MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
VOLUME 136 (1) JANUARY-MARCH 2021
Helicoma barretoi sp. nov.
(Barreto, Carmo, Gusmao— PLartE. 1, p. 81)
ISSN (PRINT) 0093-4666 https://doi.org/10.5248/136-1 ISSN (ONLINE) 2154-8889
MYXNAE 136(1): 1-262 (2021)
EDITORIAL ADVISORY BOARD
ELSE C. VELLINGA (2019-2022), Chair
Berkeley, California, U.S.A.
KAREN HANSEN (2014-2021), Past Chair
Stockholm, Sweden
XINLI WEI (2019-2023)
Beijing, China
Topp W. OsMUNDSON (2019-2024)
La Crosse, Wisconsin, U.S.A.
ELAINE MALosso (2019-2025)
Recife, Brazil
ALFREDO JUSTO (2021-2026)
Saint John, New Brunswick, Canada
ISSN 0093-4666 (PRINT)
ISSN 2154-8889 (ONLINE)
MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
JANUARY-MARCH 2021
VOLUME 136 (1)
http://dx.doi.org/10.5248/136-1
EDITOR-IN-CHIEF
LORELEI L. NORVELL
[email protected]
Pacific Northwest Mycology Service
6720 NW Skyline Boulevard
Portland, Oregon 97229-1309 USA
NOMENCLATURE EDITOR
SHAUN R. PENNYCOOK
[email protected]
Manaaki Whenua Landcare Research
Auckland, New Zealand
MycoTAxon, LTD. © 2021
www.mycotaxon.com &
www.ingentaconnect.com/content/mtax/mt
P.O. BOX 264, ITHACA, NY 14581-0264, USA
Iv ... MYCOTAXON 136(1)
MYCOTAXON
VOLUME ONE HUNDRED THIRTY-SIX (1) — TABLE OF CONTENTS
Nomenclatural novelties & typifications .......... 0c eee eee eee vii
TREVA CWE Doin iy Megha hy Steet lets saa eas la tie eects r Pe My ighg ha See eile gh ee ix
ZOZL SUBMISSION PIOCOAUTE <5 Bresso lege oid rps ee Base x
PROUAHIOCR COT Sets! reno omy Fe BREE eae id -apes AEE ae a, xi
In remembrance: NANCY SMITH WEBER........+--+00 eee eee eeeee xi
HISTORY
Four master teachers who fostered American
turn-of-the-(20'™)-century mycology and plant pathology
RONALD H. PETERSEN
NEW TAXA
Craterellus atrobrunneolus sp. nov. from southwestern China
TING Cao, JIa-Ru1 Yu, YA-PING Hu, HA1-SHENG YUAN
Camposporium chinense sp. nov. from Jiangxi, China
ZHAO-HUAN XU, WEN-XIU SUN, XU-GEN SHI, XIU-GUO ZHANG,
JI-WEN XIA, RAFAEL F. CASTANEDA-RUIZ, JIAN Ma
Helicoma barretoi sp. nov. from the Brazilian Atlantic rainforest
GABRIEL GINANE BARRETO, LUANA TEIXEIRA DO CARMO,
Luis FERNANDO PASCHOLATI GUSMAO
Teratospermopsis gen. nov. for Chaetendophragmia protuberata,
with a taxonomic review of Teratosperma ZHAO-HuAN Xu, LING QIUu,
XIU-GUO ZHANG, RAFAEL F. CASTANEDA-RUiZ, JI-WEN XIA, JIAN MA
Smardaea isoldae sp. nov. from a tropical cloud forest of Mexico
TANIA RAYMUNDO & RICARDO VALENZUELA
Scytinopogon caulocystidiatus and S. foetidus spp. nov.,
and five other species from Brazil A.N.M. FurTADO,
P.P. DANIELS, M.A. Reck, M.A. NEVES
Brykendrickia catenata gen. & sp. nov. from India
RAJNISH KUMAR VERMA, I.B. PRASHER, SUSHMA,
KUNHIRAMAN C. RAJESHKUMAR, AJAY KUMAR GAUTAM,
RAFAEL F. CASTANEDA-RUIZ
59
73
79
85
97
107
131
JANUARY-MARCH 2021... V
Distobactrodesmium gen. nov. to accommodate
Bactrodesmium rahmii and notes on Bactrodesmium
ZHENEFU NIv, KAI ZHANG, DE-WE! LI,
JIAN Ma, RAFAEL FE. CASTANEDA-Ruiz 141
Physalidiella pentagona sp. nov. from Guizhou, China
ZHONG-JIU XIAO, XIAO-XIA LI, Tine Liv,
Mo-FANG CHEN, SHUANG-SHUANG WANG, YA-PING Kone 159
Blastophragmia plurisetulosa gen. & sp. nov. from China
Jian Ma, Li-Guo Ma, Ru-QIANG Cul, WEI-GANG KUANG,
X1u-Guo ZHANG, RAFAEL F. CASTANEDA-Ruiz 163
Endophragmiella spp. nov. and new records from southern China
Jian Ma, Li-Guo Ma, ZHAO-HUAN Xu, RuU-QIANG Cul, LING QIU,
RAFAEL F, CaSTANEDA-Rufiz, X1u-Guo ZHANG 169
Morphological and phylogenetic resolution of Arthrinium
from medicinal plants in Yunnan, including A. cordylines
and A. pseudomarii spp. nov.
TONG-ZHENG CHEN, YAN ZHANG,
X1A0-BING MING, QIAN ZHANG, Hu! LONG,
KEVIN D. Hype, YAN L1, YONG WANG 183
NEW SYNONYMIES
Variability and distribution of Pluteus luteus,
a later synonym of P. variabilicolor Hana SevéixovA & BALINT Dma 201
NEW RANGES/HOSTS
Dichotomophthora portulacae, a new record from Iraq
ZAINAB KHALAF ABDULLA 215
Myxomycetes in the Pantanal biome: first records
and a new associate, Attalea phalerata
IZABEL CRISTINA MoREIRA, LUCAS LEONARDO-SILVA,
ANTONIO SERGIO FERREIRA-SA, SOLANGE XAVIER-SANTOS 219
Spathularia nigripes and Trichoglossum walteri
newly recorded from Turkey YASIN Uzun 229
Clitocybula azurea in Argentina: redescription
and phylogenetic position NicotAs NIvEIRo,
MELISA ALBERTI, NATALIA A. RAM{REZ, EDGARDO O. ALBERTO 235
Gerronema nemorale: first report of the
genus and species from Pakistan
FauziA AQDUS & ABDUL NASIR KHALID 249
VI ... MYCOTAXON 136(1)
Mycosiota (FUNGA) NEW TO THE MYCOTAXON WEBSITE
Lichenized Ascomycota on Piptadenia moniliformis
and Solanum mauritianum in the
Raso da Catarina Ecoregion, Caatinga, Brazil
(SUMMARY)
REBECA LEITE BARBOSA & NADJA SANTOS VITORIA 261
PUBLICATION DATE FOR VOLUME ONE HUNDRED THIRTY-FIVE (4)
MYCOTAXON for OCTOBER—-DECEMBER 2020 (I-xIv + 719-902)
was issued on December 30, 2020
JANUARY-MARCH 2021...
NOMENCLATURAL NOVELTIES AND TYPIFICATIONS
PROPOSED IN MYCOTAXON 136(1)
Arthrinium cordylines T.Z Chen, Yong Wang bis & K.D. Hyde
[MB 834522], p. 189
Arthrinium pseudomarii T.Z Chen, Yong Wang bis & K.D. Hyde
[MB 834523], p. 191
Blastophragmia Jian Ma, L.G. Ma, X.G. Zhang & R.F. Castaneda
[IF 557506], p. 164
Blastophragmia plurisetulosa Jian Ma, L.G. Ma, X.G. Zhang & R.F. Castaneda
[IF 557507], p. 164
Brykendrickia Rajn.K. Verma, Prasher, Rajeshk., Sushma, A.K. Gautam &
R.E Castaneda
[MB 835296], p. 132
Brykendrickia catenata Rajn.K. Verma, Prasher, Rajeshk., Sushma,
A.K. Gautam & R.F. Castaneda
[MB 835297], p. 135
Camposporium chinense Z.H. Xu, Jian Ma, X.G. Zhang & R.E Castaneda
[IF 557232], p. 74
Craterellus atrobrunneolus T. Cao & H.S. Yuan
[MB 833932], p. 64
Distobactrodesmium Z.F. Niu, K. Zhang & R.E. Castaneda
[IF 557439], p. 142
Distobactrodesmium rahmii (M.B. Ellis) Z.E. Niu, K. Zhang & R.F. Castafieda
[IF 557440], p. 151
Endophragmiella chinensis L. Qiu, Jian Ma, R.F. Castafeda & X.G. Zhang
[IF 557448], p. 170
Endophragmiella guangdongensis L. Qiu, Jian Ma, R.F. Castafeda &
X.G. Zhang
[IF 557449], p. 172
Endophragmiella lushanensis L. Qiu, Jian Ma, R.F. Castafieda & X.G. Zhang
[IF 557450], p. 174
Endophragmiella macrospora (W.P. Wu) Jian Ma, X.G. Zhang & R.F.
Castaneda
[IF 557317], p. 92
Endophragmiella obovoidea L. Qiu, Jian Ma, R.F. Castafieda & X.G. Zhang
[IF 557451], p. 175
Helicoma barretoi G.G. Barreto, L.T. Carmo & Gusmao
[MB 834819], p. 80
Physalidiella pentagona Z.J. Xiao & Xiao X. Li
[FN 570000], p. 160
VII
vill ... MYCOTAXON 136(1)
Scytinopogon caulocystidiatus A.N.M. Furtado & M.A. Neves
[MB 829606], p. 113
Scytinopogon foetidus A.N.M. Furtado & M.A. Neves
[MB 829605], p. 119
Smardaea isoldae Raymundo & R. Valenz.
[MB 830585], p. 98
Teratospermopsis Jian Ma, X.G. Zhang & R.E. Castafieda
[IF 557315], p. 88
Teratospermopsis protuberata (R.F. Castaneda) Jian Ma, X.G. Zhang &
R.E Castaneda
[IF 557316], p. 88
JANUARY-MARCH 2021...
REVIEWERS — VOLUME ONE HUNDRED THIRTY-SIX (1)
The Editors express their appreciation to the following individuals who have,
prior to acceptance for publication, reviewed one or more of the papers
prepared for this issue.
Vladimir Antonin
Flavia Rodrigues Barbosa
Jayarama Bhat
Marcela Eugenia da Silva Caceres
Rafael F. Castaneda Ruiz
Arun Kumar Dutta
Martin Esqueda
Patricia Oliveira Fiuza
Gabriela Heredia Abarca
Sana Jabeen
Ali Keles
Bernardo E. Lechner
De-Wei Li
Jun-Feng Liang
Jian Ma
Li-Guo Ma
Ekaterina F. Malysheva
Eric Mckenzie
Josiane Santana Monteiro
Ricardo E. Morales
Lorelei L. Norvell
Ibai Olariaga
Shaun R. Pennycook
Donald H. Pfister
Huzefa A. Raja
Scott Redhead
Carlos Rojas Alvarado
Amy Rossman
Adailson Feitoza de Jesus Santos
Danilo Mamede da Silva Santos
Ibrahim Tiirkekul
Nicolas Van Vooren
Else Vellinga
Nalin Wijayawardene
Xiao-Dan Yu
IX
x ... MYCOTAXON 136(1)
2021 MyCOTAXON SUBMISSION PROCEDURE
Prospective MycotTaxon authors should download the MycotTaxon 2021 guide,
review & submission forms, and MycoTaxon sample manuscript by clicking the ‘file
download page’ link on our INSTRUCTIONS TO AUTHORS page before preparing their
manuscript. This page briefly summarizes our “4-step’ submission process.
1—PEER REVIEW: Authors first contact peer reviewers (two for journal papers;
three for mycobiota/fungae) before sending them formatted text & illustration
files and the appropriate 2021 MycoTaxon journal or mycota reviewer comment
form. Experts return revisions & comments to BoTH the Editor-in-Chief
<[email protected]> and authors. ALL co-authors must correct and proof-
read their files before submitting them to the Nomenclature Editor.
2—NOMENCLATURAL REVIEW: Authors email all ERROR-FREE text & illustration
files to the Nomenclature Editor <[email protected]>.
Place first author surname + genus + ‘Mycotaxon’ on the subject line, and
(required) attach a completed sUBMISSION FORM. The Nomenclature Editor will
(i) immediately assign the accession number and (ii) after a few weeks return his
notes and suggested revisions to the author(s) and Editor-in-Chief.
3—FINAL SUBMISSION: All coauthors thoroughly revise and proof-read files
to prepare error-free text and images ready for immediate publication. Poorly
formatted copy willbe rejected or returned for revision. E-mail the final manuscript
to the Editor-in-Chief <[email protected]>, adding the accession number to
the message and all files, which include a (i) revised 2021 submission form, all (ii)
text files and (iii) jpg images, and (iv) FN, IF, or MB identifier verifications for each
new name or typification. The Editor-in-Chief acknowledges submissions within
two weeks of final submission but requests authors to wait at least 14 days before
sending a follow-up query (without attachments).
4—FINAL EDITORIAL REVIEW & PUBLICATION: The Editor-in-Chief conducts a
final grammatical and scientific review and returns her editorial revisions to all
expert reviewers and coauthors for final author approval. Author-approved files
are placed in the publication queue.
The PDF proof and bibliographic & nomenclatural index entries are sent to all
coauthors for final inspection. After PDF processing, the Editor-in-Chief corrects
ONLY PDF editorial/conversion and index entry errors; corrections of all other
errors are listed in the ERRATA of a subsequent issue for no charge. Authors will pay
fees for mycobiota uploads, optional open access, and correction of major author
errors to the Business Manager <[email protected]> at this time.
MyYcOTAXON LTD— www.mycotaxon.com
The Mycotaxon Webmaster <[email protected]> posts announcements,
subscription & publication information, and author forms & templates on the official
MycoTAXxon site. Our server also hosts the mycobiota web-page for free download
of Fungae (regional annotated species lists).
MYCOTAXON ONLINE— www.ingentaconnect.com/content/mtax/mt
The MycoTaxon journal publishes four quarterly issues per year. Both open access
and subscription articles are offered.
JANUARY-MARCH 2021... XI
FROM THE EDITOR-IN-CHIEF
MYCOTAXON 136(1) contains 21 contributions by 80 authors (representing 15 countries)
as revised by 35 expert reviewers and the editors.
Beginning with the 2021 January-March Mycotaxon, articles will henceforth be
grouped according to section. This issue starts off with History and Ron Petersen's
fascinating exposition on the introduction of the “new botany” to 19" century USS.
pedagogy and the influence of Professors Prentiss, Dudley, Thomas, and Whetzel
upon the development of North American mycology and plant pathology.
The 11 titles under NEw Taxa propose 4 new genera (Blastophragmia,
Distobactrodesmium, Teratospermopsis from CuHINA and Brykendrickia from
InpIA) and 16 species new to science representing Arthrinium, Blastophragmia,
Camposporium, Craterellus, Endophragmiella, and Physalidiella from CHINA;
Brykendrickia from INv1A; Helicoma and Scytinopogon from BRaziL; and Smardaea
from Mexico. Three new combinations are proposed in Distobactrodesmium,
Endophragmiella, and Teratospermopsis. NEW SYNONYMIES presents one paper that
convincingly establishes Pluteus luteus as a synonym of P. variabilicolor.
NEW RANGES AND/OR NEW HOSTS reports range extensions for species
representing [hyphomycetes] Dichotomophthora for IRAQ and Endophragmiella for
CurnA; [ascomycetes] Spathularia and Trichoglossum for TuRKEy; [basidiomycetes]
Clitocybula for ARGENTINA and Gerronema for PAKISTAN; and [myxomycetes]
Arcyria, Perichaena, and Physarum (all also associated with a new substrate, acuri
palm—Attalea phalerata) for BRaziL’s Pantanal region.
Our issue concludes with the announcement of one new annotated species list
on our MYCOBIOTA website, which covers lichenized ascomycetes occurring on
Piptadenia moniliformis and Solanum mauritianum in Brazil's Caatinga.
MycoTaxon 136(1) also provides keys to species in Camposporium, Teratosperma,
Smardaea, Scytinopogon, Physalidiella, and Blastophragmia. Papers providing
conclusions supported by sequence analyses include five new species representing
Arthrinium, Craterellus and Scytinopogon; one synonymy, and two range extensions,
MYCOTAXON 135(4) PUBLISHED IN 2020 AFTER ALL! Your Editor-in-Chief is delighted
to announce that MycoTAXON TREASURER, WEBMASTER, & OWNER FACTOTUM (Noni
Korf) pulled a real rabbit out of the hat by hurtling the 2020 October-December issue
(which she received the afternoon of December 29) through the publication maze so
that Mycotaxon 135(4) was published in hard copy on December 30. Readers may
not be aware that year-end issues present problems when released after December 31,
because names published in a year not corresponding to the date on the cover must
be cited with a double date in nomenclatural databases. It has been nine years since
we escaped the double-date stigma, so we are especially pleased that 23 papers and 33
names are now dated “2020” and NOT “2021 (“2020”)” as is usually the case.
xi ... MYCOTAXON 136(1)
Once notified that an issue is formally released (usually first in hard copy), we
immediately upload this open-access cover section onto ResearchGate to announce
publication. Subscribers and authors are invited to track journal progress by checking
www.researchgate.net/project/The-Mycotaxon-Awareness-Project We now close
issues fifteen days before the end of the quarter to grant your hapless Editor-in-Chief
time to finish her scientific reviews before converting your manuscripts to gold.
THE MyCOTAXON EDITORIAL ADVISORY BOARD WELCOMES ALFREDO JUSTO—We
announce with great pleasure the election of our new board member, Dr. Alfredo
Justo, Curator of Botany and Mycology at the New Brunswick Museum (Musée
du Nouveau-Brunswick), Canada. Dr. Justo, who is interested in the study of
mycological biodiversity, including fungal systematics, phylogenetics, phylogenomics,
biogeography, and conservation, also serves as an Associate Editor for MycoLoGIa.
We thank profusely and bid farewell reluctantly to Brandon Matheny, who leaves
the EAB after his extended seven-year term. “Fredo” joins Chair Else Vellinga, Past
Chair Karen Hansen, and members Xinli Wei, Todd Osmundson, and Elaine Malosso
on the Board.
Warm regards,
Lorelei Norvell (Editor-in-Chief)
31 March 2021
ce
oe
oS
o
WH &
oi
sl
3}
=m
3
5
i
q
nN
3
JANUARY-MARCH 2021... XIII
IN REMEMBRANCE: NANCY SMITH WEBER (1943-2020)
Only a few are granted the luxury of being able to live—and work—their passion.
Nancy Jane Smith was one such lucky person. It is, however, not surprising that the six-
week-old baby girl who went on her first field expedition in the arms of her mother and
who would later hang (in her mother’s words) a “lovely bright red hand-knitted boot
sock on her fireplace at Christmas time” (the “sole” survivor of a goodly supply knit
expressly for her field-tramping father by a family friend) would evolve into Dr. Nancy
Smith Weber, respected ascomycete expert adored for her work on Morchella. Nancy
may have experienced the downside of field mycology at an early age—the endless
succession of field seasons spent in wet, damp tents or drafty cabins with no bathtubs
and kitchen tables covered with collections—but she also knew the joy that comes from
finding an elusive mushroom in lush green forests while mastering a difficult science.
NANCy SMITH WEBER was born 12 March 1943 in Ann Arbor, Michigan, to North
America’s then foremost agaricologist, Dr. Alexander Hanchett Smith, and paleobotanist
Dr. Helen Vandervort Smith. These two biological ‘forces-of-nature’ instilled a love of
field and forest in their precocious child, who later shared her zest for fungi with all she
met, including ranks of graduate students who knew less about mushrooms than she
did. The three Smiths were close, and summers usually found Nancy with her parents on
their western collecting expeditions or (in alternate years) at “Bug Camp” in Michigan.
After high school in Ann Arbor, Nancy attended Ohio Wesleyan University but after
three years transferred to the University of Michigan, where she earned her AB (1965),
MA (1967), and PhD (1971) degrees in Botany. In 1970, she married fellow student James
A. Weber, and she and Jim lived in Ann Arbor where they co-edited THE MicHIGAN
BOTANIST, Jim worked at the UM Biological Station, and Nancy conducted research at
the University of Michigan Fungus Herbarium, also actively involved with the Matthaei
Botanical Gardens (today the home of the Helen V. Smith Woodland Wildflower Garden
ihe honoring Nancy’s mother).
. In 1989 Nancy, Jim, and the
now-widowed Helen moved
to Corvallis, Oregon, to Jim's
new position with the US
Environmental Protection
Agency Lab and Nancy's
| appointment as Assistant
Professor/Researcher at the
Oregon State University
Department of Forest
ewe Science. During 1995-2004
m@ she was also contracted as
m= ascomycete identifier for the
Northwest Forest Plan and
ranked rare and unusual
Linnea Gillman, courtesy of Mike Beug
y
J
XIV ... MYCOTAXON 136(1)
fungi for the Oregon Natural Heritage Information Center—encountering in the process
the frustrations inherent in ‘government work’ After Jim's unexpected death in 1998,
Nancy began a fungal survey of her now-famous backyard, expanding her knowledge of
kingdom Fungi and reaffirming her belief that fungal “rarity” is probably more related
to the scarcity of mycologists than to the real presence of species in a landscape. Nancy,
who became well known as “the Mushroom Lady of Corvallis,’ died of complications
from Parkinson's disease on December 19, 2020.
Dr. Weber published over 40 scientific papers and wrote or coauthored five highly
popular field guides—How To KNow THE GILLED MusHrooms (Smith, Smith &
Weber 1979), the revised THE MUSHROOM HUNTER’S FIELD GUIDE (Smith & Weber
1980), How To KNow THE NON-GILLED MusHROOMS (Smith, Smith & Weber 1981), A
FIELD GUIDE TO SOUTHERN MusHROOMS (Weber & A.H. Smith 1985), and A MoreL
HUNTER’S COMPANION (Weber 1988). She was also major force in the successful
publication of Hesler & Smiths NorTH AMERICAN SPECIES OF LACTARIUS, and
expended considerable effort in developing PEzwes (with its preliminary checklist of
the Pezizales of western North America), only to be disappointed when the website lost
its government platform sometime after 2001.
Perhaps Nancy’s greatest contribution was her active participation in mycological
and botanical societies. A life member of the Mycological Society of America (MSA)
and North American Mycological Association (NAMA), she was in 2007 awarded the
prestigious NAMA Award for Contributions to Amateur Mycology for her more than
30 years of devoted service to amateur mycology. Dr. Weber was a member of numerous
other scientific societies, where she delivered over 95 lectures. Five species have been
named in her honor: Boletus nancyae, Brauniellula nancyae, Galerina nancyae, Lactarius
nancyae, and Russula nancyweberae.
I don’t remember the exact year when I first met Nancy at a NAMA meeting in the
80's, but we encountered each other frequently after she moved to Oregon. We became
friends in 1995 as we ‘herbarium’ hopped together from Oregon to San Francisco
(SFSU) and Ann Arbor (MICH) where we prowled the fungaria for collections of the
Lert: Father & Daughter at the 1983 NAMA Foray, Granby Colorado
RiGut: The morel expert, truffling at the 1992 Oregon Mycological Foray
JANUARY-MARCH 2021... XV
Courtesy of Andy Wilson
= we
t \ we
Michael Beug
Es
Lert: Herald Treibs, Gene Butler, Nancy, Buck McAdoo at PNW Key Council, 1989 (UW Seattle)
RiGuT: Vera Evenson & Nancy puzzle over a Hebeloma at the Denver Botanic Garden, 1995
!
Northwest Forest Plan’s species of concern. Definitely in her element in Ann Arbor.
she made certain to introduce “Joe Ammirati’s student” to one and all while we were
there. Having joined the Oregon Mycological Society, she became part of the group I
alternatively called the OMycoBelles (OMSers) or the LOLs—Little Old Ladies, all born
between 1943 (Nancy, I, Judy Roger) and 1933 (Janet Lindgren in 1934, Maggie Roger in
1933)—who met for the first time in 2003 under that appellation in Yamhill to celebrate
my 60th. A gracious hostess whenever we stayed in Corvallis for meetings, she was
also brilliant, hardworking, and an amusing lecturer who treated tedium with sardonic
wit. After a particular difficult 2% sleepless weeks when we attempted to rank rarity for
70 species in the absence of data for a bureau that nonetheless insisted we format our
references in a particular form known only to it, a frustrated Nancy dispatched an Email
to the powers that be, noting “Here is the way I usually do articles: Do, R.E., Me, F A.
2002. Macrofungi and lichens of Portland’s parking lots. Journal of ridiculous research.
5: 16-23” thereby inheriting a new title. We all most definitely miss our terrific Editor of
the Journal of Ridiculous Research. —Lorelei Norvell
Courtesy of Lorelei Norvell
LOLs at the Joel Palmer House, 10 September 2003
(Janet Lindgren, Lorelei Norvell, Maggie Rogers, Nancy Weber, Judy Roger)
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 1-58
https://doi.org/10.5248/136.1
Four master teachers who fostered
American turn-of-the-(20™)-century
mycology and plant pathology
RONALD H. PETERSEN
Department of Ecology & Evolutionary Biology, University of Tennessee
Knoxville, TN 37919-1100
CORRESPONDENCE TO: [email protected]
ABSTRACT—The Morrill Act of 1862 afforded the US states the opportunity to found state
colleges with agriculture as part of their mission—the so-called “land-grant colleges.”
The Hatch Act of 1887 gave the same opportunity for agricultural experiment stations as
functions of the land-grant colleges, and the “third Morrill Act” (the Smith-Lever Act) of
1914 added an extension dimension to the experiment stations. Overall, the end of the 19"
century and the first quarter of the 20" was a time for growing appreciation for, and growth of
institutional education in the natural sciences, especially botany and its specialties, mycology,
and phytopathology. This paper outlines a particular genealogy of mycologists and plant
pathologists representative of this era. Professor Albert Nelson Prentiss, first of Michigan
State then of Cornell, Professor William Russel Dudley of Cornell and Stanford, Professor
Mason Blanchard Thomas of Wabash College, and Professor Herbert Hice Whetzel of
Cornell Plant Pathology were major players in the scenario. The supporting cast, the students
selected, trained, and guided by these men, was legion, a few of whom are briefly traced here.
Key worps—“New Botany,’ European influence, agrarian roots
Chapter 1. Introduction
When Dr. Lexemual R. Hesler died in 1979, he left a manuscript entitled
“Biographical sketches of deceased North American mycologists, including a
few European mycologists” (Hesler 1975). These 147 “thumb-nail” biographies,
ranging from a half-page to five pages, included almost no plant pathologists,
even though Hesler was one for the first half of his career. Moreover, Hesler was
2 ... Petersen
a proud product of Wabash College (class of 1911) and extolled the role of Prof.
Mason Thomas in his life. Second, I spent a single pivotal semester (Fall 1956)
in the Cornell Plant Pathology Department and retained some appreciation
of scientists associated with that department. Third, Hesler had alluded to
intradepartmental strife at Cornell which led to his migration to the University
of Tennessee. Later, I came upon the paper by G.C. Kent (1979), long-time head
of the Cornell Plant Pathology Department, who summarized Prof. Thomas's
role in guiding selected Wabash students into graduate education leading
to successful careers. Finally, the paper by R.P. Korf (1991), a Cornellian as
undergraduate, Ph.D. student, and career faculty member, referred both to Prof.
Thomas and to the Cornell disturbance. As added background, the influence of
post-Civil War but pre-World War I events on the maturation of mycology in
North America has already been published (Petersen 2019).
In addition to the Hesler heritage, some historical topics should be
considered. First, the summer of 1862 was a season of government turmoil. As
the Civil War spread and raged, the congressmen representing the States of the
Confederacy walked out of the federal congress, ceding control to the Union
states. In the midst of a war, the federal government was not only short on
cash, but through expansion and the Louisiana Purchase, found itself owner of
almost limitless land west of the Mississippi River. Respectful of its critical role
in the War effort, the government was moved to expand its role in agriculture.
It was also calculated that if land grant legislation were passed, perhaps some
hearts in the south would be persuaded that rebellion was too costly. Two
bills were put forward in 1862 to respond to these schemes as well as to some
popular agitation that had been simmering for years.
There was already a history of bounty-land warrants, especially to recognize
veterans of military service from the American Revolution forward. But in a
few days during the War Between the States, new laws were enacted. On 15
May 1862, Congress established the Department of Agriculture and five days
later, on 20 May, the Homestead Act was signed into law. It guaranteed 126
acres of federal land to any person willing to settle on and cultivate it. The law
answered a movement for free ownership of otherwise unsettled land. In brief,
this was the first “land-grant” act of the age. Within days (July 2) the Morrill
Act was signed, gifting, upon application, each state a grant of federally owned
land upon which to found a college at which agriculture was a significant part
of the educational program.
Second, by the decade (the 1880s) in which most students covered in this
narrative were born, relations were strained between the Euro-American
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 3
settlers—in their incessant western movement—and the Amerindians, whose
land, hunting territory, and economic bases were being usurped. The military
confrontations had largely subsided, but establishment of reservations and
relegation of Amerindians to new lands (and therefore modes of survival) were
well underway. Much of this escaped the headlines “back east,” but west of the
Mississippi River these interethnic adjustments were big news. As the issues
extended into the early and middle 20" century, “western territories” applied
for statehood, the Morrill Act was ratified, states filed applications, land grants
were assigned, land-grant colleges were established, and agriculture expanded
as both academic discipline and lifestyle. The Hatch Act of 1887 repeated
the process, this time mandating that agricultural experiment stations be
associated with the land-grant institutions. Concurrently, plant pathology was
increasingly recognized as a positive adjunct to the farmer. After all, at the turn
of the 20" century, 50% of all Americans made their living by farming. Finally
in 1914 just prior to World War I, the “third Morrill Act” (the Smith-Lever Act)
brought laboratory research into the hands of the farmers themselves.
Science itself was evolving during this period, and the general focus
on agriculture and the land grant movement spawned the development of
laboratory and experimental approaches in both research and teaching.
Although this narrative is directed at a particular network of teachers, their
students and the growth of mycology and plant pathology in the United States,
this tableau paralleled changes in natural science pedagogy, especially because
some of the teacher-innovators were also actors in the main plot. Several
individuals presented here studied in Europe with scientific innovators. They
brought back to the US not only techniques but also a keen ambition to place
botany and its sub-sciences at the forefront of academic studies. Central to the
education of several scientists was the “New Botany” as espoused by Charles E.
Bessey, early educator in botanical sciences, and several other professors. This
pedagogical progress has been summarized by Sundberg (2011, 2012, 2014).
The starring players in the current report are four in number: Prof. Albert
Nelson Prentiss, on faculty at the precursor of Michigan State University,
who moved to the fledgling Cornell University upon its opening in 1868;
Prof. William Russel Dudley, student at Cornell during the Prentiss years and
thereafter a faculty member with Prentiss; Prof. Mason Blanchard Thomas,
a fellow student with Dudley, but who moved to Wabash College; and Prof.
Herbert Hice Whetzel, student at Wabash and Cornell, later Head of the
Cornell Plant Pathology Department. The supporting cast, the students of these
professors, was legion, of which some have been selected here for lesser roles.
4 ... Petersen
Chapter 2. Albert Nelson Prentiss (22 May 1836-14 August 1896)
In 1835, upstate New York was decidedly rural. Somewhat south of Syracuse
and Utica, Cazenovia (in Madison County) was a hamlet at the south end of
Cazenovia Lake, easternmost of the Finger Lakes. Albert Nelson Prentiss (Fic.
1) was born on a farm there, and after the local schools attended the Oneida
Conference Seminary, a private school supported by the Methodist Church but
educationally nonsectarian and a pioneer in co-education. Among its more
famous graduates were Jesse Truesdell Peck, first president of Syracuse College
and Leland Stanford, Jr., founder and endower of the eponymic California
college.
The teachers and processes identifying Prentiss as a promising student have
been lost, but his family must have supported his enrollment at the Seminary
socially and financially, followed by his choosing the Agricultural College of
the State of Michigan to further his education. In 1858, some four years before
the Morrill Act was enacted into law and at age 23, he enrolled.
For many years before the Civil War there were murmurings aimed at
establishing colleges supported by government, either state or federal. In fact,
Justin Smith Morrill proposed his bill in the 1850s, but it failed repeatedly.
In four years, Michigan took things into its own hands and established the
Agricultural College of the State of Michigan. For young Prentiss, it was one
of only a very few from which to choose. Over the years its name would be
changed to Michigan State College of Agriculture and Mechanics, and finally,
in 1964, to Michigan State University.
The Morrill Act (finally passed in 1862) stimulated a surge in college
establishment. From 1860 to 1870, 175 new colleges were founded, and
“respectable” colleges had at least four science faculty members (Rudolph
1977). In the spirit of the classical education which still dominated college and
university curricula, book-reading, recitation, and professorial questions and
student answers were the chief means of learning.
The Civil War had begun to rage when Prentiss was awarded a B.S. in 1861.
Patriotism for the Union cause was fervent. Of the graduating class of seven, all
immediately enlisted in the army.
The timing of his enlistment was delicate. Prentiss was assigned to special
signal service in Missouri, but after a few months his unit was dismissed. A
major reorganization of the army was taking place in the wake of the dismissal of
the commanding general, George T. McClellan. McClellan had been promoted
to General-in-Chief of the Union Army, but he and Abraham Lincoln, the new
President, distrusted one another and McClellan was the loser. His term as
Four Masters—Prentiss, Dudley, Thomas & Whetzel ...
Fig. 1. Albert Nelson Prentiss. Atkinson GF 1896 Botanical Gazette 21: 283-289.
General-in-Chief, November 1861, to March 1862, coincided with Prentiss’s
enlistment. Prentiss was sent home to Cazenovia.
Possibly through contacts made at Michigan State, Prentiss spent the
academic year 1862-63 as associate principal of Kalamazoo High School,
6 ... Petersen
Michigan, not far from his alma mater. By the fall of 1863, he was listed on
the faculty of Michigan State Department of Horticulture. Concurrent with his
official duties, he earned an M.S. in 1864, and in 1865 he became Professor of
Horticulture and Botany as well as Director of Grounds.
Albert Prentiss had been raised in an agrarian lifestyle, left home, been a
college student, survived boot camp, and now, at 32, put all these to practice as
a professor—and director of grounds. His total time on faculty was to be five
years.
For some notable students of Prentiss at Michigan State University, see
APPENDIX 1. One, Charles Edwin Bessey, progressed into a pivotal career as an
innovator of botanical pedagogy.
In the early third of the nineteenth century the de facto controversy for
botany was the “Linnaean System” versus the “Natural System” The former
used a formulaic system locating and numbering flower parts to arrive at the
name assigned to the plant in question. The “Natural System” relied on more
information—habit, ecology, physiology, anatomy, etc.—in order to place
plants in “natural” groups (Sundberg 2011). The chief disciples were Amos
Eaton (Linnaean System) and Asa Gray (Natural System), but the modes of
teaching were consistent.
Compared to the reading-recitation-lecture-centric teaching of botany in
mid-19" century America, quite a different approach was developing on the
European continent, particularly in Germany. As early as 1849, the second
edition of Schleiden’s botanical textbook, which strongly emphasized cellular
and anatomical studies, was translated into English. In the early 1860s,
Hofmeister published his 4-volume work Handbuch der Physiologische Botanik,
soon considered one of two game-changers in biological thinking. The other
was Darwin's On the Origin of Species (Green 1967).
At Harvard, William Gilson Farlow was a student in botany. Upon graduation
and on the advice of Prof. Asa Gray, Farlow enrolled in the medical school and in
1872 was awarded his M.D. Again with advice from Gray, Farlow embarked for
Europe for what became a two-year absence. As well as studying with Anton de
Bary in Strasbourg and using some of his family wealth to purchase books and
herbaria, Farlow observed that European botany students were better prepared
than those in the United States for entering into hands-on learning. Part of this
was the early introduction of botany in preparatory school curricula as well as
the wide use of living plants and laboratory observation where students could
participate with the teacher in the subjects covered in lectures. In short, in the
classroom, students and teachers were partners.
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 7
In 1866, Charles Bessey (see APPENDIX 1), who entered Michigan
Agricultural University intending to become an engineer, also took courses
in botany from Prof. Prentiss. The sole botany classroom contained a large
glass cabinet housing the “Ross compound microscope.’ Bessey later related
the story of his epiphany in pedagogy. “It was never taken out for use in
class, but always stood there as a challenge to us. I do not know what anyone
else did, but at last I could stand it no longer, and getting permission from
Professor Prentiss, who gave me the key to the case, I locked myself in the
classroom, and taking out the ponderous instrument, looked it over, studied
its complex machinery, and made myself familiar with its structure and use”
(Bessey 1913). Bessey completed his B.S. degree in November 1869 and
began his first faculty position the next month at Iowa Agricultural College
in Ames. Following his Michigan experience, he started bringing simple
experiments into the lab, most centering on histological manipulation and
use of a microscope. He soon became an evangelist for a new teaching
philosophy for botany.
Meanwhile, in Ithaca, New York, conversations were taking place
concerning the possible founding of a college. Several well-placed men were
involved, of whom one was Ezra Cornell.
Two members of the state senate, Andrew Dickson White (1832-1918)
of Syracuse and Ezra Cornell (1807-74) of Ithaca, emerged from different
generations and backgrounds but shared an interest in establishing a college
in New York State. Cornell, a journeyman carpenter by trade but by this time
in late middle-age, had made a respectable fortune in the telegraph industry
and owned an estate and model farm in Ithaca. White was a son of a wealthy
banking family. Educated at Yale and part of “the famous class of 1853,” he
had travelled widely in Europe and had been a professor of English and
history at the University of Michigan (not Michigan State). Cornell’s offer to
deed his farm to a college established in Ithaca and to contribute $500,000
to the cause furnished a target location. In 1862, the Morrill Act afforded an
opportunity to see their concept come to life on behalf of New York State.
The impecunious federal government could not award monetary funds to
back the terms of the Morrill Act and allotments to the states was by scrip, a
promissory note for federally owned land. Each land grant was in proportion
to the number of representatives (and therefore, the population) of each
state. Under the canny influence of Cornell, New York chose 989,920 acres of
timberland in western Wisconsin Territory (the eastern portion had become
a state in 1848), with a value of about $2.5 million in mid-19" century funds.
8 ... Petersen
The land grant, together with the munificent Cornell monetary donation
and Cornell’s farm were enough to fund a modest college.
Cornell University was founded on 27 April 1865. After spirited debate the
university was named for its benefactor, and its first president was Andrew
Dickson White. But merely to pronounce the existence of a college did not
magically produce staff, buildings, or curriculum—much less students and
income.
Now the difficult tasks commenced. During the next three years, White
saw to the construction of the first two buildings and travelled to recruit
students and faculty. It was planned that the University should start with
26 professors split between resident and non-resident faculty. The non-
resident faculty would be famous personages in their respective fields, and
their recommendations would be influential in recruiting the resident faculty
and advertising the college. One such non-resident was Louis Agassiz, the
celebrated natural science magnate at Harvard. Between Agassiz and White,
an offer was made to Albert Prentiss of Michigan State, who was approved at
the eighth meeting of the trustees on the very day of the university’s opening,
6 October 1868. Prentiss was already in Ithaca, ready to assume the position
of Chair of Botany, Agriculture and Horticulture and Director of Buildings
and Grounds. The following day, 412 male students were enrolled, just a
few months after Andrew Johnson, President of the United States, had been
impeached.
The contrast between bucolic Ithaca and urbane New York City was stark.
New York City, for example grew from 500,000 in about 1825 to just less than
a million by 1870. Growing pains also increased. It was said that a lady in
lower Manhattan could wait a half-hour to cross the street, so crowded was the
traffic. The first elevated railway was opened on 2 July 1868, running between
the Battery and Cortlandt Street, just some two months before Cornell opened
its doors. With steam propulsion, the trains moved between five and 10 miles
per hour. The system was extended, but its pollution and noise were oppressive
and calls for some other system became politically exigent.
According to Atkinson (1896 a,b) Prentiss course in General Botany
opened with four students, but the following year enrollment was 144. For
three years, physical space was “borrowed” from chemistry. Over the years
the students in Prentiss’s classes, through his influence, became interested in
the local flora; students included David S. Jordan (later President of Leland
Stanford Jr. University in California), J.C. Branner (later Ph.D. botanist) and
William R. Dudley (later professor at Cornell and then Stanford). The first
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 9
careful flora of the region was compiled by Prentiss and published by Dudley
after Prentiss’s death.
Just as had been the case at Michigan State, the job of overseeing buildings
and grounds took inordinate time. In a memorial article years later upon
Prentiss’s death, the Cornell Daily Sun (Anonymous 1896) wrote: “He showed
great enthusiasm in organizing the work under the very adverse conditions
which prevailed for the time and for several years. He planned early for
beautifying the campus by planting seeds in the fall of 1868, of a number of
kinds of trees for a nursery. Many trees from the nursery were planted over
the campus, but nearly all have been destroyed by subsequent grading for new
buildings”
Prentiss met his classes and researched the flora of the surrounding
countryside but in 1870, he accompanied Prof. C.F. Hartt on an expedition to
Brazil (organized by Hartt but henceforth known as the “Morgan Expedition”
after its chief underwriter). With a number of students, they pushed off from
New York in late June, returning early in January 1871. The party made
collections in natural history and studied the natural resources of the country
along the course of the Amazon to about 400 miles above Para, as well as along
the rivers Chingu and Tapajos, two of the principal tributaries of the Amazon.
There was time enough to see Rio de Janeiro. Drawing on this trip into the
tropics, Prentiss wrote an essay in 1871, “Mode of the natural distribution of
plants over the surface of the earth,” which won the first Walker prize offered
(and published) by the Boston Society of Natural History. But in contrast, he
also wrote an extended monograph of the hemlock (Tsuga spp.) for the United
States Department of Agriculture (USDA) Division of Forestry. That same
year the Chicago Fire (with almost one third of the city consumed) dominated
headlines.
In these years, American academics were coming to appreciate the
breakthroughs produced in European laboratories. It became relatively
common, although expensive, to travel to Europe to work with a leading
researcher and to visit the premier institutions in the capitals. Prentiss spent
six months in 1872, visiting the Royal Botanic Garden at Kew, the Jardin des
Plantes in Paris, and several other important botanic gardens. His facility with
French was helpful. In a matter of three years he had experienced the biota,
ecology, and peoples of the American tropics as well as the sophistication of
European science and lifestyle, both a long way from Cazenovia, New York.
As if the Chicago Fire wasn't sensational enough, the 1872 Boston Fire
seemed apocalyptic. Completely separate, though, when Prentiss returned to
10 ... Petersen
upstate New York, Cornell, too, was a remarkably different place than the one
he had left. Economic collapse was on the horizon.
The Civil War had been followed by a boom in railroad construction. Like the
canal craze of a previous half-century, development of railroads had exploded.
Between 1868 and 1872, 33,000 miles of new track were laid across the country.
Much of the railroad investment craze was driven by government land grants
and subsidies, this time to the railroad corporations. The railroad industry,
including its manufacturing and shipping support, was the nation’s largest
employer outside of agriculture, and involved generous amounts of money and
risk, especially bartered in the money markets of the northeast. The result was
over-development of those very supporting factories, warehouses, and other
ancillary facilities. A large infusion of cash from speculators caused even more
abnormal growth. In modern parlance, a bloated “bubble” burst in “the panic
of 1873.” To be sure, the panic followed a series of economic scares including
removal of silver as a denomination of coinage. The result was catastrophic:
unemployment became acute and banks failed, creating a general economic
crisis, with colleges and universities particularly threatened.
Cornell was not exempt. Student enrollment decreased. Faculty salaries
came under attack. Teaching loads increased while research was expendable.
The “Great Depression of 1873-77” cast a pall over campus.
As though bringing the mountain to Mohammed, in 1872 the AAAS met in
Dubuque, Iowa, where Charles Bessey met Asa Gray, the presiding President.
They arranged for Bessey to spend his 3-month winter break at Harvard,
where in addition to Gray, he would also work with George Goodale, a
physiologist, and study fungi and systematic botany. The following semester,
back in Ames, he moved a table, one microscope, and a few reagent jars into
a small room at the end of a corridor with a sign over the door—“Botanical
Laboratory.’ Bessey claimed that this was the “First botanical laboratory
outside of Harvard” (Sundberg 2012). (1872 also saw Susan B. Anthony, a
Quaker, jailed for protesting for women’s suffrage.)
At Iowa State, unlike eastern universities, a significant amount of the
curriculum was science, with a full year of botany required in the sophomore
year (Beal 1908). Bessey later recalled that “with the possible exception of
Harvard, this college [Iowa State] then gave the most extended and thorough
course in botany in this country” (Bessey 1913). The first term of the junior year
was split between vegetable physiology, economic botany, and cryptogamic
botany—all making use of the herbarium and college microscopes (Pool
1934-35). Within two years, seven compound microscopes were provided.
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 11
Four years afterward, in 1880, there were 11 compound scopes in a new
building with a large botanical laboratory on the first floor. Still three
years later, the lab had 21 student compound microscopes and a “first class
microscope, with accessory apparatus, and high-power objectives” (Pool
1934-35). Bessey later took pride in recalling that the administration and his
faculty colleagues believed “that the professor of botany was slightly ‘queered’
or out of his head when the subject of microscopes was under discussion”
(Sundberg 2012).
The laboratory as part of instruction became Bessey’s trademark. While a
visiting professor at the University of California in 1874-75, he introduced
botany students to the laboratory method, doing the same during a visit to
Minnesota in 1881, where he offered a summer school botany course for
teachers (Bessey 1881). By 1885, a dozen colleges had botanical laboratories
equipped with microscopes for student use (Arthur 1885).
Asa Gray had inaugurated a summer course for teachers and others in
1872 (Pfister 2010), and now, in 1874, Farlow returned from Europe with
ideas about hands-on teaching. Later in October that same year, the star of
the Exposition Universelle in Paris, Gustave Eiffel’s Tower, was the wonder of
the world. It was also the year that George Goodale offered a winter course for
teachers on how to teach botany (Goodale 1879; Bessey 1880a). The course
intended to teach teachers how to stimulate students to learn for themselves.
This was accomplished by using interesting and attractive living plants, asking
leading questions to guide the student’s inquiry, and answering only questions
that the student could not answer for him(her)self with direct observation.
In 1878, Albert Prentiss married Adaline Eldred. The couple had no
children, so Adaline was able to accompany Albert in many of his travels.
During the ensuing years, teaching continued and departmental and physical
plant administration consumed inordinate time while new students arrived,
some of whom were encouraged in their botanical studies.
In Iowa, Bessey’s new textbook, Botany for High Schools and Colleges (Bessey
1880a), was one of the first emphasizing “the new botany” in America, a term
coined by Beal (1879) at Michigan Agricultural College, but soon taken up
by other, mostly younger, midwestern botanists including Bessey, J.C. Arthur
(Bessey’s undergraduate and Master’s student), and their mutual friend John
M. Coulter at Wabash College. The book sold out within six months and
went through a large reprinted edition. Pressed by his publisher for a book
aimed at even younger children, Bessey (1884) published The Essentials of
Botany. Both books were lavishly illustrated.
12 ... Petersen
Back at Harvard, Goodale (1879), the physiologist, published a paper to aid
in teaching botany. The paper covered a few common plants. Shortly thereafter,
J.C. Arthur (1880) published the first teaching paper in an American botanical
journal, suggesting that pumpkin was a most useful example of a dicot stem to
use in the laboratory classroom. Two years later, Bessey suggested that asparagus
stem was an optimal monocot for teaching (Bessey 1882), and Arthur (1885)
further endorsed the laboratory experience as well.
As might be expected, at Cornell Prentiss oversaw the botanical training of
some notable students bound for greater lives (APPENDIX 2). In 1874, William
Russel Dudley (see Chapter 3) was awarded his bachelor’s degree. Finding
employment loomed as a major problem but Dudley had already assisted
Prentiss in the introductory course because much of Prentiss’s time was
taken up with campus construction and beautification. Dudley remained in
the botany department as an instructor, relieving Prentiss of the introductory
courses until leaving Cornell in 1893 for a professorship at Leland Stanford Jr.
University in California.
George Francis Atkinson was another student of the Prentiss era. Originally
from rural Michigan, Atkinson transferred to Cornell as an undergraduate
in about 1883. His botanical education was probably shared by Prentiss and
Dudley. At any rate, Atkinson was awarded his B.Phil. in 1885. As Dudley
before him, Atkinson was made an assistant to Prentiss. After graduation he
pushed off from Cornell for some years on faculty at some southern schools
(see Petersen 2019, p.71), only to return thereafter.
How William Ashbrook Kellerman from Ohio came to entertain ideas of
college is unknown, but the funds for matriculation at Cornell were found
and he probably entered in 1870, for he graduated in 1874, only six years after
the establishment of the University. Prentiss was away in the Amazon and
again in Europe for three of Kellerman’s Cornell years. Nonetheless, Prentiss
was department head, and Kellerman was likely to have had classes with him.
Chances are better that he rubbed shoulders with fellow student William
Dudley. Kellerman was to embark on a celebrated career in Kansas followed by
Ohio (and death by malaria during fieldwork in Guatemala).
Mason Blanchard Thomas, a young man from New Woodstock, New York,
came to Cornell in 1886, graduated with a B.S. in 1890, and remained for
graduate studies. In 1891, however, he accepted an appointment as professor at
Wabash College in Crawfordsville, Indiana (see Chapter 4).
In November of 1884, Bessey left lowa State University to become Professor
of Botany and Horticulture and Dean of the Industrial College at the University
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 13
of Nebraska. He vowed that the program at Nebraska would not “still
regard botany as a pleasant pastime consisting mainly of flower hunting...”
or where “the scientific botanist was one who collected, dried, and pressed
into dead flatness the plants of his neighborhood, only to attach to them
afterword [sic] certain Latin names....”” (Bessey 1885; Sundberg 2012).
In 1886, Gustave Eiffel again came to the attention of Americans.
Although Frédéric Bartholdi sculpted the Statue of Liberty, it was Eiffel
who designed its steel framework. The statue was paid for by French people
and positioned on Bedloe’s Island on a pedestal financed by Americans.
Dedicated in October in New York Harbor, it was celebrated by the first
tickertape parade up Fifth Avenue.
Atkinson (1896a): “During the later years, failing health, while it did
not prevent [Prentiss] from attendance upon the duties of instruction and
administration of his office, did not leave him sufficient reserve strength
for the close and continued application necessary in conducting extended
experiments or prolonged research.”
In 1896, Prentiss died at 60 years old. At Cornell’s Sage Chapel there
is a plaque that reads “In memory of Albert Nelson Prentiss M.S. First
Professor of Botany at Cornell University 1868-1896. Born May 22, 1836.
Died August 14, 1896. A noble man, a devoted scientist, a faithful teacher.”
A note in the Cornell Sun read: “While Professor Prentiss never manifested
any great enthusiasm himself, he could arouse more enthusiasm in a
student, and get more work out of him, than any man I ever knew.”
A piece in Gardening Magazine reported: “At Prentiss’s death (1896) the
Cornell botany department had the following personnel: Geo F. Atkinson,
Ph.D. [sic] professor of botany; W.W. Rowlee, B.L., D.Sci, assistant
professor of botany; E.J. Durand, A.B., D.Sci., instructor in botany; K.M.
Wiegand, B.Sci., assistant in botany; B.M. Duggar, A.B., A.M., assistant
in charge of experiment station botany; Robert Shaw, head gardener,
in charge of conservatories, W.A. Murrill, B.Sc., Virginia Agr. College,
scholar in botany.’ Twenty-eight years previously, Prentiss had arrived as a
department of one.
Chapter 3. William Russel Dudley
(1 March 1841-4 June 1911)
Guilford, Connecticut, on Long Island Sound some miles east of New Haven,
was home territory for the Dudley family since colonial times. William Russel
Dudley (Frc. 2) was born and raised on a family farm, and reports from later
14 ... Petersen
years indicate that the family might have been landed but was not aristocratic.
His early schooling has not been uncovered but he took interest in nature,
especially the flowering plants that surrounded him. Although other colleges
were considered, he chose Cornell for its emphasis on science. He arrived there
in 1870 (age 29), sought out the botany department, and there made friends
with fellow student David Starr Jordan, Assistant to Professor Prentiss. Many
years later Jordan would describe his new friend as: “a tall, well-built, handsome
and refined young man, older and more mature than most freshmen, and with
more serious and definite purposes” (Anonymous 1913). Immediately, Dudley
set out to explore his new environment, including collecting fungi (Cooke
1956). As it turned out, he and Jordan roomed together for the following years
and soon made joint field trips.
Dudley paid his way at Cornell by milking cows at the university farm.
He and Jordan roomed in a small cabin near the small campus and soon a
small cadre of aspiring botanists gathered, some destined to become notable
academics in their own right.
In 1870, just as Dudley arrived at Cornell, construction began in New York
City on a bridge between suburban Brooklyn to business-centric Manhattan. It
was called the New York Brooklyn Bridge, but the name would be shortened to
The Brooklyn Bridge.
Although words of eulogy may be discounted by circumstances, even in his
youth Dudley was consistently described by preciseness, purity of thought and
intention (particularly in the last decades at Stanford), but as stated by Jared
Treman Newman (Anonymous 1913): “Of fine New England stock, cultured,
with a refinement that was genuine all the way thorough, doing splendid work
in his chosen profession and capable of making a great name for himself, his
best service to the world was in imparting to other men higher aspirations and
nobler ideals.”
Dudley impressed his new friend Jordan by his attitude and growing
knowledge and, when Jordan moved on, Dudley was selected in his sophomore
year as Jordan’s replacement as Assistant to Prof. Prentiss. He served in that
capacity for Prentiss’s course in fungi for four years, qualifying him to be listed
as a mycologist many years later.
Graduating in 1874 with a B.A., Dudley stayed on, enrolling for graduate
studies. In 1875, he spent the summer on Penikese Island, a tiny plot off the
south coast of Massachusetts, taking a field course from Louis Agassiz, Harvard
University’s famous zoologist. This was the first American field course located
in the midst of the material to be studied and was an early model for the Marine
Four Masters—Prentiss, Dudley, Thomas & Whetzel ...
Fic. 2. William Russel Dudley. Dudley Memorial Volume, Stanford University. 1913.
Biological Laboratory at Woods Hole, Massachusetts, founded in 1888. Dudley
returned to the island in 1876, just after receiving an M.A. from Cornell and a
IBS)
16 ... Petersen
promotion to Assistant Professor of Botany. The island was to become a leper
colony in the 20" century. In 1878-79 Dudley served as Professor of Botany at
the Martha's Vineyard Summer Institute.
A year later, his old roommate, David Jordan, by now President of the
University of Indiana, was scheduled for a leave and asked Dudley to substitute
for his teaching responsibilities. Dudley complied, taking leave from Cornell.
But Jordan was not finished with him. John Casper Branner (Anonymous
1913) related: “When Dr. Jordan was President of the University of Indiana,
he tried for some time to induce Dudley to go to that institution as professor
of botany. And I recall in this connection that Dr. Jordan said to me on one
occasion: ‘Quite aside from his ability as a teacher of botany we need him
here on account of his personal influence’ But Dudley declined the proffered
position largely because he felt that he was not altogether fitted for the pioneer
work required there at that time.”
As if to express American exceptionalism, John A. Roebling’s masterpiece,
the Brooklyn Bridge, was opened for traffic on 24 May 1883, far away from the
rural areas producing the academic centers of this narrative. As a reminder,
popular, affordable internal-combustion automobiles were still 30 years in
the future. Some lives would be lost in its construction, but the bridge was to
stand as a monument for over a century and still acts as a prime artery, now
by vehicle and foot traffic. It was a structure to be admired (and scams still
offer it for sale). That same year, Dudley was again promoted, this time to
Assistant Professor of Cryptogamic Botany, reflecting his experience teaching
the mycology course.
In 1886, he went out of character, publishing three biographical sketches of
mycologists in Journal of Mycology, edited by his Cornell student friend William
Ashbrook Kellerman: “A sketch of [Moses Ashley] Curtis;” “Elias Magnus
Fries;” and “Charles Christopher Frost’ These sketches had been advertised
by Kellerman at the end of volume 1. As the years passed, Dudley remained
at Cornell, now on the faculty of a growing department. In 1887, like Prentiss
before him, Dudley travelled to Strasbourg in Europe to work with Anton de
Bary, who was experimenting with plant and fungus physiology. When de Bary
died the following year, Dudley wrote a eulogy in Botanical Gazette.
1888 was a year of change for Cornell’s botany department. Liberty Hyde
Bailey, Asa Gray’s last student and a horticulturalist intent upon taking
botanical—largely agricultural—knowledge from the lecture hall and
academic laboratory to the practicing public engaged in agricultural pursuits,
entered the botany department through Cornell's Agricultural Experiment
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 17
Station in Geneva, New York. While Bailey’s vigor enlivened the personnel,
it also roiled the routine of teaching and research. 1888 was also noted for the
death of Asa Gray.
David Jordan moved again, this time as President of the brand-new Leland
Stanford Jr. University (later shortened to Stanford) in Los Altos, California.
He renewed his effort to bring Dudley on board, and this time Dudley was
listening. Dudley’s last paper written at Cornell, “Flora of the Lackawanna and
Wyoming Valleys; a catalogue of the flowering plants and vascular Cryptogams
found in and near Lackawanna and Wyoming Valleys,’ (published privately
with Charles O. Thurston from Wilkes-Barre, Pennsylvania) appeared as he
made the decision to move.
Dudley’s years at Stanford go beyond the current narrative. In time he became
deeply involved with California forestry and especially with the conservation
of archetype forests. He fought for, and won, the state's purchase of 2500 acres
of prime redwood forest now known as Big Basin Redwoods State Park. David
Jordan (Anonymous 1913) related: “Professor Dudley’s health was good until
about three years ago, when he set out to study the trees of Persia [the vast
stretch of land from Egypt to Pakistan, centering in Iran; what is known now
as “the Middle East”]. In Egypt he was attacked by a severe cold or bronchitis
which ended in tuberculosis.” Jordan’s grace note: “He never married.” Dudley
died 4 June 1911, in Los Altos.
John Casper Branner on Dudley (Anonymous 1913): “In the latter part of
his life certain of his traits became more prominent than during his younger
manhood. He was always, and of necessity, a purist in every sense in which that
word can be used. But as he grew older I imagine that his sensitiveness brought
him more pain than pleasure, and to this I attribute the rather lonely life he led
after coming to California.”
Jared Treman Newman on Dudley (Anonymous 1913): “Like many noble
souls, he was peculiarly sensitive. He was hurt often when no hurt was intended.
He was often melancholy, sometimes almost morbid. It has always seemed so
strange that one who gave so much and so constantly should not be always
happy. Perhaps he made up for it in the intensity of his joys. While he was often
misunderstood and while the number of persons who came close to him was
not relatively large, yet few men have merited, or have known, in so large a
degree, the love of their fellows.’
A list of notable students that passed through Dudley’s aura at Cornell
appears here in APPENDIX 3. A similar list of such students at Stanford
(Anonymous 1913) is easily three times the Cornell list.
18 ... Petersen
Chapter 4. Mason Blanchard Thomas
(16 December 1866-6 March 1912)
Born in 1866 in New Woodstock, New York about 25 miles southeast of
Syracuse and just a few miles due south of Cazenovia and the birthplace of
Albert Nelson Prentiss (born: 1835), it would be years before Prentiss would
meet Mason Blanchard Thomas at Cornell.
Thomas (Fic. 3) prepared at Cazenovia Academy (probably a lapsus by
Kent 1979, for the Cazenovia Seminary), 6 miles north of New Woodstock.
In those years, to recruit new, qualified students, Cornell ran a program of
competitive scholarships carrying stipends to defray expenses. Thomas won
one of them and enrolled in Fall 1886. According to Kent (1979): “It is unclear
why he chose to study botany.”
Although Albert Prentiss was Botany Department Head, Thomas began
early to work with William R. Dudley, at that time establishing his own course
in histology. Dudley was an experienced and inspiring teacher, as well as a
half-time investigator of plant disease in the Cornell Experiment Station.
He was a proponent of understanding disease through laboratory analysis,
particularly histological examination, joining the movement of bringing the
laboratory into the classroom. Years later, this relationship bore fruit as “A
laboratory manual of plant histology” (Thomas & Dudley 1894), even though
both authors had gone their separate ways. Through Dudley, Thomas became
acquainted and worked with microscopist Dr. Simon Henry Gage.
Awarded a B.A. in 1890, Thomas immediately enrolled in graduate studies
aiming for a Ph.D., but the Cornell fellowship he occupied at that time expired
in nine months, with no other predictable means of livelihood. So it was not
Thomas's first choice when in the fall of 1891, he was offered and accepted
a faculty position at Wabash College in far-off Crawfordsville, Indiana. He
must have come with high recommendations: the position was as the Rose
Professor of Biology and Geology, and he replaced John M. Coulter, one of
the champions of laboratory-centered learning who left Wabash to become
President of Indiana University. Thomas was 25 years old.
The contrast between Cornell, its location, student body, faculty, and
campus, and Wabash College, with about 200 students, 15-20 faculty, and
unkempt grounds, was stark, but as later reported, Thomas “hit the road
running.’ The quality of Wabash students was high. For entry into the collegiate
program, solid academics were required, including preparation in Latin and
Greek. Wabash was the quintessential small liberal arts college, and students
received a great deal of individual attention in small classes. According to
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 19
Fic. 3. Mason Blanchard Thomas. The Wabash Ambassador. 1969 vol.3(2): unpaged.
Kent (1979): “in his first year at Wabash, Thomas's remarkable energy and his
interest in students led him to become coach of the new football team. During
a practice session he received a knee injury which ended his coaching career,
20 ... Petersen
caused him continual pain, and necessitated use of a cane for the rest of his
lite.
Most of the students were from the present-day mid-west and came to
Wabash with no intention of studying biology. Many of Thomas's students
reported how he advised them to take his general course, then encouraged
them to major with him, and, finally, directed them to graduate school.
Lexemuel Hesler’s description (Petersen 1979) of his first encounter
with Thomas mirrored that of many students. As told in the third person,
“... he entered Wabash College with the intention of transferring to Purdue
University for a degree in Civil Engineering. After two years, however, his
goal changed to botany. He recalls that at registration in the Fall Quarter
at Wabash in 1907, his course of study was prepared by Professor Mason B.
Thomas. He found Thomas a magnetic and persuasive personality, which
resulted in Hesler being signed up to take freshman botany. His performance
in Thomas’ course that year scarcely sparkled. A conference which Hesler
had sought with Thomas at the end of the first quarter opened a new
understanding by this freshman as to what college was, and what it took to
do profitable college classwork. Things were now to change for the better.
However, in the following year [junior], he met another student, one Jacob
R. Schramm [Wabash class °10, one year ahead of Hesler; see APPENDIX 4;
TABLE 1)]. Soon Hesler’s professional life-plan was well laid by the designers
Thomas and Schramm. In this plan was Hesler’s assignment to assist Schramm
at the Woods Hole Biological Station, in Massachusetts, during the summer
of 1909; and the next summer (1910) he was placed in the field station at
Sodus, New York, on the recommendation of H.H. Whetzel, Wabash ’02’ [by
then on faculty at Cornell]. This move resulted in Hesler’s appointment to a
fellowship the following January 1911, at Cornell. At Cornell, Hesler held the
fellowship in Plant Pathology.”
In 1892, only a year after Thomas's arrival at Crawfordsville, campus gossip
was rivaled by different news headlines. Negotiations were underway to
designate a location for an exposition commemorating the 400" anniversary
of Columbus’ arrival in the “New World” Two cities led the competition,
New York and Chicago. The New York bid seemed insurmountable, backed
by the likes of J.P. Morgan, Cornelius Vanderbilt, and William Waldorf Astor.
Chicago’ bid was underwritten by Charles T. Yerkes, Marshall Field, Philip
Armour, Gustavus Swift, and Cyrus McCormick among others. The final
straw came when Lyman Gage, the Chicago Banker, raised over a million
dollars in 24 hours to top New York's bid. The “Windy City” site was finalized.
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 21
The site was to be grand, with lakes, ornate buildings, and participation
by many nations up and down the Americas. Its title was World’s Fair:
Columbian Exposition. In all, 46 countries participated, each advertising its
own society, culture, products, and beauty. State exhibits included California,
Connecticut, Florida, Illinois, Louisiana, Massachusetts, New Jersey, New
York, Pennsylvania, and Texas.
Fourteen “great buildings” were included. Among them were Agriculture,
Forestry, and Horticulture. William Ashbrook Kellerman, a former Prentiss/
Dudley student at Cornell (see APPENDICES 2, 3) and by 1893 the botany
department head at Ohio State, mounted an exhibit of Ohio timber trees.
Charles Horton Peck, State Botanist for New York, brought numerous ceramic
models of mushrooms and other fungi. Joseph Charles Arthur, from Purdue,
exhibited a physiological apparatus of original design, “receiving medals and
diplomas.” (Lloyd 1920). The agriculture building included displays of US.
Department of Agriculture-aided crops and new motorized technology for
the farm.
The exposition was dedicated 1 October 1892 and opened to the public
1 May 1893. During its six-month life, over 21 million people went through
the turnstiles. It was a headline-stealer and a living symbol of the resilience of
Chicago after its disastrous fire of 1871.
Inspired by the Fair’s exhibitions, William Powell Wilson, once a Prentiss
student at Michigan State (see APPENDIX 1) saw an opportunity. Wilson
imagined a permanent commercial museum with exhibits along the style
of those at the Exposition. Perhaps exhibits from Chicago could serve as
the beginning. Already a botany professor on faculty at the University of
Pennsylvania, he quickly returned to Philadelphia and floated the concept
through local authorities. Armed with official approval and adequate funding,
Wilson returned to the Fair and persuaded several Central and South American
countries to sell their Exposition exhibits to his yet-to-be-housed museum.
The concept was a success, the museum grew and eventually moved to a
building of its own, which it occupied until its closure in 1994. Wilson spent
the rest of his career searching out exhibits for the Philadelphia Commercial
Museum, an occupation which made him a respected international statesman.
To resume the interrupted narrative, in 1893, Mason Thomas, age 27,
married Anne Davidson, a young lady from Crawfordsville, who shared
his warm personal relationships with students. Even after Thomas's death
she retained the affection of many Wabash students. The Thomases had no
children (Kent 1979).
22 ... Petersen
In response to student popularity in the natural sciences at Wabash, botany
was divided in 1895. Thomas was titled Professor of Botany, with Dr. Donaldson
Bodine as Professor of Biology and Geology. The two complimented each
other in pedagogical philosophy and they became fast friends.
Perhaps as evidence of his energy, Thomas was sometimes viewed as a
gadfly. He vociferously carped on the poor appearance of the campus grounds,
and so in 1897, in a common administrative tactic, he was appointed by the
President to oversee the buildings and grounds. Thomas promptly persuaded
the Executive Committee of the Trustees to bring in a landscape architect to
develop a landscaping plan for the campus. It was his first formal attempt at
administration.
As the growth of urban New York City was contrasted to the opening
of Cornell University in 1868, the first quarter of the 20" century saw the
first operational underground rapid transit system. Two private companies
pioneered the construction, and the first New York city transit route opened
in 1904. By 1913, the City took over new construction, leasing the routes
and stations to the companies. Apace, Chicago opened its “L’ (elevated rapid
transit system) where four routes and four companies began service between
1892 and 1900. Whether measurements were based on geographic area,
population, residence density, gross domestic product, the arts, or pollution
and general filth, at every turn, the dominant cities grew and thrived usually
with little knowledge or opinion about rural, agrarian conditions over the
horizon.
During the ensuing years, Mason Thomas’ reputation grew, both as teacher/
mentor and effective administrator. A list alone cannot cover the duties and
roles as well as the esteem given him. Associate Editor of the Proceedings
of the Indiana Academy of Sciences, 1899-1900, followed by the Presidency,
1900-01; fellow of the American Association for the Advancement of Science
and appointment to its Counsel; Secretary of the Indiana Forestry Association
and Chairman of its Education Committee; Member of the Corporation of
the Marine Biological Laboratory at Woods Hole, Massachusetts. Almost
tangential was his interest in the Boys School of Plainfield, Indiana, for which
he served as Secretary of the Board of Trustees. His performance in all roles
led to his appointment as Dean of Faculty in 1907, in addition to his regular
departmental responsibilities, over which he remained head until 1908 as a
faculty of one. His mentored students kept pace, with most graduating during
1905-1914 (two years after his death; TaBLE 1). Wabash appreciated his role
in the College and in 1907, awarded him an honorary LL.D. degree.
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 23
INaGN.IS
PIGI-1681 ‘A82T]0D Yseqem Je SUIT} ITaY} pue sJUapNys seWIOY], ‘| ATAV],
24 ... Petersen
In January 1912, Thomas became ill and was confined to bed with what
was diagnosed as severe pleurisy, an infection of the membranes surrounding
the lungs. For two weeks he continued to conduct classes at his bedside. As he
continued to decline, his former student, Dr. B.R. Hoobler (see APPENDIX 4;
TABLE 1) came to Crawfordsville to assist in his treatment. Thomas died on 6
March 1912, at age 45. As written by Kent (1979): “At the turn of the century,
one of the outstanding teachers of botany in the United States was Mason
Blanchard Thomas at Wabash College.”
Memorials and obituaries for Thomas were several (Anonymous 1912a,b;
Mills 1912). From his first year at Wabash to his last, Thomas selected and
mentored students and propelled them toward more significant goals. An
annotated list offered by Kent (1979) appears as APPENDIX 4.
Chapter 5. Herbert Hice Whetzel
(5 September 1877-30 November 1944)
As might be expected, excitement over the “New Botany” pedagogical
innovations led to some differences of opinion. This dichotomy played out in
microcosm at Cornell, with the conservative Albert Prentiss as its botany head
in the College of Liberal Arts followed by George Atkinson, and the later Liberty
Hyde Bailey’s more energetic State College of Agriculture with its version of a
Botany Department (soon renamed). Bessey, John Coulter, J.C. Arthur, Dudley,
Kellerman, and others were eager to push the discipline forward by promoting
botanical education at all levels (Sundberg 2014).
The narration for Herbert Hice Whetzel (Fic. 4) includes, of course, some
facts of his life, but the circumstances at Cornell during his graduate student
days and those of his retirement from the department headship oblige additional
words, for the effects of those academic political episodes were felt throughout
the phytopathological, mycological, and academic communities.
Born in Avilla, in the upper east corner of Indiana, Herbert Hice Whetzel
(Wabash class of 1902) became a formidable, albeit controversial, force in plant
pathology. Of Whetzel’s early life little is recorded except that a teacher noted
Whetzel’s devoted hobby of collecting and preserving botanical specimens
and encouraged the young man to extend his education beyond public school
(Fitzpatrick 1945). Whetzel graduated from Avilla High School in 1895. Two
years of local school teaching followed before he arrived at Wabash College. His
choice of Wabash remains oblique, but as the qualifications for entrance were
stringent, Whetzel must have been thoroughly prepared, including familiarity
with Latin and Greek. There may have been a prior connection to Prof. Mason
Four Masters—Prentiss, Dudley, Thomas & Whetzel ...
Fic. 4. Herbert Hice Whetzel. L.R. Hesler, pers. comm.
25
26 ... Petersen
Thomas there, for Whetzel lodged with the Thomases and so had ample time
to absorb the professor’s magic. A worrisome vision problem led Whetzel to
drop out of college for a year, but when he returned, Thomas's previous Cornell
experience with and under Prof. W.R. Dudley paid off for Whetzel. As a
junior, Thomas arranged for Whetzel to become a summer assistant to George
Atkinson, the botanist at Cornell, and that summer Whetzel, Atkinson, and
Atkinson's student, Calvin H. Kauffman, collected fungi together.
Whetzel must have excelled at Wabash, for after graduating with a B.A.
in the class of 1902, he simply moved on to Ithaca, New York, to become
Atkinson's graduate student. Just a decade previously, the Hatch Act had given
state colleges the opportunity to fund agricultural experiment stations. For
Cornell it only meant additional funds, for its station had been founded in
Geneva, New York, a few years before. J.C. Arthur, one “New Botany” advocate,
was the botanist at the station. Atkinson's campus appointment in botany also
carried responsibilities at the Station, usually carried out by Atkinson's students
under his supervision. Whetzel was no exception. Within a year, the celebrated
Liberty Hyde Bailey joined the Experiment Station. Graduate student Whetzel
was there to see it all.
Whetzel’s migration came at a moment when headlines were made in
another direction. Just a decade after the Columbian Exposition in Chicago, the
anticipated Louisiana Purchase Centennial Exposition was held in St. Louis.
Like its predecessor, architecture was grand, with 60 countries and 43 American
states represented. Scientific attractions emphasized technology, perhaps
reflecting the changing demography from agrarian to urban populations. St.
Louis was (and is) considered “The Gateway to the West” and its location on the
WEST side of the Mississippi was significant. Some 19.7 million visitors took in
the fair, which cost the federal government $15 million dollars.
Whetzel’s responsibilities at the Geneva Station brought him into contact
with Bailey, who offered him a job as an extension agent, bringing the research
from the Station to the farmers who needed it (Fitzpatrick 1945). But Bailey
was soon tapped by the New York State administration to establish the New
York State College of Agriculture at Cornell University (Colman 1963).
Meanwhile, Whetzel was promoted to Assistant Professor in the Liberal Arts
botany department. The new College, however, also planned a department
of botany, awkward since Atkinson’s botany department already existed.
The solution to the naming problem came in two phases: [1] Bailey offered
Whetzel a new job as Assistant Professor and Head in the new department,
so for some time he would be on faculty in two botany departments in two
Four Masters—Prentiss, Dudley, Thomas & Whetzel ...
a
Fic. 5. Reunion of Wabash graduates at Cornell University, 1908. Left to right: Donald Reddick,
Mrs. Whetzel, Prof. Herbert Whetzel, Earl Price, Mrs. Thomas, young Gertrude Whetzel, Harry
Fitzpatrick, Prof. Mason Thomas, Jacob Schramm, Delbert Funhouser. Photograph taken on
rocks above second bridge beyond Forest Home. Courtesy: Cornell University, Plant Pathology
Herbarium (CUP).
colleges; and [2] Whetzel soon requested that the new botany department be
retitled as the Department of Plant Pathology, of which he would be the head.
In Whetzel’s (1945) own words: “In the spring of 1906, he [Bailey] disclosed to
me his intention of establishing a department of botany and offered me the job
of organizing it. The following autumn I was made assistant professor of botany
and head of the department” [of Plant Pathology in the College of Agriculture].
This titular redundancy was, of course, awkward. Although somewhat
confusing for a reader not familiar with the sub-sciences involved, the
explanation may be opaque. According to Korf (1991): Whetzel’s teaching of
“most important parasitic fungi” (Botany II - mycology) had much earlier
been offered by Atkinson and Durand in the Department of Botany [Liberal
Arts], and by 1906-07 a course in Methods of Research in Plant Pathology was
also offered in the [agriculture botany] department.” Once the [agriculture]
Department of Plant Pathology existed, “Two courses were offered in 1907-08,
la — Plant Pathology and 2a — Methods of Plant Pathology, both taught by
Whetzel and Donald Reddick, one of the “Wabash boys’ (see Fic. 5). By 1908-09
five courses, plus seminar and research, were offered by Whetzel, Reddick, and
ZH
28 ... Petersen
another of the Wabash group, M.F. Barrus (Wabash class of ‘07).?” Whetzel
kept control of the introductory courses for the rest of his career, teaching
them for the last time in 1943 (Korf 1991).
Back to Whetzel’s testimony: “... In the summer of 1907 I decided to
devote my effort entirely to the development of plant pathology as a field
for teaching and research. I went to Dean Bailey with the request that my
title be changed from assistant professor of botany to assistant professor of
plant pathology and that I be relieved of responsibility for the work in other
phases of botany. Apparently astonished at my temerity in suggesting an
entirely new kind of chair in university faculties, he, nevertheless, consented
to put my proposal before the Board of Trustees of Cornell University. When
my appointment came through that autumn, it carried the title of assistant
professor of plant pathology and head of the new department.”
Sadly, in 1912, he was widowered, but later the same year he left for a
15-month-stay (1912-14) in Europe, with a residency at the University of
Heidelberg working with Prof. Georg Klebs. Shortly after his return, two
events burdened Whetzel’s life. First, L.H. Bailey resigned the Deanship of
Agriculture, thus removing a sympathetic ear in administration. With this
change the future of the “New Botany” was put at risk.
According to Hesler (1975), an eye-witness: “In 1914, [Beverly Thomas]
Galloway was induced to accept the deanship of the New York State College
of Agriculture, at Cornell University. The move proved to be a disaster, both
for him and for Cornell.
“Before coming to Cornell, although Galloway had had little or no academic
administrative experience, he had been persuaded by Whetzel and others to
accept the deanship there. It was unfortunate for him that he should follow at
Cornell so skilled an administrator as Liberty Hyde Bailey. Galloway brought
with him from Washington some of the Federal Bureaucracy practices in
vogue there, and somehow these were both unfamiliar and unacceptable
to the Cornell Agriculture faculty” He was also resistant to “New Botany”
teaching philosophy. “Galloway’s inaccessibility to the faculty, his ineptness
in handling the legislature to get funds, and his general image all resulted in
a few special faculty meetings (which [Hesler] attended) to discuss what the
faculty felt was a grave problem. The net result of all this activity was pressure
that was applied in such a way that in 1916, Dr. Galloway was led to resign.
He then returned to the USDA where he pursued his work in plant pathology
until retirement.” For his part, during these same years Whetzel also served
as 1915-18 President of the American Phytopathological Society.
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 29
Inasecond, then seemingly insignificant, event of 1914, the June assassination
of Archduke Franz Ferdinand, heir to the Austro-Hungarian Empire sparked a
diplomatic confrontation that quickly boiled over into World War I. Whetzel
served energetically as Chairman of the American Phytopathological Society's
War Emergency Board.
Now, in order to set the stage for the subsequent decade, some words must be
added about Whetzel’s personality. Bailey’s choice of Whetzel as the person to
translate the research of the experiment station into “normal language’ testifies
to Whetzel’s affability and facility with language, and he was a persuasive
evangelist. But as years passed with him at the helm of the department, some of
his more energetic projects and idiosyncrasies began to chafe younger faculty
who did not wish to subjugate themselves to authority. A few vignettes testify
(enumerated for separation).
[1] Korf (1991): “One of the most unusual and to my mind most important
features of Whetzel’s course was that each student was held to complete 16 oral
examinations, each on one week's work. These examinations were given both by
laboratory instructors and by those professors in the department who might have
worked with the disease studied that week. By virtue of Whetzel’s commanding
and demanding personality, almost every professor in the department took part
in these oral examinations, usually lasting 20 to 30 minutes in that professor's
office.” The elapsed time for each examination was multiplied by the number
of students enrolled in the course - time taken away from the professor’s own
teaching and research. Fitzpatrick (1945): “[Whetzel] applied an entirely new
system of teaching perhaps on the English system, and belittled those who
did not adopt it” Convinced of the value of his teaching style, Whetzel (1930)
published on it.
[2] Whetzel considered the herbarium the backbone of the department
(Korf 1991). He adopted a numerical system so that everyone could find a
specimen and additions were placed at the end of the run. Individual herbaria
and other specimens were frowned upon. The departmental herbarium was
coordinated with slides, photos, notes, etc. under the same numbers. Although
revealed as an efficient system, faculty discussion and approval were not sought.
Fitzpatrick (1945): “...and though at times in his enthusiasm for organizing,
he promulgated regulations approaching regimentation his motive in so doing
were not selfish...”
[3] Korf (1991): Instead of each faculty sequestering his own instruments
and reagents, Whetzel organized the first Plant Path stockroom—with check-
out slips.
30 ... Petersen
[4] Instead of each professor staging and executing his own photography,
Whetzel placed one man in complete control of the department's photographic
facilities and had him do all of its photography.
[5] Even technical terminology was not overlooked by Whetzel. Fitzpatrick
(1945): “It must be conceded that in coining new terms, as in some other
respects, he tended to be somewhat radical, and clearly took pleasure in
nettling the ultraconservatives.” Again, Whetzel (1929) was convinced that his
terminology was salutary and published on it.
[6] Korf (1991): “The few [faculty] I did not meet in [these oral examinations]
soon became acquaintances through the regular departmental afternoon coffee
hour, attendance at which was ‘expected’ by Whetzel, whose sonorous, booming
clarion call on a rising and then declining pitch, “Coffee, coffee,” shook the
whole building daily.
[7] Before his step-down from the headship, Whetzel (1918) published a
major offering “An outline of the history of phytopathology,’ regarded by some
as preemptory.
[8] Harry Fitzpatrick (Wabash ‘09), groomed by Thomas and molded by
Whetzel, was by now on faculty in Plant Pathology at Cornell (hired specifically
to teach mycology). Newhall (1980): “Fitz[patrick] hated cigar smoke and
Whetzel smoked much of the time. He particularly liked to stand in Fitzpatrick’s
doorway and TALK AND PUFF and watch Fitz squirm. Fitz would later slam
open the door and window and then go for a walk”
In 1922, Whetzel stepped aside as department head, succeeded by Louis
Melville Massey (Wabash class of “12) who occupied the position until 1950.
The questions which surround the faculty discontent and Whetzel’s retiring
as department head to my knowledge are dealt with in only one paper (Jones
1922). Extended quotes from that short publication are warranted. Although
the paper occupies only two journal pages, not all is germane to this narrative.
The following quotes have been extracted.
“Professor H.H. Whetzel, who has been for fifteen years head of the
Department of Plant Pathology of Cornell University College of Agriculture,
retired on July 1 [1922] from the administrative leadership in order to devote
his time and energies more fully to teaching and research together with the
immediate preparation on one or more text books. Dr. L.M. Massey who
has been acting head for the past year during Professor Whetzel’s absence in
Bermuda succeeds to the permanent position.
“When I last visited Cornell a year ago the Department had in addition to
what were doubtless the largest undergraduate classes of any like department
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 31
in America, an enrollment of twenty-six graduate students. It has during the
last thirteen years granted twenty-four Ph.D. degrees with major interest in
plant pathology. ... Whetzel has in his work, shown a genius for meeting old
problems in a new way in the field of phytopathology.
“In a letter to his dean setting forth his reasons for wishing to retire from
the headship, Whetzel says: ‘I am convinced that with rare exceptions no
man should be allowed to head a department for more than fifteen years. He
should not serve for less than ten, unless he is a failure —- then the sooner he
steps out or is removed, the better. The head of a department who cannot in
ten or fifteen years put over a big administrative project deserves no further
time or opportunity.
“,.. Few men can do both administration and teaching, let alone research
also with full justice to all. After ten years of administrative work I long to
give my time and energies fully to teaching and research work. As you know,
I have for four or five years urged you to relieve me of the headship that I
might devote myself wholly to my students and my investigations. I feel that
another ten years would not only measure the span of my administrative
usefulness but would also end any possibility of a successful return to
teaching or research.
“One of the most disastrous features of long tenure headship is its effect
on ambitious and able young men in the staff. Such men see little hope of
administrative opportunity within a reasonable period of time and either
leave the institution for a better position elsewhere or become discouraged,
discontented, often intriguing and disloyal to the chief. The result in the latter
case is sure to be disastrous to someone, usually to the young man himself,
often to the department and to the institution, not infrequently to the good
name and prestige of the head of the department himself”
As to the question of whether Whetzel recognized the restive state of his
faculty, the answer is affirmative, but he judged this as disloyalty to the head.
Complaints were caused by lack of administrative opportunity as long as the
head blocked upward mobility.
His reference to four or five years of request for relief from administration,
given his style, success with “industrial fellowships” and numerous other
innovations rings hollow. In fact, the request must have fallen on the deaf
ears of the dean. Of course, Whetzel had a model in the brief term of Dean
Galloway, who lasted only two academic years under duress.
It is dificult to splice “I am sure a younger man can carry it forward
farther and with greater success than I could now.’ The word “now” could
32 ... Petersen
refer to Whetzel’s age or tenure in office, or it could refer to his wounded
status in regard to faculty distaste for his headship. But the entire paragraph
describes his role in the expansion and progress of the department. All told,
the letter reads like that of a captain facing mutiny, but who cannot stand
down without justification and self-praise. What a humbling situation to
which to return from protracted research in Bermuda. Massey maintained
the headship from 1921 to 1950 (29 years), somewhat longer than what
Whetzel might have thought advisable.
If Whetzel’s idiosyncrasies as department head were considered negative
(andthey were sobythe increasing cadre of young faculty; Korf1991), Whetzel’s
crowning achievement was establishment of “Industrial Fellowships.” This
program, while bringing increased funding, was controversial for perceived
mixing of college, “pure” research with the commercial world’s money. When
plant pathology became an administrative unit in 1906, in Whetzel’s (1945)
own words: “I soon found out that the sum which the Dean [Bailey] was
able to assign for the maintenance of the department was quite inadequate
to meet the demands for the solution of plant disease problems of pressing
importance in the State, and I began to cast about for other sources of funds
for research.” The first such fellowship started in 1909.
The “Industrial Fellowships” program took hubris on Whetzel’s part.
After ascertaining that a particular phytopathological problem could
be ameliorated by research in his department, the potential commercial
sponsor had to be contacted, informed of the benefits, and agree to a sum,
all within Whetzel’s comfort zone. Further persuasion was required: “It
was early found that the cost to the department in supervision, equipment
and administration of the work was approximately equal to the value of the
fellowships themselves. Thus the State was compelled to provide increasing
allotments to the Department of Plant Pathology to meet these requirements.”
“,..-we may conservatively say that well over half a million dollars have been
made available to the department during the past 36 years.” (written in 1945).
Pedagogically, the Industrial Fellowships turned laboratory-centered
instruction on its head. In addition to bringing real organisms and real
agricultural problems into the classroom for student consideration, they
immersed the student in the “real world” laboratory to experience both the
problem in question and the real economics of the crop and business of
agriculture.
Whetzel (1945; APPENDIX 5) himself offered a detailed listing of the
fellowships, their recipients and the money involved. He summed up the
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 33
program: “Of the 67 who have held one of these fellowships, 42 have received
the doctorate degree at Cornell University and 2 elsewhere; 31 have become
research professors or teachers in colleges or universities (9 at Cornell); 18
have become investigators (at professional stations) in the Federal service or
in commercial organizations; 2 have turned to farming; and 6 are currently
fellows in the department of plant pathology at Cornell.”
Although the “Industrial Fellowship” program continued after Whetzel’s
retirement from the headship, they then required approval from above and
were subject to “outside” accounting and lobbying for the state’s contribution
to the department's research. In the midst of such activity, in 1930, he again
spent eight months in Europe.
According to institutional regulations, members of the faculty could
not be awarded a degree by the same institution. Whetzel, therefore, could
not receive a Ph.D. from the State College of Agriculture even though his
research was far more than otherwise would have been acceptable. The
years of serving on faculty, as department head and return to teaching and
research were borne on a Bachelor of Science degree from Wabash College,
class of 1902. In 1906, Wabash conferred on him an M.A. and later in his life,
an honorary D.Sci. in 1931. A frequent field companion was Carlos Chardon,
former Cornell student under Whetzel, Chancellor the University of Puerto
Rico and later Commissioner of Agriculture and Labor. Honoring his field
work and advocacy, the University awarded Whetzel an honorary D.Sci. in
1926.
Well before his retirement from the headship, Whetzel had become
interested in plant pathogenic fungi whose sexual-state apparatus arose from
sclerotial structures, especially members of the genus Sclerotinia. Now, upon
relinquishing administrative duties, he had time to devote to this group and
did so for the rest of his life. A score of publications appeared, and travel
was undertaken to seek out the foreign species. Especially interesting was
the variety of the asexual expressions, which often proved the only way to
distinguish species of the group. His first publication on this subject dated
from 1926 (Whetzel 1926), followed by 11 taxonomic contributions over
the rest of his life. Fitzpatrick (1945): “Though Professor Whetzel in his
earlier days had directed most of his investigations toward the solution of
economically significant problems in plant pathology, his interests were
always largely mycological, and his work on the Sclerotiniaceae during the last
twenty-five years of his life was unquestionably his major accomplishment in
research.” It was Fitzpatrick who assembled Whetzel’s posthumous last paper.
34 ... Petersen
From his early days in the schools of Avilla, Whetzel was a collector of
biological specimens. This curiosity never left him, and during his later
years he participated in travel, now with a mature outlook and almost always
with one or two companions. Venues included Puerto Rico in 1916, 1924,
and 1931; a sabbatical 1921-22 in Bermuda and return in 1926; 1939 in
Venezuela, all adding to the department herbarium - operating under the
Whetzel numerical system.
Far from withdrawing from departmental activities, Whetzel soon
was appointed a member of “Ihe Committee of Three” (Whetzel, H.C.
Coles, B.M. Duggar, a student of Atkinson and on faculty in the Liberal
Arts Department of Botany) that organized the International Congress of
Plant Sciences (a.k.a. Fourth International Botanical Congress) that met
in Ithaca in August 1926. The Congress brought together mycologists and
plant pathologists with botanists of all other fields. Whetzel was placed in
charge of local arrangements, always a complicated task with little credit. In
1931, he attended the Fifth International Congress in Cambridge, England.
Also in 1931, Whetzel was among the charter members of the Mycological
Society of America, serving as its President in 1939, and the American
Phytopathological Society in 1939. In the same year, Whetzel was widowered
for the second time. Still, his teaching and research went on. Korf (1991)
reported that Whetzel taught the Introductory Plant Pathology course for
the last time in 1943. In 1944, Whetzel died and was buried in Ithaca, his
personal and professional home for 44 years. Eulogies and memorials were
many and sincere (Barrus & Stakman 1945).
Chapter 6. Wrapping it up.
This narrative deals with a sub-science within biology, namely botany, and
two of its even narrower disciplines, mycology and plant pathology. Of these,
every developing society must deal first with plant pathology—the failing of
crops from unknown causes. Once it is established that such failures may be
caused by parasitic organisms (i.e., by the application of Koch's Postulates),
often taking decades, the door is opened for the study of the parasitic organisms
themselves. This, in turn, invites study of similar but non-parasitic relatives—
in the case of this narrative, the fungi, the science of which is mycology. The
narrative opens soon after government (i.e., the Morrill Act of 1862) resolved
to aid higher education in agriculture and mechanical arts, extends through the
Hatch Act of 1887, granting support for state agricultural experiment stations,
turns the century page, and terminates in the first half of the 20". Using the
Four Masters—Prentiss, Dudley, Thomas & Whetzel ...
Whet m7 A Arthas, | Fit natrick
Fic. 6. Herbert Hice Whetzel, Joseph Charles Arthur, Harry Morton Fitzpatrick.
On the steps of Bailey Hall, Cornell University.
Courtesy Cornell Plant Pathology Department (CUP).
example of the four starring workers, a Malthusian explosion of research and
teaching was in place well before World War II.
Farlow returned from Europe in 1874 chastened by the better botanical
preparation of students than that of their American counterparts (Farlow
1876). Student Charles Bessey chafed when a microscope was locked away
from botany students. J.C. Arthur wrote about pumpkin stems and exhibited a
physiological apparatus at the St. Louis World’s Fair. Herbert Whetzel constantly
petitioned administration for more funds with which to equip classrooms with
instrumentation. All these and more trace the growth of laboratory-centered
instruction. Course popularity (and therefore enrollment figures) seemed
directly related, and other sciences followed suit. As though by accretion the
pedagogical movement morphed into the “New Botany.’ By the present day,
the “New Botany’ is an old proposition, largely dusty and overlooked, but the
concept served, and continues to serve, as the basis for almost all college-level
botanical (and therefore mycological and plant pathological) academics. Add to
this the “Socratic” question and answer and the student becomes an investigator
and the professor a consultant (Farlow 1913).
Almost all of the miniature biographies included here show men (sorrowfully,
history does not document an equal role for women) who came from rural
bis)
36 ... Petersen
backgrounds, typically from a farming lifestyle. Were the narrative to deal with
the birth of accounting, the growth of classical music, the growth of the retail
mercantile or progress in architecture, other societal roots might be revealed,
but this is not so here.
Once the members in the narrative graduated from public schools, they
often began a career in local school teaching. Wages were terrible, but there is
a subtle point that after knowledge was personally absorbed, these young men
had an internal urge to share their knowledge with a broader audience. When
public school was insufficient, there came college, and after college, graduate
studies. Ultimately, the urge to teach meant that the accumulated knowledge
was again shared with others, namely (in this case) farmers and new generations
of students. This urge to learn and to share knowledge predates the Common
Era and will continue forward.
Although a strong strain of independence as part of the American society
can be identified, there was an abiding attraction to European culture, not only
for the arts and sophistication but also for the progress and breakthroughs
emanating from the leading laboratories of the Continent. All four stars in the
narrative not only participated, but repeatedly returned to Europe for study
with leading scientific figures and consultations at herbaria, museums, and
international meetings.
Essentially the same evolution can be written about ground transportation
during the period in question. For example, Atkinson’s appointment at Cornell
combined the experiment station in Geneva and the campus in Ithaca, so it was
necessary to travel back and forth. Horsepower was not merely a measurement
of power but a mode of transportation. The distance between the two points
was about 50 miles, easily a two-day trip, with livery stables, eateries, and
lodging necessary. Railroad transportation between the campus and the station
came late in the 19" century and was slow and sooty. The model T Ford was not
readily available until after 1910, and roads were constantly ill-tended and tires
questionable. Progress in plant pathology research depended to some extent on
other societal progress apace.
Of the four stars in the narrative, three lived almost to an age normal for
that era: Dudley to 70, Whetzel to 67, and Prentiss to 66. Only Thomas died
prematurely at 46. These days (2020—pre-pandemic), all could have expected
an additional 15-20 years, and Thomas 30.
Although Wabash College is featured here, the role of the small liberal arts
college has remained clear, whether as a terminal degree or, here emphasized,
preparation for graduate studies. During my own college years, we were
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 37
reminded of the value of connections with alumni, just as Mason Thomas
made use of his Cornell years and his teacher George Atkinson and ex-student
Herbert Whetzel for the benefit of his students. (see Fic. 6)
In 1880 (Anonymous 2020a), New York State established its Agricultural
Experiment Station in advance of the 1887 Hatch Act and Michigan (1888)
soon followed suit. They were not the first, but after 1887 and the Hatch Act,
numerous other states took the federal scrip so within a decade several such
stations existed, almost always part of land-grant universities. The growth
and sophistication of research over the subsequent 140 years—including
all mechanical/technological advances, from tractors, irrigation, fertilizers,
drones, and reapers to soil science, computers and DNA sequence technology—
have not only fed the nation but much of the world.
Acknowledgements
Two reviewers of the pre-submission manuscript, Dr. Amy Rossman and Dr. Don
Pfister, were solicited for their erudition and their connections to Cornell University.
Both served well, with numerous comments and additions. Don, especially, introduced
the evolution of the “New Botany” and laboratory-centered learning. As usual, both
editors of Mycotaxon, Dr. Lorelei Norvell and Dr. Shaun Pennycook, were patient with
this sizeable paper, lending numerous editorial and substantive suggestions. Several
on-line search engines made the literature search accessible.
Literature cited
Anonymous. 1896 (Sept.). Albert Nelson Prentiss. The Cornell Daily Sun, Vol. 17, No 2: 25.
Anonymous, 1912a. Mason Blanchard Thomas. Proc. Indiana Acad. Sc. 1911: 4-5.
Anonymous. 1912b. Mason Blanchard Thomas. Wabash College Record 10: 1-54.
Anonymous. 1913. Dudley Memorial Volume (with portrait). Leland Stanford Junior University
Publications, University Series. 32 p. (with portrait) List of Cornell University pupils of
Professor Dudley. + Dudley bibliography. http://trees.stanford.edu/PDF/DudleyMemorial.pdf
Anonymous. 2020a. Scientific investigation: A history of the New York State Agriculture
Experiment Station. (retrieved June, 2020) https://genevahistoricalsociety.com/wp-content/
uploads/2014/03/experiment-station-panels.pdf
Arthur JC. 1880. Stem of pumpkin for teaching. Bot. Gaz. 5: 33-35. https://doi.org/10.1086/325340
Arthur JC. 1885. Some botanical laboratories of the United States. Bot. Gaz. 10: 395-406. https://
doi.org/10.1086/325866
Atkinson GF. 1896a. Albert Nelson Prentiss. Science 4(93): 523-524. https://doi.org/10.1126/
science.4.93.523
Atkinson GF. 1896b. Albert Nelson Prentiss. Bot. Gaz. 21: 283-289. https://doi.org/10.1086/327352
Barrus ME. 1954. An account of the extension work conducted by the Department of Plant
Pathology of the New York State College of Agriculture at Cornell University from its beginning
until 1945. Plant Pathology Department, Cornell University. 402 p.
Barrus MF, Stakman EC. 1945. Herbert Hice Whetzel. Phytopathology 35: 659-670. [with photo
portrait & list of publications]
38 ... Petersen
Beal WJ. 1879. The New Botany: A lecture on the best method of teaching the science. In: EA
Bessey. 1925. William James Beal. Bot. Gaz. 79: 103-106. https://doi.org/10.1086/333443
Beal WJ. 1908. The College in 1870. In: TC Blandell [ed.], Semi-centennial celebration of Michigan
State Agricultural College: May twenty-sixth, twenty-ninth, thirtieth and thirty-first, nineteen
hundred seven. East Lansing: The College.
Bessey CE. 1880a. Botany for high schools and colleges. New York: Henry Holt and Company.
https://doi.org/10.5962/bh1.title.55136
Bessey CE. 1880b. A Sketch of the Progress of Botany in the United States in the Year 1879. Amer.
Nat. 14: 862-870. https://doi.org/10.1086/272674
Bessey CE. 1881. Botany for high schools and colleges. 3rd rev. ed. New York: Henry Holt and
Company. https://doi.org/10.5962/bh1. title.55136
Bessey CE. 1882. The Asparagus stem for laboratory study. Amer. Nat. 16: 43.
Bessey CE. 1884. The essentials of botany. New York: Henry Holt and Company. https://doi.
org/10.5962/bh1.title.57027
Bessey CE. 1885. The younger school of botanists. Amer. Nat. 19: 73-74. https://doi.
org/10.1086/274022
Bessey CE 1913 Some of the next steps in botanical science. Science, N.S. 37: 1-13.
Boothroyd CW. 1982. Charles Chupp: extension plant pathologist. Ann. Rev. Phytopath. 26: 41-47.
https://doi.org/10.1146/annurev.py.20.090182.000353
Colman GP. 1963. Education & agriculture: a history of the New York State College of Agriculture
at Cornell University. Ithaca, N.Y.: Cornell University. Accessed through eCommons@Cornell,
http://hdl.handle.net/1813/10733
Cooke WB. 1956. The fungus collection of William Russel Dudley. Contributions from the Dudley
Herbarium 5(1): 23-35.
Estey RH. 1994a. A history of mycology in Canada. Canad. J. Bot. 73: 751-766. https://doi.
org/10.1139/b94-095
Estey RH. 1994b. Essays on the early history of plant pathology and mycology in Canada. McGill-
Queen’s University Press, Montreal. 383 pp.
Farlow WG. 1876. University instruction in botany. Amer. Nat. 10: 287-295.https://doi.
org/10.1086/271652
Farlow WG. 1913. The change from the old to the new botany in the United States. Science 37: 79-
86. https://doi.org/10.1126/science.37.942.79
Fitzpatrick HM. 1945. Herbert Hice Whetzel. Mycologia. 37 (4): 393-413. https://doi.org/10.1080
/00275514.1945.12024001
Goodale GL. 1879. Guides for science teaching. II. Concerning a few common plants. Boston
Society for Natural History.
Green JR. 1967 (reissue of 1909). A history of botany 1860-1900: being a continuation of Sachs
“History of botany, 1530-1860.” New York: Russell & Russell. https://doi.org/10.5962/bhl.
title.28456
Hesler LR. 1975. Biographical sketches of deceased North American mycologists including a
few European mycologists. MSS, unpaged. [Special Collections, library of the University of
Tennessee, Knoxville
Jacobsen BJ, Burrows ME, Ong KL. 2008. Extension plant pathology: Bringing our science
to the public, a century of progress. Online. APSnet Feature https://doi.org/10.1094/
APSnetFeature-2008-0508
Jones LR. 1922. Whetzel resigns headship - deplores present system of administrative tenure.
Phytopathology 28: 257-269.
Four Masters—Prentiss, Dudley, Thomas & Whetzel ...
Kent GC 1979 Important little-known contributors to plant pathology: Mason Blanchard Thomas.
Ann. Rev. Phytopathology 17: 21-28.
Korf, RP. 1991. An historical perspective: Mycology in the departments of Botany and Plant
Pathology at Cornell University and the Geneva Agricultural Experiment Station. Mycotaxon
40: 107-128.
Lloyd CG. 1920. Joseph Charles Arthur. Mycological Notes (No. 62). Cincinnati, Ohio. p. 904.Mllis,
WA 1912 Memorial Issue. Wabash College Record 10: 49.
Newhall AG. 1980. Herbert Hice Whetzel: Pioneer American plant pathologist. Ann. Rev.
Phytopath. 18: 27-36. https://doi.org/10.1146/annurev.py.18.090180.000331
Olive EW. 1902. A monograph of the Acrasiae. Proc. Boston Soc. Nat. Hist. 30(6) 451-513.Pegg EC,
Thomas NS. 1909. The woodlot for central Indiana. Proc. Indiana Acad. Sci.25: 1-21.
Petersen RH. 1979. Lexemuel Ray Hesler. February 20, 1888 - November 20, 1977.Mycologia 70:
757-765.https://doi.org/10.1080/00275514.1978.12020281
Petersen RH. 2019. North American mycology comes of age: the 19th century participants and
their roles. Mycotaxon 134: 1-110. https://doi.org/10.5248/134.1
Pfister DN 2010 Asa Gray and the Harvard summer school. Harvard Papers in Botany 15(2): 305-
308.
Pool RJ. 1934-35. The evolution and differentiation of laboratory teaching in the botanical sciences.
Iowa State Col. J. Sci. IX: 235-242.
Reddick D. 1919. Vern Bonham Stewart. Phytopathology 9(3): 111-113.
Rochow WE, Tyler LJ, Miller RL. 1983. Walter Hagemeyer Burkholder. http://ecommons.ibrary.
cornell.edu/handle/1813/17813
Rudolph F. 1977. Curriculum: a history of the American undergraduate course of study since 1636.
San Francisco: Jossey-Bass.
Stewart VB. 1913. The fire blight disease in nursery stock. New York Cornell Agr. Exp. Stat. Bull.
329: 316-372. https://doi.org/10.5962/bhl.title.36996
Sundberg MD. 2011. Botanical education in the 1880s and 90s. Part 1, The impact of Linnaeus and
the foundations of modern pedagogy. Pl. Sci. Bull. 57(4):134-158.
Sundberg MD. 2012 Botanical education in the 1880s and 90s. Part 2: The nineteenth century
botany for the masses vs. professionalization of botany. Pl. Sci. Bull. 58(3): 104-131.
Sundberg MD. 2014 Botanical education in the 1880s and 90s. Part 3, The Botanical Society builds
the discipline, 1895-1960. Pl. Sci. Bull. 60(1): 28-61.
Thomas CC. 1924. The Chinese Jujube. USDA Department Bull. 1215. 48 p. https://doi.org/10.5962/
bhl.title. 109053
Thomas MB, Dudley WR. 1894. A laboratory manual of plant histology. Crawfordsville, IN. x +
115 + 15 pls.
Whetzel HH. 1918. An outline of the history of phytopathology. W.B. Saunders. Philadelphia,
London. https://doi.org/10.5962/bhI.title.55666
Whetzel HH. 1926. North American species of Sclerotinia. Mycologia 18: 224-235. https://doi.org/
10.1080/00275514.1926.12020514
Whetzel HH. 1929. The terminology of phytopathology. Proc. International Congress Plant Science.
2: 1204-1215. Whetzel HH. 1930. An experiment in teaching. Scientific Monthly 31: 151-162.
Whetzel, H.H. 1930 An experiment in teaching. Scientific Monthly 31: 151-162.
Whetzel HH. 1945. The history of industrial fellowships in the Department of Plant Pathology at
Cornell University. Agricultural History 19(2): 99-104. https://pppmb.cals.cornell.edu/about-
us/history/ [Plant Pathology and Plant-microbe Biology Section, School of Integrative Plant
Science. On-line] https://www.wabash.edu/aboutwabash/history [History of Wabash College]
oo
AO ... Petersen
APPENDIX 1.
Notable Prentiss students at Michigan State
Charles Edwin Bessgy (1845-1915). Born: Milton, Wayne County, Ohio. Michigan
State College 1866, B.S. 1869. Intended to be a civil engineer. 1869 Professor
of Natural History, Iowa State College (Ames). Met Asa Gray at AAAS meeting,
went to Harvard — no Ph.D.? 1886, left Iowa State; Chair of Botany at University
of Nebraska. 1891 taught a course WITH LABORATORY at University of Minnesota.
Byron David HALSTED (1852-1918) Born: Venice, NY. Michigan State B.S. 1871, MLS.
1874. 1885-89 Professor of Botany, Iowa State College. 1889 until death, Professor
of Botany, Rutgers College & New Jersey Agricultural Experiment Station.
Samuel Mills Tracy (1847-1920) [data missing from Hesler 1975] Born: Hartford,
Vermont. Union Army. Michigan State Agricultural College: B.A. 1868, M.A.
1871. 1871-77 Horticulture at Michigan State University. 1877 Professor of Botany,
University of Missouri. 1887-88 collaborated with B.T. Galloway who eventually
served briefly as Dean of Agriculture at Cornell. 1888-97, Director of the Mississippi
Agricultural Experiment Station, Starkville.
William Powell Witson (1844-1927), Born: Oxford, Oakland Co., Michigan. Orphaned
when very young, lived and worked on a farm. Entered the State Agricultural
College of Michigan in 1864. In 1873, became assistant to Dr. Goodale at Harvard,
recommended by Asa Gray; B.Sci. 1878, Lawrence Scientific School. Graduate studies
in Europe, 1878-80. Awarded D.Sci., from Tiibingen University (Germany). Upon
return settled in Philadelphia as Professor of Botany, University of Pennsylvania. At
the Columbian Exposition in Chicago, 1893, conceived of economic or commercial
museum for Philadelphia; museum established and Wilson became an international
diplomat.
Four Masters—Prentiss, Dudley, Thomas & Whetzel ...
Appendix 2.
Notable Prentiss students at Cornell University
(Annotated from Atkinson 1896b)
Joseph Charles ARTHUR (1850-1942). Cornell Experiment Station;
Professor of Vegetable Physiology at Purdue University.
Frederick Vernon CovILLE (1867-1937). Chief of the Division of Botany
of the U.S. Department of Agriculture.
William Russel DupLey (1849-111). Professor of Botany
in the Leland Stanford Jr., University.
Romeyn B. HouGu (1857-1924). author of the classic 17-volume
AMERICAN WOobDs.
Joseph Austin HoLMEs (1859-1915). Professor of Botany and Geology at University of
North Carolina; later State Geologist.
William Ashbrook KELLERMAN (1850-1908). Cornell B.S. 1874,
Professor and Department Head of Botany at Ohio State University.
William R. LAZENBy (1850-1916). Professor of Botany then Professor of Horticulture
at Ohio State University. When the biology department was split, Lazenby became
Department Head alongside Kellerman.
Clarence Wentworth MATTHEWS (1877-1928).
Professor of Horticulture and Botany at State College of Kentucky;
First Dean, College of Agriculture; National Bureau of Education during WW I.
Veranus Alva Moore (1859-1931). A bacteriologist at the Bureau of Animal Industry
of the U.S. Department of Agriculture;
Professor of Comparative Pathology, Cornell University;
Dean of the Veterinary College, Cornell.
4]
42 ... Petersen
APPENDIX 3.
Notable Dudley students at Cornell University
Annotated from Anonymous (1913);
* = Also listed by Korf (1991)
* Arthur, Joseph Charles; B.S., M.S., Ph.D.
Professor of Vegetable Physiology and Pathology,
Purdue University, Lafayette, Indiana
*Atkinson, George Francis; B.Phil.
Professor of Botany, Cornell University, Ithaca, New York
Brady, William L.; A.B., A.M., Ph.D.
Professor of Botany, Syracuse University, Syracuse, New York
Chester, Frederick Dixon; B.S., M.S. Bacteriologist;
Director, State Bacteriological Laboratory of Delaware
Corbett, Lee Cleveland; B.S., M.S. Horticulturalist,
Department of Agriculture, Washington, D.C.
Coville, Frederick Vernon; A.B. Botanist,
Department of Agriculture, Washington; Head of the National Herbarium.
Craig, Moses; M.S.; Missouri Botanical Garden, St. Louis.
Densmore, Hiram Delos; A.B., A.M. Professor of Botany, Beloit College.
Durand, Elias Judah; A.B., D.Sci. Professor of Botany,
University of Missouri, Columbia, Missouri.
Gregory, Emily Lorina; A.B. Professor of Botany,
Barnard College, Columbia University, New York.
Henderson, Louis Fournquist; Ph.D. (Formerly) Professor of Botany,
University of Idaho, Moscow.
Hicks, Henry; B.S. Nurseryman, Westbury, Long Island. New York.
Hoffman, Harry Natt; B.Agr. Nurseryman, Elmira, New York.
Hough, Romeyn Beck, A.B. Professor of Forestry, Yale University.
Howell, Jenny Kirk; Ph.D., M.S. Teacher, Plainfield, New Jersey.
*Kellerman, William Ashbrook, B.S., Ph.D. Professor of Botany,
Ohio State University, Columbus.
Lazenby, William Rane; B.Agr., M.Agr. Professor of Forestry,
Ohio State University, Columbus.
Moore, Veranus Alva; B.S., M.D. Director,
New York State Veterinary College, Cornell.
Norris, Harry Waldo; A.B., A.M. Professor of Zoology, Grinnell College
Four Masters—Prentiss, Dudley, Thomas & Whetzel ...
Porter, Edna. Botanical Gardens, Buffalo, New York.
Rowlee, Willard Winfield; B.L., Sci.D. Professor of Botany, Cornell University.
Schrenk, Herrman von; B.S., A.M., Ph.D. Consulting Timber Engineer,
Plant Pathologist, St. Louis, Missouri.
Smith, Theobald; Ph.D., M.D., A.M., LL.D. Professor of Comparative Pathology,
Harvard Medical School, Boston.
Snow, Julia Warner; B.S., M.S., Ph.D. Professor of Botany,
Smith College, Northhampton, Massachusetts.
*Thomas, Mason Blanchard; B.S. Professor of Botany, Wabash College.
*Trelease, William; B.S., Sc.D., LL.D. Director, Missouri Botanical Garden,
St. Louis, Missouri.
White, Charles David; B.S. Geologist, Geological Survey, Washington, D.C.
Yatabe, Ryokichi; B.S. (Late) Professor of Botany, Imperial University, Tokyo, Japan.
The DupLEY MEMoRIAL VOLUME (Anonymous 1913) also includes a list of
Dudley’s notable Stanford University students, a list easily twice as long as his
Cornell students.
43
44 ... Petersen
APPENDIX 4.
Thomas-mentored students to graduate studies
(Annotated from Kent 1979) In order of graduating class
OLIVE, EDGAR WILLIAM (1870-1972) ’93
Edgar William Olive was the first botany student mentored by Mason Thomas
at Wabash (class of 1893). Born in Lebanon, Indiana, Olive taught school in Boone
County in order to pay for attendance at Wabash. After his A.B., he remained, becoming
an assistant to Thomas and receiving an A.M. in 1895. Thereafter, he studied in the
Cryptogamic Laboratory at Harvard University, earning an A.M. in 1897 and a Ph.D.
in 1904. His thesis was “A monograph of the Acrasiae” (Olive 1902). An appointment
at the University of Wisconsin was followed by a similar job at South Dakota State
College. In 1916, Olive was appointed as Head of the Botanic Gardens at the Brooklyn
(NY) Institute. A “second life” began in 1920 when he joined his brother in the family
accounting firm in Indianapolis, Indiana. At the age of 80, he moved to Florida to join
an investment and real estate project. Celebrated as the oldest Wabash alumnus at age
100, Olive died in Indiana.
Moore, GEORGE THOMAS (1871-1958) 794.
George Thomas Moore was born in Indianapolis, Indiana. With Olive and Miller, he
was among the earliest botanical students of Thomas at Wabash. In addition to Wabash
(A.B., class of 1894), Moore received a B.A., M.A., and Ph.D. from Harvard and became
Director of the Missouri Botanical Garden (from 1912-53; founded in 1914) and
Engelmann Professor in the Henry Shaw School of Botany of Washington University.
During 1909-19, he was Head of Botany at the Marine Biological Lab at Woods Hole,
M.A. There he joined Jake Schramm, also a Wabash grad, and during summers, Mason
Thomas from Wabash and Thomas’ student, Lex Hesler.
MILLER, ROBERT BARCLEY (1875-POST 1948), 96
Together with George Moore and Edgar Olive, Robert Barcley (“Dusty”) Miller—
born in Lincoln, Nebraska but educated in Thornetown, Indiana—was an early Thomas
student at Wabash (class of 1896). Armed with the A.B. degree, Miller was Assistant
Principal of Thornetown High School in 1897-1898, becoming Professor of Natural
Science at Rochester Normal School in 1899. There followed appointments at Dakota
Wesleyan College and Huron College, both in South Dakota. He received an honorary
M.A., also from Wabash, in 1906. Later that year, Miller enrolled in graduate studies at
Yale’s Sheffield Scientific School and was granted a Ph.D. in 1908. In 1909, he gained
the position as Dean of Forestry, University of New Brunswick, Canada, but in 1914,
became one of the earliest workers with the Illinois Natural History Survey. By 1929,
Miller was listed as Chief Forester, Illinois Department of Agriculture.
Hoo BLer, B. RAYMOND (1872-1943) 01
B. Raymond Hoobler stayed for a Master’s Degree in 1902 before attending Cornell
Medical School (M.D. 1905). Only 11 years out of Wabash, he was at Thomas's bedside
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 45
during Thomas's last days. Serving at several leading hospitals, Hoobler became Chief
of Medicine at Children’s Hospital and Professor of Pediatrics at Wayne State University,
Detroit, Michigan.
WHETZEL, HERBERT HICE (1877-1944) 02
Born in Avilla, in the upper east corner of Indiana, Herbert Hice Whetzel became a
formidable, albeit controversial, force in plant pathology. In Avilla’s secondary schools,
he was several years ahead of Harry Fitzpatrick (q.v.) whose future Whetzel greatly
influenced. As a student at Wabash, Whetzel lived with Professor Thomas's family
and so had ample time to absorb the Thomas magic. Using contacts from his student
days at Cornell, Thomas arranged for Whetzel to become a summer assistant to G.F.
Atkinson at Cornell, and that summer Whetzel, Atkinson and Atkinson's student,
Calvin H. Kauffman collected fungi together. Once the Cornell attachment was made,
it was never broken and Whetzel served as Professor in Atkinson's Botany Department
and eventually as Head of the new Plant Pathology Department until 1922. The events
of this time period deserve a more detailed description (see the narrative), but one of
Whetzel’s innovations was establishment of “Industrial Fellowships” through which the
agriculture industry supported phytopathological research to the benefit of the industry,
to Cornell and to the supported students, including subsequent Thomas students from
Wabash.
Germane to the outline of Whetzel’s role in Cornell (and national) plant pathology,
Whetzel was hired at Cornell by Liberty Hyde Bailey, the idealist humanist sociologist
of rural living and Dean of the newly established New York School of Agriculture at
Cornell University. Bailey was a bit of a “radical missionary,’ essentially devoting
his life to the distribution of technical education to the masses of farm-oriented
professions. His evangelism was replaced when new mechanization of disease control,
soil improvement, and other aspects of farming resulted in over-production of crops.
Family farms could prosper under these new and changing technologies. In 1913, Bailey
resigned his position as Dean of the College of Agriculture and devoted the rest of his
life to research, largely a taxonomic study of palms. It could be surmised that Bailey and
Whetzel supported each other philosophically and enthusiastically.
RECORD, SAMUEL JAMES (1881-1945) 03
A local boy from Crawfordsville, Indiana, Samuel James Record attended Wabash
College, obtaining a B.A. (1903), M.A. (1906), and honorary D.Sci. (1930). A bit
of a pioneer, Samuel was one of the first Thomas protégés to enroll at Yale School of
Forestry, earning a Master's degree in 1905. After a stint with the U.S. Forest Service in
Arkansas and Ozark National Forests, Record returned to Yale. In 1912, he published
the first of his significant books, ECONOMIC WOODS OF THE UNITED STATES, followed by
MECHANICAL PROPERTIES OF WOOD in 1914. Both books went through second editions
and became standards in the fields, with scanned versions available even now in 2020.
A career of field trips over the world produced a large collection of wood samples and
an encyclopedic knowledge of timber woods. By 1917, Record was a full Professor of
Forestry, and in the 1920s founded both the International Society of Wood Anatomists
46 ... Petersen
and the journal TRopicaL Woops. In 1945, he was placed in charge of tropical forestry
and in 1939 was appointed Dean of the School of Forestry. Record was associated with
Yale until his death.
FUNKHOUSER, WILLIAM DELBERT (1881-1948) 705
William Delbert Funkhouser became a well-respected zoologist and anthropologist.
Born in Rockport, Indiana, he graduated high school in Indianapolis before entering
Wabash College. Although known as a practical jokester, he was a member of Phi Beta
Kappa and graduated with honors. After three years teaching in high schools, he entered
Cornell’s Zoology Department, earning an M.A. (1912) and Ph.D. (1916; dissertation:
BIOLOGY OF THE MEMBRACIDAE OF THE CAYUGA LAKE Basin). During these years he
also taught in Ithaca High School. An extra year was spent at Cornell as an “Honor
Fellow,’ but in 1918, Funkhouser was appointed as Head of the Department of Zoology
and Entomology at the University of Kentucky in Lexington. Several long-distance field
trips, correspondence with appropriate authorities, and receipt of worldwide specimens
of tree hoppers established Funkhouser’s career, but opportunities were soon presented
that quickly evolved into a parallel career in archeology, especially of Ancient Man in
Kentucky. In 1925, Funkhouser was elevated to Dean of the Graduate School, a job
which cut into his research time. In 1942 he served as president of the Entomological
Society of America. He remained as Dean until shortly before his death of lung cancer
in 1948.
REDDICK, J. DONALD (1883-1955) 05
In spite of being born in Missouri, J. Donald Reddick graduated from Wabash
College in Indiana. He entered Cornell before the separation of the College of Liberal
Arts and the New York State College of Agriculture. This distinction was to play a
key role in Reddick’s career. In the botany department he was an Assistant to Dr.
George FE. Atkinson who served as his major professor for the Ph.D. degree in 1909. In
1907, however, he was appointed the first Instructor in the new Department of Plant
Pathology. According to Korf (1991): “[Reddick’s] early duties at Cornell included the
teaching of formal undergraduate courses in principles of plant disease control and the
instruction of graduate students in the field of mycology and in methods in the study
of plant diseases.” In this way, Reddick reported to both Atkinson and Whetzel, but
Whetzel retained Reddick in the new Plant Pathology faculty.
Reddick became well-known for his investigation into potato diseases. More
particularly, recent research had indicated that the cultivated potato had its origins in
Mexico, so Reddick travelled there to retrieve “primitive” stocks leading to hybridization
experiments and resistance to common diseases. In those years Reddick also served as
Editor of PHyTOPATHOLOGY (1915-18), President of the American Phytopathological
Society (1920), and Secretary of the Plant Pathology Section of the International
Botanical Congress at Ithaca (1929).
Although tangential to this narrative, during 1918-21 the Plant Pathology faculty
grew impatient with Whetzel’s administrative style, festering a schism until 1922,
when Whetzel stepped away from the headship (to be succeeded by Massey). It was
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 47
Korf’s (1991) opinion: “Then there was Donald Reddick, a potato breeder, and
internationally known pathologist and the purported ringleader of the revolt against
Whetzel’s chairmanship that rocked the department in the early 20's” Through it all,
Reddick remained in place, rising from Assistant Professor to Associate Professor to
Full Professor until his retirement in December 1950, five years before his death in
Gainesville, Florida.
STEWART, S.S. 06
I can find no record of “S.S. Stewart “06” other than the listing by Kent (1979).
RuTH, WARREN ALBERT (1884-19xXxX) 06
Another Hoosier, Warren Albert Ruth was born in Mishawaka, Indiana, in the very
north of the state. His fellow graduate was another Prof. Thomas student, class of 1906,
S.S. Stewart. After obtaining an M.A. in pomology from Wabash in 1909, Ruth was
hired by the University of Illinois Agricultural Experiment Station (Urbana) where he
received his Ph.D. in 1919 from the University. His fate through WW Tis not known, but
Ruth stayed on the staff of the Illinois Station and also became an Assistant Professor in
Agriculture at the University. His later years could not be ascertained.
BARRUS, MORTIMER FRANKLIN (1879-1962) ’07
Born in Forestville, Chautauqua Co., NY, Mortimer (a.k.a. Mortier) Franklin Barrus
was listed in the U.S. Census as still living with his mother at 21 years old. An older-
than-usual graduate of Wabash in 1907, Barrus came to Cornell just when the Plant
Pathology Department was established and before the time of “Industrial Fellowships’
He obtained a Ph.D. degree in Plant Pathology, and remained at Wabash for the rest of
his career as Professor of Plant Pathology and as Extension Professor of Plant Pathology,
specializing in field crop diseases from beans to potatoes (Barrus 1954). Publications
continued into the 1940s and 50s. In a historical summary of extension plant pathology
(Jacobsen & al 2008): “The first officially appointed extension plant pathologists were
R.E. Vaughan at Wisconsin and M.F. Barrus at Cornell in 1915. However, it should be
pointed out that Dr. Barrus had already been appointed Assistant Professor of extension
work on September 20, 1911 at the New York State College of Agriculture.” Perhaps
Barrus’s most noticed publication was THE PotaTo with fellow Cornellian, AW Gilbert
in Plant Breeding, published by McGraw Hill as part of a pioneering series of such
books. Korf’s (1991) comment: “M.F. Barrus, a gentle, delightful man, had worked with
diseases of beans, potato, and fruit.” Barrus was an early President of the American
Phytopathological Society in 1928.
ANDERSON, HARRY WARREN (1885-1971) 07.
Harry Warren Anderson was born in Ladoga, Indiana and buried in Crawfordsville.
His brother, Paul, followed at Wabash, class of 1910. Harry remained at Wabash as an
instructor from 1908-10, and after a brief sojourn at the University of Illinois, returned
to Wabash as Rose Professor and Head of the Department of Botany, succeeding his
mentor, Mason Thomas. In 1916, he returned to the University of Illinois and was
Associate Professor of Pomology and later Professor of Plant Pathology. As late as 1956,
48 ... Petersen
Harry Anderson published DIsEASES OF FRUIT CROPS through McGraw Hill. Harry’s
son, Phillip W. Anderson, won the Nobel Prize in Physics in 1977.
DORNER, HERMAN BERNARD (1878-1955) ex 08
Herman Bernard Dorner was born in Lafayette, Indiana, of parents who were
prominent carnation breeders and ran a greenhouse. Unlike the others in this roster,
Dorner earned his B.S. at Purdue University in 1900, and an MLS. in 1901. In 1905 he
was a Botany Assistant at Purdue and an Assistant at Indiana State College, but in 1906-
07 he became Assistant Professor of Botany at Wabash. In 1907, he co-authored A KEY
TO THE GENERA OF NATIVE FOREST TREES AND SHRUBS OF INDIANA. Author of several
popular articles on flower growing (especially carnm 9-lo[pOations), he was a founder
of “Flowers by Wire,’ the florists’ telegraph delivery. By 1911, Dorner was an Associate
Professor in Floriculture at the University of Illinois and its Agricultural Experiment
Station. Dorner retired in 1946 as Professor of Floriculture at Illinois.
PRICE, EARL ’09
Unfortunately, essential data on Earl Price (Wabash 1909) are missing. Conflicting
sources report: [1] 1915. Earl Price, Harrisburg, Illinois, county agent. [2] 1916 Earl Price,
school teacher of agriculture in Valparaiso, Indiana. [3] 1964. “Dean” [of Agriculture]
Earl Price of Oregon State, witness at House ([of US Representatives] Committee on
Appropriations. Perhaps the first report is correct
STEWART, VERN BONHAM (1888-1918) 09
Vern Bonham Stewart was another Hoosier born in Avilla, Indiana (see also
Whetzel, Weimer). After graduation from Wabash he spent the summer supported by an
“Industrial Fellowship” sponsored by the C.W. Stuart [nursery] Co. of Orleans, NY, after
which he entered Cornell Plant Pathology, already with the title of Fellow. His Ph.D. was
earned in 1913, and he joined the staff at the Cornell Agricultural Experiment Station.
His thesis (and publication; Stewart 1913) was on the fire blight disease of nursery stock.
He remained a frequent author of plant pathology papers and remained on the staff
through June 1918. He accepted an appointment at the “Bureau of Plant Pathology”
in Washington. In December 1918, in Newark, NJ, he died of pneumonia (probably a
complication of the “Spanish flu”), leaving a wife and infant daughter (Reddick 1919).
PEGG, ERNEST CECIL (1888-19xx) 09
Essential data are also missing for Ernest Cecil Pegg (Wabash 1909), winner of that
years Eastman Prize. Born in 1888 in Fountain City, Indiana, Pegg was interested in
forestry as an undergraduate. In his senior year, Pegg and fellow student N.S. Thomas
(Pegg & Thomas 1909) published in the PROCEEDINGS OF THE INDIANA ACADEMY OF
SCIENCE. Upon graduation he spent three months “timber estimating” in Tennessee
before attending Yale Forestry School, graduating in 1911. After a year with the US.
Forest Service at Jemez National Forest in New Mexico, he joined the one-man faculty
at the University of Missouri Forestry School. He was immediately put in charge of
establishing the “summer camp” in forestry. In 1919 he resigned his Missouri post, and
the Department of Forestry was abolished a year later. At this point the trail peters out.
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 49
In 1912, Pegg was married in Crawfordsville, Indiana, to Ruth Amanda Hesler,
daughter of Benton F. Hesler. Considering that Lex Hesler’s tenure at Wabash ended in
1911, the match may not have been coincidental.
FITZPATRICK, HARRY MorRTON (1886-1949) ex 09
Born in Greenwood, Indiana, Harry Morton Fitzpatrick attended high school in
Crawfordsville where he became acquainted with Herbert Whetzel, then a student
at Wabash. Fitzpatrick entered Wabash College, 1905, where Mason Thomas was his
mentor. Aided by Thomas and Whetzel (by that time a graduate student at Cornell),
Fitzpatrick transferred to Cornell in 1908 to become an assistant to George Atkinson
(in Botany). He received his A.B. from Cornell in 1909 and continued on to graduate
school as Assistant in Plant Pathology and later as Instructor. His Ph.D. was awarded
by Cornell in 1913. By then Whetzel was Head of the new Plant Pathology Department
and Fitzpatrick was immediately appointed Assistant Professor, with duties to teach
mycology, which developed into a full-year course. Lex Hesler knew Fitzpatrick well,
for they overlapped for some years at Cornell. Of Fitzpatrick, Hesler (1975) wrote: “Two
characteristics of the man stood out in my memory: he was an unusual scholar and
teacher; and he was a recluse.”
According to Hesler: “Fitzpatrick was highly respected by other mycologists, but
only a few knew him well. He was quiet, and often seemed dubious of the sincerity
of some individuals. Through poor health and brooding over the suicide of a favorite
son, Fitzpatrick himself took his own life in December 1949.” Korf (1991) included
reminiscences of Fitzpatrick (aka “Prof. Fitz”), who was Korf’s major professor: “He
was often considered morose, but in fact had a deep sense of humor, though he could
often be put off. He was said to have been champion at pitching pennies in the hallways,
a departmental pastime in which he is reputed to have relieved many a graduate student
of his (her) horde of pennies.” Also reputed to be competent on the tennis court,
Fitzpatrick shared his energy in service appointments; he was one of the founders of
the Mycological Society of America (1931) and its President in 1936. He was also its
Historian and wrote of its early times (Fitzpatrick 1924).
Korf (1991): “On founding the Plant Pathology department Whetzel understandably
sent all the plant pathology students down to the Arts College to take their mycology
from Atkinson, but Atkinson’s greater and greater preoccupation with the agarics led
to a somewhat distorted course offering. When Harry M. Fitzpatrick, who while at
Wabash had been thoroughly indoctrinated and encouraged by Whetzel, completed
his doctorate under Atkinson in 1912, Whetzel installed him in the Plant Pathology
department to teach mycology.”
As mentioned by Petersen (2019) and others (e.g., Hesler 1975), there was bad
blood between G.F. Atkinson and Curtis Gates Lloyd. In 1920, Lloyd came to Ithaca
to visit his nephew, but Atkinson shunned him. As told by Korf (1991): “Fitzpatrick
heard that Lloyd was in town, contacted him, and invited Lloyd to lecture to his students
and accompany them on a number of field trips in the area. Fitzpatrick’s kindnesses,
and for Lloyd perhaps unexpected ‘acceptance’ in academia, led Lloyd to purchase,
unbeknownst to anyone in the Department, three major collecting grounds, which he
50 ... Petersen
then gave to the University. These are now called the Lloyd-Cornell Preserves...to this
day some of the best areas in which to collect fungi within a 50 km radius of Ithaca.”
TAYLOR, CLARENCE EGBERT (1886-1971) 710
Clarence Egbert Taylor was born in Anthony, Kansas, but the family moved to
South Bend, Indiana, when Taylor was still very young. After graduation from South
Bend High School, Clarence entered Wabash College and subsequently Yale School of
Forestry, receiving a Master's Degree in 1912. That August, Taylor was in the U.S. Forest
Service at Plumas National Forest, northeastern California, headquartered in Quincy.
That forest included Mt. Shasta and the northern terminus of the Sierra chain. In 1913 he
was loaned to the Pennsylvania Chestnut Blight Commission, but soon was transferred
to Pine Mountain National Forest in west-central Georgia (established 1906). By 1921-
22, Taylor was listed as “forest examiner” at Cochetopah National Forest, Colorado.
All three of these national forests were established during the presidency of Theodore
Roosevelt as part of his conservation program. Further data on Taylor are missing.
ANDERSON, PAUL JOHNSON (1884-1971) 710
A product of Lodoga, Indiana, Paul Johnson Anderson (Wabash 1910), younger
brother to Harry Anderson (q.v.) was appointed to one of Whetzel’s “Industrial
Fellowships” for 1910-11 and was awarded a Ph.D. by Cornell University Plant
Pathology in 1913. His thesis was THE MORPHOLOGY AND LIFE HISTORY OF THE
CHESTNUT BLIGHT FUNGUS. His early career was at the Massachusetts Agricultural
Experiment station (of Massachusetts Agricultural College) but by 1926 he was on staff
at the Connecticut Agricultural Experiment Station, headquartered in new Haven. He
became Pathologist in Charge, Connecticut Tobacco Experiment Station (at Windsor,
CT) where he stayed until retirement to Florida. Perhaps tellingly, Anderson is buried
in Amherst, Massachusetts.
Davis, ELMER E. (dates unknown)’ 10
Elmer E. Davis spent much of his career at the American Type Culture Collection
and was publishing on fungi as late as 1976.
RANKIN, WILLIAM Howarp (1888-19xx) 710
William Howard Rankin proceeded to Cornell Plant Pathology for a Ph.D. in 1912.
By 1912 he was publishing on chestnut canker disease and in 1918 wrote A MANUAL OF
TREE DISEASES, the second book in a series on tree pathology from MacMillan Co. In the
preface, Rankin thanked several Cornell colleagues among whom were other Wabash
graduates. The book was popular enough to see a second printing in 1923. In 1920, ina
popular Cornell journal there appeared the following: “Dr. William H. Rankin, for the
last five years assistant professor of plant pathology, has been appointed officer in charge
of the field Laboratory of Plant Pathology of the Canadian Department of Agriculture,
with headquarters at St. Catherine, Ontario, and has entered upon his duties.” Two
histories of Canadian plant pathology and mycology (Estey 1994a,b) cite Rankin as
one of a few forest pathologists dealing with Canadian fir. By 1925, Rankin was back at
Cornell, but this time at the Geneva Experiment Station. That year, Rankin collaborated
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 51
with other Cornell colleagues on a second edition of LABORATORY OUTLINES IN PLANT
PATHOLOGY (“Second edition, completely revised and rewritten”). In 1933, Rankin was
second author on a paper on raspberry growing in New York State.
REES, H.L. (dates unknown) ’10
H.L. Rees was one of several Thomas students in Thomas’ later time at Wabash.
Oddly, Rees was reported at Cornell University Plant Pathology in 1910, where he
replaced C.N. Jenson as an assistant, but later in 1910 he was Plant Pathologist at the
Oregon State College Agricultural Experiment Station, Corvallis, where he wrote the
annual report for the Department of Plant Pathology. A note in Mycologia in 1913:
“Mr. H.L. Rees has moved to the Western Washington Experiment Station, Puyallup.”
There he published 11 papers in seven years (1913-20) but at that point his biographic
material runs out. Much essential information is missing.
SCHRAMM, JACOB RICHARD (1885-1976) 710
A Hoosier from Hancock Co., Indiana, Jacob (“Jake”) Richard Schramm not only
graduated from Wabash but continued his interaction with Thomas and other Wabash
academics for years. Schramm’s botanical career started at Washington University (St.
Louis) where he earned a Ph.D. in 1913. For a decade, he taught at Cornell in the Botany
Department (not Plant Pathology). As an independent investigator during these years
Schramm spent summers at the Marine Biology Station at Woods Hole, Massachusetts,
where Mason Thomas and G.T. Moore also worked. Thomas brought later students with
him, always on some sort of grant arranged by Schramm (or Herbert Whetzel; q.v.),
among whom was Lex Hesler. G.T. Moore moved to St. Louis to become Professor of
Botany at George Washington University. Moore was so impressed by Schramm that
he had him appointed as a 3-year Lackland Fellow at George Washington, and when
Moore took directorship of the Missouri Botanical Garden, Schramm became his chief
assistant. His later address was St. Louis Botanical Garden and Washington University
(St. Louis), but for the rest of his career he was Professor of Botany at the University of
Pennsylvania (1937-55) and also Director of the Morris Arboretum (1939-54). He was
one of the founders of Botanical Abstracts and served with G.T. Moore on its Editorial
Board. In retirement, Schramm was a Research Scholar at the University of Indiana.
HESLER, LEXEMUEL Ray (1888-1979) 711
Of the considerable roster of Wabash graduates covered here, Lexemuel (“Lex”) Ray
Hesler is the only worker for whom too much information is presently available. Born
in Veedersburg, Indiana, in 1907 the Hesler family moved to Crawfordsville, Indiana,
coincident with Lex’s entrance into Wabash. Among his new college friends were Jacob
Schramm (q.v.) and Harry and Paul Anderson (q.v.) all destined for graduate work
proposed by Mason Thomas, their mentor. Even before graduation from Wabash, Hesler
worked on one of Whetzel’s “Industrial Fellowships,’ this one from apple growers in
New York State. The fellowship was to be extended through his graduate school career.
Upon receipt of his Cornell Ph.D. in 1914, Hesler was retained on the faculty until 1919,
when he moved to the University of Tennessee as Professor of Botany and Department
Head. It was difficult to make a living on the wages of nine-month appointments, and
52 ... Petersen
for more than a decade of summers Hesler worked for the U.S.D.A. in wheat-rust
eradication survey and potato disease survey, both in the Washington office and New
England, Wyoming, the Gulf states. and Mayaguez, Puerto Rico.
In 1934, a disastrous fire incinerated the University of Tennessee botany department
physical plant, including an 8000-specimen fungal herbarium, a large reprint collection,
notes and manuscripts, all largely plant pathological. In the aftermath, Hesler turned his
interest to the abundant fleshy fungi in the Great Smoky Mountains and later in 1934,
he was appointed Dean of the College of Liberal Arts. Just before and after retirement
in 1958, several major North American floristic monographs of agaric genera were
published, mostly co-authored with Alexander H. Smith, the reigning North American
agaric authority of the time.
JENNISON, HARRY MILLIKEN (1888-1940) 711
Harry Milliken Jennison, from Worcester, Massachusetts, received his A.B. from
Massachusetts State College at Amherst (class of 1908) but his A.M. from Wabash
College (class of 1911). Like Jake Schramm before him, Jennison studied at Washington
University, St. Louis, earning a Ph.D. in 1922. Art Stupka (1905-99) wrote of Jennison:
“Harry Milliken Jennison was associated with the University of Tennessee from 1922
until his death in 1940. He was given a two-years’ leave of absence from his teaching
duties in the Department of Botany, beginning in 1935, during which time he served in
the Great Smoky Mountains National Park as a wildlife technician under the Civilian
Conservation Corps; his chief duties were the collection, identification, and preparation
of plant specimens.”
“During the summers of 1938 and 1939 Jennison served in the Park in the capacity
of ranger-naturalist. In 1938 he prepared A CLASSIFIED LIST OF THE TREES OF GREAT
SMOKY MOUNTAINS NATIONAL PARK.” Jennison’s association with Tennessee included
the disastrous fire of 1934, which destroyed the department's entire space, including the
herbarium.
OsNER, GEORGE ADIN (1888-1964) *11
Like several others in this roster of “Wabash Boys,’ data on George Adin Osner is
sparse after his early career. Born in Madison, Indiana, on the Ohio River, Osner’s time
at Wabash was concurrent with that of Hesler and Jennison. Moreover, like Hesler, in
1911, Osner was bound for Cornell Plant Pathology on one of Whetzel’s “Industrial
Fellowships” which actually extended through 1913. At Cornell he was listed under
plant pathology, agricultural chemistry and economic entomology with professors
Whetzel, Cavanaugh, and Herrick. The next year, his advisors changed to Reddick,
Bennett, and Herrick. In 1915 he received his Ph.D. from Cornell. His thesis was “Leaf
smut of timothy,’ published as EXPERIMENT STATION BULLETIN 381. But another
event also required his attention; his marriage to Bess Joy (“Beanie”) Whetzel, Herbert
Whetzel’s sister. Perhaps this caused the change in advisors. The following year (1916)
another significant paper was published, “Some effects of oxygen and carbon dioxide
on nitrification and ammonification in soils” as EXPERIMENT STATION BULLETIN 384,
co-authored by Louis Melville Massey (q.v.), a fellow Wabash grad. Also in 1916, Osner
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 53
pubished “Additions to the list of plant diseases of economic importance in Indiana,’
this time in the PROCEEDINGS OF THE INDIANA ACADEMY OF SCIENCE. Osner was on
staff as Assistant Botanist at the Purdue University Agricultural Experiment Station.
He remained on staff there until at least 1919, but from that year, further data seems
missing until late in his life. An unreliable entry reports his death in Delano, Kern Co.,
California, in 1964.
BABCOCK, DUANE Cook (1887-1961) 712
Duane Cook Babcock graduated from Wabash together with J.H. Muncie, L.M.
Massey, C.C. Tomas, and J.L. Weimer. Aiming for Cornell, he was hired under a Whetzel
“Industrial Fellowship” that summer, but there is no record of his enrollment at Cornell.
Instead, he was listed on staff at the Ohio State Agricultural Experiment Station at
Wooster in 1913, with the title Assistant Botanist and Agent of the Laboratory of Forest
Pathology. There he was a leader in organizing field studies of Chestnut bark disease.
Babcock published “Diseases of forest and shade trees” in the OHIO AGRICULTURAL
EXPERIMENTAL STATION MONTHLY BULLETIN and was on staff when L.R. Hesler was
an Associate Plant Pathologist there in the summers of 1925-28. In 1940, Babcock was
listed in a bibliography of American forestry, and apparently remained with the station
until retirement, and in Wooster, Ohio, until death in 1961.
Massey, Louris MELVILLE (1890-1969) 712
Born in Lima, Ohio, Louis Melville Massey obtained his Ph.D. in Plant Pathology
from Cornell in 1916. Massey’s thesis, “The hard rot disease of gladiolus” was published
as the EXPERIMENT STATION BULLETIN 380. As did others, he stayed at Cornell Plant
Pathology, where he taught the general courses for Herbert Whetzel. When Whetzel
stepped aside from administrative duties in 1922, Massy became Acting Head, and the
following year, Department Head. Several sabbatical leaves were spent at the Boyce
Thompson Institute near New York City, and later at the University of California at
Berkeley. He retained the department headship until 1950, and formally retired in 1958,
after a lengthy career at Cornell. In his memorial: “The least recognized but probably the
greatest contribution to his field and his institution was his ability as an administrator.
He ‘took over’ the administrative duties at a time when a small staff was split and
discouraged. He directed a reunification and vigorous development, the occupation of
new and modern quarters within a few years, and ‘turned over’ a staff tripled in size and
as harmonious in operation as could be expected. He was respected for his honesty, his
judgment, and his keen vision.”
MuncIg, Jay H. (dates unknown) 712.
In 1912-13 Jay H. Muncie held an “Industrial Fellowship” in Plant Pathology,
Cornell. Without completing an advanced degree at Cornell, Muncie became an
Assistant in Plant Pathology at the Michigan State Experiment Station in East Lansing.
Several authored papers appeared as publications of the Experiment Station. He
remained on staff until the early 1920s when he moved to Iowa. Muncie received a PhD
from Iowa State University in 1926, with his thesis “A study of crown gall caused by
Bacterium tumefaciens on rosaceous hosts.” Again, his research was published, including
54 ... Petersen
in AMERICAN JOURNAL OF Botany. By 1930, Muncie returned to Michigan State where
he was on faculty as Research Associate and Extension Plant Pathologist.
THOMAS, CECIL CALVERT (1886-1936) 712
Cecil Calvert Thomas was one of many students handled by Mason Thomas in his
last years. Thomas remained to receive a Master's degree in 1913, then proceeded to
Cornell where he was listed as a graduate student in 1913-14 and as an Instructor in
Botany in 1915 (not Plant Pathology), but there is no evidence that he obtained the
Ph.D. Nonetheless, he was employed by the U.S.D.A. Bureau of Plant Industry and wrote
a bulletin on the Chinese Jujube (Thomas 1924), comprehensive enough to be reprinted
in the 21“ century. His own title at that time was Assistant Plant Instructor, Office of
Foreign Seed and Plant Introduction, Bureau of Plant Industry,
Thomas was known for his expertise in propagation of trees from cuttings.
WEIMER, JAMES LERoy (dates unknown) ’12
Born and raised in Avilla, Indiana, James LeRoy Weimer attended Cornell
thereafter. Listed as a graduate student, he was supported on one of Whetzel’s “Industrial
Fellowships.” His Ph.D. thesis (Cornell 1917) was ”Three cedar rust fungi their life
histories and the diseases they produce,’ published as CORNELL EXPERIMENT STATION
BULLETIN 390. Upon graduation, he joined the USDA’s Bureau of Plant Industry,
where he remained throughout his professional career. His title was Senior Pathologist,
Division of Forage Crops and Diseases. Weimer’s publications continued into the 1950s.
BURKHOLDER, WALTER HAGEMEYER (1891-1983) 713
Walter Hagemeyer (“Burkie”) Burkholder was born in Crawfordsville, Indiana,
so perhaps it was natural that he attended Wabash College (A.B., class of 1913) and
succumbed to the mentorship of Mason Thomas. From Wabash he attended Cornell
under one of Whetzel’s “Industrial Fellowships” and was awarded the Ph.D. in 1917.
Upon graduation he was appointed progressively as Assistant, Assistant Professor, and
Professor of Plant Pathology. His pioneering work on bacterial taxonomy was adopted
in Bergey’s manual for some years. His geniality was celebrated in his “official” eulogy:
“Burkie was an avid reader of poetry and fiction and especially enjoyed light opera. He
was a connoisseur of fine food and liquor, whose subtle delights he happily introduced
to others” (Rochow & al. 1983).
CHUPP, CHARLES DavID (1886-1967) 713
Charles David Chupp was typical of the rough-hewn Hoosiers of his time. Born
in Illinois, the family moved to Indiana and Chupp spent his young life with his older
brother in Edinburg, Indiana (Boothroyd 1982). In the midst of his Wabash years,
Chupp dropped out for three years, working as a school teacher of numerous subjects.
Boothroyd (1982) related Chupp’s story: “As Chupp recalls, ‘I had planned to specialize
in English, but regularly got D in that subject while it was easy to get an A in Botany
under the teaching of the famous Professor M.B. Thomas. On his deathbed he willed me
to Cornell in 1912. Luckily Professor Whetzel, Head of the Plant Pathology Department
accepted me” Cornell granted him a Ph.D. in 1916, and Chupp returned to Wabash as
Four Masters—Prentiss, Dudley, Thomas & Whetzel ... 55
Acting Professor of Botany (Thomas had died in 1912), but after one year he migrated
back to Cornell. The passage of the Smith-Lever Act in 1914, with funding for the states
to conduct extension work, and earlier organization of the Farm Bureau to appoint
county agents, laid the groundwork for rapid development of extension activities in
the College of Agriculture. Chupp, under the tutelage of M.F. Barrus, then himself
leader in the vegetable disease area, entered vigorously into this world of extension and
soon became known as the expert. Farmers all over the state (and in fact many people
outside the United States) became his friends and admirers. Chupp soon participated
with Barrus in developing Plant Pathology extension until his retirement in 1954. Korf’s
(1991) comment: Chupp “was one of the most beloved of the professors, always cheery,
filled with fun, a vegetable pathologist with lifelong interest in the taxonomy of the
genus Cercospora ...”
GIBSON, C.B. (dates unknown) ‘14
I can find no information on C.B. Gibson, Wabash class of 1914. Mason Tomas
died in 1912, presumably in Gibson’s sophomore year, and Gibson's post-graduation life
remains undocumented. A careful check might reveal Kent’s (1975) reference to Gibson
as faulty.
PICKLER, WILLIAM EUGENE (1892-1989) 714
Born in New Albany, Indiana, but early educated in Louisville, Kentucky,
William Eugene Pickler moved on to the University of Illinois where he
was given a series of fellowships starting at $300 but later raised to $600 for
10-month contracts. He earned a Ph.D. in botany (plant physiology) from the
University of Illinois in 1918. His thesis was “Water content and temperature as
factors influencing diastase formation in the barley-grain”” He was appointed to
the Bureau of Plant Industry where his duties were primarily with White pine
blister rust eradication. An obituary published in 1989 indicates that he was a
Veteran of World War I (unlikely given his academic achievements during the
war years) and employed by the Louisville Water Department for 40 years prior
to his retirement.
WANN, FRANK BURKETT (1892-1954) ‘14
Born in Warsaw, Indiana, Frank Burkett Wann was handicapped from
birth (no more specific data found). Though circumstances are unclear,
he was enrolled in the Henry Shaw School of Botany in St. Louis and there
taught general botany with Jacob Schramm (q.v.) under the leadership of
George Moore (q.v.). Seeking additional formal education, he returned to his
home state and enrolled in Wabash College, receiving an A.B. in 1914. His
time there spanned the death of Mason Thomas. In 1915 he was reported as
Teaching Fellow in Botany back at the Shaw School. By 1919 he was reported
by Sigma Xi Cornell chapter as Fellow in Botany. Wann’s Ph.D. thesis was
56 ... Petersen
“The fixation of free nitrogen by green plants.” Wann stayed on at Cornell
as an Instructor (1921-23) and was awarded a three-year fellowship by the
National Research Council. In 1926 he departed Cornell for an appointment as
Associate Professor of Plant Physiology at Utah State College (Logan) and its
Agricultural Experiment Station. His research investigated mineral deficiencies
in fruit trees and vegetable crops. He became department head of Botany and
Plant Pathology in 1952 but lived less than two years thereafter. A quote from
his obituary: “Through his classes, many young men at Utah Stare became
interested in botany. His encouragement led many students to go away to the
leading universities of the world and to become renowned authorities in plant
science;” a statement reminiscent of Wann’s mentor, Mason Thomas back at
Wabash.
Appendix 5.
“Industrial Fellowship” students
Four Masters—Prentiss, Dudley, Thomas & Whetzel ...
Excerpted from Whetzel, H.H. 1945. The history of industrial fellowships in the
Department of Plant Pathology at Cornell University. Agricultural History 19(2):
99-104.
* = Wabash graduate. [Shared fellowships indicated by numerical superscripts. ]
NAME
Wallace, Ernest
*Stewart, V.B.
+? Blodgett, FM.
42Jensen, C.N.
3Sherbakoff, C.D.
>Faulwetter, EC.
*Jagger, I.C.
*Rankin, W.H.
* Anderson, PJ.
™*Hesler, L.R.
4+7Brausher, R.W.
47 Osner, G.
Jehle. R.A.
*Stewart, V.B.
°Wallace, E.
*Muncie, J.H.
*Burkholder, W.H.
Crittenden, C.G.
Honey, E.E.
Mix, A.J.
*Weimer, J.L.
Slocum, C.L.
Dye, H.W.
Newhall, A.G.
Gaines, J.G.
Harrison, A.L.
Felix, E.L.
Cook, H.T.
Vogel, I.H.
White, R.P.
YEAR(S)
1909-10
1909-10
1910-11
1910-11
1912=13
1912-13
1911-12
191 2=13
1910-11, "11-12
1910-11
1911-12
1912-13
1911, 1912
1911, °12-13,
1913-15
1914
1915
1911
1911-12
1913-14
1911-12
1912-13
191213, 1915
1913-14, 14-15
1917
1912-13
1913-14
1912:
1914
1917-19
1:920=2).
1925-26; ’26-27
1827-30
1930-31
1924-25; 25-26
1926-27
1919
1919-20; 20-21
Funps ($)
1500/yr
750/yr
3,000
4,000
750
750
750/yr
750/yr
750
375
* 2000
71415
1000
891
730
2000
2000
2000
2000
2176
487
1000
915
940
1000
750/yr
1000/yr
1000/yr
1250/yr
583
1000/yr
2
1000
1000/yr
57
58 ... Petersen
NAME
Gratz, L.O.
‘Boyd, O.C.
Fernow, K.H.
Schlatter, I.P.
8 Fitch, H.W.
°*Pierstoff, A.L.
Newlands, R.E.
Kightlinger, C.V.
'Wiant, J.S.
Burrell, A.B.
Townsend, G.R.
Cook, H.T.
Stuart, W.W.
Small, C.G.
Erickson, E.T.
Meyer, L.J.
Parsons, B.
Pirone, P.P.
Richards, M.C.
Cannon, O.S.
Lyle, E.W
McClellan, W.D.
Linn, M.B./
Cochran, V.W.
Hyre, R.A.
Harrison, A.L.
YEAR(S)
1920-21; 21-22
1920
1920-21; ’21-23
1920-21
1921-22; ’22-23
1923-24
1925-26
1924-25; ’25-26
1924-25;25-26
1926-27; ’27-28
1924-26
1927-28, ’28-29
1928-29, ’29-30
1930-31, ’31-32
1932-33
1928-29, ’29-30
1930-31, ’31-32, °32-33
1928
1929-30
1930-31, ’31-32, °32-33
1929-30, 30-31
1931-32, ’32-33
1933-34, 34 -35
1935-36, ’36-37, 37-38
1938
1939-40
1940-41
1931-32, ’32-33
1933-34, ’34-35, °35-36
1937-38, ’38-39, ’39-40
1941, 1942 (summers)
1931-32, ’32-33, ’33-34, ’34-35
1932-33, °33-34
1934-35, °35-36
Funps ($)
1000/yr
1000
1000/yr
4000
4000/yr
4000
4125
1000/yr
10009/yr
1250/yr
?
1000/yr
1250/yr
1000/yr
1250
1500/yr
1750/ yr
1000
1250
1250/yr
1200/yr
1450/yr
1200/yr
1450/yr
1650
1600
1500
1450/yr
1550/yr
1000/yr
100/summer
1500/yr
1500/yr
1600/yr
MYCOTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 59-71
https://doi.org/10.5248/136.59
Craterellus atrobrunneolus sp. nov.
from southwestern China
TinG Cao”, JiA-Rur Yu?”, YA-PING Hu?, HAI-SHENG YUAN”
'CAS Key Laboratory of Forest Ecology and Management, Institute of Applied Ecology,
Chinese Academy of Sciences, Shenyang 110164, P. R. China
? University of the Chinese Academy of Sciences, Beijing 100049, China
> Nanjing Institute of Environmental Sciences, MEE/State Environmental Protection Scientific
Observation and Research Station for Ecological Environment of Wuyi Mountains,
Nanjing 210042, P. R. China
* CORRESPONDING AUTHOR: [email protected]
ABSTRACT—A_ new ectomycorrhizal fungus from southwestern China, Craterellus
atrobrunneolus, is proposed as supported by morphological and phylogenetic analyses.
The basidiocarps are characterized by a dark brown to brownish gray coloration, convex to
plano-convex pileus with an umbilicate but not perforate center, smooth to slightly folded
gray to cretaceous hymenophore, absence of clamp connections in all tissues, narrow
basidia with 2-6 sterigmata, and broadly ellipsoid to subglobose basidiospores. Maximum
likelihood and Bayesian sequence analyses of the ITS + nrLSU DNA regions confirm the
phylogenetic position of the new species. Illustrations accompany the technical description
and comparisons of C. atrobrunneolus and closely related species.
Key worps—Cantharellales, Hydnaceae, taxonomy
Introduction
Craterellus Pers. is typified by the species C. cornucopioides (L.) Pers.
(Persoon 1825). The genus, characterized by funnel-shaped fruiting bodies
with a hollow stipe that may also be highly reduced (Petersen 1979), is closely
related to Cantharellus Adans. ex Fr. from which it is distinguished mainly
by the absence of clamp connections (Corner 1957, 1966; Bigelow 1978).
However, some species that lack clamp connections have been also included
60 ... Cao & al.
in Cantharellus (Yomyart & al. 2012; Wilson & al. 2012; Buyck & al. 2014;
Bijeesh & al. 2018). Craterellus was previously classified in Cantharellaceae
(Cantharellales) (Wilson & al. 2012; Henkel & al. 2014), but Hibbett & al.
(2014) now indicate that Cantharellaceae, Hydnaceae, Clavulinaceae, and
Sistotremataceae are synonymous, and Hydnaceae has priority as the correct
name of the combined family. As ectomycorrhizal fungi, Craterellus species
are symbiotic with canopy trees of the genera like Aldina, Castanopsis, Cedrus,
Cyclobalanopsis, Dicymbe, Hopea, Pakaraimaea, Pinus, Quercus, and Schima
(Matheny & al. 2010, Smith & al. 2011, Kumari & al. 2012, Wilson & al. 2012,
Buyck & al. 2014, Henkel & al. 2014, Kour & al. 2015, Bijeesh & al. 2018, Zhong
& al. 2018).
A total of 154 names have been recorded in this genus, and 76 species are
currently accepted (http://www.indexfungorum.org). Most species are edible
and often colorful (Zhong & al. 2018), although ten or so species are dark gray,
dark brown, or black in color (Persoon 1825; Peck 1878; Burt 1914; Smith
1968; Petersen 1969, 1975; Wilson & al. 2012; Yomyart & al. 2012; Bijeesh &
al. 2018). Most Craterellus species have been described from South America
(Wilson & al. 2012, Henkel & al. 2014) and North America (Dahlman & al.
2000, Dunham & al. 2003, Porter & al. 2008, Wright & al. 2009, Matheny
& al. 2010, Raja & al. 2017) plus several from Europe (Dahlman & al. 2000,
Harrington & Mitchell 2002, Tibuhwa & al. 2012, Osmundson & al. 2013)
and about ten species from Asia (Massee 1906, Bresadola 1913, Corner 1966,
Kumari & al. 2012, Hembrom & al. 2017, Das & al. 2017, Bijeesh & al. 2018,
Zhong & al. 2018). Only two species (C. aureus Berk. & M.A. Curtis and
C. luteus T.H. Li & X.R. Zhong) have been originally described from China
(Zhong & al. 2018).
During the investigation on macrofungi in southwestern China, a dark
Craterellus species was collected from an angiosperm forest in Shizong County,
Yunnan Province. We describe it as a new species, based on morphological
characters and molecular analyses.
Materials & methods
Morphological studies
Specimens are deposited at the herbarium of Institute of Applied Ecology, Chinese
Academy of Sciences, Shenyang, China (IFP). Microscopic procedures followed
Lu & al. (2018). Microscopic drawings were made with the aid of a drawing tube.
Microscopic studies used sections mounted in Cotton Blue (CB): 0.1 mg aniline blue
dissolved in 60 g pure lactic acid; CB+/- = cyanophilous/acyanophilous. Amyloid
and dextrinoid reactions were tested in Melzer’s reagent (IKI): 1.5 g KI (potassium
Craterellus atrobrunneolus sp. nov. (China) ...
TABLE 1. Craterellus species, specimens, and sequences used in the phylogenetic
analyses, with a Hydnum ellipsosporum outgroup.
Type materials are annotated with [T].
SPECIES ITS NRLSU VOUCHER LOCALITY
C. albostrigosus - MG593194 CAL 1624 [T] India
C. atratoides JQ915093 JQ915119 MCA1313 Guyana
JQ915103 JQ915129 TH8473 Guyana
JQ915111 NG042660 TH9232 [T] Guyana
C. atratus JQ915092 JQ915118 MCA1070 Guyana
JQ915100 JQ915126 MCA990 Guyana
JQ915107 JQ915133 TH9203 Guyana
C. atrobrunneolus MN902353 MN894058 IFP 019359 [T] China
C. caeruleofuscus MH558300 MH558300 TENN 073179 USA
C. cinereofimbriatus JQ915104 JQ915130 TH8999 Guyana
JQ915105 JQ915131 TH9075 [T] Guyana
JQ915112 JQ915138 TH9264 Guyana
C. cornucopioides - AF105298 UPSF-11800 USA
- AF105299 UPSF-11801 USA
- AF105301 HbO-53302 Norway
C. excelsus JQ915102 JQ915128 TH8235 [T] Guyana
C. ignicolor - AF105314 UPSF-11794 USA
C. indicus NR119831 NG060387 PUN 3884 [T] India
C. inusitatus - MG593195 CAL 1625 [T] India
C. luteus MG727896 MG701171 GDGM48105 [T] China
MG727897 MG727898 GDGM46432 China
C. lutescens - AF105302 UPSF-11789 Sweden
- AF105303 UPSF-11790 Sweden
- AF105304 UPSF-11791 Spain
C. odoratus - AF105306 UPSF-11799 USA
C. olivaceoluteus JQ915098 JQ915124 MCA3186 Guyana
JQ915109 JQ915135 TH9205 [T] Guyana
C. parvogriseus MF421099 MF421098 CAL 1533 [T] India
C. pleurotoides JQ915097 JQ915123 MCA3124 Guyana
JQ915110 JQ915136 TH9220 Guyana
KT339208 KT339208 TH8877 Guyana
C. shoreae - KY290585 CAL 1396 [T] India
Craterellus sp. - KM484695 BB 09.079 India
JQ915091 JQ915117 AWW263 Malaysia
KJ786699 KJ786611 G3211 Guyana
KJ786682 KJ786577 G2070 Guyana
C. strigosus JQ915094 JQ915120 MCA1750 Guyana
JQ915108 JQ915134 TH9204 [T] Guyana
C. tubaeformis EU057081 EU057081 ECUBC19 Canada
KP454008 KP454008 UBC F28404 Canada
DQ474413 - SWUBC511 Canada
Uncult. ECM AB251810 - Pdmt4 Japan
Hydnum ellipsosporum KX086215 KX086217 FD3281 Switzerland
62 ... Cao &al.
iodide), 0.5 g I (crystalline iodine), 22 g chloral hydrate, aq. dest. 20 ml; IKI- = neither
amyloid nor dextrinoid reaction. 5% KOH was used as a mountant. Sections were
studied at magnifications up to x1000 using a Nikon Eclipse E600 microscope with
phase contrast illumination; dimensions were estimated subjectively with an accuracy
of 0.1 um. Surfaces of the basidiospores and basidia were observed with a Phenom
Prox scanning electron microscope (ESEM) at an accelerating voltage of 10 kV. For
spore measurements, the apiculus was excluded. In presenting the spore size ranges,
5 % of the measurements at each end of the range are given in parentheses. The
following abbreviations are used in the text: L = mean spore length; W = mean spore
width; Q = variation in the ratios of L/W between specimens studied; n = number
of spores measured from a given number of specimens. Terminology for descriptive
terms follows Vellinga (1988) and special color terms are from Kornerup & Wanscher
(1978).
Molecular procedures and phylogenetic analyses
Phire Plant Direct PCR Kit procedures were used to extract total genomic DNA
from the basidiocarps. Polymerase chain reactions (PCR) were performed on a Bio-
Rad T100TM Thermal cycler. The DNA was amplified in a 30 ul reaction mixture
comprising 0.9 pl template DNA, 15 ul of 2x Phire Plant PCR buffer, 1.5 ul of each
primer, 0.6 ul Phire HS II DNA Polymerase, and 10.5 ul ddH20 (double distilled
water). The nuc rDNA ITS1-5.8S-ITS2 region (ITS) was amplified with the primers
ITS1-F (5’CTTGGTCATTTAGAGGAAGTAA3’) and ITS4 (5’TCCTCCGCTTATTGATATGC3’)
(White & al. 1990). The 28S nuclear rDNA region was amplified with the primers
LROR (5’ACCCGCTGAACTTAAGC3’) and LR5 (5’TTAAAAAGCTCGTAGTTGAAC2’)
(Vilgalys & Hester 1990). The PCR thermal cycling program condition was set as
follows: initial denaturation at 95 °C for 5 min; followed by 35 cycles at 95 °C for 30
s, either 57.2 °C (for ITS1-F/ITS4) or 52 °C (for LROR/LRS) for 30 s and 72 °C for
30 s; and a final extension at 72 °C for 7 min. PCR amplification was confirmed on
1% agarose electrophoresis gels stained with ethidium bromide. DNA sequencing
was performed at the Beijing Genomics Institute (BGI), and the newly generated
sequences were submitted to GenBank.
The sequences were processed in GenBank (http://www.ncbi.nlm.gov) using the
BLAST option and downloaded (TABLE 1). The ITS and nrLSU dataset includes the
new species and other closely related species. Sequences were aligned using Clustal
X (Thompson & al. 1997). Maximum likelihood (ML) analysis was performed
in RAxML v8.2.4 with GTR + I + G model (Stamatakis 2014). Bayesian analysis
with MrBayes 3.2.4 (Ronquist & Huelsenbeck 2003) implementing the Markov
Chain Monte Carlo (MCMC) technique and parameters predetermined with
MrModelTest2.3 (Posada & Crandall 1998; Nylander 2004) were performed and the
parameters in MrBayes were set as follows: Iset nst = 6, rates = invgamma. Four
simultaneous Markov chains were run starting from random trees and keeping one
tree every 100th generation until the average standard deviation of split frequencies
was <0.01. The value of burn-in was set to discard 25% of trees when calculating the
Craterellus atrobrunneolus sp. nov. (China) ...
100/0.98 Craterellus luteus GDGM48105 [T]
99/1.00 Craterellus luteus GDGM46432
Craterellus odoratus UPSF-11799
Craterellus atrobrunneolus IFP 019359 [T]
Craterellus sp. AWW263
Craterellus cornucopioides UPSF-11800
Craterellus cornucopioides HbO-53302
Craterellus sp. G2070
Craterellus indicus PUN 3884 [T]
Craterellus parvogriseus CAL1533 [T]
Craterellus shoreae CAL 1396 [T]
Craterellus inusitatus CAL 1625 [T]
76/0.99 ; Craterellus sp. BB 09.079
Craterellus albostrigosus CAL 1624 [T]
‘ Craterellus cinereofimbriatus TH9264
56/:
99/0.96 Craterellus cinereofimbriatus TH9075 [T]
75/0.98 | Craterellus cinereofimbriatus TH8999
TOG 00 i Craterellus sp. G3211
Craterellus excelsus TH8235 [T]
Craterellus caeruleofuscus TENN 073179
97-1 Craterellus tubaeformis SWUBC511
| ' Craterellus tubaeformis UBC F28404
Craterellus tubaeformis ECUBC19
Craterellus ignicolor UPSF-11794
Craterellus lutescens UPSF-11791
Craterellus lutescens UPSF-11789
Craterellus pleurotoides TH8877
Craterellus pleurotoides MCA3124
Craterellus pleurotoides TH9220
190/1.00) Craterellus olivaceoluteus MCA3186
Craterellus olivaceoluteus TH9205 [T]
991.09 Craterellus strigosus MCA1750
d-| ' Craterellus strigosus TH9204 [T]
Uncult ECM Pdmt4
Craterellus atratoides TH9232 [T]
100/1.00' Craterellus atratoides MCA1313
Craterellus atratoides TH8473
Craterellus atratus MCA1070
100/1.00 Craterellus atratus TH9203
Craterellus atratus MCA990
Hydnum ellipsosporum FD3281
95/1.00
0.07
FiGurE 1. Maximum likelihood tree illustrating the phylogeny of Craterellus atrobrunneolus and
related taxa based on ITS + nrLSU sequences dataset. The type materials are annotated with [T].
Branches are labeled with maximum likelihood bootstrap support >50% and Bayesian posterior
probabilities >0.95.
posterior probabilities. Bayesian posterior probabilities were obtained from the 50%
majority rule consensus of the trees kept.
Phylogenetic results
The ITS + nrLSU dataset included 43 sequenced specimens, representing our
new species, 24 other identified or putative Craterellus species, and the outgroup
63
64 ... Cao & al.
Hydnum ellipsosporum Ostrow & Beenken. Bayesian analysis ran 2,000,000
generations and produced an average standard deviation of split frequencies =
0.006070. A similar topology (Fic. 1) was generated when the same dataset and
alignment were analyzed using ML. In the phylogenetic tree, our new holotype
specimen was closely related to an unidentified Craterellus species (AWW263)
with moderate support and joined with the clade comprising Craterellus luteus
and C. odoratus (Schwein.) Fr. with moderate support.
Taxonomy
Craterellus atrobrunneolus T. Cao & H.S. Yuan, sp. nov. Fics 2-4
MB 833932
Differs from Craterellus strigosus by its larger basidiocarps, smaller basidiospores, and
absence of clamp connections on hyphae in all tissues.
Type: China. Yunnan Province, Shizong County, Junzishan Mt., on the ground
in angiosperm forest, 8 Aug 2019, Yuan 13878 (Holotype, IFP 019359; GenBank
MN894058, MN902353).
EryMo_oey: atrobrunneolus, referring to the dark brown to brownish gray basidiocarps.
BASIDIOCARPS annual, solitary to concrescent, soft and leathery when fresh,
becoming friable and light in weight upon drying. Prteus thin, 1.5-3.0 cm
in diam, when young infundibuliform, in age becoming convex to plano-
convex with a shallow depression at center, umbilicate (not perforate). PILEAL
SURFACE dark brown (6F7/7F6/8F6) to almost black when moist, drying
become brownish gray (6E3/6E2), subglabrous, regularly wrinkled to sparsely
veined. PILEAL MARGIN slightly incurved, wavy, irregularly folded, crenate
or sometimes incised. HYMENOPHORE bluish grey (23B2), smooth to slightly
folded and down to the stipe. PILEAL CONTEXT very thin, grayish (1E1),
leathery. Stripe confluent with pileus, 2.5-5.0 cm long and 0.3-1.5 cm diam,
leathery or fleshy when fresh, soft corky upon drying, concolorous with the
pileal surface; hollow, irregularly pitted, usually curved and eccentric; smooth
to finely rugulose, not thickening substantially, 0.1-0.3 mm thick in section;
stipe base somewhat bulbous. Odor mild; taste not distinctive.
Basip1osPorEss broadly ellipsoid to subglobose, yellowish in 5% KOH, with
granular contents; wall 0.5 um thick; apiculus 0.5-1.0 um long; CB+, IKI-,
(6.2-)6.5—-7.8(-8.0) x (4.2-)4.5-6.0(-6.2) um, L, = 7.38 um, W_, = 5.47 um,
Q = 1.35-1.52 (n = 60/2). Basrp1a 45.5-70 x 5.2-8.5 um long, narrow,
subcylindric, subclavate to clavate, with large guttules or finely granulose
contents, hyaline to yellowish in 5% KOH; 2-6 sterigmata, 3.5-6.0 um long.
BASIDIOLES 40.5-65 x 5.0-8.0 um, abundant, cylindrical to subclavate,
Craterellus atrobrunneolus sp. nov. (China) ... 65
ae
i, OE ie 7, |) Sin
ae ad a
FIGURE 2. Craterellus atrobrunneolus (holotype, IFP 019359). Basidiocarps.
66 ... Cao & al.
FIGURE 3. Craterellus atrobrunneolus (holotype, IFP 019359).
Basidia and basidiospores (SEM).
multiguttulate. Cystrp1a absent. HYMENTUM 60-85 um thick. HYMENOPHORAL
TRAMA hyphae 3.5-10 um diam., thin to slightly thick-walled, more or less
interwoven, occasionally branched, often with fine guttules, hyaline to
yellowish brown in 5% KOH. PILEAL TRAMA hyphae 5.5-10 um diam., thick-
walled, subregular. PILEIPELLIs composed of cylindrical hyphae, 3.5-11 um
diam, thick-walled, frequently branched, somewhat interwoven, with rounded
obtuse apex. STIPITIPELLIS composed of interwoven hyphae, 3.5-7.5 um diam.,
thick-walled; terminal elements 11.5-29 x 3.5-12 um. Clamp connections
absent in all tissues.
67
Craterellus atrobrunneolus sp. nov. (China) ...
©OOoGSaA00@4 Ba
(
FiGuRE 4. Craterellus atrobrunneolus (ex holotype, IFP 019359).
a. Basidiospores; b. A section of context and hymenium; c. Pileipellis.
68 ... Cao & al.
ADDITIONAL SPECIMEN EXAMINED— CHINA. YUNNAN PROVINCE, Shizong County,
Junzishan Mt., ground in angiosperm forest, 8 Aug 2019, Yuan 13900b (IFP 019360).
Discussion
Craterellus atrobrunneolus is characterized by dark brown to brownish
gray basidiocarps, convex to plano-convex pileus with an umbilicate (non-
perforated) center, smooth to slightly folded gray to cretaceous hymenophore,
narrow basidia with 2-6 sterigmata, and broadly ellipsoid to subglobose
basidiospores.
Several Craterellus species also have similarly dark colored basidiocarps,
such as C. albostrigosus C.K. Pradeep & K.B. Vrinda, C. atratoides
T.W. Henkel & al., C. atratus (Corner) Yomyart & al., C. caeruleofuscus
A.H. Sm., C. cornucopioides (L.) Pers., C. fallax A.H. Sm., and C. strigosus
T.W. Henkel & al.
Craterellus albostrigosus, described from India, resembles the new species
in its brownish pileus, gray hymenophore, thick-walled pileipellis hyphae,
stipitipellis hyphae with short terminal elements, and absence of clamp
connections. But C. albostrigosus is distinguished by its smaller (3-19 mm
diam) pileus with white strigose hairs, a solid stipe with strigose scales, and
larger (9-11.5 x 6-8 um) basidiospores (Bijeesh & al. 2018).
Craterellus atratoides resembles C. atrobrunneolus in its grayish brown
glabrous pileus and stipe, gray hymenophore, densely guttulate basidioles,
and ellipsoid to subglobose basidiospores but is distinguished by its broader
(7.1-9 um diam) basidiospores, larger (79-111 x 7.4-9.9 um) basidia with
3-5 sterigmata, and abundant clamp connections (Wilson & al. 2012).
Craterellus atratus also shares similarly colored basidiocarps, ellipsoid
basidiospores, a smooth to very faintly wrinkled hymenophore, and the
absence of cystidia but is separated from C. atrobrunneolus by its smaller,
campanulate basidiocarps (pileus 8-9 mm, stipe 7-9 x 0.75-1 mm), solid
stipe, larger (9 x 6-7 um) basidiospores, and rare clamp connections
(Yomyart & al. 2012).
Craterellus strigosus, described originally from Guyana, resembles C. atro-
brunneolus in its similarly shaped pileus, gray hymenophore, and
multiguttulate basidia but is distinguished by its smaller basidiocarps (4-18
mm broad, 2-9 mm tall), wider (5.9-8 um diam.) basidiospores, stipe with
dense, brown strigose scales, and abundant clamp connections in all tissues
(Wilson & al. 2012).
The phylogenetic tree supports Craterellus atrobrunneolus as distantly
related to C. odoratus and C. luteus, two species obviously separated from the
Craterellus atrobrunneolus sp. nov. (China) ... 69
new species by their bright orange to greenish yellow pileal surface (Dahlman
& al. 2000; Zhong & al. 2018).
Acknowledgments
We thank Jun-Fen Liang (Chinese Academy of Forestry, Guangzhou) and
Xiao-Dan Yu (Shenyang Agricultural University, China) for presubmission review.
This research was financed by the Biodiversity Investigation, Observation and
Assessment Program (2019-2023) of Ministry of Ecology and Environment of
China and the National Natural Science Foundation of China (Project Nos.
31770028 & 31970017).
Literature cited
Bigelow HE. 1978. The cantharelloid fungi of New England and adjacent areas. Mycologia 70:
707-756. https://doi.org/10.2307/3759354
Bijeesh C, Kumar AM, Vrinda KB, Pradeep CK. 2018. Two new species of Craterellus
(Cantharellaceae) from tropical India. Phytotaxa 346: 157-168.
https://doi.org/10.11646/phytotaxa.346.2.3
Bresadola G. 1913. Basidomycetes philippinenses. Series I]. Hedwigia 53: 44-80.
Burt EA. 1914. The Thelephoraceae of North America. II. Craterellus. Annals of the Missouri
Botanical Garden 1: 327-350. https://doi.org/10.2307/2990079
Buyck B, Kauff F, Eyssartier G, Couloux A, Hofstetter V. 2014. A multilocus phylogeny for
worldwide Cantharellus (Cantharellales, Agaricomycetidae). Fungal Diversity 64: 101-121.
https://doi.org/10.1007/s13225-013-0272-3
Corner EJH. 1957. Craterellus Pers., Cantharellus Fr., and Pseudocraterellus gen. nov. Beihefte
zur Sydowia 1: 266-267.
Corner EJH. 1966. A monograph of cantharelloid fungi. Annals of Botany Memoirs 2. 255 p.
Dahlman M, Danell E, Spatafora JW. 2000. Molecular systematics of Craterellus: cladistic
analysis of nuclear LSU rDNA sequence data. Mycological Research 104: 388-394.
https://doi.org/10.1017/S0953756299001380
Das K, Ghosh A, Chakraborty D, Li J, Qiu L, Baghela A, Halama M, Hembrom ME &
al. 2017. Fungal biodiversity profiles 31-40. Cryptogamie Mycologie 38: 353-406.
https://doi.org/10.7872/crym/v38.iss3.2017.353
Dunham SM, O'Dell TE, Molina R. 2003. Analysis of nrDNA sequences and microsatellite
allele frequencies reveals a cryptic chanterelle species Cantharellus cascadensis sp.
nov. from the American Pacific Northwest. Mycological Research 107: 1163-1177.
https://doi.org/10.1017/S0953756203008475
Harrington TJ, Mitchell DT. 2002. Characterization of Dryas octopetala ectomycorrhizas from
limestone karst vegetation, western Ireland. Canadian Journal of Botany 80: 970-982.
https://doi.org/10.1139/b02-082
Hembrom ME, Das K, Adhikari S, Parihar A, Buyck B. 2017. First report of Pterygellus from
Rajmahal hills of Jharkhand (India) and its relation to Craterellus (Hydnaceae, Cantharellales).
Phytotaxa 306: 201-210. https://doi.org/10.11646/phytotaxa.306.3.2
Henkel TW, Wilson AW, Aime MC, Dierks J, Uehling JK, Roy M, Heidy S, Wartchow F, Mueller
GM. 2014. Cantharellaceae of Guyana II: new species of Craterellus, new South American
distribution records for Cantharellus guyanensis and Craterellus excelsus, and a key to the
Neotropical taxa. Mycologia 106: 307-324. https://doi.org/10.3852/106.2.307
70 ... Cao & al.
Hibbett DS, Bauer R, Binder M, Giachini AJ, Hosaka K, Justo A, Larsson E & al. 2014.
Agaricomycetes. 373-429, in: DJ McLaughlin, JW Spatafora. (eds). The Mycota: Systematics
and Evolution, Part A. VII. Springer-Verlag, Berlin.
https://doi.org/10.1007/978-3-642-55318-9_14
Kornerup A, Wanscher JH. 1978. Methuen handbook of color. 3rd Edition, Methuen, London.
Kour H, Kour S, Sharma YP, Kumar S. 2015, Additional records of Craterellus from Jammu and
Kashmizr, India. Journal of Mycology and Plant Pathology 45: 428-433.
Kumari D, Upadhyay RC, Reddy MS. 2012. Craterellus indicus sp. nov., a new species associated
with Cedrus deodara from the western Himalayas, India. Mycological Progress 11: 769-774.
https://doi.org/10.1007/s11557-011-0788-4
Lu X, Steffen K, Yuan HS. 2018. Three new species of Tomentella (Thelephorales) from Finland
based on morphological and molecular data. Mycologia 110: 677-691.
https://doi.org/10.1080/00275514.2018.1474683
Massee GE. 1906. Fungi exotici, V. Bulletin of Miscellaneous Information (Royal Botanic
Gardens, Kew) 1906: 255-258. https://doi.org/10.2307/4118220
Matheny PB, Austin EA, Birkebak JM, Wolfenbarger AD. 2010. Craterellus fallax, a black
trumpet mushroom from eastern North America with a broad host range. Mycorrhiza 20:
569-575. https://doi.org/10.1007/s00572-010-0326-2
Nylander JAA. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology
Centre, Uppsala University.
Osmundson TW, Robert VA, Schoch CL, Baker LJ, Smith A, Robich G, Mizzan L, Garbelotto
MM. 2013. Filling gaps in biodiversity knowledge for macrofungi: contributions and
assessment of a herbarium collection DNA barcode sequencing project. PloSs ONE 8(4):
e62419. https://doi.org/10.1371/journal.pone.0062419
Peck CH. 1878. Report of the botanist. Annual Report on the New York State Museum of Natural
History 31: 19-60.
Persoon CH. 1825. Mycologia europaea 2. J.J. Palmius, Erlangen. 214 p.
Petersen RH. 1969. Notes on cantharelloid fungi. II. Some new taxa, and notes on Pseudocraterellus.
Persoonia 5: 211-223.
Petersen RH. 1975. Notes on cantharelloid fungi. VI. New species of Craterellus and infrageneric
rearrangement. Ceska Mykologie 29: 199-204.
Petersen RH. 1979. Notes on cantharelloid fungi. IX. Illustrations of new or poorly understood
taxa. Nova Hedwigia 31: 1-23.
Porter TM, Skillman JE, Moncalvo JM. 2008. Fruiting body and soil rDNA sampling
detects complementary assemblage of Agaricomycotina (Basidiomycota, Fungi) in a
hemlock dominated forest plot in southern Ontario. Molecular Ecology 17: 3037-3050.
https://doi.org/10.1111/j.1365-294X.2008.03813.x
Posada D, Crandall K. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14:
817-818. https://doi.org/10.1093/bioinformatics/14.9.817
Raja HA, Baker TR, Little JG, Oberlies NH. 2017. DNA barcoding for identification of consumer-
relevant mushrooms: A partial solution for product certification? Food Chemistry 214:
383-392. https://doi.org/10.1016/j.foodchem.2016.07.052
Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. https://doi.org/10.1093/bioinformatics/btg180
Smith AH. 1968. The Cantharellaceae of Michigan. Michigan Botanist. 7: 143-183.
Smith ME, Henkel TW, Aime MC, Fremier AK, Vilgalys R. 2011. Ectomycorrhizal fungal
diversity and community structure on three co-occurring leguminous canopy tree species
Craterellus atrobrunneolus sp. nov. (China) ... 71
in a Neotropical rainforest. New Phytologist 192: 699-712.
https://doi.org/10.1111/j.1469-8137.2011.03844.x
Stdger A, Schaffer J, Ruppitsch W. 2006. A rapid and sensitive method for direct detection of Erwinia
amylovora in symptomatic and asymptomatic plant tissues by polymerase chain reaction.
Journal of Phytopathology 154: 469-473. https://doi.org/10.1111/j.1439-0434.2006.01130.x
Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large
phylogenies. Bioinformatics 30: 1312-1313. https://doi.org/10.1093/bioinformatics/btu033
Thompson JD, Gibson TJ, Plewniak FE, Jeanmougin FE, Higgins DG. 1997. The CLUSTAL_X
Windows Interface: flexible strategies for multiple sequence alignment aided by quality analysis
tools. Nucleic Acids Research 25: 4876-4882. https://doi.org/10.1093/nar/25.24.4876
Tibuhwa DD, Savic¢ S, Tibell L, Kivaisi AK. 2012. Afrocantharellus gen. stat. nov. is part of a
rich diversity of African Cantharellaceae. IMA Fungus 3: 25-38.
https://doi.org/10.5598/imafungus.2012.03.01.04
Vellinga EC. 1988. Glossary. 54-64, in: C Bas & al. (eds). Flora Agaricina Neerlandica 1.
A.A. Balkema, Rotterdam.
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically
amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology
172: 4238-4246. https://doi.org/10.1128/JB.172.8.4238-4246.1990
White TJ, Burns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis & al.
(eds). PCR protocols, a guide to methods and applications. Academic, San Diego.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Wilson AW, Aime MC, Dierks J, Mueller GM, Henkel TW. 2012. Cantharellaceae of Guyana I: new
species, combinations and distribution records of Craterellus and a synopsis of known taxa.
Mycologia 104: 1466-1477. https://doi.org/10.3852/11-412
Wright SH, Berch SM, Berbee ML. 2009. The effect of fertilization on the below-ground diversity
and community composition of ectomycorrhizal fungi associated with western hemlock (Tsuga
heterophylla). Mycorrhiza 19: 267-276. https://doi.org/10.1007/s00572-008-0218-x
Yomyart S, Watling R, Phosri C, Piapukiew J, Sihanonth P. 2012. Two interesting
cantharelloids from Nan and Kanchanaburi provinces, Thailand. Mycotaxon 122: 413-420
https://doi.org/10.5248/122.413
Zhong XR, Li TH, Jiang ZD, Deng WQ, Huang H. 2018. A new yellow species of
Craterellus (Cantharellales, Hydnaceae) from China. Phytotaxa 360(1): 35-44.
https://doi.org/10.11646/phytotaxa.360.1.3
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 73-78
https://doi.org/10.5248/136.73
Camposporium chinense sp. nov. from Jiangxi, China
ZHAO-HUAN Xu’, WEN-XIU SUN”, XU-GEN SHI’, XIU-GUO ZHANG},
JI-WEN X1A3, RAFAEL F. CASTANEDA-RUIZ‘4, JIAN Ma? >*
‘College of Agronomy, Jiangxi Agricultural University, Nanchang, Jiangxi 330045, China
’ College of Life Science, Yangtze University, Jingzhou, Hubei 434025, China
*Department of Plant Pathology, Shandong Agricultural University,
Taian, Shandong 271018, China
‘Instituto de Investigaciones Fundamentales en Agricultura Tropical Alejandro de Humboldt’
(INIFAT), Académico Titular de la “Academia de Ciencias de Cuba’,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P. 17200
“Jiangxi Key Laboratory for Conservation and Utilization of Fungal Resources,
Jiangxi Agricultural University, Nanchang, Jiangxi 330045, China
* CORRESPONDENCE TO: [email protected]; [email protected]
ABSTRACT—A new species, Camposporium chinense, is described and illustrated from a
specimen collected on dead branches of an unidentified broadleaf tree in Jiangxi, China.
The fungus is characterized by its fusiform, 9-12-septate, versicolored conidia with an
unbranched, aseptate apical appendage. A key to Camposporium species is provided.
KEY worDs—asexual fungi, hyphomycetes, saprobes, taxonomy
Introduction
Camposporium Harkn. was established by Harkness (1884) for a single
species, C. antennatum Harkn., and is mainly characterized by solitary
acropleurogenous euseptate conidia that secede rhexolytically from polyblastic
integrated terminal sympodial extended denticulate conidiogenous cells. The
conidia are generally cylindrical or fusiform, smooth, rounded at either or
both ends and with one or more unbranched or branched appendages, the base
usually bearing a frill (Harkness 1884, Hughes 1951, Ellis 1971, Whitton & al.
2002, Seifert & al. 2011). Of the twenty epithets listed in Camposporium by
74 ... Xu & al.
Index Fungorum (January 2020), sixteen represent accepted Camposporium
species, distinguished primarily by conidial shape, size, septation,
pigmentation, presence or absence of apical appendages, and the characters of
apical appendages including branched or unbranched and septate or aseptate.
Whitton & al. (2002), who provided a synoptic table of morphological features
that distinguish the then-accepted Camposporium species, provided a key to
15 species. Adamcik & al. (2015) provided an expanded synoptic table that
includes one additional species.
China has an extensive territory with complex ecological environments
and abundant plant resources, which provide rich habitats for survival and
multiplication of various microbial species. Several mycological investigations
dealing with many new genera or species from southern China were published
recently (e.g. Xia & al. 2015, 2016, Ma & al. 2016, Ai & al. 2019, Xu & al.
2019). During ongoing mycological surveys in southern China, an interesting
hyphomycete with morphological features of Camposporium was collected on
dead branches. It differs remarkably from previously described taxa, and is
proposed here as a new species, C. chinense.
Materials & methods
Samples of dead branches were collected from humid environments or waterside
in the forests of southern China and taken to the laboratory in Ziploc™ plastic bags,
where they were processed and examined as described by Ma & al. (2011). Conidia
and conidiophores were measured and photographed using a Nikon Eclipse E200
microscope and a SmartV550Dc digital camera, with a 100x (oil immersion) objective.
Adobe Photoshop 7.0 was used for image processing to assemble photographs into a
plate, with backgrounds replaced for esthetic reasons. The specimen was deposited in
the Herbarium of Jiangxi Agricultural University, Plant Pathology, Nanchang, China
(HJAUP).
Taxonomy
Camposporium chinense Z.H. Xu, Jian Ma, X.G. Zhang & R.F. Castafieda,
sp. nov. FIG. 1
IF 557232
Differs from Camposporium fusisporum by its longer and narrower conidia with a single,
aseptate apical appendage; and from C. laundonii by its distinctly longer and wider
conidiophores and its fusiform conidia with more eusepta and a single, aseptate apical
appendage.
Type: China, Jiangxi Province, Jinggangshan Mountain, on dead branches of an
unidentified broadleaf tree, 6 November 2014, J. Ma (Holotype, HJAUP M0298).
EryMo_oey: refers to the country in which the fungus was collected.
Camposporium chinense sp. nov. (China) ...
A BT C D E F
unig:
wigz
wint9z
wit9Z
i
E
Fic. 1. Camposporium chinense (holotype, HJAUP M0298).
A-C. Conidiophores, conidiogenous cells, conidia; D. Conidiophore and conidiogenous cell;
E. Conidiogenous cell and conidia; F. Conidia.
COLONIES on natural substratum effuse, minute, brown. Mycelium partly
superficial, partly immersed, composed ofbranched, septate, smooth, subhyaline
to pale brown hyphae. CoNIDIOPHORES macronematous, mononematous,
unbranched, erect, straight or flexuous, cylindrical, brown to dark brown, paler
toward the apex, smooth, 8-16-septate, 220-400 x 7-9.5 um. CONIDIOGENOUS
CELLS polyblastic, terminal, integrated, sympodial extended, denticulate, pale
brown to subhyaline, smooth, 18.5-26 x 5-7 um, with narrowly cylindrical,
pale brown, smooth denticles at the conidiogenous loci. Conidial secession
rhexolytic. Conip1a solitary, acropleurogenous, elongate fusiform, brown
or pale brown, the end cells paler than the other 9-12-euseptate, 110-160 x
12.5-16 um (appendage excluded), truncate at the base, with a distinct basal
75
76 ... Xu & al.
frill, 0.5-1.5 um in length and with an unbranched, continuous, pale brown to
subhyaline, smooth apical appendage, <100 um length, 2-3 um diam.
ComMENTs - Among the known species of Camposporium, only C. fusisporum
Whitton &al. (Whitton & al. 2002) is similar to C. chinense in producing typically
fusiform conidia, but C. fusisporum has shorter and wider conidia (86-115 x
13.5-19 um) with 2-3 apical appendages (17-40 um long). Also C. laundonii M.B.
Ellis (Ellis 1976) bears some resemblance to C. chinense in conidial shape, but
C. laundonii has distinctly shorter and narrower conidiophores (<40 x 5-8 um),
and cylindrical to fusiform, 4-9-euseptate, shorter conidia (50-150 um long)
with 1-2 hyaline, septate apical appendages, <60 um long.
Key to Camposporium species
_
. Conidia without apical appendages ........... cic eee eee eee ee 2
<Conidia with-apical appenda cess! Fc ise Fes oid Page «BR gt mee agt oP age Pte oho o BPs 4
2. Conidia subuliform, hyaline, 48-108 x 3-4 um, 6-12-euseptate
ASE ONICIASCY NN TIC AN Oe PAR aah ig hOPe ei sP OR cP cake Bis abe Reg ick Pia ube Rua heh gt 3
3. Conidia pale brown, 20-35 x 8-12 um, (3-)7-euseptate ............. C. ontariense
3. Conidia dark brown, paler end cells, 21.6-72 x 3.6-7.2um, 3-14-euseptate
se rere a RA eS red Sse eine Mina Pea me Nem bP Rar rieY Bir C. indicum
4-Gonidial appendage branched: 3. cies 5 eesege owt teye & eee Hanae Fale BAe lee Eke et Pe 5
4, Genidial.appendapeinbranched ye nx ©. ‘aus © cates <b sar 25s 23 ews o8 2 ee on CE 6
5. Conidia pale brown, 40-70 x 6-8 um, 7-1l-euseptate .............. C. japonicum
5. Conidia brown, paler end cells, 80-112 x 6.4-9.6 um, 8-15-euseptate .. C. ramosum
Ov CONIA RONCOLOTOUS tant nari neal nent nate ake bekele akct nen eRe es 7
6) Gonidia-versicolorousss, «sy ios bbe FG Ge} Ge FS PES PS Se be be be 10
7. Conidia with a single, unbranched appendages ............. cc cece eee eee eee 8
7. Conidia with 1-2 or 1-4 independent apical appendages ...................0.. 2
8. Conidia cylindrical to fusiform, 20-75 x 3-5 um,
2=A(56)=euseptate: yes dao sash > taeM teed thea } Yaa Lomo Pe os C. hyalinum
8. Conidia cylindrical to cylindric-fusoid, (24.7-)33(-44) x (4.5-)4.7(-6.5) um,
b= 1O-euseptate?, fogs hehe. ks ae ts Heo Teas wads Hho Oo Ges C. marylandicum
9. Conidia cylindric-fusoid, 25.8-36 x 7.2-9 um, 2-6-euseptate,
wWithsl=Dcapical appendages. keds. ens bee ark tactile, wocee a beetle Sears C. microsporum
9. Conidia cylindrical, 32.4-54 x 3.6-7.2 um, 5-9-euseptate,
with-l=4 apigal appendages: fas F hnat-, seamen ls Shek EN 3 C. hyderabadense
PGE Ord CTA ETS BL OETA Pe ne Phi Maka ctl Mik sale Md tale Wid deals Red drial Mad saget a Wisk unl Redggit Risen 11
wl.
py.
Pee
12.
13.
13.
14.
14.
bey
15.
16.
16.
Camposporium chinense sp. nov. (China) ... 77
Conidia 86-115 x 13.5-19 um, 8-11(mostly 9)-euseptate,
with 2—=Sapieal appendaces sc assum stn weve utivabien lle taps leuk ya C. fusisporum
Conidia 110-160 x 12.5-16 um, 9-12-euseptate,
with a single, continuous apical appendage ...................00. C. chinense
Conidigawith-a stele appendage 2% flag whtoat late! ulettal lator Weta: Vaeals 13
Conidia with more than one apical appendage ............... 0... eee eee eee 15
Conidia 75.4-85.7 x 7-9um, 7-10-euseptate,
with 0-1 apical, aseptate conidial appendage ................ C. himalayanum
Conidial append ses Se ptaten aor, tc acess tavache, Hevea savages wane wamecie « avbcstiny bream 14
Conidia 62-115 x 8-10 um, 9-15-euseptate ..................000. C. cambrense
Conidia 78-140 x 7.5-12um, 7-16-euseptate ..............-.002- C. pellucidum
Conidia cylindrical to fusiform, 50-150 x 13-17 um, 4-9-euseptate
Conidia cylindrical, notexcéeding 78 9 [UM «02 5 iste swine siawele blawele va auld 16
Conidia 42-78 x 7.5-9 um, 4-14-euseptate .................000- C. antennatum
Conidia 28-45 x 3.5-4.5 um, 5-9-euseptate .............. 2-22 C. quercicola
Acknowledgments
The authors express gratitude to Dr. Josiane S. Monteiro (Museu Paraense Emilio
Goeldi, Belém, Brazil) and Dr. De-Wei Li (The Connecticut Agricultural Experiment
Station Valley Laboratory, Windsor CT, USA) for serving as pre-submission reviewers
and to Dr. Shaun Pennycook for nomenclatural review and Dr. Lorelei L. Norvell
for editorial review. This project was supported by the National Natural Science
Foundation of China (Nos. 31970018, 31760513, 31360011).
Literature cited
Adam¢ik S, Cai L, Chakraborty D, Chen XH, Cotter H Van T, Dai DQ, Dai YC & al. 2015. Fungal
biodiversity profiles 1-10. Cryptogamie, Mycologie 36: 121-166.
https://doi.org/10.7872/crym/v36.iss2.2015.121
AiCC, MaJ, Zhang K, Castaneda-Ruiz RF, Zhang XG. 2019. Cordana meilingensis and C. lushanensis
spp. nov. from Jiangxi, China. Mycotaxon 134: 329-334. https://doi-org/10.5248/134.329
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew, Surrey,
England. 608 p.
Ellis MB. 1976. More dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew,
Surrey, England. 507 p.
Harkness HW. 1884. New species of California fungi. Bulletin of the California Academy of
Sciences 1: 29-47.
Hughes SJ. 1951. Studies on micro-fungi. III. Mastigosporium, Camposporium, and Ceratosporium.
Mycological Papers 36. 43 p.
Index Fungorum. 2020. Fungal names search. http://www.indexfungorum.org/names/Names.asp
[accessed 26 January 2020].
Ma J, Wang Y, O’Neill NR, Zhang XG. 2011. A revision of the genus Lomaantha, with the description
of a new species. Mycologia 103: 407-410. https://doi.org/10.3852/10-176
78. 0:
Xu &al.
Ma J, Zhang XG, Castafieda-Ruiz RE 2016. Podosporiopsis, a new genus of synnematous
hyphomycetes from China. Mycotaxon 131: 773-780. http://dx.doi.org/10.5248/131.773
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Whitton SR, McKenzie EHC, Hyde KD. 2002. Microfungi on the Pandanaceae: two new species of
Camposporium and key to the genus. Fungal Diversity 11: 177-187.
Xia JW, Ma YR, Gao JM, Li Z, Zhang XG. 2015. Codinaea jianfenglingensis sp. nov. and new records
from southern China. Mycotaxon 130: 835-841. https://doi.org/10.5248/130.835
Xia JW, Ma YR, Gao JM, Li Z, Zhang XG. 2016. Sympodiosynnema, a new genus of dematiaceous
hyphomycetes from southern China. Mycotaxon 131: 45-48. https://doi-org/10.5248/131.45
Xu ZH, Zhang K, Zhang XG, Castafieda-Ruiz RF, Ma J. 2019. Cacumisporium fusiforme sp. nov.
from Jiangxi, China. Mycotaxon 134: 275-279. https://doi.org/10.5248/134.275
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021— Volume 136, pp. 79-83
https://doi.org/10.5248/136.79
Helicoma barretoi sp. nov.
from the Brazilian Atlantic rainforest
GABRIEL GINANE BARRETO’, LUANA TEIXEIRA DO CARMO’,
Luis FERNANDO PASCHOLATI GUSMAO?
' Universidade Federal de Pernambuco, Programa de P6s-graduagao em Biologia de Fungos,
Av. Prof. Nelson Chaves, s/n, Cidade Universitaria, 50670, Recife, Pernambuco, Brazil
? Universidade Estadual de Feira de Santana, Programa de Pés-graduacgdo em Botanica,
Av. Transnordestina s/n, Novo Horizonte, 44036-900, Feira de Santana, Bahia, Brazil
* CORRESPONDENCE TO: lgusmao@uefs. br
ABSTRACT—A new species, Helicoma barretoi, collected on dead twigs in Paraiba State of
northeastern Brazil, is described and illustrated. It is distinguished by frequent branched
conidiophores, cylindrical conidiogenous cells constricted at basal septa, and broad terminal
denticles.
Key worps—helicosporic fungi, tropical fungi, Tubeufiaceae, Tubeufiales
Introduction
During a survey of microfungi on miscellaneous plant debris in the
Atlantic rainforest, an interesting specimen related to Helicoma Corda (1837)
was collected. Based on molecular data, Helicoma is phylogenetically placed
in the Tubeufiaceae, Tubeufiales (Barr 1979, Boonmee & al. 2014). Lu & al.
(2018) accepted 57 and excluded 12 species, although there are 99 epithets
listed in Index Fungorum (2020) and more than a hundred in Mycobank
(2020). Helicoma is characterized by conidiophores that are macronematous,
mononematous, erect, cylindrical, branched or unbranched, and pale brown
or dark brown. The conidiogenous cells are mono- or polyblastic, integrated,
sympodial, intercalary and/or terminal, cylindrical with tiny or tooth-like
denticles, and smooth walled. The conidia are dry, solitary, acropleurogenous
or pleurogenous, helicoid, coiled in two or three dimensions (becoming loosely
80 ... Barreto, Carmo, Gusmao
coiled in water), multiseptate, hyaline to pale brown, and non-hygroscopic
(Goos 1986, Seifert 2011, Lu & al. 2018).
Material & methods
Miscellaneous plant debris substrates were collected during expeditions in Fazenda
Engenho Mineiro (Areia, Paraiba, Brazil). Samples were placed in separate paper bags,
taken to the laboratory, and processed according to Castafeda-Ruiz & al. (2016).
The samples were incubated in Petri dish moist chambers at room temperature in
polystyrene containers and examined daily. Microfungal reproductive structures
placed on microscope slides prepared with PVL (polyvinyl alcohol and lactic acid)
were measured and photographed using a microscope equipped with Differential
Interference Contrast (DIC). The holotype was deposited in the Herbarium,
Universidade Estadual de Feira de Santana, Feira de Santana, Bahia, Brazil (HUEFS).
Taxonomy
Helicoma barretoi G.G. Barreto, L.T. Carmo & Gusmao, sp. nov. PLATE 1
MB 834819
Differs from other Helicoma species by its frequently branched conidiophores and
cylindrical conidiogenous cells constricted at basal septa and with broad terminal
denticles.
Type: Brazil, Paraiba State: Areia, Fazenda Engenho Mineiro, 6°57’48’S 35°41’30’W,
on decaying twigs of an unidentified plant, 15.VIII.2019, coll. G.G. Barreto (Holotype,
HUEFS254151).
Erymotoey: honoring Francisco Haroldo Barreto, the owner of the farm where the
holotype specimen was collected.
COLONIES on natural substrate effuse, dark brown. Mycelium immersed and
superficial, composed of branched, septate, brown, smooth hyphae, 7-8 um
wide. CONIDIOPHORES macronematous, mononematous, cylindrical, erect,
slightly flexuous, mostly branched at the apex, sometimes simple, solitary or
aggregated in groups, smooth-walled or verrucose at the base, 6-22-septate,
sometimes branched, slightly constricted at the septa, dark brown at bases,
pale brown toward apex, 90-207.5 x 5-7.5 um. CONIDIOGENOUS CELLS mono-
or polyblastic, integrated, terminal, cylindrical, smooth-walled, with 1-2
percurrent extensions, constricted at the bases, brown to hyaline toward the
PiaTE 1. Helicoma barretoi (holotype, HUEFS 254151): A, B. Colonies on the natural substrate;
C. General aspect of conidiophores; D. Conidiogenous cells with constriction (arrow) and
young conidia; E. Branched conidiophores with conidia and evident septa (arrow); F. Percurrent
extensions (arrows); G. Ornamented basal cells of conidiophores; H-K. Conidia. Scale bars:
A, B =100 um; C = 50 um; D-G = 20 um, H-K= 10 um.
Helicoma barretoi sp. nov. (Brazil) ... 81
82 ... Barreto, Carmo, Gusmao
apex, 10-35 x 5-7.5 um, with terminal and broad denticles, 1.3-1.5 um diam.,
pale brown to hyaline toward the denticles. Conidial secession schizolytic.
CONIDIA acrogenous, single, dry, smooth, guttulate, hyaline, tightly coiled
1% times, 18-23.5 um diam., conidial filament hyaline, 5-10 um thick, 9-11
septa (sometimes indistinct), apex rounded, bases truncate, U-shaped, also
smooth-walled.
Notes: Helicoma barretoi differs from similar species primarily in the (3-4)
lateral branching pattern of the conidiophores and the large conidiogenous
cell with broad denticles. Helicoma ambiens Morgan, which like H. barretoi
possesses U-shaped basal conidial cells, is distinguished by its rarely branched
conidiophores and acropleurogenous conidia (Morgan 1892, Zhao & al.
2007). Helicoma dennisii M.B. Ellis produces similarly shaped conidia but is
separated from H. barretoi by its acropleurogenous and pigmented conidia
with V-shaped basal cells and rarely branched conidiophores (Ellis 1963,
Zhao & al. 2007). Helicoma divaricatum Hol.-Jech. also has similar conidia
but can be distinguished by its dichotomously branched conidiophores and
acropleurogenous conidia (Holubova-Jechova 1987). Helicoma vaccinii Carris,
which also produces percurrent proliferations, can be distinguished from
H. barretoi by its smaller (2-4 um) conidial filaments, narrower (8-13 um)
conidia, and unbranched conidiophores (Carris 1989, Zhao & al. 2007).
Helicoma guttulatum Y.Z. Lu & al. and H. hydei N.G. Liu & al. have guttulate
conidia like H. barretoi; however H. guttulatum has hyaline to pale brown
conidia and unbranched conidiophores (Hyde & al. 2016), and H. hydei has
unbranched conidiophores and larger conidia (19-39 um diam; Liu & al. 2019).
Acknowledgments
We are indebted to Dr. Rafael EF Castafieda Ruiz (INIFAT, Tropical Alejandro
de Humboldt, Habana, Cuba) and Dr. Huzefa A. Raja (University of North
Carolina, Greensboro, USA) for critical reviews of the manuscript. LTC is grateful
to the “Programa de Pés-graduacao em Botanica (PPGBot/UEFS).” GGB thanks the
“Programa de Pés-graduacao em Biologia de Fungos (PPGBF/UFPE).” LTC, GGB,
and LFPG (Proc. 312984/2018-9) are grateful to the Nacional Council for Scientific
and Technological Development (CNPq).
Literature cited
Barr ME. 1979. A classification of Loculoascomycetes. Mycologia 71: 935-957.
https://doi.org/10.1080/00275514.1979.12021099
Boonmee S, Rossman AY, Liu JK, Li WJ. 2014. Tubeufiales, ord. nov., integrating sexual and asexual
generic names. Fungal Diversity 68: 239-298. https://doi.org/10.1007/s13225-014-0304-7
Carris LM. 1989. Vaccinium fungi: Helicoma vaccinii sp. nov. Mycotaxon 36(1): 29-34.
Helicoma barretoi sp. nov. (Brazil) ... 83
Castafieda-Ruiz RF, Heredia G, Gusmao LFP, Li DW. 2016. Fungal diversity of Central and South
America. 197-217, in: DW Li (ed.). Biology of microfungi. New York, Springer International
Publishing. https://doi.org/10.1007/978-3-319-29137-6_9
Corda ACJ. 1837. Icones fungorum hucusque cognitorum 1. 32 p.
Ellis MB. 1963. Dematiaceous hyphomycetes. IV. Mycological Papers 87. 42 p.
Goos RD. 1986. A review of the anamorph genus Helicoma, Mycologia 78(5): 744-761.
https://doi.org/10.2307/3807519
Holubova-Jechova V. 1987. Studies on hyphomycetes from Cuba V. Six new species of
dematiaceous hyphomycetes from Havana Province. Ceska Mykologie 41(1): 29-36.
Hyde KD, Hongsanan S, Jeewon, R, Bhat DJ, McKenzie EHC & al. 2016. Fungal diversity notes
367-490: taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 80: 1-270.
https://doi.org/10.1007/s13225-016-0373-x
Index Fungorum. 2020. http://www.indexfungorum.org/names/names.asp [accessed February
2020].
Liu NG, Lu YZ, Bhat DJ, McKenzie EHC, Lumyong S, Jumpathong J & al. 2019. Kevinhydea
brevistipitata gen. et sp. nov. and Helicoma hydei sp. nov., (Tubeufiaceae) from decaying wood
habitats. Mycological Progress 18: 671-682. https://doi.org/10.1007/s11557-019-01480-8
Lu YZ & al. 2018. A taxonomic reassessment of Tubeufiales based on multi-locus phylogeny and
morphology. Fungal Diversity 92: 131-344. https://doi.org/10.1007/s13225-018-0411-y
Morgan, AP. 1892. North American Helicosporae. Journal of the Cincinnati Society of Natural
History. 15: 39-52,
Mycobank. 2020. http://www.mycobank.org/quicksearch.aspx [accessed February 2020].
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Zhao GZ, Liu XZ, Wu WP. 2007. Helicosporous hyphomycetes from China. Fungal Diversity 26:
313-524.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 85-95
https://doi.org/10.5248/136.85
Teratospermopsis gen. nov. for Chaetendophragmia protuberata,
with a taxonomic review of Teratosperma
ZHAO-HUuAN Xu’, LING Qiu’, XIU-GUO ZHANG’,
RAFAEL F. CASTANEDA-RUuIZ‘, JI-WEN X1A3, JIAN Ma??*
‘College of Agronomy, Jiangxi Agricultural University, Nanchang, Jiangxi 330045, China
? Jiangxi Key Laboratory for Conservation and Utilization of Fungal Resources,
Jiangxi Agricultural University, Nanchang, Jiangxi 330045, China
> Department of Plant Pathology, Shandong Agricultural University,
Taian, Shandong 271018, China
‘ Instituto de Investigaciones Fundamentales en Agricultura Tropical ‘Alejandro de Humboldt’
(INIFAT), Académico Titular de la “Academia de Ciencias de Cuba’,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P. 17200
* CORRESPONDENCE TO: [email protected]; [email protected]
ABSTRACT— Teratospermopsis is proposed as a new genus for Chaetendophragmia protuberata
[= Teratosperma microsporum]. The genus has acrogenous, solitary, euseptate conidia
seceding schizolytically from monoblastic, integrated, terminal, annellidic conidiogenous
cells. The conidia are obclavate, smooth, and with an apical cell with a filiform appendage and
a basal cell with a lateral appendage. A key and a synoptic table to six accepted Teratosperma
species accompany comments on four rejected or dubious species, including T: macrosporum
[= Endophragmiella macrospora comb. nov.].
KEY worDsS—asexual Ascomycota, hyphomycetes, saprobes, taxonomy
Introduction
Teratosperma Syd. & P. Syd. was erected by Sydow & Sydow (1909) with
T. singulare as the type species, and was mainly characterized by solitary,
holoblastic conidia seceding rhexolytically from annellidic conidiogenous cells.
The conidia bear lateral appendages which arise from the basal (or occasionally
suprabasal) cell (Sydow & Sydow 1909; Ellis 1957, 1971; Wu & Zhuang 2005).
Ellis (1957), who examined the type collection of T. singulare, monographed
86 ... Xu & al.
"GL61 PUITYSNs}eY . “6TOT ‘Te 29 JOULPSITY ; ‘ZS61 SIA ; Woy eyeq
GL-S X OF-8I vI-Ol
aN -vyarpvja1914.44, SC - L-L'S X LS-8T wunyonotpuadduun °
-P191Pv] A I €L-T9 6-9 ae ee 8 € 1191p L
CI-S X SSS CC-LI
ayl-vpJa1odsouayja I-Z I- 1-9 X SP-ZI JVINSUIS *
-PIL 12S ed 0 OI-€ oi Oe OI-9 x Sp-Z 1 AVINBUIS *T,
9-S X 9C-9T 6-GL
uMOUyU $= I-S x O€Z-€S siplajdouvsn1p “I,
uy) Ie-I v € x S€-97 € O€T-€ z
b-T X OS-OT ZI-v1
aI] -vyJasodsouaja OI-Z T1-¥P II-9 X 901-SS winsasIUsog *
a ist /€-1 x 00Z-0L 4
GS-GP X 9- SL :
umouyuy, var SP-SE (v-)e(-T) S-S'€ X 06-07 _ nqopnaipuaddo °]
/T x 0S-LT
€-@ X 81-7 rie
aI] -v]Ja4odsouaja -¢ - -€ X 0OT- 1PAVIDUD *
-P Il 1S IS-I €-G'T CAG Racert S-€ X 0OIT-SZ 1 Hp. L
i i i
oa) ats ay. NOLLV.LdaS (om) (urn)
Hd¥OWVNVNAS /AAGWOAN ADVANAddY HLGIM Tvsvg AZIS
SHUOHAOIGINO’) SHIOAdS
VIGINO’)
pulsadsoqpsay, JO saidads paydasor jo sisdouds t ATAVI,
Teratospermopsis gen. nov. (China) ... 87
the genus with illustrations and redescriptions of five accepted species:
T. anacardii, T: appendiculatum, T. cornigerum, T: pulchrum, and T. singulare.
Hughes (1971) briefly noted the Endophragmiella-like proliferations after
rhexolytic conidium secession in T. singulare, T. cornigerum, and Sporidesmium
subulatum. Later, Hughes (1979) transferred S. subulatum and S. sclerotivorum
(Uecker & al. 1978) to Teratosperma, treating T: pulchrum as a synonym
of T: cornigerum and drawing attention to the occurrence of synanamorphs
within the genus. Matsushima (1975, 1980) described T uniappendiculatum
from Japan and T! litchii from Taiwan. Five further species—T. lichenicola,
T. oligocladum, T. microsporum, T. macrosporum, and T: dicranopteridis—
were added by Hawksworth (1979), Uecker & al. (1980), Kirk (1985), Wu &
Zhuang (2005), and Kirschner & al. (2019). However, T! litchii, transferred to
Solicorynespora R.F. Castafieda & W.B. Kendr. by Castafieda-Ruiz & Kendrick
(1990), was later transferred to Morganjonesia R.F. Castaneda & al. by Zhang
& al. (2019) due to its monotretic conidial ontogeny and conidia with a
hyaline, acute or subulate conidial appendage. Subramanian (1992) transferred
T. subulatum to Repetophragma Subram. although its rhexolytic conidial
secession differs from that of Repetophragma (Hughes 1979). Kirschner &
al. (2019) excluded T. oligocladum from Teratosperma based on the absence
of annellidic conidiogenous cells and its conidial appendages arising from
suprabasal cells. Thus, eleven species have appeared under the genus
Teratosperma, most of which are reported to have close associations with
lichens, algae, or other fungi (Ellis 1957, Matsushima 1975, Hawksworth 1979,
Hughes 1979, Uecker & al. 1980, Kirk 1985, Wu & Zhuang 2005).
It is evident a revision of Teratosperma is needed, as the genus has become
heterogenous by including species with schizolytic conidial secession (Kirk
1985) as well as species producing conidia without appendages (Hawksworth
1979, Hughes 1979, Wu & Zhuang 2005). Following detailed study of the
species and comparison with the type species, T’ singulare, which has conidia
with basal appendages, annellidic conidiogenous cells, and rhexolytic
conidial secession, we now accept six species in Teratosperma (TABLE 1). We
exclude T. sclerotivorum and T: subulatum, regard Teratosperma lichenicola
as synonymous with Endophragmiella corticola (Kirk 1982), and transfer
Teratosperma macrosporum to Endophragmiella B. Sutton (Sutton 1973) as a
new combination.
Teratosperma microsporum produces conidia with schizolytic conidial
secession and a lateral appendage arising from the basal cell, which
does not agree with the generic concepts of either Teratosperma or
Chaetendophragmia Matsush. (Matsushima 1971). Therefore we propose a
88 ... Xu & al.
new genus, Teratospermopsis, typified by Chaetendophragmia protuberata, with
Teratosperma microsporum as a heterotypic synonym.
Taxonomy
Teratospermopsis Jian Ma, X.G. Zhang & R.E. Castafieda, gen. nov.
IF 557315
Differs from Teratosperma by its schizolytic conidial secession; and from
Chaetendophragmia by its schizolytic conidial secession and its conidial basal cell with
a lateral appendage.
TYPE SPECIES: Chaetendophragmia protuberata R.E. Castafieda [= Teratospermopsis
protuberata (R.F. Castaneda) Jian Ma & al.]
EryMo_oey: “Teratosperm-” from the Latin Teratosperma, “opsis” = similar, referring to
the similarity of the genus to Teratosperma.
CONIDIOPHORES macronematous, mononematous, single or in groups, simple,
cylindrical, erect, straight or flexuous, smooth, septate, pale brown to dark
brown, determinate or with percurrent proliferations. CONIDIOGENOUS CELLS
monoblastic, integrated, terminal, cylindrical, smooth, pale brown to brown.
Conidial secession schizolytic. CONIDIA acrogenous, solitary, appendiculate,
obclavate or fusiform, sometimes rostrate, brown to dark brown, euseptate,
with one or more lateral appendages arising from the basal cell.
Teratospermopsis protuberata (R.F. Castafieda) Jian Ma, X.G. Zhang & R.E
Castafieda, comb. nov. FIG. 1
IF 557316
= Chaetendophragmia protuberata R.F. Castafeda, Deuteromyc.
Cuba, Hyphomycetes 3: 7 (23 May 1985).
= Teratosperma microsporum P.M. Kirk, Mycotaxon 23: 345 (19 July 1985),
[as ‘microspora’].
CoMMENTS—Chaetendophragmia protuberata and Teratosperma microsporum
are proposed as synonyms, based on close examination of their descriptions and
illustrations. Both names were proposed in 1985, but C. protuberata [accepted
30 April (Castafieda-Ruiz 1985: 1); published 23 May (Castafeda-Ruiz pers.
comm.)] has priority over T! microsporum [published 19 July (Mycotaxon 24:
inside front cover)].
Teratospermopsis protuberata is quite different from Chaetendophragmia
and Teratosperma by its schizolytic conidial secession, and further from
Chaetendophragmia which produces conidia with lateral appendages arising
from the middle cells. The species shares a similar conidial ontogeny with
Repetophragma (Subramanian 1992) but differs by producing conidia with a
Teratospermopsis gen. nov. (China) ... 89
Oey rir rrs:
Prone rar
SEES
=
wuINl0Z
Fic. 1. Teratospermopsis protuberata (holotype, INIFAT C85/77-3).
A. Conidiophore, conidiogenous cell, and conidium;
B. Conidiophore, and conidiogenous cell; C. Conidia.
90 ... Xu & al.
lateral appendage arising from the basal cell. As its morphology prohibits this
fungus from inclusion in any previously described hyphomycete genus, we
erect a new genus, Teratospermopsis, to accommodate it.
Currently accepted Teratosperma species
Teratosperma anacardii Hansf., Proc. Linn. Soc. London 155: 54 (1943).
= Podoconis anacardii (Hansf.) S. Hughes, Mycol. Pap. 48: 65 (1952).
CoMMENTS—Hansford (1943) assigned this fungus to Teratosperma, but
Hughes (1952) transferred it to Podoconis Boedijn due to conidial development
and morphological characters. Hughes (1952) pointed out that a Selenosporella-
like synanamorph occurs on conidia of this species, or on independent
conidiophores. Ellis (1957) examined the type and other specimens of this
species and still accepted itin Teratosperma by virtue of annellidic conidiogenous
cells that produce phragmoconidia with 1-3 lateral appendages from the
basal cell. Ellis (1958) synonymised Podoconis under Sporidesmium Link, but
P. anacardii differs from Sporidesmium by its annellidic conidiogenous cells
that produce conidia with basal appendages, and rhizolytic conidial secession.
Following Ellis (1957), the basionym Teratosperma anacardii has been accepted
by Hawksworth (1979) and Kirschner & al. (2019) and is considered the
appropriate name. This species has been reported from Ghana, New Guinea,
Nigeria, Sierra Leone, Uganda, and Tanzania (Ellis 1957, Hawksworth 1979).
Teratosperma appendiculatum (S. Hughes) M.B. Ellis,
Mycol. Pap. 69: 6 (1957).
= Annellophora appendiculata S. Hughes, Trans. Br.
Mycol. Soc. 34(4): 548 (1952 [“1951”]).
ComMMENTS— This species was originally assigned to Annellophora S. Hughes,
and subsequently transferred to Teratosperma by Ellis (1957) based on its
phragmoconidia with a single lateral appendage arising from the basal cell.
A Selenosporella-like synanamorph has not been recorded for this species.
Teratosperma appendiculatum is morphologically most similar to T. anacardii,
but differs mainly in conidial size, basal scar width, and size and number of
appendages. This species has been recorded from Brazil, Ghana, and USA (Ellis
1957, Sutton & Hodges 1977).
Teratosperma cornigerum (Ellis & Everh.) M.B. Ellis, Mycol. Pap. 69: 5 (1957).
= Clasterosporium cornigerum Ellis & Everh., Proc. Acad. Nat. Sci. Philad. 43: 91 (1891).
= Clasterosporium pulchrum Ellis & Everh., Proc. Acad. Nat. Sci. Philad. 45: 169 (1893).
= Teratosperma pulchrum (Ellis & Everh.) M.B. Ellis, Mycol. Pap. 69: 4 (1957).
Teratospermopsis gen. nov. (China) ... 91
CoOMMENTS—Ellis (1957) examined the type specimens of Clasterosporium
cornigerum and C. pulchrum, and transferred them both into Teratosperma
based on their annellidic conidiogenous cells producing phragmoconidia
with 1-3 lateral appendages from the basal cell. Ellis (1971) pointed out that
T. cornigerum and T: pulchrum were possibly conspecific, although their type
specimens looked different. Hughes (1979), who examined the type and five
other specimens, treated T. pulchrum as a synonym of T! cornigerum but did
not explain or justify his decision. Teratosperma cornigerum has been recorded
from Canada, China, USA, and UK (Ellis 1957, Hughes 1979, Wu & Zhuang
2005, Xia & al. 2016).
Teratosperma dicranopteridis R. Kirschner, Taiwania 64(2): 172 (2019).
CoMMENTS— Teratosperma dicranopteridis was described on discolored living
and dead leaves of Dicranopteris linearis in Taiwan and is characterized by
annellidic conidiogenous cells that produce obclavate, 3—-5-septate conidia with
the basal cell bearing 1-3 lateral, 2-4-septate appendages. Secondary conidium
production was not found on this species. Kirschner & al. (2019) compared
this species with closely related species, T: anacardii and T: singulare based on
conidial size and appendages.
Teratosperma singulare Syd. & P. Syd., Ann. Mycol. 2: 172 (1909).
CoMMENTS— Teratosperma singulare is the type species of Teratosperma and
is known on woody plants including Fagus crenata, Liquidambar macrophylla,
Quercus germana, Ulmus parvifolia, and U. macrocarpa, usually in association
with other fungi. This species has been reported from China, Japan, and
Mexico (Ellis 1957, 1971, Matsushima 1975, Guo 1989, Heredia & al. 1995, Wu
& Zhuang 2005, Kobayashi 2007).
Teratosperma uniappendiculatum Matsush.,
Icon. Microfung. Matsush. Lect.: 152 (1975).
CoMMENTS—Matsushima (1975) described this species on dead leaves of
Osmanthus ilicifolius and discovered the “Verticicladiella-like’ anamorph
in culture. Teratosperma uniappendiculatum bears some resemblance to
T. cornigerum in conidial shape but is distinguished by its narrower conidia
with fewer basal appendages. Sutton & Hodges (1977) redescribed it from bark
of Eucalyptus saligna in Brazil. This species has been reported from Brazil,
China, Japan, and USA (Matsushima 1975, Sutton & Hodges 1977, Wu &
Zhuang 2005).
92 ... Xu & al.
Rejected or dubious Teratosperma species
Endophragmiella macrospora (W.P. Wu) Jian Ma, X.G. Zhang &
R.E Castafieda, comb. nov.
IF 557317
= Teratosperma macrosporum W.P. Wu, Fungal Divers. Res. Ser. 15: 326 (2005).
ComMMENTS—To our knowledge, this species is known only from its type
collection. Its conidial appendages arise from apical and subapical cells,
not from the basal cell, rendering it nontypical in Teratosperma; however a
similar characteristic was also found in Endophragmiella gardeniae Jian Ma &
X.G. Zhang and E. machili Jian Ma & X.G. Zhang (Ma & al. 2012). In addition,
the species exhibits percurrently extending conidiogenous cells and rhexolytic
conidial secession. Thus, we transfer T’ macrosporum to Endophragmiella,
where it is easily distinguished from E. gardeniae and E. machili by its conidial
size and septation.
Endophragmiella corticola P.M. Kirk, Trans. Br. Mycol. Soc. 78(1): 60 (1982).
= Teratosperma lichenicola D. Hawksw., Bull. Brit. Mus. (Nat. Hist.), Bot. 6(3): 262 (1979).
CoMMENTS—After examining a single collection, Hughes (1952) determined
this fungus as Podoconis sp. based on the conidial shape Hawksworth (1979),
who discovered additional material, described it as a new Teratosperma
species with close affinity to T: anacardii. Our examination of the description
and illustration of T: lichenicola revealed that this fungus differed from the
generic concept of Teratosperma in lacking conidial appendages on the basal
cell. Instead, it exhibits the key characters of Endophragmiella: percurrently
proliferating conidiogenous cells, rhexolytic conidial secession, and solitary
conidia without lateral appendages. This fungus has obclavate, brown to
dark brown, 2-3-septate conidia with a subhyaline or pale brown apical cell
occasionally bearing a Selenosporella-like synanamorph, all characters found
in E. corticola, except for the synanamorph. We consider T. lichenicola and
E. corticola to be conspecific.
Teratosperma sclerotivorum (Uecker, W.A. Ayers & P.B. Adams) S. Hughes,
New Zealand J. Bot. 17: 178 (1979), [as ‘sclerotivora’].
= Sporidesmium sclerotivorum Uecker, W.A. Ayers &
P.B. Adams, Mycotaxon 7: 276 (1978).
ComMMENTS— Uecker &al. (1978) tentatively placed this fungus in Sporidesmium.
It is characterized by the formation of solitary, holoblastic conidia on simple or
branched conidiophores, which sometimes undergo percurrent proliferation,
Teratospermopsis gen. nov. (China) ... 93
and by the production ofa Selenosporella-like synanamorph. The gently tapered,
phragmoseptate conidia secede rhexolytically from conidiogenous cells. Based
on these features, Hughes (1979) transferred it to Teratosperma. However,
the species lacks the distinctive conidial basal appendages and does not fully
conform to what can be considered the central, hallmark characteristics by
which Teratosperma is conceptualized, and its presence in Teratosperma has
not been generally accepted (Bullock & al. 1989, Litkei 1989, Mischke & Adams
1996, Mischke 1998). Moreover, the rhexolytic conidial secession of this species
does not conform to that of Sporidesmium. Wu & Zhuang (2005) redescribed
T. sclerotivorum from fungal sclerotia and decaying leaves of unidentified plants
in China, but their description does not mention a conidial appendage arising
from the basal cell and differs from the description by Uecker & al. (1978) in
citing longer and narrower [55-130 x 5-6.5 um vs 60-92 x 6-8 um] conidia
with more [8-19 vs (5—)6(-7)] septa, and the production of a Selenosporella-like
synanamorph on conidial apex, not on the hyphae as described by Uecker & al.
(1978). Based on the difference, we believe these specimens are not conspecific
and exclude the species from Teratosperma.
Teratosperma subulatum (Cooke & Ellis) S. Hughes,
New Zealand J. Bot. 17: 178 (1979).
= Ceratophorum subulatum Cooke & Ellis, Grevillea 17(83): 67 (1889).
= Sporidesmium subulatum (Cooke & Ellis) S$. Hughes, Mycol. Pap. 36: 31 (1951).
= Repetophragma subulatum (Cooke & Ellis) Subram., Proc. Indian
Natn. Sci. Acad. B 58(4): 185 (1992), [as ‘subulata’].
ComMMENTS—This species was originally described in Ceratophorum Sacc.,
and subsequently transferred to Sporidesmium by Hughes (1951) based on
the absence of a superficial ‘hyphopodiate’ foliicolous mycelium (Cooke 1889,
Hughes 1951). After examining a second collection, Hughes (1979) recombined
the species in Teratosperma based on the rhexolytic conidial secession,
annellidic conidiogenous cells, conidial morphology, and production of a
Selenosporella-like synanamorph. However, the absence of the distinctive lateral
appendages in conidia basal cell renders this species atypical in Teratosperma.
In addition, its sequence of septum formation in conidia differs from that
found in Endophragmiella socia and E. valdiviana (Hughes 1979). Subramanian
(1992), who transferred this species into Repetophragma based on its distinctive
conidiophore proliferation and euseptate conidial septation, ignored the
conidial secession, which was quite different from Repetophragma species.
Therefore, the placement of this fungus in a suitable genus is problematic.
94 ... Xu &al.
Key to accepted species of Teratosperma
1. Conidia with a single lateral appendage arising from the basal cell .............. 2
1. Conidia with more than one lateral appendage arising from the basal cell ........ 3
2. Conidia 17-50 x 7-9 um, (1-)3(-4)-septate .................. T: appendiculatum
2. Conidia 120-210 x 10-14 um, 6-9-septate ................ T. uniappendiculatum
eG) FNCU Rese! 1 Neca HG HUG n (aA Roemer Et CAE ogi a see ari tai Esa aie Ae te 4
Se set aNe Weal Op Gd be Ng I eb ee be i. Ae A RR sk URN A ME Be a 5
4, Conidia 17-30 x 4.5-7 um, 2-3-septate ... 0... eee eee eee T. anacardii
4, Conidia 26-35 x 7.5-9 um, 3—-5-septate ................2 2 ee eee T: dicranopteridis
5. Conidia 70-200 x 14-17 um, 4-12-septate ........... eee eee T. cornigerum
5. Conidia 60-130 x 17-22 um, 3-10-septate ...... eee eee eee eee T. singulare
Acknowledgments
The authors express gratitude to Dr. Flavia R. Barbosa (Universidade Federal de
Mato Grosso, Sinop, Brazil) and Dr. Patricia Oliveira Fiuza (Universidade Federal do
Rio Grande do Norte, Lagoa Nova, Brazil) for serving as pre-submission reviewers
and to Dr. Shaun Pennycook for nomenclatural review and Dr. Lorelei L. Norvell
for editorial review. This project was supported by the National Natural Science
Foundation of China (Nos. 31970018, 31760513, 31360011).
Literature cited
Bullock S, Willetts HJ, Adams PB. 1989. Morphology, histochemistry, and germination
of conidia of Sporidesmium sclerotivorum. Canadian Journal of Botany 67: 313-317.
https://doi.org/10.1139/b89-045
Castaneda-Ruiz RE. 1985. Deuteromycotina de Cuba. Hyphomycetes III. Instituto de Investigaciones
Fundamentales en Agricultura Tropical “Alejandro de Humboldt’, Habana, Cuba. 42 p.
Castafieda-Ruiz RF, Kendrick B. 1990. Conidial fungi from Cuba: I. University of Waterloo
Biology Series 33. 61 p.
Cooke MC. 1889. Omitted diagnoses. Grevillea 17(83): 65-69.
Ellis MB. 1957. Some species of Teratosperma. Mycological Papers 69. 7 p.
Ellis MB. 1958. Clasterosporium and some allied Dematiaceae-Phragmosporae. I. Mycological
Papers 70. 89 p.
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew, Surrey,
England. 608 p.
Guo YL. 1989. Foliicolous hyphomycetes of Shennongjia, Hubei Province. In Mycological and
Lichenological Expedition to Shennongjia, Academia Sinica. Fungi and lichens of Shennongjia.
World Publishing Corp, Beijing, China. 341-385 p.
Hansford CG. 1943. Contribution towards the fungus flora of Uganda. V.
Fungi Imperfecti. Proceedings Linnean Society London 155: 34-67.
https://doi.org/10.1111/j.1095-8312.1943.tb00340.x
Hawksworth DL. 1979. The lichenicolous hyphomycetes. Bulletin of the British Museum (Natural
History), Botany Series 6(3): 183-300.
Heredia G, Mercado-Sierra A, Mena-Portales J. 1995. Conidial fungi from leaf litter in a mesophilic
cloud forest of Veracruz, Mexico. Mycotaxon 55: 473-490.
Teratospermopsis gen. nov. (China) ... 95
Hughes SJ. 1951. Studies on micro-fungi. III. Mastigosporium, Camposporium, and
Ceratosporium. Mycological Papers 36. 43 p.
Hughes SJ. 1952. Fungi from the Gold Coast. I. Mycological Papers 48. 91 p.
Hughes SJ. 1971. Percurrent proliferation in fungi, algae, and mosses. Canadian Journal of
Botany 49: 215-231. https://doi.org/10.1139/b71-037
Hughes SJ. 1979. Relocation of species of Endophragmia auct. with notes on relevant generic names.
New Zealand Journal of Botany 17: 139-188. https://doi.org/10.1080/0028825X.1979.10426887
Kirk PM. 1982. New or interesting microfungi IV. Dematiaceous hyphomycetes
from Devon. Transactions of the British Mycological Society 78(1): 55-74.
https://doi.org/10.1016/s0007-1536(82)80077-6
Kirk PM. 1985. New or interesting microfungi XIV. Dematiaceous hyphomycetes from Mt
Kenya. Mycotaxon 23: 305-352.
Kirschner R, Lee PH, Huang YM. 2019. Diversity of fungi on Taiwanese fern plants: review
and new discoveries. Taiwania 64(2): 163-175.
Kobayashi T. 2007. Index of fungi inhabiting woody plants in Japan: Host, distribution and
literature. Zenkoku-Noson-Kyoiku Kyoikai Publishing.
Litkei J. 1989. Characteristics of isolates of Sporidesmium sclerotivorum Uecker, Ayers and Adams
in Hungary. Acta phytopathologica et entomologica hungarica 24: 311-315.
Ma J, Zhang YD, Ma LG, Castafieda-Ruiz RF, Zhang XG. 2012. Two new species of Endophragmiella
from southern China. Mycotaxon 119: 103-107. https://doi-org/10.5248/119.103
Matsushima T. 1971. Microfungi of the Solomon Islands and Papua-New Guinea. Published by the
author, Kobe, Japan.
Matsushima T. 1975. Icones microfungorum a Matsushima lectorum. Published by the author,
Kobe, Japan.
Matsushima T. 1980. Matsushima Mycological Memoirs 1. Published by the author, Kobe, Japan.
Mischke S. 1998. Mycoparasitism of selected sclerotia-forming fungi by Sporidesmium
sclerotivorum. Canadian Journal of Botany 76: 460-466. https://doi-org/10.1139/cjb-76-3-460
Mischke S, Adams PB. 1996. Temporal and spatial factors affecting germination of macroconidia
of Sporidesmium sclerotivorum. Mycologia 88: 271-277.
Subramanian CV. 1992. A reassessment of Sporidesmium (hyphomycetes) and some related
taxa. Proceeding of the Indian National Science Academy, B 58(4): 179-190.
Sutton BC. 1973. Hyphomycetes from Manitoba and Saskatchewan, Canada. Mycological
Papers 132. 143 p.
Sutton BC, Hodges CS Jr. 1977. Eucalyptus microfungi. Miscellaneous hyphomycetes. Nova
Hedwigia 28: 487-498.
Sydow H, Sydow P. 1909. Micromycetes japonici. Annales Mycologici 7(2): 168-175.
Uecker FA, Ayers WA, Adams PB. 1978. A new hyphomycete on sclerotia of Sclerotinia
sclerotiorum. Mycotaxon 7: 275-282.
Uecker FA, Ayers WA, Adams PB. 1980. Teratosperma oligocladum, a new hyphomycetous
mycoparasite on sclerotia of Sclerotinia sclerotiorum, S. trifoliorum, and S. minor.
Mycotaxon 10: 421-427.
Wu WP, Zhuang WY. 2005. Sporidesmium, Endophragmiella and related genera from China.
Fungal Diversity Research Series 15. 351 p.
Xia JW, Ma YR, Gao JM, Zhang XG, Li Z. 2016. A new species of Blastophragma and three
new records of other dematiaceous hyphomycetes from southern China. Nova Hedwigia
102(1): 223-232. https://doi.org/10.1127/nova_hedwigia/2015/0301
Zhang K, Qiao M, Yu ZF, Li DW, Castaneda-Ruiz RF. 2019. Morganjonesia gen. nov.
for two atypical Corynespora and Teratosperma species. Mycotaxon 134: 457-461.
https://doi.org/10.5248/134.457
MYCOTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 97-106
https://doi.org/10.5248/136.97
Smardaea isoldae sp. nov.
from a tropical cloud forest in Mexico
TANIA RAYMUNDO & RICARDO VALENZUELA
Instituto Politécnico Nacional, Escuela Nacional de Ciencias Biol6dgicas,
Plan de Ayala y Carpio s/n Col. Santo Tomas, México, D.F. 11340, México
* CORRESPONDENCE TO: [email protected]
ABSTRACT—Smardaea isoldae is described from Sierra Madre Oriental, Hidalgo State,
Mexico. The new species is distinguished by its olivaceous coloration, habit on dead wood,
and tropical cloud forest habitat. The holotype is deposited in ENCB Herbarium. A key to
Smardaea species is presented.
Key worps— Pyronemataceae, Pezizales, Pezizomycetes, taxonomy
Introduction
Smardaea was described by Svréek (1969) based on the type species
Ascobolus amethystinus W. Phillips. The genus is characterized by its discoid
to cupuliform apothecia and purple, blue purple, violet, dark violet, black
purple to black colors. The ectal excipulum comprises globose or angular cells
and the medullary excipulum is composed of interwoven septate hyphae. The
operculate asci are cylindrical with inamyloid apices and the ascospores are
globose, ellipsoid or fusoid with smooth, verrucose, or tuberculate walls. The
apothecia are found on sandy soil, leaf litter, mosses, and decayed wood. The
genus at present includes 10 species, described from Europe, Australia, and
Asia: Smardaea amethystina (W. Phillips) Svréek, S. australis P.S. Catches. &
D.E.A. Catches., S. marchica (Benkert & J. Moravec) Benkert, S. microspora
J.Z. Cao & al, S. ovalispora (Grelet) Van Vooren, S. planchonis (Dunal ex Boud.)
Korf & W.Y. Zhuang, S. protea W.Y. Zhuang & Korf, S. purpurea Dissing,
S. reticulosperma (Donadini & al) Benkert, and S. verrucispora (Donadini &
98 ... Raymundo & Valenzuela
Monier) Benkert (Svréek 1969, Brummelen 1969, Dissing 1985, Zhuang &
Korf 1986, Cao & al. 1990, Korf & Zhuang 1991, Benkert 2005, Van Vooren
2009, Moyne & al. 2010, Catcheside & al. 2017). Only S. planchonis has been
reported from the western hemisphere (Seaver 1942: Bermuda; Gamundi 1960:
Argentina; Hanlin 1965 and Pfister 1985: USA). During taxonomic work in
the Sierra Madre Oriental of Hidalgo state, Mexico, several specimens of a
Smardaea growing on dead wood in tropical cloud forest could not be placed
in any previously described species. Here we describe and illustrate those
specimens as Smardaea isoldae.
Materials & methods
The specimens were collected during 2012-2018 from two localities in a tropical
cloud forest of Tlanchinol municipality, State of Hidalgo, Sierra Madre Oriental,
Mexico. They are deposited in the “Dr. Gast6n Guzman Huerta” fungal collection of
the Herbarium of the Escuela Nacional de Ciencias Bioldgicas, Instituto Politécnico
Nacional, Mexico City, Mexico (ENCB). Georeferences were obtained with Garmin
eTrex’ GPS. Color codes follow Kornerup & Wanscher (1978). Microscopic
observations were taken from tissues rehydrated in 5% aqueous KOH and Melzer’s
reagent; ascospore dimensions include the ornamentation. Macroscopic features were
photographed with a Nikon D7000 camera and the micrographs with a Sony DSC-
WX350. For the SEM studies, the sample was prepared according to the critical-point-
drying method outlined in Moreno & al. (1995) and examined with a JSM-5800LV
scanning electron microscope. Most terminology follows Ulloa & Hanlin (2012), with
Ekanayaka & al. (2017) for the types of ectal and medullary excipulum.
Taxonomy
Smardaea isoldae Raymundo & R. Valenz., sp. nov. PLaTEs 1-3
MB 830585
Differs from Smardaea amethystina by its olive green, greyish green, dark green to olive
brown hymeniun;; its larger ascospores; and its habitat on dead wood in a tropical cloud
forest.
Type: Mexico, Sierra Madre Oriental, Hidalgo State, Tlanchinol municipality, El
Temazate, 21°01’40”N 98°38’33”W, alt. 1500 m, 31 May 2018, R. Valenzuela 18324
(Holotype, ENCB).
Erymo.oecy: In honor of Dr. Isolda Luna Vega, pioneer in the study of fungal
biogeography in Mexico.
APOTHECIA 2-4 mm diam., sessile on a broad base, pulvinate, cup shaped
when young, then flattened to discoid, flesh soft to gelatinous, dark olive
(3F3) to black, yielding yellow (3A8) KOH-extractable pigments. HYMENIUM
300-320 um thick, smooth, olive green (3D7) or olive (3F7) when young, then
Smardaea isoldae sp. nov. (Mexico) ... 99
PiatE 1. Smardaea isoldae (holotype, ENCB Valenzuela 18324). 1. Gregarious young and mature
apothecia on dead wood; 2. Mature discoid apothecium; 3. Apothecium, transverse section.
Scale bars = 5 mm.
olive gray (3E2), olive brown (4E5, 4F6), dull green (30E3), or greyish green
(30E7), black in dry specimens. EXTERNAL SURFACE Olive grey (3F2), dark olive
(3F3), brownish grey (4F2), dark olive brown (4F3) to black, slightly rugose.
100 ... Raymundo & Valenzuela
ECTAL EXCIPULUM 90-120 um thick at the margin and <200 um thick in the
base, textura globulosa to angularis from base to margin, globose cells 15-28
um diam., subglobose to elongated cells 16.5-42.5(-60) x 10-20(-25) um;
walls <3 um thick, amber (6D6), wine red (11D8) to deep magenta (13-14D8).
MEDULLARY EXCIPULUM 260-300 um thick, textura intricata intermixed with
globose to subglobose cells, hyphae 2.5-7.5 um diam., pale yellow to light
purplish in KOH, septate, branched, thin-walled, globose to subglobose cells
8-15(-25) um broad, walls <2 um thick, pale yellow to light purplish in KOH.
SUBHYMENIUM 15-25 um thick, textura globulosa mixed with few short,
branching, septate, thin-walled hyphae, 2-4 um diam, globose to subglobose
cells, 3-7 um diam., thin-walled, hyaline to pale yellow in KOH. PARAPHYSES
300-340 um long, filiform, <25 um beyond the asci, 2-4 um diam., unbranched,
septate, hyaline, pale yellow to light purple in KOH, with swollen apex, clavate
to capitate, 6-12 um diam. at the top. Asci operculate, inamyloid, 8-spored,
270-300 x 16-18(-20) um, cylindrical, hyaline. AscosporEs 22-28 x 10-14
(-15) um, oblong to fusiform, hyaline in KOH, inamyloid, surface covered by
coarse, hyaline, rounded warts or tubercles, 1.5-3 um high, and semiglobular
apiculi at the ends, 2-4 um high and 3.5-5.5 um wide.
ECOLOGY AND DISTRIBUTION— gregarious on decayed angiosperm wood in
a tropical cloud forest.
ADDITIONAL SPECIMENS EXAMINED—MEXICO. Hipateo, Tlanchinol municipality,
El Temazate, 21°01’40”N 98°38’33”W, alt. 1500 m, 17 May 2014, R. Valenzuela 15477,
T. Raymundo 5070, 5083, 5090, 5091 (all in ENCB); Parador la Montafia, 21°01’40”N
98°38'34’'W, alt. 1500 m, 27 May 2012, T. Raymundo 4188, R. Valenzuela 14695, S.
Bautista- Hernandez 17; C. Santamaria 19 (all in ENCB).
CoMMENTS—Smardaea has been described with purple pigments in the
apothecia and with differently shaped and ornamented ascospores. ‘The olive
green to dull green hymenium and dark olive to black external surface colors
of our Mexican specimens are unusual in Smardaea, but the textura of ectal
and medullary excipulum corresponds to the structure described for the genus,
and the spore ornamentation for S. isoldae is similar to that of the type species
(Smardaea amethystina). Aleurina also exhibits an olivaceous, olivaceous
brown, brown, or purplish brown hymenium when fresh, and some Aleurina
species have ascospores ornamented with rounded warts similar to Smardaea
amethystina and S. isoldae (Zhuang & Korf 1986). However, these Smardaea
species have semiglobular apiculi at the ends, which are not present in Aleurina
species (Zhuang & Korf 1986), supporting the Mexican material in Smardaea.
Perry & al. (2007) supported Aleurina and Smardaea as independent genera
because they are in different clades.
Smardaea isoldae sp. nov. (Mexico) ... 101
PLATE 2. Smardaea isoldae (holotype, ENCB Valenzuela 18324). 4. Apothecium, transverse
section; 5. Ectal excipulum in margin; 6. Medullar excipulum; 7. Basal ectal excipulum with textura
globulosa to prismatica and medullar excipulum with textura intricata; 8. Marginal ectal excipulum
(textura globulosa to prismatica). Scale bars = 4 = 300 um; 5-8 = 100 um.
102 ... Raymundo & Valenzuela
Smardaea isoldae is characterized by the green to olivaceous hymenium
and external surface, shape, size, and ornamentation of the ascospores
and its growth on dead wood in a tropical cloud forest. Our new species
resembles Smardaea amethystina in spore ornamentation and the
semiglobular apiculi, but S. amethystina differs in its purple apothecial
color, smaller (19.5-22 x 11-12.5 um) ascospores, and sandy substrate
(Brummelen 1969, as Jafnadelphus amethystinus). The other Smardaea
species (i.e., S. australis, S. marchica, S. planchonis, S. reticulosperma,
S. verrucispora) differ in their globose to subglobose ascospores.
Ascospores of several other species share the ellipsoid to oblong or
fusoid shape found in S. isoldae but are characterized by a finely rugose,
subreticulate to reticulate ornamentation; S. ovalispora, S. microspora,
S. protea, S. purpurea. S. australis, and S. planchonis have smooth to very
finely ornamented spores (Donadini 1976, 1984, Torre & al.1988, Benkert
2005, Seaver 1942, Hanlin 1965).
Key to species of Smardaea
LeAscospores:clobOse-tO-Su DO ODOSE.. fe, Tin tire, Mo atatign cetat ign aetetign eset nance tia? 2
LeAscospores ellipsoid to. fusiform 05.25 hin sale valine ¥ aoe ¥ waned akin ARS 6
2 -Ascospores finely verrucose to reticulate. co. nn fase x he Gye owe lye Fle ye Beads baw ee ba 3
2. Ascospores smooth, 8-10.5(-11.5) um diam................ 0... eee S. australis
Apothecia (3-)5-15 mm diam., cupulate, hymenium fuscous-black, violaceous black
to blackish-purple; paraphyses filiform, straight or slightly curved, sparsely septate,
tips slightly swollen, 2-7 um diam.; known only from Australia, associated with moss:
Leucopogon parviflorus, Melaleuca sp., and Acacia longifolia subsp. sophorae, on low
sand dune (Catcheside & al. 2017: 19)
3. Ascospores globose, 9-12 um diam., smooth, warted or reticulate .............. 4
3. Ascospores subglobose, 13-15 x 12-14 um, coarsely warted........... S. marchica
Apothecia 4-5 mm diam., discoid, dark violaceous brownish to almost black; paraphyses
filiform, septate, unbranched, apex swollen, 4—-7(-11) um diam.; known only from
Germany growing on sandy soil under Pinus sylvestris (Benkert & Moravec 1986: 89,
Benkert 2005: 144, 151)
4. Ascosporées*coarsely verrucose orreticulate:s.. vost. asuts Mesuts Meauts Meader oatae? 5
4, Ascospores smooth to minutely verrucose ................0.00 eee S. planchonis
Apothecia 10-20 mm diam., discoid to cupulate, hymenium violaceus purple to black
purple; paraphyses filiform, simple to branched, septate, apex slightly swollen 4.5-8 um
diam.; known from Europe, Bermuda, USA, and Argentina growing in sandy soil or leaf
litter under Cupressaceae in Europe, Yucca in USA (Seaver 1942: 74, Hanlin 1965: 135,
Donadini 1976: 256)
Smardaea isoldae sp. nov. (Mexico) ... 103
PLATE 3. Smardaea isoldae (holotype, ENCB Valenzuela 18324). 9. Hymenium with asci, ascospores,
and paraphyses; 10. Asci and ascospores; 11. Operculate ascus; 12. Base of ascus; 13. Ascospores
in 5% KOH; 14. Ascospores in scanning electronic microscope (SEM). Scale bars: 9 = 100 um;
10-12 = 20 um; 13 = 10 um.
104 ... Raymundo & Valenzuela
5. Ascospores verrucose (warts <1 um high), 9-12 um diam. ......... S. verrucispora
Apothecia 5-15 mm diam., cupulate, hymenium violet to purple; paraphyses filiform,
straight or slightly curved, branched at base or simple, septate, tips slightly swollen 3.5-5
um diam.; known only from France on humus under cedars (Donadini 1976: 259)
5. Ascospores reticulate, 10-11 um diam....................-0006- S. reticulosperma
Apothecia 10-40 mm diam., cupulate, hymenium violet to purple; paraphyses filiform,
slightly curved, branched, septate, tips slightly swollen 3-5 um diam.; known only from
France on humus under Cedrus atlanticus (Donadini 1986: 54, 58)
6. Ascospores oblong to fusiform, more than 15 um long ...................0000. 7
6. Ascospores ellipsoid, smooth, 12-14 x 8-9(-10) um ................ S. ovalispora
Apothecia 8-15 mm diam., cupulate, hymenium violet; paraphyses filiform, curved
at apex, branched at base, septate, tips slightly swollen 2.5(-4) um diam.; known
from France and Spain on humus under Pinus halepensis, Pinus sylvestris, and Cedrus
atlanticus (Donadini 1976: 258, Van Vooren 2009: 23, 24)
7. Ascospores with irregular lower ridges to reticulate ....................0..008. 8
7. Ascospores finely verrucose totuberculate ....2....55....25 chs Gaw eae cee nsh es S)
8. Ascospores finely reticulate when mature,
OMA MAHON SOS MUNICH wv. is cB. ohtvanthy Barusdy& sivas Siaccuabe f betventiodh S. microspora
Apothecia 3-6 mm diam., discoid, hymenium purple to black purple; paraphyses
filiform, unbranched, septate, tips swollen 4-7.5 um diam.; known only from China on
sandy soil (Cao & al.1990: 283)
8. Ascospores coarsely warted to reticulate when mature,
OMNAieNAHONal =SA TON ee ce lated ne Poe ee Peale eae S. purpurea
Apothecia 2.5-7 mm diam., discoid, hymenium purple; paraphyses filiform, branched,
septate, tips slightly swollen 3-4 um diam.; known from Europe under Alnus incana in
shadowed, rich, moist soil and from China under conifers (Dissing 1985: 36, 37; Cao &
al.1990: 283; Moyne & al.2010: 8)
9. Ascospores coarsely warted to tuberculate, rounded warts 1.5-3 um high and
semiglobular apiculi at the ends, 2-4 um high and 3.5-5.5 um across ....... 10
9. Ascospores finely verrucose, warts angular to irregular up to 0.7 um high,
semiglobular-apicull at theends absent. x. ci... ication neil « tote wt S. protea
Apothecia 5-12 mm diam., cupulate to discoid, hymenium purple to dark purple;
paraphyses filiform, slightly enlarged at apex, up to 6.5 um diam.; known only from
Czech Republic on sandy soil (Zhuang & Korf 1986: 380, Benkert 2005: 143, 151)
10. Apothecia dark purplish violet or blackish violet,
ascospores (18-)19.5-22(-23) x (9.5-)11-12.5(-13) um ....... S. amethystina
Apothecia 4-20 mm diam., first cupulate then discoid; paraphyses filiform, unbranched,
septate, tips swollen 4-5 um diam.; known from Europe under Salix, Alnus, Corylus, and
Laurus on sandy soil (Brummelen 1969: 225, Iglesias 2010: 35, 36)
10. Apothecia olive gray, olive brown, dull green to greyish green,
ascospores: 22-238) TO—TAC ES) tins 4 ods 5 Ad oo ds le bet oe a S. isoldae
Apothecia 3-8 mm diam., cupulate when young, then flattened to discoid; paraphyses
filiform, unbranched, septate, with swollen apex, clavate to capitate, 6-12 um diam.;
known only from Mexico on decayed wood.
Smardaea isoldae sp. nov. (Mexico) ... 105
Acknowledgments
We wish to express our gratitude to Dr. Peter R. Johnston (Manaaki Whenua
Landcare Research, New Zealand) for helping us with the English version of the
manuscript and useful comments, and to Nicolas Van Vooren (Ascomycete.org,
Lyon, France) and Dr. Martin Esqueda (Centro de Investigacién en Alimentacién y
Desarrollo, Sonora, Mexico) for reviewing the manuscript and their useful comments.
IPN is thanked by for research financial support by Tania Raymundo (Projects SIP-
20200243, 20210315), and Ricardo Valenzuela thanks COFAA and IPN for research
financial support (Projects SIP-20200956, 20210661). CONACYT is thanked
by the authors for financial support to the project “Hongos mexicanos: filogenia
y biogeografia aplicadas a la valoracidn y conservacién de especies mexicanas
endémicas, con énfasis en aquellas distribuidas en bosques templados himedos de
montana” (2015-01-207).
Literature cited
Benkert D. 2005. Beitrage zur Kenntnis einiger Gattungen der Pezizales (Ascomycetes):
Plectania/Pseudoplectania, Ramsbottomia, Smardaea/Greletia, Sowerbyella. Zeitschrift fur
Mykologie 71(2): 121-164.
Benkert D, Moravec J. 1986. Greletia marchica spec. nov., a new discomycete (Pezizales) from
GDR. Mycologia Helvetica 2(1): 87-92.
Brummelen J van. 1969. Studies on Discomycetes. III. Persoonia 5: 225-231.
Cao JZ, Fan L, Liu B. 1990. Notes on the genus Smardaea in China. Acta Mycologica Sinica
9(4): 282-285.
Catcheside PS, Qaraghuli S, Catcheside DEA. 2017. A new species of small black disc fungi,
Smardaea australis (Pezizales, Pyronemataceae), is described from Australia. Swainsona 31:
17-26. https://www.jstor.org/stable/26662853
Dissing H. 1985. Smardaea purpurea (Pezizales), another new species from Graubiinden,
Switzerland. Sydowia 38: 35-40.
Donadini J.C. 1976. Le genre Pulparia Karsten en France. Espéces nouvelles ou critiques. Revue
de Mycologie 40(3): 255-272.
Donadini J.C. 1984. Etude cytologique des Discomycétes (I). Les genres Greletia et Pulparia
(Pezizales). Bulletin de la Société Linnéenne de Provence 36: 139-151.
Donadini JC. 1986. Scanning des asques et cytologie Greletia reticulosperma n. sp. Documents
Mycologiques 16(62): 53-65.
Ekanayaka AH, Ariyawansa HA, K. D. Hyde KD, Jones EBG, Daranagama DA,
Phillips AJL, Hongsanan S, Jayasiri SC, Zhao Q. 2017. DISCOMYCETES: the
apothecial representatives of the phylum Ascomycota. Fungal Diversity 87: 237-298.
https://doi.org/10.1007/s13225-017-0389-x
Gamundi JJ. 1960. Discomycetes operculados de la Argentina; familias: Pezizaceae y
Humariaceae. Lilloa 30: 257-338.
Iglesias P. 2010. Smardaea amethystina. Primera cita en Espafia. Mycologia Montenegrina
13: 33-41.
Hanlin RT. 1965. Lamprospora planchonis from Georgia. Mycologia 57: 131-134.
https://doi.org/10.1080/00275514.1965.12018198
Korf RP, Zhuang WY. 1991. A preliminary discomycete flora of Macaronesia: part 15,
Terfeziaceae, and Otideaceae, Otideoideae. Mycotaxon 40: 413-433.
106 ... Raymundo & Valenzuela
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. 3th ed. Eyre Methuen, London.
Moreno G, Altés A, Ochoa C, Wright JE. 1995. Contribution to the study of the Tulostomataceae
in Baja California, Mexico. I. Mycologia 87: 96-120. https://doi.org/10.2307/3760953
Moyne G, Moingeon JM, Page C, Chaillet P, Frund C. 2010. Deux ascomycetes rares, nouveaux
pour la France : Smardaea purpurea et Spooneromyces helveticus (Ascomycota, Pezizales).
Bulletin Mycologique et Botanique Dauphiné-Savoie 196: 7-15.
Perry BA, Hansen K, Pfister DH. 2007. A phylogenetic overview of the family Pyronemataceae
(Ascomycota, Pezizales). Mycological Research 111: 549-571.
https://doi.org/10.1016/j.mycres.2007.03.014
Pfister DH. 1985. North American Pezizales: Greletia and Marcelleina. Sydowia 38: 235-240.
Seaver FJ. 1942. The North American cup-fungi (operculates). Supplemented edition. Reprinted
by Hafner Publ. Co., New York. 1961. 377 p.
Svréek M. 1969. Nové rody operkulatnich diskomycett (Pezizales). Ceska Mykologie 23: 83-96.
Torre M de la, Rocabruna A, Tabarés M, Arroyo I., Calonge FD. 1988. Contribucioén al estudio
de Ascomycotina espafioles. IV. Algunas especies interesantes de Catalufa. Boletin de la
Sociedad Micoldégica de Madrid 12: 35-38.
Ulloa M, Hanlin RT. 2012. Illustrated dictionary of mycology. 2nd ed. APS Press, St. Paul,
Minnesota, USA. 762 p.
Van Vooren N. 2009. Note sur Smardaea ovalispora comb. nov. (Pezizales). Bulletin Mycologique
et Botanique Dauphiné-Savoie 192: 23-28.
Zhuang W, Korf RP. 1986. A monograph of the genus Aleurina Massee (= Jafnadelphus Rifai).
Mycotaxon 26: 361-436.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 107-130
https://doi.org/10.5248/136.107
Scytinopogon caulocystidiatus and S. foetidus spp. nov.,
and five other species recorded from Brazil
A.N.M. FurtTapo'*, PP. DANIELS”, M.A. REcK?, M.A. NEVES?
"Departamento de Botanica, Universidade Federal de Santa Catarina,
Campus Universitario, 88040-900, Florianopolis, Brazil
? Department of Botany, Ecology and Plant Physiology, University of Cordoba,
Campus Rabanales, 14071, Cordoba, Spain
° Departamento de Biologia, Universidade Estadual de Maringa,
Campus Universitario, 87020-900, Maringd, Brazil
* CORRESPONDENCE TO: [email protected]
ABSTRACT—Seven species of Scytinopogon in the Atlantic Forest of Brazil are described.
Scytinopogon caulocystidiatus and S. foetidus are proposed as new species based on
morphological and molecular data. Five other species are presented: S. chartaceus,
S. dealbatus and S. robustus, originally described from Brazil; and S. pallescens and
S. scaber, previously reported for Brazil. Illustrations of the basidiomata and microstructures,
including SEM images of ornamented basidiospores, are provided for all taxa. Comparisons
with morphologically similar taxa and a key to the seven species of Scytinopogon known to
occur in Brazil are also presented.
Key worps—coral fungi, Hydnodontaceae, neotropics, taxonomy, Trechisporales
Introduction
Scytinopogon Singer is a clavarioid genus that is mainly distributed in tropical
and subtropical regions (Garcia-Sandoval & al. 2004, Larsson & al. 2011). The
genus comprises eight species (Corner 1970, Petersen 1988, Desjardin & Perry
2015) and is characterized by its light colored, densely branched basidiomata
with flattened branches, monomitic hyphal system consisting of clamped,
noninflated hyphae, usually 4-spored basidia, and slightly angular, hyaline
basidiospores with verruculose-echinulate ornamentation (Corner 1950).
108 ... Furtado & al.
Scytinopogon was previously included in Clavariaceae Chevall. based on
basidiome morphology (Corner 1950, 1970, Garcia-Sandoval & al. 2004);
however, it was also proposed as related to different taxa of Hydnodontaceae
Julich (Jiilich 1981) or the “Thelephoroid” series (Corner 1950). The tough,
coriaceous basidiomata in Scytinopogon support its removal from Clavariaceae
(ilich 1981); Larsson & al. (2011) and Birkebak & al. (2013) show a
phylogenetic proximity of Scytinopogon to the corticioid genus Trechispora
P. Karst. (Trechisporales K.H. Larss.). Morphological characters supporting the
Scytinopogon + Trechispora clade are a monomitic hyphal system and clamped
generative hyphae with subicular hyphae or context hyphae with ampulliform
septa (Hibbett & al. 2007). The presence of calcium oxalate crystals is common
in Trechispora but is a species-specific character (Jiilich 1981). Garcia-Sandoval
& al. (2004) found these crystals in the basal mycelium hyphae of Scytinopogon
species.
Reviews of previously reported species of Scytinopogon from Brazil were
published by Corner (1953, 1966, 1970) for the Amazon and by Rick (1959,
Rio Grande do Sul), Corner (1970, Rio de Janeiro), Petersen (1988, Sao Paulo),
and Meijer (2006, 2008, Parana) for the Atlantic Forest. These studies cited five
species, but most lack complete descriptions.
Considering the wide distribution of Scytinopogon in tropical and
subtropical regions, and with the goal of increasing what is known about the
genus in the Atlantic Forest, this work provides detailed descriptions and
illustrations of the seven Scytinopogon species recorded for Brazil: two new
species (S. caulocystidiatus, S. foetidus); three species described first from Brazil
(S. chartaceus, S. dealbatus, S. robustus); and two species originally described
elsewhere (S. pallescens, S. scaber).
While this article was in preparation, Meiras-Ottoni & al. (2021) proposed
synonymizing Scytinopogon under Trechispora based on ITS and 28S sequence
analyses. Although we agree the two genera are phylogenetically related, we
feel that additional DNA regions and species are needed before concluding that
Scytinopogon and Trechispora are fully synonymous. We prefer to retain the
present species in Scytinopogon until a more thorough revision of the group is
conducted.
Material & methods
Morphological data
Field trips were conducted between January 2013 and August 2014 (with an
additional expedition in January 2016) mostly during the rainy season in the states of
Scytinopogon caulocystidiatus & S. foetidus spp. nov. (Brazil) ... 109
Rio Grande do Sul, Sao Paulo, and Santa Catarina. Whenever possible, macroscopic
characters were studied from fresh specimens. Color codes (e.g., 2B19) are based
on Kornerup & Wanscher (1978). Microscopic characters were observed from
sections of dried basidiomata using an Olympus CX21 microscope and a 1000x
immersion oil lens. Descriptive terms follow Corner (1947), Largent & al. (1977),
and Vellinga & Noordeloos (2001). All microscopic structures were observed in
water, 3% potassium hydroxide, Melzer’s solution, and Congo red. Measurements
were made in a solution of Congo red and 5% potassium hydroxide. Basidiospore
measurements excluded ornamentation. At least twenty-five measurements were
made of each microstructure. Q refers to the average basidiospore length/width
ratio. The descriptions are based on all collections studied; the number of collections
is shown in parentheses (s =) after each basidiospore measurement. Illustrations
of microscopic features were based on digital photographs. Scanning electron
microscopy (SEM) was conducted at the Laboratério Central de Microscopia
Eletrénica (LCME/UFSC). Hymenophore fragments were removed from dried
basidiomata, mounted on aluminum stubs using carbon adhesive tabs, coated with
30 nm of gold, and examined with a scanning electron microscope operating at 10
keV. Voucher material was deposited at the Universidade Federal de Santa Catarina,
Floriandpolis, Brazil (FLOR). The MATERIAL EXAMINED sections list specimens
collected during the present work and the ADDITIONAL SPECIMENS EXAMINED
were from BPI, CGE, FLOR, INPA, JPB, K, MBM, PACA, RBGE, and URM (Thiers
2017). The REFERENCE EXSICCATA STUDIED Section lists specimens of other taxa
that were used for taxonomic comparison.
Genomic DNA extraction, PCR and Sequencing
Genomic DNA was extracted from dried material using a PowerPlant®Pro
DNA Isolation Kit, following the manufacturer’s protocol adapted for fungi. The
internal transcribed spacer of ribosomal nuclear DNA (nrITS) region was amplified
using the primers ITS1F and ITS4R (Dentinger & al. 2010) and the following
cycling parameters: an initial denaturation at 94°C for 2 min; 40 cycles of 30 s at
94°C, 45 s at 55°C and 1 min at 72°C; and a final extension at 72°C for 7 min. The
PCR products were purified using PEG (polyethylene glycol; Sambrook & al. 1989).
Sanger sequencing was performed with a BigDye Terminator 3.1 Cycle Sequencing
Kit, following the manufacturer’s protocol, using the same primers cited above, at
Funda¢ao Oswaldo Cruz (Fiocruz), Minas Gerais, Brazil. The generated sequences
and their respective chromatograms were manually inspected and edited with
Geneious v.6.1.8 (Kearse & al. 2012).
Phylogenetic analyses
Specimens and GenBankaccession numbers used in this study are shown in TABLE 1.
Newly generated DNA sequences were combined with the available ITS sequences of
Scytinopogon from GenBank, as well as sequences of Brevicellicium exile (HLS. Jacks.)
K.H. Larss. & Hjortstam and Trechispora stellulata (Bourdot & Galzin) Liberta as the
outgroup, to construct a final 32-sequence matrix. Alignments were generated using
110 ... Furtado & al.
TABLE 1. Scytinopogon and outgroup sequences used in the phylogenetic analyses.
Newly generated sequences are set in bold font.
GENBANK ACCESSION
TAXON VOUCHER ORIGIN soars
S. caulocystidiatus FLOR 56314 Brazil MK458772
S. chartaceus FLOR 56185 Brazil MK458775
S. dealbatus FLOR 56182 Brazil MK458776
FLOR 56183 Brazil MK458777
S. foetidus FLOR 56315 Brazil MK458769
S. havencampii SFSUDED8300 Sao Tomé & Principe KT253946
S. pallescens FLOR 56184 Brazil MK458767
FLOR 56186 Brazil MK458766
FLOR 56187 Brazil MK458771
FLOR 56188 Brazil MK458774
S. robustus FLOR 56179 Brazil MK458770
FLOR 56190 Brazil MK458768
S. scaber FLOR 56189 Brazil MK458773
Scytinopogon sp. BAB5120 India KT804576
9P829 Taiwan KF6795001
0906RK610 Taiwan KF6795051
9P615 Taiwan KF679498
0906RK623 Taiwan KF6795031
9P1233 Taiwan KF6795011
0906RK71 Taiwan KF6795021
0906RK1023 Taiwan KF6795061
0906RK647 Taiwan KF6795041
9P79 Taiwan KF6794991
Scytinopogon sp. 1 MEL2382623 Australia KP012986
MEL2382744 Australia KP012927
MEL2382716 Australia KP012897
MEL2382612 Australia KP012977
Scytinopogon sp. 2 MEL2382992 Australia KP012847
MEL2382675 Australia KP013038
MEL2382987 Australia KP012842
Brevicellicium exile UV 2022824 USA KP814539
Trechispora stellulata UC2022931 USA KP814168
Scytinopogon caulocystidiatus & S. foetidus spp. nov. (Brazil) ... L111
MAFFT v. 7 (Katoh & Standley 2013) according to E-INS-i criteria. Sequences were
then manually corrected using the software MEGA v.7.0.14 (Tamura & al. 2013). Indels
present in the nrITS datasets were recoded as binary characters following the “simple
indel coding method” (SIC, Simmons & Ochoterena 2000), which was implemented
in SeqState (Miller 2005). The resulting binary characters were joined in the final
matrix as a distinct partition. The final alignments (as well the final topologies) were
logged in TreeBase (http://purl.org/phylo/treebase/phylows/study/TB2:S22377). New
sequences generated for this work were uploaded to GenBank (Sayers & al. 2009).
Maximum likelihood (ML) and Bayesian inference (BI) criteria were applied to the
datasets, which were divided in three partitions for the ITS (ITS1/2, 5.8S and recoded
indels). The best model of nucleotide evolution for each nucleotide partition was
determined using BIC (Bayesian information criterion) with the software jModelTest
v2.1.6 (Guindon & Gascuel 2003, Darriba & al. 2012). ML analyses were performed
using the software RAxML v. 8.2.10 (Stamatakis 2014) available on the CIPRES portal
(Miller ¢ al. 2010, http://www. phylo.org/). The analysis first involved 100 ML searches,
each starting from one randomized stepwise addition parsimony tree (command -f
d), undera GT(RGAMMA model, with all other parameters estimated by the software.
To assess the reliability of the nodes, nonparametric bootstrapping replicates under the
same model were computed, allowing the program to halt bootstrapping automatically
with the autoMRE bootstrapping criterion. To plot the calculated bootstrap values on
the branches, the command -fb was used. The BI was performed with the software
Mr. Bayes v.3.2.6 (Ronquist & Huelsenbeck 2003), implemented in CIPRES Science
Gateway 3.1. BI was performed using two independent runs, each starting from
random trees, with four simultaneous independent chains, and performed 10,000,000
generations, keeping one tree every 1000th generation. Four rate categories were used
to approximate the gamma distribution. Of all trees sampled, 20% were discarded as
burn-in and checked by the convergence criterion (frequencies of average standard
deviation of split <0.01) with Tracer v.1.6 (Rambaut & al. 2014), while the remaining
were used to reconstruct a 50% majority-rule consensus tree and to estimate Bayesian
posterior probabilities (BPP) of the branches. A node was considered strongly
supported if it had a BPP 20.95 and/or BS 290% and moderately supported if it had a
BPP 20.90 and/or BS =70%.
Phylogenetic results
Twelve new nrITS sequences from Scytinopogon were generated during this
study. The best models of nucleotide substitution estimated for the partitions
were TPM2uf+G for the combined ITS1/ITS2 and K80 for the 5.8s. The
recovered tree topologies resulting from both routines were basically identical.
This work shows the topology from the ML analyses, with both BPP and BS
values (Fic. 1). Scytinopogon scaber, S. caulocystidiatus and S. dealbatus are
early branches in the trees. Four other clades are formed by the remaining
species.
112 ... Furtado & al.
Scytinopogon sp. KF6795001 Taiwan
Scytinopogon sp. KF6795051 Taiwan
Scytinopogon sp. KF679498 Taiwan
Scytinopogon sp. KF6795031 Taiwan
Scytinopogon sp. KF6795011 Taiwan
Scytinopogon sp. KF6795021 Taiwan
99/1 Scytinopogon sp. KF6795061 Taiwan
Scytinopogon sp. KF6795041 Taiwan
nad Scytinopogon sp. KF6794991 Taiwan
Scytinopogon sp1 KP012986 Australia
Scytinopogon sp1 KP012927 Australia
4100/1 ;
100/1_ Seytinopogon sp1 KP012897 Australia
Scytinopogon sp1 KP012977 Australia
Scytinopogon chartaceus MK458775 Brazil
oor Scytinopogon pallescens MK458774 Brazil
Scytinopogon pallescens MK458767 Brazil
100/1__| Scytinopogon pallescens MK458766 Brazil
BAS Scytinopogon pallescens MK458771 Brazil
it Scytinopogon sp KT804576 India
Scytinopogon sp2 KP012842 Australia
__100/1__| Scytinopogon sp2 KP013038 Australia
10071 Scytinopogon sp2 KP012847 Australia
54/0.5)
Scytinopogon havencampii KT253946 Sao Tomé and Prince
100/1 99/1 Scytinopogon foetidus MK458769 Brazil yf
100/1 Scytinopogon robustus MK458768 Brazil
Scytinopogon robustus MK458770 Brazil
t00/097Scvtinopogon dealbatus MK458775 Brazil
100/1 Scytinopogon dealbatus MK458776 Brazil
80/0.98 Scytinopogon caulocystidiatus MK458772 Brazil
Scytinopogon scaber MK458773 Brazil
10/1 Brevicellicium exile KP814539 USA
Trechispora stellulata KP814168 USA
Fic. 1. Consensus tree from Maximum likelihood (ML) analysis of Scytinopogon based on a dataset
of 32 nrITS sequences rooted with the outgroup (Brevicellicium exile and Trechispora stellulata).
Bayesian posterior probability (on the right of the “/”) >0.7 and bootstrap values (on the left of the
“T°) >50% are shown. The twelve new sequences are highlighted in bold type. Red stars indicate the
new taxa, Scytinopogon caulocystidiatus and S. foetidus.
In the analysis, the Scytinopogon caulocystidiatus sequence (FLOR 56314)
is closely related to S. dealbatus (FLOR 56182, FLOR 56183) from Brazil (BS =
80, BPP = 0.98). Our molecular phylogeny (Fic. 1) confirms our morphological
analyses that S. caulocystidiatus and S. dealbatus are distinct taxa.
Two Scytinopogon robustus sequences (FLOR 56190, FLOR 56179)
clustered in a well-supported clade (BS = 99, BPP = 1) with the sequences
Scytinopogon caulocystidiatus & S. foetidus spp. nov. (Brazil) ... 113
of Scytinopogon foetidus, S. havencampii (SSFU DEB8300) from Sao
Tomé and Principe, and Scytinopogon sp. 2 from Australia.
The Scytinopogon foetidus sequence clustered in a weakly supported
but resolved clade (BS = 54, BPP = 0.57) close to S. havencampii (SSFU
DEB8300), suggesting that they are different species. ‘This is supported by
the morphological analysis, as discussed below.
The Brazilian S. pallescens sequences (FLOR 56184, FLOR 56186,
FLOR 56187, FLOR 56188) clustered (BS = 64; BPP = 0.97) in a clade
that included Scytinopogon sp. (BAB5120) from India. The clade
including Scytinopogon chartaceus was strongly supported (BS = 100;
BPP = 1). Sequences from Scytinopogon sp. (9P829, 0906RK610, 9P615,
0906RK623, 9P1233, O0906RK71, 0906RK1023, 0906RK647, 9P79)
from Taiwan and Scytinopogon sp. 1 (MEL2382623, MEL2382744,
MEL23827 16, MEL2382612) from Australia were recovered as sister taxa
of S. chartaceus.
Taxonomy
Scytinopogon caulocystidiatus A.N.M. Furtado & M.A. Neves, sp. nov. Fig. 2
MB 829606
Differs from Scytinopogon dealbatus by the presence of catenulate caulocystidia.
TypeE—Brazil. Santa Catarina: Florianopolis, Ilha do Campeche, Trilha do Morcego,
27°40'40"S 48°28’6”W, 24 III 2014, A.N.M. Furtado 460 (Holotype, FLOR 56314;
GenBank 458772).
EtTyMOLoGyY—The epithet refers to the abundant catenulate caulocystidia.
BASIDIOMATA 35-70 mm tall, solitary, gregarious to densely caespitose,
white (1A1), drying yellowish white (4A2) with reddish-brown (8D7)
apices; branches subcylindric at first, becoming flattened, twisted, slightly
subpruinose, 3.0 mm wide in the lower branches, tapering towards the apex,
polychotomous below, di- or trichotomous towards the apex, branched three
to five times, internodes gradually becoming smaller, apices subfusiform,
acute, subterete, narrowly spathulate; stipe cylindric, short, 10—20 x 3.0—5.0
mm. CONTEXT reddish brown (8DF), tough at stipe base; odor of ammonia;
taste unrecorded.
BASIDIOSPORES 3.5—4.5 x 3.0-3.5 um (Q = 1.06) (s = 2 specimens),
subglobose, hyaline, uniguttulate, slightly angular, with diminutive spines,
<0.5 um long, slightly thick-walled, apex blunt, inamyloid; hilar appendage
<0.5 um. Basip1A 20-29 x 4.5—6.0 um, clavate, clamped; 2- or 4-spored,
3.5—5.0 um long. CysTIDIA in stipitipellis as caulocystidial hairs, 58-72 x
114... Furtado & al.
- = & ‘a ; Cf, s- \ t <i
10kV re X8,000__F reeme-UESC
Fic. 2. Scytinopogon caulocystidiatus (FLOR 56314). A. Fresh basidiomata in situ;
B, C. Basidiospores; D, Basidia; E. Capitate cystidial hairs of stipitipellis.
Scale bars: A = 1 cm; C-E = 10 um.
10-18 um, formed by concatenation of narrowly utriform, capitate to
sphaeropedunculate hyphae, smooth, thin-walled, clamped; peduncle when
present 4.0 x 2.0 um. HYMENIUM <62.5 um thick, thickening upward,
amphigenous, stratified into three layers, older basidia tortuous to collapsed,
absent in stipe. SUBHYMENIUM <40 um thick, constricted at the septa, hyphae
5.0 um diam, thin-walled. CoNTEXxT with subparallel arranged hyphae
4.0—6.0 um diam, cylindric, alternating with inflated hyphae 10-12 um wide,
ampulliform segments rare, 6.0—7.0 um wide, thin-walled, clamped. Internal
stipe hyphae 2.0—7.0 um diam, irregularly inflated, pale yellow (1A2).
ECOLOGY & DISTRIBUTION—On sandy soil in forest on marine sands.
Known only from the type locality.
ADDITIONAL MATERIAL EXAMINED—BRAZIL. SANTA CATARINA: Florianopolis,
Unidade de Conservacaéo Ambiental Desterro - UCAD, 27°31’50’S 48°30’44’W, 8 I
2016, M.L. Vanegas-Leon 61 (FLOR 59324).
Scytinopogon caulocystidiatus & S. foetidus spp. nov. (Brazil)... 115
COMMENTS—Scytinopogon caulocystidiatus is difficult to see in the field as
its white basidiomata grow on a whitish, sandy substrate.
Scytinopogon caulocystidiatus and S. dealbatus have basidiomata
that are the same size, shape, color, and consistency. Also, unlike most
Scytinopogon species, both have an amphigenous hymenium. Scytinopogon
dealbatus can be separated by its ellipsoid basidiospores and the absence
of caulocystidia.
Besides the strong odor of ammonia, a diagnostic characteristic of this
species is the cystidial stipitipellis, previously undescribed for Scytinopogon
(Corner 1950, 1970, Petersen 1988, Garcia-Sandoval & al. 2004).
Scytinopogon chartaceus (Pat.) R.H. Petersen, Mycologia 80: 574. 1988
[ as ‘chartaceum’]. Fic. 3
BASIDIOMATA 30-65 x 25-47 mm, solitary to gregarious, chalk-white
(1A1), becoming grayish white (1B1), drying pale yellow (3A4), palmately
forked from a flattened stipe immersed in soil, branching in a plane, twisted;
branches flattened and narrowly spathulate, 2.0-6.0 mm wide in the lower
branches, tapering towards the apex, polychotomous below, becoming
E
Fic. 3. Scytinopogon chartaceus. (FLOR 56185). A. Fresh basidiomata in situ;
B, C. Basidiospores; D. Basidia; E. Context hyphae with ampulliform septa.
Scale bars: A = 1 cm; C-E = 10 um.
116 ... Furtado & al.
dichotomous, branched two to four times, internodes diminishing gradually;
axils U-shaped, apices acute to blunt, subterete, suede-like above, smooth
below; sTIPE 15—30 x 7.0-15 mm, sometimes branched from the base, dilated
and flattened below the branching points, arising from very scarce white
mycelial strands on the soil. CONTEXT pale yellow (1A2), waxy, tough at the
base of the stipe, drying cartilaginous; odor and taste unrecorded.
BASIDIOSPORES 6.0—8.0 x 3.0-4.5 um (Q = 1.82) (s = 1 specimen),
narrowly ellipsoid, hyaline, angular-echinulate, slightly thick-walled, spines
0.7—1.5 um long, apex blunt, inamyloid; hilar appendage obscured by spore
ornamentation. BAsIDIA 25-32 x 6.0—8.0 um, clavate, barrel-shaped, with
homogeneous to minutely guttulate contents, clamped; 1—2-spored, 4.0—7.0
um long. CystTip1a absent. HymMENiuM thickening upward, <100 um thick,
covering the undersides of the branches. SUBHYMENIUM c, 30 um thick,
hyphae 2.5—3.0 um diam, thin-walled. ConTExtT with parallel arranged hyphae
3.5—4.0 um diam, cylindric and long-celled, slightly thick-walled, ampulliform
septa 5.5—-8.0 um diam, clamped. Surface of sterile base composed of repent
hyphae 2.5—5.0 um wide, smooth, thin-walled, clamped. Irregular crystals of
calcium oxalate covering the contextual and basal mycelium hyphae.
ECOLOGY & DISTRIBUTION—On soil among litter, in Atlantic Forest.
Known only from Sao Paulo (Campinas, Patouillard 1907; Sao Paulo, Petersen
1988), and Santa Catarina (present study), Brazil.
MATERIAL EXAMINED—BRAZIL. SANTA Catarina: Florianopolis, Trilha para
Naufragados, 27°49’4”S 48°33’37”W, 23 V 2014, A.N.M. Furtado 504 (FLOR 56185;
GenBank MK 458775).
CoMMENTS—The Brazilian type specimen, published as Lachnocladium
chartaceum by Patouillard (1907), was not studied due to its poor condition.
The identification of the specimen from Santa Catarina was based on the
original protologue (Patouillard 1907) and the description of a specimen
collected by Leif Ryvarden in Sao Paulo, Brazil, and identified as S. chartaceus
by Petersen (1988).
Morphologically, S. pallescens is the most similar species; however,
S. pallescens has larger internodes on its branches, the surface of the
basidiomata is rugulose and subtomentose, and the well-developed basal
mycelium is very compact (Corner 1950, 1970, Petersen 1988). Scytinopogon
chartaceus has smaller internodes, basidiomata with a smooth surface,
and scarce and loosely attached basal mycelium (Petersen 1984). Also,
S. pallescens has nodulose to verrucose basidiospores and S. chartaceus has
echinulate basidiospores with long spines (Reid 1962, Petersen 1988).
Scytinopogon caulocystidiatus & S. foetidus spp. nov. (Brazil) ... 117
10kV X7,000 © 2um » LCME-UESE
Fic. 4. Scytinopogon dealbatus. (FLOR 56183). A. Fresh basidiomata in situ;
B, C. Basidiospores; D. Basidia. Scale bars: A = 1 cm; C-D = 10 um.
Scytinopogon dealbatus (Berk.) Corner,
Beih. Nova Hedwigia 33: 89. 1970. Fic. 4
BASIDIOMATA 55-75 mm tall, solitary to gregarious, white (1A1), the
hymenium becoming pale yellow (1B3), drying to reddish brown (5C4);
branching often polychotomous from the base, becoming dichotomous above,
branched three to four times; branches 1.0—3.0 mm thick, ligulate, smooth;
axils flat; apices concolorous with branches; sTIPE 2.0—3.0 mm thick, slightly
distinct, white (1A1). CONTEXT gelatinous; taste and odor unrecorded.
BASIDIOSPORES 4.0-4.5 x 2.5-3.5 um (Q = 1.39) (s = 2 specimens),
ellipsoid, hyaline, echinulate to almost spineless, uniguttulate, warts <0.4 um
long, inamyloid; hilar appendage <1.0 um, often sublateral. BAstp1a 21-29
x 5.0-7.0 um, clavate, clamped; (2—)4-spored, 3.5-6.0 um long. CysTIDIA
118 ... Furtado & al.
absent. HYMENIUM <150 um thick, thickening upward, amphigenous, absent
in stipe. SUBHYMENIUM <20 um thick, composed of loosely interwoven hyphae
<5.0 um diam, thin-walled. CONTEXT hyphae subparallel, slightly agglutinated,
5.0—6.5 um diam, walls thin, subgelatinous; ampulliform septa 6.6-13 um
diam, clamped.
ECOLOGY & DISTRIBUTION—In the Atlantic Forest, this species is found on
soil. In Brazil, it is known from Amazonas (type locality), Mato Grosso (Corner
1970), Parana (Meijer 2006), Sao Paulo (Petersen 1988) and Rio Grande do
Sul (Rick 1959; present study). It is also recorded for Bolivia, Panama (Corner
1970), and Venezuela (Petersen 1988).
MATERIAL EXAMINED—BRAZIL. R1io GRANDE DO SUL: Porto Alegre, Universidade
Federal do Rio Grande do Sul, Campus do Vale, 30°04’23.8”S 51°07’23.6”W, 1 IV 2014,
E.P. Fazolino 176 (FLOR 56182; GenBank MK458776), E.P. Fazolino 177 (FLOR 56183,
GenBank MK458777).
ADDITIONAL SPECIMENS EXAMINED—BRAZIL. R10 GRANDE DO SUL: Panuré,
Sao Jerdénimo, 1873, Spruce s.n. (K 135803, 135804, holotype of Clavaria dealbata Berk.);
Sao Leopoldo, 1904, J.E. Rick s.n. (BPI 295129; PACA 17230, 17241, 17246, 17251, as
Lachnocladium dubiosum); 1907, J.E. Rick s.n. (BPI 295385, 333169, 333170, 333171
as Scytinopogon dubiosum ad. int.); 1932, J.E. Rick s.n. (BPI 295383). MATO GRosso:
Chavantina, 1 II 1968, E.J.H. Corner s.n. (RBGE 101765).
COMMENTS—Scytinopogon dealbatus basidiomata resemble young
Scytinopogon scaber but lack the erect habit and papillate branches (Petersen
1988). Also, the hymenium is present on both sides of the branches, contrary to
other Scytinopogon species where the hymenium is unilateral. The gelatinous
context is only known to occur in S. dealbatus. This character is rather common
in Ramaria species; however, it is rarely reported in Scytinopogon (Petersen
1988).
Scytinopogon pallescens could be mistaken for a robust form of S. dealbatus.
However, S. pallescens has flattened branches with the hymenium on one side of
the branches, mycelia at the base of the stipe, angular-nodulose basidiospores,
and lacks a gelatinous context (Corner 1950).
Petersen (1984, 1988) proposed transferring S. dealbatus to Ramariopsis
based on the gelatinous context of the fresh basidiomata (a character never
reported for Scytinopogon) and the ellipsoid and echinulate basidiospores
rather than angular-nodulose basidiospores described by Corner (1970).
However, Petersen (1988), who also studied a specimen from Venezuela
collected by Roy Halling and identified as S. dealbatus, agreed that the species
shares more characters with Scytinopogon than with Ramariopsis, especially
because S. dealbatus lacks the dextrinoid reaction characteristic of Ramariopsis
and not found in Scytinopogon.
Scytinopogon caulocystidiatus & S. foetidus spp. nov. (Brazil) ... 119
10kKV,. X5;500 9 2um__
Fic. 5. Scytinopogon foetidus. (FLOR 56315).
A. Fresh basidiomata in situ; B, C. Basidiospores; D. Basidia.
Scale bars: A = 1 cm; C-D = 10 um.
Scytinopogon foetidus A.N.M. Furtado & M.A. Neves, sp. nov. Fic. 5
MB 829605
Differs from Scytinopogon havencampii by its 4-spored basidia, its slightly concave
ellipsoid basidiospores, its ampulliform septa, its strong putrid odor, and by the
presence of calcium oxalate crystals.
TyPE—Brazil. Santa Catarina: Floriandépolis, Costao do Santinho, Morro das
Aranhas, 27°47'66”S 48°38'18”W, 27 I 2014, A.N.M. Furtado 423 (Holotype, FLOR
56315; GenBank MK458769).
ETYMOLOGY—The epithet refers to the strong, unpleasant odor of the fresh
basidiomata.
BASIDIOMATA 25-55 mm tall, gregarious, pale grayish beige (4C2),
becoming reddish brown (8E6) to deep brown (8F5) upward, the apices
pure white (1A1), palmately branched from a flattened stipe, branching in
one plane, sometimes twisted, subpruinose; branches cylindric to flattened
and narrowly spathulate, 3.0—4.0 mm wide in the lower branches, tapering
120 ... Furtado & al.
towards the apex, polychotomous below, becoming dichotomous, branched
three to four times, narrowly U-shaped, flattened below the branching
points, internodes gradually becoming smaller, apices blunt, subterete,
narrowly ligulate; stipE 8.0—15 x 2.0—-6.0 mm, rarely branched from the
base, pale grayish beige (4C2). CONTEXT pale yellow (1A2), slightly viscid,
tough at the base of the stipe; odor strong and putrid; taste unrecorded.
BASIDIOSPORES 5.0—6.5 x 3.0—4.0 um (Q = 1.52) (s = 1 specimen),
ellipsoid, the inner side slightly applanate to slightly concave, hyaline, finely
verrucose, thin-walled, warts 0.4—0.6 um long, apex blunt, inamyloid; hilar
appendage small. Bastp1a 23-28 x 7.0—9.0 um, clavate, barrel-shaped,
clamped; 4-spored, 3.0—5.0 um long. Cystrp1a absent. HYMENIUM <32.5
um thick, absent in stipe. SUBHYMENIUM <50 um thick, with loosely
interwoven hyphae, 3.5-5.0 um diam, thin-walled. CONTEXT with
subparallel arranged hyphae 3.5—8.0 um diam, thin-walled, constricted at
the septa, ampulliform septa 5.0—6.0 um diam, clamped. Surface of stipe
composed by a trichodermal pellis, with cylindric hyphae up to 3.0 um
diam, slightly thick-walled, clamped. Crystals of calcium oxalate in needle
clusters covering the cortical hyphae from the stipe.
ECOLOGY & DISTRIBUTION—On soil in forest, perhaps also lignicolous.
Known only from the type locality.
COMMENTS—Given that many basidiomata in Scytinopogon are white,
S. foetidus and S. robustus appear similar in their grayish-purple coloration.
Scytinopogon robustus, however, is slenderer and drier, with flattened
branches and a unilateral hymenium (Corner 1970). It also has inflated
hyphae and lacks the putrid odor and the calcium oxalate crystals in the
stipe cortex.
Another pigmented species, S. havencampii Desjardin & B.A. Perry,
described from Principe Island, Africa, differs in its cylindric, orangish-
white stipe, 2-spored basidia with long sterigmata, ellipsoid, nonconcave
basidiospores, indistinct odor, and absence of ampulliform septa and
calcium oxalate crystals (Desjardin & Perry 2015). The molecular
phylogeny also supports S. foetidus and S. havencampii as distinct species,
but closely related species and in the same clade (Fie. 1).
Another pigmented species, Scytinopogon echinosporus (Berk. &
Broome) Corner, known from Sri Lanka and Java, differs in its pale purple,
often flattened branches with dark violet-brown tips, ellipsoid to angular
basidiospores, 4-spored basidia, and inflated (<12 um diam) hyphae.
Scytinopogon caulocystidiatus & S. foetidus spp. nov. (Brazil)... 121
© 10K .x6,00
Fic. 6. Scytinopogon pallescens. (FLOR 56184). A. Fresh basidiomata in situ;
B, C. Basidiospores; D. Basidia; E. Context hyphae with ampulliform septa.
Scale bars: A = 1 cm; C-E = 10 um.
Scytinopogon pallescens (Bres.) Singer, Lloydia 8(3): 139. 1945. FIG. 6
BASIDIOMATA 40-110 mm tall, solitary, gregarious or densely caespitose,
chalk-white (1A1) when young, pale yellow (1A2) in age, not changing
when dried, palmately branched from a flattened stipe immersed in the soil,
branching four to six times in one plane but twisted; branches slightly rugulose,
flattened and narrowly spathulate, the upper side of the branches minutely
subtomentose, 3.0—5.0 mm wide in the lower branches, tapering towards the
apex, polychotomous below, becoming dichotomous, internodes becoming
gradually longer; apices white (1A1), acute to blunt, subulate or subterete,
narrowly ligulate; strpE 15-45 x 2.0—4.0 mm, sometimes branched from the
base, dilated and flattened below the branch nodes, arising from compact
mycelial strands in the soil. CONTEXT pale yellow (1A2), slightly coriaceous,
tough at the base of the stipe; odor unpleasant; taste unrecorded.
BASIDIOSPORES 6.0—7.5 x 3.0-4.5 um (Q = 1.96) (s = 5 specimens),
narrowly ellipsoid, hyaline, angular-nodulose, finely verrucose, slightly thick-
walled, warts 0.3—0.6 um long, apex blunt, inamyloid; hilar appendage small.
BASIDIA 25-32 x 6.0—-8.0 um, clavate, finely granular-vacuolate, clamped;
2—4-spored, 4.0—-5.0 um long. Cystrp1a absent. HymMEenium <40 um thick,
122 ... Furtado & al.
thickening upward, <250 um thick, covering the underside of the branches.
SUBHYMENIUM ca. 30 um thick, composed of loosely interwoven hyphae,
2.5-5.0 um diam, thin-walled. CONTEXT compact, with parallel arranged
hyphae 3.5-4.0 um diam, cylindric, with ampulliform septa 5.0-6.0 um
diam, slightly thick-walled, clamped. Surface of sterile base composed of a
trichodermal pellis, hyphae 1.5—3.0 um diam, smooth, thin-walled, clamped.
Crystals of calcium oxalate in rosettes, covering the hyphae in the context and
basal mycelium.
ECOLOGY & DISTRIBUTION—In the Atlantic Forest, this species is found
on soil and is possibly lignicolous. In Brazil, it is known from Amazonas, Mato
Grosso, Para, Parana, Rio de Janeiro, Rio Grande do Sul (Corner 1953, 1966,
1970; Meijer 2006) and Santa Catarina (present study). It is also known from
Burma, Cameroon, Congo (type locality), Cuba, Japan, Java, Madagascar,
Malaysia, Mauritius, Nigeria, Panama, Sumatra, the Philippines, Solomon
Islands, Uganda, the USA (Corner 1950, 1966, 1970), and India (Thind 1961;
Dutta & al. 2012).
MATERIAL EXAMINED—BRAZIL. SANTA CATARINA: Floriandpolis, Lagoa do Peri,
Trilha da Cachoeira, 27°74’41”S 48°52’04”W, 15 II 2014, A.N.M. Furtado 441 (FLOR
56187; GenBank MK458771); 19 III 2014, A.C. Magnago 974 (FLOR 56186; GenBank
MK458766); Universidade Federal de Santa Catarina, Campus Trindade, Depto de
Botanica, 27°60'17”S 48°52’50”W, 26 III 2013, A.N.M. Furtado 304 (FLOR 56184;
GenBank MK458767); 14 IV 2014, A.N.M. Furtado 488 (FLOR 56188; GenBank
MK458774); M.A. Neves 588 (FLOR 56197).
ADDITIONAL SPECIMENS EXAMINED—BELIZE, 2002, P.J. Roberts s.n. (K 109202,
109203, 109237). BRAZIL. ParaiBa: Mataraca, 06 VI 2011, F. Wartchow s.n. (JPB
45094). PERNAMBUCO: Recife, Parque Estadual de Dois Irmaos, 13 VII 1954, O.S. Silva
n.n. (URM 876); Vitoria de Santo Antao, Itamatamirim, 17 IX 1954, S.J. Silva n.n. (URM
1071). Rio Grande do Sul: no location, 1925, J.E. Rick s.n. (BPI 295379, 333159, 333160,
333162, 333164, 723389, as Clavaria pteruloides Pat. & Gaillard), 1907, J.E. Rick s.n.
(PACA 17243, as Lachnocladium moelleri Henn.); S4o Leopoldo, 1925, J.E. Rick s.n. (BPI
295379, 333159, 333160, 333162, 333164, 723389). MALAYSIA. Mataya: Pahang, 25
XI 1930, E.J.H. Corner s.n. (BPI 295368).
COMMENTS—Scytinopogon pallescens is morphologically highly variable and a
common species in tropical and subtropical regions (Corner 1970).
Scytinopogon pallescens is easily recognized macroscopically by its chalk-
white basidiomata with flattened branches. Microscopically, it has hyaline
ellipsoid, angular-echinulate basidiospores, and uninflated, non-mucilaginous
hyphae throughout the basidioma (Corner 1950). Some of our collections had
basidiospores with such subtle angles that they appeared ellipsoid. In addition,
the specimens have chalk-white basal mycelia that divide palmately before
reaching the surface of the substrate.
Scytinopogon caulocystidiatus & S. foetidus spp. nov. (Brazil) ... 123
Corner (1970) referred many Brazilian collections to Scytinopogon
angulisporus (Pat.) Corner, including several specimens from Rio Grande
do Sul that Petersen (1984) redetermined as S. pallescens. Scytinopogon
angulisporus is no longer accepted in Scytinopogon, since its type specimen is
conspecific with Clavulina connata (Berk.) Corner (Petersen 1984).
Scytinopogon chartaceus is quite similar to S. pallescens, in both color
and morphology of the basidioma; however, S. chartaceus has more strongly
echinulate basidiospores. This ornamentation is unusual for most Scytinopogon
species, which are normally nodulose-warted with cushion-shaped warts
(Petersen 1988).
Scytinopogon robustus (Rick) Corner, Beih. Nova Hedwigia 33: 91. 1970. Fic. 7
BASIDIOMATA 23-35 mm tall, solitary or caespitose, pale grayish
(19B2), drying pale yellow (3A4), subfragile, flattened; branches flattened
to subcylindric, bifurcate with slightly compressed axils, branched three
times, subacute, mostly dichotomous, internodes irregular, diminishing
gradually towards the apex; apices grayish violet (15E5), subulate,
Fic. 7. Scytinopogon robustus. (FLOR 56190).
A. Fresh basidiomata in situ; B, C. Basidiospores; D. Basidia.
Scale bars: A = 1 cm; C-D = 10 um.
124 ... Furtado & al.
sometimes blunt, subcristate to subpalmate; sTIPE 9.0 x 2.0 mm, white
to pale grayish (19B2), smooth, cylindric to flattened, coriaceous-fibrous.
CONTEXT hollow; odor and taste not distinctive.
BASIDIOSPORES 6.0—6.5 x 3.5—4.0 um (Q = 1.53) (s = 3 specimens),
ellipsoid, hyaline, angular-nodular, slightly echinulate, slightly thick-
walled, warts 0.4—0.8 um long, inamyloid; hilar appendage obscured
by spore ornamentation. BAsIp1a 22—31 x 7.0—10 um, clavate, barrel-
shaped, clamped; (2—)4-spored, 3.0-5.0 um long, homogeneous to
minutely guttulate. CysTip1a absent. HyMENIUM <37.5 um thick,
covering the undersides of the branches. SUBHYMENIUM c. 20 um thick,
hyphae 3.0-3.5 um diam, slightly inflated, clamped. CONTEXT with
subparallel arranged hyphae 6.0—23 um diam, inflated, thin-walled,
slightly constricted at the septa, clamped. Surface of sterile base covered
by repent hyphae <3.0 um diam, smooth, hyaline, clamped; medullary
basal hyphae 12—15 um diam.
ECOLOGY & DISTRIBUTION—In the Atlantic Forest, S. robustus occurs
on soil among litter. In Brazil, it is known from Parana (Meijer 2006), Rio
de Janeiro (Corner 1970), Rio Grande do Sul (type locality, Rick 1931,
1959), and Santa Catarina (present study). It is also known from Puerto
Rico (Corner 1970) and Mexico (Garcia-Sandoval & al. 2004).
SPECIMENS EXAMINED—BRAZIL. SANTA CaTARINA: Floriandpolis, Morro da
Lagoa, Trilha do Jipe, 27°59’43”S 49°47’83”W, 23 I 2013, A.N.M. Furtado 422 (FLOR
56190; GenBank MK548768); Costao do Santinho, Morro das Aranhas, 27°47'66”S
48°38'18”W, 27 I 2014, A.N.M. Furtado 431 (FLOR 56179; GenBank MK458770). SAo
PavuLo: Caraguatatuba, Serra do Mar, 19 I 2016, ET.FE. Linhares 144a (FLOR 59329).
ADDITIONAL SPECIMENS EXAMINED—BRAZIL. R10 GRANDE DO SUL: Pareci
Novo, 1935, J.E. Rick s.n. (PACA 12457, holotype).
CoMMENTS—Although our collection is small in size and has fragile
basidiomata, Scytinopogon robustus can reach 50-100 mm tall (Rick 1931,
Garcia-Sandoval & al. 2004). However, the epithet refers to the size of the
basidiospores, which are larger than the spores of other Scytinopogon species.
Scytinopogon pallescens, a widespread species, looks like a pale form of
S. robustus; however, S. pallescens has larger basidiospores (5.5—7.0 x 3.5—4.0
um) and its hyphae are not inflated (occasionally <10 um diam) (Corner 1950,
1970, Garcia-Sandoval & al. 2004).
Among the known species of Scytinopogon, only S. robustus and
S. echinosporus have inflated hyphae (Corner 1970). Scytinopogon echinosporus
has basidiomata with light brown apices and smaller basidiospores (4.5-5.5 x
3.5 um, Garcia-Sandoval & al. 2004).
Scytinopogon caulocystidiatus & S. foetidus spp. nov. (Brazil) ... 125
Fic. 8. Scytinopogon scaber. (FLOR 56189). A. Fresh basidiomata in situ;
B, C. Basidiospores; D. Basidia; E. Context hyphae with ampulliform septa.
Scale bars: A = 1 cm; C-E = 10 um.
Scytinopogon scaber (Berk. & M.A. Curtis) D.A. Reid,
Persoonia 2(2): 161. 1962. Fic. 8
BASIDIOMATA 95 mm tall, solitary to scattered, white (1A1), slightly
translucent to slightly pinkish close to the stipe, the apices concolor,
branched; branches in one plane, becoming inclined and horizontal, flattened
and narrowly spathulate, polychotomous below, becoming dichotomous,
internodes spaced, subterete, slightly expanded at the axils, the underside
developing minute spines or papillae (these scattered at first, then crowded
and concrescent), entire or slightly dentate, irregular, apices ligulate; sTIPE
35 x 7.0 mm, dilating 3.0 mm wide upward. CONTEXT rather dry, firm; odor
and taste absent.
BASIDIOSPORES 3.0—4.0 x 2.5-3.5 um (Q = 1.26) (s = 1 specimen),
broadly ellipsoid, hyaline, slightly angular, echinulate, warts 0.2-0.5 um
long, inamyloid; hilar appendage obscured by spore ornamentation. BASIDIA
15-18 x 4.5—5.5 um, clavate, finely granular-vacuolate, clamped; 4-spored,
2.0—4.0 um long. CystTip1a absent. HyMENIUM <20 um thick, thickening
126 ... Furtado & al.
upward, amphigenous, covering the undersides of the branches, sterile on
the hypogenous region. SUBHYMENIUM <15 um thick, hyphae 2.5—5.0 um
diam, thin-walled. CONTEXT with parallel arranged hyphae 3.5—4.0 um
diam, cylindric, slightly thick-walled, inner hyphae 8.0-12 um diam, not
inflated, clamped. Surface of sterile base with cylindric repent hyphae 3.0 um
diam, disarticulated, slightly thick-walled.
ECOLOGY & DISTRIBUTION—In the Atlantic Forest, this species occurs
on soil. It was previously reported for Brazil (without any details of localities
or specimens) by Corner (1970), and here we record it for Santa Catarina.
It is also known from Fiji (type locality), Brunei (Corner 1970), and Mexico
(Ramirez-Lopes & al. 2012).
MATERIAL EXAMINED—BRAZIL. SANTA CATARINA: Santo Amaro da Imperatriz,
Hotel Plaza Caldas da Imperatriz, Trilha da Pousada, 27°70’39’S, 48°80’37”W, 10 IV
2014, A.N.M. Furtado 483 (FLOR 56189; GenBank MK548773).
ADDITIONAL SPECIMENS EXAMINED—BRUNEI. 1959, E.J.H. Corner s.n. (K
69072), 1992, B.M. Spooner s.n. (K 27130).
COMMENTS— Originally described from Fiji, Scytinopogon scaber is diagnosed
by its small, echinulate basidiospores and branched, clavarioid, distinctly
papillate basidiomata (Ramirez-Lopes & al. 2012).
The collection from Santa Catarina is quite similar to Corner’s collection
from Brunei, except for some hyphae in the context that are broader in the
Brazilian specimen (2.0—3.5 um diam on Corner’s specimen).
Scytinopogon papillosus Corner, the only other Scytinopogon species with
a papillate hymenophore (Corner 1970), can be distinguished by its reddish
basidiomata, very strongly inflated hyphae (3.0—25[—30] um diam), and larger
(4.0-4.5 x 2.7-3.5 um) ellipsoid basidiospores (Corner 1970). Scytinopogon
papillosus is known only from Bolivia, from Singer's collection in Corner
(1970). Unfortunately, the type collection was not found so our comparison
was based on Corner’s protologue.
Key to Scytinopogon species in Brazil
1. Hymenophore becoming more or less minutely papillate or hydnoid ..... S. scaber
LeFiyimenophore smooth ys. 's stasee is casey se tacts oats wena le ta sae wie sek Bate 2 Be ted 2
2. Basidiomata light brown to reddish brown when fresh ................0...005. 3
2. Basidiomata pure white to pale yellow when fresh ................... 00 eee e eee 4
3. Basidiomata slender with flattened branches,
context dry; context hyphae inflated to 6.0-23 um diam .......... S. robustus
3. Basidiomata robust with cylindric to flattened and narrowly spathulate branches,
context viscid; context hyphae 3.5-8 um diam .................... S. foetidus
Scytinopogon caulocystidiatus & S. foetidus spp. nov. (Brazil) ... 127
4, Basidiomata subfragile, reddish brown when dry; basal mycelium absent ........ 5
4. Basidiomata more robust, pale yellow when dry; basal mycelium present ........ 6
5. Basidiospores subglobose; cystidial hairs on stipitipellis ........ S. caulocystidiatus
5. Basidiospores ellipsoid; no cystidial hairs on stipitipellis.............. S. dealbatus
6. Basal mycelium abundant and very compact, crystals present, insoluble in KOH;
basidiospores nodulose, finely verrucose .............-.- e200 eee S. pallescens
6. Basal mycelium scant and loosely attached, crystals absent;
basidiospores;trulyechinulate sii. ioe 6 oe cade acess ora Geed ¥en S. chartaceus
REFERENCE ExXsICCATA STUDIED—Scytinopogon echinosporus: SOLOMON
ISLANDS. 1967. E.J.H. Corner s.n. (RBGE 101775). INDONESIA. 1996, R.E Ellen s.n.
(K 45815).
Scytinopogon papillosus: BOLIVIA. 17 III 1956, R. Singer B 2100, B 2100 A (CGE,
holotype).
Discussion
The Brazilian Atlantic Forest harbors a great diversity of macrofungi
and the continual description of new species in this area emphasizes the
importance of studying and preserving this biome. This work expands what
is known about clavarioid fungi in the Atlantic Forest by providing detailed
descriptions and illustrations for seven Scytinopogon species and adding two
new species. to both the region and the world.
This work also presents a more robust phylogeny for Scytinopogon
generated from nrITS sequences of six out of eight known species, supporting
Scytinopogon caulocystidiatus and S. foetidus as new, independent species
and confirming the morphological differences between them and the rest
of the genus.
Scytinopogon was historically classified in Clavariaceae, despite the
proposed relationship with Hydnodontaceae and thelephoroid fungi.
However, the results obtained by Larsson & al. (2011) and Birkebak & al.
(2013) indicate Scytinopogon is related to Trechispora. Nevertheless, to
clarify the classification of Scytinopogon in Hydnodontaceae (Trechisporales),
a more comprehensive study with more samples and more molecular
markers is needed.
We have also shown that despite its being rarely documented, Scytinopogon
is both abundant and widespread in the tropics and subtropics.
Acknowledgments
The authors thank the following: Fiocruz (Centro de Pesquisas René Rachou,
Minas Gerais/Brazil) for molecular sequencing; PPGFAP/UFSC and BrBOL (Dr.
Aristoteles Gées-Neto in particular) for partial financial support; and the curators
128 ... Furtado & al.
and staff of BPI, CGE, FLOR, INPA, JPB, K, MBM, PACA, RBGE and URM for
specimen loans. We also thank the Laboratorio Central de Microscopia Eletrénica
(LCME/UFSC) for the SEM analyses. We are indebted to Altielys C. Magnago,
Fernanda T. F. Linhares, Eduardo P. Fazolino, and Mary Luz Vanegas-Léon for
providing collections. Savio Torres de Farias made important contributions to the
manuscript. Nathan Smith is acknowledged for editing the text. The authors also
thank Dr. Arun Kumar Dutta (West Bengal State University, Basarat, India) and
Dr. Ibai Olariaga (Universidad Rey Juan Carlos. Madrid, Spain) for pre-submission
review. This research was supported by the Coordenacao de Aperfeigcoamento
Pessoal de Nivel Superior (CAPES).
Literature cited
Birkebak JM, Mayor JR, Ryberg KM, Matheny PB. 2013. A systematic morphological and
ecological overview of the Clavariaceae (Agaricales). Mycologia 105(4): 896-911.
https://doi.org/10.3852/12-070
Corner EJH. 1947. Variation in the size and shape of spores, basidia and cystidia in Basidiomycetes.
New Phytologist 46(2): 195-228. https://doi.org/10.1111/j.1469-8137.1947.tb05079.x
Corner EJH. 1950. A monograph of Clavaria and allied genera. Annals of Botany Memoirs 1.
740 p.
Corner EJH. 1953. Addenda Clavariacea. WI. Annals of Botany, N.S. 17(2): 347-368.
https://doi.org/10.1093/oxfordjournals.aob.a083355
Corner EJH. 1966. Clavarioid genera and Thelephora from the Congo. Bulletin du Jardin
Botanique de l’Etat a Bruxelles 36(3): 257-279. https://doi.org/10.2307/3667188
Corner EJH. 1970. Supplement to “A monograph of Clavaria and allied genera.” Beihefte zur
Nova Hedwigia 33. 299 p.
Darriba D, Taboada GL, Doallo R, Posada D. 2012. jModelTest 2: more models, new heuristics
and parallel computing. Nature Methods 9(8): 772. https://doi.org/10.1038/nmeth.2109
Desjardin DE, Perry BA. 2015. A new species of Scytinopogon from the island of Principe,
Republic of Sao Tomé and Principe, West Africa. Mycosphere 6(4): 433-440.
https://doi.org/10.5943/mycosphere/6/4/5
Dutta AK, Pradhan P, Roy A, Acharya K. 2012. Agaricales of West Bengal, India. I. Clavariaceae:
Clavaria and Scytinopogon. Indian Journal of Applied and Pure Biology 27(1): 53-58.
Garcia-Sandoval R, Cifuentes J, Villegas M. 2004. First record of Scytinopogon from Mexico,
with notes on its systematics. Mycotaxon 89: 185-192.
Guindon S, Gascuel O. 2003. A simple, fast and accurate method to estimate
large phylogenies by maximum-likelihood. Systematic Biology 52: 696-704.
https://doi.org/10.1080/10635 150390235520
Hibbett DS, Binder M, Bischoff JE Blackwell M, Cannon PF, Eriksson OE & al. 2007. A
higher-level phylogenetic classification of the fungi. Mycological Research 111: 509-547.
https://doi.org/10.1016/j.mycres.2007.03.004
Jiilich W. 1981. Higher taxa of Basidiomycetes. Bibliotheca Mycologica 85. 485 p.
Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Molecular Biology and Evolution 30: 772-780.
https://doi.org/10.1093/molbev/mst010
Scytinopogon caulocystidiatus & S. foetidus spp. nov. (Brazil) ... 129
Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, & al. 2012. Geneious Basic: an
integrated and extendable desktop software platform for the organization and analysis of
sequence data. Bioinformatics 28: 1647-1649.
https://doi.org/10.1093/bioinformatics/bts199
Kornerup A, Wanscher JH. 1978. Methuen Handbook of Colour. 3rd ed. Eyre Methuen,
London. 243 p.
Largent DL, Johnson D, Watling R. 1977. How to identify mushrooms to genus III: microscopic
features. 3rd ed. Mad River Press Inc., Eureka. 148 p.
Larsson K-H, Lzessge T, Yorou NS, Ryvarden L. 2011. The phylogenetic position of Hydnodon
and Scytinopogon. Abstracts, Mycological Society of American Meeting, Fairbanks, Alaska,
2-5 Aug 2011.
Meijer AAR de. 2006. Preliminary list of the macromycetes from the Brazilian state of Parana.
Boletim do Museu Botanico Municipal 68: 1-55.
Meijer AAR de. 2008. Notable macrofungi from Brazil's Parana pine forests. Colombo, PR:
Embrapa Florestas. 431 p.
Meiras-Ottoni A, Gibertoni TB, Larsson K-H. 2021. Additions to Trechispora and the status
of Scytinopogon (Trechisporales, Basidiomycota). Mycological Progress 20: 203-222.
https://doi.org/10.1007/s11557-021-01667-y
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES science gateway for inference
of large phylogenetic trees. 1-8, in: Proceedings of the Gateway Computing Environments
Workshop (GCE). New Orleans, Louisiana. https://doi.org/10.1109/GCE.2010.5676129
Miller K. 2005. SeqState - primer design and sequence statistics for phylogenetic DNA datasets.
Applied Bioinformatics 4: 65-69. https://doi.org/10.2165/00822942-200504010-00008
Patouillard. 1907. Basidiomycétes nouveaux du Brésil recueillis par F. Noack. Annales Mycologici
5(4): 364-366.
Petersen RH. 1984. Type studies in the clavarioid fungi. VIII. Persoonia 12(3): 225—237.
Petersen RH. 1988. Notes on clavarioid fungi. XXII. Three interesting South American
collections. Mycologia 80: 571-576. https://doi.org/10.1080/00275514.1988.12025581
Rambaut A, Suchard MA, Xie D, Drummond AJ. 2014. Tracer v1.6, U.K. Available at:
http://beast.bio.ed.ac.uk/Tracer (Accessed 10 May 2017).
Ramirez-Lopes I, Villegas-Rios M, Cano-Santana Z. 2012. Diversidad de Agaricomycetes
clavarioides en la Estacién de Biologia de Chamelas, Jalisco, México. Revista Mexicana de
Biodiversidad 83: 1084—1095. https://doi.org/10.22201/ib.20078706e.2012.4.1271
Reid DA. 1962. Notes on fungi which have been referred to the Thelephoraceae sensu lato.
Persoonia 2(2): 109-170.
Rick JE. 1931. Clavaria robusta Rick. Egatea 16: 120.
Rick JE. 1959. Basidiomycetes Eubasidii in Rio Grande do Sul - Brasilia. III. Iheringia Botanica
5:126-192.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. https://doi.org/10.1093/bioinformatics/btg180
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning - laboratory manual, 2°‘. Cold
Spring Harbor Laboratory Press, New York.
Sayers EW, Barrett T, Benson DA, Bryant SH, Canese K, Chetvernin V & al. 2009. Database
resources of the National Center for Biotechnology Information. Nucleic Acids Research 37:
D5-D15. https://doi.org/10.1093/nar/gkn741
Simmons MP, Ochoterena H. 2000. Gaps as characters in sequence-based phylogenetic analyses.
Systematic Biology 49: 369-381. https://doi.org/10.1093/sysbio/49.2.369
130 ... Furtado & al.
Singer R. 1945. New genera of fungi. II. Lloydia 8(2): 139-144.
Stamatakis A. 2014. RAxML Version 8: A tool for phylogenetic analysis and post-analysis of
large phylogenies. Bioinformatics 30(9): 1312-1313.
https://doi.org/10.1093/bioinformatics/btu033
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular evolutionary
genetics analysis version 6.0. Molecular Biology and Evolution 30: 2725-2729.
https://doi.org/10.1093/molbev/mst197
Thiers B. 2017 [continuously updated]. Index Herbariorum: a global directory of public
herbaria and associated staff. New York Botanical Garden's Virtual Herbarium.
http://sweetgum.nybg.org/ih/. Accessed 23 Apr 2017.
Thind KS. 1961. The Clavariaceae of India. Indian Council of Agricultural Research, New Delhi.
197 p.
Vellinga EC, Noordeloos ME. 2001. Glossary. 6-11, in: ME Noordeloos ME & al. (eds): Flora
Agaricina Neerlandica, Vol. 5. A.A. Balkema Publishers, Lisse/Abington/Exton/Tokyo.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 131-140
https://doi.org/10.5248/136.131
Brykendrickia catenata gen. & sp. nov. from India
RAJNISH KUMAR VERMA”, I.B. PRASHER’, SUSHMA?,
KUNHIRAMAN C. RAJESHKUMAR‘’, AJAY KUMAR GAUTAWM?,
RAFAEL F. CASTANEDA-Ruvu1z™*
' Department of Plant Pathology, Punjab Agricultural University,
Ludhiana, Punjab, 141004, India
? Department of Botany, mycology and Plant Pathology Laboratory, Panjab University,
Chandigarh, 160014, India
* Department of Biosciences, Chandigarh University Gharuan, Punjab, India
* National Fungal Culture Collection of India, Agharkar Research Institute,
Pune, 411004, Maharashtra, India
° School of Agriculture, Abhilashi University,
Mandi- Himachal Pradesh, 175028, India
° Instituto de Investigaciones Fundamentales en Agricultura Tropical
Alejandro de Humboldt (INIFAT), OSDE, Grupo Agricola,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P. 17200
* CORRESPONDENCE TO: [email protected], [email protected]
ABSTRACT—A new hyphomycete genus and species, Brykendrickia catenata, collected
on decaying culms of bamboo species from Indian forests, is described and illustrated.
Brykendrickia catenata is the type species for a new monotypic genus possessing sporodochial
conidiomata. Conidiogenous cells are polyblastic, rarely monoblastic, cylindrical, and
hyaline to subhyaline. Conidia are loosely cheiroid, blastocatenate, and produce branches of
doliiform to oblong, botuliform, globose or subglobose, sub-hyaline to light grey cells.
KEY worDs—asexual fungi, systematics, taxonomy
Introduction
India is one of the richest reservoirs of biodiversity in Asia. During
ongoing surveys on wood inhabiting fungi, many new ascomycetes,
basidiomycetes, and asexual fungi (especially hyphomycetes) have recently
132 ... Verma & al.
been described (Adam¢ik & al. 2015; Buyck & al. 2017; Prasher & Verma
2014, 2015a,b,c; Prasher 2015; Sushma & al. 2019; Verma & al. 2019). Here
we describe and illustrate a conidial fungus collected on dead and fallen
bamboo culms from Mandi district, Himachal Pradesh. The fungus could
not be morphologically accommodated in any of the published hyphomycete
genera (Ellis 1971, 1976; Subramanian 1971; Matsushima 1975, 1983, 1985,
1989, 1993, 1995; Carmichael & al. 1980; Castafieda-Ruiz 1985, 1986a,b,
1987, 1988; Castafteda-Ruiz & Kendrick 1990a,b, 1991; Seifert & al. 2011;
Punithalingam & Spooner 2011). Therefore, a new genus, Brykendrickia, is
proposed.
Materials & methods
Decaying culms of Bambusa sp. were collected, placed in paper bags, and taken
to the laboratory. The specimen was mounted in 0.01% cotton blue in lactophenol,
and 2% congo red in 50% ammonia (Kirk & al. 2008) and examined under a Matrix
VL-Z60 stereo trinocular microscope and VRS-2f compound microscope. For
scanning electroscopy, material was vacuum-dried in an oven for 24 hours, mounted
and sputtered with gold for 60 seconds, and photographed in a JEOL JSM-6100
scanning electron microscope. The specimens were deposited in the herbarium of
the Department of Botany, Panjab University, Chandigarh, India (PAN). Repeated
attempts to culture the fungus failed on PDA (2% agar broth, potato dextrose agar),
oatmeal agar, malt extract agar (MEA), and a solidified glucose peptone medium
(glucose 10 g/l, peptone 2 g/l, KH,PO, 1 g/l, MgSO,.7H,O 0.5g/l. and agar 20 g/l in
1000 ml H,,O with chips of host).
Taxonomy
Brykendrickia Rajn.K. Verma, Prasher, Rajeshk., Sushma, A.K. Gautam & R.E.
Castaneda,
MB 835296
Differs from Brachyconidiellopsis and Brachyconidiella by its rudimentary, pustulate
conidiomata and its undifferentiated conidiophores.
TYPE SPECIES— Brykendrickia catenata Rajn.K. Verma & al.
EtymoLocy—Latin, Brykendrickia, in honor of Prof. Bryce Kendrick, who has
contributed immensely to hyphomycete taxonomy.
Conidial fungi, hyphomycetes. Conrpiomata sporodochial, rudimentary,
pustulate. Mycelium mostly superficial, composed of septate, rarely branched,
hyaline to subhyaline (pale greyish) hyphae forming mats. CONIDIOPHORES
undifferentiated. CONIDIOGENOUS CELLS polyblastic, rarely monoblastic,
terminal, discrete or integrated, sympodially elongated, cylindrical or clavate,
hyaline to subhyaline. CoNIDIAL SECESSION schizolytic. Conip14 loosely
Brykendrickia catenata gen. & sp. nov. (India) ... 133
Fic. 1. Brykendrickia catenata (holotype, PAN 32735).
A. Sporodochia on natural substratum;
B-E. Conidia with conidiogenous cell (arrows showing basal cell).
Scale bars: A = 1000 um; B-E = 10 um.
cheiroid, blastocatenate, composed of branches with doliiform to oblong,
botuliform, globose or subglobose, hyaline or subhyaline, smooth cells.
134 ... Verma & al.
Fic. 2. Brykendrickia catenata (holotype, PAN 32735).
Conidia with conidiogenous cell (arrow).
Scale bars = 10 um.
Brykendrickia catenata Rajn.K. Verma, Prasher, Rajeshk., Sushma,
A.K. Gautam & R.F. Castaneda, Figs 1-4
MB 835297
Differs from Brachyconidiellopsis and Brachyconidiella species by its rudimentary,
pustulate conidiomata and its undifferentiated conidiophores, which are reduced
to discrete or integrated conidiogenous cells.
Brykendrickia catenata gen. & sp. nov. (India) ... 135
Fic. 3. Brykendrickia catenata (holotype, PAN 32735).
A. Conidiogenous cell arising from hyphae (arrow showing point of attachment);
B. Intermixed mycelium; C-F. Conidia attached to conidiogenous cell and mycelium.
Scale bars = 10 um.
TypeE—India. Himachal Pradesh: Mandi district, 31°42’N 76°56’E, 800 m, from
dead and fallen culms of a Bambusa sp., 22 July 2015, R.K. Verma ( PAN 32735).
ETyMoLoGcy—Latin, catenata, referring to the catenate conidia.
136 ... Verma & al.
WO = 31.0 mm
Fic. 4. Brykendrickia catenata (holotype, PAN 32735).
Conidia (SEM).
Brykendrickia catenata gen. & sp. nov. (India) ... 137
CONIDIOMATA on natural substratum sporodochial, rudimentary pustulate,
irregular, blackish with smooth to slightly wavy margins, < 1.8 mm
diam. Mycelium mostly superficial, composed of hyaline to subhyaline,
septate, rarely branched, smooth hyphae, 2.6-3.2 um. CONIDIOPHORES
undifferentiated, reduced to conidiogenous cells. CONIDIOGENOUS CELLS
polyblastic, discrete or integrated, rarely monoblastic, cylindrical to clavate,
hyaline, 7.8-10.6 x 3.2-4.5 um. Conidial secession schizolytic. CONIDIA
loosely cheiroid, blastocatenate, branched, sub-hyaline to light grey in colour,
27-74.2 um long, composed of branches with 5-13(-20), doliiform, oblong,
botuliform, globose or subglobose, symmetrical, hyaline, subhyaline to light
grey cells, 4-8.7 x 3.2-4.8 um.
Discussion
Conidial shape and pigmentation in Brykendrickia are morphologically
reminiscent of several genera, including Arbusculina Marvanova & Descals,
Brachyconidiella R.E. CastafMeda & W.B. Kendr., Brachyconidiellopsis
Decock & al., Cladoconidium Bandoni & Tubaki, Matsushimaea Subram.,
Miricatena Punith. & Spooner, Speiropsis Tubaki, and Volucrispora Haskins.
Brykendrickia differs from Arbusculina, Cladoconidium, and Volucrispora in
having a markedly different (terrestrial) ecology contrasting with the truly
TABLE 1. Comparison of Brykendrickia with similar genera
GENUS CONIDIOMATA CONIDIOGENESIS / CONIDIA REFERENCE
Brykendrickia Pustulate to Polyblastic (rarely monoblastic)/ Present study
sporodochial loosely cheiroid, blastocatenate,
rudimentary branched, branches with doliiform
to oblong, botuliform, globose or
subglobose cheiroid, sub-hyaline to
light grey cells
Miricatena None Polyblastic/ hyaline, erect, solitary, Punithalingam
solitary, complex, composed of & Spooner
almost symmetrical primary & 2011
secondary (rarely tertiary) chains
Brachyconidiellopsis Sporodochial or Mono- to polyblastic/ cheiroid, Decock & al.
synnematal penicilliform, repeatedly branched, 2004
branches moniliform, dry, remaining
entire at maturity
Brachyconidiella Sporodochial or Monoblastic/ cheiroid, greyish Castafieda-Ruiz
synnematal brown to grayish black, repeatedly & Kendrick
branched 1990b
138 ... Verma & al.
aquatic habitat of the other three “Ingoldian” hyphomycetes (Seifert & al.
2011). In Speiropsis, conidiophores are macronematous and multiseptate,
conidiogenous cells are polyblastic, and conidia are connected by a narrow
cellular isthmus (Seifert & al. 2011). Matsushimaea lacks conidiomata, and
the conidiogenous cells are monoblastic (Seifert & al. 2011). Miricatena
(TABLE 1) lacks sporodochial conidiomata, and the primary conidial chains
arise from the conidiogenous cells of the (semi-)macronematous 1-7-septate
conidiophores, which further produce secondary (rarely tertiary) hyaline
conidial chains (Punithalingam & Spooner 2011). Brykendrickia differs
from Brachyconidiella and Brachyconidiellopsis in conidial development
and conidiomata (Castafeda-Ruiz & Kendrick 1990b, Decock & al.
2004), which is postulate to rudimentary sporodochial in Brykendrickia
versus sporodochial or synnematous with differentiated conidiophores in
Brachyconidiella and Brachyconidiellopsis (TABLE 1).
Acknowledgments
The authors are grateful to Ministry of Environment and Forests, Government of
India, for financial assistance (letter No. 14/26/2008-ERS/RE dt. 06. 07. 2010) and
to UGC (SAP, DRS III) and Chairperson, Department of Botany, Panjab University,
for providing infrastructural and laboratory facilities. The authors express their
sincere gratitude to Dr. De-Wei Li (The Connecticut Agricultural Experiment
Station, Valley Laboratory, USA) and Dr. Patricia Oliveira Fiuza (Programa de
Pés-graduacao em Sistematica e Evolugao, Universidade Federal do Rio Grande do
Norte, Lagoa Nova, Brazil) for their critical review of the manuscript. Our deep
thanks to Professor Bryce Kendrick for also critically reviewing the manuscript.
Dr. Lorelei Norvell’s editorial review and Dr. Shaun Pennycook’s nomenclature
review are greatly appreciated.
Literature cited
Adam¢ik S$, Cai L, Chakraborty D, Chens XH, Cotter HVT & al. 2015. Fungal biodiversity profiles
1-10. Cryptogamie, Mycologie 36: 121-166. https://doi.org/10.7872/crym/v36.iss2.2015.121
Buyck B, Duhem B, Das K, Jayawardena RS, Niveiro N & al. 2017. Fungal diversity profiles
21-30. Cryptogamie, Mycologie 38: 1-46. https://doi.org/10.7872/crym/v38.iss1.2017.101
Carmichael JW, Kendrick WB, Conners IL, Sigler YL. 1980. Genera of hyphomycetes. University
of Alberta Press, Alberta. 386 p.
Castafeda-Ruiz RF 1985. Deuteromycotina de Cuba, Hyphomycetes III. Instituto de
Investigaciones Fundamentales en Agricultura Tropical, Habana, Cuba. 42 p.
Castaneda-Ruiz RE. 1986a. Deuteromycotina de Cuba. Hyphomycetes IV. Instituto de
Investigaciones Fundamentales en Agricultura Tropical “Alejandro de Humboldt” Habana,
Cuba. 17 p.
Castaneda-Ruiz RE. 1986b. Fungi Cubense. Instituto de Investigaciones Fundamentales en
Agricultura Tropical “Alejandro de Humboldt” Habana, Cuba. 20 p.
Brykendrickia catenata gen. & sp. nov. (India) ... 139
Castafeda-Ruiz RF. 1987. Fungi Cubenses. II. Instituto de Investigaciones Fundamentales en
Agricultura Tropical “Alejandro de Humboldt” Habana, Cuba. 22 p.
Castaneda-Ruiz RF. 1988. Fungi Cubenses III. Instituto de Investigaciones Fundamentales en
Agricultura Tropical “Alejandro de Humboldt” Habana, Cuba. 28 p.
Castafieda-Ruiz RF, Kendrick WB. 1990a. Conidial fungi from Cuba: I. University of Waterloo
Biology Series 32. 53 p.
Castafieda-Ruiz RF, Kendrick WB. 1990b. Conidial fungi from Cuba: II. University of Waterloo
Biology Series 33. 61 p.
Castafieda-Ruiz RF, Kendrick WB. 1991. Ninety-nine conidial fungi from Cuba and three from
Canada. University of Waterloo Biology Series 35. 132 p.
Decock C, Castafeda-Ruiz RF, Adhikari MK. 2004. Taxonomy and phylogeny of
Brachyconidiellopsis fimicola, gen. et sp. nov., a sporodochial to synnematous coprophilous
fungi related to the Microascales (Ascomycetes) from Nepal. Cryptogamie, Mycologie 25:
137-147.
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew.
608 p.
Ellis MB. 1976. More dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew.
507 p.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth and _ Bisby’s
dictionary of the fungi, 10th edition. Wallingford, UK: CAB International.
https://doi.org/10.1079/9780851998268.0000
Matsushima T. 1975. Icones microfungorum a Matsushima lectorum, Kobe, Japan: Published
by the author. 209 p.
Matsushima T. 1983. Matsushima mycological memoirs 3. Published by the author, Kobe. 90 p.
Matsushima T. 1985. Matsushima mycological memoirs 4. Published by the author, Kobe, Japan.
68 p.
Matsushima T. 1989. Matsushima mycological memoirs 6. Published by the author, Kobe, Japan.
100 p.
Matsushima T. 1993. Matsushima mycological memoirs 7. Published by the author, Kobe, Japan.
206 p.
Matsushima T. 1995. Matsushima mycological memoirs 8. Published by the author, Kobe, Japan.
54 p.
Prasher IB. 2015. Wood rotting nongilled agaricomycetes of Himalayas. Fungal
Diversity Research Series, Springer Dordrecht Heidelberg. New York London. 653 p.
https://doi.org/10.1007/978-94-017-9858-7
Prasher IB, Verma RK. 2014. Taeniolina echinata — a new species of hyphomycetes (anamorphic)
fungus from North India. Kavaka 43: 11-13.
Prasher IB, Verma RK. 2015a. Neosporidesmium appendiculatus sp. nov. from North-Western
India. Mycological Progress 14(87): [6 p.]. https://doi.org/10.1007/s11557-015-1112-5
Prasher IB, Verma RK. 2015b. Two new species of Dictyosporium from India. Phytotaxa 204:
193-202. https://doi.org/10.11646/phytotaxa.204.3.2
Prasher IB, Verma RK. 2015c. Some new and interesting hyphomycetes from North-Western
Himalayas, India. Nova Hedwigia 100(1-2): 269-277.
https://doi.org/10.1127/nova_hedwigia/2014/0215
Punithalingam E, Spooner BM. 2011. Miricatena prunicola (hyphomycetes), a new genus
and species causing leaf spots of Prunus serotina in UK. Kew Bulletin 66: 637-642.
https://doi.org/10.1007/s12225-011-9310-z
140 ... Verma & al.
Seifert K, Morgan-Jones G, Gams W, Kendrick WB. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Subramanian CV. 1971. Hyphomycetes. An account of Indian species, except Cercospora. Indian
Council of Agricultural Research, New Delhi. 930 p.
Sushma, Prasher IB, Verma RK. 2019 (2020). Some interesting hyphomycetous fungi from
India. Vegetos: 74-82. https://doi.org/10.1007/s42535-019-00083-8
Verma RK, Prasher IB, Sushma, Gautam AK. 2019. Two new additions to mycoflora
(hyphomycetes) of India. Studies in Fungi 4: 230-243. https://doi.org/10.5943/sif/4/1/25
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 141-158
https://doi.org/10.5248/136.141
Distobactrodesmium gen. nov.
to accommodate Bactrodesmium rahmii
and notes on Bactrodesmium
ZHENFU NIwv', KAI ZHANG”*, DE-WEI L13,
JIAN MA*>, RAFAEL F. CASTANEDA-RUIZ°
' Shandong Agriculture and Engineering University, Jinan, Shandong 250100, China.
? Department of Landscaping, Shandong Yingcai University, Jinan, Shandong 250104, China
> The Connecticut Agricultural Experiment Station,
Valley Laboratory, 153 Cook Hill Road, Windsor, CT 06095, USA
* College of Agronomy, Jiangxi Agricultural University, Nanchang, Jiangxi 330045, China
° Jiangxi Key Laboratory for Conservation and Utilization of Fungal Resources,
Jiangxi Agricultural University, Nanchang, Jiangxi 330045, China
° Instituto de Investigaciones Fundamentales en Agricultura Tropical Alejandro de Humboldt’
(INIFAT), Académico Titular de la Academia de Ciencias de Cuba,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P. 17200
“ CORRESPONDENCE TO: [email protected]
ABSTRACT—A new genus Distobactrodesmium is proposed to accommodate
Bactrodesmium rahmii, characterized by sporodochial conidiomata that produce
distoseptate, brown to dark brown phragmoconidia through monoblastic conidiogenous
cells. Notes and illustrations on Bactrodesmium species are provided.
KEY worps—asexual fungi, hyphomycetes, taxonomy
Introduction
Bactrodesmium Cooke is typified by B. abruptum (Berk. & Broome)
E.W. Mason & S. Hughes, as designated by Hughes (1958). Réblova & al.
(2020) provided an emended description and revision of Bactrodesmium,
supported by phylogenetic analysis of the combined ITS, SSU, LSU, rpb2, and
tefl-a sequences. The genus is distinguished by sporodochial, punctiform,
pulvinate, scattered, brown to black conidiomata composed of (semi-)
142 ... Niu & al.
macronematous, mononematous, cylindrical (sometimes moniliform),
fasciculate or compact aggregated, brown conidiophores. The conidiogenous
cells are monoblastic, rarely terminal, determinate, sometimes elongating
sympodially, and subhyaline to hyaline. Conidial secession is rhexolytic,
and conidia are solitary, acrogenous, variously shaped (globose, subglobose,
clavate, pyriform, ellipsoidal, obovoid, fusiform or cylindrical), transversely
euseptate (sometimes with a longitudinal or oblique septum), smooth or
verruculose, and olivaceous brown or black (Réblova & al. 2020). Réblova
& al. (2020) excluded B. gabretae Koukol & Kolafova and B. rahmii from
the genus due to the presence of distoseptate conidia. They accommodated
B. gabretae in a new genus as Aphanodesmium gabretae (Koukol & Kolatova)
Réblova & Hern.-Restr., but Réblova & al. (2020) did not propose any
taxonomic change for B. rahmii, despite its distance from the Bactrodesmium
generic concept. Therefore, we propose the new genus Distobactrodesmium
to accommodate this atypical Bactrodesmium species.
Taxonomy
Distobactrodesmium Z.F. Niu, K. Zhang & R.F. Castafieda, gen. nov.
IF 557439
Differs from Bactrodesmium by its distoseptate phragmoconidia.
TYPE SPECIES: Bactrodesmium rahmii M.B. Ellis [= Distobactrodesmium rahmii (M.B.
Ellis) Z.F. Niu & al.]
EryMo_oey: Latin, Disto-, referring to the distoseptate conidia, and -bactrodesmium,
referring to the genus Bactrodesmium.
CONIDIOMATA on natural substrates sporodochial, scattered, pulvinate
or irregular, brown to reddish-brown or black. Mycelium superficial and
immersed. STROMATA rudimentary, textura angularis or globose sometimes
present. CONIDIOPHORES macronematous, mononematous, unbranched
or with short lateral branches, cylindrical, erect, septate, smooth-walled,
hyaline or subhyaline. CONIDIOGENOUS CELLS monoblastic, integrated
or discrete, cylindrical or slightly clavate (sometimes inflated near the
conidiogenous loci), determinate (rarely indeterminate with sympodial
extensions), hyaline or subhyaline. Conidial secession rhexolytic. CONIDIA
solitary, acrogenous (sometimes acropleurogenous), obovoid to clavate,
distoseptate, sometimes with thin oblique or longitudinal septa, smooth,
CONTINUED ON P. 150
Fic. 1. Bactrodesmium conidia (re-drawn from the literature). A. B. abruptum (Ellis 1959);
B. B. aquaticum (Borse & al. 2019); C. B. atrum (Ellis 1959); B. betulicola (Ellis 1959).
Scale bars = 10 um.
143
Distobactrodesmium rahmii sp. nov. ...
144 ... Niu & al.
Fic. 2. Bactrodesmium conidia (re-drawn from the literature). A. B. biformatum (Hughes
1983); B. B. cedricola (Ellis 1959); C. B. curvatum (Kirk 1985); D. B. diversum (Hernandez-
Restrepo & al. 2013); E. B. esheri (Kirk 1983). Scale bars = 10 um.
Distobactrodesmium rahmii sp. nov. ... 145
Fic. 3. Bactrodesmium conidia (re-drawn from the literature). A. B. ellipsoideum (Rao
1983); B. B. fruticosum (Matsushima 1993); C. B. globosum (Holubova-Jechova 1972);
D. B. guamense (Matsushima 1981). Scale bars = 10 um.
146 ... Niu & al.
Fic. 4. Bactrodesmium conidia (re-drawn from the literature). A. B. hebridense (Kirk 1986);
B. B. indicum (Rao 1983); C. B. leptopus (Saccardo 1881); D. B. linderi (Palm & Stewart
1982). Scale bars = 10 um.
Distobactrodesmium rahmii sp. nov. ... 147
Fic. 5. Bactrodesmium conidia (re-drawn from the literature). A. B. moenitum (Palm &
Stewart 1982); B. B. mucosum (Matsushima & Matsushima 1995); C. B. nothofagi (Cooper
2005); D. B. obliquum (Sutton 1967); E. B. obovatum (Ellis 1959). Scale bars = 10 um.
148 ... Niu & al.
Fic. 6. Bactrodesmium conidia (re-drawn from the literature). A. B. pallidum (Ellis 1959);
B. B. palmicola (Mercado Sierra & al. 1995); C. B. peruvianum (Sutton 1977); D. B. pithoideum
(Sutton 1975). Scale bars = 10 um.
Distobactrodesmium rahmii sp. nov. ... 149
2a
my
ee
OY een
So oS
Fic. 7. Bactrodesmium conidia (re-drawn from the literature). A. B. pluriseptatum (Révay
1993); B. B. pusillum (Markovskaja 2006); C. B. pyriforme (Holubova-Jechova 1972);
D. B. ramosius (Matsushima 1993). Scale bars = 10 um.
150 ... Niu & al.
brown to dark brown, with one or two hyaline or subhyaline cells toward
the fimbriate base.
Fic. 8. Bactrodesmium and Distobactrodesmium conidia (re-drawn from the literature).
A. B. spilomeum (Hughes & White 1983b); B. B. traversoanum (Ellis 1959); C. B. xerophilum
(Borowska 1975); D. D. rahmii (Ellis 1976). Scale bars = 10 um.
Distobactrodesmium rahmii sp. nov. ... 151
Distobactrodesmium rahmii (M.B. Ellis) Z.F. Niu, K. Zhang &
R.E Castaneda, comb. nov. Fic. 8D
IF 557440
= Bactrodesmium rahmii M.B. Ellis, More Demat. Hyphomyc.: 68 (1976).
Distobactrodesmium rahmii differs from all accepted Bactrodesmium
species (Fics 1-10, TABLE 1) by its distoseptate conidia, as noted by
Hughes & White (1983d) and Réblova & al. (2020). The conidia have
cells with a much reduced lumen and a particular septation sequence
(Hughes & White 1983d). This species has been recorded as an
endophytic fungus associated with Ziziphus sp. (Rhamnaceae) in Oman
(El-Nagerabi & al. (2013) and has also been found on decaying leaf litter
of Hevea brasiliensis (Willd. ex A. Juss) Mull. Arg. (Euphorbiaceae) in
Thailand (Seephueak & al. 2010) and on bark and dead branches of Picea
sp. (Pinaceae) in Canada and Switzerland (Ellis 1976, Hughes & White
1983d).
Discussion
Conidial ontogeny and conidiogenous events have been considered
fundamental criteria for asexual fungal taxonomy and_ generic
delimitation (Kendrick 2017, Seifert & al.2011). Following their multigene
DNA analyses, Réblova & al. (2020) accommodated four atypical
Bactrodesmium species within three new genera: Aphanodesmium (for
A. gabretae) and Kaseifertia Réblova & al. (for K. cubense (R.E Castaneda
& G.R.W. Arnold) Réblova & al.), both genera characterized by
rhexolytic conidial secession, and Gamsomyces Hern.-Restr. & Réblova
(for G. longisporus (M.B. Ellis) Hern.-Restr. & Réblova (type) and
G. stilboideus (R.E Castafleda & G.R.W. Arnold) Hern.-Restr. & Réblova),
characterized by schizolytic conidial secession. Several Bactrodesmium
species (Fics 1-10, TABLE 1) have been described and illustrated with
a truncate conidial base produced after schizolytic conidial secession:
e.g., B. betulicola M.B. Ellis, B. moenitum (J.L. Crane & Shearer) M.E.
Palm & E.L. Stewart, B. nothofagi J.A. Cooper, B. pithoideum (Dearn.
& House) B. Sutton, B. pluriseptatum Révay, and B. pusillum Markovsk.
(Ellis 1959, Sutton 1975, Palm & Stewart 1982, Révay 1993, Cooper 2005,
Markovskaja 2006). Despite their apparent schizolytic secession, these
species still remain in Bactrodesmium (Réblova & al. 2020). Additional
morphological and molecular studies will probably result in the
segregation of other species into new genera
152 ... Niu & al.
: sl %
Fic. 9. Bactrodesmium conidia. A. B. novageronense (Espinoza & al. 2020). B. B. pulcherrimum.
(Espinoza & al. 2020). C. B. simile (Arias & al. 2016). Scale bars = 10 um.
Distobactrodesmium rahmii sp. nov. ... 153
Fig. 10. Bactrodesmium conidia.
A. B. chinense (Shi & al. 2020). B. B. lushanense (Shi & al. 2020).
154 ... Niu & al.
TABLE 1. Comparative conidial morphology of accepted Bactrodesmium species
and Distobactrodesmium rahmii.
SPECIES SHAPE SEPTA CONIDIAL Fic. | REFERENCE
SIZE (\tm)
B. abruptum Clavate to oblong- 3-7 32-70 x 1A Ellis 1959
clavate 12-17
B. aquaticum Broadly pyriform 2 15-26 x 1B Borse & al. 2019
10-18
B. atrum Obovoid 3-5 43-72 x 1C Ellis 1959
22-38
B. betulicola Ellipsoidal or 4 26-40 x 1D Ellis 1959
cylindrical 9-15
B. biformatum Ellipsoidal to clavate — (3-)5-7 23-40 x 2A Hughes 1983
(-9) Teo
B. cedricola Ellipsoidal, 1-6 20-35 x 2B Ellis 1959
cylindrical or 9-18
clavate
B. chinense Ellipsoidal to (9-)10 54-63.5 x 10A Shi & al. 2020
broadly fusiform or (-11) 23.5-26.5
navicular
B. curvatum Subglobose to 3 24-32 x 2C Kirk 1985
broadly pyriform 14-20
B. diversum Ellipsoidal or 255. 18-64 x 2D Hernandez-
clavate, sometimes 10-18 Restrepo & al. 2013
obovoid,
pyriform or
sigmoid
B. ellipsoideum Broad ellipsoidal 5-6 30-42 x 3A Rao 1983
to fusiform or 9-12
navicular
B. esheri Ellipsoidal to 2 10.5-15 x 2k Kirk 1983
obovoid 515-75
B. fruticosum* Cylindrical (2-)4-6 30-55 x 3B Matsushima 1993
(-8) 5-6.5
B. globosum Obovoid or broadly 2-3 30-47.5 x 3C Holubova-Jechova
clavate 20-24 1972
B. guamense* Cylindrical-fusiform 3-13 20-62.5 x 3D Matsushima 1981
or cylindrical- 5.5-8
clavate
B. hebridense Ellipsoidal 8-11 36-54 x 4A Kirk 1986
11-15
B. indicum Clavate to 4-5 35-52 x 4B Rao 1983
cylindrical 7-11
Distobactrodesmium rahmii sp. nov. ...
155
SPECIES
B. leptopus
B. linderi
B. lushanense
B. moenitum
B. mucosum*
B. nothofagi
B.
novageronense
B. obliquum
B. obovatum**
B. pallidum
B. palmicola
B. peruvianum
B. pithoideum
B. pluriseptatum
B.
pulcherrimum
B. pusillum
B. pyriforme
B. ramosius
SHAPE
Clavate, ellipsoidal
or broadly obovoid
Pyriform to broadly
pyriform to globose
Obovoid, clavate or
ellipsoidal
Obovoid to
pyriform
Broadly clavate
Obovoid to
pyriform
Obovoid to
subglobose
Ovoid
Clavate
Cylindrical,
ellipsoidal or
clavate
Obovoid, clavate or
ellipsoidal
Pyriform to obovoid
Obovoid to sub-
reniform
Ellipsoidal or
cylindrical
Broadly obovoid to
subnapiform
Elongated ellipsoidal
to clavate
Obovoid to
pyriform
Narrow fusiform
SEPTA
a5
(0-)1-2
(-3)
(3-)5(-6)
3-4
355
5-8
4-transverse,
0-3 oblique
4-5
5-6
3-4
2-3-transverse
1-oblique
4
6-9
CONIDIAL
SIZE (um)
21-44 x
11.5-15.5
15-28 x
11-18
25.5-41.5 x
14-18.5
28-48 x
953i
35-60 x
20-30
47-55 x
18-25
8-13 x
7-10
23-33.5 x
16-21.5
28-58 x
15-23
35-55 x
9-12
22-44 x
15-22
14-20 x
11.5-13.5
22.5-29.5 x
11.5-14.5
30-44 x
11-14
18-24 x
13-19
18-25 x
6,5-7.5
26-30 x
12.5-16
40-64 x
5-7
Fic.
4C
4D
10B
5A
5B
5C
9A
5D
5E
6A
6B
6C
6D
7A
9B
7B
7C
7D
REFERENCE
Saccardo 1881
Palm & Stewart
1982
Shi & al. 2020
Palm & Stewart
1982
Matsushima &
Matsushima 1995
Cooper 2005
Castafieda-Ruiz
1985
Espinoza & al. 2020
Sutton 1967
Ellis 1959, Ellis
1963, Hughes &
White 1983a
Ellis 1959
Mercado Sierra &
al. 1995
Sutton 1977
Sutton 1975
Révay 1993
Espinoza & al. 2020
Markovskaja 2006
Holubova-Jechova
1972
Matsushima 1993
156 ... Niu & al.
SPECIES SHAPE SEPTA CONIDIAL FIG. REFERENCE
SIZE (um)
B. simile Broadly pyriform to 1 19-24 x 9C Arias & al. 2016
obovoid 12-16
B. spilomeum Obovoid or clavate (3-)4-5 25-49 x 8A Hughes & White
to narrowly (-6) 9-16 1983b
ellipsoidal
B. traversoanum Ellipsoidal or clavate 3-6 20-37 x 8B paid ;
8-12 Hughes & White
1983c
B. xerophilum Cylindrical, 2 14-26 x 8C Borowska 1975
ellipsoidal or 3.5-7.5
obovoid
D. rahmii Obovoid to clavate 4-10- 32-58 x 8D Ellis 1976
distoseptate 13-18
* Morphological data from culture; **as “Bactrodesmium arnaudii”
Acknowledgments
We are indebted to Dr. Josiane Santana Monteiro (Museu Paraense Emilio
Goeldi, Belém, Brazil) and Dr. Flavia Rodrigues Barbosa (Instituto de Ciéncias
Naturais, Humanas e Sociais, Universidade Federal de Mato Grosso, Brazil) for
their critical reviews. This work was financed by the National Natural Science
Foundation Program of PR China (31870016). We acknowledge the websites
provided by Dr. P.M. Kirk (Index Fungorum) and Dr. K. Bensch (MycoBank).
Dr. Lorelei L. Norvell’s editorial review and Dr. Shaun Pennycook’s nomenclature
review are greatly appreciated.
Literature cited
Arias RM, Heredia G, Castafieda-Ruiz RF. 2016. Two new species of Bactrodesmium and
Dictyoaquaphila from Mexico. Mycotaxon. 131: 291-295. https://doi.org/10.5248/131.291
Borowska A. 1975. New species of Bactrodesmium, Corynespora, Septonema and Taeniolella.
Acta Mycologica 11: 59-65. https://doi.org/10.5586/am.1975.005
Borse BD, Pawar NS, Patil SY. 2019. Bactrodesmium aquatica sp. nov. (mitosporic fungi) on
submerged wood from freshwater, Maharashtra, India. International Journal of Advanced
Research (IJAR) 7: 1365-1368. https://doi.org/10.21474/IJARO1/8767
Castafeda-Ruiz RE 1985. Deuteromycotina de Cuba. Hyphomycetes 2. Instituto de
Investigaciones Fundamentales en Agricultura Tropical, Cuba. 23 p.
Cooper JA. 2005. New Zealand hyphomycete fungi: additional records, new species,
and notes on interesting collections. New Zealand Journal of Botany 43: 323-349.
https://doi.org/10.1080/0028825X.2005.95 12957
El-Nagerabi SAF, Elshafie AE, Alkhanjari SS. 2013. Endophytic fungi associated with Ziziphus
species and new records from mountainous area of Oman. Biodiversitas 14: 10-16.
https://doi.org/10.13057/biodiv/d140102
Ellis MB. 1959. Clasterosporium and some allied dematiaceae-phragmosporae. II. Mycological
Papers 72.75 p.
Distobactrodesmium rahmii sp. nov. ... 157
Ellis MB 1963. Dematiaceous hyphomycetes IV. Mycological Papers 87. 42 p.
Ellis MB 1976. More dematiaceous hyphomycetes. Commonwealth Mycological Institute,
Kew, Surrey, England. 507 p.
Espinoza FE, Sosa D, Serrano L, Quevedo A, Magdama F, Vera M, Pérez-Martinez S, Malosso E,
Castafieda-Ruiz RE. 2020 [“2019”]. Bactrodesmium pulcherrimum sp. nov. from Ecuador.
Mycotaxon 134: 627-632. https://doi.org/10.5248/134.627
Hernandez-Restrepo M, Mena-Portales J, Gené J, Cano J, Guarro J. 2013. New
Bactrodesmiastrum and Bactrodesmium from decaying wood in Spain. Mycologia 105:
172-180. https://doi.org/10.3852/12-004
Holubova-Jechova V. 1972. Lignicolous hyphomycetes from Czechoslovakia. 2. Bactrodesmium.
Folia Geobotanica et Phytotaxonomica 7: 407-418. https://doi.org/10.1007/BF02854768
Hughes SJ 1958. Revisiones hyphomycetum aliquot cum appendice de nominibus rejiciendis.
Canadian Journal of Botany 36: 727-836. https://doi.org/10.1139/b58-067
Hughes SJ. 1983. Bactrodesmium biformatum. Fungi Canadenses 258. 1 p.
Hughes SJ, White GP 1983a. Bactrodesmium obovatum. Fungi Canadenses 256. 2 p.
Hughes SJ, White GP 1983b. Bactrodesmium spilomeum. Fungi Canadenses 257. 2 p.
Hughes SJ, White GP 1983c. Bactrodesmium traversianum. Fungi Canadenses 259. 2 p.
Hughes SJ, White GP 1983d. Bactrodesmium rahmii. Fungi Canadenses 260. 2 p.
Kendrick B. 2017. The fifth kingdom (4" ed). Hackett publishing company. 416 p.
Kirk PM. 1983. New or interesting microfungi. IX. Dematiaceous hyphomycetes from
Esher Common. Transactions of the British Mycological Society 80: 449-428.
https://doi.org/10.1016/S0007-1536(83)80041-2
Kirk PM. 1985. New or interesting microfungi XIV. Dematiaceous hyphomycetes from Mt
Kenya. Mycotaxon 23: 305-352.
Kirk PM 1986. New or interesting microfungi. XV. Miscellaneous hyphomycetes from
the British Isles. Transactions of the British Mycological Society 86: 409-428.
https://doi.org/10.1016/S0007-1536(86)80185-1
Markovskaja S. 2006. A new species of Bactrodesmium from Lithuania. Mycotaxon 97:
337-343.
Matsushima T. 1981. Matsushima Mycological Memoirs 2. 68 p.
Matsushima T. 1993. Matsushima Mycological Memoirs 7. 141 p.
Matsushima K, Matsushima T. 1995. Fragmenta mycologica - I. Matsushima Mycological
Memoirs 8: 45-54.
Mercado Sierra A, Heredia G, Mena Portales J. 1995. New species of dematiaceous
hyphomycetes from Veracruz, Mexico. Mycotaxon 55: 491-499,
Palm ME, Stewart EL. 1982. Two new combinations in Bactrodesmium. Mycotaxon 15:
SID S522.
Rao PR. 1983. Two new species of Bactrodesmium from India. Indian Journal of Mycology and
Plant Pathology 13: 207-208.
Réblova M, Hernandez-Restrepo M, Fournier J, Nekvindova J. 2020. New insights into the
systematics of Bactrodesmium and its allies and introducing new genus, species and
morphological patterns in the Pleurotheciales and Savoryellales (Sordariomycetes). Studies
in Mycology 95: 415-466. https://doi.org/10.1016/j.simyco.2020.02.002
Révay A. 1993. Some new or interesting hyphomycetes from Hungary. Nova Hedwigia 56:
473-482.
Saccardo PA. 1881. Fungi italici autographice delineati. Fascs 17-28. Tabs 641-1120. Patavii,
Italy.
158 ... Niu & al.
Seephueak P, Petcharat V, Phongpaichit S. 2010. Fungi associated with leaf litter of para rubber
(Hevea brasiliensis). Mycology 1: 213- 227. https://doi.org/10.1080/21501203.2010.536594
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Shi XG, Xu ZH, Sun WX, Xia JW, Zhang XG, Castaneda-Ruiz RE, Ma J. 2020. Bactrodesmium
chinense and B. lushanense spp. nov. and B. novageronense newly recorded from China.
Mycotaxon 135: 861-868. https://doi.org/10.5248/135.861
Sutton BC. 1967. A new species of Bactrodesmium from white spruce. Canadian Journal of
Botany 45: 1777-1781. https://doi.org/10.1139/b67-189
Sutton BC. 1975. Coelomycetes V. Coryneum. Mycological Papers 138. 224 p.
Sutton BC. 1977. Some dematiaceous hyphomycetes from Eucalyptus leaf litter. Boletin de la
Sociedad Argentina de Botanica 18: 154-161.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 159-162
https://doi.org/10.5248/136.159
Physalidiella pentagona sp. nov.
from Guizhou, China
ZHONG-JIU XIAO??’, XIAO-XIA L1?3, TING Liu”,
Mo-FANG CHEN”, SHUANG-SHUANG WANG”, YA-PING KONG?’
‘College of Resources & Environment, Zunyi Normal University,
Zunyi, Guizhou 563002, China
’ College of Biology & Agriculture (College of Food Science & Technology),
Zunyi Normal University, Zunyi, Guizhou 563002, China
° Key Laboratory of Regional Characteristics for Conservation & Utilization of Plant Resource
in Chishui River Basin, Zunyi, Guizhou 563002, China
* CORRESPONDENCE TO: [email protected]
ABSTRACT—A new species, Physalidiella pentagona, collected on dead twigs of Lindera
communis in Guizhou Province, China, is described and illustrated. The fungus is mainly
characterized by differentiated conidiophores with opposite or verticillate short branches
and monoblastic, percurrently extending conidiogenous cells that produce solitary, smooth,
quasi-stellate or T-shaped conidia with an approximately pentagonal central cell and two
smaller hemispherical lateral cells. A dichotomous key to Physalidiella species is provided.
Key worps—hyphomycetes, saprophytic fungi, taxonomy
Introduction
Physalidiella Rulamort was originally established by Rulamort (1990)
with Physalidium elegans Luppi Mosca [= Physalidiella elegans (Luppi
Mosca) Rulamort] as the type species, which was collected from stubble of
Triticum in Italy. Morelet (1995) added a second species, P. matsushimae
(R.E. Castaneda & W.B. Kendr.) M. Morelet [= Physalidium matsushimae R.F.
Castaneda & W.B. Kendr.], with a type specimen from Cuba on rotten leaves
of Cupania americana. Only these two species have been recognized in this
genus. Physalidiella is characterized by macronematous, mononematous
160 ... Xiao & al.
conidiophores with short branches arranged in verticils, and monoblastic,
integrated, terminal, determinate or occasionally percurrently extending
conidiogenous cells that produce solitary, acrogenous, smooth conidia
which are composed of an obovoid, ellipsoidal, fusiform-ventricose, biconic
or approximately pentagonal, mid to dark brown central cell and two
smaller, hemispherical, subspherical or obturbinate, hyaline to subhyaline,
lateral cells (Ellis 1971, Rulamort 1990, Seifert & al. 2011).
A survey of saprobic microfungi on dead twigs from subtropical forest
in Guizhou Province of China has revealed a previously undescribed
Physalidiella species. The specimen is deposited in the Mycological
Herbarium of Zunyi Normal College, Zunyi, China (HMZNC).
Physalidiella pentagona Z.J. Xiao & Xiao X. Li, sp. nov. FIG. 1
EN 570000
Differs from Physalidiella elegans and PB. matsushimae by its percurrently extending
conidiogenous cells, and its conidia with an approximately pentagonal or turbinate,
slightly shorter middle cell.
Type: China, Guizhou Province: Xishui National Nature Reserve, saprobic on dead
twigs of Lindera communis Hemsl. (Lauraceae), 31 Dec. 2018, Xiao X. Li (Holotype,
HMZNC 0687).
ETYMOLOGY: pentagona, refers to the shape of middle conidial cell.
CoLonles on the dead twigs effuse, arachnoid or velvety, brown. Mycelium
partly superficial and partly immersed in the substrate, composed of
branched, septate, pale brown to brown, cylindrical, smooth-walled
hyphae, 2-3 um wide. CONIDIOPHORES macronematous, mononematous,
single or in groups of 2-4, with short branches arranged in verticils: stipe
straight or flexuous, subulate, smooth, thick-walled, 5-11-septate, 95-245
x 4-9.5 um, brown to dark brown, usually a swollen node being formed by
stipe extension in the upper portion of stipe, 6.5-10.5 um wide, pale brown
towards the apex, slightly swollen at the base, dark brown, 4.5-12 um wide;
short branches arising just below the stipe septa, opposite or verticillate,
subulate, 7.5-24 um long, 2-5 um wide at the base, 0-4-septate, pale brown
to brown. CONIDIOGENOUS CELLS monoblastic, integrated, terminal on
stipe and short branches, subulate, doliiform, lageniform or cylindrical,
with up to 4 successive percurrent extensions, pale brown, 1-2.5 um wide
at the apex. Conipia solitary, dry, acrogenous, smooth, complex, quasi-
stellate or T-shaped, with a central cell approximately pentagonal or
turbinate, smooth-walled, mid to dark brown, 5.5-8.5 x 5-7.5 um, angled
Physalidiella pentagona sp. nov. (China)... 161
wncz
Fic. 1. Physalidiella pentagona (holotype, HMZNC 0687).
A. Conidiophores and conidia; B. Stipes and short branches arranged in verticils, apices showing
percurrent extensions of conidiogenous cells; C. Colonies arising from twig surface; D. Conidia.
with a slight camber at the apex, narrow truncate base, 1-2.3 um wide, and
with two lateral cells hemispherical, hyaline to subhyaline, smooth-walled,
4—5.5 x 2-4 um; overall conidial dimensions 5.5-8.5 x 10.5-13 um.
COMMENTS— Our new species, P. pentagona, is distinguished from other
Physalidiella species by its obviously percurrently extending conidiogenous
cells and approximately pentagonal or turbinate middle conidial cell. In
addition, the middle conidial cell of P. pentagona is slightly shorter than
those of P. elegans (7-11 um) and P. matsushimae (8-10 um).
162 ... Xiao & al.
Key to species of Physalidiella
1. Conidiogenous cells with 1-4 percurrent extensions,
conidial central cell approximately pentagonal,
P= Oe Dm Le) AUN ar stares sca cat age Me Sesto anon e Scares Bycls- Saar au P. pentagona
1. Conidiogenous cells without obviously percurrent extensions
Asef hibe: av bargaribbe «Srhaab esha ack saatithe fbrbes ath son ihe aeak waateteendselaarh sods aaa wea¥ibe 2
2. Conidial central cell obovoid or ellipsoidal,
PTI Oe MT ks, vitae shes att Rina Mes Meus arn se ye Rae an Se ctar apne P. elegans
2. Conidial central cell fusiform-ventricose or biconic,
GENS Genter ook 010 RRaeL APA SAG RT atte | OL AO Re Dee Re. Oe P. matsushimae
Acknowledgments
The authors express gratitude to Dr. Jian Ma (Jiangxi Agricultural University,
Nanchang, China) and Dr. Li-Guo Ma (Institute of Plant Protection, Shandong
Academy of Agricultural Sciences, China) for serving as pre-submission reviewers
and for their valuable comments and suggestions. Dr. Lorelei L. Norvell’s editorial
review and Dr. Shaun Pennycook’s nomenclature review are greatly appreciated.
This project was supported by the National Natural Science Foundation of China
(No. 31600030); Guizhou Provincial Natural Science Foundation (No. [2017]1206);
Guizhou Provincial Department of Education Foundation (Nos. QJHKY[2018]032,
QJHKY[2020]026, QJGF[2017]158, QSZHZ[2012]146); Young Science and
Technology Talents Project of Education Department of Guizhou Province (No.
KY[2016]259); Department of Science & Technology of Guizhou Province United
Fund (No. [2015]7058); Fund project of Zunyi Normal University Serving Local
Industrial Revolution (No. ZSHDFCYZ[2020]04).
Literature cited
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew,
Surrey, England. 608 p.
Morelet M. 1995. Notes de mycologie appliquée. Annales de la Société des Sciences Naturelles et
d'Archéologie de Toulon et du Var 47: 89-94.
Rulamort M de. 1990. Remarques taxonomiques et nomenclaturales sur quelques micromycetes.
II. Bulletin de la Société Botanique du Centre-Ouest 21: 511-512.
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 163-167
https://doi.org/10.5248/136.163
Blastophragmia plurisetulosa gen. & sp. nov.
from China
JIAN Ma™, L1-Guo Ma’, RU-QIANG Cur’, WEI-GANG KUANG’,
X1u-Guo ZHANG?, RAFAEL E CASTANEDA-Ruiz?
"College of Agronomy, Jiangxi Agricultural University, Nanchang, Jiangxi 330045, China
? Shandong Key Laboratory of Plant Virology, Institute of Plant Protection,
Shandong Academy of Agricultural Sciences, Jinan, Shandong 250100, China
> Shandong Provincial Key Laboratory for Biology of Vegetable Diseases and Insect Pests,
College of Plant Protection, Shandong Agricultural University,
Taian, Shandong 271018, China
‘ Instituto de Investigaciones Fundamentales en Agricultura Tropical ‘Alejandro de Humboldt’
(INIFAT), Académico Titular de la “Academia de Ciencias de Cuba’,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P. 17200
* CORRESPONDENCE TO: [email protected]; [email protected]
ABSTRACT—A new asexual ascomycete genus and species, Blastophragmia plurisetulosa, is
described and illustrated from a specimen collected on dead branches of unidentified plants
in Hainan Province, China. The fungus is distinguished by macronematous, unbranched,
determinate or percurrently extending conidiophores, and solitary, acrogenous, fusiform
to ellipsoidal, 3-euseptate, smooth, brown conidia with a single apical setula and 2-4 basal
setulae, seceding rhexolytically from monoblastic, integrated, terminal conidiogenous cells.
A key to Blastophragmia and its morphologically similar genera is provided.
KEY worDS—asexual Ascomycota, hyphomycetes, saprobes, taxonomy
Introduction
Hainan Province is located at the southernmost extension of China.
It covers approximately 35,400 km’, and has a unique natural geographic
environment, humid tropical monsoon climate with an average annual
temperature of 22.5-25.6°C and average annual precipitation of 1500-2500
mm, which is especially favorable for various plant and microbial species.
164 ... Ma & al.
During our continuing surveys of saprobic hyphomycetes from plant
debris in the forest ecosystems of this province, an interesting fungus was
collected that showed remarkable differences from all previously described
hyphomycetes (Seifert & al. 2011). Thus, it is described here as a new genus
and species.
Materials & methods
Samples of dead branches were collected and placed in Ziploc™ plastic bags for
transport to the laboratory, where they were processed, and examined as described
by Ma & al. (2011). Microphotographs were prepared using a Nikon Eclipse E200
and SmartV550Dc digital camera, with a 100 x (oil immersion) objective at the same
background and scale. Adobe Photoshop 7.0 was used for image processing to assemble
photographs into plates. The studied specimens are deposited in the Herbarium of
Jiangxi Agricultural University, Plant Pathology, Nanchang, China (HJAUP).
Taxonomy
Blastophragmia Jian Ma, L.G. Ma, X.G. Zhang & R.E. Castafieda, gen. nov.
IF 557506
Differs from Endophragmiella by its setulate conidia; and from Stratiphoromyces by
its conidiophores that are either determinate or with several enteroblastic percurrent
extensions and its uncurved conidia.
TYPE SPECIES: Blastophragmia plurisetulosa Jian Ma & al.
Erymotoey: Latin, Blasto-, referring to the blastic conidial ontogeny, + Greek,
-phragmia, referring to the phragmospores.
CONIDIOPHORES macronematous, mononematous, unbranched, septate,
brown to dark brown, paler towards the apex, determinate or indeterminate
with several enteroblastic percurrent extensions. CONIDIOGENOUS CELLS
monoblastic, integrated, terminal, cylindrical. Conidial secession rhexolytic.
ConipiA solitary, acrogenous, smooth, fusiform to ellipsoidal, euseptate,
setulate, usually bearing a basal frill.
Blastophragmia plurisetulosa Jian Ma, L.G. Ma, X.G. Zhang &
R.F. Castafieda, sp. nov. Fig. 1
IF 557507
Differs from Endophragmiella spp. by its setulate conidia; and from Stratiphoromyces
spp. by its conidiophores either determinate or with several enteroblastic percurrent
extensions, and its uncurved, fusiform to ellipsoidal, 3-euseptate conidia with a single
apical setula and 2-4 basal setulae.
Type: China, Hainan Province: Diaoluoshan Mountain, 18°4’N 109°53’E, on dead
branches of an unidentified broadleaf tree, 15 April 2015, J. Ma (holotype, HJAUP M0349).
Blastophragmia plurisetulosa gen. & sp. nov. (China) ... 165
A B Cc | "0 ( E | SS
1?
66
38
hy;
Fic. 1. Blastophragmia plurisetulosa (holotype, HJAUP M0349). A, B. Conidiophores showing
conidiogenous cells and enteroblastic percurrent extensions, and (in B) conidiophore apex
showing an initial conidium. C-E. Conidiophores and conidiogenous cells with immature
conidia; F. Conidium seceding rhexolytically from conidiogenous cell; G. Conidia.
EtyMo .ocy: refers to the multiple setulae, which arise from the conidial base and
apex.
Co.ontgs on the natural substrate effuse, brown to dark brown, hairy. Mycelium
partly superficial, partly immersed in the substratum, composed of branched,
septate, pale brown to brown, smooth-walled hyphae. CoNnrDIOPHORES
macronematous, mononematous, unbranched, erect, straight or flexuous,
cylindrical, smooth, 3-16-septate, brown to dark brown, paler towards the
apex, determinate or with 1-3 enteroblastic percurrent extensions, <340 um
long, 6.5-13.5 tm wide. CONIDIOGENOUS CELLS monoblastic, integrated,
terminal, cylindrical, brown to pale brown, smooth, 20-105 x 5.5-6.5 um.
Conidial secession rhexolytic. Conrp1A solitary, dry, acrogenous, fusiform to
ellipsoidal, smooth, brown, 3-euseptate when mature, 25-32.5 x 10.5-12.5 um;
with a single apical setula and 2-4 basal setulae, thin, 5-10 um long, straight to
curved, hyaline; bearing a distinct 3.5-5 um wide basal frill.
166 ... Ma &al.
Discussion
Blastophragmia is distinguished by its monoblastic, integrated, terminal,
cylindrical conidiogenous cells on distinct, unbranched, determinate
or percurrently extending conidiophores, and solitary, acrogenous,
fusiform to ellipsoidal, euseptate, conidia with a single apical setula and
2-4 basal setulae, and rhexolytic conidial secession. Blastophragmia
appears similar in conidial ontogeny to several existing genera, including
Endophragmiella B. Sutton (Sutton 1973), Chaetendophragmia Matsush.
(Matsushima 1971), Teratosperma Syd. & P. Syd. (Sydow & Sydow 1909),
and Stratiphoromyces Goh & K.D. Hyde (Goh & Hyde 1998). However,
Endophragmiella differs by its asetulate conidia; Chaetendophragmia
differs by its rostrate conidia with lateral appendages arising from the
middle cells; Teratosperma differs by its annellidic conidiogenous cells
producing conidia with lateral appendages, which arise from the basal
cell; and Stratiphoromyces differs by its conidiogenous cells with crowded
repeating percurrent extensions that lead to the apical portions of
conidiophores with multilayers of wall remnants, and its conidia usually
aggregating in a mass.
Several other genera, including Arachnophora Hennebert (Hennebert
1963), Acrophragmis Kiffer & Reisinger (Kiffer & Reisinger 1970), and
Phragmocephala E.W. Mason & S. Hughes (Mason & Hughes 1951),
have the same conidial secession as Blastophragmia, but Arachnophora
differs by its complex conidia with a two-celled central body, from which
arise several lateral, radial arms; Acrophragmis differs by its conidia with
central cell bearing a ring of small knobs; and Phragmocephala differs by
its asetulate conidia and cupulate or clavate conidiogenous cell.
Key to Blastophragmia and morphologically similar genera
2. Conidiogenous cells with crowded repeating percurrent extensions
Me dike Od che ied het nA hd AA ea eca easel WLAN A ia Stratiphoromyces
2. Conidiogenous cells determinate or with several enteroblastic percurrent
feed A URN (21 RY SON OP Pe a ee ch ae Och ee UR ae Rh ete eee Blastophragmia
2. Gonidia with: biterabappendagesct lap tale le cela dara da dard teh ee teeteinks danshdle:dats “:
S.Conidia without lateral appendagese ot. wit. We Rees Kates rbd a Meadiee wheats aha’ 5
4. Conidial lateral appendages arising from the middle cells ...... Chaetendophragmia
4, Conidial lateral appendages arising from the basal cell ............. Teratosperma
Blastophragmia plurisetulosa gen. & sp. nov. (China) ... 167
5. Conidia with central cell bearing a ring of small knobs ............. Acrophragmis
5. Conidia with central cell not bearing small knobs .......................0.004. 6
6. Conidia complex, with a central body bearing several lateral, radial arms
hs epee ea MMe PN ae hase Melee Mar tgale Seg Git 5 Clagett TCI Gee Tg TS eat PH Arachnophora
6. Conidia simple, without lateral, radial arms ............... 0... cece eee eee Z
7. Conidiogenous loci narrower than rest of conidiogenous cell,
conidia with a regular frill around the base .................. Endophragmiella
7. Conidiogenous loci as wide as other part of conidiogenous cells,
conidia with an irregular frill around the base ............... Phragmocephala
Acknowledgments
The authors express gratitude to Dr. De-Wei Li (The Connecticut Agricultural
Experiment Station, Valley Laboratory, USA) and Dr. Patricia Oliveira Fiuza
(Universidade Federal do Rio Grande do Norte, Lagoa Nova, Brazil) for serving as
pre-submission reviewers and to Dr. Shaun Pennycook for nomenclatural review
and Dr. Lorelei L. Norvell for editorial review. This project was supported by the
National Natural Science Foundation of China (Nos. 31970018, 31360011).
Literature cited
Goh TK, Hyde KD. 1998. Stratiphoromyces brunneisporus gen. et sp. nov., an undescribed
dematiaceous hyphomycete on Licuala palms. Mycological Research 102(9): 1149-1152.
https://doi.org/10.1017/S0953756298006303
Hennebert GL. 1963. Un hyphomycéte nouveau, Arachnophora fagicola gen. nov. spec. nov.
Canadian Journal of Botany 41(8): 1165-1169. https://doi.org/10.1139/b63-097
Kiffer K, Reisinger O. 1970. Contribution a létude de la microflore fongique du Congo — I.
Champignons observés sur débris végétaux et sur piéges de cellulose. Revue d’Ecologie et de
Biologie du Sol 7: 11-31.
Ma J, Wang Y, O’Neill NR, Zhang XG. 2011. A revision of the genus Lomaantha, with the description
of a new species. Mycologia 103: 407-410. https://doi.org/10.3852/10-176
Mason EW, Hughes SJ. 1951. Phragmocephala gen. nov. hyphomycetarum. Naturalist (Leeds)
76(838): 97-105.
Matsushima T. 1971. Microfungi of the Solomon Islands and Papua-New Guinea. Published by the
author, Kobe, Japan.
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Sutton BC. 1973. Hyphomycetes from Manitoba and Saskatchewan, Canada. Mycological Papers
132. 143 p.
Sydow H, Sydow P. 1909. Micromycetes Japonici. Annales Mycologici 7: 168-175.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021— Volume 136, pp. 169-182
https://doi.org/10.5248/136.169
Endophragmiella spp. nov. and
new records from southern China
Jian Ma™, L1-Guo Ma’, ZHAo-HuAN Xu’, RU-QIANG Cul’,
LING Qiu’, RAFAEL F. CASTANEDA-RuiIz’, XIU-GUO ZHANG?
‘College of Agronomy, Jiangxi Agricultural University, Nanchang, Jiangxi 330045, China
*Shandong Key Laboratory of Plant Virology, Institute of Plant Protection,
Shandong Academy of Agricultural Sciences, Jinan, Shandong 250100, China
*Department of Plant Pathology, Shandong Agricultural University,
Taian, Shandong 271018, China
‘Instituto de Investigaciones Fundamentales en Agricultura Tropical Alejandro de Humboldt’
(INIFAT), Académico Titular de la “Academia de Ciencias de Cuba’,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P. 17200
*CORRESPONDENCE TO: [email protected]; [email protected]
ABSTRACT—Four new species—Endophragmiella chinensis, E. guangdongensis, E. lushanensis,
and E. obovoidea—collected on dead branches of unidentified plants in southern China, are
described, illustrated, and compared with closely related species. From the same habitat,
three other species, E. cantabrica, E. ellisii, and E. uniseptata are recorded from China for
the first time.
KEY wWorDS—asexual Ascomycota, hyphomycetes, saprobes, taxonomy
Introduction
Endophragmiella B. Sutton was established (Sutton 1973) for two species,
E. pallescens B. Sutton (generic type) and E. canadensis (Ellis & Everh.)
B. Sutton [= E. subolivacea (Ellis & Everh.) S. Hughes; see Hughes 1979].
Endophragmiella is mainly characterized by solitary, acrogenous, aseptate
or euseptate conidia seceding rhexolytically from monoblastic, integrated,
terminal, determinate or percurrently elongating conidiogenous cells
on simple or branched conidiophores (Sutton 1973, Ellis 1976, Hughes
170 ... Ma & al.
1979, Holubova-Jechova 1986, Wang 1990, Wu & Zhuang 2005, Seifert &
al. 2011). Hughes (1979) clarified the conidiogenesis of Endophragmiella,
amended the generic concepts, and accepted 33 species. Subsequently, 62
species and one variety have been published in Endophragmiella (Index
Fungorum 2020). Endophragmiella cambrensis M.B. Ellis (Ellis 1976)
was excluded from that genus by Hughes (1979) but accepted by Wu
& Zhuang (2005). Endophragmiella dimorphospora Awao & Udagawa
ex P.M. Kirk was treated as a synonym of the prior name E. biconstituta
(Rambelli) Matsush. by Matsushima (1989). Endophragmiella fasciata
(R.E Castaneda) R.F Castaneda (Castaneda-Ruiz 1988) and E. quadrilocularis
Matsush. (Matsushima 1993) were transferred to Repetophragma Subram.
by Castafeda-Ruiz & al. (2006, 2011). Endophragmiella fuliginosa
(B. Sutton) S. Hughes (Hughes 1979) was treated as Rhexoacrodictys
fuliginosa (B. Sutton) W.A. Baker & Morgan-Jones by Baker & al. (2002).
Endophragmiella_ rigidiuscula R.F. Castafieda (Castafieda-Ruiz 1988)
was proposed as the type species of Distophragmia R.F. Castaneda & al.
(Castahleda-Ruiz & al. 2015). Nine invalid Endophragmiella species names
have been validated in Senwanna (2019). Endophragmiella currently
contains 91 species and one variety, of which 46 species have been recorded
from China (Matsushima 1980, Tzean & Chen 1989, Lu & al. 2000, Tsui & al.
2001, Zhuang 2001, Wu & Zhuang 2005, Chen & al. 2008, Zhang & al. 2010,
Ma & al. 2011, 2012a,b, 2015, Ren & al. 2011, Wu & Zhang 2012, Xia & al.
2016, Li & al. 2017, Jiang & al. 2018).
During an ongoing survey of anamorphic fungi on plant debris in
southern China, seven species clearly related to Endophragmiella were
collected from dead branches. Four are described here as new, and the other
three represent new records for the Chinese mycota.
Taxonomy
Endophragmiella chinensis L. Qiu, Jian Ma, R.E. Castafieda & X.G. Zhang,
sp. nov. FIG. 1
IF 557448
Differs from Endophragmiella bohaniensis by its oblong or cylindrical, smaller conidia
on branched, shorter, and narrower conidiophores; and from E. constricta, E. fallacia,
and E. oblonga by its smaller, concolorous conidia.
Type: China, Jiangxi Province, Lushan Mountain, on dead branches of an unidentified
broadleaf tree, 18 October 2016, J. Ma (holotype, HJAUP M0477).
EryMoLoey: refers to China where the fungus was collected.
Four new Endophragmiella species (China) ... 171
wingz
wingz
Fic. 1. Endophragmiella chinensis (holotype, HHAUP M0477).
A. Conidiophores, conidiogenous cells, and conidia; B. Conidiophore; C, D. Conidia.
CoLonigs on the natural substrate effuse, brown to dark brown. Mycelium
partly immersed, partly superficial, composed of branched, septate,
pale brown, smooth-walled hyphae. CONIDIOPHORES macronematous,
mononematous, single or aggregated at the base, simple or branched,
erect, straight or flexuous, septate, smooth, medium brown to brown, paler
towards the apex, 83-115 x 2.5-4 um. CONIDIOGENOUS CELLS monoblastic,
integrated, terminal, cylindrical, smooth, pale brown, attenuated into
172 ... Ma &al.
narrow and truncate at the apex, with 0-2 percurrent elongations. Conidial
secession rhexolytic. Conip1< solitary, acrogenous, smooth, thick-walled,
(1-)2-euseptate, the septum usually becoming darker and forming a band;
when mature oblong or cylindrical, medium brown, (11-)14-21 um long,
(4.5-)6-7.5 um diam. in the broadest part; apex rounded; base truncate,
1-2 um diam., with a distinct 1-1.5 um long basal frill derived from the
distal end of the conidiogenous cell.
ComMMENTs—Among the Endophragmiella taxa with predominantly
2-euseptate conidia, E. chinensis is most similar to E. bohaniensis N.D.
Sharma (Sharma 1985), E. constricta M.T. Dunn (Dunn 1982), E. fallacia
P.M. Kirk (Kirk 1981a), and E. oblonga Matsush. ex S. Hughes (Hughes 1979)
in conidial shape. However, E. bohaniensis differs by its broadly ellipsoidal
to oblong, larger conidia (18-33 x 8.5-12.5 um) on unbranched longer and
wider conidiophores (75-300 x 5-6 um; Sharma 1985); E. constricta differs
by its brown larger conidia (15-23 x 6.9-10.4 um) with paler lower cell
and constricted middle cell (Dunn 1982); E. oblonga and E. fallacia differ
mainly in their unbranched conidiophores, and larger versicolored conidia
(E. oblonga 19-28 x 9.5-11.5 um, Hughes 1979; E. fallacia 22-26 x 10-12
um, Kirk 1981a).
Endophragmiella guangdongensis L. Qiu, Jian Ma, R.F. Castafieda &
X.G. Zhang, sp. nov. Fia. 2
IF 557449
Differs from Endophragmiella cesatii and E. latispora by its smaller predominantly
2-euseptate conidia; from E. lauri by its versicolored wider conidia; and from E. curvata
by its wider conidia with the longest central or suprabasal cell.
Type: China, Guangdong Province: Liuxihe National Forest Park, on dead branches of
an unidentified broadleaf tree, 17 October 2014, J. Ma (holotype, HJAUP M0118).
EryMo_oey: refers to the province in which the fungus was found.
COLONIES on the natural substrate effuse, brown to dark brown. Mycelium
partly immersed, partly superficial, composed of branched, septate, pale brown,
smooth-walled hyphae. CONIDIOPHORES macronematous, mononematous,
single or aggregated at the base, unbranched, erect, straight or flexuous, septate,
smooth, brown to dark brown, up to 530 x 4.5-5.5 um. CONIDIOGENOUS
CELLS monoblastic, integrated, terminal, cylindrical, smooth, brown, with up
to 25 or more percurrent elongations. Conidial secession rhexolytic. CONIDIA
solitary, acrogenous, fusiform or ellipsoidal, smooth, 2(-3)-euseptate, brown
with the paler end cells, 20.5-29.5 um long, 8.5-10.5 um diam. in the broadest
Four new Endophragmiella species (China) ... 173
100um
0
avn
Fic. 2. Endophragmiella guangdongensis (holotype, HHAUP M0118).
A. Conidiophore; B, C. Conidiophores, conidiogenous cells, and conidia; D. Conidia.
part; apex rounded or acute; base truncate, 2.5-4 um diam., with a distinct
0.5-1 um long basal frill derived from the distal end of the conidiogenous cell.
CoMMENTS—In terms of conidial morphology, E. guangdongensis is most
similar to E. latispora W.P. Wu (Wu & Zhuang 2005), E. lauri P.M. Kirk &
C.M. Kirk (Kirk 1982), and E. curvata (Corda) S. Hughes and E. cesatii
(Mont.) S. Hughes (Hughes 1979), but E. cesatii and E. latispora differ by
their predominantly 3-euseptate, larger conidia (E. cesatii 32-40(-45) x
11-12.5 um, Hughes 1979; E. latispora 23-35 x 12-13 um, Wu & Zhuang 2005);
E. curvata differs by its narrower (7.2-8.3 um) conidia with the lowest cell
longer than other cells; and E. lauri differs by its concolorous, narrower
(7-8 um) conidia (Kirk 1982).
174 ... Ma &al.
A B Cc
f :
|
i a66
LL
Fig. 3. Endophragmiella lushanensis (holotype, HJAUP M0436).
A-C. Conidiophores, conidiogenous cells, and conidia; D. Conidia.
Endophragmiella lushanensis L. Qiu, Jian Ma, R.F. Castafieda &
X.G. Zhang, sp. nov. FIG. 3
IF 557450
Differs from Endophragmiella fagicola, E. latispora, E. socia, and E. valdiviana by its
conspicuously smaller predominantly 4-euseptate conidia.
Type: China, Jiangxi Province, Lushan Mountain, on dead branches of an unidentified
broadleaf tree, 18 October 2016, J. Ma (holotype, HJAUP M0436).
EryMo_oey: refers to the locality in which the fungus was found.
Co.Lonigs on the natural substrate effuse, brown to dark brown. Mycelium
partly immersed, partly superficial, composed of branched, septate, pale brown,
smooth-walled hyphae. CONIDIOPHORES macronematous, mononematous,
single or aggregated at the base, unbranched, erect, straight or flexuous,
septate, smooth, medium brown to dark brown at the lower part, pale brown
towards the apex, 54-160 x 4.5-6 um. CONIDIOGENOUS CELLS monoblastic,
integrated, terminal, cylindrical, smooth, pale brown, attenuated into narrow
and truncate apex of 2.5-3 um wide, determinate, with up to 3 percurrent
elongations. Conidial secession rhexolytic. Conip1a solitary, acrogenous,
ellipsoidal, fusiform or obclavate, smooth, (3-)4(-5)-euseptate, the septum
Four new Endophragmiella species (China) ... 175
usually becoming darker and forming a band, medium brown to brown, apical
cell pale brown to subhyaline, 20-29 um long, 7-9 um diam. in the broadest
part; apex rounded; base truncate, 2.5-3 um diam., with a distinct 0.5-1 um
long basal frill derived from the distal end of the conidiogenous cell.
ComMMENTS—Among the known species of Endophragmiella, E. lushanensis is
most similar in conidial shape to E. fagicola P.M. Kirk (Kirk 1981b), E. latispora
(Wu & Zhuang 2005), E. socia (M.B. Ellis) S. Hughes, and E. valdiviana (Speg.)
S. Hughes (Hughes 1979), but E. fagicola differs by its obvious larger (70-90 x
11-17 um) usually 5-euseptate conidia (Kirk 1981b); E. latispora differs by its
wider (12-13 um) predominantly 3-euseptate conidia (Wu & Zhuang 2005);
E. socia and E. valdiviana differ by their larger predominantly 7-euseptate
conidia (E. socia 36-50 x 10.8-14.4 um; E. valdiviana 40-50 x 11-12.5 um)
(Hughes 1979).
Endophragmiella obovoidea L. Qiu, Jian Ma, R.F. Castafieda & X.G. Zhang,
sp. Nov. FIG. 4
IF 557451
Differs from Endophragmiella occidentalis, E. aseptata, and E. fatrensis by its obovoid,
smooth, pale brown, smaller conidia.
Type: China, Jiangxi Province: Lushan Mountain, on decaying twigs of an unidentified
broadleaf tree, 18 October 2016, J. Ma (holotype, HJAUP M0475).
EryMo oay: refers to the obovoid conidial shape.
Co.Lonigs on the natural substratum effuse, brown to dark brown. Mycelium
partly immersed, partly superficial, composed of branched, septate, pale brown,
smooth-walled hyphae. CONIDIOPHORES macronematous, mononematous,
single or aggregated at the base, simple, erect, straight or flexuous, septate,
smooth, pale brown to brown, paler towards the apex, <230 x 3-4 um.
CONIDIOGENOUS CELLS monoblastic, integrated, terminal, cylindrical, smooth,
pale brown, attenuated into narrow and truncate at the apex, with up to 26 (or
more) percurrent elongations. Conidial secession rhexolytic. Conrp1a solitary,
acrogenous, smooth, thick-walled, obovoid, sometimes ellipsoidal, aseptate,
pale brown, 8-9.5 x 5-6 um, with a distinct 0.5-1.5 um long basal frill derived
from the distal end of the conidiogenous cell.
CoMMENTS—Among the known species of Endophragmiella with aseptate
conidia, E. obovoidea somewhat resembles E. occidentalis R.F. Castafieda & al.
(Castafieda-Ruiz & al. 1995), E. aseptata Hol.-Jech., and E. fatrensis Hol.-Jech.
(Holubova-Jechova 1986), but E. occidentalis differs by its obovate, smooth,
rarely verrucose, dark brown, larger conidia (10-12 x 9-11 um; Castafeda-
176 ... Ma & al.
10um
Fic. 4. Endophragmiella obovoidea (holotype, HJAUP M0475).
A-C. Conidiophores, conidiogenous cells, and conidia; D. Conidia.
Ruiz & al. 1995); E. aseptata differs by its ellipsoidal or ovoid, brown, larger
conidia (7-11 x 6-7.5 um; Holubova-Jechova 1986); and E. fatrensis differs by
its ellipsoidal to ovoidal, mid to dark smoke-brown, larger conidia (11-15.5 x
7-8.5 um; Holubova-Jechova 1986].
Endophragmiella cantabrica J. Mena, Hern.-Restr., Gené & Guarro,
Mycotaxon 123: 225, 2013. FIG. 5
CONIDIOPHORES macronematous, mononematous, single, unbranched,
erect, straight or flexuous, 7-13-septate, smooth, brown to dark brown, paler
Four new Endophragmiella species (China) ... 177
C
o
‘>
wungz
N Y
= =
5 5
_
i=)
=
Fic. 5. Endophragmiella cantabrica (HJAUP M001).
A-C. Conidiophores, conidiogenous cells, and conidia; D. Conidia.
towards the apex, <220 x 3.5-4.5 um. CONIDIOGENOUS CELLS monoblastic,
integrated, terminal, cylindrical, smooth, brown, with <20 percurrent
elongations. Conidial secession rhexolytic. Conip1a solitary, acrogenous,
oblong, ellipsoidal or sometimes obovoid, smooth, thick-walled, medially
1-euseptate, pale brown, 13-15.5 um long, 5.5-7 um diam. in the broadest part;
apex rounded; base truncate, 2-2.5 um diam., with a distinct 0.5-1 um long
basal frill derived from the distal end of the conidiogenous cell.
SPECIMEN EXAMINED: CHINA, JIANGXI PROVINCE, Jinggangshan Mountain, on dead
branches of an unidentified broadleaf tree, 16 October 2012, J. Ma (HJAUP M001).
178 ... Ma &al.
CoMMENTS—Hernandez-Restrepo & al. (2013) recorded this fungus on dead
wood from Spain, and compared it with similar species, including E. arranensis
P.M. Kirk, E. bogoriensis Rifai, E. ovoidea P.M. Kirk, and E. uniseptata var. pusilla
Hol.-Jech. This is the first report of E. cantabrica in China. Our collection fits
well with the original description of E. cantabrica except for our slightly larger
conidia (cf. 10-14 x 5-6 um; Hernandez-Restrepo & al. 2013).
Endophragmiella ellisii P.M. Kirk, Index Fungorum 421: 1, 2019. FIG. 6
“Endophragmia biseptata” M.B. Ellis, Mycol. Pap.72: 31. 1959, nom. inval.
“Endophragmiella ellisii” S. Hughes, N.Z. J. Bot. 17(2): 150, 1979, nom. inval.
CONIDIOPHORES macronematous, mononematous, single or aggregated at
the base, unbranched, erect, straight or flexuous, 4-9-septate, smooth, brown
to dark brown, paler towards the apex, 70-140 x 5-6.5 um. CONIDIOGENOUS
CELLS monoblastic, integrated, terminal, cylindrical, smooth, pale brown, with
J
908
ee
__ 20um __
A B
20um
Fic. 6. Endophragmiella ellisii (HJAUP M0316).
A-C. Conidiophores, conidiogenous cells, and conidia; D. Conidia.
Four new Endophragmiella species (China) ... 179
<14 percurrent elongations. Conidial secession rhexolytic. Conip1a solitary,
acrogenous, obovoid to pyriform, smooth, thick-walled, 2-euseptate, the
septum usually becoming darker and forming a band, distal cell brown to dark
brown, central cell pale brown to brown and basal cell paler, 17.5-23.5 um long,
8-11.5 um diam. in the broadest part; apex rounded; base truncate, 2.5-3.5 um
diam., with a distinct 0.5-2 um long basal frill derived from the distal end of
the conidiogenous cell.
SPECIMENS EXAMINED: CHINA, JIANGXI PROVINCE, Jiulianshan National Nature
Reserve, on dead branches of an unidentified broadleaf tree, 3 November 2014, J. Ma
(HJAUP M0316); HAINAN PROVINCE, Jianfengling National Nature Reserve, on dead
branches of an unidentified broadleaf tree, 15 April 2015, J. Ma (HJAUP M0402).
CoMMENTS ~-The previous invalid publication of “E. ellisii” was validated in
Senwanna (2019). This species has not previously been recorded from China.
Our specimen overlaps well with the original descriptions of Ellis (1959).
Endophragmiella ellisii is most similar to E. bisbyi B. Sutton ex P.M. Kirk
(Senwanna 2019) and E. hughesii D. Hawksw. (Hawksworth 1979) in conidial
shape, but E. bisbyi differs by its predominantly 3-euseptate, smaller conidia
(12.5-16 x 6.3-7.6 um; Hughes 1979), and E. hughesii differs by its larger
conidia (25-30 x 11-13 um) with a central pore at each septum (Hawksworth
1979).
Endophragmiella uniseptata M.B. Ellis ex P.M. Kirk,
Index Fungorum 421: 1, 2019. FIG.7
“Endophragmia uniseptata” M.B. Ellis, Mycol. Pap.72: 28. 1959, nom. inval.
“Endophragmiella uniseptata” M.B. Ellis ex S. Hughes, N.Z. J. Bot. 17(2): 156, 1979, nom.
inval.
CONIDIOPHORES macronematous, mononematous, single or aggregated at the
base, unbranched, erect, straight or flexuous, 2-7-septate, smooth, brown to
dark brown, 55-139 x 4-6 um. CONIDIOGENOUS CELLS monoblastic, integrated,
terminal, cylindrical, smooth, pale brown to brown, determinate or with
1-3 percurrent elongations. Conidial secession rhexolytic. Conrp1a solitary,
acrogenous, obovoid, smooth, 1-euseptate, the septum usually becoming
darker and forming a band, brown to dark brown with the lower cell sometimes
slightly paler, 15.5-21 um long, 10-12.5 um diam. in the broadest part; apex
rounded; base truncate, 2.5-3.5 um diam., with distinct 0.5-1 um long basal
frill derived from the distal end of the conidiogenous cell.
SPECIMEN EXAMINED: CHINA, GUANGDONG PROVINCE, Nanling National Nature
Reserve, on dead branches of an unidentified broadleaf tree, 12 July 2014, J. Ma (HJAUP
M0137).
180 ... Ma &al.
r) B E e -
20nm
Fic. 7. Endophragmiella uniseptata (HJAUP M0137).
A-C. Conidiophores, conidiogenous cells, and conidia; D, E. Conidiophores; F. Conidia.
wmQZ
wilgz
wg
=
5
CoMMENTS—Ellis (1959) reported this species on rotten wood of Castanea
saliva and Fagus sylvatica from Great Britain. The previous invalid publication
of “E. uniseptata” was validated in Senwanna (2019). Endophragmiella
uniseptata is similar to E. pinicola M.B. Ellis ex P.M. Kirk (Senwanna 2019)
in conidial shape, but E. pinicola has concolorous, smaller conidia (10-14 x
5-9 um; Ellis 1976). Our collection corresponds well with the description of
Ellis (1959; as “Endophragmia uniseptata”) except for much fewer percurrent
elongations of conidiogenous cells in our specimen (cf. up to 15; Ellis 1959).
This is the first report of this species in China.
Acknowledgments
The authors express gratitude to Dr. De-Wei Li (The Connecticut Agricultural
Experiment Station, Valley Laboratory, USA) and Dr. Gabriela Heredia (Instituto
de Ecologia, AC, Mexico) for serving as pre-submission reviewers and to Dr. Shaun
Pennycook for nomenclatural review and Dr. Lorelei L. Norvell for editorial review.
This project was supported by the National Natural Science Foundation of China
(Nos. 31970018, 31760513, 31360011).
Four new Endophragmiella species (China) ... 181
Literature cited
Baker WA, Partridge EC, Morgan-Jones G. 2002. Notes on hyphomycetes LXXXVII.
Rhexoacrodictys, a new segregate genus to accommodate four species previously classified in
Acrodictys. Mycotaxon 82: 95-113.
Castafieda-Ruiz RF. 1988. Fungi cubenses. III. Instituto de Investigaciones Fundamentales en
Agricultura Tropical “Alejandro de Humboldt” La Habana, Cuba. 27 p.
Castafeda-Ruiz RF, Guarro J, Cano J. 1995. Notes on conidial fungi. II. A new species of
Endophragmiella. Mycotaxon 54: 403-406.
Castafieda-Ruiz RF, Pascholati-Gusmao LF, Heredia G, Saikawa M. 2006. Some hyphomycetes
from Brazil. Two new species of Brachydesmiella, two new combinations for Repetophragma,
and new records. Mycotaxon 95: 261-270.
Castaneda-Ruiz RF, Heredia G, Arias RM, McKenzie EHC, Hyde KD, Stadler M, Saikawa M,
Gené J, Guarro J, Iturriaga T, Minter DW, Crous PW. 2011. A new species and re-disposed
taxa in Repetophragma. Mycosphere 2: 273-289.
Castafieda-Ruiz RF, Leao-Ferreira SM, Gusmao LFP. 2015. Distophragmia, a new genus of
microfungi to accommodate Endophragmiella rigidiuscula. Mycotaxon 130: 499-503.
https://doi.org/10.5248/130.499
Chen JL, Tzean SS, Lin WS. 2008. Endophragmiella multiramosa a new dematiaceous anamorphic
ascomycete from Taiwan. Sydowia 60: 197-204.
Dunn MT. 1982. A new species of Endophragmiella from sclerotia of Sclerotinia minor.
Mycotaxon 16: 152-156.
Ellis MB. 1959. Clasterosporium and some allied dematiaceae-phragmosporae. II. Mycological
Papers 72.75 p.
Ellis MB. 1976. More dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew,
Surrey, England. 507 p.
Hawksworth DL. 1979. The lichenicolous hyphomycetes. Bulletin of the British Museum for
Natural History 6: 183-300.
Hernandez-Restrepo M, Mena-Portales J, Guarro J, Gené J. 2013. Two new species of
Endophragmiella from Spain. Mycotaxon 123: 221-228. https://doi.org/10.5248/123.221
Holubova-Jechova V. 1986. Lignicolous hyphomycetes from Czechoslovakia. 8. Endophragmiella
and Phragmocephala. Folia Geobotanica et Phytotaxonomica 21: 173-198.
Hughes SJ. 1979. Relocation of species of Endophragmia auct. with notes on relevant generic
names. New Zealand Journal of Botany 17: 139-188.
https://doi.org/10.1080/0028825X.1979.10426887
Index Fungorum. 2020. Fungal names search. http://www.indexfungorum.org/names/Names.asp
[accessed 8 March 2020].
Jiang YL, Wu YM, Xu JJ, Kong JH, Zhang TY. 2018. Endophragmiella terricola, Gliomastix
verrucipes, and Radulidium guttiforme spp. nov. from soil in China. Mycotaxon 133:
301-305. https://doi.org/10.5248/133.301
Kirk PM. 1981la. New or interesting microfungi II]. Dematiaceous hyphomycetes from
Esher Common, Surrey. Transactions of the British Mycological Society 77: 279-297.
https://doi.org/10.1016/S0007-1536(81)80031-9
Kirk PM. 1981b. New or interesting microfungi I. Dematiaceous hyphomycetes from
Devon. Transaction of the British Mycological Society 76: 71-87.
https://doi.org/10.1016/S0007-1536(81)80010-1
182 ... Ma &al.
Kirk PM. 1982. New or interesting microfungi V. Microfungi colonizing Laurus nobilis leaf
litter. Transactions of the British Mycological Society 78: 293-303.
https://doi.org/10.1016/S0007-1536(82)80013-2
Li HH, Zhang K, Yang CL, Xia JW, Zhang XG. 2017. Endophragmiella jiulingensis sp. nov. and
two new records from China. Mycotaxon 132: 767-773. https://doi.org/10.5248/132.767
Lu BS, Hyde KD, Ho WH, Tsui KM, Taylor JE, Wong KM, Yanna, Zhou DQ. 2000. Checklist of
Hong Kong fungi. Fungal Diversity Research Series 5. 207 p.
MaLG, Ma J, Zhang YD, Zhang XG. 2011. Taxonomic studies of Endophragmiella from southern
China. Mycotaxon 117: 279-285. https://doi.org/10.5248/117.279
Ma J, Ma LG, Zhang YD, Castafieda-Ruiz RE, Zhang XG. 2012a. New species or records of
Endophragmiella and Heteroconium from southern China. Cryptogamie Mycologie 33:
127-135. https://doi.org/10.7872/crym.v33.iss2.2012.127
Ma J, Zhang YD, Ma LG, Castafieda-Ruiz RE, Zhang XG. 2012b. Two new species of
Endophragmiella from southern China. Mycotaxon 119: 103-107.
https://doi.org/10.5248/119.103
Ma YR, Xia JW, Zhang XG. 2015. A new species of Endophragmiella from Guizhou, China.
Mycotaxon 130: 451-454. https://doi.org/10.5248/130.451
Matsushima T. 1980. Matsushima Mycological Memoirs 1. Published by the author, Kobe, Japan.
Matsushima T. 1989. Matsushima Mycological Memoirs 6. Published by the author, Kobe, Japan.
Matsushima, T. 1993. Matsushima Mycological Memoirs 7. Published by the author, Kobe,
Japan.
Ren SC, Ma J, Zhang XG. 2011. New species and records of Endophragmiella from China.
Mycotaxon 117: 123-130. https://doi.org/10.5248/117.123
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Senwanna C. 2019. Nomenclatural novelties. Index Fungorum 421: 1.
Sharma ND. 1985. Some new additions to mycoflora of India. Journal of the Indian Botanical
Society 64: 251-254.
Sutton BC. 1973. Hyphomycetes from Manitoba and Saskatchewan, Canada. Mycological
Papers 132. 143 p.
Tsui CKM, Goh TK, Hyde KD, Hodgkiss JI. 2001. New records or species of Dictyochaeta,
Endophragmiella and Ramichloridium from submerged wood in Hong Kong freshwater streams.
Cryptogamie, Mycologie 22: 139-145. https://doi.org/10.1016/S0181-1584(01)80005-1
Tzean SS, Chen JL. 1989. A new species of Endophragmiella from Taiwan. Mycologia 81: 800-805.
https://doi.org/10.1080/00275514.1989.12025824
Wang CJK. 1990. Ultrastructure of percurrently proliferating conidiogenous cells and
classification. Studies in Mycology 32: 40-48.
Wu YM, Zhang TY. 2012. Newspecies of Humicola and Endophragmiella from soil. Mycotaxon 121:
147-151. https://doi.org/10.5248/121.151
Wu WP, Zhuang WY. 2005. Sporidesmium, Endophragmiella and related genera from China.
Fungal Diversity Research Series 15. 351 p.
Xia JW, Ma YR, Gao JM, Zhang XG, Li Z. 2016. Two new species of Endophragmiella from southern
China. Nova Hedwigia 103: 349-357. https://doi.org/10.1127/nova_hedwigia/2016/0356
Zhang YD, Ma J, Ma LG., Zhang XG. 2010. A new species of Podosporium and a new record from
southern China. Mycotaxon 114: 401-405. https://doi.org/10.5248/114.401
Zhuang WY. 2001. Higher fungi of tropical China. Mycotaxon Ltd. Ithaca, New York. 485 p.
MYCOTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 183-199
https://doi.org/10.5248/136.183
Morphological and phylogenetic resolution of
Arthrinium from medicinal plants in Yunnan,
including A. cordylines and A. pseudomarii spp. nov.
TONG-ZHENG CHEN", YAN ZHANG??*", XIAO-BING MING’,
QIAN ZHANG’, Hut Lona’, KEVIN D. HyDE°, YAN L1°*, YONG WANG? ®
' Department of Plant Pathology, Agriculture College, Guizhou University,
Guiyang, Guizhou 550025, China
’ Beijing University of Agriculture, Beijing 102206 China
* Beijing Bei Nong Enterprise Management Co., Ltd., Beijing, 102206, China
‘ Beijing Forestry University, Beijing, 100083, China
° Center of Excellence in Fungal Research and School of Science, Mae Fah Luang University,
Chiang Rai, 57100, Thailand
° Guizhou Key Laboratory Agro-Bioengineering, Guizhou University,
Guiyang, Guizhou 550025, China
* CORRESPONDENCE TO: *[email protected] *[email protected]
ABSTRACT—Twenty-one strains of Arthrinium were cultured from leaf samples of ten
medicinal plant hosts in Yunnan Province, China. Morphological and multi-locus
ITS+TUB+TEF1 sequence analyses revealed that the strains represented two previously
described species (A. paraphaeospermum and A. rasikravindrae) and two new species:
Arthrinium cordylines, which produces subglobose conidia that are shorter and wider than
A. aureum but larger than A. hydei, and Arthrinium pseudomarii, which produces subglobose
to ellipsoid conidia narrower than A. hispanicum, A. marii, and A. mediterranei.
Key worps—Apiosporaceae, phylogenetic analysis, taxonomy, Xylariales
Introduction
Arthrinium (Apiosporaceae, Xylariales, Sordariomycetes) is widely distributed
around the world (Hyde & al. 2020). Its species often occur on different plant
‘ Tong-Zheng Chen and Yan Zhang contributed equally to this paper.
184 ... Chen, Zhang & al.
substrates as saprobes (Agut & Calvo 2004, Singh & al. 2013, Dai & al. 2016),
pathogens (Martinez-Cano &al. 1992, Thangaraj & al. 2019), and endophytes
(Ramos & al. 2010, Huang & Jiang 2015, Rashmi et al. 2019). Arthrinium
is morphologically distinguished from other asexual genera by its basauxic
conidiophores with terminal and intercalary polyblastic conidiogenous cells
(Hughes 1953, Minter 1985, Hyde & al. 1998, Wijayawardene & al. 2016).
However, it is impossible to resolve taxonomy within the genus without
molecular data (Crous & Groenewald 2013).
During this study, we isolated 21 Arthrinium strains from leaves of ten
different medicinal plants in Yunnan Province, China. Morphological and
ITS + TUB + TEF1 sequence analyses clarified their taxonomic placements,
revealing two previously described species (A. paraphaeospermum and
A. rasikravindrae) and two new species, here proposed as A. cordylines and
A. pseudomarii.
Materials & methods
Culture & morphology
Arthrinium strains were isolated from leaf samples collected from Yunnan
Province, P.R. China, using the ‘single-spore method’ (Senanayake et al. 2020).
Colonies were transferred to oat-agar (OA) and incubated at room temperature (c.
28 °C). Following 2-3 weeks of incubation, morphological characters were recorded.
Conidial and conidiophore morphologies were examined using an Olympus BX53
compound microscope. The holotype specimens are deposited in the Herbarium of
Department of Plant Pathology, Agricultural College, Guizhou University, China
(HGUP), and pure cultures are deposited in the Department of Plant Pathology
Culture Collection, Agriculture College, Guizhou University, China (GUCC),
and isotype cultures of Arthrinum cordylines and A. pseudomarii are conserved in
Guizhou Culture Collection (GZCC), Guizhou, China.
DNA amplification & sequencing
DNA amplification, sequencing and phylogenetic analysis follow Dissanayake
& al. (2020) with modifications. Fungal cultures were grown on OA medium at 28
°C. When nearly covering the whole Petri-dish (90 mm diam), fresh mycelia were
scraped from the surface with sterilized scalpels. Genomic DNA was extracted
using a Biomiga Fungus Genomic DNA Extraction Kit (GD2416), following the
manufacturers protocol. DNA was amplified in 25 uL reactions containing 2.5 uL
10 x PCR buffer, 1 uL of each primer (10 uM), 1 wL template DNA, and 0.25 uL
Promega Taq DNA polymerase. Primers ITS4 and ITS5 (White & al. 1990) were used
to amplify the ITS region, and Two protein-coding gene fragments (TUB and TEF1)
were amplified by the primers T1/Bt2b (Glass & Donaldson 1995, O’Donnell &
Cigelnik 1997) and EF1-728F/EF-2 (O’Donnell & al. 1998, Carbone & Kohn 1999).
TABLE 1 Sequences of Arthrinium spp. and Nigrospora gorlenkoana outgroup used for
phylogenetic analyses
GENBANK ACCESSIONS
SPECIES STRAIN
ITS TUB TEF1
A.arundinis —<“—Ss—s—::—UNUS CBS 114316—<“C—s~si‘—s:s:*~*~*~*S<@ ‘BBA CKFI44974.—sCKFI45016—
A. aureum CBS 244.83* AB220251 KF144981 KF145023
A. bambusae LC7106* KY494718 KY705186 KY806204
A. camelliae-sinensis LC5007* KY494704 KY705173 KY705103
A. caricicola AP23518 MK014871 MK017977 MK017948
A. cordylines GUCC 10026 MT040105 MT040147 MT040126
GUCC 10027* MT040106 MT040148 MT040127
A. curvatum var. minus AP25418 MK014872 MK017978 MK017949
A. descalsii AP31118A* MK014870 MK017976 MK017947
A. dichotomanthi LC4950* KY494697 KY705167 KY705096
A. esporlense AP16717* MK014878 MK017983 MK017954
A. euphorbiae IMI 285638b AB220241 AB220288
A. garethjonesii HKAS 96289* NR_154736 - =
JHB004 KY356086 - -
A. guizhouense LC5318 KY494708 KY705177 KY705107
LC5322* KY494709 KY705178 KY705108
A. gutiae CBS 135835 KRO11352 KRO11350 KRO11351
A. hispanicum IMI 326877* AB220242 AB220289 =
A. hydei CBS 114990* KF144890 KF144982 KF145024
JHB0012 KY356087 - -
LC7103 KY494715 KY705183 KY705114
LC7105 KY494717 KY705185 KY705116
A. hyphopodii MFLUCC 15-0003” KR069110 - -
A. hysterinum AP2410173 MK014876 = =
A. ibericum AP10118* MK014879 MK017984 MK017955
A. italicum AP221017* MK014880 MKO017985 MK017956
A. japonicum IFO 30500 AB220262 AB220309 -
A. jatrophae CBS 134262 NR_154675 - -
MMI 00052* JQ246355 - =
A. jiangxiense LC4577* KY494693 KY705163 KY705092
A. kogelbergense CBS 113333* KF144892 KF144984 KF145026
A. longistromum MFLUCC 11-0481* KU940141 - -
MFLUCC 11-0479* KU940142 a =
MELU 15-1184* NR_154716 = =
A. malaysianum CBS 102053* KF144896 KF144988 KF145030
A. marii CBS 497.90* AB220252 KF144993 KF145035
A. mediterranei IMI 326875* AB220243 AB220290 -
A. mytilomorphum DAOM 214595* KY494685 - -
A. neosubglobosum HKAS 96354 NR_154737 - -
JHB006 KY356089 - -
JHB007* KY356090 - -
Arthrinium cordylines & A. pseudomarii spp. nov. (China) ... 185
186 ... Chen, Zhang & al.
A. obovatum
A. ovatum
A. paraphaeospermum
A. phaeospermum
A. phragmitis
A. piptatheri
A. pseudomarii
A. pseudoparenchymaticum
A. pseudosinense
A. pseudospegazzinii
A. pterospermum
A. puccinioides
A. rasikravindrae
sacchari
saccharicola
serenense
sporophleum
subglobosum
subroseum
Be Des oa ie SY ies
thailandicum
A. xenocordella
A. yunnanum
N. gorlenkoana
LC4940*
CBS 115042*
MFLUCC 13-0644*
GUCC 10124
GUCC 10125
GUCC 10126
GUCC 10127
GUCC 10128
GUCC 10129
CBS 114314
CPC18900*
AP4817A*
GUCC 10214
GUCC 10221
GUCC 10225
GUCC 10263
GUCC 10254
GUCC 10259
GUCC 10260
GUCC 10270
GUCC 10226
GUCC 10227
GUCC 10228*
GUCC 10261
LC7234*
CPC 21546*
CBS 102052*
CPC 20193*
AP26418
CBS 549.86
LC5449
LC8179
NECCI 2144*
GUCC 10088
CBS 212.30
CBS 191.73
IMI 326869*
AP21118
MFLUCC 11-0397*
LC7292*
MFLUCC 15-0202*
CBS 478.86*
MFLUCC 15-0002*
CBS 480.73
KY494696
KF144903
KX822128
MT040108
MT040109
MT040110
MT040111
MT040112
MT040113
KF144904
KF144909
MK014893
MT040114
MT040115
MT040116
MT040117
MT040118
MT040119
MT040120
MT040121
MT040122
MT040123
MT040124
MT040125
KY494743
KF144910
KF144911
KF144913
MK014894
AB220253
KY494713
KY494759
JF326454
MT040107
KF144916
KF144920
AB220250
MK014898
KR069112
KY494752
KU940145
KF144925
KU940147
KX986048
KY705166
KF144995
MT040150
MT040151
MT040152
MT040153
MT040154
MT040155
KF 144996
KF145001
MT040156
MT040157
MT040158
MT040159
MT040160
MT040161
MT040162
MT040163
MT040164
MT040165
MT040166
MT040167
KY705211
KF145002
KF145004
MK017998
AB220300
KY705182
KY705227
MT040149
KF145005
KF145009
AB220297
MKO018001
KY705220
KF145013
KY019456
* = ex-type strains. Strains and sequences generated in this study are shown in bold
KY705095
KF145037
MT040129
MT040130
MT040131
MT040132
MT040133
MT040134
KF145038
KF145043
MK017969
MT040135
MT040136
MT040137
MT040138
MT040139
MT040140
MT040141
MT040142
MT040143
MT040144
MT040145
MT040146
KY705139
KF145044
KF145045
KF145046
MK017970
KY705112
KY705155
MT040128
KF145047
KF145051
MK017973
KY705148
KPF145055
KY019420
Arthrinium cordylines & A. pseudomarii spp. nov. (China) ... 187
The annealing temperatures were adjusted to 52 °C for ITS and TUB, and 56 °C
for TEF1. The PCR amplicons were purified and sequenced by SinoGenoMax. The
DNA sequences were submitted to GenBank (TABLE 1). The DNA base differences of
different gene loci between our strains and ex-type strains of related taxa are shown
in TABLE 2.
Phylogenetic analyses
DNA sequences from our strains and reference sequences downloaded from
GenBank (Crous & Groenewald 2013, Dai & al. 2016, Wang & al. 2018, Pintos
& al. 2019) were used for maximum parsimony (MP) and maximum likelihood
(ML) analyses. Sequences in the order of ITS+TUB +TEFI1 were aligned using an
online version of MAFFT v. 7 (http://mafft.cbrc.jp/alignment/server/). Ambiguous
TABLE 2. DNA base differences in three gene regions comparing our Arthrinium
sequences and sequences from related species.
Species Strain ITS (611) TUB (752) TEF1 (464)
Arthrinum cordylines GUCC 10026 0 0 0
GUCC 10027 0
A. hydei CBS 114990° 3
A. aureum CBS 244.83° 3 24 19
A. rasikravindrae GUCC 10088 0
LC5449 1
A. paraphaeospermum GUCC 10125 0
GUCC 10124 15
GUCC 10126
GUCC 10127
GUCC 10128
GUCC 10129
MEFLU 13-0644°
A. pseudomarii GUCC 10228°
GUCC 10214
GUCC 10221
GUCC 10225
GUCC 10263
GUCC 10254
GUCC 10259
GUCC 10260
GUCC 10270
GUCC 10226
GUCC 10227
GUCC 10261
A. hispanicum IMI 326877
A. marii CBS 497.90
A. mediterranei IMI 326875
-— Fe FPF CO COCO CO COC CO NNN NY OFJrF WwW OG OF oO OoOFyo So
NN NY fF CO Coo ComlUCcUOCUCUCCOUCOCOUCUCUNMCUCOOUCOUMFLUmTUCUCOUCOCUCCOCCUCcCOULUCcCOUC OUT UL HL CO
ond
N
kt BQ > ee SO SS Oe OS SO. OS
_
188 ...
Chen, Zhang & al.
Arthrinium caricicola AP23518 7
— Arthrinium curvatum var. minus AP25418
su tonoop Arthrinium sporophleum AP21118
Arthrinium japonicum IFO 30500
ies Arthrinium puccinioides AP26418
Arthrinium puccinioides CBS 349.86
sa04 Arthrinium descalsii AP3LLI8A*
tm, Arthrinium phragmitis CPC 18900*
\y Arthrinium rasikravindrae GUCC 10083
Arthrinium rasikravindrae L.C5449
Arthrinium paraphaeospermum GUCC 10129
Jw.) Arthrinium rasikravindrae LC8179 7
Arthrinium rasikravindrae NFCCI 2144*
Arthrinium paraphaeospermum GUCC 10124
Arthrinium paraphaeospermum GUCC 10128
Arthrinium paraphaeospermum MFLU 13-0644*
Arthrinium paraphaeospermum GUCC 10126
Arthrinium paraphaeospermum GUCC 10127
Arthrinium paraphaeospermum GUCC 10125
Arthrinium aureum CBS 244.83*
7
Arthrinium hydei NBOO12
FL Arthrinium hydei LC7105
Arthrinium hydei CBS 114990*
Arthrinium hydei LC7103
Arthrinium e
wy
br
um c <a
Arthrinium esporlense AP16717*
Arthrinium xenocordella CBS 478,86*
Arthrinium kogelbergense CBS 113333*
Arthrinium malaysianum CBS 102053*
Arthrinium euphorbiae (M1 285638b
Arthrinium thailandicum MFLUCC 15-0202*
Arthrinium italicum AP221017*
Arthrinium arundinis CBS 114316 » =
Arthrinium jatrophae CBS 134262
Arthrinium jatrophae MMI 00052*
Arthrinium bambusae LC7106*
10} score) Arthrinium garethjonesii JHBOO4
Arthrinium garethjonesii HKAS 96289*
Arthrinium subroseum L.C7292*
a. Arthrinium mytilomorphum DAOM 214595*
Arthrinium hyphopodti MFLUCC 15-0003*
Arthrinium pseudoparenchymaticum L.C7234*
Arthrinium neosubglobosum
Arthrinium neosubglobosum
Arthrinium neosubglobosum HKAS
vow — Arthrinium yurmanum MFLUCE 15-0002*
Arthrinium hysterinim AP2410173
Arthrinium ovatum CBS 115042*
oun Arthrinium pterospermum CPC 20193*
Arthrinium pseudosinense CPC 21546*
Arthrinium gutiae CBS 135835
Arthrinium dichotomanthi LC49S0*
- Arthrinium ibericum AP\OV8*
B Arthrinium saccharicola CBS 191.73
pa. Arthrinium phaeospermum CBS 114314
wots Arthrinium serenense IML 326869*
~ Arthrinium camelliae-sinensis LC5007*
Arthrinium obovatum LC4940*
Arthrinium jiangxiense LC4S77*
Arthrinium piptatheri AP4817A*
Arthrinium pseudospegazzimi CBS 102052*
Arthrinium longistromum MFLUCC 11-0481*
Arthrinium longistromum MFLUCC 11-0479*
Arthrinium longistromum MFLU 15-1184*
Arthrinium sacchari CBS 212.30
Arthrinium guizhouense 1.C5322*
thiaArthrinium guizhouense LC5318
Arthrinium hispanicum YM1 326877*
Arthrinium marii CBS 497.90*
Arthrinium mediterranet IMI 326875*
Arthrinium G
Nigrospora gorlenkoana CBS 480 73
0.2
Fic. 1. Phylogenetic tree of Arthrinium spp., based on combined ITS, TUB, and TEF1 sequence
alignments generated from maximum likelihood and maximum parsimony analyses. Bootstrap
support values >50% are given at the nodes (ML/MP). The tree is rooted with Nigrospora gorlenkoana
CBS 480.73. Ex-type strains are indicated with *. Bold entries represent newly sequenced strains.
The new species are shown in bold and on a red background.
regions were excluded from the analyses, and gaps were treated as missing data.
MP analyses were performed in PAUP v. 4.0b10 (Swofford 2002), using the
heuristic search option with 1,000 random taxa addition and tree bisection and
re-connection (TBR) as the branch swapping algorithm. Maxtrees = 5000 was
Arthrinium cordylines & A. pseudomarii spp. nov. (China) ... 189
set to upbuild the phylogenetic tree. Tree Length (TL), Consistency Indices (CI),
Retention Indices (RI), Rescaled Consistency Indices (RC), and Homoplasy Index
(HI) were calculated for each tree. CIPRES Science Gateway (https://www.phylo.
org/portal2/login.action) used the resulting Phylip file to generate the ML tree
with GTRGAMMA as the nucleotide substitution model and RAxML-XSEDE
with 1000 bootstrap inferences. DNA sequences generated with forward and
reverse primers were used to obtain consensus sequences using MEGA v. 6.06
(Tamura & al. 2013). Sequences were aligned using MAFFT v7.307 online version
(Katoh & Standley 2016) and edited by hand using MEGA v. 5.1.
Phylogenetic analytical results
Strain sequences comprised 480-633 bp (ITS), 460-477 bp (TEF1), and
701-829 bp (TUB) in length. Following alignment, the combined ITS+TUB
+TEF1 dataset contained 2096 characters (ITS: 1-711 + TUB: 714-1246
+ TUB: 1249-2096, adding two “N’s” after the ITS and TEF1 sequences to
distinguish between the two gene regions), of which 876 were parsimony-
informative characters. Sequences from 50 Arthrinium species (representing
63 strains) were downloaded, plus the outgroup Nigrospora gorlenkoana
Novobr. (CBS 480.73). Five thousand equally most parsimonious trees were
obtained (TL = 3509, CI = 0.54, RI = 0.82, RC = 0.44, and HI = 0.46). Similar
topologies were obtained by MP and ML methods, and the first equally
most parsimonious tree was selected to display the phylogenetic relationship
of Arthrinium species (Fic. 1). In Fre. 1, our strains clustered into three
subclades: (1) GUCC 10026, GUCC 10027, A. aureum Calvo & Guarro, and
A. hydei Crous; (2) GUCC 10214, GUCC 10221, GUCC 10225-10228, GUCC
10254, GUCC 10259-10261, GUCC 10263, and GUCC 10270 originated
from five medicinal plants and formed a subclade with A. hispanicum
Larrondo & Calvo, A. marii Larrondo & Calvo, and A. mediterranei Larrondo
& Calvo; and (3) GUCC 10088 and GUCC 10124-10129 were adjacent to
A. paraphaeospermum and A. rasikravindrae. All subclades are supported
with high MP and ML bootstrap values (Fic. 1).
Taxonomy
Arthrinium cordylines T.Z Chen, Yong Wang bis & K.D. Hyde, sp. nov. Fic. 2
MB 834522
Differs from Arthrinium aureum by its shorter but wider conidia; and from A. hydei by
its larger subglobose to ellipsoid conidia.
Typus: China, Yunnan Province, Xichuangbanna, from leaves of Cordyline fruticosa
(L.) A. Chev. (Asparagaceae), 20.10.2018, leg. Y. Wang, (Holotype, HGUP 10027 [dried
colony on OA]; ex-type culture, GUCC 10027; isotype culture, GZCC21-0020).
190 ... Chen, Zhang & al.
Fic. 2. Arthrinium cordylines (ex-holotype GUCC 10027). A. Host (Cordyline fruticosa) and
symptoms; B, C. Cultures on OA; D. Colony on OA producing conidial masses; E-H. Conidiogenous
cells giving rise to conidia; I Conidia. Scale bars: E, F H, 1 = 10 um; G=5 um.
Arthrinium cordylines & A. pseudomarii spp. nov. (China) ... 191
Erymo.oey: The specific epithet refers to the host Cordyline fruticosa, from which the
fungus was isolated.
HypHAE hyaline, septate, branched, smooth, 1.5-2.5 um _ diam.
CONIDIOPHORES reduced to conidiogenous cells. CONIDIOGENOUS CELLS
erect, aggregated into clusters on hyphae, hyaline to pale brown, smooth,
doliiform to ampulliform or lageniform, (3-)5-10(-15) x 2.6-5.3 um
(av. 7.0 x 4.5 um, n = 30). Conrp14 olivaceous to brown, smooth to finely
roughened, subglobose to ellipsoid, 15-19 x 12.5-18.5 um (av. 17.5 x 15.7
um, n = 30).
Cotoniges on OA flat, spreading, circular, smooth at margin, with
abundant aerial mycelia, surface and reverse white to grey, sometimes with
light pink.
TELEOMORPH: not observed.
ADDITIONAL MATERIAL EXAMINED: CHINA: YUNNAN PROVINCE, Xichuangbanna,
from leaves of Cordyline fruticosa, Y. Wang (HGUP 10026).
NotTEs—Our two strains (GUCC 10026, GUCC 10027) formed a branch
with the ex-type strains of A. aureum (CBS 244.83) and A. hydei (CBS
114990) with 99% (MP) and 98% (ML) bootstrap support. Arthrinium
cordylines also showed a close relationship to A. hydei (91% MP/80% ML).
DNA pair-wise comparisons revealed three similar ITS, 13 similar TEF1,
and 15 similar TUB base pairs, confirming that A. cordylines and A. hydei
are separate species according to the guidelines of Jeewon & Hyde (2016).
Morphologically, conidia in A. cordylines are shorter and wider than
A. aureum (14-30 x 10-15 um; Calvo & Guarro 1980) but larger than the
globose conidia of A. hydei (11-12 um diam; Crous & Groenewald 2013).
Arthrinium pseudomarii T.Z Chen, Yong Wang bis & K.D. Hyde, sp.nov. — Fia. 3
MB 834523
Differs from Arthrinium hispanicum, A. marii, and A. mediterranei by its narrower
subglobose to ellipsoid conidia.
Typus: China, Yunnan Province, Kunming Institute of Botany, from leaves of Aristolochia
debilis Siebold & Zucc. (Aristolochiaceae), 15.1.2018, leg. X.B. Ming (Holotype, HGUP
10228 [dried colony on OA]; ex-type culture, GUCC 10228; isotype culture, GZCC21-
0021).
Erymo toy: The specific epithet refers to the related species Arthrinium marii.
Hypuae hyaline, septate, branched, smooth, 2-3 um diam. CONIDIOPHORES
basauxic, mononematous, macronematous. CONIDIOGENOUS CELLS erect,
aggregated into clusters on hyphae, hyaline to pale brown, smooth, doliiform
to ampulliform, or lageniform, 8-13 x 2.5-5 um (av. 6.0 x 4 um, n = 30).
192 ... Chen, Zhang & al.
Fic. 3. Arthrinium pseudomarii (ex-holotype GUCC 10228). A. Host (Aristolochia debilis) and
symptoms; B, C. Cultures on OA; D. Colony on OA producing conidial masses; E-G. Conidiogenous
cells giving rise to conidia; H. Conidia. Scale bars: E-G = 20 um; H = 5 um.
Conip1A solitary, lateral or terminal, olivaceous to brown, smooth to finely
roughened, subglobose to ellipsoid, 6-9 x 4.5-6 um (av. 7.7 x 5 um, n = 30).
Arthrinium cordylines & A. pseudomarii spp. nov. (China) ... 193
Cotonies on OA, flat, spreading, margin circular, with abundant aerial
mycelia, surface and reverse white to grey.
TELEOMORPH: not observed.
ADDITIONAL MATERIAL EXAMINED: CHINA: YUNNAN PROVINCE, Kunming Institute
of Botany, from leaves of Pachysandra terminalis Siebold & Zucc. (Buxaceae),
Q. Zhang (GUCC 10214); from leaves of Disporopsis pernyi (Hua) Diels (Asparagaceae),
H. Long (GUCC 10221); from leaves of Aristolochia debilis, X.B. Ming (GUCC 10225,
GUCC 10226, GUCC 10227, GUCC 10261); from leaves of Cordyline fruticosa,
X.B. Ming (GUCC 10263); from leaves of Lycium chinense Mill. (Solanaceae), X.B.
Ming (GUCC 10254), from leaves of Hosta ventricosa Stearn (Asparagaceae), X.B.
Ming (GUCC 10259, GUCC 10260); from leaves of Epimedium acuminatum Franch.
(Berbeidaceae), X.B. Ming (GUCC 10270).
Notges—The twelve Arthrinium pseudomarii strains formed a relatively
independent branch with 82% MP/72% ML support, which showed a close
relationship to A. hispanicum, A. marii, and A. mediterranei with 95%
MP/93% ML bootstrap support. We compared the DNA base pairs for three
gene regions in the subclade (our twelve strains, A. hispanicum, A. marii,
and A. mediterranei) which revealed that for A. marii there are 14-16 TEF1,
0-2 ITS. and 1-3 TUB differences (TABLE 2). There were 0-2 ITS base pair
differences separating A. hispanicum and A. mediterranei. Morphologically,
conidia in A. pseudomarii are narrower than conidia in A. hispanicum
(7.5-8.5 x 6.2-7.6 um), A. marii (7.2-7.5 x 6.1-6.5 um), and A. mediterranei
(9-9.5 x 7.5-9 um) (Larrondo & Calvo 1990, 1992).
Arthrinium paraphaeospermum Senan. & K.D. Hyde,
Fungal Diversity 80: 198 (2016). Fic. 4
HypuHaeE hyaline, septate, branched, 3-5 um diam. CONIDIOPHORES
reduced to conidiogenous cells. CONIDIOGENOUS CELLS erect, aggregated
into clusters on hyphae, hyaline to pale brown, smooth, elongated, conical to
ampulliform, 15-30 x 3-5 um (av. 19 x 4 um, n = 30). Conrp1a olivaceous to
brown, smooth to finely roughened, mostly subglobose, 9-15 um (av. 13 um,
n = 30) diam.
CoLonlgs on OA, flat, spreading, circular, smooth at margin with abundant
aerial mycelia, surface and reverse white to grey, sometimes with light pink.
TELEOMORPH: not observed.
MATERIAL EXAMINED: CHINA, YUNNAN PROVINCE, Kunming Institute of Botany,
from leaves of Epimedium sagittatum (Siebold & Zucc.) Maxim. (Berberidaceae),
15.1.2018, leg. X.B. Ming (GUCC 10124-10127); from leaves of Neocheiropteris
palmatopedata (Baker) Christ (Polypodiaceae), 15.1.2018, leg. X.B. Ming (GUCC 10128,
GUCC 10129).
194 ... Chen, Zhang & al.
Fic. 4. Arthrinium paraphaeospermum (GUCC 10125). A. Host (Epimedium sagittatum) and
symptoms; B, C. Cultures on OA; D. Colony on OA producing conidial masses; E-H. Conidiogenous
cells giving rise to conidia; I. Conidia. Scale bars: E = 20 um; E-I = 10 um.
Arthrinium cordylines & A. pseudomarii spp. nov. (China) ... 195
Notres—Phylogenetic group the six strains cited above with A. para-
phaeospermum and A. rasikravindrae. Morphological comparison
indicated that our strains were more similar to A. paraphaeospermum,
in that the subglobose conidia differed from the dimorphous conidia of
A. rasikravindrae (lenticular, ovoid: 10-15 x 6-10.5 tm; elongate to clavate:
15-25 x 7.5-10 um; Singh & al. 2013, Hyde & al. 2016) and the subglobose
to mainly ovoid conidia (8-13 x 6.5-11.5 um) of GUCC 10088. Although
GUCC 10124 showed 15 DNA base differences in the ITS region, the TUB
and TEF1 sequences were nearly the same for all five strains (TABLE 2).
Thus, we assign these collections to A. paraphaeospermum.
Arthrinium rasikravindrae Shiv M. Singh, L.S. Yadav, P.N. Singh,
Rahul Sharma & S.K. Singh, Mycotaxon 122: 452 (2013 [“2012”]). Fic. 5
HypHaE hyaline, septate, branched, smooth, 2-3 um _ diam.
CONIDIOPHORES reduced to conidiogenous cells. CONIDIOGENOUS CELLS
erect, aggregated in clusters on hyphae, hyaline to pale brown, smooth,
doliiform to ampulliform, or lageniform, 10-20 x 3.5-5 um (av. 14.0 x 4.0
um, n = 30). ConipIA arising acropleurogenously, olivaceous to brown,
smooth to finely roughened, subglobose to mainly ovoid, 8-13 x 6.5-11.5 um
(av. 10.5 x 10 um, n = 30).
Cotonies on OA, flat, spreading, margin circular, with abundant aerial
mycelia, surface and reverse white to grey, sometimes with light pink.
TELEOMORPH: not observed.
MATERIAL EXAMINED: CHINA, YUNNAN PROVINCE, Kunming Institute of Botany,
from leaves of Aspidistra elatior Blume (Asparagaceae), 15.1.2018, leg. X.B. Ming
(GUCC 10088).
Notes—Phylogenetic analyses (Fic. 1) confirmed that strain GUCC
10088 was closely related to A. rasikravindrae with high bootstrap support
(MP = 100% / ML = 93%). DNA base pair comparison (TABLE 2) revealed
only one ITS base pair difference as compared to representative culture of
A. rasikravindrae (LC 5449), and no differences in the TUB and TEF1
sequences. Morphological comparison also indicated that GUCC 10088
represented A. rasikravindrae (Singh & al. 2013).
Discussion
Our regional survey of Arthrinium diversity in Yunnan Province revealed
that Arthrinium was not host-specific, because the same species could be
isolated from different plants (e.g., A. paraphaeospermum and A. pseudomarii),
and strains of these two species possessed a very high base similarity in
196 ... Chen, Zhang & al.
Fic. 5. Arthrinium rasikravindrae (GUCC 10088). A. Host (Aspidistra elatior) and symptoms;
B, C. Cultures on OA; D. Colony on OA producing conidial masses; E-I. Conidiogenous cells
giving rise to conidia; J, K. Conidia. Scale bars: E, G = 10 um; KF H-K = 5 um.
Arthrinium cordylines & A. pseudomarii spp. nov. (China) ... 197
different gene regions, which was consistent with Crous & Groenewald (2013)
and Wang & al. (2018). Secondly, the discovery of four taxa suggests that
Arthrinium is highly diverse in southwestern China, which would parallel
the rich phyto-floristic diversity in this region. We also confirmed that
morphological comparison alone is sufficient to identify Arthrinium taxa, and
that sequence analysis with base comparison is essential to resolve species.
Acknowledgements
This research was supported by the National Natural Science Foundation of
China (No. 31972222, 31560489 and 31560536), Program of Introducing Talents
of Discipline to Universities of China (111 Program, D20023), Science and
Technology Basic Work of MOST [2014FY120100], Talent Project of Guizhou
Science and Technology Cooperation Platform ([2017]5788-5 and [2019]5641),
Guizhou Science, Technology Department International Cooperation Basic Project
([2018]5806), Construction Program of Biology First-class Discipline in Guizhou
(GNYL[2017]009), and Guizhou University Cultivation Project [2017]5788-33. We
would like to acknowledge Drs. Jayarama Bhat (Emeritus, Goa University, India) and
Nalin Wijayawardene (Qujing Normal University, Yunnan, P.R. China) for reviewing
content of the manuscript.
Literature cited
Agut M, Calvo MA. 2004. In vitro conidial germination in Arthrinium aureum and
Arthrinium phaeospermum. Mycopathologia 157: 363-367.
https://doi.org/10.1023/b:myco.0000030432.08860.f3
Calvo MA, Guarro J. 1980. Arthrinium aureum sp. nov. from Spain. Transactions of the British
Mycological Society 75: 156-157. https://doi.org/10.1016/S0007-1536(80)80208-7
Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in
filamentous ascomycetes. Mycologia 91: 553-556. https://doi.org/10.2307/3761358
Chomnunti P, Hongsanan S, Aguirre-Hudson B et al. 2014. The sooty moulds. Fungal Diversity
66: 1-36. https://doi.org/10.1007/s13225-014-0278-5
Crous PW, Groenewald JZ. 2013. A phylogenetic re-evaluation of Arthrinium. IMA Fungus 4:
133-154. https://doi.org/10.5598/imafungus.2013.04.01.13
Glass NL, Donaldson GC. 1995. Development of primer sets designed for use with the PCR
to amplify conserved genes from filamentous ascomycetes. Applied and Environmental
Microbiology 61: 1323-1330. https://doi.org/10.0000/PMID7747954
Dai DQ, Jiang HB, Tang LZ, Bhat DJ. 2016. Two new species of Arthrinium (Apiosporaceae,
Xylariales) associated with bamboo from Yunnan, China. Mycosphere 7: 1332-1345.
https://doi.org/10.5943/mycosphere/7/9/7
Dissanayake AJ, Bhunjun CS, Maharachchikumbura SSN, Liu J. 2020. Applied aspects of
methods to infer phylogenetic relationships amongst fungi. Mycosphere 11: 2652-2676.
https://doi.org/10.5943/mycosphere/11/1/18
Huang J, Jiang Z. 2015. Phylogenetic analysis of endophytes from bitter melon
(Momordica charantia) in Guangdong Province. Agricultural Sciences 6(6): 609-621.
https://doi.org/10.4236/as.2015.66060
198 ... Chen, Zhang & al.
Hughes SJ. 1953. Conidiophores, conidia, and classification. Canadian Journal of Botany 31:
577-659. https://doi.org/10.1139/b53-046
Hyde KD, Frohlich J, Taylor JE. 1998. Fungi from palms. XXXVI. Reflections on unitunicate
ascomycetes with apiospores. Sydowia 50: 21-80.
Hyde KD, Hongsanan S, Jeewon R & al. 2016. Fungal diversity notes 367-490:
taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 80: 1-270.
https://doi.org/10.1007/ s13225-016-0373-x
Hyde KD, Norphanphoun C, Maharachchikumbura SSN, Bhat DJ, Jones EBG
& al. 2020. Refined families of Sordariomycetes. Mycosphere 11: 305-1059.
https://doi.org/10.5943/mycosphere/11/1/7
Jeewon R, Hyde KD 2016. Establishing species boundaries and new taxa among fungi:
recommendations to resolve taxonomic ambiguities. Mycosphere 7: 1669-1677.
https://doi.org/10.5943/mycosphere/7/11/4
Katoh K, Standley DM. 2016. A simple method to control over-alignment in the MAFFT
multiple sequence alignment program. Bioinformatics 32: 1933-1942.
https://doi.org/10.1093/bioinformatics/btw108
Larrondo JV, Calvo MA. 1990. Two new species of Arthrinium from Spain. Mycologia 82: 396-398.
https://doi.org/10.2307/3759915
Larrondo JV, Calvo MA. 1992. New contributions to the study of the genus Arthrinium.
Mycologia 84: 475-478. https://doi.org/10.2307/3760203
Martinez-Cano C, Grey WE, Sands DC. 1992. First report of Arthrinium arundinis causing
kernel blight on barley. Plant Disease 76: 1077. https://doi.org/10.1094/PD-76-1077B
Minter DW. 1985 A re-appraisal of the relationships between Arthrinium and other
hyphomycetes. Plant Sciences 94: 281-308. https://doi.org/10.1007/bf03053145
O'Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a
monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics
and Evolution 7: 103-116. https://doi.org/10.1006/mpev.1996.0376
O'Donnell K, Kistler HC, Cigelnik E, Ploetz RC. 1998. Multiple evolutionary origins of the fungus
causing Panama disease of banana: concordant evidence from nuclear and mitochondrial
gene genealogies. Proceedings of the National Academy of Sciences 95: 2044-2049.
https://doi.org/10.1073/pnas.95.5.2044
Pintos A, Alvarado P, Planas J, Jarling R. 2019. Six new species of Arthrinium from Europe and
notes about A. caricicola and other species found in Carex spp. hosts. MycoKeys 49: 15-48.
https://doi.org/10.3897/mycokeys.49.32115
Ramos HP, Braun GH, Pupo MT, Said S. 2010. Antimicrobial activity from endophytic fungi
Arthrinium state of Apiospora montagnei Sacc. and Papulaspora immersa. Brazilian Archives
of Biology and Technology 53: 629-632. https://doi.org/10.1590/s1516-89132010000300017
Rashmi M, Kushveer JS, Sarma VV. 2019. A worldwide list of endophytic fungi with notes
on ecology and diversity. Mycosphere 10: 798-1079.
https://doi.org/10.5943/mycosphere/10/1/19
Senanayake IC, Rathnayaka AR, Marasinghe DS, Calabon MS & al. 2020. Morphological
approaches in studying fungi: collection, examination, isolation, sporulation and
preservation. Mycosphere 11: 2678-2754. https://doi.org/10.5943/mycosphere/11/1/20
Singh SM, Yadav LS, Singh PN, Hepat R, Sharma R, Singh SK. 2013 [“2012”]. Arthrinium
rasikravindrii [sic] sp. nov. from Svalbard, Norway. Mycotaxon 122: 449-460.
https://doi.org/10.5248/122.449
Arthrinium cordylines & A. pseudomarii spp. nov. (China) ... 199
Swofford D. 2002. PAUP* - Phylogenetic analysis using parsimony (*and other
methods). Version 4. Sinauer Associates, Sunderland, Massachusetts, USA.
https://doi.org/10.1111/j.0014-3820.2002.tb00191.x
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular Evolutionary
Genetics Analysis version 6.0. Molecular Biology and Evolution 30: 2725-2729. https://
doi.org/10.1093/molbev/mst197
Thangaraj K, Cheng LL, Deng C, Deng WW, Zhang ZZ. 2019. First report of leaf blight
caused by Arthrinium arundinis on tea plants in China. Plant Disease 103(12): 3282.
https://doi.org/10.1094/PDIS-06-19-1324-PDN
Wang M, Tan XM, Liu F, Cai L. 2018. Eight new Arthrinium species from China. MycoKeys 34:
1-24. https://doi.org/10.3897/mycokeys.34.24221
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis & al. (eds). PCR
protocols: a guide to methods and applications. San Diego, CA. Academic Press.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Wijayawardene NN, Hyde KD, Wanasinghe DN, Papizadeh M, Goonasekara ID & al. 2016.
Taxonomy and phylogeny of dematiaceous coelomycetes. Fungal Diversity 77:1-316.
https://doi.org/10.1007/s13225-016-0360-2
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 201-213
https://doi.org/10.5248/136.201
Variability and distribution of Pluteus luteus,
a later synonym of P. variabilicolor
Hana SEvCiKkovA™ & BALINT DIMA?
™ Department of Botany, Moravian Museum,
Zelny trh 6, CZ-659 37 Brno, Czech Republic
? Department of Plant Anatomy, Institute of Biology, Edtvés Lorand University,
Pazmany Péter sétany 1/c, H-1117 Budapest, Hungary
* CORRESPONDENCE TO: [email protected]
ABSTRACT—The type specimen of Pluteus luteus was studied morphologically and
molecularly using DNA sequences of the ITS region of the ribosomal RNA gene. Pluteus
luteus is reduced to a synonym of P. variabilicolor, the morphological variability of which
is discussed. The distribution of P variabilicolor as a species native to Europe and Asia is
summarized, including the first collection from Slovakia and the second report from the
Republic of Korea (South Korea).
Key worps—Agaricales, Pluteaceae, Pluteus sect. Hispidoderma, type studies, taxonomy
Introduction
Pluteus Fr. (Agaricales, Pluteaceae; Kotlaba & Pouzar 1972, Singer 1986, Justo
& al. 2011a) is characterized by free lamellae, a pinkish spore print, smooth
globose to ellipsoid (rarely oblong) basidiospores, an inverse hymenophoral
trama, and the presence of cheilocystidia, often also pleurocystidia (Singer
1986, Vellinga 1990).
Traditionally, three sections are distinguished in the genus: Pluteus sect.
Pluteus; P. sect. Hispidoderma Fayod; and P. sect. Celluloderma Fayod, divided
into P. subsect. Eucellulodermini Singer and P. subsect. Mixtini Singer (Singer
1986). Pluteus sect. Pluteus is characterized by a pileipellis in the form of a
cutis and thick-walled pleurocystidia with hooks, prongs or other types of
excrescences; P. sect. Hispidoderma by a pileipellis consisting of elongated,
202 ... Sevéikova & Dima
filiform or hyphal elements organized as a cutis, a hymeniderm or a
trichoderm, and with non-metuloid pleurocystidia; and P. sect. Celluloderma
by a pileipellis composed of relatively short (sphaeropedunculate, ellipsoid to
saccate-obpyriform) elements organized with (P. subsect. Mixtini) or without
(P. subsect. Eucellulodermini) longer elements, which may be interpreted
as dermatocystidia or pileocystidia, as a hymeniderm, and non-metuloid
pleurocystidia (Singer 1956, 1958, 1986; Orton 1986, Citérin & Eyssartier
1998). According to Justo & al. (2011a,b), these subsections are not natural
groups, because elongated elements have appeared several times during the
evolution of P. sect. Celluloderma and also some species with a cutis pileipellis
(e.g., P. fenzlii (Schulzer) Corriol & P.-A. Moreau) are members of this section.
Babos (1978) originally assigned Pluteus variabilicolor Babos to P subsect.
Mixtini. However, our phylogenetic analysis of nrDNA ITS sequences, in
accordance with previous articles (Justo & al. 2011a, Lezzi & al. 2014), shows
that it belongs to P sect. Hispidoderma, together with P leoninus (Schaeff.)
P. Kumm. The explanation of this discrepancy is provided in this paper, based
on micromorphological and phylogenetical studies.
Pluteus variabilicolor was described based on collections from Hungary,
but the author pointed out that most of the species of P. subsect. Mixtini are
non-European (Babos 1978). Later, Pluteus castroae Justo & E.F. Malysheva
[as “castri’] described from Russia and Japan (Justo & al. 2011a: 470) was
synonymized with Pluteus variabilicolor (Lezzi & al. 2014). Pluteus luteus was
originally described as Macrocystidia lutea from China (Redhead & Liu 1982),
but the authors stated M. lutea to be an anomalous species in Macrocystidia and
after two years, Redhead (1984) transferred it to Pluteus.
In this paper, Pluteus luteus is reduced to a synonym under P. variabilicolor.
The distribution of this species in Europe and Asia is summarized including
the first collections from Slovakia and the second report from the Republic of
Korea.
Materials & methods
Morphology
Macroscopic descriptions of the collected specimens are based on fresh
basidiomata. Microscopic features were studied on dried material mounted in Congo
red using an Olympus BX-50 light microscope at magnifications of 400x and 1000x.
Herbarium abbreviations are according to Thiers (2019). Morphological terminology
follows Vellinga (1988). Authors of fungal names are cited according to the Index
Fungorum Authors of Fungal Names website (http://www.indexfungorum.org/names/
AuthorsOfFungalNames.asp). Abbreviations: avl = mean of basidiospore length;
Pluteus luteus a synonym of P varibilicolor ... 203
MF 445227 P. variabilicolor SFC20160708 30 South Korea
MK123351 P. variabilicolor OKA TR13 Turkey
MG544909 P. variabilicolor OKA106 Turkey
LT838186 P. variabilicolor BRNM 788273 South Korea
FJ774077 P. castroae LE216873 Russia
HM562092 P. castroae TNSF17602 Japan holotype
HM562099 P. castroae TNSF17081 Japan
gg| MT080029 P. variabilicolor DB 2018-09-08 Hungary
MN258677 P. 'leoninus' HFJAU0154 China
MG544908 P. variabilicolor OKA116 Turkey
KP192911 P. variabilicolor TL20130521 01 Italy
LT838182 P. variabilicolor BRNM 788274 Czech Republic
= KP192912 P. variabilicolor BP56936 Hungary isotype
KP192914 P. variabilicolor VM20130504 01 Italy
MT080030 P. Juteus DAOM180447 China holotype
KP192913 P. variabilicolor VM20111105 01 Italy
P. variabilicolor
ae P. chrysaegis complex
|— P. aff. leoninus |
|
| P. leoninus s. str. complex
P. aff. leoninus II
HM562089 P. pantherinus TNSF12882 Japan
HM562140 P. umbrosus AJ213 Spain
HM562069 P. granularis Strack7 USA Illinois
-— FJ774086 Pluteus sp. clade VI LE212990 Russia
98
Lf | HM562055 Pluteus aff. dianae AJ209 Spain
93 HM562114 P. velutinus TNSF12365 Japan
HM562058 P. heteromarginatus AJ172 USA Florida
82 HM562082 P. longistriatus Minnis309203 USA Missouri
987 FJ774080 P. semibulbosus LE227534 Russia
HM562090 P. aff. semibulbosus TNSF12393 Japan
MF356558 P. fenzlii DB6253 Hungary
HM562143 P. diettrichii JLS1624 Spain
0.1
Fig. 1. Maximum likelihood phylogenetic tree inferred from nrDNA ITS data set, showing the
relationships in Pluteus sect. Hispidoderma. Species complexes not dealt with in this study are
shown as compressed clades. Newly generated sequences are highlighted in bold. PhyML bootstrap
support values are shown at the branches. Bar indicates 0.1 expected change per site per branch.
avw = mean of basidiospore width; Q = quotient of length and width in any one
basidiospore; avQ = mean of basidiospore Q-values.
Molecular phylogeny
For DNA extraction, only dried herbarium specimens were used. DNA was
extracted with the NucleoSpin Plant II Mini Kit. PCR amplification of the internal
transcribed spacer region (ITS) of the ribosomal RNA gene was performed with
the primer pair ITS1F/ITS4 (White & al. 1990, Gardes & Bruns 1993). Sequencing
of the amplicons was carried out with the same primers by LGC Genomics (Berlin,
Germany). Chromatograms were checked and assembled with CodonCode Aligner
8.0.1. Initial BLAST search in the GenBank and UNITE nucleotide databases was
performed to find homologous sequences. ITS sequences of Pluteus belonging to
204 ... Sevéikova & Dima
P. sect. Hispidoderma were downloaded based on previous studies (e.g. Justo & al.
201 1a, Lezzi & al. 2014). The names of HM562055 (Pluteus aff. dianae) and FJ774086
(Pluteus sp. clade VI) follow a previous taxonomic paper (Sevcikova & al. 2020).
Sequences were aligned with the online version of MAFFT v. 7 using the E-INS-i
algorithm (Katoh & Standley 2013). Alignment was inspected and edited with Sea View
4 (Gouy & al. 2010).
Maximum Likelihood analysis was performed in PhyML 3.1 (Guindon & Gascuel
2003) using the GIR+I+G model of evolution and gamma distribution of 8 rate
categories. The resulting tree was edited in MEGA 7 (Kumar & al. 2016).
Phylogenetic results
The aligned ITS data set comprised a total of 40 sequences and a length of
700 positions including gaps which were treated as missing data in the ML
analysis. Two new sequences were deposited in GenBank (MT080029 and
MT080030). The resulting phylogram is shown in Fic. 1. Based on our analysis,
the ITS sequence generated from the holotype of Pluteus luteus nests within
the same clade including the holotype sequences of Pluteus variabilicolor and
P. castroae, with high support (ML-BS = 99%). This clade forms a sister group
of the Pluteus chrysaegis complex, as shown in Lezzi & al. (2014).
Taxonomy
Pluteus variabilicolor Babos,
Annales Historico-Natureles Musei Nationalis Hungarici 70: 93 (1978) Fic. 2, 4
= Macrocystidia lutea Redhead & B. Liu, Canadian Journal of Botany 60(8): 1485 (1982)
= Pluteus luteus (Redhead & B. Liu) Redhead, Sydowia 37: 266 (1984)
= Pluteus castroae Justo & E.F. Malysheva [as ‘castri’], in Justo & al.,
Mycological Progress 10(4): 470 (2011)
Type revision of Pluteus /Juteus Fics 2a, e—f; 3
ORIGINAL DESCRIPTION OF MACROCYSTIDIA LUTEA — “Pileus 5-14 mm lat.
campanulatus ad convexus umbone, humidus, translucidus, glabratus, levis, luteus, in
sicco infuscato. Lamellae adnatae, ascendens, latae, confertae, albae, in siccis salmoneis.
Stipes 12-60 x 1-1.3 mm, levis, albus, in sicco ochraceo. Basidiosporae 5-6 x 4-5.8
um, subglobosae, angulatus obscure, subhyalinae ad subsalmoneus, inamyloideae, leves,
cyanophilae praecipue. Basidia tetraspora, clavata. Cheilocystidia et pleurocystidia
42-57 x 11-22 um, dispersa, fusiformia ad ventricosa, levia. Pileocystidia abundant,
clavata ad ventricosa, levia, implexa, 28-52 x 1 1-14 um. Caulocystidia apiceum versus,
aggregata, clavata ut mucronata interdum. Hyphae fibulis nullis. Lactocollybia affinis.”
Fig. 2. Pluteus variabilicolor, pileipellis elements. a. DAOM 180447, holotype of P. luteus, young
basidioma; b. BRNM 788274; c. BRNM 772177; d. BRNM 788273; e, f. DAOM 180447, holotype
of P. luteus, mature basidioma. Scale bars = 10 um.
Pluteus luteus a synonym of P varibilicolor ... 205
206 ... Sevéikova & Dima
Ho.otypus—China, Kiangsu Province, Nanking City, June 27, 1978, Liu Bo 432, on
rotting wood in mountains (DAOM 180447).
BASIDIOSPORES 5-6.5(—7.5) x (4—)4.5-6 um, avl x avw = 5.9 x 5.1 um, Q =
1.00-1.40, avQ = 1.16, subglobose, rarely broadly ellipsoid or globose with small
inconspicuous apices. BAsip1A 20-31(-33) x 6-8(-11) um, tetrasterigmate,
clavate to subfusiform or narrowly utriform, colourless. PLEUROCYSTIDIA
abundant, 40-51.5(-78) x 11-19(-24) um, clavate to broadly clavate, with
obtuse or slightly acuminate apex, narrowly to broadly fusiform, less frequently
narrowly lageniform or narrowly utriform, with obtuse apex or rarely with small
rostrate apex, hyaline, thin-walled. Lamellar edges sterile. CHEILOCYSTIDIA
(22-)31-52 x (7-)10.5-22 um, narrowly to broadly fusiform, with obtuse
apex or rarely with 1-4 um long rostrate apex, or clavate to broadly clavate,
with obtuse or slightly acuminate apex, less frequently narrowly lageniform or
narrowly utriform, very rarely with 1-3 um long rostrate apex, hyaline, thin-
walled. PILEIPELLIs a euhymeniderm composed of two types of elements: [1]
(17-)20-54(-57) x 11-17(-19.5) um, narrowly clavate to clavate, narrowly
fusiform to fusiform, frequently with obtuse apex or 1-4 um long (sub)rostrate
apex; [2] (120-)181-210(-220) x 8-16 um elongate (sub)cylindrical elements
with obtuse apex; both types with yellow or pale yellow-ochre intracellular
pigment, less frequently almost colourless with very pale yellow tinge, thin-
walled. STIPITIPELLIS a cutis of 4-12(-16) um diam cylindrical thin-walled,
colourless or pale ochre-coloured hyphae. CauLocystip1A in tufts, more
frequently in lower part of stipe, 14-30(-42) x 4-11(-19.5) um, subcylindrical,
narrowly clavate to broadly clavate, fusiform or utriform, often with 1-4 um
long rostrate apex, thin-walled, colourless, in lower part of mature basidioma
with brown intracellular pigment. CLamp CONNECTIONS absent from all tissues.
Distribution and ecology
So far Pluteus variabilicolor is known from Europe: Hungary (Babos 1978),
Austria (Lohmeyer & al. 1994), Italy (Lanconelli & al. 1998, Migliozzi 2011,
Lezzi & al. 2014), Spain (Sanchez & Mufioz 2018), Romania (BRA 32267, Béres
2012), Slovenia and Moldova (Lezzi & al. 2014), and Russia (Justo & al. 2011a)
— and from Asia: Japan (Justo & al. 2011a), China (as P luteus; Redhead & Liu
1982, Redhead 1984), and the Republic of Korea (as P. luteus; Lee & al. 2016).
A second collection from the Republic of Korea is reported from a dead trunk
of Castanea in a mixed forest (BRNM 788273). Pluteus variabilicolor was found
for the first time in Slovakia at two localities, one on a heap of sawdust and
the other on decayed wood of a deciduous tree in a deciduous forest (BRNM
788274, BRNM 772177). This species is probably widespread but rare in
Pluteus luteus a synonym of P varibilicolor ... 207
Oe
0
WANs
OT We
Fig. 3. Pluteus luteus (holotype, DAOM 180447). a. basidiospores; b. basidia; c. cheilocystidia;
d. pleurocystidia; e. caulocystidia of young basidioma; f. caulocystidia of mature basidioma.
Scale bar = 10 um.
208 ... Sevéikova & Dima
Europe and Asia, growing on decayed wood (mostly fallen trunks), sawdust,
or woodchips of deciduous trees from May to October (BRNM 772177, BRNM
788273, BRNM 788274, Babos 1978, Béres 2012, Justo & al. 2011a, Lanconelli
& al. 1998, Lezzi & al. 2014, Lohmeyer & al. 1994, Migliozzi 2011, Redhead &
Liu 1982, Redhead 1984, Sanchez & Mufioz 2018).
Discussion
Phylogenetically, the lineage of Pluteus variabilicolor |= P. luteus; = P. castroae]
forms a uniform and isolated clade, supported by our ML analysis of the ITS
dataset. The sequence variation among the specimens studied was low: 1-6
substitution or indel positions. However, most of these variations originated
from polymorphic sites and might not be real differences. (These sequences
contain uncertain positions, where base polymorphisms occur, marked
with IUB codes. Therefore, these cannot be counted as real differences with
certainty.) The closest sister taxon, the P chrysaegis complex, differs by more
than 50 substitution and indel positions.
Pluteus luteus was originally described as Macrocystidia lutea. Redhead &
Liu (1982) mentioned ascending adnate lamellae, whereas the genus Pluteus
is characteristic by free lamellae. Redhead (1984), who had never seen fresh
material, later revised the description from the type collection and combined the
name with Pluteus to draw attention to the original misclassification. Redhead
based the reclassification upon the convergent pluteoid tramal structure and a
more palisade-like nature of the pileipellis on the disc but did not mention the
attachment of the lamellae. The type material contains one larger and several
small young basidiomata on which the lamellar attachment is not clear. After
cutting the basidioma, we observed that the lamellae appear to be free.
Pluteus variabilicolor is, as its name implies, a variable species. Babos (1978)
mentioned a white (or yellowish) stipe with dark floccules (as in Leccinum),
sometimes only on the basal part of the stipe or as inconspicuous floccules
visible only with a lens. Liu described Pluteus luteus as having a white stipe
when fresh, turning ochraceous on drying (Redhead & Liu 1982). In our type
studies (DAOM 180447!), we found only rare tufts of brownish caulocystidia
in the lower part of the stipe of a mature basidioma and scattered colourless
caulocystidia in the upper part. Therefore, the dark floccules on the stipe are
not a significant feature for identification of P. variabilicolor. Moreover, the
stipes of the Slovakian collection BRNM 788274 (relatively young basidiomata)
have yellow-ochre to mustard yellow fibrils on a white background, and brown
on white background in the lower part, at least at the stipe base (see Fic. 4).
Pluteus luteus a synonym of P varibilicolor ... 209
Fig. 4. Pluteus variabilicolor, basidiomata. a~c. BRNM 788274 (photo J. Pavlik); d. BRNM 788273
(photo V. Antonin); e. BRNM 772177 (photo J. Hrasko); f. BRNM 817743 (photo D. Solar).
Babos (1978) cited various pileus colours for the young basidiomata:
lemon-, chrome- or orange-yellow, sometimes with mustard to brownish green
tinges, paler at the pileus margin, and brown or grey-brown fibrillose scales.
210 ... Sevéikova & Dima
The Slovak and South Korean collections (BRNM 788274; BRNM 772177;
BRNM 788273; see Fic. 4) confirm this variability.
Lezzi & al. (2014) mentioned a difference in the pileipellis structure
between the original description of P variabilicolor and the Italian
collections identified originally as P castroae; phylogenetically they were
identical and synonymized under P. variabilicolor. According to Lezzi &
al. (2014), Italian collections lack the elongated pileipellis elements (up
to 200 um long) found in collections of P variabilicolor. Our holotype
studies show that elongate elements of up to 210 um are frequent in mature
basidiomata (BP85860, isotype of P. variabilicolor; large basidioma labelled
as the holotype of P luteus, DAOM 180447; also BRNM 788274, etc.).
Shorter elements dominate in young basidiomata (BRNM 788273; small
basidiomata of DAOM 180447, etc.); elongate elements are very rare and
inconspicuous and thus may, in some cases, look like subpellis elements.
The long elements also prevail at the pileus margin. In some cases, long
elements are absent at least in middle parts of the pileus of very young
basidiomata (the smallest basidioma of DAOM 180447; LE 212090).
Pluteus variabilicolor was initially included within P. subsect. Mixtini
(Babos 1978) but belongs phylogenetically to P sect. Hispidoderma
(Justo & al. 2011la, Lezzi & al. 2014, our studies — see Fic. 1). Moreover,
our morphological studies of the type show that the pileipellis structure
of P. subsect. Mixtini within the traditional P sect. Celluloderma
differs significantly from the pileipellis structure of species belonging
phylogenetically to P sect. Hispidoderma. Singer (1986) pointed out that
the pileipellis of P subsect. Mixtini is based on short (ellipsoid to saccate-
obpyriform) elements, and elongate elements can be interpreted as
dermatocystidia (= pileocystidia). By contrast, a pileipellis formed of long
elements is typical of species belonging to P. sect. Hispidoderma. Thus,
the long elements of P. variabilicolor probably form the pileipellis as well
as the shorter elements. Our morphological studies show that the long
elements grow later during basidioma ontogenesis, which is a very unusual
phenomenon in Pluteus. Further investigation of the growth dynamics of
the pileipellis is needed.
Babos (1978) and Courtecuisse (2006) mentioned Pluteus variabilicolor
as possibly introduced into Europe. The new records from Slovakia and
South Korea confirm that this species is widespread in Eurasia and supports
the theory that P. variabilicolor is a native species in the temperate zone of
Europe and Asia.
Pluteus luteus a synonym of P varibilicolor ... 211
COLLECTIONS STUDIED—Pluteus variabilicolor. HUNGARY. Prope Szarliget, in heap
of sawdust, 6 July 1977, leg. M. Babos et A. Friesz, det. M. Babos (BP85860 isotype);
19 Aug. 1974, leg. E. Véssey, det. M. Babos (BP56982); Budai Mts, Mt. Janoshegy, on
rotten trunk, 19 June 1960, leg. I. Szdke, det. M. Babos (BP34357); Visegradi Mts,
Démés, Malom-patak, in heap of sawdust, 23 July 1968, leg. et det. M. Babos (BP47697);
Solymar; in heap of sawdust, 3 Sept. 1977, leg. K. Tallér, det. M. Babos (BP56990).
AUSTRIA. Tittmining-Ettenau, heap of bark mulch (Populus?), 30 Oct. 1993, leg.
R. Till et T.R. Lohmeyer, det. H. Forstinger (L 7942/2). ROMANIA. Moraresti, near
Lintesti, decaying sawdust of Quercus, 3 June 1979 leg. et det. J. Kuthan (BRA 32267).
SLOVAKIA. Snina, Hrb, heap of sawdust, 10 May 2010, leg. J. Pavlik, det. H. Sevcikova
(BRNM 788274); Mladzovo, Hlonéa, deciduous forest, on decayed wood of deciduous
tree, 21 Oct. 2015, leg. J. Hrasko, det. H. Sevcikova (BRNM 772177); Logonec, Losonsky
haj, on trunk of Quercus, 13 September 2019 leg. D. Solar, det. H. Sevéikova (BRNM
817743). REPUBLIC OF KOREA. Taean Peninsula, Deoksung, Sudeoksa Monastery,
mixed forest, dead trunk of Castanea, 7 Aug. 2014, leg. V. Antonin, det. H. Sevcikova
(BRNM 788273).
Pluteus variabilicolor [originally as P. castroae]: RUSSIA. Samara Region, near
Pribrezhny, on decaying wood of deciduous tree, 1 July 2007, leg. et det. E.F. Malysheva
(LE 212090, paratype).
Pluteus variabilicolor [originally as P. luteus]: CHINA. Kiangsu Province, Nanking
City, on rotting wood in mountains, 27 June 1978, leg. B. Liu (DAOM 180447, holotype).
Pluteus fenzlii [originally as P. variabilicolor]: HUNGARY. Vas, Hosszupereszteg,
on heap of sawdust, 7 Oct. 1990, leg. P. Serediuk, det. J. Borovicka (BP 88763).
Conclusions
According to our results, Pluteus luteus (as well as P. castroae) is a
synonym of P variabilicolor and belongs to P sect. Hispidoderma. This taxon
is macroscopically and microscopically variable in colour and in structure
of pileus and stipe. The most significant characters of P. variabilicolor
are its yellow to ochre pileus, mostly clavate or fusiform thin-walled
pleurocystidia and cheilocystidia often with an obtuse apex or rostrum.
Pileipellis structure is also important for distinguishing P. variabilicolor
from other species, but this character changes during the growth of the
basidiomata. The shorter elements prevail over the long elements in the
pileipellis of very young basidiomata in our studied collections. With
aging basidiomata, however, this ratio significantly changes even in one
population. A stipe with conspicuous dark floccules on a white ground is
not a stable character. The stipe may also be white without conspicuous
floccules; the lower part of the stipe may also have a yellow colour. Pluteus
variabilicolor is rare but widespread in Europe and Asia on decayed wood,
sawdust, or woodchips of deciduous trees. Its distribution indicates it is
native to temperate Eurasia.
212 ... Sevéikova & Dima
Acknowledgements
The authors thank S.A. Redhead (Ottawa Research and Development Centre,
Agriculture & Agri-food Canada) and E.F. Malysheva (Komarov Botanical Institute
of the Russian Academy of Sciences, Saint Petersburg) for their pre-submission
reviews of the manuscript and S.R. Pennycook for his nomenclatural review. The
authors thank curators of BP, BRA, DAOM, LE and L for the possibility to study
herbarium collections. V. Antonin, J. Hrasko, J. Pavlik, and D. Solar are acknowledged
for providing information about their collections and photos of basidiomata in situ.
We also thank S.A. Redhead and E.F. Malysheva for giving useful details of the
holotype collection of Pluteus luteus and P. castroae. We also thank J.W. Jongepier
who helped improve the overall language of the manuscript. The studies of the first
author were enabled by support provided to the Moravian Museum by the Ministry
of Culture of the Czech Republic as part of its long-term conceptual development
programme for research institutions (DKRVO, ref. MK000094862). The studies
of the second author were partly supported by the ELTE Institutional Excellence
Program financed by the National Research, Development and Innovation Office
(NKFIH-1157-8/2019-DT).
Literature cited
Babos MG. 1978. Pluteus studies, I. (Basidiomycetes, Pluteaceae). Annales Historico-Natureles
Musei Nationalis Hungarici 70: 93-97.
Béres M. 2012. Macromycetes species included in Bern Convention Appendix in the Red List
for Romania, and rare presence in historical Maramures area (Romania). Acta Oecologica
Carpatica 5: 19-38.
Citérin M, Eyssartier G. 1998. Clé analytique du genre Pluteus Fr. Documents Mycologiques
28(111): 47-67.
Courtecuisse R. 2006. La notion despéce invasive appliquée aux champignons - état des lieux, en
particulier en France. La Lettre de la Société Mycologique de France 8: 5-8.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes—
application to the identification of mycorrhizae and rusts. Molecular Ecology 2(2): 113-118.
https://doi.org/10.1111/j.1365-294X.1993.tb00005.x
Gouy M, Guindon S, Gascuel O. 2010. SeaView version 4: a multiplatform graphical user
interface for sequence alignment and phylogenetic tree building. Molecular Biology and
Evolution 27: 221-224. https://doi.org/10.1093/molbev/msp259
Guindon S, Gascuel O. 2003. A simple, fast and accurate algorithm to estimate
large phylogenies by maximum likelihood. Systematic Biology 52(5): 696-704.
https://doi.org/10.1080/10635 150390235520
Justo A, Minnis AM, Ghignone S, Menolli N, Capelari M, Rodriguez O, Malysheva E,
Contu M, Vizzini A. 2011a. Species recognition in Pluteus and Volvopluteus (Pluteaceae,
Agaricales): morphology, geography and phylogeny. Mycological Progress 10(4): 453-479.
https://doi.org/10.1007/s11557-010-0716-z
Justo A, Vizzini A, Minnis AM, Menolli Jr N, Capelari M, Rodriguez O, Malysheva E,
Contu M, Ghignone S, Hibbett DS. 2011b. Phylogeny of the Pluteaceae (Agaricales,
Basidiomycota): taxonomy and character evolution. Fungal Biology 115(1): 1-20.
https://doi.org/10.1016/j.funbio.2010.09.012
Pluteus luteus a synonym of P varibilicolor ... 213
Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Molecular Biology and Evolution 30: 772-780.
https://doi.org/10.1093/molbev/mst010
Kotlaba F, Pouzar Z. 1972. Taxonomic and nomenclatural notes on some macromycetes. Ceska
Mykologie 26(4): 217-222.
Kumar S, Stecher G, Tamura K. 2016. MEGA7: molecular evolutionary genetics analysis
version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870-1874.
https://doi.org/10.1093/molbev/msw054
Lanconelli L, Ballanti F Rava M. 1998. Funghi del Lughese. Faenza: Edit. Faenza.
Lezzi T, Vizzini A, Ercole E, Migliozzi V, Justo A. 2014. Phylogenetic and morphological comparison
of Pluteus variabilicolor and P. castri (Basidiomycota, Agaricales). IMA Fungus 5(2): 415-423.
https://doi.org/10.5598/imafungus.2014.05.02.06
Lee JS, Choi SY, Kim C, Lee HB. 2016. Twelve undescribed species of macrofungi from Korea.
Korean Journal of Mycology. 44(4): 233-239. https://doi.org/10.4489/KJM.2016.44.4.233
Lohmeyer TR, Christan J, Gruber O. 1994. Ein Nachweis von Pluteus variabilicolor in
Oberésterreich. Osterreichische Zeitschrift fiir Pilzkunde 3: 95-100.
Migliozzi V. 2011. Pluteus variabilicolor, specie frequente nella cerreta di Macchiagrande di
Manziana (RM). Parliamo di Funghi 19(1): 3-9.
Orton PD. 1986. British fungus flora: agarics and boleti. Vol. 4. Pluteaceae: Pluteus & Volvariella.
Royal Botanic Garden Edinburgh.
Redhead SA. 1984. Mycological observations, 4-12: on Kuehneromyces, Stropharia, Marasmius,
Mycena, Geopetalum, Omphalopsis, Phaeomarasmius, Naucoria and Prunulus. Sydowia 37:
246-270.
Redhead SA, Liu B. 1982. New species and new records of Tricholomataceae (Agaricales) from
China. Canadian Journal of Botany 60(8): 1479-1486. https://doi.org/10.1139/b82-189
Singer R. 1956. Contributions towards a monograph of the genus Pluteus. Transactions of the
British Mycological Society 39: 145-232. https://doi.org/10.1016/s0007-1536(56)80001-6
Singer R. 1958. Monographs of South American Basidiomycetes, especially those of the east slope of
the Andes and Brazil 1. The genus Pluteus in South America. Lloydia 21: 195-299.
Singer R. 1986. The Agaricales in modern taxonomy. 4th edn. Koeltz Scientific Books, Koenigstein.
Sanchez L, Munoz G. 2018. Pluteus variabilicolor Babos, primera cita para la Peninsula Ibérica.
Revista Catalana de Micologia 39: 111-116.
Sevcikova H, Malysheva E, Justo A, Heilmann-Clausen J, TomSovsky M. 2020. Pluteus dianae and
Pluteus punctatus resurrected, with first records from eastern and northern Europe. Mycotaxon
135(2): 245-274. https://doi.org/10.5248/135.245
Thiers B. 2019 [continuously updated]. Index Herbariorum: a global directory of public herbaria
and associated staff. New York Botanical Garden's Virtual Herbarium. [Accessed 24 January
2019: http://sweetgum.nybg.org/ih/ ].
Vellinga EC. 1988. Glossary. 54-64, in: C Bas & al. (eds). Flora Agaricina Neerlandica,
vol. 1. Rotterdam.
Vellinga EC. 1990. Pluteaceae Kotl. & P. 31-55, in: C Bas & al. (eds). Flora Agaricina
Neerlandica, vol. 2. Rotterdam.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis & al. (eds).
PCR protocols: a guide to methods and applications. New York: Academic Press.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 215-218
https://doi.org/10.5248/136.215
Dichotomophthora portulacae,
anew record from Iraq
ZAINAB KHALAF ABDULLA
Department of Biology, College of Education for Pure Sciences, University of Basrah,
Basra, Iraq
CORRESPONDENCE TO: [email protected]
ABsTRACT—Dichotomophthora portulacae isolated from Portulaca oleracea is newly recorded
from Iraq. The ITS sequence showed congruence with D. portulacae sequences deposited in
GenBank. A phylogram, description, and illustrations are provided.
KEY WORDS—conidial fungi, taxonomy, plant pathogenic fungi
Introduction
Dichotomophthora was described by Mehrlich & Fitzpatrick with the
single species D. portulacae isolated from Portulaca oleracea in Hawaii.
Dichotomophthora portulacae causes diseases on the succulent weed purslane,
Portulaca oleracea (Mehrlich & Fitzpatrick 1935, Ellis 1971). The fungus
produces a necrotic leaf spot and dark lesions on stems (Klisiewicz 1985,
Klisiewicz & al. 1983).
Materials & methods
Fungal isolation, culture, and observation
Samples were collected from Portulaca oleracea in Basra Governorate, Iraq.
Pieces of stems and leaves with disease symptoms were surface disinfected in 3%
sodium hypochlorite for 5 min, rinsed in sterile distilled water, and plated on water
agar. Hyphae originating from these tissue pieces were transferred to potato dextrose
agar (PDA). Morphological characteristics such as conidiophore length, conidial
dimension, and sclerotial dimension were measured at 40x magnification. Cultural
characteristics such as colony appearance, conidial shape, colour and shape of
216 ... Abdulla
sclerotia over the plate were also examined. The living culture, slant tube, and dried
agar plate are conserved in the author's private herbarium “herb. Z.K. Abdulla.”
DNA extraction, amplification, and sequence analysis
A monoconidial culture was grown on PDA for 10 days at 27 °C and mycelium
was harvested by scraping the culture using a sterile scalpel. Genomic DNA was
extracted from mycelium by using Ez-10 Spin Column Fungal Genomic DNA Mini-
Preps Kit. PCR amplification was performed in a 50 ul total volume containing 10
ul DNA template, 25 pl master mix, 11 ul nuclease-free water, and 2 ul of ITS 1 and
ITS4 primers (White & al. 1990). PCR was performed in an Eppendorf Thermal
Cycler following the protocol: 1 cycle of 3 min denaturation at 94 °C, then 35 cycles
of 40 sec at 94 °C, 60 sec at 55 °C, 60 sec at 72 °C, and ending with one 10 min final
extension at 72 °C. The amplified product was checked by electrophoresis on 2%
agarose gel in 1 x TBE (trisBorate) buffer stained with ethidium bromide (1mg/L)
and visualized under UV light.
For sequencing, the PCR product was purified with Gen All in One Combo
Kit according to the manufacturer's instructions and sequenced by Macrogen
using with ABI prism 3700 sequencers. The sequences were analysed using DNA
Dragon (http://www.sequentix.de/dnadragon.) and GenBank’s BLAST program
(http://blast.ncbi.nlm.nih.gov).
Taxonomy
Dichotomophthora portulacae Mehrl. & Fitzp. ex M.B. Ellis,
Demat. Hyphomyc.: 388 (1971) Fie. 1
CoLonigs on PDA were effuse, greyish brown, hairy, or velvety, producing
red pigment into the media. Mycelium was superficial and sometimes immersed,
composed of smooth, branched, brown hyphae. ScLerotTia spherical to
globose or irregular, dark brown or black non-solid 180-280 x 180-220 um.
CONIDIOPHORES macronematous, mononematous, erect, cylindrical below,
dichotomously or trichotomously branched, brown or hyaline, branches <400
um long, 6-10 um thick. CONIDIOGENOUS CELLS polytretic, lobed, discrete,
determinate. ConipIA solitary, cylindrical clavate, straight, round at the ends,
smooth or verruculose, 17.5-55 x 10-15 um, 1-4-septate, hyaline or pale
brown, with a dark scar at the conidiogenous locus.
SPECIMEN EXAMINED: IRAQ, BASRAH PROVINCE, Al Jazeera: on stems and leaves
of Portulaca oleracea L. (Portulacaceae), 15 Mar 2014, coll. Z.K. Abdulla (herb. Z.K.
Abdulla ZKA1; strain ZAI1; GenBank MN508373).
Discussion
The Iraqi Dichotomophthora portulacae isolate resembled that described
by Ellis (1971) except that the Iraqi conidia were smaller with 1-4 transverse
Dichotomophthora portulacae, new for Iraq... 217
Fic. 1. Dichotomophthora portulacae (herb. Abdulla ZKA1). A, B. Sclerotia; C, D. Branched
conidiophores; E. Lobed conidiophore; F-I. Conidia. Scale bars: A, B = 100 um; C-I = 10 um
septa and the conidiophores were usually dichotomously or trichotomously
branched. The cultures produced pigment that converted the PDA to scarlet
red after a few days. The morphological characters otherwise matched those
of D. portulacae, and the culture's ITS sequence confirmed this identification.
Dichotomophthora portulacae was isolated by Eken (2003) from Portulaca
oleracea in Turkey and by Jing & al. (2008) from Basella rubra L. in China.
The Dichotomophthora sp. isolated by Soares & Nechet (2017) from Anredera
cordifolia (Ten.) Steenis in Brazil was identified based on morphology as
218 ... Abdulla
D. lutea; analysis of its ITS sequence showed high homology with a GenBank
sequence labelled as “Bipolaris sp.”
Acknowledgments
The author is truly grateful to Dr. Rafael F. Castaneda-Ruiz and Dr. Eric McKenzie
for reviewing the paper and I give them all the respect and thanks for their helpful
suggestions; also I thank Dr. Lorelei L. Norvell, Editor-in-Chief, and Dr. Shaun
Pennycook, Nomenclature Editor, Mycotaxon for their efforts.
Literature cited
Eken C. 2003. Dichotomophthora portulacae on Portulaca oleracea in Turkey. Mycotaxon 87:
153-156.
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew,
Surrey, England.
Jing J, Diao LG, Lu BS, Li BD. 2008. The finding of Dichotomophthora portulacae in China.
Mycosystema 27: 601-603.
Klisiewicz JM. 1985. Growth and reproduction of Dichotomophthora portulacae and its biological
activity on purslane. Plant Disease 69: 761-726. https://doi.org/10.1094/pd-69-761
Klisiewicz JM, Clement SL, Norris RF. 1983. Black stem: a fungal disease of common purslane in
California. Plant Disease 67: 1162. https://doi.org/10.1094/pd-67-1162
Mehrlich FP, Fitzpatrick HM. 1935. Dichotomophthora portulacae, a pathogen of Portulaca
oleracea. Mycologia 27: 543-550.
Soares DJ, Nechet KL. 2017. Dichotomophthora sp. causing leaf spot and foliar abscission
on Anredera cordifolia in Brazil. Australasian Plant Disease Notes 12(51): [4p.]
https://doi.org/10.1007/s13314-017-0276-z
White TJ, Bruns TD, Lee S, Taylor JW. 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis & al. (eds).
PCR protocols: a guide to methods and applications. Academic Press, San Diego.
https://doi.org/10.1016/b978-0-12-372180-8.50042-1
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 219-227
https://doi.org/10.5248/136.219
Myxomycetes in the Pantanal biome:
first records and a new associate, Attalea phalerata
IZABEL CRISTINA MOREIRA, LUCAS LEONARDO-SILVA,
ANTONIO SERGIO FERREIRA-SA, SOLANGE X AVIER-SANTOS*
FungiLab, Laboratorio de Micologia Basica, Aplicada e Divulgacdo Cientifica,
Universidade Estadual de Goids,
Campus Andpolis de Ciéncias Exatas e Tecnologicas,
Rod. Br 153, Km 99, Andpolis, Goids, Brazil.
* CORRESPONDENCE TO: solange.xavier@ueg. br
ABSTRACT—The occurrence of myxomycetes is reported for the first time in the Brazilian
Pantanal and on Attalea phalerata (acuri palm). The records are based on sporocarp
collections made in the municipality of Poconé, State of Mato Grosso, in an area characterized
by seasonal hydrological fluctuations and naturally open areas. We report six species: Arcyria
obvelata, Perichaena depressa, and P. vermicularis (Trichiaceae); and Physarum album,
P. compressum, and P. polycephalum (Physaraceae), all of which represent new records for the
Pantanal and a new substrate, A. phalerata.
Keyworps— geographic distribution, Mycetozoa, myxobiota
Introduction
The Pantanal is considered the largest floodplain in the world (>140,000
km’). It is located in the central region of South America, extended in
Bolivia, Paraguay, and Brazil. Considered the smallest Brazilian biome,
the Pantanal lies in the Central-West region of the country in the States
of Mato Grosso and Mato Grosso do Sul (Prance & Schaller 1982, Ribeiro
& Dias 2007). According to the Képpen classification, its climate is AW:
predominantly tropical with hot humid summers and cold dry winters, with
annual temperature and precipitation averaging 25 °C and 140 cm (Signor
& al. 2010, Alvares & al. 2013). The floods vary between permanent and
220...
Moreira & al.
A 80°0.000'W 62°0.000'W 44°0.000'W
12°0.000'S
12°0.000'S
26°0.000'S
26°0.000'S
80°0.000'W 62°0.000'W 44°0.000'W
“ =
i
i ~= ae
——_—_.
————
Fic. 1.A. Location of the Poconé sampling area (black dot) in South America and in the
Brazilian Pantanal (yellow area). B. Some landscapes from the Poconé sampling area.
temporary, dependent upon topographical characteristics, soil composition
and regulated by the climate (Rodela & Neto 2007). The vegetation comprises
grass fields, forests, and aquatic plants (Prance & Schaller 1982, Ribeiro &
Dias 2007).
The biome is biologically highly diverse. Its location in a region where
different phytogeographic provinces (the Cerrado, Paraguayan Chaco, and
Amazon and Meridional forests) converge, results in its functioning as a
biogeographic corridor (PAE 2004). However, despite this rich diversity
of ecosystems, most of the Pantanal biodiversity, and particularly the
microbiota, is still unknown (Maia & al. 2015, Cavalcanti 2019).
Arcyria, Perichaena, and Physarum on Attalea phalerata (Brazil) ... 221
Among these microorganisms, the myxomycetes (Protozoa: Amoebozoa)
are prominent. These heterotrophic eukaryotes, characterized by at least two
very distinct phases in their life cycle (Adamonyté & al. 2013, Eliasson 2013,
Stephenson & Rojas 2017) can be found in a variety of habitats where food
and humidity are available. They occur in different plant associations with
different macromycetes (Andrade & al. 2006, Rufino & Cavalcanti 2007,
Araujo & al. 2012).
In Brazil, myxomycete studies have been concentrated in the Northeast
region, especially in the Atlantic forest and Amazon biomes (Cavalcanti
2019). Recently, those studies have been expanded to other biomes, such as
the Cerrado, in the Central-West region (Xavier-Santos & al. 2016) and the
Pampas, in the South region (Lima & Cavalcanti 2017). However, there is
no record of myxobiota in the Pantanal. Here we present the first records of
myxomycetes in this biome, as well as the first occurrence associated with
Attalea phalerata Mart. ex Spreng. (Arecaceae).
Materials & methods
During July 2018, we opportunistically sampled around Km 10 of the
Transpantaneira road in the municipality of Poconé, State of Mato Grosso (16°22’43”S
56°37'19”W) (Fic. 14). The area is characterized by seasonal hydrological fluctuations
and naturally open areas (Fic. 1B). The region climate is tropical hot and humid,
with an average annual temperature of 25°C (Silva 2010). We identified the sampled
material using micro- and macroscopic characters following a morphological species
concept. We use the taxonomic nomenclature established by Lado (2019) and, follow
the criteria used by Leontyev & al. (2019) for genus and family classifications. Specimen
vouchers studied were deposited in the myxomycete collection of the herbarium of the
Universidade Estadual de Goias, Anapolis, Brazil (HUEG).
Results
We report six species representing Trichiaceae (Arcyria obvelata, Perichaena
depressa, P. vermicularis) and Physaraceae (Physarum album, P. compressum,
P. polycephalum). These species were collected over litter and living bracts
of Attalea phalerata. This palm species—popularly known as acuri, bacuri,
or uricuri—dominates the Pantanal region where it is used for food, animal
forage, and construction material (Mostacedo & Fredericksen 1999, Miranda
& al. 2001). The palm trees Acrocomia intumescens Drude (macatba),
Copernicia prunifera (Mill.) H.E. Moore (carnauba), Mauritia flexuosa L.f.
(buriti), Orbignya phalerata Mart. [= Attalea speciosa Mart.] (babacu), and
Elaeis guineensis Jacq. (dendezeiro) have already been recorded as important
substrates for the myxobiota in Brazil (Alves & Cavalcanti 1996, Silva & al.
222 ... Moreira & al.
2010). However, this is the first Brazilian record of myxomycetes occurring on
Attalea phalerata.
Taxonomy
Arcyria obvelata (Oeder) Onsberg, Mycologia 70(6): 1286. 1979. FIG. 2A
Sporocarps densely clustered, yellow. Stalk yellowish brown, slightly curved.
Peridium persistent at base as a small shallow calyculus. Capillitia abundant,
elastic, decorated with spines and half-rings. Spores yellow, 6.0-7.5 um diam.
SUBSTRATE: Spathe (bract) of Attalea phalerata.
MATERIAL EXAMINED: BRAZIL. Mato Grosso: Poconé, Km 10 of the Transpantaneira
road, 10/VII/2018, S. Xavier-Santos 6452 (HUEG 11943); S. Xavier-Santos 6459 (HUEG
11953).
REMARKS: Arcyria obvelata is diagnosed by its long, cylindrical, yellow
sporotheca and a capillitium only slightly connected to the epicalyx. This
first record for the Central-West region establishes the species as present in
all regions of Brazil. Previously reported on leaves of the Copernicia prunifera
(Mobin & Cavalcanti 2000), this is the first record of A. obvelata on Attalea
phalerata in the country.
DISTRIBUTION: Cosmopolitan (Martin & Alexopoulos 1969, GBIF 2019).
Perichaena depressa Lib., Pl. Crypt. Arduenna 4: no. 378. 1837. FIG. 2B
Sporocarp sessile, strongly flattened. Peridium double, partially iridescent,
outer surface reddish brown and inner layer yellow, dehiscence circumsessile
(as a lid formed from the top of the peridium and a base part as a shallow glass).
Spores in mass dark yellow. Capillitia elastic, abundant, yellow, slightly warty.
Spores yellow pale, minutely warty, 8.0-10.4 um diam.
SUBSTRATE: Leaf litter.
MATERIAL EXAMINED: BRAZIL. MATo Grosso: Poconé, Km 10 of the Transpantaneira
road, 10/VII/2018, S. Xavier-Santos 6453 (HUEG 11954).
REMARKS: Perichaena depressa is easily recognized in the field due to the rapid
formation of sporocarp and circumsessile dehiscence (Ukkola & Hark6nen
1996). Widely distributed, it is the most frequent Perichaena species registered
in Brazil.
DISTRIBUTION: Cosmopolitan (Martin & Alexopoulos 1969, GBIF 2019).
Perichaena vermicularis (Schwein.) Rostaf.,
Sluzowce Monogr., Dodatek: 34. 1876. FIG. 2C
Plasmodiocarp ring-shaped, peridium double, ochraceous yellow,
dehiscence irregular, persistent at the base; inner layer membranous, papillose.
Arcyria, Perichaena, and Physarum on Attalea phalerata (Brazil) ... 223
Fic. 2. Myxomycetes recorded in the Brazilian Pantanal. A. Arcyria obvelata; B. Perichaena
depressa; C. Perichaena vermicularis; D. Physarum album; E. Physarum compressum; F. Physarum
polycephalum. Scale bars = 0.5 mm.
224 ... Moreira & al.
Capillitia decorated with small spinules, 9.0-12.5 um diam.
SUBSTRATE: Spathe (bract) of Attalea phalerata.
MATERIAL EXAMINED: BRAZIL. Mato Grosso: Poconé, Km 10 of the Transpantaneira
road, 10/VII/2018, S. Xavier-Santos 6454 (HUEG 11945); S. Xavier-Santos 6460 (HUEG
11949).
REMARKS: Perichaena vermicularis was previously reported in Brazil’s Northeast
and Southeast regions plus one record from the Midwest area. ‘This is the first
Brazilian record of the species occurring on Attalea phalerata.
DISTRIBUTION: Cosmopolitan (Martin & Alexopoulos 1969, GBIF 2019).
Physarum album (Bull.) Chevall., Fl. Gén. Env. Paris 1: 336. 1826. FIG. 2D
Sporocarps grouped. Peridium covered by calcareous granules, grayish
white, petaloid dehiscence. Stalk, blackish brown base, curved. Spores in dark
brown mass. Capillitia hyaline, interconnected by fusiform white calcareous
granules. Spores violet brown, moderately warty, 8.0-9.5 um diam.
SUBSTRATE: Spathe (bract) of Attalea phalerata.
MATERIAL EXAMINED: BRAZIL. MATo Grosso: Poconé, Km 10 of the Transpantaneira
road, 10/VII/2018, S. Xavier-Santos 6455 (HUEG 11942); S. Xavier-Santos 6461 (HUEG
11951).
REMARKS: Key characters of Physarum album are its pendant sporocarp and
blackish brown pedicel that becomes white near the apex. This species has
already been found on leaves of Elaeis guineensis (Silva & al. 2010); this is the
first Brazilian record on Attalea phalerata.
DISTRIBUTION: Cosmopolitan (Martin & Alexopoulos 1969, GBIF 2019).
Physarum compressum Alb. & Schwein., Consp. Fung. Lusat.: 97. 1805. FIG. 2E
Sporotheca with rounded lobes. Stalk short, dark brown (almost black).
Capillitia with irregular nodules. Spores dark, 9.0-13.5 um diam.
SUBSTRATE: Spathe (bract) of Attalea phalerata.
MATERIAL EXAMINED: BRAZIL. Mato Grosso: Poconé, Km 10 of the Transpantaneira
road, 10/VII/2018, S. Xavier-Santos 6456 (HUEG 11946); S. Xavier-Santos 6462 (HUEG
11952).
REMARKS: Physarum compressum is characterized by its fan-shaped or
flabelliform sporotheca that dehisce by an apical or irregular cleft and the
presence of calcium granules after opening. This is the first record for the
Central-West region. This species has already been found on leaves of Elaeis
guineensis (Silva & al. 2010); but this is the first Brazilian record on Attalea
phalerata.
DISTRIBUTION: Cosmopolitan (Martin & Alexopoulos 1969, GBIF 2019).
Arcyria, Perichaena, and Physarum on Attalea phalerata (Brazil) ... 225
Physarum polycephalum Schwein.,
Schriften Naturf. Ges. Leipzig 1: 63. 1822. FIG. 2F
Sporocarps grouped. Sporotheca multilobed, compressed, umbilicate in the
bottom, peridium simple, gray in the center and yellow on the border. Stalk
long, brownish yellow. Spore mass dark brown. Capillitia dense, pale yellow,
intertwined by pale yellow calcareous nodules. Spores globose, violaceous-
brown, spinulose 7.0-9.0 um diam.
SUBSTRATE: Spathe (bract) of Attalea phalerata.
MATERIAL EXAMINED: BRAZIL. Mato Grosso: Poconé, Transpantaneira road,
Pousada Piuval, 10/VII/2018, S. Xavier-Santos 6457 (HUEG 11948).
REMARKS: One prominent macroscopic character of Physarum polycephalum
is its multilobed and compressed sporotheca that vary in color between yellow,
gray, and bronze. This species is widely used as a biological model, due to its
easy growth and manipulation in vitro, the rapid response of the plasmodium,
migratory behavior, and attraction for food and humidity, among other factors
(Adamatzky 2010, Bozzone 2011). This is the first Brazilian report of its
occurrence on Attalea phalerata.
DISTRIBUTION: Pantropical and Northern temperate zone (Martin &
Alexopoulos 1969, Lado & Basanta 2008, Ndiritu & al. 2009, GBIF 2019).
Acknowledgments
The authors thank Dr. Carlos Rojas Alvarado (University of Costa Rica, Costa
Rica) and Ricardo Enrique Morales Hernandez (Facultad Multidisciplinaria de
Occidente, Universidad de El Salvador) for reviewing the manuscript; Dr. Shaun
Pennycook for nomenclatural review and Dr. Lorelei L. Norvell for editorial review;
and the Fundacao de Amparo a Pesquisa do Estado de Goias (FAPEG) and the
Conselho Nacional de Desenvolvimento Cientifico e Tecnolégico (CNPq) for a
scholarship granted to Izabel Cristina Moreira (FAPEG/Master’s), Lucas Leonardo
da Silva (CNPq/Herbario Virtual da Flora e dos Fungos/AT), and Anténio Sérgio
Ferreira de Sa (CNPq/IC).
Literature cited
Adamatzky A. 2010. Physarum machines: computers from slime mould. World Scientific Series
on Nonlinear Science, Series A 74. 280 p. https://doi.org/10.1142/7968
Adamonyte G, Irgénaité R, Motiejtnaite J, Matulevicitite D, Taraskevicius R. 2013. Myxomycetes
in a forest affected by great cormorant colony: a case study in Western Lithuania. Fungal
Diversity 59: 131-146. https://doi.org/10.1007/s13225-012-0203-8
Alvares CA, Stape JL, Sentelhas PC, Moraes G, Leonardo J, Sparovek G. 2013. K6ppen’s
climate classification map for Brazil. Meteorologische Zeitschrift 22(6): 711-728.
https://doi.org/10.1127/0941-2948/2013/0507
Alves MH, Cavalcanti LH. 1996. Myxomycetes em Palmeiras (Arecaceae). Acta Botanica
Brasilica 10(1): 1-7. https://doi.org/10.1590/S0102-33061996000100001
226 ... Moreira & al.
Andrade LHC, Souza WP, Santos DS, Gdées-Neto A. 2006. Filo Myxomycota. 49-74, in: LFP
Gusmao, LC Maia (eds). Diversidade e Caracterizagao dos Fungos do Semi-arido Brasileiro.
Vol. 2. Recife: Instituto Milénio do Semiarido.
Araujo JC, Moreira IC, Xavier-Santos S. 2012. Myxobiota associada a residuos de mangueira
(Mangifera indica L.). Heringiana 6(1): 20-22.
Bozzone DM. 2011. Cells with “Personality:” Physarum polycephalum. Carolina Tips 64(3): 9-11.
Cavalcanti LH. 2019. Lista de espécies da Flora do Brasil. Jardim Botanico do Rio de Janeiro. Jardim
Botanico do Rio de Janeiro. http://www. floradobrasil.jbrj.gov.br [Accessed 30 June 2019].
Eliasson U. 2013. Coprophilous myxomycetes: recent advances and future research directions.
Fungal Diversity 59: 85-90. https://doi.org/10.1007/s13225-012-0185-6
GBIF. 2019. Global Biodiversity Information Facility. 2019. https://www.gbif.org [Accessed 7
September 2019].
Lado C. 2019. (2005-2019) Nomen.eumycetozoa.com: an on-line nomenclatural information
system of Eumycetozoa. https://eumycetozoa.com/data/index.php [Accessed 8 June 2019].
Lado C, Basanta DW. 2008. A review of neotropical myxomycetes (1828-2008). Anales del Jardin
Botanico de Madrid 65(2): 211-254. https://doi.org/10.3989/ajbm.2008.v65.i2.293
Leontyev DV, Schnittler M, Stephenson SL, Novozhilov YK, Shchepin ON. 2019. Towards
a phylogenetic classification of the myxomycetes. Phytotaxa 399(3): 209-238.
https://doi.org/10.11646/phytotaxa.399.3.5
Lima VX, Cavalcanti LH. 2017. Diversity and ecology of Myxomycetes in the Pampa Biome,
Brazil. Nova Hedwigia 104: 273-291. https://doi.org/10.1127/nova_hedwigia/2016/0360
Maia LC & al. 2015. Diversity of Brazilian fungi. Rodriguésia 66(4): 1033-1045.
https://doi.org/10.1590/2175-7860201566407
Martin GW, Alexopoulos CJ. 1969. The Myxomycetes. Iowa City, University of Iowa Press. p.
561.
Miranda IPA, Rabelo A, Bueno CR, Barbosa EM, Ribeiro MNS. 2001. Frutos das palmeiras da
Amazonia. MCT INPA. Manaus. 120 p.
Mobin M, Cavalcanti LH. 2000. Myxomycetes em carnaubeira (Copernicia prunifera (Miller)
H.E. Moore, Arecaceae). Acta Botanica Brasilica 14(1): 71-75.
https://doi.org/10.1590/S0102-33062000000100007
Mostacedo B, Fredericksen TS. 1999. Regeneration status of important tropical forest tree species
in Bolivia: assessment and recommendations. Forest Ecology and Management 124: 263-273.
https://doi.org/10.1016/S0378-1127(99)00076-6
Ndiritu GG, Winsett KE, Spiegel FW, Stephenson SL. 2009. A checklist of African myxomycetes.
https://mycotaxon.com/resources/checklists/ndiritu_v107-checklist.pdf
[Summary: Mycotaxon 107: 353-356. https://doi.org/10.5248/107.353 |
PAE. 2004. Implementagao de Praticas de Gerenciamento Integrado de Bacia Hidrografica
para o Pantanal e a Bacia do Alto Paraguai. ANA/GEF/PNUMA/OEA. 317 p.
https://arquivos.ana.gov.br/projetos/gefpantanal/PAE_Pantanal_PT-.pdf
Prance GT, Schaller GB. 1982. Preliminary study of some vegetation types of the pantanal,
Mato Grosso, Brazil. Brittonia 34(2): 228-251. https://doi.org/10.2307/2806383
Ribeiro JE, Dias T. 2007. Diversidade e conservacao da vegetacao e da flora. 21-139, in:
Cerrado e Pantanal: areas e acoes prioritarias para a conservacao da biodiversidade. Série
Biodiversidade, v.17. Brasilia, Distrito Federal, Ministério do Meio Ambiente.
Rodela LG, Neto JPQ. 2007. Estacionalidade do clima no pantanal da Nhecolandia, Mato
Grosso do Sul, Brasil. Revista Brasileira de Cartografia 59(1): 101-113.
Arcyria, Perichaena, and Physarum on Attalea phalerata (Brazil) ... 227
Rufino MUL, Cavalcanti LH. 2007. Alterations in the lignicolous myxomycete biota over two
decades at the Dois Irmaos Ecologic State Reserve, Recife, Pernambuco, Brazil. Fungal
Diversity 24:159-171.
Signor CA, Fernandes IM, Penha JMF. 2010. O Pantanal e o sistema de pesquisa. 13-23, in: IM
Fernandes & al. (eds). Biodiversidade no Pantanal de Poconé. Manaus: Attema.
Silva RR. 2010. Leguminosae do municipio de Poconé, Pantanal de Poconé, Mato Grosso, Brasil.
Biota Neotropica 10(4): 313-319. https://doi.org/10.1590/S1676-06032010000400035
Silva CFE, Andrade LHC, Cavalcanti LH. 2010. Myxobiota of the Brazilian Atlantic Forest:
species on oil palm tree (Elaeis guineensis Jacq., Arecaceae). Rodriguesia 61: 575-583.
https://doi.org/10.1590/2175-7860201061402
Stephenson S, Rojas C (eds). 2017. Myxomycetes: biology, systematics, biogeography, and ecology.
Academic Press, Amsterdam & New York. 454 p.
Ukkola TE, Harkénen M. 1996. Revision of Physarum pezizoideum var. pezizoideum and var.
microsporum (Myxomycetes). Karstenia 36: 41-46. https://doi.org/10.29203/ka.1996.317
Xavier-Santos S, Moreira IC, Leonardo-Silva L. 2016. Myxomycetes. Guide to the macroscopic
fungi of Parque Estadual da Serra de Caldas Novas, Goias, Brazil. Vol. 1. Myxomycetes. Editora
Kelps. 104 p.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 229-234
https://doi.org/10.5248/136.229
Spathularia nigripes and Trichoglossum walteri
newly recorded from Turkey
YASIN UZUN*
Department of Biology, Science Faculty, Karamanoglu Mehmetbey University,
Yunus Emre Campus, Karaman, Turkey
“ CORRESPONDENCE TO: [email protected]
ABSTRACT—Two ascomycetous species, Spathularia nigripes (Cudoniaceae) and
Trichoglossum walteri (Geoglossaceae), are reported as new records for the Turkish mycobiota,
based on collections from Istanbul and Konya provinces. Descriptions of the newly recorded
species are accompanied by color photographs illustrating their macroscopic and microscopic
features.
Key worps—biodiversity, earth tongue, new record, taxonomy
Introduction
Ascomycetous macrofungi producing large pileate tongue-shaped fruiting
bodies within several genera are generally referred to as earth-tongues. They
are widely distributed and grow on various substrates. Spathularia Pers. and
Trichoglossum Boud. are among these genera.
Spathularia (Cudoniaceae) is represented by 12 species (Kirk & al. 2008) that
are generally characterized by fleshy, spathulate and stipitate ascocarps, clavate
asci, filiform paraphyses, one-celled to septate ascospores; some species also
produce obovoid to subgloboid conidia.
Trichoglossum (Geoglossaceae) is generally characterized by club-shaped
brownish black apothecia, smooth or velvety stipes, 4-8-spored inoperculate
asci with amyloid apical pores, apically curved or coiled septate paraphyses,
and multiply septate ascospores.
Seven geoglossoid or cudonioid fungi taxa have been recorded from Turkey:
Cudonia circinans (Pers.) Fr., Geoglossum lineare Hakelier, G. umbratile Sacc.,
230 ... Uzun
Trichoglossum hirsutum (Pers.) Boud., T. variabile (EJ. Durand) Nannf.,
Spathularia flavida Pers. and Spathulariopsis velutipes (Cooke & Farl.) Maas
Geest. (Akata & Kaya 2013; Giingor & al. 2015a,b), but the current checklists
(Sesli & Denchev 2014, Solak & al. 2015) and the most recent Turkish
mycobiota (Kaya & al. 2016; Isik & Tiirkekul 2018; Kaya & Uzun 2018; Sesli &
al. 2018; Sadullahoglu & Demirel 2018; Uzun & al. 2018; Acar & al. 2019; Akcay
2019; Keles 2019; Uzun & Kaya 2019a,b) do not cite Spathularia nigripes and
Trichoglossum walteri from the country. This work contributes new records to
the mycobiota of Turkey.
Materials & methods
During 2017-2018, ascocarps were collected from Eregli district (Konya province)
and Sile district (Istanbul province). Observations on the morphology and ecology
were noted in the field and the fruitbodies were photographed in their natural
habitats prior to transfer to the laboratory for further research. Tissues were mounted
in Congo Red and Melzer’s reagent and examined under a Nikon Eclipse Ci-S
trinocular light microscope. The samples were identified with the help of the relevant
literature (Mains 1954, Geesteranus 1965, Cacialli & al. 1992, Vidal 1994, Fernandez
Vicente & Undagoitia 2004, Sandras & Hairaud 2007, Bessette & al. 2007, Placido
Iglesias 2007, Requejo 2010, Ribes & al. 2015). IndexFungorum (2019) was followed
for the systematics of the taxa. The specimens are kept at Karamanoglu Mehmetbey
University, Kamil Ozdag Science Faculty, Department of Biology, Turkey (KMU).
Taxonomy
Spathularia nigripes (Quél.) Sacc. Syll. Fung. 8: 49 (1889) FIGAi
APOTHECIA $32 xX 7 mm, spathulate to claviform, composed of a fertile
head and a stipe. The fertile head 6.5-11.5 x 4-7 mm, ellipsoid, ovoid,
somewhat squashed or flattened, longitudinally furrowed, sometimes wavy,
glabrous, dirty white to beige. STIPE 7—20.5 x 2.5-3.7 mm, cylindrical, slightly
thickened at the base, smooth or slightly furfuraceous, dark grey to brownish-
grey or bluish-grey. Excipular cells have a prismatic texture in both fertile
head and stipe. Ascr 101-135 x 9-13 (14.5) um, claviform, inoperculate,
inamyloid, generally 8-spored, arising from croziers. PARAPHYSES filiform,
hyaline, septate, with curved, twisted, or spiral apex, some bifurcated near
the apex. AscospoREs 38-42 x 2-2.6 tum, needle-shaped, hyaline, smooth,
some septate, with small, scattered drops, heteropolar, acute at one end while
obtuse at the other. SECONDARY SPORES (conidia) originating from mature
ejected ascospores, 2.2-2.4 x 2-2.2 um, subglobose and attached to the
ascospores by a thin sterigma.
Spathularia nigripes & Trichoglossum walteri new to Turkey ... 231
Fic 1. Spathularia nigripes (KMU-Uzun 6290): a. ascocarps; b. asci and paraphyses (Congo red);
c. ascospores (Melzer); d. secondary spores (conidia) developing from ascospores (Congo red).
Scale bars = 10 um.
SPECIMEN EXAMINED—TURKEY, ISTANBUL: Sile, Sofular Village, 41°09’N 29°30’E, 105
m, broad leaved forest, on decaying stump of Laurus nobilis L. (Lauraceae), 07.03.2018,
Y. Uzun 6290 (KMU).
ComMENTS— The Turkish collection of Spathularia nigripes matches literature
descriptions. Spathularia species generally resemble each other. Spathularia
flavida is separated from S. nigripes by its larger (<80 mm) carpophores and
flattened, compressed or lobed fertile zone (Breitenbach and Kranzlin 1984,
Cacialli & al. 1992). The longer ascospores of S. flavida (<70 um) are another
distinguishing character (Ribes & al. 2015).
232 ... Uzun
» ©
we
e
Va |
¢
=
°
r
ie
LoD wh
"
Fic 1. Trichoglossum walteri (KMU-Uzun 6019): a,b. ascocarps; c. hairs; d. asci, paraphyses and
ascospores; e,f. ascospores (all in Melzer). Scale bars = 20 um.
Spathularia nigripes is known to occur on small remnants of unidentified
wood in mixed forest of Pinus canariensis C. Sm. and Eucalyptus, and in fayal-
heath (Erica L., Ilex L., Laurus and Myrica L. spp.) in Spain (Ribes & al. 2015),
among Erica arborea L. wood remnants in Greece (Mycohellas 2019) and on
sandy soil among woody debris in mixed forest in Italy (Cacialli & al. 1992).
Trichoglossum walteri (Berk.) E.J. Durand, Ann. Mycol. 6: 440 (1908) FIG. 2
ASCOCARPS 30-80 mm long and 5-7 mm thick, spathulate to ligulate, with a
median groove and obtuse apex, black to brownish black, densely setose. STIPE
3-6 mm thick, setose, concolorous with the ascogenous portion. Asc1 150-220
x 14-19 um, cylindrical to somewhat clavate, 8-spored, apical pore becoming
blue in Melzer’s solution. PARAPHYSES septate, generally curved and thickened
at the apex <8 um. Ascospores (70-)80-110(-120) x 5-6.5 um, subcylindrical
to fusiform, narrower below, generally with 7-8 septa, some 4-septate or
aseptate when immature, brown to blackish brown. HYMENIAL SETAE 90-130 x
6-9 um, thick-walled, straight, not forked, dark-brown to black-brown.
Spathularia nigripes & Trichoglossum walteri new to Turkey ... 233
SPECIMEN EXAMINED—TURKEY, Konya: Eregli, Tasagil Village, 37°30’N 33°5’E, 1015
m, on soil under Salix and Populus near a puddle, 09.12.2017, Y. Uzun 6019 (KMU).
ComMENTS— Trichoglossum walteri is morphologically similar to T: hirsutum,
T. octopartitum Mains, and T: variabile. The ascospores of T: hirsutum and
T. variabile are slightly longer and have more septa (9-15). The spores of
Trichoglossum octopartitum are, like those of T. walteri, 7-septate but longer
(101-125(-138) (Kucera & al. 2010).
Mains (1954) reports T: walteri on soil and rotting wood in North America,
while Placido Iglesias (2007) collected it in wet mossy soil areas in Spain.
Acknowledgments
The author would like to thank Dr. Ali Keles (Yuziincii Yil University, Van, Turkey),
Prof. Dr. Ibrahim Tirkekul (Tokat Gaziosmanpasa University, Tokat, Turkey), and
Dr. Shaun Pennycook for their helpful comments and careful review.
Literature cited
Acar I, Uzun Y, Keles A, Dizkirici A. 2019. Suillellus amygdalinus, a new species record
for Turkey from Hakkari Province. Anatolian Journal of Botany 3(1): 25-27.
https://doi.org/10.30616/ajb.514778
Akata I, Kaya A. 2013. Two earth-tongue genera new for Turkey. Mycotaxon 125: 87-90.
https:// doi.org/10.5248/125.87
Akcay ME. 2019. A new edible macrofungus record for Turkey. Journal of Natural & Applied
Sciences of East 2(1): 10-15.
Bessette AE, Roody WC, Bessette AR, Dunaway DL. 2007. Mushrooms of the Southeastern
United States. Syracuse University Press, Syracuse, New York. 192 p.
Breitenbach J, Kranzlin F. 1984. Fungi of Switzerland, Vol. 1. Lucerne: Verlag Mykologia.
Cacialli G, Cipollone F, Doveri F. 1992. Un sorprendente ritrovamento nel Parco di S. Rossore:
Spathularia nigripes. Rivista di Micologia 35(1): 53-56.
Fernandez Vicente J, Undagoitia J. 2004. Pulvinula ovalispora Boud., Arpinia luteola Gees.
var. pallidorosea Benk. Haff. & Hohm., Scutellinia torrentis (Rehm) Schum. y Spathularia
nigripes (Quél.) Sacc. en GPN y listado de Ascomicetos (II) en el Parque Natural del Gorbeia
(GPN). Errotari 1: 56-69.
Geesteranus RAM. 1965. Geoglossaceae of India and adjacent countries. Persoonia 4(1): 19-46.
Giingor H, Sen I, Alli H, Solak MH. 2015a. Two new ascomycete records for Turkish Mycota.
Biological Diversity and Conservation 8(1): 19-21.
Giingor H, Colak OF, Yaratanakul Giingér M, Solak MH. 2015b. New Ascomycete (Geoglossum
umbratile, Peziza lobulata) records for Turkey. Biological Diversity and Conservation
8(2): 1-3.
Index Fungorum. 2019. http://www. indexfungorum.org/Names/Names.asp. Accessed 30
August 2019.
Isik H, Tiirkekul I. 2018. A New Record for Turkish Mycota from Tokat Province: Arachnopeziza
aurelia (Pers.) Fuckel. The Journal of Fungus 9(1): 54-57.
Kaya A, Uzun Y. 2018. New Contributions to the Turkish Ascomycota. Turkish Journal of
Botany 42(5): 644-652. https://doi.org/10.3906/bot-1712-1
234 ... Uzun
Kaya A, Uzun Y, Karacan IH, Yakar S. 2016. Contributions to Turkish Pyronemataceae from
Gaziantep Province. Turkish Journal of Botany 40(3): 298-307. doi:10.3906/bot- 1508-4
Keles A. 2019. Mycena ustalis, a new record for the mycobiota of Turkey. Anatolian Journal of
Botany 3(1): 18-20. https://doi:10.30616/ajb.514124
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi. 10th ed.
Wallingford, UK: CAB International.
Kuéera V, Lizon P, Kautmanova I. 2010. Geoglossoid fungi in Slovakia I. Trichoglossum
octopartitum, a new species for the country. Czech Mycology 62(1): 13-18.
Mains EB. 1954. North American species of Geoglossum and Trichoglossum. Mycologia 46(5):
586-631.
Mycohellas. 2019. Spathularia nigripes. http://www.mycohellas.gr/mc/viewarticle.asp?a=856.
Accessed 30 August 2019.
Placido Iglesias J. 2007. Geoglossaceae-Parte II Trichoglossum hirsutum y Trichoglossum walteri.
Boletin Micolégico de FAMCAL 2: 47-50.
Requejo O. 2010. Una nueva cita de Spathularia nigripes (Quél.) Sacc. para el N.O. de la
peninsula Ibérica. Yesca 22: 36-38.
Ribes MA, Negrin R, Quijada L, Beltran-Tejera E. 2015. Contribucién al conocimiento de la
micobiota de las Islas Canarias (Espafia) IV. Ascomycetes. Ascomycete.org 7(6): 375-393.
Sadullahoglu C, Demirel K. 2018. Flammulina fennae Bas, A new record from Karz Mountain
(Bitlis). Anatolian Journal of Botany 2(1): 19-21. https://doi:10.30616/ajb.348740
Sandras M, Hairaud M. 2007. Découverte de Spathularia nigripes (Quél.) Sacc. en forét de La
Coubre (Charente-Maritime). Bulletin de la Société mycologique du Massif d’'Argenson
25: 47-48.
Sesli E, Denchev CM. 2014. Checklists of the myxomycetes, larger ascomycetes, and larger
basidiomycetes in Turkey. 6th ed. Mycotaxon Checklists Online. 136 p.
(http://www.mycotaxon.com/resources/checklists/sesli-v106-checklist.pdf)
Sesli E, Antonin V, Contu M. 2018. A new species of Hygrophorus, H. yadigarii sp. nov.
(Hygrophoraceae), with an isolated systematic position within the genus from the Colchic
part of Turkey. Turkish Journal of Botany 42(2): 224-232. doi:10.3906/bot-1706-64
Solak MH, Isiloglu M, Kalmus E, Alli H. 2015. Macrofungi of Turkey, Checklist, Vol. 2. Izmir,
Turkey: Universiteliler Ofset [in Turkish].
Uzun Y, Kaya A. 2019a. New additions to Turkish Pezizales from the East Black Sea Region.
Turkish Journal of Botany 43(2): 262-270. https://doi.org/10.3906/bot- 1802-34
Uzun Y, Kaya A. 2019b. Onygena, a new ascomycete genus record for Turkey. KSU Journal of
Agriculture and Nature 22(suppl. 1): 105-108.
Uzun Y, Yakar S, Karacan [H, Kaya A. 2018. New additions to the Turkish Pezizales. Turkish
Journal of Botany 42(3): 335-345. https://doi.org/10.3906/bot-1708-11
Vidal J. 1994. Spathularia nigripes. Bolets de Catalunya, Col.leccié XIII. Lamina nim. 645.
Societat Catalana de Micologia.
MYCOTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 235-247
https://doi.org/10.5248/136.235
Clitocybula azurea in Argentina:
redescription and phylogenetic position
Nico.As NIVEIRO’», MELISA ALBERTI’,
NATALIA A. RAMIREZ’, EDGARDO O. ALBERTO?
' Instituto de Botanica del Nordeste, IBONE (UNNE-CONICET),
Facultad de Ciencias Exactas y Naturales y Agrimensura,
Universidad Nacional del Nordeste (FACENA-UNNE),
Sargento Cabral 2131, CC 209 Corrientes Capital, CP 3400, Argentina
? Instituto Tecnologico de Chascomus, IIB-INTECH (UNSAM-CONICET),
Intendente Marino Km 8.2, CP 7130, Chascomus, Buenos Aires, Argentina
“CORRESPONDENCE TO: [email protected]
ABSTRACT—Clitocybula azurea, which was described by Singer in 1973 from Brazil and
Venezuela, is characterized by its bluish to grayish blue tinges, narrow lamellae, cespitose and
lignicolous habit, and small, amyloid, subglobose basidiospores. However, despite its striking
coloration, the species is not described or illustrated in recent literature. The species is here
redescribed and illustrated, its distribution extended to Argentina, and its phylogenetic
position analysed.
Key worps—Agaricales, Atlantic forest, ITS, Marasmiaceae, mushroom, taxonomy
Introduction
Clitocybula Métrod is a phylogenetically well-defined genus, related to
other genera of the hydropoid clade (Matheny & al. 2006), also including
Megacollybia Kotl. & Pouzar, Hydropus Kihner ex Singer, Trogia Fr.,
Gerronema Singer, Porotheleum Fr., Leucoinocybe Singer ex Antonin & al., and
Lignomphalia Antonin & al. (Antonin & al. 2019). It is a small genus, with
c. 15 species (Antonin & al. 2019), with a wide morphological diversity and
exhibiting small clitocyboid, omphalioid, collybioid, mycenoid or pleurotoid
habits (Singer 1962, Bigelow 1973, Antonin & al. 2019). Barrasa & al. (2006)
236 ...Niveiro & al.
defined Clitocybula based on five main characteristics: the radially fibrillose
to squamulose pileus surface; the absence of a cellular hypoderm and
pleurocystidia [except for their occasional presence as in C. azurea (Singer
1962)]; the presence of cheilocystidia and dermatocystidia; amyloid smooth
basidiospores; and lignicolous habit. Clitocybula is restricted to the temperate
regions of both hemispheres (Singer 1986, Latha & al. 2015), plus several
tropical-subtropical species, e.g., C. azurea and C. cyanocephala (Pat.) Singer
from the neotropics (Singer 1973), C. omphaliiformis Pegler from Africa
(Pegler 1977), C. canariensis Barrasa & al. from Canary Islands (Barrasa &
al. 2006), and C. sulcata K.N.A. Raj & Manim. from India (Latha & al. 2015).
Because of the absence of the recent description and illustration in the
literature, the aim of this work is to re-describe and illustrate Clitocybula
azurea based on new collections, expand its distribution area, and analyze its
phylogenetic position.
Materials & methods
Morphological studies
The specimens were collected in Misiones province, Argentina, and they
were photographed and described macroscopically in situ, and then analyzed
morphologically and identified following the criteria and terminology proposed by
Vellinga (1988) and Lodge & al. (2004). The color terminology follows Kornerup &
Wanscher (1978). Tissues were cut by hand and mounted in a solution of 5% KOH
(v/w) with 1% floxin aqueous solution for microscopical examination. Melzer’s
reagent (Wright & Alberté 2002) was used to verify amyloid reaction. The microscopic
structures were measured directly with 1000x immersion objective or through
photographs taken with a Leica EC3 built-in camera using ImageJ software (Schneider
& al. 2012). The notation L = refers to the number of true lamellae (ranging from the
stipe insertion to the margin of pileus) counted at the pileus margin. The minimum-
maximum intervals were provided for the different microscopic structures. For
basidiospores, n = indicates the number of basidiospores measured, x = the average
value, Q = length:width ratio, and Qx = mean value of Q. Nomenclatural authorities
follow Index Fungorum (2020); herbarium acronyms follow Thiers (2020). The
collected specimens were dried, frozen for a week, and conserved in the Herbarium,
Instituto de Botanica del Nordeste, Corrientes, Argentina (CTES).
DNA extraction, amplification, and sequencing
DNA isolation from small parts of fungal tissue, polymerase chain reaction (PCR)
amplification, and sequencing of PCR products were performed through the Barcode
of life Project following protocols in Ivanova & al. (2008) and Ivanova & Grainger
(2006). The nuclear ribosomal internal transcribed spacer region (ITS) was amplified
using the basidiomycete specific primer set: ITS1-F (CTTGGTCATTTAGAGGAAGTAA)
Clitocybula azurea in Argentina...
TABLE 1: Sequences of species of Clitocybula and related genera, with Baeospora
myosura as outgroup, used in the phylogenetic analyses.
Sequences obtained in this study are in bold.
237
SPECIES SPECIMEN VOUCHER ORIGIN ITS REFERENCE
Baeospora myosura AFTOL-ID 1799 USA DQ484063 Matheny & al. 2006
C. atrialba AFTOL-ID 1529 USA DQ192179 Curtis & al. unpubl.
C. azurea Alberti ADA015-17 Argentina MT009482 This work
Niveiro 3173 Argentina MT009483_ This work
C. familia BRNM 736053 Czechia JF730328 Antonin & al. 2011
X21 Czechia LN714532 —-Vétrovsky & al. 2016
C. aff. lacerata GRSM77072 USA FJ596916 Hughes & al. 2009
C. lacerata PRM:951559 (Neotype) Czechia MK713541 Antonin & al. 2019
LE6639 Russia HM191746 Malysheva & al. 2011
LE262744 Russia HM191747 Malysheva & al. 2011
16837 USA JF908760 Garbelotto & al. unpubl.
C. oculus PRM 934963 USA LT854020 Antonin & al. 2019
BIOUG24046-E05 Canada KT695404 Telfer & al. 2015
3512 Canada KM406971 Berube & al. unpubl.
BIOUG24046-B03 Canada KT695321 Telfer & al. 2015
LIP (Moreau CAN 13-50) Canada LT854017. ~—- Antonin & al. 2019
PBM 1156 (WTU) USA DQ192178 Curtis & al. unpubl.
Clitocybula sp. TENN60306/TFB12058 USA EU623637 Hughes & al. 2007
Lignomphalia lignicola LE262727 Russia HM191731 Malysheva & al. 2011,
(as C. lignicola) Antonin & al. 2019
LE6625 Russia HM191732 Malysheva & al. 2011,
Antonin & al. 2019
Leucoinocybe taniae D Italy HM191743 Malysheva & al. 2011,
(as C. flavoaurantia) Antonin & al. 2019
GDOR (Type) Italy HM191744 Malysheva & al. 2011,
Antonin & al. 2019
Megacollybia marginata LE 202274 Russia EU623688 Hughes & al. 2007
HR 90203 Czechia LT854047 Antonin & al. 2019
M. clitocyboidea TENN062231 (Type) Japan NR119690 Hughes & al. 2007
HMJAU4024/TENN62230 China EU623670 Hughes & al. 2007
Trogia infundibuliformis KUN HKAS56709 China JQ031776 Yang & al. 2012
KUN HKAS63661 China JQ031775 Yang & al. 2012
T. venenata KUN HKAS54710 China JQ031772 Yang & al. 2012
KUN HKAS56679 China JQ031773 Yang & al. 2012
238 ...Niveiro & al.
and ITS4-B (CAGGAGACTTGTACACGGTCCAG) (Gardes & Bruns 1993). The PCR
products were sequenced in the Canadian Centre for DNA Barcoding (CCDB),
Canada.
Molecular phylogeny
The dataset was compiled using our data (MT009482, MT009483) and 28
sequences selected from GenBank based on BLAST results and previous works
(Malysheva & al. 2011, Antonin & al. 2019); Baeospora myosura (Fr.) Singer was
selected as outgroup (TABLE 1). Sequence editing was done in BioEdit 7.2.5 (Hall
1999). Sequences were aligned by MAFFT 7 (Katoh & Standley 2013) under the
Q-INS-i criteria. When necessary, the alignment was manually adjusted with
MEGA 5 (Tamura & al. 2011). Potential ambiguously aligned segments of ITS1-
ITS2 were detected by Gblocks 0.91b (Castresana 2000).
Phylogenetic reconstruction was inferred using Maximum Likelihood (ML)
and Bayesian Inference (BI) separately. Maximum Likelihood was carried out
in RaxML-HPC v.8 (Stamatakis 2014), searching for the best scored trees with
GTRGAMMA model for the entire dataset with all the default parameters estimated
by the software. The analysis first involved 100 ML searches, each starting from one
randomized stepwise addition parsimonious tree. Only the best scored ML tree
was kept, and the confidence of nodes was accessed through Rapid bootstrapping
(BS).
Bayesian Inference (BI) was performed in MrBayes 3.2.6 (Ronquist & al. 2012).
The evolutionary models for BI were estimated using the Akaike Information
Criterion (AIC), as implemented in jModelTest2 v.1.6. (Guindon & Gascuel 2003,
Darriba & al. 2012), and implemented with two independent runs, each beginning
from random trees with four simultaneous independent chains. A total of 2x10’
generations were carried out, sampling one tree every 1x 10° generations.
Only the BI tree is shown, indicating support values (BPP/BS) at each node. A
node was considered to be strongly supported if it showed a BPP 20.95 and/or BS
>90%, while moderate support was considered BPP 20.70 and/or BS =70%.
Results
Phylogenetic analysis
The original dataset comprised 30 taxa and 1562 positions. The Gblocks
curated dataset comprised 540 positions, of which 320 were constant, 220
variable, and 183 parsimony informative. The best substitution model was
estimated as: TPM3uf+G. The resulting BI tree agreed with the ML analysis.
Five well-defined clades were recovered from all analyses: Leucoinocybe
(1/100), Lignomphalia (1/100), Megacollybia (1/100), Trogia (0.77/-), and
Clitocybula (0.98/70). Baeospora myosura was used as outgroup. Clitocybula
azurea sequences grouped closely with C. familia (0.78/-). The Clitocybula
clade includes a second subclade formed by C. lacerata and C. oculus (Fie. 1).
1/100
1/100
0,99/92
Clitocybula azurea in Argentina ...
HM191743 Le. taniae
| Leucoinocybe
HM191744 Le. taniae
HM191732 Li. lignicola
Lignomphalia
HM191731 Li. lignicola
DQ192179 C. atrialba
4/00 EU623688 M. marginata
4/100 LT854047 M. marginata
enn Megacollybia
NR119690 M. clitocyboidea
oadieo 0.99/83 0.97/00 L_ £y623670 M. clitocyboidea
4/100 JQ031776 T. infundibuliformis
JQ031775 T. infundibuliformis z
0,7/- Trogia
1193 JQ031772 T. venenata
JQ031773 T. venenata
4197 EU623637 Clitocybula sp.
FJ596916 C. aff. lacerata
0,96/-
MK713541 C. lacerata
41194 HM191746 C. lacerata
a
0.99/10 HM191747 C. lacerata
JF908760 C. lacerata
KT695404 C. oculus
KM406971 C. oculus 7
181 Clitocybula
DQ192178 C. oculus
0,98/70 1/100 KT695321 C. oculus
LT854017 C. oculus
LT854020 C. oculus
4/100 JF730328 C. familia
LN714532 C. familia
0,78/-
4100 MT009482 C. azurea
MT009483 C. azurea
DQ484063 Baeospora myosura
0.06
Fic. 1: Molecular phylogeny of species of Clitocybula and related genera, with Baeospora myosura
as outgroup, carried out by Bayesian Inference based on dataset of ITS sequences. Bayesian
posterior probabilities BPP =0.7, and Bootstrap values BS >70% are shown.
Taxonomy
Clitocybula azurea Singer, Beihefte zur Sydowia 7: 18 (1973). Fries 2-4
BASIDIOMATA gregarious, in small clusters or densely cespitose,
xylophagous. PrLEus <20 mm broad, plano-convex to convex with undulate
margin when young, then broadly conical, finally convex with acute papilla;
thin and delicate, distinctly hygrophanous, dark blue (22F5-8) when young,
then dark turquoise (24F6-8) to dark green (26F5-8), striate with greyish
(23A2 “bluish white’, to 26A2 “greenish white”) lines radiating from the
pileus center, finally white with a slight greenish hue, greyish turquoise
(24D5) to greyish green (26D5) on the disc to completely white (1A1) to
greenish-white (25A2) towards margin, dry, innately fibrillose; margin
239
240 ...Niveiro & al.
Fic. 2: Clitocybula azurea (Alberti ADA015-17), young specimens. A. General aspect; B. Habit
and basidioma detail; C. Pileus and stipe surface detail. Scale bars: A = 10 cm; B, C= 1 cm.
straight to wavy. CONTEXT thin, concolorous with the pileus surface, odor
and taste indistinct. LAMELLAE subfree to adnate, very narrow (<0.5 mm),
crowded to close (2-3 L/mm), dark blue when young, turning whitish,
Clitocybula azurea in Argentina ... 241
Fic. 3: Clitocybula azurea, mature specimens. A, B. General aspect, habit, and detail of whitish
basidioma (Niveiro 3165); C. Basidioma detail of an intermediate state (Niveiro 3134).
Scale bars: A = 10 cm; B, C = 1 cm.
with even concolorous edge; with two ranks of lamellulae. Stipe central,
10-40(-60) x 3-8 mm, cylindrical, equal or slightly narrowing towards the
apex, hollow, surface concolorous with the pileus surface, fibrillose, dry,
242 ...Niveiro & al.
$e |
r il
eck, Fi
Fic. 4: Clitocybula azurea (Niveiro 3165). A. Basidiospores; B. Basidia and _basidioles;
C. Cheilocystidia; D. Pleurocystidia; E. Pileocystidia; F Caulocystidia. Scale bar = 10 um.
with a white (1A1) basal mycelial patch. ANNULUS absent. SPORE-PRINT not
observed, presumably white.
BASIDIOSPORES 4-6.5 x 3-5 um, X = 5.2 x 4.2 um, Q = 1.04-1.44, Qx =
1.23, n = 25; subglobose in frontal view, broadly ellipsoid in side-view, with
ventral side plane, without a suprahilar depression, amyloid, hyaline, smooth,
thin-walled. Basip1a 16-23(-28) x 4-6 um, clavate, 4-spored, hyaline, thin-
walled. BASIDIOLES 15-20 x 4-8 um, clavate, thin-walled. CHEILOCYSTIDIA
and PLEUROCYSTIDIA 18-30 x 3.5-8 um, versiform, cylindrical, clavate,
utriform, with apical papilla or subcapitate, scattered and inconspicuous in
young specimens, more visible in mature specimens. HYMENOPHORAL TRAMA
subregular; hyphae 2.5-6 um diam, thin-walled, inamyloid. PILEIPELLIS
Clitocybula azurea in Argentina ... 243
a cutis made up of prostrate, more or less parallel hyphae; hyphae 2.5-7
um diam, smooth, inamyloid, thin-walled, with pileocystidia as terminal
elements. PILEOCysTIDIA broadly clavate to subglobose, 7-10 x 5-8 um, with
3-5 filamentous excrescences of 12-22 x 1.5-2.5 um. STIPITIPELLIS a cutis
made up of smooth, 3-6 um diam hyphae. CAULOCYSTIDIA 27-39.5(-47)
x 6.5-14 um, cylindrical to clavate, occasionally with 2-3 lobes at the apex,
either concentrated in scattered fascicles or scattered and solitary, the latter
in general cylindrical and smaller (27-33 x 6.5-9 um) than those grouped in
fascicles. CLAMP CONNECTIONS present.
EcoLocy—Growing on decaying wood, logs, and stumps of gymnosperms
and angiosperms. Caespitose, forming groups of numerous (c. 10) to very
abundant (60-90) basidiomes.
DIsTRIBUTION—Known from Brazil (Sao Paulo State, type locality) and
Venezuela (Bolivar State) (Singer 1973); Jamaica and Costa Rica (GBIF
2020); and Argentina (Misiones Province).
SPECIMENS EXAMINED—ARGENTINA, Misiones: Gral. Belgrano, San Antonio,
Campo Anexo Manuel Belgrano (CAMB-INTA) 26°02’12”S 53°47’23”W, 822 ma.s.l.,
in forestation of Araucaria angustifolia (Bertol.) Kuntze, with understory of Alsophila
setosa Kaulf., 23/03/2017, leg. Niveiro 3159 (CTES); leg. Niveiro 3165 (CTES); leg.
Niveiro 3173 (CTES: GenBank MT009483); leg. Alberti ADA015-17 (CTES; GenBank
MT009482); in forestation of Araucaria angustifolia behind CAMB, 26°03’08”S
53°46'14”W, 23/03/2017, leg. N. Niveiro 3134 (CTES).
COMMENTS—Clitocybula azurea is characterized by its bluish to grayish blue
tinges, the narrow lamellae, the cespitose and lignicolous habit, and the small,
amyloid, subglobose basidiospores. Only two Clitocybula species with bluish
coloration are known: C. cyanocephala and C. azurea, both known from
the neotropics (Singer 1979). Clitocybula cyanocephala differs by its broad
lamellae and larger basidiospores (5.5-6.5 x 4.5-5 um) (Singer 1979). The
Argentinean C. azurea specimens have slightly larger basidiospores (4—-6.5
x 3-5 um) than those described by Singer (1979) (3-4.5 um broad), making
the delimitation between both species more difficult due to the partial
overlapping spore ranges. However, the character of the lamellae (narrow
and crowded to close in C. azurea vs. broad and subclose to medium distant
in C. cyanocephala) is enough to distinguish the two species.
Pegler (1983), recombined Clitocybula cyanocephala as Calocybe
cyanocephala (Pat.) Pegler, because he did not observe amyloid basidiospores
in either the type material or new specimens from the Lesser Antilles.
Another Clitocybula species that resembles C. azurea in its caespitose and
mycenoid habit is C. familia (Peck) Singer, which differs by its beige-brown
244 ...Niveiro & al.
pileus with an olivaceous grey tinge (and lacking grayish blue tinges) when
fresh (Antonin & al. 2011).
Microscopically similar species are C. abundans (Peck) Singer and C. oculus
(Peck) Singer, with morphologically similar basidiospores, cheilocystidia, and
caulocystidia (Bigelow 1973, Antonin & al. 2011, 2019). However, these species
are easily separated by their macroscopic characters: C. abundans has a whitish
pileus, often with a darker to fuscous center (Bigelow 1973, Antonin & al.
2019), and in addition to a similar coloration to C. abundans, C. oculus has a
squamulose stipe (Bigelow 1973).
Mycena interrupta (Berk.) Sacc. [= M. cyanocephala Singer] is a bluish species
know from the temperate region of southern hemisphere (Singer 1969, Horak
1983, Gates & Ratkowsky 2014) that macroscopically resembles C. azurea
differs in its larger basidiospores (9-12 x 6-8 um), diverticulate cheilocystidia,
and pseudoamyloid trama (Horak 1980).
Discussion
Clitocybula is a small genus with a wide morphological diversity and is
phylogenetically well-defined. Our study, as well as those by Malysheva &
al. (2011) and Antonin & al. (2019), indicates that Clitocybula s.l. should
be divided into more genera such as Lignomphalia and Leucoinocybe. The
addition of the Argentinean C. azurea specimens reinforces Clitocybula as a
well-defined genus.
Within Clitocybula, Antonin & al. (2019) showed that C. familia is
related to C. oculus and C. lacerata (Scop.) Métrod as another related clade.
However, adding C. azurea to the analysis divides these four species into
two main clades: Clitocybula azurea with C. familia, moderately supported
(BPP = 0.78); and C. oculus with C. lacerata, unsupported (Fic. 1). Further
analyses are necessary (including species not yet sequenced), to fully
resolve the relationships among these species. Unfortunately, there are no
available sequences of the other bluish, morphologically similar species,
C. cyanocephala to confirm whether these are related to each other or even to
all other mycenoid Clitocybula species.
Acknowledgments
The authors wish to thank Vladimir Antonin (Moravian Museum, Brno, Czechia)
and Bernardo E. Lechner (InMiBo, UBA-CONICET, Buenos Aires, Argentina)
for critical revision of the manuscript, Sebastian Metz (INTECH, Chascomus,
Argentina) for his advice on phylogenetic analysis and Andrea Michlig (IBONE,
UNNE-CONICET, Corrientes, Argentina) for the first revision of the manuscript.
Clitocybula azurea in Argentina ... 245
This research was possible by the support of the Consejo Nacional de Investigaciones
Cientificas y Técnicas (CONICET) from Argentina (PIP 2014-0714); the Secretaria
General de Ciencia y Técnica, Universidad Nacional del Nordeste (SGCyT-UNNE -
PI15-P003); and the Agencia Nacional de Promocioén Cientifica y Tecnolégica (PICT
2016-2529). The authors also thank the Instituto Nacional de Tecnologia Agropecuaria
(INTA) for allowing us to sample in their experimental plantations and the Ministerio
de Ecologia y Recursos Naturales Renovables of the Misiones Province for providing
collection permits.
Literature cited
Antonin V, Beran M, Borovicka J, Dvorak D. Holec J. 2011. Clitocybula familia (Fungi,
Agaricales) —- taxonomy, distribution, ecology and first records in the Czech Republic and
Slovakia. Czech Mycology 63(1): 1-11. https://doi.org/10.33585/cmy.63101
Antonin V, Borovicka J, Holec J, Piltaver A, Kolarik M. 2019. Taxonomic update of
Clitocybula sensu lato with a new generic classification. Fungal Biology 123: 431-447.
https://doi.org/10.1016/j.funbio.2019.03.004
Barrasa JM, Esteve-Raventés F, Dahncke RM. 2006. Clitocybula canariensis (Tricholomataceae),
a new brown-rot fungus from the Canary Islands (Spain). Fungal Diversity 22: 1-11.
Bigelow HE. 1973. ‘The genus Clitocybula. Mycologia 65(5): 1101-1116.
https://doi.org/10.2307/3758291
Castresana J. 2000. Selection of conserved blocks from multiple alignments for their
use in phylogenetic analysis. Molecular Biology and Evolution 17: 540-552.
https://doi.org/10.1093/oxfordjournals.molbev.a026334
Darriba D, Taboada GL, Doallo R, Posada D. 2012. jModelTest 2: more models, new heuristics
and parallel computing. Nature Methods 9: 772. https://doi.org/10.1038/nmeth.2109
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity of basidiomycetes:
application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
https://doi.org/10.1111/j.1365-294X.1993.tb00005.x
Gates G, Ratkowsky D. 2014. A field guide to Tasmanian fungi. Monotone Art Printers, Hobart,
249 p.
GBIF. 2020. Clitocybula azurea Singer. https://www.gbif.org/species/3320440 [Accessed 4
February 2020].
Guindon S, Gascuel O. 2003. A simple, fast and accurate algorithm to estimate
large phylogenies by maximum likelihood. Systematic Biology 52: 696-704.
https://doi.org/10.1080/10635 150390235520
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.
Horak E. 1980 [“1979”]. Fungi Basidiomycetes. Agaricales y Gasteromycetes secotioides. Flora
Criptogamica de Tierra del Fuego 11(6). 528 p.
Horak E. 1983. Mycogeography in the South Pacific region: Agaricales, Boletales. Australian
Journal of Botany, Supplementary Series 10: 1-41.
Hughes KW, Petersen RH, Mata JL, Psurtseva N, Kovalenko AE & al. 2007. Megacollybia
(Agaricales). Kinjin Kenkyusho Kenkyu Hokoku 45: 1-57.
Hughes KW, Petersen RH, Lickey EB. 2009. Using heterozygosity to estimate a percentage DNA
sequence similarity for environmental species delimitation across basidiomycete fungi.
New Phytologist 182(4): 795-798. https://doi.org/10.1111/j.1469-8137.2009.02802.x
246 ...Niveiro & al.
Index Fungorum. 2020. Authors of fungal names. {Accessed April 2019:
http://www.indexfungorum.org/Names/names.asp ].
Ivanova NV, Grainger C. 2006. Pre-made frozen PCR and sequencing plates. Canadian Center
for DNA Barcoding Advances: Methods Release 4.
Ivanova NV, Fazekas AJ, Hebert PDN. 2008. Semi-automated, membrane-based protocol
for DNA isolation from plants. Plant Molecular Biology Reporter 26: 186-198.
https://doi.org/10.1007/s11105-008-0029-4
Katoh K, Standley DM. 2013. MAFFT Multiple sequence alignment software version 7:
improvements in performance and usability. Molecular Biology and Evolution 30: 772-780.
https://doi.org/10.1093/molbev/mst010
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour, Eyre Methuen Publishers,
London. 252 p.
Latha KPD, Raj KNA, Sharafudheen SA, Manimohan P. 2015. Clitocybula sulcata—a new
species from India. Phytotaxa 208: 63-69. https://doi.org/10.11646/phytotaxa.208.1.6
Lodge DJ, Ammirati JE, O’Dell TE, Mueller GM, Huhndorf SM & al. 2004. Terrestrial
and lignicolous macrofungi. 127-172, in: GM Mueller & al. (eds). Biodiversity of
fungi, inventory and monitoring methods. Elsevier Academic Press, San Diego.
https://doi.org/10.1016/B978-012509551-8/50011-8
Malysheva EF, Morozova OV, Contu M. 2011. New combinations in Clitocybula: a study of
cystidiate Pseudoomphalina species (Basidiomycota, Agaricomycetes). Sydowia 63: 85-104.
Matheny PB, Curtis JM, Hofstetter V, Aime MC, Moncalvo JM & al. 2006. Major
clades of Agaricales: a multilocus phylogenetic overview. Mycologia 98(6): 982-995.
https://doi.org/10.1080/15572536.2006.11832627
Pegler DN. 1977. A preliminary agaric flora of East Africa. Kew Bulletin Additional Series 6.
615 p.
Pegler DN. 1983. Agaric flora of the Lesser Antilles. Kew Bulletin Additional Series 9. 668 p.
Ronquist F, Teslenko M, Van der Mark P, Ayres DL, Darling A & al. 2012. MrBayes 3.2: efficient
Bayesian phylogenetic inference and model choice across a large model space. Systematic
Biology 61: 539-542. https://doi.org/10.1093/sysbio/sys029
Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH image to ImageJ: 25 years of image
analysis. Nature Methods 9(7): 671-675. https://doi.org/10.1038/nmeth.2089
Singer R. 1962 [“1961”]. Diagnoses fungorum novorum agaricalium II. Sydowia 15: 45-83.
Singer R. 1969. Mycoflora australis. Beihefte zur Nova Hedwigia 29. 405 p.
Singer R. 1973. Diagnoses fungorum novorum agaricalium III. Beihefte zur Sydowia 7. 106 p.
Singer R. 1979 [“1978”]. Keys for the identification of the species of Agaricales II. Sydowia 31:
193-237
Singer R. 1986. The Agaricales in modern taxonomy. 4th ed. Koeltz Scientific Books,
Koenigstein. 981 p.
Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large
phylogenies. Bioinformatics 30: 1312-1313. https://doi.org/10.1093/bioinformatics/btu033
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS: molecular
evolutionary genetics analysis using Maximum Likelihood, evolutionary distance,
and maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739.
https://doi.org/10.1093/molbev/msr121
Telfer AC, Young MR, Quinn J, Perez K, Sobel CN & al. 2015. Biodiversity inventories in
high gear: DNA barcoding facilitates a rapid biotic survey of a temperate nature reserve.
Biodiversity Data Journal 3: e6313. https://doi.org/10.3897/BDJ.3.e6313
Clitocybula azurea in Argentina ... 247
Thiers B. 2020. Index herbariorum: a global directory of public herbaria and associated staff.
New York Botanical Garden's Virtual Herbarium. http://sweetgum.nybg.org/ih/. [accessed
April 2019].
Vellinga EC. 1988. Glossary. 54-64, in: C Bas C & al. (eds). Flora agaricina neerlandica, vol. 1.
A.A. Balkema Publisher, Rotterdam.
Vétrovsky T, Kolatik M, Zifcakova L, Zelenka T, Baldrian P. 2016. The rpb2 gene represents a
viable alternative molecular marker for the analysis of environmental fungal communities.
Molecular Ecology Resources 16(2): 388-401. https://doi.org/10.1111/1755-0998.12456
Wright JE, Alberté EO. 2002. Guia de hongos de la regidn pampeana I. Hongos con laminillas.
Literature of Latin America (LOLA), Buenos Aires. 278 p.
Yang, Z.L., Li, Y.C., Tang, L.P., Shi, G.Q., Zeng, G., 2012. Trogia venenata (Agaricales), a novel
poisonous species which has caused hundreds of deaths in southwestern China. Mycological
Progress 11: 937-945. https://doi.org/10.1007/s11557-012-0809-y
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2021
January-March 2021—Volume 136, pp. 249-259
https://doi.org/10.5248/136.249
Gerronema nemorale:
first report of the genus and species from Pakistan
FAUZIA AQDUS”* & ABDUL NASIR KHALID
Department of Botany, University of the Punjab,
Quaid-e-Azam Campus-54590, Lahore, Pakistan
“ CORRESPONDENCE TO: [email protected]
ABSTRACT—Basidiomata of a Gerronema species, collected in Murree, Punjab, Pakistan,
have been confirmed as G. nemorale by morphological and ITS1-5.8S-ITS2 rDNA sequence
analyses. This is the first report of the genus Gerronema from Pakistan, and the first record of
G. nemorale for the South Asian region.
Key worps—Agaricales, Agaricomycetes, Basidiomycota, lignicolous agarics, sarcodimitic
Introduction
Gerronema Singer (Agaricales, Basidiomycota) was created by Singer
(1951) to accommodate three omphalinoid-clitocyboid species from South
America. The addition of several additional species (Singer 1961, 1964, 1975,
1986) caused it to be regarded as heterogeneous by many other authors.
Molecular phylogenetic analysis by Lutzoni (1997) using combined nrITS and
nrLSU datasets suggested that Gerronema was polyphyletic. Redhead (1986)
restricted Gerronema to species with sarcodimitic tissues; including the type,
G. melanomphax Singer. Norvell & al. (1994) limited Gerronema to species
with a lignicolous habitat, thin-walled basidiospores, and sarcodimitic tissues.
Gerronema in this restricted sense is monophyletic and falls in the /hydropoid
clade (Moncalvo & al. 2002; Antonin & al. 2008).
Gerronema as recently accepted is a genus of small- to medium-sized
white-spored lignicolous agarics with decurrent gills, inamyloid thin-walled
basidiospores, and sarcodimitic tissues (Norvell & al. 1994). The genus has a
250 ... Aqdus & Khalid
primarily tropical distribution but is also found in Europe and eastern North
America where it produces basidiomata during hot, muggy summer weather
(Norvell & al. 1994; Redhead & al. 2002). The genus is represented by 125
species worldwide (www.speciesfungorum.org, accessed on 27 December
2020).
During a routine macrofungal survey, specimens were found which
resembled Gerronema. Detailed morphological and ITS sequence analyses
were performed to identify the specimens to species.
Material & methods
Sampling site
Murree, an important Himalayan hill station (33.35°N 73.27°E, 2290 m asl) lies
50 km northeast of Islamabad (the capital of Pakistan) in the Himalayan foothills
(murreehill.com/introduction.html). The subtropical monsoon climate has an annual
precipitation of c. 1800 mm, with the maximum precipitation occurring in July and
August (World Weather Information Service 2020).
Pinus roxburghii Sarg. dominates the forest regions near Murree, with P. wallichiana
A.B. Jacks. found at the higher elevations. Abies pindrow (Royle ex D. Don) Royle,
Cedrus deodara (Roxb. ex D. Don) G. Don, and Picea smithiana (Wall.) Boiss., are
scattered sparingly throughout the Murree forests (Hameed & al. 2012). Aesculus
indica (Wall. ex Cambess.) Hook., Quercus dilatata Royle, and Q. oblongata D. Don
[= Q. incana Roxb.] are among the deciduous broadleaf trees in the upper regions
(Beg 1975). Shrubby species like Carissa opaca Stapf ex Haines, Dodonaea viscosa
(L.) Jacq., Justicia adhatoda L., and Myrsine africana L., are also present (Hussain &
Ilahi 1991).
The soils are classified as Entisols and Inceptisols, with more acid soils
predominating above 2000 m. ‘The soils are typically loamy and shallow, and their
development has been restricted due to the steepness of the slopes (Soil Survey of
Pakistan 1987).
Collection & morphological characterization
Basidiomata were collected, tagged, photographed, and _ characterized
morphologically. Colors were designated following the Munsell Soil Color Charts
(1994). The specimens were hot-air dried for preservation. Microscopic features,
measurements, and drawings were made from tissues rehydrated and crush-
mounted in 5% KOH and stained with Congo red (1% aqueous) or in Melzer’s
reagent. Basidiospores, basidia, cystidia, and pileal and stipitipellis elements were
examined with an Olympus CH 30RF 200 compound microscope equipped with
a digital camera; measurements were recorded using ScopeImage 9.0(x5) version
1.00. For basidiospores, numbers follow the formula [n/m/p] = n basidiospores,
m specimens, p collections. Basidiospore dimensions follow (a—)b-c(-d), where
b-c contains at least 90% of the measured values with extreme values given in
Gerronema reported from Pakistan... 251
parentheses. The average length and width of basidiospores is represented by avl and
avw. Quotient Q is used to symbolize the length/width ratio of individual spores;
avQ represents the Q average of all basidiospores. The examined collections were
deposited in the herbarium of the Department of Botany, University of the Punjab,
Lahore, Pakistan (LAH).
DNA extraction and PCR amplification
Genomic DNA was extracted from 30-50 mg of dried basidioma in a 2% CTAB
extraction buffer, following the Bruns (1995) protocol with some modifications.
The nrDNA ITS region was amplified using ITS1F (forward) and ITS4 (reverse)
primers (White & al. 1990). The polymerase chain reaction (PCR) was performed
with the Extract-N-Amp PCR kit in 20 ul reaction volumes according to Gardes
& Bruns (1993). The size of the PCR product was determined on a 1% agarose gel
in a gel documentation system (UVtec, Cambridge, UK) using default settings.
The PCR products were directly sequenced by the Beijing Genomics Institute in
both directions using the same pair of amplification primers. The newly generated
sequences were deposited in GenBank.
Sequence alignment, dataset assembly, and phylogenetic analysis
Newly generated Gerronema ITS sequences, along with those retrieved in
a GenBank BLAST search were used for the phylogenetic analysis. The ITS
sequence dataset comprised the Pakistani sequences, those of other Gerronema
species selected based on their similarity indices, and other taxa that were used
in previous phylogenetic analyses (Cooper 2014; Antonin & al. 2008; Latha & al.
2018). Multiclavula corynoides (Peck) R.H. Petersen and M. vernalis (Schwein.)
R.H. Petersen were selected as outgroup, following Antonin & al. (2008).
The dataset was aligned using MAFFT (Katoh & Standley 2013). DNA sequences
were trimmed with the conserved motifs 5’-(...GAT)CATTA- and -GACCT(CAAA...)-3’
with the program BioEdit sequence alignment editor v.7.2.5.0 (Alzohairy 2011).
MEGA 7 was used to select the best phylogenetic model, (Kumar & al. 2016).
Bootstrap analysis was performed with 1000 replications. A Maximum Likelihood
(ML) phylogenetic tree was generated using MEGA 7 with default settings (Kumar
& al. 2016) under the K2 + G model (Nei & Kumar 2000).
Phylogenetic results
A megablast search of the GenBank nucleotide database using the nrITS
(717-724 bp) Pakistani Gerronema sequences showed three Gerronema
nemorale sequences from the Republic of Korea (EU883592-EU883594) with
99.5% similarity and a single sequence from China (LT716047) with 99.4%
similarity. Complete alignment of the ITS region comprised 926 positions,
including gaps. The analysis involved 42 nucleotide sequences. Models with the
lowest BIC scores (Bayesian Information Criterion) were considered to best
describe the substitution pattern. All positions containing gaps and missing
252 ... Aqdus & Khalid
@ \N44687 Gerronema nemorale Pakistan
@ \1N744688 Gerronema nemorale Pakistan
LT716047 Gerronema nemorale China
EU883593 Gerronema nemorale Korea
EU883594 Gerronema nemorale Korea
EU883592 Gerronema nemorale Korea
@ MN744686 Gerronema nemoraie Pakistan
MN906021 Gerronema subclavatum USA
$00 | MN906138 Gerronema subclavatum USA
MK607510 Gerronema subclavatum USA
U66434 Gerronema subciavatum USA
MHO016932 Gerronema subclavatum USA
MH211945 Gerronema subciavatum USA
MK573888 Gerronema subclavatum USA
NR 166278 Gerronema indigoticum China
541 100 ' MK693727 Gerronema indigoticum China A
LT854045 Gerronema wildpretii Portugal /hydropoid clade
LT854023 Gerronema xanthophy ium Czech Republic
JQ694117 Gerronema waikanaense New Zealand
JQ657793 Gerronema sp Gabon
98 NR159832 Gerronema keralense India
100 ' MH156555 Gerronema keralense India
100; NR159831 Gerronema kuruvense India
a1 MH156554 Gerronema kuruvense India
98 KY242505 Gerronema strombodes USA
; KY271083 Gerronema strombodes USA
99 KY242504 Gerronema strombodes USA
DQ490626 Porotheleum fimbriatum USA
100 » DQ404389 Hydropus cf scabripes USA
GU234149 Aydropus scabripes Netherlands
57 HM191745 Clitocybula flavoaurantia USA
97 KR029720 Clitocybwa sulcata India
U66430 Chrysomphalina chrysophy lia USA
72 DQ486689 Chrysomphalina grossulaUSA
99 U66450 Omphalina pyxidata USA
U66451 Omphalina rivulicola USA
U66455 Omphalina velutipes USA
U66442 Omphalina epic insium USA
* 95 U66449 Omphalina philonotis USA
96 — U66453 Omphalina sphagnicolaUSA
U66440 Multiclavula corynoides USA
700 66439 Multiclavula vernalis USA Speterony
ri
0.05
Fic. 1. Molecular phylogenetic analysis by Maximum Likelihood; nrITS sequence-based ML
phylogram depicting the placement of G. nemorale within Gerronema. Values at nodes indicate
bootstrap support. Scale bar indicates the number of substitutions per site. Newly generated
sequences are marked with @.
data were eliminated during model estimation. K2 + G Model showed the
following base frequencies A (0.250), C (0.250), G (0.250), T (0.250) and a
gamma distribution shape parameter of 0.35. The nucleotide substitution rates
estimated according to this model were A/G = 0.178, A/T = 0.036, C/G = 0.036,
C/T = 0.178, and G/T = 0.036.
The ITS phylogenetic tree (Fic. 1) generated from the ML analysis nested the
sequences in the /hydropoid clade with 99% bootstrap support. All Gerronema
nemorale sequences and our new Pakistani sequences clustered together with
strong bootstrap support (99%).
Gerronema reported from Pakistan ... 253
Fic. 2. Gerronema nemorale.
Basidiomata: A. FA249 (MN744686); B. FA236 (MN44687); C. FA239 (MN744688).
Scale bars = 1 cm.
Taxonomy
Gerronema nemorale Har. Takah., Mycoscience 41(1): 16 (2000) Fics 2-3
BASIDIOMATA solitary or grouped. PrLEus 10-13 mm diam, convex with
umbilicate centre, margin inflexed, uplifted and wavy on maturity, innately
finely radially fibrillose to striate-rugulose except for the centre, yellow to
brown when young (2.5Y6/8-7/8), finally dull yellow (2.5Y8/4). LAMELLAE
arcuate-decurrent, subdistant, narrow, thin, pale yellow (2.5Y8/4); edges
fimbriate, concolorous, finely pubescent. CONTEXT hollow in stipe, yellowish
(2.5Y8/8) in pileus. StrpE 20-34 x 1-2 mm, cylindrical, broader at apex,
subbulbous at base, straight, central or eccentric, slender, firm, hollow, olive
254 ... Aqdus & Khalid
yellow to pale yellow (2.5Y6/8-8/4), scabrous all over. SPORE PRINT white.
Opor and TasTE not distinctive.
BASIDIOSPORES [60/8/3] (7.5-)8-9.7(-10) x (4.5-)5-5.9(-6) um, avl
x avw = 8.7 x 5.4 um, Q = (1.50)1.60-1.64(-1.66), avQ = 1.6, ellipsoid to
broadly ellipsoid, smooth, inamyloid, thin-walled, hyaline. Bastp1a 26-37 x
5-7.2 um, clavate, with 4 sterigmata. BASIDIOLES 25-34 x 5-7 um, clavate or
cylindrical. CHEILOCYSTIDIA 26-51 x 4-9 um, abundant, variable in shape
(clavate, subcylindrical, subutriform, or subfusoid), smooth, colorless or with
pale yellow contents, thin-walled. PLEUROCySTIDIA absent.
PILEITRAMA HYPHAE cylindrical, sarcodimitic (a dual hyphal system with
two types of generative hyphae: wide vessel hyphae that are non-septate,
fusoid, and thick-walled and narrow flexuous hyphae (sometimes called
binding hyphae) that are thin-walled, sinuous, and branched. PILEIPELLIS
a cutis of thin-walled hyphae, 2-5 um wide, cylindric, smooth, colorless or
with pale yellow contents; terminal cells swollen (clavate), 2-9 um wide, true
pileocystidia not observed. STIPITIPELLIS a cutis of parallel hyphae, 2-10
um wide, cylindric, smooth, colorless or with pale yellow contents, thin- to
thick-walled; CauLocystip1a (terminal cells) 22-63 x 5-10 um, irregular,
cylindrical or clavate, often capitate, with contents yellowish in KOH;
Stipititrama sarcodimitic (possessing a dual hyphal system composed of two
types of generative hyphae) CLAMP CONNECTIONS present in all tissues.
SPECIMENS EXAMINED—PAKISTAN, PunyjaB, Murree Hills, 2290 m a.s.l. solitary to
caespitose, on dead fallen twigs on forest floor in mixed forests of Abies pindrow, Cedrus
deodara, Pinus roxburghii, P. wallichiana, Quercus dilatata, Q. oblongata, 14 August 2018,
Fauzia Aqdus FA249 (LAH36351, GenBank MN744686); FA236 (LAH36370, GenBank
MN44687); FA239 (LAH36372, GenBank MN744688).
DISTRIBUTION—Gerronema nemorale has previously been recorded from
Japan, Republic of Korea, and China.
Discussion
Gerronema nemorale was originally described from Japan (Takahashi
2000) and subsequently reported from Korea (Antonin & al. 2008); its
presence in China is suggested by an unpublished sequence LT716047 in
GenBank. Our collections are the first record of the species from South Asia
and the first record of the genus from Pakistan.
The Pakistani basidiomata exhibit the omphalinoid appearance,
decurrent lamellae, thin-walled smooth basidiospores, sarcodimitic tramal
tissues, abundant cystidia on the stipe, and lignicolous habitat that led us to
Gerronema (Singer 1970, 1986).
Gerronema reported from Pakistan ... 255
CY
Fic. 3. Gerronema nemorale (FA249; MN744686):
A. Basidia and basidioles; B. Basidiospores; C. Cheilocystidia;
D. Pileipellis; E. Stipitipellis; F Tramal hyphae. Scale bars = 10 um.
Gerronema subclavatum (Peck) Singer ex Redhead (described by Bigelow
1970 as Omphalina subclavata) from North America resembles G. nemorale
in its plano-convex pileus with a depressed center and incurved margin,
fibrillose pileus surface, decurrent lamellae, smooth inamyloid ellipsoid and
256 ... Aqdus & Khalid
similarly sized (6-10 x 4-5.5 um) basidiospores, absence of pleurocystidia,
and lignicolous habitat. However, G. subclavatum is distinguished by its
broader (3-25 mm) pileus that is subhygrophanous, infundibuliform in age,
and more dully colored (with olive to brownish olive hues); slightly fungoid,
disagreeable, or bitter taste; larger (27-40 x 5.5-8.5(-10) um) basidia that
are rarely 2-spored; occasional cheilocystidia; very scattered habit; and
versiform pileocystidia (Bigelow 1970). A pair-wise alignment comparing
G. nemorale ITS sequences with G. subclavatum (MK607510) showed 99.2%
similarity. Phylogenetic studies showed a close relationship between both
taxa despite the morphological differences. We were unable to examine the
type specimens, and more research needs to be done in the future to resolve
this issue.
Gerronema strombodes (Berk. & Mont.) Singer (FJ596789) showed only
90.4% similarity with G. nemorale (FA249) in a BLASTn search using the ITS
sequence (717 bp). A species originally described from USA (Singer 1961),
G. strombodes is morphologically similar to G. nemorale in its fibrillose
pileus with depressed center, subdistant lamellae, ellipsoid basidiospores,
and absence of pleurocystidia and pileocystidia. However, G. strombodes
is distinguished from the Pakistani collection by its larger basidiomata,
grayish white pileus, longitudinally striped stipe that is slightly pruinose at
the apex, 1-4-spored basidia, and absence of caulocystidia (Singer 1961).
Gerronema strombodes was removed from Chrysomphalina and retained
in Gerronema based on its sarcodimitic tissues; and the new combination
G. xanthophyllum (Bres.) Norvell & al. was proposed for a vicariant European
taxon that had been confused with G. strombodes (Norvell & al. 1994).
The name G. xanthophyllum [= Clitocybe xanthophylla Bres., = Omphalia
hypoxantha Bres.] was selected based on examination of original material
that most closely matched the European concept to which G. strombodes had
been misapplied (Norvell & al. 1994).
Gerronema waikanaense (G. Stev.) J.A. Cooper (Cooper 2014) was
originally described by Stevenson (1963; as Hygrophorus waikanaensis).
This species shares with G. nemorale decurrent lamellae, 4-spored basidia,
inamyloid basidiospores, absence of pleurocystidia and pileocystidia, and
cylindrical caulocystidia. However, G. waikanaense is distinguished by its
broader (10-30 mm) basidiomata, the minutely fibrillose pileus surface, and
absence of cheilocystidia (Cooper 2014). A pair-wise alignment comparing
the ITS sequences of G. nemorale and G. waikanaense (JQ6941171) showed
only 87.5% similarity.
Gerronema reported from Pakistan ... 257
Gerronema kuruvense K.P.D. Latha & Manim. described from Kerala
State, India (Latha & al. 2018) resembles G. nemorale in its pileus with a
depressed center, subdistant lamellae, a stipe with a subbulbous base, absence
of pleurocystidia, and the presence of caulocystidia. However, G. kuruvense
is distinguished by its slightly smaller (<4-11 mm diam.) pileus that is
hygrophanous, 2-spored basidia, absence of cheilocystidia, and the presence
of true pileocystidia (Latha & al. 2018). A pair-wise alignment comparing
the ITS sequences of G. nemorale and G. kuruvense (NR120035) showed only
87.1% similarity.
Gerronema indigoticum T. Bau & L.N. Liu described from Guangxi
Province, China (Liu & al. 2019), resembles G. nemorale in its umbilicate
pileus with an inflexed (eventually uplifted) margin that is innately finely
radially fibrillose to striate, decurrent lamellae, a broadly based stipe, absence
of pleurocystidia and true pileocystidia, and the presence of cheilocystidia
and caulocystidia. However, G. indigoticum is distinguished by its blue to
blue-green basidiomata and slightly larger (<9-16 mm diam.) pileus, smaller
(6.8-8.8 x 3.74.4 um) basidiospores, 2—4-spored basidia, and smaller but
broader cheilocystidia (20-27 x 8-12 um; Liu & al. 2019).
Finally, G. nemorale somewhat resembles G. wildpretii Bafares & al. from
Canary Islands, Spain (Bafares & al. 2006), in its similar umbilicate pileus,
subdistant lamellae, stipe with a broadened base, absence of pleurocystidia,
and presence of cheilocystidia. Gerronema wildpretii is distinguished by its
larger (25-70 mm diam.) hygrophanous pileus, 1-3-spored (rarely 4-spored)
basidia, and true pileocystidia, and absence of caulocystidia (Banares & al.
2006).
BLASTn search results and the ITS-based phylogenetic analysis supports
G. nemorale among the other species of Gerronema. Our ITS phylogeny nests
the Pakistani sequences in the /hydropoid clade with 100% bootstrap support
together with Hydropus s. str. Clitocybula, and Porotheleum fimbriatum
(Moncalvo & al. 2002). All G. nemorale sequences clustered together with
strong bootstrap support.
Acknowledgments
We would like to express our gratitude to Dr. Sana Jabeen (Department of Botany,
Division of Science and Technology, University of Education, Lahore, Pakistan), Dr.
Vladimir Antonin (Department of Botany, Moravian Museum, Brno, Czech Republic),
and Dr. Else Vellinga (University of California at Berkeley, USA) for reviewing the
manuscript. We are also grateful to Dr. Francis Brearley (Department of Natural
Sciences, Manchester Metropolitan University, UK) for improving the language.
258 ... Aqdus & Khalid
Literature cited
Alzohairy AM. 2011. BioEdit: An important software for molecular biology. Bulletin of
Biosciences 2(1): 60-61.
Antonin V, Ryoo R, Shin HD. 2008. Gerronema nemorale (Basidiomycota, Agaricomycetes):
anatomic-morphological, cultivational, enzymatic and molecular characteristics
and its first records in the Republic of Korea. Czech Mycology 60: 197-212.
https://doi.org/10.33585/cmy.60204
Banares A, Beltran E, Bon M. 2006. Gerronema wildpretii sp. nov. (Agaricales,
Basidiomycetes) a new species from the Canary Islands. Mycologia 98(3): 455-459.
https://doi.org/10.1080/15572536.2006.11832680
Beg AR. 1975. Wildlife habitats of Pakistan. Forest institute Peshawar. Bulletin of Pakistan 5:
25-30.
Bigelow HE. 1970. Omphalina in North America. Mycologia 62: 1-32.
https://doi.org/10.1080/00275514.1970.12018941
Bruns TD. 1995. Thoughts on the processes that maintain local species diversity of
ectomycorrhizal fungi. Plant and Soil 170: 63-73. https://doi.org/10.1007/BF02183055
Cooper JA. 2014. New species and combinations of some New Zealand agarics belonging to
Clitopilus, Lyophyllum, Gerhardtia, Clitocybe, Hydnangium, Mycena, Rhodocollybia and
Gerronema. Mycosphere 5(2): 263-288. https://doi.org/10.5943/mycosphere/5/2/2
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for Basidiomycetes—
application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
https://doi.org/10.1111/j.1365-294X.1993.tb00005.x
Hameed M, Nawaz T, Ashraf M, Ahmad F, Ahmad KS, Ahmad MSA, Raza SH, Hussain M,
Ahmad I. 2012. Floral biodiversity and conservation status of the Himalayan foothill
region, Punjab. Pakistan Journal of Botany 44: 143-149.
Hussain F, Illahi I. 1991. Ecology and vegetation of Lesser Himalayan Pakistan. Botany
Department. University of Peshawar. 187 p.
Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Molecular Biology and Evolution 30(4):
772-780. https://doi.org/10.1093/molbev/mst010
Kumar S, Stecher G, Tamura K. 2016. MEGA7: molecular evolutionary genetics analysis
version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870-1874.
https://doi.org/10.1093/molbev/msw054
Latha KPD, Nanu S, Sharafudheen SA, Manimohan P. 2018. Two new species of Gerronema
(Agaricales, Basidiomycota) from Kerala State, India. Phytotaxa 364(1): 81-91.
https://doi.org/10.11646/phytotaxa.364.1.5
Liu LN, Mou GF, Bau T. 2019. A new Gerronema species with striking colours from China.
Magnolia Press. Phytotaxa 405(2): 74-82. https://doi.org/10.11646/phytotaxa.405.2.2
Lutzoni FM. 1997. Phylogeny of lichen- and non-lichen-forming omphalinoid mushrooms and
the utility of testing for combinability among multiple data sets. Systematic Biology 46(3):
373-406. https://doi.org/10.1093/sysbio/46.3.373
Moncalvo JM, Vilgalys R, Redhead SA, Johnson JE, James TY & al. 2002. One hundred and
seventeen clades of Euagarics. Molecular Phylogenetics and Evolution 23(3): 357-400.
https://doi.org/10.1016/S1055-7903(02)00027-1
Munsell Soil Color Charts. 1994. Revised Macbeth Division of Kollmorgen Instruments
Corporation, New Windsor, NY.
Nei M, Kumar S. 2000. Molecular evolution and phylogenetics. Oxford University, Press Oxford
New York. 333 p.
Gerronema reported from Pakistan ... 259
Norvell LL, Redhead SA, Ammirati JF. 1994. Omphalina sensu lato in North America 1-2.
1: Omphalina wynneae and the genus Chrysomphalina, 2: Omphalina sensu Bigelow.
Mycotaxon 50: 379-407.
Redhead SA. 1986. Mycological observations: 17-20. Nomenclatural notes on some omphalioid
genera in Canada: Chrysomphalina, Rickenella, Gerronema, Omphalina. Acta Mycologica
Sinica 1: 297-304.
Redhead SA, Lutzoni F, Moncalvo JM. Vilgalys R. 2002. Phylogeny of agarics: partial systematics
solutions for core omphalinoid genera in the Agaricales (euagarics). Mycotaxon 83: 19-57.
Singer R. 1951. New genera of fungi V. Mycologia 43: 598-604.
https://doi.org/10.1080/00275514.1951.12024157
Singer R. 1961. Diagnoses fungorum novorum Agaricalium II. Sydowia 15: 45-83.
Singer R.1964. Die Gattung Gerronema. Nova Hedwigia 7: 53-92.
Singer R.1970. Omphalinae (Clitocybeae-Tricholomataceae, Basidiomycetes). Flora Neotropica
3: 1-84.
Singer R. 1975. The Agaricales in modern taxonomy, 3rd Edition. Cramer, Vaduz. 912 p.
Singer R. 1986. The Agaricales in modern taxonomy, 4th Edition. Koeltz Scientific Books,
Konigstein. 981 p.
Soil Survey of Pakistan. 1987. Soils of mountainous regions of Pakistan. 28-31, in: FA Shams, K
Khan (eds). Resource Potential of Mountainous Regions of Pakistan. Centre for Integrated
Mountain Research. Punjab University: Lahore.
Stevenson G. 1963 [“1962”]. The Agaricales of New Zealand: IV. Kew Bulletin 16(3): 373-384.
https://doi.org/10.2307/4114672
Takahashi H. 2000. Two new species and one new variety of Agaricales from central Honshu,
Japan. Mycoscience 41: 15-23. https://doi.org/10.1007/BF02464381
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenies. 315-322, in: MA Innis & al, (eds). PCR
Protocols: a guide to methods and applications. Academic Press, Inc, San Diego,
California. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
World Weather Information Service. 2020. World Meteorological Organization. [accessed 2020
December 27]. http://worldweather.wmo.int/en/home.html
MYCOTAXON
ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. © 2021
January-March 2021—Volume 136, p. 261
https://doi.org/10.5248/136.261
Regional annotated mycobiota new to the Mycotaxon website
ABSTRACT—MycotTaxon is pleased to add a new annotated species distribution list to
our 143 previously posted free-access fungae. The 17-page “Lichenized Ascomycota on
Piptadenia moniliformis and Solanum mauritianum in the Raso da Catarina Ecoregion,
Caatinga, Brazil” by Rebeca Leite Barbosa & Nadja Santos Vitéria may be downloaded
from our website via http://www.mycotaxon.com/mycobiota/index.html
SOUTH AMERICA
Brazil
REBECA LEITE BARBOSA & NADJA SANTOS ViTORIA. Lichenized Ascomycota
on Piptadenia moniliformis and Solanum mauritianum in the Raso da
Catarina Ecoregion, Caatinga, Brazil. 17 p.
ABSTRACT—Our taxonomic survey of the lichenized Ascomycota associated
with Piptadenia moniliformis (“quipembe”) and Solanum mauritianum
(“cassatinga”) in the Raso da Catarina Ecoregion, Bahia State, Brazil was
conducted in the village of Jua (municipality of Paulo Afonso) from July 2017
to April 2018. All specimens were analyzed in the Mycology Laboratory and
are curated in the Didactic Collection, Fungal Herbarium, and Fungal Culture
Collection (MICOLAB UNEB-VIII). We identified twenty-four lichenized
fungal taxa representing 16 genera based on morphological characterizations
and measurements of the fungal structures; of those, 16 had been collected on
P. moniliformis and eight on S. mauritianum. Those plants are here described
as new hosts for those fungi. Additionally, we report three new lichen records
for Brazil and 13 for Bahia State.
Key worps—biodiversity, lichenization, semiarid, taxonomy
“et
Ne
on
==
Tote Fe
ee eee gee
Rare)
EAN,
7
i
wets
LAA,
‘<
a
me
eta fo}
ht.
eet
vas
wIN1QZ
Tot
sept eet
Bey
Teratospermopsis protuberata sp. nov.
(Xu & al.— Fie. 1, p. 89)
Jian Ma, artist