THE NAUTILUS

Volume 131, Number 4

December 27, 201 7

ISSN 0028-1344

A quarterlij devoted

to malacology.

STATEMENT OF OWNERSHIP, MANAGEMENT, AND CIRCUIWTION

1. Publication Title, THE NAUTILUS.

2. Publication No. 0028-1344.

3. Filing Date, November 10, 2017.

4. Lssue Frequency, Quarterly.

5. No. of ls.snes Published Annually, Four.

6. Annual Subscription Price, US $102.00.

7. Complete Mailing Address of Knowni Office of Publication, 3075 SaTiibel-Captiva Road, Sanibel, EL 33957 USA

8. Complete Mailing Address of Headquarters, same as 7.

9. Full Names and Complete Mailing Addresses of Publisher, The Rtiiley-Matthews Shell Museum, 3075 Sanibel-Captiva Road,

Sanibel, EL 33957 USA

Editor, Dr. Jose H. Leal, address as above.

10. Owner. Shell Museum and Educationd Foundation, Inc., address as above.

11. Known Rondholders, Mortgagees, and Other Security Holders Owiiing or Holchng 1 Percent or More of Total Amount of

Ronds, Mortgages, or Other Securities, NoTie.

12. The puqrose, function, and nonprofit status of this organization and the tax exempt status for federd income tax purjroses has

not changed during the precechng 12 months.

13. Publication Name, THE NAUTILUS.

14. Issue Date for Circulation Data Below, September 29, 2017

Average Single

15. Extent and Nature of Circulation 12 months Issue

a. Total Number of Copies 280 280

b. Paid Circulation

1. PaicPRequested Outside-County Mail Subscriptions 215 221

2. Paid In-Coimty Subscriptions 0 0

3. Sales Through Dealers and Carriers, Street Vendors,

Counter Sdes, and Other Non-USPS Pdd Distribution 0 0

4. Other Classes Mailed Through the USPS 16 18

c. Total Paid anchor Requested Circulation 231 239

cl. Free Distribution by Mail

1. Outside-County 16 18

2. In-County 6 6

3. Other Classes Mailed Through the USPS 0 0

4. Free chstribution outside the Miiil 0 0

e. Totd Free or Nominal Rate Distribution 16 18

f. Total Distribution 247 257

g. Copies not Distributed 33 23

h. Totd 280 280

i. Percent Paid Total 94% 93%

16. Electronic Copy Circulation

a. Paid Electronic Copies 0 6

b. Total Pdd Print Copies + Paid Electronic Copies 231 239

c. Totd Print Distribution + Paid Electronic Copies 247 257

d. Percent Pdd (Both Print & Electronic Copies) 94% 93%

THE NAUTILUS 131(4):2()7-216, 2017

Page 207

Description of three new muricids (Gastropoda: Muricidae:

Muricinae) from the Philippines and Fiji

Roland Houart

liistitut roval des Sciences iiaturelles de Belgitjue'

and I

Institut de Systematicjue, Evolution, Biodiversite

Museum national d’Histoire naturelle

Paris, UMR7205 FBANCE

Christopher Moe Chong Chen

91-1028 Kaianae St. Department of Subsurface Geobiological

Ewa Beach, HI 96706, USA Analysis and Besearch

Japan Agency for Marine-Earth Science

and Technology

Yokos\ika, Kanagawa 237-0061, JAPAN

ABSTRACT

Three new species are described from the Philippines and Fiji,

one in the genus Chicomurex Arakawa, 1964 and two in

Chicorens {Triplex) Perrv', 1911. Chicomurex excehus new

species from tlie Philippines is compared with C. gloriosus

(Shikama, 1977), C. pseudosiiperlms Houart, Moe, and Chen,

2015, and C. venustulus (Behder and Wilson, 1975), species that

are or were confused with the new species. Cliicoretis {Triplex)

kaitoimiei new species from Fiji is compared with C. aciileatus

(Lamarck, 1822), C. rossiteri (Crosse, 1872), C. nohilis Shikama,

1977, C. njukiiuensis Shikama, 1978, and C. cloveri Houart,

1985; two of these were confused with the new species by recent

authors and the others have a few similar shell characters.

Chicoreus {Triplex) acjuilus new species from Fiji is compared

with C. nthescens (Broderip, 1833), C. strigatus (Reeve, 1849),

C. paini Houart, 1983, and C. dodongi Houart, 1995, species

witli an appro.ximately similar size, a similarly narrow shell, high

spire, moderately long siphonal canal, and siuliU aperture.

Additional Keijivords: Neogastropoda, Chicomurex, Chicoreus

{Triplex), Philippine Islands, Fijian Archipelago, new species

INTRODUCTION

Tlie genus Chicomurex Arakawa, 1964, which is restricted

to tlie Indo-West Pacific, was recognized as a separate

genus by Houart (1992: 115) based on shell and radular

characters. The genus then included seven species:

C. elliscrossi (Ftiir, 1974), C, laciniatus (Sowerby II, 1841),

C. prohlenmticus (Lan, 1981), C. protoglohosus Houart,

1992, C. superhus (Sowerby III, 1889), C. turschi

(Houart, 1981), and C. venustulus (Rehder and Wilson,

1975). Five additional species were described by Houart

(2013) and Houart et al. (2014; 2015). Houart et al. (2014)

considered C. prohlermtic'us a junior subjective synonym

of C. superlms and Houart et al. (2015) reinstated the

name C. gloriosus (Shikama, 1977). The genus thus

currently contains 13 Recent species: C. elliscrossi (Fair,

1974), Japan; C. globus Houart, Moe, and Chen, 2015,

' Besearch Associate

New Caledonia, Vanuatu, to Okinawa, Japan; C. gloriosus

(Shikama, 1977), Indo-West Pacific; C. laciniatus

(Sowerby H, 1841), Indo-West Pacific; C. lani Houart,

Moe, and Chen, 2014, northeastern Australia, New

Caledonia, Vanuatu, to southern Japan; C. protoglohosus.

New Caledonia; C. pseudosuperbus Houart, Moe, and

Chen, 2015, Queensland, Australia, New Caledonia, to

southern Japan; C. ritae Houart, 2013, Philippines;

C. rosadoi Houart, 1999, Mozambitjue; C. superhus,

Queensland, Australia to southern Japan; C. tagaroae

Houart, 2013, Philippines; C. turschi, Indo-West Pacific;

and C. venustulus, Manjuesas. A fourteenth species is

liere described based on materials from the Philippines

and the Marshall Islands. A molecular phylogeny of the

genus Chicomurex is currently being prepared (Cben

et al., in prep.). For those species witli data available, in¬

cluding the recently described C. lani, C. pseudostiperhus,

and C. ghhus, molecular results agree well witli mor-

phologiciil identification in terms of species-level separa¬

tion, indicating that the shell characters used to separate

Chicomurex species are effective and accurate (C. Chen,

pers. comm.).

Triplex Perry, 1811 was considered separate from

Chicoreus sensu stricto by Houart (1992: 34) and was then

used as subgenus. It currently includes more than 50

species in the Indo-West Pacific. Two additional species

from Fiji are described here, in two different groups as

established by Houart (1992). Houart and Heros (2008)

estimated the number of muricids in Fiji to be 95, and the

current paper brings that number to 97. One of tbe two

new species described herein from Fiji has previously

been misidentified as Chicoreus {Triplex) nohilis Shikama,

1977 by Houart (1992: 100 [in part], fig. 210 [only]) and

Houart and Heros (2008: 443, fig. II). It is important,

however, to note that the R-pical C. nohilis does indeed

also occur in Fiji (Figure 28).

MATERIALS AND METHODS

Most of the material studied here comes from the authors’

private collections. The two new species of Chicoreus

Page 208

THE NAUTILUS, Vol. 131, No. 4

were collected a few years ago in Suva, Fiji and tlie new

species o\' Chico)tuirex from the Pliilippines was regularly

inisidentified as C. glorio.sus (Shikama, 1977) or

C. vemisinlns (Rehder and Wilson, 1975) l)y collectors in

the Philippines. Additioiiiil specimens originate from mate-

ri;ils gathered during two cniises organized by MNHN

and IRD in southern Viti Levai (SUVA 2 and SUVA 4

causes) in 1998 and 1999. The SUVA 2 Caiise was carried

out in the Fijian Archipelago from 10-23 October 1998.

Dredging, trawling, and Smith-McIntvTe grab-sampling

methods vielded 85 samples in the South and West lagoon

of Vitu Levu Island. The SUVA 4 Cruise was also carried

out in the Fijian Archipelago from 19-27 September 1999.

The puipose of that mission was to complete the benthos

sampling started in 1998. Three t)pes of dredging and

trawling methods, including Smith-Mcintyre grab, WcU-en

dredge and beam trawl, were used for 39 stations. Sampling

was carried out in Suva Harbor, Lautbala Bay, and Rewa

River, others in Beqa Lagoon and Pacific Harbor Bay.

The characters used to describe the shell moqihology

herein include the general aspect of the shell, its shape

and size, color, shape of the spire and number of pro-

toconcb and teleoconch whorls, features of tlie proto¬

conch, shape of the teleoconch whorls and features or

form of the suture and of the subsutural ramp, of iixial and

spiral sculpture, the aperture, and siphonal canal. Unless

othenvise mentioned, the species descriptions cU'e bicsed on

the holotyj^e anti the piiratyjies. The method for detennining

diameter, height and counting tlie number of protoconch

whorls is showai in Figure 1. We used the stuue method as

that illustrated tuid used by Bouchet and Ktuitor (2004).

The bathymetric range given here is provided using the

inner values of the recorded depth: the largest value of the

minimum values and the lowest value of the imudmum

values of all the recorded ranges. This is the same as the

concept of “confirmed bathymetric range” (Harasewych,

2011).

Abbreviations of repository collections are: CC: col¬

lection of Chong Chen; CM: collection of Christopher

Moe; IRSNB: Institut royal des Sciences naturelles de

Belgique, Boixelles, Belgium; MNHN: Museum national

d’Histoire naturelle, Paris, France; RH: collection of

Roland Houart; SJ: collection of Scott Johnson. Other

abbi'eviations used in the text are: DW: Waren Dredge;

IRD: Institut de Recherche pour le Developpement,

France; ad: adult specimen; juv: juvenile specimen; dd:

empty shell; Iv: live-collected specimen.

Terminology Used to Describe Spir.al Cords and

Aperti.:ral Denticles (after Merle 2001 and 2005)

(Figures 2-6) (Terminology in parentheses: erratic fea¬

ture): Spiral cords: ab: abapical (or abapertural); abis:

abapical infrasutural secondary cord (on subsuturiil ramp);

ABP: abapertural primaiy cord on the siphonal caiicil; abs:

abapertural secondary cord on the siphonal canal; ad:

adapical (or adapertural); adis: adapical infrasutural

secondary' cord (on subsutural ramp); ADP: adapertural

primary' cord on the siphonal canal; ads: adapertural

secondary' cord on the siphonal canal; IP: infrasutur:il

primaiy cord (primary' cord on subsutural ramp); MP:

median primary cord on the siphonal canal; ms: median

secondary' cord on the siphonal canal; P: primary' cord;

PI: shoulder cord; P2-P6: primary cords of the convex

part of the teleoconch whorl; s: secondary' cord; sl-s6:

secondary cords of the convex part of the teleoconch

whorl (example: si = secondary cord between PI

and P2; s2 = secondary cord between P2 and P3, etc.);

t: tertiary cord. Aperture: D1 to D6. Abapical den¬

ticles; ID. Infrasutural denticle.

Number of whorls (here 2 1/4)

Figure 1. Method for detennining diameter, height and counting the number of protoconch whorls Scale bar — 500 p,m.

R. Mouart et al, 2017

Page 209

Figures 2-6. Spiral cords and aperture inoqdiology. 2. Chicomurex excehus new species. Holotyire, MNHN IM-2()()()-33591.

3—4. Chicoreus (Triplex) kaitomoei new species. Holotyjie, MNHN IM-2000-33592. 5-6. Chicoreus (Triplex) aquiltis new

species. Holotyjie MNHN I M -2000-33593. (See Materials and Methods for abhrevdation exjolanations.)

Page 210

THE NAUTILUS, Vol. 131, No. 4

SYSTEMATICS

Family Muricidae Rafiiiesque, 1815

Subfamily Muricinae Rafiiiescjue, 1815

Genus Chicomurex Arakawa, 1964

T>qje Species: Murex superhiis Sowerby, 1889, Recent,

Philippines (original designation)

Chicomurex excelsus new species

(Figures 2, 7-15)

Chicomurex venustulus. — Merle et ah, 2011: pi. 77, fig. 16

(only) (not Chicoreus venustuhis Rehder and Wilson,

1975).

Description: Shell medium-sized for genus, up to

58.3 mm in length (paratvpe CM). Lengtli/wadth ratio

1. 8-2.1. Lanceolate, angular, broadly ovate, weakly

spinose, squamous and nodose. Lightly built. Subsutural

ramp narrow, weakly sloping, convex. Protoconch and

hrst and second teleoconch whorls light pink. Subsutural

ramp to P2 cream or light tan with traces of fight brown

on spiral cords; orange or dark brown between P2 and

P6 or between P2 and ARP; P6 and s6 occasionally white.

One parahpe (RH) creamy white with some orange spots

between P2 and s6, s6 light orange; creamy white between

s6 and tip of siphonal canal. Aperture white with narrow

brown line on outer apertural edge, line often extending

on right edge to tip of siplion:il canal; ventral left part of

siphonal canal white. Spire high with 2+ protoconch

whorls (partly broken in a paratyjie, eroded or broken

in other specimens) and up to 7 broad, weakly convex,

angular, weakly shouldered, spinose and nodose whorls.

Suture adpressed. Protoconch partly preserved in

a paratvpe (Figure 14, CM) with narrow abapical keel

on last whorl, and penultimate whorl partly broken. Axial

sculpture of teleoconch whorls consisting of low, strong,

narrow, rounded, nodose ribs and high, narrow, rounded,

weakly spinose varices. First whorl with 10 or 1 1 axial ribs,

starting varices with 2 or 3 intervariceal ribs from second

to penultimate whorl; ribs increasing in strength

abapically. Last whorl with 3 narrow, rounded, weakly

spinose varices, webbed on abapical part of whorl,

webbing extending on siphonal canal. Intervarical

sculpture of last whorl consisting of two moderately

narrow, high axial ribs with higher node close to

preceding varix. Spiral sculpture of primary, secondary

and tertiary nodose cords. Primary cords moderately high

and broad; P4-P6 slightly broader and higher, followed by

ADP, MP and ABP on siphoiiiil canal, similar in strength

to P4-P6; ADP spine occasionally shorter. Secondary

cords narrow, except s6 of similar in strength to P1-P3.

Tertiary cords very narrow. Aperture relatively small,

ovate. Columellar lip narrow, smooth abapically, with

weak folds adapically and low parietal tooth. Rim

partially erect, a small portion adherent at adapical

extremity. Anal notcli shallow, broad. Outer lip erect.

crenulated, with very weak, narrow lirae within.

Siphonal canal long, 40-43% of shell length, broad,

weakly dorsally recurved, narrowly open, with dorsally

recurved, webbed ADP, (ads), MP, ms, ABP and bs

spines. Operculum light or dark brown, ovate with

apical nucleus.

Type Material: Holotype: MNHN IM-2000-3359L

from tvpe locality; paratypes: Philippines, Southwest

of Bohol, Balicasag Island, by tangle nets, 150 m, Iv,

ad, 1 RH; Philippines, Bohol Island, 200 m, Iv, ad, 1

CM; Philippines, Balnt Island, by tangle nets, 200 m, Iv,

ad, 1 CC; Philippines, Balnt Island, Tinina, by tangle nets,

150-300m, Iv, ad, 1 CC.

Type Locality': Philippines, Bohol Island.

Other Material Examined: Kwajalein Atoll, Marshall

Islands, 60 m, dead in octopus piles on the Oceanside

drop off near Enubuj (Carlson) Island, SJ (10 dd, ad) CM

(3 dd, ad).

Distribution: Soutliem Philippines Iskmds and Kwajcilein

Atoll, Marshidl Lskmds, firing at 150-200 m.

Remarks: A parat)q^e (CM) of Chicomurex excelsus

new species has a partly preserved protoconch with intact

last and partly intact penultimate whorls. The moq:)hology

of these whorls and the presence of a narrow keel on the

abapiccil part of the last whorl (Figure 14) suggest a conical

protoconch as observed in a few other species, namely

C. laciniatus, C. superbus, C. venustuhis, C. gloriosus,

C. lath, C. globus, and C. pseudosuperbus. All the other

Chicomurex species have a rounded, paucispiral proto¬

conch. Chicomurex excelsus new species is closest to

C. gloriosus (Figures 16-17) but consistently chffers by

haring a lower spire in relation to the shell length (ap¬

proximately 35% of total shell length, as opposed to

38^0% in C. glorio.sus) and a longer siphoned canal

(40^3% of total shell length compared to 35-40% in

C. gloriosus). It also has a less rounded, more angular last

teleoconch whorl, narrower cixial varices, lower intervariced

axied nodes, a less scabrous shell and webbed spines on the

siphoned called whereas tliese are never webbed in C. gh-

rio.sus. A recently described species, C. p.seudosuperhus

(Figure 18), is edso simdar, but C. excelsus new species differs

by haring a smaller shell compared to tlie number of tel¬

eoconch whorls, a less rounded teleoconch whorl, a slightly

lower spire, aid a less scabrous shell with strongly webbed

spines on the siphomd caial instead of separate long spines

as in C. p.seudos'uperlnis . Chicomurex excelsus new species

fuitlier differs from C. venustuhis (Figures 19-20), a species

currently known only from tlie Marquesas, by haring a larger

shell, reaching almost twice the length of an adult

C. venustuhis with a same number of teleoconch

whorls. Chicomurex excelsus new species also has a less

rounded last teleoconch whorl, a less scabrous shell and

a comparatively longer siphonal canal. A specimen of

Chicomurex excelsus new species from the Kwajalein

Atoll (Figure 15) has a broader last teleoconch whorl

R. Houart et al., 2017

Page 211

Figures 7—20. Chiconiiirex species. 7—15. Chicomurex excelsus new species. 7—9. Holotyjie, MNHN IM 2000-33591, 1 hilip

pines, Bohol Island, 54.8 mm. 10-11, 14. Paratyi^e CM, Philippines, Bohol Island, 200 m, 58.3 mm. 12. Paraty^pe RH, Philippines,

Soudiwest ol Bohol, Bidicasag Island, by tangle nets, 150 m, 55.3 mm. 13. Paraty}:)e CC, Philippines, Balut Lsland, by tangle Tiets, 46.1 inni; 15.

CM, MimshaU Islands, Kwajalein Atoll, 43.1 mm. 16-17. Chiaymirex ghrumis (Sliikama, 1977), Bidnt Lslmid, Philippines (16. 49.1 jinni; 17.

50.9 mm). 18. Chianimrexpsetidosiiperlnis Houart, Moe, and Chen, 2015, RH, Pliilippines, Bohol, Kalitnhan ILshuid, tangle nets, 90 m, 71.6 min.

19-20. Chiconinrex veniistidus (Rehder and Wilson, 19/5), RH, Marque,sas, Nuku Hiva, 104—109 m, 32.4 inm. Scale bar — 500 ^rm.

Page 212

THE NAUTILUS, Vol. 131, No. 4

compared to otlier specimens hut all other features

match with the above description.

Etymology: Latin excelsus, high, lofty, distinguished:

named for the distinctive and heautiful shell moiphology.

Japanese Name: “Fiirisode-Senjn,” *7 U V X dZ > n. ,

after the “swinging-sleeves” style kimono known as “fur-

isode”, which re.semhles tire wehhed siphontd caiiid in tliis

species. “Senju” is a genend veniacidiU' tenn for muricids

with spinous and frondose varices, literally meaning

“thousand-hands”.

Chicoreus (Triplex) kaitomoei new speeies

(Ligures 3-4, 21-26)

Cliicoretis acideafus. — Cernohorskv, 1967a: 117, pi. 14,

fig. 5, te.xt fig. 1; Cernohorsk)', 1967h: 118 (in part),

pi. 25, fig. 147; Cernohorskv, 1985: 47 (in part), fig.

3 (only) (not Miirex aculeatiis Lamarck, 1822).

Chicoreus (Triplex) nohilis. — Houart, 1992: 100 (in part),

fig. 210 (only); Houart and Heros, 2008: 443, fig. II

(not Chicoreus nohilis Shikama, 1977).

Description: Shell small for genus, up to 32.8 mm in

length (paratype CM). Lengtli/width ratio 1. 7-2.0.

Slender, lanceolate, broadly ovate, heavy, weakly

spinose and nodose. Suhsutural ramp narrow, weakly

sloping, convex. Shell entirely light-orange. Aperture

white within; columellar lip and narrow hand in outer

lip pink. Spire high with 2 protoconch whorls and

teleoconch up to 7 broad, strongly convex, strongly

shouldered, nodose whorls. Suture adpressed.

Protoconch small, bulbous. Whorls rounded, smooth,

last whorl flattened, width and height 700-800 |xm.

Terminal lip delicate, thin, erect, curved. Axial

sculpture of teleoconch whorls consisting of ribs and

varices. Lirst whorl with 12-14 narrow ribs, second

whorl starting varices with 2 or 3 broad inter\'arice;il

ribs. Third to last whorl with 3 varices and 2

interv’ariceal ribs. Varices increasing obviously in width

and strength abapiccilly. Last whorl with 3 broad varices

and two broad intervariceal ribs. Spiral sculpture of

primary, secondary, tertiary cords and numerous

squamous threads. Lirst to third whorl with visible,

narrow P1-P3 or P1-P4, starting IP from second whorl.

Spiral cords increasing in width from fourth whorl, then

splitting in several threads. Top thread weakly broader

with two smaller threads on each side. Other spiral

sculpture of narrow, secondary cords, occasionally with

additional tertiary cords. P2-P5 of same strength; PI and

P6 narrower. ADP, MP, and ABP cords also topped with

several threads, giving rise to long, frondose spines.

Aperture large, ovate. Columellar lip narrow, weakly

flaring, smooth with low parietid tooth at adapical

extremity. Rim partially erect, a small portion adherent

to adapical extremity. Anal notch narrow, moderately

deep. Outer lip erect, crenulated, with strong, narrow,

split denticles extending on a short distance within as

narrow lirae: 113, 131-13.5 split. Siphonal canal moderately

long, 36-38% of shell length, narrow, strongly dorsally

recurved at tip, narrowly Open, with 3 frondose, abapically

bent, long spines, situated on abapical part of canal,

gradiudly decreasing in length abapically. Operculum

light or dark brown with apical nucleus.

Type Material: Holotype: MNHN IM-2000-33592lv,

ad (from tyqve loc;dity’); paratypes: Iv, juv, 1 IRSNB IG.

33491/MT. 3596; Iv, ad, 5 CM(from type locality); Iv, juv, 1

CC (from tyq^e locality); Liji, Viti Levu, Mbenga Island,

9 m, under coral rubble, 2 Iv, ad, 1 Iv, juv (RH); SUVA 4:

Liji, Viti Levu, stn DW08, 18°22' S, 178°02' E, 28-30 m,

juv, Iv and dd, 8 MNHN IM-2008-99L

Type Locality: Liji, southeni Viti Levm, Suva area, drop

off in 31-40 m.

Other Material Examined: SUVA 2: Liji, southern

Viti Levu, stn DW 62, 17°48' S, 177°13' E, 32 m, 1 dd,

MNHN IM-2008-992; SUVA 4, Liji, Viti Levm, stn DW

22, 18°27' S, 177°59' E, 32-36 m, 1 Iv, juv, MNHN IM-

2008-990; stn DW 26, 18°24' S, 178°05' E, 42-43 m, 1 dd,

MNHN IM-2008-989 (illustrated in Houart and Heros,

2008: fig. 11, as Chicoreus nohilis).

Distribution: Lijian Archipelago, southern Viti Levu,

Living at 9-30 m.

Remarks: Chicoreus (Triplex) kaitonwei new species is

here included in a group numbered “group 7” in Houart

(1992: 99). The shells of these species are white, pinkish or

yellowish, are relatively small and with short variceid

frondose spines. Both lecithotrophic and planctotrophic

larval development are observed. “Group 7” currently

includes Chicoreus (Triplex) aculeatus (Lamarck, 1822),

C. ros.siteri (Crosse, 1872), C. nohilis, C. ryukijuemis

Shikama, 1978, C. cloveri Houart, 1985, C. cro.snieri

Houart, 1985, C . fosterorum Houart, 1989, C. zulukmdensis

Houart, 1989, and C. kantori Houart and Heros, 2013

(here newly assigned to that group). Chicoreus kaitonwei

new species was confused with C. aculeatus and C. nohilis

in the recent literature. However, C. kaitonwei differs

from both species by having a paucispind, rounded pro¬

toconch (Ligure 26) as opposed to a multispiral and

conical protoconch with sinusigeral terminid lip in

C. acideatus (Ligure 32) and C. nohilis (Ligure 30) im¬

plying a planktotrophic larval development in both spe¬

cies, rather than lecithotrophic in C. kaitonwei new

species The same different protoconch moi'phology and

larval development separate C. rossiteri (Ligure 35) from

our new species. In adchtion, C. kaitonwei new species

differs from C. nohilis (Ligures 27-30) by having a com¬

paratively smaller shell with shorter variceal spines, es¬

pecially those extending from PI, P2, and P3, even in

a short spined form of C. nohilis from the Coral Sea

(Ligure 29). The P6 spine is also obviously relatively

longer and broader in C. kaitonwei new species while very

short and narrow in C. nohilis. Chicoreus kaitonwei new

species ;dso differs from C. nohilis by having stnught,

abapically bent spines on the siphonal cantd instead of

R. Mouait et al., 2017

Page 213

Figures 21-40. Chicoreus species. 21-26. Chicoreus (Triplex) kaitomoei new speeies. 21-25. Fiji, southern Viti Le\ai, Suva area,

drop off in 31-40 in. 21-23. Holotyi^e, MNHN I M -2000-33592, 30.8 mm. 24-25. Parat>pe CM, 32.8 mm. 26. Parat>pe RH,

protoconch, Fiji, Viti Levu, off Mbengga Island, 9 m, under coral rubble. 27-30. Chicoreus (Triplex) nobilis Sbikama,J977. 27. RH,

Philippines, Cebu, Sogod, tangle nets, 43.4 mm. 28. CM, Fiji, soutbem Viti Levu, Suva area, drop off in 31-40 m, 43.7 mm. 29. RH,

Cored Sea, 64 m, 41.6 mm. 30. RH, protoconeb, Papua New Guinea, Hansa Ray (Madang Province), Laing Island, 45 m. 31-32.

Chicoreus (Triplex) aculeatus (Lamarck, 1822). 31. RH, Philippines, Ralicasag Island, tangle nets, 51.2 mm. 32. 1 rotoconeb, Phil¬

ippines, Siargao Island. 33-35. Chicoreus (Triplex) rossiteri (Crosse, 1872). 33-34. RH, Pbibppines, Robol, Panglao, RH, 47.5 mm. 35.

RH, protoconch, Pbibppines, Cebu Island. 36—37. Chicoreus (Triplex) njukijuensis Sbikama, 19/8. 36. RH, Japan, Okinawa, Seragaki

Reef, 40-50 m, 33.1 mm. 37. RH, protoconeb, Guam, Hospital Point, 14-17 m. 38-40. Chicoreus (Triplex) cloveri Houart, 1985.

Mauritius, paraty]re RH, 23.5 mm. Scale bars = 500 (cm.

Page 214

THE NAUTILUS, Vol. 131, No. 4

long, strongly aclapically cni-ved fronded spines in

C. nohilis. CJiicoreus kaitoinoei new species further differs

from C. acnleatus (Figures 31-32), a widely distributed

species across the Indo-West Pacific, by having relatively

broader varices with shorter vaiiceal spines, lower

intemuiceal ribs (consisting usiuilly of a single high

node in C. acnleatus), and also by ha\ing shorter, more

ahapically bent canal spines. From C. rossiteri (Figures

33-35) it differs also by having distinct protoconch

moqvhology and comparatively broader axial varices

with shorter spines, 2 or 3 intervariceal ribs instead of

a single, strong node in C. rossiteri, rarely with an

additional low ridge, and by having a shorter siphonal

canal with ahapically bent spines at the lower part of the

canal rather than long spines distributed over the whole

length of the canal in C. rossiteri. Chicoreus kaitomoei

new species differs from C, ryukyuensis (Figures 36-37)

by having a lower spire, broader iixial v'arices, narrower

primary spiral cords and ahapically bent spines on the

lower part of the siphonal canal opposed to upward

recmwed spines in the whole length of the canal in

C. n/ukynensis. Lastly, C. kaitomoei new species differs

from C. cloveri (Figures 38-40), a species endemic to

Mauritius and surrounding areas, l)y having a comparatively

larger shell with broader axial varices, broader primary

spiral cords and a broader, relatively shorter siphonal

canid witli more heavily ahapically bent spines.

Etymology: Named after Kaito Ev^indr Moe, son of

the second author, Christopher Moe, hoping to infuse in

him an interest in malacology and marine science.

Japanese Name: “Kaito-Senju,” iy ^ h V' :i ,

same etvmiolog)' as above.

Chicoreus (Triplex) aquilus new species

(Figures 5-6, 41-43)

Description: Shell small for genus, 36.5 mm in length.

Lengtli/width ratio 2.0. Slender, lanceolate, broadly ovate,

heavy, weakly spinose, and nodose. Subsuturtd ramp

narrow, strongly sloping, convex.

Fight tan with black varices and iixial ribs; additional

black spots on spiral cords; ventral left part of siphonal

canal light tan. Aperture white with pinkish narrow line on

outer edge of columellar lip, extending to tip of siphonal

canal. Spire high, acute. Teleoconch of 7 broad, weakly

shouldered, nodose, weakly spinose whorls. Suture

adpressed. Protoconch unknown (eroded). Axial sculpture

consisting of high, strong, nodose ribs and v'arices. First

two teleoconch whorls partly eroded. Third to last whorl

with narrow, weakly spinose varices and two broad, no¬

dose iixial ribs, extending from the suture. A third, smaller

rib, close to succeeding varix. Spiral sculpture of high,

rounded, narrow, nodose primary cords, narrow sec-

ondaiy cords, and a few obsolete tertiary cords or lirae.

Third to penultimate whorl with adis, IP, and visible

P1-P3. Last whorl with adis, IP, PI, P2, P3, s3, P4, P5, P6,

s6, t, ADP, MP and ABP. Primar)' cords giUng rise to

short, frondose spines. P1-P3 of similar strength, PI with

somewhat longer spine; P4 and P5 broader with longer

spines; P6 narrow with very short spine. ADP and MP

spines short, less frondose than other spines, ABP shallow.

Aperture relatively small, roundly ovate. Columellar lip

narrow with strong folds ahapically and strong parietal

tooth at adapical extremity. Rim acDierent. Anal notch

moderately deep, broad. Outer lip weakly erect, crenu-

lated, with 6 strong, elongate denticles within: ID,

D1-D5. Siphonal canal moderately short, 32% of shell

length, broad, straight, weakly dorsally recurved at tip,

narrowly open, tapered ahapically, with 2 short spines

extending from ADP and MP. Operculum unknown.

Type Material: Holotype MNHN IM-2000-33593, Iv,

ad (From tvpe locality.)

Type Locality: Fiji, Viti Levu, Suva area, drop off in

31-40 m.

Distribution: Only known from the holotype, Fiji, Viti

Lev'll, Suva area, liv'ing at 31^0 m.

Remarks: Chicoreus (Triplex) aquilus new species

differs strongly from all known Indo-West Pacific Triplex

species. However, a few of them have more or less close

shell characters and may be compared with the new

species. These all have a similar size, a narrow shell with

a high spire, a moderately long siphonal canal and a small

aperture. The closest species, C. ruhesceris (Broderip, 1833)

(Figures 44—45) has a similar aperture, a moderately long

siphonal canal and short variceal spines, and occurs in

French Polynesia (tvpe locality), Wallis, and New

Caledonia. The apertures are strikingly similar, although

relatively smaller in C. aquilus, both being roundly ovate,

glossy white witli a narrow columellar lip completely

acOierent to the shell, bearing a strong, elongate knob

ahapically, and a strong, broad parietal tooth adapically.

The outer apertural lip is crenulated with strong, elongate

denticles in both species. The siphonal canal also hears

two short, ahapically bent spines. However, C. aquilus

differs from C. ruhescens by having narrower axial varices

with more strongly frondose spines, 2 or 3 interv'ariceal

axial ribs instead of a single, broad rib in C. ruhescens

and less numerous spiral threads. In Houart (1992: 62)

C. ruhescens belongs to “group 2” with C. microphylhis

(Lamarck, 1816), C. strigatus (Reeve, 1849), C. paini

Houart, 1983 and C. trivialis (A. Adams, 1854). Of these

species C. aquilus new species can only reasonably be

compared additionally to C. strigatus and C. paini. The

new species differs from Chicoreus strigatus (Figures

46-49) by having less obvious imd less frondose

variceal spines, more numerous, higher intervariceal

ribs, broader primary spiral cords, a more rounded

aperture with strong, thick, abapical folds (absent in

C. .strigatus), a stronger parietal tooth and a broader,

shallower anal notch. The siphonal canal in C. aquilus

new species is also straighter with a more tapered shape.

Chicoreus aquilus new species also differs from C.

paini (Figures 50-52) by having less obvious and

R. Hoiiait et al., 2017

Page 215

Figures 41-54. Chicoreiis species. 41-43. Chicoreus (Triplex) aquilits new species. Holotyfie, MNHN IM-2(M)0-33593, Fiji, .southern

Viti Levu, Suva area, drop off in 31^0 in. 36.5 mm. 44-45. Chicoreiis (Triplex) nihescem (Broderip, 1833). RH. lociJity doubtful, in

a collection lot of .shells from Taliiti, Marquesas, and New Caledonia, 48 mm. 46-49. Chiamm (Triplex) strigatm (Reeve, 1849). 46-47. RH,

Japan, Ryukyu Islands, 51 . 1 mm. 48-49. RH, Japan, Okinawa, Buckner Bay, under coral. 32.4 mm. 50-52. Chiaireiis (Triplex) paini Houart,

1983. 50-51. RH, Pidau, near Koror-Babeldiiob bridge, 0.6-1.5 m, among .silty rocks, 38.4 mm. 52. Piiratyjre RH, Solomon Islands, Honiara,

37.6 mm. 53-54. Chicoreiis (Triplex) doclongi Hoiuirt, 1995. RH, Philippines, Samar, Capul Island. 25 m, 30.6 mm.

Page 216

THE NAUTILUS, Vol. 131, No. 4

froiulose variceal spines, a different aperture and

a straighter siphonal canal, which is more strongly

tapered at the abapical extremity. Chicoreus dodongi

Ilonart, 1995 (Figures 53-54) is here added to “group

2” in Honart (1992) and compared with C. aqiiUus new

species; the new species differs by having less frondose

varices, obviously lower and narrower intervariceal ribs,

narrower primary spiral cords and a comparatively

longer and more strongly abapically tapered siphonal

canal.

Etymology: Latin aquilus, dark colored, blackish,

naming after the particular and distinctive color of the

holotyjre.

Japanese Name : “Kuwzotm-Setiju,’’

with “krirozome” meaning “stiiined in black”.

ACKNOWLEDGMENTS

We are grateful to Virginie Heros (Museum national

d'llistoire, naturelle, Paris, France) and Bertrand Richer

de Forges, IRD, Noumea, New Caledonia, for information

about SUVA 2 tmd SUVA 4 cmises in the Fijian Archipelago

and to Virginie Heros iuid Philippe Maestrati (MNHN) for

tlie locur of materiiil. We thank ;ilso Scott Johnson for Iris

generous contribution of both specimens and collection

infonnation on the specimens he found in Kwajidien Atoll.

Fiiudly, we are very thankful to the reviewers, M.G. (Jeirv')

Harcusewych and Yuri Kantor for tlieir useful comments,

which helped improve the article, and for additioiiid com¬

ments from Paul Ccdlomon about the Japanese uiunes.

LITERATURE CITED

Bouchet, P. and Yu. I. Kantor, Yu. I. 2004. New Caledonia: the

major center of biodiversity for volutoinitrid mollnsks

(Vlollusca: Neogastropoda; Volutoinitridae). Systeniatics

and Biodiversity 1: 467-502.

Cernohorsky, W.O. 1967a. The Muricidae of Fiji (Mollnsca;

Gastropoda). Part I Subfamilies Muricinae and Tritonalii-

nae. The Veliger 10: 111-315.

Cernohorsky, W.O. 1967b. Marine Shells of the Pacific. Pacific

Publications, Sydney, 248 pp.

Cernohorsky, W.O. 1985. The taxonomy of some Indo-Pacific

Mollnsca. Part 12. With remarks on two American gas¬

tropod species. Records of the Auckland Institute and

Museum 22: 47-67.

Harasewych, M. G. 2011. The living Columbariinae (Gastro¬

poda: Neogastropoda: Turhinellidae) of New Zedand.

Zootaxa 2744: 1-33.

Houart, R. 1992. The genus Chicoreus and related genera

(Gastropoda; Muricidae) in the Indo-West Pacific.

Memoires du Museum national d'Histoire naturelle (A)

154: 1-188.

Houart, R. 2013. Description of two new Chicomurex species

(Gastropoda: Muricidae) from the Philippine Islands.

Novapex 14: 69-75.

Houart, R. and V. Heros. 2008. Muricidae (Molhrsca: Gastro¬

poda) from Fiji and Tonga, in Heros V, Covvie R. H. and

Bouchet, P. (eds) Tropical Deep-Sea Benthos 25.

Memoires dn Museum natioiiiil d'Histoire natureOe 196:

437^80.

Houart, R., C. Moe, and C. Chen. 2014. Chicomurex lani n. sp.

(Gastropoda: Muricidae), a new species from Taiwan and its

intricate history. Bulletin of Malacology, Taiwan 37: 1-14.

Houart, R., C. Moe, and C. Chen. 2015. Description of two new

species of Chicomurex from the Philippine Islands (Gas¬

tropoda: Muricidae) with update of the Philippines species

and rehabilitation of Chicomurex glorios'us (Shikama,

1977). Venus 73: 1-14.

Vlerle, D. 2001 . The spiral cords and the internal denticles of the

outer lip in the Muricidae: terminology and methodological

comments. Novapex 2: 69-91.

Merle, D. 2005. The spiral cords of the Muricidae (Gastropoda,

Neogastropoda): importance of ontogenetic and topological

correspondences for delineatiTig structural homologies.

Lethaia 38: 367-379.

Merle, D., B. Garrigues, and J.-P. Pointier. 2011. Fossil and

Recent Muricidae of the World - Part Muricinae. Gon-

chhooks, Hackenheim, 648 pp.

THE NAUTILUS 131(4):217-225, 2017

Page 217

Bathijacmaea hecki, a new species of pectinodontid limpet

(Gastropoda: Pectinodontidae) from a hydrothermal vent of the

Manus Back- Arc Basin

Shuqian Zhang

Institute of Oceanolog)-

Chinese Academy of Sciences

Qingdao, 266071, CHINA

and

Universitv' of Cliinese Academy of Sciences

Beijing 100049, CHINA

[email protected]

Suping Zhang

Institute of Oceanology

Chinese Academy of Sciences

Qingdao, 266071, CHINA

[email protected]

ABSTRACT

A new western Pacific species of tlie deep-sea limpet family

Pectinodontidae is described from hydrothermal vents in Manus

Back-Arc Basin, at depths of 1714-1853 m. Bathyacmea hecki

new species is most similar by shell moqrhology to its geo¬

graphically closest congener Bathijacmaea jonassoni Beck, 1996,

However, the new species is characterized by a radula with

widened functional lateral teeth, which separates it from other

congeners. Phylogenetic reconstructions based respectively on

partitil sequences of COI and 16S rRNA also support its

placement within Bathyacmea.

Additional Keywords: Patellogastropoda, chemo.synthetic envd-

ronment, radula, deep-sea

INTRODUCTION

The Manu.s Basin is one of the best known hydrothermal

vent areas in the western Pacific, occupying a back-arc

position with respect to the New Britain arc-trench system

and contciining an active plate boundary (Both et cil., 1986).

To date, the gastropod fauna of this area has been studied

by various authors (e.g., Deslmiyeres and Lauhier, 1989;

Beck; 1991; 1992a; 1992b; 1993; Bouchet and Waren,

1991; Waren and Bouchet, 1993), During these studies

more than a dozen species have been reported (for re¬

views see Waren and Bouchet, 2001; Sasaki et al., 2010).

Pectinodontidae Piksbry, 1891 is a family of deep-sea

limpets inliahiting chemosynthetic enrironments {Bathij¬

acmaea Okutani, Tsuchida and Fujikura, 1992 and Ser-

radonta Okutani, Tsuchida and Fujikura, 1992, for review

see Sasaki et al., 2010) and sunken wood [Bectinodonta

Dali, 1882, for review .see Marshall, 1985; Marshtrll et id.,

2016). Species oi’ Bathijacmaea are re.stricted to tlie western

Pacific region. The group so far consists of six recognized

.species, laiown from tlie Edi.son Seamount (Beck, 1996),

Sagami Bay of Japan (Okuttmi et id., 1992), Okinawa Trough

(Okutiud et id., 1993; SiLSidd et id., 2003), Nankid Trough

(Sasidd et id., 2003) mid Soutli Cldna Sea (Zhang et id., 2016).

In the present study, we describe one adcfitional species

oi Bathijacmaea , which was ccdlectetl by ROV Faxian and

a Telexision Grab (based on mother ship RA^ Kexue)

during a research cndse carried out by Institute of

Oceiinology, Cldne.se Academy of Sciences (lOCAS) in 2015.

Bathijacmaea jonassoni Beck, 1996 from die Edison Seiuiiount

represents die geograpldcidly closest taxon to die new sqiecies.

MATERIALS AND METHODS

A totid of 28 specimens (see Table 1) was collected diuing

sevei'id dives of the ROV Faxian iuid Television Grab

(IOC AS) from hydi-odiemiid vent fields, die Pacniimus field

(Binns mid Wheller, 1991) mid Desmos caulchon field (Tufm,

1990). For more detaded infbniiation about diese sites, see

Hasldmoto et id. (1999) mid Foirrre et id. (2006). The materiids

were fixed in 99.5% edimiol immediately after collection.

Light and Scanning Electron Microscopy: The shell

mid soft parts were ohsewed under light microscopy, mid the

radulae using a scmining electron microscope (SEM). For

SEM studies, radiiku- sacs were removed mid placed in

a 10% NaOH solution for 4-5 hours. The radidae were then

dehydrated dirough mi etiimiol series mid Imd on a cover slip to

iiir-dry. Smnples were coated witli gold mid exmnined under

a Hitachi S-3400N scmining electron microscope. Type

materials were deposited at tlie Mmine Biologicid Museum,

Cliinese Academy of Sciences (MBMCAS), Qingdao, Cliina.

Molecular Procedures: Three .specimens of Bathij-

acmaea hecki new species mid one specimen of Bathijacmaea

lactea Zlimig, Zlimig, mid Zlimig, 2016 were subjected to

molecular miiilysis. Genomic DNA was extracted with tlie

Column Genomic DNA Lsolation Kit (Beijing TIANGEN,

Cliina) according to the manufacturer’s instnictions. DNA

were eluted in elution buffer mid stored at -20°C until use.

The COI region was cunplified by polymerase chtiin reaction

(PCR) using tlie primers LCO1490 (forvvtird: S^GCTCAA

CAAATCATAAAGATATTGG-3') aid HG02198 (reverse:

5'-TTAACITGAGGGTGAGGAAAAAATGA43') (Folmer et al.,

1994); the 16S rRNA region was amplified using the

primers IGSar (fonvard: 5^-GGGGTG 1 1 1 ATGAAAAAGAT')

aid 16Sbr (reveree: 5'-GGGGTCTGAAGTGAGATGAGGT-3')

(Paliimbi, 1996). PGR reactions were carried out in a

total volume of 50 fcL, inclnding 1.5 mM MgGl2,

0.2 niM of each dNTPs, 1 |jlM of both fonvard and reverse

PGR primers, lOXbuffer, aid 2.5 U Tacj DNA polymerase.

Thennal cycling was perfbniied under tlie following con-

tlitions: 95°G for 3 inin (initial denaturation), followed by 35

cycles of 95°G for 30s (denaturation), annealing temperature

for 30s (42°G for GOl; 45°G for 16S rRNA), 72°G for 60s

(extension), aid a final exten.sion at 72°G for 10 min. PGR

products were verified by a GelRed-stained 1.5% agarose gel

and purified witli tlie Golumn PGR Product Purification

Kit (Shanghai Sangon, Ghina). Purified products were

sequenced in both directions. For phylogenetic analyses,

GOI and 16S rRNA sequences from the present study and

those from GeiiBank were employed (see Table 2, 3).

Neighbor-joining (NJ) trees were determined via MEGA

6.06 (Tamura et al., 2013), using Kimura 2-parameter

(K2P) motlel (Kimura, 1980). Bootstrap analyses were

performed with 1000 replications.

Table 2. Works from which the COI sequences derived.

Figures 1-6. Bathyacmaea becki new speeies. Sliells. 1. Dorsal, 2. Left lateral, and 3. Ventral view of the Holotype, 1 / .9 inin.

4. Dorsal, 5. Left lateral, and 6. Ventral view of Paratype 1, 17.3 nun.

Page 220

THE NAUTILUS, Vol. 131, No. 4

\-'^-

■’ •'.s'sr'j.j :' 'r,

» i„r.r.«itfZ k. > >.

■10mm

“"10mm

Figures 7-11. Bathyacmaea becki new species. 7. Ventral view of Paratvpe 2. 8. Dorsal and, 9. Lateral view of Parat)'|:)e 7. 10.

Shell margin under SEM and, 10. Under light microscopy, showing microsculpture.

S.-Q Zhang and S.-P. Zhang, 2017

Page 221

Figures 12-14. Bathyacmaea becki new species. Radula. 12. Dorsal view of intact radular segment. 13. Rachidian legion,

arrows indicate vestigial rachidian teeth. 14. Single lateral tooth.

Abbreviations: CN: collection number; 16S rRNA:

16S ribosomal RNA; MBM: Marine Biological Museum;

RN: Registration number.

Type Species: Baihyacnuiea nipponicci Okutmii, Tsuchkbi,

and Fujikura, 1992 (oil Hatsirsliima Islet, Sagtimi Bay, Jap;in,

between depdis of 1110-2000 m).

SYSTEMATICS

Family Pectinodontidae Pilsbry, 1891

Genus Bathyacmaea Okutani, Tsucbida, and Fujikura,

1992

Bathyacmaea becki new species

(Figures 1-16)

Diagnosis: Shell whitish, thin, semi-transparent. Shell

surface sculptured with obsolete, concentric growdh lines,

crossed by veiy hunt ;ixial ridges. Aperture ov'al to nearly

Page 222

THE NAUTILUS, Vol. 131, No. 4

Figure 15. Bathyacmaea becki new species. Dorsal view of

soft parts of Paratyjve 2, with mantle skirt removed. .Alrbrevia-

tions; a: anus; bet: hipectinate ctenidiuni; ct: cephidic tCTitacle;

dg: digest gland; ebv: efferent branchial vein; gon: gonad; in:

intestine; Ik: left kidney; n: neck; pc: pericardium; pm: pidlird

margin; pp: pallid papillae; rk: right kidney; sm: shell muscle:

sto: stomach; ugp: urogenital papilla.

rounded in shape, anterior end slightly narrower. Radiila

fonnnla 0+1 + 0+1+0, lateral teeth trifurcated, with

stniight, stout shaft, all three cusps widened, the

outermost one with truncated tip.

Description: Shell (Figures 1-11) patelliform, thin

(ca. 0.6 mm above aperture margin in holohpe), semi¬

transparent. Outline oval to nearly rounded, longer than

wide, width 71-91% (mean 78%) of the length, anterior

end slightly narrower than posterior end. Profile high for

genus, height 36-50% (mean 42%) of the shell lengtli. Apex

on mid-line slightly anteilor to center of shell, moderately

eroded, protoconch not preserved. All slopes convex, widi

prominent constriction at transition to tlrickened peristoma.

External surf ace whitish, sculptured consisting of concentric

growth lines, crossed by very hiint :ixial ridge (Figures 9, 10,

1 1 ). Aperture slightly concave at sides; mtu'gin tliickened,

slightly reflected.

Soft P.vrts (Figures 3, 6, 7, 15):

Head rounded, stout. Cephalic tentacles short, tapering.

Eyes and oral lappets lacking. Foot sole large, ovate in

shape, anterior pedal gland lacking, no obvious epipo-

diuni; mantle edge with numerous papillae, more de¬

veloped in juveniles (Figure 7). Ctenidium hipectinate,

large, usually extending out of the mantle cavity (Figures

3, 6, arrows). Radular sac not very long for a patello-

gastropod, extending from buccal cavity straight to

middle part of visceral mass (at level of stomach), where

it turns to right to form large loop. Posterior part of

radular sac entirely embedded in digestive gland. In¬

testine blackish due to dark-gray contents. Stomach

moderately large, C-shaped, situated in central position

of visceral mass. Intestine and stomach containing soft,

lumpish material. Gonad situated posteriorly to visceral

mass. Urogenital papilla digitiform, situated right-

anteriorly to visceral mass. Pericardium (Figure 15)

situated left-anteriorly to corner of visceral mass. Left

kidney very small, located to right of pericardium, be¬

tween basal gill and rectum. Pericardium separated from

left kidney, as in some patellogastropods, i.e. Acmaeidae,

Lottiidae, and Neolepetopsidae. Right kidney more

developed, situated at right anterior corner of visceral

mass.

R. vdulx (Figures 12-14):

Docoglossate with formula 0 + 1 +0 + 1+0. Lateral

tooth trifurcated, with straight, stout shaft. Single

lateral tooth ca. 220 p,m long. Innermost cusp relatively

narrow, with pointed tip; middle cusp spoon-shaped,

strongly curved outward; outermost cusp widened, with

truncated tip.

Type Locality: Pacmanus hydrothermal vent field,

Manus Rack-Arc Basin, 3°44'02.329" S, 15r40'39.419" E,

1740 m, hard bottom,.

Type Material: Holotype: RN: MBM285093 (length

17.9 mm, width 15.8 mm, height 8.6 mm), CN: M067,

Dive 33, 12 June 2015, from type locality; paratypes 1-3,

RN: MBM285094, CN: M067, collected with the holo-

ty]ve from Fenway vent in Pacmanus field; from tvpe

locality; paratypes 4-8, RN: MBM285095, CN: M200,

collected by Television Grab (TVG) from Fenway vent

in Pacmanus field, 3°43.728' S 15r40.326' E, 1714 m,

hard bottom, 20 June 2015; paratypes 9-13, RN:

MBM285096, CN: M073, Dive 34, collected from Des-

mos cauldron field, 3°4l'30.352" S 15r5l'56.172" E,

1921 m, 13 June 2015; paratypes 14, 15, RN:

MBM285097, CN: M045, Dive 32, collected Sat:mic Mills

vent in Pacmanus field, 3°43^41.660" S 151°40^09.793" E,

11 June 2015; paratype 16, RN: MBM285098, CN:

M022, Dive 31, collected from Desmos cauldron field,

03°43'40.803" S, 151°40'09.189" E, 10 June 2015;

paratypes 17-21, RN: MBM285099, CN: M087, Dive

36, collected from Desmos cauldron field, 03°42'40.206"

S, 151°52'50.368" E, 14 June 2015; paratypes 22-27,

RN: MBM285100, CN: M129, Dive 39, collected from

Desmos cauldron field, 3°40'54.605" S, 151°5l'47.613"

E, 1853 m, 17 June 2015. All type specimens were

S.-Q Zhang and S.-P. Zliang, 2017

Page 223

COI

0.05

100

99

I\/1F499155 Batfryac/naea beck/ new species

- MG265696 Battiyacmaea lactea

— AB238451 1 Bathyacmaea nipponica

-AB238452.1 Pedinodonta rhyssa

100

99

- AY1 63392. 1 PecHnodonta sp.

AY1 60667.1 Pedinodonta &p-

-FJ9776991 Pardepetopassp

16SrRNA

S'’

I

1

2

O

a

3

sr

I outgroup

Figure 16. Neighbour-joining trees for Pectinodontidae based on suitable COI and 16S rRNA sequences from GenBank and tliis

study. Numbers above branches indicate the bootstrap values.

collected during the CHINA 1501 Vent Cruise of the

RA^ Kexue, via ROV Faxian and Television Grab.

Distribution and Habitat: Pacinanus and Desmos

cauldron field in the Manus Back-Arc Basin, live on

mussels or rock surfiice, at depths of 1714-1921 m.

Etymology: The new species is named after Dr. Lothar

A. Beck, in recognition of his pioneering jobs on the

gastropod fauna of hydrothermal vents, especially in the

Manus Basin.

Remarks: Bathyacmaea becki new species is similar

in shell morphology to its geographically closest con¬

gener Bathyacmaea jonassoni Beck, 1996. However,

the new species differs from B. jonassoni Beck, 1996

and other congeners by having enlarged lateral teeth

with widened cusps of which the outermost one with

a truncated tip. In addition, B. Jonassoni Beck, 1996 has

lateral teeth with much longer and thinner shaft.

Bathyacmaea suhnipponica Sasaki, Okutani, and

Fujikura, 2003 resembles the new species by its simi¬

lar radula. However, in Bathyacmaea suhnipponica , the

innermost cusp of the latertil tootlr is acute, rather than

tnmcated as in Bathyacmaea becki. Moreover, Bathy¬

acmaea .sulmipponica may easily be distinguished from

Bathyacnmea becki by its shell sculpture with a beaded

appearance.

The external anatomy of Bathyacmaea becki new

species approximates that of Bathyacnmea Jonassoni

Beck, 1996 and Bathyacmaea seainda Okutani, Fujikura,

and Sasaki, 1993 (see Sasaki et ah, 2006). It remarkably

differs from them, however, by tlie shape of the distal end

of the urogenitiil papilla (digitiform in the new species in

contrast to bilobed in Bathyacnmea Jonassoni and Bathy¬

acnmea sec'unda). In addition, the outline of the soft parts

of Bathyacmaea secunda is more rounded than that of

Bathyacmaea becki new species.

Examination of the intestine and stomach contents by

microscopy revealed some soft, lumpish mass and black

mineral particles; no other fragments or remains were

observed. The contents may indicate that the new

species could feed on bacterial films grazed off from the

rock and mussel surfaces where they attach, as occurs

with Bathyacmaea secunda (see Sasaki et ah, 2006). The

enlargement of the lateral teetli may make grazing more

effective.

Molecular Analyses: Three partial COI sequences

(representing a single haplotype) and one 16S rRNA

sequence of the Bathyacmaea })ecki, one COI and one

16S rRNA secpiences of Bathyacmaea lactea were ob¬

tained. The sequences have been deposited in GenBank

(see Table 2, 3 for accession numbers). The single se-

(pience tyjoe obtciined from three individuals of the new

species is indicative of a high intraspecific conservation

of the COI sequence. The Neighbor-joining (NJ) trees

(Figure 16) were reconstructed using suitable COI and

16S rRNA sequences from GenBank and this study. The

two NJ trees all show that Bathyacmaea becki new

Page 224

THE NAUTILUS, Vol. 131, No. 4

.species falls into Bathijacmaeci in which, together with

Bathi/acnuiea laciea, it forms a well-snpported sister clade

to Bathijaoiuiea nipjx^tiica Okntiuii, Tsneliida, iuid Fnjfknra,

1 992. \Vith avciilahle inolecnlar data, the analysis ol a 639-hp

fragment of the COI gene resulted in 1% pidmdse distance

between Baihijaamiea hecki and Bathijaoiuiea lactea, 10%

between Bathijaonaea ])ecki and Bathijacuuiea nipponica;

whereas the analysis of a 495-bp fragment of the 16S

rRNA gene showed a 5% painvise distance between

Bathijacmaea hecki and Bathyacmaea lactea and 7%

between Bathijacuuiea hecki and Bathijacuuiea uippouica.

Although tlie smiill pmnvise distance of COI se(jnences

seems not to separate Bathijaoiuiea hecki and Bathijacuuiea

ladea, the 6% ptiinvase distance of 16S rRNA sequences

is enough to warrant a separation of the two species.

Moiphologically, the two species are evidently different

from each other, as evidenced by characters of both shell

and radnla.

ACKNOWLEDGMENTS

We would like to e.xpress our sincere thanks to the crews

of RA^ Kexue for their cooperation dining tlie surv'ey.

Research operations in the Manus Back-Arc Basin were

carried out under permission from the government of

Papua New Guinea, through a formal diplomatic decla¬

ration. This research was financially supported by the

National Natural Science Foundation of China (No.

41606162), Key Research Program of Frontier Sciences,

CAS (QYZDB-SSW-DQC036) and RA^ Kexue Senior

User Project KEXUE2()17G05.

LITTERATURE CITED

Aktipis, S.W. and G. Giribet. 2010. A pliylogeny of Vetigas-

tropoda and other “archaeogastropods”: re-organizing old

gastropod ciades. Invertebrate Biolog)' 129: 220-240.

Aktipis, S.W. and G. Giribet. 2012. Testing relationships among

the vetigastropod taxa: a molecular approach. Journal of

Molluscan Studies 78: 12-27.

Beck, L.A. 1991. Olgaconcha tiifari u. gen. et n. sp. — a new

mesogastropod (Gastropoda: Prosobranchia) from hydro-

thermal vents in the Manus Back-Arc Basin (Bismarck

Sea. Papua New Guinea). Annalen des Naturhistorischen

Museums in Wien 92 (B): 277-287.

Beck, L.A. 1992a. Two new neritacean limpets (Gastropoda:

Prosobranchia: Neritacea: Phenacolepadidae) from active

hydrothermal vents at Hydrothermal Field 1 AVienerwald”

in the Manus Back-Arc Basin (Bismarck Sea, Papua-New

Guinea). Annalen des Naturhistorischen Museums in Wien

93(B): 259-275.

Beck, L.A. 1992b. Sijmiiietrouiphalm hageni sp. n., a new

neomphalid gastropod (Prosobranchia: Neomphalidae)

from hydrothermal vents at the Manus Back-Arc Basin

(Bismarck Sea, Papua New Guinea). Annalen Des Natur¬

historischen Museums in Wien Serie B Fiir Botanik Und

Zoologie 92B: 277-87.

Beck, L.A. 1993. Moqrhological and anatomical studies on a new

lepetodrilaeean limpet (Gastropoda, Prosobranchia) from

hydrothermal vents at the Manus Back-Arc Basin (Bismarck

Sea, Papua New Guinea). Annalen des Naturhistorischen

Museums in Wien 94/95(B): 167-179.

Binns, R.A. and G.E. Wheller. 1991. Report on the PAGLARK-

V/PAGMANUS-1 cniise, RA^ Franklin, Woodlark and

Manus Basins, Papua New Guinea. GSIRO Div'ision of

Ex|oloration Geoscience Restricted Report 263R, 107 pp.

Both, R., K. Grook, B. Taylor, S. Brogan, B. Ghappell, E.

Erankel, L. Liu, J. Sinton, and D. Tiffin. 1986. Hydro-

thermal chimneys and associated fauna in the Manus Back-

Arc Basin, Papua New Guinea. Eos Transactions American

Geophysical Union 67(21): 489-490.

Bouchet, P. and A. Waren. 1991. Ifreineria nautilei, a new

gastropod from hydrothermal vents, probably associated

with .symbiotic bacteria. Gomptes Rendus de I'Academie

des Sciences, series HI 312: 495-501.

Desbniyeres, D. and L. Laubier. 1989. Paralvinella hessleri, new

species of Alvinellidae (Polychaeta) from the Mariana Back-

Arc Basin hydrothermal yents. Proceedings of the Bi¬

ological Society of Washington 102(3): 761-767.

Eolmer, O., M. Black, W. Hoeh, R. Lutz, and R. Vrijenhoek.

1994. DNA primers for amplification of mitochondrial

cv'tochrome c oxidase submit from diverse metazoan in¬

vertebrates. Molecular Marine Biology and Biotechnology

3: 294-299.

Fourre, E., P. Jean-Baptiste, J.L. Gharlou, j.P. Donval, and J.l.

Ishibashi. 2006. Helium isotopic composition of hydro-

thermal fluids from the Manus back-arc Basin, Papua New

Guinea. Geochemical Journal 40: 245-252.

Hashimoto, J., S. Ohta, A. Eiala-Medioni, J.M. Auzende, S.

Kojima, M. Segouzac, Y. Eujiwara, J.G. Hunt, K. Gena, T.

.Miura, T. Kikuchi, T. Yamaguchi, T. Toda, T, H. Ghiba, S.

Tsuchida, J. Ishibashi, K. Heniy', M. Zbinden, A. Pniski, A.

Inoue, H. Kobayashi, J.L. Birrien, J. Naka, T. Yamanaka, G.

I.aporte, K. Nkshimura, G. Yeats, S. Malagun, P. Kia, M.

Oyaizu, and T. Katayama. 1999. Hydrothermal vent com¬

munities in the Manus Basin, Papua New Guinea: Results

of the BIOAGGESS cruises ’96 and ’98. luterRidge News

8(2): 12-18.

Kimura, M. 1980. A simple method for estimating evolutionary

rate of base substitutions through comparative studies of

nucleotide sequences. Journal of Molecular Evolution 16:

111-120.

.Marshall, B.A. 1985. Recent and Tertiary deep-sea limpets of

the genus Pectinodonta Dali (Mollusca: Gastropoda) from

New Zealand and New South Wales. New Zealand Journal

of Zoology 12: 273-282.

Marshall, B.A., N. Puillandre, J. Lambourdiere, A. Gouloux, and

S, Samadi. 2016. Deep-sea wood-eating limpets of the

genus Pectinodonta Dali, 1882 (Mollusca: Gastropoda:

Patellogastropoda: Pectinodontidae) from the tropical West

Pacific. In: Heros, V., Strong, E. and Bouchet, P. (eds.)

Tropical Deep-Sea Benthos volume 29, Memoires du

Museum national d’Histoire naturelle. Publications Sci-

entifiques du Museum, Paris: 235-265.

Nakano, T. and T. Ozawa. 2007. Worldwide phylogeography of

limpets of the order Patellogastropoda: molecular, mor¬

phological and palaeontological ev'idence. Journal of Mol¬

luscan Studies 73: 79-99.

Okiitani, T., K. Eujikura, and T. Sasaki. 1993. New taxa and new

dlstribubon records of deep sea gastropods collected from or

near the chemosynthetic communities in die Japanese waters.

Bulletin of National Science Museum .series A: 123-143.

Okutani, T., E. Tsuchida, and K. Eujikura. 1992. Eive bathyal

gastropods living within or near the Cfl/(/pfogenrt-communitv’

of the Hatsushima Lslet, Sagami Bay. Venus 51: 137-148.

S.-Q Zhang and S.-P. Zhang, 2017

Page 225

Paluinbi, S.R. 1996. Nucleic acid.s II: the polyinera.se chain

reaction. In: Hillis, D., C. Moritz, Molecular Systeinatics.

Sinauer, Sunderland, 205-247.

Sasaki, T., A. Waren, Y. Kano, T. Okutani, and K. Fujikura. 2010.

Gastropods i'roin recent hot vents and cold seeps: sys-

teniatics, diversitv' and life strategies the vent and seep

biota. Topics in Geobiology 33: 169-254.

Sasaki, T., T. Okutani. and K. Fujikura. 2003. New taxa and

new records of patelliform gastropods associated with

cheinoautosvaithesis-based communities in Japanese wa¬

ters. The Veliger 46: 189-210.

Sasaki, T., T. Okutani, and K. Fujikura. 2006. Anatomy of

Bathijocmaea secunda Okutani, Fujikura and Sasaki,

1993 (Patellogastropoda: Acmaeidae). journal ot Molluscan

Studies 72: 295-309.

Tainunr, K., G. Steelier, D. Petei-son, A. Filip.ski, and S. Kuniiir. 2013.

MEGA6: Moleculiir Evolutionary' Genetics Aiiiily’sLs Version

6.0. Molecular Biologv’ imd Evolution 30: 2725-2729.

Tnfar, W. 1990. Modem hydrothermal activ'ity, formation ol

complex massive sulfide deposits and associated vent

communities in the Manns Back-arc Basin (Bismarck Sea,

Papua New Guinea). Mitteilung der Osterreichen Geo-

logischen Gesellschaft 82: 183-210.

Waren, A. and P. Bouchet. 1993. New records, species, genera,

and a new family of astropods from hydrothermal vents and

hydrocarbon seeps. Zoologica Scripta 22: 1-90.

Waren, A. and S. Bengtson, S.K. Gollredi, and C.L.van Dover.

2003. A hot-vent gastropod with iron sulfide dermal

sclerites. Science 302(5647): 1007.

Waren, A. and P. Bouchet. 2001. Gastropocki and Monoplacophora

from hydrothermal vents and seeps; new taxa and records. The

Veliger 44: 116-231.

Zhang, S.Q., j.L. Zhang, and S.P. Zhang. 2016. A new species

of Batiujacmaea (Gastropoda: Pectinodontidae) from

a methane seep area in the South China Sea. The Nautilus

130: 1-4.

THE NAUTILUS 131(4);226-232, 2017

Page 226

Four new Vetigastropoda (Anatomidae, Seguenziidae) from the

northeastern Paeifie

Daniel L. Geiger

Santa Barbara Musenin of Natural Historv

2559 Puesta del Sol

Santa Barbara, CA 93105, USA

[email protected]

ABSTRACT

Four new species of small to mimite Vetigastropoda from two

families are described: in the Anatomidae, Anatoma georgii new

species from the intertidal of Alaska, with its radula illustrated; in

the Seguenziidae, Carenzia golikovi new species, Astlieh/s careiji

new species, and Segttenzia macleani new species, all from

abyssal depth of the northeastern Pacific.

INTRODUCTION

Anatomidae wa.s recently globally revi.se(l by Geiger

(2012), with .sub.sequent select additions and correc¬

tions by Piinenta and Geiger (2015) and Micali and Geiger

(2015). The family comprises 83 valid species. There is

generally less material available from higher latitudes,

which in part explains that new tmxa from relatively shallow

waters can still be discovered. Thus far, five species are

known from the northeastern Pacific: Anatoma concinna

(A. Adams, 1962), A. discifonnis (Golikov and Sirenko,

1980), A.janetae Geiger, 2006, A. kelseyi (Dali, 1905), and

A. lijra (Berrv, 1947).

Seguenziidae is a relatively sniidl family with some 190

valid species Listed in the World Register of Marine

Species (Bouchet, 2010). It is generally a deep-water

group, with relatively little material available. The most

significant contributions have been those of Marshall

(1983, 1991), Quinn (1983a; 1983b; 1987; 1997), and

Poppe et al. (2006). While the group once was considered

a deep divergence within archaeogastropods, in the

suborder Seguenziina (Salvini-Plawen and Haszpnniar,

1987), it is now recognized as a specialized off-shoot witliin

the kirger Troehoidea (Kano, 2008; Geiger, 2012). Studies of

the northccisteni Pacific molluscim fauna have liad sporadic

contributions by D;ill (1908; 1919), Rokop (1972), Quinn

(1983a; 19831)), mid McLemi (1985); tlie number of valid

species is subject to ongoing revisioiicuy work.

The present contriliution is part of the ongoing fauiicil

revision of the northeastern Pacific gastropods. The

project was initiated by the late James H. McLean

(1936-2016), and is continued by D.L. Geiger, L. Groves,

and J. VTndetti (editors; see www.nepacific.org).

MATERIALS AND METHODS

StcUidard methods for scanning electron microscopy (SEM)

were used ms detailed in Geiger et al. (2007) mid Geiger

(2012). Teniiinology for Anatomidae follows Geiger

(2012), wliile no specialized tenuinology was necessarv’ for

Seguenziidae. Unless specified, lueasurements refer to max¬

imum dimension. Institution;il abbreviations used are: lAGM:

Natural History Museum of Los Angeles Gounty, Los

Angeles, Galifoniia, USA; SBMNH: Smita Bcmbara Museum

of Natural Historv', Galifoniia, USA.

SYSTEMATIGS

Anatomidae McLean, 1989

Anatoma Woodward, 1859

Type Species: Anatoma crispata Eleming, 1828 (sub¬

sequent de.signation Geiger, 2012: 734).

Anatoma georgii new species

(Eigures 1-18)

Misidentification; Anatoma hjra (Berry', 1947): Geiger,

2012 (in part): fig. 784A (it is A. georgii new .species).

Description: Shell small (1.36 mm, holotype 1.17 mm),

trochiform depressed. Protoconch of 3/4 whorl, no

apertural varix, apertural margin slightly sinusoid,

flocculent sculpture. Teleoconch 1 of 2/3 whorl, finest

growth lines only. Teleoconch 11 of up to 1 1/8 whorls.

Shoulder slightly convex, with finest growth lines

(Figure 12), last 1/8 whorls with about a dozen finest

spirtil threads. Suture impressed, sutsel about as wide as

selenizone. Base biconvex, with distinct ridge at mid point,

without constriction below selenizone, same sculpture of

finest spiral threads as on shotilder, periumbiliccil cord

D.L. Geiger, 2017

Page 227

distinct, no funiculus. Umbilicus moderately wide. Aperture

sulxpiadratic. Selenizoue at peripheiy', rather uaiTow for

genus, keels low, slit open wdth parallel uuu-gius.

Auiuxil with eyes. Radula rhipidoglossate, raduku- iuterkx'k

moderate (Figures 14-15). Racliidian tooth triiuigukir, cusp

with ceutuil denticle ku-gest, 4-5 smiiller ones on each side

(Figure 15). Liiteral teetli 1-4 simiku', cusp watli 3-4 den¬

ticles, apiccilmost ku'gest (Figure 15). Lcitercil tooth 5 en-

krrged, approximately six denticles ;ilong inner edge of cusp,

2-3 iilong outer edge (Figure 16). Margin;il teetli without

food groove (Figure 17); inner marginal teeth with triiuigukir

cusp watli 2-4 clenticles on each side; outer marginal teedi

with spoon-shaped cusp, niiuiy fine denticles (Figure IS).

Type Material: Holotype SBMNH 472248, diy shell

with animal; paratypes SBMNH 469832 (1, in 70%

ethanol, probably formalin fixed), SBMNH 469836 (1 in

70% ethanol, probably formalin fixed, 2 dry, radula on

stub), SBMNH 469837 (2 in 70% ethanol, prohalily for¬

malin fixed). All from type locality.

Type Locality: Hawk Inlet, Sakagway-Hoonali-Angoon

County, Alaska, USA, 58.1237° N, 134.7553° W, intertidal.

Etymology: Named for naturalist and viola d’amore

rirtuoso, scholar, and teacher Thomas (Tom) Georgi for

his masterful and nuanced inteqoretation of early music,

particularly his tasteful gestures and ornamentation

(Georgi, 2000; 2006; 2007; 2008), and for generously

sharing his wealth of knowledge with players around the

world, including the author.

Distribution: Alaska mciinland to Aleutitui Islands, USA.

Remarks: The northeastern Pacific Anatoma species

differ from A. georgii as follows. Anatonui concinna has an

overall globular shape (not lenticular) and has strong axial

and spiral cords on shoulder and base. Anatoma dls-

cifonnis shares the lenticular overall shape, hut has cfis-

tinct iodal and spiral sculpture on shoulder and base of

the teleoconch. Anatonui janetae grows much larger

(3.8 mm); the early teleoconch has clistinct axial cords in

conjunction with the finer spiral lines. Anatonui keenae is

overall more turreted, and has strong axial and spiral cords

on shoulder and base. Anatoma hjra is proportiontilly

taller and has axial sculpture of variable strength and

a spiral cord in the position of the selenizoue.

One specimen illustrated by Geiger (2012: fig. 784A) as

a small specimen of A. lijra in fact is A. georgii. The

specimen was also collected in very shallow water (7 m) on

Attu Island, Alaska (LAGM 79-71). It is a further example

that multiple specimens of a new species help in its

recognition. Early whorls of tnie A. lijra all have chstinct

axial sculpture, have a spiral cord in the position of the

selenizone, and also have a proportionally wider seleni-

zone. Accorthngly, specimens of the new species are not

juveniles of A. hjra, but the previously figured specimen

was not recognized as being distinct.

Most Anatoma species are found between 100-1000 m

depth; only a few are known from very shallow, and even

intertidal waters, such as A. parageia Cfeiger and Sasaki,

2009, from sonthern Japan. Both species are among the

smaller members of the genns Anatonui.

Other .species with some shallow water records (<5 m/all

records) include A. anujdra Geiger ;urd Miirslaill, 2012

(1/135 records), A. aspera (Philippi, 1844) (4/273 records), A.

amkn (d’Orbigny, 1841) (1/25 records), A crispata (Fleming,

1828) (2/145 records), A. jiemingi (Marshall, 2002) (1/32

records), A.///in,sr/ Geiger, 2012 (4/10 records), A. orhiculata

Geiger, 2012 (1/3 records), A. philippiniai (Bandel, 1998)

(2/47 records), A. jmmdoequatoiia (Kay, 1979) (5/76 records),

:md A. rapaemis Geiger, 2008 (1/62 records). For tliose spe¬

cies with low frecpiency of shiiUow water occuiTences, tire re¬

cords cire ratlier m indication of {X)st-mortem tnuisport radier

tluin extensive batliymetric nuige. The tme bathymetric (x-

currence of tire above species is impossible to detennine

based on empty .shells done. The frecjuency of rec'ords given

above is t:iken as iui uncertdn proxy to the true nmge.

The illustrated shells still have some sediment attached

to thejii. Because all material had been stored in fluid, it is

extraordinarily fragile. The customary cleaning in an ul¬

trasonic bath would most likely have shattered the

specimens. Accordingly, the specimens were not further

cleaned. Fortunately, all characters are sufficiently clear to

permit an unambiguous assessment. Note that the ap¬

erture appears detached in the illustrated parat)qies

(Figure 5-11), and the sutsel appears wider than the width

of tlie selenizone, contrary to the description. Those

apparent tliscrepancies are artifacts due to the broken

nature of the paratypes, as seen in the apical views.

The radula has no special attributes. It is the most

common configuration in Anatomidae; see Geiger (2012)

for extensive illustrations.

Seguenziidae Verrill, 1884

Remarks: The subfamilies and tribes introduced by

Marshall (1991) lack unique diagnostic characters, and the

cited character states vary widely within the tiixa and

overlap significantly among tiixa. Marshall (1991: 46)

noted the gradual changes amongst character states, and

indicated that his tribes should rather be viewed as “in¬

formal groupings”. The acceptance of a higher tcixon by

other authors does not mitigate the underlying issue of

overlapping character states. Accordingly, none of those

names are used here. A multivariate moiphospace or

phylogenetic aiiiilysis may clarify the validity’ of those

higher tiixa. The most detailed phylogenetic analysis only

contains four seguenziids (Kano, 2008).

Carenzia Quinn, 1983

Type Species: Seguenzia carinata Jeffreys, 1877

(original designation).

Description: Shell conical, smooth, peripheiy carinate,

mid-whorl carination more or less chstinct; base convex,

umbilicus narrow; apertural sinuses at periphery and base

indistinct.

Page 22S

THE NAUTILUS, Vol. 131, No. 4

Figures 1-12. Shells of Anatoma georgii new species. 1^. Holotvpe SBMNH 473348. 5-11. Parappes SBMNH 4/2236. Hawk

Inlet, Sakagway-Hoonah-Angoon Counp', Alaska, USA, 58.1237 ° N, 134.7553° W, intertidal. Seale bars: shells = 1 inni; protoconch =

100 pin. 12. Enlargement of’ apertnr;il margin of holotvpe shovUng finest spiral threads. Scale bar = 100 pm.

Carenzia golikovi new species

(Figures 19-22)

Description: Shell to 5 inm, trochiform; whorls five,

rounded; carinatiou on mid shoulder; hase convex, good

dozen irregularly spaced, spiral lines of variable strength;

apeilnre snlxpiadratic, umhilicus narrow, with indistinct

funiculus; tixial growth lines indistinct.

Type Material: Holotype LACM 3317, Oregon

State University, RA^ Wkcom.-v (BMT 535), 19 August

1976; paratypes (2) LACM 3318, 5100 m, Aleutian

Trench (ne:u' western end of chiiin), 52°12^ N, 175°44^ E,

RomcUi Egorov, via Roger Clark iuid Ross Mayhew.

Type Locality: Abyssal plain W of Oregon, S of Gulf of

Alaska, 5180 m, 45°0(y N, 153°47.7' W to 45°02.3' N,

153°55.9' W.

Distribution: Aleutian Trench, 52° N, 176° W, to S

Gnlf of Alaska, 45° N, 154° W, 5100 m.

Etymology: Niuned for Russian m;ilacologist AlekscUidr

Nikolaevich Golikov (1931-2010).

D.L. Geiger, 2017

Page 229

Figures 13-18. Radula oi Anatoma georgii new species. 13. Entire radula. 14. Full wddth of radula. 15. Central field enlarged.

16. Lateral tooth 5 and marginal teeth. 17. Cusps of marginal teeth. 18. Outermost marginal teeth. Scale bars: Figures 13-14 = 100 (xni;

Figures 15-18 = 10 (xin.

Remarks: The overall shell morj^hology and the thin

nacreous lining of the shell suggests placement in

Seguenziidae. The closest genus is Carenzia, with the

absence of strong axial sculpture and the spiral keels

at the periphery and on the shoulder of the shell. In

C. golikovi, however, only the keel on the mid-shoulder

is present, while the keel at the periphery is not visible.

It is notable that the spiral sculpture on the base starts

right at the periphery, for which reason one could

consider the uppermost spiral a reduced peripheral

keel.

The most similar species in the northeastern Pacific

include C. inennis Quinn, 1983, with a more basal

carination and more inflated whorls. Carenzia nitens

Marshall, 1991 from New Caledonia shares the

smooth surface of the whorls, which, however, are

biangulated.

Asthelys Quinn, 1987

Type Species: Basilissa rnunda Watson, 1879 (original

designation).

Description: Shell small, biconical, bicarinate whorls

macroscopically smooth, aperture trapezoidal.

Asthelys careyi new species

(Figures 23-24)

Description: To 7 mm, white; whorls five, smooth,

slightly inflated; suture weakly impressed, base convex,

smooth; basal angulation slightly projecting, with small

channel above, resulting in weakly bicarinate configura¬

tion; aperture trapezoidiil, umbilicus represented by

narrow chink; bordered by narrowed columellar waill.

Type Material: Holotype LACM 3320, Oregon State

University, RA^ Wecoma (BMT 535), 19 August 1976.

Type Locality: Abyssal plain W of Oregon, S of Gulf of

Alaska, 5180 m, 45° 00' N, 153° 47.7' W to 45° 02.3' N,

153° 55.9' W.

Distribution: Only knowm from bolortpe.

Etymology: Named for Professor Andrew Carey of

Oregon State University, Corvallis.

Page 230

THE NAUTILUS, Vol. 131, No. 4

Remarks: Tlie species is placed in the genus Astlieh/s

for its conical overall shape and the diagnostic biangnlate

whorls (Quinn, 1987). That hiangulation, though, is very

subtle in A. careiji, amounting to not much more than

a pair of parallel spiral ridges. It is the first represen¬

tative of the genus from the northern Pacific. The other

congeners are known from the Atlantic Ocean and New

Caledonia.

The most similar species in tlie northeastern Pacific is

Carenzia iiieniiis (Quinn, 1983), which has a more tro-

chiform overall shell shape, more inflated whorls,

a rounded aperture, and a narrow yet distinct umbilicus.

Seguenzia Jeffreys, 1876

Type Species: Seguenzia fonno.sa Jeffreys, 1876

(monotypy).

Description: Shell to 10 mm, thin, fragile, umbilicate

or anomphalous, external and internal surfaces with na¬

creous luster. Apertural Lip bordering the three labral

sinuses often flaring in mature .shells. Columella curv'ed,

ending abmptly. Sculpture of narrow spiral carinae and

basal cords, fine spiral threads and shaqr axial rihlets

cuAlng parallel to the lahral sinuses.

Figures 19-28. New species of Seguenziidae. 19-22. Carenzia golikovi new species. 19-20. Holoty]re LACM 3317, abysstil plain

W of Oregon, S of Gulf ol Alaska, 5180 in, approximately 45° N, 153.8° W, height 5.3 inm. 21-22. Paratyjres LACM 3318, Aleutian Trench

(near western end of chain), 5100 m, 52°12' N, 175°44' E. 23-24. Asthelys careyi new species. Holoty|re LACM 3320, abyssal

plain W of Oregon, S of Gulf of Alaska, 5180 m, approximately 45° N, 153.8° W, height = 7.0 mm. 25-28. Seguenzia macleani new

species. 25—26. Holotype, LACM 3321, Aleutian Trench, 5100 m, 175° 44^ E, -55° 30^ N, height = 8.7 nun. 27-28. Paratvpe LACM

.3486, abyssal plain \V of Oregon, S of Gulf of Alaska, approximately 45° N, 153.8° \V, height = 9.6 mm. Photos by James H. McLeau.

D.L. Geiger, 2017

Page 231

Segtienzia macleani new species

(Figures 25-28)

Description: Shell 9.6 mm (holotvpe), 8.7 mm (para-

tvpe), trochiform; whorls four, inflated, suture little

impressed; spiral cords decreasing in strength from

shoulder to base, one on shoulder, one at suture, ap¬

proximately a dozen on base with stronger spirals ran¬

domly interspersed amongst the fine ones; crossed by axial

lines decreasing in strength from suture to umbilicus:

fewer stronger ones (holotvpe) or more numerous finer

ones (paratxpe); aperture rounded; umbilicus wide, no

funiculus; columella not thickened.

Type Material: Holotype LACM 3321 (Figs 25-26),

Roman Egorov, via Roger Clark and Ross Mayhew;

paratype LACM 3485 from type locality; paratype

LACM 3486 (Figures 27-28), abyssid pkiin W of Oregon,

S of Gulf of Alaska, 5180 m, 45° OO' N, 153° 47.7' W to 45°

02.3' N, 153° 55.9' W, Oregon State University, RA^

Wecoma (BMT 535), 19 August 1976.

Type Locality: Aleutian Trench (near western end of

chciin), 5100 m, 175° 44' E, -55° 30' N.

Distribution: Abyssal pkiin off Alaska imd Oregon, 45° N,

5100-5180 m.

Etymology: The species honors James H. McLean,

who first recognized this new species.

Remarks: The most similar species is S. cerveola Dali,

1919, which differs from S. nuicleani by the thickened

columella and the columellar chink partially covering the

umbilicus. This distinction cannot be explained by size,

because the larger S. macleani lacks the thickening. Ad¬

ditionally, the spiral sculpture is stronger in S. cerveola.

DISCUSSION

The present contribution adds adchtional taxa of micro-

mollusks to the northeastern Pacific malacofauna. The

chversity of Anatomidae, now with six recognized species,

is at the lower end in relation to those of other temperate

regions. Difficulty to reach the deep-water habitats of

most Seguenziidae makes an assessment of their true

diversity very challenging, because of limited availability

of samples from >200 m, with abyssal plain habits being

particularly understudied. The less than one dozen species

diversity in the northeastern Pacific is similar to that of sLx

species known from Japan (Okutani, 2017).

The specimens of A. georgii were found in voucher

material from an ecological study deposited at SBMNH

and identified as “Scissurella sp.” Tins is an instance that

confirms the paradigm that new fieldwork is not necessarily

required for the discovery of new taxa. The backlog of

unprocessed material in natural history collections repre¬

sents a highly valuable and readily accessible source for

adchtional material. Given the ever more restrictive per¬

mitting requirements and import-export complications,

working up backlog material is an excellent and cost-

effective strategy for discovering new taxa.

ACKNOWLEDGMENTS

Bnice Marshall and an anonymous reviewer made con-

stnictive comments to improve the manuscript. Jose 11.

Leal provided editorial guidance. Lindsey Groves pro¬

vided registration numbers for the LACM types.

LITERATURE CITED

Bouchet, P. 2010. Seguenziidae. In: MollnseaBa.se (2017).

Accessed through: World Register of Marine Species at

http:/Awv\v.inarinespecies.org/aphia.php?p = taxdet;iils&id

=23116 on 2017/11/14.

Dali, W.H. 1908. Reports on the dredging operations ofl tlie

west coast of Central America to the Galapagos, to the west

coast of Mexico, and in the Gulf of California XIV. The

Mollnsca and Brachiopoda. Bulletin of the Mnsenin of

Comparative Zoology, Harv'ard 43: 20.5-487, pis. 1-22.

Dali, W.H. 1919. Description of new species of Mollnsca from

the North Pacific Ocean in the collection of the United

States Nationtil Mmseum. Proceechngs of the United States

National Museum 56: 29i3-371.

Geiger, D.L. 2012. Monograph of the Little Slit Shells. Santa

Barbara Museum of Natuivil History, 1291 pp., 1042 figs., 5

color plates, 11 identification cards.

Geiger, D.L., B. Marsliall, W.F. Ponder, T. Sasaki, and A.

Waren. 2007. Techniques for collecting, handling, and

preparing small molluscan specimens. Molluscan Research

27 (Special Issue): 1-50.

Georgi, T. 2000. Many Strings Attached. Eighteenth Century

Music for \dola d’amore. Georgi, Toronto.

Georgi, T. 2006. Attilio Ariosti, The StiX'kholm Sonatas I. Lessons

and Sonatas for Viola d'amore. BlS-CD-15.35, Akersherga.

Georgi, T. 2007. Attilio Ariosti, The Stockholm Sonatas II.

Recueil de Pieces pour la Viola d'amour, part 1. BIS-CD-

1,5.55, Akersherga.

Georgi, T. 2008. Attilio Ariosti, The Stockholm Sonatas III.

Recueil de Pieces pour la Viola d’amour, part 2. Pur alfin

gentil viola. BIS-CD-1675, Akersherga.

Kano, Y. 2008. Vetigastropod phylogeny and a new concept of

Seguenzioidea: independent evolution of copulatory organs

in the deep-sea habitats. Zoologica Scripta 37: 1-21.

McLean, J.H. 1985. Two new northeastern Pacific g;istropods of

the families Lepetidae and Seguenziidae. The Veliger 27:

336-338.

Manshidl, B.A. 1983. Recent and Tertiary Seguenziidae (Mollnsca:

Gastropoda) from the New' Zealand Region. New Zealand

Journal of Zoology 10: 235-262.

Marshtill, B.A. 1991. Seguenziide from New Caldedonia and the

Loyalty Islands. Resultats de Campagnes MUSORSTOM 7,

Memoires du Museum nation;il d'Histoire naturelle (A)

150: 41-109.

Micali P. and D.L. Geiger. 201,5. Additions :uid corrections to the

Scissurellidae ;ind Anatomidae (Gastropoda Vetigastropoda) of

die Mediterranean Sea, widi first record of Sineznna smiiaisiata

Bumay and Rolan, 1990. Biodiversity Journal 6: 703-708.

Okutani, T. 2017. Family Seguenziidae. In T. Okutani (ed.).

Marine Mollnsca in Japan, second edition. Tokai University-

Press, Kanagavva, p. 767, pi. 37.

Pimenta, A.D. and D.L. Geiger. 201,5. Taxonomic revi.sion of the

Anatomidae (Mollnsca: Gastropoda: Vetigastropoda) from

Page 232

THE NAUTILUS, Vol. 131, No. 4

Brazil, with description of four new species. Malacologia 59:

135-175.

Poppe, G.T., S.P. Tagaro, and H. Dekker. 2006. The Seguen-

ziidae, Cliilodontidae, Trochidae, Calliostoinatidae and

Solariellidae of the Pliilippine Islands. Visaya Supplement

2: 1-228.

Quinn, J.F., Jr. 1983a. Carenzia, a Tiew genus of Seguenziacea

(Gastropoda: Prosohranchia) wath the de.scription of a new

species. Proceedings of the Biological Society of Washington

96: 355-364.

Quinn, j.F., ]r. 19831). A reWsion of the Seguenziacea Verrill,

1884 (Gastropoda: Prosohranchia). 1. Summary and eval¬

uation of the superfamily. Proceedings of the Biological

SocieW of Washington 96: 725-757.

Quinn, J.F., ]r. 1987. A revision of the Seguenziacea Verrill,

1884 (Gastropoda: Prosohranchia). II. The new genera

Hadrocoims, RoteUenzia, and Astheh/s . The Nautilus 101:

59-68.

Quinn, J.F. 1991. Systematic position oi Basilissojjsis and Giittula,

and a discussion of the phylogeny of die Seguenzoidea

(Gastropoda: Prosohranchia). Bulletin of Marine Sciences

49: 575-598.

Rokop, F.J. 1972. Notes on abyssal gastropods of the eastern

Pacific, with descriptions of three new species. The Veliger

15: 15-19, 2 pis.

Salvlni-Plawen, L.v. and Haszpninar, G. 1987. The

Vetigastropoda and the systeniatics of streptoneurous

Gastropoda (Mollusca). Journal of Zoology 211: 747-770.

THE NAUTILUS 131(4):233-239, 2017

Page 233

First Cretaceous record of the gastropod Exilia

(Neogastropoda: Ptychatractidae) from the northeastern Pacific

Richard L. Squires

Department of Geological Sciences

Califoniia State Universitv

Northridge, CA 91330-8266 USA

and

Invertebrate Paleontology'

Natural History Museum of Los Angeles County

LiOS Angeles, CA 90007 USA

[email protected]

Mary S. Stecheson

224N. Alta \4sta Ave.

Monrovia, CA 91016 USA

[email protected]

ABSTRACT

A new species of the ptychatractid neogastropod. Exilia ste-

chesonae Squires, is described from Upper Cretaceous (upper

lower to lower upper Campanian) strata in southern Ctdifornia.

It is found predominantly in the lower and middle parts of the

Chatsworth Formation in the Simi Hills, Los Angeles and

V'entura counties, and in the Pleasants Sandstone Member of the

Williams Formation in the Santa Ana Mountains, Orange

County. Specimens lived at shelhil depths and were subject to

post-mortem transport into deeper waters. The new species is

first Cretaceous record oi' Exilia Conrad, 1860 in the northeast

Pacific.

Additional Keywords: Dayton Canyon, Bee Canyon, Paleofiisimitra

INTRODUCTION

Neogastropods, which are among the geologically youn¬

gest of all the gastropod groups, first appeared in the

Cretaceous. Their increasing diversity, especially during

the Late Cretaceous, is one of the major features of

gastropod evolution (Sohl, 1987; Harasewych et til., 1997).

According to Kantor (2002), one of the most primitive of

the neogastropods is family Ptychatractidae Stimpson,

1865, whose fossil record is based predominantly on

Exilia Conrad, 1860. The geologic range oi Exilia is Late

Cretaceous (Coniacian) to Holocene (Kantor et al., 2001).

During the Maastrichtian, Exilia became more wide¬

spread globally, and this expansion continued into the

early Cenozoic. Several Paleocene, Eocene, and early

Oligocene Exilia species are present in the northeast

Pacific (Bentson, 1940; Squires, 2003).

Tliis present study concerns the recognition of a new

species. Exilia stechesonae Squires, from shallow-marine

Upper Cretaceous (Campanian) beds in tbe Chat.sworth

' Research Associate.

and Williams fonuations in southern California (Eigure 1).

It is the first Cretaceous occurrence of Exilia in the

northeast Pacific region. Additional significance of the

new species is that is helps to better understand the early

evolution oi Exilia. The senior author, Squires, is the

sole author of this new speeies.

MATERIALS AND METHODS

The new species is based on 40 specimens stored in the

Invertebrate Paleontology Collection of tbe Natural

Histoiy Museum of Los Angeles County. Details about

the localities of the new species are given in Appendix 1.

Cleaning of apertures and cutting of a few longitudinal

cross sections were done mostly by others using a hand¬

held, high-speed drill with diamond-coated drilling

wheels. The classification system of Bouchet (2014) is

followed here, but the “subclass” and “order” categories

remain in a state of flux. Moqihologic terms are from

Cox (1960a).

Abbrevfiations used in tbe text are: CIT: California

Institute of Technology, Pasadena (collection now stored

at LACMIP); CSUN: California State University’, Noitliridge

(collection now stored at LACMIP); LACMIP: Natural

History Museum of Los Angeles County, Invertebrate

Paleontology; UCLA: University of Califoniia at Dis Angeles

(collection now stored at LACMIP); VIPM: Vancouver

Island Paleontological Museum, Qualicum Beacb, British

Columbia, Canada.

STRATIGRAPHY, DEPOSITIONAL ENAdRONMENTS,

AND AGES

The geology and paleontology of the Chat.sworth For¬

mation are discussed in Squires et al. (1981), Link et al.

(1984), and Stecheson (2004). Inventories of the mol-

luscan fossils in this formation are in Popenoe (1942) and

Page 234

THE NAUTILUS, Vol. 131, No. 4

Figure 1 . Index map and chronostratigrapliic diagrain. Geologic

age.s from Gradstein et ;il. (2012).

Saul and Aldersoii (1981). Stecheson's (2004) study was

the first comprehensive systematic paleontologic study

done on the gastropods of the Chatswoith Fonnation in the

Bell Canyon ami Da)4on Canyon areas in the southeastern

part of tire Simi Hills (Fig. 1). Faulting and discontinuous

bedding obscure the stratigrapliic relationships between tlie

Bell Ciuiyon mid Davton Canyon fossil localities, but the

Bell CcUiyon beds me slightly older th;m die Da)4on Canyon

beds (Stecheson, 2004). The base of the Chatswoith For¬

mation is not exposed (link et al, 1984).

Only a few specimens of die new gastropod were found at

Ii\CMlP kx,'. 10710 in the lower 10 ni of die lower pmt of die

stnitigrapluc section of die ChatsAvoitli Fonnation exposed in

Bell CcUiyon. The fossils at diis kxalitx’ are concentrated in

lens-shaped beds of calcareous smidstone tiiat accumulated as

chiuinefized deposits in slope mid suliniarine mid-fmi facies

(link et al., 1984). Based on the concun-ent rmiges of the

gastrojiods Volutodenna averillii md Lysis sudensis, die rocks

at diis locality are of late early Cmiipmiimi age (Saul mid

Squires, 200Sa, 2(X38b).

Nearly all of the fossils of the new species were found at its

t\pe locality (LACMIP loc. 10715). Tliis locality, wliich is in

the middle pmt of die Chats-woith Fonnation in Dayton

Cmiyon, D)S Angeles County, southeni CaJifbniia, is ap¬

proximately 4 km northeast of Bell Cmiyon. Dicality 10715

was desciibed by Scpiires mid Saul (1981) as a 1.8 m diick mid

15 Ill long, liighly fossiliferous lens. Fossils make up about 80

percent of die lens. In addition to gastropods, there are bi¬

valves, mnmonites, nantiloids, mid shark teetii. The fossils

were likely swept from various depdis on a shelf by chmi-

nelized debris flows, dieii trmisported mid concentrated on

die adjacent slope (link, 1981; link et al., 1984). The rock

tvpe at the locality is fine- to niedium-gi'ained smidstone widi

scattered rip-up clasts. The jxiorly sorted fossil remains ai'e

stratified. Although most of the fossils are fragmental, they

are not worn or abraded (Squires mid Saul, 1981). Based on

the presence of die gastropods Volutodeniui angelica, V.

hinkei, V. santana, and V. elderi, the rocks at tliis locality are

of middle Cmnpanian age (Saul and Squires, 20()8a).

Nearly all the specimens from the Williams Formation

are poorly preserved fragments, except for a specimen

(Fig. 8) found at LACMIP loc. 42320 near the mouth of

Bee Canyon, southern California (Fig. 1). This locality is in

a fault-bounded inlier of Upper Cretaceous rocks mapped

by SchoelHiamer et al. (1981) and referred to by Saul and

Squires (2008a) as the Pleasants Sandstone Member. These

rocks are shallow-marine shelfal deposits containing the

gastropod Volutodenna? antherana, wliich is indicative of

early late Campanian age (Saul and Scpiires, 2008a).

During the Campanian, the west coast of the United

States was part of the “Northeast Pacific Subprovince” of

Kauffman (1973: fig. 1), which, in turn, was part of his

“North Temperate Beahn.” This subprovince had warm-

temperate coastal conditions (Kiel, 2002: fig. 2; Saul and

Sipiires, 2008a).

SYSTEMATIC PALEONTOLOGY

Class Gastropoda Cuvier, 1797

“Subclass” Caenogastropoda Cox, 1960b

“Order” Neogastropoda Wenz, 1938

Superfaniily Turbinelloidea Rafinesque, 1815

Family Pytchatractidae Stimpson, 1865

[= Graphidulidae Stephenson, 1941]

Discussion: Stimpson (1865: 59) named the family

Ptvchatractidae to accommodate his new genus Ptycluitractus ,

a deep water modeni-day gmstropod from Maine mid Nova

Scotia. He did not comment on the higher taxonomic

relationships of his family, which has an ongoing unsettled

and inconsistent classification history. Nielsen (2005) pro¬

vided a succinct discussion of this complicated history.

Kantor et al. (2001) discussed the synonymy of genus

Exilia in detail. Classification adjustments continue to modem

day, as evidenced by recent anatomical and molecular

phylogeny studies done by Fedosov et al. (2017), which

indicate close relationships among modern costellariids

(libbed miters), ptychatractids, and volutomitrids.

Genus Exilia Conrad, 1860

Type Species: Exilia pergi'acilis Conrad (1860, by

monotvpy; middle Paleocene [“Midway”]), Alabama,

Mississippi, and Texas (Palmer and Braun, 1966; Touhnin,

1977).

Description: Shell approximately 10 to 101 mm height;

most shells 15 to 55 mm height. Height/width ratio ranges

from 3.2 to 5.3. Fusiform, long and narrow to moderately

short and moderately wide. Spire high to, less commonly,

short. On unbroken specimens, height of spire commonly

greater than height of aperture. Spire outline evenly

tapered or knobby/angulate. Spire (pleural) angle 13° to

approximately 30°. Protoconch smooth, 0.8 to 3 whorls

(pancispiral or multispiral), depending on kuv'al development.

Teleoconch with up to approximately eight or nine

R.L. S(|uires and M.S. Steclieson, 2017

Page 235

Figures 2-19. Exilia stechesonae new species Squires, LACMIP loc. 10715, soiitliem Califomia, Cliatsworth Formation, unless

otliervvdse indicated. 2-5. Holot>pe LACMIP 10496. 2. Apertural view. 3. Aperturd view, turned slightly to show columella interior. 4.

Right-latend view. 5. Abapertunil view, showing growth line, 6-7. Paratype LACMIP 14748. 6. Right-lateral view. 7. Abapertural view.

8. Paratype LACMIP 14749, right-lateral view. 9-10. Paratype LACMIP 14750, LACMIP loc. 42320, Pleasants Sandstone Member. 9.

Abapertural? view. 10. Closeup of two whorls; crooked line denotes same juncture of two w'horls in previous figure. 11—12. Paratvpe

LACMIP 14751, upper spire. 11. Apertur;d view, 12. Abapertural view. 13-14. Paratyjve 14752. 13. Apertural view. 14. Abapertural

view. 15. Parat)pe 14753, LACMIP loc. 10710, left-latertil view showing upturned anterior end. 16. Paratyjie LACMIP 14754, apertural

view of anterior end. 17. ParaR'pe LACMIP 14755, longitudinal view of interior showing 1—2 plaits. iS. Paratvpe LACMIP 14/56,

longitudinal view of interior showing 1—2 plaits. 19. Paratype LACMIP 14757, loTigitudinal view of interior showing 1-2 pkiits. Scale bars =

10 mm.

Page 236

THE NAUTILUS, Vol. 131, No. 4

whorls, or, niucli less commonly, four to five whorls.

Whorls convex (rarely somewhat Hat-sided), with conve.xitv'

we;ik to moderately strong; whorls ctui be ;mgulate (nirely

tabulate). Sculpture varies considerably in strength, from

verv wciik to strong. Most shells with ohvaous sculpture

(especiiilly on spire), whereics some shells ovemll smootli-

looking. Axi;il rilrs we;ik to strong iuid commonly stronger

than spiral sculpture. Axiiil ribs naiTOw to moderately wide in

size cuid spacing; straight or curved, commonly elongate and

e.xtending from suture to suture, but not iiligned with axi;il

ribs on adjacent whorls. Axiiil nbs ciur be noded. Axial ribs

common on spire luid most of last whorl; or axiiil ribs only

on upper spire. Spiral ribs very weak to strong, naiTow

to moderately wide, commonly closely spaced. Spiral

ribs strongest on shoulder and neck but can be nearly

obsolete on shoulder of last whorl. Cancellate sculpture

moderately common. Aperture narrow to moderately

wide, narrowly elongate. No anal sulcus. Outer lip thin

and smooth. Columella callus slight, with zero or two to

four concealed plaits of variiihle strength. Siphonal canal

commonly long hnt can he relatively .short (attennated).

Siphonal notch narrow to moderately narrow. Anterior

end verv rarely upturned slightly hut imtudsted (i.e., no

siphonal fasciole). Operculum absent, or ver\' small with

snhcentral nucleus, or medium sized with terminal

nucleus. Growth line straight or inclined on spire

whorls; slightly sinuous on last whorl, with deHections

near suture, on angulation at periphery, and on neck

(Bentson, 1940; Kantor et al. 2001; herein).

Geologic Age: Coniacian to Holocene (Kantor et ah,

2001: fig. 5).

Discussion: Exilia has considerable variation in its spire

angle, height/width ratio, moqrhology of the protoconeh,

relative strengths of the spiral and axial sculpture, and

number and strength of tlie columellar plaits (Kantor

et ah, 2001: 84). To tins list, we add shell size, spire

height, and aperture width. Additionally, tlie narrow and

elongate outline of many Exilia species resembles otlier

gastropods belonging to odier genera in various fiunilies

(e.g., fusinids and fksciolariids) (Bentson, 1940: 204). Most

of the extinct species of Exilia are based on only a few

specimens although, in some cases, a substantial number

(e.g., 20 to 40) of specimens is available. Specimens are

commonly broken or poorly preserved.

Bentson (1940) reported on all the American and

European species of Exilia and emphasized their mor¬

phology and stratigraphic distribution. Based on mea¬

surements given by Bentson (1940) and Kantor et al.

(2001), Paleogene Exilia have the smallest shells of all

the .species of Exilia. Bentson (1940) also commented

briefiy on the biogeography and ecology of Exilia.

Kantor et al. (2001) used anatomical studies to signif¬

icantly revise the systematics of this genus, .synon)miized

many nominal genera with Exilia, provided useful digital

images of some fossil and modern-day species, and

commented on the hiogeography and ecology of this

genus. Cretaceous and early Paleogene Exilia lived in

upper and middle shelfal depths near the southern border

of the “North Temperate Bealm,” and the first relatively

deep water (lower shelf to hathyal) occurrences of this

genns did not take place until the late Eocene. Today, the

genus is confined to hathyal depths at tropical latitudes

and in the New Zealand region (Kantor et al. 2001).

There has been confusion concerning Exilia pergracilis

Conrad (the tvpe species) and Paleoq)haphi.s pergracilis

Aldrich, (1886: 22, pi. 5, fig. 18) because of them having

similar shells, the same .species name (Bentson, 1940:

206-207), Paleogene age, and occurrence in Alabama.

Kantor et al. (2001) regarded Paleorhaphis Stewart, 1927

as a junior .synonvan of Exilia, and, in so doing, made Exilia

pergracilis (Aldrich, 1886) a secondary homonym of Exilia

pergracilis Conrad, 1860.

Exilia stechesonae new species Squires

(Eigures 2-19)

Paleofitsirnitra n. sp. Saul and Alderson, 1981: 36, pi. 3,

fig. 8; Squires and Saul, 1981: 131.

Graphiclala? n. sp. Stecheson, 2004: 91-92, pi. 3, figs. 8, 9.

Diagnosis: Exilia with medium shell size, .spire Irigh witli

naiTow spire imgle (13° to 17°), teleocxrnch whorls (about

seven) lowly convex to somewhat flattened, sculpture weak

(can he missing on parts of penultimate imd last whorls),

axials widely spaced, spirals narrower and closely spaced,

cancellate .sculpture (minute) can be present, aperture

narrow and slightly upturned (but unKvisted) dorsaUy at its

anterior end, columella wiflr one or two very small con¬

cealed plaits spaced about 2.5 mm apart.

Description: Shell up to 78.2 mm height and 15.8 mm

width (same specimen); height to width ratio approxi¬

mately 4.5 (most complete specimen); fusiform. Spire

high, spire whorls tall. Protoconch missing. Spire angle

13° (adnlt specimens) to 17° (juvenile specimens). Tel-

eoconch up to approximately seven whorls (estimated

maximum of eight teleoconch whorls). Whorls lowly

convex (can be somewhat flattened). Suture impressed to

indistinct, with or without shell material extending slightly

over suture region. Sculpture overall weak, locally can he

absent. Axial sculpture consisting of weak, widely to ir¬

regularly spaced narrow ribs, extending from suture to

suture. Spiral sculpture consisting of weak, closely spaced

narrow ribs present on most of teleoconch whorls (on

some specimens spiral sculpture can he missing on an¬

terior two-thirds of penultimate and last whorls).

Cancellate sculpture (minute) can be present. Aperture

narrow and slightly upturned (but untwisted) dorsally at its

anterior end. Siphonal canal narrow, with siphonal notch

very small and narrrow. Inner lip (columellar lip) with

light callus. Columella generally straight, with one or two

very small concealed plaits, spaced about 2.5 mm apart,

and with variation as to which one is stronger. Outer lip

thin and smooth. Growih line slightly sinuous on last

whorl; slightly prosocline near suture, very slightly and

R.L. Squires and M.S. Stecheson, 2017

Page 237

broadly opistliocline across weak angulation on posterior

third of last whorl; and slightly prosocline on neck.

Holotype: LACMIP 10496 [ex hvpotvpe LACMIP

10496], height 66.5 mni (incomplete with uppermost

spire and anterior end of aperture missing), width

14.6 mm (Figures 2-5).

Para types: LACMIP 14748-14757.

Type Locality: LACMIP 10715. See Squires (1981:

insert) for the location of this locality plotted on a topo-

grapliic base map.

Geologic Age: Late early to early late Campanian.

Distribution: UPPER LOWER CAMPANIAN: Chats-

worth Eonnation, Bell Canyon, Simi Hills, V^entura Co.,

southern Ccilifomia. MIDDLE CAMPANIAN: Chatsworth

Eonnation, upper Dayton Canyon, Simi Hills, D)s Angeles

Co., southern Ciilifomia. LOWER UPPER CAMPANIAN:

Williams Eonnation, Pleasants Sandstone Member, near

mouth of Bee Canyon, Santa Ana Mountcuns, Orange Co.,

southern California.

Etymology: The new species is named for Mary S.

Stecheson, in recognition ol her study of the systematic

paleontology of the gastropod fauna of the Chatsworth

Eonnation. The senior author, Squires, is the sole

author of this new species.

Discussion: Forty specimens were examined: 38 from

the Chatsworth Formation in Dayton Canyon; one

specimen from the Chat.sworth Formation in Bell Canyon;

and one specimen from the Williams Formation (Pleas¬

ants Sandstone Member) in Bee Canyon. All the speci¬

mens are weathered, and the sculpture, especially the

axial ribs, is commonly subdued as a result. All specimens

are incomplete, most likely the result of damage during

collecting. No specimens have the protoconch or up¬

permost spire present. The anterior tip of the shell is

commonly also missing. About 16 Chat.sworth Formation

specimens have most of the aperture present. The

somewhat crushed figured specimen (Figures 9, 10) from

the Williams Formation has the best preservation of the

detciils of the sculpture. A few of the specimens are

steinkems, and some have large portions of the shell

missing. Although none of the specimens are in the

best possible state of preservation, the preservation is

good enough to show the most important moq^hological

characteristics.

The largest specimen (Figure 8) of the new species is

from Dayton Canyon and is 78.2 mm height (incomplete),

17.4 mm width, with an estimated complete height of

80 mm. The new species is one of the tallest Late Cre¬

taceous ptychatractids. Exilia mekimyjjsis (Conrad, 1860)

from tlie Late Cretaceous (Miiastrichtian) of Tennessee is

approximately the same height as E. stechesoruie. In com¬

parison, mo.st otlier .species (e.g., tlio.se illustrated by Kantor

et al., 2001) of Late Cretaceous Exilia are small to moderate

in size (19 to 48 mm height).

Exilia stechesonae with its narrow spire angle, low'ly

convex whorls, weaker sculpture, and narrow' aperture

differs from most other species oi' Exilia. The new species

is somewhat similar to .some Exilia in terms of the height

to width ratio of approximately 4.5, relatively narrow spiral

iuigle, lowly convex whorls, subdued sculpture, :md a laurow

aperture. An exmnple of one of these somewhat similar

species is Flxilia ckirki Bentson ( 1940: 2L5-21 6, pi. 2, figs. 2, 3,

8, 12, 15, 17, 19, 20) from tlie upper middle Eocene Cowlitz

Eonnation in southwestern Wasliington. The new species

differs by having a much huger shell, sliglitly upturned :m-

terior end, iuid much less prominent axiiil ribs. The degree of

tlie prominence of the axial ribs on the new species, however,

is difficult to iissess because of the effects of weatliering.

Saul and Alderson (1981) regarded the new gastropod

described here as belonging to genus Paleofusiuiitra SobI,

1963, which they (juestiouably assigned to family Mitridae

Swainson, 1831. Paleofimmitra is known with certainty

only from upper Campanian strata in the Ripley Eor-

mation in Mississippi, Alabama, and Georgia (Sohl, 1963,

1964). Sohl (1963, 1964) and Cernohorsky (1970: 26, 39,

pi. 4, figs. 6, 7) assigned Paleofasiaiitra to the mitrids.

Cernohorsky (1970: 26) mentioned, furthermore, that

Paleofusimitra is one of the earliest mitrids retciining some

of the fasciolariid features. Cernohorsky (1976: 512, pi.

462) reported that if Paleofimmitra is a mitrid, it is the

most primibve one tuid retiiined strong fasciolailid features

(e.g., placement and number of the columellar folds). The

uew species differs from Paleofusimitra by having a much

IcU-ger size, a narrower pleural cUigle, nan'ower posterior part

of tlie last whorl, narrower aiterior p;ut of the aperture,

presence of axial ribs, more numerous and more closely

spaced spind ribs near suture, wider range of number of

plaits, and absence of a slight siplional fasciole.

The new species resembles superficially specimen

VIPM 052 of the so-ctdled Nonacteonina sp. of Ludvdgsen

and Beard (1994: 95, fig. 60, in part; Ludvigsen and Beartl,

1997: 115, fig. 71, in part) from the Northumberland

Eonnation at Collishaw Point, north end of Hornby Is¬

land, off the east coast of Vancouver Island, British Co¬

lumbia, Canada. Katnick and Mustard (2003) assigned the

rocks at Collishaw Point to the upper Campanian

Northumberland Eonnation. The aperture of specimen

VIPM 052 is not present. The new species differs by

hav'ing a slightly wider spiral angle (13° to 17°, rather than

8° to 11°), less convex whorls, presence of axi;d ribs, and

a less prosocline grow'th line near the suture.

ACKNOWLEDGMENTS

Lindsey T. Groves (LACM Malacology) and Steffen Kiel

(Naturlii.stori.ska RLskmuseet, Department of P:deobioIog\',

Stockliolm) provided key molluscan references. LouElla

Saul (LACMIP) cleaned the holotyqie. Mark A. Boeder

(Department of Paleontology, San Diego Natural History

Museum) provided detciiled locality' information about

the Bee Canyon specimen. The Transportation Corridor

Agency funded the paleo-monitoring of the Bee Canyon

Page 238

THE NAUTILUS, Vol. 131, No. 4

iirea. Ravmoiitl Graluun (Victoria, British Columbia) provided

stratigraphic iuid lociility ckta concerning specimen \TPM 052

luid iilso t(x)k digital images of tliLs specimen for ct)mpcU'ative

pnrjx)ses. lindsey T. Groves cuid tui tmonymous person ciit-

iciillv reviewed the m;uinscript imd gave vtilnable c'omments.

LITERATURE CITED

Aldrich, T.H. 1886. Preliminary report on the Tertiary fossils of

Alabama and Mississippi. Geologicvil Suney of Alabama

Bulletin 1: 15-60.

Bentson, II. 1940. A systematic study of the fossil gastropod

Exilia. University of California Publications Bulletin of the

Department of Geological Sciences 25: 199-238.

Bouchet, P. 2014. World register of marine species, accessible

at <http://\wvw.marinespecies.org>

Cernohorskv, W.O. 1970. Systematics of the families Mitridae &

Volntomitridae (Mollusca: Gastropoda). Bulletin of the

Auckdand fnstitute and Museum 8: 1-190.

Gernohorsk-v, W.O. 1976. The Mitridae of the world. Part 1. The

subfamily Mitrinae. Indo-Pacific Mollusca 3: 273-528.

Gonrad, T.A. 1860. DescriptioTis of new species of Greta-

ceous and Eocene fossils of Mississippi and Alabama.

Journal of Philadelphia Academy of Natural Sciences 2:

279-296.

Gox, L.R. 1960a. Moqrhology of hard parts. Im .Moore, B. G.

(ed.) Treatise on Invertebrate Paleontology, Part 1, Mol¬

lusca 1. Geological Society of America and University of

Kamsas Press, pp. 1106-1135.

Gox, L.R. 1960b. Thoughts on the classification of the Gastro¬

poda. Proceedings of the Mkacological Society' of London

33: 239-261.

Gnvaer, G.L.G. 1797. Tableau elementaire de fhistoire nautrelle

des animaiLx [des mollusques]. Baudonin, Paris, 710 pp.

Fedosov, A., N. Puillandre, and P. Bouchet. 2017. Phylogeny,

.systematics, and evolution of the family Gostellariidae

(Gastropoda: Neogastropoda). Zoological Jouniiil of the

Idnnean Society 179: 541-626.

Gradstein, F.M., J. Ogg, M.D. Schmitz, and G.M. Ogg. 2012.

The geologic time scale 2012. Two-volume set. Elsevier,

Amsterdam, 1144 pp.

Harasewych, M.G., S.L. Adamkewiez, J.A. Blake, D. Saudek, T.

Spriggs, and G.J. Bull. 1997. Neogastropod phylogeny: A

molecular perspective. Journal of Molluscan Studies 63:

.327-351.

Kantor, Y.f. 2002. Moiphological prerequisites for understanding

neogastixqxjtl phvlogeny. BoOettino Mkacologica, Supplemento

4, Roma, pp. 161-174.

Kantor, Y.I., P. Bouchet, and A. Oleinik. 2001. A revision of the

Recent species of Exilia, formerly Bentluwoluta (Gastro¬

poda: Turbinellidae). Ruthenica 11: 81-136.

Katnick, D.C. and P.S. Mustard. 2003. Geology of Denman and

Hornby Islands, British Golumbia: Implications for Nanaimo

Basin evolution and fonnal definition of tlie Goeffrey and

Spray formations, Upper Gretaceous Naniumo Group.

Ganadian Journal of Earth Sciences 40: 375-393.

Kauffman, E.G. 1973. Gretaceous Bivvilvia. In: Hallam, A. (ed.),

Atlas of pHaeobiogeography. Elsevier Scientific Publishing

Gompany, Amsterdam: 35.3-383.

Kiel, S. 2002. Notes on the biogeography of Gampanian-

.Maastrichtian gastropods. In: Wagreich, W. (ed.). As¬

pects of Gretaceous stratigraphy and palaeobiogeography.

O.sten'eicliische Akademie der WLssenschtiften, Schriftenreilie

der Erdwissenschaftlichen Kommissionen, Vol. 15, pp.

109-127.

Link, M.H. 1981. Sand-rich turbidite facies of the Upper

Gretaceous Ghat.sworth Formation, Simi HiUs, Galifomia.

In: Link, M. H., R. L. Scpiires, and I.P. Golburn (eds). Simi

Hills Cretaceous turbidites, southern Cidifomia. Pacific

Section, Society of Economic Paleontologists and Miner-

iilogists Fiill Field Trip Guidebook, Los Angeles, Giilifoniia:

63-70.

Link, M. IL, R.L. Squires, and I.P. Golbuni. 1984. Slope and

deep-sea fan facies and pkeogeography of Upper Greta¬

ceous Ghat.sworth Formation, Simi Hills, Galifomia.

American Association of Petroleum Geologists Bulletin 68:

850-873.

Ludvigsen, R. and G. Beard. 1994. West coast fossils. A guide to

the ancient life of Vancouver Island. Whitecap Books,

Vdmcouver, 194 pp.

Ludvigsen, R. and G. Beard. 1997. West coast fossils. A guide to

the ancient life of Vancouver Island. 2"^* ed. Harbour

Publishing, Madeira Park. Ganada, 216 pp.

Nielsen, S.N. 2005. Exilia alanheui, a new species from the

Neogene of central Ghile: The first record of Exilia

(Gastropoda: Ptychatractidae) from South America. The

Nautilus 119: 153-156.

Palmer, K.V.W. and D.C. Brann. 1966. Catiilogue of the Pa-

leocene and Eocene Mollusca of the southern and eastern

United States. Part 2. Bulletins of American Paleontology

48: 471-1057.

Popenoe, W.P. 1942. Upper Cretaceous formations and faunas

of southern California. American Association of Petroleum

Geologists Bulletin 26: 162-187.

Rafinesque, C.S. 1815. Analyse de la nature, on tableau de funivers

et des coqvs organisees. Barravecchia, Piilermo, 224 pp.

Saul, L.R. and J.M. Alder.son. 1981. Late Cretaceous Mollusca of

the Simi Hills: An introduction. In: Link, M.H., R.L.

Squires, and I.P. Colburn (ecLs). Simi Hills Cretaceous

turbidites, southern California. Pacific Section, Society of

Economic Paleontologi.sts and Mineralogists Fall Field Trip

Guidebook. Los Angeles, Ciilifornia: 29-42.

Saul. L.R. and R.L. Squires. 2()08a. Volutoderminae (Gastro¬

poda: Volutidae) of Coniacian through Maastrichtian age

from the North American Pacific slope. Journal of Pale¬

ontology 82: 213-237.

Saul, L.R. and R.L. Squires. 2()()8b. Cretaceous trichotropid

gastropods from the Pacific slope of North America: Pos¬

sible pathways to catyptraeid moqvhology. The Nautilus

122: 115-142.

Schoellhamer, J.E., J.G. Vedder, R.F. Yerkes, and D.M. Kinney.

1981. Geology of the northern Santa Ana Mountains,

California. U. S. Geological Surv'ey Professional Paper 420-

D: 1-109.

Sold, N.F. 1963. New gastropod genera from the late Upper

Cretaceous of the east Gulf Coast plain. Jouniid of Pide-

ontology 37: 747-757.

Sold, N.F. 1964. Neogastropock, Opistliobranchia and Biisom-

matophora from the Ripley, Owl Creek, and Prairie Bluff

formations. U. S. Geologicid Surv'ey Professional Paper 331-B:

153-344.

Sold, N.F. 1987. Cretaceous gastropods. Contrasts between

Tethys and the temperate provinces. Jounud of Palae¬

ontology 61: 1085-1111.

Squires, R.L. 1981. Geologic map of Upper Cretaceous

Chatsworth Formation, Simi Hills, California (with fossd

localities). In: Link, M. H., R. L. Squires, and I. P. Colburn

(eds). Simi Hills Cretaceous turbidites, southern Cidifomia.

R.L. Squires and M.S. Stecheson, 2017

Page 239

Pacific Section, Societv' of Economic Paleontologists and

Mineralogists, Los Angeles, Ciilifornia: In pocket.

Sfjnires, R.L. 2003. Turnovers in marine gastropod faunas

during the Eocene-Oligocene transition, west coast of the

United States. In: Prothero, 10. R., L. C. Ivany, and E. A.

Nesbitt (eds.). From Greenliouse to icehouse, the marine

Eocene-Oligocene transition. Columbia University Press,

New York: 14-35.

Squires, R.L., M.H. Link, and I.P. Colbuni. 1981. Introduction.

In: Link, M.IL, R.L. Squires, and I.P. Colburn (eds.). Simi

Hills Cretaceous turbidites, southern California. Pacific

Section, Society of Economic Paleontologists and Miner-

iilogists, Los Angeles, Cidifornia: 5-8.

Squires, R.L. and L.R. Saul. 1981. Dayton Canyon megafossil

locality stop. In: Link, M.H., R.L. Squires, and I.P.

Colburn (eds.). Simi Hills Cretaceous turbidites, southern

California. Pacific Section, Society of Economic Paleon¬

tologists and Mineralogists, Los Angeles, California:

131-132.

Stecheson, M.S, 2004. Systematic p;ileontology of marine gas¬

tropods from the Upper Cretaceous Chatsworth Forma¬

tion, Simi Hills, southern California. California State

Universit)' Northridge, unpub. M.S. thesis, 142 pp.

Stephenson, L.W. 1941. The larger invertebrate fossils of the

Navarro Croup of Texas. The University of Texas Publi¬

cation 4101, 641 pp.

Stewart, R.R. 1927. Cabb’s California fossil t)pe gastropods.

Proceedings ol the Academy of Natural Sciences of Phil¬

adelphia 78: 287-447.

Stimpson, W. 1865. On certain genera and families of zoophagous

gasteropods, American Jouniiil of Conchology 1: 55-64.

Swainson, W. 1831-1832. Zoologiciil Illustrations. Vol. 2. Series

2. Raldwin & Cradock and R. Havell, London, pis. 46-91

(unnumbered).

Toulmin, L.D. 1977, Stratigraphic distribution of Paleocene and

Eocene fossils in the eastern Culf Coast region. Ceologicd

Surx'ey of Alabama Monograph 13. Two-volume set, 602 pp.

Wenz, W. 1938. Gastropoda Teil L Allgemeiner Teil und

Prosbranchia. In: Schindewolf, O.H. (ed.). Handbuch der

Paliiozoologie, \7)1. 6. Cebriider Rorntraeger, Rerlin:

1-1639 [Reprinted 1960-1961].

APPENDIX 1

LOCALITIES OE THE NEW SPECIES

All (|uaclrangle.s listed below are U. S. Geological Suiv/ey,

7.5 minute, topographic maps. Eor the Chatsworth

Eormation localities, see Srpiires (1981) for Simi Hills

locations plotted on a topographic base map.

LACMIP 10710 [= CIT loc. 1158], southeast slope of

Simi Hills, north hank of Bell Canyon, Chatsworth Eor¬

mation, Ventura Co., soutliem C;ilifomia, Calahasits Quad¬

rangle, United States Geological Survey. Age: Late early

Campanian. Collectors: W. P. Popenoe, L. R. Saul,

J. Alderson, 1935-circa 1990.

LACMIP 10715. [= Iocs. CIT 1159, UCLA 6965, and

CSUN 175], 34°13T2.02”N, 1 18°40’3.63”W, prominent

fossil bed on crest of spur between forks of Davton

Canyon about 122 m east of the Los Angeles-Ventura Co.

line, Chatsworth Eormation, Dayton Canyon, southeast

slope of Simi Hills, Los Angeles Co., California, Calabasas

Quadrangle. Age: Middle Campanian. Collectors: R.

Durbin, W. P. Popenoe, L. R. Saul, J. Alderson, R. L.

Scjuires, 1935-circa 2000.

LACMIP 42320. Temporary exposure made during

constniction of the Eoothill Transportation Corridor (Toll

Road Highway 241), Williams Formation, Pleasants

Sandstone Member, elevation 715 ft., 425 m due south of

hill 923, west side of Bee Canyon near its mouth, western

foothills of Santa Ana Mountains, Orange Co., southern

California, El Toro Quadrangle. Age: Early late Campa¬

nian. Collector: P. Peck, July 17, 1997.

THE NAUTILUS 131(4):24()-245, 2017

Page 240

A new species of Fissurellidae (Gastropoda: Vetigastropoda) from

the deep-sea off the eastern Pacific coast of Mexico

Nancy Yolimar Suarez-Mozo

Ciendas del Mar y Liniiiologi'a - Graduate Program

Universidad Nadonal Autonoma de Mexico

Mazatlan, Sinaloa, MEXICO

[email protected]

Daniel L. Geiger

Santa Barbara Museum of Natural History

2559 Puesta del Sol

Santa Barbara, CA 93105, USA

[email protected]

ABSTRACT

The present article describes Fissurella hendrickxi, a new deep-

sea gastropod species found off the Pacific coast of Mexico (Baja

Peninsula; Gull of California), at 650-837 m depth, collected by

the T.alud X\' and Talud X projects. Fissurella hendrickxi was

classified according to shell sculpture, radula, epipodium, and

ctenidial stnictnre. It is remarkable for its verv' thin shell, which

covers the entire animal.

Additional Kinjtvords: Deep sea, Fissurella, continental slope

INTRODUCTION

Recent siiiveys of deep-water endronments oil tiie Pacific

coast of Mexico have discovered new inolluscan species.

Such studies seldom )4eld moUusk Scunples, because avciilable

Siunpling techni(|ues tme not tilways adecpiate or only few

sediment Scunples are collected, thus preventing a diorough

inventory of the continentcil shelf, slope, mid the abyssiil pkiin

(Zarnonuio et ;il., 2013; McLeiin mid Geiger, 1998).

The Fissurellidae comprises four subfamilies: Fissur-

elliuae, Diodorinae, Emirnginulinae, and Ilemitominae, with

Fissurellinae contidning sfx genera, which ime diagnosed by

shell and radular characters (Tliiele, 1891; 1912; 1929;

Mcl.^an, 1984a; 1984b; Hickman; 1998). Members of the

Fissurellidae ime most fre(|uently found in the intertidiil (tr

sh;illow waters worldwide and are not as prevcilent in deep

waters. Some genera and species of Fissurellidae have been

recorded in deep waters of the ettstem Pacific off South

America (McLean and Geiger, 1998; Araya and Geiger,

2013). McLean (1971) documented deep-water Fissur¬

ellidae species [Enuirginula vehscoemis Shasky, 1961,

Zeidoi-aflahellum (Dtill, 1896), and Cranopsis expama (D;ill,

1896)] in the Gulf of Gcdifomia anchor ;dong the Baja

Peninsula with bathymetric ranges tmound 200 m.

MATERIALS AND METHODS

The new species was collected during the Talud X and

Talud X\' projects (2007 and 2012), on board the

Universidad Nacional Autdnoma de Mexico (UNAM)

research vessel El Puma along the western coast of Baja

California Sur and in the Gulf of Cidifoniia. Station depths

were estimated with a SIM RAD echo-sounder. Tem¬

perature and dissolved oxygen measurements were col¬

lected 20 m above the secifloor with a Seabird CTD

multisensor probe. Ox'vgen measurements were checked

by titration (Strickland and Parsons, 1972). Moqrhological

descriptions include the following dimensions: length (L),

width (W), and height (H). Fixed specimens were photo¬

graphed for their external anatomy. Specimen preparation

ancl SEM imaging were performed following Geiger et al.

(2007). Cross sections of shells were imaged from broken

pieces. Measurements were t;iken from a middle section

and a section conhiining the pcuts of the foramen.

Specimens are deposited at the Santa Barbara Museum

of Natural History (SBMNH), and the Regional Collec¬

tion of Marine Invertebrates at the Mazatlan Marine

Station, UNAM, in Mcizatlan, Mexico (EMU-ICML).

Abbreviations used in tlie figures are: an: anus; ct: cephcilic

tentacle; et: epipodi;il tentacle; ey: eye; fo: foramen; ft: foot;

gi: gill; gs: gill suspensory stiilk; mb: mantle border;

mt: mantle tentacles; mo: mouth; sn: snout.

SYSTEMATICS

Class Gastropotla Cuvier, 1797

Suborder Vetigastropoda Salvini-Plawen, 1980

Family Fissurellidae Fleming, 1822

Subfamily Fissurellinae Fleming, 1822

Genus Fissurella Bruguiere, 1789

Type Species: Fissurella nimhosa Linnaeus, 1758 (by

monoty]ry).

Fissurella hendrickxi new species

(Figures 1-18)

Diagnosis: Shell up to 42.9 mm; fonunen elipticcil, cen¬

tral. Shell extremely thin (-0.1 mm). Specimens smooth

N.Y. Suarez-Mozo and D.L. Geiger, 2017

Page 241

Figures 1—13. Fissurella hendrichxi new speeies. Holot\pe, SBMNH 457424. 1. Dorsal view. Scale bar =10 inm. 2. Ventral vaew.

Scale bar = 10 min. 3. Holoty|re, lateral view. Scale bar = 10 min. 4. Shell tliickness (SEM). Scale bar = 100 p-in. 5. Fissurella

hendrichxi new species (small specimen), EMU-ICML 1 1338. Scale bar = 10 mm. 6. Eoramen with tentacles and remnants of shell.

Scale bar = 5 inin. 7. Detail of eye, ceplndic tentacle and epipodial tentacle. Scale bar = 5 mm. 8. Right gill, epipodium, foot, eye,

cephalic tentacle, snout, and mouth. Scale bar = 10 nun. 9. Rectal opening v\ath granular fecal matter. Scale bar = o mm. 10. Mantle

border and mantle tentacles above foot. Scale bar = 2 mm. 11. Enlargement of posterior tentacle surrounding foramen. Scale bar =

1 mm. 12. Bursicle. Scale bar = 100 |xin. 13. Enlargement of bursicle. Scale bar = 100 jcin.

Page 242

THE NAUTILUS, Vol. 131, No. 4

Figures 14-18. Fissiirella hendrickxi new species. Radula under SEM. Parat\pe SBMNH 235544. 14. Entire radula. Scale bar =

2 min. 15. Whole width of radula. Scale bar = 1 mm. 16. Central field wth rachidian tooth and lateral teeth. Scale bar = 200 |j.m.

17. Lateromarginal plate Scale bar = 200 lam. 18. Marginal teeth. Scale bar = 100 p.m.

N.Y. Suarez- Mozo and D.L. Geiger, 2017

Page 243

due to erosion at top, concentric lines at sliell bases, small

specimens vvdth primarx’ and secondarv cords. External

shell color dull whiti.sh.

Description: Shell height moderate (about 30% of

length), outline elliptical, a bit narrow at posterior end

(Figures 1-3). Width about 60-70% of length. Fora¬

men central and conical, 20-22% of length (Figures 6).

Shell extremely thin (Figure 4): callus of foramen

0.16-0.17 mm reminder of shell 0.1 mm. Profiles

straight. Radial sculpture of alternating primary,

secondary cords regularly spaced. Concentric sculp¬

ture generally weak, strongest close to edges. Farger

specimens with concentric lines at shell bases, radial

scnlptnre absent. Small specimens with radial and

concentric sculpture (Figure 5). Foramen area eroded.

Color external dnll whitish; inner surface whitish,

glossy.

Head and Foot (Figures 7-9):

Eyestalk narrower than cephalic tentacles, approximately

Va of cephalic tentacle length, located just posterior to

origin of cephalic tentacles. Eye almost half as witle as

chameter of eyestalk. Snout cylindrical, tapering, sur¬

rounding central mouth. Epipodium with approximately

34-36 tentacles arranged in single horizontal row ter¬

minating at neck; tentacles varying in size by factor two,

larger ones approximately as long as eyestalk. Cephalic

li6°48 0'W 113“9.0’W 109°30 0'W

z

O

Z

o

rN

o

O

CN

Z

he

•rr

c

sO

CM

Z

rsi

o

c

r4

rsi

Figure 19. Distribution of sampling stations where specimen

of Fissurella hendrickxi new species were collected during

the Talud X\^ and X surveys off the western coast of the Baja

California Peninsula and Gulf of California ( A = tyjre locdity).

tentacle located on each side of snout, each tentacle ta¬

pering gradually (wider at base tlian at tip), tip pointed,

with different folds around tentacle, slightly shorter tlian

snout. Foot thick, 60% of the shell length.

Mantle Organs (Figures 10-13):

Mantle margin close to shell, smooth exterior fold, interior

fold wider than middle fold; mantle tentacles in middle

fold; mantle margin of foramen similar. Gill hvpertro-

phied, filaments symmetrical, with rounded tip; bursicles

present. Anus elliptical, located at posterior end of pallial

cavity.

Radula (Figures 14-18):

Rachidian tooth trapezoidal, broad. Five lateral teetli,

with narrow inner teeth. Fateromarginal plate triangular,

without projections, sinuous distal edge. Marginal teeth

with spoon-shaped pointed tip, with fine denticles on each

side of the apical margin.

Type Material: Holotype SBMNH 457424: 34. 7X

10.6X22.7 mm (FXWXH), 4 paratypes, all from type

locality: SBMNH 235544: 42.9X11.5X22.3 mm, 32.9X

10.93X22.0 mm (FXWXH), EMU-ICML 10965: 35.6X

22.3X11.9 mm (FXWXH), EMU-ICML 10966: 30.2X

20.7X8.2 mm (FXWXH).

Type Loeality: Baja California Sur Peninsula, Mexican

Pacific, Mexico, Talud XV, St. 5D, 23°16'58" N;

110°20'42" W, 650-665 m (Figure 19).

Other Material Examined: Seven specimens, EMU-

ICML 11338, Talud XV st. 5D, Baja California

Sur Peninsula, Pacific Ocean, Mexico, 23°16'58" N,

110°20'42" W; one .specimen, EMU-ICML 11339,

Talud XV, St. 20, Baja California Snr Peninsula,

Pacific Ocean, Mexico, ' 26°30'42" N, 113°56'0" W;

one specimen, EMU-ICML 11340, Talud X, St. 5,

Gulf of Ccilifomia, Mexico, 28°14'50" N, 112°24'53" W.

Environmental Conditions: Dissolved oxygen, 0.08-

0.15 ml02/l; temperature, 6.2-8.4°C; salinity, 34.55-

34.68%o. ^

Etymology: Named after Michel E. Hendrickx (Insti-

tuto de Ciencias del Mar y Limnologia, Mazatlan, Sinaloa,

Mexico), who for long time has long studied the benthic

fauna of the eastern Pacific Coast of Mexico, in particular

from off the Baja Peninsula and the Gulf of Ctilifornia.

Comparisons: The radula with veiy large lateral tooth

5, whose tip ciligns with the lateral teeth of the subse(]uent

row (see McLean and Kilbuni, 1986) places our species in

FLssurellinae, and not in Emarginulinae, which includes

the genus Stroinboli. The absence of an internal thick¬

ening around the foramen differentiates the species

from the otherwise similar Diodora. Among the genera

in Fissurellinae, genera other than Fissurella eitlier ex¬

hibit strong shell reduction {Amhlijcliilepas , Letirolepas ,

Page 244

THE NAUTILUS, Vol. 131, No. 4

Macroschisma), or show strong propodial elalrorations

(Dendwfissurella). All approximately 46 recent species of

Fissurelhi have rmich thicker shells than the new species.

Tlie two species overall most similar to Fissurella

lieiulrickxi are in genera other than Fi.ssti reiki; these are

Diodora codoceoae (McLean and Andrade, 1982) and

StroinboU heehei (Hertlein and Strong, 1951). They

share a large and thinner than nsual shell with a large

foramen that is conical in shape, and the interior shell

color is white. Diodora codoceoae and S. heehei differ

from the F. hendrickxi in their fleshy mantle that fully

envelops the edge of the shell and radial rihs that are

nniformly fine, with no distinction between primary and

secondaiy ribs (McLean and Andrade, 1982). They both

also have a much sturdier shell than F. hendrickxi and

tlie sculpture is stronger in S. heehei and D. codoceoae.

The shells of both species are noticeably thicker: D.

codoceoae 1.05 mm at length of 36.5 mm (SBMNH

172216); S. heehei 1.03 mm at length of 31.75 mm

(SBMNH 118681).

Remarks: Fissurella hendrickxi was collected just be¬

low the oxygen minimum zone < 0.5 ml O2/I (OMZ); fully

oxygenated seawater can hold >7 ml O2/I (Levin 2002).

While die oxygen measurements were taken some 20 m

above the sea floor (due to equipment limitations), it gives

a reasonable indication of the conditions previiiling in the

species habitat.

Shell sculpture changes with growth. Small specimens

(smallest specimen IS mm) have radial and concentric

elements whereas larger (>35 mm) specimens only have

concentric sculpture at the shell margin. This difference

may he accounted for by erosion and/or pliysical wear of

the shell. However, low carbonate assimilation levels or

adaptive changes among large organisms may also play

a role.

Tlie epipodium, a complex of sensory or tactile stnic-

tures located on the sides of the foot under the shell

margin of the vetigastropods (Macdonald and Maino,

1964; Cox, 1962; Crisp, 1981), has proven useful in tax¬

onomic and systematic classification (Hickman and

McLean, 1990, Geiger, 1999; Collado, 2008; Collado

et ak, 2012). The epipodium of F. hendrickxi is particu¬

larly well-developed compared to other species in the

genus. This enlargement may be an adaption to extreme

environmental conditions such as low oxygen concen¬

trations or depth. Alternatively, it may improve mobility

and tactile sensitivity in soft sea-heds.

DISCUSSION

Tlie diversity of deep-sea mollusks in the Pacific coast of

Mexico is not well documented. Most species of Fissur-

ellidae from that area occur in relatively shallow water

(0-50 m) on hard substrates. Few deep-water and soft sea¬

bed species are known [e.g., Coiimepta giizmani Araya

and Geiger, 2013; C. pacifica (Cowan, 1969); C. levinae

McLean and Geiger, 1998; C. uirapa Simone and Cunha,

2014].

Fissurella hendrickxi was found in an environment

under hy^^oxic conditions, which characterizes this region

of the eastern Pacific, where the oxygen minimum zone

exhibits significant latitudinal variations in depth, thick¬

ness, and intensity (Helly and Levin, 2004). Whether the

enlarged epipodium in the species is an adaptation to

deep-water conditions remains unknown. The compara¬

tively large gill is remarkable, and additional, indirect

evidence that the species may he adapted to that par¬

ticular environment.

Specimens described here were collected from the

continental slope region at depths >200 m. Larger or¬

ganisms feature decreased shell thickness, a potential

adaption to low energy environments. McLean (1984c)

noted that the limpet shape may prove advantageous, as it

provides protection through clamping agciinst the sub¬

stratum. Species living on soft bottoms can no longer

clamp down, and the protective function of a thick shell

does no longer apply.

Fissurellidae is an interesting lineage with respect to

shell reduction, including complete loss of the shell in

Buchanania . Reduction of shell thus far has mostly been

achieved by reduction in size while maintciining shell

thickness. Examples of moderate reduction include

Megathnra and Scuta.s, while extreme reduction is en¬

countered in Macro.schisnui. Fissurella hendrickxi, on the

other hand, has reduced shell thickness while retciining

a large size. It is the only species in Fissurellinae with fully

grown shell so thin that it does not offer any protective

function anymore (The specimens recovered had gonads

indicating maturity.) Similarly thin shells are only known

from deep-water Enuirginulinae, but those are overall

much smaller (-2-10 mm: McLean and Geiger, 1998).

ACKNOWLEDGMENTS

We would like to thank the ICML researchers who

collected the specimens, Michel Hendrickx, and the

T4LUD project. The authors are grateful to Jose Salgado

Barragan, Laboratorio de Invertehrados Bentonicos

(LIB), Unidad Academica Mazatlan, ICML, UNAM,

for tciking the photograph in Figure 5. The Talud X\^

and Talud X research cruises were funded by the Uni-

versidad Nacion;il Autonoma de Mexico cuid CONACyT.

This study Wits also partly supported by CONACyT (Project

179467), as (NYSM) receives a CONACyT graduate

studies grant. Part of the material included in this

contribution was reviewed during a stay of NYSM at the

Santa Barbara Museum of Natural History; thanks to

Paul Valentich-Scott and Henry Chaney for their assis¬

tance. We appreciate the comments of Alexander Niitzel

and an anonymous reviewer, which helped improve the

manuscript.

LITERATURE CITED

Araya J.F. and D.L. Geiger. 2013. Comisepta guzmani new

species: first species of genus confirmed from Pacific cold

N.Y. Suarez-Mozo and D.L. Geiger, 2017

Page 245

seep environments ofi central Chile (Gastropoda; Veti-

gastropoda: Fissnrellidae). The Nautilus 127: 115-118.

Collado, G.A. 2008. Significancia taxonomica del coinplejo

epipodial en espeeies sndainerieanas del genero Tegiila

Lesson, 1835 (Molln.sca: Vetiga.stropoda). Amici Mollus-

cannn 16: 9-14.

Collado, G.A., M.A. Mendez, and D.l. Browm. 2012. Epipodium

morjrholog}' of Prisoga.ster niger (.Vlollnsca: Vetigas-

tropoda): revealing potential autapomoqrhies of diagnostic

value for the Prisogasterinae. International Journal ol

Moqrhologv’ 30: 541-545.

Cox, K.W’. 1962. Ciilifornia abaloTies, lamily Haliotidae. Cal¬

ifornia Department ol Fish and Game. Fisheries Bulletin

118: 1-133.

Crisp, M. 1981. Elpithelial sensor)’ stnictnres ol trochids. Journal

Marine Biologictil Association ol the United Kingdom 61:

95-106.

Geiger, D.L. 1999. A Total Evidence Cladistic Analysis ol the

Family Haliotidae (Gastropoda: Vetigastropoda). Ph.D.

Thesis, Universitv' ol Southern Caliloniia, Los Angeles, xlx,

423 pp. [pdf available http;//vwwv.vetigastropoda.com/

abstracts/publications/scipapers.php]

Geiger, D.L., B.A. Marshiill, W.F. Ponder, T. Sasaki, and A.

Waren. 2007. Techniques for collecting, handling, and

preparing simdl molluscan specimens. Molluscan Research

27: 1-50.

Helly, J.J. and L.A. Levin. 2004. Global chstribntion of naturally

occurring marine h)poxia on continental margins. Deep-

Sea Research Part 1 51: 1159-1168.

Hickman, C.S. 1998. Fissnrelloidea. In: P.L. Beesley, G.J.B.

Ross, A. WeOs (eds.) Mollusca the Southern Synthesis, Vol.

5. Fauna of Australia CSIRO, Melbourne, pp. 669-671.

Hickman, C.S. and J.H. McLean. 1990. Systematic revision and

suprageneric classification ol trochacean gastropods. Nat-

urid Historv' Museum of Los Angeles County Science Series

.35:1-169. '

Levin, L.A, 2002. Deep-ocean life where oxygen is scarce.

American Scientist 90: 436-444.

Macdonald, J. and C. Maino. 1964. Observ'ations on the epi¬

podium, digestive tract, coelomic derivatives, and nerv'ous

system of the trochid gastropod Tegula funehrahs. The

Veliger 6: 50-55.

AIcLean, J.H., 1971. Archaeogastropoda. In: Keen, A.M. 1971,

(ed.). Sea .shells of tropical West America: marine mollusk

from Baja Caliloniia to Peru. 2nd edition. Stanford Uni¬

versity Press, pp. 307-363.

McLean, J.H. 1984a. A case for derivation ol the Fi.ssurellidae

from the Bellerophontacea. Malacologia 25: 3-20.

McLean, J.H. 1984b. Systematics oi Fissurella in the Peruvian

and Magellanic Faunal provinces (Gastropoda; Proso-

branchia). Contributions in Science, Los Angeles Count)-

.Museum of Natural History 354; 1-70.

McLean, J.H. 1984c. Shell reduction and loss in fissurellids: A

review of genera and species in the Fissurellidea group.

American Malacological Bulletin 2: 21-34.

McLean, J.H. and H. Andrade. 1982. Larger archibenthal

gastropods of central Chile: collections from an expeditions

of the FIA^ Anton Bruun and the Chilean shrimp fishery’.

Contributions in Science, Los Angeles County Museum ol

Natural History 342: 1-20.

McLean, J.H. and R.N. KObnrn. 1986. Propodial elaboration in

Sonthem African and Indian Ocean P’issurellidae (Mol-

Insca: Prosobranchia) with descriptions ol two new genera

and one new species. Contributions in Science, Los Angeles

County Mmsenm of Natural Hi.story 379: 1-12.

McLean, J.H. and D.L. Geiger. 1998. New genera and species

having the Fissurisepta shell form, with a generic-level

phylogenetic analysis (Gastropoda: Fissnrellidae). Contri¬

butions in Science, Los Angeles County Museum of Natural

Histor)’ 475: 1-32.

Strickland, J.H. andT.R. Parsons. 1972. A Practical Handbook of

Seawater Analysis. 2Tid ed. Bulletin Fisheries Research

Board, Ottawa, 310 pp.

Tliiele, J.H. 1891. Das GebLss der Schnecken, second volume, deliv’erv'

7. Nicokifsche Verlags-BncliliiuitUnng, Berlin, 251-334, 6 pLs.

Thiele, J. 1912. Scissnrelliden nnd Fissurelliden. In: Syste-

matiches Conchylien-Cabinet von Martini imd Chemnitz.

Kobelt, H.C. Kiister and W. Kobelt (eds). Bauer & Raspe,

Niiniberg, pp. 1-36, pis. 1-4.

Thiele, J. 1929. Handbuch der .systematLschen Weichtierkunde.

Erster Teil, Loricata, Gastropoda. 1. Prosobranchia

(Vorderkiemer). Gustav Fisher, Jena, 376 pp.

Zamorano, P., M.E. Hendrick-x, N. Mendez, S. Gomez, D.

Serrano, H. Aguirre, J. Madrid, and F.N. Morales-Senia.

2013. La exploracion de las aguas profundas del Pacifico

mexicano: el Proyecto Talud. In: A. Low Pfeng and E.M.

Peters Recargno (eds.). La Frontera Final: El Oceano

Profundo. INECC, Mexico, pp. 85-104.

Flof^^ United Malacologists

January 27, 2018

FLORIDA UNITED MALACOLOGISTS 2018

The ninth meeting of Florida United Malacologists (FUM 2018) will take place on Saturday, Januarv' 27, 2018, at the

Bcdley-Matthews National Shell Museum on Sanibel Island, Florida. The one-day gathering brings together researchers,

citizen scientists, and students interested in a broad swath of mollusk-related topics. FUM follows the pattern ol similar

informal gatherings such as BAM (Bay Area Malacologists), SCUM (Southern California United Miilacologists), MAM

(Mid-Atlantic Malacologists), and OVUM (Ohio Valley United Malacologists). The event circulates among different

Florida organizations, but usually takes place at the Shell Museum eveiy^ other year. Presentations are limited to

15 minutes plus 5 minutes for questions. Presenters are required to submit a brief abstract limited to 150 words or less. The

gathering will be free to presenters and pre-registered participants. Box lunches and dinner at a local restaurant (to be

arrangetl) will be avtiilable to participants and presenters. The deadline for abstract submission is December 31, 2017.

For registration and further information, visit http://shellmuseum.org/about/news/florida-united-malacologists-2018, or

emiiil [email protected].

THEe-NAUTILUS

\^()lnnie 131

2017

AUTHOR INDEX

Aln'arez-Cerrillo, L.H .

Anseeuw, P . 138

Bell, L.J . 138

Bogan, A.E . 202

Bough ET. P . 3

Brown, L.G . I'll"

Callomon. P . IPl

Castillo- Rodriguez, Z.G . 107

Chen, C . 43, 207

CowiE, R.H . 3

Fontaine, B . 3

Geiger, D.L . 226, 240

Glover, E.A . 127

Gosliner, T.M . 97

Harasewtch, M,G . 138

Hickman, C,S . 151

Houart, R . 207

Koike, H . 51

Larson, P . 163

.Marsh, L . 43

Martinez-Cruz, M . 67

Minton, R,L . 67

Mh’.ajima, Y . 51

Moe, C . 207

Naranjo-Garci'a, E . 107

Neville, B.D . 147

Newman, W,A . 87

Nobuhara, T . 51

Perez, K.E . 67

Regnier, C . 3

Ruiz, E . 67

SlCWART, J.D . 43

SyuiRES. R.L . 233

Stecheson, M,S . 233

SuArez-Mozo, N . 240

Taylor, J.D . 127

Valdes, A . 97

Valentich-Scott, P . 87

Waren, a . 97

Watters, G.T . 163

Zhang, S-Q . 76, 217

Zhang, S-P . 76, 217

NEW TAXA proposed IN VOLUME 131

GASTROPODA

Anatoma georgii Geiger, 2017, new species (Anatomidae) .

Asthehjs carei Geiger, 2017, new species (Segiienziidae) .

Botiujacmaea Jjecki S.-Q. Zliang and S.-P. Zhang, 20D, new species (Pectinodontidae) .

Bayerotrochiis helauensK Anseeuw, 2017, new species (Pleurotoniariidae) .

Carenzia golikovi Geiger, 2017, new .species (Segiienziidae) .

Chicoinurex excelms Houart, Moe, and Chen, 2017, new species (Muricidae) .

Chicorens (Triplex) aquiJus Houart, Moe, and Clien, 2017, new species (Muricidae) .

Chicoreus (Triplex) kaifoiwei Houart, Moe, and Chen, 2017, new species (Muricidae) .

Chondropomium caelicum Watters and Larson, 2017, new species (Annulariidae) .

Chondropomium sardom/x Watters and Larson, 2017, new species (Annulariidae) .

Cli/donopoma tiiamim Watters and Larson, 2017, new species (Annulariidae) .

Exilia stechesotme new species Squires, 2017, new species (Ptychatractidae, lossil) .

Fissurella hendrickxi Suarez-Mozo and Geiger, 2017, new species (Fissurelllidae) .

Laaiellomphahis S.-Q. Zhang and S.-P. Zhang, 2017, new genus (Neoinphalidae) .

Lanielloinphalus imnusensis S.-Q. Zhang and S.-P. Zhang, 2017, new species (Neoinphalidae)

Nenwcafaegis Hickman, 2017, new genus (Cataegidae) .

Nenwcataegis mcleani Hickman, 2017, new species (Cataegidae) .

Neinacataegis cpiinyii Hickman, 2017, new species (Cataegidae) .

Parvaplustrum cadieni Valdes, Gosliner, and Waren, 2017, new genus (Aplustridae) .

Praticolella salina Perez and Ruiz, 2017, new species (Polygyridae) .

Seguenzia inacleani Geiger, 2017 new species (Segiienziidae) .

Stiperbipoma Watters and Larson, 2017, new genus (Annulariidae) .

226

229

221

139

228

210

214

212

170

174

194

236

240

, 78

. 78

1.53

153

1.54

. 97

. 70

231

195

BIVALVIA

Lucinoina thnla Taylor and Glover, 2017, new species (Lucinidae) .

Pliocardia tanakai Miyajima, Nobuhara, and Koike, 2017, new species (Vesicoinyidae, fossil)

REVIEWERS EOR VOLUME 131

Reck, Lothar A.

Rogan, Arthur E.

Cadieii, Don

Campbell, David

Chaban, Elena

Chen, ChoTig

Eernisse, Dougla.s

Coldberg, Richard

Groves, Lindsey T.

Harasevv'vch, M.G.

Johnson, Paul

Kaiin, Andrzej

Kantor, Yuri 1.

Kiel, Steffen

Krylova, Elena M.

Lee, Harrv' G.

Linse, Katrvm

Lydeard, Charles

Marshall, R.A.

Nekola, Jeffrey C.

Niitzel, Alexander

Oleinik, Anton

Oliver, P. Graham

Pearce, Timothy A.

Pimenta, Alexandre D

Robinson, David G.

Sponsored in part by the State of

Florida, Department of State,

Division of Cultural Affairs and the

Florida Council on Arts and Culture

CULTURE

BUILDS

FLORIDA

flORIDADiPARTMSNU/ STATE

DIVISION ofCUtlUMl AFFAIRS

Rosenberg, Gaiy

Seibel, Rrad A.

Sigvvart, Julia D.

Slapcinslry, John

Strenth, Ned

Thiengo, Silvana

Valentich-Scott, Paul

W'aren, Anders

W’helan, Nathan

Zelaya, Diego G.

Zhang, Sliuqiang

INSTRUCTIONS TO AUTHORS

The Nautilus publishes articles on all aspects of the hi-

ology, piileontology, and systematics of mollusks. Manu¬

scripts describing oiigincd, unpublished research and

review articles will he considered. Brief articles, not ex¬

ceeding 1000 words, will be published as Research Notes

and do not require an abstract.

Manuscripts: Each original manuscript and ac-companying

illustrations should he submitted to the editor via e-mail.

Authors should follow the general recommendations of

Scientific Style and Format — The CSE Manual for Au¬

thors, Editors, and Publishers, available from the Council

of Science Editors at http://www.scientificstyleandfonnat.

org/Home.html.

The first mention of a scientific name in the text should

be accompanied by the taxonomic authority, including

year. Metric, not English, units are to be used. The se¬

quence of sections should be Title, Author(s) and Affili¬

ations, Abstract, Additional Keywords, Introduction,

Matericds and Methods, Results, Discussion, Conclusions,

Acknowledgments, Literature Cited, Tables, Figure

Captions, Figures. If the author for correspondence is not

tlie senior author, please indicate in a footnote. The ab¬

stract should summarize in 250 words or less the scope,

main results, and conclusions of the article. Abstracts

should be followed by a list of addition<il keywords. All

references cited in the text must appear in the Literature

Cited section and vice-versa. Please follow a recent issue

of The Nautilus for bibliographic style, noting that journcd

titles must be unabbreviated. Information on plates and

figures should be cited only if not included within the

pagination of cited work. Tables must be numbered and

each placed on a separate page. If in doubt, please follow

a recent issue of the journal for sequence of sections and

other style requirements.

Illustrations: Illustrations are rendered either at full-

page width (maximum width 17 cm) or column width

(maximum width 8.2 cm). Please take these dimensions

into consideration when preparing illustrations. Page-

width illustrations ideally should span the entire width of

printed page (17 cm). “Tall” page-width illustrations

should be avoided, square or “landscape” formats work

better. Please design plates accordingly, such that there

will be enough space left at the bottom of printed page for

plate caption. (Digital technology has made this task much

easier. )

All line drawings must be in black, clearly detailed, and

completely labeled. Abbreviation definitions must be

included in tlie caption. Line drawings must be high

resolution fi les at least 600 dpi (dots per inch) resolution

at actual size. Standard digital formats for line drawings

include .tif, .bmp, .psd, .eps, and .pdf.

Photographs may be submitted in black-and-white or

color, preferably in RGB mode if in color. Standard digital

formats for photographs include .tif, .psd, .jpg, or .pdf.

Photographs must be high resolution files at least 300 dpi

resolution at actual (printed) size.

If more than one figure is included in an illustration,

all figures are to be consecutively numbered (Figures

1, 2, 3, ... , NOT Figures lA, IB, 1C, . . . , NOR Plate 1,

Figure 1, . . .). In illustrations with more than one

figure, make sure that blank areas between figures

should be kept to a minimum, thereby allowing for

more area for each individual figure.

Compressed (e.g., jpg) or other low-resolution file

formats may be used to facilitate original submission and

the review process, but may not be acceptable at final

submission (see below).

Types and Voucher Specimens: Deposition of the

holotyjDe in a recognized institutional, public collection is

a recpiirement for publication of articles in which new

species-level taxa are described. Deposition of paratyj^es

in institutional collections is strongly recommended, as is

die deposition of representative voucher specimens for all

other tyi^es of research work.

The Editorial Process: Upon receipt, all manuscripts

are assigned a number and acknowledged. The ecfitor

reserves the right to return manuscripts that are sub¬

standard or not appropriate in scope for journal. Manu¬

scripts deemed appropriate for the journal will be sent for

critical review to at least two reviewers. The reriewers’

recommendations will serve as basis for rejection or

continuation of the editorial process. Reviewed manu¬

scripts will be sent back to authors for consideration of the

reviewers comments. The revised version of the manu¬

script may at this point be considered accepted for

publication by the jourmil.

Final Submission: Authors of accepted manuscripts are

required to submit a final version to the ecfitor at jleal@

shellmuseum.org. High-resolution image files may be sent

to the editor at this stage.

Proofs: After typesetting, proofs will be sent to the author.

Author should read proofs carefully and send corrections to

the editor within 48 hours. Changes otlier than typesetting

errors will be charged to the author at cost.

Offprints: An order form for offprints will accompany the

proofs. Offprints will be ordered directly from the editor.

Authors with institutional, grant, or other research sup¬

port will be asked to pay for page charges at the rate of $60

per page.

More information at http://shellmuseum.org/learn/the-

nautilus.

@ This paper meets the requirements of ANSI/NISO Z39. 48-1992 (Permanence of Paper)

SMITHSONIAN LIBRARIES