Erz
ive
LIE
Arr
er
”
un
RE
Rant!
2 Mie -
os
en à
3
4
2
0
14
3 3
/ «
}
i
a =
)
5
4
a \
f
j
j
(2
. \
‘ Le
‘
2
> +
N
% i
x
— 4
a
se |
\ yd }
2 1
I zu N
à #
i] ‘ rut
me
NOTA
LEPIDOPTEROLOGICA
A journal devoted to the study of Lepidoptera
Published by Societas Europaea Leptdopterologica (SEL)
Vol. 25 No. 1 2002
SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e. V.
http://www.zmuc.dk/entoweb/sel/sel.htm
COUNCIL
President:
Vice-President:
General Secretary:
Treasurer:
Membership Secretary:
Ordinary Council Members:
Editor in chief:
Assistant Editor: '
HONORARY MEMBERS
Prof. Dr. Niels P. Kristensen (DK)
Prof. Dr. Jacques Lhonoré (F)
Dr. Christoph L. Häuser (D)
Manfred Sommerer (D)
Willy O. de Prins (B)
Dr. David Agassiz (UK),
Prof. Dr. Jaroslaw Buszko (PL),
Michael Fibiger (DK), Dr. Elisenda Olivella (E),
Dr. Alberto Zilli (1)
Prof. Dr. Konrad Fiedler (D)
Dr. Matthias NuB (D)
Pamela Gilbert (GB), Barry Goater (GB), Prof. Dr. Laszlo Gozmany (H), Prof. Dr.
Vladimir Kuznetzov (RU), Prof. Dr. Clas M. Naumann (D), Dr. P. Sigbert Wagener (D)
Copyright © Societas Europaea Lepidopterologica (SEL)
ISSN 0342-7536
Printed by druck-zuck GmbH, Halle/Saale, Germany
All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or
mechanical including photocopying, recording or any other information storage and retrieval system, without written
permission from the publisher. Authors are responsible for the contents of their papers.
Nota lepidopterologica
A journal devoted to the study of Lepidoptera
Editor in chief: Prof. Dr. Konrad Fiedler, Lehrstuhl für Tierökologie I, Universität Bayreuth,
D-95440 Bayreuth, Germany; e-mail:
[email protected]
Assistant Editor: Dr. Matthias Nuß, Staatliches Museum für Tierkunde, Königsbrücker Landstr. 159,
D-01109 Dresden, Germany; e-mail:
[email protected]
Editorial Board: Dr. Enrique Garcia-Barros (Madrid, E), Dr. Roger L. H. Dennis (Wilmslow, UK),
Dr. Peter Huemer (Innsbruck, A), Ole Karsholt (Kobenhavn, DK), Dr. Yuri P. Nekrutenko (Kiev, UA),
Dr. Erik J. van Nieukerken (Leiden, NL), Dr.Wolfgang Speidel (Bonn)
Contents ® Inhalt » Sommaire
Volume 25 No. 1 Halle / Saale, 01. 08. 2002 ISSN 0342-7536
The discovery, description and taxonomy of Paysandisia archon
(Burmeister, 1880), a castniid species recently found in southwestern
Europe (Castniidae)
ES MONTERS «2:2 ER Eee 3
Synonyms of European Tortricidae and Noctuidae, with special reference
to the publications of Hübner, Geyer and Frölich
ENG SPEDEL GC TBI AARVIK |is.:00.¥.cchs.sseseoscccscccsesesssecslecstenssvdabeceenseseaters 7
Comparison of factors influencing the habitat characteristics
of Gortyna borelii (Noctuidae) and its larval foodplant Peucedanum officinale
in England and Germany
by ZoË RINGWOOD, TIM GARDINER, AXEL STEINER & JULIAN HILL ..............n 23
Experimental evidence for specific distinctness of the two wood
white butterfly taxa, Leptidea sinapis and L. reali (Pieridae)
BEE BREESE. & KONRAD FIEDLER sssseenscaacdoorexsseseserconysssoscsusnecenescensnesversesssssassves 39
Notes on systematics of the Erebia dabanensis species complex, with
special consideration of the dabanensis-youngi and anyuica-occulta pairs
of sibling species (Nymphalidae: Satyrinae)
D Ex G.BELIK & DMITRY G::ZAMOLODCHIKOV .......ssssscsseevsssonccerscsnseceusesuenens 61
Chazara persephone (Hübner, [1805]) or Chazara anthe (Hoffmansegg, 1806)
what is the valid name? (Nymphalidae, Satyrinae)
ELBE DEN ee et RP PR OPA AA eme st ninsnay 81
CL A aol tt die ice 16, 22, 60, 79
Erratum
The editors apologize for a missing indication of authorship for the book review of
Lastuvka, Z. & A. Lastuvka, 2001, The Sesiidae of Europe published in Nota
lepidopterologica 24 (4): 85-86. This review has been written by AxEL KALLIES.
Nota lepid. 25 (1): 3-15 3
The discovery, description and taxonomy of Paysandisia archon
(Burmeister, 1880), a castniid species recently found in south-
western Europe (Castniidae)
VICTOR SARTO I MONTEYS
Departament d’Agricultura, Ramaderia 1 Pesca-Fundacid CReSA/Entomologia, Universitat Autonoma de
Barcelona. Campus de Bellaterra, edifici V, 08193 Bellaterra, Barcelona, Spain. E-mail:
[email protected]
Summary. Paysandisia archon (Burmeister, 1880) is an attractive castniid moth whose presence in
Europe has been recently reported. Its larvae are endophagous (the first instar can be partly exophagous)
and feed inside the trunks and branches of several species of Arecaceae (palm trees), such as Trachycarpus,
Trithrinax, Phoenix, Chamaerops, Butia, Washingtonia, Brahea, Livistona and Syagrus. The present
paper deals with the historical aspects of its discovery in the Argentine province of Catamarca, becoming
the first castniid species ever found in Argentina. Details concerning its description by Hermann
Burmeister, based on probably only two specimens that he did not collect himself, and the subsequent
taxonomy of this moth, which was originally included in the genus Castnia Fabricius, 1807, are reported.
Widespread errors concerning the original date of publication of archon (which is 1880) as well as that
of its synonym josepha Oberthur (which is 1914) are discussed and corrected. The only known
paralectotype of Castnia archon Burmeister, 1880, a male, is figured (Museo Argentino de Ciencias
Naturales “Bernardino Rivadavia”, Buenos Aires).
Zusammenfassung. Seit kurzem ist die urspriinglich sidamerikanische Art Paysandisia archon (Bur-
meister, 1880) (Castniidae) auch aus Spanien und S-Frankreich bekannt. Die Larven leben endophag
(die des ersten Stadiums z.T. exophag) im Stamm von Palmen (Arecaceae) wie Trachycarpus, Trithrinax,
Phoenix, Chamaerops, Butia, Washingtonia, Brahea, Livistona und Syagrus. Hier wird die Entdeckungs-
geschichte in der argentinischen Provinz Catamarca dargestellt. P archon war die erste aus diesem
Land bekannt gewordene Castniiden-Art. Einzelheiten zur Erstbeschreibung durch Hermann Burmeister
und die taxonomische Beurteilung von P. archon (die zunächst der Gattung Castnia Fabricius, 1807
zugeordnet wurde) durch spätere Autoren werden berichtet. Irrtümer zum Jahr der Originalbeschreibung
von archon (1880) und dem subjektiven Synonym josepha Oberthür (1914) werden diskutiert und
berichtigt. Der einzig bekannte männliche Paralectotypus von Castnia archon Burmeister, 1880 wird
abgebildet (aufbewahrt im Museo Argentino de Ciencias Naturales “Bernardino Rivadavia”, Buenos
Aires).
Resume. Paysandisia archon (Burmeister, 1880) est un attirant castnidien dont la présence vient d’être
recemment signalée en Europe. Ses larves sont endophages (le ler. stade peut étre partiellement
exophage) et elles se nourrissent à l’intérieur des troncs et des branches de plusieurs espèces d’Arecaceae
(palmiers), telles que Trachycarpus, Trithrinax, Phoenix, Chamaerops, Butia, Washingtonia, Brahea,
Livistona et Syagrus. Ce travail traite exclusivement de certains aspects historiques concernant sa
découverte dans la province Argentine de Catamarca, devenant ainsi la lére espece de castnidien
trouvée en Argentine. Y sont ajoutés des details de la description faite par Hermann Burmeister, basce
très probablement sur uniquement deux exemplaires qui n’avaient même pas été capturés par lui, et de
la taxonomie subséquente de cet insecte qui à l’origine avait été inclu dans le genre Castnia Fabricius,
1807. On y discute et corrige des erreurs largement repandues sur la date originale de publication
d’archon (qui est 1880) ainsi que celui de son synonyme josepha Oberthiir (qui est 1914). On y figure
le seul paralectotype connu, un mâle, pour Castnia archon Burmeister, 1880 (Museo Argentino de
Ciencias Naturales “Bernardino Rivadavia”, Buenos Aires).
Resumen. Paysandisia archon (Burmeister, 1880) es un atractivo castnido cuya presencia en Europa
se ha dado a conocer recientemente. Sus larvas son endöfagas (el primer estadio puede ser parcialmente
exöfago), y se alimentan en el interior de troncos y ramas de varias especies de Arecaceae (palmeras),
tales como Trachycarpus, Trithrinax, Phoenix, Chamaerops, Butia, Washingtonia, Brahea, Livistona
y Syagrus. El presente trabajo trata tan sölo de aspectos histöricos relativos a su descubrimiento en la
provincia Argentina de Catamarca, convirtiéndose en la primera especie de castnido hallada en
Argentina. Se aportan detalles de su descripciön por Hermann Burmeister, basada probablemente en
tan sölo dos ejemplares que no habian sido capturados por él mismo, y de la subsiguiente taxonomia
de esta polilla, la cual habia sido originalmente incluida en el género Castnia Fabricius, 1807. Se
discuten y corrigen errores ampliamente extendidos sobre la fecha original de publicaciön de archon
(que es 1880) asi como el de su sinönimo josepha Oberthür (que es 1914). Se figura el Unico
© Nota lepidopterologica, 01.08.2002, ISSN 0342-7536
4 SARTO: Paysandisia archon
paralectotipo conocido, un macho, de Castnia archon Burmeister, 1880 (Museo Argentino de Ciencias
Naturales ”Bernardino Rivadavia”, Buenos Aires).
Key words. Paysandisia, archon, Castniidae, Europe, Arecaceae, pest status, history, taxonomy
Introduction
Paysandisia archon is an attractive castniid moth whose presence in Europe was recently
indicated by Aguilar er al. (2001) as having a well established population in the north-
eastern Spanish province of Girona, within Catalonia. In the following towns, arranged
from north to south, larvae were found within palm trunks: Cornella de Terr, Sant
Feliu de Pallerols, Les Planes d’Hostoles, Bordils, La Cellera de Ter, Angles. Towns in
that province where typical damage on the palms has been detected (although trunks
were not cut open to look for the larvae) are, at the time of writing, as follows: Vila-
Sacra, Sant Pere Pescador, Pontös, Bäscara, L’Escala, Torroella de Montgri, Cornella
del Terri, Sant Feliu de Pallerols, Les Planes d’Hostoles, Bordils, Jafre, Celra, La Pera,
Sant Gregori, Cervia, La Cellera de Ter, Anglès, Bescano, Palafrugell, Vall-Llobrega,
Vilobi d’Onyar, Santa Coloma de Farners, Caldes de Malavella, Llagostera, Santa
Cristina d’Aro, Castell-Platja d’Aro, Arbucies, Sant Feliu de Buixalleu, Breda. In
September 2001, several adults were seen flying around palm trees at the locality of
Cardedeu, the first record in the province of Barcelona. Later, its presence was also
reported from south-eastern France (Sarto 1 Monteys & Aguilar 2001; Drescher &
Dufay 2001), in the areas of Hyeres and Toulon (Departement de Var).
The larvae of this moth are endophagous (the first instar can be partly exophagous)
and feed mainly inside the trunk of several species of Arecaceae (palm trees), such as
Trachycarpus, Trithrinax, Phoenix, Chamaerops, Butia, Washingtonia, Brahea,
Livistona and Syagrus. Infected trunks may be severely damaged because of the galleries
produced by the larvae as they bore into them, as well as by secondary infections by
fungi and other micro-organisms that may result. Although this species is not considered
to be a palm pest in its native habitat (north-western Argentina, Paraguayan Chaco,
western Uruguay and the southernmost state of Brazil, Rio Grande do Sul, all located
between 25-35° southern latitude), it certainly is so in Spain and France. Full details
of its pest status will be given in a separate paper (Sarto 1 Monteys & Aguilar, in prep.).
The present paper deals with the discovery, description and taxonomy of this castniid
moth. While conducting a thorough bibliographic search into the historical background
of this species several inaccuracies were discovered that require correction.
First period: from Burmeister to Strand (1878-1913)
Paysandisia archon was described in 1880, as Castnia archon, by Dr. Hermann Carl
Conrad Burmeister, then Director of the Museo Püblico de Buenos Aires (now the
Museo Argentino de Ciencias Naturales “Bernardino Rivadavia”), where the types
(actually two syntypes) are currently housed. However, if one checks the entry for
archon in the checklist of Neotropical Castniidae (Miller 1995), the year of publication
is given as 1879. The same year appears in Lamas’ 1995 checklist in which he makes
a very thorough and critical review of the previous checklist by Miller. This same
Nota lepid. 25 (1): 3-15 5
mistake is reproduced in all publications consulted where the year of description for
archon is quoted (from Breyer 1931 to Drescher & Dufay 2001). The only exception to
this is that of Miller (1986) in which the correct year, 1880, is given. It seems
inexplicable, therefore, that Miller reverted to 1879 in her 1995 checklist.
Checking the original publication by Burmeister one can understand how the mistake
may have originated. In 1878 Burmeister published his “Description physique de la
République Argentine..”. This book contained no plates; these were published later in
a separate, but complementary work, the “Atlas de la description physique de la
République Argentine...”, published in two installments, or “livraisons” in French, each
clearly stating the year of publication on its title page. The first livraison was published
in 1879 and the second one in 1880; the two together contained 64 text pages (the first
(1879) pages 1-40 and the second (1880) pages 41-64) as well as 24 colour plates,
plus one supplementary monochrome plate.
On page 54 of the second livraison (1880), Burmeister includes a section entitled
“Additions et corrections du tome V” and it is on page 56 where he provides the
description of archon: “I. Castnia archon. C. fusco-testacea; alis anticis satis angustis,
acutis, immaculatis; posticis aurantiacis, macula magna disci sinuosa nigra, cum
maculis sex albidis, in fasciam transversam congestis. Exp. Alar. 4-47 [10-11 cm.]”.
It is worth noting that, although it is not the main subject of this paper, the date of
publication of Castnia uruguayana (now Geyeria uruguayana) must also be 1880 and
not 1879 as appears in some checklists, e.g. in that of Lamas (1995). Burmeister
describes it on pages 56-57 of this second livraison.
It is historically interesting to note that in his 1878 book (mainly dealing with
Argentine Lepidoptera) Burmeister deals with the family Castniidae (his “Dixieme
Famille”) on pages 298-301 and later (Atlas pl. IX, Fig. 13, 14) even figured the wing
design and venation of two species. In his text, he seems very familiar with Neotropical
castniids, giving quite accurate morphological and ethological observations, as well as
narrating one particular encounter he had in Brazil with Castnia decussata (now Geyeria
decussata (Godart [1824]).
However, in 1878, no castniids had yet been found in Argentina. Burmeister ex-
plains: “Nous avons regu dernierement, dans l’ouvrage de Boisduval: Spec. gener. des
Lepid. Hétéroc. tome 1, une synopsis des espèces connues, dont l'auteur en décrit 68
de l’Amérique tropicale et 10 de Nouvelle Hollande. Jusqu'à présent aucune n'a été
trouvée dans notre territoire, mais comme des différentes Orchidées et Broméliacées
sont indigènes dans les forêts vierges des Missions et du Grand Chaco du Nord, nous
avons encore l'espérance de rencontrer une ou autre espèce de ce groupe particulier”.
The wait was not long as just two years later, Burmeister mentions the first castniid
species for Argentina, a new species from the northwestern Province of Catamarca,
which he described as Castnia archon.
The type specimens of archon were given to Burmeister by a collector called Georg
Ruscheweyh, who in turn had received them from an unknown collector as originating
from the “Province of Catamarca” (as it is specified in the original description).
6 Sarto: Paysandisia archon
According to Dr. Bachmann (pers. comm.), curator of entomology at the Museo
Argentino de Ciencias Naturales “Bernardino Rivadavia”, there are only two speci-
mens, one male and one female, of archon housed in this museum bearing a label
handwritten by Burmeister; the labels read “Archon Burm.” and are accompanied by
another typewritten pink label reading “Typus”. Because Burmeister did not designate
a holotype in the original description, these two specimens must be considered syntypes;
most likely they were the only ones received from Ruscheweyh. Unfortunately, no —
further labels can be found either pinned with these two specimens or within the drawer
that contains them, so precise data on their origin is lacking.
Concerning the type locality for archon, “Province of Catamarca”, serious doubts
arise about its validity. In fact, after Burmeister’s description in 1880, it has never been
found there nor in the neighbouring Province of La Rioja, both in northwestern
Argentina. Jorgensen (1930) explains that although he lived for three years in the
Province of Catamarca and intensively looked for castniids there, he never saw it.
Furthermore, according to Jorgensen, the moth was also never found by Dr. Giacomelli
in La Rioja where the latter lived nearly all his life. Moreover, not a single modern
record exists. According to Dr. Bachmann (pers. comm.) there are virtually no palm
stands in these two provinces and this would account for the lack of archon populations,
since its larvae are specialized palm feeders. :
The specimens on which Burmeister based his description of Castnia uruguayana,
just after Castnia archon in the same 1880 publication, were also received via Georg
Ruscheweyh from an unknown collector. However, in uruguayana the exact type locality
is given in the original description as Paysandu (Uruguay). My reckoning is that the
two archon syntypes given by Ruscheweyh to Burmeister also came from the Uruguayan
town of Paysandu, where archon was and is very abundant, and that they were
mislabelled, possibly intentionally as there was an eagerness to find the first castniid
species for Argentina. The truth will probably never be known.
Burmeister did not provide a figure of his Castnia archon, which possibly accounted
for some confusion as to its identity among subsequent authors, as well as the
redescription of the species in 1914 by Oberthür as Castnia josepha (see below).
Jorgensen (1930) figured for the first time the female syntype housed at the present
Museo Argentino de Ciencias Naturales “Bernardino Rivadavia”, from a black-and-
white photograph made by Dr Carlos Bruch (see below), although stating incorrectly
that it was Burmeister’s type of archon and neglecting the male syntype. This female
syntype must be considered the archon lectotype, as according to Article 74.5 of the
Code (ICZN 1999), Jörgensen’s action constitutes a valid lectotype designation.
Subsequently (see articles 73.2.2. and 74.1.3. of the Code), the male syntype becomes
automatically a paralectotype; the latter is figured here (Fig.1) for the first time.
When Embrik Strand dealt with the Neotropical Castniidae, together with Adalbert
Seitz, who wrote a fine introduction to this group and had considerable personal
experience himself with Neotropical castniids (Seitz & Strand 1913), they included
“Castnia archon Burm.” on page 13, but added nothing new to Burmeister’s notes,
simply reproducing Burmeister’s original description of archon . They stated for example
that archon is similar to the Brazilian Castnia therapon, though twice as big, more or
Nota lepid. 25 (1): 3-15
ui
a T j : | "
m
m
ml
3
Fig. 1. Paralectotype of Castnia archon (Burmeister, 1880), male, upperside and underside, Museo
Argentino de Ciencias Naturales “Bernardino Rivadavia”, Buenos Aires. Photo: G. Lamas.
less the same what Burmeister wrote in 1880. Obviously, they never saw an archon
specimen and had to rely upon Burmeister’s description. In fact, C. therapon, now
known as Athis therapon (Kollar, 1839), is not as similar to archon as Burmeister first
stated. Not surprisingly, Castnia archon is not figured in the plates of Seitz & Strand
(1913) while Castnia therapon appears on plate 7 of that work. By 1913, nothing was
8 Sarto: Paysandisia archon
known about the biology and distribution of Castnia archon, apart from its supposed
type locality in the Argentine Province of Catamarca.
Second period: from Oberthür to Houlbert (1914-1918)
In 1914, the famous French lepidopterist Charles Oberthür reported what he believed
was a new Castnia species (Oberthür 1914). He named it Castnia josepha after his —
fellow countryman Monsieur Joseph Petit, who presented to him four specimens,
obtained from cocoons he had found on palms, and three cocoons. These had been
obtained in Paysandu, a town located in western Uruguay, near the border with the
Argentine province of Entre Rios and about 1000 km from the Argentine Province of
Catamarca. As usual, Oberthür figured in colour (plate CCLVII) (Fig. 2) one male and
one female of his new species josepha (superbly and accurately rendered by Jules
Culot), although he did not use for the illustrations those first four specimens but others
that M. Petit presented to him later (see below). He accurately described the moths
and, concerning the cocoons (which were not figured) only stated: “Ces cocons sont
grands et formés d’un tissu végétal très serré de fibres fines et dures, ayant une apparence
de chiendent”. Oberthür provided no information about the hostplant or biology of this
species. The type series of josepha is currently housed in the collection of The Natural
History Museum, London (Fig. 3).
The correct year of description
for josepha is 1914, not 1913
as 1t appears many times in the
literature (e.g. Houlbert 1918,
Miller 1995). Oberthür’s Fasci-
cle IX of his Etudes de
Lepidopterologie comparee
was published in two parts, the
first in 1913 and the second, in
which josepha is described, ın
1914; those years are clearly
stated on the title pages of each
part. Many subsequent authors
(including Aguilar er al. 2001)
cite 1913 when referring to
josepha. Lamas (1995) correctly
cites 1914 in his checklist.
Fig. 2. Castnia josepha Oberthür,
1914, male and female, reproduced
from Oberthür’s original description.
As indicated in the text, josepha
i N Oberthür, 1914 is a synonym of archon
‘Gok Deep Te Burmeister, 1880. Photo: V. Sarto i
Monteys.
Nota lepid. 25 (1): 3-15 9
Fig. 3. Paysandisia archon (Burmeister, 1880) specimens (two right columns) along with other castniids
(two left columns) belonging to the Oberthür collection deposited in drawer “Castnia 16” at The NHM
London. Included are the “Castnia josepha” Oberthur lectotype (a male, fourth on the right column) and
the paralectotype (a female, fifth on the same column) selected by J. Y.Miller in 1977, the lectotype only
bears a label that reads “Uruguay, Jos. Petit, 1902”. [Wing spans of Spanish bred specimens average
7.82 cm (males; n=10) and 9.22 cm (females; n=12)] Photo: V. Sarto 1 Monteys.
A milestone in the study of Neotropical Castniidae was undoubtedly the massive work
by Constant Houlbert, a professor at the University of Rennes, which was published in
1918 in Oberthiir’s Etudes de Lépidoptérologie comparée. To undertake this immense
work Prof. Houlbert had access to the extensive Neotropical Castniid collection of
Oberthur (approximately 425 specimens, “qui renferme 105 espèces ou variétés réparties
en 33 genres”, to use his own words). In addition, he also incorporated data on all
castniids deposited at that time in the Muséum National d'Histoire naturelle, Paris,
assisted by the lepidopterist Ferdinand Louis Le Cerf.
In that work Houlbert described several new genera of Neotropical Castniinae, in-
cluding Paysandisia (see below). Miller (1995) accepted the genera established by
Houlbert, and further refined by Rothschild (1919), Oiticica (1955) and Miller (1976,
1980), “with some reservation”. Lamas (1995) also follows Miller’s arrangement
although stating clearly that “Even though the generic arrangement adopted in Miller’s
list is completely unsatisfactory to me, for the sake of simplicity I have followed it,
recognizing the same genera as her”.
Houlbert had never seen the type of archon, so placed it in his revision with therapon
in the genus Orthia” Herrich-Schäffer [1853], no doubt because, according to
Burmeister, and then repeated by Seitz & Strand (1913), who also had not seen the
type, archon was said to be “similar” to therapon.
10 Sarto: Paysandisia archon
Houlbert was unaware that Burmeister’s archon was the same species as Oberthür’s
josepha. He created a new monotypic genus to include josepha, which he named
Paysandisia after the Uruguayan town of Paysandu, where Joseph Petit had obtained
all the specimens. Houlbert’s original description of Paysandisia is as follows:
“Ailes antérieures d’un gris rosé uniforme dans toute leur étendue, avec quelques
points noirs (mâles) ou deux taches claires discontinues (femelles) partant de la cel-
lule discoidale et se dirigeant transversalement vers l'angle interne (Fig. 96). Ailes
inférieures d’un rouge orangé, portant dans leur milieu une grande tache noire de
forme irrégulière marquée centralement de macules blanchätres. Le corps, en dessous,
est d’un gris un peu jaunätre, les antennes sont d'un gris brun. La lamelle libre des
plantules (Fig. 97) est ovale et nous a paru fortement bombée en avant.”
Figure 96 is a drawing that shows the wing design and maculation patterns of the
right upperside of a female josepha. Figure 97 is a drawing of morphological features
of the post-tarsus, including the arolium.
Certainly, such a generic description, based almost exclusively on wing colour and
maculation patterns, would not be valid by today’s standards. Paysandisia is maintained
today as a valid monotypic genus by J. Y.Miller (1986; 1995) and Lamas (1995), although
my opinion is that a modern revision of the Castniini (i.e. the Neotropical Castniinae)
is badly needed and might change the present placement. |
When Houlbert dealt with josepha, there already named as “Paysandisia josepha
Obthr.”, he reproduced the text of Oberthür’s 1914 original work, adding that, apart
from the four specimens already quoted in Oberthür’s work, he was able to study eight
more, also from Paysandü and collected again by Joseph Petit. Houlbert explains that
one male and one female of these last eight specimens were used by Culot for making
the beautiful colour figures reproduced in Oberthür’s original work. Also important is
the fact that for the first time some data on the hostplant and other biological details
were published by Houlbert, thanks to the information given to him by M. Petit. These
were as follows: “Le P. josepha vole tres rapidement, a la fagon des Sphinx, mais en
plein midi, autour des Palmiers à feuilles épineuses à l’intérieur desquels vit la che-
nille qui est blanchätre et a tete brune. L’éducation de la chenille est difficile a réaliser,
mais la recherche des cocons, presque toujours fixes a l’aisselle des petioles, fournit
aux chasseurs le moyen d'obtenir rapidement un grand nombre de Papillons vivants.
Les oeufs sont pondus sous les feuilles; a l’eclosion, les petites chenilles gagnent
l’intérieur des troncs où elles creusent, dans la moelle, de larges galeries, qui
s’entrecroisent dans tous le sens et qui ne sont pas sans causer quelque préjudice aux
Palmiers.”
“ Today, therapon is placed in the genus Athis Hübner, [1819], so one would expect Orthia Herrich-
Schaffer [1853] to be a synonym of Athis; however Fletcher and Nye (1982: 114) clearly stated the
generic name Orthia belongs in the Agaristidae (currently a subfamily of the Noctuidae). Lamas (1995)
followed Fletcher & Nye and accordingly eliminated in his checklist Orthia as a synonym of Athis. The
placement of Orthia in the Castniidae, as a synonym of Athis, by Miller (1995) is most likely due to a
misinterpretation.
Nota lepid. 25 (1): 3-15 IA
It is in this short paragraph where we learn for the first time that palm trees (with
“spiny leaves”) are the hostplants of archon and the first indication that the larvae
might cause damage to palm trees. The palm tree referred to by Petit must have been
Phoenix canariensis (see below).
Houlbert also complemented the description already given by Oberthür (1914) of the
three cocoons of archon by figuring them life size in an excellent photograph (Fig. 97-
bis of his revision). He also comments on the absence of pupal exuviae inside the three
empty cocoons: “Les parois chitineuses des chrysalides ont probablement été extraites
apres l’Eclosion; en tout cas nous n’en avons trouvé aucune trace à l’intérieur des
cocons.” This observation by Houlbert has a significant biological meaning, though he
was at the time unaware of this (Sarto 1 Monteys & Aguilar, in prep.).
Third period: Bourquin and Jorgensen (1930-1944)
In September 1930, the Argentine Fernando Bourquin visited Paysandü (Uruguay)
and by chance (Bourquin 1933, 1944) reached the property of Joseph de Boismenu, a
nephew of Joseph Petit. de Boismenu had collaborated with his uncle by sending
specimens of josepha and information to Charles Oberthür in France.
Whilst in Paysandu, undoubtedly following the information given to him by de Boismenu,
Bourquin carried out a thorough search of palm trees over a period of several days. He only
managed to find two live cocoons on the frond leaf axils of two palm species, Phoenix
canariensis (the spiny-leaved palm that Petit had indicated to Houlbert) and Trithrinax
campestris (the Spanish “Palmera Caranday” or English “Campestre palm”).
He also obtained some eggs which were figured (a photograph with three eggs) and
described quite accurately (Bourquin 1930). These were probably given to him by de
Boismenu as he makes no mention of having found them himself on the palms. This is
reinforced by the fact that what he states about where the female lays the eggs on the
palms (“within a small hole”) was obviously communicated to him by someone else
(probably again by de Boismenu) and it is not correct (Sarto 1 Monteys & Aguilar, in
prep.). In addition, he briefly mentions some morphological details of the pupa such as
its brown colour and the rows of teeth present on the abdominal segments that help it
move outside the cocoon prior to emergence.
So far, all biological information about this castniid came from the population at
Paysandu (i.e. josepha). Nothing was known about the population found in the Argentine
Province of Catamarca (i.e. archon).
In his 1930 paper, Bourquin did not mention that he had found two live cocoons on
the palms at Paysandu as explained above (he only mentioned this in his 1933 and
1944 publications). Also he told nothing about Joseph de Boismenu and the help he
received from him (again he only did so in those two latter publications) and, most
surprisingly, he referred directly to Castnia archon Burm. as the species he was dealing
with! Not a single reference to Oberthiir’s josepha appeared in his 1930 paper, which
furthermore had a rather ambiguous title “Algunas observaciones sobre Castniidae”,
i.e. “Some observations on Castniidae” when the paper was dealing solely with archon.
No doubt, Bourquin had become aware by September 1930 that josepha and archon
were the same species.
12 Sarto: Paysandisia archon
The explanation to these puzzling facts came to me later when I encountered a paper
by Alberto Breyer (1931), published in the same journal as that of the Bourquin paper.
There, Breyer added two more Argentine localities for archon (Concordia, Province of
Entre Rios; Cordoba, Province of Cordoba) and, most importantly, established the syn-
onymy between archon Burmeister and josepha Oberthir as follows:
“<,..> Considerando que la descripcion de Oberthur para la Castnia josepha nos pinta la Castnia archon
de Burmeister en todos sus detalles, que los ejemplares de Oberthur son de Paysandu como algunos de los
revisados por nosotros y como los observados por el senor Bourquin, y que las observaciones biologicas
son idénticas, como también la planta alimenticia (palmeras), no titubeamos en declarar la sinonimia
entre ambas denominaciones. Habiendo publicado Burmeister en el ano 1879, y Oberthür en 1913, la
prioridad queda a favor de la denominacion de Burmeister como Castnia archon Burm.”
No doubt Breyer had discovered, some time before September 1930, that archon
and josepha were synonyms and had communicated this to Bourquin. However this
was not published by Breyer until 1931. This is why Bourquin was so sparing in his
1930 paper: (1) because he was going to have his paper on the castniid published a bit
earlier than that of Breyer establishing the synonymy, (2) because he did not want to
take the priority about the synonymy out of Breyer’s hands and, (3) because at the
same time he disliked the fact of using the name josepha for what he knew would soon
become a synonymic name. So he just referred to Castnia archon in his 1930 paper
and eliminated any reference to Joseph de Boismenu, Joseph Petit and everything that
might link this castniid to Oberthür’s josepha. Later, in his 1933 and 1944 publications,
he gave proper credits to all people at Paysandu that had helped him.
In an interesting paper by Pedro Jorgensen (1930) dealing with all known Castniidae
of Argentina and Paraguay, he gives valuable information about the distribution and
biology of these moths, mainly from his own experience. For Castnia archon Burm.,
he only quotes what was already known from Burmeister’s work with the comment
(translated from Spanish) “It must be extremely rare or very local, as I have never seen
it during my three year stay in that province. And I believe Mr. Giacomelli has neither
seen it in the neighbouring province (Rioja)”.
The most important thing about this paper is that on plate X he figures, for the first
time, a black-and-white photograph of a female he says is Burmeister’s type of archon
(actually it was one of the two syntypes and must be considered the valid lectotype, as
explained above). So, 50 years after it was described by Burmeister, “Castnia archon”
was first shown in an illustration to the scientific community.
Later, Bourquin (1933, 1944) described quite accurately the archon larva and pupa,
figured the final larva and all other life stages (Fig. 4) and gave very useful biological
data, mentioning that it had the potential to become a serious pest of palms.
Fourth period: from Miller to present (1986-2001)
Another milestone in the study of Neotropical Castniidae is J. Y. Miller’s 1986 work
on this group. Miller retained archon Burmeister, 1880 in the monotypic genus
Paysandisia Houlbert, 1918, and provided an accurate diagnosis of the genus. It is
distinguished by the following apomorphic characters: “origins of R;, R>, and R; equi-
Nota lepid. 25 (1): 3-15 13
Fig. 4. Plate XXXII reproduced from Bourquin (1933), depicting the life history of Paysandisia archon
(Burmeister, 1880). Photo: M. R. Honey.
distant, with R3, Ry, and R; connate; distinctive setal-scale patch along cubital veins
on basal two-thirds of forewing, subcostal retinaculum absent; female genitalia, duc-
- tus bursae membranous, undulate, corpus bursae membranous without signae.”
She also gave details of many adult morphological characters (both male and female),
figuring for the first time the labial palpus, the complete wing venation and the male
and female genitalia. However, concerning the early stages, larval foodplants, flight
period and distribution, reference is only made to Bourquin’s 1933 paper, including
some inaccuracies and omitting some published data (e.g. Breyer 1931, Biezanko 1961;
cf. Sarto 1 Monteys & Aguilar, in prep.).
Later (Miller 1995) treats the Uruguayan population of archon (i.e. that used by
Oberthiir to describe josepha) as a good subspecies of archon, i.e. as Paysandisia
14
Sarto: Paysandisia archon
archon josepha (Oberthür). The Argentine population would thereby become the nomi-
nal subspecies, 1.e. Paysandisia archon archon (Burmeister). This appears to have
been done without any justification of the characters used to separate both supposed
subspecies and is based only on their extremely partially known distribution. Lamas
(1995) relegated archon josepha (Oberthür, 1914) as synonym of archon (Burmeister,
1880). Very recently, then, the species was also discovered in Spain and France (see
Introduction) where it has been accidentally introduced.
Acknowledgments
The research that culminated in this paper would have been impossible without the help of several
colleagues who contributed in different ways, mostly assisting with literature and useful comments.
These are as follows (arranged alphabetically): Dr Axel O. Bachmann, David Carter, Carlos A. Debona,
Martin R. Honey, Dr Ian J. Kitching, Dr Jacqueline Y. Miller, Carlos S. Morey, Dr Richard S. Peigler,
Antonia Rodriguez (MZB) and Andrés E. Varga. Special thanks go to Gerardo Lamas who recently
photographed the paralectotype specimen and gave permission to publish this photograph here. M. R.
Honey (The Natural History Museum, London) and R. S. Peigler (University of the Incarnate Word, San
Antonio, Texas), deserve special mention for their support and patience during my initial, constant
enquiries; they also provided linguistic assistance. Two anonymous referees and Dr. Ole Karsholt improved
the final manuscript with their valuable comments. Also I express my gratitude to the Catalonian
Department of Agriculture, Barcelona, for their financial support of my research trip to The Natural
History Museum, London.
Literature
Aguilar, LL, J. Y. Miller & V. Sarto i Monteys 2001. A new lepidopteran family for the European fauna.
— SHILAP Revta. lepid. 29 (113): 86-87.
Biezanko, C. M. 1961. XIV. Castniidae, Zygaenidae, Dalceridae, Eucleidae, Megalopygidae, Cossidae
et Hepialidae da Zona Missioneira do Rio Grande do Sul. — Arq. Ent. Escola de Agronomia “Eliseu
Maciel” (Pelotas) (ser. B) 14: 1-12, 1 Fig.
Bourquin, F. 1930. Algunas observaciones sobre Castniidae. — Revta. Soc. ent. Argentina 3: 173-174, 1 Fig.
Bourquin, F. 1933. ‘Notas biolögicas de la Castnia archon Burm. — Revta. Soc. ent. Argentina 5: 295—
298, pls. 31-32, 1 Fig. |
Bourquin, F. 1944. XXXV. Observaciones sobre Castnia archon Burmeister 1879. Lep. Fam. Castniidae.
Pp. 133-136. — In: F. Bourquin (ed.), Mariposas Argentinas. Vida, desarrollo, costumbres y hechos
curiosos de algunos lepidöpteros argentinos. — F. Bourquin Publisher, Buenos Aires.
Breyer, A. 1931. Los Castniidae argentinos. — Revta. Soc. ent. Argentina 3: 233-238, pls. 7-8.
Burmeister, H. 1878. Description physique de la République Argentine d’apres des observations
personnelles et étrangères. Tome cinquième. Lépidoptères. Première partie, contenant les Diurnes,
Crépusculaires et Bombycoides.— Imprimerie de P. E. Coni; Paris, F. Savy; Halle, E.Anton, Buenos
Aires. 524 pp.
Burmeister, H. 1879-1880. Atlas de la description physique de la République Argentine contenant des
vues pittoresques et des figures d’histoire naturelle. Cinquième section, seconde partie. Lépidoptères.
— Imprimerie de P.E.Coni; Paris, F.Savy; Halle, E.Anton, Buenos Aires. [1° Livraison, 1879]: 140
pp; [2° Livraison, 1880]: 41-64 pp., 24 colour pls. + 1 monochrome pl.
Drescher, J. & A. Dufay 2001. Un nouveau ravageur des palmiers dans le sud de la France. - PHM
Revue Horticole, 429: 48-50.
Fletcher, D. S. & I. W. B. Nye 1982. Bombycoidea, Castnioidea, Cossoidea, Mimallonoidea, Sesioidea,
Sphingoidea, Zygaenoidea. Pp. xiv + 192. — In: I. W. B. Nye (ed.), The Generic names of moths of
the world. Volume 4. — Trustees of the British Museum (Natural History). London.
Houlbert, C. 1918. II. Revision monographique de la Sous-Famille des Castniinae. Pp. 5-713, 437-462
pls. — In: Ch. Oberthiir (ed.), Etudes de Lépidoptérologie comparée, Fascicle XV. — Imprimerie
Oberthür. Rennes.
Nota lepid. 25 (1): 3-15 15
ICZN, 1999. International Code of Zoological Nomenclature, fourth edition. — International Trust for
Zoological Nomenclature, London. xxix + 306 pp.
Jorgensen, P. 1930. Las especies de Castniidae de la Argentina y Paraguay (Lepidoptera). — Revta. Soc.
ent. Argentina 3: 175-180, pls. 9-10.
Lamas, G. 1995. A critical review of J. Y. Miller’s Checklist of the Neotropical Castniidae (Lepidoptera).
— Revta. Per. Ent. 37: 73-87.
Miller, J. Y. 1976. Studies in the Castniidae. II. Descriptions of three new species of Castnia, s. ].. — Bull.
Allyn Mus. 34: 1-13, 18 figs.
Miller, J. Y. 1980. Studies in the Castniidae. III. Mirocastnia. — Bull. Allyn Mus. 60: 1-15, 20 figs.
Miller, J. Y. 1986. The taxonomy, phylogeny, and zoogeography of the Neotropical moth subfamily
Castniinae (Lepidoptera: Castnioidea: Castniidae). Ph. D. thesis, University of Florida. — U.M.I.
Dissertation Services, Ann Arbor, Michigan. 569 pp.
Miller, J. Y. 1995. Castniidae. Pp. 133-137, 176-177. — In: J.B. Heppner (ed.), Atlas of Neotropical
Lepidoptera. Checklist: Part 2. — Association for Tropical Lepidoptera / Scientific Publishers,
Gainesville, Florida.
Oberthür, Ch. 1914. VI. Nouvelle espece de Castnia de l’Uruguay. Pp 63-64, pl. CCLVII, Fig. 2164-
2165.— In: Ch. Oberthür (ed.), Etudes de Lépidoptérologie comparée, Fascicle IX (2° partie). —
Imprimerie Oberthür, Rennes.
Oiticica, J. 1955. Revisäo dos nomes genéricos sul-americanos da subfamilia Castniinae (Lepidoptera,
Castniidae). — Revta. Brasil. Ent. 3: 137-167.
Rothschild, L. W. 1919. Supplementary notes to the review of Houlbert and Oberthür’s monograph of
Castniinae by Talbot and Prout. — Novit. Zool. 26(1): 1-27.
Sarto 1 Monteys, V. & LI. Aguilar 2001. Paysandisia archon (Burmeister, 1880), Castniidae, also in
France. — SHILAP Revta. lepid. 29(115): 280
Seitz, A. & E. Strand 1913. Family Castniidae. Pp. 5-19, pls. 1-8. —Jn: A.Seitz (ed.), The Macrolepidoptera
of the world, vol. 6: The American Bombyces & Sphinges.— Alfred Kernen, Stuttgart.
Varga, A. E. 2000. Mariposas Argentinas. Guia practica e ilustrada para la identificaciön de las principales
mariposas diurnas y nocturnas de la Provincia de Buenos Aires. Metodos y técnicas para la cria,
colecciön y preservaciön de mariposas. — Asociaciön Amigos del Museo Mariposas del Mundo, San
Miguel, Buenos Aires. 148 pp.
Book Review
Hacker, H. H. (editor): Esperiana, Volume 8. 944 pp., 36 colour plates, Schwanfeld, July
31, 2001. ISBN 3-9802644-7-5. Price: € 165.00.
A new volume of Esperiana, a book-series edited by Hermann H. Hacker, has been issued two
years after the publication of Volume 7. It is again mainly devoted to the fauna of the Middle
East (Israel, Jordan, Lebanon, Sinai, and Syria). Thirty-one scientific papers on insects are
contained which mainly treat Lepidoptera, especially Noctuidae, but also Coleoptera (Elateridae)
and Hymenoptera (Formicidae).
Almost all species treated, including many type specimens and habitats, are figured on 36
excellent colour plates, which have been considerably improved over past volumes. Figuring a
series of specimens shows the full variability of some species.
The main part of the book is formed by the fauna of the Noctuidae (and Nolidae) of the Middle
East (the Levant) (which is also available separately for € 92.00) where 585 species are dealt
with. Many corrections to previous misidentifications are made, several new synonymies are
recorded, and taxonomic changes are made, considerably improving the knowledge of the
Noctuidae of this region. Not only new records to the fauna of the Middle East (79 species) are
published, but also two genera, eight species, and 10 subspecies are described as new to science.
The historical continuity in systematics is fully respected in the present volume which is in a
clear positive contrast to some recent publications by H. Beck. The genus Clytie is revised in
an appendix, where many lectotypes are selected which is necessary because of the mixed
type-series for some species. This thorough revision of the difficult genus was vital for its
inclusion in a review of the fauna of this region. A final analysis of the noctuid fauna of the
Middle East shows that species with a general Palaearctic arboreal distribution are more
numerous than eremic taxa. The careful documentation of the relationships between animal
and habitat will hopefully help to highlight the importance of protection of the remaining
natural landscapes in this region.
The second part of the volume is somewhat heterogeneous, containing papers on insects of
some Levantine countries, and also from other parts of the world (e. g. Ghana, Greece, China,
Madeira, Romania, Mongolia, Nepal, Central Asia, Iran, and Kazakhstan). These papers, though
not directly addressing the fauna of the Middle East, are of no less importance. Interestingly,
Weidlich describes a new noctuid species from Madeira. This is an absolutely unexpected
discovery of a clearly recognizable moth in the western Palaearctic region, though its genitalia
are figured without aedeagus and the female is still unknown.
This volume is highly recommended not only for every student of the insect fauna of the
Middle East, but also to all entomologists interested in taxonomy. The price of € 165,— for the
present volume is moderate, taking into account that it is hard-covered and contains excellent
colour plates. It can be reduced by 20 % when subscribing to the whole series.
WOLFGANG SPEIDEL
Nota lepid. 25 (1): 17-21 17
Synonyms of European Tortricidae and Noctuidae, with special
reference to the publications of Hübner, Geyer and Frölich
WOLFGANG SPEIDEL* & LEIF AARVIK**
*Zoologisches Forschungsinstitut und Museum Alexander Koenig, Adenauerallee 160, D-53113
Bonn, Germany. E-mail: W.Speidel.ZFMK @uni-bonn.de
**Zoological Museum, University of Oslo, P. O. Box 1172 Blindern, NO-0318 Oslo, Norway
Summary. Pyralis approximana Fabricius, 1798 is synonymized with Acleris ferrugana (Denis &
Schiffermüller, 1775). Epagoge peramplana Hübner, 1825, in combination with Aphelia Hübner, 1825
is introduced as the valid name for the species known as Aphelia amplana (Hübner, 1813). Frölich is
established as the correct author of the species currently known as Lozotaeniodes formosana (Geyer,
1830). Tortrix venustana Frölich, 1828 is a new synonym of Celypha aurofasciana (Haworth, 1811).
Olethreutes valesiana Rebel, 1907 (not 1906) is placed in the genus Phiaris Hübner, 1825. Tortrix perlana
Frölich, 1830 is a new synonym of Eublemma pulchralis (Villers, 1789).
Zusammenfassung. Pyralis approximana Fabricius, 1798 wird mit Acleris ferrugana (Denis & Schiffer-
miller, 1775) synonymisiert; Epagoge peramplana Hübner, [1825], neu kombiniert mit Aphelia Hüb-
ner, 1825 wird als gültiger Name für die als Aphelia amplana (Hübner, 1813) bekannte Art eingeführt;
Frölich wird als der richtige Autor der gegenwärtig als Lozotaeniodes formosana (Geyer, 1830) geführ-
ten Art festgestellt; Tortrix venustana Frölich, 1828 ist ein neues Synonym von Celypha aurofasciana
(Haworth, 1811); Olethreutes valesiana Rebel, 1907 (nicht 1906) wird in die Gattung Phiaris Hübner,
1825 gestellt. Tortrix perlana Frölich, 1830 ist ein neues Synonym von Eublemma pulchralis (Villers,
1789).
Résumé. Pyralis approximana Fabricius, 1798 est synonymisé sous Acleris ferrugana (Denis &
Schiffermüller, 1775). Epagoge peramplana Hübner, 1825, en combinaison avec Aphelia Hübner, 1825,
est introduit comme nom valide pour l’espèce connue sous le nom de Aphelia amplana (Hübner, 1813).
Frolich est établi comme étant l’auteur correct de l’espèce connue jusqu’à présent sous le nom de
Lozotaeniodes formosana (Geyer, 1830). Tortrix venustana Frölich, 1828 est un nouveau synonyme de
Celypha aurofasciana (Haworth, 1811). Olethreutes valesiana Rebel, 1907 (non 1906) est placé au sein
du genre Phiaris Hübner, 1825. Tortrix perlana Frölich, 1830 est un nouveau synonyme de Eublemma
pulchralis (Villers, 1789).
Key words. Lepidoptera, Tortricidae, Noctuidae, nomenclature, synonymy, Europe.
Introduction
Jakob Hübner contributed considerably to the knowledge of European Tortricidae in
the Tortrices part of the ‘Sammlung europäischer Schmetterlinge’. This part is not
dated, but the 53 plates were published, according to Hemming (1937), from 1799
until 1833. Only the first 47 plates were edited by Hübner himself, the remaining by
Geyer. There is no text to the plates published by Hübner. All plates have the headline
‘Tortrices’, 1.e. the generic name with plural ending. Therefore, we regard all the species
published without text to be originally combined with Tortrix. Plates 1 to 29 were
published in 1799, plate 30 in 1800, plates 31 to 37 in 1813, 38 to 41 in 1817, 42 to 43
in 1819, 44 in 1822, 45, 46 in 1823, 47 in 1829, 48 to 52 in 1830 and 53 in 1833
(Hemming, 1937: 284-291). Geyer edited plates 48 to 53, but he is only the author of
the names published in plate 53. The new descriptions for species figured in plates 48
to 52 were authored in an accompanying text, which is dated 1830, by Franciscus A. G.
von Frölich from Ellwangen (Germany).
© Nota lepidopterologica, 01.08.2002, ISSN 0342-7536
18 SPEIDEL & AARVIK: Synonyms of European Tortricidae and Noctuidae
Frölich was one of the first authors who specialized in Tortricidae. He has left us two
publications on Tortricidae. The first one is a faunistic paper on the Tortricidae of
Württemberg (South-West Germany) containing many new descriptions (Frölich 1828).
However, most of Frolich’s names were later forgotten, because they were not
recognizable (Guenée 1845: 111). The second publication of Frölich is the
aforementioned text relating to the specimens figured in plates 48 to 52 in Geyer’s
continuation of Hiibner’s ‘Sammlung europdischer Schmetterlinge’ (Frolich 1830, in
Hubner 1796 ff.). A part of these names are erroneously attributed to Geyer in the
modern literature, but Geyer only edited the later part of the volume on Tortricidae
after Hübner’s death, as stated above.
Some errors relating to these early authors still persisting in recent literature are
corrected in the present paper. A few other corrections pec the authorship of
European Tortricidae are also included.
The nomenclature of the two common species of Acleris, A. notana (Donovan) (the
Betula-feeder) and A. ferrugana ([Denis & Schiffermüller]) (the Quercus-feeder), has
caused a lot of confusion in the past. We deal with one old synonym that threatens the
stability and correct a mistake that appeared in Microlepidoptera Palaearctica volume
6 (Razowski 1984) on the group. Our corrections do not diminish the value and usefulness
of the important publications of Razowski (especially 1984, 2001), though they are
sometimes in conflict with statements of that author (in these mentioned publications).
Systematic Part
Tortricidae
Acleris ferrugana ([Denis & Schiffermuller], 1775)
Tortrix ferrugana [Denis & Schiffermüller], 1775: 128
Tortrix rufana sensu Hübner, 1799: Tortr., pl. 20, fig.127, nec Denis & Schiffermüller, 1775
Pyralis approximana Fabricius, 1798: 478. syn. n. Type locality: Halae Saxonum [Halle, Saxony]
Tortrix tripunctulana Haworth, 1811: 417
Tortrix bifidana Haworth, 1811: 418
[Teras] lythargyrana Treitschke, 1830: 264. Invalid name.
Tortrix brachiana Freyer, 1833: 33
Tortrix rubidana Herrich-Schäffer, 1851: 146
Teras lithargyrana Herrich-Schäffer, 1851: 147
Teras selasana Herrich-Schäffer, 1851: 147
Peronea fissurana Pierce & Metcalfe, 1915: 325
Notes. Pyralis approximana Fabricius, 1798 was listed as a doubtful synonym of Acleris
tripunctana Hübner (= notana Donovan) by Obraztsov (1956: 132) and Razowski
(1966: 442, 1984: 269). We propose to place it in synonymy with Acleris ferrugana
([Denis & Schiffermüller], 1775). This change will maintain current nomenclatural
usage of both species involved. The original description of approximana (Fabricius,
1798: 478), translated from latin, “...forewings shining yellow. Three dots, nearly
black, on the edge of the wing....... resembling boscana”, could represent both notana
and ferrugana, but most likely the latter which is slightly more yellowish than notana
in most specimens. Acleris notana normally has a more brownish hue.
Nota lepid. 25 (1): 17-21 19
Fabricius described Pyralis centrana Fabricius, 1794, which was later placed in syn-
onymy with Acleris rhombana (Denis & Schiffermüller, 1775) by Leraut (1997: 141).
This name was listed as a doubtful synonym of Acleris notana (Donovan, 1806) by
Obraztsov (1956: 132) and Razowski (1966: 442, 1984: 269). The specific names
centrana and approximana (types are either lost (centrana) or could not be traced
(approximana) according to Zimsen, 1964) have not been used as valid names after
1899 (ICZN, 4" ed., Art. 23.9.1) and would not threaten Acleris notana (Donovan,
1806) anyway, but a reversal of precedence could be avoided, if the future selection of
type specimens follows the present suggestions: A specimen of Acleris rhombana should
be selected as neotype of centrana, and a specimen of Acleris ferrugana as neotype or
eventually lectotype of approximana.
Razowski (1984) interchanged the figures of male and female genitalia of the two
species Acleris notana and A. ferrugana. His figure numbered 109 represents notana
(not ferrugana), and figure numbered 113 represents ferrugana (not notana). The
mistake was repeated by Razowski (2001), where genitalia figure 28 is notana (not
ferrugana) and 29 is ferrugana (not notana).
Aphelia peramplana (Hubner, 1825) comb. n.
Tortrix amplana Hübner, 1813 (“1796”): Tortr., pl. 31, fig. 201
Epagoge peramplana Hübner, 1825 (“1816-1826”): 389 (replacement name for amplana)
Note. Tortrix amplana Hübner, 1813 (“1796”) is a junior primary homonym of Tortrix
amplana Hübner, 1799 (“1796”): pl. 5, fig. 24, now placed in the genus Cydia. The
name peramplana is erroneously treated as a synonym of Cydia amplana (Hubner,
1799) (Leraut, 1997: 148).
Lozotaeniodes formosana (Frölich, 1830) auct. rev.
Tortrix formosana Frölich, 1830 in Hübner, Tortr.: 9, pl. 51, fig. 319, 320
Type locality: Süd-Frankreich (South France)
This name has erroneously been attributed to Geyer, 1830 in Hübner, 1796 ff. (Razowski in Karsholt &
Razowski, 1996: 141; Leraut, 1997: 135)
-Celypha aurofasciana (Haworth, 1811)
Tortrix venustana Frölich, 1828: 54. syn. n.
Type locality: Elvaci [Germany, Baden-Wiirttemberg, Ellwangen].
The name venustana was wrongly attributed to Geyer, in Hübner 1830 (“1796”) (Leraut, 1997: IST),
however it had already been used by Frölich, 1828 and Frölich, 1830 (in Hübner, 1796 ff.): 12, pl.
D, He. 326.
Phiaris valesiana (Rebel, 1907) comb. n.
Olethreutes valesiana Rebel, 1907, Dt. ent. Z. Iris 19: 232.
Type locality: Switzerland, Wallis, Grüben, ca. 1900 m.
20 SPEIDEL & AARVIK: Synonyms of European Tortricidae and Noctuidae
Note. This species has been erroneously credited to Guenée, 1844 (Razowski in Karsholt
& Razowski, 1996: 144; Leraut, 1997: 151) and placed in Celypha. However, no
description could be found under that reference. The species was listed with correct
authorship as a synonym of Phiaris turfosana (Herrich-Schäffer, 1851) (Razowski,
1995: 316). In Rebel’s original description, the present species is said to be most closely
related to Phiaris turfosana (Herrich-Schaffer, 1851) and comparative genitalia figures
of both species are given. Therefore, Olethreutes valesiana is here transferred from
Celypha to Phiaris. The correct date for the description of Phiaris valesiana and
Eucosma monstratana Rebel, which are described in the same publication, is 1907
(Rebel, 1907: 235). It has erroneously been dated 1906 (Razowski in Karsholt &
Razowski, 1996: 149; Razowski, 1995: 316; Razowski, 2001: 22). Razowski (2001)
treated valesiana as a synonym of turfosana. In our opinion, the genital characters
given in the original description indicate that valesiana is a distinct species, and evidence
to the contrary must be presented before accepting the synonymy.
Noctuidae
Eublemma pulchralis (Villers, 1789)
Tortrix perlana Frölich, 1830 in Hubner, Samml. europ. Schmett., Tort.: 8, pl. 50, fig. 316. syn. n.
Type locality: Pavia.
The name perlana has wrongly been attributed to Geyer, 1830 in Hübner, 1796 ff. (Leraut, 1997: 229).
Acknowledgements
R. Gaedike (Eberswalde, Germany) kindly furnished a copy of Frölich’s contribution to the Tortrices of
Hübner’s Sammlung europäischer Schmetterlinge. Peter Huemer (Innsbruck, Austria) and Ole Karsholt
(Copenhagen, Denmark) gave valuable comments to the manuscript. We are grateful to our colleague
Bradley Sinclair (Bonn, Germany) for useful comments and for correcting the English.
Literature
[Denis, J. N. C. M. & Schiffermüller, I.] 1775. Ankündung eines systematischen Werkes von den Schmet-
terlingen der Wienergegend herausgegeben von einigen Lehrern am k. k. Theresianum. — Wien. 323
pp., pls. 1 a and b.
Fabricius, J.C. 1798. Supplementum Entomologiae systematicae. — Proft et Storch, Hafniae
(KY benhavn). 111+572 pp.
Freyer, C. F. 1833. Neuere Beitrage zur Schmetterlingskunde mit Abbildungen nach der Natur. 1. —
Augsburg (published by the author). iv+182 pp., 96 pls.
Frölich, F. A. G. 1828. Enumeratio Tortricum Württembergiae. — Dissertat. inaug., Tübingen. 102 + 11 pp.
Guenée, A. 1845. Essai sur une nouvelle classification des microlépidoptères et catalogue des espèces
européennes connues jusqu’à ce jour. — Annls Soc. ent. Fr. (2) 3: 105-192, 297-344.
Haworth, A. H. 1811. Lepidoptera Britannica. — London. Part 3. pp. 377-512.
Hemming, F. 1937. Hübner, 1. — Royal Entomological Society, London. 605 pp.
Herrich-Schäffer, G. A. W. 1849. Systematische Bearbeitung der Schmetterlinge von Europa, zugleich
als Text, Revision und Supplement zu Jacob Hübners’ Sammlung europäischer Schmetterlinge. 4.
Die Zünsler und Wickler. — In Commission bei G. J. Manz, Regensburg. [1848]-1849-[1855]. 288+48
[0) Dee 2SArZS) jal &
Hübner, J. 1799-1833 (“1796” ff.). Sammlung europäischer Schmetterlinge. Horde 7. Tortrices-Wickler. —
Augsburg. ii+16 pp., 53 pls. [Title of the text: Sammlung europäischer Schmetterlinge. Errichtet von
Nota lepid. 25 (1): 17-21 21
Jakob Hubner. vii. Horde. Die Wickler. Tortrices Linn. Fortgesetzt von C. Geyer. Mit Beschreibungen
von Herrn Dr. v. Frolich, Medizinal-Rath und Leibmedikus. — Augsburg, 1830. ii+16 pp.]
Hübner, J. 1816-1826 (“1816”). Verzeichniß bekannter Schmettlinge [sic]. — Augsburg (published by
the author). 432 pp.
International Commission on Zoological Nomenclature, 1999. International Code of Zoological
Nomenclature. — Fourth Edition. International Trust for Zoological Nomenclature, London. xxix+306
pp.
Karsholt, O. & J. Razowski 1996. The Lepidoptera of Europe. A distributional checklist. — Apollo Books,
Stenstrup. 380 pp.
Leraut, P. J. A. 1997. Liste systématique et synonymique des Lépidoptéres de France, Belgique et Corse
(deuxiéme édition). — Alexanor (Supplement). 526 pp.
Obraztsov, N. S. 1956. Die Gattungen der Palaearktischen Tortricidae. I. Allgemeine Aufteilung der
Familie und die Unterfamilien Tortricinae und Sparganothinae. 2. Fortsetzung. — Tijdschr. Ent. 99:
107-154.
Pierce, F. N. & J. W. Metcalfe 1915. Descriptions of two further additions to the British Tortricina. —
Entomologist’s mon. Mag. 51 (series 3,1): 324-327.
Razowski, J. 1966. World fauna of the Tortricini (Lepidoptera, Tortricidae). — PaDstwowe Wydawnictwo
Naukowe, Krakow. 576 pp., 41 pls.
Razowski, J. 1984. Tortricini. — Zn: Microlepidoptera Palaearctica 6. — Verlag G. Braun, Karlsruhe. 376
pp., 101 pls.
Razowski, J. 1995. Catalogue of the species of Tortricidae (Lepidoptera). Part IV: Palaearctic
Olethreutinae: Microcorsini, Bactrini, Endotheniini and Olethreutini. — Acta zool. cracov. 38: 285—
324.
Razowski, J. 2001. Die Tortriciden (Lepidoptera, Tortricidae) Mitteleuropas. Bestimmung — Verbreitung
— Flugstandort — Lebensweise der Raupen. — FrantiSek Slamka, Bratislava. 319 pp., 24 pls.
Rebel, H. 1907. Neue palaearctische Microheteroceren. — Dt. ent. Z. Iris 19 (‘1906’): 227-242.
Treitschke, F. 1830. Die Schmetterlinge von Europa (Fortsetzung des Ochsenheimer’schen Werkes). 8.
— Fleischer, Leipzig. 312 pp.
Zimsen, E. 1964. The type material of J. C. Fabricius. - Munksgaard, Copenhagen. 656 pp.
Book Review
Emmet, A. M. & J. R. Langmaid (eds.) 2002. The moths and butterflies of Great Britain
and Ireland. — Harley Books, Great Horkesley (Colchester, England)
Volume 4, Part 1 comprising Oecophoridae, Ethmiidae, Autostichidae, Blastobasidae,
Batrachedridae, Agonoxenidae, Momphidae, Cosmopterigidae, Scythrididae. 326 pp., 7 pls.
ISBN 0 94 65 89 66 6. Price: £ 80.00.
Volume 4, Part 2. Gelechiidae. 277 pp., 6 pls. ISBN 0 94 65 89 67 4. Price: £ 80.00.
Hardback set of volume 4, part 1 and 2: ISBN 0 94 6589 63 1; Price: £ 150.00. (A paperback
edition will be published later this year).
Though the ‘Micro’-lepidoptera comprise the majority of Lepidoptera, only a minority of
lepidopterists is focusing on these smaller moths still leading to a lack of literature for their
identification. It is therefore highly appreciated that a further volume of “The moths and
butterflies of Great Britain and Ireland” dealing with smaller moths has been published now.
The two parts comprising this volume cover many of the least familiar families of the
Gelechioidea. No comparable British work exist on these ‘micro’-lepidopteran families, which
in terms of identification indeed comprise the most difficult species. Moreover, also continental
entomologists are in want of this literature since many of these taxa (e.g. Agonoxenidae,
Autostichidae, Batrachedridae, Cosmopterigidae) occurring in Britain are not treated in other
recent literature. But continentals will again regret not to find all ‘their’ species in this book
series.
Unfortunately, Arthur Maitland Emmet (1908-2001) who was instrumental in starting this
book series since 1975 and contributed by himself as an author for many chapters, did not live
to see the fourth volume published — which in his eyes is the most needed. Therefore, part one
of this volume starts with a tribute to Maitland Emmet.
The introductory chapter by Jens Rydell & Mark Young deals with the ecology and evolution
of Lepidopteran defences against bats. It is a fascinating reading to get know about a world
beyond human experience: the echolocation by bats, moth hearing, and how hearing and deaf
moths avoid the predators. Rydell & Young write in great detail on this topic, and everybody
who wants to know more will find a quite complete bibliography at the end of the chapter.
It follows the systematic section in the familiar arrangement of the family introduction, key to
species, the treatment of the species including a comprehensive morphological description, the
description of the life history and distribution, underlined by a map showing the records in
Britain and Ireland. The text is accompanied with line drawings of morphological features
(head, wing venation, genitalia) as well as images on typical life forms of pre-imaginal stages.
Colour plates of the moths conclude the work. The illustrations are valuable, highly accurate
and very esthetical throughout the book. Text and illustrations are well suitable to identify the
species treated. Authors and publisher of volume four of “The moths and butterflies of Great
Britain and Ireland” doubtless contributed much to a better understanding of the identification
and life history of the Gelechioidea in Europe. This volume certainly will influence faunistic
and systematic work on these smaller moths not only in Britain and Ireland, but also on the
European mainland. ;
MATTHIAS Nuss
Nota lepid. 25 (1): 23-38 23
Comparison of factors influencing the habitat characteristics of
Gortyna borelii (Noctuidae) and its larval foodplant
Peucedanum officinale in the United Kingdom and Germany
ZoE RINGwoop*, TIM GARDINER*, AXEL STEINER** & JULIAN HILL*
* Faculty of Science, Writtle College, Writtle, Chelmsford, Essex, CM1 3RR, United Kingdom
** Staatliches Museum fur Naturkunde, Department of Entomology, Rosenstein 1, D-70191, Stuttgart,
Germany
Summary. Gortyna borelii is a rare moth species with a widespread, but very localised distribution in
Europe. The main larval foodplant of this species is Peucedanum officinale. Both G. borelii and P. officinale
are listed as Red Data Book species in United Kingdom and Germany. Little research has been conducted
on the ecology of the moth and its larval foodplant in Europe. Both G. borelii and P. officinale inhabit a
range of grassland habitats in Germany, but are restricted to maritime grasslands in Britain. The aim of
the study reported in this paper was to compare the physical and vegetation characteristics and abundance
of G. borelii at sites that support P. officinale in both countries. A field study was undertaken at five sites
in both countries during the large larval feeding stage of G. borelii. The data collected included details of
the soil, vegetation composition, density of P officinale and occurrence of G. borelii larval feeding
signs. The main findings were that P. officinale grows within a range of soil conditions, but obtains the
greatest growth in acidic soils. Pewcedanum officinale was found to occur at a lower density in areas that
supported a high abundance of tall, coarse grass species. Conversely, a greater abundance of G. borelii
larval feeding signs tended to be found at sites where tall, coarse grass species were dominant. The
results are discussed and related to the management and conservation implications of P. officinale and G.
borelii in both countries.
Zusammenfassung. Gortyna borelii ist zwar in vielen Ländern Europas verbreitet, kommt aber überall
streng lokal an nur wenigen und eng begrenzten Fundorten vor. In Mitteleuropa ist Peucedanum officinale
ihre einzige Raupennahrungspflanze. In Großbritannien wie in Deutschland stehen der Falter und die
Nahrungspflanze auf den Roten Listen. Um die Zusammenhänge zwischen physikalischen Faktoren,
Vegetationsstruktur und der Abundanz von G. borelii zu klären, wurden in beiden Ländern je 5 Standorte
während der Raupenzeit besucht und Daten über Klima, Höhenlage, Vegetationszusammensetzung, Dichte
von P. officinale und Raupendichte von G. borelii (anhand der Fraßspuren) registriert. Dabei zeigte sich,
daß P. officinale auf verschiedenen Böden wächst, aber die größten Wuchshöhen auf saurem Boden
erreicht. An Standorten, wo heute, harte Gräser große Abundanzen erreichen, kommt P. officinale nur in
geringer Dichte vor. Dagegen wurden die meisten Raupenfraßspuren von G. borelii an Standorten ge-
funden, wo hohe Grasarten dominierten. Die Ergebnisse werden im Hinblick auf Habitatmanagement
und Schutzmaßnahmen diskutiert.
Résumé. Gortyna borelii (Pierret, 1837) est une espèce rare, ayant une large répartition en Europe, bien
que localisée. La plante nourricière principale de cette espèce est Peudecanum officinale. G. borelii et P.
officinale, sont tous deux repris sur la Liste Rouge au Royaume-Uni tant qu’en Allemagne II n’y a eu
que peu de recherche effectuée sur l’écologie de ce papillon et sa plante nourricière en Europe. G. borelii
et P. officinale se trouvent tous deux dans plusieurs types d’herbages en Allemagne, alors qu’en Angleterre
ils sont restreints à des herbages côtiers. L’objectif de l’étude rapportée dans le présent article était de
comparer les caractéristiques tant physiques que végetationnelles, ainsi que l’abondance de G. borelii
dans des sites qui abritent P. officinale dans les deux pays. Une étude sur le terrain a été conduite sur cing
sites répartis dans les deux pays pendant la longue période correspondant à l’état larvaire de G. borelii.
Les informations obtenues comprennent des données sur le sol, la composition de la végétation, la densité
de P. officinale et la présence de traces de consommation par les chenilles de G. borelii. Les résultats
principaux de |’ étude sont que P officinale se trouve sur plusieurs types de sols, mais obtient une croissance
maximale sur terrains acides. P. officinale a été retrouvé en densité moindre en des endroits comprenant
une grande abondance d’espéces de graminées hautes et dures. Au contraire, une plus grande abondance
de traces de consommation larvaire de G. borelii a pu être observée sur des sites où les graminées hautes
et dures prédominaient. Les résultats obtenus sont commentés et mis en rapport aux mesures de
conservation et de maintien de G. borelii et de P. officinale à prévoir dans ces deux pays.
Key words. biogeography, habitat, Gortyna borelii, larval foodplant, Peucedanum officinale.
© Nota lepidopterologica, 01.08.2002, ISSN 0342-7536
24 RINGWOOD, GARDINER, STEINER & Hırr: life history of Gortyna borelii
Introduction
Gortyna borelii Pierret, 1837 is a large noctuid moth with a very localised, but wide-
spread distribution in Europe. The moth has been recorded in many countries in Cen-
tral and Southern Europe (Ippolito & Parenzan 1978; Nowacki & Fibiger 1996). In
Britain (Bretherton ef al., 1983) and Central Europe (Gyulai 1987), the species is clas-
sified as the subspecies /unata Freyer, 1838. However, there is little evidence that the
separation of G. borelii into subspecies is justified and therefore the taxonomic status
of the moth remains contentious (Steiner 1998; Laszlo Peregovits, pers comm.). The
principal larval foodplant of the moth is Peucedanum officinale Linnaeus, 1753, but
G. borelii is also known to feed on Peucedanum longifolium L. (Gyulai 1987) and
Peucedanum gallicum Latour (Dumont 1925-1926).
The altitudinal range of P. officinale is from sea level in Britain to about 1800 m in
the mountains of Eastern Macedonia and Albania (Randall & Thornton 1996). The
highest altitude at which G. borelii has been recorded is 1000 m in the Carpathian
Basin, Romania, where it feeds on P. longifolium (Gyulai 1987). The moth is found
within a diversity of habitats: from meadows in forest clearings to limestone mountain
ranges in Hungary (Gyulai 1987), from the Paris lowlands to the Upper Rhine Plain
(Steiner 1998), and in regularly flooded pasture (König 1959). The populations of the
moth in Britain are restricted to maritime habitats in south-east England.
Gortyna borelii has a relatively recent recorded history in England: it was discovered
in 1968 and named Fisher’s Estuarine Moth (Fisher 1971). The main English populations
are located on the north Essex coast. These populations tend to occur <2m above mean
sea level and are therefore, vulnerable to sea flooding and the habitat being affected by
long-term sea level rise and encroachment of salt marsh (Ringwood et al., 2000). Other
threats to the moth include inappropriate management of the sea defences, low
population sizes and a lack of understanding of the ecological requirements of the
species (Gibson 2000). Due to the tenuous nature of the habitat in which it is found, the
moth is included within the British Red Data Book as Category 2 (Vulnerable) (Shirt
1987) and P. officinale is listed as Lower Risk (Near Threatened) (Wiggington 1999).
G. borelii was also added, in 1998, to Schedule 5 of the Wildlife and Countryside Act
1981 (Gibson 2000).
In Germany, G. borelii occurs mainly in the south-west of the country, especially in
the valleys of the Rhine and its tributaries (in Baden-Württemberg and Rheinland-
Pfalz). The species is listed within the German (Pretscher 1998) and Baden-Württemberg
(Ebert 1998) Red Data Books as Category 1 (Threatened by Extinction), and is also
protected under Federal Nature Protection Law 1987. Similarly, P. officinale is included
within the German and Baden-Württemberg Red Data Books as Category 3 (Threatened)
(Sebald et al. 1992). Steiner (1998) mentions that the main threats to G. borelii in
Germany are the fragmentation and destruction of meadows with P. officinale by
urbanisation or agricultural use, flooding and intensive mowing.
The phenology of this species in Germany (Steiner 1998) is virtually the same as
that in England (Heath & Emmet 1983; Skinner 1998; Gibson 2000). Diapause occurs
in the ovum and the eggs hatch during April/May, the larval stages then develop to
Nota lepid. 25 (1): 23-38 25
August, with pupation occurring in August/September. This is followed by the flight
period from September-October. During ovipositing, the ova are deposited beneath
the outer leaf sheath of grass stems (Ippolito & Parenzan 1978; Platts 1981; Steiner
1998). Observations in England have shown a preference in ovipositing for Elytrigia
atherica, which has a loose pseudostem construction (Ringwood et al. 2000). The
larvae are stem borers: feeding first within the stems of P officinale before moving
down, during the mature larval stages, to the rootstock, where pupation occurs.
There are plans to establish colonies of G. borelii further inland, away from the
threats of sea level rise, to secure the long-term future of the species in England
(Ringwood et al. 2000). However, before such plans can be developed it would be
beneficial to examine aspects of soil conditions, vegetation structure and habitat char-
acteristics that support populations of the species in continental Europe, away from
maritime environments.
The objectives of this paper are to present results from a study that compared sites
in Germany (Baden-Württemberg) and in England that may support populations of G.
borelii. The sites are compared in terms of climatological and geological information
with field studies enabling details of the soil conditions, vegetation structure, density
of P. officinale and incidence of the moth’s larval feeding signs to be reported. In
determining the habitat requirements of G. borelii factors such as larval foodplant
density, sward composition and the effects of soil pH and nutrient status on the growth
of P. officinale were also examined. The results are discussed in terms of environmen-
tal management and the conservation implications for this species in each of these
countries.
Materials and Methods
Ten sites in England and Germany were examined in the study. In England, the five
sites chosen were located within 3.5 km of each other in the Walton Backwaters area
of the north Essex coast. The close proximity of the sites chosen in England was due to
the restricted distribution of G. borelii in this country. A view across the Walton Back-
waters area is shown in Plate 1. The Walton Backwaters covers an area of around 800
ha and is of particular environmental importance (Yearsley 1994). Hamford Water is
the main creek that runs through the area and consists of constantly changing marshland
and a number of islands. The Hamford Water is a Site of Special Scientific Interest,
Special Protection Area and Ramsar Site (Countryside Agency 2000). The underlying
geology of the area is a Palaeogene clay basin overlain by Neogene and early Pleistocene
crag deposits with little or no drift geology. The mean annual temperature and pre-
cipitation of the area are 10-11°C and 400-500 mm respectively. All sites are located
at an altitude of less than 5 m OD. The five sites selected for field studies were Beaumont
Quay, Bramble Island, Old Moze, Skipper’s East and Skipper’s West. Details of the
characteristics of each of these sites are given in Table 1.
In contrast to the English sites, the sites in Germany are spread over a wide geo-
graphical area and are up to 300 km apart. Four of the sites are in Baden-Württemberg
(Speyer, Tiibingen 1, Tiibingen 2 and Zellerhorn) and one in Rheinland-Pfalz
26 RINGWOOD, GARDINER, STEINER & Hırr: life history of Gortyna borelii
(Oberhausen). The steep, rocky slope that characterises the Oberhausen site is shown
in Plate 2. A description of each of the German sites is provided in Table 2 and reports
Plate 1. The Walton Backwaters area (view towards Skipper’s Island). Photo credit: Zoé Ringwood.
Table 1. Characteristics of the English sites.
(m)
Beaumont | National | Long, rank, 1-3 Mown None
Quay Nature unimproved grassland annually perceived
Reserve | on and behind a sea
defense wall
Bramble | Privately | Grassland within an Mown Intensive
Island owned industrial area regularl mowing
Old Privately | Coarse unimproved None None
grassland on and perceived
behind a steep, well
maintained sea wall
Coastal grassland
located between the
sea wall and scrub
Coastal grassland
located between
eroding sea defences
and scrub
Flooding and
scrub
encroachment
Flooding and
scrub
encroachment
Skipper’s | National
East Nature
Reserve
National
Nature
Reserve
Skipper’s
West
Nota lepid. 25 (1): 23-38 27
Plate 2. The steep, rocky slope at Oberhausen. Photo credit: Zoé Ringwood.
Table 2. Characteristics of the German sites.
Site description Geology | Altitude | Management Threats
(m)
Oberhausen | Privately Dry grassland and | Permian None Scrub
owned scrub on a steep, encroachment to
rocky southerly certain areas
facing slope
Speyer Part Moderately dry Alluvial Mown Unsympathetic
Nature grassland on an regularly management
Reserve alluvial plain regime
Tiibingen | Nature A southerly facing | Triassic | 400-460 | Mown every None perceived
Reserve slope with third or fourth
unimproved year
grassland and
scrub
Tübingen 2 Nature Dry grassland [riassic 510-530 | Removal of Scrub
Reserve situated between scrub every encroachment
vineyards and a third or fourth
forested area year
Zellerhorn Nature Dry calcareous Jurassic 830-850 | Periodic None perceived
Reserve grassland located mowing
on a level area of a
northerly facing
slope
28 RINGWOOD, GARDINER, STEINER & HILL: life history of Gortyna borelii
that the altitude and underlying geology varies considerably between the sites. At
Oberhausen, Speyer and Tübingen 1, the mean annual temperature is about 9°C and
the mean annual precipitation is around 600 mm. However, at Tubingen 2 the mean
annual temperature and precipitation are 7-8°C and 700-800 mm respectively.
Zellerhorn is the coldest and wettest of the sites with an average annual temperature of
6°C and approximately 800-900 mm of rainfall recorded each year.
Field Survey
The five English and five German sites were surveyed between the 25" June and 10"
July 2001. Ten 1 m? quadrats were placed randomly within the area of the main stands
of P. officinale at each of the ten sites surveyed. The number of P. officinale plants,
height and width of each of these plants, and the height of the surrounding grass were
measured in each of the quadrats. The percentage ground coverage was estimated by
visual assessment (Bullock 1996) for each of the other vegetation species present
(including grasses) in each quadrat. A sward classification system that grouped sward
characteristics into density categories (Table 3) was used to provide information on the
density of the sward within each of the quadrats.
Table 3. The density categories in the sward classification system.
Category
>75% bare earth
Predominantly short (<0.25m) grass with 6-75% bare earth
Predominantly short (<0.25m) grass with <5% bare earth
A sward, mainly <0.5m in height, consisting of both fine leafed and coarse grass
species
4 Tall (>0.5m) dense, coarse grass interspersed with patches of shorter grass
5 Tall © Im), dense, coarse grass with a uniform sward height
In addition to the quadrat surveys, fifty P officinale plants were examined at
each of the sites for the presence of G. borelii larval feeding signs (bore holes
and/or frass piles within the stems, stem axils or at the base of the plant). This
was conducted to obtain an indication of the abundance of this moth at each of
the sites surveyed. The larval feeding signs of this species are very distinctive
(Steiner 1985) and therefore cannot be confused with any other species of
Lepidoptera.
Soil samples were taken to a depth of 25 cm from every site in the survey and
analysed for pH, available phosphorus, potassium and magnesium and
conductivity according to MAFF (1986).
Nota lepid. 25 (1): 23-38 29
Statistical Analysis
The data collected in the survey were non-parametric and therefore appropriate tests
were conducted. Spearman’s Rank correlation coefficient R, (Heath 1995) was
performed to determine the relationships between mean P. officinale height and soil
pH, conductivity and available soil magnesium, phosphorus and potassium at each of
the sites. The test was also performed to determine the relationship between the
proportion of P. officinale plants with G. borelii feeding signs, the mean number of P
officinale individuals per m’, mean P. officinale height and mean sward height at each
of the sites.
Czekanowski’s coefficient (Kent & Coker 1992) was used to determine the botani-
cal similarity between each of the sites in England and Germany. A chi-squared (4°)
test of association (Heath 1995) was conducted between the presence and absence of
P. officinale and the most abundant grass species within quadrats in England and Ger-
many. The English and German sites were grouped when performing this test. Mann-
Whitney U-test (Heath 1995) was used to determine if differences existed between the
mean sward height at sites in England and Germany and also between the mean P
officinale height in both countries.
Results
The soil conditions at sites in England and Germany varied considerably (Table 4).
The sites in England were characterised by soils of acidic nature and medium to heavy
texture (predominantly sandy silt loams or clay loams). However, in Germany the
soils were predominantly alkaline and medium to heavy texture (sandy loam, clay
loams or clay). The exception was the site of Oberhausen which had acidic soils of
light textural classification (loamy sand). The nutrient status of the soils varied
considerably, for example, concentrations of available phosphorus levels ranged from
4.0 mg/l at Zellerhorn to 23.4 mg/l at Bramble Island. The concentrations of available
magnesium were very varied, ranging from 62 mg/l at Speyer to 988 mg/l at Tübingen
2. Similarly, the concentrations of available potassium differed considerably between
sites. The conductivity of soil solutions extracted from the various sites were relatively
low in England and Germany.
The relationship between soil pH and mean P. officinale height is illustrated in
Figure 1. There was found to be a significant negative correlation between the two
factors (Table 5). No significant relationships were detected between P. officinale height
and the major soil nutrients. A significant positive correlation was, however, observed
between soil conductivity and P officinale height (Table 5).
A greater botanical species richness was recorded at the German sites (Table 6). At
Zellerhorn, for example, a total of 40 species were recorded in the quadrat survey, with
a maximum of 21 species per m’. Comparatively, at Skipper’s East, nine species were
noted, with a maximum of three species per m”. The vegetation at the English sites
displayed some similarity in species composition (Table 7).
30 RINGWOOD, GARDINER, STEINER & HILL: life history 0: Gortyna borelii
Table 4. Soil characteristics of the English and German sites.
English Sites P (mg/l) Mg (mg/l) K (mg/l) Conductivity Texture
(„S/cm)
2345 Clay loam
Bramble Island 732 3004 Clay loam
Old Moze 2102 Sandy silt loam
Store Er — pre an silt loam
| Skipper’s West | s West 10.0 Ber NS NE MIS OT | Clayloam | loam
a
1934
2000 Sandy loam
Tübingen 1 1992 Clay loam |
Tübingen 2 1971
Zellerhorn 1983 Clay loam
1200
224100
= % England
E 1000 i Germany
=
D 900 -
Ê
e so: J Tue
&
=
“rl ı]
8
16001
Q
=
oa 500 7
2 i i
SOO = a Er
5 5.5 6 6.5 7 1.9 8 8.9 9
Soil pH
Figure 1. Relationship between soil pH and mean P. officinale height (s. e. bars shown).
For example, Beaumont Quay was particularly similar to Old Moze and Skipper’s
East. The coarse grass species Arrhenatherum elatius and Elytrigia atherica dominate
these three sites (Table 8). In comparison, the German sites displayed a lower level of
similarity in species composition (Table 7), especially between Zellerhorn and Tübingen
2, and Speyer and Tübingen 1. In addition to the differences in species richness at
Nota lepid. 25 (1): 23-38 Sil
Table 5. The correlation (R,) between mean P. officinale height and soil pH, nutrient content and
conductivity. * — significant at p<0.05.
Rs (probability level)
Table 6. Botanical characteristics of English and German sites.
[Beaumont Quay | 21 |
| Bramble Island | 19 |
Si a | 10 |
Skipper’s East | 9 |
| Skipper's West | 12 |
| German sites | |
en...
ET.
Bes :
Ei
BF
these sites (Table 6), the most abundant grass species were also dissimilar (Table 8).
For example, at Zellerhorn the main grass species were Briza media and Festuca
pratensis, in comparison with A. elatius and Bromopsis erecta at Tubingen 2. The sites
in England and Germany display a low level of similarity in grassland botanical char-
acteristics (Table 7). In fact, the only similarity between certain sites in England and
Germany was the presence of P. officinale.
The incidence of P. officinale was found to be associated with the coarse grass
species A. elatius (4°: 8.74, P<0.01) and Elytrigia spp. (4°: 10.50, P<0.01) in England
(Table 9). Peucedanum officinale did not tend to occur in great abundance with these
two coarse grass species and therefore the association was negative. In Germany, P.
officinale was negatively associated with the presence of B. erecta (x°: 5.40, P<0.05).
A difference (Mann-Whitney test, Z = 6.61, P<0.001) was detected between mean
sward height in England and Germany, with the English sites supporting taller swards
(Table 8). A difference (Mann-Whitney test, Z = 7.61, P<0.001) was also found in
mean P. officinale height between the sites in England and Germany with a clear trend
of mean height of the larval host plant being greater at English sites. The relationship
between mean P officinale height and mean sward height at the sites (R, = 0.903, P<0.001)
in the study is illustrated in Figure 2.
32 RINGWOOD, GARDINER, STEINER & HILL: life history of Gortyna borelii
The proportion of P. officinale plants with G. borelii feeding signs at the English sites
ranged from 0.04 at Bramble Island to 0.54 at Skipper’s East (Table 8). However, in
Germany G. borelii was not recorded from Zellerhorn, whereas at Tubingen 2 the
proportion of P. officinale with larval feeding signs was 0.34. The relationship be-
tween the mean number of P officinale individuals per m? and the proportion of P
officinale plants with G. borelii feeding signs is illustrated in Figure 3. A negative
correlation was observed between the two factors (Table 10). There was no significant
relationship found between mean P. officinale height and the proportion of P. officinale
with G. borelii feeding signs, or between mean sward height and the proportion of P
officinale plants with G. borelii feeding signs (Table 10).
=
5
= 900 -
DO) |
2 8007 jes
o
© 700. hemos
© à 5
= 600 - In | % England
| | BE Germany
= 00
ö
= 400 | = area
300 - ig
|
200 - a. | | |
300, .400 500 600 700, ,800° 9007 10005 MOD
Mean sward height (mm)
Figure 2. Relationship between mean sward height and mean P officinale height (s. e. bars shown).
Discussion
Many environmental differences between the sites in England and Germany were ob-
served, including climate, topographical variation, soil, habitat and vegetative compo-
sition. Climatic differences are due to many variables, for example, the coastal nature
of the English sites and the fact that the climate of the German sites is continental. P.
55
KENEIREFEIEFT sısuap.ıd DINJS2] 'pıpaw DILL WIOYIA]]O7
BEN Fr] Suadad DISLYA]T ‘SNUD]2 wnaayjDuayAay eS
ee 4 0192.12 sısdowo4ag ‘snypja wnaayjpuay.ııy uasneyioga
| aa. a CORTE A D2]NA49D2 pIuop ‘0123.43 sısdowoag | uasuiqn |
PE Say ea WE 7) 0192.19 sısdowo4g ‘Snipa WNAaYyIDUaY LLP z uasuiqn |
Bier snDunp] SNIOH puejsj 2]qweig
(POL) LIL DAGNA DINISa.] ‘SNJDUD] SN2J0H |
(tE) T6 DILAIYID DISLUA]T ‘SNUD]A WNAIYIDUAY AL 2Z0W PIO
(ZE) ZIOI DILAIYID DIBLAJALY ‘SNUD]A WNAIYIDUIY AA Aend Juowune>g
(6S) 808 DILIYID DIBLYALT ‘SNID]2 WNADYIDUIYLIF iseq Ss saddrys
Hja40q 7) (uw)(‘3 *s)
YIM uorj10d014 AJISU9P PABMS UEIP9N x JUSRU pAems UCI ‘dds sse15 juepunqy SIS ysıduy
‘SAIS ULULIDH pue ysı[dug oY} JO YORd JE SUBIS SUIPSay /1/240Q “H
A Suejd azpuroiffo gy Jo uoniodoïd oy} pue (¢ oJgqe]L UI se uonesiyissej9 Aısusp pieMs Suisn) Aısusp pur JySsIoy pıems “dds sseis juepunge jsow Sy] ’g 2IQUL
co
dt
cm
NX
Ye purjs]
D 3Z0W PIO sıqweig
3 us WED [koe wee IR. NS CREER RENTE
8
Z ‘POADAINS Says OI SY} UIDMJOQ PIJE[NOIRO SJUDIOYJOOS LYSMOURYOZD JO xımew Ajuiejplwig *L ge]
34 RINGWOOD, GARDINER, STEINER & HILL: life history of Gortyna borelii
ues
(ae
= et
= 065 |
a England
3 a
E 04 - Germany
3
© =
Ss 0.3. a <—
g
E
= | | {4
a 02
©
=
©
5 0.1
2 nn
oO
0 —————
0 1 2 3 12 5
Mean P. officinale density (individuals per m’)
1
Figure 3. Relationship between mean P. officinale density (s. e. bars shown) and the proportion of P
officinale plants with signs of G. borelii larval feeding.
Table 9. Associations between P. officinale and the most abundant grass species in grouped English and
German sites. Given are x” values (with 1 d.f.). NR - not recorded. * — significant at p<0.05; ** —
significant at p<0.01.
England
Arrhenatherum elatius
N
officinale showed a degree of adaptability in relation to its ability to withstand a vari-
ety of climatic conditions and altitudes observed in this study. However, the absence of
the moth at Zellerhorn is suggested to be in response to poor adaptation to the adverse
climatic conditions at the site.
In England, P. officinale is a plant of coastal grassland, growing on heavy clays and
recent alluvial deposits (Thornton 1990). The German populations are generally found
in calcareous grasslands, particularly near rivers and in mountainous meadows (Randall
Nota lepid. 25 (1): 23-38 35
Table 10. The correlation (R,) between the proportion of P. officinale plants with G. borelii feeding signs
and P. officinale density, mean P. officinale height and mean sward height. * — significant at p<0.05.
& Thornton 1996). The grasslands in both countries, however, tend to be unimproved.
The English populations occur within species-poor unimproved grassland, whereas in
Germany the plant tends to grow in species-rich meadows (Table 6).
The grassland areas in England that support P. officinale display a level of similar-
ity, but the vegetation composition of the German sites was more varied (Table 7).
This may be due to the differences in altitude and climate within the sites in Germany
(Table 2), or the fact that the German sites were generally located a considerable dis-
tance from each other. Peucedanum officinale was observed in greatest abundance at
sites where it was not in competition with dominant, coarse grass species, such as A.
elatius, E. atherica and B. erecta. It was observed that very dense swards where these
species are abundant support a very low density of P. officinale. Randall & Thornton
(1996) state that initial establishment of P. officinale is reduced by dominant grass
species. This is tentatively supported by the observations that P. officinale was signifi-
cantly negatively associated with A. elatius, B. erecta and Elytrigia spp. (Table 9), and
did not tend to occur in great abundance with these coarse grass species.
The mean sward and P. officinale height were significantly greater within the Eng-
lish sites. This may be due to a number of factors, including climate, altitude, topogra-
phy and soil conditions. The climate and altitude at the German sites were very differ-
ent to those in England (Tables 1 & 2). The topographic conditions in Germany were
predominantly quite extreme with steep rocky slopes at several sites. These conditions
tend to support thin, well-drained soils, which do not provide optimal growing condi-
tions for many species of plant. The survey results indicate that pH (Figure 1) and soil
conductivity may be important factors in determining the growth of P. officinale, but
that this plant species is tolerant of a range of soil conditions. However, the relation-
ship between P. officinale height and soil conductivity may be misleading, as although
a significant positive correlation was calculated between these factors (Table 5), the
soil conductivity levels at all the sites were relatively low and the range of conductiv-
ity was relatively narrow. Also, P. officinale does not grow on salt marsh in England
‘even though it is associated to coastal habitats.
The density of P. officinale within a sward was found to have an influence on the
abundance of G. borelii. Sites in the study with a low density of P. officinale were
generally observed to have the greatest proportion of G. borelii larval feeding signs
(Figure 3). The sites in England with the greatest proportion of G. borelii larval feed-
ing signs support very tall and dense swards (Table 8). Hart (1999) also observed that
36 RINGWOOD, GARDINER, STEINER & HILL: life history of Gortyna borelii
the most favoured sites for the larvae occur where P. officinale grows amongst long,
rank grass. The reasons for this may be due to the ovipositing requirements of this
species. Ringwood ef al. (2000) observed that in England G. borelii has oviposition
preferences for Elytrigia spp., but the moth has also been observed egg laying on A.
elatius and D. glomerata (Ringwood et al. 2002 and unpublished data). These coarse
grass species tend to dominate grasslands, but also restrict the abundance of P. officinale.
It is, however, essential for coarse grasses to be present, providing an abundance of
Oviposition hosts for the moth in England. However, the host plants for ovipositing in
Germany have not been recorded and further studies are required. The results from this
study suggest that B. erecta and A. elatius are potential oviposition host plants in Ger-
many, as they are the predominant grass species at most of the sites. The availability of
suitable grass species during the flight period may be an important management con-
sideration.
Inappropriate mowing regimes at some of the English and German sites may pose
a threat to the survival of the moth and P officinale. For instance, at Bramble Island
(Table 1) and Speyer (Table 2) the sites were mown regularly and neither appears to
support a large colony of G. borelii (Table 8). Another serious threat to colonies in
both countries is scrub encroachment, which is particularly serious at Skipper’s East
and West and Tubingen 2. We suggest that some form of scrub control is necessary,
with mowing being the most practical solution at most of the sites. However, the inten-
sity and time of year when mowing is conducted needs very careful consideration.
Gibson (2000) states that mowing during the flight period (September-October) may
be detrimental to G. borelii as adult moths and eggs may be damaged. August may be
a more appropriate time of year to mow as the larva is feeding and pupating under
ground (Hart 1999). However, mowing at this time of year may prevent the grass
growing sufficiently to provide suitable oviposition sites. Further research aimed at
determining the most appropriate management is being undertaken in England.
Management recommendations in England must also include the consideration of
sea level rise and the risk of sea flooding at certain sites. Skipper’s Island, which is
thought to contain over 70% of the English G. borelii population (Tarpey 1999), is
under serious threat from the impending rise in sea level. Indeed, almost the entire
English population of this moth may be lost at any time as a result of a single surge
tide. Thus, the establishment of populations of this species further inland may be para-
mount to its survival in England. The German populations are able to persist a consid-
erable distance from the sea, in a wide range of habitats, soil conditions and at altitudes
with a more extreme climate. This may indicate that English populations may be able
to persist at locations away from coastal environments. However, further research is
needed into the ecological requirements of P. officinale and G. borelii in both coun-
tries.
G. borelii has a widespread, but very localised European distribution. In many coun-
tries where it is found, the species is rare and has some form of legal protection. The
main reason for the rarity of this moth is probably the limited distribution of P. officinale.
As the plant has been found to grow within a diversity of unimproved grasslands, it is
thought that the limited distribution may be largely due to the human actions of urbani-
Nota lepid. 25 (1): 23-38 37
sation, agricultural intensification and other changes in land use. It must now be de-
cided whether human intervention should be used to the benefit of both the moth and
its foodplant by establishing colonies of P. officinale and consequently securing the
future of G. borelii.
Acknowledgements
The authors would like to thank English Nature, the Cambridgeshire and Essex branch of Butterfly
Conservation and the Environment Agency for providing funding for this study. We are also grateful to
the Essex Wildlife Trust and Exchem Organics for allowing access to their land. A special thank you is
given to Martin Heywood, Gavin Sheill and Leon Woodrow for all their help with the fieldwork. Finally,
we thank the anonymous referees who gave useful comments on an earlier draft of this paper.
References
Bretherton, R. F., B. Goater & R. I. Lorimer 1983. Noctuidae: Cuculliinae to Hypeninae. pp. 36-413. —
In: Heath, J. & Emmet, A. M. (eds.), The moths and butterflies of Great Britain and Ireland 10. —
Harley Books, Colchester.
Bullock, J. 1996. Plants. — Jn: W. J. Sutherland, Ecological census techniques: a handbook. Cambridge
University Press, Cambridge. — p. 111-138
Countryside Agency. 2000. The state of the countryside. — Countryside Agency, Wetherby.
Dumont, C. 1925-1926. Observations biologiques sur les Hydroecia françaises. — Encycl. ent. 1: 53-72.
Ebert, G. 1998. Gefährdung und Schutz. — Jn: Ebert, G. (ed.), Die Schmetterlinge Baden-Württembergs
7. Nachtfalter V. — E. Ulmer Verlag, Stuttgart. — p. 11-20.
Fisher, J. B. 1971. Gortyna borelii Pierret (ssp. lunata Freyer?): a new British Moth. — Entomologist’s
Kec. J. Var. 83: 51-52.
Gibson, C. 2000. The conservation of Gortyna borelii lunata Freyer (Lep: Noctuidae). — Entomologist’s
Bee. J. Var. 112: 1-5.
Gyulai, P. 1987. Notes on the distribution of Gortyna borelii lunata Freyer in the Carpathian Basin.
Nota lepid. 10: 54-60.
Hart, C. 1999. An estimation of the range and population levels of Fisher’s Estuarine Moth (Gortyna borelii
lunata Freyer) (Lep.: Noctuidae) in Essex, July and October 1996. — Br. J. Ent. Nat. Hist. 11: 129-138.
Heath, D. 1995. An introduction to experimental design and statistics for biology. - UCL Press Limited,
London.
Heath, J & Emmet, A M. (eds.) 1983. The moths and butterflies of Great Britain and Ireland 10. — Harley
Books, Colchester.
Ippolito, R. & Parenzan, P. 1978. Contributo alla conoscenza della Gortyna Ochs. Europee.
Entomologica, 14: 159-202.
Kent, M. & Coker, P. 1992. Vegetation description and analysis a practial approach. — Belhaven Press,
London.
König, F. 1959. Beiträge zur Kenntnis der Lebensweise von Hydroecia leucographa Bkh. — Folia Ent.
Hung. 13: 481-493.
MAFF. 1986. The analysis of agricultural materials. - HMSO, London.
Nowacki, J. & Fibiger, M. 1996. Noctuidae. — /n: Karsholt, O. & J. Razowski, The Lepidoptera of
Europe. A distributional checklist. - Apollo Books, Stenstrup. — p. 251-293
Platts, J. 1981. Observations on the egg-laying habits of Gortyna borelii lunata in the wild.
Entomologist’s Rec. J. Var: 93: 44.
Pretscher, P. 1998. Rote Liste der Grossschmetterlinge (Macrolepidoptera). - /n: M. Binot, R. Bless, P.
Boye, H. Gruttke & P. Pretscher (eds.), Rote Liste gefahrdeter Tiere Deutschlands. — Schriftenr.
Landschaftspfl. Natursch. 55: 84-111.
Randall, R. E. & Thornton, G. 1996. Biological flora of the British Isles Peucedanum officinale L. ~ J.
Ecol. 84: 475-485.
38 RINGWOOD, GARDINER, STEINER & HILL: life history of Gortyna borelii
Ringwood, Z., J. Hill & C. Gibson 2000. A study of Gortyna borelii lunata Freyer (Lep.: Noctuidae):
Results from the first season of behavioural observation sessions. — Entomologist’s Rec. J. Var. 112:
93-99.
Ringwood, Z., J. Hill and C. Gibson. 2002. Observation on the ovipositing strategy of Gortyna borelii
Pierret, 1837 (Lepidoptera, Noctuidae) in a British population. - Acta zool. hung (In press)
Sebald, O., S. Seybold & G. Philippi 1992. Die Farn- und Blütenpflanzen Baden-Württembergs. Band 4:
Spezieller Teil (Spermatophyta, Unterklasse Rosidae) Haloragaceae bis Apiaceae. — E. Ulmer Ver-
lag, Stuttgart.
Shirt, D. B. (ed.) 1987. British Red Data Books: 2 Insects. - NCC, Peterborough.
Skinner, B. 1998. The colour identification guide to moths of the British Isles. — Viking, London.
Steiner, A. 1985. Bemerkungen über Gortyna borelii. — Ent. Z. 95: 167-173.
Steiner, A. 1998. Gortyna borelii. — In: G. Ebert (ed.), Die Schmetterlinge Baden-Württembergs 7. Nacht-
falter V. — E. Ulmer Verlag, Stuttgart. — p. 79-86.
Tarpey, T. 1999. Sea Hog’s Fennel (Peucedanum officinale) and Fisher’s Estuarine Moth (Gortyna borelii
lunata) in Hamford Water. — Unpublished report for English Nature.
Thornton, G. 1990. An environmental flora of Peucedanum officinale — Hog’s Fennel. — Dissertation,
Board of Continuing Education, University of Cambridge.
Wiggington, M. J. 1999. British Red Data Books 1 Vascular Plants (3" edition). — JNCC, Peterborough.
Yearsley, I. 1994. Islands of Essex. — Ian Henry Publications Ltd., Romford.
Nota lepid. 25 (1): 39-59 39
Experimental evidence for specific distinctness of the two wood
white butterfly taxa, Leptidea sinapis and L. reali (Pieridae)
ANJA FREESE & KONRAD FIEDLER
Animal Ecology I, University of Bayreuth, Universitatsstr. 30, D-95440 Bayreuth, Germany
Summary. In mating experiments in a flight cage females, and to a lesser extent the males, of Leptidea
sinapis und L. reali discriminated during mate choice. As a consequence only intraspecific matings
occurred within these two morphologically defined taxa. The possibility of speciation through sexual
selection and female choice is discussed. The response of both Leptidea species towards four food plants
(Lotus corniculatus, Lathyrus pratensis, Vicia cracca, Medicago sativa) was experimentally studied.
Ovipositing females in choice tests showed significantly different preferences, with L. reali favouring L.
pratensis, while L. sinapis preferably laid eggs on L. corniculatus. Both species largely rejected M.
sativa. With regard to fitness parameters such as prepupal weight, developmental duration and growth
rate, rank orders of the tested food plants were equal for both Leptidea species. Lotus corniculatus was
the optimal host, followed by Lathyrus pratensis and Vicia cracca, with Medicago sativa being least
favourable. Interspecific differences in life-history parameters were small. L. reali grew on average
slightly larger, while L. sinapis had shorter development times and higher growth rates. The extent of
protandry was 2 days in both Leptidea species. In food-choice tests fourth (= final) instar larvae of both
Leptidea species preferred L. corniculatus; M. sativa was rarely chosen. Ranking of food plants in choice
situations was similar in the two Leptidea species and matched their ranking with regard to larval fit-
ness. Discrepancies between preference and performance occurred in L. reali (relative rank of L. pratensis
versus L. corniculatus) and point towards an evolutionarily young, not yet fixed ecological differentia-
tion between the two Leptidea species. Our experimental findings support the notion that L. reali and L.
sinapis are true biospecies with ethological reproductive isolation, but only minimal differentiation with
regard to ecology and life-history.
Zusammenfassung. In Verpaarungsversuchen in einem Flugkäfig diskriminierten vor allem die Weib-
chen, aber nur begrenzt die Mannchen, von Leptidea sinapis und L. reali bei der Partnerwahl. Infolge-
dessen kam es ausschließlich zu intraspezifischen Kopulationen innerhalb der beiden morphologisch
definierten Taxa. Die Möglichkeit der Aufspaltung beider Arten durch sexuelle Selektion und Weibchen-
wahl wird diskutiert. Die Reaktion beider Leptidea-Arten gegenüber 4 Fraßpflanzen (Lotus corniculatus,
Lathyrus pratensis, Vicia cracca, Medicago sativa) wurde experimentell geprüft. Bei der Eiablage zeig-
ten die Weibchen in Wahlversuchen signifikant unterschiedliche Präferenzhierarchien, wobei L. reali
zugunsten von L. pratensis diskriminierte, während L. sinapis bevorzugt auf L. corniculatus ablegte.
Beide Arten mieden M. sativa weitgehend. Für beide Leptidea-Arten galt dieselbe Rangfolge der Pflanzen-
arten in Bezug auf deren entwicklungsphysiologische Qualität (gemessen über Präpuppengewichte,
Entwicklungsdauer und Wachstumsrate). Lotus corniculatus war die hochwertigste Pflanzenart, gefolgt
von den relativ gleichwertigen Arten Lathyrus pratensis und Vicia cracca und an letzter Stelle Medicago
sativa. Zwischenartliche Unterschiede in den Lebenszyklusparametern waren gering. L. reali wurde im
Mittel etwas größer, L. sinapis dagegen zeigte kürzere und raschere Entwicklung. Das Ausmaß der
Protandrie war mit 2 Tagen Entwicklungsdifferenz bei beiden Leptidea-Arten gleich. In Futterwahl-
versuchen wählten Raupen im vierten (= letzten) Larvalstadium beider Leptidea-Arten bevorzugt L.
corniculatus, M. sativa wurde kaum angenommen. Die Rangfolge der Fraßpflanzen in Wahlsituationen
galt für beide Leptidea-Arten gleichermaßen und stimmte mit der Rangfolge der ernährungs-
physiologischen Eignung überein. Diskrepanzen zwischen Eiablagepräferenz und Eignung der Fraß-
pflanzen traten bei L. reali auf (relativer Rang von L. pratensis versus L. corniculatus) und deuten auf
eine junge, noch nicht gefestigte ökologische Differenzierung der beiden Leptidea-Arten hin. Nach die-
sen experimentellen Befunden sind L. reali und L. sinapis echte Biospezies mit ethologischer
Fortpflanzungsbarriere, aber nur geringfügig differenziert im Hinblick auf Okologie und Lebenszyklus.
Resume. Lors d’experiences d’accouplement en cage de vol, les femelles, et en moindre mesure les
males, de Leptidea sinapis et de L. reali eurent une attitude discriminante lors du choix du partenaire. En
conséquence, seulement des accouplements intraspécifiques eurent lieu parmi ces deux taxons morpho-
logiquement définis. La possibilité d’une spéciation par sélection sexuelle et par choix par la femelle est
discutée. La réponse des deux espèces de Leptidea envers quatre plantes nourricières (Lotus corniculatus,
Lathyrus pratensis, Vicia cracca, Medicago sativa) a été étudiée expérimentalement. Lors de la ponte
durant des tests de choix, des differences significatives furent observées, L. reali favorisant L. pratensis
© Nota lepidopterologica, 01.08.2002, ISSN 0342-7536
40 FREESE & FIEDLER: Specific distinctness of Leptidea sinapis and L. reali
alors que L. sinapis pondait de préférence sur L. corniculatus. Les deux espéces rejeterent largement M.
sativa. Eu égard aux paramètres de fitness tels que le poids prépupal, la durée de développement et le
degré de croissance, les ordres par degré pour les plantes nourricières utilisées lors de ces expériences
furent les mêmes pour les deux espèces. Lotus corniculatus était la plante-hôte optimale, suivie de Lathyrus
pratensis et de Vicia cracca, Medicago sativa étant la moins appropriée. Les différences interspécifiques
au niveau des paramètres biologiques étaient faibles. L. reali atteignit une taille moyenne légèrement
supérieure, alors que L. sinapis avait une durée de développement inférieure et un degré de croissance
plus important. La protérandrie était de 2 jours pour les deux espèces. Lors de tests de préférence
nourricière, les chenilles au quatrième (et ultime) état des deux espèces de Leptidea préférèrent L.
corniculatus; M. sativa était rarement retenue. La classification en ordre de préférence des plantes nour-
ricières en situations de choix était similaire pour les deux espèces de Leptidea et correspondait à leur
classification eu égard au fitness larvaire. Des oppositions entre préférence et performance étaient appa-
rentes chez L. reali (rang relatif de L. pratensis par rapport à L. corniculatus) et semblent indiquer une
différenciation très récente des deux espèces de Leptidea du point de vue évolutif, qui n’est pas encore
fixée écologiquement. Nos observations expérimentales sont a l’appui de la notion que L. sinapis et L.
reali sont de vraies bio-espèces reproductivement isolées du point de vue éthologique, mais ne manifes-
tant q’une differenciation minimale aux niveaux écologique et biologique.
Key words. Biospecies, ethological reproductive isolation, life-history, preference, performance,
sibling species, sexual selection, female choice, hostplant relationships.
Introduction
Though there is still no universal consensus about how to define a ‘species’ (Hey
2001), this category remains the central unit for many branches of biology such as
phylogenetics or biodiversity research. Among zoologists the biospecies concept is
often accepted as the operationally most useful one (e.g. Collins 1991, Luckow 1995).
A biospecies is defined as a ‘group of actually or potentially interbreeding natural
populations, which are reproductively isolated from other such groups’ (Mayr 1942).
Although this concept has not gone unchallenged and many alternatives are still dis-
puted in the literature (Hey 2001), its major advantage is that it allows for an objective
experimental testing of species boundaries. The two major approaches to test for spe-
cific distinctness of two putative entities are (1) to measure gene flow between natural
populations or (2) to attempt crossings under controlled environmental conditions.
Such tests then reveal at which positions in the continuum between complete repro-
ductive isolation and free gene flow two entities are situated.
In practical taxonomy, however, recognition of species is frequently based on
phenotypic differentiation alone. This ‘morphospecies concept’ is at odds with evolu-
tionary theory, since static morphological entities cannot evolve per se. Morphospecies
are categories subjectively defined by human observers on the grounds of ‘simiları-
ties’ and are a priori not natural entities. Yet, since phenotypic differentiation fre-
quently is based on genotypic divergence, the morphospecies concept remains a useful
surrogate for species as true biological entities as long as relevant information about
reproductive isolation is non-existent.
In recognizing species boundaries among taxonomically complex species groups
(such as sibling species), phenotypic evidence almost always predates, and mostly
even stimulates, research on potential reproductive isolation. Thereby, the morpho-
logically based hypothesis on the existence of two (or more) species is tested in the
framework of the biospecies concept.
Even in well studied taxa and regions, such as butterflies in central Europe, occasion-
ally new phenotypic entities continue to be discovered that are then described as new
Nota lepid. 25 (1): 39-59 41
species. The wood white butterflies of the genus Leptidea provide one of the most
interesting examples in the past 15 years. A number of ecological and behavioural
studies had dealt with ‘Leptidea sinapis (Linnaeus, 1758) sensu lato’ (e.g. Wiklund
1977a, 1977b, Wiklund & Solbreck 1982, Warren 1984, 1985; Warren et al. 1986).
Yet, in 1988 Réal (1988) recognized on the grounds of genitalia studies that this well
known taxon might rather comprise a sibling species complex: L. sinapis s. str. and a
newly separated taxon, L. reali Reissinger, 1989 (= L. lorkovicii Réal, 1988). Females
(Real 1988) as well as males (Lorkovic. 1993) can be diagnosed by means of genitalia
measurements. External characteristics such as wing colours are less suitable, since
they vary strongly within both taxa in a similar way. Only extreme wing phenotypes
appear to allow for a reliable discrimination (Mazel 2000, 2001a).
The status of L. reali as a distinct species was immediately accepted in many pub-
lications including identification guides (e.g. Tolman & Lewington 1998). Faunistic
studies revealed that L. sinapis and L. reali co-occur over wide areas of Europe (Mazel
2000, 2001a, 2001b). Only few authors (Lorkovic. 1993; Kudrna 1998) remained more
sceptical and called for detailed research to substantiate the hypothesis of specific
distinctness between L. reali and L. sinapis. One reason for this wide and rapid accept-
ance of the specific status of L. reali might be found in the high value currently placed
on genitalia characters in Lepidopteran taxonomy. Disregarding the fact that genitalia,
like any other morphological feature, exhibit phenotypic plasticity and intraspecific
variation (Goulson 1993; Monti et al. 2001), differences in genitalia morphology are
readily accepted as indicators for the existence of true biospecies. Underlying this
conception is the lock-and-key hypothesis (e.g. Kullenberg 1947; Shapiro & Porter
1989), according to which genitalia differences were to provide prezygotic reproduc-
tive isolation barriers. However, support for this hypothesis is scant (Mikkola 1992;
Sota & Kubota 1998), and there is increasing evidence that in many cases genitalic
differentiation is more related to sexual selection and cryptic female choice (Eberhard
1993; Arnqvist 1998) rather than maintaining reproductive isolation.
Apart from confirmations of the genitalic differentiation, critical studies on the
status of both Leptidea forms as biospecies were lacking thus far (e.g. Lorkovic. 1993).
Similarly, published indications of some ecological divergence between both forms
are all derived from anecdotal observational evidence, without controlling for any con-
founding variables and without any statistical evaluation of the results. For example,
differential preferences of females for egg-laying substrates have been postulated (e.g.
Lorkovic. 1993; Kristal & Nässig 1996), with L. reali preferentially ovipositing on
Lathyrus spp. while L. sinapis should lay eggs more freely on Lotus corniculatus or
Vicia cracca.
Therefore, the aim of the present study is two-fold: (1) to assess by means of mat-
ing experiments under controlled conditions whether L. reali and L. sinapis butterflies
recognize each other as distinct species and thus really avoid hybridization; and (2) to
assess whether the two forms differ from each other with regard to egg-laying, food
acceptance or larval performance on a range of hostplants that have been recorded to
be utilized by the L. sinapis complex.
42 FREESE & FIEDLER: Specific distinctness of Leptidea sinapis and L. reali
Material and methods
Egg-laying experiments. Butterflies from both Leptidea forms were brought
into the laboratory for egg-laying. Insects were sampled during the emergence of both
generations (1‘ generation: May, 2" generation: mid July to mid August) in the vicin-
ity of Bayreuth and Wurzburg (northern Bavaria).
To test for oviposition preferences, field-caught females were placed singly in glasses
(2 litres) covered with gauze and lined with moist filter paper. A small vial with con-
centrated sucrose solution was added for nourishment. Glasses were placed in an envi-
ronmental chamber (25 °C constant, L:D regime 18:6 h).
Each female was offered simultaneously three small bunches of oviposition
substrates, viz. Medicago sativa, Lathyrus pratensis, and Lotus corniculatus in the
first generation and Lathyrus pratensis, Lotus corniculatus and Vicia cracca (all
Fabaceae) in the second generation. These plant species have been recorded frequently
as hostplants (Thomas & Lewington 1991; Bink 1992; Ebert & Rennwald 1993) and
were readily available in sufficient supply. Care was taken to only offer young foliage
of each plant species in approximately equal amounts. Every day the bunches were
exchanged and the numbers and placement of all eggs laid during the preceding day
was noted. Egg-laying was followed for each experimental female until her death. For
each female taxonomic identity was subsequently assessed by dissecting the genitalia.
All these females could be unequivocally assigned to one of the two morphospecies
using the genitalic characters described in the literature.
For statistical evaluations only females were considered who laid at least 10 eggs in
captivity. For each individual the proportions of eggs laid on any available food plant
species was calculated, taking her lifetime fecundity as 100%. These proportions were
then compared between the two Leptidea species.
Effects of food plants on performance and fitness. Until hatching, eggs
were kept in the same environmental chamber as the adult butterflies. Offspring of each
female was kept separately throughout the entire development. Upon hatching, larvae were
transferred in groups of two individuals into transparent plastic vials (250 ml) lined with
moist filter paper. To circumvent diapause and standardize developmental conditions,
caterpillars and pupae were placed in an environmental chamber under long day conditions
(25 °C constant, L:D regime 18:6 h). Fresh food was supplied in excess every second day.
During the fourth instar caterpillars were reared individually to avoid food competition.
We simultaneously reared offspring of the first generation of both species in no-
choice tests on either Lathyrus pratensis, Lotus corniculatus or Medicago sativa, re-
spectively. Offspring of the second generation received Lathyrus pratensis, Lotus
corniculatus or Vicia cracca, respectively. Plants of the genus Medicago have rarely
been recorded as Leptidea hostplants (e.g. Bink 1992). By including M. sativa we
aimed to test how strongly larval performance was affected if larvae were forced to
develop on this apparently less preferred hostplant species. Within each generation
larvae were randomly assigned to the food treatments.
For each caterpillar the following parameters were recorded: duration of larval de-
velopment, duration of the fourth larval instar, mass at the beginning of the fourth
Nota lepid. 25 (1): 39-59 43
larval instar, prepupal mass, duration of pupal phase. The relative growth rate in the
final larval instar was calculated from these data as: RGR = [In (prepupal weight) — In
(initial weight) |/duration of instar.
Previous analyses have shown that growth rate (apart from body size and develop-
ment time) should be treated as a life-history parameter in its own right and that the
above version of calculating growth rates has a number of statistical advantages (see
Nylin & Gotthard 1998; Fischer & Fiedler 2001). Weights were determined on an
electronic Sartorius MC 210P balance to the nearest 0.1 mg. Since prepupae had to be
removed from their girdle for weighing, the resulting pupae were later fixed using
double-sided sticky tape. This procedure ensured safe metamorphosis of the great
majority of individuals (> 95%).
Food choice experiments. For food choice experiments, fourth instar lar-
vae of both species were placed individually in Petri dishes (12 cm diameter, height
1.5 cm) lined with moistened filter paper. Larvae for these tests were randomly chosen
from the mass rearing which occurred on the two sets of three plant species each in the
first and second generation (see above). All larvae were used for a test only once. The
plant species on which a test larva had developed prior to the experiment was recorded
as the factor ‘Reared’ for subsequent analysis, whereas the plant species chosen was
noted as ‘Selected’. Thus it was possible to account for inductions of preferences through
earlier feeding experience. Each animal was then allowed to choose between three
food plant species offered simultaneously in such a way that foliage of each plant
species covered approximately one third of the area, while the centre of the Petri dish
remained free. The test caterpillar was introduced in this centre with random orienta-
tion. The Petri dishes were then placed in the same environmental cabinet as the other
larvae. After 24 h we recorded on which of the three plants the caterpillars were actu-
ally feeding.
Food choice tests were performed with the same plant combinations as the no-
choice performance experiments. Larvae in spring and early summer were offered
Lathyrus pratensis, Lotus corniculatus and Medicago sativa, while those in late sum-
mer were offered Lathyrus pratensis, Lotus corniculatus and Vicia cracca.
Mating experiments. To obtain intra- and possibly interspecific matings, a
flight cage (2.4 x 1.2 x 1.2 m) covered with gauze was placed in a greenhouse at 30 °C
und 60% relative humidity, illuminated by strong lamps that emitted a sufficient UV
fraction. In this cage butterflies of both sexes and species could fly freely. Since all
individuals were marked uniquely by numbers that had been maintained throughout
their development and since all mother butterflies had been identified based on genitalic
dissection after their death, the taxonomic identity of each butterfly individual in the
flight cage was known with certainty. As food sources vials with sucrose solution and
bunches with natural nectar sources (L. corniculatus flowers) were offered. In total, 30
to 60 butterflies were present at each observation in the cage whose mean age was 2.2 d
(range: 0-10 d). Observations were conducted for 2-3 h/d on 11 d during emergence
of the summer generation. Whenever courtship behaviour occurred, the following data
were recorded: the individual numbers of the butterflies involved, duration of court-
ship sequences (measured with a stop watch), the female’s receptiveness (indicated by
“+ FREESE & FIEDLER: Specific distinctness of Leptidea sinapis and L. reali
her bending of the abdomen towards the courting male or, alternatively, by her avoid-
ance behaviour), and the incidence and duration of a resulting copulation.
Statistical evaluation. Results were evaluated using standard statistical pro-
cedures (Sachs 1997) as implemented in the package Statistica 6.0 (StatSoft 2001).
Throughout the text, means are reported + one standard deviation. Test statistics and
sample sizes are given for each type of comparison. Where multiple tests on the same
data set had to be performed, we applied a sequential Bonferroni correction (Hochberg
1988) to maintain a table-wide significance threshold of p=0.05.
Results
Oviposition preferences. Females of both species laid eggs on all offered
food plants. Some eggs were even laid on non-plant substrates such as glass, filter paper
or gauze. Numbers of eggs laid per female were low and did not differ between species
(L. reali: 37.2+31.8 eggs (range 2-143, n=38); L. sinapis: 33.1+35.8 eggs (range 4-129,
n=18); Mann-Whitney U-test: z=0.94, p>0.34; Fig. 1). Mean fecundity was thus similar
to the value reported by Bink (1992) for ‘L. sinapis sensu lato’, while maximum fecun-
dity in our samples was much higher (up to 143 eggs). Eighteen L. reali and 10 L. sinapis
females laid enough eggs to allow for a statistical evaluation. Among these, interspecific
differences were noted only for egg-laying on L. pratensis (Mann-Whitney U-test: z=2.52,
p<0.01, significant after sequential Bonferroni correction). L. reali females laid a larger
fraction of their egg-load on this plant species as compared to L. sinapis (Fig. 2).
(29)
a
©
=
2
=
©
m
®
A
=
=)
=
20 40 60 80 100 120 140 160 0 20 40 60 80 100 120 140 160
L. reali L. sinapis
Egg number (life-time)
Figure 1. Lifetime fecundity of captive Leptidea females.
Nota lepid. 25 (1): 39-59 45
M. sativa
[| V. cracca
L. corniculatus
EM L pratensis
ZA others 18
©
=
n
0)
©)
®
ee
O
=
©
TE
O
[ex
O
—
QO.
L. sinapis
Figure 2. Proportion of eggs (means + 1 S.D.) laid by captive females of L. reali and L. sinapis when
offered a choice between various food plants. Numbers above columns refer to numbers of females in
the tests that laid more than 10 eggs.
There was substantial individual variation in egg-laying preferences in both species.
Nine L. reali females laid more than 50% of their egg-load on L. pratensis, five on L.
corniculatus and two on V. cracca. For L. sinapis, the respective numbers were one (L.
pratensis), five (L. corniculatus, including one female that laid all her eggs on this
plant species) and two (V. cracca, including one female that laid all her eggs on this
plant species).
A slightly different picture emerges if all eggs laid during the experiments are
summed up. Of the 752 eggs laid by 25 L. reali females, M. sativa received 0.9%, L.
corniculatus 33.9%, L. pratensis 40.4% and V. cracca 18.2% (5.2% were laid on non-
host substrates). The respective figures for the 436 eggs laid by 15 L. sinapis females
were: 1.6% eggs on M. sativa, 53.2% on L. corniculatus, 22.2% on L. pratensis and
. 16.3% on V. cracca (6.7% on non-host substrates). However, these cumulative data
cannot be subjected to a statistical analysis since eggs laid by the same female cannot
be treated as independent data points and individuals that happened to lay more eggs
would be over-represented.
Collectively, the oviposition experiments revealed that L. sinapis and L. reali differ
in their oviposition hierarchies, although individuals of both species may exhibit very
different responses. For L. reali, the hierarchy was L. pratensis 2 L. corniculatus > V.
cracca >> M. sativa, whereas for L. sinapis it was L. corniculatus > V. cracca 2 L.
pratensis >> M. sativa.
46 FREESE & FIEDLER: Specific distinctness of Leptidea sinapis and L. reali
Development and performance of early stages in no-choice experi-
ments. Prepupal weights differed between sexes, with females generally being 10%
larger than males (Fig. 3, Table 1). There was also a highly significant, albeit slight effect
of food plant, with larvae reared on L. corniculatus achieving highest weights in both
species and sexes, while the three other food plants were of equal quality as measured by
prepupal weights. Finally, L. reali reached overall slightly (and significantly) higher
weights (d : 63.2+7.5 mg; 2: 68.2+8.8 mg) than L. sinapis (3: 58.0+6.6 mg; 9 : 67.7£7.4
mg) under identical rearing conditions. This effect was more pronounced in males, al-
though statistically the species X sex interaction just failed to reach significance. There
was no species x food interaction suggesting that performance of the two Leptidea spe-
cies was not differentially affected by the food plant in no-choice situations.
Lathyrus
Medicago
D
=
ed
e
D
©
=
To
a.
=
2.
®
m
OW
male female male female
L. reali L. sinapis
Figure 3. Prepupal weights of L. reali and L. sinapis, according to sex and food plant, obtained under
standardized climatic conditions (25°C constant, 16:8h L:D cycle). Filled diamonds: means; boxes: + 1
SD, whiskers: + 1 SE.
There were highly significant differences between species, sexes and food plants with
regard to total development times (i.e. entire larval and pupal duration; Table 2, Fig.
4). Generally, females of both species took about 2 d longer to develop. Moreover, in
both sexes L. reali required about 1 d longer than L. sinapis to reach maturity under
identical environmental conditions (L. reali: 3: 26.2+2.7 d (n=88); 2: 28.6+2.6 d (n=88);
L. sinapis: 3: 25.1£2.6 (n=77); 2: 27.1+2.2 d (n=91)). Developmental duration was
shortest for both species and sexes when fed L. corniculatus, insects reared on L.
Nota lepid. 25 (1): 39-59 47
Table 1. Results of three-way ANOVA of prepupal weights of L. sinapis and L. reali, with species, sex
and food plant as main factors. Significant effects printed in bold. d.f. = degrees of freedom.
TS
square
Error Shea EN
pratensis required 1-2 d longer, and rearing on V. cracca or M. sativa retarded devel-
opment by about 2—4 d as compared to L. corniculatus.
Growth rates significantly differed between sexes (with males growing by about
6% more rapidly) as well as between species (L. sinapis having about 12.3% higher
growth rate than L. reali; Table 3, Fig. 5). Food plant species did not affect growth rate.
There was a significant, though weak species = food interaction which was due to the
fact that L. reali grew more slowly on V. cracca and L. pratensis, whereas growth rates
were almost equal across all food treatments in L. sinapis. Collectively, when integrat-
ing all three life-history parameters measured, larval performance was best on L.
corniculatus, with only weak differences between the other three food plant species.
Boso choice by caterpillars.
A log-linear analysis (Table 5) of food choice frequencies (Table 4) was performed.
Since the three-way interaction Species x Reared x Selected was not significantly
different from zero, only two-way interactions were included in the search for an opti-
mal model. This optimal model (goodness of fit excluding structural zeros: maximum-
likelihood ¥ ? ,, 4, =7.06, p>0.85) revealed that feeding decisions of caterpillars were
influenced by the plant species on which a caterpillar had initially fed (Reared = Se-
lected interaction). For example, V. cracca was never chosen by larvae initially fed L.
corniculatus. L. corniculatus was particularly often selected by larvae initially fed this
same plant species or L. pratensis, whereas larvae initially reared on V. cracca or M.
sativa did not prefer L. pratensis over L. corniculatus.
There was no significant Species x Selected interaction, i.e. both Leptidea species
behaved similarly when given a choice between the food plants selected for experi-
ments. Structural zeros (marked in Table 4) reflect that not all choice opportunities
were possible to the larvae. Since experiments were conducted during two genera-
tions, with two different sets of plant species, neither decisions of Vicia-reared larvae
towards Medicago, nor decisions of Medicago-fed larvae to Vicia, were possible.
Statistical significance of the factor Reared is biologically meaningless. This sim-
ply shows that the numbers of caterpillars taken from the various initial food plants
differed (due to differential availability in our rearings). The factor Selected was highly
48 FREESE & FIEDLER: Specific distinctness of Leptidea sinapis and L. reali
32
a
<=
n= ==
oS 20
LE 32
TIR
28
Er == —— ee
© SS
® 20 :
>
O 32
Ss
=
6 à 24
© 20
es
= 32
Q
S
20
male . female male female
L. reali L. sinapis
Figure 4. Duration of development (all larval instars plus pupal stage) of L. reali and L. sinapis, accord-
ing to sex and food plant, obtained under standardized climatic conditions (25°C constant, 16:8h L:D
cycle). Filled diamonds: means; boxes: + 1 SD, whiskers: + 1 SE.
Table 2. Results of three-way ANOVA of developmental times of L. sinapis and L. reali, with species,
sex and food plant as main factors. Significant effects printed in bold. d.f. = degrees of freedom.
TE en or Coc
Be EA ae ET RER
Species Sex! DE hems So aa
328 eeboawiy shat | aa im
significant, indicating that the plant species offered differed strongly in their accept-
ability. A subsequent comparison of observed against expected choice frequencies
(under the null hypothesis of equal choice of all four food plant species) revealed that
both Leptidea species discriminated between plants (L. sinapis: X? 34¢=25.9, p<0.0001;
L. reali: X ? 34¢ =30.1, p<0.0001). Identification of the plants that contributed to this
unevenness in choice decisions showed that both Leptidea species chose L. corniculatus
significantly more often than expected by chance (L. sinapis: % ? \4¢=10.9, p<0.001; L.
Nota lepid. 25 (1): 39-59 49
: EX
=
Lathyrus
(>)
N
on
OMS
— 035
TON
D >
es ==
2 0.15
G
Se
c 8g 0:35
È =
© § 0.25 Bee —
=a
O
0.15
0.35
8}
0.15
male female male female
L. reali L. sinapis
Figure 5. Growth rate during fourth (= final) larval instar of L. reali and L. sinapis, according to sex and
food plant, obtained under standardized climatic conditions (25°C constant, 16:8h L:D cycle). Filled
diamonds: means; boxes: + 1 SD, whiskers: + 1 SE.
Table 3. Results of three-way ANOVA of growth rates of L. sinapis and L. reali, with species, sex and
food plant as main factors. Significant effects printed in bold. d.f. = degrees of freedom.
aaa
square
ee a
Sen fr fons [622 [0.013
Food |3 Joo0o2 __—[0.86 [0.46
[Species x Sex 1 10.006 [2211013
nn 1257 1000 | | |
reali: X? 4¢=11.8, p=0.0006), whereas M. sativa was strongly discriminated against (Z.
sinapis: X ? jr =18.1, p<0.0001; L. reali: X ? ‚1, =10.1, p=0.0015; all comparisons sig-
nificant after sequential Bonferroni correction).
Collectively, these data demonstrate that in choice situations caterpillars of both
Leptidea species select food plants in much the same way, the hierarchy being: L.
corniculatus > L. pratensis = V. cracca >> M. sativa.
50 FREESE & FIEDLER: Specific distinctness of Leptidea sinapis and L. reali
Table 4. Frequencies of food choice decisions, depending on the initial rearing plant. *: structural zeros,
i.e. this choice opportunity was not offered to the larvae.
> SEE
LE ONE ee
CIS TRES
PE PE
MOMS fee OL
a Pe ER
FE ESPN ee
LC PS [i2
er
rn
Era
een
Pre
re
Bere“
Frequency
roman
Ber ee
i ae eh
ee es eee
rece fee
See eee
E
FT ER er. Tin ER
Fr > (ae et
rn RE
PE
ee
es En nenn
ie REEL vu ne
reece EE
Dee
aeneren
Bee
Ba
rat
Bea
a:
— bd
— en
eme um.
RM En
a Oe ur
Pet ren
sp lia D
en ae 0
Mating experiments. We observed a total of 158 courtship events in the flight
cage equipped with butterflies of both species and sexes (Table 6). Males courted not
only females of their own species, but did so also towards heterospecific females.
However, there was a clear difference between both species, with L. reali males court-
ing L. sinapis females disproportionally rarely, while L. sinapis males courted
heterospecific females even more frequently than their conspecifics (Fisher’s exact
1
Nota lepid. 25 (1): 39-59 51
Table 5. Log-linear analysis of decision frequencies in food choice tests. Significant effects printed in
bold. d.f. = degrees of freedom.
pdt [partial ?@ | partialp marginal? | marginal p |
Pees wa jos jo fos |
EEE 3501543707 <0.0000 | 5430 [0.0001
ne) 1560 |=0.0001 . |1560. : = |<00001 |
fReared* Selected |9 22.2 | [22.6 [0.007
Table 6. Observed frequencies of intersexual interactions in a large flight cage.
Species of d | Species of © | courtship | © receptive | copula | 4 attempts copula,
© ae.
Ben Ce |
I een
ps EEE 9 © 0 jo VE
Eee louer Joue put 1
Ro One 00 dé un FOREN PEN
D al Er a jo An",
test, p<0.0001). When courting, males settled down in front of a sitting female and
rapidly moved around their extended proboscis. Intraspecific courting sequences lasted
19.1432.5 s in L. reali (n=53) and 20.2+37.6 s in L. sinapis (n=20; U-test: z=0.75,
p>0.4). Interspecific courtships were of similar length as intraspecific ones (male L.
reali courting female L. sinapis (n=2): 19.4+33.7 s; male L. sinapis courting female L.
reali (n=42): 23.5+30.9 s; U-tests for intra- versus interspecific courtings by male L.
reali: z=0.29, p>0.77; by male L. sinapis: z=1.76, p= 0.087).
In 16 cases females signalled receptiveness by bending their abdomen towards the
courting male. This response exclusively occurred towards males of the ‘right’ species
and never against heterospecific males (Fisher’s exact test, intra- versus interspecific
courtships: p=0.0005).
If a female was unwilling to mate, she either remained completely calm (more
rarely), or she fluttered with her wings, but remained in place. Alternatively, the fe-
male flew off. Even with intraspecific interactions, the majority of courtings did not
result in a mating (L. reali: 88% of courtings; L. sinapis: 73%). Occasionally (Table 6)
males tried to mate with a female even though she had not signalled receptiveness.
‘Such attempts were never successful.
We observed 12 intraspecific copulations (Fisher’s exact test, intra- versus
interspecific courtships: p=0.0015). In the four cases where no copulation occurred,
despite the female’s willingness, the male was always hindered by some obstacles
(such as plant twigs or leaves) to achieve the proper mating position. Copulations
lasted 47.1+32.7 min (n=7) in L. reali and 63.2+32.2 min (n=5) in L. sinapis with no
significant difference between the two species (¢-test: =0.387, p>0.7). Though vari-
ance was very large, courtships leading to successful matings were longer (median 20 s,
32 FREESE & FIEDLER: Specific distinctness of Leptidea sinapis and L. reali
n=8) than unsuccessful intraspecific courtship sequences (median 6 s, n=63;
Kolmogorov-Smirnov test: p<0.025).
Not only young females were successfully courted. Two females aged four or five
days, respectively, but still virgin, were accepted by courting males. With 36 and 48
min, respectively, these two matings fell well within the variation observed with younger
females. The 5 d-old L. reali female subsequently laid 25 fertile eggs, whereas the 4 d-
old L. sinapis female died accidentally without having laid eggs in captivity.
Discussion
Ethological reproductive isolation. Ourexperiments ina large flight
cage revealed that the females of L. reali and L. sinapis clearly distinguish between
these two species. Males courted heterospecific females with the same intensity as
conspecifics (measured by courtship duration), whereas females never signalled re-
ceptiveness towards heterospecific males (evidenced by forward bending of the abdo-
men). Species discrimination was less straightforward in males. While L. reali males
very rarely courted L. sinapis females, L. sinapis males appeared not to discriminate
against L. reali females when courting. Neither in the laboratory nor in the field (A.
Freese, unpublished observations, identity of mates confirmed subsequently by dis-
section after their death) did we observe interspecific matings. These observations
provide strong evidence for a precopulatory mate choice particularly (but not only)
through the female sex, in contrast to predictions derived from the lock-and-key hy-
pothesis which would suggest that species discrimination occurs only at insertion of
the male’s genitalia into the female’s copulatory opening.
Due to the limited simultaneous availability of adult butterflies in sufficiently large
numbers, our mating experiments could not be fully standardized. It was impossible to
stock the cage for each observational sequence with the same number of individuals of
all sexes and species. For example, L. sinapis females were in rather short supply
which might have influenced our results. Moreover, the number of observational rep-
licates was low. Some butterflies were present in the flight cage during more than one
observation session, and some degree of pseudoreplication also occurred since the
same individual butterflies happened to interact with other individuals in the cage
more than once within one observational session. From all these reasons, the statistical
results derived from our observational data should not be overemphasized, and further
tests under improved conditions might produce slightly different results. Most animals
exhibited behaviours such as food searching, courtship and mating in much the same
way as in nature. The frequent rejection of courting males by virgin females was not a
laboratory artefact, but also often occurred in the field (A. Freese, unpublished obser-
vations). This contrasts with Wiklund’s notion (1977a) according to which only mated
females would exhibit avoidance behaviour against courting males.
Our experiments with northern Bavarian stock support the concept of L. reali and
L. sinapis being distinct biospecies, whose reproductive isolation is maintained by
precopulatory ethological isolation mediated through (mostly female) mate choice.
Initial evidence for such ethological isolation was reported by Lorkovic (1993) from
Nota lepid. 25 (1): 39-59 55
Croatia. Thus, species recognition and reproductive isolation are not just regionally
limited phenomena, as it occasionally occurs in ring species or ‘super-species’ (Barton
& Hewitt 1985, Harrison 1990). From his experiments on reproductive isolation be-
tween ‘L. sinapis’ (in retrospect it is unclear whether he experimented with true L.
sinapis or L. reali) and L. morsei Fent., Lorkovic (1950) also concluded that the fe-
male sex controls species-specific mating, while males attempt interspecific hybrid
pairings.
The role of sexual selection and female choice in speciation has been emphasized
in mathematical models (e.g. Fisher 1930; Lande 1981; Kirkpatrick 1982) and has
gained increasing empirical support (Panhuis er al. 2001). Sexually selected signals
are important in speciation processes (Darwin 1871; Thornhill & Alcock 1983; West-
Eberhard 1983). For example, Wiernasz (1989) and Wiernasz & Kingsolver (1992)
showed that in the two closely related and morphologically similar species Pieris
occidentalis and P. protodice no hybrids occur in nature, although postcopulatory iso-
lation barriers do not exist. In this case the degree of melanization of the fore wings
serves as recognition signal for the female during mate choice.
The nature of signals responsible for precopulatory species discrimination between
L. sinapis and L. reali remains to be uncovered. Wing melanization is unlikely to play
an important role since it strongly varies in both species between generations (Mazel
2000, 2001a). Only extreme phenotypes look so different to the human observer as to
allow for species distinction. Lorkovié (1930) assumed that species-specific pheromones
mediate recognition between Leptidea morsei and ‘L. sinapis sensu lato’, and this also
seems the most likely explanation in the sibling species pair L. sinapis / L. reali.
Androconia are well known from many Pieridae (Halfter et al. 1990), and their
pheromones are important in sexual interactions (Omura et al. 2000). Close inspection
under a stereomicroscope (50-fold magnification) of both Leptidea species did not
reveal any morphologically distinct androconia on the wings (A. Freese, unpublished
observations). This does, however, not imply that there are no glands that could dissi-
pate a male sex pheromone. Clearly, the nature and source of this isolating signal
deserves further research.
Hybridization experiments by Lorkovic (1950) between ‘L. sinapis sensu lato’ and
L. morsei revealed that enforced copulations were only possible after specialized scales
around the genital opening of the female had been removed experimentally. Hence in
Leptidea another factor is involved in reproductive isolation which again has nothing
to do with the size and shape of the sclerotized genitalia apparatus. Hybrids achieved
from these experiments were viable, but completely sterile. Whether this mode of
reproductive isolation is also acting between L. sinapis and L. reali has not been stud-
ied thus far.
Ecological differentiation. Our experiments revealed that apart from etho-
logical isolation between L. reali and L. sinapis ecological differences also exist. Fe-
males ranked the four tested hostplant species differentially, with L reali preferentially
Ovipositing on Lathyrus pratensis, while this plant ranked second-lowest in L. sinapis
(which preferred Lotus corniculatus). These experimental findings are exactly in line
with the hypothesis about hostplant preferences advanced by Lorkovié (1993) and
54 FREESE & FIEDLER: Specific distinctness of Leptidea sinapis and L. reali
Kristal & Nassig (1996). However, in both species some individuals showed oviposi-
tion preferences of the ‘opposite’ species, suggesting that this differentiation is not yet
fixed in either of the species and may also vary regionally. For example, in the vicinity
of Bayreuth egg-laying of females (identity subsequently confirmed by dissection)
occurred on L. pratensis as well as L. corniculatus (A. Freese, unpublished observa-
tions). Hence, without controlling for individual preferences and the local availability
of oviposition substrates, chance field observations could well be misleading for infer-
ences about hostplant preference hierarchies (Tabashnik ef al. 1981, Rausher & Papaj
1983, Thompson & Pellmyr 1991). M. sativa was for both Leptidea species the most
unattractive oviposition substrate, which is in accordance with the the rarity of records
of this plant in the literature. L. corniculatus and L. pratensis are cited most often,
followed by V. cracca, and Medicago is mentioned least often (e.g. Wiklund 1977b;
Henriksen & Kreutzer 1982; Warren 1984, Thomas & Lewington 1991; Bink 1992;
Ebert & Rennwald 1993). _
Minor differences between important life-history parameters of both species also
emerged in the rearing experiments under fully standardized environmental condi-
tions. L. reali grew slightly larger (in particular so in the male sex) and took about 1d
longer to develop, whereas L. sinapis had higher growth rates during the final larval
instar. This might indicate that selection has favoured life-history evolution towards
larger body size in L. reali as opposed to more rapid development in L. sinapis. How-
ever, variation was pronounced and it remains to be tested whether these subtle differ-
ences would be important under more variable natural growth conditions or would
recur with animals from geographically distant populations.
Under the rearing regime (high constant temperature, long photoperiod) no indi-
vidual entered diapause and all passed through four larval instars only (cf. Warren
1984). Development across five larval instars, as occasionally reported in older sources
as being characteristic for first generation larvae (Emmet & Heath 1990), never oc-
curred. We can at present not ascertain whether these Leptidea species never pass
through a five-instar pathway. In other butterflies, instar number is indeed a more
plastic trait that varies between populations and may also be associated with diapause
or subitaneous development (Fischer & Fiedler 2002).
Both Leptidea species exhibited distinct protandry, with development time being about
2d shorter in males (cf. Wiklund & Solbreck 1982). The extent of protandry did not differ
between species. Protandry was realized by a combination of higher growth rates and
smaller body size in males, while the females took more time (mainly in the final larval
and pupal stage) and grew about 10% larger. Larger body size in females probably re-
flects selective advantages such as increased fecundity (Wiklund & Karlsson 1988,
Wickman & Karlsson 1989, Honek 1993). This should be particularly relevant in egg-
limited insects like Leptidea species with a mean lifetime fecundity of but 30-40 eggs.
Protandry should be selected for if females mate only once and virgin females quickly
become rare during population emergence (Wiklund 1977a; Wiklund & Solbreck 1982;
Zonneveld & Metz 1991). Under such conditions, males may be forced to accept se-
vere trade-offs between body size and speed of development (Fischer & Fiedler 2001).
Larval food plant affected most life-history traits in no-choice experiments, but spe-
Nota lepid. 25 (1): 39-59 59
cies-specific effects (1.e. species X food interactions) were seen only with growth rates.
L. reali achieved relatively low growth rates when fed. V. cracca and L. pratensis.
Overall, however, the different plant species offered in our experiments had largely
similar effects on performance and fitness of L. reali and L. sinapis. L. corniculatus
turned out to be the most favourable plant with regard to body size and duration of
development. L. pratensis and V. cracca were almost equally suitable for both species,
while M. sativa was overall the least favourable plant. Mortality (L. reali: 66.2 + 16.6%;
L. sinapis: 49.9 + 30.0%) of larvae was also highest when fed M. sativa. Thus, the
hierarchy of food plants according to larval performance was for both Leptidea species
L. corniculatus > L. pratensis = V. cracca > M. sativa.
In choice situations larvae of both Leptidea species preferred plants almost exactly
as would be expected according to the performance hierarchy. Discrimination against
M. sativa was very strong, and also both species clearly favoured L. corniculatus. In
addition, feeding experience had a strong influence on feeding choices. Remarkably,
earlier feeding on L. pratensis did not increase the likelihood of accepting that same
plant later in a choice situation. Even in L. reali (where females prefer L. pratensis for
Oviposition), more Lathyrus-fed larvae switched to Lotus than vice versa.
Although in Lepidoptera with relatively sedentary larvae the female’s choice of a
hostplant for oviposition has usually the highest impact on larval survival, the ability
to make a choice also may have selective advantages for the caterpillars. For example,
when caterpillars fall off their hostplant after an attack, or if a plant individual does not
provide sufficient resources, larvae must be able to find and select a proper new hostplant
(Bernays & Chapman 1994).
While the caterpillars’ choices perfectly matched their performance, egg-laying
decisions and offspring performance showed a discrepancy in L. reali, where a plant
species offering less than optimal performance (1.e. Lathyrus pratensis) was preferred
for oviposition. Theoretically one would expect female preference and offspring per-
formance to be tightly correlated to maximise fitness (Thompson & Pellmyr 1991;
Gratton & Welter 1998). However, apart from phytochemical and nutritional differ-
ences between hostplant species, factors such as the incidence of predators, parasitoids
or competitors may cause discrepancies between preference and performance
(Thompson 1988a; Thompson & Pellmyr 1991). Thus, the validity of the performance
hierarchies, as extracted from our experimental study, needs to be assessed under field
conditions. Yet there is thus far no reason to assume that levels of predation, parasit-
ism, or competition should differ between, for example, L. corniculatus and L. pratensis
in the case of the two Leptidea species.
Oviposition preferences of butterflies are often heritable and vary within and across
populations (Thompson 1988b; Singer et al. 1988; Nylin & Janz 1996). Although we
did not test for heritability of preferences, individual variation was pronounced in both
Leptidea species. Any reduction in gene flow between both forms (with genetically
different preferences) should, on the long run, improve the preference-performance
correlation within each group (Via 1986). The discrepancy between preference and
performance in L. reali could then be explained by the hypothesis that the time passed
56 FREESE & FIEDLER: Specific distinctness of Leptidea sinapis and L. reali
since the split of the two taxa has not yet been sufficient for a clear preference-per-
formance correlation to evolve (Thompson 1988a).
In herbivorous insects, heritable differences in hostplant preferences may be the
driving force towards speciation, even in sympatry, provided that genetical prefer-
ence-performance correlations or assortative hostplant related matings occur (e.g.
Felsenstein 1981; Via 1986, Singer et al. 1988). In L. sinapis and L. reali, with their
strong overlap with regard to larval hostplants and the only incipient segregation with
regard to preference hierarchies, it seems very unlikely that these subtle differences
have caused or even facilitated speciation. Rather, it is likely to assume given the
results presented here that incipient speciation was mediated by sexual selection and
female mate choice, with the weak ecological segregation evolving as a chance by-
product (possibly via genetic drift: Schluter 2001).
Prospects. The results presented here demonstrate that L. sinapis and L. reali are
in all likelihood two different biospecies separated by ethological reproductive isola-
tion barriers. The two species are only weakly differentiated in ecological terms, and
speciation may not yet have reached the level of complete interruption of gene flow.
For example, the occasional occurrence of individuals with ‘odd’ genitalia measures
in the offspring of females of both species (A. Freese and K. Fiedler, unpublished
results) might indicate that limited introgression still takes place. To test this possibil-
ity rigorously, measures of gene flow by means of allozyme electrophoresis or DNA
techniques will be required (Geiger 1988; Pollock et al. 1998).
The notion that ‘L. sinapis sensu lato’ in fact comprises a sibling species pair also
raises the question as to whether earlier ecological studies on the species complex
remain valid (e.g. Wiklund 1977a, 1977b; Wiklund & Solbreck 1982; Warren 1985;
Warren et al. 1986). In retrospect, it will be difficult to unequivocally determine with
which of the two species these studies were done (unless voucher specimens were still
retained). Distributional areas of both species overlap widely in Europe, and even
syntopic occurrences are known. Our investigations demonstrate the very strong simi-
larities between both Leptidea species in terms of ecology and life-history. Also with
regard to nature conservation issues, problems recognized for ‘L. sinapis sensu lato’
(Dennis 1977; Warren 1985; Warren et al. 1986; SBN 1987; Ebert & Rennwald 1993)
are most likely relevant for both of its component species. For example, all hostplant
species are restricted to rather early successional stages of vegetation, fecundity is
equally low, and there is much overlap in body size, emergence times or longevity.
Thus, threats to the existence of one species will also affect the other, and recovery
from population reductions should also not differ. Nevertheless, the case of the two
Wood Whites is again a reminder that it is not only most worthwhile to examine puta-
tively ‘common’ and ‘well-known’ species more thoroughly, but also to fully docu-
ment results and retain voucher specimens for subsequent validation.
Acknowledgements
We are grateful to Jorg Hager, Roswitha Muhlenberg, Claudia Ruf, Christian H. Schulze and Wolfgang
Völkl for their support with rearing caterpillars, experiments and obtaining specimens in the field. Sören
Nylin provided most useful critical comments on the manuscript. The district government of Bayreuth
kindly issued a permit to study these legally protected species.
Nota lepid. 25 (1): 39-59 a7
Literature
Arnqvist, G. 1998. Comparative evidence for the evolution of genitalia by sexual selection. — Nature
393: 784-786.
Barton, N. H. & G. M. Hewitt 1985. Analysis of hybrid zones. — Annu. Rev. Ecol. Syst. 16: 113-148.
Bernays, E. A. & R. F. Chapman 1994. Host-plant selection by phytophagous insects. - Chapman &
Hall, New York.
Bink, F. A. 1992. Ecologische Atlas van de Dagvlinders van Noordwest-Europa. — Schuyt & Co, Haarlem.
Collins, M. M. 1991. Speciation: a review of concepts and studies with special reference to the Lepidoptera.
— J. Res. Lepid. 30: 45-81.
Darwin, C. 1871. The descent of man, and selection in relation to sex. — Murray, London.
Dennis, R. L. H. 1977. The British butterflies — their origin and establishment. — E. W. Classey, Faringdon.
Eberhard, W. G. 1993. Evaluating models of sexual selection: genitalia as a test case. — Am Nat. 142:
564-571.
Ebert, G. & E. Rennwald 1993. Die Schmetterlinge Baden-Württembergs 1, Tagfalter I. 2" ed. - E.
Ulmer, Stuttgart.
Emmet, A. M. & J. Heath (eds.) 1990. The moths and butterflies of Great Britain and Ireland 7 (1)
(Hesperiidae to Nymphalidae). ix + 370 pp. — Colchester: Harley Books.
Felsenstein, J. 1981. Skepticism towards Santa Rosalia, or why are there so few kinds of animals? —
Evolution 35: 124-139.
Fischer, K. & K. Fiedler 2001. Dimorphic growth patterns and sex-specific reaction norms in the butterfly
Lycaena hippothoe sumadiensis. — J. Evol. Biol. 14: 210-218.
Fischer, K. & K. Fiedler 2002. Life-history plasticity in the butterfly Lycaena hippothoe: local adaptations
and trade-offs. — Biol. J. Linn. Soc. 75: 173-185.
Fisher, R. A. 1930. The genetical theory of natural selection. — Clarendon Press, Oxford.
Geiger, H. 1988. Enzyme electrophoresis and interspecific hybridization in Pieridae (Lepidoptera) —
The case for enzyme electrophoresis. — J. Res. Lepid. 26: 64—72.
Goulson, D. 1993. Variation in the genitalia of the butterfly Maniola jurtina (Lepidoptera: Satyrinae). —
Zool. J. Linn. Soc. 107: 65-71.
Gratton, C. & Welter, S. C. 1998. Oviposition preference and larval performance of Liriomyza helianthi
(Diptera: Agromyzidae) on normal and novel host plants. — Env. Ent. 27: 926-935.
Halfter, G. & W. Peters & S. Löser 1990. Duftschuppen einheimischer Tagfalter. — Ent. Mitt. Lobbecke-
Museum & Aquazoo 6: 1-90.
Harrison, R. G. 1990. Hybrid zones: windows on evolutionary process. — Oxford Surv. Evol. Biol. 7: 69-128.
Henriksen, H. J. & I. B. Kreutzer 1982. The butterflies of Scandinavia in nature. — Skandinavisk Bogforlag,
Odense.
Hey, J. 2001. The mind of the species problem. — Trends Ecol. Evol. 16: 326-329.
Hochberg, Y. 1988. A sharper Bonferroni procedure for multiple tests of significance. — Biometrika 75:
800-802.
Honek, A. 1993. Intraspecific variation in body size and fecundity in insects: a general relationship.
Oikos 66: 483-492.
Kirkpatrick, M. 1982. Sexual selection and the evolution of female choice. — Evolution 36: 1-12.
Kristal, P. M. & W. A. Nässig. 1996. Leptidea reali Reissinger, 1989 auch in Deutschland und einigen
anderen europäischen Ländern (Lepidoptera, Pieridae). — Nachr. ent. Ver. Apollo, Frankfurt, N. F.
16: 345-361.
Kudrna, O. 1998. Die Tagfalterfauna der Rhön. — Oedippus 15: 1-158.
Kullenberg, B. 1947. Der Kopulationsapparat der Insekten aus phylogenetischem Geschichtspunkt.
Zool. Bidr. Uppsala 25: 79-90.
Lande, R. 1981. Models of speciation by sexual selection on polygenic traits. — Proc. Natl. Acad. Sci.
USA 78: 3721-3725.
Lorkovic, Z. 1930. Verwandtschaftliche Beziehungen in der morsei-major-sinapis-Gruppe des Genus
Leptidea. — Z. österr. Ent. Ver. 15: 85-113.
Lorkovic, Z. 1950. Neue ostasiatische Arten und Rassen der Gattung Leptidea nebst Nomenklatur-
berichtigungen. — Period. Biol. (Zagreb) 2/3: 57-76.
58 FREESE & FIEDLER: Specific distinctness of Leptidea sinapis and L. reali
Lorkovic, Z. 1993. Leptidea reali Reissinger, 1989 (= lorkovicii Real, 1988), a new European species
(Lepid., Pieridae). — Nat. Croat. 2: 1-26.
Luckow, M. 1995. Species concepts: assumptions, methods, and applications. — Syst. Bot. 20: 589-605.
Mayr, E. 1942. Systematics and the origin of species. — Columbia Univ. Press, New York.
Mazel, R. 2000, 2001a. Le polymorphisme de deux “espèces jumelles» Leptidea sinapis L. et L. reali
Reissinger en France (Lepidoptera: Pieridae). — Linn. Belg. 17: 277-288; 18: 37-43.
Mazel, R. 2001b. Leptidea sinapis L., 1758 — L. reali Reissinger, 1989, le point de la situation (Lepidoptera:
Pieridae, Dismorphiinae). — Linn. Belg. 18: 199-202.
Mazel, R. & R. Leestmans 1996. Relations biogéographiques, écologiques et taxinomiques entre Leptidea
sinapis Linné et L. reali Reissinger en France, Belgique et PBS limitrophes (Lepidoptera: Pieridae)
— Linn. Belg. 15: 317-328.
Mikkola, K. 1992. Evidence for lock-and-key mechanisms in the internal genitalia of the Apamea moths
(Lepidoptera, Noctuidae). — Syst. Ent. 17: 145-153.
Monti, L., M. Baylac & B. Lalanne-Cassou 2001. Elliptic Fourier analysis of the form of genitalia in two
Spodoptera species and their hybrids (Lepidoptera: Noctuidae). — Biol. J. Linn. Soc. 72: 391-400.
Nylin, S. & K. Gotthard 1998. Plasticity in life-history traits. - Annu. Rev. Ent. 43: 63-83.
Nylin, S. & N. Janz 1996. Host pJant preferences in the comma butterfly (Polygonia c-album): Do
parents and offspring agree? — Ecoscience 3: 285-289.
Omura, H., S. Morinaka & K. Honda 2000. Chemical nature of volatile compounds from the valvae and
wings of male Delias butterflies (Lepidoptera: Pieride). — Ent. Sci. 3: 427-432.
Panhuis, T. M., R. Butlin, M. Zuk & T. Tregenza 2001. Sexual selection and speciation. — Trends Ecol.
Evol. 16: 364-371. |
Pollock, D. D., W. B. Watt, V. K. Rashbrook & E. V. Iyengar 1998. Molecular phylogeny for Colias
butterflies and their relatives (Lepidoptera: Pieridae). — Ann. ent. Soc. Am. 91: 524-531.
Rausher, M. D. & Papaj, D. R. 1983. Host plant selection by Battus philenor butterflies: evidence for
individual differences in foraging behavior. — Anim. Behav. 31: 341-347.
Real, P. 1988. Lepidopteres nouveaux principalement Jurassiens. - Mem. Comité Liaison pour les
Recherches Ecofaunistiques dans le Jura, Besançon: 17—24.
Sachs, L. 1997. Angewandte Statistik — Anwendung statistischer Methoden. 8. ed. — Springer, Berlin.
SBN (= Schweizerischer Bund für Naturschutz) 1987. Reftie und ihre Lebensräume. Arten — Gefähr-
dung — Schutz. — Fotorotar, Basel.
Schluter, D. 2001. Ecology and the origin of species. — Trends Ecol. Evol. 16: 372-380.
Shapiro, A. M. & A. H. Porter 1989. The lock-and-key hypothesis: evolutionary and biosystematic
interpretation of insect genitalia. — Annu. Rev. Ent. 34: 231-245.
Singer, M. C. & D. Ng & C. D. Thomas 1988. Heritability of oviposition preference and its relationship
to offspring performance within a single insect population. — Evolution 42: 977-985.
Sota, T. & K. Kubota 1998. Genital lock-and-key as a selective agent against hybridization. — Evolution
52: 1507-1513.
StatSoft 2001. Statistica for Windows 6.0. — StatSoft Inc., Tulsa/Oklahoma.
Tabashnik, B. E. & H. Wheelcock, J. D. Rainbold & W. B. Watt 1981. Individual variation in oviposition
preference in the butterfly, Colias eurytheme. — Oecologia 50: 225-230.
Thomas, J. & R. Lewington 1991. The Butterflies of Britain and Ireland. — Dorling Kindersley, London.
Thompson, J. N. 1988a. Evolutionary ecology of the relationship between oviposition preference and
performance of offspring in phytophagous insects. — Entomol. exp. appl. 47: 3-14.
Thompson, J. N. 1988b. Variation in preference and specificity in monophagous and oligophagous
swallowtail butterflies. — Evolution 42: 118-128.
Thompson, J. N. & O. Pellmyr 1991. Evolution of oviposition behavior and host preference in Lepidoptera.
— Annu. Rev. Ent. 36: 65-89.
Thornhill, R. & J. Alcock 1983. The evolution of insect mating systems. — Harvard Univ. Press, Cambridge.
Tolman, T. & R. Lewington 1998. Die Tagfalter Europas und Nordwestafrikas. German ed. by M. Nuß.
— Franckh, Stuttgart.
Via, S. 1986. Genetic covariance between oviposition preference and larval performance in an insect
herbivore. — Evolution 40: 778-785.
Nota lepid. 25 (1): 39-59 59
Warren, M. S. 1984. The biology and status of the Wood White Butterfly Leptidea sinapis (L.) (Lepidoptera:
Pieridae), in the British Isles. — Ent. Gaz. 35: 207-223.
Warren, M.S. 1985. The influence of shade on butterfly numbers in woodland rides, with special reference
to the Wood White Leptidea sinapis. — Biol. Conserv. 33: 147-164.
Warren, M.S. & E. Pollard & T. Bibby 1986. Annual and long-term changes in a population of the wood
white butterfly Leptidea sinapis. — J. Anim. Ecol. 55: 707-719.
West-Eberhard, M. J. 1983. Sexual selection, social competition, and speciation. — Quart. Rev. Biol. 58:
155-183.
Wickman, P.-O. & B. Karlsson 1989. Abdomen size, body size and the reproductive effort of insects. —
Oikos 56: 209-214.
Wiernasz, D. C. 1989. Female choice and sexual selection of male wing melanin pattern in Pieris
occidentalis (Lepidoptera). — Evolution 43: 1672-1682.
Wiernasz, D. C. & J. G. Kingsolver 1992. Wing melanin patterns mediates species recognition in Pieris
occidentalis. — Anim. Behav. 43: 89-94.
Wiklund, C. 1977a. Courtship behaviour in relation to female monogamy in Leptidea sinapis
(Lepidoptera). — Oikos 29: 275-283.
Wiklund, C. 1977b. Oviposition and spatial separation of breeding and foraging habitats in a population
of Leptidea sinapis (Lepidoptera). — Oikos 28: 56-68.
Wiklund, C. & B. Karlsson 1988. Sexual size dimorphism in relation to fecundity in some Swedish
butterflies. — Am. Nat. 1: 132-138.
Wiklund, C. & C. Solbreck 1982. Adaptive versus incidental explanations for the occurrence of protandry
in a butterfly, Leptidea sinapis L. — Evolution 36: 56-62.
Zonneveld, C. & J. A. J. Metz 1991. Models on butterfly protandry: virgin females are at risk to die. —
Theor. Popul. Biol. 40: 308-321.
Book Review
Pro Natura — Schweizerischer Bund fiir Naturschutz (ed.) 2000. Schmetterlinge und ihre
Lebensraume. Arten, Gefahrdung, Schutz. Schweiz und angrenzende Gebiete. Band 3:
Hepialidae, Cossidae, Sesiidae, Thyrididae, Lasiocampidae, Lemoniidae, Endromidae,
Saturniidae, Bombycidae, Notodontidae, Thaumetopoeidae, Dilobidae, Lymantriidae, Arctiidae.
Fotorotar AG, Egg (Switzerland). Pp. i-xii, 1-914 (incl. 34 colour-plates). Price CHF 83.75.
Under the authorship of the “Lepidopterologen-Arbeitsgruppe” (Lepidopterological working
group) and with support by many contributors, the third volume of “Schmetterlinge und ihre
Lebensraume” (Lepidoptera and their habitats) has been completed in the year 2000 already.
The book is arranged into an introductory and a systematic part, followed by water-colour
plates of the moths and a comprehensive register of lepidopterous names, a host-plant index,
an index of localities, bibliographic references, a glossary of technical terms, and a common
index. ER
The introductory chapter is devoted to the conservation of habitats where Lepidoptera live, a
descriptive catalogue of these habitats is given and two chapters inform about economically
important species and insect pheromones.
The systematic chapter is arranged according to families. This requires some basic criticism.
The classification used in this book series is based on a ‘Macrolepidoptera’ concept of pre-
phylogenetic times. In contrast, already Minet (Ent. Scand. 22 (1991): 69-95) indicated a
monophyletic Macrolepidoptera that excludes the Hepialidae, Cossidae, Sesiidae, and
Thyrididae. Other groups of evidently monophyletic origin such as the Noctuoidea comprising
Arctiidae, Lymantriidae, Noctuidae (including Dilobinae), and Notodontidae (including
Thaumetopoeinae) are still separated, and most of these family-groups are misplaced in
Bombycoidea! Also, there is no evidence that the Thyridoidea are related to the Pyraloidea as
stated on page 253. Both taxa are currently assigned to a monophylum comprising six
superfamilies plus the Macrolepidoptera in an unresolved polytomy.
Each family-chapter starts with a short introduction to the family, a checklist of their species
occurring in Switzerland, an annotated key to these species, and an overview of their phenology.
For each species, a description and high quality colour photographs of all stages, their life-
history, a map of records within Switzerland, a description of their habitat preferences are
given and needs for their conservation are discussed. The text is accompanied with additional
information, e.g. the reader gets to know about precopulatory behaviour in Hepialidae,
pheromone reactions of clearwing moths, or the occurrence of species outside Switzerland. By
this comprehensive and well illustrated information, the book provides a useful tool for
lepidopterists, conservationists, landscape planners and ecologists. The price of the book is
quite modest relative to the 914 richly illustrated pages providing valuable information much
relevant even outside Switzerland. ‘Schmetterlinge und ihre Lebensraume’ is a valuable book
for European Lepidopterology and a perfect book to start with if you are looking for a certain
species in the wild!
MATTHIAS Nuss
Nota lepid. 25 (1): 61-78 | 61
Notes on systematics of the Erebia dabanensis species complex,
with special consideration of the dabanensis-youngi and
anyuica-occulta pairs of sibling species (Nymphalidae:
Satyrinae)
ALEXEI G. BELIK* & Dmitry G. ZAMOLODCHIKOV**
* P. O. Box 1594, RU-410028 Saratov, Russian Federation. e-mail:
[email protected]
** Forest Ecology and Production Center RAS, Novocheremushkinskaya, 69, RU-117418 Moscow,
Russian Federation. e-mail:
[email protected]
Summary. There are two pairs of closely related taxa in the Erebia dabanensis species complex which
deserve special attention. These pairs are: Erebia dabanensis Erschoff, 1871 — E. youngi Holland, 1900;
and E. anyuica Kurentzov, 1966 — E. occulta Roos & Kimmich, 1983. Relationships of the taxa within
these pairs are analysed. A study of the comparative morphology of the male genitalia demonstrates that
each discussed taxon is a distinct species. This conclusion is supported by statistically significant differ-
ences in the size proportions of the valvae in the male genitalia, as well as by results of a cluster analysis.
For the first time, two putatively endemic Nearctic species, i.e. E. youngi and E. occulta, are discovered
in the Palaearctic region, at Northeast Chukotka, thus revealing trans-Beringian distributions in both
cases. All previous records of E. occulta in the Palaearctic refer to E. anyuica. The use of the name EF.
anyuica Kurentzov, 1966 constitutes a considerable problem. This is because of the somewhat obscure
original description, while the single type specimen (holotype by monotypy) might be lost. The name F.
anyuica Kurentzov, 1966 should preferably be used for the endemic Palaearctic species, previously
considered as conspecific with E. occulta, until a thorough re-investigation of the Kurentzov collection
has been performed. Only then the holotype may be rediscovered or a neotype will be validly desig-
nated. The recent designation of a neotype of E. anyuica (Korb 1999) is considered invalid, as it does not
meet the requirements of the ICZN.
Zusammenfassung. Zwei Artenpaare aus dem Erebia-dabanensis-Komplex werden detailliert unter-
sucht: Erebia dabanensis Erschoff, 1871 — E. youngi Holland, 1900 sowie E. anyuica Kurentzov, 1966 —
E. occulta Roos & Kimmich, 1983. Eine vergleichend-morphologische Studie der mannlichen Genital-
apparate belegt, daß alle vier Taxa als distinkte Morphospezies anzusehen sind. Dies wird durch statis-
tisch signifikante Unterschiede in Genitalmaßen wie auch durch Befunde einer Clusteranalyse belegt.
Erstmalig werden zwei zuvor als endemisch-nearktische Taxa angesehene Arten (E. youngi, E. occulta)
aus der Paläarktis (von der nordöstlichen Tschuktschen-Halbinsel) gemeldet. Diese beiden Arten haben
demnach trans-beringische Verbreitungsareale. Alle früheren Meldungen von £. occulta aus der Paläarktis
betreffen in Wirklichkeit E. anyuica. Der Taxonname E. anyuica Kurentzov, 1966 ist problembehaftet,
da die Originalbeschreibung wenig präzise und der Holotypus möglicherweise verschollen ist. Solange
nicht durch gründliche Recherche im Originalmaterial von Kurentzovs Sammlung genaueres über das
Schicksal des Holotypus bekannt ist, sollte der Name E. anyuica Kurentzov, 1966 nur für die in der
Paläarktis endemische Art verwendet werden, die bis vor kurzem als konspezifisch mit E. occulta ange-
sehen wurde. Nur dann könnte der Holotypus wiederentdeckt werden oder ein Neotypus festgelegt wer-
den. Die rezente Festlegung des Neotypus von E. anyuica (Korb 1999) wird als ungültig angesehen, da
sie nicht den internationalen Nomenklaturregeln entspricht.
Résumé. Le complexe d’especes d’Erebia dabanensis comprend comprend deux paires de taxons qui
méritent une attention particuliere, a savoir Erebia dabanensis Erschoff, 1871 — E. youngi Holland, 1900
et E. anyuica Kurentzov, 1966 — E. occulta Roos & Kimmich, 1983. Les liens de parente des taxons au
sein de ces paires sont analysées. Une étude morphologique comparative des génitalia mâles démontre
que chacun des taxons discutés constitue une espèce distincte. Cette conclusion est fondée sur des diffe-
rences statistiquement significatives au niveau des proportions quantitatives des valves, ainsi que sur les
résultats d’une analyse de cluster. Pour la première fois, deux espèces jusqu’à présent supposées être des
endémiques néarctiques, à savoir E. youngi et E. occulta, ont été découvertes dans la région paléarcti-
que, dans le nord-est de la région de l’Anadyr, révélant ainsi des aires de répartition transbéringiennes
dans les deux cas. Toutes les mentions précédantes d’E. occulta de la région paléarctique s’appliquent à
E. anyuica. L'usage du nom E. anyuica Kurentzov, 1966 pose un problème considérable, à cause de la
description originale quelque peu obscure, alors que le spécimen-type unique (holotype par monotypie)
pourrait être perdu. Il est préférable, à l’heure actuelle, d’utiliser le nom E. anyuica Kurentzov, 1966
© Nota lepidopterologica, 01.08.2002, ISSN 0342-7536
62 BELIK & ZAMOLODCHIKOV: Systematics of the Erebia dabanensis species complex
pour désigner l’espece paléarctique endémique, précédemment considérée comme étant conspécifique
avec E. occulta, jusqu’à ce qu’une nouvelle étude approfondie de la collection de Kurentzov ait été
entreprise. Alors seulement l’holotype pourrait être redécouvert ou, le cas échéant, un néotype pourrait
être désigné validement. La désignation récente d’un néotype pour E. anyuica (Korb 1999) est considé-
rée comme étant invalide, vu qu’elle ne correspond pas aux conditions imposées par le Code.
Pesrome. B KoMINIeKc BugoB Erebia dabanensis BXOHAT, B 4aCTHOCTH, BE Mapbl OIH3KOPOICTBEHHBIX
TaKCOHOB, KOTOPbIE 3aCHYXKHBAIT CHEIIHAJIBHOTO PaccMoTpeHus. DTA mapbI: Erebia dabanensis Erschoff,
1871 — E. youngi Holland, 1900 u E. anyuica Kurentzov, 1966 — E. occulta Roos et Kimmich, 1983.
IlpoaHnaJın3upoBaHbI B3aUHMOOTHOMIEHNHA TAKCOHOB B NMAHHBIX Mapax. H3yueHne CpaBHHTEIBHON
MOpouOrHH TeHATAHHË CaMIIOB IIOKA3bIBAecT, YTO KAKABIA 13 OOCY’KMACMbIX TAKCOHOB ABIIAETCH
CAMOCTOATEJIBHBIM BHAOM. TaKOÏ BbIBON HOATBEP’KNAETCA KAK IIPOBEPKOHU CTATHCTUYECKOA
HOCTOBEPHOCTH Pa3HHAUA B IPONOPUMAX BAJIbB TEHUTAJIHH CAMIIOB, Tak U PE3VIPTATAMH KIACTEPHOTO
aHayım3a. BriepBrie ABA IHIIEMMYHBIX HeapKkTuuecKkux Bua E. youngi Holland, 1900 u E. occulta Roos
et Kimmich, 1983 o6Hapyxexpi B llasıeapKTuke, Ha ceBepo-Bocroke UyxoTku. Bce IpenbiyImme yKasaHna
Ha HaxogKn E. occulta B IJaneapxTuke OTHocaTca K Buy E. anyuica. Iloka3aHo, 4TO HCIIONIB30BAHHE
HasBaHus E. anyuica Kurentzov, 1966 mpencTaBıseT 3HaYMTENBHYIO MpoOMeMy. ITO CBA3aHO H C
HENOCTATOYHO NCTAJIBHbIM OIIMCAHHEM BHJIA, H C TM, YTO E]IIHHCTBEHBIH THIOBOH IK3EMINIAP (TOAOTHL
IIO MOHOTUHHHH) MOT ObITb YTEPAH. Tem He MeHee, HpeACTABIAETCH HPEAMOYTATENPHPIM HCIOJIbB30BATb
Ha3Banye E. anyuica Kurentzov, 1966 AI 3HIEMHYHOTO HaJleapKTHYECKOTO BUNA, IPEKIIE CAHTABIHETOCH
KOHCHEIHÖDHUHBIM C E. occulta, NO Tex Mop, IOKa He OYNET NepeucceqOBaHa KOMIeKHAA KypeHloBa.
Torma CTaHeT BO3MOXKHEBIM JIMO0 OOHapy2XUTb TOJIOTUN, WHOO HPOA3BECTA BAAIHNHOE 0003Ha4eHHE
HeoTuma. HenaBHss MONbITKa 0603HayeHus HeoTuna E. anyuica (Korb 1999) npu3Haetca
HEMEHÄCTBHTEIIBHOH KaK HE COOTBETCTBYIOINaA TPeOoBaHuaMm MK3H.
Key words. Erebia, sibling species, taxonomy, Chukotka, Beringian distributions.
In the present paper we attempt to clarify the systematics of the Erebia dabanensis
complex in its most complicated and confused part. We specifically ask whether each
taxon in the two pairs dabanensis—youngi and anyuica-occulta is in fact a separate
species, or the taxa in these pairs are conspecific.
In July 1998, the second author visited the interior region of the Chukotskiy Penin-
sula (Northeast Chukotka, Russia) near the lake Ioni (65°48' N, 173°22' W). There he
collected two species of the genus Evebia Dalman, 1816, which apparently belonged
to the Erebia dabanensis complex. After thorough examination and comparative study
these species turned out to be Evebia youngi Holland, 1900 and Erebia occulta Roos &
Kimmich, 1983. This is the first proven record in the Palaearctic region of these two
putatively endemic Nearctic species, as demonstrated below.
1. Erebia dabanensis Erschoff, 1871 (= E. tundra Staudinger, 1887) and Erebia
youngi Holland, 1900.
1.1. Introduction
There is a long-standing discussion in the literature about the relationships between E.
dabanensis and E. youngi: whether the latter taxon is conspecific with the former one,
as well as whether these taxa are sympatric or allopatric (Warren 1936, 1969, 1981;
dos Passos 1972; Troubridge & Philip 1983; Scott 1986; Tuzov er al. 2000). Because
of the great phenetic similarity of E. youngi with E. dabanensis, it is often impossible
to identify specimens of these taxa on the sole basis of details of the wing pattern and
coloration, without studying the male genitalia.
Erebia tundra Staudinger, 1887 is a junior subjective synonym of E. dabanensis
Erschoff, 1871 (see Belik, in press). Kurentzov (1970) considered E. tundra as a sepa-
Nota lepid. 25 (1): 61-78 63
rate species, distributed at the Northeast of Eurasia from East Yakutiya to East Chukotka,
but he appears to have been confused completely about the taxonomy of the E.
dabanensis species complex. His figures for the male genitalia of E. dabanensis and E.
tundra match the genitalia structure of E. kozhantshikovi Sheljuzhko, 1925, and vice
versa. Kurentzov’s key to Erebia (using wing pattern and coloration only) is inconsist-
ent for these three taxa. Thus, it is impossible to decide what Kurentzov meant by the
name “E. tundra”. After the publication of Kurentzov’s book (1970) the systematics of
the E. dabanensis species complex remained confused completely for a while. Ac-
cordingly, in some later publications E. tundra was considered as a separate species,
too (Korshunov 1972; Kogure & Iwamoto 1993).
Troubridge & Philip (1983) convincingly demonstrated that Æ. dabanensis and E.
youngi are two different species, separated well by the stable differences in the male
genitalia structure. They also proved that in the Nearctic only E. youngi occurs, with
all previous records of E. dabanensis from North America referring actually to E.
youngi. In the literature, no records exist about E. youngi occurring in the Palaearctic.
Thus, it was concluded that £. dabanensis and E. youngi are two closely related allopatric
species, with the Bering Strait as natural boundary between their areas of distribution.
With our discovery of E. youngi in the Palaearctic the problem of the relationship
with E. dabanensis came up again, since both taxa are sympatric in the East Palaearctic.
Specifically, the possible occurrence of a cline in the male genitalia structure from E.
dabanensis to E. youngi within the Palaearctic part of the range could not be excluded.
1.2. Material examined and methods
64 Canada, Yukon Territory: Nickel Creek; 1 4 Richardson Mts., Windy pass; 5d Russia, NE. Chukotka,
20 km SE of lake Ioni, valley of Gil’mimleveyem river; 104 Russia, NW. Chukotka, Bilibino district,
5-20 km NW of Bilibino; 10d Russia, Magadan region: Khasyn district, vicinity of Palatka; 35 Bol’shoy
Anngachak mtn. range, vicinity of the Jack London lake; 10d Russia, Chita region, Udokanskiy mtn.
range, 20-26 km SE of Udokan, upper stream of Naminga river; 104 Russia, Chita region, Kyra dis-
trict, ca. 67 km WNW of village Kyra, Sokhondo Mts., upper stream of Bukukun river; 9d Russia,
Buryat republic, East Sayan Mts.: Tunkinskiye Gol’tsy mtn. range, Mt. Khulugaysha; 1d Kitoyskiye
Gol‘tsy mtn. range, between the sources of Irkut and Kitoy rivers, vicinity of Il’chir lake; 14 Russia,
Krasnoyarsk territory, Taymyr autonomous region, Putorana plateau: vicinity of Talnakh; 5d ca. 100 km
E of Noril’sk, E. extremity of the lake Lama; 10d Russia, Tyumen’ region, Yamal-Nenets autonomous
region, Polar Ural Mts., 10-20 km NW of Kharp.
To distinguish E. dabanensis and E. youngi, Troubridge & Philip (1983) introduced a
method to compare the length of the spined ridge of the valvae (in the male genitalia)
expressed as per cent ratio of the length of the costal edge of the valvae. Initially, we
followed this method in the present work (Fig. 1).
Unpaired two-tailed Student’s ¢-tests were used to determine whether samples from
the studied populations differ significantly in average relative length of the spined
ridge of the valvae. Significance was accepted when p<0.01.
Finally, we measured a larger number of quantitative parameters to perform a clus-
ter analysis for a higher reliability and better visualization. The following parameters
were used: L — length of the spined ridge of the valva, expressed in per cent of the total
length of the costal edge of the valva; L,, — length of the forewing; C — curvature of the
dorsal edge of the spined ridge of the valva, of negative value if the edge is concave,
64 BELIK & ZAMOLODCHIKOV: Systematics of the Erebia dabanensis species complex
A
B
ROA AM TETE C
Fig. 1. Male valva of E. dabanensis, showing method used for measurements. Distance “A” is the length
of the costal edge of the valva, measured from the point where the vertical process of the basal end meets
3 = , where “L” is the
relative length of the spined ridge of the valva expressed in per cent. Distance “C” indicates the curva-
ture of the dorsal edge of the spined ridge of the valva.
the costa to the tip. Distance “B” is the length of the spined ridge of the valva.
positive if the edge is convex. Population averages of L, L,,, and C are shown in Table 1.
A hierarchical cluster analysis (single linkage method, based on the matrix of Euclidean
distances) was carried out to identify groups of similar populations. Prior to doing so,
the population parameters (L, L,, and C) were z-transformed (mean = 0, standard
deviation = 1) to exclude influences of different scaling. All calculations were per-
formed using the software package STATISTICA (StatSoft 1995).
1.3. Results
Troubridge & Philip (1983) demonstrated that in Nearctic specimens of E. youngi the
length of the spined ridge of the valva, expressed in per cent of the total length of the
costal edge of the valva, averages 43 % (range 36-47 %), while in Palaearctic speci-
mens of E. dabanensis it averages 55.8 % (range 47-67 %). Our aims were: a) to
determine if these differences could be used for the sure diagnosis of the Palaearctic
specimens of E. youngi and of E. dabanensis; and b) to check for the possible exist-
ence of a cline in this parameter toward E. youngi throughout the distribution area of
E. dabanensis.
The data presented in Table 1 demonstrate quite clearly that the length ofthe spined
ridge of the valva could be used as a good taxonomic character to differentiate E.
Nota lepid. 25 (1): 61-78 65
Table 1. Morphometric data of male E. youngi and E. dabanensis. N — number of specimens examined.
L- length of the spined ridge of the valva in male genitalia, expressed as per cent of the total length of
the costal edge of the valva. L,,,— forewing length. C — curvature of the dorsal edge of the spined ridge
of the valva; negative value if the edge is concave, positive if the edge is convex.
. : Range of L Average L Average Average C
Species Locality N (%) (%) Lew (mm) (mm)
1047-5349
E.youngi [NE Chukotka 13.05-50.63
species
61.8 20.2 20
NW Chukotka 10 | 57.69-67.39
ER
Putorana plateau | 6 | 4665-5682 | 517 | 199 | -l1__
Average for Sy 56.9 20.6
species
youngi from E. dabanensis in most cases. By this parameter, there is no noticeable
cline leading from the West to the East from FE. dabanensis into E. youngi throughout
the giant area of the distribution of FE. dabanensis. An opposite pattern occurs: the
length of the spined ridge of the valva in FE. dabanensis first decreases towards the
west with the minimum found in the population of the Putorana plateau. Then, further
west it increases again in the population of the Polar Ural.
Statistical analysis of data on relative lengths of the spined ridge of valvae (Table 2)
demonstrates that differences in means between populations of E. dabanensis and E.
youngi are significant, with one single exception. By this parameter, E. dabanensis
from the Putorana plateau is indistinguishable from E. youngi from the NE Chukotka
and Yukon.
Thus, the length of the spined ridge of the valva could not be used alone as the
ultimate means to separate E. dabanensis from E. youngi. Otherwise, one should con-
sider the population of the Putorana plateau as belonging to E. youngi. This is highly
improbable, taking into account the large distance (ca. 3800 km) between the Putorana
population and the nearest locality of E. youngi at NE Chukotka, without any linking
populations (with the same valva morphology) in between.
We found additional specific differences in the male genitalia of E. dabanensis and
E. youngi. In E. youngi the whole valvae are relatively shorter than in E. dabanensis in
specimens of similar size (cf. Figs. 4-5 with Fig. 3). To check this, we measured the
BELIK & ZAMOLODCHIKOV: Systematics of the Erebia dabanensis species complex
66
‘pjoqg ul payund are (]0'0>d) SSOUSIJJIP Juesipugis ‘sısuoupgnp ‘7 pue 18unod
‘7 JO suonejndod pourwexs uooMJoq (eIfejLusd Sfew ur) JeAJeA 9} JO adpıı pourds sy Jo YISUS] IATILIOI Ur SOOUDIOJJIP JO SISSI-7 JUuSPNIS Fo SIMS ‘7 2IQUL
6€0 0 ICT 0 £00°0 100°0> 0100 t100 100°0> ÿ00'0
c00°0 100°0> 100°0> 100°0> 100°0> 170 0 VCC 0
9100 900°0 [80 0 LGM 100°0> 100°0>
OSV 0 Otc 0 té 0 100°0> 100°0>
2107049
100°0> 100°0> MN| Si
LISLE Diaz Eee.
jeyreqsuel | UOISOI eyjoynyy
eueloind ueAes A |ICHICQSUEIL S AN uepedenN MN eyjoynyD AN| UOYNA Ayıe9o’]
sısuoupgpp | sısuoupgpp | sısuoupgpp | sısuaupgpp | sısuaupgpp | sısuaupgnp 13unod Bund | | Sospods
Nota lepid. 25 (1): 61-78 67
forewing length, as parameter to characterise the size of the specimen, in the same
specimens of which the valvae had been measured. Furthermore, the following fea-
tures in the structure of the male genitalia could serve well to distinguish E. youngi and
E. dabanensis. As already stated by Troubridge & Philip (1983), the most significant
structural difference between E. youngi and E. dabanensis is in the male valva. That of
E. dabanensis has a much longer, more pointed or narrower tip than that of E. youngi.
Moreover, in E. dabanensis the dorsal edge of the spined ridge of the valva is almost
always concave (as in Figs.1 & 3); only rarely it is straight. In E. youngi this spined
ridge is almost always more or less convex (Figs. 4, 5) and again very rarely straight.
In Nearctic specimens of E. youngi this dorsal edge it is always convex (K. Philip and
J. Troubridge, pers. comm.).
The cluster diagram (Fig. 2) based on forewing length, as well as curvature and
length of the dorsal edge of the spined ridge of the valvae demonstrates clearly that all
examined populations are separated into two clear main groups. In one group are united
all Palaearctic populations from the Polar Ural to NW Chukotka, in the other group are
united the Palaearctic population of NE Chukotka and the Nearctic ones from the Yu-
kon Territory. This phenetic result supports well the hypothesis of specific distinctness
of E. dabanensis and E. youngi. The fact that the group of populations of E. dabanensis
looks as quite heterogeneous, is not surprising taking into account the giant area of its
distribution. It ranges across ca. 4200 km from Polar Ural to NW Chukotka, forming a
number of named subspecies.
a Yukon
NE Chukotka
NW Chukotka
S Transbaikal
E Sayan
Polar Ural
Magadan region
NE Transbaikal
Putorana plateau
( 0 0.5 | Lie 2 2
à Linkage distance
Fig. 2. Phenetic cluster diagram of E. youngi and E. dabanensis populations from different localities
(three variables, Euclidean distances, agglomeration algorithm: single linkage).
68 BELIK & ZAMOLODCHIKOV: Systematics of the Erebia dabanensis species complex
Table 3. Morphometric data of male E. occulta and E. anyuica. N — number of specimens examined. L—
length of the spined ridge of the valva in male genitalia, expressed as per cent of the total length of the
costal edge of the valva. L,,— forewing length. C — curvature of the dorsal edge of the spined ridge of the
valva; negative value if the edge is concave, positive if the edge is convex.
Species Lacali Range of L Average L | Average | Average C
pecies ocality (%) (%) Lm (mm) (mm)
70.2 197 -1.7
Yukon 65.311 - 75.56
E. occulta
NE. Chukotka =~ EET
M an for 72. 1 19. 5
tract
Mien 5 at a | 5-10
Ev anyuica | NE Transbaikal | Wi" 75547: 65.52 1) 606 MEN SES
| 8. Transbaikal | 10] 59.65-65.52 | 63.2 | 236800) Oe
[E.Sayan |
species
1.4. Conclusion
Summarising the aforementioned arguments, we conclude that Æ. youngi is a bona
species, separated morphologically from the very closely related species E. dabanensis.
Further investigations in the interior regions of Chukotka should reveal whether there
is some natural boundary between E. dabanensis and E. youngi, or whether there a
narrow intermediate zone exists where these two species might occur in sympatry. All
literature records of E. dabanensis from East Chukotka should be considered as doubt-
ful so far; perhaps they refer to E. youngi.
We cannot judge yet about the subspecific status of the NE Chukotkan population
of E. youngi. First, the number of available specimens is still low. Second, we have
insufficient comparative material of all three known North American subspecies of E.
youngi available to study. Finally, the status of the taxon tschuktscha Herz, 1903 re-
mains uncertain. It was originally described as a “variety” of E. dabanensis, based of a
single specimen taken at Provideniya Bay (NE Chukotka). From the original descrip-
tion alone it is impossible to decide to which species of the E. dabanensis complex this
taxon should belong. Unfortunately, the first author (A.B.) has not yet found the type
Nota lepid. 25 (1): 61-78 69
oe”
pe aig oO” me o*
of eee m m. LA
Fig. 3. E. dabanensis, male, left valva, lateral view. Russia, Chita region, Kyra district, Sokhondo Mts., ca.
67 km WNW of village Kyra, upper stream of Bukukun river, 1990-2025 m, 18.VI.1999, A.G. Belik leg.
AAA |
a = — ne —_
Fig. 4. E. youngi, male, left valva, lateral view. Russia, NE. Chukotka, 20 km SE of lake Ioni, valley of
Gil’miml’veem river, 22.VII.1998, D.G. Zamolodchikov leg.
70 BELIK & ZAMOLODCHIKOV: Systematics of the Erebia dabanensis species complex
Fig. 5. E. youngi, male, left valva, lateral view. Canada, Yukon Territory, Nickel Creek, 4200 ft.,
28.V1.1987, M.L. Grinnell leg.
specimen of E. dabanensis tschuktscha in the collections of Zoological Institute of the
Russian Academy of Sciences (St. Petersburg) where it should be deposited.
2. E. anyuica Kurentzov, 1966 and Erebia occulta Roos & Kimmich, 1983 (= phellea
Philip & Troubridge, 1983).
2.1. Introduction
Our discovery in NE Chukotka is the first proven record of the putatively endemic
Nearctic species E. occulta for the Palaearctic region. All previous literature records
of E. occulta from the Palaearctic in fact referred to E. anyuica Kurentzov, 1966 (=
anyuka, anjuika, anjuica auct.) (Troubridge & Philip 1983; Tuzov 1993; Korshunov &
Gorbunov 1995; Korshunov 1996; Tuzov et al. 1997; Streltzov 1998; Korb 1999).
And otherwise, all recent records of E. anyuica from the Nearctic referred to E. occulta
(Layberry et al. 1998). All these records were based on the misinterpretation (or, on
the lack of the sufficient proof) of the fact that E. occulta and E. anyuica are two
separate species. In the present article, arguments are presented to support that E. occulta
and E. anyuica are two different species.
E. phellea Philip & Troubridge, 1983 is a junior subjective synonym of E. occulta
Roos & Kimmich, 1983 (Philip & Roos 1985). Korb’s statement (1999), according to
which Dubatolov (1992) synonymized E. phellea with E. occulta, is not true. Dubatolov
(1992) placed E. occulta into the synonymy of E. anyuica, indeed. A further statement
of Korb (Joc. cit.) that E. phellea is a separate species, which occurs sympatrically
Nota lepid. 25 (1): 61-78 WA
with E. anyuica and E. occulta at the same locality (sic!) near Magadan, is absolutely
wrong. This author apparently was unaware of the individual variability both in the
male genitalia structure and in the wing pattern and coloration. Moreover, he states
that in E. phellea the valva were more than two times wider than the aedeagus, while in
E. occulta the valva were of the same width as the aedeagus. On the figure of the male
genitalia of E. phellea Korb refers to (Korb, 1999:1369, Fig. 2), it is obvious that the
valva merely is flattened, the membrane of the interior side of the valva is spread, thus
the valva looks so wide in the dorsoventral aspect.
The use of the name E. anyuica Kurentzov, 1966 constitutes a serious nomenclatural
problem (Belik 1996). Though the solution of this problem is beyond the scope of the
present paper, some comments are necessary here. The name was often attributed to
some Palaearctic butterflies belonging to the Erebia magdalena species complex
(Kogure & Iwamoto 1992; Tuzov 1993; Korshunov & Gorbunov 1995). There was
also an attempt to apply the name FE. jakuta Dubatolov, 1992 (E. anyuica jakuta
Dubatolov, 1992 in the original combination) to the Palaearctic species previously
considered as E. occulta (Korshunov 1998). We suggest that the name E. anyuica
Kurentzov, 1966 should be used exclusively for the Palaearctic species that previously
was considered as E. occulta. This is necessary for the stability of the nomenclature
and to finish the permanent confusion derived from the application of the name to
butterflies belonging to very different species groups of the genus Erebia Dalman,
1816. A thorough investigation of Kurentzov’s collection (deposited at the Institute of
Biology and Pedology of the Russian Academy of Sciences, Vladivostok) should be
undertaken to find out if there are left any remains of the single type specimen (holotype
by monotypy) of E. anyuica, which specimen is presumed to be lost (Azarova 1986).
The recent designation of a neotype of E. anyuica (Korb 1999) must be considered
as premature and invalid. It does not meet the requirement of ICZN, which allow a
designation of a neotype: ICZN (1999) Art. 75.3.4. Korb’s reasons for believing the
holotype is lost are based exclusively on the report of Azarova (1986). Korb did not
take any steps to reinvestigate Kurentzov’s collection to trace the holotype. Mean-
while, there exists a specimen in Kurentzov’s collection (quite worn, without abdo-
men, as the genitalia were presumably dissected, and with no type label), which could
be the holotype of E. anyuica (Yu. Chistyakov, pers. comm.). Further, there exists a
separate stock of genitalia preparations in Kurentzov’s collection, where the genitalia
of the holotype could be stored (V. Dubatolov, pers. comm.). Yet, nobody has checked
this storage with the special aim to find the genitalia of E. anyuica. At last, though
Korb states “the neotype is forwarded to Zoological Institute of Russian Academy of
Sciences (St.-Petersburg)” (Korb 1999), he did not forward it there in fact, so far (A.
Lvovsky, pers. comm.).
2.2. Material examined and methods
193 Canada, Yukon Territory, Richardson Mts., Dempster Hwy., km 416-466; 4d Russia, NE Chukotka,
20 km SE of lake Ioni, valley of Gil’mimleveyem river; 24 Russia, NW Chukotka, Bilibino district: ca.
10 km NW of Bilibino; 14 Anyuyskiy mtn. range, vic. of Stadukhino; 12d Russia, Magadan region,
Khasyn district, vicinity of Palatka; 1d Russia, Sakha-Yakutiya republic: Oymyakon district, ca. 58 km
12 BELIK & ZAMOLODCHIKOV: Systematics of the Erebia dabanensis species complex
WSW of Oymyakon, at the confluence of Suntar and Agayakan rivers; 48 Tompo district, ca. 180 km
ENE of Khandyga, Suntar-Khayata mtn. range, upper stream of Khandyga river; 116 Russia, Chita
region, Udokanskiy mtn. range, 20-26 km SE of Udokan, upper stream of Naminga river; 104 Russia,
Chita region, Kyra district, ca. 67 km WNW of village Kyra, Sokhondo Mts., upper stream of Bukukun
river; 10d Russia, Buryat republic, East Sayan Mts., Kitoyskiye Gol’tsy mtn. range, between the sources
of Irkut and Kitoy rivers, vicinity of Il’chir lake.
When studying the male genitalia of E. anyuica and E. occulta, we noticed that in E.
anyuica the spined ridge of the valvae is relatively shorter than in E. occulta. So, we
initially used the method of Troubridge & Philip (1983) to compare the length of the
spined ridge of the valvae (in male genitalia) expressed in per cent of the length of the
costal edge of the valvae (Fig. 1). Statistical comparisons of E. anyuica and E. occulta
populations were performed as described above using f-tests and a cluster analysis
(see chapter 1.2.).
2.3. Results
Troubridge & Philip (1983) demonstrated that in E. occulta the length of the spined
ridge of the valvae, expressed in percents of the total length of the costal edge of the
valvae averages 67.2 % (range 62-72 %). However, these authors were unaware of the
possible specific independence of the Palaearctic butterflies that they considered as E.
occulta, too. Their measurements of the valvae of both the Nearctic and Palaearctic
specimens are mixed together in the published value (K. Philip, pers. comm.). So,
from the mentioned work nothing can be taken as to possible differences between E.
occulta and E. anyuica. Later it was stated, without any sufficient proof, that the dif-
ference of the male genitalia of E. occulta from the male genitalia of “E. jakuta” is “so
noticeable that there is no need for explanations” (Korshunov 1998).
Thus, our aims were as follows. First, to determine if there are some stable differ-
ences between the male genitalia of E. occulta and E. anyuica, which could be used for
the sure diagnosis of the Palaearctic specimens. Second, to check the possible exist-
ence of a cline toward E. occulta throughout the area of the distribution of £. anyuica.
The data presented in the Table 3 demonstrate clearly that the length of the spined
ridge of the valva can be used as a good taxonomic character to differentiate E. occulta
from E. anyuica in most cases. There is no noticeable cline leading from the West to
the East from E. anyuica to E. occulta throughout the huge range of E. anyuica, span-
ning about 3750 km between the known westernmost (E Sayan) and easternmost (NW
Chukotka) populations of E. anyuica. The length of the spiny ridge of the valva is
almost constant throughout the range of the species (Table 3). At the same time, the
distance between the known easternmost population of E. anyuica at NW Chukotka
and the newly discovered population of E. occulta at NE Chukotka is just about 860
km. However, there is a clear difference in the length of the spined ridge of the valvae
between these populations. Statistical analyses of data on relative lengths of the spined
ridge of valvae (Table 4) demonstrates that the differences in means between populations
of E. anyuica and E. occulta are significant without exceptions. This leaves no doubt
that E. anyuica and E. occulta should be considered as separate species.
Further, we tried to find more parameters to separate E. anyuica and E. occulta.
First, we noticed that in E. anyuica the whole valvae are relatively shorter than in E.
73
Nota lepid. 25 (1): 61-78
DIINAUD
100°0> 100°0> 4
DIINAUD
100°0> 100°0> | IPXIEQSUEIL § 4
[eyIeqsuei] | voimaAup
100°0> 100°0> AN 4
DIINAUD
100°0> 100°0> ALL LP a
UOIGAI DIINAUD
100°0> 100°0> uepeseN ‘4
DIINAUD
4
‘pjoqg ur poyurıd oe ([0'0>d) sP9U212 IP Juesipiusig 'Doındun 7 pue D1]n990
‘4 JO suonejndod paururex9 us9MjOq (eIfejIusd TRU ur) OBATVA dU} JO 98pli pourds oy} Jo YISUI] 2ANEIOI ur SOOUQIOJJIP JO SISYY-I JUOPNIS JO SINSOY ‘p 2IQUL
74 BELIK & ZAMOLODCHIKOV: Systematics of the Erebia dabanensis species complex
Yukon
NE Chukotka
NW Chukotka
Magadan region
Yakutia
NE Transbaikal
E Sayan
S Transbaikal
| —
0 0.5 I ES 2 25
7 Linkage distance
nd
Fig. 6. Phenetic cluster diagram of E. occulta and E. anyuica populations from different localities (three
variables, Euclidean distance, single linkage).
occulta, if body size of the butterflies (measured as forewing length) is controlled for.
There is one more difference between the male genitalia of E. occulta and E. anyuica
that was never mentioned in the literature before. We noticed that in the Nearctic speci-
mens of E. occulta the dorsal edge of the spined ridge of the valva almost always
forms an obtuse angle with the remaining spineless part of the dorsal edge of the valva
(Fig. 9). In contrast, in E. anyuica the dorsal edge of the spined ridge of the valva
almost always runs in parallel with the spineless part of the dorsal edge of the valva
(Fig. 7).
Differences in wing pattern and coloration support the idea about the specific dis-
tinctness of E. occulta and E. anyuica. This is especially well seen in males. Through-
out the range of E. anyuica from E Sayan to NW Chukotka there is a cline in the degree
of the development of the fulvous submarginal elements in the forewings. Thus, the
most developed fulvous ocelli that often are united in an almost uninterrupted band
(on the upperside) and the most developed and wide submarginal band (on the under-
side) occur in specimens from the western part of the range (Belik 1996: 160, pl. 1,
figs. 1-8). In specimens from the eastern part of the species range all these submar-
ginal pattern elements are strongly reduced (Tuzov et al. 1997: 359, pl. 49, figs. 25—
27). At the easternmost limit of the species range (NW Chukotka: Bilibino district),
these submarginal pattern elements are practically absent at all, both on the upper- and
underside of the fore- and hindwings. Thus, the specimens (only a few males are known)
look totally black, sometimes with almost invisible traces of the submarginal spots on
the forewings.
In the specimens of E. occulta from NE Chukotka, in contrast, the fulvous submar-
ginal elements on the forewings are normally developed, with the same range of vari-
Nota lepid. 25 (1): 61-78 75
-
Fig. 7. E. anyuica, male, left valva, lateral view. Russia, Chita region, Udokanskiy mtn. range, 23 km SE
of Udokan, upper stream of Naminga river, 1405 m, 16.VII.1998, A.G. Belik leg.
Fig. 8. E. occulta, male, left valva, lateral view. Russia, NE. Chukotka, 20 km SE of lake loni, valley of
Gil’miml’veem river, 400 m, 12.VII.1998, D.G. Zamolodchikov leg.
ations as in specimens of E. occulta from North America. If a cline were to exist from
E. anyuica to E. occulta in the Palaearctic, then we would expect to see a gradual
transition in the wing pattern and coloration from one form into the other. This is
definitely not the case.
Finally, any male specimen of E. occulta can be distinguished, more or less easily,
from any male specimen of E. anyuica by the appearance of the hindwing underside.
In E. occulta, the general appearance of the hindwing underside looks as more or less
mottled with some dark grey cast. This is due to light hair-like scales (white to creamy
tan) covering the surface and to the high proportion of pearl grey scales across the
76 BELIK & ZAMOLODCHIKOV: Systematics of the Erebia dabanensis species complex
entire wing. In E. anyuica the general appearance of the hindwing underside is much
more monotonous, sooty blackish-brown or black. The hairs covering the surface of
the wing are dark (brown to black) and pearl grey scales are absent.
The phenogram resulting from the cluster analysis (Fig. 6) clearly demonstrates
that all examined populations split into two main groups. In one group are united all
the Palaearctic populations from E Sayan to NW Chukotka, in the other group are
united the Palaearctic population of NE Chukotka and the Nearctic ones from the Yu-
kon Territory. This supports well the hypothesis of specific distinctness of E. anyuica
and F. occulta. That the populations of E. anyuica look quite heterogeneously is not
much surprising, taking into account its huge range across ca. 3750 km, from E Sayan
to NW Chukotka, where E. anyuica forms a number of subspecies.
2.4. Conclusion
Summarising all preceding evidence, we conclude that Æ. occulta is a bona species,
separated morphologically from its close relative E. anyuica. Further investigations in
the interior regions of the Chukotka should reveal whether there is some natural bound-
ary between E. anyuica and E. occulta, or whether there is some narrow intermediate
zone where these two species could occur in sympatry. We have some hints that E.
occulta is distributed throughout the whole Chukotskiy Peninsula. First, K. Philip re-
ported (pers. comm.) that in the collection of the Alaska Lepidoptera Survey there is a
series of specimens from the mouth of Cheutakan river (65° 38-39' N, 176° 51' W).
These specimens look almost like Seward Peninsula (Alaska) material, instead of re-
sembling the rather distinct form from the Magadan region, which in fact is E. anyuica.
Second, the specimen of “E. tundra” from Egvekinot (ca. 250 km NW from the mouth
of Cheutakan river), figured by Kogure & Iwamoto (1993), likely belongs to E. occulta,
but the exact determination is impossible without checking both the wing underside
and the structure of male genitalia.
At present, we cannot judge about the subspecific status of the NE Chukotkian
population of E. occulta with full certainty (because of the low number of available
specimens). There is the good probability that it belongs to the nominotypical subspe-
cies. Troubridge & Philip (1983) demonstrated that in North America the variation
from the Richardson Mts. (Canada: Yukon) to the Seward Peninsula (USA: Alaska)
does not warrant naming the extremes as subspecies. Specimens from NE Chukotka
are quite similar to those we have from Yukon for comparison. On the other hand, in
some specimens of E. occulta from NE Chukotka the shape of the valvae in the male
genitalia is quite different from that of E. occulta from Yukon (cf. Fig.8 with Fig. 9). In
the Chukotkian specimens occurs a tendency to complete reduction of the heel-like
projection in the distal part of the spined ridge of the valvae, while the spined ridge
itself is longer than in Nearctic specimens and runs in parallel to the costal edge of the
valva. This might even be used as morphological argument for a separation of the
Chukotkian populations of E. occulta as a distinct species, but such an action is abso-
lutely premature. We have studied male genitalia of but four specimens from NE
Chukotka. Moreover, we had no specimens of E. occulta from Alaska to study the
Nota lepid. 25 (1): 61-78 77
Fig. 9. E. occulta, male, left valva, lateral view. Canada, Yukon Territory, Richardson Mts., Dempster
Hwy., km 466, 3400 ft., 18.V1.1993, M.L. Grinnell leg.
variation in the male genitalia in that part of its range, which is closest to Chukotka.
More material of E. occulta from Chukotka should first be studied to clarify the range
of its variation there. Finally, it should be emphasized that our findings of E. occulta
and £. youngi in Chukotka, the first records of these putatively Nearctic species from
the entire Palaearctic region, add two further cases to the growing list of species with
trans-Beringian ranges.
Acknowledgements
We wish to thank all the persons who kindly assisted in our work. For reports of important unpublished
information, we thank Dr. P. I. Beda (Moscow, Russia), Dr. Yu. A. Chistyakov (Vladivostok, Russia),
Dr. V. V. Dubatolov (Novosibirsk, Russia), Dr. A. L. Lvovsky (St.-Petersburg, Russia), Dr. K. W. Philip
(Fairbanks, USA), Mr. J. T. Troubridge (Langley, Canada). For the grant of important comparative ma-
terials from the Magadan region, as well as for his help to A. Belik to get to NW. Chukotka, we are very
grateful to Mr. V. V. Baglikov (Palatka, Russia). For the most warm and friendly logistic support during
the expedition of A. Belik to NW Chukotka, we are indebted to Mr. V. A. Tsyb (Bilibino, Russia). The
material from NE Chukotka was collected during the complex ecological expedition, sponsored by Re-
search Institute of Innovative Technologies for the Earth (Kyoto, Japan). The logistic support of the
latter expedition by Mr. L. M. Danilov (Lorino, Russia) is greatly appreciated. For the long-standing
great help in providing us with many important foreign literature sources our special thanks are ad-
dressed to Mr. John B. O’Dell (St.Albans, England) and Mr. Willy De Prins (Antwerp, Belgium); to Mr.
Kuniomi Matsumoto (Tokyo, Japan) for his most friendly help with Japanese literature sources and for
very useful translations of them into English; to Dr. K. W. Philip (Fairbanks, USA) for granting the book
“The butterflies of Canada”.
References
Azarova, N. A., 1986. A. I. Kurentzov’s type material of Rhopalocera (Lepidoptera) in the collection of
Institute of Biology and Pedology. — /n: Ler P. I. & V. S. Kononenko (Eds.), Systematics and ecology
of Lepidoptera in the Far East of USSR. — Vladivostok, pp. 121-128 [in Russian].
Belik, A. G. 1996. New subspecies of Erebia anyuica Kurentzov, 1966 and Clossiana erda (Christoph, 1893)
from the Vostochnyy Sayan mountains, Russia (Lepidoptera: Nymphalidae). — Phegea 24 (4): 157-166.
Belik, A. G. (in press). Notes on taxonomy and geographical distribution of Erebia dabanensis and
Erebia fletcheri (Lepidoptera: Satyridae), with the description of two new subspecies from the South
Transbaikal, Russia. — Atalanta.
dos Passos, C. F. 1972. Designation of a lectotype for E. youngi Holland. — Ent. Rec. 84: 238-241.
78 BELIK & ZAMOLODCHIKOV: Systematics of the Erebia dabanensis species complex
Dubatolov, V. V. 1992. New subspecies of Nymphalidae and Satyridae (Lepidoptera, Rhopalocera) from
Yakutia. — Vestnik Zoologii 6: 40-45 [in Russian].
Herz, O. 1903. Beitrag zur Kenntniss der Lepidopterenfauna der Tschuktschen-Halbinsel. — Ann. Mus.
Zool. Acad. Sci. St.-Petersburg 8: 14-16.
ICZN 1999. International Code of Zoological Nomenclature. Fourth edition. — The International Trust
for Zoological Nomenclature, London. Pp. i-xxx, 1-306.
Kogure, M. & Iwamoto, Y. 1992. Illustrated catalogue of the genus Evebia in color. — Yadoriga 150: 2-33
[in Japanese].
Kogure, M. & Iwamoto, Y. 1993. Illustrated catalogue of the genus Erebia in color (II). — Yadoriga 154:
2-38 [in Japanese].
Korb, S. K. 1999. On taxonomy of Erebia anyuica (Lepidoptera, Satyridae). — Zool. J. Mosc. 78 (11):1368—
1370. [in Russian].
Korshunov, Yu. P. 1972. Catalogue of Rhopalocera (Lepidoptera) from the USSR. — Ent. Obozr. 51 (1):
136-154. [in Russian].
Korshunov, Yu. P. & P. Yu. Gorbunov 1995. [Butterflies of the Asian part of Russia.] — Ekaterinburg,
1995, 202 p. [in Russian].
Korshunov, Yu. P. 1996. [Addenda and corrigenda to the book “Butterflies of the Asian part of Russia”.]
— Novosibirsk, 1996, 66 p. [in Russian].
Korshunov, Yu.P. 1998. [New descriptions and specifications to the book “Butterflies of the Asian part of
Russia”.] — Novosibirsk, 1998, 70 p. [in Russian].
Kurentzov, A. I. 1966. New forms of the family Satyridae (Lepidoptera) in the fauna of the Far East. —
In: Cherepanow, A. I. (Ed.). New species of fauna of Siberia and ajoining region. Novosibirsk, 34—
38 [in Russian].
Kurentzov, A. I. 1970. The butterflies of the Far East USSR. — Leningrad, Nauka, 164 p., 14 pl. [in
Russian].
Layberry, R. A., Hall, P. W., & Lafontaine, J. D. 1998. The butterflies of Canada. — Toronto, Buffalo,
London. Univ. Toronto Press Inc., 280 p., 32 pl.
Philip, K. W. & Roos, P. 1985. Notes on Erebia occulta (Lepidoptera, Satyridae). — J. Res. Lepid. 24 (1):
81-82.
Roos, P. & Kimmich, H. P. 1983. Eine neue Art der Erebia alberganus- Gruppe aus Nordkanada (Lep.:
Satyridae). — Ent. Z: 93 (6): 69-77.
Scott, J. A. 1986. The butterflies ofNorth America. A Karl history and field guide. — Stanford, California,
Stanford University Press, 583 p., 64 pl.
StatSoft 1995. STATISTICA 5.0 for Windows. — StatSoft Inc., Tulsa, Oklahoma.
Streltzov, A.N. 1998. A new subspecies of Erebia occulta Roos et Kimmich, 1983 (Lepidoptera, Satyridae)
from North-Eastern Transbaikalia. — Far Eastern Entomologist 53: 14.
Troubridge, J. T. & Philip, K. W. 1983. A review of the Erebia dabanensis complex (Lepidoptera:
Satyridae), with descriptions of two new species. — J. Res. Lepid. 21 (2): 107-146.
Tuzov, V. K. 1993. The synonymic list of butterflies from the ex-USSR. — Moscow, Rosagroservice,
1993243):
Tuzov, V. K. 1995. Notes on the butterflies of West Chukotka (Lepidoptera, Rhopalocera). — Actias 2 ( 1-
2): 105-109.
Tuzov, V. K., Bogdanov, P. V., Devyatkin, A. L., Kaabak, L. V., Korolev, V. A., Murzin, V. S., Samodurov,
G. D., Tarasov, E. A. 1997. Guide to the butterflies of Russia and adjacent territories (Lepidoptera,
Rhopalocera). Vol. 1. Hesperiidae, Papilionidae, Pieridae, Satyridae. — Sofia & Moscow, Pensoft,
480 p., 79 pl.
Tuzov, V. K., Bogdanov, P. V., Devyatkin, A. L., Kaabak, L. V., Korolev, V. A., Murzin, V. S., Samodurov,
G. D., Tarasov, E. A. 2000. Guide to the butterflies of Russia and adjacent territories (Lepidoptera,
Rhopalocera). Vol. 2. Nymphalidae, Danaidae, Lycaenidae, Riodinidae. — Sofia & Moscow, Pensoft,
580 p., 88 pl.
Warren, B. C. S. 1936. Monograph of the genus Erebia. — London, Adlard and Son Ltd., VI+407 p., 104 pl.
Warren, B. C. S. 1969. Notes on three little-known species of the alberganus-group of the genus Erebia.
— Ent. Rec. 81: 201-203
Warren, B. C. S. 1981. Supplement to en: of the genus Erebia. — E. W. Classey Ltd., 17 p.
Book Review
PETER HUEMER 2001. Rote Liste gefährdeter Schmetterlinge Vorarlbergs. Vorarlberger
Naturschau im Auftrag der Vorarlberger Landesregierung, Dornbirn. Pp.1-112, 1 CD-ROM.
ISBN 3-902271-00-0. Price € 15.00. [in German]. To be ordered from: Vorarlberger Naturschau,
Marktstr. 33, A-6850 Dornbirn, Austria.
Red Data Books document the degree of threats to species and thus provide important
information for officials, landscape planners, conservationists and others. More than 1500 Red
Data Books have been published in the German speaking countries until 1998. Most of them
99 66
are simple lists with species names placed in one of the categories “regionally extinct”, “critically
endangered”, “endangered”, “vulnerable”, “near threatened”, and “least concern’. Moreover,
to a large extent these lists are a matter of very subjective concern, since the authors show no
data to underpin why they place a given species in a particular category. It is therefore not
surprising that many of those categorised species became known to be misplaced, e.g. “extinct”
species subsequently turned out not to be infrequent, whereas others became known to be
much more rare than originally thought. Such circumstances are found the more frequently the
less studied a taxonomic group is. It is therefore not surprising that the value of Red Data
Books is often critically debated. However, there should be a tool available providing efficient
information on which animals need more attention than others in nature conservation. Peter
Huemer has now shown how to write a Red Data Book in an understandable manner. Based on
comprehensive data received from collections, publications, databases and own field work he
analysed the occurrence of all the 2307 species of Lepidoptera currently known to occur in the
Austrian province of Vorarlberg. Additionally to the categories mentioned above, Huemer adds
the two categories “data deficient” and “not evaluated” as well as a list of misidentifications
and erroneously recorded species. Explanations are given of how the author defines each
category, why each species was placed in it and how urgent the need is for active protection.
For some species a map with distribution records from Vorarlberg is included, accompanied by
colour photographs. Analysing the quantitative data of species records and their habitats, Huemer
shows a significant correlation of species decline by intensification of land use, e. g. in urban
settlement or agriculture. The legal situation for conservation with a particular emphasis of
species of the fauna-flora-habitat directive of the EU is discussed and regional and national
responsibilities and action requirements for conservation are shown. A list of references and a
bibliography of the Lepidoptera from Vorarlberg conclude the work. A very useful and important
tool of this Red Data Book is the enclosed CD-ROM. For each species, the status within the
Red Data Book is given together with quite detailed information on their habitat, vertical
distribution, and larval habits. This table makes the entire Red Data Book understandable and
may function as a basic tool for forthcoming Red Data Books on Lepidoptera. The Red Data
Book of the Lepidoptera from Vorarlberg may be called a successful step in developing intelligent
tools for the protection of these animals. Surely, it is not the final quality we want to have.
Peter Huemer analysed more than 85.000 data records, the bibliography of the Lepidoptera
from Vorarlberg and all its important collections, but for as many as 269 species data remain
deficient. Yet it is rather common in entomology that too few specialists have to deal with too
many species. Peter Huemer’s Red Data List can be regarded as a land-mark step in the right
direction.
MATTHIAS Nuss
fs
14
“ \
: 4
F N L
A
x 7 Fi
}
\ £ =
= 5
N PA =
Ne
=~ %
(4 = 4
=
tf
\
i
\ 7
a N
\
€ ’
|
yy A FR
\ AU) ;
) a om
4 ‘ i 1 \
| { ye
| ~ \ 1
Ê
ie A
1
| a :
|
| 5
À à
| res
(2 - af
= A 4
&
= \ A *
y N?
| = À
| {|
|
| }
(l
—— à }
| f
I (
= u q
| n Pr
Ir h “ 7
Be DS
re 4
| 4
fe ' ÿ =
ij | We
|
| | 5 sé:
| 8 |
i" +
| ew ie N M
1 sl
“
Lae ay - j
A i
N Ri je { pe I
1 UT
} | a q
% ,
by = 4
Ÿ Je an fhe it ) |
= = Eloi der! | '
A { ; cari eae were Has‘
nf Be ee re
‘ a) Ds FTP TO tea ge ta uF
; ra re pk ne Au:
f | LE ar |
i 4 = "+ 7 oe
_ » 5 . Lint Ky à À (| u
4 3 a ce Cte} tuile 4
iv IS veste id a | | … | ‘
Aw tah > ear ° % wer ut rer” ET vai eu HS > à
- LA e = ur f'
\
Nota lepid. 25 (1): 81-84 81
Chazara persephone (Hubner, [1805]) or Chazara anthe
(Hoffmansegg, 1806) — what is the valid name? (Nymphalidae,
Satyrinae)
SIGBERT WAGENER
Dr. P. Sigbert Wagener, Roßbachstraße 41, D-46149 Oberhausen, Germany. e-mail:
In all his publications, Kogak (for example 1982: 166; 2001: 6; see also
Lukhtanov & Lukhtanov 1994) used the name anthe Hoffmansegg, 1804 [note
the year of publication! ] for the taxon in question. As this is in contradiction to
most other authors who used the name anthe Ochsenheimer, 1807 or persephone
Hubner, 1803 (e.g. Gaede 1931: 116; Wyatt & Omoto 1981) or persephone
Hübner, [1805] (Karsholt & Razowski 1996), the author of this note tried to
establish which name really is the valid one according to the most actual ver-
sion of the International Code of Zoological Nomenclature (ICZN 1999).
The history of the relevant species-group names is as follows:
Fabricius (1793) introduced in his Entomologia systematica III(1): 174 the
name Papilio persiphone for a butterfly taxon from tropical Africa. This name
is currently understood as a junior subjective synonym, and the species in ques-
tion is known in the combination Acraea egina egina (Cramer, [1775]) (see
Ackery et al. 1995: 236).
Hübner ([1805]) in his Sammlung europäischer Schmetterlinge, pl. 115, figs.
589-590, figured under the name Papilio persephone a Palaearctic butterfly spe-
cies currently known in the combination Chazara persephone (Nymphalidae:
Satyrinae). In the text volume to his Sammlung europdischer Schmetterlinge
the paragraph relevant to this species appeared (on p. 21) one year later [1806].
Therein Hübner names “Rußland, bey Sarepta” as the type locality and remarks:
“Aus der Sammlung des Hrn. Büringer in Gunzenhausen.” This is the species
dealt with here.
Esper ([1805]) in the Supplementband der Europäischen Schmetterlinge 2:
21, again published the same name Papilio persephone for a taxon today placed
in the genus Erebia Dalman, 1816 (Nymphalidae: Satyrinae) from the Western
Alps. According to Hemming (1937), Hübner’s plate 115 with persephone came
out before the end of 1805. As no exact publication date exists for persephone
Esper, 1805 (Poche 1938: 19) one has to take 31.xii.1805 as its publication date
according to ICZN, Article 21. Therefore the name Papilio persephone Esper is
a primary homonym of Papilio persephone Hübner.
© Nota lepidopterologica, 01.08.2002, ISSN 0342-7536
82 | WAGENER: Chazara persephone (Hübner, [1805])
Hoffmansegg (1806), in his Erster Nachtrag zu seinem Alphabetischem
Verzeichnisse von Hübner 's Papilionen wrote (on p. 182) with reference to the
species in question: “Persephone. T. 115. F. 589. 590. * Anthe Bober. Böber hat
diesen Schmetterling in Süd Russland entdekkt, und ihn Anthe genannt. Dieser
Name bleibt ihm mit desto mehr Recht, da der Hübnerische wegen Collision
mit Persephone Fab. ohnehin nicht anzunehmen wäre.” This is all of the text in
Hoffmansegg’s work pertinent to persephone.
In view of these facts it remains to ascertain: (1) The taxon described by
Fabricius, 1793 was not naıned Papilio persephone but persiphone. (2) Papilio
persiphone Fabricius, 1793 and Papilio persephone Hübner, [1805] are not pri-
mary homonyms (ICZN, Article 57.6: one-letter dıfference). (3) The asterisk
(*) preceding “Anthe Böber” in the above cited text means according to
Hoffmansegg (1804: 182) -that this is “der Name, der den übrigen vorgezogen
werden muß” [translated: “... the name that must be preferred over the others”].
Johann de Boeber (7 1820 in St. Petersburg) collected insects in South Russia
(Horn & Kahle 1937: 321). (4) There 1s no reason to presume, that Boeber him-
self described and published the name anthe (cf. Horn & Schenkling 1928: 92).
Instead, he merely gave the discovered new butterfly an informal name as it was
the use of collectors at that time when mailing material to other persons. (5) In
merely adopting the informal name suggested by Boeber, the real author of the
name anthe is Hoffmansegg, 1806 in the sense of the Code. (6) One could as-
sume that Fabricius (1793) made an inadvertent error (lapsus calami) (ICZN,
Article 32.5.1) in writing persiphone instead of persephone. Persephone is the
Greek name of the Roman Proserpina (Heinichen 1931: 428). Since the deriva-
tion of the name is doubtless on etymological grounds, according to ICZN, Ar-
ticle 19.2 indeed Papilio persephone Fabricius, 1793 could be the oldest avail-
able name (justified emendation). But this is not the case. There is no clear
evidence of an incorrect original spelling as it is required by ICZN, Article 32.5.
In the text of Fabricius (1793) the name persiphone appears twice and no de-
monstrably intentional change in the original spelling (ICZN, Article 33.2.1) is
to find in Fabricius’ own work. Therefore, Papilio persephone Fabricius, 1793
can not be deemed as a justified emendation; it is an unjustified emendation and
incorrect subsequent spelling (ICZN, Article 33.3) of Hoffmansegg (1806) and
subsequent authors. (7) From the text of Hoffmansegg (1806) can not be con-
cluded without doubt that he wished to introduce the name anthe as a replace-
ment name for persephone Hiibner, [1805]. The type material came from differ-
ent sources: Papilio persephone Hübner from Büringer, anthe Hoffmansegg
from Boeber. Therefore anthe Hoffmansegg, 1806 can not be deemed as an
replacement name and not as an objective synonym, but only as a junior subjec-
tive synonym of Papilio persephone Hubner, [1805].
Nota lepid. 25 (1): 81-84 83
Subsequently, Ochsenheimer (1807: 169) used the name anthe with reference
He Hübner Pap. Tab 115, fig. 589, 590, Text S. 21. P Persephone” and to
Hoffmansegg in “Illiger, Mag. V. ... S. 182”, following the opinion of the latter.
Neglecting these references to Hubner and Hoffmansegg, many authors during
the 19" and early 20" century, especially of German language, incorrectly used
the name anthe Ochsenheimer, 1807 whilst in the same time period most au-
thors of English language correctly used the name persephone Hubner, but com-
bining it with 1803 as publication year.
Kocak (1982) and Lukhtanov & Lukhtanov (1994) in their publications are in
error combining the name anthe Hoffmansegg with 1804 as the year of publica-
tion, because Hoffmansegg (1804) in his Alphabetisches Verzeichniss zu J.
Hübner 's Abbildungen der Papilionen ... nowhere mentions the name anthe.
From these investigations the following synonymic list results:
Papilio persephone auctorum: Incorrect subsequent spelling of the name
Papilio persiphone Fabricius, 1793 (cf. Hoffmansegg 1806; Ackery et al.
E95).
Papilio persephone Hübner, [1805]: The oldest available name for the taxon
currently known as Chazara persephone.
Papilio persephone Esper, [1805]: Junior primary homonym of Papilio
persephone Hubner, [1805].
Papilio anthe Hoffmansegg, 1806: Junior subjective synonym of Papilio
persephone Hubner, [1805].
Papilio anthe Ochsenheimer, 1807: Error of subsequent authors in the attribu-
tion of author to the name Papilio anthe Hoffmansegg, 1806.
Papilio persephone Hübner, 1803: Unavailable name, error of subsequent au-
thors in the year of publication.
Chazara anthe Hoffmansegg, 1804: Unavailable name, error of subsequent
authors in the year of publication.
Acknowledgement
The author wishes to express his cordial thanks to Prof. Dr. Otto Kraus, Hamburg, for checking a former
proof and confirming the results as well as to Prof. Dr. Konrad Fiedler, Bayreuth, for the advice to
Ackery et al. (1995) and linguistic corrections of the manuscript, also to an unknown reviewer for some
comments.
References
Ackery, P. R., C. R. Smith & R. I. Vane-Wright (eds.) 1995. Carcasson’s African butterflies. An annotated
catalogue of the Papilionoidea and Hesperioidea of the Afrotropical region. -— CSIRO Press, East
Melbourne, Victoria, Australia. 803 pp.
84 WAGENER: Chazara persephone (Hübner, [1805])
Esper, E. J. C. [1805]-[1830]. Die Schmetterlinge in Abbildungen nach der Natur mit Beschreibungen.
— Walthers, Erlangen. Supplement, part 2: 1-48; pls. 117-126. |
Fabricius, J. C. 1793. Entomologia systematica emendata et aucta. — C. G. Proft, Fil. et Soc., Hafniae. 3
(1): VI + 488 pp.
Gaede, M. 1931. Lepidopterorum catalogus. Vol. XXIX. — W. Junk, Berlin. 759 pp.
Hemming, F. 1937. Hübner. A bibliographical and systematic account of the entomological works of
Jacob Hübner ... — Royal Entomological Society, London. Vol. 1. H-XXXTIV+1+605 pp.
Heinichen, F. A. 1931. Lateinisch-deutsches Schulwörterbuch. 10" edition. — B. G. Teubner, Leipzig and
Berlin. 648 pp. j
Hoffmansegg, J. C. v. 1804. Alphabetisches Verzeichniss zu J. Hübner’s Abbildungen der Papilionen
mit den beigefügten vorzüglichsten Synonymen. — Illiger, Mag. Insektenk. 3: 181—206.
Hoffmansegg, J. C. v. 1806. Erster Nachtrag zu des Gr. v. Hoffmansegg alphabetischem Verzeichnisse
von Hübner’s Papilionen. Nachtrag aus den seitdem erschienenen Tafeln 115, 116, 117. — Illiger,
Mag. Insektenk. 5: 181-183.
Horn, W. & S. Schenkling 1928. Index litteraturae entomologicae. Serie I: Die Welt-Literatur über die
gesamte Entomologie bis inklusive 1863. — Selbstverlag, Berlin-Dahlem. Vol. 1, 352 pp., 1 pl.
Horn, W. & I. Kahle 1937. Über entomologische Sammlungen, Entomologen & Entomo-Museologie.
Nachtrag. — Ent. Beih. Berlin-Dahlem, 4: 313-388.
Hübner, J. 1796-1827. Sammlung europäischer Schmetterlinge. — Selbstverlag, Augsburg. Pls. 1-181;
text: 1805-1823, vol. 1, 74 pp.
ICZN (International Commission on Zoological Nomenclature) 1999. International code of zoological
nomenclature. 4"" edition. — International Trust for Zoological Nomenclature London. 306 pp.
Karsholt, O. & J. Razowski 1996. The Lepidoptera of Europe. A distributional checklist. -Apollo Books,
Stenstrup. 380 pp.
Kocak, A. O. Critical checklist of European Papilionoidea (Lepidoptera). — Priamus 1 (4): 155-167.
Kocak, A. O. & M. Kemal 2001. Türkiye Kelebeklerinin Anadillerdeki I simlerinin Listesi (Papilionoidea,
Hesperioidea, Lepidoptera). — Miscellaneous Papers Nr.72/73: 1-15. CESA Ankara.
Lukhtanov, V. & A. Lukthanov 1994. Die Tagfalter Nordwestasiens. (Lepidopotera, Diurna) — Herbipoliana
3. Dr. Ulf Eitschberger, Marktleuthen. 440 pp., 56 colour plates, 19 figs., 400 distribution maps.
Ochsenheimer, F. 1807. Die Schmetterlinge von Europa. — Gerhard Fleischer dem Jüngeren, Leipzig.
1(1): 324 pp.
Poche, F. 1938. Uber den Inhalt und die Erscheinungszeit einzelner Hefte, die bibliographische Anord-
nung und die verschiedenen Ausgaben von E. J. C. Esper, Die Schmetterlinge in Abbildungen nach
der Natur mit Beschreibungen. — Festschrift zum 60. Geburtstage von Prof. Dr. Embrik Strand. Riga.
Band 4 (1937): 1-37.
Wyatt, C. W. & K. Omoto 1981. Butterflies of Afghanistan. — S. Sakai, Japan. 272 pp., 197 figs., 48
colour pls. (in Japanese).
BOCIETAS EUROPAEA: LEPIDOPTEROLOGICA e. V.
Nota lepidopterologica wird den Mitgliedern der SEL zugesandt. Die Mitgliedschaft bei SEL steht
Einzelpersonen und Vereinen nach Maßgabe der Satzung offen. Der Aufnahmeantrag ist an den
Mitgliedersekretär Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgien; e-mail:
[email protected] zu richten. Das Antragsformular ist im Internet auf der Homepage
der SEL unter http://www.zmuc.dk/EntoWeb/SEL/SEL.htm erhältlich.
Der Mitgliedsbeitrag ist jährlich am Jahresanfang zu entrichten. Er beträgt für Einzelpersonen € 35,00
bzw. für Vereine € 45,00. Die Aufnahmegebühr beträgt € 2,50. Die Zahlung wird auf das SEL-Konto 1956
50 507 bei der Postbank Köln (BLZ 370 100 50) erbeten. Mitteilungen in Beitragsangelegenheiten sind an
den Schatzmeister Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail: Sommerer.Manfred@t-
online.de zu richten.
Der Verkauf von Einzelheften und älteren Jahrgängen von Nota lepidopterologica sowie der Verkauf der
Zeitschrift an Nichtmitglieder erfolgt durch Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Däne-
Adressenänderungen bitte sofort dem Mitgliedersekretär oder dem Schatzmeister mitteilen!
Nota lepidopterologica is sent to the members of SEL. The membership is open to individuals and
associations as provided for by the statutes of SEL. Applications for membership are to be addressed to
the membership secretary Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgium; e-mail:
[email protected]. The application form will be found on the SEL Homepage http://
www.zmuc.dk/EntoWeb/SEL/SEL.htm.
The annual subscription is to be paid at the beginning of the year. It is € 35.00 for individuals or € 45.00
for associations. The admission fee is € 2.50. Payments requested to SEL account no. 1956 50 507 at
Postbank Köln [Cologne] (bank code 370 100 50). In matters concerning the subscription or payments,
please contact the treasurer Manfred Sommerer, Volpinistr. 72, D-80638 Miinchen; e-mail:
Back numbers of Nota lepidopterologica may be obtained from, and orders of Nota lepidopterologica
from non-members are serviced by Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Denmark; e-
Changes of address should be immediately communicated to the Membership Secretary or the Treasurer.
Nota lepidopterologica est envoyé aux membres de la SEL. L’affiliation est possible, pour les personnes
individuelles aussi bien que pour les associations, en accord avec les statuts de la SEL. Les demandes
d’affiliation doivent être adressées au Secrétaire des Membres Willy O. De Prins, Nieuwe Donk 50, B-
2100 Antwerpen, Belgique; e-mail:
[email protected].
Le formulaire d’ affiliation est disponible par le biais de la SEL homepage http://www.zmuc.dk/EntoWeb/
SEL/SEL.htm. La contribution annuelle est payable au début de l’année. Elle est de € 35,00 pour les
personnes individuelles et de € 45,00 pour les associations. Les frais d’admission s'élèvent à € 2,50. Les
payements doivent être effectués sur le compte SEL n° 1956 50 507 auprès de la Postbank Koln
[Cologne] (code bancaire 370 100 50). Pour toutes questions en rapport à la souscription ou aux payements,
veuillez contacter le Trésorier Manfred Sommerer, Volpinistr. 72, D-80638 München, e-mail:
[email protected]. Les anciens volumes de Nota lepidopterologica peuvent être obtenus et
les commandes concernant cette revue de la part de non-membres effectuées auprès de Apollo Books,
Kirkeby Sand 19, DK-5771 Stenstrup, Danemark; e-mail: apollobooks(@vip.cybercity.dk.
Tous changements d’adresse doivent être communiqués immédiatement soit auprès du Secrétaire des
Membres, soit auprès du Trésorier.
NOTA
LEPIDOPTEROLOGICA
A journal devoted to the study of Lepidoptera
Published by Societas Europaea Lepidopterologica (SEL)
Vol. 25 No. 2/3 2002
SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e. V.
http://www.zmuc.dk/entoweb/sel/sel.htm
HONORARY MEMBERS
Pamela Gilbert (GB), Barry Goater (GB), Prof. Dr. Laszl6 Gozmany (H), Prof. Dr.
Vladimir Kuznetzov (RU), Prof. Dr. Clas M. Naumann (D), Dr. P. Sigbert Wagener (D)
À Caunch
ne am est Lo x é
Preside = Prof. Dr. Niels P. Kristensen (DK)
‘Vice-President: Dr. David Agassiz (UK)
General Secretary: Dr. Christoph L. Häuser (D)
Treasurer: | Manfred Sommerer (D)
Membership Secretary: Willy O. de Prins (B)
Ordinary Council Members: Dr. Bernard Landry (CH),
Dr. Elisenda Olivella (E), Dr. Laszlo Ronkay (H),
Dr. Gerhard Tarmann (A), Dr. Alberto Zilli (1)
Editor: Prof. Dr. Konrad Fiedler (D)
Managing Editor: Dr. Matthias Nuß (D)
Copyright © Societas Europaea Lepidopterologica (SEL)
ISSN 0342-7536
Printed by druck-zuck GmbH, Halle/Saale, Germany
All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or
mechanical including photocopying, recording or any other information storage and retrieval system, without written
permission from the publisher. Authors are responsible for the contents of their papers.
Nota lepidopterologica
A journal devoted to the study of Lepidoptera
Published by the Societas Europaea Lepidopterologica e. V.
Volume 25 No. 2/3 Halle / Saale, 15. 11. 2002 ISSN 0342-7536
Editorial Board
Editor: Prof. Dr. Konrad Fiedler, Lehrstuhl fiir Tierökologie I, Universität Bayreuth,
D-95440 Bayreuth, Germany; e-mail:
[email protected]
Managing Editor: Dr. Matthias Nuß, Staatliches Museum für Tierkunde, Königsbrücker Landstr. 159,
D-01109 Dresden, Germany; e-mail:
[email protected]
Assistant Editors: Dr. Enrique Garcia-Barros (Madrid, E), Dr. Roger L. H. Dennis (Wilmslow, UK),
Dr. Peter Huemer (Innsbruck, A), Ole Karsholt (Kobenhavn, DK), Dr. Yuri P. Nekrutenko (Kiev, UA),
Dr. Erik J. van Nieukerken (Leiden, NL), Dr.Wolfgang Speidel (Bonn), ‘
Contents ® Inhalt + Sommaire
NIEUKERKEN, E. J. v. & LASTÜVKA, A.: Ectoedemia (Etainia) obtusa
(Puplesis & Diskus, 1996) new for Europe: taxonomy, distribution and
EMMI TIBI AC) u... saisdecacdeancedboceistaranctavunannededveasneagud sata 87
Baran, T.: Elachista nolckeni Sulcs, 1992: morphology and bionomics of
es (Gelecmioidea: Elachistidae) "0... 97
HUEMER, P. & KARSHOLT, O.: A review of the genus Acompsia Hübner, 1825
D Copion Of new species (Gelechiidae) ..................cccccscsssesnnaccerecssnsccceses 109
KALLIES, A. & SPATENKA, K.: Four species of Brachodidae new to the fauna
ne ds vada ss oid so Soadonniawaacgavtcedvannsedececnune 153
GarciA-Barros, E.: Taxonomic patterns in the egg to body size allometry
of butterflies and skippers (Papilionoidea & Hesperiidae) en. 161
Ko ev, Z.: The species of Maculinea van Eecke, 1915 in Bulgaria:
distribution, state of knowledge and conservation status (Lycaenidae) ............. 177
Sommerer, M. D.: Opinion. To agree or not to agree — the question of gender
agreement in the International Code of Zoological Nomenclature 19]
ENON NG RMN MR co ofp tqs ARR AR AR SA 108, 152, 176
«= 7 ne » >
LT! E à Bi ey a
, 1 7 ie 1 pa
PP >
+
\
)
de dt An 11 ex
er go port TS .
Fi ' 5
tt mi | ij
\ ' |
| mans, j .
os ean CE ee C
+ a
5 J
tentes Tt t EN EE PRES
= _ oe
; x ; ; NE
| Be Br - ge th à y 1
7
2 a. Y
BEE
=. hd > ra 2 ws,
oo 2 PTE RC PE ee PAU | LA a
es nee i sae pce
Nota lepid. 25 (2/3): 87-95 87
Ectoedemia (Etainia) obtusa (Puplesis & Diskus, 1996) new for
Europe: taxonomy, distribution and biology (Nepticulidae)
Erik J. VAN NIEUKERKEN* & ALES LASTUVKA**
* Nationaal Natuurhistorisch Museum Naturalis, P. O. Box 9517, NL-2300 RA Leiden, The Nether-
** Slavickova 15, CZ-796 01 Prostéjov, Czech Republic
Summary. Ectoedemia (Etainia) obtusa (Puplesis & Diskus), described from Turkmenistan, is for the
first time recorded from Europe: Spain, France, Italy and Croatia. It has been reared from cocoons,
partly found on trunks of Fraxinus ornus L., which is considered to be its probable host. The female is
described here for the first time and the male redescribed and illustrated. A checklist and key of the
seven Western Palaearctic species of the subgenus are provided.
Zusammenfassung. Ectoedemia (Etainia) obtusa (Puplesis & Diskus), beschriebén aus Turkmenistan,
wird zum erstenmal aus Europa gemeldet, namentlich aus Spanien, Frankreich, Italien und Kroatien.
Die Art wurde aus Puppen gezüchtet, die teilweise auf Stämmen von Fraxinus ornus L. gefunden wurden;
diese Pflanze wird daher als die wahrscheinliche Futterpflanze angesehen. Das Weibchen wird zum
erstenmal beschrieben, und das Männchen aufs neue beschrieben und abgebildet. Eine Checkliste und
Bestimmungsschlüssel der sieben westpaläarktischen Arten der Untergattung Etaina werden angegeben
und Anmerkungen zum taxonomischen Status von Etaina gemacht.
Resume. Ectoedemia (Etainia) obtusa (Puplesis & Diskus), décrit de Turkmenistan, est rapportée de
l’Europe pour la première fois: provenant d’Espagne, France, Italie et Croatie. Quelques exemplaires
étaient élevés des cocons trouvés sur des troncs de Fraxinus ornus L.; cette plante est regardée comme
plante-hôte possible. La femelle est décrit pour la première fois, et le mâle est décrit de nouveau et figuré
en détail. Nous donnons aussi un liste des sept espèces Ouest-Paléarctiques et un table d’identification.
Key words. Lepidoptera, Nepticulidae, Ectoedemia (Etainia) obtusa, host plants, Europe.
Introduction
The nepticulid subgenus Efainia (in the genus Ectoedemia), often regarded as a sepa-
rate genus (Scoble 1983; Puplesis 1994; Puplesis & Diskus 1996) is one of the best
characterized monophyletic entities within the family, best characterized by the unique
dorsal apodeme on the valve in the male genitalia. It is also rather peculiar in its biol-
ogy, since the species are not leaf-miners, but — as far as known in the Holarctic fauna
— feed in shoots, petioles or fruits, most on Acer (Aceraceae) and one species on Arc-
tostaphylos (Ericaceae).
The four known European species were fully treated by Van Nieukerken & Johansson
(1990) and Laëtüvka & Lastuvka (1997), a fifth was described by Puplesis (1994).
Puplesis & Diskus (1996) described two further Western Palaearctic species from
Turkmenistan and provided a world checklist of the 16 known species.
The senior author received in the early nineties some specimens from southern
France and Italy which clearly did not belong to the four known European species.
Initially it was considered an undescribed species, and listed as such in the French and
Italian checklists (Karsholt er al. 1995; Leraut 1997). Later it could be identified as the
recently described Etainia obtusa Puplesis & Diskus, 1996. Since then the junior au-
thor also reared this species from cocoons, collected on trunks of Fraxinus ornus L.
Krenek (2000) beautifully illustrated one of his female specimens.
© Nota lepidopterologica, 15.11.2002, ISSN 0342-7536
88 NIEUKERKEN & LASTUVKA: Ectoedemia obtusa new for Europe
The species will be redescribed here, including the description of the unknown female
and biology. In addition we provide a revised key to Western-Palaearctic species.
Methods
Genitalia preparations were embedded in euparal, following the methods in Van
Nieukerken et al. (1990) or studied in glycerine. Photographs of genitalia were taken
by the senior author with a Zeiss AxioCam digital camera attached to a Zeiss Axioskop
H, using Carl Zeiss AxioVision 3.0.6 software. Drawings were prepared by the junior
author. Morphological terms follow Van Nieukerken ef al. (1990). The map was pre-
pared with DMAP 7.0 (Morton 2000), UTM co-ordinates were taken from French
topographical maps or calculated from the geographical co-ordinates.
Subgenus Efainia Beirne
A description of the subgenus and comments on its subgeneric position were provided
earlier (Van Nieukerken 1986; Van Nieukerken & Johansson 1990). Puplesis & Diskus
(1996) also listed the apomorphies and concluded that Etainia deserved full generic
status on the basis of many apomorphies. Although we fully agree with the monophyly
of Etainia and its long list of defining apomorphies, we consider that the rank of the
taxon is only determined by its relative position in the cladogram. Van Nieukerken
(1986) showed that Efainia most likely is the sister group of the clade Zimmermannia
Hering + Ectoedemia Busck s. str. The other subgenera Fomoria Beirne and Laqueus
Scoble branch off earlier in his cladogram. Hoare (1998) re-analysed Van Nieukerken’s
cladogram with PAUP, and was able to confirm most clades. The monophyly of Efainia,
Zimmermannia and Ectoedemia s. str. was even better supported, but no strong choice
could be made between the two alternative topologies within this branch: (Ectoedemia
(Etainia + Zimmermannia)) or (Etainia (Zimmermannia + Ectoedemia)); there was no
support for the third alternative (Zimmermannia (Etainia + Ectoedemia)). With the
present knowledge we prefer to keep Etainia as subgenus, since raising its rank imme-
diately causes the need of raising most other subgenera as well. This will cause several
tenths of name changes and new combinations, which will upset stability of nomencla-
ture. Further work to refine the cladogram is much needed.
Puplesis & Diskus (1996) consider the posterior process of the male genitalia to be
an uncus. Since we do not see a hinging point with the genital capsule or gnathos,
which normally separate the uncus, we regard this structure tentatively as a pseuduncus,
as was suggested before (Van Nieukerken 1986). The lack of the real uncus is one of
the apomorphies supporting the clade Etainia + Zimmermannia + Ectoedemia (see
above). |
Diagnosis
Etainia-species are easily recognized from other European Nepticulidae by the pres-
ence of two non-metallic white fasciae or a antemedial fascia and an additional post-
Nota lepid. 25 (2/3): 87-95 89
medial costal and dorsal spot. Only Acalyptris platani (Miiller-Rutz) has similar spots,
but is overall much paler, and the male has conspicuous widened hindwings with raised
white androconiae (Van Nieukerken & Johansson 1990). The valval apodeme in the
male genitalia is unique and also the female genitalia are rather characteristic (see
figures in Van Nieukerken & Johansson 1990; LaStüvka & Laëtüvka 1997).
Checklist of Western Palaearctic species
Ectoedemia Busck, 1907
Subgenus Evainia Beirne, 1945
Obrussa Braun, 1915 (preoccupied)
1. E. (Et.) sericopeza (Zeller, 1839) (Poland)
2. E. (Et.) louisella (Sircom, 1849) (Britain)
sphendamni (Hering, 1937) (Denmark)
3. E. (Et.) obtusa (Puplesis & Diskus, 1996) (Turkmenistan)
4. E. (Et.) biarmata (Puplesis, 1994) comb. n. (Georgia)
5. E. (Et.) decentella (Herrich-Schäffer, 1855) (Germany)
monspessulanella (Jackh, 1951) (Germany)
E. (Et.) leptognathos (Puplesis & Diskus, 1996) comb. n. (Turkmenistan)
E. (Et.) albibimaculella (Larsen, 1927) (Denmark)
Key to males on external characters
Note. E. biarmata from Abchazia in Georgia is not included, it is known from a single poorly pre-
served male. It is externally very similar to E. obtusa, but has an additional valval process in the male
genitalia (see Puplesis 1994). For other illustrations see the above mentioned books.
1. Forewing underside and hindwing upperside with conspicuous patch of black androconial
Los 2 ERO MEAS SUOMI EV CSCI 2 5c 5 sce anergsvceeee steyaasvexiytasc lature ateindeeckisndihissianseerneassaviey À
Pet nmdroconal scales absent. Basal spot present or absent 2,
2. Forewing without basal spot, dark grey; thorax uniform dark-grey ...... E. albibimaculella.
— Forewing with basal white spot; thorax posteriorly white (Fig. 1) .....................- E. obtusa.
Bra white. Frontal tuft black or yellow to brown... 4.
— Thorax black or fuscous. Frontal tuft yellow to ferrugineous E. sericopeza or E. louisella.
enr nu xaesvsovangivuinssUstanasensesbstensoraassanee E. decentella.
— Frontal tuft yellow to brown. Forewing usually with white pattern more dominant
E. leptognathos.
RRR HEHEHE HEHEHE EH EH HEHE EH EEE EH EH EEE EEE HEHEHE HEHEHE HEEH HEHEHE HEHEHE HEHEHE HEHEHE HS
Key to males on genitalia characters
Illustrations in Van Nieukerken & Johansson (1990), Puplesis (1994) and Laëtüvka & LaStuvka (1997).
The genitalia of E. obtusa, E. leptognathos and E. decentella are also illustrated here.
me jesumen produced into pseuduncus, pointed OF truncate.....ununenessünensenonnnenensnnerunsnnsennennene ER
— Tegumen rounded and wide, not or hardly produced into pseuduncus (Figs. 4, 5) .......... 5.
90
NIEUKERKEN & LASTUVKA: Ectoedemia obtusa new for Europe
Gnathos with broadly rounded central element. Valval tip broad and rounded ................ 27
Gnathos with narrow pointed central element. Valval tip broad and rounded or pointed .... 4
Genital capsule about 550-650um long. Tegumen very long and pointed. Transtilla with
sublateral arms almost as lowe as transverse ban" E. sericopeza.
Genital capsule about 410um long. Tegumen shorter, slightly truncate. Transtilla with sub-
lateral arms approximately half length of transverse bar .….............................. E. louisella.
Valval tip triangular, pointed. Pseuduncus with relatively long point... E. albibimaculella.
Valval tip broad and rounded. Pseuduncus relatively short and obtuse (Figs. 2, 3, 8)
EL Mae aod nM A EHER MEER ER cS, OUST,
Gnathos very broad, tegumen broadly rounded (Fig. 5) ..…............................… E. decentella.
Gnathos rather narrow, tegumen slightly produced (Fig. 4) ...................... E. leptognathos.
Key to females
Il
À,
Thorax completely white 2. ART ROM Ds,
Thorax brown or grey, at most with some white posteriorly and on tegulae .................... 3.
Frontal tuft black; signa very long, longest more than 500 pm... E. decentella.
Frontal tuft yellow to brown. Forewing usually with white pattern more dominant: signa
considerably shorter, longest less than 500) re eee ee E. leptognathos.
Forewing without white spot at basis; thorax uniform dark-grey ......... E. albibimaculella.
Forewing with white spot at basis; thorax with white scales on posterior tip; species only
identifiable on genitalia 1.4.4... 0 eee TE 4.
Tergite VIII with strong medial invagination of posterior margin; two difficult species, for
differences see Van Nieukerken & Johansson (1990) ............ E. sericopeza or E. louisella.
Tergite VIM with almost straight margin (Figs. GC) ee E. obtusa.
Ectoedemia (Etainia) obtusa (Puplesis & Diskus) (Figs. 1-3, 6-10)
Etainia obtusa Puplesis & Diskus, 1996: 46. Holotype 4, Turkmenistan, W. Kopet Dagh, 40 km E.
Garrygala [= Kara Kala], 800 m, [UTM 40S DH75] 26.v.1993, R. Puplesis & A. Diskus (VVPI)
[examined].
Fig. 1. Ectoedemia (Etainia) obtusa. Male, Croatia, Istra. del. A. LaStüvka.
Nota lepid. 25 (2/3): 87-95 9]
Figs. 2-5. Male genitalia of Ectoedemia (Etainia), ventral aspect. 2, 3 — E. obtusa, slide EvN 3181
(France, Les Mées). 4 — E. leptognathos, slide EvN 2920 (paratype, Turkmenistan). 5 — E. decentella,
slide VU 1297 (Netherlands, Overveen). Scales: 100 pm.
Ectoedemia obtusa (Puplesis & Diskus); Krenek 2000: 36 [colour photograph]
Ectoedemia (Etainia) sp.; Karsholt et al. 1995: 7, no 018.004.0; Leraut 1997: 82, no. 129 [listed]
Material. Croatia: 22d, 109, Istra, Labin [UTM 33T VK39], 4.iv.1999, cocoon on Fraxinus ornus,
emerged in iv, A. Laëtüvka (coll. Laëtüvka, 1 ¢ RMNH), 16, Krk, Risika, 19.-25.v.2001, M. Petrü (coll.
92 NIEUKERKEN & LASTÜVKA: Ectoedemia obtusa new for Europe
Figs. 6-7. Female genitalia of Ectoedemia (Etainia) obtusa, slide EvN 2830 (France, Les Mées): 6 —
Abdominal terminal segments, dorsally, 7 — Bursa copulatrix with the largest signum in focus. Scales: 50
im (6), 200 im (7).
Petru). — France: 2d, 19, Alpes Hte Provence, Les Mées [UTM 31T GJ3879], 14.v.1989, G. R. Langohr
(RMNH); 16, Var, La Sainte Baume, Plan d’Aups [UTM 31T GJ2001], 5.vi.1991, R. Buvat; 2d, Var, La
Sainte Baume, Plan d’Aups, La Brasque [31T GJ1900], 21.vi.1991, R. Buvat (RMNH). - Italy: 16,
Cuneo, Pezzolo v. Uzzone [UTM 32T MQ3531], 19.v.1970, reared from cocoon [host unknown], U.
Parenti (coll. Parenti). — Spain: 1 2, Aragon, prov. Teruel, Albarracin, [UTM 30T XK36], 23.vi.1992, A.
Lastüvka (coll. LaStüvka). — Turkmenistan: holotype.
Other material (not examined, data provided by R. Buvat). France: 1d, Bouches-du-Rhône, Auriol,
Bois de la Lare, [UTM 31T GJ1704], 3.vi.1991, R. Buvat; 2d, Var, La Sainte Baume, Plan d’Aups,
[UTM 31T GJ2001], 16.v1.1995, R. Buvat (coll. Buvat).
Diagnosis
Males differ from E. sericopeza, louisella and decentella by the absence of black
androconial scales on forewing underside and hindwing. E. albibimaculella is also
missing these scales, but is overall paler brown, and lacks a basal spot on the forewing.
E. biarmata 1s also externally very similar to obtusa. Females are very similar to
sericopeza and louisella, only separable by differences in the terminal tergites.
Description
Male (Fig. 1). Forewing length 2.5—2.9 mm. Head with frontal tuft pale yellow to
orange; collar similar. Antenna with ca. 51 segments (broken in most specimens); scape
creamy white, flagellum dark brown. Thorax fuscous, posterior tip white, tegulae some-
times with few white scales; forewing fuscous-black, with small basal white spot, a
slightly constricted white fascia at 1/3 and a costal and dorsal spot at 2/3, sometimes
Nota lepid. 25 (2/3): 87-95 | 93
Figs. 8-9. Genitalia of Ectoedemia (Etainia) obtusa, genitalia preparations AL (Croatia): 8 — male, 9 —
female. del. A. LaStüvka.
forming a second fascia; terminal cilia silvery white beyond more or less distinct cilia-
line. Underside brown, without black androconial scales, but with a small band of
yellow androconial scales in furrow under frenulum (often difficult to see). Hindwing
grey, no trace of androconial scales.
Female. Forewing length 2.6—3.1 mm, antenna with 51 segments. Otherwise as
male.
Male genitalia (Figs. 2, 3, 8). Capsule length 405-455 um (n=4), ca. 0.81-
0.95 as wide as long; vinculum truncate anteriorly, fused with tegumen; tegumen forming
pseuduncus with truncate tip with about 6-7 setae ventrally in one row. Gnathos with
narrow, pointed central element. Valva length 175—223 um, with broadly rounded tip;
valval apodeme sinuous, pointed, about 230-260 um long; transtilla with long trans-
verse bar and short, but distinct ventrolateral arms. Aedeagus 325-370 um long, with
pair of ventral carinae, a pointed tip; vesica with 2 strong cornuti near phallotrema and
an H-shaped circular sclerotization anteriorly near cathrema.
Female genitalia (Figs. 6, 7, 9). T VII posteriorly with lateral rows of 11—
14 setae on sclerotized plates, slightly excavated medially along anterior margin of T
VIU; T VIII with almost straight anterior margin, ca 6-8 setae on either side; anal
papillae with 23-27 setae Bursa total length 880 um (n=1). Vestibulum with paired
lobes, only slightly sclerotized. Ductus bursae with a group of spines, but occasionally
poorly developed; corpus bursae without spines, with two obovate large reticulate signa,
resp. measuring 302x115 and 278x138 um.
Biology. In 1999 cocoons were found by the junior author in Croatia on trunks
of Fraxinus ornus L., in a small forest of about 60x 100 m, with a dominance of Fraxinus
ornus. In total about 80 cocoons were collected from trunks in the whole area. The
94 NIEUKERKEN & LASTÜVKA: Ectoedemia obtusa new for Europe
Fig. 10. Distribution of Ectoedemia (Etainia) obtusa.
nearest trees of Acer monspessulanum were growing at a distance of ca 40-50 m; on
the isolated Acer and Fraxinus trees in the surroundings no cocoons were found. No
signs of feeding were observed on the trees. In 2002 these trees unfortunately had been
felled and in nearby localities trees of Fraxinus and Acer were mixed; here few co-
coons were found on both tree species. Parenti also reared the specimen from Italy
(Cuneo), but unfortunately his rearing notes have since been lost (U. Parenti in /itt.).
Puplesis & Diskus (1996) assumed Acer turcomanicum to be the host, basing on the
host preference of several related species. On the same assumption, the senior author
searched in vain for larvae in one of the French localities only amongst the various
Acer-species, unaware of the possibility of Fraxinus as host. Evaluating all the avail-
able evidence, we consider Fraxinus ornus as the most likely host in Croatia, although
the possibility that all larvae were transported prior to cocoon spinning from nearby
Acer cannot be excluded totally. Fraxinus ornus is widespread in the Eastern Mediter-
ranean region and southern Central Europe, but not native in France or Spain, although
it has been planted there (Amaral Franco & Rocha Alfonso 1972). In France and Spain
occur the more widespread F angustifolia Vahl and F! excelsior L. We tentatively
assume that E. obtusa feeds on several species of Fraxinus. Cocoons whitish to light
purple, changing into greyish-brown after few days.Adults have been collected in May
and June, cocoons were found in April.
Distribution (Fig. 10). Southern Europe: Spain, France, Italy, Croatia and in
Turkmenistan. To be expected elsewhere on the Balkan and in Turkey and Iran.
Hostplant relationships. Fraxinus (family Oleaceae) — if indeed the
host — is an interesting and unexpected addition to the hostplants of Nepticulidae.
Previously only one species was recorded from this family: Ectoedemia (Fomoria)
oleivora Vari, feeding in Olea chrysophylla Lamk. (Vari 1955; Scoble 1983); it is not
closely related. Most species of Etainia, where the biology is known, feed on Acer
species (Aceraceae or Sapindaceae in the system of Bremer et al. 1998). Only E.
albibimaculella is known to feed on Ericaceae (Arctostaphylos). Oleaceae are not closely
related to Aceraceae or Ericaceae, and most likely the feeding on Fraxinus constitutes
a secondary hostshift. Since Acer is recorded as host in Europe, the Eastern Palaearctic
Nota lepid. 25 (2/3): 87-95 95
and the Nearctic region, it is very likely that it constitutes the plesiomorphic host of
Etainia.
Remarks. The new combination Ectoedemia obtusa was inadvertently published
by Krenek (2000). _
Acknowledgements
We thank the late R. Buvat (Marseille), Gerard Langohr (Simpelveld, The Netherlands), M. Petru (Praha)
and Rimantas Puplesis for lending us their material and a gift of several specimens of E. obtusa and E.
leptognathos respectively.
References
Amaral Franco, J. do & M. L. da Rocha Alfonso 1972. Fraxinus.— Jn: T. G. Tutin, V. H. Heywood, N. A.
Burgeset al. (eds.), Flora Europaea. — University Press, Cambridge. Pp. 53-54.
Bremer, K., B. Bremer & M. Thulin 1998. Classification of flowering plants. Department of Systematic
Botany, Uppsala University. — http://www.systbot.uu.se/classification/summary98.html. [Accessed
03-02-2002. ]
Hoare, R. J. B. 1998. Systematics of Australian Nepticulid moths (Lepidoptera: Nepticulidae). —
Unpublished thesis, Canberra, Australian National University. 248 pp.
Karsholt, O., E. J. van Nieukerken, S. E. Whitebread & S. Zangheri 1995. Lepidoptera Zeugloptera,
Dacnonypha, Exoporia, Monotrysia (=Micropterigoidea, Eriocranioidea, Hepialoidea, Nepticuloidea,
Incurvarioidea, Tischerioidea). — Checkl.Spec.Faun.Ital. 80: 1-12.
Krenek, V. 2000. Small moths of Europe. — Cesky Tesin. 174 pp.
LaStüvka, A. & Z. LaStivka 1997. Nepticulidae Mitteleuropas. Ein illustrierter Begleiter (Lepidoptera).
— Konvoj, Brno. 229 pp.
Leraut, P. 1997. Liste systématique et synonymique des Lépidoptères de France, Belgique et Corse
(deuxième édition). — Supplement à Alexanor, Paris. 526 pp.
Morton, A. 2000. DMAP for Windows. Version 7.0° (32-bit). — Berkshire, UK.
Nieukerken, E. J. van 1986. Systematics and phylogeny of Holarctic genera of Nepticulidae (Lepidoptera,
Heteroneura: Monotrysia). — Zool. Verh. 236: 1-93.
Nieukerken, E. J. van, E.S. Nielsen, R. Johansson & B. Gustafsson 1990. Introduction to the Nepticulidae.
—In: R. Johansson, E. S. Nielsen, E. J. van Nieukerken & B. Gustafsson (eds.), The Nepticulidae and
Opostegidae (Lepidoptera) of NW Europe. Fauna Entomologica Scandinavica 23. Brill, Leiden. Pp.
11-109.
Nieukerken, E. J. van & R. Johansson 1990. Tribus Trifurculini.— /n: R. Johansson, E. S. Nielsen, E.J.
van Nieukerken & B. Gustafsson (eds.), The Nepticulidae and Opostegidae (Lepidoptera) of NW
Europe. Fauna Entomologica Scandinavica 23. Brill, Leiden. Pp. 239-321.
Puplesis, R. 1994. The Nepticulidae of eastern Europe and Asia. Western, central and eastern parts. —
Backhuys Publishers, Leiden. 290 pp.
Puplesis, R. & A. Diskus 1996. First record of the genus Etainia Beirne from Central Asia with descriptions
of two new species and some provisional notes on the world fauna (Lepidoptera: Nepticulidae). -
Phegea 24(1): 41-48.
Scoble, M. J. 1983. A revised cladistic classification of the Nepticulidae (Lepidoptera) with descriptions
of new taxa mainly from South Africa. — Transv.Mus.Monogr. 2: 1-105.
Vari, L. 1955. South African Lepidoptera I. Descriptions of new leafmining Tineina. — Ann. Transv.Mus.
22(3): 331-351.
96 Kozlow: Short Communication
Short Communication
First record of Nemophora lapikella Kozlov (Adelidae) from Japan
During the past years, considerable progress was achieved in investigation of the moth family
Adelidae in Japan, mainly due to the intensive work by Hirowatari (1995, 1998, 2000). To
date, 22 species of the genus Nemophora Hoffmansegg have been recorded from Japan
(Hirowatari, 1998); the latest nomenclatural changes and additions to the taxonomic treatment
of Adelidae in the famous book ’Moths of Japan’ (Moriuti 1982) were recently summarized by
Sugi (2000).
Although the faunistic lists of Adelidae from the Russian Far East (Kozlov 1997b) and
Japan (Hirowatari 1998) do not show complete correspondence, the number of common spe-
cies 1s rather high. Therefore absence of N. lapikella Kozlov, 1997, in Japan was rather confus-
ing, because this species is distributed from the Russian Primorye to Tatwan, and is abundant
in all parts of the distribution range (Kozlov 1997a).
Recent investigation of the materials kept in Taiwan Forest Research Institute (Taipei) re-
vealed that N. /apikella is indeed present in Japan, at least in Oita Prefecture of Kyushu: two
specimens (male and female) labelled ‘Japan: Kyushy, Kurodake, 8.7.1937, S. Issiki’ with
certainty belong to this species. I suspect that many more specimens of N. lapikella can be
discovered by careful examination of specimens determined as N. staudingerella (Christoph,
1881). Although it is possible to distinguish well-preserved specimens of N. lapikella from
other species by external characters (such as the abrupt change of male antennal color from
cupreous brown to light silver-white at the level of forewing fascia), reliable identification is
only possible on the basis of male genitalia (figured by Kozlov 1997a, b). In particular, N.
lapikella differs from N. staudingerella by longer vinculum (2.6-2.8 x length of valva) and
smooth right wall of aedeagus (spinosae in N. staudingerella).
One more species of the same species-group, N. chalybeella (Bremer, 1884), so far re-
ported from the Russian Far East and Korea (Kozlov, 1997b), can also be discovered from
Japan. In this species the left carinae on male aedeagus is corkscrew-shaped apically, whereas
in both N. staudingerella and N. lapikella carinae on the ventral wall of aedeagus are sym-
metrical.
Acknowledgements
Iam very much indebted to Toshiya Hirowatari for his continuous help and valuable information on Japanese Adelidae.
I gratefully acknowledge financial support from the Academy of Finland for the exchange visit to Taiwan Forest
Research Institute (Taipei) and thank Jung-Tai Chao and Shen-Horn Yen for their help.
References
Hirowatari, T. 1995. Taxonomic notes on Nemophora bifasciatella Issiki, with descriptions of its two new allied species
from Japan and the Russian Far East (Lepidoptera, Adelidae). — Jpn.J.Ent. 63: 95-105.
Hirowatari, T. 1998. Recent studies on the family Adelidae of Japan. — Nature Insects 33 (11): 27-29 [in Japanese].
Hirowatari, T. 2000. Biological notes on some Japanese species of the family Adelidae (Lepidoptera). — Yadoriga
186: 26—29 [In Japanese].
Kozlov, M. V. 1997a. Nemophora lapikella sp. n., a new fairy moth species (Adelidae) from South-Eastern Asia. — Nota
lepid. 20: 39-44.
Kozlov, M. V. 1997b. Family Adelidae. Pp. 374-289. — In: V. S. Kononenko (ed.), Key to the Insects of Russian Far East.
Vol. V. Trichoptera and Lepidoptera, pt. 1. — Dalnauka, Vladivostok [in Russian].
Moriuti, S. 1982. Incurvariidae. Pp. 51-56, pl. 1. — In: Inoue, H., Sugi, S., Kuroko, H., Moriuti, S. & Kawabe, A.
(eds.), Moths of Japan, Vols. 1 & 2. — Kodansha, Tokyo [in Japanese].
Sugi, S. 2000. ‘Post-MJ’, Edn 2. Additions of species and changes in names of Japanese moths. — Japan Heterocerists’
Society, Tokyo. x11 + 171 p.
Mikhail V. KozLov
Nota lepid. 25 (2/3): 97-107 97
Elachista nolckeni Sulcs, 1992: morphology and bionomics of
immature stages (Gelechioidea: Elachistidae)
TOMASZ BARAN
Rzeszöw University, Institute of Biology and Environmental Protection, Rejtana 16C, 35-310 Rzeszöw,
Poland
Summary. The previously unknown life history and morphology of early life stages of Elachista nolckeni
Sulcs, 1992 are described. The last instar larva, pupa and mines of the species are illustrated for the first
time. A redescription of the imago is also given. The caterpillars make Phyllonorycter-like mines in the
leaf blades of Phleum phleoides (L.) Karst. Pupation takes place on the ground. The adults fly in one
generation from mid-May to the beginning of July. The species inhabits open, xerothermic habitats.
Key words. Gelechioidea, Elachistidae, Elachista nolckeni, morphology, bionomics.
Introduction
Elachista nolckeni was described comparatively recently on the basis of specimens
from Latvia, Poland and Estonia (Sulcs 1992). Except for these countries, the species
has also been recorded from Austria (Sulcs, op. cit.), the Czech Republic (Liëka 1998)
and Germany (Gaedike & Heinicke 1999). In Poland it is known only from a few
places located in the central and eastern parts of the country: the Zbocza Plutowskie
Reserve (UTM: CE 20) (leg. T. Baran), Torun (UTM: CD 37) (Sulcs, op. cit.), the
Biebrzanski National Park (Gora Perewida, UTM: FE 24) (Buszko 1996) and the Skarpa
Dobrska Reserve (UTM: EB 68) (Buszko et al. 1996).
So far nothing was known about the immature stages of this elachistid moth. Three
years of field research enabled the author to elaborate the food-plant and habitat pref-
erences as well as the morphology of the preimaginal stages. Below the adults are also
redescribed.
Material and methods
The study was carried out in 1998-2000. During that period 25 larvae, 12 pupae and
40 moths were examined. The material was collected in two reserves of xerothermic
~ vegetation — the Skarpa Dobrska Reserve and the Zbocza Plutowskie Reserve. The
first reserve comprises xerothermophilous plant communities growing on loess soil
(Fig. 1); dominant plant species are: Anthyllis vulneraria L., Artemisia campestris L.,
Brachypodium pinnatum (L.) P.B., Coronilla varia L., Festuca sulcata (Hack.) Nym.,
Helichrysum arenarium (L.) Moench, /nula ensifolia L., Juniperus communis L., Phleum
phleoides (L.) Karsten, Salvia pratensis L., and Silene otites (L.) Wib.
The second site is formed by sunny and dry slopes of the Wista valley (Fig. 2); the
area is rich in many species of xerothermic and steppe vegetation, such as Adonis
vernalis L., Anemone silvestris L., Brachypodium pinnatum (L.) P.B., Hieracium
echioides Lumnitzer, Medicago minima (L.) Grufb., Salvia pratensis L., Stipa capillata
L. and Stipa joannis Cel.
© Nota lepidopterologica, 15.11.2002, ISSN 0342-7536
98
Baran: Immature stages of Elachista nolckeni
Terminology of structures in male and female genitalia follows Traugott-Olsen &
Nielsen (1977) and Kaila (1997, 1999), whereas the terminology relating to morphol-
ogy of the larva and pupa is according to Hinton (1946), Hasenfuss (1980) and Patocka
(1999). Chaetotaxy was studied after maceration of larvae in 10% KOH.
Figs. 1-2. The habitats of Elachista nolckeni in Poland: 1 — the Skarpa Dobrska Resrve; 2 — the Zbocza
Plutowskie Reserve.
Nota lepid. 25 (2/3): 97-107 99
Results
Description of stages
Larva — last instar (Figs. 3-5). Body length 5.5-6 mm (n = 20). Head yellowish
brown; ocellar areas blackish. Dorsal prothoracic shield well sclerotized, especially in
posterior parts; it consists of a pair of elongate plates, enlarged posteriorly, with ir-
regular margins. Ventral prothoracic shield weakly sclerotized in median part, variable
in shape, but more or less X-shaped. Anal shield sclerotized, triangular, with rounded
apex. All sclerites yellowish brown, but dorsal prothoracic plates darker posteriorly.
Body of the larva somewhat tapered towards the last segment (2nd and 3rd thoracic
segments broadest), from pale yellowish green to olive green; prothorax more yellow-
ish than other segments.
Chaetotaxy (Figs. 6-10). Thorax, T1. — On prothoracic shield, 2 pores (a, b),
D1 seta and proprioreceptor MXD1. XD1 and D2 close to lateral margin of the shield
(D2 ventral to XD1). SD1 ventral to XD2 and SD2, closer to the latter. L group trisetose,
L1 ventral to L2 and L3. SV group unisetose. MV2 and MV3 (not proprioreceptors)
almost in vertical line. V1 ventral and somewhat anterior to the leg. T2—3. — D1 some-
what dorsal to D2. SD2 dorsal to SD 1. L group trisetose, LI ventral to the others. SD2,
SD1 and L1 almost in vertical line. SV group unisetose. On these segments, there are
proprioreceptors: MD1, MSD1, MSD2, MV1 and MV3 (MV2 absent). Abdomen, Al.
Figs. 3-5. The mature larva of Elachista nolckeni: 3 — dorsal
view of the mature larva; 4 — dorsal prothoracic shield; 5 — ven-
tral prothoracic shield.
100 BARAN: Immature stages of Elachista nolckeni
Fig. 6. Setal map (last instar): 1-3 — thoracic segments; I-VI — abdominal segments.
— D1 widely separated ventrally from D2. SD1 dorsal and posterior to spiracle. SD2
anterior and ventral to SD1. L group bisetose, L3 (very small seta) ventral to L1. SV
group bisetose, but SV3 often absent. V1 ventral to SV setae. On the segment,
proprioreceptors MD1 and MV3 occur. All. — Arrangement of the setae similar to the
previous segment, but MDI more remote from D1, and SD1 closer to spiracle. AHT-
VI. — Arrangement of MD1, D, SD and L groups as on 2nd abdominal segment. SV
group trisetose, SV3 ventral and anterior to SV1, between SV1 and SV2. VI some-
what posterior and ventral to SV2. MV3 anterior and ventral to V1. AVI. — Arrange-
ment of MD1, D, SD and L setae similar to previous segments. SV group unisetose. V1
Nota lepid. 25 (2/3): 97-107 101
Figs. 7-10. Setal maps (last instar): 7 — abdominal segments VII-IX; 8 — abdominal segment X (dorsal
view); 9 — abdominal segment X (lateral view); 10 — anal proleg.
ventral and slightly anterior to SV1. MV3 anterior and between SV1 and V1. AVIII. —
The general arrangement of the setae similar to the 7th abdominal segment. AIX. — 5
‘long’ setae (D2, SD1, LI, SV1, V1) and 2 proprioreceptors (MDI, MV3). D2 and
SD1 in vertical line. LI ventral and somewhat anterior to SD1. SV1 remote ventrally
from L seta. V1 ventral and slightly anterior to SVI. AX. — On the sclerotized anal
plate, there is D2 only; DI and SD1 ventral to the plate (D3 absent). AL group with 5
setae and 1 pore (ALa on line joining ALI and AL3). AVI and AV4 more caudally and
more remote from each other than AV2 and AV3. AVa anterior to and between AV2 and
AV3.
Pupa (Figs. 11-12). Length of pupa: 3.7-4.1 mm (n = 10); yellow-brown. Vertex
slightly protruding over frons, with shallow incision. Labrum triangular caudally. Pro-
102 Baran: Immature stages of Elachista nolckeni
boscis extended to about one third of
forewing length. Antenna with protru-
sions, extended to apex of forewing. Mid
leg extended to about a half of forewing
length, and fore leg somewhat shorter.
Forewing extended to posterior margin of
6th abdominal segment or ended slightly
before; veins raised. Dorsal and lateral
ridges prominent; the dorsal one runs from
vertex to posterior margin of 8th abdomi-
nal segment, and the lateral ones run from
posterior margin of Ist abdominal seg-
ment to posterior margin of 8th one. On
ventral side of 6th, 7th and 8th segments
there are also weak ridges. On each side
of the mesonotum there is a pair of addi-
tional ridges. Lateral parts of mesonotum
with raised nodules. Abdominal spiracles
| : visible on lateral ridges.
lim M Adult male (Fig. 13). Wingspan
9-10.5 mm (n = 15). Head and neck tuft
white; labial palpus white, underside usually suffused with grey or ochreous-orange;
scape of white, sometimes with ochreous-orange scales, flagellum brownish, annu-
lated with whitish. Thorax and tegula white, often with a few ochreous-orange or black-
Fig. 13. Elachista nolckeni, adult male.
Nota lepid. 25 (2/3): 97-107 103
ish-brown tipped scales. Forewing white, strongly mottled with ochreous-orange; ba-
sal part of costa dark grey-brown; white markings consisting of slightly outward bent
fascia before middle, costal and tornal spots (costal spot distinctly beyond tornal one;
sometimes spots form a zigzag outer fascia), basal spot (often connected with inner
fascia) and usually weakly indicated narrow terminal streak. Many blackish-brown
tipped scales scattered over forewing, especially in fold between basal spot and inner
fascia, between inner fascia and outer spots as well as in tornal part; scales in dorsal
half between inner fascia and tornal spot bigger than others and slightly raised (groups
of such scales form small dots on the wing). Cilia between tornus and apex whitish
tinged ochreous with grey-brown tips; cilia on dorsum whitish. Ciliary line distinct,
blackish-brown. Hindwing grey-brownish. Costal cilia coloured as hindwing, dorsal
cilia whitish-orange, tinged light grey-brown mainly in basal half. Abdomen grey-
brown dorsally with pale grey and whitish scales on posterior margins of segments;
ventrally grey-brown, strongly covered with whitish and ochreous-white scales. Anal
tuft greyish-brown from dorsal view, and whitish ventrally.
Female similar to male but usually smaller (wing span: 8-9.5 mm [n = 10]);
antenna more clearly ringed; dark grey-brown suffusion at costa less distinct or invis-
ible; anal tuft entirely whitish.
Male genitalia (Figs. 14-17). Uncus deeply indented; uncus lobes triangu-
lar, narrow and tapering, with a few minute setae distally. Gnathos elongate, rounded
apically. Sacculus of valva almost straight, joining cucullus without angle. Costa con-
vex at about the middle. Juxta lobes triangular with rounded ends and prominent lat-
eral processes; apical parts of the lobes with a few short setae. Digitate processes
tongue-shaped, short and setose apically. Median plate of juxta well sclerotized, more
or less round, with a deep concavity. Vinculum without saccus, rounded. Aedeagus
rather short and thick, distinctly broadened beyond the middle; distal end usually fun-
nel-shaped; vesica with one boomerang-like or tooth-like cornutus.
Female genitalia (Fig. 18). Papillae anales of moderate length, covered
with setae (the longest ones basally). Apophyses rather slender; posterior pair from
1.5 to 2 times longer than anterior one. Tergum 8 well sclerotized, anterior and pos-
terior margins deeply concave. Sternum 8 sclerotized (more in anterior part) with
more or less round ostium bursae in anterior half; lateral margins concave and ante-
rior margin forming a semi-ring. Colliculum short as a longitudinal, lateral foldings.
Ductus bursae rather long, membranous, covered with very minute spines at 3/4 of
its lenght and the remaining 1/3 smooth and slightly broader than madian part. Duc-
tus seminalis situated near to colliculum. Corpus bursae oval, with three patches of
minute spines.
Life history
Eggs are laid at the basal part of a leaf of Phleum phleoides (L.) Karsten, in the middle
or near a margin of the blade. Initially the larva mines in a narrow gallery (Stigmella-
like), towards the leaf-tip; than it turns at or near the tip and mines downwards making
a pale greenish Phyllonorycter-like blister, 4.5—6 mm in length (n = 12) (Fig. 19). The
104 BaRAN: Immature stages of Elachista nolckeni
Figs. 14-18. Male genitalia of Elachista nolckeni: 14 — complex of valvae-vinculum; 15 — complex of
tegumen-uncus-gnathos; 16 — complex of juxta lobes-digitate processes-median plate; 17 — aedeagus —
examples; 18 — Female genitalia of Elachista nolckeni.
proximal part of the blotch is rounded, irregular or divided usually into two short parts
(galleries). The blister mine occupies an apical part or (rarely) a central one of the leaf.
The frass is concentrated in the distal part of the mine. Because of the colour and
twisted margins of the blade, the mine is relatively difficult to detect. During develop-
ment (in captivity), the larvae sometimes change leaves. Pupation takes place on the
Nota lepid. 25 (2/3): 97-107 105
Fig. 19. Mines of the larvae of Elachista nolckeni on Phleum phleoides — examples.
ground; in the breeding containers on the bottom among leaf litter. The pupa is an-
chored to the substrate by a terminal segment and a silken girdle. In the laboratory, the
pupal stage lasts 13-15 days. The larvae start feeding about mid-April and occur until
the second half of May. Mines with mature larvae were found in large numbers in early
May. Adults are univoltine and fly from the middle of May to the beginning of July,
most abundantly in the first half of June. The moths may easily be found resting on
leaves of various grasses or flying over plants during the day. The species occurs lo-
cally in sunny, rather open places of xerothermic grasslands. In the studied sites,
Elachista nolckeni was observed in the same places where Elachista subocellea
(Stephens, 1834) occurs. The latter appears usually later, but especially in June both
species may fly together.
Discussion
Because little information on detailed morphology of immature stages (especially of
the larvae) of Elachistidae has been published so far, it is difficult to draw general
conclusions of phylogenetic importance. Nevertheless, some of the presented results
106 BARAN: Immature stages of Elachista nolckeni
are of interest. DI on abdominal segments 1-8 is placed distinctly ventrally to D2.
This feature may be a synapomorphy for the group of species closely related with E.
nolckeni, because the character state ‘D1 more or less dorsal to D2’ is a widespread
condition in Elachistidae (T. Baran, unpublished) as well as in Gelechioidea and is
therefore inferred to be plesiomorphic. Traugott-Olsen and Nielsen (1977) suggested
that the absence of one SD seta (SD2) on abdominal segments may be a generic char-
acter defining Elachista. E. nolckeni possesses two setae from the SD group (on ab-
dominal segment 1-8), but SD2 is apparently far away from SD1 as compared with
most Gelechioidea. So, if this condition is found in other elachistid species, it may turn
out to be a synapomorphy for the family. Traugott-Olsen and Nielsen (1977) also stated
that E. apicipunctella Stainton, 1849 has no proprioreceptors. In the larva of E. nolckeni
almost all known Ditrysian proprioreceptors were found. According to Hodges (1999)
the occurrence of only one seta of the SV group on AI characterises Elachistidae s. str.
However, results in the present paper reveal that SV3 on this segment may occur,
although in E. nolckeni the seta sometimes disappears. Moreover, the position of setae
from abdominal L group may have some significance in phylogeny. Here, these L
setae have been designated as L1 and L3 (the seta situated more ventrally), so L2 is
absent. Still, it must be stressed that the homology of L setae in Elachistidae is uncer-
tain. Hitherto only full-grown larvae have been studied and the decision which seta
really is L3 (a subprimary seta), needs research of earlier instars. According to Minet
(1991), the occurrence of L1 and L2 on the same pinnaculum, or closely approximated
ones, is plesiomorphic within Gelechioidea.
With respect to wing pattern and morphology of genitalia, Elachista nolckeni 1s
most similar to two other central European species of Elachistidae, viz. E. subocellea
(Stephens, 1834) and E. collitella (Duponchel, 1843). However, it is comparatively
easily distinguished from these species even without genitalia examination; the shift-
ing of the costal spot towards the wing apex, in relation to tornal spot, is distinctive
(Fig. 13). In the male genitalia the shape of the aedeagus and juxta lobes separates
males of this moth from other species. In the female genitalia the presence of three
patches of spines on the corpus bursae as well as the shape of sternum 8 are diagnos-
tic. :
At the beginning of the 20th century, Toll described Elachista subcollutella on
the basis of one specimen collected in the Ukraine (Toll 1936). This elachistid was
later synonymised with Elachista subocellea by Traugott-Olsen & Nielsen (1977).
E. subocellea is closely related with E. nolckeni. So, there was a possibility of
misidentification, especially because E. nolckeni was described later. Since the
holotype of E. subcollutella is probably lost (it is missing in Toll’s collection pre-
served at the PAN, Kraköw), a detailed comparison was impossible. Nevertheless,
comparing the drawing of the E. subcollutella forewing (Toll 1936) with recent ma-
terial of E. nolckeni and E. subocellea confirms the synonymy suggested by Traugott-
Olsen & Nielsen (1977). E. subcollutella differs from E. nolckeni in having a trans-
verse outer fascia. Such a fascia is typical in E. subocellea. Thus, there is no doubt
that the elachistid described by Toll is conspecific with E. subocellea, while E.
nolckeni is a good species.
Nota lepid. 25 (2/3): 97-107 | 107
Acknowledgements
I would like to thank Prof. Jarostaw Buszko (Torun, Poland) for taking the photograph of the adult. I
am also sincerely grateful to Dr. L. Kaila (Helsinki, Finland) for critical comments on the manuscript,
and to Prof. J. Razowski for permission to study the material of the PAN (Krakow, Poland).
References
Buszko, J. 1996. On the occurrence of Elachista nolckeni Sulcs (Lepidoptera, Elachistidae) in Poland. —
Wiad. Ent. 15(1): 59.
Buszko, J., J. Junnilainen, J. P. Kaitila, J. Nowacki, K. Nupponen & K. Palka 1996. New and rare to the
Polish fauna species of Lepidoptera recorded in south-eastern Poland. — Wiad. Ent. 15(2): 105-115.
Gaedike, R. & W. Heinicke (eds.) 1999. Verzeichnis der Schmetterlinge Deutschlands (Entomofauna
Germanica 3). — Ent.Nachr.Ber. Dresden Beiheft 5: 1-216.
Hasenfuss, I. 1980. Die Präimaginalstadien von Thyris fenestrella Scopoli (Thyrididae, Lepidoptera). —
Bonn. zool. Beitr. 31: 168-190.
Hinton, H. R. 1946. On the homology and nomenclature of the setae of lepidopterous larvae with some
notes on the phylogeny of the Lepidoptera. — Trans.ent.Soc.Lond. 97: 1-35.
Hodges, R. W. 1999. Gelechioidea. — Jn: Kristensen, N. P. (ed.), Handbook of Zoology IV, 35. Lepidoptera,
moths and butterflies 1. — W. de Gruyter, Berlin, New York. Pp. 131-158.
Kaila, L. 1997. A revision of the Nearctic species of Elachista s. 1. Il. The argentella group (Lepidoptera,
Elachistidae). — Acta Zool.Fenn. 206: 1-93.
Kaila, L. 1999. Phylogeny and classification of the Elachistidae s. s (Lepidoptera: Gelechioidea). —
Syst.Ent. 24: 139-169.
Liska, J. 1998. Elachistidae. — /n: LaStüvka, Z. (ed.), Checklist of Lepidoptera of the Czech and Slovak
Republics (Lepidoptera). - Konvoj, Brno. p. 28-30.
Minet, J. 1991. Tentative reconstruction of the ditrysian phylogeny (Lepidoptera: Glossata). — Ent.Scand.
22: 69-95.
Patocka, J. 1999. Die Puppen der mitteleuropäischen Elachistidae (Lepidoptera, Gelechioidea). —
Bonn.zool.Beitr. 48: 283-312.
Sulcs, I. 1992. Elachista nolckeni sp. n. aus Lettland (Lepidoptera, Elachistidae). — Ent.Fenn. 3: 105-
108.
Toll, S. 1936. Untersuchung der Genitalien bei Pyrausta purpuralis L. und P. ostrinalis Hb., nebst Be-
schreibung 11 neuer Microlepidopteren-Arten. — Annls.Mus.zool. Pol. 11(24): 403-413, 3 pls.
Traugott-Olsen, E. & E. Schmidt Nielsen 1977. The Elachistidae of Fennoscandia and Denmark. — Fau-
na ent.Scand. 6: 1-299.
l 08 Book review
Book Review
Nancy L. JAcoBson & Susan J. WELLER. A cladistic study of the Arctiidae (Lepidop-
tera) by using characters of immatures and adults. 98 pp. Thomas Say Publications in
Entomology: Monographs. Published by the Entomological Society of America. Price:
members US$ 35.00, non-members: US$ 43.75. ISBN 0-9385-2294-9.
Phylogenies of organisms are essential not only for understanding the systematic rela-
tionships within a group, but also as a necessary template for the study of the evolution
of behavioural, ecological or physiological characters. Due to their aesthetic appeal
the Arctiidae have long attracted broad interest among lepidopterists. Moreover, they
frequently serve as model organisms for the study of chemical ecology, behavioural
physiology or mimicry. Thus, a better understanding of their phylogeny is in urgent
need. Historically, the higher classification of arctiid moths has undergone manifold
changes, and uncertainties persist. Today most approaches to resolve phylogenetic
relationships resort to molecular markers — which are expensive to study and notori-
ously difficult to obtain from older collection materials. In the present booklet, for the
first time an attempt is made to rigorously infer the phylogeny of the Arctiidae using
cladistic methods, but using more ‘classical’ morphological characters. By combining
66 characters of larvae, pupae and adults sampled over 40 arctiid and 8 outgroup spe-
cies, the authors provide a series of cladograms using maximum parsimony methods.
Three monophyletic subfamilies can be recognized (viz. Lithosiinae, Syntominae and
Arctiinae). Other well-known groups need to be redefined to attain the status of mono-
phyletic groups, while again others emerge as clearly polyphyletic. All characters used
and their scorings are extensively documented in photographs and drawings. Simi-
larly, all data matrices and relevant trees for subgroups are presented, which makes the
study a most valuable source also for further analyses. The appearance of the numer-
ous scanning electron micrographs could have been improved through printing on a
high-quality glossy paper. Also not all line drawings are of the highest quality, yet they
suffice to show the relevant information. In view of the large diversity of the Arctiidae
this booklet is just a step towards elucidating the phylogenetic history. A more com-
plete taxon-sampling (in particular with regard to early stages) will result in better
resolution. The price of the booklet seems to be high for a slender volume printed and
bound in a rather modest way. Nevertheless, for the time being I clearly recommend
this booklet to all those interested in Arctiidae phylogeny and evolution. It is also
reassuring to see that a combined usage of morphological characters from adults and
immatures still can contribute a lot to phylogenetics. Thus, the booklet by Jacobson
and Weller hopefully stimulates further such studies in under-explored Lepidopteran
taxa — molecular systematics is not always the single best choice in the 21° century.
KONRAD FIEDLER
Nota lepid. 25 (2/3): 109-151 109
A review of the genus Acompsia Hübner, 1825, with description
of new species (Gelechiidae)
PETER HUEMER* & OLE KARSHOLT**
* Tiroler Landesmuseum Ferdinandeum, Naturwissenschaftliche Sammlungen, Feldstraße lla, A-
6020 Innsbruck, Austria. E-mail:
[email protected]
** Zoologisk Museum, University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen,
Denmark. E-mail:
[email protected]
Abstract. The Palaearctic genus Acompsia is revised and two subgenera are considered: Acompsia Hübner,
1825 and Telephila Meyrick, 1923. Altogether 17 species are dealt with in detail and genitalia and adults
are figured. 7 new species are described: Acompsia (A.) pyrenaella sp. n. (Spain: Pyrenees), A. (A.)
ponomarenkoae sp. n. (Albania, Greece), A. (A.) schepleri sp. n. (Turkey), A. (A.) fibigeri sp. n. (Turkey),
A. (A.) bidzilyai sp. n. (Russia: Transbaikalia), A. (A.) caucasella sp. n. (Russia: Caucasus) and A. (T.)
syriella sp. n. (Syria). Lectotypes for A. maculosella (Stainton, 1851), A. dimorpha Petry, 1904 and A.
minorella (Rebel, 1899) and a neotype for A. tripunctella ([Denis & Schiffermüller], 1775) are designated.
Zusammenfassung. Die paläarktische Gattung Acompsia wird revidiert und zwei Untergattungen wer-
den beriicksichtigt: Acompsia Hiibner, 1825 and Telephila Meyrick, 1923. Insgesamt 17 Arten werden
detailliert behandelt und Genitalien sowie Adulte abgebildet. 7 neue Arten werden beschrieben: Acompsia
(A.) pyrenaella sp. n. (Spanien: Pyrenäen), A. (A.) ponomarenkoae sp. n. (Albanien, Griechenland), A.
(A.) schepleri sp. n. (Turkey), A. (A.) fibigeri sp. n. (Türkei), A. (A.) bidzilyai sp. n. (Russland:
Transbaikalien), A. (A.) caucasella sp. n. (Russland: Kaukasus) und A. (T.) syriella sp. n. (Syrien).
Lectotypen für A. maculosella (Stainton, 1851), A. dimorpha Petry, 1904 and A. minorella (Rebel, 1899)
sowie ein Neotypus für A. tripunctella ([Denis & Schiffermüller], 1775) werden designiert.
Key words. Lepidoptera, Gelechiidae, Acompsia, revision, new species.
Acompsia is a genus of 17 species of gelechiid moths whose members are mainly
distributed in montane areas of Europe. The definition of the genus is somewhat dis-
puted and pending on authors includes or excludes taxa of Telephila Meyrick, 1923
(see below). However, the taxonomy of species was regarded as well known until very
recently. The discovery of a new species in the Italian Alps (Huemer 1998) revealed a
number of additional taxonomic problems within the genus. Specimens hitherto as-
signed to A. tripunctella frequently proved misidentified and sometimes turned out to
belong to undescribed taxa. Consequently a review of the genus appeared necessary.
Abbreviations of museums and private collections:
BLDZ - coll. G. Baldizzone, Asti, Italy; BUSZ — coll. J. Buszko, Torun, Poland; BMNH — The Natural
History Museum, London, UK; DEI — Deutsches Entomologisches Institut im ZALF e. V., Eberswalde,
Germany; GRUN - coll. T. Grünewald, Landshut, Germany; HEND - coll. H. Hendriksen, Farevejle,
Denmark; MNG — Museum der Natur, Gotha, Germany; NHMW - Naturhistorisches Museum, Vienna,
Austria; TLMF — Tiroler Landesmuseum Ferdinandeum, Innsbruck, Austria; ZMKU — Zoological Mu-
seum, University of Kiev, Ukraine; ZMUC — Zoologisk Museum, University of Copenhagen, Denmark;
ZMUH - Zoological Museum, University of Helsinki, Finland; ZSM — Zoologische Staatssammlung,
Munich, Germany.
© Nota lepidopterologica, 15.11.2002, ISSN 0342-7536
110 HUEMER & KARSHOLT: The genus Acompsia
Check-list of Acompsia
Acompsia Hübner, 1825
Subgenus Acompsia Hübner, 1825
A.(A.) cinerella (Clerck, 1759)
A.(A.) pyrenaella sp. n.
A.(A.) antirrhinella (Milliére, 1866)
A.(A.) maculosella (Stainton, 1851)
A.(A.) dimorpha Petry, 1904
A.(A.) subpunctella Svensson, 1966
A.(A.) delmastroella Huemer, 1998
A.(A.) muellerrutzi Wehrli, 1925
A.(A.) caucasella sp. n.
A.(A.) minorella (Rebel, 1899)
A.(A.) tripunctella ([Denis & Schiffermiiller], 1775)
A.(A.) ponomarenkoae sp. n.
A.(A.) schepleri sp. n.
AA.) fibigeri sp. n.
A.(A.) bidzilyai sp. n.
Subgenus Telephila Meyrick, 1923
A.(T.) schmidtiellus (Heyden, 1848)
A.(T.) syriella sp. n.
Key to the species (external characters) —
Several Acompsia species are very similar in external characters, and the key should only be taken as a
guidline. In cases of doubt the genitalia should be examined. Females of A. muellerrutzi, A. caucasella
sp. n., A. schepleri sp. n., A. fibigeri sp. n., A. bidzilyai sp. n. and A. syriella sp. n. are unknown.
ile
w |
Un
S |
ge
Segment 2 of labial palpus with scale brush; forewing orange-brown or yellow .............. 2
Segment 2 of labial palpus slender; forewing brown... nn B
Forewing orange-brown mottled with some black scales ........................... A. schmidtiellus
Forewing straw yellow mottled with many blacks scales .......................... A. syriella sp. n.
Forewing unicolorous, without any markıngs 2... "4 A. cinerella
Forewing with more or less distinct spots..." #02 a ee 4
Forewing light ochreous brown, with dark subterminal fascia ............ A. caucasella sp. n.
Forewing dark brown to greyish brown, rarely dark ochreous brown, without subterminal
FASCIA. PRE ET PERS PRE recs tet ee er ace: nee er 5
Forewing with dark subcostal patch at about two-thirds .............................- A. maculosella
Forewing without subcostal patch... on nee 520
Forewing with small subbasal patch of dark scales .................................. A. bidzilyai sp. n.
Forewing without subbasal patch of dark scales..................222-2..2u.... 222... eee 7
Forewing light greyish brown, with indistinct light fascia at four fifths ......... A. minorella
Forewing ochreous brown to fuscous grey-brown, without light fascia ............................ 8
Forewing fuscous grey-brown; female distinctly brachypterous ...................... A. dimorpha
Forewing ochreous brown to light greyish brown; female smaller than male, not strongly
brachypterous Len nee ne ee ee SE 9
Adult small (wingspan male 14-17 mm); forewing dark to light greyish brown, without
darker veins and without darker dots along termen 2... nn nn ee 10
Adult larger (wingspan male 17-24 mm); forewing light ochreous brown or rarely light
greyish brown, with or without dark veins, usually with darker dots along termen ........ 12
Nota lepid. 25 (2/3): 109-151 al
10. Forewing dark grey-brown with four black spots .…................................... A. muellerrutzi
Eosewins light sreyish brown to shining olive-brown 4... 11
11. Forewing light greyish brown, mottled with light yellow; female of same size as male
4 . " snc A. subpunctella
— Forewing olive brown, slightly shining; female smaller and more narrow-winged than male
UO Ne Sey os inns csin A. delmastroella
Bee linsmale);with one black Spot... ............ 13
nein male) with three black Spots …............................................................. 14
13. Forewing with stripes of black scales between veins; apex rounded ...... A. schepleri sp. n.
— Forewing without stripes of black scales; apex weakly pointed ................ A. fibigeri sp. n.
14. Forewing with very distinct spots, terminal dots well developed; female about size of male
ne as SR ee ta hate blé de À. antirrhinella
— Forewing with distinct though small spots; female smaller than male ............................ 15
15.Forewing with or without terminal dots; female slightly brachypterous, with narrower
LL LES (26 GA GRR eee en eee eee eee A. tripunctella
— Forewing with terminal dots; female reasonably brachypterous, with forewing only half as
ce Soh en nennen sen ace can ET 16
16. Moderately small moths (male 17—21 mm, female 15 mm); forewing with groups of black
scales between veins; female reasonably brachypterous, with forewing only half as broad
Bl sppthwestern EULOPE) 2........cccccnniscscseressonnsdeseachectennscesenncasseat A. pyrenaella sp. n.
— Moderately large moths (male 20-24 mm, female 16-17 mm); forewing with scattered
black scales; female reasonably brachypterous, with forewing only half as broad as in male
HE UN] 0/2) RAR ee eee eee ee A. ponomarenkoae sp. n.
Acompsia Hiibner 1825 [1816]: 409
Type species: [Phalaena] cinerella Clerck 1759: pl. 11, fig. 6, by subsequent designation (Duponchel
1838: 19) (see Sattler 1973: 164).
Brachycrossata Heinemann 1870: 323 (junior objective synonym).
Type species: [Phalaena] cinerella Clerck 1759: pl. 11, fig. 6, by subsequent designation (Meyrick
19057 141) (see Sattler 1973: 177).
Telephila Meyrick, 1923: 626.
Type species: Ypsolophus schmidtiellus Heyden 1848: 954, by original designation.
Adult. Antenna brown, in most species indistinctly lighter ringed, in male with
short cilia. Head, thorax and tegula in all species concolourous with forewing, head
often with lighter scales above eye. Forewing sub-rectangular to almost sub-triangu-
lar, light to dark brown (occasionally orange or yellow), without or with up to four
black spots and often black stripes or patches; termen from rounded to emarginated
below apex, in some species with black spots at end of veins. Hindwing broadly sub-
rectangular, only with a slight emargination beyond apex. Tip of abdomen yellow.
Female in most species smaller than male; in some species slightly to reasonably
brachypterous, most pronounced in A. dimorpha (females of 6 species unknown, per-
haps brachypterous).
Male genitalia. Uncus broad, sub-rectangular, fused with tegumen; gnathos
with small culcitula, covered with microtrichia, distal part a strong and long hook;
tegumen about twice width of uncus, with parallel outer margin, anteriodorsal margin
2 HUEMER & KARsHOoLT: The genus Acompsia
with moderately weak emargination, pedunculi small; valva separated into
ventroanterior (sacculus) and dorsoposterior lobes (cucullus); cucullus distally dilated,
with straight posterior margin and broad semioval setose apical part; sacculus a lobe,
distal part densely covered with microtrichia, fused with vinculum by a membrane;
vinculum consisting of two long and narrow, distally usually enlarged sclerites, distally
fused by a membrane; juxta absent; anellus with two small setose humps dorsally;
aedeagus weakly inflated, apicoventrally with rounded plate, apicodorsal part with or
without dentate sclerite at base of vesica, vesica with (sg. Acompsia) or without (sg.
Telephila) spiralled sclerotized distal part.
Female genitalia. Papillae anales large; apophyses posteriores about 1.5 to
three times length of apophyses anteriores; apophyses anteriores about length of seg-
ment VIII; segment VII sclerotized dorsally and ventrally, without specialised sclerites;
sclerotized sternite occasionally prolonged into antrum, membranous in between; os-
tium submerged under the-margin of segment VII; antrum broadly funnel-shaped;
ductus bursae short, with sclerites near corpus bursae; corpus bursae large, pyriform,
with (sg. Acompsia) or without (sg. Telephila) strong sclerite at entrance of ductus
seminalis at right hand side and about middle to anterior third of corpus bursae; left
hand side of corpus bursae with patch of microtrichia and small appendix bursae.
Distribution. Species of Acompsia are mainly restricted to mountains of the
Western Palaearctic region. Several taxa are endemic to limited areas, whereas only
one species, A. cinerella, is widely distributed throughout Europe and Palaearctic Asia.
Records from outside the Palaearctic region apply to other genera (see below).
Biology. Host-plant relationships within the genus are largely unknown. Mosses
and herbaceous plants (Scrophulariaceae, Plantaginaceae, Onagraceae and Lamiaceae)
are reported as host-plants. The adults (especially the males) are usually attracted to
light; females of several species fly little and are rare in collections or even unknown.
Most of the species live in the montane to alpine zone, preferably in various types of
meadows and woodland edges.
Systematic position. Acompsiais considered as a member of the gelechiid
subfamily Dichomeridinae, which is defined by several synapomorphic character states
such as the presence of parategminal sclerites, divided valva, anteriorly tube-like
tegumen with well developed ventral wall and specialised muscles (Ponomarenko 1992;
1997a). The phylogeny and taxonomy of the Dichomeridinae has been studied in de-
tail by Ponomarenko (1997a), according to whom two genera, Helcystogramma Zeller,
1877 and Acompsia (including Telephila, see below) form a more ancestral branch,
defined by the absence of a juxta as synapomorphy. Acompsia s. |. is characterised by
two apomorphic characters: a) sacculus with stretched apex, superposed ventrally and
b) aedeagus with separate dorsal plate (Ponomarenko 1997a: 307). According to this
author Acompsia s. str. is a monophyletic entity, based on the sclerites of ductus bursae
near the entrance to corpus bursae. It remains doubtful to us whether sclerites of the
ductus bursae are meant as they occur in both subgenera. However the sclerites at the
entrance of the ductus seminalis may be regarded as an apomorphy of Acompsia s. str.
The genus Telephila Meyrick, 1923, was established to include one European and
one Australian species, and placed next to Dichomeris Hiibner, 1818 (Meyrick 1925:
Nota lepid. 25 (2/3): 109-151 1.13
173-174). The European species, A. schmidtiellus (Heyden, 1848), and A. syriella sp.
n. differ from the species here included in Acompsia s. str. by the presence of an apical
tuft on segment 2 of the labial palpus, and by the distomedially curved sacculus. The
latter was regarded as a synapomorphy for Telephila by Ponomarenko (1997a). We
consider none of these two and further characters (Table 1) being of generic impor-
tance within the Dichomeridinae. In accordance with Ponomarenko (1997b: 10) and
Elsner et al. (1999: 57) we therefore treat Telephila as a synonym of Acompsia, how-
ever, giving it subgeneric rank.
Table 1. Important diagnostic characters of subgenera Acompsia and Telephila
Labial palpus segment 2 without ventral scale brush with strong ventral scale brush
Sclerites of vinculum distally enlarged without distal broadening
Vesica distal part sclerotized, spiralled | distal part not sclerotized, nor
spiralled
Entrance of ductus seminalis with strong sclerite without sclerite
into corpus bursae
Meyrick (1925: 142) treated the genera Cathegesis Walsingham, 1910, and Oxypteryx
Rebel, 1911, as synonyms of Acompsia. Oxypteryx, with its only species jordanella
Rebel, 1911, has been treated as separate from Acompsia since Amsel (1935: 265).
Cathegesis, with its three Neotropical species (angulifera Walsingham, 1897,
psoricopterella (Walsingham, 1892) and vinitincta (Walsingham, 1910)) (Meyrick 1925:
142; Becker 1984: 49) is not congeneric with Acompsia (Sattler, pers. comm.).
In the past a number of non-Palaearctic species have been assigned to Acompsia
and Zelephila. Meyrick (1925) listed 15 species in Acompsia and four in Telephila.
In addition to the four species listed above the following have been transferred to
other genera: formosella (Hübner, 1825) (= eburnella ([Denis & Schiffermiiller],
1775)), flavella (Duponchel, 1844) and pallidipulchra (Walsingham, 1904) to
Mirificarma Gozmany, 1955 (Pitkin 1984); /abradorica (Möschler, 1864) to
Chionodes Hiibner, 1825 (Hodges 1983: 22); delotella (Busck, 1909) and vacciniella
(Busck, 1915) to Dichomeris Hiibner (Hodges 1986: 46, 76), oenochyta (Meyrick,
1921) to Leuronoma Meyrick, 1918 (Janse 1958: 43) and sphenopis (Meyrick, 1921)
to Schizovalva Jamse, 1951 (Janse 1960: 224). Ypsolophus plasticus Meyrick, 1904,
from Australia, which was included in Telephila by Meyrick (1923: 626), is a
Dichomeris (Sattler, pers. comm.). Gaede (1937: 386) also placed Rhinosia striolella
Turati, 1924, in Acompsia, but it is a synonym of Mirificarma pallidipulchra
(Walsingham, 1904) (Pitkin 1984: 24).
Acompsia tenebrosella Lucas, 1955, described from a single male from Morocco
(Lucas, 1955: 255) was stated to be related to A. cinerella. We have been unable to
study the holotype, but based on the short description which is not accompanied by
any figure we are of the opinion that fenebrosella is not an Acompsia.
Subgenus Acompsia Subgenus Telephila
114 HUEMER & KARSHOLT: The genus Acompsia
Remarks. Characters mentioned under the generic description apply to all spe-
cies and are not repeated.
Species of Acompsia may best be identified by external characters such as the wing
colour, presence/absence of spots, size and wing-shape. In the male genitalia the most
reliable specific characters are found in the shape of the sacculus and the aedeagus.
The female genitalia are rather similar between the various species with usually only
minor differences in the anterior sclerotizations of sternite VIII, length of the ductus
bursae, size of corpus bursae and the field of microtrichia.
The sequence of species is based on important genitalic characters mainly the dorsal
sclerotizations of the aedeagus. The short, weakly dentate sclerite is regarded as the
plesiomorphic state. In one group of sg. Acompsia this sclerite is gradually reduced,
whereas in the other it is developed to a large spine. However, the sequence does not
necessarily reflect the puyiceeay of the group which still requires further investiga-
tion.
Subgenus Acompsia
Acompsia (Acompsia) cinerella (Clerck, 1759: pl. 11, fig. 6) (Phalaena)
Phalaena murinella Scopoli 1763: 256.
Tinea ardeliella Hübner 1817: pl. 65, fig. 437.
Recurvaria cinerea Haworth, 1828: 547.
Lita spodiella Treitschke 1833: 78.
Material examined. Norway: 14, Vay, Kristiansand, Sogne, 7.—9.vii.1979, leg. Pedersen; 24,
Kjendalsbr&, 17.vii.1983, leg. Thomsen; 12, On, Vinstra, 4.-5.vii.1984, leg. Karsholt; 3d, ditto, but
11.vi.1985, leg. Karsholt & Michelsen (all ZMUC). Denmark: 1¢, NEZ, Grib Skov, Lods Bakker,
8.vill.1984, leg Hendriksen (gen. slide HH 873) (HEND); 1d, SZ, Frederikslund, 5.vi.1937, leg. Nielsen
(gen. slide PKN 6008); 12, NEZ, Alindelille, 2.vii.1963, leg. Nielsen (gen. slide PKN 6002); 16,
NEZ, Hundested, 9.vii.1949, leg. Lundqvist (gen. slide JL 777); 12, LFM, Hannenov, 16.viii.1969, leg.
Lundqvist (gen. slide JL 778); 12, LFM, Hovblege, 6.ix.1987, leg. Hendriksen (gen. slide HH 2218);
18,19, ditto, but 30.vii.1961 & 16.viii.1969, leg. Traugott-Olsen (gen. slide ETO1466%, 14774 );
1346, 159 further, undissected specimens from Denmark (all ZMUC). Sweden: 24, Sm, Gardby, 1.—
3.vil. 1965, leg. Johansson: Ög, Ödeshög, 17.vii.1972, leg. Karsholt (ZMUC); le. ÖL, Seberneby,
19.vii. 1975, leg. Karsholt; 14, Gtl, Hamra, Holmhäller, 21.-24.vii.1985, leg. Karsholt (all ZMUC).
Finland: 15, ‚N, Vantaa, 18.-25.vi.1968, leg. Laasonen; 15 „Ka, Virolathi, 10.-16.vii.1973, leg. Laasonen;
1d, ditto, but 1.-16.vii.1974; 13, N, Tirmo, 19.—20.vii.1980, leg. Fibiger (all ZMUC). Russia: 76, SW
Altai, Katun valley, 10 km W Katanda, 1200 m, 22.-27.v1.1983, leg. Mikkola, Hippa & Jalava (ZMUH);
1d, Primorskii Kraj, Shkotovo distr., Anisimovka, 27.vii.1994, leg. Savenkov (gen. slide HH 3385)
(ZMUC); 16, Transbaikalia, Chita, 27.vii.1997, leg. Bidzilya, I. & O. Kostjuk (ZMUH). Estonia: Taheva,
21.vi.2000, leg. Viidalep (ZMUC). Poland: 13, Puszcza Bialowieza, Park narod, 23.viii.1965, leg.
Adamczewski; 18, Suwalki, Okragle, 12.vi.1988, leg. Karsholt; 14, Podlaskie, Bialowieza, 29.v.—
1.vi.2000, leg. Karsholt (all ZMUC). Slovakia: 19, Viniansky hrad, 25.v.2000, leg. Karsholt. Germany:
13, 12, Württemberg, Markgröningen, Rotenacker, 25.vii.1979, leg. Süssner (gen. slide GEL 8816,
GEL 1048); 12, Württemberg, Schwäbische Alb, Seeburg, 650 m, 13.vi.1977, leg. Süssner; 1d, ditto,
but 20.vi.1974; 24, Württemberg, Marbach — Neckar, 19.vi. & 7.viii.1954, leg. Süssner; 19, ditto, but
25.vi.1955; 19, ditto, but 30.vi.1956; 135, Württemberg, Schwarzwald, Zwickgabel, 4.vii.1965, leg.
Süssner; 1d, Württemberg, Bissingen — Enz, 1.vi.1961, leg. Süssner; 12, Württemberg, Oberstenfeld,
Forstkopf, 7.vii.1972, leg. Süssner; 14, Bayern, Langwied, 490 m, late viii.1977, leg. Zürnbauer; 16,
Bayern, Wangen, 600 m, late vi.1973, leg. Zürnbauer; 24 , Bayern, Neurieder Forst, 520 m, late vi.1962,
leg. Zürnbauer; 14, Bayern, Inning, 550 m, early vi.1966, leg. Zürnbauer; 1?, Bayern, Eching, mid-
vii.1949, leg. Pfister; 18, Bayern, Schliersee, 8.vi.1943, leg. Geltinger (all TLMF). Great Britain: 1d,
Norfolk, Briston by Melton Constable, 10.vii.1973, Rothamsted Exp. Station (ZMUC). France: 2d,
Hautes Alpes, Les Vigneaux, 1200 m, 25.vii.1990, leg. Huemer & Tarmann; 1, Prelles, 1200 m, early
viii.1974, leg. Zürnbauer (all TLMF); 26, Isère, Séchilienne, 1000 m, 29.-30.vi.1990, leg. Schepler;
14, Alp. Cottiennes, Col de Vars, 2100 m, 16.viii.1995, leg. Schepler (gen. slide HH 3382); 14, Ecrins,
Nota lepid. 25 (2/3): 109-151 115
Allefroide, 1800 m, 18.v1i1.1995, leg. Schepler (all ZMUC). Andorra: 24 , Arnisal, 1500 m, 1.viii.1997,
leg. Baungaard (ZMUC). Spain: 14, Huesca, Penalba, 250 m, 17.x.1984, leg. Nielsen; 34, Gerona,
Bruguera by Ripoll, 1700 m, 12.vii.1988, leg. Fibiger (gen. slide GU 01/1072); 12, Gerona, Ribes,
above Bruguera, 1650 m, 14.viii.2001, leg. Skou; 2d, Lerida, 15 km W La Seu d’Urgell, Pt. Del Canto,
1650 m, 6.vii.1993, leg. Fibiger; 1 d , Lerida, Roni near Sort, 1000 m, 7.vii.1993, leg. Skou (all ZMUC);
14,19, San Ildefonso, Escalera (gen. slide 16.5343) (NHMW). Italy: 16, Südtirol, Naturns, 660 m,
mid-ix.1965, leg. Zürnbauer (TLMF); 19, Südtirol, Montiggl, Kl. Priol, 600 m, 26.vi.1993, leg. Huemer
(TLMF); 16, Verona, Garda, Mt. Bre, 16.-30.v.1982, leg. Olsen; 14, Verona, Monte Baldo, Ferrara,
1100 m, 27.-29.vi.1981, leg. Skou & Skule; 29, Verona, Monte Baldo, above Prada, 1200 m, 22.vii.1989,
leg. Karsholt; 1d, Prov. Izernia, Pizzone, dint. Valle Fiorita, 1450 m, 14.—21.v1i.1990, leg. Baldizzone,
Barbero & Bassi (gen. slide HH 3381) (all ZMUC); 39, Piemonte, Cueno, Parco Natur. Reg. Alpi,
Marittime, S. Giac. di Entracque, sent. Rifugio Soria, Gias Isterpis, 1381 m, 19.vii.1996, leg. Baldizzone;
26 , ditto, but S. Giaccomo di Entracque, sopra Lago della Rovina (Rocca Barbis), 1550-2000 m, 20.—
. 26.vii.1997; 14, ditto, but Entracque, Trinta, 1100 m, 28.vii.1997; 12, ditto, but S. Anna di Valdieri,
dint. Lago Sottano d. Sella, 1900 m, 16.vii.1998; 14, ditto, but Valdieri, 900 m, 11.vi.1999; 16, ditto,
but Terme di Valdieri, Valle della Valletta, 1450-1650 m, 19.vii.1999; 19, ditto, but dint. di Entracque,
Mte Ray, 1000-1400 m, 18.vi1.2000 (BLDZ, ZMUC). Switzerland: 1 4, Appenzell, Seealptal, 1000 m,
28.vi.1958, leg. Malicky (gen. slide 894 Malicky); 1 6, Graubünden, Landquart, 12.vi.1918, leg. Thomann
(all TLMF). Austria: 1d, Nordtirol, Nauders, Seleskopf, 1600 m, 24.vii.1955, leg. Süssner (gen. slide
GEL 78); 23, Nordtirol, Gurgltal, N Dollinger, 800 m, 30.vii.1991, leg. Cerny; 1d, Nordtirol, Pinegg,
1000 m, late vi.1971, leg. Zürnbauer; 1 4, Nordtirol, Innsbruck, 24.v1i.1958, leg. Hernegger; 14, ditto,
but 1.vii.1965; 16d, ditto, but 7.vii.1970; 19, ditto, but 28.v.1970; 12, Nordtirol, Seegrube, 27.vii.1961,
leg. Hernegger; 14, Nordtirol, Arzler Alm, 1200 m, 10.vi.1971, leg. Hernegger; 12, Nordtirol, Zirl,
30.viii.1970, leg. Hernegger; 12, Nordtirol, Valsertal, 24.vii.1969, leg. Hernegger; 2d, Osttirol,
Venedigergruppe, Dorfertal, 1520 m, 8.v11.1993, leg. Huemer; 24, Osttirol, Virgen, Nilbach, 1800 m,
16.vili.1993, leg. Rakosy; 24, Osttirol, Virgen, Obermauern, 1400 m, 14.v111.1993, leg. Rakosy; 16,
Osttirol, Venedigergruppe, Maurertal, 1550 m, 22.vi.1993, leg. Huemer; 24, Osttirol, Prägraten, St.
Andrä N, 1420 m, 23.vi.1993, leg. Huemer & Tarmann; 1 4, Osttirol, Schobergruppe, Stanis Alm, 2000
m, 10.viii.1990, leg. Tarmann; 1 à , ditto, but 8.viii.1988; 19,22, Osttirol, Kartitsch, 1600 m, 15.vii.1964,
leg. Süssner (gen. slide GEL 8786, GEL 8792); 1d, Oberösterreich, O. Weißenbach, 7.vii.1923, leg.
Knitschke; 1d, Niederösterreich, Schneeberg, 23.vi.1910; 1 4, Niederösterreich, Melk, 14.vii.1909, leg.
Zerny; 26 , Burgenland, Winden, 10.vi.1970, leg. Zürnbauer (all TLMF); 23, Burgenland, Illmitz / See,
1.1x.1973, leg. Glaser; 12, Osttirol, Lienz, 700 m, 7.vii.1981, leg. Schnack; 19, Osttirol, Tessenberg,
1400 m, 12.-15.vii.1981, leg. Schnack; 1 2, Osttirol, Glocknergruppe, below Kals, 1100 m, 28.vii.1991,
leg. Karsholt & Rakosy (genitalia in tube); 1d, ditto, but Burg bei Kals, 28.-31.vii.1991, leg. Karsholt &
Rakosy; 1 ©, ditto, but Mauriger Trog, 2100 m, 30.vii.1991, leg. Karsholt, Rakosy & Tarmann; 24, 19,
ditto, but Loweraze, 1600-1860 m, 30.-31.v11.1991, leg. Karsholt, Rakosy & Tarmann (all ZMUC).
Hungary: 1 4 , Visegrad, 8.vii.1997, leg. Larsen (ZMUC). Slovenia: 24 , Nanos, 29.ix.1983, leg. Deutsch
(gen. slide GEL 52) (TLMF). Croatia: 1 4, Slavonia, Fruska Gora, 28.vi.-12.v11.1935, leg. Daniel (ZSM).
Yugoslavia (Montenegro): 14, Durmitor, Komarnica, 1400 m, 24.vii.1985, leg. Jaksic (TLMF). Roma-
nia: 1d, B. Ouia, Sibu, 3.viii.1984, leg. Rakosy (ZMUC); 24, Lacu Rosu, Suhardu Mic, 1450 m,
8.viii.1992, leg. Rakosy (TLMF); 14, Herculana, 8.vi.1993, leg. Rakosy (ZMUC). Bulgaria: 14,
Stanimaka, 1.—10.vii.1933, leg. Pfeiffer (ZSM). Greece: 42, Lakonia, Mt. Taygetos, 1000 m, 28.—
29.vi.1982, leg. Skule & Langemark; 2¢, 19, Lakonia, Mt. Taygetos, above Trapezandi, 1500 m,
5.vii.1984, leg. Skule (gen. slide GU 01/1069); 23, Taygetos mts., 950-1800 m, 15.-19.v.1990, leg.
Karsholt; 23, Florina, 5 km NW Pisoderion, 2000 m, 21.vii.1990, leg. Fibiger; 15, 19, Fthiotida,
Parnassos mts., below skicenter, 21.vii.1998, 1650 m, leg. Skule & Nilsson; 34, 12, Makedhonia/
Thessalia, Olympos, 700-2100 m, 21.-26.v.1990, leg. Karsholt (gen. slide GU 02/1118); 1d, 19,
Kastoria, 6 km E Eptachori, 1400 m, 13.vii.1998, leg. Skule & Nilsson; 23, 19, Florina, | km NW
Pisoderi, 1600, 14.vii.1998, leg. Skule & Nilsson (all ZMUC). Turkey: 14, Ankara, 20 km NW
Kizilcahaman, 1200 m, 1.vii.1987, leg. Fibiger; 22, Ankara, 10 km NW Kizilcahaman, 1150-1250 m,
6.-7.vi1.1989, leg. Fibiger & Esser; 5d, Gümüshane, Kop Pas, 2300 m, 19.v11.1989, leg. Fibiger & Esser
(gen. slide HH 3548); 35, 21 km S Kayseri, Erciyes Dagi, 2200 m, 29.vii.1989, leg. Fibiger & Esser
(gen. slide HH 3547); 1d, ditto, but 25 km S Kayseri, 2800 m (all ZMUC). Armenia: 2d, 19, Geghard,
40 km E Eriwan, 1700 m, 24.-27.v11.1976, leg. Kasy & Vartian (NHMW).
Male (Fig. 1). Wingspan 15-19 mm. Labial palpus long, slender; segment 2 brown;
segment 3 yellow brown, both segments lighter on inner surface. Antenna dark brown,
slightly lighter ringed. Forewing clay brown, sometimes with olive tint, faintly mixed
with yellow; veins at end of cell and in apical part occasionally darker; weak dark spot
rarely present at end of cell; fringes uniformly light brown. Hindwing brown grey,
with light brown fringes.
116 HUEMER & KARSHOLT: The genus Acompsia
Female (Fig. 2). Wingspan 13-17 mm. Similar to male but smaller on average
and with forewing slightly narrower; colour of forewing often darker clay brown.
Male genitalia (Figs. 25, 42). Uncus rounded distally; cucullus with particu-
larly long dilated part; sacculus lobe almost completely covered with microtrichia,
sub-triangular, comparatively small, with long and straight distoventral (outer) mar-
gin; aedeagus with short, weakly dentate sclerite.
Female genitalia (Figs. 59-60). Apopyhses posteriores about 1.5 times length
of papillae anales; apophyses anteriores about length of segment VIII; sternite VIII
with distinct, short medial sclerotizations; ductus bursae long; corpus bursae with large
patch of microtrichia.
Distribution. Widely distributed in most parts of Europe (Karsholt & Riedl
1996: 121), and Turkey through Siberia to the Far East of Russia. Also recorded from
Kazakhstan (Ponomarenko 1997b: 10).
Biology. The larva was described by Sorhagen (1902: 56-57) — based on the
description and a water-colour made by C. W. L. Grabow, the father in law of O.
Staudinger (Sorhagen 1901: 241): rather slim, especially towards end, greenish grey;
head brown, prothoracic shield and legs black; abdominal legs concolorous with
body; back with four dark warts on each segment, laterally beneath anterior pair
another one; larva wrinkled beneath faint, light lateral line, with two rather long
bristles above each other, upper (anterior) shorter. It lives until June between moss at
the base of trees growing in forests, feeding on the moss; it is very shy, quickly
disappearing into the moss. According to Lhomme (1948: 655) Chrétien bred A.
cinerella from eggs on Veronica chamaedrys L. (Scrophulariaceae). Chrétien (1900:
202) himself informs that Milliere found larvae of A. cinerella in September on
Epilobium montanum L. (Onagraceae). It is unclear if the larva of A. cinerella 1s
polyphagous or if some of the host records above refer to other species. The adults
. fly from late May to mid-October, normal from June to August. The adult occurs in
various, mainly open habitats. It is readily attracted to light. Vertical distribution:
from sea level to about 2300 m.
Remarks... cinerella is rather constant in colour and the absence of wing mark-
ings throughout its distribution range. Specimens from SE Europe often have more
yellow scales in the forewing. The largest specimens are normally found in southern
European populations. The presence of a weak, dark spot at the end of the forewing
cell is apparently not geographically correlated, even though it is often present in speci-
mens from Turkey.
Phalaena cinerella was based on an unspecified number of specimens, probably
from Sweden, and figured by Clerck. A lectotype was designated by Robinson & Nielsen
(1983: 206).
Phalaena murinella was described from an unspecified number of specimens col-
lected in lower Carniolia (Slovenia) (Scopoli 1763). The identity of this species is
doubtful but the description does not contradict the hitherto accepted interpretation, of
which there has been consensus since it was published by Werneburg (1864: 279).
Tinea ardeliella was described from an unspecified number of specimens probably
from central Europe and figured by Hübner without accompanying text. Hübner (1796:
Nota lepid. 25 (2/3): 109-151 REZ
59, pl. 25, fig. 173) had already described and figured cinerella Clerck (as cinerella
Linnaeus), but because of later doubt another specimen was later figured under the
name ardeliella (Treitschke 1833: 78, 81).
Lita spodiella was described as uncommon (‘nicht häufig’) from Austria and Sachsen
(Treitschke 1833). It was synonymized with A. cinerella by Zeller (1839: 198). De-
spite of all efforts by Dr. L. Gozmany no labels nor type specimens could be found in
the Hungarian Natural History Museum (Treitschke collection).
Recurvaria cinerea Haworth is an unjustified emendation of Phalaena cinerella
Clerck.
Acompsia (Acompsia) pyrenaella sp. n.
Material examined. Holotype & ‘Gallia Pyren. Val. d’Ossoue 1500 m 17.7.61 K.Burmann’ ‘GEL 1063
G P. Huemer’ (TLMF). Paratypes: France: 14, C Pyrenées, Gavarnie, Col de Bucharo, 2200 m, 6.—
7.v11.1986, leg. Grünewald (GRUN); 1d, Pic du Midi de Bigorre, 2400 m, 3.viii.1981, leg. Sattler, Tuck
& Robinson (gen. slide BM 26.577); on ditto, but 2650 m, 4.vi11.1981 (gen. slide OG. STB) ISSN
Canigou, 2200 m, 30.vii.1981, leg. Sattler, Tuck & Robinson (all BMNH). Andorra: 5d, by Pto. de
Envalira, 2300 m, 1.v111.1988, leg. Fibiger (gen. slide HH 3540, 3541); 1 4, Arnisal, 1500 m, 1.viii.1997,
leg. Baungaard (gen. slide HH 3575) (all ZMUC). Spain: 1d, Lerida, Puerta la Bonaigua, 2000 m,
21.vii.1972, leg. Dicksen (BMNH); 116, ditto, but 2050 m, 31.vii.1988, leg. Fibiger (gen. slide GU 01/
1036) (ZMUC, TLMF); 1d, E Pyrenées, Col de Puymerons, 1900 m, 4.—S.viii.1980, leg. Grünewald
(GRÜN).
Male (Fig. 3). 18-21 mm. Labial palpus long, slender; segment 2 dark brown on
outer surface, other surfaces and apical part lighter; segment 3 greyish brown, mottled
with yellow. Antenna brown, indistinctly lighter ringed. Forewing brown, with groups
of black scales, especially between veins; basal half of costal area slightly lighter than
rest of the forewing; three small, black spots: one (sometimes) elongate in fold, one
above it and one at end of cell; termen emarginated below apex, with small, black
spots at end of veins; cilia only slightly lighter than forewing. Hindwing light grey,
with light yellow grey cilia.
Female (Fig. 4). 15 mm. Reasonably brachypterous, with forewings only about
half as broad as in male. Forewing dark grey-brown, mottled with light grey (especially
along costa), yellow and black scales; two black spots at 1/3 and 2/3; termen oblique,
without or with small black spots at end of veins. Hindwing grey, with grey cilia.
Male genitalia (Figs. 26, 43). Uncus comparatively small, slightly dilated
distally; cucullus with short dilated part; sacculus lobe sub-oval, moderately small,
distinctly curved distally, distoventral (outer) margin strongly excavated; apices of
vinculum arms broad; aedeagus with small undentate dorsal sclerite.
Female genitalia (Figs. 61-62). Apopyhses posteriores about two times
length of papillae anales; apophyses anteriores about length of segment VIII; sternite
VIII with indistinct medial sclerotizations; ductus bursae comparatively long, narrow,
with distinct sclerite anteriorly; corpus bursae very large, with small patch of
microtrichia.
Distribution. Endemic to the Pyrenees.
Biology. Host-plant and early stages unknown. Specimens have been caught
from early July to early August, mostly at light. Vertical distribution: altitudes between
1500 and 2650 m.
118 HUEMER & KARSHOLT: The genus Acompsia
Remarks. The male of A. pyrenaella sp. n. is very similar to that of A. antirrhinella,
but the latter has more distinct black dots in the middle of the forewing and along the
termen. The female shows a clear tendency to brachyptery and is also distinctly smaller
than the male. Also the genitalia of both taxa are very close, mainly differing in the
distinctly broadened distal part of the vinculum arms and the distinct sclerite in the
anterior part of the ductus bursae in A. pyrenaella sp. n. However, it should be pointed
out that only one female could be examined.
This species was repeatedly mistaken for A. tripunctella in various collections.
Etymology. Named after the type region.
Acompsia (Acompsia) antirrhinella (Milliere, 1866: 274, 280, pl. 80, figs 6-8)
(Gelechia) ug
Material examined. France: 1d, Cannes, leg. Milliére (gen. slide BM 13.925) (BMNH); Ko,
Hautes Alpes, Eygliers, Guillestre, 1000 m, 27.vi.1985, leg. Stadel Nielsen; 1d, ditto, but 27.vi. 1985
(gen. slide GU 02/1120); 14, Vaucluse, Mont Ventoux, 6 km nw of Sault, 1100 m, LI viii. 1996, leg.
Skou; 7d, Alp. Mar., Esteng by Col de la Cayolle, 1850 m, 9.vii.1988, leg. Fibiger (gen. slide HH 3539):
OS Pyr. Orient., La Preste, Prats de Mollo, 1420 m, 11.vii.1988, leg. Fibiger (gen. slide GU 02/1080)
(all ZMUC); 14, Super-Lioran, Rousseau des Tripas, 26.vii.1994, leg. Gibeaux (gen. slide GEL 866)
(TLMF). Andorra: 1 2, Port de Cabus, 2300-2500 m, 27.vii.1981, leg. Sattler, Tuck & Robinson (BMNH).
Spain: 12, Pyrenees, Caralps, 1.-3.vii.1960, leg. Vartian (gen. slide NM 16.638) (NHMW); 16, Teruel,
Albarracin, 22.—30.vi.1924, leg. Zerny (gen. slide NM 16.537) (NHMW); 34, ditto, but 1200 m, 25.—
26.vi.1992, leg. Skou & Skule (gen. slide HH 3542); 26, ditto, but 16.vii.1992, leg. Fibiger (gen. slide
HH 3545); 14, Gerona, Bruguerra by Ripoll, 1700 m, 12.vii.1988, leg. Fibiger (gen. slide HH 3387);
13, Gerona, Montseny by Coll de Rabell, 1700 m, 13.vii.1988, leg. Fibiger (gen. slide HH 3543); 16,
Lerida, 15 km W La Seu d’Urgell, Pt. del Canto, 1650 m, 6.vii.1992, leg. Fibiger; 1d, Huesca, 3 km W
Laco Urdiceto, 2150 m, 20.vii.1992, leg. Fibiger; 1, Huesca, 12 km N Bielsa, by Tunnel, 1900 m,
22.v11.1992, leg. Fibiger (gen. slide HH 3544) (all ZMUC).
Male (Fig. 5). Wingspan 17-23 mm. Labial palpus long, slender; segment 2 dark
brown on outer surface, other surfaces and apical part lighter; segment 3 greyish brown,
mottled with yellow. Antenna brown, indistinctly lighter ringed. Forewing plain brown
to greyish brown, more or less mottled with black brown scales, especially between
veins; three distinct, black spots: one in cell, one above it, slightly closer to base, and
one at end of cell; termen emarginated below apex, with a row of distinct, black spots
at the end of veins; cilia slightly hebt than forewing. Hindwing grey, with light yel-
low-grey fringes.
Female (Fig. 6). Wingspan 17-20 mm. Similar to male but with more contrast-
ing forewings than males because of many brown and black scales; also the basal half
ofthe costal area in the forewing is lighter.
Male genitalia (Figs. 27, 44). Uncus rounded apically; cucullus with strongly
dilated part; sacculus lobe sub-oval, small, with weakly excavated distoventral (outer)
margin; apices of vinculum arms small; aedeagus with small dorsal sclerite, not dentate.
Female genitalia (Figs. 63-64). Papillae anales large; apopyhses posteriores
about 1.5 times length of papillae anales; apophyses anteriores longer than short seg-
ment VIII; sternite VIII without prolonged medial sclerotizations; ductus bursae com-
paratively long, narrow, without distinct sclerites anteriorly; corpus bursae very large,
with small patch of microtrichia.
Nota lepid. 25 (2/3): 109-151 119
Distribution. Only known from northern part of Spain, Andorra and southern
part of France.
Biology. The larva is long, tube-like, a little flattened underneath, dark green to
almost black in the final instar; head red, bordered with black at the top; collar whitish;
the prothoracic plate coloured as the head, is also bordered with black; thoracic legs
brown and shining; abdomen without lines, but with distinct black warts; abdominal
legs unicolorous. It feeds from March to the end of May under a whitish, silken spin-
ning, which has the ends attached to one or more leaves of Asarina procumbens Miller
(=Antirrhinum asarina L.) (Scrophulariaceae), growing in the crevices of old walls or
between rocks. Pupation takes place at the basis of the plant, between dried leaves, or
sometimes on the plant, in a folded leaf (Milliere, 1867: 382-383). The adult flies from
late June into August. Vertical distribution: from sea level to about 2300 m.
Milliere (1867: 384) was of the opinion that A. antirrhinella hibernates in the adult
state (based on some worn specimens collected in March). We believe that some mis-
take may have happened, and his record needs confirmation.
Remarks. A. antirrhinella is most closely related to A. pyrenaella sp. n.; for
differences see under that species.
Gelechia antirrhinella was described twice by Milliere (1866, 1867). We have only
seen the latter of these descriptions, but according to Sattler & Tremewan (1973: 226)
they are identical.
Acompsia (Acompsia) maculosella (Stainton, 1851: 22) (Gelechia)
Material examined. Lectotype 9 (here designated) ‘Mann 1849’ ‘ Maculosella’ ‘Stainton Coll.,
Brit. Mus. 1893-134’ ‘Ex Stainton coll., (J. Mann, Vienna), Suppl. Cat. Br. Tin. Pter. App.:22, 1851’.
Germany: 1 4, Hirschbachtal, 920 m, M.vii.1965, leg. Ziirnbauer; 1 2, Berchtesgadener Alpen, Trischübel,
1800-2100 m, A.viii.1950, leg. Pfister (gen. slide) (all TLMF); 19, Karwendel, 1900 m, mid-vii.1976,
leg. Ziirnbauer (gen. slide 4104 Tokar). Switzerland: 1d, Appenzell, Ebenalpe, 1600 m, 24.vii.1990, leg.
Oswald (TLMF). Austria: 1 d, Steiermark, Reichenstein, 4.vii.1919 (gen. slide GEL 491); 14, Radstatter
Tauern, Seekarspitze, 2300 m, 3.-10.viii.1940, leg. Zerny (gen. slide GEL 381) (all TLMF); 1 d, Kärnten;
1d, Kärnten, Grossglockner, 2000 m, 9.vii.1981, leg. Schnack; 1 4, Nordtirol, Rossfall, 1200 m, 5.vi.1961,
leg. Hernoppel (all ZMUC); 1d, Osttirol, Matrei, Lukaser Kreuz, 1200 m, 18.vii.1962, leg. Süssner
(gen. slide GEL 488); 24 , Osttirol, Lasörlinggruppe, Schwarzachtal, In der Weisse, 2450 m, 14.vin.1989,
leg. Tarmann; 1d, Osttirol, Venedigergruppe, Malhambach-Talgrund, 2350-2450 m, 3.viii.1993, leg.
Rakosy & Tarmann; 1 4, Osttirol, Venedigergruppe, Essen-Rostocker-Hiitte, 2600-2650 m, 4.v111.1993,
leg. Rakosy; 1d, Osttirol, Venedigergruppe, Maurer Alpe, 2300-2500 m, 5.viii.1993, leg. Rakosy; 14,
Nordtirol, Ellmau, 1.vii.1956, leg. Hernegger; 1 ©, Nordtirol, Vennatal, 2000 m, 16.vii.1942, leg. Scholz
(gen. slide GEL 1046); 1d, Nordtirol, Rißtal, Hagelhütten, 1050 m, 3.viii.1993, leg. Huemer; 26 , Nordtirol,
Weißenbach, Errachau, 920 m, 9.vi.1989, leg. Huemer; 1d, ditto, but 17.vi.1989, leg. Kahlen; 16, St.
Anton am Arlberg, Schöngraben, 1400 m, 11.7.1959, leg. Süssner; 1 4, Vorarlberg, Lech-Oberlech, 1700
m, 28.vii.1954, leg. Süssner; 1 d, Vorarlberg, Mittelberg, 15.vii.1953, leg. Süssner (all TLMF). Slovenia:
1d, Kamn, Veliki Zvoh south slope, 1700 m, 20.vii.1993, leg. Habeler (gen. slide GEL 189) (TLMF).
Male (Fig. 7). Wingspan 16-21 mm. Labial palpus long, slender; segment 2 dark
brown, with light apical ring, yellow on inner surface; segment 3 dark brown, mottled
with light brown. Antenna dark brown, indistinctly lighter ringed. Forewing clay brown,
mottled with lighter brown scales; three distinct black spots: one more or less elongate
in fold, one (distinct) round above it, slightly closer to base, and one similar to the
second one at end of cell; between the latter spot and costa a sub-triangular, black
120 HUEMER & KARSHOLT: The genus Acompsia
patch; veins in apical part sometimes darker; termen slightly emarginated below apex;
termen line with distinct black spots at end of veins; fringes light brown. Hindwing
grey, with yellow grey fringes.
Female. Wingspan 16 mm. Similar to male, but smaller on the average. Forewing
with light yellow subcostal line in basal half; black spots reduced and indistinct; apical
part more mottled with yellow scales; termen more distinctly emarginated below apex.
Male genitalia (Figs. 28, 45). — Uncus dilated apically; cucullus with rather
short dilated part; sacculus lobe sub-oval, comparatively small, weakly curved distally,
with scarcely excavated distoventral (outer) margin; aedeagus without dentate sclerite.
Female genitalia (Figs. 65—66). Papillae anales large; apopyhses posteriores
about 1.5 times length of papillae anales; sternite VIII without prolonged medial
sclerotizations; ductus bursae comparatively long; corpus bursae rather small, with
small patch of microtrichia.
Distribution. Posstbly endemic to the central and eastern parts of the Alps:
Austria, Slovenia, Switzerland; Italy (Karsholt & Riedl 1996: 121) and Germany
(Gaedike & Heinicke 1999: 85). We have been unable to confirm the presence of A.
maculosella in France, including the Pyrenees (see Elsner et al. 1999: 57). Rebel (1917:
193) recorded a specimen from the Tannu Ola Mts. (Russia, Tuvinskaya Oblast). We
have been unable to trace this material in NHMW.
Biology. Host-plant and early stages unknown. Flight period: July to August.
The adult occurs in various montane habitats, particularly subalpine to alpine mead-
ows and shrub-formations. It flies freely during the day or can be roused from the
vegetation. Occasionally it is also attracted to artificial light. Vertical distribution: from
about 900 to 2600 m.
Remarks. A. maculosella is easily recognizable by the characteristic, dark sub-
costal patch. In the past it was considered by some authors (see Gaede 1937: 387) as a
synonym (form) of 4. tripunctella. However, both species are not very closely related
as proved by the genitalia. Gelechia maculosella was described from an unspecified
number of specimens (Stainton 1851), which most probably were collected by Mann
in the Austrian Alps. The above mentioned specimen is here designated as lectotype to
fix the status of the species.
Acompsia (Acompsia) dimorpha Petry, 1904: 4
Nia terial ex amimned? Lectotype 3 (here designated) ‘Pyrenaei centr., F 24/7 1901, Pic du Midi de
Bigorre, Dr. A. Petry legit.’ ‘Sammlung A. Petry’ ‘Museum Erfurt’ ‘Lectotype 3, Acompsia dimorpha
Petry, teste K. Sattler 1977’ “SPECIMEN PHOTOGRAPHED’ (MNG). France: 20 , 19, paralectotypes,
same data as holotype (MNG); 1 à , Htes. Pyrénées, Cédre, bred 1904, leg. Rondou (MNG); 1d, Pyrenees
cent., Pic du Midi de Bigorre, 2400 m, 2.viii.1981, leg. Sattler, Tuck & Robinson; 1 à, ditto, but 3.vi. 1981
(gen. slide BM 26.575); 1 à , ditto, but pupa on 3.viii. under rock, emerged 9.viii.1981; 19, ditto, but pupa
on 3.viii. under rock, emerged 12.viii.1981 (gen. slide BM 26.576) (all BMNH). Spain: 1d, Pyrenees cent.,
Monte Perdido, vic. Ref. Goriz, 2350 m, 1.viii.1990, leg. Sommerer (gen. slide GEL 875) (TLMF).
Male (Fig. 9). Wingspan 16-20 mm. Labial palpus comparatively long, slender.
Antenna dark brown. Forewing narrower than in A. tripunctella, greyish to black brown,
mottled with light yellow or light greyish scales; four indistinct, but rather large spots:
one near base, one (obscure) in fold, one above it, and one (more distinct) at end of
Nota lepid. 25 (2/3): 109-151 121
cell; termen slightly emarginated below apex, sometimes with a few dark scales at end
of veins; cilia light greyish brown, with faint cilia line. Hındwing light grey, with light
yellow grey fringes. .
Female (Fig. 10). Wingspan 11-13 mm. Brachypterous. Labial palpus black
brown, mottled with yellow. Antenna dark brown. Forewing not longer than antenna,
eliptical, black brown, mottled with many yellow and light brown scales; indistinct,
black spots at 1/4 2/4 and 3/4 fringes sparse, light yellow grey. Hindwing narrow,
without emarginated termen below apex, light grey, darker at apex; fringes as in
forewing. Hindlegs strong.
Male genitalia (Figs. 29, 46). Uncus brod, sub-rectangular; cucullus with com-
paratively long dilated part; sacculus lobe sub-oval, comparatively small, with weakly
and irregularly excavated distoventral (outer) margin; aedeagus without dorsal sclerite.
Female genitalia (Figs. 67-68). Apopyhses posteriores about 2.5 times length
of papillae anales; apophyses anteriores comparatively long; sternite VIII without pro-
longed medial sclerotizations; ductus bursae comparatively long; corpus bursae rather
small, with small patch of microtrichia.
Distribution. Endemic to the French and Spanish Pyrenees.
Biology. Host-plant and early stages unknown. The pupal stage has been found
under stones. Adults were collected and bred from late July to early August. A. dimorpha
is restricted to the alpine zone where it may occur together with A. pyrenaella sp. n.
Vertical distribution: recorded from about 2300 to 2400 m.
Remarks. A. dimorpha ıs easily characterized by the strongly brachypterous
female which is (from our present knowledge) unique in the genus. Other species of
Acompsia only show a slight to moderate tendency to brachyptery.
A. dimorpha was described from 1 female and 3 male syntypes collected on the 24"
of July 1901 on Pic du Midi de Bigorre in the French Pyrenees at about 2300 m (Petry
1904). The above mentioned specimen is here designated as lectotype to fix the status
of the species.
Acompsia (Acompsia) subpunctella Svensson, 1966: 188, fig. 19, pl. II, fig. 3.
Material examined. Sweden: 34,12, Nb, Overkalix, 20.-21.vii.1970, leg. Svensson (gen. slide
GU 98/8183, GU 02/1113 2, HH 2118 genitalia of one d in glycerol on celluoid) (ZMUC, ZSM); 16,
Nb, Pajala, 3.vii.1976, leg. Johansson (gen. slide GU 98/820 3) (ZMUC); 14, Norbotten, Seskarö,
7.v11.1983, leg. Svensson (gen. slide GEL 870) (TLMF); 5d, Nb, Hedenäset, 26.—27.vi.1995, leg.
Hendriksen (gen. slide HH 1462) (HEND). Poland: 14, Puszcsa Borecka, 10.vii.1993, leg. Buszko
(BUSZ). Russia: 6d, SW Altai, 15 km S Katanda, Kuragan valley, 1200 m, 23.—25.vii.1983, leg. Mikkola,
Hippa & Jalava (gen. slide GU 02/1130) (ZMUH); 1d, Transbaikalia, Chita reg., Kyra, 900 m, 14.v11.1997,
leg. Bidzilya, I. & O. Kostjuk (gen. slide GU 02/1145) (ZMUH).
Male (Fig. 11). Wingspan 15-17 mm. Labial palpus comparatively long, brown,
with light apical ring at segment 2; inner surface lighter. Antenna greyish brown, slightly
lighter ringed. Forewing greyish brown, mottled with faint light yellow; three dark
spots: one elongate in fold, one shorter above it, and one round and more distinct at
end of cell; veins in apical part often darker, cilia slightly lighter than forewing, with
faint cilia line. Hindwing greyish brown with slightly lighter cilia.
122
HUEMER & KARSHOLT: The genus Acompsia
Female. Wingspan 13-14 mm. Similar to male, but with more light greyish (espe-
cially along costa) and yellow in the forewing, by which the dark spots become more
conspicuous.
Male genitalia (Figs. 30, 47). Uncus rounded apically; cucullus with compara-
tively long dilated part; sacculus lobe sub-oval, small, with long and almost straight
distoventral (outer) margin; aedeagus comparatively small, without dentate sclerite.
Female genitalia (Figs. 69-70). Apopyhses posteriores about 1.5 times length
of papillae anales; apophyses anteriores short, about length of segment VII; sternite
VIII with prolonged, medial sclerotizations; corpus bursae comparatively large, with
indistinct patch of microtrichia.
Distribution. Locally distributed in Fennoscandia (Sweden, Finland), Esto-
nia (Jürivete et al., 2000: 43), Latvia (Karsholt & Riedl 1996: 121), north-western
Poland and Russia (Kola Peninsula (Kozlov & Jalava 1994: 73)), Altai, Transbaikalia).
Biology. The larva is stated to live from September in shoots/stems of Veronica
longifolia L. (Scrophulariaceae), often together with larvae of Aethes triangulana
(Treitschke, 1835) (Tortricidae) (Kerppola et al. 1985: 87; Svensson 1993: 35). Accord-
ing to these authors the larva hibernates in the stem, pupating in spring, but that is doubted
by Kaitila (1996: 103 and pers. comm.), who points out that this is only true for Aethes
triangulana, whereas the larva of Acompsia subpunctella apparently leaves the feeding
place for pupation, probably even before the winter. The adult occurs from late June to
July. Vertical distribution: from sea level in northern Europe to about 1200 m in Sibiria.
Remarks. A. subpunctella is quite similar to A. delmastroella in external appear-
ance, mainly differing by the lighter colour of the forewing and by the male sacculus
lobe. |
The specimens studied by us from the Altai Mts. are rather worn, and it is hence
difficult to state if they differ from specimens from N. Europe, apart from being slightly
larger.
Acompsia subpunctella was described from 3 males collected in the Swedish prov-
ince of Norbotten (Svensson 1966). The figures of the adult and its genitalia leave no
doubt about the identity.
Acompsia (Acompsia) delmastroella Huemer, 1998: 516, figs 1-3, 10-11.
Material examined. Holotype d ‘MARMORA CN. Colle d’Esischie; m 2300 slm 14.08.1996;
G. B. Delmastro & M. M. Saluto leg.’ ‘GEL 8696 P.Huemer’ ‘Holotypus d Acompsia delmastroella
Huemer, 1999’ (TLMF). Italy: 75 paratypes, Cuneo, S Anna, Valle Traversagn, 2100 m, 8.vii.1994, leg.
Delmastro; 1 à, ditto, but 1950 m, 25.vii.1995 (gen. slide GEL 864); 83, 39, ditto, but 21.vii.2001, leg.
Huemer; 1d, Cuneo, Colle dell’ Agnello, 2640 m, 20.vii.2001, leg. Huemer (all TLMF), 3d Cuneo, Val
Varita, Colle dell’Agnello, 2800 m, 30.vii.2001, leg. Baldizzone; 34 , Cuneo, Val Maira, Accegilo, 2500
m, 3.v111.2001, leg. Baldizzone (all BLDZ, ZMUC).
Male (Fig. 12). Wingspan 15—16 mm. Labial palpus long, slender, dark brown, mot-
tled with lighter scales, especially on inner surface. Antenna dark brown. Forewing
olive-brown, slightly shining, mottled with lighter scales; three rather indistinct, black
spots: two elongate, above each other at 1/3, and one (more distinct) roundish at end of
cell; termen slightly emarginated below apex, without black spots; cilia light brown
grey. Hindwing dark grey, with lighter brown grey cilia.
Nota lepid. 25 (2/3): 109-151 123
Female. Wingspan 13-14 mm. Slightly brachypterous, smaller and more narrow-
winged, but in other respects similar to male.
Male genitalia (Figs. 31, 48). Uncus small, rounded laterally and distally; cucullus
with stout and strongly dilated part; sacculus lobe sub-oval, comparatively small, with
distinctly excavated distoventral (outer) margin; aedeagus without dentate sclerite.
Female genitalia (Figs. 71-72). Sternite VIII with distinctly prolonged,
medial sclerotizations; corpus bursae comparatively large, with medium-sized patch
of microtrichia.
Distribution. Endemic to the southwestern Alps (Alpi Cozie, Alpes Maritimes,
Alpes-de-Haute-Provence) (PH pers. obs.; Nel 2001: 102).
Biology. Host-plant and early stages unknown. Flight period: July to mid-August.
The adults have been observed in the flowers of Helianthemum nummularium (L.) Mill.
(Cistaceae) (Nel 2001: 102; PH. pers. obs.) and they were swept from low vegetation in
the afternoon. However, they were not attracted to light on the same day. Preferred habi-
tats are alpine meadows. Vertical distribution: from about 1900 to 2800 m.
Remarks. The small size, olive-brown forewing colour with weakly developed
spots and the shape of the sacculus lobe are of particular specific interest for identifi-
cation of A. delmastroella.
Acompsia delmastroella was described from 15 males collected in the south-west-
ern Alps (Huemer 1998: 516). Meanwhile additional material could be found, and Nel
(2001: 103, fig. 5) figured the female genitalia for the first time.
Acompsia (Acompsia) muellerrutzi Wehrli, 1925: 137
Material examined. France (Corse): 1d, Ajaccio, 30.vi.1905 leg. Leonhard; 23, Vizzavona,
3.vii.1905, leg. Leonhard; 1 4, Monte Renoso, 17.vii.1905, leg. Leonhard (all DEI); 1 à , Statione de Val
d’Ese, 1650 m, 24.vi.1994, leg. Skule & Skou (gen. slide GU 01/1070) (Z MUC).
Male (Fig. 8). Wingspan 15—16 mm. Labial palpus long, slender; segment 2 brown,
with light yeliow apical ring, lighter on inner surface; segment 3 greyish brown, mot-
tled with light brown. Antenna dark brown, indistinctly ligher ringed. Forewing dark
brown, mottled with light grey and yellow scales. Four rather large, black spots: one
(indistinct) near base, one elongate in fold, one above it slightly towards base, and one
at end of cell; termen oblique, without black spots; cilia light yellow grey. Hindwing
dark grey, with greyish fringes.
Female. Unknown.
Male genitalia (Figs. 32, 49). Uncus broadly sub-rectangular; cucullus with
comparatively short dilated part; sacculus lobe sub-oval, comparatively small, with
distinctly excavated distoventral (outer) margin; aedeagus comparatively small, with
very long and strongly dentate, distally curved sclerite.
Female genitalia. Unknown.
Distribution. Endemic to Corsica; according to Sattler (in litt.) also known
from a single specimen collected in Sardinia (coll. Hartig). A. muellerrutzi is the only
species of Acompsia found in Corsica, which is one of the few areas in Europe where
A. cinerella has not been recorded.
124 HUEMER & KARSHOLT: The genus Acompsia
Biology. Host-plant and early stages unknown. The few adults known to date have
been collected from late June to early July. Vertical distribution: probably from sea
level to about 2400 m.
Remarks. This species is mainly characterized by its small size and the exception-
ally dark brown forewings. The genitalia (female unknown) are interestingly almost
indistinguishable from those of A. caucasella sp. n., a species with a totally different
external appearance. 3
Acompsia muellerrutzi was described from a single male collected on 5.—6.vii.1924
on Monte d’Oro (Corsica) (Wehrli 1925: 137). The holotype could not be found in the
Wehrli collection in the Naturhistorisches Museum Basel. However, the detailed de-
scription leaves no doubt about the identity.
Acompsia (Acompsia) caucasella sp. n.
Material examined. Holotype d ‘RUSSIA Caucasus Psysh river 22.07.1994 A.Zhakov leg.’
‘Acompsia sp. 3 A. Bidzilya det., 1996’ ‘GU 02/1149 3 P.Huemer’ (ZMKU). Paratypes. Russia: 16,
Caucasus, Kabardino-Balkarija, Psysh river, 20.vi1.1994, leg. Zhakov (gen. slide GU 02/1139) (ZMKU).
Male (Fig. 19). Wingspan 19-22 mm. Labial palpus comparatively long, slender,
yellow-brown, second segment mid-brown on outer surface and on lower surface in-
wards. Antenna dark brown, with quite distinct light rings. Forewing light ochreous
brown with some yellow, mottled with mid-brown scales at base and in middle of
forewing; three to four distinct, black spots: one elongate in fold, one above and one
below it closer to base, the latter sometimes reduced, and one spot at end of cell;
distinct mid-brown to dark brown subterminal fascia, interrupted by lighter veins; termen
with distinct black spots at end or veins; cilia yellow grey. Hindwing grey, with light
yellow grey cilia.
Female. Unknown.
Male genitalia (Figs. 33, 50). Uncus broadly sub-rectangular; cucullus with
comparatively short dilated part; sacculus lobe sub-oval, comparatively small, with
distinctly excavated distoventral (outer) margin; aedeagus with very long and strongly
dentate, distally curved sclerite.
Female genitalia. Unknown.
Distribution. Only known from the Caucasus mountains.
Biology. Host-plant and early stages unknown. The few adults known to date
have been collected in the last third of July. Vertical distribution: not stated on the
original labels.
Remarks. The male genitalia are very similar to those of A. muellerrutzi. How-
ever, A. caucasella sp. n. cannot be mixed with any of the known Acompsia due to its
characteristic ochreous brown colour and the markings of the forewing.
Etymology. Named after the type region.
Acompsia (Acompsia) minorella (Rebel, 1899: 180) (Brachycrossata)
Material examined. Lectotype d (here designated) ‘LECTO-TYPE’ ‘Le Sarche Juli 97 Rebel’
‘minorella Rbl Type’ ‘LECTOTYPE d Brachycrossata minorella Rebel det. L. M. Pitkin, 1987’ (NHMW).
Nota lepid. 25 (2/3): 109-151 25
Czech Republic: 12, paralectotype, ‘PARA-LECTO-TYPE’ ‘Böhmen [Reichstadt] 1835’ ‘minorella
Rbl Type’ (NHMW). France: 26 , Cannes, leg. Milliere (BMNH). Italy: 1 4, Monte Baldo, Lumini, mid-
v.1967, leg. Burmann (gen. slide 4102 Tokar) (TLMF); 14, Trento, Riva, Rochetta, 13.v.1927, leg.
Osthelder; 12, Trento, Riva, Bastione, 13.v.1927, leg. Osthelder (all ZSM); 34, Trento, Mattarello,
22.v11.1945, leg. Klimesch (BMNH, ZMUH, ZSM); 1 ex, Rome, Colosseum, bred iv.1869 (abdomen
missing); 12, Rome, Forum, 18.v.1917, leg. Walsingham; 55, Latinum, Frascati, 27.v.1917, leg.
Walsingham (gen. slide BM 13923); 19, ditto, but 4.vi.1917 (all BMNH). Switzerland: 12, Tessin,
Capolago, 5.viii., leg. Krüger (gen. slide 4103 Tokar) (TLMF); 2d, Tessin, Mendrisco, 19. & 27.v.1927
(BMNH). Austria: 1 2, paralectotype, ‘Prater 1859’ (gen. slide 16.538) (NHMW). Slovenia: Ljublijana,
1d, 1.ix.1927, leg. Hafner (gen. slide GEL 887); 19, ditto, but 18.vili.1928 (gen. slide GEL 1045) (all
TLMF); 14, ditto, but 15.viii.1927 (NHMW).
Male (Fig. 13). Wingspan 15 mm. Labial palpus long, slender; segment 2 dark
brown on outer surface, with light apical ring; other surfaces of segment 2 and seg-
ment 3 light yellow, motleded with brown. Antenna light brown grey, indistinctly
lighter ringed. Forewing greyish brown, overlaid with yellow grey or light brown
scales; three distinct, black spots: one elongate in fold, one rounded above it, and
one larger, oblique at end of cell; a faint transverse fascia at 4/5; termen oblique,
with indistinct, black spots at end of veins; cilia yellow grey. Hindwing dark grey,
with greyish cilia.
Female. Wingspan 15 mm. Similar to male.
Male genitalia (Figs. 34, 51). Uncus rounded apically; cucullus with par-
ticularly broad and stout dilated part; sacculus lobe sub-oval, small, with weakly exca-
vated distoventral (outer) margin; aedeagus with undentate sclerite.
Female genitalia (Fig. 73). Apopyhses posteriores about 1.5 times length of
papillae anales; apophyses anteriores short, about length of very short segment VIII;
sternite VIII with distinctly prolonged medial sclerotizations; ductus bursae compara-
tively long; corpus bursae comparatively small, with distinct patch of microtrichia;
entrance of ductus seminalis in posterior half.
Distribution. Only known from scattered localities in Austria, the Czech Re-
public, France, Italy, Slovenia and Switzerland.
Biology. Host-plant and early stages unknown. There is no host-plant record on
the single specimen listed above as bred. The adults have been observed in May and
June (Elsner ef al. 1999: 57) and again from July to September, most probably in two
generations. Preferred habitats are warm forest steppes. Vertical distribution: insuffi-
ciently known, but probably restricted to lowland localities.
Remarks. The characteristic greyish brown colour of the forewing with a trans-
verse fascia makes this species unmistakable. The above mentioned specimen is here
designated as lectotype to fix the status of the species.
Acompsia (Acompsia) tripunctella ({Denis & Schiffermüller], 1775: 319) (Tinea)
Material examined. Neotype d (here designated) ‘Austr. inf. Fischauerberge Brunn 11.5.57
Hans Malicky’ (TLMF). Germany: 24, Bayern, Hausham, 520 m, mid-viii.1970, leg. Ziirnbauer; 14,
Bayern, Ob. First-Alm, 1400 m, late vii.1967, leg. Zürnbauer; 1 4, Bayern, Rotwand, late vi.1951, leg.
Pfister (all TLMF). France: 7d, Alpes Maritimes, Cim de Sénéca, 2200 m, 18.vii.1991, leg. Huemer &
Tarmann; 34,29, Alpes Maritimes, Marguareis, Navela, 2100-2200 m, 18.-21.vii.1990, leg. Huemer
& Tarmann; 164, ditto, but 21.vii.1990 (gen. slide GEL 169); 24, Alpes Maritimes, La Pra, 1600 m,
21.ix.1969, leg. Dujardin; 2d, Alpes Maritimes, Le Authion, 1800-2000 m, 19.viti.1953, leg. Dujardin;
14, Alpes Maritimes, Jalorgues, 2000 m, 28.vii.1974, leg. Dujardin; 14, Alpes Maritimes, Bousieyas,
126 HUEMER & KARSHOLT: The genus Acompsia
1800 m, 18.vii.1971, leg. Dujardin; 46 , Basses Alpes, SW Castel de Restfond, Roche Chevalière, 2480
m, 25.vil.1990, leg. Huemer & Tarmann; 66 , ditto, but Ste. Caire Brun N, 2420 m, 25.-26.vii.1990; 26,
Hautes Alpes, Galibier, 2400 m, late viii.1973, leg. Zürnbauer; 14, Hautes Savoie, Plan Praz, 2000 m,
27.v11.1950, leg. Dujardin (all TLMF); 16, Ecrins, Allefroide, 18.viii.1995, leg. Schepler (gen. slide GU
02/1119) (ZMUC). Spain: 16, Huesca, 4 km W Laco Urdiceto, 10 km NW Bielsa, 2000 m, 10.vii.1992,
leg. Fibiger (gen. slide HH 3546) (ZMUC). Poland: 1d, Tatra Mts., Sarnia Skala, 1350 m, 3.vii.1987,
leg. Buszko (BUSZ). Slovakia: 14, centr., Javoric, 17.vi.1951, leg. Patocka; 16, Novoveska Huta,
8.V111. 1980, leg. Reiprich (gen. slide HH 3383); 1 d , ditto, but 3.vi.1981; 1d, Spisska Nova Ves, 19.vii.1980,
leg. Reiprich (all ZMUC). Italy: 23, Piemont, Colle di Sestrières, 2100-2700 m, 1.—6.viii.1937, leg.
Zerny; 24, Bergamo, Alpi Orobie, Val d’Arera, 2000 m, 14.-15.viii.1992, leg. Huemer; 12, Brescia,
Adamello, Pso. Croce Domini, Corna Bianca, 2100 m, 15.viii.1993, leg. Huemer; 56 , Trento, Adamello,
Rif. Mandron, 2500 m, mid viii.1985, leg. Pavlas; 16, Trento, Monte Baldo, Bocca di Navene, 1500 m,
29.vi.1985, leg. Burmann; 19, ditto, but 14.vii.1987, leg. Burmann & Huemer; 1d, Trento, Tresnico,
400 m, early vi.1973, leg. Ziirnbauer; 16, Trento, Sella group, Piz Ciavazes south, 2150 m, 7.viii.1991,
leg. Huemer (gen. slide GEL 324); 14, Südtirol, Kurzras, 2100 m, early vii.1967, leg. Ziirnbauer; 16,
Südtirol, Trafoi, 1600 m, 24.vii.1955, leg. Malicky; 1d, Südtirol, Schnalstal, 1000 m, late ix.1970, leg.
Zürnbauer; 1 4 , Südtirol, Sextener Dolomiten, Schluderbach, 1450 m, 2.vii.1991, leg. Huemer (all TLMF);
13, Südtirol, Sextener Dolomiten, Cimabanche, 22.vii.1990, leg. Klimesch (ZSM); 24 , Piemonte, Cueno,
Parco Natur. Reg. Alpi, Marittime, Valle della Valetta, Piano del Casa d. Re, 1800 m, 24.vii.1997, leg.
Baldizzone (BLDZ); 1 à , ditto, but dint. di S. Giacomo, di Entracque, Rocca Barbis, 1750 m, 11.vii.1998,
leg. Baldizzone (ZMUC); 14, ditto, but S. Giac. di Entracque, sent. Rifugio Soria, 1800-2100 m,
18.vii.1998, leg. Baldizzone (BLDZ); 24 , Limon sul Garda, 26.—30.vii.1986, leg. Baungaard; 3 , Monte
Baldo, Rif. Novezza, 1600 m, 27.-29.vi.1981, leg. Skou & Skule; 64 , ditto, but 21.vii.1983, leg. Skou &
Skule; 1d, ditto, but Ferrara, 1100 m, 27.—29.vii.1981, leg. Skou & Skule; 23, Mt. Baldo, SW Naole,
1250 m, 22.vi.1986, leg. Schepler; 136, 1 2, Monte Baldo, Naole, 1500-1600 m, 21.vii.1989, leg. Karsholt;
12, ditto, but above Prada, 1200 m, 22.vii.1989, leg. Karsholt; 12, Valle d’Aosta, above Cogne,
24.vii.1989, 1800-2000 m, leg. Karsholt; 14, Dolomiti, Pso Pordoi, 2240 m, 10.viii.1995, leg. Schepler
(all ZMUC); 1 2, Piemonte, Cueno, Val Maira, Chiappera, 2100 m, 10.viii.2001, leg. Baldizzone (BLDZ).
Switzerland: 1d, Graubünden, Umbrail, 2100 m, 31.viii.1987, leg. Burmann, Huemer & Tarmann; 46,
Graubünden, Spina, 1600 m, 5.vi.1960, leg. Malicky; 26 , Appenzell, Seealptal, 1000 m, 28.vi.1958, leg.
Malicky (all TLMF); 13, Göschenen, 1.vii.1951, leg. ?; 18, Verbier, La Tournelle, 25.vii.1968, leg.
Traugott-Olsen; 23, Route du Gd. St. Bernard / VS, Cantine de Proz, 1900 m, 29.vii.1968, leg. Traugott-
Olsen; 24, Engadin, 8 km SW St. Moritz, Sils-Maria, 1850 m, 13.vii.1989, leg. Karsholt (all ZMUC).
Austria: 1d, Vorarlberg, Lech, Schafalpe, 1700 m, 21.vii.1954, leg. Süssner; 19, Nordtirol, St. Anton/
Arlberg, Schöngraben, 1400 m, 16.vii.1959, leg. Siissner; 24, Nordtirol, Rettenbachtal, 2600 m,
14.1x.1987, leg. Burmann & Huemer; 1 4 , Nordtirol, Obergurgl, 1950 m, 22.viii.1987, leg. Huemer; 16,
Nordtirol, Pillermoor, 18.vii.1988, leg. Burmann & Tarmann; 1 3, Nordtirol, Zams, Steinseehüttenweg,
1000 m, 17.1x.1987, leg. Huemer; 19, ditto, but 13.viii.1988, leg. Burmann & Huemer; 16, Nordtirol,
Weißenbach, Feldele, 910 m, 24.viii.1989, leg. Huemer; 1 6, Forchach, Johannesbriicke, 901 m, 17.vi.1989,
leg. Kahlen; 16, Rißtal, Weitgriesalm, 900 m, 29.vi.1993, leg. Huemer; 16, ditto, but 14.viii.1993; 1d,
ditto, but 8.vi.1993, leg. Cerny; 1 2, Nordtirol, Ehrwald, 31.viii.1968, leg. Hernegger; 1d, 12, Nordtirol,
Seegrube, 27.vii.1961, leg. Hernegger; 16, Nordtirol, Langer Sattel, 13.viii.1965, leg. Hernegger; 16,
Nordtirol, Innsbruck, 6.vii.1957, leg. Hernegger; 1 4, Nordtirol, Höttinger Graben, 1200 m, 26.vii.1966,
leg. Hernegger; 1¢, Nordtirol, Innsbruck, Kranebitten, 4.v.1968, leg. Burmann; 1 4, Nordtirol, Zirl, 600
m, 1.ix.1969, leg. Burmann; 14, Nordtirol, Mösern, 1200 m, 18.viii.1969, leg. Burmann; 16,
Nordtirol, Valsertal, 1400 m, 23.vi.1959, leg. Hernegger; 14, Nordtirol, Vennatal, 1400 m, 14.vi.1938,
leg. Scholz; 14, Osttirol, Rieserfernergruppe, Patschertal, 2080 m, 15.viii.1989, leg. Tarmann; 19, 62,
Osttirol, Venedigergruppe, Sajatmähder, 2200-2600 m, 30.vii.1993, leg. Ryrholm; 2¢, Osttirol,
Venedigergruppe, Maurer Alpe, 2300-2500 m, 5.viii.1993, leg. Rakosy; 2d, Osttirol, Schobergruppe,
Stanis Alm, 2000 m, 23.vii.1989, leg. Tarmann; 1d, Osttirol, Granatspitzgruppe, S Sudetendeutsche
Hütte, 2500-2650 m, 16.viii.1991, leg. Tarmann; 19, 12, Osttirol, Kartitsch, 1600 m, 17.vii.1964, leg.
Süssner (gen. slide GEL 10472); 14,1%, ditto, but 9.vii.1964; 1 4, Kärnten, Dobratsch, 2000-2100 m,
23.vii.1993, leg. Huemer & Wieser; 16 , Kärnten, Karawanken, Kossiak, 1700 m, 25.vi.1949, leg. Pinker;
13, Kärnten, Loibltal, vii.1950, leg. Pinker (gen. slide GEL 54); 16 , Steiermark, Lainbach, 1.viii.1920,
leg. Zerny; 1d, Niederösterreich, Dürrenstein, 1400 m, 4.ix.1962, leg. Malicky (all TLMF); 14 , Umgebung
Wien; 26, Oberösterreich, Ternberg, 14.vi.1961, leg. Johansson; 1 4, Kärnten, Arnoldstein, Gailtal, 600
m, 24.vi.1981, leg. Skou & Skule; 1, Osttirol, Glocknergruppe, above Kals, 1700-2200 m, 28.vu.1991,
leg. Karsholt & Rakosy; 1 4, Osttirol, Innervillgraten, 1800 m, 15.vii.1981, leg. Schnack; 2, Osttirol,
Lavant, path to Lav. Alm, 1200 m, 2.viii.1991, leg. Deutsch, Huemer & Karsholt (all ZMUC); 16,
Steiermark, Reichenstein, 5.viii.1900 (ZSM). Slovenia: 14, Triglav, Vrata, 1100 m, 29.vii.1984, leg.
Schnack (ZMUC); 16, Solcava Logarska dolina, 900 m, 25.-26.vi.1988, leg. Lichtenberger (TLMF).
Croatia: 146, Velebit, Zavizan, 1600 m, 15.viii.1978, leg. Baldizzone (ZMUC); 1d, ditto, but 1400 m,
12.viii.1982 (BLDZ); 28 , Karlovac, 250 m, late viii.1979, leg. Zürnbauer (gen. slide GEL 880) (TLMF).
Yugoslavia (Montenegro): 36, Durmitor, Komarnica, Klijestina, 1400 m, 24.vii.1985, leg. Jaksic (gen.
Nota lepid. 25 (2/3): 109-151 127
slide GEL 325) (TLMF). Romania: 19, Retyezat, Ujhelyi, 23.vii.1910 (ZMUC). Ukraine: lé E.
Carpathian, Vorokhta, 21.vi.1964, leg. Falkovitsh (gen. slide GU 02/1143) (ZMKU).
Male (Figs. 14-15). Wingspan 19-23 mm. Labial palpus long, slender, greyish brown,
mottled with light brown on inner surface. Antenna brown, indistinctly lighter ringed.
Forewing clay-brown to greyish brown, mottled with light greyish (especially along costa),
yellow brown and some black scales; three distinct, black spots: one elongate in fold, one
above it closer to base, and one rounded or oblique elongate at end of cell, rarely a small
black dash below of the latter; termen slightly emarginated below apex, frequently with a
row of black dots at end of veins; cilia light yellow grey. Hindwing grey; cilia as in forewing.
Female (Fig. 16). Wingspan 16-18 mm. Slightly brachypterous, with narrower
wings than in male. Forewing darker brown, with more distinct light area at basal half
of costal area; black spots less distinct, especially the two basal ones.
Male genitalia (Figs. 35, 52). Uncus slightly dilated towards apex; cucullus with com-
paratively long dilated part; sacculus lobe sub-oval, very large and broadly rounded,
distoventral (outer) margin deeply excavated; aedeagus with very long, dentate sclerite.
Female genitalia (Figs. 74-75). Apopyhses posteriores about two times
length of papillae anales; apophyses about length of segment VIII; sternite VIII with
weakly prolonged, broad medial sclerotizations; ductus bursae long; corpus bursae
with medium-sized patch of microtrichia.
Distribution. Due to the confusion with externally similar species the distri-
bution is insufficiently known. Reliable or confirmed records are known mainly from
montane areas: Alps, Apennines, Carpathians and the Balkans. We examined only one
specimen from Spain, and most records from the Pyrenees and from Central Spain are
due to misidentifications of A. antirrhinella or A. pyrenaella sp. n. Records from Euro-
pean Russia, Transbaikalia and the Caucasus (Ponomarenko 1997b: 10) require con-
firmation and are at least partially based on further misidentifications. The record from
Albania (Karsholt & Riedl 1996: 121) refers to A. ponomarenkoae sp.n., and one from
Finland (Elsner et al. 1999: 57) to A. subpunctella.
Biology. The early stages were described by Chrétien (1899), who reared A.
tripunctella from eggs: Among different plants offered the small larvae chose Plan-
tago alpina L. (Plantaginaceae) for food. They emerged about 15 days after oviposi-
tion. The full-grown larva measures 12—13 mm; it is black brown slightly tinged with
greenish, without longitudinal line; incisions between 1“, 2" and 3" segments later-
ally whitish grey; warts big and intensively black; head and thoracic shield shining
black; thoracic legs long and black; abdominal legs black with brown crown.
The larva makes no spinning — apart from a silken tube covered with leaf litter for
hibernating. It pupates in June on the ground in a loose cocoon. Chrétien also found
full-grown larvae under stones in September in 2400 m altitude, and he therefore con-
cluded that A. tripunctella in higher altitudes may need two years for its development
(Chrétien 1899: 203-204).
Flight period: June to September. The adult occurs in various habitats such as clear-
ings and edges of forests, steppe slopes and various meadows up to the alpine zone. It
is readily attracted to light but can also be found during the day. Vertical distribution:
from about 500 to 2500 m.
128 HUEMER & KARSHOLT: The genus Acompsia
Literature records giving Antirrhinum majus L. (Scrophulariaceae) as host-plant for A.
tripunctella (e.g. Ponomarenko 1997b: 10) most probably refer to A. antirrhinella, and
that may also be true for the association with Linaria cymbalaria (L.) Mill.
(Scrophulariaceae) originating from Chrétien (Lhomme 1930: 120). Lhomme (loc.
cit.) also mentions Globularia as a hostplant for A. tripunctella, however, without
further reference. |
Remarks. A. tripunctella shows some variation, which at least partly seems to be geo-
graphically correlated. Male specimens from the central Alps (Austria and Switzerland)
have greyish brown forewings, frequently mottled with some number of black scales, whereas
males from the Monte Baldo area in northern Italy but also from other localities on calcar-
eous soil have lighter greyish brown forewings. Males from Slovakia and other parts of
eastern Europe are more plain brown, with few black scales, and frequently without dark
spots along termen. Populations from the southeastern Alps of Austria (Carinthia) and
Slovenia to Croatia and Yugoslavia (Montenegro) have shorter, more rounded forewings
than typical A. tripunctella, with largely reduced black markings and usually only one well
developed spot at the end of cell. Furthermore the hindwings are darker. However, we
could find no genitalia differences between these populations and hence they are regarded
a conspecific with A. tripunctella. This species is very similar to some other Acompsia but
can be readily distinguished by the very large sacculus lobe.
The original description of Tinea tripunctella (‘Flachsbräunlichter Sch. mit 3
schwarzen Punkten’) is poor and leaves some doubt about the identity. Unfortunately
in 1848 the collection of Denis & Schiffermiiller was destroyed by fire (Horn & Kahle
1935-1937: 243). However, Charpentier (1821: 119), who studied the collection of
Schiffermiiller prior to its destruction, stated that the specimen(s) of Tinea tripunctella
belonged to the same species as figured under that name by Hiibner (1796, pl. 32, fig.
217), and that figure does not contradict the current interpretation of that name. To fix
the identity of T. tripunctella we designate the mentioned specimen as the neotype.
Acompsia (Acompsia) ponomarenkoae sp. n.
Material examined. Holotype d ‘Greece, Ipiros, Katara pass, 1500-1700 m, 24.—27.v.1994, leg.
O. Karsholt’ (ZMUC). Paratypes. Albania: 1 6, Korab, 23.-31.vii.1918; 2d, Gjalica Ljums, 17.—26.vi.1918
(gen. slide 16.639) (all NHMW). Greece: allotype 2, caught in copula with holotype and mounted on
same polyporus (ZMUC); paratypes 94, 82, same data as holotype (gen. slide GU 01/10792; HH
3384) (ZMUC, TLMF); 1 6 , ditto, but 1600 m, 11.viii.1985, leg. Fibiger; 1 d , ditto, but 1800 m, 27.vu.1990,
leg. Fibiger (gen. slide GU 01/1068 2); 16, Evrytania, Timphrystos, 1900 m, 1.vii.1985, leg. Schepler
(gen. slide HH 3386) (all ZMUC); 1 6 , Epirus, Katara Pass, 1650 m, 26.vi.1991, leg. Somerma & Väisänen;
14, Epirus, Zagoria, Skamneli Timfi, 1400 m, 24.vii.1991 leg. Somerma & Väisänen; 1d, ditto, but,
Goura, 2200 m, 24.vii.1991, leg. Somerma & Väisänen (all ZMUH).
Male (Fig. 17). Wingspan 20-24 mm. Labial palpus long, slender, dark brown, mot-
tled with yellow brown, especially on inner surface. Antenna dark brown, indistinctly
lighter ringed. Forewing rather plain light brown, with scattered black brown scales;
three small, black spots: one (sometimes very weak) in fold, one above it a little to-
wards base, and one (more distinct) at end of cell; termen emarginated below apex,
with rather distinct, small black spots at ends of veins; cilia light brown. Hindwing
grey, with yellow grey fringes.
Nota lepid. 25 (2/3): 109-151 129
Female (Fig. 18). Wingspan 16-17 mm. Reasonably brachypterous. Labial palpus
of same colour as in male, but shorter. Antenna dark brown. Forewing about half as
broad as in male, dark brown, overlaid with lighter brown scales; a lighter subcostal
streak from base; two indistinct, black spots at 1/3 and 2/3; termen oblique, sometimes
with a few black scales; fringes light brown. Hindwing about two thirds as broad as in
male, grey, with lighter, brown grey cilia.
Male genitalia (Figs. 36, 53). Uncus rounded distally; cucullus with
modereately weakly dilated part; sacculus lobe medium-sized, sub-oval, delimited from
posterior part, with irregularly emarginated distoventral (outer) margin; aedeagus
distodorsally distinctly pointed, with very long and strongly dentate sclerite.
Female genitalia (Figs. 76-77). Apopyhses posteriores about three times
length of papillae anales; sternite VIII with extremely long medial sclerotizations,
extending beyond apices of apophyses anteriores; ductus bursae short; corpus bursae
large, with very large patch of microtrichia.
Distribution. Only known from Albania and Greece. Further records of A.
tripunctella from the Balkan Peninsula have to be checked and may refer to this species.
Biology. Host-plant and early stages unknown. The few adults known to date
have been collected during the day and at light from late May to late July, at altitudes
between 1400 and 2200 m.
Remarks. A. ponomarenkoae sp. n. 1s closely related to A. schepleri sp. n. from
which it differs by lacking the dark veins, and from A. fibigeri sp. n. which has smaller
sacculus lobes. From the also very similar A. bidzilyai sp. n. it differs by the light brown
rather than light greyish brown colour of the forewing without dark scales near the base.
Furthermore, the forewings are narrower and costally less convex. The male genitalia
are again very similar though the sacculus lobe is smaller in A. ponomarenkoae sp. n.
Etymology. Named after Dr. Margarita Ponomarenko (Vladivostok) who dis-
covered its distinctness independently of us.
Acompsia (Acompsia) schepleri sp. n.
Material examined. Holotype d ‘Turkey, Prov. Erzincan Kizildag Gecidi, 2100 m. 19.viii.1993.
Leg. Fritz Schepler’ ‘Gen. prep. nr. 4848d O. Karsholt’ (ZMUC). Paratypes. Turkey: 13d, same data as
holotype (gen. slide GU 01/1067) (TLMF, ZMUC).
Male (Fig. 20). Wingspan 22—24 mm. Labial palpus comparatively long, slender;
segment 2 dark brown mottled with whitish on upper and inner surface and with
white apical ring, segment 3 lighter. Antenna brown, indistinctly lighter ringed.
Forewing with rounded apex, light brown, with stripes of black scales between veins;
one slightly oblique, black spot at end of cell; termen without emargination below
apex, lined with black scales, especially at end of veins; cilia brown grey, lighter
beyond cilia line. Hindwing brown grey; cilia yellow at base, light grey beyond grey
cilia line.
Female. Unknown.
Male genitalia (Figs. 37, 54). Uncus broadly sub-rectangular; cucullus with
particularly broad dilated part; sacculus lobe medium-sized, sub-oval, distal part marked-
130 | HUEMER & KarSHOLT: The genus Acompsia
off, caudal part with very long and straight distoventral (outer) margin; aedeagus with
very long and strongly dentate sclerite.
Female genitalia. Unknown.
Distribution. Only known from one mountain locality in central Turkey.
Biology. Host-plant and early stages unknown. The adults have been collected
in mid-August at light at an altitude of about 2100 m.
Remarks. Similar to A. fibigeri sp. n. in genital characters (female unknown).
However, due to its large size and the forewings with black stripes between the veins
and the rounded apex A. schepleri sp. n. is easily separated from other species of
Acompsia. It may resemble some species of Chionodes Hiibner, but can be easily dis-
tinguished by the thin 2 segment of the labial palpus without ventral brush, the pre-
genital segment of the males and genitalia characters of both sexes.
Etymology. Named after the Danish lepidopterist Fritz Schepler who collected
the type series. i
Acompsia (Acompsia) fibigeri sp. n.
Material examıned. Holotype d “Turkey, Gümüshane, Kop pass, 2400 m, 13.-14.1x.1993, leg.
a (ZMUC). Paratypes. Turkey: 54, same data as holotype (gen. slide GU 02/1112) (TLMF,
Male (Fig. 21). Wingspan 22—23 mm. Labial palpus comparatively long, slender,
greyish brown on outer and lower surface, yellow on inner and upper surface; apex of
segment 2 light. Antenna dark brown, indistinctly lighter ringed. Forewing brown,
mottled with yellow brown and some darker scales; one weak, oblique, black spot at
end of cell; termen weakly emarginated below apex, without black spots at end of
veins; cilia yellow grey. Hindwing grey, with light yellow grey cilia.
Female. Unknown.
Male genitalia (Figs. 38, 55). Uncus broad, sub-rectangular; cucullus with
broadly dilated part; sacculus lobe comparatively small, rounded, caudal part with
very long and slightly emarginated distoventral (outer) margin; aedeagus with very
long and strongly dentate sclerite.
Female genitalia. Unknown.
Distribution. Only known from a mountain area in eastern Turkey.
Biology. Host-plant and early stages unknown. The adults have been collected
in mid-September at light at an altitude of about 2400 m.
Remarks. Very similar to A. schepleri sp. n. in genital characters (female un-
known) but differing by the absence of black stripes in the forewing and furthermore
by the small and rounded sacculus lobe.
Etymology. Named after the Danish lepidopterist Michael Fibiger who col-
lected the type series of this new species and other important material used for this
paper.
Acompsia (Acompsia) bidzilyai sp. n.
Material examined. Holotype & ‘Zabajkale Sochodinskij zapovednik r. Agucakan 1000 m light
19.07.1997 A. Bidzilja, I. Kostjuk, ©. Kostjuk [in cyrillic]’ “GU 02/1144 à P.Huemer’ (ZMKU). Paratype.
Nota lepid. 25 (2/3): 109-151 131
Russia: 1d, E Transbaikalia, Chita reg., 75 km N Mogoci, Tupik, 8.vii.1993, leg. Kostjuk, Kostjuk,
Golovushkin & Salata (gen. slide GU 02/1142) (ZMKU).
Male (Fig. 22). Wingspan 19-20 mm. Labial palpus comparatively long, slender,
light greyish brown, somewhat lighter on inner surface. Antenna mid-brown. Forewing
light greyish brown; small subbasal patch of dark scales; three distinct, rather large,
black spots: one elongate in fold, one above it closer to base, and one rounded at end of
cell; costa convex towards termen, termen straight, with a row of black dots at end of
veins; cilia concolorous with forewing. Hindwing grey; cilia as in forewing.
Female. Unknown.
Male genitalia (Figs. 39, 56). Uncus rounded distally; cucullus with
modereately weakly dilated part; sacculus lobe medium-sized, sub-oval, without strong
separation from posterior part, with irregularly emarginated distoventral (outer) mar-
gin; aedeagus distodorsally distinctly pointed, with long and strongly dentate sclerite.
Female genitalia. Unknown.
Distribution. Only known from Transbaikalia (Russia). From this region the
new species was doubtfully recorded as A. tripunctella (Budashkin & Kostjuk 1994:
20).
Biology. Host-plant and early stages unknown. The few adults known to date
have been collected in July.
Remarks. A. bidzilyai sp. n. is very similar to other species of the group exter-
nally but differs by a small subbasal patch of dark scales. Furthermore the wings are
more rounded distally and the ground colour is plain light greyish brown.
Etymology. Named after Dr. Oleksiy Bidzilya (Kiev), who already suspected
an undescribed species.
Subgenus Telephila
Acompsia (Telephila) schmidtiellus (Heyden, 1848: 954) (Ypsolophus)
Ypsolophus durdhamellus Stainton 1849: 12.
Hypsolopha quadrinella Herrich-Schaffer 1854: 154.
Material examined. Denmark: 1%, LFM, Maribo, la. 2.vi.1918, Origanum, leg. Sonderup (gen.
slide HH 1978); 3d, LFM, Hovblege Bakker, 2.viii.1961, leg. Traugott-Olsen (gen. slide ETO 442); 7d,
52, SZ, Fladsa, la. 24.v.-18.vi.1973, Origanum vulgare, leg. Karsholt (gen. slides OK 21398, 21402,
21418); 12, ditto, but la. 10.vi.1979, leg. Hendriksen (gen. slide HH 2016); 3¢, LFM, Mons Klint,
26.vii.1997, leg. Karsholt; 2d, 39, ditto, but la. 12.vi.1999, Origanum vulgare, leg. Karsholt; 36 addi-
tional, undissected specimens from Denmark (all ZMUC). Germany: 19, Württemberg, Markgröningen,
20.vii.1956 e.l., Mentha, leg. Süssner (gen. slide GEL 1059); 19, Württemberg, Marbach — Neckar,
Otterbachtal, 2.viii.1956 e.l., Origanum vulgare, leg. Siissner; 14, Württemberg, Marbach — Neckar,
26.vi.1953 e.l., Origanum vulgare, leg. Siissner; 1d, ditto, but 28.vi.1953 e.l. (gen. slide GEL 1058); 16,
Württemberg, 2 km SSW Laufen — Neckar, 170 m, 15.viii.1978, leg. Süssner (all TLMF). Andorra: 1d,
Arnisal, 1500 m, 1.viii.1997, leg. Baungaard (Z MUC). Spain: 1d, Andalucia, Sierra Nevada, Cam. D.
Valeta, 2050 m, 3.viii.1986, leg. Traugott-Olsen (ZMUC); 1d, Lerida, Aranis, Tremp Valley, 700 m,
8.vii.1993, leg Skou (ZMUC). Italy: 1¢, Piemonte, Cuneo, Parco Natur. Reg. Alpi Marittime, Valdieri,
900 m, 17.vii.1999, leg. Baldizzone; 1 4 ditto, but 29.vii.2001 (all BLDZ).
Male (Fig. 23). Wingspan 14-16 mm. Segment 2 of labial palpus with large ventral
scale-brush, black brown at outer and lower surface, yellow at inner and upper surface;
segment 3 long and thin, yellow, mottled with black-brown at lower surface. Antenna
132 HUEMER & KARSHOLT: The genus Acompsia
slightly serrated, with cilia, light brown, indistinctly lighter ringed. Forewing light
orange-brown, mottled with some black scales; two or three black spots as follows:
one distinct in cell, one indistinct (sometimes missing) above it, and one rather indis-
tinct (rarely missing) at end of cell; a small patch of black scales at tornus; an indistinct
light fascia from outside tornus to costa; termen emarginated below apex, with a fine,
black line; cilia concolourous with forewing; hindwing grey, with yellow cilia.
Female. Wingspan 15—17 mm. Similar to male, but slightly larger, with thinner,
unserrated antenna and more plain orange-brown forewing.
Male genitalia (Figs. 40, 57). Uncus sub-rectangular; cucullus with particu-
larly long dilated part; sacculus lobe covered with microtrichia in distal part, weakly
convex and comparatively small, with weakly concave distoventral (outer) margin;
sclerites of vinculum even throughout; aedeagus with long, dentate sclerite, vesica
without sclerotized, spiralled distal part.
Female genitalia (Figs. 78-79). Papillae anales large; apopyhses posteriores
about 1.5 times length of papillae anales; apophyses anteriores about length of segment
VIII; sternite VOII with distinctly prolonged medial sclerotizations; ductus bursae com-
paratively long and evenly broadened towards corpus bursae, with distinct sclerite
anteriorly; corpus bursae comparatively small, globular, with small patch of microtrichia.
Distribution. Found locally in central, eastern and southern Europe (Karsholt
& Riedl 1996: 121), from Denmark in the north to southern Spain and Portugal. To the
east it is found in Ukrainia (Elsner et al. 1999: 57). A record from Estonia (Piskunov
1990: 1004) falls outside the known distribution area and is not accepted for the Esto-
nian checklist (Jürivete 2000).
Biology. The larva and pupa were recently described and figured in detail
(Huertas-Dionisio 2002). The larva is slim, yellow white, with a small hart-formed,
shinning dark brown head and lighter brown prothoracic shield; segments three and
four purplish brown, interrupted at the segmental divisions with yellow white; central
dorsal stripe deep brown purple, on each side boardered by a broad stripe of the same
hue; abdominal segments with rows of purplish tubercular dots and darker spots with
short hairs; forelegs black brown; prolegs cream.
The larva feeds until June on Origanum vulgare L. (Lamiaceae), folding a leaf and
spinning it together, only leaving a small entrance in each end, through which it rap-
idly disappears if disturbed. It is active preferably during the night. Lhomme (1948:
660) also recorded Mentha arvensis L., M. silvestris L., M. rotundifolia L. and
Calamintha nepeta (L.) Savi (Lamiaceae) as host plants, and it was bred from
Clinopodium vulgare L. (Lamiaceae) in Portugal (Corley et al. 2000: 269). Pupation
takes place either in a folded leaf or between dry leaves on the ground. Flight period:
late June to late August. The adult is attracted to light (Heyden 1848: 955; Baker 1888:
136; OK pers. obs.). Vertical distribution: from sea level to about 2000 m.
Remarks. Ypsolophus schmidtiellus Heyden was described from an unspecified
number of larvae and adults found by U. Schmidt near Sachsenhäuser Warte (Frank-
furt/Main) and Königstein/Taunus (Germany). The description of this species leaves
no doubt about its identity.
Ypsolophus durdhamellus Stainton was described from an unspecified number of
Nota lepid. 25 (2/3): 109-151 133
specimens from Durdham Downs near Bristol, and from Devonshire (England). It was
already listed as a synonym of guadrinella by Herrich-Schäffer (1855: 37 (Index)).
Hypsolopha quadrinella Herrich-Schaffer was described from one specimen found by
Fischer von Röslerstamm at Rodaun (SW of Vienna, Austria), and first figured in a
plate non-binominal (Herrich-Schäffer 1853: pl. 81, fig. 616). It was listed as a syno-
nym of durdhamellus by Heinemann (1870: 339).
Acompsia (Telephila) syriella sp. n.
Material examined. Holotype d ‘17.-18.V.1961, Syria, 25 km W v. Damascus, Kasy & Vartian’
(NHMW). Paratypes: 26 , same label data as holotype (gen. slide HH 3389, NM 16.642 à).
Male (Fig. 24). Wingspan 14 mm. Segment 2 of labial palpus with large scale brush,
light brown, mottled with black on outer and lower surface, whitish yellow on upper
and inner surface; segment 3 comparatively long, thin. Antenna serrated, with cilia,
yellow brown, indistinctly ringed with black. Forewing straw yellow, mottled with
black scales; three black spots: one in fold, one above it slightly towards base, and one
slightly oblique at end of cell; more or less distinct black patches near base, between
black spots, at tornus and as a subapical band; termen slightly emarginated below
apex, with distinct black line; cilia yellow brown, lightest at base. Hindwing grey, with
grey, light yellow-based cilia.
Female. Unknown.
Male genitalia (Figs. 41, 58). Uncus sub-rectangular; cucullus with long,
comparatively weakly dilated distal part; sacculus lobe short, covered with few
microtrichia in distal part, weakly convex and comparatively small, almost straight
distoventral (outer) margin; sclerites of vinculum even throughout, very long, dis-
tinctly overtoping sacculus lobes; aedeagus with small doral sclerite at base, without
dentate distal sclerite, vesica without sclerotized, spiralled distal part.
Female genitalia. Unknown.
Distribution. Only known from a single locality in Syria.
Biology. Host-plant and early stages unknown. The adults have been collected
in mid-May.
Remarks. A. syriella sp. n. resembles A. schmidtiellus, but is smaller, with the
black spots and patches in the forewing more distinct; segment 3 of the labial palpus is
shorter. The male genitalia of the new species differ from the latter particularly by the
longer arms of the vinculum, the smaller valvae and the lack of a dentate sclerite of the
aedeagus.
Etymology. Named after the type region.
Acknowledgements
We are most grateful to Dr. Klaus Sattler (London) for his invaluable help in many respects, mainly
including various informations about material, literature etc., and for carefully checking the manuscript.
Moreover we want to thank the following colleagues: Dr. Giorgio Baldizzone (Asti), Dr. Ronald Bellstedt
and A. Schreyer (Gotha), Dr. Oleksiy Bidzilya (Kiev), Prof. Jarostaw Buszko (Torun), Dr. Karel Cerny
(Innsbruck), Dr. Reinhard Gaedike (Eberswalde), Dr. Laszl6 Gozmany (Budapest), Keld Gregersen (Sora),
Dr. Theo Griinewald (Landshut), Henning Hendriksen (Farevejle), Dr. Lauri Kaila and Jaakko Kullberg
(Helsinki), Jari Kaitila (Vantaa), Dr. Martin Lödl and Mag. Susanne Randolf (Vienna), Dr. Wolfgang
134 HUEMER & KarsHoLt: The genus Acompsia
Nässig (Frankfurt), Dr. Matthis Nuss (Dresden), Dr. Margarita Ponomarenko (Vladivostok), Willy De
Prins (Antwerpen), Dr. Andreas Segerer (Munich) and Kevin Tuck (London) for the loan of material,
important information and/or other kinds of assistance.
References
Amsel, H. G. 1935. Weitere Mitteilungen über Ba eS Lepidopteren. — Veröff.dt.Kolon.u.Übersee-
Mus.Bremen 1: 223-277.
Baker, G. T. 1888. Description of the larva of Ypsolophus schmidiellus [sic], Heyd. (Nothris durdhanellus,
Stn.). — Entomologist’ s mon.Mag. 25: 136.
Becker, O. 1984. Gelechiidae. Pp. 44-53, 59-60. In: Heppner, J. B. (ed.): Micropterigoidea — Immoidea.
— Atlas of Neotropical Lepidoptera. Checklist 1.— W. Junk, The Hague, Boston, Lancaster. xxviit112
pp.
Budashkin, Yu. I. & Kostjuk, I. Yu. 1994. On the fauna of Mircolepidoptera of Transbaikalia. - Memoirs
of the Dahursky Nature Reserve 2: 5-30.
Charpentier, T. von 1821. Die Zinsler, Wickler, Schaben und Geistchen des systematischen Verzeichnis-
ses der Schmetterlinge der Wrener Gegend vergleichen mit den in der Schiffermillerschen Samm-
lung in Wien befindlichen und von J. Hübner in seinem grossen Kupferwerke abgebildeten Arten
dieser Gattungen. Mit Anmerkungen von J. L. Th. Fr. Zincken gennant Sommer. — Schulbuchhand-
lung, Braunschweig. xvi + 178 pp.
Chrétien, P. 1899. Les premiers états de Brachycrossata HO S. V. (Lep.). — Bull.Soc.ent.Fr.
1899: 202-204.
Clerck, C. 1759. Icones Insectorum rariorum cum nominibus eorum trivialibus locisque e C. Linnaei
Systema Naturae allegatis. — Stockholm. 55 + 7 pls. Sectio prima: 4 pp. Dedication, 4 pp. Vorrede 1—
16 pls.
Corley, M. F. V., Gardiner, A. J., Cleere, N. & Wallis, P. D. 2000. Further additions to the Lepidoptera of
Algarve, Portugal (Insecta: Lepidoptera). - SHILAP Revta. lepid. 28: 245-319.
[Denis, M. & Schiffermiiller, I.] 1775. Ankündung eines systematischen Werkes von den Schmetterlin-
gen der Wienergegend. — A. Bernardi, Wien. 323 pp., 3 pls.
Duponchel, P.-A.-J. ([1838-1840]): Nocturnes, 8. — /n: Godart, J. B.: Histoire naturelle des Lépidopteres
. ou Papillons de France 11. - Méquinon-Marvis, Libraire-Editeur, Paris. 720 pp., pls 287-314.
Edwards, E. D: 1996. Gelechiidae. Pp. 107-114, 347-348. In: E. S. Nielsen, Edwards, E. D. & Rangsi,
T. V. (eds): Checklist of the Lepidoptera of Australia. - Monographs on Australian Lepidoptera 4. —
CSIRO Publishing, Collingwood, Australia. xiv+529 pp.
Elsner, G., Huemer, P. & Tokar, Z. 1999. Die Palpenmotten (Lepidoptera, Gelechiidae) Mitteleuropas.
Bestimmung — Verbreitung — Flugstandort — Lebensweise der Raupen. — F. Slamka, Bratislava. 208
pp.
Gaede, M. 1937. Familia: Gelechiidae. — Jn: Bryk, F. (ed.): Lepidopterorum Catalogus. Pars 79. — W.
Junk, Berlin & ‘s-Gravenhage. 630 pp.
Gaedike, R. & Heinicke, W. (eds) 1999. Entomofauna Germanica 3. Verzeichnis der Schmetterlinge
Deutschlands. — Ent.Nachr.Ber., Suppl. 5: 1-216.
Haworth, A. H. 1828. Lepidoptera Britannica 4. J. Murray, London. Pp. 512-609.
Herrich-Schäffer, G. A. W. 1847-1855. Systematische Bearbeitung der Schmetterlinge von Europa. 5. —
G. J. Manz, Regensburg. 394+52 (index) pp., 124+7+1 pls.
Heinemann, H. v. 1870..Die Schmetterlinge Deutschlands und der Schweiz. 2 Abteilung Klein-
schmetterlinge. 2. Die Motten und Federmotten. Heft 1.- C. G. Schwetschke & Sohn, Braunschweig.
388 pp.
Heyden, C. H. G von 1848. Nachtrag über den oben erwähnten Ypsolophus schmidtiellus (v. Heyden).
Pp. 954-955. In G. Koch: Die Raupen und Schmetterlinge des südwestlichen Deutschlands, ins-
besonderer der Umgebung von Frankfurt, Nassau und der westlichen Abdachung des Taunus-Gebir-
ges. — Isis, Leipzig 1848: 891-955.
Hodges, R. W. 1983. Gelechiidae. Pp. 19-25. In: Hodges, R. W. et al. (eds): Check list ofthe Lepidoptera
of America North of Mexico. xxiv + 284 pp. E. W. Classey Ltd. and The Wedge Entomological
Research Foundation, Cambridge. Hodges, R. W. 1986. Gelechioidea. Gelechiidae (Part).
Nota lepid. 25 (2/3): 109-151 135
Dichomeridinae. Jn: Dominick, R. B. ef al.: The Moths of America North of Mexico 7(1): 1-195, i—
xiii. The Wedge Entomological Research Foundation, Washington.
Horn, W. & Kahle, I. 1935-1937. Uber entomologische Sammlungen, Entomologen & Entomo-
Museologie. — Ent.Beih. Berl.-Dahlem 2—4: 1-536, pls 1-38.
Hübner, J. 1796-1836. Sammlung Rue Schmetterlinge 8 — J. Hübner, Augsburg. 78 pp. (1796),
71 pls (1796-1836).
Hübner, J. 1816-1825. Verzeichniss bekannter Schmetterlinge. — J. Hübner, Augsburg. 431 pp
Huemer, P. 1998. A new endemic species of Acompsia from the Alps (Lepidoptera, Gelechiidae). —
Linzer biol. Beitr. 30: 515-521.
Huertas-Dionisio, M. 2002. Estados inmaturos de Lepidoptera (XVI). Telephila schmidtiellus (Heyden,
1848) en Huelva, Espana (Lepidoptera: Gelechiidae, Dichomerinae). — SHILAP Revta. lepid. 30:
9-14.
Janse, A. J. T. 1958-1963. Gelechiadae. — The Moths of South Africa 6. — Transvaal Museum, Pretoria.
284 pp., 138 pls.
Jürivete, U., Kaitila, J., Kesküla, T., Nupponen, K., Viidalep, J. & Ounap, E. 2000. Eesti liblikad katalog.
Estonian Lepidoptera catalogue. — Eesti Lepidopterologide Selts, Tallinn. 151 pp.
Kaitila, J.-P. 1996. Suomen jäytäjäkoiden (Gelechiidae) elintavat. — Baptria 21: 81-105.
Karsholt, ©. & Riedl, T. 1996. Gelechiidae (except Gnorimoschemini). Zn: Karsholt O. & Razowski J.
(eds): The Lepidoptera of Europe. A distributional checklist. — Apollo Books, Stenstrup. Pp. 103-—
113, 118-122, 310-312.
Kerpola, S., Kontuniemi, I. & Lofgren, L. 1985. Mikrotiedonannot 1984. — Baptria 10: 75-95.
Kozlov, M. V. & Jalava, J. 1994. Lepidoptera of the Kola Peninsula, northwestern Russia. — Ent.fenn. 5:
65-85.
Lhomme, L. 1930. Quelques chasses a Str-Etienne-Vallée-Francaise (Lozère) [with descriptions of new
taxa by P. Chrétien]. — Amat. Papillons 5: 84-93, 103-107, 119-126, 135-141.
Lhomme, L. 1948-1949. Catalogue des Lépidoptères de France et de Belgique 2 (part 2, fasc. 5). — Le
Carriol, Douelle (Lot). Pp. 649-808.
Lucas, D. 1955. Nouveaux Lépidopteres Nord-Africains. — Bull.Soc.ent.Fr. 35: 254-257.
Meyrick, E. 1925. Lepidoptera Heterocera. Fam. Gelechiadae. — Genera Insect. 184. — Louis Desmet—
Verteneuil, Bruxelles. 290 pp., 5 pls.
Meyrick, E. 1927. Exotic Microlepidoptera 2 (20). — E. Meyrick, Marlborough. Pp. 609-640.
Milliere, P. 1864-1868. Iconographie et description de chenilles et Lépidopteres inédits. 2. — F. Savy,
Paris. 506 pp., 50 pls.
Milliere, P. 1867. Iconographie et description de chenilles et Lépidopteres inédits. — Mb eatin
(N.S.) 14: 355-388, pls 77-80.
Nel, J. 2001. Espèces nouvelles ou rarement signalées de microlépidoptères des Alpes méridionales
francaises (Lepidoptera, Alucitidae, Gelechiidae, Elachistidae, Ochsenheimeriidae). — Bull.Soc.ent
Fr. 106: 101-104.
Petry, A. 1904. Zwei neue Gelechiiden aus den Central-Pyrenäen. — Dt.ent.Z.Irıs 17: 1-6.
Piskunov, V. I., 1990. Gelechiidae. Jn Medvedev, G.S. (ed.): Keys to the insects of the European part of
the USSR. IV. Lepidoptera 2. -E. J. Brill, Leiden, New York, Kobenhavn, Köln. [English translation. ].
Pp. 889-1024.
Pitkin, L. M. 1984. Gelechiid moths of the genus Mirificarma. — Bull.Br.Mus.nat.Hist. (Ent.) 48: 1-70.
Ponomarenko, M. G. 1992. Functional and morphological analysis of male genitalia of gelechiid moths
of Dichomeridinae sensu novo (Lepidoptera, Gelechiidae). — Ent.Obozr. 71: 160-178.
Pomomarenko, M. G. 1997a. Phylogeny and taxonomy of the subfamily Dichomeridinae (Lepidoptera:
Gelechiidae). — Zoosyst. ross. 6: 305-314.
Ponomarenko, M. G. 1997b. Catalogue of the subfamily Dichomeridinae (Lepidoptera, Gelechiidae) of
the Asia. — Far East. Entomol. 50: 1—67.
Rebel, H. 1899. Zweiter Beitrag zur Lepidopteren-Fauna Südtirols. — Verh.zool.-bot.Ges.Wien 49:
158-185.
Rebel, H. 1917. Uber eine Mikrolepidopterenausbeute aus dem östlichen Tannuola-Gebiet.— Dt.ent.Z. Iris
30: 186-195.
136
HUEMER & KarsHoLt: The genus Acompsia
Robinson, G. S. & Nielsen, E. S. 1983. The Microlepidoptera described by Linnaeus and Clerck. —
Syst.Ent. 8: 191-242.
Sattler, K. 1973. A catalogue of the family-group and genus-group names of the Gelechiidae, Holcopogonidae,
Lecithoceridae and Symmocidae (Lepidoptera). — Bull.Br.Mus.nat.Hist. (Ent.) 28: 153-282.
Sattler, K. & Tremewan, W. G. 1973. The entomological publications of Pierre Milliere (1811—1887). —
Bull.Br.Mus.nat.Hist. (Hist.) 4: 223-280, pls 1-3.
Scopoli, J. A. 1763. Entomologia Carniolica exhibitus insecta Carnioliae indigine et distributa in ordines,
genera, species varietates methodo Linnaeana. — J. T. Trattner, Vienna. 421 pp., 37 pls.
Sorhagen, L. 1901-1902. Grabowiana. Ein Nachtrag zu den “Kleinschmetterlingen der Mark Branden-
burg”. — Allg.Z.Ent. 6: 241-245, 276-279, 311-314, 327-332, 343-347; 7: 19-25, 51-57, 77-81,
97-100.
Stainton, H. T. 1849. Catalogue of the British Tineidae & Pterophoridae. — John van Voorst, London. 32
PP-
Stainton, H. T. 1851. A supplementary catalogue of the British Tineidae & Pterophoridae. — John van
Voorst, London. 28 pp.
Svensson, I. 1966. New and confused species of Microlepidoptera. — Opusc.ent. 31: 183-202.
Svensson, I. 1993. Fjärilkalender. Lepidoptera-calendar. — I. Svensson, Österslöv, Kristianstad. 124 pp.
Treitschke, F. 1833. Die Schmetterlinge von Europa (Fortsetzung des Ochsenheimer’schen Werkes) 9(2).
— G. Fleischer, Leipzig. 294 pp.
Wehrli, E. 1925. Ueber die von mir im Juni — Juli 1924 in Corsica erbeuteten Mikrolepidopteren mit
Beschreibung zweier neuer Arten. — Dt.ent.Z.Iris 39: 133-137.
Werneburg, A. 1864. Beiträge zur Schmetterlingskunde. — H. Neumann, Erfurt. 1: vii + 595 pp., 2: iv +
350 pp
Zeller, P. C. 1839. Versuch einer naturgemäßen Eintheilung der Schaben. - Isis, Leipzig 1839: 167220.
Nota lepid. 25 (2/3): 109-151
Figs. 1-8. Acompsia spp., adults: 1 — A. cinerella, 3, Austria, wingspan 19 mm; 2 — ditto, 7, Germany,
wingspan wingspan 16 mm; 3 — A. pyrenaella sp. n., d, France, wingspan 20 mm; 4 — ditto, 7, France,
wingspan 15 mm; 5 — A. antirrhinella, 3, France, wingspan 20 mm; 6 — ditto, 2, Spain, wingspan 19
mm; 7 — A. maculosella, 3, Austria, wingspan 19 mm; 8 — A. muellerrutzi, d , France (Corse), wingspan
15 mm.
HUEMER & KarsHOoLt: The genus Acompsia
Figs. 9-16. Acompsia spp., adults: 9 — A. dimorpha, à , France, wingspan 17 mm; 10 — ditto, ©, France,
wingspan 11 mm; 11 — A. subpunctella, 6, Sweden, wingspan 15 mm; 12 — A. delmastroella, à , Italy,
wingspan 16 mm; 13 — A. minorella, à, Italy; 14 — A. tripunctella, 3, Austria, wingspan 23 mm; 15 —
ditto, d, Austria, wingspan 18 mm; 16 — ditto, 2, Austria, wingspan 16 mm.
Nota lepid. 25 (2/3): 109-151
Figs. 17-24. Acompsia spp., adults: 17 — A. ponomarenkoae sp. n., d, Greece, wingspan 23 mm; 18
ditto, 2, Greece, wingspan 16 mm; 19 — A. caucasella sp. n., 4, Russia (Caucasus), wingspan 22 mm; 20
— A. schepleri sp. n., 3, Turkey, wingspan 24 mm; 21 — A. fibigeri sp. n., d, Turkey, wingspan 22 mm; 22
— A. bidzilyai sp. n., d, Russia (Transbaikalia), wingspan 19 mm; 23 — A. schmidtiellus, 3, Germany,
wingspan 16 mm; 24 — A. syriella sp. n., d, Syria, wingspan 14 mm.
140
HUEMER & KARSHOLT: The genus Acompsia
Figs. 25-30. Acompsia spp., male genitalia (without aedeagus): 25 — A. cinerella, Germany, slide GEL
881; 26 — A. pyrenaella sp. n., Spain, slide 01/1036; 27 — A. antirrhinella, France, slide GEL 866; 28 — A.
maculosella, Austria, slide GEL 488; 29 — A. dimorpha, France, slide BMNH 26.575; 30 — A. subpunctella,
Sweden, slide GEL 870.
Nota lepid. 25 (2/3): 109-151 141
Figs. 31-36. Acompsia spp., male genitalia (without aedeagus): 31 — A. delmastroella, Italy, slide GEL
864; 32 — A. muellerrutzi, France (Corse), slide 01/1070; 33 — A. caucasella sp. n., Russia (Caucasus),
slide 02/1149; 34 — A. minorella, Slovenia, slide GEL 887; 35 — A. tripunctella, Croatia, GEL 880; 36 —
A. ponomarenkoae sp. n., Greece, slide 01/1068.
142 HUEMER & KarsHo.t: The genus Acompsia
Figs. 37-41. Acompsia spp., male genitalia (without aedeagus): 37 — A. schepleri sp. n., Turkey, slide 01/
1067; 38 — A. fibigeri sp. n., Turkey, slide 02/1112; 39 — A. bidzilyai sp. n., Russia (Transbaikalia),
slide02/1144; 40 — A. schmidtiellus, Germany, slide GEL 1058; 41 — A. syriella sp. n., Syria, NM 16.642.
Nota lepid. 25 (2/3): 109-151 143
Figs. 42-47. Acompsia spp., male genitalia (aedeagus): 42 — A. cinerella, Germany, slide GEL 881; 43 —
A. pyrenaella sp. n., Spain, slide 01/1036; 44 — A. antirrhinella, France, slide GEL 866; 45 — A. maculosella,
Austria, slide GEL 488; 46 — A. dimorpha, France, slide BMNH 26.575; 47 — A. subpunctella, Sweden,
slide GEL 870.
144
HUEMER & KARsHOLT: The genus Acompsia
Figs. 48-53. Acompsia spp., male genitalia (aedeagus): 48 — A. delmastroella, Italy, slide GEL 864; 49 —
A. muellerrutzi, France (Corse), slide 01/1070; 50 — A. caucasella sp. n., Russia (Caucasus), slide 02/
1149; 51 — A. minorella, Slovenia, slide GEL 887; 52 — A. tripunctella, Croatia, GEL 880; 53 — A.
ponomarenkoae sp. n., Greece, slide 01/1068.
Nota lepid. 25 (2/3): 109-151 145
Figs. 54-58. Acompsia spp., male genitalia (aedeagus): 54 — A. schepleri sp. n., Turkey, slide 01/1067;
55 — A. fibigeri sp. n., Turkey, slide 02/1112; 56 — A. bidzilyai sp. n., Russia (Transbaikalia), slide02/
1144; 57 — A. schmidtiellus, Germany, slide GEL 1058; 58 — A. syriella sp. n., Syria, slide NM 16.642.
146 | HUEMER & KARSHOLT: The genus Acompsia
Figs. 59-62. Acompsia spp., female genitalia, 59, 61 (segment VIII), 60, 62 (corpus bursae): 59 — A.
cinerella, Germany, slide GEL 1048; 60 — ditto; 61 — A. pyrenaella sp. n., slide BMNH 26.578; 62 —
ditto. |
Nota lepid. 25 (2/3): 109-151 147
Figs. 63-66. Acompsia spp., female genitalia, 63, 65 (segment VIII), 64, 66 (corpus bursae): 63 — A.
antirrhinella, slide NM 16.638; 64 — ditto; 65 — A. maculosella, Austria, slide GEL 1046; 66 — ditto.
RE Hummer & Kansnorr: The genus Acompsia
Figs. 67-70. Acompsia spp., female genitalia, 67, 69 (segment VIII), 68, 70 (corpus bursae): 67 — A.
dimorpha, slide BMNH 26.576; 68 — ditto; 69 — A. subpunctella, Sweden, slide 02/1113; 70 — ditto.
Nota lepid. 25 (2/3): 109-151 149
Figs. 71-73. Acompsia spp., female genitalia, 71 (segment VIII), 72 (corpus bursae): 71 — A. delmastroella,
Italy, slide GEL 1044; 72 — ditto; 73 — A. minorella, Slovenia, slide GEL 1045.
150
HUEMER & KARSHOLT: The genus Acompsia
Figs. 74-77. Acompsia spp., female genitalia, 74, 76 (segment VIII), 75, 77 (corpus bursae): 74 — A.
tripunctella, Austria, slide GEL 1047; 75 — ditto; 76 — A. ponomarenkoae sp. n., Greece, slide 01/1079;
77 — ditto.
Figs. 78-79. Acompsia schmidtiellus, female genitalia, 78, (segment VIII), 79 (corpus bursae), Ger-
many, slide GEL 1059.
5 2 book review
| Book Review
Razowski, J. 2001. Die Tortriciden (Lepidoptera, Tortricidae) Mitteleuropas. — F. Slam-
ka, Bratislava. 319 pp. (incl. 151 b/w plates, 24 colour plates). — ISBN: 80-967540-7-6.
Price: € 61.00: |
This book contains a very brief introduction in German, a checklist of species, brief descrip-
tions in German including the flight times and known food plants, habitat and distribution.
Then follow line drawings of male and female genitalia of most species and 24 coloured plates
depicting the adults.
The checklist of species does not agree with the European checklist by Karsholt & Razowski
(1996), but instead with Razowski’s catalogue from 1989. The few changes in names from the
European list are unfortunate: nomina dubia are introduced as senior synonyms for Epinotia
immundana (No. 355) and Cydia splendana (No. 500) which are well established names and
this is against the spirit of the ICZN (1999). Endothenia ericetana (No. 228) is incorrectly
cited as a junior synonym, it was published by Humphreys & Westwood in 1845 as well as in
the revised edition of 1854. The terminations of specific names in some cases have been changed,
supposedly to make them agree in gender with the genus. The majority of these are -ella or -
ana endings which are best regarded as nouns in apposition and so should not change. The
genus name Argyroploce comes from the Greek words apyupoc - silver and nAoxn — a wind-
ing, twining, entangling etc. and it is feminine. This eloquently illustrates the problem of this
practice. The genus Coccyx is used instead of Blastesthia even though Coccyx has been shown
to be a synonym of Cydia (Brown 1979).
The species treated are stated to be those occurring in Germany, Poland, the Czech Repub-
lic, Slovakia, Austria and Hungary, although Ditula angustiorana (Haworth, 1811),
Epichoristodes acerbella (Walker, 1864) and Lobesia littoralis (Humphreys & Westwood, 1845)
have been already recorded from Germany (Gaedike & Heinicke 1999), but are omitted.
The status of some taxa are in question, some species may be split or others synonymised,
this is not so important in an identification guide, but it would stimulate study if these cases
were mentioned. For example 378 Epinotia rhododendrana should now be listed as a synonym
of 359 E. nemorivaga (see Huemer 2002).
The genitalia drawings appear accurate and well reproduced at a sensible size. The colour
plates are photographs and all the moths are figured at the same size, although the wingspan is
given in the species description. When illustrations are of a fixed size it would be helpful if a
bar showing the actual size was included on the plates. The same number is maintained for
each species throughout making it easy to relate the description to the illustrations of genitalia
and specimens, and the locality from which each specimen depicted comes is given.
This book should be useful to European microlepidopterists, the plates are well produced
and readily recognisable and the great majority of specimens illustrated are in good condition.
Unfortunately there are rather a lot of mistakes, and in order to avoid these being repeated
a list of them is included below. These were pointed out by a number of SEL members in the
microlepidoptera workshop at the XIII SEL Congress, supplemented by comments by Knud
Larsen and others. Thanks are extended to the many who contributed. In some cases there was
disagreement as to whether the specimen illustrated was correctly identified, for example Ancylis
paludana (no. 319a), but a photograph and a locality is not always sufficient for a definite
determination. It is a pity that these errors detract from the usefulness of the book, but it is still
good value considering the number of coloured illustrations.
Nota lepid. 25 (2/3): 109-151
153
Tab. 1 List of errors in Razowski (2001). Where a figure is doubtful, but not definitely wrong a question
mark is inserted to denote confirmation needed”.
Razowski name Corrected name Comments
474 Cydia succedana
475 Cydia ulicetana -
28 Acleris ferrugana
Page
8
8
Wi
83
83
8
8
1
1
136 [255 Pseudohermenias abietana 255 Piniphila bifasciana -
255 Pseudohermenias abietana
136 256 Pseudohermenias abietana
ol 580 D. harpeana
252 580 D. harpeana
ee Paes | 4
onen
on |
es aren |
65 Gynidimorpha luridana 65 G. luridana ?
mn
a cm | I
mes —
erin pfratotmanae | |
212 I. rectifasciana female one rl
En Asoo | : |
ON mens |
Magee. mom |.
284 |344 Epinotia sordidana 344 ?
288 1405 Eucosma balatonana 405 E. obumbratana
292 436 E. obscurana
292 439 E. cnicicolana
292
294 |474 Cydia succedana
294 |475 Cydia ulicetana
296 |512 Grapholita difficilana
296 |513 Grapholita internana
&
436 Eucosma cnicicolana
439 Epiblema costipunctana
422 Epiblema confusana 422 E. costipunctana
474 C. intexta
475 Cydia sp.
512 G. internana
513 G. difficilana
513a G. nigrostriana
516, 516a G. orobana
296 |513a Grapholita internana
296 |516,516a Grapholita lunulana
298 1522 Grapholita nigrostriana
298 1526 Grapholita molesta
298
298
300
300
300
302 1580 Dichrorampha thomanni
302
302
522 G. internana
526 G. herrichiana
537 Pammene insulana 537 P. ignorata
538 Pammene suspectana 538 P. albuginana
558 Pammene albuginana 558 P. suspectana
559 S. weirana
560 S. nitidana
580 D. harpeana
589 D. alpinana ?
590, 590a D. flavidorsana
559 Strophedra nitidana
560 Strophedra weirana
589 Dichrorampha flavidorsana
590, 590a Dichrorampha alpinana
Comments
9
Further research needed, adults
illustrated as C. succedana have
genitalia matching those shown
for C. ulicetana.
error also in Microlepidoptera
Palaearctica, cf. Speidel & Aarvik
(2002)
D. thomanni is not figured
identical to fig. 214, B. lancealana
is not figured
some suspect this may be G.
minimana
258a is correct
A. sororculana is not figured
Not an Epinotia sp.
E. balatonana is not figured
10 474a and 477 are correct
11 see notes for p. 88 above
154 Book review
References
Brown, R. L. 1979. The Valid Generic and Tribal Names for the Codling Moth, Cydia pomonella. — Ann.ent.Soc.Am.
72: 565-567.
Gaedike, R. & W. Heinicke 1999. Verzeichnis der Schmetterlinge Deutschlands. — Ent.Nachr.Ber., Suppl. 5
(Entomofauna Germanica 3): 1-216.
Huemer, P. 2002. Die Identität von Steganoptycha rhododendrana Herrich-Schäffer, [1851] (Lep., Tortricidae)
Ent.Nachr.Ber., Suppl. 5 (Entomolfauna Germanica 3): 1-216.
Humphreys, H. N. & J. O. Westwood 1845. British moths and their transformations. — Wm. S. Orr & Co., London.
ICZN (International Commision on Zoological Nomenclature) 1999. International Code of Zoological Nomenclature.
Ath edition. — The International Trust for Zoological Nomenclature, London. xxx+306 pp.
Karsholt, O. & J. Razowski. 1996. The Lepidoptera of Europe. A distributional checklist. — Apollo Books, Stenstrup.
380 pp., 1 CD-ROM
Razowski J. 1989. The Genera of Tortricidae (Lepidoptera). Part II: Palaearctic Olethreutinae. — Acta zool.Cracov.
32: 107-328.
Speidel, W. & Aarvik, L. 2002. Synonyms of European Tortricidae and Noctuidae, with special reference to the
publications of Hübner, Geyer and Frölich. — Nota lepid. 25: 17—21.
Davip AGASSIZ
Nota lepid. 25 (2/3): 155-160 155
Four species of Brachodidae new to the fauna of Europe
(Sesioidea)
AXEL KALLIES* & KAREL SPATENKA**
* Axel Kallies, Zionskirchstr. 48, D-10119 Berlin, Germany, e-mail:
[email protected]
** Karel Spatenka, Vyletni 362, CZ-14200 Praha 4, Czech Republic, e-mail:
[email protected]
Abstract. In the present work, four species of the genus Brachodes Guenée, 1845 (Brachodidae) are re-
corded from Europe for the first time. B. tristis (Staudinger, 1879) is reported from the Balkan peninsula
(Greece, Bulgaria, Macedonia), B. powelli (Oberthür, 1922) from Italy, B. nanetta (Oberthiir, 1922) from
Spain and Portugal, and B. beryti (Stainton, 1867) from Greece. Furthermore, B. powelli stat. rev. is resur-
rected from synonymy with B. appendiculata (Esper, 1783). All species are figured and characterised.
Zusammenfassung. In der vorliegenden Arbeit werden von vier Arten der Gattung Brachodes Guenée,
1845 (Brachodidae) erstmals Nachweise fiir die Fauna Europas genannt. Brachodes tristis (Staudinger,
1879) wird vom Balkan (Griechenland, Bulgarien, Macedonien), B. powelli (Oberthür, 1922) aus Italien,
B. nanetta (Oberthiir, 1922) aus Spanien und Portugal sowie B. beryti (Stainton, 1867) aus Griechenland
gemeldet. B. powelli stat. rev. wird aus der Synonymie mit B. appendiculata (Esper, 1783) genommen.
Die genannten Arten werden abgebildet und charakterisiert.
Key words. Lepidoptera, Sesioidea, Brachodes, taxonomy, Europe.
Introduction
The European Brachodidae fauna is relatively poor in species and consists only of
‘grass borers’ of the genus Brachodes Guenée, 1845. Eleven species were listed when
it was last summarised by Heppner (1996).
Lately, research on the Palearctic Brachodidae has intensified and it was shown
that Brachodes candefactus (Lederer, 1858) (=Atychia diacona Lederer, 1858) and
Brachodes fallax (Staudinger, 1900) are not present in Europe as was erroneously
stated in the European checklist (cf. Heppner 1996; Kallies 1998, 2001). However,
Brachodes flavescens (Turati, 1919), a distinct species described from Italy is missing
from this list. Data on this species have been summarised by Bertaccini & Fiumi (2002).
In the course of revisional work on Palearctic Brachodidae, four species were dis-
covered which had not previously been recorded for the European fauna. Records of
these species are listed below, and diagnostic characters are given to separate them
from similar congeners. Figures of genitalia are omitted here since they are not suit-
able for the determination of these species.
The name of one of the species recorded here from Europe for the first time,
Brachodes powelli (Oberthiir, 1922) sp. rev., is resurrected from synonymy with
Brachodes appendiculata (Esper, 1783). With these additions and systematic changes,
the checklist of European Brachodidae now attains a total of 14 species.
Abbreviations
CAK - Collection of Axel Kallies, Berlin, Germany; CKS — Collection of Karel Spatenka, Prague,
Czech Republic; MGAB — Museul de Istorie Naturala ‘Grigore Antipa’, Bucharest, Romania; MNHP —
Museum National d’Histoire Naturelle, Paris, France; NHML - The Natural History Museum, London,
© Nota lepidopterologica, 15.11.2002, ISSN 0342-7536
156 KALLIES & SPATENKA: Brachodidae new to Europe
Great Britain; NHMW — Naturhistorisches Museum Wien, Austria; MNHB — Museum für Naturkunde,
Berlin, Germany; NNHM — Nationaal Natuurhistorisch Museum, Leiden; ZMUC — Zoological Mu-
seum, University of Copenhagen; ZSM — Zoologische Staatssammlung München, Germany.
Systematics and Faunistics
Brachodes tristis (Staudinger, 1879) (figs 1, 2)
Material. Holotype (by monotypy) d with labels: handwritten (Haberhauer?) ‘Taurus | Haberhr.’,
handwritten (Staudinger) ‘tristis Stgr.’, printed ‘Orig.’ (on pink paper) (MNHB). GREECE: 34,
Litochoron, 3-400 m, 14.-22.V1.1957, leg. Klimesch; 68, 32, Kamena, Vurla (Lamia), 6.-12.V1.1957,
leg. Klimesch (Fig. 1); 1¢, 42, Peloponnesos, Zachlorou, Kalavrita, 26.VI.- 3.VIL.1963, leg. Klimesch;
28, same data, but 13.-30.V1.1958; 14, same data, but 27.V.1963, leg. Klimesch (all ZSM); 16, Mt.
Olympus (ZSM); 19, Str. Akrata-Diakopton-Kalavrita, 750 m, 14.VII.1995, leg. Lingenhöle (Fig. 2,
CAK); 1 2, Peloponnesos, 15 km E Tripolis, 14.V.1990, 650 m, leg. Karsholt (ZMUC); 16 , Peloponnesos,
Chelmos (ZSM); 14, 29, Leptokaria, 26.—27.V1.1996, leg. Lastüvka; 24, 12, same data, but 23.—
24.V1.1997 (CKS); 15, same data, but 24.VI.1998; 22, Peloponnesos, Vrontamas, 30.V.1999, leg.
LaStuvka; 16, Peloponnesos, Kalavryta, 4.VI.1999, leg. LaStüvka; 14, Agios Haralambos, 27.V.1999,
leg. LaStüvka; 18, Diakopto, 15.VI.1991, leg. Feik (all CKS); MACEDONIA: 16, Stari Dojran, 2.—
10.V1.1955, leg. Klimesch (ZSM); BULGARIA: 14, 17.V111.1978, Sajtan dere, leg. Krusek (CAK);
12, Pirin Mts., Region Sandanski, Liljanovo, 800 m, 26.V.—21.VI.1981, leg. Eichler (CAK).
Material from outside Europe. 1d, LEBANON, leg. Nicholl (NHML).
This species was described from the Toros Mts in southern Turkey and is now reported
from Europe (Greece, Macedonia, and Bulgaria) and the Lebanon for the first time.
B. tristis 1s related to Brachodes appendiculata. Males can be distinguished by the
shape of the antennal processes (short and broad in B. tristis; long and narrow in B.
appendiculata) and the dark fringe of the wings, especially the hindwings (white in B.
appendiculata). Additionally, fresh specimens can be recognised by the dense orange-
yellow scaling of the forewing which covers the narrow medial streak almost com-
pletely (scaling in B. appendiculata pale yellow to olive-yellow, medial streak whitish
yellow and clearly visible). Female B. tristis can be separated by the dark and shining
black wings (brownish black, often lighter at the base of the hindwing in B.
appendiculata) and the entirely black scaling of head and legs (mixed with individual
white scales in B. appendiculata).
Brachodes powelli (Oberthiir, 1922) sp. rev. (fig. 3)
Material. ITALY: 14, Rom (ZSM); 14, 12, Aspromonte, Calabria, Serro Juncaria, 1700 m,
20.V1.1971, coll. Hartig (NHML); 1d, Aspromonte, 1600-1800 m; 14,19, Aspromonte, Cerasia, 1700
m, 3.VIL.1920, leg. Stauder (NHMW); 28, Piemonte, Val di Susa (TO) Salbertrand, 1800-2000 m,
13.V1.1998, leg. Bassi (coll. Fiumi); SPAIN: 19, Almeria, 8. IV. 1994, leg. Lange & Hoppe (CAK).
Material from outside Europe. MOROCCO: 14, Haut Atlas, ca. 60 km ENE Taroudant,
Tizi-n-Test, southern side, ca. 1800 m, 6.V1.1996, leg. Kallies (Fig. 3, CAK); 1d, Taza, 15.-21.V.1930,
Ebner (NHMW); 14,19, Moyen Atlas, Aguelmane Si Ali (2070) 1-14. VII.1939, leg. Rungs (MNHP);
23, Moyen Atlas, Tizi Tarhzeft, 2200 m, 5. VII.1984, leg. et coll. De Prins; 16, Moyen Atlas, Col du Zad,
2200 m, 2.VII.1984, leg. et coll. De Prins; 14, 1%, Tarurabta, 1.V1.1945, leg. Rungs (MNHP); ALGE-
RIA: 13, Masser, Mines, Lalla-Marnia, June 19.1914, leg. Faroult (NHMW); 26 , 19, Lambeze (MGAB);
TUNISIA: 14, 19, El Kef area, 14.V.1988, Zool. Mus. Copenhagen Exp. (ZMUC); 14, 12, Tunis,
April, coll. Wagner (NHMW); 16 , Kasserine 5.1999, leg & coll. Blasius; 1, Makter, 1000 m, 6. VI.2000,
leg. Bläsius (CAK).
B. powelli was described from Djebel-Timhadit, Morocco, but placed into synonymy
with B. appendiculata later (Heppner 1981). However, male B. powelli can be distin-
Nota lepid. 25 (2/3): 155-160 154
guished from the latter by the shape of the male antenna (processes short and broad in
B. powelli, long and narrow in B. appendiculata) and the usually dark colour of the
hindwing fringe (white in B. appendiculata). Female B. powelli differ by the shining
black colour of the wings (brownish black in B. appendiculata).
B. powelli was reported only from Morocco, although it 1s as widespread in Algeria
and Tunisia. Here this species is recorded from Italy, where it was confused with B.
appendiculata up to now. Beside the data given here, further information on the distri-
bution in Italy were published by Bertaccini & Fiumi (2002). A female Brachodes
specimen from Spain which was examined in the course of this study was found to
very likely to belong to B. powelli, too. So far, it has not been possible to locate any
specimens of B. appendiculata from Europe west of Italy. From this, it can be assumed
that records of B. appendiculata from Spain (Heppner 1996), indeed relate to B. powelli.
Further, the identity of a male specimen from Libya (Bengasi, Cyrenaica, 30. III. 1922,
leg. Hartert) which is preserved in the NHML needs confirmation.
Remark. The holotype of B. powelli could not be traced. However, the Gee of
the type specimen given in the original description is very characteristic (Oberthiir
1922). Moreover, all specimens of the B. appendiculata — species group (sensu Kallies
2001) which were examined from Morocco were found to belong to only a single
species, i.e. Brachodes powelli (Oberthiir, 1922).
Brachodes nanetta (Oberthür, 1922) (fig. 4)
Material. SPAIN: 2d, Sierra Nevada, Camino de la Veleta, 1600 m, 19./21.V11.1985, leg. Baldizzone
& Traugott-Olsen (ZMUC); 1 2, Cantabria, Potes, 4.5 km W San Pelaya, 400 m, 24.V11.1986, leg. Rich-
ter & van Nieukerken [netted at dusk, Quercus ilex shrub & cult. area] (NNHM; CAK); 14, Monte dos
Alhos, Col. Passos Carvalho, 26.VII.1978 (NHML); 19, Zaragoza, V11.1920 (Fig. 4, CAK); PORTU-
GAL: 1d, 12, Monchique, 400-900 m, 23.-30.V11.1938, leg. Zerny (NHMW); 14, Coimbra (CAK);
14, 19, Algarve, Aljezur, 8.—22.VII.2001, leg. Brandstetter (coll. Brandstetter, CAK); 2d, Algarve,
Fortes Rib. de Odeleite, 23.V.2001, leg. et coll. Corley.
Material from outside Europe. MOROCCO: 14,19, Dj. Laxchab, 1500 m, 10.-15. VIL.
1941, leg. Marten (NHMW).
B. nanetta was described and reported only from the Atlas Mts, Morocco. It ıs here
recorded from Europe (Spain and Portugal) for the first time. B. nanetta is similar to B.
nana, which, however, does not occur in the western Mediterranean region. Males can
be distinguished most easily by the proboscis which is well developed in B. nanetta
but absent in B. nana and by the colour of the hindwing (with distinct light areas near
the base of the hindwing in B. nanetta; absent or undefined in B. nana). Females differ
in the colour of the wings (blackish brown, with white markings at costa and anal
margin in distal half in B. nanetta; without markings in B. nana). Records of B. nana
from Spain and Portugal (Heppner 1996) relate to B. nanetta.
Remark. The holotype of B. nanetta could not be traced. However, the figure of the
type specimen given in the original description is quite characteristic (Oberthiir 1922).
Moreover, all specimens of the genus Brachodes — except for B. powelli — which were
examined from the Atlas Mts of Morocco were found to belong to only one species,
i.e. Brachodes nanetta (Oberthiir, 1922).
158 KALLIES & SPATENKA: Brachodidae new to Europe
Brachodes beryti (Stainton, 1867) (figs 5, 6)
Material. GREECE: 46, 12, Peloponnesos, Zachlorou, Kalavrita, 13.-30.VI.1958, leg. Klimesch (Fig.
5, ZSM); 16, Ipiros, Igumenitsa, 0 m, ultimo VII.1994, leg. Selling (ZMUC); 1 4 , Peloponnesos, Taygetos,
Tseria, 18.VII.1992, leg. Dobrovsky (CKS); 1 2, Peloponnesos, Tenaro, 17.VI.1997, leg. Laëtüvka (CKS).
Material from outside Europe. LEBANON: Id, Beskinta, 16. VIII. 1928, leg. Ebner
(NHMW); 4,9, Beirut, 1869, coll. Lederer (MNHB); 14 , Ghazir (CAK); TURKEY: 1 4 , Aintab (MGAB),
1d, Hadjin, 1888, leg. Korb; 14, Taurus, 1888, leg. Korb (both MNHB); 19, Antalya, Gülük Dagi
Termessos, 800 m, 5. VII. 1996, leg. Lingenhöle (Fig. 6, CAK); 14, Hatay Prov., Belen, 26. VI. 1993,
leg. Bakowski (CAK).
This species was described from the environment of Beirut, Lebanon. Here it is re-
ported from Europe (Greece) and Turkey for the first time.
B. beryti is similar and closely related to B. nana (Treitschke, 1834) which was
described from Sicily but is apparently more common in Greece and other parts of the
southern Balkan peninsula. Male B. beryti can be distinguished by the greyish brown
colour of the wings (yellow-brownish in B. nana), by the distinct light areas near the
base of the hindwing (absent or undefined in B. nana), and more importantly by the
antenna (tapered, relatively smooth, somewhat flattened in B. beryti; equally broad for
almost the entire length, rough, not flattened in B. nana). Females can be separated
easily by the colour of the wings (blackish brown, with white markings at costa and
anal margin in distal half in B. beryti; brown, without markings in B. nana).
Conclusions
The additions to the fauna of the European Brachodidae presented in this article ap-
pear well consistent. Both, B. tristis and B. beryti are species with levantino-
mediterranean distribution, a range type which often extends into the southern Balkan
peninsula, whereas B. powelli and B. nanetta show a south-west-mediterranean distri-
bution which frequently includes the Iberian peninsula and/or southern Italy. With
respect to the Brachodidae fauna, the western part of Europe now can be regarded as
relatively well-explored. In eastern Europe, however, the occurrence of additional and
even undescribed species is conceivable, especially in the xerothermic grasslands of
southern Russia and on the Balkan peninsula.
Recent research on the Palearctic Brachodidae has yielded several taxonomic
changes, descriptions of new species and a more detailed knowledge of the species
distribution (Kallies 1998, 2001; Zagulajev 1999) although, even concerning the Eu-
ropean fauna, several taxonomic problems remain unsolved. Likewise, knowledge of
the life cycle of Brachodes moths is still incomplete and the early stages have not been
described in detail. Sampling of Brachodidae is hampered by the rapid flight of the
heliophile adults and the endophagous cryptic life of the larvae. As demonstrated for
clearwing moths (Sesiidae) the use of artificial sexual attractants could prove to be
helpful in field research on Brachodidae and would likely result in the discovery of
additional species in Europe. This approach is hindered, however, by the lack of iden-
tified Brachodidae pheromone compounds. To increase the knowledge on the Euro-
pean and Palearctic Brachodidae, basic research on the bionomics and pheromone
reaction of Brachodidae is urgently needed.
Nota lepid. 25 (2/3): 155-160 159
5A 6
Figs. 1-6. Brachodes species. 1 — B. tristis 3, Greece, alar exp. 23 mm (ZSM). 2 — B. tristis +, Greece,
alar exp. 18 mm (CAK). 3 — B. powelli 3, Morocco, alar exp. 21 mm (CAK). 4 — B. nanetta 3, Spain,
alar exp. 19 mm (CAK). 5 - B. beryti d, Greece, alar exp. 19 mm (ZSM). 6 — B. beryti ©, Turkey, alar
exp. 23 mm (CAK).
Acknowledgements
Our cordial thanks are due to A. Hausmann and U. Buchsbaum (both ZSM), O. Karsholt (ZMUC), M.
Lödl (NHMW), W. Mey (MNHB), J. Minet (MNHP), E. van Nieukerken (NNHM) as well as G. S.
Robinson and K. Tuck (both NHML) for the loan of material under their care, and in addition to M. Nuss
(Staatliches Museum für Tierkunde, Dresden, Germany) for arranging the loan from the MNHP, respec-
tively. Furthermore, we are grateful to G. Baldizzone (Asti, Italy), M. F. V. Corley (Faringdon, Great
Britain), G. Fiumi (Forli, Italy), and W. de Prins (Antwerp, Belgium) for allowing us to study material in
their collections, and to M. Bakowski (Poznan, Poland), R. Bläsius (Eppelheim, Germany), Th. Dobrovsky
160 KALLIES & SPATENKA: Brachodidae new to Europe
(Praha, Czech Republic), H. Fischer (Rottach-Weissach, Germany), Th. Lange (Wittenberge, Germany),
Z. LaStüvka (Brno, Czech Republic), and A. Lingenhöle (Biberach, Germany) for supplying material for
this study. Finally, we thank M. F. V. Corley (Oxfordshire, Great Britain) for linguistic help.
References
Bertaccini, E. & Fiumi, G. 2002. Bombici e Sfingi d’Italia. Volume 4: Lepidoptera: Sesioidea. — Stud.
Nat. Rom. 181 pp.
Heppner, J. B. 1981. Brachodidae. pp. 8-15. — Jn: Heppner, J. B., & W. D. Duckworth, Classification of
the superfamily Sesioidea (Lepidoptera: Ditrysia). — Smiths.Contrib.Zool. 314: 1-144.
Heppner, J. B. 1996. Brachodidae. p. 125. — Jn: Karsholt, O. & Razowski J. (eds.), The Lepidoptera of
Europe. A distributional checklist. — Apollo Books, Stenstrup. 380 pp.
Kallies, A. 1998. Erster Beitrag zur Kenntnis der palaearktischen Brachodidae Agenjo, 1966: Revision
von Brachodes fallax mit Beschreibungen neuer zentralasiatischer Arten (Lepidoptera: Sesioidea). —
Nota lepid. 21(3): 170-193. |
Kallies, A. 2001. Revision of the Brachodes pumila (Ochsenheimer, 1808) species-group (Lepidoptera:
Sesioidea). — Nota lepid. 24(1/2): 7-19.
Oberthür, Ch. 1922. Les Lépidoptéres du Maroc. — Études de Lépidoptérologie Comparée 19 (1): 13-
405, pl. 74-124, 530-548.
Zagulajev, A. K. 1999. New and little known moths ee Thyrididae, Brachodidae) of the fauna
of Russia and neighbouring territories. XI. — Ent.Obozr. 78: 896-909. [in Russian]
Nota lepid. 25 (2/3): 161-175 161
Taxonomic patterns in the egg to body size allometry of butter-
flies and skippers (Papilionoidea & Hesperiidae)
ENRIQUE GARCIA-BARROS
Departmento de Biologia (Zool.), Universidad Autonoma de Madrid, E-28049 Madrid, Spain
Summary. Former studies have shown that there is an interspecific allometric relationship between egg
size and adult body size in butterflies and skippers. This is here re-assessed at the family and subfamily
levels in order to determine to what extent the overall trend is uniform through different taxonomic
lineages. The results suggest that different subtaxa are characterised by different allometric slopes. Al-
though statistical analysis across species means is known to be potentially misleading to assess evolu-
tionary relations, it is shown that the comparison of apparent patterns (based on species means) with
inferred evolutionary trends (based on independent contrasts) may help to understand the evolution of
egg size in butterflies. Further, intuitive reconsideration of statistically non-significant results may prove
informative. As an example, argumentation in favour of a positive association between large egg size
and the use of monocotyledon plants as larval food is presented. Taxa where atypical allometric trends
are found include the Riodininae and Theclini (Lycaenidae), the Graphiini (Papilionidae), and the
Heliconiinae (Nymphalidae).
Key words. Allometry, butterflies, Hesperioidea, egg size, body size, life-history, Papilionoidea,
wing-length
Introduction
Egg size has a relevant position in life-history theory because of its potential links with
most other life history traits (Fox & Czesak 2000). In butterflies, these links are be-
lieved to include female fecundity, host plant structure, the time required by the larvae
to reach their final size, as well as the endurance ability of the egg itself, or of the first
instar larvae (Reavey 1992; Garcia-Barros 2000a). Comparative research on the
interspecific relations between the egg and adult body sizes among the Papilionoidea
and Hesperioidea has demonstrated a robust positive relationship between these two
traits (Garcia-Barros & Munguira 1997; Garcia-Barros 2000a). The trend represents a
negative allometry, i.e. the eggs of species with largest adults tend to be larger than
those laid by small butterflies, but they become proportionally smaller as adult size
increases. In other words, the slope (b) of the equation Jog EGG SIZE= a + b(log
ADULT SIZE) is lower than 1.00 (in fact, within the range of 0.4-0.5 when both values
are estimated in millimetres). However, it is not known to what extent this general
trend applies to every single subordinated butterfly taxon. Alternatively, the trend might
be arising from a combination of several distinct patterns characteristic to different
phyletic lineages (e.g., Garland & Janis, 1992). This study seeks, first, to check whether
the egg to body size allometry holds within the main subtaxa of the papilionoid +
hesperioid clade, in order to identify possible exceptions. And second, to determine if
particularly small or large eggs (relative to the adult insect size) are restricted to par-
ticular taxa, as well as to discuss some possible reasons of the patterns discovered.
The size of each of the species within a clade was inherited — at least in part — from
a shared ancestor. Hence, mean sizes of individual species are not statistically inde-
© Nota lepidopterologica, 15.11.2002, ISSN 0342-7536
162 GarciA-Barros: Egg to body size allometry of butterflies
pendent, one necessary pre-requisite of standard regression procedures (for butter-
flies: Garcia-Barros 2000c). The method of independent contrasts is one of the com-
parative procedures proposed to solve this problem (Felsenstein 1985; Starck 1998),
and will be used in this study. However, the raw species means are not devoid of
interest, for two reasons: First, because they can be used to describe present patters
which, when statistically significant, have a predictive value (paradoxically, one rea-
son why this may work is phylogenetic inertia, the same reason why evolutionary
relations cannot be directly inferred from the data). And second, that comparisons of
the two approaches are by themselves informative whenever it is kept in mind that
observable patterns among raw species data do not necessarily represent evolutionary
trends, and that the opposite is true for regressions done on independent contrasts.
Methods
The information used in this work is the same as described in Garcia-Barros (2000a, b,
c). No attempt has been done to update either the size estimates nor the phylogenetic
hypotheses underlying the comparative analysis, even if new evidence of both kinds
has become available more recently (e.g. Penz 1999; Brower 2000; Kitching er al.
2000; Martin er al. 2000; Harvey & Hall 2002). This facilitates a direct comparison
with the results presented elsewhere (Garcia-Barros 2000a). The author assumes that,
as further work on butterfly life-histories and phylogenetic reconstruction progresses,
the results dealt with here might be substantially modified.
The data consisted of two linear estimates from each out of 1183 species: egg size
(egg volume’? in mm), and adult size (the length of adult fore-wing in mm). Both were
transformed to decimal logarithms before any statistical treatment. Full details can be
found in Garcia-Barros (2000b). Two parallel sets of analyses were carried out, using
two versions of the same data: the species data points (the log-transformed egg and
adult size estimates), and the taxonomically independent contrasts calculated for those
two traits. The independent contrasts are weighted differences between the values of a
variable in the taxa derived from the same node in the cladogram or taxonomic ar-
rangement (Harvey & Pagel 1991; Garland et al. 1992; Starck 1998). These were ob-
tained using the program CAIC (Purvis & Rambaut 1995), as specified in Garcia-
Barros (2000a). The contrasts can be analysed in the same way as the original data,
except that regressions have to be forced through the origin. This means that there is
no intercept, and hence the allometric equation becomes EGG SIZE contrast= b(ADULT
SIZE contrast) (e.g. Garland et al. 1992).
The analyses were performed using the computer package STATISTICA (StatSoft
2000), and included: (1) A brief description of the variation of egg size in the main
taxonomic groups (family, subfamily), and their associated adult sizes. (2) Determin-
ing the allometric relations of egg to body sizes by regression. Only taxa at or above
the tribe level, where nine or more contrasts could be calculated, were included in this
and subsequent steps. Least Squares Regression (LSR) was used throughout the study,
but Reduced Major Axis (RMA) slopes were calculated for comparison. In brief, these
two regression models differ in the way used to minimize the distances between the
Nota lepid. 25 (2/3): 161-175 163
data points and the regression line. LSR uses the shortest distance measured from the
axis that represents the independent variable, while RMA regression minimizes the
distances relative to both (X, Y) axes (details and further references can be found in
Harvey and Pagel, 1991, and in the discussion). (3) Comparing the slopes of the re-
gression lines fitted to the families and subfamilies, by means of pairwise analyses of
the covariance (ANCOVA) of egg size by taxonomic levels with adult size as the
covariate. The effect of two factors crossed (family or subfamily, and adult size) was
tested (e.g. Garland et al. 1992). Taxa where egg and body size were not correlated
‘were discarded for this purpose. (4) Finally, the mean relative egg sizes were com-
pared to the common trend, in order to identify families or subfamilies where unex-
pectedly high or low relative egg size values were found. The effect of one categorical
_ variable containing codes for the families and subfamilies was tested by ANCOVA,
with adult size as the covariate. The residuals of the regressions of egg size on adult
wing size were used for graphic purposes.
Results
The frequency distributions of the egg and adult sizes of each of the five families are
shown in Figure 1. Mean adult wing length increased following the order: Lycaenidae,
Hesperiidae, Pieridae, Nymphalidae, and Papilionidae. Mean egg size increased ac-
cordingly from Lycaenidae to Papilionidae, with the exception that Hesperiidae and
Pieridae appeared in reverse order. The taxonomic arrangement could significantly
explain the variance of the original egg size data (controlling for adult size) both at the
family level (ANCOVA: F, jogg =84.73, P<0.0001), and at the subfamily level
(ANCOVA: F4 1078 =62.71, P<0.0001), and so a degree of ‘taxonomic conservatism’
in relative egg size is evident in the original data.
Not surprisingly, the smallest (in absolute terms) eggs are those laid by the tiniest
lycaenids, in particular some representatives of the tribe Polyommatini (Lycaeninae)
such as Brephidium, Zizina or Hemiargus (e.g. Dethier 1940; Clark & Dickson 1971)
with estimated egg volumes of 0.015 to 0.03 mm’. Conversely, the largest eggs are
those of the troidine papilionids (up to 20 mm? or more). The egg of Ornithoptera
tithonus de Haan measures 4.1 mm in diameter (Parsons 1995), and its volume is
1,700 times larger that of the smallest lycaenid eggs. Other representative examples of
large butterflies laying large eggs include the nymphalid subfamilies Charaxinae or
Morphinae (e.g. Hoffmann 1938; Casagrande & Mielke 1985; Igarashi & Fukuda 1997;
Urich & Emmel 1991). Species that lay unexpectedly large eggs relative to their wing
size include some members of the nymphalid genera Dophla, Dynastor and Agrias, as
well as several Hesperiidae-Trapezitinae (e.g. Atkins 1978). Opposite to these, some
Pieridae (Phoebis, Tatochila, Antheos) and Nymphalidae (Hypolimnas, Pandoriana)
lay remarkably smaller eggs than expected (van Son 1979; Shapiro 1987; Garcia-Barros
2000d).
The regression statistics are given in Table 1. Regressions based on contrasts were
generally more conservative. Irrespective of the kind of data used, no correlation was
‚found for the Graphiini (Papilionidae), the Theclini (Lycaenidae), the Heliconiinae
164 GarciA-Barros: Egg to body size allometry of butterflies
¥=072+022 | lon es “PU
50
50
Hesperiidae
95 25
0 0
x= 47.00 + 17.01
x= 1.06 + 0.39
Papilionidae
x= 0.54 + 0.16 x= 24.50 + 6.85 DE
Pieridae
x= 0.48 + 0.14 X= 15.66 +3.30 + 100
Lycaenidae
x= 0.84 + 0.32 X= 32.52 + 1141
100 Nymphalidae 50
Si) Si
0 0
0 1 2 Sal 20 36... 52. 68 CONS
Egg size (mm) Wing length (mm)
Fig. 1. Frequency distributions of egg size (left column) and wing length (right column) of the species
included in the data set, arranged by families. Note that the Y axis scales differ among the histograms.
The arithmetic average + 1 standard deviation are included in each histogram.
(Nymphalidae), nor the two heliconiine tribes Acraeini and Heliconiini. Some correla-
tions that were supported by the analysis of species means vanished when the contrasts
were used: Hesperiidae-Trapezitinae, Lycaenidae-Eumaeini, and the family Lycaenidae
as a whole. Other relationships (e.g. in Papilionini swallowtails and within the Danainae
nymphalids) appeared to be more robust when based on contrasts than when estimated
from the original data. The Riodininae (Lycaenidae) were remarkable for representing
the single taxon to display a significant, negative correlation across contrasts, but none
with raw species data. A few representative plot graphs are presented in the Figs 2-3.
Nota lepid. 25 (2/3): 161-175 165
Table 1. The allometric relationship between egg size and adult body size in butterfly families, subfamilies
and tribes, derived from species data and independent contrasts. Only taxa where nine or more contrasts
could be calculated are included. N= number of species or contrasts, r = Pearson’s coefficient of correlation
(**** — P<0.0001, *** — P<0.001, ** — P<0.01, * — P<0.05, ns — not significant, P>0.05). Least squares
regression (LSR) and reduced major axis (RMA) slopes are given in all instances, but note these are not
relevant when the correlation is not significant. Regressions of contrasts were forced through the origin,
and thus the intercept is equal to 0.00.
___ ee 1 | Independent contrasts
TAXON |N Ir |P [a [oise oRMA)IN [r IP |sase)|srma)
| Trapezitinne 28 [040 |* 1077 |oss_|143 |o 105 Ins 100 [on
[PAPILIONIDAE |94 [076 |** |-121 [073 loss [47 lo |*** lo [097 |
[ ramassinse [34 [oso [= frs [oss [iis [nom [= os Jos
[ Papitionioae [60 Josı [res Iso jo [121 [sa Tom [ee [ors [1.06
D Gmphini [14 fois Ins [-oae fon [iss [9 fou Im los fi |
ese a foes Fr 154 [ios | Vins un [oss [+ |i20 [is
Ses sms =
SC eS oe se ose | De DE
8 ee eee ee
Price [32 [004 Ins [040 loos fin [1s
Se lee
| Thectini [43 [0.28 Ins 1.056 [024 |os7 [14 10
D uen 37 [oss [+ os fos: us [a9 fo.
BE [122 joa [>>> 08 {ass [oss [as 0.31
ee Eee Fr 0.41
ETES
Babel
LEE
Haye
on
0.70
Heicominse [105 jo22 Ins 072 [0% [197
Acracini [is [037 Is [om [oat Joss [is jou
| Heliconiini [86 [0.16 [ns ]-064 [029 loss [39 | 0.18
iihominae 165 [oa [ver fous [oss Joss [a 032
| Danainae [27 [osı |= 1.100 loss [125 [20 [om
Eimeniimee 140 fost [rer (uen [ios [ss is [ost
ee eee
00). #9
0.43
saint [138 Joss [re [om [oss [12 [58 los
oO . .
2
oO
S
D
oO |© Sal
i=
(06)
=
Whenever a significant correlation was found, the LSR slopes had positive values
between +0.21 and +1.20 (except for the Riodininae, Table 1), and RMA slopes were
often close to or above 1.00. The tests for heterogeneity of the slopes are summarised
in Tables 2 and 3. Family and subfamily mean relative egg sizes, as well as mean
relative egg size increases, are compared with the overall relation depicted in Figure 4.
The differences between pairs of taxa are presented in Tables 4 and 5.
166
GarciA-Barros: Egg to body size allometry of butterflies
Papilionidae
1.0 1.2 1.4 1.6 1.8 0.00 0.05 0.10 0.15
. Species means _ Contrasts
Fig. 2. Sample plots to illustrate the relationship between egg size (Y axis) and adult size (X axis) at
different taxonomic levels: families Papilionidae and Lycaenidae, and subfamily Hesperiinae
(Hesperiidae).-Left column, as estimated from the logarithmically transformed species data. Right col-
umn, based on independent contrasts. The trend lines illustrated are those fitted by least squares regres-
sion. A dotted line indicates non-significant correlation. Note that the scales of the left and right columns
are not the same. See Table 1 for further details.
Table 2. Paired comparisons to test the significance of differences between the slopes of the regressions
of egg size on adult size of the five butterfly families. The values are the F statistic for the interaction
between the factors ‘family’ and ‘adult size’ in an analysis of the variance of egg size by families using
adult size as a covariate (1 d.f.). * — P<0.05, nt — not tested (the differences between the Lycaenidae and
other families, based on contrasts, were not tested since no correlation was found within the lycaenids).
The comparisons based on the independent contrasts are given above the diagonal, and those based on
species data points below the diagonal. Only two pairs of families were found to have significantly
different slopes, based on independent contrasts. None of the differences based on species data were
significant (P>0.24 in all instances).
| | Hesperiidae |Papilionidae | Pieridae
Papilionidae
Pieridae
Nota lepid. 25 (2/3): 161-175
0.25
0.00
-0.25
-0.5
0.25
0.00
-0.25
-0.50
0.25
0.00
-0.25
-0.50
1.0 1.2 1.4 16 1.8 0.00 -
Species means
167
Pierinae
Heliconiini
0.10 0.15
Contrasts
Fig. 3. Plots showing the relationship between egg size and adult size in the subfamily Pierinae (Pieridae),
and the tribes Heliconiini (subfamily Heliconiinae, Nymphalidae) and Satyrini (subfamily Satyrinae,
Nymphalidae). Details as in Figure 2.
SPECIES MEANS INDEPENDENT CONTRASTS
®
E
ri
“47
3 |
439 +4 -0.01
„LA 1 0.04
J Lan
9 “mA rf e ; | +
: 14H hd 000
S hb wv on Par ausge a oF
2 vi vo € 0.02
* Vf+ ui ta pui
V
-0.2 19V 0.06
Fig. 4. Plots illustrating relative
egg size (based on species means)
and relative egg size increase
(based on independent contrasts) in
butterfly families, and selected
subfamilies. The values were cal-
culated as distances from the com-
mon trend (residuals from the re-
gression), based either on species
data points or on independent con-
trasts. The vertical bars indicate +
| standard error. The common
trend is represented by the dotted
line, and values above or below
0.00 indicate either proportionally
large or small egg size. The taxa
referred to are | = Hesperiidae, 2
= Papilionidae, 3 = Pieridae, 4 =
Lycaenidae, 5 = Nymphalidae, a =
Hesperiinae, b = Trapezitinae, c =
Pyrginae, d = Parnassiinae, e =
Papilioninae, f = Pierinae, g = Riodininae, h = Lycaeninae, i= Heliconiinae, j = Nymphalinae, k =
Limenitinae, | = Charaxinae, m = Satyrinae, n = Danainae, and o = Ithomiinae. Taxa marked with
ba)
triangle have a mean that departs significantly from the common trend (P<0.05 or below).
168 GarciA-Barros: Egg to body size allometry of butterflies
Table 3. Paired tests for the significance of the differences between the slopes of the subfamilies in
Table 1. F values, 1 d.f., details as for Table 2 (* — P<0.05, ** — P<0.01, *** — P<0.001). The upper right
half of the matrix summarises the comparisons of slopes derived from independent contrasts, and the
lower left half those between slopes derived from species data. No comparison was attempted for those
subfamilies that did not show a significant relationship between egg size and adult size (nt — not tested).
|Char. [Sat |Dan. Jitho. |
0.04 0.01
Trapezitinae | 3.06. nt nt nt Ea | nt
Pyrginae 1.34 406 loss [408 |006 |0.25 0.86 1.68
Parnassiinae ; 0.01 0.20 0.00 0.00 0.40
Papilioninae 2.88 2829" |9.69 | 4.46 041
Pierinae - 0.06
Riodininae nt nt nt 2 [35 Se
Lycaeninae 203 025 727 occ ae ee ee 1.77 [039 [0.69
Nymphalinae efor onu Lan | de foun y us fan]
Limenitinae 926° [230 - oor "355: | Im 306 "ose - eo
Charaxinae | 0.27 11.78" |2.54 0.13 2.50
Satyrinae | 22.39" 0.25 2482" | 2.33
Danainae | 2.98 one 0.04
Ithominae | 1425" Tr
208° _ |1158" loi |, soo bea eT
se jo ___|1336"" PNR
= 4.71
nt
nt
nt
nt
0.09
2.28
Table 4. Summary of the between-family differences in relative egg size (controlling for adult size)
based on a multiple range test. The upper right half of the matrix shows the relative egg size increases
based on independent contrasts, and the lower left half refers to results based on the species averages
(relative egg size). * — significant at the P<0.05 level or below (the differences themselves are not shown
for simplicity), ns — not significant.
2 Jimemeritse rapiionitae [rise [ice [Nm |
eee | 1
ns
Nymphalidae
S
S
S
*
ER es en
po | a
Pe See
Table 5. Summary of the between-subfamily differences in relative egg size increase (upper right half),
and relative egg size (lower left half). Only subfamilies where 9 or more independent contrasts could be
calculated were compared. All other details as for Table 4.
l=)
et
=!
[Hesperiinae | - | ns | nm | m |
[Trapezitinae| * | En En
Pyrginae
Parnassiinae
5
7)
17]
77)
Fink a al
Be
5
n
5
an
=]
[=]
ns |
TR
Dern
EE
BEE
=
Bunter
este]
|
Cian a
*
*
ns
Nota lepid. 25 (2/3): 161-175 169
Discussion
Taxonomic heterogeneity. The slopes of the lines fitted to the species means are mark-
edly homogeneous at a high (family) taxonomic level, but differences arise at the sub-
family level. The overall slope based on the independent contrasts (b= 0.49) appears to
mask a number of non-coincident trends. These include taxa without evident allometry
(e.g. Lycaenidae-Theclini, Nymphalidae-Heliconiinae), as well as phyletic lineages
characterized by slopes that differ significantly from the overall allometry pattern (e.g.
Pieridae, Papilionidae, Hesperiidae). For analogous reasons, the interpretation of sig-
nificant differences between family-level slopes is not straightforward. For instance,
the differences between the skipper and the swallowtail slopes are basically a conse-
quence of those that exist between the subfamilies Papilioninae (Papilionidae) and
Pyrginae (Hesperiidae), respectively. This suggests that detailed quantitative compari-
sons will require a more narrowly defined taxonomic scenario. It is likely that the
general pattern merely represents an average trend, not a real property of a number of
the subtaxa analysed.
Regression lines and models. Determining accurately the regression slopes is inter-
esting for further evolutionary argumentation, since negative allometry (slope b <1.0)
would lead to predict enhanced fecundity in large bodied butterfly species (Garcia-
Barros 2000a). This is exactly the general pattern in butterflies that one would infer
from the LSR slopes (range of significant b values: 0.35—1.06 for species data, 0.21—
1.27 for independent contrasts). In contrast the usually higher RMA slopes (most b
values >1.0, irrespective of the type of analysis) would mostly lead to reject the idea of
a structural relation between body size and fecundity. LSR tends to underestimate the
slope, and this effect is the stronger the lower the correlation coefficients are (details in
Rayner 1985; LaBarbera 1989; Harvey & Pagel 1991; Riska 1991; Garland er al. 1992).
Which method should be preferred depends on the ratio of error variance between the
two variables. Although there is some support for applying LSR to the present data set
(McArdle 1987; Garcia-Barros & Munguira 1997), estimates of the measurement er-
rors in the variables would facilitate the choice of a regression model. Such estimates
could be calculated from independent estimates of the egg and adult sizes of each
species.
Wing length and body size. The results of this work assume that wing length is well
correlated to overall body size (e.g. body weight: Miller, 1977, 1997), and that the
relationship between both is roughly constant. This is probably the case in most in-
stances. However, some degree of architectural heterogeneity may occur even among
related species, for instance, resulting from selection for flight ability, mating strate-
gies, or palatability (Betts & Wootton 1988; Chai & Srygley 1990; Marden & Chai
1992; Wickman 1992; Corbet 2000; Hall & Willmott 2000). In order to improve the
analyses, one would have to resort to more precise measures of body mass, which
however are still unavailable for most of the species.
Conflicting evidence and egg size as related to monocotyledon larval feeding. Con-
flict between the trends based on the species values and those supported by the inde-
pendent contrasts may be of interest for evolutionary speculation. For instance, the
170 GarciA-Barros: Egg to body size allometry of butterflies
Hesperiidae-Pyrginae would be said to lay relatively large eggs based on the original
data. However, the regression based on contrasts indicates that evolutionary shifts in
the relative egg size of these skippers have most often been below the butterfly aver-
age. This suggests a ‘large egg-stage’ as plesiomorphic in this group, followed by
frequent parallel shifts to proportionately lower egg sizes.
Patterns that vanish after controlling for taxonomic effects are likely to reveal sin-
gle evolutionary novelties acquired by an ancestral taxon, and subsequently inherited
by all descendant species. These are identified in the transformed data by one, or a few
positive contrasts, so that the evolutionary event will have no statistical significance
(Nylin & Wedell 1994). The volume of the eggs of species with grass-feeding larvae
provides an example. The Poaceae have leaves with a parallel array of sclerenchyma
fibres and contain high levels of silica, which make them difficult to chew (Bernays &
Barbehenn 1987). Large egg size should improve the survival of the correspondingly
larger newly hatched larvae when these have to feed on tough plant leaves (Wiklund &
Karlsson 1984; Braby 1994). The longer distance between the mandible bases would
allow for widest bites, and the widest mandibular muscles would permit a net increase
in mandibular strength (cf. Nakasuji 1987). However, tests for a positive relationship
between egg size and larval monocot feeding have not produced any convincing re-
sults (Garcia-Barros 2000a). A more intuitive reconsideration of the hypothesis is pre-
sented in Table 6. Two skipper subfamilies (Hesperiinae, Trapezitinae) have larvae
that feed on monocotyledonous plants. The members of both groups lay proportionally
larger eggs than the Pyrginae, which use dicot hosts. Further, the slope of the egg to
body size relation is lower in the Pyrginae. The association between large egg size and
larval monocot-feeding should hence be regarded as a possibility in the skippers, al-
though this probably represents a single evolutionary event related to an ancestor of
the entire Hesperiinae + Trapezitinae clade. The same might hold for the satyrine
nymphalids, and perhaps other butterflies (Table 6).
Are small eggs selected for? Small eggs might have been selected for under a number
of circumstances, such as endophytic or cryptic larval habits (Reavey 1993), or in-
creased female fecundity. Everything else being equal, egg size reduction should im-
ply a longer larval development time, and hence a possible trade-off between fecun-
dity and adult size. This could in turn be compensated for by larval feeding being
specialised on nutrient-rich parts of the host (Mattson 1980; McNeill & Southwood
1978; Slansky 1993). These circumstances make one recall the family Lycaenidae, for
in fact these butterflies lay smaller eggs than expected for their adult body sizes (at
least when the average is considered, Fig. 4). Further, egg size and body size are only
loosely linked in the Polyommatini, and apparently unrelated in the Theclini (Table 1).
Since lycaenid life-histories are often complex, a varied array of specializations may
contribute to obscure allometric trends in these insects.
Wiklund er al. (1987) found no correlation between the egg weights and female
body weights of North European pierids, and argued that such pattern could result
from selection for increased fecundity through increased body size. The present study
shows that egg size and body size are correlated in the Pieridae. However, the slope of
the relationship measured on independent contrasts is comparatively low, as it is for
Nota lepid. 25 (2/3): 161-1755 7
Table 6. Evidence concerning the possible association between larval feeding on monocotyledonous
plants and large egg size. The figures given in brackets are the egg sizes expressed as percentages of
wing length, obtained from the species values that were hierarchically averaged following the taxonomic
arrangement. An asterisk indicates that the estimate is based in only one or two species. The signs (+,
—) denote the direction of hypothetical changes in relative egg size (left to right column within each
row). Although the direction of the shift within the Morphinae depends on the phylogenetic hypothesis
assumed, it would require no less than one change to larger egg size in combination to one shift to monocots.
One of the correlated changes has to be deleted if the Brassolinae were shown to be the sister group of the
Satyrinae or Morphinae. If the two hypothesised reversals to non-monocotyledon hosts are excluded, a
majority of the events of monocot colonisation happen to be associated with increases in relative egg size.
with dicot hosts monocots non-monocots
Coeliadinae (2.69) Trapezitinae (4.86)] (4.49)
ee, Pe
Mesosemia (2.0*)
BEER
ET Otte: Fumacini (2.6 Pee oe
| Jamides bochus (1.8*) J. alecto (2.45*) PEN eee ee
Mes
Euthaliiti (3.6)
Other Nymphalids (2.3) Br ee Ragadiini (Satyrinae)
Brassolinae (2.8)
Morpho? (2.1) or other Antirrhea (3.4*)
Morphinae? or Amathusiini (2.6)
other nymphalids? (2.3)
the best represented subfamily, Pierinae. Again, the comparison between the apparent
relationship and the one derived from the comparative study suggests that proportion-
ally small eggs represent a basal trait within the Pieridae. This is difficult to judge with
precision because of the high variance of the contrasts, but it may be stated with some
confidence for the subfamily Pierinae at least (see Fig. 3). An interpretation is that the
present pierid pattern represents the result of ancestral reduction in relative egg size,
probably combined with structural negative allometry. The ultimate reason could well
have to do with selection for high fecundity, although again other ecological specializations
(such as larval feeding on highly nutritious substrates) cannot be ruled out.
Can the evolution of egg and body size be negatively correlated? According to the
data collected, the evolution of egg size in the Riodininae (Lycaenidae) has proceeded
following an inverse trend relative to wing size. Negative allometry (slope between
0.0 and 1.0) is commonplace in most animal groups (Reiss 1989), while a negative
correlation between increases of egg size and adult body size is surprising. The proc-
ess implies a generalised minimisation of egg size following evolutionary increases in
adult size, and oversized eggs in species selected for small body size. Re-assessing
this relationship on the light of new evidence proves necessary. There is of course the
possibility that the number and quality of the size estimates from riodinids was inad-
equate, or that the taxonomic arrangement adopted (basically following DeVries 1997)
is particularly unrealistic. A number of recent descriptions of riodinine eggs (Downey
172 GaARCiA-BARROS: Egg to body size allometry of butterflies
& Allyn 1980; DeVries 1997) prove that an amount of material is being collected and
stored in scientific collections. This, together with new life-history data from hitherto
poorly known species, should soon facilitate a reassessment of the egg to body size
allometry in the metalmarks.
Absence of allometry. The Heliconiinae (sensu Harvey, 1991) show no sign of egg
to body size allometry, and the same applies to the heliconiine tribes Acraeini and
Heliconiini. To the extent that the data are reliable, it is likely that the diversification of
size in these butterflies may have been subject to fast evolution in response to varied
environmental variables. The adult biology of Heliconius is peculiar in several re-
spects, such as the ability to gather amino acids from pollen and their potentially long
adult life (e.g. Dunlap-Pianka et al. 1977; Dunlap-Pianka 1979; Brown 1981). Does
pollen-feeding release egg size evolution to operate within broader limits than in other
butterflies? In theory, an important contribution of adult-acquired resources to egg
production could relax the egg size to egg number trade-off (Fox & Czesak, 2000).
This, together with several other circumstances that may have a bearing on size and
fecundity (mimicry, migration), render the Heliconiinae another relevant case to deter-
mine how selection for certain life-history trait values might affect the combined evo-
lution of egg and adult sizes. Similarly intriguing absences of egg/body size correla-
tions in the hairstreaks (Lycaenidae, Theclini) and the Graphiini (Papilionidae) also
deserve further attention.
Conclusions
Within the limits imposed by the data, it is clear that butterfly egg size is overall re-
lated to adult body size by negative allometry, and that this is equally valid for most of
the clades at the family, subfamily, and tribe levels. There are some relevant excep-
tions, and these require further research. However, as far as the quantification of the
allometric relation is concerned, things are not so clear. The results suggest that the
general pattern (above the family level) may result from a combination of heterogene-
ous allometric relations within the subordinated subtaxa. Determining the slopes with
more accuracy is the pertinent next step in this research program. This will prove
feasible only to the extent that more, and more accurate data, become available, and as
far as the degree of phylogenetic resolution in this Lepidopteran group is substantially
increased. Published butterfly life-histories represent a vast amount of data suitable
for comparative work, and this has only superficially been explored so far. Desirable
data such as egg weight are not easy to gather under field conditions, but reasonable
estimates of egg volume can be obtained without much difficulty, e.g. from scale draw-
ings of egg profiles, slides, or similar means. Hopefully, some of the patterns described
here will soon be ready for re-consideration.
Acknowledgements
I am indebted to Sören Nylin and an anonymous referee, as well as to the editors of this journal, for
constructive criticism that improved the first version of this paper. A number of persons contributed to
my egg size data base by sending egg and adult samples, measurements and life history reports, or
Nota lepid. 25 (2/3): 161-175 175
facilitated access to printed materials as well as drawings and photographs of butterfly eggs. I should
hence thank S. A. Abd El Aziz, P. R. Ackery, A. F. Atkins, K.-O. Bergman, D. Bernaud, F. A. Bink, S. W.
Cheong, R. De Jong, J. Fernandez Haeger, S. J. Johnson, D. Jutzeler, J. Martin Cano, P. J. Merrett, M. L.
Munguira, D. Sourakov, T. Racheli, F. C. Urich, and A. Vives Moreno. Dozens of keen lepidopterists
recorded butterfly life histories over the last two centuries; their observations provided the most essen-
tial materials for this study: While hypotheses come up and decay over the times, just the data will
remain.
References
Atkins, A. F. 1978. The Hesperilla malindeva group from Northern Australia, including a new species
(Lepidoptera: Hesperiidae). — J.Aust.ent.Soc. 17: 205-215.
Bernays, E. A. & R. Barbehenn 1987. Nutritional ecology of grass foliage-chewing insects. Pp. 147-
175. — In Slansky, F. & J. G Rodriguez (eds.), Nutritional ecology of insects, mites, and spiders. — J.
Wiley & Sons, New York.
Betts, C. R. & R. J. Wootton 1988. Wing shape and flight behaviour in butterflies (Lepidoptera:
Papilionoidea and Hesperioidea): a preliminary analysis. — J.exp.Biol. 138: 271-288.
Braby, M. F. 1994. The significance of egg size variation in butterflies in relation to host plant quality. —
Oikos 71: 119-129.
Brower, A. V. Z. 2000. Phylogenetic relationships among the Nymphalidae (Lepidoptera) inferred from
partial sequences of the wingless gene. — Proc.R.Soc.Lond. (B) 267: 1201-1211.
Brown, K. S. 1981. The biology of Heliconius and related genera. — Annu.Rev.Ent. 26: 427-456.
Casagrande, M. M. & O. H. H. Mielke 1985. Estagios imaturos de Agrias claudina claudianus Stau-
dinger. — Revta bras.Ent. 29: 139-142.
Chai, P. & R. B. Srygley 1990. Predation and the flight, morphology, and temperature of Neotropical
rain-forest butterflies. — Am.Nat. 135: 748-765.
Clark, G C. & C. LG. C. Dickson 1971. Life histories of South African Lycaenid butterflies. — Purnell,
Cape Town. 272 pp., 108 pls.
Corbet, S. A. 2000. Butterfly nectaring flowers: butterfly morphology and flower form. — Ent.exp.
appl. 96: 289-298.
Dethier, V. E. 1940. Metamorphoses of Cuban Lepidoptera. — Psyche 47: 14—26.
DeVries, P. J. 1997. The butterflies of Costa Rica and their natural history. Volume Il: Riodininae. —
Princeton Univ. Press, Princeton. 288 pp.
Downey, J. C. & A.C. Allyn 1980. Eggs of Riodininae. — J.Lepid.Soc. 34: 133-145.
Dunlap-Pianka, H. 1979. Ovarian dynamics in Heliconius butterflies: correlations among daily oviposition
rates, egg weights, and quantitative aspects of oögenesis. — J.Insect Physiol. 25: 741-749.
Dunlap-Pianka, H., C. L. Boggs & L. E. Gilbert 1977. Ovarian dynamics in Heliconiine butterflies:
programmed senescence versus eternal youth. — Science 197: 487-490.
Felsenstein, J. 1985. Phylogenies and the comparative method. — Am. Nat. 125: 1-15.
Fox, C. W. & M. E. Czesak 2000. Evolutionary ecology of progeny size in arthropods. — Annu.Rev.
Entomol. 45: 341-369.
Garcia-Barros, E. 2000a. Body size, egg size, and their interspecific relationships with ecological and
life history traits in butterflies (Lepidoptera: Papilionoidea, Hesperioidea). — Biol.J.Linn.Soc. 70:
251-284.
Garcia-Barros, E. 2000b. Egg size in butterflies (Papilionoidea and Hesperiidae): a summary of data.
J.Res.Lepid. 35: 90-136.
Garcia-Barros, E. 2000c. Clima y tamafio en mariposas diurnas (Lepidoptera: Papilionoidea). — Boln.
Asoc.esp.Ent. 24: 47-64.
Garcia-Barros, E. 2000d. Notas sobre la biologia de los adultos de Pandoriana pandora (Denis & Schiffer-
miiller, 1775) en la España central (Lepidoptera, Nymphalidae). - SHILAP Revta. lepid. 28: 97-102.
Garcia-Barros, E. & M. L. Munguira 1997. Uncertain branch lengths, taxonomic sampling error, and the
egg to body size allometry in temperate butterflies (Lepidoptera). — Biol.J.Linn.Soc. 61: 201-221.
Garland, T. Jr. & C. M. Janis 1992. Does metatarsal/femur ratio predict maximal running speed in cursorial
mammals? — J.Zool., Lond. 41: 18-32.
{74 Garcia-Barros: Egg to body size allometry of butterflies
Garland, T. Jr., P. H. Harvey & A. R. Ives. 1992. Procedures for the analysis of comparative data using
phylogenetically independent contrasts. — Syst.Biol. 41: 18-32.
Hall, J.P. W. & K. R. Willmott 2000. Patterns of feeding behaviour in adult male riodinid butterflies and
their relationship to morphology and ecology. — Biol.J.Linn.Soc. 69: 1-23.
Harvey, D. J. 1991. Higher classification of the Nymphalidae. Pp. 255-268. — In: Nijhout, H. F. The
development and evolution of butterfly wing patterns. Smithsonian Institution Press, Washington.
Harvey, D. J. & J. P. W. Hall 2002. Phylogenetic revision of the Charis cleonus complex (Lepidoptera:
Riodinidae). — Syst. Ent. 27: 265-300.
Harvey, P. H. & M. D. Pagel 1991. The comparative method in evolutionary biology. — Oxford Univ.
Press, Oxford. 239 pp.
Hoffmann, F. 1933. Beiträge zur Naturgeschichte brasilianischer Schmetterlinge. — Dt.ent.Z. 1932-1933:
97-148.
Igarashi, S. & H. Fukuda 1997. The life histories of Asian butterflies. Vol. 1. — Tokai Univ. Press, Tokyo.
550 pp.
Kitching, R. L., E. Scheermeyer, R. E. Jones & N. E. Pierce (eds.). 2000. Biology of Australian butter-
flies. Monographs on Australian Lepidoptera, Vol. 6. — CSIRO Publishing, Collingwood. 395 pp.
La Barbera, M. 1989. Analyzing body size as a factor in ecology and evolution. — Annu.Rev.Ecol.Syst.
20: 97-117.
Marden, J. H. & P. Chai 1991. Aerial predation and butterfly design: how palatability, mimicry, and the
need of evasive flight constrain mass allocation. — Am. Nat. 138: 15-36.
Martin, J. F., A. Gilles & H. Descimon 2000. Molecular phylogeny and evolutionary patterns of the
European satyrids (Lepidoptera: Satyridae) as revealed by mitochondrial gene sequences. —Mol.Phylg.
Evol. 15: 70 -82.
Mattson, W. J. 1980. Herbivory in relation to plant nitrogen content. — Annu.Rev.Ecol.Syst. 11:
119-161.
McArdle, B. H. 1987. The structural relationship: regression in biology. — Can.J.Zool. 66: 2329-2339.
McNeill, S. & T. R. E. Southwood 1978. The role of nitrogen in the development of insect/plant
relationships. Pp: 77-98. — In: Harborne, J. B. (ed.), Biochemical aspects of plant and animal
coevolution. J. Wiley, New York.
Miller, W. E. 1977. Wing measure as a size index in Lepidoptera: the family Olethreutidae. —
Ann.ent.Soc.Am. 70: 253-256.
Miller, W. E. 1997. Body weight as related to wing measure in hawkmoths (Sphingidae). — J.Lepid.Soc.
51: 91-92.
Nakasuji, F. 1987. Egg size of skippers (Lepidoptera: Hesperiidae) in relation to their host specificity
and to leaf toughness of host plants. — Ecol. Res. 2: 175-183.
Nylin, S. & N. Wedell 1994. Sexual size dimorphism and comparative methods. Pp: 253-280. — In:
P. Eggleton & R. Vane-Wright (eds.), Phylogenetics and ecology. Academic Press, London.
Parsons, M. J. 1995. The early stages and ecology of Ornithoptera tithonus. Pp: 401401.- In: J. M.
Scriber, Y. Tsubaki & R. C. Lederhouse (eds.), Swallowtail butterflies: their ecology and evolutionary
biology. Scientific Publishers, Gainesville.
Penz, C. M. 1999. Higher level phylogeny for the passion-vine butterflies (Nymphalidae, Heliconiinae)
based on early stage and adult morphology. — Zool.J.Linn.Soc. 127: 277-344.
Purvis, A. & A. Rambaut 1995. Comparative analysis by independent contrasts (CAIC): an Apple
Macintosh application for analysing comparative data. - Comp.Appl.Biosci. 11: 247-251.
Rayner, J. M. V. 1985. Linear relations in biomechanics. The statistics of scaling functions. — J.Zool. (A)
206: 415-439.
Reavey, D. 1992. Egg size in Lepidoptera and its relation to larval feeding. — J.Zool., Lond. 227:
277-297.
Reavey, D. 1993. Why body size matters to catterpillars. Pp: 248-279. — In: N.E. Stamp & T.M. Casey
(eds.), Caterpillars. Ecological and evolutionary constraints on foraging. Chapman & Hall, New
York.
Reiss, M. J. 1989. The allometry of growth and reproduction. — Cambridge Univ. Press, Cambridge. 182 pp.
Riska, B. 1991. Regression models in evolutionary allometry. — Am.Nat. 138: 283-299.
Nota lepid. 25 (2/3): 161-175 gS
Shapiro, A. M. 1987. r-K selection at various taxonomic levels in the Pierine butterflies of North and
South America. Pp: 135-152. — Jn: R. Taylor & F. Karban (eds.), Evolution of insect life histories.
Springer-Verlag, Berlin.
Slansky, F. Jr. 1993. Nutritional ecology: The fundamental quest for nutrients. Pp: 29-91. — In: N.E.
Stamp & T.M. Casey (eds.), Caterpillars. Ecological and evolutionary constraints on foraging.
Chapman & Hall, New York.
Starck, J. M. 1998. Non-independence of data in biological comparisons. A critical appraisal of current
concepts, assumptions, and solutions. — Theor.Biosci. 117: 109-138.
StatSoft 2000. STATISTICA for Windows (Computer program manual). StatSoft Inc., Tulsa, Oklahoma.
Urich, F. C. & T. C. Emmel 1991. Life histories of Neotropical butterflies from Trinidad. 5. Dynastor
darius darius (Lepidoptera: Nymphalidae: Brassolinae). — Trop.Lepid. 2: 145-149.
van Son, G. 1979. The butterflies of Southern Africa. Part 4, Nymphalidae: Nymphalinae. (Edited by L.
Vari). — Transvaal Mus.Mem. 14: 1-130.
Wickman, P. O. 1992. Sexual selection and butterfly design — A comparative study. — Evolution 46:
1525-1536.
Wiklund, C. & B. Karlsson 1984. Egg size variation in satyrid butterflies: adaptive vs. historical, ‘Bau-
plan’, and mechanistic explanations. — Oikos 43: 391—400.
Wiklund, C., B. Karlsson & J. Forsberg 1987. Adaptive versus constraint explanations for egg-to-body
size relationships in two butterfly families. - Am.Nat. 130: 828-838.
176 Book review
Book Review
Ronkay, L., J. L. Yela & M. Hreblay (+) 2001: Noctuidae Europaeae. Volume 5. Hadeninae
IT. 22.2 x 29.2 cm, 452 pp., hardback. Entomological Press, Sorg. ISBN 87-89430-06-9. To be
ordered from: Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Denmark. Price DKK
1190 (excl. postage; 10% discount to subscribers to the whole series, Vol. 1-12).
The present volume is the first of two devoted to the noctuid subfamily Hadeninae in the series and also
includes substantial addenda to the Cuculliinae treated in the previously published volume 7. It begins
with a preface (in English and French) by the Editor-in-chief, followed (henceforth only in English) by
a preface and introduction. As usual in the series, a very useful taxonomic and nomenclatural summary
follows, with these results: one lectotype designation, one newly described subgenus, one newly de-
scribed species, four newly described subspecies, four existing names elevated to subspecies level, ten
to species level, five to subgenus level and one to genus level, 34 new synonyms, and eight new combi-
nations. The authors tried to arrange the species under already existing subgenera within each genus
when applicable. I personally welcome such a decision, which will favour taxonomic stability.
Next comes the systematic part. A novelty, triggered by the turmoil that has swept noctuid systematics
during the last decade, is that the subfamilial system originally used for the whole series had to be
changed. Now a more tribal rather than subfamilial arrangement has been implemented, since in contrast
to many of the ‘subfamilies’ perpetuated in the literature, noctuid tribes are frequently better supported
as monophyletic units. I firmly believe this step to be a significant one in the right direction. As here
interpreted, the subfamily Hadeninae includes the classic Hadeninae (sensu Hampson), plus the tribes
Xylenini, Episemini, Apameini, Eriopini, Glottulini, and the caradrinoid complex (e.g. Hoplodrina,
Caradrina, Spodoptera, Elaphria, Athetis). The present volume deals with the Orthosiini (with 21 spe-
cies in six genera), the Xylenini (with 131 species in 31 genera) and the Episemini (with 16 species in
five genera).
For the subfamily Hadeninae and for the five tribes dealt with in the book, the authors give very useful
up-to-date phylogenetic and taxonomic comments, defending the classification adopted in their work,
although mentioning different points of view raised by authors like Beck (1996, 1999), Poole (1995),
Kitching & Rawlins (1998) and Yela & Kitching (1999). The reader will certainly be impressed by the
amount of very up-to-date and verified data incorporated into the texts of the taxa studied.
For each genus, there are four sections: Taxonomic notes, diagnosis, bionomics and distribution. The
first section includes numerous and useful, formerly unpublished taxonomic statements. The most im-
portant novelty is the inclusion of an extremely welcome checklist of the Palaearctic species of each
genus known to occur in Europe. This places each genus into a proper perspective. Concerning the
diagnosis section one happily notices that the description of the external characters as well as those of
the genitalia (male and female) are, in general terms, more complete and detailed than those of the
previous volumes. Another very welcome novelty is the inclusion, at the end of this section, of a brief
description of the larval features thoroughly prepared by Matti Ahola.
Finally, the European species are dealt with one by one, keeping the same four sections as for the genera.
A distribution map is given for each species. References to male armature, showing separately the aedeagus
with everted vesica, and female genitalia point to 584 (!) superb photographic plates for all 185 Euro-
pean species (and some subspecies) of the tribes, of which a considerable part had never been illustrated
before. Likewise, 21 colour plates by David Wilson figure, in life size, those species and subspecies. The
book ends with a references list and a useful index.
This book is a must for researchers working on noctuid moths. No doubt it will be indispensible far into
the future. The effort devoted into it by the team of authors, editors and photographers is admirable.
Only very minor mistakes have slipped through. I also missed the inclusion of colour photographs figur-
ing the final larval stages. The inclusion of such photographs would have enhanced even more the value
of the book, as was the case in the previous volume 6. I would urge the editors to consider such a
possibility in the forthcoming issues of Noctuidae Europaeae.
Victor SARTO I MONTEYS
Nota lepid. 25 (2/3): 177-190 177
The species of Maculinea van Eecke, 1915 in Bulgaria:
distribution, state of knowledge and conservation status
(Lycaenidae)
ZDRAVKO KOLEV
Department of Ecology and Systematics, Division of Population Biology, University of Helsinki,
FIN-00014 Helsinki, Finland. E-mail:
[email protected]
Summary. This paper presents the currently available information on the three species of Maculinea
occurring in Bulgaria. Their distributions are shown on maps produced on the basis of literature records
as well as unpublished data. Own observations on habitat preferences and aspects of the biology of these
species, the first of their kind in the country, are presented. At least three populations of the species
referred to in Bulgarian literature mostly as ‘Maculinea alcon’ occur on relatively dry habitat, a prefer-
ence otherwise known from M. rebeli, and should be referred to by the latter name. Larval host plants are
reported for M. rebeli (eggs and egg-laying of one population on Gentiana asclepiadea) and M. nausithous
(Sanguisorba officinalis, by association of adult butterflies with that plant). The unusual host plant af-
filiation of one M. rebeli population again emphasizes the need for a re-appraisal of the taxonomy of the
alcon complex in south-eastern Europe. The conservation status of all species is assessed. Only M.
nausithous is of immediate conservation concern; measures are proposed for research on, and conserva-
tion of, its populations in the country.
Zusammenfassung. Auf der Grundlage von Literaturdaten und neuen Feldbeobachtungen wird die
bekannte Verbreitung der drei in Bulgarien heimischen Maculinea-Arten in Karten dokumentiert.
Ergänzend werden eigene Beobachtungen zur Habitatbindung und zu Aspekten der Lebensweise
vorgestellt; dies sind die ersten derartigen Daten aus Bulgarien. Zumindest drei Populationen der in der
Literatur als „Maculinea alcon” bezeichneten Art besiedeln ein trockenes Habitat, was andernorts nur
von M. rebeli bekannt sind. Daraus wird geschlossen, daß diese bulgarischen Populationen dem Taxon
M. rebeli zuzuordnen sind. Der taxonomische Status des alcon/rebeli-Komplexes bedarf nach diesen
Erkenntnissen einer umfassenden Überarbeitung. Wirtspflanzen wurden für M. rebeli (Eiablage-
beobachtungen auf Gentiana asclepiadea) und M. nausithous (enge Assoziation der Falter mit Sanguisorba
officinalis) beobachtet. Der Status der drei Maculinea-Arten im Hinblick auf den Naturschutz wird
aufgrund der verfügbaren Information beurteilt. Nur M. nausithous, die bisher nur von einem Reliktareal
in unmittelbarer Umgebung der Hauptstadt Sofia bekannt ist, ist unmittelbar gefährdet. Maßnahmen zur
weiteren Erforschung und zum Schutz der bulgarischen Maculinea-Populationen werden vorgeschlagen.
Pesrome. HacrosımarTa myÖJmkalıms 0606011aBa HANHUYHATA HHOPMALHH 3a TPUTe BHJIA OT pod
Maculinea, cpemaıım ce B bbnrapua. Pa3IıpocTpaHeHHeTo UM € KapTHpaHO Ha OCHOBATA KAKTO Ha
JIHTEPATYPHH, Taka H Ha HEIIyOJIMKYBAHH JIaHHNn. JIoKa3Ba ce, 4e BUJLBT, H3BECTEH Nocera B bp.1rapusı
KaTo «Maculinea alcon», BCbUIHOCT OTTOBAPA HO EKOJIOTUYHHTE CH xapaKTepHCTuKH Ha OJIM3KHA BUN
M. rebeli. IpencraBenyn ca pe3y1ITaTuTe OT HPOYABAHHATA Ha ABTOPA, IITBPBHTE HO POJIA CH B CTPAHATA,
BbPXy HAKOH CTPAHH OT OHOJNOTHATA Ha TE3H BUJLOBE. ChoOmlaBaT Ce XPaHHTesiHn pacTeHHA 3a rebeli
(Gentiana asclepiadea) nu nausithous (Sanguisorba officinalis). Bpripekn 4e Mu TPHTe BUA Ca peKH H
JIOKAJIHH, CaMO nausithous e 3acTpauienH. IIpexararT ce MEPKH 3a IIO-HATATbIIHOTO My H3Y4ABAHE H
oma3BaHeTO Ha 3a0CJICKUTCIIHUTE MY PEJIHKTHH TIOTNyYJIAIIHM, EIMHCTBEHHTE MO POJIA CH Ha
BarKaHCKH4 TIOJIYOCTPOR.
Key words: Lycaenidae, Maculinea, taxonomy, habitat, biology, IUCN Red List Categories, conser-
vation, Bulgaria
Introduction
The genus Maculinea comprises some of the most fascinating and vulnerable butter-
flies in Europe, a distinction that is due on both counts to their complex larval develop-
ment which is unique among European butterflies. The larvae of Maculinea possess
sophisticated adaptations for a parasitic lifestyle in the final larval instar which they
© Nota lepidopterologica, 15.11.2002, ISSN 0342-7536
178 Ko ev: Species of Maculinea in Bulgaria
spend inside nests of ants of the genus Myrmica (see Elmes er al. 2001 and references
therein). Larvae of each Maculinea species are narrowly specialised to develop with
only one or very few Myrmica host species (Thomas ef al. 1989). Once adopted into
the ant nest, the larvae of the more primitive species prey on ant brood, while those of
the more advanced species have carried their mimicry of ant larvae even further and
are fed directly by the ants in a cuckoo-like manner (Elmes ef al. 1991; Elmes et al.
1994). As a result of their specific resource requirements, all Maculinea species can
only exploit very narrow ecological niches defined by the presence of both the host
plant and, especially important, the host ant in sufficiently high densities to support a
viable population of the butterfly (Thomas er al. 1998). The drastic decline and numer-
ous local extinctions experienced by most Maculinea species in central and northern
Europe during the 20th century are attributable to the alteration or destruction of
suitable habitats caused by cessation of traditional methods of land-use (on which
most Maculinea habitats in central and northern Europe depend) as well as different
industrial and agricultural activities (for a detailed review see Munguira & Martin
100)
Published information so far available on Maculinea in Bulgaria consists of little
more than distribution records. The overwhelming majority of these carry virtually no
information other than locality data and, in very few cases, vague habitat descriptions
of little practical use. Even until only very recently, the old catalogue of Bulgarian
butterflies and larger moths (Buresch & Tuleschkow 1930) remained the most com-
prehensive source of such records. It listed 13 localities of ‘Lycaena alcon F.[sic]’
(=Maculinea rebeli (Hirschke, 1904) under the definition used here, see below), 21 of
‘Lycaena arion L.’ (Maculinea arion (Linnaeus, 1758)) and a single, doubtful record
of ‘Lycaena arcas Rott.’ (Maculinea nausithous (Bergsträsser, 1779)). Since the pub-
lication of this catalogue, numerous records of Maculinea were reported in scattered
faunal publications, the majority in Bulgarian language. Of these, most interesting are
the reports by Gogov (1963) and Vihodcevsky & Gogov (1963), who established be-
yond doubt the occurrence of M. nausithous in the country. However, the paucity of
basic information about Bulgarian Maculinea has been aggravated by the fact that
these sporadic records are virtually inaccessible to non-Bulgarian researchers. This
was emphatically shown by a recent assessment of Maculinea distributions in Europe
(Wynhoff 1998) which lacked any specific records from Bulgaria.
The latest publication concerning Bulgarian Maculinea is a distributional atlas which
summarised most of the currently known records of butterflies in the country (Abadjiev
2001). Although providing only distibution data, this atlas, written entirely in English,
combines UTM maps (10x10 km grid) with a list of all mapped localities for each
species and is thus the single most important source of locality data for Bulgarian
Maculinea to date. It lists 63 localities for M. arion falling into 51 UTM squares, 33
localities for M. rebeli falling into 22 UTM squares, and two localities for M. nausithous
falling into a single UTM square. It has to be noted that this atlas omits a few published
records of Maculinea, notably of M. arion from the eastern part of Mt. Alibotush
(Drenowski 1930) as well as M. arion from Mt. Stara Planina (Shipka) and Mt. Rhodopi
(Batak dam; Naretchenski Bani) and ‘Maculinea sevastos’ (=M. rebeli under the defi-
Nota lepid. 25 (2/3): 177-190 179
nition used here, see below) from Mt. Stara Planina (Shipka) and Mt. Rhodopi
(Naretchenski Bani) reported by Balint ([1995]).
The first information on the present-day conservation status and priorities for re-
search and conservation of Bulgarian Maculinea was compiled by the present author
and eventually appeared in the ‘Action plan for Maculinea butterflies in Europe’
(Munguira & Martin 1999). My research since 1997, when these data were gathered,
showed that, due to the occasional use of unverified second-hand sources, my original
contribution contained several errors mostly pertaining to details of the distribution of
M. rebeli and M. nausithous. Corrections were duly suggested to the editors but these
. errors nevertheless found their way into the final version of the Action Plan. Likewise,
the information concerning threats to and conservation status of M. nausithous pre-
sented in that publication has to be augmented in the light of new information that
became available in 1999.
The purpose of this paper is to provide a concise and updated review of the distribu-
tion, ecology and conservation status of the Maculinea species occurring in Bulgaria.
This is particularly important in view of the advances that are presently being made,
under the auspices of the Council of Europe, towards creating a co-ordinated strategy
for the study and conservation of European Maculinea (Munguira & Martin 1999).
The following aspects of each species are discussed here:
Taxonomy. This is dwelt upon briefly in the case of M. arion and M. nausithous,
which present no special problems in this respect. The closely related taxa alcon ([Denis
& Schiffermüller], 1775) and rebeli (Hirschke, 1904) present a complicated case that
remains so far unresolved.
Distribution. This is outlined in appropriate detail in the text. Due to the large
number of localities involved in the case of rebeli and especially arion, only previ-
ously unpublished data are listed. The accompanying maps show all records that could
be traced to a specific locality as well as unpublished data from several collections,
which include my own materials and field records amassed since 1986. Localities of
numerous M. arion and M. rebeli specimens collected by A. Slivov and presently pre-
served in the collection of the Institute of Zoology, Sofia (hereafter abbreviated as
IZS) are included here, with the following cautionary note. The materials of A. Slivov
in that collection contain a considerable number of clear, in some cases grave, cases of
mislabelling (Kolev 2002). Thus, even though all locality data of the Maculinea speci-
mens are, in my opinion, entirely plausible (which is why they are included here) an
eventual confirmation of these records should be attempted. The records by Drenowski
(1930) and Balint ([1995]) omitted by Abadjiev (2001) are also included in the maps;
these localities are listed above.
Habitat and biology. Based on my own observations, the habitats of each
species are described and larval host plants are reported for rebeli and nausithous. No
host ant species have yet been identified for any of the Bulgarian Maculinea. Brief com-
ments on flight period and population size are included; the latter are however based on
casual observations and counts and should not be taken as estimates of population size.
Conservation status. This is assessed using the latest revised IUCN Red List
Categories (IUCN 2001).
180 KoL£v: Species of Maculinea in Bulgaria
Threats. Ihave attempted to estimate if and what potential threats exist for each
species. Much of this evidence available is speculative as no previous information on
this issue exists in Bulgaria.
Priority actions.I give a personal opinion, based on where the most signifi-
cant data deficiencies lie, as to what aspects of each species should be studied next.
This is especially important in the case of the relict populations of M. nausithous, the
only Maculinea species in the country that is in need of active protection in view of its
endangered status.
Results
Maculinea arion (Linnaeus, 1758)
Taxonomy. Bulgarian specimens correspond well to nominotypical M. arion. There
is considerable individual variation in size, ground colour and extent of wing mark-
ings, apparently in response to local environmental factors and thus, in my opinion,
without taxonomic significance.
Distribution. This is the most widespread Maculinea species in Bulgaria. It
occurs in hilly lowland terrain and mountains, at altitudes between 150 and 1800 m
(Fig. 1). The higher concentration of records in the central-western and south-western
parts of the country is at least partly due to the relatively better state of lepidopterological
exploration of these regions (cf. Abadjiev 2001: 10). The butterfly faunas of large
areas (e.g. north-eastern Bulgaria, the foothills of Stara Planina, eastern Rhodopi, the
lower mountains along the western border, etc.) are very poorly known. In view of
this, there is little doubt that the known localities of arion represent but a fraction of
the real distribution of the species in the country.
Previously unpublished localities. Dobrogled village north-west of Varna, 250 m
(Z. Kolev & N. Shtinkov leg. & coll.). — Dobrudzha: ‘Palamara’ game reserve [200-250 m] (A. Slivov
leg., in coll. IZS). — Dobrudzha: Alfatar town [170-200 m] (A. Slivov leg., in coll. IZS). — Mt. Stara
Planina: the path from Cherni Osüm village to ‘Ambaritsa’ chalet, 800-1200 m (N. Shtinkov in litt.). —
[Karnobat town, 200-250 m] (in coll. Karnobat Zoo). — Mt. Rila: the path from Rilski Manastir to
Cherni rid, below ‘Ravna’ locality, 1300-1400 m (Z. Kolev leg. & coll.). — Mt. Pirin: ‘Popina Lika’
locality, 1200-1300 m (A. Slivov leg., in coll. IZS). — Mt. Pirin: Dobrinishka river 2 km south of the
‘Kozarevi Ribarnitsi’ historical site, 1100-1200 m (Z. Kolev leg. & coll.). — Mt. Pirin: “Yavorov’ chalet
[1750 m] (A. Slivov leg., in coll. IZS). — Mt. Rhodopi: the ridge between ‘Kleptuza’ mineral springs and
the valley of Lepenitsa river, 900-1000 m (Z. Kolev leg. & coll.). — Mt. Rhodopi: Velingrad town, [900—
950 m] (N. Shtinkov in litt.). — Mt. Rhodopi: Lukovitsa river valley, 300-350 m (Z. Kolev leg. & coll.).
— Mt. Rhodopi: Khvoyna village, 750-900 m (Z. Kolev leg. & coll.).
Habitat and biology. M arion inhabits a wide range of habitats in Bul-
garia: flowery meadows, pastures, forest glades and clearings, dry rocky gullies and
slopes covered with sparse pine woodland, roadsides etc. The species occurs in mesic
as well as xeric conditions, avoiding truly xerothermic or excessively wet habitats.
The adults fly in a single generation from mid-June to late July, at higher altitudes till
mid-August.
As far as can be judged, most of the known arion habitats in Bulgaria do not depend on
sustained human activities. So far only a single case is known where grazing by live-
Nota lepid. 25 (2/3): 177-190 181
stock has created an unnatural habitat with extremely favourable conditions for arion.
In 1992 N. Shtinkov and I discovered an unusually large population in western Rhodopi
Mts. located at an altitude of 900-1000 m on a west-facing slope of a ridge between
the valley of Lepenitsa river and the ‘Kleptuza’ mineral springs on the outskirts of
Velingrad. The habitat is a dry, heavily overgrazed pasture in sparse pine forest with
large-scale erosion of the sandy topsoil. Very few butterfly species were observed in
this highly degraded habitat, arion being relatively the most abundant (precise counts
could not be made). This is a dramatic reversal of the normal condition of this species’
relative rarity: Bulgarian populations of arion are typically very localised and small,
usually with less than four specimens seen at a time.
The larval host plant of arion has not been identified positively in the country as
yet. Elsewhere in Europe these are species of the group of Thymus serpyllum L., as
well as Origanum vulgare L. (e.g. Elmes & Thomas 1992; Munguira & Martin 1999),
and Myrmica sabuleti and My. scabrinodis serve as most important ant hosts (Thomas
et al. 1989).
Threats. The total population of M. arion in Bulgaria is apparently out of dan-
ger. The species occurs in numerous localities over a large part of the country. Its
habitats, for the most part, do not appear to be critically affected by adverse human
activities. Finally, its actual distribution is certainly much wider than presently known.
Small isolated populations may be vulnerable to activities with the potential to destroy
the whole or most of their habitat.
Conservation status. Lower risk, least concern.
Priority actions. Research on the plant and ant hosts of M. arion, preferably
encompassing a wider range of habitats with varying humidity, is desirable. Conserva-
tion measures are not needed.
Maculinea rebeli (Hirschke, 1904)
Taxonomy. The closely related, externally very similar taxa alcon [Denis &
Schiffermiiller], 1775 and rebeli Hirschke, 1904, form a problematic pair whose
taxonomic relationship to each other and, consequently, the taxonomic status of the
latter, are still fraught with controversy. The high-altitude ‘form’ rebeli of M. alcon
was first separated from alcon on species level by Berger (1946) on account of the
two taxa living in different habitat types, respectively dry and damp. More recent
research on the ecology (Thomas ef al. 1989) and larval morphology (Munguira
1989) of alcon and rebeli revealed differences that lend what has been accepted as
decisive support to the existence of two species. However, other authors (e.g. Kaaber
1964; Kudrna 1996; Tolman & Lewington 1997) have repeatedly raised the argu-
ment that the purported differences between the two taxa in morphological and eco-
logical characters are in fact connected by intermediate states and that therefore the
species status of rebeli is questionable. Only a rigorous and extensive genetic study
can resolve this issue, which cannot be further discussed here. For the present report
I follow the currently most widely accepted treatment of rebeli and alcon as two
species defined on ecological grounds as follows (after Munguira & Martin 1999).
182
KoLEv: Species of Maculinea in Bulgaria
Maculinea alcon is hygrophilous and occurs in wet or marshy, mainly lowland mead-
ows on acidic soils; its larval host plants are Gentiana pneumonanthe L. and Gentiana
asclepiadea L. and its host ants are Myrmica scabrinodis Nyl., My. ruginodis Nyl.
and My. rubra L. Maculinea rebeli is xerophilous and occurs in more or less dry
meadows in lowlands and mountains, always on calcareous soils; its larval host plants
are Gentiana cruciata L. and Gentianella germanica (Willd.) Börner and its princi-
pal host ant is Myrmica schencki Emery (also recorded are My. sulcinodis Nyl., My.
sabuleti Meinert and My. scabrinodis). An interesting confirmation of the applica-
bility of thıs approach also outside western Europe is the recent separation of the
‘alcon’ populations of European Russia into alcon and rebeli based on habitat type
and host plant (Dantchenko er al. 1996).
However, within alcon (and probably also within rebeli) there is geographic varia-
tion in the use of host plants and ants (e.g. Elmes et al. 1994, Gadeberg & Boomsma
1997). Moreover, here it must be noted that populations with rebeli-type habitat pref-
erences may also thrive on Gentiana asclepiadea (Tolman & Lewington 1997; see
below). This should again serve as a reminder that the differences in ecological re-
quirements between alcon and rebeli (in this case with regard to the habitat and spe-
cies identity of their host plants) may not always be as clear-cut as it may appear from
the above definition.
On species level, the populations of the alcon type in Bulgaria were until recently
referred to as ‘alcon’, with the curious exception of Balint ([1995]) who used, with-
out further explanation, the name ‘ Maculinea sevastos’ in connection with Bulgar-
ian populations. Based on my observations on the habitats of two newly discovered
populations (Mt. Rhodopi: the town of Smolyan, 1000m; Mt. Alibotush: Hambar
Dere gorge, 1300-1400 m) and inferences regarding the geological habitat substrate
of the majority of known populations in the country (see below), I recently associ-
ated rebeli with the Bulgarian fauna and accordingly excluded alcon from it (cf.
Munguira & Martin 1999). On this basis Abadjiev (2001) too assigned all Bulgarian
populations to ‘Glaucopsyche rebeli’. The more detailed observations on the habitat
and oviposition preferences of another newly discovered Bulgarian population (see
below) support this conclusion. This agrees with the opinion expressed by some
authors that all records of ‘Maculinea alcon’ from the mountains of the Balkans and
Greece should be referred to rebeli (van der Poorten 1982; Tolman & Lewington
1997). Pamperis (1997) figured eggs on G cruciata observed at an unspecified north-
western Greek locality in the Epirus province at 1300 m altitude, which again points
to an affiliation of at least some Balkan mountain populations with rebeli rather than
alcon.
Morphologically, the Bulgarian material at my disposal does not differ from mate-
rial of the alcon group from different regions of Europe (in the collection of the Zoo-
logical Museum, University of Helsinki). However, it should be noted that Bulgarian
females resemble true alcon more than typical rebeli in that the blue suffusion on the
upperside is much less extensive: it is either absent or, if present, does not reach the
postdiscal area. However I consider it premature at this point to discuss the issue of
whether there are sufficient grounds to recognise the taxon sevastos (Rebel & Zerny,
Nota lepid. 25 (2/3): 177-190 183
1931), described from Montenegro (Zljeb) and Albania (Pashtrik), as a separate Bal-
kan and Bulgarian subspecies of rebeli.
Distribution. In Bulgaria, M. rebeli is rare and very local. It occurs mainly in
the country’s medium-high and high mountains or their foothills: Stara Planina, Vitosha,
western Rhodopi, Rila, Pirin, Alibotush, the karstic Zemen gorge between the massifs
Konyavska Planina and Zemenska Planina, and the foothills of Osogovska Planina
near the town of Kyustendil. The occurrence of this taxon on Mt. Belasitsa in the
extreme south-west of the country (Munguira & Martin 1999) is so far unconfirmed.
The records from the mountains span an altitudinal range of 500-2100 m, with most
known populations occurring at altitudes between 800 and 1700 m. Two lowland lo-
calities (at about 200-250 m) are also known from the limestone region Dobrudzha in
north-eastern Bulgaria (Fig. 2). The lepidopteran fauna of Dobrudzha is very poorly
known and further localities of rebeli may be expected to exist there. This applies even
to the relatively best-known mountainous strongholds of this species such as Rila and
Rhodopi.
The apparent disparity between rebeli occurring in lowlands in northern Bulgaria,
but at much higher altitudes in the southern half of the country is explained by the
major climatic difference between these two areas. Due to the climatic barrier of Stara
Planina range, the climate is continental to the north of this mountain chain but much
warmer, with pronounced Mediterranean influence, to the south of it, with the excep-
tion of the higher mountains. Thus, species not adapted to survive under more Medi-
terranean climatic conditions occur only at higher altitudes in southern Bulgaria. Very
similar ‘dichotomous’ distributions in the country are exhibited by other central Euro-
pean butterflies, e.g. Lasiommata petropolitana (Fabricius, 1787) and Coenonympha
glycerion (Borkhausen, 1788).
Previously unpublished localities. Dobrudzha: ‘Palamara’ game reserve [200-250
m] (A. Slivov leg., in coll. IZS). — Mt. Stara Planina: nature park ‘Karandila’, 950-1000 m (Z. Kolev leg.
& coll.). — Mt. Rila: ‘Bayuvi Dupki’ biosphere reserve [precise altitude unknown: the reserve encom-
passes altitudes from 1200 to 2820 m] (A. Slivov leg., in coll. IZS). — Mt. Rhodopi: Smolyan town, 1000
m (Z. Kolev leg. & coll.). — Mt. Rhodopi: ‘Perelik’ chalet [1900 m] (A. Slivov leg., in coll. IZS). — Mt.
Rhodopi: Trigrad village, 1200 m (A. Slivov leg., in coll. IZS).
Habitat and biology. M. rebeli in Bulgaria inhabits flowery meadows,
dry mountain grassland as well as rocky, grassy glades and margins of deciduous,
mixed or coniferous forests. Truly xerothermic conditions are avoided. The habitats
with which I have personal experience or for which sufficiently precise geological
data could be found (after Gerasimov & Gulubov 1966) — e.g. all localities in
Dobrudzha, Zemen gorge, Mt. Alibotush: Hambar Dere gorge, Mt. Rhodopi, Mt.
Pirin, Stara Planina Mts: ‘Karandila’ — lie invariably on calcareous rock (in most
cases dry karst). However, the substrate for some habitats (e.g. in Mt. Rila, the foot-
hills of Osogovska Planina, Sofia: Lozenets suburb) remains to be determined with
certainty. The adults fly in one generation from the second half of June till the begin-
ning of August. Populations are typically very small: usually less than four or five
specimens are seen at a time. An exception is the newly discovered population in the
nature park ‘Karandila’, in which about 40 individuals were counted on a single day
184
Ko tev: Species of Maculinea in Bulgaria
(19.vii.1999): this appears to be the highest count so far for any Bulgarian popula-
tion of rebeli. The habitat and butterfly fauna of this remarkable locality are de-
scribed in more detail elsewhere (Kolev 2002).
Because of its size the last-mentioned population proved particularly well suited
for observations on oviposition preferences, which I carried out in July 1999. In all 96
Gentiana plants were found in the habitat which measured about 800 m7; 71 of these
carried a total of 672 eggs. In addition oviposition was directly observed once. The
larval host plant, initially presumed by me to be G cruciata, was identified in all cases
as Gentiana asclepiadea L. by Michaela Yordanova (Faculty of Botany, University of
Sofia) using the latest identification guide to Bulgarian plants (Andreev ef al. 1992);
particular care was taken to ascertain that the plant samples were indeed not G cruciata.
In the said habitat this plant grows in dry, stony places as well as in more shaded
conditions at the forest edge and in higher, denser grass. However, robust plants either
in flower or with well-developed flower buds, growing in small groups on exposed,
dry rocky ground amid sparse and low (0-30 cm) vegetation, were preferred for ovipo-
sition. The eggs were laid on the flowers and flower buds and at the base of the upper-
most leaves. Interestingly, according to Andreev er al. (1992) G asclepiadea is found
in ‘grassy, bushy and forested places’ in all high mountains of Bulgaria, but only above
1000 m. In the studied habitat this plant is therefore near the lower limit of its distribu-
tion. The present discovery may therefore not apply to populations of rebeli at lower
altitudes. The host plant most commonly associated with rebeli in Europe, Gentiana
cruciata, occurs in Bulgaria in ‘stony, grassy, bushy and forested places’ at altitudes
above 200 m in Dobrudzha and in the hilly and mountainous regions of central and
southern Bulgaria (Andreev er al. 1992). It is thus a very likely host of at least the
lowland populations of Bulgarian rebeli, too.
Threats. No direct threats exist at present to the total population of M. rebeli in
Bulgaria. As in the case of arion, smaller populations may be vulnerable to extinction
caused by physical destruction of most or the entire habitat. No documented cases of
such extinctions are known, but it is necessary to establish whether e.g. the population
that existed more than 70 years ago in Lozenets (Buresch & Tuleschkow 1930), pres-
ently a heavily urbanised suburb of Sofia, still survives there. The small number of
known populations and the relatively restricted area of potentially suitable calcareous
habitats make rebeli a species of higher conservation concern relative to arion. —
Conservation status. Lower risk, near threatened.
Priority actions. Further research on the taxonomy, distribution and biol-
ogy of Bulgarian M. rebeli is needed. The possible effects of vegetation succession on
populations that may be affected by it, such as those at higher altitudes in Mt. Rhodopi,
should be studied. Conservation measures are presently not needed.
Maculinea nausithous (Bergsträsser, 1779)
Taxonomy. Bulgarian specimens correspond well to nausithous from the main
European range of the species. There is little variation, mainly in size as well as in the
extent and brightness of the blue upperside suffusion of males.
Nota lepid. 25 (2/3): 177-190 185
Distribution. The populations of M. nausithous in this country are widely sepa-
rated from the main European range: the nearest localities, in Slovenia and northern
Croatia (Jaksic 1988) and western Ukraine (Wynhoff 1998), are about 600 km away.
In Bulgaria this species is found in an extremely limited area on the southern outskirts
of Sofia, namely the foothills and lower slopes of the adjacent mountains Lyulin and
Vitosha (Fig. 3). Most records are from the slopes of Lyulin above the suburb of Gorna
Banya. A single specimen was first collected there in 1904 (Drenowski 1907) but this
record remained doubtful until 1957, when a population was discovered and speci-
mens were collected during four consecutive years (Gogov 1963). Subsequent records
from Mt. Lyulin are lacking until 1999, when I discovered a small population at 750-800
m. It is unfortunately not known whether all these records concern the same population.
The other known localities of this species are very poorly documented. In 1955 a
single specimen was found in the suburb of Boyana on the lower slope of Vitosha
(Vihodcevsky & Gogov 1963); in the collection of the museum of Natural History in
Burgas there are additional specimens from this locality with labels “Boyana, 5.7.[19]55”
collected by the late Sevar Zagorchinov. More recently, nausithous has been established
in two further localities (see below). All records come from an altitude of about 650-850
m. The information in Munguira & Martin (1999) regarding the occurrence of nausithous
near the town of Kostinbrod, just north of Sofia, is erroneous. It is interesting that, de-
spite the presence of extensive meadows with abundant growth of Sanguisorba officinalis
L. (pers. observ.), this butterfly has not yet been discovered on Lozenska Planina, a small
massif immediately to the east of Vitosha (S. Abadzhiev, pers. comm. _).
Previously unpublished localities. Sofia: Vladaya suburb at the junction of Mt. Lyulin
and Mt. Vitosha [750-800 m] (S. Beshkov, pers. comm.). — Sofia: Sukhodol suburb north of Mt. Lyulin
[650-700 m] (I. Stoychev leg. & coll.). — Mt. Lyulin: south-west of Gorna Banya suburb, 750-800 m (Z.
Kolev leg. & coll.).
Habitat and biology. Precise habitat descriptions are lacking for most
Bulgarian localities of M. nausithous. In the newly discovered locality on Mt. Lyulin
this species was found only in a small part of a tall-grass meadow, in which Sanguisorba
officinalis L. was present. Unlike in central Europe, where nausithous is found in damp,
marshy habitats with some preference for their relatively drier edges (e.g. Tolman &
Lewington 1997; Munguira & Martin 1999), the newly discovered habitat as well as
that in Sukhodol (I. Stoychev, pers. comm.) are situated on slopes with well-drained
sandy soils and are much drier than what is generally considered acceptable to this
species. M. nausithous has a single generation flying approximately from early July
(judging by the somewhat worn condition of the specimens observed by me on
10.vii.1999) till the second half of August. The populations are small. Thus, Gogov
(1963) reported the number of specimens collected by him in a single locality on Mt.
Lyulin as follows: ‘21.vii.1957: 1 male; 1.viii.1958: 4 males, 1 female; 3.v111.1959: 2
males, 1 female; 18.viii.1960: 12 very worn specimens’. In the Sukhodol locality less
than ten specimens were seen during several hours of intensive search (I. Stoychev,
pers. comm.). My observations yielded the highest count so far for a Bulgarian popu-
lation of nausithous: about 20 individuals during a two-hour census.
186 Ko tev: Species of Maculinea in Bulgaria
All butterflies observed by me were found on or in immediate proximity to
Sanguisorba officinalis plants, on whose flowerheads the adults perched and drank
nectar. Although oviposition was not observed, nor were any eggs found, the close
association of all observed butterflies with Sanguisorba officinalis leaves no doubt
that this plant is the host for young larvae of nausithous in this Bulgarian locality, as
elsewhere in Europe (e.g. Malicky 1969) and western Asia (Hesselbarth er al. 1995;
Korshunov & Gorbunov 1995).
Threats. The known populations of M. nausithous are situated in immediate
proximity to the most densely populated region in Bulgaria. Prior to the present study
the status of nausithous in Bulgaria had not been critically examined, although it was
listed as ‘vulnerable’ in the Red List of Bulgarian Butterflies and Moths (Ganev 1985).
On the basis of this source and in the absence of more definite data, I provisionally
retained this status (cf. Munguira & Martin 1999). Potential or actual threats have yet
to be identified for any of the Bulgarian populations. Urban development may prove to
be of concern in the more urbanised foothills of Vitosha and in the suburb of Sukhodol
(Munguira & Martin 1999). Mowing of the extensive meadows on Lyulin, which was
observed also in the meadow inhabited by nausithous, may affect the populations of
the butterfly on that mountain. The newly found nausithous population as well as the
only S. officinalis plants in the extensive meadow were located, significantly, at the
very fringe of the meadow where mowing has been much less thorough due to the
steeper, more uneven terrain.
Conservation status. In Bulgaria, presently available data suggest that M.
nausithous meets the criteria for category ‘Endangered’ (IUCN 2001). It is thus the
only member of its genus in the country of immediate conservation concern.
Priority actions. The ecological requirements of M. nausithous and its hosts
must be studied in detail. Extensive search for new populations of the butterfly in the
southern environs of Sofia as well as neighbouring regions is necessary, as is a regular
monitoring scheme for at least some localities. The potential or existing threats to all
populations should be identified. In view of the proximity to the capital and the re-
stricted size of the area involved, most if not all of the research could be carried out
efficiently and relatively inexpensively in the form of field exercises or individual
research projects for students of biology at the University of Sofia. Since mowing may
prove to be an important factor for preventing afforestation of nausithous habitats, a
total ban on mowing there should perhaps not be pursued. Instead, it is recommended
that conservation actions in mown habitats should focus on restrictions of mowing
during the flight period of the butterflies and the time needed for their larvae to com-
plete their feeding on the host plant (see Garbe 1993). Providing a legal basis for the
protection of this species and its habitats in Bulgaria is most desirable.
Concluding remarks
The present contribution reports 13 new localities of Maculinea arion, 6 of M. rebeli
and 3 of M. nausithous, which is a significant increase in the known distribution of all
these species in Bulgaria. This once again underscores the fact that there is yet much
Nota lepid. 25 (2/3): 177-190 187
Fig. 1. Known records
of Maculinea arion in
Bulgaria.
Om 200 600 1000 1600 2200 | Fig. 2. Known records
of Maculinea rebeli in
Bulgaria.
Fig. 3. Known records
of Maculinea
nausithous in Bulgaria.
188 Ko tev: Species of Maculinea in Bulgaria
basic research to be done on eastern-European Maculinea in general (see also Wynhoff
1998 and Munguira & Martin 1999).
My studies on M. rebeli in Bulgaria revealed the first case of utilization of Gentiana
asclepiadea, a host plant so far only linked with M. alcon, by a ‘dry-habitat’ popula-
tion. This shows the urgent need for more research on the taxonomy of the alcon
complex as a whole and especially on the eastern European populations, which until
now have remained virtually unstudied. The population reported here combines alcon-
like morphology and host plant with clearly rebeli-like habitat preferences. This is
perhaps the best demonstration of the frailty of the conventional, western-European
view on the specific differences between alcon and rebeli. Though based on extensive
and detailed research this view may be biased since these studies concentrated on
populations on the extreme distributional margin of both taxa. Cases like this, should
they prove to be more widespread, can seriously challenge the validity of present species
delimitations with respect to the populations in the Balkans and perhaps further east.
M. arion and M. rebeli are found to be of no immediate, and perhaps long-term,
conservation concern in Bulgaria. These two species thrive in hilly and mountainous
terrain that is mostly of little value to potentially harmful agricultural or industrial
development. It can even be said that both have locally benefited from disruptions in
the forest cover created by animal husbandry and other human activities in formerly
densely forested regions such as Mt. Rhodopi and Mt. Stara Planina. This situation is
in stark contrast to that at the western and northern extremes of the ranges of these
species, where both are considered endangered and many populations have already
become extinct.
Bulgarian M. nausithous is an altogether different case. The present main range of
the species, from France across central Europe to western Siberia, appears to be a relic
of a once wider distribution as evidenced by widely separated ‘islands’ at great dis-
tances from the main present-day range. Such still survive in e.g. Spain, Bulgaria and
north-eastern Turkey. These ‘islands’ have as a whole a greater risk of extinction than
populations in the main range of the species. In addition such peripheral populations
may differ from ‘mainland’ nausithous in certain aspects of their biology. Such is the
case with some Spanish populations which have a different ant host: My. scabrinodis
instead of My. rubra (Munguira & Martin 1999). In conservation terms such an excep-
tional adaptation to local conditions means that, should such a population become
extinct, an eventual re-introduction with stock from the main range would most likely
be a costly and complete failure. Similar ‘abnormalities’ might be expected for Bulgar-
ian nausithous. Moreover, the distribution and habitat preferences of My. rubra in the
country apparently do not fit those of the butterfly at all: this ant is widespread in
Bulgarian mountains above 1500 m, but at lower altitude occurs only in “stream banks
in strongly shaded woodland’ (Atanassov & Dlussky, 1992). It is interesting to note
that a species closely related to My. scabrinodis, My. bessarabica Nasonov, is found in
Bulgaria only in the western part, ‘especially on Mt. Lyulin’, which is a distribution
pattern unique among Bulgarian Myrmica (Atanassov & Dlussky, 1992). Studies of
the biology of the Bulgarian populations of nausithous are therefore of utmost impor-
tance both locally, as these are essential for the creation of an efficient conservation
Nota lepid. 25 (2/3): 177-190 189
scheme, as well as on European scale, as they are likely to contribute new data to the
biology of the species as a whole.
Acknowledgements
I thank all those who facilitated my research in various ways. Stoyan Beshkov (National Museum of
Natural History, Sofia), Ilko Stoytchev (University of Sofia) and Alexander Slivov (Sofia) provided
locality data and other relevant information. Michaela Yordanova (Sofia University) determined the
plant samples and shared relevant botanical information. My special thanks go to Nikolay Shtinkov
(University of Sofia) for his inspiring companionship on many of the field trips that yielded the data
reported here, and for sharing his locality data on Maculinea. | am much obliged to Prof. Dr. Konrad
Fiedler (University of Bayreuth) and two anonymous referees for their critical comments and sugges-
tions regarding the manuscript.
References
Abadjiev, S. P. 2001. An Atlas of the distribution of the butterflies in Bulgaria (Lepidoptera: Hesperioidea
& Papilionoidea). — Pensoft Publishers, Sofia & Moscow, 335 pp.
Andreev, N., Anchev, M., Kozhukharov, S., Markova, M., Peev, D. & Petrova, A., 1992. Opredelitel na
visshite rasteniya v Bulgaria [Identification guide to the higher plants of Bulgaria]. — Nauka 1 izkustvo,
Sofia, 788 pp. (in Bulgarian).
Atanassov, N. & Dlussky, G. M. 1992. Fauna Bulgarica 22. Hymenoptera, Formicidae. — Izdatelstvo na
BAN, Sofia, 310 pp. (in Bulgarian).
Balint, Z., [1995]. Adalékok a Balkan boglarkalepke-faunajahoz (Lepidoptera, Lycaenidae) [Contributions
to the lycaenid butterfly fauna of the Balkans (Lepidoptera, Lycaenidae)]. — A Janus Pannonius
Muzeum Evkönyve 39: 69-77 (in Hungarian).
Berger, L. 1946. Maculinea rebeli Hirschke, bona species. — Lambillionea 46 (6-10): 95-110.
Buresch, I. & Tuleschkow, K. 1930. Horizontalnoto razprostranenie na peperudite (Lepidoptera) v
Bülgarıya [Die horizontale Verbreitung der Schmetterlinge (Lepidoptera) in Bulgarien.] II. — Izvestija
na Tsarskite Prirodonauchni Instituti v Sofia 3: 145-248 (in Bulgarian).
Dantchenko, A., Andreev, S., Tchuvilin, A. & Sourakov, A. 1996. Notes on butterfly collecting in a
natural steppe reserve in Central Russia (Lepidoptera, Rhopalocera). — Atalanta 27: 649-656, colour
plate XII.
Drenowski, A. K. 1907. Vtori dopülnitelen prinos kim peperudnata fauna na Vitosha 1 okolnostta 1
[Zweiter ergänzender Beitrag zur Schmetterlings-Fauna des Witoscha-Berges]. — Sbornik za narodni
umotvoreniya, nauka 1 knızhnina 22: 1-36 (in Bulgarian).
Drenowski, A. K. 1930. Spisük na peperudnite vidove sübrani po planinata Alibotush (s.-1. Makedoniya)
[Verzeichnis der auf dem Alibotuschgebirge gesammelten Lepidopteren (in N. O. Mazedonien)].
Izvestija na Bülgarskoto Entomologichesko Druzhestvo 5: 107-124 (in Bulgarian).
Elmes, G. W. & Thomas, J. A. 1992. Complexity of species conservation in managed habitats: interaction
between Maculinea butterflies and their ant hosts. — Biodivers. & Conserv. 1: 155-169.
Elmes, G. W., Thomas, J. A., Hammarstedt, O., Munguira, M. L., Martin, M. & van der Made, J. G. 1994.
Differences in host-ant specificity between Spanish, Dutch and Swedish populations of the endangered
butterfly, Maculinea alcon (Denis et Schiff.) (Lepidoptera). - Memorabilia zool. 48: 55-68.
Elmes, G. W., Thomas, J. A. & Wardlaw, J. C. 1991. Larvae of Maculinea rebeli, a large-blue butterfly,
and their Myrmica host ants: wild adoption and behaviour in ant nests. — J. Zool. (London) 223:
106-118.
Elmes, G. W., Thomas, J. A., Munguira, M. L., & Fiedler, K., 2001. Larvae of lycaenid butterflies that
parasitise ant colonies provide exceptions to normal insect growth rules. — Biol. J. Linn. Soc. 73:
259-278.
Fiedler, K. 1998. Lycaenid-ant interactions of the Maculinea type: tracing their historical roots in a
comparative framework. — J. Insect Conserv. 2: 3-14.
Gadeberg, R. M. E., & Boomsma, J. J. 1997. Genetic population structure of the large blue butterfly
Maculinea alcon in Denmark. — J. Insect Conserv. 1: 99-111.
190 Ko tev: Species of Maculinea in Bulgaria
Ganev, J. A. 1985. Red list of Bulgarian butterflies and larger moths. — Entomologist’s Gaz. 36: 115-118.
Garbe, H. 1993. Hinweise zum Schutz des gefährdeten „Dunklen Ameisenbläulings” Maculinea
nausithous Bergstr. 1779 (Lepidoptera: Lycaenidae). — Nachr.entomol.Ver.Apollo Frankfurt, N.F.
14: 33-39.
Garcia-Barros, E., Munguira, M. L., Martin Cano, J., Viejo Montesinos, J. L. 1993. Maculinea nausithous
(Bergsträsser, 1779) en Madrid. — SHILAP Revta. Lepid. 21: 255-256.
Gerasimov, I. P. & Gulubov, Zh. S. (eds) 1966. Geografiya na Bülgariya. Tom 1: Fizicheska geografiya
[Geography of Bulgaria. Vol. 1: Physical geography]. — Izdatelstvo na BAN, Sofia, 548 pp., 4 map
sheets (in Bulgarian).
Gogov, D. 1963. [Papillons (Lepidoptera) rares et nouveaux pour la faune de Bulgarie]. — Izvestija na
Zoologicheskija Institut Sofia 14: 237-243 (in Bulgarian).
Hesselbarth, G., van Oorschot, H. & Wagener, S. 1995. Die Tagfalter der Türkei unter Berücksichtigung
der angrenzenden Länder. Band 1: Allgemeiner Teil; Hesperiidae, Papilionidae, Pieridae, Lycaenidae.
— Selbstverlag Sigbert Wagener, Bocholt, 754 pp.
IUCN, 2001. IUCN Red List categories version 3.1. Prepared by the IUCN Species Survival Commission,
Gland, Switzerland, http://www.iucn.org/themes/ssc/redlists/RLcategories2000.html, 2.12.2001.
JakSıc, P. 1988. Privremene karte rasprostranjenosti dnevnih leptira Jugoslavije [Provisional distribution
maps of the butterflies of Yugoslavia] (Lepidoptera, Rhopalocera). — Soc. ent. jugoslavica, editiones
separatae 1: 1-216 (in Serbo-Croatian).
Kaaber, S. 1964. Studies on Maculinea alcon (Schiff.) — rebeli (Hir.) (Lep. Lycaenidae) with reference to
the taxonomy, distribution and phylogeny of the group. — Entomol. Meddelelser 32: 277-319.
Kolev, Z. 2002. Critical notes on some recent butterfly records (Lepidoptera: Papillionoidea &
Hesperioidea) from Bulgaria and their source collection. Phegea 30: 95-100
Kolev, Z. (in press). On the distribution, ecology and conservation status of two little-known Bulgarian
butterflies: Brenthis ino (Rottemburg, 1775) and Kirinia climene (Esper, [1783]) (Lepidoptera:
Nymphalidae). — Linneana belg.
Korshunov, Y. P. & Gorbunov, P. Y. 1995. Dnevnyie babotchki aziatskoy chasti Rossi: Spravotchnik
[The butterflies of the Asiatic part of Russia: a handbook]. — Izdatel’stvo Ural’skogo universiteta,
Ekaterinburg, 202 pp.
Kudrna, O. 1996. Mapping European butterflies: handbook for recorders. — Oedippus 12: 1-60.
Malicky, H. 1969. Übersicht über Präimaginalstadien, Bionomie und Ökologie der mitteleuropäischen
Lycaenidae (Lepidoptera). — Mitt.ent.Ges.Basel 19: 25-91.
Munguira, M. L. 1989. Biologia y biogeografia de los licénidos ibéricos en peligro de extinciön
(Lepidoptera, Lycaenidae). — PhD thesis, Univ. Autönoma de Madrid.
Munguira, M. L. & Martin, J. (eds.) 1999. Action plan for Maculinea butterflies in Europe. — Council of
Europe, Nature and environment, No. 97, 64 pp.
Pamperis, L. 1997. Butterflies of Greece. — Bastas-Plessas, Athens, 574 pp.
Thomas, J. A., Clarke, R. T., Elmes, G. W. & Hochberg, M. E. 1998. Population dynamics in the genus
Maculinea (Lepidoptera: Lycaenidae). — In: J. P. Dempster & I. F. G. MacLean (eds.): Insect
populations. Kluwer Academic Publishers, Dordrecht, pp. 261-290.
Thomas, J. A. & Elmes, G. W. 1992. The ecology and conservation of Maculinea butterflies and their
Ichneumon parasitoids. — In: Pavlicek-van Beek, T., Ovaa, A. H. & van der Made, J. G (eds.). Future
of butterflies in Europe: strategies for survival. Proceedings of the International Congress 1989, pp.
116-123.
Thomas, J. A., Elmes, G. W., Wardlaw, J. C. & Woyciechowski, M. 1989. Host specificity among
Maculinea butterflies in Myrmica ant nests. — Oecologia 79: 452-457.
Tolman, T. & Lewington, R. 1997. Butterflies of Britain and Europe. — Harper Collins Publishers, 320
pp., 104 pls.
van der Poorten, D. 1982. Interessante dagvlinderwaarnemingen in Griekenland, juli 1981. — Phegea 10:
77-87.
Vihodcevsky, N. & Gogov, D. 1963. [Beitrag zur Schmetterlingsfauna des Vitosa-Gebirges]. — Izvestija
na Zoologicheskija Institut Sofia 14: 227—235 (in Bulgarian).
Wynhoff, I. 1998. The recent distribution of the European Maculinea species. — J. Insect Conserv. 2: 15-27.
Nota lepid. 25 (2/3): 191-204 191
Opinion
To agree or not to agree — the question of gender agreement in
the International Code of Zoological Nomenclature
MANFRED D. SOMMERER
Volpinistr. 72, D-80638 München, Germany; e-mail
[email protected]
Summary. The new (4th) edition of the International Code of Zoological Nomenclature still requires in
its Articles 31.2 and 34.2 that an adjectival species-group name be in agreement with the gender of the
name of the genus it is at any time associated with. Prominent and influential publications on the tax-
onomy of Lepidoptera expressly chose to ignore the gender agreement requirements of the (correspond-
ing previous) Code, and to use the specific name as given in the original description. For most lepidop-
terists of our time it is, by lack of knowledge in Latin and Greek, impossible to ascertain unambiguously
the gender of the generic names in Lepidoptera. Since strict application of the gender agreement provi-
sions of the Code in the nomenclature of Lepidoptera would, in the course of progress in systematics,
require continuous changes of epithets of specific names, the task of updating the names in electronic
databases of large lepidopteran groups is beyond the manpower and financial resources of museums and
scientific institutions. It is therefore practically not possible to apply those rules of gender agreement.
Regrettably, the International Commission on Zoological Nomenclature did not accept those arguments
for the latest version of the Code. The author explains that in lepidopterology there has never been a
tradition of ‘classic purity’ as advocated by the Code. Given the priority of the principles of stability and
permanence of zoological names the author proposes that all lepidopterists follow the example of lead-
ing authors in taxonomy and disregard the gender agreement requirements of the Code. The leading
lepidopterists’ societies should encourage their members in this respect. The Societas Europaea
Lepidopterologica (SEL) with about 600 members has, on 4 June, 2002, passed an appropriate resolu-
tion (which is reproduced in the Appendix).
Zusammenfassung. Die neue (4.) Fassung der Internationalen Nomenklaturregeln, die zum 1.1.2000 in
Kraft getreten sind, hält daran fest (Art. 31.2, 34.2), daß ein adjektivischer (Adjektiv oder Partizip im
Nominativ Singular) Artname immer mit dem grammatikalischen Geschlecht des Gattungsnamens
übereinstimmen muß, mit dem er jeweils verbunden ist. Eine Reihe namhafter Wissenschaftler und
Autoren haben bisher die „Übereinstimmung im grammatikalischen Geschlecht” ignoriert und in ihren
Publikationen den Artnamen in seiner ursprünglichen, in der Urbeschreibung dokumentierten
(Geschlechts-)Form verwendet. Die Vorschrift ist nämlich schon deshalb für die meisten Lepidopterologen
in der Praxis kaum vollziehbar, weil sie wegen unzureichender Kenntnisse in Latein oder Griechisch das
grammatikalische Geschlecht der Gattungsnamen nicht zweifelsfrei feststellen können. Es ist auch
praktisch unmöglich, weil nicht finanzierbar, die vielen Anpassungen, die sich im Zuge des Fortschritts
in der Systematik durch neue Gattungskombinationen ergeben müßten, in elektronischen Datenbanken
für die großen Lepidopteren-Gruppen laufend nachzuvollziehen. Einen solchen Tribut an die Idee der
„Korrektheit” in der lateinischen Sprache kann sich eine moderne Taxonomie nicht leisten.
Bedauerlicherweise hat sich die Internationale Nomenklaturkommission im Vorfeld der Neufassung der
Regeln diesen Argumenten verschlossen. Der Autor legt dar, daß es in der Lepidopterologie auch gar
keine Tradition für die von den Nomenklaturregeln verlangte grammatikalische „Reinheit” gibt. Im
Interesse des Leitprinzips der Namensstabilität und -kontinuität wird daher vorgeschlagen, dass alle
Lepidopterologen nach dem Beispiel anerkannter Kataloge, Faunenlisten und systematischer
Darstellungen davon absehen sollten, diesen Regeln zur „Übereinstimmung im grammatikalischen
Geschlecht” zu folgen. Vielmehr sollten die Artnamen in ihrer ursprünglichen (Geschlechts-)Form
verwendet werden. Hierzu sollten die großen lepidopterologischen Vereinigungen ihre Mitglieder aufrufen.
Die 600 Mitglieder starke Societas Europaea Lepidopterologica (SEL) hat am 4. Juni 2002 bereits eine
entsprechende (im Anhang wiedergegebene) Resolution verabschiedet.
dans les articles 31.2, 34.2, qu’un adjectif utilisé comme nom pour un groupe d’especes s’accorde avec
le genre qui lui est associé. D’importantes publications sur la taxinomie des Lépidopteres choisissent
expressement de négliger les recommandations du Code pour les genres et d’utiliser les noms spécifiques
tels que rediges dans les descriptions originales. A cause d’une manque de connaissances en langues
classiques (Latin et Grec), il est impossible pour la plupart des Lépidoptéristes de notre époque de
© Nota lepidopterologica, 15.11.2002, ISSN 0342-7536
192 | _ Sommer er: The question of gender agreement in the ICZN
s’assurer, sans ambiguïté, du genre correct des noms génériques des Lépidoptères. Comme I’ application
des règles du Code sur Paccord de genre dans la nomenclature doit, à la suite du progrès systématique,
résulter des changements continus des épithètes des noms spécifiques, la tâche de trouver les noms
“corrects” et de mettre à jour les noms d’espèces dans les banques de données conduira à une énorme
perte de temps pour le taxinomiste ainsi que de ressources budgétaires des institutions scientifiques
concernées. Il est donc pratiquement impossible d’observer les recommandations du Code sur l’accord
de genre. Il est regrettable que la Commission Internationale à la Nomenclature Zoologique n’accepte
pas ces arguments dans la dernière édition du Code. La grande majorité des noms génériques des
Lépidoptères étant des termes latinisés plutôt que des noms à signification dans la langue latine, l’auteur
explique qu’il n’y a jamais eu une tradition de “pureté linguistique” dans la nomenclature des Lépidoptéres
comme le soutient le Code. Vu que les règles de la nomenclature zoologique visent à la stabilité et
permanence des noms, l’auteur propose aux Lépidoptéristes de suivre en général l'exemple de nombreux
auteurs de haute réputation qui ont ignoré les dits articles du Code. L’auteur fait appel aux grandes
sociétés lépidoptérologiques pour encourager leurs membres dans ce sens. La Société Européenne de
Lépidoptérologie (SEL) vient d’adopter, le 4 juin 2002, lors de son Assemblée Générale, une telle
Résolution (voir Annexe).
Key words: nomenclature, stability, gender agreement, generic combinations of species names, elec-
tronic databases.
Nomina enim si pereunt perit et rerum cognitio
[When the names go the perception of the things goes as well]
Linnaeus
The burden of nomenclature on systematic research
Taxonomy and systematics are currently poorly supported as academic subjects in
scientific research because, among other reasons, they tend to be deemed of low im-
pact and are thus sparsely funded (Godfray 2002). In Germany, the need for more and
better research in systematic biology was recognized decades ago by the German Sci-
ence Foundation (DFG: Kraus 1982) but not much action was initiated. In fact, there
are very few chairs of systematic zoology at German universities and their role is
considered weak compared with ‘modern’ molecular and physiological, and even eco-
logical, research projects. Permanent scientific staff at the natural history museums in
Germany are rather ‘rare birds’ and in most cases also largely immersed in curatorial
tasks. Following the Rio Conference of 1992 a number of projects involving matters of
systematic zoology were commenced, some of them are funded by the European Com-
mission. The focus is mainly on inventorying and databasing the information on zoo-
logical diversity already to hand in collections. A major resurgence in comprehensive,
broad, and fundamental research in systematic zoology cannot be expected from those
projects, and was not intended.
In the United Kingdom, too, the decline of systematic research was recently de-
plored, and the question was raised, among others by the President of the Linnean
Society, as to why taxonomy is currently so unattractive to funding bodies (Smith
2001; Godfray 2002). It was felt that classifying and cataloguing species to produce
mere lists of names is unexciting and that resolving complex synonymies (historical
confusion in nomenclature) that have accumulated as the legacy of the 19th century is
the sort of time-consuming, unspectacular revisionary work which can hardly win in
the race for serious funding. It was argued that systematic research needs radical ac-
Nota lepid. 25 (2/3): 191-204 193
tion and should reinvent itself as a 21st century information science. A tremendous
obstacle to that, however, was seen to be this very burden of nomenclatural problems
which often wastes a large part of the life of a working taxonomist (Godfray 2002).
The concept of an official, central register of the names of organisms could offer an
attractive way to improve or secure nomenclatural stability. But, while that concept
has become working reality in microbiology, and is under way in botany, zoologists
have so far chosen, for various reasons, not to pursue registration in any form (Howcroft
& Thorne 1999). The nomenclatural problem is exacerbated by the fact that species-
rich groups of animals like insects have, in many orders, e. g. Lepidoptera, seen over
recent decades a remarkable increase in species numbers and new names; this problem
will continue. Therefore they have been, or will be, faced with fundamental
reassignments of species amongst genera and genera amongst higher categories as the
classification is improved.
Against such a background, the effect on systematic research of established
nomenclatural rules must be carefully assessed. The changing of names for the mere
sake of gender agreement might thus appear ‘at the same time childish and obnoxious
to science’ (Guenée 1857[1858]). The purpose of the nomenclatural rules would be
badly served if taxonomists, in order to avoid the disruption of such changes, turned to
the use of ‘numeric’ names as was recently proposed (cf. Sommerer 1999).
The gender trap
The much debated gender agreement between an adjectival species-group name and
the grammatical gender of the pertinent genus-group name has persisted through the
current 4th edition of the International Code of Zoological Nomenclature (ICZN 1999)
which came into force on 1 January 2000 (=Code hereafter). The actual rule (Articles
31.2, 34.2) states that
a species-group name in the form of an adjective or participle in the nominative
singular must agree with the gender of the generic name, and
the epithet has to be changed according to any new combination with another
generic name.
The application of that rule produces a twofold effect: (a) any new adjectival spe-
cies-group name shall reflect the gender of the generic name it is associated with in the
original description, and (b) the established species names must in the scientific litera-
ture be changed in gender to reflect any subsequent combination with a genus other
than that of the original description.
In practice in Lepidoptera, however, taxonomists have met with the difficulties of
the ‘niceties’ (Holloway 1993[1994]) of ancient Greek and Latin when trying to find
out the right grammatical gender of a genus-group name and to decide whether a given
species-group name is adjectival and therefore liable for gender agreement, or a noun
in apposition, and therefore immutable. The various worked examples provided in the
Code (cf. Artt. 30, 31.2, 34.2.1) sufficiently illustrate that difficulty as does the fact
194 SOMMERER: The question of gender agreement in the ICZN
that the Commission itself had to rely on ‘advice on Latin and Greek gender’ from a
university Senior Lecturer in Classics (ICZN 1999: Preface to the Fourth Edition).
Moreover, the rule is not helpful when applying modern electronic tools in tax-
onomy and systematic zoology. An entry in a database should remain unmodified as
long as possible so that easy retrieval and exchange with other systems are safeguarded.
Any modification of an entry needs human resources and is therefore liable to human
error. Certainly, software exists that can trace a name regardless of its ending, but a
database program cannot differentiate names that are nouns in apposition from adjec-
tives and the database will not furnish ‘correct’ names as envisaged by the Code unless
every relevant entry has been changed to the epithet required by the rule of gender
agreement. Advances in the higher classification will dictate that continuous, costly
updates are inevitable.
“Gender agreement’ of the Code has been widely ignored in major systematic lists
and works on the Lepidoptera (cf. Scoble 1999, with further references; Holloway
2001, 1993 [1994]; Karsholt & Razowski 1996; Nielsen er al. 1996; Poole 1989) if not
exactly qualified as ‘nonsense’ (Robinson 1993). The modern practice is to treat the
generic name as genderless and to retain the original orthography of the specific name
(Emmet 1991). Thus, many species names are in use in the spelling of the original
description regardless of the actual generic combination, and since modern taxono-
mists with ‘small Latin and Greek’ seem unable to operate the gender agreement rule
(cf. Emmet 1991), a multitude of ‘incorrect’ new species names have been entered in
the Zoological Record through the years.
But conversely there are also numerous publications testifying to their authors’
eagerness to comply fully with the Code. Some of such well intentioned attempts failed,
however, through incorrect latinisation or the doubtful or arguable interpretation of the
gender of the generic name (Scoble 1999). It is a misfortune that large and very impor-
tant projects with public funding, such as the current EU-funded Fauna of Europe
Project (the Lepidoptera work group is headed by O. Karsholt and E. van Nieukerken
— section moths, — and W. De Prins — section butterflies), formally prescribe full com-
pliance with all rules of the Code. That again will force taxonomists involved in the
project to ‘delve into the 19th century literature’ and to elucidate generic genders, an
expenditure of time that might be seen as ‘simply not good value for money’ (Godfray
2002).
Hence, there is much confusion about the ‘correct’ names of species. The scope for
error (Robinson 1993) persists. If ‘stability and universality’ of zoological names has
been the prime purpose of the nomenclatural rules (ICZN 1999: Introduction), the
latest version of the Code, it seems, has failed to release taxonomists from unnecessary
nomenclatural problems that are felt to contribute to the crisis in systematic biology.
Roots evaluated
As early as 1905 the International Rules of Zoological Nomenclature contained the
provision that adjectival specific names must agree grammatically with the generic
name (Art. 14 a). But the gender agreement rule sat on even older shoulders and was
Nota lepid. 25 (2/3): 191-204 195
also embedded in a framework of other philological conditions. The Strickland Report
(the complete title is Series of Propositions for Rendering the Nomenclature of Zool-
ogy Uniform and Permanent) of 1842, by the British Association for the Advancement
of Science, had found that ‘by adhering to sound principles of philology, we may avoid
errors in future, even when it is too late to remedy the past, and the language of science
will thus eventually assume an aspect of more classic purity than it now presents’. It
emanates from the spirit in the middle of the 19th century that the lingua franca of
science was felt obliged to reflect the ‘Augustan age of Latin’ (Strickland 1842). The
International Rules of 1905 had consequently recommended that ‘the best specific
- name is a Latin adjective, short, euphonic, and of easy pronunciation. Latinised Greek
words or barbarous words may, however, be used.’ It had also been recommended that
‘in subdividing an old genus in future, the names given to the subdivisions should
agree in gender with that of the original group’ (Strickland 1842: Recommendations §
F). The author of a new generic name was, and by the way still is (ICZN 1999: Recom-
mendations 30A & 30B; Appendix E no. 16), supposed to explain the derivation of the
name and state its grammatical gender, a rule honoured more often in the breach.
Obviously, the application of the gender agreement rule would have posed signifi-
cantly fewer problems had such recommendations been followed ever since. Instead,
under the influence of dwindling knowledge of the classic languages, it was later found
that the rule of grammatical agreement of 1905 gave birth to more and more ‘impossi-
ble’ names and became an annoying source of uncertainty and error (Richter 1948). If
the multitude of ‘very bad taste’ genus-group names, together with the reduced number
of taxonomists ‘who are conversant with the spirit of the Latin language’ was deplored
more than a century ago (Strickland 1842), the situation had certainly not improved
when the new Code of 1961 was published. This made gender agreement obligatory
for all past and new species names, whether in their original or in any subsequent
generic combination. Although ‘examples’ were added to help identify the generic
gender, philological perfection had by that time become utopia.
The practical problems connected with gender agreement did, of course, not re-
main unnoticed. There were proposals like the ‘simple’ solution that the name of a
species (not agreeing with the gender of the generic name) be ‘completed’ by the ım-
aginary insertion of the Latin word ‘species’ after the generic name so that constant
feminism of all adjectival species names would be the result (Richter 1948: 114). But
such proposals were never seriously taken up by the Commission. In 1995, the ‘Dis-
cussion Draft’ of the Editorial Committee of the proposed fourth edition of the Code
proposed that the original spelling of an adjectival species-group epithet first pub-
lished after 1996 should be accepted as correct regardless of disagreement in gender in
the original combination, and that generic names after 1996 should be treated as words
having no gender and therefore not affecting the spelling of adjectival specific epi-
thets. That solution was ‘abandoned’ because it was ‘not acceptable to a sufficiently
wide consensus of zoologists’ (ICZN 1999: Preface). The objections were based on the
argument that genera would then contain species names with various epithets and that
it would never be clear whether or not a cited binomen had been ‘corrected’ so that
users of that name would have repeatedly to check the original spelling and were thus
196 SOMMERER: The question of gender agreement in the ICZN
confronted with the difficulties of tracing old or scarce literature. Such argumentation
sounds half-hearted and is not convincing. The reason why so many participants in the
discussion of the then proposed text of the 4th edition would not accept any practical
solution to get around the strict gender agreement principle must be rooted deeper.
The rule of gender agreement has certainly nothing to do with the fact that the
working language of the acting International Commission on Zoological Nomencla-
ture is now English. English adjectives are not varied according to the gender of the
noun. The contrary is, however, true for most languages on the European continent,
and is especially the case in the Latin language which was used for zoological nomen-
clature and had for centuries — until the second half of the 19th century — served as the
language of science in Europe. To know and observe the rules of philology and gram-
mar of Latin is certainly part of the cultural tradition of Europe. It seems well founded
that no taxonomist familiar with classic Latin from his days at school could happily
accept a Felis marmoratus once systematic meanderings had shifted that species from
an original male genus to its combination with Felis. Likewise, an adjectival species
name associated with the genus Papilio could only be tolerated with a masculine epi-
thet. Such philological, cultural roots of European zoology certainly deserve respect.
But would a Sarcinodes punctata have a strong case in this respect? The answer is
rather not, as is shown by the fact that exactly that combination of a feminine adjecti-
val ending with a male generic noun (according to the Code for genera ending in -
odes; cf. Examples to Art. 30 a ii in the 3 Edition) was chosen by Warren in 1894.
Warren was following the tradition of Guenée (1857 [1858]), who erected many
geometrid genera ending in -odes and described numerous species in them with femi-
nine endings.
Many authors of lepidopteran descriptions after Linnaeus did not bother much with
grammatical gender agreement in the sense of the present Code although many 19th
century lepidopterists were more at home with Latin (and Greek) than most of their
modern colleagues, especially if they were trained as medical doctors (like Linnaeus,
Boisduval, Herrich-Schaffer, Rambur), lawyers (like Guenée), or theologians (like
Schrank) (cf. Herbulot 1983). The Genera and Index Methodicus Europaeorum
Lepidopterorum by Boisduval (1840) was written in Latin but the species in Elophos
and Gnophos were listed with their original feminine epithet. Walker’s 35-volume List
of the specimens of lepidopterous insects in the collection of the British Museum con-
tains numerous bilingual, i.e. Latin and English, descriptions of new species. Never-
theless the nomenclatural result in very many cases was such that the Commission
would now have to deplore it as ‘regrettable in itself and an unfortunate example to
others’. Obviously, in the aftermath of the classification of Linnaeus and his contem-
poraries, the generic names were understood to have general grouping prefixes like the
Linnaean Phalaena (Bombyx, Sphinx, Noctua, Geometra, Pyralis, Tortrix, Tinea,
Alucita) which would then induce feminine species names, or Papilio leading towards
masculine species names (although most specific names of the Rhopalocera were in
fact nouns in apposition), regardless of the gender of the real genus name. (Some
lepidopterists like Emmet 1991, much regretted that this simple and workable pattern
— butterfly species male and moths female — bequeathed by Linnaeus ‘had been torn
Nota lepid. 25 (2/3): 191-204 197
into shreds’.) Linnaean species names in some groups are characterized by uniform
endings such as -ana (Tortrix), -alis (Pyralis), -ella (Tinea), -dactyla (Alucita). In the
geometrids the distinction between species with pectinated (pectinicornes) and those
with filiform (seticornes) antennae resulted in the name pattern with the endings -aria
or -ata respectively. ‘Hardly a name has been bestowed since [1758] that is not mod-
elled on one that is found in Systema Naturae, Edition 10’ (Emmet 1991: 20). Tradi-
tion and culture of lepidopterological nomenclature hence cannot be reduced to mere
philological purity. The Code’s 4th edition claims to mark the 242" anniversary of the
. formal starting point of zoological nomenclature, the publication of Linnaeus’ Systema
Naturae Ed. 10 (ICZN 1999: Preface); but the Code adopts philological ideals that are
not found in the taxonomy of Linnaeus and subsequent systematists.
While Felis or Papilio were common words of the vocabulary of ancient Rome,
creations like Sarcinodes and many other artificial latinisations used as generic names
of Lepidoptera would not have had any meaning in the Roman empire. Cultural tradi-
tions of philological correctness have no relevance here. If the gender of such artifacts
or meaningless neologisms can only be determined by specialized linguists trained in
the etymology of Indo-Germanic words and by means of deduction, extrapolation or
postulation, it is indefensible that 21st century lepidopterists be burdened with such
virtual linguistic ‘correctness’. Why should taxonomists today be forced, in the name
of the rules existing in classic Latin, to ‘correct’ real or imaginary misdemeanors com-
mitted more than a century ago? Moreover, ‘classic purity’ as advocated by the Code
was never deeply rooted in the tradition of lepidopterological science.
Meanwhile, the task of recording biodiversity has largely shifted beyond the realm
of the tradition of the Latin language and involves taxonomists with other cultural
backgrounds. Of course, there have been great zoologists outside Europe with an out-
standing proficiency in classic languages but that may not reflect the situation in the
years to come, even less so since such philological abilities tend to become more and
more isolated if not obsolete among academics in Europe as well. The German press
reported recently (in early 2002) that a /apsus linguae occurred even to the Holy Fa-
ther when John Paul II referred to the paupera lingua latina. (There is a dispute among
philologists about that ‘fault’.) In 1895 no one could have foreseen that most users of
scientific names would have no knowledge of Latin or Greek (Melville 1995: Conclu-
sion), but in 2002 it is a fact. ‘Classic purity’ in a system of zoological names, if ever
sought for, is not a feature of relevant cultural impact any more. The rigid formula of
gender agreement in the Code must then appear as the anachronism that it was termed
decades ago (Holloway 1981; Robinson, 1993).
After all, scientific correctness rather depends upon historical truth. There was no
Gnophos accipitrarius by Guenée but accipitraria, no Gnophos ambiguatus described
by Duponchel but ambiguata, but there is now Gnophos porphyratus Zerny.
There may not be a copyright in scientific species names; but there are the author’s
motives, ideas, intentions, mostly unknown to us today, underlying his choice of a
name for a new species. Respect for the personalities contributing to the nomenclatural
web, or at least the good taste which was so often claimed by the early drafters of the
nomenclatural rules, should prevent the pioneers of the nomenclature of Lepidoptera
198 SOMMERER: The question of gender agreement in the ICZN
to be deprived of their species names as they had spelled them out. Guenée (1857
[1858]) once put the question whether there is permission to attack the genius of
Linnaeus and touch on the names in Systema Naturae, and he cites the fact that even
Voltaire was blamed for his correcting obvious faults committed by the Great Corneille.
To give names to a thing always had a special character. ‘Nominum ideoque impositio
primi hominis in aurea aetate actio erat’ [naming was the first man’s action in the
golden age], as Linnaeus (Systema Naturae, ed. 10) put it. In a time of endangered
species and burning primary forests the naming of species may well appear as a treas-
ure of the golden age which should be cherished. ‘Whatever the man called each living
creature, that was its name’ (Genesis 2: 19-20).
Waiting for adoption
While the confusion stemming from the impracticality of the gender agreement rules
was much regretted, no way was found to surmount the seemingly broad resistance to
them. Some minor changes in the text of the Code, intended to simplify the identifica-
tion of gender in genus-group names, merely nourish the Commission’s ‘hope’ that
they will reduce some of the. difficulties of those without knowledge of Latin (ICZN
1999: Introduction). More vigorous attempts to end debates about the correctness of
names were proposed in the discussions leading to the 4th edition of the Code. To
secure conformity with the articles of the Code in future, a system of authorisation or
mandatory registration of names was suggested. Practical difficulties as well as the
principle of taxonomic freedom were felt to stand against that (ICZN 1999: Preface).
In fact, lack of resources would preclude any system of formal acts involving the
Commission. The vision of an authority with the ability to check, within a reasonable
time, whether a new species name or a species name in a new combination meets the
gender agreement requirements and/or other provisions of the Code would, indeed, be
utterly unrealistic (cf. Bouchet 1999).
. The Code envisages, however, a potential remedy through the official adoption of
Lists of Available Names in Zoology (Art. 79): A name occurring in an adopted part of
the List is deemed to have the spelling recorded in the List despite any evidence to the
contrary (Art. 79.4.1). Once such Lists have been compiled, there will obviously be
peace with the gender agreement rule and any doubts about the correct species-group
name will be settled — for the given combination with a generic name! If the species is
later transferred to another genus with different gender the Code apparently still re-
quires the specific adjectival name to be adjusted (cf. Art. 80.6.2). The adoption of an
official list of available names was seemingly not meant to fix the epithet once and for
ever. Otherwise, specific names with different epithets could assemble in a genus as
systematic research progresses, a result that has always horrified the drafters of the
Code.
The protocols for an adoption system are likely to be complicated and slow (Artt.
79.1, 79.2). But the main issue is breaking down the immense numbers of generic and
specific names into adoptable comprehensive lists of genera and/or species which re-
quire the attention of specialists to an extent that is difficult to imagine as realistic
Nota lepid. 25 (2/3): 191-204 199
within a reasonable span of years. A general inventory of the existing species in the
Lepidoptera alone can be estimated to comprise some 160,000 (valid) names. So, even
if that option is viable in the long term, it cannot offer a handy solution for the taxono-
mist working today.
The option now
The Code is a set of rules under the aegis (now) of the International Union of Biologi-
cal Sciences. The articles of the Code are not enforceable under International Law and
the provisions of the Code are not enforceable against any taxonomist or author. There
is no court to hear arguments whilst the Commission itself explicitly states that it is
under no obligation to search out violations of the Code or to initiate any action within
its field of competence (Art. 83). But the Code claims that zoological names published
after 1757 are governed by the provisions of the Code (Art. 88) and that its articles are
mandatory to zoologists when determining the valid name for a taxon or establishing a
new name. The Code also provides for its own interpretation and administration (ICZN
1999: Introduction). Whatever its juridical character, the Code was meant to regulate
zoological nomenclature, and it can still be dealt with in the same way as other obliga-
tions of law are treated.
As pointed out, taxonomists have tended to choose a pragmatic formula that disre-
gards gender agreement. Such procedure clearly contravenes the wording of Artt. 31.2,
34.2 of the Code. But the verdict is not so clear-cut.
(a) In the first place, the strict gender agreement provisions of the Code, although in
their essential content upheld over a century, were, due to the negative effects men-
tioned above, not at all supported by consent of the majority of the addressees, at least
in the taxonomy of Lepidoptera. They may thus be deemed derogated by the inten-
tional and continuous custom of contravention.
(b) Another strong argument was, in a way, acknowledged by the Commission it-
self (ICZN 1999: Introduction): the paucity of knowledge of Latin. The knowledge of
classic Greek is evidently no longer even worth mentioning because it is virtually non-
existent among the younger zoologists of our days. For example, even the editor of the
series The Generic Names of Moths of the World, who served himself on the ICZN, did
not state the genders of the genera listed, an omission that could be interpreted as being
a tacit admission that the gender agreement article of the Code is unworkable (Holloway
1981). If modern taxonomists are unable to find the philologically correct answers as
to the gender of all generic names and to the linguistic qualification of certain specific
names then they are not able to apply the gender agreement rule correctly, and cer-
tainly not within a reasonable time and without unreasonable effort. It has been a
principle since Roman Law that ultra posse nemo obligetur, i.e. a law cannot oblige
adherence to something impossible.
Full application of the rule that adjectival species names must at any time reflect
the gender of the generic name would demand updating of the species name in elec-
tronic databases whenever required by a new combination. Institutions maintaining
databases of large animal groups like Lepidoptera would have to invest much man-
200 SOMMERER: The question of gender agreement in the ICZN
power to follow the systematic alterations. A survey of the moths of Borneo recently
found that about 50% of the macromoths may be in unsatisfactory generic combina-
tions (Holloway 2002). Obviously, the budgets of museums and other scientific insti-
tutions cannot match the need for additional staff. It is thus also financially impossible
to observe the gender agreement rule in the modern electronic tools of taxonomy and
systematics. | |
This twofold impossibility of observing the gender agreement requirements (Artt.
31.2, 34.2) renders those provisions of the Code void.
(c) Such understanding of the gender agreement rules of the Code is uniquely con-
sistent with the foremost principles of stability and permanence of zoological names,
principles that have predominance over mere rules: ‘The objects of the Code are to
promote stability and universality in the scientific names of animals and to ensure that
the name of each taxon is unique and distinct. All its provisions and recommendations
are subservient to those ends and none restricts the freedom of taxonomic thought or
actions.’ (ICZN 1999: Preamble). The Preamble declares itself an “integral part of the
Code’s provisions’. |
As pointed out, in large animal groups like Lepidoptera, systematic research is
continuously yielding reallocations of species to existing or new genera. Consequently,
an adjectival species name might possibly within a few years require different endings
and would thus, in contrast to the stated objectives of the Code, not remain stable and
permanent, and miss the single best quality of a scientific name (Minelli 1999).
(d) The contradiction between the wording of Artt. 31.2, 34.2 and the declared
objects of the Code leaves a gap that can best be bridged by adopting the interpretation
offered by the Code, albeit with some restrictions, in Artt. 31.2.2 and 34.2.1: Species
names in the form of an adjective or participle in the nominative singular may be
understood as nouns in apposition and hence remain unchanged in whichever combi-
nation with a generic name. Regrettably, the Code and the Commission did not dare to
open that door explicitly, but the restrictions to such a general application indicated in
the Code (Art. 31.2.2) seem to be of little relevance in Lepidoptera and can be deemed
overruled by the overriding principle of stability.
Quae sit actio — what to do?
Summing up, the conclusion is that, for the sake of stability and in order to avoid
confusion in the nomenclature of Lepidoptera, something has to be done. The gender
agreement provisions of the Code (Artt. 31.2, 34.2) must not be allowed to interfere
with the mainstream attitude of taxonomists in Lepidoptera which is that the species
name be preserved in its original form, regardless of any genus with which it may later
be combined. That result can be achieved if species-group names originally estab-
lished in the form of an adjective or participle in the nominative singular are generally
treated as nouns in apposition (Artt. 31.2.2, 34.2.1).
Since neither the (new) Code nor the Commission have so far offered a remedy for
the worrying situation, it is highly desirable for all working lepidopterists to have clear
and simple guidelines. In this direction, action could be taken by the leading lepidop-
Nota lepid. 25 (2/3): 191-204 201
terists’ societies as a service to their members engaged in taxonomy and systematics of
Lepidoptera. For instance, members could be encouraged to adopt generally the preva-
lent tradition of disregarding the gender agreement requirement of the Code for the
sake of stability. Additionally the societies could urge, and hopefully convince, the
Commission to cooperate in finding a formal way to achieve that goal.
The Societas Europaea Lepidopterologica (SEL), a society of about 600 lepidopter-
ists of (mainly) the Northern Hemisphere, passed a Resolution in this respect at its
General Meeting at the XIII European Congress of Lepidopterology in June 2002 (see
Appendix). Vivant sequentes [followers welcome]!
References
Boisduval, J. A. 1840. Genera et Index Methodicus Europaeorum Lepidopterorum. — Paris. 238 pp.
Bouchet, P. 1999. Recording and registration of new scientific names: a simulation of the mechanism’
proposed (but not applied) for the International Code of Zoological Nomenclature. —
Bull.zool.Nomencl. 56: 6-15.
Emmet, A. M. 1991. The scientific names of the British Lepidoptera — their history and meaning. —
Harley Books, Colchester. 288 pp.
Godfray, H. Ch. J. 2002. How might more systematics be funded? — Antenna 26: 11-17.
Guenée, A. 1857 [1858]. Uranides et Phalénites. — Pp. ix—xxxvii. — Jn: Boisduval, J. B. A. d’E. & Guenee,
A. (eds.), Histoire naturelle des insectes. Species général des Lépidoptères. vol. 9. Généralités.
Herbulot, C. 1983. Cinq grands Lépidoptéristes français du siècle dernier. — Bull.Soc.ent.Fr. 88: 154-157.
Holloway, J. D. 1981. Book review: Fletcher, D. S. (1979). Geometroidea. — Jn: Nye, I. W. B. (ed.), The
generic names of moths of the world 3. — J.nat.Hist. 15: 539.
Holloway, J. D. 1993 [1994]. The moths of Borneo. Part 11 (Geometridae, Ennominae). — Mal.Nat.J. 47:
1-309, 593 figs., 19 col. pls.
Holloway, J. D. 2001. The moths of Borneo. Part 7 (Arctiidae, Lithosiinae). — Mal.Nat.J. 55: 279-486,
461 figs., 8 col. pls.
Holloway, J. D. 2002. Checklists of tropical faunas: not the destination, just landmarks when travelling
hopefully. — Oral presentation at the XIIIth European Congress of Lepidopterology of SEL, Korser,
Denmark, June 1-6, 2002.
Howcroft, J. & Thorne, J. 1999. Centralized access to newly published zoological names. — Bull. zool.
Nomencl. 56: 108-112.
ICZN (International Commission on Zoological Nomenclature) 1999. International Code of Zoological
Nomenclature. 4th edition. — The International Trust for Zoological Nomenclature, London. xxx +
306 pp.
Karsholt, O. & Razowski, J. (eds.) 1996. The Lepidoptera of Europe. A distributional checklist. -Apollo
Books, Stenstrup. 380 pp.
Kraus, O. (ed.) 1982. Biologische Systematik. Denkschrift im Auftrag der Deutschen Forschungs-
gemeinschaft unter Beriicksichtigung der Ergebnisse des DFG-Rundgesprachs sowie des ESRC-
Interim-Report, Taxonomy in Europe’. — Verlag Chemie, Weinheim. 58 pp.
Linnaeus, C. 1758. Systema Naturae per regna tria naturae, secundum classes, ordines, genera, species,
cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. — Holmiae,
Impensis direct. Laurentii Salvii. — 824 pp.
Melville, R. V. 1995. Towards stability in the names of animals. A history of the International Commission
on Zoological Nomenclature 1895-1995. — Intern. Trust for Zool. Nomenclature, London.
Minelli, A. 1999. The names of animals. — Trends ecol.Evol. 14: 462-463.
Nielsen, E. S., Edwards, E. D. & Rangsi, T. V. (1996). Checklist of the Lepidoptera of Australia. -
Monographs of Australian Lepidoptera 4, xiv + 529 pp. CSIRO, Collingwood (Australia).
Poole, R. W. 1989. Noctuidae. Lepidopterorum Catalogus (New Series), Fasc. 118, 3 parts. — E. J. Brill
Flora & Fauna Publications, Gainesville, Florida. 1314 pp.
202 SOMMERER: The question of gender agreement in the ICZN
Richter, R. 1948. Einführung in die Zoologische Nomenklatur durch Erläuterung der Internationalen
Regeln. — Senckenbergische Naturforschende Gesellschaft, Frankfurt a. M.
Robinson, G. S. 1993. Book review of Heppner, J. B. & Inoue, H. (eds.), Lepidoptera of Taiwan. —
Antenna 17: 148-149.
Scoble, M. J. (ed.) 1999. Geometrid moths of the world. A catalogue. 2 vols. -Apollo Books, Stenstrup.
1016 pp.
Smith, D. 2001. A possible solution to the plight of systematic biology and the study of whole organisms.
— Antenna 25: 269-272. |
Sommerer, M. 1999. Nummernentomologie? [Remarks on] Reinhardt, R., Friedemann, P. & Eitschberger,
U. (eds.): Fragmentarisches Verzeichnis der Schmetterlinge Europas und angrenzender Regionen
mit einem vorläufigen Vorschlag zur Festlegung von Identifikationsnummern. — Mitt.münch.ent.Ges.
89: 118.
Strickland, H. E. 1842. Series of propositions for rendering the nomenclature of zoology uniform and
permanent. — British Association for the Advancement of Science. Report on Zoological Nomenclature
1842: Minute of the Committee of the Section of Zoology and Botany, June 29, 1842.
Walker, F. 1854-1866. List of the specimens of Lepidopterous insects in the collection of the British
Museum. 35 vols. London. |
Appendix
RESOLUTION
adopted by the General Meeting of the Societas Europaea Lepidopterologica
(SEL) at the XIII European Congress of Lepidopterology in Korser (Denmark)
on June 4, 2002:
Lepidopterists are strongly recommended to use species-group names of Lepidoptera
established in the form of an adjective or participle in the nominative singular only in
their original (gender) form given in the original description, unless the name was
fixed otherwise by a subsequent opinion of the International Commission on Zoologi-
cal Nomenclature. In this respect the gender agreement requirements of Artt. 31.2,
34.2 of the actual (4th edition) of the Code shall be disregarded, and such species-
group names of Lepidoptera in the form of an adjective or participle in the nominative
singular shall generally be treated as nouns in apposition and must in no case be changed
to agree in gender with whichever generic name they are combined (cf. Artt. 31.2.2,
34.2.1); |
When naming new species of Lepidoptera, taxonomists shall make sure that the
form (epithet) of an adjectival species name either matches the obvious gender of the
genus name (cf. Recommendation 30A, 30B) it shall be combined with or follows the
example of (the majority of) its congeners.
The President is empowered to take appropriate action so that the afore men-
tioned general mode of the application of the gender agreement provisions of the
Code in the nomenclature of Lepidoptera can be formally accepted by the institu-
tions concerned.
Nota lepid. 25 (2/3): 191-204 203
Anhang
RESOLUTION
verabschiedet von der Mitgliederversammlung der Societas Europaea
Lepidopterologica (SEL) beim XIII. Europäischen Kongress für Lepidopterologie
in Korser (Denmark) am 4. Juni 2002:
Den Lepidopterologen wird dringend empfohlen, Artnamen bei Lepidopteren, die aus
einem Adjektiv oder Partizip im Nominativ Singular bestehen, nur in der grammatika-
lischen Form zu verwenden, in der sie ursprünglich beschrieben worden sind, es sei
denn, daß der Name durch eine spätere Entscheidung der Nomenklaturkommission mit
anderem grammatikalischem Geschlecht festgeschrieben worden ist. Die Bestimmungen
zur Übereinstimmung im grammatikalischen Geschlecht (Artikel 31.2, 34.2) der aktuel-
len (4. Auflage) der internationalen Nomenklaturregeln sollen somit nicht angewandt
werden. Vielmehr sollen solche Artnamen in Gestalt eines Adjektivs oder Partizips im
Nominativ Singular wie substantivische Appositionen behandelt werden und bedürfen
damit nıe einer Anpassung an das grammatikalische Geschlecht des Gattungsnamens,
mit dem der Artname je verbunden sein soll (vgl. Artikel 31.2.2, 34.2.1).
Wer eine Lepidopteren-Art mit einem neuen, adjektivischen Artnamen benennt,
soll sicher stellen, daß sich die grammatikalische Endung nach dem offenkundigen
Geschlecht des Gattungsnamens richtet oder mit den (meisten) anderen Artnamen in
dieser Gattung übereinstimmt.
Der Präsident wird gebeten, die erforderlichen Schritte zu unternehmen, damit die
zuständigen Institutionen diese Handhabung der Nomenklaturregeln für den Bereich
Lepidoptera akzeptieren.
Annexe
RESOLUTION
adopté par l’Assemblée Générale de la Societas Europaea Lepidopterologica (SEL)
à l’occasion du XIITième Congrès de la Lepidoptérologie à Korsor (Danemark) le
4 Juin 2002:
Il est fortement recommandé aux Lépidoptéristes d’utiliser les noms de groupes
d’espèces de Lépidoptères sous la forme (épithète) établie dans la description originale,
à moins que ce nom n’ait été fixé autrement par une opinion subséquente de la Com-
mission Internationale à la Nomenclature Zoologique, et d’ignorer de l’esprit du genre
recommandé dans les articles 31.2, 34.2 de l’édition actuelle (4ème) du Code. De tels
groupes de noms d’espèces de Lépidoptères sous forme d’adjectif ou de participe d’un
nom au singulier doivent être en principe traités comme noms en apposition et ne
doivent en aucun cas être changés en accord au genre avec lequel le nom de genre est
accordé (cf. Art. 31.2.2, 34.2.1).
204
SOMMERER: The question of gender agreement in the ICZN
Lors de la description de nouvelles espèces de Lépidoptères les taxinomistes doivent
s’assurer que la forme (épithète) d’un nom d’espece adjectif s’accorde avec le nom du
genre associé si le genre en est évident sans aucune ambiguité (cf. recommandations
30A, 30B), ou suive l’exemple de (la majorité de) ses congénères.
Le Président de la SEL est mandaté pour entreprendre les actions appropriées en
vue des modifications proposées en application des recommandations du Code sur les
genres à propos des Lépidopteres afin qu’elles soient officiellement acceptées par les
institutions concernées.
eee ras EUROPAEA LEPIDOPTEROLOGICA e. V.
Nota lepidopterologica wird den Mitgliedern der SEL zugesandt. Die Mitgliedschaft bei SEL steht
Einzelpersonen und Vereinen nach Maßgabe der Satzung offen. Der Aufnahmeantrag ist an den Mit-
gliedersekretär Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgien; e-mail:
[email protected] zu richten. Das Antragsformular ist im Internet auf der Homepage
der SEL unter http://www.zmuc.dk/EntoWeb/SEL/SEL.htm erhältlich.
Der Mitgliedsbeitrag ist jährlich am Jahresanfang zu entrichten. Er beträgt für Einzelpersonen € 35,00
bzw. für Vereine € 45,00. Die Aufnahmegebühr beträgt € 2,50. Die Zahlung wird auf das SEL-Konto
1956 50 507 bei der Postbank Köln (BLZ 370 100 50) erbeten. Mitteilungen in Beitragsangelegenheiten
sind an den Schatzmeister Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail:
Der Verkauf von Einzelheften und älteren Jahrgängen von Nota lepidopterologica sowie der Verkauf der
Zeitschrift an Nichtmitglieder erfolgt durch Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Däne-
Adressenänderungen bitte sofort dem Mitgliedersekretär oder dem Schatzmeister mitteilen!
Nota lepidopterologica is sent to the members of SEL. The membership is open to individuals and
associations as provided for by the statutes of SEL. Applications for membership are to be addressed to
the membership secretary Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgium; e-mail:
[email protected]. The application form will be found on the SEL Homepage http://
www.zmuc.dk/EntoWeb/SEL/SEL.htm.
The annual subscription is to be paid at the beginning of the year. It is € 35.00 for individuals or € 45.00
for associations. The admission fee is € 2.50. Payments requested to SEL account no. 1956 50 507 at
Postbank Köln [Cologne] (bank code 370 100 50). In matters concerning the subscription or payments,
please contact the treasurer Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail:
Back numbers of Nota lepidopterologica may be obtained from, and orders of Nota lepidopterologica
from non-members are serviced by Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Denmark; e-
Changes of address should be immediately communicated to the Membership Secretary or the Treasurer.
Nota lepidopterologica est envoyé aux membres de la SEL. L’affiliation est possible, pour les personnes
individuelles aussi bien que pour les associations, en accord avec les statuts de la SEL. Les demandes
d’affiliation doivent être adressées au Secrétaire des Membres Willy ©. De Prins, Nieuwe Donk 50, B-
2100 Antwerpen, Belgique; e-mail:
[email protected].
Le formulaire d’ affiliation est disponible par le biais de la SEL homepage http://www.zmuc.dk/EntoWeb/
SEL/SEL.htm. La contribution annuelle est payable au début de l’année. Elle est de € 35,00 pour les
personnes individuelles et de € 45,00 pour les associations. Les frais d’admission s’Elevent à € 2,50.
Les payements doivent étre effectués sur le compte SEL n° 1956 50 507 aupres de la Postbank Köln
[Cologne] (code bancaire 370 100 50). Pour toutes questions en rapport a la souscription ou aux payements,
veuillez contacter le Trésorier Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail:
[email protected]. Les anciens volumes de Nota lepidopterologica peuvent étre obtenus
et les commandes concernant cette revue de la part de non-membres effectuées auprès de Apollo Books,
Kirkeby Sand 19, DK-5771 Stenstrup, Danemark; e-mail:
[email protected].
Tous changements d’adresse doivent étre communiqués immediatement soit aupres du Secrétaire des
Membres, soit aupres du Trésorier.
@ +
SA
N 318
ENT
NOTA
LEPIDOPTEROLOGICA
A journal devoted to the study of Lepidoptera
Published by Societas Europaea Lepidopterologica (SEL)
SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e. VY.
A)
Ce
http://www.zmuc.dk/entoweb/sel/sel.htm
HONORARY MEMBERS
Pamela Gilbert (GB), Barry Goater (GB), Prof. Dr. Laszl6 Gozmäny (H), Prof. Dr.
Vladimir Kuznetzov (RU), Prof. Dr. Clas M. Naumann (D), Dr. P. Sigbert Wagener (D)
COUNCIL
President:
Vice-President:
General Secretary:
Treasurer: |
Membership Secretary:
Ordinary Council Members:
Editor:
Managing Editor:
Prof. Dr. Niels P. Kristensen (DK)
Dr. David Agassız (UK)
Dr. Christoph L. Häuser (D)
Manfred Sommerer (D)
Willy ©. de Prins (B)
Dr. Bernard Landry (CH),
Dr. Elisenda Olivella (E), Dr. Läszlö Ronkay (H),
Dr. Gerhard Tarmann (A), Dr. Alberto Zilli (1)
Prof. Dr. Konrad Fiedler (D)
Dr. Matthias Nuß (D)
Copyright © Societas Europaea Lepidopterologica (SEL)
ISSN 0342-7536
Printed by druck-zuck GmbH, Halle/Saale, Germany
All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or
mechanical including photocopying, recording or any other information storage and retrieval system, without written
permission from the publisher. Authors are responsible for the contents of their papers.
Nota lepidopterologic
A journal devoted to the study of Lepidoptera
Published by the Societas Europaea Lepidopterologica e. V.
Volume 25 No. 4 Halle / Saale, 16. 06. 2003 ISSN 0342-7536
Editorial Board
Editor: Prof. Dr. Konrad Fiedler, Lehrstuhl für Tierökologie I, Universität Bayreuth,
D-95440 Bayreuth, Germany; e-mail:
[email protected]
Managing Editor: Dr. Matthias Nuß, Staatliches Museum für Tierkunde, Königsbrücker Landstr. 159,
D-01109 Dresden, Germany; e-mail:
[email protected]
Assistant Editors: Dr. Enrique Garcia-Barros (Madrid, E), Dr. Roger L. H. Dennis (Wilmslow, UK),
Dr. Peter Huemer (Innsbruck, A), Ole Karsholt (Kobenhavn, DK), Dr. Yuri P. Nekrutenko (Kiev, UA),
Dr. Erik J. van Nieukerken (Leiden, NL), Dr.Wolfgang Speidel (Bonn, D.)
Contents ® Inhalt « Sommaire
KARSHOLT, ©. & Kun, A.: A new species of Ethmia Hübner, 1819 from the Greek
ee ( VANIIIIC AC) \...:052-052c¢ecc-0-c+-4isasdcentavacvanscnansaoteeseassenadzacdasoeeuesnad- 207
Lvovsky, A. L.: Check-list of the broad-winged moths (Oecophoridae s. /.)
Er AMI ACCIE COUNTIES 5 ..:.cccc00scsocacennnnecesceeeacssissssnncectsssanccaneasednenesnscnces 213
ELSNER, G. & JAROS, J.: A new species of Ceratoxanthis Razowski, and
distribution records for two species of Aethes Billberg from the Balkan
IC IAE: EDchylini) 50:05 s0ceocccccsveqnndssbsenndencessonsnertensenensisdeascoraseeaes 221
ROUGERIE, R.: Re-capture of Sinobirma malaisei in China: description of the
female genitalia and comments on the systematic position of the genus in
ECON TE SAUUITINIGAG) fi.<0s6.cnnsansseasiasteoagreroinnecectnnssnicecsaceesenedandecnpscnansseans 227
WiLcockson, A. & SHREEVE, T. G.: The subspecific status of Pieris napi (Pieridae)
nes serais tatin 235
SIELEZNIEW, M., STANKIEWICZ, A. & BystRrowskı, C.: First observation of one
Maculinea arion pupa in a Myrmica lobicornis nest in Poland ......................... 249
WAKEHAM-DAWSON, PARKER, R., JOHN, E. & DENNIS, R. L. H.: Comparison of the
male genitalia and androconia of Pseudochazara anthelea acamanthis (Rebel,
1916) from Cyprus, Pseudochazara anthelea anthelea (Hübner, 1924) from
mainland Turkey and Pseudochazara anthelea amalthea (Frivaldsky, 1845)
kom imainland Greece (Nymphalidac, Satyrinac) ..........0ss.00r000242004000n00nn 0000010 201
FIEDLER, K. & Rur, C.: Araschnia levana larvae (Nymphalidae) do not accept
Humulus tupuilus (Cannabaceae) as food plant m... . nn... 265
GORBACH, V. V. & SAARINEN, K.: The butterfly assemblages of Onega Lake Area
in Karelia, middle taiga of NW Russia (Hesperioidea, Papilionoidea) .............. 267
IBOOK KEW C WSIS rn en AR Ne hen 226, 234, 248, 264, 280-283
Nota lepid. 25 (4), published 2003: 207-212 207
A new species of Ethmia Hübner, 1819 from the Greek island of
Rhodes (Ethmiidae)
OLE KARSHOLT* & ANDRAS Kun**
* Zoological Museum, Universitetsparken 15, DK-2100 Kobenhavn @, Denmark; e-mail:
** Department of Zoology, Hungarian Natural History Museum, H-1088 Budapest, Baross u. 13,
Hungary; e-mail:
[email protected]
Summary. Description of a new species from Greece (Rhodes), Ethmia mariannae sp. n., is given, in
comparison with its most closely related species, Ethmia iranella Zerny, 1940, and Ethmia treitschkeella
(Staudinger, 1879).
Key words. Ethmia, new species, taxonomy, Rhodes, Europe.
Introduction
The Ethmiidae is a comparatively small family of rather conspicuous moths, with about
300 described species in 3-5 genera, which are distributed in all major continents.
They form a basal clade of the Gelechioidea next to the Stenomatidae, but in spite of _
being rather easily recognizable they are only supported by few synapomorphies
(Hodges 1999). The group is treated either as a subfamily of the Elachistidae (Minet
1990; Hodges 1999) or given family status (Sattler 1967; Riedl 1996). Here we follow
the latter opinion.
Ethmiids are among the best known gelechioid moths. The Palaearctic fauna was
monographed by Sattler (1967) who recognized 72 species. He placed all species in
the genus Ethmia Hiibner, 1819, which he divided into 23 species groups. Riedl (1996)
listed 27 species from Europe.
The European ethmiid fauna has subsequently been studied by a number of au-
thors. Taxonomic or faunistic studies of the Ethmiidae were published for the Euro-
pean part of the former Soviet Union (Zagulajev 1990), Poland (Buszko 1978), north-
ern Europe (Palm 1989), central Europe (Hannemann 1997), and Great Britain and
Ireland (Sattler 2002). Other additions to the knowledge of the European ethmiids are
either data on their bionomics (e.g., Szedke & Dulinafka 1989; Prins ef al. 1991; Kun
2001), regional faunistic works (e.g., Burmann 1980; Popescu-Gor] 1984; Szyska 1997)
or checklists of certain regions and/or countries.
The Ethmiidae of Europe can be considered as well known even though several
species, and especially their biology, are still imperfectly known. The latest valid spe-
cies of Ethmia (apart from subspecies and replacements names) described from Eu-
rope is E. rothschildi (Rebel, 1912).
During a short holiday trip to the island of Rhodes, Michael Fibiger collected with
automatic light traps in two localities a series of males of a distinct, undescribed Ethmia
species, which 1s described below.
© Nota lepidopterologica, 16.06.2003, ISSN 0342-7536
208 KARSHOLT & Kun: A new species of Ethmia
Abbreviations
BMNH - Natural History Museum, London, U. K., HNHM — Hungarian Natural History Museum,
Budapest, Hungary, SUTT — Coll. R. Sutter, Bitterfeld, Germany, ZMUC — Zoological Museum, Uni-
versity of Copenhagen, Denmark, ZSM — Zoologische Staatssammlung, Miinchen, Germany.
Ethmia mariannae sp. n.
Material. Holotype & ‘GR, Rhodos, Kolombia, 40 m, 4.-5.VII.2000, leg. M. Fibiger; Gen. slide No.
3142, Ethmia, H. Hendriksen’ (ZMUC). Paratypes: 9d with the same data as the holotype (ZMUC,
HNHM), Gen. slide 403, A. Kun (HNHM); 6, same data as the holotype, except 5 km S.
Rhodos, 4.-8.v11.2000 (ZMUC). Material excluded from the type series: 3d, Greece, Karpathos
Island, Lefkos, 30 m, 17., 19. & 22.v.1997 (Sutter), Gen. slide 5367, 5485 (SUTT, BMNH).
Adult (males only) (Fig. 1). Wingspan 14-15 mm. Antenna filiform, scape and
basal segments with white scales; flagellum grey; maxillary palpus small, with grey
scales. Labial palpus with black ring on second segment, terminal segment grey, apically
pointed; base of proboscis with bright grey scales; frons and vertex similarly grey,
with black scales along junction of head and prothorax. Thorax bright grey with two
pairs of black dots; tegulae greyish, with a pair of black (anterior) spots. Costal half of
forewing suffused with darker grey; basal half overlaid with five sharply defined black
spots, two of them placed along borderline between darker costal and paler inner half
of wing, dividing this line into three rather equal portions; a further smaller spot situ-
ated close to tornal angle, just below distal dark spot of borderline; last two spots often
elongate, patchy or streak-like, placed along basal half of axillary vein; black marginal
dots present, tiny; cilia bright grey. Hindwing grey, with grey cilia; costal brushes
absent. Forelegs and midlegs darker grey, hindlegs covered with yellowish scales.
Abdomen greyish yellow, with blackish scales on ventral surface.
Variation. Specimens from Karpathos island differ in being slightly larger (wing-
span 17-19 mm), by having the costal part of the forewings more brownish grey and
by the more yellow posterior part of the abdomen. |
Male genitalia (Figs. 4, 4a). Uncus bifid, apically pointed, with deep, nar-
row medial incision. Posterior part of gnathos well developed, dentate, anterior part
slightly bilobate, finely dentate. Labis wide-based, triangular; anellus sclerotised. Valva
with bristles; costa broad, with rounded apical part. Cucullus broad, curved ventrad,
rather hooked; covered with scattered, fine bristles. Sacculus large, rather triangular,
Fig. 1. Ethmia mariannae sp. n. Paratype (ZMUC). Fig. 2. Ethmia iranella Zerny, 1940 (HNHM).
Nota lepid. 25 (4), published 2003: 207-212 209
sclerotized, with pointed process at postero-lateral edge; characteristic sclerotised ba-
sal fold. Vinculum V-shaped. Aedeagus gun-shaped; cornutus long, pointed.
Female. Unknown.
Distribution. Only known from the Greek islands of Rhodes and Karpathos.
Bionomics. Early stages unknown. The type series (apart from one specimen)
was collected with automatic light traps near the town Kolombia, behind a petrol sta-
tion. The habitat is a hot, xerothermic rocky area, with some herbaceous plants. An-
other specimen was found near Rhodes city, in a rather different vegetation type (M.
Fibiger, pers. comm.). The type series was collected in early July during a period with
high temperatures.
Etymology. -—The new species is dedicated to Mariann Fibiger for supporting
the field work of her husband Michael Fibiger during their holiday in Rhodes.
Discussion
E. mariannae belongs to the Ethmia bipunctella species-group (sensu Sattler 1967).
This group is characterised by a well developed mouth structure, a long proboscis, a
four-segmented maxillary palpus, dark spots of the thoracic pattern arranged in a simi-
lar way, last segments of the abdomen and hindlegs yellowish, costal brushes absent,
uncus divided in some species, posterior and anterior parts of gnathos dentate, labis
developed, cucullus curved, sacculus with pointed distal process, aedeagus with one
pointed cornutus, antrum with a thorn, a long helical ductus bursae, corpus bursae with
appendix and signum trilobate dentate.
The closest relatives of E. mariannae are E. iranella Zerny, 1940 (Figs. 2, 3, 3a)
and E. treitschkeella (Staudinger, 1879). The male genitalia of these three species dis-
play the same ground plan. The external appearance of E. mariannae is, however,
conspicuously different from those of the two allied species, and it is also much smaller,
with a wingspan of 14-15 mm, while those of the other members of the bipunctella-
group measure between 18 and 28 mm (Sattler 1967; Kun, unpublished). The forewing
pattern of E. mariannae is characterized by the smaller black dots in the forewing and
the uniformly greyish costal part, while the costal half of the forewing is black in E.
iranella and E. bipunctella. The black spot on the border of the head and the prothorax
is only present in E. mariannae and E. iranella. The male genitalia of E. mariannae
(Figs. 4, 4a) differ mainly from those of E. iranella by the differently shaped, broader,
more curved cucullus, the shorter and pointed distal sacculus process, the shape of the
sacculus, and the long, more pointed cornutus.
We have of course considered the possibility that Æ. mariannae may represent a
subspecies of E. iranella. We have therefore examined material of the latter, including
their male genitalia, from throughout its distribution range, apart from Spain, from
where no specimens were available. From this survey we conclude that E. iranella is a
species with nearly no variation in wing pattern and genitalia. Despite of its huge
distribution area it shows no tendency to subspecies formation. E. mariannae is clearly
separated from E. iranella in the above mentioned characters, and we thus conclude
that it represents a species distinct from E. iranella.
210
KARSHOLT & Kun: A new species of Ethmia
Figs. 3-4. Male genitalia. Figs. 3, 3a. Ethmia iranella Zerny, 1940, Gen. prep. Kun No. 206 (HNHM).
Figs 4, 4a. Ethmia mariannae sp. n. Paratype, Gen. prep. Kun No. 403 (HNHM).
Material examined of E. iranella (only dissected males). Greece: 4, Korinthos 22.vi.1985
(K. Szeöke), Gen. slide 296, A. Kun (HNHM); Hungary: d, Agasegyhaza, homokbuckas, 1.viii.1956
(Gozmäny), Gen. slide 292, A. Kun (HNHM); Iran: à , Elburz Mts., Tacht i Suleiman, Hecarcal valley,
2800-3200 m, 3.-7.vii.1936 (Osthelder), ZSM Gen. slide. No. 125 (ZSM); d, Prov. Teheran, Elburz
Mts. 10 km S of Semsak, Deezin, 2000 m, 21.vii.2000 (Benedek), Gen. slide 293, A. Kun (HNHM);
Italy: ¢, Taranto, Lido Silvana, 23.viii.1968 (Hartig), BM Gen. slide 30106 (BMNH); Turkey: 26 , Prov.
Ankara, Lake Tuz Gölü, 8 km N of Sereflikochisar, 1100 m, 33°16'E, 39°00'N, 24.iv. 1989 (Fabian,
Ronkay & Ronkay), Gen. slide. 206 (fig 3.), 294, A. Kun (HNHM); 6, Prov. Kayseri, Avanos, 920 m,
34°SS'E, 38°41'N, 19.v.2001. (Fabian & Vig), Gen. slide 295, A. Kun (HNHM).
The three male specimens from Karpathos Isl. are excluded from the type series
because of the differences in size and wing pattern described above. Even though their
genitalia fit to those of E. mariannae further studies, when more material of both sexes
and host plant data become available, may show them to represent a further taxon,
probably on subspecific level.
Nota lepid. 25 (4), published 2003: 207-212 2
Hostplants of Ethmiidae are in most cases members of the Boraginaceae. The early
stages of the taxa of the E. bipunctella species-group and their bionomics are still
poorly known, apart from E. bipunctella itself, which has been studied in some detail
(Szeöke & Dulinafka 1989; Prins et al. 1991). The immature stages and the host plants
of the other members of the species-group are still undiscovered. E. bipunctella, which,
according to literature data, feeds on various Boraginaceae species, e.g. Onosma
arenaria, Anchusa officinalis, Echium vulgare, E. calycinum, Cynoglossum officinale,
Symphytum sp. and Alkanna tinctoria, has also been recorded from Rhodes. E. iranella,
the most closely related species of E. mariannae, is distributed in Spain, Hungary,
Romania, Greece, European part of Russia, Turkey, Syria, Iran Transcaucasus and
Turkmenia (Sattler 1967; Zagulajev 1990; Neumann 2000). Zagulajev (1990) also
records iranella from northwest Asia, but this requires confirmation.
Field observations of adult Ethmia suggest that they are most abundant close to
their host plants and rarely fly far from these. However, it is still surprising that E.
mariannae has not been discovered before on the island of Rhodes especially during
the field work of Laszl6 Gozmany and the late Joseph Klimesch (Gozmany, in press).
One can only speculate about the reasons for that, but one reason could be that the
automatic light traps used by Michael Fibiger worked throughout the night and hence
also attracted moths flying only late in the night or towards the early morning.
The type series of E. mariannae is in good condition except that the antennae of
most specimens are broken. Due to the high temperature the numerous moths col-
lected in the light traps quickly became dry and their antennae broken by subsequent
moths moving around after being caught in the trap (Michael Fibiger, pers. comm.).
Acknowledgements
We are grateful to Michael Fibiger, Sorg, for presenting to the ZMUC the Microlepidoptera material
collected during his trip to Rhodes, and to Reinhard Sutter, Bitterfeld, Germany for sending specimens
and genitalia photos for study. We also thank Geert Brovad, ZMUC for photographing the adult of E.
mariannae, Henning Hendriksen, ZMUC for assisting with preparation of adults and genitalia, and Linda
Pitkin, BMNH for linguistic correction. We acknowledge the comments on our manuscript received
from Dr. Klaus Sattler, BMNH and an anonymous referee. Andras Kun’s research on Ethmiidae was
supported by the COBICE (ZMUC) and the COLPARSYST (MNHM) EC-funded IHP programs.
References
Buszko, J. 1978. Ethmiidae. — Klucze Oznacz. Owad. Pol. 27 (36): 1-21. Warszawa.
Burmann, K. 1980. Beiträge zur Microlepidopterenfauna Tirols. 2. Ethmiidae (Lepidoptera). — Nachrbl.
bayer. Ent. 29: 25-29.
Gozmäny, L., in press. The Lepidopera of Greece. — Hellenic Zoological Society, Athens.
Hannemann, H. J. 1997. Kleinschmetterlinge oder Microlepidoptera 5: Oecophoridae, Chimabachidae,
Carcinidae, Ethmiidae, Stathmopodidae. — Tierwelt Dtl. 70: 1-165.
Hodges, R. W. 1999. The Gelechioidea. /n: N. P. Kristensen (ed.): Lepidoptera, moths and butterflies.
Volume 1: Evolution, systematics, and biogeography. — Handbuch der Zoologie 4 (35). — Walter de
Gruyter, Berlin, New York. — Pp. 131-158.
Kun, A. 2001. Data to the distribution and bionomics of Ethmia dodecea (Lepidoptera: Oecophoridae)
in Hungary. — Folia ent. Hung. 62: 383-384. [Hung. ]
Minet, J. 1990. Remaniement partiel de la classification des Gelechioidea, essentiellement en fonction
de caractéres pré-imaginaux. — Alexanor 16: 239-255.
212
KARSHOLT & Kun: A new species of Ethmia
Neumann, H. 2000. Ethmia iranella Zerny, 1940 (Ethmiidae) und Aterpia circumfluxana Christoph,
1881 (Tortricidae), zwei fuer Rumaenien neue Mikrolepidopterenarten. — Entomol. Romanica 4 (1999):
69-72.
Palm, E. 1989. Nordeuropas Prydvinger (Lepidoptera: Oecophoridae). — Danmarks Dyreliv 4: 1-247
(incl. 8 pls.). Fauna Boger, Kobenhavn.
Popescu-Gorj, A. 1984. Ethmia lugubris (Staudinger) (Lepidoptera, Ethmiidae), espece nouvelle pour la
faune de Roumanie. — Trav. Mus. hist. nat. Gr. Antipa 25: 239-240.
Prins, A. H., Laan, R. M., Verboom, J. & Verboom, B. 1991. Food plant quality of Cynoglossum officinale
and herbivory by Ethmia bipunctella (Lepidoptera, Ethmiidae). — Neth. J. Zool. 41: 184-193.
Riedl, T. 1996. Ethmiidae. Jn: O. Karsholt & J. Razowski (eds.): The Lepidoptera of Europe. A
distributional checklist. — Apollo Books, Stenstrup. — Pp. 63-64.
Sattler, K. 1967. Ethmiidae. Jn: H. G. Amsel, F. Gregor & H. Reisser (eds.): Microlepidoptera Palaearctica
2 (1): i-xi, 1-185; 2 (2): pls. 1-106. Wien.
Sattler, K. 2002. Ethmiidae. In: A. M. Emmet & J. R. Langmaid: Oecophoridae — Scythrididae (excluding
Gelechiidae). The Moths and Butterflies of Great Britain and Ireland 4 (1). — Harley Books, Colchester,
Essex. — Pp. 178-187, pl. 5.
Szeöke, K. & Dulinafka, G. 1989. Damage of Ethmia bipunctella F. (Lep. Ethmiidae) in Alkanna tinctoria
plants. - Növenyvedelem 25: 142. [Hung. |
Szyska, P. 1997. Ethmia fumidella Wocke, ny sjælden dansk smäsommerfugl. — Lepidoptera 7: 112-113.
Zagulajev, A. K., 1990. Family Ethmiidae. Jn: G. S. Medvedev (ed.): Keys to the Insects of the European
part of the USSR 4, Lepidoptera, part 2. — E. J. Brill, Leiden, New York, Kobenhavn, Köln. — Pp.
853-871.
Nota lepid. 25 (4), published 2003: 213-220 215
Check-list of the broad-winged moths (Oecophoridae s. /) of
Russia and adjacent countries
ALEXANDR L. LVOVSKY
Zoological Institute, Russian Academy of Sciences, Universitetskaya nab. 1, RU-199034 St.-
Petersburg, Russia; e-mail:
[email protected]
Summary. The distribution of Oecophoridae moths in the territory of Russia and adjacent countries (i.e.
in the borders of the former USSR) is summarized. The concept of the family is taken broadly, including
the subfamilies Chimabachinae, Deuterogoniinae, Pleurotinae, Oecophorinae and Amphisbatinae, but
excluding Depressariinae and Autostichinae. There are 38 genera and 110 species in this territory. Nine
new generic combinations are introduced. The distributions of species are recorded for every republic of
the former USSR. From the data the completeness of the current knowledge of this fauna is estimated.
Zusammenfassung. Die Verbreitung aller aus dem Territorium der früheren Sowjetunion bekannten
Oecophoridae-Arten wird zusammenfassend dargestellt. Dabei wird die Familie einschließlich der Un-
terfamilien Chimabachinae, Deuterogoniinae, Pleurotinae, Oecophorinae und Amphisbatinae, aber aus-
schließlich der Depressariinae und Autostichinae aufgefaßt. Insgesamt kommen 110 Arten aus 38 Gat-
tungen im Gebiet vor. Neun neue Gattungskombinationen werden eingeführt. Die Diversität der
Oecophoriden wird tabellarisch für jede Teilrepublik der früheren Sowjetunion dargestellt. Die verfüg-
baren Daten werden genutzt, um die derzeitige Vollständigkeit des Erfassungsgrades in den einzelnen
Teilgebieten abzuschätzen.
Key words. Lepidoptera, Oecophoridae, faunal diversity, Russia, adjacent countries, new combinations.
Introduction
The first (and the last) check-list of all Russian Lepidoptera was published many years
ago (Erschoff & Field 1870). It contained only 3180 species, among them 31 species
of Oecophoridae (without Depressariidae). In the inventory presented below the number
of Oecophoridae species known to occur in the territory of the former USSR is raised
to 110 species from 38 genera. Most data used to compile this check-list stem from the
collection of the Zoological Institute of the Russian Academy of Sciences. Moreover,
the following modern faunistic literature sources were evaluated: European part of
Russia (Lvovsky 1981, 1990); Asiatic part of Russia (Lvovsky 1999); Estonia (Jürivete
et al. 2000); Latvia (Savenkov ef al. 1996); Lithuania (Ivinskis 1993); Belarus
(Merzheevskaya et al. 1976); Ukraine (Sovinskiy 1938; Budashkin 1987); Kyrgyzstan
(Lvovsky & Kozlov 1983); Tajikistan (Lvovsky & Sherniyazova 1992).
The suprageneric classification of the family is far from being settled. Diver-
gent systems are used even in the most modern literature (Leraut 1997; Hodges
1999; Kuznetzov & Stekolnikov 2001). Here I follow the system of Kuznetzov
& Stekolnikov (2001), but with some modifications. In particular, | exclude
Depressariinae and Autostichinae. Thus Oecophoridae as conceived here in-
cludes Chimabachinae, Deuterogoniinae, Pleurotinae, Oecophorinae and
Amphisbatinae. The genus Orophia Hübner, 1825 (= Cephalispheira Bruand,
1851) is retained in a rather ‘traditional’ manner, as it is probably more correct
to be included in the family Depressariidae.
© Nota lepidopterologica, 16.06.2003, ISSN 0342-7536
214 Lvovsky: Oecophoridae of Russia and adjacent countries
Faunistics and biogeographical comments
The diversity of Oecophoridae species, broken down to genera and regions, is shown
in Table 1. This table includes some unusual, surprising findings. Epicallima gerasimovi
Lvsk. was found in middle Volga (Lvovsky & Sachkov 1996), while before the species
had been only know from middle Asia. Epicallima haasi Rbl., formerly known only
from Turkey, was found in East Uzbekistan. Denisia luticiliella Ersch. also occurs in
Latvia (Savenkov 1988) and Lithuania (Ivinskis 1993), whereas it was earlier known
only from the Caucasus. These observations indicate very significant extensions of
formerly suspected distribution ranges and suggest that many more Oecophoridae spe-
cies with apparently restricted ranges may in fact be much more widespread. Clearly,
the family is under-sampled still in most territories of the former USSR.
Table 1. Species numbers within 38 Oecophoridae genera recorded from the former USSR. Regions and
states are designated as follows: 1 — European Russia; 2 — Asiatic Russia; 3 — Estonia; 4 — Latvia; 5 —
Lithuania; 6 — Belarus; 7 — Ukraine; 8 — Moldova; 9 — Georgia; 10 — Armenia; 11 — Azerbaijan; 12 —
Kazakhstan; 13 — Turkmenistan; 14 — Uzbekistan; 15 — Kyrgyzstan; 16 — Tajikistan; 17 — Entire territory.
pi
[=]
="
pi
pi
nN
ji
o>)
bod
ES
pi
Un
pd
nN
pi
—I
Genus
Diurnea Hw.
Dasystoma Curt.
Deuterogonia Rb!.
Minetia Leraut
Pleurota Hb.
Holoscolia 2.
Aplota Stph.
Alabonia Hb.
Oecophora Latr.
Dasycera Stph.
Colchia Lvsk.
Harpella Schr.
Callimodes Leraut
SchiffermuelleriaHb.
Bisigna Toll
Fabiola Busck
Decantha Busck
Metalampra Toll
Epicallima Dyar
Promalactis Meyr.
Denisia Hb.
Buvatina Leraut
Batia Stph.
Crassa Bruand
Borkhausenia Hb.
Endrosis Hb.
Hofmannophila Spul.
Martyringa Busck
PseudocryptolechiaLvsk.
Carcina Hb.
Periacma Meyr.
Pseudatemelia Rbl.
Amphisbatis Z.
Telechrysis Toll
Hypercallia Stph.
Anchinia Hb.
Orophia Hb.
Eutorna Meyr.
Total:
ooo ©
oO © © ©
—
je
—
—
SOLID rR ROOK OR RFP WNORNON RRR rR rere 0900 m SO OS mm m mm YN =
OO ANR nm OO © CO O0 CO AQU OO NO nm mOn oO COrF OOF OCC COFCO oo m N W
ON nd OO OOOmAVUWNDOOOROmnAOmROmOOOC—- OO NN BR
SOH- Do WDWOOoooS mV DOOoSROSHT-OO0 ro oo 00900 0 oO mm N W
SION SSSR SON SSSR SSSR Se SE NO E
OO On On COO OC RR RK BEN OW On mn RK Or Om Om IN KN I
Soo Sooo oc See So So oo Coco! ooo | —- oS Soo ooo SNS = NL 00
one OO ON OO On ON OS ON ON OO nn OO NO NO NO = 00 © © ON WC
SESESTZIESITSZSETESISISESISTISISISZSTESTZSIISITSESITSISIDISESISISISESZ SS: Sz—
SI OUT ON MOSS CO NS EM I NME EM SNS
Dee eee eee eee eee ae ee Se eee ee
U eee es esse sess see eee 2400 see
EN 06660000 SNS MSN SNS ENS oo oe oo ONS SNS) SS
J AO See es © Seo © ee LS Se Se SSSR SS © ©}
MMS Se Se See oo sooo 2G eee oe oe oS SoS ee
Nn
D
io)
\©
D
©
[997
N
nN
\o
=
nN
199)
I
=
=
[22]
(—)
=
D
D
[997
pi
EN
pi
En
=
Nota lepid. 25 (4), published 2003: 213-220 215
As it is demonstrated in the table, the distribution of the Oecophoridae species is very
uneven. This may be explained, on the one hand, by the very different climatic and
natural conditions across this large territory (Lvovsky 1996 a). From north to south there
are four major natural zones: tundra, forest (with subzones of boreal forest or taiga and
broad-leaved forest), steppe and desert. The broad-leaved forest is the most favourable
for Oecophoridae moths. Their fauna is abundant in European Russia and in the south of
the Russian Far East. In contrast, in tundra and desert ecosystems Oecophoridae moths
are very rare. The severe continental climate of Siberia also does not appear to be favour-
able for Oecophoridae moths, therefore their fauna is poor in this vast territory. The same
is true for highlands. Only few species are recorded here, for example Pleurota exoletella
Ersch. in the Zailijsky Alatau (Kazakhstan) at elevations up to 3000 m.
On the other hand, the uneven diversity of Oecophoridae species across regions is
at least partially explained by the variable degree of completeness of faunal invento-
ries in different regions. Judging from available distributional records and habitat avail-
ability, I suspect the completeness of regional faunal inventories as approximately
95% in Estonia, Latvia and Lithuania; 90% in European Russia, Belarus and Ukraine;
80% in Asiatic Russia and Georgia; 70% in Azerbaijan; 60% in Armenia and
Kazakhstan; 50% in Turkmenistan and Kyrgyzstan; 40% in Moldova and Uzbekistan;
and only 20% in Tajikistan.
Check-list
The species distribution in the following check-list is given only for areas within
the borders of the former USSR. The place names are spelled as Microsoft Encarta
Interactive World Atlas 2001 default place names. Kray (= territory) and oblast’ (=
region) — administrative divisions of Russian Federation; N — north, northern; S —
south, southern; W — west, western; E — east, eastern.
1. Diurnea fagella (Denis & Schiffermiiller, 1775) — Russia (centre and S of European part,
including Dagestan; to the N up to Moscow and Kazan), Estonia; Latvia, Lithuania, Belarus,
Ukraine, Moldova, Georgia, Armenia.
2. D. lipsiella (Denis & Schiffermiiller, 1775) [= phryganella (Hübner, 1796)] — Russia (centre
and S of European part, to the N up to Kazan); Estonia, Latvia, Lithuania, Belarus, Ukraine,
Moldova, Georgia, Turkmenistan (Kopet-Dag.).
D. soljanikovi Lvovsky, 1986 — Russian Far E (Primorskiy Kray [Primorye]).
4. Dasystoma salicella (Hübner, 1796) — Russia (European part, S Siberia, Amurskaya oblast’., S
Khabarovskiy Kray, Primorskiy Kray [Primorye]), Estonia, Latvia, Lithuania, Belarus, Ukrai-
ne, Moldova. The erroneous misspelling ”Dasytroma” (Lvovsky 1996b) unfortunately was
subsequently used in further publications (Jürivete ef al. 2000).
5. D. kurentzovi (Lvovsky, 1990) — Russian Far E (Primorskiy Kray [Primorye]).
6. Deuterogonia pudorina (Wocke, 1857) — Russia (middle Volga, S Irkutskaya oblast’., S
Chitinskaya oblast’., S Amurskaya oblast’, Primorskiy Kray [Primorye]), Latvia, Lithuania,
Ukraine. There is a gap in the distributional range from middle Volga to Lake Baykal. The
species is very rare in Europe, but common in Russian Far E.
7. D. chionoxantha (Meyrick, 1931) — Russian Far E (Kunashir Island).
8. Minetia crinitus (Fabricius, 1798) [= Topeutis barbella (Fabricius, 1794)] — Russia (S European
part up to Saratov, S Ural, Altay, Minusinsk); Ukraine (near Kiev).
9. M. adamczewskii (Toll, 1956) — Ukraine (near Zvenigorod).
Ww
216
10.
11.
122
132
14.
158
16.
WE:
18.
IC.
20.
Pale
DD
287
24.
257
26:
Die
28.
29).
30.
3
322
33.
34.
32:
36.
Sk
38.
30)
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
Lvovsky: Oecophoridae of Russia and adjacent countries
Pleurota pyropella (Denis & Schiffermiiller, 1775) — Russia (S European part and N Caucasus);
Ukraine, Georgia, Azerbaijan, Armenia, Turkmenistan, Uzbekistan, SE Kazakhstan, Kyrgyzstan.
P. malatya atrostriata Lvovsky, 1992 — Russia (S European part up to Kursk, Dagestan, Altay,
Minusinsk); Ukraine, Georgia, Azerbaijan, Armenia, SE Kazakhstan. In old Russian literature
this taxon was mentioned erroneously as P. brevispinella Zeller.
P. karatauella Lvovsky, 1984 — S and SE Kazakhstan. 2
P. contignatella Christoph, 1872 — European Russia (lower Volga: Sarepta, Bogdo); Kyrgyzstan.
P. ordubadella Lvovsky, 1992 — Azerbaijan (near Ordubad).
P. zhdankoi Lvovsky, 1992 — N Kyrgyzstan (mountains Kungey Alatau).
P tristatella Staudinger, 1871 — European Russia (Krasnodarskiy pee and Stavropolskiy Kray);
Ukraine, Georgia (Manglisi), Azerbaijan (Lerik).
P. semiticella Amsel, 1959 — Azerbaijan (Ordubad).
P. scabrella Lvovsky, 1984 — Georgia (Borzhomi).
P. transcaucasica Lvovsky, 1992 — Azerbaijan (Ordubad).
P. bicostella (Clerck, 1759) — Russia (N of European part, Siberia, rare in Far E, only S of
Amurskaya oblast); Estonia, Latvia, Lithuania, Belarus, W Ukraine (Carpathians).
P. kostjuki Lvovsky, 1990 — Azerbaijan, E Kazakhstan.
P falkovitshi Lvovsky, 1992 — Turkmenistan, Uzbekistan.
P. aorsella Christoph, 1872 — Russia (Saratov and Volgogradskaya oblast’, Dagestan,
Novosibirskaya oblast’); N and E Kazakhstan.
P. pungitiella Herrich-Schäffer, 1854 — S of European Russia, Dagestan; Ukraine (Crimea),
Georgia, N Kazakhstan. The record “Siberia” in old literature is erroneous.
P. metricella (Zeller, 1847) — Georgia, Azerbaijan.
P. nitens Staudinger, 1870 — Georgia, Azerbaijan, Armenia, Turkmenistan.
P. aristella (Linnaeus, 1767) — S European Russia, Dagestan; Ukraine, Georgia, Azerbaijan,
Armenia, Kazakhstan (mountains), Kyrgyzstan.
P. christophi Lvovsky, 1992 — Azerbaijan (Ordubad).
P. exoletella (Erschoff, 1874) [= Megacraspedus exoletellus Erschoff, 1874] — SE Kazakhstan,
Turkmenistan (Kopet-Dag), E Uzbekistan.
P. rezniki Lvovsky, 1984 — S Kazakhstan (Karatau).
P. marginella (Denis & Schiffermüller, 1775) [= rostrella (Hübner, 1796)] — Ukraine.
P. sibirica Rebel, 1901 — Russia (Altay, Tuva, Amurskaya oblast’); NE Kazakhstan.
P. neurograpta Filipjev, 1929 — Russia (Transbaykalia: Buryatia, Chitinskaya oblast’).
P. tuvella Lvovsky, 1992 — Russia (S Siberia: Tuva).
P. obtusella Rebel, 1917 — SE Kazakhstan, E Kyrgyzstan.
P. monotonia Filipjev, 1924 — Russia (S Siberia near Minusinsk).
Holoscolia huebneri Kocak, 1980 [= forficella (Hübner, 1813)] — Russia (S Ural); Ukraine,
Georgia, Armenia.
Aplota palpella (Haworth, 1828) — European Russia (Sarepta near Volgograd); Georgia.
A. nigricans (Zeller, 1852) [= kadeniella (Herrich-Schäffer, 1854)] — Latvia, collected by N. V.
Savenkov near Slitere.
Alabonia staintoniella (Zeller, 1850) — Ukraine, Moldova.
Oecophora kindermanni (Herrich-Schäffer, 1852) — W Georgia.
O. bractella (Linnaeus, 1758) — Estonia (Saarema Island), Ukraine.
Dasycera oliviella (Fabricius, 1794) — European Russia (Belgorodskaya oblast’); Ukraine.
Colchia zagulajevi Lvovsky, 1994 — SW Georgia (Ajaria).
Harpella forficella (Scopoli, 1763) — Estonia, Latvia, Lithuania, Belarus, W Ukraine.
Callimodes heringii (Lederer, 1864) — N Caucasian Russia near Maykop; Georgia, Armenia,
Azerbaijan.
C. mannii (Lederer, 1870) — E Georgia, Armenia, Azerbaijan.
C. zelleri (Christoph, 1882) — Russian Far E (S Khabarovskiy Kray, Primorskiy Kray [Primorye]).
Schiffermuelleria schaefferella (Linnaeus, 1758) — European Russia from Urzhum to Volgograd,
S Ural; Latvia, Lithuania, Ukraine.
Nota lepid. 25 (4), published 2003: 213-220 21%
50.
al:
32,
53:
54.
33.
56.
31.
58.
39;
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
Ali
Bisigna procerella (Denis & Schiffermiiller, 1775) — Russia from St. Petersburg to Belgorod,
‚Ural, Altay, S Amurskaya oblast’, Primorskiy Kray [Primorye]), Estonia, Latvia, Lithuania,
Belarus, Ukraine, Moldova.
Fabiola pokornyi (Nickerl, 1864) — Caucasian Russia (Dagestan); Ukraine (Crimea), Georgia.
Decantha borkhausenii (Zeller, 1839) — Russia near St. Petersburg; Estonia, Latvia, W Ukraine.
Metalampra cinnamomea (Zeller, 1839) — European Russia from Petrozavodsk and Urzhum to
Belgorod and Kazan; Estonia, Latvia, Lithuania, Belarus, Ukraine.
M. caucasica Lvovsky, 1994 — Azerbaijan.
Epicallima formosella (Denis & Schiffermiiller, 1775) — European part of Russia from St.
Petersburg to S Siberia eastwards to Novosibirsk; Estonia, Latvia, Lithuania, Belarus, Ukraine,
Moldova, Georgia, Armenia, Azerbaijan, SE Kazakhstan, Kyrgyzstan.
Epicallima haasi (Rebel, 1902) comb. n. [= Borkhausenia haasi Rebel, 1902] — E Uzbekistan
(Margelan). Note: the characteristic brown and yellow spots on the fore wings and elongated
juxta in the male genitalia substantiate the transfer of this species to the genus Epicallima Dyar.
Epicallima gerasimovi (Lvovsky, 1984) comb. n. [= Borkhausenia gerasimovi Lvovsky, 1984]
— European Russia only near Samara, collected by S. A. Sachkov; SE Kazakhstan, Turkmenis-
tan, Kyrgyzstan, Tajikistan. Note: The reason for the change of the genus name of this species
is the same as in the previous species. .
Epicallima kuldzhella (Lvovsky, 1982) comb. n. [= Callima kuldzhella Lvovsky, 1982] — SE
Kazakhstan near Alma-Ata, Kyrgyzstan. Note: the genus name Epicallima Dyar, 1903 was
proposed as a replacement name for the genus Callima Clemens, 1860, nec Herrich-Schäffer,
1858.
Epicallima tadzhikella (Lvovsky, 1982) comb. n. [= Callima tadzhikella Lvovsky, 1982] —
Tajikistan. Note: the reason for the change of the genus name is the same as in the preceding
species.
Epicallima conchylidella (Snellen, 1884) comb. n. [= Lampros conchylidella Snellen, 1884] —
E Russia (Chitinskaya oblast’, Amurskaya oblast’, S Khabarovskiy Kray, Primorskiy Kray
[Primorye]). Note: the peculiar brown spot on the dark yellow fore wings and elongated juxta
with two processes in the male genitalia explain the transfer of this species to the genus
Epicallima Dyar.
Epicallima bisinuella (Erschoff, 1874) comb. n. [= Oecophora bisinuella Erschoff, 1874] —
Uzbekistan, Tajıkistan. Note: the brown spots on the dark yellow fore wings and sclerotized
cuiller near the distal end of the valva in the male genitalia substantiate the transfer of this
species to the genus Epicallima Dyar.
Epicallima subsuzukiella (Lvovsky, 1985) comb. n. [= Promalactis subsuzukiella Lvovsky,
1985] — Russian Far E (S Primorskiy Kray [Primorye]). Note: the peculiar dark brown spot on
the yellow fore wings of this species differentiates it from all Promalactis species.
Epicallima nadezhdae (Lvovsky, 1985) comb. n. [= Promalactis nadezhdae Lvovsky, 1985] —
Russian Far E (S Primorskiy Kray [Primorye]). Note: the reason for transferring this species to
the genus Epicallima Dyar is the same as in the preceding species.
Epicallima dushanbella (Lvovsky & Arutjunova, 1992) comb. n. [= Callima dushanbella
Lvovsky & Arutjunova, 1992] — W Tajikistan. Note: the reason for transfer of this species to
the genus Epicallima Dyar is the same as in E. kuldzhella Lvovsky.
Promalactis venustella (Christoph, 1882) [= odaiensis Park, 1980] — E Russia (S Irkutskaya
oblast’, S Chitinskaya oblast’, S Khabarovskiy Kray, Primorskiy Kray [Primorye]).
P. jezonica (Matsumura, 1931) [= symbolopa Meyrick, 1935] — Russian Far E (S Primorskiy
Kray [Primorye]).
P. svetlanae Lvovsky, 1985 — Russian Far E (S Primorskiy Kray [Primorye]).
P. ermolenkoi Lvovsky, 1986 — Russian Far E (Sakhalin, Iturup, Kunashir, Shikotan Islands).
P. parki Lvovsky, 1986 — Russian Far E (Primorskiy Kray [Primorye]).
P. sinevi Lvovsky, 1986 — Russian Far E (S Primorskiy Kray [Primorye]).
Denisia stipella (Linnaeus, 1758) — N and central part of European Russia, S Siberia, Sakhalin
Island; Estonia, Latvia, Lithuania, Belarus, W Ukraine (Carpathians).
218
Lvovsky: Oecophoridae of Russia and adjacent countries
72:
13:
74.
Dex.
76.
Ta.
78.
12.
80.
81.
82.
83.
84.
85.
86.
ote
88.
89
90.
IL.
OR;
OB:
94.
95?
96.
IM:
98.
2%
100.
101.
D. similella (Hübner, 1796) — N and central part of European Russia, Ural, S Siberia, Kamchatka;
Estonia, Latvia, Lithuania, Belarus, N Ukraine.
D. luticiliella (Erschoff, 1877) — S of European Russia (Stavropol, Essentuki, Dagestan); very
rare in Latvia and Lithuania; common in Georgia, Azerbaijan, Armenia.
D. augustella (Hübner, 1796) [= angustella auct.] — Centre and S of European Russia; W Uk-
raine, Azerbaijan. Information about occurrence in Russia (Kozhantshikov 1955) and Azerbaijan
(Ahundova-Tuaeva 1958) needs verification.
D. stroemella (Fabricius, 1779) — N and central part (Samara) of European Russia; Latvia,
Lithuania.
D. coeruleopicta (Christoph, 1888) — N Caucasus of Russia (Teberda); Georgia, Armenia.
D. obscurella (Brandt, 1937) — NW Russia (Sortavala).
Buvatina iremella Junnilainen & Nupponen, 1999 — Russia (S Ural, Chelyabinskaya oblast’).
Batia lunaris (Haworth, 1828) — Ukraine, record needs verification.
B. lambdella (Donovan, 1793) — Ukraine.
Crassa unitella (Hübner, 1796) [= Batia unitella (Hübner, 1796)] — S of European Russia;
Latvia, Lithuania, Ukraine, Georgia, Azerbaijan.
C. tinctella (Hübner, 1796) [= Tichonia tinctella (Hübner, 1796)] — central part of European
Russia; Estonia, Latvia, Lithuania.
Crassa ochricolor (Erschoff, 1877) comb. n. [= Oecophora ochricolor Erschoff, 1877] —
Georgia. Note: the ochreous fore wings without spots, juxta with two peculiar processes, and a
large cornutus in the aedeagus of the male genitalia substantiate the transfer of this species to
the genus Crassa Bruand, 1851. “ee
Borkhausenia minutella (Linnaeus, 1758) — central part of European Russia; Estonia, Latvia,
Lithuania, Ukraine.
B. fuscescens (Haworth, 1828) — NW European part of Russia; Estonia, Latvia, Lithuania.
B. luridicomella (Herrich-Schäffer, 1856) — European Russia (middle Volga: Samara, Saratov);
Estonia, Latvia, Lithuania, Belarus.
Endrosis sarcitrella (Linnaeus, 1758) [= lactella (Denis & Schiffermüller, 1775)] — in all
territories.
Hofmannophila pseudospretella (Stainton, 1849) — European part of Russia; Estonia, Latvia,
Lithuania, Belarus, Ukraine, Moldova.
Martyringa ussuriella Lvovsky, 1979 — SE Russia (Altay, Chitinskaya oblast’, Primorskiy Kray
[Primorye], Kunashir and Shikotan Islands).
M. xeraula (Meyrick, 1910) [= Santuzza kuwanii Heinrich, 1920; = Martyringa ravicapitis
Hodges, 1960] — Russian Far E (S Primorskiy Kray [Primorye]).
Pseudocryptolechia sareptensis (Möschler, 1862) —S European Russia (Sarepta near Volgograd).
Carcina quercana (Fabricius, 1775) — S Belarus, Georgia, N Azerbaijan.
C. luridella (Christoph, 1882) [= Heterodmeta homomorpha Meyrick, 1931] — Russian Far E
(S Khabarovskiy Kray, Primorskiy Kray [Primorye], Sakhalin and Kunashir Islands).
Periacma delegata Meyrick, 1914 — Russian Far E (S Primorskiy Kray [Primorye]).
Pseudatemelia flavifrontella (Denis & Schiffermiiller, 1775) — central part of European Russia;
Estonia, Latvia, Lithuania, Ukraine.
Pseudatemelia Kurentzovi Lvovsky, 2001 — Russian Far East (Primorskiy Kray).
P. subochreella (Doubleday, 1859); [= Tubuliferola panzerella auct.] — Caucasian Russia
(Dagestan); Georgia, Azerbaijan.
P. josephinae (Toll, 1956) — N and central part of European Russia, S Siberia, Russian Far E (S
Primorskiy Kray [Primorye]), Kunashir and Shikotan Islands); Estonia, Latvia, Lithuania.
P. elsae Svensson, 1982 — NW Russia; Estonia, Latvia, Lithuania.
Amphisbatis incongruella (Stainton, 1849) — W Russia (Kaliningradskaya oblast’); Latvia,
Lithuania.
Telechrysis tripuncta (Haworth, 1828) — S European Russia (Sarepta), N Caucasus (Teberda),
S Siberia (Irkutskaya oblast’), Russian Far E (S Primorskiy Kray [Primorye], Kunashir Island);
Estonia, Latvia, Ukraine, Georgia.
Nota lepid. 25 (4), published 2003: 213-220 219
102. Hypercallia citrinalis (Scopoli, 1763) — European Russia from Petrozavodsk to N Caucasus, S
Siberia (Altay, Minusinsk, Irkutsk); Estonia, Latvia, Lithuania, Belarus, Ukraine, Georgia,
Armenia, Azerbaijan.
103. Anchinia cristalis (Scopoli, 1763) — Russian Far E (Kunashir Island); Estonia, Latvia, Lithuania.
104. A. daphnella (Denis & Schiffermiiller, 1775) — European Russia from Petrozavodsk to N
Caucasus, S Siberia (S Irkutskaya oblast’); Estonia, Latvia, Lithuania, Belarus, Ukraine.
105. A. grandis Stainton, 1867 — N Caucasian Russia from Teberda to Dagestan; Georgia.
106. Orophia denisella (Denis & Schiffermüller, 1775) [= Cephalispheira denisella (Denis & Schiffer-
miiller, 1775)] — S European Russia (Stavropol).
107. O. ferrugella (Denis & Schiffermiiller, 1775) — central part of European Russia (St. Petersburg,
Vladimir, Kasan); Estonia, Latvia, Lithuania.
108. O. sordidella (Hübner, 1796) — Caucasian Russia from Krasnodarskiy Kray to S Dagestan;
Georgia, Azerbaijan.
109. ©. imbutella (Christoph, 1888) comb. n. [= Depressaria imbutella Christoph, 1888)] — Georgia.
Note: the peculiar double gnathos and reduced tegumen in the male genitalia explain the transfer
of this species to the genus Orophia Hübner, 1825.
110. Eutorna leonidi Lvovsky, 1979 — Russian Far E (S Primorskiy Kray [Primorye], Kunashir
Island).
Conclusions
The fauna of Oecophoridae moths in the territory of the former USSR is by far not
completely known. Additional species are expected to be found particularly in under-
explored regions such as the Caucasian mountains, southern Siberia, Central Asia (es-
pecially in the mountains) and in the south of Russian Far East. Altogether, about 10-
15 additional species may be expected to occur in the entire territory of the former
USSR. The total number of species considered here (110) is substantially lower than in
the smaller territory of Europe (152 species). This difference would remain even if
accounting for the expected rise in species numbers, if the faunas of still under-sam-
pled areas were better known. This lower diversity of Oecophoridae in Russia is most
likely explained by the severe continental climate in Siberia and in the deserts of Cen-
tral Asia, which apparently restrain the establishment of a richer oecophorid fauna.
Acknowledgements
It is my pleasure to thank Dr. V. G. Mironov and Dr. S. Yu. Sinev (Zoological Institute of the Russian
Academy of Sciences) for their help in preparing this paper for publication. The study received financial
support from the Russian Foundation for Fundamental Research (project 01-04-49637). The work was
conducted using scientific collections of the Zoological Institute, Russian Academy of Sciences, which
obtain financial support from the Science and Technology Ministry of the Russian Federation (Reg. No.
00-03-16).
References
Ahundova-Tuaeva, L.M. 1958. Lepidoptera harmful for field-protecting forest plantations in Azerbaijan.
— Uchenie zapiski Azerbaijanskogo Universiteta, Biol. Ser. 1: 51-59 [russ.].
Budashkin, Yu. I. 1987. Cheshuyekrylye, soobshcheniye 3. [Lepidoptera, communication 3]. — /n: Flora
i Fauna Zapovednikov SSSR. Cheshuyekrylyye Karadagskogo Zapovednika (Operativno-
informatsionnyi material). - Moscow. P. 32-62. [russ.].
Erschoff, N. & Field, A., 1870. Catalogus Lepidopterorum imperii Rossici. — Trudy russ. ent. Obshch. 4:
130-204. [russ.].
220 Lvovsky: Oecophoridae of Russia and adjacent countries
Hodges, R. W. 1999. The Gelechioidea. Jn: Kristensen, N. P. (ed.), Lepidoptera, moths and butterflies,
Vol. 1: Evolution, systematics, and biogeography. — Handbook of Zoology 4 (35). — Berlin, W. de
Gruyter. P. 131-158.
Ivinskis, P. 1993. Check-list of Lithuanian Lepidoptera. — Ekologijos Institutas, Vilnius. 210 pp.
Jürivete, U., Kaitila, J., Kesküla, T., Nupponen, K., Viidalepp, J. & Ounap, E. 2000. Estonian Lepidoptera
Selena — Tallinn 151 pp.
Kozhantshikov, I. V. 1955. Gelechiidae. Jn: NEE A. (ed.), Vrediteli lesa [The pests of forest}
1. — Moscow-Leningrad, USSR Academy of Sciences. P. 146-155. [russ.].
Kuznetzov, V. I. & Stekolnikov, A. A. 2001. New approaches to the system of Lepidoptera of the world
fauna. — St. Petersburg, Nauka, 463 pp. [russ.].
Leraut, P. J. A. 1997. Liste systématique et synonymique des Lépidoptères de France, Belgique et Corse
(deuxieme Edition). — Paris. 526 pp.
Lvovsky, A. L. 1981. Oecophoridae. In: Medvedev, G. S. (ed.), Opredelitel nasekomykh evropeyskoi
chasti SSSR [Key to the insects of the European part of the USSR] 4 (2). — Leningrad, Nauka. P.
560-638. [russ. ].
L’vovskii (Lvovsky), A. L. 1990. Oecophoridae. In: Medvedev, G. S. (ed.), Key to the insects of the
European Part of the USSR 4 (2). — Leiden & Cologne, E. J. Brill. P. 747-852.
Lvovsky, A. L. 1996a. The diversity of the Oecophoridae fauna in the boreal and temperate zones of
Eurasia (Lepidoptera). — Acta Zool. Fennica 200: 3-8.
Lvovsky, A. L. 1996b. Chimabachidae. /n: Karsholt, O. & Razowski, J. (eds.), The Lepidoptera of Europe.—
Apollo Books, Stenstrup. P. 78.
Lvovsky, A. L. 1999. Oecophoridae. Jn: Ler, P. A. (ed.), Opredelitel nasekomykh Dal’nego Vostoka
Rossii [Key to the insects of Russian Far East], Trichoptera and Lepidoptera 5 (2). — Vladivostok,
Dalnauka, P. 43-57. [russ.].
Lvovsky, A. L. & Kozlov, M. V. 1983. On the fauna of broad-winged moths (Lepidoptera, Oecophouicez)
of Kirgiz SSR. — Entomol. Issledovania v Kirgizii 16: 11-14. [russ.].
Lvovsky, A. L. & Sachkov, S. A. 1994 (1996). Callima gerasimovi (Lvsk.) (Lepidoptera, Oecophoridae)
— new species for Europe from Zhigulevsk reservation. — Bull. Samarskaya Luka 5: 199-203. [russ.].
Lvovsky, A. L. & Sherniyazova, R. M., 1992. On the fauna of broad-winged moths (Lepidoptera,
Oecophoridae) of Tajikistan. — Teese Alen. Nauk Respubliki Tajikistan, ser. Biol. 2 (126): 3-7.
[russ. ].
Merzheevskaya, O. I., Litvinova, A. N. & Molchanova, R. V. 1976. Cheshuyekrylyye (Lepidoptera)
Byelorussii. Katalog. [The Lepidoptera of Byelorussia. Catalogue]. — Minsk, Nauka i tekhnika. 132
pp. [russ.].
Savenkov, N. V. 1988. New and rare Lepidoptera species of the fauna of Latvia. — Latvijas entomologs
31: 64-68. ‘[russ. ].
Savenkov, N. V., Sulcs, I., Kerppola, S. & Huldén, L. 1996. Checklist of Latvian Lepidoptera — Latvijas
Taurinu Katalogs. — Baptria 21 (3a): 1-71.
Sovyns’kiy, V. V. 1938. Moli (Lepidoptera: Tineidae, s. lat.) tsentralnoyi chastyny Kyivs’koyi oblasti.
[Moths (Lepidoptera: Tineidae, s. lat.) of the Kiev oblast’ central part]. — Zbirnyk Prats’ Zoomuzeyu
(Kyiv) 21-22: 3-95. [ukrain.].
Nota lepid. 25 (4), published 2003: 221-225 221
A new species of Ceratoxanthis Razowski, and distribution
records for two species of Aethes Billberg from the Balkan
Peninsula (Tortricidae: Cochylini)
GUSTAV ELSNER* & JOSEF JAROS**
* Hülkova 304, CZ-197 00 Praha 9 — Kbely, Czech Republic; e-mail:
[email protected]
** Institute of Entomology, Czech Academy of Sciences, Brani$ovskä 31, CZ-370 05 Ceské
Budéjovice, Czech Republic; e-mail:
[email protected]
Summary. Ceratoxanthis adriatica sp. n., a new species of Cochylini (Lepidoptera, Tortricidae) is de-
scribed from southern Yugoslavia (Montenegro). A key to all known species of the genus Ceratoxanthis
Razowski 1960, based on the male genitalia, is provided. Aethes caucasica (Amsel, 1959) is recorded
from Bulgaria for the first time. Aethes margaritifera Falkovitsh, 1963 is recorded from Bulgaria and
from the Balkan Peninsula for the first time.
Key words. Tortricidae, Cochylini, Ceratoxanthis adriatica sp. n., Aethes, new records, Yugoslavia,
Montenegro, Bulgaria.
Introduction
The Cochylini of the Balkan Peninsula have been comparatively well documented in
the last revision devoted to Cochylini of the Palaearctic Region (Razowski 1970). The
most comprehensive publication dealing with Cochylini of this Peninsula was devoted
to species of Bulgaria (Slivov 1973).
This paper presents the description of Ceratoxanthis adriatica sp. n. from Yugosla-
via (Montenegro) and two new distribution records of Cochylini from Bulgaria, which
are interesting from the zoogeographical point of view.
Ceratoxanthis adriatica sp. n.
Material examined. Holotype d : ”’ Yugoslavia mer., Buljarica, 13.7.1985, G. Elsner lgt.” Deposited in
the collection of the National Museum Praha (NMPC).
Description. Adult (Fig. 1). Wingspan 20 mm. Antenna brown. Labial palpus
approximately twice as long as the diameter of the eye, pale yellow with a brownish
hue. Frons and vertex concolorous with palpus. Thorax and tegula pale yellow. Forewing
ground colour pale yellow; basal half of costa edged with ferruginous-brown; mark-
ings consist of dark ferruginous-brown metallic erect scales; basal and sub-basal fas-
ciae obsolete; median fascia represented by conspicuous elongate subdorsal patch; a
conspicuous streak from above tornus inward-oblique to middle, inflexed outwards,
terminating on upper margin of cell; cilia pale yellow with brown admixture, more
strongly suffused with brown on tornus, with a weak ferruginous sub-basal line.
Hindwing pale greyish-brown, cilia whitish yellow with pale brown sub-basal line.
Male genitalia (Figs 2, 3). Tegumen short and broad. Socius moderately
sclerotised, sub-triangular, with the ventral margin slightly emarginated. Transtilla
strongly sclerotised, broad and convex, without spines. Valva very broad; process situ-
© Nota lepidopterologica, 16.06.2003, ISSN 0342-7536
222 ELSNER & Jaros: Cochylini from the Balkan Peninsula (Tortricidae:)
Fig. 1. Ceratoxanthis adriatica sp. n., 3, holotype.
“eg re 4 . | me
CZ Dass
BB
a 7, Uys Ca 7
DE My 72 7
Fig. 2. Male genitalia of Ceratoxanthis adriatica sp. n., holotype, ventral view. Fig. 3. Ceratoxanthis
adriatica sp. n., a caudal view at the aedeagus-juxta complex i in detail (natural position).
ated below base of costa of the valva broad basally with strong, hook-like termination,
armed with strong spines. Caulis large, extending laterally along aedeagus. Lateral
processes of juxta, connected with caulis and base of sacculus, relatively short with a
Nota lepid. 25 (4), published 2003: 221-225 223
cluster of ca. 15 long hairs distally. Aedeagus long and narrow with extremely broad
bilobate coecum penis, one minute cornutus present.
Female genitalia. Unknown.
Biology. Unknown. The holotype was collected at UV light (fluorescent tube 320—
480 nm), in ‘steppe’ habitat on dry slopes near the Adriatic Sea at an altitude of 500 m.
Distribution. Known only from the type locality: SW Yugoslavia —
Montenegro.
Etymology. The new species is named after the position of the type locality on
Adriatic coast.
Differential diagnosis. The genus Ceratoxanthis Razowski, 1960 is related
and externally similar to the genera Agapeta Hübner, 1822 and Fulvoclysia Obraztsov,
1943, but may be safely distinguished from both, by its male genitalia (cf. Razowski
1968, 1987). C. adriatica is externally similar to some forms of Agapeta hamana
(Linnaeus, 1758) with reduced markings in the costal area, but differs conspicuously
by an elongate subdorsal patch, which in A. hamana is usually oval. The most closely
related species C. externana (Eversmann, 1844) differs from C. adriatica by its nearly
complete transverse fascia extended from costa to tornus and oval subdorsal spot. C.
externana differs from C. adriatica also by its smaller size. Due to the remarkable
differences in the male genitalia, C. adriatica may be safely distinguished from all
four previously known Ceratoxanthis species. C. adriatica seems to be most closely
related to C. externana (figured in Razowski 1968: 79, fig. 2, 1970: pl. 65, fig. 142,
1987: 225, figs 115-119) by the shape of the transtilla and moderately short lateral
process of the juxta which considerably differ from those of C. argentomixtana
(Staudinger, 1870), C. iberica Baixeras, 1992 and Ceratoxanthis rakosyella Wieser &
Huemer, [2000]. The more typical features of the male genitalia of C. adriatica are the
cluster of long hairs on the distal part of the lateral process of the juxta and extremely
broad coecum penis. C. adriatica also differs considerably from C. externana by the
shape of the process situated below the base of the costa of the valva. In C. adriatica
this process has a relatively long and narrow hook-like termination and is armed with
strong and very short spines, while in C. externana this process is more or less ovate
and is armed with considerably narrower and longer spines.
A key to species of the genus Ceratoxanthis based on the male genitalia:
1 Lateral process of juxta approximately equally long as aedeagus "4%. 2
DT ral process Of juxta conspicuously longer than aedeagus ste 3
2 Lateral process of juxta provided with a row of spines terminally, aedeagus with coecum
MITES TREES ue f Ne MESSE PRENONS RAR AURA RER CON PSE PR SE PART externana
- Lateral process of juxta provided with a cluster of long hairs terminally, aedeagus with
a Senn a TIA as fe A da ase vs ck sntstssd us'vui banat vps Buvepa van ds laeput sbbosvupaseadeesh dade anauvseens adriatica
3 Lateral process of juxta more than twice as long as aedeagus .....uuuerssnnssnnnesnnnnesnnnnennnnennnnn rakosyella
- Lateral process of juxta approximately 1.5 times longer than aedeagus ............:cccccesscessseeseeeereeeseens 4
4 Lateral process of juxta provided with a long row of spines extended from basal to
Gau a ns SoA cdl fash ERROR SEEN ERRERERUHRANERTT donk debts Adebbloatidchd BENTEOBESRVTFATIEEN > SPRRRY argentomixtana
- Lateral process of juxta provided with a row of spines on terminal part only iberica
224 ELSNER & Jaros: Cochylini from the Balkan Peninsula (Tortricidae:)
Comments. The new species is known only from the holotype. There are 5 species
of Ceratoxanthis known to date. The distribution of the genus Ceratoxanthis com-
prises a few isolated localities reaching from SW Europe to Asia Minor and Central
Asia. Until recent years only two species of this genus were known (Razowski 1970):
C. externana which is distributed from south-eastern part of European Russia to cen-
tral Kazakhstan and Azerbaijan and C. argentomixtana which is distributed from south-
eastern part of European Russia to West Kazakhstan and North Syria. Surprisingly, C.
iberica was recently described from Spain (Baixeras, 1992), now a further new spe-
cies Ceratoxanthis rakosyella has been described from Romania (Wieser & Huemer,
[2000]). The fifth species, C. adriatica is known only from one locality on the Yugo-
slavian Adriatic coast. Although C. externana and C. argentomixtana are distributed
over a relatively large area, the other three species of the genus Ceratoxanthis are
known only from three isolated western localities. The biology of the representatives
of the genus Ceratoxanthis remains poorly known. The immature stages and larval
host plants are unknown. The adults occasionally come to light. C. externana is the
only species whose female is known (Razowski, 1968, 1970).
Aethes caucasica (Amsel, 1959)
Material examined. 24, Bulgaria mer., Kresna, 13.v.1975, K. Cerny lgt., G. Elsner coll.
Comments. A. caucasica is known from the Caucasus (Georgia: Tbilisi), south-
ern Ural Region (Orenburg), northern Italy (Trentino) (Razowski 1970) and central
Romania (Transylvania) (Kovacz & Kovacz 1996). Kovacz & Kovacz (1996) described
the female genitalia for the first time. The species is associated with ‘pseudo-steppe’
habitats on dry slopes at lower elevations up to 400 m. Bulgarian specimens were
collected in typical warm and dry sub-mediterranean habitat of Kresna Gorge of the
Struma River valley (SW Bulgaria). This is the first record from Bulgaria.
Aethes margaritifera Falkovitsh, 1963
Material examined. 2, Bulgaria mer., Kresna, 31.v.1984, J. Jaros lgt. et coll.
Comments. A. margaritifera is known from the south-eastern part of European
Russia (Uralsk, Krasnoarmiejsk, Orenburg), Central Asia and Armenia (Razowski 1970)
and has been recorded also from NE Turkey (F. Groenen, pers. comm. and identifica-
tion of his specimens by J. Jaroë). A. margaritifera is externally similar to A.
margaritana (Haworth, [1811]) but differs from it by a slender subterminal deep ochre-
ous streak extending to termen in contrast to 4. margaritana which has a continuous or
interrupted area of clear silver-white ground colour between the subterminal streak
and termen. These two species may be easily separated on genitalia characters (see
Razowski 1970). The Bulgarian specimen was collected in the warm and dry sub-
mediterranean habitat of Kresna Gorge of the Struma River valley (SW Bulgaria),
where A. margaritifera reaches the most north-western part of its range. This is the
first record from Bulgaria and the Balkan Peninsula. |
Nota lepid. 25 (4), published 2003: 221-225 225
Acknowledgements
We thank to Dr. Joaquin Baixeras and Dr. Peter Huemer for valuable information and helpful discus-
sions. We are also grateful to Dr. Ing. Karel Cerny, who provided the material of Microlepidoptera from
his Bulgaria expedition. Our cordial thanks are due to Mr. Robert J. Heckford for his linguistic help and
valuable comments on the manuscript. The study was partially supported by the Grant of the Czech
Academy of Sciences S 5007015.
References
Baixeras, J. 1992. A new species of Ceratoxanthis Razowski from Spain (Lepidoptera, Tortricidae). —
Nota lepid. 14: 294-296.
Koväcz, Z. & S. Kovacz 1996: The occurrence of Aethes caucasica (Amsel, 1959) (Lepidoptera:
Tortricidae: Cochylini) in Transylvania (Romania). — Folia entomol. hung. 57: 85-89.
Razowski, J. 1968. Revision of the generic group Agapeta Hiibner (Lepidoptera, Cochylidae). — Acta
zool. cracov. 13: 73-102.
Razowski, J. 1970. Cochylidae. /n: Amsel, H. G., Gregor F. & H. Reisser (eds.), Microlepidoptera
Palaearctica. — Verlag Georg Fromme & Co., Wien. 3: i-xiv, 528 pp., 161 pls.
Razowski, J. 1987. The genera of Tortricidae, I: Palaearctic Chlidanotinae and Tortricinae. — Acta zool.
cracov. 30: 141-355.
Slivov, A. 1973. List of species and distribution of moths of the family Cochylidae in Bulgaria. — Izv.
Zool. Inst. Muz., Sofia. 38: 79-104 (In Bulgarian).
Wieser, C. & P. Huemer [2000]. Ceratoxanthis rakosyella sp. n., eine bemerkenswerte neue
Schmetterlingsart aus Rumänien (Lepidoptera, Tortricidae). — Entomol. rom. 4 (1999): 5-9.
226
Book review
Book Review
Rotschke, H. & K. Huber (eds.) 2002. The Noctuids (Noctuidae) of Central Europe. An
Interactive Identification Guide on CD-ROM. ISBN 3-9805958-5-1. Price: 99 EURO. Orders:
V.LM. Verlag für interaktive Medien GbR, Orchideenweg 12, D-76571 Gaggenau, Germany.
e-mail:
[email protected]. http://www.vim.de
“The Noctuids (Noctuidae) of Central Europe” is the first CD in the interactive series “The Moths and
the Butterflies of the World”. It is a part of the “World Species Database, Professional Identification
Series”. When asked to review this software I was, initially, a little bit sceptical about its value, but
several hours later I found myself still siting at the computer, enjoying this marvellous product and
saying to myself “What a wonderful program, I must have it!” The guide covers Denmark, Germany,
Belgium, The Netherlands, Luxembourg, Switzerland, Liechtenstein, Austria, northern Italy (Italian Alps),
Hungary, Slovakia, Czech Republic and Poland. The latest version of the CD contains more than 1300
pictures of 740 species. Species are shown on several plates, and the underside of many are also illus-
trated. Details of wings pattern are provided. For difficult to identify, closely related species, detailed
information for separation is included, for example figures of genitalia. Technical terms used are ex-
plained by figures in the Introduction. Some comments concerning recent taxonomic changes are given
when necessary. Nomenclature follows different authors: Nowacki & Fibiger in: Karsholt & Razowski,
1996, Forster & Wohlfahrt, 1971, Koch, 1984, Ebert, 1994, 1997, 1998, Heath & Emmet, 1979, 1983
and the reader can choose which system to use. Readers can arrange plates according to the system they
prefer and can also arrange their own plates. Moths figures can be displayed on screen all the same size
or of relative natural size. Each species can be maximized on a full screen or displayed together with
similar species. Many species are illustrated alive, in natural positions; where such illustrations are
present they are marked on the species sheets. Each specimen has its own data label, which is hidden, but
also can be easily displayed. Filters allow species lists to be arranged in accordance with the different
classifications, alphabetically by genera or by specific names, by countries, by size and by seasons. For
example, if you choose as a country Denmark, and as a season December-January, the nine noctuids
known in this season from this country will be displayed automatically. Quick reference can be made to
all the species inhabiting each of the countries included. It is also possible to view by country or for the
entire Central European area, species 1.5 cm in size or below, etc. This, together with selection of wing
or body shape, pattern and colour of the wings allows for quick and smooth species determination as the
possible species are displayed. Species sheets include current scientific name with author and year of the
description, figure(s) of the insects with size in mm and variations (the illustration of Xylomoia strix
Mikkola, 1980 is missing), locality labels, synonyms and their source (for Central Europe only, mostly
from the monographs quoted above), vernacular names, information for similar species, taxonomic com-
ments, distribution by countries and distribution map, showing occurrence in the whole of Europe, not
only in Central Europe and additional data when necessary: key characters, genitalia etc. One small
drawback is that distribution is shown by whole country, so that the entire of a country where a species
occurs is shaded. This does not, therefore, always give detailed information on the real distribution. In
addition, a puzzle, a mind game and an identification quiz with different levels are provided for fun,
testing knowledge and for relaxing in enjoyable way. The CD-ROM contains 507 MB and it is offered in
a hard A5-sized box with instructions. Copies are available in English and German. To use this software,
which is based on HTML technology, you need at least 64 MB RAM. It is best viewed with MS Internet
Explorer version 5 or above. As software this program is extremely well composed and it is a real
pleasure to use. All illustrated specimens are of top quality and all the photographs are excellent, so each
species can be seen in details in real vivid colours on full screen. This product is strongly recommended
to everyone, amateur or professional, interested in moths and particularly in Noctuidae. It will be useful
to naturalists, students and teachers, and will be of help in educational programs by initiating in young
people an interest in the wonderful world of moths.
STOYAN BESHKOV
Nota lepid. 25 (4), published 2003: 227-233 227
Re-capture of Sinobirma malaiseiin China: description of the
female genitalia and comments on the systematic position of the
genus in the tribe Urotini (Saturniidae)
RODOLPHE ROUGERIE
Muséum national d’Histoire naturelle (Entomologie), 45 rue de Buffon, F-75005 Paris, France. e-mail:
Muséum d’Histoire naturelle de Toulouse, 27 rue Bernard Délicieux, Site Sang du Serp, F-31200
Toulouse, France.
Summary. The recent re-capture in China of the enigmatic Sinobirma malaisei (Bryk, 1944), the only
Asian member of the otherwise wholly African tribe Urotini of the subfamily Saturniinae, is recorded. A
few previously uncertain characters of the external habitus are verified and the female genitalia are
described and illustrated for the first time. The systematic position of S. malaisei is discussed and a
possible close relationship with the Madagascan species Maltagorea auricolor (Mabille, 1879) is proposed.
Résumé. L’espèce énigmatique Sinobirma malaisei (Bryk, 1944) a été re-capturée en Chine; elle est la
seule représentante en Asie de la tribu des Urotini dont tous les autres membres vivent.en Afrique ou a
Madagascar. Quelques caractères incertains de l’habitus sont précisés et l’armature génitale femelle est
décrite et illustrée pour la premiere fois. La position systématique de S. malaisei est discutée et une
relation de parente étroite avec l’espece malgache Maltagorea auricolor (Mabille, 1879) est proposée.
Key words. Saturniidae, Urotini, China, Sinobirma malaisei, relict, eastern Gondwana fragmentation.
Introduction
Sinobirma malaisei (Bryk, 1944), the sole known species of the genus Sinobirma Bryk,
1944, was discovered in 1934 by René Malaise in mountains on the border between
north-eastern Burma and the Yunnan Province of China. Since the original few speci-
mens of both sexes taken by Malaise, only a single male is known to have been col-
lected in 1998 in northern Burma by a Russian collector (S. Naumann, pers. comm.).
Because so few specimens of this species are available for study, and because of its
extraordinary taxonomic and biogeographical significance (Nassig & Oberprieler 1994),
the author initiated an expedition to China in 2001 to try and recollect it. An account of
this successful venture is presented here, together with the description of the previ-
ously unrecorded female genitalia of S. malaisei and some comments on the analysis
of its taxonomic position and relationships by Nässig & Oberprieler (1994).
Sinobirma was described as a subgenus of the Australian and New Guinean genus
Opodiphthera Wallengren, 1858, a member of the tribe Saturniini in the Saturniinae.
Nässig & Oberprieler (1994) raised Sinobirma to generic status and demonstrated its
belonging to the Afro-Madagascan tribe Urotini (= Pseudapheliini sensu Bouvier 1928,
see Oberprieler 1997 for details about the tribal name and its full synonymy). From an
examination of the wing pattern, antennae and male genitalia, these authors concluded
that, within Urotini, Sinobirma is closely related to a group of three genera, namely
Tagoropsis Felder, 1874, Pseudantheraea Weymer, 1892 (both from continental Af-
rica) and Maltagorea Bouyer, 1993 (from Madagascar).
© Nota lepidopterologica, 16.06.2003, ISSN 0342-7536
228 ROUGERIE: Sinobirma malaisei in China
A possible closer relationship between Sinobirma and Maltagorea led them to hypoth-
esise that S. malaisei may be “the relict (or offspring) of a formerly eastern Gondwanan
- species that lived in India and Madagascar during the late Cretaceous and then trav-
elled north on the ‘Arc India’ to Asia” and that “it does seem very likely [...] that
Sinobirma is some kind of ‘living fossil’ of considerable age”.
Re-capture of Sinobirma malaisei
The capture of Sinobirma malaisei was one of the major aims of a collecting trip in
south-western China which took place between 3 June and 9 July, in accordance with the
dates of Malaise’s expedition and the original captures of S. malaisei (9 and 17 June
1934). The collecting site was chosen as close as possible to the type locality of the
species, which was given by Bryk (1944) as ‘China, Yunnan Province, Kambaiti, 2000 m
a.s.l.’ It is situated in the Tongbinguan nature reserve, less than two kilometres from the
Burmese border and about 70 km south of Malaise’s locality, in the same mountain
massif, at 2080 m a.s.l. (GPS co-ordinates: 24°49'N 97°44'E). The vegetation consisted
of low and medium-sized trees, including numerous flowering Castanopsis (Fagaceae),
and small cleared zones with grass and ferns. The vegetation composition of this region
appeared very singular to us, and we have never seen similar forests elsewhere in Yunnan
province. At the site, we operated a single 125 W mercury-vapour lamp powered by a
small generator and placed in front of a vertical white sheet facing the forest. During the
nights of 12 and 13 June we collected, among numerous other Lepidoptera, seven males
and four females of S. malaisei (Figs. 1-2). Their flight times were remarkably constant,
the females arriving at the sheet at about 21:00 and the males between 23:30 and 00:00
local time. Like many other saturniids, S. malaisei arrived at the light in an erratic fash-
ion, fluttering around on the ground before settling on the sheet or surrounding shrubs.
This rediscovery of S. malaisei, almost 70 years after René Malaise took the first speci-
mens, proves that the species is still present and relatively abundant in this border zone
mountain massif. The recent capture of a single male in northern Burma (at Nan Thi, 50
km east of Putao, GPS co-ordinates: 27°27'N 97°55'E, 950 m, 11-16 May 1998) by a
Russian collector indicates that S. malaisei also occurs further north and probably has a
wider distribution in this region.
Figs. 1-2. Female (1) and male (2) of Sinobirma malaisei.
Morphology
The habitus of Sinobirma malaisei (Nassig & Oberprieler 1994: 373, Figs. 2-3, and
Figs. 1-2 in this paper) was redescribed by Nässig & Oberprieler (1994), who also
described and illustrated its male genitalia for the first time, adding some new and
important information about its relationships and systematic position. The redescription
by Nassig & Oberprieler (1994) differs from Bryk’s (1944) original account in a few
features, assumed to be due to fading of the specimens. Our fresh armen allow
clarification of these aspects, as follows:
- the antennae are indeed rusty brown, as described by Bryk, not yellowish brown as observed by
Nässig & Oberprieler on Bryk’s specimens 50 years later;
- similarly, the anterior part of the head and the legs are purplish brown, as described by Bryk;
- the black borderline of the patagia mentioned by Bryk, but invisible on some specimens available to
Nässig & Oberprieler, is clearly present on fresh specimens of both sexes (Figs. 1-2);
- the distal area of the female forewings, beyond the postmedial line, is clearly covered with reddish
scales (Fig. 1) in all four female specimens collected, as is the case in the female holotype specimen
illustrated by Nässig & Oberprieler (1994).
Nässig & Oberprieler (1994) did not study an important character, the number of
segments of the labial palpus, so as to avoid destruction of the head of one of the few
specimens known at the time. The head of a damaged male of the newly collected
specimens was partially dissected, revealing that the labial palpus consists of two
ventrally partially fused segments (Fig. 3).
With regard to the male genitalia (Nässig & Oberprieler 1994: 376, Figs. 10a-c),
one of the most important characters is the presence of a pair of postero-medial proc-
esses on the eighth abdominal sternum. Nässig & Oberprieler also described a strongly
sclerotised structure — guiding the phallus dorsally — and interpreted this as “probably”
representing a transtilla. Closer examination of this structure showed it to be con-
nected not only to the proximal part of the costae of the valves — what is consistent
with the ‘transtilla’ as defined in Klots (1970) and Scoble (1992) — but also to the
lateral arms of the gnathos, arising from the uncus at a ventral position. This transverse
sclerite is also present in other Saturniidae and its identity has been the subject of
several discussions (Michener 1952, Lemaire 1978, Balcazar-Lara & Wolfe 1997). I
interpret this part as a fusion of the transtilla and the gnathos. Another character of the
male genitalia of S. malaisei, not noticed by previous authors, is that the posterior tip
of the aedeagus opens toward the left side of the moth (Fig. 4), whereas this opening is
apical or oriented to the right in most of the other related Saturniidae (Table 1). Such
variations were already documented in sphingids by Kitching (2002), and were attrib-
uted to a twisting of the aedeagus (clockwise or counter clockwise) assessed by the
observation of internal structures. The hypothesis of a similar twisting of the aedeagus
in some saturniid moths would be premature but is an interesting candidate to explain
our observations; further anatomical studies are necessary to assess the origin of the
variations in the orientation of the distal opening of the aedeagus.
The genitalia of one of the collected females of Sinobirma malaisei were dissected;
they are described and illustrated here for the first time (Figs. 5-8). The ovipositor is
230
ROUGERIE: Sinobirma malaisei in China
formed by a pair of fleshy papillae anales with numerous setae; the posterior apophy-
ses, attached to the anterior edges of the papillae anales, are about one quarter longer
than the anterior apophyses (Fig. 7). Ventrally, between the papillae anales, the mem-
branous zone is weakly sclerotised and shows some marked longitudinal folds (Fig.
5). The vaginal plate (‘sterigma’) is composed of two, clearly distinct, ventral parts
(Figs. 5-6): a strongly sclerotised anterior part contiguous with tergum A8 (forming a
complete ring with it), and a large sclerotised posterior part with an important poste-
rior thickening. The latter, usually called “lamella postvaginalis”, is clearly distinct
from, though very close to the posterior edge of the anterior part of the sterigma. The
ostium bursae is large and lies on the anterior part of the sterigma. Tergum A8 is di-
vided by a membranous zone which is enlarged anteriorly (Fig. 8). The ductus bursae
is short, weakly sclerotised dorsally; the corpus bursae is small, with numerous wrin-
kles on its surface and without signum. The ductus seminalis enters on dorso-lateral
right side of the posterior part of the corpus bursae. The spermatheca (Fig. 7) is large,
nearly as long as the whole genitalia; the internal and external canals are short and
very thin, converging towards a thick and long receptacular canal that separates into an
Figs. 3-8. — 3 — Left labial palpus in lateral view (anterior at left) of male S. malaisei. 4 — Aedeagus in
ventral view. 5, 6 — Female genitalia in ventral and lateral view. 7 — Spermatheca. 8 — Tergum A8. Scale
bar: 0.5 mm (Fig. 3), 1 mm (Figs. 4 to 8).
Nota lepid. 25 (4), published 2003: 227-233 23
ellipsoid lagena and a long utriculus which is slightly thickened for a length approxi-
mately equal to that of lagena.
Systematics
For comparative purposes, the material examined for this study is listed in Table 1
together with the conditions of the characters described below. Nässig & Oberprieler
(1994) uncovered Bryk’s error of placing Sinobirma malaisei in the Australian and
New Guinean saturniine genus Opodiphthera, and demonstrated its surprisingly close
relationship with the Afro-Madagascar Tagoropsis group of genera (Bouyer 1993) of
Urotini, based on characters of the male (bipectinate) antennae, general wing pattern,
and male genitalia. In particular, they pointed out that Sinobirma and Pseudantheraea
share a similar general habitus, with eyespots present on the hindwings (a plesiomorphic
character in the Saturniinae), and that Sinobirma and some species of the genus
Maltagorea share an unusual character: the presence of a pair of posterior processes
on the eighth sternum in the male (possibly indicating a sister-group relationship but
then leaving Maltagorea as paraphyletic, Tablel). Oberprieler (1997) later showed
that this character also occurs in other genera of Urotini and even in Eochroa Felder,
1874, currently included in the tribe Bunaeini but of uncertain placement.
The present study of the female genitalia and mouthparts of S. malaisei reveals
further characters of possible taxonomic significance. First, S. malaisei has a two-
segmented labial palpus like Tagoropsis and unlike Maltagorea (three segments) or
Pseudantheraea (one segment); however, as already pointed out by Nässig &
Oberprieler (1994), this character is of poor phylogenetic value and very likely to be
homoplastic, as reductions in the number of labial palpus segments occur widely in
Saturniidae. Second, S. malaisei and Maltagorea auricolor (Mabille, 1879) share a
number of characters:
(1) the membranous interruption of female tergum A8 (Fig. 8), whereas it is continuous in all other
species of the group (Table 1);
(2) the conformation of the posterior lobes of male sternum A8; these lobes are weakly sclerotised and
directed toward the posterior end of the body, whereas (when present) they are shorter, strongly
sclerotised and directed toward the interior of the body in the other species of the genus Maltagorea
(Table 1);
(3) the presumed fusion of gnathos and transtilla;
(4) the distal opening of the aedeagus (Fig. 4) is oriented to the left (Table 1).
Within the Tagoropsis group, these four shared character states are unique to Sinobirma
malaisei and Maltagorea auricolor, suggesting a probable sister-group relationship be-
tween these two taxa. The evolution of characters (3) and (4) must be considered cau-
tiously and further research is needed within the subfamily to evaluate their phylogenetic
significance. The isolated taxonomic position of M. auricolor among the Madagascan
Urotini was already pointed out by Griveaud (1962) and again by Bouyer (1993) who
suggested a possible relationship between M. auricolor and Pseudantheraea, but he was
then unaware of the affınities of Sinobirma to this group of genera. A close relationship
between M. auricolor and S. malaisei had not been proposed before.
232 ROUGERIE: Sinobirma malaisei in China
Table 1. Material examined and character distribution within the Tagoropsis group of genera. n — number
of preparations (m — males, f— females). ad — aedeagus (its opening can be apical (ap), oriented toward
the left (1) or the right (r) side of the moth). st.8 — male sternum A8 (x — posterior lobes absent, w —
posterior lobes weakly sclerotized and directed toward the posterior end of the body, s — posterior lobes
strongly sclerotized and directed toward the interior of the body, t — reduced tubercle-shaped posterior
lobes). t8 — female tergum A8 (i — interrupted medially, c — continuous). — Ip = number of segments of
the labial palpus. :
[Genus 277 Kc UliSpecies 0 SE ES Ee ee SET
nie meat |
Sinobirma malaisei (Bryk, 1944) Ww 2
FT 4 7 7 Nfankarama (Vieite, 1954) ee
| auricolor Mabille, 1879 7] 6 |" 1 | a
re Crees ee a Pee = aa
| dentate (Griveand, 1962) | | = | En
[| dura (Keferstein, 1870) 3 | | eee
I 1] fsieolor (Mabille, 1879) 2 eee
(ee I TR eee RUE)
|__| monsarrati (Griveaud, 1968) | MON ER EEE
020 |rostaingi (Griveaud,1962) | 8 | 1 | CORRE
| |mabriflava (Griveand, 190) | 2 | 71 Ps
BEIDE eee
aa CAE) ee En | ee ae]
GC 19 | > |
Separator Roupeot 1962 Er | ER
Re ER ER
nn CRE 7
fe on |atalensis (Relder 1872), Weeze
Conclusions
The re-capture of Sinobirma malaisei in China confirms that this enigmatic species
still exists in the mountain massif on the border between Burma and the Chinese prov-
ince of Yunnan, and apparently in a sizeable population. It also enabled the first study
of the female genitalia of this species and now allows a more detailed comparison with
other members of the Tagoropsis group of Urotini. Such a study and a phylogenetic
_ analysis of the group, using both morphological and molecular data, are currently in
progress (Rougerie, in preparation) and intend to clarify the relationships and taxo-
nomic position of this extraordinary species, as well as the presumed paraphyly of
Maltagorea.
As already pointed out by Nässig & Oberprieler (1994), the occurrence of this
single species of the otherwise wholly Afrotropical tribe Urotini in south-east Asia has
considerable biogeographical implications. Reconstructing the evolutionary history
and biogeography of S. malaisei is, however, dependent on a rigorous phylogenetic
analysis of its relationships within the Urotini. Nässig & Oberprieler (1994) preferred
a vicariant hypothesis of the ancestor of S. malaisei drifting to Asia on the Indian
subplate after the cretaceous break-up of eastern Gondwana, over a dispersal hypoth-
esis of colonisation by long-distance flight or migration within a formerly more exten-
Nota lepid. 25 (4), published 2003: 227-233 233
sive (forest) habitat. Clarification of whether Sinobirma is most closely related to a
Madagascar member of Urotini (Maltagorea or part of it) or a continental African one
(Pseudantheraea or Tagoropsis) will significantly increase our understanding of the
evolutionary history of not only S. malaisei and the Urotini but also the subfamily
Saturniinae. cs
Acknowledgements
I am very grateful to Thierry Deuve of the Muséum national d’Histoire naturelle (MNHN, Paris) and
Tian Mingyi of the Chinese Agricultural University of Canton for their dedicated support of my ‘quest’
for Sinobirma in China. Joël Minet (MNHN, Paris), Rolf Oberprieler (CSIRO, Canberra, Australia),
Wolfgang Nassig (Senckenberg-Museum, Frankfurt am Main, Germany), Kirby Wolfe (Escondido, Cali-
fornia), and an anonymous reviewer provided valuable comments and corrections to the manuscript. I
also wish to thank Alain Dubois (MNHN, Paris) for his help in obtaining a grant for our expedition. This
paper is publication n° xx of the “Programme Pluriformation: Etude de la faune et de la flore de I’ Asie
du Sud-Est” of the MNHN [previous publication n° 75): David, P., Vogel, G & N. Vidal 2003. On
Trimeresurus fasciatus (Boulenger, 1896) (Serpentes: Crotalidae), with a discussion on its relationships
based on morphological and molecular data. — Raffles Bulletin of Zoology, 51 (1): 155-163].
Literature
Balcazar-Lara, M. & K. L. Wolfe 1997. Cladistics of the Ceratocampinae (Lepidoptera: Saturniidae). —
Tropical Lepid. 8 (Suppl. 2): 1-53.
Bouvier, E.-L. 1928. Observations sur la structure et le classement des Saturniens d’Afrique. — Mém.
Acad. Sci. 59 (4): 1-42.
Bouyer, T. 1993. Maltagorea n. gen., un nouveau genre de Saturniidae malgache (Lepidoptera: Saturniidae,
Saturniinae, Pseudapheliini). — Lambillionea 93: 97-102.
Bryk, F. 1944. Entomological results from the Swedish expedition 1934 to Burma and British India.
Lepidoptera: Saturniidae, Bombycidae, Eupterotidae, Uraniidae, Epiplemidae and Sphingidae. — Ark.
for Zool. 35 (A)8: 1-55.
Griveaud, P. 1962. Insectes, Lépidopteres Eupterotidae et Attacidae. — Faune de Madagascar 14: 1-64,
12 pls.
Kitching, I. J. (2002) The phylogenetic relationships of Morgan’s Sphinx, Xanthopan morganii (Wal-
ker), the tribe Acherontiini, and allied long-tongued hawkmoths (Lepidoptera: Sphingidae,
Sphinginae). — Zool. J. Linn. Soc. 135: 471-527. |
Klots, A. B. 1970. Lepidoptera. Pp. 115-130 in: S.L. Tuxen (ed.), Taxonomist’s glossary of genitalia in
insects. — Munksgaard, Copenhagen.
Lemaire, C. 1978. Les Attacidae Américains: Attacinae. Neuilly-sur-Seine, 238 pp., 49 pls.
Michener, C. D. 1952. The Saturniidae (Lepidoptera) of the western hemisphere: morphology, phylogeny,
and classification. — Bull. Amer. Mus. Nat. Hist. 98: 335-501, 1 pl.
Nässig, W. A. & R. G. Oberprieler 1994. Notes on the systematic position of Sinobirma malaisei (Bryk
1944) and the genera Tagoropsis, Maltagorea, and Pseudantheraea (Lepidoptera, Saturniidae:
Saturniinae, Pseudapheliini). — Nachr. ent. Ver. Apollo, Frankfurt, N. F. 15: 369-382.
Oberprieler, R. G. 1997. Classification of the African Saturniidae (Lepidoptera) — the quest for natural
groups and relationships. - Metamorphosis. J. Lepid. Soc. Afr., Occ. Suppl. 3: 142-155.
Scoble, M. J. 1992. The Lepidoptera: form, function and diversity. - Oxford Univ. Press, Oxford, xi +
404 pp., 4 pls.
234
Book review
Book Review
Ernestino MARAVALHAS (ed.): As borboletas de Portugal [in Portuguese]. viii + 455 pp. Dis-
tributed by Apollo Books, Stenstrup Da 2003. Price: DKK 320.00 (= approx. € 40.00)
plus postage. ISBN 972-9603 1-9-7.
Butterfly books are now available for most regions and countries in the world. They range in
scope from popular picture books designed for nature lovers to scientific monographs of re-
gional faunas. Now a new butterfly book on the fauna of Portugal is on the European market.
Written mostly by E. Maravalhas, contributions come also from a variety of other authors. The
book starts with a series of introductory chapters, e.g. on arthropods in general, on the evolu-
tion, life-cycles, and natural enemies of butterflies, on habitats, conservation or migration, but
also on methods for the study of butterflies (monitoring, mapping, population genetics). These
chapters are useful for readers who are not (yet) familiar with entomology. The main part of
the book are the richly illustrated species accounts (one page per species), separately presented
for the mainland Portuguese fauna and the Macaronesian islands. Twenty-seven colour plates
of set specimens facilitate identification. Various indexes, a references list, a glossary, and
English translations of figure captions complete the book. The full text is also available on the
web http//www.tagis.net for download and translation. A fair rating of the book against the
many other available books on European butterflies requires to consider the particular reader-
ship which the authors aimed to address. For certain, the book will find many readers among
Portuguese nature lovers, and it deserves to be used by all organizations and authorities con-
cerned with nature conservation in that country or in neighbouring Spain. However, the book
will be of only marginal interest to a wider international audience. The use of Portuguese
language does not seem to be a major obstacle, since brief English abstracts are provided to all
chapters (although one might have wished these to be somewhat more extensive and present-
ing more data). The colour plates do not reach the high standards the butterfly community is
now used to, and occasionally very worn specimens are depicted (this does not facilitate safe
identification). While many illustrations in the species accounts are excellent, quite a number
are suspect of showing anaesthetised (if not killed) specimens in “pseudo-natural’ positions.
The maps provide schematic sketches of distributions in Portugal (as opposed to dot maps of
true records). While such schematic maps may still be informative, point or grid maps are
much more valuable for all those who wish to use distributional data for subsequent analyses.
Quite a number of hostplant affiliations seem to be simply perpetuated from earlier literature
without critical re-evaluation, and some are suspect of being wrong. To give but one example,
I am unaware of any populations of the lycaenid butterfly Polyommatus bellargus feeding on
Trifolium species. A number of citations in the text did not lead me to a reference in the biblio-
graphic list. Overall, the book leaves a mixed impression. For butterfly enthusiasts or decision
makers from the Iberian Peninsula this will be a valuable source of information. From a more
international perspective, probably only few lepidopterists with special interest in the Iberian
fauna will find this volume to be of sufficient interest, since there is rather little information to
be gained in comparison to other recent books on European butterflies.
KONRAD FIEDLER
Nota lepid. 25 (4), published 2003: 235-247 235
The subspecific status of Pieris napi (Pieridae) within the
British Isles
ANDREA WILCOCKSON & TIMOTHY G. SHREEVE
School of Biological and Molecular Sciences, Oxford Brookes University, Headington,
Oxford OX3 OBP, UK e-mail:
[email protected]
Summary. Previously, Pieris napi (Linnaeus, 1758) within the British Isles has been divided into differ-
ent subspecies and also separated from mainland European populations on the basis of androconial and
wing morphology variation. Using image analysis we obtained quantitative data on androconial scale
shape measurements and wing morphology characters (size and colour pattern elements) of P napi from
the British Isles and France (wing morphology only) to examine the subspecific status of P napi within
the British Isles. Androconia are variable in shape but this variation is normally distributed. There is no
basis for describing different scale types within the British Isles. Variation within populations in Scot-
land and southern England is greater than between regions and there is no basis for using androconial
measures to describe Scottish specimens as subspecies. Wing size, shape and colouration are variable
within populations and variation in particular characters is not consistent between generations or geo-
graphic regions. Wing morphology is a poor taxonomic tool for describing regional forms. We conclude
that there is no evidence to divide P napi in the British Isles into subspecies or to differentiate populations
in the British Isles from mainland Europe.
Key words. Lepidoptera, Pieridae, taxonomy, biogeography, British Isles, androconia, morphology,
image analysis, Pieris napi.
Introduction
Morphological variation within species can be a response to current selection proc-
esses and/or the result of historic patterns of range changes and past patterns of isola-
tion and divergence. Assessments of the effects of selective processes in different loca-
tions and biogeographic inference require reliable and quantitative estimates of trait
variation at the morphological and/or genetic levels.
The Pieris napi (Linnaeus, 1758) complex has a number of different geographic
forms within its Holarctic distribution (Geiger & Shapiro 1992). Within the Palaearctic,
P. napi and closely related species are widespread. P napi is seasonally and geographi-
cally variable and there is considerable confusion and uncertainty about the taxonomic
status of most geographic forms, including specific and subspecific divisions. Within
the British Isles the nominate species, P napi napi, is described as absent (Emmet
1989) and three subspecies have been named: sabellicae (Stephens, 1827), type local-
ity England, which is described as occurring within southern and northern Britain;
britannica (Miiller & Kautz, 1939), type locality Ireland, in Ireland and Scotland, and
thomsoni (Warren, 1968), type locality Dunblane, in Scotland. Originally the basis for
the separation of sabellicae and britannica from each other and from the nominate
species was on differences of wing shape, colour and pattern expression and, in the
case of thomsoni, on androconial variation. Warren (1961, 1968) originally described
Scottish P napi as having four androconial scale types but Thomson (1970, 1980)
identified two further scale types in Scottish populations and only one in specimens
from southern England. The occurrence of different scale types and a comparison with
© Nota lepidopterologica, 16.06.2003, ISSN 0342-7536
236 WILCOCKSON & SHREEVE: Pieris napi within the British Isles
androconia from other geographic regions led Warren (1968) and Thompson (1980) to
conclude that Scottish populations were more similar to P napi adalwinda (Fruhstorfer,
1909), type locality Finnmark, with a distribution north of 65°N in Fennoscandia. Sub-
sequently Bowden (1983) identified Irish specimens as having androconial scale types
similar to those of thomsoni. |
Described morphological and androconial variation has been used as supporting
evidence for a double invasion of Pieris napi into the British Isles during the Holocene
(Dennis 1977). According to him, early arriving (15,000-13,000 years BP), cold toler-
ant P napi survived the Younger Dryas and spread northward with warming at the
beginning of the Holocene (11,500 years BP to present), but were replaced by P napi
from more southerly locations in southern Britain. It was also suggested that if two
forms exist there has been interbreeding, providing a mosaic of populations in Scot-
land (Dennis 1977; Bowden 1983).
Studies of allozymes from P napi in Scotland and northern England reveal non-
equilibrium in respect to gene flow and genetic drift (Porter & Geiger, 1995). This has
been interpreted as the result of secondary contact between a northern population group
and more recently invading populations, consistent with the hypothesis of Dennis (1977),
or genetic isolation within population sets within northern parts of the British Isles.
The morphological variation which has been used to elevate regional populations
to subspecific status has been on the basis of comparing relatively few individuals
from a species which is known to display within-population variation, some of which
is related to the rate of pupal development (Thompson 1947) and thus temperature.
There has also, in the case of britannica, been an emphasis on the yellow ground
colour revealed by breeding experiments to be the product of more than one recessive
allele also present in other parts of the British Isles (Emmet 1989). Described androconial
variation has either been qualitative or when quantitative, based on visual examination
(Bowden 1983) and not subject to statistical analysis. Using limited qualitative data is
poor taxonomic practice to employ in such a variable species. Here, we use a quantita-
tive analysis of morphological and androconial variation of P. napi to provide a reas-
sessment of its status in the British Isles.
Methods
Androconial measurements. Neither Warren (1968), Thomson (1970,
1980) or Bowden (1983) provided any information about the wing area, which they
removed androconia from (they just stated that these were taken from the upper sur-
face), or used any quantifiable criteria to define ‘scale types’. Assessment of scale
types was based on visual inspection, but from published illustrations the main differ-
ence between types is on the basis of shape, principally scale length and width, espe-
cially midway between the base and apex. Bowden (1983) also stated that some scale
types could occur at low frequency (2-3 %) within any individual. We use a quantita-
tive approach using individuals from eight Scottish and six southern British sampling
locations (Table 1). Preliminary observations confirmed the presence of androconia
over the whole of the fore and hind wing upper surfaces, with more on the forewing.
Nota lepid. 25 (4), published 2003: 235-247 237
Tab. 1. Sampling locations and sample sizes of individuals of Pieris napi used for androconial and wing
morphology measurements
Location Coordinates’ Sampling Androconial Morphology sample
aie Sample (N) ee |,
Scotland Males Females
Spring Loch Aline NM702473 05/1998 10
Breacleit NB155376 05/2001 20 20
Summer Loch Aline NM702473 07/1996 1
Glen Lonan NM938280 07/1996 2
Glen Achulish NN045583 07/1996 2
Barcaldine NM962411 07/1996 2
Sneils NM998577 07/1996 1
Glas Drum NN009461 07/1996 1
Ford NN023788 07/1996 1
Breacleit NB155376 07/1996 1
07/2000 20 20
Southern England
Spring Long Crendon SP6839093 05/2000 5
Shotover SP566058 05/2000 l
Lye Valley SP549060 05/2000 15 13
Summer Shotover SP566058 08/2000 & 4 13 11
2001 2 10 10
Lye Valley SP549060 08/2000 & 1
2001 1
Loosley Row SP816011 07/1996 2
Cothill Fen SU465996 08/1999
Buckfastleigh SX7366 08/1996
Southern France
Summer St. Andeol 44°45’N 06/1999 12 10
05222%E
Gumaine 44°45’N 06/1999 2 I
0SP22°E
Menée 44°45’N 06/1999 9 |
05°22
Bois de Tauligan 44°45’N 06/1999 1]
0522°E
' National Grid Reference for the British Isles; latitude and longitude in France
Using a fine paintbrush, scales were removed from the cell of the upper forewing and
then gently tapped onto a microscope slide. This was done separately for 10 males
from each sampling location. These were then examined using a Zeiss!" bifocal mi-
croscope at 200-fold magnification. Images of the first 100 androconia from each indi-
vidual which were flat were then captured using a digital camera (JVC K Y-F55B)
attached to a frame grabber (Imaging Technology IC-PCI) and stored for subsequent
analysis using OPTIMAS™ (v.6.0) imaging software. Measurements of length, mid-
width and neck width were taken for each androconial scale. From these, three shape
describing variables were calculated; length/mid-width ratio, length/neck-width ratio
and mid-scale/neck-width ratio. In addition, forewing length from the wing base to
apex was also measured using the same camera, framegrabber and software. All meas-
urements were made in calibrated measurements and exported to Statistica version 5.5
(Statsoft 1999) for subsequent analysis. Repeated measures for all variables gave a
238 WILCOCKSON & SHREEVE: Pieris napi within the British Isles
reliability of 95%. Populations and generations were compared using MANOVA
(multivariate analysis of variance) using all androconial scale variables. The test sta-
tistic Wilk’s À (determinant of the within groups variance/covariance matrix over the
determinant of the total variance/covariance matrix) was used to compare between and
within region/generation variation. Wilk’s A scales from 0 (perfect discrimination) to 1
(no discrimination). Regional and seasonal variation is visualised using non-metric
multidimensional scaling of an individual x individual matrix of Spearman rank corre-
lation coefficients produced from values of (neck-width x mid-width)/length for all
androconia measured from single individuals. |
Wing colour and pattern. Digital colour images were captured of both
surfaces of wings removed from adults from first and second generation adults from
Scottish and southern English locations and second generation individuals from French
locations (Table 1). Previous distinctions between different named subspecies have
been on the basıs of the intensity of yellow ground colour and vein colouration (black/
grey/green) of the hindwing lower surface; the intensity and area of basal area
melanisation of forewing and hindwing upper surfaces and wing sizes and shapes of
both sexes (Stephens 1827; Verity 1916; Müller & Kautz 1939; Emmet 1989). Other
distinctions have also been made for individual subspecies, such as the size and colour
of postdiscal spots in female sabellicae. We took quantitative measurements of wing
characteristics (Table 2) that have been described for all named subspecies within the
British Isles. For image analysis, wings were illuminated with a Zeiss™ fibre optic
ring light and captured and processed with the same camera and software used for
androconial measures. All images were calibrated and repeat measures gave a reliabil-
ity of at least 95%. Colour was measured in the red, green and blue planes. Each plane
has a separate luminance value ranging from 0 (none) to 255 (complete saturation).
(Pure black = 0:0:0 and pure white = 255:255:255). For the analysis of ‘white/yellow’
and black in this study, the threshold values of 200-235:200-225:157-195 for white/
yellow and 0-177:0-184:0-129 were applied. Mean luminance values of wing com-
ponents in each of the thresholded bands for each colour were used in subsequent
analyses. Because we randomly sampled from wild populations not all captured speci- —
mens were perfect and intact. Thus measurements of fore- and hindwing dorsal and
ventral surfaces within populations were not all from the same individuals, with approx.
5% being taken from different individuals. As field sampling was random and our
analysis is primarily concerned with between population variation such an approach is
justified. Wing morphology comparisons were made using ANOVA.
Results
Androconial variation. There was no relationship between the mean
values of the three basic androconial measurements of length, neck width and mid-
length width of any individual with wing area for any geographic or seasonal sample
or for all samples (Table 3). Thus, all further analysis is of unscaled measurements.
Within any region or brood, there is no evidence for multimodality in any measure. All
variables are normally distributed (Kolmogorov-Smirnov tests, P>0.2 in all cases) in-
Nota lepid. 25 (4), published 2003: 235-247
259
Tab. 2. The wing morphology characteristics used to quantitatively compare Pieris napi from Scotland,
England and southern France and their use by previous authors to distinguish subspecies.
Wing surface Wing character measured Previous use in describing subspecies
Wing area
Area : perimeter length ratio
Fore and hindwing
Luminance of yellow
colouration
Proportion of wing yellow
Melanisation of veins
Extent of black scales over
veins
Brightness of white background
colour
Melanisation of veins
Extent of black scales over
veins
Melanisation of basal area
Brightness of white background
colour
Melanisation of veins
Extent of black scales over
veins
Melanisation of basal area
Hindwing ventral surface
Forewing dorsal surface
Hindwing dorsal surface
Used by Stephens (1827) to distinguish sabellicae
from napi, the former described as having more
angular wings
Stephens (1827) and Verity (1916) describe sabellicae
as yellower and more melanised than napi. Warren
(1968) and Thomson (1970) describe a greater
frequency of yellow forms in thomsoni than sabellicae
Stephens (1827) and Verity (1916) describe sabellicae
as brighter than napi, with greater and more extensive
melanisation; Miiller & Kautz (1939) and Warren
(1968) describe thomsoni as yellower and more
melanised than sabellicae on forewing and hindwing
dorsal surfaces
Tab. 3. Androconial length, neck and mid-scale widths and ratios of widths to length and mid-scale to
neck width ratios of specimens of Pieris napi from Scotland and southern England. All means are reported
+ 1 SD. N.S. — not significant (P > 0.05).
Gl — first generation; G2 — second generation; r, — Spearman’s rank correlation of individual mean
measurement with forewing area; P — significance of r,
Region and generation
Scotland
Androconial P G2
variable
Length
(mm)
Mid-scale
width
(mm)
Neck width
(mm)
Length/mid-
scale width
ratio
Length/neck
width ratio
Mid-scale/
neck width
ratio
0.092
+ 0.007
0.029
+ 0.004
0.14 NS. 0.092
+0.007
0.029
+0.004
-0.28 NS.
0.026
+ 0.004
3.26
+£0.55
-0.28 0.026
+0.003
3.25
+0.54
3.27
3.61
+0.62
1.11
+0.13
3.60
+£0.61
1.11
+0.13
3.63
0.093
+0.007
0.029
+0.004
0.026
+0.004
+0,56
+0.63
+0.13
Overall
relationship
with wing
area
Southern England
far ee s P
0.43 N.S. 0.092
+0.007
-0.08
0.09 N.S. 0.029
+0.004
0.25
0.026
+0.004
32
+0,55
3.62
+0,62
1.11
+0.13
240 WILCOCKSON & SHREEVE: Pieris napi within the British Isles
cluding the ratio of androconial length to mid-length width (Figure 1) and the ratio of
width measurements, both of which are the most likely measures to categorise
androconial scale type classes. Overall, there are no significant differences between
the distributions of androconial scale dimensions from the Scottish and southern Eng-
lish regions. |
Scotland spring Scotland summer
No of obs.
No of obs
Ce]
2 2
© ©
© ©
O O
2. Zz
Fig. 1. Distributions of the ratios of androconial length to mid-width for spring and summer generations
of Pieris napi from Scotland and southern England.
MANOVA (multivariate analysis of variance) is used to examine within and be-
tween region and season differences of androconial size and shape measures (Table 4).
Within any region and season there are differences between individuals in androconial
size and shape measures. For both Scotland and southern England there are greater
differences between samples within a season than between seasons (Scotland, Wilk’s
À 0.77 versus 0.16 and 0.07; southern England Wilk’s À 0.66 versus 0.10 and 0.12). In
addition, differences between regions are no greater than within regions (Wilk’s A 0.67
versus 0.77 and 0.66). This is indicative of between individual variation exceeding
between season or region variation.
A two dimensional non-metric scaling plot derived from an individual x individual
matrix of Spearman correlation coefficients produced from individual values of
androconial neck-width x mid-width)/length reveals a lack of any underlying geo-
Nota lepid. 25 (4), published 2003: 235-247 241
Tab. 4. MANOVA comparisons of within region and between region androconial variation, using all
androconial scale variation measures. Sample sizes are 10 individuals from each region and 100 scales
from each individual.
Comparison Wilk’s Rao’s R P
Lambda
Scotland spring 0.16 953 <0.01
Scotland summer 0.07 161.1 <0.01
southern England spring 0.10 293 <0.01
southern England summer 0.12 116.7 <0.01
Scotland spring vs summer 077 1952 <0.01
England spring vs summer 0.66 339.0 <0.01
Scotland vs southern England 0.67 19526 <0.01
Wilk’s Lambda is the determinant of the within groups variance/covariance matrix over the determinant of the total
variance/covariance matrix. It ranges from 0, perfect discrimination, to 1, no discrimation.
Rao’s R is a transformed value of Wilk’s Lambda to determine the significance of each effect. It follows the F-distribution.
P - Significance of Rao’s R.
graphic or between-population structuring in androconial scale variation (Figure 2).
No grouping of specimens on the basis of location is evident, dimensional distances
between individuals from the same location are as large as those between individuals
from different locations.
a
=
©
m
C
©
=
Q
-0.4
Dimension 1
Fig. 2. Two-dimensional non-metric scaling plot of Scottish (N) and southern English (S) androconial
scales from first (1) and second (2) generations derived from an individual x individual Spearman corre-
lation matrix derived from androconial length and width measurements.
242
WILCOCKSON & SHREEVE: Pieris napi within the British Isles
Tab. 5. Mean wing morphology measures of Pieris napi from Scotland, southern England and southern
France and statistical comparisons between generations within regions and between regions an
generations.
Variable
FW area
(mm?)
FW area:
perimeter
length ratio
HW area
(mm? )
HW area:
perimeter
length ratio
HW ventral
yellow
luminance
HW ventral
surface
proportion
yellow
HW ventral
surface vein
melanisation
(luminance)
HW ventral
proportion of
wing covered
by black
scales
FW dorsal
white
luminance
FW dorsal
vein
melanisation
(luminance)
FW dorsal
proportion of
wing covered
by black
scales
FW basal area
melanisation
(luminance)
male
female
male
female
male
female
male
female
male
female
male
female
male
female
male
female
male
female
male
female
male
female
male
female
Scotland
Gi G2
209.2 + 20.1 215.0 + 22.0
203.6 + 20.6 195.3 +9.4
3.5 + 0.2 3.6+0.1
3522.02 3.5+0.1
226.3 + 20.5 230.8 + 30.9
DUB SEDI A PIV S25 Ns
3.9+0.2 4.1+0.1
3.8 + 0.2 3.8+0.1
177.0 6.5 17923907
GEO) Aci er
0.22 + 0.02 0.26 + 0.01
0.16 + 0.03 0.13 + 0.03
1253238 127.3 + 2.6
122.4 + 3.6 02534
0.59 + 0.05 0.52 + 0.07
0.53 + 0.09 0.46 + 0.10
200.4 + 7.7 199.0 + 0.5
176.5 + 60.3 179.9 + 61.5
125.9 + 6.1 136.1 + 3.4
113.1 + 19.5 1344+38
0.08 + 0.01 0.07 + 0.01
0.12 + 0.01 0.11 +0.01
125.2 + 5.0 136.3 + 3.4
113.2 + 19.0 133.2 44.5
southern England
Gl
182.6 + 21.5
176.0 + 21.2
3.3 + 0.2
322202
205.3 + 19.8
190.9 + 26.0
3.8+0.2
3.6+0.3
180.5 2.3
180.6 3.4
0.27 + 0.02
0.33 + 0.03
13322927
1291122279
0.51 + 0.04
0.49 + 0.06
199.0 + 0.5
200.2 + 0.8
135.9+4.7
131.9 + 4.8
0.08 + 0.01
0.11 +0.01
135.7 + 4.4
131.9 + 4.8
G2
218.5 + 23.0
193.5+17.3
3.6+0.2
3.4+0.2
233.4+15.4
- 2084+21.1
40+0.3
3.8+0.2
184.0+ 0.6
180.7 + 2.8
0.33 + 0.02
0.54 + 0.03
130.6 + 3.5
126.8 + 3.2
0.36 + 0.13
0.23 + 0.81
198.9 + 4.4
199.5 + 0.7
13077, 233
134.8 + 6.0
0.07 + 0.01
0.10+0.01
138.0 + 3.3
135.0+5.9
southern
France
G2
252.7 +24.1
242.9 + 14.0
3.9+0.2
359031
250.8 + 24.5
262.5 + 33.6
4.3 +03
4.2 + 0.3
182.8 + 2:6
180.7 + 2.9
0.41 + 0.04
0.63 + 0.02
127.3 + 4.3
127.6 + 4.3
0.13 + 0.08
0.07 + 0.03
199.0 + 0.5
200.2 + 0.5
141.8 + 3.8
138.8 4.7
0.11 +0.01
0.09 + 0.01
141.7 + 3.6
139.0 + 4.5
Pee
(between region
and generation)
F(49s) = 35.5
P <0.001
Fass) = 19.2 P<0.001
F495) = 32.8
P<0.001
Fass) = 42.4
P <0.001
F494) = 23.7
P <0.001
Fass) = 22.9
P <0.001
F(4,94) = 17.7 P<0.001
F488) = 20.3 P<0.001
Figs) = 11.3 P<0.001
F487) = 23.3
P <0.001
F496 = 10.7
P<0.001
F (4,87) — 68.4
P <0.001
F495) = 16.6
P <0.001
Fasn = 6.6
P <0.001
F495) = 106.9
P <0.001
F437) = 112.3
P <0.001
F«4.5) = 1.73
P>0.05
F(4,88) = 1.7
P>0.05
Fags) = 37.8
P<0.001
Fa, 88) — 15.5
P <0.001
F495) =1.1
P >0.05
F(4,88) = 14.7
P <0.001
F(4595) = 48.0
P <0.001
F(4,88) = 20.6
P <0.001
Nota lepid. 25 (4), published 2003: 235-247
Continued Tab. 5.
243
HW dorsal male 195.1+3.7 197.3+0.8 197.1+0.4 197.6 1.0 198.6 + 0.6 Fass) = 8.94
white P <0.001
; female 195.8 + 3.3 198.6 + 1.7 199.2 + 0.6 197.6 + 0.8 200.0 + 0.9 Fass) = 12.1
luminance P <0.001
HW dorsal male 134.0 + 6.1 141.1 + 3.2 139.3 + 3.1 141.4+2.3 141.2 + 3.0 E09 1495
vein P <0.001
PT. female 139.839 140.5 + 2.6 140.1 + 4.6 141.6 + 2.5 138.8 + 3.2 F4,88) = 2.02
melanisation P>0.05
(luminance)
HW dorsal male 0.19 + 0.08 0.17 + 0.03 0.15 + 0.02 0.11 + 0.03 0.08 + 0.03 Base 18675;
2 P <0.001
roportion of
ne female 039+018 0322008 0.314012 0.1540.04 0.07 + 0.03 Fi 30,5
wing covered P<0.001
by black
scales
HW dorsal male 125.2 + 5.7 137.3434 135.1439 145.1+17.3 140.2 + 3.3 He = LUC
] area P <0.001
ped ; 4 : female 130.4 + 4.8 1379331 136.7 + 3.46 BONEE3S IS7AlEESES Fags) = 17.5
melanisation P <0.001
(luminance)
Wing morphology variables are normally distributed and their variation is summarised
in Table 5. (All comparisons are supported by LSD post-hoc tests, P < 0.05). Within
any region there is some seasonal variation in characteristics but seasonal variation is
not consistent between regions, or between sexes within regions. Males are smaller
(forewing and hindwing) in the first generation compared to the second in Scotland
and in southern England. For females, seasonal size variation is more complex. In
Scotland they are smaller in the second generation, but in southern England they are
larger in the second generation. Second generation individuals also have more rounded
wings (area/perimeter ratios) than those of the first. First generation individuals of
both sexes have darker melanised basal wing areas on the upper wing surfaces than
second generation individuals in Scotland, but not in southern England where this
difference is restricted to females only. Upper wing surfaces are brighter in the first
than second generation in both Scotland and England. Upper surface melanisation,
excluding basal melanisation, is greater in the first generation in Scotland and only on
the hindwing for males in the first generation in southern England. The extent of dark
scales on the dorsal surfaces is greater in the first generation in both Scotland and
southern England for both sexes. Some individuals had yellow suffusion on the ventral
hindwing. For both sexes in Scotland and for females in southern England there were
no seasonal differences in either the intensity of yellow or its extent. Males from southern
England had more extensive and darker yellow underside colouration in the second gen-
eration than the first. In both regions and sexes the veins on the hindwing underside were
more heavily melanised in the spring than the summer in both intensity and extent.
Comparisons including the French samples are more complex. Within males, first
generation individuals differ between regions in size, but second generation males do
244 WILCOCKSON & SHREEVE: Pieris napi within the British Isles
not differ in size between Scotland and southern England but are larger in southern
France. Females of the first generation are larger in Scotland than southern England. In
the second generation they are the largest in France and the smallest in southern Eng-
land. Females of the second generation from southern England do not differ in either
forewing or hindwing shape from females from France but those from the first genera-
tion do. There are also no significant differences in shape between females from Scot-
land and from southern England for either generation. In contrast, males differ in shape
between the regions in spring, and in summer between Scotland and southern England
but not between southern England and France. Dorsal basal wing area melanisation is
darker in first generation males and females in southern England than in Scotland.
This characteristic does not differ between Scotland, southern England and southern
France in the second generation. The ventral ground colour of both males and females
is brighter yellow in the first generation in Scotland than in southern England but there
are no significant differences in this characteristic in males between the three regions
in the second generation. The ventral hindwing of second generation females is brighter
yellow in Scotland than elsewhere but does not differ between southern England and
southern France. In both generations the darkness of the wing venation of the ventral
hindwing of both sexes does not differ between regions, but the dark scales surround-
ing the veins are the most extensive in Scotland and the least extensive in southern
France. In the first generation in Scotland the yellow ground colour of both sexes and
female dorsal basal melanisation is more variable than in any other region or generation.
Regional and seasonal comparisons reveal an overall pattern of variability and a
lack of consistency in the way individual characteristics vary.
Discussion
Our quantitative findings on androconial and wing morphology variation within
the British Isles are not consistent with earlier work (e.g., Stephens 1827; Verity 1916;
Miiller & Kautz 1939; Warren 1961, 1986; Thomson 1970, 1980). The only consistent
finding between our measures of androconia and previous ones is the lack of a rela-
tionship between forewing size and androconial scale size (Warren 1961). All the meas-
ures of androconial shape we have made are normally distributed and variation within
Scottish samples is no greater than in southern Britain. This is not consistent with the
scale type of southern Britain being monomorphic, and Scottish specimens having
_ four or six distinct types (Warren 1961, 1968; Thomson 1970, 1980). Bowden (1983)
described different scale types from different regions of the British Isles, raising doubts
about the validity of any distinction between populations from Scotland and elsewhere.
In particular the named subspecies britannica was described as having thomsoni type
androconial scales. Bowden (1983) never conducted a statistical analysis of his cat-
egorical data. Such an analysis reveals that there is no significant difference between
the frequencies of scale types in different regions (G = 10.50; df = 15; P > 0.05) al-
though such a comparison is not valid because according to our data distinct scale
types do not exist. Even if distinct types cannot be identified using quantitative meas-
ures, the possibility of differences between the distributions of androconial shape
Nota lepid. 25 (4), published 2003: 235-247 | 245
descriptors could exist 1f there was a distinction between regional types. Our analysis
is not consistent with this hypothesis and there is no regional separation on the basis of
androconial variation.
Quantification of wing morphological characteristics reveals a pattern that is far
more complex than previously described. Separation of regional forms in a quantita-
tive analysis is not consistent between generations. When quantified, variation of the
characteristics that have been previously used to describe subspecies, including the
separation of sabellicae in southern England from napi in mainland Europe, is not
consistent with previous work. Those individual wing characteristics that have been
used to describe subspecies do not vary between seasons or between regions in a con:
sistent fashion. For example ventral ground colour, basal melanisation and vein
colouration have been used to differentiate the nominal subspecies sabellicae from
napi, and thomsoni and britannica from sabellicae (Stephens 1827; Verity 1916; Miiller
& Kautz 1939; Emmet 1989). Patterns of variation in these characteristics are not
consistent between generations and when quantified, differences in one (basal
melanisation) are the reverse of that which has previously been described. Whilst
multivariate analysis shows some pattern in the differentiation of seasonal and re-
gional forms of both sexes, there is also overlap in the morphology of regional forms.
If regional separation of forms is possible, it has to be restricted to overall tendencies
in individual characteristics but these characteristics are not necessarily correlated in
how they vary, either with season or region.
The wing morphology of Pieris napi is recognised as being variable within regions
and influenced by environmental conditions experienced in the pupal stage (Thompson
1947). The results presented here indicate that wing morphology characteristics, or at
least those which have been used previously, lack the stability that would be required to
use them to differentiate regional forms. Perhaps the most revealing result to emerge
from this analysis is that some characteristics, especially size, yellow underside ground
colouration and basal melanism are variable, and the most variable in northern populations.
In P napi these characteristics are of potential importance to thermoregulation, crypsis
and flight performance (Wilcockson 2002). For example, reduced basal melanisation of
southern French P. napi in comparison to the British Isles is consistent with an emphasis
on thermal constraints on activity whilst small size in first generation and northern areas
may facilitate rapid warming and maximise activity in cool conditions. A large size in
southern France may also be consistent with reduced thermal constraints in warmer ar-
eas. Variability may be the result of a lack of directional selection in environments that
vary in weather over short time scales. Thus, the greater variation within north-western
populations may be explained by consistent within-season weather variation, which is
more extreme than elsewhere. Whilst wing morphology variation does not resolve issues
about levels of regional differentiation, controlled studies of reaction norms would re-
veal much about responses to selection on individual wing elements in variable environ-
ments. A more comprehensive analysis using more wing characteristics reveals the same
pattern of variability as demonstrated here (Wilcockson 2002).
On the basis of androconial and wing morphology variation there seems to be little
evidence for making any distinction between regional forms of Pieris napi in the Brit-
246 WILCOCKSON & SHREEVE: Pieris napi within the British Isles
ish Isles. Furthermore there seems to be little basis for making any distinction between
forms on the European mainland and the British Isles. Porter & Geiger (1995) exam-
ined F,, values derived from nine loci using populations throughout Europe, including
Scotland and northern England. Their analysis revealed non-equilibrium amongst
populations in the British Isles, which they attributed to either mixing of different
forms or differences in local selection. Their analysis was designed to examine infer-
ences of gene flow at different geographic scales, not specifically phylogenetic differ-
entiation. But allozyme data has shown that many of the taxa in the Pieris napi com-
plex lack a genetic justification. The use of such enzymes as markers for revealing
phylogeography in a species in which there is likely to be considerable mobility (Por-
ter & Geiger 1995; Asher er. al. 2001), and which is possibly subject to different re-
gional and local selection gradients, is unlikely to be conclusive. Whilst we are aware
of arguments about the neutrality of allozymes we emphasise that at least one (PGI) is
subject to selection in relation to thermal requirements in one other pierid butterfly
(Kingsolver & Watt, 1984), and other commonly used allozymes are also involved in
metabolic processes that could be under selection.
We conclude that on the basis of androconial and wing morphology characteristics
there is no justification for raising any geographic forms within the British Isles to
subspecific status. Direct evidence for any specific invasion sequence is also lacking
and is unlikely to be obtained from allozyme data. Studies using the mitochondrial
genome based on appropriate markers (microsatellites, RFLPs) are needed. Our stud-
ies of wing morphology also reveal that there is regional overlap, but within regions
variation is greater in northern areas than elsewhere.
Acknowledgements
Andrea Wilcockson was funded by a School of Biological and Molecular Sciences, Oxford Brookes
University, studentship. We thank two anonymous referees for their valuable comments.
References
Asher, J., Warren, M., Fox, R., Harding, P., Jeffcoate, G. & Jeffcoate, S. 2001. The millenium atlas of
butterflies on Britain and Ireland. — Oxford University Press, Oxford. 433 pp.
Bowden, S. R. 1983. Androconial scales and Scottish Artogeia napi. — Entomol. Gaz. 34: 237-245.
Dennis, R. L. H. 1977. The British butterflies — their origin and establishment. — E.W.Classey, Faringdon.
318 pp.
Emmet, A. M. 1989. Pieris napi (L.). Pp. 107-111. —Jn: Emmet, A.M. & Heath, J. (eds.), The moths and
butterflies of Great Britain and Ireland, Volume 7(1), Hesperiidae-Nymphalidae, The butterflies. —
Harley Books, Colchester.
Geiger, H. & Shapiro, A. M. 1992. Genetics and evolution of holarctic Pieris napi species group
populations (Lepidoptera: Pieridae). — Z. Zool. Syst. Evol.-Forschg. 30: 100-122.
Kingsolver, J. G. & Watt, W. B. 1984. Mechanistic constraints and optimality models: thermoregulatory
strategies in Colias butterflies. — Ecology 65: 1835-1839.
Müller, L. & Kautz, I. H. 1939. Pieris bryoniae Ochs. und Pieris napi L. — Osterr. Entomolgen-Ver.
Wien, 16 + 191 pp., 16 plates.
Porter, A. H. & Geiger, H. 1995. Limitations to the inference of gene flow at regional geographic scales
—an example from the Pieris napi group (Lepidoptera: Pieridae) in Europe. — Biol. J. Linn. Soc. 54:
329-348.
Nota lepid. 25 (4), published 2003: 235-247 247
Statsoft, 1999. STATISTICA for Windows. — Statsoft Inc., Tulsa, Oklahoma. 4022 pp.
Stephens, J. F. 1827. Illustrations of British entomology; or, a synopsis of indigenous insects: containing
their generic and specific distinctions: with an account of their metamorphoses, times of appearance,
localities, food, and economy. Haustellata, Volume 1. — Baldwin & Cradock, London.
Thomson, G. 1970. The distribution and nature of Pieris napi thomsoni Warren (Lep.: Pieridae). — Ent.
Rec. J. Var. 82, 255-261.
Thompson, J. A. 1947. Some preliminary observations on Pieris napi (L.). — Proc. Trans. S. Lond.
Entomol. Nat. Hist. Soc. 1947: 115-122.
Verity, R. 1916. The British races of butterflies: their relationship and nomenclature. — Ent. Rec. J. Var.
28: 73-80.
Warren, B. C. S. 1961. The androconial scales and their bearing on the question of speciation in the
genus Pieris. — Entomol. Tidskr. 82: 121-148.
Warren, B. C. S. 1968. On an instable race of Pieris adalwinda, located in Scotland. — Ent. Rec. J. Var.
80: 299-302.
Wilcockson, A. 2002. The functional significance of wing morphology in Pieris napi. — PhD thesis,
Oxford Brookes University, Oxford. 346 pp.
248
Book review
Book Review
Hellmann, F., Brockmann, E. & Kristal, Ph. M.: / Macrolepidotteri della Valle d Aosta.
17 x 24 cm, 284 p., 1 color plate, 2 maps, hardback, 1999. Museo Regionale di Scienze
Naturali, I-11010 Saint-Pierre (Aosta), Italy. Price and ISBN not available.
In this publication, the studies of various researchers on the macrolepidopterous fauna of the
Aosta Valley are summarized. Only very few older publications contain faunistic data on the
Lepidoptera of this region and only during the past 50 years has the study been intensified, e.g.
by installing permanent light traps. No less than 1141 different species have been recorded
from this single northwest Italian valley. This high species richness is due to the great variety
of habitats which are distributed vertically from 315 to 4807 m. The average altitude of the
region amounts to 2106 m and the area measures 3262 km?. The introductory part of the book
starts with general data about the geology, climate and vegetation of the Aosta Valley. This
brief explanation is followed by some lists of interesting species, arranged according to different
criteria. The first list contains four endemic species (all figured in color), the second six species
new to the Italian fauna and the last one contains species which are remarkable for their
distribution in the southern Alps. At the end of the introduction, an ecological and chorological
analysis of the moth fauna is given, as well as an explanation of the used material and methods.
The main part of the book consists of the systematic list of observed species with data on their
“occurrence in the Aosta Valley, their general distribution and a list of all localities in the valley
where the species have been observed. The book ends with a reference list and an alphabetic
index. It is well, though not luxuriously published and can serve as an information source for
the students of European and especially alpine moth faunistics.
WILLY DE PRINS
Nota lepid. 25 (4), published 2003: 249-250 249
Short Communication
First observation of one Maculinea arion pupa in a Myrmica
lobicornis nest in Poland
Marcin SIELEZNIEW!, ANNA STANKIEWICZ? & CEZARY BYSTROWSKI
' Warsaw Agriculture University, Department of Applied Entomology, Nowoursynowska 166, PL-02-
787 Warszawa, Poland (corresponding author; e-mail:
[email protected]
* Museum and Institute of Zoology, Polish Academy of Sciences, Laboratory of Social and
Myrmecophilous Insects, Wilcza 64, PL-00-679 Warszawa, Poland.
> Institute of Forestry Research, Department of Forest Protection, Sekocin Las, PL-05-090 Raszyn,
Poland.
Maculinea arion (Linnaeus, 1758) (Lycaenidae) is a fast declining species endan-
gered in many European countries. In Poland M. arion has disappeared from the
whole western part of the country within the last few decades (Buszko 1997). Cater-
pillars feed initially in the flowerheads of Thymus or Origanum spp. (Lamiaceae), to
complete development in Myrmica colonies preying on ant larvae. Although all
Myrmica workers transport caterpillars to their nest, survival is high only with the
main host ant species, My. sabuleti Meinert, 1861 (Thomas 1995). Habitat demands
of M. arion and its major host ant vary according to regional climate (Thomas ef al.
1998), but almost nothing is known in this respect from vast areas in Eastern Europe
and Asia.
In mid-June 2002 we therefore attempted to identify the habitat requirements of M.
arion in Poland more precisely. A survey, which coincided with the emergence of the
first adults, was performed at Gugny (52°24'N/18°59'E) in the Biebrza National Park
(NE Poland) on raised, sandy land surrounded by fens. Three neighbouring dry hills,
regularly grazed by cattle and wild game, were covered by sparse trees (mainly oaks
and some pines) and bushes. Thymus serpyllum, the host plant of M. arion, was abun-
dant almost everywhere in the turf and overgrew sandy places as well as parts of the
site bordering on swamps. Areas within a radius of 2m around host plants were searched
for Myrmica ants. All nests encountered were carefully inspected, progressing from
the uppermost to the deepest chambers. Voucher samples (5-10 workers) were col-
lected and identified in the laboratory according to Czechowski et al. (2002).
A total number of 51 Myrmica nests were excavated and 5 species were recorded,
the commonest being My. sabuleti (27 nests, 53%). Thirteen nests (25%) of My.
scabrinodis Nylander, 1846, 6 (12%) of My. schencki Viereck, 1903, 3 (6%) of My.
rubra (Linnaeus, 1758) and 2 (4%) of My. lobicornis Nylander, 1846, were also found.
Only one M. arion pupa in a My. lobicornis nest was recorded, about 4 cm below
ground level in a chamber with ant pupae. The nest was hidden in a tuft of grass and
was situated in the lower (but sandy) place of the hill about 5 m away from the edge of
the wet area.
© Nota lepidopterologica, 16.06.2003, ISSN 0342-7536
250 SIELEZNIEW, STANKIEWICZ & BysTrowski: Maculinea arion pupa in Myrmica lobicornis nest
My. lobicornis, preferring cooler habitats than My. sabuleti (Elmes et al. 1998), has
never been noticed so far as a host of M. arion or any Maculinea species (Wardlaw er
al. 1998). Occasional individuals of the predacious Maculinea species survive in ‘non-
host’ Myrmica colonies (Thomas & Elmes 1998). Hence, our finding does not allow to
asses if My. lobicornis is a regular host ant of M. arion on the investigated site. Appli-
cation of a population model developed by Thomas (1995) rather suggests M. sabuleti
being the main host here as well. Possibly, pupae in My. sabuleti nests were over-
looked during the survey, if these were hidden deeper in the ground, below the cham-
bers where ants were observed. Moreover nests parasitised by M. arion are often de-
serted by ants and then invaded by neighbouring Myrmica colonies. The association of
the single M. arion pupa with My. lobicornis could also have originated this way.
Anyway, the unexpected finding reported here emphasizes the need for further studies
on the host ant relationships of Maculinea butterflies, in particular in the more eastern
parts of their distributional ranges. This seems to be vital for understanding the ecol-
ogy and evolution of Maculinea, especially if we consider that this genus probably
evolved in a steppe-like habitat in Asia (Fiedler 1998).
Acknowledgements. We thank J. A. Thomas and K. Fiedler for constructive comments on an earlier
manuscript draft.
Literature
Buszko, J. 1997. A distribution atlas of butterflies in Poland 1986-1995. — Torun, Turpress. 170 pp.
Czechowski, W., A. Radchenko & W. Czechowska 2002. The ants (Hymenoptera, Formicidae) of Poland.
— Warsaw, MIZ PAN. 200+1 pp.
Elmes, G. W., J. A. Thomas, J. C. Wardlaw, M .E. Hochberg, R. T. Clarke & D. J. Simcox 1998. The
ecology of Myrmica ants in relation to the conservation of Maculinea butterflies. — J. Insect Conserv.
2: 67-78.
Fiedler, K. 1998. Lycaenid-ant interactions of the Maculinea type: tracing their historical roots in a ~
comparative framework. — J. Insect Conserv. 2: 3-14.
Thomas J. A. 1995. The ecology and conservation of Maculinea arion and other European species of
large blue butterfly. In: A. S. Pullin (ed.), Ecology and conservation of butterflies. - London, Chapman
& Hall. Pp. 180-197.
Thomas, J. A., G. W. Elmes, J. C. Wardlaw & M. Woyciechowski 1989. Host specificity among Maculinea
butterflies in Myrmica ant nests. — Oecologia 79: 425-457.
Thomas, J. A. & G. W. Elmes 1998. Higher productivity at the cost of increased host-specificity when
Maculinea butterfly larvae exploit ant colonies through trophallaxis rather than by predation. — Ecol.
Entomol. 23: 457-464.
Thomas, J. A., D. J. Simcox, J. C. Wardlaw, G. W. Elmes, M. E. Hochberg & KR. T. Clarke 1998. Effects
of latitude, altitude and climate on the habitat and conservation of the endangered butterfly Maculinea
arion and its Myrmica ant hosts. — J. Insect Conserv. 2: 39-46.
Wardlaw, J. C., G. W. Elmes & J. A. Thomas 1998. Techniques for studying Maculinea butterflies: II.
Identification guide to Myrmica ants found on Maculinea sites in Europe. — J. Insect Conserv. 2:
119-127.
Nota lepid. 25 (4), published 2003: 251-263 | 251
Comparison of the male genitalia and androconia of
Pseudochazara anthelea acamanthis (Rebel, 1916) from Cy-
prus, Pseudochazara anthelea anthelea (Hübner, 1824) from
mainland Turkey and Pseudochazara anthelea amalthea
(Frivaldsky, 1845) from mainland Greece (Nymphalidae,
Satyrinae)
ANDREW WAKEHAM-Dawson!, Ros PARKER”, EDDIE JOHN? & ROGER L. H.
Dennis*
! The International Commission on Zoological Nomenclature, c/o The Natural History Museum,
Cromwell Road, London, SW7 SBD, Great Britain (e-mail:
[email protected]); corresponding
author
? 66 Cornfield Road, Bury St Edmunds, Suffolk, IP33 3BN, Great Britain
3 Davies Cottage, Penllyn, Cowbridge, Vale of Glamorgan, CF71 7RQ, Great Britain
: Department of Entomology, The Manchester Museum, Manchester University, Oxford Road,
Manchester, M13 9PL, Great Britain
Summary. Statistical analysis of measurements made on genitalia and androconia of Pseudochazara
anthelea acamanthis (Rebel, 1916) butterflies from Cyprus, P anthelea anthelea (Hübner, 1924) from
mainland Turkey and P. anthelea amalthea (Frivaldsky, 1845) from mainland Greece shows that there is
considerable overlap between the three taxa as represented by the specimens used in this study. The
general similarity of the genitalia and androconia of these specimens supports Olivier’s (1996) syn-
onymy of P. anthelea acamanthis with P. anthelea anthelea based on his study of wing pattern.
Key words. Lepidoptera, Satyrinae, Pseudochazara anthelea, genitalia, androconia, Cyprus, Greece,
Turkey, biometrics, statistical analysis.
Introduction
The genus Pseudochazara de Lesse, 1951 (type-species by original designation
Hipparchia pelopea Klug, 1832) consists of over twenty species and subspecies that
are restricted to Europe and Asia. Gross (1978) reviewed the genus, but recent discov-
ery of additional species means that a fresh revision is now necessary and preliminary
work towards such a revision is underway (Wakeham-Dawson & Kudrna 2000;
Wakeham-Dawson & Dennis 2001). As noted by Gross (1978), Hesselbarth et al. (1995)
and Wakeham-Dawson & Dennis (2001), Pseudochazara species can be divided into
two subgroups: (1) those that have male genitalia and androconia that are broadly
similar to the type species P. pelopea and (2) those that have male genitalia and
androconia that are broadly similar to P anthelea anthelea (Hübner, 1824). It is in-
tended that these two groups be formally described as subgenera in the planned revi-
sion.
The P anthelea anthelea-subgroup is represented in the area around the Aegean
Sea by a number of nominal subspecies. Olivier (1996) concluded, on the basis of
wing pattern examination, that the nominal subspecies Pseudochazara anthelea
© Nota lepidopterologica, 16.06.2003, ISSN 0342-7536
252 WAKEHAM-DAWSON, PARKER, JOHN & DENNIS: Male genitalia and androconia of Pseudochazara
acamanthis (Rebel, 1916) from Cyprus is conspecific with P anthelea anthelea (Hübner,
1824) from mainland Turkey. However, he did not consider male genitalia or androconia
in his deliberations. In continuation of a long-running study of the butterflies of Cy-
prus (Parker 1983, John 2000) and as part of the revision of the genus Pseudochazara
mentioned above, measurements made on androconia and genitalia from specimens of
P. anthelea acamanthis from Cyprus are compared in the current study with measure-
ments made on specimens of P. anthelea anthelea from mainland Turkey. This paper
presents the results of an analysis of these measurements and comments on the rela-
tionship between mainland and Cyprus populations (subspecies). It also compares these
findings with androconia and genitalia measurements from specimens of P anthelea
amalthea (Frivaldsky, 1845) captured in mainland Greece and areas just north of Greece.
Methods
Sources of data and measurements .The genitalia and androconia
measurement data used in the current study are taken from 60 male Pseudochazara
butterfly specimens: 23 P anthelea acamanthis, 20 P. anthelea anthelea and 17 P.
anthelea amalthea. The locations in which these specimens were captured are pro-
vided in the Appendix.
The genitalia have been measured using the methods described in Wakeham-Dawson
& Dennis (2001) and the androconia using methods described in Wakeham-Dawson &
Kudrna (2000) (also see Figs. 1-3), although in the current study androconia were
mounted under cover slips in DPX medium on microscope slides, rather than being
preserved dry under the cover slips (as in Wakeham-Dawson & Kudrna 2000). Diago-
Fig. 1. Diagram of male genitalia of Pseudochazara anthelea subspecies. aa = apex angularis; b = bra-
chium; f = furca; p = penis; s = saccus; t = tegumen; u = uncus; v = valve; vi = vinculum. Terminology
after Higgins (1975).
Nota lepid. 25 (4), published 2003: 251-263 253
Fig. 2. Diagram of measurements made on male genitalia of Pseudochazara anthelea subspecies. DL =
diagonal length, measured from dorsal junction of tegumen and uncus to base of saccus (the line running
at the same angle as the vinculum); VL (indicated by the solid line running beneath the valve) = valve
length; VB = valve breadth, measured at 0.5 mm from valve apex and at 90° to the line VL; UL = uncus
length, measured from uncus apex to mid-point between junction of tegumen and uncus; UB = uncus
breadth, measured at 0.5 mm from uncus apex and at 90° to the line UL; BL = brachium length, meas-
ured from apex of brachium to dorsal junction of tegumen and brachium; BB = brachium breadth, meas-
ured across junction of tegumen and brachium; TL = tegumen length, measured from dorsal junction of
tegumen and uncus to junction of apex angularis and vinculum; TB = tegumen breadth; PL = penis
length; PB = maximum penis breadth.
nal length (DL) is divided by valve length (VL) to produce a unit-less ratio D, which
measures overall proportion (shape) of the genitalia independently of size variation
between individuals in a taxon. Similarly, valve length (VL) is divided by valve breadth
(VB) to produce a ratio V, representing valve shape. Uncus length (UL) is divided by
uncus breadth (UB) to produce a ratio U, representing uncus shape. Brachium length
(BL) is divided by brachium breadth (BB) to produce a ratio B, representing brachium
shape. Tegumen length (TL) is divided by tegumen breadth (TB) to give a ratio 7,
representing tegumen shape, and penis length (PL) 1s divided by uncus breadth (UB)
(as penis breadth, PB, is not available for all specimens) to give a ratio P/. In addition,
penis length (PL) is divided by penis breadth (PB) (with linear regression estimates of
PB for thirteen specimens; r = 0.67, F; 4, = 11.59, p < 0.00001) to give a ratio P2.
254 WAKEHAM-DAWSON, PARKER, JOHN & DENNIS: Male genitalia and androconia of Pseudochazara
Fig. 3. Diagram of Pseudochazara anthelea androconium and the
measurements made. AL = androconium length, measured from ba-
sal stalk (bs) to terminal points (tp) at apex; AB = androconium
breadth, measured across widest part of androconium. Terminology
after Kudrna (1977).
Androconium length (AL) is divided by androconium breadth (AB) to give ratio A.
This provides 21 variables (13 measurements and 8 ratios) for analysis.
Statistical analysis. All variables, with the exception of BB, are nor-
mally distributed: These variables are analysed untransformed. BB shows a positive
skew and is treated with a log,, transformation before analysis. Data are analysed
using one-way analysis of variance (ANOVA), stepwise discriminant function analy-
sis (DFA) and Euclidean non-metric multi-dimensional scaling (NMMS) (see Sneath
& Sokal 1973; Statsoft 1999). These methods have been shown to be effective in re-
vealing morphological relationships between taxa (e.g. Wakeham-Dawson & Dennis
2001).
Results
The means, standard errors and maximum and minimum values of measurements
and ratios from genitalia (Fig. 2) and androconia (Figs. 3 & 4) of all three taxa are
presented for comparison in Tables 1 (measurements) and 2 (ratios). Only five of the
13 measurements (VL, UL, log,, BB, TB, PL) reveal significant differences (p<0.05)
between the taxa, with PB marginally significant at p=0.06, when ANOVA is applied
(Table 3). For the eight ratios, only three (U, B and P/) show significant differences
when ANOVA is applied (Table 4).
In these cases, the taxonomic pattern is similar in all variables, except for the com-
parison of BB and ratio B (brachium length, BL, divided by brachium breadth, BB). P.
anthelea acamanthis is distinct from P anthelea anthelea (significant differences,
p<0.05, shown in all variables except B) and P. anthelea amalthea (significant differ-
Nota lepid. 25 (4), published 2003: 251-263 255
Fig 4. The androconia of P. anthelea anthelea from mainland Turkey [specimen nos. 443 (diagram a),
345 (b, bi, bii), 444 (c), 192 (d, di)] and P anthelea acamanthis from Cyprus [specimen nos. 437 (dia-
gram e), 439 (f), 438 (g), 436 (h), 435 (i)]. Note the variation in androconium base shape both within and
between specimens. The androconia of P anthelea amalthea (not illustrated) are similar in shape and
show similar variation in base shape to those illustrated. There is no significant difference in the shape of
the androconia between any of these taxa (see Tables 3 & 4).
Jon & Dennis: Male genitalia and androconia of Pseudochazara
’
ER
WAKEHAM-Dawson, P
256
1000 _|ezwo | 100
| | : € pias | CN Do aa
i I
en | €
Se 3
Be | | ca)
Eure | | Kae
BA 0 zz
Bez 0 LE |
| Bere
| stoo | oseo | oero | eco 1000 [0170 |osro [oo |oz |8000 |ozeo |osıo |ozco |
i @
pojayjup bajayjuv DAPZDYI0PN2S
ES
Dayıjpu DajayjUD DADZDYIOPNasST
"uoneue[dx9 IO} 1x9] 998 'suswmads Jo Jaquinu = N (WW UI SJUSWI9INSEQU) SOIJIONNG PAVZPYIOPRS JO
exe} 99IUJ UI SOJgeLIeA [EIUO901IpUE pue JeIU9S 107] sonjea ((XEJA]) wnwxew pue (up) WINUIUIU pue (HS) SION prepuRys ‘suesw) sonsmejs Arewumg °F ‘AUL
Nota lepid. 25 (4), published 2003: 251-263 257
Tab. 2. Summary statistics (means, standard errors (SE) and minimum (Min) and maximum (Max)) for
genital and androconial ratios in three taxa of Pseudochazara butterflies (no units). N = number of
specimens. See text for explanation.
Pseudochazara anthelea amalthea
SR u a a GIE
EEE
23 }
01 .09
Taxon Pseudochazara anthelea acamanthis Pseudochazara anthelea anthelea
Variable
3
U
V 14.21
937
9 :
2.38
l 1.10 ß
7
:
a i ie CE RE
Pseudochazara anthelea acamanthis N= 23, Pseudochazara anthelea anthelea N = 20, Pseudochazara anthelea amalthea N = 17
Tab. 3. One way analysis of variance (ANOVA) for genital and androconial measurements in three taxa
of Pseudochazara butterflies. Significant effects (p<0.05) printed in bold face.
One way ANOVA
Variable | SS effect df MS SS error | dferror | MS error F
effect effect
5 REN
5
à à
; 5
5
5
5
Ree Moses | 2] 02849 | 2.0417 | 7 7.95
D ln OT 2 7
2 6
2 7
2 7
2 57
eee) | 2200101 | 27122) 2 57 | 00476 | 2140.13 |
2 7
2 6
2 6
, Z 4
2 4
2
Ber |
eas Br |
2] 0.0709 | 0.3695 | 56 | 0.0066 | 10.74 | <0.0001 |
[RC PORTE |
[A BE |
Be 0087| 57
0.0506 | 2] 0.0253 | 1.2594 |
ur Bul) :
ae) :
er
>
Bee
| 0.0010 | 0.0136) 44] 0.0003 | 3.111 0.06
PRE |
VL
VB
pus |
DE
ences shown in all variables), but P anthelea anthelea and P. anthelea amalthea are
homogeneous (only log,, BB and B show a significant difference).
In stepwise discriminant function analysis (DFA), only three of the variables (P/,
log,, BB and UL) are retained that provide significant discrimination between taxa when
all three groups (P anthelea acamanthis, P. anthelea anthelea and P. anthelea amalthea)
are compared or when only two groups (P. anthelea acamanthis vs. P. anthelea anthelea
298 WAKEHAM-DAWSON, PARKER, JOHN & DENNIS: Male genitalia and androconia of Pseudochazara
Tab. 4. One way analysis of variance (ANOVA) for genital and androconial ratios in three taxa of
Pseudochazara butterflies. Significant effects (p<0.05) printed in bold face.
[waa [ esi [arene [Wiener [aie [eon ae |
rat] a] | re a a
BEE HR 2 RE BC BR |
2
A LE 2 2 NL AL RE]
CE EA)
CE AE DE ECD
TEA PR PE 2 DE 2 ar 2a] LL
and P anthelea amalthea amalgamated) are compared. DFA of the three groups gives
70% (18 individuals misclassified) correct classification (Wilks’A = 0.42, F4 1107 9-92,
p<0.0001). A plot of the first two roots shows that P anthelea anthelea and P. anthelea
amalthea almost completely overlap. However, P anthelea acamanthis would fall
_ outside these two groups if it were not for five of the P anthelea anthelea specimens
and the position of one P. anthelea acamanthis specimen (Fig. 5). DFA of the two
groups gives 90% (6 individuals misclassified) correct classification (Wilks’A=0.50,
Fa, 567 18.95, p<0.0001). This shows good separation, but not enough to avoid confu-
sion in a blind trial.
Two Euclidean non-metric multidimensional scaling (NMMS) plots based on all
variables and just on ratios are virtually identical and show that there is considerable
overlap between the P anthelea acamanthis, P. anthelea anthelea and P. anthelea
amalthea specimens (Fig. 6 for all variables).
Discussion
Comparison of genitalia and androconia morphology
between populations. Analysis of variance shows that P anthelea acamanthis
specimens differ significantly from the two mainland taxa specimens (P. anthelea
anthelea and P. anthelea amalthea) in a number of variables. Similarly, P anthelea
acamanthis specimens are largely distinct from P anthelea anthelea and P. anthelea
amalthea in DFA axes. However, Euclidean plots show considerable overlap between
the three taxa as represented by the specimens used in this study. The general similar-
ity of the genitalia and androconia of these specimens supports Olivier’s (1996) syn-
onymy of P anthelea acamanthis with P. anthelea anthelea based on his study of wing
pattern. Perhaps more surprising is the apparent similarity between P. anthelea anthelea
and P. anthelea amalthea. However, the similarity between these two taxa has been
noted previously by Wakeham-Dawson & Dennis (2001), and although these taxa are
treated as distinct species by many authors (e.g. Kudrna 2002), they may in fact be
conspecific (i.e. capable of interbreeding to produce fertile offspring). The differences
Nota lepid. 25 (4), published 2003: 251-263 | 259
+ P. acamanthis
= P. anthelea
QO P. amalthea
Fig. 5. Plot of three Pseudochazara anthelea taxa in the first two roots (Root 1 vs. Root 2) of a discrimi-
nant function analysis (DFA).
Alienation K = 0.11
Kruskal stress S = 0.11 + P. acamanthis
= P. anthelea
25 O P. amalthea
Fig. 6. Non-metric two-dimensional plot (Axis 1 vs. Axis 2) of three Pseudochazara anthelea taxa based
on Euclidean distances for all genitalia and androconia variables.
260 WAKEHAM-DAWSON, PARKER, JOHN & Dennis: Male genitalia and androconia of Pseudochazara
between P anthelea acamanthis and P. anthelea anthelea and P. anthelea amalthea,
and the similarities between P. anthelea anthelea and P. anthelea amalthea indicated
by the current small-scale study suggest that a larger study including more specimens
and use of molecular data could provide some revealing insights into the relationships
between these nominal taxa.
Gene flow between populations. Geological evidence suggests that
formation of the island of Cyprus began between 230 and 95 million years ago as it
was forced up from the bed of the now Mediterranean Sea by movement of tectonic
plates. ‘A land area of some sort has existed on the present site of the island from
Middle Miocene (about ten million years ago) times onwards’ (Greensmith 1998, p.6).
As a result, the formation of the island almost certainly pre-dates the formation of the
taxa we know as subspecies of P. anthelea. The population on Cyprus was probably
established by individuals immigrating from the mainland in the last million or so
years (although the actual age of these taxa can only be guessed at). The most suitable
opportunities for migration would have been during the climate changes, lower sea
levels and extended shorelines associated with ice-sheet formation between the Last
Glacial Maximum and the early Holocene (Zonnerveld 1995; Lambeck & Bard 2000).
As Cyprus is only 70 km from mainland Turkey, the island population has probably
been sporadically augmented in the past with individuals from the mainland, and vice
versa. However, P anthelea acamanthis is nowadays the most sedentary of the Cyprus
Satyrinae in terms of its vertical distribution. Hipparchia cypriensis (Holik, 1949) (an-
other member of the Satyrinae present on Cyprus) has been observed engaging in
seasonally reversed migration between sea level and 1900 m (John & Parker 2002).
However, P anthelea acamanthis does not show this type of behaviour. It is most
frequently encountered above 1000 m (Makris in press; R. Parker & E. John, unpub-
lished data) and although it does occur at intermediate elevations, only one specimen
(an individual nectaring on Lantana) has been recorded from as low as 250 m (D.
Haines, unpublished data). It is therefore hard to envisage specimens of the present
day P. anthelea acamanthis dispersing in numbers from higher elevations. It is even
harder to contemplate the species embarking on a crossing to the mainland or vice
versa. |
This view is supported by an analysis of nearly 300 sightings of P anthelea anthelea
recorded in Hesselbarth et al. (1995). On the Turkish mainland, only three specimens
(1% of sightings) are listed as being noted below an altitude of 250 m while, in sharp
contrast, 282 (96%) were found above 500 m (including 237 records (81%) observed
at 1000 m or higher). Changes in climate or agricultural practices may have influenced
behaviour in recent centuries, confining the species to generally higher elevations.
Although the population on Cyprus may have previously been in reproductive contact
with mainland populations, it appears to be effectively isolated at present.
As there are only slight differences between the genitalia and androconia morphol-
ogy in the island (P. anthelea acamanthis) and Turkish mainland (P. anthelea anthelea)
populations, it would appear that gene flow probably did occur in the past between the
two populations. For similar reasons, it would also appear that there is or, until re-
cently, has been regular gene flow between mainland Greece (P. anthelea amalthea)
Nota lepid. 25 (4), published 2003: 251-263 | 261
and mainland Turkey (P. anthelea anthelea) populations. On the other hand, there may
have been only limited evolutionary divergence between the various P. anthelea anthelea
populations since they became isolated. If this is the case, limited differentiation may
be a result of the similarity of the biotopes of the populations in Turkey, Greece and
Cyprus (see below). It is worth noting that although P. anthelea amalthea and P. anthelea
anthelea differ in wing colour (especially in the females) this probably does not indi-
cate reproductive isolation between these nominal taxa, as wing colour appears not to
be a reliable taxonomic character in the genus Pseudochazara (Wakeham-Dawson &
Dennis 2001).
Comparison of biotopes between populations. The biotopes
of Pseudochazara anthelea populations, both on the Turkish mainland and in Cyprus,
appear to be very similar, with favoured areas comprising open, rocky ground on steep,
mainly south-facing, calcareous hillsides. On Cyprus, sparse vegetation (predominantly
Cistus creticus, Arbutus andrachne and other evergreen sclerophyllous shrubs scat-
tered among large rocks) completes the picture (Parker 1983, John 2000 and unpub-
lished observations). Although we do not have biotope data for all the specimens meas-
ured in the current study, some of the Turkish mainland (P. anthelea anthelea) speci-
mens measured in our study were captured in surroundings that are similar to the areas
where the Cyprus (P. anthelea acamanthis) specimens were found. For example, A.
Kogak (personal communication) reported that the specimens (nos. 479-484; see Ap-
pendix) he and his wife (M. Kemal) provided for this study were found at 1580 m in
openings of Quercus woodland on calcareous slopes. The biotope occupied by P
anthelea amalthea on mainland Greece is similar to that inhabited by the mainland
Turkish and Cyprus populations with the species generally restricted to calcareous
forested mountain areas above 1000 m (e.g. specimen nos. 73—75; see Appendix).
Acknowledgements
We thank Ulf Eitschberger, Muhabbet Kemal, Ahmet Kocak, Otakar Kudrna and Christodoulos Makris
for assistance with the provision of Pseudochazara specimens for this investigation; and Jo Konopelko
(Design Studio, The Natural History Museum, London) and Nick Greatorex-Davies (Monks Wood, Centre
for Ecology and Hydrology) for assistance with preparation of the figures. An earlier version of this
paper was improved by comments from an anonymous referee.
References
Greensmith, T. 1998. Southern Cyprus. Geologists’ Association Guide No. 50, London. 146 pp.
Gross, F. J. 1978. Beitrag zur Systematik von Pseudochazara-Arten (Lep., Satyridae). — Atalanta 9: 41-103.
Higgins, L. G. 1975. The classification of European butterflies. — Collins, London. 320 pp.
Hesselbarth, G., van Oorschot, H. & Wagener, S. 1995. Die Tagfalter der Türkei. — S. Wagener, Bocholt.
1354 pp., 847 pp.
John, E. 2000. Butterflies of Cyprus 1998 (Records of a year’s sightings). — Bull. Amat. Ent. Soc.,
Pamphlet No. 15. 46 pp.
John, E. & Parker, R. 2002. Dispersal of Hipparchia cypriensis (Holik, 1949) (Lepidoptera: Nymphalidae,
Satyridae) in Cyprus, with notes on its ecology and life-history. — Ent. Gaz. 53: 3-18.
Kudrna, O. 1977. A Revision of the Genus Hipparchia Fabricius. — E. W. Classey, Faringdon. 300 pp.
Kudrna, O. 2002. The distribution atlas of European butterflies. - Oedippus 20: 1-342.
Lambeck, K. & Bard, E. 2000. Sea-level changes along the French Mediterranean coast for the past
262 WAKEHAM-DAWSON, PARKER, JOHN & DENNIS: Male genitalia and androconia of Pseudochazara
30,000 years. — Earth Planetary Sci. Letts. 175: 203-222.
Makris, C. 2002. Butterflies of Cyprus. — Bank of Cyprus Cultural Foundation, Nicosia, in press [in
Greek; English translation planned for publication in 2003].
Olivier, A. 1996. Notes on the taxonomic status and supposed biogeographical affinity of the
Pseudochazara anthelea (Hiibner, [1924]) populations from Kipros (Cyprus) and from the Greek
island of Kos (Lepidoptera: Nymphalidae, Satyrinae). — Phegea 24: 5—12.
Parker, R. 1983. The butterflies of Cyprus. — Ent. Gaz. 34: 17-53.
Sneath, P. H. A. & Sokal, R.R. 1973. Numerical taxonomy. The principles and practice of numerical
classification. — W. H. Freeman, San Francisco. 573 pp.
Statsoft. 1999. STATISTICA 5.5 for Windows. — StatSoft Inc., Tulsa, OK.
Wakeham-Dawson, A. & Dennis, R. L. H. 2001. A quantitative description of the male genitalia of 23
taxa of Pseudochazara butterflies (Lepidoptera: Nymphalidae, Satyrinae). — Ent. Gaz. 52: 227250.
Wakeham-Dawson, A. & Kudrna, O. 2000. A quantitative description of androconia from Staudinger’s
Pseudochazara de Lesse, 1951 (Lepidoptera: Nymphalidae, Satyrinae) type specimens in the
Zoological Museum of Berlin. — Ent. Gaz. 51: 75-81.
Zonnerveld, K. A. F. 1995. Palaeoclimatic and palaeo-ecological changes during the last deglaciation in
the Eastern Mediterranean — implications for dinoflagellate ecology. — Rev. Palaeobot. Palynol. 84:
221-253.
Nota lepid. 25 (4), published 2003: 251-263 263
Appendix. Collection data of Pseudochazara butterfly specimens (23 P. anthelea acamanthis, 20 P.
anthelea anthelea and 17 P. anthelea amalthea) measured in the current study. AWD - collection A.
Wakeham-Dawson; EIT — collection U. Eitschberger (Marktleuthen, Germany); BM — Booth Museum,
UK; RP - collection R. Parker, UK.
Taxon no. Location Capture date Altitude Collector Collection
acamanthis 435 Platres, Cyprus 25.vili.1975 1120 m R. Parker AWD
acamanthis 436 Almyrolivado, Cyprus 7.v11.1996 1600 m C. Makris AWD
acamanthis 437 Prodromos Dam, Cyprus 8.v111.1996 1400 m C. Makris AWD
acamanthis 438 Trooditissa, Cyprus 28.vi.1975 1380 m R. Parker RP
acamanthis 439 Trooditissa, Cyprus 23.v11.1975 1380 m R. Parker RP
acamanthis 445 Prodromos Dam, Cyprus 14.v1.2001 1450 m E. John AWD
acamanthis 446 Prodromos Dam, Cyprus 14.v1.2001 1450 m E. John AWD
acamanthis 447 Trooditissa, Cyprus 13.vi.2001 1380 m E. John AWD
acamanthis 448 Trooditissa, Cyprus 13.v1.2001 1380 m E. John AWD
acamanthis 449 Foini, Cyprus 10.v1.2001 800 m C. Makris AWD
acamanthis 450 Prodromos Dam, Cyprus 14.v1.2001 1450 m E. John EIT
acamanthis 451 Prodromos Dam, Cyprus 13.v1.2001 1450 m E. John EIT
acamanthis 452 Prodromos Dam, Cyprus 13.v1.2001 1450 m E. John EIT
acamanthis 453 Madari, Cyprus 10.v1.2001 1400 m C. Makris EIT
acamanthis 454 Madari, Cyprus 10.v1.2001 1400 m C. Makris AWD
acamanthis 455 Trooditissa, Cyprus 8.v1.2001 1380 m E. John AWD
acamanthis 456 Trooditissa, Cyprus 8.v1.2001 1380 m E. John EIT
acamanthis 457 Trooditissa, Cyprus 13.v1.2001 1380 m E. John EID
acamanthis 458 Trooditissa, Cyprus 13.v1.2001 1380 m E. John EIT
acamanthis 459 Trooditissa, Cyprus 8.v1.2001 1380 m E. John AWD
acamanthis 460 Trooditissa, Cyprus 8.v1.2001 1380 m E. John AWD
acamanthis 461 Trooditissa, Cyprus 8.v1.2001 1380 m E. John AWD
acamanthis 471 Trooditissa, Cyprus 23-1975 1380 m R. Parker AWD
amalthea 68 Mt. Parnassus, Greece 12.v11.1995 1000 m A.Wakeham-Dawson AWD
amalthea 70 Peloponnesus, Greece di ? D. & S. Howell AWD
amalthea wh Peloponnesus, Greece ? 2 D. & S. Howell AWD
amalthea 72 Peloponnesus, Greece ? 2 D. & S. Howell AWD
amalthea 73 Mt. Chelmos, Greece 24.vii.1992 1000 m A.Wakeham-Dawson AWD
amalthea 74 Mt. Chelmos, Greece 26.vii. 1992 1000 m A.Wakeham-Dawson AWD
amalthea 75 Mt. Chelmos, Greece 26.vii.1992 1000 m A.Wakeham-Dawson AWD
amalthea 346 Mt. Parnassus, Greece 14.v11.1978 1000 m D. & S. Howell AWD
amalthea 362 Mt. Parnassus, Greece 8.v11.1973 2 P.W. Cribb BM
amalthea 363 Mt. Parnassus, Greece 23.v11.1973 ‘a P.W. Cribb BM
amalthea 472 Konitsa, Greece 3.vil. 1997 ? A.Wakeham-Dawson AWD
amalthea 473 Pirin, Bulgaria 31.v.1983 ? ex Coll. T. Hacz AWD
amalthea 474 Konitsa, Greece 3.vil. 1997 ? A.Wakeham-Dawson AWD
amalthea 475 Topolka, Macedonia 5.vi.1984 ? Schaider AWD
amalthea 476 Mt. Smolikas, Greece 18.v11.1995 1700 m Binter AWD
amalthea 477 Mt. Chelmos, Greece 10.v1.1992 1200 m ?, ex Coll. O. Kudrna AWD
amalthea 478 Kalavrita, Greece 18.vi.1991 ? V. Folk AWD
anthelea 192 Dazkiri, Turkey 26.vii. 1980 1500 m D. & S. Howell AWD
anthelea 345 Dazkiri, Turkey 26.vii.1980 1500 m D. & S. Howell AWD
anthelea 358 Elmadag, Turkey 15.vii. 1980 ? P.W. Cribb BM
anthelea 443 Bayburt, Turkey ? ? 2, ex Coll. O. Kudrna AWD
anthelea did Bayburt, Turkey ? ? 2, ex Coll. ©. Kudrna AWD
anthelea 462 Elazig, Turkey 13-14.vi.1974 700 m F.J. Gross EIT
anthelea 463 Ankara, Turkey 19-20.v1.1974 1000 m F.J. Gross EIT
anthelea 464 Corum, Turkey 05.v111.1976 1100 m F.J. Gross EIT
anthelea 465 Ankara, Turkey 19-20.v1.1974 1000 m F.J. Gross EIT
anthelea 466 Elazig, Turkey 13.v1.1974 1200 m F.J. Gross EIT
anthelea 467 Erzurum, Turkey 6-13.vi1.1998 ? ex Coll. O. Kudrna AWD
anthelea 468 Erzurum, Turkey 6-13.vii.1998 ? ex Coll. O. Kudrna AWD
anthelea 469 Erzurum, Turkey 6-13.vii.1998 ? ex Coll. ©. Kudrna AWD
anthelea 470 Erzurum, Turkey 6-13.vii.1998 ? ex Coll. O. Kudrna AWD
anthelea 479 Kayseri, Turkey 26.v1.2001 1580 m M. Kemal/A. Kocak AWD
anthelea 480 Kayseri, Turkey 26.v1.2001 1580 m M. Kemal/A. Kocak AWD
anthelea 48] Kayseri, Turkey 26.v1.2001 1580 m M. Kemal/A. Kocak AWD
anthelea 482 Kayseri, Turkey 26.1.2001 1580 m M. Kemal/A. Kocak AWD
anthelea 483 Kayseri, Turkey 26.vi.2001 1580 m M. Kemal/A. Kocak AWD
anthelea 484 Kayseri, Turkey 26.v1.2001 1580 m M. Kemal/A. Kocak AWD
264
Book review
Book Review
Arenberger, E. 2002. Pterophoridae IL. — Jn: R. Gaedike (ed.), Microlepidoptera Palaearctica
11. — Goecke & Evers, Keltern. — 287 pp., incl. 80 b/w pls., 16 colour pls. ISBN3-931374-21-1.
Price: 90 Euro (subscription: 72 Euro). [In German].
According countings by Heppner (1991), 315 species of Pterophoridae occur in the Palaearctic
region, which is about one third of the entire world fauna of this group. Ernst Arenberger from
Vienna is probably the best authority of this fauna, based on his profound life-time work. He
previously published the first volume on Palaearctic Pterophoridae including 168 species, in
the old and well known layout of the Microlepidoptera Palaearctica (Arenberger 1995).
In 2002, the second volume on Palaearctic Pterophoridae has been published, treating 63 spe-
cies of the subfamilies Deuterocopinae and Platyptilinae. The style of the main text remained
the same and the user again find the impressive high-quality watercolours by Frantisek Gregor.
It is a bit questionable for what purpose the separate figures of the hind-wings (pls. 70-80) are
given. They seem to be pure magnifications in black and white made from Gregor’s watercol-
ours and do not show additional details. The drawings of the genitalia are very simple and
appear at a first glance like sketches. However, the user will realise that all necessary charac-
ters are clearly given and sufficiently well illustrated for identification. In comparison to the
first volume on Palaearctic Pterophoridae, the user will miss the distribution maps, which
always immediately give an instructive impression about an species areal. This way, it is nec-
essary to read through the sometimes long lists of geographic names given in the distribution
paragraph. Altogether, the eleventh volume of this series is among those books that enable the
user to identify the treated species sufficiently and that gives comprehensive information for
further reading.
Beside this, it must be criticised that some general scientific standards are not fulfilled. The
differential diagnoses are missing for the species, examined material is not listed, references
are missing for included life history data, and a summary is missing. It will be indispensable to
develop the series accordingly, at least for the time it is printed with financial support from the
German Research Foundation (Deutsche Forschungsgemeinschaft). Future volumes also may
safe printing space by using a smaller script for lists of synonyms, geographic names and
references as well as avoiding that much space is used for low-graded headings like ‘Synonymie’
and ‘Literatur’ or extended spaces between pairs of entries in the keys, the lists of synonyms
and the list of references.
Nevertheless, Ernst Arenberger provided again a comprehensive and profound contribution,
and we are looking forward to see the Palaearctic Pterophoridae completed by its third volume.
As the entire series, this book contributes much to the understanding of Microlepidoptera, not
only to their identification. Summaries of life history data might be a starting point for ecologi-
cal studies. The geographic coverage of Microlepidoptera Palaearctica allows to show the
complete areal of a species and thus will support forthcoming biogeographical studies. I wish
this book series a continued existence, though perhaps with improved standards.
References
Arenberger, E. 1995. Pterophoridae. — In: H. G. Amsel, F. Gregor & H. Reisser, Microlepidoptera
Palaearctica 9 (1+2). G Braun, Karlsruhe.
Heppner, J. B. 1991. Faunal regions and the diversity of Lepidoptera. — Tropical Lepidoptera 1 Suppl. 1:
85 pp.
MATTHIAS Nuss
Nota lepid. 25 (4), published 2003: 265-266 | 265
Short Communication
Araschnia levana larvae (Nymphalidae) do not accept Humulus
Jupulus (Cannabaceae) as food plant
KONRAD FIEDLER & CLAUDIA RUF
Department of Animal Ecology I, University of Bayreuth, D-95440 Bayreuth, Germany
The Palaearctic nymphalid genus Araschnia comprises about seven species, with highest
diversity occurring in China. Life-histories of the transpalaearctic A. /evana (Linnaeus,
1758) and the East Asian A. burejana Bremer, 1861 are relatively well known. Almost
all published data (e.g. Ebert & Rennwald 1991, Fukuda et al. 1992, Tuzov et al. 2000,
Gorbunov 2001) indicate that both are restricted to host plants in the family Urticaceae
(Urtica, Boehmeria, Laportea). Also in a comparative experimental approach Janz er
al. (2001) failed to observe any food acceptance of European A. levana beyond its
usual hostplant, stinging nettle Urtica dioica L. In their feeding trials, Janz et al. incor-
porated exemplar species of all plant families known to be utilized as hosts among
Nymphalini butterflies, including wild hop Humulus lupulus L. (Cannabaceae). The
Cannabaceae are generally accepted as being closely related to the Urticaceae and
Ulmaceae (APG 1998, Bhattacharyya & Johri 1998), two typical hostplant families of
Nymphalini butterflies. Indeed, feeding on A. /upulus has been recorded rather widely
in the Nymphalini genera /nachis, Aglais, Polygonia and Nymphalis (Janz et al. 2001).
In a Russian source (Korshunov & Gorbunov 1995) it is indicated that A. /evana
‘rarely’ feeds on A. /upulus, although no details are recorded there. Despite the nega-
tive results obtained by Janz et al. (2001) this stimulated us to again test whether
larvae of A. levana might accept that plant at least in captivity. In contrast to Janz ef al.
who tested each food plant in their study with only five first instar larvae, we at-
tempted to obtain larger samples and confronted a wider range of larval stages in no-
choice tests with cut young foliage of H. /upulus. The larvae used in the tests origi-
nated from the offspring of a number of field-collected mated females of the summer
generation that had been sampled in the vicinity of Bayreuth (Northern Bavaria, Ger-
many). Larvae were maintained in closed plastic containers (volume 1000cm*) lined
with moist filter paper and kept at room temperature (22—25°C).
In no case did we observe any signs of feeding on A. lupulus. This was true for first
instars directly hatching from the egg with no prior feeding experience (N>100), as
well as for first (N=30), second (N=15) and third instar larvae (N=15) that had been
raised previously on U. dioica foliage. All larvae starved to death within 3-5 days.
Frequently, the larvae were seen crawling around in the containers off the plant in
search for suitable food.
Our complete failure to induce feeding by A. /evana larvae on A. lupulus indicates
that in fact this plant species does not qualify as a food plant. It is at present impossible
© Nota lepidopterologica, 16.06.2003, ISSN 0342-7536
266
FIEDLER & Rur: Araschnia levana
to decide where the discrepancy to Korshunov & Gorbunov’s record (1995) comes
from. It might still be possible that certain Siberian populations of A. levana do have
the capacity to feed on A. lupulus. However, it seems remarkable in this respect that in
his recent book Gorbunov (2001) no longer mentions any relationship between A.
levana and H. lupulus. Hence, for the time being and until any conclusive data can be
presented to show the contrary, we suggest to delete Humulus from the hostplant list of
Araschnia butterflies, which appear in fact to be family-monophagous on Urticaceae.
References
APG (= Angiosperm Phylogeny Group). 1998. An ordinal classification for the families of flowering
plants. — Annls. Missouri Bot. Gard. 85: 531-553.
Bhattacharyya, B. & B. M. Johri. 1998. Flowering plants — taxonomy and phylogeny. — Narosa Publ.
House, New Delhi. xxi + 753 pp.
Ebert, G. & E. Rennwald. 1991. Die Schmetterlinge Baden-Württembergs, vol. 1. — E. Ulmer, Stuttgart.
Fukuda, H., E. Hama, T. Kuzuya, A. Takahashi, M. Takahashi, B. Tanaka, H. Tanaka, M. Wakabayashi &
Y. Watanabe. 1992. The life histories of butterflies in Japan, vol. 3. 2nd ed. — Hoikusha Publishers,
Osaka. xxii + 373 pp.
Gorbunov, P. Y. 2001. The butterflies of Russia: classification, genitalia, keys for identification
(Lepidoptera: Hesperioidea and Papilionoidea). — Thesis Publishers, Ekaterinburg. 320 pp.
Janz, N., K. Nyblom & S. Nylin. 2001. Evolutionary dynamics of host-plant specialization: a case study
of the tribe Nymphalini. — Evolution 55: 783-796.
Korshunov, Y & P. Gorbunov. 1995. Dnevnye babochki aziatskoi chasti Rossii. Spravochnik. [Butter-
flies of the Asian part of Russia. A handbook]. — Ural University Press, Ekaterinburg. 202 pp. [in
Russian; English translation by O. Kosterin available at: http://pisum.bionet.nsc.ru/kosterin/korgor]
Tuzov, V. K., P. V. Bogdanov, S. V. Churkin, A. V. Dantchenko, A. L. Devyatkin, V. S. Murzin, G. D.
Samodurov & A, B. Zhdanko. 2000. Guide to the butterflies of Russia and adjacent territories, vol. 2.
— PenSoft Publishers, Sofia & Moscow. 580 pp.
Nota lepid. 25 (4), published 2003: 267-279 | 267
The butterfly assemblages of Onega Lake Area in Karelia,
middle taiga of NW Russia (Hesperioidea, Papilionoidea)
VYACHESLAV V. GORBACH! & Kimmo SAARINEN”
| Petrozavodsk State University, Department of Zoology and Ecology, RUS-185640 Petrozavodsk,
Russia
South Karelia Allergy and Environment Institute, Lääkäritie 15, FIN-55330 Tiuruniemi, Finland
* corresponding author, e-mail:
[email protected]
Summary. The species composition and abundance of butterflies were studied on the north-western
coast of Lake Onega in four years (1992-1993, 1995—1996). A total of 50 species and 3,832 individuals
were observed during 1,554 transect counts at 111 sites. The most abundant species were Callophrys
rubi, Brenthis ino and Pieris napi. The abundance of the majority of species was rather similar compared
to the adjacent provinces of Russian and Finnish Karelia. Clustering of the sites resulted in four groups
of assemblages, i.e. those of peatlands, open environments, forest meadows and forests. The average
number of species in the groups varied from 7 in peatlands to 13 in open environments, whereas the
average density of individuals was highest in open environments and lowest in forests. The groups
differed with respect to dominance, species diversity, and the number of species with a clear habitat
preference. Peatland assemblages were the most homogenous ones. A principal component analysis
(PCA) indicated three main trends in the variation of butterfly abundance: an affinity of species to either
forest environments, open environments, or peatlands. Based on these trends and their habitat prefer-
ences, the species were considered woodland, grassland and peatland species, respectively. A hypothesis
about the historical formation of the present butterfly fauna in the study area is presented.
Key words. Butterfly communities, boreal forest zone, habitat preferences, multivariate analysis.
Introduction
Butterflies are one of the best-known groups of Lepidoptera in the mid-taiga subzone
of Russian Karelia. Studies have mainly been carried out, however, before the 1950s
and have been reported in the form of simple species lists (e.g., Günther 1896; Möberg
1925; Lahtivirta 1939; Kaisila 1944, 1945; Karvonen 1945). Only Kaisila (1947) and
Kozhantshikov (1958) generalised from their data and considered the ecological as-
pects of butterflies in detail. Recent lists, still few, have been annotated more precisely
(Kozlov 1983; Kutenkova 1986, 1989).
According to available data, a total of 85 butterfly species has been recorded in the
region. The species composition of the fauna is fairly similar to the well-documented
fauna of Finnish Karelia, comprising 89 species (Saarinen ef al. 2002). However, with
regard to Russian Karelia we have scant information about the distribution and abun-
dance of individual species as well as about the composition and the structure of local
assemblages. In addition, changes in the butterfly fauna during recent decades and the
present status of many species are not known (Ivanter & Kuznetsov 1995; Kotiranta er
al. 1998).
We investigated butterflies at two adjacent localities in the Onega Lake area in
order to partly fill this gap in our knowledge. This biogeographical province offers two
advantages for evaluating the present status of the butterfly fauna in the middle taiga
of Russian Karelia. On the one hand, a relatively mild climate in the Lake Onega
© Nota lepidopterologica, 16.06.2003, ISSN 0342-7536
268 GorBACH & SAARINEN: Butterfly from Onega Lake Area in Karelia
region allows some species to penetrate further north due to favourable conditions for
reproduction. Hence, the butterfly fauna of the province is relatively rich in species.
On the other hand, because of the strongly broken relief with its frequent alternation of
ridges and valleys and the long-term traditional forest exploitation and agricultural
practices, the landscape of the Onega Lake area is characterised by a high diversity of
environments at a small spatial scale, including all major butterfly habitats in the mid-
taiga subzone of Russian Karelia.
Methods
The study area was situated on the north-western coast of Lake Onega (Fig. 1). The
landscape of the region is made up of forests (60% of the area, with a predominance of
Scots pine (Pinus sylvestris) in the tree cover), lakes and rivers (20%), open and forested
bogs and mires (15%) and cultivated fields, meadows and pastures (5%) (Volkov et al.
1990; Gromtzev 1993). The annual mean temperature is +2.1 °C and the monthly
means range from +16.8 °C in July to -10.9 °C in February (Romanov 1961).
Butterfly assemblages were studied in two nearby localities, Konchezero (1992—
1993) and Kivach (1995-1996). All accessible butterfly habitats in both areas were
visited before the field studies commenced and a total of 111 sampling sites (Table 1)
were selected randomly. Based on the plant associations, i.e. dominant and subdomi-
nant species and relative abundance of indicators of humid and shady conditions, the
sites were grouped according to the classification used by Ramenskaya (1958) and
Yakovlev & Voronova (1959). The location of each site was also taken into considera-
tion. The groups were as follows. Peat bogs and mires were oligo- and
mesotrophic with semi-open or open vegetation. Tree cover was mostly dominated by
Scots pine and the ground layer was comprised of oligotrophic shrubs (Ledum palustre,
Chamaedaphne calyculata, Betula nana), sedges and herbs. Dry pine forests
were dominated by Scots pine in the tree cover, and by Cladonia spp., Vaccinium vitis-
idaea and Calluna vulgaris in the ground layer. Humid pine forests exhib-
ited conditions varying from moderately dry to humid and the composition of the tree
Fig. 1. The biogeographical provinces of Karelia (Ahti ef al.
1968) and the location of the study area (black dot). Middle
taiga subzone: Ik = Isthmus karelicus, Ka = Karelia australis,
RUSSIA K1 = K. ladogensis, Kb = K. borealis, Kol = K. olonetsensis,
Kon = Karelia onegensis, Kton = K. transonegensis. North-
ee ern taiga subzone: Kpor =K. pomorica orientalis, Kpoc=K.
p. occidentalis, Kk =K. keretina.
Nota lepid. 25 (4), published 2003: 267-279 269
Tab. 1. The combined sampling data in ten site groups. Symbols are as follows: MIR= Peat bogs and
mires, DPF= Dry pine forests, HPF= Humid pine forests, HBF= Humid birch forests, HAF= Humid
aspen forests, SFM= Swampy forest meadows, HFM= Humid forest meadows, DFM= Dry forest
meadows, DOM= Dry open meadows, RDS= Roadsides. For definition of vegetation types see Methods
section.
Groups Sites Number of transects Counts Number of
total range mean SD (total) species individuals
MIR 16 47 IS 29 2.6 282 21 900
DPF 2 33 1-5 33 22 198 14 93
HPF 16 42 1-4 26 pal 252 41 543
HBF 8 19 273 2.4 0.5 114 19 89
HAF 5 15 2-5 3.0 1.2 90 16 62
SFM fi 16 1=7 23 2» 96 28 355
HFM 12 27 1-6 23 7 162 32 353
DFM 15 2] 1-3 1.4 07 126 26 347
DOM 14 19 1-3 3 0.6 114 30 618
RDS 6 20 3-4 33 0.5 120 36 472
Total 111 259 112 2.6 0.9 1,554 50 3,832
cover varied from pure pine forests to mixed forests with a high abundance of shrubs.
The ground layer vegetation varied substantially, but mosses (Pleurozium spp.,
Hylocomnium spp.) and Vaccinium myrtillus constantly prevailed in the plant associa-
tions. There were some meadow plants, but unlike the situation in forest meadows
these species did not form typical associations. Humid birch forests were
characterised by a predominance of birch (Betula spp.) and small numbers of Scots
pine and spruce (Picea abies) in the tree cover, but aspen (Populus tremula) and sev-
eral shrubs, such as Rhamnus frangula, Rosa spp. and Lonicera spp., were common in
these sites. Vaccinium myrtillus, Calamagrostis arundinacea, Deschampsia flexuosa
and some forest herbs were abundant in the ground layer. Humid aspen for-
ests had only a small number of trees other than aspen in the tree cover. The ground
layer was similar to that of humid birch forests, but species adapted to shady condi-
tions, such as Paris quadrifolia and Milium effusum, were more common. Swampy
forest meadows were dominated by Carex nigra, and the ground layer included
common species adapted to humid conditions, such as Agrostis canina, Carex canescens,
Cirsium palustre and Viola epipsila. Humid forest meadows were charac-
terised by an unevenness of species composition and density of vegetation. The domi-
nant species were Alchemilla spp., Trollius europaeus and Filipendula ulmaria. Typi-
cal plant species of swampy and dry meadow associations were distributed in small
fragments along the humidity gradient. Dry forest meadows were character-
istically patchy in regard to the structure of their vegetation and dominated by Agrostis
capillaris or Nardus stricta. The species adapted to dry conditions, such as Festuca
ovina, Knautia arvensis and Hieracium umbellatum were commonest in plant associa-
tions. Dry open meadows were similar to dry forest meadows, but were situ-
ated in an open arable landscape. Sites were usually bordered by lines of bushes along
270 GorBACH & SAARINEN: Butterfly from Onega Lake Area in Karelia
drainage ditch banks, and plant associations were spotted with ruderal and weed veg-
etation. Roadsides represented both stable and open dry habitats with a predomi-
nance of meadow plants, and overgrowing habitats with bushes and forest plants.
Butterflies were studied using the transect count method (Pollard & Yates 1993). All
transects were 150 m long and 3 m wide. The number of transects at each site, varying
from 1 to 12, was determined by the size of the site and the heterogeneity of the vegeta-
tion structure. In the forests, only semi-open areas, such as sparsely wooded or treeless
glades and tracks, were censused as boreal butterflies avoid areas with closed canopy.
Transects were studied over two seasons in each locality. The season was divided
into three periods; the first was between late May and late June, the second in July, and
the third one between mid-August and mid-September. Each transect was censused
once in a period, and all butterflies seen within the boundaries of the route were counted.
Counts were conducted between 10:00 and 15:00 local time if weather conditions
were satisfactory. A transect was not censused if the temperature was lower than +18
°C, or if sunshine prevailed for less than 70% of the time, or the wind speed exceeded
level three (>5.4 m/s) on the 12-point Beaufort scale.
A butterfly assemblage was defined as all species found in the site. Before any
analyses were made, the data from Konchezero and Kivach were combined and the
number of individuals per site was adjusted to individuals per ha. Since the species
density data contained many zeros, Euclidean-based methods (e.g., k-means cluster-
ing and PCA) could not be used without prior transformation of the data. We applied
the Chord transformation to the species data (Legendre & Gallagher 2001). The as-
semblages were first classified using k-means clustering and the resulting groups were
compared by means of the species composition, the total density, the species richness
and diversity, the dominance and the differences in the composition of assemblages
and the number of species with a habitat preference. The species richness of butterfly
assemblages was determined using rarefaction (Smith & van Belle 1984). Diversity
and dominance were examined using Shannon and Berger-Parker indices (Magurran
1988), whereas compositional differences between the assemblages were evaluated
using Euclidean distance. Diversity, dominance and distance between the groups were
compared using ANOVA. The habitat preference of each species was based on the
hypothesis that a species has the highest abundance in the most favourable habitat. The
G-test was used for the examination of two null-hypotheses: 1) Individuals of species
A are distributed evenly across all habitats. The absence of significant differences
between even and actual distribution (G-test, G<7.81, df=3, p>0.05) was interpreted as
non-significant habitat preference. 2) The highest abundance of species A does not
differ from abundances in the other habitats. The other habitats, where the number of
individuals did not differ significantly from the highest (G-test, G<3.84, df=1, p>0.05),
were also classified as preferred by the species. The species density table was not
appropriate for the analysis, as the species with the highest density of less than 3 indi-
viduals per hectare indicated an even distribution across the habitats. Thus, we used
actual numbers of individuals, which were adjusted to equal the total square of the
transects in all habitats. The proportion of sites occupied by the species indicated its
degree of localisation.
Nota lepid. 25 (4), published 2003: 267-279 274
Trends of structural variation in the groups of butterfly assemblages were studied by
principal component analysis (PCA). The factor loadings estimate the participation of
each assemblage in the separation of species along the principal component. The
eigenvalue is a measure of this separation. The participation of the principal compo-
nents with eigenvalues <1 were equated to zero in the separation. Signs and values of
the factor loadings were used for interpreting the ecological sense of the principal
components. If the value of the factor loading was <0.7, it was not regarded as signifi-
cant (Jeffers 1978). In accordance with the trends, the species were relegated to envi-
ronment groups based on their habitat preference.
Results
The transect count data consisted of 3,832 individuals representing 50 species. The
three most abundant species were Callophrys rubi, Brenthis ino and Pieris napi, which
accounted for 24% of all individuals. In addition, 12 species were found outside the
study sites: Carterocephalus palaemon, Papilio machaon, Pieris brassicae, Pontia
daplidice, Colias hyale, Satyrium pruni, Glaucopsyche alexis, Issoria lathonia, Vanessa
atalanta, Vanessa cardui, Nymphalis io and Nymphalis antiopa (nomenclature after
Kullberg et al. 2002).
According to k-means clustering of butterfly assemblages the type of vegetation
was not decisive for the structure of the assemblage, since assemblages in habitats
with different plant associations could be similar and vice versa. The clustering indi-
cated four large groups of assemblages (Table 2), after rejection of two mire assem-
blages which formed independent clusters and were thus excluded from all further
considerations. The groups were as follows: 1) The peatland group included
assemblages of both bogs and mires and adjoining dry pine forests. 2) The open
environment group included assemblages of dry open meadows, roadsides
and forest habitats situated near open environments. 3) The forest meadow
group included assemblages of forest meadows and treeless glades with rich veg-
etation, located apart from open environments. 4) The forest group included
assemblages of sparsely wooded glades, tracks and small overgrown forest meadows.
Means of pairwise Euclidean distances within groups indicated that the peatland group
was the most homogenous one (Table 3). The differences between groups were all
significant (one-way ANOVA: F=39.75, df=3, 1485, p<0.0001).
Tab. 2. Clustering of the butterfly assemblages. Given are numbers of assemblages as represented in the
four groups revealed by k-means clustering. Two outlier assemblages at the MIR-sites were excluded
from the analysis.
MIR DPF HPF HBF HAF SFM HFM DFM DOM RDS total
Peatlands 14 5 - - - - - - - - 19
Open environments - | 3 - - - 3 # 14 5 33
Forest meadows - 2 4 2 - 4 8 5 - | 26
Forests - 4 9 6 5 3 | 3 - - 31
22 GORBACH & SAARINEN: Butterfly from Onega Lake Area in Karelia
Tab. 3. The number of species, the density of individuals, and the similarity, species diversity and
dominance in the four groups of butterfly assemblages. The differences between groups were significant
in each category (one-way ANOVA, see Results section). * number of pairwise Euclidean distances to
be compared.
Open Forest
Peatlands environments meadows Forests
n=19 n=33 n=26 n=31
*n=171 *n=528 *n=325 *n=465
Number of species observed
mean VP, 1229 10.2 Tes
SD 2.8 3.9 3.8 3.4
Individuals per hectare
mean ; 49.7 88.2 33.2 34.8
SD 45.9 313 265 28.7
Euclidean distance*
mean 0.128 0.146 0.155 0.158
SD 0.029 0.028 0.035 0.036
Shannon index (H’)
mean 1192 DD] 1.99 1.60
SD | 0.30 0.29 0.39 0.47
Berger-Parker index (d)
mean 0.31 022 0.29 0.42
SD 0.07 0.06 OAI 0.19
In the four groups the average number of species was highest in open environments
and lowest in peatlands (one-way ANOVA: F=16.86, df-3, 105, p<0.0001). Accord-
ing to rarefaction curves, the species richness was rather equally high in open environ-
ments and forest meadows, and equally low in forests and peatlands (Fig. 2). The
average density of individuals varied from 34.8 individuals ha” in forests to 88.2 indi-_
viduals ha ! in open environments (one-way ANOVA: F=13.46, df=3, 105, p<0.0001).
Species diversity was highest in the assemblages of open environments and lowest in
forest assemblages (one-way ANOVA: F=19.19, df=3, 105, p<0.0001).
Peatland assemblages were dominated by Boloria aquilonaris, Albulina optilete
and Callophrys rubi; those of open environments by Pieris napi, Aphantopus hyperantus
and Nymphalis urticae; those of forest meadows by Erebia ligea, Brenthis ino and
Gonepteryx rhamni; and those of forests by Brenthis ino. The Berger-Parker index
indicated the highest dominance in forest assemblages. The differences between groups
were all significant (one-way ANOVA: F=7.89, df=3, 105, p<0.0001).
A total of 47 species exhibited a significant habitat preference as defined in the
Methods section (Table 4). Five species were observed only in peatlands (Boloria
eunomia, B. freija, Coenonympha tullia, Erebia embla, Oeneis jutta). Others were
exclusive to open environments (Pieris rapae, Lycaena hippothoe, Coenonympha
glycerion) or forest (Pararge aegeria, Erebia euryale). There were 30 species with a
preference for a single habitat type. The number of species showing distinct habitat
preferences varied from 7 in forests to 23 in open habitats. The highest localisation of
the populations across the environments was recorded for Pyrgus malvae, P. alveus,
Nota lepid. 25 (4), published 2003: 267-279 273
Forest
meadows
Open
environments
Forests
Peatlands
Fig. 2. Rarefaction curves for the four groups of butterfly assemblages. S — expected number of species,
N — number of individuals (sample size).
Aricia eumedon, Boloria freija, B. titania, Euphydryas maturna, Erebia euryale,
Coenonympha glycerion, Pararge aegeria and Lasiommata petropolitana.
PCA produced two significant components which together accounted for more than
75% of the data variance (Table 5). The first component included significant factor
loadings for assemblages of forests and forest meadows. Along the second axis, the
butterfly assemblages of open habitats contrasted with those of peatlands. Thus, PCA
results indicated three main trends in the variation of butterfly abundances: an affinity
of species to forest environments, open environments, or peatlands (Fig. 3).
Discussion
A total of 62 species found in the two localities correspond to 71% of all species
known from Russian Karelia. Only 12 species previously recorded from the Onega
Lake area in Karelia were not observed. Of these, some have a more or less disjunct
distribution in Russian Karelia (Pyrgus centaureae, Lycaena helle, Aricia nicias,
Argynnis niobe, Boloria frigga, and Coenonympha pamphilus), while others are known
from a few populations on the shores or islands of Lake Onega (Hesperia comma,
Parnassius mnemosyne, Maniola jurtina, and Maniola lycaon) or as single finds in the
area (Colias crocea, Lycaena phlaeas) (Kaisila 1947; Kozlov 1983; Kutenkova 1989).
In general, only a few local or migrant species distinguish the provincial fauna from
the faunas of adjacent areas (Peltonen 1947; Kozhantshikov 1958; Sotavalta 1987).
274 GORBACH & SAARINEN: Butterfly from Onega Lake Area in Karelia
Tab. 4. Butterfly species and the density of individuals ha’! in the four groups of assemblages (M=
mean, SD= standard deviation). Ps indicates the proportion (%) of the sites in the group occupied by the
species. The habitat preference of the species is indicated in bold type. *no significant preference.
Nomenclature follows the checklist of Kullberg ef al. (2002).
Peatlands Open environments Forest meadows Forests
MSD Ps MESSD Ps M SD Ps M SD Ps
Pyrgus malvae* OH O.SA ES - 0.0. 02 06 10 - -
P. alveus - - = OS 20-2 - - = 0.1 oe
Carterocephalus silvicola - - = - - = 0:2 0.8726 0.52 HE SIG
Thymelicus lineola - - 7 34 73 70 CMD 0.1 "2076
Ochlodes sylvanus - = 3.2 44 55 es) Oasis IS ik ©
Leptidea sinapis - TU 1.6 49 24 Oe 1326 3.2. 10905
Anthocharis cardamines Oe Ors whl FO 20 24 2.2 24 45 1.2. 245225
Aporia crataegi oe - 2.1: 2,9033 Oe al 23 0.1, POS
Pieris rapae - - = 1222/9071 - re - =) = ae
P. napi - = = 109 84 97 2.8 4.1 48 2.1 42 42
Colias palaeno 33 45 74 Ont Vor 3 0.1 2024256 0.1 720275
Gonepteryx rhamni 0520.92 26 3:0. 25.085385 6.1 6.1 74 1.1 TI»
Callophrys rubi 8.4 11.4 84 0 0:5) 12 3.0 4.8 45 32 3a
Lycaena virgaureae | - - = 192787236 05" 25 - - =
L. hippothoe - - = 2:53 8:6) 15 - - = - - =
Celastrina argiolus N UC? 2 TT 0.8 1.8 23 0.3 1.239
Aricia artaxerxes - - = 14 46 18 OASIS NS 0:17 03
A. eumedon - - = 0.6 2.8 6 Ol 409, ye3 0.1 O07 6
Plebeius argus 26) 23.0058 16 43 24 OG 26 6 - = en
P. idas 2.700 2,2065 ee 3S POSE 0.3 ars
Albulina optilete 945235100 - = = 02 05696 0.1 2028
Polyommatus semiargus - - = 2:6 OSS) VS NG - Zu =
P. amandus - - = 33 AM, 61 0.4 1.1 16 0.1 20. Je
P. icarus O38. OO. jl 4.37 "4 70.02 7.0310 0.17 UT
Argynnis paphia - TH 212 7:0,.45 2.6 84 16 0.9 SMIE
A. aglaja - UE E28 52 2.0: 2:8 42 1.3°. 3.5593
A. adippe - - = hs 2 2:5:..:45 1.0, 229298 - u:
Brenthis ino DAL OS 2.0. Bl CSS 6.3 10.0 84
Boloria eunomia 1 2 804,53 - - = - - = - - =
B. euphrosyne Varel! O0 973 16 44 13 027006283
B. selene - - = 3.6 44 64 2.1= 292 45 1.1 7 0887
B. titania* - - = OAI CS Od OW 3 0.27 70.80
B. freija 1:0, > 3:57 11 - - = - Sry - - =
B. aquilonaris 10.7 9.8 84 - - = - - = 0002156
Araschnia levana - - = OSes ks el) 2.01: 5.299
Nymphalis urticae OST) OMS (6 8.6 6.1 94 2.0 ES 0:3 0.9723
N. c-album - - = 1:6) 23:8 730 (LEONA 20) 0.2 OS ats
Euphydryas maturna On 0:42 > 07-162 29 - - 0. 0.1, 0:78
Melitaea athalia = - = 0.37 AIR 06 1.7 310 0.2 0.9756
Limenitis populi - = 01704 729 0.32 715. 73 2.4 45 35
Pararge aegeria - - = - Le: - - = 0.6 2.1 10
Lasiommata maera OD) 9 i0:Ge il 2,936 2.5 41 42 0:6 : 2.077168
L. petropolitana - - 012083, 3 14 252710 - -
Coenonympha tullia 05 14 11 - 0.0. - Se - - =e
C. glycerion - = = Jes 6 NO). 1A - - = - - =
Aphantopus hyperantus One 03 ees 8909710082 OS 626 0.5 « 100025
Erebia ligea 0,0352 2 7.3. 3748 4.3 7.1268
E. euryale* - - = - - = - - = 0.3. lt se
E. embla 16 4.1 26 - are ie - dE - San
Oeneis jutta 2 ESS Al - = = ale 5 TO
Tab. 5. Eigenvalues of the principal components and the factor loadings (values >0.7 in bold) of the four
groups of butterfly assemblages.
Principal component PC-1 PE=2
Eigenvalue 1.846 1147
Cumulative % variance explained 46.2 1946
Peatlands —0.275 1.000
Open environments 0.508 —0.823
Forest meadows 1.000 0.240
Forests 0.924 0.490
2,5 x | X—X
= rubi | opti aqui
5 i
oO
euno
x
idas pala
x x
D + popu | argu x jutt
ae %leva EUPh agi =X x embl
Eh age Xe
paph © agla Var | a % eume ul
rham Donat? où
OsEIE |! adip- GO Virg rapa
/ semi OF oa hipp
eae glyc
© sylv
% woodland species
O grassland species
X peatland species
-2,5 =
2,5 | 0,0 Pe 725
Fig. 3. PCA ordination diagram of butterfly species (indicated as four-letter codes derived from species
epithets) along the first two principal components. Seven species printed exactly upon the borders of the
diagram are due to a reduction in the graphic area. Three groups (collapsing forests and forest meadows,
see Table 5) were defined according to the highest densities of the species (Table 4), excluding three
species with no preference for any of the environment groups as they emerged from a k-means clustering.
The abundance of the majority of butterfly species in the study area was similar to that
in the Onega Lake area in the 1940s (Kaisila 1947) as well as in SE Finland in the
1990s (Marttila et al. 2001). The most abundant species included Pieris napi, Gonepteryx
rhamni, Callophrys rubi, Brenthis ino, Nymphalis urticae, Aphantopus hyperantus and
Erebia ligea. In contrast, Papilio machaon, Pieris brassicae, Nymphalis antiopa and
Boloria euphrosyne had a surprisingly low abundance in the study area. Species with
relatively discrete populations (e.g., Pyrgus alveus, Boloria titania, Boloria freija, Erebia
276 GorBACH & SAARINEN: Butterfly from Onega Lake Area in Karelia
euryale and Pararge aegeria), in addition to other local species, are probably the most
vulnerable in the provincial fauna, although some had rather high abundances in par-
ticular sites. :
Butterflies in the Onega Lake area are concentrated in more or less open habitats
within forests, including peat bogs and mires, and non-cultivated areas in arable land-
scapes. The average density of butterflies was rather similar in comparison to other
studies carried out in the middle and southern taiga. In a pine bog in SE Finland,
Väisänen (1992) reported 58 individuals ha’. In arable landscapes in Finnish and Rus-
sian Karelia, 45 to 101 individuals ha’ were recorded on field boundaries (Saarinen &
Jantunen 2002). In addition, the lists of dominant and common species commonly
coincided. Some differences may be due to the fluctuation of butterfly populations
between the years. In addition, the number of species and the total density in the as-
semblages varied substantially. The phenomenon is a consequence of two reasons.
Firstly, the assemblages with varying number of species and total density were united
into a few groups according to their similarity of structure. For example, the highest
variation in total density was recorded in the peatland group, which was an amalgama-
tion of more abundant assemblages of peat bogs and mires and less abundant assem-
blages of dry pine forests. Differences in their structure, however, were the lowest
among the four groups of assemblages. Secondly, the quality of the environment for
species may differ even between similar habitats. This effect, however, is impossible
to assess without detailed investigation of many factors. No doubt the most important
ones are the presence of a sufficient number of food plants for larvae and adults, and a
favourable meso- and microclimate (e.g., Holl 1995; Dover et al. 1997). It is also
necessary to take into consideration the position of a habitat in the surrounding land-
scape matrix and its degree of isolation. Some species are mobile and counts may
reflect the attraction of individuals to nectar sources (Pollard 1977). For example, the
flowering of Potentilla palustris resulted in a. high density of Boloria aquilonaris,
while the concentration of another abundant species, Callophrys rubi, was a conse-
quence of the flowering of Chamaedaphne calyculata and Ledum palustre. Hence the
presence and the density of butterfly species may strongly depend on the abundance of
these plants in the habitat. In the majority of cases, however, the number of species and
the high density of individuals did not result from trophic migration of adult butter-
flies, but seems to indicate the most favourable habitats. Butterfly movements are
commonly short (e.g., Scott 1975; Ehrlich 1984; Thomas 1984) and the migration of
individuals to suitable habitats is in most species not a mass phenomenon (e.g., Demp-
ster 1991; Shreeve 1992; Hanski & Kuussaari 1995). The intensity of migration may
depend on distance and the availability of natural barriers between habitats. The effect
of a possible concentration of butterflies in small areas within the boundaries of one
site was reduced by using several transects spread evenly across each site.
The structure of the assemblages was characterised by indices of species diversity
and dominance, which are inversely correlated with each other; the higher the diver-
sity, the lower the dominance. Low species diversity and higher dominance in the
peatland assemblages may be explained by extreme levels of humidity and specific
plant associations, while forest assemblages were impoverished by the most shady
Nota lepid. 25 (4), published 2003: 267-279 274
conditions and the poverty of ground layer vegetation. Consequently, these habitats
were unsuitable for most species, and those observed usually appeared in small num-
bers. In contrast, higher species diversity and low dominance in the assemblages of
open environments indicated that habitats are suitable for the majority of species in the
study area.
The most important differences between the assemblages are due to a great extent
to the habitat-specific species. In general, our results further endorsed previous knowl-
edge of the habitat preferences of butterflies in the boreal zone (Marttila et al. 2000).
Based on the analyses of the structural variation we conclude that the peatland
group is distinct from the rest. This fauna is mainly composed of tyrphobiont and
tyrphophilous species. Due to their close association with peatlands, the ability of the
latter in regard to transition to other habitats is extremely limited (Mikkola & Spitzer
1983). Most butterfly species, however, are able to utilize different habitats, even though
in different abundances. Thus, the assemblages from forest and open environments did
not differ significantly with respect to species composition, but abundances of the
species varied substantially. In general, the separation of the fauna into woodland and
grassland species is a result of the anthropogenic transformation of a once continuous
coniferous forest cover. Prior to human alteration of pristine landscapes, species pre-
ferring open habitats apparently existed as small populations in forest openings, such
as glades and unforested bedrock, as well as on shore meadows. Later on, these spe-
cies moved into anthropogenic meadows and due to increasing numbers of individu-
als, they have become noticeable elements of the fauna. The assemblages of forest
meadows can be considered as a transitional stage to open meadow assemblages. This
standpoint conforms to Nitzenko’s (1969) hypothesis about the origin of meadow plant
associations in the middle taiga. Due to the trophic specialisation of butterflies, we
may suppose that butterfly species followed their host plants on to the meadows. The
increase in numbers of individuals was probably caused by a gradual increase of food
resources, with many herbs finding more favourable conditions in open habitats. In
addition, some butterflies might penetrate from southerly areas and so form resident
populations in suitable sites. The formation of a butterfly assemblage in meadows was
accompanied by an increase in species diversity, as numerous grassland species ap-
peared in addition to abundant and common woodland species. The overgrowing of
meadows leads to the impoverishment of the species composition and a reduction in
total abundance in the butterfly assemblage. This is illustrated in deciduous forests in
the taiga zone, which according to Ramenskaya (1958) are a result of the overgrowth
of meadows due to lack of management. We predict that the structure of any local
fauna in the middle taiga is defined by the proportion of peatland, forest and open
environments in the area and the heterogeneity of the habitats available in the land-
scape matrix.
Acknowledgements
The authors gratefully acknowledge Ernest V. Ivanter, Sergei D. Uzenbaev, Andrei V. Korosov and
Nadezhda N. Kutenkova for their support and help in the study. We are also indebted to Leigh Plester
and two anonymous referees for valuable comments on the manuscript.
278 ; GORBACH & SAARINEN: Butterfly from Onega Lake Area in Karelia
References
Ahti, T., Hamet-Ahti, L. & Jalas, J. 1968. Vegetation zones and their sections in northwestern Europe. —
Ann. Bot. Fen. 5: 169-211.
Dempster, J. P. 1991. Fragmentation, isolation and mobility of insect populations. Pp. 143-153 in: N. M.
Collins & J. A. Thomas (eds.), The conservation of insects and their habitats. - Academic Press, San
Diego, CA.
Dover, J. W., Sparks, T. H. & Greatorex-Davies, J. N. 1997. The importance of shelter for butterflies in
open landscapes. — J. Insect Conserv. 1: 89-97.
Ehrlich, P. R. 1984. The structure and dynamics of butterfly populations. Pp. 25-40. In: R.I. Vane-
Wright & P.R. Ackery (eds.), The biology of butterflies. - Academic Press, London, UK.
Gromtzev, A. N. 1993. [Landscape conformities to natural laws of structure and dynamics of mid-taiga
pine forests in Russia]. — Karelian Res. Cent. Rus. Sci. Acad., Petrozavodsk. 160 pp. [russ.].
Günther, A. K. 1896. [List of Lepidoptera found in Olonets province]. — Izv. St. Petersb. Biol. lab. 1: 21—
33. [russ.].
Hanski, I. & Kuussaari, M. 1995. Butterfly metapopulation dynamics. Pp. 149-171. In: N. Cappuccino
& P.W. Price (eds.), Population dynamics: New approaches and synthesis. — Academic Press, San
Diego, CA.
Holl, K. D. 1995. Nectar resources and their influence on butterfly communities on reclaimed coal
surface mines. — Restoration Ecol..3: 76-85.
Ivanter, E. V. & Kuznetsov, O. L. (eds.) 1995. [Red data book of Karelia]. — Karelia, Petrozavodsk. 286
pp. [in Russian].
Jeffers, J. N. R. 1978. An introduction to systems analysis: with ecological applications. - Arnold, London.
198 pp.
Kaisila, J. 1944. Züge aus der Schmetterlingsfauna der Umgebung von Karhumäki in Ostkarelien. —
Ann. Ent. Fen. 10: 104-122.
Kaisila, J. 1945. Züge aus der Schmetterlingsfauna der Umgebung von Karhumäki in Ostkarelien. —
Ann. Ent. Fen. 11: 113-117. |
Kaisila, J. 1947. Die Macrolepidopteren Fauna des Aunus-Gebietes. — Acta Ent. Fen. 1: 4-112.
Karvonen, V. J. 1945. Beobachtungen über die Insektenfauna in den Gegend von Vaaseni am mittleren
Lauf der Suwari (Swir). — Ann. Ent. Fen. 11: 39-54.
Kotiranta, H., Uotila, P., Sulkava, S. & Peltonen, S.-L. (eds.) 1998. Red data book of East Fennoscandia.
— Ministry of the Environment, Finnish Environment Institute and Botanical Museum, Finnish Mu-
seum of Natural History, Helsinki. 351 pp.
Kozhantshikov, I. V. 1958. [New facts in the study of fauna and ecology of the Lepidoptera of Karelian
Isthmus]. — Proc. Zool. Inst. Acad. Sci. USSR 24: 3-88. [in Russian].
Kozlov, M. V. 1983. [Materials on fauna of Lepidoptera, Rhopalocera of Nature Reserve Kivach (Karelian
ASSR)]. — Pp. 1-10, Leningrad. [russ., manuscript deposited in the All-Union Institute of Science
and Technical Information, St. Petersburg] .
Kullberg, J., Albrecht, A., Kaila, L. & Varis, V. 2002. Checklist of Finnish Lepidoptera —Suomen perhosten
luettelo. — Sahlbergia 6: 45-190.
Kutenkova, N. N. 1986. [Lepidoptera of Nature Reserve Kivach]. Pp. 123-158 in: E. B. Yakovlev & S.
D. Uzenbaev (eds.), [Fauna and ecology of arthropods in Karelia]. — Acad. Sci. USSR, Petrozavodsk:
Karelian Centre of the USSR Academy of Sciences. [In Russian].
Kutenkova, N. N. 1989. [Lepidoptera of Nature Reserve Kivach. Flora and Fauna of Nature Reserves of
the USSR]. — Moscow. 59 pp. [In Russian].
Lahtivirta, K. 1939. Havaintoja Terijoen pitäjän Kuokkalan alueen suurperhosfaunasta. — Ann. Ent. Fen.
5: 125-140.
Legendre, P. & Gallagher, E.D. 2001. Ecologically meaningful transformations for ordination of species
data. — Oecologia 129: 271-280.
Magurran, À. E. 1988. Ecological diversity and its measurement. — Princeton University Press, Princeton,
NJ. 179 pp.
Marttila, O., Saarinen, K., Aarnio, H., Haahtela, T. & Ojalainen, P. 2000. Päiväperhosopas. Suomi ja
lähialueet. — Tammi, Helsinki. 232 pp.
Nota lepid. 25 (4), published 2003: 267-279 279
Marttila, O., Saarinen, K. & Lahti, T. 2001. Valtakunnallinen päiväperhosseuranta — Ensimmäisen 10-
vuotisjakson (1991-2000) tulokset. — Baptria 26: 29-65.
Mikkola, K. & Spitzer, K. 1983. Lepidoptera associated with peatlands in central and northern Europe:
a synthesis. — Nota lepid. 6: 216-229.
Möberg, K. 1925. Beiträge zur Kenntnis der Lepidopterenfauna des Leningrad Gouvernements. —Ann.
Zool. Mus. Acad. Sci. USSR 24: 277-328.
Nitzenko, A.A. 1969. [A contribution to the history of formation of recent types of parvifoliate forests in
the north-west of the European part of the USSR]. — Botan. J. 54: 3-12. [in Russian].
Peltonen, ©. 1947. Vienan perhosfaunasta. — Ann. Ent. Fen. 13: 131-144.
Pollard, E. 1977. A method of assessing changes in the abundance of butterflies. — Biol. Conserv. 12:
115-134.
Pollard, E. & Yates, T. J. 1993. Monitoring butterflies for ecology and conservation. The British butterfly
monitoring scheme. — Chapman & Hall, London. 274 pp.
Ramenskaya, M. L. 1958. [Meadow vegetation in Karelia]. —- Gosizdat KASSR, Petrozavodsk. 400 pp.
[in Russian].
Romanov, A. A. 1961. [About climate of Karelia]. — Gosizdat KASSR, Petrozavodsk. 140 pp. [in Russian].
Saarinen, K. & Jantunen, J. 2002. A comparison of butterfly fauna of agricultural habitats under diffe-
rent management history in Finnish and Russian Karelia. — Ann. Zool. Fen. 39: 173-181.
Saarinen, K., Jantunen, J. & Gorbach, V. V. 2002. Päiväperhoset Suomen ja Venäjän Karjalan
maatalousympäristöissä. — Baptria 27: 69-74.
Scott, J. A. 1975. Flight patterns among eleven species of diurnal Lepidoptera. — Ecology 56: 1367—
BR.
Shreeve, T. G. 1992. Monitoring butterfly movements. Pp. 120-128. Jn: R. L. H. Dennis (ed.), The
ecology of butterflies in Britain. — Oxford University Press, Oxford.
Smith, E. P. & van Belle, G. 1984. Nonparametric estimation of species richness. — Biometrics 40: 119-
129. |
Sotavalta, O. 1987. Provincial distribution of Finnish Macrolepidoptera. — Notulae Entomol. 67: 187—
205.
Thomas, J.A. 1984. The conservation of butterflies in temperate countries: past efforts and lessons for
the future. Pp. 333-353. Jn: R. I. Vane-Wright & P. R. Ackery (eds.), The biology of butterflies. —
Academic Press, London, UK.
Volkov, A. D., Gromtsev, A. N. & Erukov, G. V. 1990. [Ecosystems of landscapes of west middle taiga].
— Karelia, Petrozavodsk. 284 pp. [in Russian].
Väisänen, R. 1992. Distribution and abundance of diurnal Lepidoptera on a raised bog in southern Finland.
— Ann. Zool. Fen. 29: 75-92.
Yakovlev, F. S. & Voronova, V. S. 1959. [Types of forests in Karelia]. — Karelia, Petrozavodsk. 190 pp.
[in Russian].
280
Book review
Book Review
Kudrna, O., 2002. The Distribution Atlas of European Butterflies. — Oedippus 20: 1-342.
Naturschutzbund Deutschland e.V. & Gesellschaft fiir Schmetterlingsschutz e.V. in coopera-
tion with Apollo Books, Stenstrup, Denmark. — ISBN 87-88757-56-0. Price: € 50.00.
This book embodies the first tangible result of a very ambitious undertaking, the ongoing project Map-
ping European Butterflies (MEB). Conceived and headed with remarkable energy and determination by
the well-known lepidopterist Dr. Otakar Kudrna, this project has been made possible by the selfless
participation of as many as 254 contributors. It has only taken about six years to get this far — not a small
feat considering the multitude of bureaucratic, logistical, methodological and financial obstacles that
have plagued MEB from the beginning. These preliminary statistics are impressive and this book will
surely attract considerable interest.
Kudrna’s views on butterfly taxonomy and conservation present many points of interest. The check-
list of species makes fascinating reading for those with a penchant for taxonomy and nomenclature of
European butterflies, whether they agree with Kudrna’s opinions or not. His views on the often bureau-
cratic approach to butterfly study and conservation in Europe are doubtlessly going to find a sympathetic
audience. On the taxonomic side, I personally applaud the decision to ‘lump’ many traditionally recog-
nized genera (e.g. Brintesia, Kanetisa, Chazara, Pseudochazara, Neohipparchia, Pseudotergumia,
Parahipparchia, Arethusana, Satyrus and Minois are all rolled into Hipparchia) which I see as a step in
the right direction — away, that is, from the splitter-dominated mentality of the past several decades. The
species list likewise presents numerous points of interest to the taxonomist, and will stir up a storm of
- conflicting opinions depending on one’s side on the splitter/lumper barricade. I found myself in agree-
ment with e.g. the treatment of Pieris balcana, Coenonympha darwiniana, C. elbana, Polyommatus
sagratrox and P. abdon as belonging to P napi, C. gardetta, C. corinna, P. golgus and P icarus respec-
tively. On the other hand, treating e.g. Colias werdandi, Coenonympha iphioides, Erebia arvenensis
[recte arvernensis], E. serotina, Hipparchia amymone, H. tisiphone, Polyommatus exuberans and P.
violetae as bona species seems poorly if at all justified. The taxon Callophrys butlerovi is not a synonym
of C. rubi (Kudrna 1996) but of C. suaveola (Gorbunov 2001). Polyommatus fulgens is not a synonym of
P. ripartii as it belongs to a species group with blue, not brown males. Polyommatus menelaos, endemic
to Mt. Taygetos (S Greece), is not even mentioned as a synonym under either P. eros or P. eroides. Two
other recently described Polyommatus are also omitted without explanation: P. slovacus, a bivoltine
relative of the univoltine P coridon, and P. andronicus, a univoltine montane taxon endemic to the
Balkans and closely related to the ubiquitous plurivoltine P. icarus. However, Kudrna’s book is not
intended as a comprehensive taxonomic revision of the European butterfly fauna and certainly should
not be regarded as such. So let us concentrate on its main point: the distribution of the European butter-
flies.
The 451 maps look good though their typographical quality could be better. Records are mapped by
means of three symbols according to date. Because of the controversial status of some taxa, or the
inability of all recorders to differentiate between similar species, in many cases several such taxa had to
be united and plotted on a single map. |
The geographical scope is probably one of the main selling points of the book. In a most welcome
departure from the annoying tradition of ‘European’ butterfly guides, it includes the eastern part of the
continent up to its natural eastern border with Asia (the Urals), while North Africa is rightly excluded.
However, the choice of an arbitrary south-eastern border for Europe — across the foothills and plains
north of the Caucasus — is poor judgement. The border between Europe and Asia in the area between the
Caspian and Black Seas lies unambiguously along the main ridge of the Great Caucasus, just as the main
ridge of Ural Mts. forms the eastern border between these two continents. Excluding the northern Great
Caucasus from Kudrna’s ‘Europe’ is unfortunate, as this is a region very rich in butterfly species (at least
196), no fewer than 21 of which occur nowhere else in Europe (Gorbunov 2001). There are a few false or
doubtful identities. The records of “Colias hyale” from the southern Balkans are, in my opinion, suspect
and most probably refer to misidentified specimens of the similar C. alfacariensis; true hyale has so far
Book review 281
been found in the northern and central Balkans only. The records of “Spialia sertorius” from the south-
ern part of the Balkan Peninsula actually refer to S. orbifer, while those of “Plebejus pylaon” from
Greece and Crimea belong to P. sephirus. The closely related and probably conspecific taxa Aricia
artaxerxes and A. montensis are shown in two separate maps, according to which both taxa occur in the
Iberian Peninsula (moreover, the dots are exactly the same on both maps): a clear error, as only montensis
occurs there (Tolman & Lewington 1997). The records of “Polyommatus eros” from polar Ural belong
to P. kamtshadalis (Gorbunov 2001). The dot marking the occurrence of “Hipparchia cingovskii” in NW
Greece is attributable to “A. [mniczechii] tisiphone”; cingovskii is endemic to the Republic of Macedo-
nia (Tolman & Lewington 1997). But all these are trivial points. The most serious problem of MEB is the
project’s very core, the Reference Locality System (RLS) for data mapping. To put it simply, it does not
work, and below I am going to show why this is so.
Kudrna argues that existing mapping systems and particularly the popular UTM (Universal Trans-
verse Mercator) grid system are unsuitable for the purposes of MEB. He writes (p. 9): “[The UTM grid]
would be a wonderful universal system if the Earth were flat, which it is not. Because the Earth is round
compensating triangles are necessary to counterbalance the squares. This means that the ideally shaped
square, the only true reason for using this system, is not generally available on the map.” This puzzling
statement shows that Kudrna has missed the idea of UTM by a very wide margin indeed, which is
remarkable considering how simple it is: to identify each point on the Earth’s surface by means of a
unique ‘map address’, i.e. full UTM coordinates measured east and north from two perpendicular refer-
ence baselines. Which the UTM does quite well, hence its popularity. Besides, an increasingly important
practical reason to use UTM in mapping distributions of living organisms is that the use of GPS receiv-
ers in the field is rapidly becoming a popular way for determining the precise coordinates of localities,
and most GPS receivers offer UTM as a coordinate system option. Kudrna deems working directly with
latitude/longitude data equally unsuited for MEB as the use of co-ordinates “would have made the data
subject to many errors and their input very awkward, and certainly subject to further errors” (p. 10). This
statement is ironic since the author’s own system can — and does — produce errors of unsurpassed mag-
nitude. The subsequent claim that “it is much easier to check any record under the name of a reference
locality [see the definition below] than under the impersonal geographical co-ordinates” (p. 10) is sim-
ply ludicrous. All these introductory remarks on the subject of mapping do nothing to boost one’s belief
in the author’s competence and ability to design a functioning mapping system. For, having decided that
no existing system lives up to MEB, this is exactly what he has done. The prototype is an obsolete
invention from Communist Czechoslovakia (Kudrna is Czech-born) where until 1989 the general use of
detailed topographical maps was forbidden. Under these conditions “a useful system of pre-selected
localities referring to map ‘squares’” has been designed. Not deterred by the fact that the socio-political
environment in which this system had been conceived is long since extinct, the author applies it, under
the name Reference Locality System (RLS), to the whole of Europe. This is supported with the argument
that apart from the Czech Republic “a similar system is also being used in Norway and possibly [my
italics] in other European countries” (p. 10). At the same time, the rejection of UTM is backed with the
claim that “the UTM grid is not a standard European system” (p. 9). This may be so — but RLS does not
come even close. The examples of comprehensive projects using UTM for mapping the distributions of
various groups of organisms, including butterflies, are just too numerous to be listed here. But let us
judge RLS on its own merits. |
The basic idea of the RLS is to convert coordinates of real localities into coordinates of “reference
localities” (RLs), meaning human settlements or, exceptionally, prominent landmarks (such as mountain
summits) rather arbitrarily picked out of the Times Atlas. These are then plotted into a 60' x 30! (called
by Kudrna “30! x 60°”) grid by a computer program specially written for MEB. Theoretically this proce-
dure might work quite well for a densely populated territory (such as the Czech Republic) where one can
hope to find a convenient RL for most if not all actual localities. But huge territories in northern Europe
are much more sparsely populated. There is a tacit admission of this ‘inconvenience’ since tens of locali-
ties not found in the Times Atlas map have been added in the case of Russia. Even so, the map on p. 32
shows that eastern Europe has many 60' x 30' grid units not covered by a single RL. Finally, the density
of RLs varies immensely between countries, and one wonders how Kudrna has decided what is a suffi-
cient number of RLs for a given country: witness the disparity between Bulgaria (111000 km’, 110 RLs)
282
Book review
and its southern neighbour Greece (132000 km’, 372 RLs), or between Italy (301000 km’, 797 RLs) and
Finland (338000 km’, 230 RLs)! This means an extremely uneven RL/km? coverage, which in turn
means that the distance between a random locality and the nearest RL will vary greatly. While it should
be obvious to anyone that such factors should never be allowed to bias the performance of any mapping
system, they are unfortunately by no means the worst flaws of MEB’s RLS.
The handbook for recorders (Kudrna 1996) details the procedure for compiling records in RLS-
compatible form. Each recorder is provided with 1) a species list, 2) a list of RLs for the respective
country, 3) detailed instructions for filling in the forms, down to the type of pen and colour of ink to use,
and 4) a photocopy of the relevant country map from the Times Atlas. For each actual locality the
recorder is to 1) determine the nearest pre-approved RL from the map, and either 2a) fill in the name of
that RL in the appropriate field, or 2b) if there is “good reason” to use a RL which is on the Times Atlas
map but not on the list, its coordinates must be written down as given in the Times Atlas. With these clear
instructions, can anything possibly go wrong? Oh yes.
RLS might have actually worked had Kudrna taken the extra step of sending the recorders, together
with the copy of the map, the-actual grid in which the dots will finally appear. This would have been vital
considering the way RLS works, which shall be demonstrated with the aid of the following hypothetical
situation (F1g.1a). A, B and C are legitimate RLs and the black dot marks the site X of a butterfly record.
Following Kudrna’s instructions there is no difficulty in converting X to the clearly nearest RL, C. The
recorder’s job is done and the computer’s job begins. It should be remembered at this point that the
mapping software will plot the co-ordinates of the RL in 60’ x 30’ grid. Let us also keep in mind that we
have no idea what this grid is nor is there anything in the detailed instructions to suggest to us that it is of
any significance. The grid has therefore not influenced our choice, but it does influence that of the
computer. So the program, using the pre-programmed (hypothetical) grid (Fig. 1b), plots the dot (Fig.
lc). Well, this is just what one expects of a properly working mapping system: the dot and the actual
locality are in the same grid unit. But in fact this is a matter of pure chance in the case of RLS, as in
exactly the same situation (Fig. 2a) the grid might as well be something like in Fig. 2b ...
Now this is not what one expects of a properly working system. And this is why Kudrna’s RLS is not
one. Had the grid been available to recorders together with instructions to choose not the nearest RL but
one in the same grid unit as the actual locality, the system would have worked, though clumsily. But no.
RLS can therefore only work for localities situated either inside or in the immediate vicinity of the pre-
approved RLs. One may object that in the densely populated regions of western and central Europe there
is a good chance that a random actual locality and the nearest RL will happen to be situated in the same
grid unit. This may indeed be so, but what practical value does this system have if, looking at the maps,
one can never be sure whether a given dot is in the same grid unit as the locality represented by that dot?
Moreover, it is easy to see that the probability of error increases dramatically with the increase of dis-
tances between RLs, as in northern or eastern Europe. There our example may well look like Fig. 3. In
fact, in very sparsely populated regions the probability that a random locality and the nearest RL (mean-
ing the final dot) will happen to be in the same grid unit becomes very slim.
Book review 283
The above example is purely hypothetical but the point it makes is only too real. No great effort is
needed to detect such errors on the maps in the book. As an example let us take the distribution of the
following 17 species in the Pyrenees: Boloria napaea, B. pales, Colias phicomone, Erebia arvenensis
[sic], E. epiphron, E. gorge, E. gorgone, E. hispania, E. lefebvrei, E. manto, E. oeme, E. pronoe, E.
sthennyo, Pieris callidice, Polyommatus eros, Pyrgus andromedae and P. cacaliae. These all have a dot
(marked with an arrow) in the grid containing the city of Toulouse, as exemplified by the distribution of
Erebia sthennyo and E. pronoe (Fig. 4b). However these species are found in the subalpine and alpine
zone of the Pyrenees, generally above 1500 m (Tolman & Lewington 1997), while the area inside the
grid in question does not exceed 500 m altitude (Fig. 4a) — in fact most of it is even below 200 m. The
‘presence’ of such a species-rich, specialized high-mountain butterfly fauna in the lowlands covered by
this grid unit is clearly an artifact of MEB’s system.
In conclusion, this book fails to deliver what the back cover so exuberantly promises: that “for the
first time Europe will be the first continent ever to have all its butterfly species plotted on precise and
comprehensive distribution maps”. While one might put up with the fact that many of these maps are far
from being comprehensive (which is only natural), or that not all European species are included (which
could be corrected in subsequent editions), the fact that the maps are inherently imprecise can neither be
overlooked nor downplayed. The points appealing to me personally, such as some of Kudrna’s bold and
unorthodox views on butterfly taxonomy and conservation, are side issues in a work purporting to be
above all a distribution atlas. In this light I consider € 50 an exorbitant price for a volume that, in
addition to being of little if any practical use, has soft cover and less-than-excellent print on rough,
cheap-looking paper.
Yet all of the above pales next to the staggering realization that the most valuable asset of MEB, the
huge and in other circumstances priceless database which has taken countless hours of enthusiastic
labour to compile, has been ‘polluted’ beyond repair due to flawed methodology. As this database con-
tains no actual latitude/longitude data, there is no way to convert the records back into a meaningful
form. Unfortunately, Kudrna’s system can neither be mended nor improved: it can only be scrapped. The
only way forward is then to start from square one. And preferably a UTM one at that.
References
Gorbunov, P. Y., 2001. The butterflies of Russia: classification, genitalia, keys for identification
(Lepidoptera: Hesperioidea and Papilionoidea). — Thesis, Ekaterinburg. 320 pp.
Kudrna, O., 1996. Mapping European Butterflies: Handbook for Recorders. — Oedippus 12: 1-60.
Tolman, T. W. & Lewington, R. 1997. Butterflies of Britain and Europe. — Collins Field Guide Series,
Harper Collins Publishers, 320 pp., 104 pls.
ZDRAVKO KOLEV
Nota lepidopterologica
A journal devoted to the study of Lepidoptera
Published by the Societas Europaea Lepidopterologica e. V.
Editor in chief: Prof. Dr. Konrad Fiedler, Lehrstuhl für Tierökologie I, Universität Bayreuth,
D-95440 Bayreuth, Germany; e-mail:
[email protected]
Managing Editor: Dr. Matthias Nuß, Staatliches Museum für Tierkunde, Königsbrücker Landstr. 159,
D-01109 Dresden, Germany; e-mail:
[email protected]
Assistant Editors: Dr. Enrique Garcia-Barros (Madrid, E), Dr. Roger L. H. Dennis (Wilmslow, UK),
Dr. Peter Huemer (Innsbruck, A), Ole Karsholt (Kobenhavn, DK), Dr. Yuri P. Nekrutenko (Kiev,
UA), Dr. Erik J. van Nieukerken (Leiden, NL), Dr. Wolfgang Speidel (Bonn)
Contents ¢ Inhalt » Sommaire
Volume 25 Halle / Saale, 16. 06. 2003 ISSN 0342-7536
Baran, T.: Elachista nolckeni Sulcs, 1992: morphology and bionomics of
es (Gelechioidea: Elachistidae). 97
BELK, A. G. & D. G. ZAMOLODCHIKOV: Notes on systematics of the Erebia
dabanensis species complex, with special consideration of the
dabanensis-youngi and anyuica-occulta pairs of sibling species
I A Fog RE EN EHER RER RE dase 61
ELSNER, G. & J. JAROS: A new species of Ceratoxanthis Razowski, and
distribution records for two species of Aethes Billberg from the Balkan
NS 2 OCAV NAN) 132 c2 5 once onssvinassisnconederanoctavanssoteeiuueraiaasesbacn bsonetaboe 221
FREESE, A. & K. FIEDLER: Experimental evidence for specific distinctness
of the two wood white butterfly taxa, Leptidea sinapis and L. reali
2 cdlodicvuscsecdusosssouconupacénddsdgsbivduovdunetdnasvaxe 39
FIEDLER, K. & C. Rur: Araschnia levana \arvae (Nymphalidae) do not
accept Humulus lupulus (Cannabaceae) as food plant ..........cccccececeeeseeeeseseeeeeeeeees 265
GARCiA-BARROS, E.: Taxonomic patterns in the egg to body size allometry
of butterflies and skippers (Papilionoidea & Hesperiidae). .................224224422442200200.. 161
GORBACH, V. V. & K. SAARINEN: The butterfly assemblages of Onega Lake
Area in Karelia, middle taiga of NW Russia (Hesperioidea, Papilionoidea) ................ 267
HUEMER, P. & O. KARSHOLT: A review of the genus Acompsia Hübner,
fees wıth description of new species (Gelechiidae). ses 109
KALLIES, A. & K. SPATENKA: Four species of Brachodidae new to the
fauna of Europe (Sesioidea)...….....................#..e CRE 155
KARSHOLT, O. & A. Kun: A new species of Ethmia Hübner, 1819 from
the Greek island of Rhodes (Ethmiidae). .......2..2u....0......00 REN... 207
KoLev, Z.: The species of Maculinea van Eecke, 1915 in Bulgaria:
distribution, state of knowledge and conservation status (Lycaenidae)..................... 177,
Lvovsky, A. L.: Check-list of the broad-winged moths (Oecophoridae Sn)
of Russia and adjacent COUMUIES 2..............2.\220000anetaananaunennnnn en en 213
NIEUKERKEN, E. J. v. & A. LASTOUVKA: Ectoedemia (Etainia) obtusa
(Puplesis & Diskus, 1996) new for Europe: taxonomy, distribution
and biology (Nepticulidae)................................. RARE rr 87
Rincwoop, Z., T. GARDINER, A. STEINER & J. HILL: Comparison of factors
influencing the habitat characteristics of Gortyna borelii (Noctuidae)
and its larval foodplant Peucedanum officinale in England and Germany .................. 23
ROUGERIE, R.: Re-capture of Sinobirma malaisei in China: description of
the female genitalia and comments on the systematic position of the
genus in the tribe Urotini (Saturniidae). en eee eee 227
SARTO I Monteys, V.: The discovery, description and taxonomy of
Paysandisia archon (Burmeister, 1880), a castniid species recently
found in southwestern Europe (Castniidae). "a 3
SIELEZNIEW, M., A. STANKIEWICZ & C. BysSTROWSKI: First observation of
one Maculinea arion pupa in a Myrmica lobicornis nest in Poland .......................- 249
SOMMERER, M. D.: Opinion. To agree or not to agree — the question of
gender agreement in the International Code of Zoological
Nomenclature. ......... TR Re eee 191
SPEIDEL, W. & L. AARVK: Synonyms of European Tortricidae and Noctuidae,
with special reference to the publications of Hübner, Geyer and Frülich 17
WAGENER, S.: Chazara persephone (Hübner, [1805]) or Chazara anthe
(Hoffmansegg, 1806) — what is the valid name? (Nymphalidae, Satyrinae) ............... 81
WAKEHAM-Dawson, A., R. PARKER, E. JOHN & R. L. H. Dennis: Comparison of
the male genitalia and androconia of Pseudochazara anthelea acamanthis
(Rebel, 1916) from Cyprus, Pseudochazara anthelea anthelea (Hübner,
1924) from mainland Turkey and Pseudochazara anthelea amalthea
(Frivaldsky, 1845) from mainland Greece (Nymphalidae, Satyrinae) ................... 251
WiILCOCKSON, A. & T. G. SHREEVE: The subspecific status of Pieris napi
nn ne British TSIES 5.2... ne ethnies. 235
BrpkReviews. 11................. 16, 22, 60, 79, 108, 152, 176, 226, 234, 248, 264, 280-283
EOETIETAS EVROPAEA LEPIDOPTEROLOGICA e. V.
Nota lepidopterologica wird den Mitgliedern der SEL zugesandt. Die Mitgliedschaft bei SEL steht
Einzelpersonen und Vereinen nach Maßgabe der Satzung offen. Der Aufnahmeantrag ist an den Mit-
gliedersekretär Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgien; e-mail:
[email protected] zu richten. Das Antragsformular ist im Internet auf der Homepage
der SEL unter http://www.zmuc.dk/EntoWeb/SEL/SEL.htm erhältlich.
Der Mitgliedsbeitrag ist jährlich am Jahresanfang zu entrichten. Er beträgt für Einzelpersonen € 35,00
bzw. für Vereine € 45,00. Die Aufnahmegebühr beträgt € 2,50. Die Zahlung wird auf das SEL-Konto
1956 50 507 bei der Postbank Köln (BLZ 370 100 50) erbeten. Mitteilungen in Beitragsangelegenheiten
sind an den Schatzmeister Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail:
Der Verkauf von Einzelheften und älteren Jahrgängen von Nota lepidopterologica sowie der Verkauf der
Zeitschrift an Nichtmitglieder erfolgt durch Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Däne-
Adressenänderungen bitte sofort dem Mitgliedersekretär oder dem Schatzmeister mitteilen!
Nota lepidopterologica is sent to the members of SEL. The membership is open to individuals and
associations as provided for by the statutes of SEL. Applications for membership are to be addressed to
the membership secretary Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgium; e-mail:
[email protected]. The application form will be found on the SEL Homepage http://
www.zmuc.dk/EntoWeb/SEL/SEL.htm.
The annual subscription is to be paid at the beginning of the year. It is € 35.00 for individuals or € 45.00
for associations. The admission fee is € 2.50. Payments requested to SEL account no. 1956 50 507 at
Postbank Köln [Cologne] (bank code 370 100 50). In matters concerning the subscription or payments,
please contact the treasurer Manfred Sommerer, Volpinistr. 72, D-80638 Miinchen; e-mail:
Back numbers of Nota lepidopterologica may be obtained from, and orders of Nota lepidopterologica
from non-members are serviced by Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup, Denmark; e-
Changes of address should be immediately communicated to the Membership Secretary or the Treasurer.
Nota lepidopterologica est envoyé aux membres de la SEL. L’affiliation est possible, pour les personnes
individuelles aussi bien que pour les associations, en accord avec les statuts de la SEL. Les demandes
d’affiliation doivent étre adressées au Secrétaire des Membres Willy O. De Prins, Nieuwe Donk 50, B-
2100 Antwerpen, Belgique; e-mail:
[email protected].
Le formulaire d’ affiliation est disponible par le biais de la SEL homepage http://www.zmuc.dk/Ento Web/
SEL/SEL.htm. La contribution annuelle est payable au début de l’année. Elle est de € 35,00 pour les
personnes individuelles et de € 45,00 pour les associations. Les frais d’admission s’élevent à € 2,50.
Les payements doivent étre effectués sur le compte SEL n° 1956 50 507 aupres de la Postbank Köln
[Cologne] (code bancaire 370 100 50). Pour toutes questions en rapport a la souscription ou aux payements,
veuillez contacter le Trésorier Manfred Sommerer, Volpinistr. 72, D-80638 München; e-mail:
[email protected]. Les anciens volumes de Nota lepidopterologica peuvent étre obtenus
et les commandes concernant cette revue de la part de non-membres effectuées aupres de Apollo Books,
Kirkeby Sand 19, DK-5771 Stenstrup, Danemark; e-mail:
[email protected].
Tous changements d’adresse doivent être communiqués immédiatement soit auprès du Secrétaire des
Membres, soit aupres du Tresorier.
1
Bil
Ale
Ga
NRAS
ENT
NOTA
LEPIDOPTEROLOGICA
A journal devoted to the study of Lepidoptera
Published by Societas Europaea Lepidopterologica (SEL)
Vol. 26 No. 1/2 2003
SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e.V.
http://www.soceurlep.org
HONORARY MEMBERS
Pamela Gilbert (GB), Barry Goater (GB), Prof. Dr Laszl6 Gozmäny (H), Prof. Dr
Viadimir Kuznetzov (RU), Prof. Dr Clas M. Naumann (D), Dr P. Sigbert Wagener (D)
COUNCIL
President: , Prof. Dr Niels P. Kristensen (DK)
Vice-President: Dr David Agassiz (UK)
General Secretary: | Dr Christoph Häuser (D)
Treasurer: | Manfred Sommerer (D)
Membership Secretary: Will O. de Prins (B)
Ordinary Council Members: Dr Bernard Landry (CH), Dr Elisenda Olivella (E),
Dr Laszlo Ronkay (H), Dr Gerhard Tarmann (A),
Dr Alberto Zilli (1),
Editor: Dr Matthias Nuss (D)
© Societas Europaea Lepidopterologica (SEL)
ISSN 0342-7536
Type setting: Markward Fischer (Dresden)
Printed by Lausitzer Druck- und Verlagshaus GmbH, Bautzen
All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or
mechanical including photocopying, recording or any other information storage and retrieval system, without written
permission from the publisher. Authors are responsible for the contents of their papers.
Nota lepidopterologica
A journal devoted to the study of Lepidoptera
Published by the Societas Europaea Lepidopterologica e.V.
Volume 26 No. 1/2 Dresden, 30.10.2003 ISSN 0342-7536
Editor
Dr Matthias Nuss, Staatliches Museum fuer Tierkunde Dresden,
Koenigsbruecker Landstr. 159, D-01109 Dresden;
EMITHSON/A>
EL 3 0 2003
Editorial Board L'ONANIL
Dr Enrique Garcia-Barros (Madrid, E), Dr Roger L. H. Dennis (Wilmslow, UK),
Dr Peter Huemer (Innsbruck, A), Ole Karsholt (Copenhagen, DK), Dr Bernard Landry (Genève, CH),
Dr Yuri P. Nekrutenko (Kiev, UA), Dr Erik van Nieukerken (Leiden, NL),
Dr Wolfgang Speidel (Bonn, D)
Contents
D arith NEN ERROR RE AA ONE rn 2
PETRÜ, M. & J. LISKA
Postsolenobia nanosella sp. n. (Psychidae) from Slovenia .….............................. 3
HATTENSCHWILER, P.
Phalacropterix fritschi, eine neue Psychide aus der Portugiesischen
OS) LA M Ai Lane AT OR EA dM 9
HATTENSCHWILER, P. & S. SCALERCIO
Systematik, Morphologie und Verbreitung von Taleporia defoliella
ee 25 COMM TEV, (Bsychidae) nu... RAR RARE 19
Nuss, M. & A. STÜBNER
Coleophora variicornis Toll, 1952 stat. rev. is a distinct species occurring
trop (Coleophandae ) 7... IR ARR RARE RROD 27
KALLIES, A.
Synanthedon pamphyla sp. n. from southern Turkey with a comparative
analysis of mitochondrial DNA of related species (Sesiidae) ...........uu 35
WANG, X., H. Li & S. WANG
Study on the genus Clepsis Guenée, 1845 from China (Tortricidae) ................... 47
SOLIS, M. A. |
Pyraloidea specimens labelled as Rebel types from Egypt at the National
Museum of Natural History, Smithsonian Institution, Washington, D.C. ........... 59
LUKHTANOV, V. A., M. WIEMERS & K. MEUSEMANN
Description of a new species of the “brown” Agrodiaetus complex
from South-East Turkey (Lycaemidac) ...................ss0ss00-ssss2.s:0-2 eee 65
Vieira, V.
Records of Macrolepidoptera from Corvo island, Azores ................................ >
BOOK TEVIEWS nn een ae een ne EEE 26, 79
Instructions for AuthorS......rcsscesscseaeecsun ne nesdaene an eee. ee EE RE 81
Editorial
Konrad Fiedler and I took over the editorship of Nota lepidopterologica during the
12th Congress of Lepidopterology in Bialowieza (Poland), in 2000. Subsequently, we
tried to increase its scientific standard by introducing a referee system and changing
its layout. The readership may decide how much we succeeded in that, but in one main
task we were certainly not successful: that Nota lepidopterologica becomes published
regularly. There are reasons for that, especially that not enough acceptable manu-
scripts were submitted to complete the issues in time. It is regrettable that Konrad
stepped down from his position as Editor of Nota lepidopterologica in June 2003.
Without any doubt, he contributed much to increase the standard and the style of the
journal, not only as editor, but also as author of several articles. I herewith heartily
express my deepest gratitude to Konrad for all his work during his two years of edi-
torship. I appreciated very much to collaborate with him.
The SEL council decided during its meeting in South Tyrol in June 2003 that I should
take over the editorship of Nota lepidopterologica. The Council also decided that we
should publish only two double issues in 2003 in order to be able to get back to a reg-
ular schedule of publication from 2004 onwards. I ask all members of the SEL to con-
tribute themselves by submitting papers to be published in Nota lepidopterologica.
During the past, editors almost completely rewrote several papers in order to achieve
a good standard of publication. It is our experience that many authors simply ignore
the Instructions for Authors, a fact which should normally result in rejection of
papers. Based on our experience, the Instructions for Authors were adapted and are
printed at the end of this issue. They should serve not only as a guide for authors, but
also for the editorial board and referees. Lets make Nota lepidopterologica a fine and
regularly published journal!
Matthias NuB
Nota lepid. 26 (1/2): 3-8 3
Postsolenobia nanosella sp. n. (Psychidae) from Slovenia
MILOSLAV PETRÜ* & JAN LISKA**
* Revoluéni 25, CZ 110 00 Praha 1, e-mail:
[email protected]
** Strnady 138, CZ 156 04 Praha 5, e-mail:
[email protected]
Abstract. A new psychid species Postsolenobia nanosella sp. n. is described from south-western
Slovenia (Nanos Mountains). The systematic position of this species in Postsolenobia Meier, 1958 as
well as the differences between similar species of this genus are discussed. The new species is charac-
terized by its very small size, reduction of some veins, grey colour of the head, pure white forewings with
a dark-brown pattern and dark-grey hindwings. The cases were collected on rocks on sunny slopes with
xerothermic vegetation.
Key words. Lepidoptera, Psychidae, Postsolenobia, sp. n., Nanos Mountains, Slovenia.
Introduction
During several excursions to Slovenia in 2000-2002 a series of specimens of the tribe
Dahlicini was collected in the Nanos Mountains. These specimens do not belong to
any of the species hitherto known within the tribe. This species, described below as
new, is apparently a member of the genus Postsolenobia Meier, 1958. Morphological
features of the species correspond with characters defining Postsolenobia, 1.e.:
absence of epiphysis on foretibia, five veins from the discal cell of the hindwing,
wingspan less than 10 mm, and cloaking scales of forewing falling into class 5 of
Sauter (1956). Postsolenobia was later synonymized with Dahlica Enderlein, 1912
by Arnscheid (1988), but again treated as a valid genus in recent works involving
taxonomic revisions and keys for the genera of the family Psychidae (Sauter &
Hättenschwiler 1991, 1999).
Postsolenobia nanosella sp. n.
Material. Holotype © Slovenia, Nanos Mts., Rebrnice 750 m, 3.v.2002 pupa (emerged 18.v.2002), LiSka
leg. Paratypes: @ Slovenia, Nanos Mts., Rebrnice 750 m, 19.v.2001 pupa (emerged 30.v.2001), Petru leg.;
95 same data, but 28.v.2000, 26.v.2001, 19 26.v.2001 pupa (emerged 30.v.2001), 20° 3.v.2002 pupa
(emerged 13.v.2002 and 18.v.2002), 19 3.v.2002 pupa (emerged 18.v.2002), LiSka leg.; 20 25.
28.v.2001, 19 28.v.2001 pupa (emerged 2.vi.2001), Skyva leg.; 10° 3.v.2002 pupa (emerged 10.v.2002),
Sumpich leg.
The holotype and a female paratype are deposited in the Slovenian Museum of Natural History Ljubljana
(Prirodoslovni muzej Slovenije); other paratypes are in coll. J. LiSka, M. Petrü, J. Skyva, J. Sumpich, the
National Museum Prague (Narodni museum Praha), and the Zoological State Collection Munich (Zoolo-
gische Staatssammlung München).
Further material (not revised by the authors): 109 Slovenia, Nanos Mts., 800 m, 25.v.1993 (ex pupa),
300, 89 same data, but 1.-5.v1.2002 (ex pupa), Lasan leg. et coll.; 20° same data, but 14., 17.v.2002 (ex
pupa), Gomboc leg. et coll.; 5S same data, but 700 m, 25.v.2000, 14.v.2002, Deutsch leg. et coll.
Male (Figs. 1-/, 1-2). Wingspan of the type series 8.1—9.0 mm, 8.5 mm on ave-
rage (n=15), and 8.3 mm in the holotype. Head covered with grey hairlike scales,
partly mixed with white. Labial palpi reduced, stump-shaped, covered with grey
scales. Antennae with 24-26 segments (including scape and pedicel), ca 2/3 of
forewing length. Distance between eyes twice their diameter. Ocelli absent. Thorax
© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536
PETRU & LISKA: Postsolenobia nanosella from Slovenia
Fig. 1. Males of Postsolenobia. 1 — P nanosella sp. n., holotype, Slovenia, Nanos Mts., Rebrnice, 750
m, 3.v.2002 pupa, emerged 18.v.2002. 2 — P nanosella sp. n., paratype, same data as holotype. 3 — P
Juliella (Rebel, 1919), Italy, Interneppo, 4.v.2002 pupa, emerged 6.v.2002. 4 — P thomanni (Rebel, 1936),
Switzerland, Brusio, Puschlav, 12.iv.1942, ex pupa.
and tegulae covered with a mixture of grey and white hairlike scales, the same colour
as the head. Length of forewing 3.5 times the width. After removing the scales, the
apex of the forewing is shown to be pointed. Hindwing slightly narrower than
forewing. Legs striped white and brown-grey, in darker specimens the white colour is
almost absent. Forewing fringe white with some grey. The dark cilia line is well
marked. The ground colour of the forewing is pure white with a moderately dark-
brown pattern, with no yellowish colour. The extent of the white and brown colour
varies between specimens and white scales are sometimes mixed with grey ones.
Cloaking scales covering the forewing fall into class 5 of Sauter (1956). Hindwing
densely covered with dark grey scales. Forewing venation (Fig. 2) with 9 veins from
the discal cell. M2 and M3 usually stalked. Accessory and intercalary cells sometimes
present on forewing. Accessory cell (present/examined) 3/6, intercalary cell 1/6. The
presence of additional cells was also mentioned recently in descriptions of similar
small species from the tribe Dahlicini from eastern Europe (Herrmann & Weidlich
1999; Rutjan 2000). Hindwing venation (Fig. 3) without additional cells, only 5 veins
from the discal cell. M2 and M3 almost completely merged, sometimes with a long
stalk (5/14). Foretibia without epiphysis, midtibia with 1 pair and hindtibia with
2 pairs of spurs. Abdomen scaled dark grey to black. Genitalia are typical of Dahlicini
(cf. Capuse 1964). Genital index is approximately 1.05—1.16 (n = 3). The valva is
3.5 times longer than the width in the middle.
Nota lepid. 26 (1/2): 3-8 5
Figs. 2-5. Postsolenobia nanosella sp. n., paratypes. 2. ©’, forewing venation. 3. ©’, hindwing venation.
4. 9, pupal skin. 5. ©, dorsal field thorns.
Female. 16 antennal segments. Body length about 3.5 mm; head, thorax, and
abdomen whitish dorsally, greyish laterally and ventrally, hairlike scales on whitish-
grey,. Foretibia without epiphysis. Pupal skin (cf. Hattenschwiler 1977) and dorsal
field thorns illustrated on Figs. 4-5.
Cases. The cases are 4.2-5.8 mm long (n=20), 5.3 mm on average and 5.5 mm in
the holotype, straight, composed of small pale greyish-brown particles of limestone and soil.
Type locality. Slovenia, Nanos Mountains, Rebrnice, 750 m a.s.l., 45°48’N,
14°00’E (Fig. 6). The locality lies outside the Alps, in the Slovenian Karst in a very
moderate calcareous country. The territory of the Slovenian Karst is known for its
high biological diversity and relatively high rate of endemism.
Habitat and life history. Cases were collected on sunny, south-west facing
calcareous rocky slopes with xerothermic vegetation (Quercus pubescens, Fraxinus
ornus, etc.). The altitude is 700-800 m. Cases with larvae were observed from early
spring (March) until mid May. Most probably the larvae feed on lichens. The adults
were collected from the second half of May to the first days of June. The maximum
occurrence is at the end of May. Dahlica triquetrella forma parthenogenetica was the
only other species of the tribe Dahlicini found in the vicinity of the locality.
PETRU & LISKA: Postsolenobia nanosella from Slovenia
Cd
Fig. 6. The type locality of Postsolenobia nanosella sp. n.
Distribution. At present Postsolenobia nanosella is known only from the
type locality. It can also be expected to be found in the neighbouring mountains
(e.g. Tarnovski Gozd Mts.).
Remarks. The type locality of P juliella (Rebel, 1919) is given as Monte
Matajur in northern Italy (Rebel 1919; Arnscheid 1988). In the original description of
that species, two paratypes were reported from Reifenberg (Görz), now called Branik,
southwest of Ajdovscina in Slovenia. In the authors’ opinion, the population from the
latter locality may belong to the newly described species. Unfortunately, the types
specimens could not be traced at the Naturhistorisches Museum in Vienna.
Derivatio nominis. The name of the species is derived from that of the type
locality of the new species, the Nanos Mts.
Discussion
The new species Postsolenobia nanosella appears to be most closely related to
P juliella (Rebel, 1919) and P thomanni (Rebel, 1936). Postsolenobia juliella has a
yellowish white head in contrast to its darker thorax (Fig. 1, 3). Postsolenobia thomanni
has brown hairlike scales on the head (Fig. 1, 4). The head of P nanosella has grey
hairs, partly mixed with white, especially in pale specimens. At first sight the
forewing is grey-white, in contrast to the two other species. The ground colour of the
forewing is pure white, occasionally with a mixture of single grey scales, mainly in
the costal sector. The dark-brown markings are of high contrast. The hindwing is grey
and markedly darker compared to the forewing. Furthermore, P nanosella is smaller
and its wings are shorter than in P juliella. The ratio between the length of the aedeagus
and valva (genital index) is between 1.05—1.16, which is somewhat more than in the
two other species. The remaining species of this genus, P banatica (M. Hering, 1922)
can be distinguished by the absence of marked spots on the wings and by a larger
genital index. All characters are summarised in Table 1.
Nota lepid. 26 (1/2): 3-8 i
Tab. 1. Specific characters of Postsolenobia thomanni, P juliella, P nanosella, and P banatica. Data are
taken from Capuse (1964), Hattenschwiler (1997), Hering (1922), Meier (1957), Rebel (1936) and from
the following material: Postsolenobia thomanni: & Switzerland, Brusio, Puschlav, case 12.iv.1942,
Weber leg., Petrü coll. — Postsolenobia juliella: 40 Italy, Gemona, 23., 24., 26., 28.iv.1952, Sieder leg.,
Petrü coll.; & Italy, Dolomiten, Piano Fugazze, 1300 m, 3.vi.1960, Meier leg., Petri coll.; & Italy,
Matajur, 1100m, 11.v.1961, Sieder leg., Petrü coll.; © Italy sup., Friaul, Mt. Matajur, 1200 m, 16.v.1961,
Meier leg., Petri coll.; 29 Italy, Monte Festa, 23.v.1968, e.p., Schatz leg., Petri coll.; & Italy, Monte
Festa, 24.v.1968, e.p., Schatz leg., Petrü coll.; © Italy, Monte Festa, 14.v.1969, e.o., P. Hättenschwiler
leg., Petri coll.; 40°, 19, Italy, Matajur, 4.v.2002, e.p., LiSka & Petrü leg. et coll; 10, 19, Italy, Gemona-
Interneppo, 4.v.2002, e.p., Liska & Petrü leg. et coll. — Postsolenobia banatica: S Romania, Domogled,
18.iv.1964, Cäpuse leg.; @ Baile Herculaneae, 15.v.1965, Cäpuse leg., Petrü coll.
so ES ee |
grey
Acknowledgements
We are grateful to our colleagues for their kind help during the preparation of the manuscript: G. Elsner
(photography of adults), R. J. Heckford (linguistic revision), P. Kapitola (translation to English),
Z. Lastuvka (text revision), J. Skyva and J. Sumpich (part of type material). Financial support came
from the Biotop foundation Prague.
Literature
Arnscheid, W. 1988. Ein Beitrag zur Systematik der europäischen Arten der Gattungen Postsolenobia
Meier, Brevantennia Sieder und Siederia Meier (Lepidoptera, Psychidae, Taleporiinae). —
Nachrichten des entomologischen Vereins Apollo, N.F. 8 (1987) 3-4: 113-144.
Cäpuse, I. 1964. Über Solenobia banatica Hering, eine bisher nur aus der rumänischen Volksrepublik
bekannte Psychide. — Zeitschrift der wiener entomologischen Gesellschaft 49: 104-111.
Hättenschwiler, P 1977. Neue Merkmale als Bestimmungshilfe bei Psychiden und Beschreibung von
drei neuen Solenobia Dup.-Arten. — Mitteilungen der entomologischen Gesellschaft Basel 27 (2):
33-60.
Hättenschwiler, P. 1997. Psychidae-Sackträger. S. 165-308. — /n: Pro Natura (Hrsg.), Schmetterlinge und
ihre Lebensräume 2. Fotorotar, Egg.
Hering, M. 1922. Solenobia banatica m., eine neue palaearktische Psychide. — Deutsche entomologische
Zeitschrift Iris 36: 93-94.
Herrmann, R. & M. Weidlich 1999. Psychidenbeobachtungen in Westrumanien — Teil 2. Beschreibung
von Siederia transsilvanica sp. n. (Psychidae). — Nota lepidopterologica 22 (1): 10-16.
Meier, H. 1957. Ein neues Subgenus und neue Arten aus der Gattung Solenobia Dup. (Lep. Psych.). -
Nachrichtenblatt bayerischer Entomologen 6: 55-61.
Meier, H. 1958. Der taxonomische Wert der Hinterfliigel-Aderung bei den Arten der Gattungen
Brevantennia Sieder und Solenobia Duponchel (Lep., Psych.). Mitteilungen naturwis-
senschaftlicher Verein Steiermark 88: 178-192.
Rebel, H. 1919. Zur Kenntnis palaearktischer Talaeporiiden. — Deutsche entomologische Zeitschrift Iris
32 (3-4): 95-112, Taf. 1.
Rebel, H. 1936. Drei neue Mikrolepidopteren aus der Schweiz. — Zeitschrift des Österreichischen
Entomologenvereins 21: 11-13.
Rutjan, E. V. 2000. A new bagworm species ofthe genus Dahlica (Psychidae) from southeastern Ukraine.
— Nota lepidopterologica 23 (1): 26-39.
Sauter, W. 1956. Morphologie und Systematik der schweizerischen Solenobia-Arten (Lepidoptera,
Psychidae). — Revue Suisse de Zoologie 63 (3): 451-550.
8 PETRÜ & LISKA: Postsolenobia nanosella from Slovenia
Sauter, W. & P. Hättenschwiler 1991. Zum System der palaearktischen Psychiden (Lepidoptera,
Psychidae). 1. Teil: Liste der palearktischen Arten. — Nota lepidopterologica 14 (1): 69-89.
Sauter, W. & P. Hättenschwiler 1999. Zum System der palaearktischen Psychiden (Lepidoptera,
Psychidae). 2. Teil: Bestimmungschüssel für die Gattungen. — Nota lepidopterologica 22 (4):
262-295.
Nota lepid. 26 (1/2): 9-18 9
Phalacropterix fritschi, eine neue Psychide aus der
Portugiesischen Algarve (Psychidae)
PETER HATTENSCHWILER
Seeblickstrasse 4, CH-8610 Uster, Schweiz
Abstract. The genus Phalacropterix is revised, a key to the species provided and P fritschi sp. n.
described. The taxonomic status of P calberlae (Heylaerts, 1890) and P apiformis f. siculella (Bruand,
1852) is discussed. It is suggested to consider siculella as a colour form of P apiformis.
Zusammenfassung. Die Gattung Phalacropterix wird revidiert, Ein Bestimmungsschliissel zu den Arten
gegeben und P. fritschi sp. n. beschrieben. Der taxonomische Status von P calberlae (Heylaerts, 1890)
und P apiformis f. siculella (Bruand, 1852) wird diskutiert. Es wird empfohlen, siculella als Farbvariante
von P apiformis zu betrachten.
Résumé. Le genre Phalacropterix est révisé. Un clef pour les espèces est donné et P fritschi sp. n. est
décrit. le statue taxonomique de P calberlae (Heylaerts, 1890) et P apiformis f. siculella (Bruand, 1852)
est discuté. Il est recommandé de considérer siculella comme forme de coloration de P apiformis.
Key words. Lepidoptera, Psychidae, Algarve, Phalacropterix fritschi.
Einleitung
Im Winter 1998/1999 bereiste Herr Dieter Fritsch die stidliche portugiesische Provinz
Algarve. Als erfahrener Entomologe besuchte er auch in der kalten Jahreszeit alle
möglichen Orte, an denen sich Insekten aufhalten könnten. So fand er im Februar in
einem Sandheidegebiet an Stechginster (Ulex spec.) angesponnene Psychidensäcke.
Von diesen Säcken brachte er einige mit nach Hause und überließ uns 14 davon. Aus
einem Teil der Säcke ragten noch die leeren männlichen Puppenhüllen, zwei der
Raupen waren erst etwa halb erwachsen. Vom 5.-9.3.1999 verließen vier männliche
Schlupfwespen die Säcke (/toplectis viduata (Gravenhorst), det. Peter Schmid,
Leutkirch, coll. Schmid & Hättenschwiler). Am 23., 26., 30.3. und 2.4.1999 schlüpf-
ten die jungen Raupen, die wohl als Eier im Muttersack überwintert hatten.
Offensichtlich fand der Paarungsflug noch vor dem Februar statt, denn aus keinem der
vom 22.-25.2.1999 von Herrn Fritsch gesammelten Säcken schlüpften noch Falter.
Mit den geschlüpften jungen Raupen begannen wir die Nachzucht. Diese Zuchten
konnten wir über zwei Generationen weiter führen, erhielten aber jeweils nur wenige
adulte Tiere. Der Sommer im Fundgebiet ist sehr heiß und der Winter mild. Der
Sommer bei uns in Uster auf 475 m über dem Meeresspiegel ist für diese Art
möglicherweise nicht warm genug. Vielleicht waren auch im Futter nicht alle
notwendigen Substanzen ausreichend vorhanden. Wir verwendeten eine Vielzahl von
Pflanzen, von denen Vogelknöterich (Polygonum aviculare L.), Einjähriges Rıspen-
gras (Poa annua L.) und Heidekraut (Calluna vulgaris L.) bevorzugt wurden. Die
Entwicklung war hier langsamer und dauerte bis zum April des folgenden Jahres, die
Überwinterung fand als etwa halb erwachsene Raupe statt. Von der zweiten
Generation brauchten etwa 1/3 der Raupen zwei Jahre für die Entwicklung. Trotz der
großen Mortalität standen uns für die Untersuchungen 27 Männchen, 29 Weibchen
sowie 6 Raupen zur Verfügung.
© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536
10 HATTENSCHWILER: Phalacropterix fritschi sp. n. from the Algarve
Aufgrund der Säcke war sogleich klar, daß es sich um eine Phalacropterix-Art
handeln muß. Jedoch ergab die Untersuchung der adulten Tiere aus der Nachzucht
Abweichungen gegenüber allen bekannten Arten. Es erwies sich als notwendig, alle
Arten der Gattung gründlich zu prüfen und möglichst viele Unterscheidungsmerk-
male zu vergleichen. In der Gattung Phalacropterix sind die folgenden Arten zusam-
mengefaßt:
Hauptverbreitungsgebiet Bemerkungen
P apiformis (Rossi, 1790) Italien, Südliches Frankreich Gattungstypus
f. siculella (Bruand, 1852) Italien (siehe Text)
P graminifera (Geoffroy, 1785) Südliches Frankreich
P praecellens (Staudinger, 1870) Mitteleuropa, nördlich und südlich der Alpen
P calberlae (Heylaerts, 1890) Tirol / Pyrenäen (siehe Text)
P. graslinella (Boisduval, 1852) Mitteleuropa, nördlich der Alpen
P bruandi (Lederer, 1855) Türkei
P. fritschi sp. n. Südliches Portugal, Algarve (siehe Text)
Es ıst oft nicht einfach, die verschiedenen Arten zu unterscheiden, obwohl teilweise
auffällige Unterschiede vorhanden scheinen, denn die Merkmale sind meist großen
Streuungen unterworfen.
Abkürzungen
Ant — Antenne, DZ — Discoidalzelle, Hfl — Hinterflügel, KZ — Kammzähne, rr — Radialramus im Hfl, sc
— Subcostalader, Vfl — Vorderflügel
Bemerkungen zu einzelnen Arten
P apiformis f. siculella wurde von Bruand (1852) als Art aufgrund eines
Männchens aus Sizilien beschrieben. Er erwähnt, daß die Art selten sei und kenne nur
das eine Exemplar von Boisduval. Seitz (1913: 363) führt siculella unter P apiformis
mit der Anmerkung: „Kommt in Sicilien zusammen mit der Hauptform vor und zeich-
net sich durch schwarzen Thorax und Abdomen aus“. In Dalla Torre & Strand (1929:
108) wird siculella als „Var“ unter P apiformis geführt. Kozhantshikov (1956: 432)
erwähnt siculella am Anfang der Beschreibung von P apiformis neben Synonymen,
ohne jedoch etwas über den Status von siculella auszusagen.
Offenbar wurde dieser Name damals als Art, Unterart oder Variation verwendet.
Gestützt auf diese frühen, nicht in allen Fällen sehr klaren Beschreibungen, betrach-
teten wir damals siculella als Unterart von P apiformis (Sauter & Hättenschwiler 1991).
Nun, nachdem wir eigene Erfahrungen mit mehreren Zuchten haben, betrachten wir
die Sache etwas anders. Bei den heute als siculella betrachteten Faltern handelt es sich
um eine Form von apiformis, bei der die haarförmige, orange-gelbe oder orange-rote
Körperbeschuppung ganz oder teilweise durch schwarze haarförmige Schuppen erset-
zt ist. In einigen Populationen treten solch dunkle Männchen auf. Wir haben beispiels-
weise aus gezüchteten Raupen, die mit der Ausnahme von „Macerata“ jeweils aus
Nota lepid. 26 (1/2): 9-18 ji
einem Gelege stammten, die folgenden Verhältnisse ermittelt: 230 Marche, Macerata
1970, leg. A. Teobaldelli (davon nur 20 als verdunkelte Zwischenstufe). 120 Romagna,
Forli 1987, leg. F Gabriele (davon 30° schwarz). 140 Romagna, Rocandello 1994,
leg. L. Bertaccini (davon 20 schwarz, 10° Zwischenstufe). 170 Liguria, Savona 2002,
leg. D. Fritsch (davon keine schwarz oder Zwischenstufe). Dieser Farbverlust tritt in
den verschiedenen Populationen in unterschiedlicher Häufigkeit auf. Beide Formen
können bei Männchen aus dem gleichen Gelege auftreten. Nach unseren Beobach-
tungen ın den verschiedenen Zuchten scheint es sich hier also nur um eine Form zu
handeln.
P. calberlae (Heylaerts, 1890) wurde nach einem Weibchen, einer Raupe von
Cauterets, Hautes Pyrénées, Frankreich leg. R. Oberthür sowie eines Männchens, das
mehrere Jahre später E. Pokorny, ebenfalls als Raupen mit Säcken, in ,,Teriolis mer.,
Condino“ im südlichen Tirol gesammelt hatte beschrieben. Durch Kauf gelangte
dieses Männchen und die Säcke ın die Sammlung Calberla in Dresden. Ein Holotypus
wurde nicht festgelegt, es handelt sich somit um Syntypen. Von den bekannten Arten
hat nur P praecellens eine Verbreitung, die diejenige von P calberlae einschließt. Die
Beschreibung enthält einige meß- und vergleichbare Angaben, die jedoch oft auch für
andere Arten der Gattung zutreffen. Sämtliche Angaben liegen jedoch im Streu-
bereich von P praecellens. Wir haben somit starke Vermutungen, daß P calberlae als
Synonym von P praecellens betrachtet werden muß.
Von den Belegen, die Heylaerts in der Beschreibung erwähnt hat ist das getrock-
nete Weibchen, die geblasene Raupe und dreı Säcke ım Naturhistorischen Museum in
Leiden (Holland) aufbewahrt. In liebenswürdiger Weise hat uns Herr Dr. E. J. van
Nieukerken Bilder übermittelt und die Belege so kommentiert: „When looking at the
bags of praecellens they look indeed very much the same“ Das übermittelte Foto
eines Männchens von „Carniolia, Wippach, Mitte 4.00 (= Aprıl 1900), Wagner“, von
Heylaerts als P calberlae bestimmt ist im Geäder, der Flügelbeschuppung und den
Fühlern auch mit P praecellens übereinstimmend.
Die Sammlung von Herrn Calberla ist im Museum für Tierkunde in Dresden
(Deutschland). Herr Dr. Matthias Nuß hat in freundlicher Weise die Sammlung durch-
gesehen und fand wohl die in der Beschreibung erwähnten Säcke, nıcht aber das
fragliche Männchen. So gelang es uns nicht den Fall zu klären und wir müssen das
Männchen momentan als verschollen betrachten. Wir sind der Ansicht, daß P calber-
lae ein Synonym zu P praecellens ist. Da wir es vorziehen würden, das Männchen als
Lectotypus festzulegen, möchten wir die Sache noch nicht abschließen und hoffen,
daß es noch gefunden wird.
Phalacropterix fritschi sp. n.
Material. Holotypus © Portugal, Algarve, 2-4 km NW von Sagres, 75 m, leg. Fritsch, erste
Nachzucht ex. ovo 27.4.2000, cult. Hättenschwiler, coll. Naturmuseum Luzern. Paratypen: 130°, 149,
6 Larven gleiche Daten, erste Nachzucht ex. ovo 16.-29.4.2000; 110°, 129 21.4-30.5.2001 (zweite
Nachzucht, erste Überwinterung), 20°, 39 25.3.-4.4.2002 (zweite Nachzucht, zweite Uberwinterung);
14 Säcke beider Geschlechter, 22.-25.2.1999 leg. Fritsch; 20 Säcke aus Zuchten, ın denen die erwach-
senen Raupen oder die Puppen abgestorben sind; coll. Erwin Hauser, Peter & Ruth Hättenschwiler,
Hans Henderickx, René Herrmann, Willi Sauter, Nationaal Natuurhistorisch Museum Leiden, Natur-
museum Luzern, Museum für Tierkunde Dresden.
12
HATTENSCHWILER: Phalacropterix fritschi sp. n. from the Algarve
AMAT pur), ae
Murten 19 20
)
win! MER]
Naas
(LU ES ae
! m 5
Fe ae ;
Ayn HM gg
Abb. 1. Flügeladerung von a: P fritschi sp. n., Exemplar mit 10 Adern aus der Discoidalzelle im
Vorderflügel, b: P fritschi sp. n., Exemplar mit nur 9 Adern sowie c: P praecellens.
Abb. 2. Männliche Genitalapparate: a: P apiformis, b: P fritschi sp. n, c: P praecellens, d: P graslinel-
la, jeweils rechts der Aedeagus.
Abb. 3. Links Weibchen, rechts Raupe von P fritschi sp. n.
Beschreibung ©. Flügel-Spannweite 15-19 mm, Vorderflügel Costalkante
nach innen gebogen, mit 10 Adern aus der Discoidalzelle (Abb. 1a), seltener 9 Adern,
dann fehlt r5 (Abb. 1b). Braun-schwarze, stumpfe Schuppen der Klasse 1-2 (cf. Sauter
1956) außen und helle, gelblich-braune Schuppen der Klasse 1 im Wurzelfeld der
Nota lepid. 26 (1/2): 9-18 13
Fligelflache. Hinterflugel mit 6 Adern aus der Zelle, Farbung und Beschuppung wie
im Vorderflügel, rr+sc im Basisdrittel sehr nahe oder verschmolzen, dann getrennt.
Fühler doppelkammzähnig mit 23-30 Gliedern, Kammzähne dunkel, schwärzlich
beschuppt, nur selten sınd einzelne helle Schuppen zu erkennen. Ocellen fehlen,
Augen klein, hochoval, in den langen, schwarzen Schuppen versteckt, Augenabstand
groß, 2,2-2.8 mal Augenhöhe. Labialpalpen stark rückgebildet. Beine normal
entwickelt, mit 5 Tarsengliedern, ohne Epiphyse an der Vordertibia, Mittel- und
Hinter-beine ohne Sporne, höchstens kurze Enddornen. Genital (Abb. 2b) mit leicht
abgesetztem Saccus, Aedeagus schwach gebogen, fast die Länge des gesamten
Genitales erreichend. Sacculus mit kräftigen Dornen, Valve etwa bis zum Ende des
Tegumens reichend.
©. Ungeflügelt, 8-10 mm lang bei 3.5 mm Durchmesser, zylindrisch,
blaßgelb-weißlich, weichhautig, ohne Zeichnungen, nur der Kopf und die drei Brust-
segmente sind leicht sklerotisiert. Ocellen fehlen, Labialpalpen kaum noch erkennbar,
Fühler fehlen, Augen als kleine dunkle Punkte vorhanden, Beine etwa 0.5 mm lange
Stummel. Die Legeröhre ist fleischig weich, sehr kurz, viel kürzer als deren
Durchmesser. Auf dem 8. Abdominalsegment ein bräunlicher Kranz von Afterwolle,
schwache, hellere Haarkränze befinden sich auf einigen weiteren Segmenten
(Abb. 3 links).
Eier. Hell gelb-griinlich, leicht oval, ohne Strukturen. Wahrend der Entwicklung
werden sie dunkler. Ein Weibchen kann etwa 100 Eier ablegen.
Raupen. Ausgewachsen werden sie 15—18 mm lang bei einem Durchmesser von
2.5-3.5 mm. Kopf und Brustsegmente sind hart sklerotisiert, dunkel mit unregelmäßi-
gen, hellen Flecken. Abdominalsegmente dorsal dunkel graubraun, ventral schmutzig
hellbraun (Abb. 3 rechts).
Säcke. Bei beiden Geschlechtern 16-20 mm lang, birnenförmig, mit feinen
Ästchen oder Grashalmen quer belegt und mit einem unvollständigen, lockeren
Gespinst überzogen. Bei den Männchen-Säcken ist der belegte Teil etwas kürzer und
das hintere Ende in eine weißliche, unbelegte 1-2 mm lange Endröhre ausgebaut, die
beim Weibchen-Sack fehlt. Das Weibchen verläßt den Sack nıe. Es spinnt beı der
Verpuppung im hinteren Sackende eine Reuse, durch die später das Männchen bei der
Begattung sein Abdomen in den Sack bohren und so das Weibchen erreichen kann.
Bei den Säcken beider Geschlechter liegen die quer angesponnenen Pflanzenteile
nicht alle parallel und sind in der Länge etwas unterschiedlich. Dadurch entsteht ein
„struppiges“, unregelmäßiges Aussehen. Sackdurchmesser bei den Männchen 6-8 mm,
bei den Weibchen 8-10 mm (Abb. 4a).
Puppe. Männchen vor dem Schlüpfen dunkelbraun, Exuvie hellbraun, Kopf-
Brustplatte mit allen Scheiden normal entwickelt. Kopfplatte mit 4 Borstenpaaren.
Weibchen dunkelbraun bis schwarz, an beiden Enden rotbraun gefärbt, zylindrisch,
8-10 mm lang und 3-3.5 mm im Durchmesser. Kopf-Brust Platte sehr stark reduziert,
die einzelnen Scheiden sind verwachsen und kaum noch erkennbar.
Lebensweise. Die Männchen schlüpfen um die Mittagszeit, sind schon nach
kurzer Zeit flugbereit und suchen in stürmischem Flug ein Weibchen, das im Sack
wartet und ihren Duftstoff durch die Sackwände ausströmen läßt. Die Paarung dauert
14 HATTENSCHWILER: Phalacropterix fritschi sp. n. from the Algarve
Abb. 4. Säcke im Puppenstadium jeweils links Männchen-, rechts Weibchensäcke. a: P fritschi, die nack-
te Endröhre beim Männchensack ist kurz, b: P praecellens, die nackte Endröhre ist deutlich länger.
1-3 Minuten. Das Männchen kann 2 bis 3 Mal kopulieren und stirbt in der Regel noch
am gleichen Tag. Die Weibchen können während mehrerer Tage um die Mittagszeit
wiederholt locken, bis eine Paarung statt findet. Dann werden sogleich alle Eier in die
Puppenhülle abgelegt; dabei wird die Afterwolle abgestreift und zwischen den Eiern
abgelagert. Das Weibchen bleibt als kleines Häufchen Haut in der Puppenöffnung liegen
und stirbt langsam ab. Nach etwa drei bis vier Wochen schlüpfen die jungen Raupen,
verlassen den mütterlichen Sack, bauen sogleich ihr eigenes Säcklein und beginnen
erst dann zu fressen. Aufgrund der in ihrer Heimat schon im Februar schlüpfenden
Jungraupen muß angenommen werden, daß die Flugzeit im Klima der Algarve im
Herbst oder spätestens im Dezember-Januar stattfinden muß. Die Entwicklung dauert
in der Freiheit ein Jahr, mit wenigen Ausnahmen, bei denen die Raupen etwa halb
erwachsen überwintern und erst zusammen mit den Nachkommen ihrer Geschwister
erwachsen sind. Zur Verpuppung werden die Säcke meist oben in der Futterpflanze
festgesponnen, was den Nachkommen das Suchen des Futters erleichtert. Nach dem
Festspinnen des Sackes wird bei den Männchen die Endröhre mit der Schlüpföffnung
vorbereitet. Anschließend kehrt die Raupe sich im Sack um und häutet sich zur
Vorpuppe, die Raupenhaut wird durch die Schlüpföffnung aus dem Sack geschoben
und bleibt dort oft als schwarzes Klümpchen hängen. Nun kehrt sich die Raupe
nochmals im Sack und häutet sich zur Puppe, mit dem Kopf zur Schlüpföffnung
gerichtet, wodurch die abgestreifte Haut im Inneren des Sackes bleibt. Die Entwick-
lung zur Imago dauert etwa 3 Wochen. Auch bei den Weibchen wird die Begattungs-
öffnung des Sackes sorgfältig vorbereitet und dann erst häutet sich die Raupe, den
Kopf gegen die Schlüpföffnung gerichtet, zur Puppe ohne die Zwischenstufe der
Vorpuppe. Die Puppe braucht zur Entwicklung nur etwa 2 Wochen, die Raupen spinnen
ihre Säcke entsprechend später zur Verpuppung fest.
Nota lepid. 26 (1/2): 9-18 15
apiformis graminifera
(15-19 mm) (15-23 mm)
graslinella
(15-20 mm) (17-22 mm)
apiformis f. siculella
(15-19 mm)
bruandi
(13-15 mm)
16
HATTENSCHWILER: Phalacropterix fritschi sp. n. from the Algarve
Abb. 6. Männliche Genitalapparate, links P graminifera, rechts P bruandi (Maßstab: 0,5 mm).
Abb. 7. Flügeladerung bei P apiformis, im Hinterflügel entspringen rr+sc nahe zusammen, verschmelzen
etwa bei der DZ-Mitte und bleiben bis zum Zellende verschmolzen.
Abb. 8. Verteilung der dunklen- und hellen Schuppen auf den Flügeln, links P praecellens, rechts P
graslinella.
Verbreitung. Die neue Art ist zur Zeit nur aus der Algarve bekannt, wo sie
etwa 75 m über dem Meeresspiegel unweit der Atlantikküste gefunden wurde. _
Derivatio nominis. Wir widmen die neue Art als Dank dem Finder Herrn
Dieter Fritsch und nennen sie Phalacropterix fritschi sp. n.
Diagnose. Die neue Art steht der P praecellens nahe, läßt sich jedoch unter-
scheiden durch den Verlauf der Adern rr+sc im Hinterflügel, die bei praecellens über
die ganze Länge getrennt verlaufen, bei fritschi sp. n. jedoch im Basisdrittel anasto-
mos oder approximal. Die Fühlerkammzähne tragen bei praecellens helle Schuppen,
bei fritschi sp. n. fast ausschließlich dunkle Schuppen. Der Männchen-Sack hat bei
praecellens eine nackte Endröhre von 6-9 mm Länge, die bei fritschi sp. n. nur 1-2
mm lang ist. Weitere Hinweise finden sich in der Tabelle und im nachfolgenden
Schlüssel zu den Arten.
Nota lepid. 26 (1/2): 9-18 17
Schliissel zu den Arten der Gattung Phalacropterix
1) Thorax und Abdomen mit orangegelben, haarförmigen Schuppen, Vfl meist mit 9 DZ-Adern, nur
m2+m3 gestielt, Hfl rr+sc entspringen nahe beisammen, verschmelzen etwa in der DZ-Mitte und
trennen sich wieder beim DZ-Ende (Abb. 7). Ant KZ gelblich, fast goldglanzend beschuppt.
apiformis
(Körperbehaarung mehrheitlich oder ganz schwarz = f. siculella)
— Thorax und Abdomen mit dunklen haarförmigen Schuppen, oft mit helleren Schuppen durchmengt.
Vfl meist 10 DZ-Adern, r3+r4 sowie m2+m3 gestielt. Hfl rr+sc anders verlaufend. 2
2) Alle Flügel im Wurzelfeld und in DZ mit hellen Schuppen von gelb-brauner Farbe, Klasse 1, gegen
die Flügelspitze dunkle, grauschwarze, stumpfe Schuppen Klassen 2-3. 3
— Flügel einfarbig schwärzlich, im Wurzelfeld nicht oder nur unwesentlich heller (Abb. 5). graminifera
3) Kleiner, Flügelspannweite 13-16 mm, dorsale KZ sehr stark mit langen Schuppen besetzt, so daß sie
wie verklebt erscheinen, während diese Beschuppung an der ventralen Zahnreihe weitgehend fehlt
und die einzelnen KZ gut sichtbar sind. KZ dunkel bis schwarz beschuppt, selten einzelne, heller
glänzende Schuppen, Wimpern kaum erkennbar. © Sack mit kurzer Endröhre von nur 1-2 mm
Länge. Saccus im männlichen Genital vom Vinculum nicht oder kaum abgesetzt (wie Abb. 6 rechts).
Hfl rr+sc meist auf der ganzen Länge weit getrennt. buandi
— Größer, Flügelspannweite 15-22 mm, Beschuppung der KZ beider Reihen schütter und anliegend,
Wimpern gut sichtbar. 4
4) Beschuppung der KZ dunkel bis schwarz, selten einzelne heller glänzende Schuppen. © Genital,
Saccus durch starke Verengung deutlich vom Vinculum abgesetzt (Abb. 2b). Hfl rr+sc im Basisdrittel
sehr genähert verlaufend oder verschmolzen, nachher getrennt (Abb. 1a+1b). © Sack mit kurzer
Endröhre von 1-2 mm Länge. fritschi sp. n.
— Beschuppung der KZ ganz oder teilweise hell, silberweiß. © Sack mit langer Endröhre. 5
5) Wurzelteil aller Flügel hell bräunlich beschuppt, DZ im Vfl transparent (Abb. 8 links). KZ stark hell,
silberweiß glänzend beschuppt. Sack schwach umsponnen. praecellens
— Basale Hälfte beider Flügel hell, braungelb beschuppt. Die DZ ist im äußeren Teil verdunkelt, wenig
auffallend (Abb. 8 rechts). KZ dunkel (bräunlich) aber glänzend beschuppt. Der Glanz kann, ab-
hangig von der Beleuchtung, die Schuppen hell erscheinen lassen. Ab und zu mit einzelnen silber-
weißen Schuppen. Sack meist stark umsponnen. graslinella
Tab. Ubersicht iiber morphologische Merkmale in der Gattung Phalacropterix. Fett hervorgehoben
sind jene Merkmale, die sich von der Mehrheit der Arten in der Gattung unterscheiden.
P| apiformis | graminifera | praecellens | grastinelta | bruandi | frisch |
Vorderflügel, Adern aus DZ
Beam 6 | Ik Ik |s@ | |
Aderung Hinterflügel rr + sc Basis bis Ende DZ getrennt mit getrennt mit getrennt mit Basisdrittel
getrennt mit
verschmolzen, außen | Querader Querader Querader Querader nahe oder
frei verschmolzen
Flügelfärbung, Vfl + Hfl Flügelbasis gelb- ganze Fläche
braun schwarz-grau
Anzahl Fühlerglieder 29-32 27-32 31-38 23-30
Beschuppung
nackten Endröhre in mm
Vinculum / Saccus abgesetzt abgesetzt abgesetzt undeutlich abgesetzt
Weibchen Puppe, Färbung hellbraun mit 5 dunkel mit dunkel mit dunkel mit dunkel mit
dunklen Ringen braun-roten braun-roten braun-roten braun-roten
Enden Enden Enden Enden
außen frei
Flügelbasis Flügelbasis Flügelbasis Flügelbasis
relb-braun elb-braun selb-braun relb-braun
£ B 4 £
18 HATTENSCHWILER: Phalacropterix fritschi sp. n. from the Algarve
Danksagungen
Auch bei dieser Arbeit durfte ich wieder die große Hilfe von verschiedener Seite in Anspruch nehmen.
Herzlichen Dank geht an Herrn Dieter Fritsch, der die Säcke mit den Eiern der neuen Art gefunden und
uns geschenkt hat; ihm verdanke ich auch die Angaben zu Klima und Flora am Fundort. Meinem lieben
Freund, Herrn Prof. Dr. Willi Sauter danke ich für die stete Beratung und umfangreiche Hilfe bei den
Untersuchungen sowie für die Durchsicht des Manuskriptes. Vielen Dank geht auch an Herrn Dr. Erwin
Hauser für die Aufnahme der Fotos, Herrn Dr. E. J. van Nieukerken im Museum Leiden für die Hilfe und
Übermittlung der Bilder und Kommentare zu dem Typusmaterial von P calberlae, Herrn Dr. Matthias
Nuß im Museum für Tierkunde Dresden für die Suche nach dem verschollenen Männchen sowie Herrn
Peter Schmid für die Bestimmung der Schlupfwespen. Besonderen Dank schulde ich meiner lieben Frau
Ruth und Tochter Sereina Parpan, sie haben alle Zuchten erfolgreich über die Jahre betreut. Ganz herz-
lichen Dank allen Beteiligten, ohne die ich diese Arbeit nicht hätte zu Ende führen können.
Literatur
Bruand, M. T. 1852. Essai Monographique sur la tribu des Psychides. — Mémoirs de la Société Libre
d’Emulation de Doubs (ser. 2) 3: 60.
Dalla Torre, K. W. & E. Strand 1929. Psychidae. — In: F. Bryk (Hrsg.), Lepidopterorum Catalogus 34. —
W. Junk, Berlin, 211 S.
Hauser, E. 1998. Morphologie der Männchen von Phalacropterix bruandi (Lederer, 1855). — Zeitschrift
der Arbeitsgemeinschaft österreichischer Entomologen 50: 21—28.
Heylaerts, F.-J.-M. 1890. Notes Psychidologiques. — Annales de la Société Entomologique de Belgique
34, comptes-rendus: 131.
Kozhantshikoy, I. V. 1956. Fauna of the U.S. S. R., Lepidoptera, Psychidae. — Zoological Institute of the
Academy of Sciences of the USSR, N. S. 62: 432 S.
Pro Natura 1997. Schmetterlinge und ihre Lebensräume 2. Basel, I-XII, 1-679.
Sauter, W. 1956. Morphologie und Systematik der schweizerischen Solenobia-Arten. — Revue Suisse de
Zoologie 63 (27): 451-550.
Sauter, W. &. P. Hättenschwiler 1991. Zum System der palaearktischen Psychiden, 1. Teil: Liste der
palaearktischen Arten. — Nota lepidopterologica 14 (1): 69-89.
Seitz, A. 1913. Die Gross-Schmetterlinge des Palaearktischen Faunagebietes 2. 363 S. — In: A. Seitz
(Hrsg.), Die Gross-Schmetterlinge der Erde. — Alfred Kernen, Stuttgart.
Nota lepid. 26 (1/2): 19-25 19
Systematik, Morphologie und Verbreitung von Taleporia
defoliella Constant, 1895 comb. rev. (Psychidae)
PETER HÄTTENSCHWILER! & STEFANO SCALERCIO”
! Seeblickstrasse 4, CH-8610 Uster, Switzerland;
[email protected]
* Universita degli Studi della Calabria, Ddip.di Ecologia, I-87036 Arcavacata di Rende-Cosenza;
Abstract. Taleporia defoliella Constant, 1895 comb. rev. has been known formerly only by males and
only from the Alpes Maritimes. This species is now recorded for the first time from Italy (Calabria and
Piemont). Reared from ex ovo, males and females of the same species are now recognised. Immature
stages, females and males are described and based on the morphological characters, defoliella is trans-
ferred from Bankesia Tutt, 1899 back to Taleporia Hübner, [1825]. The life history of the species is
described. Cases found in nature were parasitised by Xanthellum transsylvanicum Erdös & Novicky,
1951, which is herewith also recorded for the first time from Italy.
Zusammenfassung. Taleporia defoliella Constant, 1895 comb. rev. war bislang nur von Männchen und
nur vom Typenfundort in den Alpes Maritimes bekannt. Diese Art wird erstmalig für Italien (Kalabrien
und Piemont) nachgewiesen. Anhand einer ex ovo Zucht können Männchen und Weibchen derselben Art
erkannt werden. Die ersten Stände, die Weibchen sowie die Männchen werden beschrieben und anhand
der morphologischen Befunde wird defoliella aus der Gattung Bankesia Tutt, 1899 zurück in die Gattung
Taleporia Hübner, [1825] transferiert. Die Lebensweise der Art wird beschrieben. Im Freiland gefundene
Säcke waren von Xanthellum transsylvanicum Erdös & Novicky, 1951 parasitiert, die damit ebenfalls
erstmalig für Italien nachgewiesen wird.
Riassunto. Taleporia defoliella Constant, 1895 comb. rev. e stata originariamente descritta su un mas-
chio raccolto sulle Alpi Marittime. Questa specie € nuova per la fauna italiana (Calabria e Piemonte).
Lallevamento di alcune uova ha permesso di descrivere anche gli stadi pretmmaginali e la femmina,
finora ignoti. I nuovi caratteri morfologici raccolti hanno permesso il ritorno di defoliella da Bankesia
Tutt, 1899 Taleporia Hübner, [1825]. Inoltre, viene descritta l’ecologia della specie. Alcuni astucci rac-
colti in natura erano parassitizzati da Xanthellum transsylvanicum Erdös & Novicky, 1951, anche esso
nuovo per la fauna italiana.
Key words. Lepidoptera, Psychidae, Taleporiinae, Taleporiini, Taleporia, Bankesia, defoliella,
Chalcidoidea, Xanthellum, transsylvanicum.
Einleitung
Im Herbst 2001 hat eine Gruppe Entomologen der Universita degli studi della Cala-
bria, dipartimento di Ecologica unter der Leitung von Dr. Stefano Scalercio bei der
Feldarbeit im Gebiet des Passo della Crocetta auf etwa 900 Meter über dem Meeres-
spiegel eine Anzahl kleiner Psychidensäcke gesammelt. Diese waren oft an den
Leitplanken entlang der Straße bis in etwa 20 cm über dem Boden festgesponnen. Im
Labor schlüpften dann einige ungeflügelte Weibchen, jedoch keine Männchen. Eine
spätere Nachsuche an denselben Leitplanken erbrachte Männchen, die sich von allen
im Gebiet bekannten Arten unterscheiden. Es war aber nicht sicher, ob diese
Männchen und die zuvor gezogenen Weibchen zur gleichen Art gehörten. Wir durften
jedoch annehmen, dass sich in den Säcken der im Freiland geschlüpften Weibchen
befruchtete Eier befinden. Mit diesem Material wurde eine Nachzucht in Uster
(Schweiz) auf 475 m über dem Meeresspiegel durchgeführt, weil dort die geeigneten
Zuchteinrichtungen und Erfahrung mit Psychiden-Zuchten zur Verfügung stehen.
Zur Zucht verwendeten wir einen Kasten, in dem das Biotop des Fundortes der
Säcke möglichst gut nachgebildet war. In diesen Kasten legten wir am 31.1. und nochmals
© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536
20 HATTENSCHWILER & SCALERCIO: Taleporia defoliella from Italy
Abb. 1-6. Merkmale der Imagines von Taleporia defoliella Constant, 1895. 1: Flügelform und -aderung.
2: Vorderbeine, links ©, vergrößert Epiphyse und Tarsus; rechts ©, vergrößert Tarsus. 3: Antennen, 4 — ©,
oben gesamte Lange, unten vergrößerter Ausschnitt, B — 9 (stärker vergrößert). 4: & Genitalapparat. 5:
© in Seitenansicht. 6: 9 Postabdomen.
am 21.3.2002 einige Weibchen-Säcke auf Moos, Rinden- und Aststücke sowie auf
Steine, die mit Flechten und Algen besetzt waren. Von nun an war nichts mehr zu
sehen bis zum 8.8.2002 als zwei erwachsene Raupen mit ihren Sacken an der Gaze
des Kastens empor kletterten und sich oben angesponnen haben. Die ganze Entwick-
lung hat im Verborgenen im Moos und unter den Rinden- und Holzstücken stattge-
funden. Zur Verpuppung suchten die meisten Weibchen einen erhöhten Ort, während
alle Männchen sich versteckt, tief im Moos oder in der Erde verpuppten, so dass nur
die Schlupföffnung aus dem Boden ragte. Erst durch diese Zucht konnten wir die bei-
den Geschlechter sicher derselben Art zuordnen: Bankesia defoliella (Constant,
1895). Sie wurde ursprünglich anhand von 6 Männchen aus den französischen West-
und Seealpen (Alpes Maritimes) beschrieben und war bislang auch nur aus dieser
Region bekannt. Im folgenden geben wir eine Beschreibung der Männchen sowie der
bislang unbekannten Präimaginalstadien, der Säcke, der Weibchen sowie der Lebens-
Nota lepid. 26 (1/2): 19-25 21
weise und zeigen anhand der morphologischen Befunde, dass diese Art nicht zur
Gattung Bankesia Tutt, 1899, sondern wieder zur Gattung Zaleporia Hübner, [1825]
gestellt werden muß, ın der sie ursprünglich beschrieben wurde.
Taleporia defoliella Constant, 1895 comb. rev.
Talaeporia [sic] defoliella Constant, 1895: st
Bankesia defoliella (Constant, 1895) (Tutt 1899: 191).
Typenfundort: France, “Collines de |’Estérel’ [Alpes Maritimes, in einem Pinienwald
(Constant 1899)].
Material. -509 (ex larva/ ex pupa), ~30 Freilandtiere sowie 320, 239 (ex. ovo), Italien, Kalabrien,
Passo della Crocetta, 900 m, Mitte September bis Anfang Oktober; weitere Belege von verschiedenen
Fundorten in Kalabrien; coll. Universita della Calabria Dipartimento di Eccologia Arcavacata di Rende-
Cosenza, Naturmuseum Luzern, Museum für Tierkunde Dresden, Sammlung R. und P. Hattenschwiler
und weitere. 20 Piemonte, Region Asti, Boschi di Valmanera, 25.9.1975; 19 Piemonte, Riserva Natur
Valle Andona, 21.9.2000; 19 Piemonte, Sassello, 29.9.1969, alle Tagfang und Baldizzone leg., coll.
Baldizzone et Hättenschwiler.
Beschreibung ©. Flügelspannweite 8,5-10 mm; alle Flügel schmal; Hinter-
flügel mit langen Fransen, deren Länge nahezu die Flügelbreite erreicht. Vorderflügel
mit 10 Adern aus der Discoidalzelle, mit Anhangzelle, Deckschuppen Klasse 5-6
(Sauter 1956), gelb-goldiger Grundfarbe mit vielen braunen Flecken, am äußeren
Zellende meist ein größerer dunkler Fleck. Hinterflügel mit 6 Adern aus der Discoidal-
zelle (Abb. 1), Deckschuppen Klasse 3-4, einfarbig hellgrau. Kopf mit Ocellen;
Komplexaugen groß, Abstand etwa 1,2-1,6 x Augenhöhe; Labialpalpen lang, 3-glied-
rig, mit haarförmigen Schuppen; Kopf anterior dunkelbraun, dorsal braungelb mit
haarförmigen Schuppen besetzt. Fühler fadenförmig, etwa 28 Glieder, dorsal be-
schuppt, anteroventral auf jedem Glied zwei unregelmäßig geformte Wärzchen mit
mehreren büschelartig angeordneten Borsten (Abb. 2-A). Vorderbeine mit Epiphyse
(Abb. 3), Mittelbeine mit 1 Paar Tibialsporne, Hinterbeine mit 2 Paaren. Genital mit
Tegumen eingekerbt; Saccus breit, kurz, gerundet; Aedeagus gebogen (Abb. 4).
©. Ungeflügelt; Körper 3,5-4 mm lang (ohne Legeröhre), zylindrisch, 0,7-0,9 mm
im Durchmesser; blassgelb; dorsal auf Kopf-, Brust- und Abdominalsegmenten hell-
braune, sklerotisierte Platten; ventral auf jedem Segment zwei gegeneinander
gerichtete hellbraune sklerotisierte, dreieckige Platten, die auch verbunden sein können.
Ocellen fehlen; Augen klein, schwarz, rückgebildet; Labialpalpen rückgebildet, kaum
noch erkennbar (Abb. 5); Antennen kurz, 6-9 Glieder (Abb. 2-B). Beine reduziert,
geeignet zum Festklammern am Sack, jedoch nur schlecht brauchbar zur Fortbewe-
gung; alle Tarsen mit 5 Gliedern. Genitalöffnung auf dem Segment VIII umgeben von
langen, schmalen Dornen (Abb. 6); Afterwolle dunkel rotbraun, nicht geknöpft
(Sauter 1956); Legeröhre lang ausstreckbar (zum Ablegen der Eier in den Sack).
Ei. bei der Ablage blaßgelb, leicht oval, ohne Strukturen; verfärbt sich später und
wird vor dem Schlüpfen bräunlich.
Talaeporia Agassiz, 1847 is an unjustified emendation and Talaeporia Zeller, 1838 an incorrect subse-
quent spelling, both of Taleporia Hübner, [1825]) (cf. Nye & Fletcher 1991).
22 HATTENSCHWILER & SCALERCIO: Taleporia defoliella from Italy
=
BR
As,
hintere
Offnung
Abb. 7-9. Merkmale der Präimaginalstadien von Taleporia defoliella Constant, 1895. 7: Raupen
(Seitenansicht, alle gleicher MaBstab). A — 1. Stadium, frisch aus dem Ei geschliipft, B — Raupe im
2. Stadium, C — Raupe vor der Verpuppung. 8: Der Sack beider Geschlechter. A — Riickenseite, B — schrag-
seitlich, C — Frontalansicht mit Schlupföffnung. 9: © Puppe, Kopf in Frontalansicht.
Raupe (Abb. 7). vor der Verpuppung etwa 3 mm lang, 0,6 mm Durchmesser.
Kopf und Brustsegmente hellbraun, hart sklerotisiert. Abdominalsegmente blah
weıßlich mit meist fünf leicht erhöhten Feldern, je 2 lateral und ein Feld dorsal.
Sack. Beider Geschlechter im Querschnitt dreieckig, 6,5—7,0 mm lang, Seiten 1
mm breit (Abb. 8), aus Seide, ohne Einbezug anderer Materialien (nur vereinzelt sind
um die vordere Öffnung Pflanzenfragmente, Sandkörnchen oder Chitinteile angespon-
nen); hinteres Ende, durch das der Kot ausgestoßen und das Weibchen schlüpfen wird,
durch drei Lappen verschlossen (diese Lappen werden im Inneren durch gespannte
Fäden zusammengehalten und können dadurch von Aussen kaum geöffnet werden).
Puppe. Vor dem Schlüpfen dunkelbraun, da Imago durchscheint, Exuvie hell-
braun. & Puppen mit deutlich erkennbaren Scheiden für alle Körperteile. Kopfplatte der
o Puppe stark reduziert, die einzelnen Teile oft nicht unterscheidbar; kurze
Fühlerscheiden jedoch länger als Kopfplatte, diese mit zwei Borstenpaaren (Abb. 9).
Abdominalseg-mente dorsal bedornt; ein nach hinten gerichtetes Dornenfeld hilft der
Puppe sich beim Schlüpfen teilweise aus dem Sack zu schieben.
Lebensweise. Flugzeit von September bis erste Oktoberhälfte. Die Männchen
schlüpfen am Abend und warten dann an Moosen, Gräsern oder Steinen sitzend bis
bei Tagesanbruch die Weibchen schlüpfen und zu locken anfangen. Dazu sitzen sie
am Sack, Kopf nach oben gerichtet, die Legeröhre weit nach oben ausgestreckt. Die
wartenden Männchen reagieren sogleich auf den Lockduft der Weibchen und fliegen
Nota lepid. 26 (1/2): 19-25 23
zu ihnen. Die Kopula dauert 1—2 Minuten, dann fliegt das Männchen weiter und sucht
weitere Weibchen. Wir konnten 3 Paarungen eines einzelnen Männchens beobachten.
Das Geschlechtsverhaltnis ist etwa 1 : 1. Sofort nach der Paarung beginnt das Weibchen
seine Eier in den Sack zu legen, dazu schiebt es die lang ausgestoßene Legeröhre
zwischen der Sackwand und der noch im Sack steckenden Puppenhülle in den Sack.
Die Ablage der etwa 18-26 Eier (n = 30) dauert 2-2,5 Stunden, dann wird die Lege-
röhre aus dem Sack gezogen und das Weibchen klettert weg oder fällt zu Boden und
stirbt bald. Beim Ablegen der Eier werden die Afterschuppen abgerieben und kommen
zwischen den Eiern zu liegen, wo sie als Polsterung und Schutz dienen. Wenn keine
Paarung stattgefunden hat, klettert das Weibchen um die Mittagszeit vom Sack weg
und stirbt. Beide Geschlechter erleben den nächsten Tag nicht.
Die Raupen der Weibchen klettern ab etwa Mitte August in die Höhe und spinnen
ihren Sack an festen Gegenständen wie Steine, Holz, Leitplanken der Straßen usw.
fest. Die Puppenruhe dauert etwa 3 Wochen, etwas abhängig vom Wetter, besonders
der Temperatur.
Die Raupen der Männchen bleiben ihr ganzes Leben in der Bodenstreu, zwischen
Moosen und Steinchen versteckt. Zur Verpuppung werden die Säcke im Moos, ın
Ritzen und Bodenstreu festgesponnen oder in die Erde so tief eingegraben, dass nur
noch die hintere Öffnung die Oberfläche erreicht.
Die ganze Entwicklung findet im Verborgenen statt, sogar bei Zuchten ist das
Beobachten in den Zuchtkästen sehr schwierig bis unmöglich. Die jungen Raupen
schlüpfen sehr unterschiedlich, im Zimmer sind die ersten schon Anfang Dezember
geschlüpft, im Freien waren die letzten Beobachtungen im Marz. Die Eientwicklung
scheint somit sehr von der Umgebungstemperatur beeinflußt zu sein. Die frisch
geschlüpften Raupen (Abb. 7-A) bauen sogleich einen kleinen Sack, wozu sie die von
der Mutter unter die Eier gemischten, seidigen, langen Abdominalschuppen mit ver-
wenden. Kaum einen Tag alt findet die erste Häutung statt. Als Futter kommen Algen,
Flechten und verwesende Pflanzenteile ın Frage.
Den Ausbau den Sackes konnten wir bei der verborgenen Lebensweise der Raupen
nicht beobachten. Es ist aufgrund der Sackkonstruktion jedoch anzunehmen, daß der
Ausbau ähnlich wie bei Taleporia tubulosa Retzius, 1783 stattfindet (Hättenschwiler
1997: 214-219).
Aus den Freiland-Säcken wurden einige Exemplare des Parasitoids Xanthellum
transsylvanicum Erdos & Novicky, 1951 gezogen (det. Prof. Dr. G. Viggiani, Neapel);
der Befall liegt bei etwa 1.5 %. Diese Art ist neu für Italien.
Systematische Stellung. Durch die späte Flugzeit im September bis
Oktober unterscheidet sich 7! defoliella von den meisten anderen Arten der
Taleporiinae, die in den Monaten März bis Mai fliegen. Im Herbst fliegen lediglich
Taleporia autumnella Rebel, 1919 aus Pisino in Istrien (sie soll helle lehmgelbe haar-
förmige Schuppen auf dem Kopf sowie Fühler mit kürzerer Bewimperung haben) und
Bankesia deplatsella Nel, 1999 aus Süd Frankreich, Bouches-du-Rhone (sie hat 9 mm
Flügelspannweite und feine Unterschiede in der Form der Valven im männlichen
Genital). Beide Arten konnten wir nicht selber vergleichen, die Angaben haben wir
den Beschreibungen entnommen.
24 HATTENSCHWILER & SCALERCIO: Taleporia defoliella from Italy
Tab. 1. Merkmale zur Unterscheidung der drei Gattungen Taleporia, Pseudobankesia, Bankesia. Die
jeweils gattungstypischen Merkmale sind kursiv gedruckt. * Präparation und Einbettung des Genitales
oder der Betrachtungswinkel kann dieses Verhältnis stark beeinflussen.
| Takpra | ____Pseudobankesia
2 Borstenbündel / Segment |2 Borstenbündel / Segment | 1 Halb-Kranz / Segment
S Genital
GC Valvenlänge * überragen Tegumen wenig |überragen Tegumen kaum überragen Tegumen deutlich
Oo Tegumen ohne Stab ohne Stab mit Stab
ohne Spitzen mit Spitzen ohne Spitzen
Sack lang, hart, ohne Belag kurz, weich, mit Belag kurz, weich, mit Belag
Länge : Breite 4:1-8:1 1,4:1 —3.5:1 2:13:
Q alle Beine 5 Tarsenglieder 5 Tarsenglieder meist 3 Tarsenglieder
Stab im Tegumen
Tegumen mit Spitzen
Abb. 10.-11. Gattungsmerkmale von Taleporia Hübner, 1825, Pseudobankesia Meier, 1963 und
Bankesia Tutt, 1899. — 10: Antennen (unterschiedliche Vergrößerungen), A: Taleporia, B:
Pseudobankesia, C: Bankesia. — 11: Männliche Genitalien, A: 7. tubulosa (Retzius, 1783), B: P
alpestrella (Heinemann, 1870), C: B. conspurcatella (Zeller, 1850).
Nota lepid. 26 (1/2): 19-25 25
Die vorliegende Studie vieler Exemplare beider Geschlechter, der Säcke und der
Lebensweise zeigt, daß defoliella wieder zurück in die Gattung Taleporia gesetzt wer-
den muß. In Tabelle 1 werden die gattungstypischen Merkmale (kursiv) der sich inner-
halb der Taleporiini besonders ähnlichen Gattungen Taleporia, Pseudobankesia
Meier, 1963 und Bankesia zusammengefaßt.
Danksagung
Wir danken allen die mit geholfen haben, diese Arbeit durchzuführen, im besonderen Prof. Dr. Pietro
Brandmayr, Universitä degli Studi della Calabria, Dip. di Ecologia (Arcavacata di Rende-Cosenza) für
die finanzielle Unterstützung der Arbeiten in Kalabrien. Vielen Dank auch den beiden Damen Emilia
Pugliese und Manuela Russo (Arcavacata di Rende-Cosenza), die durch ihre Arbeiten im Feld viel zur
Kenntnis der weitgehend unbekannten Art beigetragen haben. Auch danken wir Prof. Dr. G. Viggiani,
Universita degli Studi di Napoli „Federico II“ für das Bestimmen der Parasitoide. Prof. Dr. Willi Sauter
(Illnau) danken wir für die Beratung und Ruth Hättenschwiler und Sereina Parpan (Uster) für die
Durchführung der Zuchten in Uster.
Literatur
Burks, R. A. 2002. Key to the Nearctic genera of Eulophidae, subfamilies: Entedoninae, Euderinae, and
Eulophinae (Hymenoptera: Chalcidoidea). — http://cache.ucr.edu/heraty/Eulophidae/ Xanthellum_
page.html.
Constant, A. 1895. Microlépidoptéres nouveaux de la faune frangaise. — Bulletin Société Entomologique
de France: 50-55.
Constant, A. 1899. Description of a new Taleporid species: Zaleporia vernella, n. sp. with a further des-
cription of 7. defoliella Cnst. — Entomologist’s Record and Journal of Variation 11: 256.
Hattenschwiler, P. 1997. Psychidae-Sackträger. S. 165-308. — Jn: Pro Natura (Hrsg.), Schmetterlinge und
ihre Lebensräume 2. Fotorotar, Egg.
Meier, H. 1963. Zur Kenntnis der Gattungen Pseudobankesia gen. nov. und Bankesia. — Mitteilungen der
Münchner Entomologischen Gesellschaft 53: 1-23
Nel, J. 1999. Espèces nouvelles ou rarement signalées de microlépidoptères de France. — Bulletin de la
Société entomologique de France 104 (4): 347-355
Nye, I. W. B. & D. S. Fletcher 1991. The generic names of moths of the world 6. Microlepidoptera. —
Natural History Museum, London. i-xxx, 1-368.
Rebel, H. 1919. Zur Kenntnis palaearktischer Taleporiiden. — Deutsche Entomologische Zeitschrift Iris
32 (1918) 3-4: 95-112.
Sauter, W. 1956. Morphologie und Systematik der schweizerischen Solenobia-Arten. — Revue Suisse de
Zoologie 63 (27): 451-550.
Tutt J. W. 1899. New genera in the Micro-Psychids. — Entomologist’s Record and Journal of Variation 11
(7) 191.
26 Book review
Book Review
Horak, M. & R. B. Halliday (eds.) 2003. Lepidoptera Systematics and Biology. A
tribute to Ebbe S. Nielsen. — Invertebrate Systematics 17 (1). ISSN 1445-5226.
Price: Au$ 75.00. |
This special issue of Invertebrate Systematics is dedicated to the memory of Ebbe
Schmidt Nielsen (7.6.1950-6.3.2001). Ebbe’s tremendous beneficial influence on
lepidopterology can hardly be described just by a few lines. Niels Peder Kristensen
(2001, Nota lepidopterologica 24 (3): 3-9) already reminded of him as a European
lepidopterist, as one of the founders of the Societas Europaea Lepidopterologica, and
as a leader of Australian lepidopterology. Invertebrate Systematics, a journal whose
Advisory Committee he chaired for several years, now commemorates his life and
contributions to science. Contributions were invited from friends and colleagues of
Ebbe, who had worked and collaborated with him during his career. J. L. Edwards, R.
B. Halliday, M. J. Scoble, and M. Whitten write about Ebbe’s leading activities in
lepidopterology, his achievements in terms of the management for the Australian
National Insect Collection, his bioinformatics legacy and compiled a bibliography of
Ebbe. A number of scientific papers were collected and edited by Marianne Horak
and Bruce Halliday in order to honour Ebbe and thus his broad impact on lepidop-
teran systematics, which reaches well beyond the groups that he worked on himself.
Just to give examples, the issue includes the description of the new monotrysian moth
family Andesianidae from South America (by D. R. Davis & P. Gentili), descriptions
of the new genera Plesiozela (Heliozelidae) by O. Karsholt & N. P. Kristensen,
Xanadoses (Cecidosidae) by R. J. B. Hoare & J. S. Dugdale, and Ebbepterote
(Eupterotidae) by R. G. Oberprieler, W. A. Nässig & E. D. Edwards. Several new
species are described from Guam, Argentinia, New Zealand, Tasmania, mainland
Australia, Japan, Papua New Guinea, and Sulawesi. Studies of host-plant relation-
ships of several lepidopteran groups, a reassessment of the pyralid Anerastiini, and a
test of the Gondwanan ancestry of Australian butterflies are given. The entire issue
includes information about so many lepidopteran families from around the world that
it will be an important addition to the libraries of Lepidoptera biologists worldwide.
All papers included in the journal are of good standard and layout, as a tribute to Ebbe
should be. Congratulations to all authors and especially the two editors, Marianne
Horak and Bruce Halliday for this fine contribution!
The issue is for sale as a stand-alone title from CSIRO Publishing
(http://www.publish.csiro.au/index.cfm).
MATTHIAS NUSS
Nota lepid. 26 (1/2): 27-34 27
Coleophora variicornis Toll, 1952 stat. rev. is a distinct species
occurring in Central Europe (Coleophoridae)
MATTHIAS Nuss! & ANDREAS STÜBNER”
! Museum für Tierkunde, Königsbrücker Landstr. 159, D-01109 Dresden.
2 Schulstr. 14a, D-03197 Jänschwalde-Ost
Abstract. Coleophora variicornis Toll, 1952 formerly treated as a synonym of C. hieronella Zeller, 1849
is recognised as a distinct species after investigation of the type specimens. Diagnoses are given to distin-
guish these two species from the other members of the Coleophora trifolii species group and to distinguish
C. variicornis from C. hieronella. Their external and genitalia features are described and figured.
According to our investigations, C. variicornis is known by specimens from Albania, Bulgaria, Croatia,
Germany, Italy, Macedonia, Turkey, and Turkmenistan. Coleophora variicornis is recorded for the first
time from Central Europe by specimens collected in historical and recent times from the German state of
Brandenburg. Coleophora hieronella is so far known from Spain, France, Italy (Sicily), and Croatia.
Key words. Coleophora trifolii species group, variicornis, hieronella, taxonomy, nomenclature.
Introduction
Vives-Moreno (1988) listed about 1000 species for the genus Coleophora Hubner,
1822 world wide, of which 174 species occur in Germany (Gaedike & Heinicke 1999).
When we revised the faunistic inventory of the species of Coleophora Hubner, 1822
from eastern Germany we found altogether six species distinguished by their metallic
green coloured forewings. However, until that time only five species with this character
had been known from Germany (Gaedike & Heinicke 1999). These are C. frischella
(Linnaeus, 1758), C. mayrella (Hübner, [1813]), C. alcyonipennella (Kollar, 1832),
C. trifolii (Curtis, 1832), and C. deauratella Lienig & Zeller, 1846 for which Emmet
et al. (1996) proposed the C. trifolii species group (which excludes C. alcyonipennella
which is not known from the British Isles, but includes the Mediterranean C. fusci-
cornis Zeller, 1847 which is recorded from North Essex in Great Britain). So far as
known, the larvae of these species feed on the seeds of legume species of the genera
Melilotus, Trifolium, and Vicia (Emmet et al. 1996).
We checked the literature for other species related to this species group (e.g.
Baldizzone 1986, 1990a, b; Vives-Moreno 1988; Nel 1993; Emmet ef al. 1996) and
traced about 30 names (including synonyms) available for metallic-green Coleophora
species. However, we could not identify our German specimens with the available lit-
erature and started to check the type specimens. During this process, we found that C.
variicornis Toll, 1952 which has been treated as a synonym of C. hieronella Zeller,
1849 (Toll 1961; Baldizzone 1986; Vives-Moreno 1988) is a distinct species conspe-
cific with specimens from Germany. In the following, we redescribe the two species,
figure their genitalia and give a list of the examined material.
' According to Gaedike & Heinicke (1999), there is another metallic-green Coleophora species known
from Germany, C. paripennella Zeller, 1839. However, this species does not belong to the C. trifolii
species group due to different morphological features of the genitalia and a different life history (cf.
Emmet et al. 1996: 300-301, figs. 52b, 78d, pl. 15 fig. 28).
© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536
28 Nuss & STUBNER: Coleophora variicornis stat. rev. in Central Europe
Fig. 1. Coleophora variicornis, adult from Germany, Brandenburg, Jänschwalde/ Ost, 23.v1.2002,
Stübner leg. Note the flagellum which is thickened along the basal third, chequered black and white along
the distal two thirds.
Abbreviations. DEI — Deutsches Entomologisches Institut, Eberswalde; BMNH — The Natural History
Museum London; GU - Genitaluntersuchung (genitalia slide); MNHU — Museum für Naturkunde der
Humboldt-Universität zu Berlin; MTD - Staatliches Museum für Tierkunde, Dresden; ISEZ — Polish
Academy of Sciences, Institute of Systematics and Evolution of Animals, Department of Invertebrate
Zoology, Krakow; ZSM — Zoologische Staatssammlung, Munchen.
Results
Externally, C. variicornis (Fig. 1) and C. hieronella present the same morpholo-
gical features and can not be distinguished from each other. The forewing length
(measured from the base of the wing to the tip of the apical fringe) is 4-5.5 mm in
C. variicornis and 5.5 mm in the holotype of C. hieronella. Head vertex and fronto-
clypeus covered with metallic olive-green scales, shining metallic copper to bronze;
compound eye black-brown, shining metallic violet, not distinctly edged; labial pal-
pus metallic olive-green, basio-ventrally creamy-white; proboscis basally scaled
creamy-white. Antenna about three quarter as long as forewing; scape flat and
enlarged, covered with elongated metallic violet-brown scales projecting ventrally;
first third to first half of flagellum thickened by dark metallic brown to violet
coloured scales, remaining distal part entirely chequered black and white. Thorax dor-
sally and ventrally covered with metallic olive-green scales; legs metallic olive-green
Nota lepid. 26 (1/2): 27-34 29
to brown, shining orange to violet; dorsal surface of forewing basally scaled metallic
olive-green, changing to metallic brown and violet distally, ventral surface shining
silver (changing to brown in older collection specimens); hindwing lanceolate, greyish-
brown, not metallic. Abdomen metallic silver, ventrally with some olive shine.
Though C. variicornis and C. hieronella can not be distinguished externally from
each other, they differ by their characteristic scaling of the antennae from all other
metallic-green Coleophora species we examined. Some species of the C. trifolii-
group have a basally slender flagellum without elongated scales (C. alcyonipennella,
C. frischella, C. fuscicornis, C. trifolii, C. etrusca Baldizzone, 1990) while the fla-
gellum of the remaining species of the C. trifolii group is basally thickened by elon-
gated scales (C. deauratella, C. hieronella, C. mayrella, C. paramayrella Nel, 1993,
C. variicornis). Among the five species with a basally thickened flagellum, the remai-
ning part of the flagellum is black with a white tip (C. deauratella), chequered black
and white with a white tip (C. mayrella, C. paramayrella), or entirely chequered black
and white (C. variicornis, C. hieronella). However, we also found C. mayrella speci-
mens which have the antennae entirely chequered black and white up to the tip. Those
specimens need to be identified by their genitalia. For the identification of C. mayrella
(= Porrectaria spissicornis Haworth, 1828), we here refer to Baldizzone (1986) and
Emmet et al. (1996).
Coleophora variicornis Toll, 1952: 28, fig. 21, stat. rev. (Figs. 1-3, 6, 7)
Material. Holotype S with labels: “Typus” (red paper, printed in black); “Holotypus” (red paper,
printed in black); “fabriciella | Amasia” (handwritten with pencil on light green paper”; “Präparat |
No. 39 | Gr. v. Toll” (on white paper handwritten and printed in black); “Coleophora | variicornis Toll |
Typus. | Gr. v. Toll det.” (handwritten and printed in black ink), MNHU. Paratypus: Q same data as holo-
type, ISEZ. © Albania, Borschi, south of Vlora, 14-27.v.1961; © Albania, Uji Ftohte, south of Tepelena,
200 m, 29-31.v.1961; 40, Albania, west of Poliçan, Tomor, 500 m, 2—12.vi.1961; 4c Albania, Iba below
Krraba, 400 m, 17-22.v1.1961; 30° Albania, Daiti, Shkall Prisk, 850 m, 27.vi.-2.vu.1961; all specimens
at light, Albania expedition DEI, coll. DEI. @ Croatia, Dalmatia mer., environment of Gravosa,
15-31.v.1939, Klimesch leg., ZSM. @ Macedonia, Matka, Treska valley, 19-29.v.1955, Klimesch leg.,
ZSM. © Italy, Lucania, Vulture Va! d’Ofanto, 20—30.iv.1966, Klimesch leg., ZSM. © Bulgaria, Pirin
mts., Liljanovo, 800 m, 26.v.—21.vi.1981, leg. Eichler, coll. DEI. 250, 9 Germany, Brandenburg,
Jänschwalde/Ost, 2.viii.1996, 26.vi.1998, 16., 28.vi., 13.vii.1999, 11.vi., L.vii., 1.v111.2000, 29.vi., 1, 3,
23.vii.2001, 13, 17, 23.vi.2002, 14.vi., 7., 14.v11.2003; 4c Jänschwalde, power station, 15, 16,
22.v1.2002, all specimens A. Stübner leg., coll. Stübner, MTD. © Potsdam-Wilhelmshorst, 10.vii.[19]43,
coll. Ernst, MTD. 1S Greece, Delphi, Parnass, 500 m, 28-30.iv.1980, Cox leg., coll. van der Wolf.
30 Turkmenistan, western Kopet Dag, 40 km east of Garrygala (= Kara Kala), 800 m, 4, 15, 19.v.1993,
Sruoga leg., coll. van der Wolf.
References. Toll 1961: 280 (syn. of hieronella); Patzak 1974: 319: (C. variicornis as bona sp.);
Baldizzone 1986: 3, 9, figs. 15, 18, 24-26 (as C. hieronella); Vives-Moreno 1988: 82 (syn. of hieronella);
Razowski 1990: fig. 407 (as C. mayrella).
30 Nuss & STUBNER: Coleophora variicornis stat. rev. in Central Europe
Figs. 2-5. Male genitalia. 2. C. variicornis (GU Stübner 860). 3. C. variicornis (GU Stübner 860),
cornuti (interference contrast and extended focus option with 41 planes, interplanal distance 0.55 um,
object depth 22.2um) scale bar 40um. 4. C. hieronella, holotype (genitalia slide BM Microlep. 2363).
5. C. hieronella, holotype (genitalia slide BM Microlep. 2363), cornuti (interference contrast and extended
focus option with 62 planes, interplanal distance 0.74 um, object depth 45,6 um) (one cornutus is bro-
ken off) scale bar 40um.
CO genitalia (Figs. 2, 3). As is characteristic for the genus Coleophora, an
uncus is not present and the distal part of the gnathos is an ovoid structure bearing
many spines; tegumen narrow, without any special features; vinculum slender, V-
shaped; costal part of valva weakly sclerotised, finger-shaped, without macroscopic
setae dorsally; sacculus strongly sclerotised, dorsal edge more strongly sclerotised and
terminating in a dorso-distal thorn, with one macroscopic seta ventro-anally; aedea-
gus caudally forming a sclerotised ring with a dorso-caudal elongated projection,
vesica with a group of 8—10 cornuti, which arise from a broad, straight sclerotised
base, which can be plate-like and enlarged; each cornutus straight.
© genitalia (Figs. 6, 7). Bursa copulatrix ovoid with minute scobinate patches
in its wall, signum crescent-shaped and with a sclerotised hook directed inwardly;
ductus bursae membranous and straight on anterior third, slightly angled beyond and
along the second third with numerous sclerotised spines in wall, angled at insertion of
ductus seminalis, posterior third straight and membranous; colliculum forming an
ovate sclerotised shield with strongly sclerotised spines; antrum strongly sclerotised,
funnel-shaped, with a smooth wall; VIIIth segment entirely sclerotised, surrounding
ostium bursae ventrally; membrane VIII-IX elongated; apophyses posteriores twice as
long as apophyses anteriores; papillae anales separated, each pointed distally.
Nota lepid. 26 (1/2): 27-34 31
Figs. 6-9. Female genitalia. 6. C. variicornis (GU Stübner 1407). 7. C. variicornis (GU Stübner 1407),
detail of posterior ductus bursae and segment VII. 8. C. hieronella (GU van der Wolf 6242). 9. C.
hieronella (GU van der Wolf 6242), detail of posterior ductus bursae and segment VIII. (a.a.: apophyses
anteriores; c: colliculum; d.b.: ductus bursae; d.s.: ductus seminalis; VIII: segment VIII)
Diagnosis. Coleophora variicornis 1s distinguished from C. hieronella in the
male by the absence of a macroscopic seta from the costa of the valva and in the
female by the more pointed posterior tips of segment VIII, the longer apophyses ante-
riores, and the thicker ductus bursae between the ductus seminalis and colliculum.
Distribution. Known from Germany, Italy, Croatia, Macedonia, Albania,
Bulgaria, Greece, Turkey, and Turkmenistan.
Life history. The male adults have been attracted by lights, the female has
been netted from Trifolium pratense flowers in day time. Surprisingly, C. variicornis
is at least in some areas of eastern Germany the most common species of the €. tri-
folii species group.
Coleophora hieronella Zeller, 1849: 203 (Figs. 4, 5, 8, 9)
Material. Holotype (by monotypy) & “Syracuse | SIZILY | 29.iv.1844 | Zeller.” (handwritten with
black ink on white paper), “Hieronella Z. | 29/4 44. Syracus. | Mayrella Is. 47, 883” (handwritten with
black ink on white paper, edged with black ink), “B.M. © | Genitalia slide | No. 2363” (printed in black
and handwritten in red ink), “Coleophora | hieronella, Z. | Lin. Ent. IV. 203. (1849) | = C. * mayrella,
Z. Is. 1847.883-4 | Type B-unique-desr.” (handwritten and printed with black ink on white, black edged
paper), (drawer label: “Holo- | type”), BMNH. ©, 9 [paratypes of C. varticornis!] Spain, Chiclana,
iv-v.1912, Korb leg., ISEZ; 40 Huelva, El Rompido, 13.v.1981, coll. van der Wolf; 40° Sierra Morena,
Sta. Elena, Jaen, 10.v.1983, J. B. Wolschrijn, coll. van der Wolf; © Almeria, Las Menas de Seron, 1500 m,
32 Nuss & STUBNER: Coleophora variicornis stat. rev. in Central Europe
1-2.v1.2003, leg. et coll. van der Wolf; & Huelva, Mazagon, 8-10.iv.1994, leg. et coll. van der Wolf;
20 Ventade, Azuel, Cortoba, 17.v.1981, coll. van der Wolf; @ Marabella, Malaga, 5.v.1981, coll. van der
Wolf; @ Salamancha, Belena, 8.v.1979, coll. van der Wolf; @ Sevilla, Ronquillo, 15.v.1981, coll. van der
Wolf; & Granada, 2.v.1978, coll. van der Wolf; © Periana, Malaga, 24.iv.1978, coll. van der Wolf:
@ Andalusia, province Malaga, Camino, de Ojen, 150 m, 17.iv.1980, E. Traugott-Olsen leg., ZSM;
S Granada, 5 km north of Otivar, 600 m, 17.iv.1987, Coenen & de Prins leg., coll. van der Wolf.
CG France, Corse sept., Calvi, 12-20.v.1967, Klimesch leg., ZSM; ©, 9 Corse, Ste Lucie de Porto
Vecchio, 7, 11.v.1996, K. J. Huisman leg., coll. van der Wolf. & Italy, Sizily, Palermo, S. Martino d.
Scale, 20-31.v.1954, Klimesch leg., ZSM. GC Croatia, Istrien, Moscenice, 300 m, 5.vi.1970,
A. Speckmeier leg., ZSM
References. Toll 1961: 280; Patzak 1974 b: 319 (syn. of spissicornis); Baldizzone 1983: 225, 227;
Kaltenbach & Roesler 1985: 49, 83, 84, 93, 104; Baldizzone 1986: fig. 14 (male genitalia of holotype of
C. hieronella); Vives-Moreno 1988: 82; Baldizzone 1990 a: 43; Baldizzone 1994: 83; Baldizzone
1995: 110; Baldizzone 1997: 223.
GO genitalia (Figs. 4, 5). As is characteristic for the genus Coleophora, an uncus
is not present and the distal part of the gnathos is an ovoid structure bearing many
spines; tegumen narrow, without any special features; vinculum slender, V-shaped;
costal part of valva weakly sclerotised, finger-shaped, with one macroscopic seta dor-
sally; sacculus strongly sclerotised, dorsal edge more strongly sclerotised and termi-
nating in a dorso-distal thorn, and with one macroscopic seta ventro-anal; aedeagus
caudally forming a sclerotised ring with a dorso-caudal elongated projection, vesica
with a group of seven cornuti, which arise from a sclerotised, slender and elongated
base which is bent on the side where the smaller cornuti arise (entire length of cornuti
group: 180 um); each cornutus slightly bent.
© genitalia (Figs. 8, 9). The features of the 9 genitalia are very similar to those
of C. variicornis, with the following exceptions: the posterior tips of segment VIII are
less pointed, more rounded, the apophyses anteriores are shorter, and the ductus bur-
sae is narrower posterior to the ductus seminalis.
Diagnosis. Coleophora hieronella differs from C. variicornis in the male by
the presence of a seta at the costa of the valva, in the female by the more rounded pos-
terior tips of segment VIII, the shorter apophyses anteriores, and the narrower ductus
bursae between the ductus seminalis and colliculum.
Distribution. Known from France, Spain, Italy (Sicily), and Croatia.
Remarks. After we identified a male of C. hieronella collected on May 11, 1996 at
“Ste Lucie de Porto Vecchio” on Corsica, we concluded that a female from the same
locality collected on May 7, 1996 might be conspecific with it. Subsequently, we
investigated the differences of C. hieronella and C. variicornis in female genitalia and
found that they are very little. However, the result is supported by the fact that the two
paratypes (9, Q) of C. variicornis from Spain appeared to be true C. hieronella, and
all characters correspond with that species. According to these results, Baldizzone
(1986) figured under ‘C. hieronella’ a female of C. hieronella on figures 24 and 25
(from Andalusia), but C. variicornis on figure 26 (from Eolie Islands, Lipari).
Nota lepid. 26 (1/2): 27-34 33
Discussion
Baldizzone (1983-1997) records ‘C. hieronella’ from a number of localities in the
Mediterranean Region. Since this species has been confused with C. variicornis for-
merly, we do not repeat those records for the distribution of C. hieronella here. It will
be necessary to re-investigate those records and to verify whether the specimens
belong to C. hieronella or to C. variicornis.
Acknowledgements
We acknowledge the loan of type specimens of metallic green Coleophora-species by Patrice Leraut &
Joël Minet (MNHN Paris), Wolfram Mey (MNHU Berlin), Lukasz Przybylowicz (ISEZ Krakow), and
Kevin Tuck (BMNH London). James E. Hogan from the Hope Entomological Collections of the Oxford
University Museum of Natural History kindly checked for us the type specimen of Coleophora spissi-
cornis (Haworth, 1828). For the loan of additional specimens we thank Andreas Segerer (ZSM Munich),
Reinhard Gaedike (DEI Eberswalde), and Hugo van der Wolf (Nuenen). Helmut Kolbeck (Weng) and
Antonio Vives Moreno (Madrid) kindly supplied our work with literature on Coleophora. We presented
the discovery of an additional species of dark-metallic green Coleophora-species in Germany to the
Microlepidoptera-workshop at the SEL-congress held in Korsor in June 2002 and thank the participants
for their contributions to the discussion, especially Marko Mutanen (Oulu), Antonio Vives Moreno, and
Hugo van der Wolf (Nuenen). Giorgio Baldizzone (Asti) and Hugo van der Wolf carefully reviewed this
manuscript and kindly provided constructive comments. We gratefully acknowledge the linguistic
improvements by Bernard Landry (Geneve) to the English manuscript.
References
Baldizzone, G. 1983. Records of the Lepidoptera of Greece based on the collections of G. Christensen
and L. Gozmany: III. Coleophoridae. — Annales Musei Goulandris 6: 207—248.
Baldizzone, G. 1986. Contributions a la connaissance des Coleophoridae. XLII. Sur quelques Coleo-
phoridae d‘Espagne (Seconde partie: Espèces nouvelles pour la Faune espagnole, ou peu connues).
— Nota lepidopterologica 9 (1-2): 2-34.
Baldizzone G. 1990 a. Contributi alla conoscenza dei Coleophoridae, LVI. Coleophoridae nuovi o
poco conosciuti della fauna Greca (Lepidoptera). — Fragmenta Entomologica, Roma 22 (1): 39-59.
Baldizzone, G. 1990 b. Contributions a la connaissance des Coleophoridae. LXII. Deux especes nou-
velles du genre Coleophora Hübner de la région méditerranéenne (Lepidoptera). — Nota lepi-
dopterologica 13 (4): 198-206.
Baldizzone, G. 1994. Contribuzioni alla conoscenza dei Coleophoridae. LXXV. Coleophoridae dell’ Area
Irano-Anatolica e regioni limitrofe (Lepidoptera). — Associazione Naturalistica Piemontese Memorie
3: 5-423. — Apollo Books: Stenstrup.
Baldizzone, G. 1995. Contribuzioni alla conoscenza dei Coleophoridae. LXXXIV. I Coleophoridae
raccolti in Marocco dalla spedizione dello Zoologisk Museum di Copenhagen (Lepidoptera:
Coleophoridae). — Shilap Revista de Lepidopterologia 23 (90): 107-121.
Baldizzone, G. 1997. Contribuzioni alla conoscenza dei Coleophoridae. LXX XVII. Coleophoridae nuovi
© poco conosciuti dell‘Africa settentrionale (Lepidoptera: Coleophoridae). — Shilap Revista de
Lepidopterologia 25 (100): 219-257.
Emmet, A. M., J. R. Langmaid, K. P. Bland, M. F. V. Corley & J. Razowski 1996. Coleophoridae.
126-338. — In: Emmet, A. M. (ed.), The Moths and Butterflies of Great Britain and Ireland 3:
Yponomeutidae — Elachistidae. — Harley Books: Colchester, 452 pp.
Gaedike, R. & W. Heinicke 1999. Verzeichnis der Schmetterlinge Deutschlands. — Entomofauna
Germanica 3. — Entomologische Nachrichten und Berichte, Dresden, Beiheft 5: 1-216.
Kaltenbach, T. & R.-U. Roesler 1985. Untersuchungen zur Zoogeographie der auf Sardinien vorkom-
menden Coleophoridae (Microlepidoptera) unter Berücksichtigung ökologischer Aspekte. — Neue
Entomologische Nachrichten, Keltern 16: 1-136.
34 Nuss & STUBNER: Coleophora variicornis stat. rev. in Central Europe
Nel, J. 1993. Une nouvelle espèce de coléophore bronzé métallique, Coleophora paramayrella n. sp.
(Lep. Coleophoridae). — Entomologica Gallica 4 (4): 213-217.
Patzak, H. 1974. Ergebnisse der Albanien-Expedition des “Deutschen Entomologischen Institutes”. 88.
Beitrag: Lepidoptera: Coleophoridae. — Beiträge zur Entomologie, Berlin 24 (5-8): 317-322.
Razowski, J. 1990. Motyle (Lepidoptera) Polski. XVI-Coleophoridae. — Monografie Fauny Polsky 18:
1-270, pl. 1.
Toll, S. 1952. Etude sur les genitalia de quelques Coleophoridae X. — Bulletin de la Société Entomo-
logique de Muhlhouse 1952 (no. 3, 4, 5, 6, 7-8, 9): 17-24, 27-30, 35-39, 43-47, 53-56, 61-65.
Toll, S. 1961. Ergebnisse der Mazedonienreise Friedrich Kasys, 1. Teil Lepidoptera: Coleophoridae. —
Sitzungsberichte der österreichischen Akademie der Wissenschaften, mathematisch-naturwissen-
schaftliche Klasse Abt. I, 170 (7): 279-304, pl. 1.
Vives-Moreno, A. 1988. Catalogo mundial sistematico y de ditribucion de la familia Coleophoridae
Hübner, [1825] (Insecta, Lepidoptera). — Boletin de Sanidad Vegetal 12: 1-196.
Zeller, P. C. 1849. Beitrag zur Kenntnis der Coleophoren. — Linnaea Entomologica 4: 191-416.
Nota lepid. 26 (1/2): 35-46 ss
Synanthedon pamphyla sp. n. from southern Turkey with a
comparative analysis of mitochondrial DNA of related species
(Sesiidae)
AXEL KALLIES
The Walter and Eliza Hall Institute of Medical Research, 1G Royal Parade, Melbourne/Parkville,
Victoria 3050, Australia. e-mail:
[email protected]
Abstract. Synanthedon culiciformis (Linnaeus, 1758) shows a circumpolar distribution and is recorded
from most parts of the northern Palaearctic region and from North America. Its known sister species,
Synanthedon talischensis (Bartel, 1906), however, is endemic to the Hyrcanian fauna and is found only
in Talish south of the Caspian Sea. Here, another species, Synanthedon pamphyla sp. n., closely allied to
S. culiciformis is described from southern Turkey. It is clearly separated from the known species by exter-
nal characters, morphology of genitalia and bionomics. Further, sequences of two mitochondrial DNA
regions of S. culiciformis and S. pamphyla sp. n. are analysed and compared to homologous sequences
of the ‘outgroup’ species Synanthedon spheciformis ([Denis & Schiffermiiller], 1775). This analysis sug-
gests an isolation of S. culiciformis and S. pamphyla sp. n. for at least 300 000 years and implies that the
latter species can be regarded as a Pleistocene relict.
Zusammenfassung. Synanthedon culiciformis (Linnaeus, 1758) ist eine circumpolar verbreitete Art, die
in der gesamten nördlichen Palaearktis und in Nordamerika vorkommt. Ihre einzige bisher bekannte
Schwesterart, Synanthedon talischensis (Bartel, 1906), ist dagegen ein Endemit der hyrcanischen Fauna
und ist nur aus Talish südlich des Kaspischen Meeres bekannt. In dieser Arbeit wird eine weitere eben-
falls eng mit S. culiciformis verwandte Art, Synanthedon pamphyla sp. n., beschrieben, deren bisher
bekannte Vorkommen auf die südliche Türkei beschränkt sind. Diese neue Art wird von den bekannten
Taxa habituell, genitalmorphologisch und bionomisch abgegrenzt. Außerdem werden zwei mitochon-
driale DNS-Regionen von S. culiciformis und S. pamphyla sp. n. analysiert und mit homologen
Sequenzen der “Außengruppen-Art” Synanthedon spheciformis ([Denis & Schiffermüller], 1775) ver-
glichen. Diese Analysen deuten auf eine Isolation von S. culiciformis und S. pamphyla sp. n. seit min-
destens 300 000 Jahren hin und lassen vermuten, daß es sich bei letzterer um ein Glazialrelikt handelt.
Key words. Lepidoptera, Sesiidae, new species, mitochondrial DNA, Turkey.
Introduction
In Asia Minor the family of clearwing moths (Sesiidae) is unusually rich in species.
More than 100 species have been reported from Turkey alone (de Freina 1994;
Spatenka et al. 1999; unpublished data). Like in the entire Mediterranean region or in
Central Asia, the majority of species in Turkey belong to the rhizophagous genera
Bembecia Hübner, [1819], Chamaesphecia Spuler, 1910, Dipchasphecia Capuse,
1973, and Pyropteron Newmann, 1832. Xylophagous genera, of which Synanthedon
Hiibner, [1819] is by far the most species-rich in the Palaearctic region, are poorly
represented. Considering this, the finding of a large, undescribed Synanthedon
species in Turkey is remarkable. Here, Synanthedon pamphyla sp. n., a species closely
related to Synanthedon culiciformis (Linnaeus, 1758) and Synanthedon talischensis
(Bartel, 1906), is described from the southern Toros Mts. From both related species
S. pamphyla differs clearly in external characters and also in details of genitalia and
bionomics. While S. culiciformis shows a wide circumpolar distribution with records
from all over the northern Palaearctic and North America, S. talischensis 1s restricted
to the Talish south of the Caspian Sea and is thought to be the sister species of S. culi-
ciformis (Spatenka et al. 1999). S. pamphyla can be regarded as a remarkable addition
to the S. culiciformis species group.
© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536
36 KALLIES: Morphology and mitochondrial DNA of Synanthedon pamphyla sp. n. from Turkey
Figs. 1-8. Synanthedon species, all specimens in CAK. 1. S. pamphyla, male, holotype, Turkey.
2. S. pamphyla, female, paratype, Turkey. 3. S. culiciformis, male, Germany. 4. S. culiciformis, female,
Germany. 5. S. culiciformis, male, Bulgaria. 6. S. culiciformis, male, Bulgaria. 7. S. stomoxiformis amasina,
male, Turkey. 8. S. stomoxiformis amasina, male, Greece.
Nota lepid. 26 (1/2): 35-46 37
Up to now, proposed phylogenetic relationships within the family Sesiidae are
solely based on morphological analyses. DNA sequence data that have been widely
applied in Lepidoptera systematics in the past decade (reviewed in Caterino et al.
2000) have not been used for phylogenetic inference in Sesiidae. Nuclear genes, such
as 18S rDNA, are one of the primary sources of molecular characters for relationships
among more divergent groups (Hillis & Dixon 1991; Wiegmann er al. 2000). Mito-
chondrial genes have proven most useful for relatively recent divergences, especially
of mid Tertiary and younger age and thus have been mainly used to reconstruct the
phylogenetic relations of species within closely related taxa groups (Lopez et al. 1997).
Except for a study on the pheromone binding protein (Willett 2000) published
sequence data of Sesiidae are not available. In this work, two different mitochondrial
DNA fragments were analysed to estimate the genetic divergence of the two closely
related species, S. pamphyla sp. n. and S. culiciformis. The results presented here may
stimulate further molecular research on the phylogeny of Sesiidae.
Material and Methods
DNA isolation, primers, PCR conditions. DNA was extracted from
the abdomen of dried specimens using a rapid and simple salt-based method as
described previously (Aljanabi & Martinez 1997). The ND1 fragment was amplified
using forward primer (S’ACATGATCTGAGTTCAAACCGG) and reverse primer
(5 GCTGGTTGATCTTCTAATTCTA) (Weller ef al. 1994). It contains 576 nucleo-
tides and comprises a part of the 16S ribosomal RNA gene, the tRNA-Leu gene and
a portion of the first exon of the NADH dehydrogenase subunit 1 gene. The CO fragment
consists of 586 nucleotides and contains the 3’ end of the cytochrome oxidase subunit
I gene, the leucine tRNA gene, and the 5’ end of the cytochrome oxidase subunit I]
gene. It was amplified using the primers $2792 (S’ATACCTCGACGTTATTCAGA)
and A3389 (5° TCATAAGTTCAATATCATTG) (Brown ef al. 1994). For each speci-
men PCR fragments were obtained by two independent PCR reactions, cloned into
pCR-XL-TOPO vector (Invitrogen) and sequenced by light cycler. PCR protocols
were adopted from Weller et al. (1994) and Brown et al. (1999) respectively.
Specimens used for DNA analysis. S. culiciformis: ©, Germany, Brandenburg, Neubrück
near Gr. Köris, 2000, leg. Kallies & Garrevoet (Gen. prep. AK327, DNA-AK3) (CAK); ©, Germania,
Thüringen, Fischbachtal, 1991, leg. Eue (Gen. prep. AK328, DNA-AK4) (CAK); 9, Russia, middle
Volga region, 40 km NEN Uljanovsk, Yumanovka, forest, 1997, leg. Tumanova (DNA-AK11) (CAK); S.
pamphyla: 3, Q (paratypes, Gen. Prep. AK322, DNA-AK8; Gen. Prep. AK320, DNA-AK1) (CAK); S.
spheciformis: &, Germany, Mecklenburg, Hüttelmoor near Rostock, 1996, leg. Ahrens (Gen. prep.
AK338, DNA-AK5) (CAK).
Material examined for morphological comparison. S. culiciformis: Norway: 9, Buskerud
Fylke, Store Rödungen, Aal Kommune, 950 m, 1993, leg. Ockruck (CJG); France: 9, Alpes, Tignes les
Brév., 45°30’N 6°56’E, leg. Schmidt (CHR); Germany: ©, Brandenburg, Oderberg, Pimpinellenberg,
1996, leg. Kallies (Gen. prep. AK321) (CAK); ©, Brandenburg, Neubrück bei Gr. Köris, 2000, e.l., leg.
Kallies & Garrevoet (Gen. prep. AK327) (CAK); ©, Thüringen, Fischbachtal, 1991, leg. Eue (Gen. prep.
AK328) (CAK); 9, Mecklenburg, Grambower Moor near Schwerin, 1992, e.l. leg. Kallies (Gen. prep.
AK323) (CAK); Austria: G Lacken, 1942, leg. Reichl (Gen. prep. AK326) (CAK); Switzerland: 9,
Graubiinden, Maloja pass, 1500m, 1991, leg. Riefenstahl (CHR); Russia: 9, middle Volga region, 40 km
NEN Uljanovsk, Yumanovka, forest, 1997, leg. Tumanova (CAK); 9, Saratov distr., Polivanovka, 1929,
lg. Richter (Gen. prep. AK355) (CAK); 9, Transbaikal, Noworotnaja, Schilka river, 2000 m (CAK);
38 KALLIES: Morphology and mitochondrial DNA of Synanthedon pamphyla sp. n. from Turkey
Bulgaria: 50, 29, Mitchurin, 1987 e.l., ex Alnus, leg. Lastuvka (CZL, CAK); USA: 9, Maryland,
Chestertown, 1999, leg. Mistera (CHR). S. stomoxiformis: Germany ©, 9, Werbach near
Tauberbischofsheim, ex Frangula, 1991, leg. Kallies (CAK). S. stomoxiformis amasina: Turkey:
O, Prov. Artvin, Kackar Dagi, Sarigöl-Yaylalar, 1500 m, 1995, leg. Kallies (CAK); Greece: 9
Pelepones, Kardamili, 1999, leg. Lastuvka (CAK).
Abbreviations. ETA — external transparent area; PTA — posterior transparent area; ATA — anterior trans-
parent area; CAK - collection A. Kallies; CHR — collection H. Riefenstahl, Hamburg, Germany; CJG —
collection J. Gelbrecht, Königs Wusterhausen, Germany; CZL — collection Z. Lastuvka, Brno, Czech
Republic.
2
Taxonomic part
Synanthedon pamphyla sp. n.
Material. Holotype © ‘Turkey S, Toros Mts, ca. 25 km NW Alanya, Güzelbag, ca. 500 m, larva
30.X.2001, ex Alnus orientalis, 9-25.111.2002 e.l., leg. A. Kallies, A. Musolff & Th. Drechsel’ (CAK, the
holotype will be deposited in the Museum für Naturkunde Berlin, Germany). Paratypes: 11, 109, same
dates as holotype (CAK) (of two males and one female genitalia examined, gen. prep. AK320, AK322,
AK325); ©, same locality data as holotype, 12.1V.2001 on leaf of Alnus orientalis, leg. Th. Drechsel
(CAK); ©, 49, Turkey S, Toros Mts, ca. 10 km E Alanya, Dimcay river valley, ca. 200 m, larva, early
IX.2001, ex Alnus orientalis, 9-25.111.2002 e.l., leg. A. Kallies, A. Musolff & Th. Drechsel (CAK); 39,
Turkey, between Odemis and Salihli, northern slope of Boz Dagi, 1000 m, 38°22’N 28°07’E, 19.V.1983,
leg. E. Hüttinger (CZL); 9, Turkey, Prov. Izmir, 3 km N Bozdag (Birgi-Salihli), 900 m, 38°22’N 27°58’E,
22.V.1981, leg. H. & R. Rausch, FE Ressl (CZL). |
Male (holotype, Fig. 1). Alar expanse 26.0—28.0 mm, body length 14.0-16.0 mm,
forewing length 11.5—12.5 mm, antenna 8.3—8.6 mm.
Head. black almost throughout; frons laterally bright white; pericephalic scales
laterally orange. Thorax: black; ventrally with a large orange-red spot; mesothorax
with white hairlike scales dorso-laterally. Legs: entirely black. Abdomen: black;
tergite 2 dorsally with a red orange band along posterior margin, laterally with orange-
red spots; segment 4 with a broad orange-red, ventrally open band; anal tuft com-
pletely black. Forewing: discal spot broad, with a narrow and short projection into the
ATA; PTA well-developed, reaching under discal spot; ETA round, relatively small,
maximally about 1.5x broader than discal spot; apical area broad and black, cell
between R4 and RS opaque; veins, costal and anal margins dorsally black, the latter
with a few individual red scales near base; ventrally cubitus, costal and anal margins
covered with orange scales; fringe black. Hindwing: with relatively broad discal spot
which reaches M3; ventrally basal portion of the costal margin orange.
Female (paratype, Fig. 2). Very similar to male but larger (alar expanse
27.0-30.5 mm, one female with 24.0 mm), ETA somewhat smaller; ATA with some
black scales in distal portion; outer margin of hindwing broader.
Genitalia (Figs 10, 12). Very similar to that of S. culiciformis (diagnosis below).
Diagnosis. This new species is closely related and similar to Synanthedon culi-
ciformis and S. talischensis. From both species, however, it can be easily separated by
external characters. S. pamphyla differs from S. culiciformis by the broader discal spot
and the smaller ETA of the forewing (ETA maximally 1.5x broad than discal spot; 3x
broader in S. culiciformis), by the broader apical area (along R3 about as broad as
ETA; 1/3 to 1/2x as broad in S. culiciformis), by the opaque cell between Cul and Cu2
(transparent in S. culiciformis), by the shape of the PTA (just reaching the discal spot;
reaching beyond in S. culiciformis), by the equally broad discal spot of the hindwing
Nota lepid. 26 (1/2): 35-46 39
Figs. 9-10. Male genitalia. a — uncus-tegumen, b — saccus, ¢ — right valva, d — aedeagus (scale bar
0.5 mm), e — basal part of the crista sacculi (scale bar 0.2 mm). 9. Synanthedon culiciformis, Germany
(gen. prep. AK327, CAK). 10. Synanthedon pamphyla sp. n., Turkey (gen. prep. AK325, CAK).
40 KALLIES: Morphology and mitochondrial DNA of Synanthedon pamphyla sp. n. from Turkey
(narrower and pointed towards M2 in S. culiciformis), by the almost complete absence
of red scales at the forewing base (present and very pronounced in S. culiciformis), by
the black labial palps (ventrally red in S. culiciformis), by the completely black legs
(tarsomers yellow in S. culiciformis), by the color of the abdomen (in S. culiciformis
tergite 2 only occasionally red, red ring of segment 4 ventrally closed), and by the
color of the ventral side of the forewing (orange-red scaling extending into the apical
area in S. culiciformis). Further, S. pamphyla is conspicuously larger than S. culici-
formis (alar expanses in males of S. culiciformis only 20-26 mm, in females 23—28 mm).
From S. talischensis the new species differs by completely black antennae (distally
white in S. talischensis), by the black labial palps (ventrally red in S. talischensis), and
by the broad discal spot of the hindwing (small in S. talischensis).
Consistent differences between S. pamphyla and S. culiciformis are also found in
the morphology of the genitalia (Figs. 9-12). In male S. pamphyla, the valva is broad
and arched, the distal end of the crista sacculi is relatively close to the ventral margin
of the valva (valva narrow and straight, crista sacculi stronger bent with distal end
more close to the setae field in S. culiciformis), the small ‘secondary’ crista connecting
the proximal portion of the crista sacculi with the surface of the valva (Figs. 9e, 10e)
is absent while it is present in S. culiciformis, the crista medialis of the gnathos is dis-
tally somewhat longer and more pronounced than in S. culiciformis, and the ventral
margin of the crista medialis is simple while it is cloven in S. culiciformis. In female
genitalia (Figs. 11, 12), S. pamphyla displays short apophyses anteriores which do not
reach the corpus busae (longer, reaching the corpus bursae in S. culiciformis) and the
deepening in which the ostium and the proximal part of the ductus bursae is situated
is covered with small well-sclerotized hooks (nearly absent in S. culiciformis).
Furthermore, the ostium bursae is narrower, not conspicuously funnel-shaped as it is
in S. culiciformis, and shows a small roundish distal plate ventrally which is absent in
S. culiciformis. Since there was no material of S. talischensis available for detailed
genitalia examination potential differences could not be investigated.
Besides the two species compared above, S. pamphyla is also similar to S. stomoxi-
formis (Hubner, 1790). Externally the latter can be separated by the black abdominal
segment 2, the partially red tegulae, the laterally orange edged anal tuft, the com-
pletely black frons, and the ventrally black thorax. Moreover, S. stomoxiformis dis-
plays a completely different morphology of the genitalia (cf. Spatenka et al. 1999).
Variability. Except for size, S. pamphyla is almost invariable in terms of external
appearance. In some regions (Bulgaria, southern Russia) specimens of S. culiciformis
with relatively small transparent areas and broad discal spots can be found. These
specimens frequently display a red ring on abdominal segment 2. However, additional
characters such as the red labial palps, yellowish tarsi and ventrally closed red
abdominal ring are consistent and distinguish these populations from S. pamphyla.
More importantly, characters of male and female genitalia used to differentiate
between S. culiciformis and S. pamphyla did not show any variation.
Distribution. To date S. pamphyla is known from the southern part of Turkey
(Provinces of Antalya and Izmir), however, this species can probably be found asso-
ciated with its hostplant along the Mediterranean coast of Turkey.
Nota lepid. 26 (1/2): 35-46 4]
Figs. 11-12. Female genitalia, ventral view (scale bar 0.5 mm), a — ostium and proximal part of ductus
bursae (scale bar 0.2 mm). 11. Synanthedon culiciformis, Germany (gen. prep. AK323, CAK). 12.
Synanthedon pamphyla sp. n., Turkey (gen. prep. AK320, CAK).
Records of S. culiciformis from Turkey (Spatenka er al. 1999) may at least in part
relate to specimens of S. pamphyla of which one was figured previously (Lastuvka &
Lastuvka 1995: pl. 3 fig. 10, misidentified as S. culiciformis). The presence of S. culi-
ciformis in Turkey needs verification. While this species may occur in the northern
part of Turkey it is very unlikely to be found in the southern provinces. Specimens of
S. culiciformis (Figs 6-7) from Micurin, Bulgaria, are the records which are geo-
graphically closest to the known range of S. pamphyla.
Bionomics. The hostplant of the new species is Alnus orientalis Decne
(Betulaceae). This tree grows along rivers and streams on the southern slopes of the
Toros Mts often accompanied by Nerium (Apocynaceae), Platanus (Platanaceae) or
Vitis (Vitaceae). Typically S. pamphyla inhabits the main shoot of young trees from
1 to 6 cm diameter where it can be found from close to the root up to 4 m high in the
tree. Infested trees usually can be recognised easily by a conspicuous swelling which
is often accompanied by a patch of dead and dry bark. In autumn the full grown larva
is found in a tunnel which leads from the swelling 8 to 15 cm upwards within the
42 KALLIES: Morphology and mitochondrial DNA of Synanthedon pamphyla sp. n. from Turkey
wood of the stem. Pupation takes place in early spring head-down in a cocon made
from narrow wooden chips which is tightly attached to the tunnel’s inner surface. The
emerging hole is closed by fibrous wood chips which are pressed out of the hole by
the larva. Occasionally, larvae can be found associated with injuries of the stem.
Several larvae were found in the remnants of an older Alnus tree which was cut down
a year before.
The known localities of S. pamphyla are within the Eumediterranean to
Mesomediterranean climate zone on the slopes of the Toros mountain range mostly
between 200 and 500 m. The average temperature in January is 5-9 °C and in summer
between 25 and 27 °C. Temperatures below zero are rare in this zone. Under labora-
tory conditions branches which contained larvae, were stored from early December to
early March in a humid environment at about 5 to 15 °C. After placing the branches
at room temperature adults emerged within 3 to 19 days. From this it is assumed that
under natural conditions adults can also be found in early spring probably from March
to April. So far, however, only one adult specimen, a somewhat worn female, was
observed at the type locality by Mr. Thomas Drechsel on the 12th of April. Some addi-
tional specimens which are also part of the type series have been collected at an alti-
tude of 900-1000 m on the slopes of the Boz Mts near Izmir. These specimens, all
females, were collected at the end of May. |
Derivatio nominis. The species name derives from the ancient kingdom of
Pamphylia which was situated east of Antalya about 3000 years ago.
Genetic analysis
Analysis of sequence divergence. To estimate the genetic distance
between S. culiciformis and S. pamphyla and to initiate molecular characterisation of
Sesiidae in systematics, the sequence of two mitochondrial DNA fragments, ND1 and
CO, was analysed. As a prelude to interspecific analysis, the intraspecific variation
within the ND1 and CO fragments was determined. While specimens of individual
populations (as determined for the ND1 fragment in S. culiciformis from Brandenburg
and S. pamphyla from the type locality) in general did not show sequence variation, a
series of Thymidines (positions 31 to 39 of the fragment) within the 5’ end of ND1
fragment was found to be of variable length even among specimens of the same po-
pulation. Since this region could not be reliable aligned it was omitted from analysis as
was suggested by Brower (1994). Under these conditions, in the ND1 fragment seven
positions (1.23%) and in the CO fragment five positions (0.85%) were consistently dif-
ferent between specimens of S. culiciformis from central Europe and specimens of S.
pamphyla from the type locality in southern Anatolia. Of these changes only one, with-
in the ND1 fragment, was modified by transversion, all other changes were transitions.
The comparison of the sequences generated from a specimen of S. culiciformis from
the Volga region of southern Russia and specimens of S. pamphyla indicated a higher
degree of similarity. In this approach only 0.7% sequence divergence (four positions)
for the ND1 fragment or 0.85% (five positions) for the CO fragment were found
between the two taxa. However, while among specimens of S. culiciformis from
Brandenburg and Thuringia only one position was found to be targeted by substitution,
the mean divergence between these specimens and the specimen from southern
Nota lepid. 26 (1/2): 35-46 43
Tab 1. Uncorrected pairwise distances (below diagonal) and transition / transversion ratio (above diago-
nal). GB — Germany, Brandenburg; GT — Germany, Thuringia; RV — Russia, Volga region
5 S. pamphyla 0.0900 | 0.0104 | 0.0104 | 0.0078
Russia was as high as 0.97% indicating a genetic distance almost as high as the dis-
tance between central European S. culiciformis and S. pamphyla. In fact, a phyloge-
netic tree based on the mitochondrial sequence data generated in this study would
group the specimen from the Volga region and S. pamphyla as sister taxa (not shown).
As an ‘outgroup’ species Synanthedon spheciformis ([Denis & Schiffermüller],
1775) was used in this study. The ND1 fragment of this species shows a divergence
of about 9% to both S. pamphyla and S. culiciformis with several indels (gaps and
insertions) in the 5’ noncoding part of the fragment. Table 1 shows the uncorrected
pairwise distances for all haplotypes as calculated from the ND1 and CO fragment
(since for S. spheciformis a CO fragment could not be generated, distances and ratios
for this species relate only to the ND1 fragment) and the ratio of transitions versus
transversions. All sequences are available at DDBJ/EMBL/GenBank, Accession Nos
AY304162-70.
Applying a ‘molecular clock’. Brower (1994) has proposed a molecular
clock for arthropod mitochondrial DNA and assumed a constant pairwise mutation
rate of about 2.3% per million years. Applying this molecular clock the corresponding
age of the separation of S. culiciformis and S. pamphyla is estimated to be 300 000 to
500 000 years. The divergences found in comparison of S. spheciformis to the species
of the S. culiciformis group suggests a separation nearly 5 million years ago.
Discussion
The tribe Synanthedonini comprises an extensive group of clearwing moths which
is found in all zoogeographic regions. There are several genera recognized in the tribe
of which the genus Synanthedon (sensu auctorum) which includes mainly
xylophagous species, is by far the most species rich. However, in the Palearctic region
rhizophagous genera, 1.e. Dipchasphecia, Bembecia, Pyropteron, and Chamaesphecia,
account for the bulk of Synanthedonini species. Most of the members of these genera
can be placed into species groups partly containing large numbers of closely related
species which are often found only in small ranges suggesting relatively recent radia-
tions within the Palearctic region. While the rhizophagous genera are mainly well
defined monophyletic groups, the genus Synanthedon in the present concept is likely
to be paraphyletic (Lastuvka 1992a, b; unpublished data).
In most cases, Palearctic Synanthedon species can be differentiated clearly by
external and genitalic characters and often appear only distantly related, a view which
is supported by the finding of this study (i.e. the large genetic distance of S. spheci-
formis and the species of the S. culiciformis group). There are only few and usually
44 KALLIES: Morphology and mitochondrial DNA of Synanthedon pamphyla sp. n. from Turkey
small species groups such as the S. formicaeformis (Esper, 1783), S. tipuliformis
(Clerck, 1759), and S. vespiformis (Linnaeus, 1761) groups in the Palearctic region
and the formation of local endemits, such as S. geranii Kallies, 1997 from Greece, is
rather unusual, suggesting that recent species radiation in Palearctic Synanthedon is
not as common as in rhizophagous Synanthedonini.
The Holarctic Synanthedon culiciformis, the south Anatolian S. pamphyla and the
Hyrcanian (south-west Caspian) S. falischensis are closely related but strictly
allopatric species which share broad morphological, bionomical, and genetic simila-
rities (as shown for two species). While Synanthedon culiciformis shows a circumpolar
distribution with records from all over the northern Palearctic and North America,
S. talischensis and S. pamphyla are restricted to the Talish south of the Caspian Sea
and to the southern Toros Mts of Anatolia, respectively. To answer the question of how
long populations of these three species have been separated and the gene flow
between has been disrupted, it is appropriate to consider the history of climate
changes in Asia Minor. Like in the entire northern hemisphere, the climate of Anatolia
has been strongly influenced by the glacial ages. Periods of milder to warm climates
alternated with periods of colder climates which triggered the spreading of arctic and
boreal flora and fauna towards the south. During the past 1.7 million years at least
17 glacial-interglacial oscillations occurred in the Mediterranean region (Bertolani-
Marchetti 1985). Glacial periods, such as the Wurm glacial, caused the progression of
the subarctic region deep into southern Europe and Asia Minor. During these times
the average temperature in present Anatolia was about 8 to 10 °C lower than today and
a maximal extension of the distribution of arctic and boreal species such as
Synanthedon culiciformis can be supposed. At the same time, however, Eumediterra-
nean vegetation was well-established in the lower parts of the southern Toros Mts
(Wagener 1995). It can be assumed that in line with the glacial oscillations a geo-
graphic separation and lasting isolation of at least two different populations of the
Synanthedon culiciformis group took place. Genetic analysis indicates that speciation
occurred 300 000 to 500 000 years ago suggesting an isolation during early glaciation
events. Later, regression of the arcto-boreal vegetation led to a geographic isolation
and an interruption of a potential gene flow between the isolated ancestor populations
of Synanthedon pamphyla and Synanthedon talischensis on one side and Synanthedon
culiciformis on the other side.
Refugia, such as the Hyrcanian and the Tauro-Mediterranean regions, were essen-
tial for the survival of flora and fauna during the glacial periods of Pleistocene. These
regions contain many endemic species (Wagener 1995) and Synanthedon pamphyla
may represent another example of endemism in the southern Toros Mts. :
Although there is a general trend for reproductive isolation to increase with genet-
ic divergence this relationship is hardly predictive for identifying new species. A broad
variation in genetic distance between sibling species has been found in different
studies ranging from undetectable to more than 13% (reviewed in Ferguson 2002).
Several studies indicate that the mitochondrial DNA evolves at a similar rate in a wide
range of organisms (Brower 1994; Avise et al. 1998) but the duration of speciation
varies widely from several thousand years, as shown for fishes, and several million
years, in mammals and other vertebrates (reviewed in Avise ef al. 1998).
Analysis of mitochondrial sequences carried out in this study revealed a degree
of divergence between Synanthedon pamphyla and Synanthedon culiciformis of
Nota lepid. 26 (1/2): 35-46 45
0.78-1.04% consistent with rates of between 0.19% and 5% found for haplotypes
within species groups or for sibling species in other studies on Lepidoptera (Caterino
& Sperling 1998; Brown er al. 1999; Blum et al. 2003). This result and the high ratio
of transitions to transversions support a very close relationship of both species, in
agreement with the hypothesis of a speciation during the Pleistocene. Further, in this
study surprisingly clear sequence differences between populations of S$. culiciformis
from the ‘western’ (central European) and the ‘south-eastern’ part (southern Russia)
of the range were found. In fact, the distance between the Russian S. culiciformis com-
pared to central European culiciformis was higher than the distance between Russian
S. culiciformis and S. pamphyla (Tab. 1). This result as well as external characters of
S. culiciformis from southern Russia and Bulgaria (such as the broad discal spot and
the small transparent areas of the forewing) which distinguish these populations from
central European S. culiciformis suggest that the south-eastern clade of S. culiciformis
is well separated from the main part of the species range and may represent the sister
taxon of S. pamphyla leaving S. culiciformis in the present concept paraphyletic. More
material of S. culiciformis from various parts of its range especially from Bulgaria and
southern Russia as well as material of S. talischensis and its detailed examination both
on morphological and molecular level is necessary to decide whether a further taxo-
nomic differentiation of the S. culiciformis group 1s appropriate.
The higher degree of sequence similarity between the south Russian S. culiciformis
and S. pamphyla suggests that S. pamphyla has evolved from an isolated population
of the ‘south-eastern clade’ of S. culiciformis. Interestingly, the specimens from
Bulgaria just like S. pamphyla and S. talischensis were bred from Alnus, which is
utilized by S. culiciformis only occasionally as a host plant. It could be speculated that
speciation in the S. culiciformis group was promoted not only by geographic isolation
but also by host plant switch.
As demonstrated by Ferguson (2002) genetic distance itself is not sufficient for
species identification since several additional factors, e.g. degree of sympatry and
geographical range, have a strong effect on the genetic distance measured.
Accordingly, in this work, genetic distance was not used to separate S. pamphyla from
S. culiciformis, rather mitochondrial sequence analysis was applied to reconstruct
speciation in a temporal and geographical frame.
As an ‘outgroup’ species S. spheciformis was used in this study. This species is
well separated from the species of the S. culiciformis group. Mitochondrial DNA
divergences found in comparison of S. spheciformis to the species of the S. culici-
formis group suggest a much earlier separation, nearly 5 million years ago. This is
in line with morphologica! data indicating a more distant relationship between
S. spheciformis and the S. culiciformis species group.
Acknowledgements. First of all I want to express my hearty thanks to my good friend Thomas Drechsel,
(Neubrandenburg, Germany) with whom I shared many interesting and successful collecting trips.
He was the one who collected the first specimen of S. pamphyla at the type locality and donated it to me.
Further, I wish to thank Sven-Ingo Erlacher (Jena, Germany) for helpful comments on DNA analysis in
insect phylogeny, Dr Zdenek Lastuvka (Brno, Czech Republic), Dr Jorg Gelbrecht (Königs Wuster-
hausen, Germany) and Hans Riefenstahl (Hamburg, Germany) for the possibility to study material under
their care, and to Dr Vadim Zolotuhin (Uljanovsk, Russia) for donating specimens for comparison.
Finally, I want to express my heartiest thanks to my wife Anne for joining me on several expeditions and
helping me collecting the larvae of the species described here, and to Dr Douglas Hilton (Melbourne,
Australia) for correcting the English version of this article.
46 KALLIES: Morphology and mitochondrial DNA of Synanthedon pamphyla sp. n. from Turkey
References
Aljanabi, S. M. & L. Martinez 1997. Universal and rapid salt extraction of high quality genomic DNA
for PCR-based techniques. — Nucleic Acid Research 25: 4692-4693.
Avise, J. C., D. Walker & G. C. Johns 1998. Speciation durations and Pleistocene effects on vertebrate
phylogeography. — Proceedings of the Royal Society of London (B) 265: 1707-1712.
Bertolani-Marchetti, D. 1985. Pollen paleoclimatology in the Mediterranean since Messinian time.
Pp. 525-543. — In: D. J. Stanley, D. J. & F.-C. Wezel (eds), Geological evolution of the Mediterranean
Basin. Springer Verlag, New York-Berlin-Heidelberg-Tokyo.
Blum, M. J., E. Bermingham & K. Dasmahapatra 2003. A molecular phylogeny of the neotropical but-
terfly genus Anartia (Lepidoptera: Nymphalidae). — Molecular Phylogenetics and Evolution 26:
46-55.
Brown, J. M., O. Pellmyr, J. N. Thompson & R. G. Harrison 1994. Phylogeny of Greya (Lepidoptera:
Prodoxidae), based on nucleotide sequence varaition in mitochondrial cytochrome oxidase I and II:
Congruence with morphological data. — Molecular Biology and Evolution 11: 128-141.
Brown, B., R. M. Emberson & A. M. Paterson 1999. Phylogeny of “Oxycanus” lineages of Hepialid
moths from New Zealand inferred from sequence variation in the mtDNA COI and II gene regions.
— Molecular Phylogenetics and Evolution 13: 463-473.
Brower, A. V. Z. 1994. Rapid morphological radiation and convergence among races of the butterfly
Heliconius erato inferred from patterns of mitochondrial DNA evolution. — Proceedings of the
National Academy of Sciences of the United States of America 91: 6491-6495.
Caterino, M. S., S. Cho & F. A. H. Sperling 2000. The current state of insect molecular systematics: a
thriving tower of Babel. — Annual Review of Entomology 45: 1—54.
Caterino, M. S. & F A. H. Sperling 2002. Papilio phylogeny based on mitochondrial cytochrome oxidase
I and II genes. — Molecular Phylogenetics and Evolution 11: 122-137.
de Freina, J. J. 1994. Contribution a la connaissance de la faune des Sesiidae de l’Asie Mineure
(Lepidoptera: Sesiidae). — Linneana Belgica 14: 455-480, 25 figs, 56 maps.
Ferguson, J. W. H. 2002. On the use of genetic divergence for identifying species. — Biological Journal
of the Linnean Society 75: 509-516.
Hillis, D. M. & M. T. Dixon 1991. Ribosomal DNA. Molecular evolution and phylogenetic inference. —
Quarterly Review of Biology 66: 411-453.
Lastuvka, Z. 1992a. Zur Systematik der paläarktischen Gattungen der Tribus Synanthedonini. 1. Mor-
phologie und Klassifikation (Lepidoptera, Sesiidae). — Acta Universitatis Agricultrae, Brno (A) 38
(1990): 221-233.
Lastuvka, Z. 1992b. Zur Systematik der paläarktischen Gattungen der Tribus Synanthedonini. 2. Phylo-
genese (Lepidoptera, Sesiidae). — Acta Universitatis Agricultrae, Brno (A) 38 (1990): 235-242.
Lastuvka, Z. & A. Lastuvka 1995. An illustrated key to European Sesiidae (Lepidoptera). — Mendel
University of Agriculture and Forestry, Brno. 174 pp.
Lopez, J. V., M. Culver, J. C. Stephens, W. E. Johnson & S. J. O’Brien 1997. Rates of nuclear and cyto-
plasmic mitochondrial DNA sequence divergence in mammals. — Molecular Biology and Evolution
14: 277-286.
Spatenka, K., O. Gorbunov, Z. Lastuvka, I. Tosevski & Y. Arita 1999. Sesiidae — clearwing moths. — In:
C. Naumann (ed.), Handbook of Palaearctic Macrolepidoptera. Vol. 1. — Gem Publ. Co., Wallingford,
England. 569 pp.
Wagener, S. 1995. Klima- und Vegetationsgeschichte des Vorderen Orients. — Jn: G. Hesselbarth, H. van
Oorschot & S. Wagener, Die Tagfalter der Türkei. — Selbstverlag Sigbert Wagener, Bocholt. 1354 pp,
141 pls, 342 + 4 maps.
Weller, S. J., D. P. Pashley, J. A. Martin & J. L. Constable 1994. Phylogeny of noctuid moths and the util-
ity of combining independent nuclear and mitochondrial genes. — Systematic Biology 43: 194-211.
Wiegmann, B. M., C. Mitter, J. C. Regier, T. P. Friedlander, D. M. Wagner & E. S. Nielsen 2000. Nuclear
genes resolve Mesozoic-aged divergences in the insect order Lepidoptera. — Molecular Phylogenetics
and Evolution 15: 242-259.
Willet, C. S. 2000. Do pheromone binding proteins converge in amino acid sequence when pheromones
converge? — Journal of Molecular Evolution 50: 175-183.
Nota lepid. 26 (1/2): 47-57 47
Study on the genus Clepsis Guenée, 1845 from China
(Tortricidae)
XINPU WANG, HoUHUN Li! & SHUXIA WANG
Department of Biology, Nankai University, Tianjin 300071, P. R. China.
' Corresponding author, e-mail:
[email protected]
Abstract. The present paper reports fifteen species of the genus Clepsis Guenée, 1845 from China.
Among them, two species, C. laetornata sp. n. and C. flavifasciaria sp. n., are described as new to sci-
ence with genital structures illustrated. Three species, C. celsana (Rennel), C. neglectana (Herrich-
Schäffer) and C. luctuosana (Rebel), are newly recorded from the country. The female of C. aba
Razowski is described for the first time to science. Key to all the known Chinese species is given based
on external characters and male genital characters respectively.
Key words. Lepidoptera, Tortricidae, Clepsis, new species, China.
Introduction
Clepsis Guenée, 1845 is a large genus of the subfamily Tortricinae, tribe Archipini. To
date about 112 species have been reported worldwide, including sixty-four species
from the Palaearctic Region, ten species from the Nearctic Region, ten from the Oriental
Region, thirty-six from the Neotropical Region and one from the Afrotropical Region.
In Asia, four species are recorded from Korea (Byun 1998), six from Japan (Kawabe
1982), two from Nepal (Diakonoff 1976), one from northern Sumatra (Diakonoff
1983), four from Taiwan (Kawabe, 1992b) and two from the northern part of China
(Liu 1977). In China a total of ten species of the genus Clepsis have been recorded so
far (Razowski 1979a, 1979b; Kawabe 1992b). In this paper two new species, Clepsis
laetornata sp. n. and Clepsis flavifasciaria sp. n., are added to the world fauna, three
species are newly recorded from China and the female of Clepsis aba Razowski, 1979
is described for the first time. Distributions of Chinese species of Clepsis are shown
in Fig. 1. The type specimens are deposited in the Department of Biology, Nankai
University, Tianjin, China. The research was supported by National Natural Science
Foundation of China (No. 39960017).
Clepsis Guenée, 1845
Clepsis Guenée, 1845: 168. Type species: Tortrix rusticana Hübner, [1799].
Smicrotes Clemens, 1860: 355. Type species: Smicrotes peritana Clemens, 1860.
Siclobola Diakonoff, 1947: 25. Type species: Tortrix unifasciana Duponchel, 1843.
Pseudamelia Obraztsov, 1954: 196. Type species: Tortrix unicolorana Obraztsov, 1954.
Mochlopyga Diakonoff, 1955: 44. Type species: Tortrix humana Meyrick, 1912.
This genus is well identified by the following characters: transtilla absent, labis with
strong sclerotized disc and its upper edge armed with thorns, valva elongate with
more or less distinctly differentiated terminal part, sacculus without free termination
in male genitalia.
© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536
48 WANG, Li & WANG: Study on the genus Clepsis Guenée from China
The genus Clepsis was divided into seven species-groups by Razowski (1979a).
According to his system, C. /aetornata sp. n. should belong to the group of C. rurinana
and C. flavifasciaria sp. n. to the group of C. unicolorana.
Fig. 1. Distributional map of Clepsis species in China. Legend: [] C. laetornata sp. n.; @ C. flavifasciaria
sp. n.; @ C. aba Razowski; x C. celsana (Rennel); x C. neglectana (Herrich-Schäeffer); O C. luctuosana
(Rebel); À C. rurinana (Linnaeus); A C. pallidana (Fabricius); © C. melissa (Meyrick); M C. aerosana
(Lederer); x C. zeuglodon Razowski; * C. razowskii Kawabe; © C. owadai Kawabe; # C. hohaunsha-
nensis Kawabe; C. provocata (Meyrick)
Key to the Chinese species of Clepsis based on external characters
1. Forewing with many yellowish brown streaks. C. razowskii
— Forewing without yellowish brown streaks. 2
2. Male forewing with costal fold. 3
— Male forewing without costal fold. 12
3. Hindwing yellow, termen black; costal edge of underside of forewing
with brightly yellowish fascia. C. flavifasciaria sp. n.
— Hindwing pale gray or whitish. 4
4. Forewing with ground color yellow, two parallel fasciae present. C. pallidana
— Forewing with ground color brownish or pale gray. 5
5. Forewing with costal fold very slender and short. C. celsana
— Forewing with costal fold moderately broad. 6
6. Basal blotch large or distinct. 7
— Basal blotch small or absent. 8
7. Front white; basal blotch, median fascia and subapical blotch very distinct, brown.
C. laetornata sp. n.
— Front yellowish ochreous; median fascia strongly broadened medially, rust brown. C. aba
Nota lepid. 26 (1/2): 47-57 49
8. Forewing with ground color brownish yellow. 9
— Forewing with ground color pale gray or creamy. 10
9. Median fascia broken, not reaching posterior margin. C. owadai
— Median fascia reaching posterior margin, with one line parallel to median fascia.
C. rurinana
10. Forewing distinctly expanded terminally, median fascia narrow. C. melissa
— Forewing indistinctly expanded terminally. jo
11. Labial palpus whitish; head gray; subapical blotch large and distinct. C. provocata
— Labial palpus ochreous with brown scales; head brownish; subapical blotch indistinct.
C. zeuglodon
12. Forewing with ground color pale. 13
— Forewing with ground color dark. 14
13. Forewing whitish, with spots among the pattern. C. luctuosana
— Forewing slivery gray, without spots among the pattern. C. hohuanshanensis
14. Forewing yellowish creamy, subapical blotch reaching apex. C. aerosana
— Forewing brownish, subapical blotch small or not obvious, median
fascia strongly broadened medially. C. neglectana
Key to the Chinese species of Clepsis based on the male genital characters
1. Aedeagus smooth, without process or denticle. 2
— Aedeagus with process or denticle. 6
2. Uncus strong and thick. 3
— Uncus slender, gradually tapering terminally; sacculus with ventral margin smooth.
C. provocata
3. Valva short, ovate; labis with two broad dentate lobes at both sides. C. owadai
— Valva not ovate. 4
4. Uncus straight apically, valva short, without lobated terminal part. C. luctuosana
— Uncus rounded apically, valva elongate, with lobated terminal part. 5
5. Uncus parallel laterally, rounded apically; aedeagus short and narrow. C. razowskii
— Uncus distinctly broadened at middle, tapering terminally, aedeagus long and slender.
C. laetornata sp. n.
6. Aedeagus with dense ventral and dorso-lateral denticles,
provided with long subterminal process on the left side;
uncus broad and rounded apically. C. flavifasciaria sp. n.
— Aedeagus without dense ventral denticles.
7. Aedeagus with small dent. 8
— Aedeagus with large process. 11
8. Valva elongate, with lobated terminal part. 9
— Valva somewhat ovate, without lobated terminal part. 10
9. Uncus broad, tapering from before middle. C. rurinana
— Uncus broad at base, slender in distal half; sacculus with dentate ventral prominence.
C. melissa
10. Uncus long; aedeagus provided with one lateral and one ventral thorn. C. zeuglodon
— Uncus broad, aedeagus provided with some subterminal teeth laterally. C. hohuanshanensis
11. Aedeagus with long process on the right side. C. aba
— Aedeagus with process on the left side. 12
12. Valva narrow, sacculus with distinct ventral prominence or denticle. 13
— Valva broad, sacculus without ventral denticle. 14
13. Uncus expanded from base to distal; ventral edge of sacculus with
sharp prominence situated submedially. C. neglectana
— Uncus tapering postmedially, ventral edge of sacculus with 3-4 acute
denticles; aedeagus thick, with two processes, left one larger than right one. C. celsana
14. Uncus straight apically; aedeagus with long ventro-lateral process situated
on the left side. C. aerosana
— Uncus rounded apically; aedeagus with subterminal denticle situated on the left side.
C. pallidana
50 WANG, Li & WANG: Study on the genus Clepsis Guenée from China
Figs. 2-3. Adults of Clepsis spp.: 2. Clepsis laetornata sp. n. 3. Clepsis flavifasciaria sp. n.
Clepsis laetornata sp. n. (Figs. 2, 4)
Material. Holotype: © China: Weishan County (25.2 °N 100.3 °E), Yunnan Province, 2200 m, 20 Jul.
2001, leg. Houhun Li and Xinpu Wang, genitalia slide no. WXP02182. Paratypes: 40’, same data as
holotype.
Description. Male (Fig. 2). Length of forewing 7.0—8.0 mm. Labial palpus 1.5 times
shorter than diameter of compound eye; basal portion pale brownish, terminal portion
of the second and the third segments whitish, third segment small, concealed in the ter-
minal of second. Antenna slender, outer side whitish, inner side yellowish brown.
Front white. Vertex with rough scales, yellowish brown. Thorax yellowish brown.
Tegula developed. Forewing with ground color pale brown; basal blotch, median fas-
cia and subapical blotch dark brown; basal portion of costal edge yellow-brown;
costal fold broad, reaching median fascia; apex blunt; termen oblique; basal blotch
finger-shaped; anterior portion of median fascia narrow, posterior portion broad; sub-
apical blotch converse triangular; fringes with basal part pale white, distal part dark
brown. Hindwing pale gray, termen somewhat yellow. Legs whitish, outer side of tarsi
of foreleg, midleg and outer spur of midleg dark brown. Dorsal surface of abdomen
pale brown, ventral surface pale yellow.
Genitalia © (Fig. 4). Tegumen broad. Uncus strong, distinctly broadened at
middle, tapering terminally, rounded apically. Socius small. Lateral sclerite broad-
ened. Arm of gnathos strong, rounded apically. Valva oblong, terminal portion with
lobe. Sacculus narrow, slightly convex near base. Median part of labis broad and
spined, terminal portion slender. Aedeagus thin, apically rounded, with three large
cornuti in vesica.
Female. Unknown.
Diagnosis. The new species is similar to Clepsis melissa (Meyrick, 1908), but differs
from the latter in the following characters: forewing with ground color light brown;
uncus distinctly broadened at middle; sacculus without ventral prominence; aedeagus
without ventro-lateral denticle.This species is also closely allied to Clepsis rurinana
(Linnaeus), but can be distinguished from it by basal blotch on the surface of the
forewing very large and distinct; uncus shorter and much stronger than that of the lat-
ter species; aedeagus much slender, laterally without subterminal denticle.
Nota lepid. 26 (1/2): 47-57 Si
Fig. 4. Male genitalia of Clepsis laetornata sp. n. (slide no. WXP02182)
Derivatio nominis. The specific name comes from the Latin word, /aetus (distinct)
and ornatus (ornate), corresponding to the distinct basal blotch, median fascia and
subapical blotch in the forewing.
Clepsis flavifasciaria sp. n. (Figs. 3, 5, 6)
Material. Holotype: ©, China, Ningshan County (33.3 °N 108.3 °E), Shaanxi Province, 1650 m, 28 May
1992, leg. Houhun Li, (slide no. WXP02186). Paratypes: 10, 19, same data as holotype.
Description. Male (Fig. 3). Length of forewing 9.5 mm. Labial palpus 1.5 times as
long as diameter of the compound eye; basal segment whitish; second segment long,
pale brown; third segment small, whitish. Antenna thick, black, outer side with white
scales, inner side ciliated. Front whitish. Vertex with rough scales, yellowish brown.
Tegula developed. Forewing blackish brown, costal margin distinctly curved outwards
to middle; brightly yellowish fascia below costal edge reaching subapical blotch;
costal fold reaching 1/3 of costa, basally narrow, medially broad; apex pointed; ter-
men distinctly oblique; basal blotch ill-defined; median fascia black, band-like, its
anterior portion as wide as posterior portion; subapical blotch semicircular, black;
fringes yellowish brown. Hindwing yellow, termen black; fringes pale brown. Tarsi of
foreleg and midleg pale brown. Dorsal surface of abdomen pale brownish, ventral sur-
face pale yellow.
52 WANG, LI & WANG: Study on the genus Clepsis Guenée from China
Female. Length of forewing 10.5 mm, with yellow fascia below costal edge.
Other characters same as male.
Genitalia © (Fig. 5). Tegumen broad; uncus strong, with basal half narrow,
somewhat parallel laterally, distal half expanded, rounded apically. Socius vestigial.
Arm of gnathos long and slender, terminal narrow. Valva narrow, weakly tapering ter-
minally. Sacculus narrow, slightly convex before middle of ventral edge. Median part
of labis broad, terminal part weakly tapering, dentate. Aedeagus large, densely with
ventral and dorso-lateral denticles, provided with long subterminal process on the left
side; no cornuti in vesica.
Genitalia 9 (Fig. 6). Apophyses posterior almost as long as apophyses anteri-
or, with a dent near base, highly sclerotized. Sterigma cup-shaped. Antrum long, scle-
rotized. Ductus bursae thick, without cestum. Signum large, horn-shaped, inner side
with small denticles.
Fig. 5. Clepsis flavifasciaria sp. n., male genitalia (slide no. WXP02186).
Diagnosis. This new species is closely allied to Clepsis unicolorana (Duponchel,
1835) in male genitalia, but can be separated from the latter by the following character:
in male genitalia, sacculus narrow; aedeagus densely with ventral and dorso-lateral
denticles, provided with long subterminal process on the left side. In female geni-
talia, signum horn-shaped.
Nota lepid. 26 (1/2): 47-57 53
Derivatio nominis. The specific name is derived from the Latin word, flavus (yel-
low) and fasciarius (fascia), indicating the brightly yellowish fascia below costal edge
in the forewing.
Figs. 6-7. Female genitalia. 6. Clepsis flavifasciaria sp. n. (slide no. WXP02187). 7. Clepsis aba (slide
no. WXP02165).
Clepsis aba Razowski, 1979a: 147, figs. 129, 130 (Fig. 7)
Material. China: 50°, 39, Ningshan County, Shaanxi Province, 1650 m, 15-20 June 1987, leg. Houhun
Li, (slide no.WXP02165).
54 WANG, LI & WANG: Study on the genus Clepsis Guenée from China
Description. Length of forewing 11.0-12.0 mm.
Genitalia © (Fig. 7). Papilla analis broad; apophyses posterior about 1.5 times
as long as apophyses anterior, heavily sclerotized. Sterigma broad. Antrum long,
cylindrical, thick near ductus bursae. Ductus bursae thick. Cestum 1/3 as long as duc-
tus bursae. Signum horn-shaped, small.
Remarks. Razowski (1979) did not provide the description of the female in his paper.
During our study, we found the female and described it here for the first time.
Clepsis celsana (Kennel, 1919: 52, pl. 2 figs. 2, 3) (Cacoecia)
Material. China: 30°, Gongliu County, Xinjiang Aut. Reg., 1100 m, 6 June 1994, leg. Xincheng An.
Remarks. The species is treated by Razowski (1979: 146, figs. 125-128, 213) and
transferred to Clepsis. It is here recorded for the first time from China (Xinjiang).
Clepsis neglectana (Herrich-Schäffer, 1851: 167) (Tortrix Lozotaenia)
Tortrix flavana Duponchel, 1834: 87, pl. 239, fig. 6.
Heterognomon betulifoliana Lederer, 1859: 248.
Tortrix stiolana Ragonot, 1879: CXXXII.
Tortrix xylotoma Meyrick, 1891: 13.
Tortrix severana Kennel, 1901: 227.
Cacoecia delibatana Rothschild, 1912: 27, 49.
Tortrix dorana Kennel, 1919: 60, pl. 2, fig. 12, pl. 4, fig. 1b.
Cacoecia acclivana Zerny, 1933: 108, pl. 1, fig. 11.
Material. China: 110°, Gongliu County, Xinjiang Aut. Reg., 1100 m, 16 Jul. 1994, leg. Xincheng An;
19, Beitun County, Xinjiang Aut. Reg., 530 m, 22 Jul. 1994, leg. Houhun Li; 20°, Urümgi City, Xinjiang
Aut. Reg., 920m, 8 Aug. 1994, leg. Houhun Li; 19, Altay County, Xinjiang Aut. Reg., 900 m, 23 Jul.
1994, leg. Houhun Li. a
Remarks. The species is treated by Razowski (1979a: 161, figs. 162-168, 225) and
transferred to Clepsis. It is known to occur in Central Asia, Middle East, Europe and
is here recorded for the first time from China (Xinjiang).
Clepsis luctuosana (Rebel, 1914: 272, pl. 4 fig. 8) (Cnephasia)
Material. China: 10°, Altay County, Xinjiang Aut. Reg., 900 m, 23 Jul. 1994, leg. Houhun Li.
Remarks. The species is treated by Razowski (1979a: 124, figs. 63, 64) and trans-
ferred to Clepsis. It is known to occur in Central Asia (Tian shan) and here recorded
for the first time from China (Xinjiang).
Clepsis rurinana (Linnaeus, 1758: 823) (Phalaena Tortrix)
Phalaena Tortrix modeeriana Linnaeus, 1761: 347.
Phalaena Tortrix angulana Villers, 1789: 417, 612.
Cacoecia idana Kennel, 1919: 51, pl. 2, fig. 1.
Tortrix liotoma Meyrick, 1936: 60.
Material. 30°, Shexian County, Hebei Province, 700 m, 2-3 Jul. 2000, leg. Haili Yu; 40°, 29, Yixian
County, Hebei Province, 150 m, 19 Jul. 2000, Haili Yu leg.; 10°, Laiyuan County, Hebei Province, 1300 m,
20 Jul. 2000, leg. Haili Yu; 40°, 19, Jingxing County, Hebei Province, 1200 m, 23—26 Jul. 2000, leg.
Haili Yu; 10, Neigiu County, Hebei Province, 670 m, 28 Jul. 2000, leg. Haili Yu; 10°, Harbin City,
Nota lepid. 26 (1/2): 47-57 55
Heilongjiang Province, 150 m, 23 Jul. 1997, leg. Houhun Li; 60°, Heihe City, Heilongjiang Province,
120 m, 25 Jul. 1997, leg. Houhun Li; 29, Wudalianchi, Heilongjiang Province, 270 m, 30 Jul. 1997, leg.
Houhun Li; 100°, Tianmushan Mt., Zhejiang Province, 800 m, 19 Aug. 1999, leg. Houhun Li; 10°, Yuexi
County, Anhui Province, 8 Aug. 1995, leg. Xiangfu Hu; 60°, Xinyang City, Henan Province, 11 Jul. 1997,
leg. Houhun Li; 160°, 19, Neixiang County, Henan Province, 650 m, 12 Jul. 1998; 20°, 29, Shanxian
County, Henan Province, 1 Jun. 2000, leg. Haili Yu; 230°, 8Q, Jiyuan County, Henan Province, 650 m,
3-7 Jun. 2000, leg. Haili Yu; 20°, Dengfeng County, Henan Province, 800 m, 9 Jun. 2000, leg. Meicai
Wei; 109, 49, Lichuan City, Hubei Province, 1100 m, 2 Aug. 1999, leg. Houhun Li; 10°, Hefeng
County, Hubei Province, 1260 m, 18 Jul. 1999, leg. Houhun Li; 50°, Sangzhi County, Hunan Province,
1250 m, 13 Aug. 2001, leg. Houhun Li and Xinpu Wang; 290°, 109, Fanjingshan Mt., Guizhou Province,
1300 m, 1 Aug. 2001, leg. Houhun Li and Xinpu Wang; 300°, Chengxian County, Shaanxi Province,
1000 m, 9-12 Jun. 1993, leg. Houhun Li; 110°, 49, Louguantai, Shaanxi Province, 650 m, 11-15 May
1995, leg. Aisihaer; 100°, 29, Yuzhong County, Gansu Province, 2120 m, 30-31 Jul. 1993, leg. Houhun
Li; 40°, 29, Kangxian County, Gansu Province, 2-5 Jun. 1995, leg. Aisihaer; 20°, Wenxian County,
Gansu Province, 1950 m, 4-5 Jul. 2001, leg. Houhun Li and Xinpu Wang; 50°, 49, Xunhua County,
Qinghai Province, 2240 m, 13-15 Jul. 1995, leg. Houhun Li; 30°, 49, Jingyuan County, Ningxia Aut.
Region, 13-17 Jul. 1983.
Remarks. The species is treated by Razowski (1979a: 129, figs. 81, 82, 198) and
transferred to Clepsis. It is known from China (Hebei, Heilongjiang, Anhui, Zhejiang,
Henan, Hubei, Hunan, Guizhou, Shaanxi, Gansu, Qinghai and Ningxia), Mongolia,
Korea, Japan, Indian, Nepal, Afghanistan, Siberia and Europe.
Clepsis pallidana (Fabricius, 1776: 292) (Pyralis)
[Tortrix] strigana Hübner, [1799]: pl. 22, fig. 141.
Tortrix Lozotaenia stramineana Herrich-Schaffer, 1851: 163.
Tortrix quinquemaculana Bremer, 1864: 90, pl. 7, fig. 23.
Tortrix cesareana Joannis, 1891: LX XXIII.
Tortrix districta Meyrick, 1920: 342.
Material. 50°, 69, Tianjin, 31 May-2 Jul. 1965; 89, 19, Jixian County, Tianjin, 550 m, 23-25 Jun.
2001, leg. Houhun Li; 10°, Zunhua City, Hebei Province, 120 m, 7 Jul. 2001, leg. Yanli Du; 19,
Dongwuzhu Banner, Inner Mongolia, 920 m, 8 Aug. 1997, leg. Houhun Li; 10°, Heihe City, Heilongjiang
Province, 120 m, 25 Jul. 1997, leg. Houhun Li; 180°, 89, Yangling, Shaanxi Province, 450 m, Date from
3 May 1985 to 31 Aug. 1995, leg. Houhun Li; 20°, Xunyi County, Shaanxi Province, 30 May 1985, a
Houhun Li; 40, Chengcheng County, Shaanxi Province, 10-11 Aug. 1993, leg. Houhun Li; 30,
Danfeng County, Shaanxi Province, 28-29 May 1994, leg. Jin Zhou; 10, 19, Kangxian County, Gansu
Province, 1200 m, 2-3 Jun. 1995, leg. Aisihaer; 70°, 39, Zhongning County, Ningxia Aut. Reg., 26 Jul.
1993, leg. Houhun Li; 20°, Uriimgi, Xinjiang Aut. Reg., 920 m, 8 Aug. 1994, leg. Houhun Li; 19, Jinghe
County, Xinjiang Aut. Reg., 23 Jul. 1994, leg. Duoliken.
Remarks. The species is treated by Razowski (1979a: 149, figs. 133-135, 215) and
transferred to Clepsis. It is known to occur in China (Tianjin, Hebei, Inner Mongolia,
Heilongjiang, Shaanxi, Gansu, Ningxia, Xinjiang), Mongolia, Korea, Japan, Asia
Minor, Russia and Europe.
Clepsis melissa (Meyrick, 1908: 613) (Capua)
Capua epiclintes Meyrick, 1928: 452.
Material. China: 10°, Kangding County, Sichuan Province, 2400 m, 8 Jul. 2001, leg. Houhun Li and
Xinpu Wang.
Remarks. The species is treated by Diakonoff (1976: 98) and Razowski (1979a: 131,
figs. 83-87, 199, 200) and transferred to Clepsis. It is known to occur in China
(Sichuan, Yunnan), Nepal and India.
56
WANG, Li & WANG: Study on the genus Clepsis Guenée from China
Clepsis aerosana (Lederer, 1853: 383, pl. 7, fig. 1) (Tortrix)
Remarks. The species is treated by Razowski (1979a: 113, figs. 24-29, 183) and
transferred to Clepsis. It is known to occur in China (Xingjiang), Mongolia, Russia
(Razowski 1993).
Clepsis zeuglodon Razowski, 1979a: 165, figs. 176-178
Remarks. The species is known from China (Zhejiang) (Razowski 1979a).
Clepsis razowskii Kawabe, 1992: 178, figs. 14, 20, 21, 30
Remarks. The species is known from China (Taiwan) (Kawabe 1992).
Clepsis owadai Kawabe, 1992: 180, figs. 15, 22, 31
Remarks. The species is known from China (Taiwan) (Kawabe 1992).
Clepsis hohaunshanensis Kawabe, 1985: 5. figs. 7, 8, 9, 15
Remarks. The species is known from China (Taiwan) (Kawabe 1992).
Clepsis provocata (Meyrick, 1912: 1) (Catamacta)
Remarks. The species is treated by Razowski (1979b: 137. figs. 62, 93) and trans-
ferred to Clepsis. It is known from China (Taiwan), India (Assam) (Razowski 1979b).
References
Bremer, O. 1864. Lepidopteren Ost-Sibiriens, insbesondere des Amur-Landes, gesammelt von den
Herren G. Radde, R. Maack und P. Wulffius. — Mémoirs de l’Académie des Sciences de St.-Péters-
bourg (ser. 7) 8 (1): 1-104, pls. 1-8.
Byun, B. K., Y. S. Bae & K. T. Park 1998. Illustrated Catalogue of Tortricidae in Korea (Lepidoptera). —
In: K. T. Park (ed.), Insects of Korea [2], 317 pp. Korea.
Clarke, J. F. G. 1958. Catalogue of the type specimens of Microlepidoptera in the British Museum
(Natural History) described by Edward Meyrick, Vol. 3, 599 pp. London.
Clemens, B. 1860. Contributions to American Lepidopterology. No. 6. — Proceedings of the Academy of
Natural Sciences of Philadelphia 12: 345-362.
Diakonoff, A. 1947. Microlepidoptera from Madagascar. — Mémoirs de l’Institut Scientifique de Mada-
gascar (A) 1(1): 22-30, figs. 8.
Diakonoff, A. 1955. Lepidoptera of the Deutschen Nepal-Expedition. — Veröffentlichungen der Zoologi-
schen Staatssammlung München 8: 43-50, fig. I, pls. 24-26.
Diakonoff, A. 1976. Tortricoidea from Nepal, 2. — Zoologische Verhandelingen 144: 1-145.
Diakonoff, A. 1983. Tortricidae from Atjeh, Northern Sumatara (Lepidoptera). — Zoologische Verhande-
lingen 204: 1-132.
Duponchel, P.A.J. 1834. Nocturnes. — In: J.B. Godart & P.A.J. Duponchel, Histoire Naturelle des Lépi-
dopteres ou Papillons de France 9: 1-627, pls CCXXXVII-CCLXVI. Paris, Mequignon-Marvis.
Fabricius, J.C. 1776. Genera insectorum eorumque characteres naturales secundum numerum, figuram,
situm et proportionem omnium partim oris adiecta mantissa specierum nuper detectrum.. 310 pp.
Cologne
Guenée, M.A. 1845. Essai sur une nouvelle classification des Microlépidoptères et catalogue des espèces
européennes connues jusqu’a ce Jour. — Annales de la Société Entomologique de France (ser. 2) 3:
105-192, 297-344.
Nota lepid. 26 (1/2): 47-57 57
Herrich-Schäffer, G.A.W. (1847—) 1849 (-1855). Systematische Bearbeitung der Schmetterlinge von
Europa, zugleich als Text, Revision und Supplement zu Jakob Hübner’s Sammlung europäischer
Schmetterlinge. 4: Die Zünsler und die Wickler. — [1]-2-288, (Index) [1]-2—48, pl. 1-23 (Pyrali-
dides) + 1-59 (Tortricides).
Hübner, J. [1799]. Tortrices. - Sammlung europäischer Schmetterlinge 7: pls. 1-29.
Joannis, J. 1891. [Untitled.] Bulletin de la Société entomologique de France 1891: LXXIX-LXXXIV
Kawabe, A. 1982. Tortricidae. — Jn: H. Inoue et al. (eds.), Moths of Japan. 1: 966 pp, 2: 522 pp. Tokyo.
Kawabe, A. 1985. Notes on the Tortricidae (Lepidoptera) from Taiwan, 1. — Tinea 12 (1): 1-10.
Kawabe, A. 1992. Notes on the Tortricidae (Lepidoptera) from Taiwan, 4. — Tinea 13 (17): 178-181.
Kawabe, A. et al. 1992b. Title. — Jn: J. B. Heppner & H. Inoue (eds.), Lepidoptera of Taiwan 1 (2):
Checklist. 276 pp. Gainesville.
Kennel, J. 1901. Neue Wickler des palaearctischen Gebietes. — Deutsche entomologische Zeitschrift Iris
13 (1900) 2: 205-305.
Kennel, J. 1919. Mittelasiatische und andere neue Tortriciden. — Mitteilungen der Münchener Entomolo-
gischen Gesellschaft 8 (1917-1918): 50-95, pls. 2—4.
Lederer, J. 1853. Lepidopterologisches aus Sibirien. — Verhandlungen der Zoologisch-Botanischen
Gesellschaft in Wien 3 (Abhandlungen): 351-386, pls. 1-7.
Lederer, J. 1859. Classification der europäischen Tortriciden. — Wiener Entomologische Monatschrift 3:
241-255.
Linnaeus, C. 1758. Systema naturae per regna tria naturae, secundum classes, ordines, genera, species,
cum characteribus, differentiis, synonymis, locis, 1 [10th edition]: 1-824.
Linnaeus, C. 1761. Fauna Svecica. 1-560. Laurentii Salvii, Stockholmiae.
Liu, Y. Q. J. W. Bai 1977. Economic Entomology of China, 11, Lepidoptera, Tortricidae. 93 pp. Beijing.
Meyrick, E. 1891. A fortnight in Algeria, with descriptions of new Lepidoptera. —Entomologist’s
Monthly Magazine 27: 9-13.
Meyrick, E. 1908. Descriptions of Indian Micro-Lepidoptera VII. — Journal of the Bombay Natural
History Society 18: 613-638.
Meyrick, E. 1912. Exotic Microlepidoptera. 1: 1--64. — [London], Taylor & Francis.
Meyrick, E. 1920. Exotic Microlepidoptera. 2: 289-384. — [London], Taylor & Francis.
Meyrick, E. 1928. Exotic Microlepidoptera. 3: 449-464. — [London], Taylor & Francis.
Meyrick, E. 1936. Exotic Microlepidoptera. 5: 1-64. — [London], Taylor & Francis.
Mutuura, A. 1980. A new species of Clepsis from the Northern Yukon Territory (Lepidoptera: Tortri-
cidae). — Canadian Entomologist 112: 1071-1073.
Obraztsov, N.S. 1954, Die Gattungen der palaearktischen Tortricidae. I Allgemeine Aufteilung der
Familie und die Unterfamilien Tortricinae und Spargnothinae. I. Fortsetzung. — Tijdschrift voor Ento-
mologie 97(3): 141-231, figs. 1-248.
Ragonot, E.L. 1879. [Untitled.] Bulletin de la Société entomologique de France 1879: CXXXII-CXXXIII.
Razowski, J. 1979a. Revision of the Clepsis Guenée (Lepidoptera, Tortricidae). Part I. — Acta zoologica
cracoviensia 23 (9): 101-198.
Razowski, J. 1979b. Revision of the Clepsis Guenée (Lepidoptera, Tortricidae). Part II. — Acta zoologica
cracoviensia 24 (2): 113-152.
Razowski, J. 1987. The Genera of Tortricidae (Lepidoptera). Part II: Palaearctic Childanotinae and Tor-
tricinae. — Acta zoologica cracoviensia 30 (11) : 141-355.
Razowski, J. 1993. The catalogue of the species of Tortricidae (Lepidoptera). Part II: Palaearctics,
Spargenothini, Euliini, Ramapesiini and Archipini. — Acta zoologica cracoviensia 35 (3): 665-703.
Razowski, J. 2001. Die Tortriciden (Lepidoptera, Tortricidae) Mitteleuropas. 319 pp. Bratislava.
Rebel, H. 1914. Ueber eine Mikrolepidopterenausbeute aus dem westlichen Thian-Shan-Gebiet. —
Deutsche entomologische Zeitschrift Iris 28: 271-278, pl. 4.
Rothschild, L.W. 1912. Adatok Magyarorszäg lepkefaunäjähoz. — Rovartanı Lapok 19: 21-29,
Villers, C. J. 1789. Caroli Linnaei Entomologia, Faunae Suecicae descriptionibus aucta; D.D. Scopoli,
Geoffroy, de Geer, Fabricii, Schrank, ec. Speciebus vel in Systemate non enumerates, vel nuperrime
detectis, vel speciebus Galliae Australis locupletata, generum specierumque rariorum iconibus orna
menta; curante & augente Carolo de Villers. 2: xvi+656 s., 6 Taf. Lugduni.
Zerny, H. 1933. Lepidopteren aus dem nördlichen Libanon. — Deutsche entomologische Zeitschrift Iris
47: 60-109, pl. 1.
4
* : i
j \
= ;
os
a t
= r
q
ve
.
‘ 7
” at
t
= my | # 4
: 2 FC
+ | > i
\
1, | gi
re $ Er MX
§
5 4
4. y'
7 le ri had CP
DE
’ = AL toi ,
r, à 27 oe
4 : nl te» 7 si Pra Pi
La
Oru gi : ap DEE RN |
LUN] ae
IT oh 2 oy = ; Lime
al : iu ae éd Itt : © Uh. ol br vale A
re ter ‚eur on) ANNE TUE
0 à vos Eee 4 Lire ob noire
ur Mali re pedo att aah ORNE
> ‘
Nota lepid. 26 (1/2): 59-63 39
Pyraloidea specimens labelled as Rebel types from Egypt at
the National Museum of Natural History, Smithsonian
Institution, Washington, D.C.
M. ALMA SOLIS
Systematic Entomology Laboratory, PSI, Agriculture Research Service, USDA, Smithsonian
Institution, P.O. Box 37012, National Museum Natural History, E-517, MRC 168, Washington, DC
20013-7012; e-mail:
[email protected]
Abstract. The Anastase Alfieri collection from Egypt, acquired by the National Museum of Natural
History (USNM), Smithsonian Institution, Washington, D.C., in 1965, included 5 pyraloid specimens
labelled as types described by Rebel (1927): Piletocera opacalis, Pseudosyria gracilis, Heterographis
acrobasella, Acrobasis pumilella, and Trachypteryx acanthotecta. The specimens are figured and the
nomenclatural status of each species in the literature is described. There is a specimen of 7. acanthotec-
ta labelled as holotype in the USNM, but this was not been designated in the original description; and
the subsequently designated lectotype is located at the Natural History Museum in Vienna. The follow-
ing biological data is available: Pseudosyria gracilis eclosed from a stem of Lavandula pubescens
(Lamiaceae) as indicated on the label data; and 7° acanthotecta eclosed from a case on Acacia tortilis
(Forssk.) Hayne (Fabaceae) as stated in the original description. Information about these specimens is
provided to the lepidopterists’ community for utilization in future systematic research. Types are not des-
ignated.
Key words. Pyraloidea, type depository, Anastase Alfieri, Egypt, host plant records, nomenclatural
changes, type status.
Introduction
Rebel (1927) described many new Egyptian Microlepidoptera species from the
collections of Adolf Andres and Anastase Alfieri. In 1965 the National Museum of
Natural History (USNM), Smithsonian Institution, Washington, D.C. acquired the
insect collection of Anastase Alfierl, who was with the Ministry of Egyptian
Agriculture. The Alfieri collection included 5 pyraloid specimens labelled as types.
None of the handwriting on the labels resemble the reproduction of a Rebel label pre-
sented by Horn et al. (1990: pl. 26 fig. 20).
Rebel (1927) stated that voucher specimens were deposited in the Alfieri collec-
tion in Cairo and the Natural History Museum in Vienna (NHMW). According to
Horn et al. (1990) the Coleoptera of the Alfieri collection is said to be at the Museum
Frey in Tutzing near Munich (now Basel), and no mention is made of the Lepidoptera
collection. Presumably the pyraloid specimens came to the United States long before
the publication of Horn et al. (1990). The Alfieri collection has long since been incor-
porated into the main USNM Lepidoptera collection.
These five specimens labelled as types are figured here and the text of the labels
is given to inform the Lepidoptera community that they are deposited at the National
Museum of Natural History for confirmation and utilization in future systematic
research. The current nomenclatural status of each species group taxon is given
according to published data, and further determination is left for researchers con-
© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536
60 SOLIS: Pyraloidea labelled as Rebel types at the U. S. National Museum of Natural History
Figs. 1-5. Habitus of Rebel types. 1. Piletocera opacalis. 2. Pseudosyria gracilis. 3. Heterographis
acrobasella. 4. Acrobasis pumilella. 5. Trachypteryx acanthotecta.
ducting revisionary- work on these taxa. The nomenclatural status of the specimens
considered is not determined nor designated herein. For unresolved type problems
concerning Rebel species descriptions, future workers should examine the Pyraloidea
material of both, the Natural History Museum in Vienna and the National Museum of
Natural History in Washington.
Nota lepid. 26 (1/2): 59-63 61
Results
Crambidae: Spilomelinae
Piletocera opacalis Rebel, 1927:186—187 (Fig. 1). The original description states
“Drei Stucke, davon eines mit Bezeichnung Bacos (Andres)” (three specimens of
which one is labelled “Bacos”), and does not state the sex of the specimens upon
which the name of the species is based; the specimen figured here is a female. Text of
labels: “Sakka, at | camp, 10.11.22” (handwrtten with black ink on beige paper);
“Coll. Alfieri | Egypte” (printed with black ink on beige paper); “Philitocera [sic] |
opacalis n. sp | DET. REBEL, TYPE” (handwritten and “DET. REBEL’ printed with
black ink on beige paper); “Anastase Alfieri | Collection | 1965” (printed with black
ink on white paper with a broad red stripe on the bottom half of the label).
Pyralidae: Phycitinae
Pseudosyria gracilis Rebel, 1927:180-182 (Fig. 2). The original description gives
the following information: Two male specimens from “Wadi Hof 19.111.[19]15”; the
specimen figured here is a male. A lectotype was designated by Roesler (1973: 661)
and deposited at the Natural History Museum Vienna, so the specimen figured here is
a paralectotype. Roesler (1973) synonymized Pseudosyria with Pempelia Hubner and
gracilis with malacella (Staudinger, 1870: 196). Leraut (2001: 141), after study of the
genitalia of malacella, resurrected Pseudosyria from synonymy declaring it a valid
genus. Text of labels: “Eclos 22.4.18 de tiges de | Lavandula pubescens | de Wadi Abu
Gufan | (Ou gret [sic] Sheik) 29.3.18” (handwrtten with black ink on beige paper);
“Coll. Alfieri | Egypte” (printed with black ink on beige paper); “PSEUDOSYRIA nov.
gen | gracilis n. sp. | DET REBEL | TYPE” (handwritten and “DET. REBEL’ printed
with black ink on beige paper); Anastase Alfieri | Collection | 1965” (printed with black
ink on white paper with a broad red stripe on the bottom half of the label). The label
information states that the specimen eclosed from a stem of Lavandula pubescens.
Heterographis acrobasella Rebel, 1927: 182—183 (Fig. 3). The original descrip-
tion gives the following information: “Nur ein Männchen mit der Bezeichnung” [only
one male with data]: Ramleh (Palais), 5 [sic] Septembre 1921,” and indicates with a
symbol that the type is a male; but the specimen figured in this paper is a female.
Roesler (1973: 659-660) placed acrobasella in Acrobasopsis Amsel, 1958 and syn-
onymized Acrobasopsis talhouki Amsel, 1958 with Acrobasopsis acrobasella (Rebel,
1927). Roesler (1973: 659) mentioned that the type is in The Natural History Museum
Vienna, but that specimen is also a female and bears exactly the same label data
(including 15[sic].9.21). Text of labels: “Ramleh (Palais) / 15.9.21” (handwrtten with
black ink on beige paper); Coll. Alfieri | Egypte (printed with black ink on beige
paper); “Heterographis | acrobasella n. sp. | DET REBEL | TYPE” (handwritten and
“DET. REBEL’ printed with black ink on beige paper); Anastase Alfieri | Collection
| 1965” (printed with black ink on white paper with a broad red stripe on the bottom
half of the label).
62 SOLIS: Pyraloidea labelled as Rebel types at the U. S. National Museum of Natural History
Acrobasis pumilella Rebel, 1927: 185—186 (Fig. 4). The original description gives
the following information: 1 male, indicated with a symbol and stated in the text, from
“Ramleh Palais 15 August 1921”; the specimen figured here is a female. This species
has not been treated in the literature (i.e. Roesler 1973, 1993). If no type specimen is
found at the Natural History Museum in Vienna, this specimen should be investi-
gated as a possible type specimen in a future study. Text of labels: “Ramleh (Palais) |
15.9.21” (handwritten with black ink on beige paper); Coll. Alfieri | Egypte” (printed
with black ink on beige paper); “Acrobasis | puminella [sic] n. sp. | DET REBEL,
TYPE” (handwritten and “DET. REBEL? printed with black ink on beige paper);
“Anastase Alfieri | Collection | 1965” (printed with black ink on white paper with
a broad red stripe on the bottom half of the label).
Trachypteryx acanthotecta Rebel, 1927: 183-185 (Fig. 5). The original descrip-
tion gives the information on the type specimens as “<<éclos 11.IV.26 (9), 2.V.26 (GC),
de fourreaux sur Acacia tortilis du Galala, 1-4.IIL.26»> und ein grosses gefangenes 9
mit der Bezeichnung ««Sud-Sinai, pres Wadi Isla, 27.IIL.1924»> vor.” [eclosed 11.1V.26
(2), 2.V.26 (©), from cases on Acacia tortilis from Galala, 1-4.111.[]19]26 and one
large female collected in South Sinai, near Wadi Isla, 27.11.1924]. The biology of this
species is described in a separate article by Alfieri (1927). Male and female were indi-
cated by symbols in the original description. The specimen figured here is a female
and is probably the latter mentioned above. Roesler (1993: 143) designated a lecto-
type at the Natural History Museum, Vienna from the two male “syntypes” deposited
there. The specimen in the USNM is labelled as the holotype and is probably part of
the original type series, but was not designated as a paralectotype subsequently. Text
of labels: “Sud SINAI, pres | Wadi Isla | 27.3.1924” (handwritten with black ink on
beige paper); “Coll. Alfieri | Egypte” (printed with black ink on beige paper);
“HOLOTYPE” (handwritten with black ink on dark orange paper); “Anastase Alfieri
| Collection | 1965” (printed with black ink on white paper with a broad red stripe on
the bottom half of the label).
Acknowledgements
I thank M. Shaffer (The Natural History Museum, London) who encouraged me to publish this infor-
mation, and Matthias Nuss (Staatliche Naturhistorische Sammlungen, Dresden) who provided very
helpful suggestions with the German text and drafts of this article. I thank M. Pogue who aided in the
photography of the specimens and L. Lawrence who placed the digital photographs on a electronic
plate, both with the Systematic Entomology Laboratory, USDA.
Nota lepid. 26 (1/2): 59-63 63
References
Alfieri, A. 1927. Sur deux Pyralides remarquables des déserts égyptiens. — Bulletin de la Société Royale
Entomologique d’Egypte 10 (1926): 288-294.
Amsel, H.G. 1958. Kleinschmetterlinge aus Nordost-Arabien der Ausbeute A.S. Talhouk. — Beiträge zur
Naturkundlichen Forschung in Südwestdeutschland 17: 61-82.
Horn, W., I. Kahle, G. Friese & R. Gaedike. 1990. Collectiones entomologicae. — Berlin: Akademie der
Landwirtschaftswissenschaften der Deutschen Demokratischen Republik, Part 1: 220 pp.
Leraut, P. 2001. Contribution a l’étude des phycites Paléarctiques (Lepidoptera, Pyralidae, Phycitinae). —
Revue française d’Entomologie (N.S.) 23 (2): 129-141.
Rebel, H. 1927. Beitrage zur Lepidopterenfauna Aegyptens. — Bulletin de la Société Royale Entomo-
logique d’Egypte 10 (1926): 179-191.
Roesler, R.-U. 1973. Phycitinae. Jn H.G. Amsel, F. Gregor & H. Reisser (eds.), Microlepidoptera
Palaearctica. Wien: Verlag Georg Fromme & Co., vol. 4: 752 pp.
Roesler, R.-U. 1993. Phycitinae. Jn H.G. Amsel, F. Gregor, H. Reisser & R.-U. Roesler (eds.) Micro-
lepi-doptera Palaearctica. Wien: Verlag Georg Fromme & Co., vol. 8: 305 pp.
Staudinger, O. 1870. Beschreibung neuer Lepidopteren des europäischen Faunengebiets. — Berliner
Entomologische Zeitschrift 14: 193-208.
%
*
N
Nota lepid. 26 (1/2): 65-71 65
Description of a new species of the “brown” Agrodiaetus com-
plex from South-East Turkey (Lycaenidae)
VLADIMIR A. LUKHTANOV!, MARTIN WIEMERS~ & KAREN MEUSEMANN?
Laboratory of Entomology, Biological Institute, St. Petersburg State University, St. Petersburg,
Zoologisches Forschungsinstitut & Museum Alexander Koenig, Adenauerallee 160, D-53113 Bonn,
Abstract. Agrodiaetus dantchenkoi sp. n. is described from Van Province in Turkey. The new taxon
belongs to the “brown” complex of the genus Agrodiaetus Hubner, 1822. This complex includes several
sibling species which are extremely uniform in their morphology but have distinct chromosome numbers.
The karyotype of Agrodiaetus dantchenkoi sp. n. (n=40-42) is investigated. The new species is compared
with A. eriwanensis Forster, 1960 (n=34), A. humedasae Toso & Balletto, 1976 (n=38) and A. aroanien-
sis Brown, 1976 (n=48).
Zusammenfassung. Agrodiaetus dantchenkoi sp. n. wird aus der Provinz Van in der Türkei neu
beschrieben. Das neue Taxon gehört zum “braunen” Artenkomplex der Gattung Agrodiaetus Hübner,
1822. Dieser Komplex enthält mehrere Zwillingsarten, die sich morphologisch äußerst ähnlich sind, aber
verschiedene Chromosomenzahlen besitzen. Der Karyotyp von Agrodiaetus dantchenkoi sp. n.
(n=40-42) wird untersucht und die neue Art wird mit A. eriwanensis Forster, 1960 (n=34), A. humedasae
Toso & Balletto, 1976 (n=38) und A. aroaniensis Brown, 1976 (n=48) verglichen.
Key words. karyotype, chromosome number, Agrodiaetus, Lepidoptera, Lycaenidae, Turkey, biolog-
ical species concept, reproductive isolation, chromosome rearrangement.
Introduction
The “brown” complex of the genus Agrodiaetus Hübner, 1822 is composed of sibling
species in which both males and females have similar brown coloration of the upper-
side of the wings. This complex is a real stumbling block in the taxonomy of the
genus. The species of this group are extremely similar in wing colour and pattern as
well as in genitalia structure. In contrast to morphological uniformity, the complex
possesses a great chromosome number diversity, and each species has a specific kary-
otype.
The following haploid chromosome numbers were found in the complex: n=19 in
A. alcestis karacetinae Lukhtanov & Dantchenko, 2002 (Lukhtanov & Dantchenko
2002b), n=20-21 in A. alcestis alcestis (Zerny, 1932) (De Lesse 1960), n=29-32 in A.
eriwanensis interjectus De Lesse, 1960 (De Lesse 1960), n=32-34 ın A. eriwanensis
eriwanensis Forster, 1960 (Lukhtanov & Dantchenko 2002a and unpublished data),
n=38 in A. humedasae Toso & Balletto, 1976 (Troiano ef al. 1979), n=48 in A.
aroaniensis Brown, 1976 (Coutsis ef al. 1999), n=66 in A. galloi Balletto & Toso,
1979 (Troiano & Giribaldi 1979), n=67-74 in A. demavendi (Pfeiffer, 1938) (De
Lesse 1960), n=78—80 in A. admetus (Esper, [1783]) (De Lesse 1960), n=84 in A. kho-
rasanensis Carbonell, 2001 (Carbonell 2001) and n=90 in A. ripartii (Freyer, 1830)
and A. fabressei (Oberthür, 1910) (De Lesse 1960). The chromosome number is the
© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536
66 LUKHTANOV, WIEMERS & MEUSEMANN: A new species of Agrodiaetus from Turkey
Figs. 1-3. Karyotype of Agrodiaetus dantchenkoi sp. n. 1: ML n=40, paratype, © NoVL01L344, Turkey,
Prov. Van, 34 km N Catak. 2: MI, n=42, paratype, MW99319, Turkey, Prov. Van, 25-32 km N Catak.
3: MII, n=42, paratype, © MW99274, Turkey, Prov. Van, Kurubas Geçidi.
same in the two latter species. However, there is a difference between them in karyo-
type structure: A. ripartii has one large, one medium and 88 small bivalents, and
A. fabressei has 2 large, 2 medium and 86 small bivalents (De Lesse 1961).
As it follows from the investigations of De Lesse (1960), who first studied this
group karyologically, the species description and the species determination is only
possible on the basis of karyotype investigation. Our studies confirm this statement.
Using karyological methods, we were able to find numerous mistakes in species iden-
tification even in cases, when species were determined by recognized experts of the
group.
Abbreviations. ca — circa, approximately determined chromosome number, MCZH — Museum of
Comparative Zoology (Harvard University, Cambridge, MA, USA), MI - first metaphase of meiosis, MII
— second metaphase of meiosis, n — haploid chromosome number, SPSU - St. Petersburg State
University, St. Petersburg, Russia, ZFMK — Zoologisches Forschungsinstitut und Museum Alexander
Koenig (Bonn, Germany).
Methods
The methods described by Lukhtanov & Dantchenko (2002a) were used to inves-
tigate the karyotype in the specimens VLOIL341, VLOIL343, VLOIL344, VLOIL345
and 2001-372, and the methods applied to the specimens MW99319, MW99320 and
MW99274 are described in Olivier et al. (2000).
Agrodiaetus dantchenkoi Lukhtanov & Wiemers sp. n.
Material. Holotype &: No VLO1L342, n=42, Turkey, Prov. Van, 34 km N Çatak, 20.vu.2001,
Dantchenko leg., MCZH. The mitochondrial genes COI and COII of the holotype specimen were
sequenced (Kandul et al., in press) and will be submitted to GenBank (http://www.ncbi.nlm.nih.gov/).
— Paratypes. 50’ same data as holotype, but VLOIL341 (n=ca 40-42), VLOIL343 (n=ca 40-42),
VL01L344 (n=40,41), VLOIL345 (n=ca 40-42), MCZH; 2001-372, (n=ca 40-42), SPSU. 20
MW99319 (n=42), MW99320 (n=ca 40-41), Prov. Van, 25-32 km N Catak, 2100 m, 18.v11.1999,
Wiemers leg., ZFMK. 19 MW99274 (n=42), 9 MW99275 (found in copula with o MW99274), Prov.
Van, Kurubas Geçidi, 2200 m, 17.vii.1999, Wiemers leg., ZFMK.
Description d (Figs 4-27). Forewing length 14-17 mm.
Upperside: Ground colour light brown with light yellow shimmer and with darker
veins. Discoidal, submarginal and antemarginal marking completely absent on both
fore- and hindwings. Forewings with a well developed sex brand and scale-tuft. Fringe
brown.
Nota lepid. 26 (1/2): 65-71 67
Figs. 4-27. Wings of Agrodiaetus dantchenkoi sp. n. 4-7. Holotype S No VLOIL342, Turkey, Prov. Van,
34 km N Catak, 20.vii.2001, Dantchenko leg., MCZH (n=42). 8-11. Paratype 0 NoVLOIL343, Turkey,
Prov. Van, 34 km N Catak, 2100 m, 20.v11.2001, Dantchenko leg., MCZH (n=ca 40-42). 12-15. Paratype
oO MW99319, Turkey, Prov. Van, 25-32 km N Catak, 2100 m, 18.vii.1999, Wiemers leg., ZFMK (n=42).
16-19. Paratype MW99320, Turkey, Prov. Van, 25-32 km N Çatak, 2100 m, 18.v11.1999, Wiemers leg.,
ZFMK (n=ca 40-41). 20-23. Paratype MW99274, Turkey, Prov. Van, Kurubas Geçidi, 2200 m,
17.vii.1999, Wiemers leg., ZFMK (n=42). 24-27. Paratype Q MW99275, Turkey, Prov. Van, Kurubas
Gegidi, 2200 m, 17.vii.1999, found in copula with 9 MW99274, Wiemers leg., ZFMK.
Colour differences between figs. 4-11 and figs. 12-27 are caused by different scanning techniques and
do not reflect real differences.
68 LUKHTANOV, WIEMERS & MEUSEMANN: A new species of Agrodiaetus from Turkey
O
1 2
©
ER. |... cc. .n,
mm
Fig. 28. Agrodiaetus dantchenkoi, paratype, S genitalia (MW99274) (drawing by J. Coutsis).
Underside: Ground colour is warm yellowish brown. Greenish blue basal suffusion
nearly absent. Basal black spots present on hindwings, but absent on forewings.
Discoidal and postdiscal black marking well developed on both fore- and hindwings,
but postdiscal black marking vestigial in some specimens. Submarginal and antemar-
ginal marking completely absent on forewings. On the hindwings submarginal mar-
king strongly reduced, nearly absent; antemarginal marking is presented by small
inconspicuous strokes. White streak on hindwings clearly visible. Fringe grey.
Phenotypically similar to A. eriwanensis eriwanensis Forster, 1960 and A. eriwa-
nensis interjectus De Lesse, 1960 but can be distinguished by the karyotype.
©. One female was found in copula with a male of A. dantchenkoi whose kary-
otype could be established. Forewing length 14 mm.
Upperside: Ground colour is light brown with light yellow shimmer and with dark-
er veins. Discoidal cell spot present on forewings, hindwings with faint yellowish
brown submarginal lunules in SI-S3. Fringes warm yellowish brown.
Underside: Ground colour warm yellowish brown. Basal black spots present on
hindwings, but absent on forewings. Discoidal and postdiscal black marking well
developed on both fore- and hindwings. Faint brown submarginal marking present on
forewings (S1-S3) and reduced orange submarginal marking on hindwings (S1-S4).
White streak on hindwings clearly visible. Fringe greyish brown.
Karyotype (Figs. 1-3). In the holotype the chromosome number n=42 was
found in 4 studied MII cells from one spermatocyst. In another spermatocyst, in each
of 8 studied MI cells we have found 36 bivalents and 3 multivalents. Taking into
account the fact that MII plates have 42 chromosomes, we can conclude that these MI
cells were heterozygous for reciprocal translocation involving three chromosome
pairs, i.e. these multivalents were tetravalents in reality. Thus, the chromosome
Nota lepid. 26 (1/2): 65-71 69
number of the specimen VLOIL342 is n=42. The same chromosome number n=42
was precisely determined in one MII cell of paratype specimen MW99274 and in one
MI cell of the paratype specimen MW99319.
In few well squashed MI cells from the paratype specimens VL01L344 and
MW99320, we were able to count only 40 or 41 chromosome elements. In the last
case, it remains unknown whether these counts reflect the real chromosome number
in these specimens or, like in the holotype specimen, the decrease of chromosome ele-
ments was caused by undetected chromosome rearrangements. In three other paratype
specimens, the counts of chromosome elements were made with approximation
(n=ca 40-42) due to the fact that some of the bivalents overlapped.
Distribution. SE Turkey (Van) (map). Only known from the type locality
(N Catak) and from Kurubas Geçidi south of Van where it was found flying together
with A. ripartii (n=90). A. alcestis karacetinae (n=19) was found a few km south of
the type locality on 18.v11.1999 (MW) and A. demavendi (n=68-71) is known from
Edremit near Van (VL). Therefore four species of the brown Agrodiaetus complex
(identified by their karyotype) are now known to occur in Van Province.
Derivatio nominis. The new species is dedicated to A. Dantchenko, an
expert in the taxonomy and biology of the Lycaenidae.
Map. Distribution of Agrodiaetus eriwanensis (@)), A. interjectus (Qj), and A. dantchenkoi (@).
70 LUKHTANOV, WIEMERS & MEUSEMANN: A new species of Agrodiaetus from Turkey
Discussion
A. dantchenkoi sp. n. is genetically (Kandul et al., in press) and phenotypically most
similar to A. eriwanensis eriwanensis and A. eriwanensis interjectus. All these three
taxa are allopatric in their distribution (map). In most cells of A. dantchenkoi we found
metaphase plates showing 42 bivalents; in few metaphase plates 40 or 41 chromosome
elements were detected. A variable chromosome number ofn=29-32 was found by De
Lesse (1960) in A. eriwanensis interjectus. In MI cells of A. eriwanensis eriwanensis
from 29 up to 34 chromosome elements (bivalents, multivalents and univalents) were
counted (Lukhtanov & Dantchenko 2002a). This variability in A. eriwanensis eriwan-
ensis ıs due to different chromosome rearrangements of the main chromosome set
consisting of 34 bivalents (Lukhtanov & Dantchenko, unpublished). The cytological
nature of the rearrangements in 4. eriwanensis eriwanensis as well as in A. eriwan-
ensis interjectus and A. dantchenkoi remains unknown. However it is evident that the
difference in the number of visible chromosome elements in MI plates, which was
found within the above mentioned taxa, does not reflect the real variation of their
diploid number. Heterozygosity for different chromosome rearrangements may result
in multivalent formation in the MI stage and consequently in change of number of re-
cognizable chromosome units even if the diploid chromosome number remains con-
stant. More investigations are necessary to clarify this complex situation.
Thus, at the minimum there is a difference of 6 chromosome pairs (12 chromo-
somes) between A. eriwanensis (n=34) and A. dantchenkoi (n=40-42). Therefore
these two taxa represent different karyospecies. The application of the biological spe-
cies concept (BSC) is complicated in this case because of their allopatric distribution.
Theoretically we can not exclude that these two chromosome forms could be geneti-
cally compatible and produce fertile hybrids. However according to our knowledge
about the characters of intra- and interspecific karyotype variability in Lepidoptera
(Lukhtanov & Dantchenko 2002b) the hypothesis about their nonconspecifity seems
to be much more likely.
The pattern of geographical distribution can provide one more evidence of non-
conspecifity of chromosomal races. If multiple chromosome rearrangements would
be no barrier to gene flow (i.e. unimportant as isolating mechanisms), chromosome
races should hybridize freely and should form a broad transition zone, in which exten-
sive chromosome polymorphism will be expected. A free circulation of chromosome
rearrangements in accordance to the Hardy-Weinberg equilibrium should be also
expected in such zones. In reality, the chromosomal races, differing in multiple fixed
rearrangements, have discrete distribution (even if there is no geographical border
between them) and, if a contact zone is present, it is narrow, and hybridization is either
absent, or present but with very limited chromosomal introgression (see review: King,
1993). Such a pattern of distribution is usually considered as a characteristic of
species but not of subspecies (Kitching & Cadiou 2000).
Similar chromosome numbers, n=38 and n=48, were found in two other species of
the “brown Agrodiaetus-complex” — A. humedasae and A. aroaniensis correspon-
dingly (Troiano et al. 1979; Coutsis et al. 1999). A. humedasae has a very restricted
distribution in Val d’ Aosta in NW Italy. A. aroaniensis is locally distributed in Greece.
Nota lepid. 26 (1/2): 65-71 WN
One could speculate that A. dantchenkoi may be conspecific with A. humedasae or
A. aroaniensis. However this supposition seems to be improbable due to karyological
differences, geographical distribution and the morphology of the taxa. Phenotypically
A. humedasae and A. aroaniensis differ by the total absence of the white streak in the
hindwing underside in all (A. humedasae) or most individuals (ca. 60-70% of A.
aroaniensis; Coutsis pers. comm.) and by the postdiscal series of points that are nearer
to the discal spot than to the margin.
Acknowledgements
We thank Prof. Dr. Can Bilgin (Middle East Technical University, Ankara, Turkey), Prof. Dr. Naomi
Pierce (Harvard University, USA), Dr. Cagan Hakki Sekercioglu (Stanford University, USA) for their
invaluable help during the organization and realization of the collecting trips 2001 to the Van Region in
Turkey, and Willy De Prins, Dirk van der Poorten and Alain Olivier (Antwerpen, Belgium) for help in
organizing the joint collecting trip 1999 to Eastern Turkey. Thanks to Dr. A. Hausmann and Mr. U. Buchs-
baum (Zoologische Staatssammlung München, Germany), late Prof. Dr. G. Bernardi, Dr. M. J. Pierre and
Mr. F. Carbonell (Muséum National d’Histoire Naturelle, Paris, France) for the possibility to study the
types of A. eriwanensis and A. interjectus. We thank Prof. Dr. C. Naumann (ZFMK, Bonn, Germany) for
unlimited access to the facilities at the ZFMK and his invaluable all-out support and Dr. Jurate De Prins
(Royal Museum for Central Africa, Tervuren, Belgium) for teaching her method of permanent chromo-
some preparations. We thank John Coutsis (Athens) for providing the genital drawing. We gratefully
acknowledge the financial support from the William F. Milton Fund and Putnam Expedition Committee
(Museum of Comparative Zoology, Harvard University, Cambridge, MA, USA), the Russian Research
Foundation (Grants RFFI 02-04-49138 and 00-15-97934) and the Russian Federal Programmes
“Universities of Russia” (Grant UR 07.01.056) and “Scientific schools” (Grant 2232.2003.4) to VL and
the support of the Deutsche Forschungsgemeinschaft (Grants 436 RUS 17/90/02 and Na 90/14).
References
Carbonell, F. 2001. Contribution a la connaissance du genre Agrodiaetus Hübner (1822), A. ahmadi et
A. khorasanensis nouvelles espèces dans le Nord de l’Iran (Lepidoptera, Lycaenidae). — Linneana
Belgica 18 (2): 105-110.
De Lesse, H. 1960. Les nombres de chromosomes dans la classification du groupe d’Agrodiaetus ripar-
tii Freyer (Lepidoptera, Lycaenidae). — Revue française d’Entomologie 27: 240-264.
De Lesse, H. 1961. Cohabitation en Espagne d’Agrodiaetus ripartii Freyer et A. fabressei Oberthür
(Lepidoptera, Lycaenidae). — Revue francaise d’Entomologie 28: 50-53.
Eckweiler, W. & C. Hauser 1997. An illustrated checklist of Agrodiaetus Hubner, 1822, a subgenus of
Polyommatus Latreille, 1804 (Lepidotera: Lycaenidae). — Nachrichten des entomologischen Vereins
Apollo, Suppl. 16: 113-168.
Kandul, N. P., V. A. Lukhtanov, A. V. Dantchenko, J. W. S. Coleman, C. H. Sekercioglu, D. Haig &
N. E. Pierce (in press). Phylogeny of Agrodiaetus Hübner 1822 (Lepidoptera: Lycaenidae) inferred
from mtDNA Sequences of CO/ and COI, and Nuclear Sequences of EF /-a: Karyotype
Diversification and Species Radiation. — Systematic Biology.
King, M. 1993. Species evolution. — Cambridge University Press, Cambridge, UK. 336 pp.
Kitching, I. J. & J.-M. Cadiou 2000. Hawkmoths of the world. An annotated and illustrated revisonary
check-list (Lepidoptera: Sphingidae). — Cornell University Press, Ithaca and London. 226 pp.
Lukhtanov, V. A. & A. D. Dantchenko 2002a. Principles of the highly ordered arrangement of metaphase
I bivalents in spermatocytes of Agrodiaetus (Insecta, Lepidoptera). — Chromosome Research 10 (1):
5-20.
Lukhtanov, V. A. & A. V. Dantchenko 2002b. Descriptions of new taxa of the genus Agrodiaetus Hübner,
[1822] based on karyotype investigation (Lepidoptera, Lycaenidae). — Atalanta 33 (1/2): 81-107,
224-225, colour plate I.
Olivier, A., D. van der Poorten, J. Puplesiene & W. de Prins 2000. Polyommatus (Agrodiaetus) artvinen-
sis stat. nov. and P (A.) sigberti sp. nov., two vicariant species known so far only from Turkey
(Lepidoptera: Lycaenidae). — Phegea 28 (2): 57-74.
Troiano, G., E. Balletto & G. G. Toso 1979. The karyotype of Agrodiaetus humedasae Toso & Balletto,
1976. — Bollettino della Societa Entomologica Italiana 111 (7-10): 141-143.
Troiano, G. & M. A. Giribaldi 1979. Karyotypic analysis. — Nota lepidopterologica 2 (1-2): 22-23.
—
>
…
| tu sin
1 in UE AUOT ER
| Mel faa fe 2 gal ey à, LEE
€ | | | | | m
N aver NE ) be dee
, x
N
+
oe
|
LS
is
= * |
7, 42 “ 3 ele: fr
à ‘
' |
~ a!
j TM u | 1
fer ie sr u. {i f 7
| AT tale L
4 ’ Fr h a =.
’ LU Ja = Ye
| ee
= ht? rare
N 1 wave i tre D eared Gees | rite. ta N iR 58 3
Ÿ £ Ss
Ri * | al di as, ARE = ok LOU, er Ey LA pat er
L Fe 3 2
AU VE avai ci co “ah OR ne 4 wi W ï ut en 4 ae
VON ET: ou jrs coe il rt Ré Eee oval EEE en EN :
A trent: Ars aa:
4 ‚not I gugi CET »° ah do ide a a ida eae > > ake
ao . din re ES ee UNO
5 & . . Po > u us
… Fos an 7
_ = x = Ve … NOR en ; ; u …
= i … u - .
Nota lepid. 26 (1/2): 73-78 73
Records of Macrolepidoptera from Corvo Island, Azores
VIRGILIO VIEIRA
Universidade dos Açores, Departamento de Biologia, CIRN, Rua da Mae de Deus,
PT-9501-801 Ponta Delgada, Açores, Portugal (e-mail:
[email protected])
Abstract. An annotated list of butterflies and moths collected or observed on Corvo island (Azores) dur-
ing September 11—13, 2002, is provided. Twenty six species are recorded (2 Pieridae, 2 Nymphalidae, 2
Geometridae, 2 Sphingidae and 18 Noctuidae), six of which are new to this island: Cleora fortunata
azorica Pinker, 1971, Macroglossum stellatarum (Linnaeus, 1758), Chrysodeixis chalcites (Esper, 1789),
Helicoverpa armigera (Hubner, [1808]), Acantholeucania loreyi (Duponchel, 1827), and Agrotis ipsilon
(Hufnagel, 1766). This brings the total number of species recorded from Corvo to 44.
Résumé. L'auteur présente une liste annotée de 26 espèces de Macrolépidoptères récoltés ou observés
dans l’île de Corvo, archipel des Açores, du 11 au 13 Septembre 2002. Parmi ces 26 espèces (2 Pieridae,
2 Nymphalidae, 2 Geometridae, 2 Sphingidae et 18 Noctuidae), parmi lesquelles six sont rapportées pour
la première fois de cette île : Cleora fortunata azorica Pinker, 1971, Macroglossum stellatarum
(Linnaeus, 1758), Chrysodeixis chalcites (Esper, 1789), Helicoverpa armigera (Hübner, [1808]),
Acantholeucania loreyi (Duponchel, 1827), et Agrotis ipsilon (Hufnagel, 1766). La liste totale des
espèces mentionnées de cette île s’élève maintenant a 44.
Key words. Lepidoptera, Azores, Corvo, endemism, new records.
Introduction
The Azores are an volcanic archipelago situated on the eastern slope of the Mid-
Atlantic ridge rising from depths of 2000 m. The archipelago is composed of nine
inhabited islands of which Corvo is the smallest (17 km“) and the northwesternmost.
The geographical position of Corvo is 39°40’—-43’N and 31°5’—8’ W and the maximum
altitude is 718 m at Estreitinho. Because of its outermost position within the archi-
pelago, Corvo’s lepidopteran fauna is less explored than that of all the other Azorean
islands. The earliest records on Lepidoptera from Corvo are scattered throughout a
very small number of publications (Drouét 1861; Godman 1870; Sousa 1985a, 1991;
Vieira & Pintureau 1991; Vieira 1994), and generally provide vague information on
the species. A preliminary checklist including 28 species and subspecies, of which 25
were new records for Corvo, was elaborated by Vieira & Tavares (1995). The present
contribution deals with butterflies and moths records obtained during a recent visit to
Corvo.
Material and methods
An arthropod survey was conducted on Corvo island during September 11-13,
2002, of which the results concerning Macrolepidoptera are treated here. For the col-
lection of lepidopterous specimens, the following techniques were used: (1) an adapt-
ed Pennsylvania light trap, with a TLD 15 W/05 lamp, fed by a 12 V battery coupled
with a transformer, for the noctuids; (11) an entomological net, for moths and butter-
flies; (111) the direct observation of various host plants (exotic and endemic) and lar-
vae (compare also Vieira 1994; Vieira & Tavares 1995). The taxonomy and nomen-
clature used is adapted from Vives Moreno (1994), Vieira & Tavares (1995), Vieira
© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536
74
VIEIRA: Macrolepidoptera from Corvo, Azores
(1997) and Carvalho er al. (1999), for the Hipparchia azorina species group from
Tennent & Sousa (2003) and Fujaco ef al. (in press). Place, date, number of specimens
captured or observed were recorded for each species and ecological observations were
noted. Records of the occurrence of the treated taxa in other Azorean islands and in
the other Macaronesian archipelagos are given according to published data (e.g.
Vieira 1997; Carvalho et al. 1999; Vieira 2002). Species here recorded from Corvo
for the first time are marked with +, and those which are endemic to the Azores archi-
pelago are marked with *.
List of species
Family PIERIDAE
Colias crocea (Fourcroy, 1785)
CORVO: 11-13.1x.2002 — Common throughout the island, namely at Vila Nova do Corvo, the airport,
Engenhos, Forno Velho, Pico Joao de Moura, and Caldeirao. The larvae and adults of C. crocea feed on
Medicago, Trifolium, and Lotus flowers. Colias crocea is common in the Azorean islands. A single spec-
imen of var. helice Hübner, a female form in which the normal orange yellow coloration is replaced by
creamy-white, was observed at Vila Nova do Corvo, on 12.1x.2002. Colias crocea is considered a migra-
tory indigenous species in the Azores archipelago.
Pieris brassicae (Linnaeus, 1758)
*ssp. azorensis Rebel, 1917
CORVO: 11-13.1x.2002 — Larvae, pupae, and adults were very common throughout the island at low alti-
tudes, especially close to cultivated Brassicae plants (Vila Nova do Corvo). Pieris brassicae is repre-
sented in the Azores by the endemic subspecies azorensis Rebel, 1917. The larvae cause very important
economic damage to their preferred food plants (Brassica oleracea L.). However, some natural enemies
in the Hymenoptera (see Vieira 1994) certainly facilitate the biological control of both larva and pupa of
this horticultural pest. The local people call P brassicae the “bicha da couve” and “borboleta da couve”.
Family NYMPHALIDAE
Vanessa atalanta (Linnaeus, 1758)
CORVO: 12.1x.2002 — At the port of Vila Nova do Corvo two 2 atalanta larvae were feeding on
Parietaria judaica L. (Urticaceae); a pupa suspended on this hostplant was also observed. This holarctic
species is considered a migrant indigenous to the Azores archipelago.
*Hipparchia azorina (Strecker, 1899)
ssp. occidentalis (Bivar de Sousa, 1982)
CORVO: 12.ix.2002 — Caldeiräo: An old specimen flying. This Azorean endemic subspecies was
observed on the external slope of Caldeiräo (between + 600-800 m). It is not common presently on the
island. The foodplant of H. azorina larvae is Festuca jubata Lowe (Poaceae), which grows only in moun-
tainous regions.
Remarks: In order to clarify the controversial taxonomy of this Azorean taxon see, for example, Meyer
(1991a), Olivier & Coutsis (1997), Sousa (1999), Tennent & Sousa (2003), and Fujaco et al. (in press).
Family GEOMETRIDAE
Cleora fortunata Blachier, 1887
*+ssp. azorica Pinker, 1971
CORVO: 12.ix.2002 — Pico Joao de Moura: A male captured in a black light trap. Larvae feed on Myrica
faya (Myricaceae), Erica scoparia azorica (Ericaceae), Myrsine africana vat. retusa (Myrsinaceae),
Viburnum tinus subcordatum (Caprifoliaceae). Cleora fortunata 1 is an endemic species to Macaronesia,
represented in the Azores by the endemic subspecies azorica Pinker, 1971 (Pinker 1971).
Gymnoscelis rufifasciata (Haworth, 1809)
CORVO: Pico Joao de Moura: 12.ix.2002 — Two adults captured in a light trap.
Remarks: Palaearctic species recently recorded from Corvo island by O. Karsholt (Vieira, Borges,
Karsholt & Wunderlich, submitted). Recently introduced into the Azores (Sousa 1991), although it had
been previously recorded by Carthy (1957).
Nota lepid. 26 (1/2): 73-78 75
Family SPHINGIDAE
Agrius convolvuli (Linnaeus, 1758)
CORVO: 11-13.1x.2002 — Vila Nova do Corvo (Matriz and Cascalho): Larvae common on /pomoea
batatas (L.) (Covolvulaceae); 19, 69 were captured on “Boas noites” plants, i.e. Mirabilis jalapa L.
(Nyctaginaceae). Several adults flying under a streetlight at Vila Nova do Corvo. Eggs were found on /.
batatas. Larvae were attacking /. batatas, a preferred hostplant, causing serious damage.
The local people call A. convolvuli the “bicho batate”, “batato”, and “besouro”. A subtropical species
which migrates in the Azorean archipelago.
+Macroglossum stellatarum (Linnaeus, 1758)
CORVO: 12.1x.2002 — Pico Joäo de Moura: One adult flying. 13.1x.2002 — Vila Nova do Corvo (airport
gare): one adult flying. Larvae feed on Galium and Rubia plants (Rubiaceae), of which some species
exist in this island, although larvae were not seen. Palearctic diurnal migrant in the Azores .
Family NOCTUIDAE
Hypena obsitalis (Hubner, [1813])
CORVO: 11-12.1x.2002 — Vila Nova do Corvo (Caminho da Horta Funda): Two adults flying. Larvae
feed on Parietaria and Urtica plants. 12.1x.2002 — Pogo Velho: One specimen in a light trap.
Autographa gamma (Linnaeus, 1758)
CORVO: 12.1x.2002 — Vila Nova do Corvo (Matriz): One adult flying in B. oleracea culture, but not cap-
tured. 12.ix.2002 — Pico Joao de Moura: One © captured in a black light trap.
Thysanoplusia orichalcea (Fabricius, 1775)
CORVO: 11.1x.2002 — Vila Nova do Corvo: Two adults and one pupa observed on /. batatas crop.
Ctenoplusia limbirena (Guenée, 1852)
CORVO: 11-12.1x.2002 — Vila Nova do Corvo (Matriz): Two adults under streetlights. 12.1x.2002 —
Forno Velho: 4 adults captured in a light trap.
+Chrysodeixis chalcites (Esper, 1789)
CORVO: 12.1x.2002 — Vila Nova do Corvo: One adult captured under lights of EDA building.
+Helicoverpa armigera (Hübner, [1808])
CORVO: 11-13.1x.2002 — Vila Nova do Corvo: Larvae were very common in field crops of Zea mays;
some larvae found on Lycopersicum esculentum fruits; various adults flying under streetlights.
1 1—12.ix.2002 — Pico do Jodo Moura: 13 adults captured in light trap. Recently, H. armigera became an
important pest of Z. mays in the archipelago.
Galgula partita Guenée, 1852
CORVO: 11-12.1x.2002 — Pogo Velho and Vila Nova do Corvo: One adult observed each day at each site,
but they were not captured. Subtropical species, originates from the New World.
Sesamia nonagrioides (Levebvre, 1827)
Not observed in 2002, but captured in 1993 (Vieira & Tavares 1995).
Phlogophora meticulosa (Linnaeus, 1758)
CORVO: 12.1x.2002 — Pico Jodo de Moura: Three adults captured in a light trap. Larvae polyphagous on
various plants (cf. Vieira 1997).
*Mesapamea storai (Rebel, 1940)
CORVO: 12.ix.2002 — Pico Jodo de Moura: One adult captured in a light trap.
+Acantholeucania loreyi (Duponchel, 1827)
CORVO: 12.1x.2002 — Pico Joao de Moura: One adult captured in a light trap. Cosmopolitan species with
tropical to subtropical distribution.
Pseudaletia unipuncta (Haworth, 1809)
CORVO: 11-12.ix.2002 — 330°, 349, Pico Joao de Moura. Larvae and adults were generally common
throughout the island. Some larvae were observed on pasture grasses (e.g. Rebentao, Pogo Velho, Pico
Joao de Moura) and on Zea mays (e.g. Vila Nova do Corvo). At Vila Nova do Corvo adults were seen
under streetlights. Pseudaletia unipuncta is the most important economic pest of the Azorean pasture
grasses. It is considered a non-seasonal migrant species in the archipelago (Vieira 2000).
76
VIEIRA: Macrolepidoptera from Corvo, Azores
Tab 1. The Macrolepidoptera taxa recorded from Corvo in 2002 with indications of their distribution in
the Azores, and other Macaronesian archipelagoes (Madeira, Canaries, Cape Verde). Numbers and per-
centages of the taxa from Corvo in relation with other islands are given. Azores: Co = Corvo, F1 = Flores,
Gr = Graciosa, Jo = Sao Jorge, Fa = Faial, Pi = Pico, Te = Terceira, Mi = Säo Miguel, Ma = Santa Maria.
Zoogeographical distribution (Dist.): E = Endemic, P = Palearctic, H = Holarctic, T = Tropical, ST =
Subtropical, AM = Asiatic-Mediterranean, EA = Euroasiatic, ET = Ethiopian, C = Cosmopolitan. * =
Taxon endemic to the Azores, + = new records from Corvo island.
Colias crocea
Pieris brassicae azorensis*
Vanessa atalanta
Hipparchia azorina occidentalis*
Cleora fortunata azorica*+
Gymnoscelis rufifasciata
Agrius convolvuli
Macroglossum stellatarum +
Hypena obsitalis
ra
"M Ke M KK m»
~ ~ Me »
Autographa gamma
Thysanoplusia orichalcea
Ctenoplusia limbirena
~ Mm KR mM OM
M Mm mM KN
Chrysodeixis chalcites +
~ mn»
Helicoverpa armigera +
Galgula partita
Sesamia nonagrioides
"M on OK KOK OOO
~ M nm KM KK Kl lll KU UK OK
~ M nm Mh Kl Kl OOK
Phlogophora meticulosa
M nm Mr N » rn MOM
Der eM MM
~ ns »
M x»
Mesapamea storai*
Acantholeucania loreyi +
ta
“nn M rn». » » »
Pseudaletia unipuncta
Noctua pronuba
Noctua atlantica*
Xestia c-nigrum
Peridroma saucia
~ X KK »m »
Agrotis ipsilon +
Hrn Mn »m nm » » » »m on N MM »m » FF FM » MM » » » » a)
~ nn Om »m mm nm »m »M »m » »m KKK » »
pd A M Koko
Sie <a mp u D
M M mx»
Agrotis segetum
Total number of species 26.24" 20 21 725 21 23 25 23
Percentage (%) 100 52-77 81 96 81 88 96 88
Noctua pronuba (Linnaeus, 1758)
Not observed in 2002, but captured by the author in 1993 (Vieira 1994, Vieira & Tavares 1995).
*Noctua atlantica (Warren, 1905)
CORVO: 12.ix.2002 — 10°, 19, Pico Joao de Moura, captured in a light trap.
Xestia c-nigrum (Linnaeus, 1758)
CORVO: 11-12.ix.2002 — 150°, 49, Pico Joao de Moura, captured in a light trap.
Peridroma saucia (Hubner, [1808])
CORVO: 11-12.ix.2002 — 260°, 429, Pico Joao de Moura and Pogo Velho, captured in a light trap.
Cosmopolitan migrant species with neotropical origin.
+Agrotis ipsilon (Hufnagel, 1766)
CORVO: 11-12.ix.2002 — 30°, 3Q, Pico Joao de Moura and Pogo Velho. A migrant species in the Azores
with a cosmopolitan distribution.
Agrotis segetum ([Denis & Schiffermüller], 1775)
CORVO: 11-12.1x.2002 — 90°, 249, Pico Joao de Moura and Pogo Velho.
Nota lepid. 26 (1/2): 73-78 a.
Conclusions
During a short visit on Corvo island from September 11—13, 2002, a total of 26
Macrolepidoptera species were recorded, of which six are first records for the island:
Cleora fortunata azorica, Macroglossum stellatarum, Chrysodeixis chalcites,
Helicoverpa armigera, Acantholeucania loreyi, and Agrotis ipsilon, rising the total
number of Macrolepidoptera recorded from Corvo to 44 (cf. Vieira & Tavares 1995).
This is about half the number of the 60 known Macrolepidoptera species from the
Azores (Vieira 1997, 1998). None of them is endemic to Corvo or has been found
exclusively on this island (Table 1), but H. azorina occidentalis seems to be restrict-
ed to Flores and Corvo (see Sousa 1985a; Olivier & Coutsis 1997; Tennent & Sousa
2003; Fujaco et al., in press). Most taxa have been recorded on the central and east-
ern islands of the archipelago, as well as in other Macaronesian archipelagos (Table
1). The relatively low number of species recorded from Corvo might be due to insuf-
ficient collecting, as well as the small size of the island. More fieldwork needs to be
conducted for a comprehensive account on the composition of the lepidopteran fauna
of Corvo. The same holds true for other arthropod taxa, which were captured during
the field trip as well. The Microlepidoptera have been studied already and will be
reported on separately (Vieira, Borges, Karsholt & Wunderlich, submitted).
Acknowledgements
I thank Joao Greves (Presidente da Camara Municipal do Corvo) and Lubélio Mendonga (Corvo) who,
in different practical ways, contributed to the success of the fieldwork on Corvo island. I am also grate-
ful to Ole Karsholt (University of Copenhagen), Matthias Nuss (Dresden), Paulo Borges, and Luis Silva
(University of the Azores) for their comments on an earlier version of this manuscript and correction of
the English. This research was supported by funds provided by the Department of Biology and CIRN
(University of the Azores).
References
Carthy, J. D. 1957. Aspects of the fauna and flora of the Azores. XI. Lepidoptera. — Annals and Magazine
of Natural History, including Zoology, Botany and Geology (ser. 12) 10: 209-214.
Carvalho, J. P., V. Vieira & M. U. P. Carvalho 1999. Borboletas nocturnas dos Açores. — /n: Amigos dos
Acores, Ponta Delgada. 115 pp.
Drouét, H. 1861. Eléments de la faune Acoréenne. — In: J. B. Bailliere & Fils, Librairie de l’Académie
de Médecine, Paris. 245 pp.
Fujaco, A., D. Mendonga, P. A. V. Borges, M. Laimer & A. de Camara Machado (in press). Interpret
Hipparchia azorina superspecies complex taxonomy and biogeography based on mtDNA analysis. —
Biological Journal of the Linnean Society.
Godman, F. D.-C. 1870. Natural History of the Azores, Western Islands. — John Van Voorst & Paternoster
Row, London. 358 pp.
Meyer, M. 199la. Les Lépidoptéres de la région macaronésienne, I. Papilionoidea des Açores:
“Checklist” et observations en juillet-aoüt 1990 (Lepidoptera: Rhopalocera). — Linneana Belgica
13 (3): 99-116.
Meyer, M. 1991b. Les Lépidoptères de la région macaronésienne, II. Liste des Macro-Hétérocères
observés en juillet-août 1990 aux Açores (Lepidoptera: Geometridae, Sphingidae, Noctuidae). -
Linneana Belgica 13 (3): 117-134.
Olivier, A. & J. G. Coutsis 1997. A revision of the superspecies Hipparchia azorina and of the
Hipparchia aristaeus group (Nymphalidae: Satyrinae). — Nota lepidopterologica 20 (3-4): 150-192.
Pinker, R. 1971. Neue und interessante Lepidopteren aus Madeira und den Azoren mit faunistischen
Hinweisen auf die Kanaren. — Zeitschrift der wiener entomologischen Gesellschaft 54: 101-131.
Sousa, A. B. de 1985a. Duas novas subespécies de Hipparchia azorina (Lepidoptera, Satyridae) dos
Açores: H. azorina barbara n.ssp. e H. azorina minima n.ssp. respectivamente das ilhas Terceira e
Corvo. — Boletim da Sociedad portuguesa d’Entomologia (Supl. 1): 375-382.
78 VIEIRA: Macrolepidoptera from Corvo, Azores
Sousa, A. B. de 1991. Novas citaçôes de Lepidöpteros para os Açores. — Boletim da Sociedad portuguesa
d’Entomologia 133 (V-1): 1-15.
Sousa, A. B. de 1999. Catalogo dos Lepidöpteros Papilionoidea, Nymphaloidea, Lycaenoidea e Hes-peri-
oidea de Portugal (Continente, Açores, Madeira e Selvagens). — Boletim da Sociedad portuguesa
d’Entomologia 2: 1-13.
Tennent, W. J. & A. B. de Sousa 2003. Notes on Hipparchia taxa from the Azores, with the description
of a new subspecies of H. miguelensis from the island of Terceira (Lepidoptera, Nymphalidae,
Satyrinae). — Entomologist’s Gazette 54: 7—24.
Vieira, V. 1994. Contributions to the Arthropoda fauna of the Corvo island (Azores). — Arquipélago (Life
and Marine Sciences) 12A: 51-56.
Vieira, V. 1997. Lepidoptera of the Azores Islands. — Boletim do Museo Municipal de Funchal 49 (273):
5-76.
Vieira, V. 1998. Biogeografia dos Lepidöpteros (Insecta, Lepidoptera) dos Açores. — Revista Biologica,
Lisboa 16: 87-106.
Vieira, V. 2000. Comparaçôes biolögicas entre populagöes continentais e insulares de Pseudaletia
unipuncta (Haworth) (Lepidoptera: Noctuidae). Tese de Doutoramento. — Universidade dos Açores,
Ponta Delgada.166 pp.
Vieira, V. 2002. New records and observations on Macrolepidoptera (Insecta: Lepidoptera) from the
Azores islands. — Arquipelago (Life and Marine Sciences) 19A: 55-65.
Vieira, V., P. Borges, O. Karsholt & J. Wunderlich (submitted). Checklist of the Arthropoda fauna from
the Corvo island (Azores) with some new records. — Vieraea.
Vieira, V. & B. Pintureau 1991. Diversité comparée des Lépidoptères (Insecta) dans les îles des Açores.
— Arquipélago (Life and Earth Sciences) 9: 25-35.
Vieira, V. & J. Tavares 1995. A checklist of the Lepidoptera from Corvo island (Azores). — Agoreana
8 (1): 79-89.
Vives Moreno, A. 1994. Catalogo sistematico y sinonimico de los Lepidopteros de la Peninsula Iberica
y Baleares (Insecta: Lepidoptera) (Segunda Parte). - MAPA/DGSPA, Madrid. 775 pp.
Nota lepid. 26 (1/2): 79-80 79
Book Review
Cees GIELIS 2003: World catalogue of insects. Vol. 4: Pterophoroidea & Alucitoidea
(Lepidoptera). — Apollo Books, Stenstrup (Denmark), 198 pp.
ISBN 87-88757-68-4. — Price: DKK 320.00 (= approx. € 43.10) plus postage.
Systematic catalogues are essential tools for biodiversity research. Correct and up-to-
date information about the numbers of described organısms, their scientific names
and synonyms is indispensable not only for the specialist on the taxonomy or phylo-
geny of a given taxon, or the faunistics of a region. Rather, such information needs to
be available also to scientists and decision makers concerned with ecology, biogeo-
graphy, or nature conservation, to name but a few. The present volume is the fourth in
the series World catalogues of insects, and the first devoted to a taxon in the order
Lepidoptera. Authored by Cees Gielis, a renowned specialist on Pterophoridae, this
book is a most laudable addition to the entomological literature. Gielis has compiled
the first global catalogue of the two superfamilies Pterophoroidea and Alucitoidea
after 90 years. He has drawn together not only a large number of new descriptions and
synonymies that were published in scattered sources throughout the past decades, but
also incorporated results of current phylogenetic research where available. The cata-
logue is organised according to the hierarchical classification (superfamily, family,
tribe, genus). Species are listed alphabetically under the genus name with which they
are currently affiliated. For all family-group names the original reference is cited. For
genus-group names also the type species, and relevant synonyms with their type
species, are listed. Species entries are more complex and contain, besides reference to
the original description and synonyms, also information about the type locality (coun-
try), geographical distribution (by countries), hostplants and parasitoids (if known).
All species names are preserved in their original spelling, thus avoiding the problems
pertinent to the highly disputed rule about gender agreement in the /nternational
Code of Zoological Nomenclature (see M. Sommerer, 2002, Nota lepid. 25: 191-204).
The taxonomic catalogue comprises the main part of the book (112 pp) together with
the very extensive list of references (45 pp.). Five alphabetical indexes (30 pp) to par-
asitoids, hostplants, and moths (the latter separately for both superfamilies — which
may be somewhat impractical for non-specialist users) allow an easy and rapid access
to the relevant entries. I found a list of species numbers by taxonomic hierarchies
particularly useful (pp. 8-9), which gives almost consistently higher species counts
(1344 altogether) than Dugdale er al.” I have only few criticisms to this book. No
information is given as to the preservation of type specimens. Host plant data are not
‘complete’ (they admittedly will never be), but use of the web-based HOSTS database
(managed by the Natural History Museum, London) as well as extraction from print-
ed sources would have allowed for a more comprehensive presentation. There are few
typographical errors (some are in the references list, e.g. for titles in German). I found
it unfortunate that the book (in contrast to catalogues of similar scope and distributed
by the same publisher””) is not accompanied by a searchable database file on CD.
Such a file would facilitate extraction of data, for example by country, or would faci-
© Nota lepidopterologica, 30.10.2003, ISSN 0342-7536
80 Book review
litate use of the information for purposes such as collection management or inclusion
oftaxonomic updates. At a time where an ever growing number of initiatives is going
on worldwide to compile and update global inventories of organisms using web-based
information technology, it is a pity that this well researched world list of a significant
proportion of lepidopteran diversity is not (yet?) available on the internet. It is to be
hoped that this will become reality soon, or will at least be the case with forthcoming
volumes of the series. Above all, however, this catalogue is an important step towards
a global inventory of the Lepidoptera. Given its moderate price and enormous infor-
mation content it deserves a wide distribution not only among lepidopterists, but also
among scientists concerned with global biodiversity issues. Just as has happened with
other such catalogues I am convinced that within short time this work will inspire
meta-analyses for which comprehensive and taxonomically reliable information on
species numbers and presences is essential.
I Dugdale, J.S., Kristensen, N.P., Robinson, G.S. & Scoble, M.J. 1998. The smaller microlepidoptera-
grade superfamilies. Pp. 403-422 in N.P. Kristensen (Ed.), Lepidoptera, moths and butterflies.
Vol. 1: Evolution, systematics, and biogeography. Handbuch der Zoologie, Vol. IV: Arthropoda:
Insecta, part 35. Walter de Gruyter, Berlin.
. Karsholt, O. & Razowski, J. 1996. The Lepidoptera of Europe — a distributional checklist. Apollo
Books, Stenstrup. |
: Scoble, M.J. (Ed.) 1999. Geometrid moths of the world — a catalogue (Lepidoptera: Geometridae).
CSIRO Publishing, Collingwood.
KONRAD FIEDLER
NOTA LEPIDOPTEROLOGICA
A journal devoted to the study of Lepidoptera
Published by Societas Europaea Lepidopterologica
INSTRUCTIONS FOR AUTHORS
Manuscripts and all related correspondence should be sent to the editor:
Dr. Matthias Nuss, Staatliches Museum für Tierkunde, Königsbrücker Landstr. 159,
D-01109 Dresden, Germany; e-mail:
[email protected]
General. ‘Nota lepidopterologica’ is a scientific journal published by Societas Europaea
Lepidopterologica (SEL). Since SEL is a registered non-profit organization, no royalties will
be paid to authors of contributions. Papers accepted become the property of the journal.
Twenty-five reprints of each paper will normally be supplied free of charge to the first author;
additional copies may be ordered on a form enclosed with the proofs. However, no reprints
(even for charge) will be available for short communications and book reviews.
Papers submitted for publication should be original contributions to the study of palaearctic
Lepidoptera, especially on taxonomy, morphology/anatomy, phylogenetics, biogeography,
ecology and conservation. Submission of a manuscript implies that the same work has not
been published or submitted elsewhere.
Papers may be up to 15 printed pages long, or 10,000 words. For longer papers, authors are
requested to contact the editor in advance. Short communications up to 2 printed pages are
available for publication of new faunistic records, hostplant data, or similar important fin-
dings. Primary language for publication in Nota lepidopterologica is English, but papers in
German and French are also accepted. It is anticipated that authors will make every efforts to
carry out linguistic corrections before submitting the manuscript. Manuscripts requiring
extensive linguistic improvement will be returned to the author(s). Authors are asked to care-
fully observe the following guidelines. Manuscripts not conforming with these instructions or
requiring extensive editorial improvement are liable to be returned to the author(s) without fur-
ther consideration.
Preparation of text for a full paper. A manuscript should begin with (1) a Title which
should be informative and concise; all authors’ full names, home institutions with full postal
addresses, and e-mail addresses (if available); and the name, phone and fax of the author to
whom all correspondence should be addressed.
This should be followed by (2) an Abstract (an abstract in English is mandatory) not
exceeding 200 words and giving a succinct account of the subject, results and conclusions; and
a list of up to 10 Keywords. Abstracts in up to two other languages (e.g., German and French)
can also be published if provided by the authors. No abstracts are required for short commu-
nications.
The text should be clearly structured into chapters and should usually consist of (3) an
Introduction chapter; (4) a Material and Methods chapter (only Methods chapter in taxo-
nomic papers, if material is listed separately for each taxon); (5) a list of Abbreviations;
(6) one or several chapters presenting the Results (or the species (re)descriptions in taxo-
nomic papers); (7) a Discussion and/or Conclusion chapter; (8) Acknowledgements (if
desired); (9) a list of References; (10) Appendices (optional).
Contents of the chapters. The Introduction should make the article accessible to
a broad range of Lepidopterists. For taxonomic papers this means that some general informa-
tion should be provided about the taxa treated (e.g. closest relatives, current situation in the
systematic research of that group, phylogenetic and biogeographical information). In the
result(s) chapter(s), (re)descriptions of taxa should have the full name of the taxon, including
author and year of description as a heading. Species descriptions should be divided into sec-
tions ‘material’, ‘description’, ‘diagnosis’ (mandatory), ‘derivatio nominis’, and perhaps ‘life
history’, ‘distribution’, and ‘remarks’. Furthermore, the ‘description’ section should be divid-
ed into subsections, e.g. ‘measurements’, ‘coloration’, ‘head’, ‘thorax’, ‘legs’, ‘abdomen’, ‘$
genitalia’, ‘§ genitalia’. In the description and diagnosis sections, relevant characters/diffe-
rences, even if shown in the illustrations, should also explicitly be described in words. Lists of
taxa, locations, etc. that might disturb the fluency of the text might be accommodated in one
or several appendices. In the latter case, appendices should be numbered in Arabic numerals
(e.g., Appendix 1). All through the text factual evidence and interpretations or hypothetical
conclusions should be clearly separated.
Nomenclature. The first mention of any organism should include the full scientific
name with the author and the year of publication. For systematic papers authors should strict-
ly follow provisions of the current edition of the International Code of Zoological
Nomenclature and the resolution about gender agreement published by Manfred Sommerer in Nota
lepidopterologica 25 (2/3): 202. New species group taxa must be carefully distinguished from
their congeners (key and/or diagnosis); if they are compared only to members of a subordinate
species group, the latter must be diagnosed. The abbreviations gen. n., sp. n., syn. n., comb. n.
or similar have to be used to explicitly indicate all taxonomic acts. New genus group or higher
taxa are only accepted if their proposal is accompanied by explicit phylogenetic reasoning.
In line with the recent edition of the ICZN, the editors urge all authors of newly described
species-group taxa to deposit holotypes in publicly accessible collections. A clear statement
about type depositions is mandatory.
Style and format. Generally keep formatting to a minimum. Please do not use inden-
tations (e.g., for the first line of a paragraph), and do not hyphenate the text. Scientific names
of genera and species should be in italics. Authors names are not formatted in small caps. Fore
wing length should be used, not wingspan. References in the text should be cited by author and
date, e.g. Higgins (1950); (Higgins & Riley 1980a, b; Kingsolver 1978), or (Robinson & Tuck
1996). Reference to particular figures, tables, plates, or pages of cited publications should be
given as fig. 1; figs. 1-3, tab. 1; pl. 3 fig. 4; in case of pages 5, 7-9 etc. (wothout pp.); such
indications should be uniformly embedded in the references, e. g., Meier (1936: 35, pl. 7 fig. 5).
Male and female symbols have to be coded as $ and § respectively. Special characters with dia-
critic marks usually not included to the West European fonts (e.g. Slavic languages, Romanian,
Turkish, etc.) should also be coded; the codes used must be presented on a separate sheet with
a printed version of the manuscript. If special characters are used from the word processing
software, these should be taken from the font Timeless Tee. Geographic and other names in
languages where other than Latin characters are used should be given in the transliteration/
transcription (not translation!) system accepted in The Times Atlas of the World for articles in
English; the names of the local administrative subdivisions and features should also be given
as they are spelt in this atlas (international glossary and index-gazetteer sections).
In the Material section of species descriptions, type material should be listed before the
remaining material, with the latter set off by a long dash. For type specimens, the complete
label data should be quoted using single quotation marks ‘...’ for starting and terminating the
quotation of one label, a vertical line | for separating different lines of the label, angled brackets
<...> for including comments into the quotation (e.g. <sic>), and square brackets [...] for
expansions of abbreviations (e.g., Bras.[il]) and for the conversion of measurements. For non-
type specimens, localities should be given in order of increasing precision as shown in the
examples:
Material. Holotype §, ‘Turkey, Hakk.[ari] | 8 km E. of Uludere, | 1200 m, 10.vi.1984’, ‘Meier leg.’,
‘coll. MTD Drsden <sic>’, ‘Holotype | Aus beus sp. n. § | det. A. Schmidt’, MTD. — Paratypes: 7$, 38,
labelled as holotype, NHMW. — 28, 1$, Iraq, Kurdistan, Sersang, 1500 m, Higgins leg., BMNH; 1$
Kurdistan, Shaqlawa, 2500 ft, 15/24 May 1957, Higgins leg., BMNH.
In the list of references, references should be arranged in alphabetical order and must
include all and only those sources that are mentioned in the text. For journals, the full titles
should be given without any abbreviations. Please use the following examples and pay atten-
tion to the punctuation and types of dashes used:
Higgins, L. G. 1950. A descriptive catalogue of the Palaearctic Euphydryas (Lepidoptera: Rhopalocera).
— Transactions of the Royal entomological Society of London 101: 435-489.
Higgins, L. G. & N. D. Riley 1980. A field guide to the butterflies of Britain and Europe. 4th ed. —
Collins, London. 384 pp., 63 pls.
Robinson, G. S. & K. R. Tuck 1996. Describing and comparing high invertebrate diversity in tropical for-
est — a case study of small moths in Borneo. Pp. 29-42. — In: D. S. Edwards, W. E. Booth & S. C.
Choy (eds.), Tropical rainforest research — current issues. — Kluwer Academic Publishers, Dordrecht.
Illustrations. Tables and figures have to be numbered consecutively using Arabic
numerals, e.g., Tab. 1; Tab. 2 or Fig. 1, Fig. 2 etc. All tables and figures must be mentioned in
the text and should be referred to as , e.g., Fig. 1; Fig. la, b; Figs. 1-3, Figs. 1, 3; Tab. 1 etc.
The legend should start as follows: ‘Tab. 1. Title ...’ or ‘Fig. 1. Title ...” and should be self
explanatory without reference to the text. Illustrations should be instructive and produced
carefully. Line drawings, graphics and photographs must be sharp, clear, of high contrast, and
submitted in a way suitable for printing without requiring time-consuming reprocessing.
Where several photographs are to form one plate, they should be mounted on plates by the
authors only if they are of similar contrast. Otherwise, photographs should be submitted sep-
arately, so that they can be scanned individually according to contrast. Each figure should
carry on the back the author’s name and the figure number; the top should be indicated.
Figures of morphological structures should bear reference scale bars. For digitised illustra-
tions, line drawings have to be scanned at 600 dpi, colour photographs at 400 dpi, and half-
tone (grey scale) illustrations at 300 dpi, all at 100% of the final printing size.
Preparation of text for a Short Communication. The same directions as for full papers
apply, but there is no Abstract page and no appendix.
First submission. The entire manuscript, including all tables and figures, should be sub-
mitted in digital form or printout; the latter in triplicate on A4 size paper (or US-format) and
the text typed with double spacing throughout and wide margins on one side only. Always
retain one complete copy of the manuscript (including figures). In digital form, manuscripts
may be submitted on PC formatted disc/ CD or via e-mail as attached file. For text, use *.RTF
format for [BM-compatible PCs. Figures and illustrations must be submitted as separate
graphics files. Information about graphics files, their formats and the software (version) used
to generate them must be included in the cover letter. Digital images of line or colour draw-
ings, or photographs must be submitted in *.TIF format.
Review. All manuscripts will be reviewed by at least two independent referees. Based on
their reviews the editor in further consultation with the editorial board decides whether a man-
uscript will be accepted for publication. If a manuscript requires revision, final acceptance
may only be decided after a revised version of the manuscript has been received. The editors
reserves the right to make minor corrections that do not alter the author’s meaning.
Final submission. Once a manuscript is accepted for publication, the final version is
required in digital form either on floppy disk, CD or as attached file(s) via e-mail (for file for-
mats see above). If original art-work, photographic plates, colour slides or else are intended to
be used for illustrations, these should only be included with the final submission. Only origi-
nal art-work will be returned to authors, but no printouts, photographic prints, floppy disks or
CDs,. Colour plates may be printed free of charge at the discretion of the editor. Alternatively,
authors may be asked to contribute to the printing costs of colour illustrations.
For acceptable style and format please examine recent issues of the journal.
a
2“
x
er
ri + i r
#
La
be hb a)
+
Cheat ch > CRTIEN ui se
SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e.V.
Nota lepidopterologica wird den Mitgliedern der SEL zugesandt. Die Mitgliedschaft bei SEL steht
Einzelpersonen und Vereinen nach Maßgabe der Satzung offen. Der Aufnahmeantrag ist an den
Mitgliedssekretär Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgien; e-mail:
[email protected] zu richten. Das Antragsformular ist im Internet auf der Homepage der SEL
unter http://www.soceurlep.org erhältlich.
Der Mitgliedsbeitrag ist jährlich am Jahresanfang zu entrichten. Er beträgt für Einzelpersonen € 35,00
bzw. für Vereine € 45,00. Die Aufnahmegebühr beträgt € 2,50. Die Zahlung wird auf das SEL-Konto
19 56 50 507 bei der Postbank Köln (BLZ 370 100 50) erbeten. Seit dem 1. Juli 2003 gibt es einen neuen,
(preiswerteren) Weg für Geldüberweisungen innerhalb der EU. Die neuen Standardformulare erfordern
eine International Bank Account Number (IBAN) und einen Bank Identifier Code (BIC). Für das SEL
Postbankkonto ist die IBAN DE63 3701 0050 0195 6505 07 und die BIC lautet PBNKDEFF.
Mitteilungen ın Beitragsangelegenheiten sind an den Schatzmeister Manfred Sommerer, Volpinistr. 72,
D-80638 München; e-mail:
[email protected] zu richten.
Der Verkauf von Einzelheften und älteren Jahrgängen von Nota lepidopterologica sowie der Verkauf der
Zeitschrift an Nichtmitglieder erfolgt durch Apollo-Books, Kirkeby Sand 19, DK-5771 Stenstrup,
Dänemark; e-mail:
[email protected].
Adressenänderungen bitte sofort dem Mitgliedssekretär oder dem Schatzmeister mitteilen!
Nota lepidopterologica is sent to the members of SEL. The membership is open to individuals and
associations as provided for by the statutes of SEL. Applications for membership are to be addressed to
the Membership Secretary Willy ©. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgium; e-mail:
[email protected]. The application form will be found on the SEL homepage
http://www.soceurlep.org.
The annual subscription is to be paid at the beginning of the year. It is € 35.00 for individuals or € 45.00
for associations. The admission fee is € 2.50. Payments requested to SEL account no. 19 56 50 507 at
Postbank Köln [Cologne] (bank code 370 100 50). From July Ist, 2003, a new (cheaper) way of money
transfer within the EU will be available. The new standard forms require the International Bank Account
Number (IBAN) and the Bank Identifier Code (BIC). For the SEL Postbank account, the IBAN is
DE63 3701 0050 0195 6505 07, and the BIC is PBNKDEFF.
Back numbers of Nota lepidopterologica may be obtained from, and orders of Nota lepidopterologica
from non-members are serviced by Apollo-Books, Kirkeby Sand 19, DK-5771 Stenstrup, Denmark;
Changes of addresses should be immediately communicated to the Membership Secretary or the Treasurer.
Nota lepidopterologica est envoyé aux membres de la SEL. Vaffiliation est possible, pour les personnes
individuelles aussi bien que pour les associations, en accord avec les statuts de la SEL. Les demandes
d’affiliation doivent étre adressées au Secrétaire des Membres Willy O. de Prins, Nieuwe Donk 50,
B-2100 Antwerpen, Belgique; courriel:
[email protected] .
Le formulaire d’ affiliation est disponible par le biais de la page web de la SEL http://www.soceurlep.org.
La contribution annuelle est payable au début de l’année. Elle est de € 35,00 pour les personnes indi-
viduelles et de € 45,00 pour les associations. Les frais d’admission s'élèvent à € 2,50. Les payements
doivent étre effectués sur le compte SEL n° 19 56 50 507 aupres de la Postbank Köln [Cologne] (code
bancaire 370 100 50). Les nouveaux formulaires requierent le Numero de compte banquaire international
(NCBI) et le Code identificateur de banque (C}B). Pour le compte postal de la SEL, le NCBI est DE63
3701 0050 0195 6505 07 et le CIB est PBNKDEFF.
Pour toute question en rapport a la souscription ou aux payements, veuillez contacter le Tresorier,
Manfred Sommerer, Volpinistr. 72, D-80638 Munich; courriel:
[email protected].
Les anciens volumes de Nota lepidopterologica peuvent être obtenus et les commandes concernant cette
revue de la part de non-membres effectuées auprès de Apollo-Books, Kirkeby Sand 19, DK-5771
Stenstrup, Danemark; courriel:
[email protected].
Tout changement d’adresse doit être communiqué immédiatement soit auprès du Secrétaire des Mem-
bres, soit auprés du Trésorier.
NOTA
LEPIDOPTEROLOGICA
A journal devoted to the study of Lepidoptera
Published by Societas Europaea Lepidopterologica (SEL)
Vol. 26 No. 3/4 2003
SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e.V.
http://www.soceurlep.org
HONORARY MEMBERS
Pamela Gilbert (GB), Barry Goater (GB), Prof. Dr Laszlo Gozmäny (H), Prof. Dr
Vladimir Kuznetzov (RU), Prof. Dr Clas M. Naumann (D), Dr P. Sigbert Wagener (D)
COUNCIL
President: Prof. Dr Niels P. Kristensen (DK)
Vice-President: Dr David Agassiz (UK)
General Secretary: - Dr Christoph Hauser (D)
Treasurer: | Manfred Sommerer (D)
Membership Secretary: Will O. de Prins (B)
Ordinary Council Members: Dr Bernard Landry (CH), Dr Elisenda Olivella (E),
Dr Läszlö Ronkay (H), Dr Gerhard Tarmann (A),
Dr Alberto Zilli (1),
Editor: Dr Matthias Nuss (D)
© Societas Europaea Lepidopterologica (SEL)
ISSN 0342-7536
Type setting: Markward Fischer (Dresden)
Printed by Lausitzer Druck- und Verlagshaus GmbH, Bautzen
All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or
mechanical including photocopying, recording or any other information storage and retrieval system, without written -
permission from the publisher. Authors are responsible for the contents of their papers.
Nota lepidopterologica
A journal devoted to the study of Lepidoptera
Published by the Societas Europaea Lepidopterologica e.V.
Volume 26 No. 3/4 Dresden, 31.01.2004 ISSN 0342-7536
Editor
Dr Matthias Nuss, Staatliches Museum fuer Tierkunde Dresden,
Koenigsbruecker Landstr. 159, D-01109 Dresden;
Editorial Board
Dr Enrique Garcia-Barros (Madrid, E), Dr Roger L. H. Dennis (Wilmslow, UK),
Dr Peter Huemer (Innsbruck, A), Ole Karsholt (Copenhagen, DK), Dr Bernard Landry (Geneve, CH),
Dr Yuri P. Nekrutenko (Kiev, UA), Dr Erik van Nieukerken (Leiden, NL),
Dr Wolfgang Speidel (Bonn, D)
Contents
LEIF AARVIK & KAI BERGGREN
Description of Elachista tanaella sp. n. (Elachistidae) from Arctic Norway ..... 83
TOMASZ BARAN
Scythris buszkoi sp. n., a new species of Scythrididae from Europe
TL RER RE EE 7 ARS SERA A 9 CR 89
DuBI BENYAMINI
Lythrum salicaria (Lythraceae) — a confirmed summer hostplant
of Leptotes pirithous in Israel (Lycaenidae: Polyommatinae) .................... 99
JAAN VIIDALEPP & AXEL HAUSMANN
Two new European geometrid moths: Xanthorhoe skoui sp. n.
mae aninorhoe friedrichi sp. n. (Geometridae) 103
MICHAEL A. KURZ, MARION E. KURZ & HANS CHRISTOF ZELLER-LUKASHORT
A new Micropterix species from southern France (Micropterigidae) ............. 111
MIKHAIL V. KOZLOV
Annotated checklist of the European species of Nemophora (Adelidae) ......... 133
AXEL HAUSMANN & STEFAN DOTTERL
Nectar plants and larval food-plants of the genus Glossotrophia
(Geometridae, Sterrhinae): studies on pollen grains attached to
MUSCUNY SPECIMENS tee23hs cae. iin aan aad et SPP 127
FRANS CUPEDO
Geographische Variabilitat und spatglaziale Einwanderungswege von
Erebia pluto (de Prunner, 1798) in der Ortlergruppe und den Otztaler Alpen
(Nymphalidae) us htm EEE 137
PIETRO PASSERIN D’ENTREVES & ANGELA ROGGERO
Four new species, a new synonymy and some new records of
Scythris Hübner, [1825] (Gelechioidea: Scythrididae) ................................... 153
Book Review ..........00.2 een nue oaeocu cn 88
Nota lepid. 26 (3/4): 83-87 83
Description of Elachista tanaella sp. n. (Elachistidae) from
Arctic Norway
LEIF AARVIK! & KAI BERGGREN”
' Zoological Museum, University of Oslo, P. ©. Box 1172 Blindern, NO-0318 Oslo, Norway; e-mail:
? Brävann terrasse 21, NO-4624 Kristiansand, Norway
Abstract. Elachista tanaella sp. n. is described from northernmost Norway. It differs from other
Elachista species of the region by plain grey forewings, distally wide valvae with large hump in the male
genitalia and in the female genitalia by a long tube-like colliculum gradually widening into the antrum.
The habitat are bogs just above the timberline dominated by Carex rotundata.
Key words. Lepidoptera, Elachistidae, Elachista, new species, Norway.
Introduction
The North European fauna of the micro-moth family Elachistidae s. str. is well docu-
mented (Traugott-Olsen & Nielsen 1977). The family is richly represented in the
region, and since 1974 nine new species have been described from northernmost
Fennoscandia (Traugott-Olsen 1974; Svensson 1976; Bengtsson 1977; Traugott-
Olsen & Nielsen 1977; Kyrki & Karvonen 1985; Kaila & Kerppola 1992; Kaila
1998). These discoveries result from rather intensive collecting. Every summer lepi-
dopterists visit northern Fennoscandia. In spite of this, single species may escape dis-
covery for a long time because of local occurrence and strong variation in abundance
from year to year. Populations may be low for many seasons, before suddenly in one
year there is a peak. Arctic species, in particular, have the ability to survive in low
numbers through several unfavourable seasons.
In 2002 the authors collected an unknown Elachista species in two localities in
Finnmark in Arctic Norway. Both sexes were found in reasonable numbers and were
compared with descriptions in the literature of other Elachista species. The North
Palaearctic species have been treated by Traugott-Olsen & Nielsen (1977) and Sinev
& Sruoga (1997), and the Nearctic fauna has been dealt with by Kaila (1999). In addi-
tion to the shorter papers mentioned, the following papers containing descriptions of
a few or single species were checked: Kaila (1992), Albrecht & Kaila (1994) and
Kaila & Jalava (1994).
Abbreviations
KBE - coll. K. Berggren, Kristiansand, Norway; LAA - coll. L. Aarvik, As, Norway; ZMO - Zoological
Museum, University of Oslo, Norway; ZMUH — Zoological Museum, University of Helsinki, Finland.
© Nota lepidopterologica, 31.01.2004, ISSN 0342-7536
84 AARVIK & BERGGREN: Elachista tanaella sp. n. from Arctic Norway
Fig. 1. Elachista tanaella sp. n., adult male (wingspan 11 mm).
Elachista tanaella sp. n.
Material. Holotype ©, Norway, FN Tana: Faccabæljäkka (UTM 35WNU 722 198, EIS 184) 270 m,
15.vii.2002, Aarvik leg. (genitalia slide ZMO 1188) ZMO. — 26 Paratypes: 10 19 same data as holotype
(genitalia slides ZMO 1189, 1190); 10° same data, but ZMUH; 20°19 same data, but coll. Aarvik; 60°
same data, but leg. & coll. Berggren; 30°19 same data, but 14.vii.2002, Aarvik leg. & coll.; 50° Norway,
FN Tana: Ifjordfjellet, Ammunjavrit (UTM 35WNU 2113, EIS 183) 350 m, 15.v1i.2002, Berggren leg.
& coll.; 10° same data, Aarvik leg. & coll.; 202Q same data (genitalia slides 19 LAA 2646, coll.
Aarvik, 2019 KBE 4561, 4604, 4592 coll. Berggren).
Description of imago (Fig. 1). Wingspan 8.5-11.5 mm. Head brownish
grey, posterior scales of neck tufts lighter, almost white; labial palpus and antenna
grey, scape with some light scales. Thorax brownish grey, with some lighter dark-
tipped scales, tegulae posteriorly with light scales, some of them dark-tipped.
Abdomen brownish grey, anal tuft yellowish grey in male, ochreous in female.
Forewing unicolorous brownish grey, at higher magnification appearing mottled
because scales are basally light and have dark tips. Cilia light grey, basally light and
with ochreous sheen. Hindwing grey, with grey cilia which are basally light.
Abdominal sternites are sclerotized in both sexes, and males have the anterior margin
of tergites 5—7 strongly sclerotized.
Male genitalia (Fig. 2). Uncus lobes longer than wide, wide apart; gnathos
almost circular; valva becoming wider distally, costa with well developed hump,
cucullus rounded ventrally, sacculus with weak distal spine; digitate process rather
narrow; juxta lobes ventrally setose, with rounded edge, laterally produced; aedeagus
straight, no cornuti.
Female genitalia (Figs. 3a, 3b, 4a, 4b). Papillae anales longer than wide;
ostium bursae wide; dorsal wall of antrum with spinules; colliculum gradually wide-
ning into antrum, length of colliculum exceeding length of sternum 7; ductus seminalis
inserted in anterior end of colliculum, basally bulbous; small sclerotized tooth
Nota lepid. 26 (3/4): 83-87 85
Figs. 24. Genitalia of Elachista tanaella sp. n.: 2. Male genitalia, slide KBE 4604. 3-4. Female geni-
talia. 3a, 4a: Posterior part of female genitalia; 3b, 4b: Corpus bursae and ductus bursae (3a, 3b: slide
KBE 4592; 4a, 4b: slide ZMO 1190).
86 AARVIK & BERGGREN: Elachista tanaella sp. n. from Arctic Norway
Fig. 5. Type locality of Elachista tanaella sp. n., North Norway, Tana: Faccabæljäkka.
present in ductus bursae near insertion point of ductus seminalis; corpus bursae
longer than wide; signum an elongate dentate plate, widest in middle. There is great
variation in the length of the apophyses anteriores. In three dissected females the ratios
of the length of the apophyses posteriores and the length of the apophyses anteriores
are 0.9, 1.6 and 1.9. The ratio for each specimen is the mean value of the ratio of the
left and the ratio of the right pair of apophyses. Figs. 3a and 4a show the extremes.
Habitat. Both localities, situated just above the timberline, are wet bogs domi-
nated by Carex rotundata Wahlenberg. Some Eriophorum angustifolium Honckeny
also grow in the bogs. Salix glauca Linnaeus grows in patches inside the bogs and also
around them. Not a single specimen was observed flying. The specimens were all
swept from Carex rotundata. We believe that this represents the foodplant. At least
one related species in the bifasciella complex (see below) uses Carex as foodplant,
E. alpinella Stainton, 1854 (Traugott-Olsen & Nielsen 1977). E. kilmunella Stainton,
1854, also belonging to the bifasciella complex, feeds on Eriophorum (Kaila 1999).
Remarks. Elachista tanaella sp. n. is easily distinguished from most other
North European species of the genus due to its plain grey forewings. At first the uni-
colorous grey moths were thought to belong to some Scythris species which typically
have unmarked blackish or greyish forewings. Elachista pigerella (Herrich-Schaffer,
1854) from Central and South Europe is a brownish, unicolorous species in the
tetragonella-group. The male of Elachista lastrella Chrétien, 1896, distributed in
Central Europe, also has grey forewings, but they are much narrower than in E.
tanaella. E. lastrella belongs to the bifasciella-group, as does E. tanaella, but in a dif-
ferent subgroup, the cerusella-subgroup (Traugott-Olsen & Nielsen 1977). Both E.
pigerella and E. lastrella have genitalia that differ strongly from those of E. tanaella
Nota lepid. 26 (3/4): 83-87 87
(cf. illustrations in Traugott-Olsen & Nielsen 1977). The external appearance and the
genitalia of E. tanaella are distinct, and there are no other Elachista species known
from Arctic Fennoscandia that could be confused with it.
Elachista tanaella belongs to the bifasciella-subgroup of the bifasciella-group
(Traugott-Olsen & Nielsen 1977). According to Kaila’s (1999) classification of the
North-American species, it seems to fit in his Elachista bifasciella complex (which is
somewhat different from the concept of Traugott-Olsen & Nielsen 1977). In particu-
lar the long, tubular colliculum in the female genitalia speaks for the inclusion in this
complex. However, E. tanaella has male antennae with short visible cilia, and this
character contradicts placement in the bifasciella complex. We believe that E. tanael-
la has an isolated position within this complex, and with the present knowledge it is
not possible to state which species are the closest relatives of E. tanaella. In the male
genitalia the distally widened cucullus with large costal hump, and in the female gen-
italia the wide ostium bursae, combined with the long colliculum gradually widening
into the antrum, are unique characters among North European Elachistidae.
Acknowledgements
We thank Mr. Stein-Rune Karlsen, Tromsg, for the identification of some of the plants growing at the
locality Faccabæljäkka. We are also grateful to Dr. Lauri Kaila, Helsinki, for confirming that the species
described here has not been named before. Special thanks are due to Ms. Nini Cecilie Aarvik, As, for
performing the water colour painting for the present article. Mr. Lars Ove Hansen, Oslo, is thanked for
technical assistance. We also thank Dr. Erik J. van Nieukerken, Leiden, and an anonymous referee for
constructive comments to the manuscript.
References
Albrecht, A. & L. Kaila 1994. Elachista fuscofrontella Sruoga (Lepidoptera, Elachistidae) from Estonia,
new to Europe, with description of the female. — Entomologica Fennica 5: 35-37.
Bengtson, B. Ä. 1977. Two new species of Microplepidoptera from northern Sweden (Lepidoptera:
Elachistidae, Scythrididae). — Entomologica Scandinavica 8: 55-58.
Kaila, L. 1992. The Elachistidae of southern Siberia and Central Asia, with descriptions of five new
species (Lepidoptera). — Entomologica Fennica 3: 177-194.
Kaila, L. 1998. Two new Elachista species (Lepidoptera, Elachistidae) from the Polar Urals region,
Russia. — Entomologica Fennica 8: 219-223.
Kaila, L. 1999. A revision of the Nearctic species of the genus Elachista s. I. III. The bifasciella, prae-
lineata, saccharella and freyerella groups (Lepidoptera, Elachistidae). - Acta Zoologica Fennica 211:
1-235.
Kaila, L. & J. Jalava 1994. Elachista adelpha sp. n., E. coeneni titanella ssp.n, and other Elachistidae
(Lepidoptera) from North Caucasus. — Entomologica Fennica 5: 97-102.
Kaila, L. & S. Kerppola 1992. Elachista leifi sp. n. from northern Finland (Lepidoptera, Elachistidae).
Entomologica Fennica 3: 155-158.
Kyrki, J. & J. Karvonen 1985. Elachista eskoi sp. n., a new species of Elachistidae from Finland
(Lepidoptera). — Entomologica Scandinavica 15: 521-525.
Sinev, S. Yu. & V. Sruoga 1997. Elachistidae. — /n: P. A. Lera (ed.): Key to the insects of Russian Far
East 5. Trichoptera and Lepidoptera (1): 491-502. [In Russian]
Svensson, I. 1976. Six new species of Microlepidoptera from northern Europe. — Entomologica
Scandinavica 7: 195-206.
Traugott-Olsen, E. 1974. Descriptions of three new Elachista species, and nomenclatural remarks on
other species of the genus (Lep., Elachistidae). - Entomologist’s Gazette 25: 259-268.
Traugott-Olsen, E. & E. S. Nielsen 1977. The Elachistidae (Lepidoptera) of Fennoscandia and Denmark.
— Fauna Entomologica Scandinavica 6: 1-299.
88 Book review
Book Review
Koster, S. & S. Y. Sinev 2003. Momphidae, Batrachedridae, Stathmopodidae,
Agonoxenidae, Cosmopterigidae, Chrysopeleiidae. — Jn: P. Huemer, O. Karsholt & L.
Lyneborg (eds.), Microlepidoptera of Europe 5. — 387 pp. — Apollo Books, Stenstrup. — ISBN
87 88757 66 8. — Available from the publisher for DKK 720.00 (excl. postage).
The recently published volume five of ‘Microlepidoptera of Europe’ treats six families of the
Gelechioidea, the Momphidae, Batrachedridae, Stathmopodidae, Agonoxenidae, Cosmopterigidae,
and Chrysopeleiidae. 163 species of 37 genera from Europe, northern Africa and the Near
East are included. The book starts with an introduction, which includes, among others (e.g.
collecting methods, genitalia preparation), a survey of the history of the systematics of the six
families. Because the phylogenetic relationships of these taxa have remained insufficiently
resolved, the authors still follow ‘old traditions in taxonomy of narrow-winged moths’. An
overview of all names and synonyms is given in a checklist, completing the introductory part.
The systematic part follows, arranged by family. Each family chapter starts with a general
part, giving a description of the morphology and life history, information about the distribution
and systematics as well as illustrations of typical morphological features of the head, wing
venation, and male and female genitalia. The systematic treatment of the genera, subgenera
and species of each family gives for each taxon full nomenclatural information and pithy
descriptions of the morphology, distribution, and life history. The latter is supported by
text-figures illustrating the infested leaves of the mining larvae. The systematic treatment is
followed by a distribution catalogue, which lists the occurrence of each species by country.
The 15 plates of watercolours showing the adults were produced by Sjaak Koster. These
figures are an eye-catcher of the book, with each moth a painted masterpiece. The water-
colours are so detailed to allow identification of most of the species just by looking at the wing
pattern elements. Nevertheless, looking at the genitalia remains essential if in doubt, especially
among very similar species, and in case of worn specimens. Male and female genitalia are
illustrated on 123 black & white plates with line drawings, arrows indicating characteristic
structures for distinction of very similar species. The book is closed with a list of references,
indices to generic names, species names and host-plant names. The interpretations of phylo-
genetic relationships at gelechioid family level need some comments, because these are some-
times dubious. As an example, two autapomorphies are mentioned for Batrachedridae (p. 51):
“wings extremely narrow with reduced venation, and resting position very peculiar.” However,
it is not specified which reduction is regarded as derived and the resting position is neither
described nor illustrated. Moreover, “scanty of species and absence of evident geographic
centres of diversity” are no circumstances providing phylogenetic evidence and cannot (!)
“speak in favour of the viewpoint that the family represents a small advanced group of
gelechiod moths with some very peculiar characters” (p. 51-52). Descriptions like an “archaic
larval life style” (for Stathmopodidae, p. 60) rather implicate that the authors reflect intuitive
thoughts. Since phylogenetic interpretations are not an urgent need for a field guide, it is
unfortunate that such wordings have been included in this otherwise very good book.
Microlepidoptera of Europe 5 is easy to use, full of information for those who want to
identify species, study their life history or even find information for a cladistic analysis. It is
made for collectors, students and scientists, and those who just love nature. This is a book
which shouldn’t be missing in any library about European Lepidoptera.
MATTHIAS NUSS
Nota lepid. 26 (3/4): 89-98 89
Scythris buszkoi sp. n., a new species of Scythrididae from
Europe (Gelechioidea)
TOMASZ BARAN
Institute of Biology and Environmental Protection, University of Rzeszow, Rejtana 16C,
35-310 Rzeszöw, Poland. E-mail:
[email protected]
Abstract. Scythris buszkoi sp. n. is described from material collected in south-western Ukraine. The
species was found at two different localities: Kam’janec’-Podil’s’kyj (Khmelnytsky oblast) and Tovste
(Ternopil oblast). Almost half of the type material was reared from larvae mining the leaves of Lycium
barbarum L. (Solanaceae). The imago, male and female genitalia, as well as pupa and last instar larva
are described and illustrated. Notes on the life history are also given. Some larval characters of phylo-
genetic importance are discussed.
Key words. Lepidoptera, Scythrididae, Scythris buszkoi, new species, immature stages, morphology,
Ukraine, Europe.
Introduction
The family Scythrididae comprises small or medium sized, teardrop-shaped moths,
frequently diurnal, dark-coloured, and cryptic in mode of life. The family is world-
wide in distribution, and most members of Scythrididae live in various types of
xerothermic habitats.
The Scythrididae fauna of Europe is at present fairly well investigated. The results
from research carried out mainly by two lepidopterists: Bengt A. Bengtsson (Sweden)
and Pietro Passerin d’Entreves (Italy). Apart from many descriptive and faunistic arti-
cles, two of their achievements are especially worth mentioning. One is the first com-
prehensive monograph dealing with scythridid moths of Europe and North Africa
(Bengtsson 1997), while the other is a list and summary of the distribution of all
European species of the family (Passerin d’Entréves 1996). As yet, these publications
are the most important contributions to our knowledge on Scythrididae of the conti-
nent. Nevertheless, the accumulated knowledge on scythridid preimaginal stages and
larval life cycles is still rudimental, most likely because the immature stages are
extremely difficult to find. This is a pity because there is no doubt that larvae, partic-
ularly, could provide many valuable features useful for solving some phylogenetic
problems in the family. Although over the last decades Scythrididae were intensely
investigated in Europe, some regions were explored less thoroughly; especially in
eastern areas. Thus there is still a possibility of discovering new species belonging to
this family in some parts of Europe.
In the present paper, a new scythridid species is described under the name of
Scythris buszkoi sp. n., on the basis of material coming from south-western Ukraine.
The rich material, collected by Professor J. Buszko, allows the description of adults
and preimaginal stages. Furthermore, information on bionomics is also provided.
© Nota lepidopterologica, 31.01.2004, ISSN 0342-7536
90 BARAN: A new Scythris species from Europe
Fig. 1. Scythris buszkoi sp. n., holotype.
Material and methods
The type material comprises 12 specimens: four moths were reared from larvae
feeding on Lycium barbarum, two specimens emerged from the pupal stage, and
6 adults were caught with a net. The research on morphology of preimaginal stages
was based on 3 caterpillars and 5 pupae. All study material was collected in
Kam’ janec’-Podil’s’kyj (11.vii.2002) and Tovste (= Tolstoye) at the Seret River
(12.v11.2002) in SW Ukraine.
The holotype is preserved in the Zoologische Staatssammlung, Munich, Germany
(ZSM) while the paratypes are deposited in Zoologisk Museum, Copenhagen,
Denmark (ZMUC), ZSM, as well as in the collections of the author (Poland) (TBA)
and Bengt A. Bengtsson (Sweden) (BAB).
The terminology of the male and female genitalia follows Landry (1991), the one
relating to larval morphology is according to Baran (1999, 2002), Hasenfuss (1980),
Hinton (1946), and the terms of pupal structures follow Patoëka (1997).
Scythris buszkoi sp. n.
Material. Holotype (Fig. 1): © Ukraine, Khmelnytsky oblast, Kam’janec’-Podil’s’kyj, e.l. 29.vii.2002
(larva on Lycium barbarum), Buszko leg. (ZSM). — Paratypes: 40°, 2Q Ukraine, Khmelnytsky oblast,
Kam’janec’-Podil’s’kyj, 10.vii.2002, Buszko leg; 20° Ukraine, Khmelnytsky oblast, Kam’janec’-
Podil’s’kyj, e.p. 15.vii.2002, Buszko leg.; 2Q Ukraine, Khmelnytsky oblast, Kam’janec’-Podil’s’kyj, e.l.
6.viii.2002 (larvae on Lycium barbarum), Buszko leg.; 1Q Ukraine, Ternopil oblast, Tovste at the Seret
River, e.l. 10.ix.2002 (larvae on Lycium barbarum), Buszko leg. (ZMUC, ZSM, TBA, BAB). Genitalia
slides: T. Baran, prep. No: 102, 103, 104.
Nota lepid. 26 (3/4): 89-98 91
Description of imago (Fig. 1). Wingspan: 11.4-13.4 mm. Head dark olive
brown mixed with ochreous brown and beige scales. Neck tuft ochreous brown.
Haustellum base covered with whitish and beige scales. First segment of labial palpus
white or white mixed with beige; basal half and dorsal surface of second and third
segments covered with ochreous brown, beige or whitish scales, ventral surface of
terminal parts dark brownish; sometimes third article dark brownish ventrally, and
ochreous brown to beige dorsally. Antenna filiform, extended to about two-thirds of
forewing length; scape, pedicel and segments of flagellum dark olive brown dorsally,
ochreous brown to beige ventrally (occasionally, on ventral surface whitish scales also
present); pecten of scape pale brown. Collar, tegula and dorsal part of thorax dark
olive brown with some ochreous brown scales (sometimes tegula and collar almost
entirely ochreous brown); ventral surface of thorax covered with whitish and beige
scales. Legs olive brownish strongly mixed with ochreous scales on dorsal parts, and
ochreous, beige and whitish scales on ventral ones; hind tibia also with long, whitish
and ochreous hairlike scales. Forewing rather elongate-lanceolate. Forewing upper
surface dark olive brown, somewhat glossy, densely covered with ochreous brown
scales, and also mottled by dark brown or blackish brown scales forming more or less
indistinct markings; dark pattern variable, most often consisting of irregular suffu-
sions at dorsum (in basal half) and apical area, a few elongate spots just beneath fold
(sometimes dark scales also scattered above), and near tornus; cilia dark olive brown.
Forewing ventral surface entirely dark brown or dark brown with whitish or beige
scales forming lines along some veins. Hindwing narrowly lanceolate, with both sur-
faces dark brown or ventral surface dark brown with whitish or beige scales at basal
part and along costa; cilia coloured like those of forewing. Male abdomen dorsally
brownish with grey tinge, ventral side covered with numerous whitish, beige and
ochreous scales; anal tuft comparatively short and thick, ochreous. Female abdomen
coloured as in male's, but dorsal side entirely brownish with grey tinge, 1.e. without
ochreous anal tuft; papillae anales somewhat protruding.
Male genitalia (Figs. 2-4). Tegumen in ventral aspect conical, rounded dis-
tally, with two long and wide lateral arms fused to ventral part at about half of tegu-
men length; in dorsal aspect, anterior margin with deep and narrow V-shaped emar-
gination. Uncus well developed, hood-like, in ventral aspect more or less rectangular
in outline, with rounded and setose lateral parts, shallow median depression at apex,
and wide basal concavity; central part darkly melanized; in lateral aspect a distinct
incision on ventral edge. Base of gnathos a semicircular band; distal arm rather long,
very darkly sclerotized; the arm in ventral aspect tapered, truncated at tip; in lateral
aspect hooked apically, with small protrusion on dorsal side. Vinculum more or less a
U-shaped plate extended caudally beneath basal part of valvae; median part with
longitudinal incision. Valva broadened at about basal one-third; the remaining part
narrow, slightly tapered, and strongly curved inwardly; inner wall setose; apex
rounded with a few long and stout spines. Aedeagus distinctly shorter than valvae,
strongly sigmoid; swollen near base, bulb-shaped, the remaining portion narrow,
92 BARAN: A new Scythris species from Europe
Figs. 2-4. Male genitalia of Scythris buszkoi sp. n., paratype. 2. Complex of tegumen-uncus-gnathos-
vinculum-valvae-aedeagus-sternum 8, ventral view (scale bar 0.5 mm). 3. Complex of tegumen-uncus-
gnathos, lateral view. 4. Tergum 8, ventral view (scale bar 0.5 mm). ~
tubular, somewhat tapered. Tergum 8 a slender, arched sclerite. Sternum 8 sub-
quadrate, anteriorly with wide V-shaped emargination, posteriorly with two lateral
projections, each equipped with big, terminal spine.
Female genitalia (Figs. 5-7). Sterigma undeveloped. Ostium bursae funnel
shaped, situated medially in anterior half of segment VIII. Ductus bursae membra-
nous; the most posterior, short (about half length of anterior apophyses) portion with
thickened and transversely wrinkled walls, strongly broadened just before ostium bur-
sae; inception at posterior end of more or less ovoid corpus bursae. Segment VIII well
sclerotized, except for narrow, longitudinal area on tergal side, and U-shaped,
depressed, strongly wrinkled region on sternal side; posterior margin setose. Sternum
8 with median plate in posterior half of segment VIII; distal part of the plate (a frag-
ment projected out of posterior margin of the segment) conical, proximal part (a frag-
ment placed on the segment) rectangular with rounded anterior margin. Anterior
apophyses almost straight, shorter than sclerotized part of segment VIII. Posterior
apophyses thin and long (about 4 x length of anterior ones). Papillae anales tapered.
Sternum 7 trapezoid with more or less rounded posterior margin; distal part (about
one third of the sternum length) protruding from posterior margin of segment VII.
Nota lepid. 26 (3/4): 89-98 93
Figs. 5—7. Female genitalia of Scythris buszkoi sp. n., paratype: 5. General aspect without corpus
bursae. 6. Corpus bursae. 7. Sternum VII (scale bar 0.5 mm).
Last instar larva (Fig. 8). Body length: 7-8.5 mm, head capsule width:
0.76-0.84 mm. Head capsule dirty yellow orange with extensive, postero-lateral, dark
brown or blackish brown spots; narrow areas next to adfrontals whitish; ocellar
regions black. Prothoracic shield dirty yellow orange with narrow, white dorsal line
and big, postero-lateral blackish brown spots (at posterior margin of the shield, spots
reach dorsal line). Anal shield weakly sclerotized, as blackish brown spots (some-
times, spots only around pinacula of setae). Body cocoa brown, but areas between
subdorsal and lateral lines, as well as lateral and supraspiracular ones darker. Lines
creamy white; dorsal and ventral lines extended from thoracic segment I to abdomi-
nal segment IX, the remaining ones extended from thoracic segment II to abdominal
segment IX; on 9th abdominal segment lines less distinct. Dorsal and subdorsal lines
almost unbroken, with somewhat irregular edges, lateral ones rather indistinct, as
irregular spots, supraspiracular ones distinct, with very irregular edges, subspiracular
ones wide, with almost smooth edges, ventral line very broad. Pinacula blackish
brown. Thoracic legs dark brown in outer parts, whitish in inner ones. Chaetotaxy
(Figs. 9-11); thorax, segment I: XD1, XD2 vertically located; SD1 somewhat poste-
rior to XD2; anterior and lateral parts, as well as posterior half of prothoracic plate
94
BARAN: A new Scythris species from Europe
Figs. 8-12. Features of preimaginal stages of Scythris buszkoi sp. n. 8. Mature larva, habitus, dorsal view
(scale bar = 1 mm). 9. Larval chaetotaxy, last instar, thoracic segments I-IIT, abdominal segments I-IX. 10.
Larval prothoracic plate. 11. Larval anal plate (scale bar 0.5 mm). 12. Pupa, ventral view (scale bar 1 mm).
with secondary setae. L1, L2, L3 almost in vertical line; pinaculum of L group weak-
ly sclerotized. SV group (SV1-2) with 1-2 secondary setae on pinaculum. Seta V1
minute. Segments II-III: pinacula of D, SD, SV groups, and pinaculum of L1 and L2
with secondary setae (L3 on separate pinaculum). V1 distinctly longer than the one of
previous segment. Abdomen, segment I: Pinacula of D1, D2, L3, V1, and SV group
Nota lepid. 26 (3/4): 89-98 95
(SV1-3) with secondary setae. L2 dorsal to L1, on common pinaculum. Anterior and
slightly dorsal to L3 there is one separate group of secondary setae; the group con-
sists of 2 setae. SD2 (minute seta) adjacent to dorsal part of the basal ring of SD1;
apodeme directed ventrally; SD group surrounded by extra ring. L2 relatively long.
Segment II: arrangement of setae similar to abdominal segment I, except for: SD2
adjacent to anterior part of the basal ring of SD1, extra ring somewhat smaller,
apodeme directed more or less posteriorly; SV group and L3 usually with more
numerous secondary setae on pinacula. Segments III-VI: arrangement of D, SD, and
L groups as on abdominal segment II. Pinaculum of the separate group with 1-3 se-
condary setae. Pinaculum of SV group sickle-shaped, with numerous secondary setae.
V1 shorter than in previous abdominal segments, with 1—2 secondary setae. Segment
VII: D1 with 1 secondary seta, D2 with 1-2 secondary setae on pinaculum. SD group
as on Ist abdominal segment. Pinaculum of L3 with less numerous secondary setae
than the pinaculum of previous abdominal segments. The separate group of secon-
dary setae consists of 1-3 setae. SV1 and SV3 with 3-4 secondary setae on common
pinaculum. V1 with maximum of 2 secondary setae. Segment VIII: only pinacula of
D2, SV group, and V1 with secondary setae. SD2 adjacent more or less to dorsal part
of small basal ring of SD1; extra ring as elongated posterior sclerite; SD1 shorter and
thinner than on previous abdominal segments. L1 longer and L3 distinctly shorter
than on abdominal segments I-VII. Segment IX: D2 dorsal to D1; D2 distinctly
longer than DI. SD1 hair-like. SV3 and VI with secondary setae. D2, LI, L2
distinctly longer than on abdominal segment VIII. Segment X: anal shield with D1,
D2, D3, SD1 and 1 secondary seta on each side of the shield; the secondary seta
anterior to D1. The long setae on the body pointed or bifurcated apically. The
other positions of setae as in Figs. 9-11. Crochets of ventral prolegs triordinal
and partially biordinal (in outer part). Crochets of anal prolegs triordinal medially,
biordinal laterally.
Pupa (Fig. 12). Length: 4.0-5.5 mm; width: 1.2—1.6 mm. Fronto-clypeal suture
distinct, curved medially. Labrum without clear incision. Maxillary palpus very small,
more or less tetragonal. Basal part of labial palpus weakly indicated. Proboscis en-
ding somewhat before or at forewing apex. Foreleg extending somewhat behind half
of proboscis length; midleg ending slightly before foreleg. Antenna running beyond
half of proboscis length but not reaching proboscis apex; a distance between apex of
antenna and forewing similar to length of labial palpus. Forewing extending to poste-
rior margin of 7th abdominal segment or somewhat before. 10th abdominal segment
rounded.
Life history. Caterpillars of S. buszkoi sp. n. feed on Lycium barbarum
(Solanaceae). They live in silken galleries extending along branches and leaf-stalks.
From these ‘shelters’ larvae mine the leaves of the food-plant making blotch-like
mines which may sometimes occupy almost an entire leaf-blade. The larvae are
‘external’ miners because they stay in mines only during feeding. If not feeding or dis-
turbed, they reside in a web. Mature larvae were found in the first half of July, when
adults were on the wing. Pupation takes place on the plant, in a dense, white cocoon.
The moths were observed flying around their food-plant during the day. Although
96
BARAN: A new Scythris species from Europe
moths were caught only in July (reared in July-September), S. buszkoi sp. n. has likely
more than one brood per year. This assumption is supported by the fact that most
European Scythrididae produce their first generation in May—June. Thus, the moths
occurring in the period of July to September belong most probably to a second gene-
ration. S. buszkoi sp. n. inhabits sunny slopes overgrown with Lycium barbarum.
Distribution. The species is known only from two localities situated in
Podil’ska Vysoëyna, in the south-western part of the Ukraine.
Derivatio nominis. This new species is dedicated to Professor Jaroslaw
Buszko, in honour of his achievements in lepidopterology.
Discussion
Moths of Scythris buszkoi sp. n. externally resemble other scythridids with olive
brown forewings mixed with pale scales. However, the presence of dark spots on the
wings (especially in fresh specimens), as well as numerous whitish scales on the ven-
tral side of the abdomen may be helpful for determination. The genitalia of both male
and female are very characteristic and they can not be confused with those of any
other species of Scythrididae: In the male the shapes of the aedeagus, valvae, and ster-
num VIII are diagnostic, while in the female the form of the sternal plate and that of
the sclerotization of segment VIII easily separate this species from others. Moreover,
an interesting feature of the male genitalia is the presence of relatively long and sharp
spines on the apices of the valvae and on two processes of sternum 8. Such spines
on these parts of the genitalia appear seldom in the family and may have some
significance in phylogeny. This combination of genitalic features, however, does not
coincide with any known European species-group established by Bengtsson (1997).
Thus, Scythris buszkoi sp. n. forms, in all probability, its own group.
As regards preimaginal stages, caterpillars of the new species are coloured as in
most Scythrididae, i.e. they are dark with paler longitudinal lines. The mature larvae
are somewhat similar to those of Scythris bifissella (Hofmann, 1889) (Baran 2002)
and Scythris knochella (Fabricius, 1794) (Baran, in prep.), but they can be distin-
guished from these species mostly by the characteristic pattern of the head and pro-
thoracic shield, as well as by the arrangement and shapes of body lines. The research
on larval chaetotaxy shows that the species possesses a feature which may be an
important synapomorphy for the family Scythrididae (Baran, in prep.) — abdominal
segments I-VII have an additional, separate group of secondary setae situated antero-
dorsally to L3. This character has also been found in a few other examined larvae of
Scythrididae (Baran 1999, 2002, 2003 in press., MacKay 1972). The feature has not
been discovered in other families so far, and thus appears to be unique within
Lepidoptera. Moreover, two other characters of Scythris buszkoi sp. n. should be men-
tioned: 1. On abdominal segments I-VII, seta L3 always has secondary setae on a
common pinaculum; 2. On abdominal segments I and VII, microscopic seta SD2 is
placed on the dorsal part of the basal ring of SD1, whereas the seta of abdominal seg-
ments II-VI is situated anteriorly. Although our knowledge of scythridid larvae is
scanty, it seems probable that both characters will prove to be autapomorphic for the
Nota lepid. 26 (3/4): 89-98 97
family in future comprehensive, phylogenetic research. Nevertheless, especially the
second feature needs further investigation, because it shows some variability — a modi-
fication of this state has been observed in mining larvae of Scythris siccella (Zeller,
1839) (Baran 2003 in press.). The results in the present paper reveal also that the SD
group of abdominal segments I-VII is equipped with a sclerotized, complete ring.
Such pinacula are widespread within Scythrididae and in the past they were used as a
generic character (Benander 1965); nevertheless, some cases of their reduction have
been discovered too (Powell 1976, Baran 2003 in press.). It should be stressed, how-
ever, that according to the author’s research (Baran, in prep.) and to Hasenfuss (1993)
the presence of extra rings in Scythrididae is a case of retention of a plesiomorphic
state, and therefore this feature should be treated only as a diagnostic one.
As for the pupa, the species may be differentiated from other known European
scythridids (Patocka 1997, Baran 2002, 2003 in press.) only by a combination of the
following features: basal part of labial palpi indistinct, midlegs shorter than forelegs,
and antennae somewhat shorter than proboscis.
In conclusion, it is worth noting that Scythris buszkoi sp. n. is the only known
scythridid in Europe whose larvae feed on Lycium barbarum. However, in Asia there
are two described species of the family feeding on the related Lycium ruthenicum,
namely Scythris deresella Falkovich, 1969 and Scythris lyci Falkovich, 1969
(Falkovich 1969). The morphology of the male genitalia, however, does not indicate a
close affinity between these taxa and Scythris buszkoi sp. n. Furthermore, S. buszkoi
sp. n. is the second known species of Scythrididae in Europe with leafmining
habits in the larval stage. Hitherto, mining caterpillars had been discovered only in
S. siccella (Baran 2003 in press.).
Acknowledgements
I am sincerely grateful to Prof. J. Buszko (Poland, Torun) for the donation of material from the Ukraine,
as well as to Mr. M. Kopeé (Poland, Krakow) for taking the photograph of the holotype.
References
Baran, T. 1999. Morphology and biology of Scythris clavella (Zeller, 1855) (Lepidoptera, Scythrididae).
— Polskie Pismo Entomologiczne 68: 165-195.
Baran, T. 2002. The immature stages and bionomics of Scythris bifissella (Hofmann, 1889) (Lepidoptera:
Scythrididae). — Polskie Pismo Entomologiczne 71: 195-209.
Baran, T. 2003 (in press.). Life history and description of the preimaginal stages of Scythris siccella
(Zeller, 1839) (Lepidoptera: Scythrididae). — Entomologica Fennica.
Benander, P. 1965. Notes on larvae of Swedish Micro-Lepidoptera. II. - Opuscula Entomologica 30:
1-23.
Bengtsson, A. B. 1997. Scythrididae. — In: P. Huemer, O. Karsholt & L. Lyneborg (eds), Microlepidop-
tera of Europe 2. — Apollo Books, Stenstrup, 301 pp.
Falkovich, M. I. 1969. O pishchevykh svyazakh pustinnykh cheshuekrylykh (Lepidoptera) v srednei Azii
[About trophic relationships in Lepidoptera from steppe areas of Middle Asia]. — In: Doklady na
dvatsat’pervom ezhegodnom chtenii pamyati N.A. Cholodkovskogo. Akademiya Nauk SSSR. —
Vsesoyuznoe Entomologicheskoe Obshchestvo, pp. 53-88.
Hasenfuss, I. 1980. Die Präimaginalstadien von Thyris fenestrella Scopoli (Thyrididae, Lepdoptera). —
Bonner Zoologische Beitrage 31: 168-190.
98
BARAN: A new Scythris species from Europe
Hasenfuss, I. 1993. Morphology, evolution, and taxonomic importance of supposed web-vibration recep-
tors in the larvae of butterflies (Lepidoptera: Pyraloidea, Gelechioidea). — Entomologica Generalis
18 (1/2): 43-54.
Hinton, H. E. 1946. On the homology and nomenclature of the setae of lepidopterous larvae with some
notes on the phylogeny of the Lepidoptera. — Transactions of the Royal Entomological society of
London 97: 1-35. |
Landry, J.-F. 1991. Systematics of Nearctic Scythrididae (Lepidoptera: Gelechioidea): Phylogeny and
classification of supraspecific taxa, with a review of described species. - Memoirs of the Entomolo-
gical Society of Canada 160: 1-341.
MacKay, M. R. 1972. Larval sketches of some Microlepidoptera, chiefly North America. — Memoirs of
the Entomological Society of Canada 88: 1—86.
Passerin d’Entreves, P. 1996. Scythrididae. — Jn: O. Karsholt & J. Razowski (eds), The Lepidoptera of
Europe. — Apollo Books, Stenstrup, pp. 74-78.
Patoëka, J. 1997. Die Puppen einiger mitteleuropäischen und kanarischen Scythrididae (Lepidoptera),
Gelechioidea). — Tijdschrift vor Entomologie 140: 207—220.
Powell, J. A. 1976. A remarkable new genus of brachypterous moth from Coastal Sand Dunes in
California (Lepidoptera: Gelechioidea, Scythrididae). — Annals of the Entomological Society of
America 69: 325-339.
Nota lepid. 26 (3/4): 99-101 | 99
Short Communication
Lythrum salicaria (Lythraceae) — a confirmed summer
hostplant of Leptotes pirithous in Israel (Lycaenidae:
Polyommatinae)
DUBI BENYAMINI
91 Levona Street, Bet Arye, Israel 71947, e-mail:
[email protected]
Leptotes pirithous (Linnaeus, 1767) is a highly polyphagous species. In Israel with 28
known hostplant species in 12 plant families it even „leads“ over the famous cosmo-
politan Vanessa cardui (Nymphalidae) with only 20 plant species of 8 families, and
Lampides boeticus with 25 species of 4 plant families (O. Tomer, pers. comm.).
Fiedler (1991, based on Vorbrodt & Müller-Rutz 1911) listed a record of Lythraceae
as a hostplant for L. pirithous, but marked this as questionable, since no more recent
supportive evidence was available. Hesselbarth et al. (1995) cited even much earlier
records of Zeller (1847) and Wilde (1861) who mentioned Lythraceae as a possible
hostplant family for the species. Apart from a few tropical species, use of hostplants
from the family Lythraceae is exceedingly rare in the family Lycaenidae (Fiedler
1991). These historical records have now finally been confirmed after over ninety
years.
I visited an upper rivulet of the Crocodile (Hataninim) River on 2.1x.2003. The
biotope is located in the coastal plain of central Israel between Ma’agan Michael and
the southern tip of Mt. Carmel. It is situated 12.6 km N of Hadera city at 32°33’02” N
& 34°55’38“ E, 20 m above sea level (GPS reading). It owes its name to the last wild
crocodile shot down here in the early 1930ies. Walking along the blossoming serpen-
tine line of Lythrum salicaria (Lythraceae) plants which marks the track of the rivulet,
I noticed a concentrated activity of adult L. pirithous flying around the flowers of two
large L. salicaria plants. Other typical plants and butterflies observed in this interest-
ing biotope include: Blossoming Cynanchum acutum (Asclepiadaceae) which attracts
migrating Danaus chrysippus to establish a local seasonal community almost every
year; Pelopidas thrax, another Palaeotropical migrant which lays eggs on Phragmites
australis (Poaceae); Pyrgus melotis over its host Rubus sanctus (Rosaceae); Zizeeria
karsandra and Lycaena thersamon which both use Polygonum equisetiforme (Poly-
gonaceae) as hostplant and nectar source; Polyommatus icarus possibly feeds on
the locally common Trifolium fragiferum (Fabaceae) and this blue was also observed
nectaring on L. salicaria.
© Nota lepidopterologica, 31.01.2004, ISSN 0342-7536
100 BENYAMINI: Leptotes pirithous
Fig. Leptotes pirithous on Lythrum salicaria.
Males of L. pirithous were tracing the females, which after landing rejected them
by opening and vibrating the wings. At 11:30 I observed a female which succeeded to
escape a courting male and started to check the flower buds with the tip of her
abdomen. While walking around up and down the top of the flower spike of L. sali-
caria she laid an egg among the small buds of the flowers. Subsequently, other eggs
were also found on young leaves. The larvae hatching from these eggs in captivity
turned out to consume buds and flowers, usually digging a small hole in the side of
the calyx. First instar larvae which hatched on a leaf, consumed it by opening a small
„window“ in the epidermis. In later instars, larvae also fed only on flowers and flower
buds of L. salicaria.
Several branches of the preferred plants were searched carefully in the lab,
yielding a total of twenty larvae. This might indicate that certain plants are much
more attractive to egg-laying females than others. However, only three adults hatched.
The rest (85%) were attacked by braconid parasitoids, always yielding just one
wasp per larva. During September 2003, in Bet Arye, I bred this blue butterfly also
on the introduced ornamental plant Plumbago auriculata (= P capensis)
(Plumbaginaceae). Of nineteen larvae ten adults hatched successfully. In this case
the white cocoons of apparently the same solitary parasitic wasp appeared in 47.3%
of the larvae. The lower percentage of parasites was explained by Clark & Dickson
(1971) who wrote on the Genus Syntarucus (= Leptotes): ,,Parasites though paying
a toll on the sticky basal portion (calyx) of the flowers of Plumbago, manage to
attack the eggs and larvae.“
Nota lepid. 26 (3/4): 99-101 101
Some twenty meters away from the L. salicaria biotope, a female was observed
laying an egg on a prostrate Trifolium fragiferum flower head and another landed on
blooming Polygonum equisetiforme (Polygonaceae). I could, however, not confirm
whether this latter plant serves as another host or rather as nectar source.
L. pirithous actually demonstrates a survival strategy of continuous shifting bet-
ween habitats and hostplants; Benyamini (1999a, b, 2000, 2001, 2002a, b, 2003a, b;
Feingold 2003; Tomer 2000). Being a strong migrant it is always attracted to flowers
and buds which are available in every season of the year. No diapause behaviour is
known. The species retreats in the cold winter months to lower, warmer and more
southern biotopes. In spring and summer when temperatures are rising it expands
again to the mountains and northern Israel. There is no question that many more food
plants will be found in the future.
Acknowledgements
I am grateful to Prof. Konrad Fiedler of Bayreuth University, Germany, for his contribution to this note,
and his encouragement to bring it to print. O. Tomer kindly made available the host plant database of the
Israeli Lepidopterists’ Society.
References
Benyamini, D. 1999a. Bauhinia galpini L.(Caesalpiniaceae) a new host plant for Leptotes pirithous
and Deudorix livia in Israel. — Bulletin of the Israeli Lepidopterological Society 16 (2): 35-36.
[in Hebrew]
Benyamini, D. 1999b. Seasonal records of L. pirithous. — Bulletin of the Israeli Lepidopterological
Society 16 (2): 49. [in Hebrew]
Benyamini, D. 2000. Seasonal records of L. pirithous. — Bulletin of the Israeli Lepidopterological Society
17 (1) : 23. [in Hebrew]
Benyamini, D. 2001. Seasonal records of L. pirithous. — Bulletin of the Israeli Lepidopterological Society
18 (1): 32. [in Hebrew]
Benyamini, D. 2002a. A Field Guide to the Butterflies of Israel including Butterflies of Mt Hermon, Sinai
and Jordan. — Keter Publishing House Jerusalem. 248 pp. sth ed. [in Hebrew]
Benyamini, D. 2002b. Seasonal records of L. pirithous. — Bulletin of the Israeli Lepidopterological
Society 19 (2): 57 [in Hebrew]
Benyamini, D. 2003a. Lythrum salicaria a new food plant of Leptotes pirithous in Israel. — Bulletin of
the Israeli Lepidopterological Society 20 (2): in print.
Benyamini, D. 2003b. Seasonal records of L. pirithous — Bulletin of the Israeli Lepidopterological
Society 20 (2): in print.
Clark, C. C. & C. G. C. Dickson 1971. Life Histories of the South African Lycaenid Butterflies. — Purnell
& sons, Cape Town. 272 pp.
Feingold, E. 2003. Breeding L. pirithous on Tipuana tipu (Benth.) Kuntze (Fabaceae). — Bulletin of the
Israeli Lepidopterological Society 20 (2): in print
Fiedler, K. 1991. Systematic, evolutionary, and ecological implications of myrmecophily within the
Lycaenidae (Insecta: Lepidoptera: Papilionoidea). — Bonner Zoologische Monographien 31: 1-210.
Hesselbarth, G., H. van Oorschot, & S. Wagener 1995. Die Tagfalter der Türkei. — S. Wagener, Bocholt.
Vols. 1&2: 1354 pp., Vol. 3: 847 pp.
Tomer, O. 2000. Tesomaria capensis Spach (Bignoniaceae), a new hostplant for L. pirithous in Israel.
Bulletin of the Israeli Lepidopterological Society 17 (2): 21. [in Hebrew]
Vorbrodt, C. & Miiller-Rutz, J.1911. Die Schmetterlinge der Schweiz, erster Band. — K. J. Wyss, Bern.
Wilde, ©. 1860-1861. Die Pflanzen und Raupen Deutschlands. — Mittler & Sohn, Berlin.
Zeller, P. C. 1847. Bemerkungen über die auf einer Reise nach Italien und Sicilien beobachteten
Schmetterlingsarten. — Isis (von Oken), Jena 1847 (2): 121-159.
f run,
| the -
f à TI
| i =
a & ns
ir 2
x
{
à At ey nz
| SRLS, TREE
| RAD à T N ET 4: A a ‘ape
ce ee: | - i
FA a u à a de” a
nur 4. AIS TON LOT ECS
( 108 les “ree
- } R bi ‘1 "TE
| , | :
u 5 u
| Xe À =
‘ ‘
| LE
| 4 |
| | =
|
\
7 à N
= Mi
v er
4
r | = ve tx
i "+ a f
My
€ | La
we
J
seh
4 ; | 43%
Ne
Y
‘ à Co | Î "4 ly
1 e | 44 g Pr ye Fe D er y Uhr A af ai ms! h ds Pu a À
\ A: , . > gs
| . Aalen!
| … | \ | ci {
| i an DL UFSPNTNE DE
| 3 Ww Len | 4 . . 3 vr HU pe Krach à
di } té (LRU dd Aes ea, v4 ours 3 sy tay
: ke > - Fi nf ] mn
il { : "it 45-0 { th tn N i IE as , mad 8 ae ET gi
| | é aT. Ira. ® | YA
i i FETES Ly + te - 7 LS | DT Bu: oy pant DE. A werner
| J bape à i os er ER mitt
/ u A i
iy i ne 7 . hn 2 ar ur KALT, 2 vun A iM put 9 es 4 ”
. Fe! tu i art 4 sft, sf | m + À LAN
= ZZ 32 05 ant bar le un
1 ‘Ou aa ml larve. ET (Et ARETE Sb tic
| . | = r Ne u, |
| £ 3 en > x ir = 20 if. %
| 7 = … RL te.
ri 14 Br = à de ns er = 5
Nota lepid. 26 (3/4): 103-110 103
Two new European geometrid moths: Xanthorhoe skoui sp. n.
and Xanthorhoe friedrichi sp. n. (Geometridae)
JAAN VIIDALEPP! & AXEL HAUSMANN ”
' Institute of Zoology and Botany at Estonian Agricultural University, Riia St. 181, EE-51014 Tartu,
2 Zoologische Staatssammlung, Münchhausenstrasse 21, D-81247 München, Germany;
Abstract. Two new European larentiine species are described: Xanthorhoe skoui Viidalepp & Hausmann
sp. n. from eastern part of central Spain, and Xanthorhoe friedrichi Viidalepp & Skou sp. n. from Greece.
Both are closely related to Xanthorhoe oxybiata (Milliére, 1877). Habitus, male and female genitalia are
illustrated.
Zusammenfassung. Zwei neue europäische Larentiinen-Arten werden beschrieben: Xanthorhoe skoui
Viidalepp & Hausmann sp. n. aus dem östlichen Zentralspanien, und Xanthorhoe friedrichi Viidalepp &
Skou sp. n. aus Griechenland. Beide sind vergleichsweise nah mit Xanthorhoe oxybiata (Milliere, 1877)
verwandt. Abbildungen der beiden neuen Arten, sowie der männlichen und weiblichen Genitalien wer-
den gegeben.
Key words. Lepidoptera, Geometridae, Xanthorhoe, new species, new status, Spain, Greece.
Introduction
After the death of the famous Microlepidoptera specialist Dr. J. Klimesch (1901-1997),
his enormous Lepidoptera collection was incorporated into the Zoologische Staats-
sammlung Munich (ZSM), where it began to be studied by a large number of guest
researchers. Among the Geometridae, the junior author discovered a series of Spanish
specimens of the genus Xanthorhoe Hübner, [1825] that could not be attributed to one
of the known European species. The specimens had been collected by R. Wolfschlager
(1874-1958) from Austria, whose collection has been acquired by Klimesch. In 1998,
the above mentioned specimens were studied by the senior author, who confirmed
that they belong to a so far undescribed species. In the same period the Thuringian
amateur lepidopterist Egbert Friedrich brought some specimens of Xanthorhoe from
Greek to the ZSM, asking for their identification. Also these specimens revealed to
belong to an undescribed species. Furthermore, at the SEL congress in Malle 1998,
specimens of both new species had been shown and given on loan by Peder Skou,
Stenstrup, Denmark, to the senior author. As a forerunner to the third volume of
the book series ‘Geometrid moths of Europe’ (Viidalepp, in preparation) these dis-
coveries are published here. They raise the number of European Xanthorhoe species
from 16 (Müller 1996) to 18. Hopefully this will focus attention on the taxa in ques-
tion, and help to trace additional material which may permit to improve knowledge
about their distribution areas.
Abbreviations
ZSM - Zoologische Staatssammlung München, Germany; ZMUC - Zoological Museum University
Copenhagen, Denmark; EMEM - Entomological Museum Eitschberger Marktleuthen.
© Nota lepidopterologica, 31.01.2004, ISSN 0342-7536
104 VIIDALEPP & HAUSMANN: Two new European Xanthorhoe
Systematic relationships
Currently, the larentiine genus Xanthorhoe Hübner, 1825 includes 228 species from
all zoogeographical regions (Scoble 1999). Due to the world-wide distribution, it has
split into a taxonomically complicated pattern of various phylogenetical lines. No
modern revision of the genus is available, and, until now, no analytical study revealed
evidence for monophyly of the genus, as presently delimited (Holloway 1997:
190-191).
The type species of the genus X. montanata ([Denis & Schiffermüller], 1775) is cha-
racterised by extremely long, eversible coremata between segments A7 and A8 in
male, in male genitalia by long, free distal projections of costa of valva, by elongate
lateral thorns of manica, in female genitalia by broad antrum, heavily sclerotized and
longitudinally folded. Apart from the type species, the apical process of the valve
costa exceeds the distal margin of the membranous ventral part of valva in five other
European Xanthorhoe species: X. annotinata (Zetterstedt, 1839), X. incursata
(Hübner, 1813), X. vidanoi Parenzan & Hausmann, 1993, X. spadicearia ([Denis &
Schiffermüller], 1775), and X. ferrugata (Clerck, 1759), but also in the south-west
Asian X. inconsiderata (Staudinger, 1892) and X. pseudogaliata (Staudinger, 1898).
The costa is shorter than the rest of the valva in the other congeners.
Both the below described species belong to the oxybiata species-group, embracing
Xanthorhoe oxybiata (Milliere, 1877) with possible certain relationships to X. incon-
siderata and X. pseudogaliata. The group is characterized by similar habitus with
broad, dark median fascıa, male antennae shortly bipectinate with additional fascicu-
late ventral sensilla at distal, ventral part of each flagellomere, in X. oxybiata on short
branches, thus sub-quadripectinate here. Male genitalia with large aedeagus with
large and thick bundles of thin, dark cornuti. Female genitalia with sclerotised ductus
bursae, posterior part of corpus bursae sclerotized, a very unusual character in
Xanthorhoe. Signum distinct in X. friedrichi sp. n., very small in X. skoui sp. n.,
absent in X. oxybiata, probably due to a secondary loss in the phylogeny of this group.
Xanthorhoe designata (Hufnagel, 1767), Xanthorhoe abrasaria (Herrich-Schäffer,
1856), and Xanthorhoe montanata are characterised by three small patches of cornu-
ti attached to the distal part of vesica in male genitalia, the other European species
with some thin cornuti at distal end of aedeagus.
Xanthorhoe skoui Viidalepp & Hausmann sp. n.
Material. Holotype ©, ‘Hispania Arag[on], Albarracin, Wolfschlager IX 1954‘, ZSM. — Paratypes.
30, 99, ‘Hispania, Arag[on], Albarracin‘, 6.VIIL.-26.1X.1954, Wolfschläger leg., ZSM; 10,
‘Zentralspanien, Provinz Teruel, Albarracin, 7.-17.IX 1998, W. Kraus leg.‘, coll. Kraus, Kaiserslautern;
19, ‘Spanien, Aragon, Umg. Albarracin, 22.IX 1962, V. Buddenbrock leg.‘, EMEM in ZSM; 19, ‘Hisp.
centr. or. Albarracin, 1200 m, 7.-30.IX 1963, J. R. & W. Caron leg.‘, EMEM in ZSM; 19, ‘Spanien,
Murcia/Moratalla, 21.1X.1989, J. Lenz leg.‘, ZSM; 19, ‘Spain, Teruel, Albarracin, 1000m, 29.IX.1987,
P. Skou leg.‘, coll. Skou, Stenstrup; 10, ‘Spain, Prov. Teruel, Albarracin, Val de Vecar, 1200 m,
18.1x.2002, Peder Skou leg‘, coll. Skou; 50, 19, ‘Spain, Prov. Teruel, 7 km W. of Albarracin, 1200 m,
17.-18.1x.2002, Peder Skou leg‘, coll. Skou; 10, 29, ‘Spain, Prov. Teruel, 1 km E. of Tramacastilla,
1200 m, 17.1x.2002, Peder Skou leg‘, coll. Skou.
Nota lepid. 26 (3/4): 103-110 105
Figs. 1-4. Xanthorhoe skoui sp. n., and Xanthorhoe friedrichi sp. n.: 1. Xanthorhoe skoui sp. n., ©,
paratype. 2. Xanthorhoe skoui sp. n., Q, paratype. 3. Xanthorhoe friedrichi sp. n., ©, paratype.
4. Xanthorhoe friedrichi sp. n., Q, paratype (scale bar 1 cm).
Description. External characters (Figs. 1, 2). Length of forewing 12-14 mm,
females slighly larger than males. Antennae of male bipectinate with comparatively
short branches, length of longest branches ca. 0.35 mm, measured at half length of
antenna. Ground colour of forewing light grey. Basal and medial area blackish grey
with slight brown tinge. Postmedial fascia whitish, divided by a fine, grey line, at veins
strongly projecting towards medial area. Cell spots absent on upperside, on underside
present but small. Hindwings grey, in the medial area with four or five dark grey trans-
verse lines, which are indistinct or, sometimes, well contrasted. Terminal line consisting
of small separate dots. Fringe usually concolorous with ground colour, unchequered.
Male genitalia (Fig. 6). Similar to those of X. oxybiata (see Fig. 5, and dif-
ferential diagnosis). Uncus long and slender. Calcar, 1.e. ventral projection of juxta,
comparatively broad, saccus long. Valva elongate, with distal end of costa tapering,
and ventral margin slightly concave or shallowly indented. Aedeagus large, with two
large bundles of cornuti of nearly equal length (n=2).
Female genitalia (Fig. 9). Similar to those of X. oxybiata (see Fig. 8, and dif-
ferential diagnosis). Ductus bursae broad bottle-shaped, smoothly sclerotized. Corpus
bursae laterally with ‘rough surface’ (lamina dentata) and a weak bundle of spines.
106 VIDALEPP & HAUSMANN: Two new European Xanthorhoe
Figs. 5-7. Male genitalia of Xanthorhoe species: 5. Xanthorhoe oxybiata (Milliére, 1877), southern
France, prep. ZSM G 4416. 6. Xanthorhoe skoui sp. n., paratype, prep. ZSM G 10089. 7. Xanthorhoe
friedrichi sp. n., holotype, prep. ZSM G 12634 (scale bar 1 mm).
Posterior part of corpus bursae well sclerotised, at the right side (ventral view) with
V-shaped sclerotisation, at the left side irregularly bordered (n=2).
Diagnosis. In habitus similar to X. oxybiata (Milliere, 1877), but the latter with
white postmedial border of medial area straighter, without sharp indentations, ground
colour of forewing darker, hindwing basad from postmedial line uniformly dark, cell
spots distinct on all wings, terminal dots elon-gate, often contiguous, fringe slightly
chequered. Male antennae in X. oxybiata sub-quadripectinate with short additional
branches from distal, ventral side of each flagellomere. Male genitalia of X. oxybiata
(n=4 from southern France and Dalmatia; Fig. 5) with calcar on average narrower,
valva shorter, ventral margin of valva with deep emargination, costal process of valva
broad and rounded at tip. Saccus on average slightly shorter. In aedeagus ventral patch
of cornuti shorter than the dorsal. Female genitalia (n=4 from southern France and
Dalmatia; Fig. 8) with ductus bursae narrower, corpus bursae smoothly sclerotised,
without spinules and lamina dentata. Sclerotised, posterior part of corpus bursae
tapered at the right side, straightly and sharply bordered at the left side.
Distribution. Eastern Spain, from Aragon to Murcia province. The closest
related species, X. oxybiata, is recorded from southern France, Italy including
Sardinia and Sicily, former Yugoslavia, Greece, Cyprus and Turkey. Spanish records
of X. oxybiata (e.g. Vives Moreno 1994; Redondo & Gaston 1999) are misidentified
and refer to the new species. Todate, no sympatric occurrence of both species is
known, and they have to be considered allopatric vicariant species.
Nota lepid. 26 (3/4): 103-110 107
Figs. 8-10. Female genitalia of Xanthorhoe species: 8. Xanthorhoe oxybiata (Milliere, 1877), Dalmatia,
prep. ZSM G 7994. 9. Xanthorhoe skoui sp. n., paratype, prep. ZSM G 10091. 10. Xanthorhoe friedrichi
sp. n., paratype, prep. ZSM G 12635 (scale bar | mm).
Biology. Supposedly univoltine phenology, from early September to late
September. No specimens could be collected at the type locality late August (Skou,
pers. comm.). On average, X. oxybiata flies later, from September to November,
exceptionally December. Limited data to vertical distribution indicate occurrence from
500 m to 1200 m above sea-level. Immature stages unknown.
Derivatio nominis. The species is dedicated to Peder Skou, Stenstrup,
Denmark, who collected the species and pointed it out as a potential new species.
With this dedication, his merits in promoting research on European Geometridae,
especially by initiating the project “The Geometrid Moths of Europe’ are honoured.
Xanthorhoe friedrichi Viidalepp & Skou sp. n.
Material. Holotype ©, ‘Greece, Parnassos-Gebirge, Umg. Arahova, Grotte, 1400 m, 14.09.1997 a.L.,
E. Friedrich leg.‘, ZSM. — Paratypes. 1c, id., ‘13.09.1997*, coll. Friedrich, Jena; 19, 19, ‘Greece,
Peloponnes, Umg. Kalavrita, Rogi, 950 m, 23.09.1997 a.L., E. Friedrich leg.‘, coll. Friedrich; 10, id.,
ZSM; 29, ‘Greece, Peloponnes, Parnon-Gebirge, Umg. Kosmas, 850 m, 29.09.1997, E. Friedrich leg.‘,
ZSM; 19, id., coll. Friedrich; 10, id., ‘1150 m, 28.09.1997‘, coll. Friedrich; 10°, ‘Greece, Peloponnes,
Umg. Kalavrita, Mega Spileon, 900 m, 7.10.1992, E. Friedrich leg.‘, coll. Friedrich; 10°, 29 (with gen.
prep. JV 6216), ‘Greece, Erythrea, 29.09.1984, M. Fibiger & A. Moberg leg.‘, coll. Skou, Stenstrup; 19,
id., ZMUC; 19, ‘Greece, Pierias, mt. Olympus above Litochorion, 950 m, 9.09.1983, M. Fibiger & A.
Moberg leg.‘, coll. Fibiger, Sora; 19, ‘Griechenland, Thermopilae, 60 m, 18.10.1971, Lukasch leg.‘,
ZSM; 19, ‘M. Griechenland, Tempi-Tal, Omelio, 50 m, 02.10.1996, Stengel leg.‘, ZSM.
108 VIIDALEPP & HAUSMANN: Two new European Xanthorhoe
Fig. 11. Habitat of Xanthorhoe skoui sp. n.: Spain, Prov. Teruel, 7 km west of Albarracin, 1200 m,
19th September 2002 (photo P. Skou).
Description. External characters (Figs. 3, 4). Length of forewing 13-14 mm.
Male antennae bipectinate with longest branches about 0.4 mm. Female antennae fili-
form. Ground colour light grey in male, slightly darker in female. Medial fascia of
forewing blackish grey, with arched proximal and distal border. Broad whitish post-
medial fascia with traces of a wavy transverse line, dark grey blotches present at the
forewing costa close to apex, and in the terminal area, between veins M,—M3.
Terminal area more or less suffused with grey, mainly in females. Vein ends with
paired blackish terminal dots. Hindwing slightly darker than ground colour of
forewing, postmedial line diffuse, bent between veins M;-CuA,. Underside of
forewing greyish, darker than hindwing. Distal border of medial area concave
between M, and M, distally projecting at M;—CuA,. A dark costal spot at the posti-
tion of the antemedial line, three costal spots in the distal half of medial area.
Underside of forewing apex dark grey with traces of wavy line, reduced to 2-3
whitish spots. Paired terminal dots indistinct on underside of forewing, distinct on
hindwing. Fringe chequered white and grey. Wing pattern is variable, but is always
characterised by a certain chalk-powdered aspect. One male shows bright orange
patches at the main veins along the inner and outer border of the medial field, and one
female has the entire forewing suffused with ashen, with a slight bluish tinge.
Male genitalia (Fig. 7). Similar to those of X. oxybiata (see Fig. 5, and diffe-
rential diagnosis). Uncus long and slender. Calcar comparatively broad, saccus long.
Valva elongate, with distal end of costa tapering, and ventral margin slightly concave
or shallowly indented. Aedeagus very long, comparatively slender, with one patch of
cornuti, of about 2/5 length of aedeagus (n=3).
Nota lepid. 26 (3/4): 103-110 109
Female genitalia (Fig. 10). Genitalia pyriform with ductus bursae sclerotised,
narrow. Anterior part of ductus bursae and posterior part of corpus bursae irregularly
folded, with finely granulate surface on the left side. Signum well developed, as an
elongate patch of longer needles, length of signum 0.20-0.35 mm (n=3).
Diagnosis. In habitus slightly reminiscent of Epirrhoe galiata ([Denis &
Schiffermüller], 1775), but clearly belonging to the genus Xanthorhoe according to
venation (two accessory cells in forewing), and male antennal structure (bipectinate
rather than ciliate). Close relationship to X. oxybiata species-group supported e.g. by
the size of the aedeagus with large patch of cornuti in male genitalia, or the sclero-
tised ductus bursae in female genitalia. Antennae of X. friedrichi exactly as described
for X. skoui sp. n., differences from X. oxybiata see diagnosis of X. skoui sp. n.. In
habitus, the chalk-powdered aspect of the wing pattern of X. friedrichi sp. n. is unique
within Mediterranean species of the genus Xanthorhoe Hbn. X. oxybiata differing
from X. friedrichi sp. n. furthermore in darker medial fascia of forewing and uni-
formly dark coloration of hindwing basad from postmedial line. Male genitalia of X.
oxybiata (n=4 from southern France and Dalmatia; Fig. 5) with valva shorter, ventral
margin of valva with deep emargination, costal process of valva broad and rounded at
tip. Saccus on average slightly shorter. Aedeagus shorter and broader, cornuti patches
larger, about 3/5 length of aedeagus, with two patches of cornuti. Female genitalia
(n=4 from southern France and Dalmatia; Fig. 8) with ductus bursae and posterior
part of corpus bursae smoothly sclerotised. Corpus bursae without signum.
Consequently Xanthorhoe friedrichi shares three derived character states (large
aedeagus; vesica with numerous dark cornuti arranged in large and thick bundle;
entire ductus bursae sclerotised) with X. oxybiata and X. skoui sp. n.
Distribution. Central and southern Greece, probably endemic.
Bionomics. Collected at light from early September to mid-October, mainly on
limestone mountains (800-1400 m above sea-level), accompanied by xeromontane
species such as Aplocera dervenaria Mentzer, 1981, Nebula senectaria (Herrich-
Schaffer, 1852), Xanthorhoe oxybiata, Scopula vigilata (Sohn-Rethel, 1929) (E. Friedrich,
pers. comm.). Immature stages unknown.
Derivatio nominis. The species is dedicated to Egbert Friedrich, Jena,
Thuringia, who collected a fine series of it in Greece.
Acknowledgements
We thank Egbert Friedrich (Jena, Germany), Peder Skou (Stenstrup, Denmark) and Dr. Michael Fibiger
(Sorg, Denmark) for loan of material, and E. Friedrich for additional detailed data on collecting locali-
ties, and Prof. Dr. Niels P. Kristensen, Copenhagen, for valuable advice to the manuscript. Dr. Sven
Erlacher, ZSM, kindly helped by photographing type specimens and genitalia, by dissecting some spe-
cimens and by discussing the results. Irina Fritz, ZSM, assisted in the digital type photography. J. V. was
financially supported by the short-time grant from DAAD in 1999, and later by the grant 4085 of the
Estonian Science Foundation
References
Holloway, J. D. 1997. The Moths of Borneo. Part 10. Geometridae: Sterrhinae, Larentiinae. - Malayan
Nature Journal 51: 1-242.
110 VIIDALEPP & HAUSMANN: Two new European Xanthorhoe
Miller, B. 1996. Geometridae. — In: O. Karsholt & J. Razowski (eds.): The Lepidoptera of Europe, a
distributional checklist. — Apollo Books, Stenstrup. — Pp. 218-249
Redondo, V. N. & F. J. Gaston 1999. Los Geometridae (Lepidoptera) de Aragon (Espana). — Sociedad
Entomolögica Aragonesa (Monografias S. E. A.), Zaragoza 3: 130 pp.
Scoble, M. J. 1999. Geometrid Moths of the World, a Catalogue. — Csiro Publishing, Apollo Books,
Collingwood (Australia), Stenstrup (Denmark), 1400 pp.
Viidalepp, J. (an preparation): Larentiinae (1). — Jn: Hausmann (ed.), Geometrid moths of Europe 3.
— Apollo Books, Stenstrup.
Vives Moreno, A. 1994. Catalogo sistematico y sinonimico de los Lepidopteros de la Peninsula Ibérica
y Baleares (Insecta: Lepidoptera, II). — Ministerio de Agricultura, Pesca y Alimentacion, Madrid. 775 pp.
Nota lepid. 26 (3/4): 111-114 111
A new Micropterix species from southern France
(Micropterigidae)
MICHAEL A. Kurz., Marion E. KURZ’& HANS CHRISTOF ZELLER-LUKASHORT"
' A-5400 Rif, Reischenbachweg 2, e-mail:
[email protected] — ? A-5303 Thalgau, Sportplatzstr. 23,
e-mail:
[email protected] — * A-5303 Thalgau, Unterdorf 118, e-mail:
[email protected]
Abstract. Micropterix huemeri sp. n. is described from the Alpes-Maritimes Department (southern
France) and compared with its closest relatives, i.e. Micropterix trifasciella Heath, 1965 and Micropterix
rothenbachii Frey, 1856. The new species is well characterised by the structure of the male genitalia.
Zusammenfassung. Aus den französischen Meeralpen wird Micropterix huemeri sp. n. beschrieben und
mit ihren nächsten Verwandten verglichen. Dies sind Micropterix trifasciella Heath, 1965 und
Micropterix rothenbachii Frey, 1856. Die neue Art ist sehr gut durch den Genitalapparat des Männchens
charakterisiert.
Résumé. Micropterix huemeri sp. n. est décrit du département des Alpes-Maritimes (Sud de la France)
et comparé aux espèces les plus apparentées, à savoir Micropterix trifasciella Heath, 1965 et Micropterix
rothenbachii Frey, 1856. La nouvelle espèce est bien caractérisée par la structure des genitalia mâles.
Introduction
The genus Micropterix, Hübner, [1825] belongs to the most basal lineages of
Lepidoptera and contains about 70 species, most of them occuring in the western
Palaearctic (Kristensen 1998). Though the morphology of the group has been studied
extensively due to the long recognised phylogenetic key position within the
Amphiesmenoptera and the fascinating habit of pollen-feeding by the moths, a taxo-
nomic revision or field guide for the European species still do not exist. The most
complete overview might be that of the website of Kurz, Kurz & Zeller-Lukashort
(2001-2004) which catalogues the western Palaearctic species of Micropterix and
gives illustrations, descriptions, and the distribution for each species. Discoveries of
new Micropterix species are still possible in Europe, the previous one dating back to
1997, when the authors described Micropterix renatae from Tuscany (Kurz, Kurz &
Zeller 1997). During a collecting trip to Marguareis in the Alpes-Maritimes
Department of southern France in 1991, Drs Peter Huemer and Gerhard Tarmann
from the Tiroler Landesmuseum Ferdinandeum, Innsbruck (TLMF) found some spec-
imens of an unidentified Micropterix species. Subsequent investigations showed that
these specimens belong to an undescribed species. In this paper, we are presenting a
description because a revision of the group is not foreseen in the near future.
Micropterix species are well characterized by a combination of the forewing pattern
elements and characters of the male genitalia. The following description is based on
these features.
© Nota lepidopterologica, 31.01.2004, ISSN 0342-7536
112 KURZ, KURZ & ZELLER-LUKASHORST: A new Micropterix species
Figs. 1-2. Schematic drawings of the forewings (top male, bottom female). 1. Micropterix huemeri sp.
n. 2. Micropterix rothenbachii Frey, 1856.
Micropterix huemeri sp. n.
Material. Holotype: ©: „Frankreich; Dep. Alpes Maritimes; Marguareis W-Hang; Navela, 2100-
2200 m; 18.7.1991; leg. Huemer & Tarmann“; „GU MIC2 © P. Huemer“; ,,[red label] Holotypus
Micropterix huemeri Kurz, Kurz & Zeller 9“; „ID-Nummer HdN-2289“; coll. TLMF. Paratypes: 20°, 19
same data, ID-Nummern: MK-1190, MK-1191, HdN-2290; coll. TLMF.
Description
Adult (Fig. 1). Forewing length: © 3.9 mm (n=3); 9 4.4 mm; Head yellow; antennae
approximately almost 3/4 (male) or almost 1/2 (female) forewing length, golden fus-
cous. Thorax coppery to bronzy golden, tegulae purple violet with bronzy golden
edges; forewings purple violet to bluish violet; base of costa bronzy golden; wing
markings golden, slightly lined bronzy golden; a fascia at 1/4, slightly bent, mode-
rately broad on inner margin, distinctly narrowed from centre of wing to costa; a fascia
at 1/2, slightly bent outwards, moderately broad, sometimes narrowed medially, some-
times distinctly broadened at costa; a fascia at 3/4, slightly broader than the other ones
with distinctly curved inner margin; sometimes a residual costal spot at 3/5; cilia
bronzy golden, apically whitish; hindwing coppery to bronzy golden, apically dis-
tinctly tinged purple; cilia bronzy golden; legs and abdomen golden fuscous.
Male genitalia (Fig. 3) (n=1). Uncus short, slightly stout with moderately
broad tip; beyond uncus a hairy structure; a small area with several faint, straight setae
at the posterior margin of tegumen between uncus and accessory clasper; accessory
clasper proximally broad, distally tapered, on inner surface with an upper row of 6
sickle-shaped setae and a lower row of 9 more or less straight, moderately long setae,
with the two proximal setae slightly set apart; valva slightly bent, narrowed beyond
middle with a triangular distal end and 2-3 irregular rows of shorter setae on inner
surface beyond the narrowing; post-basally with a distinctly robust seta on inner sur-
face; aedeagus typical for the genus, without cornuti.
Nota lepid. 26 (3/4): 111-114 113
Figs. 3-5. Male genitalia. 3. Micropterix huemeri sp. n. (holotype). 4. Micropterix trifasciella Heath,
1965. 5. Micropterix rothenbachii Frey, 1856.
Diagnosis. Based on our investigations of more than 50 western Palaearctic
Micropterix species, M. huemeri belongs to a group of closely related species which
is characterised by the following characters. The accessory claspers bear two rows of
setae. In the ventral row, the distal setae are strongly modified (Y- or T-shaped) and
the 1—2 most proximal ones are distinctly separated from the rest. These characters are
shared by M. hartigi Heath, 1981 (n=8), M. rothenbachii Frey, 1856 (n=77), M. iberi-
cella Caradja, 1920 (n=2), M. allionella (Fabricius, 1794) (n=29), and M. trifasciella
Heath, 1965 (n=42).
114 KURZ, KURZ & ZELLER-LUKASHORST: A new Micropterix species
Externally M. huemeri is quite well separated from the other species of this group
by its three complete golden fasciae on the forewing and the absence of any other
markings. One exception is M. trifasciella, which has very similar wing pattern ele-
ments with only slightly broader fasciae on the forewing. However, the male genitalia
are different in the shape of the accessory clasper which is proximally much narrow-
er and with a different formation of setae. Further, on the inner surface of the valva
the row of the short and thick setae extends further towards the basis into the narrow-
ing of the valva.
In M. huemeri the structures of the male genitalia are most similar to those of M.
rothenbachii. The latter species is redescribed and figured by Heath (1981). M. hue-
meri can be distinguished superficially from M. rothenbachii by both the lack of a
small costal golden spot and the golden tinge on the outer margin of the forewing.
Concerning the male genitalia, M. rothenbachii has a distally club-shaped uncus and
longer, distally more spatulate valvae with only one stout seta in the middle of the nar-
rowing.
Distribution. To our present knowledge, M. huemeri sp. n. seems to be an
endemic of the geologically isolated region of the Marguareis, living at altitudes high-
er than 2000 m.
Derivatio nominis. The new species is named in honour of Dr Peter Huemer,
who collected the species.
Remarks. Due to the persisting problems in preparing female genitalia of speci-
mens in the genus Micropterix, no attempt has been made to prepare the genitalia of
the single available female of the new species.
Acknowledgements ;
We are grateful to Dr Peter Huemer and Dr Gerhard Tarmann, both from the Tiroler Landesmuseum
Ferdinandeum, Innsbruck, for the loan of the material.
References
Heath, J., 1965. A new species of Micropterix (Lepidoptera Zeugloptera: Micropterigidae). — Atti della
Societa Italiana di Scienze Naturali 104 (2): 243-245.
Heath, J., 1981. Two new species of Micropterix Huebner (Lepidoptera, Zeugloptera: Micropterigidae).
— Entomologist’s Gazette 32: 99-102.
Kristensen, N. P. 1998. The non-Glossatan moths. Pp. 41-49. — In: N. P. Kristensen (ed.), Lepidoptera,
Moths and Butterflies 1: Evolution, Systematics, and Biogeography. — Handbuch der Zoologie 4 (35).
— Walter de Gruyter, Berlin and New York.
Kurz, M. A., M. E. Kurz & H. C. Zeller 1997. A new Micropterix Hübner, [1825] from northern Italy
(Lepidoptera: Micropterigidae). — Nota lepidopterologica 20 (3-4): 293-298.
Kurz, M. A., M. E. Kurz & H.C. Zeller-Lukashort 2001-2004. Naturkundliches Informationssystem. —
http://www.penny-in-the-slot-machine.com/nkis/zanmeldung.cgi
Nota lepid. 26 (3/4): 115-126 115
Annotated checklist of the European species of Nemophora
(Adelidae)
MIKHAIL V. KOZLOV
Section of Ecology, University of Turku, FIN-20014 Turku, Finland; e-mail
[email protected]
Abstract. The checklist, which is an excerpt from the forthcoming world-wide taxonomic revision of the
genus Nemophora Hoffmannsegg, 1798, includes 20 species so far reported from Europe, along with
most important synonymy and comments about the characters useful for identification of the problematic
species. N. albiciliellus (Staudinger, 1859) is a distinct species, not a junior subjective synonym of
N. barbatellus (Zeller, 1847). The following synonymies are established: N. istrianellus (Heydenreich,
1851) = N. chlorista (Meyrick, 1912) syn. n.; N. prodigellus (Zeller, 1853) = N. auricellus (Ragonot,
1874) syn. n.; N. fasciella (Fabricius, 1775) = N. annae (Zeller, 1853) syn. n. = N. purpureus (Stainton,
1867) syn. n.; N. mollella (Hubner, [1813]) = N. glabrata (Meyrick, 1922) syn. n.; N. albiciliellus
(Staudinger, 1859) = N. beryllopa (Meyrick, 1935) syn. n. N. padrejusto (Agenjo, 1965) (nomen nudum)
is attributed to N. barbatellus (Zeller, 1847). Generic affinity of N. associatella (Zeller, 1839), the
species sometimes placed into the genus Adela Latreille, is confirmed.
Key words. Lepidoptera, Adelidae, Nemophora, Europe, nomenclature, new synonymies.
Introduction
In spite of the colourful appearance of fairy moths and general interest to this group,
the taxonomy of Adelidae remains surprisingly obscure. Imperfect original descrip-
tions in combination with pronounced variation in external characters caused nume-
rous problems even in the identity of widespread European species, at least half of
which had been repeatedly misidentified. These misidentifications, both preserved in
historical collections and published by competent researchers, continue to influence
the lepidopterological community, leading to the multiplication of errors.
The genus Nemophora Hoffmannsegg, 1798 is taxonomically one of the most
complicated groups of Adelidae. First, the information provided in all primary
descriptions of the European species is insufficient for reliable determination, and in
many situations the best what we can do now is just accept the common usage of the
names by former authors. The amount of ‘historical’ problems can easily be seen from
the recent debates around the name N. cupriacella auct., the current use of which is
simply the result of misidentification (Kozlov 2002); however, it has been suggested
to conserve this name by selection of the neotype (van Nieukerken 2003). Two further
examples concern recent discovery of senior subjective synonyms of N. associatella
(Zeller) and N. dumerilella (Duponchel) that became nomina oblita due to identifica-
tion problems (Kozlov & Kaila 2002; Kozlov 2004). Second, all major recent keys and
checklists contain a number of errors and misleading statements; among these the key
by Zaguljaev (1978) and the book by Kuppers (1980) share the first place. Although
these works contain much useful information, | would suggest that researchers with-
out sufficient knowledge of Adelidae refrain from uncritical use of these. Already a
number of subsequent publications (e. g. the paper by Kovacs & Kovacs 1999) caused
the multiplication of errors. Third, the genitalia of type specimens of most of
European species (had they existed) have never been investigated, which has made
© Nota lepidopterologica, 31.01.2004, ISSN 0342-7536
116
KozLov: Checklist of European species of Nemophora
impossible segregation of diagnostic characters from within-species variation in wing
pattern and coloration. In this extremely variable group even the ‘best’ characters of
the wing pattern, such as the presence of a forewing fascia, can easily vary, leading to
description of aberrant specimens as distinct species. Last but not least, the wide dis-
tribution of several species resulted in their repeated description from different parts
of the world, as in N. decisella (Walker) (Kozlov & Robinson 1996). The European
case is N. bellela (Walker), which until the last decade was named N. bellela in North
America only (e. g. Powell 1969), while European populations were determined as
N. esmarkella (Wocke) (e. g. Zaguljaev 1978; Küppers 1980), and the name N. hedemanni
(Christoph) was used for the Siberian populations (Meyrick 1912).
Although the taxonomic revision of the genus Nemophora was initiated back in
1981, the identity of some European species became clear only in 2003, when I mana-
ged to sort out the most confusing complex of uniformly coloured species externally
resembling N. fasciella (Fabrictus). Since I received several requests during the past
years to provide taxonomic decisions for checklists and databases, such as the ‘Fauna
Europaea’ project, I decided to publish an annotated checklist of the European
species, because the forthcoming revision will not be completed within a couple of
years. This checklist is based on an extensive study involving some 700 publications,
as well as collections of nearly all leading museums; in particular, I investigated all
type specimens of Nemophora discovered so far. However, keeping in mind the pur-
pose of this publication, I did not include a detailed bibliography (in particular, refe-
rences to primary descriptions are omitted, as they can easily be found from Meyrick
1912 and Kiippers 1980) or complete morphological descriptions. Only the most
important synonyms are included; these were all checked against the type specimens,
where available. |
The genus Nemophora includes to date about 350 species world-wide, among
which some 150 species remain to be described in the forthcoming revision. The
species of Nemophora more or less naturally split into a number of species groups
which, however, could not be combined at the subgeneric level. Since the analysis of
the phylogeny of the genus has not been completed yet, the order of species in the
present checklist follows Wojtusiak (1996). All species names are given in their ori-
ginal spelling, i.e. the highly debatable (Sommerer 2002) requirement of ICZN (1999)
about the gender agreement is not followed.
Last but not least, this publication indicates some shortcomings in our knowledge
about fairy moths in order to focus current studies on the problems that have not been
solved yet. Any criticism, as well as information on material or publications which
have not been accounted for, will be accepted with gratitude.
Abbreviations
MINGA — Museul de Istorie Naturala ‘Grigore Antipa’, Bucharest, Romania.
MNHN - Museum National d’Histoire Naturelle, Paris, France.
NHM — The Natural History Museum, London, UK.
ZIN — Zoological Institute, St. Petersburg, Russia.
MNB — Museum für Naturkunde, Berlin, Germany.
Nota lepid. 26 (3/4): 115-126 117
Nemophora Hoffmannsegg, 1798
Type species: Phalaena (Tinea) degeerella Linnaeus, 1758 by subsequent designation by Hampson
(1918: 388); for the authorship of the generic name, see Nye & Fletcher (1991).
N. degeerella (Linnaeus, 1758)
Determination. This is the best known species of the genus, and its identity
has only occasıonally caused problems. It can be confused with N. amatella, from
which differs in particular by the narrower forewings; for other diagnostic characters,
including male genitalia, consult Kyrki (1981), Razowski (1978) for N. degeerella,
and Kozlov (1997) for N. amatella. The records of N. degeerella from Siberia, Far
East Russia and Japan should most likely be attributed to N. amatella; the record from
India represents an unidentified species. The eastern distributional limit remains to be
clarified.
Nomenclature. No synonyms are listed for this species, because its synonymy
requires detailed investigation that had not been completed yet.
N. amatella (Staudinger, 1892)
Adela degeerella var. amurensis Alpheraky, 1897.
Adela kukunorensis Sauber, 1899.
Adela badioumbratella Sauber, 1899.
Adela coreana Matsumura, 1931.
Nemotois degeerella f. ogasawarai Matsumura, 1932.
Determination. Transpalaearctic species, widely distributed in Asia (Siberia,
Korea and Japan); in Northern Europe N. amatella has been collected for a long time,
but was misidentified as N. degeerella until its true identity was revealed two decades
ago (Kyrki 1981). The species is very variable both in external characters (head
colour, width of fascia, length of apical yellow strips) and in the male genitalia (shape
of valva, tegumen, and base of aedeagus); for diagnostic traits consult Kyrki (1981)
and Kozlov (1997).
Nomenclature. The syntypes of N. amatella (deposited in MNB) include two
specimens of N. amatella and two specimens of N. degeerella.
N. bellela (Walker, 1863)
Adela esmarkella Wocke, 1864.
Adela hedemanni Christoph, 1888.
Adela bellella Walsingham, 1890, incorrect subsequent spelling.
Nemotois belleta Anderson, 1915, lapsus calami.
Nemophora belella Wojtusiak, 1996, incorrect subsequent spelling.
Determination. This is the only circumpolar species of Nemophora, and the
only representative of this genus in North America. It is easily distinguishable from
N. degeerella, N. amatella and N. congruella by the short male antennae (not excee-
ding the doubled forewing length); for male genitalia and other diagnostic traits
consult Kyrki (1981; referred to as N. esmarkella) and Kozlov (1997).
118 KozLov: Checklist of European species of Nemophora
Nomenclature. Note the correct spelling of this name — the number of errors
is exceptionally high; Wojtusiak (1996) introduced one more version of an incorrect
subsequent spelling. The synonymy was established on the basis of investigation of
the type specimens deposited in NHM, ZIN and MINGA.
N. congruella (Zeller, 1839)
Determination. This infrequent transpalaearctic species, belonging to the
degeerella species group, is clearly distinguished by its light-coloured forewing: in N.
congruella the dominant forewing colour is yellow, whereas in both N. degeerella and
N. amatella the dominant wing colour is dark (black, brown and silver-grey). Also the
forewing fascia in N. congruella is situated closer to the forewing base than in both
N. degeerella and N. amatella.
Nomenclature. For a long time Fischer von Röslerstamm was considered as
the author of this species (e. g. Meyrick 1912; Zaguljaev 1978; Küppers 1980); how-
ever, the pages of his book (Fischer von Roslerstamm 1834-[1843]) with descriptions
of Adelidae were published in 1840, and they contain reference to Zeller (1839), who
is the author. Duponchel [1839] published the description of N. congruella the same
year but later than Zeller (see Joannis 1922 for the publication dates). No synonyms
were discovered so far.
N. ochsenheimerella (Hubner, [1813])
Nemotois chibiana Matsumura, 1931.
Nemophora japanalpina Yasuda, 1957.
Determination. In Europe this transpalaearctic species is difficult to confuse
with any other due to its characteristic V-shaped yellow spot in the distal part of the
forewing. However, this spot is often split into two spots (along the fascia and along
termen), and the proximal part of it (along the fascia) sometimes disappears.
Melanistic specimens have often been misidentified as N. degeerella, although
N. ochsenheimerella is much smaller than N. degeerella (wing expanse 10-14 and
16-22 mm, respectively).
N. basella (Eversmann, 1844)
Adela basiradiella Christoph, 1888.
Determination. N. basella is easily distinguished from all other European
species by two elongate yellow spots in the basal half of the forewing (see figures in
Reiprich 1978) and by a horn-like protuberance at the middle of the internal valvar mar-
gin in the male genitalia (Kozlov 1997). The mass occurrence of this species in a
single locality of Central Europe (Reiprich 1978) is intriguing, since it had not be found
so far in any other European locality, except for the South-Eastern part of Western
Europe (the type locality); sparsely distributed from Ural to Amur region; infrequent.
Nota lepid. 26 (3/4): 115-126 119
N. raddaella (Hubner, 1793)
Tinea raddella Hubner, [1796], lapsus calami.
Alucita latreillella Fabricius, 1798.
Nemotois raddaéllus Wocke, 1871, unjustified emendation.
Nematois algeriensis Walsingham, 1907.
Determination. The species is easily recognisable by the combination of its
large size, the prominent glossy bronze forewing colour, and an incomplete light
yellow fascia consisting of a larger costal spot and a smaller dorsal spot.
Nomenclature. The modification of the original spelling by Hubner [1796]
should be considered a /apsus calami, because it was subsequently corrected (Hübner
1816: 416). Unfortunately, both Heydenreich (1851) and Herrich-Schaffer [1855]
have used the incorrect subsequent spelling; as result, the original spelling (N. rad-
daella) was followed only by about half of the authors mentioning this species.
Zaguljaev (1978) was probably the last to use the correct spelling, and during the past
decade the incorrect subsequent spelling became commoner (e. g. Wojtusiak 1996;
Leraut 1997). Note that if these changes are considered unjustified emendations, the
use of the original spelling should be maintained, because the correct spelling had
been used frequently and conditions of article 33.3.1 of the ICZN (1999) are not met.
Some authors (e. g. Küppers 1980; Vives Moreno 1991; Leraut 1997) consider
N. latreillella as a subspecies; however, the differences between populations from
Central and Southern Europe do not exceed the ‘normal’ range of geographical vari-
ation within the genus Nemophora.
N. metallica (Poda, 1761)
Phalaena scabiosella Scopoli, 1763.
Nemotois aerosellus Zeller, 1850.
Nemotois rebelellus Turati, 1924.
Determination. Large unicoloured species, whose identity had not been ques-
tioned for a long time; however, small females (poor quality specimens) have some-
times been misidentified as N. pfeifferella.
Nomenclature. Since the description by Poda (1761) does not allow a reliable
identification, a neotype will be selected to assure the stability of the current use of
this name.
N. pfeifferella (Hübner, [1813])
Adela chrysochraon Razowski, 1978, unnecessary replacement name.
Adela huebneri Kogak, 1980, unnecessary replacement name.
Determination. Due to characteristic wing pattern, this species is only rarely
misidentified; however large females (poor quality specimens) can be mixed with
N. metallica.
Nomenclature. For the history of the replacement names, see Nielsen (1985).
120 KozLov: Checklist of European species of Nemophora
N. istrianellus (Heydenreich, 1851)
Adela beyruthella Bruand, 1858.
Nemotois cupriacellus var. dalmatinellus Zeller, 1853.
Nemotois chlorista Meyrick, 1912, syn. n.
Determination. W™. istrianellus does not possess an epiphysis, and by this cha-
racter can easily be distinguished from other species of the fasciella species group
(listed below) except for N. prodigellus and N. cupriacella auct. From N. prodigellus
it differs in the following characters: forewing without distinct spot at the base of R
stem; forewing background dark brown to dark coppery brown; hindwing uniformly
brown to dark brown; base of male antenna usually with dense row of semi-erect
scales. In the male genitalia, N. istrianellus differs from N. prodigellus by the shape
of the valvae, which are widely rounded to almost rectangular apically, with parallel
distal halves of their inner borders (consult fig. 85b in Küppers 1980). Females of
N. istrianellus differ from females of N. cupriacella auct. in the following characters:
fore tibia dorsally bronze to brown, ventrally and sometimes ventrolaterally yellowish
white to yellow, with strict border between these two colours; forewing fascia usually
distinct; forewing bronze to dark coppery brown.
The species is reported from South Europe and Asia Minor, but due to numerous
misidentifications is with certainty known from a few localities only. There is an
urgent need for reliable information about the distribution and biology of N. istri-
anellus.
Nomenclature. Herrich-Schäffer ([1851], plate 33, fig. 232) illustrated a male
moth under the name ‘istrianella’. Herrich-Schäffer’s plates carry only specific
names, which are not binominal and therefore not available; the descriptive text (on
p. 98) did not appear until 1854 (see Hemming 1937: 588 for the publication dates of
vol. 5 of Herrich-Schäffer’s work). The name was made available by reference to
Herrich-Schäffer’s illustration by Heydenreich (1851: 81, published in combination
Nematois [sic!] istrianellus). The type specimen has not been discovered yet, and
therefore a neotype will be selected from the NHM collection in accordance with the
current use of this name.
The junior subjective synonym, N. dalmatinellus, is traditionally ascribed to Mann,
with the date 1869 (e. g. Meyrick 1912). However, already Heydenreich (1851) pub-
lished this name (as ‘Nematois dalmatinellus Mn.’) without description; this name is
therefore nomen nudum. Zeller (1853) described ‘cupriacellus Var. b’, indicating on
p. 60 that he received the described males from Mann who identified them as N. dal-
matinellus. This name should be considered as subspecific according to article 45.6.4
of ICZN (1999) and attributed to Zeller.
N. cupriacella auctorum
Determination. This is the only parthenogenetic species of Nemophora (Suoma-
lainen 1978). There exist however a possibility that males of N. cupriacella auct. can
occasionally be found, as it happened in several other parthenogenetic moths (van
Nota lepid. 26 (3/4): 115-126 2
Nieukerken 2003); therefore any reliable information about this species, especially
results of the rearing from larvae, would be extremely important to clarify the situation.
Descriptions of males of N. cupriacella published so far clearly belong to other
species, and the identity this species caused much doubt and confusion until very
recently (Kozlov 2002). Females of N. cupriacella differ from females of its closest
relative, N. istrianellus, by uniformly coloured, light bronze to brown, fore tibia, and
light bronze to bronze forewing without distinct fascia, and from females of N. vio-
lella by absence of epiphysis and longer labial palpi covered predominantly by yellow
hairs (for head photos, see van Nieukerken 2003).
Nomenclature. The figure of Tinea cupriacella by Hubner ([1819], f. 445), to
my opinion, depicts a male specimen of N. violellus, and therefore the current use of
this name for the parthenogenetic species is most likely the result of misidentification
(Kozlov 2002). The case is under consideration by the International Commission on
Zoological Nomenclature (Kozlov 2002; van Nieukerken 2003). If ICZN rules as pro-
posed by Kozlov (2002), then the parthenogenetic species will require formal descrip-
tion, because no available name exists for it. An alternative suggestion is to conserve
the existing usage of the name N. cupriacella (van Nieukerken 2003).
N. violellus (Herrich-Schaffer in Stainton, 1851)
Adela violaria Razowski, 1978, unnecessary replacement name.
Determination. This species has a characteristic external appearance, with an
oily (not metallic) tint of uniformly dark brown forewings. Poor quality specimens
can be confused with N. fasciella, from which N. violella differs by the absence of a
forewing fascia, longer male antennae (2.5-3.0x forewing length) and shorter labial
palpi (0.95—1.05x vertical eye diameter in males). Females of N. violella differ from
females of N. cupriacella auct. by presence of an epiphysis and shorter labial palpi
covered almost exclusively by black hairs (for head photos, see van Nieukerken 2003).
Nomenclature. For nomenclature and authorship of this species consult
Karsholt (1996) and Kozlov (2002).
N. prodigellus (Zeller, 1853), sp. rev.
Nemotois auricellus Ragonot, 1874, syn. n.
Nemotois splendidus Staudinger, 1880.
Determination. N. prodigellus possesses no epiphysis, and by this character
can easily be distinguished from other species of the fasciella species group (listed
below) except for N. istrianellus and N. cupriacella. From both these species it differs
by the presence of a distinct dark brown spot at the base of the R stem; additionally,
from N. istrianellus it differs by bronze to dark bronze forewing background colour
and by the base of the male antenna, which is not thickened by semi-erect scales. In
the male genitalia N. prodigellus differs from N. istrianellus by the shape of the
valvae, which are almost triangular with narrow tips.
122 KozLov: Checklist of European species of Nemophora
Nomenclature. There has been a long-lasting confusion about the identity of
N. prodigellus, the species has sometimes been attributed to Heinemann (1870), or con-
sidered sensu Heinemann. In fact, both Zeller (1853) and Heinemann (1870) provided
descriptions of the same species, and Zeller is thus the author of this name. Direct com-
parison of lectotypes of all three taxa involved showed that they are conspecific. Since
all three names have been used until recently, the principle of priority is applicable, and
the senior subjective synonym, N. prodigellus (Zeller, 1853), is to be used as the valid name.
Another confusing story concerns the suggested synonymy between N. prodigel-
lus and N. inauratella that has been repeated by several authors. It is based on
misidentification of the latter species by Peyerimhoff (1872) and as such has no influ-
ence on the synonymy. The syntypes of N. inauratella (MNHN) are conspecific with
N. dumerilella.
N. fasciella (Fabricius, 1775)
Tinea schiffermillerella [Denis et Schifermuller], 1775.
Nemotois annae Zeller, 1853, syn. n.
Nemotois purpureus Stainton, 1867, syn. n.
Determination. The species is variable in forewing colour and in development
of the fascia; in particular, southern populations are darker, with more expressed
metallic tint of the forewing. The dark brown spot at the base of the R stem is also
variable in size and can easily be overlooked in some specimens. The following
species are most similar to N. fasciella:
¢ albiciliellus, from which N. fasciella differs by the brown colour of the hindwing
cilia, shorter labial palpi (palpus length 1.2-1.4x vertical eye diameter in males) and
uniformly brown piliform scales covering the labial palpi;
¢ violellus, from which N. fasciella differs by the presence of a fascia and by a metallic
tint of the forewing;
¢ barbatellus and N. mollella, from which N. fasciella differs by presence of a dif-
fuse but distinct dark brown spot (diameter approximately equal to the width of
fascia) near the tornal margin of forewing, and the slightly larger size (forewing
length 5.4-7.2 mm).
Nomenclature. The synonymization of N. purpurea and N. annae with
N. fasciella is based on investigation of the type specimens of all three taxa (all
deposited in NHM). |
N. barbatellus (Zeller, 1847)
Nemotois chalcochrysellus Mann, 1855.
Nemotois constantinella Baker, 1888.
Nemotois demaisoni Ragonot, 1889.
Nemotois padrejusto Agenjo, 1965, nomen nudum.
Nota lepid. 26 (3/4): 115-126 123
Determination. Closest to N. mollella, from which it differs by the presence
of a horizontal row of long (reaching beyond the lateral margin of compound eyes)
piliform scales above antennal sockets. The labial palpi are longer than in N. mollella
(1.2-1.7x vertical eye diameter in males) and densely covered with long piliform
scales, which are dark brown to black, at least on the external face of the palp.
Nomenclature. WN. barbatellus has for a long time erroneously been considered
as a senior subjective synonym of N. albiciliellus (see below for details). The name
N. padrejusto is nomen nudum; the specimens to which Agenjo (1965) applied this
name were later on misidentified by Vives Moreno (1991) as N. minimella ([Denis &
Schiffermüller]).
N. mollella (Hübner, [1813])
Nemotois molellus Hartmann, 1880, incorrect subsequent spelling.
Nemotois glabrata Meyrick, 1922, syn. n.
Determination. Although this species seems difficult to misidentify, confu-
sions with other species are surprisingly frequent (Küppers 1980); therefore only
little reliable information about N. mollella is available. This species is closest to
N. barbatellus, from which it differs by the less hairy male head (a tuft of piliform
scales never reaches the lateral margin of the compound eyes) and the shorter labial
palpi (1.1-1.3x vertical eye diameter in males), which are sparsely covered with short
brown piliform scales. From N. prodigellus, with which it is most frequently confused,
it differs by the presence of an epiphysis, and from N. minimella by the absence of a
brown spot at the base of the R stem in the forewing.
Nomenclature. The spelling of this name was nearly consistent during almost
two centuries; unfortunately Wojtusiak (1996) used the incorrect subsequent spelling.
The new synonymy is established on the basis of the investigation of the type of
N. glabrata (deposited in NHM). Note that the description of N. glabrata by
Küppers (1980) is misleading as it is probably based on misidentified specimens of
N. istrianellus.
N. minimella (|Denis & Schiffermüller], 1775)
Nemotois schiffermillerellus var. lenellus (Zeller, 1853).
Determination. The species is easy to recognise by its small size (forewing
length 4.5-5.7 mm) and by the long (>0.15x forewing length) brown spot at the base
of the R stem in the forewing.
Nomenclature. Heydenreich (1851) published the name ‘Nematois lenellus
Mn.’ without description; I therefore regard it as a nomen nudum. Investigation of the
lectotype of N. lenellus (deposited in NHM) confirmed the synonymy, which was
established by Küppers (1980).
124 KozLov: Checklist of European species of Nemophora
N. dumerilella (Duponchel, [1839])
Adela inauratella Duponchel, 1844.
Tinea basochesella Hübner, [1824], nomen oblitum.
Determination. This species can easily be recognised by the presence of
bright yellow scales at least on the internal part of the dark brown forewing fascia and
by the very short labial palpi (not exceeding 0.7x vertical eye diameter in males).
Nomenclature. The study of the types of N. inauratella (deposited in MNHN)
confirmed that they are conspecific with N. dumerilella.
The name Nemotois fervidellus Z. was included in the catalogue by Heydenreich
(1851) whthout description; it is thus a nomen nudum. Zeller (1853: 83) provided
some morphological and distributional details for two undescribed taxa in his descrip-
tion of N. dumerilella; these were referred to as ‘fervidellus Mann in lit.’ and
‘zelleriellus Dahlbom in lit.’. However, since Zeller mentioned that these forms do not
even deserve infrasubspecific status, these names remain unavailable.
N. albiciliellus (Staudinger, 1859), sp. rev.
Nemotois beryllopa Meyrick, 1935, syn. n.
Determination. WN. albiciliellus can be easily distinguished from N. barbatellus
by the snow-white scales which dorsally cover the labial palpi, and by the white pili-
form scales on the inner face of the palpus. From N. fasciella it differs by the white
cilia of the hindwing, the longer labial palpi (1.4-1.6x vertical eye diameter in males),
and the colour of the piliform scales, covering the labial palpi: in N. albiciliellus they
are usually white on the inner face and brown on the outer face of the palpus.
Nomenclature. N. albiciliellus was erroneously synonymized with N. barba-
tellus long ago (Wocke 1871), and subsequent authors uncritically followed this
synonymy. However, investigation of the type specimens of both species (deposited in
MNB and NHM) demonstrated that this synonimization was incorrect.
N. associatella (Zeller, 1839)
Tinea megerlella Hubner, [1810], nomen oblitum.
Determination. Differs from other European Nemophora by the medial posi-
tion of the wide forewing fascia, and by the absence of a distinct pattern in both basal
and apical halves of the forewing; its identity in Europe seems to cause no problems
so far.
Nomenclature. This species was erroneously placed into the genus Adela
Latreille by several authors including Wojtusiak (1996), and this generic placement
was uncritically followed by many researchers, including myself (Kozlov & Kaila
2002). However, investigation of the male antennal structures surprisingly revealed
that the antennal pegs of N. associatella are of the Nemophora type, not of the Adela
type (see Nielsen 1980). Therefore N. associatella is herewith transferred to the genus
Nemophora. For identity of N. megerlella, see Kozlov & Kaila (2002).
Nota lepid. 26 (3/4): 115-126 125
Acknowledgements
I am grateful to all colleagues who made this long-lasting study feasible by loan or donation of impor-
tant specimens, sending of reprints and colour slides as well as replying to numerous inquiries, namely:
B. K. Byun, D. R. Davis, T. Hirowatari, P. Huemer, J. Jalava, O. Karsholt, N. P. Kristensen, T. Kumata, A.
Kun, J. F. Landry, M. Lödl, A. Lvovsky, W. Mey, K. Mikkola, J. Minet, S. Moriuti, E. S. Nielsen, E. J.
van Nieukerken, K. T. Park, G. S. Robinson, L. Ronkay, D. Rusti, K. Sattler, M. Shaffer, S. Sinev, I.
Svensson, K. R. Tuck, A. Vives Moreno, T. Yasuda, and many others. I appreciated financial support from
the British Council and SYS-Resource programme for study of the NHM collections, from Biod-Iberia
programme for study of the collections of the Museo Nacional de Ciencas Naturales in Madrid, from the
Smithsonian Institution for a short-term fellowship, and from the Academy of Finland for research
exchange visits to zoological museums in Budapest, Bucharest, and St. Petersburg.
References
Agenjo, R. 1965. Catalogo ordenador de los lepidöpteros de Espana. Familias: Micropterygidae,
Eriocraniidae, Hepialidae, Adelidae, Lithocolletidae, Argyresthiidae, Plutellidae, Epermeniidae,
Coleophoridae (= Eupistidae), Elachistidae y Douglasidae. — Graellsia 21: [168]-[ 193].
Duponchel, P. A. J. [1839] 1838. Nocturnes. — /n: J. B. Godart & P. A. J. Duponchel, Histoire naturelle
des Lépidoptères ou Papillons de France 8. — Crevot, Paris. 720 pp.
Fischer von Röslerstamm, J. E. 1834-[1843]. Abbildungen zur Berichtigung und Ergänzung der
Schmetterlingkunde, besonders der Microlepidopterologie, als Supplement zu Treitschke’s und
Hübner’ europaeischen Schmetterlingen, mit erläuterndem Text. — J. C. Hinrichs'schen Buchhand-
lung, Leipzig. 308 pp., 100 pls.
Hampson, G. F. 1918. Some small families of the Lepidoptera which are not included in the key to the
families in the Catalogue of Lepidoptera Phalaenae, a list of the families and subfamilies of the
Lepidoptera with their types and key to the families. — Novitates Zoologicae 25: 366-394.
Heinemann, H. 1870. Die Schmetterlinge Deutschlands und der Schweiz. Abt. 2. Kleinschmetterlinge.
Bd. 2. Die Motten und Federmotten. — C. A. Schwetschke u. Sohn, Braunschweig. 825 pp.
Hemming, F. 1937. Hübner: A bibliographical and systematic account of the entomological works of
Jacob Hübner, and of the supplements thereto by Carl Geyer, Gottfried Franz von Frölich and
Gottlieb August Wilhelm Herrich-Schäffer. — Royal Entomological Society of London, London. Vol. 1,
xxxIv + 605 pp.; Vol. 2, x1 + 274 pp.
Herrich-Schäffer, G. A. W. [1847]-1855. Systematische Bearbeitung der Schmetterlinge von Europa 5. Die
Schaben und Federmotten. — G. J. Manz, Regensburg. 394 pp., 124 pls.
Heydenreich, G. H. 1851. Lepidopterorum Europæorum catalogus methodicus. Systematisches
Verzeichniss der Europaeischen Schmetterlinge. — J. Klinkhardt, Leipzig. [2] + 131 + [2] pp.
Hübner, J. 1796-[1836]. Sammlung europäischer Schmetterlinge. VIII. Tineidae — Schaben. — Auf
Rosten der Liebhaber, Augsburg. 78 pp., 71 pls.
ICZN. 1999. International code of zoological nomenclature, adopted by the International Union of
Biological Sciences. 4th edn. — International Trust for Zoological Nomenclature, London. xxix + 306 pp.
Joannis, J. d., 1922. Duponchel ou Zeller? note complémentaire. — Bulletin de la Société Entomologique
de France 17: 277-280.
Karsholt, ©. 1996. Note 350. P. 301. — Jn: O. Karsholt & J. Razowski (eds.), The Lepidoptera of Europe:
A distributional checklist. — Apollo Books, Stenstrup.
Kovacs, Z. & S. Kovacs. 1999. Familia Adelidae (Lepidoptera) in Romania. — Buletin de Informare al
Societatea Lepidopterologica Romania 10: 9-66.
Kozlov, M. V. 1997. Family Adelidae. Pp. 274-289. — In: V. S. Kononenko (ed.), Key to the Insects of
Russian Far East. Vol. V. Trichoptera and Lepidoptera, pt. I. — Dalnauka, Vladivostok (in Russian).
Kozlov, M. V. 2002. Nemotois violellus Herrich-Schaeffer in Stainton, 1851 (currently Nemophora vio-
lella; Insecta, Lepidoptera): proposed conservation of the specific name. — Bulletin of Zoological
Nomenclature 59: 32-35.
Kozlov, M. V. & L. Kaija. 2002. The identity of Tinea megerlella Hübner, [1810] — a long-lasting confu-
sion between Elachista (Elachistidae) and Adela (Adelidae). — Nota lepidopterologica 24: 3-10.
Kozlov, M. V. & G. S. Robinson. 1996. Identity and distribution of two dimorphic oriental fairy moths —
Nemophora decisella (Walker, 1863) and Nemophora cantharites (Meyrick, 1928) (Lepidoptera,
Adelidae). — Nota lepidopterologica 18: 39-56.
126 KozLov: Checklist of European species of Nemophora
Küppers, P. V., 1980. Untersuchungen zur Taxonomie und Phylogenie der westpaläarktischen Adelinae
(Lepidoptera: Adelidae). — M. Wahl, Karlsruhe. 497 pp.
Kyrki, J. 1981. Nemophora amurensis \ta-Fennoskandissa (Lepidoptera, Incurvariidae). — Notulae
Entomologicae 61: 125-129.
Leraut, P. 1997. Liste systématique et synonymique des Lépidoptères de France, Belgique et Corse
(deuxieme édition). — Universa, Wetten. 526 pp.
Meyrick, E. 1912. Lepidoptera Heterocera (Tineae). Fam. Adelidae. — P. Wytsman (ed.), Genera
Insectorum. Fasc. 133. — V. Verteneuil & L. Desmet, Bruxelles. 12 pp., 1 pl.
Nielsen, E. S. 1980. A cladistic analysis of the Holarctic genera of adelid moths (Lepidoptera:
Incurvaroidea). — Entomologica Scandinavica 11: 161-178.
Nielsen, E. S. 1985. The nomenclature of the two species named Tinea pfeifferella by J. Hubner (1813)
(Lepidoptera: Heliozelidae, Adelidae). — Entomologist's Gazette 36: 23-27.
Nieukerken, E. J. van. 2003. Comment on the proposed conservation of the specific name of Nemotois
violellus Herrich-Schaeffer in Stainton, 1851 (currently Nemophora violella; Insecta, Lepidoptera).
— Bulletin of Zoological Nomenclature 60: 54—57.
Nye, I. W. B. & Fletcher, D. S. 1991. The generic names of moths of the world. Vol. 6. Microlepidoptera.
— Natural History Museum, London. xxix + 368 pp.
Peyerimhoff, H. de. 1872. Description de quelques Lépidoptères nouveaux ou peu connus. — Annales de
la Société Entomologique de France (ser. 5) 2: 7-17.
Poda, N. 1761. Insecta musei Gr&censis, qu& in ordines, genera et species juxta Systema Naturae Caroli
Linnaei. — Heredum Widmanstadii, Gr&cii. 18 + 127 pp., 2 pls.
Powell, G. A. 1969. A synopsis of Nearctic Adelid moths, with descriptions of new species (Incurvarii-
dae). — Journal of Lepidopterists’ Society 23: 211-240. |
Razowski, J. 1978. Heteroneura, Adeloidea. Motyle (Lepidoptera) Polski, Cz. III. Monografie fauny
Polski 8. — Panstwowe Wydawnictwo Naukowe, Warszawa & Krakow. 137 pp., 11 pls.
Reiprich, A. 1978. Adela basella Eversman — eine neue Schmetterlingsart für Mitteleuropa aus Slovensky
Ray in der Slowakei (Lep. Incurvariidae). — Biologia (Bratislava) 33: 423-430.
Sommerer, M. D. 2002. To agree or not to agree: The question of gender agreement in the International
Code of Zoological Nomenclature. — Nota lepidopterologica 25: 191-204.
Suomalainen, E. 1978. Two new cases of parthenogenesis in moths. — Nota lepidopterologica 1:
65-68.
Vives Moreno, A. 1991. Catalogo sistemätico y sinonimico de los Lepidopteros de la Peninsula Iberica y
Baleares (Insecta: Lepidoptera). — Ministerio de Agricultura, Madrid. 378 p.
Wocke, M. F. 1871. Microlepidoptera. Pp. 201-346. — In: O. Staudinger & M. F. Wocke, Catalogue ou
Enumération Méthodique des Lépidoptères qui habitent le territoire de la Faune Européenne. — Dresden.
Wojtusiak, J. 1996. Adelidae. Pp. 28-29. — In: O. Karsholt & J. Razowski (eds.). The Lepidoptera of
Europe: A distributional checklist. — Apollo Books, Stenstrup.
Zaguljaev, A. K. 1978. Fam. Adelidae — long-horn moths. Pp. 92-112. — In: G. S. Medvedev (ed.), Key
for determination of Insects of the European Part of the USSR. Vol. IV, Lepidoptera, pt. 1. — Nauka,
Leningrad. [in Russian]
Zeller, P. C. 1839. Versuch einer naturgemäßen Einteilung der Schaben. — Isis von Oken 23: 167-219.
Zeller, P. C. 1853. Sieben Tineaceen-Gattungen. — Linnaea Entomologica 8: 1-87.
Nota lepid. 26 (3/4): 127-136 127
Nectar plants and larval food-plants of the genus
Glossotrophia (Geometridae, Sterrhinae): studies on pollen
grains attached to museum specimens
AXEL HAUSMANN! & STEFAN DÔTTERL?
' Zoologische Staatssammlung München, Münchhausenstr. 21, D-81247 München, Germany; e-mail:
* Lehrstuhl Pflanzensystematik, Universität Bayreuth, Universitätsstrasse 30, D-95440 Bayreuth,
Germany, e-mail:
[email protected]
Abstract. 544 specimens of the Geometrid moth genus Glossotrophia, belonging to nine species,
were examined under the stereomicroscope searching for attached pollen grains. Pollen was found on
105 specimens (8 species). In addition we identified pollen grains of further 39 specimens under the
scanning electron microscope. Pollen grains attached to the tip of the abdomina of nine females strongly
indicate egg deposition at or in those flowers (mainly Caryophyllaceae). Pollen grains attached to the
proboscis or neighbouring structures, most frequently found in the subgenus Glossotrophia, and here
preferably in females, are suggestive of nectar plant use. The subgenus Glossotrophia turned out to be
almost exclusively specialised on Caryophyllaceae nectar plants (mainly Silene, Dianthus), whereas the
other subgenera utilize a wider spectrum of nectar sources. This finding does well correspond to the
known spectra of larval host-plants. A strong positive correlation was found between length of proboscis,
preference for Caryophyllaceae, and frequency of pollen grain attachment. Collectively, these results
demonstrate that the analysis of pollen loads in museum specimens (though sometimes being very old)
may provide valuable data on host use patterns through time and space.
Key words. Geometridae, Sterrhinae, Glossotrophia, pollen load, museum specimens, nectar sources,
host plants, Caryophyllaceae
Introduction
Pollen loads have previously been studied in different groups of animals, such as mam-
mals (Goldingay et al. 1991; Hacket & Goldingay 2001), birds (Hopper 1980; Wooller
et al. 1983; Borgella et al. 2001), bees (Bernhardt & Walker 1984; Westrich & Schmidt
1987; Camillo & Garofalo 1989; Abrol 1990; Nazarov 1995; Muller 1996; Nazarov &
Gerlach 1997), flies (Krannitz & Maun 1991; Kearns 1992), butterflies (Cruden &
Hermann-Parker 1979; Hawkeswood 1985; Tobar et al. 2001) and moths (Esche 1992;
Gregg 1993; Nazarov & Efetov 1993). This is an indirect method to get information on
nectar-plant relationships of the studied specimens. Pollen load can be used as a marker
for migration (Gregg 1993) or for determination of the extent of host-plant specialisa-
tion (Westrich & Schmidt 1987; Müller 1996). Further it was used to determine the
role of specific animals as pollinators of particular plant species (Hopper 1980;
Goldingay et al. 1991; Hacket & Goldingay 2001) and to discover food sources and
food niche overlap among sympatric species (Camillo & Garofalo 1989; Esche 1992).
We here study pollen loads of the taxonomically difficult genus Glossotrophia.
Identification and systematics of this genus were subject of various previous papers
(Hausmann 1992, 1993a, b, 1994, 1996). Some taxa of this genus have a very long
proboscis. The length of the proboscis is about 10-13mm in subgenus Glossotrophia,
7-10mm in subgenus Libanonia, 4-6mm in subgenus Parenzanella, and only 3-4mm
in subgenus Microglossotrophia (Hausmann 1993b).
© Nota lepidopterologica, 31.01.2004, ISSN 0342-7536
128 HAUSMANN & DOTTERL: Nectar plants and larval foot-plants of Xanthorhoe
The long proboscis of the nominotypical subgenus Glossotrophia is unique in
Geometridae and inspired Prout (1913) to base the scientific name on this feature. The
curved proboscis externally projects from the pupa and is much longer than the whole
pupa (Hausmann 2001, text fig. 113). As until now nothing is known about nectar
plant interactions of the adult moths and data on larval host-plant relationships are
scarce (Tab. 2), we aimed to analyse pollen loads attached to different body parts of
the different sexes and taxa of Glossotrophia in order to obtain more information on
food-plants. Using museum specimens, we show that analysis of pollen loads in
museum specimens (though sometimes being very old) may provide valuable indica-
tors of host use patterns through time and space.
Material and Methods
Light microscopy. 544 specimens of the collection material of the genus
Glossotrophia in the Zoologische Staatssammlung Miinchen (ZSM) (Tab. 2) were
examined under a stereomicroscope in order to determine a statistical pattern about
the frequency of pollen loads in the genus Glossotrophia. In a standardised way we
examined each specimen for 30sec. All details, such as label data, sex, position of
pollen grains and if possible pollen type were noted (special labels were attached to
specimens with pollen grains). Reared specimens were excluded from the study. If
long series were available, representative random samples from selected localities
were examined. Real frequency of pollen grain attachment is underestimated, since
(1) some pollen grains have surely been overlooked given the limited time of exami-
nation, (2) doubtful observations of grains were scored as negative findings, (3) during
collecting usually the more beautiful and thus younger specimens are chosen, which
may not had visited flowers, (4) possibly some reared specimens, that are not labelled
as such, were included in the study and (5) some specimens could have lost the pollen
grains after collecting.
SEM studies: 39 further specimens where pollen was visible under the stereomi-
croscope were chosen for detailed examination and identification of the pollen grains
(these specimens are not included in the frequency analysis). All pollen grains were
studied if there were just a few; otherwise we examined a random sample. The air-
dried pollen grains from the moths were taken up on double faced adhesive tape, sput-
tered with gold and studied under a scanning electron microscope (Philips XL 30
ESEM) at 20 kV. We used the works of Punt (1976), Punt et al. (1981), Punt & Clarke
(1980, 1981, 1984), and Punt & Hoen (1995) to identify pollen grains.
Statistical analysis: To analyse the data we employed a Chi’-test (Rohlf and Sokal
1995; Sokal and Rohlf 1995). If the expected value for at least one cell was equal to
or smaller than 5 we carried out Fisher’s exact test instead.
Results
We studied under the SEM more than 250 pollen grains attached to 39 specimens
belonging to 10 Glossotrophia taxa (6 species; Tab. 1). More than 60% of these grains
could be identified as Caryophyllaceae pollen. The subgenus Glossotrophia exhibited
Nota lepid. 26 (3/4): 127-136 129
the highest specialisation to plants of this plant family: 5 of the 6 examined taxa had
exclusively Caryophyllaceae pollen grains, mostly from Silene or Dianthus (Figs. 2a,
b). The only exception was Glossotrophia diffinaria where, in addition to Silene
pollen, grains from Linum catharticum (Fig. 2c), cf. Polygonum and an unknown
pollen grain were found. In contrast, examination of taxa from the subgenera
Libanonia and Parenzanella revealed pollen types from a diverse spectrum of plant
families. On one female (specimen Nr. 14b, Tab. 1) we found Caryophyllaceae pollen
grains on the last segment of the abdomen.
105 specimens with pollen grains were found among 544 examined specimens
studied under the stereomicroscope (Tab. 3). Though it was not possible to identify the
plant species or families under the stereomicroscope, most of the pollen grains
(>70%) seemed to correspond well to the Caryophyllaceae pollen grains as examined
under the SEM.
We found pollen in all subgenera and on most studied taxa (Tab. 3). Especially in
the subgenus Glossotrophia (Chi’ j-,=6.36; p=0.012) pollen occurred more frequent-
ly on females than on males. No pollen grains could be found on males of the sub-
genus Microglossotrophia. In the remaining three subgenera, 6-21% of the males car-
ried pollen grains (difference between these three subgenera not significant:
Chi’ y2=3.35; p=0.19). In females there were big differences with regard to pollen
load at subgeneric level (Chi*,-;=19.8; p<0.001). Females of the subgenus
Glossotrophia had an exceptionally high load (pollen grains on 35% of the studied
specimens).
In all subgenera most pollen was found attached to head parts (Tab. 4). 86-100%
of the pollen-positive specimens in the different subgenera had pollen grains at least
on one of the head parts. When looking only at the head, the most important structure
for pollen load in all subgenera, except for Parenzanella, was the proboscis. In the
subgenus Glossotrophia, for example, we found 70% of the ‘head-positive’ specimens
carrying pollen on the proboscis, in Parenzanella only 38% (Chi? ;=6.76; p<0.01).
In the latter subgenus, the most important structure of the head for pollen load was
the eye.
Comparing the sexes with respect to pollen attachment to different body parts
there are barely differences with one exception: In 15% of the cases pollen could be
found on the tip of abdomen on females, but pollen grains were never attached to the
tip of abdomen on males (Fig. 1).
Discussion
Most species of the Silene vulgaris and S. dioica-groups are considered ‘good’
nectar plants for nocturnal moths. They produce a lot of nectar in the late afternoon
or evening until midnight (Witt et al. 1999). Pollen grains attached to eyes, palpi,
frons or proboscis of various Glossotrophia species may be interpreted as strong indi-
cation of nectaring at Silene species, as does the frequent presence of pollen grains at
the underside of wings (mainly at the basis). In 105 of 544 examined specimens
(19%) pollen grains were found, almost all of them attached to the mouthparts or
130 HAUSMANN & DOTTERL: Nectar plants and larval foot-plants of Xanthorhoe
0,6
Y
males (n = 46)
4
[| females (n = 59)
0,5
0,4
0,3
0,2
0,1
0,0
proboscis wing tip abdomen
abdomen
Fig. 1: Sex-specific attachment of pollen grains to various body parts of Glossotrophia moths in rela-
tion to specimens with pollen grains (results from stereo microscope examination). Bars with the same
letters are not significantly different (p < 0.05). Comparisons were made only within single body parts
(*: Fisher’s exact test).
close to them, and most of the pollen grains apparently belonged to the family
Caryophyllaceae. Thus pollen grains attached to collection specimens revealed that
Caryophyllaceae are important as food source for Geometrid moths of the genus
Glossotrophia. The authors have no explication for the extraordinarily high frequen-
cy of pollen grains at the eyes of G. asellaria (subgenus Parenzanella), though pollen
frequency was low at the proboscis of this species (Tab. 4).
The following conclusions are drawn from our studies:
(1) Species of the subgenus Glossotrophia seem to feed nearly exclusively on nec-
tar from Caryophyllaceae, mainly Silene and Dianthus. Only the Turkish G. diffinaria
was recorded also on Linaceae, and probably Polygonaceae. One attached
Orchidaceae pollinarium was observed in G. confinaria prouti (Fig. 2d). The other
subgenera had a much wider spectrum of nectar-plants (Tab. 1).
(2) Overall females bear pollen grains more often than males. This difference was
pronounced in the subgenus Glossotrophia, but absent in Libanonia, Parenzanella
and Microglossotrophia. Our findings might indicate that females visit flowers more
often than males. Since in other moths adult feeding affects the size or number of off-
spring produced by a female (e.g. Boggs 1987; Stevens et al. 2002), also Glossotrophia
females might be in greater need of carbohydrate intake.
(3) Attachment of pollen grains at the last segment(s) of female abdomen (as found
in 9 females) may be interpreted as strong indication of egg deposition into the calyx
Nota lepid. 26 (3/4): 127-136 131
Fig. 2: Pollen found at different Glossotrophia taxa. (a) Caryophyllaceae pollen attached to head parts
of Glossotrophia confinaria, (b) Pollen grain of the Silene dioica-group, (e) Pollen grain of Linum
catharticum, (d) Pollinium of Platanthera (Orchidaceae) attached to head of Glossotrophia confinaria
prouti (northern Italy).
of the flower. No males were found with pollen grains at the tip of the abdomen. In
one female of Glossotrophia confinaria prouti (specimen Nr. 14, Tab. 1) eight
Caryophyllaceae pollen grains were identified under the SEM. Caryophyllaceae as
larval host-plants are already known for this species (Tab. 2). Similarly pollen grains
at the tip of female abdomen have been observed under the stereo microscope in nine
further females belonging to G. confinaria, G. diffinaria, G. alba, G. mentzeri and
G. rufomixtaria (all subgenus Glossotrophia). Pollen grains could be identified in
additional studies under the SEM as ‘Caryophyllaceae’.
(4) Known larval host-plants for the subgenus G/ossotrophia are largely restricted
to the Caryophyllaceae genus Silene. The Spanish G. rufomixtaria was recorded also on
Gypsophila and, reputedly, on Dianthus (references in Tab. 2). Thus, larval host-plants
do well correspond to the preferred adult nectar sources (Tab. 2) in this subgenus. This
may indicate a narrow niche of the adult moths, 1.e. nectaring, mating and oviposition
would all occur close to host-plants. In the monobasic subgenus Parenzanella (includ-
ing only G. (P) asellaria), however, larval host-plants of many other families
(Zygophyllaceae, Scrophulariaceae, Lamiaceae; Brassicaceae) are recorded (Haus-
mann in press). Similarly, a much wider spectrum of nectar sources was observed than
in the subgenus Glossotrophia.
(5) Length of proboscis is about 10-13mm in subgenus Glossotrophia, 7-10mm
in subgenus Libanonia, 46mm in subgenus Parenzanella, and only 34mm in sub-
132 HAUSMANN & DOTTERL: Nectar plants and larval foot-plants of Xanthorhoe
genus Microglossotrophia (Hausmann 1993b). Thus, length of proboscis reveals to be
strongly correlated to frequency of pollen grain attachment to proboscis and palpi
(Tabs. 2, 4). While this frequency is 21.6% in Glossotrophia, the subgenus with the
longest proboscis, it is only 1.6% in Microglossotrophia, the subgenus with the short-
est proboscis, and about 6% in Libanonia and Parenzanella, the subgenera with
medium sized probosci. These differences are significant (Chi’j-;=33.3; p<0.001).
Taking into consideration the results discussed under (1), correlation results also
between length of proboscis and Caryophyllaceae as nectar source. Analyzing the
SEM results, Caryophyllaceae pollen was found on 25 of in total 28 studied speci-
mens of Glossotrophia, the subgenus with the longest proboscis, while
Caryophyllaceae pollen was only found on 4 of in total 11 studied specimens of sub-
genera with shorter probosci (difference significant in Fisher’s exact test; p=0.002).
Acknowledgements
We are grateful to Ulrich Meve, Georg Acker and Rita Grotjahn for their introduction and supervision
on the scanning electron microscope, and to Konrad Fiedler for valuable discussions about the manu-
script and the statistical analyses. We thank Wim Punt for help on identification of some pollen grains.
Gunter Gerlach (Botanical Garden Munich) kindly helped with the identification of an Orchidaceae
pollinium.
References
Abrol, D. P. 1990. Studies on the pollen loads and pollination efficiency of some bees. — Journal of
Animal Morphology & Physiology 37: 147—150. |
Bernhardt, P. & K. Walker 1984. Bee foraging on 3 sympatric species of australian Acacia. —
International Journal of Entomology 26: 322-330.
Boggs, C. L. 1987. Ecology of nectar and pollen feeding in Lepidoptera. Pp. 369-391 in: F. Slansky Jr.
& J. G. Rodriguez (eds.), Nutritional ecology of insects, mites, spiders, and related invertebrates —
current issues. — John Wiley & Sons, New York.
Borgella, R. J., A. A. Snow & T. A. Gavin 2001. Species richness and pollen loads of hummingbirds using
forest fragments in southern Costa Rica. — Biotropica 33: 90-109.
Camillo, E. & C. A. Garofalo 1989. Analysis of the niche of two sympatric species of Bombus
(Hymenoptera, Apidae) in southeastern Brazil. — Journal of Tropical Ecology 5: 81-92.
Cruden, R. W. & S. M. Hermann-Parker 1979. Butterfly pollination of Caesalpinia pulcherrima with
observations on a psychrophilous syndrome. — Journal of Ecology 67: 155-168.
Esche, T. 1992. Konkurrieren Nachtschmetterlinge um Blüten? — Dissertation, Albert-Ludwig-
Universität Freiburg. 194 pp.
Forster, W. & T. A. Wohlfahrt 1981. Die Schmetterlinge Mitteleuropas, Band 5 (Spanner). — Franckh’sche
Verlagsbuchhandlung, Stuttgart. 312 pp.
Goldingay, R. L., S. M. Carthew & R. J. Whelan 1991. The importance of non-flying mammals in polli-
nation. — Oikos 61: 79-87.
Gregg, P. C. 1993. Pollen as a marker for migration of Helicoverpa armigera and Helicoverpa puncti-
gera (Lepidoptera: Noctuidae) from western Queensland. — Australian Journal of Ecology 18:
209-219.
Hackett, D. J. & R. L. Goldingay 2001. Pollination of Banksia spp. by non-flying mammals in north-east-
ern New South Wales. — Australian Journal of Botany 49: 637-644.
Hausmann, A. 1992. Nachtrag zur Geometridenfauna Jordaniens (Lepidoptera, Geometridae). —
Nachrichtenblatt bayerischer Entomologen 41: 98—100.
Hausmann, A. 1993a. Der Aussagewert struktureller Unterschiede des 8. Sternits. Beitrag zur Systematik
der italienischen Vertreter der Gattung Glossotrophia Prout, 1913 (Lepidoptera, Geometridae). —
Atalanta 24: 265-297.
Hausmann, A. 1993b. Zweiter Beitrag zur Taxonomie und Systematik der Gattung Glossotrophia Prout,
1913 (Lepidoptera: Geometridae, Sterrhinae). — Mitteilungen der Miinchner Entomologischen
Gesellschaft 83: 77-107.
Nota lepid. 26 (3/4): 127-136 133
Hausmann, A. 1994. Dritter Beitrag zur Revision der Gattung Glossotrophia Prout, 1913 nebst
Beschreibung zweier neuer Gattungen (Lepidoptera: Geometridae, Sterrhinae). — Nota lepidoptero-
logica 17: 195-211.
Hausmann, A. 1996. Zwei neue Geometridenarten aus Vorderasien (Insecta, Lepidoptera, Geometridae).
— Spixiana Suppl. 22: 3-10.
Hausmann, A. 2001. Introduction. Archiearinae, Orthostixinae, Desmobathrinae, Alsophilinae,
Geometrinae. 282 pp. — In: A. Hausmann (ed.), The Geometrid Moths of Europe 1. — Apollo Books,
Stenstrup.
Hausmann, A., in press. Sterrhinae. 600 pp. — Jn: A. Hausmann (ed.), The Geometrid Moths of Europe
2, — Apollo Books, Stenstrup.
Hawkeswood, T. J. 1985. The role of butterflies as pollinators of Acacia bidwillii (Mimosaceae) at
Townsville, northern Queensland. — Australian Journal of Botany 33: 167-174.
Hopper, S. D. 1980. Bird and mammal pollen vectors in Banksia communities at Cheyne Beach western
Australia. — Australian Journal of Botany 28: 61-76.
Kearns, C. A. 1992. Anthophilous fly distribution across an elevation gradient. - American Midland
Naturalist 127: 172-182.
Krannitz, P. G. & M. A. Maun 1991. Insect visitors to the guelder rose Viburnum opulus var. opulus
(Caprifoliaceae) in London, Ontario. — Canadian Field Naturalist 105: 13-17.
Milliere, P. 1871. Catalogue raisonné des Lépidopteres des Alpes-Maritimes 2. — Memoires Societe
Scientifice Naturaliste 1873: 1-135.
Muller, A. 1996. Host-plant specialization in western palearctic anthidiine bees (Hymenoptera: Apoidea:
Megachilidae). — Ecology Monographs 66: 235-257.
Nazarov, V. V. 1995. Pollination of Steveniella satyrioides (Orchidaceae) by wasps (Hymenoptera,
Vespoidea) in the Crimea. — Lindleyana 10: 109-114.
Nazarov, V. V. & K. A. Efetov, 1993. On the role of the Crimean Zygaenidae (Lepidoptera) in pollination
of Anacamptis pyramidalis (Orchidaceae). — Zoological Journal 72: 54—67.
Nazarov, V. V. & G. Gerlach 1997. The potential seed productivity of orchid flowers and peculiarities of
their pollination systems. — Lindleyana 12: 188-204.
Punt, W. (ed.) 1976. The northwest European pollen flora, I. — Elsevier, Amsterdam. 145 pp.
Punt, W. & G. C. S. Clarke (eds.), 1980. The northwest European pollen flora, II. — Elsevier, Amsterdam.
265 pp.
Punt, W. & G. C. S. Clarke (eds.) 1981. The northwest Ruropean pollen flora, III. — Elsevier, Amsterdam.
138 pp.
Punt, W. & G. C. S. Clarke (eds.) 1984. The northwest European pollen flora, IV. — Elsevier, Amsterdam.
369 pp.
Punt, W. & P. P Hoen 1995. Caryophyllaceae. — Review of Palaeobotany and Palynology 88: 83-272.
Prout, L. B. 1912-1916. Die spannerartigen Nachtfalter. — /n: A. Seitz (ed.), Die GroBschmetterlinge der
Erde 4. — Verlag A. Kernen, Stuttgart.
Prout, L. B. 1934-1935, additions 1938. Brephinae, Oenochrominae, Hemitheinae, Sterrhinae,
Larentiinae. — In: A. Seitz (ed.), Die Großschmetterlinge der Erde, Suppl. 4. — Verlag A. Kernen,
Stuttgart.
Rohlf, F. J. & R. R. Sokal 1995. Statistical tables. - W. H. Freeman and Company, New York. 199 pp.
Sokal, R. R. & F. J. Rohlf 1995. Biometry. — W. H. Freeman and Company, New York. 887 pp.
Stevens, P., Froud, K. & Jamieson, L., 2002. Effects of adult feeding on longevity and fecundity of
Ctenopseustis obliquana (Lepidoptera: Tortricidae). - New Zealand Journal of Crop and Horticultural
Science 30: 229-234.
Tobar, L. D., C. J. O. Rangel & C. M. Andrade G. 2001. Las cargas polinicas en las mariposas
(Lepidoptera: Rophalocera) de la parte alta de la cuenca del Rio Roble-Quindio-Colombia.
Caldasia 23: 549-557.
Westrich, P & K. Schmidt 1987. Pollen analysis an auxiliary tool to study the collecting behavior of wild
bees (Hymenoptera: Apoidea). — Apidologie 18: 199-214.
Witt, T., A. Jiirgens, R. Geyer & G. Gottsberger 1999. Nectar dynamics and sugar composition in flow-
ers of Silene and Saponaria species (Caryophyllaceae). — Plant Biolology 1: 334-345.
Wooller, R. D., E. M. Russell, M. B. Renfree & P. A. Towers 1983. A comparison of seasonal changes in
the pollen loads of nectarivorous marsupials and birds. — Australian Wildlife Research 10: 311-318.
134
HAUSMANN & DOTTERL: Nectar plants and larval foot-plants of Xanthorhoe
Tab. 1. Examined taxa, number of observed pollen grains, body parts, where grains were attached to, and
identification of pollen types using a SEM.
Specimen Sex Number of
Nr. pollen grains
Pollen grains attached to Pollen type
Glossotrophia (Glossotrophia) confinaria confinaria
1 f 2 leg Silene vulgaris-type
2) m 3 proboscis, palpi, eye Dianthus
3 m 3 wing Silene vulgaris-type
4 m 1 proboscis Silene vulgaris-type
5 m 4 proboscis Silene dioica-group
6 f 4 eye Caryophyllaceae
7 m 4 wing Caryophyllaceae
8 m 9 proboscis, palpi Silene dioica-group
9 m 1 proboscis Silene dioica-group
Glossotrophia (Glossotrophia) confinaria prouti
10 f proboscis, leg Dianthus
11 i 10 , proboscis, eye 4 x Silene dioica-group, 6 x Dianthus
12 m 22 proboscis Dianthus
13 m 2 proboscis Caryophyllaceae
14a f 11 proboscis Dianthus
14b f 8 tip of abdomen Caryophyllaceae
Glossotrophia (Glossotrophia) confinaria scoblei
15 m wing Caryophyllaceae
Glossotrophia (Glossotrophia) diffinaria |
16 f 3 proboscis 1 x cf. Polygonum, 1 x Silene dioica group, 1
x Silene vulgaris-type
17 f 10 proboscis, palpi 9 x Silene vulgaris-type, 1 x unidentified (not
Caryophyllaceae)
18 f 4 proboscis Linum catharticum
19 f 9 proboscis Linum catharticum
20 f 6 proboscis, wing Linum catharticum
Glossotrophia (Glossotrophia) alba alba
21 f 6 proboscis _Caryophyllaceae
22 f 3 proboscis, eye Silene dioica-group
23 iP 2 wing Silene vulgaris-type
24 f 2) proboscis Silene vulgaris-type
Glossotrophia (Glossotrophia) rufomixtaria
25 m 6 proboscis 3 x Dianthus, 3 x Caryophyllaceae
26 if 2 proboscis, eye Silene dioica-group
DR) m 1 proboscis Silene dioica-group
28 m 8 proboscis Caryophyllaceae
Glossotrophia (Libanonia) semitata taurica
29 f 5 proboscis 4 x Caryophyllaceae, 1 x Linum catharticum
30 fi 12 proboscis cf. Polygonum
Glossotrophia (Libanonia) semitata ariana
31 f 7 proboscis cf. Polemonium
32 f 13 proboscis Syringa
33 m 4 proboscis Caryophyllaceae
34 f 10 proboscis Silene dioica-group
35 m 14 proboscis 12 x cf. Polemonium, 2 x unknown (not
Glossotrophia (Parenzanella) asellaria isabellaria
36 tf 13 proboscis
57 f 10 proboscis
Glossotrophia (Parenzanella) asellaria dentatolineata
38 £ 1 proboscis
39 f 7 wing
DN
Caryophyllaceae)
cf. Polemonium
cf. Polemonium
Caryophyllaceae
Syringa
135
127-136
Nota lepid. 26 (3/4)
domly,
imens ran
f spec
10n O
* select
** apparently no Caryophyllaceae pollen
’
Tab. 2. Studied material with results from the analysis of pollen loads
focussing on 2-3 regions, but o
imens;
freared spec
ion oO
lect
mitting se
+ 2LOOLIUUT
“oro9rr1e[nydo19S
‘orooe4ydo347
, svar 4yd0847
pig ROOBOISSRIG
c'e SvaoRIIe[NYydo1NSg
giz, ProdeI[AydoAıe)
| 2299e]]4ydoÂre
- 2809e14qdoÂres
9+, 2899P]TAydoATe)
. 2299eAydo Are
larval food plant
families
| 2B99B]JAUAOAIR")
‘2B99L9[O
| 2B99EIUOUOTO 4,
2899e]JAydoAre
ne) tole) 12) (@)
‘2P99PIUOU9[O4
| 2P998U084[044,
‘2B99PUTT
‘avoor][AydoAie)
| 2299e]JAydoAre
| 289981 AydoAI
| 2P998U08410q4
‘OP99PUIT
‘aeoor|[AydoAre)
| 28998] AydoAI)
| 2U99PPIHOIO
‘orooe AydoAIe)
98998 44do41r
nectar plant families
(1861) HUBIUOM 9 195104 :, ‘(S£6 1) MOI :, (ILST) MINN :, ‘(S£61) MO :, (FOOT) uueWSNEH :, ‘(H2N0Q 9 UUEWSNEH) sarpnıs juasaid Woy Sypnsai
La
La
€I-0l
£TOI
£T-OT
eI-O0l
eI-Ol
el-Ol
el=01
tl!
length of proboscis
(mm)
0001
00077009
0011-0
001-0
008-007
0081-0011
0001-007
0001-0
00117055
0091-001
0017009
0071-007
00ÿ-00€
008-007
th
attached pollen
altitude (m above sea-
level)
specimens WI
AI Ajaeo
JA Â[IB9 — A Ne]
ILA AH ‘AJ-pruu
JIA-PIUU — JA-pruu
X Ajıe9 — JJA-PIU
A Ne] — AI Me]
XI-pruu
— TITA-prat ZA] Afıeo
IA-PIU — JA A]ıeo
X-prut — X] AFRO
SLA QUE — A Apreo
XI Aj1ea
‘TA 938] — A-pruu
XI
JE] ‘ITA Me] — JA-PrUU
ITA 938] = A-PIU
IITA-pruu — JA Afıeo
INA AT — [A-pruu
ITA 938] — [JA-pruu
XI AFIE9 — JA Se]
XI Aıes— A Se]
=)
252%
as“
ets
Rus
ou. &
got.
Pu)
oo Ls
va
ASE
mn ” ©
E
~
6
th
specimens wi
attached pollen in
SEM studies
07
07
th
attached pollen in
specimens wi
binocular studies
UPUU()
udu A
“eIqery Ipneg MS
eAqry “euos|y IS
spuejsı Areur)
ODDO1OW
ureds S
ureds q pue N
Aal)
PIUIPIES “BOISIOD
uejstuoum.um]L
‘uejsıuedydy q
AMI S
uredg ‘oourly S
aD
Aye S
Ayey D
AMI
AIRIS N
BJSOU9 A [PA ‘API N
(PHUIO ET)
BIUOPIILN M “(epsey
axe) AI N ‘(Sadry
sayneH) SOUBLI IS
origin
number of randomly
0€
IE
6l
selected (*)specimens
for stereo microscope
studies
total specimens
present at ZSM
OOS
007
0€
in
a
007
09
Ol
007
OOF
(approx.)
Ir6l
‘\pueig sı]100.43 (viydo.uossoj30401 N) “D
6r6l
“AHUSIIM 11491/7D (pıydo.40SS0]30.121 N) no)
6761 nem]
pup1jodıu DLipjjasp (vJjaupzuaang) D)
€66| "uurwsneH
149319Q1S198 DLID]JasD (DJJ2UDZU24D 4) “DH
£661
‘UUELUSNEH 1242] DLIDjJasD (pjjaupzuadsDg) 1)
9761 ‘THUY2M
DID2UI]OIDJU2P DLID]Jasv (vjjaupzuaang) “DH
(S981 aa)
DLID]]2QDS1 DLIDJJasD (Djjaupzuaıng) 1)
(6981 RAIN)
DLIDUDUOA DLAD]Jasv (DjJjauvzuaIDg) 1)
(281 Oyey>s-ypLu>H)
DLID]]asv DLAD]Jasv (DJjaupzua4ng) “HD
S961 “egg DUDLD DIDINUAS (muoupgtT) 2)
O£6I
“ILO A DOLD) DIDI Was (DIUOUDGIT) 1)
(£981
‘UI[SBID ap) pLipıxmwofna (pryd00SSO]9) “DH
£661
“uuewusney Liazjuau (p1ydodjossojy) 1)
C661 ‘UUPWSNEH
ijjaunig ogjo (piydo.uosso]n) “DH
£661
‘UUEUISNEH pgjp Dq]D (v1ydo.4jossojy) 4)
£I61 ‘Woig puivuffip (p1ydo.ossojyH) “DH
£66] ‘UuEWSNEH
12]9098 vı1puıfuos9 (v1ydo.4JOSSO]D) 1)
€66| "uuewsneH
ynoad piapurfuod (piydoajossojy) “5
(LPT TAYeYOS-Yo9H})
piipuyuod piuvurfuod (p1ydo.d4joOsso]y) *D
Taxon
136
HAUSMANN & DOTTERL: Nectar plants and larval foot-plants of Xanthorhoe
Tab. 3. Frequency of pollen grains attached to Glossotrophia specimens (selected taxa) after examination
under a stereomicroscope.
Taxon
total examined
with pollen grains
males females males females
Glossotrophia (Glossotrophia) confinaria 41 32 8 (20%) 12 (38%)
confinaria
Glossotrophia (Glossotrophia) confinaria prouti 27 16 2(9%) 5(31%)
Glossotrophia (Glossotrophia) confinaria scoblei 6 4 5 (83%) 2 (50%)
Glossotrophia (Glossotrophia) diffinaria 14 15 9 (64%) 11 (73%)
Glossotrophia (Glossotrophia) alba alba 15 15 1(7%) 7(47%)
Glossotrophia (Glossotrophia) alba brunellii 15 14 0 (0%) 0 (0%)
Glossotrophia (Glossotrophia) mentzeri 15 4 4(27%) 1 (25%)
Glossotrophia (Glossotrophia) rufomixtaria 14 26 1(7%) 6 (23%)
Glossotrophia (Libanonia) semitata taurica 16 16 2 (13%) 4(25%)
Glossotrophia (Libanonia) semitata ariana 15 16 0 (0%) 1(6%)
Glossotrophia (Parenzanella) asellaria asellaria 13 1 3 (23%) 1 (100%)
Glossotrophia (Parenzanella) asellaria 10 5) 3 (30%) 1 (20%)
romanaria
Glossotrophia (Parenzanella) asellaria 27 15 4 (15%) 2(13%)
isabellaria
Glossotrophia (Parenzanella) asellaria 12 8 2 (17%) 0(0%)
dentatolineata
Glossotrophia (Parenzanella) asellaria lenzi 11 6 0 (0%) 3 (50%)
Glossotrophia (Parenzanella) asellaria 14 11 0 (0%) 0(0%)
gerstbergeri
Glossotrophia (Parenzanella) asellaria 9 10 2 (22%) 2 (20%)
tripolitana
Glossotrophia (Microglossotrophia) alfierii 15 16 0(0%) 1(6%)
Glossotrophia (Microglossotrophia) gracilis 12 18 0 (0%) 0 (0%)
subgenus Glossotrophia (total) 142 126 30 (21%) 44 (35%)
subgenus Libanonia (total) 31 32 2 (6%) 5 (1570)
subgenus Parenzanella (total) 96 56 14 (15%) 9 (16%)
subgenus Microglossotrophia (total) 27 34 0 (0%) 1(3%)
TOTAL 296 248 46 (16%) 59 (24%)
Tab. 4. Attachment of pollen grains to various body parts of the moths (results from stereo microscope
examination; compare Tab. 3); ab: absolute numbers (multiple entries possible); pp: frequency of occur-
rence in relation to specimens with pollen grains; pt: frequency of occurrence in relation to total number of
examined specimens; S: total numbers of examined specimens; n: specimens with pollen grains.
subgenus Glossotrophia Libanonia Parenzanella Microglossotrophia total
body part ab pp pt ab pp pt ab pp pt ab pp pt ab pp pt
proboscis 45 0.61 0.17 4 0.57 0.06 8 0.35 0.05 1 1.00 0.02 58 0.55 0.11
palpi 28 0.38 0.10 1 0.14 0.02 2 0.09 0.01 - - - 31 0.30 0.06
eye 25 0.34 0.09 3 0.43 0.05 14 0.61 0.09 = - - 42 0.40 0.08
frons 4 0.05 0.01 - - - 1 0.04 0.01 - - 5 0.05 0.01
antennae 5 0.07 0.02 - - - 1 0.04 0.01 - - - 6 0.06 0.01
legs/thorax 15 0.20 0.06 - - - 1 0.04 0.01 - - - 16 0.15 0.03
wings 28 0.38 0.10 3 0.43 0.05 4 0.17 0.03 - - - 35 0.33 0.06
abdomen 11 0.15 0.04 - - - 2 0.09 0.01 - - - 13 0.12 0.02
tip of abdomen 8 0.11 0.03 - - - - - - - - - 8 0.08 0.01
n 74 7 23 1 105
268 63 152 61 544
Nota lepid. 26 (3/4): 137-152 137
Geographische Variabilitat und spatglaziale
Einwanderungswege von Erebia pluto (de Prunner, 1798) in
der Ortlergruppe und den Otztaler Alpen (Nymphalidae)
FRANS CUPEDO
Processieweg 2, NL-6243 BB Geulle, Niederlande; e-mail:
[email protected]
Abstract. Populations of Erebia pluto (de Prunner, 1798) in the Ortler Alps (ssp. velocissima Fruhstorfer,
1918) and in the Otztal Alps (ssp. alecto f. turbo Fruhstorfer, 1918) exhibit extreme variation, both with-
in and between populations, and several individuals are indistinguishable from those of the surrounding
subspecies. To reveal the cause of this phenomenon, a quantitative analysis of wing characters at the
population level is combined with a reconstruction of Erebia pluto’s post-glacial recolonization path-
ways. The analysis of the four main differentiating wing characters reveals that the populations of the
Otztal Alps and Ortler Alps are surrounded by well defined and hardly varying subspecies: ssp. alecto
Hübner, 1803, ssp. berninae Warren, 1839, and ssp. nicholli Oberthür, 1896/ ssp. burmanni Wolfsberger,
1969 (both the latter two taxa belong to zoogeographical unit nicholli s. 1.). The wing pattern of the
populations within the Ortler Alps ıs a mixture of berninae and nicholli elements, in geographically
determined proportions. In the most westerly populations pure berninae forms are found, whereas in the
easterly populations nicholli forms occur. From west to east a gradual increase of nicholli characters and
a decrease of berninae characters is observed. In the Ötztal Alps, alecto characters prevail, though mixed
with nicholli and berninae elements. Based on palaeoclimatological data, the most probable location of
the glacial refuges of the subspecies alecto, berninae and nicholli s. 1. has been determined, and the
routes of their late glacial invasion into the Alps have been reconstructed. The Ortler Alps turn out to have
been colonised both from the west (berninae) and from the east (nicholli s. 1.), the ssp. velocissima thus
being merely a group of mixed populations of post glacial origin. The Otztal Alps were invaded both from
the north (alecto) and from the south-east (nicholli s. |.). A gene flow across the Reschenpass brought the
berninae elements into the Otztal Alps. Thus it is established that the actual geographic distribution of
each single wing pattern element within the Otztal and Ortler Alps is entirely accounted for by the course
of the late glacial recolonization of the Alps. The name antracites Fruhstorfer, 1918 syn. n. is applied to
a population which occurs within the area of E. p. alecto. Therefore, E. p. antracites Fruhstorfer, 1918
syn. n. is a junior subjective synonym of E. p. alecto Hubner, 1803.
Resumé. Les populations d’Erebia pluto habitant les Alpes de l’Ortler (ssp. velocissima Fruhstorfer,
1918) et les Alpes de l’Otztal (ssp. alecto f. turbo Fruhstorfer, 1918) montrent une forte variation, aussi
bien entre les individus de la même population qu’entre ceux de populations différentes. Il ya même des
individus qui sont identiques à d’autres de sous-espèces environnantes. Pour révéler la cause de cette
extrême variation, les résultats d’une analyse quantitative des caractères des ailes ont été combinés avec
une reconstruction des voies de recolonisation tardiglaciaire d’Erebia pluto. De l'analyse des quatre
caractères alaires principaux résultent les conclusions suivantes : Les populations des Alpes de l’Otztal
et des Alpes de l’Ortler sont environnées de sous-espèces bien définies et peu variables: ssp. alecto
Hiibner, 1803, ssp. berninae Warren, 1839, et ssp. nicholli Oberthür, 1896/ ssp. burmanni Wolfsberger,
1969 (ces deux derniers taxons faisant partie d’une seule entité zoogéographique, nicholli s. I.). Le dessin
des ailes dans les Alpes de l’Ortler est composé d’éléments de berninae et de nicholli s. |. , dans des pro-
portions variables. Dans les populations occidentales on trouve des formes berninae typiques, et dans les
populations orientales figurent des nicholli typiques. De l’ouest à l’est on constate une augmentation
graduelle de la proportion des caractères de nicholli, et une diminution de ceux de berninae. Dans les
Alpes de l’Ötztal les caractères d’alecto prévalent. Toutefois ils sont mélangés avec ceux de nicholli et
de berninae. Sur la base de données paléoclimatologiques, les sites présumés des refuges glaciaires de
berninae, nicholli s. L et alecto ont été déterminés, et leurs voies de recolonisation ont été reconstruites.
De là se révèle que les Alpes de l’Ortler ont été peuplées tant à partir de l’est (nicholli s. I.) que de l’ouest
(berninae). La SSP. velocissima se révèle donc un groupe de populations mixtes d’origine post-glaciaire.
Les Alpes de l’Otztal ont été peuplées à partir du nord (par alecto) et du sud-est (par nic holli s. 1.). Un
flux de gènes à travers le Col de Resia y a porté des traits de berninae. Ainsi il a été établi que la distri-
bution géographique des éléments individuels du dessin des ailes dans les Alpes de l’Ötztal et celles de
l’Ortler s’explique complètement à partir du cours de la recolonisation tardiglaciaire. Puisque le nom
E. p. antracites Fruhstorfer, 1918 syn. n. s’applique à une population qui se rencontre dans les limites de
l’aire de E. p. alecto Hübner, 1803, il est considéré comme un synonyme récent de ce dernier.
© Nota lepidopterologica, 31.01.2004, ISSN 0342-7536
138 CUuPEDO: Post-Pleistocene invasion of Erebia pluto in the Central Alps
Zusammenfassung. Populationen von Erebia pluto (de Prunner, 1798) in der Ortlergruppe (ssp. velo-
cissima Fruhstorfer, 1918) und den Otztaler Alpen (ssp. alecto f. turbo Fruhstorfer 1918) zeigen eine
aussergewohnlich große Variabilität innerhalb und zwischen Populationen, und manche Exemplare sind
von den umgebenden Unterarten nicht zu unterscheiden. Zur Erklärung dieses Phänomens wird eine
quantitative Merkmalsanalyse der Populationen durchgeführt und mit einer Rekonstruktion der spät-
glazialen Einwanderungswege kombiniert. Die Analyse der vier wichtigsten Flügelmerkmale zeigt, dass
Populationen der Otztaler Alpen und der Ortlergruppe von gut definierten und wenig variablen
Unterarten umgeben sind: ssp. alecto Hübner, 1803, ssp. berninae Warren, 1839, und ssp. nicholli
Oberthür, 1896/ ssp. burmanni Wolfsberger, 1969, von denen die beiden letztgenannten Taxa eine zoo-
geographische Einheit, nicholli s. I., bilden. Die Flügelzeichnung in der Ortlergruppe ist zusammenge-
setzt aus berninae- und nicholli-Elementen, wobei von West nach Ost der Anteil von nicholli-Merkmalen
allmählich zunimmt, der Anteil von berninae-Merkmalen dagegen abnimmt sowie im Westen reine
berninae-Formen und im Osten reine nicholli-Formen vorkommen. Populationen der Otztaler Alpen
zeigen überwiegend Zeichnungselemente der ssp. alecto, mit Ubergangen zu ssp. nicholli und berninae.
Aufgrund palaoklimatologischer Daten sind die mutmaßlichen Glazialrefugien der Unterarten berninae,
alecto und nicholli s. I. sowie ihre spätglazialen Besiedlungsgeschichten rekonstruiert worden. Demzu-
folge ist die Ortlergruppe sowohl vom Südwesten (berninae) als auch vom Südosten her (nicholli s. I. )
besiedelt worden und die ssp. velocissima ist als eine Gruppe von postglazial entstandenen
Mischpopulationen zu betrachten. Die Otztaler Alpen sind vom Norden aus (alecto) und vom Südosten
her (nicholli s. 1. ) besiedelt worden. Ein Genfluss über den Reschenpass brachte berninae-Elemente in
die Otztaler Alpen. Die Verteilung der einzelnen Elemente der Flügelzeichnung in der Ortlergruppe und
Otztaler Alpen lässt sich also gut aus der spätglazialen Besiedlungsgeschichte erklären. Der Name
antracites Fruhstorfer, 1918 syn. n. bezieht sich auf eine Population, die innerhalb des Areals der ssp.
alecto vorkommt. Erebia pluto antracites Fruhstorfer, 1918 syn. n. ist somit ein jüngeres subjektives
Synonym von Erebia pluto alecto Hübner, 1803.
Key words. Postpleistocene invasion, Alps, Erebia pluto, refugia, zoogeography.
Einleitung
Spät- und postglaziale Arealveranderungen paläarktischer Faunenelemente sind
mittlerweile gut dokumentiert. Die traditionellen, auf vergleichend-chorologischen
Methoden basierenden Modelle (de Lattin 1967; Varga 1975a, 1975b; Schintlmeister
1989; Dubatolov & Kosterin 2000) werden in zunehmendem Maße durch molekular-
biologische Analysen an einzelnen Arten bestätigt und verfeinert (Hewitt 1996, 1999,
2000; Taberlet et al. 1998; Seddon et al. 2001). Diese Studien beziehen sich jedoch
ausnahmslos auf arboreale Arten. Eine Rekonstruktion der postglazialen Geschichte
der orealen Arten wird durch zwei Faktoren erschwert: Erstens gab es nebst dem aus-
gedehnten mitteleuropäischen Periglazialraum eine Vielfalt an Kleinstrefugien,
namentlich an der Peripherie der europäischen Hochgebirgssysteme, und zweitens
fand bei orealen Arten fast ausnahmslos eine Verlagerung statt einer Ausbreitung der
Areale statt, wodurch die Glazialrefugien nicht im heutigen Areal liegen. Einiger-
maßen detaillierte Studien der Besiedlungsgeschichte der Alpen beziehen sich daher
hauptsächlich auf weniger ausbreitungsfähige Insektenarten, bei denen die
Angehörigkeit zu einem bestimmten Glazialrefugium aus ihrer heutigen Verbreitung
ziemlich gut hergeleitet werden kann (Holdhaus 1954; de Lattin 1967; Besuchet 1968;
Nadig 1968). Bei Schmetterlingen beschränkt sich die vorhandene Literatur fast ganz
auf Beispiele postglazialer Einwanderung thermophiler Arten während des Atlantikums,
von denen in klimatologisch bevorzugten Alpenregionen Reliktpopulationen erhalten
geblieben sind (Arnscheid 1981; Daniel & Wolfsberger 1955, 1957).
In dieser Arbeit werden die spätglazialen Einwanderungswege einiger Unterarten
von Erebia pluto (de Prunner, 1798) rekonstruiert. Diese Schmetterlingsart kommt
rezent nur in den Alpen und im zentralen Apennin vor. Aus dem Alpenraum sind
Nota lepid. 26 (3/4): 137-152 139
Abb. 1a. Abgrenzung des
Untersuchungsraumes (Alpen-
einteilung nach Grassler 1984).
ssp. beminae Wm. ssp. burmanni Wolfsb.
NN ssp. alecto Hbn. ssp. velocissima Frhst.
i. der == ssp. nicholli Obth. AUTH ssp. alecto (Otztaler A.)
Abb. Ic. Räumliche Verteilung
der Stichproben in Ortler- und
Sesvennagruppe.
Punktiert: Gebirge über 3000 m.
A: Ofenpass. B: Umbrailpass.
C: Stilfserjoch. D: Gaviapass.
140 CUPEDO: Post-Pleistocene invasion of Erebia pluto in the Central Alps
mehrere Unterarten beschrieben worden, die morphologisch und geographisch leicht
voneinander zu trennen sind. Die Merkmale der einzelnen Unterarten sind innerhalb
ihres jeweiligen Areals konstant, obwohl die einzelnen Populationen seit dem frühen
Postglazial voneinander isoliert sind. Es handelt sich also um glaziale
Differenzierungen (Cupedo 1997). Ihre Areale grenzen an den Alpenrand, was die
Rekonstruktion der Einwanderwege erleichtert. Dies alles trifft jedoch nicht für die
Erebia pluto-Populationen der Ortlergruppe (ssp. velocissima Fruhstorfer, 1918) und
der Ötztaler Alpen zu. Ihre Areale haben eine zentrale Lage, und sind von den
Fluggebieten anderer Unterarten umgeben. Auch sind sie morphologisch nicht ein-
deutig definiert, da ihre Populationen in unterschiedlichem Maße Merkmale von
benachbarten Unterarten in sich vereinigen (Schawerda 1911; Fruhstorfer 1918).
Dadurch sınd sie taxonomisch schwer einzuordnen. Eine quantitative Analyse der
Flügelmerkmale dieser Populationen, im Zusammenhang mit einer auf paläoklima-
tologischen Daten gegründete Rekonstruktion der spatglazialen Einwanderwege, soll
die Ursache dieser ungewöhnlichen Variation ersichtlich machen.
Material und Methoden
Untersuchungsgebiet
Die westliche Begrenzung des Untersuchungsgebietes erstreckt sich zwischen
Comosee und Bodensee, und wird vom Bergell, vom Inntal (bis Landeck), vom
Stanzertal, Klostertal und Rheintal gebildet. Im Osten bilden Etsch-Eisacktal, Wipptal
und unteres Inntal die Grenze (Abb. la). Das Gebiet umfasst die Areale der nachfol-
genden Unterarten: ssp. berninae Warren, 1939 (Bernina-Alpen und Livigno-Alpen)’,
ssp. alecto Hübner, 1803 (Nordkette, Ötztaler und Stubaier Alpen), ssp. velocissima
(Ortlergruppe und Sesvennagruppe), ssp. nicholli Oberthür, 1896 (Brentagruppe) und
ssp. burmanni Wolfsberger, 1969 (Monte Baldo) (Vgl. Abb. 1b). Benennung und
Begrenzung der einzelnen Gebirgsstöcke sind der Alpenvereinseinteilung (AVE) des
Deutschen Alpenvereins entnommen (Grassler 1984). In dem sich westlich
anschließenden Teil der Alpen fliegt die ssp. anteborus Fruhstorfer, 1918 und östlich
des Etschtales die ssp. dolomitana Schawerda, 1911. In der südlich der Ortlergruppe
gelegenen Adamello-Presanellagruppe, sowie in den südlich der Bernina-Alpen
liegenden Bergamasker Alpen (Alpi Orobie) konnte E. pluto bisher nicht
nachgewiesen werden.
An folgenden Stellen wurden Stichproben gesammelt (Abb. 1b):
1. Bernina: Am Südhang des Munt Pers, 6 km nordöstlich des Piz Bernina, 2700-3200 m.
2. Mte. Baldo: Auf den Schutthalden der Cima del Longino, 2100 m.
3. Brentagruppe: Auf der Westseite des Passo del Groste, 2250 m.
4 Seefeld: Auf der Westflanke der Reitherspitze, östlich von Seefeld, im Karwendelgebirge,
2100-2200 m.
Umbrail: Auf den östlichen Schutthalden des Piz Umbrail, 2400 m.
SE
6. Stelvio: Am Monte Scorluzzo, südwestlich des Stilfserjochs, 2700-3200 m.
7. Sulden: Auf den Moränen des Suldengletschers, unter der Ortlerostwand, 2600-2700 m.
| Die ssp. berninae wurde von der ssp. anteborus abgetrennt (Warren 1939), ist aber der ssp. oreas
(Warren, 1933) sehr ähnlich. Die Frage der Namensberechtigung der ssp. berninae wird im Rahmen
dieser Arbeit nicht beriicksichtigt.
Nota lepid. 26 (3/4): 137-152 141
8. Martelltal: Auf den Moränen des Soyferners an der Nordwand der Zufrittspitze (Gioveretto),
2450-2700 m (Östlichste bekannte Vorkommen von E. pluto im Ortlermassiv).
9. Gavia: Auf den Moränen des Dosegüferners unterhalb des Pizzo San Matteo, nördlich des
Gaviapasses, im Südwesten der Ortlergruppe, 2600 m.
10. Rabbital: Auf den westlichen Schutthalden des Nordgrats des Glecks (Collécchio), im oberen
Rabbital, 2550-2850 m.
11. Ofenpass: Am Nordhang eines namenlosen Gipfels, 2 km nördlich des Ofenpasses (Sesvenna-
gruppe), 2500 m.
12. Sölden; Am Pitztaler Joch, auf der Ostseite des Kammes, der das Pitztal vom Ötztal trennt,
2650-2800 m.
13. Kurzras: Auf der italienischen Seite des Hochjochs, oberhalb Kurzras im oberen
Schnalstal, 2400-3 100m.
14. Texelgruppe: Auf den Grundmoränen des Grafferners, an der Nordwand der Grafspitze (Cima della
Grava), 2800 m.
Methoden
Im Wesentlichen unterscheidet sich die Flügelzeichnung der einzelnen Unterarten von
E. pluto ın vier Zeichnungselementen voneinander:
1. Zahl der Augenflecke auf den Vorderflügeln (AV 0, 2, 3 oder 4).
Zahl der Augenflecke auf den Hinterflügeln (AH 0 bis 3).
2
3. Ausprägung der Submarginalbinde der Oberseite der Vorderflügel (BO).
4. Braunfärbung auf der Unterseite der Vorderflügel (BU).
Die Merkmale 3 und 4 wurden wie folgt quantifiziert:
BO: 0: Keine Braunfärbung sichtbar.
: Braunfärbung um die Apikalaugen (Zellen 4 und 5), eventuell auch in Zelle 3.
: Binde bis Zelle 2, jedoch entweder in Flecken aufgelöst oder stark verschmälert.
: Komplette und deutliche Binde bis Zelle 2, eventuell von dunklen Adern durchzogen.
: Keine Braunfärbung sichtbar.
: Braunfärbung beschränkt sich auf das Postdiskalfeld.
: Braunfärbung auch im proximalen Flügelabschnitt.
3: Unterseite gleichmäßig braun, ohne dunkle Querlinie.
Von jedem Falter wurden diese vier Merkmale erfasst und für jede Population die
Mittelwerte berechnet und Frequenzdiagramme erstellt. Weil von den meisten Fund-
orten weniger als zehn Weibchen zur Verfügung standen, bezieht sich diese Studie
ausschließlich auf die Männchen.
ÙN = © WNR ©
Ergebnisse
Die Ergebnisse sind in Tab. | zusammengefasst und in Abb. 4a-d graphisch
dargestellt.
A. Die peripheren Massive (Abb. 2).
Bernina Alpen. Die ssp. berninae ist gekennzeichnet durch die größte Ausdehnung
der Braunfärbung auf der Vorderflügelober- und unterseite sowie durch das Fehlen
von Augenflecken.
Monte Baldo. Die ssp. burmanni ist charakterisiert durch das fast vollstandige Fehlen
von Braunfärbung und durch die maximale Entwicklung der Augenzeichnung auf
allen Fliigeln. Auffallend ist die Uniformitat der Population.
142 CuPEDO: Post-Pleistocene invasion of Erebia pluto in the Central Alps
Abb. 2. A: E. p. berninae Warren, 1939. B: E. p. alecto Hubner, 1803; C: E. p. burmanni Wolfsberger, 1969.
Brentagruppe. Die ssp. nicholli ist der ssp. burmanni sehr ahnlich. Nur die Variation
der Augenzahl der Vorderflügel ist größer. Nicholli und burmanni bilden eine zoo-
geographische Einheit, folgend als nicholli s. 1. bezeichnet. |
Nördliche Kalkalpen. Die ssp. alecto der nördlichen Kalkalpen nimmt eine
Zwischenstellung zwischen berninae und nicholli s. |. ein. Die Vorderflügel haben
normalerweise zwei Augen. Die Braunfärbung beschränkt sich auf die
Vorderflügelunterseite.
Im Rahmen dieser Arbeit sind die Merkmale, die nur auf eine der drei Unterarten
(berninae, nicholli s. 1. und alecto) beschränkt sind, von besonderem Interesse.
Exklusive berninae-Merkmale sind das Fehlen von Augenflecken und die gut
entwickelte Postdiskalbinde der Vorderflügeloberseite (AV=0; AH=0; BO=3-4).
Exklusive Merkmale von nicholli s. |. sind der Besitz von mehr als zwei Augen auf
der Vorderflügeloberseite und das Fehlen von Braunfärbung auf der Unterseite der
Vorderflügel (AV=3-4; BU=0). Exklusive alecto-Merkmale gibt es nicht. Eine für
alecto typische Merkmalskombination dagegen schon.
B. Die zentralen Massive.
Ortler- und Sesvennagruppe (Fundorte 5-11). In den studierten Merkmalen weisen die
Populationen dieses Gebiets untereinander so große Unterschiede auf, dass sie nicht als
Stichproben aus einer Population zu betrachten sind (Kruskal Wallis: p<0. 001 für jedes
der vier Merkmale). Von West nach Ost vollzieht sich eine Verschiebung vom berninae-
Habitus zum nicholli-Habitus. Es liegt eine klinale Variation vor, die sich außerhalb der
Ortlergruppe fortsetzt: Entlang den nördlichen Hängen der Ortlergruppe erkennt man
ein Gefälle vom M. Baldo über Brenta, Martelltal, Sulden, Stelvio und Umbrail nach
Bernina (Reihe A). Ebenso entlang der Südflanke des Massivs: vom Monte Baldo über
Brenta, Rabbital, Gavia, Stelvio und Umbrail nach Bernina (Reihe B). Ordnet man die
Nota lepid. 26 (3/4): 137-152 143
Tab. 1. Numerische Werte der Zeichnungselemente von Erebia pluto. Stichprobengröße (N) und
Mittelwerte pro Population: AV = Augenzahl der Vorderflügel; AH = Augenzahl der Hinterflügel;
BO = Binde der Vorderflügeloberseite; BU = Binde der Vorderflügelunterseite.
ina, | N
EE
M. Baldo
Sôlden
> ee
on Du | as na
ee 0508 | 0 noue her 130
Tab. 2. Korrelationskoeffizienten der zwei Reihen von Populationen in den Ortlergruppe (AV =
Augenzahl der Vorderflügel; AH = Augenzahl der Hinterflügel; BO = Binde der Vorderflügeloberseite;
BU = Binde der Vorderflügelunterseite).
Reihe | RS NE NN 7 a ME TN
(N=278) p (2- see) <Q. 001 <Q. 001 <0. 001 <0. 001
Reihe2 | Spearman’stho | 75 | 816 | 890 | -864
(N=291) p (2-seitig) <0. 001 <0. 001 <0. 001 <0. 001
Tab. 3. Zahl und Prozentsatz von Tieren mit exklusiven berninae- oder nicholli-Merkmalen, und mit
einer Kombination von beiden in den Populationen der Otztaler Alpen.
| berminae | nicholli | berninae+nicholi
Soden | _ nn Hibs droit
8 (36% 10 (46%
R “En Pos
Texel
Populationen in einer dieser Reihenfolgen, dann gibt es eine signifikante Korrelation
zwischen Rangnummer und Merkmalswert, für jedes der vier Merkmale (Siehe Tab. 2).
Die Variationsbreite umfasst reine berninae-Formen und reine nicholli-Formen nebst
allen erdenklichen Zwischenformen. 43 Individuen (17%) besitzen eine Kombination
von exklusiven berninae-Merkmalen und exklusiven nicholli-Merkmalen.
144 CuPEDO: Post-Pleistocene invasion of Erebia pluto in the Central Alps
Martelltal
Rabbi
Gavia
M.Baldo
Brenta
Sulden
Ofenpas
Kurzras
Texel
Sölden
Seefeld
Bernina
Umbrail
Stelvio
Abb. 3. Clusterdiagramm der studierten Populationen.
Ötztaler Alpen (Fundorte 11-13). Die Populationen der Ötztaler Alpen sind untere-
inander weniger variabel als die der Ortlergruppe. (Kruskal Wallis: AV p=0. 425; AH
p=0. 022; BO p=0. 107; BU p=0. 967). Sie unterscheiden sich von nominotypischen
alecto der nördlichen Kalkalpen dadurch, dass es Tiere gibt, die exklusive nicholli-
Merkmale, oder exklusive berninae-Merkmale, oder beide besitzen, wobei berninae-
Merkmale nur in den südlichen Populationen vorkommen (Siehe Tab. 3). Im
Gegensatz zur Ortlergruppe liegt hier also eine Vermischung der Merkmale von drei
Unterarten vor.
Ein Clusterdiagramm (Ward-Verfahren, nach Standarisierung der Messwerte) ver-
anschaulicht die Ergebnisse (Abb. 3). Die östlichen Ortler-Populationen (Martelltal,
Rabbi, Gavia) weisen die größte Ähnlichkeit mit nicholli s. 1. auf, die westlichen
(Umbrail und Stelvio) mit berninae. Die am stärksten gemischten Populations
(Sulden und Ofenpass) mit dem intermediaren alecto-Cluster.
Diskussion
Die Ergebnisse suggerieren, dass es sich in den Ortlergruppe um Mischpopulationen
von berninae und nicholli handelt, die anscheinend dadurch entstanden sind, dass
berninae vom Westen her und nicholli vom Südosten her die Ortlergruppe besiedelt
und sich untereinander gemischt haben, und dass die Ötztaler Alpen nicht nur vom
Norden her von alecto besiedelt worden sind, sondern dass es zusätzliche Genflüsse
vom Südosten (nicholli s. 1.) und vom Südwesten her (berninae) gegeben hat.
Diese hypothetische mehrfache Einwanderung aus verschiedenen Richtungen lässt
Nota lepid. 26 (3/4): 137-152 145
sich nur bestatigen, indem sie mit einer auf historisch-klimatologische Daten gegrun-
deten Rekonstruktion der Einwanderwege von Erebia pluto in Einklang gebracht wer-
den kann. In der Literatur gibt es dafür ausreichend Anhaltspunkte: die klassische
Arbeit Pencks und Brückners (1909) lässt Einsichten in die Lage der potentiellen
eiszeitlichen Refugien am Alpenrand gewinnen, und spätere paläoklimatologische
Arbeiten (Kerschner 1986, 1996, 2002; Ivy-Ochs et al. 1996) vermitteln ein gutes
Bild des periodischen Rückzuges des Eises.
Wiederbesiedlung durch E. pluto
Erebia pluto ist wohl die erste Erebienart, die beim Abklingen der Eiszeit die Alpen
wieder zu besiedeln vermochte. Die sich zurückziehenden Gletscher ließen in den eis-
frei gewordenen Gebieten bis hoch über die Talsohle große Mengen Moranenmaterial
zurück, wo E. pluto geeignete Lebensbedingungen fand. Weil sich am Ende der
Gletscherzunge bald die normale Vegetationsentwicklung vollzog (Firbas 1939), fand
die Einwanderung hauptsächlich über den Seitenmoränen statt, und war das
Fluggebiet von E. pluto im Tal im günstigsten Fall auf eine schmale Zone hinter dem
Gletscherrand beschränkt. Bei fortschreitender Klimaverbesserung verlagerten sich
die Vegetationsgürtel, und mit ihnen die p/uto-Biotope aufwärts, und wurden die
Populationen auf beiden Seiten der Gletscher endgültig voneinander isoliert. Die
Besiedlung benachbarter Massive war von da an nur noch während periodisch auftre-
tender Klimaverschlechterungen mit dementsprechendem Absinken der Vegetations-
gürtel möglich. Es werden eine Reihe solcher Kältephasen unterschieden (Kerschner
2002; siehe Abb. 5), von denen für diese Arbeit vor allem das Bühl- und das Gschnitz-
Stadium von Interesse sind (Kerschner, in litt.).
Die Refugien von E. pluto
Ein Refugium fiir Organismen, deren Lebensraum sich unterhalb der nivalen Stufe
befindet, soll wahrend des Hochglazials oberhalb der Gletscheroberflache, jedoch
unterhalb der sommerlichen Schneegrenze gelegen haben. Der vertikale Abstand
zwischen Gletscheroberfläche und Schneegrenze war mitbestimmend für die Diversität
an Lebensmöglichkeiten. Am südlichen Alpenrand fand sich eine Reihe von unver-
gletscherten Massiven, die beide Bedingungen erfüllten und die seit langem als
wichtige Refugien (“Massifs de Refuge”) anerkannt werden (Holdhaus 1954, Nadig
1968). Zwischen Etschtal und Lago Maggiore waren das (siehe Abb. 6):
1. Der Monte Baldo. Die Stammform der ssp. nicholl s. |. hat hier zweifellos ihr
Refugium gehabt. Die ssp. burmanni ist eine wichtige Zeugenpopulation.
2. Große Teile der Brescianer Alpen (zwischen Gardasee und Iseosee). Das voll-
ständige Fehlen von E. pluto in der Adamello/Presanella-Gruppe weist darauf hin,
dass hier keine E. pluto-Populationen die Eiszeit überdauert haben.
3. Die Südhänge der Bergamasker Alpen (zwischen Iseosee und Comosee). Auch
hier fehlen Zeugenpopulationen.
4. Zwischen Comosee und Lago Maggiore lag eine Reihe 1isolierter
Kleinstrefugien. Angeblich hat E. pluto auch hier kein Refugium gehabt. In den
nördlich sich anschließenden Massiven lebt die ssp. anteborus, die einem nordalpinen
Refugium entstammt (Cupedo, in Vorb.).
CuPEDO: Post-Pleistocene invasion of Erebia pluto in the Central Alps
NT
go
\
146
| NN
ogg
N
S
N
\
+ #5
== 2 +
AP =
== hr +
Ant.
À
7
C: Entwicklung der
Braunfärbung auf der
D:
siehe Text).
Abb. 4. A: Augenzahl der Vorderflügel. B: Augenzahl der Hinterflügel.
siehe Text).
Submarginalbinde der Vorderflügeloberseite (0 bis 3:
Vorderflügelunterseite (0 bis 3:
Nota lepid. 26 (3/4): 137-152 147
Nordalpen
Clavadel-
Senders Egesen
Gschnitz
Steinach
je)
Te)
co
à TA
ec
®
oD)
®
D
®
ie
‘©
=
N
=
®
—
D
®
®
Cc
<=
O
u)
Bühl Holozän
absolute Datierung noch problematisch
20000 19000 18000 17000 16000 15000 14000 13000 12000 11000 10000
Kalenderjahre B.P.
Abb. 5. Klimaschwankungen während des Spätglazials. I: Grönland Stadial 2a (Älteste Dryas); II:
Grönland Interstadial 1 (Balling-Allerod); III: Grönland Stadial 1 (Jüngere Dryas); IV: Holozän. (nach
H. Kerschner, in litt.)
5. Das Monte Disgrazia-Massiv, im westlichen Teil der Bernina-Alpen, wird von
Holdhaus (1954) als ”Zwischengebiet” bezeichnet: ihre Lage ist klimatisch nicht so
günstig wie die der obigen Massifs de Réfuge, aber einige Carabidenarten haben an
eisfrei gebliebenen Stellen die Eiszeit überdauert. Auch im Genus Erebia gibt es zwei
endemische Unterarten der Bernina-Alpen (E. pluto berninae und E. flavofasciata
thiemei). Nach den heutigen Einsichten (H. Kerschner, pers. Mitt. ) soll an den süd-
seitigen Hängen im Veltlin und in seinen Seitentälern die Schneegrenze bei etwa
1800 m oder sogar darüber gelegen haben. Die Gletscheroberfläche hat während des
Hochwürms die 1600 m nicht überschritten, und größere Hangpartien, mit steilen
Schutthalden, sind während des ganzen Würmglazials eisfrei geblieben. Soweit sich
das jetzt beurteilen lässt, muss die ssp. berninae hier ihr Refugium gehabt haben.
In den nördlichen Alpenketten lag die Schneegrenze um 600 m niedriger als im
Süden (Penck & Brückner 1909, S. 1143). Die Vergletscherung war dem gemäß stärker,
und die Gletscher reichten viel weiter (bis 65 km) ins Alpenvorland hinein. Die
Gipfel, die östlich des Rheingletschers das Eis überragten, lagen gänzlich über der
Schneegrenze und boten daher Æ. pluto keinen geeigneten Lebensraum. Als poten-
zieller Refugialraum in diesem Gebiet kämen nur die Allgäuer Vorberge, die während
der ganzen Würmeiszeit unvergletschert geblieben sind und mit dem Alpenvorland ın
Verbindung standen, in Betracht (1. c. S. 412). Es kann jedoch nicht ausgeschlossen
werden, dass E. pluto alecto darüber hinaus auf den ausgedehnten fluvioglazialen
Schotterfeldern im Periglazialraum auftrat.
148 CupEDo: Post-Pleistocene invasion of Erebia pluto in the Central Alps
Grenze der P Me,
Vergletscherung Heutige Seen Ly
Abb. 6. Siidlicher Alpenrand zwischen Lago Maggiore und Etschtal wahrend fie! Wurmeiszeit. (nach
Penck & Brickner 1909, umgezeichnet).
Rekonstruktion der Spätglazialen Einwanderwege (Abb. 7)
l. Etschtal: ssp. nicholli s. 1. Vor Anfang des Bühlstadiums waren große Teile des
unteren Etschtales eisfrei. E. pluto hat also schon ganz früh, entlang den Höhen
zwi-schen Sarcatal und Etschtal, die Brentagruppe besiedeln konnen. Im unteren
Etschtal haben sich (im Gegensatz zum Inntal) die Gletscher der Seitentaler schon
früh vom Hauptgletscher gelöst (Penck & Brückner 1909, S. 948). Da namentlich der
Nocegletscher sich auffallend schnell zurückgezogen hat (l. c. S. 857), kann an-
schließend die Besiedlung des Ortlermassivs durch ein Überqueren des unteren
Nocetales stattgefunden haben. Jetzt konnte E. pluto ungehindert südlich und nördlich
um das Ortlermassiv ziehen, nachdem der Ofenpass eisfrei geworden war, bis in die
Sesvennagruppe hinein. Aus dem Auftreten von nicholli-Merkmalen in den Ötztaler
Alpen müsste man schließen, dass E. pluto, wahrscheinlich während einer der nach-
folgenden Kältephasen, das Etschtal unterhalb der Gletscherzunge hat überqueren
können. Auf dem Tonalepass trafen sich Seitenäste des Noce- und Ogliogletschers
(Gletscherhöhe 2400 m), auf dem Carlo Magnopass solche des Noce- und Sarca-
gletschers. Ein Eindringen in den Adamello und in die Presanella, entweder vom
Brentamassiv aus oder vom Ortlergebiet aus, wurde dadurch verhindert.
2. Addatal: ssp. berninae. E. pluto ist hier dem Adda-Gletscher bei dessen Rückzug
auf der Nordflanke gefolgt. Sie fand drei Hindernisse auf ihrem Weg: Berninapass,
Ofenpass und Reschenpass sind während des Hochglazials von aufgestauten
Seitenästen des Inngletschers bedeckt gewesen, die Eisoberfläche über den Passhöhen
ist auf 2500 m festgestellt worden. Nach Freiwerden des Berninapasses wurden die
Livigno-Alpen besiedelt, nach Freiwerden des Ofenpasses die Sesvennagruppe, und
nach Freiwerden des Reschenpasses konnte schließlich ein Genfluss in die südlichen
Ötztaler Alpen stattfinden. Nach Nordwesten hat E. pluto sich nicht ausbreiten kön-
nen, da der Inngletscher, dessen Eis auch über den Malojapass ins Bergell hineinfloss,
noch lange eine unüberwindbare Verbreitungsschranke darstellte.
Nota lepid. 26 (3/4): 137-152 149
Grenze der
Vergletscherung
Mutmaßliche
Refugien
ssp. berninae
ssp. nicholli s.l
ssp. alecto
Abb. 7. Rekonstruktion der Einwanderungswege von Erebia pluto.
Vermischung in der Ortlergruppe. Die Livignoalpen und die Ortlergruppe gehen ım
Bereich der Sesvennagruppe, die von beiden Massiven die natürliche Fortsetzung
bildet, ineinander über. Dort sind also, bei ständiger Klimaverbesserung, ihre E.
pluto-Populationen irgendwann miteinander in Kontakt geraten. Zuerst muss das im
oberen Addatal, oberhalb Bormio, geschehen sein. Das führte zu Vermischung an den
südlichen Hängen des Ortlermassivs. Durch Überschreiten des Ofenpasses und,
später, des Umbrail- und Stelviopasses, kam es zu inniger Vermischung in der
Sesvennagruppe und entlang der Ortlernordflanke (siehe Abb. 7).
3. Inntal: ssp. alecto. Die Nordalpen waren, infolge der extremeren klimatischen
Bedingungen, viel stärker vergletschert als dıe Südalpen. In gleicher Meereshöhe
wurden die Lebensbedingungen erst später für E. pluto geeignet. Es ist anzunehmen,
dass E. pluto während der ersten Erwärmungsphase zumindest die nördliche
Alpenkette besiedelte. Im Inntal hat sich während dieser Periode das Eis bis Imst
zurückgezogen, also möglicherweise sind auch die Ötztaler Alpen damals schon
besiedelt worden. Spätestens geschah das in der nachfolgenden Warmeperiode, als
das Inntal bis weit oberhalb Landecks eisfrei wurde. Weil das Überqueren des Tales
nur möglich war in einem beschränkten Bereich am Ende der Gletscherzunge, muss
dies geschehen sein, bevor der Gletscher bis Landeck abgeschmolzen war. Zu dieser
Zeit waren das Stanzertal und das Klostertal noch ganz mit Eis gefüllt und der
Arlbergpass mit Eis überdeckt (Penck & Brückner 1909, S. 350). Es war für E. pluto
also unmöglich, in die Verwall-, Silvretta- und Samnaungruppe einzudringen.
150 CuPEDO: Post-Pleistocene invasion of Erebia pluto in the Central Alps
Nach der Einwanderung in die Otztaler Alpen waren schlieBlich alle Massive in
dem hier besprochenen Teil der Alpen von Erebia pluto besiedelt, und zwar in einer
genetischen Zusammensetzung, die mit der heutigen übereinstimmte.
Zusammenfassung
Die spätglazialen Einwanderwege der Unterarten nicholli s. |., berninae und alecto
von Erebia pluto, soweit diese sich mit unserem heutigen Wissen rekonstruieren
lassen und die geographische Variation, wie wir sie heute wahrnehmen, stehen der-
maßen miteinander ım Einklang, dass die Annahme einer kausalen Beziehung
gerechtfertigt erscheint: die lokalen Variationen innerhalb der Ötztaler und
Ortlergruppe lassen sıch aus der Besiedlungsgeschichte erklären. Auch das Fehlen
von nicholli s. |. in Adamello und Presanella, von alecto südlich des Arlbergpasses
und von berninae in den Albula-Alpen sind logische Folgen der Besiedlungs-
geschichte. Damit hat sich erwiesen, dass es in bestimmten Fällen auch möglich ist,
die spätglazialen Einwanderwege alpiner Schmetterlingsarten anhand historisch-
klimatologischer Daten wenigstens in groben Zügen zu rekonstruieren. Man gewinnt
damit mehr als nur zusätzliche Information bei der Interpretation der geographischen
Variation einzelner Arten: dies bietet vielmehr einen Rahmen, innerhalb dessen die
geographische Variation mehrerer Arten miteinander ın Einklang zu bringen ist.
Der Unterschied zwischen den ssp. nicholli s. str. und burmanni lässt sich aus der
Besiedlungsgeschichte nicht erklären. Die wahrscheinlichste Ursache der extremen
Uniformität der Monte Baldo-Population ist postglaziale genetische Drift. Das sowohl
horizontal als auch vertikal äußerst beschränkte Fluggebiet macht die Population sehr
empfindlich für Flaschenhalseffekte in wärmeren Perioden (z. B. während des
Atlantikums).
Taxonomie und Nomenklatur
Mit der Feststellung, dass es Individuen gibt, die Merkmale von zwei oder sogar drei
peripheren Unterarten in sich vereinigen, ist der Beweis erbracht, dass die vıkari-
ierenden Unterarten berninae, nicholli und alecto, wie sehr sie sich auch morpholo-
gisch voneinander unterscheiden, nicht reproduktiv voneinander isoliert sind. Der
Name velocissima bezieht sich auf die Æ. pluto-Populationen der Ortler- und
Sesvennagruppe, der Typenfundort ist das Ortlergebiet (Schawerda 1911). Man kann
sich mit Recht fragen, ob Mischpopulationen überhaupt als zoologische Taxa aufzu-
fassen sind. Aus phylogenetischer Sicht jedenfalls nicht, weil von einer mono-
phyletischen Gruppe grundsätzlich keine Rede sein kann. Der Status von velocissima
als biologisches Taxon steht demnach zur Diskussion. Es ist vorzuziehen, für aner-
kannte Mischpopulationen keine neuen Namen einzuführen.
Die Mischpopulationen der Ötztaler Alpen werden daher, weil die alecto-
Merkmale vorherrschen, am besten als mit nicholli und berninae vermischte alecto
bezeichnet.
Nota lepid. 26 (3/4): 137-152 151
Der Name antracites Fruhstorfer, 1918 bezieht sich auf eine Population
(Schnalstal), von der jetzt feststeht, dass sie innerhalb des Areals der ssp. alecto (von
der sie abgetrennt wurde) keine taxonomische Einheit darstellt. Erebia pluto
antracites Fruhstorfer, 1918 ist somit ein jüngeres subjektives Synonym von Erebia
pluto alecto Hübner, 1803.
Erebia pluto f. turbo Fruhstorfer, 1918 ist ein infrasubspezifischer Name, und als
solcher nie verfügbar gewesen (ICZN Art. 10. 2 und 45. 6. 4).
Danksagung
Vielen Dank schulde ich Herrn Dr. Hans Kerschner (Innsbruck), der mir ausführlich über die modernen
Einsichten in die spätglazialen Klimageschichte informierte; zwei anonymen Referenten, deren
Bemerkungen wesentlich zur Verbesserung des Manuskripts beigetragen haben; und meinem Kollegen
Marcel Prick (Heerlen, Niederlande), der mit großer Sorgfalt den deutschen Text korrigiert hat.
Literatur
Arnscheid, W. 1981. Die Makrolepidopteren-Fauna des Sonnental-Nonnsberggebietes (Val di Sole und
Val di Non in Oberitalien). — Studi Trentini di Scienze Naturali 57: 95-245.
Besuchet, C. 1968. Répartition des insectes en Suisse. Influence des glaciations. — Bulletin de la Société
entomologique Suisse 61: 337-340.
Cupedo, F. 1997. Die geographische Variabilität und der taxonomische Status der Erebia manto bubastis-
Gruppe, nebst Beschreibung einer neuen Unterart (Nymphalidae: Satyrinae). — Nota lepidopterolo-
gica 20 (1/2): 3-22.
Daniel, F. & J. Wolfsberger 1955. Die Föhrenheidegebiete des Alpenraumes als Refugien wärmelieben-
der Insekten. I. Der Kaunerberghang im Oberinntal. — Zeitschrift der Wiener Entomologischen
Gesellschaft 40: 13-135.
Daniel, F. & J. Wolfsberger 1957. Die Föhrenheidegebiete des Alpenraumes als Refugien wärmelieben-
der Insekten. II. Der Sonnenberghang bei Naturns im Vintschgau (Südtirol). — Mitteilungen der
Münchner Entomologischen Gesellschaft 47: 21-121.
Dubatolov, V. V. & O. E. Kosterin 2000. Nemoral species of Lepidoptera (Insecta) in Siberia: a novel view
on their history and the timing of their range disjunctions. — Entomologica Fennica 11: 141—166.
Firbas, F. 1939. Vegetationsentwicklung und Klimawandel in der Mitteleuropäischen Spät- und
Nacheiszeit. — Die Naturwissenschaften 27 (6): 81-108.
Fruhstorfer. H. 1918. Erebia alecto rediviva. — Archiv für Naturgeschichte (A) 82 (7): 21-169.
Grassler, F. , 1984. Alpenvereinseinteilung der Ostalpen (AVE). — Alpenvereinsjahrbuch 1984, pp.
215-224. — Rother Verlag, München.
Hewitt, G. M. 1996. Some genetic consequences of ice ages, and their role in divergence and speciation.
— Biological Journal of the Linnean Society 58: 247-276.
Hewitt, G. M. 1999. Post-glacial re-colonization of European biota. — Biological Journal of the Linnean
Society 68: 87-112.
Hewitt, G. M. 2000. The genetic legacy of the Quaternary ice ages. — Nature 405: 907-913.
Holdhaus, K. 1954. Die Spuren der Eiszeit in der Tierwelt Europas. — Abhandlungen der zoologisch-
botanischen Gesellschaft Wien 18: 1-493, 52 Karten.
International Commision on Zoological Nomenclature 1999. International Code of Zoological
Nomenclature (4th ed.), — The International Trust for Zoological Nomenclature, c/o The Natural
History Museum, London. XIX + 125pp.
Ivy-Ochs, S., C. Schlüchter, P. Kubik, H. -A. Synal & H. Kerschner, 1996. The exposure age of an Egesen
moraine at Julier Pas, Switzerland, measured with cosmogenic radionucleides "Be, Al, and el
— Eclogae geologicae Helvetiae 89 (3): 1049-1063.
Kerschner, H. 1986. Zum Sendersstadium im Spätglazial der nördlichen Stubaier Alpen, Tirol. —
Zeitschrift für Geomorphologie N. F. Suppl. 61: 65-76.
152 CUuPEDO: Post-Pleistocene invasion of Erebia pluto in the Central Alps
Kerschner, H. 1996. Late Würm glacier history in the Tyrolean Alps. Pp. 5-8. — In: Panizza, M., M.
Soldati, D. Barani & M. Bertacchini (eds.), The Erasmus 94-95 Programme in Geomorphology.
Intensive Course in Tyrol (Austria) and Student Mobility. Dipartimento di Scienza della Terra,
Universita dagli Studi di Modena.
Kerschner, H. 2002. Mountain glaciers as sources of paleoclimatic information — an alpine perspective.
— Bulletin of the World Meteorological Organization 51 (1): 29-35.
Lattin, G. de 1967. Grundriss der Zoogeographie. — Fischer Verlag, Stuttgart. 499pp.
Nadig, A. 1968. Uber die Bedeutung der Massifs de Refuge am siidlichen Alpenrand (dargelegt am
Beispiel einiger Orthopterenarten). — Mitteilungen der Schweizerischen entomologischen Gesell-
schaft 61: 341-358.
Penck, A. & E. Brückner 1909. Die Alpen im Eiszeitalter. 3 Teile. — Chr. Herm. Tauchnitz, Leipzig.
1199 pp.
Schawerda, K. 1911. Erebia glacialis Esp. und ihre Formen in den Hochalpen Österreichs. — Verhand-
lungen der zoologisch-botanischen Gesellschaft Wien 61: (29)-(40)
Schintlmeister, A. 1989. Zoogeographie der palaearktischen Notodontidae (Lepidoptera). — Neue ento-
mologische Nachrichten 25: 1-74
Seddon, J. M., F. Santucci, N. J. Reeve & G. M. Hewitt 2001. DNA footprints of European hedgehogs,
Erinaceus europaeus and E. concolor: Pleistocene refugia, postglacial expansion and colonization
routes. — Molecular Ecology 10: 2187-2198.
Taberlet, P, L. Fumagalli, A.-G. Wust-Saucy & J.-F. Cosson 1998. Comparative phylogeography and
postglacial colonization routes in Europe. — Molecular Ecology 7 (4): 453-464.
Varga, Z. 1975a. Zoogeographische Gliederung der Paläarktischen Orealfauna. — Verhandlungen des
Sechsten Internationalen Symposiums über Entomofaunistik in Mitteleuropa: 263-385.
Varga, Z. 1975b. Geographische Isolation und Subspeziation bei den Hochgebirgs-Lepidopteren der
Balkanhalbinsel. — Acta entomologica Jugoslavica 11 (1-2): 5—41.
Warren, B. C. S. 1936. Monograph of the genus Erebia. — Trustees of the British Museum (Natural
History), London. 407 pp., 104 pls.
Warren, B. C. S. 1939. An unrecognised race of Erebia pluto, hitherto confused with the ssp. anteborus
Frhst. (Lep. Satyridae). — The Entomologist 72: 94-99
Wolfsberger, L. 1969. Erebia pluto burmanni ssp. n. vom Monte Baldo (Lep. Rhop. ). — Memorie del
Museo Civico di Storia Naturale di Verona 17: 237-239.
Nota lepid. 26 (3/4): 153-164 153
Four new species, a new synonymy and some new records
of Scythris Hubner, [1825] (Gelechioidea: Scythrididae)
PIETRO PASSERIN D’ENTREVES & ANGELA ROGGERO
University of Torino, Dpt. Biologia Animale, Via Accademia Albertina 17, I-10123 Torino (Italy).
Abstract. Four new species of Scythrididae are described: Scythris tauromeniella sp. n. from southern
Italy, S. /andryi sp. n. from Tunisia, and S. herati sp. n. and S. nielseni sp. n., both from northern
Afghanistan. A brief account of all the new Palaearctic species recently added to the family is provided.
S. koskjuki Sinev is synonymized with S. immaculatella (Chambers) which was beforehand known from
the Nearctic region only. New records of some other recently described and little-known species from the
Arabian Peninsula are added.
Key words. Lepidoptera, Scythris, Palaearctic, New species, Beringia, Nearctic, Afrotropical,
Arabian Peninsula.
Introduction
In the last ten years, investigations on Scythrididae have been carried out by nume-
rous authors, chiefly on the fauna of the Middle and Far East. More than a hundred
new species were described and new records were reported for many known species.
For some of the new species the species-group was already known, and some new
groups were proposed, but, at present, most of these species cannot be assigned to any
known species-group.
In 1997 Bengtsson described six new species in the material collected by Hacker
in Pakistan and in India. The data reported by the author (Bengtsson 1997a) are very
interesting since most of the scythridid fauna of the Indian subcontinent is not yet
known.
The scythridid fauna of the Arabian Peninsula is also almost unknown. Since the
work by Passerin d’Entreves in 1986, nobody else treated the Arabian scythridids till
Bengtsson described six new species from Northern Oman (2002a) and thirty-nine
from Yemen (2002b). As reported by the same Bengtsson (2002a), within the Oman
species only S. elachistoides constitutes a new species-group along with at least four
species described from Yemen (Bengtsson 2002b). As for Yemen, Bengtsson (2002b)
described one species of Enolmis, thirty-eight species belonging to the genus Scythris,
and he reported new data for some of the species previously described from Oman.
Only a few of the species from Yemen could be assigned to known species-groups.
Seemingly the new species described from Oman and Yemen have relationships with
the Palaearctic, Oriental and Afrotropical faunas.
Lately, Passerin d’Entreves & Roggero (2003) described two new species of
Apostibes belonging to the Middle Asıan fauna: Apostibes afghana from Northern
Afghanistan and A. dhahrani from Saudi Arabia. At present, eight species of
Apostibes are known, but the three Nearctic ones almost surely do not belong to this
genus (Landry 1991).
© Nota lepidopterologica, 31.01.2004, ISSN 0342-7536
154 PASSERIN D’ENTREVES & ROGGERO: New species, synonymy and records of Scythris
Fig. 1. Map of the type localities of the four new species Scythris landryi (@), S. tauromeniella (MW),
S. herati (A), and S. nielseni (@).
As for the fauna of the Middle East, Junnilainen (2002) described three new species
from central Turkey, many years after Staudinger’s (1880) contribution. Seven more
species have been described between 1880 and 2002 with Turkey as type locality.
The Eastern Palaearctic is a region more widely studied in the last years, and many
new species have been described from central Asia, mainly from Russia, but also from
Mongolia and Korea. After several works by Falkovitsh (1969, 1972, 1979, 1981, 1986)
on the scythridid fauna of Eastern Russia, Sinev in 1993 described two new species
from SW Altai.
Bengtsson & Liska (1996) described four new species, two from the Baikal area
(Russia), and two from North Korea. In the same year, S. felixi was described (Bengtsson
& Sutter 1996) as the first known species of Scythris from Mongolia, but was later
reported also from the Altai Mountains (Nupponen & Nupponen 2001); the species
belongs to the /aminella-group like some of the species later described by Sinev (2001).
Bengtsson described (1997c) other species from the Russian area, two from
Kazakhstan, three from the Tuva republic, and one from the Primorsky territory.
Nupponen travelled in unexplored regions of Russia, and found several unknown
scythridids. In 2000 (Nupponen et al.) the descriptions of fourteen new species from
Ural Mountains were published, and in 2001 Nupponen & Nupponen described four
other new species from the Altai Mountains.
Moreover, in the same year (2001) Nupponen described two new species from Tunisia,
S. kefensis and S. spectatorella, both belonging to the subfasciata species-group.
Finally, Sachkov and Sinev worked occasionally on the Scythrididae of Eastern
Russia (Sachkov 1995, 2000; Sachkov & Sinev 2001; Sinev 1993, 2001).
For the almost completed Scythrididae part of Lepidopterorum Catalogus, we
examined 200-300 specimens, which are preserved in various Museums and
Collections. The specimens came mostly from Afghanistan, Iran, Tunisia, Algeria, and
Morocco. More entomological material from other Palaearctic areas was studied in
order to enlarge our knowledge on the widespread distribution of this microlepi-
dopteran family, and some specimens within the material are identified as being unde-
scribed species (Fig. 1), while others belong to recently described species.
Nota lepid. 26 (3/4): 153-164 155
Fig. 2. Male genitalia of S. tauromeniella. A: Uncus-tegumen-gnathos-right valva complex. B: Aedeagus.
C: VIII sternite. (Scale bar for all Figs. 0.1 mm).
Results
Scythris tauromeniella sp. n.
Material. Holotype, ©: “Sicilia orient. Taormina 200 m, LT 7.X.1950 Htg. E Grshm. leg”;
“Holotypus Scythris tauromeniella sp. n. Passerin d’E. & Roggero 2003”; “Genital slide no. 820 Passerin
d’E.”; Passerin d’Entreves Collection, Torino, Italy.
Description. Male with wingspan of 10 mm. Head, thorax and abdomen light
brown. Fore and hindwings bright white, fringe whitish. Antennae brown-whitish,
half as long as forewing. Female unknown.
Male genitalia (Fig. 2 A, B, C). Uncus lamina-shaped, tegumen subtriangular
in lateral view; gnathos well developed, the joining zone between the two arms is pro-
truding, while the median process is bent downward and backward, with a bifid
extremity. Valvae symmetrical, with enlarged distal two thirds, truncate at apex.
Aedeagus tubular, slightly longer than half the length of the valva, strongly curved
downwards. S8 laminar, truncated at apex, deeply incurvated on proximal edge.
Distribution. S. tauromeniella sp. n. is known only from the Southeastern Sicily.
Life history. The host plant and early stages are unknown. The adult specimen
was collected in October.
Remarks. S. tauromeniella sp. n. cannot be assigned to any known species-
group, but might be a member of the pascuella-group.
Derivatio nominis. The species is named after Tauromenium, the ancient
Latin name of Taormina.
156 PASSERIN D’ ENTREVES & ROGGERO: New species, synonymy and records of Scythris
Fig. 3. Male genitalia of S. Jandryi. A: Uncus-tegumen-gnathos-right valva complex. B: VIII sternite.
C: Aedeagus. (Scale bar for Fig. A 0.1 mm, Figs. B and C 0.2 mm).
Scythris landryi sp. n.
Material. Holotype, ©: “Tunisie mérid. Bou-Hedma, 2-IX-1929, coll Dumont”; “Holotypus Scythris
landryi sp. n. Passerin d’E. & Roggero 2003”; “Genital slide no. 916 @ Passerin d’E.” ; Passerin
d’Entreves Collection, Torino, Italy.
Description. Male with wingspan of 9.5 mm. Head, thorax and abdomen dark
brown. Forewings bright dark brown with a longitudinal light brown stria following
the median fold, with a whitish dot at apex, arch-shaped outwards. Hindwings, fringes
and antennae brown. Female unknown.
Male genitalia (Fig. 3 A, B, C). Uncus laminar; tegumen elongate; gnathos
elongate, with arms prolonged backwards and median process long, and turned back-
wards. Valvae symmetrical, elongated, slightly downward curved, pointed at apex;
aedeagus tubular, elongate, the proximal part strongly curved downwards; S8 two
symmetrical plates united only along a short distance medio-anteriorly; each plate
with curved, slender, posterolateral extension.
Distribution. S. landryi sp. n. is known only from central Tunisia.
Life history. The host plant and early stages are unknown. The adult specimen
was collected in September.
Remarks. S. landryi sp. n. belongs to the punctivittella-group, as established by
Bengtsson (1997b), in accordance with the male genitalia features.
Derivatio nominis. The species is named after Jean-François Landry, well-
known Canadian lepidopterist.
Nota lepid. 26 (3/4): 153-164 157
Fig. 4. Male genitalia of S. herati. A: Uncus-tegumen-gnathos-right valva complex. B: Aedeagus.
C: VIII. sternite. (Scale bar for all Figs. 0.2 mm).
Scythris herati sp. n.
Material. Holotype, ©: “Afghanistan, Herat 970 m, 15.5.1956, H.G. Amsel leg”; “Holotypus
Scythris herati sp. n. Passerin d’E. & Roggero 2003”; “Genital slide no. 818 © Passerin d’E.”; Amsel
Collection, Landessammlungen für Naturkunde, Karlsruhe, Germany. Paratype, 10°: “Afghanistan, Herat
970 m, 5.5.1956, H.G. Amsel leg.’; “Genital slide no. 853 © Passerin d’E.”; Amsel Collection,
Landessammlungen für Naturkunde, Karlsruhe, Germany.
Description. Males with wingspans of 16-17 mm. Head, thorax and abdomen
brown with many scattered, whitish scales. Whitish surface of the forewings unevenly
covered by brown scales. Hindwings light brown. Antennae brown, slightly longer
than forewing. Female unknown.
Male genitalia (Fig. 4 A, B, C). Uncus laminar, bilobate and elongate. Gnathos
well developed, lateral arms strongly curved, with a sharp straight process extending
downwards. Tegumen elongate; valvae curved ventrally, slightly asymmetrical, and
rounded at apex, the left one with apical flap. Aedeagus slightly longer than valvae,
tubular, slightly enlarged distally, curved ventrally; S8 subtriangular, concave at base.
Distribution. S. herati sp. n. is known only from northern Afghanistan.
Life history. The host plant and early stages are unknown. The adult specimens were
collected in May.
Remarks. S. herati sp. n. cannot be attributed to any known species-group, but may
belong to the pascuella-group.
Derivatio nominis. The species is named after Herat, the type locality in
Afghanistan.
158
PASSERIN D’ ENTREVES & ROGGERO: New species, synonymy and records of Scythris
Fig. 5. Male genitalia of S. nielseni. A: Uncus-tegumen-gnathos-right valva complex. B: Aedeagus.
C: VIII. sternite. (Scale bar for Figs. A and B 0.1 mm, C 0.2 mm).
Scythris nielseni sp. n. ?
Material. Holotype, ©: “N.-Afghanistan Polichomri 700 m, 5.6.1956 H. G. Amsel leg”; “Holotypus
Scythris nielseni sp. n. Passerin d’E. & Roggero 2003”; “Genital slide no. 807 © Passerin d’E.’; Passerin
d’Entreves Collection, Torino, Italy. Paratype, 10°: same label data as holotype.
Description. Male with wingspan of 11.3 mm. Head, thorax, and abdomen
covered by white-xanthous scales. Forewings whitish with small and chequered
yellow spots. Apex of the forewings brown-yellow. Fringes yellowish. Antennae brown,
two thirds as long as the forewing; pedicel whitish. Female unknown.
Male genitalia (Fig. 5A, B, C). Uncus short and bilobate, gnathos well-deve-
loped, tegumen globose, valvae symmetrical, elongate, showing a tuft of about ten
stout and elongated bristles in a ventral concavity at two third from valva-base,
and three other bristles near apex, two elongated and one shorter. Aedeagus tubular,
sinuate, almost four fifths as long as valvae; S8 deeply emarginate anteriorly, shows
a cone-shaped and distinct caudal process.
Distribution. S. nielseni sp. n. is known only from Northern Afghanistan.
Life history. The host plant and early stages are unknown. The adult speci-
mens were collected in June.
Remarks. S. nielseni sp. n. shows a vague resemblance with S. productella,
mainly in appearance of valvae and S8.
Derivatio nominis. The species is named in honour of the late Ebbe Schmidt
Nielsen, eminent Danish lepidopterist who suddenly died in 2001.
Nota lepid. 26 (3/4): 153-164 159
Scythris immaculatella (Chambers, 1875: 10)
Type locality: USA, Waco and Basque Co., Texas.
S. pacifica McDunnough, 1927: 275 (synonymized by Landry 1991: 117).
S. kostjuki Sinev, 2001: 21. syn. n.
Description. Adults medium sized, usually with almost entirely unicolorous
grey or dark grey body. Upper surface of forewings grey or beige, sometimes darkened
by olive-brown suffusion, with brassy lustre and greenish hue. Hindwings elongate-
lanceolate, apex pointed, upper surface beige or pale olive-brown with same lustre and
hue as forewings’ upper surface; cilia grey or beige. Antenna extended to about two
thirds length of forewings, ventrally densely ciliated (Landry 1991).
Male genitalia. Symmetrical. Tegumen elongate, with deep V-shaped emar-
gination on anterior margin, apex bilobate. Uncus with a medioventral blunt tooth on
each arm, apex broad and slightly upcurved. Gnathos relatively thick, thorn-like and
pointed downwards. Vinculum large and convex. Valvae moderately incurved, broadly
spatulate. Juxta elongate, fused to base of aedeagus. Aedeagus tubular, thin, almost as
long as valvae (Landry 1991).
Female genitalia. Sterigma an oval, concave plate at caudal margin of S8.
Ductus bursae membranous; corpus bursae oblong, slightly curved. Anterior apophy-
ses straight, slightly divergent. Posterior apophyses thinner then anterior ones; ovi-
positor short (Landry 1991).
Distribution. From Russia to North America (Fig. 6).
Pate history. See Landry (1991).
Remarks. S. immaculatella was regarded as a junior synonym of Scythris
impositella (Zeller), now under the combination Asymmetrura impositella, by
Chambers, 1878, and subsequent authors. Landry (1991:117) revised its status as
valid after studying the type. In 1927, McDunnough described S. pacifica, which was
synonymized with S. immaculatella by Landry (1991).
The new synonymy was assessed by comparing the drawings of the genitalia of the
male and female of S. koskjuki Sinev 2001 with those published by McDunnough in
1927 (as S. pacifica) and Landry in 1991 (as S. immaculatella).
At present, the species is known from Canada (British Columbia, Alberta, Quebec,
and Ontario) and USA (Alaska, Montana, Wyoming, South Dakota, Colorado, Kentucky,
North Carolina, Texas, and Michigan) (Landry, pers. comm.), and Siberia (Russia:
Nizhniy Tsasuchey, Dauria). The distribution of S. immaculatella is very interesting,
since it represents one of the few records in the Scythrididae of a disjunct transberingian
distribution extending from central Siberia to most of the Nearctic region. This peculiar
distribution can be explained by the many climatic and geological changes, which suc-
ceeded in the Tertiary and Quaternary in the so-called Beringia.
In the Tertiary, the conditions prevalent in the Arctic were very different than today
and, recently, an isthmus between Asia and America was hypothesized to have
occurred so biotic exchanges were possible. Many vascular plants of northeastern
America show affinities with the East Asian and European floras. Continuity was
across the northern part of the world, and the highland and steppe components of the
Arcto-Tertiary Flora extended in eastern and far-eastern North America and in
eastern Asia (Weber 2003).
160 PASSERIN D’ ENTREVES & ROGGERO: New species, synonymy and records of Scythris
2 Een,
Fig. 6. Map of the distribution of S. immaculatella (Chambers, 1875).
On the other hand, Beringia played a key role as a refugium during the glaciations
of the Pleistocene since vast lowland regions of Eastern Siberia, Alaska, and the Yukon
territories remained essentially ice-free, even during times of maximum ice extent. The
Beringian land bridge served as the only land connection between Asia and North
America during much of the Pleistocene (Hopkins et al. 1982; Hamilton et al. 1986;
Elias et al. 2000; Brigham-Grette 2001). The most substantial evidence for the Bering
land bridge was provided in 1937 by Hultén (Elias et al. 2000). Hultén argued against
the up-to-that-time accepted belief of an entire ice covering of northern areas during
the glacial periods. On the basis of his studies of the modern floras of Alaska and
Siberia, he hypothesized that most of Northeast Russia and Northwest America
remained ice-free during the Quaternary glaciations. Therefore, they served as a mas-
sive northern refugium for arctic and boreal biota, which did not have to migrate south-
wards of the advancing ice-sheets to survive in southern refugia (Abbott & Brochmann
2003). At present three refugia are identified, as usual, by fossil and climatological evi-
dences: the Beringia Refugium, the Northwest Coast Refugium and the Southern
Refugium (Cox & Moore 1993; Trembley & Schoen 1999; Stone et al. 2002).
Various examples of this distribution are found, in the flora and fauna of Siberia
and North America (Hopkins et al. 1982; Greenberg 1987; Beaudoin et al. 1996; Cox
2000; Stone et al. 2002; MacDougall 2003; Weber 2003).
The distributional gap of S. immaculatella in Northern Siberia can be explained by
the climatic alterations during the Quaternary as well as by modern climatic regimes,
as proved by many studies on climatic changes. There are essential differences
between the insect faunas of Eastern and Western Beringia, both modern and ancient;
these differences have been shaped by the past and present climatic regimes of these
regions (Dawson 1992). Due to peculiarities of atmospheric circulation, the climates
of the boreal zone in these two regions are rather different. The main differences in
climate between the two regions include several aspects that unavoidably have direct
effects on the invertebrate faunas (Elias 1994, 2000; Elias et al. 2000; Felzer 2001).
The succession of geological and climatic alterations that occurred in the area,
could surely explain both the wide and peculiar distribution of S. immaculatella as
could also the lack of collecting in Northern Siberia. Certainly, the discovery of the
host-plants of this Scythris species would bring new light to this mystery.
Nota lepid. 26 (3/4): 153-164 161
S. albocanella Bengtsson 2002b: 65
Material. 39 (Genital slides no. 2232, 2251 and 2253 Passerin d’Entreves), Saudia Arabia, SW-
Arabien, Asirgebirge, 2350 m, 5 km s. Namas, 17—21.iv.1979, Amsel leg.; 19 (Genital slide no. 2252
Passerin d’Entreves), same data, but 2000 m, Wadi Morah, 81 km s. Biljurshi, 24.1v.1979, H. G. Amsel
leg.; 19 (Genital slide no. 2256 Passerin d’Entreves), same data, but 22.1v.1979, H. G. Amsel leg.; 19
(Genital slide no. 3319 Passerin d’Entreves), same data, but 29.1v.—2.v.1979, H. G. Amsel leg.
Distribution. Yemen, Saudi Arabia.
Remarks. The area of distribution is extended to the Asir region, in southern
Saudi Arabia. The new records from Saudi Arabia all refer to the Asir region, which
is characterized, as reported by Hegazy et al. (1998), by a temperate climate and ele-
vations above 2000 m a.s.l. It is also close to the Tihama coastal plains which have
elevations ranging from 0 to 500 m. The transition zone between the arid environ-
ments, which characterize the Tihama area, and the Asir temperate environments has
a complex topography, and distinctive vegetational zones along the altitudinal gradi-
ent. Furthermore, the southwestern territory of the Arabian peninsula is interesting
from a phytogeographic point of view because of its relation to the neighbouring
regions of Africa and Asia. However, these connections are very little studied due to
the rugged topography of the region (Hegazy et al. 1998).
S. badiella Bengtsson 2002b: 66
Material. 30, 29 Congo, Ht. Katanga, Kyala, 18.vii., 1., 9., 23.viti.[19]29, J. Romieux (Genitalia
slides no. 3152, 3153, 3682, 3684, 3690 Passerin d’Entreves).
Distribution. Yemen, Congo (Katanga province).
Remarks. The species shows a clear Sudano-Zambesian distribution (Hegazy et
al. 1998). The peculiar geographical position of Arabia, which lies between the
Afrotropical, Palaeactic, and Oriental Regions, makes it of great importance from a
biogeographical point of view. Indeed, the EastAfrotropical-SouthArabian distribu-
tions represent 40.5% of the whole afrotropical fauna (Franz & Beier 1970). In Arabia
the afrotropical elements are dominant in the foothills and mountains of Hajiaz, Asir,
Yemen, including the Aden hinterland, and to a lesser degree in the Hadramaut and
Qara Mountains (Büttiker 1979; Abo-Khatwa et al. 1980), while the central and SE
areas belong to the Palaearctic Region, and the E and NE areas have influences of the
Oriental Region (Buttiker & Wittmer 1979).
S. biacutella Bengtsson 2002b: 68
Material. 10 (Genital slide no. 2219 Passerin d’Entreves), 1Q (Genital slide no. 2237 Passerin
d’Entréves), Saudi Arabia, SW-Arabien, Asirgebirge, 2350 m, 5 km s. Namas 17., 21.1v.1979, Amsel leg.
Distribution. Yemen, Saudi Arabia.
Remarks. The area of distribution is extended to Saudi Arabia. See also
S. albocanella.
S. strabella Bengtsson 2002b: 88
Material. 30 (Genital slides no. 2221, 2255 and 3318 Passerin d’Entreves), Saudi Arabia, SW-
Arabien, Asirgebirge, 2000 m, Wadi Morah, 81 km s. Biljurshi, 26./27.1v.1979, H. G. Amsel leg.; 10
(Genital slide no. 2254 Passerin d’Entreves), same data, but 29.iv.-2.v.1979, H. G. Amsel leg.
162 PASSERIN D’ ENTREVES & ROGGERO: New species, synonymy and records of Scythris
Distribution. Yemen, Saudi Arabia.
Remarks. The area of distribution is extended to Saudi Arabia. See also S. albo-
canella.
S. valvaearcella Bengtsson 2002b: 92
Material. 10 (Genital slide no. 2233 Passerin d’Entreves), 19 (Genital slide no. 2234 Passerin
d’Entreves), Saudi Arabia, SW-Arabien, Wadi Tihama 850 m, 23.iv.1979, Asirgebirge, H. G. Amsel leg.
Distribution. Yemen, Saudi Arabia.
Remarks. The area of distribution is extended to Saudi Arabia. See also S. albo-
canella.
Acknowledgements
The research was supported by grants from the Italian Ministero della Ricerca Scientifica e Tecnologica
(MURST 60% ,,Biosistematica dei Lepidotteri Scythrididae“). We are very grateful to J.-F. Landry, who
provided the distribution data of S. immaculatella. Many thanks also to Daniela Cresta, who kindly gave
us many useful suggestions to improve the English text.
References
Abbott, R. J. & C. Brochmann 2003. History and evolution of the arctic flora: in the footsteps of Eric
Hultén. — Molecular Ecology 12: 299-313.
Abo-Khatwa, N., A. Banaja, W. Buttiker & W. Wittmer 1980. Fauna of Saudi Arabia. Zoological expedi-
tion to the Northern Hedjaz Region, 1979. — Fauna of Saudi Arabia 2: 5—14.
Beaudoin, A. B., M. Wright & B. Ronaghan 1996. Late Quaternary landscape history and archeology in
the “ice-free corridor”: some recent results from Alberta. — Quaternary International 32: 113-126.
Bengtsson, B. A. 1997a. Scythridids found by H. Hacker in Pakistan 1988 and India 1992. — Esperiana
4: 467-481.
Bengtsson, B. A. 1997b. Scythrididae. — In: P. Huemer, O. Karsholt & L. Lyneborg (eds.),
Microlepidoptera of Europe 2. Stenstrup, Apollo Books. 301 pp.
Bengtsson, B. A. 1997c. Notes on interesting scythridids in the Zoological Museum, Helsinki, Finland
(Lepidoptera, Scythrididae). — Entomologica Fennica 8: 89-102.
Bengtsson, B. A. 2002a. Scythridids of the Arabian Peninsula, I: Oman (Lepidoptera: Scythrididae). —
Phegea 30: 105-118.
Bengtsson, B. A. 2002b. Scythridids of the Arabian Peninsula, II: Yemen (Lepidoptera: Scythrididae). —
Esperiana 9: 61-128.
Bengtsson, B. A. & Liëka, J. 1996. Notes on Asian scythridids with description of four new species
(Lepidoptera: Scythrididae). — Phegea 24: 33-39.
Bengtsson, B. A. & R. Sutter 1996. Scythris felixi spec. nov. aus der Mongolei (Insecta: Lepidoptera:
Scythrididae). — Reichenbachia 37: 207—208.
Brigham-Grette, J. 2001. New perspectives on Beringian Quaternary paleogeography, stratigraphy, and
glacial history. — Quaternary Science Reviews 20: 15-24.
Büttiker, W., 1979. Fauna of Saudi Arabia. Zoological collections from Saudi Arabia. — Fauna of Saudi
Arabia 1: 1-22.
Büttiker, W. & W. Wittmer 1979. Entomological Expedition of the Natural History Museum, Basle to
Saudi Arabia. — Fauna of Saudi Arabia 1: 2329.
Chambers, V. T. 1875. On Tineina from Texas, with descriptions of new species. — Canadian Entomologist
7: 7-108.
Chambers, V. T. 1878. Index to the described Tineina of the United States and Canada. — Bulletin of the
United States Geological and Geographical Survey of the Territories 4: 125-167.
Cox, C. B. 2000. Plate Tectonics, Seaways and Climate in the Historical Biogeography of Mammals. —
Memorias do Instituto Oswaldo Cruz 95: 509-516.
Cox, C. B. & P. D. Moore 1993. Biogeography: an ecological and evolutionary approach. 5th ed. —
Blackwell, Oxford. 326 pp.
Nota lepid. 26 (3/4): 153-164 163
Dawson, A. G. 1992. Ice Age Earth: Late Quaternary Geology and Climate. — Routledge, London & New
York. 293 pp.
Elias, S. A. 1994. Quaternary Insects and Their Environments. — Smithsonian Institution Press,
Washington & London, 284 pp.
Elias, S. A. 2000. Late Pleistocene Climates of Beringia, Based on Analysis of Fossil Beetles. —
Quaternary Research 53: 229-235.
Elias, S.A., D. Berman & A. Alfimov 2000. Late Pleistocene beetle faunas of Beringia: where east met
west. — Journal of Biogeography 27: 1349-1363.
Falkovitsh, M. I. 1969. O pishchevykh svyazakh pustinnykh cheshuekrylykh (Lepid.) v srednei Azii. —
Vsesoyuznoe Entomologicheskoe Obshchestvo 1969: 53-88.
Falkovitsh, M. I. 1972. Novye vidy roda Scythris Hb. (Lepidoptera, Scythrididae) iz srednei Azii. — Trudy
Zoologicheskogo Instituta Rossiiskaia Akademiia Nauk 52: 319-331.
Falkovitsh, M. I. 1979. Novi vid roda Scythris Hbn. (Lepidoptera, Scythrididae) iz pustyni Kyzylkum
Novye vidi nasekomykh. — Trudy Vsesoyuznogo Entomologicheskogo Obshchestva 62: 107-110.
Falkovitsh, M. I. 1981. Scythrididae. — Jn: G. S. Medvedev, Opredelitel nasekommych evropeijskoj chasti
SSSR 4, Cheshuekrylye (2). — Leningrad, 788pp.
Falkovitsh, M. I. 1986. Cheshuekrylye (Lepidoptera) Ostantsovykh gor Kul’dzhuktau 1 podgornoi raviny
(yugozapadnyi Kyzylkum). Fauna Cheshuekrylikh (Lepidoptera) SSSR. — Trudy Vsesoyuznogo
Entomologicheskogo Obshchestva 67: 131-186.
Felzer, B. 2001. Climate impacts of an ice sheet in East Siberia during the Last Glacial Maximum. —
Quaternary Science Reviews 20: 437-447.
Franz, H. & M. Beier 1970. Die Geographische Verbreitung der Insekten. — Berlin, 139 pp.
Greenberg, J. H. 1987. Language in the Americas. — Stanford University Press, Stanford. 438 pp.
Hamilton, T. D., K. M. Reed & R. M. Thorson 1986. Glaciation in Alaska: the geological record. — Alaska
Geological Society, Anchorage. 265 pp.
Hegazy, A. K., M. A. El-Demerdash & H. A. Hosni 1998. Vegetation, species diversity and floristic rela-
tions along an altitudinal gradient in south-west Saudi Arabia. — Journal of Arid Environments 38:
3-13.
Hopkins, D. M., J. V Matthews & S. B. Young (eds.) 1982. Paleoecology in Beringia. — Academic Press,
New York. 489 pp.
Junnilainen, J. 2002. Three new species of Scythrididae from central Turkey (Lepidoptera: Scythrididae).
— Entomologica Fennica 13:146-152.
Landry, J.-F. 1991. Systematics of Nearctic Scythrididae (Lepidoptera: Gelechioidea): phylogeny and
classification of supraspecific taxa, with a review of described species. — Memoirs of the
Entomological Society of Canada 160: 3-341.
MacDougall, A. 2003. Did Native Americans influence the northward migration of plants during the
Holocene? — Journal of Biogeography 30: 633-647.
McDunnough, J. 1927. The Lepidoptera of the Seton Lake Region, British Columbia. — Canadian
Entomologist 59: 266-277.
Nupponen, K. 2001. Records of scythridids from Tunisia, with description of two new species
(Lepidoptera: Scythrididae). — Entomologica Fennica 12: 53-58.
Nupponen, K. & T. Nupponen 2001. Notes on the scythridid fauna of the Altai Mountains, with descrip-
tion of four new species (Lepidoptera: Scythrididae). — Entomologica Fennica 12: 81-93.
Nupponen, K., B. A Bengtsson, J.-K. Kaitila, T. Nupponen, J. Junnilainen & V. Olschwang 2000. The
scythridid fauna of the southern Ural Mountains, with description of fourteen new species
(Lepidoptera: Scythrididae). — Entomologica Fennica 11: 5-34.
Passerin d’Entreves, P. 1986. Lepidoptera: Fam. Scythrididae of Saudi Arabia. — Fauna of Saudi Arabia
8: 256-261.
Passerin d’Entreves, P. & A. Roggero (2003). Description of two new species of Apostibes Walsingham,
1907 with some synonymic and phylogenetic accounts of the genus (Lepidoptera: Scythrididae).
Italian Journal of Zoology 70: 347-352.
Sachkov, S. A. 1995. New from Europe species of Microlepidoptera (Lepidoptera: Scythrididae,
Elachistidae) from Samara region. — Actias 2: 77-78.
Sachkov, S.A. 2000. New species of scythridid moths (Lepidoptera, Scythrididae) from the Middle Volga
River region. — Zoologichesky Zhurnal 79: 1479-1484.
Sachkov, S. A. & S. Y. Sinev 2001. A new species of the genus Scythris Hbn. (Lepidoptera, Scythrididae)
from Transbaikalia. — Trudy Zoologitsheskogo Instituta 291: 27-30.
164 PASSERIN D’ENTREVES & ROGGERO: New species, synonymy and records of Scythris
Sinev, S. Yu. 1993. Novye i maloizvestnye vidy roda Scythris (Lepidoptera, Scythrididae) iz Altaya
(=New and little-known species of the genus Scythris from Altai). — Vestnik zoologii 2: 53-57.
Sinev, S. Yu. 2001. New and little-known species of the genus Scythris Hbn. (Lepidoptera, Scythrididae)
from the asiatic part of Russia. — Trudy Zoologitsheskogo Instituta 291: 3-26.
Staudinger, O. 1880. Lepidopteren-Fauna Kleinasien’s. — Horae Societatis entomologicae Rossicae 15:
159-435.
Stone, K. D., R. W. Flynn & J. A. Cook 2002. Post-glacial colonization of northwestern North America
by the forest-associated American marten (Martes americana, Mammalia: Carnivora: Mustelidae). —
Molecular Ecology 11: 2049-2063.
Trembley, N. ©. & D. J. Schoen 1999. Molecular phylogeography of Dryas integrifolia: glacial refugia
and postglacial recolonization. — Molecular Ecology 8: 1187—1198.
Weber, W. A. 2003. The Middle Asian Element in the Southern Rocky Mountain Flora of the Western
United States: a critical biogeographical review. — Journal of Biogeography 30: 649-685.
eee reTAS EUROPAEA LEPIDOPTEROLOGICA e.V.
Nota lepidopterologica wird den Mitgliedern der SEL zugesandt. Die Mitgliedschaft bei SEL steht
Einzelpersonen und Vereinen nach Maßgabe der Satzung offen. Der Aufnahmeantrag ist an den
Mitgliedssekretär Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgien; e-mail:
[email protected] zu richten. Das Antragsformular ist im Internet auf der Homepage der SEL
unter http://www.soceurlep.org erhältlich.
Der Mitgliedsbeitrag ist jährlich am Jahresanfang zu entrichten. Er beträgt für Einzeipersonen € 35,00
bzw. für Vereine € 45,00. Die Aufnahmegebühr beträgt € 2,50. Die Zahlung wird auf das SEL-Konto
19 56 50 507 bei der Postbank Köln (BLZ 370 100 50) erbeten. Seit dem 1. Juli 2003 gibt es einen neuen,
(preiswerteren) Weg für Geldüberweisungen innerhalb der EU. Die neuen Standardformulare erfordern
eine International Bank Account Number (IBAN) und einen Bank Identifier Code (BIC). Für das SEL
Postbankkonto ist die IBAN DE63 3701 0050 0195 6505 07 und die BIC lautet PBNKDEFF.
Mitteilungen in Beitragsangelegenheiten sind an den Schatzmeister Manfred Sommerer, Volpinistr. 72,
D-80638 München; e-mail:
[email protected] zu richten.
Der Verkauf von Einzelheften und älteren Jahrgängen von Nota lepidopterologica sowie der Verkauf der
Zeitschrift an Nichtmitglieder erfolgt durch Apollo-Books, Kirkeby Sand 19, DK-5771 Stenstrup,
Dänemark; e-mail:
[email protected].
Adressenänderungen bitte sofort dem Mitgliedssekretär oder dem Schatzmeister mitteilen!
Nota lepidopterologica is sent to the members of SEL. The membership is open to individuals and
associations as provided for by the statutes of SEL. Applications for membership are to be addressed to
the Membership Secretary Willy O. de Prins, Nieuwe Donk 50, B-2100 Antwerpen, Belgium; e-mail:
[email protected]. The application form will be found on the SEL homepage
http://www.soceurlep.org.
The annual subscription is to be paid at the beginning of the year. It is € 35.00 for individuals or € 45.00
for associations. The admission fee is € 2.50. Payments requested to SEL account no. 19 56 50 507 at
Postbank Köln [Cologne] (bank code 370 100 50). From July Ist, 2003, a new (cheaper) way of money
transfer within the EU will be available. The new standard forms require the International Bank Account
Number (IBAN) and the Bank Identifier Code (BIC). For the SEL Postbank account, the IBAN is
DE63 3701 0050 0195 6505 07, and the BIC is PBNKDEFF.
Back numbers of Nota lepidopterologica may be obtained from, and orders of Nota lepidopterologica
from non-members are serviced by Apollo-Books, Kirkeby Sand 19, DK-5771 Stenstrup, Denmark;
Changes of addresses should be immediately communicated to the Membership Secretary or the Treasurer.
Nota lepidopterologica est envoyé aux membres de la SEL. L’affiliation est possible, pour les personnes
individuelles aussi bien que pour les associations, en accord avec les statuts de la SEL. Les demandes
d’affiliation doivent être adressées au Secrétaire des Membres Willy ©. de Prins, Nieuwe Donk 50,
B-2100 Antwerpen, Belgique; courriel:
[email protected].
Le formulaire d’ affiliation est disponible par le biais de la page web de la SEL http://www.soceurlep.org.
La contribution annuelle est payable au début de l’année. Elle est de € 35,00 pour les personnes indi-
viduelles et de € 45,00 pour les associations. Les frais d’admission s’elevent à € 2,50. Les payements
doivent étre effectues sur le compte SEL n° 19 56 50 507 aupres de la Postbank Köln [Cologne] (code
bancaire 370 100 50). Les nouveaux formulaires requierent le Numéro de compte banquaire international
(NCBI) et le Code identificateur de banque (CIB). Pour le compte postal de la SEL, le NCBI est DE63
3701 0050 0195 6505 07 et le CIB est PBNKDEFF.
Pour toute question en rapport a la souscription ou aux payements, veuillez contacter le Tresorier,
Manfred Sommerer, Volpinistr. 72, D-80638 Munich; courriel:
[email protected].
Les anciens volumes de Nota lepidopterologica peuvent étre obtenus et les commandes concernant cette
revue de la part de non-membres effectuées auprès de Apollo-Books, Kirkeby Sand 19, DK-5771
Stenstrup, Danemark; courriel:
[email protected].
Tout changement d’adresse doit être communiqué immédiatement soit auprès du Secrétaire des Mem-
bres, soit aupres du Trésorier.
)
SMITHSONIAN INSTITUTION LIBRARIES
3 9088 01090 3615
geek
ae h f
TEE ‘
1 B