Bonn Volume 68
Issue 1
zoological 2019
Bulletin
formerly: Bonner zoologische Beitrage
An open access journal of organismal zoology, published by
Zoologisches Forschungsmuseum Alexander Koenig — Leibniz-Institut fiir Biodiversitat der Tiere, Bonn
BHL
i
Blank Page Digitally Inserted
FORSCHUNGS
Bonn zoological Bulletin 68 (1): 1-12
2019 - Sharma B.K. & Sharma S.
https://doi.org/10.20363/BZB-2019.68.1.001
Research article
urn:|sid:zoobank.org:pub:839E82A A-0807-47C 1-B21E-CS5DE2098C 146
The biodiverse rotifer assemblages (Rotifera: Eurotatoria)
of Arunachal Pradesh, the eastern Himalayas:
alpha diversity, distribution and interesting features
Bhushan Kumar Sharma’’ & Sumita Sharma’
'2 Department of Zoology, North-Eastern Hill University, Shillong — 793 022, Meghalaya, India
* Corresponding author: Email: [email protected]
'urn:lsid:zoobank.org:author:FD069583-6E7 1-46D6-8F45-90A87F35BEFE
?urn:Isid:zoobank.org:author:668EQFEO-C474-4 D0D-9339-F01ADFD239D1
Abstract. The present assessment of Rotifera biodiversity of the eastern Himalayas reveals a total of 172 species belonging
to 39 genera and 19 families from Arunachal Pradesh, the northeastern-most state of India. The richness forms ~59% and
~40% of the rotifer species known till date from northeast India (NEI) and India, respectively. Three species are new to the
Indian sub-region, four species are new to NEI and 89 species are new to Arunachal Pradesh; 27 species indicate global
distribution importance and 25 species reported exclusively from NEI merit regional interest. The rich and diverse alpha di-
versity and biogeographic interest of Rotifera of this Himalayan biodiversity hot-spot is noteworthy in light of predominance
of the small lentic ecosystems. Lecanidae > Brachionidae > Lepadellidae > Trichocercidae collectively comprise ~71% of
total rotifer species. Brachionidae records the highest richness known from any state of India. This study indicates the role of
thermophiles with overall importance of “tropic-centered’ genera Lecane and Brachionus, and particularly at lower altitudes;
species of ‘temperate-centered’ genera Keratella, Notholca and Synchaeta are notable in our collections at middle and higher
altitudes, while 7richocerca and Lepadella are other species-rich genera. The rotifer fauna shows a mixture of ‘tropical’ and
‘cold-water’ elements, depicts the littoral-periphytonic character, and records a large component of cosmopolitan species.
The study of more collections from middle and higher altitudes of Arunachal Pradesh are desired for an update on Rotifera
ISSN 2190-7307
http://www.zoologicalbulletin.de
from the eastern Himalayas.
Key words. Biodiversity, biogeography, habitat heterogeneity, Himalayan hot-spot, interesting species.
INTRODUCTION
Rotifera, an important group of aquatic metazoans and an
integral link of aquatic food-webs, have been inadequate-
ly documented from several states of India in spite of over
120 years of taxonomic contributions (Sharma & Shar-
ma 2017, 2018a). This generalization holds valid for the
eastern-most hill state of Arunachal Pradesh of northeast
India (NEI) with an earlier report of 76 species (Sharma
& Sharma 2014a). On the other hand, a recent document
on ‘Faunal diversity of Indian Himalayas’ (Chandra et
al. 2018) listed only 24 species without taking due cog-
nizance of our report in spite of its citation, and Sinha
(2018) enlisted 45 rotifer species while collating infor-
mation on zooplankton fauna of Arunachal Pradesh. The
present study is thus an endeavor to augment the status of
Rotifera biodiversity of the eastern Himalayas and NEI
in particular as well as our work on Fauna volume on the
Indian Freshwater Rotifera.
Arunachal Pradesh, “the land of dawn-lit mountains”,
is the northeastern-most state of India. Geographically, it
is the largest amongst eight sister states of NEI and more
importantly, it forms a part of the Himalayan biodiversity
Received: 11.09.2018
Accepted: 23.01.2019
hot-spot. This eastern Himalayan hill state is character-
ized predominantly by small lentic biotopes located un-
der varied climatic regimes that range from the low alti-
tude humid subtropical climate to high altitude and very
high altitude areas with subtropical highland climate and
alpine climate. We hypothesize the lentic ecosystems of
Arunachal Pradesh to harbor biodiverse Rotifera in view
of likely habitat heterogeneity under varied ecological re-
gimes. Our plankton and semi-plankton collections from
different districts and largely from small lentic ecosystems
of this state interestingly reveal rich and diverse Rotifera
assemblages. We present an inventory of the rotifer spe-
cies observed from Arunachal Pradesh with illustrations
of interesting elements. Comments are made on the rotifer
alpha diversity with emphasis on the nature and compo-
sition, new records, elements of global and regional bio-
geographic interest and other salient features. This study
marks a notable contribution to biodiversity and biogeog-
raphy of the Indian and Asian Rotifera and that of the east-
ern Himalayas in particular.
Corresponding editor: B. Huber
Published: 30.01.2019
2 Bhushan Kumar Sharma & Sumita Sharma
Af,
92°0'0"E 93°0'0"E 94°0'0"E 95°0'0"E 96°0'0"E 97°0'0"E
es)
30°0'0"N
=
= =
) >?
2 a
NN
=
z 2 5
“4 ; i
© ¢ East Siang &
4
2 f a
nN
=
Fa ©
2 >
o nd
RK NN
N
92°0°0"E 93°0'0"E 94°0'0"E 95°0'0"E 96°0'0"E 97°0'0"E
Fig. 1A—B. A. Map of India indicating the state of Arunachal Pradesh; B. District map of Arunachal Pradesh.
Bonn zoological Bulletin 68 (1): 1-12 ©ZFMK
The biodiverse rotifer assemblages (Rotifera: Eurotatoria) of Arunachal Pradesh, the eastern Himalayas 3
MATERIALS & METHODS
The present study is based on analysis of our plankton
and semi-plankton samples collected during January and
March, 2013; February, August and November, 2013;
February, 2014 from different districts of Arunachal
Pradesh (26.28°—29 30° N latitude; 91.20°—97.30° E lon-
gitude) as well as during September, 2013 and June, 2014
from Twang and East Kameng districts. A total of 419
samples collected from scattered localities of Tawang,
East Kameng, Lower Subansiri, Upper Subansiri, West
Siang, Lower Siang, East Siang, Upper Dibang Valley,
Lower Dibang Valley, Namsai, Lohit, Changlang and
Tirap districts were examined (Fig. 1, A—B). The collec-
tions largely covered the localities from the lower alti-
tudes particularly from the districts adjoining the state of
Assam with limited samples from middle altitudes and
higher altitudes because of logistic difficulties for sam-
pling namely restricted area and lack of access; infra-
structure, difficult terrain and financial support constrains
for intensive sampling. The small lentic ecosystems were
mainly sampled while the collections were also examined
from certain floodplain wetlands from lower altitudes.
Water samples were taken from various aquatic bio-
topes; water temperature, pH and specific conductivity
were recorded with the relevant field probes to provide
information on some basic abiotic attributes. The plankton
samples were collected by towing a nylobolt plankton net
(No. 25; # 50um)) and were preserved in 5% formalin. In-
dividual samples were screened with a Wild stereoscopic
binocular microscope; the rotifer taxa were isolated and
mounted in Polyvinyl alcohol-lactophenol, and were ob-
served with Leica (DM 1000) stereoscopic phase contrast
microscope fitted with an image analyzer. The micro-pho-
tographs were provided for interesting species and mea-
surements were given in micrometers (um). The rotifer
taxa were identified following Koste (1978), Koste and
Shiel (1987, 1989, 1990), Shiel and Koste (1992, 1993),
Segers (1995), Sharma (1983, 1987, 1998) and Sharma &
Sharma (1999, 2000, 2008, 2013) and Jersabek & Leitner
(2013). Segers (2007) and Jersabek & Leitner (2013) were
followed for distributional records of various taxa. The
percentage similarities between the rotifer communities
were calculated vide Sorenson’s index (Sorenson 1948).
The voucher collections are deposited in the holdings of
Zoological Survey of India, Kolkata.
RESULTS
The plankton and semi-plankton collections from
Arunachal Pradesh reveal 172 species of Rotifera be-
longing to 39 genera and 19 families. A detailed system-
atic list of the recorded taxa is presented below:
Bonn zoological Bulletin 68 (1): 1-12
Systematic list of Rotifera recorded from Arunachal
Pradesh
Phylum: Rotifera
Class: Eurotatoria
Subclass: Monogononta
Order: Ploima
Family: Brachionidae
Anuraeopsis coelata De Beauchamp, 1932
A. fissa Gosse, 1851
Brachionus angularis Gosse, 1851
B. bennini Leissling, 1924 **
B. bidentatus Anderson, 1889
B. budapestinensis Daday, 1885 **
B. calyciflorus Pallas, 1766
B. caudatus Barrois & Daday, 1894
B. dichotomus reductus Koste & Shiel, 1980 **
10. B. dimidiatus Bryce, 1931 *
11. B. diversicornis (Daday, 1883) **
12. B. falcatus Zacharias, 1898
13. B. forficula Wierzejski, 1891
14. B. kostei Shiel, 1983 **
15. B. lyratus Shephard, 1911 #
16. B. mirabilis Daday, 1897 **
17. B. murphyi Sudzuki, 1989 **
18. B. quadridentatus Hermann, 1783
19. B. rubens Ehrenberg, 1838 **
20. Keratella cochlearis Gosse, 1851
21. K. edmondsoni Ahlstrom, 1943 **
22. K. javana Hauer, 1937 **
23. K. lenzi Hauer, 1953 **
24. K. serrulata (Ehrenberg, 1838)
25. K. tecta (Gosse, 1851) **
26. K. ticinensis (Callerio, 1921) *
27. K. tropica (Apstein, 1907)
28. Notholca acuminata (Ehrenberg, 1832)
29. N. labis Gosse, 1887 *
30. N. squamula (O.F. Muller, 1786)
31. Plationus patulus (O.F. Miller, 1786)
32. Platyias leloupi Gillard, 1957 **
33. P. quadricornis (Ehrenberg, 1832)
Meee Oe Se
Family: Epiphanidae
34. Epiphanes brachionus (Ehrenberg, 1837) **
Family: Euchlanidae
35. Beauchampiella eudactylota (Gosse, 1886)
36. Dipleuchlanis propatula (Gosse, 1886)
37. Euchlanis dilatata Ehrenberg, 1832
38. E. incisa Carlin, 1939
39. E. triquetra Ehrenberg, 1838 **
AQ. Tripleuchlanis plicata (Levander, 1894) **
Family: Mytilinidae
41. Lophocharis salpina (Ehrenberg, 1834) **
42. Mytilina acanthophora Hauer, 1938 **
©ZFMK
4 Bhushan Kumar Sharma & Sumita Sharma
43. M. bisulcata (Lucks, 1912) **
44. M. brevispina (Ehrenberg, 1830) **
45. M. michelangellii Reid & Turner, 1988 **
46. M. ventralis (Ehrenberg, 1830)
Family: Trichotriidae
47. Macrochaetus danneelae Koste & Shiel, 1983 **
48. M. longipes Myers, 1934 **
49. M. sericus (Thorpe, 1893)
50. Trichotria tetractis (Ehrenberg, 1830)
51. Wolga spinifera (Western, 1894) **
Family: Lepadellidae
52. Colurella adriatica Ehrenberg, 1831 **
53. C. obtusa (Gosse, 1886)
54. C. sulcata (Stenroos, 1898) **
55. C. uncinata (O.F. Miller, 1773)
56. Lepadella acuminata (Ehrenberg, 1834)
57. L. apsicora Myers, 1934
58. L. apsida Harring, 1916 **
59. L. benjamini Harring, 1916 **
60. L. biloba Hauer, 1938 **
61. L. costatoides Segers, 1992 **
62. L. dactyliseta (Stenroos, 1898) **
63. L. discoidea Segers, 1993 **
64. L. ehrenbergi (Perty, 1850)
65. L. heterostyla (Murray, 1913)
66. L. minuta (Weber & Montet, 1918) **
67. L. ovalis (O. F. Muller, 1786)
68. L. patella (O.F. Muller, 1773)
69. L. quinquecostata (Lucks, 1912) **
70. L. rhomboides (Gosse, 1886)
71. L. triba Myers, 1934 **
72. L. triptera Ehrenberg, 1830
73. L. vandenbrandei Gillard, 1952 **
74. Squatinella lamellaris (O. F. Muller, 1786) **
Family: Lecanidae
75. Lecane aculeata (Jakubski, 1912)
76. L. aeganea Harring, 1914 **
77. L. arcula Harring, 1914
78. L. bifurca (Bryce, 1892) **
79. L. blachei Berzins, 1973 **
80. L. bulla (Gosse, 1851)
81. L. closterocerca (Schmarda, 1898)
82. L. crepida Harring, 1914
83. L. curvicornis (Murray, 1913)
84. L. decipiens (Murray, 1913)
85. L. dorysimilis Trinh Dang, Segers & Sanoamuang, 2015 **
86. L. doryssa Harring, 1914 **
87. L. elegans Harring, 1914 **
88. L. flexilis (Gosse, 1886) **
89. L. furcata (Murray, 1913)
90. L. haliclysta Harring & Myers, 1926 **
91. L. hastata (Murray, 1913) **
92. L. hamata (Stokes, 1896)
Bonn zoological Bulletin 68 (1): 1-12
93. L. hornemanni (Ehrenberg, 1834) **
94. L. inermis (Bryce, 1892) **
95. L. inopinata Harring & Myers, 1926 **
96. L. lateralis Sharma, 1978 **
97. L. leontina (Turner, 1892)
98. L. ludwigii (Eckstein, 1883)
99. L. luna(O.F .Miller, 1776)
100. L. /unaris (Ehrenberg, 1982)
101. L. monostyla (Daday, 1897) **
102. L. nitida (Murray, 1913) **
103. L. niwati Segers, Kotethip & Sanoamuang, 2004 **
104. L. obtusa (Murray, 1913) **
105. L. papuana (Murray, 1913)
106. L. paxiana Hauer, 1940 **
107. L. ploenensis (Voigt, 1902)
108. L. pusilla Harring, 1914 **
109. L. pyriformis (Daday, 1905)
110. L. quadridentata (Ehrenberg, 1830)
111. L. rhenana Hauer, 1929 **
112. L. rhytida Harring & Myers, 1926**
113. L. signifera (Jennings, 1896)
114. L. stenroosi (Meissner, 1908) **
115. L. stichoclysta Segers, 1993 #
116. L. superaculeata Sanoamuang & Segers, 1997 **
117. L. undulata Hauer, 1938 **
118. L. unguitata (Fadeev, 1925)
119. L. ungulata (Gosse, 1887)
Family: Notommatidae
120. Cephalodella forficula (Ehrenberg, 1832)
121. C. gibba (Ehrenberg, 1830)
122. C. intuta Myers, 1924 **
123. C. mucronata Myers, 1934
124. C. trigona (Rousselet, 1895) **
125. Monommata longiseta (O.F. Miller, 1786) **
126. Notommata pachyura (Harring & Myers, 1924) **
Family: Scaridiidae
127. Scaridium longicaudum (O.F. Muller, 1786)
Family: Trichocercidae
128. Trichocerca bidens (Lucks, 1912) **
129. T. bicristata (Gosse, 1887) **
130. T. capucina (Wierzejski & Zacharias, 1893) **
131. T cylindrica (Imhof, 1891)
132. T. edmondsoni (Myers, 1936) **
133. T. elongata (Gosse, 1886)
134. T flagellata Hauer, 1938 **
135. T hollaerti De Smet, 1990 **
136. T. insignis (Herrick, 1886) **
137. T: longiseta (Schrank, 1802)
138. T maior Hauer, 1936 **
139. T. mus Hauer, 1938 #
140. T: pusilla (Lauterborn, 1898) **
141. T rattus (O.F. Miller, 1786)
142. T. similis (Wierzejski, 1893)
©ZFMK
The biodiverse rotifer assemblages (Rotifera: Eurotatoria) of Arunachal Pradesh, the eastern Himalayas 5
Figs. 2A—I. New Rotifera records and species of biogeographic interest. A. Brachionus lyratus Shephard (ventral view); B. Lecane
stichoclysta Segers (ventral view); C. Trichocerca mus Hauer (lateral view); D. Brachionus dimidiatus Bryce (ventral view); E. Ker-
atella ticinensis (Callerio) (dorsal view); F. Notholca acuminata (Ehrenberg) (dorsal view); G. Notholca labis Gosse (ventral view);
H. Brachionus dichotomus reductus Koste & Shiel (ventral view); I. Brachionus murphyi Sudzuki (dorsal view).
Bonn zoological Bulletin 68 (1): 1-12 ©ZFMK
6 Bhushan Kumar Sharma & Sumita Sharma
Figs. 3A—J. Rotifera species of biogeographic interest. A. Cephalodella trigona (Rousselet) (lateral view); B. Keratella edmondsoni
Ahlstrom (dorsal view); C. Keratella javana Hauer (ventral view); D. Keratella serrulata (Ehrenberg) (ventral view), E. Lecane
blachei Berzins (ventral view); F. Lecane lateralis Sharma (ventral view); G. Lecane niwati Segers, Kotethip & Sanoamuang (ventral
view), H. Lecane superaculeata Sanoamuang & Segers (ventral view); I. Lepadella discoidea Segers (ventral view); J. Lepadella
vandenbrandei Gillard (ventral view).
Bonn zoological Bulletin 68 (1): 1-12 ©ZFMK
The biodiverse rotifer assemblages (Rotifera: Eurotatoria) of Arunachal Pradesh, the eastern Himalayas 7
PCA
aig Pe &
a es =
a, ea
He,
Ohh ees ‘a Pap Sy ate
Figs. 4A—H. Rotifera species of biogeographic interest. A. Macrochaetus danneelae Koste & Shiel (ventral view); B. Notholca squa-
mula (O.F. Muller) (dorsal view); C. Testudinella amphora Hauer (ventral view); D. Testudinella brevicaudata Yamamoto (ventral
view); E. Testudinella greeni Koste (dorsal view); FK. Trichocerca edmondsoni (Myers) (lateral view); G. Trichocerca hollaerti De
Smet (lateral view); H. Trichocerca maior Hauer (lateral view).
Bonn zoological Bulletin 68 (1): 1-12 ©ZFMK
8 Bhushan Kumar Sharma & Sumita Sharma
143. T tigris (O.F. Muller, 1786) **
144. T stylata (Gosse, 1851) **
145. T. uncinata (Voigt, 1902) **
146. T: weberi (Jennings, 1903) **
Family: Asplanchnidae
147. Asplanchna priodonta Gosse, 1850
Family: Synchaetidae
148. Ploesoma lenticulare Herrick, 1885 **
149. Polyarthra vulgaris Carlin, 1943
150. Synchaeta oblonga Ehrenberg, 1832 **
151. S. longipes Gosse, 1887
152. S. pectinata Ehrenberg, 1832
Family: Dicranophoridae
153. Dicranophoroides caudatus (Ehrenberg, 1834)
154. Dicranophorus forcipatus (O.F. Miller, 1786) **
Order. Flosculariaceae
Family: Floscularidae
155. Sinantherina semibullata (Thorpe, 1893) **
156. S. spinosa (Thorpe, 1893)
Family: Hexarthridae
157. Hexarthra mira (Hudson, 1871)
Family: Testudinellidae
158. Pompholyx sulcata Hudson, 1885
159. Testudinella amphora Hauer, 1938 **
160. 7: dendradena de Beauchamp, 1955 **
161. T. brevicaudata Yamamoto, 1851 **
162. T. emarginula (Stenroos, 1898)
163. T. greeni Koste, 1981 **
164. T. parva (Ternetz, 1892) **
165. T. patina (Hermann, 1783)
166. T. tridentata Smirnov, 1931 **
Family: Trochosphaeridae
167. Filinia camasecla Myers, 1938 **
168. F longiseta (Ehrenberg, 1834)
169. F opoliensis (Zacharias, 1898)
Order. Collothecaceae
Family: Collothecidae
170. Collotheca ornata (Ehrenberg, 1832) **
Subclass: Bdelloidea
Order: Philodinida
Family: Philodinidae
171. Dissotrocha aculeata (Ehrenberg, 1832)
172. Rotaria neptunia (Ehrenberg, 1832)
# New record from India; * new record from northeast
India (NEI); ** new record from Arunachal Pradesh
Bonn zoological Bulletin 68 (1): 1-12
Water temperature of the sampled water bodies ranged
between 8—23 °C, pH ranged between 5.3—7.4 and specif-
ic conductivity varied between 18.5—89.7 uS/cm.
Brachionus lyratus (Fig. 2A), Lecane_ stichoclysta
(Fig. 2B) and Trichocerca mus (Fig. 2C) are new records
from India. Brachionus dimidiatus (Fig. 2D), Keratella
ticinensis (Fig. 2E) and Notholca acuminata (Fig. 2F)
and N. /abis (Fig. 2G) are new records from northeast
India (NEI), and 89 species (marked by **) are additions
to the rotifer fauna of Arunachal Pradesh. Various other
interesting species observed in our collections include
Brachionus dichotomus reductus (Fig. 2H), B. murphyi
(Fig. 21), Cephalodella trigona, (Fig. 3A), Keratella ed-
mondsoni (Fig. 3B), K. javana (Fig. 3C), K. serrulata
(Fig. 3D), Lecane blachei (Fig. 3E), L. lateralis (Fig. 3F),
L. niwati (Fig. 3G), L. superaculeata (Fig. 3H), Lep-
adella discoidea (Fig. 31), L. vandenbrandei (Fig. 35),
Macrochaetus danneelae (Fig. 4A), Notholca squamula
(Fig. 4B), Zestudinella amphora (Fig. 4C), T. brevicau-
data (Fig. 4D), 7: greeni (Fig. 4E), Trichocerca edmond-
soni (Fig. 4F), T. hollaerti (Fig. 4G), T. maior (Fig. 4H),
and 7? uncinata. Lecane (Lecanidae) indicates 45 spe-
cies; Brachionidae records 33 species with 17 species of
Brachionus, Colurellidae (23 species) includes 18 spe-
cies of Lepadella, Trichocerca (Trichocercidae) indicates
19 species while Keratella and Testudinella include eight
species each.
DISCUSSION
The water bodies of Arunachal Pradesh depict “sub-trop-
ical to temperate’ nature concurrent with their altitudi-
nal locations and are characterized by ‘slightly acidic—
circum neutral—slightly alkaline waters’ while specific
conductivity highlights general ‘soft-water nature with
distinctly low ionic concentrations’. The last feature war-
rants inclusion of the sampled lentic ecosystems under
‘Class I’ category of trophic classification vides Talling
& Talling (1965).
The present report of total richness (S) of 172 Rotifera
species from Arunachal Pradesh, belonging to 39 genera
and 19 families, comprises ~59% and ~40% of the spe-
cies of the phylum known till date from NEI and India, re-
spectively. The biodiverse rotifer assemblage is hypoth-
esized to function of habitat heterogeneity of small lentic
biotopes of this hill state located under varied ecological
regimes and also to certain extent to the ‘rotiferologist ef-
fect’ vide Fontaneto et al. (2012) though we are aware of
the sampling limitations. The results endorse our hypoth-
esis on importance of small lentic environs as one of the
rotifer diverse habitats (Sharma & Kensibo 2017; Sharma
et al. 2017) of the Indian sub-region. This study marks
a significant increase (~126%) of the rotifer tally of the
eastern Himalayas than 76 species recorded by Sharma
& Sharma (2014a) but is contrastingly higher than 24
©ZFMK
The biodiverse rotifer assemblages (Rotifera: Eurotatoria) of Arunachal Pradesh, the eastern Himalayas 9
and 45 species listed by Chandra et al. (2018) and Sinha
(2018), respectively. Our results record richer alpha di-
versity than 162 (Sharma & Sharma 2015), 161 (Sharma
unpublished) and 150 (Sharma et al. 2017) rotifer species
known from hill states of NEI namely Mizoram, Megha-
laya and Nagaland, respectively. On the other hand, the
richness is relatively lower than 189 species observed
from the floodplain wetlands of Manipur (Sharma &
Sharma 2018a) state of NEI. The rotifer species exam-
ined from the eastern Himalayas register higher affini-
ty (83.8% community similarity vide Sorenson’s index)
with the fauna of adjacent hill state of Nagaland; these
indicate 71.0% and 74.8% similarities with the faunas
of Manipur and Mizoram, respectively but records more
divergence in species composition (66.7% similarity)
than the rotifers known from Meghalaya. We caution on
the stated comparisons in view of our yet limited collec-
tions particularly from the higher altitudes of Arunachal
Pradesh. Further, our report from the eastern Himalayas
though concurs with 173 species known from Jammu
& Kashmir state of the western Himalayas (Sharma &
Sharma 2018b) but is characterized by only 53.3% com-
munity similarity (vide Sorenson’s index) thus reflecting
notable divergence in species composition than the latter.
Brachionus lyratus, Lecane stichoclysta and Trichocer-
ca mus are new records from the Indian sub-region; these
species are known elsewhere from the Oriental region
from Thailand (Sa-Ardrit et al. 2013). Brachionus lyra-
tus, described from Australia, resembles with B. angularis
but 1s differentiated from the latter by its short foot-open-
ing flanked by blunt spines. We opine wider distribution
of the former brachionid in India because of its likely
over-looking as B. angularis. L. stichoclysta, described
from Oguta Lake of Nigeria (Segers 1993), is diagnosed
by completely separated claws, nearly square and cov-
ered foot pseudosegment, and relatively short toes. Be-
sides, 7’ mus, originally described from Indonesia, is now
categorized as thermophilic pan (sub) tropical species
vide Segers (2003).
Brachionus dimidiatus, Keratella_ticinensis, Not-
holca acuminata and N. labis are new records from
NEI. B. dimidiatus is validly known from India from
Delhi (Sarma, 1988) while we consider its report from
Rajasthan (Nayar 1968) as unverifiable due to lack of
any validation. K. ticinensis 1s examined from Dal Lake
(Kashmir) by Sarma (1988) while its other un-authenti-
cated Indian reports are categorized as dubious (Sharma
& Sharma 2014b). N. acuminata is listed from Jammu &
Kashmir (Sharma & Sharma 2018b) but without any val-
idation while its indiscriminate reports elsewhere from
India are considered dubious (Sharma & Sharma 201 4b).
N. labis is known from Yamuna River, Delhi (Sarma
1988; Arora & Mehra 2003). The present report of these
four brachionid species extends their distribution to the
eastern Himalayas. In addition, our study adds 89 species
as new records to the rotifer fauna of Arunachal Pradesh
Bonn zoological Bulletin 68 (1): 1-12
and thus marks significant update to Rotifera biodiversity
of the eastern Himalayas.
Our collections from Arunachal Pradesh indicate 27
species (~15.7% of S) of global biogeographic impor-
tance. These include the Australasian Brachionus dichot-
omus reductus, B. lyratus and Macrochaetus danneelae;
the Oriental endemics Brachionus murphyi, Keratella
edmondsoni, Filinia camasecla, Lecane blachei, L. ni-
wati and L. superaculeata, the Indo-Chinese Lecane do-
rysimilis, the Paleotropical Keratella javana, Lepadella
discoidea, L. vandenbrandei, Lecane lateralis, L. sticho-
clysta, L. unguitata, Testudinella brevicaudata, T: gree-
ni and Trichocerca hollaerti;, the Holarctic Trichocerca
uncinata, and seven other species with restricted glob-
al occurrence namely Brachionus kostei, Cephalodella
trigona, Notholca acuminata, N. labis, Trichocerca ed-
mondsoni, T: maior, and Testudinella amphora. Overall
richness of the globally notable elements outnumbers
the reports of such taxa from the states of Meghalaya,
Mizoram, Nagaland and Tripura of NEI (Sharma & Shar-
ma 2014a, 2017) and elsewhere from India (Sharma &
Sharma 2017). Interestingly, 25 species (~14% of S)
namely Brachionus kostei, B. lyratus, B. murphyi, Ceph-
alodella trigona, Keratella javana, Lecane aeganea, L
dorysimilis, L. niwati, L. rhenana, L. rhytida, L. sticho-
clysta, Macrochaetus danneelae, Mytilina michelangellii,
L. superaculeata, Lepadella benjamini, L. vandenbrandei,
Testudinella amphora, T: brevicaudata, T: dendrade-
na, T. tridentata, Trichocerca edmondsoni, T. hollaer-
ti, T. maior, T: mus and T. uncinata are notable for their
Indian distribution restricted till date exclusively to NEI
(Sharma & Sharma 2017). The species of the two catego-
ries impart global and regional biogeographic interest to
the rotifer fauna of Arunachal Pradesh. The regional im-
portance of the eastern Himalayan Rotifera is augmented
by occurrence of more species of restricted distribution
in India 1.e., Brachionus bennini, Colurella adriatica,
Keratella serrulata, Lepadella costatoides, L. dactylise-
ta, L. quinquecostata, Lecane bifurca, L elegans, L. hal-
iclysta, L. hastata, L. paxiana, L. pusilla, Trichocerca
bidens, T: insignis, T. stylata, T: tigris, Testudinella parva,
Platyias leloupi, and Wolga spinifera. We attribute siz-
able fractions of species of biogeographic interest in the
eastern Himalayas to the fact that our collections largely
covered the localities from the lower and middle altitudes
from the districts adjoining the state of Assam of NEI. The
latter itself assumes interest as ‘the Assam-gateway’ — an
important phase in the biogeographic evolution of India
and a vital corridor that facilitated extensive interchang-
es between the Indian and Asian biota (Mani 1974), thus
changing the modern biotic composition of the epigean
ecosystems of India (Ranga Reddy 2013).
Lecanidae > Brachionidae > Lepadellidae > Trichocer-
cidae collectively comprise ~71% of the rotifers species
of Arunachal Pradesh. The dominance pattern concurs
with that of the Indian Rotifera (Sharma & Sharma 2017)
©ZFMK
10 Bhushan Kumar Sharma & Sumita Sharma
but differs from the composition of NEI rotifers partic-
ularly with regards Brachionidae. The latter is interest-
ingly notable for the highest richness (33 species) known
from any state of India which even exceeds our report
of maximum diversity of 32 species from Assam state
of NEI (Sharma & Sharma 2014b). In fact, our collec-
tions indicate ~72% and ~92% of the brachionid species
known till date from India and NEI, respectively. This
feature is attributed to Brachionus richness (17 species),
the record number of eight species of Kerate/la out of 11
species of the brachionid genus known from India (Shar-
ma & Sharma 2014b) and three species of Notholca.
Overall richness importance of Brachionidae as well as
Brachionus spp. marks a salient departure than the rela-
tive paucity of these taxa indicated from the states of Me-
ghalaya (Sharma & Sharma 1999; Sharma unpublished),
Mizoram (Sharma & Sharma 2015), Nagaland (Sharma
et al. 2017) and Manipur (Sharma & Sharma 2018) of
NEI.
Lecane (45 species) > Trichocerca (19 species) >
Lepadella (18 species) are species-rich genera while
Brachionus (17 species) also deserves attention. The
collective role of first three genera (~48 % of S) assigns
the littoral-periphytic character to the rotifer fauna of
Arunachal Pradesh. The richness importance of Lecane,
Trichocerca and Lepadella endorses possibility of rules
for composition of the periphytic rotifer assemblages as
hypothesized by Green (2003) and affirmed by the re-
ports of Sharma (2014), Sharma & Sharma (2014a, 2015,
2017, 2018) and Sharma et al. (2018). The richness of
Testudinella, Colurella, Cephalodella and Mytilina, and
even several non-planktonic brachionids as well as the
paucity of the planktonic genera Hexarthra and Filinia,
and lack of Conochilus species in particular endorse our
remarks on the littoral-periphytic nature of Rotifera of
Arunachal Pradesh. The rotifer fauna indicates a number
of small-sized species of Colurella, Lecane, Lepadella
and Trichocerca concurrent with the reports of Sharma
(2005, 2014), Sharma & Sharma (2014a, 2015, 2018a,
2018b); this feature is hypothesized to predation influ-
ence of juvenile fish and invertebrates (Baumgartner et
al. 1997). Though morphological variability is inherent
in all natural populations of metazoans, the extant of
variations noted in Brachionus angularis, B. bidentatus,
B. caudatus, Lecane bulla, L. curvicornis, L. hamata,
L. leontina, L. luna, L. lunaris, L. ludwigii, L. papuana,
L. quadridentata, L. signifera, L. unguitata, L. ungulata,
Lepadella costatoides, L. ovalis, L. patella, Testudinella
emarginula, T: patina, T: tridentata and Plationus patulus
populations from Arunachal Pradesh needs attention for
cryptic diversity analysis.
Segers (2001) remarked on the role of thermophiles
in the rotifer fauna of Southeast Asia while Sharma &
Sharma (2005, 2008, 2014a, 2015, 2017, 2018a) extend-
ed this generalization to the rotifer assemblages of India.
Our collections from Arunachal Pradesh highlight overall
Bonn zoological Bulletin 68 (1): 1-12
importance of species of the ‘tropic-centered’ Lecane and
Brachionus and particularly in water bodies at lower al-
titudes, while species of ‘temperate-centered’ Keratella,
Notholca and Synchaeta are notable in collections from
middle and higher altitudes with the notable reports of
‘cold-water’ K. serrulata, Notholca acuminata, N. labis
and N. squamula in particular from the eastern Himala-
yas. Intensive future collections from middle and high-
er reaches of Arunachal Pradesh are likely to add more
species of the second category. The rotifer fauna of the
eastern Himalayas shows a combination of ‘tropical’ and
‘cold-water’ elements and thus marks a distinct departure
from other states of NEI (Sharma & Sharma 2014a, 2015,
2017) except the Sikkim Himalayas which is yet nearly
un-explored. Further, cosmopolitan species form a notable
fraction (~64%) of the rotifer assemblages in our collec-
tions while tropical and subtropical species comprise 18%
of total richness; overall importance of the stated taxa en-
dorses the reports of Sharma & Sharma (2014a, 2017).
To sum up, the rich and diverse Rotifera assemblage
of the eastern Himalayas observed vide this study is hy-
pothesized to function of habitat heterogeneity which, in
turn, highlights overall biodiverse nature of small lentic
biotopes of Arunachal Pradesh located under different
ecological regimes. The reports of several new records;
notable fraction of species of global and regional bio-
geographic interest, the littoral-periphytic nature of the
rotifer fauna, several small-sized species, the mixture of
‘tropical and temperate’ elements, and high richness of
Brachionidae elements are notable features. This study
marks a significant contribution to biodiversity and bio-
geography of the Indian and Asian Rotifera and that of
the eastern Himalayas in particular. Our collections are
yet biased towards planktonic and semi-planktonic taxa
and thus specific analysis of sessile, colonial and benthic
taxa, and of cryptic diversity in certain species-groups
merit interest for future Rotifera biodiversity update of
the eastern Himalayas.
Acknowledgements. The senior author (BKS) is thankful to
the Ministry of Environment & Forests (Govt. of India) for AI-
COPTAX research project which facilitated the sampling, and to
Messer’s J. Mali and N. Noroh for the field collections. Thanks
are due to the Head, Department of Zoology, North-Eastern
Hill University, Shillong for laboratory facilities. We thank
our anonymous peers for valuable comments and Dr. Bernhard
Huber (Bonn zoological Bulletin) for useful suggestions during
the peer review. The authors have no conflict of interests.
REFERENCES
Arora J, Mehra NK (2003) Species diversity of planktonic and
epiphytic rotifers in the backwaters of the Delhi segment of
the Yamuna River, with remarks on new records from India.
Zoological Studies 42 (2): 239-247
Baumgartner G, Nakataki KM, Cavicchiolo M, Baugartner
MS (1997) Some aspects of the ecology of fish larvae in the
©ZFMK
The biodiverse rotifer assemblages (Rotifera: Eurotatoria) of Arunachal Pradesh, the eastern Himalayas 1]
floodplain of the high Parana river, Brazil. Review Brazilian
Zoology 14: 551-563
Chandra K, Gopi KC, Rao DV, Valarmathi K, Alfred JRB (eds)
(2018) Current status of freshwater faunal diversity in India.
Zoological Survey of India, Kolkata
Fontaneto D, Marcia Barbosa A, Segers H, Pautasso M (2012)
The ‘rotiferologist’ effect and the other global correlates of
species richness in rotifers. Ecography 35: 174-182
Green J (2003) Associations of planktonic and periphytic roti-
fers in a tropical swamp, the Okavango Delta, Southern A fri-
ca. Hydrobiologia 490: 197—209
Jersabek CD, Leitner MF (2013) The Rotifer World Catalog.
World Wide Web electronic publication. http://www.rotifera.
hausdernatur.at/accessed {17.07.2018}
Koste W (1978) Rotatoria. Die Radertiere Mitteleuropas, be-
griindet von Max Voigt. Uberordnung Monogononta. Gebrii-
der Borntaeger, Berlin, Stuttgart. I. 673 pp U. II. Tafelbd. (T.
234)
Koste W, Shiel RJ (1987) Rotifera from Australian inland
waters. II. Epiphanidae and Brachionidae (Rotifera: Mono-
gononta). Invertebrate Taxonomy 7: 949-1021
Koste W, Shiel RJ (1989) Rotifera from Australian inland wa-
ters. IV. Colurellidae (Rotifera: Monogononta). Transactions
of the Royal Society of South Australia 113: 119-143
Koste W, Shiel RJ (1990) Rotifera from Australian inland wa-
ters V. Lecanidae (Rotifera: Monogononta). Transactions of
the Royal Society of South Australia 114 (1): 1-36
Mani MS (1974) Biogeographical evolution in India, In: Mani
MS (ed.) Ecology and Biogeography in India. Dr. W. Junk
b.v. Publishers, The Hague. pp. 698—724
Nayar CKG (1968) Rotifers fauna of Rajasthan, India. Hydro-
biologia 31 (2): 168-185
Ranga Reddy Y (2013) Neodiaptomus prateek n. sp., a new
freshwater copepod from Assam, India, with critical review
of generic assignment of Neodiaptomus spp. and a note on di-
aptomid species richness (Calanoida: Diaptomidae). Journal
of Crustacean Biology 33 (6): 849-865
Sa-Ardrit P. Pholpunthin P. Segers H (2013) A checklist of the
freshwater rotifer fauna of Thailand (Rotifera, Monogononta,
Bdelloidea). Journal of Limnology 72 (2): 361-375
Sarma SSS (1988) New records of fresh water rotifers (Rotif-
era) from Indian waters. Hydrobiologia 160: 263-269
Segers H (1993) Rotifera of some lakes in the floodplain of the
river Niger (Imo State, Nigeria). I. New species and other
taxonomic considerations. Hydrobiologia 250: 39-61
Segers H (1995) Rotifera 2: Lecanidae. 6. pp: 1-226. In: Du-
mont HJ, Nogrady T (eds) Guides to identification of the Mi-
croinvertebrates of the Continental waters of the world. SPB
Academic Publishing. Amsterdam, the Netherlands.
Segers H (2001) Zoogeography of the Southeast Asian Rotifera.
Hydrobiologia 446/447: 233-246
Segers H (2003) A biogeographical analysis of rotifers of the ge-
nus Trichocerca Lamarck, 1801 (Trichocercidae, Monogon-
onta, Rotifera), with notes on taxonomy. Hydrobiologia 500:
103-114
Segers H (2007) Annotated checklist of the rotifers (Phylum
Rotifera), with notes on nomenclature, taxonomy and distri-
bution. Zootaxa 1564: 1-104
Sharma BK (1983) The Indian species of the genus Brachionus
(Eurotatoria: Monogononta: Brachionidae). Hydrobiologia
104: 31-39
Sharma BK (1987) Indian Brachionidae (Eurotatoria: Mono-
gononta) and their distribution. Hydrobiologia 144: 269-275
Bonn zoological Bulletin 68 (1): 1-12
Sharma BK (1998) Freshwater Rotifers (Rotifera: Eurotatoria).
In: Fauna of West Bengal. State Fauna Series 3 (11): 341-
461. Zoological Survey of India, Calcutta.
Sharma BK (2005) Rotifer communities of floodplain lakes of
the Brahmaputra basin of lower Assam (N. E. India): biodi-
versity, distribution and ecology. Hydrobiologia 533: 209-—
pA
Sharma BK (2014) Rotifers (Rotifera: Eurotatoria) from wet-
lands of Majuli — the largest river island, the Brahmaputra
river basin of upper Assam, northeast India. Check List 10
(2): 292-298
Sharma BK, Khan SI, Sharma S (2018) Biodiverse rotifer as-
semblage (Rotifera: Eurotatoria) of floodplain lakes of the
Brahmaputra basin of lower Assam, northeast India: compo-
sition and ecosystem diversity. Journal of Oceanology and
Limnology 36 (2): 362-375
Sharma BK, Kensibo (2017) Rotifer assemblages (Rotifera:
Eurotatoria) of two wetlands of Nagaland, northeast India:
ecosystem diversity and interesting features. International
Journal of Fisheries and Aquatic Studies 5 (2): 609-617
Sharma BK, Kensibo, Sharma S (2017) Biodiversity of roti-
fers (Rotifera: Eurotatoria) of Nagaland, northeast India;
richness, composition and ecosystem diversity. International
Journal of Fisheries and Aquatic Studies 5 (5): 180-187
Sharma BK, Raghunathan C, Sharma S (2017) Rich freshwater
Rotifer (Rotifera: Eurotatoria) fauna of small lentic ecosys-
tems of south Andaman, India. Opuscula Zoologica, Buda-
pest 48 (2): 185-192
Sharma BK, Sharma S (1999) Freshwater Rotifers (Rotifera:
Eurotatoria). In: Fauna of Meghalaya. State Fauna Series
4(9): 11-161. Zoological Survey of India, Calcutta
Sharma BK, Sharma S (2000). Freshwater Rotifers (Rotifera:
Eurotatoria). In: Fauna of Tripura: State Fauna Series 7 (4):
163-224. Zoological Survey of India, Calcutta
Sharma BK, Sharma S (2005) Biodiversity of freshwater roti-
fers (Rotifera: Eurotatoria) from North-Eastern India. Mit-
teilungen aus dem Museum fiir Naturkunde Berlin, Zoolo-
gische Reihe 81: 81-88
Sharma BK, Sharma S (2014a) Northeast India — An important
region with a rich biodiversity of Rotifera. In: Sharma BK,
Dumont HJ, Wallace RL (eds) Rotifera XII: Rotifer Biology
— A structural and functional Approach. International Review
of Hydrobiology 99 (1-2): 20-37
Sharma BK, Sharma S (2014b) The diversity of Indian Bra-
chionidae (Rotifera: Eurotatoria: Monogononta) and their
distribution Opuscula Zoologica, Budapest 45(2):165—180
Sharma BK, Sharma S (2015) Biodiversity of freshwater ro-
tifers (Rotifera: Eurotatoria) of Mizoram, Northeast India:
composition, new records and interesting features. Interna-
tional Journal of Aquatic Biology 3 (5): 301-313
Sharma BK, Sharma S (2017) Rotifera: Eurotatoria (Rotifers).
Chapter 7: 93-113. In: Kailash Chandra, Gopi KC, Rao DV,
Valarmathi K, Alfred JRB (eds) Current status of freshwater
faunal diversity in India. Zoological Survey of India, Kolkata
Sharma BK, Sharma S (2018a) Loktak Lake, Manipur revisited:
A Ramsar site as the rotifer (Rotifera: Eurotatoria) biodiver-
sity hot-spot of the Indian sub-region. Bonn zoological Bul-
letin 67 (1): 5-13.
Sharma BK, Sharma S (2018b) The rotifers (Rotifera: Eurota-
toria) from the Kashmir Himalayan floodplains and Rotifera
biodiversity of Jammu & Kashmir, north India. International
Journal of Aquatic Biology 6 (4): 208-220.
Sharma S, Sharma BK (2008) Zooplankton diversity in flood-
plain lakes of Assam. Records of the Zoological Survey of In-
dia, Occasional Paper No. 290: 1-307
©ZFMK
12 Bhushan Kumar Sharma & Sumita Sharma
Sharma S, Sharma BK (2013) Faunal diversity of aquatic in-
vertebrates of Deepor Beel (a Ramsar site), Assam, northeast
India. Wetland Ecosystem Series, 17: 1-226
Shiel RJ, Koste W (1992) Rotifera from Australian inland wa-
ters VIII. Trichocercidae (Monogononta). Transactions of
Royal Society of South Australia 116 (1): 1-27
Shiel RJ, Koste W (1993) Rotifera from Australian inland wa-
ters. IX. Gastropodidae, Synchaetidae, Asplanchnidae (Roti-
fera: Monogononta). Transactions of Royal Society of South
Australia 117 (1): 111-139
Bonn zoological Bulletin 68 (1): 1-12
Sinha B (2018) Status of studies on zooplankton fauna of
Arunachal Pradesh, India. Journal of Threatened Taxa 10
(11): 12552-12560
Sorensen T (1948) A method of establishing group of equal am-
plitude in plant sociology based on similarity of species con-
tent and its application to analyse the vegetation of Danish
Commons. Biologiske Skrifter 5: 1-34
Talling JF, Talling IB (1965) The chemical composition of Af-
rican lake waters. Internationale Revue der gesamten Hydro-
biologie 50: 421-463
©ZFMK
Bonn zoological Bulletin 68 (1): 13-19
2019 - Ntoungwa Ebague G.M. et al.
https://doi.org/10.20363/BZB-2019.68.1.013
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org:pub: D3C8DAAF-4F7A-4BB4-97A 1 -384C6E3D889D
Terrestrial small mammal assemblage from pellets of three sympatric owl
species in the Mount Oku area (Northwest Cameroon), with implications for
conservation
Guy Martial Ntoungwa Ebague’, Alain Didier Missoup”*, Ernest Keming Chung’,
Maurice Tindo* & Christiane Denys*
' 2.4 Zoology Unit, Laboratory of Biology and Physiology of Animal Organisms, Faculty of Science, University of Douala,
POBox 24157 Douala, Cameroon
3Kilum-Ijim Forest Project, PO Box: 119, Kumbo, Cameroon
> Institut de Systématique, Evolution, Biodiversité, ISYEB —UMR 7205 — CNRS, MNHN, UPMC, EPHE,
Muséum National d’Histoire Naturelle, Sorbonne Universités, F-Paris, France
* Corresponding author: Email: [email protected], ORCID: http://orcid.org/0000-0002-3018-9188
'urn:Isid:zoobank. org: author: 80FEO7CD-3F95-47C7-8B4B-A A7C5D03AC64
7urn:|sid:zoobank. org:author:946A07D5-4A F2-453A-A579-7D22D0092E3B
>urn:lsid:zoobank. org:author:27FD377D-34EC-4634-A 5 10-DF279254191C
“urn:|sid:zoobank.org:author:4BF 1 8523-4634-4A 8D-A8CF-2A4A A 85DBD33
>urn:|sid:zoobank.org:author:FCD37439-1E9D-4FD2-A 845-E311603D45EF
Abstract. Mount Oku is well known for its exceptional species diversity for both animals and plants. A total number of
27 species of rodents and six species of shrews are reported from the area. Ten of these species are endemic at local or
regional level and are considered as endangered or vulnerable, with a decreasing population trend. They are thus conside-
red as having a high conservation importance. We sampled terrestrial small mammals from owl pellets during a period of
22 months in different areas near the village Oku, in order to assess the importance of these taxa in the diet of owl species
present in the area. The 236 pellets attributed to three sympatric owl species (Barn owl, Tyto alba, the African wood owl,
Strix woodfordii, Northern white-faced owl, Ptilopsis leucotis), yielded a total number of 543 specimens of rodents and
shrews, belonging to 22 species (16 species of rodents and six species of shrews). They represented respectively 69.06%
and 30.94% of the total assemblage, the species Dasymys sp., with a final score of 18.23%, having the highest relative
abundance. Of the ten species with a high conservation importance, only Lemniscomys mittendorfi was missing. All
constituted about 27.62% of all specimens collected, with a relative abundance of 4.23% for species strictly restricted to
Mount Oku. This study confirms the position of Mount Oku as an important conservation area for rodents and shrews,
and highlights the evidence that terrestrial small mammal predation by owls cannot be considered a threat to species of
conservation concern at Mount Oku.
Key words. Mount Oku, owl pellets, rodents, shrews, owls, conservation.
INTRODUCTION
The montane forests of the Cameroon Highlands’ re-
gion are considered as priority conservation areas at a
global scale (Oates et al. 2004) and are one of the most
important centres of endemism on the African continent
(Zimkus & Gvozdik 2013). The Kilum-Ijim forest in the
massif of Mount Oku (3100 m asl), the second highest
mountain after Mount Cameroon, is relatively well-stud-
ied for many taxa including animals and plants (Cheek
et al. 2000; Doherty-Bones & Gvozdik 2017; Ineich et
al. 2015; Momo 2017). It represents the largest remain-
ing part of afromontane forest in West Africa (Cheek et
al. 2000). Several studies have been carried out on small
mammals of Mount Oku, most of them using trapping
Received: 15.01.2019
Accepted: 24.01.2019
methods, which enabled the publication of an updated list
of 27 species of rodents (24 terrestrial and three arboreal)
and six species of shrews (Maisels et al. 2001; Denys et
al. 2014).
It has been recently demonstrated that the use of owl
pellets is amore effective alternative to conventional trap-
ping for broad-scale studies of small mammals’ commu-
nities (Heisler et al. 2016). However, very little attention
has been focussed on the study of small mammal commu-
nities using owl pellets in tropical Africa. Indeed, most
of data available are from the northern part of the conti-
nent, mainly from the country Algeria (Baziz et al. 2002,
2005; Sekour et al. 2010, 2011, 2014; Alia et al. 2012;
Hadjoudj et al. 2012; Idouhar-Saadi et al. 2014; Tergou
et al. 2014; Souttou et al. 2015; Bounaceur et al. 2016;
Corresponding editor: J. Decher
Published: 30.01.2019
14 Guy Martial Ntoungwa Ebague et al.
Djilali et al. 2016; Ouarab & Doumandyji 2017); few are
from Morocco (Rihane et al. 2015), Tunisia (Leonardi &
Del-Arte 2006) and Egypt (Sandor & Moldovan 2012).
For tropical Africa, some studies were made in the South
African region, including the countries Malawi (Hap-
pold & Happold 1986; Ngonda 1991; Denys et al. 1999),
Botswana (Denys 1985) and South Africa (Grindley et al.
1973; Dean & Dowsett 1986; Mendelsohn 1989; Avery
1992; Avery et al. 2005). The few data available for West
Africa are mainly from Senegal (Ba et al. 2000; Thiam
et al. 2008), Mauritania (Bruderer & Denys 1999) and
Nigeria (Lekunze et al. 2001). Previous works in the East
African region include the two countries Ethiopia (De-
meter 1982) and Tanzania (Andrews 1990). In Central
Africa, only one study from the area of Bambilli (NW
Cameroon), based on the diet of the African grass owl
(Tyto capensis) and the spotted eagle owl (Bubo afri-
canus) is known from the literature (Riegert et al. 2007).
However, Denys et al. (2014) used owl pellets collected
by O. Filling in 1990 and 1991 in the lake Oku cave
and for the first time verified the presence of Mylomys
dybowskii at Oku.
Of the 27 species of rodents reported from Mount Oku
(Denys et al. 2014), four are known as strictly endem-
ic (Lamottemys okuensis, Hylomyscus grandis, Lophu-
romys dieterleni and Lemniscomys mittendorfi) to the
mountain, and three others (Praomys hartwigi, Hybomys
eisentrauti and Otomys occidentalis) have a distribu-
tion range that is limited to the Banso-Bamenda High-
lands. Two of the six species of shrews reported from
Oku (Myosorex okuensis and Sylvisorex camerunensis)
6,25321 N
o study area
Fig. 1. Map showing the location of the study area.
Bonn zoological Bulletin 68 (1): 13-19
are restricted to the Banso-Bamenda Highlands and one
(Sy/visorex isabella) extends to the southern part of Cam-
eroon Highlands in Bioko. All these species are consid-
ered as endangered or vulnerable on the IUCN Red List,
with a decreasing population trend (IUCN 2016). Mount
Oku is thus an important area for the conservation of ter-
restrial small mammals. The effect of owl predation on
small mammal populations’ abundance has already been
reported and their importance in rodent pest species man-
agement has been repeatedly highlighted (Baleiauskiene
2005; Previtali et al. 2009; Sekour et al. 2014), suggest-
ing a possible influence on rodent population dynamics
at the local level. From 2015 to 2016 we conducted op-
portunistic sampling of pellets in areas near the village
Oku, from 2000 up to 2900 m asl, in order to assess the
importance of species with high conservation value in the
diet of owl species present in the area. This paper reports
data on small mammal assemblages sampled from three
owl species (Barn owl, Zyto alba, the African wood owl,
Strix woodfordii, and the Northern white-faced owl, Pti-
lopsis leucotis), with an emphasis on the conservation of
rodent species endemic to Mount Oku or to the whole
Banso-Bamenda Highland region.
MATERIAL & METHODS
Study area
Belonging to Banso-Bamenda Highlands within the
Cameroon Highlands’ region, Mount Oku (Fig. 1) is
- Oku village
Kilum-ljim forest
Lake Oku
©ZFMK
Terrestrial small mammal assemblage from pellets of three sympatric owl species in the Mount Oku area (NW Cameroon) 15
covered by a small montane forest, the Kilum Ijim forest
massif which extends from 2200 m to 2800 m asl (Mais-
els et al. 2001). It is dominated by Carapa grandiflora
(Meliaceae), Nuxia congesta (Loganiaceae), Syzygium
staudtii (Myrtaceae) and Arundinaria alpina (Poaceae).
An afroalpine vegetation is found from 2800 m up to the
summit (3011 m), and mostly constitutes of the grass
species Gnidia glauca, Hypericum revolutum and Erica
mannii (Momo 2017). Lower altitudes (below 2200 m
asl) are widely used for agriculture. The Oku village is
situated at about 2000 m asl in Mount Oku, close to the
Kilum forest. Mount Oku is dominated by equatorial
climate, characterised by a wet season of seven to eight
months and a dry season of four to five months; months
of August and March being respectively the most wet
and dry. The average annual rainfall is about 2427 mm
and the temperature ranges between about 10 °C and
25-28 °C (Forboseh & Ikfuingei 2001).
Owl pellet sampling
From March 2015 to December 2016, opportunistic
sampling of pellets (97 complete and about 139 dam-
aged) was done in different habitats near the village Oku
(6°24’ N—10°50’ E), including montane forests, montane
grasslands and crop plantations. The sampling was done
between 2000 m and 2900 m asl. On each occasion, the
samples collected were kept together in a dry plastic bag.
They were later attributed to three owl species known
from the area, the Barn owl (7yto alba), the African wood
owl (Strix woodfordii), and the Northern white-faced owl
(Ptilopsis leucotis), based on direct observations and
feather remains, following the field guide by Borrow &
Demey (2008).
Owl pellet treatment and small mammal species iden-
tification
In the laboratory, each pellet was softened in hot wa-
ter during five to ten minutes and disinfected later in a
10% diluted solution of chlorinated water. Pellets were
then opened and the bones were cleaned using a pair of
forceps. After rinsing with water and drying, skulls and
other remaining bones were placed in separate tubes for
further observations.
Species identifications of rodents and shrews were
mostly based on the mandibles, the upper molar row
and skull morphology, following the criteria provided
in Denys et al. (2014) as well as reference collections
housed at the MNHN. We also followed identification
keys of Monadjem et al. (2015). For shrews, we also
used cranio-dental characters, and followed character
descriptions reported in Heim de Balsac (1968, 1975),
Meester & Setzer (1971) and Hutterer & Happold (1983).
In two cases (rodents and shrews), morphological char-
acters of teeth were checked by using a Pierron® binocu-
Bonn zoological Bulletin 68 (1): 13-19
lar magnifier at 10x. All specimens are currently housed
at the Zoology Unit of the Laboratory of Biology and
Physiology of Animal Organisms, Faculty of Science,
University Douala.
Small mammal relative abundance estimates
As skulls were not present in all pellets collected, the
total number of small mammals was estimated in each
pellet based on a tally of paired mandibles as proposed
by Bueno & Motta-Junior (2008). After pairing, unpaired
mandibles were counted as additional individuals. The
same approach was also used to evaluate the total num-
ber of individuals in the whole sample, and finally for an
estimation of the relative abundance.
RESULTS
The entire sample examined yielded a total number of
543 specimens of rodents (Order Rodentia) and shrews
(Order Soricomorpha), belonging to 22 species, 18 gen-
era and three families (Table 1). Rodents were repre-
sented by 16 species from 14 genera and two families.
Shrews included six species belonging to four genera
and one family. Rodents represented 69.06% of the small
mammal assemblage, while shrews constituted 30.94%
of the entire sample. The Shaggy rat (Dasymys sp.) was
the most abundant species found (18.23%), followed by
the Hun shrew (Crocidura attila Dollman, 1915), with
12.34% of the total assemblage. The less represented
species of our sample were the Mount Oku Hylomyscus,
Hylomyscus grandis Eisentraut, 1969 (0.55%), the Roof
rat, Rattus rattus (Linnaeus, 1758) and the Mount Oku
rat, Lamottemys okuensis Petter, 1986 (each with 1.1 %).
Of the ten species with a high conservation importance,
only one species, Lemniscomys mittendorfi, was missing.
The nine other species represented together a total num-
ber of 150 specimens, out of the 543 individuals counted,
corresponding to a relative abundance of about 27.62%.
From the whole sample, the relative abundance of each
of these species varied from 0.55% (three specimens of
Hylomyscus grandis) to 7.18% (33 individuals of Otomys
occidentalis).
DISCUSSION
With a total number of 236 pellets collected in the study
area, our sample represents important material, which
can help to complement our knowledge on small mam-
mal diversity from the Oku area. Of the 543 specimens
counted from the pellets, 22 species of terrestrial small
mammals, including 16 species of rodents and six spe-
cies of shrews were finally identified. All of these newly
©ZFMK
16 Guy Martial Ntoungwa Ebague et al.
Table 1. Relative abundance (RA) of rodent and shrew species found in owl pellets collected in Oku (N: Number of specimens).
collected species of rodents were previously sampled at
Oku (Eisentraut 1968, 1969; Bowden 1986; Hutterer &
Fulling 1994; Maisels et al. 2001; Denys et al. 2014),
as well as the six species of shrews found in our sample
(Maisels et al. 2001). Of the 24 species of terrestrial ro-
dents reported by Denys et al. (2014), eight were missing
from our sample. Some of these taxa are known by only a
low number of specimens from Oku (H. alleni cf. montis,
H. walterverheyeni, Lemniscomys mittendorfi, Mylomys
dybowskii, Gerbilliscus kempi). The others are members
of genera currently under revision, in which the identi-
fication solely using morphology is not obvious (Gram-
momys sp., L. sikapusi). Moreover, species of the genus
Cricetomys, with a mean weight of 500 grams (Monad-
Bonn zoological Bulletin 68 (1): 13-19
Orders Subfamilies Species N RA
Rodentia Dendromurinae | Dendromus sp. 13- | 2.39
Muridae Deomyinae Lophuromys dieterleni Verheyen, Hulselmans, Colyn & Hut-
terer, 1997 14 | 2.58
Murinae Dasymys sp. 99 | 18.23
Grammomys poensis Eisentraut, 1965 1.47
Hybomys rufocanus (Tulberg, 1893) 1.29
Hylomyscus grandis Eisentraut, 1969 0.55
Lamottemys okuensis Petter, 1986 1.10
Lemniscomys striatus (Linnaeus, 1758) 29 | 5.34
Mastomys sp. 36 | 6.63
Mus musculus Linnaeus, 1758 11 | 2.03
Mus setulosus Peters, 1876 19 | 3.50
Mus sp. 22 | 4.05
Oenomys hypoxanthus Eisentraut, 1968 9 1.66
Otomys occidentalis Dieterlen & Van der Straeten, 1992 39 | 7.18
Praomys hartwigi Eisentraut, 1968 22 | 4.05
Praomys jacksoni (de Winton, 1897) 19 | 3.50
Rattus rattus Linnaeus, 1758 6 1.10
Undetermined murines 13, #2339
Total Rodents 375 | 69.06
Soricomorpha | Soricidae Crocidurinae Crocidura attila Dollman, 1915 67 | 12.34
Crocidura olivieri Lesson, 1827 15 | 2.76
Suncus megalura Jentink, 1888 16! | 2295
Sylvisorex camerunensis Heim de Balsac, 1968 14 | 2.58
Sylvisorex isabellae Heim de Balsac, 1968 10 | 1.84
Myosoricinae | Myosorex okuensis Heim de Balsac, 1968 35 | 6.45
Undetermined shrews 11 | 2.03
Total Shrews 168 | 30.94
Total general 543 | 100
jem et al. 2015) are likely not suitable prey in the diet of
the three species of owls involved tn this study.
The predominance of rodents, compared to shrews, in
small mammal assemblages using owl pellets has been
previously reported from different areas of the African
continent (Demeter 1982; Dean & Dowsett 1986; Men-
delsohn 1989; Ngonda 1991; Riegert et al. 2007; San-
dor & Moldovan 2010; Hadjoudj et al. 2011; Alia et al.,
2012; Sekour et al. 2014; Ouarab & Doumandji 2017).
However, some studies documented the abundance of
birds (Hamani et al. 2011), amphibians (Tergou et al.
2014) or insects (Doumandji et al. 1997). With pellets of
the African grass owl, Riegert et al. (2007) reported more
shrew specimens (about 70.41% of the total prey items),
compared to rodents. Data from other areas also suggest-
©ZFMK
Terrestrial small mammal assemblage from pellets of three sympatric owl species in the Mount Oku area (NW Cameroon) 17
ed an abundance of shrew items in the diet of 7Zyto alba
(Love et al. 2000; Mahmood-Ul-Hassan et al. 2007).
Many studies have highlighted the evidence of a seasonal
variation in the diet composition of different owl species
(Bose & Guidali, 2000; Mahmood-UlI-Hassan et al. 2007;
Sekour et al. 2011). Other works suggested the existence
of a shift in the trophic habits of these birds, depending
on prey availability (Bueno & Motta-Junior 2008; San-
dor & Moldovan, 2010). In this study, we used specimens
collected from pellets from a period of 22 months, sug-
gesting that we report here a general trend in the preda-
tion of small mammals by owls at Oku. In Bambili, less
than 50 km from Oku, Riegert et al. (2007) reported a
dominance of Dasymys (with about 27% of rodent and
shrew samples), Otomys occidentalis (15%) and Masto-
mys sp. (12%) specimens in the diet of the Spotted eagle
owl, which ts very close to our findings.
Our study confirms the presence of nearly all the spe-
cies with a high conservation importance at Oku, except
Lemniscomys mittendorfi. All represented about 27.62%
of the total small mammal assemblage. The three spe-
cies Lamottemys okuensis (1.10%), Hylomyscus grandis
(0.55%) and Lophuromys dieterleni (2.58%), that are re-
stricted to Oku, together constituted only 4.23% of all
the specimens identified. Using both Sherman, snap and
traditional traps, specimens of Lamottemys okuensis rep-
resented about 18.66% of all the rodents trapped (Denys
et al. 2014). Thus, the abundance of this species as re-
vealed by owl pellets is not representative of its popu-
lation size in the study area. Otherwise, from our final
sample of species with high conservation importance, the
three taxa having a high abundance, Otomys occidentalis
(7.18%), Myosorex okuensis (6.45%), Praomys hartwi-
gi (4.05%), are widely distributed in the whole area of
the Banso-Bamenda highlands. Riegert et al. (2007) ob-
tained between 2.0% (Myosorex okuensis) and 11.4%
(Otomys occidentalis) of total prey items in their study.
All these findings together highlight the fact that (1) ter-
restrial small mammal species with high conservation
importance do not constitute the main diet of owl species
in the Oku area, (11) those with a predation rate that can
be considered as relatively high (eg. Otomys occidenta-
lis. from 3.0 to 11.4% depending on the owl species) are
widely distributed in Banso-Bamenda Highlands, sug-
gesting a lower pressure at the level of their entire area
of distribution. In conclusion, terrestrial small mammal
predation by owls cannot be considered a threat to their
conservation at Mount Oku. Many other threats, mainly
relating to high human pressure on natural environments
of Mount Oku have been reported before, with a partic-
ular emphasis on local rodent trapping levels (Denys et
al. 2014; Maisels et al. 2001). With nine of the ten small
mammal species having a high conservation importance,
this study confirms the place of Mount Oku as an import-
ant conservation area for rodents and shrews.
Bonn zoological Bulletin 68 (1): 13-19
Acknowledgments. The authors would like to express their
gratitude to local people of Oku that helped for pellets sampling
during the study period. They are also grateful to authorities of
the University of Douala for the deliverance of a research cer-
tificate to G.M. Ntoungwa Ebague (Ref. LBPOA/05/2015), as
part of its PhD project, and for the specimen transportation cer-
tificate delivered to A.D. Missoup (Ref. LBPOA/01/2018) that
was used to export specimens at the MNHN in Paris in March
2018. The authors would finally like to thank the reviewers who
improved the earlier draft of this manuscript.
REFERENCES
Alia Z, Sekour M, Ould El Hadj MD (2012) Importance des
rongeurs dans le menu trophique de Zyto alba (Scopoli,
1759) dans la région de Souf (Algérie). Revue des BioRes-
sources 2 (2): 37-47
Andrews P (1990) Owl, Caves and Fossils. Natural History
Museum publications, London, 231 pp.
Avery DM (1992) Ecological data on micromammals collect-
ed by Barn owls 7yto alba in the West Coast National Park,
South Africa. Israel Journal of Zoology 38: 385-397
Avery DM, Avery G, Palmer NG (2005) Micromammalian dis-
tribution and abundance in the Western Cape Province, South
Africa, as evidenced by Barn owls 7yto alba (Scopoli). Jour-
nal of Natural History 39 (22): 2047-2071
Ba K, Granjon L, Hutterer R, Duplantier J-M (2000) Les micro-
mammiféres du Djoudj (delta du Sénégal) par l’analyse du
régime alimentaire de la chouette effraie, Zyto alba. Bonner
Zoologische Beitrdge 49: 31-38
Balciauskiené L, Jovaidas A, Narudevieius V, Petradka A, Sku-
ja S (2006) Diet of tawny owl (Strix aluco) and long-eared
owl (Asio otus) in Lithuania as found from pellet. Acta Zoo-
logica Lituanica 16 (1): 37-45
Baziz B, Doumandji S, Denys C, Khemici M (2002) Répartition
en Algérie du Pachyure étrusque Suncus etruscus (Insectivo-
ra, Soricidae). Premiere observation dans le Nord-Est du
Sahara, a Biskra. Mammalia 66: 133-137
Baziz B, Sekour M, Doumandji S, Denys C, Metref S, Bendja-
ballah S, Nadji FZ (2005) Données sur le régime alimentaire
de la Chouette chevéche (Athene noctua) en Algérie. Aves 42
(1-2): 149-157
Bounaceur F, Bissaad FZ, Marniche F, Boutheldja H, Abaiter
N, Khellil K, Saad A (2016) Ecologie trophique du hibou
grand-duc du désert Bubo ascalaphus (Savigny, 1809) dans
la région de I’Ahaggar, sud algérien. Revue Ivoirienne des
Sciences Technologiques 27: 175-189
Borrow N, Demey R (2008) Guide des Oiseaux de I’ Afrique de
l’Ouest. Paris, France.
Bose M, Guidali F (2001) Seasonal and geographic differences
in the diet of the barn owl in an agro-ecosystem in northern
Italy. Journal of Raptor Research 35 (3): 240-246
Bowden, C. G. R. (1986) Small mammal research in western
Cameroon. Pp 196-200 in Stuart S (ed.) Conservation of
Cameroon Montane Forests. International Council for Bird
Preservation, Cambridge.
Bruderer C, Denys C (1999) Inventaire taxonomique et tapho-
nomique d’un assemblage de pelotes d’un site de nidification
de 7: alba de Mauritanie. Bonner Zoologische Beitrage 48
(3-4): 245-257
Bueno AA, Motta-Junior JC (2008) Small mammal prey selec-
tion by two owl species in southeastern Brazil. Journal of
Raptor Research 42 (4): 248-255
©ZFMK
18 Guy Martial Ntoungwa Ebague et al.
Cheek M, Onana JM, Pollard BJ (2000) The plants of Mount
Oku and the Ijim Ridge, Cameroon: a conservation checklist.
Royal Botanic Gardens, Kew
Dean WRJ, Dowsett RJ (1986) A nest of the Grass-owl Tyto
capensis in the Southern Cape. Ostrich 57: 187-188
Demeter A (1982) Prey of the Spotted Eagle-Owl Bubo afri-
canus in the Awash National Park, Ethiopia. Bonner Zoolo-
gische Beitrage 33: 283-292
Denys C (1985) Nouveaux critéres de reconnaissance des con-
centrations de microvertébrés d’apres |’étude des pelotes
de chouette du Botswana (Afrique australe). Bulletin du
Muséum National d’Histoire Naturelle de Paris, Section A
(Zoologie) 7 (4): 879-933
Denys C, Chitaukali W, Mfune JK, Combrexelle M, Cacciani
F (1999) Diversity of small mammals in owl pellet assem-
blages of Karonga district, northern Malawi, Acta Zoologica
Cracoviencia 42: 393-396
Denys C, Missoup AD, Nicolas V, Filling O, Delapré A, Bilong
Bilong CF, Taylor JP, Hutterer R (2014) African highlands
as mammal diversity hotspots: new records of Lamottemys
okuensis (Rodentia: Muridae) and other endemic rodents
from Mount Oku, Cameroon. Zoosystema 36 (3): 647-690
Djilali K, Sekour M, Souttou K, Ababsa L, Guezoul O, Denys
C, Doumandji S (2016) Diet of Short-eared Owl Asio flam-
meus (Pontoppidan, 1763) in desert area at Hassi El Gara (El
Golea, Algeria), Zoology and Ecology 26 (3): 159-165
Doumandyji S, Doumandji-Mitiche B, Cisse O (1997) Régime
alimentaire de la Chouette hulotte Strix aluco Linné, 1758
(Aves, Strigidae) en milieu suburbain pres d’ Alger. Annales
de I’ Institut National Agronomique de El-Harrach 18: 1-8
Doherty-Bone TM, Gvozdik V (2017) The Amphibians of
Mount Oku, Cameroon: an updated species inventory and
conservation review. ZooKeys 643: 109-139
Eisentraut M (1969) Die tiergeographische Bedeutung des
Oku-Gebirges 1m Bamenda-Banso-Hochland (Westkame-
run). Bonner Zoologische Beitrage 19: 170-175
Eisentraut M (1969) Die Verbreitung der Muriden Gattung Hy-
lomyscus auf Fernando Poo und in Westkamerun. Zeitschrift
fur Sdugetierkunde 34: 296-307
Forboseh PK, Ikfuingei RN (2001) Estimating the population
densities of Zauraco-bannermani in the Kilum-Ijim Forests,
North Western Cameroon. Ostrich 15: 114-118
Grindley J, Siegfried WR, Vernon CJ (1973) Diet of the Barn
owl in the Cape Province. Ostrich 44: 266—267
Hadjoudj M, Manaa A, Merzouki Y, Sekour M, Doumandji S
(2011) Place des rongeurs dans le régime trophique de la
Chouette effraie 7yto alba dans la région de Touggourt. Re-
vue des BioRessources 2 (1): 33-40
Hamani A, Denys C, Doumandji S (2011) Nouvelles données
sur le régime alimentaire de la Chouette effraie Tyto alba aux
abords du barrage de Boughzoul. In: Séminaire internation-
al de protection végétale, Département de Zoologie agricole
et forestiere, Ecole Nationale Supérieure d’agronomie, El
Harrach, Algerie
Happold DCD, Happold M (1986) Small mammals of Zomba
Plateau, Malawi, as assessed by their presence in pellets of
the Grass-owl, Tyto capensis, and by live-trapping. African
Journal of Ecology 24: 77-87
Heim de Balsac H (1968) Contribution a I’ étude des Soricidae
de Fernando Po et du Cameroun. Bonner Zoologische Bei-
trage 19: 15-42
Heim de Balsac H (1975) Nouvelles données sur la faune sori-
cidienne du Cameroun. Bonner Zoologische Beitrage 26:
94-99
Bonn zoological Bulletin 68 (1): 13-19
Heisler LM, Somers CM, Poulin RG (2016) Owl pellets: a more
effective alternative to conventional trapping for broad-scale
studies of small mammal communities. Methods in Ecology
and Evolution 7: 96-103
Hutterer R, Filling O (1994) Mammal diversity in the Oku
Mountains, Cameroon. In: International Symposium on Bio-
diversity and Systematics in Tropical Ecosystems. Museum
Koenig, Bonn, Germany.
Hutterer R, Happold DCD (1983) The shrews of Nigeria (Mam-
malia: Soricidae). Bonner Zoologische Monographien 18:
1-79
Idouhar-Saadi H, Moulai R, Souttou K, Baziz-Neffah F, Smai
A, Zenia S, Doumandji S (2014) Diet comparison between
fledgling and adult tawny owl Strix aluco Linné, 1758 (Aves;
Strigidae) in suburban area of El Harrach (Algiers, Algeria).
International Journal of Zoology and Research 4 (4): 59-66
Ineich I, LeBreton M, Lhermitte-Vallarino N, Chirio L (2015)
The reptiles of the summits of Mont Oku and the Bamenda
Highlands, Cameroon. Amphibian & Reptile Conservation 9
(2): 15-38
IUCN, 2016. IUCN Red List of threatened species 2018.
HTTP://www.iucnredlist.org. Last access 22 Nov 2018
Lekunze LM, Ezealor AU, Aken’ Ova T (2001) Prey groups in
the pellets of the barn owl 7yto alba (Scopoli) in the Nigerian
savanna. African Journal of Ecology 39: 38-44
Leonardi G, Dell’ Arte GL (2006) Food habits of the Barn Owl
(Zyto alba) in a steppe area of Tunisia. Journal of Arid Envi-
ronments 65: 677-681
Love RA, Webon C, Glue DE, Harris S, Harris S (2000) Chang-
es in the food of British Barn Owls (Zyto alba) between 1974
and 1997. Mammal Review 30 (2): 107-129
Mahmood-UI-Hassan M, Beg MA, Ali H (2007) Seasonal vari-
ation in the diet of the barn owl 7yto alba stertens in central
Punjab, Pakistan. Current Zoology 53 (3): 431-436
Maisels FG, Keming E, Kemei M, Toh C (2001) The extirpa-
tion of large mammals and implications for mountain for-
est conservation: the case of Kilum-Ijim Forest, Northwest
Province, Cameroon. Oryx 35 (4): 322-331
Meester J, Setzer HW (1971) The Mammals of Africa. An Iden-
tification Manual. Smithsonian Institution Press, Washington.
Mendelsohn JM (1989) Habitat preferences, population size,
food and breeding of six owls species in the Springbok Flats,
South Africa. Ostrich 60: 183-190
Momo SMC (2017) Plant assemblages along an altitudinal gra-
dient of Mount Oku forests (Cameroon). Journal of Agricul-
ture and Ecology Research International 11 (2): 1-10
Monadjem A, Taylor PJ, Denys C, Cotterill FPD (2015) Ro-
dents of Sub-Saharan Africa: a biogeographic and taxonomic
synthesis. De Gruyter, Berlin
Ngonda JB (1991) Food Choice of the Spotted Eagle Owl
(Bubo africanus) at Kachulu. Bacheolor thesis, Chanco Col-
lege University of Malawi
Oates JF, Berg] RA, Linder JM (2004) Africa’s Gulf of Guinea
Forests: Biodiversity Patterns and Conservation Priorities.
Advances in Applied Biodiversity Science. Conservation In-
ternational, Washington D. C.
Ouarab S, Doumandji S (2017) Ecologie trophique De la chou-
ette effraie Tyto alba (Scopoli, 1769) Dans la réserve na-
turelle De la zone humide de Réghaia. Bulletin de la Société
zoologique de France 142(1): 13-28
Previtali MA, Lima M, Meserve PL, Kelt DA, Gutirrez JR
(2009) Population dynamics of two sympatric rodents in a
variable environment: rainfall, resource availability, and pre-
dation. Ecology 90 (7): 1996-2006
©ZFMK
Terrestrial small mammal assemblage from pellets of three sympatric owl species in the Mount Oku area (NW Cameroon) 19
Riegert J, Sedlacek O, Hutterer R (2007) Diet of sympatric Af-
rican grass owl (Zyto capensis) and spotted eagle owl (Bubo
africanus) in the Bamenda Highlands NW Cameroon. Afri-
can Journal of Ecology 46: 428-431
Rihane A, Lahrouz S, El Hamoumi R (2015) Etude du régime
alimentaire de la Chouette effraie Zyto alba (Strigiforme, Ty-
tonidae) dans la région de Lalla Mimouna dans la plaine du
Gharb (plaine du Maroc atlantique). Afrique Science 11 (2):
116-126
Sandor AD, Moldovan I (2010) Heading to the city. Diet se-
lection of urban breeding Desert Eagle Owls (Bubo ascala-
phus) in Hurghada, Egypt. Journal of Arid Environments 74:
1146-1148
Sekour M, Baziz B, Denys C, Doumandji S, Souttou K,
Guezoul O (2010) Régime alimentaire de la Chevéche
d’ Athena Athene noctua, de |’ Effraie des clochers Tyto alba,
du Hibou moyen-duc Asio otus et du Grand-duc Ascalaphe
Bubo ascalaphus: Réserve naturelle de Mergueb (Algérie).
Alauda 78 (2): 103-117
Sekour M, Beddiaf R, Souttou K, Guezoul O, Denys C, Dou-
mandji S (2011) Variation saisonniere du régime alimentaire
de la Chouette chevéche (Athene noctua) (Scopoli, 1769)
dans I’extréme Sud-Est du Sahara algérien (Dyanet, Algérie).
Revue Ecologique (Terre Vie) 66: 2011
Bonn zoological Bulletin 68 (1): 13-19
Sekour M, Guerzou A, Benbouzid N, Guezoul O, Ababsa L,
Denys C, Doumandji S (2014). Importance de la Mérione de
Shaw Meriones shawii au sein des composantes trophiques
de la Chouette effraie 7Zyto alba en milieux steppiques de
l’ Algérie. Comptes Rendus de Biologies 337: 405-415
Souttou K, Manaa A, Sekour M, Ababsa L, Guezoul O, Bakria
M, Doumandji S, Denys C (2015) Sélection des proies par la
chouette effraie 7yto alba et le hibou moyen-duc Asio otus
dans un milieu agricole a El Maalba (Djelfa, Algérie). Leba-
nese Science Journal 16 (2): 3-17
Tergou S, Boukhemza M, Marniche F, Milla A, Doumandji S
(2014) Dietary distinctive Features of Tawny Owl, Strix alu-
co (Linn 1758) and Barn Owl, Jyto alba (Scopoli 1759) in
Gardens of Algerian Sahel, El Harrach, Jardin D’essai Du
Hamma. Pakistan Journal of Zoology 46 (4): 1013-1022
Thiam M, Ba K, Duplantier J-M (2008) Impacts of climatic
changes on small mammal communities in the Sahel (West
Africa) as evidenced by owl pellet analysis. African Zoology
43 (2): 135-143
Zimkus BM, GvoZzdik V (2013) Sky Islands of the Cameroon
Volcanic Line: a diversification hot spot for puddle frogs
(Phrynobatrachidae: Phrynobatrachus). Zoologica Scripta
42: 591-611
©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 68 (1): 21-29
2019 - Ahrens D. & et al.
https://doi.org/10.20363/BZB-2019.68.1.021
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:lsid:zoobank.org:pub:0A3BF492-C 1 ED-4241-A1D9-68D9E63AAAD7
On the identity of some taxa of Sericinae described by
C. P. Thunberg and L. Gyllenhal
(Coleoptera, Scarabaeidae)
Dirk Ahrens", Silvia Fabrizi’?, Katharina Nikolaev’, Lisa Knechtges* & Jonas Eberle*
"234° Centre of Taxonomy and Evolutionary Research, Zoologisches Forschungsmuseum A. Koenig, Adenauerallee 160,
D-53113 Bonn, Germany
* Corresponding author: Email: [email protected]; [email protected]
'urn:lsid:zoobank. org: author: DEDCESCF-AA 11-4BBF-A2C6-D7C8 15019714
urn: lsid:zoobank.org: author: D88C5 EOB-9E32-430A-909C-CED1C3075471
urn: lsid:zoobank.org: author: E4D2CD82-843A-45 1D-9F BB-D0A49E0A 4260
urn: lsid:zoobank. org: author: 92DF02BE-9465-455A-ASBE-299BA 7 180E80
> urn: lsid:zoobank.org: author: 3A048DF B-D6E1-4F17-9705-9B2EB2753B94
Abstract. The type specimens of a number of species of Sericinae described by C.P. Thunberg and L. Gyllenhal were
revised. The study of the type material of the Zoological Museum of the Uppsala University revealed the identity of these
forgotten species and resulted in five new combinations and four new synonymies: Ablaberoides fuliginosus (Thunberg,
1818) comb. n., Ablabera haemorrhoa (Thunberg, 1818) comb. n.; Camenta caffra (Thunberg, 1818) comb. n., Maladera
setifera (Gyllenhal, 1817) comb. n., and Microserica pusilla (Thunberg, 1818) comb. n. [= Microserica compressipes
(Wiedemann, 1823) syn. n.; Microserica brenskei Reitter, 1896 syn. n.; Microserica pulchella Brenske, 1899 syn. n.;
Microserica leopoldiana Balthasar, 1932 syn. n.|. Melolontha fuliginosa Thunberg, 1818 resulted to be a senior primary
homonym of Melolontha fuliginosa Fairmaire, 1889 (now Exolontha fuliginosa) for which a replacement name is pro-
posed, Exolontha neofuliginosa Ahrens, nom. nov. Ablabera clypeata (Gyllenhal, 1817) and Ablabera totta (Thunberg,
1818) were removed from synonymy with Ablabera splendida (Fabricius, 1781). We designated lectotypes for Melo-
lontha setifera Gyllenhal, 1817, Trichius pusillus Thunberg, 1818, Melolontha fuliginosa Thunberg, 1818, Melolontha
analis Thunberg, 1818, Melolontha haemorrhoa Thunberg, 1818, Melolontha clypeata Gyllenhal, 1817, Melolontha totta
Thunberg, 1818, and Melolontha caffra Thunberg, 1818.
Key words. Sericini, Ablaberini, species taxonomy, South Africa, Indonesia.
INTRODUCTION
During a research visit of the first author in the Stock-
holm Museum of Natural History in 2007, part of the
type specimens of Sericinae (tribes Sericini and Ablaber-
ini) described by the Swedish entomologists Carl Peter
Thunberg and Leonard Gyllenhal preserved at Uppsala
University were examined. In the preparation of further
taxonomic revisions, the findings of that visit merit be-
ing published separately here since some of the species
described by the two authors were forgotten or misun-
derstood. One reason for this 1s the fact that part of Thun-
berg’s species were neglected ever since, as they did not
appear in subsequent works of Blanchard (1850) and
Burmeister (1855), or the first comprehensive world cat-
alogue (Dalla Torre 1912). Thus, they were not regarded
also by subsequent authors. A similar situation applies to
a number of species described by L. Gyllenhal; types of
Oriental species were never again examined by any of
the subsequent authors, and thus, their exact geographical
Received: 15.11.2018
Accepted: 20.03.2019
provenience was never really understood. The taxonomic
revision of these types resulted in some unexpected syn-
onyms, lectotype designations for eight species, correc-
tions and refinement of knowledge of the type localities,
as well as new combinations, a new name and one new
primary homonymy.
MATERIAL AND METHODS
The terminology and methods used for measurements,
specimen dissection and genital preparation follow
Ahrens (2004). Data from specimens examined are cited
in the text with original label contents given in quota-
tion marks (“ “), multiple labels are separated by a slash
(/ ). Male genitalia were detached and glued to a small
pointed card and photographed in both lateral and dorsal
view using a stereomicroscope Leica M125 with a Leica
DC420C digital camera. Stacks of single focussed im-
ages were combined with the automontage software as
Corresponding editor: X. Mengual
Published: 02.04.2019
22 Dirk Ahrens et al.
implemented in Leica Application Suite (V3.3.0). The
resulting entirely focussed images were subsequently
digitally edited.
ABBREVIATIONS
TMSA = Transvaal Museum (now Ditsong Museum),
Pretoria, South Africa
SMNS = Staatliches Museum fiir Naturkunde Stuttgart,
Germany
UUZM = Uppsala University, Zoological Museum,
Sweden
ZFMK = Zoologisches Forschungsmuseum Alexander
Koenig, Bonn, Germany
SUBFAMILY SERICINAE
Tribe Sericini
Maladera setifera (Gylenhal, 1817) comb. n.
(Fig. 1A—F)
Melolontha setifera Gyllenhal, 1817: 95; Wallin 1994: 9.
Serica setifera. Brenske 1898: 218; Dalla Torre 1912: 15;
Krajcik 2012: 243; Ahrens & Fabrizi 2016: 273.
Type material examined. Lectotype (here designated).
S “Uppsala Univ. Zool. Mus. Gyllenhal saml. Typ nr.
1467/ c” (UUZM). Paralectotypes: 1 2 “Uppsala Univ.
Zool. Mus. Gyllenhal saml. Typ nr. 1467/ b” (UUZM),
1 9 “Uppsala Univ. Zool. Mus. Gyllenhal saml. Typ nr.
1467/ a” (UUZM).
Additional material examined. | 3, 3 29 “Indonesia
C. Java Mt. Sumbing, VI.2006 St. Jakl leg.” (ZFMK),
1 3 “Indonesia W. Java Puncak near Boggor, 1500m,
8 —10.1V.1992, Eddi Samin leg.” (ZFMK).
Lectotype redescription. Length: 7.3 mm, length of el-
ytra: 5.8 mm, width: 4.9 mm. Body oblong-oval, yellow-
ish brown, antenna yellowish, dull, labroclypeus shiny,
with a few robust setae on head, otherwise glabrous.
Labroclypeus short, wide and subrectangular, widest
at base, lateral margins slightly convex, slightly conver-
gent anteriorly, anterior angles strongly rounded, ante-
rior margin straight, margins strongly reflexed; lateral
margin and ocular canthus produce an indistinct angle:
surface convexly elevated medially, finely, densely punc-
tate, with a few erect, long setae;_frontoclypeal suture
distinctly incised and elevated, angled medially; smooth
area anterior to eye convex, twice as wide as long; oc-
ular canthus short and narrow (1/3 of ocular diameter),
finely densely punctate, with a terminal seta. Frons dull,
with moderately dense, coarse punctures, with a few sin-
Bonn zoological Bulletin 68 (1): 21-29
gle setae beside eyes and behind frontoclypeal suture.
Eyes moderately large, ratio diameter/ interocular width:
0.62. Antenna with ten antennomeres; club with three an-
tennomeres and straight, slightly longer than remaining
antennomeres combined. Mentum elevated and slightly
flattened anteriorly.
Pronotum moderately transverse, widest at middle, lat-
eral margins moderately evenly convex and convergent
anteriorly as well as posteriorly, anterior angles distinct-
ly produced and sharp, posterior angles blunt, slightly
rounded at tip; anterior margin straight, with fine margin-
al line, base without marginal line; surface moderately
densely and finely punctate, with minute setae in punc-
tures; anterior and lateral margin finely sparsely setose;
hypomeron carinate, not produced ventrally. Scutellum
wide, triangular, with fine, moderately dense punctures,
impunctate on midline.
Elytra widest at middle, striae finely impressed, finely
and densely punctate, intervals slightly convex, with fine,
moderately dense punctures concentrated along striae
and with minute setae in punctures, odd intervals (most
abraded) with a few single long setae in robust punctures;
epipleural edge fine, ending at anterior third of elytra,
epipleura sparsely setose; apical border of elytra mem-
braneous, with a fine rim of microtrichomes (visible at ca
100x magnification).
Ventral surface dull, finely and densely punctate, near-
ly glabrous, metasternal disc sparsely covered with fine,
short setae; metacoxa with a few longer setae laterally.
Abdominal sternites finely and densely punctate, punc-
tures with minute setae, each sternite with a transverse
row of punctures each bearing a fine seta. Mesoster-
num between mesocoxae as wide as mesofemur. Ratio
of length of metepisternum/metacoxa: 1/1.95. Pygidium
moderately convex, dull, finely and densely punctate,
with narrow smooth midline, with numerous long setae
along apical margin.
Legs short and wide, dull; femora with two longitudinal
rows of setae, finely and sparsely punctate. Anterior mar-
gin of metafemur acute, without adjacent serrated line,
anterior row of setae complete; posterior ventral margin
smooth, moderately widened at ventral apex, dorsal pos-
terior edge smooth, neither serrate, glabrous. Metatibia
short and wide, widest at middle, ratio of width/length:
1/2.25, sharply carinate dorsally, with two groups of
spines, basal group shortly behind middle, apical group
at three quarters of metatibial length, in basal half with
a few short single setae subparallel to dorsal margin; lat-
eral face longitudinally convex, superficially and sparse-
ly punctate, along midline broadly smooth, with minute
setae in punctures; ventral margin finely serrate, with
five equidistant robust setae; medial face smooth and
glabrous; apex finely serrate, shallowly sinuate interiorly
near tarsal articulation._Tarsomeres dorsally impunctate,
glabrous, neither laterally nor dorsally carinate, moder-
ately setose ventrally; metatarsomeres with a strongly
©ZFMK
On the identity of some taxa of Sericinae described by C. P. Thunberg and L. Gyllenhal 23
‘\ |Uppsala Univ. Zool. Mus.
Gylkenhals saml. TYP nr.
1467
Uppsala Univ. Zool. Mus.
Thunbergsaml. ne. 4040
Hoplia pusilia
Cap. TY
Uppsala Univ. Zool. Mus.
unbergsaml. nr. 3802
Melolontha fuliginosa
Cap. TYP L
Fig. 1. A-F. Maladera setifera (Gyllenhal, 1817) (lectotype); G—J. Microserica pusilla (Thunberg, 1818) (lectotype); K—N. Ab-
laberoides fuliginosus (Thunberg, 1818) (lectotype). A. Aedeagus, left side lateral view; D. Aedeagus, right side lateral view; B.
Parameres, dorsal view; C. Parameres, ventral view; G, K. Head, dorsal view; E, J, M. Habitus, dorsal view, I, N. Habitus, lateral
view; F, H, L. Specimen labels. Scale: 0.5 mm.
Bonn zoological Bulletin 68 (1): 21-29 ©ZFMK
24 Dirk Ahrens et al.
serrated ridge ventrally and a smooth subventral longitu-
dinal carina, glabrous; first metatarsomere slightly short-
er than following two tarsomeres combined and slightly
longer than dorsal tibial spur. Protibia moderately long,
bidentate; anterior claws symmetrical, basal tooth of both
claws bluntly truncate at apex.
Remarks. The designated lectotype is the only male
specimen of the syntype series. The paralectotypes nr.
1467a and 1467b belong to clearly different species,
however, their identity remains unclear because they are
female. Type nr. 1467a somewhat resembles Maladera
subspinosa (Brenske, 1898) from northeastern India,
while type nr. 1467b 1s very similar to Maladera holoser-
icea (Scopoli, 1772), which definitively would not occur
at the presumptive type locality in Asia. Originally, there
were syntypes in the Schonherr collection too, however,
none was presently found in the Stockholm Museum of
Natural History.
In contrast to that, the original description mentions
only two variants, one corresponding to the lectotype
(var. §), and the other one to type nr. 1467a (nominal
form). None of the characters of the latter contain species
specific traits that are useful without the exact geographic
provenience of the specimens, and, it cannot be excluded
that the specimens of the type series have been collected
in two completely different areas, as also the potential
presence of M. holosericea in the labelled syntypes series
suggests.
For long time it was believed that the species originat-
ed from India (Brenske 1898; Dalla Torre 1912) because
the type locality was originally given as India orientalis
(“habitat in India orientali”; Gyllenhal 1817). Since the
designed lectotype fits to 100% recently collected and
geographically well-defined material, the type locality
could be more strictly circumscribed to Java. Indeed, the
most important ports on the East India route were Cape,
Batavia and Canton, and thus the two latter are the com-
pletely dominant places of origin for specimens labelled
“India orientalis” in Swedish collections, and supporting
the identification of the type locality as being Java (Mat-
tias Forschage, pers. com.). This is further supported by
geographically rather restricted distributions of species
of the M. thomsoni species group, which includes M. se-
tifera.
Microserica pusilla (Thunberg, 1818) comb. n.
(Fig. 1G—J)
Trichius pusillus Thunberg, 1818: 437.
Melolontha compressipes Wiedemann, 1823: 91, syn. n.
Microserica compressipes. Brenske 1899: 186; Ahrens
2004: 53.
Microserica brenskei Reitter, 1896: 186, Ahrens 2004:
53, Syn. n.
Bonn zoological Bulletin 68 (1): 21-29
Microserica pulchella Brenske, 1899: 161, Ahrens 2004:
53, Syn. n.
Microserica leopoldiana Balthasar, 1932: 113, Ahrens
2004: 53, syn. n.
Type material examined. Lectotype (here designated).
9 “Uppsala Univ. Zool. Mus. Thunbergsaml. nr. 4040
Hoplia pusilla Cap. TYP” (UUZM).
Remarks. This species was redescribed by Ahrens
(2004). The here designated lectotype specimen was the
only available syntype specimen. The lectotype is virtu-
ally identical in morphology and shape with female spec-
imens of Microserica compressipes (Wiedemann, 1823),
which was originally described form Java, and later rec-
ognized as a wider distributed species also occurring in
Sumatra (Ahrens 2004). Although the lectotype of M
pusilla is a female specimen, the shape and punctation
of the labroclypeus and the shiny and sparsely punctate
surface of the pygidium are very typical for this species,
while in the entire Africa there 1s no species with these
morphological characteristics. Thus, we consider the
type locality (Cape of Good Hope; Thunberg 1818) er-
roneous, rather being from Indonesia than from southern
Africa. The confusion between Cape and Java is not very
unlikely, since these two ports on the East India route are
the two main places where Thunberg collected on his trip
abroad, staying in Cape for three years 1772-1775 and in
Batavia for one month in 1775 (Mattias Forschage, pers.
com. ).
The lectotype is nearly entirely yellowish brown, with-
out the lateral paired stains on the elytra, which often
occur in females of M. compressipes. The entirely shiny
and sparsely punctate pygidium is a key feature of all
Microserica sensu stricto species, which occur only in
the Oriental region.
Ablaberoides fuliginosus (Thunberg, 1818) comb. n.
(Figs 1K—L, 2A—D)
Melolontha fuliginosa Thunberg, 1818: 426, not Fair-
maire 1889: 22.
Type material examined. Lectotype (here designated).
9 “Uppsala Univ. Zool. Mus. Thunbergsaml. Nr. 3802
Melolontha fuliginosa Cap. TYP” (UUZM).
Additional material examined. | < “X-DA4037-—South
Africa, W. Cape: Goukamma Nat. Res. Dunes near Ron-
davell Chalet, 10m, 34°04'02.9"S; 22°56'50.8"E, 24 —26.
xi.2013, lg. Ahrens, Eberle, Fabrizi” (ZFMK), 2 3, 1 2
“S.Afr.; Namaqualand Stallberg pass 30.27 S — 18.04 E
/5.9.1977; E-Y: 1384 grass netting leg. Endrédy- Youn-
ga” (TMSA), 1 3 “S.Afr.; W Cape Gamkaberg Nat. Res.
33.43 S — 21.56 E/ 8.12.1995; E-Y: 3176 fymbos flow-
©ZFMK
On the identity of some taxa of Sericinae described by C. P. Thunberg and L. Gyllenhal 25
Fig. 2. A-D. Ablaberoides fuliginosus (Thunberg, 1818) (S. Afr.; W Cape, Gamkaberg Nat. Res.); A. aedeagus, left side lateral
view; C. aedeagus, right side lateral view; B. parameres, dorsal view; D. habitus, dorsal view. Scale: 0.5 mm.
er leg. CL Bellamy“ (TMSA), 5 3 “S.Afr.; Little Karoo
Gamkaberg Nat. Res. 33.42 S — 21.54 E / 8-9.12.1995:
E-Y: 3175 beating leg. CL Bellamy” (TMSA), 1 ¢
“S.Affr.; Cape Prov Tsitsikama 33.58 S — 24.10 E/ For.
& Coastal Nat. Park 9.3.1992; dung Janssen & Le Roux“
(TMSA), 2 3 “S.Afr., S.W. Cape Ryspuntstrand 34.36 S
— 20.19 E / 30.9.1984; E-Y: 2130 ground & vegetation
leg. R. Muller” (TMSA), 1 3 “S.Afr., Cape-Karoo Farm
Zwaartskraal 33.10S — 22.32E / 8.11.1978; E-Y: 1539
ground traps, 69 days leg. R. Oosthuizen A / ground traps
with ferm. Banana bait‘ (TMSA), 1 ¢ “Assengaibos, La
Motte, C.P.X 40 G. van Son” (TMSA), 1 ¢@ “Uitenhage
IX. 1950 K. Dickson” (TMSA), 2 3 “S.Afr., S.W. Cape
Waenhuiskrans 34.39 S — 20.14 E / 30.9.1984; E-Y:
2129 grass netting leg. R. Miller” (TMSA), 1 ¢ “S.Afr;
Little Karoo Gamka Mt., 1000m 33.43 S — 21.56 E /
25.10.1993; E-Y:2901 flow. Karoo veget. Leg. En-
droédy-Younga” (TMSA), | ¢@ “S. Afr; LittleKaroo Gam-
ka Nat. Res. 33.43 S — 21.46 E/ 8.11.1993; E-Y: 2950
flower. Vegetation leg. Endrédy-Younga” (TMSA), 2 ¢
“S.Afr., S.W. Cape Arniston, dunes 34.39 S — 20.13 E/
26.10.1983; E-Y: 2021 grass netting leg. Endrédy- Youn-
ga” (TMSA), 1 6 “WILDERNIS SE 34 23 Aa 3 - X -
1981 C. H. SCHOLTZ” (TMSA), 3 6, 1 9 “RSA, W
Cape, Greyton env., 22.XI.2002, leg. M. Snizek, ex.
Coll. Ahrens” (ZFMK), 1 3 “SOUTH AFRICA: Eastern
Cape, R337, 43 km NE of Willowmore, 33°08’S 23°50’E
650m, 18.X1.1999 leg. M. Hauser” (SMNS).
Lectotype redescription. Length: 5.5 mm, length of el-
ytra: 3.4 mm, width: 3.2 mm. Body short-oval, blackish,
antenna black, surface with iridescent shine, with a few
robust setae on head, otherwise glabrous.
Bonn zoological Bulletin 68 (1): 21-29
Labroclypeus short, narrow and trapezoidal, widest at
base, lateral margins convex and strongly convergent an-
teriorly but between labrum and clypeus deeply concave-
ly sinuated,_anterior angles sharp and reflexed, anterior
margin bluntly sinuated medially and strongly reflexed:
lateral margin of clypeus and ocular canthus produce
an indistinct angle; surface flat, with a transverse carina
shortly behind the lateral incision between labrum and
clypeus, surface finely, very densely punctate, with a few
erect setae in front of the carina; frontoclypeal suture dis-
tinctly incised and flat, angled medially and sublaterally;
smooth area anterior to eye flat, as wide as long; ocular
canthus moderately long and narrow, finely densely punc-
tate, with a terminal seta; at apex touching the strongly
produce posterior eye keel (which is as long as the ocu-
lar canthus). Frons shiny, with dense, coarse punctures,
with a single seta beside each eye. Eyes very small, ratio
diameter/interocular width: 0.24. Antenna with ten an-
tennomeres; club with three antennomeres and straight,
as long as remaining antennomeres combined. Mentum
elevated and slightly convex anteriorly.
Pronotum moderately transverse, widest at base, lat-
eral margins moderately evenly convex and convergent
anteriorly, anterior angles distinctly produced and sharp,
posterior angles blunt, slightly rounded at tip; anterior
margin weakly convex, with robust marginal line, base
with robust marginal line that is widely interrupted medi-
ally by nearly twice scutellar widths; surface densely and
finely punctate, with minute setae in punctures; lateral
margin finely sparsely setose; hypomeron carinate, not
produced ventrally. Scutellum dull, wide, triangular, with
fine, moderately dense punctures.
©ZFMK
26 Dirk Ahrens et al.
Fig. 3. A-D. Ablabera analis (Thunberg, 1818) (lectotype), E-H. Ab/abera totta (Thunberg, 1818) (lectotype); I-N. Ablabera
haemorrhoa (Thunberg, 1818) (lectotype); A, E, L. Head, dorsal view; C, H. Habitus, lateral view; D, G, N. Habitus, dorsal view;
I. Aedeagus, left side lateral view; K. Aedeagus, right side lateral view; J. Parameres, dorsal view; B, F, M. Specimen labels. Scale:
0.5 mm.
Bonn zoological Bulletin 68 (1): 21-29 ©ZFMK
On the identity of some taxa of Sericinae described by C. P. Thunberg and L. Gyllenhal 21.
Elytra widest at middle, striae finely impressed, finely
and densely punctate, intervals flat, with fine, moderate-
ly dense punctures and with minute setae in punctures;
epipleural edge fine, ending at blunt external apical angle
of elytra, epipleura sparsely setose; apical border of ely-
tra chitinous, without rim of microtrichomes (visible at
ca 100x magnification).
Ventral surface dull, finely and densely punctate, near-
ly glabrous, metasternal disc sparsely covered with fine,
short setae; metacoxa with a few longer setae laterally.
Abdominal sternites finely and densely punctate, punc-
tures with minute setae, each sternite with a transverse
row of punctures each bearing a fine seta. Mesoster-
num between mesocoxae as wide as mesofemur. Ratio
of length of metepisternum/metacoxa: 1/2.13. Pygidium
moderately convex, dull, weakly shiny in apical half,
coarsely and densely punctate, without smooth midline,
with numerous short setae along apical margin.
Legs short and wide, dull; femora with two longitudi-
nal rows of setae, finely and sparsely punctate, of which
the posterior one 1s nearly completely reduced. Anterior
margin of metafemur acute, without adjacent serrated
line, anterior row of setae complete; posterior ventral
margin smooth, strongly widened at ventral apex, dorsal
posterior edge smooth, neither serrate, glabrous. Metatib-
ia short and wide, widest at middle, ratio of width/length:
1/2.55, sharply carinate dorsally, with two groups of
spines, basal group shortly before neterior quarter, apical
group shortly behind middle of metatibial length; later-
al face longitudinally convex, finely and sparsely punc-
tate, along midline broadly smooth, with minute setae in
punctures; ventral margin finely serrate, with four equi-
distant robust setae; medial face smooth and glabrous;
apex finely serrate, distinctly concavely sinuate interiorly
near tarsal articulation. Tarsomeres dorsally impunctate,
glabrous, neither laterally nor dorsally carinate, moder-
ately setose ventrally; metatarsomeres with a strongly
serrated ridge ventrally and a smooth subventral longitu-
dinal carina, with a few short setae; first metatarsomere
as long as following tarsomere and slightly shorter than
dorsal tibial spur. Protibia moderately long, tridentate:
anterior claws symmetrical, basal tooth of both claws
bluntly truncate at apex.
Remarks. The here designated lectotype specimen was
the only available syntype specimen. The name is a pri-
mary senior homonym of Melolontha fuliginosa Fatr-
maire, 1889, currently placed under a different genus
name as Exolontha fuliginosa (Fairmare, 1889) (Li et
al. 2010; Bezdek 2016). Given the rare use of the latter
name, we see no reason to make a case to advocate a
conservation of Melolontha fuliginosa Fairmaire, 1899.
In consequence, we propose here a replacement name for
the latter, Exolontha neofuliginosa Ahrens, nom. nov.
Bonn zoological Bulletin 68 (1): 21-29
Tribe Ablaberini
Among the type material of Ablaberini described by C.P.
Thunberg and L. Gyllenhal in the Stockholm Museum of
Natural History, only species of the genera Camenta Er-
ichson, 1847 and Ablabera Erichson, 1847 were found.
Species of both genera await a comprehensive taxonom-
ic revision and consequently, little can be said about the
current status of the species at this moment. Thus, we de-
cided to not include any redescription because a broader
taxonomic knowledge of these genera is needed.
Ablabera analis (Thunberg, 1818)
(Fig. 3A—D)
Melolontha analis Thunberg, 1818: 427.
Ablabera analis: Blanchard 1850: 101; Péringuey 1904:
86; Dalla Torre 1912: 75.
Type material examined. Lectotype (here designated).
9° “Uppsala Univ. Zool. Mus. Thunbergsaml. nr. 14777
Hoplia analis TYP” (UUZM).
Additional material examined. | 9 “Uppsala Univ.
Zool. Mus. Thunbergsaml. nr. 3326 Hoplia analis TYP”
(UUZM).
Remarks. The exact identity of this species and its po-
tential synonymy is difficult to establish as male speci-
mens are not available.
The specimen nr. 3326 of the supposed type series was
not designated as paralectotype as not an Ablabera spe-
cies, but appears to be a female of Maladera holosericea
(Scopoli) which was mislabeled and which possibly is
not part of the type series.
Ablabera clypeata (Gyllenhal, 1817) stat. rev.
(Fig. 4A—E)
Melolontha clypeata Gyl\lenhal, 1817: 70.
Ablabera clypeata. Blanchard 1850: 101; Burmeister
1855: 137; Péringuey 1904: 78; Dalla Torre 1912: 76.
Type material examined. Lectotype (here designated).
9 “Uppsala Univ. Zool. Mus. Gyllenhal saml. Typ nr.
1453/ a” (UUZM).
Remarks. The here designated lectotype specimen was
the only available syntype specimen. No other syntype
specimen was present in the Stockholm Museum.
Ablabera clypeata and A. totta (Thunberg, 1818) were
listed by Péringuey (1904) as junior synonyms of Ab-
labera splendida (Fabricius, 1781). However, the exam-
ination of both Thunberg’s type specimens revealed that
the types belong to different species and they are not A.
©ZFMK
28 Dirk Ahrens et al.
Fig. 4. A-E. Ablabera clypeata (Gyllenhal, 1817) (lectotype); F-I. Camenta caffra (Thunberg, 1818) (lectotype). A, G. Habitus,
lateral view; B, H. Habitus, dorsal view; F, C. Head, dorsal view; D. Metatibia: lateral view; E, I. Specimen labels. Scale: 0.5 mm.
splendida. Since there is no evidence in previous works
that either Péringuey (1904) or other authors examined
the type of any of the tree species, it seems reasonable
to treat them as valid taxa until the group is comprehen-
sively revised.
Ablabera haemorrhoa (Thunberg, 1818) comb. n.
(Fig. 3I-N)
Melolontha haemorrhoa Thunberg, 1818: 427.
Type material examined. Lectotype (here designated).
3 “Uppsala Univ. Zool. Mus. Thunbergsaml. nr. 3805
Melolontha haemorrhoa Cap. TYP” (UUZM).
Bonn zoological Bulletin 68 (1): 21-29
Remarks. The here designated lectotype specimen was
the only available syntype specimen.
Ablabera totta (Thunberg, 1818) stat. rev.
(Fig. 3E—H)
Melolontha totta Thunberg, 1818: 428.
Ablabera totta: Péringuey 1904: 78; Dalla Torre 1912:
76.
Type material examined. Lectotype (here designated).
9° “Uppsala Univ. Zool. Mus. Thunbergsaml. nr. 3812
Melolontha totta Cap. TYP” (UUZM).
©ZFMK
On the identity of some taxa of Sericinae described by C. P. Thunberg and L. Gyllenhal 29
Remarks. See Remarks under A. clypeata (Gyllenhal,
1817). The here designated lectotype specimen was the
only available syntype specimen.
Camenta caffra (Thunberg, 1818) comb. n.
(Fig. 4F-I)
Melolontha caffra Thunberg, 1818: 427.
Type material examined. Lectotype (here designated).
9 “Uppsala Univ. Zool. Mus. Thunbergsaml. nr. 3804
Melolontha caffra Cap. TYP” (UUZM).
Remarks. The here designated lectotype specimen was
the only available syntype specimen.
Acknowledgements. We are grateful to Hans Mejlon for the
loan of the type specimens from Uppsala University and to
Mattias Forshage (Stockholm) for his help with the loan of the
Uppsala type specimens as well as his hints towards these valu-
able specimens. AleS Bezdék and Mattias Forshage provided
helpful comments on the manuscript. Part of this research was
supported by grants from the German Science Association to D.
A. (DFG/AH175/1 and AH175/3) and by SYNTHESYS (SE-
TAF-3424).
REFERENCES
Ahrens D (2004) New species of the genus Microserica Bren-
ske, 1894 from Sumatra and the Malay Peninsula, with notes
on synonymy (Coleoptera, Scarabaeoidea, Melolonthidae).
Annali del Museo Civico di Storia Naturale “G. Doria” 95:
35-63
Ahrens D & Fabrizi S (2016) A Monograph of the Sericini of
India (Coleoptera: Scarabaeidae). Bonn Zoological Bulletin
65: 1-355
Balthasar V (1932) Une contribution a la connaissance des
Scarabaeidae de la région Orientale. Annales de la Société
entomologique de Belgique 72: 113-117
Bezdék A (2016) Melolonthini. p. 226—236. In: Lobl, I. & Lobl,
D. (Eds.), Catalogue of Palaearctic Coleoptera. Volume 3.
Bonn zoological Bulletin 68 (1): 21-29
Scarabaeoidea — Scirtoidea — Dascilloidea — Buprestoidea
— Byrrhoidea. Revised and Updated Edition (2™ Edition).
Leiden: Brill.
Blanchard ME (1850) Catalogue de la collection Ento-
mologique. Classes des Insectes. Ordre des Coléopteres.
part.: Melolonthidae, Tome I. Muséum d’ Histoire Naturelle
de Paris, 128.pp
Brenske E (1898) Die Serica-Arten der Erde. II. Berliner Ento-
mologische Zeitschrift 43: 205-403
Brenske E (1899) Die Serica-Arten der Erde. HI. Berliner Ento-
mologische Zeitschrift 44: 161-272
Burmeister H (1855) Handbuch der Entomologie. 4. Band. Be-
sondere Entomologie, Fortsetzung. 2. Abteilung, Coleoptera
Lamellicornia Phyllophaga chaenochela. Theodor Christian
Friedrich Enslin, Berlin, 467pp.
Dalla Torre KW (1912) Scarabaeidae: Melolonthinae I. In: Junk
W & Schenkling S (eds): Coleopterorum Catalogus 45: 1-84
Fairmaire L (1889) Coléopteres de l’intérieur de la Chine (5
partie). Annales de la Societe Entomologique de France 6:
5—84
Krajcik M (2012) Checklist of the World Scarabaeoidea. Anim-
ma.x, supplement 5: 1-278
Gyllenhal L (1817) In: Schonherr CJ (1817) Appendix ad C.
J. Schoenherr synonymia insectorum. Vol. 1, Part 3, sistens
descriptiones novarum specierum, Scaris, 266pp.
Li C-L, Yang P-S, Wang C-C (2010) Revision of the Me/olon-
tha guttigera Group (Coleoptera: Scarabaeidae) With a Key
and an Annotated Checklist of the East and South-East Asian
Melolontha Groups. Annals of the Entomological Society of
America 103(3): 341-359
Péringuey L (1904) Descriptive catalogue of the Coleoptera of
South Africa. (Lucanidae and Scarabaeidae). Transactions of
the South African Philosophical Society 13: 1-293
Reitter E (1896) Uebersicht der mir bekannten palaearktischen,
mit der Coleopteren-Gattung Serica verwandten Gattungen
und Arten. Wiener Entomologische Zeitung 15: 180-188
Thunberg CP (1818) Coleoptera Capensia, antennis lamellatis,
sive clave fissili instructa. Mémoires de Il’ Académie impéri-
ale des sciences de St. Pétersbourg 6: 395-450
Wallin L (1994) Catalogue of type specimens. 3. Entomology.
Uppsala University, Museum of Evolution, Zoology section,
S6pp.
Wiedemann CRW (1823) Zweihundert neue Kafer von Java,
Bengalen und dem Vorgebirge der guten Hoffnung. Zoolo-
gisches Magazin 2: 1-135
©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 68 (1): 31-60
2019 - Kehlmaier C. et al.
https://do1.org/10.20363/BZB-2019.68.1.031
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:lsid:zoobank.org: pub: DC3BA 949-1 88E-465C-92C8-A B61 B4EABC3A
New records of big-headed flies (Diptera: Pipunculidae)
from the Mediterranean Basin
Christian Kehlmaier'*, David J. Gibbs? & Phil Withers*
'Senckenberg Natural History Collections Dresden, Museum of Zoology, Konigsbriicker LandstraBe 159, D-01109 Dresden,
ry. Z SY, &
ermany
? Orchard Cottage, Cecil Road, Weston-super-Mare, Somerset BS23 2NF, United Kingdom
3 Montée du Cimetiére, Sainte Euphémie, F-01600, France
* Corresponding author: Email: [email protected]
'urn:Isid:zoobank.org:author:3 BD2A72C-A 88E-4B2F-A22C-7CF522DE6F4D
? urn:Isid:zoobank.org:author:6DF4A27A-C5CA-4D2E-A910-4B5C373306B2
3 urn:Isid:zoobank.org:author:3F23770A-94DC-4A C0-8F33-F917B04A62C9
Abstract. Despite great progress in Pipunculidae (Insecta: Diptera) systematics during the past decades, the Mediterrane-
an fauna of big-headed flies remains largely unknown. Here, we present new faunistic and taxonomic data for 98 named
species from Cyprus, Egypt, France, Greece, Italy, Malta, Morocco, Portugal, Spain, Tunisia, and Turkey, based on our
own collecting efforts and museum specimens. Besides 56 first national records, the paper includes the description of
Cephalops (Semicephalops) brachium Kehlmaier & Withers sp. n. from France and Spain, and of Zomosvaryella osito
Kehlmaier, Gibbs & Withers sp. n. and Zomosvaryella pugiunculus Kehlmaier & Gibbs sp. n. from the Balear Islands
(Spain). Furthermore, two new synonymies are proposed: 7Zomosvaryella lyneborgi (Coe, 1969) = Tomosvaryella cilitar-
sis (Strobl, 1910); and Zomosvaryella glabrum (Adams, 1905) = Tomosvaryella pilosiventris (Becker, 1900). Lectotypes
are designated for Jomosvaryella pilosiventris (Becker, 1900) and Tomosvaryella vicina (Becker, 1900). The following
species need to be deleted from the Spanish checklist due to misidentifications: Cephalops subultimus Collin, 1956, Eu-
dorylas montium (Becker, 1897), and Tomosvaryella nigronitida Collin, 1958.
Key words. Diptera, Pipunculidae, Mediterranean Basin, taxonomy, faunistics, new species.
INTRODUCTION
Pipunculidae (Insecta: Diptera), commonly known as
big-headed flies, are brachycerous flies whose endopar-
asitic larvae develop within larval and adult Auchenor-
rhyncha (Insecta: Hemiptera) and adult Tipulidae (Insec-
ta: Diptera) (see Rafael & Skevington 2010 for a brief
review of the family's biology). Currently, four subfam-
ilies are recognized (Kehlmaier et al. 2014) and slightly
more than 1,400 valid species are described (Rafael &
Skevington 2010). Whereas pipunculids can readily be
recognized by their large compound eyes, occupying al-
most the entire globular head (Fig. 1), species identifi-
cation is primarily based on male genitalic features and
the piercer-like shape of the female ovipositor used for
penetrating the intersegmental skin of their larval hosts;
and thus, it requires some experience.
Regarding taxonomy and systematics, vast progress
has been achieved during the past three decades. Many
revisionary works, covering all biogeographic regions,
have more than doubled the number of described spe-
cies (Skevington & De Meyer 2004: fig. 1). Although the
Received: 07.05.2018
Accepted: 20.05.2019
western Palaearctic can be considered the most thorough-
ly studied region worldwide, knowledge of the fauna of
the Mediterranean Basin is still fragmentary. Being lo-
cated at the intersection of the African and the Eurasian
landmasses the Mediterranean Basin is considered one of
the world's biodiversity hotspots (Cuttelod et al. 2008).
It stretches from Portugal to Jordan (W to E) and from
northern Italy to Morocco (N to S), including around
five thousand islands scattered around the Mediterranean
Sea, plus the Macaronesian archipelagos of the Canaries,
Madeira, the Selvages (Selvagens), the Azores, and Cape
Verde. In this study, however, the Macaronesian archipel-
agos are not considered.
Although no absolute figures exist, the high degree of
plant endemism — approx. 52% of all 22,500 vascular
plant species, mainly concentrated on islands, peninsulas,
rocky cliffs, and mountain peaks (International 2011) —
has undoubtedly triggered radiations within many groups
of arthropods, including endoparasitoids. Although much
of the Mediterranean hotspot was once covered in ever-
green oak forests, deciduous and conifer forests, eight
thousand years of human settlement and habitat modifica-
Corresponding editor: X. Mengual
Published: 02.06.2019
32 Christian Kehlmaier et al.
tion have distinctly altered the characteristic vegetation
(International 2011). Today, the most widespread veg-
etation type is hard-leafed or sclerophyllus shrublands
called maquis or matorral, which include representatives
from the plant genera Juniperus L., Myrtus L., Olea L.,
Phillyrea L., Pistacia L., and Quercus L. (International
2011).
Of all countries situated in the Mediterranean Basin,
only France (Withers 2006), Israel (De Meyer 1995),
Italy (Kozanek & Belcari 1995; Kehlmaier 2008a;
Kehlmaier 2010a), Malta (Ebejer 2012), Portugal
(KehIlmaier & Andrade 2016), and Spain (De Meyer
1997; Kehlmaier 2001, 2003, 2005a; Kehlmaier & Ass-
mann 2008; Kehlmaier & Alonso-Zarazaga 2018) have
received more substantial attention in the past, resulting
in well documented, yet far from complete species lists.
During the past years, the authors had the opportunity to
collect new material as well as to study specimens depos-
ited in various institutional and private collections. The
results of these efforts are presented in this paper, and in-
clude, amongst others, the description of three new spe-
cies (1.e., Cephalops (Semicephalops) brachium Kehl-
maier & Withers sp. n., Jomosvaryella osito Kehlmaier,
Gibbs & Withers sp. n., and Zomosvaryella pugiunculus
Kehlmaier & Gibbs sp. n.) and new records and findings
for Cyprus, Egypt, France, Greece, Italy, Malta, Mo-
rocco, Portugal, Spain, Tunisia, and Turkey. Moreover,
lectotypes are designated for Zomosvaryella pilosiventris
(Becker, 1900) and 7Zomosvaryella vicina (Becker, 1900),
and two new synonymies are proposed: 7omosvaryella
lyneborgi (Coe, 1969) = Tomosvaryella cilitarsis (Strobl,
1910), and Tomosvaryella glabrum (Adams, 1905) = To-
mosvaryella pilosiventris (Becker, 1900).
MATERIAL AND METHODS
Morphological terminology in the descriptive part fol-
lows recent systematic papers (e.g., Kehlmaier et al.
2014). Note that in contrast to previous papers (e.g.,
Kehlmaier 2005a) using the terms ‘inner’ and ‘outer’ to
differentiate between the position of surstyli, gonopods
and sides of the epandrium, the terms ‘left’ and ‘right’ are
used in accordance with Skevington (2002), representing
the actual morphological location of these structures.
As no comprehensive work exists for identifying Pi-
punculidae from the Mediterranean Basin, various pub-
lications need to be consulted for species identification,
Fig. 1. Male holotype of Zomosvaryella osito Kehlmaier, Gibbs & Withers sp. n. prior to dissection. A. Left lateral view. B. Dorsal
view.
Bonn zoological Bulletin 68 (1): 31-60
©ZFMK
New data on Mediterranean Pipunculidae oo
i.e., for Chalarinae (Kehlmaier 2006; Kehlmaier &
Assmann 2008; Kehlmaier 2010b); for Nephrocerinae
(Grootaert & De Meyer 1986); for Pipunculini (Kehl-
maier 2008b, 2010a); for Cephalopsini and Microceph-
alopsini (Ackland 1993; De Meyer 1989; Kehlmaier &
Andrade 2016); for Eudorylini (Kehlmaier 2005a, b);
and for Tomosvaryellini (Albrecht 1990; De Meyer 1993,
1995; Foldvari & De Meyer 2000; Kehlmaier 2008a, b).
An identification key to the world genera is included in
Skevington & Yeates (2001). If not otherwise stated, the
material was identified by the senior author.
For selected specimens, DNA-barcodes of the mito-
chondrial coding gene cytochrome oxidase subunit I
(CO1) were generated using the protocol by Kehlmaier
et al. (2012) at the molecular laboratory at Senckenberg
Naturhistorische Sammlungen Dresden, Museum fir
Tierkunde, Dresden, Germany (SGN-SNSD-Mol-Lab).
Specimens sequenced received an additional label stat-
ing an individual lab number “DNA CKxxx”. Sequence
accession numbers issued by the European Nucleotide
Archive (ENA) are provided in the individual species
section.
In the faunistic listing below, genera and species are
arranged alphabetically within their corresponding sub-
family. First national records are indicated by an asterisk
(*) after the country’s name.
Abbreviations used for collections and equivalents
BMNH = British Museum of Natural History,
London, United Kingdom
MNCN = Museum Nacional de Ciencias Naturales,
Madrid, Spain
MNHN = Muséum National d'Histoire Naturelle,
Paris, France
MNHU = Museum fir Naturkunde, Berlin,
Germany
SMTD =_ Senckenberg Naturhistorische Sammlun-
gen Dresden, Museum fir Tierkunde,
Dresden, Germany
MVHN = Museu Valencia d'Historia Natural,
Fundacion Entomologica Torres Sala,
Valencia, Spain
OUMNH = Oxford University Museum of Natural
History, Oxford, United Kingdom
PCCK = _ Personal collection Christian Kehlmaier,
Dresden, Germany
PCCP = Personal collection Chris J. Palmer,
Hampshire, United Kingdom
PCDG = Personal collection David J. Gibbs,
Weston-super-Mare, United Kingdom
PCJC = Personal collection Jocelyn Claude,
Labergement-Sainte-Marie, France.
PCME = Personal collection Martin J. Ebejer,
Cowbridge, United Kingdom
Bonn zoological Bulletin 68 (1): 31-60
PCNV = Personal collection Nikita Vikhrev,
Moscow, Russia.
PCPC = Personal collection Peter J. Chandler,
Melksham, United Kingdom
PCPW- = Personal collection Phil Withers,
Sainte Euphémie, France.
ZMUC = Zoological Museum, University of
Copenhagen, Denmark.
Other abbreviations used in the text
MT = Malaise trap
ZMCE = Zoological Museum Copenhagen Expedition
In order to study the ventral aspect of the male termi-
nalia, the syntergosternite 8 was separated from the ab-
domen and placed on a microscope slide in a drop of
glycerine. Illustrations were prepared by merging several
microphotographs, taken with a Nikon Coolpix 990 in
different planes at a magnification of 250 times, using
CombineZP (by Alan Hadley; http://www.hadleyweb.
pwp.blueyonder.co.uk), before redrawing them with Ink-
scape (Inkscape Community; http://www. inkscape.org).
The studied material originates from our own collect-
ing efforts or has been compiled by various institutions
or individuals during Malaise trap projects or collecting
trips, e.g., the Wetland Kerkini Biodiversity Study (cour-
tesy of Gordon J. Ramel, http://www.ramel.org/lake-ker-
kini/, 41°10'46"N 23°9'20"E) in Kendriki Makedonia,
Greece, and The Albufera International Biodiversity
Project (TAIB, courtesy of Nick J. Riddiford, https://
www.taib.info/en/, 39°47'50"N 3°6'22.5"E) in Mallorca,
Spain. These and additional localities are listed in more
detail (where available) in Appendix I.
Species records formerly presented in so-called “grey
literature”, e.g., the Annual Reports of the TAIB project
(Riddiford 2006; Riddiford & Férriz 2007), are included
in this study whereas records published in scientific jour-
nals holding an “International Standard Serial Number“
(ISSN) are referred to in Appendix II.
RESULTS
Description of new species
Cephalops (Semicephalops) brachium Kehlmaier &
Withers sp. n.
urn: |sid:zoobank. org: act: 24A74A 42-654C-4F8F-BA59-6F C428 984B4C
Figs 2A—G
Differential diagnosis. The species can be differentiat-
ed by the male genitalia with its elongated surstyli and
the long dorsal arm of the phallic guide. The female is
characterised by its small ovipositor that 1s pointing away
from the sternites. It 1s not clear at present to which spe-
©ZFMK
34 Christian Kehlmaier et al.
cies C. brachium is closely related to, as the long dorso-
medial arm of the phallic guide and the elongated sursty-
li are unique within Cephalops (Semicephalops) Fallén,
1810.
Description. MALE. Body length: about 3.6—3.7 mm
(head and terminalia detached in holotype). Head. Scape
and pedicel dark brown, flagellum yellowish. Pedicel
with three short dorsal bristles and 3-4 longer ventral
bristles, the longest almost reaching the tip of flagellum,
which is pointed below. Arista dark brown with broad-
ened base. Eyes meeting for length of frons (14 ommatid-
ial facets), which is silver pollinose. Occiput brown polli-
nose in upper quarter, otherwise grey pollinose. Thorax.
Postpronotal lobe same colour as scutum. Prescutum,
scutum and scutellum dark brown and brown pollinose.
Propleural hair fringe with six long hairs. Prescutum
and scutum with two dorsocentral rows of minute hairs.
Posterior hair fringe of scutellum minute. Wing length:
3.9-4.2 mm. Wing width: 1.3—1.4 mm. Length of third
costal section (LTC) 1.1—1.3 times length of fourth costal
section (LFC). Pterostigma as long as LTC. Wing cov-
ered with microtrichia. Only small basal cells of wing,
e.g., bc, and beginning of cells sc, c, r,, br and bm with
reduced microtrichia. Crossvein r-m reaches cell dm at
basal third of the cell’s length. Halter white but narrow-
ly brownish at base and partly dorsally on knob. Coxae
dark brown. Trochanters yellow. Fore and mid femora
Fig. 2. Cephalops (Semicephalops) brachium Kehlmaier & Withers sp. n. A. Right lateral view of male terminalia. B. Strictly
dorsal view of surstyli. C. Left lateral view of male terminalia. D. Dorsal view of syntergosternite 8 with membraneous area, ep-
andrium and surstyli. E. Dorsal view of ovipositor. F. Ventral view of phallic guide and phallus. G. Left lateral view of ovipositor.
Bonn zoological Bulletin 68 (1): 31-60
©ZFMK
New data on Mediterranean Pipunculidae 35
yellow with weak brownish tinge anterodorsally in bas-
al half. Hind femur yellow with stronger brownish tinge
in anterior half (anterior, dorsal and ventral). Fore femur
with antero- and posteroventral rows of black spines at
apex consisting of one to four spines. Mid femur with
antero- and posteroventral rows of black spines consist-
ing of 7-10 spines in apical two thirds. Hind femur with
anteroventral row of four peglike spines in anterior third.
Hind femur shining posteroventrally. Tibiae yellow. Hind
tibia with four longer hairs anteromedially. Tarsi yellow
with dititarsus brown. Pulvilli shorter than distitarsus.
Abdomen. All tergites dark brown, lacking distinct hairs
except tergite 1 with 3-4 hairs laterally. Genitalia: Dark
brown. Membranous area narrowly reaching epandrium
(Fig. 2D). Surstyli in strictly dorsal view elongated, rath-
er symmetric; right surstylus slightly longer (Fig. 2B).
In lateral view gently bent towards sternites (Figs 2A,
2C). Phallus trifid with one short and two longer ejacu-
latory ducts with cupular apices (Fig. 2F). Phallic guide
ankyroid with a long dorsomedial arm wrapping around
the ejaculatory ducts (Fig. 2F). FEMALE. Body length:
3.0 mm. Differing from male by eyes separated, with en-
larged anterior facets. Frons broadest at its middle where
four times wider than diameter of largest ommatidial fac-
et. Wing length: 3.7 mm. Wing width: 1.6—1.7 mm. Legs
can be entirely yellow. Femora with slightly reduced ven-
tral rows of dark peg-like spines. Pulvilli on fore and mid
leg as long as distitarsus, slightly shorter on hind Genita-
lia: Ovipositor in dorsal view (Fig. 2E) with base (tergite
7) dark brown, almost quadratic, and piercer (tergite 9)
yellow, as long as base and with triangular lateral flanges.
In lateral view (Fig. 2G), base with convex dorsal and
ventral margin; piercer straight and pointing away from
sternites; reaching to posterior margin of sternite 4.
Type material. HOLOTYPE 3 (DNA CK914, ENA
LT999991), FRANCE: Département Ardéche, Réserve
Naturelle Nationale des Gorges de |’Ardeche, TM n°12,
Malaise, 19.v1.2016, J. Claude [SMTD]. PARATYPES:
same data as holotype [1¢, PCJC]; Département Ar-
déche, Granzon, river bank, 25.v—27.vi.2010, P. Withers
[1¢, PCPW]. Additional material. SPAIN: “VD19”, D.
Ventura [12, SMTD]; same data as previous [2¢'¢ 19,
PECK
Remarks. The additional material from Spain was ex-
cluded from the type series due to the fragmentary lo-
cality data.
Etymology. The species epithet brachium is Latin for
‘arm’ or ‘forearm’, referring to the long arm or dorsome-
dian projection of the phallic guide. The specific epithet
is to be treated as a noun in apposition.
Bonn zoological Bulletin 68 (1): 31-60
Tomosvaryella osito Kehimaier, Gibbs & Withers sp. n.
urn: 1sid:zoobank. org: act: 2F DE06C2-3A B5-42C7-937B-AC7508CD3334
Figs 1A—B, 3A-—G
Differential diagnosis. The new species is unique within
Tomosvaryella Aczél, 1939 for its pilose appearance in
both sexes (Figs 1A—B). Based on the male terminalia,
T! osito sp. n. belongs to the minima species group that
comprise 7. minima (Becker, 1897), 7: hortobagyien-
sis Foldvari & De Meyer, 2000, 7’ resurgens De Meyer
(1997), and 7. sepulta De Meyer (1997). The latter two
Species were originally described from mainland Spain
and the shape of the surstyli resembles especially to
T! sepulta. However, the lateral shape of both surstyli is
distinctly more angular in 7: osito sp. n. (Figs 3A and
3C) compared to 7? sepulta. (De Meyer 1997: figs 12a
and 12c).
Description. MALE. Body length: 4.0 mm (prior to dis-
section). Head. Scape and pedicel dark brown, the latter
with some minute dorsal and ventral bristles. Flagellum
yellowish brown and long tapering. Arista with yellowish
broadened base, otherwise dark brown. Eyes meeting for
less then length of ocellar triangle (four facets). Frons
and face densely silver pollinose. Palpus yellowish. Lat-
erally, occiput silver pollinose with some weak brownish
pollinosity intermingled in anterior half; upper half twice
as broad as lower half. Thorax. Postpronotal lobe yellow,
densely silver pollinose, with about twelve long hairs.
Prescutum and scutum black, weakly silver pollinose,
covered with long white hairs along anterior and later-
al margins and with two dorsocentral rows that broaden
considerably in posterior third. Scutellum black, dense-
ly silver pollinose and entirely covered with long white
hairs. Subscutellum black and densely silver pollinose.
Pleura black, bare, weakly silver pollinose. Wing length:
3.8 mm; width: 1.1 mm. Length of third costal section
(LTC) 0.3 times length of fourth costal section (LFC).
Pterostigma absent. Wing covered with microtrichia ex-
cept partly bare in small basal cells, e.g., bc, and begin-
ning of cells sc, c, r,, br and bm. Crossvein r-m reaches
cell dm shortly after the middle of the cell's length. Hal-
ter narrowly brown at base, otherwise white. Legs dark
brown except yellow at tip of femur and in basal quar-
ter of tibia; silver pollinose except hind femur shining
posteroventrally. Hind trochanter without any distinct
protuberance or spines. Femora without ventral spines,
with posterodorsal and posteroventral row of white hairs,
complemented by an anterior row on hind femur. Hind
basitarsus flattened. Pulvilli slightly shorter than disti-
tarsus. Abdomen. Tergites black, shining but with an-
terolateral triangular patches of grey pollinosity; even-
ly covered with long white hairs (Figs 1A—B). Viewed
caudally, membranous area placed to the right (Fig. 3E).
Genitalia: Surstyli in strictly dorsal view rather sym-
metric, left one slightly longer; both with broad base and
©ZFMK
36 Christian Kehlmaier et al.
inward bent tips (Fig. 3B). In lateral view, both surstyli
are hunchbacked and bent towards sternites (Figs 3A &
C). Epandrium elongated, longer than surstyli (Fig. 3B).
Phallus with three short ejaculatory ducts; one duct bar-
ing five distinct spines pointing towards the phallic guide
(Fig. 3D). Phallic guide inconspicuous, rather long and
slim with a slight curve towards the epandrium in lat-
eral view (Fig. 3D). FEMALE. Body length: 3.7 mm.
Differing from male by eyes separated, with enlarged
anterior facets. Frons entirely silver pollinose except in
upper quarter, broadest in its middle, five times wider
than largest ommatidial facet. Occiput silver pollinose
A
in lower, weakly silver pollinose in upper half. Pleura
densely silver pollinose. Wing length: 3.4-3.5 mm. Wing
width: 1.1-1.2 mm. LTC 0.5 times LFC. Leg densely
silver pollinose. Anterior femur with two white bristles
at base. Tibiae yellow in basal third. Pulvilli as long as
distitarsus. Tergite 1—6 laterally silver pollinose, broadest
towards anterior margin. Genitalia: Ovipositor in dorsal
view (Fig. 3G) with base (tergite 7) dark brown, ovate,
longer than broad, weakly silver pollinose. Piercer with
tergite 8 (around anal opening) dark brown and shining;
tergite 9 (the actual piercer) thin, yellowish, shining.
C
B
F
Fig. 3. Zomosvaryella osito Kehlmaier, Gibbs & Withers sp. n. A. Lateral view of right surstylus. B. Strictly dorsal view of surstyli.
C. Lateral view of left surstylus. D. Right lateral view of phallus and phallic guide. E. Caudal view of syntergosternite 8. F. Right
lateral view of ovipositor. G. Dorsal view of ovipositor.
Bonn zoological Bulletin 68 (1): 31-60
©ZFMK
New data on Mediterranean Pipunculidae 37
Piercer twice length of base. In lateral view (Fig. 3F),
piercer straight, reaching posterior margin of sternite 3.
Type material HOLOTYPE <, SPAIN: Mallorca,
S’Albufera, Es Comu, 39°46'34"N 3°08'27"E, 20.v.2007,
D.J. Gibbs [SMTD]. PARATYPES: same data as holo-
type [14 (dissected), 22 9, PCDG]; same data as holo-
type [1¢, BMNH (not dissected); 2¢'4', OUMNH (not
dissected)]; same data as holotype [12, PCDG; 19,
BMNH; 12, OUMNH]; same data as holotype, 18.v.2007
[13 PCDG; 1412, BMNH (not dissected)]. FRANCE:
Aude, Narbonne, Gruissan, dunes a 7Jamarix, 13.v1.2006,
B. Nusillard [14', PCPW].
Etymology. The species epithet osito is Spanish for ‘lit-
tle bear’ and refers to the Teddybear-like appearance of
the new species. The specific epithet is to be treated as a
noun in apposition.
Tomosvaryella pugiunculus Kehlmaier & Gibbs sp. n.
urn: |sid:zoobank. org: act: 2C8CB334-3692-4A66-BOBS-0734D16AA9F2
Figs 4A-I, SA-C.
Differential diagnosis. The species cannot be attributed
to any specific species group at present. Important exter-
nal features to diagnose this species are the shape of the
flagellum in both sexes, with its filiform tip; the shape
of the male hind leg with the hollow femur base and the
bent tibia; the female ovipositor with its long, straight
piercer having weak lateral flanges; and the male termi-
nalia with a peculiar ventrocaudal aspect of the surstyli
(rather angular, their distal margin forming a horizontal
line; right gonopod larger than left one in ventral view;
phallus with three short ducts, one baring a small hook
at its base).
Description. MALE. Length from head to tip of scutel-
lum: 2.1 mm (abdomen missing due to dissection). Head.
Scape and pedicel dark brown, the latter with some
minute dorsal and ventral bristles. Flagellum yellowish
brown with a whitish filiform tip that is almost half the
length of flagellum (Fig. 4J). Arista dark brown with
broadened base. Eyes meeting for about twice length of
ocellar triangle (7-8 facets). Frons shining black; face
densely silver pollinose; palpus not assessable. Lateral-
ly, occiput weakly grey pollinose in lower and weakly
brown pollinose in upper half; the latter twice as broad as
lower half. Thorax. Postpronotal lobe yellowish white,
weakly grey pollinose, without distinct longer hairs. Pres-
cutum and scutum black, weakly brown pollinose, with
two dorsocentral rows of short hairs. Scutellum black,
weakly brown pollinose and with short hairs along pos-
terior margin. Subscutellum black, laterally densely, cen-
trally weakly silver pollinose. Pleura black, bare, weak-
ly silver pollinose. Wing length: 3.8 mm; wing width:
1.2 mm. Length of third costal section (LTC) about 0.3
Bonn zoological Bulletin 68 (1): 31-60
times length of fourth costal section (LFC). Pterostigma
absent. Wing covered with microtrichia except partly
bare in small basal cells, e.g., bc, and beginning of cells
sc, c, ,, br and bm. Crossvein r-m reaches cell dm at
the middle of the cell's length. Halter narrowly brown at
base, otherwise white. Legs with coxae and trochanters
dark brown. Hind trochanter without a distinct protuber-
ance or spines. Femura dark brown except yellow at tip:
silver pollinose except hind femur shining posteroven-
trally. Only mid femur with posterodorsal and postero-
ventral row of black ventral spines in apical half. Hind
femur ventrally hollowed in basal third, about two-thirds
the height as at its middle (Fig. 5C). Tibiae yellow but
with a brown tinge medially, especially dorsally, and ex-
tending towards the apex, more extensive and blackish
in One specimen. Hind tibia considerably bent (Fig. 5C).
Tarsal segments yellow. Hind basitarsus flattened. Pul-
villi slightly longer (front leg) or slightly shorter than
distitarsus (mid and hind leg). Abdomen. Tergites black,
shining but tergite 1 grey pollinosity; evenly covered
with short black hairs, tergite 1 with hairs paler, espe-
cially laterally where thy form a distinct, mono-serial fan
of longer bristly hairs. Tergite 3 latero-ventrally tapering
to a point clearly extended below the adjacent tergites.
Genitalia: Large, giving the abdomen a very clubbed
appearance. Viewed caudally, membranous area placed
to the right, narrow and sickle-shaped (Figs 4B, 4D).
Viewed ventrocaudally, surstyli rather angular, their dis-
tal margin forming a horizontal line (Fig. 4D). Strictly
dorsal, surstyli with broad base (broader on right sursty-
lus) and fingerlike apex; left surstylus slightly longer and
apically curved inwards (Fig. 4B). In lateral view base
of right sustylus considerably broader than on left sur-
stylus; fingerlike apex rather straight (Figs 4A, 4C). Ep-
andrium small, only slightly longer than surstyli. Viewed
ventrally, right gonopod larger than left one (Fig. 4B).
Phallus with three short ducts, one baring a small hook
at its base (Fig. 4F). FEMALE. Body length: 3.0 mm.
Differing from male by eyes separated, with distinctly
enlarged anterior facets. Frons entirely silver pollinose
in lower half, but shining in upper half, broadest in its
middle, four times largest ommatidial facet. Filiform tip
of flagellum slighty shorter. Wing length: 3.3 mm. Wing
width: 1.0 mm. Front femur with two white bristles at
base. Hind leg with femur not hollowed basally and tibia
less strongly bent. Pulvilli on fore and mid leg distinctly
longer than distitarsus; on hind leg shorter than distitar-
sus. Tergite 1 dark brown, weakly silver pollinose; with
lateral hair fan consisting of about twelve hairs reach-
ing on dorsal surface but diminishing in length towards
center. Tergite 2-6 dark brown, weakly silver pollinose,
laterally with short pale hairs that extend onto dorsal
surface along posterior margin. Genitalia: Ovipositor in
dorsal view (Fig. 41) with base (tergite 7) dark brown,
ovate, longer than broad, weakly silver pollinose. Pierc-
er (tergites 8 & 9) yellowish and shining. Transition be-
©ZFMK
38 Christian Kehlmaier et al.
wy
Pupyy
)
Wy
yy
H
Fig. 4. Zomosvaryella pugiunculus Kehlmaier & Gibbs sp. n. A. Lateral view of right surstylus. B. Strictly dorsal view of surstyli.
C. Lateral view of left surstylus. D. Dorso-caudal view of syntergosternite 8. E. Caudal view of syntergosternite 8. F. Left lateral
view of phallus and phallic guide. G. Ventral view of syntergosternite 8 without phallus. H. Left lateral view of ovipositor. I. Dorsal
view of ovipositor.
Bonn zoological Bulletin 68 (1): 31-60 ©ZFMK
New data on Mediterranean Pipunculidae 39
Fig. 5. Male 7? pugiunculus Kehlmaier & Gibbs sp. n. A. Left lateral view; paratype. B. Dorsal view; paratype. C. Anterior view
of left hind leg; holotype.
tween tergite 7 and 8 constricted. Tergite 9 with weak
lateral flanges in its middle. Piercer almost three times
length of base. In lateral view (Fig. 4H), piercer straight,
reaching posterior margin of sternite 3.
Type material HOLOTYPE <, SPAIN: Mallorca,
Cala Figuera, 39°56'56"N 3°10'18"E, 92 m, 21.v.2007,
D.J. Gibbs [SMTD]. PARATYPES: same data as ho-
lotype [1¢, PCDG; 14, BMNH; 1, OUMNH]; same
Table 1. Species list of Pipunculidae of The Albufera Interna-
tional Biodiversity Project (TAIB) (Spain, Mallorca). The list is
based on the herein presented records, partly published in Rid-
diford (2006 — records from 2001), Riddiford & Férriz (2007
— records from 2006) and previously unpublished records from
2007. Total: 20 species.
Cephalops vittipes (Zetterstedt, 1844)
Clistoabdominalis dilatatus (De Meyer, 1997)
Clistoabdominalis imitator (De Meyer, 1995)
Eudorylas bermeri Kehlmaier, 2005
Eudorylas mediterraneus De Meyer & Ackland, 1997
Eudorylas obliquus Coe, 1966
Eudorylas venturai Kehlmaier, 2005
Eudorylas wahisi De Meyer, 1997
Pipunculus aff. carlestolrai Kuznetzov, 1993
Pipunculus lenis Kuznetzov, 1991
Tomosvaryella cilitarsis (Strobl, 1910)
Tomosvaryella frontata (Becker, 1897)
Tomosvaryella geniculata (Meigen, 1824)
Tomosvaryella kuthyi (Aczél, 1944)
Tomosvaryella osito KehImaier, Gibbs & Withers sp. n.
Tomosvaryella pugiunculus Kehlmaier & Gibbs sp. n.
Tomosvaryella resurgens De Meyer, 1997
Tomosvaryella sepulta De Meyer, 1997
Tomosvaryella trichotibialis De Meyer, 1995
Verrallia aucta (Fallén, 1817)
Bonn zoological Bulletin 68 (1): 31-60
data as holotype [12, PCDG]; same data as holotype
[12, SMTD]; Mallorca, Puig de Sant Marti, 39°49'29"N
3°05'51"E, 19.v.2007, D.J. Gibbs [14', PCDG]; same
data as previous, 23.iv.2006 [14, PCDG]; Mallorca, Sa
Moleta, 712 m, 39°49'41"N 2°49'03"E, 21.v.2007, D.J.
Gibbs [14, PCDG; 14, BMNH; 1<', OUMNH]; Mallor-
ca, Sa Coveta Negra, 39°47'24"N 2°53'28"E, 21.v.2007,
D.J. Gibbs [14, PCDG; 14, BMNH].
Table 2. Species list of Pipunculidae of the Wetland Kerkini
Biodiversity Study (Greece) based on the herein presented re-
cords. Total: 22 species.
Chalarus brevicaudis Jervis, 1992
Chalarus indistinctus Jervis, 1992
Chalarus spurius (Fallén, 1816)
Verrallia aucta (Fallén, 1817)
Nephrocerus scutellatus (Macquart, 1834)
Cephalops (Semicephalops) straminipes (Becker, 1900)
Clistoabdominalis ruralis (Meigen, 1824)
Dorylomorpha imparata (Collin, 1937)
Dorylomorpha lautereri Albrecht, 1990
Eudorylas fluviatilis (Becker, 1900)
Eudorylas obliquus Coe, 1966
Eudorylas pannonicus (Becker, 1897)
Eudorylas trigonus (Becker, 1921)
Eudorylas unicolor (Zetterstedt, 1844)
Eudorylas zermattensis (Becker, 1897)
Tomosvaryella cilifemorata (Becker, 1907)
Tomosvaryella coquilletti (Kertész, 1907)
Tomosvaryella freidbergi De Meyer, 1995
Tomosvaryella geniculata (Meigen, 1824)
Tomosvaryella inermis De Meyer, 1995
Tomosvaryella israelensis De Meyer, 1995
Tomosvaryella kuthyi Aczél, 1944
©ZFMK
40 Christian Kehlmaier et al.
Etymology. The species epithet pugiunculus is Latin for
‘stiletto’, a little dagger, referring to the dorsal shape of
the ovipositor. The specific epithet is to be treated as a
noun in apposition.
FAUNISTICS
In this section we report the new material collected from
field excursions and new material studied from the col-
lections mentioned above, listed alphabetically following
the current subfamily and tribal classification (KehImai-
er et al. 2014, Raffael & De Meyer 1992). In the course
of this study, the presence of many species could be es-
tablished for various countries for the first time (marked
with an asterisk (*) after the country’s name). Appendix
II summarises these findings, providing species lists for
those countries, whose pipunculid fauna has not been
summarised in the past years, 1.e., Cyprus, Egypt, Greece,
Malta, Morocco, Tunisia, and Turkey. Tables 1—2 provide
species lists for two biodiversity studies, one conducted
at S’Albufera Natural Park (Mallorca, Spain) (Table 1)
and the second at Lake Kerkini and its associated Nature
Reserves (northern Greece) (Table 2).
CHALARINAE
Chalarus brevicaudis Jervis, 1992
GREECE*: Kendriki Makedonia, Kerkini, Ecotourism
site, 41°08'15.6"N 23°13'01.2"E, 45 m, 11-17.vii.2006,
G. Ramel, det. D.J. Gibbs [1 2, BMNH]. SPAIN: Madrid,
Monte de El Pardo, El Goloso, 40°31'14"N 3°44'42"W,
750 m, MT, 9-16.vi.1991, J.L. Nieves & C. Rey [16,
MNCN].
Chalarus exiguus (Haliday, 1833)
SPAIN: Madrid, Sierra de Guadarrama, Cercedil-
la, Estacion Bioldgica El Ventorrillo, 40°45'16.5"N
4°01'15.5"W, 1450 m, MT, 1-6.vi.1990, J.L. Nieves &
C. Rey [12, MNCN].
Chalarus fimbriatus Coe, 1966
FRANCE: Corsica, Forét d’Agnone, Vizzavona, 910 m,
30-31.v.2000, A.C. Pont, det. D.J. Gibbs [19, BMNH].
Chalarus indistinctus Jervis, 1992
FRANCE: Pyrénées-Orientales, forét de la Massane,
Col del Pal, 20.viii.2009, J. Garrigue, det. P. Withers [16',
PCPW]. GREECE*: Kendriki Makedonia, Kerkini, Be-
les, 41°17'19.5"N 23°12'18.4"E, 550 m, 11—17.1v.2005,
G. Ramel, det. D.J. Gibbs [12, BMNH]. SPAIN: Canta-
Bonn zoological Bulletin 68 (1): 31-60
bria, San Pedro de Bedoya, MT, 17—30.vu1i.1990, C. Rey
[329, MNCN].
Chalarus juliae Jervis, 1992
SPAIN: Madrid, Sierra de Guadarrama, Cercedil-
la, Estacion Bioldgica El Ventorrillo, 40°45'16.5'N
4°01'15.5'W, 1450 m, MT, 18—25.vili.1989, J.L.
Nieves & C. Rey [14¢, MNCN].
Chalarus latifrons Hardy, 1943
FRANCE: Alpes-Maritimes, Col du Méercantour,
29 viii.2010, P. Withers, det. P. Withers [1<', PCPW].
Chalarus spurius (Fallén, 1816)
FRANCE: Ardeéche, forét de Paiolive, Bildon, 29.vi—
21.vii.2011, M. Speight & E. Castella, det. P. Withers
[14, PCPW]; Pyrénées Orientales, forét de la Massane,
Ripisylve, 10.vi.2009, J. Garrigue, det. P. Withers [1¢,
PCPW]; Corsica, Forét d’Agnone, Vizzavona, 910 m,
30-31.v.2000, A.C. Pont, det. D.J. Gibbs [19, BMNH];
same data as previous, 1—2.vi.2000 [229, BMNH].
GREECE*: Kendriki Makedonia, Kerkini, Beles,
41°17'19"N 23°12'18"E, 25.1v—1.v.2005, G. Ramel, det.
D.J. Gibbs [19, PCDG]; same data as previous, 30.v—5.
v1.2005 [22 2, PCDG]. SPAIN: Madrid, Sierra de Gua-
darrama, Cercedilla, Estacion Bioldgica El Ventorrillo,
40°45'16.5"N 4°01'15.5''W, 1450 m, MT, 1-7.v.1990,
J.L. Nieves & C. Rey [192, MNCN]; same data as previ-
ous, 7-15.v.1990 [49 9, MNCN]; same data as previous,
15-22.v.1990 [429°, MNCN]; same data as previous,
23-31.v.1990 [329, MNCN]; same data as previous,
9-16.vi.1989 [229, MNCN]; same data as previous,
30.vi-6.vii.1989 [14, MNCN]; same data as previous,
10.vi1.1991 [12, MNCN]; same data as previous, 21—28.
1x.1989 [12, MNCN]; Gerona, Caralps, 1200-1300 m,
13-17.v1.1982, S. Andersen, L. Lyneborg, V. Michelsen
[14, ZMUC].
Chalarus zyginae Jervis, 1992
SPAIN*: Madrid, Monte de El Pardo, El Goloso,
40°31'14"N 3°44'42"W, 750 m, MT, 24-31.vii.1991, J.L.
Nieves & C. Rey [12, MNCN]; same data as previous,
1-8 viii.1991 [1¢ 399, MNCN; 19, PCCK]; Cantabria,
San Pedro de Bedoya, MT, 17—30.viii.1990, C. Rey [19,
MNCN].
Remarks. Previously C. zyginae has only been recorded
from the type specimens, reared from Zygina suavis Rey,
1891 (Hemiptera: Cicadellidae: Typhlocybinae) collect-
ed in Italy. The total body size of the specimens studied
here lies between 1.7 and 2.3 mm, fitting well to the spe-
cies concept presented in Jervis (1992).
©ZFMK
New data on Mediterranean Pipunculidae 4]
Jassidophaga pilosa (Zetterstedt, 1838)
FRANCE*: Pyrénées-Orientales, forét de la Massane,
réserve intégrale, 14.v.2009, J. Garrigue, det. P. Withers
[329, PCPW].
Jassidophaga villosa (von Roser, 1840)
FRANCE: Ardeche, forét de Paiolive, Langarneyre,
28.iv—25.v.2010, M. Speight & E. Castella, det. P. With-
ers [39 2, PCPW]; Ardeche, forét de Paiolive, Combe de
Bouse, 8—28.1v.2010, M. Speight & E. Castella, det. P.
Withers [1¢, PCPW]; Ardéche, forét de Paiolive, Gran-
zon, 28.1v—25.v.2010, M. Speight & E. Castella, det. P.
Withers [19, PCPW]. SPAIN: Gerona, Caralps, 1200-
1300 m, 13—17.v1.1982, S. Andersen, L. Lyneborg, V.
Michelsen [19, ZMUC].
Remarks. First French records with locality data. Previ-
ously, only a country record of unknown provenance was
published (De Meyer 1992; Withers 2006).
Verrallia aucta (Fallén, 1817)
CYPRUS*: Diarizos Valley, Nikoklela, 70 m, 23.iv.2002,
M.J. Ebejer, det. D.J. Gibbs [1¢, PCME]. FRANCE: Ar-
déche, forét de Paiolive, Hermitage, 28.1v—23.v.2010, M.
Speight & E. Castella, det. P. Withers [19, PCPW]; Ar-
deche, forét de Paiolive, 23.v—26.v1.2010, M. Speight &
E. Castella, det. P. Withers [1¢, PCPW]; Ardéche, forét
de Paiolive, Combe des Bouses, 28.1v—25.v.2010, M.
Speight & E. Castella, det. P. Withers [1¢', PCPW]; Ar-
deche, forét de Paiolive, Montchamp, 24.v—31.v1.2009,
M. Speight & E. Castella, det. P. Withers [1¢, PCPW];
Ardeéche, forét de Paiolive, Langarneyre, 26.vi—10.
vii.2010, M. Speight & E. Castella, det. P. Withers [1¢,
PCPW]; Ardeéche, forét de Paiolive, Chibasse, 25.v—27.
vi.2010 M. Speight & E. Castella, det. P. Withers [1¢,
PCPW]. GREECE*: Peloponnisos, Taiyetos mountains,
950-1800 m, 15—19.v.1990, ZMCE [12 (DNA CKS583,
ENA LT999989), ZMUC]; Kendriki Makedonia, Kerki-
ni, Ecotourism site, 41°08'15.6"N 23°13'01.2"E, 45 m,
16—22.v.2006, G. Ramel, det. D.J. Gibbs [19, BMNH];
Kendriki Makedonia, Kerkini, Kerkini marsh site,
41°13'32.8"N 23°05'04.2"E, 45 m, 25.iv—1.v.2007, G.
Ramel, det. D.J. Gibbs [12, BMNH]. PORTUGAL: Al-
garve, Albufeira, 27.11—4.111.1988, A.E. Stubbs, det. D.J.
Gibbs [1', PCDG]. SPAIN: Salamanca, Villar de Cier-
vo, Las Coronas, 17—21.v.2005, H.-P. Tschorsnig [1<,
PCCK]; Gerona, Caralps, 1200-1300 m, 13-16.vi.1982,
S. Andersen, L. Lyneborg, V. Michelsen [19, ZMUC];
Madrid, Sierra de Guadarrama, Cercedilla, Estacion
Biologica El Ventorrillo, 40°45'16.5"N 4°01'15.5'"W,
1450 m, MT, 1-6.v1.1990, J.L. Nieves & C. Rey [18,
MNCN]; same data as previous, 16—22.vi.1989 [19,
MNCN]; same data as previous, 22—30.vi.1989 [29°,
Bonn zoological Bulletin 68 (1): 31-60
MNCN]; same data as previous, 30.vi-6.vii.1989
[329, MNCN]; same data as previous, 6—14.v11.1989
[12, MNCN]; same data as previous, 12.vii.1991 [19,
MNCN]; same data as previous, 14—21 .vii.1989 [29 9,
MNCN]; same data as previous, 20—28.vii.1989 [19,
MNCN]; same data as previous, 28 .vii-4.vili.1989 [19,
MNCN]; Mallorca, Puig de Sant Marti, 39°49'29"N
3°05'S1"E, 23.1v.2006, D.J. Gibbs, det. D.J. Gibbs [72 8,
PCDG]; 16.1v.2001, Mallorca, S’Albufera, Es Comu,
M.J. Ebejer, det. M.J. Ebejer [14, PCME]. TUNISIA*:
Tabarka area, 7—-18.v.1988, ZMCE [2° 2 (Jeff Skeving-
ton specimen # 8542 & 8543; 192 DNA CK582, ENA
LT999990), ZMUC].
NEPHROCERINAE
Nephrocerus scutellatus (Macquart, 1834)
FRANCE: Ardéche, forét de Paiolive, Combe de Bouse,
25.v—26.v1.2010, M. Speight & E. Castella, det. P. With-
ers [1¢, PCPW]; Ardéche, forét de Paiolive, Bildon,
6—28.iv.2010, M. Speight & E. Castella, det. P. Withers
[14, PCPW]; Ardéche, forét de Paiolive, Montchamp,
28.iv—22.v.2010, M. Speight & E. Castella, det. P. Withers
[14, PCPW]; same data as previous, 6.v—29.vi.2011, M.
Speight & E. Castella, det. P. Withers [1', PCPW]; Ar-
deche, forét de Paiolive, Langarneyre, 28.1v—25.v.2010,
M. Speight & E. Castella, det. P. Withers [1¢, PCPW];
same data as previous, 26.vi-10.vil.2010, M. Speight &
E. Castella, det. P. Withers [1¢, PCPW]; Ardéche, forét
de Paiolive, Hermitage, 8—28.1v.2010, M. Speight & E.
Castella, det. P. Withers [14, PCPW]; same data as pre-
vious, 28.1v—23.v.2010, M. Speight & E. Castella, det. P.
Withers [1<, PCPW]; Granzon, 8—28.iv.2010, M. Spei-
ght & E. Castella, det. P. Withers [1<, PCPW]; same data
as previous, 28.1v—25.v.2010, M. Speight & E. Castella,
det. P. Withers [1', PCPW]; Granzon, 25.v—27.vi.2010,
M. Speight & E. Castella, det. P. Withers [22 9, PCPW];
Ardeche, forét de Paiolive, Chibasse, 25.v—27.v1.2010,
M. Speight & E. Castella, det. P. Withers [1¢, PCPW];
Ardeche, Réserve Naturelle Nationale des Gorges de
lArdéche, 15.iv.2015, J. Claude, det. P. Withers [1¢,
PCPW]; Pyrénées-Orientales, forét de la Massane, Rip1,
3.vi.2009, J. Garrigue, det. P. Withers [1', PCPW]; Var,
Vidauban, 7.v.2014, T. Ramage, det. P. Withers [19,
PCPW]. GREECE*: Peloponnisos, 15 km N Leonidhion,
27.iv.1998, V. Michelsen [1<', ZMUC]; Thessaly, Volos,
Platania, 12.v.2005, L. & K. Standfuss [1¢, PCCK];
same data as previous, 18.v.2005 [1', PCCK]; Pelopon-
nisos, Taiyetos mountains, 950-1800 m, 15—19.v.1990,
ZMCE [43:3 ZMUC]; Ipiros, Smolikas mountains,
700-1500 m, 21—22.v.1994, V. Michelsen [19°, ZMUC];
Ipiros, Peristéri mountains, 1200-1700 m, 24—28 .v.1994,
S. Andersen [19, ZMUC]; Kendriki Makedonia, Ker-
kini, Kerkini marsh site, 41°13'32.8"N 23°05'04.2"E,
45 m, 25.iv—1.v.2007, G. Ramel, det. D.J. Gibbs [19,
©ZFMK
42 Christian Kehlmaier et al.
BMNH]; Kendriki Makedonia, Kerkini, Krousia mts.
site, 41°11'32.4'N 23°03'59.5"E, 190 m, 30.v—5.v1.2007,
G. Ramel, det. D.J. Gibbs [1 9, BMNH]; Kendriki Make-
donia, Kerkini, Ramna site, 41°17'43’N 23°11'33"E
750 m, 16—22.vi.2008, G. Ramel, det. D.J. Gibbs [1¢,
PCDG]. SPAIN: Lerida, Sorpe, 1200-1300 m, 19-22.
vi.1982, S. Andersen, L. Lyneborg, V. Michelsen [724
coll. ZMUC].
PIPUNCULINAE
PIPUNCULINI
Pipunculus campestris Latreille, 1802
SPAIN: Pontevedra, Sanxenxo, 42°24'53.1'"N,
8°52'04.7"'W, 6 m, 24.viii.2008, R. Andrade [1,
PCCK]; Gerona, Caralps, 1200-1300 m, 13—17.vi.1982,
S. Andersen, L. Lyneborg, V. Michelsen [44'3', ZMUC].
Pipunculus aff. carlestolrai Kuznetzov, 1993
FRANCE: Ardeéche, forét de Paiolive Bildon, 25.vui.2010,
M. Speight & E. Castella [14', SMTD]; Ardéche, forét
de Paiolive Bildon, Granzon, 25.vii.10, M. Speight & E.
Castella, det. P. Withers [14, PCPW]. SPAIN: Mallorca,
Puig de Sant Marti, 39°49'29"N 3°05'51"E, 23.iv.2006,
D.J. Gibbs [14 299, SMTD].
Remarks. A final taxonomic conclusion could not be es-
tablished yet. The specimens from Mallorca have been
published previously as P. carlestolrai in Riddiford &
Férriz (2007).
Pipunculus elegans Egger, 1860
FRANCE*: Ardeéche, forét de Paiolive, Langarneyre,
28.1v—25.v.2010, M. Speight & E. Castella, det. P. With-
ers [14 PCPW].
Pipunculus lenis Kuznetzov, 1991
FRANCE: Ardeéche, forét de Paiolive, Combe des Bous-
es, 25.v—26.v.2010, M. Speight & E. Castella, det. P.
Withers [12, PCPW]. SPAIN: Mallorca, S’Oliveret
d’Abaix, Alaré, 28.v.2007, J. Lilla, det. D.J. Gibbs [19,
PCDG]; Burgos, near Ona, 19.vi.1980, P.J. Chandler, det.
P.J. Chandler [1', PCPC].
Pipunculus oldenbergi Collin, 1956
SPAIN*: Asturias, Covadonga, 11.v.1928, J. Dusmet
[14, MNCN].
Bonn zoological Bulletin 68 (1): 31-60
Pipunculus tenuirostis Kozanek, 1981
FRANCE: Ardeche, forét de Paiolive, Hermitage, 9-28.
iv.2010, M. Speight & E. Castella, det. P. Withers [2° 9,
PCPW].
Pipunculus tumbarinus Kehlmaier, 2010
TUNISIA*: 13 km N Ain Draham, 22—24.111.1986,
ZMCE [1¢, ZMUC]; 5 km E Tamera, 21-25 .iii.1986,
ZMCE [14,, ZMUC]; Ain Draham area, 5—18.v.1988,
ZMCE [14 (DNA CK581, ENA LT999988), ZMUC].
Remarks. Species only known previously from its type
locality on Sardinia, Italy.
Pipunculus zugmayeriae Kowarz, 1887
SPAIN*: Logrofio, Villanueva de Cameros, 20.v1.1980,
PJ. Chandler, det. PJ. Chandler, vid. D.J. Gibbs [1-,
PERCH
CEPHALOPSINI
Cephalops (Cephalops) aeneus Fallen, 1810
FRANCE: Ardeéche, forét de Paiolive, Montchamp,
30.vill—29.1x.2011, M. Speight & E. Castella, det. P.
Withers [12, PCPW]. ITALY: Sicily, Catania, Etna, Pia-
no della Donne, 1450 m, 5.v1.1999, M.J. Ebejer, det. M.J.
Ebejer [1<, PCME].
Cephalops (Cephalops) conjunctivus Coe, 1958
FRANCE: Ardeche, forét de Paiolive, Langarneyre,
30.ix.10, M. Speight & E. Castella, det. P. Withers [16',
PCPW]; Granzon, 25.v—27.v1.2010, M. Speight & E.
Castella, det. P. Withers [1¢, PCPW]. SPAIN: Malaga,
Sierra de Tejeda, Maro, 19.1v.1997, C.J. Palmer, det. D.J.
Gibbs [192, C.J. Palmer]; Valencia, Fuente del Abrulla-
dor, Chella, 39°02'32"'N 0°40'50"'W, 25.v.2006, S. Mon-
tagud et al. [1¢, MVHN (Cod. 280308MP22)]; Andalu-
cia, W of Capilerilla, 36°56'21"N 3°20'26"W, 1480 m,
7.vi.2008, D.J. Gibbs, det. D.J. Gibbs [1¢, PCDG];
Madrid, Monte de El Pardo, El Goloso, 40°31'14"N
3°44'42"W, 750 m, 1-8.vi.1991, J.L. Nieves & C. Rey
[12, MNCN]; same data as previous, 9-16.vi.1991 [1¢,
MNCN]; Madrid, El Boalo, 40°43'19"N 3°55'03"W,
940 m, 22-28 .vi.1998, F. Fontal [1d 192, MNCN]; Jaén,
Sierra de Cazorla, Roblehondo, 1300 m, 23—29.v1.1993,
J.L. Nieves [19, MNCN]; Madrid, Monte de El Pardo, El
Goloso, 40°31'14"N 3°44'42"W, 750 m, 17—23.1x.1991,
J.L. Nieves & C. Rey [2¢'4, MNCN]; same data as pre-
vious, 1—8.x.1991 [22 2, PCCK]; same data as previous,
9-17.x.1991 [14 PCCK]. TURKEY: Antalya, 40 km
©ZFMK
New data on Mediterranean Pipunculidae 43
N of Akseki, 1700 m, 28.ix.2006, N. Vikhrev, det. DJ.
Gibbs [13, PCNV].
Cephalops (Cephalops) vittipes (Zetterstedt, 1844)
FRANCE: Ardeéche, forét de Paiolive, Baildon,
25.vili.2010, M. Speight & E. Castella, det. P. Withers
[12, PCPW]. SPAIN*: Mallorca, S’Albufera, Es Comu,
39°46'34"N 3°08'27"E, 2 m, 18.v.2007, D.J. Gibbs, det.
D.J. Gibbs [1¢, PCDG]; Mallorca, Puig de Sant Marti,
39°49'29"N 3°05'51"E, 19.v.2007, D.J. Gibbs, det. D.J.
Gibbs [19°, PCDG].
Cephalops (Parabeckerias) obtusinervis (Zetterstedt,
1844)
GREECE*: Peloponnisos, Taiyetos mountains, 950-
1800 m, 15—19.v.1990, ZMCE [12, ZMUC].
Cephalops (Semicephalops) grandimembranus De Mey-
erlOsg
FRANCE*: Ardéche, forét de Paiolive, Chibassse,
28.iv—25.v.2010, M. Speight & E. Castella, det. P. With-
ers [14,, PCPW]; Bildon, 28.vii-31.viii.2010, M. Spei-
ght & E. Castella, det. P. Withers [14, PCPW].
Remarks. This species was formerly only known from
its type locality in southern Germany (Bavaria, Hohena-
schau im Chiemgau).
Cephalops (Semicephalops) penultimus Ackland, 1993
SPAIN*: Madrid, Sierra de Guadarrama, Cercedil-
la, Estacion Biologica El Ventorrillo, 40°45'16.5"N
4°01'15.5"W, 1450 m, 6-14.vii.1989, J.L. Nieves &
C. Rey [1¢, MNCN]; same data as previous, 20-28.
vii. 1989 [12, MNCN]; same data as previous, 28.vii-4.
viii. 1989 [1¢ 12, PCCK; 12, MNCN]; same data as pre-
vious, 11—18.viii.1989 [1<, MNCN]; same data as previ-
ous, 25.—31.vili.1989 [12, MNCN].
Remarks. The specimens cited in Kehlmaier (2001) un-
der the name Cephalops subultimus Collin, 1956 were
misidentified and actually belong to C. penultimus.
Cephalops subultimus must be deleted from the Span-
ish checklist as no other Spanish record of this species
is known or published. Cephalops penultimus has only
recently been described and detailed figures and a key
for identification are provided by Ackland (1993). So far,
C. penultimus is known from Belgium, France, Germany,
Great Britain, Portugal, and Spain.
Bonn zoological Bulletin 68 (1): 31-60
Cephalops (Semicephalops) perspicuus (de Meijere, 1907)
GREECE*: Peloponnisos, 5 km S Monemvasia,
17.vi.1984, G. Christensen [1.<', ZMUC].
Cephalops (Semicephalops) straminipes (Becker, 1900)
GREECE®*: Kendriki Makedonia, Kerkini, Kerkini lake
site, 41°09'06.5"N 23°11'55.0"E, 75 m, 9-15.v.2005, G.
Ramel, det. D.J. Gibbs [12, BMNH].
Cephalops (Semicephalops) subultimus Collin, 1956
FRANCE: Ardeéche, forét de Paiolive, Granzon, 25.v—
27.vi.2010, M. Speight & E. Castella, det. P. Withers
[14, PCPW]; Chibasse, 28.iv—25.v.2010, M. Speight &
E. Castella, det. P. Withers [14¢, PCPW].
Cephalops (Semicephalops) ultimus (Becker, 1900)
FRANCE: Ardeéche, forét de Paiolive, Granzon,
30.1x.2010, M. Speight & E. Castella, det. P. With-
ers [1¢, PCPW]. SPAIN: Madrid, Sierra de Guadar-
rama, Cercedilla, Estacion Biologica El Ventorrillo,
40°45'16.5'"N 4°01'15.5"W, 1450 m, 6-14. vii.1989, J.L.
Nieves & C. Rey [2¢'¢, MNCN]; same data as previ-
ous, 14—21.vii.1989 [19, MNCN]; Asturias, Tanda, 2—9.
vill. 1993, C. Rey [12, MNCN]; Madrid, Sierra de Gua-
darrama, Cercedilla, Estacion Bioldgica El Ventorrillo,
40°45'16.5"N 4°01'15.5'"W, 1450 m, 21—28.1x.1989, J.L.
Nieves & C. Rey [12, MNCN]. TURKEY*: Isparta,
Kovada, 7.vii.1997, M.J. Ebejer, det. D.J. Gibbs [1¢,
PCME]; Mugla, Marmaris, 14.v11.1997, M.J. Ebejer, det.
D.J. Gibbs [344 M.J. Ebejer].
Remarks. The recently described Cephalops lusitan-
icus Kehlmaier & Andrade, 2016 from Portugal stands
very close to C. u/timus. A separation of these species
based on external morphology and genitalic characters is
provided in Kehlmaier & Andrade (2016). Female speci-
mens of C. ultimus from the Mediterranean tend to have
yellowish abdominal markings as seen in C. perspicuus.
Hence, a closer look at the female ovipositor is necessary
to distinguish the C. u/timus from C. perspicuus (see Ke-
hlmaier & Andrade 2016).
Cephalops (Semicephalops) varipes (Meigen, 1824)
SPAIN: Madrid, Sierra de Guadarrama, Cercedil-
la, Estacion Biologica El Ventorrillo, 40°45'16.5"N
4°01'15.5"W, 1450 m, 28. vil-4.vill.1989, J.L. Nieves &
C. Rey [12, MNCN]; same data as previous, 11-18.
vill. 1989 [19, MNCN].
Remarks. The holotype of Pipunculus varipes Meigen,
1824 was recently studied and found to be the senior syn-
©ZFMK
44 Christian Kehlmaier et al.
onym of Pipunculus semifumosus Kowarz, 1887 (Kehl-
maier 2008b).
Cephalosphaera (Cephalosphaera) furcata (Egger, 1860)
FRANCE: Corsica, Forét d’Agnone, Vizzavona, 910 m,
28-29 v.2000, A.C. Pont, det. D.J. Gibbs [16', BMNH].
Cephalosphaera (Cephalosphaera) germanica Aczél, 1940
FRANCE: Ardéche, forét de Paiolive, Chibasse, 8-28.
iv.2010, M. Speight & E. Castella, det. P. Withers [19,
PCPW]; Pyrénées-Orientales, forét de la Massane, ré-
serve intégrale, 14.v.2009, J. Garrigue, det. P. Withers
[12, PCPW]. SPAIN: Jaén, Sierra de Cazorla, Ro-
blehondo, 1300 m, 28.v—15.vi.1993, J.L. Nieves [19,
MNCN]; Soria, San Leonardo de Yagtie, 15.v1.1991, C.
Rey [12, MNCN]; Madrid, Sierra de Guadarrama, Cer-
cedilla, Estacion Bioldgica El Ventorrillo, 40°45'16.5'"N
4°01'15.5''W, 1450 m, 9-16.vi.1989, J.L. Nieves & C.
Rey [1¢, MNCN]; Jaén, Sierra de Cazorla, Roblehondo,
1300 m, 23—29.v1.1993, J.L. Nieves [192, MNCN]; Ma-
drid, Sierra de Guadarrama, Cercedilla, Estacion Biologi-
ca El Ventorrillo, 40°45'16.5"N 4°01'15.5"W, 1450 m,
6—14.vii.1989, J.L. Nieves & C. Rey [1¢, MNCN].
EUDORYLINI
Claraeola conjuncta (Collin, 1949)
TUNISIA*: 15 km NW Kebili, 17.iii. 1986, ZMCE [1¢,
ZMUC].
Remarks. The species was redescribed by Kehlmaier
(2005b).
Clistoabdominalis dilatatus (De Meyer, 1997)
FRANCE: Ardeéche, forét de Paiolive, Combe de Bouse,
28.iv—25.v.2010, M. Speight & E. Castella, det. P. With-
ers [1<, PCPW]; Pyrénées-Orientales, forét de la Mas-
sane, Col del Pal, 8.vii.2009, J. Garrigue, det. P. With-
ers [1¢, PCPW]; same data as previous, 20.viii.2009, J.
Garrigue, det. P. Withers [1¢', PCPW]. SPAIN: Valen-
cia, Losa del Obispo, 39°42'02'"'N 0°52'09""W, 3.iv.2008,
S. Teruel [14, MVHN (Cod. 270308SM38)]; Asturias,
Corros (de Parcal), 10.v.1990, C. Rey [14', MNCN]; Sal-
amanca, Villar de Ciervo, Las Coronas, 17—21.v.2005,
H.-P. Tschorsnig [1<, PCCK]; Mallorca, S’Albufera,
Es Comu, 39°46'34"N 3°08'27”E, 2 m, 20.iv.2006, D.J.
Gibbs, det. D.J. Gibbs [46'3' 299, PCDG]; Mallorca,
Puig de Sant Marti, 39°49'29"N 3°05'51"E, 23.iv.2006,
D.J. Gibbs, det. D.J. Gibbs [1', PCDG]; Mallorca, S’ Al-
bufera, Es Comu, dunes, 39°46'34"N 3°08'27”"E, 2 m,
25.iv.2006, D.J. Gibbs, det. D.J. Gibbs [1 2, PCDG].
Bonn zoological Bulletin 68 (1): 31-60
Clistoabdominalis imitator (De Meyer, 1995)
SPAIN: Mallorca, Puig de Sant Marti, 39°49'29"N
3°05'51"E, 19.v.2007, D.J. Gibbs, det. D.J. Gibbs [13
12, PCDG].
Clistoabdominalis ruralis (Meigen, 1824)
FRANCE: Alpes-Maritimes, Biot, 20—26.1x.2010, A.
Piton, det. P. Withers [1<4, PCPW]; Ardéche, forét de
Paiolive, Montchamp, 28.vii—31.viil.2010, M. Speight &
E. Castella, det. P. Withers [1', PCPW]. GREECE: Chi-
os, Thimiana, 38°17'87"N 26°07'89"E, 6—16.v.2003, C.J.
Palmer, det. D.J. Gibbs [2¢'3', C.J. Palmer]; Kendriki
Makedonia, Kerkini, Pumping station site, 41°12'48.7'"N
23°06'11.9"E, 40 m, 13—19.vi.2007, G. Ramel, det. D.J.
Gibbs [24'3', BMNH]; Kendriki Makedonia, Kerkini,
Kerkini lake site, 41°09'06.5"N 23°11'55.0"E, 75 m,
9-15.v.2005, G. Ramel, det. D.J. Gibbs [14, BMNH];
Kendriki Makedonia, Kerkini, Krousia Mts. site,
41°11'32.4"N 23°03'59.5"E, 190 m, 4—10.vil.2007, G.
Ramel, D.J. Gibbs [1<', BMNH]; Kendriki Makedonia,
Kerkini, Krousia Mts. site, 41°11'32.4""N 23°03'59.5"E,
190 m, 30.v—5.vi.2007, G. Ramel, det. D.J. Gibbs [14,
BMNH]; Peloponnisos, Monemvasia, 8.xi1.1984, G.
Christensen [16', ZMUC]. MALTA: Buskelt, 9.vii.1993,
M.J. Ebejer, det. D.J. Gibbs [14', PCDG]. TURKEY: An-
talya, Side, dunes, 30.1x.2007, N. Vikhrev, det. D.J.Gibbs
[1¢, PCDG].
Clistoabdominalis trochanteratus (Becker, 1900)
EGYPT: Safaga, 27.1.2007, N. Vikhrev, det. D.J. Gibbs
(344, PCDG]. TUNISIA*: Nefta area, 1-4.v.1988,
ZMCE [14, ZMUC].
Remarks. Clistoabdominalis trochanteratus 1s widely
distributed and most likely represents a species complex
(Skevington et al. 2007). The type locality is “Assiut,
Luxor” in Egypt. From the Palaearctic, it has also been
cited from Portugal (Kehlmaier & Andrade 2016), the
Asian part of Turkey (Kehlmaier 2005a), and Iran (Ma-
jnon Jahromi et al. 2017a).
Clistoabdominalis tumidus (De Meyer, 1997)
FRANCE: Ardéche, forét de Paiolive, Chibasse, 25.v—
27.v1.2010, M. Speight & E. Castella, det. P. Withers
[14, PCPW]; Ardéche, forét de Paiolive, Montchamp,
29.vi-21.vil.2011, M. Speight & E. Castella, det. P.
Withers [1', PCPW]; Ardéche, forét de Paiolive, Gran-
zon, 6.v—29.vi.2011, M. Speight & E. Castella, det. P.
Withers [1', PCPW]; same data as previous, 29.vi-21.
vii.2011, M. Speight & E. Castella, det. P. Withers [13',
PCPW]. GREECE: Peloponnisos, Taiyetos mountains,
950-1800 m, 15-19.v.1990, ZMCE [1¢', ZMUC].
©ZFMK
New data on Mediterranean Pipunculidae 45
Dasydorylas gradus Kehlmaier, 2005
TURKEY*: 30.v.2008, Antalia,
Vikhrev, det. D.J. Gibbs [16', PCDG].
Gundogmus, N.
Remarks. A distinctive species, formerly known only
from Israel (Kehlmaier 2005b).
Dasydorylas holosericeus (Becker, 1987)
FRANCE: Ardeéche, forét de Paiolive, Combe de Bouse,
8—28.1v.2010, M. Speight & E. Castella, det. P. Withers
[14, PCPW]; same data as previous, 8.ix—4.x.2010, M.
Speight & E. Castella, det. P. Withers [1', PCPW]; Ar-
deche, forét de Paiolive, Langarneyre, 26.vi-10.vii.2010,
M. Speight & E. Castella, det. P. Withers [1¢, PCPW];
same data as previous, 28.vii—3.vill.2010, M. Speight &
E. Castella, det. P. Withers [1¢, PCPW]; Ardéche, forét
de Paiolive, Granzon, 29.vi-21.vii.2011, M. Speight & E.
Castella, det. P. Withers [1¢, PCPW]. GREECE*: Ken-
driki Makedonia, Kerkini, Procom site, 41°22'38.1"N
23°21'58.8"E, 60 m, 27.vi-3.vil.2007, G. Ramel, det.
D.J. Gibbs [14¢, PCDG]. SPAIN*: Gerona, Caralps,
1200-1300 m, 13—17.vi.1982, S. Andersen, L. Lyneborg,
V. Michelsen [1', ZMUC].
Remarks. First reliable citing from Spain. A previous
Spanish record, as FE. demeyeri Kozanek, 1993 (see
Kehlmaier 2005a for synonymy), needs confirmation due
to a possible confusion with Dasydorylas roseri (Becker,
1897). The type material of E. demeyeri proved to be a
mixture of D. holosericeus and D. roseri, but the identity
of the single Spanish paratype could not be revalidated
so far.
Dasydorylas horridus (Becker, 1897)
FRANCE: Ardeéche, forét de Paiolive, Granzon, 28.1v—
25.v.2010, M. Speight & E. Castella, det. P. Withers [1¢,
PCPW]; Ardeéche, forét de Paiolive, Chibasse, 28.1v—
25.v.2010, M. Speight & E. Castella, det. P. Withers [1¢,
PCPW].
Dasydorylas setosus (Becker, 1908)
SPAIN: Canary Islands, Tenerife, Monte Aguirre, v.1927,
A. Cabrera [1¢, MNCN]; Canary Islands, Tenerife,
Médano, 18.iv.1930, A. Cabrera [14, MNCN]; Canary
Islands, Tenerife, Monte Aguirre, xi1.1934, A. Cabrera
[12, MNCN].
Eudorylas angustimembranus (Kozanek, 1991)
FRANCE*: Ardeche, forét de Paiolive, Bildon, 28.vii—
31.vill.2010, M. Speight & E. Castella, det. P. Withers
Bonn zoological Bulletin 68 (1): 31-60
[14, PCPW]; same data as previous, 30.ix.2010, M.
Speight & E. Castella, det. P. Withers [1¢', PCPW].
Eudorylas bermeri Kehlmaier, 2005
SPAIN: Granada, Barranco de Miranda, 8 km SW Or-
giva, 300 m, 20.iv.1966, L. Lyneborg & M. Lange-
mark [14, ZMUC]; Mallorca, S’Albufera, Es Comt,
39°46'34"N 3°08'27"E, 2 m, 25.iv.2006, det. D.J. Gibbs
[14¢, PCDG]; Almeria, Adra, 36°47'10"N, 3°5'44.5'"'W,
433 m, 9.v.2012, R. Andrade [1¢ 19, PCCK]; Ibiza,
Torre de Ses Portes, P.N. Ses Salines, 30.v.2006, M.J.
Ebejer, det. D.J. Gibbs [12, PCDG].
Remarks. First citing for mainland Spain; previously re-
corded from Mallorca (Balearic Islands) by Riddiford &
Férriz (2007).
Eudorylas blascoi De Meyer, 1997
FRANCE: Pyrénées-Orientales, forét de la Massane,
Col del Pal, 29.vii.2009, J. Garrigue, det. P. Withers
[14, PCPW]; Var, Vidauban, 7.v.2014, T. Ramage, det.
P. Withers [1¢, PCPW]. GREECE*: Chios, Thimiana,
38°17'87"N 26°07'89"E, 6-16.v.2003, C.J. Palmer, det.
D.J. Gibbs [19, PCCP]; Kendriki, Makedonia, Thes-
saloniki, Limni Volvi, 10.v.1998, M.J. Ebejer, det. D.J.
Gibbs [14, PCME]; Kendriki Makedonia, Kerkini, Mid-
way site, 41°18'49.8"N 23°16'35.6"E, 750 m, 30.vi-6.
vii.2008, G. Ramel, det. D.J. Gibbs [14, PCDG]; Ken-
driki Makedonia, Kerkini, Farfara site, 41°19'30"N
23°15'00"E, 750 m, 28.vii—3.vili.2008, G. Ramel, det.
D.J. Gibbs [192, PCDG]; Kendriki Makedonia, Kerki-
ni, Procom, Promohonas, 41°22'38.1''N 23°21'58.8"E,
60 m, 11—-17.vu1.2007, G. Ramel, det. D.J. Gibbs [19,
PCDG]. SPAIN: Asturias, Corros (de Parcal), 10.v.1990,
C. Rey [1d, MNCN]; Madrid, El Pardo, 7.viii.1904, J.
Arias Encobert [26'3', MNCN]. TURKEY*: Nevsehir,
Avanos, Urgiip area, 1000 m, 4-6.v.1993, V. Michelsen
[14, ZMUC].
Eudorylas fluviatilis (Becker, 1900)
GREECE*: Kendriki Makedonia, Kerkini, Ecotourism
site, 41°08'15.6"N 23°13'01"E, 65 m, 29. vili—4.1x.2006,
G. Ramel, det. D.J. Gibbs [14, PCDG]. SPAIN: Tener-
ife, Guimar, 3.iv.1973, PJ. Chandler & C.H. Jackson,
det. DJ. Gibbs [12, PCDG]; Canary Islands, Tener-
ife, Fanabe, 22.vii.1970, J.J. & A. Menier [23'¢ 229,
MNHN]; TURKEY*: Antalya, Side, 28.1x.2007, dunes,
N. Vikhrev, det. D.J. Gibbs [19, PCDG].
Eudorylas fuscipes (Zetterstedt, 1844)
FRANCE: Ardeéche, forét de Paiolive, Granzon, 25.v—
27.vi.2010, M. Speight & E. Castella, det. P. Withers
©ZFMK
46 Christian Kehlmaier et al.
[1¢, PCPW]; Ardéche, forét de Paiolive, Montchamp,
28.1v—22.v.2010, M. Speight & E. Castella, det. P. With-
ers [1, PCPW]; Ardéche, forét de Paiolive, Langarney-
re, 28.1v—25.v.2010, M. Speight & E. Castella, det. P.
Withers [16', PCPW]; Ardéche, forét de Paiolive, Her-
mitage, 23.v—26.v1.2010, M. Speight & E. Castella, det.
P. Withers [1<, PCPW]; same data as previous, 26.vi-28.
vii.2010, M. Speight & E. Castella, det. P. Withers [1¢,
PCPW]; Ardeéche, forét de Paiolive, Chibasse, 28.iv—
25.v.2010, M. Speight & E. Castella, det. P. Withers [1¢,
PCPW]. SPAIN: Cantabria, San Pedro de Bedoya, 17—
30.viii.1990, C. Rey [204 299, MNCN].
Eudorylas fusculus (Zetterstedt, 1844)
FRANCE: Alpes-Maritimes, Sophia Antipolis, 1.1x.2010,
leg., det. P. Withers [1¢, PCPW]; Ardéche, forét de
Paiolive, Bildon, 25.vi1.2010, M. Speight & E. Castella,
det. P. Withers [14, PCPW]; Var, Vidauban, 20.iv.2015,
T. Ramage, det. P. Withers [14', PCPW]; same data as
previous, 28.v.2015, T. Ramage, det. P. Withers [2¢¢4,
PCPW]; same data as previous, 8.vi.2015, T. Ramage,
det. P. Withers [26'3', PCPW]. SPAIN: Lleida, La Nogu-
era, 41°57'34.3"N, 0°51'44.2"E, 612 m, 3.viii.2014, R.
Andrade [19° PCCK].
Eudorylas ibericus Kehlmaier, 2005
FRANCE*: Ardeche, forét de Paiolive, Combe de
Bouse, 31.vili—8.1x.2010, M. Speight & E. Castella, det.
P. Withers [1', PCPW]; Ardéche, forét de Paiolive, Lan-
garneyre, 24.vi-10.vii.2010, M. Speight & E. Castella,
det. P. Withers [14, PCPW]; Ardéche, Réserve Naturelle
Nationale des Gorges de |l’Ardeche, 24.vu.2015, J.
Claude, det. P. Withers [1<4, PCPW]. MOROCCO. Itzér
area, 2100 m, 16.iv.1989, ZMCE [1¢', ZMUC]. SPAIN:
Salamanca, Villar de Ciervo, Las Coronas, 17—21.v.2005,
H.-P. Tschorsnig [19, PCCK]. TUNISIA*: Ain Draham
area, 5—18.v.1988, ZMCE [2'3', ZMUC].
Remarks. Ebejer & Kettani (2019) recently recorded fe-
males of this species from Morocco.
Eudorylas jenkinsoni Coe, 1966
FRANCE: Ardéche, forét de Paiolive, Chibasse, 25.v—
24.vi.2010, M. Speight & E. Castella, det. P. Withers [1¢,
PCPW]; Ardeche, forét de Paiolive, Bildon, 20.vii-30.
vilil.2010, M. Speight & E. Castella, det. P. Withers [1°,
PCPW]; Ardeéche, forét de Paiolive, Granzon, 25.v—27.
vi.2010, M. Speight & E. Castella, det. P. Withers [1¢,
PCPW]; same data as previous, 30.1x.2010, M. Spei-
ght & E. Castella, det. P. Withers [14, PCPW].
Bonn zoological Bulletin 68 (1): 31-60
Eudorylas johnenae Dempewolf, 1996
SPAIN*: Lleida, Sorpe, 1200-1300 m, 19—22.vi.1982, S.
Andersen, L. Lyneborg, V. Michelsen [1¢, ZMUC].
Eudorylas longifrons Coe, 1966
FRANCE: Ardeéche, forét de Paiolive, Granzon,
25.v11.2010, M. Speight & E. Castella, det. P. Withers
[14, PCPW].
Eudorylas mediterraneus De Meyer & Ackland, 1997
FRANCE: Bouches-du-Rhéne, Martigue La Revaille,
8.v.2017, P. Withers, det. P. Withers [1¢, PCPW].
GREECE: Sterea Elada, Drossohori, Parnassos Mts.,
15.v.1998, M.J. Ebejer, det. D.J. Gibbs [14', PCME].
PORTUGAL: Algarve, Albufeira, 26.1v.1989, A.E.
Stubbs, det. D.J. Gibbs [1<, PCDG]. SPAIN: Salaman-
ca, Villar de Ciervo, Las Coronas, 17—21.v.2005, H.-P.
Tschorsnig [19, PCCK]; Ibiza, Es Cavallet, P.N. Ses
Salines, 1.vi.2006, M.J. Ebejer, det. D.J. Gibbs [19,
PCME]; Mallorca, Sa Roca, S’Albufera, 8.x.2007, NJ.
Riddiford, det. D.J. Gibbs [1¢, PCDG]; same data as
previous, 27—28.x.2007 [24'3, PCDG]; same data as
previous, 6.x.2007 [12, PCDG]; same data as previous,
21—23.x.2007 [12, PCDG]; Mallorca, Mondrago, S’Am-
arador, 9.x.2007, J. Salva, det. D.J. Gibbs [12, PCDG];
Mallorca, Puig Sant Marti, 22.x.2007, M.A. Rens, det.
D.J. Gibbs [19, PCDG].
Eudorylas monegrensis De Meyer, 1997
SPAIN: Andalucia, Corona, 36°55'24"N 3°18'27"W,
1250 m, 12.vi.2008, & det. D.J. Gibbs [14', PCDG].
Eudorylas nemoralis Kozanek, 1993
SPAIN: Salamanca, Villar de Ciervo, Las Coronas, 17—
21.v.2005, H.-P. Tschorsnig [2¢'4, PCCK].
Eudorylas obliquus Coe, 1966
CYPRUS: Diarizos Valley, Nikoklela, 70 m, 23.1v.2002,
M.J. Ebejer, det. D.J. Gibbs [3'¢', PCME]; Pano Lefka-
ra, 595 m, 26.iv.2002, M.J. Ebejer, det. D.J. Gibbs [1¢,
PCME]; Malia, 570 m, 27.1v.2002, M.J. Ebejer, det. D.J.
Gibbs [1¢, PCME]. FRANCE: Alpes Maritimes, Biot,
20.xi-12.xii.2010, A. Piton, det. P. Withers [1¢, PCPW];
Var, Vidauban, 28.v.2015, T. Ramage, det. P. Withers
[1¢, PCPW]. GREECE: Peloponnisos, Taiyetos moun-
tains, 950-1800 m, 15-19.v.1990, ZMCE [2¢¢ 19,
ZMUC]; Peloponnisos, Monemvasia, 3.v.1984, G. Chris-
tensen [1', ZMUC]; same data as previous, 23.v.1984
[14, ZMUC]; same data as previous, 7.vi.1984 [1¢,
ZMUC]; Kendriki Makedonia, Kerkini, Ecotourism site,
©ZFMK
New data on Mediterranean Pipunculidae 47
41°08'15.6"N 23°13'01.2"E, 45 m, 23-29.v.2006, G.
Ramel, det. D.J. Gibbs [12, BMNH]; Kendriki Make-
donia, Kerkini, Procom site, Promohonas, 41°22'38.1'"N
23°21'58.8"E, 60 m, 4-10.vii.2007, G. Ramel, det. D.J.
Gibbs [12, BMNH]; Kendriki Makedonia, Kerkini,
Pumping St. site, 41°12'48.7"N 23°06'11.9"E, 40 m,
9-15.v.2007, G. Ramel, det. D.J. Gibbs [14', BMNH]. IT-
ALY: Sicily, Catania, Randazzo, Lago di Gurida, 870 m,
11.vi.1999, M.J. Ebejer, det. D.J. Gibbs [14, PCME].
SPAIN: Gerona, Caralps, 1200-1300 m, 13—17.v1.1982,
S. Andersen, L. Lyneborg, V. Michelsen [1¢, ZMUC];
Valencia, near Alcoy, 1000 m, 21.vi.2003, A.E. Stubbs,
det. D.J. Gibbs [2¢¢, PCDG]; Mallorca, S’Albufera,
Es Comu, 39°46'34"N 3°08'27"E, 2 m, 20.iv.2006, det.
D.J. Gibbs [2¢'4, PCDG]; Mallorca, Puig de Sant Marti,
39°49'29"N 3°05'S51"E, 23.iv.2006, det. D.J. Gibbs
[233 229, PCDG]; Mallorca, S’Albufera, Es Coma,
39°46'34"N 3°08'27"E, 2 m, 25.iv.2006, det. D.J. Gibbs
[13 12, PCDG]; Mallorca, Son Ton Woods, Sa Pobla,
21.iv.2001, M.J. Ebejer, det. D.J. Gibbs [24'4', PCME].
Eudorylas obscurus Coe, 1966
FRANCE: Ardeéche, forét de Paiolive, Montchamp,
8—28.1v.2010, M. Speight & E. Castella, det. P. Withers
[14, PCPW]; Ardéche, forét de Paiolive, Granzon, 8-28.
iv.2010, M. Speight & E. Castella, det. P. Withers [1%,
PCPW]; Ardeche, forét de Paiolive, Hermitage, 28.1v—
23.v.2010, M. Speight & E. Castella, det. P. Withers [1¢,
PCPW]; Ardeéche, forét de Paiolive, Langarneyre, 26.vi—
10.vit.2010, M. Speight & E. Castella, det. P. Withers
[14, PCPW]; Ardéche, Réserve Naturelle Nationale des
Gorges de I’Ardeéche, 18.111—1.iv.2015, J. Claude, det. P.
Withers [1<', PCJC]; same data as previous, 8—23.vi.2015,
det. P. Withers [1<, PCJC]; Pyrénées-Orientales, forét
de la Massane, réserve intégrale, 3.vi.2009, J. Garrigue,
det. P. Withers [3'3', PCPW]. GREECE: Peloponnisos,
Taiyetos mountains, 950-1800 m, 15—19.v.1990, ZMCE
[14, ZMUC]. SPAIN: Salamanca, Villar de Ciervo, Las
Coronas, 17—21.V.2005, H.-P. Tschorsnig [2¢'4¢, PCCK];
Gerona, Caralps, 1200-1300 m, 13—17.vi.1982, S. An-
dersen, L. Lyneborg, V. Michelsen [30'¢', ZMUC]; Llei-
da, Sorpe, 1200-1300 m, 19—22.v1.1982, S. Andersen,
L. Lyneborg, V. Michelsen [1¢, ZMUC]. TURKEY*:
Nevsehir, Avanos, Urgtip area, 1000 m, 4-6.v.1993, V.
Michelsen [14, ZMUC].
Eudorylas pannonicus (Becker, 1897)
FRANCE: Ardeéche, forét de Paiolive, Combe de Bouse,
25.v—26.v1.2010, M. Speight & E. Castella, det. P. With-
ers [1¢, PCPW]; Ardéche, forét de Paiolive, Langar-
neyre, 28.vii—31.vili.2010, M. Speight & E. Castella,
det. P. Withers [1<, PCPW]; Ardéche, forét de Paiolive,
Chibasse, 25.v—27.v1.2010, M. Speight & E. Castella,
det. P. Withers [1<, PCPW]; Ardéche, forét de Paiolive,
Bonn zoological Bulletin 68 (1): 31-60
Granzon, 29.vi-21.vu.2011, M. Speight & E. Castella,
det. P. Withers [1<, PCPW]; Ardéche, forét de Paiolive,
Hermitage, 28.vit-31.vii.2010, M. Speight & E. Cas-
tella, det. P. Withers [1<, PCPW]; Ardéche, forét de
Paiolive, Bildon, 25.vii.2010, M. Speight & E. Castella,
det. P. Withers [1¢, PCPW]. GREECE: Peloponisos,
5 km S of Monemvasia, 15.v.1984, G. Christensen [19,
ZMUC]; Lakonia, 5 km S of Monemvasia, 15.v.1985, G.
Christensen [1 9°, ZMUC]; Kendriki Makedonia, Kerkini,
Midway site, 41°18'49.8'N 23°16'35.6"E, 750 m, 16-22.
vii.2008, G. Ramel, det. D.J. Gibbs [14 Form A 19,
PCDG]; Kendriki Makedonia, Kerkini, Krousia mts. site,
41°11'32.4"N 23°03'59.6"E, 190 m, 13—-19.v1.2007, G.
Ramel, det. D.J. Gibbs [16' Form D, PCDG].
Remarks. Eudorylas pannonicus in its current species
concept might represent a species complex (Kehlmaier
2005a). At Kerkini, Form A, representing the lectotype
of E. pannonicus, was collected at “Midway”, whereas
Form D, formerly only known from Bulgaria, was col-
lected at “Krousia”.
Eudorylas subfascipes Collin, 1956
GREECE*: Makedhonia/Thessalia, Olympos, 700-
2100 m, 21-26.v.1990, ZMCE [13', ZMUC].
Eudorylas subterminalis Collin, 1956
SPAIN: Sobira, Pallars, Soriguera, 42°22'15.0"N
1°14'12.1"E, 4.vi1.2014, R. Andrade [19°, PCCK].
Eudorylas terminalis (Thomson, 1870)
FRANCE: Ardeche, forét de Paiolive, Langarneyre,
28.iv—25.v.2010, M. Speight & E. Castella, det. P. With-
ers [1¢', PCPW]. SPAIN: Gerona, Caralps, 1200-1300 m,
13—17.v1.1982, S. Andersen, L. Lyneborg, V. Michelsen
[14, ZMUC].
Remarks. First French record with locality data. Previ-
ously, only a country record of unknown provenance was
published (De Meyer 1992; Withers 2006).
Eudorylas triangularis Kehlmaier, 2005
TURKEY*: Antalya, Koprilii Kanyon National Park,
28—29.iv.1993, V. Michelsen [19, ZMUC].
Eudorylas trigonus (Becker, 1921)
GREECE: Kendriki Makedonia, Kerkini, Midway
site, 41°18'49.8"N 23°16'35.6"E, 750 m, 12—18.v.2008,
G. Ramel, det. D.J. Gibbs [29 9, PCDG]; same data as
previous, 26.v—1.vi.2008 [29 9°, PCDG].
©ZFMK
48 Christian Kehlmaier et al.
Eudorylas unicolor (Zetterstedt, 1844)
GREECE: Ipiros, Smolikas Mountains, 700-1500 m,
21-22.v.1994, V. Michelsen [1<, ZMUC]; Kendriki
Makedonia, Kerkini, Krousia mts. site, 41°11'32.4"N
23°03'59.6"E, 190 m, 27.vi-7.vil.2007, G. Ramel, det. &
coll. D.J. Gibbs [1.', PCDG].
Eudorylas venturai Kehlmaier, 2005
SPAIN: Almeria, Alhama, 5 km W, 200-500 m,
17.iii. 1966, L. Lyneborg [1¢4, ZMUC]; Valencia, Campos
de Cerezos, 8.iii.2008, S. Montagud et al. [1¢, MVHN
(Cod. 140308JL12)]; Granada, Barranco de Miranda,
8 km SW Orgiva, 300 m, 16.1v.1966, L. Lyneborg & M.
Langemark [14, ZMUC]; Andalucia, Cortijo del Alca-
zar, 36°55'1I5"N 4°05'18"E, 990-1200 m, 9.vi.2006,
D.J. Gibbs, det. DJ. Gibbs [14', PCDG]; Mallorca,
Puig de Sant Marti, 39°49'29"N 3°05'51"E, 19.v.2007,
D.J.Gibbs, det. D.J.Gibbs [14, PCDG].
Remarks. Coe (1969) published the two males from
Almeria and Granada as Eudorylas montium (Becker,
1897). To our knowledge (Kehlmaier 2003, 2005a), no
reliable records of E. montium from Spain exist and the
species should be deleted from the national checklist.
Eudorylas wahisi De Meyer, 1997
SPAIN: Mallorca, S’Albufera, Es Comu, 39°46'34"N
3°08'27"E, 2 m, 25.iv.2006, D.J. Gibbs, det. D.J. Gibbs
[12, PCDG].
Eudorylas zermattensis (Becker, 1897)
FRANCE: Ardeéche, forét de Paiolive, Montchamp,
25.vi-12.vii.2009, M. Speight & E. Castella, det. P.
Withers [1¢, PCPW]; Pyrénées-Orientales, forét de
la Massane, Col del Pal, 20.vi.2009, J. Garrigue,
det. P. Withers [14', PCPW]. GREECE*: 5 km south
of Monemvassia, 29.1v.1982, S. Andersen, L. Lyne-
borg & V. Michelsen [19, ZMUC]; Monemvassia,
29.iv.1984, G. Christensen [19, ZMUC]; same data as
previous, 9.1x.1984 [19, ZMUC]; same data as previous,
13.ix.1984 [1¢, ZMUC]; Kendriki Makedonia, Kerki-
ni, 41°09'06.5"N 23°11'55.0"E, 23-29.v.2005, G. Ra-
mel, det. D.J. Gibbs [19, PCDG]; Kendriki Makedonia,
Kerkini, Ecotourism site, 41°08'15.6"N 23°13'01.2"E,
65 m, 20-26.vi.2006, G. Ramel, det. D.J. Gibbs [14 19,
BMNH]; Kendriki Makedonia, Kerkini, Pumping St.
site, Kerkini, 41°12'48.7'"N 23°06'11.9"E, 40 m, 13-19.
vi.2007, G. Ramel, det. D.J. Gibbs [14, BMNH]; Kend-
riki Makedonia, Kerkini, Pumping St. site, 41°12'48.7""N
23°06'11.9"E, 40 m, 20—26.v1.2007, G. Ramel, det. D.J.
Gibbs [12, BMNH]. SPAIN: Granada, Rio Guadalfeo,
Orgiva, 300 m, 2.iv.1966, L. Lyneborg & M. Langemark
Bonn zoological Bulletin 68 (1): 31-60
[14, ZMUC]; Gerona, Caralps, 1200-1300 m, 13-17.
vi.1982, S. Andersen, L. Lyneborg, V. Michelsen [1°,
ZMUC].
Eudorylas zonatus (Zetterstedt, 1849)
FRANCE: Ardéche, forét de Paiolive, Chibasse, 25.v—
27.v1.2010, M. Speight & E. Castella, det. P. Withers
[14, PCPW]; Ardéche, forét de Paiolive, Granzon, 25.v—
27.v1.2010, M. Speight & E. Castella, det. P. Withers
[14, PCPW]; Var, Vidauban, 28.v.2015, T. Ramage, det.
P. Withers [1<, PCPW]; same data as previous, 8.vi.2015
[44'4, PCPW].
TOMOSVARYELLINI
Dorylomorpha (Dorylomorpha) confusa (Verrall, 1901)
SPAIN: Cantabria, Fuente Dé, 17.vi.1980, P.J. Chandler,
det. PJ. Chandler [1<, PCPC].
Dorylomorpha (Dorylomorpha) extricata (Collin, 1937)
FRANCE: Ardeéche, forét de Paiolive, Granzon, 28.1v—
25.v.2010, M. Speight & E. Castella, det. P. Withers [1¢,
PCPW]; Corsica, Forét d’Agnone, Vizzavona, 910 m,
1—2.vi.2000, A.C. Pont, det. D.J. Gibbs [19, BMNH].
Dorylomorpha (Dorylomorpha) imparata (Collin, 1937)
FRANCE: Corsica, Forét d’Agnone, Vizzavona, 910 m,
1—2.vi.2000, A.C. Pont, det. D.J. Gibbs [1¢, BMNH];
same data as previous, 28—29.v.2000 [12, BMNH];
same data as previous, 30-31.v.2000 [12, BMNH].
GREECE*: Kendriki Makedonia, Kerkini, Beles,
41°17'19"N 23°12'18"E, 25.1v—1.v.2005, G. Ramel, det.
D.J. Gibbs [1¢, PCDG]; Kendriki Makedonia, Ker-
kini, Kerkini marsh site, 41°13'32.8"N 23°05'04.2"E,
45 m, 21-27.iii.2007, G. Ramel, det. D.J. Gibbs [1-¢,
BMNH]; Kendriki Makedonia, Kerkini, Kerkini marsh
site, 41°13'32.8"N 23°05'04.2"E, 45 m, 11—-17.1v.2007,
G. Ramel, D.J. Gibbs [12, BMNH]; same data as previ-
ous, 4-10.iv.2007 [1<, BMNH]; same data as previous,
18-24. iv.2007 [24'3', BMNH].
Dorylomorpha (Dorylomorpha) rufipes (Meigen, 1824)
SPAIN*: Santander, near Cosgaya by Rio Neva,
18.vi.1980, P.J. Chandler, det. P.J. Chandler [1<, PCPC].
Dorylomorpha (Dorylomyia) incognita (Verrall, 1901)
SPAIN: Jaén, Sierra de Cazorla, Roblehondo, 1300 m,
28.v—15.vi.1993, J.L. Nieves [1¢, MNCN]; Madrid, Si-
erra de Guadarrama, Cercedilla, Estacion Biologica El
©ZFMK
New data on Mediterranean Pipunculidae 49
Ventorrillo, 40°45'16.5"N 4°01'15.5"W, 1450 m, 16-22.
vi.1989, J.L. Nieves & C. Rey [12, MNCN]; same data
as previous, 6—14.vii.1989 [12, MNCN]; same data as
previous, 1421 .vii.1989 [14 19, MNCN].
Dorylomorpha (Dorylomyza) lautereri Albrecht, 1990
GREECE*: Kendriki Makedonia, Kerkini, Pumping
Station site, 41°12'49"N 23°6'12"E, 40 m, 16—22.v.2007,
Malaise, G. Ramel, det. D.J. Gibbs [19, PCDG].
D
Tomosvaryella cilifemorata (Becker, 1907)
CYPRUS*: Kalavasos Dam, 34°48'01'""N 33°16'02"E,
165 m, 24.iv.2002, M.J. Ebejer, det. D.J. Gibbs [16,
PCME]. FRANCE: Ardeche, Réserve Naturelle Natio-
nale des Gorges del’ Ardéche, 7.vu1.2015, J. Claude, det. P.
Withers [14, PCJC]. GREECE*: Kendriki Makedonia,
Kerkini, Krousia Mts. site, 41°11'32.4"N 23°03'59.5"E,
190 m, 4-10.vii.2007, G. Ramel, det. D.J. Gibbs [1-4,
PCDG]; same data as previous, 27.vi-3.vii.2007 [13,
PCDG]; Kendriki Makedonia, Kerkini, Midway site,
y
‘-
C
F
Fig. 6. A. Surstyli of a Spanish 7° cilifemorata formerly published as 7: nigronitida. B. Surstyli of the lectotype of Zomosvaryella
disjuncta (Becker, 1900). C. Lectotype of Zomosvaryella vicina (Becker, 1900). D. Surstyli of the holotype of Zomosvaryella
lyneborgi (Coe, 1969), a junior synonym of Jomosvaryella cilitarsis (Strobl, 1910). E. Right lateral view of ovipositor of Zomosva-
ryella vicina (Becker, 1900). F. Dorsal view of ovipositor of Zomosvaryella vicina (Becker, 1900).
Bonn zoological Bulletin 68 (1): 31-60
©ZFMK
50 Christian Kehlmaier et al.
41°18'49.8"N 23°16'35.6"E, 750 m, 30.vi-6.vii.2008,
G. Ramel, det. D.J. Gibbs [12, PCDG]. ITALY: Sici-
ly, Catania, Randazzo Rummolo (Flascio river), 850 m,
7.vi.1999, M.J. Ebejer, det. M.J. Ebejer [1¢, PCME].
SPAIN: Granada, Barranco de Miranda, 8 km SW Orgi-
va, 300 m, 20.iv.1966, L. Lyneborg [1<, ZMUC]; Grana-
da, Mecina Bombaron, 800 m, 8.v.1966, L. Lyneborg &
M. Langemark [1¢, ZMUC].
Remarks. The Spanish material was, together with a
third male from Spain (Almeria, Alhama 5 km W, 200-—
500 m, 28.11.1966, L. Lyneborg), originally published as
Tomosvaryella nigronitida Collin, 1958 by Coe (1969).
The third specimen could not be located at ZMUC. The
other two specimens were dissected and the syntergoster-
nite 8 of one of the males is illustrated in Fig. 6A. Geni-
talia and outer morphology correspond to 7° cilifemorata
as outlined in Foldvari & De Meyer (2000). The latter au-
thors also comment on a possibile synonymy of the two
species. As 7! nigronitida is based on the female holotype
from Croatia and has been only recorded once thereaf-
ter by De Meyer (1995) (a single female from Israel),
collecting at the type locality is necessary before a final
decision can be made. The male sex of 7. nigronitida 1s
thus unknown and the species needs to be deleted from
the Spanish checklist. Strobl (1909) described this spe-
cies from Spain under Pipunculus argyrosticus Strobl,
1909, which was synonymised with T. cilifemorata later
by Aczél (1944).
Tomosvaryella cilitarsis (Strobl, 1910)
Tomosvaryella lyneborgi (Coe, 1969) syn. nov.
SPAIN: Almeria, Tabernas, 8 km N, 14.111.1966, L. Ly-
neborg [1¢' (holotype of T. jyneborgi), ZMUC]; Grana-
da, Sierra de Contraviesa, 5 km SE Orgiva, 500 m,
18.iv.1966, L. Lyneborg [12 (paratype of 7 lyneborgi),
ZMUC]; Mallorca, S’Albufera, Es Comu, 39°46'34"N
3°08'27"E, 2 m, 25.1v.2006, D.J. Gibbs, det. D.J. Gibbs
[1¢, PCDG].
Remarks. The type series of 7’ /yneborgi consists of a
male holotype and a female paratype. Coe (1969) figures
the undissected male terminalia and the female oviposi-
tor. The male syntergosternite 8 was detached from the
abdomen to obtain a better view of the surstyli (Fig. 6D)
and other genitalic features, and it was found to be a ju-
nior synonym of 7° cilitarsis (for the latter see Kehlmaier
2008b).
Tomosvaryella coquilletti (Kertész, 1907)
GREECE?*: Kendriki Makedonia, Kerkin1, 41°09'06.5'""N
23°11'55.0"E, 13-—19.v1.2005, G. Ramel, det. D.J. Gibbs
[14, PCDG]; SPAIN*: Burgos, NW of Ora, 19.vi.1980,
P.J. Chandler, det. D.J. Gibbs [1', PCPC].
Bonn zoological Bulletin 68 (1): 31-60
Tomosvaryella dentiterebra (Collin, 1949)
EGYPT: Edku Salt Lakes (© Lake Idku), 2.vu.1944,
R. Coe [4 (lectotype), BMNH]. same data as lectotype
[12 (paralectotype), BMNH]; Lake Karoun (= Qarun),
1x.1945, R. Coe [1° (paralectotype), BMNH].
Remarks. The species was originally described from
Egypt and it has been recently recorded and redescribed
from Iran (Majnon Jahromi et al. 2017b).
Tomosvaryella disjuncta (Becker, 1900)
FRANCE: Alpes-Maritimes, Biot, 3—10.x.2010, A. Pi-
ton, det. P. Withers [1<, PCPW]; same data as previous,
11—20.x.2010, A. Piton, det. P. Withers [1¢, PCPW].
Remarks. This is the second record of 7. disjuncta from
Europe and France. The species was originally described
from Egypt and only recently recorded from Val les
Bains (Ardeche) by Withers (2006). Kuznetzov (1993)
redescribed the species and designated a lectotype which
has been studied and illustrated (Figs 6B, 7A).
Tomosvaryella freidbergi De Meyer, 1995
GREECE®*: Kendriki Makedonia, Kerkini, Pumping St.
site, 41°12'48.7"N 23°06'11.9"E, 40 m, 13.—-19.vi.2007,
G. Ramel, det. D.J. Gibbs [24¢4¢, BMNH];; Kendriki
Makedonia, Kerkini, Pumping St. site, 41°12'48.7"N
23°06'11.9"E, 40 m, 20—26.v1.2007, G. Ramel, det. D.J.
Gibbs [24'3', BMNH]; Kendriki Makedonia, Kerkini,
Procom site, Promohonas, 41°22'38.1"N 23°21'58.8"E,
60 m, 4-10.vii.2007, G. Ramel, det. D.J. Gibbs [1¢'19,
BMNH]; Kendriki Makedonia, Kerkini, Krousia Mts.
base camp, 41°18'35''N 23°03'36"E, 1300 m, 25-31.
vii.2007, G. Ramel, det. D.J. Gibbs [3¢¢, BMNH].
SPAIN: Canary Islands, Tenerife, near Santiago,
2.1v.1973, P.J. Chandler & C.H. Jackson, det. D.J. Gibbs
[14, PCDG]; Canary Islands, Tenerife, Purto de Erjos,
2.1V.1973, P.J. Chandler & C.H. Jackson, det. M. Fold-
vari [14, PCDG]; Canary Islands, Tenerife, El] Medano,
3.1v.1973, P.J. Chandler & C.H. Jackson, det. D.J. Gibbs
[12, PCDG]; Canary Islands, La Palma, near Las Indias,
26.v.1976, PJ. Chandler, det. M. Foldvari [16', PCDG];
Canary Islands, La Palma, La Cumbrecita, 29.v.1976, P.J.
Chandler, det. D.J. Gibbs [14, PCDG]; Asturias, Corros
(de Parcal), 31.v.1990, C. Rey [14, MNCN]; Cantabria,
San Pedro de Bedoya, 17—30.vili.1990, C. Rey [19,
MNCN]. TURKEY*: Denizli, Aci Gol, 4.vi.1997, M.J.
Ebejer, det. D.J. Gibbs [1', PCME].
Tomosvaryella frontata (Becker, 1897)
MALTA: Mellieha Bay, Ghadira, 19-31.viti.1992, B.
Petersen [4¢¢ 72 2, ZMUC]. SPAIN*: Mallorca, S’Al-
©ZFMK
New data on Mediterranean Pipunculidae 51
B
Fig. 7. Dorsal view of surstyli, epandrium and syntergosternite 8 of lectotypes of A. Zomosvaryella disjuncta (Becker, 1900), and
B. Tomosvaryella vicina (Becker, 1900).
bufera, Sa Roca, 39°47'47"N 3°06'19"E, 2 m, 19.1v.2006,
D.J. Gibbs, det. D.J. Gibbs [1 9, PCDG]; Mallorca, Cami
des Polls, S’Albufera, 21.v.2006, M.J. Ebejer, det. D.J.
Gibbs [12, PCME]; Mallorca, S’Albufera, Sa Roca,
39°47'47"N 3°06'19"E, 2 m, 18.v.2007, D.J. Gibbs, det.
D.J. Gibbs [3¢'¢ 399, PCDG].
Tomosvaryella geniculata (Meigen, 1824)
CYPRUS*: Lefkas Dam, 34°53'50"N 33°18'19"E,
290 m, 26.iv.2002, M.J. Ebejer, det. D.J. Gibbs [19,
PCME]. FRANCE: Ardéche, forét de Paiolive, Gran-
zon, 25.vi1.2010, M. Speight & E. Castella, det. P. With-
ers [1¢, PCPW]; Ardéche, forét de Paiolive, Chibasse,
25.v—27.v1.2010, M. Speight & E. Castella, det. P. With-
ers [14', PCPW]; Ardéche, forét de Paiolive, Combe des
Bouses, 31.viii—8.1x.2010, M. Speight & E. Castella,
det. P. Withers [1', PCPW]; Var, Vidauban, 13.vi.2014,
T. Ramage, det. P. Withers [1<', PCPW]; same data as
previous, 22.vi.2014, T. Ramage, det. P. Withers [2¢.¢,
PCPW]; same data as previous, 8.v1.2015, T. Ramage,
det. P. Withers [44'3', PCPW]; Corsica, Forét d’Ag-
Bonn zoological Bulletin 68 (1): 31-60
none to Cascade des Anglais, Vizzavona, 900-1100 m,
28.v.2000, A.C. Pont, det. D.J. Gibbs [14, BMNH]; Cor-
sica, Forét d’Agnone, Vizzavona, 910 m, 1—2.v1.2000,
A.C. Pont, det. D.J. Gibbs [12, BMNH]; Ardéche, Gil-
hac, 44°50'18.3"N 4°46'2.3"E, 339 m, 22.viil.2008, C.J.
Palmer, det. D.J. Gibbs [1¢, PCCP]. GREECE*: Ken-
driki Makedonia, Kerkini, 41°09'06.5'""N 23°11'55.0"E,
23—29.v.2005, G. Ramel, det. D.J. Gibbs [19, PCDG];
Kendriki Makedonia, Kerkini, Plateau, Kerkini Mts,
41°18'53"N 23°01'46"E, 1000 m, 8—13.viil.2007, G. Ra-
mel, det. D.J. Gibbs [1', BMNH]; Kendriki Makedonia,
Kerkini, Plateau, Kerkini Mts, 41°18'59"N 23°01'55"E,
1000 m, 8—-13.viil.2007, G. Ramel, det. D.J. Gibbs
[1¢, BMNH]. SPAIN: Mallorca, S’Albufera, Sa Roca,
18.iv.2001, M.J. Ebejer, det. M.J. Ebejer [12, PCME].
Tomosvaryella helwanensis (Collin, 1949)
EGYPT: Helwan, xi.1944, R.L. Coe, B.M. 1946-39 [3
(lectotype), BMNH]; same data as lectotype [1¢ 399
(paralectotypes), BMNH].
©ZFMK
52 Christian Kehlmaier et al.
Fig. 8. Tomosvaryella helwanensis (Collin, 1949). A. Right lateral view of male surstylus. B. Strictly dorsal view of syntergoster-
nite 8. C. Left lateral view of male surstylus. D. Right lateral view of phallus and phallic guide. E. Left lateral view of ovipositor.
F. Dorsal view of ovipositor.
Remarks. The species was originally described from
Egypt based on eleven males and nine females and it has
not been recorded thereafter. Here, Collin’s extensive and
detailed description 1s completed by the illustration of the
male and female terminalia (Figs 8A—F) and by the later-
al habitus view of the female (Fig. 9) in order to enable a
secure identification.
Tomosvaryella hildeae De Meyer, 1997
GREECE*: Chios, Armolia, 38°16'86"N 26°02'91"E,
20.v.2003, C.J. Palmer, det. D.J. Gibbs [14 19, PCCP;
Bonn zoological Bulletin 68 (1): 31-60
1¢, PCDG]. SPAIN: Andalucia, above Alcaucin,
36°54'44"N_ 4°06'17"E, 800-1050 m, 7.v1.2006, D.J.
Gibbs, det. D.J. Gibbs [14, PCDG].
Tomosvaryella hispanica De Meyer, 1997
SPAIN: Asturias, Corros (de Parcal), 10.v.1990, C. Rey
[14, MNCN]; Salamanca, Villar de Ciervo, Las Coronas,
17-21.v.2005, H.-P. Tschorsnig [16', PCCK].
©ZFMK
New data on Mediterranean Pipunculidae 53
Fig. 9. Right lateral view of female of Zomosvaryella helwanensis (Collin, 1949).
Tomosvaryella inermis De Meyer, 1995
GREECE*: Kendriki Makedonia, Kerkini, Ecotourism
site, 41°08'15.6"N 23°13'01"E, 65 m, 20.v—3.vi.2006, G.
Ramel, det. D.J. Gibbs [14 12, PCDG].
Tomosvaryella israelensis De Meyer, 1995
GREECE*: Kendriki Makedonia, Kerkini, Ecotourism
site, 41°908'15.6"N 23°13'01"E, 65 m, 12-18.1x.2006,
G. Ramel, det. D.J. Gibbs [1<, PCDG]; same data as
previous, 29.viii-4.ix.2006 [2¢¢, PCDG]; Kendriki
Makedonia, Kerkini, Pumping Station site, 41°12'49"N
23°06'12"E, 40 m, 18—24.v1.2007, G. Ramel, det. D.J.
Gibbs [146:19, PCDG].
Tomosvaryella kuthyi Aczél, 1944
CYPRUS*: Akrounta, 34°48'48""N 33°05'30"E, 600 m,
24.iv.2002, M.J. Ebejer, det. D.J. Gibbs [14, PCME].
FRANCE: Alpes-Maritimes, Biot, 20—26.1x.2010, A. Pi-
ton, det. P. Withers [1<, PCPW]; same data as previous
Bonn zoological Bulletin 68 (1): 31-60
but 11—20.x.2010, A. Piton, det. P. Withers [16', PCPW];
Ardeche, forét de Paiolive, Granzon, 25.vii.2010, M.
Speight & E. Castella, det. P. Withers [16', PCPW]; Ar-
déche, forét de Paiolive, Combe des Bouses, 28.vii.2010,
M. Speight & E. Castella, det. P. Withers [1¢, PCPW];
Ardeche, forét de Paiolive, 31.viti—8.1x.2010, M. Spei-
ght & E. Castella, det. P. Withers [14, PCPW]; Ardéche,
forét de Paiolive, 8.ix—4.x.2010, M. Speight & E. Cas-
tella, det. P. Withers [1<, PCPW]; Ardéche, forét de
Paiolive, Bildon, 28.vii—31.vi1.2010, M. Speight & E.
Castella, det. P. Withers [1<, PCPW]; Ardéche, forét
de Paiolive, Langarneye, 26.vi-10.vu1.2010, M. Spei-
ght & E. Castella, det. P. Withers [14, PCPW]; Ardéche,
forét de Paiolive, 28.vii-3.vil.2010, M. Speight & E.
Castella, det. P. Withers [1<, PCPW]; Ardéche, forét
de Paiolive, Hermitage, 23.v—26.vi.2010, M. Speight,
det. P. Withers [1<, PCPW]; Ardéche, forét de Paiolive,
Chibasse, 25.v—27.v1.2010, M. Speight & E. Castella,
det. P. Withers [14', PCPW]; Pyrénées-Orientales, forét
de la Massane, Col Fondo, 14.1x.2014, J. Garrigue, det.
P. Withers [1', PCPW]; Pyrénées-Orientales, forét de
la Massane, réserve intégrale, 7.vi1.2009, J. Garrigue,
©ZFMK
54 Christian Kehlmaier et al.
det. P. Withers [1<, PCPW]; Var, Vidauban, 19.v.2014,
T. Ramage, det. P. Withers [2¢'¢', PCPW]; same data
as previous, 13.vi.2014 [1¢, PCPW]; same data as
previous, 28.v.2015 [14, PCPW]; same data as previ-
ous, 8.vi.2015 [54'3, PCPW]. GREECE*: Kendriki
Makedonia, Kerkini, Krousia Mts. site, 41°11'32.4"N
23°03'59.5"E, 190 m, 30.v—5.vi.2007, G. Ramel, det.
D.J. Gibbs [24'3', BMNH]. SPAIN: Almeria, Adra,
36°47'24.8"N 3°06'06.6"W, 502 m, 9.v.2012, R. Andrade
[23:3 12, PCCK]; Catalunya, Barcelona, Pruit, 15 km S
Olot, 30 km W Girona, 42°02'39"N 2°27'31"E, 900 m,
4 vii.1997, C. Lange & J. Ziegler [12, PCCK]; Mallorca,
Puig de Sant Marti, 39°49'29"N 3°05'51"E, 23.iv.2006,
D.J. Gibbs, det. D.J. Gibbs [1° 19, PCDG]; Mallorca,
Son Bosc, S’Albufera, 24.v.2006, M.J. Ebeyjer, det. D.J.
Gibbs [14 19, PCME].
Tomosvaryella parakuthyi De Meyer, 1995
CYPRUS*: Frenaros, 35°03'04.50"N 33°52'57.66"E,
1.ix-30.x.2018, S. Schiffel [14, PCCK].
Tomosvaryella pilosiventris (Becker, 1900)
Tomosvaryella glabrum (Adams, 1905) syn. nov.
SPAIN: Canary Islands, Tenerife, Fanabe, 22.vu.1970,
J.J. & A. Menier [14 12, MNHN]. TURKEY*: Antalya,
Side, green grass plot, 28.i1x.2007, N. Vikhrev, det. D.J.
Gibbs [14', PCDG].
Remarks. The original type series consisted of an un-
specified number of males and females collected at Cairo,
Assiut and Fayum between November and March (Beck-
er, 1900). At MNHU four specimens were identified that
belong to the type series: 24'3' 12, Fayum, 44775, III;
192, Cairo, 44244, XI. The whereabouts of the syntypes
from Assiut 1s unknown. Both present males have been
dissected in the past. One male (with missing head) was
labelled as lectotype by Sergey Kuznetzov. However, this
lectotype designation was apparently never published.
The “head-less” male is hereby designated as lectotype
in order to fix the name involved and ensure a universal
and consistent interpretation of the taxon in the future.
The status of this species involves several nomencla-
tural acts. Aczél (1944) originally placed 7: pilosiventris
in synonymy under 7! subvirescens (Loew, 1872), but
Kuznetzov (1994) restored 7: pilosiventris as a good spe-
cies. Hardy (1949) placed 7 glabrum (Adams, 1905) in
synonymy under 7! subvirescens, but later De Meyer et
al. (2001) reinstated 7’ glabrum as a valid taxon and syn-
onymised 7: tecta De Meyer, 1993 under T: glabrum. The
present study revealed that 7’ pi/osiventris is conspecif-
ic with specimens identified as 7. glabrum syn. nov. by
Kehlmaier & Majnon Jahromi (2015), who also studied
material originally identified as 7. glabrum by De Mey-
Bonn zoological Bulletin 68 (1): 31-60
er et al. (2001). Male genitalia are figured in De Meyer
(1993).
Tomosvaryella resurgens De Meyer, 1997
SPAIN: Mallorca, Santa Ponca, 23.x.1992, C.J. Palmer,
det. D.J. Gibbs [16', PCCP]; Mallorca, S’ Alqueria, An-
dratx S’ Alqueria, Andrnix, 2.vii1.2007, J. Monterde, det.
D.J. Gibbs [1¢19, PCDG]; Mallorca, Puig San Marti,
15.ix.2008, N. Riddiford, det. P. Withers [1¢, PCPW];
Mallorca, Mandrago, 13—14.1x.2007, N. Riddiford, det.
P. Withers [1¢, PCPW]; Santa Eugencia, light trap,
10.viii.2005, N. Riddiford, det. P. Withers [1¢', PCPW].
Tomosvaryella sepulta De Meyer, 1997
SPAIN: Mallorca, S’Albufera, Es Comu, 39°46'34N
3°08'27"E, 2 m, 20.1v.2006, DJ. Gibbs, det. D.J.
Gibbs [3¢¢, PCDG]; Mallorca, Puig de Sant Marti,
39°49'29"N 3°05'S1"E, 23.1v.2006, DJ. Gibbs, det.
D.J. Gibbs [12, PCDG]; Andalucia, W of Capilerilla,
36°56'21"N 3°20'26"W, 1480 m, 7.vi.2008, D.J. Gibbs,
det. D.J. Gibbs [16 292, PCDG].
Tomosvaryella trichotibialis De Meyer, 1995
SPAIN: Mallorca, S’Albufera, Es Comu, 39°46'34"N
3°08'27"E, 2 m, 18.v.2007, D.J. Gibbs, det. D.J. Gibbs
[13, PCDG]; same data as previous, 20.v.2009 [19,
PCDG]; Andalucia, Sendero vela blanca, 36°44'05"N
2°10'14"W, 240 m, 29.iv.2008, D.J. Gibbs, det. D.J.
Gibbs [1¢, PCDG].
Tomosvaryella vicina (Becker, 1900)
EGYPT: Luxor, 44629, ii, T. Becker [ (lectotype),
MNHU]; same data as lectotype [34'3' (paralectotypes),
MNHU]; Assiut, 44396, xii, T. Becker [14 19 (paralec-
totypes), MNHU]; Assiut, 44459, xii, T. Becker [1¢' 19°
and 1 badly damaged specimen (only part of thorax and
five legs left), MNHU].
Remarks. De Meyer (1993: fig. 36) redescribed and
illustrated the species, listing only the male “holotype”
with the label data “4629 II”. This is obviously a misin-
terpretation and a typo, respectively. In De Meyer (1996),
one syntype from Assiut (44459) and three syntypes
from Luxor (44629) are mentioned. The original type
series consisted of an unspecified number of males and
females collected at Assiut and Luxor between Dezem-
ber and February (Becker, 1900). At MNHU, nine spec-
imens were identified that belong to the type series. All
specimens are pinned on minutens. The four males from
Luxor are placed on two insect needles. One male from
Luxor has been dissected in the past and was labelled as
lectotype by Sergey Kuznetzov. This lectotype designa-
©ZFMK
New data on Mediterranean Pipunculidae 55
tion was apparently never published. The dissected male
from Luxor is hereby designated as lectotype in order to
fix the name involved and ensure a universal and consis-
tent interpretation of the taxon in the future. The male
syntergosternite 8 (Figs 6C, 7B) and the female oviposi-
tor are illustrated (Figs 6E & F).
DISCUSSION
Ninty-eight named species of Pipunculidae from eleven
countries (Cyprus, Egypt, France, Greece, Italy, Malta,
Morocco, Portugal, Spain, Tunisia, and Turkey) are in-
cluded in this work. Among them there are three new spe-
cies described in full. In addition, 56 first national records
were compiled, demonstrating that the knowledge on the
distribution of big-headed flies in the Mediterranean Ba-
sin is still very fragmentary for most countries. But even
in comparatively well-studied countries like Spain, 13
species could be added to the national list. In detail, the
number of named species in the present paper, first na-
tional records, and newly described species are: Cyprus
(6 named species / 4 first records / 0 new species), Egypt
(1/0/0), France (42/6/1), Greece (31/23/0), Italy (3/0/0),
Malta (2/0/0), Morocco (1/0/0), Portugal (2/0/0), Spain
(56/13/3), Tunisia (5/5/0), and Turkey (10/8/0). Appen-
dix II provides national checklists for selected countries,
whose pipunculid fauna has not been summarised in the
past years (Cyprus, Egypt, Greece, Malta, Morocco, Tu-
nisia, and Turkey). The national checklist for Portugal
currently comprises 45 species (Kehlmaier & Andrade
2016). The national checklist for Italy stands at 105 spe-
cies (Kehlmaier 2008a, 2010a). The national checklist for
continental France (Withers 2006) must be complement-
ed by the addition of C. brachium sp. n., C. grandimem-
branus, E. angustimembranus, E. ibericus, J. pilosa, and
P. elegans, counting a total of 115 species. And the na-
tional checklist for Spain (KehImaier 2003, 2005a; Kehl-
maier & Assmann 2008; Kehlmaier & Alonso-Zarazaga
2018) now counts 101 species, with Ch. zyginae, C. bra-
chium sp. n., C. penultimus, C. vittipes, D. holosericeus,
D. rufipes, E. johnenae, P. oldenbergi, P. zugmayeriae,
7. coquilletti, T: frontata, T. osito sp. n., and T. pugiuncu-
Jus sp. n. added in this study.
Due to the lack of taxonomic workers, expertise and
funds on Pipunculidae, a targeted and systematic collect-
ing of the family in the Mediterranean has hardly ever
been conducted in the past. Although pipunculids lead
a rather concealed life, even a couple of collecting days
can contribute valuable faunistic insights to regional fau-
nas as shown by Kehlmaier (2010a), who hand-netted 83
specimens belonging to 18 species in nine collecting days
on the Italian island of Sardinia. The majority of records
presented here must either be regarded as by-catches of
fellow entomologists, or originated from small biodiver-
sity projects, highlighting the importance of such initia-
Bonn zoological Bulletin 68 (1): 31-60
tives often organised by enthusiasts and amateur ento-
mologists and therefore lacking any substantial financial
support. Their commitment as well as scientific expertise
cannot be overrated in this respect. Two examples that
we would like to point out are The Albufera Internation-
al Biodiversity Project on Mallorca (TAIB) (Mallorca,
Balear Islands, Spain; https://www.taib.info/en/) and the
Wetland Kerkini Biodiversity Study (Central Macedonia,
Greece; http://www.ramel.org/lake-kerkini/). TAIB has
been running since 1989 and focuses on the biodiversity
of the S’Albufera Natural Park. Since 1989 regular trap-
ping projects are undertaken during spring and autumn
field excursions, training programms, and cooperations
with taxonomists, including four Diptera specialists re-
sulting in a total of 20 Pipunculidae species including
the two newly described Tomosvaryella (Table 1). The
Wetland Kerkini Biodiversity Study took off as a one-
man-project in 2001, surveying the biotic diversity for
Lake Kerkini and its associated Nature Reserves. The
Pipunculidae material studied in the present work was
collected during 2005—2007 and so far 22 species of Pi-
punculidae have been identified most of them new to the
Greek fauna (Table 2).
Acknowledgments. Material was put at our disposal by Car-
olina Martin (MNCN), Lisa and Klaus Standfuss (Dortmund),
Sergio Montagud Alario (MVHN), Rui Andrade (Porto),
Peter J. Chandler (Melksham), Jocelyn Claude (Laberge-
ment-Sainte-Marie), Martin J. Ebejer (Cowbridge), Milan
Kozanek (Bratislava), Chris J. Palmer (Hampshire), Thomas
Pape (ZMUC), Adrian C. Pont (Goring-on-Thames), Sebas-
tian Schiffel (Dresden), Martin C.D. Speight (Dublin), Alan
Stubbs (Peterborough), Hans-Peter Tschorsnig (Stuttgart), Ni-
kita Vikhrev (Moscow), Joachim Ziegler (formerly MNHU),
the Albufera International Biodiversity Project (TAIB, courtesy
of Nick J. Riddiford, https://www.taib.info/en/) and the Wet-
land Kerkini Biodiversity Study (courtesy of Gordon J. Ramel,
http://www.ramel.org/lake-kerkini/). The first author received
financial support by the European Commission HUMAN PO-
TENTIAL PROGRAMME, under BIODIBERIA at MNCN in
Madrid. Collection work at ZMUC in Copenhagen was made
possible through financial support received from the SYNTH-
ESYS Project (http://www.synthesys.info/) financed by Eu-
ropean Community Research Infrastructure Action under the
FP7 ‘Capacities’ programme. Nigel Wyatt (BMNH) organised
the loan of type material. Also, we would like to thank the two
anonymous reviewers for their helpful comments and sugges-
tions. The DNA barcoding data was generated in the molecular
laboratory of the Museum of Zoology, Senckenberg Dresden
(SGN-SNSD-Mol-Lab).
REFERENCES
Ackland DM (1993) Notes on British Cephalops Fallén, 1810
with description of a new species, and Microcephalops De
Meyer, 1989, a genus new to Britain (Dipt., Pipunculidae).
Entomologist's Monthly Magazine 129: 95-105
Aczél M (1944) Die Gattung Zomosvaryella Acz. (Dipt.). (Do-
rylaiden-Studien VIII). Annales Historico-Naturales Musei
Nationalis Hungarici, Pars Zoologica 37: 75-130
©ZFMK
56 Christian Kehlmaier et al.
Albrecht A (1990) Revision, phylogeny and classification of the
genus Dorylomorpha (Diptera, Pipunculidae). Acta Zoologi-
ca Fennica 188: 1-240
Becker T (1900) Dipterologische Studien V. Pipunculidae.
Erste Fortsetzung. Berliner Entomologische Zeitschrift 45:
215-252
Coe RL (1969) Some Pipunculidae (Diptera) from Southern
Spain, with description of a new species. Entomologiske
Meddelelser 37: 3-8
Cuttelod A, Garcia N, Abdul Malak D, Temple H & Katariya
V (2008) The Mediterranean: a biodiversity hotspot under
threat. 13 pp. in: Vie J-C, Hilton-Taylor C & Stuart SN (eds),
The 2008 Review of The IUCN Red List of Threatened Spe-
cies. IUCN Gland, Switzerland. https://www.researchgate.
net/publication/285086595 (accessed: 06.11.2019).
De Meyer M (1989) The West-Palaearctic species of the pi-
punculid genera Cephalops and Beckerias (Diptera): classi-
fication phylogeny and geographical distribution. Journal of
Natural History 23: 725-765
De Meyer M (1992) Preliminary database on the distribution of
Pipunculidae in Europe. Faunal inventories of sites for car-
tography and nature conservation — Proceedings of the 8th
International Colloquium of the European Invertebrate Sur-
vey, Brussels: 91-100
De Meyer M. (1993) A revision of the Afrotropical species of
Tomosvaryella Aczél, 1939 (Diptera: Pipunculidae). Annals
of the Natal Museum 34: 43-101
De Meyer M (1995) The pipunculid flies of Israel and the Sinai
(Insecta, Diptera, Pipunculidae). Spixiana 18: 283-319
De Meyer M (1997) Contribution to the Pipunculidae fauna of
Spain (Diptera). Beitrage zur Entomologie 47: 421-450
De Meyer M, Foldvari M & Baez M (2001) The Pipunculidae
(Diptera) fauna of the Canary Islands and Madeira. Bulletin
et Annales de la Société Royale belge d‘Entomologie 136
[2000]: 144-152
Ebejer M (2012) The familes Lonchopteridae, Opetiidae and
Pipunculidae of Malta (Diptera, Aschiza). Bulletin of the En-
tomological Society of Malta 5: 77-79
Ebejer M & Kettani K (2019) The Pipunculidae, a neglected
family of Diptera in Morocco. Dipterists Digest 26: 13-18
Foldvari M & De Meyer M (2000) Revision of Central and
West European 7omosvaryella Aczél species (Diptera, Pi-
punculidae). Acta Zoologica Academiae Scientiarum Hun-
garicae 45 [1999]: 299-334
Grootaert P & De Meyer M (1986) On the taxonomy and ecol-
ogy of Nephrocerus Zetterstedt (Diptera, Pipunculidae) with
a redescription of N. /apponicus and a key to the European
species. Bulletin van het Koninklijk Belgisch Instituut voor
Natuurwetenschappen, Entomologie 56: 85-91
Hardy DE (1949) The African Dorilaidae (Pipunculidae-Dip-
tera). Memoires de I’Institut Royal des Sciences Naturelles
de Belgique 36: 1-80
International C (2011) Biological diversity in the Mediterranean
Basin. URL: _http:/Awww.eoearth.org/view/article/150647
(accessed: 31. January 2019)
Jervis MA (1992) A taxonomic revision of the pipunculid fly
genus Chalarus Walker, with particular reference to the Eu-
ropean fauna. Zoological Journal of the Linnean Society 105:
243-352
Kehlmaier C (2001) Records of Stratiomyidae, Pipunculi-
dae and Conopidae (Diptera) from northern Spain. Munibe
(Ciencias naturales) 51: 79-84
Kehlmaier C (2003) Pipunculidae (Diptera) from a forest eco-
system in northern Spain, with the description of a new spe-
cies. Entomologische Zeitschrift 113: 87-94
Bonn zoological Bulletin 68 (1): 31-60
Kehlmaier C (2005a) Taxonomic revision of European Eudo-
rylini. Verhandlungen des Naturwissenschaftlichen Vereins
in Hamburg (NF) 41: 45-353
Kehlmaier C (2005b) Taxonomic studies on Palaearctic and
Oriental Eudorylini (Diptera: Pipunculidae), with the de-
scription of three new species. Zootaxa 1030: 1-48
Kehlmaier C (2006) The West-Palaearctic species of Jassido-
Dphaga Aczél and Verrallia Mik described up to 1966 (Dip-
tera: Pipunculidae). Stuttgarter Beitrage zur Naturkunde,
Serie A (Biologie) 697: 34 pp
Kehlmaier C (2008a): 4.3.19 Pipunculidae. 207—220 pp. in:
Ziegler J (ed), Diptera Stelviana. A dipterological perspective
ona changing alpine landscape. Volume 1. Studia dipterolog-
ica Supplement 16. Ampyx- Verlag, Halle (Saale)
Kehlmaier C (2008b) Finnish Pipunculidae (Diptera) Studies
Part I: Taxonomic Notes on Cephalops Fallén, 1810, Pipun-
culus Latreille, 1802 and Zomosvaryella Aczél, 1939. Zoot-
axa 1672: 1-42
Kehlmaier C. (2010a) Syrphoidea (Diptera: Pipunculidae and
Syrphidae) previously unrecorded from Sardinia (Italy), with
the description of a new species of the genus Pipunculus La-
treille. Studia dipterologica 16 [2009]: 155-167
Kehlmaier C (2010b) A nomenclatural note on European Cha-
larus (Diptera: Pipunculidae): a new synonymy of C. elegan-
tulus Jervis, 1992. Zootaxa 2656: 67
Kehlmaier C & Assmann T (2008) The European species of
Chalarus Walker, 1834 revisited (Diptera: Pipunculidae).
Zootaxa 1936: 1-39
Kehlmaier C & Alonso-Zarazaga MA (2018) Pipunculidae
(Diptera) from the Caldera de Taburiente National Park,
La Palma (Canary Islands, Spain) — investigating the mor-
phological and molecular variability in a new species of
big-headed flies. Graellsia 74(1): e069
Kehlmaier C & Andrade R (2016) New records of big-headed
flies (Diptera: Pipunculidae) from Portugal. Studia diptero-
logica 22 [2015] 137-151
Kehlmaier C & Majnon Jahromi B (2015) On the presence
of Pipunculidae (Diptera) in Iran. Studia dipterologica 21
[2014]: 29-36
Kehlmaier C, Dierick M & Skevington JH (2014) Micro-CT
studies of amber inclusions reveal internal genitalic features
of big-headed flies, enabling a systematic placement of Me-
tanephrocerus Aczél, 1948 (Insecta: Diptera: Pipunculidae).
Arthropod Systematics and Phylogeny 72: 23-36
Kehlmaier C, Michalko R & Korenko S (2012) Ogcodes fu-
matus (Diptera: Acroceridae) reared from Philodromus
cespitum (Araneae: Philodromidae), and first evidence of
Wolbachia alphaproteobacteria in Acroceridae. Annales Zoo-
logici (Warszawa) 62: 281-286
Kozanek M & Belcari A (1995) Contribution to the knowledge
of the pipunculid fauna of Italy (Diptera Pipunculidae). Bol-
letino della Societa Entomologica Italiana 127: 159-178
Kuznetzov SY (1993) A new Jomosvaryella Aczél from Egypt,
with redescription of 7! disjuncta (Becker) (Diptera, Pipun-
culidae). Diplerologicol Research 4(3) 151-162
Kuznetzov SY (1994) Short notes on synonymy and nomen-
clature of Pipunculidae (Diptera). Dipterologicol Research
5(2): 105
Majnon Jahromi B, Gheibi M, Fallahzadeh M, Kehlmaier C &
Hesami S (2017a) Pipunculidae from southern Iran (Diptera:
Brachycera) including two new species of the genus 7o-
mosvaryella Aczél. Zootaxa 4273: 488-500
Majnon Jahromi B, Gheibi M, Fallahzadeh M, Kehlmaier C &
Hesami S (2017b) A checklist of the genus Zomosvaryella
Aczél (Diptera: Pipunculidae) from the Middle East with
©ZFMK
New data on Mediterranean Pipunculidae 57
the description of a new species. Zoology in the Middle East
63(4): 336-347. DOI: 10.1080/09397140.2017.1349240.
Raffael JA & De Meyer M (1992) Generic classification of the
family Pipunculidae (Diptera): a cladistic analysis. Journal of
Natural History 26: 637-658
Rafael JA & Skevington JH (2010) Pipunculidae (big-headed
flies). 793-803 pp. in: Brown BV, Borkent A, Cumming JM,
Wood DM, Woodley NE & Zumbado MA (eds), Manual of
Central American Diptera. Volume 2. NRC Research Press,
Ottawa
Riddiford N (ed) (2006) TAIB Project S’Albufera: A Mediter-
ranean model for the study of biodiversity and environmental
change. The Albufera International Biodiversity Group An-
nual Report 2005. 126 pp.
URL: _ https://www.taib.info/download/fieldwork-reports/TAIB-
Report-2005.pdf?x22428 (accessed: 07. August 2017)
Riddiford N & Férriz M (eds) (2007) TAIB Project S’ Albufera:
A Mediterranean model for the study of biodiversity and en-
vironmental change. The Albufera International Biodiversi-
ty Project Annual Report 2006. 106 pp. URL: https://www.
taib.info/download/fieldwork-reports/TAIB-Report-2006.
pdf?x22428 (accessed: 07. August 2017)
Appendix I. Characterisation of selected collecting localities.
¢ El Boalo: Malaise trap placed in a degraded Quercus pyre-
naeica Willd. forest.
¢ El Pardo: The study site is dominated by a mature Quercus
ilex L. forest with isolated Ou. suber L., Qu. coccifera L. and
Fraxinus L. The climate is of continental Mediterranean char-
acter. Malaise trap.
¢ Estacién Biolégica El Ventorrillo: Spain, Madrid, Sierra
de Guadarrama, Cercedilla, Estaci6n Biologica El Ventorrillo,
40°45'16.5"N 4°01'15.5''W. Malaise trap placed on a south-
west facing slope between a mixed deciduous forest dominated
by Acer pseudoplatanus L. and Ulmus glabra Huds. and a ma-
ture growth of Pinus sylvestris L. The transition zone between
the two being characterized by small clearings, dominated by a
variety of bushes like Cytisus L., Crataegus L., Rubus L., Rosa
L., Cistus L., Santolina L., Juniperus L., Prunus L. etc. The
climate is subhumid Mediterranean with cold winters.
¢ Forét de la Massane: France, Pyrénées-Orientales, forét de
la Massane, 42°28'31''N 3°01'09"E. One of the last remaining
ancient forests in the Mediterranean basin. It comprises 336
hectares of mixed old forest, much of it dead wood, with princi-
pally beech (Fagus sylvatica L.), mixed with holm-oak (Quer-
cus ilex L.), downy oak (Quercus pubescens Willd.) and sessile
oak (Quercus petraea (Matt.) Liebl.).
¢ Forét de Paiolive: France, Ardéche, forét de Paiolive,
44°23'40"'N 4°10'41"E. This area covers 15 square kilometres
and is dominated by river gorges cut by the River Chassezac.
Bonn zoological Bulletin 68 (1): 31-60
Skevington JH (2002) Revision of Australian Eudorylas Aczél
(Diptera: Pipunculidae). Studia dipterologica 9: 621-672
Skevington JH & De Meyer M (2004) Pipunculidae Research
by Elmo Hardy: Another Founding Event on the Hawaiian
Islands. Bishop Museum Bulletin in Entomology 12: 13-25
Skevington JH & Yeates DK (2001) Phylogenetic classification
of Eudorylini (Diptera: Pipunculidae). Systematic Entomol-
ogy 26: 421-452
Skevington JH, Kehlmaier C & Stahls G (2007): DNA barcod-
ing: mixed results for bigheaded flies (Diptera: Pipunculli-
dae). Zootaxa 1423: 1-26
Strobl G (1909) Spanische Dipteren. III. Beitrag. Verhandlun-
gen der Zoologisch-Botanischen Gesellschaft in Wien 59:
121-301
Withers P (2006) A preliminary account of the fauna of Pipun-
culidae (Diptera) of continental France. Dipterists Digest,
2nd Series, 13: 145-155
There are extensive dry grasslands and garrigue-type terrain,
with riverine forests of mainly downy oak (Quercus pubescens
Willd.) and holm-oak (Quercus ilex L.).
¢ Kerkini: Greece, Kendriki Makedonia, Lake Kerkini,
41°10'46"'N 23°9'20"E. This locality refers to the Wetland Ker-
kini Biodiversity Study (courtesy of Gordon J. Ramel, http://
www.ramel.org/lake-kerkini/) which covers many habitats
from the actual lake shore right into the nearby mountains. For
detailed information visit the project’s homepage.
¢ S’Albufera: Spain, Balear Island, Mallorca, 39°47'50"N
3°6'22.5"E. An extensive wetland area in north Mallorca close
to Port d’ Alcudia. Surveys were carried out on behalf of TAIB
(The Albufera International Biodiversity Project, courtesy of
Nick J. Riddiford, https://www.taib.info/en/) in April and May
2006 and May 2007 by D.J. Gibbs. Sampling was confined to
sweep-netting but included visits to many habitats both within
and adjacent to S’Albufera Natural Park. Particularly the dunes
of Es Comu and the dry, Pine covered low hills of Puig san
Marta were productive collecting localities.
¢ Vidauban: France, Var, Vidauban, Vidauban golf club,
43°23'36" 6°27'51'"E. This area is situated in the Plaine des
Maures, an area dominated by parasol pine (Pinus pinea L.)
and cork-oak (Quercus suber L.). There are also numerous tem-
porary or permanent ponds in the area.
©ZFMK
58 Christian Kehlmaier et al.
Appendix II. A systematic checklist of named Pipunculidae of selected Mediterranean countries.
[*Probably misidentified (see Kehlmaier 2005a: 312; Kehlmaier 2005b: 12)].
Fi [reece tia [torneo [tania [ Tukey [ Gyprs
Nunbecotreoiedeeies Ts | oat tk | kf 6
. = — SS eee [ili
ae |. | | ad | as
[ChatarinaeAcré 1939 |
[ChalarusWalker,1834 |
fie
C. brevicaudis Jervis, 1992
C. clarus Jervis, 1992
C. indistinctus Jervis, 1992
C. spurius (Fallén, 1816)
Verrallia Mik, 1899
V. aucta (Fallén, 1817)
Nephrocerinae Aczél, 1939
x
Cephalops Fallén, 1810
C. (Cephalops) conjunctivus Coe, 1958
C. (Parabeckerias) obtusinervis (Zetterstedt, 1844)
C. (Semicephalops) perspicuus (de Meijere, 1907)
C. (Semicephalops) straminipes (Becker, 1900)
C. (Semicephalops) ultimus (Becker, 1900)
Claraeola Aczél, 1940
C. clavata (Becker, 1897)
C. cypriota Kehlmaier, 2005
C. conjuncta (Collin, 1949)
Clistoabdominalis Skevington, 2001
C. dilatatus (De Meyer, 1997)
C. nitidifrons (Becker, 1900)
C. ruralis (Meigen, 1824)
C. sinaiensis (De Meyer, 1995)
C. trochanteratus (Becker, 1900)
C. tumidus (De Meyer, 1997)
Dasydorylas Skevington, 2001
ar
|
=
_
[ne
oe |
=|
oa |
/ |
a |
|
li
7
[|
ill
=
[a
[C.brevicandis Jervis, 1992 |
[Cclarus Servis 1992
[C.indistinctus Jervis, 1992 |
[C.spurius (Fallen, 1816)
[Vervallia Mik 1899
Vaueta (Fallen 1817)
[NephrocerinaeAczé 1939 |
[Nephrocerus Zetterstedt, 1838 |
[N.seutellatus (Macquart, 1834) |
[Pipunculinae Walker, 1834 |
Cephalopsini
[Cephalops Fallen 1810
[C.(Cephalops) conjunetivus Coe 1958 |
[C. (Parabeckerias) obtusinervis (Zetterstedt, 1844) [|
[C. (Semicephalops) perspicuus (de Meijere, 1907) |
[C. (Semicephalops) straminipes (Becker, 1900) |
[C.(Semicephalops) ultinus (Becker, 1900) |
fudotini
[Claraeola cas 1940
[C.clavata (Becker, 1897)
[Ceypriota Kehmaier, 2005 |
[Cconjuneta (Colin, 1949) |X
[Clistoabdominalis Skevington, 2001 |
[C.dilatatus (De Meyer, 1997) |
[C.nitidfrons (Becker, 1900) |X
[Cruralis (Meigen, 1824) |X
[C.sinaiensis(De Meyer, 1995) |X
[C.trochameratus (Becker, 1900) |X
LC. tumidus(De Meyer. 1997) |
[Pasydorylas Skevington, 2001 |
[D. gradusKehimaier,2005 |
[D. holosericeus (Becker, 1897) |
[D. setosus (Becker, 1908) |
[EudorylasAcas1940
[eanctusKehinaien 2005 ————~d Si XT dT
[ie blscorDemeyen i977 ———S—S—~d Si x | dT Cd
Bonn zoological Bulletin 68 (1): 31-60 ©ZFMK
New data on Mediterranean Pipunculidae 59
eg ed or
EcmatiKorneis iTS Xx TTT
.ctorans (beckon 99) —————S—~i SSCs x | Pr
fet (Becker 190) ————~d CX ~| x | pd
ae A a
Ee semesnciniesa6s LP
Ee
infers Colin, 1956 <i SiS
medteranen De Meyer Ackand, 997 |__| _x_[| x
i. obinme coe. i566 SS SSSCdESSCdS XT
[&obscrusCoe,1966 —————S—S—~d Si
.panmonicas Backer 187) ————SS~s SX
sae Ganssens 1955) |__| x |
. stfascpes Coli, i986 |__| x |
.rapezods Becker 900) «dCi
.triangris Keniaie, 2005 |__| |
é.tigoms Benker 190) «dCi
uncer Catertea, 884) +d + x |
. cermatensis (Beker, 1997) ————~dYt iS
Er
Piomenustaneiie 2 ———SSSSC*di
PcarevoiaiKunen.i5 ||
P.umbarine Kohima 2010 +i
Ee
[Doniomerpha ALI
[B. Denyomerpha)imparaacouin,i9a | «|X|
[B (Dostomyza) aera esst 1950 |__| _x_[|
Tomowanetanasie9 |
racer Kuen. i958 |X S|
Fr ciiemoraa ecker1901) ————~d_x | x |
Fr coguite Keres, 907) —————~+dt «ix
bmn Dene 95
djs Bote, 90)
Tr dts DeMeyer 995 SS~S
fidbergi De Meyer 995 ————SS—~dCS~dSC
froma Becken 1997) —————S—S~d <P
Fr genicuta(eigen, 82) <i SiS
nanensis Colin, 949) ————S—~dC SP
Tr tldeos DeMeyer 9977 ———S~wSSiC
[ir inermis De Meyer 1995 «di xX
inpinaa Dewieyen 1995 ————SS—C~iCi SP
Bonn zoological Bulletin 68 (1): 31-60 ©ZFMK
mM |r | | | x | OS | OS
~<
60 Christian Kehlmaier et al.
[ee
[KisrcenisdeMeeni9s EE x TT
7. parakuthyi De Meyer, 1995
T: vicina (Becker, 1900) x
Bonn zoological Bulletin 68 (1): 31-60 ©ZFMK
FORSCHUNGS
AM 6ENIG Bonn zoological Bulletin 68 (1): 61-91
2019 -Trape JF et al.
https://do1.org/10.20363/BZB-2019.68.1.061
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org:pub:0F40DD 1 A-D80F-49BA-B6DF-FF8F27E487E7
On the Psammophis sibilans group
(Serpentes, Lamprophiidae, Psammophiinae)
north of 12°S, with the description of a new species from West Africa
Jean-Francois Trape', Pierre-André Crochet’, Donald G. Broadley*?, Patricia Sourouille’,
Youssouph Mané*, Marius Burger®, Wolfgang Boéhme’, Mostafa Saleh’, Anna Karan’,
Benedetto Lanzat!’ & Oleg Mediannikov"!
“> Institut de Recherche pour le Développement (IRD), Laboratoire de Paludologie et de Zoologie Médicale, UMR MIVEGEC,
B.P. 1386, Dakar, Sénégal
2.4 Centre d’Ecologie Fonctionnelle et Evolutive (CEFE), UMR 5175, CNRS — Université de Montpellier — Université Paul-Valéry
Montpellier — EPHE, 1919 Route de Mende, F-34293 Montpellier cedex 5, France
3 Natural History Museum of Zimbabwe, P.O. Box 240, Bulawayo, Zimbabwe
° African Amphibian Conservation Research Group, Unit for Environmental Sciences and Management, North-West University,
Potchefstroom 2520, South Africa — Flora, Fauna & Man, Ecological Services Ltd, Tortola, British Virgin Islands
’Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany
° Departement of Zoology, Faculty of Science, Al Azhar University, Cairo, Egypt
*1 Aix Marseille Université, IRD, AP-HM, MEPHI, Marseille, France
!0 Museo di Storia Naturale, Universita di Firenze, Sezione di Zoologia ‘‘La Specola”’, Via Romana 17, I-50125 Firenze, Italy
“Corresponding author: Email: [email protected]
'urn:lsid:zoobank. org:author:F8BE8015-09CF-420B-98D3-D255D 142AA2D
urn:|sid:zoobank.org:author: BBBDEE7B-A5F5-4161-A85B-8955EA 86432A
>urn:lsid:zoobank. org:author: 1615CF64-94B 1-4FOB-849E-18514AB10010
“urn:|sid:zoobank.org:author:4B2249CA-1D60-4A CB-8839-D6128B523A0F
>urn:|sid:zoobank.org:author: 1 1 SEFE60-2220-436F-AB43-CAF6D5011410
°urn:lsid:zoobank.org:author: DE28 1330-973D-4FFO-B506-809247E76E4D
7urn:|sid:zoobank.org:author: FFAC2972-9F52-404B-BA9C-489C7793FF8D
Surn:lsid:zoobank.org:author: | CE839A7-CE97-498D-8780-36C64029C899
*urn:|sid:zoobank.org:author:8AA64018-8520-4694-BD77-FDDA 760DBD3C
'urn:Isid:zoobank.org:author:}6E670725-CBA3-4E05-A4F2-26602ED614F9
''urn:lsid:zoobank. org:author:EF2B 1604-1 BDB-4739-AA65-7458BD8DB3F8
Abstract. Based on molecular, morphological and field data, the status and zoogeography of the taxa of the Psammophis
sibilans group north of 12°S are reviewed. Molecular data including sequences from 20 of the 22 described species known
to occur north of 12°S suggest that P. sibi/ans distribution is restricted to northeastern Africa, from Egypt to Ethiopia. Po-
pulations from West Africa are described as a new species, P. afroccidentalis sp. nov., and those from Chad, Cameroon and
Central African Republic are assigned to P. rukwae which is also distributed from Tanzania to Ethiopia. Molecular data
indicate the occurrence within this complex of three additional cryptic species in the Horn of Africa. Populations previous-
ly assigned to P. phillipsi in Central Africa north, south and east of the Congo forest block are assigned to P. mossambicus
and the status of P. occidentalis is discussed. P. phillipsi is restricted to West Africa, with P. irregularis as junior synonym.
Key words. Reptilia, Ophidia; Psammophiinae, Psammophis sibilans, Psammophis afroccidentalis sp. nov., taxonomy,
biogeography, Africa.
INTRODUCTION
According to Hughes (1999) Psammophis sibilans (Lin-
naeus, 1758) is the species “mostly widely and commonly
reported from Africa and the most confused taxonomical-
ly of any African snake”. According to Broadley (1963)
Received: 26.10.2018
Accepted: 24.05.2019
“the Psammophis sibilans group has been a herpetolo-
gist’s nightmare for two centuries”. The nomen sibilans
was based on several specimens, one of them is still ex-
tant and preserved at Uppsala University museum (Lin-
naeus coll. n° 42). It has been figured by Anderson (1898:
fig. 12) and Brandstatter (1996: fig. 25), and its identi-
Corresponding editor: P. Wagner
Published: 13.06.2019
62 Jean-Frang¢ois Trape et al.
ty well established (Loveridge 1940). The type locality
“Asia” (in error) was corrected to Africa (Anderson 1898,
Flower 1933) then restricted to Egypt (Loveridge 1953).
Loveridge (1940) revised the genus and grouped the fol-
lowing six taxa as subspecies of P. sibilans: P. schokari
(Forskal, 1775), P. phillipsi (Hallowell, 1844), P. notos-
tictus Peters, 1867, P. trinasalis Werner, 1902, P. leighto-
ni Boulenger, 1902, and P. sudanensis Werner, 1919. He
also synonymized P. irregularis Fisher, 1856, P. brevi-
rostris Peters, 1881, P. mossambicus Peters, 1882 and P.
leopardinus Bocage, 1887 with P. sibilans, and P. regula-
ris Sternfeld, 1908 and P. occidentalis Werner, 1919 with
P. phillipsi. Marx (1958) described Psammophis aegyp-
tius and erected P. schokari as a full species. Broadley
(1966) described P. sibilans rukwae from southwestern
Tanzania. This taxon was distinguished from all other
related southeastern forms of Psammophis by having
the first five lower labials in contact with anterior sub-
linguals, an arrangement typical of Egyptian populations
of P. sibilans. He also argued that P. sibilans rukwae was
widely distributed north of the Equator from Tanzania to
Senegal. Broadley (1977) recognized P. phillipsi as a full
species ranging from Senegal to South Africa, P. /eop-
ardinus as a subspecies of P. sibilans, and P. notostictus,
P. leightoni and latter (Broadley 2002) P. trinasalis and
brevirostris as full species distributed in southern A frica.
Spawls (1983) described P. /eucogaster on the basis of a
single specimen from Wa, Ghana. A revision of the genus
Psammophis by Brandstatter (1995, 1996) was discussed
by Hughes (1999) who provided an updated table of the
nomenclatural changes in Psammophis over the past 100
years. Branch (1998) restricted P. phillipsi to West Af-
rica and applied the name P. mossambicus for southern
African populations. Hughes (1999), then Trape & Mané
(2006), thought that P. /eucogaster was conspecific with
P. sudanensis, which they recognized as a full species,
whereas Broadley (1977) previously synonymized P. su-
danensis with P. sibilans, and Bohme (1986) treated it
as conspecific with P rukwae. Hughes & Wade (2002)
described P. zambiensis from Zambia and southern Dem-
ocratic Republic of the Congo, a species previously con-
founded with P. /eopardinus from Angola that they erect-
ed as a full species. Broadley (2002) erected P. orientalis
Broadley, 1977, from eastern and southern Africa as a
full species. This taxon was initially described as a sub-
species of P. subtaeniatus Peters, 1882, a species widely
distributed south of 12°S (Broadley 2002). Hughes &
Wade (2004) revived P. occidentalis from the synonymy
of P. phillipsi and proposed to use this name for the pop-
ulations of central Africa north of the Congo forest block
previously assigned to P. phillipsi. Several Psammophis
species were included in the phylogeny of the Lamprophi-
idae by Vidal et al. (2008). Kelly et al. (2008) published
a phylogenetic study of Psammophis and allied genera
including 39 species, but few specimens from West or
Central Africa were included in these studies. Additional
Bonn zoological Bulletin 68 (1): 61-91
species of the genus Psammophis currently recognized
in Africa north of 12°S include P. elegans (Shaw, 1802),
P. praeornatus (Schlegel, 1837), P. lineatus (Duméril,
Bibron & Dumeéril, 1854), P punctulatus Dumeril, Bi-
bron & Dumeril, 1854, P. angolensis (Bocage, 1872),
P. biseriatus Peters, 1881, P. pulcher Boulenger, 1895,
P. jallae Perraca, 1896, and P. tanganicus Loveridge,
1940 (Wallach et al. 2014, Uetz & HoSek 2018). Here we
present molecular and morphological data on the taxa of
the P. sibilans group and review their status and zooge-
ography north of 12°S.
MATERIALS AND METHODS
Extensive field studies of snakes were conducted in West
and Central Africa between 1980 and 2017 by one of the
authors (JFT) who collected more than 4,000 specimens
belonging to the genus Psammophis. The database of
another author (DGB) included most of the P. sibilans
group material available in American, European and
southern African museums, totalling more than 3,000
specimens. Tissues from selected specimens of most taxa
and colour variants of the P. sibilans group collected by
JFT, MB and WB between 2006 and 2017, or originat-
ing from the BEV tissue collection in Montpellier, were
used for the molecular study (see Table 1). We also ob-
tained tissues from specimens of P. sibilans from Egypt
(collected by MS), and of P. mossambicus from Gabon
(provided by L. Chirio). We included in our phylogenetic
tree data from GenBank, in particular those from Kelly
et al. (2008) and Vidal et a/. (2008) who sequenced most
Psammophis taxa known from southern and eastern Af-
rica. Sequences of Malpolon monspessulanus and Psam-
mophylax rhombeatus downloaded from GenBank were
used as outgroups.
Molecular studies were conducted independently in
Montpellier (PS and PAC) and Marseille (OM and AK)
with 3 mitochondrial DNA genes: ND4 (Montpellier),
16S (Marseille), and CytB (both Montpellier and Mar-
seille, most samples duplicated). DNA from small pieces
of snake tissue samples preserved in 80-96% ethanol was
extracted using either the DNeasy Blood & Tissue Kit or
the BioRobot MDx Workstation (Quiagen, Courtaboeuf,
France), with customized extraction protocols following
the manufacturer’s instructions and doing negative con-
trol with water. Whole DNA eluted in 200 ul AE Buffer
was stored at 4°C until used in Polymerase chain reactions
(PCR) amplifications. We amplified mitochondrial 16S
rDNA with the universal vertebrate primers 16SA-2290,
CGCCTGTTTACCAAAAACAT and 16SB-2860, CCG-
GTCTGAACTCAGATCACGT (Gatesy eft al. 1997),
NADH dehydrogenase subunit 4 with primers ND4,
CACCTA TGACTACCAAAAGCTCATGTAGAAGC
and Leu CATTACTTTTACTTGGATTTGCACCA
(Arévalo et al. 1994) and Cytochrome b with primers
©ZFMK
Psammophis sibilans group 63
L14724, CGAAGCTTGATATGAAAAACCATCGTTG
(Irwin et a/. 1991) and H15547b AATAGGAAG TAT-
CATTCTGGTTTAATG (Campbell 1997). Primers were
manufactured by Eurogentec (Seraing, Belgium).
In Montpellier PCR amplification was carried out in
20 uL using REDExtract-N-Amp PCR Reaction Mix,
primers at 0.5 uM and 8 ul of DNA. Thermocycling con-
ditions were an initial denaturation step of 2 minutes at
94°C, followed by 35 to 40 cycles of 94°C, 40 s; 53°C,
40 s; 72°C, 1 min and a final elongation step of 10 min
at 72°C. Negative extraction and PCR controls with wa-
ter were amplified to check absence of contamination by
PCR products from previous amplifications in our ampl-
icons. Approximatively 150 ng of unpurified PCR prod-
ucts were sent to Eurofins Genomics (Ebersberg, Germa-
ny) for purification and sequencing with PCR primers
and internal forward primer of Cytochrome b gene SNK-
P2b TGARGACAAATATCATTC (Kelly et al., 2003).
In Marseille PCR was performed using a HotStar Taq
DNA Polymerase Kit (Qiagen) with 1.0 uwL MgCl2, 0.2
uL HotStart Tag, 2.5 wl 10x PCR buffer, 2.5 uL dNTP
(2 mM stock), 0.5 uL of a 10 uM solution of each primer,
12.8 wL sterile water and 5 uwL of DNA. Cycling condi-
tions were as follows: 94°C 2 minutes followed by 40
cycles of 94°C, 30 s; 53°C, 30 s; 72°C, 1 min.; the final
elongation was at 72°C, 3 min. We did not use positive
controls. Sterile water was used as negative control. PCR
products were visualized by electrophoresis on a 1.5%
agarose gel, stained with ethidium bromide and exam-
ined using an ultraviolet transilluminator. The PCR prod-
ucts were purified using a QIAquick Spin Purification Kit
(Quiagen) according to the manufacturer’s instructions.
Sequencing of amplicons was performed using the Big-
Dye Terminator Cycle Sequencing Kit (Perkin Elmer Ap-
plied Biosystems) with ABI automated sequencer (Ap-
plied Biosystems 3130 Genetic Analyzer).
We used Codon Code Aligner 4.2.5 (LI-COR, Inc) and
MEGA 6.06 (Tamura et al. 2013) to check, assemble and
align sequences. The phylogenetic tree was inferred us-
ing Maximum-likelihood with MEGA 6.06 using the fol-
lowing options: 1000 bootstrap replications, use all sites,
and default settings for the other options. The best substi-
tution model (HK Y+G+I) was determined with MEGA
using the BIC critertum for the whole alignment.
Morphological analysis included classical meristic
data (numbers of dorsals, ventrals, subcaudals, oculars,
temporals, supralabials and infralabials) and several col-
oration characters, with special attention to some char-
acters that previous studies have shown to be of interest
in the genus Psammophis (Hughes 1999, Broadley 2002,
Hughes & Wade 2002): (1) the infralabials contact with
anterior sublinguals, (2) the aspect of the cloacal scale
(entire or divided), (3) the dorsal head pattern, (4) the oc-
curence and aspect of a vertebral chain (colour pattern of
alternate pale and dark areas on the central row of dorsal
Bonn zoological Bulletin 68 (1): 61-91
scales), and (5) the occurrence of pale longitudinal bands
over body.
RESULTS AND DISCUSSION
Molecular analysis
We aligned 513-514 bp of 16S, 797 bp of cytochrome 5,
and 852-855 bp of ND4. Of the 2160 mitochondrial nu-
cleotides, 776 are variable and 654 informative under the
parsimony criterion. All sequences have been deposited
with GenBank and accession numbers are given in Ta-
ble 1 (Appendix I).
The phylogenetic tree (Fig. 1) includes sequences from
our specimens and additional sequences from GenBank
specimens. Only two taxa (P. pulcher and P. zambiensis)
of the 22 Psammophis taxa currently known north of
12°S are missing in this tree which reveals eleven major
lineages of Psammophis species, including nine lineages
for the species (and unnamed cryptic species) distributed
north of 12°S:
¢ Lineage | includes two clades, the first one (clade 1a)
comprising the GenBank sequences of P. rukwae from
Tanzania and Kenya, one of our sequences from Ethi-
opia, and sequences from Chad, with in particular all
those from Baibokoum at the tri-junction border of Chad,
Cameroon and Central African Republic, some of them
belonging to specimens with uniform dorsum (Fig. 2)
and others with marked vertebral and dorsolateral stripes
(Fig. 3). All these specimens are characterized by five in-
fralabials in contact with the anterior sublinguals and a
divided cloacal. The second clade 1b comprises all our
sequences from West Africa, but also a sequence from
Mao in Chad. As in clade la, some of them belong to
specimens with uniform dorsum (Fig. 4) and others with
marked vertebral and dorsolateral stripes (Fig. 5). As in
clade 1a, all these specimens have also five infralabials
in contact with the anterior sublinguals and a divided clo-
acal. Within clade la, there is very little divergence be-
tween P. rukwae from Tanzania and our specimens from
Chad and Ethiopia, and less divergence between our
specimens than between P. rukwae from Tanzania and
P. rukwae from Kenya. Within clade 1b, two groups with
close sequences are observed, one including specimens
from Senegal, Mauritania, Guinea, Ivory Coast (data not
shown, ND4 only), Mali (data not shown, ND4 only)
and one of two specimens from Niger, the second group
including specimens from Burkina Faso and Benin, the
second specimen from Niger (data not shown, ND4 only)
and a specimen from Mao in Chad. To our knowledge,
there is no available name in the literature for these West
African specimens of clade 1b that were previously con-
founded with P. sibilans or attributed either to PR. rukwae,
P. cf. rukwae or P. cf. phillipsi in the recent literature.
©ZFMK
64 Jean-Frang¢ois Trape et al.
P. rukwae Chad IRD 2121.N
971 p. rukwae Chad IRD 2020.N
P. rukwae Chad IRD 2150.N
77\ P. rukwae Chad IRD 1949.N
198 P. rukwae Chad IRD 1888.N
P. rukwae Kenya DQ486279 DQ486443 1a
95} P. rukwae Ethiopia MBUR 08343
P. rukwae Chad IRD 2001.N
100)..4 P. rukwae Chad IRD 2759.N
P. rukwae Chad IRD 2002.N
99) P. rukwae Tanzania DQ486214 DQ486375
100! P. rukwae Tanzania DQ486215 DQ486376
P. rukwae Kenya DQ486282 DQ486446
70; P. afroccidentalis Niger FJ404325 FJ404316 FJ404219
P, afroccidentalis Mauritania IRD TR.4501
P. afroccidentalis Guinea IRD 5001.G
ito P. afroccidentalis Guinea IRD TR.4177
P. afroccidentalis Senegal IRD TR.4167 1 b
99) P. afroccidentalis Burkina Faso IRD TR.4173
P. afroccidentalis Chad IRD 2808.N
98} | P. afroccidentalis Benin ZFMK 77012
46| P. afroccidentalis Benin ZFMK 77036
82 P. afroccidentalis Benin ZFMK 77019
96
1007 P. orientalis Mozambique DQ486295 DQ486459
100} P. orientalis Tanzania DQ486219 DQ486380 2 a
99) P. orientalis Mozambique DQ486235 DQ486396
48) P. orientalis Tanzania DQ486232 DQ486393
z P. cf. sudanensis Kenya DQ486266 DQ486429 2 b
100 P. cf. sudanensis Tanzania DQ486221 DQ486382
| P. subtaeniatus Zimbabwe DQ486253 DQ486415 2 Cc
| P. sudanensis Chad IRD 2289.N
1" 100] P. sudanensis Chad IRD 2280.N 2 d
98) P. sudanensis Chad IRD 2283.N
P. sudanensis Chad IRD 2231.N :
| | al P. sp. cf. sibilans Ethiopia DQ486256 DQ486419 2 e
P. sibilans Ethiopia MBUR 08588
P. sibilans Egypt BEV T.4799
100] |p. sibilans Egypt AUZC R.143973 2f
100! P. sibilans Egypt AUZC R.143972
P. leopardinus Namibia DQ486298 DQ486462 3 a
100/- P. sp. cf. occidentalis Burundi DQ486264 DQ486427
98) P. sp. cf. occidentalis Zambia DQ486210 DQ486371
P. brevirostris South Africa DQ486241 DQ486402 3 b
100L P. brevirostris Zimbabwe DQ486234 DQ486395
P. sp. Ethiopia MBUR 08346 3c
40| P. phillips? Guinea IRD 5005.G
P. phillipsi Guinea IRD 5004.G
62
51} P. phillipsi Guinea IRD 5002.G
99 P. phillipsi Guinea IRD 5003.G
P. phillipsi Guinea IRD TR.4609 3 d
gq| | P. phillips? Guinea IRD TR.4610
99 P. phillipsi Togo IRD 10.T
P. phillipsi Togo IRD 358.T
|, P. phillipsi Togo IRD 44.T
75| P. phillipsi Togo IRD 367.T
P. mossambicus Chad IRD 2226.N
63] P. mossambicus Chad IRD 2136.N
P. mossambicus Chad IRD 2066.N
99 P. mossambicus Chad IRD 2053.N
P. mossambicus Chad IRD 2224.N
100] | P. mossambicus Chad IRD 2238.N
P. mossambicus Chad IRD 2186.N
P. mossambicus Cameroon IRD TR.4579
oor P. mossambicus South Africa DQ486239 DQ486400
96 P. mossambicus Mozambique FJ404322 FJ404314 FJ404217
94;— P. mossambicus Mozambique DQ486293 DQ486457
P. mossambicus Tanzania DQ486198 DQ486359 3 e
P,. mossanibicus Kenya DQ486283 DQ486447
P. mossambicus Rwanda DQ486222 DQ486383
93. Pp, mossambicus Zambia ZFMK 88703
7799) P. mossambicus Zambia ZFMK 88503
3h) -P. mossambicus Zambia ZFMK 88502
t P. mossambicus Botswana DQ486249 DQ486411
53] P,. mossambicus Republic Congo MBUR 08242
|| P. mossambicus Gabon IRD TR.4367.LC
SSI! P. mossambicus Gabon IRD TR.4366.LC
10] P. mossambicus Republic Congo MBUR 03143
P, mossambicus Gabon DQ486290 DQ486454
34 57! P. mossambicus Gabon FJ404323 AY612061 AY611879
P. lineatus Chad IRD 2120.N
100L P. Jineatus Benin FJ404354 FJ404313 FJ404216
P. biseriatus Tanzania DQ486228 DQ486389
99 P. sp. Somalia FJ404326 FJ404317 FJ404220
96 P, tanganicus Tanzania DQ486217 DQ486378
gi— P. elegans Ivory Coast IRD 222.Cl
P. elegans Mauritania IRD TR.4504
62 100|__p. elegans univittatus Chad IRD 2761.N
(| P. punctulatus trivirgatus Tanzania DQ486269 DQ486432
P. praeornatus Senegal IRD 9193.S
41
86
aon Oo ao Ff
l| 400 P, schokari Tunisia FJ404324 AY612034
29 P. schokari Morocco DQ486204 DQ486365
700 P. aegyptius Egypt BEV.11350 MG003038 MG002972
57 Tool; P. aegyptius Egypt BEV.T4801 MG003042 MG002976
991 P. aegyptius Egypt BEV.10372 MG003041 MG002975
100) P. angolensis Botswana CMRK263 DQ486248 DQ486410
P. angolensis Botswana CMRK447 DQ486275 DQ486439 9
99 100 P. angolensis Zambia CMRK283 DQ486254 DQ486416
100'_ P. angolensis Tanzania CMRK392 DQ486270 DQ486433
P. crucifer South Africa DQ486310 D|486334 10
P. jallae Botswana DG486247 DO4B6409
gl trigrammus Namibia DQ486305 Da486469 1 1
: Malpolon monspessulanus FJ404320 AY 188029 AY188068
99 Psammophylax rhombeatus Fu404327 FJ404312 Fl404215
0.05
Fig. 1. Phylogenetic tree (16S, Cyt. B, ND4) of the African spe-
cies of Psammophis inferred with maximum likelihood from a
concatenated dataset. Numbers on branches are bootstrap sup-
port values. Black lines separate the major lineages, and red
lines clades within lineages 1—3 which include most species of
the Psammophis sibilans group.
Bonn zoological Bulletin 68 (1): 61-91
They are described below as a new species, Psammophis
afroccidentalis sp. nov.
¢ Lineage 2 includes six clades. Clade 2f comprises
the three specimens of P. sibilans from Egypt and one
specimen from Ethiopia, clade 2e a GenBank sequence
from Ethiopia attributed to P. cf. sibilans, clade 2d our
specimens of P. sudanensis from Chad, clade 2c Gen-
Bank sequences of Kenyan and Tanzanian specimens at-
tributed to P. sudanensis, clade 2b P. subtaeniatus from
Zimbabwe, and clade 2a P. orientalis from Tanzania and
Mozambique. No sequence of P. sibilans from Egypt was
available before the present study, and our results clearly
show that most previous records of P. sibilans in the lit-
erature were erroneous, but also that P. sibilans distribu-
tion reach Ethiopia, likely with a continuous distribution
through Sudan as previously proposed by Brandstatter
(1995, 1996). Unfortunately, no specimen from Sudan
was available for the molecular study.
¢ Lineage 3 corresponds to the P. phillipsi complex
and includes five clades. All species belonging to these
clades have four infralabials in contact with the anteri-
or sublinguals. Clade 3a corresponds to P. /eopardinus
from Namibia, clade 3b comprises P. brevirostris from
southern Africa and GenBank sequences from Burundi
and Zambia of Kelly et al. (2008) labelled P. phillipsi
occidentalis (see below), and clade 3c corresponds to a
probably undescribed species from Ethiopia collected by
one of us (MB). The two other clades include specimens
of wet savannas and forest-savanna mosaics distributed
either in West Africa (clade 3d), or north, east and south
of the Congo forest block (clade 3e).
All specimens from West Africa (clade 3d) are al-
most identical genetically, but they include both typical
P. phillipsi specimens (from Guinea and Togo, with en-
tire cloacal scale) and two specimens from southern Togo
characterized by black dorsal blotches and, for one spec-
imen, by a divided cloacal scale, 1.e., matching the char-
acteristics of the holotype of P. irregularis that originated
from the same area (Fig. 6). This supports the view that
P. irregularis is a junior synonym of P. phillipsi, a species
restricted to West Africa.
Around the Congo forest block (clade 3e), specimens
from Chad and Cameroon selected for the molecular
analysis also presented a variety of colour patterns, in-
cluding unpatterned specimens, specimens with dor-
sal black blotches, specimens with orange supralabials
(Fig. 7) that are common in Adamaoua mountains in
Cameroon (Psammophis sp. 1 of Chirio & LeBreton
2007), and specimens with or without black spots on
the supralabials, the throat and the ventrals. Despite
these marked differences in colour patterns, sequences
were all almost identical, and there was little difference
between these specimens and those of P. mossambicus
from south and east of the Congo forest block. All have
four infralabials in contact with the anterior sublinguals
and a divided cloacal. Hughes & Wade (2004) resurrect-
©ZFMK
Psammophis sibilans group 65
ed P. occidentalis Werner, 1919, for the populations of
the P. phillipsi complex distributed north of the Congo
forest block from Cameroon to Uganda. The lectotype
of P. occidentalis (type locality: “Congo” without preci-
sion) has a vertebral chain, a dorsolateral light coloured
stripe on body scales 4/5 and grey obfuscation of the
ventral scales in the midline (Hughes & Wade 2004).
This pattern was not observed in the specimens from
Chad or Cameroon that we sequenced, but according to
Hughes & Wade (2004) it is not rare north of the Con-
go forest block where various patterns are observed as
previously highlighted by Roux-Estéve (1965). Howev-
er, the pattern with a vertebral chain and a dorso-lateral
stripe is also common south of the Congo forest block, in
particular in coastal savannas of Gabon, Republic of the
Congo and Democratic Republic of the Congo (“P. sib-
ilans” of Trape & Roux-Estéve 1995, see Fig. 8). Our
three specimens from coastal Gabon and Republic of the
Congo with this pattern are very close molecularly to
P. mossambicus specimens from Zambia, Rwanda, Tan-
zania, Kenya, Mozambique, Botswana and South Africa.
Thus we follow Branch (1998) and Broadley (2002) in
attributing all specimens of clade 3e to P mossambicus,
both north, east and south of the Congo forest block, and
we treat P. occidentalis as synonym of P. mossambicus.
East and south of the Congo forest block, clade 3b in-
cludes P. brevirostris from Zimbabwe and South Africa,
and two specimens from Burundi and Zambia studied
by Kelly et a/. (2008) that were attributed with doubt
by these authors to P. phillipsi occidentalis. According
to Hughes & Wade (2004), who revived this taxon, P.
occidentalis was attributable only to populations north of
the Congo forest block from Cameroon to Uganda. How-
ever, aS mentioned above, the specimens from this area
that we sequenced match much better P. mossambicus.
Kelly et al. (2008) sequences in clade 3b may correspond
to P. zambiensis — a species known from Zambia — or to
an undescribed cryptic species.
¢ Lineages 4-11 include species previously sequenced
and discussed by Kelly et al. (2008) and some additional
taxa. In the P. sibilans group, both P. schokari and P. ae-
gyptius (lineage 8) belong to a lineage distant from those
of P. sibilans, P. rukwae and P. afroccidentalis sp. nov.
Lineage 5 comprises three species, all distributed in East
Africa: P. biseriatus, P. tanganicus and a cryptic species
from Somalia sequenced by Kelly et al. (2008). In the
other lineages, no species belong to the P. sibilans group.
There is little divergence between P. elegans univittatus
Perret, 1961 from Cameroon and Chad and the nominate
subspecies from West Africa (lineage 6). The colour pat-
terns of these two taxa are distinct, with univittatus pos-
sessing a single vertebral brown line and lacking those
present on the flanks in e/egans. The univittatus pattern
is rare in West Africa (Hughes unpublished, Trape &
Mané 2015) but was observed in all specimens collected
in Chad except two specimens from Mao (Trape unpub-
Bonn zoological Bulletin 68 (1): 61-91
lished). Lineages 4, 7, 9 and 10 comprise each a single
species, P. lineatus, P. praeornatus, P. angolensis and
P. crucifer, respectively, with the later species restricted
south of 12°S. Finally, lineage 11 comprises two species,
P. jallae and P. trigrammus, which are also restricted
south of 12°S (Broadley 2002).
SYSTEMATIC ACCOUNT
PSAMMOPHIS SIBILANS (Linnaeus, 1758)
Egyptian Hissing Sand Snake,
Schmuck-Sandrennnatter
Psammophis _rayé,
Coluber sibilans Linnaeus, 1758, Syst. Nat., ed. 10, 1:
222. Type locality: “Asia” & 1766, Syst. Nat., ed. 12,
12383;
“Le Chapelet” Lacépede, 1789, Hist. Nat. Serpens 2:
246, pl. xii, fig. 1.
Coluber Gemmatus Shaw, 1802, Gen. Zool., 3: 539. No
locality.
Coluber moniliger Daudin, 1803, Hist. Nat. Rept. 7: 69.
No locality.
Natrix sibilans Merrem, 1820: Vers. Syst. Amphib.: 114.
Coluber auritus Geoffroy Saint Hilaire, 1827, Descr.
Egypte, 1, Hist. Nat. Rept.: 147, 151, pl. viti, fig. 4.
Type locality: Egypt.
Psammophis sibilans Boie, 1827, in Oken, Isis, 20, col.
547; Gunther, 1858: 136 (part); Jan & Sordelli, 1870:
Livr. 34, Pl. 11, fig. 3 (Cairo); Boulenger, 1896: 161
(part); Anderson, 1898: 303, fig. 12, Pl. xlim; Bouleng-
er, 1915c: 653 (part); Flower, 1933: 824; Corkill, 1935:
20 (part); Parker, 1949: 70 (part); Largen & Rasmus-
sen, 1993: 366 (part); Brandstatter, 1995: 173 (part), PI.
14; Schleich et al., 1996: 517; Largen, 1997: 91 (part);
Baha el Din, 2006: 266; Largen & Spawls, 2010: 564
(part); Geniez, 2015: 248.
Coluber lacrymans Reuss, 1834, Mus. Senckenberg 1:
139. Type locality: Tor District, Arabia (= Tor, Sinai
Peninsula, Egypt).
Psammophis moniliger Peters, 1862: 274 (Egypt).
Psammophis sibilans sibilans Loveridge, 1940: 30 (part);
Marx, 1956: 8; 1968: 198; Lanza, 1972: 178; 1983:
227 (part); 1990: 440 (part); Saleh, 1997: 156, PI. 92.
Description. (325 specimens from Egypt and two spec-
imens from Ethiopia examined) Nostril pierced between
2 nasals; preocular 1 (very rarely 2), in short contact with
or separated from frontal; postoculars 2 (very rarely 3);
temporals basically 2+2+3, but with frequent fusions; su-
pralabials 8 (but often 9 in Upper Egypt), the 4" & 5" (or
the 5" & 6") entering orbit; infralabials usually 10 or 11
(rarely 9 or 12), the first 5 in contact with anterior sublin-
guals; dorsal scales in 17-17-13 rows; ventrals 154-178:
cloacal divided; subcaudals 98-119 (lowest count 91 fide
©ZFMK
66 Jean-Frang¢ois Trape et al.
Anderson 1898, but tip of the tail probably mutilated).
Brandstatter (1995, fig. 68-70) has published SEM mi-
crographs of a dorsal scale of an Egyptian specimen.
Dorsum brown, top of head often with a pale median
stripe on the snout which either terminates at the fron-
tal or continue up to two-thirds its length (Fig. 9), back
of head often with pale transverse markings; labials im-
maculate yellow or with a few dark spots; dorsum plain
(Fig. 10) or with a vertebral line with each scale yellow
with black laterally or paler at base and pale dorsolateral
stripes on scale rows 4 and 5 (Fig. 11); lower half of outer
scale row and ventrals yellow; sometimes a pair of faint
or broken black ventral hairlines.
Size. Largest specimen: 1,445 mm (Flower 1933).
Remarks. Here we follow the usage established by
Loveridge (1953) in treating “Egypt” as the type locality
of P. sibilans. However, to fulfil the requirements of the
code of Zoological Nomenclature, a proper restriction
of type locality would require designation of a lectotype
and, if the origin of the lectotype cannot be traced and/or
its identity cannot be ascertained, application to the com-
mission to set aside the type and designate a neotype in
accordance with Article 75.5 of the Code. Further studies
are needed to establish the distribution of P. sibilans in
north-eastern Africa. Sequences from Ethiopia and So-
malia published by Kelly et a/. (2008) and one additional
sequence from our specimens suggest that at least three
cryptic species of the Psammophis sibilans group occur
in the Horn of Africa.
Habitat. Cultivated and other vegetated areas along
the Nile in Egypt and Sudan, woodland savanna in Ethi-
opia.
Distribution. Egypt, Sudan and Ethiopia. Possibly
extending in neighbouring areas of Eritrea and South
Sudan. Figure 12 shows the geographic distribution of
the P. sibilans specimens that we sequenced, and of other
sequenced specimens of closely related species.
PSAMMOPHIS RUKWAE Broadley, 1966
Rukwa Whip Snake, Psammophis du Rukwa, Ruk-
wa-Sandrennnatter
Psammophis sibilans sibilans (not Linnaeus) Loveridge,
1940: 30 (part); 1956: 48 (part); Perret, 1961: 136;
Roussel & Villiers, 1965: 1528; Graber, 1966: 141.
Psammophis sibilans (not Linnaeus) Boulenger, 1896:
161 (part); Sternfeld, 1908b: 218, 233; 1909a: 21;
1917: 478; Bohme, 1975: 40; Hughes, 1983: 353
(part); Chippaux, 2006: 175 (part); Chirio & Ineich,
2006: 52; Chirio & LeBreton, 2007: 534.
Psammophis subtaeniatus (not Peters) Loveridge, 1933:
254 (part).
Psammophis subtaeniatus sudanensis (not Werner) Ve-
sey-FitzGerald, 1958: 62, Pl. 17; Robertson ef al.,
1962: 428.
Bonn zoological Bulletin 68 (1): 61-91
Psammophis sibilans rukwae Broadley, 1966: 3. Type
locality: Kafukola, Rukwa valley, Tanzania. Holotype:
NMZB 4212.
Psammophis rukwae Cadle, 1994: 119; Brandstatter,
1995: 151; Spawls et al., 2002: 406.
Psammophis rukwae rukwae Broadley & Howell, 1991:
28.
Description. (127 specimens examined) Nostril pierced
between 2 nasals; preocular 1 (very rarely 2), in short
contact with or separated from frontal; postoculars 2:
temporals basically 2+2+3, but with frequent fusions;
supralabials 8 (very rarely 9), the 4" & 5" (very rarely
5 & 6") entering orbit; infralabials usually 11 (rarely 10
or 12), the first 5 (very rarely 4) in contact with anteri-
or sublinguals; dorsal scales in 17-17-13 rows; ventrals
160-184 (Rukwa type series 165-177; populations East
of 25°E 160-184; Chad 169-177; up to 192 for Soma-
lia, but probably a cryptic species); cloacal divided; sub-
caudals 71-102 (Rukwa type series 83-96; populations
East of 25°E 71-100, Chad 84—102 (n=30). Brandstatter
(1995, figs 63, 64) has published SEM micrographs of a
dorsal scale of the holotype NMZB 4212.
Top of head with a pale median stripe which forks and
then borders the frontal, but the head may become uni-
form yellow-brown in large adults; labials immaculate
or with large brown spots; dorsum dark or light brown,
rarely uniform, most specimens with at least a vertebral
chain, each scale in vertebral row paler at base. Some
specimens have ill-defined pale dorsolateral stripes on
scale rows 4 and 5, which fade out in some adults, but
many other specimens, including large adults, have both
well contrasted vertebral chain, with black pigment on
each side of the scales of the vertebral row, and well
contrasted pale dorsolateral stripes on scale rows 4 and
5 with black pigment on each side. Lower half of outer
scale row and ends of ventrals yellowish, separated or not
by a pair of brown or blackish ventral lines from a yellow
mid-ventral band.
Size. Largest specimen (TM 25301 — Kafukola, Ruk-
wa, Tanzania) 1,090 + 388 = 1,478 mm.
Remarks. According to Broadley (1966) P. rukwae was
a subspecies of P. sibilans distinguished by consistent
ventral pattern of a pair of black lateral hairlines similar
to that found in P. subtaeniatus. However our series of
specimens from Chad show that many specimens lack
black lateral hairlines.
Habitat. Flood plains and grasslands seem to be the
preferred habitats in eastern Africa. In Chad this species
is common in all types of savannas.
Distribution. East Africa from the Rukwa valley in
Tanzania, north through Kenya, Uganda, Ethiopia, South
Sudan and Sudan, then the western populations extend
from the Central African Republic and Chad west to
northern Cameroon.
©ZFMK
Psammophis sibilans group 67
Fig. 3. Psammophis rukwae. Lineated phase. Sequenced specimen IRD 2150.N. Baibokoum (Chad)
Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK
68 Jean-Frang¢ois Trape et al.
PSAMMOPHIS AFROCCIDENTALIS
Béhme & Mediannikoy, sp. nov.
urn: lsid:zoobank.org:act:E27CDF96-C9ED-48 20-B64F-93A4FD16CCE8
Trape,
West-African Whip Snake, Psammophis ouest-africain,
Westafrikanische Sandrennnatter
Psammophis sibilans (not Linnaeus) Boettger, 1881:
395; Boulenger, 1896: 161 (part); Boulenger, 1906:
214; Sternfeld, 1908a: 412; Chabanaud, 1918: 165;
Angel, 1933a: 69; 1933b: 162, fig. 61; Andersson,
1937: 8; Cansdale, 1949: 106; Hughes & Barry, 1969:
1023; Roman, 1980: 61; Chippaux, 2006: 175 (part);
Trape & Mané, 2000: 26; 2002: 149; 2004: 21; 2015:
45; Villiers & Condamin, 2005: 144; Auliya er al.,
2012: 280; Hughes, 1983: 353 (part); 2012: 123; 125
(ZFMK 29365 from Tamanrasset); Chirio, 2012: 83;
Trape & Baldé, 2014: 317.
Psammophis trinasalis (not Werner) Chabanaud, 1918:
166 (Senegal).
Psammophis sibilans sibilans (not Linnaeus) Loveridge,
1940: 30 (part); Leston 1950: 84; Villiers, 1950: 93;
1951: 827; 1952: 892; 1953: 1119; 1954: 1242; 1956a:
880; 1956b: 158; 1963: 1372; 1975: 138; Condamin,
1958: 255; Doucet, 1963: 306.
Psammophis phillipsii (not Hallowell) Bohme, 1978:
398, Fig. 16, 17 (right); 2000: 71.
Psammophis rukwae (not Broadley) Bohme, 1978: 401;
1987: 259; Brandstatter, 1995: 151 (part); Chirio,
2009: 30.
Psammophis cf. rukwae (not Broadley) Joger, 1981: 332;
1982: 332; Gruschwitz et al., 1991: 30.
Psammophis cf. phillipsii (not Hallowell) Schatti, 1986:
771; Bohme et al., 1996: 21; Rodel et al., 1995: 7;
1999: 170; Ullenbruch ef a/., 2010: 43.
Psammophis sudanensis (not Werner) Ullenbruch et al.,
2010: 44; Chirio, 2012: 83.
Psammophis aff. sibilans (not Linnaeus) Trape & Mané,
2017: 120.
Holotype. MNHN 2018.0013 (formerly IRD 7631.S, a
male from Dakar Hann, Senegal (14°43’N, 17°26’ W)
collected by J.-F. Trape on December 10th, 2005 (Figs.
13 & 14).
Diagnosis. Distinguishable from other species of the
P. sibilans group by the combination of the following
characters: 17 scale rows around midbody, 156—185 ven-
trals, 96-120 subcaudals (rarely less than 100), cloacal
divided, 5 infralabials in contact with anterior sublin-
guals (very rarely 4). Dorsum pale brown, dark brown
or greenish-brown, rarely uniform, usually a vertebral
chain with the scale of vertebral row paler at base, but
this chain often restricted to part of the dorsum, ill-de-
fined and occasionally totally absent; pale dorsolateral
stripes on the 4" row of dorsals, but often ill-defined or
absent; top of head with a pale median stripe on the snout
Bonn zoological Bulletin 68 (1): 61-91
which forks when reaching the frontal and then borders
the frontal, but often ill defined or absent in adults. Ge-
netically diagnosable through possession of unique mi-
tochondrial haplotypes. Psammophis afroccidentalis
sp. nov. can be distinguished from P. rukwae by a higher
number of subcaudals (P. rukwae 70-100, exceptionnaly
up to 105), from P. sibilans by major differences in mi-
tochondrial haplotypes, a pale median stripe that borders
the frontal (not bordering the frontal in P. sibilans) and
a more uniform dorsal colouration in most specimens,
from P. schokari and P. aegyptius by a lower number of
subralabials (8 versus 9) and a different head pattern, and
from P. sudanensis, P. phillipsi, P. occidentalis, P. mos-
sambicus, P. leopardinus, P. zambiensis and P. subtae-
niatus by a higher number of infralabials in contact with
the anterior sublinguals (5 versus 4) and by different head
and dorsal patterns.
Description of holotype. A male specimen, snout-
vent length 745 mm, tail length 345 mm, total length
1090 mm, ratio total length: tail length 3.16. Supralabi-
als 8/8 supralabials, 4° & 5 entering orbit (Fig. 15);
11/11 infralabials, first 5 contact anterior sublinguals; 1/1
preocular contacting frontal; 2/2 postoculars; 2/2 anterior
temporals (the lower one on right side divided); 2+3/2+3
posterior temporals. Scale rows 17 around hood, 17
around midbody, 13 one head length ahead of the vent,
all smooth and oblique. Dorsal scales smooth, oblique.
Vertebral row not enlarged. Ventrals 168 (Dowling: 167),
subcaudals 104, all divided, cloacal divided.
Top of head with a pale median stripe on the snout
which forks and then borders the frontal; labials pale
brown and yellowish. Dorsum uniform brown except pale
dorsolateral stripes on scale rows 4 and adjacent parts of
rows 3 and 5. No vertebral chain. Belly yellowish, limit
with dorsal colouration on the first row of dorsals; traces
of broken brown hairlines on part of the ventrals.
Etymology. The name is derived from the contraction
of Africa and occidentalis, the region of Africa where this
species 1s distributed.
Variation. (924 specimens examined) Nostril pierced
between 2 nasals; preocular 1, in contact with or sepa-
rated from frontal; postoculars 2; temporals basically
2+2+3 with occasional fusions or divisions, supralabials
8, the 4" & 5" entering orbit; infralabials usually 11 (rare-
ly 9 or 10), the first 5 (very rarely 4, 2% of specimens
only) in contact with anterior sublinguals; dorsal scales
in 17-17-13 rows; ventrals 156-165.9-180 in males; 160-
173.2-185 in females, cloacal divided; subcaudals 98-
108.0-121 in males, 96-106.2-120 in females.
Colouration variable (Figs 4, 5, 16, 17). Top of head
pale brown with a pale median stripe on the snout which
forks and then borders the frontal, but the head often
becomes uniform brown in adults; labials immaculate
or with brown spots; dorsum from light brown to dark
brown; a vertebral chain rarely absent but often ill-de-
fined, with most scale in vertebral row paler at base and
©ZFMK
Psammophis sibilans group 69
a" a\ v5
wa Sa A,
Fig. 5. Psammophis afroccidentalis sp. nov. Lineated phase. Dakar (Senegal).
Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK
70 Jean-Frang¢ois Trape et al.
rarely black edged; pale dorsolateral stripes on scale row
A either well contrasted, ill-defined or absent; belly light
yellowish, often immaculate but occasionally with hair-
lines.
Size. Largest intact specimen (IRD 3538.S — Matam,
Senegal) 1,145 + 460 = 1,505 mm, but largest SVL =
1,260 mm in two specimens with truncated tails (IRD
3345.8 — Jalalawy, Senegal, and IRD 3345.S — Matam,
Senegal).
Remarks. There are limited molecular differences be-
tween a mainly western group of specimens (Senegal,
Mauritania, Mali, Guinea, Ivory Coast and one of the two
specimens from Niger) and those from Burkina Faso, Be-
nin, Niger, and Mao in Chad. They are not correlated to
differences in colour patterns nor in meristic data.
Habitat. Sahel and Sudan savanna in West Africa.
Penetrates in Guinea savanna and relict populations in
sahelo-saharan wetlands.
Distribution. Mauritania (northernmost record: Tidra
island 19°44’N, 16°24’W), Senegal, Gambia, Guinea
Bissau, Guinea, Mali (northenmost record: Tinjemban
16°44°N, 02°50’W and along the Niger River), Ivory
Coast, Burkina Faso, Ghana, Togo, Benin, Niger (north-
ernmost record: Azzel 17°03’N, 08°03’E), Nigeria and
Chad (Mao). Possibly a relict population in southern Al-
geria (ZFMK 29365 from 200 km north of Tamanrasset,
a damaged specimen previously assigned to P. rukwae by
Bohme 1986 and to P. sibilans by Hughes 2012).
PSAMMOPHIS SUBTAENIATUS Peters, 1882
Western Stripe-bellied Sand Snake, Psammophis a ventre
ligné, Gelbbauch-Sandrennnatter
Psammophis sibilans var. subtaeniata Peters, 1882: 121
(part). Type locality: Tete, Mozambique. Lectotype:
ZMB 9992A designated by Broadley, 1977: 13.
Psammophis bocagii Boulenger, 1895: 538. Type local-
ity: “Angola”, subsequently given as Benguela (Bou-
lenger 1896). Lectotype: BMNH 67.7.23.22.
Psammophis subtaeniatus Broadley, 2002: 93.
One specimen examined by DGB from north of Latitude
12° S, MBL 1772 from Rio Bengo near Luanda in Ango-
la (8°43’S, 13°24’E), one of the syntypes of P. bocagii
destroyed by fire in the Museu Bocage. Full data for this
taxon have been published in Broadley (2002).
PSAMMOPHIS ORIENTALIS Broadley, 1977
Eastern Stripe-bellied Sand Snake, Psammophis oriental,
Ostliche Sandrennnatter
Psammophis subtaeniatus orientalis Broadley, 1977, Ar-
noldia Rhod. 8, No, 12: 17. Type locality: Morogoro,
Bonn zoological Bulletin 68 (1): 61-91
Tanzania. Holotype: MCZ 146965; Broadley & How-
ell, 1991: 27; Brandstatter, 1995: 194 (part).
Psammophis orientalis Broadley, 2002: 94; Spawls et al.,
2002: 405.
Description. (147 specimens examined) Nostril pierced
between 2 nasals; preocular 1 (very rarely 2), in short
contact with or separated from frontal; postoculars 2:
temporals basically 2+2+3, but with frequent fusions;
supralabials 8 (very rarely 7 or 9), the 4" & 5" (rarely
3 & 4th qth 5 & 6" or 5" & 6th) entering orbit; infral-
abials usually 10 (rarely 9 or 11), the first 4 (very rarely
3 or 5) in contact with anterior sublinguals; dorsal scales
in 17-17-13 rows; ventrals 148-170; cloacal divided:
subcaudals 95-117. Brandstatter (1995, figs 74-75) has
published SEM micrographs of a dorsal scale of NMZB
23336 from Mutare, Zimbabwe.
Dorsum dark brown, top of head uniform; each scale
in vertebral row paler at base, an ill-defined pale dorso-
lateral stripe on scale row 4 and 5; a dark stripe across
rostral, anterior nasal and upper portions of supralabi-
als 1-4; labials white speckled with black; lower half of
outer scale row and ends of ventrals white, separated by
a pair of well defined black ventral lines from a yellow
mid-ventral band.
Size. Largest male (NMZB 11267 — Mafia Island, Tan-
zania) 790 + 395 = 1,185 mm: largest female (USNM
72471 — Dodoma, Tanzania) 730 = 350 = 1,080 mm.
Remarks. This form was originally assigned to P. sub-
taeniatus sudanensis (Loveridge, 1940; Broadley, 1966),
but was later described from Morogoro, Tanzania, where
it is sympatric with P. sudanensis.
Habitat. Dry savannas on the east coast from Kenya
south to about Latitude 23°S in Mozambique, sometimes
sympatric with P. subtaeniatus in southeastern Zimba-
bwe.
Distribution. East Africa from coastal Kenya, south
through Tanzania, Malawi, eastern Zimbabwe and Mo-
zambique to the Bazaruto archipelago and adjacent main-
land.
PSAMMOPHIS SUDANENSIS Werner, 1919
Northern Stripe-bellied Sand Snake, Psammophis sou-
danien, Sudanesische Sandrennnatter
Psammophis subtaeniatus (not Peters) Boulenger, 1896:
161 (part); Tornier, 1896: 82 (part, Arusha); Corkill,
1935: 22: Loveridge, 1936a: 38, 193; Uthmoller, 1937:
119; Pitman 1938: 155, Pl. K, fig. 2; Bohme, 1975: 39
(Makolo); Hedges 1983: 30, fig. 39; Chippaux, 1999:
166; 2006: 179.
Psammophis sibilans (not Linnaeus) Hedges 1983: 30,
fig. 29.
©ZFMK
Psammophis sibilans group 71
Psammophis subtaeniatus var. sudanensis Werner, 1919:
504. Type locality: Kadugli, Sudan. Lectotype NMW
19086.
Psammophis sibilans sibilans (not Linnaeus) Bogert,
1940: 79 (part); 1942: 3 (Voi); Villiers 1951: 827 (part),
Fig. 3; Broadley & Howell, 1991: 28.
Psammophis subtaeniatus sudanensis Loveridge, 1940:
50 (part); 1956: 49 (part); 1957: 280 (part); Mertens,
1955: 59; Broadley, 1966: 5 (part); Spawls, 1978: 8
(part).
Psammophis cf. rukwae (not Broadley) Bohme, 1978:
A402, fig. 17 (left); Joger, 1982: 332, fig. 8.
Psammophis leucogaster Spawls, 1983: 11. Type locali-
ty: Wa, Ghana. Holotype BMNH 1980.261.
Psammophis rukwae (not Broadley) Bohme, 1986: 172
(part); Bohme & Schneider, 1987: 259.
Psammophis subtaeniatus subsp. Bohme, 1987: 85 (Dar-
fur).
Psammophis_ subtaeniatus orientalis (not Broadley)
Brandstatter, 1995: 194 (part).
Psammophis sudanensis Hughes 1999: 67; Spawls, et
al., 2002: 407; Trape & Mané, 2002 : 149, 2015 : 45;
Trape, 2005: 142; Villiers & Condamin, 2005: 144;
Trape & Baldé, 2014: 323.
Psammophis sudanensis leucogaster Trape & Mané,
2006: 156.
Description. (114 specimens examined) Nostril pierced
between 2 nasals; preocular 1, in short contact with or
separated from frontal; postoculars 2 (very rarely 1 or 3);
temporals basically 2+2+3, but with frequent fusions; su-
pralabials 8 (very rarely 7 or 9), the 4" & 5" (rarely 3% &
Am or 4%, 5" & 6") entering orbit; infralabials usually 10
(rarely 9 or 11), the first 4 (very rarely 3 or 5) in contact
with anterior sublinguals; dorsal scales in 17-17-13 rows;
ventrals 150—180; cloacal divided (entire in type of /eu-
cogaster); subcaudals 93-122. Dorsum dark brown, top
of head with a black-bordered pale median stripe extend-
ing far back on the frontal before forking (Fig. 18), trans-
verse pale markings on back of head; labials immaculate
white or speckled with black; vertebral stripe ill-defined
in the east, strongly marked in the west, broadening on
the nape; pale dorsolateral stripes on scale rows 4 and 5;
lower half of outer scale row and ends of ventrals whit-
ish, often separated by a pair of well defined black ven-
tral lines (occasionally ill-defined or absent in West and
Central Africa) from a yellow mid-ventral band.
Size. Largest male (MCZ 53449 — Torit, South Sudan)
820 + 390 = 1210 mm; largest female (FMNH 58389 —
Torit, South Sudan) 920 + 405 = 1325 mm.
Remarks. The type of P. /eucogaster from Ghana ap-
pears to be a highly aberrant specimen of P. sudanensis.
Populations from Chad are probably similar genetically
to those in Kordofan, the type locality, which is close
geographically and ecologically. The sequences of P. su-
danensis from Tanzania and Kenya of Kelly et al. (2008)
Bonn zoological Bulletin 68 (1): 61-91
belong to a distinct clade, suggesting that they may be-
long to a cryptic species. However, the pattern of a Ken-
yan specimen illustrated by Spawls et a/. (2002) is simi-
lar to those of our specimens from West Africa and Chad
(Fig 19). Some rare specimens from Chad are uniformly
beige dorsally (e.g. IRD 2871.N and 2884.N).
Habitat. In eastern Africa, coastal thicket, moist
and dry savanna and high grassland, from sea level to
2,700 m (Spawls et al. 2002). In Chad it was the most
common colubrid snake that JFT collected in almost all
moist and dry savanna areas of the country (17% of 1,010
colubrids collected between 7°N and 14°N). In West Af-
rica, it is a very rare species: only three specimens out
of 9,000 snakes in Senegal, all in the Sahel north of
14°N (Trape & Mané unpublished), one specimen out
of 1,714 in Niger (Trape & Mané 2015), none out of
4,906 in Guinea (Trape & Baldé 2014), and none out of
5,224 in Mali (Trape & Mané 2017). A single specimen
of P. sudanensis was present in Roman’s collection of
5,000 snakes from Burkina Faso (Trape 2005). Psammo-
phis sudanensis reports from Sangaredi area (Guinea) by
Chirio (2012) and from southern Benin by Ullenbruch et
al. (2010, see Figs 16 & 17 p. 44) are in fact attributable
to specimens belonging to the lineated phase of P. afroc-
cidentalis sp. nov.
Distribution. East Africa from southern Sudan, south
through eastern Uganda and Kenya to northern Tanzania,
west through the Central African Republic, Cameroon,
Nigeria, Niger, Burkina Faso, Ghana, Senegal. Sympatric
with P. orientalis at Morogoro in Tanzania, with P. ruk-
wae in Chad and Cameroon, and with P. afroccidentalis
sp. nov. in West Africa.
PSAMMOPHIS PHILLIPS (Hallowell, 1844)
Phillips’ Whip Snake, Psammophis de Phillips, Phil-
lips-Sandrennnatter
Coluber Phillipsii Hallowell, 1844, Proc. Acad. Nat. Sci.
Phil.: 169. Type locality: Liberia. Lectotype: ANSP
5112, designated by Broadley 1977: 24.
Psammophis Phillipsii Hallowell, 1854: 100 & 1887: 69.
Psammophis irregularis Fischer, 1856: 92. Type locality:
Peki, Ghana; Giinther, 1858: 137. Holotype apparent-
ly lost according to Hughes & Wade 2004. Dumeéril,
1860: 208, Pl. xvui, fig. 9; Jan & Sordelli, 1870: livr.
34, Pl. iv, fig. 1-2; Matschie, 1893: 212.
Psammophis sibilans (not Linnaeus) Werner, 1902: 338
(Togo); Klaptocz, 1913: 286; Aylmer, 1922: 21; Barbo-
ur & Loveridge, 1930a: 773 (Liberia); Monard, 1940:
Lee
Psammophis notosticta (not Peters) Matschie, 1893: 212
(Togo).
Psammophis regularis Sternfeld, 1908a: 412, 428 (Togo);
1909b: 20 (Togo); Chabanaud, 1916: 377; 1917: 12
(Benin).
©ZFMK
Fe. Jean-Frang¢ois Trape et al.
Psammophis_ sibilans phillipsi Loveridge, 1938: 59;
1940: 41 (part); 1946: 246; Leston, 1950: 84; Vil-
liers, 1950: 98; 1954: 1242; Angel et al., 1954: 396;
Condamin, 1958: 255; 1959: 1359; Taylor & Weyer,
1958: 1217; Doucet, 1963: 307; Menzies, 1966: 175;
Roux-Esteve, 1969: 121; Balletto et a/., 1973: 101;
Villiers, 1975: 140.
Psammophis sibilans sibilans (not Linnaeus) Loveridge,
1940: 30 (part); Villiers, 1956: 158; 1966: 1765; Dou-
cet, 1963: 306 (part).
Psammophis sibilans var. phillipsi Cansdale, 1949: 106
(Ghana).
Psammophis phillipsi Leston & Hughes, 1968: 754;
Hughes & Barry, 1969: 1023; Bohme, 1978: 398
(part); Joger, 1981: 331, fig. 16; Hughes, 1983: 346,
353 (part); Roman, 1984: 23; Butler & Reid, 1990: 32
(part); Gruschwitz et al., 1991: 30 (Gambia); Cadle,
1994: 119; Brandstatter, 1995: 75 (part); Bohme, 2000:
71; Ineich, 2003: 619; Luiselli et al., 2004: 415 (part);
Villiers & Condamin, 2005: 144; Trape & Mané, 2006:
150; Chippaux, 2006: 178 (part); Ullenbruch ef al.,
2010: 43; Hughes, 2012: 123; Trape & Baldé, 2014:
316 ; Trape & Mané, 2017: 120.
Psammophis cf. phillipsii Rodel et al., 1995: 7; 1999:
170.
Description. (180 specimens examined) Nostril pierced
between 2 (rarely 3) nasals; preocular 1, usually widely
separated from frontal; postoculars 2; temporals usual-
ly2+2 or 2+3; supralabials 8 (very rarely 7), the 4° & 5"
entering orbit; infralabials usually 10 (rarely 9 or 11), the
first 4 (very rarely 5) in contact with anterior sublinguals;
dorsal scales in 17-17-13 rows; ventrals 161—183; cloacal
usually entire (9% divided); subcaudals 89-115. Brand-
statter (1995: Fig. 56—57) illustrated photomicrographs
of a mid-dorsal scale of SMF 20067 from Ghana.
Dorsum olive brown, uniform in most specimens
(Fig. 20), rarely with black-edged mid-dorsal scales
forming black lines (Fig. 21), or with irregularly scat-
tered black scales on the body anteriorly (Fig. 6). Top of
head usually uniform, but reticulations may be present,
including a double pale line on the frontal (Fig. 6). Each
labial and sublingual is usually adorned with a dark spot.
Venter yellow or white, uniform or with lateral rows of
black spots or short streaks or irregular black speckling.
Size. Largest specimen (MCZ 53726 — Achimota, Gha-
na) 1,280 + 533 = 1,813 mm,
Remarks. Brandstatter (1995) and Hughes (1999) first
restricted the name P. phillipsi to the uniform olive form
with an entire cloacal shield in West Africa, where it oc-
cupies forest clearings and moist savanna. Our molecular
data also support this view for the occasional West Af-
%, :
oo a o y
?
ee
3
on
. -
> b
f
ow
7 *
- ”~
» 4 Agito =
1 ae
Fig. 6. Psammophis phillipsi “irregularis”. Sequenced specimen IRD 44.T. Vicinity of Kpalimé (Togo).
Bonn zoological Bulletin 68 (1): 61-91
©ZFMK
Psammophis sibilans group 73
rican specimens with a divided cloacal shield and black
dorsal blotches (P. irregularis Fisher).
Habitat. Moist savannas and deforested rainforest ar-
eas of West Africa from coastal Gambia to Nigeria.
Distribution. Gambia, Senegal, Guinea Bissau, Guin-
ea, Sierra Leone, Liberia, southern Mali, Ivory Coast,
Ghana, Togo, Benin, Nigeria.
PSAMMOPHIS MOSSAMBICUS (Peters, 1882)
Olive Whip Snake, Psammophis olivatre, Olivenfarbige
Sandrennnatter
Psammophis sibilans (not Linnaeus) Mocquard, 1887:
78 (Brazzaville); Bocage, 1895: 114 (part, var. C);
Tornier, 1896: 82; Boulenger, 1905: 113; 1906: 214
(part, Fernand Vaz); Sternfeld, 1911: 250; Boulenger,
1915a: 213; 1915b: 631; Loveridge, 1916: 85; 1918:
328; Sternfeld, 1917: 478; Schmidt, 1923: 111; Love-
ridge, 1923: 886; Loveridge, 1928: 39; 1933: 255;
Witte, 1933a: 123; 1933b: 93; Corkill, 1935: 20 (part);
Loveridge, 1936a: 38; 1936b: 262; Uthmoller, 1937:
119; Mertens, 1955: 59; Laurent, 1960: 55; Trape &
Roux-Esteéve, 1995: 41.
Psammophis sibilans var. mossambica Peters, 1882, Rei-
se nach Mossambique...3: 122. Type locality: Mozam-
bique Island. Lectotype: ZMB 2468A.
Psammophis sibilans var. tettensis Peters, 1882, Reise
nach Mossambique...3: 122. Type locality: Tete, Mo-
zambique.
Psammophis sibilans var. intermedius Fischer, 1884: 14
(Arusha, Tanzania).
Psammophis irregularis (not Fischer) Sauvage, 1884:
201.
Psammophis sibilans var. occidentalis Werner, 1919:
504. Type locality: Congo. Holotype NMW 19245:2.
Psammophis notostictus (not Peters) Witte, 1933a: 123;
1933b: 93.
Psammophis brevirostris (not Peters) Witte, 1933a: 123;
1933b: 93.
Psammophis_ sibilans phillipsii Loveridge, 1940: 41
(part); Witte 1962: 117 (part); Perret 1961: 136; Bohme
1975: 40; Stucki-Stirn, 1979: 434.
Psammophis subtaeniatus (not Peters) Witte, 1941: 212
(part, Bitshumbi, P.N. Virunga); Joger, 1990: 97, Fig. 6
(Bangui, CAR).
Psammophis sibilans sibilans (not Linnaeus) Bogert,
1940: 79 (part); Loveridge, 1940: 30 (part); 1942a:
110; 1942b: 8; 1956: 48 (part); Witte, 1941: 213; 1955:
220219622 1173197582; Laurent, 1950: 8; 1954-59:
1956: 249, Pl. xxiv, fig. 1; 1964: 113; Monard, 1951:
164; Villiers, 1966: 1765; Vesey-FitzGerald, 1958:
60; Robertson ef al., 1962: 428; Bourgeois, 1964: 81;
Roux-Esteve, 1965: 72; Thys van den Audenaerde,
1965: 381 (Kinshasa); Broadley, 1971: 88 (Zambia);
Bonn zoological Bulletin 68 (1): 61-91
Pitman, 1974: 156; Stucki-Stirn, 1979: 430; Pakenham,
1983: 26; Spawls, 1978: 8; Rasmussen, 1991: 177.
Psammophis subtaeniatus sudanensis (not Werner) Lau-
rent, 1956: 248, PI. xxiv, fig. 2 (part, Bitshumb1); Per-
ret, 1961: 136; Witte, 1962: 117; 1975: 88.
Psammophis_ phillipsi Joger, 1982: 331, 1990: 97;
Hughes, 1983: 346, 353 (part); Butler & Reid, 1990:
32 (part); Broadley, 1991: 530; Broadley & Howell,
1991: 28; Rasmussen, 1991: 177; Brandstatter, 1995:
75 (part), 1996: 55 (part); Trape & Roux-Esteve, 1995:
41; Chippaux, 1999: 164 (part); Luiselli et al/., 2004:
A15 (part); Chirio & Ineich, 2006: 52: Jackson et al.,
2007:77.
Psammophis mossambicus Branch, 1998: 92; Haagner et
al., 2000: 15; Hughes & Wade, 2002: 77; Spawls et
al., 2002: 405; Broadley et al., 2003: 167, Pl. 110-1;
Marais, 2004: 153; Bates et al., 2014: 377.
Psammophis phillipsi occidentalis Hughes & Wade,
2004: 129, Fig. 1.
Psammophis occidentalis Chirio & LeBreton, 2007: 532;
Wallach et al., 2014: 589.
Psammophis sp. Chirio & LeBreton, 2007: 538.
Psammophis cf. phillipsi Pauwels & Vande weghe, 2008:
220:
Description. (431 specimens examined) Nostril pierced
between 2 (rarely 3) nasals; preocular 1, usually wide-
ly separated from frontal; postoculars 2 (rarely 1 or 3);
temporals usually2+2/3 but fusions or partial fusions fre-
quent; supralabials 8 (very rarely 6, 7 or 9), the fouth and
fifth & (rarely third & fourth or fifth and sixth) entering
orbit; infralabials usually 10 (rarely 9 or 11), the first 4
(rarely 5, e.g. sequenced specimen IRD 2226.N) in con-
tact with anterior sublinguals; dorsal scales in 17-17-13
rows; ventrals 154-188; cloacal divided (rarely entire);
subcaudals 84—122.
Dorsum brown or greenish brown often uniform
(Fig. 22), sometimes yellowish posteriorly, sometimes
with scattered black scales (rarely more black scales
than olive ones). Other specimens have black-edged
dorsal scales, a vertebral chain and a yellow or whitish
dorsolateral stripe on scale rows 4 and 5 (Fig. 23), this
pattern almost constant in specimens from coastal areas
of Gabon, Republic of the Congo and Democratic Re-
public of the Congo. Top of head uniform or reticulated,
which fades out in adults. Supralabials uniform or speck-
led with black. Venter yellow or whitish, uniform or with
lateral rows of black spots or short streaks or irregular
black speckling, sometimes delimiting a mid-ventral
band of grey ofuscation. A specimen from coastal Ga-
bon with a contrasted head and body pattern is illustrated
in Pauwels & Vande weghe (2008, Figs 333-334), and a
specimen from Kenya with uniform dorsum is illustrated
in Spawls et al. (2002: 405). Roux-Esteve (1965) pro-
vided a detailed description of the two types of patterns
of the populations of southern Central African Republic.
©ZFMK
74 Jean-Frang¢ois Trape et al.
e
s
<s
Fe, eS
Fig. 8. Psammophis mossambicus. Typical specimen from Pointe Noire area (Republic of Congo) with a head reticulated pattern,
a vertebral chain and a pale dorso-lateral stripe (MNHN 1988.2316).
Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK
Psammophis sibilans group 75
De Witte (1966) provided scale counts of specimens of
Garamba National Park in northern Democratic Republic
of the Congo.
Size. Largest specimens for the species, including south
of 12°S: NMK 3233/1 — Kassa B, Sennar, Sudan, 1,320 +
460 = 1,780 mm; IRD 2226.N — Baibokoum, Chad, 1,227
+ 508 = 1,735 mm; IRD 2136.N — Baibokoum, Chad,
1,235 + 515 = 1,750 mm; NMZB 16031 — Ndau School,
Western Province, Zambia, 1,260 + 500 = 1,760 mm.
Remarks. (Broadley, 1977, 1983) first applied the
name P. phillipsi to populations in eastern Africa, but
Brandstatter (1995) and Hughes (1999) restricted the
name to the uniform olive form with an entire cloacal
shield in West Africa, and our molecular data support this
view. Branch (1998) first used the name P. mossambicus
Peters for the southern African populations after Broad-
ley selected a lectotype in Berlin. Hughes & Wade (2004)
used the name P. occidentalis for populations from Cam-
eroon to Uganda with a divided cloacal, but our data
show little molecular divergence between southern A fri-
can populations and those from north of the Congo forest
block, despite a great variety of colour patterns in both
regions. Another available name for this species was
P. irregularis Fischer, 1856, based on a specimen from
Peki in former German Togo with a divided cloacal and
extensive black dorsal patches on the anterior third of
the body, decreasing posteriorly, but our molecular study
show that such specimens from Togo are molecularly
identical to typical P phillipsi from West Africa. Data
for specimens south of 12°S were published by Broadley
(2002). Further molecular studies are needed to investi-
gate if additional species of this complex occur around
the Congo forest block (e.g. sequencing specimens with
a grey mid-ventral band from Central African Republic
and other areas), and to clarify the situation in Nigeria
where both P. phillipsi and P. mossambicus occur, possi-
bly in sympatry.
Habitat. Moist savannas and grasslands, especially ri-
parian habitats, swamps, reed beds and cultivated areas
from sea level to 1,500 metres.
Distribution. Southeastern Nigeria, Cameroon, south-
ern Chad, Central African Republic, Sudan, South Su-
dan, Gabon, Republic of Congo, Democratic Republic
of Congo, Rwanda, Burundi, Uganda, Kenya, Tanzania,
Angola, Zambia, Mozambique, Malawi, northeastern
Namibia, northern Botswana, Zimbabwe and the North-
ern, Mpumalanga and KwaZulu-Natal provinces of
South Africa.
PSAMMOPHTS LEOPARDINUS Bocage, 1887
Leopard Whip Snake, Psammophis Iéopard, Leop-
arden-Sandrennnatter
Bonn zoological Bulletin 68 (1): 61-91
Psammophis sibilans var. leopardinus Bocage, 1887:
206. Type locality: Catumbela, Angola. Lectotype
MBL 1798, destroyed by fire in the Museu Bocage.
Psammophis sibilans var. C (part) & D Bocage, 1895:
117; Ferreira 1905: 116.
Psammophis sibilans leopardinus Broadley, 1977: 18, PI.
ii; 1983: 143
Psammophis brevirostris leopardinus Brandstatter, 1995:
oo:
Psammophis leopardinus Broadley, 2002: 95.
Description. Two specimens examined by DGB from
the Angolan coast north of Latitude 12° S: USNM 20132
from Luanda and TM 45751 from Quicama National
Park. Nostril pierced between 2 or 3 nasals; preocular 1,
widely separated from frontal; postoculars 2; temporals
usually 2 + 3; supralabials 8, 4 & 5" entering orbit; in-
fralabials 10, the first 4 in contact with anterior sublin-
guals; dorsal scales in 17-17-13 rows; ventrals 163-167;
cloacal divided; subcaudals 104—106.
Both specimens have P. /eopardinus head markings,
but the dorsum is uniform except for a yellow dotted ver-
tebral line in USNM 20132 and pale dorsolateral stripes
on scale row 4 in TM 45751.
Ferreira (1905) recorded three specimens from north-
ern Angola (Cazengo; Chingo) and Cabinda, which were
presumably destroyed by fire in the Museu Bocage.
Further data on this taxon were published by Broadley
(2002) and Hughes & Wade (2002).
PSAMMOPHIS ZAMBIENSTS Hughes & Wade, 2002
Zambian Whip Snake, Psammophis zambien, Sambische
Sandrennnatter
Psammophis sibilans (not Linnaeus) Pitman, 1934: 297
(part, “‘Chimikombe’ specimens only).
Dromophis lineatus (not Dumeril & Bibron) Laurent,
1956: 247 (Kundelungu, DRC).
Psammophis ? sibilans Broadley & Pitman, 1960: 445.
Psammophis_ brevirostris leopardinus (not Bocage)
Broadley, 1971: 88; Brandstatter, 1955: 53, Pl. 39 &
1966: 48 (Zambia only); Haagner et al., 2000: 16.
Psammophis zambiensis Hughes & Wade, 2002: 75.
Type locality: “Abercorn”, probably = Mweru-Wanti-
pa, Zambia. Holotype: BM 1959.1.1.81; Broadley er
al., 2003: 170.
Description. (23 specimens examined) Nostril pierced
between 2 nasals; preocular 1, separated from frontal:
postoculars 2; temporals usually 2+2/3; supralabials 8
(rarely 7 or 9), the 4" & 5" (rarely 3% & 4") entering
orbit; infralabials 9 or 10, the first 4 in contact with ante-
rior sublinguals; dorsal scales in 17-17-13 rows; ventrals
147-161; cloacal divided (entire in NMZB 16601); sub-
caudals 72-83. Brandstatter (1995, fig. 39) has published
©ZFMK
76 Jean-Frang¢ois Trape et al.
Fig. 9. Psammophis sibilans. Dorsal view of the head of BM 1897.10.28.603 from Abasstyeh near Cairo, Egypt (A), MNHN
2001.0601 from Ain Ghossair near Ismailia, Egypt (B), and AUZC.R02262 from Qalubiya near Cairo, Egypt (C). Note the black
edged yellow median line starting from the snout which is not forking then bordering the frontal as observed in Psammophis afroc-
cidentalis sp. nov. and P. rukwae.
eS Pg le
-) oe a w
J ad
: .
Fig. 10. Psammophis sibilans. Plain phase. Specimen from Fatyum (Egypt).
Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK
Psammophis sibilans group 77
Fig. 11. Psammophis sibilans. Lineated phase. Specimen from Ain Ghossair near Ismailia, Egypt (MNHN 2001.0601).
a SEM micrograph of a dorsal scale of NMZB 10636
from Ikelenge, Zambia.
Dorsum greenish-brown, top of head with complex
pale markings; labials yellowish speckled with black; a
pale double chain marking covers the dorsal nine scale
rows anteriorly, dorsal scales heavily edged in black
(more extensive in juveniles and subadults), a pale dor-
solateral stripe on scale row 4 and 5 continues caudad;
lower half of outer scale row and ventrals greenish, free
edges of ventral irregularly bordered with black (more
extensive in subadults). Two specimens from Sake-
ji School (Haagner et a/. 2000), and all those from the
Muchinga escarpment and Malawi, lack the distinctive
dorsal and ventral markings, but are still distinguishable
from sympatric / parapatric P- mossambicus by their low
ventral and subcaudal counts.
Size. Largest male (PEM 6237 — Sakeyi School, Zam-
bia) 770 + 275 = 1,045 mm; largest female (PEM 6224 —
Sakeyi School, Zambia) 740 + 180+ mm (tail truncated).
Remarks. This taxon was originally assigned to
P. leopardinus, which it resembles in dorsal colour pat-
tern, but it differs in tts much lower mandibular tooth
counts and also lower ventral and subcaudal counts. In
addition there seems to be no connection across eastern
Angola and the two forms occupy very different habitats.
The sequences of “P. occidentalis” from Zambia and Bu-
rundi in Kelly et al. (2008) and Fig. 1 may correspond to
this species. See Hughes & Wade (2002) for further data.
Bonn zoological Bulletin 68 (1): 61-91
Habitat. Apparently inhabiting swampy areas in moist
miombo woodland in Zambia and Katanga or montane
grassland in Malawi.
Distribution. Northern Zambia and adjacent Katanga
Province of the DRC, extending into montane areas of
northern and central Malawi.
TENTATIVE KEY TO THE SPECIES OF
PSAMMOPHITS NORTH OF LATITUDE 12°S
(excluding the cryptic species only known by their se-
quences)
la. Dorsal scales in 17 or 19 rows at midbody.............. 2
1b. Dorsal scales in less than 17 rows at midbody ...... 14
2a. Supralabials usually 8 (occasionally 9 for P. sibilans),
with fourth and fifth, or four, fifth and sixth entering
the orbit (occasionally fifth and sixth for P. sibilans).
Dorsaliscalesanwyitowsy: 0) eae o)
2b. Supralabials usually 9, with fifth and sixth, or four,
fifth and sixth entering the orbit. Dorsal scales in 17
TOW va CALC ys 1 teeta. ita Aen eae eee sane eeaht 10
3a. Temporals 1+2, rarely two anterior temporals.
Ventrals 138-167, subcaudals 73-107. Dorsum
brown or olive, uniform or with a fine yellow
vertebral line and a yellow dorsolateral stripe. Belly
yellowish, often with short transverse black marks at
(ne Outened Ges: san... a wen Psammophis lineatus
©ZFMK
78 Jean-Frang¢ois Trape et al.
rf a
a ee
J p-g
rae s\
| q
A
Al.
a
A.
Rp A
eh re
A P. afroccidentalis sp. nov.
PP. phillipsi
VP. mossambicus
RP. rukwae
S P. sibilans
S P. sudanensis
C] Type locality
Fig. 12. Geographic distribution of the sequenced specimens of
P. sibilans and other species frequently confounded with P. sib-
ilans. P. phillipsi, P. mossambicus, P. rukwae, P. sudanensis,
and P. afroccidentalis sp. nov. One symbol may correspond to
several specimens from neighbouring localities. Location of
type locality is approximate for P. sibilans (“Egypt”), P. phil-
lipsi (“Liberia”) and P. mossambicus (“insel Mossambique’”).
3b. Temporals basically 2+2, fusions and/or divisions
TRC QUCMION Secs hae ia hsemunnd Mera Rane earn 4
4a. Usually the first five infralabials in contact with the
AUG LIOL SU MS WANS sek tnt het ange ee aR OLEATE AS 5
4b. Usually the first four infralabials in contact with the
AMSHIOF SUBLNGUAIS:.. | ovis Hy rccetonndbdig Us yeh eee rtantern de 6
5a. Subcaudals 71-102, ventrals 160-184. Dorsum
brown, often with a black and white vertebral chain,
the black pigment either covering the edges or the
hindermost part of the scale. A pale dorsolateral
stripe absent or present. Top of head often with a
pale median stripe on the snout which forks when
reaching the frontal and then borders the frontal.
Sahel and Sudan savanna from Cameroon to Ethiopia
and Panzania 12 2) Be ree Psammophis rukwae
5b. Subcaudals 98-119, ventrals 154-178. Dorsum
uniform or strongly stripped with a black and white
vertebral chain, the black pigment covering the
edges of the scale, and a pale dorsolateral stripe. Top
of head often with a pale median stripe on the snout
which is interrupted before the frontal or forks only
after the middle of the frontal. Northeastern Africa
from Egypt and Sudan to Ethiopia............0000...00....
she helen btn Ah aii ahs Dede e hk Psammophis sibilans
Bonn zoological Bulletin 68 (1): 61-91
Fig. 13. Psammophis afroccidentalis sp. nov. General view of
the holotype MNHN 2018.0013 (formerly IRD 7631.S) from
Dakar, Senegal.
5c. Subcaudals 96-120, ventrals 156-185. Dorsum
brown with a black and white vertebral chain, the
black pigment covering the hindermost part of the
scale. A pale dorsolateral stripe absent or present.
Top of head often with a pale median stripe on the
snout which forks when reaching the frontal and
then borders the frontal. Sahel, Sudan and Guinean
Savalitias.OL West -AlmiCde(.....00 4 wil. voltae tents
6a. Cloaqual scale usually entire. Dorsum and top of
head usually uniform. If present, reticulations on the
top of the head may form a complex network, but
never with a pale median stripe on the snout which
forks and then borders the frontal. Moist savannas of
VCS EAM 1G 2 iets: st eee 2 28t ee osarat Psammophis phillipsi
GbaGloaqualscale Givi” Se stcen snk -pscct iy pan! dose le 7
7a. Ventrum yellowich usually with a pair of well-defined
|) TG) eo) Ee TetshPeen epee ie ot bestvolies Gel Pt Saale F, el aoe Oa 8
7b. Ventrum uniform or with ill-defined black lines or
CASHES: . 2 rerres| S ARs, ed teeta excl Aes trates bce retae 9
8a. Top of head with a yellow median stripe on the snout
and the frontal. A yellow vertebral line bordered by
two pairs of brown and one pair of yellow dorsolateral
stripes. Ventrals 148-180, subcaudals 90-129. Dry
savannas of West, Central and East Affrica................
Fee See NS Pe Ld Psammophis sudanensis
8b. No median stripe on the top of the head. Dorsum
brown uniform. Ventrals 148-170, subcaudals 95—
Li? Goastal areas Or, Rast AMiCar 5.2. cect eens
©ZFMK
Psammophis sibilans group 79
Fig. 14. Psammophis afroccidentalis sp. nov. Ventral view of the holotype MNHN 2018.0013 from Dakar, Senegal.
Fig. 15. Psammophis afroccidentalis sp. nov. Lateral (A), dor-
sal (B) and ventral (C) view of the head of the holotype MNHN
2018.0013 from Dakar, Senegal.
Bonn zoological Bulletin 68 (1): 61-91
9b.
Oe.
9a. Subcaudals 84-122, ventrals 154-188. Dorsum olive
to yellow-brown, uniform or with black-edged scales
forming narrow black longitudinal lines, or with
scattered black scales (rarely largely black), or witha
black and white vertebral line and a pale dorsolateral
stripe. Top of head uniform or with complex pale
markings. Ventrum yellow or whitish, uniform or
with rows of black lateral spots or irregular black
spekling, some specimens with a mid-ventral band
of grey obfuscation. Moist savannas and forest
clearings from southeastern Nigeria to eastern and
southern Africa............... Psammophis mossambicus
Subcaudals 75-90, ventrals 148-165. Dorsum
greenish-brown with scales often heavily edged in
black and the nine median rows with black and white
markings. Top of head reticulated. Free edges of
ventrals irregularly edged in black. Zambia, Malawi
and southern Democratic Republic of Congo...........
Psammophis zambiensis
Subcaudals 79-106, ventrals 151-167. Colour
pattern variable, a pale dorsal chain pattern usually
changes posteriorly to paired dorsolateral stripes.
Pale transverse and reticulated markings often
present on back of head. Chin and throat speckled
and sometimes bands of grey flecking on ventrum.
Angola and northern Namibia..........00....0ccccee
DBA snes pie (rms enn des: Psammophis leopardinus
©ZFMK
80 Jean-Frang¢ois Trape et al.
Fig. 16. Psammophis afroccidentalis sp. nov. General view of a specimen with a typical dorsal head pattern, ill-defined vertebral
chain and lacking pale dorsal stripes. Dielmo, Senegal.
10a. Subcaudals more than 140 ....00000... eee 11
10b. Subcaudales less than 135 ......000...ccceceeeeeee 12
Ila. Ventrals 170-198, subcaudals 143-178. Flanks and
belly heavily speckled with black. Semi-desert and
arid savannas from southeastern Egypt to Somalia
and northern Tanzania....... Psammophis punctulatus
11b. Ventrals 186-211, subcaudals 142-172. Flanks
not speckled with black, belly with a large median
grey band. Sahel and sudano-guinean savannas from
Senegal to Chad and Central African Republic.........
Ted ampere ite een re Psammophis elegans
12a. Usually three supralabials entering the orbit.
Ventrals 155-181, subcaudals 106-132. Angola and
southern Affica..........00.... Psammophis subtaeniatus
12b. Usually two supralabials entering the orbit. North
ATH Casands Salen’ Je le. ee dae eo fee on ad, A 13
BOGY Ie Joan el rene eon Cm Psammophis schokari
13b. Ventrals 183-203. Dorsal scales in 17 or 19 rows at
TG" DOG Vesa. ry, cr aaa wee Psammophis aegyptius
Bonn zoological Bulletin 68 (1): 61-91
14a. Dorsal scales in 11 rows at mid-body ...........0...0.0....
eer ae te ee eee rer Psammophis angolensis
14b. Dorsal scales in 13 rows at mid-body......................
seo a cane ie, Re oe Psammophis pulcher
14c. Dorsal scales in 15 rows at mid-body .................. 15
15a. Two upper labials, usually fourth and fifth, entering
orbit. Ventrals 161-191, subcaudals 107-133. Top
of head with transverse black bars. West and Central
PMI Cates Arne a AER ow Psammophis praeornatus
15b. Two upper labials, usually fifth and sixth, entering
orbit. Ventrals 138-156, subcaudals 102-134. Top of
head more or less uniform. East Affica........0....00.
olay fey Ae eh A ar ee os oli Psammophis biseriatus
15c. Three upper labials, usually the fourth, fifth and
sixth, entering orbit. Ventrals 142-169, subcaudals
81—123. Top of head with dark bordered tan blotches
and a light longitudinal stripe along the junctions of
infranasals and prefrontals. East Affica ..........000..00..
feces eae Psammophis tanganicus
©ZFMK
Psammophis sibilans group 81
. ne ay is om
-_ oS
’ . =
Pe
Fig. 17. Psammophis afroccidentalis sp. nov. Juvenile specimen with a vertebral chain and pale dorso-lateral stripes. Dakar, Sen-
egal.
Fig. 18. Psammophis sudanensis. Jos (Nigeria). Specimen with a typical head and dorsal pattern.
Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK
Jean-Francois Trape et al.
Fig. 19. Psammophis sudanensis. Bitea (Chad). Specimen with a typical head and dorsal pattern.
Fig. 20. Psammophis phillipsi. Mt Nimba (Guinea).
Bonn zoological Bulletin 68 (1): 61-91
Psammophis sibilans group 83
Fig. 21. Psammophis phillipsi. Sequenced specimen IRD 5002.G. Kindia (Guinea).
Fig. 22. Psammophis mossambicus. Sequenced specimen IRD 2238.N. Baibokoum (Chad).
Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK
84 Jean-Frang¢ois Trape et al.
Fig. 23. Psammophis mossambicus. Sequenced specimen LC.4366. Gamba (Gabon).
Acknowledgments. Part of this work was based on an unpub-
lished 2005 preliminary manuscript by D. G. Broadley, C. Kel-
ly, B. Lanza and J.-F. Trape which included only morphological
data, most of them from the databases of DGB and JFT, and
further data communicated to DGB by B. Hughes and B. Lan-
za. This manuscript has never been published due to numer-
ous remaining issues that were only resolved recently, at least
in part, when molecular data become available for specimens
from Egypt, and central, eastern and western Africa. Christo-
pher Kelly published separately his molecular study of eastern
and southern African specimens (Kelly et a/. 2008). Donald
G. Broadley and B. Lanza unfortunately deceased before the
achievement of this work, and we aknowledge here their enor-
mous contribution both to this study and African herpetology.
We thank L. Chirio for providing samples of P. mossambicus
from Gabon, A.-G. Zassi-Boulou for helping collecting sam-
ples of P. mossambicus in the Republic of Congo, P. Geniez
for useful discussions on the Psammophis species of northern
Africa, and P. Wagner and B. Hughes for helpful remarks on a
preliminary manuscript.
REFERENCES
Anderson J (1898) Zoology of Egypt. 1. Reptilia and Batrachia.
London, Bernard Quaritch
Andersson LG (1937) Reptiles and Batrachians collected in the
Gambia by Gustav Svensson and Birger Rudebeck (Swedish
Expedition 1931). Arkiv for Zoologi, A29, 16: 1-28
Angel F (1933a) Sur quelques reptiles et batraciens du nord
du Soudan frangais. Bulletin du Muséum national d’ Histoire
naturelle, Paris, série 2, 5: 68-69
Angel F (1933b) Les serpents de |l’Afrique Occidentale
Francaise. Paris, Larose
Bonn zoological Bulletin 68 (1): 61-91
Angel F, Guibe J, Lamotte M, Roy R. (1954) La réserve na-
turelle intégrale du Mont Nimba. Serpents. Mémoires de
l'Institut frangais d’ Afrique noire 2: 381-402
Arévalo E, Davis SK, Sites Jr JW (1994) Mitochondrial DNA
sequence divergence and phylogenetic relationships among
eight chromosome races of the Sceloporus grammicus com-
plex (Phrynosomatidae) in Central Mexico. Systematic Biol-
ogy 43: 387-418
Auliya M, Wagner P, BOhme W (2012) The herpetofauna of
the Biyagos Archipelago, Guinea-Bissau (West Africa) and
a first country-wide checklist. Bonn Zoological Bulletin 61:
255-281
Aylmer C (1922) The snakes of Sierra Leone. Sierra Leone
Studies 5: 7-37
Baha El Din SM (2006) A guide to the reptiles and amphibians
of Egypt. American University in Cairo Press, Cairo & New
York
Balletto E, Bardelli G, Spano S (1973) Contributo all’ erpetolo-
gia della Costa d’Avorio. Bolletino dei Musei e degli Istituti
Biologici dell’ Universita di Genova 41: 85-104
Barbour T, Loveridge A (1930a) Reptiles and amphibians from
Liberia. In: Strong, R. Report of the Harvard-African Expe-
dition upon the African Republic of Liberia and the Belgian
Congo. 2: 769-786
Barbour T, Loveridge A (1930b) Reptiles and amphibians from
the central African lake region. In: Strong, R. Report of the
Harvard-African Expedition upon the African Republic of
Liberia and the Belgian Congo. 2: 786-796
Bates MF, Branch WR, Bauer AM, Burger M, Marais J, Alex-
ander GJ, De Villiers MS (eds.) (2014) Atlas and red list of
the reptiles of South Africa, Lesotho and Swaziland. Suricata
1. South African National Biodiversity Institute, Pretoria
©ZFMK
Psammophis sibilans group 85
Bocage JV Barboza du (1887) Mélanges erpétologiques. IV
Reptiles du dernier voyage de M.M. Capello et Ivens a tra-
vers l'Afrique. Jornal de Sciencias, Mathematicas, Physicas
e Naturaes, Lisboa 11(44): 201-208
Bocage JV Barboza du (1895) Herpétologie d’Angola et du
Congo. Imprimerie Nationale, Lisbonne
Boettger O (1881) Aufzahlung der von Frhrn. H. und Frfr. A.
von Maltzan im Winter 1880/81 am Cap Verde in Senegam-
bien gesammelten Kriechthiere. Abhandlungen der Sencken-
bergischen Naturforschenden Gesellschaft 12: 393-418
Bogert CM (1940) Herpetological results of the Vernay Angola
Expedition, with notes on African reptiles in other collec-
tions. I. Snakes, including an arrangement of African Colu-
bridae. Bulletin of the American Museum of natural History
77. 1-107
Bogert CM (1942) Snakes secured by the Snyder East Afri-
can expedition in Kenya Colony and Tanganyika Territory.
American Museum Novitates 1178: 1-5
Bohme W (1975) Zur Herpetofaunistik Kameruns, mit Be-
schreibung eines neuen Scinciden. Bonner Zoologische Bei-
trage 26: 2-48
Bohme W (1978) Zur Herpetofaunistik des Senegal. Bonner
Zoologische Beitrage 29: 360-417
Bohme W (1986) Preliminary note on the taxonomic status of
Psammophis leucogaster Spawls, 1983 (Colubridae: Psam-
mophin1). Litteratura Serpentium 6 (5): 171-180
Bohme W (1987) Zur Kenntnis von Psammophis subtaeniatus
Peters, 1882 an seinem nordostlichen Arealrand (Serpentes:
Colubridae: Psammophini). Salamandra 23: 84-89
Bohme W, Meinig H, Rédel MO (1996) New records of am-
phibians and reptiles from Burkina Faso and Mali. British
Herpological Society Bulletin 56: 7-26
Bohme W (2000) Diversity of a snake community in a Guin-
eran rain forest (Reptilia, Serpentes). Bonner Zoolologische
Monographien 46: 69-78
Bohme W, Schneider B (1987) Zur Herpetofaunistik Kamer-
uns (III) mit Beschreibung einer neuen Cardioglossa (Anura:
Arthroleptidae). Bonner Zoologische Beitrage 38: 241-263
Boulenger GA (1896) Catalogue of the snakes in the British
Museum (Natural History). Volume III. British Museum
(Natural History), London
Boulenger GA (1905) A list of the batrachians and reptiles col-
lected by Dr W.J. Ansorge in Angola, with descriptions of
new species. Annals and Magazine of Natural History (7) 16:
105-115
Boulenger GA (1906) Report on the reptiles collected by the
late L. Fea in West Africa. Annali dell Museo Civico di Storia
Naturale di Genova (Series 3) 2: 196-216
Boulenger GA (1915a) A list of the snakes of the Belgian and
Portuguese Congo, Northern Rhodesia and Angola. Proceed-
ings of the Zoological Society of London 85: 193—223
Boulenger GA (1915b) A list of the snakes of East Africa, north
of the Zambezi and south of the Soudan and Somaliland, and
of Nyasaland. Proceedings of the Zoological Society of Lon-
don 85: 611-640
Bourgeois M (1964) Les reptiles de la Kasapa (Elizabethville).
Publications de |’Université Officielle du Congo a Lubum-
bashi 7: 65-89
Branch WR (1998) Field guide to snakes and other reptiles of
southern Africa. Struik, Cape Town
Brandstatter F (1995) Eine Revision der Gattung Psammophis
mit Berticksichitung der Schwesterngattung innerhalb der
tribus Psammophiinae (Colubridae: Lycodontinae). Teil 1:
Die Gattungen und Arten der Tribus Psammophiinae. Teil
2: Rasterelektronenmikroskopische Untersuchungen zur
Bonn zoological Bulletin 68 (1): 61-91
Schuppenultrastruktur bei den Arten der Tribus Psammophi-
ini mit besonderer Berticksichtigung der Arten der Gattung
Psammophis. Unpub. D.Sc. thesis, Universitat des Saarlan-
des, Saarbrticken
Brandstatter, F. 1996. Die Sandrennattern. Westarp. — Wiss.,
Magdeburg; Spektrum Akad. Verlag, Heidelberg
Broadley DG (1963) Psammophis sibilans (Linnaeus, 1758)—a
taxonomic dustbin. Journal of the Herpetological Association
of Rhodesia 20: 5—7
Broadley DG (1966) A review of the African stripe-bellied
sand-snakes of the genus Psammophis. Armmoldia Rhodhesia
2 (36): 1-9
Broadley DG (1971) The reptiles and amphibians of Zambia.
Puku 6: 1-143
Broadley DG (1977) A review of the genus Psammophis in
southern Africa (Serpentes: Colubridae). Arnoldia Rhodhe-
sia 8 (12): 1-29
Broadley DG (1983) FitzSimons’ snakes of southern Africa.
Revised edition. Delta Books, Johannesburg
Broadley DG (1991) The herpetofauna of northern Mwinilunga
District, northwestern Zambia. Arnoldia Zimbabwe 9 (37):
519-537
Broadley DG (2002) A review of the species of Psammophis
Boie found south of Latitude 12° S (Serpentes: Psammophi-
inae). African Journal of Herpetology 51: 83-119
Broadley DG, Howell KM (1991) A checklist of the reptiles of
Tanzania, with synoptic keys. Syntarsus 1: 1-70
Broadley DG, Pitman CRS (1959) On a collection of snakes
taken in Northern Rhodesia by Monsieur H.J. Bredo. Occa-
sional papers of the National Museums of Southern Rhodesia
24B: 437-451
Broadley DG, Doria CT, Wigge J (2003) Snakes of Zambia.
An atlas and field Guide. Edition Chimaira, Frankfurt a. M.
Butler JA, Reid JC (1990) Records of snakes from Nigeria. Ni-
gerian Field 55: 19-40
Cadle JE (1994) The colubrid radiation in Africa (Serpentes:
Colubridae): phylogenetic relationships and evolutionary
patterns based on immunological data. Zoological Journal of
the Linnean Society 110: 103-140
Campbell BN (1997) Hic sunt seroentes; molecular phyloge-
netics and the Boidae (Serpentes: Booidea). Ph.D. disserta-
tion, Queen’s Univ., Ont., Canada, published privately
Cansdale GS (1949) Further notes on Gold Coast snakes. Nige-
rian Field 14: 106-113
Chabanaud P (1916) Enumeration des ophidiens non encore
étudiés de Il’ Afrique occidentale, appartenant aux collections
du Muséum, avec la description des espeéces et des variétés
nouvelles. Bulletin du Muséum national d’ Histoire naturelle
22: 362-383
Chabanaud P (1918) Etude d’une collection de reptiles de P Af-
rique Occidentale Franc¢aise, récemment donnée au Muséum
(histoire naturelle de Paris par le Dr G. Bouet, avec la de-
scription de deux especes nouvelles. Bulletin du Muséum
national d’ Histoire naturelle 24: 160-166
Chippaux JP (1999, 2006) Les serpents d’ Afrique occidentale
et centrale. IRD éditions, Paris
Chirio L (2009) Inventaire des reptiles de la Réserve de Bio-
sphere Transfrontali¢re du W (Niger/Bénin/Burkina Faso :
Afrique de |’Ouest). Bulletin de la Société Herpétologique
de France 132: 13-41
Chirio L (2012) Inventaire des reptiles de la région de Sangaré-
di (Guinée maritime). Bulletin de la Société Herpétologique
de France 144: 67-100
©ZFMK
86 Jean-Frang¢ois Trape et al.
Chirio L, Ineich I (2006) Biogeography of the reptiles of the
Central African Republic. African Journal of Herpetology
55: 23-59
Chirio L, Lebreton M (2007) Atlas des reptiles du Cameroun.
MNHN & IRD éditions, Paris
Condamin M (1958) La collection des serpents de l’IFAN
(aquisitions 1956). Bulletin de I’Institut Francais d’ Afrique
Noire, Série A 20: 243-262
Condamin M (1959) Serpents récoltés a Sérédou (Guinée) par
R. Pujol. Bulletin de I’Institut Frangais d’Afrique Noire,
Série A 21: 1351-1366
Corkill NL (1935) Notes on Sudan snakes. A guide to the spe-
cies represented in the collection in the Natural History Mu-
seum Khartoum. Sudan Government Museum (Natural His-
tory), Khartoum 3: 1-41
Doucet J (1963) Les serpents de la République de Cote d’Ivo-
ire. Acta Tropica 20: 201-340
Dowling HG (1951) A proposed standard system of counting
ventral scales in snakes. British Journal of Herpetology 1 (5):
97-99
Ferreira J Bethencourt (1905) Reptis e amphibios de Angola da
Regido ao norte do Quanza (Collecg¢aéo Newton — 1903). Jor-
nal de Sciencias, Mathematicas, Physicas e Naturaes, Lisboa
(2) 7: 111-117
Flower SS (1933) Notes on the recent reptiles and amphibians
of Egypt, with a list of the species recorded from that king-
dom. Proceedings of the Zoological Society of London 103:
735-831
Gatesy JL, Amato G, Vrba E, Schaller G, Desall R (1997) A
cladistic analysis of mitochondrial ribomosal DNA from the
Bovidae. Molecular Phylogenetics and Evolution 7: 303-319
Graber M (1966) Note d’herpétologie tchadienne: étude
préliminaire de quelques serpents récoltés dans la région de
Fort Lamy de 1954 4 1965. Revue d’Elevage et de Médecine
Vétérinaire des Pays Tropicaux19: 137-148
Geniez P (2015) Serpents d’Europe, d’Afrique du Nord et du
Moyen-Orient. Paris, Delachaux et Niestlé
Gruschwitz M, Lenz S, B6hme W (1991). Zur Kenntnis der
Herpetofauna von Gambia (Westafrika). Teil 1. Herpetofau-
na 13 (74): 13-34
Haagner GV, Branch WR, Haagner AJF (2000) Notes on a
collection of reptiles from Zambia and adjacent areas of the
Democratic Republic of the Congo. Annals of Eastern Cape
Museums 1: 1—25
Hedges NG (1983) Reptiles and amphibians of East Africa.
Kenya Literature Bureau, Nairobi
Hellmich W (1957) Die Reptilienausbeute der Hamburgischen
Angola-Expedition. Mitteilungen aus dem Hamburgisches
Zoologisches Museum und Institut 55: 39-80
Hughes B (1983) African snake faunas. Bonner Zoologische
Beitrage 34: 311-356
Hughes B (1999) Critical review of a revision of Psammophis
(Linnaeus, 1758) (Serpentes: Reptilia), by Frank Brandstat-
ter. African Journal of Herpetology 48: 63-70
Hughes B (2012) Snakes of Bénin, West Africa. Bulletin de la
Société Herpétologique de France 144: 101-159
Hughes B, Barry DH (1969) The snakes of Ghana, a checklist
and key. Bulletin de I’Institut Fondamental d’ Afrique Noire
31: 1004-1041
Hughes B, Wade E (2002) On the African leopard whip snake,
Psammophis leopardinus Bocage, 1887 (Serpentes, Colub-
ridae), with the description of a new species from Zambia.
Bulletin of the Natural History Museum (Zoology Series) 68
(2): 75-81
Bonn zoological Bulletin 68 (1): 61-91
Hughes B, Wade E (2004) Is Psammophis sibilans occidenta-
lis Werner 1919 (Squamata: Serpentes; Colubridae) a junior
synonym of P. phillipsii (Hallowell 1844) ? Herpetozoa 16
(3/4): 127-132
Ineich I (2003) Contribution a la connaissance de la biodiversi-
té des régions afro-montagnardes: les Reptiles du mont Nim-
ba. Mémoires du Muséum national d’ Histoire naturelle 190:
597-637
Irwin DM, Kocher TD, Wilson AC (1991) Evolution of the Cy-
tochrome b Gene of Mammals. Journal of Molecular Evolu-
tion 32: 128-144
Jackson K, Zassi-Boulou A-G, Mavoungou LB, Pangou S
(2007) Amphibians and reptiles of the Lac Télé community
reserve, Likouala Region, Republic of Congo (Brazzaville).
Herpetological Conservation and Biology 2: 75—86
Joger U (1981) Zur Herpetofaunistik Westafrikas. Bonner Zo-
ologische Beitrage 32: 297-340
Joger U (1982) Zur Herpetofaunistik Kameruns (II). Bonner
Zoologische Beitrage 33: 313-342
Joger U (1990) The herpetofauna of the Central African Re-
public, with description of a new species of Rhinotyphlops
(Serpentes: Typhlopidae). In: Peters G. & R. Hutterer (eds.)
Vertebrates in the tropics: pp. 85-102
Kelly CMR, Barker NP, Villet MH, Broadley DG, Branch WR
(2008) The snake family Psammophiidae (Reptilia: Ser-
pentes): Phylogenetics and species delimitation in the Afri-
can sand snakes (Psammophis Boie, 1825) and allied genera.
Molecular Phylogenetics and Evolution 47: 1045-1060
Klaptocz A (1913) Reptilien, Amphibien und Fische aus
Franzésich-Guinea. Zoologische Jahrbticher (Systematik)
34: 279-290
Lanza B (1972) The reptiles of the Awash National Park (Shoa,
Ethiopia). Monitore Zoologico Italiano N.S. Suppl. 4 (7):
159-184
Lanza B (1983) A list of the Somali amphibians and reptiles.
Monitore Zoologico Italiano N.S. Suppl. 18 (8): 193-247
Lanza B (1990) Amphibians and reptiles of the Somali Demo-
cratic Republic: check list and biogeography. Biogeographia
14: 407-465
Largen MJ (1997) An annotated checklist of the amphibians
and reptiles of Eritrea, with keys for their identification.
Tropical Zoology 10: 63-115
Largen MJ, Rasmussen JB (1993) Catalogue of the snakes of
Ethiopia (Reptilia Serpentes), including identification keys.
Tropical Zoology 6: 313-434
Largen MJ, Spawls S (2010) The amphibians and reptiles of
Ethiopia and Eritrea. Chimaira, Frankfurt am Main
Laurent RF (1950). Reptiles et Batraciens de la région de Dun-
do (Angola du Nord-Est). Publicagées Culturais da Compan-
hia de Diamantes de Angola, Dundo 10: 7-17
Laurent RF (1954) Reptiles et Batraciens de la région de Dundo
(Angola) (Deuxieme note). Publicagdées Culturais da Com-
panhia de Diamantes de Angola, Dundo 23: 35-84
Laurent RF (1956) Contribution a |’ Herpetologie de la région
des Grands Lacs de |’Afrique centrale. Annales du Musée
Royal du Congo Belge, Sér. 8vo (Sci. Zool.) 48: 1-390
Laurent RF (1960) Notes complémentaires sur les Chéloniens
et les Ophidiens du Congo oriental. Annales du Musée Royal
du Congo Belge, Sér. 8vo (Sci. Zool.) 84: 1-86
Laurent RF (1964) Reptiles et Amphibiens de Il’Angola
(Troisieme contribution). Publicagées Culturais da Compan-
hia de Diamantes de Angola, Dundo 67: 11-165
Leston D (1950) Identification of snakes of the Gold Coast.
Crown Agents, London
©ZFMK
Psammophis sibilans group 87
Leston D, Hughes B (1968) The snakes of Tafo, a forest Co-
coa-farm locality in Ghana. Bulletin de I’ Institut Fondamen-
tal d’ Afrique Noire 30: 737-770
Loveridge A (1916) Report on the collection of Ophidia in the
Society’s Museum. Journal of the East African and Uganda
natural History Society 5: 76-87
Loveridge A (1918) Notes on snakes in East Africa. Journal
of the East African and Uganda natural History Society 13:
315-338
Loveridge A (1923) Notes on East African snakes, collected
1918-1923. Proceedings of the Zoological Society of Lon-
don 93: 871-897
Loveridge A (1928) Field notes on vertebrates collected by
the Smithsonian-Chrysler East African Expedition of 1926.
Proceedings of the United States National Museum 73 (17):
1-69
Loveridge A (1933) Reports on the scientific results of an expe-
dition to the southwestern highlands of Tanganyika Territory.
VII. Herpetology. Bulletin of the Museum of Comparative
Zoology 74: 197-416
Loveridge A (1936a) African reptiles and amphibians in Field
Museum of Natural History. Zoological Series, Field Muse-
um of Natural History 22: 1-111
Loveridge A (1936b) Scientific results of an expedition to rain
forest regions in eastern Africa. V. Reptiles. Bulletin of the
Museum of Comparative Zoology 79: 209-337
Loveridge A (1938) On a collection of reptiles and amphibians
from Liberia. Proceedings of the New England Zoological
Club 17: 49-74
Loveridge A (1940) Revision of the African snakes of the gen-
era Dromophis and Psammophis. Bulletin of the Museum of
Comparative Zoology 87: 1-69
Loveridge A (1942a) Scientific results of a fourth expedition to
forested areas in east and central Africa. IV. Reptiles. Bul-
letin of the Museum of Comparative Zoology 91: 237-373
Loveridge A (1942b) Comments on the reptiles and amphibians
of Lindi. Tanganyika Notes and Records 14: 1-14
Loveridge A (1953) Zoological results of a fifth expedition to
East Africa. III. Reptiles from Nyasaland and Tete. Bulletin
of the Museum of Comparative Zoology 110: 141-322
Loveridge A (1956) On snakes collected in the Anglo-Egyp-
tian Sudan by J.S. Owen, Esq. Sudan Notes and Records 36:
37-56
Loveridge A (1957) Check List of the reptiles and amphibians
of East Africa (Uganda; Kenya; Tanganyika; Zanzibar). Bul-
letin of the Museum of Comparative Zoology 117: 151-362
Luiselli L, Akani GC, Angelici FM, Eniang EA, Ude L, Poli-
tano E (2004) Local distribution, habitat use, and diet of two
supposed species of the Psammophis phillipsi complex (Ser-
pentes: Colubridae), sympatric in southern Nigeria. Amphib-
ia-Reptilia 25: 415—423
Marais J (2004) A complete guide to the snakes of southern
Africa. Struick Publishers, Cape Town
Marx H (1956) Keys to the lizards and snakes of Egypt. NAM-
RU-3 Research Report NM 005 050.39.45. Cairo
Marx H (1958) Egyptian snakes of the genus Psammophis.
Fieldiana Zoologica 39: 191—200
Matschie P (1893) Die Reptilien und Amphibien des Togoge-
bietes. Mitteilungen von Forschungsreisenden und Gelehrten
aus den Deutschen Schutzgebieten 6: 207—215
Menzies JI (1966) The snakes of Sierra Leone. Copeia 21:
169-179
Mertens R (1955) Amphibien und Reptilien aus Ostafrika.
Jahreshefte des Vereins fiir vaterlandische Naturkunde in
Wirttemberg 110: 47-61
Bonn zoological Bulletin 68 (1): 61-91
Monard A (1940) Résultats de la Mission scientifique du Dr
Monard en Guinée Portugaise 1937-1938. Arquivos do Mu-
seu Bocage 11: 147—180
Monard A (1951) Reptiles et Batraciens. In: Résultats de la
mission zoologique suisse au Cameroun. Mémoires de |’In-
stitut fran¢ais d’Afrique noire, série Sciences naturelles 1:
123-185
Mocquard MF (1887) Sur les ophidiens rapportés du Congo par
la mission de Brazza. Bulletin de la Société Philomathique de
Paris, série 7, 11: 62-92
Pakenham RHW (1983) The reptiles and amphibians of Zanzi-
bar and Pemba Islands (with a note on the freshwater fishes).
Journal of the East African Natural History Society and Na-
tional Museum 177: 1-40
Papenfuss TJ (1969) Preliminary analysis of the reptiles of arid
central West Africa. Wasman Journal of Biology 27: 249-325
Parker HW (1949) The snakes of Somaliland and the Sokotra
Islands. Zoologische Verhandelingen 6: 1-115
Pasteur G, Bons J (1960) Catalogue des reptiles actuels du
Maroc. Révision de formes d’Afrique, d’Europe et d’ Asie.
Travaux de |’ Institut scientifique chérifien, série Zoologie 21:
1-132
Pauwels OSG, Vande Weghe JP (2008) Les reptiles du Gabon.
Smithsonian Institution, Washington
Perret JL (1961) Etudes herpétologiques africaines III. Bul-
letin de la Société neuchateloise de Sciences naturelles 84:
133-138
Perret JL, Mertens R (1957) Révision du matériel her-
pétologique du Cameroun, étudié par A. Monard. Revue su-
isse de Zoologie 64: 73-78
Pitman CRS (1934) A check list of Reptilia and Amphibia oc-
curring and believed to occur in Northern Rhodesia. In: a re-
port on a faunal survey of Northern Rhodesia. Government
Printer, Livingstone, pp 292-312
Pitman CRS (1938, 1974) A guide to the snakes of Uganda.
Wheldon & Wesley, Codicote
Rasmussen JB (1991) Snakes (Reptilia: Serpentes) from the
Kouilou River basin, including a tentative key of the snakes
of the République du Congo. Tauraco Research Report 4:
175-188
Robertson IAD, Chapman BM, Chapman RF (1962) Notes on
some reptiles collected in the Rukwa Valley, S.W. Tangan-
yika. The Annals and Magazine of natural History (13) 5:
421-432
Rodel MO, Grabow K, Bockheler C, Mahsberg D (1995)
Die Schlangen des Comoé-Nationalparks, Elfenbeinktste
(Reptilia: Squamata: Serpentes). Stuttgarter Beitrage zur
Naturkunde Ser A 528: 1-18
Rodel MO, Kouadio K, Mahsberg D (1999) Die Schlangenfau-
na des Comoé-Nationalparks, Elfenbeinkiste: Erganzungen
und Ausblik. Salamandra 35: 165—180
Roman B (1980) Serpents de Haute-Volta. C.N.R.S.T., Ouaga-
dougou
Roman B (1984) Serpents des pays de |’Entente. C.N.R.S.T.,
Ouagadougou
Roussel MR, Villiers A (1965) Serpents du Mayo-Kebbi
(Tchad). Bulletin de l’Institut Fondamental d’ Afrique Noire,
sér. A, 27: 1522-1533
Roux-Esteve R (1965) Les serpents de la région de la
Maboké-Boukoko. Cahiers de la Maboké (Zoologie) 3: 51—
92
Roux-Esteve R (1969) Les serpents de la région de Lamto
(Céte dIvoire). Annales de |’Université d’Abidjan, série E
2: 81-137
©ZFMK
88 Jean-Frang¢ois Trape et al.
Saleh MA (1997) Amphibians and reptiles of Egypt. Publica-
tion of National Biodiversity Unit, No. 6, Cairo
Sauvage HE (1884) Notice sur une collection de reptiles et de
poisons recueillie a Majumba, Congo. Bulletin de la Société
Zoologique de France 9: 199-204
Schatti B (1986) Herpetologische Ausbeute einer Sammelreise
nach Mali (Amphibia, Reptilia). Revue suisse de Zoologie
93: 765-778
Schmidt KP (1923) Contributions to the herpetology of the
American Museum Congo Expedition, 1909-1915. Part II. —
Snakes. Bulletin of the American Museum of Natural History
49: 1-146
Schleich HH, Kastle W, Kabish K (1996) Amphibians and rep-
tiles of North Africa. Koeltz Publisher, Koenigstein
Spawls S (1978) A checklist of the snakes of Kenya. Journal of
the East African Natural History Society and National Muse-
um 31 (167): 1-18
Spawls S (1983) A new Psammophis from northern Ghana.
British Journal of Herpetology 6: 311-312
Spawls S, Howell K, Drewes R, Ashe J (2002) A field guide to
the reptiles of East Africa. Academic Press, San Diego
Sternfeld R (1907) Die Schlangenfauna von Kamerun. Mittei-
lungen aus dem Zoologischen Museum in Berlin 3: 397-432
Sternfeld R (1908a) Die Schlangenfauna Togos. Mitteilungen
aus dem Zoologischen Museum in Berlin 4: 207—236
Sternfeld R (1908b) Zur Schlangenfauna Ostafrikas. Mitteilun-
gen aus dem Zoologischen Museum in Berlin 4: 237—247
Sternfeld R (1909a) Die Fauna der deutschen Kolonien. He-
rausgegeben mit Untersttitzung des Reichs-Kolonialamtes
vom Zoologischen Museum in Berlin. Reihe I, Kamerun.
Heft.1. Die Schlangen Kameruns. R. Friedlander & Sohn,
Berlin
Sternfeld R (1909b) Die Fauna der deutschen Kolonien. He-
rausgegeben mit Unterstiitzung des Reichs-Koloniatlamtes
vom Zoologischen Museum in Berlin. Reihe II. Togo. Heft 1.
Die Schlangen Togos. R. Friedlander & Sohn, Berlin
Sternfeld R (1910) Die Fauna der deutschen Kolonien. Heraus-
gegeben mit Unterstiitzung des Reichs-Kolonialamtes vom
Zoologischen Museum in Berlin. Reihe II. Deutsch-Os-
tafrika. Heft 2. Die Schlangen Deutsch-Ostafrikas. R.
Friedlander & Sohn, Berlin
Sternfeld R (1911) Zur Reptilienfauna Deutsch-Ostafrikas.
Sitzungsberichte der Gesellschaft Naturforschender Freunde
zu Berlin 4: 245-251
Sternfeld R (1913) Reptilia. In: Wissenschaftliche Ergebnisse
der deutschen Zentral-Afrika-Expedition 1907-1908. Band
IV, Zoologie II. pp. 197-280. Leipzig, Klinkhardt & Bier-
mann
Sternfeld R (1917) Reptilia und Amphibia. In: Hamburgische
wissenschaftliche Siftung. Ergebnisse der zweiten deutschen
Zentral-Afrika-Expedition, 1910-1911. Band I, Zoologie II.
pp. 407-509. Leipzig, Klinkhardt & Biermann
Stucki-Stirn MC (1979) Snake report 721: A comparative study
of the herpetological fauna of the former West Cameroon/
Africa. Herpeto-Verlag, Teuffenthal
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013)
MEGAG6: Molecular Evolutionary Genetics Analysis version
6.0. Molecular Biology and Evolution 30: 2725-2729
Taylor EH, Weyer D (1958) Report on a collection of amphibi-
ans and reptiles from Harbel, Republic of Liberia. University
of Kansas Science Bulletin 38: 1191-1230
Thys Van Den Audenaerde DFE (1965) Les serpents des en-
virons de Léopoldville. Revue de Zoologie et de Botanique
Africaine 72: 366-388
Bonn zoological Bulletin 68 (1): 61-91
Tornier G (1896) Die Kriechthiere Deutsch-Ost-Afrikas. Beit-
rage zur Systematik und Descendenzlehre, 1-164
Trape JF (2005) Note sur quelques serpents méconnus du
Burkina Faso de la collection de Benigno Roman. Bulletin
de la Société Herpétologique de France 116: 39-49
Trape JF, Baldé C (2014) A checklist of the snake fauna of
Guinea, with taxonomic changes in the genera Philotham-
nus and Dipsadoboa (Colubridae) and a comparison with the
snake fauna of some other West African countries. Zootoxa
3900: 301-338
Trape JF, Mané Y (2000). Les serpents des environs de Diel-
mo (Sine-Saloum, Sénégal). Bulletin de la Société Her-
pétologique de France 95: 19-35
Trape JF, Mané Y (2002). Les serpents du Sénégal: liste com-
mentée des espeéces. Bulletin de la Société de Pathologie Ex-
otique 95: 148—150
Trape JF, Mané Y (2004) Les serpents des environs de Banda-
fassi (Sénégal oriental). Bulletin de la Société Herpétologique
de France 109: 5-34
Trape JF, Mané Y (2006) Guide des serpents d’Afrique occi-
dentale. Savane et désert. IRD éditions, Paris
Trape JF, Mané Y (2015) The snakes of Niger. Amphibian and
Reptile Conservation, 9(2) (special section): 39-55 (e110)
Trape JF, Mané Y (2017) The snakes of Mali. Bonn Zoological
Bulletin 66: 107-133
Trape JF, Roux-Estéve R (1995) Les serpents du Congo: liste
commentee et clé de détermination. Journal of African Zool-
ogy 109: 31-50
Uetz P, HoSek J (2018) The Reptile Database (eds.). Online
at: http://www.reptile-database.org, last accessed on Octo-
ber10th 2018
Ullenbruch K, Grell O, Bohme W (2010) Reptiles from south-
ern Bénin, West Africa, with the description of a new Hemi-
dactylus (Gekkonidae), and a country-wide checklist. Bonn
Zoological Bulletin 57: 31-54
Uthmoller W (1937) Beitrag zur Kenntnis der Schlangenfauna
des Kilimandscharo (Tanganyika-Territory, ehemaliges Du-
utsch-Ostafrica). Temminckia 2: 97-134
Vesey-Fitzgerald LDEF (1958) The snakes of Northern Rhode-
sia and the Tanganyika borderlands. Proceedings and Trans-
actions of the Rhodesia scientific Association 46: 17—102
Vesey-Fitzgerald LDEF (1975) A guide to the snakes of the
Tanzania and Kenya borderlands Journal of the East African
Natural History Society and National Museum 149: 1—26
Vidal N, Branch WR, Pauwels OSG, Hedges SB, Broadley DG,
Wink M, Cruaud C, Joger U, Nagy ZT (2008) Dissecting the
major African snake radiation: a molecular phylogeny of the
Lamprophiidae Fitzinger (Serpentes, Caenophidia). Zootaxa
1945: 51-66
Villiers A (1950) La collection de serpents de ?I.F.A.N. Institut
Frangais d’ Afrique Noire, Catalogues VI, Dakar
Villiers A (1951) La collection de serpents de ’ IFAN (acquisi-
tions 1950). Bulletin de I’Institut Frangais d’Afrique Noire
13: 813-836
Villiers A (1952) La collection de serpents de IFAN (acquisi-
tions 1951). Bulletin de I’Institut Frangais d’Afrique Noire
14: 881-898
Villiers A (1953) La collection de serpents de IFAN (acquisi-
tions 1952). Bulletin de I’Institut Francais d’Afrique Noire
15: 1103-1127
Villiers A (1954) La collection de serpents de IFAN (acquisi-
tions 1953). Bulletin de I’Institut Frangais d’Afrique Noire
16 (sér. A): 1234-1247
©ZFMK
Psammophis sibilans group 89
Villiers A (1956a) La collection de serpents de PIFAN (acqui-
sitions 1954-1955). Bulletin de |’Institut Fran¢ais d’ Afrique
Noire 18 (sér. A): 877-883
Villiers A (1956b) Le Parc National du Niokolo-Koba. Vol. 1.
Reptiles. Mémoires de |’Institut Frangais d’ Afrique Noire
48: 143-162
Villiers A (1963) Serpents africains des collections de Muséum
de Paris. Bulletin de I’Institut Frangais d’ Afrique Noire 25
(sér. A): 1367-1373
Villiers A (1965) Serpents récoltés au Mali et en Haute-Volta
par le Dr. Lamontellerie. Bulletin de I’ Institut Francais d’ Af-
rique Noire 27 (sér. A): 1192-1195
Villiers A (1966) Contribution a la faune du Congo (Brazza-
ville). Mission A. Villiers et A. Descarpentries. XLII. Rep-
tiles Ophidiens. Bulletin de I’ Institut Fondamental d’ Afrique
Noire 28 sér. A): 1720-1760
Villiers, A (1975) Les serpents de l’ ouest Africain. Inititiation et
Etudes A fricaines II (3éme édit.), Dakar
Villiers A, Condamin M (2005) Les serpents de |’Ouest Afric-
ain. IFAN, Inititiation et Etudes Africaines II (4 éme édit.),
Dakar
Wallach V, Williams KL, Boundy J (2014) Snakes of the world:
a catalogue of living and extinct species. CRC Press, Boca
Raton, London, New York
Werner F (1902) Uber Westafrikanische Reptilien. Verhandlun-
gen der Zoologisch-Botanischen Gesellschaft in Wien 52:
332-348
Werner F (1915) Reptilia und Amphibia. In W. Michaelsen,
Beitrage zur Kenntnis der Land- und Sisswasserfauna
Deutsch-Stidwestafrikas. 3: 323-376
APPENDIX I
Werner F. (1919) Wissenschaftliche Ergebnisse der mit Unter-
stiitzung der Kaiserlichen Akademie der Wissenschaften in
Wien aus der Erbschaft treitl von F. Werner unternommenen.
Zoologischen Expedition nach dem Anglo-Aegyptischen Su-
dan (Kordofan) 1914. IV. Bearbeitung der Fische, Amphibien
und Reptilien. Denkschriften der Kaiserlichen Akademie der
Wissenschaften in Wien, Mathematische-Naturwissenschaft-
liche Klasse 96: 437-509
Witte GF de (1933a) Batraciens et Reptiles recueillis par M.L.
Burgeon au Ruwenzori, ua Kivu et au Tangnyka. Revue de
Zoologie et de Botanique Africaine 24: 111-123
Witte GF de (1933b) Reptiles récoltés au Congo Belge par le Dr
H. Schouteden et par M. G.-F. de Witte. Annales du Musée
du Congo Belge (Zoologie) 3: 53—100
Witte GF de (1941) Batraciens et reptiles. Exploration du Parc
national Albert. Mission G.-F. de Witte (1933-1935) 33:
1-261
Witte GF de (1953) Reptiles. Exploration du Parc national de
l’Upemba. Mission G.-F. de Witte 6: 1-322
Witte GF de (1955) La population de reptiles de la région de
Mutsora (Kivu Nord). Académie royale des Sciences colo-
niales (N.S.) 1: 203-225
Witte GF de (1962) Genera des serpents du Congo et du Ru-
anda-Urundi. Annales du Musée royal de I’ Afrique Centrale
(Sci. Zool.) 104: 1-203
Witte GF de (1966) Reptiles. Exploration du Parc national de la
Garamba. Mission H. de Saeger 48: 1-108
Witte GF de (1975) Serpents: Boidae, Colubridae, Elapidae
et Viperidae. Exploration du Parc national des Virunga 24:
62-121
Table 1. Localities and GenBank numbers of sequenced specimens.
Species & collection N° | Country & locality Cyt B 16S
P. rukwae Chad O7°44°N / MH997939 | MK032650 | MK005696
IRD 2121.N Baibokoum 1S5°41’E
P. rukwae Chad O7°44°N / MH997941 | MK032652 | MK005698
IRD 2150.N Baibokoum 1S5°41’E
P. rukwae Chad O7°44°N / MH997931 | MK032646 | MK005692
IRD 2020.N Baibokoum 15°41’E
P. rukwae Chad 12°07’N / MH997936 | MK032643 | MK005689
IRD 1888.N Mahargal Balen P/4) 0)
P. rukwae Chad 10°41°N / MH997937 | MK032644
IRD 1949.N Bon Amdaoud 19°28’E
P. rukwae Ethiopia 10°36’N / MH997968 | MK032678 | MK005726
MBUR 08343 near Kutaworke 34°24’ E
P. rukwae Chad 12°04N / MH997929 MK005690
IRD 2001.N N’Djaména | he yat OF oa
P. rukwae Chad 12°04N / MH997930 | MK032645 | MK005691
IRD 2002.N N’Djaména 15°07°E
P. rukwae Chad 10°33°N / MH997951 | MK032658 | MK005706
IRD 2759.N Kiékeé 19°48°E
P. afroccidentalis sp. nov. | Benin 07°13’N / MH997972 | MK032682
ZFMK 77019 Za-Kpota O2S1 20
P. afroccidentalis sp. nov. | Benin 07°20’N / MH997971 | MK032681
ZFMK 77012 Dyidja 01°56’E
Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK
90 Jean-Frang¢ois Trape et al.
Species & collection N° | Country & locality Cyt B | ND4 | 168 |
P. afroccidentalis sp. nov. | Benin O7°11VN/ MH997973 | MK032683
ZFMK 77036 Bohicon 02°04’E
P. afroccidentalis sp. nov. | Niger 14°02’N / MK032663
IRD 370.N Toundi Farkia O1°32°E
P. afroccidentalis sp. nov. | Burkina Faso 1 1°32°Ni7 MH997961 | MK032677 | MK005718
IRD TR.4173 Pa 03°18’W
P. afroccidentalis sp. nov. | Senegal 13°12’N/ MH997960 MK005717
IRD TR.4167 Dar Salam 13°06’W
P. afroccidentalis sp. nov. | Ivory Coast 09°31°N / MK032660
IRD 328.CI Niagnon 06°26’ W
P. afroccidentalis sp.nov | Mali 11°09°N / MK032642
IRD 115.M Doussoudiana 07°48’ W
P. afroccidentalis sp. nov. | Guinea 10°16’N / MH997962 | MK032671 | MK005719
IRD TR.4177 near Tiva 14°11 W
P. afroccidentalis sp. nov. | Guinea 11°10°N/ MH997954 | MK032665 | MKO005711
IRD 5001.G near Sangaredi 13°50’W
P. afroccidentalis sp. nov. | Mauritania 17°517N/ MH997965 | MK032674 | MK005721
IRD TR.4501 near Matmata 12°09" W
P. afroccidentalis sp. nov. | Chad 14°08’N / MK005683 MK005708
IRD 2808.N Mao 15°18°E
P. sibilans Egypt 25°01’N / MH997935 | MK032641
BEV T4799 near Edfu 32° 5808,
P. sibilans Egypt 29°25’ N# MH997928 | MK032639 | MK005687
AUZC R.143972 Faiyum 30°S4V’E
P. sibilans Egypt 29°25’N / MH997934 | MK032640 | MKO005688
AUZC R.143973 Faiyum 30°S4V’E
P. sibilans Ethiopia 10°35’N / MH997970 | MK032680 | MK005727
MBUR 08588 near Kutaworke 34°21VE
P. sudanensis Chad O7°44’N / MH997948 MK005703
IRD 2280.N Baibokoum 15°41VE
P. sudanensis Chad 07°44’N / MH997949_ | MK032657 | MK005704
IRD 2283.N Baibokoum 15°41VE
P. sudanensis Chad O7°44’N / MH997946 | MK032655
IRD 2231.N Baibokoum 15°41’E
P. sudanensis Chad O7°44’N / MH997950 MK005705
IRD 2289.N Baibokoum 15°41’E
Psammophis sp. Ethiopia 10°40°N / MH997969 | MK032679
MBUR 08346 NE of Kutaworke 34°2S°E
P. phillipsi Guinea 10°03’N / MH997955 | MK032666 | MK005712
IRD 5002.G Kindia 12°51°W
P. phillipsi Guinea 10°03’N / MH997956 | MK032667
IRD 5003.G Kindia 12°51°W
P. phillipsi Guinea O9°14"N / MH997957 | MK032668 | MK005713
IRD 5004.G Kissidougou 10°03’ W
P. phillipsi Guinea 09° 14"N / MH997958 | MK032669 | MKO005714
IRD 5005.G Kissidougou 10°03’ W
P. phillipsi Guinea 07°43°N / MK005681 MK005715
IRD TR.4609 Ziéla 08°21°>W
Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK
Species & collection N°
Psammophis sibilans group
Country & locality Cyt B
ND4 16S
91
P. phillipsi Guinea O8°O1’N / MK005682 MK005716
IRD TR.4610 Paia 09°02’ W
P. phillipsi Togo 08°05S’N / MK005680 | MK032661 | MK005709
IRD 358.T Dyjiguengué 00°38’°E
P. phillipsi Togo 08°05S’N / MH997952 | MK032662 | MKO005710
IRD 367.T Dyjiguengué 00°38’°E
P. phillipsi Togo O7°19°N / MK005686
IRD 10.T Sodo 00°48°E
P. phillipsi Togo 06°54’N / MH997953 | MK032664
IRD 44.T Kpalimé 00°37°E
P. mossambicus Chad 07°44’N / MH997940 | MK032651 | MK005697
IRD 2136.N Baibokoum 15°41’E
P. mossambicus Chad 07°44’N / MH997942 MK005699
IRD 2186.N Baibokoum 15°41’E
P. mossambicus Chad 07°44’N / MH997945 | MK032654 | MKO005701
IRD 2226.N Baibokoum 15°41’E
P. mossambicus Chad 07°44’N / MH997932 | MK032647 | MK005693
IRD 2053.N Baibokoum 15°41’E
P. mossambicus Chad 07°44’N / MK032648 | MK032648 | MK005694
IRD 2066.N Baibokoum 15°41’E
P. mossambicus Chad 07°44’N / MH997944 | MK032653 | MKO005700
IRD 2224.N Baibokoum SAK
P. mossambicus Chad 07°44’N / MH997947 | MK032656 | MK005702
IRD 2238.N Baibokoum £54 he
P. mossambicus Cameroon 05°43’N / MH997967 | MK032676 | MK005723
IRD TR.4579 Foumban 10°5S’E
P. mossambicus Zambia I29D SF MH997976 | MK032686
ZFMK 88703 Luambe Nat. Park 32 aS E
P. mossambicus Zambia Leta sy MH997974 | MK0326684
ZFMK 88502 Ikelenge Nchila 24°16°E
P. mossambicus Zambia 1114S MH997975 | MK032685
ZFMK 88503 Ikelenge Nchila 24°16°E
P. mossambicus Gabon 02°43’S / MH997963 | MK032672 | MK005720
IRD TR.4366.LC Gamba 10°01’E
P. mossambicus Gabon 02°43’S / MH997964 | MK032673
IRD TR.4367.LC Gamba 10°01’E
P. mossambicus Republic of Congo | 04°32’S / MK005684 MK005725
MBUR 08242 Hinda 12°04"E
P. mossambicus Republic of Congo | 04°29’S / MK005684 MK005724
MBUR 03143 Lake Fony 11°46°E
P. lineatus Chad 07°44’N / MH997938 | MK032649 | MK005695
IRD 2120.N Baibokoum 15°41°E
P. elegans Mauritania 16°33’N / MH997966 | MK032675 | MK005722
IRD TR.4504 35 km E Rosso 15°317W
P. elegans Ivory Coast 07°00’N / MH997943 MK005728
IRD 222.CI Drekro 05°177W
P. elegans univittatus Chad 10°41°N / MK005679 | MK032659 | MKO005707
IRD 2761.N Bon Amdaoud 19°28°E
P. praeornatus Senegal 13°04’N / MH997959 | MK032670
IRD 9193.8 Fafakourou 14°33’W
Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 68 (1): 93-96
2019 - Landgref Filho P. et al.
https://do1.org/10.20363/BZB-2019.68.1.093
ISSN 2190-7307
http://www.zoologicalbulletin.de
Scientific note
urn:|sid:zoobank.org: pub: CBA 156F4-E9AA-401C-B036-77C362CE1 E89
Diet composition of Ameerega picta (Tschudi, 1838) from
the Serra da Bodoquena region in central Brazil, with a summary of dietary
studies on species of the genus Ameerega (Anura: Dendrobatidae)
Paulo Landgref Filho’, Fabricio H. Oda", Fabio T. Mise’,
Domingos de J. Rodrigues‘ & Masao Uetanabaro*
' Universidade Federal de Mato Grosso do Sul, Campus Aquidauana, 79200-000, Aquidauana, Mato Grosso do Sul, Brazil
? Departamento de Quimica Biologica, Programa de Pés-graduagdo em Bioprospec¢do Molecular, Universidade Regional do
Cariri, 63105-00, Crato, Ceard, Brazil
3Departamento de Biologia, Universidade Estadual do Centro-Oeste, 85040-080, Guarapuava, Parana, Brazil
*Instituto de Ciéncias Naturais, Humanas e Sociais, Universidade Federal de Mato Grosso — Campus Universitario de Sinop,
78557-267, Sinop, Mato Grosso, Brazil
*Instituto Nacional de Ciéncia e Tecnologia de Estudos Integrados da Biodiversidade Amazénica — Niucleo Regional de Sinop,
Sinop, Mato Grosso, Brazil
>Rua Clovis n. 24, 79022-071, Campo Grande, Mato Grosso do Sul, Brazil
* Corresponding author: Email: [email protected]
'urn:Isid:zoobank.org:author:5821C96D-4D9E-4E1 D-BE9B-C231B77D1AF3
2urn:Isid:zoobank.org:author:3497 12B5-E1B2-4059-A826-58F081DD3A4D
3urn:Isid:zoobank.org:author:E996A F2A-6CB7-4B73-8DEF-AB7CS5EEE1 AAO
4urn:Isid:zoobank.org:author: ACFBA432-3220-49 10-A FF5-8FF85053A872
Surn:Isid:zoobank.org:author:626F6A E3-7D90-4500-BFDC-4E6F4E01B378
Abstract. We provide data on the diet composition of Ameerega picta from the region of Serra da Bodoquena in the state
of Mato Grosso do Sul, central Brazil. We also provide a summary of dietary studies on species of the genus Ameerega.
Key words. Cerrado, dendrobatid frog, feeding habits, trophic ecology.
The Neotropical genus Ameerega Bauer, 1986 (Anu-
ra: Dendrobatidae), currently includes 31 species of
frogs distributed in Bolivia, Brazil, Colombia, Ecuador,
French Guiana, Guyana, Peru, Surinam, and Venezue-
la (Frost 2019). The spot-legged poison frog Ameerega
picta (Tschudi, 1838) is a small (SVL in males: 24 mm;
females: 26 mm), terrestrial, diurnal frog distributed in
Bolivia (Departamentos Santa Cruz, Cochabamba, Beni,
and La Paz), Brazil (states of Mato Grosso and Mato
Grosso do Sul), Peru (Departamentos Ucayali and Madre
de Dios), Colombia (Departamentos de Amazonas, Meta,
and Putumayo), and Venezuela (state of Bolivar) at al-
titudes of 200 to 2500 m asl (Duellman 2005; Acosta
Galvis 2017; Frost 2019). Ameerega picta is character-
ized as myrmecophagous (Mebs et al. 2010), but studies
on diet composition in different populations are scarce.
Toft (1980) investigated the diet of A. picta (as Dendro-
bates pictus) and 12 syntopic species in Amazonian Peru.
Ramon et al. (2010) determined the diet composition of
A. picta in an area of the Cerrado (Brazilian savanna) in
the municipality of Nova Xavantina in Mato Grosso state
Received: 12.12.2018
Accepted: 03.06.2019
in central Brazil. Considering the previous information
on the diet composition of A. picta throughout its geo-
graphic distribution, new studies could contribute to the
understanding of its trophic ecology. Here, we provide
data on the diet composition of A. picta from the region
of Serra da Bodoquena in the state of Mato Grosso do
Sul, central Brazil. We also provide a summary of dietary
studies on species of the genus Ameerega.
This study was conducted on the Rancho Branco
farm (20°41’S, 56°47’W) located in the municipality of
Bodoquena, state of Mato Grosso do Sul, central Brazil
(Fig. 1). We conducted six field trips (each lasting four
days) between May and October 2001. Specimens of
A. picta were sampled during the day on the leaf litter
near the margins of the Salobrinha stream using visual
and auditory search methods (Scott & Woodward 1994),
We determined the sex of the specimens collected and
measured snout-vent length (SVL) to the nearest 0.01 mm
using calipers. The specimens collected were euthanized
with 5% lidocaine, fixed in 10% formalin and preserved
in 70% ethanol. Voucher specimens were deposited at
Corresponding editor: W. Bohme
Published: 13.06.2019
94 Paulo Landgref Filho et al.
18°S
21°S
@ Rancho Branco farm
L_] Bodoquena municipality
— Rivers
Ecoregions
MS Pantanal
MS Cerrado
fH Atlantic Forest
Paraguay
Fig. 1. Map of the study site in the region of Serra da Bodoquena, municipality of Bodoquena, state of Mato Grosso do Sul, central
Brazil. Brazilian state abbreviations: GO, Goias; MG, Minas Gerais; MS, Mato Grosso do Sul; MT, Mato Grosso; PR, Parana; SP,
Sao Paulo.
Fig. 2. Specimen of Ameerega picta from region of Serra da
Bodoquena, municipality of Bodoquena, state of Mato Grosso
do Sul, central Brazil.
the zoological collection of the Universidade Federal de
Mato Grosso do Sul (ZUFMS — AMP, Brazil).
In the laboratory, a longitudinal incision was made in
each individual to remove the stomach and determine
Bonn zoological Bulletin 68 (1): 93-96
Table 1. Relative number (N%) of prey categories consumed
by Ameerega picta (N = 50) in the region of Serra da Bodoque-
na in the municipality of Bodoquena, state of Mato Grosso do
Sul, central Brazil (percentages shown in parentheses).
Prey categories N(%)
Insecta
Formicidae A0 (22.6)
Coleoptera (both larvae and adults) 39:(22:0)
Diptera 29 (16.4)
Homoptera 17 (9.6)
Arachnida
Araneae 22 (12.4)
Arthropod remains 30 (16.9)
Total 177 (100)
the contents under a stereomicroscope. Food items were
identified to the lowest taxonomic category possible. We
used the Student’s f-test (t) to determine differences in
numeric percentage (N%) per prey category between
males and females. As no significant differences between
sexes were found (t = 0.72, p > 0.05), we calculated the
numeric percentage per prey category for the pooled
stomachs.
©ZFMK
Diet composition of Ameerega picta from the Serra da Bodoquena region
Table 2. List of dietary studies on species of Ameerega in South America
Species
A. bilinguis
A. braccata
A. flavopicta
A. hahneli
A. parvula
A. petersi
A. picta
A. trivittata
Locality*
Parque Nacional Yasuni, Francisco de Orellana province (ECU)
Estacion Bioldgica Jatun Sacha, Napo province (ECU)
Reference
Darst et al. (2005)
Chapada dos Guimaraes, MT (BRA)
Cuiaba, MT (BRA)
Forti et al. (2011)
Minacu, GO (BRA)
Alto Paraiso, GO (BRA)
Pirenopolis, GO (BRA)
Caldas Novas, GO (BRA)
Ecological Station of Piratininga, MG (BRA)
Biavati et al. (2004)
Lima & Eterovick (2013)
Parque Nacional Yasuni, Francisco de Orellana province (ECU)
Estacion Bioldgica Jatun Sacha, Napo province (ECU)
Estacion Bioldgica Jatun Sacha, Napo province (ECU)
Darst et al. (2005)
Darst et al. (2005)
Biological Station Panguana, Huanuco province (PER) Toft (1980)
Biological Station Panguana, Huanuco province (PER) Toft (1980)
Remanso farm, Nova Xavantina, MT (BRA) Ramon et al. (2010)
Rancho Branco farm, Bodoquena, MS (BRA) This study
Biological Station Panguana, Huanuco province (PER) Toft (1980)
Juruti, PA (BRA)
Luiz et al. (2015)
“BRA, Brazil: PA, Para; MT, Mato Grosso; MS, Mato Grosso do Sul; GO, Goias; MG, Minas Gerais; ECU, Ecuador; PER, Peru.
95
We examined 61 specimens of Ameerega picta (Fig. 2),
50 of which (82%) had stomach contents. We identified
177 prey items in five prey categories belonging to the
classes Insecta and Arachnida. The most numerous prey
items in the diet composition of A. picta were Formicidae
(23%), Coleoptera (22%) and Diptera (16%) (Tab. 1). A
small variety of prey and high abundance of Formicidae
have been found in the diet of other populations of A. pic-
ta (Toft 1980; Ramon et al. 2010) and congeneric species,
such as A. bilinguis, A. braccata, A. flavopicta, A. hahne-
li, A. parvula, A. petersi and A. trivitatta (Toft 1980;
Biavati et al. 2004; Darst et al. 2005; Forti et al. 2011;
Luiz et al. 2015). The sequester of chemical defenses
from dietary sources 1s an important adaptation to the an-
ti-predator defense of dendrobatid frogs, as their diurnal
habits result in greater exposure to predators (e.g., Luiz
et al. 2015). The diet composition pattern of these species
of Ameerega is related to their dietary specialization on
ants, which are the source of the toxic alkaloids secreted
through the skin (Saporito et al. 2004; Darst et al. 2005;
Mebs et al. 2010). Some dendrobatid species that feeds
on ants and/or mites in higher proportions have been con-
sidered “ant-mite specialists” (Simon & Toft 1991; Toft
1995; Caldwell 1996). However, mites have been sug-
gested to be more important than ants as dietary sourc-
es of alkaloids in poison frogs (Saporito et al. 2007). In
the present study, we found high abundance of Formici-
Bonn zoological Bulletin 68 (1): 93-96
dae, Coleoptera and Diptera and absence of mites in the
diet composition of A. picta from region of the Serra da
Bodoquena, which seems to reflect the availability vari-
ation of these prey items in the habitats from which the
frogs were sampled.
Although Ameerega picta exhibits sexual dimorphism
in body size (Uetanabaro et al. 2008), we did not find
any significant difference between sexes regarding nu-
meric percentages per prey category. Differences in diet
composition between males and females are reported for
A. braccata and A. trivitatta (Forti et al. 2011; Luiz et al.
2015), which may be related to behavioral differences
that enable the partitioning of feeding resources between
SEXES:
We found only seven studies on the diet composition of
eight species of Ameerega (Tab. 2). The eight species of
Ameerega in the dietary studies analyzed correspond to
26% of the species in this genus, demonstrating that the
diet of most species of the genus is unknown. Therefore,
further studies should focus on species of Ameerega and
another dendrobatid species with undetermined diet in
order to improve the understanding of the trophic ecolo-
gy of the poison frogs.
Acknowledgments. The authors would like to thank the
Fundacéo Grupo Boticario de Protegéo a Natureza (process
#046820002) and project Padrées de biodiversidade da fauna
©ZFMK
96 Paulo Landgref Filho et al.
e flora do Pantanal (process #521746/97-3) for having provid-
ed both financial and logistical support during the fieldwork.
The Conselho Nacional de Desenvolvimento Cientifico e Tec-
nologico for having granted master’s scholarships to Domingos
J. Rodrigues (2000-2001) and Valdir who granted us access to
Assentamento Canaa and provided logistical support. We would
also like to thank Fabricio R.D. Fonseca, Rafael S. Arruda, Re-
nata S. Ledo and Tatiana S.F. de Souza for their assistance in
the field. Fabricio H. Oda receives a postdoctoral fellowship
from the Coordena¢gao de Aperfeigoamento de Pessoal de Nivel
Superior/Funda¢éo Cearense de Apoio ao Desenvolvimento
Cientifico e Tecnologico (grant n. 88887.162751/2018-00).
REFERENCES
Acosta Galvis AR (2017) Lista de los Anfibios de Colombia.
Online at http://www.batrachia.com/ (last access 20 April
2018)
Biavati GM, Wiederhecker HC, Colli GR (2004) Diet of Epipe-
dobates flavopictus (Anura: Dendrobatidae) in a Neotropical
Savanna. Journal of Herpetology 38: 510-518
Caldwell JP (1996) The evolution of myrmecophagy and its
correlates in poison frogs (Family Dendrobatidae). Journal
of Zoology 240: 75-101
Darst CR, Menéndez-Guerrero PA, Coloma LA, Cannatella DC
(2005) Evolution of dietary specialization and chemical de-
fense in poison frogs (Dendrobatidae): a comparative analy-
sis. American Naturalist 165: 56-69
Duellman WE (2005) Cusco Amazonico: The lives of amphib-
ians and reptiles in an Amazonian Rainforest. Comstock
Books in Herpetology, Cornell
Forti LR, Tissiani ASO, Mott T, Strissmann C (2011) Diet of
Ameerega braccata (Steindachner, 1864) (Anura: Dentro-
batidae) from Chapada dos Guimaraes and Cuiaba, Mato
Grosso State, Brazil. Brazilian Journal of Biology 71: 189-
1960
Frost DR (2019) Amphibian Species of the World: an Online
Reference, Version 6.0. http://research.amnh.org/herpetolo-
gy/amphibia/index.html/ (last access 26 March 2019)
Lima NGS, Eterovick PC (2013) Natural history of Ameerega
flavopicta (Dendrobatidae) on an island formed by Trés Ma-
rias hydroelectric reservoir in southeastern Brazil. Journal of
Herpetology 47: 480-488
Bonn zoological Bulletin 68 (1): 93-96
Luiz LF, Contrera FAL, Neckel-Oliveira S (2015) Diet and tad-
pole transportation in the poison dart frog Ameerega trivittata
(Anura, Dendrobatidae). Herpetological Journal 25: 187—190
Mebs D, Jansen M, Kohler G, Pogoda W, Kauert G (2010)
Myrmecophagy and alkaloid sequestration in amphibians: a
study on Ameerega picta (Dendrobatidae) and Elachistocleis
sp. (Microhylidae) frogs. Salamandra 46: 11-15
Ramon D, Fenker J, Calvao L, Pereira O, Marestoni T (2010)
Dieta e micro-habitat de duas espécies de anuros Rhinella
ocellata (Bufonidae) e Ameerega picta (Dendrobatidae),
Nova Xavantina-MT, Brasil. In: Programa de Pos-gradu-
acéo em Ecologia e Conservacao, Universidade do Estado de
Mato Grosso, Brazil. https://docplayer.com.br/8530067-Di-
eta-e-micro-habitat-de-duas-especies-de-anuros-rhinel-
la-ocellata-bufonidae-e-ameerega-picta-dendrobatidae-no-
va-xavantina-mt-brasil.html (last access 11 June 2019)
Saporito RA, Martin Garraffo H, Donnelly MA, Edwards AL,
Longino JT, Daly JW (2004) Formicine ants: an arthropod
source for the pumiliotoxin alkaloids of dendrobatid poison
frogs. Proceedings of the National Academy of Sciences of
the United States of America 101: 8045-8050
Saporito RA, Donnelly MA, Norton RA, Garraffo HM, Spande
TF, Daly JW (2007) Oribatid mites as a major dietary source
for alkaloids in poison frogs. Proceedings of the National
Academy of Sciences of the United States of America 104:
8885-8890
Simon MP, Toft CA (1991) Diet specialization in small verte-
brates: mite-eating in frogs. Oikos 61: 263-278
Scott Jr NJ, Woodward BD (1994) Standard techniques for in-
ventory and monitoring: Surveys at breeding sites. Pp. 118—
125 in: Heyer WR, Donelly MA, McDiarmid RW, Hayek
LC, Foster MS (eds) Measuring and monitoring biological
diversity: Standard methods for Amphibians. Smithsonian
Institution Press, Washington
Toft CA (1980) Feeding ecology of thirteen syntopic species
of anurans in a seasonal tropical environment. Oecologia 45:
131-141
Toft CA (1995) Evolution of diet specialization in poison-dart
frogs (Dendrobatidae). Herpetologica 51: 202—216
Uetanabaro M, Prado CPA, Rodrigues DJ, Gordo M, Campos Z
(2008) Guia de Campo dos Anuros do Pantanal Sul e Planal-
tos de Entorno. Editora UFMS/UFMT, Campo Grande
©ZFMK
Bonn zoological Bulletin 68 (1): 97-124
2019 - Bouarakia O. et al.
https://do1.org/10.20363/BZB-2019.68.1.097
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org:pub:B119E34D-9E27-47EF-99A0-051 ABA0E8268
Biogeographic history of Gerbillus campestris (Rodentia, Muridae) in Morocco
as revealed by morphometric and genetic data
Oussama Bouarakia'*, Christiane Denys’, Violaine Nicolas’, Touria Benazzout & Abdelaziz Benhoussa*
'° Laboratory ‘Biodiversity, Ecology and Genome’, Research Center ‘Plant and Microbial Biotechnology, Biodiversity and
Environment’, Faculty of Sciences, Mohammed V University in Rabat, 4 Avenue Ibn Battouta B.P. 1014 RP, Rabat, Morocco
?.3 Institut Systématique Evolution Biodiversité (ISYEB), Sorbonne Universités, MNHN, CNRS, EPHE, 57 Rue Cuvier, CP 51,
F-75005 Paris, France
* Faculty of Sciences, Mohammed V University in Rabat, 4 Avenue Ibn Battouta B.P. 1014 RP, Rabat, Morocco
* Corresponding author: Email: [email protected]
'urn:lsid:zoobank.org:author:7F7449 1 B-8506-4D56-8D03-4629 1 SCEO9F5
2urn:|sid:zoobank.org:author:FCD37439-1E9D-4FD2-A 845-E311603D45EF
3urn:Isid:zoobank.org:author:FA 1B1FA8-CB99-4CE8-B87A-F9B329ES5DFO07
*urn:Isid:zoobank.org: author: F33BA 104-53D9-4250-B807-744A6BCCBDDA
>urn:lsid:zoobank.org:author: A9B4B5A6-68D0-4BB3-9B99-683A 92EC6FD6
Abstract. Gerbillus campestris is a widely distributed small rodent that lives in various habitats in North Africa and can be
a potential agricultural pest. We conducted a biogeographic study of this species with an integrative approach using mor-
phometric data from body and craniomandibular distances and molecular genetic data from the cytochrome b gene of the
mitochondrial DNA. We collected 96 individuals in six localities from central, northern and eastern Morocco. Data from
18 morphological characters were used in multivariate statistical analyses and molecular data were analysed using maxi-
mum likelihood and median-joining networks. Our analyses confirmed the high morphological variability in this species
and allowed to discriminate four groups containing the studied populations. We found that a few craniomandibular measu-
rements had the highest contribution in the differences between populations, and that this variability reflected a spatial and
environmental differentiation. In the genetic analyses, we placed our six populations and six individuals from four other
countries in nine previously identified phylogenetic lineages in this species, and we also added a tenth lineage. Limited
gene flow, isolation by distance and biogeographic barriers were further explored to explain this genetic structuration. We
also jointly examined morphometric and genetic variability and found that the morphological groups were congruent with
the genetic lineages and the geographic distribution. A better knowledge of the phenotypic plasticity and genetic diversity
of this gerbil can be used to comprehend the micro-evolutionary processes in other small mammals in North Africa.
Key words. North Africa, cytochrome b gene, craniometry, populations, Gerbillinae, agriculture.
INTRODUCTION
The Gerbillinae subfamily and the genus Gerbillus are
the most diverse group of rodents in North Africa. Like
other small rodents, the species of this genus represent
suitable models for the construction of biogeographic his-
tory thanks to their brief generation time and prolific re-
production rates; their rather limited dispersion capacities
and strong affiliation to arid and/or open habitats (Avise
2000; Nicolas et al. 2009). A few recent molecular studies
have attempted to review the systematics of the various
species of Gerbillus inhabiting North Africa and Moroc-
co, or to better understand their biogeography (Abiadh
et al. 2010; Ndiaye et al. 2012, 2013a, 2016; Nicolas
et al. 2014; Bouarakia et al. 2018). Among this genus, the
most widespread species in Morocco 1s the North African
Gerbil, Gerbillus campestris Loche, 1867, which is also
considered as an agricultural pest (Giban & Haltebourg
Received: 14.01.2019
Accepted: 04.02.2019
1965; Ouzaouit 1980; Zyadi & Benazzou 1992). It is a
long tailed, middle sized gerbil, with naked hind feet, that
lives throughout the Mediterranean part of North Africa
from Egypt, west of the Nile River and Delta, to Morocco
in the West. It is also present but less widely distributed in
the Sahara Desert and Sahel region, in Sudan, Niger and
Mali (Happold 2013; Granjon et al. 2016; Denys et al.
2017). The species dwells in different habitats, from sub-
humid to arid and desertic regions, except high moun-
tains, forests and sandy desert areas. It occupies steppes,
arable lands, rocky habitats and oases; and digs its bur-
row in sandy or clay soils (Petter & Saint Girons 1965;
Happold 1967; Aulagnier & Thevenot 1986; Kowalski &
Rzebik-Kowalska 1991; Dobigny et al. 2002; Musser &
Carleton 2005; Aulagnier et al. 2017).
Previous studies have investigated the intraspecific
variability of Gerbillus campestris. Petter & Saint-Gi-
rons (1965) suggested the subdivision of the species in
Corresponding editor: R. Hutterer
Published: 13.06.2019
98 Oussama Bouarakia et al.
Morocco into to two subspecies based on coloration cri-
teria. In Tunisia, due to geographic variation in size, the
existence of two subspecies was suggested (Ranck 1968:
Jordan et al. 1974). By combining the variation of skull
size and characters, external size and pelage colour, two
to five subspecies were identified in Egypt, Libya and Su-
dan (Setzer 1958; Ranck 1968; Osborn & Helmy 1980).
Benazzou & Zyadi (1990) and Baala (1995) displayed
the presence of a geographic biometric variation between
five populations in Morocco, while Baala (1995) showed
the absence of biochemical polymorphism between these
five populations. On a chromosomal level, the most com-
mon diploid number of chromosomes for G. campestris
is 2n = 56. This karyotype is present in Algeria, Tunisia,
Egypt, Mali and Niger (Matthey 1952; Wassif et al. 1969;
Jordan et al. 1974; Dobigny et al. 2001, 2002). However,
chromosomal polymorphism was documented in Moroc-
co with 2n = 56 in Taroudant locality and 2n = 57, 58 in
Goulimine locality (Lay et al. 1975). More recently, Nico-
las et al. (2014) presented a complex phylogeographic
pattern in Morocco and North Africa using cytochrome
b sequences. The wide distribution of G. campestris, the
multiplicity of habitats tt occupies, the rich geographic
diversity of the region and the extreme environmental
changes that occurred in North Africa during the Pleisto-
cene, parallel this important intraspecific diversity.
To complete the phylogeographic structuration uncov-
ered by Nicolas et al. (2014), we increased sample size
@:
e:
a:
e:
*:
a:
a:
wa:
@:
Mauritania
Senegal @
Oe,
in three localities and added three new ones in Morocco,
to perform a study of genetic variability based on the cy-
tochrome b gene of the mitochondrial DNA. The addi-
tional sampling from north-western Morocco helped us
to explore the existence of barriers to gene flow in this
part of Morocco, namely the Sebou River. In addition,
the new sampling from north-eastern Morocco on both
the eastern and western sides of the Moulouya River was
useful to investigate the role of the Moulouya River and/
or its arid valley as a major geographic barrier and to ver-
ify the suggested east-west genetic differentiation around
this river (Nicolas et al. 2014; Lalis et al. 2016; Beddek
et al. 2018). We also included samples from GenBank
from four new localities (Mali, Tunisia, Libya and Egypt)
to better identify past gene flow in other parts of the dis-
tribution range of the species.
Furthermore, we used body and craniomandibular dis-
tance-based measurements of genetically typed individu-
als from six localities from central, northern and eastern
Morocco in a comparative study of morphometric vari-
ability, to explore the influence of spatial, geographic and
environmental factors on phenotypic diversity. Finally,
we jointly examined the morphological and genetic inter-
population variability to verify their congruence in defin-
ing the biogeographic history of the species in Morocco.
Chad
Fig. 1. Map displaying the geographic range (grey area, as mentioned by Granjon et al. 2016) of Gerbillus campestris and the dis-
tribution of the ten mitochondrial lineages. Dotted lines surround the geographic groupings of five lineages (1, 2, 3, 4 and 6). Based
on Nicolas et al. (2014), only the localities of Mali and Niger were included in the geographic grouping of lineage 2. Localities from
the present work (CHR, ANT, KTR, MZ, GCF, FRT) and from bibliography (numbered from | to 28) are indicated (see Appendix
I). Localities 14, 16, 20, 23 and 24 shelter haplotypes from both lineages 1 and 3. Moulouya, Sebou, Niger and Nile Rivers are also
shown in the map.
Bonn zoological Bulletin 68 (1): 97-124
©ZFMK
Biogeographic history of Gerbillus campestris 99
MATERIAL AND METHODS
Sampling. We collected 96 specimens of Gerbillus
campestris between 2011 and 2015 in six localities in
Morocco from various regions: 10 specimens in the
Tingitane peninsula in Chrouda locality (named hereafter
CHR); 13 in central Morocco in Aounate locality (ANT);
24 in Kenitra (KTR) and 25 in Merja Zerga (MZ) in the
Gharb region north of the Sebou River; five in Guercif
(GCF) on the west side of the Moulouya River and 19 in
Fritissa (FRT) on the east side of the river in the Oriental
region (Fig. 1, see Appendix I). We captured the animals
alive using Sherman traps then we euthanized them by
cervical dislocation. This protocol was approved by the
Cuvier (Museum National d’Histoire Naturelle, Paris)
ethics committee. We extracted a piece of the liver for
the genetic study and preserved the carcasses in formal-
dehyde. Later, we extracted and prepared the skulls for
the morphometric study. Then, we deposited voucher
specimens in the collections of the Laboratory ‘Biodi-
versity, Ecology and Genome’ of the Faculty of Sciences
of Rabat, except those from the Chrouda locality, that
are preserved in the collections of the Museum National
d’ Histoire Naturelle of Paris (see Appendix I).
Morphometric study. We used the standard body mea-
surements, head-body length (HB), tail length (T), hind
feet length (HF), ear length (E), weight (WT) and the
ratio of tail length to head-body length (%T). Using a
Mitutoyo caliper accurate to 0.01 mm, we took 10 skull
measurements (mm) on dorsal, ventral and lateral view
of the skull. We also took three mandibular measure-
ments (mm). Abbreviations of these craniomandibular
values are as follows: greatest length of skull (GLS),
width of the zygomatic arch (WZYG), breadth of brain-
case (BB), length of nasals (LN), least interorbital con-
Table 1. Geographic data for the six localities studied in Morocco.
striction (IO), occipital height from the tympanic bulla
to the parietal-interparietal suture (HOCC), length of
anterior palatine foramina (LAF), length of upper molar
series (M1M3), width of the palate between the first two
molars M1 at the anterocone (WP), diagonal length of
tympanic bulla (LTB), length of the mandible from the
tip of the lower incisor to the angular process (LMDB),
height of the mandible taken above the mandibular con-
dyle (HMDB), length of lower molar series (LM1MS3).
The body and skull variability in each population was
first calculated using descriptive statistics (minimum,
maximum, mean, standard deviation). Multivariate
analyses were conducted on log transformed body and
craniomandibular measurements to make them more ho-
mogenous. To represent the body and skull variability we
performed a principal component analysis (PCA). The
results of the PCA were analysed to identify the factors
influencing the structure of the data point clouds as visu-
alized in the bi-plot graphs of the analyses.
A multivariate analysis of variance (MANOVA) was
made to test the sexual dimorphism for the body and
skull variables. We made another MANOVA to test the
effect of the “locality” variable on the measurements.
The standard significance threshold for the MANOVA
was set at 5%. To visualize the morphological variability
without the influence of sex, we performed a PCA sepa-
rately within each sex. We also conducted a discriminant
function analysis (DFA) within each sex to quantify the
rate of discrimination based on the “locality” variable. In
this DFA, we did not include the two individuals of CHR
locality. An additional DFA was conducted on the data of
the combined sexes to quantify the rate of discrimination
based on the “locality” variable, and to identify the mea-
surements that best categorise morphological variabili-
ty. Finally, we tested the influence of altitude, latitude,
longitude and annual precipitations using MANOVA
Locality Altitude (m) Latitude Longitude Precipitations (mm)
Chrouda
(CHR) 209 35.360 -5.170 795
Aounate
(ANT) 185 32.746 -8.244 317
Kenitra
(KTR) 43 34.445 -6.520 579
Merja Zerga
(MZ) 25 34.817 -6.310 622
Guercif
(GCF) 410 34.206 -3.424 222
BritissA 510 34.161 3.231 218
(FRT) ae
Bonn zoological Bulletin 68 (1): 97-124
©ZFMK
100 Oussama Bouarakia et al.
(Tab. 1). All statistical analyses were performed using the
software XLSTAT version 2016 (Addinsoft 2012).
To minimize age-related bias, two individuals were
excluded from the statistical analyses because they were
identified as juveniles. This age estimation was done us-
ing the dental wear scheme of the upper molar series es-
tablished by Zyadi (1989) and the age classes based on
weight made by Zyadi & Benazzou (1992). Also, in all
the multivariate analyses, we did not include 11 tndivid-
uals due to missing data in the measurements.
Molecular study. We extracted and purified the DNA
of the 96 individuals using the QIAGEN Kit (DNeasy
Blood & Tissue Kit) following the manufacturer recom-
Table 2. Body measurements of Gerbillus campestris in six populations in Morocco. Abbreviations: head-body length (HB); tail
length (T); hind feet length (HF); ear length (E); weight (WT); ratio of tail length to head-body length (%T); sample size (N); min-
imum (Min); maximum (Max); standard deviation (S.d.).
Chrouda Aounate’ Kenitra Merja Zerga Guercif — Fritissa All popula-
(CHR) (ANT) (KTR) (MZ) (GCF) (FRT) Hows
N 2 12 24 24 5 19 86
ye OMin 95 83 83 78 81 89 78
Max 105 103 103 98 116 108 116
(mm) Mean — 100.00 92.33 94.42 90.87 102.40 98.37 94.60
S.d 7.07 7.02 5.72 4.75 14.54 6.49 ROT
N 2 12 22 24 5 18 83
7 Min 109 99 94 93 106 11 93
Max 119 117 112 117 149 134 149
(mm) Mean 114.00 110.64 106.27 107.54 126.80 121.33 112.29
S.d 7.07 5.16 5.07 5.59 18.40 7.07 10.09
N 2 12 24 24 5 19 86
We Min 26 23 23 23 24 25 23
Max 28 26 25 26 29 28 29
(mm) Mean 27.00 24.67 24.52 24.44 25.60 26.55 25.09
S.d. 1.41 0.78 0.60 0.71 2.07 0.88 1.33
N 2 12 24 24 5 19 86
: Min 12 13 14 13 1 15 if
Max 15 16 16 16 16 18 18
(mm) Mean 13.50 14.92 15.10 14.56 14.00 16.18 15.06
S.d D9 1.16 0.77 0.68 1.87 0.80 1.14
N 2 12 24 24 5 19 86
wr Min 34 16.8 17.8 16 18 22.5 16
Max 40 32 35 25 37.5 36.5 40
(8) Mean 37.00 377 24.85 20.57 29.00 28.13 24.75
S.d 4.24 5,37 4.52 2.55 8.31 4.66 5.60
N 2 12 22 25 5 18 83
Min 104 11 97 99 117 104 97
%T Max 125 131.5 131 144 131 138 144
Mean 114.54 Wise 113,09 118.72 123.96 123.72 119.08
S.d. 15.17 6.98 9.17 8.77 5.96 10.03 9.97
Bonn zoological Bulletin 68 (1): 97-124 ©ZFMK
Biogeographic history of Gerbillus campestris 101
mendations. Then we amplified the cytochrome b gene
(1040 bp) via polymerase chain reaction (PCR) using
the primers L7 (ACC AAT GAC ATG AAA AAT CAT
CGT T) and H15915 (TCT CCA TTT CTG GTT TAC
AAG AC) (Ducroz et al. 2001). The PCR included an
initial denaturation step of 3 min at 94°C, followed by
38 cycles of 30 sec at 94°C, 40 sec at 52°C, and 90 sec at
72°C, with a final extension step of 5 min at 72°C. Dou-
ble-stranded PCR products were purified and sequenced
by Eurofins. We checked the chromatograms then we
corrected and aligned the sequences both manually and
using ClustalW in the software BioEdit (Hall 1999). To
attain the genetic identification, we entered the sequenc-
es into the Basic Local Alignment Search Tool (BLAST,
https://blast.ncbi.nim.nih.gov/Blast.cgi). All the se-
quences were submitted to GenBank (see Appendix I).
To choose the model of nucleotide substitution for our
phylogenetic analysis, we used the software jModeltest
2.1.10 (Darriba et al. 2012). The General time reversible
(GTR)+I+G model (Gu et al. 1995) was determined as
the best-fit model of nucleotide substitution, according
to the Akaike information criterion (Akaike 1973). We
constructed a phylogenetic tree using the Maximum
Likelihood method (ML) in the software MEGA 7.0.26
(Tamura et al. 2013). The robustness of the obtained to-
pologies was estimated in all the treatments using a boot-
strap analysis (1000 replicates). We included in the mo-
lecular analysis all the cytb sequences of G. campestris
present in the GenBank database (108 sequences). We
removed the beginning and the end of all the sequences
used in the analysis because these parts of the sequences
were missing in many specimens from GenBank, and we
maintained a fragment of 1033 pb. We rooted the phy-
logenetic tree with one representative from each of the
three subgenera of Gerbillus: G. simoni for the subge-
nus Dipodillus, G. hesperinus for the subgenus Gerbil-
lus and G. henleyi for the subgenus Hendecapleura (see
Appendix I). We also used the Median Joining algorithm
through the software NETWORK version 4.500 (Bandelt
et al. 1999) to estimate evolutionary relationships among
the haplotypes. Finally, the Pairwise Kimura two-param-
eter (K2P) genetic distances (Kimura 1980) between the
lineages were computed using MEGA 7.0.26 (Tamura
et al. 2013).
RESULTS
Morphometric study. In the descriptive statistics of the
body and craniomandibular measurements, we observe
the existence of a variability between the six populations
(Tabs 2-3). In general terms concerning body and cranio-
mandibular size, the highest mean values belong to the
populations of CHR, GCF and FRT; while the lowest
mean values belong to the populations of ANT, KTR and
MZ.
Bonn zoological Bulletin 68 (1): 97-124
Variables (axes F1 and F2: 74,59 %)
F2 (10,08 %)
/
7 \
als
=\'5)
=
-0,75
F1 (64,52 %)
Fig. 2. Correlation circle obtained by the principal component
analysis (PCA) of the body and craniomandibular variables in
the factor space of (F1 and F2).
Observations (axes F1 and F2: 74,59 %)
2 Mz «TR,
ama MZ ® op on
* + +
an® en Gen ¢ .
an! 2 Nz gW2 ¢ 2¢ KTR Wir | Chi
3 , 2 eee. Je ae Far *¢ & ¢
Z uz
So -—Y dy 3 # __eM te ¥, = » oe: ;
a KTR mz ig +, rity ‘mn * e
f 1 wz ® +. we em | “ Piss og, FRT RT
on ant + + we +
2 uz @ li Pi +
ant + Sar +
3 ant ® ANT +
4 co @ aE
F1 (64,52 %)
Fig. 3. Projection of individuals on the first two axes (F1 and
F2) of the principal component analysis (PCA). Different co-
lours represent different localities (Chrouda: black; Aounate:
green; Kenitra: blue; Merja Zerga: red; Guercif: orange; Fri-
tissa: purple).
For the PCA, we visualize in the correlation circle,
the first two axes F1 and F2 that represent respectively
64.52% and 10.08% of the total variance (Fig. 2). The
projection of the 18 body and craniomandibular variables
on the F1xF2 plane shows that the F1 axis is positively
©ZFMK
102 Oussama Bouarakia et al.
Table 3. Craniomandibular measurements of Gerbillus campestris in six populations in Morocco. Abbreviations: greatest length of
skull (GLS), width of the zygomatic arch (WZYG), breadth of braincase (BB), length of nasals (LN), least interorbital constriction
(IO), occipital height from the tympanic bulla to the parietal-interparietal suture (HOCC), length of anterior palatine foramina
(LAF), length of upper molar series (M1M3), width of the palate between the first two molars M1 at the anterocone (WP), diagonal
length of tympanic bulla (LTB), length of the mandible from the tip of the lower incisor to the angular process (LMDB), height of
the mandible taken above the mandibular condyle (HMDB), length of lower molar series (LM1M3); sample size (N); minimum
(Min); maximum (Max). standard deviation (S.d.).
Chrouda Aounate Kenitra Merja Zerga Guercif Fritissa All popula-
(CHR) (ANT) (KTR) (MZ) (GCF) (FRT) tions
N 2 m2 24 24 5 19 86
Min 28.77 25.42 25.66 25.36 26.98 28.09 25.36
GLS Max 32.66 29:77 28.63 28.98 31.07 31.74 32.66
Mean DO: ial 27.90 27.43 Zee 29.68 30-12 28.23
S.d. 2S 1.36 0.83 0.80 Pero 1.02 1.62
N Z 12 24 24 5 19 86
Min 12.5 10.77 10.81 10.01 10.97 12 10.01
WZYG Max 13.8 12.64 12.4 1225 13.26 37 13.8
Mean 13.15 11.81 11.62 29 1232 12.83 11.90
S.d. 0.92 0.61 0.47 0.49 0.97 0.53 0.81
N 2 12 24 24 5 19 86
Min 13.82 12.83 12:57 1259 13.34 13.69 1257
BB Max 14.53 14.18 13.55 13.65 15.59 15.27 15°39
Mean 14.17 13.52 13.13 [elk 14.57 14.24 13,55
S.d. 0.50 0.42 0.26 0:33 0.85 0.41 0.64
N 2 12 24 24 5 19 86
Min 11.26 10.09 10.09 9.84 10.43 11.08 9.84
LN Max | Bee | 12.12 | ae bE73 12.87 13.08 [354
Mean 12.38 27 ha3 11.00 11.89 12,32 11.45
S.d. 159 0.67 0.49 0.48 1.10 0.49 0.79
N 2 12 24 24 5 19 86
Min 5.24 4.52 4.62 4.55 4.88 5.01 4.52
IO Max 5.8 5.43 5:2 5.46 5.63 5.94 5.94
Mean 5:52 5.00 491 4.99 5.29 5.43 5.10
S.d. 0.40 0.27 0.14 0.20 0.27 0.25 0.30
N Z 12 24 24 5 19 86
Min Pi2 10.42 9.94 10.05 10.71 11.11 9.94
HOCC Max 11.44 11.06 10.87 10.89 11.91 11.94 11.94
Mean [132 10.82 10.44 10.44 11.24 11.43 10.78
S.d. 0.17 0.21 0.26 0.26 0.47 (23 0.49
N 2 12 24 24 5 19 86
Min B22 4.44 42 4.42 4.38 49 42
LAF Max 5.64 5:29 5.69 5.65 5:52 6.08 6.08
Mean 5.42 4.97 23 S33 5.16 5.46 Rees
S.d. 0.31 0.29 0.35 0.31 0.48 0.32 0.36
Bonn zoological Bulletin 68 (1): 97-124 ©ZFMK
Biogeographic history of Gerbillus campestris
Table 3. (continued)
Chrouda Aounate Kenitra
(CHR) (ANT) (KTR)
N 2 12 24
Min 4.21 3:71 3.38
M1M3 Max 4.22 4.2 3.89
Mean 4.21 3.89 3.64
S.d. 0.01 0.14 0.12
N 2 12 24
Min 3.02 2.66 2.88
WP Max Bie 3.2 3.54
Mean Boy. 2.99 3.19
S.d. 0.36 0.17 0.16
N 2 12 24
Min 8.11 8.14 8.14
LTB Max Isl 8.95 8.91
Mean 8.60 8.71 8.44
S.d. 0.70 0.25 0.18
N 2 12 24
Min 16.37 14.42 14.77
LMDB Max 18.56 17.18 6.3
Mean 17.46 16.05 15.81
S.d. L55 0.89 0.50
N Z 12 24
Min 6.67 6.31 6.23
HMDB Max 7.81 7.49 7.44
Mean 7.24 6.92 6.85
S.d. 0.81 0.37 0.28
N 2 12 24
Min SAS B99 3.27
LM1M3 Max 4.05 4.03 3.66
Mean 3.90 3.81 B55
S.d. 0.21 0.13 0.10
correlated with all the variables, which indicates a size
axis. On the other hand, several variables are positive-
ly correlated with the F2 axis, while several others are
negatively correlated with this axis. The most strongly
positively correlated variable with the F2 axis is the vari-
able WP, with a correlation value of 0.69. The scatter plot
of the PCA (Fig. 3) does not allow to visualize different
distinct groups, but all the specimens from FRT and CHR
and virtually all those from GCF are located on the pos-
itive side of the Fl axis. Contrarily, the specimens from
Bonn zoological Bulletin 68 (1): 97-124
103
Merja Zerga Guercif Fritissa All popula-
(MZ) (GCF) (FRT) tions
24 5 19 86
3.41 Boo 3.76 3.38
3.86 4.27 4 36 4 36
3.65 4.13 4.07 3.81
0.11 0.11 0.15 0.24
24 5 19 86
ZAS 2.85 2:95 2.66
3.54 3.41 3.58 3.58
3.19 3.18 3.23 SF
0.17 22 0.18 0.19
24 5 19 86
7.89 8.55 8.85 7.89
8.87 9.87 75 9.87
8.44 925 9.36 8.73
0.24 0.49 G27 0.46
24 5 19 86
14.71 13.32 16.26 14.42
16.8 18.35 hSe35 18.56
15.71 Aral Z 78 16.22
0.52 1.38 0.63 0.92
24 5 19 86
6.42 6.58 7.04 6:23
7.61 7.74 8.26 8.26
6.94 7.28 ee | HOT
0.30 0.50 0.36 0.42
24 5 19 86
3.3 3.8 3.74 Si2t
3.64 4.15 4.13 4.15
3.50 3 OF 32, 3.68
0.11 O12 0.10 O22.
MZ and KTR are located mainly on the negative side of
F1. Specimens from ANT show high size variation.
Among the 83 individuals (55% males, 45% females),
the average size of females seems somewhat larger than
the one of males, and the Wilks’ test in the MANOVA
showed the existence of sexual dimorphism (Wilks’ ) =
0.598, F statistics = 2.386, DF, = 18, DF, = 64, p< 0.05),
which means that sex has a slightly significant influence
on the dispersal of the observations on the PCA. For the
PCA of the male individuals, we visualize the scatter plot
of the two first axes F1 and F2 that represent respective-
©ZFMK
104 Oussama Bouarakia et al.
Variables (axes F1 and F2: 81,36 %)
F2 (10,68 %)
F1 (70,68 %)
Fig. 4. Correlation circle obtained by the discriminant function
analysis (DFA) of the body and craniomandibular variables in
the factor space of (F1 and F2).
ly 66.45% and 10.17% of the total variance (see Appen-
dix IT). For the PCA of the female individuals, we visu-
alize the scatter plot of the two first axes Fl and F2 that
represent respectively 62.55% and 13.46% of the total
variance (see Appendix II). In both the PCA of males
and females, the Fl axis is positively correlated with
all the variables indicating a size axis; with the cranio-
mandibular measurements HOCC, LTB, WZYG, BB,
LN, HMDB, LMDB and GLS being the most strongly
correlated variables with F1 (values ranging from 0.83
to 0.98). In both scatter plots (males and females), indi-
viduals from MZ and KTR are the smallest, while those
from FRT are the largest. Male individuals from GCF are
almost as large as the individuals from FRT, while the
female individuals from GCF have a high size variation.
Male individuals from ANT show a medium size and the
females show high size variation. The male individual
from CHR 1s one of the largest individuals and the female
from CHR has a medium size. In the DFA, we were able
to quantify the discrimination between five populations
within each sex: in the males, 100% of the individuals of
ANT were correctly classified, 86.67% for KTR, 81.25%
for MZ, 100% for GCF and 100% for FRT; while in the
females, 100% of the individuals were correctly classi-
fied in each one of the five populations.
The Wilks’ test in the MANOVA revealed the presence
of a highly significant morphological difference between
the various localities (Wilks’ 2 = 0.01, F statistics =
5.146, DF, = 90, DF, = 296, p < 0.0001). According to
Bonn zoological Bulletin 68 (1): 97-124
this result, we performed a discriminant function analysis
(DFA) to quantify the morphological variability based on
a locality effect. In the correlation circle (Fig. 4), the first
two axes Fl and F2 of the DFA represent respectively
70.68% and 10.68% of the total variance. The projec-
tion of the 18 body and craniomandibular variables on
the F1xF2 plane shows that the F1 axis 1s positively cor-
related with all the variables except WP (-0.02). In the
F1 axis, the most discriminating variables are LM1M3
(0.91), HOCC (0.88), M1M3 (0.87), LTB (0.82), BB
(0.80) and GLS (0.75).
Observations (axes F1 and F2: 81,36 %)
F2 (10,68 %)
F1 (70,68 %)
Fig. 5. Projection of individuals on the first two axes (F1 and
F2) of the discriminant function analysis (DFA). Different sym-
bols represent different localities. Also shown are confidence
circles for each locality using covariance hypothesis.
On the scatter plot of the two first axes of the DFA
(Fig. 5), although some overlap can be observed, we can
distinguish four major groups:
— Group I composed of the individuals of Merja Zerga
(MZ) and Kenitra (KTR);
— Group II composed of the individuals of Aounate
(ANT);
— Group III composed of the individuals of Guercif
(GCF) and Fritissa (FRT);
— Group IV composed of the individuals of Chrouda
(CHR).
This structuration is integrated by the F1 axis that iso-
lates Group I on the negative side of the axis and Groups
III and IV on the positive side, while Group IJ is located
in an intermediate position along this axis. The F2 axis
allows a complete separation between Group IV and
Group III. The DFA has also allowed to quantify the dis-
crimination between the six populations: 100% of the
©ZFMK
Biogeographic history of Gerbillus campestris 105
Lineage 6 (Morocco)
Lineage 4 (Tunisia,
Algeria, Morocco)
Lineage 8 (Morocco)
Lineage 7 (Morocco)
Lineage 10 (Mali)
Lineage 1 (Morocco)
Lineage 3 (Morocco)
Lineage 2 (Egypt, Libya,
Niger, Mali)
Fig. 6. Phylogenetic tree of Gerbillus campestris for the cytochrome b gene resulting from the Maximum-Likelihood analysis
(GTR +1I+G substitution model). Numbers at nodes represent ML bootstrap support. To improve clarity, values of the most apical
nodes are not shown. The scale bar represents the branch length measured in the number of substitutions per site. The ten mitochon-
drial lineages are presented on the right border along with their geographic origin.
Bonn zoological Bulletin 68 (1): 97-124 ©ZFMK
106 Oussama Bouarakia et al.
individuals of ANT were correctly classified, 86.4% for
KTR, 87.5% for MZ, 80% for GCF, 100% for FRT and
100% for CHR.
Based on the results of the MANOVA, all the geo-
graphic parameters (altitude, latitude, longitude, annual
precipitations; Tab. 1) have a highly significant effect:
Wilks’ A = 0.01, F statistics = 5.146, DF, = 90, DF, =
296, p < 0.0001). A supplementary observation concern-
ing the body variation between our suggested morpho-
metric groups is the difference of dorsal coat colour,
being dark brown for Group I, II and IV; and yellowish
brown for Group HI.
Molecular study. Based on the results of the phyloge-
netic tree (Fig. 6) and the haplotypes network (Fig. 7),
the individuals from the six localities belong to four of
the nine phylogenetic lineages previously identified by
Nicolas et al. (2014):
— All the ten individuals from Chrouda (CHR) are found
in lineage 7, which was previously composed of four
specimens from this same locality.
— All the 13 individuals from Aounate (ANT) are found
in lineage 1, which is widely distributed in Morocco
and contains specimens from many localities south of
the Bou Regreg River.
— All the 24 individuals from Kenitra (KTR) and the 25
individuals from Merja Zerga (MZ) are found in lin-
eage 6, that was previously composed of only nine
specimens from Merja Zerga.
— All the five individuals from Guercif (GCF), west of
Moulouya River, and the 19 individuals from Fritissa
(FRT), east of Moulouya River, are found in lineage 4
that previously contained only specimens from the east
of this river (Morocco, Algeria and Tunisia).
Moreover, we have added three individuals from Egypt
(Khalifa et al. 2018) and one from Libya (Chevret et al.
2014) to lineage 2, that was previously composed only
of specimens from Niger and Mali (Tessalit and Adrar
des Iforas localities). We also added one individual from
Tunisia (Alhajeri et al. 2015) to lineage 4. Furthermore,
we have attributed one individual from Mali (Sinkerma
locality) (Schwan et al. 2012) to a new suggested lineage
10. The K2P genetic distance between lineage 10 and the
other lineages goes from 1.4% with lineage 8, to 2.6%
with lineage 2.
DISCUSSION
Morphological adaptation. The results of the morpho-
metric study revealed a significant morphological vari-
ability among Gerbillus campestris in Morocco. The
significant difference in the MANOVA testing the effect
of “locality” variable; and the relatively high rate of dis-
Bonn zoological Bulletin 68 (1): 97-124
crimination of the DFA indicates a spatial structuration
between populations. This structuration was represented
by Group I (Merja Zerga and Kenitra populations), Group
II (Aounate population), Group III (Guercif and Fritissa
populations) and Group IV (Chrouda population). The
parameters that contribute the most to this clustering are
the lower and upper molar series length, the skull height,
the tympanic bulla length and the braincase breadth. The
variation of these parameters shows a gradual increase in
size, from Group I being the smallest, to Group IV and
Group III being the largest; while Group IT has a medium
size. In Morocco, a few previous studies were made on
the geographic variation in biometrics for G. campestris
(Benazzou & Zyadi 1990; Baala 1995). Apart from the
Kenitra locality, they showed for different localities than
Ours an interpopulational variation in size, with Kenitra
being the smallest. Another type of body variation re-
ported in Morocco was related to the dorsal coat colour,
being fawn grey in the northern regions and gradually
brightening towards the south, until becoming light fawn
in desertic habitats (Petter 1961).
In our study, the morphological variability was slightly
influenced by sex, as we showed in the MANOVA the
existence of a weak sexual dimorphism when males and
females were analysed together. The PCA of the variabil-
ity within each sex shows almost similar results between
males and females; and roughly a similar distribution of
individuals in the F1xF2 plane. Also, there is a strong rate
of discrimination between the populations within each
sex. All these reasons support a weak influence of sex
on the clustering of our populations in distinct groups. In
the precedent study of G. campestris in Morocco, Baala
(1995) found no significant sexual dimorphism in five
populations. In Tunisia, Jordan et al. (1974) found sex-
ual difference in only one character. Additionally, sexual
dimorphism has seldom been confirmed in Muridae ro-
dents using classical morphometric analysis (Csanady &
Mo8ansky 2018). Thus, larger samples from each pop-
ulation are needed to verify if the minor sexual dimor-
phism that we uncovered is not due to sampling bias.
The morphometric structuration that we showcased in
G. campestris 1s explained by the wide distribution of
this species in Morocco and the vast environmental di-
versity of this country. The significant differences found
in the MANOVA for the geographical factors (altitude,
latitude, longitude, precipitations) give more explanation
to support this spatial and environmental differentiation.
A similar result was found for Rattus rattus in Tunisia,
where latitude, longitude, altitude and precipitation vari-
ables exhibited a significant control on size parameters
(Ben Faleh et al. 201 2a).
Our different populations are located in diverse bio-
climates: subhumid for Group I (Kenitra and Merja
Zerga) and Group IV (Chrouda), semi-arid for Group II
(Aounate) and arid for Group III (Guercif and Fritissa)
(Mokhtari et al. 2013). The influence of varying biocli-
©ZFMK
Biogeographic history of Gerbillus campestris 107
Fig. 7. Minimum spanning network of Gerbillus campestris for the cytochrome b gene haplotypes. Circle sizes are proportional
to the number of similar haplotypes observed in the data set. Branch lengths are proportional to the number of mutations between
haplotypes. The dashed ellipses (added for clarity) represent the ten mitochondrial lineages.
Bonn zoological Bulletin 68 (1): 97-124 ©ZFMK
108 Oussama Bouarakia et al.
mates and rainfall patterns on the populations acts indi-
rectly through the availability and type of food resources
(Yom-Tov & Geffen 2011; Breno et al. 2011). Previous
studies showed an influence of climate on the skull of
rodents, through variations in the type and availability of
food (Renaud et al. 2005; Samuels 2009). The quality and
quantity of food were shown to influence growth rates
and skull morphology in the multimammate rat, Mas-
tomys natalensis (Lalis et al. 2009; Breno et al. 2011). In
the muskrat, Ondatra zibethicus, the high availability of
food to each individual accelerated its growth, but if food
was less abundant, there was an extension of the growth
phase and an increase in growth variability (Pankakos-
ki et al. 1987). Pocket gophers inhabiting alfalfa crops
had larger body and skull size compared to those living
in natural dry environments (Patton & Brylski 1987). In
another example, a high difference in protein content in
the diet of captive rats, Rattus norvegicus, caused a clear
modification in adult skull shape but much less modifi-
cation in the adult body and skull size (Miller & German
1999; Reichling & German 2000). However, squirrel
monkeys, Saimiri sciureus that were fed a diet varying in
protein content had different skull sizes but similar shape
(Ramirez Rozzi et al. 2005). Surprisingly in our study,
the individuals of Kenitra and Merja Zerga are the small-
est even if they occupy the fertile agricultural fields of
the Gharb region, characterized by high food availability
and the abundance of peanut crops known to be rich in
protein; as opposed to the individuals of Guercif and Fri-
tissa, that are the largest even if they occupy habitats with
low food availability in the Oriental region.
Food hardness, too, has an influence on skull devel-
opment. This is an important factor of differentiation
between our suggested morphometric groups, especially
that the most discriminating variables in the DFA are the
lower and upper molar series length. It was established in
various species of rodents that skull morphology can be
associated with the structure of food. In the prairie deer
mouse, Peromyscus maniculatus, a softer diet caused a
reduction in size of the masseteric tubercles and a nar-
rowing of the zygomatic plate (Myers 1996). In laborato-
ry rats, individuals feeding on a soft diet suffered a 12%
loss of the mass of the skull and mandible, 4% decrease in
the length of the angular process and 1% to 2% decrease
in the dimensions of the cranial and facial skeleton, com-
pared to the individuals feeding on a normal diet (Moore
1965). Other studies performed on rats demonstrated that
maxillary breadth was markedly increased in the hard-di-
et reared individuals (Beecher & Corruccini 1981); that a
modification in food consistency altered the masticatory
muscle function and thus had an impact on craniofacial
morphology (Kiliaridis 2006); and that a harder diet in-
creased the growth of craniomandibular structures, espe-
cially those connected to the masticatory function (Abed
et al. 2007). Feeding on a harder diet also relatively aug-
mented the skull width of other mammals (Corruccini &
Bonn zoological Bulletin 68 (1): 97-124
Beecher 1984; Ciochon et al. 1997). In our studied pop-
ulations, the smallest individuals, representing Group I
populations (Kenitra and Merja Zerga) feed on various
crops but primarily on peanut crops, in the form of seeds
at the seedling stage, or the plant at the vegetative stage,
or the pods at maturity (Zyadi & Benazzou 1992). On the
opposite, the biggest individuals, representing Group III
(Guercif and Fritissa), feed mainly on wheat and other
cereals, in the form of plants and their hard grains. Our
explanations connecting the morphological differences
to the quantity and quality of food resources are hypo-
thetical but reasonable, even if we do not possess quanti-
fiable data on the food resources available to the studied
populations or the stomach content of the individuals.
Differentiation between our morphometric groups was
also partly due to the increase in size of the occipital part
of the skull, represented by an increase in the size of the
tympanic bulla, and therefore an increase in skull height
and braincase breadth. This hypertrophy is observed in
our populations with the increase of aridity, from Group I
with the smallest bullae, found in a subhumid bioclimate,
to Group III with the largest, found in an arid bioclimate.
The size increase of the bullae also seems to go along
with the decline of the population’s density, from Group
I of the Gharb region where G. campestris is prolific
and can pullulate (Zyadi & Benazzou 1992), to Group
II of the Oriental region where this species is much less
abundant. Bioclimate variability, through the change of
aridity levels, causes variations in vegetation cover and
the abundance of food resources. At first, fewer food re-
sources are available in the more arid habitats, and con-
sequently there is a lowering of the rodent population
density. Secondly, more arid habitats are characterized
by a lower vegetation cover and thus more open habitats.
Hypertrophy of the tympanic bullae, and consequently
enhanced auditory sensitivity, is considered as an adap-
tation to these conditions of arid habitats. Gerbillinae ro-
dents were distinguished to be one of the rodent families
most predisposed to the hypertrophy of their bullae (Pet-
ter 1961). A better hearing acuity facilitates the encounter
of the sexes and reproduction in low population densities
(Petter 1961) and can help in evading predators in these
more open habitats (Lay 1972; Webster & Webster 1975;
Alhajeri et al. 2015). Similar to our results, Colangelo
et al. (2010) found in Gerbilliscus that modifications in
the molar row and the tympanic bulla were related to cli-
mate.
Other possible factors influencing morphological vari-
ability are predation pressure and intra- and interspecific
competition (Yom-Tov & Geffen 2011). The different
degrees of predation pressure by various predators (birds
of prey, reptiles, small carnivores, rats, dogs) as well as
competition over resources with the other rodents that we
have captured in the studied localities (Mus musculus,
Mus spretus, Rattus rattus, Rattus norvegicus, Meriones
shawit), need to be tested by joint ecological studies.
©ZFMK
Biogeographic history of Gerbillus campestris 109
Phylogeographic distribution. Previously, Nicolas et al.
(2014) revealed a complex phylogeographic structuration
of Gerbillus campestris in the form of nine mitochondrial
lineages in Morocco, North Africa (Algeria and Tunisia)
and the western Sahel region (Mali and Niger). Accord-
ing to these authors, different factors contributed to this
structuration: isolation by distance; the climatic fluctua-
tions of the Pleistocene marked by warming and cooling
conditions, and the period of aridification at the end of
the Pleistocene; and the role of the Moulouya River and
Bou Regreg River as biogeographical barriers to genetic
flow. The new sampled specimens and populations in our
study give additional details concerning the distribution
of the various lineages (Fig. 1).
The supplementary individuals from Chrouda locali-
ty reinforce the presence of lineage 7 in this locality as
an allopatric lineage, in spite of the small geographic
distance between this locality and the Esperada locality
where exists the allopatric lineage 8, that forms a recent
monophyletic group with lineage 7 beyond the Rif moun-
tains in the extreme north of Morocco.
The added individuals from Aounate locality show that
lineage 1 is still the only lineage present in this locality,
even though this lineage is sympatric with lineage 3 in
almost all the localities surrounding Aounate locality, in
the north, east and south; between the Bou Regreg River
and Souss River.
In the allopatric lineage 6, the Merja Zerga locality and
the new locality of Kenitra are both located between the
northern side of the Sebou River, the largest river in Mo-
rocco, and the southern side of the Loukkos River. How-
ever, on the southern side of the Sebou River, in the Sidi
Boughaba locality just nearly 30 km from the Kenitra lo-
cality, we find the allopatric lineage 5. This suggests that
the Sebou River is a significant barrier to gene flow for
this species. Studies on different plant species have found
that the Sebou River was a major geographical limit to
gene flow (Hypochaeris salzmanniana DC. by Ortiz
et al. 2007; Chamaerops humilis L. by Garcia-Castafio
et al. 2014; Onopordum dissectum Murb. by Balao et al.
2017). The north-west of Morocco is surrounded by the
Rif and Middle Atlas Mountains and comprises several
long rivers (Bou Regreg, Sebou and Loukkos Rivers)
originating in these mountains and extending to the At-
lantic coast at different latitudes, creating large estuaries
and floodplains (Chichagov 2008), that probably acted as
barriers separating the populations of G. campestris and
promoting genetic isolation.
Lineage 4 was thought to be restricted to the eastern
bank of the Moulouya River in Morocco and extend-
ing to the north of Algeria and to the north of Tunisia
(Nicolas et al. 2014). However, thanks to our sampling
in the new localities of Guercif and Fritissa, we showed
that lineage 4 originating on the eastern bank of the
Moulouya has later spread towards the western bank of
the river. For another North African Gerbillinae rodent,
Bonn zoological Bulletin 68 (1): 97-124
Meriones shawii, Lalis et al. (2016), using both mtDNA
and nDNA, suggested to split it into two species with
an east-west structuration roughly around the Moulouya,
though samples were missing from the western side of
the Moulouya and from Northern Morocco. On the con-
trary, in the Greater Egyptian Jerboa, Jaculus orientalis,
one of the three identified cytb lineages is found both in
northern Morocco west of the Moulouya and in north-
ern Algeria (Ben Faleh et al. 2012b). Based on Beddek
et al. (2018), the structuration of mitochondrial diversity
of reptiles and amphibians species around the Moulouya,
between northern Morocco and north-western Algeria,
can be assembled into three groups: 1) the same lineage
exists in north-western Algeria and northern Morocco,
on both sides of the Moulouya (Zimon tangitanus, Tro-
gonophis wiegmanni, Podarcis vaucheri, Acanthodacty-
lus erythrurus), 11) north-western Algeria is inhabited by
the same lineage that is found in northern Morocco but
only on the eastern side the Moulouya (Natrix maura);
1i1) a continuity between Moroccan populations from the
two sides of the Moulouya, but with a separation from
the populations of north-western Algerian (Pelophylax
saharicus, Natrix maura). For these reptiles and amphib-
ians, the origin of the east-west phylogeographic break
around the Moulouya was attributed to the former marine
Rifian corridor that joined the Atlantic Ocean with the
Mediterranean Sea, east of the Rif mountains, between
8.0 Mya and 5.6 Mya (Barhoun & Bachiri 2008; Beddek
et al. 2018). Although part of this marine corridor was
located on the present Moulouya valley, this paleogeo-
graphic barrier cannot be applied, at least not directly, to
the case of G. campestris since the history of this species
has occurred starting from the middle Pleistocene (0.4-
0.5 Mya) (Tong 1989). Our results may lessen the role of
the Moulouya River and the valley encompassing it, in
preventing the spread of G. campestris towards western
Morocco at some point in the past, but the real geograph-
ic differentiation in this region 1s complex and should be
further explored. An alternative possible explanation for
the occurrence of lineage 4 on the western bank of the
Moulouya River is a human-mediated transport of indi-
viduals, which can represent a counterbalancing factor to
the genetic differentiation caused by geographic barriers.
Surprisingly, and although they originate from very
distant localities, the specimens from Libya and Egypt
belong to the Saharan lineage 2 along with the individ-
uals of Niger and Mali (Tessalit and Adrar des Iforas
localities), which makes lineage 2 the most widespread
lineage, being present in Mali and Niger in the south and
west; and Libya and Egypt in the north and east. Ger-
billus campestris has a large distribution and occupies
a wide variety of habitats, except in the Sahara Desert
where it has a sporadic distribution and is restricted to
rocky massifs. The Sahara Desert acts as a barrier to
genetic flow between north and south of the desert, for
species that are not adapted to extremely arid and san-
©ZFMK
110 Oussama Bouarakia et al.
dy habitats, like G. campestris. However, the presence
of lineage 2 from Mali and Niger in the south, to Egypt
and Libya in the north of the Desert can represent a relic
of a larger distribution during more favourable periods
of the Pleistocene. Paleoenvironmental data and climatic
reconstructions show that North Africa regularly shifted
from wetter to drier climatic conditions throughout the
Quaternary (deMenocal 2004; Schuster et al. 2006; Ta-
bel et al. 2016), leading to periodic contraction/expan-
sion of the Sahara Desert. Similarly, Nicolas et al. (2018)
showed through ecological niche modelling and genetic
data that presently unsuitable arid areas of the Saharan
Desert were suitable for the amphibian Bufotes bouleng-
eri throughout most of the Quaternary.
Another unexpected result concerns the specimen from
south central Mali (Sinkerma locality) representing the
added lineage 10. Even if it is geographically close to the
specimens from north-east Mali (Tessalit and Adrar des
Iforas localities), the Sinkerma individual is genetically
very distant from lineage 2 (2.6%) and seems to be ge-
netically closer to lineages from the north of Morocco. In
this case, the high genetic differentiation between the ad-
jacent populations eliminates the role of isolation-by-dis-
tance as a cause of genetic variability. The Sinkerma
locality is found south of the Niger River, the third lon-
gest river in Africa, compared to the two other localities
that are situated north of the river. Therefore, the Niger
River may have played a role as a barrier to gene flow
between lineages, similarly to what was suggested for
other rodents (Nicolas et al. 2008, 2009; Brouat et al.
2009; Dobigny et al. 2010; Hima et al. 2011; Colangelo
et al. 2013). Also, phylogeographic studies for different
rodents showed the existence of distinct phylogroups in
this region of West Sahel (Mastomys erythroleucus by
Brouat et al. 2009; Acomys chudeaui by Nicolas et al.
2009; Gerbillus henleyi by Bouarakia et al. 2018). To
explain the phylogeographic discontinuity for G. camp-
estris in Mali, more samples from this region are needed
to evaluate the combined actions of barriers and allopat-
ric differentiation or the effects of lineage sorting from
a highly polymorphic ancestral gene pool (Avise 2000).
Relationship between morphometric and molecular
variability. A crucial goal of this work is the confronta-
tion of the results of the morphometric study to those of
the molecular study. Previously, Baala (1995) showed in
five populations in Morocco, that the biometric variabil-
ity was not accompanied by allozymic variability based
on biochemical differentiation of proteins. However, in
our study, the morphometric results are congruent with
the genetic results and the geographic distribution. The
geographic structuring of the six populations of G. camp-
estris in Morocco has produced sufficient phenotypic dif-
ferentiation and high levels of sequence divergence that
allows their discrimination into four groups:
Bonn zoological Bulletin 68 (1): 97-124
— Group I of the morphometric study, composed of the
populations of Merja Zerga and Kenitra, corresponds
to the genetic lineage 6 and Is present in north-west-
ern Morocco.
— Group II, representing the population of Aounate,
corresponds to the genetic lineage | and is present in
central Morocco;
— Group III, composed of the populations of Guercif
and Fritissa, corresponds to genetic lineage 4 and is
present in north-eastern Morocco;
— Group IV representing the population of Chrouda,
corresponds to the genetic lineage 7 and is present in
the extreme north of Morocco.
A notable point is the clarification of the phylogeograph-
ic status of the populations of Guercif and Fritissa in
relation to the populations present either on the eastern
bank or the western bank of Moulouya River. This river
was considered to be a major barrier reducing dispersal
rates and thus hindering gene flow between the eastern
populations (Tunisia, Algeria and east of Morocco) and
the western ones (west of Morocco). Yet, both the mor-
phological and genetic analyses showed that the popula-
tions of Guercif (west of Moulouya) and Fritissa (east of
Moulouya) belong to the same group.
Although we did not determine the specific relationship
between morphological and genetic variation, we were
able nonetheless to demonstrate for G. campestris its high
plasticity, its capacity of adaptation and the micro-evolu-
tionary processes at work. In summary, G. campestris 1s a
widely distributed species that can be divided in Moroc-
co into different assemblages of populations that experi-
enced variable degrees of geographic isolation and adapt-
ed to different local environmental conditions, resulting
in a strong morphological differentiation and genetic
structuration. But systematically speaking, the question
to be asked is whether we should see this variability as
a progressive gradient or must divide the species into
different diverging subspecies. Several subspecies were
previously described based on geographic variations of
pelage coloration, external size and/or skull characters
(Setzer 1958; Petter & Saint-Girons 1965; Ranck 1968;
Jordan et al. 1974; Osborn & Helmy 1980). Based only
on their geographic distribution, we may attribute some
populations used in the current study to these different
subspecies. For example, the individuals from Tunisia
and Algeria belonging to lineage 4 may be attributed
to the subspecies G. campestris campestris Levaillant,
1857. However, in other cases, specimens from the same
lineage fall within different subspecies: the individuals
from Egypt fit with G. campestris haymani Setzer, 1958;
while the one from Libya fits with G. campestris dod-
soni Thomas, 1902. Furthermore, Petter & Saint-Girons
(1965) suggested that only two subspecies are found in
Morocco and they were identified based merely on color-
ation criteria (G. c. campestris and G. c. dodsoni), which
©ZFMK
Biogeographic history of Gerbillus campestris 111
does not correspond to the complex phylogeographic
structuration revealed in this country. Gerbillus hilda
Thomas, 1918, first described as a new species in Mo-
rocco on the northern Atlantic coast (122 km south-west
of Tangiers), approached the dimensions of G. campes-
tris externally and cranially but was characterized by a
small band of hairs on the hind feet soles (Thomas 1918).
Specimens captured 17 km south-west of Rabat and de-
scribed as G. hilda by Schlitter & Setzer (1972) appear to
be closer in body and skull dimensions to the G. camp-
estris individuals of Group I. G. hilda was later regarded
as a subspecies of G. campestris (Petter 1975 and Corbet
1978, as cited in Lay 1983), while Lay (1983) viewed
it as a subspecies of G. nanus. If we want to reconsider
the taxonomy of Gerbillus campestris on an intraspecific
level, genetic variability and morphological character-
istics must be further identified across the range of the
species.
CONCLUSIONS
Supplementary sampling from the whole distribution
area of Gerbillus campestris should be carried out, and
different markers must be used in the genetic study to
better explore the genetic diversity of this species in the
Sahara Desert (Mali, Niger) and in Algeria. In addition,
the study of morphological variability should be refined
in order to include specimens from all the geographic
range of the species and all the genetic lineages. Clas-
sical morphometry is not sufficient and craniomandibu-
lar variation should be further studied using geometric
morphometric methods. Further research should focus on
how morphological and genetic variations could be relat-
ed to the adaptation capacity of this rodent to anthropized
habitats, increasing its pullulation capacity and the dam-
age it can cause to agricultural crops.
Acknowledgements. The present study was supported by the
Laboratory ‘Biodiversity, Ecology and Genome’ of the Faculty
of Sciences of Rabat, by the UMR7205 ISYEB of the ‘Muse-
um National d’ Histoire Naturelle’ of Paris and by the CNRS-
CNRST corporation project (2014-2015): ‘Caractérisation de la
diversité génétique des rongeurs Gerbillidae du Maroc, de leur
distribution et de leurs ectoparasites: Implications pour la santé
et la conservation’. Molecular analyses were supported by the
‘Service de Systématique Moléculaire’ of the ‘Museum Nation-
al d’ Histoire Naturelle’ of Paris (UMS 2700, Paris, France) and
the ‘Centre National pour la Recherche Scientifique et Tech-
nique’ of Morocco. We also thank S. Liefrid, A. Rihane, L. Ti-
farouine and Z. Sahi for helping in the collection of specimens.
REFERENCES
Abed GS, Buschang PH, Taylor R, Hinton RJ (2007) Matura-
tional and functional related differences in rat craniofacial
growth. Archive of Oral Biology 52: 1018-1025
Bonn zoological Bulletin 68 (1): 97-124
Abiadh A, Chetoui M, Lamine-Cheniti T, Capanna E, Colange-
lo P (2010) Molecular phylogenetics of the genus Gerbillus
(Rodentia, Gerbillinae): Implications for systematics, taxon-
omy and chromosomal evolution. Molecular Phylogenetics
and Evolution 56: 513-518
Addinsoft S.A.R.L. (2012) XLSTAT 2016: Leading data anal-
ysis and statistical solution for Microsoft Excel. Addinsoft
SRL
Akaike H (1973) Information theory and an extension of the
maximum likelihood principle. In: Petrov BN, Csaki F (eds)
Proceedings of the Second International Symposium on In-
formation Theory, Akadémiai Kiado, Budapest, pp. 267-281
Alhajeri BH, Hunt OJ, Steppan SJ (2015) Molecular systemat-
ics of gerbils and deomyines (Rodentia: Gerbillinae, Deomy-
inae) and a test of desert adaptation in the tympanic bulla.
Journal of Zoological Systematics and Evolutionary Re-
search 53: 312-330
Alvarez Y, Mateo JA, Andreu AC, Diaz-Paniagua C, Diez A,
Bautista JM (2000) Mitochondrial DNA haplotyping of 7es-
tudo graeca on both continental sides of the Straits of Gibral-
tar. Journal of Heredity 91: 39-41
Arano G, Llorente GA, Montori A, Busckley D, Herrero P
(1998) Diversification in north-west African water frogs: mo-
lecular and morphological evidence. Herpetological Journal
8: 57-64
Aulagnier S, Thévenot M (1986) Catalogue des mammiferes
sauvages du Maroc. Travaux de |’Institut scientifique, Série
Zoologie 41: 1-164
Aulagnier S, Cuzin F, Thévenot M (2017) Mammifeéres sau-
vages du Maroc : Peuplement, répartition, écologie. Société
Frangaise pour |’ Etude et la Protection des Mammiferes
Avise JC (2000) Phylogeography: the history and formation of
species. Harvard University Press, Cambridge, Massachu-
setts
Baala L (1995) Etude de la variabilité morphologique et
génétique chez Gerbillus campestris Levaillant, 1857 (Ron-
geurs, Gerbillidés) au Maroc. Mémoire D.E.S., Univ. Mo-
hammed V, Rabat, Morocco
Balao F, Navarro-Sampedro L, Berjano R, Garcia-Castafio
JL, Casimiro-Soriguer R, Talavera M, Talavera S, Terrab A
(2017) Riverine speciation and long dispersal colonization in
the Ibero-African Onopordum dissectum complex (Asterace-
ae). Botanical Journal of the Linnean Society 183: 600-615
Bandelt HJ, Forster P, Rohl A (1999) Median-joining networks
for inferring intraspecific phylogenies. Molecular Biology
and Evolution 16: 37—48
Barhoun N, Bachiri TN (2008) Evénements biostratigraphiques
et environnementaux enregistrés dans le corridor sud rifain
(Maroc septentrional) au Miocene supérieur avant la crise de
salinité messinienne. Geodiversitas 30(1): 21-40
Beddek M, Zenboudji-Beddek S, Geniez P, Fathalla R, Sou-
rouille P, Arnal V, Dellaoui B, Koudache F, Telailia S, Peyre
O, Crochet PA (2018) Comparative phylogeography of am-
phibians and reptiles in Algeria suggests common causes for
the east-west phylogeographic breaks in the Maghreb. PLOS
ONE 13(8): e0201218
Beecher RM, Corruccini RS (1981) Effects of dietary consis-
tency on craniofacial and occlusal development in the rat.
Angle Orthodontist 51: 61-69
Benazzou T, Zyadi F (1990) Présence d’une variabilité
biométrique chez Gerbillus campestris au Maroc (rongeurs,
gerbillides). Mammalia 54: 271-279
Ben Faleh A, Annabi A, Said K (2012a) Morphometric varia-
tion in black rat Rattus rattus (Rodentia: Muridae) from Tu-
nisia. Acta Zoologica Bulgarica 64: 381-387
©ZFMK
112 Oussama Bouarakia et al.
Ben Faleh AR, Granjon L, Tatard C, Othmen AB, Said K, Cos-
son JF (2012b) Phylogeography of the Greater Egyptian Jer-
boa (Jaculus orientalis) (Rodentia: Dipodidae) in Mediterra-
nean North Africa. Journal of Zoology 286: 208-220
Bouarakia O, Denys C, Nicolas V, Tifarouine L, Benazzou T,
Benhoussa A (2018) Notes on the distribution and phyloge-
ography of two rare small Gerbillinae (Rodentia, Muridae) in
Morocco: Gerbillus simoni and Gerbillus henleyi. Comptes
Rendus Biologies 341(7-8): 398-409
Breno M, Leirs H, Van Dongen S (2011) Traditional and geo-
metric morphometrics for studying skull morphology during
growth in Mastomys natalensis (Rodentia: Muridae). Journal
of Mammalogy 92(6): 1395-1406
Brouat C, Tatard C, Ba K, Cosson JF, Dobigny G, Fichet-Calvet
E, Granjon L, Lecompte E, Loiseau A, Mouline K, Piry S,
Duplantier JM (2009) Phylogeography of the Guinea mul-
timammate mouse (Mastomys erythroleucus). a case study
for Sahelian species in West Africa. Journal of Biogeography
36(12): 2237-2250
Chevret P, Dobigny G (2005) Systematics and evolution of the
subfamily Gerbillinae (Mammalia, Rodentia, Muridae). Mo-
lecular Phylogenetics and Evolution 35(3): 674-688
Chevret P, Ndiaye A, Dobigny G, Granjon L (2014) New mo-
lecular evidence for Gerbillus: phylogenetics relationships
among Gerbillus (Rodentia: Gerbillinae) inferred by mito-
chondrial and nuclear genes. Unpublished.
Chichagov VP (2008) The plains at the periphery of the Atlas
Mountains: the genesis, relief, current desertification. Geog-
raphy and Natural Resources 29: 292—296
Ciochon RL, Nisbett RA, Corruccini RS (1997) Dietary con-
sistency and craniofacial development related to masticatory
function in minipigs. Journal of Craniofacial Genetics and
Developmental Biology 17: 96-102
Colangelo P, Castiglia R, Franchini P, Solano E (2010) Pattern
of shape variation in the eastern African gerbils of the genus
Gerbilliscus (Rodentia, muridae): Environmental correla-
tions and implication for taxonomy and systematics. Mam-
malian Biology 75: 302-310
Colangelo P, Verheyen E, Leirs H, Tatard C, Denys C, Dobigny
G, Duplantier JM, Brouat C Granjon L, Lecompte E (2013) A
mitochondrial phylogeographic scenario for the most wide-
spread African rodent, Mastomys natalensis. Biological Jour-
nal of the Linnean Society 108: 901-916
Corruccini RS, Beecher R (1984) Occlusofacial morphologi-
cal integration lowered in baboons raised on soft diet. Jour-
nal of Craniofacial Genetics and Developmental Biology 4:
135-142
Csanady A, Mogansky L (2018) Skull morphometry and
sexual size dimorphism in Mus musculus from Slovakia.
North-Western Journal of Zoology 14(1): 102—106
Darriba D, Taboada GL, Doallo R, Posada D (2012) Jmodelt-
est2: More models, new heuristics and parallel computing.
Nature Methods 9(8): 772
Denys C, Taylor P, Aplin K (2017) Subfamily Deomyinae, Ger-
billinae, Leimacomyinae, Lophiomyinae species accounts.
In: Wilson DE, Lacher Jr TE, Mittermeier RA (eds) Hand-
book of the Mammals of the World, Vol. 7, Rodents H, Lynx
Edicions, Barcelona, 2017, pp. 598-650
Dobigny G, Moulin S, Cornette R, Gautun JC (2001). Rodents
from Adrar des Iforas, Mali. Chromosomal data. Mammalia,
65: 215-220
Dobigny G, Nomao A, Gautun JC (2002) A cytotaxonomic
survey of rodents from Niger: implications for systematics,
biodiversity and biogeography. Mammalia 66(4): 495-523
Bonn zoological Bulletin 68 (1): 97-124
Dobigny G, Catalan J, Gauthier P, O’Brien PCM, Brouat C, Ba
K, Tatard C, Ferguson-Smith M, Duplantier JM, Granjon L,
Britton-Davidian J (2010) Geographic patterns of inversion
polymorphisms in a wild African rodent, Mastomys erythro-
leucus. Heredity 104: 378-386
Ducroz JF, Volobouev V, Granjon L (2001) An assessment of
the systematics of Arvicanthine rodents using mitochondrial
DNA sequences: Evolutionary and biogeographical implica-
tions. Journal of Mammalian Evolution 8: 173-206
Escoriza D, Comas MM, Donaire D, Carranza S (2006) Redis-
covery of Salamandra algira Bedriaga, 1883 from the Beni
Snassen massif (Morocco) and phylogenetic relationships of
North African Salamandra. Amphibia-Reptilia 27: 448-455
Garcia-Castafio JL, Terrab A, Ortiz MA, Stuessy TF, Talavera
S (2014) Patterns of phylogeography and vicariance of Cha-
maerops humilis L. (Palmae). Turkish Journal of Botany 38:
1132-1146
Giban J, Haltebourg M (1965) Le probleme de la Mérione de
shaw au Maroc. Comptes Rendus du Congres sur la Protec-
tion des Cultures tropicales, Marseille, 587-588
Granjon L (2016) Gerbillus campestris. The IUCN Red List of
Threatened Species 2016: e.T45088A22465830. http://dx.do1.
org/10.2305/IUCN.UK.2016-3.RLTS.T45088A22465830.en
Gu X, Fu YX, Li WH (1995) Maximum likelihood estimation
of the heterogeneity of substitution rate among nucleotide
sites. Molecular Biology and Evolution 12: 546—557
Hall TA (1999) BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows 95/98/
NT. Nucleic Acid Symposium Series 41: 95—98
Happold DCD (1967) Gerbillus (Dipodillus) campestris (Ger-
billinae, Rodentia) from the Sudan. Journal of Natural His-
tory 1:3, 315-317
Happold DCD (2013) Mammals of Africa, Vol. III, Blooms-
bury Publ., London
Hima K, Thiam M, Catalan J, Gauthier P, Duplantier JM, Piry
S, Sembene M, Britton-Davidian J, Granjon L, Dobigny G
(2011) Extensive Robertsonian polymorphism in the African
rodent Gerbillus nigeriae: geographic aspects and meiotic
data. Journal of Zoology 284: 276-285
Jordan RG, Davis BL, Baccar H (1974) Karyotypic and mor-
phometric studies of Tunisian Gerbillus. Mammalia 38:
667-680
Khalifa MA, Younes MI, Ghazy A (2018) Cytochrome b shows
signs of adaptive protein evolution in Gerbillus species from
Egypt. The Journal of Basic and Applied Zoology 79:1
Kiliaridis S (2006) The importance of masticatory muscle func-
tion in dentofacial growth. Seminars in Orthodontics 12:
110-119
Kimura M (1980) A simple method for estimating evolution-
ary rate of base substitutions through comparative studies of
nucleotide sequences. Journal of Molecular Evolution 16:
111-120
Kowalski K, Rzebik-Kowalska B (1991) Mammals of Algeria.
Polish Academy of Sciences, Institute of Systematics of Evo-
lution of Animals, Wrodow, Poland
Lalis A, Baylac M, Cosson JF, Makundi RH, Machang’u RS,
Denys C (2009) Cranial morphometric and fine scale genetic
variability of two adjacent Mastomys natalensis (Rodentia:
Muridae) populations. Acta Theriologica 542: 171-181
Lalis A, Leblois R, Stoetzel E, Benazzou T, Souttou K, Denys
C, Nicolas V (2016) Phylogeography and demographic histo-
ry of Shaw’s Jird (Meriones shawii complex) in North Africa.
Biological Journal of the Linnean Society 118(2): 262-279
©ZFMK
Biogeographic history of Gerbillus campestris 113
Lay DM (1972) The anatomy, physiology, functional signifi-
cance and evolution of specialized hearing organs of gerbill-
ine rodents. Journal of Morphology 138: 41-120
Lay DM, Agerson K, Nadler CF (1975) Chromosomes of some
species of Gerbillus (Mammalia, Rodentia). Zeitschrift fir
Saugetierkunde 40: 141-150
Lay DM (1983) Taxonomy of the genus Gerbillus (Roden-
tia: Gerbillinae) with comments on the applications of ge-
neric and subgeneric names and an annoted list of species.
Zeitschrift fir Satigetierkunde 48: 329-354
Matthey R (1952) Chromosomes de Muridae (II). Experientia
8: 389-390
deMenocal P (2004) African climate change and faunal evo-
lution during the Pliocene-Pleistocene. Earth and Planetary
Science Letters 220: 3-24
Miller JP, German RZ (1999) Protein malnutrition affects the
growth trajectories of the craniofacial skeleton in rats. Jour-
nal of Nutrition 129: 2061—2069
Mokhtari N, Mrabet R, Lebailly P, Bock L (2013) Spatialisa-
tion des bioclimats, de l’aridité et des étages de végétation
du Maroc. Revue Marocaine des Sciences Agronomiques et
Vétérinaires, volume 2, pp. 50-66
Moore WJ (1965) Masticatory function and skull growth. Jour-
nal of Zoology 146: 123-131
Musser GC, Carleton MD (2005) Superfamily Muroidea. In:
Wilson DE, Reeder DAM (eds), Third edition, Mammal spe-
cies of the world: A taxonomic and geographic reference,
Vol. 2, John Hopkins University Press, Baltimore, MD, USA,
pp. 894-1531
Myers P, Lundrigan BL, Gillespie BW, Zelditch ML (1996)
Phenotypic plasticity in skull and dental morphology in the
prairie deer mouse (Peromyscus maniculatus bairdii). Jour-
nal of Morphology 229: 229-237
Ndiaye A, Ba K, Aniskin V, Benazzou T, Chevret P, Konecny
A, Sembéne M, Tatard C, Kergoat GJ, Granjon L (2012) Evo-
lutionary systematics and biogeography of endemic gerbils
(Rodentia, Muridae) from Morocco: an integrative approach.
Zoologica Scripta 41: 11-28
Ndiaye A, Shanas U, Chevret P, Granjon L (2013a) Molecular
variation and chromosomal stability within Gerbillus nanus
(Rodentia, Gerbillinae): taxonomic and biogeographic impli-
cations. Mammalia 77(1): 105-111
Ndiaye A, Chevret P, Dobigny G, Granjon L (2013b) Molec-
ular phylogeny of Gerbillus (Rodentia: Gerbillinae) using
mitochondrial and nuclear genes: taxonomic implications.
11th International Mammalogical Congress (IMC), Belfast,
Ireland
Ndiaye A, Chevret P, Dobigny G, Granjon L (2016) Evolution-
ary systematics and biogeography of the arid habitat-adapt-
ed rodent genus Gerbillus (Rodentia, Muridae): a mostly
Plio-Pleistocene African history. Journal of Zoological Sys-
tematics and Evolutionary Research 54: 299-317
Nicolas V, Bryja J, Akpatou B, Konecny A, Lecompte E, Colyn
M, Lalis A, Couloux A, Denys C, Granjon L (2008) Compar-
ative phylogeography of two sibling species of forest-dwell-
ing rodent (Praomys rostratus and P. tullbergi) in West Afri-
ca: different reactions to past forest fragmentation. Molecular
Ecology 17: 5118-5134
Nicolas V, Granjon L, Duplantier JM, Cruaud C, Dobigny G
(2009) Phylogeography of spiny mice (genus Acomys, Ro-
dentia: Muridae), from the southwestern margin of the Sa-
hara, with taxonomic implications. Biological Journal of the
Linnean Society 98: 29-46
Nicolas V, Ndiaye A, Benazzou T, Souttou K, Delapre A, Cou-
loux A, Denys C (2014) Phylogeography of the North Af-
Bonn zoological Bulletin 68 (1): 97-124
rican Dipodil (Rodentia: Muridae) based on Cytochrome-b
sequences. Journal of Mammalogy 95(2): 241-253
Nicolas V, Mataame A, Crochet P, Geniez P, Ohler A (2015)
Phylogeographic patterns in North African water frog Pe-
lophylax saharicus (Anura: Ranidae). Journal of Zoological
Systematics and Evolutionary Research 53: 239-248
Nicolas V, Mataame A, Crochet PA, Geniez P, Fahd S, Ohler A
(2018) Phylogeography and ecological niche modeling un-
ravel the evolutionary history of the African green toad, Bu-
fotes boulengeri boulengeri (Amphibia: Bufonidae), through
the Quaternary. Journal of Zoological Systematics and Evo-
lutionary Research 56:102-116
Ortiz MA, Tremetsberger K, Talavera S, Stuessy TE, Garcia-
Castafio JL (2007) Population structure of Hypochaeris
salzmanniana DC. (Asteraceae), an endemic species to the
Atlantic coast on both sides of the Strait of Gibraltar, in re-
lation to Quaternary sea level changes. Molecular Ecology
16: 541-552
Osborn DJ, Helmy I (1980) The contemporary land mammals
of Egypt (including Sinai). Fieldiana Zoology new series 5:
1-428
Ouzaouit A (1980) La situation des rongeurs au Maroc. In:
Journées nationales sur les Rongeurs nuisibles, Rabat 1-3
December 1980. Ministere de I’ Agriculture et de la Réforme
agraire, Rabat, Morocco, 5p
Pankakoski E, Vaisanen RA, Nurmi K (1987) Variability of
muskrat skulls: measurement error, environmental modifica-
tion and size allometry. Systematic Zoology 36: 35-51
Patton JJ, Brylski PV (1987) Pocket gophers in alfalfa fields:
causes and consequences of habitat-related body size varia-
tion. The American Naturalist 130: 493-506
Petter F (1961) Répartition géographique et écologique des
rongeurs désertiques (du Sahara occidental a |’ Iran oriental).
Mammalia 25(special number): 1-219
Petter F, Saint-Girons MC (1965) Les rongeurs du Maroc.
Travaux de I’ Institut Scientifique Chérifien, Rabat, Série Zo-
ologie 31: 44-47
Ramirez Rozzi FV, Gonzalez-José R, Pucciarelli HM (2005)
Cranial growth in normal and low-protein-fed Saimiri: an en-
vironmental heterochrony. Journal of Human Evolution 49:
515-535
Ranck G (1968) The rodents of Libya: Taxonomy, ecology and
zoogeographical relationships. Bulletin of U.S. National Mu-
seum of Natural History 275, 264 pp
Reichling TD, German RZ (2000) Bones, muscles and viscer-
al organs of protein-malnourished rats (Rattus norvegicus)
grow more slowly but for longer durations to reach normal
final size. Journal of Nutrition 130: 2326-2332
Renaud S, Michaux J, Schmidt DN, Aguilar JP, Mein P, Auffray
JC (2005) Morphological evolution, ecological diversifica-
tion and climate change in rodents. Proceedings of the Royal
Society B: Biological Sciences 272: 609-617
Samuels JX (2009) Cranial morphology and dietary habits of
rodents. Zoological Journal of the Linnean Society 156(4):
864-888
Schlitter DA, Setzer HW (1972) A new species of short-tailed
gerbil (Dipodillus) from Morocco (Mammalia: Cricetidae:
Gerbillinae). Proceedings of The Biological Society of
Washington 84: 385-391
Schuster M, Duringer P, Ghienne JF, Vignaud P, Mackaye HT,
Likius A, Brunet M (2006) The age of the Sahara Desert.
Science 311: 821
Schwan TG, Anderson JM, Lopez JE, Fischer RJ, Raffel SJ,
McCoy BN, Safronetz D, Sogoba N, Maiga O, Traore SF
(2012) Endemic Foci of the Tick-Borne Relapsing Fever
©ZFMK
114 Oussama Bouarakia et al.
Spirochete Borrelia crocidurae in Mali, West Africa, and
the Potential for Human Infection. PLoS Neglected Tropical
Diseases 6(11): e1924
Setzer HW (1958) The gerbils of Egypt. Journal of the Egyptian
Public Health Association 33(6): 205—227
Tabel J, Khater C, Rhoujjati A, Dezileau L, Bouimetarhan I,
Carre M, Vidal L, Benkaddour A, Nourelbait M, Cheddadi R
(2016) Environmental changes over the past 25 000 years in
the southern Middle Atlas, Morocco. Journal of Quaternary
Science 31: 93-102
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013)
MEGAG6: Molecular Evolutionary Genetics Analysis version
6.0. Molecular Biology and Evolution 30: 2725-2729
Thomas O (1918) New Forms of Dendromus, Dipodillus, and
Gerbillus. Annals and Magazine of Natural History 9, vol.
2(7): 59-64
Tong H (1989) Origine et évolution des Gerbillidae (Mamma-
lia, Rodentia) en Afrique du Nord. Mémoires de la Société
Géologique de France 155: 1-120
Bonn zoological Bulletin 68 (1): 97-124
Wassif K, Lutfy RG, Wassif S (1969) Morphological, cytologi-
cal, and taxonomic studies of the rodent genera Gerbillus and
Dipodillus from Egypt. Proceedings of the Egyptian Acade-
my of Sciences XXII: 77-96
Webster DB, Webster M (1975) Auditory systems of Heteromy-
idae: functional morphology and evolution of the middle ear.
Journal of Morphology 146: 343-376
Yom-Tov Y, Geffen E (2011) Recent spatial and temporal
changes in body size of terrestrial vertebrates: probable caus-
es and pitfalls. Biological Reviews 86: 531-541
Zyadi F (1989) Etude de la dynamique d’une population de
Gerbillus campestris (Rodentia, Gerbillidae) de la plaine du
Rharb. These 3eme Cycle, Univ. Mohammed V, Faculté des
Sciences de Rabat, 130p
Zyadi F, Benazzou T (1992) Dynamique de population de
Gerbillus campestris (Rodentia, Gerbillidae) dans la plaine
du Gharb, Maroc, Revue d’Ecologie la Terre et la Vie, 473:
245-258
©ZFMK
115
Biogeographic history of Gerbillus campestris
JOM STULL
SOM STULL
SION STULL
JOM STULL
SOM STULL
SOM STULL
SIOM STULL
SION STULL
SION SIYL
SOM STULL
SION STULL
JOM STULL
SOM STULL
SOM STULL
SIOM STULL
SION STULL
JOM STULL
JOM STULL
SOM STULL
SOM STULL
SIOM SIYL
SOM STULL
SOM STULL
SIOM STULL
SION STULL
SOM STULL
IIUIAIFIY
caLAvlaVAN-Ysa
CULAVIAVAN- ASA
TY LA-vIaVAN- asa
CLLNV-VIAVAN- SA
CILNV-VIAVA-aSA
ILLNV-rldavVA- asa
OILLNV-VIaVA-aSa
6LNV-VldVAN-adSA
8.INV-TIAVA-aSA
LINV-VIYVAN- SA
9LINV-VLYVA-aSA
SINV-VIAVAN-YSA
VINV-VIYVAN- SA
CLINV-VlYVAC-aSaA
CLNV-VIdVAN- SA
LINV-7VlavVA- asa
C810
O81)
891)
OS1O
SvlO
CVO
6Cc1O
9ITO
SITIO
Ell
oN JOqon0,
C9LCSPAN
CIOTCSVAIN
I9TCSPAIN
ESICSVAWN
CSICSVAIN
IST cSv AN
OST CST AN
6vV I cCSV AN
O9TCSTAIN
8VIcSVAIN
LvVIcSVAWN
OVI CST AN
6ST CSV AN
SvICSTAIN
bpricsSvAN
eVICSVAWN
CVICSVAIN
IVI csv aN
OVI CST AN
6E1CSVAIN
8E1CSTAIN
LEICSVAN
9ETCSVAIN
SEICSVAN
VEICSVAN
CElLCSVAWN
oN YUBA UIE)
UIA
UIA
UIA
LNV
LNV
LNV
INV
LNV
LNV
INV
LNV
LNV
INV
LNV
LNV
LNV
UHO
UHO
UHO
UHO
UHO
UHO
UHO
UHO
UHO
UHO
9pod ApIPBIOT
eIuoy
eluoy
elluoy
oyeunoV
oyeunoV
oyeunoV
oyeunoV
oyeunoV
oyeunoV
oyeunoV
oyeunoV
oyeunoV
oyeunoV
oyeunoV
oyeunoV
oyeunoV
epnoly)
epnolyy)
epnolyy)
epnolyy)
epnolyy)
epnoly)
epnolyy)
epnolyy)
epnolyg
epnolyy)
Ay]eIO'T
009010)
009010)
0D9010/
099010)
0D9010/\
0D9010/
009010)
009010)
099010/\
009010)
009010)
009010)
0D9010/\
009010)
0D9010/\
0D9010/\
0D0010/
0D9010/
0D9010/\
0D9010/\
099010)
099010)
009010)
0d9010/
0D9010/
0D9010/\
AQUNO)
cuLy
(eal BI
Talo
€ILLNV
CILLNV
ILLNV
OLLNV
6.LNV
8.LINV
LINV
9INV
SLINV
VINV
€LNV
CLNV
LINV
OLYHO
6aHO
8auHO
LYHO
JUNHO
SuHO
VaHO
€adHO
CuHO
TYHO
apod *v0dS
SLAJSAAUDI “DH
SLJSAAGUDI “DH
SLAJSAGUDI “DH
SLJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLJSAAUDI “DH
SLIJSAAUDI “DH
SLJSAAUDI “DH
SLJSAAGUDI “DH
SLISAAUDI “DH
SLAJSAAUDI “DH
SLJSAACUDI “DH
SLJSAAUDI “DH
SLJSAAUDI “DH
SLJSAACUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLISAGUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLISACUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAGUDI “DH
SLAJSAAUDI “DH
soieds
‘QOUdIOFOI puB JOQUINU JOYONOA “Ioquinu yURqUdy “UISIIO d1ydeIs0NS Id} YIM ‘Apnys d1}9Ud8 SY} UI posn sudUTdads Jo JSI'T
T XIGNAddV
©ZFMK
Bonn zoological Bulletin 68 (1): 97-124
Oussama Bouarakia et al.
116
JOM STULL
JOM SIU
SOM STULL
SIOM STULL
SIOM STULL
SOM STULL
JOM SIYL
SION STULL
SOM STULL
JOM STULL
SION STULL
SOM STULL
JOM STULL
SION STULL
SION STULL
JOM STULL
SION STULL
SION STULL
SION STULL
JOM STULL
JOM STULL
SION STULL
SOM STULL
SIOM STULL
SION STULL
SION STULL
SION STULL
YOM STY,L
IIUIAIFIY
LZW-VIAVA- ASA
9ZW-VIAVA- ASA
SZW-VIAVW- ASA
VZW-VIAVA- ASA
EZW-VIAVN- USA
CZW-VIAVA- ASA
[IZW-VIUVAW- ASA
VOALA-S LAVIN ASA
ECULA-S LUVNW- ASA
CCULA-S TAVIN- USA
[cal a-S PAVIA aSA
OCALA-S LAVIN ASA
6laLA-STAVIAN-aSA
8la.LaA-sS TAVIA-aSA
LIAL A-vldVA- asa
STA LAVAS
Cla La-rldaVvVA- asa
VIALA vlad VA-aSaA
ClaLa-vlavW-asa
ClUaLA Vlad VA-aSaA
[Tabor laVvW-adsa
OlLAELA-VlaVIA-aSA
6aLA-VIaVN-aSA
8ULAVIAVAN- ASA
LYLA-VIAVW- ASA
9A LA-VIAVAN- ASA
SULA-VIaVAN- ASA
VALA-VIAVW- ASA
oN Foqono,
l6lcsv an
O6IcST AN
681 CSV AN
881 CSV AN
L81cSVAWN
981 CST AN
S8ICSTAIN
P8I CSV AN
E8lLCSVAWN
C8ICSTAIN
[8IcSv AN
O8TcSVAIN
6LI CSV AN
8LICSV AWN
LLICSVAWN
9LICSV AN
SLICSVAN
DLICSVAWN
ELICSVAWN
CLICSVAIN
ILICSVAIN
OLICSV AN
691 CST AN
891 CSTAIN
LOICSVAIN
99T CST AN
S9ICSTAIN
DIT CSVAIN
oN WUBI!)
UIA
9pod ApITBIOT
esI97 BLD
eSI97 BID
eSI97 BID
eSI97 BID
eSI97 BID
eSI97 BID
eSI97 BID
eID yy
eIUDy
eID y
eID yy
eID
eID yy
eIUDy
eID yy
eID y
eID
eID
eID y
eID
eID yy
eIUDy
eID yy
eID yy
eIIUDy
eID yy
eID yy
eID y
Ay]VIOT
Od90IO/
Od9010/
Od90IO/
Od90IO/
Od90IO/
Od90IO/
Od90IO/
Od90IO/
Od90IO/
Od9010/
OdD0IO/
Od90IO/
Od901O/
Od901O/
Od90IO/
Od90I0/
Od901O/
Od9010/
Od901O/
Od901O/
OdD0IO/
Od9010/
Od90IO/
Od901O/
Od90IO/
Od901O/
OdD0IO/
Od901O/
AQUNO)D
LZW
OZ
SZW
VZIN
eZW
CZIN
IZIN
pVouLya
ceca Ly
CCULA
IcuLo
OcuLy
6laLa
8laLa
LIALY
9TaLa
SlTaLy
VIaLa
claLy
ClaLa
Pi TST
OLYLY
6a Ly
sadly
Lalo
9a LY
Sale
Vay
9pod “90dS
(ponunuos) "| XIGNAddV
SLAJSAAUDI “DH
SLJSACUDI “DH
SLJSAAUDI “DH
SLAJSAAUDI “DH
SLJSAAUDI “DH
SLJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLIJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLJSAAUDI “DH
SLJSAAUDI “DH
SLAJSAAUDI “DH
SLISAGUDI “DH
SLJSAAUDI “DH
SLAJSAAUDI “DH
SLJSAGUDI “DH
SLISAAUDI “DH
SLJSAAUDI “LH
SLJSACUDI “DH
SLAJSAAUDI “DH
SLJSAAUDI “DH
SLJSAAUDI “DH
SLAJSAGUDI “DH
SLAJSACUDI “DH
SLJSAAUDI “DH
soieds
©ZFMK
Bonn zoological Bulletin 68 (1): 97-124
117
Biogeographic history of Gerbillus campestris
SOM STYL
SOM STULL
JOM STULL
SION SIYL
SOM STULL
JOM SIYL
SION STULL
SOM STULL
SOM STULL
SION SIYL
SION SIUL
SOM STULL
SIOM STULL
SION STULL
SOM STULL
SOM SIYL
SION STULL
SOM SIYL
SION STULL
SION STULL
SOM STULL
SION STULL
JOM STULL
JOM SIYL
SOM STULL
JOM STULL
SIOM STULL
YOM STYL
IIUIAIFIY
SLYA-S PUVA ASA
Plats TAVIA-ASA
€Ladd-slTaVW-aSA
CLYA-S TUVIN-ASA
LLasd-S Pav aSA
9ADD-STUVIAC- ASA
SHOD-STUVW- ASA
VADD-S TUVIA- ASA
CHOD-VIAVIA- ASA
[HOD-VIAVAC ASA
SCZIN-S LUVIN ASA
VCZIN-S LUVW- ASA
ECZIN-STAVIAN-USA
CCZIN-S LUVIN ASA
ICZIN-S LUVIN ASA
OCZN-VIAVW- ASA
6LZN-VIAVW- ASA
8IZIN-VIAVAN- ASA
LIZW-VIAVW- ASA
9IZN-VIAVW- ASA
SIZINN-VIAVAN- ASA
VIZN-VIAVW- ASA
CIZIN-VIAVAN- ASA
CIZN-VIAVAN- ASA
LIZIN-VIAVIAN-USA
OLZN-VIAVW- ASA
6ZIW-VIAVA- SA
8ZW-VIAVW- USA
oN Foqono,
[el csvan
OE CSVAIN
6c I CSV AWN
[1 ccspoin
OL ccSV AN
8S 1 CST AN
LSICSVAWN
9ST CSVAIN
SSICSTAIN
DS ICSVAN
60ccS TAIN
80CCSTAIN
LOCCSV AN
90CCST AN
SOcCST IN
VOCCSV AN
COCCSVAWN
COCCSV AN
LOccSV AN
OOCcCSV AN
661 CSV AN
861 cSTAIN
LOICSVAN
961 CST AN
S6ICSVAIN
VOI CcSVAWN
COlCSVAW
COICSV AN
oN WUBE UI)
ZI
ZINN
9pod APITBIOT
ess]
ess]
ess]
ess]
BSS]
jrorony
jrorony
jrorony
jrorony
jrorony
eSIO7 BID
eSI97 BID
eSI97 BID
esIO7 BID
esI97 BID
eSI97 BID
esI97 BID
eSIO7 BID
esI97 BID
esI97 BID
esIa7 BID
esI97 BID
esI97 BID
eSI97 BID
eSI97 BID
esI97 BID
eSI97 BID
eSI97 BID
Ay]VIOT
Od90IO/
Od901O/
Od901O/
Od901O/
Od901O/
OdD0IO/
OdD0IO/
OdD01O/
Od901O/\
Od90IO/
Od90IO/
Od90IO/
Od90IO/
OdD0IO/
Od9010/
OdD0IO/
Od90IO/
OdD0IO/
Od90IO/
Od90IO/
Od90IO/
Od901O/
Od901O/
OdD0IO/
Od90IO/
OdD0IO/
Od90IO/
Od901O/
AQUNO)
¢ Las
pla
€ Lad
Cla
LLa4
9499
SHOD
pIOD
CHOD
THOD
SCZW
VCZW
EcZIN
CCZW
ICZW
OCZN
61 ZN
8IZN
LIZW
OT ZN
SI ZW
VIZW
eI ZIN
CIZIN
IL ZIN
OLZN
6ZIN
8ZIN
9pod ‘v0dS
(ponunuod) "| XIGNAddV
SLJSAAUDI “DH
SLSAAUDI “DH
SLISAAUDI “DH
SLJSAAUDI “DH
SLJSAAUDI “DH
SLIJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAGUDI “DH
SLJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLJSAAUDI “DH
SLJSAAUDI “DH
SLJSAAUDI “DH
SLASAAUDI “DH
SLJSAAUDI “DH
SLAJSAAUDI “DH
SLASAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLASAAUDI “DH
SLJSAAUDI “DH
SLJSAAUDI “DH
soieds
©ZFMK
Bonn zoological Bulletin 68 (1): 97-124
Oussama Bouarakia et al.
118
(PIOT) Te 19 SRJOOIN
(PIOT) Te 19 SRTOOIN
(PIOT) Te 19 SRJOOIN
(PIOT) Te 19 SRJOOIN
(PIOT) Te 19 SRJOSIN
(PIOT) Te 19 SRJOOIN
(PIOT) Te 19 SRTOOIN
(PIOT) Te 19 SeJOOIN
(PIOT) Te 19 SeJOOIN
(S107) Te 190 Holey
(9107) ‘Te 10 OAPIPN
(S107) Te 19 eyeYY
(S107) Te 19 eyeUY
(S107) Te 19 eyeYY
yIOM SIU
yIOM SIU
yIOM SIU
yIOM SIU,
yIOM SIU [
yIOM SIU,
yIOM SIU
yIOM SIU [
yIOM SIU L
yIOM SIU,
yIOM SIU,
yIOM SIU,
yIOM SIU,
YAOM STYL
IIUIAIFIY
Ic Lads PUVA ASA
OCLAA-S LUVIN USA
61. Led-S TUVAN- USA
81 Lad-s LUVIN ASA
LILad-S TaVW- SA
91LaA-S TAVN- USA
SILad-$ PUVA ASA
€lLdd-s TYVINN- ASA
CILYA-S LUVIN USA
[1 Ladd-$ PAVIA aSA
OLLYA-STUaVN- ASA
6.LYA-S TUVIN-ASA
8.LYA-S LUVIN ASA
9LYA-S TUVIN-ASA
oN Joqono,
[98S E804
SE8SE80
PE8SE8OA
CE8SC80 A
CEBSE8OA
LE8ses04
O€8SE80A
6C8S E807
8C8S E80
91068084
VLOSOON'T
6LVCOLX A
8LVCOLX A
SSI98ZX>
COLLSVAWN
COLLSVAW
T9LLSVAWN
O9LLSVAWN
6SLLSVAWN
8CICSVAIN
LCEICSVAWN
ICI CSV AN
SCICSTAIN
SIccSv AN
VIccSV AN
elccSvAW
CICCSV AN
CEICSV AN
oN YUBA UIS)
UYHO
UYHO
UYHO
SG
SC
9C
9C
LE
Il
8C
8C
8C
La
La
Lat
Lat
La
La
Lat
La
La
Lat
La
Lat
La
ARs al
9pod ApIBIO'T
epnoly)
epnoly)
epnoly)
epeiodsy
epeiodsy
epnojyuony
epnojyuony
epnojyuony
epnojyuony
Poss Sy UlV [Sqef
PIZNO IPI§
(sIseQ BMIS) BUOLAILZ [J
(sIseQ BAIS) BUOLAIEZ 1g
(SISEO VMIS) BUOTAILZ [gq
ess
ess
ess
ess
ess
ess
ess
ess
ess
ess
ess
ess
ess
ess
Ay]WIO'T
Od90IO/
OdD0IO/
Od90IO/
Od90IO/
OdD0IO/
Od90IO/
OdD0IO/
OdD0IO/
Od90IO/
eISIUN],
vISIUN
AB
AB
AB q
OdD0IO/
OdD0IO/
Od901O/
Od901O/
Od9010/
Od901O/
Od90IO/
Od901O/
Od9010/
Od901O/
Od90IO/
Od901O/
OdD0IO/
Od901O/
AQUNO)D
9800-L
O99VI-L
CSOVIN-L
LLVVIW-8
OLVVW-8
OCCVIN-D
8ICVIN-Y
SICVIN-Y
COCVIT
00607 ALL
€90L66 I
O8cSOON
6LcSOOW
8LcSOOW
[clad
CARE
61. Lat
81LaaA
Li Ld
91 La
SI Lad
elLdd
CLLaA
[1Lad
Ol La
6.LaH
8.La4
9.LaA
9pod ‘v0dS
(ponunuod) "| XTIGNAddV
SLASAAUIDO °
SLASAadUvd °
SLASAadUDO °
SLASAadUvd °
SLASAadUIDO °
SLASAaAUDO °
SLASAadUvd °
SLSadUvd °
SLASadUvd °
SLASAaAUIDO °
SLASAadUDd °
SLASAadUDO °
SLASAadUIDO °
SLASadUvd °
SLYSaduUvd °
SLASAaAUIDO °
SLASadUvd °
SLSAadUvd °
SLASAadUIDO °
SLASadUvd °
SLSAadUvd °
SLASAaAUIDO °
SLYSAadUDO °
SLASAadUIDO °
SLASAaAUIDO °
SLASAadUDO °
SLSaduUvd °
SLASAadUIDO °
soieds
SS a se ae ees pm aay: P| te ay ss EO RS
©ZFMK
Bonn zoological Bulletin 68 (1): 97-124
119
(P10Z) °
(P10Z) °
(P10Z) °
(P1OZ) °
(PL07) °
(P10) °
(P107) °
(PL07) °
(PIO) °
(P10Z) °
(P107) °
(P10) °
(PL07) °
(P10) °
(P1O7) °
(P10Z) °
Caval
(PLO0Z) °
(P10Z) °
(P10) °
(P107) °
(PIO0Z) °
(VIO) °
(PL0Z) °
(P1O0Z) °
(P10) °
(PLO7) °
(P10Z) °
Biogeographic history of Gerbillus campestris
[e 30 SPJOOIN
[e 39 SPJOOIN
[e 10 SPJOOIN
[e 30 SPJOOIN
[e 19 SPJOOIN
[e 10 SPJOOIN
[e 10 SPJOOIN
[e 30 SPJOOIN
[e 39 SP[OOIN
[e 30 SPJOOIN
[e 19 SP[OOIN
[e 39 SPJOOIN
[e 10 SPJOOIN
[e 19 SP[OOIN
[e 39 SP[OOIN
[e 30 SP[OOIN
[e 30 SPJOOIN
[e 19 SPJOOIN
[e 19 SPJOOIN
[e 10 SPJOOIN
[e 10 SPJOOIN
[e 19 SPJOOIN
[e 10 SP[OOIN
[e 30 SPJOOIN
[e 19 SPJOOIN
[e 10 SPJOOIN
[e 10 SPJOOIN
[e 39 SPJOOIN
IIUIAIJFIY
oN JOqon0,A
LO8SE8O A
098S E807
6S8S E807
8S8SE80 4
LS8SE804
9S8S E807
816Se804
SS8SE80
PS8SE80A
ES8SC80
CS8SE8OA
[S8Se8)0 4
OS8S E802
68S E807
8P8Se80 7
LV8Ses0r
9V8SE80A
SV8Se80
PV8SE80A
EV8SC80 A
CV8S E807
[v8Se80 4
OV8SE80%
6E8S E807
8E8SC80 A
LE8SE8OA
9E8SE8OA
LI6S E807
oN WUBE UI)
6l
OC
OC
OC
Ic
Ic
INV
INV
INV
ZI
ZI
UHO
9pod ApIBIO'T
Yooxer, N Wy OZ
WIDON PpenoO
WIDON peo
WIDUN PenoO
eqeysnog pis
eqeysnog Ipis
ayeunoy
aeunoy
aeuno0y
aAvqnoyyinog
ZV [A INnos
ZV [A INOs
ZV [A INOS
ZV [A INOS
ZV [A INnOs
ZV [A INOs
IRDOW.T IPIS
IRIDOW.T IPIS
eSI97 BID
esI97 BID
eSI97 BID
esI97 BLD
eSI97 BID
eSI97 BID
eSI97 BID
esI97 BID
eSI97 BID
epnolyy)
Ay]VIOT
Od901O/
Od90IO/
Od901O/
Od90IO/
OdD0IO/
Od90IO/
OdD0IO/\
OdD0IO/
OdD0IO/
OdD01O/
Od90IO/
OdD0IO/
Od90IO/
OdD01O/
Od90IO/
Od90IO/
Od901O/
OdD01O/
Od901O/
Od90IO/
Od90IO/
Od901O/
Od90IO/
Od901O/
Od901O/
Od901O/
OdD0IO/
Od901O/
AQUNO)
Loar}
LAY. CALS
OCVNO I
CHNOA I
CCHS S
OTES-S
TOH.LO-1
OIG.LO-1
608.LO-1
9T6VN-6
S68VIN-€
O68VIN- I
688VIN- I
8L8VINN- I
SS8VIN-E
CS8VWN- I
Svs8VIN- I
VP8VIN-E
S~LVIW-9
vrLVW-9
eVLVW-9
CVLVIW-9
6eLVW-9
SCLVW-9
6IZLVIN-9
9ILVIN-9
SILVIN-9
[900-4
9pod “v0dS
(ponunuod) "| XTIGNAddV
SLJSAAUDI “DH
SLJSAAUDI “DH
SLIJSAAUDI “DH
SLJSAAUDI “DH
SLJSAAGUDI “DH
SLAJSAAUDI “DH
SLAJSAACUDI “DH
SLISAAUDI “DH
SLAJSAAUDI “DH
SLAJSAAUDI “DH
SLJSACUDI “DH
SLAJSAAUDI “DH
SLAJSAGUDI “DH
SLAJSAAUDI “DH
SLJSAAUDI “DH
SLAJSAAUDI “DH
SLJSAAUDI “DH
SLJSAAUDI “DH
SLJSAAUDI “DH
SLISAAUDI “DH
SLAJSAAUDI “DH
SLJSAGUDI “DH
SLIJSAAUDI “DH
SLAJSAAUDI “DH
SLJSAAUDI “DH
SLAJSAAUDI “DH
SLJSAAUDI “DH
SLAJSAGUDI “DH
soieds
©ZFMK
Bonn zoological Bulletin 68 (1): 97-124
Oussama Bouarakia et al.
120
(P1O7) °
(P107) °
(PLO7) °
(PL0Z) °
(P10) °
(P107) °
(P107) °
(P10Z) °
(P10) °
(P107) °
(P10) °
(P10) °
(P10Z) °
(P10) °
(PLOZ) °
(P10Z) °
(P10Z) °
(PL07) °
(P107) °
(P10Z) °
(PL0Z) °
(PLO0Z) °
(PLOZ) °
(P10) °
(PL07) °
(P10Z) °
(P10Z) °
(P1OZ) °
[e 19 SPJOOIN
[e 10 SPJOOIN
[e 10 SPJOOIN
[e 30 SPJOOIN
[e 10 SP[OOIN
[e 10 SP[OOIN
[e 30 SP[OOIN
[e 10 SPJOOIN
[e 10 SPJOOIN
[e 19 SPJOOIN
[e 10 SPJOOIN
[e 30 SPJOOIN
[e 30 SPJOOIN
[e 10 SP[OOIN
[e 19 SPJOOIN
[e 19 SPJOOIN
[e 10 SP[OOIN
[e 19 SPJOOIN
[e 19 SPJOOIN
[e 19 SPJOOIN
[e 19 SPJOOIN
[e 10 SPJOOIN
[e 10 SPJOOIN
[e 30 SPJOOIN
[e 39 SPJOOIN
[e 30 SPJOOIN
[e 10 SPJOOIN
[e 10 SPJOOIN
IIUIAIFOY
oN JOqon0,
S68SE80 4
68S E807
C68S C807
CO8S E802
L68S E804
068S E80
688S E80 A
888SE80 4
L88S C80 4
988S E802
S88SE80 4
P88S E807
E88SC80 4
C88S E807
[88S€8)0 4
O88S E80 A
6L8S E80 A
8L8SE80 4
LL8SE80A
9L8S E807
SL8SE80 4
PL8SE80A
EL8SC80 4
CLES E807
[L8S E804
OL8S E802
698S E802
898S C807
oN YUBA UIS)
LI
EI
LI
81
81
81
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
6l
9pod ApITBIO'T
elmnoessy § WY S
elmnoessy § UY S
elmnoessy § WY S
elmnoessy § Wy ¢
elmnoessy § Wy ¢
elmnoessy § Wy ¢
YyooyeeA, N Wy OZ
YyOoyeUeA, N Wy OZ
YOoyeLeA, N Wy OZ
YyooyeLeA, N WY OZ
YOoyeURA, N Wy OZ
YyooyeUeA, N Wy OZ
YyooyeueA, N WY OZ
YOoyeLeA, N Wy OZ
YOoyeLRA, N WY OZ
YOoyeLeA, N Wy OZ
YOoyeUeA, N WY OZ
YyooyeUeA, N Wy OZ
YOoyeLRA, N WY OZ
YyooyeueA, N Wy OZ
YOoyeLRA, N WY OZ
YOoyeLeA, N Wy OZ
YooyeLeA, N Wy OZ
YyooyeLeA, N Wy OZ
YOoyeUeA, N Wy OZ
YOoyeLeA, N WY OZ
YOoyeLRA, N Wy OZ
YOoyeLeA, N Wy OZ
Ay]VIOT
Od90IO/
Od901O/
Od90IO/
Od90IO/
OdD0IO/
Od90IO/
OdD0IO/
OdD0IO/
Od90IO/
Od901O/
OdD0IO/
OdD0IO/
Od901O/
Od90IO/
OdD0IO/
OdD0IO/
Od901O/
Od901O/
Od901O/
OdD0IO/
OdD0IO/
Od901O/
Od9010/
Od901O/
Od90IO/
Od901O/
OdD0IO[
OdD01O/
AQUNO)
eee l=]
8cDT°1
Leal]
8cDT"1
LOD TAL
6 a |
SCOTTI
BOOT]
CCO'T- |
Wee eal
OC Tl
GLO}
81D 1-1
SED Ea
SIDT-1
VIDT-I
1 ES 1A Be
Cloves
HOTT
CLOVE]
Gols
sO 1-1
LD I-[
9D'T 1
SOT 1
Peale]
EVAL
COT 1
9pod “90ds
(ponunuod) "| XTIGNAddV
SLSadUvd °
SLASAadUIDO °
SLASAadUDO °
SLASAadUvd °
SLYSadUvd °
SLYSAadUDO °
SLASAadUIDO °
SLASAadUvd °
SLASAadUDO °
SLASAAUID °
SLASAadUIDO °
SLASAadUDO °
SLASAAUIDO °
SLASAadUvd °
SLASAadUvd °
SLASAAUIDO °
SLASAadUvd °
SLASAadUIDO °
SLASAadUID °
SLASAadUIDO °
SLASAadUDO °
SLASAaAUID °
SLYSAadUDvd °
SLASAadUDO °
SLASAAUIDO °
SLYSAadUvd °
SLSaduUvd °
SLASAadUIDO °
soieds
Se a oe ae Ses As ie Oe SS
©ZFMK
Bonn zoological Bulletin 68 (1): 97-124
121
Biogeographic history of Gerbillus campestris
(PIOT) Te 19 SeJOOIN CLOSE8OA I (Se1OJ] Sop IeIpy) IWolpy TRA LAAOQE0-% S1AISadwupd ‘H
(PILOT) ‘Te 39 SPJOSIN 616SE80M 8 W]eSSo Te SCSAL-Z —- Slusadwupd ‘DH
(PILOT) TB 39 SPJOSIN 998S E807 8 W]eSsa Te 9909W-7J Os S1ISadwuipd “DH
(PLOT) Te 39 SPJOSIN S98SE8OM 8 {]eSsoa Te 6S6SIW-T Os S1JSadwupd ‘DH
(PILOT) Te 39 SPJOSIN OLSOSEND 6 JOUIeLUUTe eIsIun |, WHLI-p = SLsadiuva “DH
(PIOT) ‘Te Jo SBJOSIN 69S9SENDO 6 JOUTeUTWUe PY eIsIUN |, WHEI-p = SLusadiuva “DH
(PIOZ) Te 19 SPJOOIN 89S9SENO 6 JOWRUIUWIeH eIsIUn |, WHO7C-b = SLsadiuva “DH
(PLOT) Te 39 SPJOSIN LOSOSENMO 6 JOUIeLUUe eIsIUn WH9-? SLASAAUDI “DH
(PLOT) ‘Te 12 SBJOOIN 99S9SENDO 6 JOUTeUTWUe PY eIsIUN |, WH8I-p = SLsadiuva “DH
(PIOZ) Te 19 SeJOOIN S9SOSEND Ol euipoynog eIsIUn |, Hd9T-p ss SISadwuip9 “H
(PIOTZ) ‘Te 12 SeJOSIN [l6S€804 Il PIZNog IPs eIstuny, IAAP90-p = SLsadupa “5
(PIO) ‘Te 12 SeJOSIN OL6S€804 Il PIznog Ip!s eIstun IAA€90-p = SLSadiupa “+
(PIOT) ‘Te 19 SBOOIN VI8SE8OA Gl jowolq [q golpeH CLIOS[V €9|-1 SLAJSAAUDI “DH
(PILOT) Te 39 SPJOSIN C98SE8O A GL jowolq [q golpeH BLIOS[V 611-7 SLAJSAAUDI “DH
(PIOT) Te 19 SRJOOIN TIBSE8IM a jowald [4 qefpey elas[V L6-b Sisadups “5
(PILOT) ‘Te Jo SBJOOIN 9T6SE80M El Inopinog OdD0OIOW. =ZTAATZOO-] = SSadupa ‘DH
(PIOT) ‘Te 0 SeJOSIN LO6S E80 vi SSNOS pono § UT ¢ ODSOIOJ IQDT-1 = Silsadwupa “
(PIOTZ) ‘Te 12 Se[OSIN 906S £804 vi SSNOS pono § UT ¢ OSS0IO/ O9DT-E = SLsadupa “H
(PIOT) Je 19 SPJOOIN CO06SE80M cl ssnog pono § Wy ¢ ODDO0IOJ SSN 1-1 SLASAAUDI “DH
(PIOT) ‘Te 19 SRJOOIN vO6S E807 SI SSNOS pono § UY ¢€ OIS0IOJ LSOT-1 = Siisadwupa “5
(PIO) ‘Te 32 SeJOSIN €06S E807 91 bIINOBSSH § UY OT OSS0IO/ ESOT-1 = Stapsadiupa “5
(PIO) ‘Te 12 SeJOSIN CO6S E807 91 bIINOBSSH § UY OT OIS0IOJ TSOT-E = SL.sadwupa “H
(PIOTZ) ‘Te 32 SeJOSIN L06S E804 oI blINORSSH § UL OT ODSOIO/ ISOT-1 = Sisadwupa
(PLOT) ‘Te 10 SBJOSIN O06S £807 91 elmnoessy § WY 07 ODD0IO/I SPO T-[ sidjsadiupoa
(PILOT) ‘Te 39 SPJOSIN 668S E804 7A | eimnoessy S$ WY ¢ ODDO01OJ| CPN 1-1 siasadups ‘
(PILOT) Te 39 SPJOSIN 868S E80 ial eimoessy S$ WY ¢ ODDOIO TPOT-1 = SLusadupa “DH
(PILOT) Te 39 SPJOSIN LO8S E807 LI eimoessy S$ WY ¢ ODD01O/ IPOT-1 = Stagsaduin9 “5
(PLOT) Te 39 SPJOSIN 968S E804 LI eimoessy S$ WY ¢ ODDOIOJ OPOT-| siysadups ‘Dp
JIUIAIJOY] oN JOqono,d oN WuBgquesy 9pos AjI[BIOT A}IBIO'T AQUNO) Ipod ‘deds soiseds
(ponunuod) "| XTIGNAddV
©ZFMK
Bonn zoological Bulletin 68 (1): 97-124
Oussama Bouarakia et al.
122
(S10Z) Te 19 eryesenog
(ZI0Z) [B19 OAVIPN
(S107) Te 19 elyeenog
(S007)
AUSIQO 7 JOIAYD
(Z10Z) Je 39 UeMYIS
(ZI0Z) Te 19 OAVIPN
(Z10Z) [2 19 OAVIPN
(GE107) Te 19 SACIPN
(PIOZ) ‘Te 39 JoIADY
(pIOZ) Te 19 SBJOOIN
(pIOZ) Te 10 SeJOOIN
(pIOZ) Te 10 SeJOOIN
(pIOZ) ‘Te 19 SeJOOIN
O1L6099HW
CO8CSONL
[l6099HN
[ZclSsfv
v68cocxl
LOVI CONE
OOVI CONE
81 c96Vd a
9TL9ECIN
S16Se804
PI6OSE80A
LO8CSONE
€l6Se80
N
= EB OPM Ee} st mM
(Se1OJ] Sop IeIpy) Iolpq
BULIOYUIS
no[sV
Nd essepy ssnos
(zapesy) WV
sTuepey
welesnohH
IV
IV
(SeJOJ] Sop JeIpy) sJWolpy
ODD0IO/|
ODD0IO/
ODD0IO/
Te
Te
0D9010J\
0d9010J\
JOSIN
eAqry]
JOSIN
JOSIN
JOSIN
Te
1UOUIS “L)
snulsadsay “5
idajuay “5
O€06661 sLusadiua “5
cel
“600¢d ZT
C8OT SLAJSACUDI “DH
SLOT SLAJSAAUDI “DH
Or06661 sLusadwupa “5
T878PdINN = Siusaduipo ‘5
TAAB8LT-C Stuisaduipa “1
TAAOb0-% = SiuIsaduipa “+
1O8TS9-T —_ SLusadutpo “5
IAAPE0-Z SiuISaduipa “+
SLIJSAAUDI “DH
(ponunuos) ‘| XIGNAddV
©ZFMK
Bonn zoological Bulletin 68 (1): 97-124
Biogeographic history of Gerbillus campestris 123
APPENDIX ILI.
Projection of male individuals on the first two axes (F1 and F2) of the principal component analysis (PCA). Different colours
represent different localities (Chrouda: black; Aounate: green; Kenitra: blue; Merja Zerga: red; Guercif: orange; Fritissa: pur-
ple). The dashed ellipses (added for clarity) represent the six populations.
Observations (axes F1 and F2: 76,63 %)
F1 (66,45 %)
Bonn zoological Bulletin 68 (1): 97-124 ©ZFMK
124 Oussama Bouarakia et al.
APPENDIX III.
Projection of female individuals on the first two axes (F1 and F2) of the principal component analysis (PCA). Different colours
represent different localities (Chrouda: black; Aounate: green; Kenitra: blue; Merja Zerga: red; Guercif: orange; Fritissa: purple).
The dashed ellipses (added for clarity) represent the six populations.
Observations (axes F1 and F2: 76,01 %)
.
°
"ee, get
*eeenee®
psaseessaPennneernens,, ot
aeuee “ee
ot fe
.*” *48°
3
ANT @ *
+* Pid .
=
é :
.
_
&
ite)
t
sa
el
N
LL
s *s
oe
2
ie
ofn
0 1
F1 (62,55 %)
Bonn zoological Bulletin 68 (1): 97-124 ©ZFMK
Bonn zoological Bulletin 68 (1): 125-146
2019 - Steenis J van et al.
https://do1.org/10.20363/BZB-2019.68.1.125
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org:pub:D11F29FC-D803-44BD-850E-6A0895E268C3
Hoverflies (Diptera: Syrphidae) of Cyprus:
results from a collecting trip in October 2017
Jeroen van Steenis'’", Menno P. van Zuijen’, Wouter van Steenis*, Christodoulos Makris*,
André van Eck* & Ximo Mengual®
‘Naturalis Biodiversity Center, Leiden. Hof der Toekomst 48, NL-3823 HX Amersfoort, The Netherlands
?Kolkakkerweg 21-2, NL-6708 RK Wageningen, The Netherlands
>Naturalis Biodiversity Center, Leiden. Vrouwenmantel 18, 3621 TR Breukelen, The Netherlands
*Ethnikis Antistaseos 21, 3022 Lemessos, Cyprus
> Korte Hoefstraat 30, 5046 DB Tilburg, The Netherlands
°Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany
* Corresponding author: Email: [email protected]
'urn:lsid:zoobank.org:author:C7FODO01C-B182-4B93-AF73-E4154367B535
?urn:Isid:zoobank.org:author:C82093 D8-EE58-47DD-B13A-4F47BDF73911
3urn:Isid:zoobank.org:author:59753746-8 DB9-4954-A22B-6D5D582132A2
*urn:Isid:zoobank.org:author:B13BD7FB-27F2-4F33-A5C2-D281947E2309
>urn:lsid:zoobank.org:author:3F9CD483-BDC2-43C5-9235-CADF874C427D
°urn:|sid:zoobank.org:author:A5093 1OD-B567-4830-B8A4-BCB139BB8768
Abstract. In October 2017 an international expedition to Cyprus was made in order to collect hoverflies (Diptera: Syr-
phi-dae) and to improve knowledge of the local fauna. In twelve days, numerous localities were visited in a wide range
of habitats, where Syrphidae were collected by hand net. Malaise and pan traps were placed in some sam-pling localities
around the Troodos Mountains. In total, 52 Syrphidae species were collected, 23 of which represent new species records
for the island and another three belong to undescribed taxa. Newly obtained DNA data from the genera Merodon and
Ceriana indicate a large interspecific morphological variation within Merodon sp. nov. | and support the recent split of
C. glaebosa Van Steenis & Ricarte, 2016 from C. vespiformis (Latreille, 1809).
Key words. Hoverfly, Cyprus, faun. nov., DNA, ecology.
INTRODUCTION
Short collecting trips in connection with the Internation-
al Symposium on Syrphidae in Finland (2007) were fol-
lowed by expeditions to Serbia (Van Steenis et al. 2015),
the Russian Far East (Mutin et al. 2016) and Taiwan
in 2016. For 2017, a further expedition was planned to
collect hoverflies (Diptera, Syrphidae); a priori the aim
was to visit SE Europe and collect Mediterranean spe-
cies of the genera Eumerus Meigen, 1822 and Merodon
Meigen, 1803. The recent papers on Eumerus (Grkov-
i¢ et al. 2015), Pseudodoros Becker, 1903 (Van Eck &
Makris 2016), Merodon (Sa8ié et al. 2016) and the tribe
Cerioidini (Van Steenis et al. 2016) plus the contacts al-
ready established by André van Eck were decisive in se-
lecting Cyprus as the collecting destination. The collect-
ing trip to Cyprus had the aim of improving the current
knowledge of the syrphid fauna of the island, especially
to sample the species occurring in autumn. This collect-
ing trip fitted with the current project run by André van
Eck to establish the first hoverfly checklist of Cyprus.
Received: 23.12.2018
Accepted: 04.06.2019
The results of the present report will be included in the
final checklist for Cyprus.
MATERIAL AND METHODS
From October 1 to October 13" 2017 Syrphidae sam-
pling was carried out in the Republic of Cyprus, mainly
in the central and western parts of the island.
Syrphidae were collected by hand net from morning to
late afternoon, with most specimens collected between 10
am and 4 pm. Before 10 am the sun was still too low and
in the mountains it was cold (<20°C), facts that hindered
us from collecting hoverflies, as syrphids needed to warm
up before starting to fly or feed. After 4 pm the tempera-
ture fell slowly, but with the onset of sunset most Syrphi-
dae ceased flying. On more cloudy days, lower altitudes
were visited to make collecting still possible in warm and
sunny weather.
Plant names provided in the present work follow the
nomenclature from The Plant List (2013).
Corresponding editor: R. Peters
Published: 01.07.2019
126 Jeroen van Steenis et al.
Fig. 1. Malaise trap sites. A. Pera Pedi. B. Pine forest above Trooditissa picnic site. C. Paphos forest, Appides stream. D. Troodi-
tissa — Prodromos road E804.
Collecting by Malaise and Pan Traps
In several sampling sites, pan traps and Malaise traps
of different fabrics were used. Malaise traps were ei-
ther home-made or commercial models, both based on
Townes’ model (Townes 1972) (Fig. 1). One commercial
model consisted of two single Malaise traps sewn togeth-
er along the lowest part, making it twice as long and with
two collecting heads (Fig. 1C). All the collecting heads
had a capacity of 0.5 to 0.7 L and were filled with at least
90% pure ethanol. The pan traps were of two types in
the colours white and yellow. The collecting medium
consisted of water with diluted salt as preservative and a
detergent to reduce surface tension. After collecting, all
specimens were rinsed several times in at least 90% pure
ethanol and stored in plastic bags. Finally, the collected
specimens were transferred to plastic vials prior to study.
Bonn zoological Bulletin 68 (1): 125-146
Search for immature stages
We searched for larvae and puparia in aphid colonies,
decaying and rotting plant material, live rootstocks and
other habitats with decaying organic matter such as open
and closed rot holes and sap streams on live trees. Wa-
ter-filled rot holes in trees were searched for larvae but
did not render any specimens.
Several times, bulbs were dug out to check for larvae
or larval feeding signs. In the field, no larvae were found
in the bulbs. In order to check for the presence of larvae,
two plants (its bulbs and most of its tubers) of Aspho-
delus aestivus Brot. and 15 bulbs of Colchicum troodi
Kotschy (Fig. 2E) and Prospero autumnale (L.) Speta
(Fig. 2D) were removed for potential rearing of larvae.
The bulbs of each species were placed together in plas-
tic containers and covered with a soil and sand mixture.
The containers were kept indoors at room temperature
and watered several times a week. Each container was
covered by an entomological net in order to capture any
freshly hatched specimens.
©ZFMK
Hoverflies of Cyprus: results from a collecting trip in October 2017 127
Fig. 2. Flowers. A. Taraxacum cyprium, Trooditissa picnic site. B. Cachrys crassiloba, Pera Pedi. C. Foeniculum vulgare, Gialia
River near Agios Sozomenos. D. Prospero autumnale, Kourio near ancient Kourion stadium. E. Colchicum troodi, Trooditissa
picnic site. KF. Crithmum maritimum, Kavo Gkreko.
Localities visited la. Saittas to Mesa Potamos (34°52’29.25”N
32°54’53.40”E, 706 m. a.s.l.). Small valley in a Pinus
A total of 25 different sampling localities were surveyed brutia Ten. forest with Alnus orientalis Decne., Pla-
during the collecting trip: tanus orientalis L., Quercus alnifolia Poech, Stvrax
Bonn zoological Bulletin 68 (1): 125-146 ©ZFMK
128
1b.
Te!
officinalis L. and flowering Hedera pastuchovii sub-
sp. cypria (McAllister) Hand. Visited on 2.X.2017.
Almyrolivado (34°55’33.38"N = 32°53’24.00”E,
1546 m. as.l.). Small stream in Pinus nigra forest
with Dittrichia viscosa subsp. angustifolia (Bég.)
Greuter, Rubus sanctus Schreb. and Epipactis vera-
trifolia Boiss. & Hohen. Visited on 2.X.2017.
Saittas to Fylagra (34°53'01.69"" N 32°55'16.75" E,
757 m. a.s.l.). Stream valley in Pinus brutia forest re-
covering from fire, with Platanus orientalis, Quercus
alnifolia, Arbutus andrachne L., Tamarix smyrnensis
Bunge and flowering Dittrichia viscosa subsp. angus-
tifolia. Visited on 2.X.2017.
2. Trooditissa picnic site (34°54'53.05" N 32°50'32.14"
E, 1340 m. a.s.l.) (Fig. 3A). Rocky stream banks in
Pinus brutia forest with Alnus orientalis, Platanus
orientalis, Quercus alnifolia and flowering Colchi-
cum troodi, Taraxacum cyprium H. Lindb. and Hede-
ra pastuchovii subsp. cypria. Visited on 2.X, 4.X.and
OX IOLY:.
. Pera Pedi, abandoned vineyard (34°51'56.8" N
32°50'55.91" E, 881 m. a.s.1.). Flower-rich abandoned
vineyard next to Pera Pedi - Mandria road with flow-
ering Foeniculum vulgare (Fig. 2C), Dittrichia vis-
cosa subsp. angustifolia, Cachrys crassiloba (Boiss.)
Meikle, Polygonum equisetiforme Sm., Chondrilla
Juncea L. and Hypericum triquetrifolium Turra. Vis-
ited on 2.X, 4.X. and 12.X.2017. Three Malaise traps
were used in this locality (Figs 1A, 3B).
. Hala Sultan Tekke (34°53'10.37" N 33°36'30.74" E,
5 m.a.s.l.) (Fig. 3C). Dry canal at the west side of the
Larnaka Salt Lake with abundant flowering Polygo-
num equisetiforme, Foeniculum vulgare and Aspara-
gus horridus L. Visited on 3.X.2017.
5. Akrotiri marsh (34°37'38.92" N 32°56'27.78" E, 5 m.
a.s.1.). Open area with extensive reed beds dominated
by Phragmites australis (Cav.) Steud. and flower-rich
meadows, partly grazed by cattle, with Foenicu-
lum vulgare, Dittrichia viscosa subsp. angustifolia
and Polygonum equisetiforme. Visited on 3.X. and
10.X.2017.
6. Pine forest above Trooditissa picnic site (34°55'05.8"
N 32°50'55.95" E, 1480 m. a.s.l.). Small open area
next to a flowing stream, with flowering Dittrichia
viscosa subsp. angustifolia, Rubus sanctus and Jun-
cus spp. The dominant species in the surrounding
pine forest were Pinus brutia, Pinus nigra subsp.
pallasiana (D. Don) Holmboe, Juniperus foetidissi-
ma Willd., Cistus creticus L. and Genista fasselata
Decne. Visited on 4.X. and 12.X.2017 (Fig. 1B). Two
Malaise and several pan traps were placed here.
7. Alassa, north side of Kouris Dam, (34°45'34.34" N
32°55'53.92" E, 217 m. a.s.l.). Dry bank of dam with
meadows and deep ravines, some of which still con-
tained water, and flowing river with reed beds, Jun-
cus spp., Piptatherum miliaceum (L.) Coss., Tamarix
Bonn zoological Bulletin 68 (1): 125-146
Jeroen van Steenis et al.
spp., Mentha longifolia subsp. cyprica (Heinr. Braun)
Harley and Dittrichia viscosa subsp. angustifolia.
Visited on 4.X.2017.
8. Gialia River near Agios Sozomenos (35°03'0.41"" N
33°26'27.89" E, 184 m. a.s.l.). Wide flat dry river
bed with Vitex agnus-castus L., Nerium oleander L.,
Tamarix smyrnensis and abundant flowering Foenic-
ulum vulgare and Dittrichia viscosa subsp. angustifo-
lia. Visited on 5.X.2017.
9. Agios Sozomenos (35°04'01.8" N 33°26'13.19" E,
10.
1
1.
13:
14.
202 m. a.s.l.). Rocky slope at field boundary with
Ziziphus lotus (L.) Lam. bushes and phrygana with
Thymbra_ capitata (L.) Cav., Noaea mucronata
(Forssk.) Asch. & Schweinf. and several non-flower-
ing bulbous plants. Visited on 5.X.2017.
Valley along Karvounas-Kakopetria road (B9)
(34°58'28.77" N 32°54'46.96" E, 790 m. a.s.l.)
(Fig. 4A). River valley with riverine broadleaved for-
est and a gravel road bordered by Polygonum equi-
setiforme and several non-flowering bulbous plants.
The dominant species in the broadleaved forest were
Alnus orientalis, Platanus orientalis and flowering
Hedera pastuchovii subsp. cypria. Visited on 5.X.
and 9.X.2017.
.Paphos forest, Appides stream (34°59'28.6" N
32°38'49.2" E, 747 m. a.s.l.) (Fig. 1B). Small stream
with Alnus orientalis, Platanus orientalis and flow-
ering Rubus sanctus, Colchicum troodi and Hedera
pastuchovii subsp. cypria. The dominant species in
the surrounding montane pine forest were Pinus bru-
tia, Quercus alnifolia, Arbutus andrachne and Cistus
spp. Visited on 6.X. and 12.X.2017. Two Malaise and
several pan traps were placed in this locality.
Paphos forest, Livadi Picnic site near Pomos village
(35°06'06.2" N 32°35'37.33" E, 366m. a.s.l)), Large
open area around small streams, with Alnus orien-
talis, Platanus orientalis and flowering Foeniculum
vulgare and Dittrichia viscosa subsp. angustifolia in
montane forest dominated by Pinus brutia, Quercus
alnifolia and Cistus spp. Visited on 6.X.2017.
Asomatos, near Limassol Salt Lake (34°37'37.46" N
32°57'17.67" E, 2 m. a.s.l.). Forest corridor in Fasou-
ri forest along the north margin of the Akrotiri Salt
Lake. Fasouri forest is an old plantation with exotic
trees such as Eucalyptus spp., Casuarina cunning-
hamiana Migq. and Acacia saligna (Labill.) H. Wendl.
The north margin of the Akrotiri Salt Lake is covered
by large reed beds dominated by Phragmites austra-
lis and stands of Zamarix tetragyna Ehrenb. Along
the corridor the dominant species were Carex spp.,
Juncus spp., Dittrichia viscosa subsp. angustifolia
and Lotus spp. Visited on 7.X.2017.
Kourio near ancient Kourion stadium (34°40'15.62"
INe32002 28:35," 0.2 2s as (Pie 3D): Open
landscape covered by stands of Pinus brutia and Cu-
pressus sempervirens L. and maquis with Juniperus
©ZFMK
Hoverflies of Cyprus: results from a collecting trip in October 2017 129
Fig. 3. Adult habitat, collecting sites on Cyprus. A. Trooditissa picnic site. B. Pera Pedi. C. Hala Sultan Tekke. D. Kourio near
ancient Kourion stadium. E. Diarizos River south of Tzelefos Bridge. F. Kavo Gkreko.
Phoenicea L., Ceratonia siliqua L., Olea europaea di, Asparagus acutifolius L. and Drimia maritima
L., Pistacia lentiscus L., Cistus parviflorus Lam. and (L.). Visited on 7.X. and 10.X.2017.
Cistus salviifolius L. The area is very rich in bulbous ‘15. Oreites wind farm (34°43'35.12" N 32°37'21.13" E,
plants too. Flowering during our visit were the spe- 370 m. a.s.l.). Hilly area covered with maquis and Pi-
cies Prospero autumnale (L.) Speta, Colchicum troo- nus brutia stands. The dominant species in the maquis
Bonn zoological Bulletin 68 (1): 125-146 ©ZFMK
130
Jeroen van Steenis et al.
Fig. 4. Habitat of Syrphidae on Hedera pastuchovii subsp. cypria. A. Karvounas-Kakopetria road B9. B. Trooditissa-Prodromos
road E804.
16.
Vie
18.
19.
are Ceratonia siliqua, Olea europaea, Quercus coc-
cifera subsp. calliprinos (Webb) Holmboe, Pistacia
lentiscus, Pistacia terebinthus L., Cistus parviflorus,
Cistus salviifolius and flowering Asparagus acutifo-
lius and Drimia maritima. Visited on 7.X.2017.
Mamonia (34°45'41.44" N 32°38'35.51" E, 184 m.
a.s.1.). Uncultivated field next to Mamonia — Archi-
mandrita road with Foeniculum vulgare and Polygo-
num equisetiforme. Visited on 7.X.2017.
Kapileio to Limnatis (34°49'0.07" N 32°57'50.59" E,
372 m. a.s.l.). Dry stream bed with A/nus orientalis,
Arundo donax L. and flowering Foeniculum vulgare,
Dittrichia viscosa subsp. angustifolia and Polygonum
equisetiforme. Visited on 8.X.2017.
Mesa Potamos (34°52'33.09" N 32°54'48.70" E,
720 m. a.s.l.). Stream in Pinus brutia forest with A/-
nus orientalis, Platanus orientalis, Quercus alnifolia
and flowering Hedera pastuchovii subsp. cypria. Vis-
ited on 8.X.2017.
Stream near Trikoukkia monastery on Trooditissa —
Prodromos road E804 (34°55'53.18" N 32°50'22.42"
E, 1352 m. as.l.). Stream in Pinus nigra forest with
Alnus orientalis, Platanus orientalis and flowering
Bonn zoological Bulletin 68 (1): 125-146
20.
2M,
D2,
Hedera pastuchovii subsp. cypria. Visited on 9.X.
and 13.X.2017 (Fig. 1D). One Malaise and several
pan traps were placed near low growing Hedera.
Lefkosia, Athalassa National Forest Park
(B57 07233815 1heNI33"22 5894 Fi. l/ Onin. tars je@ pen
lowland area with forest plantation dominated by Pi-
nus spp. Flowering plants were Foeniculum vulgare
and Dittrichia viscosa subsp. angustifolia. Visited on
10.X.2017.
Diarizos River south of Tzelefos Bridge and north
of Arminou Dam (34°53'11.71" N 32°44'46.54" E,
460 m. a.s.l.). Flower-rich meadows close to the dam
and surrounded by steep slopes with Alnus orientalis,
Platanus orientalis, Tamarix smyrnensis and montane
forest dominated by Pinus brutia, Quercus coccifera
subsp. calliprinos, Styrax officinalis and Pistacia ter-
ebinthus. Flowering plants were Foeniculum vulgare,
Dittrichia viscosa subsp. angustifolia and Polygonum
equisetiforme. Visited on 11.X.2017 (Fig. 3E).
Platys Valley (34°54'50.97" N 32°46'0.59" E, 550 m.
a.s.1.). Narrow valley with steep slopes along Diarizos
River with a narrow gravel road next to the river. The
dominant species in the valley were A/nus orienta-
©ZFMK
Hoverflies of Cyprus: results from a collecting trip in October 2017 131
lis, Platanus orientalis, abundant flowering Hedera
pastuchovii subsp. cypria and sporadically flower-
ing Colchicum troodi. The valley was surrounded by
montane forest dominated by Pinus brutia, Quercus
alnifolia, Acer obtusifolium Sm. and Cistus spp. Vis-
ited on 11.X.2017.
23. Komititzi picnic site near Mylikour village
(34°56'50.57" N 32°46'29.18" E, 655 m. a.s.l.). Open
area in Pinus brutia forest next to a stream with Alnus
orientalis, Platanus orientalis, flowering Colchicum
troodi and abundant flowering Hedera pastuchovii
subsp. cypria. Visited on 11.X.2017.
24. Diarizos River near Prastio village (34°47'51.96" N
32°42'20.46" E, 320 m. a.s.l.). Broadleaved riverine
forest with A/nus orientalis, Platanus orientalis and
meadows with flowering Foeniculum vulgare, Dittri-
chia viscosa subsp. angustifolia, Polygonum equiseti-
forme and Rubus sanctus. Visited on 12.X.2017.
25. Kavo Gkreko (34°57'50.38" N 34°04'50.24" E, 9 m.
a.s.1.). Rocky coast with sparse vegetation dominat-
ed by Crithmum maritimum L. (Fig. 2F). Visited on
13.X.2017.
Adult identification
We used available general literature for the identification
of the collected specimens to genus and species level
(Van Veen 2004; Speight & Sarthou 2017) and the fol-
lowing genus specific literature: Callicera Panzer, 1806
(Speight 1991; Smit 2014); Eumerus (Sack 1932; Stack-
elberg 1961; Vuji¢ & Simié 1998; Grkovié et al. 2015);
Merodon (Hurkmans 1993; Radenkovic¢ et al. 2011;
Popovic et al. 2015; Vujic et al. 2018); Paragus Latreille,
1804 (Sorokina & Cheng 2007); Pipiza Fallén, 1810
(Vujic¢ et al. 2013); Sphaerophoria Lepeletier & Serville,
1828 (Bankowska 1964) and Syritta Lepeletier & Ser-
ville, 1828 (Lyneborg & Barkemeyer 2005).
Images
Habitat photos were made by the first author with a
Nikon Coolpix P510. The images of the pinned adults
were made with a Canon EOS D6 DSLR camera with
a Canon MP-E 65 mm 1-—5x macro lens mounted on a
Cognisys StackShot macro rail. Lighting was provided
by a Yongnuo macro ring lite yn-14ex. Several images of
the specimens were stacked with Zerene Stacker 1.04 and
further edited with GNU Image Manipulation Program
(GIMP 2.8.22).
DNA analysis
Several specimens were selected to sequence the Folmer
region of the mitochondrial cytochrome c oxidase sub-
unit I (COI), the so-called DNA barcode (Hebert et al.
2003).
Bonn zoological Bulletin 68 (1): 125-146
One to three legs of either dry pinned, or ethanol-pre-
served, specimens were used for DNA extraction. Ex-
tractions were carried out using the NucleoSpin Tissue
DNA Extraction kit (Macherey-Nagel, Duren, Germany)
following the manufacturer’s instructions; samples were
resuspended in 100 ul ultra-pure water. Entire specimens
were preserved and labelled as DNA voucher specimens
for the purpose of morphological studies and deposited
at the Zoological Museum Alexander Koenig [ZFMK],
as listed in Appendix I.
The COI sequence fragment was amplified using
the forward primer LCO-1490 (5'-GGTCAACAAAT-
CATAAAGATATTG-3') and the reverse primer 780R
(5'-CCAAAAAATCARAATARRTGYTG-3’). PCR
amplification protocols for mitochondrial COI were the
same as described in Mengual et al. (2008, 2012). Am-
plified DNA was electrophoresed on 1.5% agarose gels
for visual inspection of amplified products. PCR prod-
ucts were enzymatically treated with ExoSap-IT (USB,
Cleveland, OH, USA) and then sequenced (using the
PCR primers) in both directions. The sequences were
edited for base-calling errors and assembled using Ge-
neious R7 (version 7.1.3, Biomatters Ltd.). All new se-
quences were submitted to GenBank (see Appendix I for
accession numbers). The uncorrected pairwise distances
(% similarity) among COI sequences of selected Mero-
don and Ceriana specimens are shown in Appendices I
and II.
RESULTS
DNA sequences
COI sequences were successfully obtained for 11 select-
ed specimens collected on Cyprus in 2017 (Appendix I).
The sequence length varied between 658 and 669 bp. In
order to compare the COI sequences of two different Ce-
riana species, Jeffrey H. Skevington (Canadian National
Collection of Insects, Arachnids and Nematodes, Ottawa,
Canada) kindly shared with us the COI sequences of nine
Ceriana vespiformis (Latreille, 1809), which are deposit-
ed in BOLD (http://www. boldsystems.org/).
Species list
The species list for the collected material is given in al-
phabetical order. The main distribution is mentioned for
each species, and for some species, this is followed by
other information on, for example, threat category and
biology. The information on distribution is mainly from
Dirickx (1994) and Speight (2017); other references are
given for each species separately. Under the section re-
marks, habitat and habit information is given based on
our own observations during the fieldwork in Cyprus. All
collected specimens are given with their locality number.
©ZFMK
M52 Jeroen van Steenis et al.
Callicera macquarti Rondani, 1844
(Fig. SA)
Widespread Mediterranean autumn species (Speight
1991). Recorded from Cyprus (Dirickx 1994).
Remarks. Widespread in the Troodos area (10: 3¢'¢
729; 11: 294 629; 19: 14599). All the females were
collected on Hedera pastuchovii subsp. cypria either
feeding on the flowers or flying close to the leaves and
flowers. Based on our observations, Speight (2017) and
Claussen & Standfuss (2017), Hedera seems to be the
main food source for the adults. Two males were collect-
ed while defending a territory on Pinus nigra (Fig. 5A)
or on leaves of low shrubs near the base of Pinus nigra
in full sun, making short flights and most often returning
to the same spot. Also collected in a Malaise trap and a
white pan trap.
Ceriana glaebosa Van Steenis & Ricarte, 2016
(Fig. 6A)
Endemic species from Cyprus with spring and autumn
populations and a dark and light form (Van Steenis et al.
2016).
Remarks. One light form female was collected on Foe-
niculum vulgare (21). The presumed model (Crabroni-
dae: Cerceris spp. Fig. 6B) was found in several plac-
es (3, 8, 16, 21) where flowering Foeniculum vulgare
was present. DNA barcode comparison shows a 2.79 to
3.04% difference between C. glaebosa and specimens of
C. vespiformis (Appendix IIT) supporting the recent split
of these species (Van Steenis et al. 2016).
Cheilosia thessala Claussen & Stahls, 2007
(Fig. 5B)
First published record of this genus and species for Cy-
prus.
Described from Thessalia, Greece (Claussen & Stahls
2007).
Fig. 5. Adults in their natural habitat. A. Callicera macquarti 3, on Pinus spp. defending a territory, Paphos forest, Appides stream.
B. Cheilosia thessala 3, feeding on Foeniculum vulgare, Diarizos River south of Tzelefos Bridge. C. Milesia crabroniformis °,
egg-laying behaviour near entrance of rot hole in Acer spp., Paphos forest, Appides stream.
Bonn zoological Bulletin 68 (1): 125-146
©ZFMK
Hoverflies of Cyprus: results from a collecting trip in October 2017 133
Fig. 6. Adult Syrphidae and their models, dorsal view. A. Ceriana glaebosa 3. B. Cerceris spp. 2 (model of C. glaebosa). C.
Merodon pruni @. D. Philanthus spp. 2 (model of M. pruni). Scale bar = 1.0 mm.
Remarks. Collected in autumn 2016 in Cyprus for the
first time (pers. comm. Van Eck) based on specimens col-
lected on Hedera in the Troodos mountains. During this
trip, collected in low numbers throughout the Troodos
mountains (2: 23: 19; 3: 19; 10: 6¢¢ 799; 22: 12;
24: 12) mostly on Hedera pastuchovii subsp. cypria, and
Bonn zoological Bulletin 68 (1): 125-146
very abundantly at Tzelefos Bridge (21: 46¢¢ 1499)
visiting flowers of Foeniculum vulgare (Fig. 5B).
Chrysotoxum intermedium Meigen, 1822
Widespread Mediterranean species, recorded previously
from Cyprus (Dirickx 1994).
©ZFMK
134 Jeroen van Steenis et al.
Remarks. The only Chrysotoxum species found in Cy-
prus so far. Collected in a Malaise trap and by hand net
while visiting flowers on Cachrys crassiloba and Foenic-
ulum vulgare (3: 629; 17: 19).
Didea fasciata Macquart, 1834
First published record of this genus and species for Cy-
prus.
Widespread European species. Dirickx (1994) did not
give records from Greece or Turkey.
Remarks. Several males and some females were collect-
ed on Hedera pastuchovii subsp. cypria (2: 173.3 329;
11: 348; 19: 288).
Episyrphus balteatus (De Geer, 1776)
Very common and widespread species. Dirickx (1994)
gave records from Cyprus.
Remarks. Found in most habitats (2: 399; 3: 299; 7:
Le Seer: 2 PO ale] Oe LDC ale DC ie
19: 19; 21: 14 399; 23: 19; 24: 299). Flower visiting
observed on Hedera pastuchovii subsp. cypria, Foenic-
ulum vulgare, Dittrichia viscosa subsp. angustifolia and
Cachrys crassiloba.
Eristalinus aeneus (Scopoli, 1763)
Very common and widespread species, especially in
coastal areas. Dirickx (1994) mentioned records from
Cyprus.
Remarks. Collected in several coastal areas (4: 6¢'¢
999; 7:14; 8: 14:17:14 19; 25: 14 19) at Hala Sul-
tan Tekke in great numbers on Polygonum equisetiforme,
furthermore found on Foeniculum vulgare and Crithmum
maritimum.
Eristalinus megacephalus (Rossi, 1794)
First published record of this species for Cyprus.
Widespread Mediterranean species (see Dirickx 1994),
Remarks. Found at the coastal Akrotiri marsh on Dittri-
chia viscosa subsp. angustifolia and at Tzelefos Bridge
on Foeniculum vulgare (5: 20¢ 19; 21: 12).
Eristalinus taeniops (Wiedemann, 1818)
Widespread Mediterranean species. Georghiou (1977)
recorded it from Cyprus.
Remarks. In Troodos mountains mainly found flower
visiting on Hedera pastuchovii subsp. cypria (7: 14; 10:
4gS 299; 22: 13).
Eristalis similis (Fallén, 1817)
First published record of this species for Cyprus.
Bonn zoological Bulletin 68 (1): 125-146
Widespread Mediterranean species, also migratory far
into Northern Europe (Bartsch et al. 2009).
Remarks. One male specimen was collected visiting
flowers of Hedera pastuchovii subsp. cypria (10).
Eristalis tenax (Linnaeus, 1758)
Very common and widespread species. Dirickx (1994)
mentioned records from Cyprus.
Remarks. Several specimens found feeding on Hedera
pastuchovii subsp. cypria (3: 12; 19: 5299; 21: 19).
Eumerus amoenus Loew, 1848
Widespread Mediterranean species. Claussen & Lucas
(1988) and Vuji¢ & Simi¢ (1998) gave records from Cy-
prus.
Remarks. Widespread and abundantly found species in
Cyprus (2: 1543 59.9; 3: 399: 4: 14; 6: 14; 8: 499;
114g S92 Ss TAs TOE 18826 Ge 21 11 Oe 221305
409; 24: 19). Most often seen flying low over bare
ground or through low vegetation and often close to Col-
chicum flowers. Also found higher in the vegetation and
feeding on Foeniculum vulgare and Hedera pastuchovii
subsp. cypria or basking on leaves of large bushes.
One male hatched from collected tubers of Asphode-
lus aestivus. The hatched male was seen flying close to
the bulbs on 18.11.2018. This is a new host plant for this
hoverfly species and the second time that A. aestivus is
recorded as a host plant for hoverfly immatures (Ricarte
et al. 2008). Other species of Asphodelus L. have been
reported as host plants for other Eumerus species (Ri-
carte et al. 2017). Efflatoun (1922) reared this hoverfly
species from Allium (Alliaceae), potato tubers, water
melon, grapes, rotten paw-paw and damaged rhizomes
of Iris germanica L. (Iridaceae). Furthermore, Assem &
Nasr (1967) reported it as injurious to onion.
Eumerus argyropus Loew, 1848
(Figs 7C, 7D)
First published record of this species for Cyprus.
Mediterranean species (Vujié & Simi¢ 1998; Krpaé et al.
2011; Claussen & Standfuss 2017).
Remarks. Most abundantly found along Appides stream
in Troodos Mountains flying through the vegetation,
sometimes close to Colchicum flowers (2: 23' 19; 3:13;
11:43¢ 1199).
Eumerus basalis Loew, 1848
First published record of this species for Cyprus.
Widespread Mediterranean species (Vuji¢ & Simié 1998).
Remarks. Widespread and common species throughout
Cyprus (3: 3443 899; 8: 19; 10: 234 19; 16: 27¢¢
69 9:17:43 299; 21: 634 19; 22: 13). Found high-
©ZFMK
Hoverflies of Cyprus: results from a collecting trip in October 2017 135
Fig. 7. Adult, A-C, dorsal view; D-F lateral view. A. Pelecocera (Chamaesyrphus) sp. nov. 3. B. Pelecocera (Chamaesyrphus)
pruinosomaculata 2. C. Eumerus argyropus 3. D. Eumerus argyropus 2. E. Eumerus lucidus 2. F. Eumerus rusticus 2. Scale
bar = 1.0 mm.
er in the vegetation than E. amoenus and found flower Eumerus lucidus Loew, 1848
visiting on Polygonum equisetiforme, Foeniculum vul- (Fig. 7E)
gare, Cachrys crassiloba, Colchicum troodi and on Hed-
era pastuchovii subsp. cypria. First published record of this species for Cyprus.
Bonn zoological Bulletin 68 (1): 125-146 ©ZFMK
136 Jeroen van Steenis et al.
Described from Rhodos (Greece) and further known
from mainland Greece (Ssymank 2013; Claussen &
Standfuss 2017).
Remarks. Identity confirmed by Ante Vujic. Found at
Trooditissa picnic site and Appides stream on Hedera
pastuchovii subsp. cypria (2: 42°; 11: 299). Habitat
and characters for identification similar to E. argyropus.
Eumerus pusillus Loew, 1848
First published record of this species for Cyprus.
Widespread Mediterranean species (Claussen & Lucas
1988). Ricarte et al. (2008) reared larvae from decayed
bulbs of Drimia maritima.
Remarks. Identity confirmed by Ante Vuji¢. Found in
the same habitat as F. basalis, flower visiting on Foenic-
ulum vulgare, Cachrys crassiloba and Hedera pastucho-
vii subsp. cypria (3: 299; 12: 7¢¢ 19; 16: 733 19;
PF LIGS SOO ANS POI 336649 922-745 19:
2425 S38 Ae).
Eumerus aff. rusticus Sack, 1932
(Fig. 7F)
First published record of this species for Cyprus.
Described on the basis of one male and one female from
“Asia Minor” most likely collected in Turkey (Sack
1932), and also reported from Romania and Turkmeni-
stan (Stackelberg 1961; Bradescu 1991).
Remarks. The identification is based on females only,
and therefore not entirely reliable. Based on Sack (1931)
and Stackelberg (1961) these specimens belong to E. rus-
ticus. The specimens were collected at Hala Sultan Tekke
on Polygonum equisetiforme, at Mylikouri flying near
Colchicum and at Agios Sozomenos on Foeniculum vul-
gare (4: 299; 8: 19; 22: 299).
Eumerus torsicus Grkovi¢ & Vujic, 2015
(Figs 8A, 8B)
Described from some Greece islands and Cyprus (Grkov-
i¢ et al. 2015).
Remarks. Identity confirmed by Ante Vuji¢. Found in
the same habitat as FE. argyropus and flying around Col-
chicum (2: 443 22.9; 11: 229; 24: 12).
Eumerus vestitus Bezzi, 1912
(Fig. 8C)
Eastern Mediterranean species. Dirickx (1994) provid-
ed records from Cyprus (as E. efflatouni Curran, 1938).
Smit et al. (2017) mentioned EF. efflatouni as junior syn-
onym of E. vestitus.
Remarks. Found at Hala Sultan Tekke and Agios So-
zomenos (4: 2¢'4; 8: 299) flower visiting on Foenic-
ulum vulgare.
Bonn zoological Bulletin 68 (1): 125-146
Eupeodes corollae (Fabricius, 1794)
Very common and widespread species. Dirickx (1994)
provided records from Cyprus.
Remarks. Widespread on Cyprus (2: 24'3' 799; 3: 4¢¢
1099; 5: 499; 6: 14 499; 7: 14; 8: 40h 1099; 10:
529; 11:30 499; 12: 299; 14:19; 16:19; 17: 403
TO 19s SO GLBS-Oy 21s ais O0s-22> 10 2Ar toy.
flower visiting on Hedera pastuchovii subsp. cypria,
Foeniculum vulgare, Cachrys crassiloba and Dittrichia
viscosa subsp. angustifolia.
Eupeodes nuba (Wiedemann, 1830)
Mediterranean species. Dirickx (1994) gave records from
Cyprus.
Remarks. One male was found at Tzelefos Bridge (21)
on Foeniculum vulgare.
Ferdinandea aurea Rondani, 1844
(Fig 8D)
First published record of this genus and species for Cy-
prus.
Mediterranean species with a flight period from late sum-
mer into winter, and larvae in Quercus species, possibly
in water-filled holes (Ricarte et al. 2010).
Remarks. In Troodos Mountains collected on Hedera
pastuchovii subsp. cypria and Taraxacum cyprium (2:
BOOS 67290210 3a C NI6dS 200)
Heringia heringi (Zetterstedt, 1843)
First published record of this genus and species for Cy-
prus.
Widespread European species but rare in the Mediterra-
nean region (Claussen & Lucas 1988).
Remarks. One female found flower visiting on Foenicu-
lum vulgare at Tzelefos Bridge (21) and one female col-
lected in a Malaise trap at Pera Pedi (3).
Ischiodon aegyptius (Wiedemann, 1830)
(Fig 8E)
First published record of this genus and species for Cy-
prus.
Mediterranean species (Dirickx 1994) and widespread in
the African continent (Mengual 2018).
Remarks. Found on Foeniculum vulgare (8: 6¢.¢ 52.9).
Melanostoma mellinum (Linnaeus, 1758)
Widespread species. Dirickx (1994) gave records from
Cyprus.
Remarks. Only collected in a Malaise trap at Pera Pedi
(22004:
©ZFMK
Hoverflies of Cyprus: results from a collecting trip in October 2017 137
Fig. 8. Adult; A, D lateral view; B, C, E, F dorsal view. A. Eumerus torsicus 3. B. Eumerus torsicus 9. C. Eumerus vestitus 2. D.
Ferdinandea aurea &. E. Ischiodon aegyptius 2. F. Merodon sp. nov. 2 (natans group) &. Scale bar = 1.0 mm.
Merodon avidus (Rossi, 1790) Merodon neofasciatus Stahls & Vujic, 2018
(Figs 9C, 9D)
Widespread central and eastern Mediterranean species.
Popovic et al. (2015) gave records from Cyprus. First published record of this species for Cyprus.
Remarks. Two male specimens were collected inasmall East Mediterranean species from the M. geniculatus
grassy meadow in ariverine forest (24) andonemaleina group (Vuji¢ et al. 2018).
Malaise trap at Pera Pedi (3).
Bonn zoological Bulletin 68 (1): 125-146 ©ZFMK
138 Jeroen van Steenis et al.
Fig. 9. Adult; dorsal view. A. Merodon aff bessarabicus 3. B. Merodon aff bessarabicus 2. C. Merodon neofasciatus ¢. D. Mer-
odon neofasciatus 2. E. Merodon pulveris @. F. Merodon pulveris &. Scale bar = 1.0 mm.
Remarks. Identity confirmed by Ante Vujic. Widespread
but scarce in Cyprus (5: 805 39.9; 11:19: 14: 299; 25:
353 299). Found flower visiting on Dittrichia viscosa
subsp. angustifolia at Akrotiri marsh and Crithmum mar-
itimum at Kavo Gkreko.
Bonn zoological Bulletin 68 (1): 125-146
Merodon pruni (Rossi, 1790)
(Fig 6C)
Widespread Mediterranean species (Claussen & Lucas
1988). Dirickx (1994) gave records from Cyprus.
©ZFMK
Hoverflies of Cyprus: results from a collecting trip in October 2017 139
Remarks. Found flower visiting on Foeniculum vul-
gare, Cachrys crassiloba and Crithmum maritimum (3:
1033 72Q; 8: 19; 16: 14 299; 17: 53 o¢ 8Q9; 21:
255 399; 24: 19; 25: 234 19). Found together with
the presumed wasp model (Crabronidae: Philanthus spp..,
Fig. 6D), with which the resemblance of the white-yel-
low abdominal colour and the irregular flight pattern, is
especially striking in flight.
Merodon pulveris Vuji¢ & Radenkovic¢, 2011
(Figs 9E, 9F)
First published record of this species for Cyprus.
Described from Lesvos, Greece and Turkey (Radenkovic
et al. 2011).
Remarks. Identity confirmed by Ante Vujic. Widespread
in the lower parts of Cyprus (3: 14 329; 11: 19; 14:
2333 1199; 16: 19; 17: 299; 21: 39 @). Found flower
visiting on Foeniculum vulgare and Prospero autumnale.
Also seen flying low over bare ground and around leaves
of Prospero autumnale and other bulbous plants.
Merodon aff bessarabicus
(Figs 9A, 9B)
First published record of this species for Cyprus.
Remarks. Identity confirmed by Ante Vujic. Yellow-co-
loured species found throughout the Troodos mountains
(11: 2334 1199; 12: 14; 14: 14; 15: 1¢ 19) and seen
flying around Colchicum. Morphologically this species
is rather variable concerning pile coloration on the scu-
tum and scutellum and the shape of the plate-like struc-
ture on the metatrochanter. However, the three selected
morphologically distinct specimens share the same COI
haplotype (Appendix IT) and have no differences in the
male genitalia, which indicate a broad intraspecific mor-
phological variation.
Merodon aff natans
(Fig. 8F)
First published record of this species for Cyprus.
Remarks. Identity confirmed by Ante Vuji¢. Collected at
Kourion Stadium (14: 23).
Milesia crabroniformis (Fabricius, 1775)
(Fig. SC)
First published record of this genus and species for Cy-
prus.
Widespread in the Mediterranean region (Dirickx 1994).
Remarks. The female specimen was collected while
seen flying around the ruins of a wooden building with
several old logs (11). One additional female was seen
flying through this same wooden building and later with
egg-laying behaviour at a Platanus orientalis tree with a
Bonn zoological Bulletin 68 (1): 125-146
large hole near its base. This specimen was not collected
but was photographed (Fig. 5C).
Myathropa florea (Linnaeus, 1758)
Very common and widespread species. Dirickx (1994)
gave records from Cyprus.
Remarks. Found on flowers of Hedera pastuchovii sub-
sp. cypria and Foeniculum vulgare (2: 14.19; 10: 19483
1899; 19: 19; 21:23; 22: 248).
Neoascia podagrica (Fabricius, 1775)
Widespread West-Palaearctic species, previously record-
ed from Cyprus (Claussen & Lucas 1988; Dirickx 1994).
Remarks. One male was collected on Hedera pastucho-
vii subsp. cypria close to a river (10), together with many
Riponnensia morini.
Neocnemodon spec.
First published record of this genus for Cyprus.
Remarks. Only one @ collected in a Malaise trap above
the Trooditissa picnic site (6). The females of this genus
are at the moment not identifiable. Recent insights (Vuji¢
et al. 2013) showed that Heringia and Neocnemodon are
separate genera.
Paragus (Paragus) bicolor (Fabricius, 1794)
Widespread species in Europe and northern Africa. Dir-
ickx (1994) gave records from Cyprus.
Remarks. Widespread and common species on Cyprus
(3: 6605 2999; 4: 234; 8: 293; 21: 73h 299).
Flower visiting on Cachrys crassiloba, Foeniculum vul-
gare and Polygonum equisetiforme.
Paragus (Paragus) compeditus Wiedemann, 1830
(Fig. 10A)
First published record of this species for Cyprus.
Southeastern Mediterranean species (Dirickx 1994).
Remarks. Widespread species; however, not found at
higher elevations (4: 54'3' 49.9; 5: 2344 499; 8: 16204
1699; 13: 19; 17: 12; 20: 19; 21: 344). Flower visit-
ing on Cachrys crassiloba, Foeniculum vulgare and Po-
lygonum equisetiforme.
Paragus (Paragus) quadrifasciatus Meigen, 1822
(Fig. 10B)
Widespread Mediterranean species, extending its range
to Northern Europe and reaching the Netherlands (Reem-
er et al. 2009). Dirickx (1994) gave records from Cyprus.
Remarks. Widespread and common species on Cyprus
O13" 65:0 109 Or 107 td: 161g Tes 17: Ad:
©ZFMK
140 Jeroen van Steenis et al.
Fig. 10. Adult; A-D, dorsal view; E, F lateral view. A. Paragus compeditus ¢. B. Paragus quadrifasciatus 3. C. Pipiza noctiluca,
&. D. Pseudodoros nigricollis 3. E. Riponnensia morini &. F. Sphaerophoria bengalensis 3. Scale bar = 1.0 mm.
21: 1604; 22: 14; 24: 14). Flower visiting on Cachrys Paragus (Pandasyopthalmus) haemorrhous (Meigen,
crassiloba, Foeniculum vulgare and Polygonum equiset- 1822)
iforme.
Widespread in Europe, Afrotropical Region and Euro-
pean parts of Russia. Dirickx (1994) gave records from
Cyprus.
Bonn zoological Bulletin 68 (1): 125-146 ©ZFMK
Hoverflies of Cyprus: results from a collecting trip in October 2017 141
Remarks. Collected on flowers of Foeniculum vulgare
and Dittrichia viscosa subsp. angustifolia (5: 14; 21:
233).
Paragus (Pandasyopthalmus) tibialis (Fallén, 1817)
Widespread in Europe, North of Africa, Turkey and Isra-
el. Dirickx (1994) gave records from Cyprus.
Remarks. More widespread and more common than the
previous species (4: 40.9; 5: 23'3; 8: 35'S), flower vis-
iting on Dittrichia viscosa subsp. angustifolia, Foenicu-
lum vulgare and Polygonum equisetiforme.
Pelecocera (Chamaesyrphus) pruinosomaculata (Strobl,
1906)
(Fig. 7B)
First published record of this genus and species for Cy-
prus.
Dirickx (1994) recorded it only from the Iberian Peninsu-
la, and showed his doubts about its occurrence in Israel.
Claussen & Standfuss (2017) recorded the species from
mainland Greece. As there might be several undescribed
Pelecocera (Chamaesyrphus) species in the Mediterra-
nean region (Claussen & Lucas 1988; Claussen & Stand-
fuss 2017), the true identity of the Israeli records remain
uncertain.
Remarks. One male was collected on Polygonum eq-
uisetiforme flowers in partly shaded conditions close to
several Hedera pastuchovii subsp. cypria plants stand-
ing on either side of a small stream. On these Hedera
plants one male of Pelecocera (Chamaesyrphus) sp. nov.
was collected, indicating that both species can be found
in flight closely together. One additional male of P. (C_)
pruinosomaculata was collected in a Malaise trap in an
abandoned vineyard (3).
Pelecocera (Chamaesyrphus) sp. nov.
(Fig. 7A)
First published record of this species for Cyprus.
So far known only from the Troodos Mountains in Cy-
prus (pers. obs. A. van Eck).
Remarks. All specimens were collected at or on Hedera
pastuchovii subsp. cypria (10: 19: 19: 2844 1399; 22:
14), where most specimens were seen flying close to the
flowers, and also feeding on them. The species was most
often seen flying in fully sunlit places, occasionally in
partially shaded places at a height of 1 to 4 metres above
ground level. One Malaise trap placed over a low-grow-
ing Hedera pastuchovii subsp. cypria bush (Fig. 1D)
contained 24 specimens and a yellow pan trap close by
the Malaise trap contained a single specimen. This spe-
cies will be described in a forthcoming work (A. van Eck
in prep.). It is considered that this species has a strong
connection to the Hedera flowers and possibly this is the
Bonn zoological Bulletin 68 (1): 125-146
main food source of the adults and possibly also a favour-
able mate-location place.
Pipiza noctiluca (Linnaeus, 1758)
(Fig. 10C)
First published record of this genus and species for Cy-
prus.
Common and widespread species in Europe (Vujic et al.
2013).
Remarks. Specimens were collected visiting flowers of
Hedera pastuchovii subsp. cypria and seen flying low
through vegetation; also collected in a Malaise trap (2:
19; 3 1399 1088992 V1).
Pseudodoros nigricollis Becker, 1903
(Fig. 10D)
Recently recorded from one locality at the west coast of
Cyprus (Van Eck & Makris 2016).
Remarks. Now also recorded in a second locality, in the
south near Akrotiri Salt Lake (13: 14¢'¢' 12). Found rest-
ing or flying slowly through Phragmites australis (Cav.)
Trin. ex Steud. leaves; one male caught by a yellow crab
spider on Dittrichia viscosa subsp. angustifolia.
Riponnensia morini Vujic, 1999
(Fig. 10E)
First published record of this species for Cyprus.
Threatened and with a restricted range on the Balkans,
and possibly extinct at the type locality (Vuji¢ et al. 2001),
but recently recorded from FYR Macedonia (Krpaé et al.
2011) and Greece (Claussen & Standfuss 2017). Up to
now recorded only in spring.
Remarks. All specimens have been collected on Hede-
ra pastuchovii subsp. cypria along a bridge over a small
river (10: 90¢'4¢ 59. 2), most specimens were seen in half
shade. This is the first time the genusname Riponnensia
is published for Cyprus, although one species of this ge-
nus was mentioned from Cyprus by Dirickx (1994) under
the name Orthonevra longicornis , which was transferred
to the genus Riponnensia by Maibach et al. (1994).
Scaeva pyrastri (Linnaeus, 1758)
Very common and widespread species. Dirickx (1994)
provided records from Cyprus.
Remarks. Found on Hedera pastuchovii subsp. cypria
(2: 299; 6:19; 19: 2¢¢ 299).
Sphaerophoria bengalensis Macquart, 1842
(Fig. 1OF)
First published record of this species for Cyprus.
©ZFMK
142 Jeroen van Steenis et al.
Ghorpadé (2009) synonymized S. turkmenica Bankows-
ka, 1964 under S. bengalensis. In the Palaearctic Region,
Speight (2017) reported this species from parts of Euro-
pean and Asiatic Russia, the Caucasus (Armenia, Azer-
baijan), Iran, Arabian Peninsula (Oman), Kazakhstan,
and Turkmenistan. The species was originally found in
the Oriental Region along the Himalayas to West Bengal.
Remarks. Several specimens were collected at Agios
Sozomenos while flower visiting on Foeniculum vulgare.
Also collected at Hala Sultan Tekke and in a Malaise trap
in Pera Pedi (3: 14; 4: 14; 8: 644).
Sphaerophoria rueppelli Wiedemann, 1830
Widespread European species. Dirickx (1994) provided
records from Cyprus.
Remarks. Common on Cyprus (4: 53° 22.9; 5: 10¢¢
399: 7: 2388; 8: 1¢ 899; 9: 14; 17: 19; 21:48 19).
Found flower visiting on Polygonum equisetiforme, Foe-
niculum vulgare and Dittrichia viscosa subsp. angusti-
folia.
Sphaerophoria scripta (Linnaeus, 1758)
Very common and widespread species. Dirickx (1994)
gave records from Cyprus.
Remarks. Found flower visiting on Foeniculum vulgare,
Cachrys crassiloba and Dittrichia viscosa subsp. angus-
tifolia (3: 43.4; 5: 33.4; 8: 19).
Syritta flaviventris Macquart, 1842
Widespread Mediterranean species. Dirickx (1994) gave
records from Cyprus.
Remarks. Flower visiting on Polygonum equisetiforme
and Dittrichia viscosa subsp. angustifolia (4. 16¢¢
499: 5: 303¢ 1099; 13: 294 19).
Syritta pipiens (Linnaeus, 1758)
Very common and widespread species. Dirickx (1994)
gave records from Cyprus.
Remarks. Very common species (1: 11¢¢ 399; 2: 12;
SPU S224 2056 BOOS Saree os O60.
1029; 7:13; 8: 533 329; 10: 50h 299; 12:14 19;
182268 Vw 2 IIE LOEG C4 OO? 20: WS ITI GS
299; 22: 245 299; 24: 19), flower visiting on Po-
lygonum equisetiforme, Foeniculum vulgare, Cachrys
crassiloba, Dittrichia viscosa subsp. angustifolia and
Hedera pastuchovii subsp. cypria.
DISCUSSION
Little information is known about the flower fly fauna of
Cyprus. In his work on the syrphid fauna of the Mediter-
Bonn zoological Bulletin 68 (1): 125-146
ranean countries, Dirickx (1994) provided bibliographic
references for 36 species recorded from Cyprus. But nei-
ther comprehensive species lists nor articles about col-
lecting trips on Cyprus have been published until now.
Based on literature studies, recent field trips and some
collection work, circa 70 species are recorded from Cy-
prus (van Eck unpub.). Our collecting trip resulted with
more than half (52) of the known fauna for this island,
adding nine new genera and 23 new species records to
the island’s list. The genera Eumerus and Merodon are
well represented with eight and six species, respective-
ly. These genera are very species-rich in the Mediterra-
nean region (e.g. Hurkmans 1993; Grkovic et al. 2017).
Although the genus Merodon is relatively well studied
in the Eastern Mediterranean region (Hurkmans 1993;
Radenkovic¢ et al. 2011; Popovic et al. 2015; Vujic et al.
2018), two undescribed species have been found on this
trip, which, however, were already known to occur on
Cyprus (A. Vuji¢ pers. comm.). Within the genus Eumer-
us, some of the listed species differ from mainland spec-
imens in several characters and some collected females
could not be identified. It is likely that some of the Cy-
priot Eumerus taxa will turn out to be different from the
mainland species and name changes are to be expected
(A. Vuji¢ pers. comm. ).
The species’ composition differs between autumn and
spring, and the number of species is most likely lower in
autumn than in spring according to current evidence (van
Eck unpub.). Based on our experience and fieldwork,
more species are likely to occur in Cyprus and several of
those taxa might be endemics, as Ceriana glaebosa (Van
Steenis et al. 2016), due to the geographical landscape
and the relative isolation of the island. The present re-
sults prompt us to continue our fieldwork and collecting
trips to improve the knowledge on biology, ecology and
taxonomy of Syrphidae and to persist with work on local
hoverfly faunas.
Acknowledgments. The Department of Environment (ref. no’s
02.15.001.003 and 04.05.002.005.006) and the Department of
Forests (ref. no. 2.15.05.3) of the Ministry of Agriculture, Ru-
ral Development and Environment of the Republic of Cyprus
(Nicosia, Cyprus) kindly permitted us to collect in Cyprus. Mr
Michael Makris (the Paphos Divisional Forests Officer) kind-
ly informed us about suitable collecting places when we met
each other out in the field. We thank Claudia Etzbauer (ZFMK,
Germany) for her support to obtain molecular data. Ante Vujic¢
(Novi Sad) helped with identification of some species of the
genera Eumerus and Merodon, Jeffrey Skevington (Ottawa)
gave permission to use DNA barcodes of Ceriana vespiformis
produced by his laboratory and Eddie John (Cowbridge, UK)
checked the English text. The Dutch Uyttenboogaart-Eliasen
©ZFMK
Hoverflies of Cyprus: results from a collecting trip in October 2017 143
foundation under number SUB.2017.05.08 provided financial
support for the first author.
REFERENCES
Assem MA, Nasr ESA (1967) A syrphid fly, Eumerus amoenus
Loew injurious to onion in U.A.R. (Diptera: Syrphidae). Ag-
ricultural Research Review (Cairo) 45(2): 27-32
Bankowska R (1964) Studien tiber die palaarktischen Arten der
Gattung Sphaerophoria St.Farg. et Serv. (Diptera, Syrphi-
dae). Annales Zoologici, Warszawa 22: 285-353
Bartsch H, Binkiewicz E, Klintbjer A, Radén A, Nasibov E
(2009) Blomflugor: Eristalinae & Microdontinae. National-
nyckeln till Sveriges flora och flora, DH 53b. Artdatabanken,
SLU, Uppsala. 478 pp
Bradescu V (1991) Les Syrphides de Roumanie (Diptera, Sy-
rphidae). Clés de détermination et répartition. Travaux du
Muséum d‘ Histoire naturelle “Grigore Antipa” 31: 7-83
Claussen C, Lucas JAW (1988) Zur Kenntnis der Schwebflie-
genfauna der Insel Kreta mit der Beschreibung von Eumer-
us minotaurus sp. n. (Diptera, Syrphidae). Entomofauna,
Zeitschrift fir Entomologie 9(5): 133-168
Claussen C, Stahls G (2007) A new species of Cheilosia Mei-
gen from Thessaly/Greece, and its phylogenetic position
(Diptera, Syrphidae). Volucella 8: 45-62
Claussen C, Standfuss K (2017) Schwebfliegen (Diptera, Sy-
rphidae) im Olivengtrtel SO-Thessaliens/GR, neue Funde
und Gesamtverzeichnis. Entomofauna, Zeitschrift fiir Ento-
mologie 38(2): 405—424
Dirickx HG (1994) Atlas des Diptéres syrphides de la région
méditerranéenne. L’ Institut royal des Sciences naturelles de
Belgique, Bruxelles. 317 pp
Efflatoun HC (1922) A monograph of Egyptian Diptera, Pt. 1:
Syrphidae. Mémoires de la Société Entomologique D’ Egypte
2(1): 1-123
Georghiou GP (1977) The Insects and Mites of Cyprus. Benaki
Phytopathological Institute, Athens. 347 pp
Ghorpadé K (2009) Some nomenclatural notes on Indian Sub-
region Syrphini (Diptera—Syrphidae). Colemania 15: 3—13
Grkovic A, Vuji¢ A, Radenkovic S, Chroni A, Petanidou T
(2015) Diversity of the genus Eumerus Meigen (Diptera,
Syrphidae) on the eastern Mediterranean islands with de-
scription of three new species. Annales de la Société ento-
mologique de France 51: 361-373
Grkovic A, Vuji¢ A, Chroni A, van Steenis J, Dan M, Raden-
kovi¢ S (2017) Taxonomy and systematics of three species of
the genus Eumerus Meigen, 1822 (Diptera: Syrphidae) new
to southeastern Europe. Zoologischer Anzeiger 270: 176-192
Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003) Bio-
logical identifications through DNA barcodes. Proceedings
of the Royal Society of London B 270: 313-321
Hurkmans W (1993) A monograph of Merodon (Diptera: Syr-
phidae). Part 1. Tijdschrift voor Entomologie 136: 147—234
Krpaé VT, Vujié A, Simié S, Lazarevska S (2011) New data on
hover-flies (Diptera: Syrphidae) in Macedonia. Entomologia
Croatica 15: 185-208
Lyneborg L, Barkemeyer W (2005) The genus Syritta, A World
Revision of the genus Syritta Le Pelletier & Serville, 1828
(Diptera: Syrphidae). Entomograph 15. Apollo Books, Den-
mark. 224 pp
Maibach A, Goeldlin de Tiefenau P, Speight MCD (1994) Lim-
ites génériques et caractéristiques taxonomiques de plusieurs
genres de la Tribu des Chrysogasterini (Diptera: Syrphidae)
Bonn zoological Bulletin 68 (1): 125-146
2. Statut taxonomique de plusieurs des espeéces étudiées et
analyse du complexe Melanogaster macquarti (Loew).
Annales de la Société entomologique de France (N.S.) 30:
253-271
Mengual X (2018) A new species of /schiodon Sack (Diptera,
Syrphidae) from Madagascar. African Invertebrates 59: 55—
73
Mengual X, Stahls G, Rojo S (2008) Molecular phylogeny of
Allograpta (Diptera, Syrphidae) reveals diversity of lineages
and non-monophyly of phytophagous taxa. Molecular Phylo-
genetics and Evolution 49: 715-727
Mengual X, Stahls G, Rojo S (2012) Is the mega-diverse genus
Ocyptamus (Diptera, Syrphidae) monophyletic? Evidence
from molecular characters including the secondary structure
of 28S rRNA. Molecular Phylogenetics and Evolution 62:
191-205
Mutin, VA, Steenis J van, Steenis W van, Palmer C, Bot S.,
Skevington J., ..., Mengual X. (2016) Syrphidae fauna (Dip-
tera: Syrphidae) of Tumnin river basin, the eastern macro-
slope of the northern Sikhote-Alin, Russia. Far Eastern En-
tomologist, 306, 1-31
Popovic D, Aéanski J, Djan, M, Obreht D, Vujic A, Radenkovic
S (2015) Sibling species delimitation and nomenclature of
the Merodon avidus complex (Diptera: Syrphidae). European
Journal of Entomology 112: 790-809
Radenkovi¢ S, Vuji¢ A, Stahls G, Pérez-Bafion C, Rojo S,
Petanidou T, Simi¢ S (2011) Three new cryptic species of the
genus Merodon Meigen (Diptera: Syrphidae) from the Island
Lesvos (Greece). Zootaxa 2735: 35-56
Ricarte A, Marcos-Garcia A, Rotheray GE (2008) The early
stages and life histories of three Eumerus and two Merodon
species (Diptera: Syrphidae) from the Mediterranean region.
Entomologica Fennica 19: 129-41
Ricarte A, Nedeljkovic Z, Quinto J, Marcos-Garcia MA (2010)
The genus Ferdinandea Rondani, 1844 (Diptera, Syrphidae)
in the Iberian Peninsula: First records and new breeding sites.
Journal of the Entomological Research Society 12(3): 57-69
Ricarte A, Souba-Dols GJ, Hauser M, Marcos-Garcia MA
(2017) A review of the early stages and host plants of the gen-
era Eumerus and Merodon (Diptera: Syrphidae), with new
data on four species. PLoS ONE 12(12): e0189852. https://
doi.org/10.1371/journal.pone.0189852
Sack P (1932) Die Fliegen der Palaearktischen Region, 31.
_ Syrphidae. Stuttgart (Schweizerbart), 451 pp
Sasic¢ L, Aéanski J, Vujic A, Stahls G, Radenkovic S, Milic, D.,
..., Dan, M. (2016) Molecular and morphological inference
of three cryptic species within the Merodon aureus species
group (Diptera: Syrphidae). PLoS ONE 11(8): e0160001.
https://doi.org/10.1371/journal.pone.0160001
Smit JT (2014) Two new species of the genus Callic era Panzer
(Diptera: Syrphidae) from the Palaearctic Region. Zootaxa
3779(5): 585-590
Smit JT, van Harten A, Ketelaar R (2017) Order Diptera, family
Syrphidae. The hoverflies of the Arabian Peninsula. Arthro-
pod fauna of the UAE 6: 572-612
Sorokina VS, Cheng X-Y (2007) New species and new dis-
tributional records of the genus Paragus Latreille (Diptera,
Syrphidae) from China. Volucella 8: 1-33
Speight MCD (1991) Callicera aenea, C. aurata, C. fagesi
and C. macquarti redefined, with a key to and notes on the
European Callicera species (Diptera: Syrphidae). Dipterists
Digest 10: 1-25. http:/\www.dipteristsforum.org.uk/docu-
ments/DD/df_1_10.pdf
Speight MCD, Sarthou J-P (2017) StN keys for the identification
of the European species of various genera of Syrphidae 2017/
©ZFMK
144 Jeroen van Steenis et al.
Clés StN pour la détermination des espéces Européennes de
plusieurs genres des Syrphidae 2017, vol. 99, Syrph the Net
publications, Dublin, 139 pp
Speight MCD (2017) Species accounts of European Syrphidae,
2017. Syrph the Net, the database of European Syrphidae
(Diptera), vol.97, Syrph the Net publications, Dublin, 294 pp
Ssymank A (2013) Contribution to the fauna of hoverflies (Dip-
tera: Syrphidae) of northeastern Greece, with special focus
on the Rhodope Mountains with the Natura 2000 site Perio-
chi Elatia, Pyramis Koutra. Studia dipterologica 19 (2012):
17-57
Stackelberg AA (1961) Palaearctic species of the genus Eumer-
us Mg. (Diptera, Syrphidae). Horae Societatis Entomologi-
cae Unionis Soveticae 48: 181—229 [in Russian]
The Plant List (2013) The Plant List Version 1.1. Published
on the Internet; http://www.theplantlist.org/ (accessed
14.X1.2018)
Townes H (1972) A light-weight Malaise trap. Entomological
News 83: 239-247
van Eck A, Makris C (2016) First records of Pseudodoros nigri-
collis Becker (Diptera: Syrphidae) from Cyprus. Biodiversity
Data Journal 4: e8139. https://doi.org/10.3897/BDJ.4.e8139
van Steenis J, van Steenis W, Ssymank A, van Zuijen MP, Ned-
eljkovié Z, Vuji¢ A, Radenkovi¢ S (2015) New data on the
Bonn zoological Bulletin 68 (1): 125-146
hoverflies (Diptera: Syrphidae) of Serbia and Montenegro.
Acta entomologica serbica 20: 67—98
van Steenis J, Ricarte A, Vujic A, Birtelle D, Speight MCD
(2016) Revision of the West-Palaearctic species of the tribe
Cerioidini (Diptera, Syrphidae). Zootaxa 4196(2): 151-209
van Veen MP (2004) Hoverflies of Northwest Europe: Identi-
fication keys to the Syrphidae. KNNV Publishing, Utrecht,
254 pp
Vuji¢ A, Simié S (1998) Genus Eumerus Meigen, 1822 (Dip-
tera: Syrphidae) in area of former Yugoslavia. Glasnik
Prirodnjatkog Muzeja u Beogradu B 49-50: 173-190
Vujic A, Simié S, Radenkovic S (2001) Endangered species
of hoverflies (Diptera: Syrphidae) on the Balkan Peninsula.
Acta entomologica serbica 5: 93-105
Vuji¢ A, Stahls G, Aéanski J, Bartsch H, Bygebjerg R, Ste-
fanovic A (2013) Systematics of Pipizini and taxonomy of
European Pipiza Fallén: molecular and morphological evi-
dence (Diptera, Syrphidae). Zoologica Scripta 42: 288-305
Vujic A, Stahls G, Aéanski J, Rojo S, Pérez-Bafion C, Raden-
kovi¢ S (2018) Review of the Merodon albifasciatus Mac-
quart species complex (Diptera: Syrphidae): the nomencla-
tural type located and its provenance discussed. Zootaxa
4374: 25-48
©ZFMK
~~
+
a 86106 sove6 | sore 1768 1768 1768 [soca] suaaynd wy
197 16 197 16 ; [roca] smmiosnfoou W
197 16 878 66 [LOE] sunjou jye W
197 16 87866 Lege] sunjou jye W
78688 90688 [goed] snaiqnapssag jye W
L99¢d] snoiqnspssaq Je W
[Z9Ed] snaiqvspssaq Je W
Z£9ECU
] u‘ds ;w
“SUDUTTOAS UOPOsAW PdJD9T9S UdDMJOq (ALILIIWIS 0%) SOOULISIP ISIMITed Pd}DOIIONUN [OOD “TT Xipueddy
C€908C000-dId jensusW “xX “897 ‘LIOTX LO W OLE “A WEL ITLEoTE
“MNAZ Nu SEEPoPE WR] PUIM SoILIO “ejnose ‘soyded :‘SAYdAD
7908c000-dId Jensusl “X 897 “LIOTX'LO WIT “A LE 877 oTE
“MNAZ NuZ9'S LOPobe Whipeis UoLINOY juorouY ‘Idoysidg “Jossewty :SAadAD
09087000-dIG Jensusyl “XxX 2397 “L107 X90 W Lr “A 7 6b. 8EoTE
-MNAZ N 9’ 87,6Sob€ “Weeans sapiddy ‘1so10,4 soydeg ‘soydeg ‘SQYdAD
¢L08c000-dId jensusl “X 2897 “LIOTX'LO WIT “A LE 8778S oTE
a eas “MNAZ N.iZ9'S LOPE Wipes UoLINOY juorouY ‘Idoysidy “Jossewry :SAYdAD
9908c000-dId jensucy “xX :°89T “L107 X'€0
“MNAZ WS “A BLLTISoTE N 76 SELEoPE YSIL UNOLTY ‘TOSseul'T ‘SVAdAD
ISO6S6MIN €908c000-dId jensusy “XK “897 “L107 X' FO W OPEL “A PI TEOSoTE
“MNAZ N SO'ES.PSoPE SUS UII PSSIPOOIL, “Sony ‘TOSseUTT ‘SAAD
LS$087000-dIG jensuaW “xX 897 “LIOTX TI “W Lp “A 7 6p, 8E0TE
-MINAZ N 9 87,6SopE ‘Weons sapiddy ‘yso10,J soydeg ‘soyded ‘SAYdAD
616£c000-dId Jensusl “X :°89T “LIOTX TI-80 “osiepe “W 188
“MNAZ “A 16'SS,0SoTE N 89S, 1SoP€ “PILAOUIA PIO “Ipod Jog ‘JOSSeUT'T :SNAdAD
€Z8Z£c000-dId Jensuspl “X 2897 “L107 X60 “X1/2Y VAapaf] UO “WI ZSET “A .,19'61,0SoTE
SPOSSESIN (snydudsapupy))
“INAZ N uSEPS.SSobE “VOSA PeOs SuOye ‘soneyd ‘JOsseul'] :SAAdAD eee
6v6L7000-dIG jensuayl “X -89T “L107 X'LO-ZO ‘asleep “We 18g :
‘ ‘ ; snoeuul pan]yIou vzid1
eQoeo as INAZ FI 16°SS,0S0ZE N 1.895, 1SobE ‘PAeAOUIA PIO ‘Ipad dq ‘JOSSeUI] “SAAD (8521 D p pomnoow d | 6sed
LL8L7000-dIG uolinZ AGW .897 LIOTX TL W O09 “A LPS 9bPhoTE N wIL TL ESob€ P
9P06S6AN -JNAZ ‘TIOAIOSOY NOUILUTY JO YOU ‘Ospliq SOJaTay JO Nos ‘soydedg ‘SQUdAD PLOG, SHEE ay STURT UES Esoqenis MUNA )-| 3560.
oN TORO. UOHVULIOJUI Jaqe Ivak puv 10yjn saidods snua a Said
yueguas oN CI MINAZ 0 JUL [9qu'T p quny I re qe]
‘saouanbas [QD OY} OF S1OquINU UOISsad0R YURqUSyH YUM */ [07 snIdA_D UO paydaT]oo suswIdads JOYONOA WN ‘T xXipueddy
9S06S6XAN SNIIGDADSS AQ Ife uopolayy
SS06S6XIN SUubIDU Je uopolayy
VSO6S6AN SNIIGDADSS AQ Ife uopolayy
[107 ‘SlAoyuapey 7 dfn sidaajnd uopolay’
TSO6S6MWN 8107 “SIINA 2 sTYyRIS snyolospfoau uopolayy
subjou jye uopo1aeyy
OSO06S6XAN SNIIGDADSS AQ Ife uopo1ayy
©
(snydudsapupy))
Dda9094/ag
(9061 ‘IGoNS) | vipjnovwosoumnsd
6V06S6AWN
Hoverflies of Cyprus: results from a collecting trip in October 2017
‘u ds
SO8| SOOM PO FSS | SOs | SOmal|| hoae| he: || so:
©ZFMK
Bonn zoological Bulletin 68 (1): 125-146
Jeroen van Steenis et al.
146
©ZFMK
[LL8L7000-dIG-AWAZ,
OP06SOXIIN $89°96 96'S6 90€ L6 PIT L6 66L'96 661'96 661'96 61:96 61:96 saa
PePTLOX $89°96 110°66 Zh8 66 67L'66 PEL 66 PEL'66 PEL'66 PEL'66 P£L'66 Ur pace
L7PZLOXIN 96'S6 110°66 £686 6£8'86 858 86 858'86 858'86 8S8'86 858'86 pa syn
STPTLONN 90€'L6 Zh8'66 £6'86 001 001 001 001 001 001 [1l-vecac No]
smusofidsaa ‘Dd
oN UOISSSDDW | [2/8L7000-dIG-MWAZ] | [11-977AGONO] | [11-EtTZAGONO] | [11--Z7AGONO] | [91-691ONOAS] | [1I-StTAGONO] | [SI-eIZTAVUAS] | [SI-9ITAVUAS] | [SI-8ITAVUAS] | [SI-LITAVUAS]
yurguey psogav]s ‘Dd smusofidsaa ‘Dd smusofidsaa ‘Dd smusofidsaa ‘Dd smlsofidsaa “D smsofidsaa ‘Dd smsofidsaa ‘Dd smsofidsaa ‘Dd smsofidsaa ‘Dd smsofidsaa ‘Dd
001
[ST-8IZNVUAS]
smusofidsaa “Dd
[SI-LICAVYAS
smusofidsaa ‘Dd
‘SIOquINU UOIssao0R YUR_UayH YIM ‘susUTIdads DUDLIAD Pa}d9TAS UI9MJOq (ATLILITUUTS 0%) S9URISTIP 9SIMATed Po}d9LIONUN [QD “TIT Xipusddy
Bonn zoological Bulletin 68 (1): 125-146
FORSCHUNGS
Bonn zoological Bulletin 68 (1): 147-162
2019 - Sharma B.K. & Sharma S.
https://do1.org/10.20363/BZB-2019.68.1.147
Research article
urn: |sid:zoobank.org:pub:D9308652-B9BF-4BBB-B573-F1C4B53E1ACS
The biodiverse rotifers (Rotifera: Eurotatoria) of Northeast India:
faunal heterogeneity, biogeography, richness in diverse ecosystems
and interesting species assemblages
Bhushan Kumar Sharma’’ & Sumita Sharma?
'2 Department of Zoology, North-Eastern Hill University, Shillong — 793 022, Meghalaya, India
* Corresponding author: Email: [email protected]
'urn:lsid:zoobank.org:author:FD069583-6E7 1-46D6-8F45-90A 87F35BEFE
2urn:Isid:zoobank.org:author:668EQFE0-C474-4D0D-9339-F01ADFD239D1
Abstract. The biodiverse Rotifera of northeast India (NEI) revealed 303 species belonging to 53 genera and 24 families;
~96% of these species examined from seven states of NEI affirm the rotifer heterogeneity of our plankton and semi-plank-
ton collections. This study documents the record number of species of global and regional biogeographic interest, high-
lights affinity with Southeast Asian and Australian faunas, and indicates notable heterogeneity in richness and composition
amongst the seven northeastern states. The speciose rotifers of small lentic biotopes of Arunachal Pradesh, Mizoram,
Nagaland, Meghalaya, Manipur and Tripura, the floodplain lakes (bee/s) and small wetlands (dobas and dubies) of the
Brahmaputra and the Barak floodplains of Assam, and the floodplain lakes (pats) of Manipur are noteworthy. Deepor Beel
and Loktak Lake (two Ramsar sites) are the globally rich rotifer ‘hotspots’. Interesting assemblages per sample of 80+
species in certain beels and pats, and up to 50 species in dobas and dubies depict the ‘Rotifera paradox’. The most diverse
and interesting Rotifera of NEI, than any other region of India, is attributed to habitat and ecosystem heterogeneity of wa-
ter bodies spread over varied ecological regimes, the location of the region in the Himalayan and Indo-Burma Biodiversity
hotspots, vital biogeographic corridor of ‘the Assam gateway’, ‘the rotiferologist effect’ and the sampling intensity. Our
ISSN 2190-7307
http://www.zoologicalbulletin.de
study marks a valuable contribution to biodiversity and biogeography of the Indian, Asian and Oriental Rotifera.
Key words. Biodiversity, distribution, important taxa, species assemblages, Rotifera paradox.
INTRODUCTION
Northeast India (NEI), a geographic division of India,
originally consisted of the contiguous seven ‘sister-states
of Assam, Arunachal Pradesh, Meghalaya, Manipur,
Mizoram, Nagaland and Tripura; the logistically distant
state of Sikkim was recently added to this easternmost re-
gion of India. NEI occupies a unique geographic location
in the Indo-Chinese sub-division of the Oriental region,
forms part of both the Himalayan and the Indo-Burma
biodiversity ‘hot-spots’, and includes ‘the Assam-gate-
way’ as a vital biogeographic corridor of India (Mani,
1974). This region is known for diverse freshwater eco-
systems, ranging from small lentic biotopes to the fluvial
floodplains, located under varied geo-morphologic and
ecological regimes which impart special biodiversity
and ecological diversity interest to assessment of aquatic
metazoan diversity of NEI. Referring particularly to this
aspect, Sharma & Sharma (2014a) initially commented
on the importance of NEI vis-a-vis the rich biodiversity of
Rotifera — an important group of freshwater zooplankton.
Nevertheless, this work highlighted distinct gaps relating
to the poorly explored states of Arunachal Pradesh (the
eastern Himalayas), Nagaland, Manipur and Mizoram as
Received: 06.03.2019
Accepted: 18.06.2019
well as stressed on the need for overall augmentation of
faunal analyses from other states of this region.
The present study, a follow up of our earlier work
(Sharma & Sharma 2014a), endeavors to provide a com-
prehensive assessment of Rotifera biodiversity of NEI
based on intensive collections from the former seven
‘sister-states’ of Assam, Arunachal Pradesh, Meghalaya,
Manipur, Mizoram, Nagaland and Tripura. We present
an exhaustive species inventory of the rotifers known to
date from NEI and provide illustrations of selected rare
and interesting species to provide validations otherwise
routinely lacking in the Indian works (Sharma & Sharma
2014a, 2017). Remarks are made on Rotifera heteroge-
neity of NEI with reference to species richness, nature
and composition, elements of global and regional bio-
geographic interest, important taxa, and comparison of
the rotifer faunas of the sampled seven states. We also
comment on ecological diversity and interesting species
assemblages found in our studies on the floodplain lakes
(bee/s) and small wetlands (dobas and dubies) of the
Brahmaputra and the Barak river floodplains of Assam;
the floodplain lakes (pats) of Manipur; and small lentic
ecosystems of Arunachal Pradesh, Mizoram, Nagaland,
Meghalaya, Manipur and Tripura. This intensive study
Corresponding editor: B. Huber
Published: 01.07.2019
148 Bhushan Kumar Sharma & Sumita Sharma
fa Shee let, so
oe }
x
a
\ : e pel
aa i
p ,
=a) a 5
ft ;
ae
NORTHEAST INDIA
Arunachet Pradesh
Sikkim 72
engtok ltanagar / SS
re) g f *
: re A
+ Guwahati Assam 4 \
j
Goat BA
Shillong
Meghalaya
Tripura
Aizwal
Mizoram
Agartala\
B
Fig. 1A—B. A. Map of India showing (in blue color) northeast India (NEI). B. Map of NEI indicating the states of Arunachal
Pradesh, Assam, Manipur, Meghalaya, Mizoram, Nagaland and Tripura.
marks an important contribution to biodiversity and bio-
geography of Rotifera of India, Asia and the Oriental re-
gion as well as of the tropical and subtropical floodplains
and small lentic ecosystems.
MATERIALS & METHODS
This study is based on analysis of plankton and semi—
plankton samples collected, during several faunal and lim-
nological surveys undertaken between 1998-2017, from
scattered localities of the seven states (between 90—94°E,
22-—28°N) of NEI (Fig. 1A—B). The samples were collect-
ed from the Brahmaputra valley (90°-93°E, 26°—27°N)
and the Barak valley (24°48’—24°80’N, 92°45’-92°75’E)
of Assam; Tripura (92°10’—92°20’E, 22°56’—24°32’N);
Arunachal Pradesh (26°28’—29°30’N, 91°20’—97°30’E),
Mizoram (21°58’—24°35’N, 92°15’—93°29’E), Megha-
laya (90°05’—92°40’E, 25°10’—26°15’N); and Nagaland
(25°4’—27°0’N, 93°3’-93°5’E). The collections were ob-
tained from small ephemeral and perennial lentic ecosys-
tems of Arunachal Pradesh, Mizoram, Meghalaya, Ma-
nipur, Nagaland and Tripura; small floodplain wetlands
(dobas or dubies) as well as floodplain lakes (bee/s) of
the Brahmaputra and Barak river basins, respectively and
beels of Majuli River Island of Assam; the floodplain
lakes (pats) of the Iral, Imphal and Thoubal river basins
of Manipur; selected reservoirs of Meghalaya, Mizoram
and Tripura; and intensive limnological surveys of two
Ramsar sites namely Loktak Lake (Manipur) and Deepor
Bonn zoological Bulletin 68 (1): 147-162
beel (Assam). The voucher collections are deposited in
the holdings of Zoological Survey of India, Kolkata. In
addition, our species inventory includes certain sessile
and bdelloid rotifers not observed in our collections but
otherwise recorded from NEI (Sharma & Sharma 2014a).
All the samples were collected by towing a nylobolt
plankton net (mesh size # 50 um) from varied freshwater
ecosystems in seven states of NEI and were preserved
in 5% formalin. In addition, some collections were not
preserved to examine live rotifers. Individual collec-
tions were screened with a Wild stereoscopic binocular
microscope; the rotifers were isolated and mounted in
polyvinyl alcohol-lactophenol mixture, and were ob-
served with a Leica DM 1000 image analyzer fitted with
a drawing-tube. The micro-photographs were taken with
a Leica DM 1000 image analyzer. Rotifera species were
identified following the works of Koste (1978), Koste
and Shiel (1987, 1989, 1990), Segers (1995), Sharma
(1983, 1987a, 1987b, 1998, 2014), Sharma & Sharma
(1997, 1999, 2000, 2008, 2014b, 2014c, 2015a, 2018a,
2018b) and Jersabek & Leitner (2013). Segers (2002)
was followed for the system of Rotifera classification
and comments on the distribution of various taxa were
made following Segers (2007) and Jersabek & Leitner
(2013). The community similarities were calculated us-
ing Serensen’s index (Sorensen 1948). Hierarchical clus-
ter analysis, based on Sorensen’s similarities, was done
using SPSS (version 11.0) to examine the rotifer commu-
nity groupings.
©ZFMK
The biodiverse rotifers of Northeast India
RESULTS
We record a total of 303 species of Rotifera (Table 1)
belonging to 53 genera and 24 families from Northeast
India (NEI). Of these, 292 species (~96%) are observed
in our plankton and semi-plankton collections from sev-
en ‘sister states’ of NEI. A detailed systematic list of the
documented taxa is presented below:
Systematic list of Rotifera recorded from Northeast
India
Phylum: Rotifera
Class: Eurotatoria
Subclass: Monogononta
Order: Ploima
Family: Brachionidae
1. Anuraeopsis coelata De Beauchamp, 1932
A. fissa Gosse, 1851
A. navicula Rousselet, 1911
Brachionus ahlstromi Lindeman, 1939
B. angularis Gosse, 1851
B. bennini Leissling, 1924
B. bidentatus Anderson, 1889
B. budapestinensis Daday, 1885
9. B. calyciflorus Pallas, 1766
10. B. caudatus Barrois & Daday, 1894
11. B. dichotomus reductus Koste & Shiel, 1980
12. B. dimidiatus Bryce, 1931
13. B. diversicornis (Daday, 1883)
14. B. donneri Brehm, 1951
15. B. durgae Dhanapathi, 1974
16. B. falcatus Zacharias, 1898
B. falcatus reductus Koste & Shiel, 1987
17. B. forficula Wierzejski, 1891
18. B. kostei Shiel, 1993
eee see eS
19. B. leydigii Cohn, 1862
20. B. lyratus Shephard, 1911
21. B. mirabilis Daday, 1897
22. B. murphyi Sudzuki, 1989
23. B. nilsoni Ahlstrom, 1940
24. B. quadridentatus Hermann, 1783
25. B. rubens Ehrenberg, 1838
26. B. srisumonae Segers, Kotethip & Sanoamuang, 2004
27. Keratella cochlearis (Gosse, 1851)
28. K. edmondsoni Ahlstrom, 1943
29. K. javana Hauer, 1937
30. K. lenzi Hauer, 1953
31. K. procurva (Thorpe, 1891)
32. K. quadrata (Miller, 1786)
33. K. serrulata (Ehrenberg, 1838)
34. K. tecta (Gosse, 1851)
35. K. ticinensis (Callerio, 1921)
36. K. tropica (Apstein, 1907)
Bonn zoological Bulletin 68 (1): 147-162
37. Notholca acuminata (Ehrenberg, 1832)
38. N. labis Gosse, 1887
39. N. squamula (Muller, 1786)
40. Plationus patulus (Muller, 1786)
Al. Platyias leloupi (Gillard, 1967)
42. P. quadricornis (Ehrenberg, 1832)
Family: Epiphanidae
43. Epiphanes brachionus (Ehrenberg, 1837)
44. E. senta (Muller, 1773)
Family: Euchlanidae
45. Beauchampiella eudactylota (Gosse, 1886)
46. Dipleuchlanis ornata Segers, 1993
47. D. propatula (Gosse, 1886)
48. Euchlanis dilatata Ehrenberg, 1832
49. E. incisa Carlin, 1939
50. E. meneta Myers, 1930
51. E. oropha Gosse, 1887
52. E. semicarinata Segers, 1993
53. E. triquetra Ehrenberg, 1838
54. Tripleuchlanis plicata (Levander, 1894)
Family: Mytilinidae
55. Lophocharis oxysternon (Gosse, 1851)
56. L. salpina (Ehrenberg, 1834)
57. Mytilina acanthophora Hauer, 1938
58. M. bisulcata (Lucks, 1912)
59. M. brevispina (Ehrenberg, 1830)
60. M. lobata Pourriot, 1996
61. M. michelangellii Reid & Turner, 1988
62. M. ventralis (Ehrenberg, 1830)
Family: Trichotriidae
63. Macrochaetus collinsi (Gosse, 1867)
64. M. danneelae Koste & Shiel, 1983
65. M. longipes Myers, 1934
66. M. sericus (Thorpe, 1893)
67. M. subquadratus (Perty, 1850)
68. Trichotria tetractis (Ehrenberg, 1830)
69. Wolga spinifera (Western, 1894)
Family: Lepadellidae
70. Colurella adriatica Ehrenberg, 1831
71. C. colurus (Ehrenberg, 1830)
72. C. obtusa (Gosse, 1886)
149
73. C. sanoamuangae Chittapun, Pholpunthin &
Segers, 1999
74. C. sulcata (Stenroos, 1898)
75. C. tesselata (Glascott, 1893)
76. C. uncinata (Miller, 1773)
C. uncinata bicuspidata (Ehrenberg, 1832)
77. Lepadella acuminata (Ehrenberg, 1834)
78. L. apsida Harring, 1916
79. L. benjamini Harring, 1916
80. L. bicornis Vasisht & Battish 1971
©ZFMK
150 Bhushan Kumar Sharma & Sumita Sharma
81. L. biloba Hauer, 1938
82. L. costatoides Segers, 1992
83. L. cristata (Rousselet, 1893)
84. L. dactyliseta (Stenroos, 1898)
85. L. desmeti Segers & Chittapun, 2001
86. L. discoidea Segers, 1993
87. L. elongata Koste, 1992
88. L. eurysterna Myers, 1942
89. L. cf favorita Klement, 1962
90. L. latusinus (Hilgendorf, 1889)
91. L. lindaui Koste, 1981
92. L. minoruoides Koste & Robertson, 1983
93. L. minuta (Weber & Montet, 1918)
94. L. nartiangensis Sharma & Sharma, 1987
95. L. neglecta Segers & Dumont, 1995
96. L. ovalis (Miller, 1786)
97. L. patella patella (Muller, 1773)
L. patella elongata Sharma & Sharma, 1987
L. patella oblonga (Ehrenberg, 1834)
98. L. quadricarinata (Stenroos, 1898)
99. L. quinquecostata (Lucks, 1912)
100. L. rhomboides (Gosse, 1886)
101. L. rhomboidula (Bryce, 1890)
102. L. triba Myers, 1934
103. L. triptera Ehrenberg, 1830
L. triptera alata (Myers, 1934)
104. L. vandenbrandei Gillard, 1952
105. L. (Heterolepadella) apsicora Myers, 1934
106. L. (H.) ehrenbergi (Perty, 1850)
107. L. (H.) heterostyla (Murray, 1913)
108. L. (H.) heterodactyla Fadeev, 1925
109. Squatinella bifurca (Bolton, 1884)
110. S. lamellaris (Miller, 1786)
Family: Lecanidae
111. Lecane acanthinula (Hauer, 1938)
112. L. aculeata (Jakubski, 1912)
113. L. aeganea Harring, 1914
114. L. arcula Harring, 1914
115. L. aspasia Myers, 1917
116. L. batillifer (Murray, 1913)
117. L. bifastigata Hauer, 1938
118. L. bifurca (Bryce, 1892)
119. L. blachei Berzins,1973
120. L. braumi Koste, 1988
121. L. bulla (Gosse, 1851)
L. bulla diabolica (Hauer, 1936)
122. L. calcaria Harring & Myers, 1926
123. L. clara (Bryce, 1892)
124. L. closterocerca (Schmarda, 1898)
125. L. crepida Harring, 1914
126. L. curvicornis (Murray, 1913)
127. L. decipiens (Murray, 1913)
128. L. dorysimilis Trinh Dang, Segers & Sanoamuang,
2015
129. L. doryssa Harring, 1914
Bonn zoological Bulletin 68 (1): 147-162
130.
131.
132;
133;
134.
13D:
136,
13%.
138.
139;
140.
141.
142.
143.
144.
145.
146.
147.
148.
149.
150.
151.
LOZ
153;
154.
1:55:
156.
15%.
158.
159;
160.
161.
162.
163.
164.
165.
166.
167.
168.
169.
170.
LEY,
172,
173;
174.
Was
176.
177.
178.
179.
180.
181.
182.
183.
184.
185.
L. elegans Harring, 1914
L. elongata Harring & Myers, 1926
L. flexilis (Gosse, 1886)
L. furcata (Murray, 1913)
L. glypta Harring & Myers, 1926
L. haliclysta Harring & Myers, 1926
L. hamata (Stokes, 1896)
L. hastata (Murray, 1913)
L. hornemanni (Ehrenberg, 1834)
L. inermis (Bryce, 1892)
L. inopinata Harring & Myers, 1926
L. isanensis Sanoamuang & Savatenalinton, 2001
L. jaintiaensis Sharma, 1987
L. lateralis Sharma, 1978
L. latissima Yamamoto, 1951
L. leontina (Turner, 1892)
L. levistyla (Olofsson, 1917)
L. ludwigii (Eckstein, 1883)
L. luna (Miller, 1776)
L. lunaris (Ehrenberg, 1982)
L. marchantaria Koste & Robertson, 1983
L. monostyla (Daday, 1897)
L. nana (Murray, 1913)
L. nitida (Murray, 1913)
L. niwati Segers, Kotethip & Sanoamuang, 2004
L. obtusa (Murray, 1913)
L. ohioensis (Herrick, 1885)
L. papuana (Murray, 1913)
L. paxiana Hauer, 1940
L. pertica Harring & Myers, 1926
L. ploenensis (Voigt, 1902)
L. pusilla Harring, 1914
L. pyriformis (Daday, 1905)
L. quadridentata (Ehrenberg, 1830)
L. rhenana Hauer, 1929
L. rhytida Harring & Myers, 1926
L. rugosa (Harring, 1914)
L. ruttneri Hauer, 1938
L. scutata (Harring & Myers, 1926)
L. shieli Segers & Sanoamuang, 1994
L. signifera (Jennings, 1896)
L. simonneae Segers, 1993
L. sola Hauer, 1936
L. solfatara (Hauer, 1928)
L. stenroosi (Meissner, 1908)
L. stichaea Harring, 1913
L. stichoclysta Segers, 1993
L. styrax (Harring & Myers, 1926
L. superaculeata Sanoamuang & Segers, 1997
L. sympoda Hauer, 1929
L. syngenes (Hauer, 1938)
L. tensuiseta Harring, 1914
L. thienemanni (Hauer, 1938)
L. undulata Hauer, 1938
L. unguitata (Fadeev, 1925)
L. ungulata (Gosse, 1887)
©ZFMK
The biodiverse rotifers of Northeast India
Family: Notommatidae
186. Cephalodella catellina (Miller, 1786)
187. C. forficata (Ehrenberg, 1832)
188. C. forficula (Ehrenberg, 1832)
189. C. gibba (Ehrenberg, 1830)
190. C. intuta Myers, 1924
191. C. mucronata Myers, 1924
192. C. trigona (Rousselet, 1895)
193. C. ventripes (Dixon-Nuttal, 1901)
194. Monommata grandis Tessin, 1890
195. M. longiseta (Miller, 1786)
196. M. maculata (Harring & Myers, 1930)
197. Notommata pachyura (Gosse, 1886)
198. N. spinata Koste & Shiel, 1991
199. Taphrocampa annulosa Gosse, 1851
Family: Scaridiidae
200. Scaridium longicaudum (Miller, 1786)
Family: Gastropodidae
201. Ascomorpha ecaudis Perty, 1850
202. A. ovalis (Bergendal, 1892
203. A. saltans Bartsch, 1870
204. Gastropus minor (Rousselet, 1892)
Family: Trichocercidae
205. Trichocerca abilioi Segers & Sarma, 1993
206. T. bidens (Lucks, 1912)
207. T. bicristata (Gosse, 1887)
208. T: braziliensis Murray, 1913
209. T. capucina (Wierzejski & Zacharias, 1893)
210. T cylindrica (Imhof, 1891)
211. T edmondsoni (Myers, 1936)
212. T elongata (Gosse, 1886)
213. T flagellata Hauer, 1937
214. T hollaerti De Smet, 1990
215. T iernis (Gosse, 1887)
216. T. insignis (Herrick, 1885)
217. T. insulana (Hauer, 1937)
218. T. kostei Segers, 1993
219. T. longiseta (Schrank, 1802)
220. T. maior (Hauer, 1935)
221. 7: mus Hauer, 1938
222. T. porcellus (Gosse, 1851)
223. T. pusilla (Jennings, 1903)
224. T. rattus (Miller, 1776)
225. T. ruttneri Donner,1953
226. T. scipio (Gosse, 1886)
227. T. siamensis Segers & Pholpunthin, 1997
228. T. similis (Wierzejski, 1893)
229. T. stylata (Gosse, 1851)
230. T sulcata (Jennings, 1894)
231. T. taurocephala (Hauer, 1931)
232. T. tenuior (Gosse, 1886)
233. T. tigris (Muller, 1786)
234. T. uncinata (Voigt, 1902)
Bonn zoological Bulletin 68 (1): 147-162
235. T. voluta (Murray, 1913)
236. T: weberi (Jennings, 1903)
Family: Asplanchnidae
237. Asplanchna brightwelli Gosse, 1850
238. A. priodonta Gosse, 1850
Family: Synchaetidae
239. Ploesoma lenticulare Herrick, 1855
240. Polyarthra euryptera Wierzejski, 1891
241. P. vulgaris Carlin, 1943
242. Synchaeta oblonga Ehrenberg, 1832
243. S. pectinata Ehrenberg, 1832
Family: Dicranophoridae
151
244. Dicranophoroides caudatus (Ehrenberg, 1834)
245. Dicranophorus forcipatus (Miller, 1786)
Order: Flosculariaceae
Family: Floscularidae
246. Floscularia ringens (Linnaeus, 1758)
247. Lacinularia flosculosa (Miller, 1773)
248. L. racemovata Thorpe, 1893
249. Limnias ceratophylli Schrank, 1803
250. Ptygura melicerta Ehrenberg, 1832
251. P. tacita Edmondson, 1940
252. Sinantherina procera (Thorpe, 1893) *
253. S. semibullata (Thorpe, 1893)
254. S. socialis (Linnaeus, 1758)
255. S. spinosa (Thorpe, 1893)
256. Stephanoceros fimbriatus (Goldfusz, 1820)
Family: Conochilidae
257. Conochilus unicornis Rousselet, 1892
Family: Hexarthridae
258. Hexarthra intermedia Wiszniewski,1929
259. H. mira (Hudson, 1871)
Family: Testudinellidae
260. Pompholyx sulcata Hudson,1885
261. Testudinella amphora Hauer, 1938
262. T brevicaudata Yamamoto, 1951
263. T: dendradena de Beauchamp, 1955
264. T: emarginula (Stenroos, 1898)
265. T: greeni Koste, 1981
266. T: parva (Ternetz, 1892)
T: parva bidentata (Ternetz, 1892)
T. parva semiparva (Hauer, 1938)
267. T: patina (Hermann, 1783)
268. T. tridentata Smirnov, 1931
269. T: walkeri Koste & Shiel, 1980
270. T. sp. Sharma & Sharma 2018a
271. T. sp.1 Sharma & Sharma 201 8a
©ZFMK
152
Family: Trochosphaeridae
272. Filinia brachiata (Rousselet, 1901)
273. F. camasecla Myers, 1938
274. F longiseta (Ehrenberg, 1834)
275. F opoliensis (Zacharias, 1898)
276. F- pejleri Hutchinson, 1964
277. F- saltator (Gosse, 1886)
278. F. terminalis (Plate, 1886)
279. Horaella brehmi Donner, 1949
280. Trochosphaera aequatorialis Semper, 1872
Order: Collothecaceae
Family: Atrochidae
281. Cupelopagis vorax (Leidy, 1857)
Family: Collothecidae
282. Collotheca hexalobata Banik, 2002*
283. C. ornata (Ehrenberg, 1832)
284. C. mutabilis (Hudson, 1885)
285. C. tenuilobata (Anderson, 1889)
286. C. tetralobata Banik, 2002 *
287. C. trilobata (Collins, 1872) *
Sub-class: Bdelloidea
Order: Philodinida
Family: Adinetidae
Bhushan Kumar Sharma & Sumita Sharma
288. Adineta longicornis Murray, 1906 *
289. A. vaga (Davis, 1873)
Family: Habrotrochidae
290. Habrotrocha angusticollis (Murray, 1905)
291. H. angusticollis attenuata (Murray, 1906) *
292. H. lata (Bryce, 1892)
293. H. leitgebii (Zelinka, 1886)*
*
294. H. microcephala (Murray, 1906) *
Family: Philodinidae
295. Dissotrocha aculeata (Ehrenberg, 1832)
296. Macrotrachela multispinosa Thompson, 1892
297. Philodina citrina Ehrenberg, 1832
298. Rotaria macroceros (Gosse, 1851)
299. R. mento (Anderson, 1889)
300. R. neptunia (Ehrenberg, 1830)
301. R. neptunoida Harring, 1913*
302. R. rotatoria (Pallas, 1766)
303. R. tardigrada (Ehrenberg, 1830) *
* Not observed in our collections
Brachionus dichotomus reductus (Fig. 2A), B. don-
neri (Fig. 2B), B. falcatus reductus (Fig. 2C), B. kostei
(Fig. 2D), B. lyratus (Fig. 2E), B. murphyi (Fig. 2F),
B. nilsoni (Fig. 2G), B. srisumonae (Fig. 2H), Collothe-
ca hexalobata, C. tetralobata, Colurella sanoamuangae,
C. tesselata (Fig. 21), Dipleuchlanis ornata (Fig. 2J—K),
Euchlanis semicarinata (Fig. 2L—M), Gastropus minor
(Fig. 3A), Keratella edmondsoni (Fig. 3B), K. javana
(Fig. 3C), K. serrulata (Fig. 3D), K. ticinensis, Lecane
batillifer, L. bifastigata, L. calcaria (Fig. 3E), L. clara
(Fig. 3F), L. dorysimilis (Fig. 3G), L. jaintiaensis,
L. isanensis (Fig. 3H), L. latissima (Fig. 31), L. march-
antaria (Fig. 3J), L. niwati (Fig. 3K), L. rhenana, L shieli
(Fig. 3L), L. superaculeata (Fig. 4A), Lepadella desme-
ti (Fig. 4B), L. elongata, L. minoruoides, L. neglecta
(Fig. 4C), L. vandenbrandei, Macrochaetus danneelae
(Fig. 4D), Mytilina lobata (Fig. 4E), M. michelangellii,
Notholca acuminata, N. labis (Fig. 4F), N. squamula,
Squatinella bifurca (Fig. 4G—H), Testudinella amphora,
T! brevicaudata, T: greeni, T: parva bidentata, T. triden-
tata, T. walkeri (Fig. 41), Trichocerca edmondsoni, T. hol-
laerti, T: maior, T: mus (Fig. 4J), T: siamensis(Fig. 4K),
7) taurocephala (Fig. 4L), and T. uncinata, observed in
our collections from the sampled seven states, are rotifers
with global or regional biogeographic interest or their In-
dian distribution yet restricted to NEI. Of these, certain
rare and interesting species are illustrated to warrant for
validations and to serve as source of reference for the
future workers.
Table 1. Rotifera taxa recorded from Northeast India and seven states.
States /NEI| Taxa— Species
Arunachal Pradesh
Assam
Manipur
Meghalaya
Mizoram
Nagaland
Tripura
Northeast India
P72
244
200
161
162
150
176
303
Present study
Bh,
46
48
40
35
Bf
36
53
19
21
23
20
19
19
20
24
Genera Families Species Genera Families
Earlier Report Species added
(Sharma & Sharma 2014a)
76 29 18 96
26 46 21 28
155 45 23 45
135 36 19 26
76 28 17 86
66 os 14 84
152 36 20 24
238 50 23 65
Bonn zoological Bulletin 68 (1): 147-162
©ZFMK
The biodiverse rotifers of Northeast India 153
I J-K L—-M
Fig. 2A—M. Interesting Rotifera from Northeast India. A. Brachionus dichotomus reductus Koste & Shiel, ventral view. B. Bra-
chionus donneri Brehm, ventral view. C. Brachionus falcatus reductus Koste & Shiel, ventral view. D. Brachionus kostei Shiel,
dorsal view. E. Brachionus lyratus Shephard, ventral view. F. Brachionus murphyi Sudzuki, ventral view. G. Brachionus nilsoni
Ahlstrom, ventral view. H. Brachionus srisumonae Segers, Kotethip & Sanoamuang, dorsal view. I. Colurella tesselata (Glascott),
lateral view. J-K. Dipleuchlanis ornata Segers, ventral view and cross-section (after Sharma, 2005). L-M. Euchlanis semicarinata
Segers, dorsal and lateral views.
Bonn zoological Bulletin 68 (1): 147-162 ©ZFMK
154 Bhushan Kumar Sharma & Sumita Sharma
Fig. 3A—L. Interesting Rotifera from Northeast India. A. Gastropus minor (Rousselet), lateral view. B. Keratella edmondsoni Ahl-
strom, dorsal view. C. Keratella javana Hauer, ventral view. D. Keratella serrulata (Ehrenberg), ventral view. E. Lecane calcaria
Harring & Myers, ventral view. F. Lecane clara (Bryce), dorsal view. G. Lecane dorysimilis Trinh Dang, Segers & Sanoamuang,
dorsal view. H. Lecane isanensis Sanoamuang & Savatenalinton, ventral view. I. Lecane latissima Yamamoto, dorsal view. J. Le-
cane niwati Segers, Kotethip & Sanoamuang, ventral view. K. Lecane marchantaria Koste & Robertson, dorsal view. L. Lecane
Shieli Segers & Sanoamuang, dorsal view.
Bonn zoological Bulletin 68 (1): 147-162 ©ZFMK
The biodiverse rotifers of Northeast India 155
I J K lif
Fig. 4A-L. Interesting Rotifera from Northeast India. A. Lecane superaculeata Sanoamuang & Segers, ventral view. B. Lepadella
desmeti Segers & Chittapun, ventral view. C. Lepadella neglecta Segers & Dumont, ventral view. D. Macrochaetus danneelae
Koste & Shiel, ventral view. E. Mytilina lobata Pourriot, lateral view. F. Notholca labis Gosse, ventral view. G-H. Squatinella bi-
furca (Bolton), lateral and dorsal views. I. Testudinella walkeri Koste & Shiel, ventral view. J. Trichocerca mus Hauer, lateral view.
K. Trichocerca siamensis Segers & Pholpunthin, lateral view. L. Trichocerca taurocephala (Hauer), lateral view.
Bonn zoological Bulletin 68 (1): 147-162 ©ZFMK
156 Bhushan Kumar Sharma & Sumita Sharma
B® Lecanidae OLepadellidae @ Brachionidae @ Trichocercidae O Testudinellidaae O Notommatidae
No. of species
Fig. 5. Species richness of important Rotifera families of seven states of NEI; ASS-Assam; MNP-Manipur; TRP-Tripura; MEG-Me-
ghalaya; MIZ-Mizoram, NGL-Nagaland; ARP-Arunachal Pradesh.
Dendrogram using Average Linkage (Between Groups)
Rescaled Distance Cluster Combine
5 10 15 20
Manipur
Tripura
> Nagaland
Arunachal
Mizoram
Meghalaya
Fig. 6. Hierarchical cluster analysis of Rotifera assemblages of seven states of NEI.
Rotifera of Northeast India contained 287 species of | 150 species were observed from Assam, Manipur, Tri-
Monogononta and 16 of Bdelloidea. The rotifer rich- pura, Arunachal Pradesh, Mizoram, Meghalaya and Na-
ness of seven states varied (Table 1) between 150-244 galand, respectively. Lecanidae, Brachionidae, Lepadel-
(181+39 species) and 244, 200, 176, 172, 162, 161 and __lidae, Trichocercidae, Notommatidae, Testudinellidae,
Bonn zoological Bulletin 68 (1): 147-162 ©ZFMK
The biodiverse rotifers of Northeast India 157
Table 2. Rotifer community richness by aquatic ecosystem types of Northeast India.
Study sites Species Genera Families
Ramsar sites
Loktak Lake (93°46’— 93°55’E, 24°25’—24°42’N) 200 48 23
Deepor Beel (91°35’—91°43’E, 26° 05’—26°11’N) 183 36 20
Floodplain lakes (beel/s) of Brahmaputra Basin, Assam 244 46 el
Barpeta (6 beels) (90°52’—91 °42’E, 26°17'—-26°40’N) 176 35 19
Mayjuli River Island (10 bee/s) (93°-95°E, 25°-27°N) 174 34 18
Dibru-Saikhowa Biosphere Reserve (DSBR) (5 ee/s) 162 32 18
(95°22’—95°24’E, 27°34’-27°55’N)
Tinsukia (5 beels) (95°22’—96°35’E, 27°14’—28°40’N) 169 33 19
Dibrugarh (6 beels) (93°22’—95°35’E, 26°19’—27°30’N) 179 3) 19
Floodplain lakes (pats) of Manipur
Manipur valley (15 pats) (93°45’—94°00’E, 24°25’—24°45’N) 200 48 23
Small floodplain wetlands (dobas or dubies) of Assam
A. Brahmaputra valley (90°—93°E, 26°—27°N) 167 34 18
a. Lower Assam 154 34 18
b. Central Assam 150 31 19
c. Upper Assam 135 30 1
B. Barak valley, south Assam (92°45’—92°75’E, 24°48’—24°80’N) 159 35 19
Arunachal Pradesh (91°20’—97°30’E, 26°28’—29°30’N) 165 Sy 19
Nagaland (93°3’-93°5’E, 25°4’-27°0’N) 150 37 19
Mizoram (92°15’—93°29’E, 21°58’—24°35’N) 162 35 19
Meghalaya (90°05’—92°40’E, 25°10’—26°15’N) 161 40 20
Tripura (92°10’—92°20’E, 22°56’—24°32’N) 163 35 19
Manipur (93°50’—94°00’E, 24°10’—24°55’N) 169 44 22
Floscularidae and Euchlanidae were represented by 75,
42, 41, 32, 14, 11 and 10 species, respectively; Trochos-
phaeridae and Philodinidae comprised 9 species each;
and Trichotriidae and Collothecidae included 8 and 7 spe-
cles, respectively. Brachionidae and Flosculariidae each
yielded six genera. The richness variations of speciose
six Eurotatoria families in seven states of NEI are shown
in Fig. 5. The rotifer communities of the sampled sev-
en states had similarities ranging between 72.1—82.3%
(vide Serensen’s index). The hierarchical cluster analy-
sis (Fig. 6) showed highest affinity between the rotifer
assemblages of Assam and Manipur, while Meghalaya
fauna showed the highest divergence.
Our observations on faunal diversity of Rotifera in the
floodplain lakes, small floodplain wetlands and small
Bonn zoological Bulletin 68 (1): 147-162
lentic ecosystems of NEI recorded richness variations as
indicated in Table 2. Two Ramsar sites: Loktak Lake and
Deepor Beel yielded 200 species belonging to 48 genera
and 23 families, and 183 species belonging to 36 gen-
era and 20 families, respectively. The small floodplain
wetlands (dobas or dubies) of the Brahmaputra river ba-
sin had 157 species with marginal variations from low-
er (154 species), central (150 species) and upper Assam
(135 species); and dobas or dubies from Barak valley of
south Assam had 159 species. The sampled small lentic
ecosystems of Arunachal Pradesh, Nagaland, Mizoram,
Meghalaya, Tripura and Manipur had 150-165 species.
Richness ranged from 162 to 179 in various floodplain
lakes (beels) of Assam and Manipur floodplain lakes
(pats) had 200 species.
©ZFMK
158 Bhushan Kumar Sharma & Sumita Sharma
DISCUSSION
The rotifer assemblages of NEI reveal total richness (S)
of 303 species belonging to 53 genera and 24 families;
these represent ~70%, ~81% and 96% of species, genera
and families of the phylum known to date from India,
respectively, and thus highlight highly biodiverse char-
acter vis-a-vis the Indian Rotifera. Further, 292 species
(~96% of S) observed from seven northeastern states af-
firm the high rotifer heterogeneity found in our plankton
and semi-plankton collections. To date, Rotifera of NEI
is the most speciose and diverse than any region of In-
dia (Sharma & Sharma 2017) and Sri Lanka (Fernando
1980) — the only reasonably well sampled country of the
Indian subcontinent. The diverse nature of rotifer fauna is
attributed to overall habitat diversity and ecological het-
erogeneity of aquatic ecosystems located across varied
ecological and geomorphic regimes, the location of NEI
in the Himalayan and Indo-Burma Biodiversity hotspots,
the ‘rotiferologist effect’ vide Fontaneto et al. (2012), and
sampling intensity. The rotifer richness documented from
this interesting biogeographic region of India is similar to
that of Cambodia (304 species: Sor et al. 2015) although
less than the 398 species known from well studied fauna
of Thailand (Sa-Ardrit et al. 2013). On the other hand,
our tally is distinctly higher than other Southeast Asian
faunas including Laos (Segers & Sanoamuang 2007),
Philippines (Tuyor & Segers 1999), Malaysia (Segers
2004; Fontaneto &Ricci 2004), Myanmar (Koste 1990),
and Singapore (Fernando & Zankai 1981) and Vietnam
(Trinh et al. 2019).
This study records high Rotifera richness amongst sev-
en states (150-244, 181+39 species; 49.5—80.5% of S) of
NEI than 66—216 species reported earlier (Sharma & Shar-
ma 2014a). Our observations show a distinct > two-fold
increase in species known each from Arunachal Pradesh
(Sharma & Sharma 2019a), Mizoram (Sharma & Sharma
2015b), and Nagaland (Sharma et al. 2017). In addition,
we report richness updates from Manipur (29%); Assam
(12.9%) and Meghalaya (19.2%) and Tripura (17.8%)
and overall species update of 27.3% from NEI. Assam
> Manipur depict highest number of species of the phy-
lum known from any state of India, while Manipur also
reflects rich higher diversity (genera and families). The
state-wise richness variations from NEI concur with the
report of ‘All Taxa Biological Inventories (ATBI) vide
Dumont & Segers (1996) for the tropical and subtropical
rotifer assemblages. With nearly ’4 species known from
all seven states, the rotifers communities showed 72.1—
82.3% similarities (vide Sorensen’s index). Assam and
Manipur rotifers had the maximum affinity (82.3%) and
it was followed by 81.5% similarity between two hills
states of Arunachal Pradesh and Nagaland, while Megha-
laya had the greatest dissimilarity to other assemblages.
Bonn zoological Bulletin 68 (1): 147-162
Rotifera of NEI is characterized by sizable fraction of
species (~ 24% of S) of global biogeographic interest
which are categorized as follows:
a) Australasian species: Brachionus dichotomus re-
ductus, B. falcatus reductus, B. kostei, B. lyratus,
B. murphyi, Lecane batillifer, L. latissima, L. shieli,
Macrochaetus danneelae, Notommata spinata and
Testudinella walkeri,
b) Oriental endemics: Brachionus donneri, B. srisu-
monae, Colurella sanoamuangae, Keratella edmond-
soni, Lecane acanthinula, L. blachei, L. bulla diabol-
ica, L. isanensis, L. niwati, L. solfatara, L. superacu-
leata and Filinia camasecla;
c) Indo-Chinese species: Lecane dorysimilis;
d) Indian endemics: Collotheca hexalobata C. tetralo-
bata, Lecane jaintiaensis, Lepadella nartiangensis,
and undetermined 7estudinella sp. and T. sp.1 (vide
Sharma & Sharma 2018a).
e) Paleotropical species: Dipleuchlanis ornata, Euchla-
nis semicarinata, Keratella javana, Lecane braumi,
L. lateralis, L. simonneae, L. stichoclysta, L. unguita-
ta, Lepadella bicornis, L. discoidea, L. minoruoides,
L. vandenbrandei, Testudinella brevicaudata, T. gree-
ni, Trichocerca abilioi, T. braziliensis, T. hollaerti and
T. kostei;
f) Palaearctic species: Cephalodella trigona, Lecane bi-
fastigata and Squatinella bifurca,
g) Holarctic species: Lecane elongata, L. levistyla,
Trichocerca taurocephala and T. uncinata;
h) Nearctic and Palearctic species: Trichocerca maior,
i) Neotropical species: Lecane calcaria, L. marchantar-
ia, L rugosa, L. sola, Lepadella neglecta, Mytilina
lobata;
j) Neotropical-Pacific species: Lepadella desmeti and
L. elongata;
k) Cosmo (sub) tropical species: Brachionus durgae:
1) Other interesting species: Lecane calcaria, L. rhena-
na, L. ruttneri, L. patella oblonga, Mytilina mi-
chelangellii, Ptygura tacita, Testudinella amphora,
Trichocerca edmondsoni and T. siamensis.
Our collections highlight the record richness of 91% and
87% of the Australasian and the Oriental elements known
from India, respectively with ~81% and ~67% species
of the two categories exclusively restricted to NEI, re-
spectively. This diagnostic feature, affirming strong af-
finity of Rotifera of NEI with that of Southeast Asia and
Australia, is hypothesized to invasion of these elements
through ‘the Assam gateway’ — a vital biogeographic cor-
ridor of India (Mani 1974) which is known to facilitate
interchanges between the Indian and Asian biota (Ranga
Reddy 2013) and presently even with Australian Rotif-
era. About ~72% species of the listed 12 categories are
reported to date from India exclusively from NEI. Be-
sides, 32 species (10.6%) namely Adineta vaga, A. lon-
©ZFMK
The biodiverse rotifers of Northeast India 159
gicornis, Cephalodella intuta, C. ventripes, Colurella
tesselata, Habrotrocha angusticollis, H. angusticollis
attenuata, H. lata, H. leitgebii, H. microcephala, Kera-
tella javana, Lecane aeganea, L. clara, L. glypta, L. rhyt-
ida, L. stichaea, Lepadella heterodactyla. L. latusinus,
L. patella oblonga, Monommata grandis, M. maculata,
Stephanoceros fimbriatus, Taphrocampa annulosa, Te-
studinella dendradena, T. tridentata, Trichocerca bidens,
T. insignis, T: insulana, T: mus, T. scipio and T: sulcata
are characterized by the Indian distribution restricted to
NEI. Our remarks thus impart both the global and region-
al biogeographic interest to Rotifera fauna of NEI and,
hence, assign it a contrasting identity than the rotifer as-
semblages of the rest of India. The relative paucity of the
Indian endemics in NEI is secondary as (a) a number of
such species namely Brachionus srisumonae, Colurella
sanoamuangae, Lecane dorysimilis, L. isanensis, L. la-
tissima, L. niwati, L. shieli, L. superaculeata, Lepadella
desmeti and Trichocerca siamensis are described as new
species from Thailand and elsewhere from southeast
Asia; (b) about eight potential new species from NEI are
awaiting descriptions pending analysis of more speci-
mens (BKS, unpublished); and (c) collections from high
and middle altitudes of Arunachal Pradesh, and the most
unexplored eastern Himalayan state of Sikkim are likely
to add interesting species.
Lecanidae (75 species) forms a notable fraction of Ro-
tifera of NEI (24.8%) and that of individual states (5149
species), while Brachionidae (42, 28+5 species) > Lep-
adellidae (41, 2645 species) > Trichocercidae (32, 18+4
species) contribute 38.1%. The four families collectively
comprise sizable components of 62.9% and 66.943.4%
of Rotifera species known from NEI and the seven
states, respectively. The order of importance deviates
as Lepadellidae > Brachionidae in our collections from
Manipur, Meghalaya and Nagaland in particular due to
diagnostic paucity of the brachionids. On the contrary,
the Brachionidae-rich Rotifera of Assam and Arunachal
Pradesh (33 species each) are noteworthy. Lecanidae,
Lepadellidae, Trichocercidae and Brachionidae richness
of NEI represents ~81%, ~91%, ~86% and ~84% of the
species of these taxa known from India. The cumulative
importance of these families concurs with the reports
from Thailand (Sa-Ardrit et al. 2013), Africa (Segers
et al. 1993; Green 2003), Argentina (Jose de Paggi 2001),
and Brazil (Serafim Jr. et al. 2003; Bonecker et al. 2005,
2009). Notommatidae, Testudinellidae, Trochosphaeri-
dae, Mytilinidae and Trichotriidae are other Monogonont
families with richness interest. The stated features of
richness impart a broadly littoral-periphytic character to
the rotifer fauna of NEI which, in turn, is largely attribut-
ed to nature of the sampled water bodies, and even pau-
city of planktonic rotifers in small lentic ecosystems pre-
dominant in hill states of Arunachal Pradesh, Mizoram,
Nagaland and Meghalaya, and largely sampled from Tri-
pura and Manipur.
Bonn zoological Bulletin 68 (1): 147-162
The importance of ‘tropic-centered’ Lecane throughout
the seven states (27.7+1.7% of S) confirms the most im-
portant role of this thermopile in Rotifera communities
of NEI as found in southeast Asia (Segers 1996, 2001).
This generalization, inclusive of the eastern Himalayan
state of Arunachal Pradesh (Sharma & Sharma 2019a),
marks a notable contrast to its relative paucity from the
western Himalayas (Sharma & Sharma 2018c). The rich-
ness of ‘tropic-centered’ Brachionus merits caution in
light of the relative paucity of its species in Manipur as
well as in hill states of Meghalaya, Mizoram, Nagaland
and Arunachal Pradesh. This salient feature is attribut-
ed to slightly acidic waters (Sharma & Sharma 2005,
2014a) of hilly areas, lack of permanent limnetic habitats
(Sharma & Sharma 2014c) and is hypothesized to result
from certain factors otherwise limiting the regional dis-
tribution of Brachionus spp. (BKS, unpublished); the last
aspect yet needs to be investigated. The rotifer fauna of
NEI indicates highest richness (10 species) of “temperate
centered’ Keratella, amongst 11 known Indian species
(Sharma & Sharma 2014c), but with the ‘cold-water’
Keratella serrulata and K. ticinensis found exclusive-
ly from Arunachal Pradesh (Sharma & Sharma 2019a).
Further, the three species of “temperate centered’ Nof-
holca are known only from this eastern Himalayan state
(Sharma & Sharma 2019a). Our observations also focus
attention on the paucity of Mytilina and Filinia spp., and
lack of Conochilus from Arunachal Pradesh, Nagaland
and Mizoram; and paucity of Filinia, and scarceness of
Hexarthra and Conochilus species in Manipur. Overall
importance of ‘tropic-centered’ taxa, restricted occur-
rence of ‘cold-water’ species, high richness of cosmopol-
itan species (~65%) and collective richness (~21%) of
cosmotropical and (sub) tropical species impart a broadly
tropical character to Rotifera of NEI.
Segers et al. (1993) hypothesized (sub) tropical flood-
plain lakes as the globally rich rotifer habitats, while
Sharma & Sharma (2008, 2014a, 2018b) extended this
hypothesis to the floodplains of NEI. While augmenting
the studies supporting our hypothesis, we now report 200
and 183 species from Loktak Lake and Deepor beel, re-
spectively; the two Ramsar sites are thus categorized as
Rotifera ‘hot-spots’ of the Indian sub-region as well as
one of the globally most biodiverse rotifer biotopes. Be-
sides, the selected beels of Barpeta district (176 species),
the Dibru-Saikhowa Biosphere Reserve (162 species),
the Majuli River island (174 species), Dibrugarh district
(179 species) and Tinsukia district (169 species) of the
Brahmaputra river basin of Assam, and selected pats of
Manipur (200 species) reveal speciose assemblages. The
richness known from various bee/s and pats of NEI large-
ly compares with 184 species from the well-sampled Up-
per Parana floodplain (Bonecker et al. 1994, 1998, 2005)
of Brazil, while it is more biodiverse than the records
from the Rio Pilcomayo National Park (a Ramsar site),
Argentina (Jose de Paggi 2001); Oguta lake and Iyi-Efi
©ZFMK
160 Bhushan Kumar Sharma & Sumita Sharma
lake from the Niger delta (Segers et al. 1993), Africa:
Lake Guarana, Brazil (Bonecker et al. 1994); Thale-No1
Lake, a Ramsar site of Thailand (Segers and Pholpunthin
1997); Laguana Bufeos of Bolivia (Segers et al. 1998;
Koste 1974), and from Rio Tapajos and Lago Camaleao
(Koste and Robertson 1983) of Brazil, respectively; and
the Kashmir Himalayan floodplains (Sharma & Sharma
2018c).
We focus attention on the high species richness of Roti-
fera of small lentic ecosystems of NEI; the latter deserve
attention as hotspots both in terms of species composition
and biological traits (EPCN 2008), and are considered as
keystone systems for analyses and conservation of bio-
diversity (Oertli et al. 2010; Céréghino et al. 2014; Vad
et al. 2017; Oertli 2018). These water bodies are largely
ignored in India while Sharma & Kensibo (2017) hypoth-
esized these biotopes to be one of the biodiverse Rotifera
habitats of the Indian sub-region. The small lentic habi-
tats predominant in the hill states of Arunachal Pradesh,
Nagaland, Mizoram and Meghalaya had 165, 150, 162
and 161 species, respectively. Besides, small floodplain
wetlands (dobas or dubies) of Assam are the rotifer rich
habitats with record richness of 167 species from the
Brahmaputra valley with marginal variations of 154, 150
and 135 species from dobas or dubies of lower, central
and upper Assam regions, while dobas or dubies of Barak
valley of south Assam have ~93% of the rotifer species
reported from the floodplains of south Assam (Sharma &
Sharma 2019b). The results thus endorse our hypothesis
on overall importance of varied small lentic ecosystems
of NEI vis-a-vis Rotifera biodiversity.
This study highlights the record richness of 84 and 81
species found in May and June, 2017 collections from a
floodplain lake (bee/) of upper Assam; 85 species each
from December 2016 and January 2017 samples from
Deepor beel (Ramsar site) and the record richness of 86
and 89 species from Loktak Lake basin of Manipur in
November and December 2017 samples. The assemblag-
es of 80+ species are described as the ‘Rotifera paradox’,
analogous to the classical ‘paradox of the plankton’ re-
ported by Hutchinson (1961), which reveal the intriguing
possibility of the co-existence of a number of rotifer spe-
cies in the floodplain ecotones and are attributed to high
amount of niche overlap (MacArthur 1965). The said re-
ports merit interest as compared with the highest global
assemblage of 102+ species known from Broa reservoir,
Brazil (Segers & Dumont 1995). Our results are more
biodiverse than earlier highest individual Indian reports
of 76 species from a beel of DSBR (Sharma et al. 2017),
79 species from Deepor beel (Sharma & Sharma 2013)
and 79 species from Loktak Lake (Sharma 2009; Sharma
et al. (2016). Further, our collections from unstructured
small floodplain wetlands (dobas or dubies) of the Maju-
li River Island and upper Assam highlight the * Rotifera
paradox’ with speciose assemblages of up to 50 species
per sample (Sharma & Sharma 2019c).
Bonn zoological Bulletin 68 (1): 147-162
In summary, the most biodiverse Rotifera of NEI, than
known from any region of the Indian subcontinent, is
noteworthy. High richness of species of global and re-
gional biogeographic interest with a large fraction ex-
clusively restricted to NEI, the littoral-periphytic rotifer
assemblages with broadly tropical character except that
of the eastern Himalayan state of Arunachal Pradesh, and
notable rotifer heterogeneity amongst the seven north-
eastern states are notable attributes. The high affinity of
NEI Rotifera with Southeast Asian and Australian faunas
highlights the role of ‘the Assam-gateway’ that facilitates
the invasion of the Australasian, Oriental, the Indo-Chi-
nese and the Southeast Asian species. The species-rich
rotifer assemblages of small lentic environs of Arunachal
Pradesh, Mizoram, Nagaland, Meghalaya, Manipur and
Tripura; beels and dobas and dubies of the Brahmapu-
tra and the Barak river floodplains of Assam, and pats
of Manipur; the examples of ‘the Rotifera paradox’ in
certain beels and pats, and dobas and dubies highlight
the tremendous ecological diversity of this phylum in
NEI. This study is an important contribution to biodi-
versity and biogeography of Rotifera of India, Asia and
the Oriental region. Our results affirm the importance of
intensive sampling and taxonomic expertise in enabling
comprehensive faunal analyses and documentation of
small rotifer species that are usually over-looked in the
Indian works. Analyses of the littoral-periphytic, sessile,
colonial and benthic rotifers from the unexplored eastern
Himalayan state of Sikkim, high and middle altitudes of
Arunachal Pradesh and also other states are desired for
future biodiversity update.
Acknowledgements. The senior author is thankful to the Min-
istry of Environment, Forests and Climate Change (Govt. of
India) for AICOPTAX project, the G.B. Pant Institute of Hi-
malayan Environmental Development, Almora for a research
grant, and to “University with Potential for Excellence Program
(Biosciences)” program of North-Eastern Hill University, Shill-
ong for a research program which facilitated the sampling. The
senior author is thankful to the Head, Department of Zoology,
NEHU, Shillong, for facilities and collectively to Drs L. Pach-
uau, M.K. Hatimuria, G. Thangjam, K.R. Sounti Pou, S.I. Khan
and N. Noroh for their help in the field collections on several
occasions. We thank our peers: Dr Russell J. Shiel, Australia
and an anonymous reviewer for useful comments and sugges-
tions. Our special personal thanks to Dr Russell J. Shiel for his
critical post-peer review scrutiny of our Ms. We wish to thank
Dr Ralph S. Peters and Dr Bernhard Huber (Bonn zoological
Bulletin) for help and suggestions during the peer review. The
authors have no conflict of interests.
REFERENCES
Bonecker CC, Aoyagui ASM, Santos RM (2009) The impact
of impoundment on the rotifer communities in two tropical
floodplain environments: interannual pulse variations. Bra-
zilian Journal of Biology 69: 529-537
©ZFMK
The biodiverse rotifers of Northeast India 161
Bonecker CC, Costa CLD, Velho LFM, Lansac-To6ha FA
(2005) Diversity and abundance of the planktonic rotifers in
different environments of the Upper Parana River floodplain
(Parana State — Mato Grosso do Sul State, Brazil). Hydrobi-
ologia 546: 405-414
Bonecker CC, Lansac-Toha FA, Rossa DC (1998) Planktonic
and non-planktonic rotifers in two environments of the upper
Parana River floodplain, state of Mato Grosso do Sul, Brazil.
Brazilian Archives of Biology & Technology 41: 447-456
Bonecker CC, Lansac-Téha FA, Staub A (1994) Qualitative
study of Rotifers in different environments of the high Para-
na River floodplain (Ms), Brazil. Revista UNIMAR, 16(1):
1-16
Céréghino R, Botx D, Cauchie HM, Martens K, Oertli B (2014)
The ecological role of ponds in a changing world. Hydrobi-
ologia 723(1):1—6
Dumont HJ, Segers H (1996) Estimating lacustrine zooplank-
ton species richness and complementarity. Hydrobiologia
341: 125-132
EPCN (2008) The Pond Manifesto. Available: http://campus.
hesge.ch/epcn/projects.asp.
Fernando CH (1980) The freshwater zooplankton of Sri Lanka,
with a discussion of tropicalfreshwater zooplankton compo-
sition. Internationale Revue der gesamten Hydrobiologie 65:
411-426
Fernando CH, Zankei NP (1981) The Rotifera of Malaysia and
Singapore with remarks on some species. Hydrobiologia 78:
205-219
Fontaneto D, Marcia Barbosa A, Segers H, Pautasso M (2012).
The ‘rotiferologist’ effect and the other global correlates of
species richness in rotifers. Ecography 35: 174—182
Fontaneto D, Ricci C (2004) Rotifera: Bdelloidea. Pp.121—126.
In: Yule CM, Sen YH (eds) Freshwater Invertebrates of the
Malaysian Region. Academy of Sciences Malaysia
Green J (2003) Associations of planktonic and periphytic roti-
fers in a tropical swamp, the Okavango Delta, Southern Afri-
ca. Hydrobiologia 490: 197—209
Hutchinson GE (1961) The paradox of the plankton. American
Naturalist 95: 137-145
Jersabek CD, Leitner MF (2013) The Rotifer World Catalog.
World Wide Web electronic publication. http,//www.rotifera.
hausdernatur.at/accessed {17.07.2018}
José De Paggi S (2001) Diversity of Rotifera (Monogononta) in
wetlands of Rio Pilcomayo national park, Ramsar site (For-
mosa, Argentina). Hydrobiologia 462: 25-34
Koste W (1974) Zur Kenntnis der Rotatorienfauna der ‘schwim-
menden Weise‘ einer Uferlagune in der Varzea Amazoniens,
Brasilien. Amazoniana 5: 25-60
Koste W (1978) Rotatoria. Die Radertiere Mitteleuropas, be-
griindet von Max Voigt. Uberordnung Monogononta. Geb-
rider Borntaeger, Berlin, Stuttgart. I. 673 pp U. II. Tafelbd.
(T. 234)
Koste W (1990) Zur Kenntnis der Radertierfauna des Kin-
da-Stausees in Zentral-Burma (Aschelmintes: Rotatoria). Os-
nabriicker Naturwissenschaftliche Mitteilungen 16: 83-110
Koste W, Robertson B (1983) Taxonomic studies of the Ro-
tifera (Phylum Aschelminthes) from a central Amazonian
varzea lake, Lago Camaleao (Ilha de Marchantaria, Rio Soli-
moes, Amazonas, Brazil). Amazoniana 7(2): 225-254.
Koste W, Shiel RJ (1987) Rotifera from Australian inland
waters. II. Epiphanidae and Brachionidae (Rotifera: Mono-
gononta). Invertebrate Taxonomy 7: 949-1021
Koste W, Shiel RJ (1989) Rotifera from Australian inland wa-
ters. IV. Colurellidae (Rotifera: Monogononta). Transactions
of the Royal Society of South Australia 113: 119-143
Bonn zoological Bulletin 68 (1): 147-162
Koste W, Shiel RJ (1990) Rotifera from Australian inland wa-
ters V. Lecanidae (Rotifera: Monogononta). Transactions of
the Royal Society of South Australia 114(1): 1-36
Mac Arthur, RH (1965) Patterns of species diversity. Biological
Revue 40: 510-533
Mani MS (1974) Biogeographical evolution in India, In: Mani
MS (ed.) Ecology and Biogeography in India. Dr. W. Junk
b.v. Publishers, The Hague. pp. 698—724
Oertli B (2018) Freshwater biodiversity conservation: The role
of artificial ponds in the 21st century. Aquatic Conservation
Marine and Freshwater Ecosystems 28: 264—269
Oertli B, Biggs J, Céréghino R, Declerck S, Hull A, Miracle
MR. (eds) (2010) Pond Conservation in Europe. Dordrecht,
the Netherlands: Springer
Ranga Reddy Y (2013) Neodiaptomus prateek n. sp., a new
freshwater copepod from Assam, India, with critical review
of generic assignment of Neodiaptomus spp. and a note on di-
aptomid species richness (Calanoida: Diaptomidae). Journal
of Crustacean Biology 33(6): 849-865
Sa—Ardrit P, Pholpunthin P, Segers H (2013) A checklist of the
freshwater rotifer fauna of Thailand (Rotifera, Monogononta,
Bdelloidea). Journal of Limnology 72(2): 361-375
Segers H (1995) Rotifera 2: Lecanidae. 6. pp: 1-226. In: Du-
mont HJ, Nogrady T (eds) Guides to identification of the Mi-
croinvertebrates of the Continental waters of the world. SPB
Academic Publishing bv. Amsterdam, the Netherlands.
Segers H (1996) The biogeography of littoral Lecane Rotifera.
Hydrobiologia 323: 169-197
Segers H (2001) Zoogeography of the Southeast Asian Rotifera.
Hydrobiologia 446/447: 233-246
Segers H (2002) The nomenclature of the Rotifera, annotated
checklist of valid family— and genus—group names. Journal
of Natural History 36: 621-640
Segers H (2004) Rotifera: Monogononta. Pp.106—119. In: Yule
CM, Sen YH (eds) Freshwater Invertebrates of the Malaysian
Region. Academy of Sciences Malaysia.
Segers H (2007) Annotated checklist of the rotifers (Phylum Ro-
tifera), with notes on nomenclature, taxonomy and distribu-
tion. Zootaxa 1564: 1-104
Segers H, Dumont HJ (1995) 102+ rotifer species (Rotifera:
Monogononta) in Broa reservoir (SP., Brazil) on 26 August
1994, with the description of three new species. Hydrobiolo-
gia 316: 183-197
Segers H, Ferrufino NL, De Meester L (1998) Diversity and
zoogeography of Rotifera (Monogononta) in a flood plain
lake of the Ichilo River, Bolivia, with notes on little known
species. International Review of Hydrobiology 83: 439-448
Segers H, Nwadiaro CS, Dumont HJ (1993) Rotifera of some
lakes in the floodplain of the river Niger (Imo State, Nigeria).
II. Faunal composition and diversity. Hydrobiologia 250:
63-71
Segers H, Pholpunthin P (1997) New and rare Rotifera from
Rivers for Life Thale Noi Lake, Pattalang Province, Thai-
land, with a note on the taxonomy of Cephalodella (Notom-
matidae). Annals Limnologie 33: 13-21
Segers H, Sanoamuang L (2007) Note on a highly diverse ro-
tifer assemblage (Rotifera: Monogononta) in a Laotian rice
paddy and adjacent pond. Internationale Revue Hydrobiolo-
gie 92(6): 640-646
Serafim M Jr, Bonecker CC, Rossa DC, Lansac-Toéha FA, Cos-
ta CL (2003) Rotifers of the Upper Parana River floodplain:
additions to the checklist. Brazilian Journal of Biology 63(2):
207-212
©ZFMK
162 Bhushan Kumar Sharma & Sumita Sharma
Sharma BK (1983) The Indian species of the genus Brachionus
(Eurotatoria: Monogononta: Brachionidae). Hydrobiologia
104: 31-39
Sharma BK (1987a) Indian Brachionidae (Eurotatoria: Mono-
gononta) and their distribution. Hydrobiologia 144: 269-275
Sharma BK (1987b). On the distribution of lecanid rotifers
(Rotifera: Monogononta: Lecanidae) in North-Eastern India.
Revue Hydrobiologie tropicale 20: 101-105
Sharma BK (1998) Freshwater Rotifers (Rotifera: Eurotatoria).
In: Fauna of West Bengal. State Fauna Series 3(11): 341—
461. Zoological Survey of India, Calcutta.
Sharma BK (2005) Rotifer communities of floodplain lakes of
the Brahmaputra basin of lower Assam (N. E. India): biodi-
versity, distribution and ecology. Hydrobiologia 533: 209-—
22s.
Sharma BK (2009) Diversity of Rotifers (Rotifera: Eurotatoria)
of Loktak lake, North-eastern India. Tropical Ecology 50(2):
277-285.
Sharma BK (2014) Rotifers (Rotifera: Eurotatoria) from wet-
lands of Majuli — the largest river island, the Brahmaputra
river basin of upper Assam, northeast India. Check List
10(2): 292-298
Sharma BK, Haokip TP, Sharma S (2016) Loktak lake, Ma-
nipur, northeast India: a Ramsar with rich rotifer (Rotifera:
Eurotatoria) diversity and its meta-analysis. International
Journal of Aquatic Biology 4(2): 69-79
Sharma BK, Kensibo (2017) Rotifer assemblages (Rotifera:
Eurotatoria) of two wetlands of Nagaland, northeast India:
ecosystem diversity and interesting features. International
Journal of Fisheries and Aquatic Studies 5(2): 609-617
Sharma BK, Kensibo, Sharma S (2017) Biodiversity of rotifers
(Rotifera: Eurotatoria) of Nagaland, northeast India; rich-
ness, composition and ecosystem diversity. International
Journal of Fisheries and Aquatic Studies 5(5): 180-187
Sharma BK, Noroh N, Sharma S (2017) Rotifers (Rotifera:
Eurotatoria) from floodplain lakes of the Dibru Saikhowa
Biosphere Reserve, upper Assam, northeast India: ecosystem
diversity and biogeography. International Journal of Aquatic
Biology 5(2): 79-94.
Sharma BK, Sharma S (1997) Lecanid rotifers (Rotifera: Mo-
nogononta: Lecanidae) from North-Eastern India. Hydrobio-
logia 356: 157-163
Sharma BK, Sharma S (1999) Freshwater Rotifers (Rotifera:
Eurotatoria). In: Fauna of Meghalaya. State Fauna Series
4(9): 11-161. Zoological Survey of India, Calcutta
Sharma BK, Sharma S (2000). Freshwater Rotifers (Rotifera:
Eurotatoria). In: Fauna of Tripura: State Fauna Series 7 (4):
163-224. Zoological Survey of India, Calcutta
Sharma BK, Sharma S (2005) Biodiversity of freshwater roti-
fers (Rotifera: Eurotatoria) from North-Eastern India. Mit-
teilungen aus dem Museum fur Naturkunde Berlin, Zoolo-
gische Reihe 81: 81-88
Sharma BK, Sharma S (2014a) Northeast India — An important
region with a rich biodiversity of Rotifera. In: Sharma BK,
Dumont HJ, Wallace RL (eds) Rotifera XIII: Rotifer Biology
— A structural and functional Approach. International Review
of Hydrobiology 99(1—2): 20-37
Sharma BK, Sharma S (2014b) Indian Lecanidae (Rotifera:
Eurotatoria: Monogononta) and its distribution. In: Sharma
BK, Dumont HJ, Wallace RL (eds) Rotifera XIII: Rotifer Bi-
ology — a Structural and Functional Approach. International
Review of Hydrobiology 99(1—2): 38-47
Sharma BK, Sharma S (2014c) The diversity of Indian Bra-
chionidae (Rotifera: Eurotatoria: Monogononta) and their
distribution. Opuscula Zoologica Budapest 45(2):165—180
Bonn zoological Bulletin 68 (1): 147-162
Sharma BK, Sharma S (2015a) The diversity and distribution
of Lepadellidae (Rotifera: Eurotatoria: Monogononta) of India.
International Review of Hydrobiology 100 (1): 34-42
Sharma BK, Sharma S (2015b) Biodiversity of freshwater ro-
tifers (Rotifera: Eurotatoria) of Mizoram, Northeast India:
composition, new records and interesting features. Interna-
tional Journal of Aquatic Biology 3(5): 301-313
Sharma BK, Sharma S (2017) Rotifera: Eurotatoria (Rotifers).
Chapter 7: 93-113. In: Kailash Chandra, Gopi KC, Rao DV,
Valarmathi K, Alfred JRB (eds) Current status of freshwater
faunal diversity in India. Zoological Survey of India, Kolkata
Sharma BK, Sharma S (201 8a) The Indian species of 7estudinel-
la (Rotifera: Flosculariacea: Testudinellidae) and their distri-
bution. International Journal of Aquatic Biology 6(1): 15-20.
Sharma BK, Sharma S (2018b) Loktak Lake, Manipur revisited:
A Ramsar site as the rotifer (Rotifera: Eurotatoria) biodiver-
sity hot-spot of the Indian sub-region. Bonn zoological Bul-
letin 67(1): 5-13
Sharma BK, Sharma S (2018c) The rotifers (Rotifera: Eurota-
toria) from the Kashmir Himalayan floodplains and Rotifera
biodiversity of Jammu & Kashmir, north India. International
Journal of Aquatic Biology 6(4): 208—220
Sharma BK, Sharma S (2019a) The biodiverse rotifer assem-
blages (Rotifera: Eurotatoria) of Arunachal Pradesh, the east-
ern Himalayas: alpha diversity, distribution and interesting
features. Bonn zoological Bulletin 68(1):1—12
Sharma BK, Sharma S (2019b) The biodiverse rotifers (Rotif-
era: Eurotatoria) of the floodplain wetlands of Barak valley
of Assam state, northeast India. Opuscula Zoologica Buda-
pest 50(1): 3-15.
Sharma BK, Sharma S (2019c) The biodiverse rotifers (Rotif-
era: Eurotatoria) from small wetlands of the Brahmaputra river
floodplains of lower and upper Assam, northeast India. Jour-
nal of Limnology and Freshwater Fisheries Research DOI:
10.17216/LimnoFish-15981
Sharma S, Sharma BK (2008) Zooplankton diversity in floodplain
lakes of Assam. Records of the Zoological Survey of India, Oc-
casional Paper No 290: 1-307
Sharma S, Sharma BK (2013) Faunal diversity of aquatic in-
vertebrates of Deepor Beel (a Ramsar site), Assam, northeast
India. Wetland Ecosystem Series 17: 1-226. Zoological Survey
of India, Kolkata
Sor R, Meas S, Wong KY, Min M, Segers H (2015) Diversity
of Monogononta rotifer species among standing water bodies
in northern Cambodia. Journal of Limnology 74(1): 192—204
Sorensen T (1948) A method of establishing group of equal am-
plitude in plant sociology based on similarity of species con-
tent and its application to analyse the vegetation of Danish
commons. Biologiske Skrifter 5: 1-34
Trinh MD, Vo MV, Traw ANQ, Le HTN, Tran SN (2019) Spe-
cies diversity of rotifers (Rotifera: Eurotatoria) of Phu Ninh
Lake with five new records from Vietnam. International Jour-
nal of Aquatic Biology 7(1): 38-44.
Tuyor JB, Segers H (1999) Contribution to the knowledge of
the Philippine freshwater zooplankton: new records of mono-
gonont Rotifera. International Review of Hydrobiology 84:
175-180.
Vad CF, Péntek A, Cozma NJ, Féldi A, Toth A, Toth B, Béde
NA, Mora A, Ptacnik R, Acs E, Zsuga K, Horvatha Z (2017)
Wartime scars or reservoirs of biodiversity? The value of
bomb crater ponds in aquatic conservation. Biological Con-
servation 209: 253-262
©ZFMK
Bonn zoological Bulletin 68 (1): 163-165
2019 - Sinclair J.B. & Shamshev I.V.
https://do1.org/10.20363/BZB-2019.68.1.163
ISSN 2190-7307
http://www.zoologicalbulletin.de
Scientific note
urn:Isid:zoobank.org:pub: A6BFC9BE-08 19-438 1-9199-2198E05A3145
Atalanta astigmatica Stackelberg, a new synonym of Wiedemannia lota Walker
(Diptera: Empididae: Clinocerinae)
Bradley J. Sinclair’* & Igor V. Shamshev’
‘Canadian National Collection of Insects & Canadian Food Inspection Agency, OPL-Entomology, K.W. Neatby Bldg., C.E.F.,
960 Carling Ave., Ottawa, ON, KIA 0C6, Canada
Zoological Institute, Russian Academy of Sciences, Universitetskaya nab. 1, St. Petersburg, 199034, Russia
* Corresponding author: Email: [email protected]
'urn:Isid:zoobank.org:author:45 16327F-B73E-456C-927F- 1 8EFBOB9E08B
2urn:Isid:zoobank.org:author:569F41CC-EC2B-4CF0-802A-8D7056C72C93
Abstract. An uncatalogued species of Empididae, Atalanta (Philolutra) astigmatica Stackelberg, 1937 was recently dis-
covered. This species is a new synonym of Wiedemannia lota Walker, 1851.
Key words. Turkmenistan, dance flies, Palaearctic.
While sorting through miscellaneous reprints, the publi-
cation of the Russian dipterist A.A. Stackelberg (1937)
was found to include an uncatalogued species of Empid-
idae: Atalanta (Philolutra) astigmatica Stackelberg,
1937. The species was based on four males and one fe-
male collected at Kara-Kala (now Magtymguly), Turk-
menistan. The species is not listed in the Palaearctic and
World catalogues (Chvala & Wagner 1989; Yang et al.
2007), but is recorded in the online database: Systema
Dipterorum (Evenhuis & Pape 2019). It should be noted
that A. (P.) astigmatica is the only species of Empididae
described by A.A. Stackelberg. Atalanta Meigen, 1800 is
treated as a junior synonym of Clinocera Meigen, 1803
(Evenhuis & Pape 2017).
The type series of A. (P.) astigmatica was collected by
the Russian parasitologist Polina A. Petrishtsheva (St. Pe-
tersburg, Institute of Experimental Medicine). She stud-
ied invertebrates (especially culicids and phlebotomids of
Diptera) as vectors of diseases but her collection (pres-
ent in ZIN) also includes many other taxa of Diptera that
were found together with imagoes of Culicidae and Psy-
chodidae in mammal burrows, caves, etc. The type locali-
ty, Magtymguly, is a small town (village in 1931) situated
near the southern slopes of the Kopet Dag Range on the
river Sumbur (south-western Turkmenistan) and it is not
a surprise that a species of aquatic empidids was found.
However, P.A. Petrishtsheva notes on labels (also in the
title of the paper of A.A. Stackelberg) a specific biotope,
“syum” (syumy, plural in Russian), which are artificial
or natural caves near villages which local people used
mainly for food storage. Stackelberg (1937) described
A. (P.) astigmatica in Russian (p. 123) and in German
Received: 14.05.2019
Accepted: 24.06.2019
(p. 133), because a part of the paper was simultaneous-
ly published in two languages and both versions of the
description are identical. In the Russian version he notes
that P.A. Petrishtsheva found several specimens but in the
German version four males and one female are indicated.
Stackelberg (1937) clearly designates a “type”; 1.e., ho-
lotype, and the entire series was listed as housed in the
Zoological Institute, St. Petersburg, Russia (ZIN), where
two male specimens were found; one specimen in the
general Empididae collection and one specimen in a box
with materials of P.A. Petrishtsheva, both are definitely
conspecific and undoubtedly originates from series noted
by Stackelberg in his paper. However, none of these spec-
imens bear an identification or type label of Stackelberg
(Fig. 1).
On the basis of the male terminalia and specifically
the clasping cercus, this species is conspecific with Wie-
demannia lota Walker, 1851 (Figs 1—2). For this reason
we propose that W. astigmatica is a junior synonym of
W. lota (syn. nov.). Wiedemannia lota is widespread in
the Palaearctic Region from Ireland to central Asia (Ta-
jikistan) (Chvala & Wagner 1989; Shamshev 2016).
The French dipterist F. Vaillant borrowed from ZIN a
collection of Clinocerinae collected in Middle Asia. In
the resulting paper (Vaillant 1960) he notes two males
and one female specimen collected by Petrishtsheva from
Kara-Kala, but did not recognize them as type specimens.
Vaillant identified these specimens as W. Jota. One of
these male specimens was returned to the general Empid-
idae collection of ZIN with Vaillant’s determination la-
bel attached. Vaillant retained two males from the series,
which are now housed in Musée cantonal de zoologie,
Corresponding editor: X. Mengual
Published: 01.07.2019
164 Bradley J. Sinclair & Igor V. Shamshev
-
Figs 1-3. Atalanta astigmatica Stackelberg, 1937 (=Wiedemannia lota Walker, 1851). 1. Paratype male, habitus in
lateral view and labels; 2. Paratype male, habitus, dorsolateral view; 3. Labels of holotype.
Bonn zoological Bulletin 68 (1): 163—165 ©ZFMK
Atalanta astigmatica Stackelberg, a new synonym of Wiedemannia lota Walker
Lausanne, Switzerland (MZLS). One of these male spec-
imens included a Stackelberg identification label (Fig. 3),
which clearly identifies it as the holotype of A. astigmati-
ca. Stackelberg (1937) stated that the series was collected
in September (IX), but the holotype is labelled August
(VII), which we consider an oversight by the author.
Apparently, Vaillant overlooked the type status of this
specimen. He (Vaillant 1960) made no mention of Stack-
elberg’s paper with the description of A. astigmatica and
probably was unaware that it was an available name.
Wiedemannia lota Walker, 1851: 107.
Atalanta (Philolutra) astigmatica Stackelberg, 1937:
123. Type locality: “Kara-Kala” (= Magtymeguly, 38°26'N
56°18'E), Turkmenistan. Syn. nov.
Type material examined.
Holotype. Male, labelled (Fig. 1C): “[printed in Cyrillic,
Russian] Kara-kala [now Magtymguly], Syumy/ Turk-
mentya [= Turkmenistan] VHI —/ Petrishtsheva [1]931”;
“Atalanta Typ. °33/ astigmatica sp.n./ Stackelberg det.”;
“Wiedemannia/ (Chamaedipsia)/ lota HALIDAY/ </
F. VAILLANT dét. [yellow label]” (ZIN) [currently
housed in MZLS].
Paratypes. Same data as for holotype, except collected in
IX (2 64, ZIN, 1 63, MZLS).
Bonn zoological Bulletin 68 (1): 163-165
165
Acknowledgements. Jean-Luc Gattolliat (MZLS) kindly as-
sisted us in locating two males from the type series donated
by F. Vaillant to his Museum and provided the photo of the
holotype labels. Alexey Kovalev (ZIN) kindly produced pho-
tos of the habitus of the paratype. The study of Igor Shamshev
was performed within the frames of the Russian State Research
Project No AAAA-A19-119020690101-6 and supported by
the Russian Foundation for Basic Research (grant no. 18-04-
00354A).
REFERENCES
Chvala M, Wagner R (1989) Empididae. Pp. 228-336 in: Sods
A & Papp L (eds) Catalogue of Palaearctic Diptera, Volume 6,
Therevidae — Empididae. Elsevier Science Publishing, Am-
sterdam
Evenhuis NL, Pape T (2017) Battling the un-dead: the status of
the Diptera genus-group names originally proposed in Johann
Wilhelm Meigen’s 1800 pamphlet. Zootaxa 4275: 1-74
Evenhuis NL, Pape T (eds) (2019) Systema Dipterorum, Ver-
sion 2.2. Online at http://sd.zoobank.org/, accessed on
May 14, 2019
Shamshev IV (2016) An annotated checklist of empidoid flies
(Diptera: Empidoidea, except Dolichopodidae) of Russia.
Proceedings of the Russian Entomological Society 87: 3-183
Stackelberg AA (1937) Neue Dipteren-arten aus Hohlen de
Vertebrata Turkmeniens und angegrenzenden Lander Mittel
Asiens. Trudy soveta po izucheniyu estestvennykh proiz-
voditelnykh sil. Seria Turkmenskaya 9: 121—139 [In Russian
with German descriptions]
Vaillant F (1960) Quelques Empididae Atalantinae d’ Asie russe
[Dipt.]. Bulletin de la Société entomologique de France 65:
170-186
Walker F (1851) Insecta Britannica. Diptera. Volume 1. Reeve &
Benham, London
Yang D, Zhang K, Yao G, Zhang J (2007) World Catalog of
Empididae (Insecta: Diptera). China Agricultural University
Press, Beijing
©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 68 (1): 167-181
2019 - Mey E.
https://do1.org/10.20363/BZB-2019.68.1.167
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org:pub:A7B17D73-FA88-41B9-9361-FB3B3AB2ABDD
Parasitic on bird or mammal?
Echinopon monounguiculatum gen. nov., spec. nov.,
representative of a new family (Echinoponidae fam. nov.) in the Amblycera
(Insecta: Psocodea: Phthiraptera)
Eberhard Mey
Zentralmagazin Naturwissenschaftlicher Sammlungen der Martin-Luther-Universitat Halle-Wittenberg,
[Natural Science Collections, Martin Luther University Halle-Wittenberg], Domplatz 4, D-016108 Halle (Saale), Germany
* Corresponding author: Email: [email protected]
urn:lsid:zoobank.org:author:40DEB37F-48C3-434A-BA40-A7495ED878CC
Abstract. On the study skin of a Bornean Black Magpie Platysmurus aterrimus (Passeriformes, Corvidae) collected in
1888, stored in the collection of the Museum fir Tierkunde [Zoological Museum] Dresden, a female specimen of a pha-
rate amblyceran third instar larva was found. The possibility that the larva originally lived on this bird can be definitively
excluded, therefore it can only be considered as a straggler from an unknown host species. Its morphology showed a com-
bination of unusual characters that differentiates the specimen from all other known Amblycera, but that does place it close
to the Menoponidae sensu Jato. The insect, measuring only 1.32 mm in length, is characterized dorsally by stiff spine-like
setae on thorax and abdomen, and can be placed close to a menoponoid-style habitus by the following autapomorphies that
form the basis for the erection of Echinoponidae fam. nov.: 1. A blunt, curved cutaneous bulge on both sides of the labrum
equipped with three sturdy setae on each side, whose function (apart from possible movement coordination) is unknown.
— 2. A respiration system with tiny stigmata and tracheae, apparently without a post-spiracular setal complex at each end
of the central abdominal tergites. — 3. Coxa I is rounded, not elongated anteroposteriorly as tn all avian Amblycera. — 4. All
three pairs of legs have only a single long apically curved, basally humped claw. A small euplantula sits apically opposite
the second, only slightly smaller, first tarsal segment while the tarsus sole is equipped with two rows of adhesive pads (?)
and two setae pairs. Single-clawed Amblycera are only known from Neotropical mammals. — 5. Dorsally and ventrally,
head, thorax, and abdomen setae depart in many details from previously known chaetotaxies, (e.g.) ventral femur III has
setal combs (ctenidia) with three rows, on each side of abdominal segment II they have two rows, and on segments III to
VII one row on each (ctenidia are absent in all mammal-infesting Amblycera and in avian Amblycera are unknown in
such an excessive development); abdominal macrochaetae present only ventrally with one pair on each side of segment IT
and two pairs on segments VIII and IX. — 6. The female probably lacks the anal corona of setae typical of Menoponidae.
These characters, and the circumstances of the discovery of the specimen (with a record of a goniodoid ischnoceran, also
a straggler, on the same skin), allow us to make the simple decision as to whether the enigmatic Single-clawed Spiny
Amblyceran Echinopon monounguiculatum gen. nov., spec. nov. is an avian or a mammalian amblyceran.
Key words. Amblycera, morphology, taxonomy.
INTRODUCTION
The search for mummified chewing lice on an old mu-
seum study skin of the endemic Bornean Black Magpie
Platysmurus aterrimus (Corvidae) resulted in the sur-
prising discovery of an unknown species and genus of
the suborder Amblycera. Despite the rather awkward
situation of having only a single pharate (molting) third
instar larval female amblyceran to work with, whose ac-
tual host species was definitely not the Bornean Black
Magpie, this remarkable finding is here presented. The
specimen represents a new taxon, which actually requires
the erection of its own family within the Amblycera, a
suborder parasitizing almost all avian families but only a
Received: 03.01.2019
Accepted: 09.07.2019
few mammal groups, in particular Neotropical Rodentia
as well as Australian and Neotropical Marsupialia.
Based on the overview by Price et al. (2003: 3), 1509
valid species of Amblycera are known, of which 1341
infest birds and only 168 infest mammals. Taking a con-
servative approach, they can be placed in 10 families
(see Mey 2003; number of species according to PRICE
et al. 2003 in square brackets): Only on birds — Meno-
ponidae Myjéberg, 1910 s./. [1043], Laemobothriidae
Myjoberg, 1910 [20], Ricinidae Neumann, 1890 [79] and
Trochiloecetidae (Carriker, 1960) Clay, 1962 a [30]. On
mammals — Boopiidae Mjéoberg, 1910 [55], Trimeno-
ponidae Harrison, 1915 [18], Protogyropidae (Ewing,
1924) Eichler, 1963[1], Gyropidae Kellogg, 1896 [44],
Abrocomophagidae Emerson & Price, 1976 [3] and
Corresponding editor: R. Peters
Published: 18.07.2019
168 Eberhard Mey
Gliricolidae (Ewing, 1924) v. Kéler, 1957 [45] (see also
Emerson 1982, Lakshminarayana 1976). If we ignore
the anthropogenically created secondary colonization of
Heterodoxus spiniger (Enderlein, 1909), this straightfor-
ward picture of the hospitalic distribution is “distorted”
only by one other boopiid species (Therodoxus oweni
Clay, 1971), which lives on cassowaries of New Guinea
(Mey & Barker in prep.).
A consistent recognition by louse systematists of the
Psocodea in the phylogenetic system has so far not been
reached because arguments regarding the paraphyly of
the Phthiraptera are apparently insufficiently grounded.
The discussion is still ongoing since Lyal’s (1987) mor-
phological and Murrell & Barker’s (2005) controversial
genetic study; see also Johnston et al. (2004), Yoshiza-
wa & Johnston (2006) and Friedemann et al. (2013).
Following the dissolution of the orders Psocoptera and
Phthiraptera, and their amalgamation in the order Psoco-
dea (formerly the superorder of Psocoptera and Pththi-
raptera), Ruggiero et al. (2015) among others have sug-
gested the following phylogenetic classification:
Order: Psocodea
Suborder: Troctomorpha
Infraorder: Nanopsocetae
Subinfraordinal group: Phthiraptera
Superfamily groups: Amblycera, Anoplura, Ischnocera
and Rhynchophthirina
The study by Johnson et al. (2018) confirms this classi-
fication.
MATERIAL & METHODS
The bird study skin that harbored the Echinopon spe-
cimen was twice thoroughly examined by me. During a
cursory observation the finding was initially misidenti-
fied as the exuviae of a Dermestes beetle, but following
preparation of the specimen it was eventually discovered
to be an unidentified louse species (Fig. 1) The follow-
ing more thorough examination of the Bornean Black
Magpie skin showed with certainty that the Echinopon
individual could not have originally infested that bird
species but must have arrived on the skin through con-
tamination. Neither a second specimen of Echinopon nor
amblyceran nits could be found on the skin. Only the sev-
eral imagines of the ischnoceran Olivinirmus borneensis
Mey, 2017 occurring on the skin can definitely be accept-
ed as having lived on the Bornean Black Magpie, espe-
cially as nits and larvae of the species were also found.
Instead, an additional finding on the skin (Figs 2—3) was
a pharat immature male of a goniodoid specimen (total
length 1.05 mm, head length 0.34, rear head breadth
0.42, abdomen breadth 0.51). Therefore, the possibility
must be conceded that the type host of Echinopon might
Bonn zoological Bulletin 68 (1): 167-181
Pharate
Fig. 1. female third instar larva, holotype
(Slide M. 5408. b) of Echinopon monounguiculatum gen. nov.,
spec. nov. Total length 1.32 mm. Photos: Stephan Lowe.
be a bird, and this would be either a pigeon/dove or a
galliform, since the true goniodids only parasitize the
orders Columbiformes and Galliformes. It can be not-
ed, that this specimen also reveals similarities with these
three ischnocerans, which live only on the Couas (Cuc-
uliformes) of Madagascar: Couala Gustafsson & Bush,
August 2017 (syn. Couanirmus Mey, September 2017),
Tesonirmus Mey, 2017 or Koanirmus Mey, 2017 (Gus-
tafsson & Bush 2017, Mey 2017). Echinopon morphol-
ogy also points in this direction, though it is so unusual
that a mammal as host cannot be excluded at this stage.
It is more than likely that both larvae (Figs 1—2) got
onto the Bornean Black Magpie skin from their origi-
nal host as “stragglers”, either in life in the “game bag”,
or on the taxidermy table, or even as mummies during
some handling of the study skin collection. In this last
case, strictly speaking, the idea that the type host must
occur on Borneo would have to be rejected. Skin C 9223
©ZFMK
Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 169
Fig. 2. Pharate male third instar larva goniodoid ischnocer-
an, undetermined (slide M. 5408. b, total length 1.05 mm),
found together with Echinopon monounguiculatum gen. nov.,
spec. nov. on the study skin of a Bornean black Magpie Platy-
smurus aterrimus.
was purchased in 1888 by A. B. Meyer from the taxi-
dermist and natural history dealer Edward Gerrard Ist
(1810-1910). Gerrard was working for the “new Natural
History Museum in South Kensington”, and was an “as-
sociate member of the Linnean Society of London and a
friend of Charles Darwin” (Morris 2014: 2). How Ger-
rard came into possession of the skin and under which
circumstances can today hardly be reconstructed without
going to a great deal of trouble. The inventory book of
the Dresden collection contains less information on the
matter than the original label on the bird skin itself; nor
does Morris (2014) provide any clues that could help. For
the moment, we have no other choice than to hope that
Echinopon monounguiculatum gen. nov., spec. nov. will
one day be rediscovered.
Bonn zoological Bulletin 68 (1): 167-181
Forty years have passed since the amblyceran chew-
ing-louse family Abrocomophagidae was erected, named
from the new genus and species Abrocomophaga chilen-
sis Emerson & Price, 1976 discovered in 1974 in the
Chilean Andes on Bennett’s Chinchilla Rat Abrocoma
bennettii (Emerson & Price 1976). This is the most recent
case in the 200-year history of phthirapterology in which
a new discovery immediately required that such a high
new taxonomic category be employed to accommodate
an unknown recent chewing louse.
Fig. 3. Male genitalia of the goniodoid in Fig. 2. Scale 0.1 mm.
In the meantime two further South American Abro-
comophaga species have been found: A. emmonsae
Price & Timm, 2000 ex Cuscomys ashaninka Emmons,
1999 [Abrocomidae] and A. hellenthali Price & Timm,
2000 ex Octodon degus (Molina, 1782) [Octodontidae]|
(Price & Timm 2000). However, Price & Timm (2000:
211) have withdrawn Abrocomophagidae, treat it now as
a synonym and place it in the Gyropidae, although they
state: “This genus [Abrocomophagal] is separated from
others in the family Gyropidae (and suborder Amblyc-
era) in having known representatives with all legs having
an unmodified tarsal claw and the abdomen with only
five pairs of spiracles”. Price et al. (2003: 75) should at
least have mentioned the former proposed division of
Gyropidae into subfamilies (Protogyropinae, Gyropinae
and Gliricolinae, see Clay 1970) but they did not.
The pharate third-stage Echinopon larva is mounted in
Canada balsam, and the state of its preservation can be
seen in Fig. 1. The photographs of the prepared specimen
©ZFMK
170 Eberhard Mey
Fig. 4. Front of head of Echinopon monounguiculatum gen. nov., spec. nov. with “labral organ” (LO).
Cn
Figs 5—6. Chaetotaxy of margin of front of head from one side above the upper mandibular articulation between nodus and labrum
(semi-schematic), 9 9. 5. Actornithophilus totani (Schrank, 1803) (Menoponidae sensu lato). 6. Echinopon monounguiculatum
gen. nov., spec. nov. (Echinoponidae fam. nov.) with “labral organ” (LO). Scale 0.1 mm.
Bonn zoological Bulletin 68 (1): 167-181 ©ZFMK
Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 171
ub
|
Fig. 7. Labium and postmentum chaetotaxy of Echinopon mon-
ounguiculatum gen. nov., spec. nov. Scale 0.1 mm.
(which also show a male of the pharate goniodoid men-
tioned above) were taken by Stephan Lowe at the Phy-
letisches Museum of the Friedrich-Schiller-Universitat in
Jena. All line drawings are by the author.
The following description of the new taxon is unusual
—a perhaps justified objection — in that it is solely based
on a single pharate third instar female, on which larval as
well as imaginal characters are visible. It should be re-
called that the paurometaboly of the Phthiraptera means
that during post-embryogenesis the morphostructure de-
velops gradually altering imaginipetal characters (e.g.,
chaetotaxy; see for instance Eichler 1959, v. Kéler 1952,
1955, Modrzejewska & Ztotorzycka 1987, Price 1987).
Even the beginnings of genital structures can often be
recognized in pharate third instar. The evaluation of these
characters therefore requires great care in order to avoid
erroneous interpretations.
In the Echinopon monounguiculatum holotype, the
postembryonic molt suture is a Y-shaped “fault line”
running from the head to abdominal segment VI (Fig. 1).
In this feature, Echinopon does not fundamentally dif-
fer from the familiar pattern in the other Amblycera (es-
pecially Menoponidae sensu /ato): molt suture running
from head to the far margin of abdominal segments II,
Fig. 8. Antenna and apparently three-segmented maxillarpalpus (end segment in molt) of Echinopon monounguiculatum gen. nov.,
spec. nov.
Bonn zoological Bulletin 68 (1): 167-181
©ZFMK
172 Eberhard Mey
DHS 27
Fig. 9. Chaetotaxy of head, prothorax, and mesothorax (dorsal) of Echinopon monounguiculatum gen. nov., spec. nov. Front of
head to molt suture. Rear of head in fresh molt, except for a few bristles on the temple not yet sclerotized, therefore uncertain in
outline.
38 =#
ee vee ote oy
Fig. 10. Chaetotaxy of head, prothorax, and mesothorax (dorsal) of Echinopon monounguiculatum gen. nov., spec. nov. Sclerotized
temple half, both pronotum halves and mesonotum of the third instar larva with bristles. Scale 0.1 mm. Bristle enumeration after
Clay (1962, 1969) and Ledger (1970, 1971).
Bonn zoological Bulletin 68 (1): 167-181 ©ZFMK
Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 173
Fig. 11. Meso- and metanotum as well as abdominaltergite I
(each of right side) of Echinopon monounguiculatum gen. nov.,
spec. nov. Scale 0.1 mm.
III, or IV (Eichler 1963, v. Kéler 1969, Neuffer 1954).
In the Laemobothriidae, however, there is a difference,
since in Eulaemobothrion atrum (Nitzsch, 1818) the pre-
formed molt suture is in a ventral position, beginning on
both sides of the antennal bases, then joining up before
the gular plate and running medianly to the third pair of
legs (v. Kéler 1969: 63).
A phylogenetic character analysis of Echinopon, to-
gether with a revision of Jadwigiella Mey, Eichler &
Kaddou (Menoponidae sensu lato) (Mey et al. 2004), is
planned.
Abbreviations. A, 8, C: dorsal temple setae (new ?, un-
known in Amblycera ?). — a—e (f): dorsal head sensillae (f
is perhaps new). — appsr: anterior-posterior pronotal setal
row (= marginal prothoracic setae = mps). — Cn: clypeal
nodus. — cps: central pronotal setae complex. — ct 2—7:
ventral ctenidia (“setal comb”) on abdominal segments II
to VII. — DHS 2—32: dorsal head setae 2-32. — dps I—3:
dorsal prothoracic setae. — E: euplantula. — ES: ecdysial
suture. — L: labrum. — LO: “labral organ”. — M: mandi-
ble. — Pm: postmentum. — Pn: postnotum. — ps: pronotal
Bonn zoological Bulletin 68 (1): 167-181
Fig. 12. Double-segmented tarsus and tibia (detail) of first pair
of legs of Echinopon monounguiculatum gen. nov., spec. Nov.
Pretarsus in molt (imaginal claw fully developed, larval “drawn
in” and disintegrating).
sensillum. — f: transverse pronotal carina. — T /—2: tarsus
1 (first segment), 2 (second segment = pretarsus).
RESULTS
Phylogenetic placement. The Echinoponidae fam. nov.
are differentiated from all other known Amblycera by the
following characters. If there is a strong possibility that
certain characters are autapomorphies then this is indicat-
ed. Characters whose interpretation is uncertain are also
thus indicated. The characters or combined characters
1-4, 6, 8-12, 14 and 15 are exclusive to the Echinoponi-
dae.
1. Special organ flanking each side of the labrum. Pear-
shaped cutaneous bulge with bristles between labrum
and front of clypeal nodus, mounted on a broad base
immediately before the upper mandibular articulation
(Figs 4, 6). Whether this is homologous with the bris-
tle-free pulvinus (pallettes, pulvinarium) of Ricinus is
questionable. Autapomorphy.
2. Diverges in at least six positions from the striking
dorsal head bristles (including sensilla) of Menoponi-
dae s./. and Boopiidae (Figs 9-10). The following are
six autapomorphies: (1) On rear head only one macro-
chaeta on temple (DHS 27; also longest head bristle)
with one associated mesochaeta (DHS 26). (2) From
here to interface of pronotum and rear head 8 micro-
chaetae are marginally inserted at roughly similar
©ZFMK
174 Eberhard Mey
13
Figs 13—14. Echinopon monounguiculatum gen. nov., Spec. nov.
13. First pair of legs (of the right one only coxa and trochan-
ter). Tibia (partly) and femur without bristles. Scale 0.1 mm.
14. Tibia and tarsus enlarged.
intervals. Therefore, compared with Menoponidae
and Boopliidae, between DHS 23 and 26 there are 6
additional bristles (in Fig. 10 not numbered). (3) The
submarginal DHS 21—23 are microchaetae. In Meno-
ponidae and Boopiidae at least one of them is in the
form of a macrochaeta (Fig. 10). (4) Among the preoc-
ular setae DHS 8-11 of Menoponidae and Boopi-
idae one is missing, probably the first one (DHS 8).
In this group of bristles DHS 9 is the second-longest
head macrochaeta. It is followed by a short (DHS 10)
and the third-longest head bristle (DHS 11) (Fig. 9).
(5) Of the setal complex DHS 14—16 with sensilla c
and d there is only one microchaeta (14 or 15) and
also, shifted one bristle-length towards the median, a
bristleless sensillum (probably d) (Fig. 9). (6) Of the
dorsal head sensilla a—-e (sensu Clay 1969, Marshall
2003) only d is definitely without an accompanying
bristle. Also without an adjacent bristle is a new (=
f) sensillum, sitting on the rear head exactly between
DHS 21 and 22 (Fig. 10). (7) In Fig. 10, three temple
setae, marked A, B and C, cannot with certainty be
homological with bristles observed in Menoponidae
or Boopiidae.
3. Prothorax without macrochaeta, which would have
been longer than the prothorax. Pronotum with 11
robust marginal-posterior spines (= appsr incl. mps)
Bonn zoological Bulletin 68 (1): 167-181
Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 175
Fig. 15. Femur III with “double” triple-rowed ctenidia (upper
of imago, lower of third instar larva) of Echinopon monoun-
guiculatum gen. nov., spec. nov.
on one half and 9 on the other. Their regularly spaced
points of insertion line the side and hind margins
of the pronotum. All spines are relatively short, the
longest being the middle ones on the hind margin
(Fig. 10). Autapomorphy.
. Oneach body half, along the transverse pronotal cari-
na, there are three relatively fine bristles (differing in
size only on one side), dps 1—3. In this row, on both
sides, there 1s a pronotal sensillum (ps.). On each side
two robust spiny setae are inserted median-posterior-
ly (Fig. 10). Autapomorphy.
. Narrow free mesonotum with one pair of microchae-
tae on the margin (Figs 10-11). The actual micro-
chaetae placing (in Figs 10-11) on the mesonotum is
unclear.
. Except for the front margin, the metanotum is
equipped with dense series of spine-like setae, (each
half with 36 spines), only one pair of spines extends
median-posteriorly over the hind margin of abdomi-
nal tergite I (Fig. 11). Autapomorphy.
. First coxa rounded (Fig. 13), not anterioposteriorly
extended as in Boopiidae and bird-infesting Ambly-
cera. Plesiomorphy?
. Tarsus two-segmented. First tarsal segment with dou-
ble row of adhesive pads on the soles (each with at
least 8 pads), which are each flanked at the start and
Figs 16-17. Abdomen (ventral) of Echinopon monounguiculatum gen. nov., spec. nov. from segment III (16), from segment III to
end of abdomen (17). Note ctenidiae and macrochaetae growth. Ventral structures hardly pigmented and sclerotized.
Bonn zoological Bulletin 68 (1): 167-181
©ZFMK
176 Eberhard Mey
\ ct 2
1
1
ee ee eee ree, ee ”
Ss
ct 3
C gs vary ty
—1
~4
ct4
Win,
Fig. 18. Abdomen (ventral) with central chaetotaxy of Echinopon monounguiculatum gen. nov., spec. nov. Lateral bristles very
probably incomplete. Scale 0.1 mm.
Bonn zoological Bulletin 68 (1): 167-181 ©ZFMK
Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 177
Fig. 19. Abdomen (dorsal) from segment IV of Echinopon monounguiculatum gen. nov., spec. nov. Lateral sclerites on left side
have been pushed into each other on the slide. Scale 0.1 mm.
end with one pair of bristles. On tarsus I apical-dis-
tally a small euplantula (Figs 13-14). Second tarsal
segment without euplantula. Autapomorphy.
9. Second tarsal segment (pretarsus) of the three more or
less same-sized pairs of legs with a single claw. Claw
large, roughly half as long as second tarsal segment,
apically more or less bent to a hook, basally with a
proximal hump; not spreadable (Figs 12-14). Aut-
apomorphy.
10. Hardly sclerotized tiny abdominal stigmata pleural
(!) between the separated lateral sclerites. Tracheae
on segments III to VHI are so small that they can
Bonn zoological Bulletin 68 (1): 167-181
hardly be detected. The lumen of the tracheal branch-
es 1s hardly larger than that of Gliricola porcelli
(0.005 mm). So stigmata and tracheae of Echinopon
are among the smallest in the Amblycera.
. Postspiracular setal complex of abdominal tergites is
peculiar: postspiracular seta on mediad lateral sclerite
is long spiny seta, which is accompanied by only one
minute seta closely associated with the alveolus of the
postspiracular seta on segments II to VIII (Fig. 19).
12. Dorsal and ventral abdominal bristles in combination
autapomorph, in each of these characters: (1) Dor-
sal and pleural aspects equipped almost exclusively
1
©ZFMK
178 Eberhard Mey
with spines (except for tiny anterior bristles stand-
ing in 1—2 rows on tergites II to VIII). At least one
macrochaeta on each side of terminal end of abdo-
men abdomen (Fig. 19). (2) Ventrally without long
spines, bristles finer and more differentiated than dor-
sally (Figs 18-19). (3) Segments II to VHI ventrola-
terally with combs of spiny setae. Ctenidia on III in
double rows, all others in single rows (Figs 16-18).
(4) Macrochaetae ventrally only on segment II and
terminalia as follows: on II a lateral macrochaeta on
each side, which extends to segment VI; on segment
VIII two pairs of macrochaetae on each side, which in
the prepared specimen (Figs 17—18) show a striking
“relaxed position” below the end of the abdomen (in
front of the vulval opening).
13. Vulva margin with only two median small bristles
(Fig. 18). Genital chamber with striking outline,
above which a group of bristles in four rows is me-
dianly inserted into the still opaque hypogynium
(Fig. 18). Autapomorphies?
14.Hind margin of final abdominal segment almost
straight except for two slight lateral indentations and
completely sclerotized (not soft skinned as is usual),
(Figs 18-19).
15. Setal fringe around anal margin absent (Figs 18-19).
TAXONOMY
Phthiraptera Haeckel, 1896
Suborder Amblycera Kellogg, 1896
Echinoponidae Mey, fam. nov.
Type species: Echinopon monounguiculatum Mey,
gen. nov., here designated
urn. lsid:zoobank.org:act: E49D 1362-3FA2-412F-A162-08365D65CB55
Diagnosis. Very small (total length of 9 pharate larva
1.32 mm; 4 unknown, based on known amblyceran
males probably < 1 mm) amblyceran louse of meno-
ponoid habitus. “Labral organ” laterally on each side
between cranial mandibular articulation and margin of
front of head. Only one macrochaeta (DHS 27) on head,
where, between DHS 26 and border of thorax, there are
eight marginal microchaetae. (Head chaetotaxy does not
conform to known patterns in Menoponidae sensu lato).
Coxa I rounded. Leg pairs homonomous, pretarsus with
only one non-spreadable long robust claw. Thorax and
abdomen dorsally with short robust protective spine-like
setae. Ventral ctenidia on femur III with three rows, on
each side of abdominal segment II two rows, and on seg-
ments HI to VII one row. On abdominal segment VIII
two pairs of macrochaetae flank the hypogynium on each
side. Lateral-sternally on abdominal segment I one mac-
rochaeta on each side. No further macrochaetae on abdo-
men. Respiratory system with tiny spiracle and trachea
Bonn zoological Bulletin 68 (1): 167-181
on abdominal segments III-VHI, but complete without
postspiracular-seta complex.
True type host (bird or mammal) unknown.
Autapomorphies. The extraordinary single-clawed
pretarsus, the dense dorsal spiny growth on thorax and
abdomen, the presence of ventral ctenidia on abdominal
segments II—VII, and the sparse but striking growth of
ventral macrochaetae on abdominal segments II and VHI
are only some of the characters unique among the Am-
blycera and clearly autapomorphic for the family.
Echinopon Mey gen. nov.
Type species: Echinopon monounguiculatum spec. nov.
urn: |sid:zoobank.org:act: FED6BD6C-2097-4DDD-B480-D5858F239A9E
Diagnosis. By the characters of the family.
Apomorphies. As for the family.
DESCRIPTION
Measurements. Total length 1.32 mm, head length (me-
dian) 0.30 mm, front head breadth 0.33 mm, rear head
breadth 0.46 mm. Remaining intact abdomen broadest at
segment IV with 0.51 mm. The four ventral macrochae-
tae on each side of abdominal segment VHI/IX are by far
the longest body hairs (c. 0.6 mm).
Head. Typical menoponoid head form (Figs 1, 9). Tem-
poral region dorsally with honeycomb-like structure
(here only visible on skin of third instar). Front of head
with slightly protruding clypeus, with nodus on each side
(Figs 4, 6).
Before the abutment of the upper mandibular articula-
tion there is a cutaneous, clearly contrasting pear-shaped
opaque structure with 5 bristles (LO in Fig. 6). The fron-
tal “pear-stalk” is formed by a relatively large bristle,
which (in the prepared specimen) lies in the narrow space
between labrum and frontal head margin, where it prob-
ably reaches to the head median on each side (bristle tips
not visible; bristles in Fig. 6 however exposed). An addi-
tional bristle of the same thickness, but probably slight-
ly shorter, emerges below this one and similarly lies in
front of the labrum. The three other bristles on the “labral
organ” are microchaetae directed proximally or caudally
(Fig. 6). The lateral labral bristle group exists in a simi-
lar form also in the Menoponidae sensu Jato (Fig. 5) and
Boopiidae, but it is not structured in the way it is in the
organ unique to Echinopon. It probably has a tactile func-
tion connected to movement or feeding.
The labrum is almost fixed to the front head margin
(Fig. 4). For labium see Fig. 7. Labial palps with 6 or 7
terminal setae and prementum with 3 setae on each side
©ZFMK
Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 179
(Fig. 7). The cibarial sclerite is of the Colpocephalum
type (Haub 1972). Gula (without pigmentation) with two
bristles of different length on each side. Maxillary palps
only apparently with three segments (basal segment on
both sides not definitely identified) (Fig. 8). Apical max-
illary segment with strikingly rod-shaped pair of bristles.
Maxillary palps without postpalpal processes. Antennae
with four segments, on terminal segment (second fla-
gellomere = anellus) two sensilla coeloconicum. Dor-
solateral head margin with notch. Antennal fossae fully
developed (Fig. 9). One short, one middle-sized seta at
the anterior termination of the ventrolateral head margin.
Ommatidia not found, one ocularis (DHS 20) present
as microchaeta (Fig. 9). Dorsal head chaetotaxy as in
Figs 9-10.
Thorax. Transverse pronotal carina with 3 setae on each
side (larger on one side than on the other), one sensil-
lum (ps) each between the two mediad ones (Fig. 10).
Pronotum posterior-medially on each side with one pair
of bristles. Anterior-posterior row of 20 bristles (11/9, of
nearly equal length) on the dorsal prothorax complete
without gap (Fig. 10). The postnotum (Pn) with two mi-
crochaetae, hyaline (Fig. 13). Between coxae I there is a
conspicuous “bracing sclerite’, between coxae I and II
an anteriorly forked pair of sclerites (Fig. 13, interpreta-
tion unclear). The craniad bristle pair very probably be-
longs to the prosternite. A small free-moving mesonotum
with its own fine bristles (whose assignment is doubtful)
(Figs 10-11). Metanotum, except for the craniad third,
densely covered with spine-like setae (36 on each side!)
(Fig. 11).
All pairs of legs incl. tarsi and claws homonomous.
In detail, however, coxa I and femur I are slightly larg-
er than those of the other leg pairs. Bristles and sensilla
of coxa I and trochanter I as in Fig. 13. Coxae I to III
roughly rounded. Distance between coxae I and II slight-
ly greater than between II and HI. Tibiae of all pairs of
legs dorsal-distally with marginal fine spines projecting
at right-angles (on tibiae I c. 17/14, on II c. 11/10, and
on II c. 8/9); larval bristle rows are already disintegrat-
ing (Fig. 15). Only femur III sternally with triple-rowed
ctenidium (Fig. 15). This has the longest spines compared
with the only single- or double-rowed abdominal ctenid-
ia (Fig. 18). The tarsi have two segments (Figs 13-14).
All pairs of legs with a single apically slightly curved
claw of the same size (= single-clawed creeping leg, pes
reptans). The unguitractor divides on the proximally un-
equal paired on tarsus II (Figs 13-14). The structure of
the larval pretarsus was discernably complete so that in1-
tially a double claw was considered, but in the pharate
specimen this can be definitely excluded.
Abdomen. Ventrally and pleurally with finely streaked
shagreened appearance. By contrast, tergites finely and
densely spotted (Figs 16-17). Surface textured only on
Bonn zoological Bulletin 68 (1): 167-181
lateral sclerites and distal ends of tergites with caudal
false hairs protruding from the integument. Abdomen
dorsally mainly only with spines (one pair of macrochae-
tae only at the end of the abdomen), ventrally (except for
ctenidia) with finer bristles and pairs of macrochaetae on
segments II and VIII/IX (Figs 16-18).
On segment I only one very narrow lateral sclerite
(Fig. 11), on segments II to VIII on each side two se-
parate lateral sclerites (tergopleurites) (Fig. 16-17, 19).
It can be expected that the separate abdominal tergopleu-
rites II-VIII will be fused together following imaginal
molt.
Tergopleurites with a posterior row of spines: I, 13; II-
IV, 14 each; V, 13; VI, 14; VII, 12; VIII, 10; TX, 8 (incl.
2 macrochaetae) + 6 spines on rear margin of abdomen.
Anterior half of tergopleurites with fine, double-rowed
Sparse cover of microchaetae (Fig. 19). Sternites not scle-
rotized (Figs 16-18). Bristle pattern (except on ctenidia
and lateral thin spine on each side of segments HJ—VIT/
IX) hardly discernable because of ecdysis. Ctenidia on
sternites III and IV perhaps still in development? Abdo-
men ventrally with macrochaetae on only two places: on
each side sternolaterally on segment II one and on seg-
ment VIII/IX a double pair (Fig.18).
Subgenital region with a unique bristle pattern
(Fig. 18). Bell-shaped genital chamber, on which 16 fine
bristles of the same size are concentrated. Only a single
pair of microchaetae on the vulva margin, immediately
before which are 4 fine much larger bristles.
Abdominal end is broadly truncated, slightly indented
laterally on each side (Figs 17-19). Anal margin com-
pletely lacking (perhaps only applies to larval stage?).
Dorsal side of abdominal terminalia with a submargi-
nal row of 6 spines and on each side one macrochaeta,
ventromedial 8 fine bristles (only the insertion points are
visible since the bristles are broken off).
Between the lateral sclerites (Fig. 19), or laterally from
there, are the stigmata (on segments III to VIII), to which
(only partly visible) inconspicuously small tracheae lead.
Their lumen has a diameter of less than 0.006 mm. For
comparison, the diameter of some longitudinal tracheal
trunks: Gliricola porcelli (Schrank, 1781) 0.005 mm,
Heterodoxus longitarsus (Piaget, 1880) 0.040 mm, Lae-
mobothrion maximum circi (Fourcroy, 1785) 0.069 mm,
and Piagetiella titan (Piaget, 1880) 0.119 mm (v. Keéler
1967). Abdominal post-spiracular setal complex com-
plete left, in contrast to all other Amblycera. These have:
“At least one pair of post-spiracular setae with two min-
ute adjacent setae, rarely absent and replaced by single
circular sensillum” (Clay 1970: 87). Trichobothria on the
abdomen not confirmed.
Derivatio nominis. The genus name is created from the
latinized Greek echinatum (= spiny) and the suffix pon. It
is neuter. The species epithet is constructed from Greek:
mono (= one) and unguiculata (= claw), referring to the
©ZFMK
180 Eberhard Mey
single-claw condition of all three pairs of legs. The name
of the provisionally monotypic family Echinoponidae
fam. nov. 1s derived from the genus name.
Echinopon monounguiculatum Mey spec. nov.
urn: lsid:zoobank.org:act: F916D592-C184-4262-AF 56-3C80CC29B676
Figs 1, 4, 6-19
Single-clawed Bornean Spiny Amblyceran; Einkrallige
Borneo-Stachelamblyzere
Material. A female pharate third instar larva (slide Mey
5408. b) collected from a dry study skin (C 9223) of Pla-
tysmurus aterrimus in the Museum fir Tierkunde, Senck-
enberg Naturhistorische Sammlungen Dresden. Skin la-
bel reads: “1888 Trusan, Borneo, coll. Gerrard“. True
host unknown.
Holotype. (M. 5408. b) in the Zentralmagazin Naturwis-
senschaftlicher Sammlungen of the Martin-Luther-Uni-
versitat Halle-Wittenberg, Deutschland [Natural Science
Collections, Martin Luther University Halle-Wittenberg,
Germany].
Diagnosis. By the character of the genus.
Description. The description of the species is contained
in that of the genus.
CONCLUSIONS
None of the presently known bird-infesting Amblycera
possesses on all pairs of legs tarsi ending in a single claw.
As far as known, only some menoponids (Dennyus Neu-
mann, 1906 sensu lato) living on swifts (Apodiformes)
have undergone a remarkable reduction in the plesiomor-
phic double-clawed character of the pretarsus. While in
23 species of the subgenus Col/lodennyus Ledger, 1970
only the tarsi of the first pair of legs have lost their two
claws (Clayton et al. 1996, Ledger 1970), in the subge-
nus Crenodennyus Ewing, 1930 on Dennyus elbli Price &
Clayton (probably only a provisional species in Cteno-
dennyus) all three pairs of legs are clawless (Price &
Clayton 1997). In the remaining 23 known Dennyus
species in the subgenera Ctenodennyus Ewing, 1930
(2 spp.), Dennyus (19 spp.), and Takamatsuia Uchida,
1926 (2 spp.) all pretarsi have remained double-clawed
(Ledger 1971, Price et al. 2003). That this phenomenon
should manifest itself in the menoponids, living on — of
all birds — the supremely aerial swifts, is absolutely re-
markable and deserves greater attention.
Compared with the delicate pair of claws on avian Am-
blycera, the apparently powerful single claw of Echino-
pon is also a distinct morphostructural peculiarity. Look-
ing at the Booptidae, which only occur in the Australian
Bonn zoological Bulletin 68 (1): 167-181
Region (apart from Heterodoxus spiniger), it is perhaps
possible that this adaptive variant arose, probably having
its origin in a change of host (from bird to mammal) in
the very distant past. There is perhaps a similar case in
the Trichophilopteridae (Ischnocera), only found on the
lemurs of Madagascar. While all other mammal-inhabit-
ing Ischnocera (Trichodectoidea, c. 400 species) possess
single-clawed pretarsi, the monotypic Trichophilopteri-
dae have retained two unequal claws. Yet no mammal-in-
festing amblycerans show femoral and/or abdominal
ctenidia. These setal combs are only found in various
Menoponidae sensu Jato genera, especially Colpocepha-
/um complex, but nowhere in such a markedly excessive
development as in Echinopon.
With Echinopon we are actually looking at a taxon
that does not allow us to make the simple decision as to
whether it is an avian or a mammalian amblyceran.
Acknowledgments. For permission to work in the avian study
skin collection of the Museum fiir Tierkunde, Senckenberg
Naturhistorische Sammlungen Dresden, I wish to extend my
warmest thanks to the curator Dr. Martin Packert. Prof. Dr. Rolf
Beutel (Phyletisches Museum Jena) made it possible for the
student Stephan Lowe to take his excellent photomicrographic
images. Brian Hillcoat (Berlin) translated the manuscript into
English. I am most grateful for the support of all those con-
cerned.
REFERENCES
Barker SC, Whiting MF, Johnson KP, Murell A (2003) Phy-
logeny of the lice (Insecta, Phthiraptera) inferred from small
subunit rRNA. Zoologica Scripta 32: 407-414
Clay T (1962a) A key to the species of Actornithophilus Ferris
with notes and descriptions of new species. Bulletin of the
British Museum (Natural History), Entomology 11: 191—253
Clay T (1962b) A new species of Anatoecus Cummings (Mal-
lophaga) from Phoenicopterus ruber Linn. Entomologische
Berichten 22: 220-226
Clay T (1969) A key to the genera of the Menoponidae (Am-
blycera: Mallophaga: Insecta). Bulletin of the British Muse-
um (Natural History), Entomology 24: 3-26 + plates 1-6
Clay T (1970) The Amblycera (Phthiraptera: Insecta). Bulletin
of the British Museum (Natural History), Entomology 25:
75-98 + plates 1-5
Clayton DH, Price RD, Page RDM (1996) Revision of Den-
nyus (Collodennyus) lice (Phthiraptera: Menoponidae) from
swiftlets, with descriptions of new taxa and a comparison
of host-parasite relationships. Systematic Entomology 21:
179-204
Eichler W (1959) Die Larvenstadien der Mallophagen. I. Eu-
laemobothrion cubense (Kellogg & Ferris). Wissenschaftli-
che Zeitschrift der Martin-Luther-Universitat Halle-Witten-
berg, Mathematisch-Naturwissenschaftliche Reihe 8 (4/5):
543-548
Eichler W (1963) Mallophaga. Dr. Bronns Klassen und Ord-
nungen des Tierreichs, Funfter Band. Arthropoda, III. Abtei-
lung: Insecta, 7. Buch b) Phthiraptera, 1. Teil. 291 pp. Aka-
demische Verlagsgesellschaft Geest & Portig K.-G., Leipzig
©ZFMK
Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 181
Emerson KC (1982) Mallophaga. Pp. 409-415 in: Parker, S. P.
(ed) Synopsis and Classification of living Organisms. Mc-
Graw-Hill Book Company, Inc., New York
Emerson KC, Price RD (1976) Abrocomophagidae (Mallopha-
ga: Amblycera), a new family from Chile. The Florida Ento-
mologist 59: 425-428
Friedemann K, Spangenberg S, Yoshizawa K, Beutel RG
(2013) Evolution of attachment structures in the highly di-
verse Acercaria (Hexapoda). Cladistics 30: 170-201
Gustafsson, DR, Bush, SE (2017) Morphological revision of
the hyperdiverse Brueelia-complex (Insecta: Phthiraptera:
Ischnocera: Philopteridae) with new taxa, checklists and ge-
neric key. Zootaxa 4313 (1): 1-443
Haub, F. (1972) Das Cibarialsklerit der Mallophaga-Amblyc-
era und der Mallophaga-Ischnocera (Kellogg) (Insecta).
Zeitschrift fur Morphologie der Tiere 73: 249-261
Johnston KP, Yoshizawa K, Smith VS (2004) Multiple origins
of parasitism in lice. Proceedings of the Royal Society of
London, Series B, 271: 1771-1776
Johnson KP, Dietrich HC, Friedrich F, Beutel RG, Wipfler, B,
Peters RS, Allen JM, Petersen M, Donath A, Walden KKO,
Kozlov AM, Podsiadlowski L, Mayer C, Meusemann K,
Vasilikopoulos A, Waterhouse RM, Cameron SL, Weirauch
C, Swanson DR, Percy DM, Hardy NB, Terry I, Liu S, Zhou
X, Misof B, Robertson HM, Yoshizawa K (2018) Phyloge-
nomics and the evolution of hemipteroid insects. Proceed-
ings of the National Academy of Sciences 115: 12775-12780
Kéler Sv (1952) Uber den feineren Bau der Tarsen bei Pseu-
domenopon rowanae Kéler. Beitrage zur Entomologie 2:
573-582
Kéler Sv (1955) Einige Bemerkungen tber den Bau der Tars-
en von Gyropus und Gliricola. Beitrage zur Entomologie 5:
293-308
Kéler, Sv (1957) Uber die Deszendenz und die Differenzierung
der Mallophagen. Zeitschrift fiir Parasitenkunde 18: 55-160
Kéler, Sv (1969) 17. Ordnung Mallophaga (Federlinge und
Haarlinge). Handbuch der Zoologie I'V., 2. Halfte, 2. Auflage,
2. Teil, 17: 72 pp. Walter de Gruyter & Co. Berlin
Lakshminararayana KV (1976): Nomenclatural changes in
Phthiraptera — some suggestions. Angewandte Parasitologie
17: 160-167
Ledger JA (1970) A preliminary review of Dennyus (Mallopha-
ga: Menoponidae) parasitic on swiftlets. Journal of the Ento-
mological Society of South Africa 33: 239-260
Ledger JA (1971) A review of Dennyus (Phthiraptera: Meno-
ponidae) parasitic on the avian genera Apus and Crypsiurus.
Journal of the Entomological Society of South Africa 34:
37-56
Lyal CHC (1987) Phylogeny and classification of the Psocodea,
with particular reference to the lice (Psocodea: Phthiraptera).
Systematic Entomology 10: 145-165
Marshall IK (2003) A morphological phylogeny for four fami-
lies of amblyceran lice (Phthiraptera: Amblycera: Menoponi-
dae, Boopiidae, Laemobothriidae, Ricinidae). Zoological
Journal of the Linnean Society 138: 39-82
Mayer C (1954) Vergleichende Untersuchungen am Skel-
ett-Muskelsystem des Thorax der Mallophagen unter Bertick-
Bonn zoological Bulletin 68 (1): 167-181
sichtigung des Nervensystems. Zoologische Jahrbticher,
Abteilung ftir Anatomie und Ontogenie der Tiere 74: 77-131
Mey E (2003) Tierlause (Phthiraptera). Pp. 308-330, 880-881
in: Kaestner A, Gruner HE (Hrsg.), Lehrbuch der Speziellen
Zoologie. Band I: Wirbellose Tiere, 5. Teil: Insecta (Hrsg.
HH Datue). 2. Auflage. Spektrum Akademischer Verlag,
Heidelberg/Berlin
Mey E (2017) [2016] Neue Gattungen und Arten aus dem
Brueelia-Komplex (Insecta, Phthiraptera, Ischnocera,
Philopteridae s. 1.). Rudolstadter naturhistorische Schriften
22: 85-215
Mey E, Eichler W, Kaddou IK (2004) Jadwigiella enigmati-
ca nov. gen. et spec. (Insecta, Phthiraptera, Amblycera,
Menoponidae s. |.) von der Guineataube Columba guin-
ea (Aves, Columbiformes). Rudolstadter naturhistorische
Schriften 12: 133-140
Modrzejewska M, Ztotorzycka J (1987) Studies on morphology
of nymphs of selected Amblycera and Ischnocera (Mallopha-
ga). Polskie Pismo Entomologiczne 57: 657-672
Morris PA (2012): Edward Gerrard & Sons A Taxidermy Mem-
oir. Lavenham Press, Lavenham, Suffolk.
Murrell A, Barker SC (2005) Multiple origins of parasitism in
lice: phylogenetic analysis of SSU rDNA indicates that the
Phthiraptera and Psocoptera are not monophyletic. Parasito-
logical Research 97: 274—280
Neuffer G (1954) Die Mallophagenhaut und ihre Differen-
zierungen. Zoologische Jahrbticher, Abteilung fiir Anatomie
und Ontogenie der Tiere 73 (4): 425-616
Price RD (1987): Order Mallophaga. Pp. 215-223 in Stehr,
FW (ed.): Immature Insects. Kendall/Hunt Pub. Company,
Dubuque, Iowa.
Price RD, Clayton DH (1997) Two new species of Denny-
us (Ctenodennyus) lice (Phthiraptera: Menoponidae) from
Swiftlets (Apodiformes: Apodidae). Journal of the Kansas
Entomological Society 70: 4-10
Price RD, Hellenthal RA, Palma RL (2003) World checklist of
chewing lice with host associations and keys to families and
genera. Pp. 1-448 in: Price RD, Hellenthal RA, Palma RL,
Johnson KP, Clayton DH (eds.): The chewing lice: world
checklist and biological overview. Illinois Natural History
Survey Special Publication 24, X + 501 pp.
Price RD, Timm RM (2000) Review of the chewing louse genus
Abrocomophaga (Phthiraptera: Amblycera), with description
of two new species. Proceedings of the Biological Society of
Washington 113 (1): 210-217
Ruggiero MA, Gordon DP, Orrell TM, Bailly N, Bourgoin T,
Brusca RC, Cavalier-Smith T, Guiry MD, Kirk PM (2015)
Correction: A higher level classification of all living organ-
isms. PLoS ONE 10(6): e0130114. https://doi.org/10.1371/
journal.pone.0119248.
Uchida S (1926) Studies on amblycerous Mallophaga of Japan.
Journal of the College of Agriculture Tokyo 9: 1-56
Yoshizawa K, Johnston KP (2006) Morphology of male genita-
lia in lice and their relatives and phylogenetic implications.
Systematic Entomology 31: 350-361
©ZFMK
BHL
i
Blank Page Digitally Inserted