking to 6-10 mm
diam; disc grey and smooth when fresh, whitish beige to whitish grey when
Fic. 1. Geopora ahmadii (holotype, LAH310019). a. Section of ascoma showing hymenium,
subhymenium, excipulum, and excipular hairs; b. Excipular cells with single excipular hair; c. Asci
and paraphyses; d. Asci and paraphyses, with detail of an ascospore with a single guttule (insert).
Scale bars: a = 200 um; b, d = 50 um; c = 100 um.
Geopora ahmadii sp. nov. (Pakistan) ... 383
}
Fic. 2. Geopora ahmadii (holotype, LAH310019). Ascospores, each with a single guttule:
a. Mounted in Congo red in ammonia; b. Mounted in water. Scale bars = 10 um.
rehydrated; receptacle dark brown, warted and hairy. Margin wavy at young
stages, splitting into 5-6 lobes at older stages.
HyMENIUM 180-220 um thick. Ascr cylindrical, |e (175-)210-250(-340)
x 15-21 um, with 8 ascospores. SUBHYMENIUM dense textura intricata,
dark brown, compact. Ascospores uniseriate, broadly ellipsoid, with a
single guttule, and smaller guttules at the poles, 19-26.0 x (11-)12-15 um,
Q = 1.68-1.94; wall 1.0-1.5 um thick, hyaline. ParApuysss slender, hyaline,
broadly clavate, 7-10 um diam. at the tip, 5-6 um diam. in the middle, septate.
ECTAL EXCIPULUM 75-87(-115) um thick, dark brown of textura globulosa to
textura angularis, cells round to irregular to polygonal, 16-30 x 13-16 um,
walls brown, 1-2 um thick (especially thicker in the outermost cells), outer
cells aggregated to form warts. MEDULLARY EXCIPULUM (40-)50-70(-80) um
thick; dense textura intricata, cells appearing angular to irregular to roundish,
becoming smaller towards the subhymenium, cells 8.5-20.5 x 5-12 um. Hairs
arising from globose ectal excipular cells, septate and forming a mat of brown
hyphae holding soil particles. When young thin, straight, light brown, smooth,
(6-)7.5-10.0(-16) um diam.; with age branched, twisted and curved, dark
brown, <(40-)50-70(-80) um diam., with dark granular walls and granular
content; hair walls 0.8-1.5(—2) um thick.
384 ... Saba & al.
ADDITIONAL MATERIAL STUDIED: PAKISTAN, Punyjas, Lahore, University of the
Punjab, Botanical Garden, 31°29’56”N 74°17'57’E, 16 June 2011, MSM#00160 (LAH
310099!); 5 May 2013, leg. M. Saba, T. Ashraf & A.N. Khalid, MSM#00163 (FH
01142414; GenBank KY805996).
Molecular analyses of the genus Geopora
Initial BLAST analysis of the G. ahmadii ITS sequence showed a
maximum identity of 84% with collection TAAM 192330 (GenBank
accession number FM206472). This collection belongs to clade IX (sensu
Tamm & al. 2010) but was identified based on morphology as G. arenicola
(Lév.) Kers. Our data matrix included 53 isolates, all representing identified
Geopora species except for three unidentified ectomycorrhizal isolates (El
Karkouri & al. 2004, Rincén & al. 2007) and the two outgroup sequences
(TaBLE 1). The final aligned data matrix included 722 characters, of which
272 were constant and 351 were parsimony-informative.
Our MP and ML analyses (Fic. 3) largely agree. One exception is the
placement of G. gilkeyae (Burds.) Guevara & al. (as “Geopora cooperii var.
gilkeyi” in Smith & al. 2007) and G. tolucana Guevara & al. In the MP
topology (not shown), these species are sister taxa and form a branch basal
to all other Geopora species (sensu Tamm & al. 2010). However, there is no
bootstrap support for this placement. Also, the placement of G. gilkeyae
in the ML analysis is unresolved (no bootstrap support). In the three
analyses (MP, ML, Bayesian), a number of the basal branches lack support,
and phylogenetic reconstructions based on ITS alone cannot resolve
relationships of Geopora at deeper nodes.
Clades I through X (sensu Tamm & al. 2010) are recognized here with
high support from MP, ML, and Bayesian analyses (Fics 3, 4). Geopora
ahmadii is inferred in Geopora clade IX from Tamm & al. (2010) with
maximum support. The morphological characters of G. ahmadii (fruit-
body features, ascospore dimensions, Q ascospore values) are consistent
with those of clade IX as given by Tamm & al. (2010). The species is
recovered as sister to “Geopora sp. b” (sensu Schumacher 1979; defined in
the study of Tamm & al. 2010) in clade IX. Geopora sp. b is known only
from northern Europe, with records from Estonia (Tamm & al. 2010) and
Norway (Schumacher 1979).
Discussion
Tamm & al. (2010) reviewed the history of the genus Geopora and
confirmed that delimitations of species within Geopora are difficult. All
Geopora ahmadii sp. nov. (Pakistan) ... 385
e Tarzetta catinus
100 Trichophaea hybrida
Geopora cercocarpi NR_121491
Geopora cercocarpi HQ283090
Geopora pinyonis KF768653
Geopora pinyonis KF768652
Geopora tolucana HQ184961
Geopora tolucana HQ184960
Geopora ahmadii KY805995
Geopora ahmadii KY805996
= Geopora arenicola FM206472
Geopora sp. FM206471
Geopora foliacea FM206470
Pe Geopora arenicola FM206473
99 - ECM 2 AJ410862
00 ECM 95 AJ410865
99 ECM Riv-4 EF484934
$8 Geopora cf. sepulta FM206476
75| Geopora cooperi AF387651
Geopora cooperi AF387649
Geopora cooperi AF387650
Geopora gilkeyae DQ974731
Geopora arenicola FM206449 |
84
100} Geopora arenicola FM206446
74 |- Geopora arenicola FM206460
82] Geopora arenicola FM206440
se Geopora arenicola FM206439
Geopora arenicola FM206433
Geopora arenicola FM206462
Geopora sepulta FM206432
Geopora sepulta FM206431
Geopora foliacea FM206428
Geopora cervina FM206426
Geopora foliacea FM206424
Geopora cervina FM206420
95 l96-— Geopora tenuis FM206429
90 95L_— Geopora sp. FM206475
93 Geopora tenuis FM206397
93 Geopora tenuis FM206402
Geopora tenuis FM206396
80 Geopora cervina FM206401
100 B Geopora arenicola FM206412
100 Geopora cervina FM206413
99 Geopora cervina FM206406
96 pa Geopora cervina FM206409
97 aal| 99 'Geopora cervina FM206410
93 Geopora arenicola FM206418 |
ll
I+I+II1
9g|} Geopora cervina FM206417
1004 Geopora cervina FM206419
Geopora cervina FM206387
Geopora cervina FM206390 |
gs| Geopora cervina FM306391
97 'Geopora cervina FM206389
Fic. 3. Phylogeny of Geopora species produced from maximum likelihood (ML) analysis of the ITS
rDNA dataset. The best-scoring ML tree (log likelihood of -6541.843463) is shown. Only bootstrap
values >70% are given. Maximum parsimony (MP) bootstrap values are given above the branches;
ML bootstrap values are below the branches. Branches in bold have maximum support.
known taxa are ectomycorrhizal (Tedersoo & al. 2006) but we have not
been able to determine the mycorrhizal associate(s) for our new species.
The ectomycorrhizal host could be Pinus roxburghii, which grows near the
site where this species has been repeatedly collected in the Botanical Garden
386 ... Saba & al.
Tarzetta catinus
Trichophaea_hybrida_TAA192334
Geopora ahmadii KY805995
Geopora ahmadii KY805996
Geopora arenicola FM206473 IX
Geopora foliacea FM206470
Geopora arenicola FM206472
0.7 Geopora sp. FM206471
7 ECM 2 AJ410862
ECM 95 AJ410865
0.9 ECM Riv-4 EF484934
09 Geopora cf. sepulta FM206476 X
Geopora cooperi AF387650
Geopora cooperi AF387651
Geopora cooperi AF387649
Geopora cercocarpi NR_121491
Geopora cercocarpi HQ283090
Geopora pinyonis KF768653
0.8 Geopora pinyonis KF768652
Geopora tolucana HQ184961
Geopora tolucana HQ184960
Geopora gilkeyae DQ974731
Geopora sepulta FM206432
Geopora sepulta FM206431
Geopora arenicola FM206449
Geopora arenicola FM206446
Geopora arenicola FM206462
Geopora arenicola FM206460
Geopora arenicola FM206433
Geopora arenicola FM206440
Geopora arenicola FM206439
Geopora foliacea FM206428
0.9 - Geopora foliacea FM206424
Geopora cervina FM206426 |
Geopora cervina FM206420 |
0.7
Geopora sp. FM206475
Geopora tenuis FM206429
Geopora tenuis FM206402
Geopora tenuis FM206397
Geopora tenuis FM206396
Geopora cervina FM206401
Geopora cervina FM206413
Geopora arenicola FM206412
Geopora cervina FM206406
Geopora cervina FM206410
Geopora cervina FM206409
Geopora arenicola FM206418
Geopora cervina FM206419
Geopora cervina FM206417
0.7 - Geopora cervina FM206390
Geopora cervina FM206387
Geopora cervina FM206389
Geopora cervina FM306391
I+11+lll
Fic. 4. Phylogeny of Geopora species produced from Bayesian inference of the ITS rDNA dataset.
Only posterior probabilities 20.9 are shown. Branches in bold have maximum support.
of the Department of Botany, University of the Punjab, Lahore, Pakistan.
Associations of the new species should be evaluated with sequences from
root tip samples.
Geopora ahmadii sp. nov. (Pakistan) ... 387
Geopora ahmadii is distinct from other Geopora species based on
apothecial shape, partial immersion of the apothecium in the soil, hymenial
color, and ascospore size. Other partly immersed species are G. tenuis
(Fuckel) T. Schumach. and G. cervina (Velen.) T. Schumach. (Yao & Spooner
1996), which are distinguished by different spore sizes ((20.3—)21.4(—23.0) x
(10.8—)11.6(—12.1) for G. tenuis; (20.8—)23.8(—26.2) x (10.8—)12.1(-14.2) um
for G. cervina; Tamm & al. 2010) and placement in different clades in our
analyses. The hymenial color in G. ahmadii is similar to G. sepulta (Fr.) Korf
& Burds., which differs by complete immersion in the soil and placement
in another clade.
Our molecular analyses place G. ahmadii in clade IX sensu Tamm &
al. (2010). Its morphological characters—including the position and shape
of the ascomata and ascospore dimensions—are consistent with placement
among the other clade IX species. This clade includes specimens initially
identified as G. arenicola and G. foliacea (Schaeff.) S. Ahmad. Geopora
arenicola, as defined by Tamm & al. (2010), has a completely immersed
ascoma. The name G. foliacea has been variously applied.
Once again, this study underscores the difficulties of using morphology
for species delimitation in this group. Southworth & al. (2011) also
noted the difficulty in using morphology to describe their new species,
G. cercocarpi, citing its exclusive association with Cercocarpus ledifolius and
that other Geopora specimens showed similar host fidelity. Unfortunately
we do not know the associate of G. ahmadii but we plan to collect root tip
samples under trees of its most likely candidate ectomycorrhizal associate,
Pinus roxburghii.
One comment regarding G. arenosa (Fuckel) S. Ahmad: Ahmad (1978)
transferred Peziza arenosa Fuckel [= Humaria arenosa (Fuckel) Fuckel]
(Fuckel 1864, 1866, 1870) to Geopora based on a collection he studied from
Rawalakot, Pakistan. According to his description, G. arenosa has globose
to subglobose apothecia, a whitish gray hymenial surface, and ellipsoid
ascospores measuring 20-24 x 13-14.5 um. Yao & Spooner (1996) studied
the type material of G. arenosa (Fuckel’s Fungi Rhenani exsiccati, No. 1212,
K—K(M) 69362, designated as lectotype by Yao & Spooner 2003), and
their description contrasts with the material studied by Ahmad (1978) in
ascospore shape and size (ellipsoid to fusoid, 27-30 x 13.5-15 um in the
G. arenosa type vs. ellipsoid, 20-24 x 13-14.5 um in Ahmad’s material).
Because of these discrepancies, we believe that Ahmad’s collection from
Rawalakot represents a previous collection of our new species. We have not
388 ... Saba & al.
been able to locate Ahmad’s specimen and it is likely lost. It is not present
in LAH and no sequence data are available for the Rawalakot material.
Further collecting in Rawalakot may help to resolve the identity of Ahmad’s
species and to determine if it is indeed conspecific with G. ahmadii.
Acknowledgments
We are highly indebted to Higher Education Commission (HEC), Islamabad,
Pakistan, for funding this project under Phase II, Batch I, Indigenous PhD fellowships
program for 5000 scholars and through International Research Support Initiative
Program (IRSIP). Finally, we thank Dr. Rosanne Healy and Dr. Matthew E. Smith (both
of Dept. Plant Pathology, University of Florida, Gainesville, USA), and Nomenclature
Editor Dr. Shaun B. Pennycook for critically reviewing the manuscript, which would
have been a lot meagerer if it weren't for their valuable comments for improvement.
References
Ahmad S. 1978. Ascomycetes of Pakistan. Part 1. Biological Society of Pakistan, Lahore. Monograph
No. 7.
Burdsall HH Jr. 1965. Operculate asci and puffing of ascospores in Geopora (Tuberales). Mycologia
57(3): 485-488. https://doi.org/10.2307/3756880
Burdsall HH Jr. 1968. A revision of the genus Hydnocystis (Tuberales) and of the hypogeous species
of Geopora (Pezizales). Mycologia 60(3): 496-525. https://doi.org/10.2307/3757418
Dentinger BT, Didukh MY, Moncalvo JM. 2011. Comparing COI and ITS as DNA barcode
markers for mushrooms and allies (Agaricomycotina). Plos One 6(9): e25081 [8 p.].
https://doi.org/10.1371/journal.pone.0025081
Drummond AJ, Rambaut A. 2007. BEAST: Bayesian evolutionary analysis by sampling trees.
BMC Evolutionary Biology 7(1): 214. https://doi.org/10.1186/1471-2148-7-214
Edgar, RC. 2004. MUSCLE: Multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Research 32: 1792-1797. https://doi.org/10.1093/nar/gkh340
El Karkouri K, Martin FE, Mousain D. 2004. Diversity of ectomycorrhizal symbionts in a
disturbed Pinus halepensis plantation in the Mediterranean region. Annals of Forest
Science 61(7): 705-710. https://doi.org/10.1051/forest:2004069
Flores-Renteria L, Lau MK, Lamit LJ, Gehring CA. 2014. An elusive ectomycorrhizal fungus
reveals itself: a new species of Geopora (Pyronemataceae) associated with Pinus edulis.
Mycologia 106(3): 553-563. https://doi.org/10.3852/13-263
Fuckel L. 1864. Fungi Rhenani exsiccati, fasc. 13. No. 1212.
Fuckel L. 1866. Fungi Rhenani exsiccati. Cent. 12-17. N. 1101-1700. Hedwigia 5: 14-16.
Fuckel L. 1870. Symbolae mycologicae. Beitrage zur Kenntniss der Rheinischen Pilze.
Jahrbiicher des Nassauischen Vereins fir Naturkunde 23-24. 459 p.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for Basidiomycetes:
application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
https://doi.org/10.1111/j.1365-294X.1993.tb00005.x
Guevara-Guerrero G, Stielow B, Tamm H, Cazares-Gonzalez E, Géker M. 2012. Genea
mexicana, sp. nov., and Geopora tolucana, sp. nov., new hypogeous Pyronemataceae from
Mexico, and the taxonomy of Geopora reevaluated. Mycological Progress 11(3): 711-724.
https://doi.org/10.1007/s11557-011-0781-y
Geopora ahmadii sp. nov. (Pakistan) ... 389
Hansen K, Perry BA, Dranginis AW, Pfister DH. 2013. A phylogeny of the highly diverse cup-
fungus family Pyronemataceae (Pezizomycetes, Ascomycota) clarifies relationships and
evolution of selected life history traits. Molecular Phylogenetics and Evolution 67: 311-335.
https://doi.org/10.1016/j.ympev.2013.01.014
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large
phylogenetic trees. 45-52, in: Proceedings of the Gateway Computing Environments Workshop
(GCE) 14 Nov. 2010. New Orleans, Louisiana. https://doi.org/10.1109/GCE.2010.5676129
Munsell Soil Color Charts. 1975. Munsell Color Company. Baltimore, Maryland, USA.
Perry BA, Hansen K, Pfister DH. 2007. A phylogenetic overview of the family Pyronemataceae
(Ascomycota, Pezizales). Mycological Research 111(5): 549-571.
https://doi.org/10.1016/j.mycres.2007.03.014
Rincon A, de Felipe MR, Fernandez-Pascual M. 2007. Inoculation of Pinus halepensis Mill. with
selected ectomycorrhizal fungi improves seedling establishment 2 years after planting in a
degraded gypsum soil. Mycorrhiza 18(1): 23-32. https://doi.org/10.1007/s00572-007-0149-y
Schumacher T. 1979. Notes on taxonomy, ecology, and distribution of operculate discomycetes
(Pezizales) from river banks in Norway. Norwegian Journal of Botany 26: 53-83.
Smith ME, Douhan GW, Rizzo DM. 2007. Ectomycorrhizal community structure in a xeric Quercus
woodland based on rDNA sequence analysis of sporocarps and pooled roots. New Phytologist
174(4): 847-863. https://doi.org/10.1111/j.1469-8137.2007.02040.x
Southworth D, Frank JL. 2011. Linking mycorrhizas to sporocarps: a new species, Geopora
cercocarpi, on Cercocarpus ledifolius (Rosaceae). Mycologia 103(6): 1194-1200.
https://doi.org/10.3852/11-053
Stamatakis A, Hoover P, Rougemont J. 2008. A rapid bootstrap algorithm for the RAxML web
servers. Systematic Biology 57(5): 758-771. https://doi.org/10.1080/10635150802429642
Stielow B, Hensel G, Strobelt D, Makonde HM, Rohde M, Dijksterhuis J, Klenk HP, Goker
M. 2013. Hoffmannoscypha, a novel genus of brightly coloured, cupulate Pyronemataceae
closely related to Tricharina and Geopora. Mycological Progress 12(4): 675-686.
https://doi.org/10.1007/s11557-012-0875-1
Swofford DL. 1991. PAUP: Phylogenetic Analysis Using Parsimony, version 3.1. Computer
program distributed by the Illinois Natural History Survey, Champaign, Illinois, USA.
Tamm H, Podldmaa K, Kullman B. 2010. Phylogenetic relationships in genus
Geopora (Pyronemataceae, Pezizales). Mycological Progress 9(4): 509-522.
https://doi.org/10.1007/s11557-010-0659-4
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS: molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and
maximum parsimony methods. Molecular Biology and Evolution 28(10): 2731-2739.
https://doi.org/10.1093/molbev/msr121
Tedersoo L, Hansen K, Perry BA, Kjoller R. 2006. Molecular and morphological diversity of
pezizalean ectomycorrhiza. New Phytologist 170: 581-596.
https://doi.org/10.1111/j.1469-8137.2006.01678.x
White TJ, Bruns T, Lee SJWT, Taylor JW. 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis & al. (eds).
PCR protocols: a guide to methods and applications. San Diego, CA. Academic Press.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Yao YJ, Spooner BM. 1996. Notes on British species of Geopora. Mycological Research
100(1): 72-74. https://doi.org/10.1016/S0953-7562(96)80102-X
Yao YJ, Spooner BM. 2003. The occurrence of Geopora arenosa in the British Isles. Kew
Bulletin 58(1): 247-252. https://doi.org/10.2307/4119373
MYCOTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 391-398
https://doi.org/10.5248/134.391
Seychellomyces sinensis sp. nov. from China
Min Q1A0%, HuA ZHENG**S, ZHE ZHANG’, ZE-FEN YU”*
‘Laboratory for Conservation and Utilization of Bio-resources,
Key Laboratory for Microbial Resources of the Ministry of Education,
Yunnan University, Kunming, Yunnan, 650091, P. R. China
’ School of Life Sciences, Yunnan University,
Kunming, Yunnan, 650091, P. R. China
* CORRESPONDENCE TO: [email protected]
ABSTRACT —An aquatic hyphomycete, Seychellomyces sinensis, isolated from China, is
proposed as a new species. Phylogenetic analysis of combined ITS, LSU, 60S, and MCM7
sequences place Seychellomyces in Ceratocystidaceae. The new species, characterized by
septate conidia and elliptical to cylindrical (sub)hyaline endoconidia, is distinguished from
S. hexagonus by its larger, 1-3-septate conidia.
KEY worps—asexual fungi, Microascales, Sordariomycetes, taxonomy
Introduction
Aquatic hyphomycetes are fungi that most commonly occur on dead
leaves in streams (Barlocher 1992). These fungi are a polyphyletic group
that play a key role in processing organic matter in freshwater (Belliveau &
Barlocher 2005). Traditionally, species have been identified through their
conidial morphology, but phylogenetic placements of many species have
not yet been determined. The introduction of molecular analysis to fungal
taxonomy has recently verified the phylogenetic placement of some species
(Duarte & al. 2015).
Seychellomyces Matsush. was proposed for a single species, S. hexagonus
Matsush. (Matsushima 1981) and remains monotypic. It is characterized by
‘These authors contributed equally to this research.
392 ... Qiao, Zheng & al.
producing septate brown to pale brown conidia that are hexagonal in cross-
section and aseptate hyaline endoconidia (Matsushima 1981, Seifert & al.
2011).
Several new hyphomycetes species have been reported from southwest
China (Qiao & al. 2017a,b; 2018a,b, 2019; Yu & al. 2019). During further
study of the aquatic hyphomycetes, a specimen with two types of conidia
was found growing on submerged dicotyledonous leaves. The specimen was
quite close to Seychellomyces hexagonus in its conidiogenous features but
differed in possessing larger and more septate conidia. Here we describe it
as a new species and present the phylogenetic position of Seychellomyces as
determined by combined sequences of internal transcribed spacer (ITS),
large subunit nuclear ribosomal RNA (LSU), 60S ribosomal protein gene
RPL10 (60S), and the minichromosome maintenance complex component
7 (MCM7).
Materials & methods
Collection, fungal isolation, and morphological characterization
Submerged dicotyledonous leaves were collected from a stream in Sangsi,
Guangxi Province, China. Samples were preserved in zip-lock plastic bags,
labelled, and transported to the laboratory. Each rotted leaf was cut into several
3-4 x 4-5 cm fragments that were incubated on CMA (20 g cornmeal, 18 g agar,
40 mg streptomycin, 30 mg ampicillin, 1000 ml distilled water) for 5 days at room
temperature. Individual conidia were isolated using a sterilized toothpick under
a BX51 microscope and cultivated on CMA plates. Morphological observations
were conducted on cultures growing on CMA, V-8 juice agar (200 ml Campbell
V-8 juice, 3.0 g CaCO,, 18 g agar, 800 ml distilled H,O), and PDA (200 g potato,
20 g dextrose, 18 g agar, 1000 ml distilled H,O) after incubation at 25°C for one
week.
Pure cultures were deposited in the Herbarium of the Laboratory for
Conservation and Utilization of Bio-resources, Yunnan University, Kunming,
Yunnan, P.R. China (YMF; formerly Key Laboratory of Industrial Microbiology
and Fermentation Technology of Yunnan).
DNA extraction, PCR amplification, and sequencing
Genomic DNA was extracted from fresh mycelia grown on potato dextrose agar
(PDA) at 25°C as described by Turner & al. (1997). Four gene regions were amplified:
ITS with primer pair ITS5/ITS4 (White & al. 1990); LSU with LROR/LR7 (Vilgalys
& Hester 1990); 60S ribosomal protein RPL10 (60S) with 60S-506F/60S-908R
(Nel & al. 2018); and MCM7 with MCM7-for/MCM7-rev (Nel & al. 2018). The
PCR thermal cycle programs for the amplifications of these four DNA fragments
followed those described in de Beer & al. (2014). PCR products were then purified
Seychellomyces sinensis sp. nov. (China) ... 393
TABLE 1. Strains and GenBank accession numbers of sequences used in molecular
phylogenetic analyses
GENBANK NUMBER
SPECIES STRAIN
ITS LSU 60S MCM7
Ambrosiella xylebori CMW110.61 NR_144921 KM495318 KM495495 KM495407
Berkeleyomyces basicola CMW6714 MF952423 MF948658 =MF967072 MF967079
CMW49351 MF952428 MF948659 MF967075 MF967102
CMW25439 MF952427 — _ MF967099
Berkeleyomyces rouxiae CMW5472 MF952406 MF948657. + =MF967074 = MF967080
CMW 14219 MF952402 MF948660 MF967076 MF967086
Ceratocystis diversiconidia CMW22445 FJ151440 KM495334. =KM495511 KM495423
Ceratocystis eucalypticola CMW11537 FJ236723 KM495339 =96KM495516 =©«KM495428
Ceratocystis fimbriata CMW 15049 AY953378 KM495343, =KM495520 KM495432
Ceratocystis pirilliformis CMW6579 AF427105 KM495365 KM495542 KM495453
Ceratocystis platani CMW 14802 DQ520630 KM495366 KM495543 KM495454
Chalaropsis ovoidea CMW22733 FJ411343 KM495400 =KM495577. =. KM495487
Chalaropsis thielavioides CMW 22736 FJ411342 KM495402, =KM495579 =KM495489
Davidsoniella australis CMW2333 FJ411325 KM495396 KM495573 KM495483
Davidsoniella eucalypti CMW3254 FJ411327 KM495338 KM495515 KM495427
ame note CMW26365 -FJ411322. = KM495329 KM495506 KM495418
Endoconidiophora douglasii §CMW26367 NR_120295 KM495335 KM495512 KM495424
Graphium pseudormiticum CMW503 AY 148186 KM495390 KM495567. =KM495477
Huntiella chinaeucensis CMW24658 JQ862729 KM495327 KM495504 KM495416
Huntiella moniliformis CMW 10134 FJ151422 KM495355 = KM495532. =KM495443
Huntiella oblonga CMW23803 EU245019 KM495359 =9.KM495536 =9§ KM495447
Seychellomyces sinensis YMF1.04178 KU549178 MG830704 MK554714. MK554715
Thielaviopsis cerberus CMW36668 NR_145225 KM495326 KM495503 KM495415
Thielaviopsis musarum CMW 1546 JX518325 KM495357. = KM495534. KM 495445
Thielaviopsis paradoxa CMW36689 JX518342 KM495363, =KM495540 KM495451
Thielaviopsis radicicola CMW 1032 KF612023 KM495371 KM495548 KM495459
using a Bioteke DNA Gel/PCR Purification Kit and forward and reverse sequenced
with a LI-COR 4000L automatic sequencer, using a Thermo Sequenase-kit as
described by Kindermann & al. (1998).
394 ... Qiao, Zheng & al.
4007 CMW11536 C. eucalypticola
62|' CMW15049 C. fimbriata
100|_ CMW14802 C. platani Ceratocystis
top CMW22445 C. diversiconidia
98 CMW6579 C. pirilliformis
CMW22733 Ch. ovoidea
CMW22736 Ch. thielavioides
He. CMW49352 B. basicola
100 CMW6714 B. basicola
100|‘ CMW25439 B. basicola Berkeleyomyces
CMW14219 B. rouxiae
°°! CMW5472 B. rouxiae
YMF1.04178 Seychellomyces sinensis Seychellomyces
CMW1032 T. radicicola
106 CMW36668 T. cerberus Thie laviopsis
CMW1546 T. musarum
'°l__ CMW36689 T. paradoxa
“ soo CMW2333 D. australis
Ul ina CMW3254 D. eucalypti
CMW26365 E. coerulescens
CMW26367 E. douglasii
so07- CMW23803 H. oblonga
100 | CMW24658 H. chinaeucensis Huntiella
ree CMW10134 H. moniliformis
CBS110.61 A. xylebori Ambrosiella
ie Chalaropsis
97
94
df
Davidsoniella
100 Endoconidiophora
CMW503 G. pseudormiticum Graphium
0.07
aeoepiskoojelay
PLATE 1. MrBayes tree generated from a combined alignment of ITS, LSU, 60S, and MCM7
sequences of Ceratocystidaceae, with Graphium pseudormiticum (Microascaceae) as outgroup.
Sequence alignment and phylogenetic analysis
The sequence dataset contained the ITS, LSU, 60S and MCM7 sequence data for 21
species representing eight genera in the Ceratocystidaceae (Microascales). Graphium
pseudormiticum M. Mouton & M.J. Wingf. (Microascaceae) was chosen as outgroup
based on Nel & al’s (2018) phylogenetic study, and the sequence data were downloaded
from the NCBI GenBank database (TABLE 1).
Seychellomyces sinensis sp. nov. (China) ... 395
DNA sequence data were aligned using ClustalX 1.83 (Higgins 1994) with default
parameters, and the consensus sequences were adjusted manually and linked in
BioEdit v.7.0 (Hall 1999). MrBayes (Ronquist & Huelsenbeck 2003) was used to
calculate the concatenated sequence-based tree, with following parameters: ngen =
1,000,000; samplefr = 1000; printfr = 1000.
Phylogenetic results
The final alignment included a total of 2022 base pairs. The phylogenetic
tree was generated by combining the ITS, LSU, 60S, and MCM7 sequences and
using Bayesian analysis. The topology of the tree is shown with the bootstrap
support value for each node (PLATE 1). The tree supports Seychellomyces
within the Ceratocystidaceae; the genus does not group with any other genera
but is associated with the lineage (94% support) containing Berkeleyomyces,
Chalaropsis, and Ceratocystis in a basal position.
Taxonomy
Seychellomyces sinensis Z.F. Yu & Hua Zheng, PLATE 2
MB 829084
Differs from Seychellomyces hexagonus by its larger 1-3-septate conidia.
Type: China, Guangxi province, Shangsi, Shiwan Mountain, 21°34’49”N 109°14’20’E,
alt. 23 m, on decaying leaf of an unidentified broadleaf tree, 7 July 2013, Z.F. Yu.
(Holotype, YMFT 1.04178 [permanent slide]; ex-type living culture, YMF 1.04178;
GenBank KU549178, MG830704, MK554714, MK554715).
EryMo.oey: From the Latin, sinensis, for the country of origin, China.
COLONIES attaining 3 cm diam. after 7 days on CMA, effuse, pale brown
to brown. Mycelium sparse, hyphae branched, septate, hyaline or pale
brown. CONIDIOPHORES arising from the creeping hyphae, cylindrical,
2(-5)-septate, erect, unbranched, smooth, 12-40 x 5-7 um (narrowing to
3.5-5 um at the apex). CONIDIOGENOUS CELLS monoblastic, integrated,
terminal, determinate. Conip1A ellipsoidal, brown to pale brown, smooth or
sometimes with a warty surface, growing singly or 2-3 in chains, 1-3-septate
(mainly 2-septate), with short (4-13 um long) cylindrical conidiophore
remnants at both ends, in cross-section hexagonal (occasionally pentagonal
or quadrangular). ENDOCONIDIA originating endogenously within phialides,
catenulate, variable in length, hyaline or subhyaline, elliptical to cylindrical,
truncate at ends, occasionally repetitiously germinating by producing a
short conidiophore from which a phialide is formed to produce a chain of
endoconidia. CHLAMYDOSPORES ochraceous, globose, smooth, 5-10 um in
diam.
396 ... Qiao, Zheng & al.
CONIDIAL SIZES ON DIFFERENT MEDIA—ON V-8 JUICE AGAR: 1-septate,
20-23 x 12-16 um, total length (including short cylindrical conidiophore
remnants) 34-39 tm; 2-septate, 29-39 x 16-21 um, total length 40-56 um;
3-septate 35-49 x 11-15 um, total length 55-35 um; endoconidia 5-21 x
3=5;/-pams
On PDA: 1-septate, 20-27 x 13-21 um, total length 31-45 um; 2-septate,
38-50 x 19-30 um, total length 42-69 um; 3-septate 38-56 x 19-27 um, total
length 53-73 um; endoconidia 7-39 x 3-5 um.
On CMA: 1-septate, 23-30 x 15-21 um, total length 34-47 um; 2-septate,
31-51 x 19-31 um, total length 42-70 um; 3-septate, 42 x 20 um, total length
58 um; endoconidia 6-42 x 3-5 um.
Discussion
Seychellomyces has been treated as monotypic since the genus was
established in 1981. Based on characteristic of conidia and endoconidia,
our strain was easily identified to Seychellomyces. However, S. sinensis is
distinguished from the type species, S. hexagonus, by having 1-3-septate
conidia, while conidia of S. hexagonus are always 2-septate. In
addition, conidia of S. hexagonus are always hexagonal in cross-section
(Matsushima 1981), whereas those of S. sinensis are mostly hexagonal,
but occasionally pentagonal or quadrangular. The size of conidia of
S. sinensis differs based on growth medium and conidial septation; but
on V-8 juice agar medium the 2-septate conidia of S. sinensis are larger
than those of S. hexagonus (25-33 x 14-18 um; Matsushima 1981).
Globose chlamydospores were observed in culture of S. sinensis, but not
mentioned in S. hexagonus.
Among Ceratocystidaceae, only Thielaviopsis sensu lato has a
superficial resemblance to Seychellomyces in conidial shape (Seifert & al.
2011). However, Thielaviopsis, Chalaropsis, and Ceratocystis significantly
differ from S. sinensis phylogenetically.
Acknowledgments
This work was financed by the National Natural Science Foundation Program
of the PR China (31770026, 31570023). We are very grateful to Dr. Rafael F.
Castafieda-Ruiz (INIFAT Alejandro de Humboldt, Havana, Cuba) and Prof. Jun-
Zhi Qiu (Fujian Agriculture & Forestry University, Fuzhou, China) for critically
reviewing the manuscript and providing helpful suggestions to improve this paper,
and to Dr. Shaun Pennycook and Dr. Lorelei Norvell for their critical review and
suggestions.
Seychellomyces sinensis sp. nov. (China) ... 397
|
PLATE 2. Seychellomyces sinensis (holotype, YMF 1.04178): A-C. Conidia; D, E. Conidia with
conidiophores; F. Chlamydospores; G. Cross-section of conidia. H. Endoconidia. I. Conidiogenous
cells of endoconidia. Scale bars: A-C, F, H, I = 10 um; D, E = 20 um; G = 100 um.
398 ... Qiao, Zheng & al.
Literature cited
Barlocher F. 1992. The ecology of aquatic hyphomycetes. Springer Berlin Heidelberg.
Belliveau MJ, Barlocher F. 2005. Molecular evidence confirms multiple origin of aquatic
hyphomycetes. Mycological Research 109: 1407-1417.
https://doi.org/10.1017/s0953756205004119
de Beer ZW, Duong TA, Barnes I, Wingfield BD, Wingfield MJ. 2014. Redefining Ceratocystis and
allied genera. Studies in Mycology 79:187-219. https://doi.org/10.1016/j.simyco.2014.10.001
Duarte S, Batista D, Barlocher F, Cassio F, Pascoal C. 2015. Some new DNA barcodes of aquatic
hyphomycete species. Mycoscience 56: 102-108. https://doi.org/10.1016/j.myc.2014.04.002
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.
https://doi.org/10.1007/978-1-4757-0905-6_31
Higgins DG. 1994. CLUSTAL V: multiple alignment of DNA and protein sequences. Methods in
Molecular Biology 25: 307-318. https://doi.org/10.1385/0-89603-276-0:307
Kindermann J, El-Ayouti Y, Samuels GJ, Kubicek CP. 1998. Phylogeny of the genus Trichoderma
based on sequence analysis of the internal transcribed spacer region 1 of the rDNA clade.
Fungal Genetics and Biology 24: 298-309. https://doi.org/10.1006/fgbi.1998.1049
Matsushima T. 1981. Matsushima mycological memoirs no. 2. Matsushima Fungus Collection.
Kobe. 68 p.
Nel WJ, Duong TA, Wingfield BD, Wingfield MJ, de Beer ZW. 2018. A new genus and species
for the globally important, multihost root pathogen Thielaviopsis basicola. Plant Pathology 67:
871-882. https://doi.org/10.1111/ppa.12803
Qiao M, Huang Y, Deng C, Yu ZF. 2017a. Tripospermum sinense sp. nov. from China. Mycotaxon
132: 513-517. https://doi-org/10.5248/132.513
Qiao M, Du X, Bian ZH, Peng J, Yu ZE. 2017b. Ellisembia pseudokaradkensis sp. nov. from Hainan,
China. Mycotaxon 132: 813-817. https://doi.org/10.5248/132.813
Qiao M, Guo JS, Tian WG, Yu ZF. 2018a. Ellisembia hainanensis sp. nov. from Hainan, China.
Mycotaxon 133: 97-101. https://doi.org/10.5248/133.97
Qiao M, Li WJ, Huang Y, Xu JP, Zhang L, Yu ZE 2018b. Classicula sinensis, a new species
of basidiomycetous aquatic hyphomycetes from southwest China. MycoKeys 40: 1-12.
https://doi.org/10.3897/mycokeys.40.23828
Qiao M, Tian WG, Castafeda-Ruiz RF, Xu JP, Yu ZE 2019. Two new species of Verruconis from
Hainan, China. MycoKeys 48: 41-53. https://doi.org/10.3897/mycokeys.48.32147
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. https://doi.org/10.1093/bioinformatics/btg180
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Turner D, Kovacs W, Kuhls K, Lieckfeldt E, Peter B, Arisan-Atac I, Strauss J, Samuels GJ,
Borner T, Kubicek CP. 1997. Biogeography and phenotypic variation in Trichoderma sect.
Longibrachiatum and associated Hypocrea species. Mycological Research 101: 449-459.
https://doi.org/10.1017/s0953756296002845
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
https://doi.org/10.1128/jb.172.8.4238-4246.1990
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis & al. (eds). PCR Protocols: a guide to
methods and applications. San Diego, CA. Academic Press.
https://doi.org/10.1016/b978-0-12-372180-8.50042-1
Yu ZF, Lv YE, Feng B, Qiao M. 2019. Lemonniera yulongensis sp. nov. from Yunnan, China.
Mycotaxon. 134:177-181. https://doi.org/10.5248/134.177
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2019
April-June 2019—Volume 134, pp. 399-406
https://doi.org/10.5248/134.399
Ramaria flavescentoides sp. nov. with clamped basidia
from Pakistan
MUHAMMAD HAnIkF’*, ABDUL NASIR KHALID’, RONALD L. EXETER?
' Department of Botany, Government College University,
Lahore, 54600, Pakistan
? Department of Botany, University of the Punjab,
Quaid-e-Azam Campus, Lahore, 54590, Pakistan
* Dallas, Oregon, 97338, USA
* CORRESPONDENCE TO: dr.mhanif @gcu.edu.pk
AsBsTRACT—During an investigation of macrofungi from Pakistan, a new species with
clamped basidia within Ramaria subg. Laeticolora and associated with Abies pindrow was
found, which is proposed here as Ramaria flavescentoides. The new fungus morphologically
resembles R. flavescens and clusters phylogenetically within the same clade. Ramaria
flavescentoides is characterized by an obovate to obconic basidioma with pale orange to light
orange branches and apices that are tinged light greenish grey, a monomitic hyphal system,
ampulliform clamp connections, stellate crystals distributed within the upper branches,
multiguttulate rhizomorphic strands, and oblong to ellipsoid verrucose basidiospores.
Key worps—Himalayan moist temperate forest, ITS region, molecular identification,
polychotomous branching
Introduction
Ramaria Fr. ex Bonord. (Ramariaceae) is a widespread non-gilled
basidiomycete genus comprising nearly 220 species worldwide (Kirk & al.
2008). The basidiomata, which generally repeatedly branch dichotomously,
are usually divided into stipe, branches, and apices. Important diagnostic
characters include color, stipe consistency (fibrous vs gelatinous), odor,
staining reactions to reagents, presence or absence of clamp connections,
and spore size and ornamentation (Exeter & al. 2006). Villegas & al. (1999)
AOO ... Hanif, Khalid, Exeter
placed Ramariaceae in Gomphales, a placement also supported by molecular
phylogenetic studies (Hibbett & al. 1997, Bruns & al. 1998, Humpert & al.
2001, Giachini 2004). Ramaria, which includes both saprobic and
ectomycorrhizal species, is currently divided into four subgenera: R. subg.
Echinoramaria Corner, R. subg. Lentoramaria Corner, R. subg. Ramaria,
and R. subg. Laeticolora Marr & D.E. Stuntz (Marr & Stuntz 1973, Exeter
& al. 2006). Previously these divisions were based on spore ornamentation,
monomitic vs. dimitic rhizomorphic strands, humicolous vs. lignicolous
substrate, and presence or absence of clamp connections.
Ramaria flavescentoides is described here based on morphological and
molecular data as a new species in R. subg. Laeticolora. Both R. subg. Laeticolora
and R. subg. Ramaria tend to develop larger fruiting bodies than R. subg.
Echinoramaria and R. subg. Lentoramaria. Ramaria subg. Laeticolora is further
characterized by non-striate basidiospores that are almost smooth to distinctly
ornamented at 1000x (vs. striate in R. subg. Ramaria), tissues that are primarily
non-amyloid (vs. amyloid in R. subg. Ramaria), single to fasciculate stipe bases,
usually brightly colored branches and apices, and a terrestrial habit (Exeter &
al. 2006).
Materials and methods
Collections
The sampling site was selected based on the richness and abundance of
aphyllophoralean fungi in an area of probable high basidiomycete biodiversity in
a moist temperate coniferous forest in Khyber Pakhtunkhwa, Pakistan where air
temperatures range from -4 to 25°C, and the soil is loamy with gravel and variably
sized stones. Field notes and photographs were made of all collections, and the
specimen was morphologically characterized following Corner (1950). Features
(stipe, branches, rhizomorphic hyphae) were measured microscopically at 1000x
using a compound microscope equipped with an ocular micrometer. Measurements
of basidiospores, basidia, cystidia, and rhizomorphic hyphae were determined from
at least 20 measurements per character. Small (~1 cm) portions of the hymenium
were stored in 2% CTAB buffer in 1.5 ml Eppendorf vials and stored at —20°C for
molecular analysis; the remaining material was dried using a fan heater and stored
in sealed plastic bags. The collections are curated at the mycological herbarium at
the University of the Punjab, Lahore, Pakistan (LAHMH).
DNA extraction, PCR amplification & sequencing
Hymenial tissue was removed with sterile forceps for DNA extraction by a CTAB
method following Gardes & Bruns (1993), modified for Gene-Clean silica emulsion
binding and purification. The polymerase chain reaction (PCR) followed Gardes &
Ramaria flavescentoides sp. nov. (Pakistan) ... 401
Mi Ramaria flavescentoides MG760617
@ Ramaria flavescentoides MG760618
@ Ramaria flavescentoides MG760616 [T]
@ Ramaria flavescentoides MG760615
@ Ramaria flavescentoides MG760614
@ Ramaria flavescentoides MG760613
24 @ Ramaria flavescentoides MG760612
Ramaria sp. DQ974713 Clade | [Clamped Basidia]
94 , Ramaria flavescens AJ408366
77 Ramaria flavescens AJ408365
58 Ramaria rasilisporoides JQ408242
99 - Ramaria flavoides AJ408381
Ramaria flavoides AJ408380 Subgenus Laeticolora
99 Ramaria largentii EU652344
82 Ramaria maculatipes EU669390
92 Ramaria ignicolor AJ408386
Ramaria conjunctipes EU846301
Ramaria mediterranea AJ408370
85 , Ramaria araiospora EU837208
99 [TL Ramaria sp. DQ365620 Clade II [Non-Clamped Basidia]
Ramaria araiospora EU852809
30 Ramaria sp. DQ365603
Ramaria cystidiophora EU597077
93 |Ramaria cystidiophora DQ384590
Ramaria formosa DQ365648
99 Ramaria flaccida AJ408390
89 Ramaria flaccida AJ408371 peo Echinoramaria
99
51
34 Ramaria curta AJ408358
Ramaria stricta EU819419
Ramaria stricta DQ367910 Clade Ill
Ramaria rubella AY854078
Ramaria abietina FJ627035
51 Ramaria gracilis AJ408378
g9 + Ramaria gracilis EU258553
Ramaria rubripermanens AJ408368
Ramaria botrytis AF377055
Ramaria concolor f. marrii AF213110
Ramaria rainierensis AY574694
Ramaria eumorpha AF139973
Ramaria botrytis EU652385
Ramaria rubrievanescens AF213061
93 | Ramaria rubrievanescens AF213060
Clade IV
99
0.1
Fic. 1. Maximum Likelihood phylotree of the evolutionary history of ITS sequences of Ramaria
species, including R. flavescentoides. The tree with the highest log likelihood (-10063.0715)
is shown, drawn to scale with branch lengths indicating the number of substitutions per site.
Bootstrap support is shown next to the branches.
Bruns (1993), using the fungus-specific ITS1F primer (CTTGGTCATTTAGAGGAAGT)
and the eukaryotic ITS4 primer (TCCTCCGCTTATTGATATGC) to amplify the nuclear
rDNA-ITS region. The hot-start enzyme JumpStart catalyzed the PCR with 2 min
at 94°C; followed by 30 cycles of 30 s at 94°C, 30 s at 53°C, and 40s + 5s per cycle
at 72°C; and finishing with 5 min at 72°C. The PCR products were purified with
QIAquick, sequenced bi-directionally using the reverse and forward primers and
BigDye 3.1 on an ABI 3730 DNA sequencer, and edited in Sequencher 4.5 by Jodrell
Laboratory, Royal Botanical Gardens, Kew, UK. The DNA sequences were BLAST
searched at NCBI (https://www.ncbi.nlm.nih.gov/) and submitted to GenBank.
Sequences were aligned and corrected manually for phylogenetic analysis with
MacClade 4.08. Percentage identities were calculated using DNAStar software.
402 ... Hanif, Khalid, Exeter
Phylogenetic analysis
The rDNA ITS sequences were aligned with sequences of other Ramaria species
selected from GenBank. The original dataset comprising 1108 characters including
gaps was trimmed by 252 characters excluded from 3’ and 5’ ends of the sequences. All
gaps were treated as missing data. Of the 856 characters (of ‘unord’ type and equally
weighted) analysed, 202 characters were constant, 616 were parsimony-uninformative,
and 507 were parsimony-informative. The Branch-and-Bound search method was
used for bootstrapping with 1000 bootstrap replicates in MEGA5 (Tamura & al. 2011).
Results
ITS rDNA-based identification and phylogenetic analysis
The amplification of the rDNA ITS from Ramaria flavescentoides produced
630-665 bp fragments. The consensus sequence of R. flavescentoides showed
91% identity and 65% query coverage with an undescribed Ramaria sp.
(DQ974713.1) and 88% identity and 75% query coverage with R. flavescens
(AJ408365).
Species included in this study were selected from all four Ramaria
subgenera based on the diagnostic characters of each subgenus. The
maximum likelihood phylogram represents four clades (Fic. 1). Clade I
represents species belonging to R. subg. Laeticolora with clamped basidia,
Clade II represents species belonging to R. subg. Laeticolora with non-
clamped basidia, and Clades III and IV represent species belonging to
R. subg. Echinoramaria, R. subg. Lentoramaria, and R. subg. Ramaria.
The Clade I sequences from R. flavescentoides clustered with those from
R. flavescens, R. flavoides, R. largentii, R. maculatipes, R. rasilisporoides, and
Ramaria sp. (bootstrap = 77%). Within the clade, R. flavescentoides was
sister to R. flavescens, R. rasilisporoides, and Ramaria sp. (bootstrap = 94%).
Percentages of genetic characters shared by R. flavescentoides with other
species were: Ramaria sp.—83%, R. flavescens—82%, R. largentii—81%,
R. rasilisporoides—79%, R. maculatipes—78%, and R. flavoides—77%.
Taxonomy
Ramaria flavescentoides Hanif & Khalid, sp. nov. Fic. 2
MB 823965
Differs from Ramaria flavescens by its obconic to obovate basidioma, its non-bulbous
fasciculate stipe, and the presence of stellate crystals in the upper branches.
Type: Pakistan. Khyber Pakhtunkhwa province, Hazara Division, Ayubia—Khanspur,
34°01’24”’N 73°24’14’E, 2159 m asl, under Abies pindrow, 8 August 2009, M. Hanif
MH88 (Holotype, LAHMH0889; GenBank MG760616).
EryMoLoGy—Named for its macroscopic resemblance with R. flavescens.
Ramaria flavescentoides sp. nov. (Pakistan) ... 403
Fic. 2. Ramaria flavescentoides (holotype, LAHMH0889). A. Basidiocarps; B. Basidiospores;
C. Basidia and cystidia; D. Stipe tramal hyphae; E. Overlapped cellular hyphae of upper
branches; F. Ampulliform tramal hyphae of upper branches; G. Stellate crystals among stipe
hyphal mass; H. Cellular hyphae of upper branches; I. Tramal elements of upper branches;
J. Dimitic hyphae of rhizomorph. Scale bars: A = 2 cm; B, C = 3 um; D, G = 15 um; E, H = 17 um;
F = 13.5 um; I = 6 um; J = 37.5 um.
BASIDIOMA 13-15 cm high, <10 cm broad, repeatedly branched, usually
obovate to obconic in outline; orange to light orange on drying. STIPE <3(-
404 ... Hanif, Khalid, Exeter
4) cm high, compound to fasciculate in groups of 2-5, orange white at the
base, upward pale orange, tapering gradually downward into a basal mycelial
mat or white tomentum covering the stipe base. RHIZOMORPHS white,
involving significant amounts of substrata, drying light orange. FLESH white,
solid, gelatinous or slippery, dried flesh firm but easily penetrated. Mayor
BRANCHES 4-6, 1.5-2 cm thick, stout, more or less terete, ascending, orange
white below, upward pale. BRANCHES 4—7 ranks, ascending, polychotomous,
smooth and gelatinous from exterior, pale orange; axils more or less rounded.
ApicEs 2—4 mm long, acute to blunt, light orange up to the tips with light
greenish grey tint. TASTE, ODOR, and MACROCHEMICAL REACTIONS not
recorded.
STIPE TRAMAL HYPHAE 6-11 um wide, hyaline, thin-walled, parallel,
slightly ampulliform, occasionally clamped, grainy encrusted with crystalline
material of various shapes; gloeoplerous hyphae not observed. TRAMAL
HYPHAE OF UPPER BRANCHES 6-8 um diam., hyaline, thin-walled, parallel,
ampulliform; skeletal generative hyphae present, clamps occasional, stellate
crystalline material 32 um diam. HYPHAE OF BASAL MAT monomitic, 3-4 um
diam., thin-walled, branched, clamped, 6 um thick at clamps, grainy
encrusted with crystalline material of various shapes; generative hyphae
7-10 um diam. RHIZOMORPHIC HYPHAE smooth to encrusted, diameters
vary. SUBHYMENIUM rudimentary, hyphal structure is monomitic with thin-
walled and thick-walled hyphae of various diameters, overlapped, septate;
frequent ampulliform hyphae (27 x 15 um). Hymenium thick during
maturation. BAsIDIA 32—50(—70) x 9-12 um, clavate, clamped; contents
homogeneous when young, slightly grainy, hyaline or slightly yellowish,
slightly cyanophilous, 4-spored; sterigmata 6-8 um high. BASIDIOSPORES
(10.7-)11—13(-15) x (4.8-)5—6(—7) um, verrucose, multiguttulate when
mature, oblong to ellipsoid, slightly curved at one end, contents weakly
cyanophilous; wall moderately thick; ornamentation strongly cyanophilous,
roughened outline of low coarse warts and delicate meandering ridges
covering significant areas of wall.
HABITAT & DISTRIBUTION—Terrestrial, solitary, under Abies pindrow.
Known only from the type area, Ayubia-Khanspur, fruiting in July-August
at 1900-2200 m asl.
ADDITIONAL SPECIMENS EXAMINED—PAKISTAN. KHYBER PAKHTUNKHWA
PROVINCE, Hazara Division, Ayubia~Khanspur, 34°01’24”N 73°24’14”E, 2159 m asl,
17 Aug 2009, M. Hanif MH136 (LAHMH1789.1; GenBank MG760618); Helipad,
34°01’31”N 73°25'19”E, 1974 m asl, 25 Jul 2008, M. Hanif MH253 (LAHMH2578.2;
GenBank MG760612); M. Hanif MH254 (LAHMH2578.3; GenBank MG760617);
Ramaria flavescentoides sp. nov. (Pakistan) ... 405
M. Hanif MH96 (LAHMH2578.5; GenBank MG760615); M. Hanif MHI101
(LAHMH2578.1; GenBank MG760613); 16 Aug 2009, M. Hanif MH97 (LAHMH 1689;
GenBank MG760614).
CoMMENTS—Ramaria flavescentoides is characterized by medium sized
obovate to obconic basidiomata with pale orange to light orange colored
branches and lightly tinged greenish grey apices and a compound to
fasciculate stipe that narrows gradually downward into a mat of white
mycelia and rhizomorphic strands.
The new species resembles R. flavescens (Schaeff.) R.H. Petersen in
shape, branching pattern, and basidioma color, also sharing a similar spore
shape and ornamentation and the presence of basidial clamp connections.
However, our specimens differ morphologically from R. flavescens, which
produces smaller (10 x 7 cm) obpyriform profusely branched basidiomata
with a rather abrupt ball surmounting the stipe and smaller basidiospores
(11-12.5 x 4.8-5.6 um; Petersen 1974). The presence of stellate crystalline
material in the hyphae of upper branches is another important character of
R. flavescentoides. Similar crystals have been reported by Zhang & al (2005)
in the stipe and upper branches of Ramaria luteoaeruginea P. Zhang & Zhu
L. Yang in R. subg. Echinoramaria. Phylogenetically, R. flavescentoides nests
adjacent to R. flavescens; and R. flavescentoides and R. flavescens cluster
together in clade I with other species having clamped basidia (Fic. 1).
Ramaria flavescentoides shares similar branching pattern, clamped
basidia, warted (verrucose) spores with morphological similarities with
its phylogenetic sister species, R. rasilisporoides Exeter, which clusters in
the same clade with strong (94%) bootstrap support (Fic. 1). Ramaria
rasilisporoides differs from R. flavescentoides in its pale yellow basidiomata,
amyloid stipe tissues, deeply rooting stipe with numerous abortive
branchlets, and smaller basidiospores (Exeter & al. 2006).
Ramaria mairei Donk, the only species of subg. Laeticolora previously
reported from Pakistan (Ahmad 1972; Ahmad & al. 1997), is distinguished
by larger (18 cm) basidiomata, a 8 cm high stipe, numerous pale or deep
lemon to pale ochraceous and rather lax or fairly crowded branches, and
slightly longer (10-15-um) oblong to ellipsoid roughened pale ochraceous
basidiospores (Ahmad 1972).
Phylogenetic analysis also supports the morphological identification.
Ramaria flavescentoides clusters with the clamped species of subg.
Laeticolora. This clade seems to be paraphyletic and originated with non-
clamped species of this subgenus with unsupported bootstrap frequency.
A406 ... Hanif, Khalid, Exeter
Humpert & al. (2001) reported the genus Ramaria as polyphyletic, which
our analyses support.
Acknowledgments
The authors would like to thank Dr. Ping Zhang (Hunan Normal University,
China) and Dr. Sana Jabeen (University of Education, Lahore, Pakistan) for their
helpful comments and critical review of this manuscript.
Literature cited
Ahmad S. 1972. Basidiomycetes of Pakistan. Biological Society of Pakistan. Monograph 6, Lahore.
Ahmad §S, Iqbal SH, Khalid AN. 1997. Fungi of Pakistan. Sultan Ahmad Mycological Society of
Pakistan, Department of Botany, University of Punjab, Quaid-e-Azam Campus, Lahore.
Bruns TD, Szaro TM, Gardes M, Cullings KW, Pan JJ, Taylor DL, Horton TR, Kretzer A, Garbelotto
M, Li Y. 1998. A sequence database for the identification of ectomycorrhizal basidiomycetes by
phylogenetic analysis. Molecular Ecology 7: 257-272.
https://doi.org/10.1046/j.1365-294X.1998.00337.x
Corner EJH. 1950. A monograph of Clavaria and allied genera. Annals of Botany Memoirs.
1. 740 p.
Exeter RL, Norvell L, Cazares E. 2006. Ramaria of the Pacific Northwestern United States.
United States Department of Interior, Bureau of Land Management: Salem, Oregon USA.
156 p.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes
application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118
https://doi.org/10.1111/j.1365-294X.1993.tb00005.x
Giachini AJ. 2004. Systematics of the Gomphales: the genus Gomphus Pers. sensu lato. PhD
Dissertation, Oregon State University, Corvallis, OR, USA
Hibbett DS, Pine EM, Langer E, Langer G, Donoghue MJ. 1997. Evolution of gilled
mushrooms and puffballs inferred from ribosomal DNA sequences. Proceedings of
the National Academy of Sciences of the United States of America 94: 12002-12006.
https://doi.org/10.1073/pnas.94.22.12002
Humpert AJ, Muench EL, Giachini AJ, Castellano MA, Spatafora JW. 2001. Molecular phylogenetics
of Ramaria and related genera: evidence from nuclear large subunit and mitochondrial small
subunit rDNA sequences. Mycologia 93: 465-477. https://doi.org/10.2307/3761733
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi.
10th edn. CAB International, U.K. https://doi.org/10.1079/9780851998268.0000
Marr CD, Stuntz DE. 1973. Ramaria of western Washington. Bibliotheca Mycologia 38. 232 p.
Petersen RH. 1974. Contribution toward.a monograph of Ramaria. 1.Some classic species redescribed.
American Journal of Botany 61: 739-748. https://doi.org/10.1002/j.1537-2197.1974.tb12296.x
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS5: molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and
maximum parsimony methods. Molecular Biology and Evolution 28(10): 2731-2739.
https://doi.org/10.1093/molbev/msr121
Villegas M, de Luna E, Cifuentes J, Torres AE. 1999. Phylogenetic studies in Gomphaceae sensu
lato (Basidiomycetes). Mycotaxon 70: 127-147.
Zhang P, Yang ZL, Ge ZW. 2005. Two new species of Ramaria from southwestern China.
Mycotaxon 94: 235-240.
MYCOTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. © 2019
April-June 2019—Volume 134, p. 407
https://doi.org/10.5248/134.407
Regional annotated mycobiota new to the Mycotaxon website
ABSTRACT—In May, Mycotaxon added the following new annotated species distribution
list to our 132 previously posted free-access fungae. The 24-page “Aphyllophoroid fungi in
Teide National Park (Tenerife, Canary Islands)” by Esperanza Beltran-Tejera, Jesus Laura
Rodriguez-Arma, Miguel Jonathan Diaz Armas, and Luis Quijada may be downloaded
from our website via http://www.mycotaxon.com/mycobiota/index.html
EUROPE
Portugal & Spain (Iberian Peninsula)
ESPERANZA BELTRAN-TEJERA, JESUS LAURA RODRIGUEZ-ARMA, MIGUEL
JONATHAN Diaz Armas, Luis QuyapA. Aphyllophoroid fungi in Teide
National Park (Tenerife, Canary Islands). 24 p.
ABSsTRACT—Data on aphyllophoroid fungi in Teide National Park Tenerife are
summarized, and 102 species are recorded. Twenty eight species are new to Tenerife,
out of which 17 are also new records for the Canary Islands (Athelia pyriformis,
Cartilosoma ramentaceum, Ceriporia excelsa, Dendrocorticium lilacinoroseum,
Hyphoderma sibiricum, Hyphodermella rosae, Hyphodontiella multiseptata,
Melzericium bourdotii, Phanerochaete avellanea, Phanerochaete cremeo-ochracea,
Phlebia griseoflavescens, Phlebia lacteola, Phlebia lilascens, Phlebia_tuberculata,
Sistotrema pistilliferum, Skeletocutis amorpha, and Tubulicrinis angustus). The list
is supplemented with 7 species of Peniophora recorded for this area, published
previously (Diaz Armas et al. 2019).
Mycobiota of the two highest mountain areas of the Canary Islands (Teide
National Park in Tenerife and Taburiente National Park in La Palma) are compared
regarding their richness of genera, species, abundance and substrates. Aphyllophoroid
fungi were found on 16 endemic vascular species, the majority were on Spartocytisus
supranubius, which is dominant in both abundance and distribution in the study area.
MYCOTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. © 2019
April-June 2019—Volume 134, pp. 409-412
https://doi.org/10.5248/134.409
BOOK REVIEWS AND NOTICES:
ELSE C. VELLINGA
861 Keeler Avenue, Berkeley CA 94708 USA
ABSTRACT—Books reviewed include Syllabus of Plant Families—A. Engler’s
Syllabus der Pflanzenfamilien. 1/3 Basidiomycota and Entorrhizomycota by Begerow,
McTaggart, and Agerer (W. Lang ed.) and Fungi lepiotoidei (Agaricaceae) edited by
Zhu-Liang Yang (2019).
GENERAL
Syllabus of Plant Families—A. Engler’s Syllabus der Pflanzenfamilien. 1/3
Basidiomycota and Entorrhizomycota. 13" ed. By Wolfgang Frey (ed.)
2018. Borntraeger Science Publishers, Johannesstr. 3A, 70176, Stuttgart, Germany.
xiit+471p. 43 figs. ISBN 978-3-443-01098-0. Price (excl. postage): € 139. www.
borntraeger-cramer.com/9783443010980
Two years after the volume on Ascomycota (Jaklitsch & al. 2016), the
current work was published, giving an overview of the Basidiomycota and
the Entorrhizomycota.
Only three authors wrote the text: Dominik Begerow and Alistair
McTaggart took care of the Pucciniomycotina, Ustilagomycotina, and
Entorrhizomycota, whereas Reinhard Agerer is the author for the
Agaricomycotina.
This is a systematic overview, incorporating the newest insights and
giving standardized descriptions for all genera in these groups. As such it
replaces long out-of-date works such as Singer’s 1986 monumental “The
* Book reviews or books for consideration for coverage in this column should be sent to the
EDITOR-IN-CHIEF <[email protected]> 6720 NW Skyline, Portland OR 97229 USA.
A410 ... MycoTaxon 134
. . b>]
Wottgang Frey cate) “84ricales in modern taxonomy,’ although
the present work lacks keys and infrageneric
Syl labus a "* classifications and is much wider in scope.
of Plant Families
J, Feeder’ Syleinac der Plenzenieniien I am impressed with the morphological
descriptions provided, which present a
1/3 Basidiomycota and Entorrhizomycota wealth of knowledge.
an? i ;
Ms have not been used in decades, but this does
It is always a bit of a balancing act which
genera to include, as modern data are not
available for all genera. There are names that
not mean that they do not represent good
solid genera. In some genera, most species—
but not all—have been transferred to a
more fitting genus, such as is the case for Torrendia. But as one Australian
Torrendia species has not yet been combined in Amanita, the genus is still
treated here separately.
Unfortunately, there are quite a number of strange mistakes, such
as the statement that Saproamanita species are ectomycorrhizal. This
genus was explicitly erected to accommodate the non-ectomycorrhizal
species in Amanita, as is also reflected in the genus name (Redhead &
al. 2016). Another example is Notholepiota, which here is still included
in the Agaricaceae, although it was shown to be based on a secotioid
bolete species, now called Boletus semigastroideus (Nuhn & al. 2013).
Some genera, such as Bonomyces and Cruentomycena are not included, for
unknown reasons.
Therearealso differences between the treatments of the Pucciniomycotina
and Ustilagomycotina on the one hand, and the Agaricomycotina on the
other. For instance, in Agaricomycotina the type species of a genus is only
given for monotypic genera but is always cited for genera in the other two
subphyla. Discussion on genus borders etc. are also given for the genera in
the first two subphyla, and absent in the Agaricomycotina.
Of course, the description of new families and genera did not grind
to a halt when this work was sent to the publisher. Mythicomycetaceae
(Vizzini et al. 2019) and Sarcoporiaceae (Audet 2018) have recently been
distinguished at the family level, and Zhulangiomyces (Redhead 2019)
and Clitopaxillus (Alvarado & al. 2018) are just two examples of recently
published genera in the Agaricales.
Book Reviews ... 411
This overview is an especially useful and thorough piece of work that
hopefully will be the standard for years to come. As such the SYLLABUS 1/3
deserves a place on many mycologists’ bookshelves.
Alvarado P, Moreau P-A, Dima B, Vizzini A, Consiglio G, Moreno G, Setti L, Kekki T,
Huhtinen S., Liimatainen K, Niskanen T. 2018. Pseudoclitocybaceae fam. nov.
(Agaricales, Tricholomatineae), a new arrangement at family, genus and species level.
Fungal Diversity 90: 109-133. https://doi.org/10.1007/s13225-018-0400-1
Audet S, 2018. Sarcoporiaceae. Mushrooms nomenclatural novelties no. 18: 1-6.
Jaklitsch W, Baral H.-O, Licking R, Lumbsch HT, Frey W (eds). 2016. Syllabus of Plant
Families. A. Engler’s Syllabus der Pflanzenfamilien Part 1/2: Ascomycota.
Nuhn ME, Binder M, Taylor AFS, Halling RE, Hibbett DS, 2013. Phylogenetic overview
of the Boletineae. Fungal Biology 117: 479-511. https://doi-org/10.1016/j.funbio
Redhead SA, 2019. Nomenclatural novelties. Index Fungorum 385: 1.
Redhead SA, Vizzini A, Drehmel DC, Contu M. 2016. Saproamanita,a new name for both
Lepidella E.-J. Gilbert and Aspidella E.-J. Gilbert (Amaniteae, Amanitaceae). IMA
Fungus 7: 119-129. https://doi.org/10.5598/imafungus.2016.07.01.07
Singer, R. The Agaricales in modern taxonomy. Ed. 4. Koeltz Scientific Books, Koenigstein,
Federal Republic of Germany, 908 p., 88 pl.
Vizzini A., Consiglio G., Marchetti M., 2019. Mythicomycetaceae fam. nov. (Agaricineae,
Agaricales) for accommodating the genera Mythicomyces and Stagnicola, and
Simocybe parvispora reconsidered. FUSE 3: 41-56. https://doi.org/10.3114/
fuse.2019.03.05
BASIDIOMYCETES
Fungi lepiotoidei (Agaricaceae). By Zhu-Liang Yang (ed.). 2019. Flora
FUNGORUM SINICORUM VOL. 52. http://www.sciencep.com Science Press,
Beijing, China. 228 p. 2 colour plates, 112 black & white figures, Hardcover.
ISBN 978-7-03-060680-8. Price (excl. postage): 198.00 ¥; cited at $76 by
www.chinascientificbooks.com
This 52nd volume in the series that aims
at providing keys and descriptions of all
fungi in China focuses on the lepiotoid
fungi, to be more precise, all agaricoid
genera in the Agaricaceae except Agaricus
and Micropsalliota, a total of 14 genera.
Most of these are white-spored, but some
species in Chlorophyllum and the genera
Heinemannomyces, Hymenagaricus, and
Melanophyllum have coloured basidiospores.
412 ... MycoTAXON 134
An introduction to the group gives an overview of the recent literature,
classification and phylogeny of the group (which represents only part of a
monophyletic clade), and the morphology.
After the key to the genera, the genera are treated in alphabetical order,
with keys to species, descriptions, and high-quality line drawings of all
species that have been confirmed for the country. All collections on which
the descriptions are based are listed. Those species listed in earlier works
whose presence is questionable are briefly discussed. For 15 species, colour
photos are provided. An extensive list of references and an index complete
the work.
This book is the result of 15 years of work by Prof. Zhu-Liang Yang and
his students (now professors themselves) Zai- Wei Ge and Jun-Feng Liang.
Lepiota has the highest number of taxa (48)—it interesting is to see
how some species have a distribution area spanning from western Europe
throughout the Northern Hemisphere into China, whereas others,
especially those from southern, tropical China, have a much more limited
distribution. Thanks to DNA comparisons of collections from Europe,
North America and China, real distribution patterns emerge. In the past,
when neither these techniques nor literature were available, names were
adopted indiscriminately from other regions.
Some species listed under Lepiota (L. shixingensis and L. furfuraceipes)
belong to Leucoagaricus. Hymenagaricus taiwanensis is now considered in
the genus Xanthagaricus.
The last word on the Chinese lepiotoids has not been said yet—I am
convinced that there are more species in Leucoagaricus than presented
here, but that does not diminish the value of the present work, a value that
extends far beyond China. The only drawback, of course, is the language,
as the book is written in Chinese, but fortunately the names are presented
in Latin.