Volume 10 Number 5 1 May 2022
The Taxonomic Report
OF THE INTERNATIONAL LEPIDOPTERA SURVEY
ISSN 2643-4776 (print) / ISSN 2643-4806 (online)
Checking the checkered taxonomy of Pl6tz's checkered skippers
(Hesperiidae: Pyrgini)
Jing Zhang'”, Qian Cong'’, John M. Burns’, and Nick V. Grishin’**
'Eugene McDermott Center For Human Growth & Development, Departments of "Biophysics and *Biochemistry, and
“Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX
75390-9050, USA; °Department of Entomology, National Museum of Natural History, Smithsonian Institution, Washington,
DC 20013-7012, USA. “Corresponding author:
[email protected]
ABSTRACT. We present an analysis of the names proposed by Carl Plotz in 1884 for the New World species in the
genus Pyrgus Hubner, [1819] facilitated by the genomic sequencing of extant primary type specimens comparatively with a
larger sample of more recently collected specimens of these species and their relatives. The changes to nomenclature suggested
here are only caused by the identity of primary type specimens as revealed by their phenotypes or though genomic sequencing.
All neotypes are designated to stabilize nomenclature in agreement with the current usage of these names, which in unison
agrees best with the information available about them. Lectotypes are designated for the following 5 taxa: Pyrgus (Scelothrix
[sic]) bellatrix Plotz, 1884 (type locality Argentina: Buenos Aires), Pyrgus (Pyrgus) willi Plotz, 1884 (type locality in Brazil:
Minas Gerais), Pyrgus (Pyrgus) albescens P\6tz, 1884 (type locality in Mexico), Pyrgus (Syrichthus [sic]) lycurgus Plotz, 1884
(type locality in "Central America", likely southern Mexico), and Pyrgus occidentalis Skinner, 1906 (type locality USA: Texas,
San Antonio). Neotypes are designated for the following 4 taxa: Pyrgus (Pyrgus) adepta Plotz, 1884 (Herrich-Schaffer in litt.)
(type locality Colombia: Bogota), Pyrgus (Scelothrix [sic|) dion Plétz, 1884 (type locality Colombia: Bogota), Pyrgus
(Scelothrix [sic|) adjutrix Plotz, 1884 (Herrich-Schaffer in litt.) (type locality in Mexico: Nuevo Leon), Pyrgus (Pyrgus)
insolatrix Plotz, 1884 (Herrich-Schaffer in litt.) (type locality in "Central America", likely southern Mexico). As a result, P.
lycurgus and P. insolatrix are objective synonyms. The following are junior subjective synonyms: P. dion of Burnsius adepta
(Plotz, 1884), Pyrgus (Syrichthus [sic]|) varus Plotz, 1884 of Burnsius orcus (Stoll, 1780) and P. adjutrix of Burnsius oileus
(Linnaeus, 1767). Heliopetes (Heliopyrgus) willi (Pl6tz, 1884) is a species-level taxon and not a subspecies of Heliopetes
(Heliopyrgus) domicella (Erichson, [1849])). Genomic analysis of the lectotypes of P. albescens, P. lycurgus, and P.
occidentalis establishes them as conspecific with Burnsius communis (Grote, 1872), thus depriving a distinct species currently
identified as Burnsius albescens from its name, that becomes a name for Burnsius communis albescens (Pl6tz, 1884) in accord
with its lectotype identity; P. /ycurgus and P. insolatrix are its junior subjective synonyms, but P. occidentalis is a junior
subjective synonym of B. communis communis. A new name Burnsius albezens Grishin sp. n. (type locality USA: Arizona,
Cochise Co., Portal) is proposed for the species misidentified as B. albescens. Furthermore, genomic comparisons reveal two
other new species and one new subspecies of Burnsius Grishin, 2019: B. burnsi Grishin sp. n. (type locality Mexico: Veracruz,
Huatusco), B. adepta inepta Grishin ssp. n. (type locality Ecuador: Pichincha, Tandapi), and B. orcynus Grishin sp. n. (type
locality Curagao: Hato Field) that are cryptic and can be confidently identified only by their genotype.
Additional key words: nomenclature, stability, taxonomy, classification, genomics, biodiversity, butterflies.
ZooBank registration: http://zoobank.org/1 AC] F3FB-603E-46A0-B8C2-BB9DE88B46BB
INTRODUCTION
Carl Pl6tz named several hundred Hesperiidae species in a short span of 8 years right before his death,
developed and published identification keys for the Worldwide Hesperiidae fauna as he understood it, and
prepared drawings for nearly all Hesperiidae species he knew and had access to. Unfortunately, a large
number of species proposed by Plétz could not be traced to primary type specimens, his drawings were
not published and their whereabouts remain unknown, and his keys were neither detailed nor accurate
1
enough to allow unambiguous identification. For these reasons, it has been a challenge to figure out the
attribution of Plétz names, and many of them were either incorrectly synonymized or used for species
they were not meant for.
To partly alleviate the problem, copies of some of Pl6tz's drawings were arranged by Godman for
the species he could not confidently recognize and attribute to specimens in his collection (Godman
1907). This compilation was largely focused on Neotropical species, but included a number of Old World
species as well. These drawings that are not particularly precise and look more like sketches (it is unclear
whether the originals were any more accurate), remain unpublished and are in the library of the Natural
History Museum, London, UK (BMNH). At least a second copy of some of these drawings was also
made, because similar drawings, cut into small cards, are pinned among the specimens of corresponding
species in the collection of National Museum of Natural History, Smithsonian Institution, Washington,
DC, USA (USNM).
In his treatment of checkered skippers Pl6tz placed in Pyrgus Hitibner, [1819], a number of species
that are now transferred to other genera, such as Burnsius Grishin, 2019, Heliopetes Billberg, 1820,
Muschampia Tutt, 1906, Favria Tutt, 1906, Spialia Swinhoe, 1912, Agyllia Grishin, 2020, Ernsta
Grishin, 2020, Alenia Evans, 1935, Taractrocera Butler, [1870], Nervia Grishin, 2019, and Amblyscirtes
Scudder, 1872, assigned to 6 tribes (Pyrgini Burmeister, 1878, Carcharodini Verity, 1940, Celaenorrhinini
Swinhoe, 1912, Astictopterini Swinhoe, 1912, Taractrocerini Voss, 1952, and Hesperiini Latreille, 1809)
in 3 subfamilies (Pyrginae Burmeister, 1878, Tagiadinae Mabille, 1878, and Hesperiinae Latreille, 1809);
and he proposed 12 new names that have been associated with the New World fauna (Pl6tz 1884). One of
them, Pyrgus (Syrichthus [sic|) argina Pl6tz, 1884 (type locality Australia, Brisbane, in error), later found
to be a junior subjective synonym of Amblyscirtes (Stomyles) hegon (Scudder, 1863) (Evans 1949; Evans
1955) (synonymy confirmed), belongs to the subfamily Hesperiinae Latreille, 1809 and was never truly
associated with the "checkered skippers" later on. Here, we analyze the remaining 11 names together with
others, trace some to their primary type specimens, and propose solutions to nomenclatural and taxonomic
problems related to these names. The major new data presented here are: (1) unpublished copies of the
Pl6tz's drawing of Pyrgus (Syrichthus [sic|) varus Plétz, 1884 and (2) genomic analysis of primary type
Specimens together with a series of more recently collected specimens, which calls for a number of
taxonomic changes.
MATERIALS AND METHODS
The specimens were inspected and photographed/sampled for DNA in the following collections:
American Museum of Natural History, New York, NY, USA (AMNH), Natural History Museum,
London, UK (BMNH), Burke Museum of Natural History and Culture, Seattle, WA, USA (BMUW),
Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), Ernst Moritz Arndt Universitat in
Greifswald, Germany (EMAU), Field Museum of Natural History, Chicago, IL, USA (FMNH),
Mississippi Entomological Museum, Starkville, MS, USA (MEM), Museum fiir Naturkunde, Berlin,
Germany (MFNB), McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL, USA (MGCL),
Texas A&M University Insect Collection, College Station, TX, USA (TAMU), Bohart Museum of
Entomology, University of California, Davis, CA, USA (UCDC), National Museum of Natural History,
Smithsonian Institution, Washington, DC, USA (USNM), Zoologische Staatssammlung Mtiinchen,
Germany (ZSMC). Historical documents, such as unpublished drawings, were inspected in the following
collections: Natural History Museum, London, UK (BMNH) and National Museum of Natural History,
Smithsonian Institution, Washington, DC, USA (USNM). Photographs of specimens and illustrations
were taken with Nikon D800 camera through 105 mm macro lens and processed using Photoshop.
Genomic sequencing and analysis was carried out using our developed protocols as previously described
(Cong et al. 2021; Zhang et al. 2021). Sequence datasets obtained in this work are deposited in the NCBI
database <https://www.ncbi.nlm.nih.gov/> as BioProject PRJNA832040 (BioSample entries of the project
contain the locality and collection data of the sequenced specimens shown in the trees), and COI barcodes
have GenBank accessions ON255697—ON255706. Exon sequences with diagnostic characters highlighted
2
are also available from <https://osf.10/ru7bc/>. DNA characters are given as abbreviations, e.g.,
aly728.44.1: G672C means position 672 in exon | of gene 44 from scaffold 728 of Cecropterus lyciades
(formerly in Achalarus Scudder, 1872, thus aly) reference genome (Shen et al. 2017) is C, changed from
G in the ancestor. Similar notations are used for the COI barcode characters, e.g., A78G means position
78 is G, changed from A in the ancestor, or T264T(not C) means position 264 is T, unchanged from the
ancestor, and not C as in sister taxon.
RESULTS AND DISCUSSION
At the end of his Pyrgus revision, Plétz acknowledged the difficulties he experienced with the project
(translated from German): "several species are [known] only in a defective condition, from female
specimens, or illustrations" (Plotz 1884). The issue with female specimens is that major divisions in
Pl6tz's key are largely based on the two characters: costal fold and "hair pencil", 1.e., a tuft of long, hair-
like scales on hind-tibiae. Both of these characters are expressed only in males. "Defective condition"
might refer to the absence of hindlegs in males, needed to check a "hair pencil" (although thoracic pouch
presence is also an indicator of the pencil).
As a result, four subjective synonyms of a single species Pyrgus ruralis (Boisduval, 1852), all
treated as separate species by Pl6tz, are scattered throughout his key: Hesperia ricara W. H. Edwards,
1865 is placed in the subgenus Pyrgus (hair pencil absent, costal fold present), Syrichtus caespitatis
Boisduval, 1852 and Syrichtus ruralis Boisduval, 1852 are placed not near each other in the subgenus
Scelothrix [sic] (hair pencil present, costal fold present in all but one species) and Syrichtus petreius W.
H. Edwards, 1870 is placed in the subgenus Syrichthus [sic] (both hair pencil and costal fold are absent).
The characters given in the key seem insufficient to confidently figure out which actual species were
meant by Plétz. All these 4 taxa have costal fold and hair pencil in males. Therefore, Pl6tz either
misidentified some of these species, or experienced other problems, like having only female specimens
available for analysis (leaving the rest to guesswork), misidentifying females as males, or missing the
presence of sometimes poorly developed costal fold. Judging from the information in his key, we
hypothesize that, if Plétz inspected actual specimens of these taxa (instead of inserting them into the key
based on literature and correspondence), both his "vicara" (males probably included) and "petreius"
(likely only females) were variations of Burnsius communis (Grote, 1872) from Colorado and Nevada.
One of the more mysterious names, Pyrgus (Scelothrix |[sic|) dion Plotz, 1884, was proposed on
the basis of a female (likely a single specimen) from unknown locality, so its attribution to a subgenus
defined by the two secondary sexual characters in males, was arbitrary. Regardless of these mistakes and
problems, we undertook the task to figure out which presently known species were meant by the 11
names proposed by Pl6tz in this work for the New World taxa. From the example given above, we learned
that we should not put much weight in Pl6tz's identification of species named before him and his
judgment about the presence or absence of secondary sexual characters or the sex of a specimen. In our
decisions, we largely relied on (1) the agreement between the description, more heavily weighted for the
characters given in the paragraph just above the name, with the specimen(s) curated as the type(s) of this
name, or with the copies of unpublished drawings; (2) Pl6tz's statements about general similarity between
his taxa: for his n. 49 (Lycurgus), 50 (Petreius) and 51 (Communis), all 3 in the subgenus Syrichthus [sic],
Pl6tz stated: "It is the same habitus as in § n. 5 [Albescens], 6 [Ricara], 7 [Jnsolatrix, all 3 in the subgenus
Pyrgus| and §§§ n. 38 [Adjutrix, in the subgenus Scelothrix [sic]], but in basal area of the discal cell there
is no white ray on forewing, and no spot on the hindwing"; (3) specimen localities, if MFNB and ZSMC
(the two collections with Pl6étz's types) had many old specimens of a species from one locality.
We started from the names with extant syntype specimens: Pyrgus (Pyrgus) willi Plotz, 1884
(NVG-18057A03, ZSMC), Pyrgus (Pyrgus) albescens Plotz, 1884 (NVG-15033H10, MFNB), Pyrgus
(Scelothrix |sic|) bellatrix Plétz, 1884 (NVG-15032B12, MFNB), and Pyrgus (Syrichthus [sic|) lycurgus
Pl6tz, 1884 (NVG-15033H11, MFNB), one specimen per name found (Fig. la—d). For each of the four,
we compared the specimen closely with the original description and found a good agreement in all cases.
Therefore, we confirm them as syntypes, and stabilized nomenclature by lectotype designations below.
3
All four type specimens were sequenced and included in the genomic tree along with many more
recently collected specimens. While P. willi and P. bellatrix indeed grouped with the specimens identified
as such (the former is a species-level taxon, not a subspecies as in the current taxonomic arrangement), to
our surprise, both P. albescens and P. lycurgus clustered within the species known today as Burnsius
communis (Grote, 1872) (type locality in USA: central Alabama) and not in agreement with the current
usage of these names (Table 1). This discrepancy prompted a more careful investigation into original
descriptions of other seven taxa and analysis of additional information available about them.
For the two of these names, Pyrgus (Pyrgus) aconita Plétz, 1884 and Pyrgus (Scelothrix |sic|)
veturius Plotz, 1884, we agree with the current taxonomic interpretation and hypothesize that the type
locality of P. veturius might have been in Brazil: Bahia. For one name, Pyrgus (Syrichthus [sic]) varus
Pl6tz, 1884, we inspected and photographed Godman's copies of Pl6étz's original drawings (Fig. 2c, d)
that, in agreement with the original description, allowed us to identify this species as Burnsius orcus
(Stoll, 1780), a change to the current synonymy. Furthermore, using this information, we found two
female specimens in MFNB that are syntypes of P. varus, possibly the specimens illustrated by Plotz.
For the remaining four names, we analyze the original descriptions and designate neotypes to
objectively define these names, because we were not able to find their syntypes and believe they were
lost. The exceptional need for the neotype designations arises from the discovery of several cryptic
species of Burnsius as revealed by genomic sequencing, and thus the necessity to apply names to them in
accord with the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999). In all
four cases of neotype designations, we find that our choice is consistent with the current usage of these
names, apparently the best decision that can be arrived at on the basis of available information and in the
absence of syntypes. The neotypes are needed, however, to stabilize nomenclature, because the original
descriptions are vague and at times inconsistent, some missing type localities.
After objectively defining Pl6tz's questionable names with lectotypes and neotypes, we find that
the species currently known as Burnsius albescens (Pl6tz, 1884) does not have a name, because the
primary types of all names previously assigned to it are B. communis and no other available name
apparently applies. It has been a challenge to separate the now nameless species ("B. albescens") from B.
communis. Over the course of more than a century, the entity called albescens has been widely and
variously called a form, variety, race, geographical race, or subspecies of communis, or a separate species.
Using differences in male genitalia, average size, and geographic distribution, Burns (2000) decisively
documented its species status. Using genomics, we demonstrate that the trinomial Burnsius communis
albescens should be retained but applied to an altogether different taxon: a Mexican subspecies of B.
communis. So there are three valid taxa: B. communis, its Mexican subspecies B. c. albescens, and a
Species currently known as B. albescens.
It is unclear whether the ICZN should be approached to preserve the current usage of the name B.
albescens by a neotype designation and to rename the true Mexican albescens. This matter is for the wider
community of Lepidopterists to decide. To alleviate the problem for the time being, we propose a new
Table 1
New taxa, change of synonymy, and change in status are highlighted in green, yellow, and blue, respectively
First proposed as Current treatment Proposed herein
Pyrgus (Scelothrix [sic]) veturius Plétz, 1884 Chirgus (Turis) veturius (Plétz, 1884) Chirgus (Turis) veturius (Plétz, 1884)
Pyrgus (Scelothrix [sic]) bellatrix Plétz, 1884 Heliopetes (Heliopyrgus) americanus bellatrix (Pl6tz, 1884) Heliopetes (Heliopyrgus) americanus bellatrix (Pl6tz, 1884)
Pyrgus (Pyrgus) aconita Plotz, 1884 (Herrich-Schaffer in litt.) Heliopetes (Heliopyrgus) domicella domicella (Erichson, [1849]) Heliopetes (Heliopyrgus) domicella domicella (Erichson, [1849])
Pyrgus (Pyrgus) willi Plétz, 1884 Heliopetes (Heliopyrgus) domicella willi (Pl6tz, 1884) ~ Heliopetes (Heliopyrgus) willi (Platz, 1884) Sra
Pyrgus (Pyrgus) adepta Plotz, 1884 (Herrich-Schaffer in litt.) Burnsius adepta (Plétz, 1884) Burnsius adepta adepta (Plétz, 1884)
Pyrgus (Scelothrix [sic]) dion Plotz, 1884 Burnsius adepta (Plétz, 1884) Burnsius adepta adepta (Plétz, 1884)
Pyrgus (Syrichthus [sic]) varus Plétz, 1884 Burnsius communis (Grote, 1872) - Burnsiusorcus (Stoll, 1780)
Pyrgus (Scelothrix [sic]) adjutrix Pl6tz, 1884 (Herrich-Schaffer in litt.) Burnsius oileus (Linnaeus, 1767) Burnsius oileus (Linnaeus, 1767)
Pyrgus (Pyrgus) albescens Plétz, 1884 Burnsius albescens (Plétz, 1884) _ Burnsius communis albescens (Plétz, 1884)
Pyrgus (Syrichthus [sic]) lycurgus Pl6tz, 1884 Burnsius adepta (Pl6tz, 1884) - Burnsius communis albescens (Plétz,1884)
Pyrgus (Pyrgus) insolatrix Pl6tz, 1884 (Herrich-Schaffer in litt.) Burnsius communis (Grote, 1872) _ Burnsius communis albescens (Plétz,1884)
Pyrgus occidentalis Skinner, 1906 Burnsius albescens (Pl6tz, 1884) - Burnsius communis communis (Grote,1872)
n/a Burnsius albescens (Pl6tz, 1884) of Evans 1953 and Burns 2000 - BurnsiusalbezensGrishin,sp.n.
n/a Burnsius adepta (Pl6tz, 1884) in North and Central America - BurnsiusburnsiGrishin,sp.n.
n/a B. adepta and orcynoides in SW Colombia and Ecuador _ Burnsius adeptaineptaGrishin,ssp.n.
n/a Burnsius orcynoides (Giacomelli, 1928) on islands off Venezuela - BurnsiusorcynusGrishin,sp.n.
4
Coll: Weymer|E 7
fZ505) nttp://coll:mfn-berlin.de/ DNA sample ID:
eee ic ae soak NVG-15032B12
nitaes ; c/o Nick V. Grishin
DNA sample ID: —— a
NVG-—18057A03 He SJE erra tigre a
c/o Nick V. Grishin Willi Fl. Mi nesiver:
DNA sample ID:
NVG—15033H10
c/o Nick V. Grishin
Al.
Baga
x http://coll.mfn-berlin.de/u/
ores B0a6ef
isa
DNA sample ID:
NVG-15033H11
eae
° Tex.
DNA sample ID:
NVG-—15095F03 Fe —— . aa
c/o Nick V. Grishin | © aS a ZS
iL SSS
05mm |
Ke —. =
e Burnsius communis communis (=occidentalis)
= =
Fig. 1. Lectotypes and neotypes of Heliopetes and Burnsius. a. lectotype of Pyrgus (Scelothrix [sic]|) bellatrix Plotz, 1884, now
Heliopetes (Heliopyrgus) americanus bellatrix; b. \ectotype of Pyrgus (Pyrgus) willi Plotz, 1884, now Heliopetes
(Heliopyrgus) willi, stat. rest.; ¢. lectotype of Pyrgus (Pyrgus) albescens P\6tz, 1884, now Burnsius communis albescens, stat.
rev.; d. lectotype of Pyrgus (Syrichthus |sic|) lycurgus Plotz, 1884 and, simultaneously, neotype of Pyrgus (Pyrgus) insolatrix
Plotz, 1884 (Herrich-Schaffer in litt.), now junior subjective synonyms of Burnsius communis albescens, stat. rev.; e. lectotype
of Pyrgus occidentalis Skinner, 1906, now junior subjective synonym of Burnsius communis communis (Grote, 1872), end of
its abdomen in left lateral view is shown on the right, scales removed to expose left valva and green arrows point at the two
prongs of its expanded harpe, 0.5 mm scale bar refers to this image. Each specimen is separated from others by black lines;
dorsal and ventral aspects are shown on the left and right, respectively. Labels and specimens are shown to scale with a 1 cm
scale bar given. Synonyms are preceded with = sign and are placed in parenthesis. LT and NT denote lectotype and neotype,
respectively. Specimen repository abbreviations are shown 1n blue font.
name for the current albescens. The new name is phonetically similar to albescens and would not sound
like a change; and it replaces two letters (standing for the typically two-prong harpe of male genitalia in
true albescens) with one letter (standing for what Evans (1953) called the "monodent" harpe of the
unnamed species).
5
After this general overview summarized in Table 1, we present sections dealing with each name
individually. These sections are ordered taxonomically unless the logic of presentation dictates a different
order, which is adopted for clarity.
Pyrgus (Scelothrix [sic|) veturius Plétz, 1884 is confirmed as a valid (and type) species
of Turis Grishin, 2022, a subgenus of Chirgus Grishin, 2019
We inspected specimens identified as Pyrgus (Scelothrix [sic|) veturius Plétz, 1884 (type locality not
specified, could have been Brazil: Bahia, because this is one of the known localities with specimens
collected at around that time, and Plétz named other species from there) in MFNB, an illustration of this
species by Draudt (1921—1924) (which might have been a reproduction of the original drawing by Pl6tz
that was included among the drawings copied by Godman's decision), and the original description given
in a form of an identification key (Pl6tz 1884). Plotz diagnosed P. veturius by the absence of a central
white band on hindwing that is replaced with disjoined spots, five in number, not reaching costal margin,
and five spots in the submarginal area; two spots in forewing discal cell, one above the other, and pale
dash between them and costa; a divided white spot in the postdiscal area of forewing cell 1 (CuA>-
1A+2A), with one of the parts of the spot displaced basad (i.e., actually two postdiscal spots in cell 1, one
shifted basad comparatively to the other); a well-defined row of marginal white spots, but poorly
developed submarginal spots; among other characters detailed in the original description (Pl6tz 1884).
One discrepancy with the original description is that this species lacks costal fold but stated to
have one. It is possible that Plétz had only females at his disposal and made a guess that its males should
have the fold, thus placing it in the subgenus Sce/othrix [sic]. Alternatively, Plétz could have mistaken its
somewhat expanded costal area for the fold. Regardless of the fold, this species is rather distinct from
others, and the original description was detailed enough to allow its recognition even in the absence of
illustrations and locality. Thus, we do not see problems with the current usage of this name, and simply
confirm it as a valid species Chirgus (Turis) veturius Pl6étz, 1884 as it was identified and illustrated by
Draudt (1921-1924) (reproduced here as Fig. 21), Evans (1953), and subsequent workers in agreement
with the original description. Therefore, we do not see an exceptional need to designate a neotype of this
species.
Lectotype designation for Heliopetes (Heliopyrgus) americanus bellatrix (P\6tz, 1884)
Described on the basis of at least two specimens from Argentina: Buenos Aires, Pyrgus (Scelothrix |sic|)
bellatrix Pl6tz, 1884 is characterized by (interpretively translated from the original description): "dorsally,
body and wing bases overscaled with gray hair-like scales, wings brown or blackish-gray with bright
white spots, spot in cell 2 [CuA;-CuA,] square and not smaller than the spot in discal cell, which may
have a ray towards the base; hindwings ventrally with gray bases and two strongly angular bands, the one
by the base is broad in cell 7 [Sc+R;-RS] and constricted before its middle" (Plétz 1884). Forewing length
given as arange: 14-15 mm and the mention of "sometimes" referring to the discal cell white ray indicate
that more than one specimen was described. This species is placed before Heliopetes (Heliopyrgus)
americanus americanus (Blanchard, 1852) in the key, and therefore was likened to it by Pl6tz.
We were able to locate only a single syntype, but it agrees well with the original description and
reflects the current application of this name. To ensure that this taxon is objectively defined, N.V.G.
designates this syntype, in MFNB, shown in Fig. la, and bearing the following 8 labels: || Typus ||
Americanus | Buenos Ayres | 71 v. Ha[?]. || Bellatrix Plotz | taf 877 11. | non Americanus || Coll. Weymer
|| Coll. Weymer || Bellatrix Plétz 1 |, | Aserteanus—Gay | Buenos Ayres || {QR Code} http://coll.mfn-
berlin.de/u/ | 44a0c5 || DNA sample ID: | NVG-15032B12 | c/o Nick V. Grishin || that can additionally be
recognized by not fully expanded right hindwing near the outer margin around cell CuA ,-CuAg2 as the
lectotype of Pyrgus (Scelothrix |sic|) bellatrix Plotz, 1884. Curiously, the drawing number 877 that
appears on one of the lectotype labels is not mentioned in Godman (1907), or in the original description
6
by Plétz, and as far as we can tell, is not available anywhere but from the original Pl6tz's drawing, further
increasing the confidence that this specimen is from the type series. The COI barcode sequence of the
lectotype (GenBank ON255697) is:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGAAATCCTGGATCATTAATTGGTGATGATCAAATTTATAATACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATCGGAGGATTTGGAAACTGATTAGTTCCTTTAATACTAGGAGCTCCAGATATAGCATTTCCACGTA
TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACATTACTTATTT CGAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGC
TCATCAAGGCTCCTCTGTTGATTTAGCTATTTTCTCACTACATTTAGCAGGAATTTCATCTATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATATATCA
TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTATTATTATCATTACCTGTCTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTT
CATTTTTCGACCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Genomic analysis places P. bellatrix as a close sister to H. americanus americanus (Fig. 3a)
consistently with its current treatment as a subspecies Heliopetes (Heliopyrgus) americanus bellatrix
(Plétz, 1884), their COI barcode sequences are only 0.3% (2 bp) different, and additional data are needed
to study the relationship between the two subspecies.
Pyrgus (Pyrgus) aconita P\étz, 1884 (Herrich-Schiffer in litt.) is confirmed as a junior
subjective synonym of Heliopetes (Heliopyrgus) domicella domicella (Erichson, [1849])
Pyrgus (Pyrgus) aconita Plétz, 1884 (Herrich-Schaffer in litt.) (type locality "Georgia", probably in error)
was paired with the species currently known as Heliopetes (Heliopyrgus) domicella (Erichson, [1849]) by
Pl6tz in his key (Plétz 1884), and differs from it by lacking the marginal (while still having submarginal)
row of white dots on all wings and greener bands on ventral hindwing. Godman, who inspected the
original unpublished Plétz's drawing, which had a number 871 not listed in the original description,
commented that P. aconita was "very like Heliopetes domicella Er., but greener" (Godman 1907). We
were not able to find any additional information about this taxon, but note that some populations of H.
domicella are indeed darker and lack various rows of white spots, approaching the appearance of
Heliopetes (Heliopyrgus) domicella margarita (E. Bell, 1937) at the extreme. Therefore, it is likely that P.
aconita 1S a junior subjective synonym of Heliopetes (Heliopyrgus) domicella domicella (Erichson,
[1849]), as currently presumed. Finally, we note that according to Plotz, the type(s) of P. aconita had the
base of cell 3 (M3-CuA,) on forewing filled with white (not brown) and thus merged with the central
band, something to watch for in re-discovering this taxon or its type specimens.
Heliopetes (Heliopyrgus) willi (Plétz, 1884), reinstated status
Genomic sequencing of Pyrgus (Pyrgus) willi Plétz, 1884 (type locality Brazil: Minas Gerais) syntype
and a more recent specimen reveals prominent genetic differentiation of this taxon currently treated as a
subspecies of Heliopetes (Heliopyrgus) domicella (Erichson, [1849]) (type locality Guyana) from the
nominotypical subspecies (Fig. 3a). For instance, Fst/Gmin between them computed on the Z
chromosome are 0.39/0.02 and COI barcodes between type specimens of P. willi and H. domicella differ
by 1.7% (11 bp). Therefore, we reinstate it as a species Heliopetes (Heliopyrgus) willi (Plotz, 1884), stat.
rest. However, despite differences in facies, Heliopetes domicella margarita (E. Bell, 1937) (type locality
Venezuela: Margarita Island) clusters within H. domicella and therefore is left as its subspecies.
To define this species objectively, Olaf H. H. Mielke hereby designates a male syntype in the
Zoologische Staatssammlung Miinchen, Germany (ZSMC) shown in Fig. 1b and bearing the following 5
labels: || Pyrgus | Willi | Pl6tz || Hesperia type | Willi Pl. Minas Geraes || Type || Lectotypus | Pyrgus | willi
| Plotz, 1884 | Zool. Staatssammlg Miinchen | O. Mielke det. 1979 || DNA sample ID: | NVG-18057A03 |
c/o Nick V. Grishin || as the lectotype of Pyrgus (Pyrgus) willi Plotz, 1884. This designation is only
reflected on the label added to the specimen, but was not published previously, so it is formalized here.
The COI pateeue sequence of the lectotype (GenBank ON255698) is:
AACTTTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGAAATCCTGGATCACTAATTGGAGATGACCAAATTTATAATACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAAT TGGAGGATTTGGAAATTGATTAATTCCATTAATAT TAGGAGCCCCAGATATAGCATTCCCCCGCA
TAAATAATATAAGATTTTGATTACTACCCCCATCTTTAACTT TACTTATTT CAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGAT GAACAGTTTATCCCCCTCTTTCAGCTAATATCGC
TCATCAAGGTTCTTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATATATCT
TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAAT TACAGCATTATTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTT
1 A
CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Db
————— eee
GRRE) http: //coll.mfn-
ee berlin.de/u
ao /961e6
Coll. Vey mer Poon eel
gas ie] MeN uRr
ise http://coll.mfn-
F . berlin.de/u/
i] eee4fe
ee
Mexico _
2 ; KE
cp Yh BMNH
Burnsius adepta (=dion)
*
Burnsius oileus (=adjutrix)
Burnsius albezens sp. n.
cay
NVG-19086D03
USNM
Burnsius orcynus sp. n. USNM Burnsius adepta inepta ssp. n.
Fig. 2. Type specimens and illustrations of Burnsius. a, b. Syntypes of Pyrgus (Syrichthus [sic|) varus Plotz, 1884, now junior
subjective synonym of Burnsius orcus (Stoll, 1780), with their labels separated between specimens by black lines; ¢, d.
Godman's copies of unpublished Plotz's drawings of P. varus Plétz, 1884 from Mexico: no. 900 labeled as ¢ (actually 2) and
900a &, respectively (to save space, sex symbols are pasted in from below the images, where they appear on the drawings); e,
f, g. syntypes of Papilio orcus Stoll, 1780 (now in Burnsius) as drawn by Lambertz: 3 dorsal, 2 ventral, and dorsal aspects,
respectively (sexes of specimens shown in dorsal aspects were switched in the original drawing and published engravings); h.
neotype of Pyrgus (Scelothrix [sic]) dion Plotz, 1884, now junior subjective synonym of Burnsius adepta adepta (P\étz, 1884);
8
i. illustration of a possible syntype (if it is a copy of Plotz's drawing) of Pyrgus (Scelothrix [sic]) veturius Plotz, 1884, now
Chirgus (Turis) veturius from Draudt (1921-1924), pl. 179 row a, images 4 and 5; j. illustration of a specimen identified as
Pyrgus adepta by Snellen (1887: Pl. 2, Fig. 4), but actually Burnsius orcynus sp. n., image flipped (left-right inverted) from the
original. k. neotype of Pyrgus (Scelothrix [sic|) adjutrix Plotz, 1884 (Herrich-Schaffer in litt.), now junior subjective synonym
of Burnsius oileus (Linnaeus, 1767); 1. neotype of Pyrgus (Pyrgus) adepta P\6tz, 1884 (Herrich-Schaffer in litt.), now Burnsius
adepta adepta, m. holotype of Burnsius albezens sp. n.; n. holotype of Burnsius burnsi sp. n.; 0. holotype of Burnsius orcynus
sp. n.; p. holotype of Burnsius adepta inepta ssp. n. Additional data in text. Dorsal and ventral aspects are on the left and right,
respectively (if both are shown). Where available, DNA sample number and collecting locality are shown above dorsal and
ventral images, respectively. Specimens are shown to scale with a 1 cm scale bar given. Synonyms are preceded with = sign.
HT, ST, and NT denote holotype, syntype and neotype, respectively. Repository abbreviations are shown in blue font.
Photographs a, b are by MFNB, k is by TAMU, and c-h are © The Trustees of the Natural History Museum London, and are
made available under Creative Commons License 4.0 (https://creativecommons.org/licenses/by/4.0/).
Neotype designation for Burnsius adepta (P\l6tz, 1884) affirming its current usage
Pyrgus (Pyrgus) adepta Plétz, 1884 (Herrich-Schaffer in litt.) (type locality Colombia: Bogota) presents
two problems. First, this name is currently applied to a species lacking costal fold. However, the original
description placed it in the subgenus Pyrgus that Pl6tz defined by the presence of costal fold and the lack
of tibial tuft of long scales (Pl6tz 1884). Second, general appearance of what is currently presumed to be
Burnsius adepta is more similar to Burnsius communis (Grote, 1872) and its close relatives than to
Heliopetes domicella (Erichson, [1849]), with which P. adepta was grouped in the key by Pl6tz on the
basis of a wide white central band on all wings, and differentiated from by white spots basad of this
central band: two on the forewing and one on the hindwing (Plétz 1884).
Assuming that the type locality (Bogota in Colombia) is correct, the only species with costal fold
that generally fits the description of P. adepta would be H. domicella. However, we could not find a
specimen of H. domicella with white spots basad of the central band. Wing bases of H. domicella, even in
the palest specimens, are always unspotted brown. Due to the white spots present at wing bases, P. adepta
is not H. domicella. The only two other options, among species recorded from Colombia, would be either
the species currently called B. adepta, or Burnsius orcus (Stoll, 1780) (type locality Suriname). The latter
Species is widely distributed in Colombia, has costal fold (as Plotz described for P. adepta) and tibial tuft
(contrary to Plo6tz description). However, it reminds even less of H. domicella than a species currently
called B. adepta. Indeed, in B. orcus, the forewing discal cell spot does not overlap much, if at all, with
the spot in cell 2 (CuA;-CuA 2), not giving an appearance of a band.
Therefore, we agree with Evans (1953), who applied the name P. adepta to the species identified
today as B. adepta. It is conceivable to think that instead of separate spots, P. adepta possesses a
continuous discal band through both wings, similar to that of H. domicella, although basal edges of discal
cell spot and the spot in cell 2 (CuA,-CuAz2) are not aligned as perfectly as in H. domicella and the spot in
cell 2 is typically offset distad (or at least the basal edge of the band is more irregular), giving us an
overall impression of B. communis rather than of H. domicella.
Minding the lack of the costal fold and assuming that Pl6tz didn't mix something up in his key, the
type specimen(s) of P. adepta should have been female(s), or Pl6tz mistook his male type(s) for females,
not seeing costal fold or tibial tuft. In either case, by likening P. adepta to H. domicella, Plétz might have
deduced that P. adepta males would have costal fold. It is also conceivable that Pl6tz mistook convex in
basal half forewing costa for the costal fold. A related discrepancy in Pl6tz's key is that in both H.
domicella and Heliopetes willi (Pl6tz, 1884) tibial tuft 1s present, but they are placed in Pyrgus stated to
lack the tuft. Because at least the lectotype of H. willi is a male, we hypothesize that hindtibiae might have
been missing in the type specimen(s) during Pl6tz's inspection, as they are missing today in the lectotype.
For the lack of a better option, Plétz might have presumed that the hindtibiae lacked the tuft, without
having a chance to observe them.
Evans noted that there was an unpublished figure of P. adepta in the British Museum (Evans
1953), but the compilation of Godman's copies of Pl6tz's drawings did not include P. adepta. Moreover,
Godman did not mention P. adepta in his listing of American species named by Plétz (Godman 1907).
The source and whereabouts of the figure that Evans referred to remain unknown. However, in 1887, just
9
; Chirgus nigella|NVG-14102E11|Peru: Arequipa|1939
a = Chirgus fides|11-BOA-13382G01|Chile: Atacama Prov.|1981
1 Chirgus bocchoris bocchoris|NVG-17069B08|Argentina|old
Chirgus veturius|11-BOA-13382F11|Brazil: Bahia|1991
st Burnsius crisia| NVG-15033H02|ST|Cuba: Santo Domingo|old
Burnsius crisia| NVG-19041H06|Dominican Republic|1986
Burnsius communis communis|NVG-3867|USA: TX, Dallas Co.|2015
Burnsius communis albescens| NVG-19086E05|Mexico|1907
Burnsius albezens| NVG-4377|USA: TX, Dallas Co.|2015
Burnsius albezens|NVG-19086E01|Mexico: Michoacan|1965
, Burnsius burnsi|NVG-19086B10|PT|Mexico: Guerrero|1984
-Burnsius burnsi|NVG-19086C02|PT|Panama: Panama Prov.|1978
4) Burnsius adepta adepta| NVG-19086D05|NT|Colombia: Bogota|old
ol urnsius adepta adepta|NVG-19086C09|Venezuela: Merida|1988
> burnsius adepta inepta| NVG-15092E10|PT|Colombia: Valle| 1987
Burnsius adepta inepta| NVG-16108G09|HT|Ecuador: Pichincha|1990
,Burnsius orcynus|NVG-19086C10|PT|Venezuela: Margarita Island|1989
Burnsius orcynus| NVG-19086D03]|HT|Curacao: Hato Field|1943
5 Burnsius orcynoides|NVG-19086B05|Peru|old
Burnsius orcynoides| NVG-19086D01|TT|Argentina: Jujuy|1979
,;Burnsius chloe|11-BOA-13382G04|Peru: Cajamarca|1999
i
7 Burnsius chloe|NVG-16108HO5|Peru: Lima|1975
Burnsius titicaca| NVG-19086B03|Peru: Cusco|1983
Burnsius titicaca| NVG-19086B04|Peru: Cusco|1983
Burnsius notatus valdiviana|NVG-14102F09|Chile: Contulmo|no date
* Burnsius notatus notatus|NVG-16108H06|Chile: Mauie Prov. |1981
, Burnsius philetas| NVG-4213|USA: TX, Tarrant Co|2015
Burnsius philetas|NVG-12174|USA: AZ, Pinal Co.|2019
Fi Burnsius oileus| NVG-8226|USA: FL, Miami-Dade Co.|2017
Burnsius oileus| NVG-19048E08|Costa Rica|2010
po eurnsius orcus| NVG-20054B03|Panama: Panama|2013
Burnsius orcus|11-BOA-13382G12|Guyana|2000
fi Burnsius brenda|11-BOA-13382H04|Ecuador: Guayas| 2004
Burnsius brenda|11-BOA-13382H06|Ecuador: Loja|2002
» {deliopetes americanus americanus|11-BOA-13382G07|Chile|1981
».gHeliopetes americanus americanus|NVG-19064D01 |Chile| 1997
; Heliopetes americanus americanus|NVG-19064D03|Chile|1996
pableliopetes americanus bellatrix| NVG-15032B12|LT|Argentina: Buenos Aires|old
Heliopetes americanus bellatrix| NVG-17108A10|Argentina|1953
‘ Heliopetes purgia|NVG-19091C06|Brazil: Parana|old
Heliopetes purgia|NVG-19091C07|Brazil: Rio Grande do Sul|1957
» jeliopetes domicella margarita| 11-BOA-13385F12|Venezuela: Margarita Is|1989
a ckleliopetes domicella margarita] NVG-18024H12|HT|Venezuela: Margarita Is|1920
Heliopetes domicella domicella| NVG-15032B11|ST|Guyana|old
Heliopetes domicella domicella] NVG-5229|USA: TX, Starr Co.|2015
‘ Heliopetes willi|11-BOA-13385G01|Brazil: Mato Grosso|1990
Heliopetes willi|NVG-18057A03|LT|Brazil: Minas Gerais|old
Heliopetes sublinea| NVG-14114E04|USA: TX, Hidalgo Co.|2014
Heliopetes sublinea| NVG-19013D10|Mexico: San Luis Potosi|1980
Heliopetes ericetorum|NVG-19091A04|USA: CA, Riverside Co.|1992
Heliopetes libra] NVG-19091B06| Brazil: Rio de Janeiro|1996
Heliopetes laviana laviana|NVG-4012|USA: TX, Hidalgo Co.|2015
Heliopetes omrina|NVG-19091A08|Peru: Cusco|2001
Heliopetes orbigera| 11-BOA-13382H10|Guyana|2000
Heliopetes nivella| NVG-19091C05|Venezuela: Guarico|1985
Heliopetes macaira| NVG-5250|USA: TX, Cameron Co.|2015
; Heliopetes petrus|11-BOA-13383A01|Ecuador|2002
a Heliopetes ochroleuca|NVG-19042A01|Argentina|1928
; Heliopetes alana|11-BOA-13383A03|Gyuana|1999
Heliopetes chimbo|NVG-15092D09|Ecuador|1980
Heliopetes leucola|NVG-19091D11|Brazil: Parana|1973
i Heliopetes arsalte| NVG-19091D05|Guyana |1999
Heliopetes marginata| NVG-19091D10|Ecuador: Imbabura|2001
1
0.007 1
Burns communis albescens| NVG-15033H10|LT|Mexico|old
Burnsius communis communis|NVG-7551|USA: TX, Bexar Co.|1977
Burnsius communis communis|NVG-18018E05|USA: AZ, Cochise Co.|1974
| Burnsius communis communis|NVG-18018E04|USA: AZ, Cochise Co.|1974
Burnsius communis communis|NVG-18048A10|USA: AZ, Cochise Co.|1974
r= Burnsius communis communis|NVG-3867|USA: TX, Dallas Co.|2015
oa Burnsius communis communis|NVG-18018E06|USA: AZ, Cochise Co.|1974
| fae Burnsius communis communis|NVG-7549|USA: TX, Bandera Co.|1966
Burnsius communis albescens|NVG-19086E07|Mexico: Coahuila] 1976
Burnsius communis communis|NVG-18048A09|USA: AZ, Cochise Co.|1974
Burnsius communis communis|NVG-7552|USA: TX, Bexar Co.|1977
Burnsius communis albescens (=lycurgus)|NVG-15033H11|LT|"Central America" old
Burnsius communis albescens|NVG-19086E08|Mexico: Veracruz|1908
Burnsius communis albescens|NVG-19086E02|Mexico: Oaxaca|old
Burnsius communis albescens| NVG-19086E05|Mexico: DF|1907
Burnsius communis communis (=occidentalis)|NVG-15095F03|LT|USA:TX, Bexar Co. |old
ee rere Burnsius communis communis|NVG-19086E03|Mexico: Chihuahua|1984
Burnsius communis communis|NVG- 20045D06|USA: UT, San Juan Co.|2020
Burnsius communis albescens|NVG- 19086E04|Mexico: San Luis Potosi|1976
Burnsius communis communis|NVG-3864|USA: TX, Wise Co.|2015
Burnsius communis communis|NVG-4175|USA: TX, Wise Co.|2015
Burnsius communis communis|NVG-20045D05|USA: UT, San Juan Co.|2020
Burnsius communis communis|NVG-18048A08|USA: AZ, Cochise Co.|1974
rare Burnsius albezens| NVG-18018E01|PT|USA: AZ, Cochise Co.|1974
U. Burnsius albezens|NVG-18048A11|PT|USA: AZ, Cochise Co.|1974
0.02 Burnsius albezens|NVG-19086E11|Mexico: Sonora|1978
| as Burnsius albezens|NVG-19086E06|Mexico: Nuevo Leon|1976
Burnsius albezens| NVG-3362|USA: TX, Hidalgo Co.|2015
Burnsius albezens|NVG-19086E01|Mexico: Michoacan|1965
Burnsius albezens|NVG-19086E10|Mexico: Baja California Sur|1974
Burnsius albezens|NVG-3786|USA: TX, Starr Co.|2015
2 Burnsius albezens|NVG-4038|USA: TX, Duval Co.|2015
lhe: Burnsius albezens| NVG-7553|USA: TX, Bexar Co.|1981
0.08 Burnsius albezens| NVG-4377|USA: TX, Dallas Co.|2015
Burnsius albezens| NVG-18018E02|PT|USA: AZ, Cochise Co.|1974
Burnsius albezens|NVG-18048A12|HT|USA: AZ, Cochise Co.|1974
Burnsius albezens|NVG-19086E09|Mexico: Baja California|1973
Burnsius albezens|NVG-7556|USA: TX, Bexar Co.|1982
‘ oa ©Burnsius albezens| NVG-18018E03|PT|USA: AZ, Cochise Co.|1974
Burnsius albezens|NVG-19086E12|Mexico: Sinaloa|old
Burnsius albezens|NVG-18048B01|PT|USA: AZ, Cochise Co.|1974
Burnsius albezens|NVG-7555|USA: TX, Bexar Co.|1982
526 ~©6Burnsius albezens|NVG-4495|USA: TX, Cameron Co.|2015
Burnsius albezens|NVG-7554|USA: TX, Bexar Co.|1981
{voce Burnsius burnsi|NVG-16108G12|PT|Mexico: Guerrero|1984
Burnsius burnsi|NVG-19086B12|PT|Honduras: Cortes|1975
L{o.is Burnsius burnsi] NVG-16108H04|HT|Mexico: Veracruz|2007
Burnsius burnsi]|NVG-19086B10|PT|Mexico: Guerrero|1984
Burnsius burnsi/NVG-18014A04|PT|Costa Rica: Guanacaste Prov.|2015
Burnsius burnsi|NVG-19082H04|Honduras: Emerald Valley|2019
Burnsius burnsi|NVG-19086C05|PT|Guatemala: Izabal|1969
Burnsius burnsi|NVG-19086C01|PT|Costa Rica: San Jose|1980
, Burnsius burnsi|NVG-19086C02|PT|Panama: Panama Prov. |1978
Burnsius burnsi| NVG-19086C03|PT|Panama: Chiriqui|1975
cor aoe burnsi| NVG-19086B07|PT|Mexico: Veracruz|1974
0.04
0.34
1
0.02
0.1
0.14
0.24
0-706.
0.9
Burnsius burnsi|NVG-19086C07|PT|Mexico: Veracruz|1974
Burnsius burnsi|NVG-7701|PT|Mexico: Oaxaca|1981
Loos Burnsius burnsi|NVG-19086B08|PT|Mexico: Tamaulipas|1965
Burnsius burnsi|NVG-19086C08|PT|Mexico: Veracruz|1974
Burnsius burnsi]/NVG-19086B09|PT|Mexico: Campeche| 1964
Burnsius burnsi|NVG-19086C06|PT|Belize: Orange Walk District|1975
Burnsius burnsi|NVG-19086B11|PT|El Salvador: San Salvador|1952
Burnsius adepta adepta] NVG-19086C04|Colombia: Tolima|1972
Burnsius adepta adepta| NVG-19086D05|NT|Colombia: Bogota|old
Burnsius adepta adepta| NVG-19086C09|Venezuela: Merida|1988
Burnsius adepta inepta| NVG-15092E10|PT|Colombia: Valle|1987
Burnsius adepta inepta| NVG-16108G08|PT|Ecuador: Pichincha|1992
i 0 ’'Burnsius adepta inepta|NVG-16108HO07|PT|Ecuador: Pichincha|2002
Burnsius adepta inepta| NVG-16108G09|HT|Ecuador: Pichincha] 1990
ma Burnsius orcynus|NVG-16108HO02|PT|Curacao: Hato Field |1943
Burnsius orcynus|NVG-19086D03|HT|Curacao: Hato Field|1943
, Burnsius orcynus|NVG-16108H08|PT|Venezuela: Margarita Island|1988
*“Burnsius orcynus|NVG-19086C10|PT|Venezuela: Margarita Island|1989
Lae Burnsius orcynoides|NVG-19086B05|Peru|old
0.92 >, Burnsius orcynoides|NVG-19086D01|TT|Argentina: Jujuy|1979
oa2 Burnsius orcynoides|NVG-19086C11|Brazil: Rio de Janeiro|1972
Burnsius orcynoides|NVG-19086C12|Brazil: Rio de Janeiro|1995
Burnsius orcynoides|NVG-19086D02|TT|Argentina: Buenos Aires Prov.|1975
Burnsius chloe|11-BOA-13382G04|Peru: Cajamarca|1999
Burnsius chloe|NVG-16108G07|Peru: Coropuna|1911
Burnsius chloe] NVG-16108HO5|Peru: Lima|1975
jaa. Burnsius titicaca| NVG-16108G10|Peru: Cusco|1911
: Burnsius titicaca| NVG-16108G11|Peru: Cusco|1952
Burnsius titicaca| NVG-19086B04|Peru: Cusco|1983
Burnsius titicaca|NVG-19086B03|Peru: Cusco] 1983
0.98
0.3
| 0.42
ese
0.76
Fig. 3. Phylogenetic trees of Burnsius and its relatives constructed from protein-coding regions of the Z chromosome. a.
Representatives of Chirgus, Burnsius, and Heliopetes. The clades of Heliopetes willi stat. rest. and Heliopetes domicella are
shown in magenta and green, respectively. The clade highlighted in yellow is expanded into panel b.,
in which clades of
different taxa are colored in different colors. Names of primary type specimens are shown in red font. Type status
abbreviations are: HT - holotype; LT - lectotype; ST - syntype; PT - paratype; TT - topotype, which is not a true type, but is
used as a symbol to indicate specimens from near type localities.
three years after the description of P. adepta, Snellen published its illustration from Curacao (Snellen
1887), reproduced here as Fig. 2] (it likely to depict a new species described below), and the appearance
of this species generally agrees with P. adepta of Evans, although Evans might have assigned it to his
Pyrgus communis orcynoides (Giacomelli,
1928). Apparently, Snellen arrived at his identification
independently, using Pl6tz's key, and was confused by the vague description of the ventral side.
In his key, Plétz portrayed P. adepta by the following combination of characters (translated and
assembled from relevant sections): "forewing with costal fold; hindtibiae without a tuft of long scales; all
wings with wide white central band, which on hindwing decreases rapidly from the middle to anal
margin; basad of the discal band, forewing with two white spots, one in cell 1 [CuA2-1A+2A], and the
other at the base of cell 2 [CuA,-CuAg], hindwing with one spot, in discal cell; distad of forewing discal
cell several evenly narrow spots, and before the outer margin of all wings a row of small roundish white
spots; underside pale brownish-white, mostly only with pure white discal band on the forewing, the
markings are brownish-gray?green ["gran"], the bases are gray, those of hindwings with a brown dot in
cell 7 [probably viewed by Pl6tz as a union of cells Sc+R)-RS and C-Sc+R |" (Pl6tz 1884). While the
characters of the dorsal side are defined clearly, we found Pl6tz's description of the ventral side to be
vague and difficult to interpret. Evans' P. adepta keys to G.1.10.(c), largely agreeing with Pl6étz's
description, except for the lack of costal fold (Evans 1953). Above, we argued that Plétz and Evans
referred to the same species. If P. adepta syntype(s) were mislabeled (1.e., were not from Bogota), then its
males with costal fold and without the tibial tuft could have been B. communis. However, without locating
syntypes or having strong evidence that they were mislabeled, it would be difficult to argue along these
lines, especially in the interest of nomenclatural stability.
To learn more about this species, we searched for syntypes of P. adepta in the collections that are
known to house Plétz's types: MFNB, ZSMC, and EMAU. We failed to find any candidate specimens.
Although in MFNB there are specimens identified as P. adepta from Colombia: Bogota (conspecific with
Evans' P. adepta), none was clearly identifiable as a syntype. Therefore, we believe that the syntypes of
P. adepta are no longer extant. There is an exceptional need to designate a neotype of P. adepta, because
of possible errors in Pl6tz's description and its general vagueness (costal fold, tibial tuft, ventral side), and
the presence of new species from this group (see below), creating a potential for instability of
nomenclature until the name is objectively defined, best in agreement with its current widespread
application. To stabilize nomenclature, N.V.G. hereby designates a specimen from Bogota shown in Fig.
21, a male, as the neotype of Pyrgus (Pyrgus) adepta Plétz, 1884. This neotype is consistent with both the
present usage of the name and the original description of this taxon (including its locality), except that it
lacks costal 10" (see above). The COI barcode sequence of the neotype (GenBank ON255699) is:
AACTTTATATTTTATTTTTGGAATT TGAGCAGGAATAGTAGGTACTTCTTTAAGTT TATTAATTCGAACTGAATTAGGAAATCCCGGCTCATTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCACATGCTTTCATTATAATTTTTTTCATAGTTATACCTATTATAAT TGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCTCGTA
TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACAT TACTTATTT CAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGAT GAACAGTTTATCCCCCATTATCAGCTAATATTGC
TCACCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCCTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA
TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT
CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
This neotype of P. adepta satisfies all requirements set forth by ICZN Article 75.3, namely:
75.3.1. It is designated to clarify the taxonomic identity of this taxon in the light of new species
discovered by genomic sequencing; 75.3.2. The characters for the taxon have been given in its original
description by Plétz (1884), subsequent work by Evans (Evans 1953) and are re-stated above; 75.3.3. The
neotype specimen bears the following four labels || Bogota || EASmyth | Collection | 1947 || DNA sample
ID: | NVG-19086D05 | c/o Nick V. Grishin || USNMENT | {QR Code} | 01588760 ||. 75.3.4. Our
unsuccessful search for the syntypes is described above, leading us to conclude that they are lost; 75.3.5.
As detailed above, the neotype is consistent with the original description of this taxon (except that it lacks
costal fold, see discussion above), other information, such as subsequent published illustrations, and the
current usage of this name; 75.3.6. The neotype is from Colombia: Bogota and the type locality given for
P. adepta in the original description is "Bogota"; 75.3.7. The neotype is in the collection of the National
Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM).
Neotype designation for Pyrgus (Scelothrix [sic|) dion Ploétz, 1884 confirming it as a
junior subjective synonym of Burnsius adepta (Pl6tz, 1884)
Pyrgus (Scelothrix [sic|) dion Plétz, 1884 was described from female(s) of unknown provenance (P16tz
1884) and, not being clearly attributed to the New World, was not included in the analysis of Godman
(1907). Except being listed in several catalogs, this name was not discussed in publications, and Evans
(1953) synonymized it with the species currently known as Burnsius adepta (Pl6tz, 1884). To learn more
about P. dion, we turned to its original description, assembled from the Pl6tz's key and translated here:
"Hindtibiae with a tuft of long scales. Abdomen beneath with a pit, and two almost straight, narrow,
somewhat flat appendages arise from the base of abdomen ["hair pencil" and thoracic pouch define the
subgenus Scelothrix |sic]]. Forewing with costal fold. Hindwing with a white, sometimes overscaled with
brown or gray [this variation may refer to different species included in the corresponding part of the key,
not necessarily to P. dion], central band that starts at the costal margin but does not reach anal margin: the
band increases in width from the costal margin to discal cell and then tapers rapidly to cell 1 [CuA>-
11
1A+2A]. Dorsal side black-gray with large, white, sharply defined, interconnected typical [for this genus]
spots; in cell 1 [CuA2-1A+2A] the typical [i.e., discal band] spot is connected along the vein 1 [1A+2A]
with the spot by the base. The minor spots are small, at the base of hindwing there is a gray one.
Ventrally, broad margin of hindwing and bases of all [wings] are green, spotted with white" (Plétz 1884).
Because P. dion was named from specimen(s) Pl6tz assumed to be female(s), statements in the
description referring to secondary sexual characters (costal fold and tibial tuft) were Pl6tz's hypotheses
about how males of this species might appear rather than actual observations, and therefore were not
considered in our analysis. Pl6tz's description gives an impression of P. dion as a specimen with larger
spots in the discal band (compared to most other "Pyrgus") contrastingly smaller submarginal spots, and
hindwing band shaped more like an oval central spot. Out of all characters listed for P. dion, merging of
the discal and the basal white spots in cell CuA,-1A+2A into one along forewing vein 1A+2A is not
found in many specimens, and can be used to constrain the set of possibilities in search for P. dion.
Inspecting all checkered-patterned Hesperiidae worldwide that can possibly be attributable to the genus
Pyrgus a century ago, we only found this merging present in several New World species, such as those in
the Burnsius communis (Grote, 1872) group and the Burnsius oileus (Linnaeus, 1767) group. Specimens
from the latter species group have smaller discal band spots on both wings and comparatively larger
"minor" spots along wings' margins, thus contradicting the original description of P. dion, and therefore
are less likely to be that taxon.
In the species of B. communis group other than B. adepta, the merging of spots in cell CuA>-
1A+2A is accompanied by even stronger merging of the two spots in cell CuA;-CuAz (not mentioned in
the description of P. dion), but most of the paler-patterned females of B. communis and B. albescens
develop a pair of pale streaks in between the two spots in the middle of cell CuA2-1A+2A, rather than
these spots being merged along vein 1A+2A. Therefore, we concur with Evans that P. dion is most likely
a junior subjective synonym of B. adepta, the placement not questioned since it was proposed (Evans
1953). Burnsius adepta was described by Pl6tz in the same work from specimen(s) from Colombia:
Bogota, therefore he had specimens of this species from this locality. The specimen we found that agrees
best with the original description of P. dion was a B. adepta variation that appears different enough from
other specimens to suspect it was a distinct species, also from Bogota (Fig. 2h), which gave additional
confidence in our association of the name P. dion with specimens.
One notable discrepancy of B. adepta with the original description of P. dion is the green color of
ventral hindwing margin and base of the latter, as described by Pl6étz. First, there are no Hesperiidae
worldwide with a truly green pattern like this. Second, Plétz used the word "green" [griin] to describe the
color of hindwing bands of several other species in the same work (e.g., Heliopetes domicella (Erichson,
[1849])), none of which are really green, but are more similar in color to B. adepta. Third, Godman
mentioned for a number of Pl6tz drawings that they appeared greener than the species they represent, e.g.,
that P. aconita was "very like Heliopetes domicella Er., but greener" (Godman 1907). Therefore, we
hypothesize that Plé6tz either worked under lighting conditions that did not allow accurate color perception
and reproduction, or was at least partly color-blind. Therefore, we do not put much weight in Pl6tz's
assessment of the ventral bands color as "green".
We searched for syntypes of P. dion in the collections that are known to house Pl6étz's types:
MENB, ZSMC, and EMAU. We failed to find any candidate specimens and believe that the syntypes of
P. dion are no longer extant. There is an exceptional need to designate a neotype of P. dion, due to the
presence of several new species in this complex and unknown type locality of this taxon creating a
potential for instability of nomenclature in future. To stabilize nomenclature, N.V.G. hereby designates a
Specimen shown in Fig. 2h as the neotype of Pyrgus (Scelothrix |sic|) dion Pl6tz, 1884. This neotype
confirms Evans' hypothesis that P. dion is a junior subjective synonym of Burnsius adepta (Plotz, 1884).
The neotype is consistent with both the present usage of the name and the original description of this
taxon (except that the ventral dark bands are not "green", but at best greenish-olive-brown).
This neotype of P. dion satisfies all requirements set forth by ICZN Article 75.3, namely: 75.3.1.
It is designated to clarify the taxonomic identity of this taxon in the light of new species discovered by
genomic sequencing; 75.3.2. The characters for the taxon have been given in its original description by
12
Pl6tz (1884) and are re-stated above as a translation of the original description; 75.3.3. The neotype
specimen is labeled from "Bogota" and can be recognized by the merged discal and basal spots in
forewing cell CuA2-1A+2A, but separated in cell CuA ;-CuAg2, head tilted to the right, right antenna
pointing anteriad and left antenna more aligned with the forewing costal margin. 75.3.4. Our unsuccessful
search for the syntypes is described above, leading us to conclude that they are lost; 75.3.5. As detailed
above, the neotype agrees with the original description of this taxon (except that the ventral dark bands
are not "green") and the current usage of this name; 75.3.6. The neotype is from Colombia: Bogota and
the type locality for P. dion was listed as unknown ("?") in the original description, but Pl6tz worked with
Specimens on this species (as its senior synonym) from "Bogota"; 75.3.7. The neotype is in the collection
of the Natural History Museum, London, UK (BMNH).
Pyrgus (Syrichthus [sic|) varus Ploétz, 1884 is a junior subjective synonym
of Burnsius orcus (Stoll, 1780)
Out of all 11 names proposed by Plétz (1884) and discussed here, only one was included in the
compilation of Godman's copies of the original Pl6tz's drawings. Pyrgus (Syrichthus |sic]|) varus Plotz,
1884 (type locality Mexico) was represented by two illustrations intended to depict a male (no. 900) and a
female (no. 900a) (Fig. 2c, d). Attribution of this species to the subgenus Syrichthus [sic] by Plétz implied
the absence of costal fold and tibial tuft in males that Pl6tz assumed were among his P. varus syntypes,
illustrating one. For unclear reasons, Evans synonymized P. varus with Burnsius communis (Grote, 1872)
(costal fold present) and not with Burnsius adepta (Pl6tz, 1884) (costal fold absent). Moreover, Evans
mentioned these unpublished drawings of P. varus. Our inspection of the drawings reveals that they
depict neither B. communis, nor B. adepta, but Burnsius orcus (Stoll, 1780).
This identification is based on four characters. First, there is a well-developed white spot on the
forewing between the discal cell spot and the streaks in cells distad discal cell. Second, the row of
marginal forewing spots is complete, with a spot in cell Ry-Rs. These two spots are depicted in both
drawings (Fig. 2c, d). These spots are present only in the B. oileus group species and are (nearly always)
absent (or very small) in the B. communis group species. Third, ventral hindwing lacks a brown spot at
costa in the middle, characteristic of B. oileus and lacking in B. orcus, the only character given for by
Evans (1953) to separate the former from the latter. Both drawings show no trace of the costal spots.
Fourth, ventral hindwing pattern on the drawing is well-developed and therefore excludes Burnsius
philetas (W. H. Edwards, 1881). These four characters imply that P. varus is a junior subjective synonym
of B. orcus. Mexico as the locality for P. varus is consistent with this identification: it is the northern limit
of B. orcus distribution.
Using this opportunity, we reproduce parts of the original drawings of Papilio orcus syntypes,
from Suriname, by G. W. Lambertz in the Library of the Natural History Museum, London, that served as
models for engravings published in Cramer volumes (1775—1780) (with Stoll) (Gilbert 2000) (Fig. 2e—g).
The Lambertz drawings, which are typically more precise than stylized engravings, reveal additional
details about the syntypes. The P. orcus drawings are similar to Pl6tz's P. varus (Fig. 2c, d), and the
specimen illustrated in ventral view (Fig. 2f) lacks the brown spot on hindwing mid-costa. We also note
that sexes of specimens shown in dorsal view were switched, both in the original Lambertz drawings and
engravings published in Stoll (1780): the specimen labeled as a male (Fig. 2g) is a female (no gray
overscaling, evenly convex forewing costa, smaller white spots), and the specimen labeled as a female
(Fig. 2e) is a male instead (gray overscaling, slightly indented costa in the middle at the end of costal
fold). The ventral image is labeled as a female (Fig. 2f), which may be correct due to an evenly convex
forewing costal margin similar to Fig. 2g, and different from straightened in the middle costa of a male
(Fig. 2e) reflecting its costal fold.
The only obstacle with the identification of P. varus as B. orcus is that according to Plétz, males
of P. varus lack costal fold and tibial tuft, but B. orcus has both. However, the specimen on the drawing
that depicts a male looks more similar to B. orcus female, because males have extensive gray overscaling
13
on both wings, at least at the bases, and no such overscaling is visible on the drawing. If Pl6étz mistook
female for a male, then he would find neither the fold, nor the tuft, and place this species in the subgenus
Syrichthus [sic], as he did.
Curious about this reasoning, we searched for syntypes of P. varus in the collections that are
known to house Plétz's types. We found two specimens in MFNB, both females, that match Godman's
copies of Pl6tz's drawings rather well (Fig. 2a, b). Both specimens are from the Weymer collection
according to their labels that refer to Pl6tz's taf[el] 900, labeled "varus", and the smaller specimen
(marked as a male in old notation: 6 ) bears a large label with locality "Mexico". The larger specimen
exhibits fusion of discal and basal white spots in forewing cells CuAz-1A+2A and CuA;-CuAg, exactly as
the drawing 900a shows. This fusion is not that commonly observed, and additionally supports the
hypothesis that this (or similar in appearance) specimen was used as a model of drawings no. 900a. The
name "corus" on the labels of these specimens refers to an unpublished initial version of the name for this
Species conceived by Plotz.
The shapes of spots agree well between the specimens and the drawings, except that the white
markings are broader in the drawings. We suspect that because these specimens are small and were drawn
life-size, it was difficult to accurately outline the spots, therefore a more schematic image resulted, where
dark lines were drawn to separated spots, rather than each spot being drawn individually. Therefore, the
two specimens we found are syntypes of P. varus (the red '"Typus" labels and specimen number labels
with barcodes were added to them after our discovery, Fig. 2a, b), and they are identifiable as B. orcus
confirming our hypothesis based on the drawings that Pyrgus (Syrichthus |sic|) varus Pl6tz, 1884 is a
junior subjective synonym of Burnsius orcus (Stoll, 1780).
Neotype designation for Pyrgus (Scelothrix |sic|) adjutrix Plétz, 1884
(Herrich-Schaffer in litt.) confirming it as a Junior subjective synonym of
Burnstus oileus (Linnaeus, 1767)
Pyrgus (Scelothrix [sic|) adjutrix Plotz, 1884 (type locality Mexico) was named from at least 2
Specimens, one male and one female. By attributing this species to the subgenus Scelothrix [sic], Plotz
implied the presence of a tibial tuft (and thoracic pouch), and he placed it in the key with species having a
costal fold. Provided that males were mentioned in the description, it is reasonable to assume that Plotz
observed both costal fold and thoracic pouch with tibial tuft (and that's how they were identified as
males), otherwise he would not have assigned this species to Scelothrix [sic]. He could not have mistook
females for males in this case, because females lack secondary sexual characters, and such species would
have been placed in the subgenus Syrichthus [sic], as Plotz did with P. varus. It is conceivable that the
males lacked hindlegs making it impossible for Pl6étz to check the presence of the tibial tuft, but Plotz
explicitly mentioned the pouch that should have been present in these specimens even in the absence of
hindlegs. Therefore, unless some mistakes were made, P. adjutrix males should have had both the fold
and the tuft. The only widely distributed Mexican species that generally agrees with the description of P.
adjutrix and possesses both the fold and the tuft is Burnsius oileus (Linnaeus, 1767). This is likely the
reason why Evans (1953) synonymized P. adjutrix with B. oileus. Moreover, Plétz placed P. adjutrix in
the key following his Papilio syrichtus Fabricius, 1775, with which he synonymized Papilio orcus Stoll,
1780 among others, and listed specimens he inspected from South America. Therefore his concept of P.
syrichtus was most likely based on specimens of Burnsius orcus (Stoll, 1780). Thus, if P. adjutrix is
indeed synonymous with B. oileus, it seems logical that it was placed next after B. orcus in Plotz's
identification key.
The original description of P. adjutrix, assembled and combined from segments of Pl6tz's key, can
be translated as: "Hindtibiae with a tuft of long scales. Abdomen beneath with a pit, and two almost
straight, narrow, somewhat flat appendages arise from the base of abdomen ["hair pencil" and thoracic
pouch define the subgenus Scelothrix [sic]|. Forewing with costal fold. The white central band of dorsal
hindwing begins at the costal margin and does not reach anal margin, but extends in the @ until in cell 1
14
[CuA2-1A+2A], in the 9 until in cell 2 [CuA,-CuAo], is fairly broad and sometimes densely overscaled
with brown. Dorsal side gray or brown; Forewing with the typical [for the genus Pyrgus] spots,
sometimes predominantly white, the spot in the discal cell is almost square and continues to the costal
margin, outwardly in cells 4 [M2-Ms3] to 6 [Rs-Mj;] there are several white streaks, the typical spots in cells
1 [CuA2-1A+2A] and 2 [CuA;-CuAg2] are fairly large, basewards in cell 1 [CuA2-1A+2A] there is
sometimes missing [spot], at the base of cell 2 [CuA,-CuAg] there is a consistently-present white mark, in
front of the outer margin there is not always a row of pale spots, but at the outer margin mostly fine
points. Ventral hindwings white or yellowish with 3 broken, irregular bands composed of interconnected,
square, green, black-edged spots, a black point near the base at the costal margin, several cap-shaped
green spots at the outer margin and white or pale gray anal margin. [Forewing length] 13-14 mm.
Mexico" (Pl6tz 1884).
Pl6tz's description mostly agrees with B. oileus, in particular, dense brown overscaling of the
white hindwing discal band is characteristic of some B. oileus females, and "predominantly white" might
have referred to dense pale overscaling present in B. oi/eus males, some of which may also have large
white spots. The same refers to the description of the dorsal side as "gray" (likely for males) "or brown"
(females), to which B. oileus is a good fit. The three broken and irregular bands on ventral hindwing may
apply to the three brown spots at the costal margin, from which three band-like arrangements of spots can
be traced towards the anal margin, developed in most specimens of B. oileus. The brown spot mid-costa is
absent in B. orcus, which was the only character to distinguish between B. orcus and B. oileus given by
Evans (1953). Thus, the ventral wing pattern of B. orcus is less likely to be described as having three
bands, and therefore P. adjutrix is not B. orcus. In addition to these three costal spots that can be viewed
as beginnings of the bands, B. oileus also possesses the fourth costal spot at the very base of hindwing, as
mentioned in the description.
The only obvious contradiction is that the color of ventral hindwing bands and spots is not green
("griinen") in B. oileus. See discussion of "green" used by Pl6tz (1884) in the section dedicated to Pyrgus
dion above. Apparently, Pl6tz used the term "green" to describe the color of ventral hindwing bands for a
number of Pyrgus species in which these bands can at best be called olive-brown. Other possible
problems with the fit of B. oileus to the description of P. adjutrix is not about what the description
contains, but about what is missing from it. For instance, the description does not explicitly mention
extensive gray overscaling in males, described by Pl6tz for P. syrichtus as "wing bases are hairy bluish-
white". Then, there is no mention of the forewing white spot between the discal cell spot and streaks that
for P. varus Plétz referred to as "there is also a spot at the end of the discal cell spot" (Pl6tz 1884).
Finally, the forewing length of 13-14 mm may be on a smaller size of the spectrum for B. oileus. To study
these possible contradictions, we analyzed other available sources.
The description of P. adjutrix refers to multiple specimens, detailing their variation (from nearly
white to densely overscaled with brown). Although Godman didn't organize a copy of P. adjutrix
drawing, he mentioned that there were more than one, and these drawings "were taken from Mexican
Specimens" in agreement with the original description (Godman 1907). Godman suggested that these
drawings of P. adjutrix depicted "?=Hesperia montivaga", the same hypothesis as for P. albescens and P.
varus. Godman's "H. montivaga" refers to Burnsius communis/albescens, as he treated these species in
Biologia Centrali-Americana (Godman and Salvin 1899). Therefore, the drawings of the following three
Pl6tz's taxa were similar to each other (they were like Godman's H. montivaga): P. albescens, P. varus
and P. adjutrix. As shown above, P. varus is a junior subjective synonym of B. orcus, thus P. adjutrix
could have been its close relative B. oileus. However, inclusion of P. albescens (and P. communis, by
mentioning of "H. montivaga") in this group of similar-looking taxa deserves additional consideration.
The major disagreement between the species of the B. communis group and the description of P.
adjutrix is in the lack of tibial tuft and thoracic pouch in the former. Only if Pl6tz has made a mistake in
his assessment of the tuft/pouch, it is possible that males of the B. communis group species were among P.
adjutrix syntypes. It is also possible that the type series included both species, i.e., some males had the
tuft/pouch and were B. oileus, while others (which Plétz didn't check for the presence of the tuft/pouch)
were from the B. communis group. It is also possible that some females in the type series of P. adjutrix
15
were not B. oileus but species (may be several) from the B. communis group. However, in his description
of P. adjutrix, Pl6tz mentioned brown overscaling of the discal hindwing band, which is more typical for
B. oileus females than for the B. communis group females. For all these reasons, overall, the description
and other information we gathered is more consistent with P. adjutrix being B. oileus (in agreement with
Evans (1953) and the current synonymy), largely based on the costal fold and tibial tuft stated to be
present in P. adjutrix per original description (P16tz 1884).
To further learn about P. adjutrix, we searched for its syntypes in the collections that are known to
house Pl6tz's types: MFNB, ZSMC, and EMAU. We failed to find them, and believe that the syntypes of
P. adjutrix were lost. There is an exceptional need to designate a neotype of P. adjutrix due to the generic
nature of the original description that does not unambiguously point to a single species, a possibility of
mistakes in the description (e.g., about the presence of tibial tuft), a possibility of a polytypic type series,
and the presence of new cryptic species requiring objective definition of this name. To stabilize
nomenclature, N.V.G. hereby designates a specimen shown in Fig. 2k, female, as the neotype of Pyrgus
(Scelothrix |sic|) adjutrix Pl6tz, 1884. This neotype is consistent with both the present synonymy of the
name as being conspecific with B. oileus, and the original description of this taxon (except that ventral
hindwing bands and spots are not green).
This neotype of P. adjutrix satisfies all requirements set forth by ICZN Article 75.3, namely:
75.3.1. It is designated to clarify the taxonomic identity of this taxon in the light of new species that we
found (see below); 75.3.2. The characters for the taxon have been given in its original description by Plétz
(1884) and are also discussed above; 75.3.3. The neotype specimen bears the following 3 labels: ||
MEXICO: Nuevo Leon | ca. 5 mi. (8 km) | SSW Cola de Cabillo [sic!] | (horsetail falls) || coll. | 18 Mar 77
| Roy O. Kendall | and C. A. Kendall || HESPERIDAE, | Pyrginae: | Pyrgus oileus | (Linnaeus, 1767) |
det. R. O. Kendall | M. & B. No. 106 ||. 75.3.4. Our unsuccessful search for the syntypes is described
above, leading us to conclude that they are lost; 75.3.5. As detailed above, the neotype is mostly
consistent with the original description of this taxon (compare Fig. 2k with the description translated
above, but the color of spots in hindwing ventral bands is not green) and the current synonymy of this
name; 75.3.6. The neotype is from Mexico: Nuevo Leon and the type locality given for P. adjutrix in the
original description is "Mexico"; 75.3.7. The neotype is in the Texas A&M University Insect Collection,
College Station, TX, USA (TAMU). As a result of this neotype designation, Pyrgus (Scelothrix |sic])
adjutrix Plé6tz, 1884 remains a junior subjective synonym of Burnsius oileus (Linnaeus, 1767).
Burnsius communis albescens (Pl6tz, 1884), revised status
A single syntype of Pyrgus (Pyrgus) albescens Pl6tz, 1884, in the MFNB collection and labeled from
"Mexico" (Fig. 1c), agrees well with the original description (Plétz 1884). Most notably, it is one of the
smaller specimens, with the forewing length of 12 mm, at least by | mm smaller than any of the other 10
species of Pyrgus described by Plétz and analyzed here. Its general appearance is whiter than that of most
other relatives, consistent with the name chosen by Pl6tz. In various details of wing pattern, this particular
specimen is a nearly perfect fit to the original description (Pl6tz 1884).
For instance, Pl6tz starts with the following species-specific statement in his key: "The white band
on the upper side of the hindwings is also quite wide towards the anal margin, the basal area is unspotted"
(Plétz 1884). Indeed, compared to other specimens, some illustrated here (Fig. Id, e), where the hindwing
band narrows to nearly disconnected small spots and dots, in this specimen, the last spot of the band (in
cell CuAz-1A+2A) near the anal margin is almost square, and only slightly narrower than a spot in the cell
M3-CuA, (Fig. Ic). The entire dorsal hindwing area basad of discal band is unspotted in the syntype (paler
in the middle) fitting the description, and can be contrasted with other specimens having a defined pale
spot (Fig. 1d). The next character given by Pl6tz is that on "ventral side [of hindwing] at the base, in the
discal cell and in cell 7 [Sc+R,-RS], there is a cube-shaped, gray-nucleated spot, also the bands are mostly
filled with gray", exactly as in the syntype, except that the color is more of a pale-brown hue than simply
gray. Such color discrepancies are present throughout Pl6tz's works and indicate either suboptimal
16
lighting conditions, color reproduction problems on his drawings (if descriptions were written from them),
or color perception differences. The last species-specific character in Pl6tz's key is "the inner margin is
gray [i.e., not white]" on ventral hindwing. The syntype has the entire area from at least vein 1A+2A to
anal margin grayish-brown, different from paler anal margin area in other specimens (Fig. Id, e).
Among characters that are shared with other species included in Plétz's key, and therefore not
necessarily exactly applicable to this specimen or to P. albescens, several are nevertheless worth
mentioning: "The bands on the ventral hindwing are composed of cube-shaped or crescent-shaped spots
bordered with brown: the central spot of the first [discal] band is very narrow in front [anterior], broad
behind; the outer [submarginal] band encloses a white spot in cell 6 [RS-M;]; its spot in cell 4x5 [M2-M3
and M,-Mp] forms a sharp angle inward. At the edge in cells Ic [CuA2-1A+2A], 2 [CuA;-CuA,]| and 3
[M3-CuA,] there are green lunules." All these characters are matched perfectly in the syntype, particularly
the sharp, beak-like shape of the inner edge of the submarginal dark band along vein Mbp (in cell "4«5").
The combination of the small size (12 mm, exactly as given in the description), wing patterns
closely matching the original description, separate locality label "Mexico" (not only on the identification
label, in which case it may simply indicate type locality, not the locality of this specimen capture),
identification label "a/bescens" mentioning drawing no. 889 (number not given in the original description,
and possibly only available on the original drawing at the time this label was written, but the same
number 889 is given for albescens by Godman (1907)), and the red label "Typus", implying that the
specimen was curated as a type, strongly suggests that this specimen is indeed a syntype of P. albescens.
Curiously, taf. 877 (not stated in the Pl6tz paper) is given on a label with similar handwriting on the
lectotype of bellatrix, and this species is not mentioned in Godman (1907); therefore it is likely to be
taken from the original drawing, giving further evidence that the P. albescens specimen is a syntype.
Furthermore, two other specimens from the Weymer collection, labeled similarly from "Mexico", and
curated in MFNB as types of Thymelicus isidorus Pl6tz, 1884 and Apaustus euphrasia Plotz, 1884, match
their descriptions and agree with (available in this case) Godman's copies of Plétz's drawings for both
species. This finding further increases our confidence in that this specimen is a/bescens syntype, because
it was part of a similarly labeled series probably collected at the same locality (at least in the same
country), and this series included type specimens of other Pl6tz names. All of these names were published
in 1884, many of which were likely based on the Weymer collection specimens.
No other syntypes were found, and it is possible that none existed, because only a single length
measurement (12 mm) was given in the description, not a range (e.g., 12-13 mm) as for a number of other
Species, and no mention of variation observed in other specimens was made (usually following the word
"sometimes"). However, avoiding the assumption of the holotype, we proceed with a lectotype
designation that is needed to objectively define this taxon. N.V.G. hereby designates a syntype illustrated
in Fig. lc, in the Museum fiir Naturkunde, Berlin, Germany (MFNB), bearing the following 11 labels:
|| T'ypus || Mexico || Gabinus Pltz | 130 best. v. Pltz. || Albescens Pl | Plétz taf 889 || 89:74 || Coll. Weymer
|| Albescens PI. i. 1. | Gabinus Pl6tz | olim. il | Mexico || Prap. B. A | 658 || Pyrgus tessellata | det Alberti
| {QR Code} http://coll.mfn-berlin.de/u/ | 80a6ef || DNA sample ID: | NVG-15033H10 | c/o Nick V.
Grishin || that can additionally be recognized by the missing head and several terminal cleaned segments
of the abdomen glued back to the specimen after genitalia dissection, as the lectotype of Pyrgus (Pyrgus)
albescens Oe 1884. The COI barcode sequence of the lectotype (GenBank ON255700) is:
AACTTTATATTTTATTTTTGGAATTT pPecaceir. TAGTAGGTACTTCTTTAAGTTTATTAATT CGAACTGAATTAGGAAAT CCCGGCTCATTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCACATGCTTTCATTATAATTTTTTTTATAGTCATACCTATTATAAT TGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCCCGTA
TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACAT TACTTATTT CAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGAT GAACAGTT TACCCCCCATTATCAGCTAATATTGC
TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA
TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT
CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
The label "89:74" refers to the genus and species numbers in Mabille (1904), which stand for
Hesperia albescens, a species placed in his "species dubiae", simply referencing Plétz. According to two
of its labels, the lectotype was identified by Pl6tz as gabinus: "gabinus best[immt] v[on] Pl[6]tz". We
attempted to understand how the name gabinus made it on the labels of this specimen. The only published
Hesperia gabinus Pl6tz, 1882 (type locality Brazil: Rio de Janeiro), currently a junior subjective synonym
of Sodalia argyrospila (Mabille, 1876), is a different-looking species (per description, illustration and an
17
extant syntype) that cannot possibly agree with the description of P. albescens. Additionally, it is not from
Mexico, suggesting that gabinus on the label refers to an unpublished name. Indeed, on another label,
gabinus is followed by the word "olim", which is Latin for "once", "formerly", "some time ago". This
label implies that previously this specimen was identified as gabinus, but the published name became
albescens. We interpret this label as "albescens, formerly known as gabinus". Furthermore, we found
another specimen, a likely syntype of Nisoniades eusebius Pl6tz, 1884, currently Bolla eusebius, labeled
similarly to the albescens lectotype, and having the second name "parna Ploétz" (and "olim") on its labels,
a name not found in any publications. This N. eusebius specimen agrees with the original description,
including its stated locality and forewing length measurement, and is a likely syntype of this taxon.
Existence of this additional case of a double-named (with an unpublished, likely former manuscript name)
Syntype gives yet another evidence for the authenticity of the albescens lectotype.
Genomic tree places the lectotype of P. albescens within specimens of B. communis (Fig. 3b)
implying that they are conspecific. To verify this unexpected result, we re-extracted DNA from the leg of
the lectotype, prepared genomic libraries, and sequenced them for the second time. This second
experiment was done with extra precautions to minimize cross-contamination, and no other Burnsius
samples were prepared in the same batch with the lectotype. The results confirmed the initial conclusion
that the lectotype of P. albescens is conspecific with B. communis and not with the species Burns (2000)
called P. albescens. In addition to the tree, we assigned the lectotype of P. albescens to species using
DNA characters. First, we "cleaned" the dataset of the lectotype to remove all sequences that did not
match closely (fewer than 3 mismatches allowed) sequences of the species Burns called P. albescens. In
addition to removing various
contamination (e.g., from fungi and
bacteria that were living on the
Specimen) present in century-old
samples, this procedure biases the
result towards Burns's "P. albescens"
by selecting sequences that are
closer to that species. Therefore, if
the lectotype is still assigned to B.
communis despite this bias, the
result is easier to accept. Second,
we selected positions in_ the
lectotype that are covered by more
than one sequencing read, thus
increasing the reliability of such
TOOMANTOr
oon MODI MO = I OMNOMAAOMOON AD
Soares ithe ls 50) ere Becta A ag erty sat msc
ti LAT™WOLOOLOLYY IS IO ROOD POO
DOLE CO NODDOENEOS DOOM TF OO cI onGo OOOO
cor ON
On onan icp
a a nininininininininieme PAM ETT LALALALALALAL OOM
Burnsius communis communis | NVG-3867 | USA: TX, Dallas Co.|2015
Burnsius communis communis |NVG-7551| USA: TX, Bexar Co.|1977
Burnsius communis communis |NVG-7552| USA: TX, Bexar Co.|1977
Burnsius communis communis |NVG-20045D06| USA: UT, San Juan Co.|2020
Burnsius communis communis | NVG-20045D05 | USA: UT, San Juan Co.| 2020
Burnsius communis communis | NVG-18018E06| USA: AZ, Cochise Co.|1974
Burnsius communis communis | NVG-18048A09 | USA: AZ, Cochise Co.|1974
Burnsius communis communis | NVG-18018E05 | USA: AZ, Cochise Co.| 1974
Burnsius communis communis | NVG-18018E04 | USA: AZ, Cochise Co.|1974
Burnsius communis communis | NVG-18048A10| USA: AZ, Cochise Co.| 1974
Burnsius communis communis |NVG-18048A08 | USA: AZ, Cochise Co.|1974
Burnsius communis communis | NVG-19086E03 | Mexico: Chihuahua | 1984
Burnsius communis albescens | NVG-19086E07 | Mexico: Coahuila|1976
Burnsius communis albescens | NVG-19086E02 | Mexico: Oaxaca |old
Burnsius communis albescens | NVG-19086E05 | Mexico: Mexico City| 1907
Burnsius communis albescens |NVG-19086E04 | Mexico: SLP|1976
Burnsius communis albescens |NVG-15033H10|LT|Mexico| old
Burnsius albezens | NVG-18018E01|PT|USA: AZ, Cochise Co.| 1974
Burnsius albezens | NVG-18048A11|PT| USA: AZ, Cochise Co.|1974
Burnsius albezens |NVG-18018E02|PT|USA: AZ, Cochise Co.|1974
Burnsius albezens | NVG-18048A12|HT|USA: AZ, Cochise Co.|1974
Burnsius albezens | NVG-18018E03 |PT|USA: AZ, Cochise Co.|1974
= ‘ Burnsius albezens | NVG-18048B01|PT|USA: AZ, Cochise Co.|1974
base pairs. Third, out of these Burnsius albezens | NVG-19086E11| Mexico: Sonora|1978
positions we selected those that Burnsius albezens | NVG-19086E09 | Mexico: Baja California |1973
°
Burnsius albezens | NVG-19086E10| Mexico: Baja California Sur|1974
Burnsius albezens|NVG-7553| USA: TX, Bexar Co.|1981
discriminate best between the two
species: B. communis and Burns's
"P. albescens". Such a_ position
should have a base pair present (and
not missing due to low coverage
sequencing) in more than 60% of
samples of each species, and the
most frequent base pair in this
position should be different in the
two species and present in more
than 80% of samples of each
species. As a result, we found 38
such discriminating positions (Fig.
4). In the lectotype of P. albescens,
Burnsius albezens | NVG-7555| USA: TX, Bexar Co.|1982
Burnsius albezens|NVG-7554| USA: TX, Bexar Co.|1981
Burnsius albezens | NVG-3362 | USA: TX, Hidalgo Co.|2015
Burnsius albezens | NVG-19086E06 | Mexico: Nuevo Leon|1976
Burnsius albezens | NVG-19086E01 | Mexico: Michoacan|1965
Fig. 4. Assignment of the lectotype of Pyrgus albescens to species by DNA
characters. All 38 positions that are covered in the lectotype (coverage above 1)
and discriminate best between the two species are shown as columns labeled
above as {scaffold number}.{position number in the scaffold} (e.g., 2.331839
means position 331839 in scaffold 2) referring to the genomic assembly of B.
communis specimen NVG-13311 (sequence not shown). The lectotype sequence
(name in red font) is sandwiched between samples of the two species. Color
highlight corresponds to the base type. Standard ambiguity codes (e.g., Y, R, S,
etc.) denote heterozygous positions in the genomic sequences (different base
pairs in mother and father copies). Dashes are used for data missing due to low
coverage of sequencing. The only position that is inconsistent with the
assignment of the P. albescens lectotype to B. communis 1s framed with black.
18
out of these positions, 34 (90%) match the most frequent base pair in B. communis (Fig. 4, above the
lectotype sequence) and mismatch the most frequent base pair in Burns's "P. albescens" (Fig. 4, below the
lectotype sequence), three positions are consistent with B. communis (i.e., base pair in them is present in
at least one sequenced specimen of B. communis), and only one (39.2646192, Fig. 4, base pair framed in
black) is inconsistent, and this base pair (A) is observed only in Burns's "P. albescens" among the
Specimens we sequenced. Therefore, despite biasing the lectotype sequences towards Burns's "P.
albescens", the majority of positions assign the lectotype of P. albescens to B. communis in agreement
with the phylogenetic tree analysis.
Furthermore, Alberti, who 4 Ag tied ey etary fee
dissected the lectotype according to [=== uae
the label (Fig. 1c), identified it as oa
"Pyrgus tessellata", which is an P
unavailable name (junior homonym)
synonymous with B. communis.
Genitalia Prapfarat] Blurchard]
A[lberti] 658 was not located in the
MFNB, and neither were other
Alberti genitalia dissections despite
a dedicated search by the collection
manager. Genomic analysis reveals
that many Mexican populations of B.
communis, where P. albescens is
placed, both by the locality label and
genomic data (Fig. 5a), show some
genetic differentiation from the
Specimens in the United States.
Burnsius communis|USA: central TX
Burnsius communis|northern MX
Burnsius communis|southern MX
———
Burnsius communis albescens (=lycurgus)|15033H11|LT|"Central America"
0.02
C
Burnsius communis|USA: central TX
i) ———————_ Burnsius communis communis (=occidentalis)|15095F03|LT|USA:TX, San Antonio
Burnsius communis|northern MX
Burnsius communis|southern MX
0.02
Fig. 5. Assignment of lectotypes to populations: a. Pyrgus albescens, b.
Pyrgus lycurgus; ¢. Pyrgus occidentalis. TreeMix (Pickrell and Pritchard 2012)
unrooted trees are shown. Three population are defined as: central TX
(specimens 7551 & 7552 Bexar Co., 7549 Bandera Co., see also Fig. 3b),
northern Mexico (19086E03 Chihuahua, 19086E04 San Luis Potosi, 19086E07
Coahuila), and southern Mexico (19086E02 Oaxaca, 19086E08 Veracruz,
19086E05 Mexico City). Each lectotype was analyzed separately to increase
the number of positions used in the analysis, and placed in the context of the
three populations. Terminal branches of lectotypes are colored in red and are
longer than shown due to unique sequence variants in lectotypes compared to
the averaged over three specimens branches leading to each population. The
results are preliminary due to small number of specimens from each
Therefore, instead of synonymizing
P. albescens under B. communis, we
propose to treat it as a southern
subspecies Burnsius communis albescens Pl6tz, 1884, stat. rev.
population, low coverage of sequencing, and too distant reference genome
(Burnsius philetas, the closest available then) used for mapping of reads.
Pyrgus (Syrichthus [sic|) lycurgus Ploétz, 1884 is a junior subjective synonym
of Burnsius communis albescens (Pl6tz, 1884)
A single syntype of Pyrgus (Syrichthus [sic]|) lycurgus Pl6étz, 1884 is curated in MFNB and agrees nearly
perfectly with the original description, including its locality given as "Centr. Amer." on its label and size
(forewing length 15 mm). More specifically, the original description, which is rather detailed and precise,
mentions the following characters that can all be found in the syntype shown in Fig. Id (translated here):
"Forewing with a white outwardly curved central band, which consists of the square spot in the discal cell,
the large one of cell 2 [CuA,-CuAo] and the almost split one in cell 1 [CuA2-1A+2A]; a small, elongated
spot is at the origin of cell 2 [CuA,-CuAg] and a similar one closer to the base in cell 1 [CuA2-1A+2A].
The other typical [for the genus Pyrgus] spots are smaller. In submarginal area there is an interrupted row
of small spots and at the margin there are dots, doubled in cell 1 [CuA2-1A+2A]. In cells 4 [Mo-M3] and 5
[M,-M>] distad of discal cell, there are two elongated white spots and in cells 6—9 [Rs-Mj—R2-R3] there
are fine lines to the costal margin. Along the radius, a fine white line from the wing base to its center. The
hindwings also have a broad white central band which ends in cell 1 [CuA2-1A+2A] with a point, the
point in cell 2 [CuA;-CuAg] is offset towards the base. In the submarginal area, there is a row of spots,
some of which are cap-shaped [*], and sizable points at the outer margin. The ventral hindwings are
yellowish-white with two jagged bands of olive-green, brown-rimmed patches; the inner one with a large
central spot and two torn-off small side spots. By the outer margin in cells 1 [CuA2-1A+2A], 2 [CuA,-
19
CuAgz], 3 [M3-CuA;] and 6 [RS-Mj)] there are cap-shaped spots and black dots at the margin" (Pl6tz 1884).
To stabilize nomenclature, N.V.G. hereby designates a female syntype in MFNB shown in Fig. Id
that bears the following 8 labels: || Typus || Centr. Amer || 89:76 || lycurgus Pltz | 129 best. v. Pltz || Coll.
Weymer || Lycurgus Pltz | Amer, centr. 2 || {QR Code} http://coll.mfn-berlin.de/u/ | 80a6f0 || DNA sample
ID: | NVG-15033HI11 | c/o Nick V. Grishin || and a card with a genitalia capsule as the lectotype of
Pyrgus (Syrichthus |sic|) lycurgus Plétz, 1884. The COI barcode sequence of the lectotype (GenBank
ON255701) is:
AACTTTATATTTTATTTTTGGAATTT Sa seh TAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAAT CCCGGCTCATTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCACATGCTTTCATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCCCGTA
TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACATTACTTATTTCAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGATGAACAGTTTACCCCCCATTATCAGCTAATATTGC
TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA
TT TGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT
CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
The label "89:76" refers to the genus and species numbers in Mabille (1904), which stand for
Hesperia lycurgus, a species placed in his "species dubiae", simply referencing Plétz. Although currently
associated with B. adepta, probably due to the lack of costal fold per original description (Pl6étz 1884) and
its locality given as Central America, which by default may not always include Mexico, genomic
sequencing reveals that the lectotype is placed among B. communis specimens from southern Mexico
(Figs. 3b, 5b), either narrowing down its provenance, or suggesting that B. communis may have been
found south of Mexico (unless the lectotype was mislabeled). Therefore, instead of synonymizing P.
lycurgus under B. adepta, we propose that Pyrgus (Syrichthus [sic|) lycurgus Pl6tz, 1884 is a junior
subjective synonym of Burnsius communis albescens (Pl6tz, 1884). The lectotype is a female, but it might
have been misidentified as a male by Pl6tz, or associated with males incorrectly, because B. communis
possesses a costal fold and P. /ycurgus was placed by Pl6étz in the subgenus Syrichthus [sic] characterized
by the lack of costal fold. Alternatively, Plétz might have been correct in identifying this specimen as a
female, but may have had no males to pair with it, and hypothesized that this species lacked costal fold.
Neotype designation for Pyrgus (Pyrgus) insolatrix Plotz, 1884
(Herrich-Schaffer in litt.) confirming it as a junior subjective synonym
of Burnsius communis albescens (Pl6tz, 1884)
Pyrgus (Pyrgus) insolatrix Plotz, 1884 (type locality in Mexico) did not enjoy a dedicated description as
detailed as the one provided for P. lycurgus Plotz, 1884, and most of its characters were listed as shared
with two other species: P. albescens Plétz, 1884 (type locality in Mexico) and Hesperia ricara W. H.
Edwards, 1865 (Plé6tz 1884). Description of the latter was based on at least 2 specimens from Colorado,
which judging from the characters given ("ventral hindwing at the base greenish-gray with two brown
points at the costal margin") and locality were probably misidentified Burnsius communis. Moreover, as
he stated on page 18 (1884), Plétz considered the following additional four taxa to be of a similar habitus
as the abovementioned three: P. /ycurgus Plétz, 1884, Syrichtus petreius W. H. Edwards, 1870 (probably
misidentified B. communis from Nevada), Syrichtus [sic] communis Grote, 1872, and P. adjutrix Pl6tz,
1884. Furthermore, inspecting Pl6tz's original drawings, Godman suggested (1907) that P. insolatrix and
P. lycurgus might have been "?=Hesperia notata [sic]". Pyrgus insolatrix and P. lycurgus were the only
two of Pl6étz's Pyrgus species Godman identified as "notata" implying that the two drawings were rather
similar to each other. This similarity is probably in being darker and having smaller white spots than other
species, which was Godman's concept of "notata" as it was illustrated in Biologia Centrali-Americana
(Godman and Salvin 1899), a misidentification of a species currently referred to as B. adepta.
Indeed, Pl6tz's descriptions of P. insolatrix and P. lycurgus are rather similar, for instance, in both
species the white band on hindwing is much narrowed toward anal margin, versus being rather wide in P.
albescens, a species paired with P. insolatrix + H. ricara (misidentified B. communis) in the key (P16tz
1884). Both P. insolatrix and P. lycurgus have bands on ventral hindwing composed of dark cube-shaped
or crescent-shaped spots bordered with brown. According to Pl6tz's key, apart from semantic difference in
words used to describe them (e.g., "cap-shaped spots" vs. "lunules") the only discernible difference
20
between the two species is in the presence/absence of costal fold: present in P. insolatrix (as in B.
communis), but absent in P. lycurgus (as in B. adepta). Due to this difference in costal fold, Evans (1953)
synonymized P. insolatrix with B. communis and P. lycurgus with B. adepta. However, our genomic
analysis of P. /ycurgus lectotype, which is a female, and if it was the only specimen Pl6tz inspected, did
not offer evidence about the costal fold presence, implies that it is B. communis, not B. adepta (Fig. 3b),
further strengthening the tie between the two species named by Pl6otz.
Specifically for P. insolatrix, Plétz mentions that "ventral hindwing at the base with a green or
gray angular cross-bar ["Querstrich"| and its anal margin is white [gray in P. albescens|" (Pl6tz 1884).
Although no "cross-bar" or color of anal margin was mentioned in the description of P. lycurgus, its
lectotype has such a bar at the base of ventral hindwing discal cell, and its ventral hindwing by the anal
margin is relatively paler (not gray), agreeing with the description of P. insolatrix.
In summary, both Plétz (who described them) and Godman (who inspected Pl6tz's unpublished
original drawings) thought that P. insolatrix and P. lycurgus are similar, their original descriptions are
similar, they are both from the southern parts of North American continent: Mexico or "Central America"
(which according to genomic analysis of P. /ycurgus lectotype can be Mexico), and their forewing lengths
are given as 15 mm for both. Evans synonymized P. insolatrix with B. communis, and genomic analysis
of P. lycurgus lectotype reveals that it is B. communis. Therefore, we hypothesize that P. insolatrix is a B.
communis-looking species.
Keeping this comparative analysis in mind, we searched for syntypes of P. insolatrix in the
collections that are known to house Pl6tz's types: MFNB, ZSMC, and EMAU. We failed to find any
candidate specimens, and believe that the syntypes of P. insolatrix were lost. There is an exceptional need
to designate a neotype of P. insolatrix because of new cryptic species we found and the need to have an
objective definition of this taxon, accompanied by genomic information about its primary type specimen.
To stabilize nomenclature, N.V.G. hereby designates the lectotype of Pyrgus (Syrichthus [sic|) lycurgus
Pl6tz, 1884, female, shown in Fig. Id as the neotype of Pyrgus (Pyrgus) insolatrix Pl6tz, 1884, making
the two names objective synonyms. The two "species" are very similar and are from the same
biogeographical realm, as discussed above. The only marked difference between them we were able to
tease out from the original description was the lack of costal fold in P. lycurgus, which turned out to be
incorrect, provided our lectotype designation. Our neotype is consistent with both the present synonymy
of the name as being conspecific with Burnsius communis (Grote, 1872) and the original description of
this taxon, thus placing it as a junior subjective synonym of Burnsius communis albescens (Plo6tz, 1884).
This neotype of P. insolatrix satisfies all requirements set forth by ICZN Article 75.3, namely:
75.3.1. It is designated to clarify the taxonomic identity of this taxon in the light of possible new species
that we found by genomic sequencing; 75.3.2. The characters for the taxon have been given in its original
description by Plétz (1884) and are also discussed above; 75.3.3. The neotype specimen bears the
following 8 labels: || Typus || Cent. Amer || 89:76 || lycurgus Pltz | 129 best. v. Pltz || Coll. Weymer ||
Lycurgus Pltz | Amer, centr. 2 || {QR Code} http://coll.mfn-berlin.de/u/ | 80a6f0 || DNA sample ID: |
NVG-15033H11 | c/o Nick V. Grishin || and a card with a genitalia capsule. 75.3.4. Our unsuccessful
search for the syntypes is described above, leading us to conclude that they are lost; 75.3.5. As detailed
above, the neotype is consistent with the original description of this taxon, comments by Godman who
examined Pl6étz's original drawing (Godman 1907), and the current synonymy of this name; 75.3.6. The
neotype is from Central America (according to the genomic analysis it may have come from Mexico) and
the type locality given for P. insolatrix in the original description is "Mexico"; 75.3.7. The neotype is in
the collection of the Museum fiir Naturkunde, Berlin, Germany (MFNB).
Pyrgus occidentalis Skinner, 1906 is a junior subjective synonym
of Burnsius communis communis (Grote, 1872)
A lectotype of Pyrgus occidentalis Skinner, 1906 was designated by Skinner and Williams (1923), who
wrote: "We now Select from the type material a male from San Antonio, Texas, as the single type." In the
21
Carnegie Museum of Natural History (CMNH), we found only one specimen labeled as "TYPE No. 7108
/ Pyrgus / occidentalis / Henry Skinner". It is in the type collection, bears a label "SanAntonio / Tex.", and
is the lectotype (Fig. le). Such dark-red "TYPE No." labels are characteristic of Skinner type specimens,
and the presence of this label indicates authenticity of this specimen as the type. All other specimens
attributed to the type series of P. occidentalis we found are labeled as "ALLO-TYPE" (1 female, in the
type collection), and "PARA-TYPE" or "PARATYPE" (18 specimens in the general collection).
Bernard Hermier questioned this lectotype designation by Skinner and Williams because, while
their work referred to a syntype ("We ... select from the type material"), mentioned their selection of "the
single type", and gave a specific locality ("San Antonio, Texas") and sex ("male"), it did not provide
information sufficient to unambiguously distinguish this particular "male from San Antonio" from other
such syntypes, e.g., by some unique feature, such as a specimen photograph, number, or a unique label
that would make the specimen recognizable on the basis of the Skinner and Williams publication alone.
(Hermier pers. comm.). Some paralectotypes (labeled as paratypes in the collection) have the same
locality label as the lectotype, and therefore they could not be distinguished from the specimen selected
by Skinner and Williams as the lectotype without the presence of other labels. To alleviate this problem,
N.V.G. hereby designates the only specimen of the type series with the label that states "TYPE" (and not
"ALLO-TYPE", "PARA-TYPE" or "PARATYPE"), as the lectotype of Pyrgus occidentalis Skinner,
1906. This specimen from the collection of the Carnegie Museum of Natural History, Pittsburgh, PA,
USA (CMNH) is the same specimen chosen as the lectotype by Skinner and Williams (1923), is
illustrated here in Fig. le, and bears the following 2 labels: || SanAntonio | Tex. || TYPE No. 7108 | Pyrgus
| occidentalis | Henry Skinner ||. Whichever of the two lectotype designation is considered valid, the type
locality of P. occidentalis is USA: Texas, Bexar Co., San Antonio. A leg of the lectotype was sampled for
genomic DNA sequencing, and the following label was added to the lectotype "DNA sample ID: | NVG-
15095FO03 | c/o Nick V. Grishin".
Whole genome shotgun sequence analysis of the lectotype (NVG-15095F03) unambiguously
places it among specimens of Burnsius communis communis (Grote, 1872) (Fig. 3b), in agreement with
Skinner's statement (1906) that P. occidentalis (initially proposed as a species), was "not a species, but
only a form or geographical race of" B. communis, and confirming its provenance from Texas (Fig. 5c).
Therefore, in accord with our genomic results and consistently with the opinion of the original author of
the taxon, we propose that Pyrgus occidentalis Skinner, 1906 is a junior subjective synonym of Burnsius
communis communis (Grote, 1872), new placement. The COI barcode sequence of the lectotype
(GenBank one 2 is:
AACTTTATATTTTATTTTTGGAATTT eecia ca uae TAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAAT CCCGGCTCATTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCACATGCTTTCATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCCCGTA
TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACATTACTTATTTCAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGATGAACAGTTTACCCCCCATTATCAGCTAATATTGC
TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA
TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCAT TACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT
CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Accompanying their lectotype designation, Skinner and Williams (1923: Fig. 8) illustrated
genitalia of a specimen they presumed to be Hesperia tessellata race occidentalis (the name they used for
P. occidentalis) from Arizona: Tucson. However, as the genomic tree implies, genitalia of P. occidentalis
lectotype would instead look more similar to Skinner and Williams Fig. 7, showing Hesperia tessellata
(currently B. communis). Indeed, this is the case, see Fig. le here, for the in situ photograph of the left
valva of P. occidentalis lectotype showing a more robust costa and a prominent bipartite terminal prong
directed anterodorsad characteristic of B. communis. Apparently, genitalia in Skinner and Williams Fig. 8
are not of P. occidentalis, but belong to the taxon that Lindsey, Bell, and Williams (1931) and Evans
(1953) called "Pyrgus communis albescens", which Burns (2000), with compelling evidence, treated as a
Species, status further supported by our genomic sequencing and analysis.
As a consequence of the analysis presented above, the species that Burns (2000) called "Pyrgus
albescens" lost all of its names to other taxa: (1) the true Pyrgus (Pyrgus) albescens Pl6tz, 1884 is a
subspecies of B. communis, and (2) P. occidentalis is a synonym of the latter. Moreover, we analyzed all
names associated with Burnsius (see above), and none of these names applies to "Pyrgus albescens" of
Burns. Therefore, a new name is proposed here for this morphologically and genetically distinct species.
22
Burnsius albezens Grishin, new species
http://zoobank. org/86633D04-9E08-4C9D-BC 15-181 A68DBB430
(Figs. 2m, 3 part, 4 part)
Description and diagnosis. Keys to G.1.10.(b). in Evans (1953) and is diagnosed by the shape of male
genitalic valvae as described and illustrated by Burns (2000). In brief, males have costal fold and lack the
tuft of long scales on hind tibiae; genitalia overall smaller than those of B. communis; relative to its
length, valva shorter in dorsoventral dimension; harpe smaller and more rounded, without prominent
dorsal expansions and prongs, but sometimes with 1 or 2 small teeth or bumps. In facies, basically
indistinguishable from B. communis, but averages paler due to larger white spots, and smaller in overall
size (see Burns 2000 figs. 376 and 377). It remains to be determined if females of this species can be
separated from B. communis using methods other than DNA sequencing.
Barcode sequence of the holotype: Sample NVG-18048A12, GenBank ON255703, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCTGGCTCATTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCACATGCTTTCATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCCCGTA
TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACATTACTTATTT CAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGATGAACAGTTTACCCCCCATTATCAGCTAATATTGC
TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA
TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT
CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: 3 (Fig. 2m), deposited in the National Museum of Natural History,
Smithsonian Institution, Washington, DC, USA (USNM), bears five rectangular printed labels: four white
[| ARIZ.: COCHISE CO. | Portal 4800 ft | Chiricahua Mountains | VIH-21-1974 | J. M. & S. N. Burns ],
[ Pyrgus albescens | 4 Ploetz | det. J. M. Burns 1986 ], [ P-755 ], [ DNA sample ID: | NVG-18048A12 |
c/o Nick V. Grishin ], and one red [ HOLOTYPE < | Burnsius | albezens Grishin ]. Paratypes are all
specimens identified as "Pyrgus albescens" by Burns with genitalia illustrated (Burns 2000 figs. 19, 24,
25, 27-29, 31-49, 52-67, 70-74, 77-82, 84, 85, 91, 92, 94, 103, 104, 107, 109-111, 266-374).
Type locality. USA: Arizona, Cochise Co., Chiricahua Mountains, Portal, ca. 4800 ft.
Etymology. The name is constructed to sound similar to albescens—the species epithet that was
incorrectly applied to this taxon since Lindsey, Bell, and Williams (1931)—in order to ease this
nomenclatural change by phonetic conservation of the name. Moreover, the spelling of the name replaces
the two letters "sc" that stand for the two prongs of harpe typical for Burnsius communis albescens, with
the one letter "z" that stands for the harpe that Evans described as "monodent" (actually, just more
rounded and smnailanr in Burnsius albezens sp. n. The name is a participle.
Distribution. This species is widely distributed in the southern United States and Mexico, as detailed and
mapped by Burns (2000 figs. 21, 22, 375).
Burnstus burnsi Grishin, new species
http://zoobank.org/A97F5934-44A C-4D71-BFF9-BC325C393A07
(Figs. 2n, 3 part)
Description and diagnosis. North and Central American populations previously attributed to B. adepta
reveal genetic differentiation from it suggesting a species-level distinction (Fig. 3). This new species lacks
costal fold and keys to G.1.10.(c). in Evans (1953), together with B. adepta, and is distinguished from it
by being paler, in particular around the tornal area of ventral forewing, by larger white spots and broader
bands, and in males by typically heavier pale-gray overscaling at the wing bases, in particular on
hindwing. However, due to significant individual variation, confident identification is currently possible
only by DNA. A combination of the following DNA characters is diagnostic: aly2275.1.2:G183A,
aly383.14.4:C75A, aly383.16.4:T54G, aly173.14.1:C1638T, and aly173.36.3:A51G. Fst/Gmin between
the new species and B. adepta computed on the Z chromosome are 0.22/0.07. The COI barcodes differ
between them by 0.9% (6 bp) and the barcode characters for the new species are T157T(not C), T163C,
C238C(not T), C340C(not T), T367T(not C), and A400A(not C). The barcode of this species is different
from B. adepta and its South American relatives, but is nearly the same as B. communis and B. albezens
23
sp. n. Therefore, in mitochondrial DNA, this new species is like B. communis and B. albezens sp. n., but
in nuclear DNA and phenotypic characters it is more similar to B. adepta. Partly due to this hybrid
composition, this taxon is proposed as a species, but its genetic diversification from B. adepta is modest.
Barcode sequence of the holotype: Sample NVG-16108H04, GenBank ON255704, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTT SN eh ane TAGTAGGTACTTCTTTAAGTTTATTAATT CGAACTGAATTAGGAAAT CCCGGCTCATTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCACATGCTTTCATTATAATTTTTTTTATAGTCATACCTATTATAAT TGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCCCGTA
TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACAT TACTTATTT CAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGAT GAACAGTT TACCCCCCATTATCAGCTAATATTGC
TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA
TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT
CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: <@ (Fig. 2n), deposited in the National Museum of Natural History,
Smithsonian Institution, Washington, DC, USA (USNM), bears four rectangular printed labels: three
white | MEXICO: Veracruz | Huatusco 4500 ft. | 19.17°N, 96.97°W | 8-12 January 2007 | Leg. Sam
Droege |], [| DNA sample ID: | NVG-16108H04 | c/o Nick V. Grishin |], [ USNMENT | {QR Code} |
00894458 ] and one red [ HOLOTYPE < | Burnsius | burnsi Grishin ]. Paratypes: 14 (NVG-19086B09),
Mexico: Campeche, 10 mi S Campeche, 28-Jul-1964, leg. Paul J. Spangler; 14 (NVG-19086B10) & 19
(NVG-16108G12), Mexico: Guerrero, Acapulco, Barra Vieja, reared on Sida sp. 5-Sep-1984, leg. Gillett
& Miranda Segura; 12 (NVG-7701, genitalia NVG170108-32), Mexico, Oaxaca, 14 mi N Tonaltepec,
10-Jul-1981, leg. Schaffner, Bogar & Friedlander; 14 (NVG-19086B08), Mexico, Tamaulipas, Tampico,
Sep-1965, leg. N. L. H. Krauss; 24'3' (NVG-19086C07 & NVG-19086C08, genitalia J. M. Burns 1978 X-
467 & X-473, respectively) Mexico: Veracruz, 5 km SW La Tinaja, 6-Jul-74, leg. J. A. Chemsak & J.
Powell; 14° (NVG-19086B07, genitalia J. M. Burns X-465, 1978), Mexico: Veracruz, Amate, 12-Aug-
1974, leg. J. Chemsak, J. Powell, E. G. Linsley; 12 (NVG-19086C06), Belize: Orange Walk District, San
Antonio Rio Hondo, 9-14-Oct-1975, leg. D. S. Puleston; 14 (NVG-19086C05), Guatemala: Izabal,
Quirigua, elevation 800', 22-Sep-1969, James H. Baker collection; 1d (NVG-19086B11), El Salvador:
San Salvador, 18-Jun-1952, leg. Stan Nicolay; 14 (NVG-19086B12), Honduras: Cortes, San Pedro Sula,
Aug-1975, leg. N. L. H. Krauss; 12 (NVG-18014A04, 15-SRNP-70966), Costa Rica: Guanacaste Prov.,
Area de Conservacion Guanacaste, Sector Pitilla, Medrano, elevation 380 m, GPS 11.0160, —85.3805,
eclosed on 24-May-2015, leg. Dinia Martinez; 14° (NVG-19086C01), Costa Rica: San Jose, Patarra,
9.883, —84.033, 25-Jun-1980, leg. Gordon B. Small; 14 (NVG-19086C03), Panama: Chiriqui, Cerro La
Galera, 8-Aug-1975, leg. Gordon B. Small; and 14’ (NVG-19086C02), Panama: Panama Prov., Distrito
de El Llano, Cordillera de San Blas, N of El Llano, elevation ca. 330 m, 10-May-1978, leg. Gordon B.
Small. All paratypes are in USNM, except NVG-7701, which is in TAMU.
Type locality. Mexico: Veracruz, Huatusco, elevation ca. 4500 ft, GPS ca. 19.17, —96.97.
Etymology. This cryptic species is named in honor of John Burns, whose meticulous and insightful
studies shed light on the speciation in the Burnsius communis species group and resolved the question in
favor of species-level distinction between Burnsius communis and B. albezens sp. n., known as Pyrgus
albescens at the time. The name is a noun in the genitive case.
Distribution. From Mexico to Panama.
Comments. In addition to DNA, the two species B. communis and B. albezens can be reliably separated
only by male genitalia. Females of these two species cannot be told apart by phenotype, including
genitalia. Here, we find an example of a species where even male genitalia fail confident identification,
but suspect that future analyses of large series may be fruitful in finding phenotypic differences.
Burnstus adepta inepta Grishin, new subspecies
http://zoobank. org/D6F927E2-B298-4F80-B98E-BC733DDA044C
(Figs. 2p, 3 part)
Description and diagnosis. Populations from western Colombia and Ecuador that Evans (1953)
attributed to taxa currently known as B. adepta or B. orcynoides show notable genetic differentiation from
these species, in particular from B. orcynoides, and form a distinct clade in the tree (Fig. 3), indicating
that they constitute a new taxon, which is sister to B. adepta. Fst/Gmin between this taxon and B. adepta
24
computed on the Z chromosome are 0).22/0.08, and the COI barcodes differ between them by 0.6—0.8%
(4—5 bp). These statistics do not support the differentiation at the species level, therefore the new taxon is
proposed as a subspecies of B. adepta pending further research. This new subspecies mostly keys to
G.1.10.(d). in Evans (1953), together with B. orcynoides, but some paler specimens from Colombia would
key to G.1.10.(c)., together with B. adepta. Distinguished from the nominotypical subspecies by being
darker on average, with generally smaller white spots. In particular, white streaks at the base of forewing
cells M;-M> and M>-Ms3 are smaller and less developed than in the nominotypical subspecies. Conversely,
the submarginal white spot in forewing cell My)-M> is usually larger compared to other spots.
Distinguished from B. orcynoides by paler ventral forewing margins, which are overscaled with pale
olive-brown up to, and partly fused with, white submarginal spots in cells M,-Mz and M2-M3. However,
due to significant phenotypic variation (e.g., paratype NVG-15092E10 is boldly patterned), this new
subspecies is largely delimited by its non-trivial genetic differentiation from the nominotypical one, and
confident identification can be made through DNA sequences using the following DNA characters in the
nuclear genome: aly35699.3.1:TI59A, aly171.6.1:G5310A, aly171.6.1:G3873A, aly2582.35.2:A1227G,
and aly1146.51.1:T897C, and in the COI barcode: C142T, T157T(not C), A217G, T367T(not C).
Barcode sequence of the holotype: Sample NVG-16108G09, GenBank ON255705, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCCGGTTCATTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGGGCTCCAGATATAGCATTCCCTCGTA
TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACATTACTTATTT CAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGATGAACAGTTTATCCCCCATTATCAGCTAATATTGC
TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCCTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA
TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTT TAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT
CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: @ (Fig. 2p), deposited in the National Museum of Natural History,
Smithsonian Institution, Washington, DC, USA (USNM), bears four rectangular printed labels: three
white [ ECUADOR Pichincha | Tandapi, 1500 m | 16 Sept. '90 | S. S. Nicolay |], [| DNA sample ID: |
NVG-16108G09 | c/o Nick V. Grishin |], [ USNMENT | {QR Code} | 00894451 | and one red
[ HOLOTYPE < | Burnsius adepta | inepta Grishin ]. Paratypes: 1d (NVG-15092E10 in MGCL),
Colombia, Valle, Cali, Pance, elevation 3000', 23-Jan-1987, leg. J. Bolling Sullivan; 14 (NVG-16108H07
in USNM), Ecuador, Pichincha, 4 km E of Tandapi, elevation 2050 m, 23-Sep-2002, leg. I. Aldas; and 19
(NVG-16108G08 in USNM), Ecuador, Pichincha, Tandapi, elevation 1700 m, 16-Nov-1992, leg. S. S.
Nicolay.
Type locality. Ecuador: Pichincha, Tandapi.
Etymology. The name is an antonym of adepta, its sister subspecies, and refers to its "inability" to
noticeably diverge phenotypically from the nominotypical subspecies, while exhibiting genetic
diversification, and "inability" to be discovered and diagnosed without the genomic sequence analysis.
The name is a noun in apposition, made into such to resolve gender (dis)agreement.
Distribution. western Colombia and Ecuador.
Comments. This is likely one of the first subspecies identified nearly exclusively by its genetic
differentiation. Nevertheless, this differentiation confidently defines the clade from western Colombia and
Ecuador, both in nuclear and mitochondrial genomes, including the COI barcode, thus strongly implying
distinct evolutionary history of these populations. Therefore, these populations represent a distinct taxon
that is rather advanced along its path to speciation, and it is possible that it is already distinct at the
species level, something we were not able to support currently with our standard statistics.
Burnstus orcynus Grishin, new species
http://zoobank.org/9E8808A7-F6E1-4873-BE8A-6691B9085878
(Figs. 2j, 0, 3 part)
Description and diagnosis. Sister to B. orcynoides, but genetically distinct from it at the level that
suggests its species status (Fig. 3). Fst/Gmin between the new species and B. orcynoides computed on the
Z chromosome are 0.29/0.04. The COI barcodes differ between them by about 1.7% (11 bp). This new
species keys to G.1.10.(d). in Evans (1953), together with B. orcynoides, and is distinguished from it by
25
broader discal white bands on both wings, and on average paler area along inner margin of ventral
forewing, with discal spot edge at vein 1A+2A being defined weaker than in B. orcynoides. However, due
to individual variation, can be confidently identified only by DNA sequences, in particular, by the
following DNA characters in the nuclear genome: aly5294.24.2:C108T, aly728.49.1:T1263C,
aly1849.9.6:C66A, aly3512.3.2:T9OA, and aly318.4.2:T45C; and in the COI barcode T59C, C88T,
C235C(not T), T340T(not C), T536T(not C), and T616T(not C).
Barcode sequence of the holotype: Sample NVG-19086D03, GenBank ON255706, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGTTTACTAATTCGAACTGAATTAGGAAATCCTGGTTCATTAATTGGAGATGATCAAATTTATAATACT
ATTGTCACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCTTTAATAT TAGGAGCTCCAGATATAGCATTCCCTCGTA
TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAACATTACTTATTTCAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGATGAACAGTATATCCCCCATTATCAGCTAATATTGC
TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA
TTTGATCAAAT ASS OE) re eee ae a ee ee tt ee eee [CGAAACTTAAATACAT
CATTTTTTGATCCTGCCGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: <@ (Fig. 20), deposited in the National Museum of Natural History,
Smithsonian Institution, Washington, DC, USA (USNM), bears four rectangular printed labels: three
white [Curacao | Hato Field | Nov. 27, 43 | W. H. Wagner |, [| DNA sample ID: | NVG-16108G09 | c/o
Nick V. Grishin ], [ USNMENT | {QR Code} | 01588758 | and one red [ HOLOTYPE < | Burnsius |
orcynus Grishin ]. Paratypes: 14° (NVG-16108H03) and 19 (NVG-16108H02) the same data as the
holotype; 244 Venezuela, Margarita Island: La Sierra, elevation 600 m, GPS 11.017, —63.883, 13-18-
Mar-1988, leg. R. K. Robbins (NVG-16108H08); and San Francisco, 24-Feb-1989, leg. J. F. G. Clarke &
N. L. McIntyre (NVG-19086C10). All four paratypes are in USNM.
Type locality. Curacao: Hato Field.
Etymology. The name is derived from its sister species B. orcynoides. The name is a masculine adjective.
Distribution. Currently known only from Margarita Island in Venezuela and Curacao.
Comment. It is likely that this species was misidentified as B. adepta by Snellen (1887), who provided its
description and illustration.
Burnstus titicaca (Reverdin, 1921) and Burnsius chloe (Evans, 1942)
are confirmed as species-level taxa
Genomic comparison of Burnsius titicaca (Reverdin, 1921) (type locality Titicaca) and Burnsius chloe
(Evans, 1942) (type locality Peru: Callao) reveals prominent genetic differentiation between them and
even larger differences between either of them and Burnsius communis (Grote, 1872), a species they have
been treated as subspecies of (Evans 1953) (Fig. 3): e.g., Fst/Gmin in the pairs B. communis vs. B. titicaca
and B. communis vs. B. chloe are 0.70/0.00 and 0.65/0.00 respectively, suggesting nearly non-existent
gene exchange between them; and for B. fiticaca vs. B. chloe 0.39/0.02, revealing only 2% gene
exchange, consistent with two closely related and yet distinct sister species.
Notably, COI barcodes did not diverge substantially and differ by 1.4% (9 bp) between B. titicaca
and B. chloe. Comparing barcodes of B. communis with B. titicaca and B. chloe, we get 2.3% (15 bp) and
2.4% (16 bp) difference, respectively. To put these data in perspective, barcodes essentially do not differ
between prominently distinct B. communis and B. albezens sp. n.: mostly 0.2% (1 bp), but their Z
chromosome Fst/Gmin are well in the range of distinct species 0.50/0.03. Apparently, mitochondrial
evolution experienced some irregularities in Burnsius, and the following three species possess nearly
identical mitochondrial genomes: B. communis, B. albezens sp. n., and B. burnsi sp. n. Mitochondrial pool
is shared between these three sympatric North American species, but differs from that in South America.
The data presented here offer additional support for the hypothesis (Li et al. 2019) that Burnsius
titicaca (Reverdin, 1921) and Burnsius chloe (Evans, 1942) are species distinct from each other and from
Burnsius communis (Grote, 1872). This distinction is also reflected in their wing patterns: B. chloe has
greenish continuous and nearly straight ventral hindwing bands giving it a unique appearance; and in B.
titicaca, the dark bands are jagged, outlined by darker lines and paler within, discal band almost broken
into two or three spots as in most other Burnsius species (Evans 1953).
26
On the value of primary types
Primary type specimens are name bearers for taxa they represent. Specimens and populations that belong
to the same taxon as the type get the name this type bears. Therefore, careful analysis of primary type
Specimens is essential for taxonomic research. Often, however, type specimens themselves have not been
studied, so that (particularly in earlier works) name usage is based mostly on published descriptions and
illustrations. Especially for taxa whose identification by facies is more challenging, this practice may
involve mistakes. As a result, detailed analyses of primary types are often surprising and call for revision
of previous taxonomic treatments. The dilemma in such cases is whether to change the name of a
misnamed taxon to that of its primary type or to seek the ICZN ruling to preserve current but erroneous
usage by designating a neotype. There are no definitive guidelines for what to do, but we can turn to a
precedent of how a similar problem has been dealt with in the past (e.g., Hesperia discussion below).
The centerpiece of this work is the genomic analysis of primary type specimens that reveals their
identity. For the two Plétz names where phenotypic identification is straightforward, genomic analysis of
their types confirms the current usage of the names. For the other two Plétz names, where identification
by facies is frequently impossible, we find that their lectotypes are not the taxa currently referred to by
these names. While one of these names (Pyrgus lycurgus) has been consistently treated as a junior
subjective synonym and would remain as such, just of a different taxon, the other (Pyrgus albescens) has
long been misapplied. The issue with Pyrgus albescens is somewhat similar to that with Hesperia
colorado (Scudder, 1874), a thoroughly researched case (MacNeill 1975; Scott 1998; Calhoun 2015b;
Calhoun et al. 2020; Cong et al. 2021). For several decades, it has been assumed that the name H.
colorado applied to a high elevation population (MacNeill 1975; Scott 1998), and as our studies revealed,
one of the H. colorado paralectotypes indeed had a significant genetic component of this high elevation
population (Cong et al. 2021). However, lectotype designation (Barnes and McDunnough 1916) fixed the
application of the name to the Arkansas river valley population (Calhoun 2015b; Cong et al. 2021), which
is inconsistent with the application of that name by most lepidopterists during the last several decades
(Scott et al. 2018).
The only extant syntype of P. albescens (and maybe the only specimen available at the time of its
original description) has been curated as the type of this taxon in the MFNB, previously investigated and
dissected (dissection could not be located and the results were not published), and apparently accessible
for research. Genomic comparisons reveal that this specimen, designated here as lectotype, defines P.
albescens as a differentiate that we consider a southern subspecies of B. communis that is not conspecific
with the species Burns called "P. albescens". Regarding Hesperia colorado, we have argued for the
acceptance of the lectotype as the name bearer, and against designation of the neotype to preserve the
widespread, but historically incorrect, usage of the name (Calhoun et al. 2020). Calhoun, who traced the
provenance of the H. colorado \ectotype through diligent research and discovery of historical documents,
concluded that the high elevation populations, previously assumed to be H. colorado, lost this name to the
Arkansas River valley populations, which already had a more recently proposed name, Hesperia comma
oroplata J. Scott, 1981 (Calhoun 2015b; Calhoun 2015a). A new name for the high elevation populations
was proposed (Warren and Calhoun 2015).
The situation with Pyrgus albescens is analogous. We found that according to its lectotype, it is
not the species this name is currently used for, and this species loses its name to southern populations
(southern Mexico, Central America) of B. communis. A new name for the species previously assumed to
be B. albescens is proposed here. To soften the experience of the name change, the new name is chosen to
be phonetically similar: B. albezens sp. n. However, in either case, be it Hesperia colorado or Burnsius
albescens, one can argue that the lectotypes should be set aside and neotypes designated to preserve
erroneous usage of these names. The erroneous usage is caused by mistakes of prior researchers who did
not study the type material, although it was available and labeled appropriately in corresponding
collections (Calhoun 2015b). We leave it to the community of lepidopterists to decide on the best
27
solution, but chose to accept the lectotypes as the name bearers in both cases (Hesperia colorado and
Pyrgus albescens).
Taxonomic history of the two Burnsius species in the US reveals evolving opinions. Skinner
(1906) described new species P. occidentalis (subsequently, and as we show incorrectly, synonymized
with P. albescens) but immediately changed his mind by stating that occidentalis “is not a species, but
only a form or geographical race of tessellata” (currently B. communis). In so doing, he initiated the
communis/albescens debate. Intrigued by the question of taxonomic rank, several workers soon found
unmistakable differences in the male genitalia of these taxa but differed in their taxonomic conclusions
(which were often equivocal) because of a lot of individual genitalic variation. Skinner and Williams
(1923) clearly figured the typical genitalic differences between the two taxa. Lindsey et al. (1931), using
the combination Pyrgus communis race albescens, reprinted those figures and stated that this taxon occurs
“from California to Texas and Mexico” and that “this form is scarcely worthy of a name, but may be
regarded as a pale southwestern geographic race.” Pyrgus communis albescens has been used for decades
to denote this subspecies (known in this century, first as Pyrgus albescens and then Burnsius albescens).
Sequencing of the P. albescens lectotype shows that it 1s indeed closely related to B. communis but at no
more than a subspecific level. The geographic distribution of this subspecies is far different from that of
what, for a long time, has been erroneously called P. c. albescens, and constitutes the southernmost
outskirts of its former vast range. As dictated by its lectotype, we now apply the name B. c. albescens to
this subspecies and name its former owner, a distinct species, Burnsius albezens sp. n.
Nomenclature-wise, the situation with Pyrgus albescens is noteworthy because the name
albescens has been applied to two subspecific taxa of B. communis. Lindsey et al. (1931) erroneously
used it in their trinomial Pyrgus communis albescens, and now we correctly call a genomically and
geographically distinct subspecies Burnsius communis albescens. Invalidating the previous use of
albescens leaves its bearer without a name. We call it new species Burnsius albezens.
Species, subspecies, and genomics
Traditionally, species delimitation in Hesperiidae is often based on consistent differences in genitalia, and
subspecies in butterflies are defined by geographic differences in wing patterns. Since the introduction of
COI barcodes in 2003, they have been widely used to detect cryptic species (which often lack appreciable
genitalic differences). However, any single locus, especially in mitochondrial DNA where the barcode ts
located, is subject to gene exchange between species, which is frequent within species complexes of close
relatives. Due to gene exchange, significant barcode differences within a population do not necessarily
indicate multiple species. On the other hand, the lack of differences in COI barcodes need not imply
conspecificity, and closely related sympatric species may have identical barcodes.
One common way to define species is by a reproductive barrier that may not, however, be
absolute. Genomic comparison enables direct assessment of this reproductive barrier through the analysis
of genetic differentiation and gene exchange. Greater genetic differentiation between populations and
lesser gene exchange between them suggest a higher reproductive barrier and a possible loss of
conspecificity. Sex chromosomes, such as the Z chromosome in butterflies, are more instructive for these
analyses than autosomes, because they encode a large fraction of genes important for mate recognition
and are less susceptible to gene exchange due to a lower recombination rate. Recombination of Z
chromosomes occurs only in the homogametic sex, which, in butterflies, 1s the male.
In traditional phylogenetic trees constructed from genomic alignment positions sampled from
protein-coding genes in the Z chromosome, distinct species usually stand out as strongly supported clades
with statistical support of 1 (Fig. 3b). To compute this statistical support, we draw 100 samples of
positions and construct a tree from each sample. Statistical support for a node in the tree is the fraction of
trees (out of 100) with this node present. Support of 1 means that all samples of different genomic regions
result in the same grouping of specimens. With reproductive isolation, interspecific gene exchange that
puts a specimen of one species within specimens of the other is rare. Most genomic regions group all
28
specimens of the same species and away from specimens of a different species.
However, within species, phylogenetic trees are not expected to have clades with strong support.
Indeed, due to free gene flow within each species, samples of various positions are not expected to group
Specimens the same way. Gene flow equilibrates gene frequencies within species and prevents a group of
populations from diverging. Therefore, we see a lack of tree structure within species (Fig. 3b blue, red, or
magenta clades) and species subtrees appear comb-like rather than the usual bifurcating trees (Fig. 3a).
Subspecies in butterflies have been defined by wing pattern differences. While some of these
differences may be minor and might even be environmentally induced, others should reflect certain
genetic differentiation between subspecies. Such genetically differentiated subspecies may be viewed as
groups of populations on their way to allopatric speciation. Therefore, these subspecies may be delineated
by genomic comparison as clades of specimens from different parts of the range. However, such
subspecies clades would be less prominent than the clades corresponding to species, and with weaker
Statistical support due to gene flow between subspecies. This is what we observe with Burnsius adepta
inepta ssp. n. (Fig. 3b, orange clade). The existence of this subspecies was first suggested by our genomic
trees, and its wing pattern differences were only found afterwards.
While general concepts about genomic data, species, and subspecies presented here are reasonably
well understood from a theoretical perspective, an exact numeric criterion for species vs. subspecies
definition is unrealistic, remains uncertain in borderline cases, and should be investigated. Here, B. adepta
inepta ssp. n. (Fig. 3b orange) is conservatively proposed as a subspecies due to its limited genetic
differentiation from nominotypical B. adepta (Fig. 3b cyan). However, it is possible that it may be a
species-level taxon. Genomic sequencing and analysis of a larger sample of specimens is necessary to
shed further light on the situation. In particular, an analysis could be focused on Colombia, from which
both taxa have been recorded.
ACKNOWLEDGMENTS
We acknowledge Jinhui Shen, Leina Song, Ping Chen, and Ming Tang for excellent technical assistance.
We are grateful to David Grimaldi and Courtney Richenbacher (AMNH: American Museum of Natural
History, New York, NY, USA), Blanca Huertas, David Lees, and Geoff Martin (BMNH: Natural History
Museum, London, UK), Jonathan Pelham (BMUW: Burke Museum of Natural History and Culture,
Seattle, WA, USA), Jim Fetzner, Bob Androw, Vanessa Verdecia, Cat Giles, and the late John Rawlins
(CMNH: Carnegie Museum of Natural History, Pittsburgh, PA, USA), Crystal Maier and Rebekah
Baquiran (FMNH: Field Museum of Natural History, Chicago, IL, USA), John R. MacDonald and
Richard L. Brown (MEM: Mississippi Entomological Museum, Starkville, MS, USA), Wolfram Mey,
Viola Richter, and Theo Leger (MFNB: Museum fiir Naturkunde, Berlin, Germany), Andrew D. Warren
and Andrei Sourakov (MGCL: McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL, USA),
Edward G. Riley, Karen Wright, and John Oswald (TAMU: Texas A&M University Insect Collection,
College Station, TX, USA), Jeff Smith and Lynn Kimsey (UCDC: Bohart Museum of Entomology,
University of California, Davis, CA, USA), Robert K. Robbins and Brian Harris (USNM: National
Museum of Natural History, Smithsonian Institution, Washington, DC, USA), and Axel Hausmann and
Ulf Buchsbaum (ZSMC: Zoologische Staatssammlung Miinchen, Germany), for granting access to
specimens in the collections under their care and for stimulating discussions; to the Texas Parks and
Wildlife Department (Natural Resources Program Director David H. Riskind) for the research permit 08-
02Rev; to Robert Gallardo, Robb Hannawacker, and the late Edward C. Knudson (specimens now at the
McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL, USA) for specimens and leg samples;
to Peter Michalik and Lara Lopardo (EMAU: Ernst Moritz Arndt Universitat in Greifswald, Germany) for
photographs of Hesperiidae primary types under their care; to Viola Richter, Théo Léger, and the
Museum fiir Naturkunde Berlin digitization team for locating and photographing type specimens of P.
varus (Fig. 2a, b); to Karen Wright (TAMU) for photographs of P. adjutrix neotype (Fig. 2k); to Ernst
Brockmann for help with sampling specimens for DNA in MFNB; to Gerardo Lamas, Bernard Hermier
29
and Jonathan Pelham for fruitful discussions and suggestions; and to Bernard Hermier for the critical
review of the manuscript and copious helpful suggestions and corrections. Please note that the images ©
The Trustees of the Natural History Museum, London are made available to you under Creative
Commons License 4.0 (https://creativecommons.org/licenses/by/4.0/), which means in particular that
when using the images you must give appropriate credit and provide a link to the license. We
acknowledge the Texas Advanced Computing Center (TACC) at The University of Texas at Austin for
providing HPC resources. The study was supported in part by the grants (to N.V.G.) from the National
Institutes of Health GM127390 and the Welch Foundation I-1505.
LITERATURE CITED
Barnes, W. and J. H. McDunnough. 1916. Notes on North American diurnal Lepidoptera. Contributions
to the natural history of the Lepidoptera of North America 3(2): 53-152, [153-156].
Burns, J. M. 2000. Pyrgus communis and Pyrgus albescens (Hesperiidae: Pyrginae) are separate
transcontinental species with variable but diagnostic valves. Journal of the Lepidopterists' Society
54(2): 52-71.
Calhoun, J. V. 2015a. Assessing specimen provenance through the writings of Theodore L. Mead, with
notes on his specimens of Hesperia colorado (Hesperiidae). News of the Lepidopterists’ Society
57(4): 176-181, 173.
Calhoun, J. V. 2015b. An updated itinerary of Theodore L. Mead in Colorado in 1871, with type locality
clarifications and a lectotype designation for Melitaea eurytion Mead (Nymphalidae). Journal of
the Lepidopterists’ Society 69(1): 1-38.
Calhoun, J. V., Q. Cong, N. V. Grishin, and A. D. Warren. 2020. Comment (Case 3709) — Additional
comments on the proposed conservation of names for western North American Hesperia comma-
group subspecies through designation of neotypes. Bulletin of Zoological Nomenclature 77(1):
36-40.
Cong, Q., J. Shen, J. Zhang, W. Li, L. N. Kinch, J. V. Calhoun, A. D. Warren, and N. V. Grishin.
2021. Genomics reveals the origins of historical specimens. Molecular Biology and Evolution
38(5): 2166-2176.
Cramer, P. 1775-1780. De uitlandsche Kapellen voorkomende in de drie Waereld-Deelen Asia, Africa
en America. Papillons exotiques des trois parties du monde I'Asie, l'Afrique et l'Amérique. S. J.
Baalde; Amsteldam; Barthelemy Wild and J. Van Schoonhoven & Comp.; Utrecht. I: 1-xxx, I-
155, pls 1-96; II: 1-151, pls 97-192; III: 1-176, pls 193-288, IV: 1-28, pls 289-304.
Draudt, M. W. K. 1921-1924. B. Grypocera, breitképfige Tagfalter. /n: Seitz, A. (Ed.). Die Gross-
Schmetterlinge der Erde. Alfred Kernen; Stuttgart, pp. 833-1011, 1046-1139, pls 113B, 160-193.
Evans, W. H. 1949. A catalogue of the Hesperiidae from Europe, Asia, and Australia in the British
Museum (Natural History). The Trustees of the British Museum (Natural History); London. xix +
502 pp., 53 pls.
Evans, W. H. 1953. A catalogue of the American Hesperiidae indicating the classification and
nomenclature adopted in the British Museum (Natural History). Part III. Pyrginae. Section 2. The
Trustees of the British Museum (Natural History); London. v + 246 pp., pls. 26—53.
Evans, W. H. 1955. A catalogue of the American Hesperiidae indicating the classification and
nomenclature adopted in the British Museum (Natural History). Part IV. Hesperiinae and
Megathyminae. The Trustees of the British Museum (Natural History); London. v + 499 pp.., pls.
54-88.
Gilbert, P. 2000. Butterfly collectors and painters: four centuries of colour plates from the library
collections of The Natural History Museum, London. Beaumont; Singapore. x+166 pp., 60 pl.
Godman, F. D. 1907. Notes on the American species of Hesperiidae described by Pl6tz. Annals and
Magazine of natural History (7)20(16): 132-155.
30
Godman, F. D. and O. Salvin. 1899. Biologia Centrali-Americana. Insecta. Lepidoptera-Rhopalocera.
Dulau & Co., Bernard Quaritch; London. 2(147): 449-456, pl. 90
ICZN [International Commission on Zoological Nomenclature]. 1999. International code of
zoological nomenclature. Fourth edition - Code international de Nomenclature Zoologique.
Quatriéme édition. International Trust for Zoological Nomenclature; London. xxx + 306 pp.
Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes
of skipper butterflies reveal extensive convergence of wing patterns. Proceedings of the National
Academy of Sciences of the United States of America 116(13): 6232-6237.
Lindsey, A. W., E. L. Bell, and R. C. Williams. 1931. The Hesperioidea of North America. Denison
University Bulletin 26(1): 1-142, pls. 1-33.
Mabille, P. 1904. Lepidoptera Rhopalocera. Fam. Hesperidae. Genera Insectorum 17b: 79-142.
MacNeill, C. D. 1975. Family Hesperiidae. The skippers. pp. 423-578. In: Howe, W. H. (Ed.). The
butterflies of North America. Doubleday & Co., Inc.; Garden City, New York.
Pickrell, J. K. and J. K. Pritchard. 2012. Inference of population splits and mixtures from genome-wide
allele frequency data. PLoS Genet 8(11): e1002967.
Plétz, C. 1884. Analytische Tabellen der Hesperiinen-Gattungen Pyrgus und Carcharodus. Mittheilungen
aus dem naturwissenschaftlichen Vereine von Neu-Vorpommern und Rtigen in Greifswald 15: I-
24.
Scott, J. A. 1998. New western North American butterflies. Papilio (n.s.) 11: 1-12.
Scott, J. A., N. G. Kondla, J. F. Emmel, K. E. Davenport, S. O. Mattoon, M. S. Fisher, C. S. Guppy,
S. Kohler, W. D. Patterson, Jr., P. A. Opler, A. R. Westwood, and R. A. Royer. 2018. Case
3709 — Conservation of the usage of names of western North American Hesperia comma-group
subspecies (Lepidoptera, Hesperiidae) through designation of neotypes for Pamphila colorado
Scudder, 1874, Pamphila manitoba Scudder, 1874, Pamphila cabelus Edwards, 1881, Pamphila
harpalus Edwards, 1881, Pamphila idaho Edwards, 1883, Pamphila oregonia Edwards, 1883, and
Hesperia colorado ochracea Lindsey, 1941. Bulletin of Zoological Nomenclature 75(1): 88-121.
Shen, J., Q. Cong, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017. Complete genome of Achalarus
lyciades, the first representative of the Eudaminae subfamily of skippers. Current Genomics 18(4):
366-374.
Skinner, H. 1906. Studies of Pyrgus syrichtus, tessellata, occidentalis, and montivagus. Entomological
news, and proceedings of the Entomological Section of the Academy of Natural Sciences of
Philadelphia 17(8): 277-278, pl. XII.
Skinner, H. and R. C. Williams. 1923. On the male genitalia of the Hesperiidae of North America,
Paper II. Transactions of the American Entomological Society 48(3): 283-306.
Snellen, P. C. T. 1887. Bijdrage tot de Kennis der Lepidoptera van het Eiland Curacgao, met Afbeeldingen
door Prof. Dr. J. Van Leeuwen Jr. Tijdschrift voor Entomologie 30(1): 9-66, 5 pls.
Stoll, C. 1780. Jn: Cramer, P. (Ed.). De uitlandsche Kapellen voorkomende in de drie Waereld-Deelen
Asia, Africa en America. Papillons exotiques des trois parties du monde I'Asie, l'Afrique et
l'Amérique. S. J. Baalde; Amsteldam; Utrecht, Barthelemy Wild and J. Van Schoonhoven &
Comp.; Utrecht. 4(26/28): 29-90, pls. 305-336.
Warren, A. D. and J. V. Calhoun. 2015. A new name for the alpine populations of Hesperia colorado
(Scudder) (Hesperiidae, Hesperiinae) in Colorado. Journal of the Lepidopterists’ Society 69(1):
39-49,
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2021. Genomics-guided refinement of
butterfly taxonomy. The Taxonomic Report of the International Lepidoptera Survey 9(3): 1—54.
31
The Taxonomic Report
is a publication of
The International Lepidoptera Survey (TILS)
The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in
the state of Virginia, U.S.A. The Taxonomic Report (TTR) is published for the purpose of providing a
public and permanent scientific record. Contents are peer-reviewed but not necessarily through the
anonymous review and comment process preferred by some publishers of serial literature. It appears in
digital, open-access form, is regularly disseminated in hardcopy form to select institutional repositories
and is also available as printed copy upon request at the discretion of authors and/or the editor. Printing
and postage costs may apply. An initial run of 25 copies is printed on paper to meet ICZN
recommendation 8B. Copies of all TTR papers are available at the archival TTR website:
(http://lepsurvey.carolinanature.com/report.html) and via the following digital repositories:
Internet Archive (https://archive.org/)
Biodiversity Heritage Library (https://www.biodiversitylibrary.org)
Zobodat (https://www.zobodat.at/)
Zenodo (https://zenodo.org)
TILS Purpose
TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,
determination, and documentation, without which there can be no preservation.
TILS Motto
“As a world community, we cannot protect that which we do not know”
Articles for publication are sought
They may deal with any area of research on Lepidoptera, including faunal surveys, conservation topics,
methods, etc. Taxonomic papers are especially welcome. There are no page charges for authors. Before
sending a manuscript, simply write to TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg,
VA, 20176, USA to initiate discussion on how to best handle your material for publication, and to discuss
peer review options; or email to
[email protected] (cc: to
[email protected] if you do not
receive a reply within one week).
Visit The International Lepidoptera Survey on the World Wide Web at:
http://lepsurvey.carolinanature.com
&
Join the discussion at our list serve on Groups.1io at:
https://groups.io/g/TILS
You can subscribe by sending an email to:
[email protected]
&
Join The International Lepidoptera Survey on Facebook at:
https://www.facebook.com/groups/1072292259768446
32