OAS CHUNG S
museum
KOENIG
Bonn Volume 70
Issue 1
zoological 2021
Bulletin
formerly: Bonner zoologische Beitrage
An open access journal of organismal zoology, published by
Zoologisches Forschungsmuseum Alexander Koenig — Leibniz-Institut fiir Biodiversitat der Tiere, Bonn
BHL
i
Blank Page Digitally Inserted
FORSCHUNGS
Bonn zoological Bulletin 70 (1): 1-14
2021 - Ghiraldi L. et al.
https://do1.org/10.20363/BZB-2021.70.1.001
Research article
urn:|sid:zoobank.org:pub:67213318-C4D5-4D11-AOF4-AEF7B416CA39
Revised catalogue of monotremes and marsupials
in the historic mammal collection housed at
Museo Regionale di Scienze Naturali of Torino, Italy
Luca Ghiraldi'*, Ana Paula Carmignotto’, Vera Tosetto*®, Sandy Ingleby‘ & Mark D.B. Eldridge*
' Museo Regionale di Scienze Naturali di Torino, Via Giolitti 36, I-10123 Torino, Italy
?Laboratorio de Diversidade Animal, Departemento de Biologia Universidade Federal de SGo Carlos (UF SCar), Campus Soro-
caba, Sorocaba, Brazil
3 Universita degli Studi di Torino, Dipartimento di Scienze della Vita e Biologia dei Sistemi, Via Accademia Albertina 13, I-10123
Torino, Italy
*° Australian Museum Research Institute, Australian Museum, I William Street, Sydney, NSW 2010, Australia
“Corresponding author: Email: [email protected]
'urn:Isid:zoobank.org:author:3556E7BD-C957-4E5E-8CFA-9DA069E34487
2urn:Isid:zoobank.org:author: BE376A 1 8-C4E4-4CE8-9F47-1796A 8E36A4C
3urn:lsid:zoobank.org:author:285 17B1B-EBB2-4470-8A52-EF3B43A43C91
*urn:Isid:zoobank.org:author: FED6DBA2-B36A-4855-B16B-7276EA33FAE6
>urn:Isid:zoobank.org:author:C42A D8C3-67FB-436E-B191-5BB236287ADF
Abstract. The historic collection of the Museo di Zoologia and of the Museo di Anatomia Comparata of Torino University
(Italy), now hosted at Museo Regionale di Scienze Naturali of Torino, contains almost 3000 mammal specimens, in addi-
tion to 200 almost complete skeletons and an undefined number of skeletal units. The present work, which is part of a larg-
er project whose aim is to make a complete revision of the specimens still present in the historic collection, was focused
on the 135 specimens of monotremes and marsupials, mainly represented by mounted skins, flat skins, and osteological
material composed of 12 skeletons and 32 skulls. The study allowed in addition to the implementation of a new revised
catalogue, the update of the taxonomic nomenclature and a new determination of 32 specimens and 18 skeletal units.
Overall, the monotremes and marsupials in the collection represent 58 species, with some of high scientific value; this is
the case of some extinct species such as: Thylacine (Thylacinus cynocephalus Harris, 1808), Eastern Hare-Wallaby (La-
gorchestes leporides (Gould, 1841)) and the Crescent Nailtail Wallaby (Onycogalea Iunata (Gould, 1841)). Unfortunately,
it was not possible to reach the species level with certainty for 28 specimens due to their bad state of preservation, the loss
of the original labels, the lack of detailed collecting data or because of the juvenile or immature stage of development.
ISSN 2190-7307
http://www.zoologicalbulletin.de
Key words. Ameridelphia, Australidelphia, Monotremata, Natural History Collections, Biodiversity.
INTRODUCTION
Natural history museums and their biological collections
play a fundamental role in disseminating knowledge and
understanding of the earth’s biodiversity (Grande 2017;
Kemp 2017). The wealth of specimens preserved in these
collections have always had an important educational
role, providing data concerning the biology, ecology and
conservation of species, but also serve as major sources
of biological data for scientists. As such they represent
records of inestimable value, providing multidimension-
al documentation in geographic and biodiversity space,
and position in time (Winker 2004). They are invaluable
resources to scientific studies, permitting comparative
analyses in terms of phenotypic change, abundance and/
or distribution. It is therefore of the utmost importance to
publish inventories with all related information in order
Received: 18.05.2020
Accepted: 16.11.2020
to make the scientific community aware of the existence
of such biological heritage.
The present study, which is part of a larger project,
whose final purpose 1s to make a revised catalogue of all
the specimens preserved in the MRSN (Museo Regio-
nale di Scienze Naturali) of Torino (NW Italy), includ-
ing those coming from the historic mammal collections
of the MZUT (Museo di Zoologia dell’ Universita di To-
rino) and the MACUT (Museo di Anatomia Comparata
dell’ Universita di Torino). This was necessary for three
important reasons:
1) Reduced interest in the museum specimens has
meant zoological studies involving taxonomic analysis of
the voucher materials preserved in the collections are no
longer undertaken.
2) Unlike other groups, the MZUT and MACUT mam-
mal collections lacked specialized curatorial staff and
Corresponding editor: E. Barmann
Published: 28.01.2021
2 Luca Ghiraldi et al.
consequently part of the collection has not yet been stud-
ied and the taxonomic status of such material is, as al-
ready pointed out by Tadini (1937), in many cases still
indeterminated.
3) The numerous relocations to which the collection
has been subjected over time, and the problems connect-
ed with its preservation, have contributed to the loss and
the deterioration of many specimens (Tortonese 1957)
and to the loss of original data from several specimens,
which currently have incomplete or no associated infor-
mation regarding their provenance.
The present work, which aims to overcome these is-
sues is the third contribution after those published by
Passeirin d’Entreves & Gavetti (2014) on the cetaceans
and by Calvini et al. (2016) on the primates.
The monotremes and marsupials in the mammal his-
toric collection
The MZUT mammal collection includes about 3,000
specimens, most of which are mounts; several hundred
are preserved as flat skins, whereas most of the small
mammals, in particular bats and small rodents, are kept in
ethanol. In addition, in the MACUT osteological collec-
tion there are approximately 200 almost complete skele-
tons, to which an undefined number of skulls and individ-
ual skeletal units from a large number of heterogeneous
species can be added. Among them, the specimens of
monotremes and marsupials represent only a minor part,
but they are also the ones that have been never investi-
gated with the exception of a single report in the work of
Thomas (1898). These specimens arrived in the muse-
um mainly between 1819 and 1899 and are the results of
the contributions of several scientific expeditions. This
includes the material collected and purchased in Brazil
by Antonio Caffer, assistant at the zoology section of the
Royal zoological museum of Torino, engaged as member
of the scientific staff during the voyage of the “Fregata
Regina” (1839-1840); by Enrico Giglioli from the mu-
seums of Melbourne and Sydney (Australia) during the
three year (1865-1868) voyage around the Globe of the
Italian warship “Pirocorvetta Magenta” (Hyller Giglioli
1876); by Enrico Festa during his four year expedition
(1895-1898) in Panama and Ecuador; and by Alfredo
Borelli who travelled in Argentina, Paraguay, Brazil and
Bolivia between 1893-1896.
The number of specimens was also enhanced with the
contribution of the Royal Zoological Gardens of Torino
and Stupinigi (Corti 1955; Maschetti et al. 1988), and
due to acquisitions from other collectors not directly re-
lated to the Torino Museum, as well as from different Eu-
ropean animal dealers. In many cases during the prepara-
tion of the skins, the skeletons, or part of them, were also
preserved in order to increase the osteological collection
which was mostly used for scientific purposes.
Bonn zoological Bulletin 70 (1): 1-14
MATERIAL AND METHODS
The first phase of the work was to find as much infor-
mation as possible associated with each specimen. Three
major archival sources were used: two old manuscript
catalogues of the mammals (MZUT) and osteological
(MACUT) collections and a degree thesis realized by Ta-
dini in 1937, which reports all the specimens preserved
at that time.
The second step was to carry out a complete revision
and taxonomic update for all the specimens of mono-
tremes and marsupials still present in the collections.
As there continues to be some disagreement about the
classification of marsupials, it was decided for the Aus-
tralasian species to follow the nomenclature of the Hand-
book of the Mammals of the World (Wilson & Mitter-
meier 2015); whereas for the South American opossum
species we followed the nomenclature, taxonomy and
geographic distribution used in the general works of
Gardner (2008), Voss & Jansa (2009), and Astuia (2015),
as well as more recent work for specific genera such as
Giarla et al. (2010) for Thylamys Gray, 1843; Rossi et al.
(2010) and Voss et al. (2014) for Marmosa Gray, 1821;
Voss et al. (2018) for Philander Brisson, 1762; and Voss
et al. (2019) for Metachirus Burmeister, 1854. The popu-
lar names and threat categories follow IUCN (2020).-For
species recently described or revalidated, no IUCN cate-
gory was provided, since these taxa were not yet evaluat-
ed under IUCN criteria.
Along with this second step, skins and skulls were
photographed in high resolution in order to be examined,
whereas for the Ameridelphia osteological materials the
skulls measurement (Fig. 1, Table 1) have also been tak-
en to aid in the taxonomic identification following the
methodology of Cerqueira & Lemos (2000). In addition,
the skulls were also classified in age classes based on
the criteria of tooth eruption of Rossi et al. (2010), being
treated as juveniles (age classes 1 to 4) when the per-
manent dentition are not fully erupted, as subadults (age
class 5) when the third non-deciduous premolars are not
fully erupted, and as adults (age class 6) when all perma-
nent tooth are fully erupted and in place.
The third step was the creation of a catalogue, which
largely follows the structure proposed by Calvini et al.
(2016) where all the specimens have a unique identifica-
tion code that replaces all the previous ones (which are
reported, if present, in parentheses). It begins with the ac-
ronym MZUT followed by the letter T (theriology) and a
progressive number. If for a given specimen the skeleton,
or part of it, can be recognized, it will have the same code
as the specimen. Separated by semicolons are the method
of preservation: mount, unmount (previously mounted),
skin, ethanol; sex and age (if available); origin, date of
the arrival in museum, the name of the person who be-
stowed the specimens in museum and lastly (if neces-
sary) some additional notes reported in the manuscript
©ZFMK
Revised catalogue of monotremes and marsupials housed at MRSN, Italy
Fig. 1. Seven cranio-dental measurements taken on Didelphimorphia marsupial skulls based on the work of Cerqueira & Lemos
(2000).
Table 1. Cranio-dental measurements (mm) of sub-adult (sub) and adult (ad) specimens of Didelphimorphia marsupials housed in
the historic mammal collection of the Torino University.
Species MZUT Age Sex GLS ZB PL MAX C CAN MAD
Caluromys derbianus T417 ad female 594 33.2 32.8 213 86 114 447
Caluromys derbianus T422 ad female 574 32.7 33.7 214 7.1 11.9 43.0
Caluromys derbianus T424 ad female 56.2 32.5 33.0 214 60 11.7 41.7
Chironectes minimus T428 = ad _ LO7 OZ 2a O21 416 169 21.8 865
Didelphis albiventris T433 sub - 178 396, 50,0 SAF se 129 8623
Didelphis aurita T435 ad - 90.0 45.3 56.4 37.8 11.8 161 69.4
Didelphis marsupialis T439 ad female 942 51.8 67.1 445 10.7 183 866
Didelphis marsupialis T440 = ad — 1205 -60°5 “67.9 A3.6 T%9 22.0° ~929
Didelphis pernigra T442 sub - 84.5 40.3 53.3 340 88 140 68.0
Lutreolina crassicaudata 1446 ad - 76.0 42.7 41.4 294 88 145 60.0
Philander melanurus T449 ad male 86.7 34.6 40.1 28 tid) WB 534)
Didelphis sp. T459 ad - 107.5 50.7 642 41.8 179 220 84.0
Didelphis sp. T460 = ad - 101.1 50.0 62.1 400 99 180 79.9
Didelphis sp. T461 ad male 1044 —- 63.0 404 15.0 15.0 840
Didelphis sp. T462 = ad - 96.8 479 599 414 11.7 160 783
Didelphis sp. T463 sub - 9233 4G. 53:2" 36:2 TO “1Si/e FAO
Didelphis sp. T464 ad male 1025 553 622 £41.11 128 179 844
Bonn zoological Bulletin 70 (1): 1-14
©ZFMK
4 Luca Ghiraldi et al.
catalogues or other explicative notes. If the specimens
have no reference the acronym w.d. (without data) was
used. On the same row where there is the name of the
species, the IUCN category has been reported.
Institutional abbreviations
International Union for Conservation of
Nature
MZUT = Museo di Zoologia dell’ Universita di
Torino, Italy
Museo di Anatomia Comparata
dell’ Universita di Torino, Italy
IUCN
MACUT
Abbreviations of threat categories (IUCN 2020)
LC = least concern
NT = near threatened
VU = vulnerable
EN = endangered
CR = critically endangered
EX = extinct
Abbreviations for morphological terms used in the
text and the figures
CAN = distance between canines
C = canine heigth
GLS = greatest length of the skull
MAD = mandibular length
MAX = maximun Length of tooth row
PL = palatal length
ZB = zygomatic breadth
RESULTS AND DISCUSSION
Overall, the historic catalogue of mammals reported
120 marsupial and eight monotreme specimens, whereas
Tadini (1937) recorded 126 marsupials, without includ-
ing 14 specimens collected by Enrico Festa, and eight
monotreme specimens. In contrast, our inventory re-
corded a total of 135 specimens. These comprise eight
monotremes and 127 specimens of marsupials, of which
37 (15 mounted, 21 flat skins, one in ethanol) are from
South America, one from North America (mounted),
one from Timor (mounted) and two from Celebes (now
known as Sulawesi) (mounted), while the remaining 87
(78 mounted, four skins, five in ethanol) are from Austra-
lia and nearby islands.
As regards the osteological materials the old catalogue
reported 15 complete skeletons (one without skull) and
36 skulls. Our inventory documents 12 (two monotems;
two Ameridelphia) complete or partial skeletons and 32
(28 Ameridelphia) skulls, almost all undetermined.
Bonn zoological Bulletin 70 (1): 1-14
This work has resulted in an update of the taxonomic
nomenclature and a new determination of 32 specimens
and 18 skeletal units. Overall, the monotremes and mar-
supials in the collection represent 58 taxa, with some of
them of high scientific value because they are now ex-
tinct, such as: Thylacine Thylacinus cynocephalus Har-
ris, 1808 (Fig. 3), Crescent Nailtail Wallaby Onychoga-
lea lunata (Gould, 1841) (Fig. 6), Eastern Hare-wallaby
Lagorchestes leporides Gould, 1841 (Fig. 5) or very rare
such as the Western Long-Beaked Echidna Zaglossus
bruijnii (Peters & Doria, 1876) (Fig. 2) and the Woylie
Bettongia penicillata Gray, 1837 (Fig. 4).
Unfortunately, it was not possible to identify 28 speci-
mens to species level with certainty because of the fading
of their original colours or their bad state of conservation.
Moreover, some specimens are young or not completely
mature, and a definite determination could not be made
without observing the complete dentition and well-devel-
oped cranial structures or the use of biomolecular tech-
niques. Furthermore, some skulls also lack the prove-
nance, which is very important for some morphologically
similar species under genera such as Didelphis.
COMMENTED CATALOGUE
Order MONOTREMATA Bonaparte, 1837
Family TACHYGLOSSIDAE Gill, 1872
Genus Zaglossus Gill, 1877
WESTERN LONG-BEAKED ECHIDNA Zaglossus
bruijnii (Peters & Doria, 1876) (CR)
MZUT T405 (1010); mount; unsexed ad.; Torres Strait,
Australia; 1866; Voyage of the Pirocorvetta “Magen-
ta”, donation by Mr. Teijsman.
Remarks: The specimen was obtained during the cir-
cumnavigation voyage by the Italian Warship Magenta.
On 2 May 1866, Enrico H. Giglioli and Filippo Defilippi
visited the Botanical Garden of Bogor (Java, Indonesia),
where its Director Johannes Elias Teijsmann (1808-
1882) gave them some specimens of “rare animals” (Gi-
glioli 1876).
Genus Tachyglossus Illiger, 1811
SHORT-BEAKED ECHIDNA Tachyglossus aculeatus
(Shaw, 1792) (LC)
MZUT T406 (897); mount; unsexed ad.; Tasmania, Aus-
tralia; 1/1861; exchange with Ercole Turati from Mi-
lano;
MZUT T407 (540); mount; unsexed; Tasmania, Austra-
lia;
MZUT T408 (MACUT 326); skeleton; w.d.
Remarks. Count Ercole Turati (1829-1881) was a
banker and a passionate naturalist based in Milano (lIt-
aly). He purchased and exchanged many natural history
©ZFMK
Revised catalogue of monotremes and marsupials housed at MRSN, Italy 5
Fig. 2. MZUT T405 specimen of Western Long-Beaked Echidna Zaglossus bruijnii.
specimens and built up a very large private collection, in
particular of birds (more than 20,000 specimens) which,
after his death, were donated to the Natural History Mu-
seum of Milano. Unfortunately, after the bombing in
1943, the collection was almost completely destroyed.
Family ORNITHORHYNCHIDAE Gray, 1825
Genus Ornithorhynchus Blumenbach, 1800
PLATYPUS Ornithorhynchus anatinus (Shaw, 1799)
(NT)
MZUT T409 (541); mount; male ad.; river near Port
Jackson, New South Wales, Australia; 1819; donation
by Mr. Mackay;
MZUT T410 (1335); mount; unsexed ad.; no locality;
1/1892; donation by Mr. Giglio Giuseppe;
MZUT T411 (1562); mount; male ad.; no locality; 1899;
donation by Carlo Bajnotti;
MZUT T412 (1858); mount; unsexed; no locality; 1905;
donation by Mr. Chiotti;
MZUT T413 (2756); mount; unsexed ad.; Melbourne,
Victoria, Australia; 1927; donation by Count Teofilo
Rossi of Montelera;
MZUT T414 (MACUT 325); skeleton; w.d.
Remarks: James Townsend Mackay was the curator of
the botanical garden of the Trinity College (Dublin, Ire-
land) and associate of Linnean Society of London.
The MZUT catalogue reports for the specimen MZUT
T409 the following note “the specimen through its spur
Bonn zoological Bulletin 70 (1): 1-14
caused the loss of a soldier’s arm who wanted to take
him alive”.
Carlo Bajnotti (1868-1942) was a passionate traveller
and naturalist who worked as taxidermist for the Royal
Zoological Museum of Torino (Simondetti 1943).
Mr. Chiotti was ship’s purser of the warship “Liguria”,
captained by His Majesty Luigi Amedeo di Savoia, Duke
of the Abruzzi during his journey around the globe in the
years 1902-1904.
Teofilo Rossi di Montalera (1865-1927) was an entre-
preneur, a politician of the Kingdom of Italy and office of
Mayor of the City of Torino up to 1917.
Order DIDELPHIMORPHIA Gill, 1872
Family DIDELPHIDAE Gray, 1821
Genus Caluromys J.A. Allen, 1900
CENTRAL AMERICAN WOOLLY OPOSSUM Cal-
uromys derbianus (Waterhouse, 1841) (LC)
MZUT T415; skin; unsexed ad.; Vinces, Ecuador,
[X/1897; Festa expedition; (voucher number 89);
MZUT T415 (MACUT 4683); partial skull;
MZUT T416; skin; female ad.; Vinces, Ecuador, [X/1897;
Festa expedition (voucher number 123);
MZUT T416 (MACUT 4736); partial skull;
MZUT 1417; skin; female ad.; Vinces, Ecuador, [X/1897;
Festa expedition (voucher number 125);
MZUT T417 (MACUT 4680); skull:
©ZFMK
6 Luca Ghiraldi et al.
MZUT 1418; skin; unsexed juv.; Vinces, Ecuador,
[X/1897 Festa expedition (voucher number 1251);
MZUT 1T419; skin; unsexed juv.; Vinces, Ecuador,
IX/1897,; Festa expedition (voucher number 1283);
MZUT 1T420; skin; unsexed juv.; Vinces, Ecuador,
IX/1897 Festa expedition (voucher number 1284);
MZUT 1T421; skin; unsexed juv.; Vinces, Ecuador,
[X/1897 Festa expedition (voucher number 1292);
MZUT T4272; skin; female ad.; Vinces, Ecuador, LX/1897;
Festa expedition (voucher number 90):
MZUT T422 (MACUT 4677); skull;
MZUT T423; skin; female ad.; Vinces, Ecuador, LX/1897
Festa expedition (voucher number 121);
MZUT T423 (MACUT 4675); skull;
MZUT 424; skin; female ad.; Vinces, Ecuador, LX/1897;
Festa expedition (voucher number 122);
MZUT T424 (MACUT 4681); skull.
Remarks: All the skins and skulls were undetermined,
and only the skulls were reported in the MACUT cata-
logue.
Genus Marmosa Gray, 1821
ISTHMIAN MOUSE OPOSSUM Marmosa isthmica
Goldman, 1912 (Not Evaluated)
MZUT 7T425, skin; unsexed ad.; Vinces, Ecuador,
IX/1897; Festa expedition (voucher number 114).
Remarks: The specimen was undetermined and not re-
ported in the MZUT catalogue.
LINNAEUS’S MOUSE OPOSSUM Marmosa murina
(Linnaeus, 1758) (LC)
MZUT T426 (693); mount; male ad.; Suriname; 1845;
purchased by G.A. Frank.
Remarks: Gustav Adolph Frank was a natural history
dealer based in Amsterdam.
Genus Metachirus Burmeister, 1854
BROWN FOUR-EYED OPOSSUM WMetachirus myo-
suros (Temminck, 1824) (Not Evaluated)
MZUT T427 (347); mount; unsexed ad.; Rio de Janeiro
(Brazil); 1839; Antonio Caffer expedition.
Genus Chironectes I\liger, 1811
WATER OPOSSUM Chironectes minimus (Zimmer-
mann, 1780) (LC)
MZUT T428 (MACUT 7718); skull; unsexed ad.; Brazil:
24/TX/1914; donation by Alfonso Bovero.
Remarks. Professor Alfonso Bovero (1872-1937) was
an Italian medical doctor. In 1912 he moved to Brazil
where he got the chair of anatomy and histology at the
Faculty of Medicine and Surgery of Sao Paulo Universi-
ty. He was also the founder of the Anatomy museum of
the Sao Paulo University.
Bonn zoological Bulletin 70 (1): 1-14
Genus Didelphis Linnaeus, 1758
WHITE-EARED OPOSSUM) Didelphis albiventris
Lund, 1840 (LC)
MZUT T429 (1386); mount; unsexed ad.; Luque, Para-
guay, VIII/1893; Borelli expedition;
MZUT T429 (MACUT 3731); partial skull;
MZUT T430 (1387); mount; unsexed ad.; Luque, Para-
guay, 1893; Borelli expedition;
MZUT T430 (MACUT 3508); partial skull;
MZUT T431 (1899); ethanol; unsexed juv.; Corrientes,
Argentina; 1893; Borelli expedition;
MZUT 7T432 (2769); mount; unsexed juv.; Argentina,
1928; donation by Principe di Piemonte;
MZUT T433 (MACUT 10035); skull; unsexed subad.;
Brazil; 05/V/1921; donation by Alfonso Bovero.
Remarks: The specimens MZUT T431 and MZUT
T433 were undetermined, MZUT T433 1s not reported in
the MACUT catalogue.
BRAZILIAN COMMON OPOSSUM Didelphis aurita
Wied-Neuwied, 1826 (LC)
MZUT 1T434 (338); mount; unsexed ad.; near Rio de Ja-
neiro (Brazil); 1839; Antonio Caffer expedition;
MZUT T434 (MACUT 338); skeleton;
MZUT T435 (MACUT 7736); skull; unsexed ad.; Bra-
sil; 15/V/1919; donation by Alfonso Bovero.
Remarks: In the MZUT catalogue the specimen MZUT
T434 was reported as Didelphis albiventris, but since it
presents dark face and ears, 1t was redetermined as D. au-
rita. The MZUT T435 was undetermined. See also the
skull measurements in Table 1.
BLACK-EARED OPOSSUM Didelphis marsupialis
Linnaeus, 1758 (LC)
MZUT 1T436 (694); mount; unsexed juv.; Suriname;
1845; purchased by G.A. Frank:
MZUT 1437; skin; unsexed ad.; Vinces, Ecuador;
TX/1897; Festa expedition (voucher number 93);
MZUT T1438; skin; female ad.; Vinces, Ecuador;
IX/1897; Festa expedition (voucher number 109);
MZUT T438(MACUT 4666); skull;
MZUT T439 (1425); mount; unsexed ad.; Punta de Sa-
bana, Darien, Panama; 1895; Festa expedition;
MZUT T439 (MACUT 3777); skull;
MZUT T440 (MACUT 3628); skull; female ad.; Darien
(Ecuador); 1896 Festa expedition;
MZUT T441 (MACUT 7733); skull; unsexed ad.; Brazil:
no date; donation by Alfonso Bovero.
Remarks: The specimen MZUT T436 was identified
as Marmosa murina, but tt was redetermined as Didel-
phis marsupialis due to its dorsal dark pelage, with long
white guard hairs, extending well beyond the base of the
tail, which is large and bicolored in the distal portion.
The dark face and black ears also points to this species.
The specimens MZUT T437 and 438 was undetermined
©ZFMK
Revised catalogue of monotremes and marsupials housed at MRSN, Italy 7
and not reported in the MZUT catalogue. The specimen
MZUT T439 was undetermined.
The specimen MZUT T440 was identified as Chi-
ronectes minimus, but the morphological qualitative and
quantitative characters of the skull lead to redetermina-
tion as D. marsupialis (see Cerqueira & Lemos 2000;
Voss & Jansa 2009). See also the skull measurements in
Table 1. The skull MZUT T440 was undetermined.
ANDEAN WHITE-EARED OPOSSUM Didelphis
pernigra J.A. Allen, 1900 (LC)
MZUT 1442; skin; unsexed ad.; Ibarra, Ecuador,
XII/1896; Festa expedition (voucher number 67);
MZUT T442 (MACUT 4678); partial skull;
MZUT T443; skin; unsexed subad.; Quito, Ecuador,
XII/1896; Festa expedition (voucher number 69);
MZUT T443 (MACUT 4667); skull.
Remarks: All the skins were undetermined and not re-
ported in the MZUT catalogue. The skulls MZUT T442
and 443 were undetermined.
VIRGINIA OPOSSUM Didelphis virginiana Kerr,
1792 (LC)
MZUT T444 (331); mount; unsexed ad.; North America;
1823; donation by Gaspeare Deabbate:
MZUT T445 (MACUT 321); skeleton; w.d.;
MZUT T446 (MACUT 337); skull; juv.; w.d.
Remarks: Gaspeare Deabbate was the General Consul
of the Sardinian Kingdom in Philadelphia (Pennsylvania,
USA).
Genus Lutreolina Thomas, 1910
LITTLE WATER OPOSSUM Lutreolina crassicauda-
ta (Desmarest, 1804) (LC)
MZUT T447 (MACUT 4539): skull; unsexed ad.; w.d.;
MZUT T448 (MACUT 3472); skull; unsexed ad.; no lo-
cality; 1896; collected by Crivelli.
Remarks: MZUT T447 was undetermined; MZUT
T448 was labelled as Didelphis sp., but the morpholog-
ical qualitative and quantitative characters of the skull
lead to redetermination as Lutreolina crassicaudata (see
Voss & Jansa 2009). See also the skull measurements in
Table 1.
We didn’t find any information about Mr. Crivelli.
Genus Philander Brisson, 1762
BLACK FOUR-EYED OPOSSUM = Philander
melanurus (Thomas, 1899) (Not Evaluated)
MZUT 1T449; skin; unsexed ad.; Vinces, Ecuador;
IX/1897; Festa expedition (voucher number 110);
MZUT T450; skin; male ad.; Vinces, Ecuador; [X/1897;
Festa expedition (voucher number 116);
MZUT T450 (MACUT 4676); skull.
Remarks: The specimens MZUT T449 and 450 were
undetermined and are not reported in the MZUT cata-
logue. The skull MZUT T450 was undetermined.
Bonn zoological Bulletin 70 (1): 1-14
GRAY FOUR-EYED OPOSSUM Philander opossum
(Linnaeus, 1758) (LC)
MZUT T451 (341); mount; female ad.; Cayenne (French
Guyana); 10/.V/1899; donation by Mr. Bacle;
MZUT T452 (342); mount; male ad.; Cayenne (French
Guyana); 10/[V/1899; donation by Mr. Bacle;
Remarks: We didn’t find any information about Mr.
Bacle.
SOUTHEASTERN FOUR-EYED OPOSSUM Phi-
lander quica (Temminck, 1824) (LC)
MZUT T453 (335); mount; unsexed ad.; Rio de Janeiro,
Brazil; 1839; Caffer expedition;
MZUT T454 (336); mount; unsexed ad.; Rio de Janeiro,
Brazil; 1839; Caffer expedition.
Genus Thylamys Gray, 1843
ELEGANT FAT-TAILED MOUSE OPOSSUM Thyi-
amys elegans (Waterhouse, 1839) (LC)
MZUT 1T455 (735); skin; unsexed ad.; Valparaiso, Chile:
1845; purchased by G.A. Frank:
MZUT T456 (840); skin; unsexed ad.; Chile; 1849; Pi-
collet d’ Hermillon;
MZUT 1T457 (2935); skin; male ad.; Quilpué, Chile; no
date; donation by Enrico Festa (the specimen was orig-
inally part of Francisco Videla collection).
Remarks: Auguste Picollet d’Hermillon was the Gen-
eral Consul of Kingdom of Sardinia in Valparaiso, Chile.
UNDETERMINED SPECIMENS
Didelphis sp.
MZUT T458 (2643); partial skin; unsexed; Villa Corti-
na?: I/1891;
MZUT T459 (MACUT 7734); skull; unsexed ad.; Brazil;
no date; donation by Alfonso Bovero;
MZUT T460 (MACUT 7735); skull; unsexed ad.; Brazil;
no date; donation by Alfonso Bovero;
MZUT T461 (MACUT 10036); skull; male ad.; Brazil;
25/X/1921; donation by Alfonso Bovero;
MZUT T462 (MACUT 10037); skull; unsexed ad.; Bra-
zil; 1921; donation by Alfonso Bovero;
MZUT T463 (MACUT 10038); skull; unsexed subad.;
Brazil; 1V/1918; donation by Alfonso Bovero;
MZUT T464 (MACUT 10039); skull; male ad.; Brazil:
28/TX/1921; collected by Dr. Y. Karimi;
MZUT T465 (MACUT 10040); skull; unsexed juv.; Bra-
zil; 04/X1/1924.
Remarks: The specimen MZUT T 458 is from the ge-
nus Didelphis, and since it presents dark face and black
ears, it could be identified as D. aurita, if it proves to
come from Atlantic Forest of Brazil or D. marsupialis if
it came from Amazonian Forests.
The specimens from MZUT T459 to MZUT T465
present skulls from the genus Didelphis and by their
measurements (see Table 1) they are probably specimens
©ZFMK
8 Luca Ghiraldi et al.
from black-eared opossums, D. aurita or D. marsupialis
(see Cerqueira & Lemos 2000).
Didelphis cf. imperfecta
MZUT T466 (332); mount; female ad.; Cayenne (French
Guyana); 1810; purchased in Paris by Franco Andrea
Bonelli;
MZUT T467 (333); mount; unsexed juv.; Cayenne
(French Guyana); 1822; from Mr. Banon.
Remarks: The specimens MZUT T466 and 467, previ-
ously cited as D. marsupialis, could not be identified at
species level due to the faded coloration of the skins. But
since they present whiter faces, they could be, instead,
representatives of D. imperfecta.
Order DASYUROMORPHIA Gill, 1872
Family DASYURIDAE Goldfuss, 1820
Genus Antechinus Macleay, 1841
YELLOW-FOOTED ANTECHINUS Antechinus fia-
vipes (Waterhouse, 1838) (LC)
MZUT T468 (548); unmount; unsexed ad.; New South
Wales, Australia; 1856; purchased by G.A. Frank.
DUSKY ANTECHINUS Antechinus swainsonii (Water-
house, 1840) (LC)
MZUT T469 (715); mount; unsexed ad.; Van Diemen
Land (Tasmania), Australia; V/1845; purchased by
G.A. Frank.
Genus Dasyurus E. Geoffroy, 1796
WESTERN QUOLL Dasyurus geoffroii Gould, 1841
(NT)
MZUT 1T470 (889); mount; female ad.; Australia; 1860;
purchased by Verreaux;
MZUT 1T471 (837); mount; unsexed ad.; Australia; 1848;
purchased in Milano (Italy).
Remarks. Mr. Verreaux was a professional collector of
and trade in natural history based in Paris.
SPOTTED-TAILED QUOLL Dasyurus maculatus
(Kerr, 1792) (NT)
MZUT T472 (550); mount; w.d.
Remarks: The specimen lacks the tail.
EASTERN QUOLL Dasyurus viverrinus (Shaw, 1800)
(EN)
MZUT T473; mount; unsexed ad.; Tasmania, Australia;
II/1867;
MZUT 1T474 (354); mount; unsexed ad.; Australia; 1839;
purchased in Rio de Janeiro by Antonio Caffer;
MZUT T475 (899); mount; unsexed ad.; Australia; 1860;
purchased by Verreaux.
Bonn zoological Bulletin 70 (1): 1-14
Genus Phascogale Temminck, 1824
BRUSH-TAILED PHASCOGALE Phascogale_ ta-
poatafa (Meyer, 1793) (NT)
MZUT T476 (695); mount; unsexed ad.; Australia; 1829.
Genus Sminthopsis Thomas, 1887
FAT-TAILED DUNNART Sminthopsis crassicaudata
(Gould, 1844) (LO)
MZUT 1T477 (2042); ethanol; unsexed, ad., Southern
Australia; no date; donation by Oldfield Thomas.
Remarks: Michael Rogers Oldfield Thomas was a Brit-
ish zoologist who worked on the mammal collections at
the Natural History Museum of London.
Family MYRMECOBHDAE Waterhouse, 1841
Genus Myrmecobius Waterhouse, 1836
NUMBAT Myrmecobius fasciatus Waterhouse, 1836
(EN)
MZUT T478 (687); mount; female ad.; York district,
Western Australia; VH/1844; donation by Mr. Preiss
MZUT T479 (699); mount; male ad.; Australia; 1/1845;
purchased by G.A. Frank.
Remarks. The MZUT catalogue reports that the speci-
men MZUT T478 was killed on 10/04/1840.
Johann August Ludwig Preiss (1811-1883) was a German
naturalist mainly interested in plant collection, but he
made extensive collections of natural history specimens
of all kinds. In the course of his activities he visited
from 1838 to 1841 most of the known parts of south-
western Australia and several islands off the coast. Most
of his zoological collection was sold to various European
museums, or dealers of natural history specimens.
Family THYLACINIDAE Bonaparte, 1838
Genus Thylacinus Temminck, 1824
TASMANIAN TIGER Thylacinus cynocephalus Har-
ris, 1808 (EX)
MZUT T480 (352); mount; male ad.; Tasmania, Austra-
lia; 1831; purchased by Mr. Leadbeater;
MZUT T480 (MACUT 331); partial skeleton.
Remarks: The skull 1s inside the taxidermy mount.
Benjamin Leadbeater was a renowned merchant of
natural history materials in London.
Order PERAMELEMORPHIA Ameghino, 1889
Family PERAMELIDAE Gray, 1825
Genus Isoodon (Desmarest, 1817)
SOUTHERN BROWN BANDICOOT J/soodon obesu-
lus (Shaw, 1797) (LC)
MZUT T481 (691); mount; female ad.; Australia;
VII/1844; donation by Mr. Preiss.
Remarks: The specimen was killed on 4/VI/1839.
©ZFMK
Revised catalogue of monotremes and marsupials housed at MRSN, Italy 9
Genus Perameles E. Geoffroy, 1804
LONG-NOSED BANDICOOT Perameles nasuta
Geoffroy, 1804 (LC)
MZUT T482 (829); mount; female ad.; Australia; 1848:
purchased in Milano by Mr. Bonomi.
Family THYLACOMYIDAE Bensley, 1903
Genus Macrotis Reid, 1837
GREATER BILBY Macrotis lagotis Reid, 1837 (VU)
MZUT T483 (848); mount; unsexed ad.; Australia; 1850:
purchased in Milano by Mr. Bonomi.
Order DIPROTODONTIA Owen, 1866
Family PHASCOLARCTIDAE Owen, 1839
Genus Phascolarctos Blainville, 1816
KOALA Phascolarctos cinereus Goldfuss, 1817 (VU)
MZUT T484 (360); mount; unsexed juv.; Australia:
1839-1840; purchased in Rio de Janeiro by Antonio
Caffer;
MZUT T485 (898); mount; unsexed ad.; Australia; ex-
change with Count Ercole Turati from Milan (Italy);
MZUT T486 (964); mount; w.d.;
MZUT 1T487; skin; unsexed ad.; Gosford, New South
Wales, Australia; 1893; donation by G. Podenzana.
Remarks. Giovanni Podenzana (1864-1943) was an
Italian naturalist, explorer and ethnographer. During
the last decade of XIX. century he travelled in Austra-
lia, Tasmania where he gathered numerous ethnographic
artifacts for the Museo Civico of La Spezia (Italy), but
also zoological and botanical specimens who enriched
the collections of several Italian museums.
Family VOMBATIDAE Burnett, 1829
Genus Vombatus E. Geoffroy, 1803
WOMBAT Vombatus ursinus ursinus (Shaw, 1800)
(LC)
MZUT T488 (714); mount; unsexed ad.; islands of the
Bass Strait, Australia, VIII/ 1845, purchased by G.A.
Frank.
Family PHALANGERIDAE Thomas, 1888
Genus Phalanger Storr, 1780
NORTHERN COMMON CUSCUS Phalanger orien-
talis (Pallas, 1766) (LC)
MZUT T489 (800); mount; unsexed ad.; Indonesia,
Timor Island, 1845; purchased by G.A. Frank;
MZUT T490 (799); mount; unsexed ad.; Indonesia,
Timor Island, 1845; purchased by G.A. Frank.
Remarks: The specimen MZUT T4839 is albino variety.
Genus Trichosurus (Lesson, 1828)
COMMON BRUSHTAIL POSSUM Trichosurus vul-
pecula (Kerr, 1792) (LC)
MZUT T491 (2268); mount; unsexed ad.; Australia; do-
nation by Mr. Gallardo;
MZUT T491 (MACUT 7051); skeleton;
MZUT T492 (704); mount; unsexed ad.; 1845; Australia:
purchased by G.A. Frank:
MZUT T493 (679); mount; unsexed ad.; eastern coast of
Australia, I/1844; donation by Dr. Ricord;
MZUT T494 (807); mount; unsexed ad.; Australia; 1845;
purchased by G.A. Frank:
Fig. 3. MZUT T480 specimen of Tasmanian Tiger Thylacinus cynocephalus.
Bonn zoological Bulletin 70 (1): 1-14
©ZFMK
10 Luca Ghiraldi et al.
MZUT T495; skin; unsexed ad.; Gosford, New South
Wales, Australia; 1893; donation by G. Podenzana;
MZUT T496 (MACUT 7868); skeleton; w.d.
Remarks: The specimens MZUT T491 and MZUT
T496 were undetermined.
The specimen MZUT T494 is albino variety.
Alexandre Ricord (1798-1876) was an assistant sur-
geon who devoted his life to natural history. He travelled
in tropical America between 1826 and 1834, collecting
many zoological specimens.
We didn’t find any information about Mr. Gallardo.
Family PPEUDOCHEIRIDAE Winge, 1893
Genus Pseudocheirus Ogilby, 1837
COMMON RINGTAIL POSSUM Pseudocheirus per-
egrinus (Boddaert, 1785) (LC)
MZUT T497; mount; unsexed ad.; w.d.;
MZUT T498 (801); mount; unsexed juv.; Australia:
1845; purchased by G.A. Frank;
MZUT T499 (355); mount; unsexed ad.; Australia; 1839;
purchased in Rio de Janeiro by Antonio Caffer.
Remarks: The specimen MZUT T497 was undeter-
mined.
Genus Petauroides Thomas, 1888
GREATER GLIDER Petauroides volans (Kerr, 1792)
(VU)
MZUT T500 (358); mount; female ad.; Australia;
MZUT T501 (705); mount; unsexed ad.; Australia; 1843;
donation by Dr. Ricord;
MZUT T502 (876); mount; unsexed ad.; Australia; no
date; from Royal Armory of His Majesty.
Family PETAURIDAE Bonaparte, 1838
Genus Petaurus Shaw, 1791
YELLOW-BELLIED GLIDER Petaurus australis
Shaw, 1791 (NT)
MZUT T503 (884); mount; female ad.; Australia; 1860;
purchased by Verraux:
MZUT 1T504; skin; unsexed ad.; Gosford, New South
Wales, Australia; 1893; by G. Podenzana.
Fig. 4. MZUT T512 specimen of Wolye Bettongia penicillata.
Bonn zoological Bulletin 70 (1): 1-14
©ZFMK
Revised catalogue of monotremes and marsupials housed at MRSN, Italy 1]
SUGAR GLIDER Petaurus breviceps Waterhouse,
1839 (LC)
MZUT T505 (1051); mount; unsexed ad.; Melbourne,
Victoria, Australia; donation by Mr. Cossu.
Remarks: Carlo Cossu was the vice-consul of the King-
dom of Italy in Melbourne between the years 1864 and
1870.
Family TARSIPEDIDAE Gervais & Verreaux, 1842
Genus Tarsipes Gervais & Verreaux, 1842
HONEY POSSUM Tarsipes rostratus Gervais & Ver-
reaux, 1842 (LC)
MZUT T506 (688); mount; female ad.; King George III
Bay, Western Australia, Australia; VII/1844; donation
by Mr. Preiss;
MZUT T507 (256); mount; unsexed ad.; Australia;
TX/1846; purchased from G.A. Frank.
Remarks. The MZUT catalogue reports that specimen
MZUT T506 was killed XI/1840.
Family ACROBATIDAE Aplin, 1987
Genus Acrobates Desmarest, 1818
FEATHERTAIL GLIDER Acrobates pygmaeus Shaw,
1793 (LC)
MZUT T508 (3138); ethanol; unsexed ad.; Australia; do-
nation by Enrico Festa;
MZUT T509 (2043); ethanol; unsexed ad.; New South
Wales, Australia; donation by Oldfield Thomas.
Family POTOROIDAE Gray, 1821
Genus Bettongia Gray, 1837
BURROWING BETTONG Bettongia lesueur (Quoy &
Gaimard, 1824) (NT)
MZUT 1T510 (702); mount; male ad.; Australia; 1/1845;
purchased by G.A. Frank
MZUT T511 (1131); mount; unsexed ad.; Australia;
1867; Pirocorvetta “Magenta” expedition.
WOYLIE Bettongia penicillata Gray, 1837 (CR)
MZUT T512 (790); mount; female ad.; Western Austra-
lia, Australia; 1845; purchased by G.A. Frank.
Genus Potorous Desmarest, 1804
LONG-NOSED POTOROO Potorous
(Kerr, 1792) (LC)
MZUT T513 (888); mount; male ad.; Tasmania, Austra-
lia; 1860; purchased by Verreaux.
tridactylus
Family MACROPODIDAE Gray, 1821
Genus Lagorchestes Gould, 1841
EASTERN HARE-WALLABY §Lagorchestes lep-
orides, Gould, 1841 (EX)
Bonn zoological Bulletin 70 (1): 1-14
Fig. 5. MZUT 1T514 specimen of Eastern-Hare Wallaby
Lagorchestes leporides.
MZUT T514; mount; unsexed ad.; Australia;
MZUT T515; mount; unsexed ad.; Australia;
MZUT T516; mount; unsexed ad.; Australia.
Remarks: The specimens MZUT T514-515 were unde-
termined. The specimen MZUT T516 was identified as
Bettongia rufescens.
Genus Lagostrophus Thomas, 1887
BANDED HARE-WALLABY Lagostrophus fasciatus
(Peron & Leseur, 1807) (VU)
MZUT T517 (797); mount; female ad.; Western Austra-
lia, Australia; 1845; purchased by G.A. Frank.
Genus Onychogalea Gray, 1841
BRIDLED NAILTAIL WALLABY Onychogalea frae-
nata (Gould, 1841) (VU)
MZUT T518; mount; male ad.; Australia;
MZUT T519; mount; unsexed ad.; w.d.
CRESCENT NAILTAIL WALLABY Onychogalea lu-
nata (Gould, 1841) (EX)
MZUT T520 (796); mount; unsexed ad.; Western Austra-
lia, Australia; 1845; purchased by G.A. Frank.
©ZFMK
12 Luca Ghiraldi et al.
Fig. 6. MZUT T520 specimen of Crescent Nail Wallaby Onychogalea lunata.
Genus Thylogale Gray, 1837
TASMANIAN PADEMELON Thylogale_billardierii
(Desmarest, 1822) (LC)
MZUT T521; mount; unsexed ad.; Tasmania, Australia.
RED-NECKED PADEMELON Thylogale thetis (Les-
son, 1828) (LC)
MZUT T522 (792); mount; female ad.; New South
Wales, Australia; 1845; purchased by G.A. Frank;
MZUT 1523; skin; unsexed; Gosford, New South Wales,
Australia; 1893; donation by G. Podenzana.
Genus Petrogale Gray, 1837
BRUSH-TAILED ROCK-WALLABY Petrogale peni-
cillata (Gray, 1827) (VU)
MZUT 1524 (1373); mount; unsexed ad.; Australia;
1893; purchased by Mr. Schiavetti.
Remarks: The specimen MZUT T524 was undeter-
mined.
Genus Setonix Lesson, 1842
QUOKKA Setonix brachyurus (Quoy e Gaimard, 1830)
(VU)
MZUT T525; mount; unsexed ad.; Australia.
Bonn zoological Bulletin 70 (1): 1-14
Remarks: The specimen MZUT T525 was undeter-
mined.
Genus Wallabia Trouessart, 1905
SWAMP WALLABY Wallabia bicolor Lesson, 1828
(LC)
MZUT 1T526 (798); mount; male ad.; Western Australia,
Australia; 1845; purchased by G.A. Frank.
Remarks: The locality of provenance is out of the range
of the species (Wilson & Mittermeier 2015).
Genus Macropus Shaw, 1790
EASTERN GRAY KANGAROO Macropus giganteus
Shaw, 1790 (LC)
MZUT 1527; mount; female ad.; Australia;
MZUT T528 (1084); mount; female ad.; Australia; no
date; dead in captivity at the Royal Zoological garden
of Torino;
MZUT T529; mount; male ad.; Australia; no date;
MZUT T530; mount; female juv.; w.d.;
MZUT T531 (MACUT 332); skeleton; w.d.
©ZFMK
Revised catalogue of monotremes and marsupials housed at MRSN, Italy 13
WESTERN GRAY KANGAROO Macropus fuligino-
sus Desmarest, 1817(LC)
MZUT T532; mount; female ad.; Australia; no date;
MZUT T533 (361); mount; female ad.; Australia; no
date; dead in captivity at the Royal menagerie of Stu-
pinigi in II/1859;
MZUT 1534 (2234); mount; male ad.; Australia; no date:
MZUT T534 (MACUT 7056); skull.
Genus Osphanter Gould, 1842
RED KANGAROO Osphranter rufus Desmarest, 1822
(LC)
MZUT T535 (1434); mount; female ad.; Australia; no
date;
MZUT T536; mount; female ad.; w.d.;
MZUT T537; mount; female ad.; w.d.
Remarks: All specimens were undetermined.
Genus Notamacropus Dawson & Flannery, 1985
RED-NECKED WALLABY Notamacropus rufogri-
seus Desmarest, 1817 (LC)
MZUT 1T538 (2724); mount; male ad.; Australia; no date:
donation by Enrico Festa. Dead in captivity;
MZUT T538 (MACUT 7295); skeleton;
MZUT T539 (789); mount; female ad.; King Island, Aus-
tralia; 1845; purchased by G.A. Frank;
MZUT T540 (804); mount; female ad.; Australia:
V/1845; purchased by G.A. Frank;
MZUT T541; mount; male ad.; w.d;
MZUT T542; mount; male ad.; w.d.;
MZUT T542 (MACUT 3461); skull; w.d.;
MZUT T543 (MACUT 336); skeleton; w.d.
Remarks: The specimen MZUT T542 was undeter-
mined.
TAMMAR WALLABY Notamacropus eugenii Des-
marest, 1817 (LC)
MZUT T544 (794); mount; male ad.; Western Australia,
Australia; 1845; purchased by G.A. Frank;
MZUT 1T545 (701); mount; female ad.; Australia; 1845;
purchased by G.A. Frank.
Remarks: The specimen MZUT T544 was labelled as
Halmaturus hautmanni.
PARMA WALLABY Notamacropus parma Water-
house, 1846 (NT)
MZUT T546 (806); mount; unsexed ad.; Western Austra-
lia, Australia; V/1845, purchased by G.A. Frank.
Remarks: The locality of provenance is out of range of
the species (Wilson & Mittermeier 2015).
UNDETERMINED SPECIMENS
Ailurops cf. furvus
MZUT T547 (703); mount; unsexed; Celebes Island, In-
donesia; I/1845; purchased by G.A. Frank.
Bonn zoological Bulletin 70 (1): 1-14
Remarks: The specimen could be identified as A. fur-
vus, due to the size and coat colaration, but because of the
size We can rule out an immature specimen of A. ursinus.
Isoodon cf. auratus.
MZUT T548; ethanol; w.d.
Remarks: The coloration seems to be that of /. auratus.
However, the small size of the specimen could suggest an
immature or an individual from a population of 1. obesu-
Jus characterized by a small size.
Perameles sp.
MZUT T549; ethanol; w.d.
Remarks: The specimen could be a juvenile and there-
fore the identification is difficult. The coat coloration
rules out P. gunni.
Petaurus cf. australis
MZUT T550 (359); mount; unsexed; Australia; 1819;
purchased in London during the Bullock’s Auction in
1819.
Remarks. The patagium is poorly developed, the coat
coloration and the lack of the dorsal stripe seem to indi-
cate P. australis.
Bettongia sp.
MZUT T551 (787); mount; male ad.; Australia; 1846;
purchased by G.A. Frank
Thylogale cf. thetis
MZUT T552 (795); mount; male ad.; New South Wales,
Australia; 1845; purchased by G.A. Frank.
Remarks: The correct identification is uncertain due to
the faded coat, but red on neck and back suggest T° thetis.
Petrogale sp.
MZUT T553 (1367); mount; unsexed ad.; purchased by
Mr. Schiavetti; 1893;
MZUT T554 (MACUT 3453); skull; no locality; 1896;
purchased by Mr. Crivelll.
Remarks. We didn’t find any information about Mr.
Schiavetti and Mr. Crivelli.
Macropus sp.
MZUT T555; mount; male ad.; w.d.;
MZUT T556; mount; female ad.; w.d.;
MZUT T557: mount; male juv.; w.d.;
MZUT T558: mount; male juv.; w.d.;
MZUT T559: mount; female; w.d.;
MZUT T560: mount; female; w.d.;
MZUT T561 (MACUT 329); skeleton (no skull); w.d.;
MZUT T562 (MACUT 322); skull; juv.; w.d.;
MZUT 1563; skeleton; juv.; w.d.
©ZFMK
14 Luca Ghiraldi et al.
Acknowledgements. We wish to thank Kenny Travoullion,
Western Australian Mueum for assistance with the bandicoot
identifications, the reviewers for their suggestions in improving
the manuscript, and Franco Andreone of the Museo Regionale
di Scienze Naturali of Torino for the comments on an earlier
version of the manuscript. We are also grateful to Pier Chiado
Fiorio and Marina Spini of the library of the Museo regionale
di Scienze Naturali di Torino for their support in retrieving sci-
entific literature.
REFERENCES
Astua D (2015) Morphometrics of the largest New World mar-
supials, opossums of the genus Didelphis (Didelphimorphia,
Didelphidae). Oecologia Australis 19 (1): 117-142
Calvini M, Siori MS, Gippoliti S, Pavia M (2016) Catalogue of
the primatological collection of the Torino University. Natu-
ral History Sciences 3 (2): 3-26
Cerqueira R, Lemos B (2000) Morphometric differentiation be-
tween Neotropical black-eared opossums, Didelphis marsu-
pialis and D. aurita (Didelphimorphia: Didelphidae). Mam-
malia 64 (3): 319-327
Corti A (1955) Torino ha avuto il primo giardino zoologico ittal-
iano. Natura 46 (2): 53-67
Gardner AL (2008) Genus Caluromys Allen, 1900. Pp. 1-11 in
AL Gardner (ed.) Mammals of South America, vol. 1: mar-
supials, xenarthrans, shrews, and bats. University of Chicago
Press, Chicago
Giarla TC, Voss RS, SA Jansa (2010) Species limits and phylo-
genetic relationships in the didelphid marsupial genus Thy/-
amys based on mitochondrial dna sequences and morphol-
ogy. Bulletin of the American Museum of Natural History
346: 1-67
Grande L (2017) Curators: Behind the Scenes of Natural His-
tory Museums. University of Chicago Press, First Edition,
Chicago
Hyller Giglioli E (1876) Viaggio intorno al globo della R. Piro-
corvetta Italiana Magenta. Relazione descrittiva e scientifica.
Maisner e Compagnia Editiori, Milano
IUCN 2020. The IUCN Red List of Threatened Species. Ver-
sion 2020-1. Online at: https://www.iucnredlist.org [last ac-
cessed 24 Nov. 2020]
Bonn zoological Bulletin 70 (1): 1-14
Kemp C (2017) The Lost Species: Great Expeditions in the
Collections of Natural History Museums. University of Chi-
cago Press, First Edition, Chicago
Maschetti G, Muti M, Passerin D’Entreves (1988) Serragli e
Menagerie in Piemonte nell’Ottocento sotto la Real Casa
Savoia. Allemandi & C. Editiori, Torino
Thomas O (1898) On the small mammals collected by Dr.
Borelli in Bolivia and Northern Argentina. Bollettino dei
Musei di Zoologia e Anatomia Comparata della R. Universita
di Torino 315 (XIII): 1-4
Passerin d’Entreves P, Gavetti E (2014) La collezione di cetacei
dei Musei di Zoologia e di Anatomia comparata dell’ Univer-
sita di Torino. Museologia Scientifica Memorie 12: 13-21
Rossi RV, Voss RS & Lunde DP (2010) A revision of the didel-
phid marsupial genus Marmosa. Part 1. The species in Tate’s
‘mexicana’ and ‘mitis’ sections and other closely related
forms. Bulletin of the American Museum of Natural History
334: 1-83
Simondetti M (1943) Necrologico — Carlo Bajonotti. Rivista
italiana di Ornitologia I-13 (2): 65-66
Tadini G (1937). Imammiferi del Museo di Torino. Tesi di Lau-
rea inedita della Facolta di Scienze della Regia Universita di
Torino (unpublished)
Tortonese E (1957) Venticinque anni di vita del Museo Zoolog-
ico di Torino (1930-1955). Natura 48 (1): 1-27
Voss RS, Jansa SA (2009). Phylogenetic relationships and clas-
sification of didelphid marsupials, an extant radiation of New
World metatherian mammals. Bulletin of the American Mu-
seum of Natural History 322: 1-177
Voss RS, Gutiérrez EE, Solari S, Rossi RV, Jansa SA (2014)
Phylogenetic relationships of mouse opossums (Didelphidae,
Marmosa) with a revised subgeneric classification and notes
on sympatric diversity. American Museum Novitates 3817:
1-27
Voss RS, Diaz-Nieto JF, Jansa SA (2018) A revision of Phi-
lander (Marsupialia: Didelphidae), Part 1: P. quica, P. canus,
and a new species from Amazonia. American Museum No-
vitates 3891: 1-70
Wilson DE, Mittermeier RA (2015) Monotremes and marsu-
pials. Handbook of the mammals of the World Vol. 5. Lynx
Edicions, Barcelona
Winker K (2004) Natural History Museums in a Postbiodiversi-
ty Era. BioScience 54 (5): 455-459
©ZFMK
Bonn zoological Bulletin 70 (1): 15-49
2021 - Junkiert L. et al.
https://do1.org/10.20363/BZB-2021.70.1.015
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org:pub:F935 124B-7308-4734-94A3-22CEA 19942E2
Four new species of the Madagascan genus Exphora Signoret, 1860
(Auchenorrhyncha: Fulgoromorpha: Tropiduchidae: Elicini)
with comments on some hitherto undescribed ultrastructural characters
Lukasz Junkiert', Marcin Walczak’? & Agnieszka Bugaj-Nawrocka*>*
'2.3 Faculty of Natural Sciences, Institute of Biology, Biotechnology and Environmental Protection, University of Silesia in Ka-
towice, Bankowa 9, PL-40-007 Katowice, Poland
“Corresponding author: Email: [email protected]
'urn:lsid:zoobank.org:author: AF78807C-2115-4A33-AD65-9190DA612FB9
2 urn:lsid:zoobank.org:author:046FOD52-7FBA-4D7D-9F79-AEBF7F2C98B8
2 urn:Isid:zoobank.org:author: BSA9DF15-3677-4F5C-A DOA-46B25CA350F6
Abstract. Four new species of the Madagascan genus Exphora Signoret, 1860 (Hemiptera: Fulgoromorpha: Tropiduchi-
dae) are described: EF. bourgoini sp. nov., E. kalalaoensis sp. nov., E. angustivenosa sp. nov. and E. robusta sp. nov. Also,
a new, green colour form of E. /innavuorii Junkiert, Walczak & Bourgoin, 2017 is presented. The male and female geni-
talia of the new species are illustrated. SEM photos of the head, antennae and their sensilla, legs, as well as the fore and
hind wings are given. A number of structures, which were previously unknown or undescribed, are discussed, including
the compound eye with trichoid sensilla, the sensory plate organ on the antennal pedicel surface, the fore and hind wings
hamuli, the area of microtrichia at the costa posterior of the fore wing, the tegula, the postcubitus bulla, the third coxa
with coxal protrusion and the spines of tibia. A distribution map of the newly described species and an illustrated key to
all Exphora species are provided.
Key words. Planthoppers, insect genitalia, SEM, sensilla, wing morphology.
INTRODUCTION
Madagascar is the fourth largest island in the world, re-
maining in relative isolation for about 88 million years,
and over 90% of Malagasy wildlife is endemic (Venc-
es et al. 2009). The state of knowledge of Madagascar’s
fauna improves each year and affects various groups of
animals (e.g., Thalmann & Geissmann 2005; Couri et al.
2006; Olivieri et al. 2007; Glaw et al. 2012). This also
applies to the quantity of newly described Hemiptera
species, especially Heteroptera (e.g., Kment 2013; Banar
et al. 2016; Chiond et al. 2016) and Fulgoromorpha (e.g.,
Stroinski et al. 2011; Constant 2014; Gnezdilov 2015;
Gnezdilov & Bourgoin 2015; Junkiert & Walczak 2015;
Junkiert et al. 2016; Swierczewski et al. 2016). The num-
ber of scientific expeditions has increased significantly,
which allows to describe more and more new species of
plants and animals. However, the rapidly progressing
degradation of the island’s natural habitats is reducing its
biodiversity. Unfortunately, there is a concern that many
of the species described as new taxa for science may no
longer exist at all, because their habitats have been de-
stroyed (Goodman & Benstead 2003).
Within the family Tropiduchidae Stal, 1866, Elicini
Melichar, 1915 (37 genera, 139 species) is one of the
Received: 25.02.2020
Accepted: 02.12.2020
three tribes belonging to the subfamily Elicinae Meli-
char, 1915, next to Bucini Gnezdilov, Bartlett & Bour-
goin, 2016 (two genera, four species) and Parathisciini
Gnezdilov, 2013 (four genera, seven species) (Gnezdilov
2013; Gnezdilov et al. 2016; Bourgoin 2020). Previously,
representatives of this tribe were placed within the Issi-
dae Spinola, 1839 or Lophophidae Stal, 1866. In 1978,
Fennah designated subtribes Elicina and Gaetuliina with-
in Bladinini (Nogodinidae Melichar, 1898). Based on the
morphology of genitalia, as well as the data provided by
Urban & Cryan (2006), Gnezdilov (2007) transferred
Gaetuliina Fennah, 1978, and it gained tribe status (Gae-
tuliini) within the Tropiduchidae. In 2013, Gnezdilov
merged Elicina Melichar, 1915 with the Gaetuliini Fen-
nah, 1978 and established the Elicini tribe.
Among the characteristics distinguishing the repre-
sentatives of the tribe Elicini are hemispheric gono-
placs without teeth or with denticles, lateral spikes on
the metatibia, as well as symmetrical spinulation on the
second metatarsomere (Gnezdilov 2013; Gnezdilov et al.
2016). Elicini are found in the Americas, southern Afri-
ca, Madagascar, Asia, Australia and Oceania (Bourgoin
2020). Fossil records are known also from the areas of
Europe (Szwedo & Stroinski 1999; Szwedo et al. 2019).
Corresponding editor: R. Peters
Published: 28.01.2021
16 Lukasz Junkiert et al.
Currently, the Malagasy fauna of Tropiduchidae 1s rep-
resented by 35 species (including four described in the
present study). Until the mid-1960s, only 19 species of
this family were known from Madagascar (of which ten
from the subfamily Elicinae), including seven species of
the genus Exphora Signoret, 1860: E. guerinii Signoret,
1860, E. fumivenosa (Jacobi, 1917), E. longipennata
Lallemand, 1950, E. succinae Lallemand, 1950, E. ifa-
nadiensis Synave, 1966, E. perinetensis Synave, 1966,
and EF. similis Synave, 1966. Over the past few years, one
species of the genus Chrysopuchus Gnezdilov, 2013, one
of Bambomada Gnezdilov, 2015 and six of Bolitropis
Gnezdilov, 2013 (Gnezdilov 2013, 2015) have been de-
scribed, followed by eight new species of the genus Ex-
phora: E. ambatolaonaensis, E. constanti, E. stroinskii
(Junkiert & Walczak 2015), E. linnavuorii (Junkiert et al.
2017), as well as E. bourgoini sp. nov., E. kalalaoen-
sis Sp. nov., E. angustivenosa sp. nov., and FE. robusta
sp. nov. (this study). Among the genera of the tribe Eli-
cini, Exphora is now a rather speciose genus counting
15 species, including the four described here, ranking
in third place in terms of species numbers within Elicini
(after Neaethus Stal, 1861 and Dictyssa Melichar, 1906).
Examination of unidentified tropiduchid specimens in
the collections of the Royal Belgian Institute of Natural
Sciences in Brussel (Belgium) and the Royal Museum
for Central Africa in Tervuren (Belgium) allowed the de-
scription of new species, as well as of the green colour
form of E. linnavuorii Junkiert, Walczak & Bourgoin,
2017. In addition, the use of scanning electron micros-
copy (SEM) allowed to study a number of structures, not
yet known and described for this genus.
MATERIALS AND METHODS
Examination of the specimens
External structures were examined using a stereoscopic
microscope Olympus SZX9. The genitalia were dissected
after boiling the abdomen three times (about three min-
utes each time) in a 10% solution of potassium hydroxide
(KOH). Then the pygofer and styles were separated from
the abdomen and the aedeagus s.l. was extracted using
thin forceps and a needle blade. After that, the aedeagus
s.1. was placed in glycerine. The genitalia were exam-
ined using a light microscope Nikon Eclipse. Drawings
were made using a camera lucida. Photographs were tak-
en with a Canon Eos camera with extension rings. Wing
venation nomenclature follows Bourgoin et al. (2015).
Quoting the labels of specimens: (/) is used to divide data
on different rows on the label, (;) is used to divide data
on different labels, ({ ]) is used for authors’ comments.
Bonn zoological Bulletin 70 (1): 15-49
Institutional abbreviations
RBINS = Royal Belgian Institute of Natural Sciences,
Brussels, Belgium
RMCA = Musée Royal de I’ Afrique Centrale,
Tervuren, Belgium
Occurrence data and map preparation
All localities were georeferenced using Google Earth
Pro 7.3.2.5776 (Google Inc. 2019, Mountain View, CA,
USA) (coordinates for localities were collected in dec-
imal degrees, datum: WGS84). The map was prepared
in Quantum GIS 3.8 (QGIS Development Team 2019;
http://www.qgis.org) using WGS84 datum and EPSG:
3395 (World Mercator).
RESULTS
A key (Appendix I) to all known species of Exphora is
presented. The authors of this article would like to em-
phasize that they claim that the species EF. /ongipennata
Lallemand, 1950 and E. fumivenosa (Jacobi, 1917) do
not belong to the genus Exphora, but are included in this
key as the genus has not been revised yet.
Taxonomy
Class Insecta Linneaus, 1758
Order Hemiptera Linneaus, 1758
Family Tropiduchidae Stal, 1866
Subfamiliy Elicinae Melichar, 1915
Tribe Elicini Melichar, 1915
Genus Exphora Signoret, 1860
Exphora bourgoini Junkiert & Walczak sp. nov.
(Figs 1A, 2A, 3A, 5-6)
urn: |sid:zoobank.org:act: EF43 ES EF-4DB9-4184-A87C-1354EA32A410
Material examined
Holotype
1 3 / Exphora bourgoini sp. nov. / Junkiert & Wal-
czak det. 2018 [red label]; Sahafanjana / Manambato /
(Anove) [white label]; INSTITUT / SCIENTIFIQUE /
MADAGASCAR [light green label]; Coll. R.L.Sc.N.B.
[blue label] (RBINS).
Paratypes
1 9 / Exphora bourgoini sp. nov. / Junkiert & Wal-
czak det. 2018 [red label]; Sahafanjana / Manambato /
(Anove) [white label]; INSTITUT / SCIENTIFIQUE /
MADAGASCAR [light green label]; Coll. R.L.Sc.N.B.
[blue label] (RBINS).
1 2 / Exphora bourgoini sp. nov. / Junkiert & Walczak
det. 2018 [red label]; H. Synave det. 1956 / EXPHORA
GUERINII [sic!] Signoret (hand written); Sahafanjana /
©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 17
oe -
i —— =~ .
a eae
= eT ee
= a a 4 ©. -
- i
Sigh]
y
ri
e S| |
; . iat
if, 4
A
ft
i
A)
{
—-
Ze ma a
Ze 7 oan cas
eT eS eS
es
Fig. 1. Dorsal habitus of the newly described species. A. Exphora bourgoini sp. nov. B. E. kalalaoensis sp. nov. C. E. angustivenosa
sp. nov. D. E. robusta sp. nov
Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK
18 Lukasz Junkiert et al.
1mm
"a
= ee ,
Sn geae OR
a Lt
Dhak one paige at
‘iit aan’
CORRE Fe He ms hae i
gE aincegine
: a : ’
a:
i=
Bt 4
f
espe ae. ae
*
Fig. 2. Metope of the newly described species. A. Exphora bourgoini sp. nov. B. E. kalalaoensis sp. nov. C. E. angustivenosa
sp. nov. D. E. robusta sp. nov.
©ZFMK
Bonn zoological Bulletin 70 (1): 15-49
New species of Exphora (Hemiptera: Tropiduchidae) 19
Z bees
——
Fig. 3. Fore wing and hind wing of the newly described species. A. Exphora bourgoini sp. nov. B. E. kalalaoensis sp. nov. C. E. an-
gustivenosa sp. nov. D. E. robusta sp. nov.
Manambato / (Anove) [white label]; INSTITUT / SCI-
ENTIFIQUE / MADAGASCAR [light green label];
Coll. R.I.Sc.N.B. [blue label] (RBINS).
Description
Body length 10.8 mm.
Head. Metope twice as long as wide, lateral margins
slightly arched and extended laterally at 3/4 in its lower
part, then narrowing to metopoclypeal suture. Dorsal
margin of metope weakly arched but distinctly concave.
Median keel distinct, running through metope and
metopoclypeal suture (Fig. 2A). Metopoclypeal suture
elongate (about 1/4 shorter than metope), triangular.
Lateral keels present and distinct. In lateral view, metope
Bonn zoological Bulletin 70 (1): 15—49
is distinctly convex, whereas metopoclypeal suture
almost straight but median keel in lateral view gently
arches over surface of metopoclypeal suture, and it also
protrudes above surface of metope, but in lateral view it
is covered by also protruding lateral keels. Eyes round.
Coryphe almost 1.5 times as wide as long (measured in
the middle of the length), with anterior margin convex
and distinctly angular and posterior margin distinctly
arcuately concave.
Pronotum and mesonotum. Pronotum bluntly rounded
anteriorly, distinctly concave posteriorly. Mesonotum
weakly convex, with three parallel keels: median
keel is in its anterior part joined to two slanting carina
converging to each other almost at right angle and thus
©ZFMK
20 Lukasz Junkiert et al.
double row
of bristles
D
Fig. 4. Various views of the protibia of Exphora bourgoini sp. nov. A—C. With double row of bristles highlighted. D. Profemur in
dorsal view with small spines at inner margin.
forming an arrow-shaped structure. Both edges of arrow
are joined to two lateral keels.
Fore wings. Clavus elongate, reaching almost 2/3 of
the wing length, of hyperpterism type. Costal area well
developed with 11 or 12 cells between CA and Pc+CP;
ScP+R._ short, separating; RA two-branched; RP with
at least 7 terminals; MP separating before nodal line;
MP1+2 separating before nodal line, after the third
terminal, clearly forked at the same level as stigma;
MP3+4 separating, before nodal line; MP4 single,
MP3 short, separating before nodal line, after the first
terminal. CuA forking before nodal line and before MP;
3—4 transverse veins connecting CuP and PCu+A1 (more
often one, sometimes two connecting CuP and PCu before
joining with Al and two or three veins connecting CuP
and PCu+A1). Al running parallel to posterior margin
of clavus. Cubital cell twice as long, or even more, than
postcostal cell, radial cell and median cell. Radial cell
sometimes separated by a transverse vein. Cl based
well before C2—C5; C2 and C4 in contact sharing MP
margin. Cl, C2, C3 and C4 of similar length, C5 about
2 times longer. Eighteen or nineteen apical cells. Stigma
longitudinal and dark-brown, well visible, including 4
short veins running to edge of wing (Fig. 3A).
Bonn zoological Bulletin 70 (1): 15-49
Hind wings. Well developed, 4/5 of the fore wings’
length. Hyaline with brown veins. Almost twice long as
wide in midline (ratio length to width: 2.2—2.4). Eleven
apical cells (Fig. 3A).
Legs. Prothoracic and mesothoracic legs: Femur about
2/3 of tibia length, irregular in cross-section, margins of
femur covered with small bristles, inner margin bears
small spines. Tibiae long and thin, trapezoidal in cross-
section, margins covered with small bristles, lateral
margins with double row of bristles (e.g., Fig. 4).
Metathoracic legs. Metafemur margins covered with
small bristles. Metatibia twice as long as metafemur,
triangular in cross-section with concave ventral side.
Margins of metatibia covered with small, barely
visible bristles. Lateral margin with four lateral spines,
three of which are distinct and one is weakly visible.
Metatibiotarsal formula 8/8/2.
Colouration. General colouration yellowish-brown,
more contrastingly coloured than most species of this
genus. Metope with keels distinctly red, between lateral
and median keels red-brown stripes passing along the
metope. Eyes slightly darker than background; ocelli with
dark rim. Posterior margin of pronotum and mesonotum
contoured by a distinct dark line, similar to all darkly
©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 21
0.5mm
Fig. 5. Male genitalia of Exphora bourgoini sp. nov. A. Aedeagus, lateral view. B. Anal tube, dorsal view. C. Gonostyl, lateral view.
Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK
22 Lukasz Junkiert et al.
0.5mm
0.2 mm
Fig. 6. Female genitalia of Exphora bourgoini sp. nov. A. Distal part of abdomen in lateral view. B. Anal tube, dorsal view. C.
Gonapophyses VIII. D. Gonapophyses IX. Gp = gonoplac.
marked convex keels on the mesonotum. Lateral margins
of tergites of abdomen brown. Wings hyaline with brown
veins. Femur and tibia colouration uniform-yellowish-
brown, spines of metatibia brown, darker than tibia, the
sharp end of the spike is black. Prothoracic legs darker
than meso- and metathoracic legs.
Bonn zoological Bulletin 70 (1): 15-49
Genitalia. Male. Pygofer with hind margin convex.
Aedeagus s.l. narrow, falcate in lateral view. Ventral
phallobase overreaching half-length of aedeagus. Each
dorso-lateral phallobase lobe with one long apical
finger-shaped process bearing very small denticles.
Subapical process smaller and slightly curved. Ventral
©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 23
Fig. 7. Distribution of the newly described species and colour
form on Madagascar. Yellow. Exphora angustivenosa sp. nov.
Green. FE. bourgoini sp. nov. Red. E. kalalaoensis sp. nov. Pur-
ple. £. robusta sp. nov. Blue. E. /innavuorii green colour form.
process (aedeagus s.s.) with inner part duck-head shaped,
outer part elongated in distal part with finger-shaped
apical process and smaller triangular subapical process
(Fig. SA). Anal tube rather robust, weakly narrowed
basally and enlarged apically in dorsal view with two
horn-like angles. Anal column elongate, about 0.5 times
anal tube length (Fig. 5B). Gonostyle triangle-shaped
with smooth roundish edges, lateral margin of gonostyle
slightly concave; capitulum wide and folded, bearing
subapical spiralling tooth on inner side (Fig. 5C).
Female. Endogonocoxal process well sclerotized with
slightly rounded apex and delicate subapical indentation
on the inner side. Gonoplac (third valvula) semi-circular
Bonn zoological Bulletin 70 (1): 15—49
in lateral view with dorsal margin slightly convoluted
innerly (Fig. 6A). Median part of sternite VII sinuous
at ventral side with distinct acute incision in the middle.
Genitalia with anal tube relatively short, broadly rounded
in dorsal view (Fig. 6B). Gonapophyses VIII (first
valvula) almost triangular, strongly sclerotized and
bearing three teeth on dorsal margin, and one relatively
large tooth with smaller subapical tooth (Fig. 6C).
Gonapophyses VIII not visible externally, covered by
gonoplacs. Gonapophyses IX (second valvular) well
developed, sclerotized with apical ends not confluent,
bearing very small quite abundant spikes, acute at apex
(Fig. 6D).
Measurements (in mm, females in parentheses). Body
length: — (10.80); head width (with eyes): 1.84 (1.80-
1.97); metope length: 1.87 (2.02—2.08); metope width:
1.14 (1.22—1.25); metope length/metope width ratio: 1.64
(1.66—1.67); coryphe length: 0.38 (0.44—-0.45); coryphe
width: 0.77 (0.87-0.89); coryphe length/coryphe width
ratio: 0.49 (0.50-0.51); fore wing length: 8.63 (8.64—
8.73); fore wing width: 4.23 (4.44); mesonotum length:
2.02 (1.94—2.13); mesonotum width: 1.95 (2.11—2.29).
Diagnosis. Exphora bourgoini sp. nov. can be
distinguished from other species by the pattern of dark-
brown longitudinal stigma including four short veins
running to edge of wing, metope with wide brown
stripes, horned anal tube, shape of style, aedeagus and
its processes.
Etymology. The name of this new species is dedicated to
professor Thierry Bourgoin, an excellent Fulgoromorphan
specialist from the Institute of the Systematic Evolution
and Biodiversity, National Museum of Natural History,
Paris, France.
Distribution. Madagascar, Sahafanjana [16°32’28.9” S,
49°47°02.4” E] (Fig. 7).
Exphora kalalaoensis Junkiert & Walczak sp. nov.
(Figs 1B, 2B, 3B, 8-9)
urn: |sid:zoobank. org: act: EZCE 1LAF'5-08 FC-4E67-B41F-D297F91973F5
Material examined
Holotype
1 ¢/ Exphora kalalaoensis sp. nov. / Junkiert & Walczak
det. 2018 [red label]; Ile Sainte Marie / forét de Kalalao
/ III-60 Andria R. [white label]; INSTITUT / SCIEN-
TIFIQUE / MADAGASCAR [light green label]; Coll.
R.LSc.N.B. [blue label] (RBINS).
Paratypes
2 63,1 9 / Exphora kalalaoensis sp. nov. / Junkiert &
Walczak det. 2018 [red label]; Ile Sainte Marie / forét
de Kalalao / III-60 Andria R. [white label]; INSTITUT /
©ZFMK
24 Lukasz Junkiert et al.
0.5mm
Fig. 8. Male genitalia of Exphora kalalaoensis sp. nov. A. Aedeagus, lateral view. B. Anal tube, dorsal view. C. gonostyl, lateral
view.
Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 25
SCIENTIFIQUE / MADAGASCAR [light green label];
Coll. R.I.Sc.N.B. [blue label] (RBINS).
Description
Body length 10.7—11.1 mm.
Head. Metope almost twice as long as wide, lateral
margins slightly arched and extended laterally at level of
3/4 in its lower part, then narrowing to metopoclypeal
suture. Dorsal margin of metope weakly arcuately
but distinctly concave. Median keel distinct, running
through metope and metopoclypeal suture (Fig. 2B).
Metopoclypeal suture elongate (about 1/4 shorter than
metope) and triangular. Lateral keels present and distinct.
In lateral view, metope distinctly convex, whereas
metopoclypeal suture almost straight, the median keel in
lateral view gently arches over surface of metopoclypeal
suture, and it also protrudes above surface of metope, but
in lateral view it is almost all covered by also protruding
lateral keels. Eyes not quite round (hind edge of the eye
almost straight). Coryphe almost 1.5 times as wide as
long, with anterior margin convex and strongly angular
and posterior margin distinctly arcuately concave.
Pronotum and mesonotum. Pronotum bluntly rounded
anteriorly, distinctly concave posteriorly. Mesonotum
weakly convex, with three parallel keels: median keel is
in its anterior part joined to two slanting lines converging
to each other almost at right angle and thus forming an
arrow-shaped structure. Both edges of arrow are joined
to two lateral keels.
Fore wings. Clavus elongate, reaching almost 2/3 the
length of the whole wing, of hyperpterism type. Costal
area well developed with 12—15 cells between CA and
Pct+CP; ScP+R short; RA two-branched; RP with 6-9
(mostly 7—8) terminals; MP separating before nodal
line; MP1+2 separating before nodal line, 3-4 terminals
(mostly 3), after the last terminal, clearly forked at the
same level as stigma; MP3+4 separating before nodal
line; with 1 terminal; MP4 single, MP3 short, with 1
terminal, separating before nodal line. CuA forking
before nodal line and before MP; two or three transverse
veins connecting CuP and PCu+A1 (one vein connecting
CuP and PCu before joining with Al and one or two
connecting CuP and PCu+A1). Al running parallel to
posterior margin of clavus. Cubital cell at least twice as
long as postcostal cell, radial cell and median cell. Radial
cell separated by a transverse vein. C1 usually separated
by a transverse vein. Cl based well before C2—C5; C2
and C4 in contact sharing MP margin. Cl longer than
C2, C3 and C4, C5 about 2 times longer than C2, C3 and
C4. Seventeen to twenty-one apical cells. Stigma well
visible, including cell created by disjunction of ScP+RA
(with dark brown spot within cell) and 4—5 short veins
running to edge of wing (slightly paler cells) (Fig. 3B).
Bonn zoological Bulletin 70 (1): 15—49
Hind wings. Well developed, 4/5 of the fore wings’
length. Hyaline with brown veins. Almost twice long as
wide in midline (ratio length to width: 2.2—2.4). Twelve
apical cells (Fig. 3B).
Legs. Prothoracic and mesothoracic legs: Femur about
2/3 of tibia length, irregular in cross-section, margins
of femur covered with small bristles, inner margin bear
small spines. Tibiae long and thin, trapezoidal in cross-
section, margins covered with small bristles, lateral
margins with double row of bristles.
Metathoracic legs. Metafemur margins covered with
small bristles. Metatibia twice as long as metafemur,
triangular in cross-section with concave ventral side.
Margins of metatibia covered with small, barely visible
bristles. Lateral margin with four lateral spines, three of
which are distinct and one weakly visible. Metatibiotarsal
formula 8/8/2.
Colouration. General colouration yellowish-brown.
Metope with keels distinctly red, between lateral and
median keels red-brown stripes passing (but thinner than
in the previous species) along the metope. Eyes distinctly
darker than background. Ocelli with delicate rim, blurred
at the back. Posterior margin of pronotum and mesonotum
contoured by a distinct dark line, similar to all darkly
marked convex keels on mesonotum. Lateral margins of
tergites of abdomen brown. Wings hyaline with brown
veins. All legs in the same colour as the rest of the body.
Femur and tibia colouration uniform yellowish-brown,
spines brown, darker than tibia, the sharp end of the spike
black.
Genitalia. Male. Pygofer with hind margin convex.
Aedeagus s.1. U-shaped, robust (thick) in lateral view.
Ventral phallobase reaching half-length of aedeagus.
Each dorso-lateral phallobase lobe with one long apical
finger-shaped process bearing abundant small denticles.
Subapical process smaller and sharp ended. Aedeagus
s.S. with inner part club-shaped, outer part lobate, narrow
on the whole length, slightly sharpened with delicate
indentation on its apical part (Fig. 8A). Anal tube rather
robust, enlarged apically in dorsal view with slightly
convex lateral margin in the middle; anal column short,
about 0.43 times anal tube length (Fig. 8B). Gonostyle
triangle-shaped (but slightly elongated) with smooth
roundish edges, lateral margin of gonostyle slightly
concave; capitulum wide and folded, bearing subapical
spiralling tooth on inner side (Fig. 8C).
Female. Genitalia with anal tube relatively short, broadly
rounded in dorsal view. Gonapophyses VIII (first
valvula) rather triangular, elongated, strongly sclerotized
and bearing two teeth on dorsal margin and one relatively
large tooth, bearing smaller subapical tooth (Fig. 9A).
©ZFMK
26 Lukasz Junkiert et al.
0.5mm
Fig. 9. Female genitalia of Exphora kalalaoensis sp. nov. A. Gonapophyses VIII. B. Gonapophyses IX. C. Anal tube, dorsal view.
Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 27
Gonapophyses VIII not visible externally, covered
by gonoplacs. Gonapophyses IX (second valvular)
confluent with endogonocoxal processes forming
triangular structure (Fig. 9B). Gonoplac (third valvula)
semi-circular in lateral view (Fig. 9C). Median part of
sternite VII with shallow roundish incision in the middle.
Measurements (in mm, females in parentheses). Body
length: 10.13 (10.69-11.0); head width (with eyes):
1.81 (1.89-1.93); metope length: 1.93 (1.90-2.01);
metope width: 1.10 (1.20—1.21); metope length/metope
width ratio: 1.75 (1.58-1.66); coryphe length: 0.49
(0.44—0.48); coryphe width: 0.83 (0.89); coryphe length/
coryphe width ratio: 0.49 (0.44—0.48); fore wing length:
8.34 (9.17-9.25); fore wing width: 3.77 (4.51-4.66);
mesonotum length: 1.81 (1.88—1.97); mesonotum width:
2.01 (2.08-2.27).
Diagnosis. Exphora kalalaoensis sp. nov. can be
distinguished from other species by a stigma which
includes cell created by disjunction of ScP+RA (with
dark brown spot within cell) and 4—5 short veins running
to edge of wing, metope with wide brown stripes, anal
tube with obtuse lateral margins, shape of style, aedeagus
and its processes.
Etymology. The name of species is connected with place
where specimens were collected, Kalalao Forest, Sainte
Marie Island, Madagascar.
Distribution. Madagascar, Nosy Boraha (fr. [le Sainte-
Marie), Kalalao Forest [16°55’32.1” S, 49°53’10.0” E]
(Fig. 7).
Exphora angustivenosa Junkiert & Walczak sp. nov.
(Figs 1C, 2C, 3C, 10-11)
urn: lsid:zoobank. org: act: FSB7097C-68BC-46A3-B8FA-511795E141EF
Material examined
Holotype
1 4 / Exphora angustivenosa sp. nov. / Junkiert & Wal-
czak det. 2018 [red label]; Madagascar / Nosy Komba
[blue label]; Coll. R.I.Sc.N.B. [blue label] (RBINS).
Paratypes
1 4 / Exphora angustivenosa sp. nov. / Junkiert & Wal-
czak det. 2018 [red label]; Coll. R.I.Sc.N.B. / Madagascar
/ Nossi-Be / Ex Coll. Le Moult [green label] (RBINS);
1 9 / Exphora angustivenosa sp. nov. / Junkiert & Wal-
czak det. 2018 [red label]; Coll. R.I.Sc.N.B. / Madagas-
car / Nosy Komba [blue label] (RBINS).
1 9 / Exphora angustivenosa sp. nov. / Junkiert & Wal-
czak det. 2018 [red label]; Coll. R.I.Sc.N.B. [blue label];
INSTITUT / SCIENTIFIQUE / MADAGASCAR [white
label]; Madagascar Sambirano / Nosy-Be / forét de
Lokobe / I-60 / Andria Robinson [white label] (RBINS).
Bonn zoological Bulletin 70 (1): 15—49
Description
Body length 12.35—12.60 mm.
Head. Metope twice as long as wide, lateral margins
slightly arched and extended laterally at level of 3/4 in
its lower part, then narrowing to metopoclypeal suture.
Dorsal margin of metope weakly arcuately but distinctly
concave. Median keel distinct, running through metope
and metopoclypeal suture (Fig. 2C). Metopoclypeal
suture elongate (about 1/4 shorter than metope),
triangular. Lateral keels present and distinct. In lateral
view metope is distinctly convex, whereas metopoclypeal
suture almost straight. Median keel in lateral view gently
arches above the surface of the metopoclypeal suture and
it also protrudes clearly above surface of metope, so that
in lateral view it is still visible, and rather not covered by
slightly protruding lateral keels. The eyes not quite round
(hind edge of the eye almost straight). Coryphe almost
1.5 times as wide as long, with anterior margin strongly
convex and strongly angular, and posterior margin
distinctly and very arcuately concave.
Pronotum and mesonotum. Pronotum bluntly rounded
anteriorly, distinctly concave posteriorly. Mesonotum
weakly convex, with three parallel keels: median keel is
in its anterior part joined to two slanting lines converging
to each other almost at right angle and thus forming an
arrow-shaped structure. Both edges of arrow are joined
to two lateral keels.
Fore wings. Clavus elongate, as long as 2/3 of whole
wing length, of hyperpterism type. Costal area well
developed with 10 or 11 cells between CA and Pc+CP;
ScP+R_ short, separating; RA two-branched; RP with
5-7 terminals; MP separating before nodal line; MP1+2
separating before nodal line, after the third or fourth
terminal, clearly forked at the same level as stigma;
MP3+4 separating, before nodal line; MP4 single, MP3
short, separating before nodal line, after the first terminal.
CuA forking before nodal line and before MP. Two or
three transverse veins connecting CuP and PCu+A1 (one
vein connecting CuP and PCu before joining with Al and
one or two connecting CuP and PCu+A1). Al running
parallel to posterior margin of clavus. Cubital cell at least
twice as long as postcostal cell, radial cell and median
cell. Cl based well before, C2, C3 and C4; C5 starts
at a similar level as Cl; C2 and C4 in contact sharing
MP margin. Cl, C2, C3 and C4 of similar length, C5
about 2 times longer. Eighteen to nineteen apical cells.
Stigma longitudinal and brown, well visible, includes 3-4
(mostly 3) short veins running to edge of wing (Fig. 3C).
Hind wings: Well developed, 4/5 of the fore wings’
length. Hyaline with brown veins. Almost twice long as
wide in midline (ratio length to width: 2.2—2.4). Eleven
apical cells (Fig. 3C).
©ZFMK
28 Lukasz Junkiert et al.
Fig. 10. Male genitalia of Exphora angustivenosa sp. nov. A. Aedeagus, lateral view. B. Anal tube, dorsal view. C. Gonosty], lateral
view.
Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 29
0.5mm 0.2mm
0.2 mm
Fig. 11. Female genitalia of Exphora angustivenosa sp. nov. A. Distal part of abdomen in lateral view. B. Anal tube, dorsal view.
C. Gonapophyses VIII. D. Gonapophyses [X. Gp = gonoplac.
Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK
30 Lukasz Junkiert et al.
Legs. Prothoracic and mesothoracic legs: Femur about
2/3 of tibia length, irregular in cross-section, margins
of femur covered with small bristles, inner margin bear
small spines. Tibiae long and thin, trapezoidal in cross-
section, margins covered with small bristles, lateral
margins with double row of bristles.
Metathoracic legs: Metafemur margins covered with
small bristles. Metatibia twice as long as metafemur,
triangular in cross-section with concave ventral side.
Margins of metatibia covered with small, barely
visible bristles. Lateral margin with four lateral spines,
three of which are distinct and one is weakly visible.
Metatibiotarsal formula 8/8/2.
Colouration. The species is paler than the previous
one. General colouration ochre-lightbrown, metope
with keels distinctly red, between lateral and median
keels red-brown thin stripes passing (much thinner than
the previous two species) passing along the metope.
Eyes darker than background, almost black, ocelli with
delicate rim, blurred at the back. Posterior margin of
pronotum and mesonotum gently contoured by a very
thin dark line, all convex keels on the mesonotum also
darker than the background. Mesonotum at the proximal
part with two small spots, with two larger irregular spots
on each side, and at the distal part with two small but
distinct spots. Lateral margins of tergites of abdomen
light brown. Wings hyaline with red-brown veins. Legs
ochre-lightbrown, metatibial spines of the same colour
except for the tip that is black.
Genitalia. Male. Pygofer with hind margin convex.
Aedeagus s.l. arched, robust in lateral view. Ventral
phallobase not reaching half-length of aedeagus.
Each dorso-lateral phallobase lobe with long fusiform
process reaching the apex of aedeagus, apical process
semi-circularly covered by abundant denticles, the
lateral margin serrate, subapical process absent. Inner
phallobase lobes spatulate, slightly curved, narrow on
the base and wider on apices. Aedeagus s.s. long and
fusiform (Fig. 10A). Anal tube rather robust, enlarged
apically in dorsal view with concave lateral margin and
roundish lateral margins. Anal column length about
0.54 times anal tube length (Fig. 10B). Gonostyle oval,
elongated. Capitulum wide and folded, bearing subapical
tooth on inner side (Fig. 10C).
Female. Endogonocoxal process, well developed,
apical ends roundish, with well visible incision, inner
margin strongly sclerotized. Gonoplac (third valvula)
semi-circular in lateral view (Fig. 11A). Median part
of sternite VII with distinct roundish incision in the
middle. Genitalia with anal tube relatively short, broadly
rounded in dorsal view (Fig. 11B). Gonapophyses VIII
(first valvula) almost trapezoidal, elongated, strongly
Bonn zoological Bulletin 70 (1): 15-49
sclerotized and bearing three teeth on dorsal margin and
one large, long tooth, bearing smaller subapical tooth
(Fig. 11C). Gonapophyses VIII not visible externally,
covered by gonoplacs. Gonapophyses IX (second
valvular) sclerotized, confluent with endogonocoxal
processes (Fig. 11D).
Measurements (in mm, females in parentheses). Body
length: 12.35 (12.60); head width (with eyes): 2.00
(1.93-—2.00); metope length: 2.18 (1.84-2.14); metope
width: 1.28 (1.27—1.30); metope length/metope width
ratio: 1.70 (1.41—1.68); coryphe length: 0.68 (0.60—
0.67); coryphe width: 0.98 (0.83-0.90); coryphe length/
coryphe width ratio: 0.69 (0.72—0.74); fore wing length:
10.46 (10.17—10.99); fore wing width: 5.13 (4.78—5.32);
mesonotum length: 2.40 (2.32—2.36); mesonotum width:
2.25 (2.12—2.15).
Diagnosis. Exphora angustivenosa sp. nov. can
be distinguished by its size (it is bigger than other
representatives of this genus), small brown longitudinal
stigma which includes 34 (mostly 3) short veins running
to edge of wing, metope with thin brown stripes, anal tube
with roundish lateral margins, shape of style, aedeagus
and its processes.
Etymology. The name of species refers to the thin veins
on the fore wings.
Distribution. Madagascar, Nosy Ambariovato, Nosy
Komba [13°28'18.7” S, 48°20°54.2” E]; Nosy Be,
Lokobe Forest [13°23’36.8” S, 48°18°42.4” E] (Fig. 7).
Exphora robusta Junkiert & Walczak sp. nov.
(Figs 1D, 2D, 3D, 12-13)
urn: |sid:zoobank.org:act: 702486 F8-43C2-4845-9AE3-9189D299CEE9
Material examined
Holotype
1 3 / Exphora robusta sp. nov. / Junkiert & Walczak det.
2018 [red label]; Coll. Mus. Tervuren / Madagascar: Ta-
mata / ve: Foul pointe XI- / 1995 A. Pauly [white label |
(RMCA).
Paratypes
1 3,2 99 / Exphora robusta sp. nov. / Junkiert & Wal-
czak det. 2018 [red label]; Coll. Mus. Tervuren / Mad-
agascar: Tamata / ve: Foul pointe XI- / 1995 A. Pauly
[white label] (RMCA).
Description
Body length 9.5—10.25 mm.
Head. Metope twice as long as wide, lateral margins
Slightly arched and extended laterally at level 3/4
in its lower part, then narrowing to metopoclypeal
suture. Dorsal margin of metope very weakly arcuately
©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 31
0.5mm
Fig. 12. Male genitalia of Exphora robusta sp. nov. A. Aedeagus, lateral view. B. Anal tube, dorsal view. C. Gonostyl, lateral view.
Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK
32 Lukasz Junkiert et al.
0.5mm
0.2mm
Fig. 13. Female genitalia of Exphora robusta sp. nov. A. Distal part of abdomen in lateral view. B. Anal tube, dorsal view. C. Go-
napophyses VIII. D. Gonapophyses [X. Gp = gonoplac.
Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 33
concave (almost straight). Median keel distinct, running
through metope and metopoclypeal suture (Fig. 2D).
Metopoclypeal suture elongate, equal to 3/4 of the metope
length, triangular. Lateral keels present and distinct. In
lateral view, the metope is distinctly convex, whereas
the metopoclypeal suture is almost straight. Median keel
gently arches over surface of metopoclypeal suture and
protrudes slightly above surface of the metope, bottom
part is hidden by gently protruding lateral keels. The
eyes rather round (hind edge of the eye almost straight).
Coryphe almost 1.5 times as wide as long, with anterior
margin convex and distinctly angular and posterior
margin distinctly arcuately concave.
Pronotum and mesonotum. Pronotum bluntly rounded
anteriorly, distinctly concave posteriorly. Mesonotum
weakly convex, with three parallel keels: median keel is
in its anterior part joined to two slanting lines converging
to each other almost at right angle and thus forming an
arrow-shaped structure. Both edges of arrow are joined
to two lateral keels.
Fore wings. Clavus elongate, reaching almost 2/3 the
length of the whole wing, of hyperpterism type. Costal
area well developed with 13-14 cells between CA and
Pc+CP; ScP+R short, separating; RA two-branched; RP
with at least 8 terminals; MP separating before nodal
line; MP1+2 separating before nodal line, 3—5 terminals
(mostly 3), after the last terminal, clearly forked at the
same level as stigma; MP3+4 separating, before nodal
line; with 2—3 terminals (sometimes 1); MP4 single, MP3
short, with 1—2 terminals, separating before nodal line,
after the last terminal. CuA forking before nodal line
and before MP; two or three transverse veins connecting
CuP and PCu+A1 (one vein connecting CuP and PCu
before joining with Al and one or two connecting CuP
and PCut+A1). Al running parallel to posterior margin
of clavus. Cubital cell twice as long, or even more, than
postcostal cell, radial cell and median cell. Radial cell
separated by a transvers vein. C1 based well before C2-
C5; C2 and C4 in contact sharing MP margin. Cl longer
than C2, C3 and C4, C5 about 2 times longer than C2, C3
and C4. Nineteen to twenty one apical cells. Stigma well
visible, includes cell created by disjunction of ScP+RA
(with dark brown spot within cell) and 4 short veins
running to edge of wing (slightly paler cells) (Fig. 3D).
Hind wings. Well developed, 4/5 of the fore wings’
length. Hyaline with brown veins. Almost twice long as
wide in midline (ratio length to width: 2.2—2.4). Thirteen
apical cells (Fig. 3D).
Legs. Prothoracic and mesothoracic legs: Femur about
2/3 of tibia length, irregular in cross-section, margins
of femur covered with small bristles, inner margin bear
small spines. Tibiae long and thin, trapezoidal in cross-
Bonn zoological Bulletin 70 (1): 15—49
section, margins covered with small bristles, lateral
margins with double row of bristles.
Metathoracic legs. Metafemur margins covered with
small bristles. Metatibia twice as long as metafemur,
triangular in cross-section with concave ventral side.
Margins of metatibia covered with small, barely
visible bristles. Lateral margin with four lateral spines,
three of which are distinct and one is weakly visible.
Metatibiotarsal formula 8/8/2.
Colouration. General colouration brown, metope with
keels distinctly red, between lateral and median keels
red-brown thin stripes passing along the metope. Eyes
darker than background, almost black, ocelli darker
than background, without rim. The hind edge of the
pronotum and mesonotum is contoured by a distinct
dark line, similar like all dark marked convex keels on
the mesonotum. Lateral margins of tergites of abdomen
brown. Wings hyaline with brown veins. Legs brown like
the rest of the body. Metatibial spines dark brown with
black tip.
Genitalia. Male. Pygofer with hind margin convex.
Aedeagus s.l. falcate in lateral view. Ventral phallobase
overreaching half-length of aedeagus. Each dorso-lateral
phallobase lobe with one long apical finger-shaped
process bearing very small denticles. Subapical process
smaller and slightly curved. Inner part of ventral process
(aedeagus s.s.) short and robust, duck-head shaped,
outer part finger-shaped with apical process and smaller
triangular subapical well visible process (Fig. 12A). Anal
tube rather robust, weakly narrowed basally and enlarged
apically in dorsal view with two horn-like edges. Anal
column elongated, about 0.5 times anal tube length
(Fig. 12B). The dorsal and lateral margins of gonostyle
form a right angle, ventral margin oval; capitulum
folded, bearing subapical spiralling tooth on inner side
(Fig.12C).
Female. Endogonocoxal process, well sclerotized with
slightly rounded apex. Gonoplac (third valvula) semi-
circular in lateral view (Fig. 13A). Median part of
sternite VII with distinct, wide triangular incision in the
middle. Genitalia with anal tube relatively short, broadly
rounded in dorsal view (Fig. 13B). Gonapophyses VIII
(first valvula) rather short, almost trapezoidal, strongly
sclerotized and bearing three short teeth on dorsal
margin and one relatively large tooth, bearing smaller
subapical tooth (Fig. 13C). Gonapophyses VII not
visible externally, covered by gonoplacs. Gonapophyses
IX (second valvular) sclerotized, confluent with
endogonocoxal processes, forming _ bell-mouthed
immersion (Fig. 13D).
©ZFMK
34 Lukasz Junkiert et al.
Fig. 14. Exphora linnavuorii. A. Lateral habitus. B. Green form of E. /innavuorii.
Measurements (in mm, females in parentheses). Body
length: 9.48 (10.04—10.24); head width (with eyes): 1.73
(1.66-1.77); metope length: 1.90 (1.86—-1.90); metope
width: 0.98 (1.09-1.24); metope length/metope width
ratio: 1.94 (1.50—1.74); coryphe length: 0.43 (0.44—
0.49); coryphe width: 0.85 (0.82—0.92):; coryphe length/
coryphe width ratio: 0.50 (0.53—0.54); fore wing length:
8.52 (8.41-8.63); fore wing width: 4.26 (3.92-4.41),;
mesonotum length: 1.81 (1.96—2.02); mesonotum width:
2.17 (2.10-2.12).
Diagnosis. Exphora robusta sp. nov. can be distinguished
by its size (it is smaller and more robust than other species
of this genus), brown rounded stigma which includes
four short veins running to edge of wing (colouration is
slightly paler on those cells), metope with wide brown
stripes, horned anal tube, shape of style, aedeagus and
its processes.
Etymology. The name is given according to the robust
appearance of the body of this species.
Distribution. Madagascar, Toamasina, Tamatava
[18°0805.0” S, 49°22°00.9” E] (Fig. 7).
Bonn zoological Bulletin 70 (1): 15-49
Exphora linnavuorii — description of the new colour
form (Fig. 14)
Material examined
1 3 / Exphora linnavuorii / Junkiert & Walczak det. 2018
[red label]; Coll. R.I.Sc.N.B. / Madagascar (2090m) /
Plateau Soaindrana [blue label] (RBINS).
Description
Description consistent with the holotype of Exphora
linnavuorii Junkiert, Walczak & Bourgoin 2017. Unlike
the type specimen whose body is ochre-light brown
(metope with keels distinctly red), this form has a light
green body throughout (metope with keels distinctly
reddish). Wings hyaline, with green veins (veins of
the type specimen are light brown). Legs of the type
specimen are ochre-light brown (anterior and median
legs with darker colour shade), while this form has light
green legs with spikes on metatibiae in the same colour
as the leg and the sharp end of the spike 1s black.
Measurements (in mm, only male). Body length: 9.63;
head width (with eyes): 1.61; metope length: 1.72:
metope width: 0.97; metope length/metope width ratio:
1.77; coryphe length: 0.47; coryphe width: 0.69; coryphe
length/coryphe width ratio: 0.68; fore wing length:
©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 3D
Fig. 15. Scanning electron micrographs of Exphora angustivenosa sp. nov., male. A. Entire view of the compound eye. B. Trichoid
sensilla (TS) between different ommatidia. C. Antenna, lateral view. D. Sensory plate organ on antennal pedicel surface. Chl =
sensillum chaeticum type I; fl = flagellum; pe = pedicel; PO = plate organ; sc = scape; SD = sclerotized denticles. Scale bars: A =
300 um; B = 20 um; C = 100 um; D = 30 um.
8.02; fore wing width: 3.43; mesonotum length: 1.90;
mesonotum width: 2.10.
Distribution. | Madagascar, Plateau Soaindrana
panes 13.2 eS.47 70271867 "E| (Rig. 2)
Ultrastructural characters
The terminology used for specific parts of the body and
sensilla is taken from Bourgoin and Deiss (1994), Brozek
and Bourgoin (2013) and Schubnel et al. (2019). The use
of a scanning microscope allowed to visualize some in-
Bonn zoological Bulletin 70 (1): 15—49
teresting structures that have not been presented for mem-
bers of the genus Exphora so far. The images show what
the compound eye looks like (Fig. 15A) and how trichoid
sensilla are arranged on it (Fig. 15B). They are not evenly
distributed and do not adhere to each ommatidium. The
antennal pedicel is short and knobbed, with over a dozen
sensory plate organs (Fig. 15C). Moreover, the antennae
are covered with numerous sensilla chaetica type I, as
well as shorter hairs with rounded ends (Fig. 15D). In
figure 15C, the flagellum is broken at the base. Figure
16 shows the whole head in lateral view, with marked
©ZFMK
36 Lukasz Junkiert et al.
Fig. 16. SEM image of Exphora angustivenosa sp. nov., male.
Head, lateral view. An = antenna; Cl = clypeus; Lb = labium;
Lm = labrum; Sf= stylet fascicle; I-V = segments of labium.
structures, in particular the subsequent segments of the
labrum.
Each metatarsomere is covered with numerous, long
trichobothria (Fig. 17). Distal margins of each metatar-
somere bear spikes with longitudinal reticulation. Metat-
ibiae are provided with distinct spines (4 or 5, depending
on the species) and sensilla chaetica type II (Fig. 18).
Figure 19 presents the ventral surface of the fore wing
with description of particular veins and cells, correspond-
ing to the descriptions given above. The SEM images
Bonn zoological Bulletin 70 (1): 15-49
Fig. 17. SEM image of Exphora angustivenosa sp. nov., male.
Tarsus of hind leg, lateral view. Abbreviations after Liang 2017:
ar = arolium; cl = claw; dst = dorsal seta on tarsus; Isc = lateral
seta on claw; Ist = lateral seta on tarsus; mt I, II and III = meta-
tarsomeres I, II, and III, respectively. Scale bar: 100 um.
show that in this group of tropiduchids, the pterostigma
is not a structural character, but corresponds to an area
of pigmentation of certain cells and veins. On the ven-
tral side of the fore wing, a micro-sculpture on the veins
is noticeable, which may have a strengthening function
(Fig. 20A,B). On the dorsal side of the fore wing, sensilla
chaetica type II occur only on the margin of the wing,
while on the ventral side they occur all over the margin
and on the veins of the membrane (Fig. 20C,D). At the
ventral side of the first anal vein (fore wing) campaniform
sensilla (mechanoreceptors) and sensilla chaetica type I
©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 37
are present (Fig. 2OE-F). The area of microtrichia was
found at the costa posterior vein of the fore wing (ven-
tral side) (Fig. 21A—D). Examination of the area where
the wing is attached to the body (Fig. 22A) showed that
the thorax has a special depression where the postcubitus
bulla (Fig. 22B) is hidden when the wings are folded on
the body. In addition, the area of microtrichia at the me-
sopleuron has also been observed, and — while the wings
are placed on the body — this area is 1n contact with the
area of microtrichia at the costa posterior vein of the fore
wing (Fig. 22C—D). Figure 23 presents how tegula and
basal part of the wing look like, when the fore wing is
placed on the body.
oe
" a
- a e-
? rae » ae
etn tere ree?
x pact a ae
Pg as
+
tt:
The hind wing is covered dorsally with sensilla chaeti-
ca type IJ on each vein (the jugal area was rolled up under
the wing so it cannot be seen in the picture) (Fig. 24). The
SEM pictures of both wings show the hamuli in Exphora
that allow the wings of insects to remain connected in
flight (Fig. 25). For members of the genus Exphora, the
hamuli take the form of a fold at the edge of both wings.
A higher magnification shows that the hamuli on the hind
wing is covered with spines (Fig. 26A—B). A cuticular
micro-sculpture of the fused veins (ScP+R+M) on the
proximal part of the hind wing (Fig. 26C—D) was also
observed.
rear.
Sep, Sie
pe a, *
Fig. 18. SEM image of Exphora angustivenosa sp. nov., male. Spine of tibia (hind leg), ventral view. Ch2 = sensillum chaeticum
type II.
Bonn zoological Bulletin 70 (1): 15—49
©ZFMK
38 Lukasz Junkiert et al.
Ge ci.
\
—_— ‘i
.
= f has ia,
at ee 5
i : 3 i ae
* f
™ P
— he / :
a wa me i x
. ‘, i
. a /
. - + d
= “s : : ™, ee
; .
f
presto —< fe é .
i ee é
: é Wm Cc
a C2
—_ f oe = Me rice =
= : .
aa eae
ao RP A
C2 i radial cell
f
a ———
= —
medial cell —
ae
-~ cubital cell
Fig. 19. SEM image of Exphora angustivenosa sp. nov., male. Fore wing, ventral view. Al = first anal vein; A2 = second anal vein;
bc = basal cubital; CA = costa anterior; CP = costa posterior; CuA = cubitus anterior; CuP = cubitus posterior, MP = media poste-
rior; RP(+MA) = radius posteriori (+media anterior); SCP+R(MA) = subcosta posterior + radius (with media anterior); ScP+RA =
subcosta posterior + radius anterior.
Each metacoxa presents a protrusion shaped as a spine
(Fig. 27A—-B). At higher magnification, a dense pad of
microtrichia can be observed (Fig. 27C—D).
REFERENCES
Bahar P, Davranoglou LR, Chtond D (2016) A New species of
Henicocephaloides from Eastern Madagascar (Hemiptera:
Heteroptera: Reduviidae). Entomologica Americana 122
(1-2): 238-244
Bourgoin T (2020) FLOW (Fulgoromorpha Lists on The Web):
a world knowledge base dedicated to Fulgoromorpha. Ver-
sion 8, updated [01.07.2020]. Online at http://www. hemip-
tera-databases.org/flow/ [last accessed 27 Dec. 2020]
Bourgoin T, Deiss V (1994) Sensory plate organs of the antenna
in the Meenoplidae—Kinnaridae group (Hemiptera: Fulgoro-
morpha). International Journal of Insect Morphology and
Embryology 23: 159-168
Bourgoin T, Wang RR, Asche M, Hoch H, Soulier-Perkins A,
Stroinski A, Yap S, Szwedo J (2015) From micropterism to
hyperpterism: recognition strategy and standardized homol-
ogy-driven terminology of the fore wing venation patterns in
planthoppers (Hemiptera: Fulgoromorpha). Zoomorphology
134 (1): 63-77
Brozek J, Bourgoin T (2013) Morphology and distribution of
the external labial sensilla in Fulgoromorpha (Insecta: He-
miptera). Zoomorphology 132: 33-65
Chtond D, Rédei D, Banary P (2016) A new species of the Mada-
gascan genus Physoderoides (Hemiptera: Heteroptera: Redu-
viidae: Physoderinae). Entomologica Americana 122 (1-2):
245-250
Bonn zoological Bulletin 70 (1): 15—49
Constant J (2014) Revision of the Malagasy lanternfly genus
Belbina Stal, 1863, with two new species (Hemiptera: Ful-
goromorpha: Fulgoridae). European Journal of Taxonomy
102: 1-37
Couri MS, Pont AC, Penny ND (2006) Muscidae (Diptera) from
Madagascar: identification keys, descriptions of new species,
and new records. Proceedings of the California Academy of
Sciences 57 (4): 799-923
Davranoglou RL, Mortimer B, Taylor GK, Malenovsky I (2019)
On the morphology and possible function of two putative vi-
broacoustic mechanisms in derbid planthoppers (Hemiptera:
Fulgoromorpha: Derbidae). Arthropod Structure and Devel-
opment 52: 100880
Fennah RG (1978) The higher classification of the Nogodin-
idae (Homoptera, Fulgoroidea) with the description a new
genus and species. Entomologist’s Monthly Magazine 113:
113-119
Glaw F, Kohler J, Townsend TM, Vences M (2012) Rivaling the
World’s Smallest Reptiles: Discovery of Miniaturized and
Microendemic New Species of Leaf Chameleons (Brooke-
sia) from Northern Madagascar. PLoS One 7(2): e31314. ht-
tps://doi.org/10.1371/journal.pone.0031314
Gnezdilov VM (2007) On the systematic position of the Bla-
dinini Kirkaldy, Tonginae Kirkaldy, and Trienopinae Fen-
nah (Homoptera, Fulgoroidea). Zoosystematica Rossica 15:
293-297
Gnezdilov VM (2013) Contribution to the taxonomy of the
family Tropiduchidae Stal (Hemiptera, Fulgoroidea) with de-
scription of two new tribes from Afrotropical Region. Deut-
sche Entomologische Zeitschrift 60 (2): 179-191
Gnezdilov VM (2015) Madagascan Caliscelidae (Hemiptera,
Fulgoroidea): Current Knowledge and Description of a New
Genus and Species. African Invertebrates 56 (3): 739-746
©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 39
Fig. 20. SEM image of Exphora angustivenosa sp. nov., male. A-B. Micro-sculpture on the veins of the fore wing. C—D. Sensilla
chaeticum type II occurring on the ventral side of the fore wing, mainly at distal part of the wing as well as costa anterior and costa
posterior veins. E. Campaniform sensillum. F. Sensillum chaeticum type I, both at ventral side of the first anal vein (fore wing).
Chl = sensillum chaeticum type I; Ch2 = sensillum chaeticum type II (after Wang et al. 2018); CS = campaniform sensillum.
Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK
40 Lukasz Junkiert et al.
Fig. 21. SEM image of Exphora angustivenosa sp. nov., male. A-D. Different views of the area of microtrichia at costa posterior
(CP) of fore wing (ventral view).
Gnezdilov VM, Bartlett CR, Bourgoin T (2016) A new tribe of
Tropiduchidae (Hemiptera: Fulgoroidea) with revision of the
genus Buca and description of asymmetric hind leg spinula-
tion. Florida Entomologist 99 (3): 406-416
Gnezdilov VM, Bourgoin T (2015) New Genera and New
Species of the Tribe Elicini (Hemiptera: Fulgoroidea: Tropi-
duchidae) with Key to Tropiduchid Genera Known from
Madagascar. Annales Zoologici 65 (4): 599-618
Goodman SM, Benstead JP (2003) The Natural History of
Madagascar. University of Chicago Press, Chicago / London
Jacobi A (1917) Die Zikadenfauna Madagascars und der Co-
moren. In: Jacobi A (ed) Voeltzkow‘s Reise in Ostafrika
Vol 3. Schweizerbart’sche Verlagsbuchhandlung, Stuttgart:
519-552
Bonn zoological Bulletin 70 (1): 15—49
Junkiert L, Walczak M (2015) Three new species of the genus
Exphora Signoret, 1860 (Hemiptera, Fulgoromorpha, Tropi-
duchidae) from Madagascar. Zootaxa 3926 (1): 129-136
Junkiert L, Walczak M, Bourgoin T (2017) A new species of
the genus Exphora Signoret, 1860 from Madagascar (He-
miptera: Auchenorrhyncha: Fulgoromorpha: Tropiduchidae).
Entomologica Americana 122 (3): 495-501
Kment P (2013) Carduelicoris stehliki, anew genus and species
of Pentatomidae (Hemiptera: Heteroptera) from Madagascar.
Acta Musei Moraviae, Scientiae biologicae 98 (2): 415-432
Lallemand V (1950) Contribution a I’étude des Homopteres de
Madagascar. Mémoires de |’Institut des Sciences de Mada-
gascar (Series A) 4 (1): 83-96
©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 4]
Cy
i fag tis tdetcere
or
focerseeselae
-e
Sot
Fig. 22. Stereoscopic microscope and SEM images of Exphora bourgoini sp. nov. and E. angustivenosa sp. nov. A. Stereoscopic
microscope image of the area where the wing is attached to the body (£. bourgoini sp. nov., male). Circumflex (“) indicates post-
cubitus bulla, i.e., the processus, which is located at the ventral side of fore wing, between cubitus anterior and cubitus posterior.
* indicates the area of microtrichia at mesopleuron. B. SEM image of processus at the ventral side of fore wing (E. angustivenosa
sp. nov., male). C. SEM image of the area of microtrichia at mesopleuron. D. Area of microtrichia at higher magnification. am =
area of microtrichia at costa posterior; bc = basal cubital; PCuB = postcubitus bulla.
Melichar L (1898) Monographie der Ricaniiden (Homoptera).
Annalen des k.k Naturhistorischen Hofmuseums 13: 197—
359.
Melichar L (1906) Monographie der Issiden. (Homoptera). Ab-
handlungen der K. K. Zoologisch-botanischen Gesellschaft
in Wien 3: 1-327
Melichar L (1915) Monographie der Lophopinen. Annales His-
torico-Naturales Musei Nationalis Hungarici 13: 337-385
Olivieri G, Zimmermann E, Randrianambinina B, Rasolohar-
yaona S, Rakotondravony D, Guschanski K, Radespiel U
Bonn zoological Bulletin 70 (1): 15-49
(2007) The ever-increasing diversity in mouse lemurs: Three
new species in north and northwestern Madagascar. Molecu-
lar Phylogenetics and Evolution 43 (1): 309-327
Schubnel T, Desutter-Grandcolas L, Legendre F, Prokop J, Ma-
zurier A, Garrouste R, Grandcolas P, Nel A (2019) To be or
not to be: postcubital vein in insects revealed by microto-
mography. Systematic Entomology 45 (2): 327-336
Signoret V (1860) Faune des hémipteres de Madagascar. lére
partie. Homopteres. Annales de la Société Entomologique de
France 3 (8): 177-206
©ZFMK
A? Lukasz Junkiert et al.
Fig. 23. Stereoscopic microscope image of tegula and basal part
of wing of Exphora bourgoini sp. nov., male. bc = basal cubital;
CA = costa anterior.
Pc+C+ScA
““ScP¢R+MA.
=
a
AP
StroinskiA, Gnezdilov VM, Bourgoin T (2011) Sub-brachypter-
ous Ricaniidae (Hemiptera: Fulgoromorpha) of Madagascar
with morphological notes for these taxa. Zootaxa 3145: 1—70
Swierczewski D, Bourgoin T, Stroinski A (2016) Revision of
the Madagascan genus Paraflata (Hemiptera: Fulgoromor-
pha: Flatidae), with notes on planthopper hosts parasitized by
epipyropidae moths. Annales Zoologici 66 (1): 57-82
Synave H (1966) Homopteres de Madagascar. Verhandlungen
der Naturforschenden Gesellschaft in Basel 77: 55—75
Szwedo A, Drohojowska J, Popov Y, Simon E, Wegierek P
(2019) Aphids, true hoppers, jumping plant-lice, scale in-
sects, true bugs and whiteflies (Insecta: Hemiptera) from the
Insect Limestone (latest Eocene) of the Isle of Wight, UK.
Earth and Environmental Science Transactions of the Royal
Society of Edinburgh 1—66
Szwedo J, Stroinski A (1999) Redescription of Tritophania pa-
truelis Jacobi, 1938 from Eocene Baltic amber (Hemiptera:
Nogodinidae). Annales Zoologici Warszawa 49 (3): 203—207
Thalmann U, Geissmann T (2005) New species of woolly le-
mur Avahi (Primates: Lemuriformes) in Bemaraha (Central
: ~
500 pm
Fig. 24. SEM image of Exphora angustivenosa sp. nov., male. Hind wing, dorsal view. Abbreviation after Davranoglou et al. 2019:
AA = anal anterior; AP = anal posterior; cv = cross-vein; CuA = cubitus anterior; CuP — cubitus posterior, MP = media posterior;
Pc+C+ScA = postcubitus + costat+ subcostal anterior; SCP+R+MA = subcosta posterior + radius + media anterior.
Spinola M (1839) Essai sur les Fulgorelles, sous-tribu de la tri-
bu des Cicadaires, ordre des Rhyngotes. Annales de la So-
ciété Entomologique de France 8: 133-337
Stal C (1861) Nova methodus familias quasdam Hemipterorum
disponendi genera Issidarum synoptice disposita. Ofversigt
af Kongliga Svenska Vetenskaps-Akademiens Foérhandlingar
18: 195-212
Stal C (1866) Hemiptera Homoptera Latr. Hemiptera Africana
Vol 4. Officina Norstedtiana, Stockholm, Sweden
Bonn zoological Bulletin 70 (1): 15-49
Western Madagascar). American Journal of Primatology 67
(3): 371-376
Urban JM, Cryan JR (2006) Evolution of the planthoppers (In-
secta: Hemiptera: Fulgoroidea). Molecular phylogenetics
and evolution 42: 556-572
Vences M, Wollenberg KC, Vieites DR, Lees DC (2009) Mada-
gascar as a model region of species diversification. Trends in
Ecology and Evolution 24 (8): 456-465
©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 43
Fig. 25. SEM image of Exphora angustivenosa sp. nov., male. A. Fore wing (ventral view). B. Hind wing (dorsal view) hamuli (*),
located along both wing margins.
Fig. 26. SEM images of Exphora angustivenosa sp. nov., male. A. Hind wing (dorsal view) hamuli. B. Higher magnification view
of hamuli with spines (sp). C. General view of the fused veins (ScP+R+M) on the proximal part of hind wing. D. Cuticular mi-
cro-sculpture of the fused veins on the proximal part of hind wing. ScP+R+M = subcosta posterior + radius + media; sp = spines.
Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK
44 Lukasz Junkiert et al.
coxal
protrusion
=
c a=
4 8 Ps 4
SRS Yeo
> 6a} & ae gg
Fig. 27. Stereoscopic microscope and SEM images of Exphora bourgoini sp. nov. and E. angustivenosa sp. nov.
A. Stereoscopic microscope image of the third coxa with coxal protrusion (E£. bourgoini sp. nov., male). B. SEM
image of the third coxa with coxal protrusion (E. angustivenosa sp. nov., male). C—D. The coxal protrusion at higher
magnification, covered with densely packed microtrichia.
Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 45
APPENDIX I.
Key to the species of Exphora
— Exphora longipennata Exphora fumivenosa Exphora perinetensis
Metope distinctly enlarged over clypeus
at almost right angle, with two rows of
s
on
ar]
o)
=)
vo
oy
Pterostigma small, includes 1-3 cells, | Pterostigma large, well visible, includes} Fore wing with dark brown transvers
without distinct dark spot at cell Cla |more than 3 cells, with distinct dark spot} veins; pterostigma small, barely visible,
(cell Cla is missing) at cell Cla; fore wing with dark brown | includes 1-3 cells, without distinct dark
transvers veins spot at cell Cla
Costal cells number — 7-8 Costal cells number — 8-9 Costal cells number — 9-10
Apical cells number — 16-17 Apical cells number — 15+1 Apical cells number —17+1
Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK
46 Lukasz Junkiert et al.
| Exphora similis | Exphora succinae___|—__Exphora linnavuorii__|
Pterostigma small, barely visible, Pterostigma small, barely visible,
spot at cell Cla spot at cell Cla
Costal cells number — 10-11 Costal cells number — 8-10
Apical cells number — 17-19 Apical cells number — 14-17
z
on
Ss
5
ae)
uP)
_—
[oF
wn
=
oO
1o)
aedeagus
Apical part of aedeagus with long Apical part of aedeagus with long
needle-like processes directed needle-like processes directed
dorsall
Bonn zoological Bulletin 70 (1): 15-49
Pterostigma small, barely visible,
spot at cell Cla
Costal cells number — 7-8
includes 1-3 cells, without distinct dark | includes 1-3 cells, without distinct dark | includes 1-3 cells, without distinct dark
Apical cells number —15-17
Lateral lobes without additional
processes
©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 47
Exphora angustivenosa
pterostigma
gs
Pterostigma small, barely visible,
includes 1-3 cells, without distinct dark
spot at cell Cla
Costal cells number — 10-12
Apical cells number — 18+1
aedeagus
Aedeagus s.1. well developed, lateral
lobes with small spikes (1), inner lobes
spatulate (2
Bonn zoological Bulletin 70 (1): 15—49
Exphora ifanadiensis
r |
Z lal
Pterostigma large, well visible, includes
more than 3 cells, with distinct dark spot
at cell Cla
Costal cells number — 9-13
Apical cells number — 18-19
Aedeagus s.l. well developed, lateral
lobes with small spikes (1), inner lobes
Exphora constanti
J ; ia
Pterostigma large, well visible, includes
more than 3 cells, with distinct dark spot
at cell Cla
Costal cells number — 11-13
Apical cells number — 20-22
Apical part of lateral lobes with finger-
like shaped processes (1), inner lobes
with two bulges (2
©ZFMK
48 Lukasz Junkiert et al.
|| Exphora ambatolaonaensis Exphora stroinskii Exphora bourgoini
- ee Ai 4
Pterostigma large, well visible, includes
more than 3 cells, with distinct dark spot
at cell Cla
Costal cells number — 10-11 Costal cells number — 10-12 Costal cells number — 11+1
Apical cells number — 18-19 Apical cells number — 18-20 Apical cells number — 18+1
E
of
oa
wn
2)
=)
vo
~_
oO.
wn
Oo
oO
Aedeagus s.l. narrow, apical part of | Apical part of lateral lobes with finger- | Apical part of lateral lobes with finger-
lateral lobes with spiky ending (1) like shaped processes (1), inner lobes | like shaped processes (1), inner lobes
like shaped (2
Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK
New species of Exphora (Hemiptera: Tropiduchidae) 49
| Exphora guerini Exphora robusta Exphora kalaloensis
3 a a
( ln > ome
ARH tie ee
Tippee ene
|
Pterostigma large, well visible, includes | Pterostigma large, well visible, includes | Pterostigma large, well visible, includes
more than 3 cells, with distinct dark spot
at cell Cla
Costal cells number — 10-12 Costal cells number — 12-13 Costal cells number — 12-14
Apical cells number — 19+1 Apical cells number — 19-21 Apical cells number — 20+1
ne]
Ss
iB)
a=
E
or8)
oa
wm
oe)
ta
o
_
oF
wn
oP)
2)
Apical part of lateral and inner lobes
with small spikes (1), inner lobes spikes and finger-like shaped processes | of lateral lobes with finger-like shaped
extended in apical part (2); apical (1), inner lobes with distinct spiky processes (1); aedeagus s.s. robust and
process of aedeag as subapical knobed (2
Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 70 (1): 51-65
2021 - Saigusa T. & Sinclair B.J.
https://do1.org/10.20363/BZB-2021.70.1.051
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:Isid:zoobank.org:pub:37C79C19-FAF6-4900-BB9B-7D43EC1 AE371
Revision of the 7richoclinocera yixianensis species-group from eastern Asia
(Diptera: Empididae: Clinocerinae)
Toyohei Saigusa! & Bradley J. Sinclair?”
'7. 1-402 Baikoen 2-chome, Chuo-ku, Fukuoka-shi 810-0035, Japan
?Canadian National Collection of Insects & Canadian Food Inspection Agency, OPL-Entomology, K.W. Neatby Bldg., C.E.F.,
960 Carling Ave., Ottawa, ON, Canada KIA 0C6
“Corresponding author: Email: [email protected]
'urn:lsid:zoobank.org:author:390F7B 16-1 B9D-419F-BOCD-F3279B89DF 1D
>urn:Isid:zoobank.org:author:45 16327F-B73E-456C-927F-18EFBOB9E08B
Abstract. The 7richoclinocera yixianensis species-group from eastern Asia is revised and includes five species: 7. emotoi
sp. nov., 7! maculata sp. nov., T. nakanishii sp. nov., T: pakistanensis sp. nov. and 7: yixianensis Li & Yang, 2009. A key
to all five species is provided and their distributions mapped.
Key words. Aquatic dance flies, Empididae, Diptera, Bhutan, China, Nepal, Pakistan.
INTRODUCTION
Adults of the genus Trichoclinocera Collin, 1941 (Dip-
tera: Empididae: Clinocerinae) are normally encountered
on emergent rocks in large streams and rivers (Saigusa &
Sinclair 2016), usually where the riparian vegetation is
open overhead (Sinclair 1994). Larvae inhabit the riffle
zones, moving among the rocks and moss and the imma-
ture stages have been described (Sinclair 1994; Lanning
et al. 2020). Prior to this study, there were 40 described
species found in the Nearctic, Palearctic and Oriental
Regions (Yang et al. 2007; Li & Yang 2009; Sinclair &
Shamshev 2014; Saigusa & Sinclair 2016; Sinclair et al.
2020).
This is third in a series of papers revising the eastern
Asian species of Trichoclinocera. The first contribution
revised the species of the 7? dasyscutellum species-group
and included eight species (Sinclair & Saigusa 2005). The
second study revised the Japanese fauna and included
nine species (Saigusa & Sinclair 2016). In this study, the
species of the Trichoclinocera yixianensis species-group
are revised, presently occurring in Bhutan, China, Nepal
and Pakistan.
MATERIAL AND METHODS
This study is based on material deposited in the following
institutions: Biosystematics Laboratory, Kyushu Univer-
sity, Fukuoka, Japan (KUMEF); and Canadian National
Insect Collection, Ottawa, Canada (CNC). Label data for
primary types are cited from the top downward, with the
Received: 20.01.2021
Accepted: 11.02.2021
data from each label in quotation marks. Labels are cited
in full, with original spelling, punctuation, and date, and
label lines are delimited by a slash (/). The repository of
each type 1s given in parentheses. Secondary type data are
abridged and listed alphabetically.
Methods used in specimen preparation follow Sinclair
(1994, 1995) and Saigusa & Sinclair (2016).
Abbreviations used in the description
acr = acrostichal setulae
dc = dorsocentral setae
dm = discal medial cell
npl = notopleural setae
pal = postalar seta
ph = posthumeral seta
pprn = postpronotal setae
presut spal= presutural supar-alar setae
psut spal = postsutural supra-alar setae
R = radial vein
sctl = scutellar setae
T = tergite
Terms used for adult structures follow those of Cum-
ming & Wood (2017).
Some photographs were taken with a Leica camera
model DFC5400 using Leica Application Suite X. Addi-
tional images were taken using an Olympus SZ60 micro-
scope and camera on Xperia 1011 or Olympus BX-50
and Nikon Coolpix 995 camera. Maps were constructed
by using the location data on the specimen labels. If co-
ordinates were not present on specimen labels, the col-
lection locality data were used to estimate approximate
Corresponding editor: X. Mengual
Published: 18.02.2021
52 Toyohei Saigusa & Bradley J. Sinclair
coordinates, through the use of Google Earth® and Goo-
gle Maps®. SimpleMappr (Shorthouse 2010) was used
to plot the distribution of each species.
TAXONOMY
Trichoclinocera Collin, 1941
Trichoclinocera Collin, 1941: 237. Type species, 7’ stack-
elbergi Collin, 1941 (original designation).
Seguyella Vaillant, 1960: 179 nec Kelsey (1969: 294).
Type species, S. rostrata Vaillant, 1960 (original designa-
tion). Sinclair, 1994: 1012 (synonymy).
Acanthoclinocera Saigusa, 1965: 53. Type species,
A. dasyscutellum Saigusa, 1965 (original designation).
Sinclair, 1994: 1012 (synonymy).
Recognition. Trichoclinocera is distinguished from
other clinocerine genera by the following combination of
characters: R, setose, R, and R, normally nearly parallel,
sal
188 wm
apex of cell dm not strongly produced, M, and M, arising
separately from cell dm, fore femur with rows of ventral
setae; female abdomen truncate, with tergite 9+10 setose
(acanthophorite-like); and apex of phallus membranous,
lacking filament.
Distribution. The genus occurs in the Palearctic, Ne-
arctic and Oriental Regions.
Trichoclinocera yixianensis species-group
Recognition. These are very unusual species of 7ri-
choclinocera, characterized by long spine-like setae at
the base of the fore femora (Figs 3-4), often one-third
to one-half length of the segment; face greatly narrowed,
eyes somewhat narrowed, with facets enlarged antero-
ventrally (Fig. 2), and bacilliform sclerite extending api-
cally beyond base of clasping cercus.
Remarks. Specimens of this group were collected in
seepages and small streams with overhead canopy, in
contrast to broad streams and rivers which are the usual
habitat for Trichoclinocera (see Discussion).
Figs 1—4. Scanning Electron photographs of Trichoclinocera yixianensis Li & Yang. 1. Female head, lateral view. 2. Female head,
anterior view. 3. Male fore femur, anterior view. 4. Female fore femur, anterior view.
Bonn zoological Bulletin 70 (1): 51-65
©ZFMK
Revision of the Trichoclinocera yixianensis species-group from eastern Asia 53
nen NTU eo (
ee
~~.
7 } 8
Figs 5—8. Habitus and forelegs of Trichoclinocera yixianensis species-group. 5. 7’ emotoi sp. nov., male habitus. 6. 7) emotoi
sp. nov., female forelegs. 7. 7’ maculata sp. nov., male habitus. 8. 7’ maculata sp. nov., male forelegs. Scale bars: Figs 6, 8 = 0.5 mm;
Figs 5, 7 = 1.0 mm.
Bonn zoological Bulletin 70 (1): 51-65 ©ZFMK
54 Toyohei Saigusa & Bradley J. Sinclair
Trichoclinocera emotoi sp. nov.
(Figs 5-6, 13, 17-18, 35, 41)
urn: lsid:zoobank.org:act:C258A922-SA4E-458D-923E-096FBIE304FD
Type material. HOLOTYPE <3, labelled: “(E. NE-
PAL)/ Thurukpa (2600m)/ 27°36' N, 87°36' E - - -/ (E.
NEPAL)/ Topke Gola (3700m)/ 27°38' N, 87°35' E”;
“June 12, 1972/ J. Emoto leg./ Kyushu Univ. Col.”;
“THOLOTYPE]/ Trichoclinocera/ emotoi/ Saigusa &
Sinclair [red label]” (KUMF). PARATYPES: NEPAL:
same data as holotype (2 6a’, 2 92, CNC; 3 da, 1 @,
KUME); Penmaten, 2600 m, 27°36' N, 87°36' E / Topke
Gola, 3700 m, 27°38' N, 87°35' E, 30.vi.1973/ H. Ma-
kihara (1 6, KUMF); NE of Thudam, 4000 m, 27°47' N
87°36! E, 25.vi.1972, H. Shima (1 3, CNC).
Recognition. This species is distinguished by the pair
of long spur-like setae mounted on a short tubercle at
the base of the fore femur, greyish legs, clear wings and
clasping cercus with broad U-shaped notch near base.
Description. Wing length 3.64.0 mm. Male. Grey-
blue pruinescence and dark legs (Fig. 5). Head narrowed
ventrally, compound eyes oval; facets enlarged antero-
ventrally. Face greatly narrowed medially, ca. width of
antennal socket, with bright whitish pruinescence; low-
er margin of face straight, lacking cleft and carina; gena
one-seventh as wide as eye height. Frons slightly darker
than face in dorsal view; vertex and ocellar triangle dark
brown, lower postocciput brown, gena lightly pruine-
scent. Ocellar seta longest among cranial setae; occiput
with 3-4 pairs of long setae posterior to ocellar triangle;
postocular with row of short setae along eye margin, up-
per 5—6 setae dark, stouter than lower setae; postgena
with numerous long, white silky setae. Arista-like sty-
lus long and slender, not tapered apically. Palpus short,
pointed apically, ca. one-fourth eye height.
Pleura grey with pale blue pruinescence; scutum grey-
ish brown with somewhat bluish lateral margins, medial-
ly paler brown in posterior view; posterolateral margin of
postpronotal lobe shiny brown; faint black vitta along in-
ner edge of dc; prescutellar depression somewhat bluish
posteromedially in posterior view. Thoracic setae long,
ca. subequal to width of eye; acrostichal setulae lacking:
5-6 dc; O-1 very short, pale pprn, at most one-fourth
length of dc, with 0-2 pale setulae; 1 presut spal; 2 npl;
2 psut spal; 1 pal; 2 pairs sctl and several pale marginal
setulae; several pale setulae on notopleural depression.
Laterotergite with patch of pale setae; prothoracic epi-
sternum with several setulae and 2 long, spine-like setae,
longer than width of fore coxa, shorter seta often pale;
anepisternum with a few pale setulae along posterior
margin; katepisternum with a few minute pale setulae;
hind margin of metepisternum with white setulae.
Wing (Fig. 35) narrow, lightly infuscate, without mark-
ings; pterostigma very narrow, faint, elliptical. One basal
costal seta, two-thirds length of posterior dc. Sparse row
of setulae from base of R to mid-length of R,; auxiliary
Bonn zoological Bulletin 70 (1): 51-65
crossvein lacking; cell dm produced apically; R, and R,
divergent apically; base of R, often with short spur vein.
Halter dark.
Legs dark, coxae with blue pruinescence, concolour-
ous with pleura. Coxae with long, pale marginal setae;
fore coxa with long pale anterolateral setae. Fore femur
(Fig. 6) distinctly swollen on basal half, with pair of setae
mounted on short single tubercle: anterior seta spur-like,
ca. one-half length of femur, posterior seta pale, thinner
and one-half length of anterior seta; anteroventral row of
ca. 20 spine-like setae extending length of femur, length
ca. one-fourth width of femur, decreasing in length api-
cally; 3-4 preapical anterior setae, longer than antero-
ventral setae; row of slender, pale posteroventral setae
extending length of femur, some subequal in length to
width of femur; 2—3 posteroventral, spine-like setae near
mid-length of femur, ca. subequal in length to width of
femur; dense, very short, white pile beneath. Fore tibia
slightly sinuous to arched in shape with row of stout setae
beneath, biserial apically; setae increasing in length api-
cally to width of tibia; row of posterodorsal setae promi-
nent on apical half. Mid femur with slender anteroventral
and posteroventral preapical setae; without anterodorsal
and posterodorsal setae. Hind femur with anteroventral
setae; without anterodorsal and posterodorsal setae. Hind
tibia without posterodorsal spur-like seta near base; 1
erect, spine-like posterodorsal preapical seta. Tarsi long-
er than corresponding tibiae. Empodium pulvilliform,
subequal in length to claw, less than half length of tar-
somere.
Abdomen concolourous with thoracic pleura in lateral
view, with mostly pale setae, darker along posterior mar-
gin. Terminalia (Figs 13, 15-16): hypandrium narrow,
cylindrical, tapered apically, 1.5x length of epandrium;
anterior margin pointed. Phallus extending beyond clasp-
ing cercus; strongly bent sub-basally; shaft narrow with
broad, expanded base; apex with cup-like opening, with
small, round, bulbous membranous swelling, slightly
wider than diameter of apex of phallus; membrane lack-
ing microtrichia; ejaculatory apodeme arched strongly
within base of phallus. Epandrium subtriangular, with
large membranous area at basal margin with hypandrium.
Surstylus slender, two-thirds length of clasping cercus,
lacking apical setae and microtrichia. Clasping cercus
finger-like, tapered on apical half; basal half with broad
U-shaped notch on dorsal margin; long, fine setae on
ventral margin; inner dorsal margin with peg-like setae
along entire length, except in notch.
Female. Similar to male including chaetotaxy of legs.
Terminalia (undissected): Tergite 9+10 with 4 straight
spine-like setae on apical margin.
Distribution. This species is confined to eastern Nepal
known from 2600-4000 m (Fig. 41), often collected to-
gether with 7? maculata sp. nov.
©ZFMK
Revision of the 7richoclinocera yixianensis species-group from eastern Asia 5D
fi €,
Ps
PP
ig
a.
, s
awe
a a
ae ee |
eT a a
nition ‘. J
ATL HE OVI LE. ©
” ~
Figs 9-12. Habitus and forelegs of Trichoclinocera yixianensis species-group. 9. 7. nakanishii sp. nov., male habitus, holotype
(terminalia dissected). 10. 7. nakanishii sp. nov., male forelegs, holotype. 11. 7. pakistanensis sp. nov., male habitus, holotype (ter-
minalia dissected). 12. 7’ pakistanensis sp. nov., male forelegs, holotype. Scale bars: Figs 10, 12 = 0.5 mm; Figs 9, 11 = 1.0 mm.
Bonn zoological Bulletin 70 (1): 51-65 ©ZFMK
56 Toyohei Saigusa & Bradley J. Sinclair
Etymology. The specific epithet is named after Jun
Emoto, the collector of the holotype of this species and
many other valuable specimens.
Trichoclinocera maculata sp. nov.
(Figs 7-8, 14, 19-20, 36, 41)
urn: lsid:zoobank.org:act: 1B720600-8E64-456F-8 BC0-867360561A 19
Type material. HOLOTYPE <j, labelled: “(E. NE-
PAL) Thurukpa (2600m)/ 27°36' N, 87°36' E - - -/ Topke
Gola (3700m)/ 27°38' N, 87°35' E”; “June 12, 1972/ H.
Shima leg./ Kyushu Univ. Col.”; “[HOLOTYPE]/ 7ri-
choclinoceral maculata/ Saigusa & Sinclair [red label]”
(KUMP). PARATYPES: NEPAL: same data as holotype
(1 4, KUMF); same data as holotype except, J. Emoto
(1 3, KUMF); same data as holotype except, 9.vii.1972,
J. Emoto (1 4, CNC); Thudam, 3500-3800 m, 27°45' N
87°31' E-27°46' N 87°33’ E, 18.vi.1972, H. Shima (1 3,
CNC).
Recognition. This species is distinguished by 2-3
long, spine-like setae at the base of the fore femur, grey-
ish legs, spotted wings and auxiliary crossvein between
veins R,,, and R,.
Description. Wing length 3.5—-3.8 mm. Male. Grey-
blue pruinescence and dark legs (Fig. 7). Head narrowed
ventrally, compound eyes oval; facets enlarged antero-
ventrally. Face narrowed medially, narrower than width
of antennal sockets, with bright whitish pruinescence;
lower margin of face with short, narrow cleft, lacking ca-
rina; gena one-eighth as wide as eye height. Frons darker
than face in dorsal view; vertex and ocellar triangle dark
brown, lower postocciput brown, gena lightly pruines-
cent. Ocellar seta longest among cranial setae; occiput
with 3 pairs of long, stout setae posterior to ocellar trian-
gle; postocular with row of short setae along margin of
eye, upper 4—5 setae dark, stouter than lower setae; post-
gena with numerous long, white silky setae. Arista-like
stylus long and stout, slightly tapered apically. Palpus
tapered apically, ca. one-fourth eye height.
Pleura grey with blue pruinescence; scutum grey-
ish-brown with paler lateral margins, medially paler
brown in posterior view, bluish on postalar callus extend-
ing medially; dark vitta along inner edge of dc incon-
spicuous. Thoracic setae long, some subequal to width
of eye; acrostichal setulae lacking; 5 dc, prescutellar pair
longest; 1 short pprn, one-fourth length of dc; 1 presut
spal; 2 npl; 1—2 psut spal; 1 pal; 2 pairs sctl, without set-
ulae; several pale setulae near notopleural depression.
Laterotergite with patch of pale setae; prothoracic epi-
sternum with | dark, spine-like seta and | narrower, pale
seta, longer than width of fore coxa; anepisternum with
setulae along posterior margin; katepisternum and hind
margin of metepisternum without setulae.
Wing (Fig. 36) narrow, infuscate, with bands of cloud-
ing at basal third of wing, across apex of cell dm to R
445?
and base of R, and along auxiliary crossvein. Pterostig-
Bonn zoological Bulletin 70 (1): 51-65
ma very narrow, faint, elliptical; 1 basal costal seta, two-
thirds length of posterior dc. Row of long setulae from
base of R to mid-length of R,; auxiliary crossvein be-
tween R,,, and R,; cell dm truncate apically; R, and R,
nearly parallel-sided, somewhat divergent apically. Hal-
ter dark.
Legs dark, coxae with blue pruinescence, concolourous
with pleura. Coxae with long, dark marginal setae; fore
coxae with row of erect setae along anterolateral margin,
subequal to width of coxa. Fore femur (Fig. 8) distinctly
swollen on basal half, with 2—3 black, spine-like basal
setae, posterolateral seta less than one-fourth length of
femur; anteroventral row of ca. 20 stout, spine-like setae
extending length of femur, length ca. one-fourth width of
femur; 2—3 preapical anterior setae, longer than antero-
ventral setae; row of slender, pale posteroventral setae
extending length of femur, ca. one-half width of femur; 1
spine-like posteroventral seta near mid-length of femur,
subequal in length to basal width of femur; dense, very
short, white pile beneath. Fore tibia straight with row of
stout setae beneath, subequal to width of tibia and an-
teroventral setae of femur. Mid femur with slender an-
teroventral and posteroventral preapical setae; without
anterodorsal and posterodorsal setae. Hind femur with-
out distinct anteroventral setae; with a few anterodorsal
and posterodorsal setae. Hind tibia without posterodorsal
spur-like seta near base; several erect dorsal setae on api-
cal fourth. Tarsi longer than corresponding tibiae. Em-
podium pulvilliform, subequal in length to claw, ca. half
length of tarsomere.
Abdomen concolourous with thoracic pleura in lat-
eral view, with mostly pale setae. Terminalia (Figs 14,
19-20): hypandrium narrow, cylindrical, 1.3x length of
epandrium; anterior margin pointed. Phallus extending
beyond clasping cercus, gently arched; shaft narrow,
without basal expansion; apex with cup-like opening,
with small, tubular membrane; membrane lacking micro-
trichia; ejaculatory apodeme arched strongly anteriorly.
Epandrium with large membranous area at basal margin
with hypandrium. Surstylus slender, two-thirds length of
clasping cercus, lacking apical setae and microtrichia.
Clasping cercus finger-like, tapered throughout length to
rounded apex; base expanded posteriorly; fine setae on
ventral margin; inner dorsal margin with sharp, peg-like
setae along entire length.
Female. Unknown.
Distribution. This species is confined to eastern Ne-
pal known from 2600-3800 m near the Tibet border
(Fig. 41), often collected together with 7’ emotoi sp. nov.
Etymology. The specific epithet 1s from the Latin mac-
ulatus (spot, stain, speckle), in reference to the spotted
wings.
©ZFMK
Revision of the Trichoclinocera yixianensis species-group from eastern Asia 57
cl cerc
Figs 13-16. Male terminalia of Trichoclinocera yixianensis species-group, lateral view. 13. 7. emotoi sp. nov. 14. T. maculata
sp. nov. 15. 7. nakanishii sp. nov. 16. T: pakistanensis sp. nov. Scale bars = 0.1 mm. Abbreviations: cl cerc = clasping cercus; epand
= epandrium; hypd = hypandrium; ph = phallus; sur = surstylus.
Bonn zoological Bulletin 70 (1): 51-65 ©ZFMK
58 Toyohei Saigusa & Bradley J. Sinclair
Figs 17-22. Male terminalia of Trichoclinocera yixianensis species-group, lateral view. 17-18. 7. emotoi sp. nov. 17. Terminalia.
18. Clasping cercus. 19-20. 7. maculata sp. nov. 19. Terminalia. 20. Clasping cercus. 21—22. 7? nakanishii sp. nov. 21. Terminalia.
22. Clasping cercus. Scale bars = 0.1 mm.
Trichoclinocera nakanishii sp. nov.
(Figs 9-10, 15, 21-22, 37, 41)
urn: |sid:zoobank.org:act:6191F 70F-BA02-49F 9-BC5D-2F43ECSBB3CE
Type material. HOLOTYPE <, labelled: “(NE-
PAL)/ Chhouban, Kharka, 3400m/ 83°25' E. 28°43' N./
Sept. 28. 1971/ A. Nakanishi”; “[HOLOTYPE]/ Tricho-
clinoceral nakanishii/ Saigusa & Sinclair [red label] [dis-
sected]” (KUMP).
Recognition. This species is distinguished by three
long spine-like setae at the base of the fore femur, greyish
legs, clear wings, and shape of the clasping cercus.
Description. Wing length 3 mm. Male. Grey-blue pru-
inescence and dark brownish legs (Fig. 9). Head pointed
ventrally, compound eyes oval; facets enlarged antero-
ventrally. Face greatly narrowed medially, ca. width of
antennal socket, with bright whitish pruinescence for full
length; lower margin of face with short, narrow cleft,
lacking carina; gena one-seventh as wide as eye height.
Bonn zoological Bulletin 70 (1): 51-65
Frons greyish brown; vertex and ocellar triangle dark
brown, lower postocciput brown, gena lightly pruines-
cent. Ocellar setae longest among cranial setae; occiput
with 3 pairs of setae posterior to ocellar triangle; post-
ocular with row of short setae along margin of eye, upper
3—4 setae dark, stouter than lower setae. Arista-like stylus
short and stout, not tapered apically. Palpus pointed api-
cally, ca. one-fourth height of eye.
Pleura grey with pale blue pruinescence; scutum
brown, paler medially and on postpronotal lobe, some-
what bluish lateral margins; apex of postpronotal lobe
shiny brown, dark vitta along edge of dc inconspicuous;
prescutellar depression brown in posterior view. Thorac-
ic setae long, ca. subequal to width of eye; acrostichal
setulae lacking; 5 pairs dc; 1 very short pprn, one-fourth
length of dc; 1 presut spal; 2 npl; 1 psut spal; 1 pal; 2
pairs sctl and pairs of pale marginal setulae; several pale
setulae on postpronotal lobe and notopleural depression.
Laterotergite with patch of pale setae; prothoracic epi-
©ZFMK
Revision of the 7richoclinocera yixianensis species-group from eastern Asia 59
26
Figs 23—26. Habitus, forelegs and head of Trichoclinocera yixianensis Li & Yang. 23. Male habitus, lateral view (Shaanxi). 24.
Male forelegs, lateral view (Shaanxi). 25. Male habitus, lateral view (Shaanxi). 26. Female head, anterior view (Shaanxi). Scale
bars: Fig. 26 = 0.5 mm; Figs 23—25 = 1.0 mm.
Bonn zoological Bulletin 70 (1): 51-65 ©ZFMK
60 Toyohei Saigusa & Bradley J. Sinclair
Figs 27-32. Terminalia of Trichoclinocera yixianensis species-group, lateral view. 27—28. 7: pakistanensis sp. nov. 27. Male termi-
nalia, stained with Delafield hematoxyline. 28. Clasping cercus, inner view. 29-30. 7! vixianensis Li & Yang. 29. Male terminalia.
30. Clasping cercus. 31-32. 7! yixianensis Li & Yang. 31. Female terminalia. 32. Close-up of female proctiger. Scale bars: Figs 28,
30 = 0.5 mm; Figs 27, 29, 31-32 = 1.0 mm.
sternum with 1 long, spine-like seta and several pale se-
tae, longer than width of fore coxa; anepisternum with
a few pale setulae on ventral part; katepisternum with a
few minute pale setulae; hind margin of metepisternum
with | white setula.
Wing (Fig. 37) narrow, lightly infuscate, without mark-
ings; pterostigma very inconspicuous, possibly lacking.
One basal costal seta, one-half length of posterior dc.
Sparse row of setulae from base of R to mid-length of R,;
auxiliary crossvein lacking; cell dm produced apically:
R, and R, divergent. Halter knob dark, base of shaft paler.
Legs dark, brownish; coxae with blue pruinescence,
concolourous with pleura. Coxae with long, pale margin-
al setae; fore coxa with erect, pale, anterolateral setae,
longer than width of coxa. Fore femur (Fig. 10) evenly
tapered apically, except extreme base distinctly swollen;
base with 3 black, spine-like setae, anterior posterolat-
eral seta ca. one-half length of femur, remaining setae
one-third length of anterior seta; anteroventral row of
ca. 20 stout, spine-like setae extending length of femur,
Bonn zoological Bulletin 70 (1): 51-65
length less than one-fourth width of femur, decreasing
in length apically; lacking conspicuous preapical anterior
setae; row of slender, pale posteroventral setae extending
length of femur, some subequal in length to width of fe-
mur; | spine-like posteroventral seta near mid-length of
femur, subequal in length to basal width of femur; dense,
very short, white pile beneath. Fore tibia slightly arched
with row of stout setae beneath, length of some subequal
to width of tibia, shorter proximally. Mid femur with
slender anteroventral and posteroventral preapical setae;
lacking anterodorsal and posterodorsal setae. Hind femur
lacking distinct anteroventral setae; lacking anterodorsal
and posterodorsal setae. Hind tibia lacking posterodorsal
spur-like seta near base; several erect dorsal and antero-
ventral setae on apical fourth. Tarsi nearly subequal in
length to corresponding tibiae. Empodium pulvilliform,
subequal in length to claw, less than half length of tar-
somere.
Abdomen concolourous with thoracic pleura in lateral
view. Terminalia (Figs 15, 21—22): hypandrium broad ba-
©ZFMK
Revision of the 7richoclinocera yixianensis species-group from eastern Asia 61
Figs 33—34. Terminalia of Trichoclinocera yixianensis Li & Yang, lateral view. 33. Male. 34. Female. Scale bars = 0.1 mm. Abbre-
viation: T = tergite.
sally, tapered apically, nearly 1.5x length of epandrium;
anterior margin with small projection. Phallus extending
beyond clasping cercus; strongly bent subbasally; shaft
narrow with broad, expanded base; apex with cup-like
opening, with small, round, bulbous swelling of mem-
brane, slightly wider than diameter of apex of phallus;
membrane lacking microtrichia; ejaculatory apodeme
arched strongly within base of phallus. Epandrium with
large membranous area at basal margin with hypandrium.
Surstylus slender, two-thirds length of clasping cercus,
lacking apical setae and microtrichia. Clasping cercus
subtriangular, tapered apically; long, fine setae on ven-
tral margin; inner dorsal margin with peg-like setae along
entire length.
Female. Unknown.
Distribution. Known only from the holotype, collect-
ed in central Nepal, west of Pokhara (Fig. 41).
Etymology. The specific epithet is named after Akinor1
Nakanishi, the collector of the holotype of this species.
Trichoclinocera pakistanensis sp. nov.
(Figs 11-12, 16, 27—28, 38, 41)
urn: lsid:zoobank. org: act: SAF5E4C7-9802-4F 63-9297-E3780DCD499C
Type material. HOLOTYPE <, labelled: “(PAKI-
STAN) Naran/ Kagan V./ 1800m/ 22.vi1.1987/ K. Kan-
miya’; “[HOLOTYPE]/ Trichoclinocera/ pakistanensis /
Saigusa & Sinclair [red label]” (KUMF). PARATYPES:
Bonn zoological Bulletin 70 (1): 51-65
PAKISTAN: same data as holotype [34°54' N 73°39! E]
(1 9, CNC; 1 2, KUMF).
Recognition. This species is distinguished by the pair
of long spine-like setae at the base of the fore femur, very
short anteroventral setae at mid-length of fore femur hid-
den within pile, giving appearance of a broad gap, pale
yellowish-brown legs and clear wings.
Description. Wing length 3.9-4.3 mm. Male. Pale
grey-blue pruinescence and pale yellowish-brown legs
(Fig. 11). Head pointed ventrally, compound eyes oval;
facets enlarged anteroventrally. Face greatly narrowed
medially, less than width of antennal socket, with bright
whitish pruinescence for full length; lower margin of face
with short, narrow cleft, lacking carina; gena one-seventh
as wide as eye height. Frons greyish brown: vertex and
ocellar triangle dark brown, lower postocciput brown,
gena lightly pruinescent. Ocellar setae longest among
cranial setae; occiput with 3-4 pairs of setae posterior to
ocellar triangle; postocular with row of short setae along
margin of eye, upper 3—4 setae dark, stouter than lower
setae. Arista lost in type series. Palpus pointed apically,
ca. one-fourth height of eye.
Pleura grey with pale grey-blue pruinescence; scutum
brown with pale, somewhat bluish lateral margins and
median paler stripe extending full length of scutum; post-
pronotal lobe and postalar callus paler brown; faint dark
vitta along inner edge of dc in dorsal view. Thoracic setae
long, some subequal to width of eye; acrostichal setulae
©ZFMK
62 Toyohei Saigusa & Bradley J. Sinclair
lacking; 5 pairs dc; 1 very short, pale pprn, one-fourth
length of dc; 1 presut spal; 2 npl; 2 psut spal; 1 pal; 2 pairs
sctl, lacking setulae; several pale setulae on postpronotal
lobe and notopleural depression. Laterotergite with patch
of pale setae; prothoracic episternum without spine-like
setae; anepisternum with posterior setulae; katepister-
num without setulae; hind margin of metepisternum with
white setulae.
Wing (Fig. 38) narrow, lightly infuscate, without mark-
ings; pterostigma very narrow, faint, elliptical. One basal
costal seta, one-half length of posterior dc. Sparse row
of setulae from base of R to mid-length of R,; auxiliary
crossvein lacking; cell dm produced apically; R, and R,
divergent. Halter pale brown.
Legs yellowish-brown, darker towards tarsi, coxae
with faint blue pruinescence. Coxae with long, pale mar-
ginal setae; fore coxa with long, pale anterolateral setae,
shorter than width of coxa. Fore femur (Fig. 12) distinct-
ly swollen, tapered apically evenly throughout; base with
2 black, spine-like setae, posterolateral seta ca. one-third
length of femur, anterolateral seta thinner and one-half
length of posterolateral seta; anteroventral row of stout,
spine-like setae extending length of femur, setae very
short medially hidden within pile, setae of apical and bas-
al fourth pronounced ca. one-fourth width of femur; 5—6
slender, preapical anterior setae, longer than anteroven-
tral setae; row of slender, pale posteroventral setae ex-
tending length of femur, length less than width of femur;
without spine-like, posteroventral setae near mid-length;
Bonn zoological Bulletin 70 (1): 51-65
| at
Figs 35—40. Wings of Trichoclinocera yixianensis species-group. 35. T. emotoi sp. nov. 36. 7: maculata sp. nov. 37. T. nakanishii
sp. nov., holotype. 38. 7. pakistanensis sp. nov. 39. T! yixianensis Li & Yang (Bhutan). 40. 7. yixianensis Li & Yang (Shaanxi). Scale
bars = 1.0 mm. Abbreviations: R,,, = second branch of radius; R, = upper branch of third branch of radius.
dense, very long, white pile beneath. Fore tibia straight to
distinctly curved, with row of stout setae beneath, near-
ly subequal in length to width of tibia; apical third with
long spine-like seta, 2x width of tibia. Mid femur with
slender anteroventral and posteroventral preapical setae;
lacking anterodorsal and posterodorsal setae. Hind femur
without distinct anteroventral setae; lacking anterodorsal
and posterodorsal setae. Hind tibia without posterodorsal
spur-like seta near base; 2—3 erect, dorsal spine-like setae
and | similar ventral seta on apical fourth. Tarsi one-third
to one-half longer than corresponding tibiae. Empodium
pulvilliform, subequal in length to claw, less than half
length of tarsomere.
Abdomen concolourous with thoracic pleura in lateral
view. Terminalia (Figs 16, 27—28): hypandrium slender,
tapered apically, subequal in length to epandrium; ante-
rior margin rounded. Phallus extended slightly beyond
clasping cercus; straight beyond base; shaft narrow with
expanded base; apex with small, round, membranous
swelling; membrane lacking microtrichia; ejaculatory
apodeme arched within base of phallus. Epandrium sub-
triangular, with large membranous area at basal margin
with hypandrium. Surstylus slender, slightly shorter than
length of clasping cercus, lacking apical setae or long mi-
crotrichia. Clasping cercus broad, subtriangular, tapered
apically; long, fine setae on ventral margin; inner dorsal
margin lacking peg-like setae.
©ZFMK
Revision of the 7richoclinocera yixianensis species-group from eastern Asia 63
Fig. 41. Known distribution of the Trichoclinocera yixianensis species-group.
Female. Similar to male including chaetotaxy of legs;
posterolateral basal seta of fore femur more than one-
third length of femur.
Distribution. Known only from the type locality in the
western Himalayas (Fig. 41).
Etymology. The specific epithet is in reference to the
country of the type locality.
Trichoclinocera yixianensis Li & Yang, 2009
(Figs 1-4, 23-26, 29-30, 33-34, 39-41)
Trichoclinocera yixianensis Li & Yang, 2009: 134. Type
locality: China: Henan, Yixian, Huaguoshan Mountain
[34°18' N 111°50' E].
Material examined. BHUTAN: E of Jilay La
[27°22' N 89°22' E], 3000 m, 19.vili.1993, T. Saigusa
(1 3, KUMF). CHINA: Shaanxi: Zuoshui-x, Brook nr
tunnel, Hetaoping [33°47' N 108°54' E], 1650-1750 m,
20.vi.1997, T. Saigusa (4 43, 1 9, CNC; 21 3g, 24 29,
KUMEF); Zuoshui-x, Brook nr tunnel, Hetaoping 1650-—
1750 m, 20.vi.1997, T. Saigusa (1 9, KUMF); Fuping-x,
Bridge 3 km NW of Donghetai [33°41' N 107°57' E],
1500 m, 28.vi.1997, T. Saigusa (12 do, 5 299, KUMF);
Fuping-x, Dadianzi, 1850-1960 m, 5 km N of Donghe-
tai, 8.vii.1997, T. Saigusa (2 ¢¢, 3 99, KUMF); Fup-
ing-x, Daping-Huanmuqiao, 1550-1600 m, WNW of
Donghetai, 28.vi.1997, T. Saigusa (1 9, CNC); Fuping-x,
Bonn zoological Bulletin 70 (1): 51-65
Daping-Huanmugqiao, 1500-1600 m, WNW of Donghe-
tai, 28.vi.1997, T. Saigusa (3 6, 1 2, KUMF); Fup-
ing-x, Huanmuqiao, 1600-1700 m, WNW of Donghetai,
28.vi.1997, T. Saigusa (2 do, 1 9, CNC; 1 &, 3 29,
KUMEF); Fuping-x, Wangkoushang, 1450 m, 2 km NE
Donghetai, 25.vi.1997, T. Saigusa (2 99°, KUMEF):; Zu-
oshui-x, W of Hetaoping, 1500-1550 m, 10.vil.1997, T.
Saigusa (6 Jo, 3 29, KUMF); Zuoshui-x, Yingpan-lin-
chang [33°50' N 108°50' E], 1850 m, 10.vit.1997, T.
Saigusa (4 ¢¢, 5 99, KUMF); Fuping-x, Liangfengya,
2000-2100 m, 12 km WNW Longcaoping [33°41' N
107°56' E], 24.vi.1997, T. Saigusa (7 3, 1 9, KUMF).
Sichuan: Jingding, 2900-3030 m, Emeishan [29°30' N
103°40' E], 8.viii.1998, T. Saigusa (2 bo, 1 9, CNC:
5 33,10 92, KUMF). Yunnan: Zhongdian, Tuomunan
[27°20' N 99°59' E], 3030-3500 m, 42 km N Qiaotou,
11.vi.1996, T. Saigusa (1 4, KUMF).
Recognition. This species is distinguished by the three
long spine-like setae at the base of the fore femur and
apical half with 4—5 spine-like posteroventral setae, gen-
erally pale yellowish-brown legs, elongate hypandrium
and clear wings.
Redescription. Wing length 3.9-4.4 mm. Male.
Pale grey-blue pruinescence and yellowish-brown legs
(Figs 23, 25). Head pointed ventrally, compound eyes
oval; facets enlarged anteriorly (e.g., Fig. 26). Face great-
ly narrowed medially, less than width of antennal socket,
with bright whitish pruinescence for full length; lower
©ZFMK
64 Toyohei Saigusa & Bradley J. Sinclair
margin of face with short, narrow cleft, lacking carina;
gena one-seventh as wide as height of eye. Frons slightly
darker than face; vertex and ocellar triangle dark brown,
lower postocciput brown, gena lightly pruinescent. Ocel-
lar setae longest among cranial setae; occiput with 3-4
pairs of setae posterior to ocellar triangle; postocular with
row of short setae along margin of eye, upper 3—4 setae
dark, stouter than lower setae. Arista-like stylus long and
slender, somewhat tapered apically. Palpus pointed api-
cally, ca. one-fourth height of eye.
Pleura brownish with pale grey-blue pruinescence;
scutum brown with pale, somewhat bluish lateral mar-
gins; posterolateral margin of postpronotal lobe shiny
brown; black vitta along inner edge of dc inconspicu-
ous. Thoracic setae long, some subequal to width of eye:
acrostichal setulae lacking; 5 pairs dc; 1 pprn reduced
to black or pale setula, very short, inconspicuous; | pre-
sut spal; 2 npl, lower slender; 1—2 psut spal, anterior
more slender and shorter than posterior; 1 pal; 2 pairs
sctl, lacking setulae; several pale setulae on postpronotal
lobe and notopleural depression. Laterotergite with patch
of pale setae; prothoracic episternum with pair of pale
spine-like setae; anepisternum with short pale posterior
setulae; katepisternum and hind margin of metepister-
num with pale setulae.
Wing (Figs 39, 40) narrow, lightly infuscate, lacking
markings; pterostigma very narrow, faint, elliptical. One
basal costal seta, one-half length of posterior dc. Row
of setulae extending from base of R to just beyond Rs
branching; auxiliary crossvein lacking; cell dm _ pro-
duced apically; R, and R, divergent throughout; base
of R, with small spur. Halter dark, except extreme base
orange-brown.
Legs yellowish-brown, tarsi darker towards tips, coxae
with faint blue pruinescence, especially darker on fore
coxa. Coxae with long, pale marginal setae; fore coxa
with long pale anterolateral setae. Fore femur (Figs 3, 24)
distinctly swollen, tapered apically evenly throughout:
base with 3 black, spine-like setae, posterolateral seta ca.
one-half length of femur, anterolateral and posterior se-
tae thinner and one-half length of posterolateral seta; an-
teroventral row of short, stout spine-like setae extending
length of femur, becoming stouter apically, setae longer
than pile; 5—6 slender, preapical anterior setae, longer
than anteroventral setae; row of slender, pale postero-
ventral setae extending length of femur, length less than
width of femur; apical half with 4—5 spine-like, postero-
ventral setae, basal seta ca. two-thirds width of femur, re-
maining setae decreasing in length apically; dense, long,
white pile beneath. Fore tibia slightly curved with row
of stout setae beneath, length ca. one-half width of tibia;
setae of equal length, except apical seta. Mid femur with
1 (sometimes 2) pairs of spur-like anteroventral and pos-
teroventral preapical setae; lacking anterodorsal and pos-
terodorsal setae. Hind femur with | preapical anteroven-
tral seta; lacking anterodorsal and posterodorsal setae.
Bonn zoological Bulletin 70 (1): 51-65
Hind tibia without spur-like posterodorsal seta near base;
sometimes spur-like, dorsal seta on apical fourth; erect
dorsal and ventral spine-like setae on apical third. Tarsi
ca. one-third longer than corresponding tibia. Empodium
pulvilliform, shorter than length of claw, less than half
length of tarsomere.
Abdomen concolourous with thoracic pleura in lateral
view, with mostly dark setae in dorsal view. Terminalia
(Figs 29-30, 33): hypandrium slender, slightly tapered
apically, nearly 1.3x length of epandrium; anterior mar-
gin somewhat pointed. Phallus extending slightly be-
yond clasping cercus; gradually arched to strongly bent
subbasally; shaft narrow with expanded base; apex with
cup-like opening, with small, round, bulbous swell-
ing of membrane, slightly wider than diameter of apex
of phallus; membrane lacking microtrichia; ejaculatory
apodeme arched within base of phallus. Epandrium sub-
triangular, with large membranous area at basal margin
with hypandrium. Surstylus slender, two-thirds length of
clasping cercus, lacking apical setae or long microtrich-
ia. Clasping cercus narrow, digitiform, tapered apically;
long, fine setae on ventral margin; inner dorsal margin
lacking peg-like setae.
Female. Similar to male including chaetotaxy of legs
(Fig. 4). Sclerites of segment 8 not overlapped laterally
(Figs 31, 34); T8 with posterior row of long and short
setae, T9+10 with stout, curved setae along inner mar-
gin, with apical setae more stout than remaining setae
(Fig. 32); anteroventral corner of T9+10 narrowed and
prolonged obliquely.
Distribution. This is the most widespread species of
this group, found in Bhutan and China (Henan, Shaanx1,
Sichuan, Yunnan) (Fig. 41).
Key to species of the 7. yixianensis species-group
1 Wings spotted and auxiliary crossvein between R,
and R,,, present (Figs 7, 36) ...... maculata sp. nov.
— Wings not spotted and without auxiliary crossvein
between R, and R,,, (Figs 35, 37-40) oo... 2
2. Whe os danke Pie Soo, -O-. bs oS eo Re ee moot 4
Legs yellowish-brown (Figs 11-12, 23-25) .......... 3
3 Fore femur with posteroventral spine-like seta near
mid-length (Figs 3, 24); mid femur with one pair
of stout preapical anteroventral and posteroventral
setae; anteroventral setae at mid-length of fore
femur extending beyond pile (Fig. 24); clasping
cercus narrow, digitiform, with slender inner setae
CET NS OI" Naas Scsrecul estat sions! T. yixianensis Li & Yang
— Fore femur without posteroventral spine-like seta
near mid-length (Fig. 12); mid femur without pair
of stout preapical anteroventral and posteroventral
setae; anteroventral setae at mid-length of fore
femur hidden within pile (Fig. 12); clasping cercus
subtriangular, with stout inner setae (Fig. 28) ..........
Poem Ae ata ells Asay et AIC os nr T. pakistanensis sp. nov.
©ZFMK
Revision of the Trichoclinocera yixianensis species-group from eastern Asia 65
4 Fore femur with pair of stout setae mounted on
short tubercles (Fig. 6); clasping cercus finger-like,
tapered on apically half, with broad U-shaped notch
AtDaSey Gigs Wise un ee anata T. emotoi sp. nov.
— Fore femur with pair of stout setae not mounted
on short tubercles (Fig. 10); clasping cercus
subtriangular, tapered apically, without U-shaped
notch at base (Figs 15, 22) .... 2 nakanishii sp. nov.
DISCUSSION
There are now 44 described species of Trichoclinocera
worldwide, of which 28 species are known from the
eastern Palearctic and Oriental Regions. Currently most
species are recorded from the Himalayas with eight spe-
cies and Japan with nine species. An additional 26 unde-
scribed species from species-groups not yet treated have
been identified by the authors.
Adults of Trichoclinocera normally occur on large,
emergent rocks or boulders in fast flowing streams and
rivers together with other clinocerine genera. But excep-
tions have been noted and summarized as follows: adults
of two Japanese species (1. miranda Saigusa & Sinclair,
2016 and 7: shinogii Saigusa & Sinclair, 2016) were ob-
served on moist sand close to water of slowly moving
rivers, or on pebbles in shallow streamlets partially sep-
arated from the main river, a rather unusual habitat for
this genus. The first author notes that 7. dasyscutellum
(Saigusa, 1965) has almost always been collected along
narrow, shallow streamlets in forests, whereas adults
of 7: vixianensis were surprisingly collected on vertical
rock seepages and steeply inclined or cliff-like surfaces
of small streams.
Sinclair (1994) initially recognized six species-groups
of Trichoclinocera in a revision of the Nearctic spe-
cles (comata, dasyscutellum, dolicheretma, lapponica,
longipes, stackelbergi groups). Some of the definitions
of these groups were re-evaluated by Saigusa & Sin-
clair (2016), with the 7’ /ongipes species-group trans-
ferred into an expanded concept of the 7’ stackelbergi
species-group. Most described and undescribed Palearc-
tic and Oriental species are assigned to the 7’ apponica
Species-group. In the present study, the 7’ yixianensis
Species-group 1s newly described for a morphologically
unusual group of Palearctic/ Oriental species. A small
group of species related to 77 maewa Smith, 1965 appear
to form an additional species-group, defined on the basis
of a cluster of spicule-like projections near the apex of
the phallus. Future studies will focus on this latter group,
as well as new species in the 7! Japponica and T: stackel-
bergi species-groups.
Acknowledgements. The following collectors kindly provided
specimens to the first author: J. Emoto, K. Kanmiya, the late A.
Nakanishi and H. Shima. Scanning electron photographs were
Bonn zoological Bulletin 70 (1): 51-65
produced by T. Tachi and A. Tachi (Kyushu University). Two
anonymous reviewers kindly commented on the manuscript.
REFERENCES
Collin JE (1941) Some Pipunculidae and Empididae from the
Ussuri region on the far eastern border of the U.S.S.R. (Dip-
tera). Proceedings of the Entomological Society of London
(B) 10: 218-248. https://doi.org/10.1111/).1365-3113.1941.
tb00684.x
Cumming JM, Wood DM (2017) [Chapter] 3. Adult morpholo-
gy and terminology. Pp. 89-133 in Kirk-Spriggs AH, Sinclair
BJ (eds) Manual of Afrotropical Diptera. Volume 1. Introduc-
tory chapters and keys to Diptera families. Suricata 4, South
African National Biodiversity Institute, Pretoria
Kelsey LP (1969) A revision of the Scenopinidae (Diptera) of
the World. United States National Museum Bulletin 277:
1-336
Lanning SW, Sinclair BJ, Mabee WR, Combes, MD (2020) 7ri-
choclinocera (Diptera: Empididae): a new aquatic dance fly
record for Missouri. Transactions of the Missouri Academy
of Science 47: 18—20. https://doi.org/10.30956/MAS-28R1
Li Z, Yang D (2009) A new species of Trichoclinocera Collin
(Diptera: Empididae) from China. Aquatic Insects 31: 133-
137. https://doi.org/10.1080/01650420802623778
Saigusa T (1965) Two new species of Clinocerinae from Japan
(Diptera, Empididae). Kontya 33: 53-57
Saigusa T, Sinclair BJ (2016) Revision of the Japanese species
of Trichoclinocera Collin (Diptera: Empididae: Clinoceri-
nae). Zootaxa 4103: 201-229. https://doi.org/10.11646/zoo-
taxa.4103.3.1
Shorthouse DP (2010) SimpleMappr, an online tool to produce
publication-quality point maps. Online at http://www.simple-
mappr.net [last accessed on 8 Feb. 2021]
Sinclair BJ (1994) Revision of the Nearctic species of 7ri-
choclinocera Collin (Diptera: Empididae; Clinocerinae).
The Canadian Entomologist 126: 1007-1059. https://doi.
org/10.4039/Ent126 1007-4
Sinclair BJ (1995) Generic revision of the Clinocerinae (Empi-
didae), and description and phylogenetic relationships of the
Trichopezinae, new status (Diptera: Empidoidea). The Ca-
nadian Entomologist 127: 665-752. https://doi.org/10.4039/
Ent127665-5
Sinclair BJ, Saigusa T (2005) Revision of the Trichoclinocera
dasyscutellum group from East Asia (Diptera: Empididae:
Clinocerinae). Bonner zoologische Beitrage 53 (2004) (1-2):
193-209.
Sinclair BJ, Shamshev IV (2014) Review of Clinocerinae (Dip-
tera: Empididae) from the Caucasus, with description of
three new species. Proceedings of the Zoological Institute
RAS 318: 40-47
Sinclair BJ, Shamshev IV, Gattolliat J-L (2020) Revision of
the aquatic dance flies (Diptera: Empididae: Clinocerinae)
described by F. Vaillant in two 1960 publications. Bonn zoo-
logical Bulletin 69 (2): 263-274. https://doi.org/10.20363/
BZB-2020.69.2.263
Vaillant F (1960) Quelques Empididae Atalantinae d’ Asie russe
[Dipt.]. Bulletin de la Société entomologique de France 65:
170-186
Yang D, Zhang K, Yao G, Zhang J (2007) World Catalog of
Empididae (Insecta: Diptera). China Agricultural University
Press, Beijing.
©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 70 (1): 63-65
2021 - Jablonski D. & Masroor R.
https://do1.org/10.20363/BZB-2021.70.1.063
ISSN 2190-7307
http://www.zoologicalbulletin.de
Scientific Note
urn:|sid:zoobank.org: pub:C63D45 10-C397-46D3-A3C9-FF57B6C9E0C9
First record of Eremias kakari Masroor et al., 2020
(Squamata: Lacertidae) for Afghanistan
Daniel Jablonski'* & Rafaqat Masroor’
' Department of Zoology, Comenius University in Bratislava, Ilkovicova 6, Mlynska dolina, Bratislava, Slovakia
?Zoological Sciences Division, Pakistan Museum of Natural History, Garden Avenue, Shakarparian, Islamabad,
Pakistan
“Corresponding author: Email: daniel. [email protected]
'urn:|sid:zoobank. org:author:B624407A-7A F2-487 1-9B03-C0A694959B8A
2urn:lsid:zoobank.org:author:76A 7CDF5-578E-4580-9 1 EA-O2DD6804DA59
Abstract. The presented paper reports on the first record of Eremias kakari Masroor, Khisroon, Khan, Jablonski, 2020
for Afghanistan based on morphological data obtained from one specimen stored for 49 years in the Zoological Research
Museum Alexander Koenig, Bonn, Germany. Up to now, the species was known only from the type locality in Pakistani
Balochistan.
Key words. Central Asia, endemism, faunistics, morphology, range extension, Reptilia.
The recently described new species of the genus Eremias
Fitzinger, 1834 (Squamata: Lacertidae), E. kakari Mas-
roor, Khisroon, Khan, Jablonski, 2020, was considered
as an endemic lizard, collected in the vicinity of Tanishpa
village (31.1869° N, 68.4126° E), Torghar, Toba Kakar
Range in the Sulaiman Mountains, at an elevation around
2,500 m a.s.l. (Masroor et al. 2020), a remote area of
Pakistani Balochistan. This species is a member of the
subgenus Rhabderemias Lantz, 1928 and is a morpholog-
ically and genetically well-defined species. Based on a
multilocus dataset of mitochondrial and nuclear markers,
E. kakari forms the sister taxon to a clade comprising the
closely related species E. scripta Strauch, 1867 and E.
cholistanica Baig & Masroor, 2006 (Khan et al. 2021).
The species is characterized by having a single row of
subdigital lamellae and a complete row of lateral scales
with an overall three scales around the penultimate pha-
lanx of the 4" toe. Eremias kakari is similar to E.. fasciata
but can be distinguished from it by having 22—26 sub-
digital lamellae under 4" toe, 48—55 dorsal scales across
midbody, ventrals in 11-14 oblique longitudinal series
across the belly, 17—21 femoral pores, and 17—21 scales
in the 9"—10" caudal annulus. This species is known only
from 13 specimens deposited in the Pakistan Museum of
Natural History (PMNH), Islamabad, Pakistan. Because
the type locality of FE. kakari is close to the border with
Afghanistan (ca 60 km), and the same mountain range
(Shinkay Ghar, Sulatman Mountains) traverses through
both countries, its presence in Afghanistan was expected
(Masroor et al. 2020). Most of the territory of Afghani-
Received: 09.01.2021
Accepted: 18.02.2021
stan is, however, inaccessible due to the long-time pres-
ence of political instability and therefore field research is
almost impossible to carry out. The current herpetologi-
cal research in Afghanistan is thus based mostly on the
historical museum collections (see Wagner et al. 2016;
Jablonski et al. 2019a) which is also the case of this con-
tribution. In this scientific note, we provide the first re-
cord of E. kakari for the territory of Afghanistan based on
a specimen stored for 49 years in the museum collection
of the Zoological Research Museum Alexander Koenig,
Bonn, Germany (ZFMK).
This single specimen of FE. kakari (ZFMK-H 8553; cur-
rently stored as E. fasciata) was collected in Urgun, Pak-
tika Province (32.858° N, 69.146° E, ~2300 m a.s.l.)
during July 1972 by Clas Naumann, the former director
of the ZFMK who carried out zoological research in Af-
ghanistan. The examined specimen is an adult male with
the following morphological characters that fully corre-
spond with the diagnostic characters of E. kakari pre-
sented by Masroor et al. (2020; measurements in mm):
snout-vent length (SVL = 58.32), tail length (TL = 91.0),
head length (HL = 12.93), head width (HW = 6.74), head
height (HH = 6.60), trunk length (TrL = 18.41), hindlimb
length (HLL = 32.27), femur length (FL= 8.7), crus length
(CL = 8.24), forelimb length (FLL = 20.7), length of hu-
merus and radius (HRL = 12.35), length of femoral pore
row (LFPR = 7.29), width of space between femoral pore
rows (LFPS = 1.8), length of frontal scale (FrL = 3.2),
maximum width of frontal scale (FrW = 2.4), length of
pileus (Lpil = 12.24), head length from snout tip to the
Corresponding editor: W. Bohme
Published: 26.02.2021
64 Daniel Jablonski & Rafaqat Masroor
1cm
1cm
Fig. 1. The specimen of Eremias kakari (ZFMK-H 8553) from Urgun, Paktika Province, Afghanistan. A. Dorsal view on the body.
B. Ventral view. C—F. Details on parts of the head. C. Dorsal parts. D. Ventral parts. E—F. Lateral parts.
anterior edge of collar (NL = 16.5), length of supranasal
suture (SNL = 0.5), length of frontonasal (FNL = 1.5),
length of prefrontal (PFL = 1.56), width of prefrontal
(PFW = 1.45), number of supralabials (SL = 10), num-
ber of infralabials (IL = 7), number of dorsal scales on
midbody (DS = 49), maximum number of scales across
mid-belly in a single row in the widest part (VL = 12),
number of ventral scales in a single row (VT = 32), gu-
lars, from chin shields to the collar (G = 26), number of
collar scales (C = 8), scales around ninth and tenth cau-
dal whorl posterior to the vent (NCWS = 18), number of
supralabials anterior to subocular (SLAS = 6), number
of femoral pores (FP = 17), number of scales separating
femoral pore rows (FPS = 4), subdigital lamellae under
Ath toe (SDLT 4" = 23), number of scales around 4th toe
at penultimate phalanx (SA 4" = 3), subdigital lamellae
under 4th finger (SDLF 4" = 16), contact of fifth maxil-
lary/chin shield with infralabial (FMIL = yes), subocular
in contact with a mouth (SOM = yes), contact of frontal
and supraoculars (FSO = no), contact of infranasal with
rostral (INTR = yes).
After the description of EF. kakari, we found the
above-mentioned museum specimen ZFMK-H 8553,
morphologically determined as E. fasciata. The collect-
Bonn zoological Bulletin 70 (1): 63-65
ing locality of the specimen is, however, far away from
the known records of E. fasciata (~400 km airline) in the
Afghan part of the Sistan Basin (see Wagner et al. 2016
and Fig. 2 of this study). We have considered it as a re-
markable range extension of £. fasciata for the country
suggesting that the collected specimen ZFMK-H 8553
could be a different species. Due to the relatively close
distance to the type locality of EF. kakari (~200 km air-
line) and its presence in the same mountain range, we
correctly expected that it could be conspecific to E. kaka-
ri. Moreover, ZFMK-H 8553 was collected in an area
that does not represent the typical habitats known for
E. fasciata. Eremias fasciata is characteristic for rather
lower-lying desert areas, where it inhabits gravely hama-
da, salt-encrusted silt, drifting loess, silty alluvium, and
sandy plains with bushes (Anderson 1999, Khan 2006),
while F. kakari 1s, based on current information, mostly
a mountain species inhabiting rocky habitats (Masroor
et al. 2020). Such habitat characteristic for FE. fasciata
corresponds with the environment in the Sistan Basin,
and for E. kakari in Urgun, respectively.
Interestingly, specimens of E. fasciata from southern
Afghanistan differ also morphologically (e.g., number
of dark stripes on the body) from the original species
©ZFMK
First record of Eremias kakari Masroor et al., 2020 for Afghanistan 65
_ _ Sistan Basin
¥ ~ Papet
“\
wap uate! /
te. AEN
- =China
{SOR
Nr Besce,
Lo eee
—___—_—
By eine.
ie Ete
Fig. 2. The distribution records of Eremias kakari (ZFMK-H 8553) and E. fasciata from Afghanistan with the designation and the
airline distance of the type locality of E. kakari from Tanishpa in Pakistan and from the nearest records of E. fasciata from the
Sistan Basin in Afghanistan (Wagner et al. 2016): 1 =6 km NW Delaran, Farah Province (CAS 120400-04); 2 = 64 km W Kanda-
har, Kandahar Province (CAS 120398-99); 3 = Pirzada, Kandahar Province (ZMUC R-4594); 4 = 5 mi downstream from Girishk,
Dasht-i-Margo Area, Chah-i-Angir, Helmand Province (CAS 84684-88); 5 = 56 km S and 10 km E of Darweshan, Helmand Prov-
ince (CAS 120397). CAS = California Academy of Sciences, USA; ZMUC = Zoological Museum, University of Copenhagen,
Denmark.
description from the Iranian type locality in Saidabad,
southwest of Kerman (Anderson 1999). Therefore, the
situation needs further integrative research to find out
whether the morphological variability in EF. fasciata is
only environmentally inducted or whether divergent evo-
lution takes place. Nevertheless, &. kakari is the 106"
species of reptile fauna recorded from Afghanistan, 17"
species in the family Lacertidae and 13" species of the
genus Eremias (see Jablonski et al. 2019b).
Acknowledgements. We are thankful to Morris Flecks
(ZFMK) who provided us information and photographs of the
Specimen and two reviewers for their comments that improved
the first version of the manuscript. This study was supported by
the Slovak Research and Development Agency under contract
no. APVV-19-0076.
Bonn zoological Bulletin 70 (1): 63-65
REFERENCES
Anderson SC (1999) The Lizards of Iran. Contributions to Her-
petology, Vol. 15. Society for the Study of Amphibians and
Reptiles, New York
Jablonski D, UroSevic A, Andjelkovi¢ M, DZzuki¢ G (2019a) An
unknown collection of lizards from Afghanistan. ZooKeys
843: 129-147
Jablonski D, Regan JM, Holzheuser C, Farooqi J, Basit A, Mas-
roor R (2019b) Additional data to the herpetofauna of Af-
ghanistan. Herpetozoa 32: 177-193
Khan MA, Jablonski D, Nadeem MS, Masroor R, Kehlmaier C,
Spitzweg C, Fritz U (2021) Molecular phylogeny of Eremias
spp. from Pakistan contributes to a better understanding of
the diversity of racerunners. Journal of Zoological Systemat-
ics and Evolutionary Research 59: 466-483
Khan MS (2006) Amphibians and Reptiles of Pakistan. Krieger
Publishing Company, Malabar, Florida
Masroor R, Khisroon M, Khan MA, Jablonski D (2020) A new
species of Eremias (Squamata: Lacertidae) from the arid
mountains of Pakistan. Zootaxa 4786: 101-121
Wagner P, Bauer AM, Leviton AE, Wilms TM, Bohme W
(2016) A Checklist of the amphibians and reptiles of Af-
ghanistan — Exploring herpetodiversity using biodiversity ar-
chives. Proceedings of the Californian Academy of Sciences
63: 457-565
©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 70 (1): 67-84
2021 - Bartak M. et al.
https://do1.org/10.20363/BZB-2021.70.1.067
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org:pub:B885A4CC-7 1 ED-45F5-8BB3-08A D5 DOFO0C6
SEM morphology and courtship rituals of a new species of Rhamphomyia
(Diptera: Empididae: Empidinae)
from the Kashmir Himalayas (India)
Miroslav Bartak', Shahid Ali Akbar” *, Mariusz Kantursk?, Aijaz Ahmad Wachkoo‘* & Amir Maqbool*
'Czech University of Life Sciences, Faculty of Agrobiology, Food and Natural Resources, Department of Zoology and Fisheries,
Kamycka 129, 165 00 Praha 6 — CZ-Suchdol, Czech Republic
? Division of Plant Protection; Department of Entomology, Central Institute of Temperate Horticulture, Srinagar,
Jammu and Kashmir — IN-191132, India
>Zoology Research Team, Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences,
University of Silesia in Katowice, Bankowa 9, PL-40-007 Katowice, Poland
*Department of Zoology, Government Degree College, Shopian, Jammu and Kashmir — IN-192303, India
° Department of Zoology, Government College for Women, M.A. Road, Srinagar, Jammu and Kashmir — IN-190001, India
“Corresponding author: Email: [email protected]
'urn:Isid:zoobank. org:author:053CF9E7-44BB-43D5-BB79-2F5DD9962899
2urn:Isid:zoobank.org:author: 5AOAC4C2-B427-43A D-840E-7BB4F2565A 8B
3urn:lsid:zoobank.org:author:78C290A3-D07B-4A F9-9358-ED8C05A702BF
“urn:|sid:zoobank. org:author:6F 19EB1 F-5DDC-4722-BBD3-F75C29F901 D9
-urn:lsid:zoobank.org:author:3B24A69F-B725-4A7F-A917-1B760AB6AE88
Abstract. Rhamphomyia bhagati Bartak, Akbar, Kanturski, Wachkoo & Maqbool sp. nov. (Diptera: Empididae) is descri-
bed and illustrated based on male and female specimens. The discovery marks the first record of the genus Rhamphomyia
from the Kashmir Valley. Scanning Electron Microscopy (SEM) analysis was carried out to elucidate the general morpho-
logy and sensilla of the male and female specimens. The species is most prevalent during April and early May. The male
provides female with a nutritious prey, as a courtship gift through a series of rituals discussed herewith.
Keywords. Empididae, Rhamphomyia, courtship, Kashmir valley, India, new species.
INTRODUCTION
Empidinae (Diptera: Empididae) is a subfamily of dipter-
an flies with over 3,000 described species and many still
undescribed (Thompson 2005; Yang et al. 2007; Pape
et al. 2011). These flies occur worldwide with majorities
found in the Holarctic region, exhibit enormous structur-
al diversity and inhabit a broad range of biotopes (Sin-
clair & Cumming 2006; Moulton & Wiegmann 2007).
These are commonly known as balloon or dance flies,
which characterizes their elaborate mating displays, ae-
rial swarming, nuptial gift transfers, and other courtship
rituals (Cumming 1994).
The subfamily is divided into two tribes (1.e., Empidini
and Hilarini) centered on three megadiverse genera: Emp-
is Linnaeus, 1758, Rhamphomyia Meigen, 1822 (tribe
Empidini), and Hilara Meigen, 1822 (tribe Hilarini),
and around 27 other smaller genera (Watts et al. 2016).
Large gaps in the taxonomic knowledge of the subfamily
remain for most regions of the world, especially in the
Received: 07.10.2020
Accepted: 02.03.2021
Southern Hemisphere (Sinclair & Cumming 2006). Lim-
ited literature is also available on the Indian fauna. Apart
from some old works by Walker (1849), Bigot (1889),
Bezzi (1904), Brunetti (1913, 1917, 1920) and Collin
(1960), no recent pertinent literature is available. Of 57
species of Indian Empididae, the subfamily Empidinae
in India currently comprises about 20 species belonging
to four genera (Brunetti 1920; Collin 1960; Alfred et al.
1998; Mitra et al. 2015); however, like other Indian flies
these have not been the subject of a dedicated study and
the true number of species is still unknown (Shah et al.
2014; Wachkoo et al. 2017).
The megadiverse genus Rhamphomyia is the most spe-
ciose of dance flies, currently represented by almost 610
known species globally (Bartak & Kubik 2012; Saigusa
2012; Bartak et al. 2014; Rhodén & Wahlberg 2020), and
with many unpublished records, likely to increase to about
1,500 species (Sinclair et al. 2019). These flies thrive in
mountainous regions with an enormous radiation in the
Holarctic region and are well represented in the arctic en-
Corresponding editor: X. Mengual
Published: 08.04.2021
68 Miroslav Bartak et al.
vironment as well (Sinclair et al. 2019; Shamshev et al. tic species groups of Rhamphomyia have been revised
2020). These flies are also an ideal taxon for site quality (Bartak 1982, 2003; Bartak 2007, 2014; Bartak & Dan-
assessment studies (Grootaert 2004). Several Palaearc- telson 2007; Bartak & Kubik 2008a, b, c, 2009, 2010,
32°0'0"N 34°0'0"N 36°
70°0'0"E 80°0'0"E
= J
-
a / ik a.
= Wentrallinstitute 1@ + & ; a
—Temperate Horticulture ' ee
i
= Xe A -
ae
Fig. 1. Study area. a—d. Aerial view of Central Institute of Temperate Horticulture. e-f. Full blossom of fruit trees.
Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK
A new Rhamphomyia from the Kashmir Himalayas 69
2012, 2015). The genus Rhamphomyia, however, still
awaits global taxonomic revision with the dubious status
of some of the proposed subgenera (Bartak 1982; Chvala
1994). Little attention has been paid to Southeast Asian
species and our knowledge of the Indian Himalayan Re-
gion fauna is also very poor. Only three species, R. gri-
seonigra Brunetti, 1913, R. himalayana Brunetti, 1913
and R. unifasciata Brunetti, 1913 have been previously
reported from Indian Himalayas (Brunetti 1913, 1920)
and it is highly likely that many more Rhamphomyia
Species await discovery (Bartak & Kubik 2012). Herein
a new species belonging to Rhamphomyia (Pararham-
Phomyia) is described from the Kashmir valley. This
also marks the first record of the genus from the region.
The species placement within the subgenus (Pararham-
Pphomyia) 1s followed after Collin (1961) and Bartak &
Sinclair (2003). This subgenus is characterized by the
prosternum and mostly propleura without setae, biseri-
al acrostichals, incomplete anal vein, long setose label-
la and usually a distinct basal costal seta. The species is
described and differential diagnoses with closely related
species are provided. Notes on courtship rituals of the
new species are also provided, along with SEM analysis
to elucidate morphological details. Male and female flies
are frequent flower visitors, observed feeding on nectar
all day long from flowers belonging to genera Pyrus,
Prunus, and Cydonia.
MATERIAL AND METHODS
Material and taxonomy
Specimens were collected by hand picking method from
orchards of the Central Institute of Temperate Horticul-
ture (CITH) located in Kashmir Valley. CITH is situated
at 33.59° N, 74.50° E with an altitude of 1,640 m a.s.l.
(Fig. 1), in the Palaearctic portion of India on the north-
ern fringe of the Western Himalayas (Akbar et al. 2018,
2020; Wachkoo & Akbar 2019). Behavioral patterns
were observed similarly as in previous works (Kessel
1955; LeBas et al. 2004; Daugeron & Grootaert 2005;
Wilkinson & Johns 2005). The field photographs were
obtained using a Canon 80D DSLR fitted with 100 mm
macro lens. Five mating couples were observed, thrice
a month for three successive months (April—June) from
2015 to 2018 for their courtship rituals. The pairs, formed
in air and descend from the swarm, were observed af-
ter they commence copulation. The timing of copulation
was counted once the pair settled on nearby vegetation
till copulation was terminated and the pair separated.
Upon separation, these were caught and their body mea-
surements taken. Statistical analysis was carried out with
Statistical Analysis Software (SAS).
Taxonomic analyses were conducted using an Olym-
pus SZX16 stereo zoom microscope. For digital imag-
Bonn zoological Bulletin 70 (1): 67-84
es, ProgResO CapturePro ver. 2.8.0. evolution digital
camera was used on the same microscope with Combine
ZP-Montage software. Later, images were cleaned with
Adobe Photoshop CS6. Genitalia together with 2-3 pre-
genital segments were removed and macerated in potas-
sium hydroxide solution (10%) in small vials, for 1—2
hours, treated with 8% acetic acid and dissected in glyc-
erine. The morphological terms used here follow Sinclair
and Cumming (2006). All body measurements (including
body and setae length) were taken from dry specimens
(therefore the actual length may differ) by means of an
ocular micrometer on the above Olympus microscope.
Description pattern and measurements adopted here
follow Bartak & Kubik (2015). Length of antennal seg-
ments = length of scape:pedicel:postpedicel:stylus (in
0.01 mm). Male body length was measured from anten-
nal base to the tip of last abdominal segment (without
the genitalia) and female body length from the base of
antennae to the tip of the cerci. Wing measurements:
M,/d = length of vein M,:greatest length of discal medial
cell (discal cell); CuA, ratio = length of apical: preapical
sections of vein CuA,; lw/ww = greatest length of the
wing (from basicosta to apex):greatest width of the wing.
Length of frons is measured from front margin of anterior
ocellus to antennal base. Holotype and paratypes are de-
posited in the Central Institute of Temperate Horticulture,
Srinagar, India (CITH). Two paratypes are deposited in
CULSP (Czech University of Life Sciences Prague), two
in University of Silesia, Katowice (DZUS) and two will
be deposited in Natural History Museum, London, UK
(BMNH).
Scanning electron microscopy
Specimens for SEM analyses were preserved in 70% eth-
anol for several days. From ethanol, the specimens were
transferred into 6% phosphotungstic acid (PTA) solution
in 70% ethanol for 24 hours. Dehydration was provid-
ed by ethanol series of 80, 90, 96% and two changes in
absolute ethanol for 10 minutes each. Some of the de-
hydrated specimens were treated with chloroform for 24
h. Dehydrated and cleaned specimens were dried using
the Leica EM CPD 300 automated critical point dryer
(Leica Microsystems, Vienna, Austria). Dry samples
were mounted on aluminum stubs with double-sided ad-
hesive carbon tape and sputter-coated with 30 nm layer
of chromium in a Quorum 150 T ES Plus sputter coater
(Quorum Technologies Ltd, Laughton, East Sussex, UK).
The specimens were imaged by the Hitachi SU8010 field
emission scanning electron microscope FESEM (Hitachi
High-Technologies Corporation, Tokyo, Japan) at 5 and
7 kV accelerating voltage with a secondary electron de-
tector (ESD) in the SEM laboratory of the Institute of
Biology, Biotechnology and Environmental Protection,
University of Silesia in Katowice (Katowice, Poland).
©ZFMK
70 Miroslav Bartak et al.
RESULTS
Rhamphompyia (Pararhamphompyia) bhagati sp. nov.
(Figs 2-9)
urn: |sid:zoobank.org:act:9943F FCF-5CB1-4699-B778-390236261B77
Diagnosis. Light grey microtrichose species of Rhamph-
omyia (Pararhamphomyia) with brown legs, both black
and pale setae on the body, palpus black, acrostichals
narrowly biserial, dorsocentrals irregularly biserial and
slightly longer than acrostichals, both mostly whitish
yellow, often with some dark setae intermixed, axillary
angle 90°, anal vein incomplete, basal costal seta long,
cercus elongate, subcercal process long and thin, epan-
drium extremely elongate with broadly rounded tip, phal-
lus long, filamentous with short basal swelling followed
by S-shaped arc.
Fig. 2. Rhamphomyia bhagati sp. nov. a—c. Male. d—f. Female. a, d. Head, frontal view. b, e. Habitus, lateral view.
c, f. Habitus, dorsal view.
Bonn zoological Bulletin 70 (1): 67-84
©ZFMK
A new Rhamphomyia from the Kashmir Himalayas Fal
0.5mm
ej apod
J apoc’ cere subcercal proc
b 8S WZ x |
\
ave w= epand
ph or sti Ws a a ~
Be, ¢ i. bie
. beh
bs
cerci
Fig. 3. Rhamphomyia bhagati sp. nov. a. Wing venation with labeled discal cell (dm), cubitus (CuA1) and medial
veins (M2), (note: costal seta broken). b-d. Male genitalia, cercus (cerc), ejaculatory apodeme (ej apod), epandrium
(epand), hypandrium (hypd), phallus (ph), subcercal process (subcercal proc), sternite 8 (8S), tergite 8 (8T). e. Female
genitalia cerci.
Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK
a. Miroslav Bartak et al.
Material examined
Holotype. @, INDIA: Kashmir: Srinagar: Central In-
stitute of Temperate Horticulture, 34.0094°N 74.7984°E,
1640m.a.s.1., 11 April 2015 (CITH).
Paratypes. Same collection data as for holotype, ex-
cept: 11 April 2015 (4 6g, 2 99, CITH; 1 3, 1 9, CUL-
SP), 16 May 2015 (2 64, 1 9, CITH; 1 4, 1 2, DZUS),
28 May 2016 (1 3, 1 9, CITH), 09 June 2017 (4 3g, 1
©, CITH; 1 4, 1 9, BMNH), 11 June 2018 (5 3d’, 5 29,
CITH), 07 May 2019 (15 33, 11 29, CITH), 09 May
2019 (21 33, 14 92, CITH), Shahid Ali Akbar leg.
Distribution. India: Western Himalaya, Kashmir.
Dates of occurrence. April to June.
Description
Male (Figs 2a—c; 3a—d; 4—8; 9a—1)
Head. Light grey, microtrichose; eyes holoptic,
meet along median dorsal line, facets in dorsal half of eye
considerably enlarged (Fig. 2a); frons confined as small
triangle above antennae, without setulae. Frons blackish
brown, 0.15—0.18 mm long. Ocellar triangle prominent,
microtrichose; ocellar setae black, fine, approximately
0.26—0.27 mm long. Occiput sparsely covered with setae
subequally long as ocellars on dorsal part, colour vari-
able, mostly black to brown, often intermixed with white
setae; lower part of occiput mostly with pale and some-
what shorter setae; postocular row incomplete, irregular
or absent on lower half. Face approx. 0.12—0.14 mm wide,
0.15—0.16 mm long, without setae; microtrichose except
1.00 mm
Fig. 4. Scanning electron microscopy (SEM) showing general morphology of the male of Rhamphomyia bhagati
sp. nov. a. Lateral view. b. Head and thorax lateral view. c. Wing. d. Genitalia.
Bonn zoological Bulletin 70 (1): 67-84
©ZFMK
A new Rhamphomyia from the Kashmir Himalayas 73
Hy
¥ F: (a " , 4 % te |
1) hi Gate ek & ja fs Re I F ‘ " r «) @ d « 1
5) 250.0um Fe —* Bie ee . Ou : K .
Bit
| <
Vif
50/0um *10-0um
Lue , ~—_- c ~ g ‘ : -
y / , : . \ _ tae :
/ = Dn aa ns -
~~ + S . ¥ ees P
Froritayirl ih = . : 4 ge Se, age
. : a
is
roost
200um
Fig. 5. SEM of Rhamphomyia bhagati sp. nov. head, antennae and mouth parts. a. Holoptic eyes (e) with enlarged
facets along dorsal half and ocelli (0). b. Fine structure of the ocelli. ec. Fine structure of the ommatidia. d. Scape
(sc), and pedicel (pd) with sclerotic microtrichia. e. Structure of type III trichoid sensilla (dotted arrows) and type IV
trichoid sensilla (solid arrows). f. Fine structure of the type IV trichoid sensilla sockets. g. Postpedicel with the area
of basiconicsensilla (arrow heads) on the ventral side. h. Postpedicel microtrichia and basiconicsensilla (ba). i. Fine
structure of the basiconicsensilla covered by wax layer. j. Stylus. k. Labrum. I. Fine structure of the labrum apical end.
m. Labium. n—o. Fine structure of the ventral side of the labellum with visible pseudotracheae (pt).
Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK
74 Miroslav Bartak et al.
extreme lower margin. Clypeus microtrichose, gena
narrow and microtrichose. Palpus black and short, with
several long setae (up to 0.20 mm). Labrum black,
shiny, distinctly longer than head height; labellum with
rather long setae. Antenna black, both basal segments
short setose (Fig. 2a); length of antennal segments
(scape: pedicel: postpedicel:stylus) = 0.06—0.09 mm:0.06—
0.8 mm:0.27—0.31 mm:0.09-0.11 mm.
Thorax. Black, light grey microtrichose with two nar-
row brownish stripes between dorsocentrals and acros-
tichals (Fig. 2b—c). Most thoracic setae pale, posterior
dorsocentrals, postalars and scutellars black; acrostichals
and dorsocentrals mostly whitish yellow, often with
some dark setae intermixed. Chaetotaxy: antepronotum
with a few short setae in middle; proepisternum with sev-
eral fine setulae; prosternum and propleura bare; acrosti-
iene d
’ 5.00um
Fig. 6. SEM of Rhamphomyia bhagati sp. nov. thorax and wings. a. Long and rigid setae (trichoid and chaetic sensilla)
on thorax. b. Structure of trichoid sensilla. ec. Fine structure of socket and basal part of chaetic sensillum. d. General
view of thoracic microtrichia. e—f. Fine structure of thoracic cuticle and microtrichia with waxy secretion. g. Wing ar-
ticulation and base. h. Pillow-like structures on the articulation part of the wing. i. Chaetic sensilla on the wing edges.
j. Wing membrane with linearly arranged microtrichia. kl. Fine structure of the wing microtrichia.
Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK
A new Rhamphomyia from the Kashmir Himalayas 1D
chals narrowly biserial (almost uniserial anteriorly) and
few in number (5-7 in one row), about 0.10-0.12 mm
long; dorsocentrals irregularly biserial, slightly longer
than acrostichals, ending in 2—3 long black prescutellar
pairs; one presutural intra-alar (intrahumeral), one pre-
sutural supra-alar (posthumeral) and additional 5—8 setae
between dorsocentrals and presutural supra-alar seta; one
long postpronotal seta and several much shorter setulae;
2-3 notopleural setae and 1-3 rather long but fine setae
on anterior part of notopleuron; two pairs of black scute-
llars.
Legs. Brown, light grey microtrichose, with both whit-
ish and brown setae (Fig. 2b). Fore femur with rows of
setae ventrally slightly shorter than femur depth, dorsal
setae much shorter. Fore tibia with very short setulae ven-
trally, with irregularly arranged setae dorsally subequally
long as tibia depth. Mid femur with irregularly arranged
setae anteroventrally, slightly shorter than femur depth,
Jo ot ou Uo oo wom gy
200um
more ventral and thicker proximally and finer and more
anteroventral distally; posteroventral setae much longer,
on apical third longer than femur depth. Mid tibia with
rather dense fine setae anteriorly and anteroventrally;
posteroventral setae slightly thicker, more regularly ar-
ranged, all at most as long as tibia depth; dorsally with
short setae; in some specimens with poorly distinct 1—2
anterodorsal setae. Hind femur distinctly thickened and
flattened, with irregularly arranged rather dense and thick
pale antero- and posteroventral setae on distal two-thirds,
slightly shorter than femur depth; dorsal setae rather
long, especially on proximal part of femur, otherwise
shorter and finer setose. Hind tibia distinctly curved,
shortened and thickened (almost as in R. gibba (Fallén,
1816)), short setose ventrally, with 4—5 rather long pos-
terodorsal setae (up to 0.20—0.23 mm long). Tarsi of all
legs narrow and long, short setose, with apical circlets of
100um
Prrritirarerit
90.0um
Fig. 7. SEM of Rhamphomyia bhagati sp. nov. halter. a. General view of the dorsal side of the halter with robust
scabelum (Sc), pedicellus (Pe) and oval capitellum (Ca). b. Sensilla on the dorsal scabellum (D.Scab.) and dorsal
pedicellus (D.Ped.). ¢. Capitellum with single trichoid sensilla (arrows). d. Fine structure of the basal plate sensilla. e.
Fine structure of the flanking sensilla. f. Fine structure of the trichoid sensilla. g. General view of the ventral side of
halter. h. Flanking sensilla on the ventral pedicellum (V.Ped.). i. Single trichoid sensilla on the capitellum.
Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK
76 Miroslav Bartak et al.
Porrrtlerecl ff : = s tc ‘ po Pease
f 5.0Qum
100um
ioe Oo Uo tan o U
400um
——
- a
Too on 0 fo oo oo rae,
, < ge Wy ip : 5
100um 1 Oks .Orgat x1:80k-LIMCULe, Pott: — Oums. 40.0um
Imo 0 t 0 0 0 Teo
50.0um
1 1 ot oom oO
10.0um 2.00um
Fig. 8. SEM of Rhamphomyia bhagati sp. nov. legs. a. Coxa (cx) with long trichoid sensilla, trochanter (tr) femur (f)
with much shorter ones b. Single campaniform sensillum (arrow) on the proximal part of femur. ¢c. Fine structure of
the campaniform sensillum. d. Fine trichoid sensilla on the dorsal side (solid arrow) and thick and rigid chaetic sen-
silla (dotted arrow) on the ventral side of femur. e. Fine structure of the socket and basal part of trichoid sensillum on
dorsal femur. f. Fine structure of chaetic sensilla on ventral femur. g. Part of tibia with trichoid and chaetic sensilla.
h. Fine structure of dorsal tibiae with trichoid and chaetic sensilla. i. Fine structure of two kinds of chaetic sensilla
with thick and very fine apices on ventral tibia. j. Chaetic sensilla on the distal part of tibia (ti) and first tarsomere (t1).
k. Trichoid and chaetic sensilla on the third tarsomere. I. Trichoid sensilla on the fifth tarsomere (t5), curved claws
(clv) and pulvilli (pulv). m. Fine structure of claw. n. Fine structure of the tentent setae (ts). 0. Fine structure of the
tenent setae terminal plates.
Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK
A new Rhamphomyia from the Kashmir Himalayas
ut pil f eran
100um \
200u
Pourtrutlareel ib i ooo oo | } Pasorrbooaal
10!
I
s00um 400um Oum
SS —vthe
iF ae PSa ae
: SS ees bar
ote ai eT 1)
50.0um
Fig. 9. SEM of Rhamphomyia bhagati sp. nov. male and female genitalia. a. General view of male genitalia with
labelled phallus (ph) and cerci (cerc). b. Long and rigid chaetic sensilla on the genitalia. ce. Basal part of the phallus.
d-f. Fine structure of different parts of the phallus. g. Trichoid sensilla on the cerci (cerc). h. Trichoid and chaetic sen-
silla on the epandrium. i. Surface of the epandrium and fine structure of trichoid sensilla sockets j. Female abdomen.
k. Chaetotaxy of the terminal segments of female abdomen tergites 6—10 (tg6—tg10) and cerci (cerc). I. Fine structure
of seventh segment of abdomen. m. Genital pore. n—o. Chaetic sensilla on the last abdominal segment and cerci.
Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK
78 Miroslav Bartak et al.
setae and long claws. Posteroapical comb of hind tibia
with | long seta.
Wing. Clear, veins brownish-black to yellowish brown,
pterostigma brown, anal vein incomplete (apparent as de-
pigmented vein in basal two-thirds); anal lobe well de-
veloped with axillary angle right angled (Fig. 3a); basal
costal seta rather long, black. Halter yellow with brown
stem, calypter yellow with whitish fringes (Fig. 2b-—c).
Abdomen. Black, very light grey microtrichose, cov-
ered with whitish yellow setae; epandrium with black
setae and setulae (Fig. 2b—c). Lateral marginal setae on
tergites 2-4 subequally long as their segments, dorsal
setae and setae on segments 5—7 much shorter, sternites
with long, yellowish white setae, sternite 1 without se-
tae, sternite 8 with very long and dense setae (dorsally up
to 0.35 mm long). Segments 6—7 as simple unmodified
structures. Segment 8 with tergite and sternite separat-
ed; tergite 8 simple, somewhat C shaped viewed later-
ally, sternite 8 simple, enlarged, subrectangular in later-
al view. Terminalia as in Fig. 3b—d. Hypandrium short,
lustrous, without setae; epandrium extremely elongated
(apical part about 1.7 mm long), apex broadly rounded;
cercus elongate, lower cercus or subcercal process long
and thin, as an extension of the cercus; phallus filamen-
tous, with short basal swelling followed by S-shaped arc
and then broadly arching around epandrium exceeding
lamellae (total length of very thin hair-like phallus up to
5 mm).
Length. Body about 4.0-4.6 mm long, wing 3.6—
4.0 mm.
Female (Figs 2d-f, 3e, 9j-0)
Similar to male, but body setae much shorter and dark-
er; legs simple and short setose. Eyes dichoptic with all
facets almost equal in size (Fig. 2d). Frons approximately
0.15—0.18 mm, broad with 3—5 black or pale, rather long
setae on sides. Labrum black, labella with rather long se-
tae. Thoracic chaetotaxy: acrostichals and dorsocentrals
mostly black, dorsocentrals distinctly longer (Fig. 2e—f).
Both fore and mid femora short setose, longest (distal)
posteroventrals shorter than femur depth. Both fore and
mid tibiae very short setose, without prominent setae.
Hind femur with only a few anteroventral setae on dis-
tal half, slightly shorter than femur depth, otherwise very
short setose (including very short posteroventrals). Hind
tibia with several antero- and posterodorsal setae as long
as tibia diameter. Terminalia as in Fig. 3e. Length: body
3-3.5 mm; wing 3.4—3.6 mm.
Etymology. The species is named in the honour of Pro-
fessor Ramesh Chander Bhagat.
Remarks. The species described above 1s allied to
Pararhamphomyia with extremely elongated epandri-
um and very long and extremely thin, hair-like phallus,
present (but not in such an extreme form) as in R. (P.)
tenuiterfilata Becker, 1900 or R. (P.) longestylata Frey,
Bonn zoological Bulletin 70 (1): 67-84
1916. However, the former species has the mesoscutum
disc shiny and the latter has all body setae black. The
new species shares some affinities with R. himalayana,
but differs in having the abdomen with long pale setae;
labrum distinctly longer than head height; wing clear
with pterostigma brown; thorax with a few long and pale
setae, whilst R. himalayana has the abdomen with only
short blackish setose; labrum as long as head height; wing
pale brownish without distinct pterostigma and thorax se-
tae short and blackish. The male terminalia of the new
species share some similarities with R. macrura Loew,
1871. However, the two species can be differentiated by
combination of the following characters: R. macrura 1s
entirely black setose species with dark halter and peculiar
comb of ventral setae on mid basitarsus. Moreover, male
terminalia also differs slightly: basal part is bent ante-
riorly and epandrial lamellae are much narrower, whilst
the new species has yellow halter, mid basitarsus without
peculiar setae, basal part of terminalia not bent anteriorly
and the epandrial lamellae are broader.
Notes on SEM morphology of Rhamphomyia bhagati
Sp. nov.
The male is generally similar to the female, except for
the normal sexual dimorphism. The general morphology
of the male specimen with the ratios of body appendages
can be observed on Fig. 4.
Head, antennae and mouthparts
The ommatidia of the compound eye are tightly and reg-
ular deployed 20—25 um, with dimorphism of the omma-
tidia in the upper and the lower half (Fig. 5a—c). The ocel-
li are rounded, slightly convex, 31—47 um, with slightly
developed sclerotic rim on the edges (Fig. 5b). All an-
tennomeres are deeply covered by numerous short and
fine sclerotic microtrichia without sockets and different
number of sensilla with visible sockets (Fig. 5d). Lateral
sides of the scape and pedicel bear quite long, thick, rigid
and deeply ribbed type III trichoid sensilla with pointed
apices (Fig. 5e), whereas the pedicel bears additionally
much shorter type IV trichoid sensilla with very fine and
pointed apices (Fig. 5f). Type III trichoid sensilla on the
scape are 22—25 um long whereas those on the pedicel are
30-60 um long. Type IV trichoid sensilla on the scape are
only 5—6 um long. The postpedicel is the larger segment
with expanded and convex ventral basal part (Fig. 5g).
The whole surface of this segment is densely covered by
numerous short and fine microtrichia and its ventral side
bears numerous basiconicsensilla (most probably type I)
(Fig. 5g—h). The sensilla are rather regular, lengthwise
located. They are 5—9 um long, mostly covered by wax
layer but on the raw sensilla porous surface can be seen
(Fig. 51). The stylus is densely covered by numerous mi-
crotrichia, its very apical part (mechanoreceptor) is raw
and seems to be porous (Fig. 5j). Labrum is covered by a
©ZFMK
A new Rhamphomyia from the Kashmir Himalayas 79
wax layer with pointed epipharyngeal blades (Fig. 5k—l).
The labium is densely covered by numerous microtrich-
ia, with thick long setae (chaetic sensilla), especially on
the dorsal side of labellum (Fig. 5m—n) and well-visible
pseudotracheae (Fig. 50).
Thorax, wings and legs
The thorax is densely covered by numerous, thin, short
and pointed microtrichia. They are slightly curved, have
rounded apices and a lot of wax secretion can be not-
ed between them. The dorsal side of thorax is covered
by thin, fine and pointed trichoid sensilla and very long,
thick, rigid and pointed chaetic sensilla. Both kinds of
sensilla are furthermore ribbed and the chaetic sensilla
arise from large, protuberant sockets (Fig. 6a—f). The
wing has a distinct wax layer, covered by numerous mi-
crotrichia (wing membrane) and chaetic sensilla, espe-
cially on wing edges and wing articulation (Fig. 6g, i-l).
The surface of the basal part of the wing and wing artic-
ulation is densely covered by small pillow-shaped struc-
tures with short and conical projections (Fig. 6h). The
chaetic sensilla are thick and ribbed as on other parts of
the thorax (Fig. 61). The microtrichia are deployed regu-
larly, are fine, almost pointed and also slightly ribbed es-
pecially near the basal half (Fig. 6j-1). The halter 1s cov-
ered by numerous microtrichia with well-visible sensilla
plates on the scabellum and pedicellus and a large oval
capitellum (Fig. 7a—c). Dorsal scabellus is characterized
by well-visible and densely arranged spherical and pro-
tuberant basal plate sensilla (Fig. 7d), which also have a
linear orientation similar to flanking sensilla on the dor-
sal pedicel stem (Fig. 7e). The capitellum, besides short,
fine and pointed microtrichia, bears rather single trichoid
and campaniform sensilla (Fig. 7f). The ventral side of
the halter is rather similar but only on the ventral pedicel,
Table 1. Descriptive analysis of observed courtship characters.
linearly arranged flanking sensilla are visible and trichoid
sensilla on the capitellum (Fig. 7g—-1).
The legs are densely covered by numerous short, fine
and pointed microtrichia and mechanoreceptors. Many
long, fine and pointed trichoid sensilla are found on cox-
ae (Fig. 8a). On the basal inner side of femora a single
campaniform sensillum can be found. The campaniform
sensilla is about 5.5—6.5 um in diameter with quite pro-
tuberant inner part and without visible pore (Fig. 8b—c).
The femora bear besides microtrichia, fine and pointed
trichoid sensilla on the dorsal side and rigid and point-
ed chaetic sensilla (Fig. 8d). Both kinds of sensilla are
ribbed (but the trichoid sensilla are deeper ribbed) and
are characterized by well-developed and protuberant
sockets (Fig. 8e—f). Chaetic and trichoid sensilla are nu-
merous on the tibiae where they are located rather reg-
ularly (Fig. 8g), having the same morphology (Fig. 8h)
with the exception that some chaetic sensilla on the ven-
tral side have elongated and very fine apices (Fig. 81).
Distal parts of tibiae and tarsomeres are characterized
by larger numbers of chaetic sensilla, while distal part of
the last tarsomere bears more trichoid sensilla (Fig. 8j-1).
Claws with proximal halves covered by pointed microtri-
chia. The distal halves are curved and ribbed (Fig. 8m).
Ventral side of the pulvilli are characterized by numerous
and regularly arranged tenent setae with flat capitate ter-
minal plates (Fig. 8n—o).
Male and female terminalia
The terminal part of the male abdomen is densely cov-
ered by very long, rigid and pointed chaetic sensilla
(Fig. 9a—b). The basal part of the phallus is very smooth,
enlarged, with an evident indentation on the ventral side
(Fig. 9c—d). The rest of the phallus is also smooth but
often covered by waxy secretions, especially on the apex
which is double pointed (Fig. 9e—f). The cercus and ep-
Character | ANOVA test results
Source of Variation
between groups SS df MS F P-value F crit
within groups
LH between groups 318.94 ) 159.47 2.47 0.08 3.06
within groups 8521.46 132 64.55
ML between groups 0.42 2 0.21 1.62 0.20 3.06
within groups 17.46 132 0.13
FL between groups 0.95 2 0.47 1.61 0.20 3.06
within groups 38.92 132 0.29
DC between groups 1000.84 2 500.42 0.98 0.37 3.07
within groups 60760.34 120 506.33
Abbreviations: LH = Lek height; ML = Male length; FL = Female length; DC = Duration of copulation
Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK
80 Miroslav Bartak et al.
Fig. 10. Courtship rituals of Rhamphomyia bhagati sp. nov. a. Male occupy terminal tips prior to aerial flights for
raids. b. Aerial nematoceran swarms. ec. Aerial hunting male swarms. d—f. Aerial raids on male nematocerans. g. Male
with captured prey.
Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK
A new Rhamphomyia from the Kashmir Himalayas 81
Fig. 11. Courtship rituals of Rhamphomyia bhagati sp. nov. a. Tangled male and female land on the leaf. b-c. Male
and female in copulation. f, i. Female terminates copulation, and female with leftover prey. e, h. Male terminates cop-
ulation and predated by spider. d, g. Male and female resumes flower visiting.
Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK
82 Miroslav Bartak et al.
Table 2. Correlation among factors affecting duration of cop-
ulation.
Correlation table (n = 572)
DC LH
FL -0.04 -0.06
ML 0.08 -0.07
LH -0.04 1
andrium are characterized by numerous microtrichia,
trichoid and long chaetic sensilla (Fig. 9g—1). The female
terminal segments (besides the very last ones and cer-
cl), especially the tergites appear with less microtrichia
as they are partially retracted into the proximal segment
(Fig. 9j-l), while the ventral sides and cerci are charac-
terized by more chaetic sensilla (Fig. 9m—o).
Courtship rituals
The male and female flies are frequent flower visitors,
without showing any strong territoriality. These are ob-
served visiting flowers from April to June with increase
in incidence towards the middle half of June. Most of the
major temperate fruit crops from the region are visited
by these insects. However, it seems that the white floral
varieties of almond, apple, cherry, pear, plum, and quince
plants are preferred over pink floral varieties of apricot,
peach and nectarine. Apart from being flower visitors,
these flies are seen forming courtship lek swarms during
different phases of the day. On cloudy, cooler days with
suitable conditions, lek swarms are more frequently seen
compared with hot days. Most of the lek sites orient in
Open areas in an otherwise complete canopy (Fig. 10a).
The aerial swarms were usually formed at 74.83 +
8.12 cm from the ground with lower and higher heights
of 60 and 95 cm respectively. These flies usually do not
form swarms above 100 cm, although may attain individ-
ual flight heights of about 300-500 cm. Before the for-
mation of mating swarms, males raid small nematocerans
(Fig. 10b—f) and carry this prey as nuptial gifts to the lek
swarms, where other males also display their captured
raid to the nearby hovering females. All males capture
small male chironomid midges of a particular species,
and no polymorphism in gift giving was observed. The
males after capture of midges may settle on nearby veg-
etation and reorient the prey, before entering the swarm
(Fig. 10g) or they may directly enter the lek after cap-
turing the prey. The prey presentation to the female by
male occurs in the air. The male displays captured prey
by holding it in between the hind legs and hovering near
females in air. Females approach the males in the mid-air
for accepting the prey and to mate. Coupling takes place
abruptly and as the female accepts the gift; a male gets
a better hold of the female in the air with his mid legs.
Bonn zoological Bulletin 70 (1): 67-84
Soon the tangled couple with prey settles along the un-
derside of a leaf with the help of the forelegs of the male
(Fig. 1la). The couple rearranges with the female getting
a proper hold of the prey and starting to consume it, while
the male gets hold of the leaf with its forelegs and ori-
ents for the genital union (Fig. 11b—c). It was observed
that the extremely elongate phallus helps detain an ini-
tially wilting female until the ejaculate is transferred.
The mean duration of copulation (seconds) was 137.27 +
23.57, ranging from 87—190. Upon completion the male
terminate copulation by releasing its hold of the vegeta-
tion. This makes the pair separate either on downward
descent or on impact with the ground. The mated pair is
frequently also disturbed by other insects. In these cases
mainly the female terminates the copulation, by beating
her wings and it may stay with the prey for some time
(Fig. 11f-1). If mating was interrupted in an earlier stage,
the male keeps hold of the prey and re-enters the lek
(Fig. lle); sometimes interruption to mating is caused
by predation of either male or female by spiders, rob-
ber flies and other predator insects (Fig.11h). Excluding
these episodic behavioral events, both male and female
suck nectar to fulfill most of their dietary requirements
(Fig. 11d, g).
The correlation coefficient exhibited a non-significant
negative relationship of female body length with both du-
ration of copulation and lek height from the ground (Ta-
bles 1—2). Females with higher body sizes usually take at
a lower lek height and have lower duration of copulation,
as against females of lower body size who exhibit a high-
er duration of copulation and show a higher lek height
from the ground. Males with larger body size exhibited a
higher duration of copulation (r = 0.08, p > 0.05), how-
ever, with lek height, a non-significant negative relation-
ship was recorded (r = -0.07, p > 0.05). A non-significant
negative relationship also existed between duration of
copulation and lek height (r = -0.04, p > 0.05), suggest-
ing that at lower heights the duration of copulation was
higher and vice-versa. This may be explained by envi-
ronmental factors like wind and gravity, which makes the
attachment to the leaves continuously challenging for the
compromised couples. However, the statistical signifi-
cance of the various observations exhibited that except
for the lek height, none of the other variables were statis-
tically significant at 95% probability and require further
understanding.
Conclusion
Several hypotheses have tried to correlate diversification
rate and traits presumed to intensify sexual selection. The
typical empidine suite of mating behaviors is of particu-
lar interest for understanding such proposed hypotheses
and processes of speciation. During the present study,
observations were made on some of the courtship ritu-
als performed by the new species. Whether some of the
©ZFMK
A new Rhamphomyia from the Kashmir Himalayas 83
exhibited dimorphic sexual structures have any impact
to facilitate speciation and scale relationships among
conspecific members, needs to be explored further. By
using SEM, a more precise picture of the body surface of
these insects was revealed, which in future can facilitate
and clarify function of various parts of the body and even
assist in character identification and misidentification as-
pects in their systematics.
Acknowledgements. The Corresponding author would like
to thank Department of Science and Technology (DST), Govt.
of India, New Delhi for research encouragement and finan-
cial assistance rendered via; N-PDF Fellowship program: File
No: PDF/2015/000866 while the third author gratefully ac-
knowledges the Scholarship for Outstanding Young Scientists
from the Ministry of Science and Higher Education of Poland
(1165/E-340/STYP/12/17). All the authors would also like to
thank Prof. Darryl Gwynne (University of Toronto, Mississau-
ga, Canada), Dr Luc Bussiére (Biological and Environmental
Sciences, University of Stirling, United Kingdom), Mr Suhaib
Firdous Yatoo (Centre for Biological Diversity, CBD) and Dr
M. Javaid Dad (DST- Young Scientist, ICAR- CITH) for their
valuable suggestions. Sincere thanks are due to the director of
CITH for facilitates made available. Thanks are extended to
anonymous reviewers for improving the manuscript with in-
valuable comments and suggestions.
REFERENCES
Alfred JRB, Das AK, Sanyal AK (1998) Faunal Diversity in In-
dia. Published by ENVIS Centre, Zoological Survey of India,
Calcutta i-viit: 1-495
Akbar SA, Dar MA, Mahendiran G, Wachkoo AA (2018) The
first record of pear psylla Cacopsylla bidens (Hemiptera:
Psyllidae) from India along with notes on seasonal occur-
rence and some elements of its biology. Oriental Insects 52
(1): 101-11. https://doi.org/10.1080/00305316.2017.1378598
Akbar SA, Nabi SU, Mansoor S, Khan KA (2020) Morpho-mo-
lecular identification and a new host report of Bactrocera
dorsalis (Hendel) from the Kashmir valley (India). Inter-
national Journal of Tropical Insect Science 40: 315-325.
https://doi.org/10.1007/s42690-019-00083-w
Bartak M (1982) The Czechoslovak species of Rhamphomyia
(Diptera, Empididae), with description of a new species from
Central Europe. Acta Universitatis Carolinae — Biologica
1980: 381-461
Bartak M (2003) Revision of Palaearctic species of Rhampho-
myia (Megacyttarus) argentea group (Diptera: Empididae).
Acta Universitatis Carolinae Biologica 47: 197—245
Bartak M (2007) Five new European species of the Rhamph-
omyia (s.str.) albosegmentata group (Diptera: Empididae).
Revue Suisse de Zoologie 114(2): 417-435
Bartak M, Danielson R (2007) Revision of Rhamphomyia spe-
cies (Diptera, Empididae) described by J. W. Zetterstedt.
Acta Zoologica Universitatis Comenianae 47 (2): 105-114
Bartak M, Kubik S (2008a) New peculiar Eastern Palaearc-
tic Rhamphomyia (Diptera: Empididae). Entomological
News 119 (4): 338-344. https://doi.org/10.3157/0013-
872X-119.4.338
Bartak M, Kubik S (2008b) A new species of Rhamphomyia
(Pararhamphomyia) (Diptera: Empididae) from Thailand.
Bonn zoological Bulletin 70 (1): 67-84
Oriental Insects 42: 285-289. https://doi.org/10.1080/00305
316.2008.10417552
Bartak M, Kubik S (2008c) Four new West Palaearctic species
of the Rhamphomyia (s.str.) (Diptera: Empididae). Revue Su-
isse de Zoolgie 115 (1): 25-36
Bartak M, Kubik S (2009) Two new East Palaearctic
Rhamphomyia (Pararhamphomyia) (Diptera: Empidi-
dae). Entomological News 120 (1): 76-86. https://doi.
org/10.3157/021.120.0114
Bartak M, Kubik S (2010) Three new European species of the
Rhamphomyia (s.str.) melania group (Diptera: Empididae).
Revue Suisse de Zoologie 117 (1): 89-100
Bartak M, Kubik S (2012) A review of the Palaearctic species
of Rhamphomyia subgenus Holoclera (Diptera: Empididae)
with description of 5 new species. Revue Suisse de Zoologie
119 (3): 385-407
Bartak M, Kubik S (2015) Palaearctic species of Rhamphomyia
(Pararhamphomyia) anfractuosa group (Diptera, Empidi-
dae). ZooKeys 514: 111-127. https://doi.org/10.3897/zook-
eys.514.9379
Bartak M, Kubik 8, Civelek H, Dursun O (2014) New species
of Rhamphomyia (Diptera: Empididae) from Turkey with a
key to species of the Middle East and adjacent territories.
Zootaxa 3815 (1): 68-78. https://doi.org/10.11646/zoot-
axa.3815.1.4
Bartak M, Sinclair BJ (2003) Case 3269. Rhamphomyia (Rham-
Dhomyia) Meigen, 1822 and Rhamphomyia (Pararhampho-
myia) Frey, 1922 (Insecta: Diptera): proposed conservation
of usage of the subgeneric names by designation of Empis-
sulcata Meigen, 1804 as the type species of Rhamphomyia.
Bulletin of Zoological Nomenclature 60 (3): 203-205
Bezzi M (1904) Empididae Indo-australianiraccolti dal Signor
L. Biro. Annales Historico-Naturales Musei Nationalis Hun-
garici 2: 320-361
Bigot JMF (1889) Dipteres nouveaux ou peu connus, 34° par-
tie. XLII Empidi. Annales de la Société entomologique de
France (6) 9: 111-134
Brunetti E (1913) New Indian Empidae. Records of Indian Mu-
seum 9: 11-45
Brunetti E (1917) Diptera of the Simla district. Records of Indi-
an Museum 13: 59-101
Brunetti E (1920) Diptera Brachycera. The Fauna of British In-
dia, including Ceylon and Burma. Vol. 1. Taylor and Francis,
London
Chvala M (1994) The Empidoidea (Diptera) of Fennoscandia
and Denmark. Vol. III. Genus Empis. Fauna EntomologicaS-
candinavica 29. E.J. Brill, Leiden, New York, Koln
Collin JE (1960) Some Empididae from Palestine. Annals and
Magazine of Natural History Ser.13 (2): 385-420
Collin JE (1961) British Flies, Empididae. University Press,
Cambridge
Cumming JM (1994) Sexual selection and the evolution of
dance fly mating systems (Diptera: Empididae; Empidinae).
The Canadian Entomologist 102: 769-920
Daugeron C, Grootaert P (2005) Atypical mating behaviour in
the empidine dance fly Rhamphomyia (Lundstroemiella) ma-
gellensis (Diptera: Empididae: Empidinae). Belgian Journal
of Zoology 135 (1): 97-99
Grootaert P (2004) Family Empididae (Diptera, Brachycera).
Pp. 805-809 in: Yule CM & Sen YH (eds.) Freshwater In-
vertebrates of the Malaysian Region. Academy of Sciences,
Malaysia
Kessel EL (1955) The mating activities of balloon flies. Sys-
tematic Biology 4 (3): 97-104
©ZFMK
84 Miroslav Bartak et al.
LeBas NR, Hockham LR, Ritchie MG (2004) Sexual selection
in the gift-giving dance fly, Rhamphomyia sulcata, favors
small males carrying small gifts. Evolution 58(8): 1763—
1772. https://doi.org/10.1554/03-659
Mitra B, Roy S, Biswas O, Chakraborti U (2015) True flies
(Insecta: Diptera): Diversity and Endemism in Himachal
Pradesh, India. International Journal of Advanced Research
in Biology and BioTechnology 1 (1): 46-59
Moulton JK, Wiegmann BM (2007) The phylogenetic relation-
ships of flies in the superfamily Empidoidea (Insecta: Dip-
tera). Molecular Phylogenetics and Evolution 43: 701-713.
https://doi.org/10.1016/j.ympev.2007.02.029
Pape T, Blagoderov V, Mostovski MB (2011) Order Diptera
Linnaeus, 1758. Pp. 222-229 in: Zhang Z-Q (ed.) Animal
biodiversity: An outline of higher-level classification and
survey of taxonomic richness. Zootaxa, Magnolia Press,
Auckland, New Zealand. http://www.mapress.com/zootax-
a/2011/f/zt03148p229
Rhodén C, Wahlberg E. 2020. The phylogeny of Empis and
Rhamphomyia (Diptera, Empididae) investigated using
UCEs including an over 150 years old museum specimen.
Evolutionary Systematics 4: 21-33. https://doi.org/10.3897/
evolsyst.4.49537
Saigusa T (2012) A new Asio-Nearctic subgenus of Rham-
Phomyia (Diptera: Empididae: Empidinae). The Canadian
Entomologist 144 (2): 291-322. https://doi.org/10.4039/
tce.2012.28
Shah GM, Jan U, Wachkoo AA (2014) A checklist of hoverflies
(Diptera: Syrphidae) in the Western Himalaya, India. Acta
Zoologica Academiae Scientiarum Hungaricae 60: 283-305
Shamshev IV, Sinclair BJ, Khruleva OA (2020) The empidoid
flies (Diptera: Empidoidea, exclusive of Dolichopodidae) of
the Russian Arctic islands and Svalbard Archipelago. Zoo-
taxa 4848: 1-75. https://doi.org/10.11646/zootaxa.4848.1.1
Bonn zoological Bulletin 70 (1): 67-84
Sinclair BJ, Cumming JM (2006) The morphology, higher-lev-
el phylogeny and classification of the Empidoidea (Diptera).
Zootaxa 1180: 1-172
Sinclair BJ, Vajda EA, Saigusa T, Shamshev IV, Wheeler TA
(2019) Rhamphomyia Meigen of the Canadian Arctic Ar-
chipelago, Greenland and Iceland (Diptera: Empididae).
Zootaxa 4670 (1): 001-094. https://doi.org/10.11646/zoot-
axa.4670.1.1
Thompson FC (ed.) (2005) Biosystematic Database of World
Diptera. Online at http://www.diptera.org/Diptera/biosys.
htm [last accessed on 1 Nov. 2018]
Wachkoo AA, Akbar SA (2019) Protichneumon pisorius (Hy-
menoptera, Ichneumonidae) — the first record from India. Na-
tional Academy Science Letters 42 (5): 391-393. https://dol1.
org/10.1007/s40009-018-0775-2
Wachkoo AA, Shah GM, Jan U, Akbar SA (2017) A checklist of
soldierflies (Diptera, Stratiomyidae) in India. Journal of Asia-
Pacifc Biodiversity 10 (1): 44-54. https://do1.org/10.1016/j.
japb.2016.04.004
Walker F (1849) List of specimens of dipterous insects in the
collection of the British Museum. Part III, London: 485-687
Watts M, Winkler IS, Daugeron C, de Carvalho CJB, Turner SP,
Wiegmann BM (2016) Where do the Neotropical Empidini
lineages (Diptera: Empididae: Empidinae) fit in a worldwide
context? Molecular Phylogenetics and Evolution 95: 67—78.
https://doi.org/10.1016/j.ympev.2015.10.019
Wilkinson GS, Johns PM (2005) Sexual selection and the evo-
lution of mating systems in flies. Pp. 312-339 in: Yeates
DK & Weigmann BM (eds) The Biology of the Diptera. Co-
lumbia University Press, New York.
Yang D, Zhang K, Yao G, Zhang J (2007) World catalog of
Empididae (Insecta: Diptera). China Agricultural University
Press, Beijing
©ZFMK
Bonn zoological Bulletin 70 (1): 85-95
2021 - Stuke J-H.
https://do1.org/10.20363/BZB-2021.70.1.085
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:lsid:zoobank.org:pub:7C2593 FA-2C3F-4134-8 1 0F-011EC81B42C0
New European species of Athyroglossa Loew, 1860
(Diptera: Ephydridae)
from Finland and the Republic of Georgia
Jens-Hermann Stuke
Roter Weg 22, D-26789 Leer, Germany
Email: [email protected]
urn:Isid:zoobank.org:author:27ED8CBD-9201-4983-8FE3-698FB499A0E0
Abstract. Athyroglossa (Athyroglossa) fennica spec. nov. (Finland) and Athyroglossa (Athyroglossa) kuraensis spec. nov.
(Georgia) are described. A key to European species of Athyroglossa is presented. The male terminalia and sternites 3—5 of
all European species are illustrated.
Key words. Ephydridae, Athyroglossa, Europe, Finland, Georgia, new species, key.
INTRODUCTION
Ephydridae, also known as shore flies, is a large family of
Diptera Acalyptratae with almost exactly 2000 described
species worldwide (based on author’s database). To date,
about 350 species are recorded from Europe. The mor-
phological diversity of Ephydridae is high and, as a proof
of that, 134 genera are currently distinguished. Certainly,
the number of known species will significantly increase
in the future if more taxonomic research and field work
are carried out on this family. Ephydridae are minute to
medium sized flies (0.6—11 mm) and their beauty only
reveals itself under high magnification. In addition to
the morphological diversity, there is also a wide range
of larval natural history with some larvae living in ex-
treme habitats like hot springs, geysers or pools of crude
oil (Mathis 2010). Most shore fly larvae and adults are
typically microphagous on microscopic algae, yeasts and
other unicellular forms, but there are predaceous larvae
and adults, with some species preying on egg masses of
amphibians and spiders (Wirth et al. 1987).
The genus Athyroglossa Loew, 1860 belongs to the
Gymnomyzinae (Gymnomyzini) and is divided into
two subgenera, namely Athyrogiossa s. str. and Par-
athyroglossa Hendel, 1931. There are 36 species known
worldwide with records from the Nearctic (eight species),
the Neotropics (11 species), the Palaearctic (12 species),
the Oriental (one species) and the Australasian (five spe-
cies) Regions. In Europe only four species have been
recorded so far, and these were reviewed by Mathis &
Zatwarnicki (1990). The most recent comprehensive
diagnosis of the genus is given by Mathis et al. (2017).
All we know about the natural history of Athyroglossa
Received: 29.01.2021
Accepted: 05.03.2021
was published by Grimaldi & Jaenike (1983) and Kri-
vosheina & Ozerov (1990).
New material of Ephydridae has been collected all over
Europe since 2003 by the author, with the aim to pre-
pare identification keys to European species. One of the
first genera to be worked out was Athyroglossa and sur-
prisingly two undescribed species were discovered. Here
these two new species of Athyroglossa are described and
illustrated, and an identification key for the European
species of the genus is provided.
MATERIAL AND METHODS
Terminology follows Cumming & Wood (2017) and ge-
nus specific interpretations from Mathis et al. (2017).
Numbers of setae refer to one side of the body only. The
identification of previously described species was done
using Mathis & Zatwarnicki (1990). Nomenclature was
checked with the original descriptions. To investigate
the male terminalia the abdomen was dissected, macer-
ated for about three hours in an aqueous solution of so-
dium hydroxide NaOH,,,.. neutralized with acetic acid
CH,-COOH and stored together with the specimen in in
microvial filled with glycerine C,H(OH),. Indices are
defined in the text below. Labels of holotypes are list-
ed and numbered in the order found, commencing with
the uppermost. They are indicated with double quotation
marks. Line-breaks on labels are indicated by slashes. If
not noted otherwise, all specimens are collected by the
author, air dried, pinned on minuten and deposited in the
author's private collection (PJHS, Leer, Germany).
Corresponding editor: X. Mengual
Published: 08.04.2021
86 Jens-Hermann Stuke
Fig. 1. Habitus of Athyroglossa fennica spec. nov., holotype, 3.
RESULTS
Athyroglossa (Athyroglossa) fennica spec. nov.
(Figs 1, 3,9; 15, 21)
urn. lsid:zoobank.org:act:374E3C1C-15A0-4EBC-A79F-BOB14159325B
Type material
Holotype. FINLAND: <6; (1) ,,Fl Central Finland /
Kolima 3.7 km ese / Pihtipudas / [63,342°N 25,621°E] /
18.vu1.2020, leg. Stuke / 2667 [cross written]”. — (2) “Ho-
lotypus / Athyroglossa fennica 3 / spec. nov. 3 / Stuke
det. 2020”. [The specimen is pinned using a minuten and
is in excellent condition (Fig. 1). The holotype will be pre-
served in the collection of the Museum fiir Naturkunde —
Leibniz Institute for Evolution and Biodiversity Science,
Berlin, Germany (ZMB). ].
Paratypes. FINLAND: 1 <6, 18.vii.2020, Central
Finland, Kolima 3.7 km ESE Pihtipudas [63.342°N
25.621°E], leg. Stuke. — 1 @, 18.vii.2020, Central
Finland, Kolima 8.1 km ESE Pihtipudas [63,310°N
25:670°R)| les-Stuke:
Bonn zoological Bulletin 70 (1): 85—95
Description (holotype, ©)
Body length about 2.2 mm. Wing length = 1.9 mm. Head
height = 0.6 mm.
Head black. Gena-eye-ratio (in lateral view genal
height measured at the maximum eye height:eye
height) = 0.8. Antenna black. First flagellomere strongly
light brown dusted. Arista black, with 4—5 dorsal rays,
basal rays slightly shorter than height of basal aristomere.
Eye brown, all ommatidia about same size, no omma-
trichia recorded. Eye height-length-ratio (in lateral view
maximum eye height:maximum eye length) = 1.2. Ocelli
forming an isosceles triangle. Frons with distinct brown
dusting surrounding ocellar tubercle and reaching for-
ward to ptilinal fissure and posterolaterally to the dorsal
eye margin. Frontal triangle indistinct, reaching forward
to the ptilinal fissure. Frontal triangle polished, inter-
frontal vitta otherwise polished to very fine longitudinal
wrinkled. Facial grooves with indistinct facial carina.
Ventral face bulging and stretching ventrally beneath
the clypeus. Facial grooves and parafacia silver dusted.
Clypeus large, slightly wider than high, shiny, slightly
microsculptured. Gena large, polished in upper *%4 and
microsculptured in ventral ’4. Anteroventral margin and
©ZFMK
New European species of Athyroglossa Loew, 1860 from Finland and the Republic of Georgia 87
posteroventral margin of gena forming an angle of about
65°. Postcranium brown dusted to subshining. Palpus
brown, without setae. Proboscis reaching to mouth edge.
1 ocellar seta; 1 postocellar seta about as long as verti-
cal setae; 1 outer and 1 inner vertical seta; no postorbital
setae; 1 distinct reclinate and | distinct proclinate fron-
to-orbital-seta; 1 large dorsal, 1 smaller but still distinct
seta below and 3 minute facial setae; 1 distinct proclinate
genal seta.
Thorax black. Scutum finely microsculptured, scutel-
lum more roughly microsculptured. Scutum and scutel-
lum covered with short, brown, scattered setulae that are
not arranged in lines. Scutum medially distinctly dusted,
laterally shining. Scutellum subshining to shining. Ane-
pisternum with several setulae. Anepimeron, posterior
margin of anepisternum, meron, katatergite, subscute-
llum and dorsal *% of mediotergite dusted. Other pleu-
rae shining. no acrostichal seta; 0+1 dorsocentral seta;
O prescutellar seta; 1 intra-alar seta; O supra-alar seta:
1 small postpronotal seta; 2 notopleural seta, posterior
inserted above level of anterior; 0 postalar seta; 1 sub-
apical+3 indistinct lateral scutellar seta, only subapical
seta situated on a small tubercle; 1 small katepisternal
seta; | small anepisternal seta. Wing membrane slight-
ly brownish infuscated. Veins brown. Wing complete-
ly covered with microtrichia. Alula about four times as
wide as long. Dark brown setulae at hind margin of al-
ula about twice as long as alula. Costal index I (straight
line distance between the apices of R, and R,,, [section
2 of costa]:straight line distance between the apices of
R,,, and R,,, [section 3 of costa]) = 2.7. Costal index II
(straight line distance between the apices of R,,. and R,,,,
[section 3 of costa]:straight line distance between the api
ces of Media and R,,,. [section 4 of costa]) = 2.1. R,,.
vein-ratio (straight line distance along vein R,,, between
crossvein r-m and branch of R,,, and R,,, [Section | of
R,,,,|:distance apicad of r-m [section 2 of R,,.]) =0.1. M
vein-ratio (straight line distance along vein M between
crossveins dm-cu and r-m [section 1 of M]:distance
apicad of dm-cu [section 2 of M]) = 0.6. M vein-ratio
(straight line distance along vein M between crossveins
dm-cu and r-m:distance apicad of dm-cu) = 0.6. Base and
stem of halter brown, knob of halter black. Legs black
with tarsi lighter dark brown to yellow. Fore tarsi dark
brown, middle and hind tarsi brown. Legs mostly sub-
shining, all tibiae shining on dorsal surfaces. Legs cov-
ered with small setulae. Fore femur with conspicuous,
slightly longer, regular setulae arranged on posteroven-
tral surface, long setae anteroventrally towards the apex
of the middle femur and some regularly arranged pos-
teroventral setulae at the apex of the hind femur. Mid-
dle tibia distally with 2 ventral setae. Metatarsus II-tibia
II-ratio (length metatarsus 2:length tibia 2) = 0.5. Fore
femur distally with 2 inconspicuous posteroventral short
spines.
Bonn zoological Bulletin 70 (1): 85—95
Abdomen black. Tergites laterally reflexed under. Terg-
ites smooth. Tergite 1 completely dusted. Tergites 2+3
broadly dusted in the middle with a small shining hind
margin, dusted at the anterior margin and dusted at the
extreme lateral margin. Tergite 4 broadly dusted in an-
terior 2/3 of the middle and at the anterior margin. Terg-
ite 5 completely dusted dorsally. Tergites covered with
scattered black setulae. Tergite III-IV-ratio (length tergite
3 medially:length tergite 4 medially) = 0.9. Tergite I'V-
V-ratio (length tergite 4 medially:length tergite 5 medi-
ally) = 2.3.
Description of male postabdomen and sternites based
on | dissected paratype: Sternites 3—5 as shown in Fig. 3:
Sternites 3-4 moderately large, elongated. Sternite 5 di-
vided in two triangular sclerites. A small additional scler-
ite between sternites 4 and 5. Sternites 3—5 covered with
scattered setulae. Epandrium as Figs 9 and 15: hind mar-
gin about as long as cercus, without ventral protuberance
and therefore hind margin in lateral view almost straight.
Epandrium with minute setulae and hind margin behind
cerci with 4 strong setae. Cercus elongated, covered with
microtrichia and setae. Surstylus as Figs 9 and 15: elon-
gated, base broadened, dorsally concave, ventrally slight-
ly concave, posterodorsally separated from epandrium,
anteriorly upcurved and pointed anteromedially. No set-
ulae present on surstylus. Hypandrium as Fig. 21: with a
large anteriorly directed appendix that is almost as long
as wide and anteriorly hollowed out. Additionally, with
a narrow ventrally directed appendix. Postgonite elon-
gated, anteriorly rounded, dorsally almost straight, and
ventrally without indentation. Pregonite distinct, slight-
ly shorter than high, dorsally semicircular and ventrally
straight.
Variability. The dusting of the frons can cover almost
all of the frons. Wing may be almost hyaline. Apical tar-
someres may be black.
Female. Female unknown.
Diagnosis. This species is easily recognised by the com-
bination of black fore tarsi and long postocellar seta. The
only other Palearctic Athyroglossa with black fore tarsi is
A. flaviventris (Meigen, 1830), and it has a reduced pos-
tocellar seta. Additional characters to separate both spe-
cies are given in the key below. With the table of the West
Palearctic species presented by Mathis & Zatwarnicki
(1990) A. fennica spec. nov. will key out at couplet 4 with
the separation of A. flaviventris and A. glabra (Meigen,
1830) where a decision to one of the keys alternatives
is not possible anymore. In the key to Nearctic species
(Wirth 1970), A. fennica spec. nov. will be identified as
A. glabra.
©ZFMK
88 Jens-Hermann Stuke
Fig. 2. Habitus of Athyroglossa kuraensis spec. nov., holotype, @.
Etymology. The Latin female adjective “fennica” de-
scribes the known distribution of this new species that is
known thus far from central Finland.
Distribution. Although the author visited 128 locations
all over Finland to collect Ephydridae and several looked
very similar to the locations of A. fennica, this new spe-
cies was only recorded at two adjacent sites in central
Finland.
Ecology. All specimens were collected along man-made
shores with sparse vegetation of a lake. One locality is a
larger harbour, the other one a small area that is used for
fishing and bathing. Such localities are the only locations
where collecting Ephydridae was successful at large
Finnish lakes. At one of the locations A. glabra occurred
together with A. fennica spec. nov.
Bonn zoological Bulletin 70 (1): 85-95
Athyroglossa (Athyroglossa) kuraensis spec. nov.
(Figs 2, 6, 12, 18, 24)
urn: lsid:zoobank.org: act: 30B 1D772-4884-464 B-B308-86441830440B
Type material
Holotype. GEORGIA: 3; (1) “Georgia, Debeda River /
n Kirach-Mughanlo / (41,340°N 45,051°E) / 30.06.2019,
Stuke leg. / 2459 [cross written]”. — (2) “Holotypus
/ Athyroglossa kuraensis & / spec. nov. 3 / Stuke det.
2020”. [The specimen is pinned using a minuten and is
in excellent condition (Fig. 2). The holotype will be pre-
served in the collection of the Museum fiir Naturkunde —
Leibniz Institute for Evolution and Biodiversity Science,
Berlin, Germany (ZMB). |
Paratypes. GEORGIA: 4 33, 1 9: 30.vi.2019, Debe-
da River E of Kirach-Mughanlo [41,334°N 45,068°E];:
4 33,2 29; 30.vi.2019, Debeda River N of Khan-
ji-Gazlo [41,357°N 45,005°E], leg. Stuke. — 7 42,
322; 30.v1.2019, Debeda River n Kirach-Mughanlo
[41,340°N 45,051°E], leg. Stuke. — 1 9; 30.vi.2019,
Kura River 1.6 km E of Ilmazo [41,428°N 45,043°E],
©ZFMK
New European species of Athyroglossa Loew, 1860 from Finland and the Republic of Georgia 89
Figs 3-8. 3; sternites 3-5 (ventral view) of European Athyroglossa. 3. Athyroglossa fennica spec. nov. 4. A. flaviventris (Meigen,
1830). 5. A. glabra (Meigen, 1830). 6. A. kuraensis spec. nov. 7. A. nudiuscula Loew, 1873. 8. A. ordinata Becker, 1896. Abbrevi-
ations: S3 = sternite 3; S = sternite 5.
Bonn zoological Bulletin 70 (1): 85—95 ©ZFMK
90 Jens-Hermann Stuke
Figs 9-14. Epandrium, surstylus and cercus (dorsal view) of European Athyroglossa. 9. A. fennica spec. nov. 10. A. flaviventris
(Meigen, 1830). 11. A. glabra (Meigen, 1830). 12. A. kuraensis spec. nov. 13. A. nudiuscula Loew, 1873. 14. A. ordinata Becker,
1896. Abbreviations: ce: cercus, ep: epandrium, su: surstylus.
leg. Stuke. — 1 9; 30.vi.2019, Kura River 2.0 km ESE
Ilmazo [41,420°N 45,044°E], leg. Stuke.
Description (holotype, ©)
Body length about 2.3 mm. Wing length = 1.8 mm. Head
height = 0.7 mm.
Head black. Gena-eye-ratio (in lateral view genal
height measured at the maximum eye height:eye
height) = 0.7. Scape black, pedicel and first flagellomere
orange brown. First flagellomere strongly white dusted.
Arista black, with 9 dorsal rays, basal rays slightly longer
than width of basal aristomere. Eye brown, all ommatidia
about same size, with minute ommatrichia. Eye height-
length-ratio (in lateral view maximum eye height:max-
imum eye length) = 1.5. Ocelli forming an isosceles tri-
angle. Frons shining. Frontal triangle indistinct, reaching
Bonn zoological Bulletin 70 (1): 85—95
forward to the ptilinal fissure. Frontal triangle polished,
interfrontal vitta otherwise fine longitudinal wrinkled.
Facial grooves with indistinct facial carina. Ventral face
bulging and stretching ventrally beneath the clypeus.
Facial grooves and parafacia strongly silver dusted.
Clypeus large, slightly wider than high, shiny, slightly
microsculptured. Gena large, polished in upper 7% and
microsculptured in ventral “4. Anteroventral margin and
posteroventral margin of gena forming an angle of about
65°. Postcranium subshining. Palpus brown, without se-
tae. Proboscis reaching to mouth edge. Chaetotaxy head:
1 ocellar seta; 1 postocellar seta about as long as vertical
setae; 1 outer and | inner vertical seta; several minute
postorbital setae; 1 distinct reclinate fronto-orbital-seta
and 2 minute proclinate front-orbital setae; 1 large dorsal
©ZFMK
New European species of Athyroglossa Loew, 1860 from Finland and the Republic of Georgia 9]
es
Figs 15-20. Epandrium, surstylus, hypandrium and cercus (lateral view) of European Athyroglossa. 15. A. fennica spec. nov.
16. A. flaviventris (Meigen, 1830). 17. A. glabra (Meigen, 1830). 18. A. kuraensis spec. nov. 19. A. nudiuscula Loew, 1873.
20. A. ordinata Becker, 1896. Abbreviations: ce = cercus; ep = epandrium; hyp = hypandrium; hypb = hypandrial bar; phyp =
projection of hypandrium; su = surstylus.
and about 8 minute (difficult to see) facial setae; 1 dis-
tinct proclinate genal seta.
Thorax black. Scutum finely microsculptured, scutel-
lum more roughly microsculptured. Scutum and scute-
llum covered with short, brown, scattered setulae that
are not arranged in lines. Scutum medially subshining
to slightly dusted, laterally shining. Scutellum subshin-
ing. Anepisternum with several setulae. Posterior half of
anepimeron, meron, katatergite, subscutellum and dorsal
half of mediotergite dusted. Other pleurae shining. Chae-
totaxy thorax: no acrostichal seta; 0+1 dorsocentral seta;
O prescutellar seta; 1 intra-alar seta; O supra-alar seta:
1 small postpronotal seta; 2 notopleural seta, posterior
inserted above level of anterior; 0 postalar seta; 1 sub-
apical+1 lateral scutellar seta, both situated on small tu-
Bonn zoological Bulletin 70 (1): 85—95
bercles; 1 small katepisternal seta; 1 small anepisternal
seta. Wing membrane hyaline, indistinctly darker around
dm-cu. Veins white but dm-cu, middle part of R,,,, mid-
dle part of R,,, and apex of CuA, dark brown. Wing com-
pletely covered with microtrichia. Alula about twice as
wide as long. Dark brown setulae at hind margin of alula
about as long as alula.
Costal index I (straight line distance between the api-
ces of R, and R,,, [section 2 of costa]:straight line dis-
tance between the apices of R,,, and R,,. [section 3 of
costa]) = 3.0. Costal index II (straight line distance dis-
tance between the apices of R,,, and R,,, [section 3 of
costa]:straight line distance between the apices of Me-
dia and R,,. [section 4 of costa]) = 2.1. R,,, vein-ratio
(straight line distance along vein R,,. between crossvein
©ZFMK
92 Jens-Hermann Stuke
22 (ees
Figs 21-26. 3; Hypandrium (ventral view) of European Athyroglossa. 21. A. fennica spec. nov. 22. A. flaviventris (Meigen, 1830).
23. A. glabra (Meigen, 1830). 24. A. kuraensis spec. nov. 25. A. nudiuscula Loew, 1873. 26. A. ordinata Becker, 1896. Abbrevia-
tions: hypb = hypandrial bars; phyp = projection of hypandrium.
r-m and branch of R,,. and R,, [Section 1 of R
4+5 243 “il :dis-
tance apicad of r-m [section 2 of R,,.])=0.2. M vein-ratio
(straight line distance along vein M between crossveins
dm-cu and r-m [section 1 of M]:distance apicad of dm-
cu [section 2 of M]) = 0.5. Base and stem of halter light
brown, knob of halter white. Legs black with apex of fore
and hind tibiae yellow and middle tibia yellow. All 3 basal
tarsomeres light yellow. Legs partly silver to grey dusted
with middle tibia completely dusted. Legs covered with
small setulae. Obvious are slightly longer posteroventral
setulae on the fore femur. Middle tibia distally with 2
ventral setae. Metatarsus []-tibia II-ratio (length meta-
Bonn zoological Bulletin 70 (1): 85—95
tarsus 2:length tibia 2) = 0.5. Fore femur distally with 5
inconspicuous posteroventral short spines.
Abdomen black. Tergites laterally reflexed under. Terg-
ites smooth. Tergite 1 completely dusted. Tergites 2+3
broadly dusted in the middle. Tergite 4 broadly dusted
in anterior 2/3 of the middle, tergite 5 only with a small
central macula. Tergites covered with single brown setu-
lae. Tergite HI-I'V-ratio (length tergite 3 medially:length
tergite 4 medially) = 0.8. Tergite IV-V-ratio (length terg-
ite 4 medially:length tergite 5 medially) = 2.2.
Description of male postabdomen and sternites based
on 3 dissected paratypes: Sternites 3—5 as shown in
©ZFMK
New European species of Athyroglossa Loew, 1860 from Finland and the Republic of Georgia 93
Fig. 27. Records of Athyroglossa kuraensis spec. nov.
Fig. 6: Sternite 4 large, almost square, sternite 3 small-
er. Sternite 5 divided into 2 large triangular sclerites. No
additional sclerite between sternites 4 and 5. Sternites
slightly dusted and with scattered setulae. Sternite 5 with
obvious long setae on the hind margin. Epandrium as
Figs 12, 18: hind margin with 10 strong setae and without
ventral protuberance and therefore hind margin in later-
al view almost straight. Cercus elongated, covered with
microtrichia and setae. Surstylus as Figs 12, 18: elongat-
ed, dorsally convex, ventrally concave, posterodorsally
fused with epandrium. Surstylus with few minute setulae.
Hypandrium as Fig. 24: with a large anteriorly directed
appendix that is almost as long as wide. Postgonite elon-
Bonn zoological Bulletin 70 (1): 85-95
gated, pointed, dorsally almost straight, and ventrally
with a subapical indentation. Pregonite distinct, with an
almost circular base and a pointed anterior tip.
Variability. The colouration of mid tibia varies between
yellow and light brown. The amount of dusting on scu-
tum may be less in older specimens.
Female. Females do not differ from males other than in
characters of the postabdomen.
Diagnosis. Athyroglossa kuraensis spec. nov. has a re-
duced postocellar seta, white halteres, dark brown to
©ZFMK
94 Jens-Hermann Stuke
black fore and hind tibiae and white basal fore tarsomeres
and therewith can be only confused with 4. nudiuscula.
A. nudiuscula Loew, 1873 is compared with A. kuraen-
sis spec. nov. in the key below. The most obvious diag-
nostic character of A. kuraensis spec. nov. is the slightly
dusted scutum and scutellum. With the table of the West
Palaearctic species of Mathis & Zatwarnicki (1990)
A. kuraensis spec. nov. will be identified as non-Euro-
pean A. argyrata. Both species share important charac-
ters, such as dusting of the scutum and scutellum, white
veins at the wing base and antenna that are partly orange.
However, 4. argyrata has a distinctly microsculptured
face below the antennal grooves (polished in A. kuraen-
sis), light yellow orange hind tibia (brown to black in
A. kuraensis), dorsally shining middle tibia (completely
dusted in A. kuraensis spec. nov.) and obviously dusted
parafacial and facial ridge (only parafacial partly dusted
in A. kuraensis spec. nov.).
Etymology. This species is named after the Kura river.
The type material originates from the Kura and its tribu-
tary, the Debeda river.
Distribution. Although Ephydridae have been collect-
ed all over eastern Georgia and suitable habitats with
other Athyroglossa species have been visited regularly,
A. kuraensis spec. nov. has only been recorded thus far
from a very small area at the border with Azerbaijan
(Fig. 27).
Ecology. All specimens of A. kuraensis spec. nov. were
collected by sweeping at shores of the Debeda or Kura
rivers or a nearby gravel pit with little or no vegeta-
tion. Sympatric species of Athyroglossa recorded at the
locations are A. nudiuscula and A. ordinata. However,
A. kuraensis spec. nov. was the most numerous species
among the collected specimens of Athyroglossa.
Key to European species of Athyroglossa Loew, 1860
1. Halter whitish; postocellar seta less than half the
length of vertical setae; arista with more than seven
branches, the longest of these longer than width of
basal flagellomere; < sternite 4 distinctly wider than
sternite 3, no additional sclerite between sternite 4 and
sternite 5 (Figs 6, 7); ¢ terminalia with epandrium
almost orbicular, posteriorly without protuberance,
and not reaching to tip of cercus (Figs 12-13, 18—
19); hypandrium narrow, hypandrial bars anteriorly
separated by an area of less strong sclerotisation,
and with a distinct anteriorly directed protuberance
ORT Pct PEE ae ee i i Se al ee 2
— Halter dark brown to black; postocellar seta longer
than half the length of vertical setae (exception
flaviventris), arista with less than seven branches
that are often shorter than the width of the first
Bonn zoological Bulletin 70 (1): 85-95
flagellomere; ¢ sternite 4 at most slightly wider than
sternite 3; a small additional sclerite between sternite
4 and sternite 5 (Figs 3-5, 8); 4 terminalia with
epandrium elongated or orbicular, sometimes with a
posterior protuberance; reaching or not reaching to
tip of cercus; hypandrial bars anteriorly fused, and
without distinct anteriorly directed protuberance
(Figs 9-11, 14-17, 20-23, 26) ooo. 3
Scutum shiny; scutellum almost flat, microsculptured,
shiny; tergites 3-4 at most dusted at hind margin;
middle tibia mainly black, dorsally shiny; veins
brown; <@ sternites 3-5 as Fig. 7: sternite 5 divided
into two triangular sclerites with short setae only; ¢
terminalia as Figs 13, 19, 25: anteriorly directed
protuberance of hypandrium wider than long ..........
O28 Fee We oe One nudiuscula Loew, 1873
Scutum with broad medial stripe of slight dusting;
scutellum smooth, convex and slightly dusted all
over; tergite 3 dusted medially over its whole length,
tergite 4 dusted medially for more than half of its
length; middle tibia mainly orange-yellow to light
brown, completely silver dusted; veins in basal half
of wing white; 3 sternites 3-5 as Fig. 6: sternite
5 divided into two ovate sclerites with long apical
setae; 3 terminalia as Figs 12, 18 & 24: anteriorly
directed protuberance of hypandrium about as wide
AS OTOP Mares ew Mn Bee wee kuraensis spec. nov.
Setulae on scutum in lines; fore femora without
posteroventral stout black setulae; scutellum convex,
polished; 3 sternites 3-5 as Fig. 8: sternites 3-4
elongated; sternite 5 divided into two small elliptic
sclerites, distance between these sclerites about
as long as maximum width of one sclerite; ¢
terminalia as Figs 14, 20, 26: epandrium elongated,
posteriorly with protuberance; almost reaching to tip
of cercus; hypandrium with posterodorsally directed
protuberance (Figs 14, 20) ... ordinata Becker, 1896
Setulae on scutum not arranged in lines; fore femora
with posteroventral stout black setulae; scutellum
flat, distinctly microsculptured; 3 at least sternite 4
broader, sternite 5 divided into two larger sclerites,
distance between these sclerites less than maximum
width of one sclerite (Figs 3—5); epandrium less
elongated, posteriorly without protuberance,
not reaching to tip of cercus (Figs 9-11, 15-
17); hypandrium without posteriorly directed
protuberance CF tes 21-23)... i evccccse thous deivssFamvetects 4
Postocellar seta minute, about as long as diameter
of ocellus; pedicel and base of basal flagellomere
orange; fore tarsi dark brown to black; frons shining;
parafacia silver dusted right next to antennal
groove; tergite 4 shiny, only narrowly dusted at fore
margin; 3 sternites 3-5 as Fig. 4: sternite 4 large,
broader than sternite 3; 3 terminalia as Figs 10, 16,
22: hypandrium a large sclerotised plate without
©ZFMK
New European species of Athyroglossa Loew, 1860 from Finland and the Republic of Georgia 95
distinct hypandrial bars; surstylus distally pointed
and curved upwards ......flaviventris (Meigen, 1830)
— Postocellar seta as long as vertical setae; at least
pedicel black; fore tarsi dark brown to black or
yellow; frons shining or partly dusted: parafacia at
eye margin completely shining or silver dusted up to
ventral eye margin; tergite 4 can be more dusted; 3
sternite 4 about as broad as sternite 3; hypandrium
smaller and with distinct hypandrial bars (Figs 21,
23); surstylus distally not curved upwards (Figs 9,
LPR sl NS ets crated. sthaatraaseata diate Mad ae cteanscalaacene, 2a 5
5 Basal two tarsomeres of all legs yellow white:
parafacia completely shining; frons completely
shining, might be subshining in some specimens;
scutum shining; tergite 4 shining, only narrowly
dusted at fore margin; 3 sternites 3-5 as Fig. 5:
sternites 3-4 large, about as broad as wide and
broader than sternite 5; 4 terminalia as Figs 11, 17,
23: epandrium in front of cerci narrow; surstylus
straight, apically rounded; hypandrium narrow and
with small lateral evaginations ..............000.cceeee
1 Saeeeerr 1). Ste eee, 2S glabra (Meigen, 1830)
— All fore tarsomeres black or dark brown, all other
tarsi at least partly black; parafacia dusted along
anteroventral eye margin: frons partly dusted; scutum
at least dusted in the centre; tergite 4 dusted for more
than half of its length in the middle; 3 sternites 3—5
as Fig. 3: sternites 3-4 narrow, distinctly narrower
than long and narrower than sternite 5; 4 terminalia
as Figs 9, 15, 21: epandrium in front of cerci
broad; surstylus slightly s-shaped, apically straight;
hypandrium broad and apically obviously indented
fennica spec. nov.
Acknowledgments. Eliana Buenaventura, Sven Marotzke and
Jenny Pohl, all from the Diptera collection of the Berlin Muse-
Bonn zoological Bulletin 70 (1): 85—95
um, helped to organise a loan of Athyroglossa specimens. Jenny
Pohl in particular invested much time searching for a historical
specimen of A. flaviventris. The Alexander Koenig Research
Museum supported the collecting trip to Georgia. Tony Irwin
(Norwich) and Wayne N. Mathis (Washington) read an earlier
draft of this manuscript, corrected the English and gave valu-
able hints.
REFERENCES
Cumming JM, Wood DM (2017) Adult morphology and termi-
nology. Pp. 89-133 in: Kirk-Spriggs AH, Sinclair BJ (eds)
Manual of Afrotropical Diptera. Volume 1. Introductory
chapters and keys to Diptera families. Suricata 4. Pretoria
Grimaldi DA, Jaenike J (1983) The Diptera breeding on skunk
cabbage, Symplocarpus foetidus (Araceae). Journal of the
New York Entomological Society 91: 83-89
Krivosheina M, Ozerov AL (1989) [Ecology and Morphology
of the Larvae of Athyroglossa glabra Meigen (Diptera, Eph-
ydridae) — Living in Corpses of Vertebrate Animals], in Rus-
sian. Biologi¢eskie Nauki 5: 47-50
Mathis WN (2010) Ephydridae (shore flies). Pp. 1211-1233 in:
Brown BV, Borkent A, Cumming JM, Wood DM, Woodley
NE, Zumbado MA (eds) Manual of Central American Dip-
tera. Volume 2. NRC Research Press, Ottawa
Wirth WW, Mathis WN, Vockeroth JR (1987): Ephydridae. Pp.
1027-1048 in: McAlpine, JF, Peterson, BV, Shewell, GE,
Teskey, HJ, Vockeroth, JR, Wood, DM (eds.): Manual of Ne-
arctic Diptera. Volume 2. Monograph of the Research Branch
Agriculture Canada 11, Ottawa
Mathis WN, Zatwarnicki T (1990) A Revision of the Western
Palearctic Species of Athyroglossa (Diptera: Ephydridae).
Transactions of the American Entomological Society 116:
103-133
Mathis WN, Zatwarnicki T, Stuke J-H, Deeming JC (2017) Or-
der Diptera, family Ephydridae. A conspectus on shore-flies
from the United Arab Emirates. Arthropod Fauna of the UAE
6: 636-761
Wirth WW (1970) A new Athyroglossa with a key to North
American species (Diptera: Ephydridae). Journal of the Kan-
sas Entomological Society 43: 315-319
©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 70 (1): 97-113
2021 - Gebicki C. et al.
https://do1.org/10.20363/BZB-2021.70.1.097
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org:pub:7EE18761-DDC9-46CB-B41A-30295DF72E24
Ugyopini of New Caledonia
(Hemiptera: Fulgoromorpha: Delphacidae: Asiracinae)
with a description of Notuchus linnavuorii sp. nov.
Cezary Gebicki', Marcin Walczak”", Piotr Krupa’ & Malgorzata Kalandyk-Kolodziejczyk*
"3 Jan Dilugosz University in Czestochowa, Faculty of Science & Technology, Armii Krajowej 13/15,
PL-42-200 Czestochowa, Poland
2 4University of Silesia, Faculty of Natural Sciences, Institute of Biology, Biotechnology and Environmental Protection,
Bankowa 9, PL-40-007 Katowice, Poland
“Corresponding author: Email: [email protected]
'urn:lsid:zoobank.org:author:}6FC4935A-D82E-45BE-BD77-8E9EFEB9BFDD
?urn:lsid:zoobank.org:author:046FOD52-7FBA-4D7D-9F79-AEBF7F2C98B8
3urn:Isid:zoobank.org:author: BA76E970-D883-457E-B171-DBE1C8012232
*urn:Isid:zoobank.org:author:600C5C5B-38C0-4F26-99C4-40A4DC8BBO016
Abstract. The paper presents information about species of Ugyopini, Fennah, 1979 from New Caledonia. One new spe-
cies from New Caledonia is described, Notuchus linnavuorii sp. nov., with notes on the morphological details of selected
external structures. An identification key to all of the species of Notuchus Fennah, 1969 and a checklist of the species
of this genus are also provided. The male terminalia of three species of the genus Ugyops Guérin-Méneville, 1834 (U.
inermis Distant, 1920, U. nemestrinus Fennah, 1969 and U. taranis Fennah, 1964) are described and illustrated for the
first time.
Key words. Delphacidae, Ugyopini, Notuchus, Ugyops, new species, key to species, checklist, New Caledonia.
INTRODUCTION
The genus Notuchus Fennah, 1969 (type species Notu-
chus risioides Fennah, 1969) together with the genera
Canyra Stal, 1862 (type species — in original combina-
tion: Delphax placida Stal, 1854), Melanugyops Fen-
nah, 1956 (type species Melanugyops erebea Fennah,
1956), Perimececera Muir, 1913 (type species Per-
imececera giffardi Muir, 1913), Ugyopana Fennah, 1950
(type species Ugyopana cassia Fennah, 1950), Ugyops
Gueérin-Méneville, 1834 (type species Ugyops percher-
onii Guérin-Meéneville, 1834), and Serafinanat Gebicki
& Szwedo, 2000 (type species Serafinana perperunaet
Gebicki & Szwedo, 2000) comprise the tribe Ugyopi-
ni within the Asiracinae subfamily (Gebicki & Szwedo
2000; Urban et al. 2010; Bourgoin 2020). The genus Notu-
chus comprises nine endemic species, which are found
in Australia (Queensland) — N. kurandae Donaldson,
1979 (syn. N. palmerstonensis Donaldson), N. oresbios
Donaldson, 1988 and N. rotundifacies Donaldson, 1979
(Donaldson 1979, 1983, 1988); on Lord Howe Island —
N. howensis Donaldson, 1987 and N. monticola Fennah,
1973 (Donaldson 1987; Fennah 1973); in New Caledo-
nia — N. risioides Fennah, 1969, and three cavernicolous
species known only from New Caledonia: N. kaori Hoch
Received: 21.01.2020
Accepted: 18.02.2021
& Asche, 2006, N. /arvalis Fennah, 1980 and N. ninguae
Hoch & Asche, 2006 (Fennah 1980; Hoch et al. 2006).
The representatives of this genus differ significantly from
other Delphacidae in their general exterior and head mor-
phology, which partly results from their hidden, epigeic
life in the rainforest floor (Hoch et al. 2006).
N. linnavuorti Gebicki & Walczak sp. nov. represents
the species group monticola as its only representative in
New Caledonia. In its external structure, the species is
most closely related to Australian N. oresbios Donaldson,
1988. The other species from New Caledonia are char-
acterised by a distinctively different structure (especially
the head). N. risioides Fennah, 1969, which represents
the species group risioides, is distinguished by a short-
ened preocular part of the head, and N. kaori Hoch &
Asche, 2006 and N. ninguae Hoch & Asche, 2006, rep-
resentatives of species group /arvalis, are characterised
by advanced troglomorphism. The majority of known
species of the genus Notuchus is characterised by a dor-
soventrally flattened body (especially by a flattened head)
with three clearly visible keels on its lateral margins and
shortened, sclerotised, short and thick forewings (hind-
wings are rudimentary), which are morphological adap-
tations for living in leaf litter and in detritus (upper layer
of detritus) (Hoch et al. 2006).
Corresponding editor: R. Peters
Published: 08.04.2021
98 Cezary Gebicki et al.
The largest genus within the tribe Ugyopini is Ugyops
Guérin-Meéneville, which contains 101 species of which
many are endemic (Asche 1985). It is probably a taxon
of a Gondwanan origin comprising the species that cur-
rently inhabit two isolated areas: the Neotropical region
(from the Antilles to central Brazil) and the Indo-Aus-
tralian region (extending in the North to Central China
and Japan, in the West to the Seychelles, in the East to
some of the islands of Oceania including New Caledo-
nia). There are two recognised subgenera within the ge-
nus Ugyops: U. (Ugyops) Guérin-Meéneville, 1834 and
U. (Paracona) Fennah, 1965 of which the nominative
subgenus contains most of the species, whereas the other
comprises two species that are known only from New
Zealand (Muir 1923; Fennah 1965).
Morphological descriptions of many species of the genus
Ugyops Guérin-Meéneville are not very precise, especially
descriptions of male genitalia are missing (Fennah 1969,
1973; Donaldson 1983). Therefore, it seems justified to
supplement morphological descriptions using scanning
electron microscopy (SEM) and complete information
about male genitalia and male terminalia, which are now
widely considered in recent descriptions of species of
Ugyopini (Hoch et al. 2006).
MATERIAL AND METHODS
The studied material belongs to the collection of the Up-
per Silesian Museum in Bytom (USMB, Poland). It was
collected in December 2006 and March-April 2008. To
collect the specimens, a standard entomological sweep-
net, (O = 0.35 m), a light trap (bulb “MIX”-type 250 W,
E40) and pitfall traps were used.
The specimens were mainly identified based on the
structure of the genital apparatus. The structures were ex-
tracted from the body and mounted using a 10% solution
of KOH according to the procedure developed by Knight
(1965). The material was identified on the basis of the
following keys: Distant (1920), Fennah (1964, 1969),
Donaldson (1979, 1988) and Hoch et al. (2006).
The specimen from the genus Notuchus was quite dirty
(this species lives on the surface of the ground and in its
top layers). Using an ultrasonic cleaner did not give posi-
tive results. For this reason, we used the cleaning method
of Schneeberg et al. (2017). For the SEM, the specimen
was treated with 5% KOH for 14 h at room temperature
(22°C). After the treatment, the KOH was removed with
distilled water. Next, the specimen was dehydrated in an
ascending ethanol/water series (70, 80, 96 and 100% eth-
anol and 100% acetone; in 70-96% ethanol for 15 min in
each concentration, in 100% ethanol and 100% acetone
for one hour each with four reagent changes) and then
dried. The specimens of Ugyops were also cleaned in an
ultrasonic washer, which gave much better results than
Bonn zoological Bulletin 70 (1): 97-113
for the specimen of Notuchus. A method of Kantursk1
et al. (2015) was adapted and used to dehydrate and dry
the specimens. The material was dehydrated in a graded
ethanol/water series of 75%, 80%, 90%, 95% and 100%
for 10 min in each concentration with three 100% etha-
nol changes. The dehydrated samples were then dried in
hexamethyldisilazane (HMDS).
Color photographs of the specimens were obtained us-
ing a Leica M205C stereo microscope, a Leica DFC495
camera and the Leica application suite ver. 4.9.0. The
photographs of the genital structures were obtained us-
ing a Nikon Eclipse E-600 biological microscope with
a Nikon DS-Fi2 digital camera and NIS Elements ver.
4.10.
The SEM examinations were conducted in the Labora-
tory of Scanning Microscopy of the Jan Diugosz Univer-
sity, Czestochowa, Poland using a Tescan VEGA 3 SBU
scanning electron microscope equipped with an X-ray
EDS spectrometer (OXFORD X-ACT PENTAFET Pre-
cision) in the low-vacuum mode and at the Institute of
Biology, Biotechnology and Environmental Protection
of the Faculty of Sciences of the University of Silesia
in Katowice, Poland using a Phenom XL field emission
scanning electron microscope in the low-vacuum mode.
The samples for SEM analyses were mounted on alumin-
ium stubs using double-sided adhesive carbon tape. In
contrast to the methods that are usually used in morpho-
logical studies, the specimens were not sputter-coated
with a film of electrically conductive material. However,
the specimens were covered with anti-static spray. Us-
ing such methods and equipment enable relatively good
quality photos to be obtained without destroying the
specimens, which should be returned to the museum in a
good condition (Gorczyca et al. 2019).
Using scanning microscopy made it possible to obtain
high-quality images, including the overall morphology
of the specimens, the legs in detail and the distribution
and types of the sensilla on the antennae. The classifica-
tion and description of the sensilla are based on Altner
& Prillinger (1980), Stacconi & Romani (2011) and Zhu
et al. (2019). The morphological terminology of the head
is adopted from Holzinger et al. (2003).
Despite the fact that the described specimen of Notu-
chus linnavuorii sp. nov. was a single female, it was dis-
tinguished by a set of morphological features (especially
concerning the head and mesonotum). The morphologi-
cal features of this species make it possible to distinguish
it from other similar species of the genus Notuchus Fen-
nah, 1956, especially from Notuchus oresbios Donald-
son, 1988, which is a morphologically similar species.
All of the known species of the genus Notuchus live
hidden in the forest litter and under mosses (except for a
few cavernicolous species), which is the reason that often
only a few specimens are collected. A large number of
specimens is rarely obtained without using specific col-
lection methods.
©ZFMK
Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 99
Abbreviations
Quoting the labels of specimens: (//) is used to divide the
data on the different rows on a label, (;) is used to divide
the data from different labels and ([]) is used for the au-
thors’ comments.
RESULTS
Notuchus linnavuorii Gebicki & Walczak sp. nov.
(Figs 1-4)
urn: |sid:zoobank. org: act:6 D3BBF9F-A2F9-4011-81C8-B1EBA72162A6
Delphacidae Leach, 1815
Ugyopini Fennah, 1979
Notuchus Fennah 1969
Notuchus linnavuorii Gebicki & Walczak sp. nov.
Etymology. The name of this new species is dedicated
to Professor Linnavuori, a Fulgoromorphan and Heter-
opteran specialist.
Material examined
Holotype. 1 8 // Notuchus linnavuorii sp. nov. // Gebic-
ki & Walczak det. 2015 [red label]; New Caledonia (N)
// 21°00.318’ S, 165°14.605’ E // Tchamba (Wao Uni),
20.03.2008 // from refuge to 500 m // leg. R. Dobosz;
5915/26293 // coll. Upper Silesian Museum // (USMB)
Bytom, Poland.
Description
Body. Oval (Fig. 1A, D), dorso-ventrally flattened
(Fig. 1C).
Head. Broad, delta-shaped, vertex acutely rounded.
Coronal keel relatively high, reaching % of the vertex
where it bifurcates. Vertex flat with a distinct concavi-
ty in the apical area (Fig. 2A). Frons with two pairs of
flattened lateral keels that surround its weakly concave
surface. The area between the keels is regularly arcuate
and slightly concave, its maximal width at the level of
antennae is almost three times narrower than the widest
part of middle frons. Frons arcuately tapering towards the
vertex, at its base almost straight with broad ventral mar-
gin. Additional pair of short keels stretching from dorsal
margin of the eye to the apex of the head, which together
with anterolateral keels form characteristic longitudinal
concavity above the eye. Postclypeus broad with arcuate
margins and with light-colored median keel. Anteclypeus
triangular, distinctly shorter than postclypeus with a dis-
tinct median keel. Mouthpart long, reaching the base of
hind legs (Fig. 2B). Rostrum very long, its tip exceeds
the line between hind coxae considerably (Figs 1B, 2D).
Compound eye slightly oval, its posterior margin with
antenna hollow. Eye length (in lateral view) approxi-
mately equal to the length of the part of head anterior
Bonn zoological Bulletin 70 (1): 97-113
to eyes. Ocelli absent. Scapus of antennae with slight-
ly convex lateral margin, pedicellus apically expanding
with numerous placoidal sensilla, which concentrate to
form basal and apical groups (Fig. 3A—B). Apical part
of pedicellus is covered with numerous minute spines,
which are distinctly separated from wide scale-like struc-
tures that cover its basal part (Fig. 3D). A few rather long
spines and more numerous short fine ciliate structures are
evenly distributed among sensilla placoidea (Fig. 3C—D).
Pronotum. Clearly differentiated medial part with
three distinct keels and two lateral parts in the form of flat
plates. Lateral keels arcuate and indistinctly connected to
the posterior margin of pronotum. The structure of lateral
plates forms a cleavage in which basal margins of wings
are located (Fig. 2A).
Mesonotum. In the middle line about 1.5 times larger
than pronotum with three distinct high keels. Its anterior
margin joins pronotum at 4 of the length of its lateral
plates. Median keel bears the mark of the scutellum con-
nection (Fig. 2A).
Tegmina. Coriaceous, strongly shortened and distally
truncated. In medial and clavial parts, strongly convex;
in costal part, flattened and slightly upturned. Both teg-
mina and wings adhere to each other along the medial
margin, narrowly bordered and apically arcuately round-
ed. In basal part, two protrusions formed at the veins R
and M+Cu. Longitudinal veins indistinct with undulating
course and with numerous transverse veins, supposedly
vena spuria. Tegulae absent (Figs 1D, 2A).
Legs. Prothoracic and mesothoracic legs without
spines along tibia but with a row of high chaetae. Their
tarsal segments I and II are small, the third is the longest
and is apically enlarged (Fig. 2C—D). Metathoracic legs
with three strong spines on the ventral margin of tibia,
the convex dorsal margin fits into the shallow elongated
indentation of the femur.
Pattern arrangement of metatibial spines. 2+3, with
the first one being the longest. Post-tibial calcar in cross
section almost round and apically acuminate. The apex
of the basal and medial segment of the tarsus with spines
arranged in a way typical of the Ugyopini and Eodelpha-
cini tribes (Figs 1B, 2E).
Abdomen. With three distinct longitudinal tergal keels
with spikes (Fig. 1D). Ventral plates of pygofer convex,
truncated at the apex. Ovipositor longer than pygofer,
does not extend over the anal tube (Fig. 4A). Broad plates
of the anal tube are joined together on the ventral side
(Fig. 4B).
Ovipositor. Second pair of gonopophyses slightly
arched downwards near apex (Fig. 4C), their dorsal edges
covered with numerous homogenous denticles (Fig. 4D).
Third pair of gonopophyses with strong sclerotised thick-
ening at the basal part and over its entire length (Fig. 4E).
Measurements. Total body length 4.68 mm; maxi-
mal body width 2.56 mm; head length (in its coronal
part) 0.52 mm; head width (at its base) 0.69 mm; head
©ZFMK
100 Cezary Gebicki et al.
B
1mm
Fig. 1. Notuchus linnavuorii sp. nov., °. A. Dorsal view. B. Ventral view. C. Lateral view. D. Dorsal view, SEM.
Bonn zoological Bulletin 70 (1): 97-113 ©ZFMK
Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 101
width (including eyes) 1.35 mm; eye length (in dorsal
view) 0.48 mm; pronotum length (along the median keel)
0.41 mm; pronotum length in its lateral part 0.56 mm;
total pronotum length 2.21 mm; width of the median part
of pronotum (between lateral keels) 0.63 mm; mesono-
tum length 0.78 mm; mesonotum width (at its anterior
margin) 1.41 mm; tegmina length 1.47 mm; length of
the ventral edge of tegmina 0.73 mm; tegmina width
1.34 mm; length of the visible part of abdomen 2.02 mm;
maximal abdomen width 2.49 mm.
Fig. 2. Notuchus linnavuorii sp. nov., 2°. A. Head and thorax with brachypteric wings, dorsal view. B. Front of head. C. First pair
of legs (1). D. Second pair of legs (II) and fragment of labium (La). E. Third pair of legs (III) with calcar (Ca) and teeth (To) in the
distal part of the tibia.
Bonn zoological Bulletin 70 (1): 97-113
©ZFMK
102 Cezary Gebicki et al.
Coloration. General body coloration almost uniformly
greyish-brown. The base of abdomen, thorax and frons
black. Along the anterolateral and interolateral keels of
frons, alternate yellow and black spots present (6 each).
Similar spots (three each) are present on the ventral side
of lateral keels of pronotum. Vertex yellow. Lateral plates
of pronotum with long black blurred spots. Tegmen
brownish, its costal parts distinctly lighter. Longitudinal
veins slightly darker than the rest of the wing. Legs dark.
|
mae
NS
4a
ae \
|) 4," e?e
oo Se 2
OP Sees &
Apical parts of pro and mesotibia yellowish, metatibia
uniformly dark (Fig. 1A—C).
Distribution. Endemic for New Caledonia.
Remarks. Notuchus linnavuorii sp. nov. is differenti-
ated from the other species in the same genus by a set
of features: a well-developed compound eye, vertex in
the lateral view extending anterior to eyes for about the
Fig. 3. Notuchus linnavuorii sp. nov., ° (SEM). A. Antenna: scapus (Sc) and pedicellus (Pe). B. Pedicellus with sensors structure:
sensilla trichoidea (ST), sensilla placoidea (SP). C. Fragment of pedicellus: ciliate structure (CiS), conoidal structure (CS), sensilla
placoidea (SP), sensilla trichoidea (ST). D. Fragment of pedicellus: ciliate structure (CiS), conoidal structure (CS), squamates
structure (SS).
Bonn zoological Bulletin 70 (1): 97-113
©ZFMK
Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 103
length of an eye, marginal carinae distinctly visible inthe feature and the vertex ratio differentiate N. /innavuorii
dorsal view, vertex with a ratio of total length in midline — sp. nov. from its closest Australian species N. oresbios
to length anterior to eyes >1.8; vertex acutely rounded, Donaldson, 1988.
mesonotum with median carina weakly curved. The last
Fig. 4. Notuchus linnavuorii sp. nov., 29. A. Abdomen from below. B. Abdomen from above. C. Left median gonapophysis. D.
Distal part of left median gonapophysis. E. Ovipositor external valvae. A-B.: SEM.
Bonn zoological Bulletin 70 (1): 97-113 ©ZFMK
104 Cezary Gebicki et al.
Key to the males and females of the species
of the genus Notuchus Fennah, 1969
The key is based on partial keys (Donaldson 1979, 1988;
Hoch et al. 2006) and has been supplemented and mod-
ified.
1. Eyes reduced; length of vertex less than half width
at base; surface dorsal and ventral part of the head
of imaginal stage without distinct carinae. Tegmina
vestigial. Endemics of New Caledonia: species
TOU LOLVAUIS 6 csc ccotic ccs ough ence dite act idies spengate gtd mantis th 2
— Eyes normal; vertex more than half width at base;
head with distinct carinae. Tegmina short but
converge:on the dorsallsurface oi... cede teeeaisheess 4
2. Tegmina foliated, veins visible .......000000000
SRE Shs Meg eR ct AACR la N. larvalis Fennah, 1980
Tegmina narrowly lanceolate, veins reduced ......... 3
3. Anterior margin and lateral portion of pronotum pale
yellow; rostrum very long reaching anterior margin
of genital segment in male and reaching posteriorly
to mid-length of ovipositor in female; ventrocaudal
margin of male genital segment bilobate; sclerite of
flagellum membrane taeniform ...........000...c0eee
NEL tn ee. N. kaori Hoch & Asche, 2006
— Thorax uniformly white; rostrum shorter not
reaching anterior margin of genital segment in male
and reaching proximal third of ovipositor in female;
ventrocaudal margin of male genital segment
medially shallowly incised; sclerite of flagellum
PEMA DRAM CMM LORIN a t0 0 8 Mae Rtek Foreman Ae
flaps cetorde <leeaa dt. Be N. ninguae Hoch & Asche, 2006
4. Vertex with ratio of total length in midline to length
anterior to eyes < 1.8: species group monticola ....5
— Vertex with ratio of total length in midline to length
anterior to eyes > 2: species group risioides .......... 8
5. Marginal carinae not visible in dorsal view; vertex
very long, length anterior to eyes significantly more
than width at base (Lord Howe Isl.) ...........0000000.
Seer he das Me N. monticola Fennah, 1973
— Marginal carinae distinctly visible in dorsal view;
vertex shorter, length anterior to eyes at most equal
LOMA, AtsBASG Inc 5287008 Wr 8 NO oe oe oe ee eee 6
6. Vertex rounded, in lateral view extending anterior to
eyes for about length of an eye (Lord Howe Isl.) ....
pier Fs ca FR tans Seal abe N. howensis Donaldson, 1987
WerlexrdCulely NOUNS Gs at Sarna tccetcysatiep saat: t
7. Vertex in lateral view extending anterior to eyes for
more than length of an eye; mesonotum with median
carina strongly convex in lateral view (Donaldson
1988: Fig. 2) (Australia, Queensland) ........0......0..
Cee ee N. oresbios Donaldson, 1988
— Vertex in lateral view extending anterior to eyes at
most for length of an eye; mesonotum with median
carina only slightly convex in lateral view (New
Caledonia) .0H. nS aa, N. linnavuorii sp. nov.
Bonn zoological Bulletin 70 (1): 97-113
8. Frons with lateral margin angulate below level of
eyes (New Caledonia) .....N. risioides Fennah, 1969
— Frons with lateral margins evenly curved below level
of eyes (Australia, Queensland) ........00.0..c0 9
9. Frons generally convex, lateral areas not depressed
below level of median area; length of median area in
midline usually > 1.6 times greatest width ...............
is WR Oren ey N. rotundifacies Donaldson, 1979
— Frons concave, lateral areas distinctly depressed
below level of median area; length of median area in
midline usually > 1.6 times greatest width ..............
ees x15 1 a ee N. kurandae Donaldson, 1979
Checklist of species of the genus Notuchus Fennah,
1969
Species group Jarvalis
I. Notuchus kaori Hoch & Asche, 2006
2. Notuchus larvalis Fennah, 1980
3. Notuchus ninguae Hoch & Asche, 2006
Species group monticola
4. Notuchus howensis Donaldson, 1987
5. Notuchus linnavuorii sp. nov.
6. Notuchus monticola Fennah, 1973
7. Notuchus oresbios Donaldson, 1988
Species group risioides
&. Notuchus kurandae Donaldson, 1979
9. Notuchus risioides Fennah, 1969
10. Notuchus rotundifacies Donaldson, 1979
Information about the selected species of the genus
Ugyops Guérin-Méneville, 1834 from New Caledonia
Ugyops inermis Distant, 1920
(Figs SA—B, 6A, 7A—B, 8A—B, 9A-B, 12A-—B)
Ugyops inermis 1s an endemic species from New Cale-
donia (Distant 1920). Individuals of this species are
about 5—7 mm long. The biology of the species remains
unknown. Perhaps it 1s a nocturnal species. During the
study in New Caledonia, both males and females came to
the light sources (Fig. SA—B). Our text and illustrations
complete Distant’s description (1920), which included a
short and very inaccurate diagnosis of this taxon, without
drawings.
Material examined
1 9 (Fig. 5A) // Ugyops inermis Distant // C. Gebicki det.
2015; New Caledonia (S) // 21°37.632’ S, 165°45.830’ E
// Farino env., rainforest, at light // Les Grandes Fougeres
// 11.03.2008, 467 m // netting, beating // leg. R. Dobosz
& T. Blaik; 5915/17537 // coll. Upper Silesian Museum
// (USMB) Bytom, Poland. — 1 3 (Fig. 5B) // Ugyops in-
ermis Distant // C. Gebicki det. 2015; New Caledonia (S)
©ZFMK
Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 105
Fig. 5. A. Ugyops inermis Distant, 1920, 2. B. U. inermis Distant, 1920, 3. C. Ugyops nemestrinus, 3. D. Ugyops taranis Fennah,
1964, 2.
Bonn zoological Bulletin 70 (1): 97-113 ©ZFMK
106 Cezary Gebicki et al.
Fig. 6. Heads in frontal view. A. Ugyops inermis Distant, 1920, ¢. B. Ugyops nemestrinus Fennah, 1969, 3. C. Ugyops taranis
Fennah, 1964, 3.
// 22°10.648’ S, 166°30.430’ E // Mt Koghi rainforest //
12.04.2008, 480 m //at light // leg. R. Dobosz & T. Blaik;
5915/18481 // coll. Upper Silesian Museum // (USMB)
Bytom, Poland.
Description of the external features of U. inermis
Vertex separated from large occiput by horizontal groove
(Fig. 7A). Frons with two very indistinct keels situated
close to each other at apical and basal parts (Figs 6A,
7B). Scapus evenly covered with short setae, pedicellus
with numerous sensilla placoidea, among which there are
fine setae embedded in cavities and arched towards the
apex (Fig. 8A). Less numerous and irregularly distribut-
ed spines are embedded in cavities surrounded by cuticu-
lar fringe. Round or oval platelles are composed of sever-
al dozen hooked setae pointed towards antennal tip. Each
platella is surrounded by cuticular crown divided into
teeth, which are bent inwards (Fig. 8B). Rostrum reaches
beyond the line between hind coxae; its second segment
is about three times longer than its apical segment.
Coloration of dorsal surface. Tip of the head in dorsal
view with two distinct (especially in females) black spots
separated by pale keel. Pronotum with four dark spots
(less visible in males). Scutum with broad central stripe,
uniformly pigmented with yellow ridges in male. Hind
coxae uniformly yellowish, post-tibial calcar and tarsi
pale (in male calcar black and apical part of tibiae and
tarsi greenish). Along claval anal vein A2, two dark spots
(well visible in male), bases of veins R and especially M
Bonn zoological Bulletin 70 (1): 97-113
and Cu with white sections (less visible in male), longi-
tudinal veins uniformly yellow at apical part (greenish in
male) (Fig. SA—B).
Coloration of frons. Central and lateral carinae of frons
uniformly yellowish. Surfaces between keels with five
longitudinal dark patches (median patch is the longest
one) in the lower part and a few irregular spots in the
lateral and apical part. Carinae of clypeus yellowish, the
area between keels darker in the upper part of clypeus.
The scapus uniformly pale, second segment with
two dark stripes (similar to other species of this genus)
(Fig. 6A).
Morphology of male genitalia of U. inermis
Posterior margin of pygofer almost straight, with nar-
row and extremely shallow incisions for genital styles
(one-sixth the length of pygofer — Fig. 12A—B). Anal
tube relatively short, slightly wider than half its length
(lateral view — Fig. 12A). Genital style distinctly broad-
er apically, with a short, rounded apex, which is bent to
the outer side. Inner margin of genital style with short
and strong teeth apically (Fig. 9B). Apexes of connective
short, rounded and directed upwards (in form of a shal-
low “Y” — Fig. 9B). Connective shaft almost as thick as
apical processes. Theca of aedeagus well developed with
two distinct lobe-like processes at the apex. The shaft of
aedeagus almost evenly thick along its length, in circu-
lar form (regular) with a characteristic straight process,
which is broadened and rounded apically. Apex of aedea-
©ZFMK
Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 107
Fig. 7. Representatives of the genus Ugyops Guérin-Meéneville,
1834. A, C, E. Heads, prothorax and scutellum, dorsal view;
SEM. B, D, F. Heads in front view; SEM. A-B. Ugyops iner-
mis Distant, 1920, 3. C-D. Ugyops nemestrinus Fennah, 1969,
3S. E-F. Ugyops taranis Fennah, 1964, &.
Bonn zoological Bulletin 70 (1): 97-113
gus membranous, granular in structure without spines or
processes, endowed with a subapical gonopore (Fig. 9A)
Ugyops nemestrinus Fennah, 1969
(Figs 5C, 6B, 7C—D, 8C—E, 10A—B, 12C—D)
Ugyops nemestrinus is an endemic species known from
New Caledonia (Fennah 1969). In terms of body size,
specimens of this species are quite large relative to other
species of this genus. Its body length is about 7-9 mm.
The morphological features of the male were very poorly
illustrated (Fennah 1969). Our work presents an exhaus-
tive supplement to the aforementioned deficiencies. The
biology of this species 1s poorly known.
Material examined
1 3 (Fig. 5C) // Ugyops nemestrinus Fennah // C.
Gebicki det. 2015; New Caledonia (N) // 21°08.941’ S,
165°19.407’ E // Aoupinié (refuge) // 30.03.2008, 400 m
// netting, beating // leg. R. Dobosz; 5915/26751 // coll.
Upper Silesian Museum // (USMB) Bytom, Poland.
Description of external features of U. nemestrinus
Occiput clearly smaller than vertex (Fig. 7C). Frons with
two distinct keels, keels slightly convex and diverge to-
wards apex of the head. Fronto-clypeal suture distinct
and slightly arcuated. Labrum slender, sharply pointed
(Figs 6B, 7D). Second antennal segment covered with
sensilla placoidea over its entire length (except for its
basal part) (Fig. 8C). Sensilla placoidea surrounded by
cuticular ridge with large spines placed vertically. Setae
and rather large spines irregularly distributed among sen-
silla placoidea, tiny tubercles absent (Fig. 8E). Rostrum
reaches beyond the line between hind coxae (Fig. 8D).
Coloration of dorsal surface. Apical part of vertex
with two rather small dark spots merging with each oth-
er. Pronotum and scutum with broad vertical median and
reddish strip. Four irregular reddish spots at the back
edge of pronotum. All pairs of legs more or less uniform-
ly brightly colored. All longitudinal veins of forewings
uniformly yellow, wing cells transparent and colorless
(Fig. 5C).
Coloration of frons. Four carinae dark, areas among
keels uniformly bright colored without patches. Carinae
of clypeus dark yellow, cells between them uniformly
yellow (Fig. 6B).
Morphology of male genitalia of U. nemestrinus
Posterior margin of pygofer slightly undulating with nar-
row and very shallow incisions for genital styles (one-
tenth length of pygofer — Fig. 12C—D); stem of stylus
slightly broader than that in U. inermis. Anal tube rel-
atively narrow, almost three times as long as wide (lat-
eral view — Fig. 12D). Genital styles slightly broadened
and rounded apically. Apexes of genital styles narrowed,
distinctly longer than those in U. inermis and bent to-
©ZFMK
Cezary Gebicki et al.
Fig. 8. Antennae of representatives of the genus Ugyops Guérin-Méneville, 1834 from New Caledonia. A-B. Ugyops inermis
Distant, 1920, 3. C-E. Ugyops nemestrinus Fennah, 1969, 3. F-G. Ugyops taranis Fennah, 1964, 4. D. Distal part of labium (U.
nemestrinus). Abbreviations: SC = scapus; Pe = pedicellus; CiS = ciliate structure; CS = conoidal structure; SP = sensilla placoidea;
ST = sensilla trichoidea; La = labium.
Bonn zoological Bulletin 70 (1): 97-113 ©ZFMK
Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 109
0.5mm
Fig. 9. Ugyops inermis Distant, 1920, male genitalia. A. Aedeagus lateral view. B. Gonostyles with connective, ventral view.
wards the outer side. Inner margin of genital style cov-
ered with indistinct teeth in apical part (Fig. 10B). Apex-
es of connective short and rounded (stouter than those
in U. inermis and not “Y”-shaped). Stem of connective
slightly thinner than its apex. Theca of aedeagus with-
out distinct, regular lobe-like processes apically. Aedea-
gus relatively short, bent elliptically, almost evenly thick
along its length with a characteristic thin spine; the spine
not broadened at the apex, slightly bent towards the base
of aedeagus. Apex of aedeagus membranous, granular in
structure without spines or processes, endowed with a
subapical gonopore (Fig. 10A).
Bonn zoological Bulletin 70 (1): 97-113
Ugyops taranis Fennah, 1964
(Figs 5D, 6C, 7E-F, 8F—G, 11A—B, 12E-—F)
Ugyops taranis is a small representative of its genus that
reaches about 4—5 mm in length. It is endemic to New
Caledonia (Fennah 1964). The species was described
based on two females. The male morphological features
are given here for the first time, despite the fact that Fen-
nah had access to a male from the Gressitt’s collections
at a later date (Fennah 1969). The biology of the species
remains unknown.
Material examined
1 & (Fig. 5D) // Ugyops taranis Fennah // C. Gebicki det.
2015; New Caledonia (S) // 22°10.7’ S, 166°30.4’ E // Mt
©ZFMK
110
Cezary Gebicki et al.
Fig. 10. Ugyops nemestrinus Fennah, 1969, male genitalia
Koghi 450-500 // 16.12.2006 rainforest, netting // leg.
R. Dobosz; 5915/6668 // coll. Upper Silesian Museum //
(USMB) Bytom, Poland.
Description of external features of U. taranis
Apical part of vertex distinctly convex (Fig. 7E). Dis-
crete keel slightly convex, broadened in the apical part.
Fronto-clypeal suture straight, barely visible. Labrum
Bonn zoological Bulletin 70 (1): 97-113
4 ae
| ar tte aly cera
. * < ¢ ‘Rg Yi ‘a
; ee ioe
ae See bee
ay 8,
a} 4 : he 4 )
, oe
oe te
spartan te 2
Ser Wy ““
i he 8 ae
ee.
:
Saat
ele Sat he are
. A. Aedeagus lateral view. B. Gonostyles with connective, ventral view
relatively short (Figs 6C, 7F). First antennal segment
relatively long, covered with long dense hair. Second
antennal segment almost entirely covered with regular-
ly distributed sensilla placoidea (Fig. 8F). Rather large
spines and setae irregularly distributed among sensilla
placoidea, numerous minute immovable tubercles visible
among sensilla placoidea (Fig. 8G).
©ZFMK
Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 111
Fig. 11. Ugyops taranis Fennah, 1964, male genitalia. A. Aedeagus lateral view. B. Gonostyles with connective, ventral view.
Coloration of dorsal surface. Apical part of vertex
with two indistinct dark spots, carinae reddish. Prono-
tum with two small spot in the lateral parts. Tegulae dark.
Forewing longitudinal veins mostly green with short and
irregularly distributed dark sections. Inner edge of clavus
black for two thirds of its length and in the apical part
(Fig. 5D).
Coloration of frons. Carinae of facies dark, areas be-
tween them with dark red longitudinal stripes, their me-
dian part pale. Carinae of clypeus reddish and areas pale
(Fig. 6C).
Morphology of male genitalia of U. taranis
Posterior margin of pygofer straight with very deep in-
cisions for genital styles (almost one-third the length of
pygofer — Figs 12E, F). This is distinctly different from
those in U. inermis and U. nemestrinus. Anal tube rel-
Bonn zoological Bulletin 70 (1): 97-113
atively broad, only twice as long as wide (lateral view
— Fig. 12E). Genital styles relatively short, indistinctly
broadened apically, broadly rounded and directed to-
wards the inner side. Inner margin of genital style cov-
ered with distinct, short teeth in apical part (Fig. 11B).
These features are also different from those in the other
two species. Apexes of connective long, slender, directed
towards sides in a distinct way (forming clear “T”). Stem
of connective as thick as its apical processes.
Theca of aedeagus without distinct and regular lobe-
like processes apically of aedeagus relatively short, less
evenly bent, broadened apically with a characteristic thin
spine; the spine tapering, bent towards the apex of aedea-
gus. Apex of aedeagus membranous, granular in struc-
ture with a single lateral spine with a subapical gonopore
(Fig. 11A).
©ZFMK
112 Cezary Gebicki et al.
Fig. 12. External male genitalia. A, D-E. Lateral views. B—C, F. Ventral views. A—B. Ugyops inermis Distant, 1920. C-D. Ugyops
nemestrinus Fennah, 1969. E—F. Ugyops taranis Fennah, 1964.
Bonn zoological Bulletin 70 (1): 97-113 ©ZFMK
Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 113
Checklist of the species of the genus Ugyops Guérin-
Meéneville, 1834 of New Caledonia (after Distant 1920,
Fennah 1964, 1969, Bourgoin 2020)
Ugyops (Ugyops) alecto Fennah, 1969
Ugyops (Ugyops) atreces Fennah, 1964
Ugyops (Ugyops) houadouensis Distant, 1920
Ugyops (Ugyops) inermis Distant, 1920
Ugyops (Ugyops) lato Fennah, 1969
Ugyops (Ugyops) manturnus Fennah, 1969
Ugyops (Ugyops) menelaus Fennah, 1964
Ugyops (Ugyops) nemestrinus Fennah, 1969
Ugyops (Ugyops) taranis Fennah, 1964
Acknowledgments. We would like to thank Dr Roland Dobosz
for providing the material from the entomological collection of
the Upper Silesian Museum in Bytom. The authors would also
like to express their gratitude to Professor Manfred Asche, an
outstanding expert of the Delphacidae family, for his valuable
comments regarding this work in its earlier version.
Our grateful thanks are also extended to Dr Wojciech Szc-
zepanski (Upper Silesian Museum in Bytom, Department of
Natural History) for his contributions to our work.
We would also like to thank MSc Marzena Zmarzly (Univer-
sity of Silesia, Faculty of Natural Sciences, Institute of Biology,
Biotechnology and Environmental Protection) and MSc Dasha
Michenko (National Academy of Sciences of Belarus) for tak-
ing the images of the specimens. Special thanks to Dr Wojciech
Prochwicz (Jan Dlugosz University in Czestochowa, Faculty of
Science & Technology) for his help in taking the SEM images.
We also thank Dr Artur Taszakowski, Dr Mariusz Kanturski,
Dr Lukasz Junkiert and Krzysztof Kudta (University of Silesia,
Faculty of Natural Sciences, Institute of Biology, Biotechnolo-
gy and Environmental Protection) and MSc Janusz Trzepizur
(the Elementary School of the Orzet Bialy in Kuleje) for their
technical support.
REFERENCES
Altner H, Prillinger L (1980) Ultrastructure of Invertebrate
Chemo- Thermo-, and Hygroreceptors and its Functional
Significance. International Review of Cytology 67: 69-139
Asche M (1985) Zur Phylogenie der Delphacidae Leach, 1815
(Homoptera Cicadina Fulgoromorpha). Teil I et Il. Marburg-
er Entomologische Publikationen 2 (1): 1-910
Bourgoin T (2020) FLOW (Fulgoromorpha Lists on The Web);
a world knowledge base dedicated to Fulgoromorpha. Ver-
sion 8 updated 2020.12.26. Online at https://hemiptera-data-
bases.org/flow/ [last accessed 16 Mar. 2021]
Distant WL (1920) Rhynchota from New Caledonia Part II.
Homoptera. Annals and Magazine of Natural History 9 (6):
456-470
Donaldson JF (1979) Revision of the genus Notuchus Fennah
(Homoptera: Fulgoroidea: Delphacidae). Journal of the Aus-
tralian Entomological Society 18: 181-185
Donaldson JF (1983) Revision of the Australian Asiracinae
(Homoptera: Fulgoroidea: Delphacidae). Journal of the Aus-
tralian Entomological Society 22: 277-285
Donaldson JF (1987) Notuchus howensis sp. n. (Homoptera:
Fulgoroidea: Delphacidae) from Lord Howe Island. Journal
of the Australian Entomological Society 26: 81-83
Bonn zoological Bulletin 70 (1): 97-113
Donaldson JF (1988) Further studies on Asiracinae (Homop-
tera: Delphacidae) in Australia and New Caledonia. Journal
of the Australian Entomological Society 27: 133-141
Fennah RG (1964) New species of Ugyops (Fulgoroidea: Del-
phacidae). Bulletin of the British Museum (Natural History),
Entomology 15 (5): 117-143
Fennah RG (1965) Delphacidae from Australia and New Zea-
land (Homoptera: Fulgoroidea). Bulletin of the British Muse-
um (Natural History), Entomology 17: 1-59
Fennah RG (1969) Fulgoroidea (Homoptera) from New Cale-
donia and the Loyalty Islands. Pacific Insects Monographs
21: 1-116
Fennah RG (1973) A new species of Notuchus (Homoptera,
Fulgoroidea, Delphacidae) from Lord Howe Island. Records
of the Australian Museum 28: 265—267
Fennah RG (1980) A cavernicolous new species of Notuchus
from New Caledonia (Homoptera: Fulgoroidea: Delphaci-
dae). Revue Suisse Zoologie 87: 757-759
Gebicki C, Szwedo J (2000) A fossil Ugyopine planthopper
from Baltic Amber (Hemiptera: Fulgoroidea: Delphacidae).
Polskie Pismo Entomologiczne 69: 389-395
Gorezyca J, Wolski A, Taszakowski A (2019) Redescription
and new records of the monotypic genus 7rynocoris Herring,
1976 (Heteroptera: Miridae: Cylapinae: Fulviini). Zootaxa
4623 (1): 51-60
Hoch H, Asche M, Burwell Ch, Monteith GM, Wessel A (2006)
Morphological alteration in response to endogeic habitat and
ant association in two new planthopper species from New
Caledonia (Hemiptera: Auchenorrhyncha: Fulgoromorpha:
Delphacidae). Journal of Natural History 40 (32-34): 1867—
1886
Holzinger WE, Kammerlander I, Nickel H (2003) The Auche-
norrhyncha of Central Europe. Vol. 1: Fulgoromorpha, Cica-
domorpha, excl. Cicadellidae, Brill, Leiden / Boston
Kanturski M, Karez J, Wieczorek K (2015) Morphology of the
European species of the genus Eu/achnus (Hemiptera: Aph-
ididae: Lachninae) - A SEM comparative and integrative
study. Micron 76: 23-36
Knight WJ (1965) Techniques for use in the identification of
leafhoppers (Homoptera, Cicadellidae). Entomologist’s Ga-
zette 16: 129-136
Muir FAG (1923) Two species of Delphacidae (Homoptera)
from Kermadec Archipelago. Transactions and Proceedings
of the New Zealand Institute 54: 257
Schneeberg K, Bauernfeind R, Pohl H (2017) Comparison of
cleaning methods for delicate insect specimens for scanning
electron microscopy. Microscopy Research & Technique 80
(11): 1199-1204
Stacconi MVR, Romani R (2011) Antennal Sensory Structures
in Scaphoideus titanus Ball (Hemiptera: Cicadellidae). Mi-
croscopy Research and Technique 75 (4): 458-466
Urban JM, Bartlett CR, Cryan JR (2010) Evolution of Delpha-
cidae (Hemiptera: Fulgoroidea): combined-evidence phylo-
genetics reveals importance of grass host shifts. Systematic
Entomology 35 (4): 678-691
Zhu Q, Wu N, Brozek J, Dai W (2019) Antennal Morphology
and Sexual Dimorphism of Antennal Sensilla in Callitettix
versicolor (Fabricius) (Hemiptera: Cercopidae). Insects 10
(2): 1-16
©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 70 (1): 115-139
2021 - Przybycien M. et al.
https://do1.org/10.20363/BZB-2021.70.1.115
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org: pub: E9E9665D-B904-427E-AE1 7-2E254E2CEAA6
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group
(Coleoptera: Curculionidae):
an integrative approach using molecular, morphological, ecological,
and biogeographical data
Maja Przybycien', Dorota Lachowska-Cierlik’, Beniamin Waclawik’, Peter Sprick’ & Stanislaw Knutelski* *
"2.35 Department of Entomology, Institute of Zoology and Biomedical Research, Jagiellonian University, Krakow, Poland
*Curculio Institute e.V. (CURCI), WeckenstraBe 15, D-30451 Hannover, Germany
* Corresponding author: [email protected]
'urn:lsid:zoobank.org:author: EOEDF340-653 1-4F3C-996F-1C7420398937
urn: lsid:zoobank.org:author:A5944069-0F77-4B9F-BE12-7B302385C7E2
3urn:Isid:zoobank.org:author: 14829388-EC88-4A57-8350-9CD87DDFFDCS5
*urn:lsid:zoobank.org:author: CC8F6E14-0623-4BBF-99F4-5F8DA6E35A72
>urn:Isid:zoobank.org:author:C74D006B-64E3-4CD4-B5D0-BEEB853094A9
Abstract. The species of the Otiorhynchus clavipes (Bonsdorff, 1785) group (Coleoptera: Curculionidae) treated here, are
characterized by their unusually high phenotypical variation, which often caused taxonomic problems and controversies.
Molecular markers COI and EF 1-a, karyological analysis, as well as morphological, biogeographical and ecological data
are used to study weevils collected in the Alps, Carpathians, Sudetes and different areas of Germany. In the investigated
populations of the flightless species O. fagi Gyllenhal, 1834 and O. clavipes, we detected an interspecific genetic distance
of 11.3-15.8% (COI) and 3.1—3.7% (EF1-a) depending on geographical distance. The phylogenetic trees indicate that
both species are monophyletic and that they were correctly delimited from each other. Both species have also separate
geographical ranges in Central Europe. Male specimens differ in the morphology of the aedeagus and the last abdominal
sternite. Our study supports the legitimacy of species delimitation of O. fagi and O. clavipes as separate species, which
can be treated as stable taxonomic hypotheses. The determination of the species status required the re-examination of spe-
cies ranges and allowed together with data on biology and altitudinal preferences a better biogeographical and ecological
characterization of the species.
Keywords. Weevils, Otiorhynchus, integrative taxonomy, species delimitation, molecular markers (COI, EF1-a), biodi-
versity, distribution.
INTRODUCTION
Inconsistent definitions and taxonomic treatment of cryp-
tic species prevent informed estimates of their contribu-
tion to biodiversity and impede our understanding of their
evolutionary, biogeographical and ecological significance
(Struck et al. 2018). The cryptic concept refers to two or
more species that have been classified as a single nominal
species including subspecies and varieties due to the fact
that they are apparently morphologically very similar,
show subtle regional or ecological adaptations and/or are
completely indistinguishable (Zuniga-Reinoso & Benitez
2015). Careful taxon-specific approaches and knowledge
are consequently required to discriminate between spe-
cies. One of the most common suppositions 1s that most
cryptic species result from speciation phenomena that are
so recent that morphological traits or any other tradition-
al diagnostic characters have not yet evolved (Winker
Received: 27.09.2020
Accepted: 09.03.2021
2005). In this sense, the hyperdiverse genus Otiorhyn-
chus Germar, 1822, which current systematics is based
mainly on the morphological structure of adults, includes
many cryptic species which have yet to be discovered.
The genus Otiorhynchus (Curculionidae: Entiminae:
Otiorhynchin1) is the most species-rich of all weevil gen-
era in Europe and the West Palaearctic Region, compris-
ing around 1500 valid species and 105 subgenera within
the main distribution area in the Palaearctic region (Hoff-
mann 1950; Smreczynski 1966; Dieckmann 1980; Knu-
telski 2005; Germann 2010; Sttiben et al. 2015; Mazur
2016). In Europe, the tribe Otiorhynchini includes eight
genera, and the subgenus Otiorhynchus Germar, 1822
sensu stricto is represented by 64 species (Alonso-Zaraz-
aga et al. 2017). The highest numbers of species of the
genus Otiorhynchus occur in the European mountains
(Dieckmann 1980), and many local forms inhabit the
high montane and alpine regions and especially areas
Corresponding editor: D. Ahrens
Published: 08.04.2021
116 Maja Przybycien et al.
with non-glaciated refugia and nunataks. Otiorhynchus
species occurring north of the Alps, the Sudetes and
Carpathians (including the Tatra Mts.) represent only a
very small part of the species of this speciose genus (e.g.,
Hoffmann 1950; Smreczynski 1966; Magnano 1998:
Knutelski 2005; Germann 2010; Sttiben et al. 2015;
Mazur 2016). Otiorhynchus species, which are without
exception incapable of flight, are known as general fee-
ders with a large number of host plant genera comprising
deciduous and coniferous trees, woody plants, perennial
dicots and perennial grasses (Smreczynski 1966; Koch
1992; Knutelski 2005; Sprick & Sttiben 2012). Adults are
leaf feeders and cause characteristic bite marks on host
plant leaves, and the larvae are subterraneous, ectopha-
gous root feeders (Willis 1964; Dieckmann 1980; Gosik
et al. 2016).
One of the most problematic taxa arousing much con-
troversy among many current taxonomists are the species
related to Otiorhynchus fagi, previously called Otiorhyn-
chus tenebricosus (Herbst, 1784) group (Casalini & Col-
onnelli 2019), which probably includes two or more cryp-
tic species with a distribution restricted to certain are-
as inside the range. This phenotypically extremely vari-
able taxon was interpreted differently in the past, which
led to the description of many subspecies, varieties and
forms, and the creation of a huge number of species syno-
nym names.
In the opinion of Hoffmann (1950), Otiorhynchus lug-
dunensis Boheman, 1843 together with O. hungaricus
Germar, 1824, O. fuscipes (Olivier, 1807) and O. clavipes
(Bonsdorff, 1785) form a complex of closely related but
separate species in Western Europe. Other authors con-
sidered them forms of one variable species. For example,
Lona (1936) distinguished within O. clavipes three taxa
as varieties, and Hoffmann (1950) regarded these as sub-
species and subdivided additionally each subspecies into
varieties. In turn, Frieser (1981) included in the O. clavi-
pes group: O. lugdunensis, O. fuscipes, O. clavipes sensu
stricto, and O. hungaricus. Morris (1997) treated O. /ug-
dunensis and O. fuscipes in Great Britain as synonyms
of O. clavipes, but he explained that the true status is
unresolved and needs further study especially on bio-
logy. Smreczynski (1966) distinguished O. fuscipes and
O. lugdunensis from Poland and other countries of East-
ern Europe using morphological features and he listed
them as separate species. Likewise, Dieckmann (1980)
treated both taxa as separate and valid species in east-
ern Germany. In his opinion, some specimens from the
mountain and the low mountain ranges, determined as
O. clavipes, belong either to O. fuscipes or to O. lugdu-
nensis, and O. hungaricus was regarded as a southeastern
European species with an isolated occurrence in southern
France. The status of O. hungaricus Germar, 1824 as sepa-
rate species from other taxa of this group raised the least
controversy and is widely accepted (e.g., Endrédi 1961;
Mazur 2002; Alonso-Zarazaga et al. 2017; Yunakov et al.
Bonn zoological Bulletin 70 (1): 115-139
2018). Currently, Casalini & Colonnelli (2019) syno-
nymized the French subspecies Otiorhynchus hungaricus
hospitellensis Hustache, 1923 with the nominotypical
taxon. Magnano (2001) synonymized O. clavipes (Bons-
dorff, 1785), O. fuscipes (Olivier, 1807), and O. /ugdu-
nensis Boheman, 1843 together with more than 30 taxa
to a very diverse species cluster (Delbol 2010, 2013;
Alonso-Zarazaga 2014) under the name of O. tenebrico-
sus (Herbst, 1784). Several other authors (e.g., Germann
2010; Lobl & Smetana 2011) adopted this proposal at
first. Wanat & Mokrzycki (2005) also accepted the syno-
nymization of O. /ugdunensis but with some objections,
arguing ecological distinctness from the nominotypical
O. tenebricosus. However, some researchers using dif-
ferent methods studied and indicated the dissimilarity
between O. tenebricosus and O. lugdunensis. Germann
(2013) reinstalled O. /ugdunensis as a valid species from
synonymy with O. tenebricosus based on differences
in the morphological structure of the aedeagus of both
taxa. Gosik & Sprick (2013) studied the morphological
structure of pupae and found some diagnostic features
specific to each of both taxa. Further evidence for the
status of O. /ugdunensis as separate species came from
the p-distance (COI) of 11.4-11.6% from O. tenebricosus
(Schitte et al. 2013; Stiiben et al. 2015). Probably based
on these results, the name O. /ugdunensis was used again
as a separate taxon in the catalogues of Lobl & Smetana
(2013) and Alonso-Zarazaga et al. (2017). However, in
those two catalogues the synonymy of O. clavipes and
O. fuscipes with the species O. tenebricosus remained
unchanged. The study of the larval morphology of the
O. tenebricosus group (Gosik et al. 2016) confirmed the
validity of O. /ugdunensis as reported by Schiitte et al.
(2013); Germann (2013); and Stuben et al. (2015) against
synonymisation suggested by Magnano (2001) and Fau-
na Europaea (Alonso-Zarazaga 2014). Wanat & Mokrzy-
cki (2018) also withdrew O. /ugdunensis from synonymy
with O. tenebricosus, although the relation to the very
similar O. clavipes remained unresolved. Casalini & Col-
onnelli (2019) designated a neotype for Curculio clavipes
Bonsdorff, 1785, rediscovered several overlooked syno-
nymies and discovered new synonyms of this species.
Recently, O. tenebricosus was synonymized with O. fagi
by Casalini & Colonnelli (2019).
Therefore, it was necessary to verify all available data
and explore this species group more in detail except the
well-defined O. hungaricus. The ecological differenc-
es between the forms, particularly in Central Europe
and the United Kingdom, were also taken into account,
which may provide additional evidence to shed light on
this problem. Thus, the aims of this paper are: 1) to com-
pare morphology, karyology and the results of molecular
analyses of adult weevils of the taxa Otiorhynchus clavi-
pes (Bonsdorff, 1785), O. fuscipes (Olivier, 1807), and
O. lugdunensis Boheman, 1843, collected in the Alps,
Carpathians, Sudetes and different areas of Germany; 2)
©ZFMK
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 117
to find diagnostic characters useful to distinguish these
taxa, 3) to report new bionomic data, and 4) to present an
updated distribution of these taxa.
MATERIAL AND METHODS
A total of 66 adult specimens were collected for this
study from 16 localities in the Alps (Slovenia), Carpath-
ians (Poland and Slovakia), Sudetes (Poland) and differ-
ent regions in Germany, using sweep nets, beating trays
or direct collecting from plants and under stones, over
a period of ten years (2009-2018). A full list of locali-
ties and their coordinates, biotopes, and collecting plants
with these sites is given in Table 1. Additional specimens
from various regions of Germany, England and France
were used for morphological descriptions and photos of
habitus and abdominal sternites (Figs 7-8). All individu-
als were a priori identified to species level using the keys
of Smreczynski (1966) or Dieckmann (1980). Nomencla-
ture of scientific names follows Alonso-Zarazaga et al.
(2017); Wanat & Mokrzycki (2018); and the PolBIN
(2019).
The gonads of 12 alive individuals (males) of each ta-
xon were dissected for chromosome analysis, the oth-
er 45 individuals were preserved in 99.8% ethanol and
stored at -20°C for molecular and morphometric studies.
Information on morphology, ecology and biogeogra-
phy of the studied taxa is based on the authors’ own data
and Hoffmann (1950, 1963); Smreczynski (1966); En-
drodi (1961); Knutelski (2005); Sprick & Sttiben (2012);
Germann (2013); Mazur (2016); and Gosik et al. (2016).
Molecular analysis
DNA was isolated from complete insects. In order to
avoid the damage of body parts which were later used
in morphometry the specimen were poked with a needle
on the abdomen to facilitate the flow of genetic materi-
al. NucleoSpin tissue kit (Macherey-Nagel) with suitable
procedure was used for the isolation process. Two DNA
fragments, mitochondrial cytochrome oxidase 1 (COI)
and nuclear elongation factor a (EF1-a), were amplified
with PCR technique in a reaction mix consisting of: 3 ul
of DNA, 2 ul of buffer x10 with MgCl, 0.6 pl of dNTPs,
0.6 ul of primer F, 0.6 pl of primer R, 0.2 ul of Taq poly-
merase, 13 wl of water. Amplification was conducted
with the use of the following primers: EF-F sequence
(5° AGAACGTGAACGTGGTATCA 3’), EF-R_ se-
quence (5° CTTGGAGTCACCAGCTACATAACC 3’),
LCO1490-JJ sequence (5° CHACWAAYCATAAAGA-
TATYGG 3’) HCO2198-JJ sequence (5° AWACTTCVG-
GRTGVCCAAARAATCA 37’) (Astrin & Sttiben 2008;
Hernandez-Vera et al. 2013).
The amplification was performed in a Mastercycler
EpigradientS (Eppendorf) with the following profile:
Bonn zoological Bulletin 70 (1): 115-139
95°C for 4 min, 95°C for 30 s, 50°C for COI and 55°C for
EF1, for 1 min, 72°C for 2 min followed by 35 cycles at
95°C for 30 s, 50°C for 1 min, 72°C for 2 minutes and a
final extension step at 72°C for 10 min and | min at 10°C.
The effectiveness of the amplification was checked by
conducting electrophoresis in 1% agarose gel tinted with
Midori Green Advance DNA Stain (NIPPON Genetics)
(100 mg/ml). Purified PCR products were sequenced
with Big Dye Terminator v3.1. Cycle Sequencing Kit
(Applied Biosystems) according to the manufacturer’s
instructions with the same primers that were used in the
PCR reaction. Sequencing reaction was conducted by
Genomed S.A., Warsaw.
Alignment and phylogenetic analysis
Sequences were read and edited using BioEdit v.7.2.6
(Hall 1999) and then aligned using ClustalX (Thomp-
son et al. 1997). The most suitable model of nucleotide
substitution was determined by using MrModeltest 2.3
(Nylander 2004) in conjunction with PAUP*4.0b (Swof-
ford 2002). The GIR+G model was chosen for COI
(proportion of invariable sites I = 0, gamma distribution
shape parameter G = 0.2521), the GTR model for EF-la
(proportion of invariable sites I = 0, equal rates for all
sites).
We used two methods to determine phylogeny: Bayes-
ian inference (BI) and maximum likelihood (ML). BI was
ran using MrBayes 3.1 (Ronquist & Huelsenbeck 2003;
Nylander et al. 2004) with one cold and three heated
Markov chains for 3,000,000 generations and trees were
sampled every 100" generation. Each simulation was run
twice. Stationarity was considered to be reached when
the average standard deviation of split frequencies was
<0.01; the convergence of each run was visually inspect-
ed using Tracer v. 1.5.0 (Rambaut et al. 2009), and appro-
priate number of sampled trees were discarded as ‘burn-
in’, and a majority-rule consensus tree was obtained.
Maximum likelihood was run using RAxML v. 8.0.0
(Stamatakis 2014) with a bootstrap resampling of 100
replicates via the rapid bootstrap procedure of Stamatakis
et al. (2008) to assign support to branches in the ML tree.
Genetic distances were computed in PAUP*4.0b (Swof-
ford 2002) by using uncorrected “p” model. Each tree
has one outgroup — Liparus glabirostris Kuster, 1849
(for EF1 marker) or Liophloeus tessulatus (O.F. Muller,
1776) (for COI marker), both species are from the same
family (Curculionidae). All trees were visualized with
TreeView 1.6.6 (Page 1996).
Chromosomes
The gonads of 12 individuals (males) of each species
were dissected and used as material for slides. The go-
nads were fixed in Carnoy (3:1 96% ethanol: glacial
acetic acid). The squashes were performed on dry ice in
©ZFMK
Maja Przybycien et al.
118
Table 1. Sampling areas, locations, date, biotopes and plants of collected weevils used in molecular analysis: Germany, Poland, Slovakia and Slovenia. Abbreviations: m a.s.l. = meter
above sea level, N = individual numbers, Leg. = name of collector, APC = a priori categorisations, C = Otiorhynchus clavipes, L = O. lugdunensis, T = O. tenebricosus.
x A ae Geograph. _ Altitude :
Sampling area Sampling site coordinates -UEGnered:) Date Biotope Plants N Leg. APC Remarks
Germany
hea eHaG rather abundant, very
Hannover-Linden, er 5, 2011-04-06, TEE j local in a small area
Lower Saxony N52°22'40 E. fortunei, ;
(LSH) park south of £09°42'30" 53 2017-03-23, park ee ee adeee 4 Sprick L (<100 square meters);
Leine river 2017-04-12 on cae beating in the late
Fraxinus spec.
evening and early night
Lower Saxony Bad Zwischenahn- N53°12'18,5" 2012-07-09,
(LSB) Tee iacaas £08°04'22.5" 12 3013-07.02 ee nursery Thuja occidentalis 2 Sprick L _ rare, collected at night
Lower Saxony Ith Mountains N52°04'35"
(LSL) aiauenticiny 509°32'56" 350-400 2012-03-26 5 Sprick T abundant
National Park N51°46'16" coniferous Bisoaluhios abundant, beaten from
Harz: Harz Mts., ee 740 2012-07-02 forest, oa ie ae 1] Sprick T plants and collected
Lower Saxony E10°32'03 Vaccinium myrtillus
at Oderteich lake, mountain under stones
spruce forest forest
Schleswig-Holstein Pinneberg: N53°38'25! Thuja plicata rare, beating in the
(SHP) Rellingen, E09°50'22" Wt SD DOnOF See NUE one 5 eprick L afternoon
hedgerow
Schleswig-Holstein Bullenkuhlen, Nee ae 8 et Agoe nursery HE MEGSDCE. of. 10 Sprick Tie Rare pains:
E09°45'04 2013-06-04 plicata females
(SHB) hedgerow
Paderborn hillside forest Fraxinus excelsior, noe Dale eee
Nore Ne: Wewer Ne 140-150 2012-07-15 oncalcareous Euonymus euro teh 4 Sprick C Cay aro tne ow ek
Westphalia (NRW) ; E08°42'43" ‘ eee P parts of bushes and
Ziegenberg, forest ground Cornus sanguinea
young trees
edge
Bagcr Ware bes Silent 1 Sprick L
(BWH)
©ZFMK
Bonn zoological Bulletin 70 (1): 115-139
119
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group
AWUNUIUOD SoTUaSOL
UI Jopiog ueINsnyIeoU OC, SCsjaynuy wml apes ysooj aonids = 1-90-€ 107 STII ears bak SR ae e (AMV) sdiv
ssed uiejunow Je Suneaq 1q Id wOVLT9VN SIA DI
BIUIAOTS
di
sures rysjoqnu Salqv baal soloj sonids -90- u€0,CCo6 LA Niee malone ge suviyyedie
yeoq ok Iyspoynuy 1q Iq — \SO1OF OI-90-€ 10C OS6 |PZ9So8bN “SA SBIR, MOT yyedse’)
BDIBAOTS
Byloysed ( ean
iT INZeI| ysaloj sonIds ~—- $- 80-6007 Orl uvOF.6 10914 “SIA. SMOOIS WSS Pas
uS LOToOSN
}Oq SUBJUOUT JOMO] L8,1L0S14 ay gee ae (AMS) sozepng
out UT soon woxy Suryeog L Tysjanuy saiqgp David ysoaloyaonids ¢(-L0-€ 107 0S6 er aoen ““S]IJA SZSOUOYILY]
BIND BYONS = SIA
suyeoq LS FySyoynuy saiqp partg ysoloyaonsds —_ €9-90-T 107 SL9 ie ies Splysog IoIMAZ (ZO) suemmedre)
sures rysjoynu Salqv Daal soroy sonids -90- u0$.:8000CH map cae sueiyjyedie
yeoq iL yspoynuy 1q Iq — SOlOF 0C-90-C10C Ovcl PCC Lob PN “SYA 9009) (INDO) sueryjedies
opeys & JO a8po oy} snyyAdi wniUlza0 ee w€ LES61A W991 PEN
ye queyd woy Sieg «LS PISTON eet tion] ape[s 97-90-1107 00ST “6SPL.GPN _“SuTtjunoyy eney (ALLO) sueryyedsed
puelod
: (['s°e WI) =sazBUTpP.1009
SYIVUIIY JdV rice | sJUvld 3doj}01g 218q apminty ‘udexZ005) dS Sulduvs Bole SUTTdUIeS
‘ponuyuoD *] a1qeL.
©ZFMK
Bonn zoological Bulletin 70 (1): 115-139
120
Table 2. Measured body parts of the studied taxa for morpho-
metric analysis.
Measurements
width
width of rostrum
Body parts
es eye diameter
distance between eyes
distance: eye-basis of
antennae
width
length
width
length
width of left and right part
width
length
elytra
pronotum
metasternum
sternum
length of dorsal view
width of dorsal view
aedeagus length of lateral view
width of lateral view
angle of apex
width
receptaculum seminis Beieit
eig
70% acetic acid. The finished preparations were dried
with warm air and stained in 4% Giemsa phosphate
buffer (pH 6.8) for 10 min. Well-spread spermatogonial
metaphases were selected for the determination of chro-
mosome numbers. Observations of chromosomes and
photomicrographs were made using a Nikon Eclipse 501
microscope.
Morphological measurements
Weevils were dissected, mounted on separate mounting
cardboards and labelled. Males and females from the
same locality were identified as the same taxon. Mea-
surements of twenty morphometric characters were ana-
lyzed in this study (Table 2). Additionally, sex dimor-
phistic features were also measured (five for males and
two for females). A Nikon SMZ1500 stereomicroscope,
with NIS Elements software, was used for all morpho-
metric measurements. All body parts were photographed
and measured. Every measurement was taken five times
and averaged.
Statistical analyses of all morphometric data were con-
ducted using R software version 3.4.1 (r-project.org) and
slightly modified versions of the R-scripts provided by
Bonn zoological Bulletin 70 (1): 115-139
Maja Przybycien et al.
Baur & Leuenberger (2011). Scatterplots were genera-
ted with the package ‘ggplot2’ (Wickham 2009). Missing
measurements were replaced by mean average of respec-
tive body parts. All data were standardized by transfor-
ming into a logarithmic scale.
Additionally, bl: body length (from front margin of
the eyes to apex of elytra/body), bw: body width (largest
width of body), hw: head width, were measured of four
taxa specimens whose habitus 1s shown in Fig. 7, as well
as the width and length of the five abdominal sternites
(AS) of the five taxa presented in Fig. 8.
Majority of the specimens used in this study are depo-
sited in the Department of Entomology at Institute of Zo-
ology and Biomedical Research, Jagiellonian University
of Krakow (Poland), and those presented in Figs 7-8 are
in the collection of P. Sprick.
RESULTS
DNA analysis
In the case of COI marker analysis, the biggest gene-
tic distance (15.8%) was detected between Otiorhynchus
jagi from the Alps: Karawank Mountains (Slovenia) and
Otiorhynchus clavipes from Schleswig-Holstein: Bullen-
kuhlen (Germany). Compared with other populations of
O. clavipes in Germany the genetic distance is similar
(15.6%). In turn, genetic distance between six popula-
tions of O. clavipes in Germany and five populations of
O. fagi in the Carpathians (Poland), and two populations
in the Sudetes (Poland) is almost similar (11.3—11.6%).
Only in one population of O. fagi from the Gorce Mts.
(Carpathians) there is a bigger genetic distance (12.5%)
to O. clavipes (Table 3).
The results of EF1-a marker analysis of five O. clavipes
populations from Germany and six O. fagi populations
from Poland (four from the Carpathians and two from
the Sudetes) show the biggest genetic distance (4.7%)
between O. fagi from the Carpathians: Zywiec Beskids
(Poland) and O. clavipes from Schleswig-Holstein: Bul-
lenkuhlen (Germany). The genetic distance between the
O. lugdunensis population from Bullenkuhlen and O. fagi
populations from the Carpathians and the Sudetes is a
bit lower (in each case 4.2%). However, the genetic dis-
tance of EFl-a between the other five O. clavipes popu-
lations from Germany and five O. fagi populations from
the Polish Carpathians and the Sudetes is clearly smaller
(mean value 3.1%) (Table 4).
Using two phylogenetic methods and two different
markers (mitochondrial and nuclear), trees of similar to-
pology were obtained (Figs 1—2). On each tree O. fagi and
O. clavipes form separate clades, which implies that they
are correctly divided. Otiorhynchus clavipes is monophy-
letic in both trees. These results also indicate the relative-
ly high genetic variation of O. fagi, especially for COI
©ZFMK
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 121
— Liophloeus tessulatus
O. ovatus
O. clavipes LSH
O. clavipes LSB
O. clavipes SHB
O. clavipes SHP
O. clavipes LSH
O. clavipes BWH
O. clavipes NRW
O. clavipes LSL
1.00
O. clavipes LSL
O. fagi CZB
O. fagi CGM
0.92
O. fagi CGM
89
O. fagi CZB
O. fagi CTM
1.00 O. fagi CTM
O. fagi SSM
0.88
O. fagi SKM
O. fagi AKM
1.00
O. fagi AKM
O. coecus KU910731.1
O. asfaltinus
O. sulcatus KR479989.1
O. carinatopunctatus KU918176.1
O. rugosostriatus KR481561.1
0.05
Fig. 1. Bayesian approach consensus tree for COI data. Numbers at nodes indicate Bayesian posterior probability: LSB = Lower
Saxony: Bad Zwischenahn, LSH = Lower Saxony: Hannover; SHB = Schleswig-Holstein: Bullenkuhlen; SHP = Schleswig-Hol-
stein: Pinneberg; NRW = North Rhine Westphalia; BWH = Baden-Wuerttemberg: Heilbronn (GERMANY); CZB = Carpathians:
Zywiec Beskid Mts.; CGM = Carpathians: Gorce Mts.; CTM = Carpathians: Tatra Mts.; SSM = Sudetes: Stolowe Mts.; SKM =
Sudetes: Karkonosze Mts. (POLAND); AKM = Alps: Karawank Mts. (SLOVENIA). Sequences from O. ovatus, O. coecus, O. sul-
catus, O. carinatopunctatus, O. rugosostriatus downloaded from GenBank.
data (Fig. 1). These COI data also show that Alpine popu-
lations are notably different from the Carpathians and
Sudetes populations, and in the Carpathians genetic dif-
ferences between populations within individual moun-
tain ranges are present (Table 3, Figs 1—2). In the case of
O. clavipes genetic differences between populations were
relatively smaller than in the previous species (Fig. 1).
The EF1-a data confirm genetic differences of O. fagi in
the Carpathians and indicate a small variability of some
German O. clavipes populations (Figs 3-4), however, we
had unfortunately no data for the populations from the
Karawank Mts. (Slovenian Alps).
Chromosomes
Otiorhynchus fagi and O. clavipes share the same diploid
complement of 22 chromosomes and a sex determination
mechanism of the parachute type (Xy_.). The meioformu-
la n = 10+Xy. was identical at all metaphase I plates of
spermatid division (Figs 5-6).
Bonn zoological Bulletin 70 (1): 115-139
Morphometric differences
Before the analysis, data on body size were normalized
and then analyzed with principal component analysis
(PCA). This analysis was performed to evaluate body
size correlations between two species among males and
females. We focused on PCs with eigenvalues >1 (Quinn
and Keough, 2002), following our PCA of the body size
data, we considered three principal components, PC1,
PC2 and PC3. To test differences between both species
we used general linear model (GLM). Amid males and
females we observed no significant differences for all
PC’s (Tables 6, 7). The Principal component analysis
(PCA) showed no statistically significant differences be-
tween Otiorhynchus fagi (T) and O. clavipes (L), both for
females (Fig. 7) and males (Fig. 8).
©ZFMK
122
100
94
O. asfaltinus
Liophloeus tessulatus
100)
Maja Przybycien et al.
soo © fag/ AKM
O. fagi AKM
O. coecus_KU910731.1
O. clavipes LSL
O. clavipes LSL
O. clavipes BWH
O. clavipes NRW
O. clavipes LSB
O. clavipes LSH
O. clavipes SHB
O. clavipes SHP
O. clavipes LSH
O. fagi SSM
O. fagi SKM
O. fagi CTM
O. fagi CZB
O. fagi CGM
O. fagi CGM
O. fagi CZB
O. fagi CTM
O. rugosostriatus KR481561.1
O. carinatopunctatus KU918176.1
O. sulcatus KR479989.1
O. ovatus HM412003.1 0.07
Fig. 2. Maximum-likelihood tree for COI data. Numbers at nodes indicate bootstrap values: LSB = Lower Saxony: Bad Zwischen-
ahn, LSH = Lower Saxony: Hannover; SHB = Schleswig-Holstein: Bullenkuhlen; SHP = Schleswig-Holstein: Pinneberg; NRW =
North Rhine Westphalia; BWH = Baden-Wuerttemberg: Heilbronn (GERMANY); CZB = Carpathians: Zywiec Beskid Mts.; CGM
= Carpathians: Gorce Mts.; CTM = Carpathians: Tatra Mts.; SSM = Sudetes: Stolowe Mts.; SKM = Sudetes: Karkonosze Mts. (PO-
LAND); AKM = Alps: Karawank Mts. (SLOVENIA). Sequences from O. ovatus, O. coecus, O. sulcatus, O. carinatopunctatus,
O. rugosostriatus downloaded from GenBank.
Additional information on species
The main morphological features to distinguish O. fagi
and O. clavipes are the sculpture and pubescence of the
upper surface of the body as well as of the underside, the
length of the antennal scrobe and of the funicle, the colo-
ration of the legs, the different body shape and especially
the number of grooves of the last abdominal sternite (AS)
in the male sex (Figs 9-10). The females of both taxa are
marginally different (see Table 5).
Both taxa occur in Central Europe and form two ex-
tremes among other representatives of the genus Ofio-
rhynchus regarding these characteristics and molecular
differences demonstrated earlier (Tables 1—2), and they
behave in this area 1n terms of their ecology and biogeog-
raphy as two separate species (Table 5).
Based mainly on own observations of the authors, the
description of the species has been supplemented with
information from the publications mainly of Hoffmann
Bonn zoological Bulletin 70 (1): 115-139
(1950); Smreczynski (1966); Dieckmann (1980); Ger-
mann (2013); and other authors mentioned in the text.
Otiorhynchus fagi Gyllenhal, 1834
(Figs 9-10, Table 5)
Synonyms were presented according to the order of data
descriptions of species names, after Alonso-Zarazaga
et al. (2017) and Casalini & Colonnelli (2019):
= Curculio clavipes Bonsdorff, 1785: 40
= Curculio rufipes Sturm, 1792: pl. 17
= Curculio tenebricosus Herbst, 1795: 333 not Curculio
tenebricosus Herbst, 1784
= Curculio haematopus Schrank, 1798: 490 not Curculio
haematopus Gmelin, 1790, replacement name for Cur-
culio tenebricosus Herbst, 1795
= Otiorhynchus erythropus Boheman, 1842: 267
= Curculio fuscipes Olivier, 1807: 372 not Curculio fusci-
pes Geoffroy in Fourcroy, 1785
©ZFMK
123
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group
S9061T'0 098810 86c6l 0
vre000 99ST 0
= c6cS 10
nal el
86c61 0
9E9ST 0
c6cS 10
000000
4
86c61 0
9E9ST0
c6cS 10
00000°0
00000°0
TI
86c61 0
9E9ST 0
c6cS 10
000000
000000
000000
‘Or
l6r6l 0
808S1°0
p9rsl0
cLI00 0
cLI00 0
CLIO0 0
cLIO0 0
6
108810
8r6rl0
SO9rl0
Orell 0
Orel 0
Orel 0
Orel 0
Orel 0
8
OcCcOI 0
v9OrSl 0
OcIST 0
v89I1 0
v89I1 0
vs89I1 0
v89I10
ps9I1 0
SOvc0 0
*L
LIC6l 0
v9VSl 0
OcIST 0
v89I10
vs89I10
v89I1 0
v89I1 0
v89I1 0
SOvc0 0
vre00 0
9
SLO081°0
c6cS 10
8r6rl 0
evscl 0
evscl 0
evscl 0
evscl 0
evscl 0
[c6c0 0
€60£0 0
€60£0 0
iS
vrsLl 0
8r6rl 0
SO9VI0
cISITO
cISItO
cISITO
cISITO
cISITO
VETCO 0
SOvc0 0
SOvc0 0
SLE100
Y
Tv0810
8r6rl 0
SO9rI0
cISII 0
cISII 0
cISIIO
cISIT 0
cISII 0
C900 0
LLSCO 0
LLSCO 0
SLEI00
vre00 0
[SO810
OcISTO
LLLVI0
cISIl 0
cISIl 0
cISIT 0
cISI1 0
cISIT 0
068100
VETCO 0
VETTO 0
9rS100
¢1S00°0
vre00 0
%
TSO81 0
OcIST 0
LLLVI0
cISI1 0
cISIT 0
cISIT 0
cISI1 0
cISI1 0
068100
VETCO 0
VETCO 0
9VS100
¢1S000
vre00 0
00000°0
T
dNOYOLNO
snjpnssa] "T 9]
WV
180{ OSI
WV
1820 “v1
dHS
sadiav]2 ‘OC “€]
MUN
sadiavj2 ‘OC “TI
dqsT
sadiav]2 ‘OC TI
HST
sadiavj2 ‘OC ‘Ol
aHs
sadiav]2 ‘O 6
WLO
180{ 0 '8
WMS
180 'O 'L
WSS
sof 09
WDO
182 O'S
dZo
180{ Of
WDO
182{O'€
dZo
180{ OT
WLO
182 OC "|
OU/BXBL,
‘(VINAAOTS) ‘SIA yuemerey ‘sdtv = WMV (GNV10d) ‘SW ezsouoysey ‘sajapns = WMS “SIA PMO]OIS ‘sajapns = WSS “SIP 90H
‘sueryyedieg = WDD “SIA prysod 99IMA7Z ‘suvryjyedieg = {7D “SIA BURL, :sueiediey = WLO (ANVINAD) sioqouul g :uld}S[OH-SIMSO[YIS = HS “Uloqsoped ‘elyeydysa SUTUYY
YON = MUN ‘uyeusyosIm7 peg :AUOXBS IOMO'T = GST “JoAOUURH] :AUOXBS JOMOT = HST ‘UdTYNYyUST[NG :UId]STOH-SIMSaTYIS = AHS ‘JOYIVU [OD JOJ SOURISIP OOUDH *¢ IqQUL,
©ZFMK
Bonn zoological Bulletin 70 (1): 115-139
Maja Przybycien et al.
124
Table 4. Genetic distances for EFla marker: LSB = Lower Saxony: Bad Zwischenahn; LSH = Lower Saxony: Hannover; NRW = North Rhine Westphalia: Paderborn; SHP =
Schleswig-Holstein: Pinneberg; SHB = Schleswig-Holstein: Bullenkuhlen (GERMANY); CTM = Carpathians: Tatra Mts.; SSM = Sudetes: Stolowe Mts.; SKM = Sudetes: Karkono-
sze Mts.; CGM = Carpathians: Gorce Mts.; CZB = Carpathians: Zywiec Beskid Mts. (POLAND).
Taxa/no
1. O. fagi
CTM
2: fagi
SSM
3. O. fagi
CTM
4. O. fagi
SKM
5. O. fagi
CGM
6. O. fagi
CZB
7. O. clavipes
LSB
8. O. clavipes
LSH
9. O. clavipes
NRW
10. O. clavipes
SHP
11. O. clavipes
SHB
12. L. glabrirostris
OUTGROUP
1.
0.00000
0.00000
0.00000
0.00000
0.00524
0.03147
0.03147
0.03147
0.03147
0.04196
0.23741
2.
0.00000
0.00000
0.00000
0.00524
0.03147
0.03147
0.03147
0.03147
0.04196
0.23741
a:
0.00000
0.00000
0.00524
0.03147
0.03147
0.03147
0.03147
0.04196
0.23741
4.
0.00000
0.00524
0.03147
0.03147
0.03147
0.03147
0.04196
0.23741
5.
0.00524
0.03149
0.03149
0.03149
0.03149
0.04198
0.23681
6.
0.03671
0.03671
0.03671
0.03671
0.04720
0.23961
0.00000
0.00000
0.00000
0.01049
0.24619
0.00000
0.00000
0.01049
0.24619
0.00000
0.01049
0.24619
10.
0.01049
0.24619
11.
0.25030
12.
©ZFMK
Bonn zoological Bulletin 70 (1): 115-139
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 125
O. sulcatus KU041904.1
O. auropunctatus HQ883728.1
Liparus glabrirostris
O. clavipes LSB
O. clavipes SHP
O. clavipes LSH
O. clavipes SHP
O. clavipes NRW
O. clavipes BWH
O. clavipes LSH
O. clavipes LSL
O. asplenii
O. fagi SSM
O. fagi SKM
O. fagi CGM
O. fagi CTM
O. fagi CZB
O. coecus KJ801844.1
0.02
Fig. 3. Bayesian approach consensus tree for EF1-a data. Numbers at nodes indicate Bayesian posterior probability: LSB = Lower
Saxony: Bad Zwischenahn, LSH = Lower Saxony: Hannover; SHP = Schleswig-Holstein: Pinneberg; NRW = North Rhine West-
phalia; BWH = Baden-Wuerttemberg: Heilbronn (GERMANY); CZB = Carpathians: Zywiec Beskid Mts.; CGM = Carpathians:
Gorce Mts.; CTM = Carpathians: Tatra Mts.; SSM = Sudetes: Stolowe Mts.; SKM = Sudetes: Karkonosze Mts. (POLAND). Se-
quences from O. sulcatus, O. auropunctatus, O. coecus downloaded from GenBank.
= Curculio maritimus Donovan, 1811: 63
= Otiorhynchus substriatus Silbermann, 1833: no. 7
= Otiorhynchus substriatus Gyl\lenhal, 1834b: 563
= Otiorhynchus sanguinipes Boheman, 1842: 296
= Otiorhynchus waltoni Smith, 1869: 136
= Otiorrhynchus sanguinipes var. subglaber Reitter,
1913: 50
= Otiorhynchus fuscipes forma heynei Voss, 1919: 405
= Otiorhynchus evertsi Uyttenboogaart, 1931: 292
= Otiorrhynchus sanguinipes var. stierlini Uytten-
boogaart, 1931: 295 not Otiorhynchus stierlini Gem-
minger, 1871
= Otiorrhynchus stierlinianus Uyttenboogaart, 1933:
229 not Otiorrhynchus populeti Boheman, 1842 var.
stierlinianus Reitter, 1914b: 159, replacement name
for Otiorrhynchus sanguinipes var. stierlini Uytten-
boogaart, 1931
= Otiorhynchus olivieri Abbazzi & Osella, 1992: 294,
replacement name for Curculio fuscipes Olivier, 1807
not Curculio fuscipes Geoffroy in Fourcroy, 1785
Bonn zoological Bulletin 70 (1): 115-139
Adult morphology. Otiorhynchus fagi is quite vari-
able, depending on the origin, such as in the coloration
of the legs (knees and base of femorae more or less dark-
ened but not as clear as in O. coecus), in the fine pubes-
cence of the top of the body and especially in the sculp-
tures and spaces of the elytral striae. Generally, O. fagi is
morphologically similar to O. clavipes, but it is weaker
and narrower in habit than the usually large, strong form
of O. clavipes. The body length is 8-13 mm. The anten-
nae are black. The upper side of the pronotum Is uneven-
ly scored in the front part, in the back part it is equipped
with small granules, just like on the sides. The sides of
the pronotum are rarely pubescent and hardly stand out
from the upper part. On the elytra there are very small
and very sparse patches of scales. Along the elytral striae
small punctures are clearly visible. The tarsi are black.
Body hairs are rare and very delicate, so that the beetle
appears bare; exceptionally hair clusters at the punctures
of grooves merging into very small spots on the sides of
elytra are hardly noticeable.
©ZFMK
126 Maja Przybycien et al.
Table 5. Additional distinctness in morphology, ecology and biogeography between Otiorhynchus fagi Gyllenhal, 1834 and O.
clavipes (Bonsdorff, 1785; compilation of the authors’ own data and information from Hoffmann (1950, 1963), Smreczynski
(1966), Endr6odi (1961), Knutelski (2005), Sprick & Stiiben (2012), Germann (2013), Mazur (2016) and Gosik et al. (2016); for
illustrations see Figs 7-8.
Feature/Species O. fagi Gyllenhal, 1834 O. clavipes (Bonsdorff, 1785)
Morphology
weaker and narrower than O. clavipes, no stronger and broader than O. fagi; head black with a
body shape bright spots on elytra, antennae black, small cherry stripe behind the eyes, white hair spots on elytra,
points clearly visible on the elytral striae femorae cherry
size 9-13 mm 9.5-15 mm
sten very small and very sparse, scaly patches usually loosely covered by groups of small silver-grey
y present spots
only very fine grooves in front of the
apex, less expanded and less deep, in
great number (more than 40), no crest of
yellowish hairs or bristles at the apex
about 8—15 strong ribs in the middle, accompanied by a
different number of small ribs/grooves at the sides and a
crest of yellow hairs/bristles at the top border
abdominal sternite
apex rounded, the inner bag with several apex usually angular, the inner bag almost completely
aedeagus
complex tortuous sclerites reduced
head dark brown; all thoracic and abdominal head yellow or dark yellow; all thoracic and abdominal
lnevarcolonaton segments from dark yellow to brownish segments yellow or yellowish to brownish
Ecology
in western Europe in lowlands and areas of low and
medium height (low mountain ranges), introduced in
location mainly in mountainous and piedmonts areas Sentral idl aAsteenIbuoMeamninIsrinaacbatk estateean
sandy regions
mainly in forest areas, deciduous and in great parts of Western Europe in the forest zone of the
A mixed, from the lower to the high mountain —_ low hill country; in introduced areas (e.g. the northern
habitat an, ee . RE ty
regions; abundant in different habitats inthe plains) mainly in allotments, nurseries, parks, thickets,
Sudetes and Carpathians Mts. cemeteries, hedges, and gardens
adults feed leaves of various plants, such adults feed leaves and buds mainly of common lilac and
food as European spruce, also of herbaceous privet, also recorded from other Oleaceae plants and
perennials, producing characteristic feeding adjacently growing bushes, producing characteristic
notches feeding notches similarly to O. fagi
May—October, and most often in June and
appearance of adults July; nocturnal, in the mountains also during Og poner anes Zo undan tinea pil ay, manly
the day nocturnal
Biogeography
most mountainous regions of Central mainly in western and central Europe, introduced in
geographic and Eastern Europe, in the hill country eastern Europe and very rare and local in this area;
distribution of Germany, in the Alps, Sudetes and increasing its range with the planting of common lilac
Carpathians (Syringa), white-cedar (Thuja) and privet (Ligustrum)
altitudinal 400-2500 m a.s.l., mostly abundant and up to 200 m a.s.l. (in France also found in some higher
distribution frequent in 800-2100 m a.s.l. mountain areas)
piogeorrapincal European, mountain European, mountain and lowland
element
Bonn zoological Bulletin 70 (1): 115-139 ©ZFMK
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 127
O. fagi CGM
O. fagi SSM
O. fagi SKM
O. fagi CTM
O. fagi CTM
O. fagi CZB
O. clavipes LSB
94
O. clavipes SHB
O. clavipes BWH
O. clavipes SHP
O. clavipes NRW
95 O. clavipes LSH
O. clavipes LSH
O. clavipes LSL
O. coecus KJ801844.1
O. sulcatus KU041904.1
82
O. auropunctatus HQ883728.1
Liparus glabrirostris
0.02
Fig. 4. Maximum-likelihood tree for EF1-a data. Numbers at nodes indicate bootstrap values: LSB = Lower Saxony: Bad Zwischen-
ahn, LSH = Lower Saxony: Hannover; SHB = Schleswig-Holstein: Bullenkuhlen; SHP = Schleswig-Holstein: Pinneberg; NRW =
North Rhine Westphalia; BWH = Baden-Wuerttemberg: Heilbronn (GERMANY); CZB = Carpathians: Zywiec Beskid Mts.; CGM
= Carpathians: Gorce Mts.; CTM = Carpathians: Tatra Mts.; SSM = Sudetes: Stolowe Mts.; SKM = Sudetes: Karkonosze Mts.
(POLAND). Sequences from O. sulcatus, O. auropunctatus, O. coecus downloaded from GenBank.
Male. The elytra are elongate. The last abdominal ster-
nite (AS) is flat and characterized by a great number (>
40) of very fine grooves in front of the apex, less expan-
ded and less deep, bearing no crest of yellowish hairs or
bristles at the posterior edge of the apex (Fig. 8). The
AS of O. fagi is the smallest (1.75 x 1.175 mm = 1.49: 1)
among the compared AS of all measured taxa (Fig. 8).
In appearance it is very similar to AS of O. coecus Ger-
mar, 1823, used here as the ,,outgroup”. The aedeagus of
O. fagi is almost parallel laterally in the apical region,
and the apex is rounded, the inner sac 1s armed with sev-
eral complex tortuous sclerites (Germann 2011, 2013;
Schitte et al. 2013).
Female. The last abdominal sternite has very fine fur-
rows in the central part, and it bears fine hairs at the sides
and at the apex as on the other sternites.
Larva. The head is dark brown; all thoracic and ab-
dominal segments from dark are yellow to brownish; cu-
ticle is almost smooth. For more details on the morpholo-
gy of the larva see the publication of Gosik et al. (2016).
Bonn zoological Bulletin 70 (1): 115-139
Ecology. This species inhabits mainly montane and
submontane areas, from the deciduous and mixed for-
ests of the middle and higher low mountain regions to
the coniferous forest of higher elevations. In the Tatra
Mts. O. fagi mainly inhabits spruce forests, fir-spruce
forests, mountain pine, subalpine and alpine meadows,
rowan-spruce and willow-rowan brushwood, but it is
also found in beeches, alders, in brush and herbs at road-
sides, at streams and at windbreak, on clearings as well as
in couloirs and on turfs on the rocks. Otiorhynchus fagi
does not show clear habitat preferences and can be classi-
fied as eurytopic weevil species of the hill and mountain
regions (Hoffmann 1950; Smreczynski 1966; Dieckmann
1980; Morris 1997; Knutelski 2005; Sprick & Sttiben
2012; Stiiben et al. 2015; Gosik et al. 2016; Mazur 2016).
Food plants. Polyphagous, adults feed on leaves of
various plants, both woody and herbaceous, making
characteristic feeding notches on Picea abies (L.) H.
Karst., Abies alba Mill., Pinus mugo Turra, Alnus inca-
na (L.) Moench, Corylus avellana L., Salix spp., Sorbus
©ZFMK
128
Maja Przybycien et al.
hy
Me
10um
—_—————I
Fig. 5. Chromosomes of Otiorhynchus fagi, arrow indicates Xyp (the sex chromosomes of parachute type).
aucuparia L., Rubus idaeus L., Petasites albus Gaertn.,
Adenostyles alliariae A. Kern., Rumex acetosa L., Trifo-
lium pratense L., Vaccinium myrtillus L., various species
of Alchemilla, Cirsium and Geranium: in the Carpath-
ians and Harz Mts. collected mainly from Picea abies
(Hoffmann 1950; Dieckmann 1980; Palm 1996; Knutel-
ski 2005; Sttben et al. 2015; Kizub and Slutsky 2019;
P. Sprick, pers. data). In the Czech Republic the species
was collected also from Rosa sp., and from Solanum tu-
berosum L. at agricultural potato crops areas near a forest
(Hrabovsky 2014).
Appearance of adults. From beginning of May to
October, and most often in June and July; on and under
Bonn zoological Bulletin 70 (1): 115-139
different plants, under stones and in the leaf litter (Dieck-
mann 1980; Knutelski 2005; Gosik et al. 2016).
Geographical distribution. This species occurs in
several central and east European mountainous regions,
from Eastern France to Romania.
In Western Europe additionally present in the Massif
Central, and possibly, but very isolated and to confirm in
the French Pyrenees (two sites) and in adjacent regions
of Northern Spain (two to three sites). In the Apennines
of northern and central Italy and on Monte Amiata (see
Casalini & Colonnelli 2019), a volcano of Pleistocene
origin in Tuscany, it was also recorded from the north-
ern Mediterranean region. In Germany occurring in all
regions of the Alps and Central Uplands with northern
©ZFMK
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group
rs “
sok
=
129
10um
|
Fig. 6. Chromosomes of Otiorhynchus clavipes, arrow indicates Xyp (the sex chromosomes of parachute type).
limit in the Ith and Harz Mountains and absent or nearly
absent from the northern sandy plains (Kohler & Klaus-
nitzer 1998; Bleich et al. 2020).
On the Balkan Peninsula only present in the northern
or northwestern part (Croatia).
In the Sudetes and the Carpathian areas of Poland the
Species is common, and in particular it is widespread and
often very frequent in the Tatra Mts., as well as in the
Slovakian, Ukrainian and Romanian Carpathians (Knu-
telski 2005; Kizub & Slutsky 2019; own data of P. Sprick
and S. Knutelski). It is widespread and quite frequent in
Switzerland: Jura Mts., midlands, north side of the Alps,
Western and Eastern Central Alps (Germann 2010; in
conjunction with Germann 2013; and C. Germann, pers.
comm. 2020).
It is widespread also in the southeastern part of France:
Alpes de Savoie, Alpes du Dauphiné, Hautes Alpes,
Rhone-Alpes (Isere, Ain), Massif Central/Auvergne
(Cantal, le Lioran, le Sancy, Puy-de-Déme), Vaucluse
(Mt. Ventoux), and Vosges (Hoffmann 1950; Schott
2017).
In Hungary is known only from several localities
(northern part, in the environs of the Bukk highland, close
to the frontier with Slovakia) (Slicker 2019), present also
in Banat (Western Romania) and in Croatia, where it is
Bonn zoological Bulletin 70 (1): 115-139
rare (Endr6odi 1961). Also known from many places in
hillside areas of the same regions.
In Poland the largest enclave outside mountain regions
is located in the Krak6w-Wielun Upland; it includes the
Pradnik valley in the Ojcow National Park.
It was recorded once or sporadically in a few localities
in the highlands and lowlands, too (Hoffmann 1950; En-
drédi 1961; Smreczynski 1966; Dieckmann 1980; Knu-
telski 2005; Germann 2013; Sprick & Stiiben 2012; Stu-
ben et al. 2015; Mazur 2016; Yunakov et al. 2018; Kizub
and Slutsky 2019).
According to Alonso-Zarazaga et al. (2017) and new
information by Casalini and Colonnelli (2019), our own
data, information from some colleagues and further re-
search, the revised distribution is as follows: Austria,
Belgium, Croatia, Czech Republic, France, Germa-
ny, Hungary (northern part), Italy (northern to central
part) (Abbazzi & Maggini 2009; R. Casalini, Roma,
pers. comm. 2020), Liechtenstein, Luxembourg, Poland
(southern part), Romania, Slovakia, Slovenia, ?Spain,
Switzerland, and Ukraine (western part). Information
on introduction of O. tenebricosus to North America by
Alonso-Zarazaga et al. (2017) probably refers to O. clavi-
pes (see next break).
©ZFMK
130 Maja Przybycien et al.
Shape PC2 (20.1%)
OO. fagi
Q O. clavipes
Shape PC1 (35.6%)
Fig. 7. Shape principal component analysis (PCA) for exploring females’ variation within Otiorhynchus fagi (G) and Otiorhynchus
clavipes (Q) using all variables, the variance explained by each shape principal (PC) is given in parentheses. Statistical analysis
showed no significant differences.
There are no reliable data for Great Britain, Ireland, the
Netherlands, and North America. The data for Denmark
have been revised by Casalini and Colonnelli (2019) and
belong to O. clavipes. Records from Belgium are proba-
bly confined to the eastern parts, where altitudes of over
650 ma.s.l. are achieved (M. Delbol, Liege, pers. comm.
2020). Records from Luxembourg seem possible as
heights above 500 m are achieved, too, but should be con-
firmed. All records from four Dutch provinces belonged
to O. clavipes (Heijerman 2020). In Slovenia O. fagi is
present but apparently not common (M. Kahlen, pers.
comm. 2020). Records from Spain (Alonso-Zarazaga
2018) are all from the Basque region bordering to the
west of the Pyrenees: two old and one recent record from
2019, identified by Bahillo de la Puebla as O. tenebrico-
sus (MA Alonso-Zarazaga, pers. comm. 2020), may be
correct, but the finding region is situated rather far and
isolated from the next occurrences in France. Thus it re-
mains doubtful if O. clavipes can be really excluded and
if this occurrence is secondary (introduced) or represents
an original site. Information on the introduction to North
Bonn zoological Bulletin 70 (1): 115-139
America, reported in the catalogue of Alonso-Zarazaga
et al. (2017), is probably not correct. The basis of this re-
cord is unknown. Our research revealed only data about
an introduction of O. clavipes to North America, accord-
ing to Poole & Gentili (1996).
Biogeographical element. Western European: eastern
part, Central and Eastern European, in mountainous re-
gions, abundant along the chains of the Alps, including
Maritime Alps, the Carpathians, Sudetes; further west
until Massif Central; further north in the mid-mountain
areas of Germany and Belgium, and further south along
the Italian mountain chain of the Apennines; disjunct
occurrences apart from this core area were reported for
several regions. Introductions of this species are rare —
opposite to O. clavipes. In the light of the Dutch O. tene-
bricosus records, just recently determined by Heijerman
(2020) as O. clavipes, the distribution of both species in
Belgium, which was communicated preliminairily by M.
Delbol (pers. comm.), should be confirmed and shown
more in detail.
©ZFMK
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 131
Altitudinal distribution. It occurs between 400 m and
2500 m above sea level (a.s.l.), and it is most abundant
and frequent between 800 m and 2100 ma.s.l.
Otiorhynchus (Otiorhynchus) clavipes_ (Bonsdorff,
1785)
(Figs 9-10, Table 5)
Synonyms were presented according to the order of data
descriptions of species names, after Alonso-Zarazaga
et al. (2017) and Casalini & Colonnelli (2019):
= Curculio clavipes Bonsdorff, 1785: 40
= Curculio rufipes Sturm, 1792: plate 17 not Curculio
rufipes Linnaeus, 1758
= Curculio maritimus Donovan, 1811: 63 not Curculio
maritimus Marsham, 1802
= Othiorhynchus substriatus Silbermann, 1833: no. 7
= Otiorhynchus substriatus Gyllenhal, 1834: 563, not
Othiorhynchus substriatus Silbermann, 1833
= Otiorhynchus lugdunensis Boheman, 1842: 268
= Otiorrhynchus elongatus Stierlin, 1861: 65 not Otio-
rhynchus elongatus Hochhuth, 1847
= Otiorhynchus francolinus L.W. Schaufuss, 1867: 22,
replacement name for Otiorrhynchus elongatus Stier-
lin, 1861: 65 not Otiorhynchus elongatus Hochhuth,
1847
= Otiorhynchus longulus Marseul, 1872: 250, replace-
ment name for Otiorrhynchus elongatus Stierlin, 1861
not Otiorhynchus elongatus Hochhuth, 1847
= Otiorhynchus longulus Marseul, 1873: 143
= Otiorrhynchus dilatipes Guillebeau, 1885: 2
= Otiorhynchus guillebeaui Desbrochers des Loges,
1894: 89
= Otiorrhynchus clavipes ssp. evertsi Uytenboogaart,
1931-292
Adult morphology. Otiorhynchus clavipes 1s general-
ly morphologically very similar to O. fagi, but especial-
ly specimens up to now identified as O. /ugdunensis are
stronger and broader in habit. The body is 8-15 mm long,
black and covered with hairs clear. The head is black, of-
ten cherry colored behind the eyes, with small but clear-
ly visible, light colored scales between the eyes and on
the entire upper surface of the rostrum. The granules on
pronotum and elytra are fine. The elytra are about twice
as long as wide, usually loosely covered with groups of
small, silver-gray spots clearly visible in the usually faint
grooves, sometimes bare even on the disc. The femur is
widened in the middle part, cherry, without spurs. The
tibia is black.
Male. The elytra are elongate. The last abdominal ster-
nite (AS) is with about 6—15 strong ribs in the middle,
on the sides with different numbers of very fine smaller
ribs and grooves, and in front of the end with a well-de-
veloped cavity; at the hind-margin there is a dense fringe
Bonn zoological Bulletin 70 (1): 115-139
of erect yellow hairs. The aedeagus 1s almost parallel
in the apical area, and the apex is angular, the inner sac
is almost completely reduced. The tip of the spiculum
ventrale is more or less deep concave (Germann 2013;
Schiitte et al. 2013).
Female. The elytra are oval. The last abdominal ster-
nite usually bears punctures and hairs.
Larva. The head is dark yellow; all thoracic and ab-
dominal segments are from yellowish to brownish; cuti-
cle is almost smooth (Gosik et al. 2016).
Ecology. This species occurs in the forest zone of col-
line regions and in medium to high areas, but mainly in
the low mountain ranges of Western and western Central
Europe. In the northern central and eastern part of the
continent (e.g., Northern Germany, Poland), it was intro-
duced and inhabits mainly urban estates (cities, very rare-
ly outside), such as gardens, parks, cemeteries, nurseries
and similar areas. This species prefers several Oleaceae,
and it has been found mainly on common lilac (Syringa),
but also on privet (Ligustrum), young ashes (Fraxinus),
Euonymus, Thuja and a few other bushes, which are also
involved in passive transport processes and the introduc-
tion to other regions by trade. Adults are polyphagous
and nocturnal. Weevils start to eat the leaf margin of
shrubs at dusk and continue by night. Larvae are also po-
lyphagous and develop mainly between the roots of these
plants. They were bred with Euonymus fortunei (Turcz.)
Hand.-Mazz., Ligustrum vulgare L. and Syringa vulgaris
L. (Gosik et al. 2016).
The last (sixth) larval instar forms a pupal chamber
with compressed walls made from soil under the ground
(Gosik et al. 2016). Metamorphosis of the larvae oc-
curs from end of February, and in the Paris region adu-
Its emerged from the pupa in March (Hoffmann 1950).
According to Ibbotson & Edwards (1954), the life cycle
of O. clavipes is completed within 12 or 18 months de-
pending on the oviposition period. Adult weevils appear
in two periods. One part pupates in autumn, overwinters
in the pupal chamber and emerges in large numbers from
April to May, the other part pupates from mid-May to
July, and adults emerge from mid-June to end of August.
For pupation larvae move deeper in the soil and pupate
between 15 and 20 cm below soil level. According to
Gosik et al. (2016) early emerging weevils lay eggs in
Spring and early summer, larvae develop during spring
and summer, pupate and hatch in autumn, overwinter in
the pupal cell and emerge again early in the season. And
weevils laying eggs later in the season larvae overwinter
and complete their development in the following season.
Food plants. Larvae and adults are polyphagous. Ma-
inly feed on common lilac, Syringa vulgaris, and also
Ligustrum sp., Aucuba sp., Lonicera sp., etc., especially
in Isere (France) they were observed on vine (Hoffmann
1950). Beetles were collected from various shrubs, such
as Euonymus fortunei (Turcz.) Hand.-Mazz., E. japoni-
cus Thunb., Fraxinus excelsior L., F- ornus L., Viburnum
©ZFMK
132 Maja Przybycien et al.
0.2
Shape PC2 (16.8%)
S
De)
- 0.4
-0.6
-1.0 - 0.5
QO O. fagi
O O. clavipes
0.0 0.5 1.0
Shape PC2 (44.3%)
Fig. 8. Shape principal component analysis (PCA) for exploring males’ variation within Otiorhynchus fagi (G) and Otiorhynchus
clavipes (Q) using all variables, the variance explained by each shape principal (PC) is given in parentheses. Statistical analysis
showed no significant differences.
tinus L., V. opulus L., Acer sp., Rhus coriaria L., Weige-
la sp., Vitis sp., Lonicera sp. and Thuja plicata Donn ex
D. Don (Hoffmann 1950, 1963; Gosik et al. 2016; Stu-
ben et al. 2015). In the past O. clavipes was reported
by Hoffmann (1950, 1963) to be harmful to Syringa sp.
and Ligustrum sp. in nurseries, and present on Aucuba
sp., Viburnum tinus, V. opulus, Acer sp., Rhus coriaria,
Weigela sp. and Vitis sp. Ibbotson & Edwards (1954) in
turn mention this species as noxious to English strawber-
ry cultures in a rather small area around Cheddar, only. In
Northern Germany it was regarded as species with no or
nearly no economic importance in all parks and tree nurs-
eries where it was found during 2008 to 2011 (Sprick &
Stiiben 2012).
Appearance of the adults. In the nightfall adults be-
gin to devour the edges of buds and leaf plates and gnaw
already in April and May on the leaf and flower buds of
common lilac. In the course of the year large notches
are eaten in the leaf margin of different bushes, causing
characteristic incisions. The weevils already copulate in
mid-April and start laying their eggs in the ground more
or less during the entire season (Gosik et al.2016). They
were found on the plants from April to mid-August (Hof-
Bonn zoological Bulletin 70 (1): 115-139
fmann 1950), with maximum abundance in May and
June.
Geographical distribution. The locus typicus of
“O. lugdunensis” is Lyon (Hoffmann 1950). This species,
now O. clavipes, shows a western to western central Eu-
ropean distribution. Moreover it was introduced to areas
around the North Sea and the Baltic Sea, to eastern Eu-
rope, and even to North America.
In France, it is widespread throughout the entire coun-
try, mainly in the plains and low-altitude hills but also in
the higher mountain ranges (e.g.: Cevennes, Ardeche, la
Garde, la Lozere, montagnes de Provence, Basses-Alpes,
Alpes Maritimes, and also in many other regions (Hoff-
mann 1950; GBIF https://www.gbif.org); there are also
observations from the area around Paris, where it can
sometimes be harmful to nurseries (Hoffmann 1950; Za-
gatti et al. 2001), which may also depend on introduction.
In Germany it was introduced to many localities in
the lowlands, especially into the northern sandy plains,
e.g., Lower Saxony, Schleswig-Holstein, Brandenburg,
Sachsen (Dieckmann 1980; Sprick & Sttiben 2012;
Schittte et al. 2013; Sttiben et al. 2015).
©ZFMK
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 133
Otiorhynchus fagi Otiorhynchus clavipes
Otiorhynchus clavipes (U.K.) Otiorhynchus coecus
5
&
ry
Fig. 9. Habitus of males. O. fagi (Germany, National Park Harz, Sachsen-Anhalt: Brocken, experimental garden, 7.8.2019, 1100 m
a.s.l., leg. & det. P. Sprick; bl = 9.9 mm, bw = 3.95 mm, hw = 1.675 mm), O. clavipes (Germany, Hannover-Linden, park south of
Leine river, 25.5.2009, leg. & det. P. Sprick; bl = 11.2 mm, bw = 5.05 mm, hw = 1.9 mm), O. clavipes (U.K., England, Cornwall:
Rescassa, 21.5.1989, leg. & det. M.G. Morris; bl = 9.55 mm, bw =4.1 mm, hw= 1.7 mm), and O. coecus (Germany, National Park
Harz, Sachsen-Anhalt: Brocken, experimental garden, 28.5.2019, 1100 maz.s.l., leg. & det. P. Sprick; bl = 8.2 mm, bw = 3.6 mm,
hw = 1.5 mm) as an outgroup; bl: body length, bw: body width, hw: head width. All photos by F. Bahr. Scale bar = 5 mm.
Bonn zoological Bulletin 70 (1): 115-139 ©ZFMK
134 Maja Przybycien et al.
Otiorhynchus coecus Otiorhynchus fagi
Otiorhynchus clavipes (U.K.) Otiorhynchus clavipes (France)
Otiorhynchus clavipes
Fig. 10. Abdominal sternites (AS) of males. O. coecus (Germany, National Park Harz, Sachsen-Anhalt: Brocken, experimental
garden, 28.5.2019, 1100 maz.s.1.; AS: 1.65 x 0.9 mm (= 1.83:1), as an outgroup; O. fagi (Germany, National Park Harz, Sachsen-An-
halt: Brocken, experimental garden, 7.8.2019, 1100 ma.s.l., both leg. & det. P. Sprick; AS: 1.65 x0.9 mm (= 1.83:1); O. clavipes
(U.K., England, Cornwall: Rescassa, 21.5.1989, leg. & det. M.G. Morris, the brownish colour indicates a specimen with not ful-
ly-sclerotized exoskeleton; AS: 1.9 x 1.15 mm (= 1.65:1); O. clavipes (France, Savoie: Valloire, 19.8.1987, leg. H. Gunther, det. P.
Sprick; bl = 9.8 mm, bw = 4.45 mm, hw = 1.75 mm; AS: 1.91.1 mm © 1.73:1); O. clavipes (Germany, Hannover-Linden, Park
south of Leine river, 25.5.2009, leg. & det. P. Sprick; AS (2.3 x 1.3 mm = 1,77:1); bl: body length, bw: body width, hw: head width.
All photos by F. Bahr.
Bonn zoological Bulletin 70 (1): 115-139 ©ZFMK
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 135
In Poland, O. clavipes is known only from a few urban
areas, like Wroclaw and Olsztyn (Biatooki 2005; Mazur
2016; Wanat & Mokrzycki 2018). Its occurrence in large
towns or in areas with tree nurseries is very typical for
introduced flightless weevil species.
Heijerman (2020) confirmed presence O. clavipes in
the Netherlands where it was recorded in several prov-
inces. He supposed that it is not introduced there.
The known current distribution of O. clavipes, mainly
based on Alonso-Zarazaga et al. (2017), is revised here as
follows: originally occurring in Belgium, France, Great
Britain, Germany (western parts: Baden-Wuerttemberg,
Hesse, North Rhine Westphalia; Kohler & Klausnitzer
1998), Ireland, Luxembourg, the Netherlands (southern
colline part), and introduced to: Denmark, Estonia, Ger-
many (northern parts), Latvia, the Netherlands (plain re-
gions), Poland, where it is sometimes very rare and local
(Mazur 2016), Sweden and Switzerland (Germann et al.
2017). The few records from Switzerland are based on
introduction (C. Germann, pers. comm. 2020).
Similar as in O. fagi, the few extreme southwestern
records of O. clavipes are from the Pyrenees and adyja-
cent areas, two on the French and two on the Spanish
side, usually old records, remain doubtful. And if correct,
there is no information, whether these records from Spain
and the French Pyrenees are based on original occurrence
or on introduction.
Biogeographical element. Western European inclu-
ding the western parts of Central Europe; lower foothill
(colline zone) to mountainous regions, introduced in the
lowlands (usually < 100 m a.s.l.) in northern Central,
southern North and Eastern Europe, rarely elsewhere,
often on sandy ground; introduced to North America
(Poole & Gentili 1996) (Table 5).
Otiorhynchus hungaricus Germar, 1824
Synonyms after Casalini & Colonnelli (2019):
= Otiorhynchus hungaricus Germar, 1823: 351:
= Otiorrhynchus hungaricus var. hospitellensis Hus-
tache, 1923: 54
The third species of the O. clavipes group is O. hungari-
cus, which was not main study object of this paper, but it
is included in the revision of the distribution, here.
According to Alonso-Zarazaga et al. (2017) the range
of O. hungaricus was reported as follows: Bosnia-Herce-
govina, Bulgaria, Croatia, Russia: Central European Ter-
ritory, Germany, Hungary, Moldova, Romania, Serbia,
Slovakia, and Ukraine. As there are no data for Germany,
this often repeated record has to be deleted from the list
until an introduction may have been proven.
The following records from isolated sites, which are
given by different authors via https://www.gbif.org, have
to be assessed in future, as to whether they are native or
Bonn zoological Bulletin 70 (1): 115-139
based on introduction: Estonia (Tallinn-Lasnamae, lime-
stone grassland, several specimens) by Roosileht (2015),
Poland (Gory Stolowe, Sudetes Mts., > 800 m as.l.)
by Wanat (2017), and Czech Republic (Tfinec, around
300 m, surrounding area up to over 900 m a.s.1.) by Lan-
geveld et al. (2020). The Estonian records are so far north
of the core area (> 1000 km) that an introduction seems
probable, even if the species inhabits limestone grass-
land in this northern exclave. The record from Poland is
from a rather high area, untypical for this species. The
presence in France is limited to the extreme Southeast
(region of Digne and Alpes-Maritimes; Hoffmann 1950),
but there 1s no information about habitats, indicating that
its status remains unresolved, probably this 1s a historical
introduction of an Eastern European species. In western
Ukraine O. hungaricus inhabits mainly the low moun-
tain Carpathians foothill zone, but the upper altitudinal
limit is unknown. The Russian territory is situated also
rather far from the core area of this species, and introduc-
tion cannot be excluded. The presence in Moldova con-
firms the preference of lower foothill sites, as the high-
est mountain of this country achieves only 428 m a.s.l.
Apparently very little is known about host plants (po-
lyphagous, preference for Rosaceae, according to Mazur
2002) and altitudinal limit. The determination of the right
biogeographical character and especially in the northern
sites the status as native or introduced species have to
be regarded as provisional. Benedikt et al. (2010) listed
this species only from one site in Slovakia (Matranské
Pannonikum region) and characterized it as forest spe-
cies of steppe regions. Thus, we regard it preliminarily as
Southeastern European forest steppe species that prefers
lower altitudes.
In summary it can be stated that there are well-deve-
loped characters of aedeagus and on abdominal sternites
of males (Fig. 8) and very subtle differences, sometimes
easy to overlook, between certain parts of the body of
O. fagi and O. clavipes, such as the presence or absence of
elytral spots (Table 5, Figs 7-8), and that there are signifi-
cant genetic differences between O. fagi and O. clavipes
(Tables 3-4, Figs 1-2) and separate geographical ranges
in Central Europe between all three studied species.
DISCUSSION
The results of our study supports the legitimacy of the
two separate species, O. fagi and O. clavipes, which had
been also suggested by previous studies (Germann 2011,
2013; Gosik & Sprick 2013; Schutte et al. 2013; Stiben
et al. 2015; Gosik et al. 2016; Casalini & Colonnelli
2019; Smreczynski 1966; Dieckmann 1980), in opposite
to synonymizing both taxa proposed by Magnano (2001)
and Fauna Europaea (Alonso-Zarazaga 2014). The data
indicate that O. fagi is a mountain species (Massif Cen-
tral, Alps, Carpathians, Sudetes) and several other more
©ZFMK
136
or less adjacent mountainous areas of Europe with an en-
larged distribution rather far to the North and to the South
in the central part of its range. Otiorhynchus fagi inhabits
preferably coniferous, and also deciduous forests and re-
lated clearings with shrubs, young trees and tall herbs.
On the other hand, O. clavipes is a Western to western
Central European species inhabiting mainly areas with
deciduous trees.
Weevils used in molecular analysis were collected in
various regions of Germany, Poland, Slovakia and Slo-
venia and marked a priori as Otiorhynchus clavipes (C),
O. lugdunensis (L) and O. tenebricosus (T) according
to the usual nomenclature in the beginning of 2019 and
to available identification keys (Table 1), previously to
publication of Casalini and Colonnelli (2019). Our re-
sults (Figs 1-4, 9-10) confirm the synonymization of
O. clavipes and O. lugdunensis and are consistent with
the recently published taxonomic review of these authors
(Casalini & Colonnelli 2019).
Considering the limitations inherent to an exception-
ally morphological study of species delimitation, we
selected an integrative approach combining genetic,
molecular and morphological methods. The desirabi-
lity of an integrative taxonomy has been acknowledged
for more than a decade (Dayrat 2005; Valdecasas et al.
2008; Ober & Connolly 2015), even if it became appar-
ent that observations of the chromosomes did not help in
the separation of taxa, probably because it is a symple-
siomorphic trait (Holecova et al. 2002; Lachowska et al.
2006). Measurements of several body parts did also not
help very much in our study (Figs 7—8), although these
methods were widely used in the past and very useful
in discovering morphological diversity (e.g., Marvaldi
et al. 2002; Przybycien & Wactawik 2015). Differences
in some morphological features between both taxa were
observed but they were not statistically significant. Rea-
sons for the differences of most morphological features
between O. fagi and O. clavipes being so small could
be the phylogenetically low age and their close relation.
Both species produced a rather high number of varie-
ties indicating rather high speed of differentiation may-
be due to Pleistocene or pre-Pleistocene spatial isolation
in mountain areas and indicating a low rate of intermix-
ing despite their size, which should allow a rather better
spreading as in small flightless species. On the other hand
this is in accordance with more recent spreading process-
es by the human-induced passive transport of O. clavipes
as lowland and foothill species and the low introduction
rate of O. fagi as mountain species. Moreover, both may
be subject of ongoing speciation. It seems that genetic
differences will accumulate in prospective generations,
which may lead to even greater isolation between both
taxa and greater morphological differences.
For many weevil species there are significant simi-
larities in morphology, and they can be distinguished
mainly based on their genetic traits, like the genus Aus-
Bonn zoological Bulletin 70 (1): 115-139
Maja Przybycien et al.
tromonticola and new species from New Zealand (Brown
2017) or the genus Sitophilus with the two closely rela-
ted species S. oryzae and S. zeamais (Correa et al. 2013),
or some soil-inhabiting Cryptorhynchinae of the genus
Acallorneuma and the tribe Torneumatini (Sttiben et al.
2016). The method of DNA analysis used in our study
also proved to be the most effective. The results of our
molecular analysis with markers COI and EF-1« indicate
that all German populations studied belong to O. clavi-
pes, and populations from the Alps, the Carpathians and
the Sudetes represent O. fagi. The populations of O. fagi
from the Karawank Mts. (Slovenian Alps) are very dif-
ferent from O. fagi populations of other mountainous re-
gions of Europe, at least based on the available COI data.
We consider this a consequence of long time isolation.
These divergences, especially in COI are rather uncom-
mon in flightless species. Up to now COI or EF-1a could
not be studied in specimens from France and England.
Also habitus and abdominal sternite (AS) of O. clavipes
from Germany, the United Kingdom and France show
rather great morphological variation but differ even
more clearly from the respective morphological parts of
O. fagi.
Our results support the hypothesis that Otiorhynchus
fagi and O. clavipes are two different species and that
O. clavipes is mainly a Western European species. Its
current presence in some cities in the eastern parts of
Europe is an effect of introduction with common lilac,
privet or other shrubs or young trees. Earlier suggestions
of Dieckmann (1980) that diversification of the studied
species began already in the Pliocene and was continued
in the Pleistocene seem worth of further study. This kind
of diversification is still going on, and we regard them as
young, currently evolving species. Studies on evolution
and phylogeography of these taxa in their entire range
could more clearly explain process and time of this phe-
nomenon.
Acknowledgements. We are grateful to our colleagues Miguel
Alonso-Zarazaga (Spain), Marc Delbol (Belgium), Roberto
Casalini (Italy), Christoph Germann (Switzerland), Theodoor
Heijerman (The Netherlands), Manfred Kahlen (Austria) and
Marek Wanat (Poland) for useful information on the presence
of these species in their countries, and Friedhelm Bahr (Germa-
ny) for the excellent photos, as well as to Mitosz Mazur (Po-
land) for offering weevils from the Sudetes. Finally, we would
like to express our warmest thanks to the unknown reviewer for
her or his profound comments.
Financial support. This work was supported by the Jagiello-
nian University (K/ZDS/006320, N18/DBS/000016).
REFERENCES
Abbazzi P, Maggini L (2009) Elenco sistematico-faunistico dei
Curculionoidea Italiani, Scolytidae e Platypodidae esclusi
(Insecta, Coleoptera). Aldrovandia 5: 29-216
©ZFMK
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 137
Alonso-Zarazaga MA (2014) Fauna Europaea. Version 2.6.2.
Online at http:/(www.faunaeur.org [last accessed 20 Jan.
2020]
Alonso-Zarazaga MA, Barrios H, Borovec R, Bouchard P, Cal-
dara R, Colonnelli E, Gultekin L, Hlava¢ P, Korotyaeev BA,
Lyal CHC, Machado A, Meregalli M, Pierotti H, Ren L, San-
chez-Ruiz M, Sforzi A, Silfverberg H, Skuhrovec J, Tryzna
M, Velazquez de Castro AJ, Yunakov NN (2017) Cooperative
Catalogue of Palaearctic Coleoptera Curculionoidea. Socie-
dad Entomologica Aragonesa, Monografias electronicas SEA
8. Online at www.sea-entomologia.org [last accessed 13 Mar.
2020]
Alonso-Zarazaga MA (2018) Elenco sistematico de los Cur-
culionoidea (Coleoptera) de la peninsula Ibérica e islas
Baleares. Boletin de la Sociedad Entomologica Aragonesa
(S.E.A.) 63: 3-44
Astrin JJ, Sttiben PE (2008) Phylogeny in cryptic weevils: mol-
ecules, morphology and new genera of western Palaearctic
Cryptorhynchinae (Coleoptera: Curculionidae). Invertebrate
Systematics 22 (5): 503-522
Biatooki P (2005) On the distribution of some interesting wee-
vil species (Coleoptera: Apionidae, Curculionidae) in Po-
land. Weevil News Vol. 29. CURCULIO-Institute, M6nchen-
gladbach. Online at http://www.curci.de/Inhalt.html [last
accessed 17 Mar. 2021]
Baur H, Leuenberger C (2011) Analysis of ratios in multivariate
morphometry. Systematic Biology 60 (6): 813-825
Benedikt S, Borovec R, Fremuth J, Kratky J, Schon K,
Skuhrovec J, Tryzna M (2010) Annotated checklist of wee-
vils (Coleoptera: Curculionoidea excepting Scolytinae and
Platypodinae) of the Czech Republic and Slovakia. Klapa-
lekiana 46: 1-1363
Bleich O, Girlich S & Kohler F (2020) Verzeichnis und Ver-
breitungsatlas der Kafer Deutschlands. Internet-Katalog En-
tomofauna Germanica. Online at http://www.coleokat.de/de/
thl/ [last accessed 13 Mar. 2020]
Brown SDJ (2017) Austromonticola, a new genus of broad-
nosed weevil (Coleoptera, Curculionidae, Entiminae) from
montane areas of New Zealand. ZooKeys 707: 73-130
Casalini R, Colonnelli E (2019) Notes on some species of Otio-
rhynchus Germar, 1822 sensu stricto, with new synonymies
and a neotype designation (Coleoptera: Curculionidae). Gre-
dleriana 19: 193-200
Correa AS, Orlando de Oliveira L, Braga LS, Guedes RNC
(2013) Distribution of the related weevil species Sitophi-
lus oryzae and S. zeamais in Brazil. Insect Science 20 (6):
763-770
Dayrat B (2005) Towards integrative taxonomy. Biological
Journal of the Linnean Society 85: 407-415
Delbol M (2010) Les Otiorhynchini de Belgique (Curculioni-
dae: Entiminae). Entomologie faunistique — Faunistic Ento-
mology 62 (4): 139-152
Delbol M (2013) Catalogue des Curculionoidea de Belgique
(Coleoptera: Polyphaga). Belgian Journal of Entomology 13:
1-95
Dieckmann L (1980) Beitrage zur Insektenfauna der DDR: Co-
leoptera — Curculionidae (Brachycerinae, Otiorhynchinae,
Brachyderinae). Beitrage zur Entomologie 30: 145-310
Endrodi S (1961) Bestimmungstabelle der Otiorhynchus-Arten
des Karpaten-Beckens. Krajske Nakladatelstvi, Ostrava
Frieser R (1981) Anthribidae, Otiorhynchinae. Pp. 22-34,
184—240 in: Freude H, Harde KW, Lohse GA (eds) Die Kafer
Mitteleuropas. Band 10. Krefeld
Global Biodiversity Information Facility (GBIF). Online at
https://www.gbif.org [last accessed 13Mar. 2020]
Bonn zoological Bulletin 70 (1): 115-139
Germann C (2010) Die Russelkafer (Coleoptera, Curculionoi-
dea) der Schweiz — Checkliste mit Verbreitungsangaben nach
biogeografischen Regionen. Mitteilungen der Schweizeri-
schen Entomologischen Gesellschaft 83: 41-118
Germann C (2011) Supplement zur Checkliste der Rtisselkafer
der Schweiz (Coleoptera, Curculionoidea). Bulletin de la So-
ciété Entomologique Suisse 84: 155-169
Germann C (2013) First additions to the Checklist of the Swiss
weevil fauna (Coleoptera, Curculionoidea). Bulletin de la
Société Entomologique Suisse 86: 151-164
Germann C, Wyler S, Bernasconi MV (2017) DNA barcoding
of selected alpine beetles with focus on Curculionoidea (Co-
leoptera). Revue suisse de Zoologie 124 (1): 15-38
Gosik R, Sprick P (2013) Morphology and identification of the
pupae of several species of soil-dwelling broad-nosed wee-
vils from Central Europe (Coleoptera, Curculionidae, En-
timinae). Zootaxa 3731 (4): 445-472
Gosik R, Sprick P, Skuhrovec J, Derus M, Hommes M (2016)
Morphology and identification of the mature larvae of seve-
ral species of the genus Otiorhynchus (Coleoptera, Curculi-
onidae, Entiminae) from central Europe with an update of the
life history traits. Zootaxa 4108 (1): 1-67
Hall TA (1999) BioEdit: a user-friendly biological sequence
alignment editor and analysis program for windows 95/98/
NT. Nucl Acids Symp Ser 41: 95—98
Heijerman T (2020) Otiorhynchus clavipes in Nederland (Co-
leoptera: Curculionidae). Entomologische berichten 80 (6):
229-230
Hernandez- Vera G, Caldara R, Tosevski I, Emerson BC (2013)
Molecular phylogenetic analysis of archival tissue reveals
the origin of a disjunct souther African-Palaearctic weevil
radiation. Journal of Biogeography 40: 1348-1359
Hrabovsky K (2014) Nosatcoviti lesnich ekosystémt Beskyd.
Bakalarska prace. Mendelova Univerzita v Brne. Brno
Hoffmann A (1950) Coléopteres Curculionides (Premiere Par-
tie). Faune de France 52
Hoffmann A (1963) Sous-famille des Brachycerinae. Pp. 948—
952 in: Balachowsky AS (ed.): Entomologie appliquée a
Vagriculture, Tome 1. Coléopteres 2. Phytophagoidea (suite
et fin) (Chrysomelidae — Curculionidae — Attelabidae — Sco-
lytidae et Platypodidae). Masson et Cie, Paris
Holecova M, Rozek M, Lachowska D (2002) Heterochromatic
banding patterns on chromosomes of twelve weevil species
(Insecta, Coleoptera, Curculionoidea: Apionidae, Curculio-
nidae). Folia biologica 50 (3-4): 129-134
Ibbotson A, Edwards CAT (1954) The biology and control of
Otiorrhynchus clavipes Bonsd. (Rhyn. Coleopt.), a pest of
strawberries. The Annals of applied Biology 41 (3): 520-535
Kizub IV, Slutsky AI (2019) Contribution to the knowledge of
the genus Otiorhynchus Germar, 1822 (Coleoptera: Curcu-
lionidae) fauna of Ukraine. Part 2. Munis Entomology and
Zoology Journal, Ankaral4 (2): 530-546
Knutelski S (2005) Roznorodnos¢, ekologia 1 chorologia ryj-
kowcow Rezerwatu Biosfery “Tatry” (Coleoptera: Curculio-
noidea). Monografie Faunistyczne 23: 1-340
Koch K (1992) Die Kafer Mitteleuropas. Vol. 3 (Okologie).
Goecke & Evers, Krefeld
Kohler F, Klausnitzer B (1998) Verzeichnis der Kafer Deutsch-
lands. Entomofauna Germanica. Entomologische Nachricht-
en und Berichte (Dresden) 4: 1-185
Lachowska D, Rozek M, Holecova M (2006) Karyotypic cha-
racterization of three weevil species (Coleoptera: Curculioni-
dae, Brachyderini). Folia Biologica 54 (1-2): 13-17
Langeveld B, Creuwels J, Slicker F, Van der Es H (2020) Natu-
ral History Museum Rotterdam — Specimens. Version 1.6.
©ZFMK
138 Maja Przybycien et al.
Natural History Museum Rotterdam. Occurrence Dataset.
https://doi.org/10.15468/kwqaay. Online at https://www.gbif.
org/occurrence/2570204550 [last accessed 13 Mar. 2020]
Lona C (1936) Curculionidae: Otiorrhynchinae I. Pp. 1-226
in: Schenkling S (ed.) Coleopterorum Catalogus auspiciis et
auxilio W. Junk. Pars 148. Junk, Berlin
Lobl I, Smetana A (eds) (2011) 7. Curculionoidea I. Apollo
Books, Stenstrup
Lobl I, Smetana A (eds) (2013) Catalogue of Palaearctic Cole-
optera. Vol. 8. Curculionoidea II. Brill, Leiden / Boston
Magnano L (1998) Notes on the Otiorhynchus Germar, 1824
complex (Coleoptera: Curculionidae). Pp. 51—80 in: Colon-
nelli E., Louw S. & Osella G (eds) Taxonomy, Ecology and
Distribution of Curculionoidea. XX" International Congress
of Entomology (1996, Firenze, Italy). Museo Regionale di
Scienze Naturali, Torino
Magnano L (2001) Designation of lectotypes for species of Cir-
rorhynchus Apfelbeck, 1898, Dodecastichus Stierlin, 1861,
Limatogaster Apfelbeck, 1898, Otiorhychus Germar, 1822
and 7ylotus Schoenherr, 1823, in the Germar and Herbst col-
lections (Coleoptera Curculionidae). Memorie della Societa
Entomologica Italiana 80: 139-158
Marvaldi AE, Sequeira AS, O’Brien CW, Farrell BD (2002)
Molecular and Morphological Phylogenetics of Weevils (Co-
leoptera, Curculionoidea): Do Niche Shifts Accompany Di-
versification? Systematic Biology 51 (5): 761-785
Mazur M (2002) The distribution and ecology of weevils (Cole-
optera, Nemonychidae, Attelabidae, Apionidae, Curculioni-
dae) in western Ukraine. Acta zoologica Cracoviensia 45 (3):
213-244
Mazur M (2016) Otiorhynchini (Coleoptera: Curculionidae)
Polski. Zroznicowanie i klasyfikacja zasiegow. Prace Mono-
graficzne 767. Wydawnictwo naukowe Uniwersytetu Peda-
gogicznego im. Komisji Edukacji Narodowej, Krakow
Morris MG (1997) Broad-nosed weevils. Coleoptera: Curculi-
onidae (Entiminae). Handbooks for the Identification of Bri-
tish Insects 5 (17a). Royal Entomological Society, London
Natural History EM, Abarenkov, K. Estonian Museum of Natu-
ral History. PlutoF. Online at https://www.gbif.org/occur-
rence/2462724453 [last accessed 13 Mar. 2020]
Nylander JAA (2004) MrModeltest 2.0. Program distributed by
the author. Evolutionary Biology Centre, Uppsala University,
Uppsala
Nylander JAA, Ronquist F, Huelsenbeck JP, Nieves-Aldrey JL
(2004) Bayesian phylogenetic analysis of combined data.
Systematic Biology 53 (1): 47-67
Ober KA, Connolly CT (2015) Geometric morphometric and
phylogenetic analyses of Arizona Sky Island populations of
Scaphinotus petersi Roeschke (Coleoptera: Carabidae). Zoo-
logical Journal of the Linnean Society 175: 107-118
Page RDM (1996) TREEVIEW: An application to display phy-
logenetic trees on personal computers. Computer Applica-
tions in the Biosciences 12: 357-358
Palm E (1996) Nordeuropas Snudebiller. 1. De kortsnudede
arter (Coleoptera: Curculionidae) — med szerligt henblik pa
den danske fauna. Danmarks Dyreliv, Bind 7, Apollo Books,
Stenstrup
PoIBIN (2019) Polish Biodiversity Information Network. On-
line at http://coleoptera.ksib.pl/?l=en [last accessed 13 Mar.
2020]
Poole RW & Gentili P (comps.) 1996-1997. Nomina Insecta
Nearctica: A Check List of the Insects of North America. En-
tomological Information Services, Rockville, Maryland: vol.
1. Online at http://nearctica.com/nomina/pdfs/pdf_files.htm
[last accessed 17 Mar. 2021]
Bonn zoological Bulletin 70 (1): 115-139
Przybycien M, Waclawik B (2015) Morphometric measure-
ments of Bryodaemon (Coleoptera: Curculionidae): contri-
bution to phylogeny. Baltic Journal of Coleopterology 15 (2):
129-136
Quinn GP, Keough MJ (2002) Experimental Design and Data
Analisys for Biologists. Cambridge, UK: Cambridge Univer-
sity Press
Rambaut A, Suchard MA, Drummond AJ (2009) Tracer ver.
1.5. Online at tree.bio.ed.ac.uk/software/tracer/ [last ac-
cessed 17 Mar. 2021]
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phy-
logenetic inference under mixed models. Bioinformatics 19
(12): 1572-1574
Roosileht U (2015) Estonian Additions to Silfverberg’s ,,Enu-
meratio renovata Coleopterorum Fennoscandiae, Daniae et
Baltiae“ Coleoptera Catalog. Sahlbergia 21 (2): 6-39
Schott C (2017) Liste commentée des espéeces alsaciennes
de Cimberidae, Rhynchitidae, Attelabidae, Curculionidae.
(Uniquement les especes confirmées depuis 1950 pour la
région ou de zones limitrophes des départements voisins).
Online at http://claude.schott.free.fr/Curculionidae/Liste_
comm_curcul.html [last accessed 13 Mar. 2020]
Schititte A, Sttiben PE, Sprick P (2013) The Molecular Weevil
Identification Project (Coleoptera: Curculionoidea), Part I. A
contribution to integrative taxonomy and phylogenetic sys-
tematics. Snudebiller 14 (211): 1-77
Slieker F (2019) Natural History Museum Rotterdam (NL)
— Insecta collection. Version 19.34. Natural History Mu-
seum Rotterdam. Online at https://www.gbif.org/occur-
rence/1269535242 [last accessed 20 Jan. 2020]
Smreczynski S (1966) Ryjkowce — Curculionidae. Podrodzi-
ny Otiorhynchinae, Brachyderinae. Klucze do Oznaczania
Owadow Polski, czes¢ XIX, 98b. Panstwowe Wydawnictwo
Naukowe, Warszawa
Sprick P, Sttiben PE (2012) Russelkafer in anthropogenen Le-
bensraéumen. Snudebiller extra (CD Rom), Curculio-Institute,
Monchengladbach. Julius-Kiihn-Institut, Institut fiir Pflan-
zenschutz in Gartenbau und Forst, Braunschweig, Germany
Stamatakis A (2014) RAxML version 8: a tool for phylogenetic
analysis and post-analysis of large phylogenies. Bioinforma-
tics 30 (9): 1312-1313
Stamatakis A, Hoover P, Rougemont J (2008) A rapid bootstrap
algorithm for the RAxML web servers. Systematic Biology
57 (5): 758-771
Struck TH, Feder JL, Bendiksby M, Birkeland S, Cerca J, Gu-
sarov VI, Kistenich S, Larsson KH, Liow LH, Nowak MD,
Stedje B, Bachmann L, Dimitrov D (2018) Finding Evolu-
tionary Processes Hidden in Cryptic Species. Trends in Eco-
logy & Evolution 33 (3): 153-163
Stiiben PE, Schtitte A, Bayer C, Astrin JJ (2015) The Molecular
Weevil Identification Project (Coleoptera: Curculionoidea),
Part II. Towards an Integrative Taxonomy. Snudebiller 16
(237): 1-294, Curculio-Institute, Monchengladbach
Stiben PE, Schtitte A, Lopez H, Astrin JJ (2016) Molec-
ular and morphological systematics of soil-inhabiting
Cryptorhynchinae of the genus Acallorneuma and _ the
tribe Torneumatini (Coleoptera: Curculionidae), with
description of two new species. Beitrage zur Entomo-
logie 66 (2): 169-199
Swofford DL (2002) PAUP*. Phylogenetic Analysis Using
Parsimony (*and Other Methods). Version 4. Sinauer Asso-
ciates, Sunderland, Mass
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins
DG (1997) The CLUSTAL_X windows interface: flexible
©ZFMK
The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 139
strategies for multiple sequence alignment aided by quality
analysis tools. Nucleic Acids Research 25 (24): 4876-4882
Valdecasas AG, Williams D, Wheeler QD (2008) Integrative
taxonomy then and now: a response to Dayrat (2005). Bio-
logical Journal Linnean Society 93: 211-216
Wanat M, Mokrzycki T (2005) A new checklist of the weevils of
Poland (Coleoptera: Curculionoidea). Genus 16 (1): 69-117
Wanat M (2017) Collection of Coleoptera. Wroclaw University,
Museum of Natural History. Online at https://www.gbif.org/
occurrence/1706930172 [last accessed 13 Mar. 2020]
Wanat M, Mokrzycki T (2018) The checklist of the weevils
(Coleoptera: Curculionoidea) of Poland revisited Annales
Zoologici (Warszawa) 68(1): 1-48
Wickham H (2009) ggplot2: Elegant Graphics for Data Analy-
sis. Springer-Verlag, New York
Willis RJ (1964) The bionomics and larval morphology of the
Otiorrhynchid pests of soft fruit crops. PhD thesis, Queen’s
University of Belfast, Belfast
Bonn zoological Bulletin 70 (1): 115-139
Winker K (2005) Sibling species were first recognized by Wil-
liam Derham (1718). The Auk 122 (2): 706-707
Yunakov N, Nazarenko V, Filimonov R, Volovnik S (2018)
A survey of the weevils of Ukraine (Coleoptera: Curculio-
noidea). Zootaxa 4404 (1): 1-494
Zagatti P, Horellou A, Mari A, Arnaboldi F, Reisdorf P (2001)
Atlas des Coléopteres du Massif de Rambouillet et du Parc
Naturel Régional de la Haute Vallée de Chevreuse, Tome
1: 1990-2000. Observatoire National des Invertébrés. Of-
fice Pour l’Information Eco-entomologique. Muinistére de
1’ Aménagement du Territoire et de 1’ Environnement, Paris
Zuniga-Reinoso A, Benitez HA (2015) The overrated use of
the morphological cryptic species concept: An example with
Nyctelia dark beetles (Coleoptera: Tenebrionidae) using geo-
metric morphometrics. Zoologischer Anzeiger 255: 47—53
©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 70 (1): 141-171
2021 - Wagner P. et al.
https://do1.org/10.20363/BZB-2021.70.1.141
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org: pub:4E7 B4E14-7682-465D-A2D9-A26EA04A B3FD
Integrative approach to resolve the
Calotes mystaceus Duméril & Bibron, 1837 species complex
(Squamata: Agamidae)
Philipp Wagner" *, Flora Ihlow’, Timo Hartmann’, Morris Flecks‘, Andreas Schmitz* & Wolfgang Boéhme®
'Allwetterzoo Miinster, Sentruper Strabe 315, D-48161 Minster, Germany
' Department of Biology and Center for Biodiversity and Ecosystem Stewardship, Villanova University, 800 Lancaster Avenue,
Villanova, Pennsylvania 19085, USA
? Museum of Zoology Senckenberg, Dresden, K6énigsbriicker LandstraBe 159, D-01109 Dresden, Germany
46 Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany
° Natural History Museum of Geneva, UREC-Herpetology & Ichthyology, Route de Malagnou 1, CH-1208 Genéve, Switzerland
“Corresponding author: Email: [email protected]
'urn:|lsid:zoobank.org:author:0575CE45-AB5C-4493-A 8A D-DD399E 18284A
2urn:Isid:zoobank.org:author: 1ODB565B-DA19-484E-AE50-ED29945658E8
3urn:Isid:zoobank.org:author:A911B13A-B364-424E-8579-AE23820F1DC1
4urn:|sid:zoobank.org:author:974BF839-926B-4039-96 1 7-135F5CEC2596
>urn:lsid:zoobank.org:author:5B1146D2-B9A6-48E6-9E4E-EB1C8EDIAE7A
6urn:Isid:zoobank.org:author: FFAC2972-9F52-404B-BA9C-489C7793FF8D
Abstract. The genus Ca/otes Cuvier, 1816 “1817” currently contains 25 species, which are widely distributed in Asia
and have been introduced in Africa and America. The genus includes several species complexes, for example, Calotes
versicolor and Calotes mystaceus. The latter was partly resolved by describing Calotes bachae as a distinct species, but it
became obvious that C. mystaceus still consists of several lineages. This study was done to resolve those lineages and we
herein restrict Calotes mystaceus to southern coastal Myanmar, while describing three new species occurring in Cambo-
dia, China, Laos, Myanmar, Thailand, and India. The new species are distinguishable from each other by male coloration
with C. goetzi sp. n. having prominent dark brown dorsolateral blotches, C. geiss/eri sp. n. having orange to light brown
blotches and a whitish stripe from snout-tip to hind limb insertion and C. vindumbarbatus sp. n. having a whitish stripe
from tip of snout continuing to beyond limb insertion. Mean uncorrected p-distances for COI between C. mystaceus and
other taxa are: C. goetzi sp. n. (=0.0603); C. vindumbarbatus sp. n. (=0.0656) and C. bachae (=0.1415). Mean uncorrec-
ted p-distances for 12S between C. mystaceus and other taxa are: C. goetzi sp. n. (=0.0291), C. vindumbarbatus sp. n.
(=0.0375), C. bachae (=0.0548) and C. geissleri sp. n. (=0.0457).
Key words. Calotes bachae, Calotes goetzi sp. n., Calotes geissleri sp. n., Calotes vindumbarbatus sp. n., Indochina.
INTRODUCTION
To date, 25 species of the genus Calotes Cuvier, 1816
“1817” (=journal issued in 1816, but published in 1817)
(Squamata: Agamidae: Draconinae) are recognized (Uetz
et al. 2020). They are mainly distributed across continen-
tal Asia, but also occur on, for example, Sri Lanka, Suma-
tra, and the Moluccas. With the exception of C. versicol-
or (Daudin, 1802) and C. mystaceus Dumeril & Bibron,
1837, species of this genus occupy small geographic rang-
es in India, Sri Lanka, and Myanmar (Hallermann 2000),
while Calotes versicolor in particular has been introduced
on several Asian islands (e.g., Sulawesi and Borneo). In-
dochina, the focal area of this study, harbors eight Ca/otes
species: C. bachae Hartmann, Geissler, Poyarkov, Ihlow,
Galoyan, Rodder & Bohme, 2013; C. chincollium Vin-
dum, 2003; C. emma Gray, 1845; C. htunwini Zug &
Received: 20.01.2021
Accepted: 15.04.2021
Vindum in Zug et al., 2006; C. irawadi Zug, Brown,
Schulte & Vindum, 2006; C. jerdoni Ginther, 1870;
and the widespread species C. mystaceus and C. ver-
sicolor. Calotes rouxii Duméril & Bibron, 1837 and
C. ophiomachus Dumeéril & Bibron, 1837, previously
mentioned in early faunal publications (Morice 1875;
Tirant 1885; Bourret 1927) to occur in Southeast Asia,
are based on misidentifications or synonyms. The latter
is today recognized as synonym of C. calotes, whereas
C. rouxii was transferred to the recently described ge-
nus Monilesaurus (Pal et al. 2018), which is restricted
to the Indian subcontinent.
Despite the widespread distribution of the genus, no
complete review has been done, but several publications
demonstrate that some taxa represent species complex-
es (e.g., Zug et al. 2006; Hartmann et al. 2013). One of
these is the spectacularly colored Blue Forest Lizard
Corresponding editor: A. Bauer
Published: 07.05.2021
142 Philipp Wagner et al.
Calotes mystaceus Duméril & Bibron, 1837. Originally
described from “Pays de Birmans” (=~Myanmar), the
putative range of C. mystaceus extends from China
(e.g., Bain & Hurley 2011) through Southeast Asia (e.g.,
Cambodia: Hartmann et al. 2013, Laos & Myanmar: Das
2015; Thailand: Chan-Ard et al. 2015; to India e.g., Das
2015; see also Figure 1). Previous records from Vietnam
(e.g., Pham et al. 2018) refer to the recently described
C. bachae. A record from Sri Lanka by Flower (1899)
was not confirmed by Somaweera & Somaweera (2009)
and reports from peninsular Malaysia (Das 2015) and the
Andaman and Nicobar Islands (Chan-Ard et al. 2015)
lack references to specific records and are likely also
based on misidentifications. According to Enge & Krys-
ko (2004), C. mystaceus is introduced in Florida, USA.
Previous studies (e.g., Hartmann et al. 2013; Saijun-
tha et al. 2017) revealed high levels of morphological
and genetic differentiations within C. mystaceus. Fur-
thermore, geographic variation of the color pattern
of different populations was recognized from both
sides of the Mekong (e.g., Smith 1921; Bourret 2009),
which was later resolved by the description of Ca/otes
bachae (Hartmann et al. 2013). Therefore, the aim of
this study is a range wide analysis of the morphological
variance and genetic relationships of C. mystaceus Ss.
str. and C. bachae, to implement respective taxonomic
results and discuss potential geographic barriers.
MATERIAL AND METHODS
Institutional abbreviations
The specimens used in this study (see Appendix I) have
been obtained from the following collections:
BMNH = (now NHM) Natural History Museum,
London, UK
California Academy of Sciences,
San Francisco, CA, USA
MNHN = Muséum national d’ Histoire naturelle,
Paris, France
NME = Naturkundemuseum Erfurt,
Erfurt, Germany
ZFMK = Zoologisches Forschungsmuseum
Alexander Koenig, Bonn, Germany
ZMB- = Museum fir Naturkunde, Berlin, Germany
ZMMU = Zoological Museum, Moscow State
University, Moscow, Russia
CAS =
Genetic analysis
Fragments of the two mitochondrial genes 12S rRNA
and COI were sequenced to assess genetic differentia-
tion and to determine phylogenetic relationships between
different populations of Calotes mystaceus. Samples of
thigh muscle tissue were extracted from 54 ethanol-pre-
served museum collection specimens. DNA was extract-
Bonn zoological Bulletin 70 (1): 141-171
ed using the peqGold tissue DNA mini kit (peqLab).
The primers 12sL1091 (light chain; 5'-AAACTGG-
GATTAGATACCCCACTAT—33’) and 12sH1478 (heavy
chain; 5'-AAACTGGGATTAGATACCCCACTAT—3’)
of Kocher et al. (1989) as well as COIVF 1d (light chain;
5'-TTCTCAACCAACCACAARGAYATY GG—33’') and
COIVRId (heavy chain; 5'- TAGACTTCTGGGTGG-
CCRAARAAYCA—3’) of Nazarov et al. (2012) were
used for amplification of 388 bp of 12S rRNA and 600
bp of COI, respectively. PCR cycling conditions follow
Schmitz et al. (2005) and Nazarov et al. (2012). PCR
products were purified using the QIAquick PCR purifi-
cation kit (Qiagen) and sequenced by an external vendor
(Macrogen). Sequences were checked using the orig-
inal electropherograms in PhyDE (http://www.phyde.
de). The dataset was supplemented with sequences from
previous studies (Hartmann et al. 2013; Saijuntha et al.
2017), resulting in a total of 63 sequences (see Table | for
sampled taxa and GenBank accession numbers). We in-
cluded only three sequences from Saijuntha et al. (2017),
carefully chosen to best represent each of the three lin-
eages of C. mystaceus detected by their study, since in-
cluding all sequences showed no alteration in topology,
but resulted in drawbacks concerning the overall support
statistics of trees during preliminary analyses. Sequences
were aligned with MAFFT (Katoh et al. 2009), refined
using the MUSCLE algorithm (Edgar 2004), and manu-
ally corrected where necessary. To account for the phy-
logenetic information of indels, gaps were coded using
the ‘simple method’ of Simmons & Ochoterena (2000) as
implemented in FastGap 1.2 (Borchsenius 2009). Both
gene fragments were analyzed separately as well as us-
ing a concatenated data set for phylogenetic reconstruc-
tion by Bayesian inference (BI). Model parameters were
estimated separately for each gene and codon position
by partitioning the data set. Models of nucleotide sub-
stitution (GTR+G+I for 12S rRNA; K80+I for the 1°,
HKY for the 2", and GTR+G for the 3“ codon position
of COI) were chosen by the Akaike information criterion
(AIC) using Modeltest (Posada & Crandall 1998) as im-
plemented in the package ‘phangorn’ (Schliep 2011) for
Cran R (R Core Team 2020). Bayesian trees were calcu-
lated with MrBayes 3.2.6 (Ronquist et al. 2012) with four
independent runs (10 million generations each, sampled
every 1000, random starting tree). Runs were stopped
when the average standard deviation of split frequencies
had reached 0.01. Convergence of the Markov chains
was checked with Tracer v1.7.1 (Rambaut et al. 2018)
and the initial 25% of generations were discarded prior
to building a consensus tree.
Morphological comparison
A total of 109 specimens belonging to the Calotes mys-
taceus complex (including Calotes bachae) were ex-
amined (see Appendix I). Measurements were taken to
the nearest 0.1 mm using digital calipers. Twenty-three
©ZFMK
New Calotes Species from Mainland SE Asia 143
mensural and eleven meristic characters were obtained
according to Hartmann et al. (2013; Table 2). Specimens
were grouped according to the genetically resolved oper-
ational taxonomic units (OTUs). Juveniles were defined
as specimens with a snout-vent length (SVL) less than
50% of the SVL of the largest specimen of the same OTU
and excluded from the statistical analyses. Analyses of
(co-)variance (AN(C)OVA) were performed to identify
morphological characters that show significant differenc-
es between the OTUs. OTU and sex were considered as
factors for the two-way ANOVA and SVL was added as
covariate for the two-way ANCOVA. Due to sexual di-
morphism, males and females were analyzed separately.
All metric data were log-transformed to assure normal
distribution. Regression residuals were calculated on the
morphometric variables using SVL as a covariable to ac-
count for allometry, 1.e., to avoid size dependent intercor-
relation effects, prior to conducting a principal compo-
nent analysis (PCA) to assess the overall morphological
variation between the putative taxa without making a pri-
orl assumptions about groupings. PCAs were computed
using the ‘ade4’ package (Dray & Dufour 2007) for Cran
R retaining only principal components (PCs) with an ei-
genvalue > 1. Outliers in the PCs were identified using
Mahalanobis distances and removed from the analyses.
As previous authors demonstrated that coloration is an
important character to distinguish distinct evolutionary
lineages in agamid lizards (see, e.g., Stuart-Fox & Ord
2004; Chen et al. 2012; Quah et al. 2012; Wagner 2014)
we also compared coloration patterns of the genetically
distinct lineages.
RESULTS
The phylogenetic analysis of the concatenated 12s rRNA
and COI gene fragments (Fig. 2) reveals differentia-
tion within the Calotes mystaceus complex, including
C. bachae. Based on the type locality (“Pays de Bir-
mans”), Calotes mystaceus s. str. is referable to Clade
D, the sister to Clade A. This latter includes two lineages
(Al and A2) from Central Indochina. Clades A and D to-
gether form the sister to Clade C which includes speci-
mens from northern Myanmar. Basal to these clades is
one lineage including the sister Clades B and E. The lat-
ter includes the holotype of Calotes bachae, while Clade
B includes specimens from western Myanmar. Accord-
ing to our analysis the valid species Calotes mystaceus s.
str. (Clade D) and Calotes bachae (Clade E) are clearly
not sister lineages as C. bachae, along with specimens of
Clade B, constitutes a distinct lineage to the clade that
contains C. mystaceus s. str. Calotes bachae (Clade E)
shows geographic variation between specimens from
Cambodia and Vietnam and one distinct specimen from
Vietnam without precise locality. Clade A shows a differ-
entiation (Clade Al and A2) roughly along the border be-
Bonn zoological Bulletin 70 (1): 141-171
tween Thailand and Myanmar. None of the other clades
show geographic separation.
Mean uncorrected p-distances between species for COI
and 12s rRNA are shown in table 3.
A PCA (Figs 3-4, Table 4, Appendix H—IIT) computed
for all morphological characters of males grouped ac-
cording to genetic OTUs revealed that morphospaces of
the distinct genetic lineages overlap. However, Clade C
is only partly overlapping with Clades B and E, whereas
Clades B, D and E are largely overlapping with Clade
A. The currently valid taxa Calotes bachae (Clade E)
and C. mystaceus (Clade D) also overlap in their mor-
phospaces. In females, most of the morphospaces are
overlapping as well, except for one specimen of Clades
B and C, respectively, and the two specimens represent-
ing Clade D (Figs 3+4, Table 4, Appendix IT). Females of
Clade E are almost completely embedded in the morpho-
space of Clade A. None of the examined morphological
characters was significantly different between OTUs in
the ANOVA and only two characters (“Head width” and
“Interorbital width”) showed differences in the ANCO-
VA (Table 5, Appendix I). According to these results,
the valid species C. mystaceus and C. bachae as well as
the unnamed lineages within the complex are supported
by our genetic data. However, despite the non-discrimi-
natory results of the AN(C)OVA, the clades are clearly
identifiable and have diagnosable characters. Differences
in coloration support the genetic data and distinguish the
lineages from one another. Neither the valid species nor
the cryptic lineages as groups are monophyletic. There-
fore, this complex of lineages, including the above-men-
tioned taxa is herein revised and the genetically support-
ed clades are described as new species according to their
diagnostic morphological characters.
Taxonomic Revision of the Calotes mystaceus species
complex
Calotes bachae Hartmann, Geissler,
Thlow, Galoyan, R6dder & BOhme 2013: 252
(Fig. 2, Clade E)
Hartmann, T., Geissler, P., Poyarkov, N. A. J., [hlow, F., Galoy-
an, E. A., Rédder, D. & W. Bohme (2013). A new species of
the genus Calotes Cuvier, 1817 (Squamata: Agamidae) from
southern Vietnam. Zootaxa 3599 (3): 246—260.
Holotype. ZFMK 88935 (adult male, Fig. 5A-B,
Clade E) from “Vietnam, Dong Nai Province, Cat
Tien National Park (11.6344444° N 107.456667° E),
104 m elevation,” collected by Peter Geibler on May
10" 2009.
Original Diagnosis. A medium-sized Calotes with
a maximum SVL of 97 mm. It can be distinguished
from all taxa of the C. mystaceus complex by the
combination of the following characters: 1) head and
body robust; 2) body scales homogeneous, relative-
ly small, feebly keeled and arranged in regular rows;
Poyarkov,
©ZFMK
Philipp Wagner et al.
144
weg 90% MeL ueg :Arenjoues aJI[pPyIAA Sune}
Apnys SIU. | [O9LI8SMW | S6ILI8SMIW | = -"osuTy :diysuMmo] IAD 90]]] PMN “OLNSIG URAD UA] ‘UOIsTAIC Avjepuey| pOrlEt SVD
Apnys sIUL | ZT6SLISMIN | P8ILI8MIN peol uosue, -Avjepuey] UO Avyepury] JO § UN 96 ‘UOISIAIG Aejepueyy | sewed] 6b8r07 SVD
Apnys sty 97TLISMN SUOH UoOY Suen] OOUTAOIg SURITUSIA, 080L7 NNAZ
Apnys sty 87TLISMINN AB] Ye SuLNI] :OOUIAOI, I[NqeAUles sor] Ev76b MNAZ
Apnys SIUL | P6OSLISMIN | 98TLI8MIN nyni'] Jo JoALUMOp Isnf oATY Usemes =) SueINN :suelfNnN ‘ueuUNA 68PL07 SVD
Apnys SIUL | 96SLI8MIN | O6ILI8MIN peor suosnj-nyniy uo aspliq nyNIT Jo N wy ¢] ‘suelfnN :ueuuny EvI87Z SVO
Apnjs sIuUL | L6OSLI8SMI | I6ILI8MN peol sul[suoT-nyniT Uo osplig NyNIT Jo § wy g] :suelfny :ueuUNA prI87Z SVD
Apnys sIUL | PIOLI8SMIW | 80TLI8MIN sueXsu0T ‘ueysoeg ‘ueuun, SSPTrT SVO
Apnys sIuL | STOLI8SMI | 607LI8MIN sueXsu0T ‘ueysoeg ‘ueuun, LSvTvT SVD
Apnys sIUL | OTOLI8MIW | OLZLI8SMIN Jjouin) suryenyleg Jo § peol nyni]-sul[suo7T ‘sulpsuoT] :ueysoeg ‘ueuuNA euly E9PTVT SVO
E107
ye jo uueUnIeH | €909100M uvodg yeqy yied JeuOTeN UN y WoUYd :soUIAOIg deoy Wag IVE88 NINAZ
E107
‘Te 19 UUeUIeE | «6Q909T0ON Arenyoues asp daywo1g uspny :sOurAOIg IwOYIA Yeoig | eIpoquieg €1706 NNAZ ‘u ‘ds 17j208 ‘Dd
Apnys sty 68ILISMN dred ovg oyeqeyy ed [euoeN edeyyey Mepsuneyy ‘uoIsIAIg suleses ad.Aj0[0y 6ESSIZ SVO
Apnys stu], L8ILISMW dures urged 307] :yeg [euoTeN edeyjey Mepsunryy -UOISIAIG SUIeseS odAyered OLZOIZ SVO
Apnjs stu], ZIZLISMWN OSETIA ynepy :diysumO] MESURD ‘JOLNSIG] MESURD -UOISIAIG, APMSP/Y adAjered OSOEPT SVO
Apnys stu], IIZLISMW OSETIA yNepy :diysumO], MESURD ‘JOLNSIGG MESURD -UOISIAIG, APMSP/L adAjered 8ZOEPT SVO
Apnys sty EITLISMN Osel[IA SuezyeN :diysumo], suezuo], JOLNsIG Wee :a1e1g UIYD TEEEHT SVO
Apnjs sty], SETLISMW OBUIIIA [VISSUITS “JOLNSIG Wee :aye1S UIYD | IJeWUPAPY | odAjered 166L6 MINAZ ‘u ‘ds tajssias ‘Dd
Apnys SUL | [909I00M | TETLI8MIN weg [RUOIEN UOT] JD :OoUIAOI_ 1eN Sug od.Aj0[0y S€688 NNAZ
E107
ye jo uueUnIeH | T909I0ON wed [PUOIEN UOT] JD :OUIAOI_ IBN SUG odAyered €T T7107 V UGA
Apnys sIUL | STOLISMIN | TETLISMIN yueyy Suns], :soulAOIg Sueg OVD 87076 NNAZ
E107
ye Jo uueUNIeH | SySSTrWH BoH sony ‘yleg [euoeN dep] VID ng :s0ulAo1g sony, Yul 1OE€00d VN NWINZ
Apnys sty JETLISMIN [Aqyeso] ostooid ou] | = weujolA 1€796 MINAZ
Apnys SUL | 8ZOLI8SMIN | SETLISMIN sunfueg :doulAold Lryeuryey L6Ev6 ANAZ
Apnys sIuL | LZOLI8SMI | PETLISMIN sunfueg :doulAold Lryeueyey 96€76 NNAZ
Apnys sIUL | 9TOLI8SMIN | E€TLISMIN sunfueg :soulAold Wihyeueyey | eipoquied S6€r6 MNAZ apyong Sajojv)
JUIIIJIY
10)
VNU S7T
UOISSIDIV YuURguas)
Aqe0]
“SIOqUINU UOISsad0R YURqUSDH dAI}Dadsal puv sasdyeue dOUdNsOTAYd dy} UI popnyoul susUTDads *] IQR
Aauunodg
addy, | Gy] adures/zaqono0,
sarpeds
©ZFMK
Bonn zoological Bulletin 70 (1): 141-171
145
New Calotes Species from Mainland SE Asia
Apnys sty]
Apnys sty.
Apnys sty.
Apnys sty.
Apnys sty.
Apnys sty]
L1O@
‘ye 19 eYyJUNIIVS
Apnys sty]
Apnys sty]
Apnys sty.)
Apnys sty]
Apnys sty]
L1O@
‘ye 19 eYyJUNIIeS
LI0C
‘ye 39 vyjUNIIeS
Apnys sty.)
Apnys sty.)
Apnys sty.
Apnys sty]
Apnys sty.)
Apnys sty.
Apnys sty.
Apnys sty]
Apnys sty]
Apnys sty.)
Apnys sty.
IUIIIJIY,
[ILTOZI8MN
609L 18MIN
OL9LI8MIN
CCOLISMIN
OCOLI8SMIN
99088EXA
ECOLISMIN
IC9LI8MN
LIOLI8MWN
VCILI8MWN
[9088EXo
V8088EXa
619LI8MN
8I9ZI8MN
86SL18MN
66SLI8MN
SO9LI8MN
CIOLI8MN
909LI8MIN
LOOLI8SMIN
OO9LI8SMIA
10D
SOCTLI8MN
COCTLISMIN
VOCLISMINN
CCCLIBMINN
ICCTLISMIN
6ICLISMINN
6CCLISMINN
OCCLISMINN
SICTLI8MN
LECLIBMN
O€cLISMN
LICLISMINN
9ITLISMINN
COILISMINN
cOlILI8MN
661 ZLI8MN
LOCLISMIN
OOCLISMINN
LOTLI8MIN
SCCLIBMIN
VCCLIBMINN
v6ILISMN
VNU S7T
eposeg OAYIeAY 0} UOWUTY [Ie oy} Suoye :diysuMmoOy oy YIeAY :91e1S UO
OBU]IIA
SuneyoyoAesNy :diysumoy, Mepndesn :J1NsIq uloyeg :UOIsTAIG: ApeMIvAdKYV
dures jso10J UIASUNOX puUe d8eIIIA UIqey}
-Ub}H UdOMJOq :diysuMO], MepndesyN “OLNsIq Ulayjeg :UOIsIAIG ApeMmIeAdAYV
JOATY ION Wog Wey :unqiyg :Tueyyeyoyey Uo”
UOYYeN woyes
UOYYeN woyes
sueny] suojyy suey, wnyiedg
DOUTAOIg URN
eUISeYyo}ey UOYYeN
eUISeYyd}ey UOYyeN
sueyiq ‘unqdo'y
asplq JOATY eM Y ‘Linqeueyouey
suong ueg ‘lng uoYyD
sue, ‘Tey, suey)
Ie] suelyD
Ie] SueryD
weq ejury 0} dues urg ny eypy :AATenjoues
OJIPILM, OARD Uljepeg pue Sunvjueg :diysumol ues uesueM X :aye1S ULYS
OSLI[IA OSRTIIA JNO], SulepY :AeNjouKS PULTIOM Ye] IU] :aye1S UBYS
Alo\seuo|/
quod sUTPy Jeou :ArenjouRS SJITP]IAA Iesieg :diysumoy, Yylayroey, :ayeyg ueys
dSRI[IA YHouL, Sureyy :ATenyoues puvpjony Oye] su] :o7e1S ueYS
dBE]IIA OG UIA 0} SuNvYydiedy :drysumoy, Suoyedy :aye1S UeYS
ase][IA odoyueg pue eA UTP] UdOMJOq :diysuMO], SUOWeAY ‘981g UPYS
uopnyy ouUTAIETMe] :9781S UOJ]
uopnyy oUTATETMe] :9781S OP]
OSR[IA PMH IT Weg ulejUNOp]
edog :diysumoy, sunepedynedy :101INsIq ( SuNeAN :UOTSTAIG Avyepueyy
Aqe0']
JewuuedAjy
pueyrey,y,
Aauunodg
L8c0v~ SVO
9LTOET SVO
86€6€C SVO
19S0v ANAZ
€1/98L0 a HNN
CI/TSL0 ¥ AWN
DP1Ld
O19SS AWAZ
€1/S8Z0 a HNN
60/18S0 Y ANN
v9l6v AWAZ
L988 AWAZ
TQNO
INO
(60/r8S0 U ANN
®60/78S0 U AWN
vo90ET SVO
vS90ET SVO
697SET SVO
LLSIv~ SVO
LISS€T SVO
88SEC SVO
660SV AWAZ
860S7 AWAZ
T€clec SWO
ody, | GY adures/z9qon0,
snaopjsdul “Dd
sapeds
(panunuos) “T a1qeI
©ZFMK
Bonn zoological Bulletin 70 (1): 141-171
Philipp Wagner et al.
146
; : gO 2
S S B.S. 6
~ SS it hale
a 3 & B
3 Ss Ss
S S
S
i S
S
wA
INR SZ eG: ONG © Gyo |e Oe OG: |r
gae2ezl|r> &- Je >| > & Sle
Snr *ngZgz zw Alin n nm! &
A pal Rk AP NIN NY w| &
BW WwW BO Ww!}o re Bb] @
Bio of © VN Ni HRA Ww OO]
SB AalY Y sp wl nA BW NI ®
Sia ie eee ok S OIE
a a s[rx a S & I] S AE
Sa 8
zg 2
—_
i]
3s to DOD Sr 9 <j
> Ss S$ 6 »®
Ss s s o 8 ZS
gee ae <2 is
gsJd6fto# 68
Oo Og OaQoO QO Oo
: eat < eo)
B 56 ‘S S
= & = =
ie) os
Zs =| =
© te
11h rin n
eogle ean xls # 3/5
5S F&F © /0@ 0 GQ Oo o/l/B B S/6
PSE. & FEF Fe ge Fle
es Y Set [dee e-em | PO eee er lt
= nn Nn
Be RO ee cela
aes S$ © & SIE & x
ey aoe = te
556 22 Zlf & 8
rE Soe ae See
a -&4 alo
Ar Re Re =
es Fea a2jg FS
B §& B 5 Ble =
gs Ss 2 & ele & 2
Sao ne Re Peles
Big 20) GD Q)a py B
Sass Rilo ss 5
oO. Uw go na =
eS Gamarces. OS eek
a fr 2& FF ®2 s &
2 Sip 6 oS
5 v2 oa ga y BS
So eee oe ice @ ga
> 2 FF Bf ~
Z2Ss65 6&6 6 A Oe
o U©F:lUmlhUe CU @
> fo « -« - <q
n?Zg ee = See.
2s £ SB S 5 cq
o BF wf °° >
= Sie gle ee @ &
z= 5
gq « Bots
o 5
25 os Ss
5 sR
< 2 'S
é ae
S
ia is)
rg
per)
ge
is)
a.
2
> =, (Soe eS She ke —
ee Z=steesz 8/2 = ?
~— | 00 C0 C0] C8 Cc oO CO} 00 CO OO] Um
OO et Ee SE EE a ee ee
gvlixa xa ATA A AN 3/3 3 3/8
Bin vw nie vy vb = =f Se -— vy
Sr [Rs Shes Coot (Son MM Foes | eae Met came en
a] «(E222 SEES
re 0 0 Cc Co co | 0 co ofA
oO SS = — Safe Fe KF1S
ee a yn xn Nn s~}/rn xn nr! =
iS DRA A Aa Alanna a
oS SoS ON 8S S/o © =
NO wo OO fs Wlwoi Wm wv
<>l3 5 53)/53 33s Hl3a45s45lp
eS |S Meee eg ee a (ed S| 8
NO|2A A ALA BDA a a | An nA a] ep
per ie elle. | ae Te Pea a ye Ie
See 2. aire E So = |\re- 12> 8
pend poh my oue, odie shar at ah Cele ES a Gs: |l
Bisa Sa SSeS: a ees a re
3
bab)
N
°
Bonn zoological Bulletin 70 (1): 141-171
(panunuos) *T a1qer
3) 44-50 midbody scale rows; 4) upper dorsolateral
scales pointing backwards and upwards; 5) two short
and well separated spines, surrounded by three to four
scales on either side of the upper head above the tym-
panum; 6) nuchal and dorsal crest continuous, com-
posed of erected compressed scales, directed poste-
riorly; 7) vertebral spines and scales in males 35—42
and in females 43—46; 8) oblique fold of skin in front
of fore limb insertion distinct, covered with small
granular dark scales; 9) extremities and tail relatively
long and slender (see comparison with C. mystaceus
for details); 10) bluish to turquoise head and anteri-
or body part, this coloration not well exceeding front
limb insertion; 11) yellowish light stripe at upper lip
reaching from below anterior corner of eye to posteri-
or end of head; 12) no dorsolateral brownish blotches,
sometimes faint medial brownish blotches across the
vertebral crest.
Male coloration. The brilliant coloration of adult
males is characterized by a brightly colored bluish to tur-
quoise head, with bluish coloration continuing posterior-
ly to fore limb insertion. There is a relatively faded light
(bright yellowish, when under acute distress, a character
typical for C. bachae only) stripe at the upper lip crossing
the tympanum from beneath the eye to end of head. Gular
pouch colored in darker blue, interscale skin black. A tri-
angular to crescent-shaped patch of small black scales is
present in front of shoulder. Very faint brownish blotch-
es extending mid-dorsally over the vertebral crest, from
above fore limb insertion on to tail; posterior to fore limb
insertion brownish orange in color on trunk and tail; hind
limb in a slightly darker brown; venter cream.
Distribution. Calotes bachae is known from southern
Vietnam, with two specimens reported from the Viet-
nam-China border in northern Vietnam, and from eastern
Cambodia (Fig. 1).
Ecology. Calotes bachae is a diurnal, semi-arboreal
lizard, often observed climbing on tree trunks at a height
of 5-10 meters above the ground. The species mainly
inhabits dipterocarp lowland forests and cultural land-
scapes up to 700 m a.s.l. The species seems to be quite
heliophilic, preferring more open habitats without closed
canopies (Hartmann et al. 2013), but was also observed
in dense tropical monsoon forests with closed canopy, in
open gallery forest, and anthropogenic habitats like road-
sides within the forest or open park landscapes within
the headquarters of the park. In these anthropogenic hab-
itats C. bachae occurs in syntopy with Calotes versicol-
or (Hartmann et al. 2013). According to Hartmann et al.
(2013) C. bachae feeds on numerous arthropods includ-
ing Formicidae, Coleoptera, Orthoptera, and Myriapo-
da. Males acquire their breeding coloration at the end
of February, while gravid females have been found
mid-April and egg-laying of a clutch of five eggs was
observed in April and May. Juveniles hatched after 56
days while incubated at 22 to 25° C in captivity.
©ZFMK
New Calotes Species from Mainland SE Asia 147
Fig. 1. Geographic distribution of examined specimens of the Calotes mystaceus complex. Colors correspond to the identified
OTUs. Diamonds mark the type localities of the species described herein. Records with a bold margin were also included in the
phylogenetic analyses. Imprecise (1.e., country-level) records are marked with a question mark. Detailed localities are: Calotes
bachae: Vietnam: Dong Nai Prov.: Cat Tien National Park (1); Dong Nai Nature Reserve (2); Bu Gia Map National Park (3); Kon
Tum (4); Trung Khanh (5); Cambodia: Banlung (7); Calotes goetzi sp. n.. Cambodia: Phnom Kulen National Park (8); Kulen Prom-
tep Wildlife Sanctuary (9); Laos: Muang Phon Hong (10); Luang Prabang (11); Muang Pak Lay (12); Thailand: Sakon Nakhon
Prov. (13); Lam Dom Noi River (14); Khon Buri (15); Nakhon Ratchasima (16); Dilang (17); Ban Nam Len (18); Lom Sak (19);
Ban Bueng (20); Khlong Luang (21); Cha-am (22); Ban Phai (23); Kwai River bridge (24); Ban Dong Noi (25); Phitsanulok Prov.
(26); Nan Prov. (27); Chiang Mai Prov. (28); Fang (33); Myanmar: Kawkareik (30); Mudon (31); Karen Hills (32); Parsa Wildlife
Sanctuary (29); Kyaitong Township (34, 35); Inle Lake Wetland Sanctuary (36, 37); Taunggyi (38); Pindaya (39); Panlaung and
Padalin Cave Wildlife Sanctuary (40); Mandalay- Yangon road (41); Minsontaung Wildlife Sanctuary (42); Popa Mountain Park
(43); Mandalay (44); Shwebo (45); Bhamo (46); Indawgyi Lake (47); “Pegu” (54, see discussion in text); China: Baihualing (48);
Longyang (49, 50); Liuku-Longling road (51); Liuku (52); Liuku-Fugong road (53); Calotes mystaceus: Myanmar: “Pegu” (54;
see discussion in text); Kyaiktryo Pagoda (56, 57); Taungoo (58); Letpein village (59); Hlawga National Park (60); Ngapudaw
township (61); Ngayokekaung village (62); Calotes vindumbarbatus sp. n.: Myanmar: Gat Shang Yang village (63); Hepu village
(64); Linpha village (65); Swekawngaw (66); Calotes geissleri sp. n.: Myanmar: Alaungdaw Kathapa National Park (67, 68); Mauk
village (69, 70); Natzang village (71); Simggial village (72); India: Nagaland: Kohima (73).
Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK
148 Philipp Wagner et al.
NME RO590/09 Calotes emma
NME RO577/09 Calotes emma
ZFMK 44016 Calotes emma
| CAS 210270 (68)
L CAS 243028 (69)
@ CAS 243050 (70)
CAS 215539 (67) Clade B
CAS 243332 (71)
° ZFMK 97991 (72)
ZFMK 96231 (6)
ZFMK 94396 (7)
ZFMK 94395 (7)
ZFMK 94397 (7)
IEBR A.2012.23 (1) Clade E
ZFMK 88935 (1)
« ZFMK 92028 (5)
ZMMU NAPO0301 (3)
CAS 232247 (66)
CAS 239206 (65)
CAS 232387 (63) Clade C
CAS 232388 (63)
ZFMK 97990 (63) &
CAS 239276 (62)
CAS 239398 (61)
CAS 213300 (60) |
— CAS 206548 (59) Clade D
P_« CAS 240287 (57)
~ CAS 240296 (56)
CMf1 (33)
j CAS 207489 (52)
© | CAS 228143 (53)
| CAS 228144 (51)
b CAS 242455 (50)
| CAS 242457 9)
CAS 242463 (48
| - CAS 230654 (37) :
CAS 241577 (36) Clade A1
« CAS 235517 (35)
F CAS 235883 (34)
CAS 204849 (41)
CAS 230624 (40)
CAS 231231 (43)
CAS 231404 (42)
CAS 235469 (29)
ZFMK 45498 (31)
ZFMK 45499 (31)
ZFMK 47080 (10)
ZFMK 49164 (17)
ZFMK 55610 (27)
ZFMK 84867 (24)
CNb1 (20)
PTk1 (21)
NME R0581/09 (16) Clade A2
NME RO785/13 (16)
NME R0584/09a (28)
NME R0584/09j (28)
NME RO751/12 (13)
NME RO786/13 (13)
ZFMK 40561 (14)
_ ZFMK 49243 (12)
0.01 ZFMK 88341 (8)
ZFMK 90413 (9)
Fig. 2. The Bayesian consensus tree based on 988 bp of mitochondrial DNA (12S rRNA and COI) shows six distinct lineages within
Calotes mystaceus. Node support in terms of Bayesian posterior probabilities is indicated by circles at nodes (nodes with a BPP >
0.90 are white, BPP > 0.95 are grey, BPP > 0.99 are black, values < 0.90 are not marked). Outgroup (Calotes versicolor) not shown
for clarity. Numbers in parentheses behind taxa refer to localities mapped in Fig. 1.
©ZFMK
Bonn zoological Bulletin 70 (1): 141-171
New Calotes Species from Mainland SE Asia 149
Table 2. Description of the morphological characters and respective abbreviations used in this study.
Character Abbreviation | Description
Mensural characters
4" finger 4"FingL Distance from juncture of 3™ and 4" digits to distalmost extent (outer/distalmost surface of claw) of
4" finger.
4" toe 4"ToeL Distance from juncture of 3" and 4" digits to distal end of 4" digit on hindfoot.
Crus length CrusL Length of tibia from knee to heel.
Eye-ear length EyeEar Distance from anterior edge of tympanum to posterior of orbit (not pupil opening).
Forefoot length ForefL Distance from proximal end of forefoot to tip of fourth digit.
Head height HeadH Dorsoventral distance from top of head to underside of jaw at transverse plane intersecting angle of
jaws.
Head length HeadL Distance from anterior edge of tympanum to tip of snout.
Head width Head W Distance from left to right outer edge of temporal or jaw muscles at their widest point without com-
pression of soft tissue.
Hindfoot length HindfL Distance from proximal end (heel) of hindfoot to distalmost surface of fourth toe.
Interorbital width Interorb Transverse distance between anterodorsal corners of left and right orbits.
Jaw width JawW Distance from left to right outer edge of jaw angles; this measurement excludes jaw musculature
broadening of head.
Lower arm length LoArmL Distance from elbow to distal end of wrist, or just before underside of forefoot.
Naris-eye length NarEye Distance from anterior edge of orbit to posterior edge of naris.
Snout-eye length SnEye Distance from anterior edge of orbit to tip of snout (rostral scale).
Snout-forelimb length | SnForeL Distance from anterior of forelimb, or shoulder, to tip of snout.
Snout width SnW Internasal or internarial distance; transverse distance between left and right nares.
Snout-vent length SVL
Tail height TailH Distance from dorsal to ventral surface of tail base measured just posterior to vent.
Tail length TailL Distance from vent to distal end of tail; noting completeness or regeneration of tail.
Tail width TailW Distance from left to right side of tail base just posterior to vent.
Trunk length TrunkL Body length or axilla-groin length of others; distance between posterior edge of forelimb insertion
(axilla) to anterior edge of hindlimb insertion (inguen).
Upper arm length UpArmL Distance from anterior insertion of forelimb, or shoulder, to elbow.
Upper leg length UpLegL Distance from anterior edge of hindlimb insertion to knee.
Meristic characters
Forefoot lamellae 4FingLm Number of 4" digit lamellae; from 1‘ lamella at digits’ cleft that is wider than deep and touches
dorsal digital scale (on at least one side) to most distal lamella; fragmented proximal scales are
excluded.
Hindfoot lamellae 4ToeLm Analogous to 4FingLm at 4" toe.
Canthus rostralis CanthR Number of elongate scales along ‘dorsolateral snout ridge’ from above posterodorsal corner of nasal
scale to and including posteriormost supraciliary scale.
Dorsal eyelid scales Eyelid Number of scales found along dorsal edge of eyelid.
Dorsal head scales HeadSLn Number of scales longitudinally on midline between interparietal and rostral scale.
Head scales HeadSTr Number of scales in transverse line between posteriormost left and right supraciliary scales, just
anterior of interparietal.
Infralabials Inflab Posterior end defined by posteriormost enlarged scales that touches with Suplab at rear corner of
mouth.
Midbody scale rows | MidbS Number of scale rows around trunk at midbody.
Snout scales SnS Number of scales on line transversally between left and right nasal scales (single scale surrounding
naris).
Supralabials Suplab Posterior end defined by posteriormost enlarged scales that touches Inflab at rear corner of mouth.
Vertebral scales or VertS Number of middorsal scales (spines or not), beginning with first enlarged spine-like scale on nape to
spines
above vent.
Bonn zoological Bulletin 70 (1): 141-171
©ZFMK
150 Philipp Wagner et al.
Table 3. Mean uncorrected p-distances between species for COI (above diagonal) and 12S rRNA (below diagonal). [NA = not
available, C. geiss/eri sp. n. missing in COI data set]
bachae mystaceus | vindumbarbatus sp. n.
bachae NA 0.1465 0.1415 0.1391
geissleri sp. n. 0.0610 NA NA NA
goetzi sp. Nn. 0.0603 0.0486 0.0603 0.0647
mystaceus 0.0548 0.0457 0.0291 0.0656
vindumbarbatus sp. n. | 0.0615 0.0476 0.0326 0.0375
Calotes geissleri sp. n.
(Fig. 2, Clade B)
urn. lsid:zoobank.org:act: EC4DA90A-417D-48 E6-8EA2-FA073D168425
Holotype. CAS 215539 (adult male, Fig. 6A-B,
Clade B) from Myanmar, Sagaing Division, Mon Ywa
District, AK Park, Thabake Sae Camp [22.316806° N,
94.475556° E], collected by H. Win, T. Thin, S.L. Oo
and H. Tun on June 9" 2000.
Paratypes. CAS 210270 from Myanmar, Alaungdaw
Kathapa National Park, Thabakesay (Log Cabin Camp)
[22.318194° N, 94.475722° E]; ZFMK 97991 (formerly
CAS 243200) from Myanmar, Chin State, Phalum Dis-
trict, Simggial village [23.762583° N, 93.546167° E,
1362 m.]; CAS 243028, CAS 243050 both from Myan-
mar, Magway Division, Gangaw District, Gangaw
Township, Mauk village [22.335861° N, 94.144583° E,
205 m.].
Diagnosis. A large sized Calotes species with a known
maximum SVL of 122 mm in males and 114 mm in fe-
males. Tail relatively short, up to 270 mm in males and
223 mm in females. The new species can be distinguished
from other species of the complex by the combination
of the following characters: 1) head and body very ro-
bust; 2) nuchal and dorsal crests continuous, composed
of erect compressed scales, directed posteriorly, larger on
the nuchal crest than on the dorsal crest, becoming small-
er towards the tail; 3) 50-62 scale rows around midbody;
4) 35-45 vertebral spines and scales in males, 49-50
in females; 5) body scales small, homogeneous, feebly
keeled and arranged in regular rows; 6) a short row of
separated spines on both sides of the head, directing from
the tympanum to the first scale of the nuchal crest; 7)
extremities relatively short and robust; 8) oblique skin
fold in front of the fore limbs, 9) head and body bluish,
with a white band from the tip of the mouth along the
upper lip, the tympanum and prominently continuing be-
tween the dorsolateral brownish orange body blotches on
the body reaching the hind limbs, band as broad as the
height of the tympanum on the head and above the front
legs, becoming gradually narrower until the insertion of
the hindlimbs; 10) three or more large distinct brownish
orange blotches on both sides of the body between the
limbs.
Bonn zoological Bulletin 70 (1): 141-171
Description of the holotype. Moderately large male
of 110 mm SVL. Tail relatively short (201 mm), extremi-
ties robust. Head large, distinct from the neck and lateral
sides flat. Posterior parts of jaw angle swollen. Snout-tip
blunt. Nostril in a single scale, separated from the labial
scale by a single scale. Rostral and mental scales small.
Canthus rostralis sharp and straight from the nostril to
the posterior part of the eye, including six scales between
the nostril and the eye and 12 supraciliary scales. Eleven
supralabial scales on both sides of the head, separated
from the orbit by five rows of small scales. Nine infral-
abial scales. Seven scales between the orbit and the tym-
panum, tympanum distinct, with a row of spiny scales
from above the tympanum to the first scale of the nu-
chal crest. Scales on chin and throat keeled. Nuchal crest
with 14 scales, dorsal crest with 21 scales. Spines of the
nuchal crest larger than those of the dorsal crest, rela-
tively uniform in height at the nuchal crest but gradually
decreasing from posterior of the neck to the hind limbs.
Dorsal and lateral body scales keeled, pointing upwards
and backwards. Caudal scales keeled, directed back-
wards. Fore and hind limbs relatively robust, forth finger
and fourth toe longest.
Male coloration. Males in breeding color with blue
head and body (Fig. 6C). A white band 1s present from
the tip of the snout along the upper lips and the tympa-
num, predominantly continuing between the dorsolateral
blotches on the lateral sides of the body to the hind limbs.
The band is as broad as the height of the tympanum on
the head and above the fore legs, becoming gradually
narrower towards the insertion of the hind limbs. Three
or more large distinct brownish-orange blotches on the
lateral sides of the body between the limbs. Non-display
coloration unknown.
Variation. Body measurements and meristic charac-
ters for adult individuals are given in Table 4. Specimens
ranged in size from the smallest female with a SVL of
92 mm (CAS 210270) and the largest female with a SVL
of 114 mm (CAS 243200) to the largest male with a SVL
of 120 mm (CAS 243028). In general, adult males are
larger than females, and have greater SVLs, tail lengths
and head lengths and widths and fewer vertebral scales,
including crest scales. While proportionally the heads of
adult males and females are equal, males have propor-
©ZFMK
New Calotes Species from Mainland SE Asia 151
O Calotes bachae
@ C. bachae holotype
O C. geissleri sp. n.
® C. geissleri sp. n. holotype
© C. goetzi sp. n. (eastern clade)
O C. goetzi sp. n. (western clade)
® C. goetzi sp. n. holotype
O C. mystaceus
@ C. mystaceus holotype
© C. vindumbarbatus sp. n.
® C. vindumbarbatus sp. n. holotype
Fig. 3. Principal component analyses results for the morphologically examined specimens. Details of Eigenvalues and explained
variance are given in Table 3.
tionally wider heads than females, probably because of
the swollen jaw angle. Dorsal coloration differs between
sexes and both sexes are able to change coloration. Col-
oration characters (lateral stripe, blotches) are lighter or
sometimes absent in females. Blue coloration on head
and body. The stripe is distinctly present between the
mental and the shoulder, becoming more indistinct be-
tween the blotches on the lateral sides of the body, and
extending to above the hindlimbs. Irregular whitish dots
Bonn zoological Bulletin 70 (1): 141-171
of several scales are present on the lateral sides of the
body in females.
Etymology. The specific epithet is a patronym formed
in the genitive singular honoring Dr. Peter GeiBbler, Mu-
seum Natur und Mensch, Freiburg, Germany, in recog-
nition of his work on the Southeast Asian herpetofauna
in general, and his collection of Calotes bachae speci-
mens in 2009 in particular, which initiated research on
the Calotes mystaceus complex.
©ZFMK
152 Philipp Wagner et al.
© Calotes bachae
( © holotype)
© Calotes geissleri sp. n.
( @ holotype)
© Calotes goetzi sp. n.
( ®@ holotype)
© Calotes mystaceus
( @ holotype)
© Calotes vindumbarbatus sp. n.
( © holotype)
PC1
Fig. 4. Principal component analysis results for the morphologically examined specimens, colored according to to the genetic
clades. Details of Eigenvalues and explained variance are given in Table 3.
Table 4. Eigenvalues and percent of explained variance per principal component of mensural and meristic data of males and fe-
males as shown in Figs 3-4.
Females PCI PC2 PC3 PC4 PCS PC6 PC7 PC8
Eigenvalue 8.97458 3.36167 2.39687 2.23517 1.94366 1.50995 1.49041 1.16296
Explained variance 0.29915 0.11206 0.07990 0.07451 0.06479 0.05033 0.04968 0.03877
Males PCI PC2 PC3 PC4 PCS PC6 PC7 PC8
Eigenvalue 8.36195 3.14874 2.78013 2.03641 1.53439 1.34330 1.23076 1.06270
Explained variance 0.27873 0.10496 0.09267 0.06788 0.05115 0.04478 0.04103 0.03542
Distribution. The new species is documented only
from Myanmar and India (e.g., BMNH 1956.1.11.98,
specimens mentioned by Lalremsanga et al. [2010]).
Ecology. Calotes geissleri sp. n. is diurnal and semi-ar-
boreal. Preferred habitats are unknown. Lalremsanga
et al. (2010) collected one individual on a branch of Pi-
nus kesiya, about 3m above the ground, in a secondary
forest. The specimen was kept and remained greyish
brown in coloration in captivity, but changed the color of
the head and anterior portion of the trunk to bright blue
minutes after exposure to the sun. Like other Calotes spe-
cies, C. geissleri sp. n. feeds on arthropods like Coleop-
tera, Formicidae and others. In India (see Lalremsanga
et al. 2010) the species occurs in sympatry with Calotes
Jerdoni and C. versicolor.
Calotes goetzi sp. n.
(Fig. 2, Clade A)
urn: sid:zoobank.org:act:7827D48E-E 121-4904-96 36-3A46AE42B369
Holotype. ZFMK 92606 (adult male, Fig. 7A-C, Clade
A) from Cambodia, Siem Reap Province, near Kbal Spean
within the Phnom Kulen National Park [13.699167° N,
103.998611° E].
Paratypes. ZFMK 88341 (adult male), ZFMK 92607
(adult female) from the same locality as the holotype.
Diagnosis. A large species of Ca/otes, with a maximum
SVL of 143 mm in males and 122 mm in females. It can
Bonn zoological Bulletin 70 (1): 141-171
be distinguished from other species of the group by the
combination of the following characters: 1) head, body
and limbs robust, tail long but not as long as in C. mys-
taceus;, 2) body scales mid-sized, homogeneous, keeled,
arranged in regular rows; 3) upper dorsolateral scales
pointing up- and backwards; 4) body scales arranged in
45—60 rows around midbody; 5) two short and separated
spines, surrounded by a ring of scales between the tym-
panum and the vertebral crest on both sides of the head;
6) vertebral crest continuous from above the tympanum
to the hind limbs, composed of erected scales, directed
posteriorly, highest slightly in front of the insertion of the
front limbs, becoming gradually shorter towards the hind
limbs; 7) vertebral scales, including vertebral spines, 37—
52 in males and 43-60 in females; 8) oblique skin fold in
front of the fore limbs; 9) head, body, and limbs bluish in
males; 19) males with a white stripe from between nostril
and orbit along the upper lip and the tympanum to the
front limb insertion; 11) three to five distinct dark brown
dorsolateral blotches.
Description of the holotype. Large male (SVL
118 mm). Body robust, tail relatively short, 236 mm
long. Fore- and hind limbs relatively slender, fourth fin-
ger and toe longest. Head distinct from the neck, poste-
rior jaw angles heavily swollen. Tip of the snout blunt,
rostral small. Nostril large, in a single scale, separated
from the rostral by one elongated scale and from the first
two supralabial scales by two rectangular scales. Canthus
©ZFMK
New Calotes Species from Mainland SE Asia 153
lateral view. C. Living holotype from Cat Tien National Park, Vietnam.
Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK
Philipp Wagner et al.
AYER Sas.
rs
%
——. -
ee a
pag
Ss ot
Fig. 6. Calotes geissleri sp. n. A. Holotype (CAS 215539, adult male), general view from above. B. Holotype, lateral view. C. Liv-
ing adult male (CAS 220586), from Nat Ma Taung National Park, Htin Chaun Village, Chin State, Myanmar.
Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK
New Calotes Species from Mainland SE Asia
EE ) — > a!
_— oe = f' — we _ aoe | Y ,
a ’ cal eye 5
ees 7. Calotes ery sp. n. A. Holotype (ZFMK 92606, adult male), general view from el B. Gene lateral view. me Living
holotype from Kbal Spean, Cambodia.
Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK
156 Philipp Wagner et al.
Fig. 8. Calotes mystaceus Dumeéril & Bibron, 1837. A. Holotype (MNHN 2557, juvenile male), general view from above. B. Holo-
type, detailed lateral view. C. Adult male from Yangon, eastern Irrawaddy delta, coastal Myanmar, which is within the type locality
“pays de Birmans [=Myanmar].”
Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK
New Calotes Species from Mainland SE Asia 157
rostralis distinct, formed by nine scales from the nos-
tril to above the orbit and continuous with supraciliary
scales. Lateral sides of the head flat. Supralabial scales
9/9, infralabial scales 10/10. Supralabial scales separated
from the orbit by four rows of small scales. Eight scales
between the orbit and the tympanum, two of them slight-
ly ridged. Tympanum distinct, two spines, surrounded by
a ring of scales, between the tympanum and the vertebral
crest. Mental scale small, bordered by two postmental
scales which are separated from each other. First pair
of the postmental scales in contact with the infralabial
scale. Scales on the dorsal part of the chin smooth to fee-
bly keeled, becoming strongly keeled towards the throat.
Vertebral crest continuous from above the tympanum to
the tail, spines highest above the insertion of the front
limbs and gradually decreasing towards the tail. Dorsal
and lateral scales strongly keeled, pointing up- and back-
wards. Ventral scales parallelly keeled. Caudal scales
smooth to feebly keeled, directed backwards. Subcaudal
scales parallel and strongly keeled.
Male coloration. Head, body and limbs bluish. A white
stripe, as high as the tympanum, is present from between
nostril and orbit along the upper lip and the tympanum to
the insertion of the front limb. The stripe is followed by
three to five large reddish-brown to dark-brown blotches,
with the first above the insertion of the fore limbs and
the latest at around midbody or above the insertion of
the hindlimbs, sometimes continuing on the tail. Throat
coloration darker than the chin and the head coloration.
From Thailand, males are known to have bright blue
hindlimbs and crest scales. Intermediate males with a
blue head and a white stripe, but body coloration brown-
ish-black with indistinct light brown blotches. Non-bril-
liant coloration in males from Thailand reddish-brown,
with a white non-continuous stripe from the orbit to
above the hindlimbs. Blotches brownish, darker than the
body coloration.
Variation. Body measurements and meristic characters
for adult individuals are given in Tables 4. Specimens
ranged in size between the smallest adult with a SVL of
84 mm (MNHN 1884.548) and the largest female with
a SVL of 126 mm (ZFMK 44893) to the largest male
measuring 145 mm (MNHN 1884.546). In general, adult
males are larger than females, because of longer SVLs,
tail lengths, head lengths, and widths and slightly fewer
vertebral scales including the crest scales. Heads of adult
males and females are proportionally equal in length,
but male heads are wider than those of females, proba-
bly because of the swollen jaw angle. Dorsal coloration
differs between sexes and both sexes are able to change
the coloration. Coloration characters being lighter in fe-
males; head and body blue. Lateral stripe from between
the nostril and orbit along the upper lips and the tympa-
num to the first blotch. Sometimes the first two brown-
ish blotches are framed by scales in the same coloration
as the lateral stripe. Three to five blotches present, from
Bonn zoological Bulletin 70 (1): 141-171
above the insertion of the fore limbs to about mid-body
or even hindlimb insertion. Non-display coloration of fe-
males with lateral parts of the body gray and dorsal parts
brown, with three to four darker crossbands between the
lateral stripes on both sides of the body. Lateral stripe
white, from the mental scale along the upper lips and the
tympanum to the hindlimbs. Head light blue.
Etymology. The specific epithet is a patronym formed
in the genitive singular honoring Dr. Stephan Goetz, Mu-
nich, Germany, in recognition of his longtime support of
Species conservation efforts in Cambodia.
Distribution. Ca/otes goetzi sp. n. is distributed in a
large area of Indochina and inhabits most of the previous
range of C. mystaceus. The new species is documented
by museum specimens and photo vouchers from Cam-
bodia, China (Yunnan province), Laos, Myanmar, and
Thailand.
Ecology. Calotes goetzi sp. n. is diurnal and semi-ar-
boreal to arboreal and can easily climb on tree trunks at
a height of 5-10 meters or above. The species is known
from dipterocarp lowland forests, cultural landscape and
secondary forest. At its type locality the species was ob-
served in more open habitats with a closed canopy, but
also within dense monsoon tropical forests and solitary
trees in rather open areas. Here it occurs sympatrical-
ly with Calotes versicolor. Hawkeswood & Sommung
(2018) report it from farmland with e.g., rice, coconut,
banana, and durian plantations. Chan-Ard et al. (2015)
report the species from a wide range of forest types in
Thailand, including tree-lined agricultural lands and
grasslands. Similar to other Calotes species, C. goetzi
sp. n. feeds on a variety of arthropods. Chan-Ard et al.
(2015) report from Thailand, that mature individuals are
territorial, chasing away possible intruders. Eggs are bur-
ied in soft soil and later guarded by the males. Amber
et al. (2017) recognized a possible ontogenetic shift in
defense strategies of C. goetzi sp. n. (C. mystaceus at the
time of their publication), with older individuals utilizing
color change, while juveniles do not.
Calotes mystaceus Dumeéeril & Bibron, 1837: 408
(Fig. 2, Clade D)
Dumeril, A. M. C. & G. Bibron (1837). Erpétologie Générale
ou Histoire Naturelle Complete des Reptiles. Vol. 4. Libr. En-
cyclopédique Roret, Paris, 570 pp.
Holotype. MNHN 2557 (juvenile male, Fig. 8A-B),
from “Indes orientales (...) pays de Birmans [=Myan-
mar].”
Original Diagnosis. “Deux petites épines places I’ une
apres l’autres de chaque céte de la nuque. Un pli oblique
en longueur devant |’épaule. Ecailles des cétes du tronc
grandes; celles du ventre moitié plus petites. Dessus de la
base de la queue subanguleux, garni d’écailles seulement
un peu plus grandes que celles qui les avoisinent. Fauve
en dessus; sous l’oeil une bande jaune qui se prolonge
jusque sur |’épaule.”
©ZFMK
158 Philipp Wagner et al.
Table 5. Morphological variation in the examined specimens of the Ca/otes mystaceus complex. Values are given are as mean +
standard deviation and minimum — maximum. Characters marked with an asterisk were significantly different between species in
the AN(C)OVA.
C. bachae C. geissleri sp. n. C. goetzi sp. n. C. mystaceus C. vindumbarbatus sp. n.
females males females males females males females males females males
(n=6) (n= 10) (n= 2) (n=4) (n = 33) (n= 38) (n= 2) (n=7) (n= 2) (n= 3)
SVL 80.5+6.35 88.6+ 14.06 103415.56 114547.72 101.334 114.16+ 87+416.97 8229+ 17.58 60+ 18.38 67+ 14
71-86 56-102 92-114 106-122 10.32 16.34 75-99 58-101 47-73 51-77
83-126 84-145
EyeEar 4.82+0.58 5.924+1.21 6844£1.36 8.1141.25 601+0.76 7.88+41.645.61+40.86 5.094+1.18 3.51+1.56 435+0.79
3.91-5.61 3.56-7.15 5.88-7.8 6.95-9.45 4.66-7.73 5.33-11.46 5-621 3.49-6.56 2414.61 3.444 89
HeadH 14.884 1.85 16.24+2.95 17.43+43.3 20.75+3.88 17.8142.13 2185+ 15.14+ 14644357 10.05+ 11.02 + 2.07
12.19-17.35 11.7-19.55 15.1-19.76 17.45-26.35 13.74-22.38 4.18 3.73 9.87-20.03 2.97 8.64-12.33
13.55— 12.5-17.78 7.95-12.15
31.79
HeadL 19.82 + 1.94 21.9743.5324.714465 2842.71 23.7542.15 2718+ 21.124 2044413 154449 16.28+43.47
16.92-21.5 14.71-25.72 21.42-28 24.89-31.07 20.14-2839 5.44 3.85 14.59-24.73 11.83-18.18 12.28-18.43
7.8-36 18.4-23.85
HeadW* = 15.01 + 1.04 16.89 + 3.22 19.664 2.62 24.87+43.86 17.9742.1623.844+5.2 15.82+ 15.7943.65 12.66+ 13.12+2.59
14.12-16.93 11.21-20.54 17.81-21.52 20.81-30 14.92-22.73 12.75- 1.95 11.19-21.36 3.85 10.19-15.12
37.13 14.44-17.2 9.94-15.39
Interorb* 8.96+0.73 9.92+1.67 14.1641.92 12.341.99 11.12+0.99 1248+ 10.39 + 89416 7.1642.22 7.74+1.43
7.85-9.73 6.7-11.69 12.8-15.52 9.92-1469 9.2-12.7 1.85 Lee? 6.62-10.87 5.59-8.73 6.08—8.57
8.75-16.65 9.13-11.64
JawW 13.92+ 0.93 15.07+2.5 17.77+1.79 20.98 + 1.53 16.54+1.44 20.01 + 1491+ 140942.73 11.844 11.89 42.47
12.82-15.56 10.74-18.36 16.5-19.03 19.32-22.44 14.2-19.65 4.06 1.53 10.44-17.6 3.34 9.13-13.9
12.03— = 13.83-16 9.47-14.2
37.39
NarEye 5.354085 615+1.04 7.3141.55 7.89+0.69 6.86+0.73 7.764 1.316.6242.05 5.994143 423+41.03 469+40.86
3.75-6.19 4.34-7.62 6.22-8.41 7.38-8.9 5.25-8.44 5.31-10.71 5.17-8.07 3.61-7.41 3.54.96 3.72-5.33
SnEye 9.19+41.26 10.08 + 1.8512.01+2.23 12.44+0.78 11.3941.13 12.974 1014+ 954422 6974182 769+1.5
7.58-10.56 6.32-11.96 10.43-13.59 11.71-13.5 8.74-14.22 2.19 2.67 6.44-11.72 5.69-8.26 5.96-8.63
8.64-17.54 8.26-12.03
SnW 5.04+0.62 5.53+0.75 6.334049 6924+0.45 656+41.52 7.7842.885.42+40.59 5374066 4454069 4644081
4.06-5.83 3.94656 5.98-668 6.49-7.48 5.11-14.39 5.1-18.43 5-5.84 448-63 3.96-4.93 3.7-5.15
4FingL 10.04 + 1.05 10.67 + 1.4712.35+0.64 13.69+0.46 12.1441.12 13.154 10.27+ 102+1.74 7.454134 8.09+1.41
8.56-10.93 7.44-12.04 11.89-12.8 13.41-14.37 9.99-14.14 1.64 1.89 7.63-12.08 6.5-8.4 6.46-8.91
9.82-16.03 8.93-11.6
4ToeL 13.38 + 0.93 15.03 + 1.95 16.22 40.76 17.68+0.71 15.12+1.57 1743+ 149142.5 140742.92 1046+ 11.8441.4
11.83-14.59 11.04-16.92 15.68-16.76 16.88-18.59 12.75—20.31 2.19 13.14-— 10.31-18.19 2.64 10.25-12.86
13.71- 16.68 8.6-12.33
21.89
CrusL 17.22 + 1.66 18.46 + 2.9220.91 + 3.43 23.41+0.94 205742.25 23.31 + 17.35+ 17.0843.81 12.59+ 13.89 + 2.96
14.58-18.55 12.65—21.57 18.49-23.34 22.39-24.22 17.11-27.25 2.91 3.44 11.83-21.83 4.19 10.48-15.81
17.55- 14.92— 9.62-15.55
28.98 19.78
ForefL 13.35+0.79 14.62+2.22 159+1.09 18.25+04 15.9541.68 17.71 + 13.364 13.8842.75 10.39+ 11.39 + 1.73
12.11-14.17 10.29-17.73 15.13-16.67 17.67-18.56 13.98-22.19 2.03 1.34 9.97-17.8 2.64 9.39-12.43
13.16-21.4 12.41-14.3 8.53-12.26
HindfL 23.75 + 1.94 25.69 + 3.1828.39+2.74 30.88 +0.81 27.3142.22 3082+ 2534+ 24224489 1789444 19.95+43.35
20.34-25.3 19.75-28.7 26.46-30.33 29.94-31.58 23.74-33.62 3.25 3.85 17.24-29.07 14.78-21 16.09-22.12
23.36— 22.62-
37.41 28.07
LoArmL = 14.45+1.51 15.4942.9317.39+2.81 20.0941.31 175+2.22 19.78+33 1542+ 13.9843.27 1014368 11.1242.17
11.95-15.75 9.6-18.64 15.4-19.38 18.48-21.57 13.64-24.14 13.64— 3.44 8.99-17.38 7.5-12.7 8.62-12.51
27.73 12.99-
17.85
SnForeL 27.83 43.43 30.34 11.23 3242.83 42456 35214454 40.174 31.5+6.36 29.29+804 214566 2261+4.1
23-32 2-39 30-34 37-50 29-45 7.61 27-36 20-41 17-25 1825.83
27-59
TailH 6.72£0.97 9.744207 104267 1456+1.31 9.794144 1441+ 9274352 9044295 4884192 691+42.69
5.12-8.06 6.02-12.29 8.11-11.89 13.44-16.43 7.46-12.69 3.26 6.78-11.76 5.18-13.07 3.52-6.23 3.81-8.61
6.6-21
Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK
New Calotes Species from Mainland SE Asia
Table 5. (continued).
159
C. bachae C. geissleri sp. n. C. goetzi sp. n. C. mystaceus C. vindumbarbatus sp. n.
females males females males females males females males females males
(n= 6) (n= 10) (n=2) (n= 4) (n = 33) (n = 38) (n= 2) (n=7) (n=2) (n=3)
TailL 178.33 + 1744+ 20642404 22267+ 193.77 + 219.96 + 1I58+NA 169.33+ 113+438.18 115+24.04
21.86 63.54 189-223 41.04 23.48 29.55 158-158 37.56 86-140 98-132
157-203 13.6-215 197-270 127-237 161-272 119-210
TailW 7.154143 9.044 1.85 11.2541.53 12434067 1049+ 12424218 8141.51 8044231 63843.84 662+1.75
5.27-915 5.3-12.38 10.17-12.33 11.75-13.35 1.14 5.56-16.39 7.03-9.17 4.98-11.03 3.67-9.1 4.61-7.82
8.31-12.9
TrunkL 3842.83 37.65+13.2 5447.07 5542.45 4852+ 52394628 4044.24 38574658 2947.07 30.67+45.13
34-41 2.5-47 49-59 52-57 5.75 39-65 37-43 29-47 24-34 25-35
38-62
UpArmL 13.15+ 1.37 14.76+2.2616.0540.11 18.3841.41 1561+ 17.56+1.97 1414052 14344309 1025+ 9.95+ 1.33
11.67-14.78 9.69-16.94 15.98-16.13 16.64—20.09 1.73 13.46-21.64 13.73-14.47 9.91-17.87 Bal] 8.44-10.96
12.59-20.53 8.72-11.79
UpLegL 17.924 1.85 19.23 +3.1321.12+2.67 23.5141.39 2012+ 23.1943.01 18.71+4.84 17.5143.9 13.143.14 13.82+41.7
14.85-20.14 12.86—21.83 19.23—23.01 22.31-25.17 1.81 18.47-29.1 15.29-22.14 11.96—-22.18 10.88-15.32 11.85—-14.85
17-25.2
CanthR 8.83+0.75 8.7+1.34 6+0 Face 8.55+0.79 889+0.8 PE283:) 6572207 S820771 5+0
8-10 6-11 6-6 6-10 7-10 8-11 5-9 5-10 5-6 5-5
Eyelid 13:17 40:75. 126+£0:°7 TWSh071 132115 1333 “It +0:92- 1152071, 12.292.0.95 12:35 +0-71 1733 Shs
12-14 12-14 11-12 12-14 1.05 11-15 11-12 11-14 12-13 10-12
11-16
HeadSLn 1542.19 15.8+41.55 1642.83 1554129 1618+ 16.29+42.22 16+0 16.714+2.43 15.54+2.12 1567+1.15
12-18 14-19 14-18 14-17 1.33 11-21 16-16 13-20 14-17 15-17
14-19
HeadSTr 15.6741.63 156+41.58 16+1.41 15541 17.3+1.79 16.86+1.46 145+0.71 16.29+41.11 1641.41 1633+40.58
14-18 13-18 15-17 14-16 13-21 13-20 14-15 15-18 15-17 16-17
Inflab 10.33+0.52 10.2+0.79 10.5+0.71 10+1.41 1064+ 1061411 95+0.71 10.14+0.38 10.5+0.71 10+0
10-11 9-11 10-11 9-12 0.93 8-13 9-10 10-11 10-11 10-10
9-13
SnS 8.3341.03 76+1.35 65+0.71 7+0 8.36+1.29 7894125 7540.71 6574098 65+£0.71 6.67+40.58
7-10 6-10 6-7 7-1 6-10 6-10 7-8 5-8 6-7 6-7
Suplab 1054055 10+0.82 105+0.71 1140.82 10.7+0.81 10424106 95+0.71 10+1.15 105+0.71 10+1
10-11 9-11 10-11 10-12 9-12 8-13 9-10 8-11 10-11 9-11
4FingLm 19.334 1.63 20.7140.95 1941.41 22.3342.08 2033+ 20424+1.29 224+NA 216+1.95 205+0.71 21.33+0.58
18-22 20-22 18-20 20-24 1.22 19-24 22-22 20-25 20-21 21-22
18-23
4ToeLm 23.83+1.17 24+1 25+0 263343.79 23.974 24.19+1.78 28+NA 26+1.22 25+0 26.67 + 0.58
22-25 23-25 25-25 22-29 1.98 22-30 28-28 25-28 25-25 26-27
21-28
VertS 4454122 37.4+43.63 495+0.71 4154451 4888+ 45164364 4347.07 41.864+3.67 4642.83 4433+43.79
43-46 32-42 49-50 35-45 4.01 37-52 38-48 38-49 44-48 40-47
43-60
MidbS 48.17+2.04 47642.76 524283 5545.29 51.82+ 51.68+43.32 4954495 47574454 5440 50.67 + 1.15
46-51 44-53 50-54 50-62 2.81 45-60 46-53 44-56 54-54 50-52
46-59
Revised Diagnosis. A small sized Ca/otes with a max-
imum known SVL of 101 mm in males and 99 mm in fe-
males. Distinguished from all other species of the group
by the combination of the following characters: 1) Head
and body slender, with long tail and extremities; 2) body
scales relatively large in respect to the body size, homo-
geneous, strongly keeled and arranged in regular rows;
3) upper dorsolateral scales pointing back- and upwards;
4) 44-56 scale rows around midbody; 5) no spines above
the tympanum; 6) Vertebral crest, composed of erected
Bonn zoological Bulletin 70 (1): 141-171
spiny scales, directed posteriorly, continuous from above
the tympanum to about the insertion of the hindlimbs,
but spines becoming abruptly shorter above the insertion
of the front limbs; 7) Vertebral scales, including crest
spines 38-49 in males and 38-48 in females; 8) oblique
skin fold in front of the fore limbs; 10) Head, chest, front
limbs, and anterior dorsal crest turquoise; 11) whitish lat-
eral stripe from the snout along the upper lip and the tym-
panum to behind the insertion of the fore limbs, behind
tympanum becoming brownish beige and fusing with
©ZFMK
Philipp Wagner et al.
ra . : os” Rad
25 e248
SIG IO OD. aia
. a
=
—_ SS 3
er Ars
Fig. 9. Calotes vindumbarbatus sp. n. A. Holotype (CAS 232388, adult male) from Myanmar, Kachin State, Gat Shang Yang
Village, general view from above. B. Holotype, lateral view. C. Living adult male (CAS 232819) from Myanmar, Kachin State,
Mohnyin Township, Hepu village [25.094528° N, 96.401833° E, alt. 243 m.].
Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK
New Calotes Species from Mainland SE Asia 161
beige dorsolateral blotches above front limb insertion;
12) four faint beige dorsolateral blotches.
Male coloration. According to the original descrip-
tion ventral and dorsal parts of the body, tail and limbs
brownish. Upper parts of the head olive, chest and throat
brownish to yellow. Orange-yellowish stripe from the
upper lip crossing the tympanum to the shoulders. More
recently collected males (Figure 8C) show the head and
the anterior of body to the shoulders blue, with a yellow-
ish stripe from the mental towards the upper lips and the
tympanum to above and in front of the insertion of the
front limbs, followed by indistinct orange blotches.
Variation. Body measurements and meristic charac-
ters for adult individuals are given in Table 4. Specimens
ranged in size between the smallest juvenile male with a
SVL of 58 mm (CAS 239398) to the largest male with a
SVL of 101 mm (BMNH 1891.11.26.18) and the largest
female measuring 99 mm (BMNH 1868.4.3.62). In gen-
eral, adult males and females have the same body pro-
portions. Dorsal coloration differs between sexes with
coloration characters generally being lighter in females.
Both sexes are able to change their color. Turquoise col-
oration is restricted to the throat, other parts of the head
and body brownish. White lateral stripe present, extend-
ing from the mental along the upper lips, becoming beige
posterior to tympanum, ending in the first lateral blotch
of the same coloration, followed by three blotches of the
same color but lighter.
Distribution. With the description of the new species
of the group, the distribution of Calotes mystaceus is re-
stricted to the Irrawaddy delta region of coastal southern
Myanmar. However, further research is needed to fully
clarify the species distributional boundaries.
Ecology. Calotes mystaceus is diurnal and arboreal.
The species inhabits forests and more open landscapes
with a closed canopy. Mating was observed in September
2014 ina public garden within Yangon (pers. comm. An-
dreas Hellmann). As in other species of the genus the diet
mainly consists of arthropods.
Calotes vindumbarbatus sp. n.
(Fig. 2, Clade C)
urn: lsid:zoobank. org: act: 202D3652-BF 04-464E-87A2-E1A4611C0CAI1
Holotype. CAS 232388 (adult male, Fig. 9A-B, Clade
C) from Myanmar, Kachin State, Myitkyina Township,
Gat Shang Yang village [25.373421° N, 97.37475° E],
collected by T.Z. Min on April 8" 2003.
Paratypes. CAS 232247 from Myanmar, Sagaing
Division, Homalin Township, North of Swekawngaw
[25.371694° N, 95.369028° E, 205 m.]; CAS 232387
from Myanmar, Kachin State: Myitkyina, Gat Shang
Yang village; CAS 239206 from Myanmar, Sagaing Di-
vision, Hkanti District, Hkanti Township, Linpha village
[25.803389° N, 95.528778° E, 155 m.]; CAS 232819
from Myanmar, Kachin State, Mohnyin Township, Hepu
Bonn zoological Bulletin 70 (1): 141-171
village [25.094528° N, 96.401833° E, 254 m.]; ZFMK
97990 (formerly CAS 232389) from Myanmar, Kachin
State: Myitkyina, Gat Shang Yang village.
Diagnosis. A small Calotes species of the complex,
males with a known maximum SVL of 77 mm, females
with a SVL of 73 mm. Tail length short, up to 140 mm. It
can be distinguished from the other species of the com-
plex by the combination of the following characters: 1)
head slender, not as distinct from the body as in other spe-
cies of the complex; 2) body scales small and homoge-
neous, smooth, and arranged in regular rows around the
body. 3) Upper dorsolateral scales pointing backwards;
4) body scales arranged in 50—54 rows around midbody;:
5) 40-47 vertebral spines and scales in males, 44-48 in
females; two short and well separated spines above the
tympanum; 6) low nuchal and dorsal crest continuous
to the midpoint between the limbs, composed of erect
compressed scales, which are larger on the nuchal and
smaller on the dorsal crest, gradually decreasing towards
the end of the crest; 7) oblique skinfold in front of the
fore limb; 8) extremities and tail long, but shorter than in
C. mystaceus; 9) bluish head and chest; 10) whitish stripe
from about the nostril, along the upper lip to about the
insertion of the fore limb, posteriorly the whitish stripe
is laterally intersected by a dark reticulate pattern across
vertebrae; 11) brownish blotches missing.
Description of the holotype. Small male (SVL
77 mm). Extremities relatively slender with the fourth
finger and toe longest, tail incomplete. Head slightly dis-
tinct from the neck, area posterior of jaw angle slightly
swollen. Tip of the snout blunt, rostral small, nostril in a
single scale, separated from the rostral and the first supra-
labial scale by two scales in a row. Canthus rostralis of
five scales, distinct and straight, canthus scales continu-
ous with supraciliary scales. Lateral sides of the head flat
with 9/9 supralabial scales separated from the orbit by
three rows of small scales. Five feebly ridged scales from
the orbit to above the tympanum. Tympanum distinct,
one spiny scale posteriorly above the tympanum. Mental
scale small, bordered by two postmental scales which are
separated from each other, only the first pair is in contact
with the infralabial scales; 10/10 infralabial scales. Later-
al scales on the chin and throat smooth, becoming keeled
towards the ventral part. A continuous vertebral crest of
elevated spiny scales from above the tympanum to about
mid-body, spine height gradually decreasing posterior of
the neck, in total 40 vertebral scales from the nape to
above the cloaca. Dorsal and lateral scales keeled, point-
ing back- and upwards, in 50 rows around midbody. Cau-
dal scales parallel keeled, directed backwards. Ventral
scales parallel keeled.
Male coloration. Brilliant coloration unknown
(Fig. 9C). Head most probably blue, with a whitish
stripe, less broad than in the other species of the C. mys-
taceus complex, from behind the nasal scale along the
upper lips and the tympanum to the shoulders. Followed
©ZFMK
162 Philipp Wagner et al.
Fig. 10. Overview of the distinct taxa of the Calotes mystaceus complex. A. Calotes mystaceus, male from Mingalardon Town-
ship, Hlawga Wildlife Park, Yangon Divison, Myanmar (CAS 213300). B. Calotes mystaceus, female from Yangon, Myanmar.
C. Calotes bachae, holotype from Cat Tien National Park, Vietnam (ZFMK 92028). D. Calotes bachae, female paratype from Cat
Tien National Park, Vietnam (ZFMK 88936, now IEBR A.2012.23). E. Calotes geissleri sp. n., male from Chin, Myanmar (CAS
220586). F. Calotes geissleri sp. n., female from Magwe, Myanmar (CAS 221593). G. Calotes goetzi sp. n., male from the type
locality Kbal Spean, Cambodia (ZFMK 92606). H. Calotes goetzi sp. n., female from the type locality Kbal Spean, Cambodia
(ZFMK 92607). I. Calotes vindumbarbatus sp. n., male from Kachin, Myanmar (CAS 232819). J. Calotes vindumbarbatus sp. n.,
male from Kachin, Myanmar (CAS 232819).
Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK
New Calotes Species from Mainland SE Asia 163
by one distinct and one or more indistinct lateral blotches
of the same color.
Variation. Body measurements and meristic charac-
ters for adult individuals are given in Table 4. Specimens
ranged in size from the smallest female with a SVL of
47 mm (CAS 232247) and the largest female with a SVL
of 73 mm (CAS 232387) to the largest male with a SVL
of 77 mm (CAS 232388). Adult males are slightly larger
than females, because of longer SVLs and tail lengths,
and have fewer vertebral scales including the crest scales.
However, proportionally males and females are equal.
Dorsal coloration of females unknown, but most prob-
ably similar to other taxa of the species group with fe-
males having lighter coloration characters (lateral stripe,
blotches) than males. Most probably, both sexes are able
to change their coloration.
Etymology. The specific epithet is a patronym honor-
ing Jens Vindum, retired staff of the California Academy
of Sciences, in respect of his outstanding contributions
to the herpetology of Myanmar and SE Asia. The patro-
nym of his family name was used, in recognition of his
impressive beard which has a direct link to “mystaceus”
[Greek for bearded], together with the Latin word “bar-
batus” for bearded.
Distribution. This new species is so far only known
from northern Myanmar.
Ecology. Calotes vindumbarbatus sp. n. is diurnal and
arboreal to semi-arboreal. It inhabits forests and more
open habitats with a dense canopy, but detailed habitat
preference is unknown. As in other Ca/otes species the
diet most likely consists predominantly of arthropods,
but details are not known.
Identification key
Key to the species using the characters of male color-
ation:
Key to the species using the characters of male coloration
1. Brownish dorsolateral blotches ..............0000.ccc. 2
2. Prominent dark brown dorsolateral blotches.............
tephra lis et, cers eR a Calotes goetzi sp. n.
— Brownish orange/tan/light brown dorsolateral
DIGIGHCS Be) cc teecn tls eee mee ke eer ere 5}
3. Whitish stripe from snout-tip to hindlimb insertion
continuous between orange to light brown blotches,
body robust with relatively short limbs...............0.....
ape AE AR ia Atenas ARIE Sty, cecil Calotes geissleri sp. n.
— Whitish stripe from snout-tip to front limb insertion,
posterior to tympanum becoming brownish beige
and fusing with faint brownish dorsolateral blotches,
body slender with relatively long limbs....................
Se TNA | J ters Sine E BS, Bonu he xt AO Calotes mystaceus
4. Yellowish stripe from below eye to posterior end of
|WePa\8 chad ss epee btn Hinsneconclls Rahat 5. Calotes bachae
Bonn zoological Bulletin 70 (1): 141-171
— Whitish stripe from tip of snout continuing to beyond
limb insertion ........... Calotes vindumbarbatus sp. n.
Genetically the clades (Fig. 2) refer to the follow-
ing taxa: Clade Al+A2=Calotes goetzi sp. n.; Clade
B=C. geissleri sp. n.; Clade C=C. vindumbarbatus
sp. n.; Clade D=C. mystaceus; Clade E=C. bachae.
The morphological variation within the type specimens
is given in Appendix IV. In general, PCAs demonstrated
that the species are not distinguishable by their morpho-
spaces. However, they are identifiable by their coloration
(Fig. 10) and by the combination of single characters
(Appendix. V, Table 5). In Calotes vindumbarbatus sp. n.
both males and females are distinctly shorter than the
other species of the complex but have comparably high
numbers of vertebral scales and scales around midbody.
The largest species with the highest scale counts are
C. geissleri sp. n. and C. goetzi sp. n., whereas C. bachae
usually has low scale counts.
DISCUSSION
Dumeril & Bibron (1837) gave as type locality for Calotes
mystaceus “Indes orientales (...) pays de Birmans,*
which corresponds to Myanmar today. The type speci-
men, a juvenile male (MNHN 2557), morphologically
resembles material from the Irrawaddy delta in southern
Myanmar. Specimens from this region also form a dis-
tinct genetic lineage (Clade D) referable to Calotes mys-
taceus. Since no specimens from other regions could be
assigned to C. mystaceus, the species’ distribution might
be restricted to the Irrawaddy delta in southern Myanmar.
More research in this area is required to corroborate this
assumption. In addition to C. mystaceus and C. bachae,
we revealed the C. mystaceus complex to harbor three
genetically distinct lineages which are further support-
ed by both morphological characters and coloration of
adult males. Several authors have demonstrated, that col-
oration is an important character to distinguish distinct
evolutionary lineages in agamid lizards, especially in
taxa with sexually dimorphic coloration but without body
ornamentations like horns (see, e.g., Stuart-Fox & Ord
2004; Chen et al. 2012; Quah et al. 2012; Wagner 2014).
Within the C. mystaceus complex, two lineages (Calotes
bachae, C. vindumbarbatus sp. n.) are clearly distinct in
coloration from all other lineages. The genetic distinct-
ness of Calotes bachae was also supported by Saijun-
tha et al. (2017). The remaining three lineages (Calotes
mystaceus, C. geissleri sp. n., C. goetzi sp. n.) are more
similar to each other in coloration, but distinct to each
other according to the phylogenetic results. However,
all unnamed lineages are distinct enough in coloration
from the recognized species C. bachae and C. mystaceus
to identify them as new species. The former is a distinct
genetic lineage within the C. mystaceus complex, which
©ZFMK
164 Philipp Wagner et al.
would render C. mystaceus polyphyletic if these new spe-
cles were not recognized.
Mean uncorrected p-distances for COI are overall rel-
atively similar between C. mystaceus and its close re-
lated species (C. mystaceus to C. goetzi sp. n.: 0.0603;
C. mystaceus to C. vindumbarbatus sp. n.: 0.0656) and
similar between C. goetzi sp. n. to C. vindumbarbatus
sp. n. (0.0647), but are higher between C. mystaceus to
C. bachae (0.1415). This is similar to the mean uncor-
rected p-distances for 12S, where C. mystaceus 1s closely
related to C. goetzi sp. n. (0.0291) and to C. vindumbar-
batus (0.0375), but less related to C. bachae (0.0548) and
C. geissleri sp. n. (0.0457). The p-distances are similar
between other closely related taxa within the C. mysta-
ceus Clade: C. goetzi sp. n. vs. C. vindumbarbatus sp n.
(0.0326) while C. bachae vs. C. geissleri sp. n. (0.0610)
has similar p-distances than C. bachae vs. C. goetzi sp. n.
(0.0603) and C. bachae vs. C. vindumbarbatus sp n.
(0.0615). These distances are similar to those shown by
Wagener et al. (2009) for recognized taxa at the species
level within the genus Agama. Therefore, these lineag-
es have been described as new species rather than syn-
onymizing the recently described Calotes bachae with
C. mystaceus and producing a taxonomy which underes-
timates diversity.
This taxonomic act restricts C. mystaceus to Myanmar,
while the most widespread taxon of the group, C. goetzi
sp. n., 1s distributed nearly across entire central Indochi-
na, excluding Vietnam. While our study also revealed
two lineages (Al & A2) within C. goetzi sp. n. (Fig.2),
their geographic distribution does not match the phylo-
geographic pattern previously proposed by Saijuntha
et al. (2017). Using the mitochondrial COI gene, Saijun-
tha et al. (2017) studied 238 C. goetzi sp. n. (C. mys-
taceus at that time) from 43 localities across Thailand
and Cambodia and found two major lineages. The first
of their lineages corresponds to northeast Thailand and
adjacent Cambodia and the second to central and north-
ern Thailand respectively. The authors suggested these
lineages to be separated by mountain ranges. Our study
incorporated three sequences from Saijuntha et al. (2017;
table 2), two from the first lineage (CNb1 [20], PTK1
[21]) corresponding to our lineage A2, and one (CMfl
[33]) that matched neither lineage of Saijuntha et al.
(2017) but corresponds to our lineage Al. Therefore, the
structuring observed by Saijuntha et al. (2017) reveals a
fine scale structure within our lineage A2 while the sole
sample representing our lineage Al only found in Myan-
mar and extreme northwestern Thailand, was suggested
to represent a distinct taxon.
The present study supports the Lower Mekong as a dis-
tributional boundary separating C. bachae from the other
taxa as suggested by Hartmann et al. (2013) and Geissler
et al. (2015). However, our study demonstrates the dis-
tributional range of C. bachae to be much larger than
assumed, as specimens from northern Vietnam can also
Bonn zoological Bulletin 70 (1): 141-171
be assigned to this species which was previously only
known from southern Vietnam and adjacent Cambodia.
Myanmar appears to represent a hotspot of species di-
versity, as all species, except for C. bachae, occur in this
country. However, further studies are necessary to clarify
distributional boundaries, potential contact zones, and
speciation processes that led to the diversity of Calotes
species in Myanmar.
The discovery of so far unrecognized species within the
C. mystaceus complex in Indochina is not surprising con-
sidering the geological history of the region and the large
river systems functioning as potential barriers to disper-
sal. As a result, several new species have been described
from the area in recent years (see, e.g., Zug et al. 2006;
Bohlen et al. 2016; Zemlemerova et al. 2016). Bain &
Hurley (2011) found the Red River in northern Indochina
to act as or coincide with an apparent dispersal barrier,
but they have not found any evidence that the Mekong
River limits dispersal of the regional herpetofauna. In
contrast, Geissler et al. (2015) have demonstrated that, at
least for amphibians, the Lower Mekong serves as or at
least coincides with a biogeographical barrier. Moreover,
the distribution pattern of C. bachae versus the other taxa
of the C. mystaceus complex shows that the Lower Me-
kong represents a barrier for these lizard species.
On the western side of the distributional range of the
C. mystaceus complex, the Irrawaddy (=Ayeyarwady
River) could have acted earlier as a geographic barrier
separating C. goetzi sp. n. and C. vindumbarbatus sp. n.
from C. geissleri sp. n. leading to speciation. Howev-
er, for specimens of C. goetzi sp. n. (Fig. 1, locality 47)
and C. vindumbarbatus sp. n. (Fig. 1, locality 64) both
collected from the vicinity of “Lake Indawgyi” we are
missing more detailed information but suggest that these
taxa are already co-occurring in this area, probably due
to anthropogenic diversion. According to the known
distributional range, dispersal of C. goetzi sp. n. could
have been restricted by the two large river systems of
the Mekong and Irrawaddy resulting in speciation with-
in this geographically isolated area. This is supported by
the extreme southern parts of the Salween River marking
the genetic split within C. goetzi sp. n. as an intraspecific
geographic barrier. However, Calotes mystaceus is rec-
ognized from “Pegu” (Fig. 1, locality 54), referring to
the town “Bago” or the “Bago-Division”, but not to the
borders of the former Pegu Empire, because the latter had
ceased to exist long before the specimen was collected.
This division encompasses large parts of the supposed
distribution area of C. mystaceus but in its northern and
eastern boundaries as indicated by sample site 54 (see
Fig. 1) might overlap with the distribution range of C.
goetzi sp. n. and therefore it is possible that both species
occur sympatrically in this area.
Acknowledgments. We are grateful to the following curators
and collection managers: Patrick Campbell (NHM), Lauren
©ZFMK
New Calotes Species from Mainland SE Asia 165
Scheinberg and Jens Vindum (CAS); Ivan Ineich (MNHN),
Ulrich Scheidt (NME), Frank Tillack and Mark-Oliver Rodel
(ZMB). All of them gave not only access to their collections
and material, but also provided help and amicable hospitality.
We are grateful to the Ministry of Environment of the Kingdom
of Cambodia, the staff of the Angkor Centre for Conservation
of Biodiversity (ACCB) for their help during field studies in
Cambodia and to the Allwetterzoo Munster (Germany) for the
financial support of the ACCB and the field studies. Natalia
Ananjeva and Thomas Ziegler helped us with valuable com-
ments on the manuscript and we are thankful to Aaron Bauer
who handled it as editor.
REFERENCES
Amber ED, Waengsothorn S, Strine CT (2017) Calotes mys-
taceus (Moustached Crested Lizard). Defensive behaviors.
Herpetological Review 48: 640
Bain RH, Hurley MM (2011) A biogeographic synthesis of the
amphibians and reptiles of Indochina. Bulletin of the Ameri-
can Museum of Natural History 360: 1-138.
https://doi.org/10.1206/360.1
Bohlen J, Petrtyl M, Chaloupkova P, Borin C (2016) Schistu-
ra kampucheensis, a new species of loach from Cambodia
(Teleostei: Nemacheilidae). Ichthyological Exploration of
Freshwaters 26 (4): 353-362
Borchsenius F (2009) FastGap 1.2. Department of Biosciences,
Aarhus University, Denmark. Online at http://www.aubot.dk/
FastGap_home.htm [last accessed 19 Apr. 2021]
Bourret R (1927) La Faune de I’Indochine, Vértébres. Société
de Géographie de Hanoi, Hanoi
Bourret R (2009) Les Lézards de Il’ Indochine. Edition Chimai-
ra, Frankfurt am Main
Chan-Ard T, Parr JWR, Nabhitabhata J (2015) A Field Guide to
the Reptiles of Thailand. Oxford University Press, New York
Chen IP, Stuart-Fox D, Hugall AF, Symonds MRE (2012) Sex-
ual selection and the evolution of complex color patterns in
dragon lizards. Evolution 66: 3605-3614.
https://doi.org/10.1111/).1558-5646.2012.01698.x
Das I (2015) A Field Guide to the Reptiles of South-east Asia,
Myanmar, Thailand, Laos, Cambodia, Vietnam, Peninsular
Malaysia, Singapore, Sumatra, Borneo, Java, Bali. Blooms-
bury, London, UK
Dray S, Dufour A (2007) The ade4 Package: Implementing the
duality diagram for ecologists. Journal of Statistical Software
22 (4): 1-20. https://doi.org/10.18637/jss.v022.104
Edgar RC (2004) MUSCLE: multiple sequence alignment with
high accuracy and high throughput. Nucleic Acids Research
32 (5): 1792-1797. https://do1.org/10.1093/nar/gkh340
Enge KM, Krysko KL (2004) A new exotic species in Flori-
da, the bloodsucker lizard, Calotes versicolor (Daudin 1802)
(Sauria: Agamidae). Florida Scientist 67: 226—230
Evan SH, Quah CTC, Mohd AM, Shahrul AMS (2012) Col-
or changes during courtship and mating of the green crested
lizard Bronchocela cristatella (Kuhl, 1820) (Squamata: Ag-
amidae) with a discussion of its behavioral and evolutionary
significance. Russian Journal of Herpetology 19: 303-306
Flower SS (1899) Notes on a second collection of reptiles made
in the Malay Peninsula and Siam, from November 1896 to
September 1898, with a list of the species recorded from
those countries. Proceedings of the Royal Zoological Society
of London 1899: 600-697
Geissler P, Hartmann T, Ihlow F, Rodder D, Poyarkov NA. Jr,
Nguyen TQ, Ziegler T, Bohme W (2015) The Lower Me-
Bonn zoological Bulletin 70 (1): 141-171
kong: an insurmountable barrier to amphibians in southern
Indochina? Biological Journal of the Linnean Society 144:
905-914. https://do1.org/10.1111/biy.12444
Grismer LL (2011) Lizards of Peninsular Malaysia, Singapore
and their Adjacent Archipelagos. Edition Chimaira, Frank-
furt am Main, Germany
Hallermann J (2000) A new species of Calotes from the Moluc-
cas (Indonesia), with notes on the biogeography of the genus
(Sauria: Agamidae). Bonner zoologische Beitrage 49 (1-4):
155-163
Hammer O, Harper DAT, Ryan PD (2001) PAST: Paleontolog-
ical statistics software package for education and data analy-
sis. Palaeontologia Electronica 4 (1): 1-9
Harikrishnan S, Vasudevan K, Choudhury BC (2010) A review
of herpetofaunal descriptions and studies from Andaman and
Nicobar Islands, with an updated checklist. Pp 387-398 in:
Ramakrishna, Raghunathan C., Sivaperuman C. (eds) Recent
trends in biodiversity of Andaman and Nicobar Islands. Zoo-
logical Survey of India, Kolkata
Hartmann T, Ihlow F, Edwards S, Sovath S, Handschuh M,
Bohme W (2013) A preliminary annotated checklist of the
Amphibians and Reptiles of the Kulen Promtep Wildlife Sanc-
tuary in Northern Cambodia. Asian Herpetological Research
4: 36-55. https://doi.org/10.3724/SP.J.1245.2013.00036
Hawkeswood TJ, Sommung A (2018) First record of the Blue
Forest Lizard, Calotes mystaceus Duméril & Bibron, 1837
(Reptilia: Agamidae) from Ubon Ratchathani Province,
Thailand, with a review of literature on the biology and dis-
tribution of the species in Thailand. Calodema 607: 1-8
Katoh K, Asimenos G, Toh H (2009) Multiple alignment of
DNA sequences with MAFFT. Methods in Molecular Biolo-
gy 537: 39-64. https://doi.org/10.1007/978-1-59745-251-9 3
Kocher TD, Thomas WK, Meyer A, Edwards SV, Paabo S,
Villablanca FX, Wilson AC (1989) Dynamics of mitchondri-
al DNA evolution in animals: Amplification and sequencing
with conserved primers. Proceedings of the National Acade-
my of Sciences, USA 86: 6196-6200.
https://doi.org/10.1073/pnas.86.16.6196
Lalremsanga HT, Khawlhring L, Lalrotluanga (2010) Three
additional lizard (Squamata: Sauria) records for Mizoram,
India. Journal of Threatened Taxa 2 (2): 718-720.
https://doi.org/10.11609/JoTT.02246.718-20
Manthey U (2008) Agamid Lizards of Southern Asia, Dracon-
inae 1, (Terralog 7a). Edition Chimaira, Frankfurt am Main
Morice A (1875) Coup d’oeil sur la faune de la Cochinchine
Frangaise. Association Lyonnaise des Amis des Sciences Na-
turelles 1875: 25-121
Nazarov R, Poyarkov NA, Orlov NL, Phung TM, Nguyen TT,
Hoang DM, Ziegler T (2012) Two new cryptic species of the
Cyrtodactylus irregularis complex (Squamata: Gekkonidae)
from southern Vietnam. Zootaxa 3302: 1-24.
https://doi.org/10.11646/zootaxa.3302.1.1
Pal S, Vijayakumar SP, Shanker K, Jayarajan A, Deepak V
(2018) A systematic revision of Calotes Cuvier, 1817 (Squa-
mata: Agamidae) from the Western Ghats adds two genera
and reveals two new species. Zootaxa 4482 (3): 401-450.
https://doi.org/10.11646/zootaxa.4482.3.1
Pham AV, Hoang VT, Nguyen TV, Ziegler T, Nguyen TQ (2018)
New records and an updated list of lizards from Son La Prov-
ince, Vietnam. Herpetology Notes 11: 209-216
Posada D, Crandall KA (1998) Modeltest: testing the model of
DNA substitution. Bioinformatics 14: 817-818.
https://doi.org/10.1093/bioinformatics/14.9.817
R Core Team (2020) R: A language and environment for sta-
tistical computing. R Foundation for Statistical Computing,
©ZFMK
166
Vienna, Austria. Online at https://www.R-project.org/ [last
accessed 19 Apr. 2021]
Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA
(2018) Posterior summarization in Bayesian phylogenetics
using Tracer 1.7. Systematic Biology 67: 901-904.
https://doi.org/10.1093/sysbio/syy032
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling
A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP
(2012) MrBayes 3.2: efficient Bayesian phylogenetic infer-
ence and model choice across a large model space. Systemat-
ic Biology 61: 539-542. https://doi.org/10.1093/sysbio/sys029
Sayuntha W, Khumkratok S, Wongpakam K, Thanonkeo S,
Senakhun C, Appamaraka S, Yodsiri S, Thongnetr W, Pilap
W, Kongbuntad W, Tawong W, Agatsuma T, Petney TN, Tan-
trawatpan C (2017) Genetic diversity and population struc-
ture of blue-crested lizard, Calotes mystaceus Duméril &
Bibron, 1837 (Squamata: Agamidae) in Thailand. Journal
of Genetics 96 (2): 377-382.
https://doi.org/10.1007/s12041-017-0767-x
Schliep KP (2011) phangorn: phylogenetic analysis in R. Bio-
informatics 27 (4): 592-593. https://do1.org/b2rv94
Schmitz A, Ineich I, Chirio L (2005) Molecular review of the
genus Panaspis sensu lato in Cameroon, with special refer-
ence to the status of the proposed subgenera. Zootaxa 863:
1-28. https://doi.org/10.11646/zootaxa.863.1.1
Simmons MP, Ochoterena H (2000) Gaps as characters in se-
quence-based phylogenetic analyses. Systematic Biology 49:
369-381. https://doi.org/10.1093/sysbio0/49.2.369
Smith, MA (1921) New or little-known reptiles and batra-
chians from southern Annam (Indo-China). Proceedings of
the Zoological Society of London 29: 423-440.
https://doi.org/10.1111/).1096-3642.1921.tb03271.x
APPENDIX I. List of specimens examined for morphological
analyses. See text for acronyms of museum collections (BMNH
numbers refer to the Natural History Museum, London, UK,
now NHM).
Calotes bachae (n = 17): BMNH 1927.5.20.30, BMNH
1927.5.20.31, BMNH 1927.5.20.32, MNHN 1927.44,
MNHN 1927.46, ZFMK 88935, ZFMK 88936 (now
TEBR A.2012.23), ZFMK 88937, ZFMK 92028, ZFMK
92029, ZFMK 94395, ZFMK 94396, ZFMK 94397,
ZMMU NAP 01509, ZMMU NAP 01512, ZMMU
NAP 02910, ZMMU NAP 02911. Calotes geissleri
sp. n. (7 = 6): BMNH 1856.1.11.98, CAS 210270, CAS
215539, CAS 243028, CAS 243050, CAS 243200 (now
ZFMK 97991). Calotes goetzi sp. n. (n = 71): BMNH
1868.4.3.61, BMNH 1868.4.3.63, BMNH 1891.11.26.29,
BMNH 1914.4.25.1, BMNH_ 1929.12.1.11, BMNH
1933.3.10.1, BMNH 1933.3.10.2, MNHN 1884.546,
MNHN 1884.547, MNHN 1884.548, MNHN 1893.335,
MNHN 1893.336, NME RO0581/09, NME R0584/09,
NME_ R0585/09, NME R0686/11, NME R0751/12,
NME RO0783/13, NME RO784/13, NME RO785/13, NME
Bonn zoological Bulletin 70 (1): 141-171
Philipp Wagner et al.
Somaweera R., Somaweera N. (2009) Lizards of Sri Lanka: A
Colour Guide with Field Keys. Edition Chimaira, Frankfurt
am Main
Stuart-Fox DM, Ord TJ (2004) Sexual selection, natural selec-
tion and the evolution of dimorphic coloration and ornamen-
tation in agamid lizards. Proceedings of the Royal Society of
London B 271: 2249-2255. https://doi.org/dfwvnd
Tirant P (1885) Notes sur les Reptiles et les Batraciens de la Co-
chinchine et du Cambodge. Excursions et Reconnaissance,
Saigon
Uetz P, Freed P, HoSek J (2020) The Reptile Database. Online at
http://www. reptile-database.org [last accessed 29 Nov. 2020]
Wagner P, Bare} MF, Schmitz A (2009) Studies on African Ag-
ama VII. A new species of the Agama agama-group (Linnae-
us, 1758) (Sauria: Agamidae) from Cameroon & Gabon, with
comments on Agama mehelyi Tornier, 1902. Bonner zoolo-
gische Beitrage 56 (4): 285-297
Wagner P (2014) A new cryptic species of the Agama lionotus
complex from south of the Ngong Hills in Kenya. Salaman-
dra 50 (4): 187-200
Zemlemerova ED, Bannikova AA, Lebedev VS, Rozhnov VV,
Abramov AV (2016) Secrets of the underground Vietnam: An
underestimated species diversity of Asian moles (Lipotyphla:
Talpidae: Euroscaptor). Proceedings of the Zoological Insti-
tute RAS 320 (2): 193-220. https://doi.org/f9nr
Zug GR, Brown HHK, Schulte II JA, Vindum JV (2006) Sys-
tematics of the garden lizards, Calotes versicolor group
(Reptilia, Squamata, Agamidae), in Myanmar: Central dry
zone populations. Proceedings of the California Academy of
Sciences 57 (2): 35-68
RO786/13, NME RO0787/13, NME R0790/14,
16640, ZFMK 16641, ZFMK 40561, ZFMK
ZFMK 43930, ZFMK 43931, ZFMK 43932,
44893, ZFMK 44894, ZFMK 45490, ZFMK
ZFMK 45492, ZFMK 45493, ZFMK 45494,
45495, ZFMK 45496, ZFMK 45497, ZFMK
ZFMK 45499, ZFMK 45500, ZFMK 45501,
45502, ZFMK 45553, ZFMK 45554, ZFMK
ZFMK 47081, ZFMK 49164, ZFMK 49202,
49219, ZFMK 49220, ZFMK 49221, ZFMK
ZFMK 49243, ZFMK 49244, ZFMK 49245,
49246, ZFMK 55610, ZFMK 55611, ZFMK 55612,
ZFMK 84867, ZFMK 88341, ZFMK 92606, ZFMK
92607, ZMB 11603A, ZMB 30186, ZMB 30188A, ZMB
30197, ZMB 6034. Calotes mystaceus (n = 9): BMNH
1868.4.3.60, BMNH 1868.4.3.62, BMNH 1891.11.26.18,
CAS 206548, CAS 213300, CAS 239398, CAS 240287,
CAS 240296, MNHN 2557. Calotes vindumbarbatus
sp. n. (1 = 6): CAS 232247, CAS 232387, CAS 232388,
CAS 232389 (now ZFMK 97990), CAS 232819, CAS
239206.
ZFMK
43906,
ZFMK
45491,
ZFMK
45498,
ZFMK
47080,
ZFMK
49242,
ZFMK
©ZFMK
New Calotes Species from Mainland SE Asia 167
APPENDIX IT. Results of the analyses of (co-)variance.
ANOVA (Species*Sex) ANCOVA (Species*Sex+SVL)
Df Sum Sq Mean Sq __ F value Pr(F) Df Sum Sq Mean Sq F value Pr(>F)
EyeEKar 4 9.8948 2.4737 1.5780 0.1863 4 1.8177 0.4544 1.8669 0.1225
HeadH 4 52.8725 13.2181 1.2188 0.3079 4 13.4904 3.3726 0.9480 0.4398
HeadL 4 30.9982 7.7496 0.4756 0.7536 4 0.7392 0.1848 0.0398 0.9969
HeadW 4 110.3601 27.5900 1.8957 0.1173 4 40.9293 10.2323 2.6634 0.0371
Interorb 4 22.8385 5.7096 2.4167 0.0538 4 13.5416 3.3854 5.1825 0.0008
Jaww 4 47.4540 11.8635 1.4079 0.2371 4 13.8597 3.4649 1.1385 0.3431
NarEye 4 3.5544 0.8886 0.7383 0.5681 4 0.4279 0.1070 0.3667 0.8318
SnEye 4 9.0886 2.2721 0.7153 0.5835 4 1.2831 0.3208 0.6036 0.6610
Snw 4 4.5220 1.1305 0.2793 0.8907 4 4.0574 1.0144 0.2483 0.9101
4FingL 4 2.3127 0.5782 0.2894 0.8842 4 0.5621 0.1405 0.3025 0.8757
4ToeL 4 15.4688 3.8672 1.0240 0.3989 4 2.8556 0.7139 0.4292 0.7872
CrusL 4 19.1150 4.7787 0.6483 0.6294 4 1.5220 0.3805 0.3354 0.8535
ForefL 4 3.7860 0.9465 0.2603 0.9027 4 1.4872 0.3718 0.3248 0.8607
HindfL 4 36.3682 9.0920 1.0157 0.4032 4 3.7463 0.9366 0.4704 0.7574
LoArmL 4 24.4185 6.1046 0.7766 0.5431 4 1.6210 0.4052 0.2291 0.9214
SnForeL 4 138.3759 34.5940 0.7310 0.5730 4 42.8073 10.7018 0.7989 0.5288
TailH 4 43.2840 10.8210 1.7550 0.1442 4 9.9255 2.4814 1.7805 0.1390
TailL 4 2929.8532 732.4633 0.6505 0.6283 4 1616.6444 404.1611 0.7285 0.5753
TailW 4 8.8285 2.2071 0.6745 0.6113 4 2.6875 0.6719 0.5411 0.7059
TrunkL 4 91.0978 22.7744 0.4831 0.7481 4 30.3159 7.5790 0.5770 0.6800
UpArmL 4 9.7110 2.4277 0.6430 0.6331 4 3.7578 0.9394 1.0160 0.4031
UpLegL 4 35.9759 8.9940 1.2683 0.2878 4 6.3605 1.5901 0.8706 0.4846
CanthR 4 2.8504 0.7126 0.6347 0.6390 4 1.9353 0.4838 0.4558 0.7679
Eyelid 4 6.9810 1.7452 1.9294 0.1116 4 43572 1.8393 2.0673 0.0911
HeadSLn 4 2.5589 0.6397 0.1826 0.9470 4 2.7415 0.6854 0.1938 0.9411
HeadSTr 4 7.6648 1.9162 0.7963 0.5305 4 6.6723 1.6681 0.6886 0.6017
Inflab 4 1.2920 0.3230 0.3560 0.8393 4 1.2709 0.3177 0.3466 0.8458
SnS 4 2.3226 0.5806 0.3999 0.8083 4 PAPI 0.5568 0.3804 0.8221
Suplab 4 1.9375 0.4844 0.5645 0.6890 4 1.7392 0.4348 0.5079 0.7300
4FingLm 4 15.6652 3.9163 2.2782 0.0677 4 15.5661 3.8915 2.2371 0.0721
4ToeLm 4 8.0602 2.0151 0.6241 0.6466 4 8.5495 2.1374 0.6771 0.6098
VertS 4 77.0790 19.2698 1.3790 0.2470 4 74.8883 18.7221 1.3456 0.2588
MidbS 4 30.3863 7.5966 0.7433 0.5648 4 34.1770 8.5443 0.8404 0.5029
Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK
Philipp Wagner et al.
168
APPENDIX III. PCA loadings showing the correlations of the variables with each principal component.
EyeEar
HeadH
HeadL
Head W
Interorb
JawW
NarEye
SnEye
SnW
X4FingL
X4ToeL
CrusL
ForefL
HindfL
LoArmL
SnForeL
TailH
TailW
TrunkL
UpArmL
UpLegL
CanthR
Eyelid
HeadSLn
HeadSTr
Inflab
SnS
Suplab
VertS
MidbS
PCl
-0.75525
-0.67424
-0.86595
-0.60811
-0.59644
-0.70201
-0.55888
-0.70519
-0.35463
-0.38443
-0.69787
-0.85104
-0.66583
-0.85521
-0.82898
-0.17538
-0.64347
-0.60269
-0.30761
-0.43331
-0.70564
-0.23477
0.11221
0.10498
0.16085
-0.02711
0.07648
-0.33310
0.06534
-0.10086
PC2
0.16989
0.02346
0.05108
0.34174
0.11476
0.21499
0.10090
-0.06856
-0.21067
-0.31922
0.04033
-0.18965
-0.27931
-0.08047
-0.18214
-0.26259
0.18157
-0.16016
0.07998
-0.06371
0.15285
-0.39123
-0.43959
-0.55602
-0.79420
-0.70759
-0.48978
-0.42133
-0.62521
-0.28365
PC3
-0.22269
0.15873
-0.05904
-0.08501
-0.47778
-0.24915
-0.02613
-0.22104
-0.47750
0.19819
0.36659
0.16945
0.27745
0.29367
0.21096
0.10331
-0.09635
-0.55652
-0.55369
-0.07085
0.46822
0.51004
0.16014
-0.26430
-0.10576
-0.11644
-0.08728
0.00313
-0.06376
-0.28425
Females
PC4 PCS5
-0.01294 0.24323
-0.04942 -0.27829
-0.24969 0.21947
0.32551 0.48056
-0.01772 0.09550
0.23554 0.45903
-0.28023 -0.42155
-0.43262 -0.12481
-0.22143 -0.06374
-0.05155 -0.19096
0.28480 -0.24105
0.07265 -0.12514
0.37895 -0.22584
-0.00698 -0.26403
0.09452 -0.10009
-0.19321 0.63065
-0.16504 -0.03693
-0.17410 -0.04155
-0.06031 -0.19381
0.40439 0.15450
-0.12682 0.21040
-0.40430 0.38986
-0.15034 0.29433
0.18548 0.09349
0.03352 -0.03726
-0.01106 0.22691
-0.65324 -0.16930
0.24329 0.05218
0.38778 -0.06164
0.56212 -0.16698
PC6
0.00700
-0.22727
0.03273
-0.10907
0.27685
0.00286
0.25182
0.00138
0.13042
0.36051
0.21365
-0.10511
-0.19237
0.09581
-0.07696
0.35282
-0.10019
-0.17064
-0.36406
0.02603
0.16618
-0.18081
-0.58140
0.43481
0.14819
-0.00926
-0.09119
-0.32409
0.10847
-0.13425
PC7
-0.04300
0.08993
-0.01811
-0.07130
0.11750
-0.01674
-0.33016
-0.09491
-0.23115
0.01694
0.15823
0.11699
-0.02880
0.11081
0.16949
-0.17874
-0.21686
0.03768
0.40744
0.48463
-0.03706
-0.03345
0.20952
0.39520
0.18963
-0.06686
0.07348
-0.45256
-0.28200
-0.44121
PC8
0.11053
0.19408
0.09272
0.14145
-0.09362
-0.02673
0.26470
0.09595
-0.09282
-0.55210
0.07841
-0.03772
-0.06696
-0.02399
-0.02846
-0.32135
0.09744
-0.02758
-0.34864
-0.01337
0.02772
0.13267
0.01400
0.26326
0.16826
0.32044
-0.01296
-0.37246
-0.12152
0.24713
PC1
-0.49448
-0.54832
-0.77265
-0.48326
-0.53248
-0.54572
-0.63474
-0.70986
-0.25000
-0.52555
-0.50561
-0.80714
-0.72394
-0.74190
-0.82194
-0.32402
-0.71715
-0.69643
-0.35213
-0.59939
-0.64429
-0.14721
0.03388
0.34793
0.20249
0.13877
0.06954
0.38437
0.34780
0.14780
PC2
-0.02133
-0.40647
-0.07336
-0.13349
-0.15727
-0.29901
0.17902
0.02333
-0.25742
0.10494
0.24765
-0.18595
0.07031
-0.06006
-0.08915
0.51756
-0.20001
-0.28763
0.11127
-0.01912
0.00180
-0.37221
-0.40134
-0.22163
-0.54805
-0.57709
-0.67905
-0.44679
-0.57617
-0.49523
PC3
-0.44625
-0.24104
-0.15015
-0.62878
-0.34010
-0.45650
-0.17293
-0.03465
-0.19629
0.57245
0.49917
0.30386
0.27142
0.51220
0.15888
-0.08928
-0.15575
-0.09897
0.09077
0.31731
0.17486
0.18127
0.14306
0.53327
0.26218
0.12324
0.19148
0.02271
0.04991
-0.19489
Males
PC4 PC5
0.06837 0.03929
0.19018 0.23031
0.20683 0.16099
-0.01647 -0.22370
0.21315 0.30224
-0.07679 -0.14994
0.13905 0.08910
0.14698 0.33054
-0.12475 -0.33731
-0.09094 -0.13827
0.15975 -0.39533
-0.18112 -0.11203
0.03083 -0.17620
-0.10618 -0.19790
-0.11019 0.03200
-0.25167 0.23200
-0.18595 -0.07670
-0.28503 = -0.11902
-0.72006 0.21148
-0.03996 0.15214
0.04809 0.27442
0.70641 -0.14171
0.45892 -0.24158
0.00820 0.21020
-0.08652 0.39470
0.01809 0.09956
0.05743 0.30968
-0.36597 =: 0.12892
-0.33670 -0.23357
-0.28996 -0.35693
PC6
0.06267
0.17456
-0.15454
0.10301
-0.01767
0.01496
-0.22567
-0.28926
0.39429
-0.22248
0.23919
-0.15885
0.34152
-0.03208
-0.24464
0.49388
-0.00060
0.09819
0.17127
-0.08263
0.09823
0.22109
-0.00807
0.18253
-0.07070
0.31839
0.09565
0.19758
-0.30235
-0.21622
PC7
0.31731
-0.28018
0.19897
0.05942
-0.30404
-0.12911
-0.08849
-0.21731
-0.23871
-0.01199
-0.18324
0.04568
0.00254
-0.08698
-0.02479
0.04105
0.05789
0.15706
-0.08173
0.27742
0.30656
-0.00282
0.43340
-0.16753
-0.10593
-0.18659
0.05075
0.48938
-0.17845
-0.01141
PC8
0.13505
-0.06276
0.15761
0.01572
-0.06344
0.16814
0.35082
-0.13810
0.04083
0.16279
-0.03572
-0.07284
0.07634
-0.04896
-0.04130
0.08881
-0.17193
-0.31878
-0.20439
0.08373
0.31426
-0.10976
-0.19650
0.38285
-0.11181
0.23510
-0.09419
0.03290
-0.05054
0.48185
©ZFMK
Bonn zoological Bulletin 70 (1): 141-171
New Calotes Species from Mainland SE Asia
169
APPENDIX IV. Morphological variation in the type specimens of the Calotes mystaceus complex. Values given as mean +
standard deviation and minimum — maximum.
C. geissleri sp. n.
C. goetzi sp. n.
C. mystaceus
C. vindumbarbatus sp. n.
SVL
EyeEar
HeadH
HeadL
Head W
Interorb
JawW
NarEye
SnEye
SnW
4FingL
4ToeL
CrusL
ForefL
HindfL
LoArmL
SnForeL
TailH
TailL
TailW
TrunkL
UpArmL
UpLegL
CanthR
Eyelid
HeadSLn
HeadSTr
Inflab
C. bachae
holotype paratypes
(n=5)
90 85+8.22
74-97
5.30 5.19+41.2
3.91-7.15
14.88 14.444 2.24
12.19-18.22
21.80 20.84 + 3.26
16.92—25.72
17.04 15,57 £257
13.71—20.02
10.09 9.31 +4 1.45
7.85—11.69
15.00 14.40 + 2.06
12.62-17.94
6.16 5.544 1.21
3.75-6.97
10.44 9.54 + 1.46
7.58-11.54
5.45 5.37+0.92
4.06-6.56
11.79 10.28 + 0.84
8.88-10.94
15.08 13.47 + 1.09
11.83-14.59
1921 17.38 + 2.07
14.58-19.83
13.74 13.59 + 1.35
12.11-15.59
26.14 24.344 2.45
20.34—26.97
15.59 14.954+2.51
11.95-18.64
30 30.40 + 4.67
25.00-37.00
8.71 7.49 42.02
5.12-10.35
199 188.25 + 21.53
157-203
8.44 7.41 + 1.68
5.27-9.57
42 37.60 + 2.97
34-41
14.73 13.66 + 1.62
11.77-15.78
20.24 18.51 +2.78
14.85-21.83
9 8.8 + 0.84
8-10
14 13.2+0.45
13-14
17 IS a5145
14-18
16 16.4+ 1.34
15-18
11 10.2+ 0.45
10-11
holotype
110
6.95
17.45
24.89
20.81
9.92
19.32
7.38
11.71
6.49
13.56
18.59
22.83
17.67
31.58
19.73
Bonn zoological Bulletin 70 (1): 141-171
paratypes
(n= 4)
108 + 12.11
92-120
7.57 + 1.49
5.88-9.45
18.51 42.29
15.10-19.85
26.36 + 3.44
21.42-29.22
22.00 + 3.15
17.81—25.11
13.22 + 1.60
11.8-15.52
19.50 + 2.46
16.50—22.44
7.47+0.92
6.22-8 41
12.14+1.31
10.43—13.59
6.59 + 0.46
5.98-7.09
13.12+ 1.04
11.89-14.37
16.70 + 0.75
15.68-17.47
22:11. +253
18.49-24.22
17.144 1.57
15.13-18.44
29,70 22,22
26.46—31.53
18.46 + 2.22
15.40—20.60
35.50 + 4.65
30.00-41.00
12.09 + 2.87
8.11-14.42
203 + 17.78
189-223
11.78 + 1.08
10.17-12.35
54.25 + 4.57
49-59
17.64 + 1.97
15.98—20.09
22.43 + 2.46
19:23-25417
6+0
6-6
12.25 + 1.26
11-14
16+ 1.83
14-18
1640.82
15-17
10.5 + 1.29
9-12
holotype
118
8.20
26.81
29.60
25.35
12.73
20.02
LIS
13.76
£23
13.30
16.62
24.48
17.43
30.61
20.82
paratypes
(n= 2)
97.5+9.19
91-104
5.55 + 0.80
4.99-6.12
17.55 + 1.07
16.80-18.31
24.27 + 1.32
23.33—25.20
18.34 + 3.38
15.95—20.73
10.98 + 1.00
10.27—11.69
17.34 + 1.63
16.19-18.50
6.51 + 0.39
6.23-6.78
11.40+ 0.51
11.04—-11.76
6.17 + 0.49
5.82-6.52
12.12 +0.30
11.90-12.33
14.58 + 0.40
14.30-14.86
20.88 + 1.33
19.94—21.82
15.00 + 0.28
14.80-15.19
27.39 + 0.33
27.16—27.62
17.75 + 0.88
17.12—18.37
32.00 + 1.41
31-33
9.48 + 1.67
8.30—10.66
214+0
214-214
9.82 + 0.03
9.80-9.84
47.00 + 1.41
46-48
15.77 + 1.48
14.72-16.81
19.91+0.11
19.84-19.99
8.5+0.71
8-9
rae Ot
12-13
16+0
16-16
17.5+0.71
17-18
10.5+0.71
10-11
holotype
80
4.68
13.56
19.72
14.83
8.20
13.73
5.88
9.90
4.98
10.40
14.07
16.42
13.59
24.22
13.41
24
9.33
164
8.25
43
16.33
16.52
6
12
iS
Ls
10
holotype
77
4.89
12.33
18.43
14.05
8.56
12.63
5.33
8.63
aA bs
paratypes
(n=4)
61 + 13.95
47-73
3.79 1.09
2.41-4.71
10.21 42.23
7.95-12.15
15.11 +3.53
11.83-18.18
12.66 + 3.00
9.94-15.39
7.24 + 1.64
5.59-8.73
11.68 + 2.75
9.13-14.20
430+0.81
3.50—5.03
710+ 1.48
5.69-8.48
4.41 +0.68
3.70—5.06
7.57+41.27
6.46-8.91
11.01 + 1.96
8.60—12.86
12.75 +3.14
9.62-15.55
10.63 + 1.96
8.53-12.35
18.5+43.61
14.78—22.12
10.33 + 2.66
7.50-12.70
21.464 4.6
17.00—25.83
5.47 42.25
3.52-8.31
114 + 26.08
86-140
6.3+2.58
3.67-9.1
28.75 + 4.99
24-34
9.85 + 1.57
8.44-11.79
13.22+2.19
10.88—15.32
5.25+0.5
5-6
11.75 + 1.26
10-13
15.75+1.5
14-17
16.25 + 0.96
15-17
10.25+0.5
10-11
©ZFMK
170
APPENDIX IV. (continued).
SnS
Suplab
4FingLm
4ToeLm
VertS
MidbS
C. bachae
holotype paratypes
(n=5)
9 8.6+0.89
8-10
10 10.2+0.45
10-11
21 20+ 1.41
18—22
23 23.84 1.3
22-25
42 42+4.18
35—46
48 45.8+ 1.48
44-48
Philipp Wagner et al.
C. geissleri sp. n.
holotype
7
1]
24
28
44
50
Bonn zoological Bulletin 70 (1): 141-171
paratypes
(n=4)
6.75 +0.5
6-7
1140.82
10-12
20.25 + 2.06
18—23
25.2542.87
22-29
46.5 +3.7
42-50
55.545
50-62
C. goetzi sp. n.
holotype
7
50
52
paratypes
(n=2)
75+0.71
7-8
10+0
10-10
20+ 1.41
19-21
220-b OF]
22-23
47.5+4.95
44-5]
52+ 4.24
49-55
C. mystaceus
holotype
7
10
20
25
4]
44
C. vindumbarbatus sp. n.
holotype
7
40
50
paratypes
(n=4)
6.5+0.58
6-7
10.5+0.58
10-11
21+0.82
20-22
26+ 1.15
25-27
46.25+ 1.71
44-48
52.5+1.91
50-54
©ZFMK
New Calotes Species from Mainland SE Asia
171
APPENDIX V. Boxplots of selected characters of examined specimens of the different described species. A. Males. B. Females.
A
120
100
SVL
80
60
HeadW
20 25 30 35
15
10
B
120
100
SVL
80
60
18 20 22
HeadW
16
‘ Males
TailL.
C. bachae
C. geissleri sp.n.
T T
C. goetzi sp.n. Ic. vindumbarbatus sp.n.
C. mystaceus
.
VertS.
C. bachae C. goetzisp.n. | ©. vindumbarbatus sp.n.
C. geissleri sp.n.
: Females
C. mystaceus
+
TailL.
T
C. bachae
C. geissleri sp.n.
T T
C. goetzisp.n. |C. vindumbarbatus sp.n.
C. mystaceus
C. bachae
C. geissleri sp.n.
T T
C. goetzisp.n. | ©. vindumbarbatus sp.n.
C. mystaceus
Bonn zoological Bulletin 70 (1): 141-171
200
150
i
100
1
50
n
a
°
-
tees |b
HeadL
15
10
CT
—_
°
C. bachae
C. geissleri sp.n.
T T
C. goetzisp.n. |. vindumbarbatus sp.n.
C. mystaceus
C. bachae
C. geissleri sp.n.
T T
C. goetzi sp.n. C. vindumbarbatus sp.n.
C. mystaceus
45
L
C. bachae C. goetzisp.n. | ©. vindumbarbatus sp.n.
C. geissleri sp.n.
60
Te
mL
o
+
C. mystaceus
——
+
T
C. bachae
C. geissleri sp.n.
T T
C. goetzisp.n. | ©. vindumbarbatus sp.n.
C. mystaceus
200
25
2 o | as
—— — 8 8
8
to)
8
T T T T T T
C. bachae C. goetzisp.n. |C-. vindumbarbatus sp.n. C. bachae C. goetzisp.n. | ©. vindumbarbatus sp.n.
C. geissleri sp.n.
C. mystaceus
40
1
54
+
MidbS
52
wotaae
©
+
C. geissleri sp.n.
C. mystaceus
i
a
C. bachae
(os goetzi sp.n. |C vindumbarbatus sp.n.
C. geissleri sp.n.
C. mystaceus
C. bachae
C. geissleri sp.n.
C. goetzi sp.n. | C. vindumbarbatus sp.n.
C. mystaceus
©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 70 (1): 173-199
2021 - Handfield L. & Handfield D.
https://do1.org/10.20363/BZB-2021.70.1.173
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org:pub: D0O3E2C9D-73A8-4A A0-89F8-EE2C3E241451
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863
(Lepidoptera: Crambidae: Spilomelinae: Herpetogrammatini),
with descriptions of three new species
Louis Handfield’* & Daniel Handfield?
'845 de Fontainebleau, Mont-Saint-Hilaire, Québec, Canada, J3H 4J2
?94 Chemin Bonnaly, Orford, Québec, Canada, J1X 6S3
“Corresponding author: Email: [email protected]
'urn:|lsid:zoobank.org:author:7D9385 1 B-DASE-4E50-B5 12-51 A98AD2549C
2 urn:|sid:zoobank.org:author: 7 D060A75-CD6A-4FB7-9DE2-5DS57FCFF5D1C
Abstract. The genus Herpetogramma Lederer in Canada is revised to include ten species of which three are new: H. aqui-
lonalis sp. n., H. fraxinalis sp. n., and H. nymphalis sp. n. Keys to the Canadian species of Herpetogramma are includ-
ed as well as descriptions, distribution, biology and illustrations of adults and genitalia. Herpetogramma abdominalis
(Zell.,1872) syn. n. and H. fissalis (Grt., 1881) syn. n. are synonymized with H. thestealis (Walker, 1859) here.
Key words. Herpetogramma, abdominalis, aeglealis, aquilonalis, bipunctalis, fluctuosalis, fraxinalis, nvmphalis, pertex-
talis, phaeopteralis, sphingealis, theseusalis, thestealis, Canada, distribution, biology, hostplants.
INTRODUCTION
In February 1967, when my mother (LH) gave me $20
to buy a used copy of Holland’s Moth Book (1903), I
acquired a very precious tool (at the time, the only rare
and costly book available for amateurs) to identify the
moths of my then small collection begun at my parents’
home in Mont-Saint-Hilaire (Québec). But my identifica-
tion problems were not all solved as, amongst others, one
of my specimens of a small moth looking like the moth
illustrated on plate 47: 54 of Holland’s book as Pyrausta
pertextalis (Lederer, 1863) was similar, but not the same
as my specimen. I continued to search for a better answer,
but without finding any. The problem remained unsolved
and was forgotten until 2004, when a lot of Herpetogram-
ma Lederer, 1863 of a very dark form (now known as
H. sphingealis Handfield & Handfield, 2011) were col-
lected at Rougemont, Québec. This reminded me of my
original problem and led me to return to that old Her-
petogramma specimen. As this specimen could still not
be identified, we decided to collect more specimens of
this genus and attempt to provide some resolution to this
problem.
After many years of collecting hundreds of Herpeto-
gramma specimens, studying and searching for more in-
formation, we found out that this difficult group could
only be resolved with the help of the DNA barcoding and
genitalia dissection, the latter being carried by Dr J. Don-
ald Lafontaine. We hope that this revision of the species
Received: 28.01.2021
Accepted: 05.05.2021
known to occur in Canada will help future studies of this
complex genus.
Herpetogramma sphingealis having been described in
2011, we then decided to tackle the rest of the Canadian
species of Herpetogramma. It was not an easy task, but as
we collected hundreds of specimens in Québec between
2004 and 2019, and we were able to study photographs of
all types specimens associated with the existing names,
SO We can now come to a conclusion.
The first lepidopterist who tried to resolve that group
was Forbes (1923) in his treatment of the Lepidoptera
of New York and neighboring States, part 1 (under the
broader genus Pyrausta). In his North American list of
species Munroe (1983) attempted to resolve the taxono-
my of Herpetogramma of the region in providing many
new combinations. Solis (2010) published an illustrated
list of the North American species of Herpetogramma,
but it did not give the information needed to resolve is-
sues with the identification of some of the species occur-
ring in Canada or the United States. After our description
of Herpetogramma sphingealis in 2011, we continued to
collect and study the species occurring in Canada. This
was aided by sending many of our Canadian Herpeto-
gramma to the Canadian Centre for DNA Barcoding Data
(“BOLD”) for DNA barcoding and this gave us a clearer
view of this difficult genus. With the additional charac-
ters of the male vesica and other genitalia characters, we
are now able to present our conclusions pertaining to the
identifications of the species of Herpetogramma known
Corresponding editor: M. Espeland
Published: 13.05.2021
174 Louis Handfield & Daniel Handfield
to occur in Canada and add three new species of Herpe-
togramma to the list of North American species.
In the present paper, the word “Newfoundland” does
not include “Labrador” and vice-versa.
MATERIAL AND METHODS
Repository abbreviations
Specimens were examined from the following collec-
tions:
AC = Personal collection of Alain Charpentier,
Saint-Hyacinthe, Québec, Canada
American Museum of Natural History,
New York, USA
Natural History Museum (formerly British
Museum of Natural History) [BMNH]),
London, UK
Canadian National Collection of Insects,
Arachnids, and Nematodes, Ottawa,
Ontario, Canada, including the collections
of Léo-Paul Landry, Michel Pratte, and
parts of the collections of Alain
Charpentier and Bernard Landry
Cornell University Insect Collection,
Cornell University, Ithaca, New York,
USA
Personal collection of Daniel Abraham
and Nathalie Michel, Saint-Pierre,
Iles-Saint-Pierre-et-Miquelon, France
Personal collection of Daniel Handfield,
Orford, Québec, Canada
Personal collection of Eric Rassart,
Brossard, Québec, Canada
Lyman Entomological Museum, McGill
University, Sainte-Anne-de-Bellevue,
Québec, Canada
Personal collection of Louis Handfield,
Mont-Saint-Hilaire, Québec, Canada
Personal collection of Norman Handfield,
Mont-Saint-Hilaire, Québec, Canada
Naturhistorisches Museum Vienna
(Natural History Museum), Vienna,
Austria
Personal collection of Normand Juneau,
Saint-Maurice, Québec, Canada
E.H. Strickland Entomological Museum,
University of Alberta, Edmonton, Alberta,
Canada
Collection Ouellet-Robert, Université de
Montréal, now Centre de la Biodiversité,
Montréal, Québec, Canada
National Museum of Natural History
(formerly United States National
Museum), Washington, USA
AMNH
NHMUK =
CNC =
CUIC =
DANM
DH =
ER =
LEM =
LH =
NH =
NHM =
NJ =
SEM =
UM =
USNM =
Bonn zoological Bulletin 70 (1): 173-199
Dissecting methods and genital terminology.
Dissections of genitalia and terms for genital structures
and wing patterns and markings follow Lafontaine
(2004) and the terminology used in the Moths of America
North of Mexico (MONA) series, few exceptions follow
Kristensen, Niels P. (2003).
Diagnosis of genus in North America
Herpetogramma Lederer, 1863
Type species: Herpetogramma servalis Lederer, 1863, by
monotypy.
Even if the genus Herpetogramma is worldwide in dis-
tribution (Solis 2010), we have restricted our research
to North America — mostly to Canada — as there are so
many discoveries remaining to be made and also so many
habits of these fantastic species remain unknown. Even
for American species, very few details are known as to
the biology of Herpetogramma (Solis 2010). The latter
is the only author who has tried to shed light on that mat-
ter. Larvae of our species, so far as known (Solis 2010),
are mostly general feeder, especially on herbaceous low
plants, no one in Canada are of economic importance
(Solis 2010).
The last treatment of North American species of Her-
petogramma (Scholtens & Solis 2015) lists ten species
for the North American fauna including the species we
added in 2011 (Handfield & Handfield 2011). With the
present revision, the total number of known North Amer-
ican species is now thirteen of which ten occur in Canada.
Adult. Medium-sized moths with a wingspan of
25-37 mm. The three basic forms in North America
(H. phaeopteralis, H. bipunctalis, and H. theseusa-
lis) have a pale gray-brown or creamy-brown forewing
ground colour with a relatively simple forewing pattern
consisting of darker, slightly wavy, antemedial, postme-
dial, and subterminal lines, and solidly dark reniform and
orbicular spots. The other species have a more complex
pattern with the veins usually lined in dark shading, the
basal and antemedial lines zigzagged, the postmedial and
subterminal lines scalloped between the veins, and the
terminal line even along the outer edge of the forewing;
the orbicular and reniform spots are dark and either solid,
or with a pale center. The hind wing has a similar pattern
to that of the forewing, although usually paler, and the
orbicular and reniform spots are replaced by an elongated
discal spot.
Male genitalia. Valva elongated, elliptical; lightly
sclerotized, except for narrow sclerotized rod-like brace
on dorsal margin, angled at one-third from base, and short
rod along basal '4 of ventral margin, densely covered
with hairlike setae. Uncus about 4 x length of valve, ta-
pered gradually to a densely setose apex. Vinculum with
pair of short eversible coremata each covered with mass
©ZFMK
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 175
of fine hair-like setae that are longer than valves. Phallus
relatively lightly sclerotized, especially dorsally, usually
7-10 x medial width; eversible vesica 0.65—0.95 x length
of phallus; vesica with one or two basal diverticula, and a
large spiny diverticulum at % or *%4 from base.
Female genitalia. Anal papillae elongated, narrow,
densely setose; posterior apophyses as long as height of
anal papillae; ductus bursae narrow 4—’2 x length of cor-
pus bursae; corpus bursae narrow posteriorly, broad and
oval anteriorly, anterior part 1-7 x as long as narrower
posterior part of corpus bursae. Large posterior part of
corpus bursae covered with minute sclerotized spicules
that are concentrated to form a double-pouched signum
toward posterior end.
DNA Barcoding tree
With the help of BOLD (Barcode of Life Database),
many specimens of all Herpetogramma morpho-species
could be DNA barcoded, and it appears that the genus
Herpetogramma is more complex and diversified than
was previously suspected (see Appendix 1).
Key to Canadian species of Herpetogramma (external
markings of adults)
1. Abdomen with two dark dots dorsally on second
segment, small dark discoidal spot on hindwing;
wingspan 23—24 mm ............00 cee H. bipunctalis
— Abdomen without these two dark dots or the small
GARACISCOIDAL SDO ls. :.careoms aad ae ni dl delat eas 2,
2. Forewings narrow; wingspan about 20 mm .............
pp Ia cts re ene LE: Cn eee at H. phaeopteralis
— Forewings broader; wingspan 25—37 mm............... 3
3. Reniform spot black, kidney shaped..........0...0000.... 4
— Reniform spot square, often with paler center ........ 6
4. Hindwing with an even, thin, gray-brown terminal line
near margin; wingspan 25—27 mm..... H. theseusalis
— Hindwing subterminal line somewhat checkered,
usually projecting into hindwing fringe as dark dots
a
5. Hindwing with dark gray-brown bands contrasting
with paler ground colour; wingspan 27—33 mm ......
a orl Ce 2 Bec a I) ae PN, Ph Joe. 3 H. aeglealis
— Hindwing dark gray brown; wingspan 31-37 mm....
H. sphingealis
6. Terminal and subterminal lines on hindwing absent;
wingspan 29-32 mm. ............00.... H. fraxinalis sp. n.
— Terminal and subterminal lines on hindwing gray
brown; subterminal line scalloped between veins... 7
7. Terminal line on hindwing barely marked, usually
represented by minute dots on wing veins; wingspan
ge a M00) 00 Lng My oe 20. eae ts H aquilonalis sp. n.
— Terminal line on hindwing continuous, gray brown
Bonn zoological Bulletin 70 (1): 173-199
8. Forewing with reniform and orbicular spots pale
gray brown, concolourous with other markings on
forewing; wingspan 23—24 mm .......... H. pertextalis
— Forewing with reniform and orbicular spots
contrastingly dark, beeing darker than other forewing
Td Ge AGG pe see, ah A aad cee ns LR Re BS AEE, ,
9. Inner margin of subterminal line on hindwing deeply
scalloped between veins; wingspan 29-33 mm .......
AY. Pepe i leetmereen ypc epee Mive bere seth H. thestealis
— Inner margin of subterminal line on hindwing slightly
scalloped between veins; wingspan 26—27 mm .......
Wi § CR ERROR at ME ES cies A H. nymphalis sp. n.
Key to Canadian species of Herpetogramma (male
genitalia)
1. Vesica with single basal diverticulum...............00.... 2
— Vesica with basal and medial or _ subapical
CIV CILICHI AA Axia as A errhi ic eee eA Ree ree | 4
2. Vesica enlarged toward apex.......... H. phaeopteralis
— Vesica cylindrical, of even girth for whole length .. 3
3. Vesica projecting posteriorly from apex of phallus...
silts nea EEN ee at UTR eat cea dee ate H. theseusalis
— Vesica curved at end of phallus to project ventrally .
Baccus SRRare : eenneaices amines 2 se. aa H. bipunctalis
4. Vesica with spiny diverticulum at % distance to
apex of vesica; with two diverticula at base, an
elongated one on right side and a small bubble-like
diverticulum one dorsally ........0.000ccccccecceeteeeeee 5
— Vesica with spiny diverticulum at % distance to apex
of vesica; with one diverticulum at base on right side
with a narrow finger-like secondary one projecting
PROUT 105s. . hk ac oe anh IM one eae Ure eet ee aos 8
5. Vesica straight at position of spiny diverticulum. ......
Lame inctua Dh Be Pie sae va See iar Se oe na okt ba th H. pertextalis
— Vesica angled at position of spiny diverticulum ..... 6
6. Two separate diverticula at base of vesica on right...
Pi, Oe = AeA Man sorrel ha hee te Pay, ED H.. aquilonaris sp. n.
— Single elongated diverticulum at base of vesica on
(5620 Paes Ste eT NN , Wienaee BO, We ed 7
7. Basal diverticulum on right side of vesica elongated
LO PLOJECE POSTSMIOT] Voki. itses Myr scgvsaniceens H. thestealis
— Basal diverticulum on right side of vesica anvil
shaped, projecting anteriorly and posteriorly............
a Poe Neh ae eee ol hae ee H. fraxinalis sp. n.
8. Phallus 8.0-8.8 x as long as its medial width of
[O)OC=t NDEs Mastic ae bone Ud coapbiacin akan haa hii ,)
— Phallus 10.0—10.6 x as long as its medial width of
12) OY 1 LPNS Mie Revs cee esl Sere te EP SPR NE H. sphingealis
9. Distance between end of phallus and base of dorsal
diverticulum 0.5 length of phallus .......0.000.
Med Ricans Rie Ieee Wie cnt chao sR H. nymphalis sp. n.
— Distance between end of phallus and base of dorsal
diverticulum 0.25—0.3 length of phallus .................
se Ee ater Pe eneenlt pet. fs an bots Perm H. aeglealis
©ZFMK
176 Louis Handfield & Daniel Handfield
Note for new names
All names herein for new species are names in apposi-
tion.
Species account
Herpetogramma phaeopteralis (Guenée, 1854) (801196,
MONA 5274)
Pl. 1, Figs 1 (4), 2 (Q) (adults); Pl. 4, Figs 35-36
(¢ gen.); Pl. 7, Fig. 55 (Q gen.).
Synonyms. As listed by Solis 2010; Scholtens & So-
lis 2015: Botys vecordalis Gn., 1854; Botys ostreonalis
WIk., 1859; Botys vestalis W\lk., 1859; Botys additalis
WIk., 1862; Botys plebejalis Lederer, 1863; Botys cella-
talis W\k., 1866; Botys communalis Snellen, 1875; Botys
intricatalis Moschler, 1890; Acharana descripta Warren,
1892. For Botys neloalis W\k. and Botys triarialis Wk.,
“these names and the type specimens associated with
them need to be re-evaluated with respect to the North
American fauna” (Alma Solis, in /itt., 30.1v.2018).
Type material. | 3. Cayenne, French Guyana, lecto-
type in NHML [NHMUK] (Solis 2010).
Diagnosis. This is a generally uniformly medi-
um-brown species having a wingspan of generally
20 mm, without any special markings except for the usu-
al black transverse lines, with a long, black, nearly half-
moon-shaped reniform spot and a small, black, rounded
orbicular spot; there is no pale patch between the orbic-
ular and reniform spots. The forewing narrower than in
other soecies; the hindwing is similar in colour or slightly
paler than the forewing; there is no sexual dimorphism.
Solis (2010: figs 10-11) illustrates a male and a female.
Male genitalia. Figs 35-36. Valvae and genital capsule
generally as described for genus, except sclerotized rod
extending along basal third of ventral margin of valva
more heavily sclerotized than in other species. Vesica ex-
tending posteriorly from phallus, 0.8 x length of phallus,
vesica larger posteriorly, with single dorsal subbasal
diverticulum. Female genitalia. Fig. 55. Large anterior
part of corpus bursae elongated with length about 1.7 x
width, 2 x length of narrower posterior part, and 1.5 x
length of ductus bursae.
Distribution. In the North, it is a rare migrant. Only
five specimens are known from Canada: Ontario: “Cave
west side of lake Mindemoya, Manitoulin Island, 21—
22.x.1979, 4 34, John K. Morton;” and “Lambton Co.,
Port Franks, 18.x.2014, one 9, Kenneth H. Stead” [iden-
tification confirmed by BOLD] [in CNC]. Common from
southern United States southward through the Caribbe-
an region and Central and South America (BOLD, Solis
2010). In BOLD, there are barcode records from Florida,
Oklahoma, South Carolina (Myrtle Beach), Texas, Bo-
livia, Costa Rica, Honduras, Jamaica, Mexico, Peru, and
Brazil. Solis (2010) lists Brazil, Colombia, French Guy-
ana (Cayenne), Haiti, Jamaica, Puerto Rico, and Vene-
zuela. In the United States, it flies in May and June, and
from mid-August to December (Solis 2010). It 1s com-
monly known as the “tropical sod webworm.”
Biology. The larva feeds on St. Augustine grass [Sten-
otaphrum secundatum] (Poaceae) and centipede grass
[Eremochloa ophiuroides| [Poaceae] (Allyson 1984);
also on bermudagrass [Cynodon ssp.|, seashore paspal-
um [Paspalum vaginitium], carpetgrass [Axonopus ssp. |,
zoysiagrass [Zoysia japonica], bahiagrass [Paspalum no-
tatum| and creeping bentgrass [Agrotis stolonifera] (all
Poaceae) (Tofangsazi et al. 2012 rev. 2015). In the Unit-
ed States, the larvae are pests on new lawns, turfgrass,
golf courses, and athletic fields (Tofangsazi et al. 2012
rev. 2015). As the moth is only a rare migrant in Canada,
there is no special habitat in Canada, but the moth prefers
open grassy habitats. It is a nocturnal species, flying from
dusk and comes to light.
Note. According to Shaffer & Munroe (2003), H. phaeo-
pteralis (Gn., 1854) is a New World species that is not
present in the Old World (Europe, Africa, Asia, Ocea-
nia). The data for H. phaeopteralis in the literature for
the Old World list Africa, islands in the Indian Ocean (for
La Réunion, see Guillermet 2009), Asia, Korea (see Bae
et al. 2008). However, all needs to be re-evaluated and
verified (Alma Solis, in litt., 30.iv.2018) because these
records likely refer to H. licarsisalis (Wlk., 1859) (TL
Sarawak, Borneo) which is the Old World species (spec-
imens in CNC of H. Jicarsisalis are from Belgian Congo
[Democratic Republic of Congo], Hawaii [USA]), India
[Republic of India], Japan, Malacca, Samoa Island, Sik-
Figs 1-12 (opposite page). 1. Herpetogramma phaeopteralis 3, CNCLEP00212001: Canada, ON, Manitoulin, The Cave W side,
Lake Mindemoya, 21.x.1979, J. K. Morton. 2. Herpetogramma phaeopteralis 2°, CNCLEP00212002: Canada, ON, Lambton, Port
Franks, 18.x.2014, K.H. Stead. 3. Herpetogramma bipunctalis 6, CNCLEP00212003: Canada, QC, St-Hyacinthe, 4865 rue Mari-
court, 45.609426° N, 72.978514° W, 01.x.2016 at light, Alain Charpentier. 4. Herpetogramma bipunctalis 2°, CNCLEP00212004:
United States, SC, Myrtle Beach, 10.x.1965, A. C. Sheppard. 5. Herpetogramma theseusalis 3, CNCLEP00212005: Canada. QC,
south end of Pike Lake, Manitoulin Is., 7.viii.2008, J. K. Morton. 6. Herpetogramma theseusalis 9°, CNCLEP00212006: Canada,
ON, Rockville Junction Bog, Bidwell Rd, Manitoulin Is., 29.vi.1991, J.K. Morton. 7. Herpetogramma aquilonalis sp. n. Holotype,
3, CNCLEP00212007: Canada, QC, Mont Rougemont, Rougemont, 45°27.89’ N, 73°04.52’ W, 14.vii.2008, D. Handfield. 8. Her-
petogramma aquilonalis sp. n. 3, CNCLEP00212008: Canada, QC, Lanoraie, Tourbiére de Lanoraie, 45°59.50’ N, 73°16.60’ W,
5.vii.2016, D. Handfield. 9. Herpetogramma aquilonalis sp. n. 2°, CNCLEP00212009: Canada, QC, Lanoraie, Tourbiére de Lan-
oraie, 45°59.50’ N, 73°16.60’ W, 5.vii.2016, D. Handfield. 10. Herpetogramma aquilonalis sp. n. 2°, CNCLEP00212010: Canada,
QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 14.vii.2008, Louis Handfield and Daniel Handfield. 11. Herpeto-
gramma aquilonalis sp. n. 3: United States, NY, Ithaca, Snyder Heights, 15.vii.1977, 1,100 ft, J.G. Franclemont (CUIC). 12. Her-
petogramma aquilonalis sp. n. 9: United States, NY, Ithaca, Snyder Heights, 22.vii.1977, 1,100 ft, J.G. Franclemont (CUIC).
Bonn zoological Bulletin 70 (1): 173-199 ©ZFMK
177
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863
©ZFMK
Bonn zoological Bulletin 70 (1): 173-199
178 Louis Handfield & Daniel Handfield
kim [Republic of India], Taiwan and Tonkin [Vietnam].
A barcode analysis (BOLD) (23.111.2021) shows a large
divergence between Australian specimens of H. Jicarsi-
salis and South American specimens of H. phaeopteralis.
Herpetogramma bipunctalis (Fabricius, 1794) (801193,
MONA 5272)
Pl. 1, Figs 3-4 (adults); Pl. 4, Figs 37-38 (3 gen.).
Synonyms (as listed by Solis 2010, Scholtens & So-
lis 2015). Botys detritalis Gn., 1854; Botys lycialis Wk.,
1859; Botys philealis Wlk., 1859; Botys terricolalis
Moschler, 1881; Botys repetitalis Grote, 1882; and Botys
simplex Warren, 1892.
Type material. | < from the “West Indies” [Carribean
region] (Surinam in original description) in ZMUC (Zo-
ological Museum, Copenhagen, Denmark) (Solis 2010).
Diagnosis. This well-known species is a pest of culti-
vated beets in the South where it is known as the “south-
ern beet webworm.” Specimens generally have a wing-
span of 23—24 mm; there is no sexual dimorphism and
the species is highly variable in colour pattern being light
brown, cream, or even whitish, but 1s characterized by
the solid, black, reniform and orbicular spots, without a
white or cream-coloured bar between them as in some
other Herpetogramma species. It 1s most easily identi-
fied by the two dark spots on the dorsum of the second
abdominal segment; also there is a small dark discoidal
spot on hindwing. The name bipunctalis refers to the
two black dots on the forewing that plays the role of the
orbicular and reniform. Solis (2010: figs 4—5) illustrates
a male and a female of H. bipunctalis. Male genitalia.
Figs 37-38. Valves and genital capsule as described for
genus. Vesica projecting ventrally from apex of phal-
lus; vesica 0.8 x length of phallus, with single ventral
subbasal diverticulum. Female genitalia. Recently de-
scribed in fig. 150 in Landry (2016).
Distribution. In the North of North America, this is a
rare migrant. Only a few records are known from Qué-
bec: Sainte-Christine, (21.1x.2003, coll. DH [identifica-
tion confirmed by BOLD]); Montréal (22.1x.1957, A.C.
Sheppard); Pincourt (Ile Perrot) (24.ix.1970, V. R. Vick-
ery) (LEM); St-Hyacinthe (4865 Maricourt, 1.x.2016,
Alain Charpentier) (CNC). Records from Ontario include
a migratory flight recorded in 2016 (Long Point and Port
Franks; Kenneth Stead, pers. comm.) and at Ottawa (No-
lie Schneider, pers. comm.). No records are known from
elsewhere in Canada. It is a species generally present in
the mid-eastern and southeastern United States. Records
in BOLD are from Florida, Oklahoma, Tennessee and
Texas (United States of America) and Mexico. The spe-
cies 1s common in agricultural areas where the hostplants
are cultivated. Adults occur from August to December. It
is nocturnal, coming to light and easily flushed during the
day from low vegetation.
Biology. The larva feeds on cultivated beets (Che-
nopodiaceae), cauliflower and cabbage (Brassicaceae),
cabbage (Brassicaceae) and weeds, also feeds especial-
ly on species of Amaranthus (Amaranthaceae), eggplant
(Solanum melongena [Solanaceae]) and beet (Beta vul-
garis [Amaranthaceae]) (Allyson 1984). Specimens in
the USNM were reared from Amaranthus sp., Ambrosia
sp. (Asteraceae) and soybean (Glycine max [Fabaceae])
(J. D. Lafontaine, personal communication, October
2018). The species seems to have found a new hostplant
and feed on the invasive A/ternanthera philoxeroides
(Amaranthacea) in Florida and neighboring States (Hep-
pner 2003); it attacks the parts of the plant that are above
the water level (Lara- Villalon et al. 2014). As the moth is
migratory in Canada, there is no special habitat in Cana-
da, but it 1s generally found in open areas.
Herpetogramma theseusalis (Walker, 1859) (8011200,
MONA 5279)
Pl. 1, Figs 5-6 (adults); Pl. 4, Figs 39-40 (¢ gen.); PI. 7,
Fig. 56 (9 gen.).
Synonymy. feudalis Grote, 1875 (Botis) (Solis, 2010)
(Scholtens & Solis 2015).
Type material. Botis theseusalis Walker, 2 holo-
type from “United States” in NHMUK; Botis feudalis
Grote, 3 lectotype from New York or Massachusetts in
NHMUK by Solis 2010.
Figs 13-24 (opposite page). 13. Herpetogramma fraxinalis sp. n. Holotype 4, CNCLEP00212011: Canada, QC, Mont Rougemont,
Rougemont, 45°28.026’ N, 73°04.29’ W, 5.viii.2009, D. Handfield. 14. Herpetogramma fraxinalis sp. n. 2°, CNCLEP00212012:
Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 29.vii.2008, Louis Handfield and Daniel Handfield.
15. Herpetogramma fraxinalis sp. n. 4, CNCLEP00212013: Canada, QC, Brome-Missisquoi, St-Armand, Domaine Baie-Mis-
sisquol, 18.vili.2000, B. Landry. 16. Herpetogramma fraxinalis sp. n. 9, CNCLEP00212014: Canada, QC, Mont Rougemont,
Rougemont, 45°28.026’ N, 73°04.29’ W, 29.vii.2008, Louis Handfield and Daniel Handfield. 17. Herpetogramma thestealis &,
CNCLEP00121457: Canada, QC, Gatineau Park, Luskville Falls, creek below picnic ground, 45.5333° N, 75.9955° W, 25.vii.2014,
J.F. Landry and B. Landry. 18. Herpetogramma thestealis 2°, CNCLEP00212016: Canada, QC, St-Valérien-de-Milton, Tourbiere
de St-Valérien, 45°32.55’ N, 72°40.24’ W, 2.viii.2005, Daniel Handfield. 19. Herpetogramma thestealis 3, Canada, QC, Mont
Rougemont, Rougemont, 45°28.026’ N, 73°04.29? W, 25.vii.2008, Louis and Daniel Handfield. 20. Herpetogramma thestealis
9, Canada, QC, Otterburn Park, Les Bosquets Hudon, 5.viii.2008, Louis and Daniel Handfield. 21. Herpetogramma pertextalis
3, CNCLEP00212017: Canada, ON, Simcoe, 27.vi.1935, T.N. Freeman. 22. Herpetogramma pertextalis 3, CNCLEP00212018:
Canada, QC, Lac Trousers, 495 rte Mississiquoi, 45°24.86’ N, 72°35.25’ W, 1.viit.2011, Daniel Handfield. 23. Herpetogramma
pertextalis 2°, USNMNH 208285: United States, NY, Six Mile Creek, 31.v.1957, J.G. Franclemont. 24. Herpetogramma pertextalis
2, CNCLEP00121794: Canada, ON, Lambton Co., Port Franks, 28.1x.2014, K.H. Stead.
Bonn zoological Bulletin 70 (1): 173-199 ©ZFMK
179
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863
©ZFMK
Bonn zoological Bulletin 70 (1): 173-199
180 Louis Handfield & Daniel Handfield
Diagnosis. This well-known species has all four wings
concolourous with buff brown (rarely light brown),
except for slightly darker margins; wingspan usually
25 mm; the antemedial line is black and nearly straight,
with no light-coloured patch between the reniform and
orbicular spots; the reniform spot is a black bar, some-
times outwardly convex; the orbicular spot is a rounded
black dot; the apex of the forewing is more squared, not
acutely angled as in other species; the postmedial line
is black, sinuous, and strongly bent below the cell, as
in most Herpetogramma species; the abdomen, thorax,
and head, are of the same colour as the wings; the palpi
are short (Forbes 1923). There is no sexual dimorphism.
Solis (2010: fig. 12) illustrates a male. Male genitalia.
Figs 39-40. Valves and genital capsule as described for
genus. Vesica extending straight posteriorly from phal-
lus, 0.7 x length of phallus, with single dorsal subbasal
diverticulum. Female genitalia. Fig. 56. Large anterior
part of corpus bursae with length about 2 < width, about
4 x length of narrower posterior part, and 2 x length of
ductus bursae.
Distribution. In Canada Herpetogramma theseusa-
lis is only known by a few specimens from Southern
Québec (incl. Saint-Hilaire mountain [in Mont-Saint-
Hilaire]), Eastern Ontario, New Brunswick (Cormier-
ville, Cocagne Co., 29.vi1.2015 [Bug Guide, 20.1x.2020])
and Nova Scotia (near Sherbrooke, 11.vii.2017) [Butter-
flies and Moths of North America, accessed 20.1x.2020].
In the United States, it is known from Maine, Massachu-
setts, New York, and Pennsylvania; farther south it is
recorded from Maryland, Delaware, and Virginia south-
ward to Florida, and along the Gulf of Mexico to Texas.
Specimens barcoded and available on BOLD form two
different Barcode Index Numbers (BINs), suggesting the
existence of two species there, one in the North being the
typical one, and another one in Southern United States,
Only four specimens have been submitted to BOLD and
these are from Québec, Ontario, South Carolina, and
Florida. The types of feudalis are from New York and
Massachusetts (Solis 2010) and consequently feudalis is
considered a synonym of the typical northern H. theseu-
Salis (Solis 2010).
Biology. The larva rolls the tips of various ferns (Forbes
1923) “rolling up fronds into round balls” (Winn 1912, p.
79), and especially Thelypteris palustris (Thelypterida-
ceae) [Specimens in the USNM] (Solis 2010) and LEM
(Hertel lake [on mountain of Saint-Hilaire, Mont-Saint-
Hilaire, Québec [handwritten note on A.C. Sheppard’s
working copy of Winn List]). Thelypteris palustris is a
common fern in eastern North America occurring from
Québec to Florida. The larva also feeds on Osmunda
cinnamonea (Osmundaceae) (East Concord, New York
[CUIC]) and on Onoclea sensibilis (Dryopteridaceae)
in Maine (Adams & Morse 2014), both common ferns
in Eastern Canada. In Maryland, the larva feeds also on
Woodwardia areolata (Blechnaceae) (Maryland Biodi-
versity Project, accessed 20.1x.2020), a fern known only
from southern Nova Scotia in Canada, and then from
Massachusetts to Florida, and along the Gulf of Mexico
to Louisiana and eastern Texas (Lady Bird Johnson Wild-
flower Center, Texas, accessed 20.1x.2020). The moth is
associated with mesic habitats, bogs (like the Lanoraie
bog in Québec), open boggy habitats, and lake and river
shorelines. It is nocturnal and comes to light.
Herpetogramma aquilonalis sp. n.
urn: |sid:zoobank.org:act:89F 000D3-83 DE-4CEC-A9F8-55A4E33D8CEA
Pl. 1, Figs 7-12 (adults); Pl. 4, Figs 41-42 (3 gen.); Pl. 7,
Fig. 57 (2 gen.).
Type material. Holotype <6. Canada: Québec:
Rougemont, montagne [mountain] [45°28’026” N,
73°04’029” W], 14.vu1.2008, Daniel Handfield collection
[MDH006455]. Deposited in CNC.
Paratypes. (54 34, 38 29): Canada: Québec: [Daniel
Handfield Collection]: Canton de Magog, lac Lovering,
25.vii.2002 (1 4); Chambord, usine Louisiana Pacifique,
16.vii.2001 (1 4); Franklin, Réserve écologique du Pin-
Rigide, 5.vii.2013 (1 3), 17.vii.2013 (1 4); Lac Trou-
sers, 495 Route Missisquoi, 2.viii.2011 (3 33); Lano-
raie, tourbiéres de Lanoraie [bogs], 3.vii.2007 (1 ©),
16.vii.2007 (1 @), 24.vi.2016 (2 03), 5.vii.2016 (13 33)
, 23.vii.2016 (4 OQ), 5.vii.2016 (11 99), 23.vii.2016
(7 9°); Lac Granet, chalet de la SEPAC, 5.viii.2014
(1 3); Grand-Remous, club du lac Brilé, 5.viii.2010
(3 &4); La Présentation, 5e rang, 17.vii.2002 (1 3);
Hemmingford, chemin Covey Hill, 22.vi.2012 (1 ©),
27.vii.2012 (1 3), 1.viii.2012 (1 3); Moisie, bord du
fleuve, 30.vi.2016 (1 4); Parc des Laurentides, lac Sept-
Iles, 11.vii.2011 (1 4); Pare national de la Pointe-Tail-
Figs 25-34 (opposite page). 25. Herpetogramma nymphalis sp. n. 3, Holotype CNCLEP0089832: Canada, QC, Gatineau, Parc de
la Gatineau, Mont King, 24.v.1989, B. Landry. 26. Herpetogramma nymphalis sp. n. 2°, CNCLEP0089833: Canada, QC, Gatineau,
Parc de la Gatineau, Mont King, 24.v.1989, B. Landry. 27. Herpetogramma nymphalis sp. n. 3, CNCLEP0040835: Canada, MB,
Manitoba Tall Grass Prairie Preserve, Nature Conservancy Block, 49.0895° W, 96.7339° W, 294 m, 19.vii.2007, J.F. Landry and
V. Nazari. 28. Herpetogramma nymphalis sp. n. 2°, CNCLEP0040836: Canada, MB, Manitoba Tall Grass Prairie Preserve, Nature
Conservancy Block, 49.0895° W, 96.7339° W, 294 m, 19.vii.2007, J.F. Landry and V. Nazari. 29. Herpetogramma aeglealis, 3,
Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 25.vi1.2008, D. Handfield. 30. Herpetogramma aeglea-
lis, 2, Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 25.vii.2008, D. Handfield. 31. Herpetogramma
aeglealis, 3, Canada, QC, Mont-Saint-Hilaire, 845 de Fontainebleau, 26.ix.2006, Louis Handfield. 32. Herpetogramma aeglealis,
9, Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 29.vi1.2008, D. Handfield. 33. Herpetogramma sphin-
gealis, 6, Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 29.vii.2008, D. Handfield. 34. Herpetogramma
sphingealis, 2°, Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 29.vii.2008, D. Handfield.
Bonn zoological Bulletin 70 (1): 173-199 ©ZFMK
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 181
Bonn zoological Bulletin 70 (1): 173-199 ©ZFMK
182 Louis Handfield & Daniel Handfield
lon, secteur de la dune, 25.vii.2011 (1 4); Parc nation-
al des Monts-Valin, chalet Courtepointe, 17.vii.2009
(1 &), 7.viii.2009 (1 @), 7.ix.2009 (1 3), 7.viii.2009
(1 @); Pare national des Monts-Valin, pic Bellevue,
8.vii.2010 (1 3), 27.vii.2013 (1 @); Pied des Monts
Groulx, refuge du Prospecteur, 28.vii.2014 (1 <4); S[ain]
te-Christine, boisé Julien Picard, 23.vii.2010 (2 3);
S[ain]t-Mathieu-de-Beloeil, 355 des Grands Coteaux,
8.vii.2005 (1 3), 355 des Grands Coteaux, 29.vii.2005
(1 4); Villeroy, Grande Tourbiére, 21.vii.2011 (2 33),
ZEC des Passes, Lac aux Bleuets Secs, 27.vii.2013 (1 3)
(all DH); [Louis Handfield Collection] : Mont-S[ain]
t-Hilaire, 845 de Fontainebleau, 10.vii.2010 (1 3); S[ain]
t-Charles-sur-Richelieu (Ile de Jeannotte) (de jour, bat-
tant les grandes herbes au centre de l’ile, milieu humide),
20.vii.1969 (1 4). [Daniel Handfield Collection]: 9:
Bishopton, chalet Mésange des Sommets, 12.vi1i.2004
(1 2); Canton de Magog, lac Lovering, 23.v1i.2004 (1 9);
Franklin, Réserve écologique du Pin-Rigide, 5.vii.2013
(1 &); Henryville, Réserve écologique Marcel-Raymond,
18.vii.2014 (2 2); Lac Trousers, 495 Route Missisquoi,
1.viit.2011 (2 9°); La Présentation, Se rang, 1.x.2002
(1 2); Oriskany, 17.vi1.2008 (1 ©); Parc des Laurentides,
Lac Sept-Iles, 11.vii.2011 (1 2); Rougemont, montagne,
14.vi1.2008 (1 9), 29.vii.2008 (1 9); S[ain]te-Christine,
boisé Julien Picard, 15.1x.2006 (1 2); S[ain]te-Christine,
boisé Julien Picard, 3.vii.2011 (1 &), 22.vii.2011 (1 Q),
27.vil.2008 (2 29); ZEC des Passes, tourbiere du lac
Madame, 10.vi11.2013 (1 @).
Etymology. The species name is derived from Latin
aquilo for “northern wind,” referring to the transconti-
nental northern distribution of the species.
Diagnosis. Herpetogramma aquilonalis sp. n. has long
been confused in collections as there is a marked dimor-
phism in this species. That dimorphism led to a puzzle
in identification, white females often masquerading as
“abdominalis” and males as “pertextalis” and sometimes
as “thestealis.” Solis (2010: fig. 14) illustrates a male of
H. aquilonalis sp. n. from the McClean Bogs Reserve,
in New York, as H. abdominalis. Overall, the female is a
whitish moth, different from the females of its southern
counterpart, the true H. pertextalis. So, from H. pertexta-
lis, H. aquilonalis sp. n. can also be easily separated by
its larger size, by the coloring of the wings and even by
the wingshape of the forewings.
Description. Male. Figs 7-8, 11. Wingspan: 25-—
27 mm [rarely 28 mm], more heavily marked and longer
winged than female; palpi and head white, collar white
with a tuft of gray hair dorsally near thorax; thorax and
abdomen light gray, each segment of abdomen marked
by a thin white line at apex; forewing: fringe light gray
marked by a darker line at each vein; terminal line pale
gray, bordered interiorly by darker gray subterminal line,
scalloped between veins; terminal space slightly wider
toward apex; postmedial line wavy, thin, gray, extending
from costa to dorsal margin of wing; medial line thin,
gray, under reniform spot, upon reaching dorsal mar-
gin; turning inwardly toward base of wing; antemedial
line extending from costa, a bit wavy, convex, touching
dorsal margin of wing near medial line; sometimes post-
medial and medial lines connected as in H. theseusalis?;
basal dash absent; costa dark gray from wing base usu-
ally to postmedial line; area between reniform and or-
bicular spots an elongated white patch, or concolourous
with ground colour; reniform spot a dark gray rectangle,
solid or with pale center; orbicular spot dark gray, round,
barely evident in some specimens, sometimes paler
in middle; veins, especially in males, marked by gray.
Hindwing upperside: ground colour white, fringes as in
forewing, terminal area cream, as wide as on forewing:
postmedial line wavy, scalloped between veins; veins not
marked with gray as on forewing; discal spot a gray bar.
Hindwing underside: ground colour white; lines as on
forewing upperside; area between terminal and subter-
minal lines darker than on upperside of wing; reniform
and orbicular spots as on upperside of wing, but darker,
also for large dark line on costa and discal spot. Female.
Figs 9-10, 12. Wingspan: 23—26 mm [rarely 27 mm];
smaller, paler, with forewing apex more squared than in
male; head, palpi, and thorax white, abdomen pale gray,
abdominal segments marked by a thin white line as in
male; forewing mainly white, fringe white, with a very
thin gray mark at each vein, subterminal area between ter-
minal and subterminal lines pale gray; subterminal area
nearly as wide from base to apex, unlike in H. thestealis,
rest of wing white, postmedial and antemedial lines thin,
gray, following same course as in the male; orbicular
spot barely visible, a pale gray dot, reniform spot small,
more rounded than in male, gray with a pale-yellow cen-
ter. Hindwing: white; discal spot an elongated dark gray
spot; subterminal line medium gray to barely evident, es-
pecially light gray, scalloped between veins, fading out
posteriorly. Underside of forewing and hindwing white
except for terminal area of forewing, which has a light
gray dot on each wing vein, darker toward wing apex:
forewing costa marked by a gray line; reniform spot well
Figs 35—42 (opposite page). 35. Herpetogramma phaeopteralis valves PYR 1317: Bermuda, 8.x1i.1951, W. and E. Mason.
36. Herpetogramma phaeopteralis phallus PYR 1317: Bermuda, 8.xi1.1951, W. and E. Mason. 37. Herpetogramma bipunctalis
valves PYR 1311: United States, FL, Homestead, 7.x.1958, D.O. Wolfenbarger. 38. Herpetogramma bipunctalis phallus PYR
1311: United States, FL, Homestead, 7.x.1958, D.O. Wolfenbarger. 39. Herpetogramma theseusalis valves PYR 1313: Canada,
QC, Co. Laviolette, Lac-a-la-Tortue, 22.vii.1947, E. Munroe. 40. Herpetogramma theseusalis phallus PYR 1313: Canada, QC, Co.
Laviolette, Lac-a-la-Tortue, 22.v1i.1947, E. Munroe. 41. Herpetogramma aquilonalis sp. n. valves PYR 1293: United States, OR,
Marion Co., Croisan Gulch, S Salem, 25.vi.1978, R.L. Westcott. 42. Herpetogramma aquilonalis sp. n. phallus PYR 1293: United
States, OR, Marion Co., Croisan Gulch, S Salem, 25.vi.1978, R.L. Westcott.
Bonn zoological Bulletin 70 (1): 173-199
©ZFMK
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 183
Bonn zoological Bulletin 70 (1): 173-199 ©ZFMK
184 Louis Handfield & Daniel Handfield
marked; orbicular spot barely evident in most specimens.
Male genitalia. Figs 41-42. Valves and genital capsule
as described for genus. Vesica with doubled diverticulum
near base on right side and small dorsal diverticulum at
base; spined diverticulum at %4 toward apex of vesica.
Female genitalia. Fig. 57. Large anterior part of corpus
bursae about 2.4 x as long as wide, about 0.6 x total cor-
pus length, 2.7 x length of ductus bursae.
It is to be noted that we have seen in the CUIC a large
collection of specimens of H. aquilonalis sp. n. males
and females from New York State nearly all whitish in
both sexes (Figs 11-12), but still easily recognized by
their size, exactly as for other specimens more alike our
northern population; male brownish specimens are also
present in the New York State population. One of these
New York specimens was dissected and the genitalia
has proven without doubt its identity, especially since a
BOLD analysis has been rejected due to the age of these
specimens.
Distribution. Herpetogramma aquilonalis sp. n. is
transcontinental in Canada, from Newfoundland, Nova
Scotia, New Brunswick, Québec (nearly extending to
Labrador, as specimens have been caught in the Groulx
Mountain Range near the Labrador border [coll. DH]),
also present on the North shore of the St. Lawrence riv-
er up to Moisie River [coll. DH] and also in the Gaspé
Peninsula [Bonaventure along Bonaventure River] [coll.
LH] and Maria [coll. AC]; Magdalen Islands [Havre-aux-
Maisons] [coll. LH]); the French Territory of the Islands
of Saint-Pierre-et-Miquelon (Daniel Abraham and Na-
thalie Michel [DANM]); Newfoundland (BOLD); New
Brunswick (BOLD, CNC); Nova Scotia (BOLD, CNC);
Ontario (BOLD, CNC); scattered localities westward to
Alberta (SEM [Danny Shpeley in litt. & phot.] and in
southern British Columbia (BOLD, CNC). Specimens
from Saskatchewan (BOLD) and Manitoba (BOLD,
CNC) were all previously and wrongly identified as
H. pertextalis or H. abdominalis. The species is also
known from boreal habitats in the United States, from
New York (Adirondacks) to Georgia, mainly in the Appa-
lachian Mountains (BOLD). In the West it occurs in mon-
tane areas from Washington to California [specimens in
USNM; J. D. Lafontaine pers. comm.]. There are even
some specimens from British Columbia [Port Alberni]
called “thestealis” that have been submitted to BOLD;
they group with H. aquilonalis sp. n., not H. thestealis,
these specimens are of a peculiar form of H. aquilonalis
Sp. n.
Biology. Powell & Opler (2009: 180), under the name
H. pertextalis, list the larvae as leaf rollers on Asarum
(Aristolochiaceae), Urtica (Urticaceae), Rubus (Rosace-
ae) and Viola (Violaceae) in the Western United States;
the larva makes a shelter by folding, rolling and tying one
or several leaves of its host plant. It is certainly the same
pattern in Canada and the Eastern United States. In East-
ern United States Matteucia struthiopteris (Onocleace-
Bonn zoological Bulletin 70 (1): 173-199
ae), Plantago lanceolata (Plantaginaceae), and Ribes
(Grossulariaceae) are host plants (David L. Wagner, pers.
comm.); reared records in the USNM are from Euony-
mus sp. (Celastraceae) and Lonicera sp. (honeysuckle)
(Caprifoliaceae) (J. D. Lafontaine, pers. comm.); also on
Solidago flexicaulis and Solidago bicolor (Asteraceae)
(Tomkins Co., New York [CUIC]). Allyson (1984) re-
ports records from Ottawa, Ontario (as H. pertextalis):
10 specimens on Aster macrophyllus (Asteraceae) (17.
vii.1952), 10 specimens on Rubus sp. (Rosaceae) (21.
vui.1953), and 10 specimens on U/rtica sp. (Urticaceae)
(30.v1i.1955) (only as larvae having not been reared to
adults). Specimens in the CNC reared by Dr Bernard
Landry on Pedicularis canadensis (Scrophulariaceae)
(Landry 1993) are H. aquilonalis sp. n. and H. nympha-
lis sp. n. (described below). In the CNC, there are many
specimens reared on Manitoba maple (Acer negundo
[Sapindaceae]) (Ottawa, Ont.), basswood (Tilia amer-
icana [Tiliaceae]) (no locality), Salix sp. (Salicaceae)
(Forest Insect Survey, British Columbia), violet (Viola
sp. [Violaceae]) (prob. Ottawa, Ont.), Lonicera villosa
(Caprifoliaceae) (Almonte, Ontario), basswood (Tilia
sp. [Tiltaceae]) (Almonte, Ont.), false nettle (Boehmeria
cylindrica [Urticaceae]) (Almonte, Ont.), Helianthus sp.
(Asteraceae) (Annapolis, Nova Scotia), Agastache foe-
niculum (Lamiaceae) (Aweme, Manitoba), Steironema
ciliatum (Primulaceae) (Aweme, Manitoba) and Broad-
leaf maple (Acer macrophyllum |Sapindaceae (Mission
City, British Columbia). Two specimens (as abdomina-
lis 2) reared on Hamamelis sp. (Hamamelidaceae) in
the Potomac State Forest, in Maryland (see Larry Line,
Maryland Moths, visited 20.ix.2020); Hamamelis virgin-
iana 1s the only Hamamelis present in Eastern Canada
and eastern United-States (Lady Bird Johnson Wild-
flower Center, Texas, visited 20.1x.2020; Marie-Victorin
1995). It is not surprising that such a widespread species
of Herpetogramma would have a range of larval host
plants over their geographic range, as found in many ex-
amples in the host plant list for species of Lepidoptera in
Tietz 1972 (J. D. Lafontaine. pers. com, 20.111.2021). The
species 1s polyphagous on low plants and rarely found
on woody plants. It prefers open habitats, and open for-
ests, humid maple groves, even bogs and boggy habitats.
H. aquilonalis sp. n. is abundant on the slopes of the
mountain of Rougemont, Québec, in maple groves with
red oak (Quercus rubra) growing on an intrusive igneous
rock (essexite) (O’Neill 1914).
Flight period. In Québec, the moth is in flight from
mid-June to mid-August (with scattered records into
mid-September). The peak flight is from the middle of
July to the beginning of August in most of Canada. It
is the only Herpetogramma species in Canada to have
a second generation in particularly long hot summers as
was the case in 2019 in South-Eastern Québec, but we
have not been able to collect enough specimens to ascer-
tain if it was a full or only a partial second generation. It
©ZFMK
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 185
is anocturnal species, coming freely to light. According
to Joachim Lafrance (personal notes taken from 1965 to
1969 in Ste-Clotilde, Québec) (under the name H. per-
textalis), the moth flies until up to three o’clock in the
morning.
Herpetogramma fraxinalis sp. n.
urn: lsid:zoobank. org: act: 6EA259F9-5C98-4155-8232-CDFF6C5CC10C
Pl. 2, Figs 13-16 (adults); Pl. 5, Figs 43-44 (4 gen.);
Pl. 7, Fig. 58 (Q gen.).
Type material. Holotype <. Canada: Québec:
Rougemont, montagne [mountain] [45°28’026” N,
73°04’029” W.], 27.vi1.2008, Daniel and Louis Hand-
field. CNC.
Paratypes (16 33, 9 99). Canada: Ontario: Lake
Erie, Wallacetown, reared on Fraxinus americana, For-
est Insect Survey, 17.vii.1958 1 4 (CNC), 15.vii.1958,
3 dS (CNC), reared on Tilia sp., Forest Insect Sur-
vey, 15.vii.1958, 1 4 (CNC); Manitoulin Island, Mud
Creek, Lake Kagawong, 13.vui.1996, John K. Morton,
1 ¢ (CNC) ; Canada: Québec: Milton East [= Sainte-
Cécile-de-Milton], reared on Tilia glabra |= Tilia amer-
icana], Forest Insect Survey, 25.vi.1970, 1 3 (CNC);
S[ain]te-Foy, reared on Fraxinus americana, Forest
Insect Survey, 6.vii.1961, 1 4 (CNC); 10.vii.1961,
1 3 (CNC); Rougemont, montagne, Daniel and Lou-
is Handfield, 25.vii.2008, 1 2 (CNC), 29.vii.2008, 1 3
(LH), 28.vii.2009, 1 4 (LH) ; 8.vii.2010, 2 6S (LH);
12.vii.2010, 1 4 (LH); 16.vii.2010, 1 4 (LH); 12. vii.2008,
1 2 (LH); 24.vi1.2008, 1 2 (LH); 29.vii.2008, 1 2 (LH);
10.vii.2009, 1 9 (LH); 5.vit.2010, 1 9 (LH); 15.vii.2010,
1 9 (LH); 19.vii.2010, 1 2 (LH); Rougemont, montagne,
26.vil.2010, Daniel and Louis Handfield, 1 9 (LH);
Mont-Saint-Hilaire, 845 de Fontainebleau, 5.viii.2017,
Louis Handfield, 1 4 (LH).
Etymology. The species name is derived from one
of the hostplants of the species, Fraxinus americana L.
(Oleaceae).
Diagnosis. Herpetogramma fraxinalis sp. n. has been
in the past confused with H. abdominalis because of its
mainly white wing colour. There is little significant di-
morphism in this species, males and females being nearly
alike, except that the forewings of males are slightly lon-
ger and apically more pointed than those of females and
the latter’s wings have less dark shading than males. It is
a large species (wingspan: 29-32 mm, average 30 mm).
It is easily distinguished from H. aquilonalis sp. n. fe-
males by its wingspan (30 mm for H. fraxinalis sp. n.
and 24—26 mm for H. aquilonalis sp. n. females [rarely
up to 28 mm]), by its large, yellow reniform spot, rare-
ly yellow/brownish, and by its yellowish-gray lines on
the forewings more visible in fresh specimens. Finally, a
larger moth than H. aquilonalis sp. n., and easily recog-
nized by its larger size.
Bonn zoological Bulletin 70 (1): 173-199
Description. Adult. Male. Figs 13, 15. Head and palpi
white; collar light yellow; tegulae light yellow; thorax
white; abdomen pale yellow, each segment marked by
a white band; forewing upperside mostly pale yellowish
white with darker markings faint in most specimens; apex
not sharply pointed; costa with a yellow band along from
wing base to postmedial line; a thin yellow line from base
of wing extending along medial vein almost to postmedi-
al line and lower part of reniform spot; basal area yellow
from base to basal line; basal dash absent; antemedial and
medial lines pale gray, barely evident in most specimens;
postmedial line pale gray, scalloped between veins, when
these are more evident, pale grey, starting at 3/5 of dor-
sum, curved outwards between CuA1 and CuA2, costal
*%5 scalloped, meeting costa at */5; subterminal line barely
evident as faint shade in some specimens; inner part of
costa marked by yellow area, especially where the post-
medial line and antemedial lines touch costa; reniform
spot large, rectangular, with basal and distal edges grey,
orbicular spot yellow rounded, gray, centre yellow; hind-
wing similar to forewing, all lines dentate, thin and gray,
discal spot rectangular, gray, with yellow center; ground
colour pale yellow except yellow band along antemedial
and postmedial lines. Underside of wings typically near-
ly entirely white, except costal border which shows a thin
light-brown or yellow line, especially in males; some-
times reniform and orbicular spots and postmedial line
on forewing, and discal spot on hindwing, show through
to upper side as very light marks; fringes white, some-
times with a pale brown line on veins. Female. Figs 14,
16. Like male except forewings slightly more squared at
apex and mainly white with maculation barely evident
or absent.
Male genitalia. Figs 43-44. Valves and genital cap-
sule as described for genus. Vesica extending posterior-
ly from phallus and about length of phallus; vesica with
anvil-shaped subbasal diverticulum on left projecting
anteriorly and posteriorly, single dorsal subbasal diver-
ticulum; spined diverticulum *%4 toward apex of vesica.
Female genitalia. Fig. 58. Anterior part of corpus bursae
with length 2.5 x width, 2 x length of narrower posterior
part, and 2.5 x length of ductus bursae.
Distribution. Herpetogramma fraxinalis sp. n. is only
known from a small northern area, corresponding exactly
to the northern distribution of Fraxinus americana and
Tilia americana in eastern Canada, the two known host-
plants of the larvae. It is known from eastern Ontario,
southern Québec up to Québec City and the southern part
of the Parc Les Grands Jardins (Carle Bélanger, pers.
comm.), and New Brunswick. It presumably occurs in
northeastern United States.
Biology. Specimens (in CNC) were reared by the
Forest Insect Survey on Fraxinus americana (Oleace-
ae) (Wallacetown, Ont. and Ste-Foy, Québec) and Tilia
americana (Tiliaceae) (Wallacetown, Ontario, and Mil-
ton East, Québec). The species could be in a dangerous
©ZFMK
186 Louis Handfield & Daniel Handfield
decline due to the situation of Fraxinus being killed by
the Emerald Ash Borer (Agrilus platipennis Fairmaire,
1888; Coleoptera, Buprestidae), imported accidentally
from Asia through the United States. It is a forest-dwell-
ing moth, where its hostplants are growing in abundance.
Flight period. The moth is in flight from early July
to early August, with a peak from mid to late July. It is
nocturnal and comes to light.
Note: The yellow on the wings tends to fade or even
disappear in older specimens and on those that have
flown a lot, as evident from their thinner fringes. Some
old specimens are nearly pure white. The best way to ac-
curately identify this species 1s by genitalia dissection or
DNA analysis, or by its large wingspan.
Herpetogramma thestealis (Walker, 1859) (801199,
MONA 5277)
Pl. 2, Figs 17-20 (adults); Pl. 5, Figs 45-46 (@ gen.);
Pl. 8, Fig. 59 (2 gen.).
Synonyms: abdominalis (Zeller, 1872) (Botis) (syn.
n.), magistralis (Grote 1873) (Botis), fissalis (Grote,
1881) (Botis) (syn. n.), gulosalis (Hulst, 1886) (Botis).
Alma Solis (2010), Scholtens & Solis (2015). Misspelled
as thestialis in Forbes (1923) and in Covell (1984).
Type material. One ¢ in BMNH, locality given as “?”
[not known] (Solis, 2010).
Diagnosis. Herpetogramma thestealis has been con-
fused in collections under the name abdominalis due
mostly to the misidentification of the type specimen of
Botis abdominalis Zeller and that of its synonym Botis
fissalis Grote, as well as its occurrence in two forms: a
dark form found in mesic areas such as bogs and marsh-
es, and a paler form found in drier, more xeric areas, a
situation also found in Spilosoma dubia Walker, 1855
(Noctuoidea, Erebidae) (see Handfield 2011: pl. 27) for
example. There is a slight dimorphism in H. thestealis,
males and females being nearly alike, except for fore-
wing shape and colour of wing, females being paler than
males; H. thestealis is a relatively large species (wing-
span 30-35 mm for males; 29-31 mm for females). This
variation has been confirmed by DNA analysis of spec-
imens submitted to BOLD and by genitalia dissections.
Solis (2010, fig. 15) illustrated a male of H. thestealis, as
representing the typical form of the species. The large,
round, dark to very dark, subterminal area, wider at the
costa, and pointed on the veins (in the fringe), is typical
of H. thestealis on the forewings as 1s all the darker fea-
tures on the forewings of the moth. These are the best
distinguishing characters for the species.
Redescription. Adult. Male. Typical (dark form)
(Figs 17, 19): Head, palpi, and thorax brown, the same
brown as on wings; abdomen same brown colour with
white line marking each segment. Forewing: medial line
absent, or represented by a few dark spots between post-
medial and antemedial lines; antemedial line extending
as a Slightly sinuate line from costal basal '/5 to orbicular
spot obliquely outward to posterior margin of wing below
position of orbicular spot; basal line usually evident only
as a dusting of dark scale; reniform spot dark, rectangu-
lar in shape, usually dark brown, but sometimes with a
light center; orbicular spot V-shaped or rounded, rarely
with a light center; area between reniform and orbicular
spots cream, as for ground colour of wing; fringe cream,
marked by brown on each vein, tornus white, not forming
a larger white patch as in other species of Herpetogram-
ma; terminal line dark brown; terminal area dark gray
brown, with deeply scalloped subterminal line on inner
margin; postmedial line curving slightly inward distal to
reniform spot, then curving outward at opposite lower
margin of reniform spot, then turning abruptly inward
to a position below reniform spot, and then downward
below reniform spot to hind margin of wing. Hindwing:
fringe white, marked with brown at veins; terminal area
pale yellowish brown bordered inwardly by dark grayish
brown subterminal line scalloped between veins; post-
medial line irregular, bending outward around position
of dark gray to black discal spot. Light form (Figs 18,
20). As for dark form, except lines, markings, and wings
paler especially in subterminal area, which is yellow
brown and contrasts with dark gray-brown terminal line
and deeply-scallopped subterminal line. Maculation as in
dark specimens, but lighter brown, often with a reddish
iridescence on brown markings. Underside. White, all
lines, and orbicular, reniform, and discal spots brown;
dark terminal area well marked and dark, but lines not
as well marked on hindwings. Female. As for male, also
presenting two forms, but never as dark as for male;
forewings not apex less acute, more squared; usually
smaller than male. Concolourous with male, but not as
dark. Light form more yellow than brown. Male genita-
lia. Figs 45-46. Valves and genital capsule as described
for genus. Vesica extending posteriorly from phallus
and about 1.4 x length of phallus; vesica with elongated
curved diverticulum on left projecting posteriorly, dorsal
subbasal diverticulum two lobed; spined diverticulum *%
toward apex of vesica. Female genitalia. Fig. 59. Ante-
Figs 43—48 (opposite page). 43. Herpetogramma fraxinalis sp. n. valves PYR 1301: Canada, ON, Wallacetown, Lake Erie,
15.vui.1958, F.L.S. 44. Herpetogramma fraxinalis sp. n. phallus PYR 1301: Canada, ON, Wallacetown, Lake Erie, 15.vii.1958,
FILS. 45. Herpetogramma thestealis valves PYR 556: Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°4.029’ W,
25.vi1.2008, Louis Handfield and Daniel Handfield. 46. Herpetogramma thestealis phallus PYR 556: Canada, QC, Mont
Rougemont, Rougemont, 45°28.026’ N, 73°4.029’ W, 25.vii.2008, Louis Handfield and Daniel Handfield. 47. Herpetogramma
pertextalis valves PYR 1315, United States, NY, Monroe Co., 7.viii.1949, C.P. Kimball. 48. Herpetogramma pertextalis phallus
PYR 1315, United States, NY, Monroe Co., 7.viil.1949, C.P. Kimball.
Bonn zoological Bulletin 70 (1): 173-199
©ZFMK
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 187
Bonn zoological Bulletin 70 (1): 173-199 ©ZFMK
188
rior part of corpus bursae with length 2.5 x width, 1.5 x
length of narrower posterior part, and 3 x length of duc-
tus bursae.
Note: We have submitted many specimens of both the
dark typical form and the light form to BOLD, males and
females, using a very dark male (see Fig. 17) to repre-
sent a “typical” H. thestealis. All sequences were found
to represent a single species, H. thestealis. We have also
compared males and females of the light form in BOLD
and with the images of the type specimens of abdomina-
lis and fissalis, considering also that the type specimens
are old and faded. The forewings of the two types have
the same large, dark subterminal area; the dark subter-
minal area is rounded toward the costa and pointed on
the veins, so the area near the postmedial and subtermi-
nal lines is much narrower near the wing apex, leaving a
small pale cell between the two lines. This is typical of
H. thestealis, whereas in H. aquilonalis sp. n., the other
species that has light forms, this area is pale yellowish
brown and not as large, nor as rounded, as in H. thestea-
lis, and the subterminal line in H. aquilonalis sp. n. is
usually straight near the apex, leaving a larger and lon-
ger pale cell between the two lines. In BOLD, samples
of the light and dark forms cluster together leaving no
doubt that the forms represent a single species. The large,
round, dark to very dark, subterminal area, wider at the
costa, and pointed on the veins typical of H. thestealis are
faded on the types of abdominalis and fissalis but these
distinguishing characters, even though faded, are present
so we conclude that these two names represent synonyms
of H. thestealis.
This is the only Canadian species of Herpetogramma
to have a white leucistic form, mostly in females, rarely
in males. BOLD data confirms that these leucistic spec-
imens are H. thestealis. These specimens have a large
round, black reniform spot on the forewing and on the
hindwing; this is the easiest way to identify them. We
have only seen one semi-melanic specimen.
Distribution. Herpetogramma thestealis occurs
from Eastern Canada (Nova Scotia westward through
southern Québec (as far north as Québec City [CNC]),
and southern Ontario to southern Manitoba. It oc-
curs in eastern and central United States as far south
as Florida. American records in BOLD are from North
Carolina and Tennessee. The species is listed from
as far west as British Columbia (Pohl et al. 2015),
and shown on Moths Photographers Group website
(https://mothphotographersgroup.msstate.edu; accessed
20.1x.2020) by dots and photographs from British Co-
lumbia and as far south as California; however, these
specimens are referrable to H. aquilonalis sp. n.; the
same is true for a specimen from Port Alberni, British
Columbia, shown in Bug Guide (accessed 20.1x.2020)
(https://bugguide.net/) that is also a worn H. aquilona-
lis sp. n.. Some specimens from British Columbia [Port
Alberni] of “thestealis” have been submitted to BOLD
Bonn zoological Bulletin 70 (1): 173-199
Louis Handfield & Daniel Handfield
and they sort out with H. aquilonalis sp. n., not H. thes-
tealis, these specimens are of a peculiar form of H. aq-
uilonalis sp. n.. In BOLD, there are more than 90 speci-
mens analysed from British Columbia and more than ten
from Washington State; none is H. thestealis, all being
H. aquilonalis sp. n.. Also, specimens from Alberta in the
E. H. Strickland Entomological Museum at the Universi-
ty of Alberta, Edmonton, which were identified as H. ab-
dominalis are referred to H. aquilonalis sp. n. and not
to H. thestealis (SEM [Danny Shpeley in litt. & photo.])
and those from Saskatchewan under H. thestealis are re-
ferred to H. aquilonalis sp. n. (BOLD), so no H. aqui-
lonalis sp. n. in Alberta and Saskatchewan. We conclude
that H. thestealis should be removed from lists of species
from areas west of Manitoba.
Biology. Herpetogramma thestealis appears to be
associated with woody plants such as Tilia [Tiliaceae|
and Corylus [Betulaceae] (Forbes 1923), Halesia caro-
lina [Styraceae] and Aralia racemosa |Araliaceae] (D.
Wagner, pers. comm. 2011) (see Handfield & Handfield
2011); in the USNM, only Celastrus scandens |Celastra-
ceae] is reported as a hostplant for H. thestealis. Other
hostplants listed by Solis (2010), needs verification. The
moth seems to prefer wet habitats, like bogs and wet for-
ests, being scarce in less mesic habitats.
Flight period. In eastern Canada, the moth is in flight
from early June to late August, with a peak from mid-Ju-
ly to early August. It is nocturnal and comes to light.
Herpetogramma pertextalis (Lederer, 1863) (801187,
MONA 5275)
Pl. 2, Figs 21-24 (adults); Pl. 5, Figs 47-48 (¢ gen.).
Synonyms: thesealis Zell., 1872 (Botis), gentilis Grote,
1883 (Botis) (Solis 2010) (Scholtens & Solis 2015).
Type material. One male lectotype designated by So-
lis (2010) from “Nordamerica” in the NHM, in Vienna,
Austria; it has a wingspan of 21.5 mm.
Remarks. This is the “true” pertextalis, which is
smaller and differently marked than its northern counter-
part (H. aquilonalis sp. n.). All pyraloid species named
by Lederer are from the southern United States (Texas
and Florida). Some of his southern species occur in the
North, but Lederer’s species that occur in the North, also
occur in the South. This suggests that the type locality
is somewhere in the southern United States, and more
particularly in Texas or northern Florida, and not from
northern United States or Canada. During the years 1850
—1900, the city of Jacksonville was the commercial center
of Florida, and an important city for business with Europe
(Gannon 2013). It is probable that Lederer received his
specimens from Texas, Florida, or elsewhere in southern
United States via Jacksonville. Consequently, the name
pertextalis would not apply to its northern counterpart.
Solis (2010) mentions having seen specimens of per-
textalis in the USNM from Texas and Illinois, under the
©ZFMK
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 189
name thesealis Zell., 1872, a synonym, with specimens
from Texas and Massachusetts (2 ¢¢ and 1 Q) (Solis
2010). We also have documented it in northern Florida
(Appalachicola National Forest, Liberty Co., Florida,
29.v.1993, Florida State Collection of Arthropods, Flori-
da Museum of Natural History / McGuire Center, James
Hayden, pers. comm.). So, we believe that the type local-
ity of pertextalis Led. is Texas or Florida. As most of the
specimens of Lederer were from Texas, the type locality
is most probably Texas, the specimens being sent to Ger-
many through the port of Jacksonville, Florida.
Diagnosis. Herpetogramma pertextalis has been long
confused with the species we describe above as H. aqui-
lonalis sp. n.. It is a well-marked species, smaller than
H. aquilonalis sp. n., with a wingspan of 21.5—23.0 mm
(males) and 23—24 mm (females) compared to 25—27 mm
(males) and 23—26 mm (females) for H. aquilonalis sp. n..
Solis (2010: fig. 13) illustrated a female of H. pertextalis.
Redescription. Adults. There is a dimorphism in the
species, but not as pronounced as in H. aquilonalis sp. n.,
the female being larger and more boldly marked than
the male. The wingspan of the male is 21.5—23.0 mm,
of the female 23—24 mm. Male (Figs 21—22): head, pal-
pi, thorax, and abdomen concolourous with the wings.
Abdomen with each segment marked by a small white
line (yellowish in dark specimens). Forewings cream
with gray band on costa from wing base to postmedial
line, apex acute, not pointed; fringes white, terminal line
dark brown, at base of pale-brown fringe; subterminal
area, between dentate subterminal line and sinuate post-
medial line cream coloured. Postmedial line dark gray,
sharply defined, incurved from costa to M2 vein, then
bent outwardly to form three points on veins, then turn-
ing inwardly up a position below the reniform spot, then
extending straight to posterior margin of wing. Ante-
medial line dark gray, slightly sinuate, extending from
forewing costa proximal to orbicular spot, projecting
downward and outward to a position on hind margin of
wing below position of orbicular spot. No basal dash but
with an oblique gray basal line near base. Orbicular spot
a grayish dot; reniform spot a rectangular patch, gray
with innerside pale. Area between orbicular and reni-
form spots cream coloured. Veins lightly marked by gray
streaks. Hindwing concolourous with forewing; postme-
dial line wavy with an outward bend at middle of wing,
pointed on veins, as on forewing. Discal spot a gray bar
on creamy-white background. Underside pale gray, all
lines visible, orbicular and reniform spots pale, but visi-
ble, and pale creamy-white area between them. Female
(Figs 23—24). More boldly marked than male; ground co-
lour typically more yellowish white than creamy white,
lines more crisply marked (including costa); postmedial
and antemedial lines converge at hind margin of wing to
form a V or U in many specimens; orbicular spot a round
circle with gray margins and yellow center; reniform spot
rectangular, with gray margins and yellow center. Dis-
Bonn zoological Bulletin 70 (1): 173-199
cal spot of hindwing more boldly marked than in male.
Ground colour of both wings creamy white except for
area between wing margin and submarginal line, which
is pale yellow. Underside as in male but more bodly
marked. Male genitalia. Figs 47-48. Valves and genital
capsule as described for genus. Vesica short, extending
posteriorly from phallus and about 0.66 x length of phal-
lus; vesica with smaller rounded diverticulum on left, as
well as an elongated, curved, multilobed diverticulum
projecting posteriorly; dorsal diverticulum '4 from base
and dorsolateral; spined diverticulum *%4 toward apex of
vesica. Female genitalia. No illustration available.
Distribution. Herpetogramma pertextalis is only
known from extreme Southern Québec (1 <4 from
Philipsburg, 16.vii.1974 [CNC], | ¢ from Trousers Lake,
1.viii.2011 [DH]), 1 4 from Franklin [Réserve écologique
du Pin-Rigide], 8.x.2017 [DH]), and from southern On-
tario (2 3 and 1 @ from Port Franks, Lambton Co.,
18.ix.2014 (4), 4.ix.2015 (4), 1.ix.2016 (Q), K. H. Stead
[CNC], Simcoe, 22. vii.1939, one 4 [CNC], Thousand Is-
lands National Park [shoreline transitional area, marsh],
4 1x.2014 (BOLD), Wellington Co., Puslinch Township,
concession 11 / Hume road, 7.x.2005, Paul D. N. He-
bert (BOLD), Windsor, Ojibway Prairie Provincial Park,
3.1x.2014 (BOLD), and then from New York and Mas-
sachusetts to northern Florida along the Atlantic Coast,
including rivers and lake shores in southeastern United
States and westward to Illinois, Oklahoma, and Texas
(Solis 2010). With more than 90 specimens analysed in
BOLD, the presence of H. pertextalis in British Colum-
bia (Pohl et al. 2015) is clearly an error and the specimens
are H. aquilonalis sp. n. Herpetogramma pertextalis is a
specialist of mesic habitats especially along the Atlantic
coast; it is absent from the Appalachian Mountain range.
In Ontario, it is likely found in Carolinian forests, but it is
not known if the specimens from Ontario were residents
or migrants. Powell et al. (2009) list H. pertextalis as be-
ing present in western North America, but these speci-
mens are more likely referable to H. aquilonalis. sp. n.
Biology. In Maryland, Larry Line (see Maryland
Moths, visited 20.ix.2020) reared a dozen larvae of Her-
petogramma pertextalis found at the beginning of June
“tying conspicuous tubular shelters on terminal shoots
of Clethra alnifolia L. (Clethraceae) in the Patuxent
Wildlife Research Center and in the Millington WMA
[Wildlife Management Area].” Clethra alnifolia is found
along the Atlantic Coastal Plain from Nova Scotia and
Maine southward to northern Florida, and westward
along the Gulf Coast to Louisiana, but does not occur
in the Appalachian Mountains. It is very sporadic in oc-
currence to the west of the Appalachians (northern New
York, western Pennsylvania, Tennessee, etc.). This also
represents the range of H. pertextalis with western re-
cords from Kentucky, Illinois and Oklahoma. The moth
has other hostplants and it could use Clethra acuminata
(Clethraceae) as this plant is found in mountainous ar-
©ZFMK
190 Louis Handfield & Daniel Handfield
eas of Tennessee (incl. Sevier, where the moth has been
found [Mitchell & Hespenheide 1967]), Kentucky, and
West Virginia. Larvae have been found or reared on other
plants like Rubus sp. (Rosaceae) (in West Virginia), and
Plantago lanceolata (Plantaginaceae) (in Connecticut)
(David L. Wagner, pers. comm.). One specimen in the
Murtfeld collection in the CUIC has been reared on Er-
igeron canadensis (Asteraceae) in New York in 1899, but
this is a questionable old record. Other hostplants listed
by Solis (2010: 460) based on specimens in the USNM
are not included here because the material has not been
positively identified. In Québec, the known specimens
have been caught on lake shorelines (Trousers lake and
Philipsburg) and a humid habitat (Franklin, Réserve
écologique du Pin-Rigide); these specimens are in good
condition, but not freshly emerged, and are singletons, so
they could have flown from C/lethra populations in near-
by New York State (Essex Co., Warren Co. along Lake
Champlain [New York Flora Atlas, visited 20.1x.2020])
(http://newyork.plantatlas.usf.edu/) as they do not seem
to represent a resident population. Concerning the speci-
mens from Port Franks, Lambton Co., Ontario, the male
has not been freshly collected, only the female is in good
condition; the dates are late in the season and are from
the Lake Huron shoreline (near Pinery Provincial Park).
The specimen from Simcoe, Ontario, is in good condi-
tion. The Ontario specimens likely represent strays, con-
sidering that the host plant (Clethra sp.) is not present in
Canada. It seems to be a moth of shorelines (rivers, lakes,
etc.) and especially along the Atlantic Coastal Plain in
eastern United States.
Flight period. In Canada, the moth has been found
from the 16" of July to 8" of October. It 1s probably a
wandering species, at least in its northern distribution
(Ontario and Québec), as there are only a few scattered
records. The moth is nocturnal and comes to light.
Note. The specimens identified as H. pertextalis by
Landry (1993) are in fact H. nymphalis sp. n. and H. aq-
uilonalis sp. n.
Herpetogramma nymphalis sp. n.
urn: lsid:zoobank.org:act:41E47FA9-D48 1-44 0E-BA65-193886B7AA82
Pl. 3, Figs 25-28 (adults); Pl. 6, Figs 49-50 (@ gen.);
Pl. 8, Fig. 60 (2 gen.).
Type material. Holotype <. Canada: Québec: Gatin-
eau Park, King Mountain [45°29’33” N, 75°52’42” W.],
14.vi.1989 (emerging date, reared on Pedicula-
ris canadensis), Bernard Landry. CNC. Bold CNC-
LEP00089832.
Paratypes. Canada: Québec: Gatineau Park, King
Mountain, reared on Pedicularis canadensis), Ber-
nard Landry, 16.vii.1989 [emerging date], 1 9 (CNC),
19.vi.1989 [emerging date], 1 4 (CNC); Canada: Mani-
toba: Manitoba Tall Grass Prairie Reserve, Nature Con-
servancy block W[est] of Gardenton, 19.vii.2016, Jean-
Francois Landry and Vazrick Nazari, 3 64 (CNC).
Etymology. The species name is Latin derived from
the word Nympha (plural Nymphae), the small deities
of forests, mountains and rivers, in reference to the little
luminous Nymphs haunting the oak and juniper woods
at night on the top of King mountain, in Gatineau Park,
Québec, according to an old legend to that effect (Lau-
rent Le Sage, pers. comm.).
Diagnosis. Herpetogramma nymphalis sp. n. was con-
fused in collections under the name H. thestealis due to
its similarity with that species, even if it is much smaller
(wingspan: 26 mm for H. nymphalis sp. n. and more than
30 mm [very rarely 29 mm for females] for H. thestea-
lis). It looks like a small orange-brown H. thestealis.
Description. Adult. Head, palpi, thorax, tegulae, and
abdomen concolourous with rusty-brown ground colour
of forewing. Each segment of abdomen marked by a thin
white line. Wingspan 26 mm. Forewing: apex acute, not
round. Fringe: wide, pale brown, marked with darker
brown on veins. Terminal line dark brown. Subterminal
area between terminal and submarginal lines wide, rusty
brown; subterminal line pointed on veins, deeply dentate,
wide at anal angle, then a little narrower through middle,
then wide toward top of wing, leaving a small whitish cell
between it and postmedial line; small cell also typical of
H. thestealis,; area between three outward pointed cells
of the postmedial and subterminal lines narrow. Postme-
dial line a dark brown line from costa to M2 vein, then
bent outwardly toward subterminal line, nearly touching
it, pointed (dentate) on three cells, then bent inwardly to
position below reniform spot, then turning downward to
posterior margin of wing. Antemedial line also a dark
brown line, sinuous, extending from costa to posterior
margin of forewing, but well separated from postmedial
line. Reniform spot rectangular, dark brown or represent-
ed by two parallel dark lines, with light brown inside,
orbicular spot dark, rounded. Area between orbicular
and reniform spots creamy white, distinct. Area between
Figs 49-54 (opposite page). 49. Herpetogramma nymphalis sp. n. valves PYR 1308: Canada, MB, Manitoba Tall Grass Prairie
Preserve Nature Conservancy Block, 294 m, 19.vii.2007, J.F. Landry and V. Nazari. 50. Herpetogramma nymphalis sp. n. phallus
PYR 1308: Canada, MB, Manitoba Tall Grass Prairie Preserve Nature Conservancy Block, 294 m, 19.vii.2007, J.F. Landry and V.
Nazari. 51. Herpetogramma aeglealis valves PYR 555: Canada, QC, Mont Rougemont, Rougemont, 45°28.026’N, 73°4.029’ W,
25.vi1.2008, Louis and Daniel Handfield. 52. Herpetogramma aeglealis phallus PYR 555: Canada, QC, Mont Rougemont,
Rougemont, 45°28.026’ N, 73°4.029’ W, 25.vii.2008, Louis and Daniel Handfield. 53. Herpetogramma sphingealis valves PYR
551: Canada, QC, Mont Rougemont, Rougemont, 45°28.026’N, 73°4.029’ W, 25.vii1.2008, Louis and Daniel Handfield. 54. Her-
petogramma sphingealis phallus PYR 553: Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°4.029’ W, 25.vii.2008,
Louis and Daniel Handfield.
Bonn zoological Bulletin 70 (1): 173-199
©ZFMK
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 191
Bonn zoological Bulletin 70 (1): 173-199 ©ZFMK
192 Louis Handfield & Daniel Handfield
subterminal and postmedial lines lightly coloured as is
cell between reniform spot and postmedial line. Ground
colour light rusty brown (dirty white with rusty brown
scales in some specimens [Manitoba]). Costa dark from
base of wing to postmedial line; in paler specimens, cos-
tal area pale between subterminal and postmedial lines,
but still dark brown between postmedial line and wing
base. Hindwing light, ground colour pale yellowish ex-
cept for subterminal area that is dark, but not as dark as on
forewing. Discal spot a dark bar. Postmedial line brown,
sinuous as on forewing. Underside pale, but with all lines
and spots visible including dark band between terminal
and subterminal lines. Without sexual dimorphism.
Specimens that have flown a lot have the same lines,
but the colours are less pronounced with the ground
colour of the wings much paler; however, on the fore-
wing costa, the width of the terminal area is wide, almost
reaching the postmedial line, leaving the subterminal area
very narrow on the costa. Male genitalia. Figs 49-50.
Valves and genital capsule as described for genus. Vesica
extending posteriorly from phallus and similar in length
to phallus; distance between end of phallus and base of
dorsal diverticulum 0.25—0.3x length of phallus; vesica
with gourd-shaped diverticulum on right, apical narrow
part curved posteriorly; spined diverticulum 2 way to-
ward apex of vesica. Female genitalia. Fig. 60. Large
anterior part of corpus bursae with length 2.8 =< width,
2.8 x length of narrower posterior part, and 2.8 x length
of ductus bursae.
Distribution. Herpetogramma nymphalis sp. n. is
known from specimens from Québec (Gatineau Park
[King mountain], and Montréal [on Mount Royal]), On-
tario (Lambton Co., Port Franks) and Manitoba (Garden-
ton) (all in BOLD and CNC).
Biology. The specimens from Gatineau Park were
reared on Pedicularis canadensis (Orobanchaceae),
an unusual hostplants for Herpetogramma (see Landry
1993; identified as H. pertextalis), this hostplant has
also been found in the area where the specimens were
found in Manitoba (see Rousseau 1974 for Québec, and
Scoggan 1957 for Manitoba). We also know that Pedic-
ularis canadensis was present on Mount Royal in Mon-
tréal at least until 1987 (see Marineau, 2008: 112); it is
also present on Saint-Hilaire mountain (see the web site
“Végétaux vasculaires du mont Saint-Hilaire,” visited
20.1x.2020: _ https://gault.mcgill.ca/workspace/uploads/fich-
iers/vascularplant.pdf ) but so far the moth has not been
found on Saint-Hilaire mountain or on Rougemont
mountain. According to Rousseau (1974), Pedicularis
canadensis is rare and localized in southern Québec and
is mostly present in rocky and mountainous woodlands,
including maple groves. Is Pedicularis canadensis the
only hostplant of that species? Probably, but this remains
unproven; more data are needed. It is a moth of xeric
woods, especially in mountainous and rocky places in
Québec.
Bonn zoological Bulletin 70 (1): 173-199
Flight period. The moth should be searched for in July
in suitable areas from New Brunswick (see Hinds 2000),
southern Québec (see Rousseau, 1974), Ontario (see On-
tario Wildflowers, site visited 20.1x.2020) and southeast-
ern Manitoba (see Scoggan 1957), in the native range of
Pedicularis canadensis in Canada. The scarcity of spec-
imens prevents us from giving precise information about
the habits of the moth, but it is probably nocturnal and
comes to light like other Herpetogramma.
Note: All specimens reared by Dr Bernard Landry
(Landry 1993) on Pedicularis canadensis are in the CNC,
have been submitted to BOLD, reviewed and re-identi-
fied as being H. nymphalis sp. n. for the most part, with
a few being H. aquilonalis sp. n. (see above, and Solis
2010 under H. abdominalis).
Herpetogramma aeglealis (Walker, 1859) (801191,
MONA 5280)
Pl. 3, Figs 29-32 (adults); Pl. 6, Figs 51-52 (4 gen.);
Pl. 8, Fig. 61 (& gen.).
Synonym: quinquelinealis (Grt., 1875) (Botis) (see
Solis 2010) (Scholtens & Solis 2015).
Type material. One ¢ from the “United States” in the
BMNH (Solis 2010).
Diagnosis This is probably the best known of all East-
ern North American Herpetogramma. It is common and
easily identified even though it is a variable species with
a typical form, which is pale gray with a yellowish hue
on the forewing. Other forms have a light-gray forewing
ground colour. There is also a dark form (more common
in females, rare in males) that could be confused with
H. sphingealis. Wingspan 29-33 mm (male), 27-31 mm
(female), showing a sexual dimorphism, females having
a more squared and shorter forewing than males, but with
the same colouration and lines in both sexes. Solis (2010:
figs 1, 3) illustrated a typical H. aeglealis (fig. 1) and a
darker form (fig. 3).
Redescription. Adult. It has a wing pattern typical of
Herpetogramma. Generally, head, palpi, thorax, and ab-
domen are concolourous with the wings. The forewing is
elongate with a slightly acute apex in the male, but more
squared in the female, therefore with a shorter wing-
spread; the forewing fringe is pale brown or checkered
in the pale form, and dark gray brown in the dark form,
except the lower part of the fringe is white in both forms
(occasionally the white area is absent); the terminal line
is dark gray brown, slightly darker to much darker than
the fringe and subterminal area; the postmedial line ex-
tends obliquely from the costa to the second medial vein
at the level of the lower edge of reniform spot where it
curves in an outward arc, then curves in an inward arc to
the lower edge of the wing; the reniform spot is a dark
patch more or less rectangular, or curved and crescentic;
the orbicular spot is dark and rounded or square, with a
white area in the cell between the two spots; the ante-
©ZFMK
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 193
Figs 55-58. 55. Herpetogramma phaeopteralis female PYR 1310: Bermuda, 8.xi1.1951, W. and E. Mason. 56. Herpetogramma
theseusalis female PYR 1314: United States, FL, Stemper, no date, G. Krautwurm. 57. Herpetogramma aquilonalis sp. n. female
PYR 1294: Canada, CAN, QC, Mont Rougemont, Chemin vers la croix, Rougemont, 27.vii.2008, Louis Handfield. 58. Herpeto-
gramma fraxinalis sp. n. female PYR 1305: Canada, QC, Mont Rougemont, Chemin vers la croix, Rougemont, 27.vi1.2008, Louis
Handfield.
Bonn zoological Bulletin 70 (1): 173-199 ©ZFMK
194 Louis Handfield & Daniel Handfield
medial and postmedial lines are dark gray brown, con-
trasting in pale forms, less so in dark forms, frequently
with some pale shading on one or both sides of the lower
part of the line. There is no basal dash. The hindwing is
usually paler than the forewing with the antemedial and
postmedial lines dark gray brown, the discal spot is elon-
gated, and the veins usually are dark and contrast with
the paler ground colour; in some forms the subterminal
area 1s contrastingly darker than the general ground co-
lour; the terminal line is dark gray brown and contrasting.
Male genitalia. Figs 51-52. Valves and genital capsule
as described for genus. Phallus 8.0—8.8 mm long; vesica
extending posteriorly from phallus and similar in length
to phallus; vesica with gourd-shaped diverticulum on
right smaller than that of H. nymphalis sp. n.; narrow
apical part of diverticulum curved posteriorly; spined
diverticulum 2 way toward apex of vesica. Female gen-
italia. Fig. 61. Anterior part of corpus bursae with length
2 x width, 3 x length of narrower posterior part, and 3 x
length of ductus bursae.
Distribution. Herpetogramma aeglealis is known in
Canada from New Brunswick westward through south-
ern Québec to southern Ontario. In the United States, it
occurs from Maine westward to Wisconsin and Illinois
and southward to Florida and Texas.
Biology. Herpetogramma aeglealis is a leaf tyer mak-
ing a shelter by folding and tying one or several leaves of
its host plant and is probably a general feeder, but most
records are from “ferns” [Polypodiales] (D. Wagner, pers.
comm. ), like Woodwardia |Polypodiaceae] (in Sweet Air,
Baltimore Co., Maryland, Larry Line, pers. comm.), and
Osmunda claytoniana [Osmundaceae] (in Maryland, see
https://marylandbiodiversity.com/, visited 20.1x.2020). It
has also been reared on a variety of herbaceous plants
including Asarum canadense [Aristolochiaceae] (West
Virginia, Bug Guide.net, visited 20.1x.2020), pokeweed
[Phytolaccaceae] (Forbes 1923); specimens of H. aegle-
alis reared have been found in the USNM on Solidago
sp. [Asteraceae] and one specimen reared on Mayapple
(Podophyllum peltatum) [Berberidaceae] (W.W. Judd,
London, Ontario, 24.VI.1953) (see Judd 1954). Also on
Solidago flexicaulis and S. bicolor (Asteraceae) (Tom-
kins Co., New York [CUIC]). In southeastern Canada,
where H. aeglealis is common, Asarum canadense, Os-
munda claytoniana, and Woodwardia virginica usually
are present. For Québec (see Rousseau 1972), Asarum
canadense is most common of these three host plants, es-
pecially in maple groves (Rousseau, 1974). It is a moth of
mesic woods, open boggy habitats, humid maple groves,
and maple groves on mountain slopes.
Flight period. It is nocturnal and comes freely to light.
According to Joachim Lafrance (personal notes taken
from 1965 to 1969 in Sainte-Clotilde, Québec) the moth
flies from the beginning of the night up to three o’clock
in the morning.
Bonn zoological Bulletin 70 (1): 173-199
Note. It is a variable species, some specimens first ap-
pearing in June are pale, with forewings looking paler
and having orangish to pinkish hue; some of these speci-
mens have been submitted to BOLD and, without doubt,
they are all H. aeglealis. The dark form (male: Fig. 31,
female: Fig. 32) is easy to distinguish from H. sphingea-
lis by the smaller wingspan, and the postmedial line has
pale outside the line in H. aeglealis. That dark form is
rare in males, commoner in females.
Remarks: Specimens reared by Dr Bernard Landry
on Pedicularis canadensis were in fact Herpetogram-
ma nymphalis sp. n. and H. aquilonalis sp. n., and not
H. pertextalis as identified by Landry (1993).
Herpetogramma sphingealis Louis Handfield & Daniel
Handfield, 2011 (801192, MONA 5279,1)
Pl. 3, Figs 33-34 (adults); Pl. 6, Figs 53-54 (¢ gen.);
Pl. 8, Fig. 62 (2 gen.).
Synonym: H. aeg/ealis auct. (in part).
Type material. | ¢ from the mountain of Rougemont
[45°28°026” N, 73°04’029” W.], Rougemont, Québec,
Canada (in CNC) (Handfield & Handfield 2011).
Diagnosis. Adult male (Fig. 33). Wingspan 34—
37 mm. Upperside of head, palpi (except tufts at base),
prothoracic collar, and upperside of thorax and abdomen,
concolourous, chocolate brown, fading to a slightly paler
brown with age; antenna filiform, finely ciliate on under-
side, each segment concolourous dorsally with upper sur-
face of head; upperside of abdomen concolourous with
wings, except for posterior brownish-yellow tuft cover-
ing valvae; maxillary palpi, legs, and underside of head,
thorax, abdomen white, being a beautiful flashing white
in living specimens; dark brown band (nearly width of
eye on side of head) and including the top of the maxil-
lary palpi and chaetosema, gives head appearance of hav-
ing a longitudinal mask; eye black with greenish bands.
Forewing chocolate brown, concolourous with upper-
side of head, thorax, abdomen, fading slightly to a pal-
er brown with age; apex acutely angled; postmedial line
slightly zigzagging from costa to halfway down wing,
then turning abruptly inward at nearly right angle to posi-
tion below reniform spot before turning downwards and
zigzagging to posterior margin of wing; no other lines
visible (except sometimes a vague trace of an outward
curved antemedial line); other marks on forewing are
a white patch on fringe at anal angle, two black dots at
position of orbicular and the reniform spots, a cream-co-
loured rectangular patch between two black dots, and a
dark terminal line at base of fringe; fringe concolourous
with wing except for white anal patch and slightly dark-
er shading on veins. Hindwing concolourous with fore-
wing, including fringe; fringe with dirty white shading at
anal angle; transverse lines not visible or barely evident;
discal spot black, rounded (more elongated in H. aeglea-
lis); a creamy-white patch towards upper margin of wing
©ZFMK
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 195
Figs 59-62. 59. Herpetogramma thestealis female PYR 762: Canada, BC, Vancouver, Stanley Park, 49.063° N, 123.1528° W,
24.vi1.2007, A. Li. 60. Herpetogramma nymphalis sp. n. female PYR 1302: Canada, QC, Gatineau, Gatineau Park, Mont King,
24.v.1989, B. Landry. 61. Herpetogramma aeglealis female PYR 546: Canada, QC, Mont-St-Hilaire, 45°31.758’ N, 73°10.723’ W,
5.vii.2008, Louis Handfield. 62. Herpetogramma sphingealis female PYR 550: Canada, QC, Otterburn Park, Les Bosquets Hudon,
5.vil1.2006, Louis Handfield.
Bonn zoological Bulletin 70 (1): 173-199 ©ZFMK
196
base (usually hidden by overlapping posterior margin of
forewing). Fringes of all wings even, not crenate. Under-
side of all wings, including fringes, a dark grey, fading
to a paler whitish grey towards wing base with white at
base near pure white thorax, especially along inner mar-
gin of hindwing; small creamy patch between orbicular
and reniform dots on forewing. Discal spot on hindwing
often barely evident. Legs mainly pure white, sometimes
with brownish scales on upperside of anterior and poste-
rior legs. Adult female (Fig. 34). Wingspan 31-34 mm
(H. aeglealis 27-31 mm). Essentially same as for male
except forewing larger, less elongated (more squared at
apex); colour of wings a pale chocolate brown, transverse
lines more contrasting. Hindwing as for male, but colour
fading near base, sometimes showing a vague trace of
a postmedial line (Handfield & Handfield 2011). Solis
(2010, fig. 2) illustrated a male of H. sphingealis under
the name H. aeglealis (H. sphingealis was not yet de-
scribed at that time). Male genitalia. Figs 53-54. Valves
and genital capsule as described for genus. Phallus
10.0-10.6 mm long, % x longer than vesica; vesica with
gourd-shaped diverticulum on right with narrow apical
part of diverticulum wider than for H. aeglealis; spined
diverticulum 2 way toward apex of vesica. Female gen-
italia. Fig. 62. Anterior part of corpus bursae with length
2 x width, 3 x length of narrower posterior part, and 3 x
length of ductus bursae.
Distribution. The distribution of Herpetogramma
sphingealis apparently covers the distribution of its
only host plant in North America, although there has
not been enough sampling in the Maritime Provinces
to confirm this. The moth is known from southern Qué-
bec and southern Ontario (Wilson Tract, Norfolk Co.,
25.vii.2008) in Canada [see www.ontariomoths.com/
herpetogramma-sphingealis/]; it has not yet been col-
lected in eastern Ontario. Christmas fern is common in
some areas of Eastern Ontario (e.g., Larose Forest near
Ottawa), but up to 2020 no H. sphingealis has been seen
or collected there (Diane Lepage, comm. pers.). In the
United States, it is known from all Eastern United States
from Maine [River Point Bird Observatory], New Hamp-
shire, Vermont, New York to Northern Florida (Torreya
State Park, Liberty Co., Florida [James Hayden, in Iitt.]),
and eastern parts of Central United States from Michi-
gan, Minnesota to Louisiana. It is a moth occurring in the
darkest areas of rich xeric forests, with maples and oaks,
especially rocky, hilly, maple groves where Christmas
fern occurs commonly (Handfield & Handfield 2011).
Biology. As far as known the host plant is exclusively
Polystichum acrostichoides (Dryopteridaceae) (Ruehl-
mann et al. 1988 [under H. aeglealis|, Handfield & Hand-
field 2011); the larva makes a shelter like a round hut by
folding and tying several leaves generally at the tip of the
fern. It is the only member of Canadian Herpetogramma
proven to be specialized on its hostplant.
Bonn zoological Bulletin 70 (1): 173-199
Louis Handfield & Daniel Handfield
Flight Period. The moth is nocturnal, flying as soon
as the dusk is dying, and comes to light. On the slopes of
Mount Rougemont (Québec), the moth is commoner be-
fore the full moon of July, rarer during the full moon, and
common again after the full moon. Could it be due to its
dark colouring, it is much more visible for owls and bats
and other birds, so the moth is not flying much during the
full moon or is it only due to interference between the
moon and the artificial light? Based on our experience,
the moth is not flying much during that period even if
moonrise is later in the night; anyway it does not fly after
midnight. It is one of the most striking and beautiful Her-
petogramma to see flying and coming to lights.
Note on Herpetogramma fluctuosalis (Lederer, 1863)
Herpetogramma fluctuosalis (Lederer, 1863) (801195,
MONA 5244) was cited from Québec by Louis Hand-
field (1997), on the basis of one specimen from Sainte-
Anne-de-Bellevue (Québec) in the collection of the Ly-
man Entomological Museum (LEM) identified under
that name. This data led Gregory H. Pohl et al. (2018)
to erroneously include that species from Québec in their
checklist of the Lepidoptera of Canada and Alaska. The
specimen in question is in fact a Parapoynx allionealis
(WIk., 1859) (Pyralidae: Acentropinae) (800739, MONA
4764) misidentified. Consequently, H. fluctuosalis has to
be removed from the lists of Lepidoptera of Québec and
of Canada.
Herpetogramma fluctuosalis is present from Mary-
land to Florida and Texas (Solis 2010), including Geor-
gia, Missouri, Oklahoma, South Carolina and Tennessee
(BugGuide, www.bugguide.net, visited 30.1x.2020). It
feeds on Jpomoea batatas (Convolvulaceae) (Solis 2010).
Conclusion
Our paper presents the first systematic revision of the
highly variable Herpetogramma species from Canada,
with description of three new species. Vesica characters
of the male genitalia were significant in distinguishing
species morphologically. We did not include distribution
maps in this paper, as the paucity of data for nearly all
Canadian Provinces and Territories precludes the utility
of such maps. Indeed, with the extensive data available
from Ontario and Québec, maps would be misleading
and would suggest that Ontario and Québec are the world
capital of the genus Herpetogramma! Undoubtedly,
many questions remain unresolved, especially concern-
ing hostplants, but the fact is that the taxonomy of this
genus has always been a real puzzle. Now we hope that
other researchers will follow up with a revision of Herpe-
togramma species of the United States. With the present
work, the total number of Herpetogramma species for
North America is thirteen, but we expect that additional
species remain to be found. Vesica characters of the male
©ZFMK
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 197
genitalia were significant in distinguishing species mor-
phologically.
Acknowledgements. First, thanks are due to Dr J. Donald La-
fontaine for his constant support and encouragements since the
beginning of this project and his help in finding types in the
British Museum, and data in the USNM, preparation of spec-
imens for BOLD, and preparation of genitalic dissections; to
Jocelyn Gill for her preparation of the figures of specimens and
genitalic armatures; to Dr Jean-Francois Landry for his pre-
cious contribution to the preparation of the barcode tree, his
helpful comments, and for sampling of the specimens for DNA
barcoding and search of data at the USNM; to Dr Paul D.N.
Hebert and the Canadian Centre for DNA Barcoding (“BOLD”)
for his constant support and the barcoding of specimens of Her-
petogramma, and permission to use the sequence analysis; to
Dr David L. Wagner for providing his data on host plants and
specimens; to Dr Alma Solis (USNM) for providing the pho-
tograph and data of the Lederer type in the Vienna Museum
and for providing specimens for study; to Dr James Hayden
(FSCA) for providing data and photographs of specimens in the
Florida State Collection of Arthropods, Gainesville, Florida; to
Dr Kevin Tuck (NHMUK) for finding the type of H. abdomi-
nalis Zell. in the British Museum of Natural History, and his
permission to use photographs and data; to Suzanne Rab Green
(AMNH) for her support and help in finding Herpetogramma
data in the AMNH, New York; to Sarah Lee (UWOC) for her
help in finding Herpetogramma specimens from Dr W.W. Judd
in the collection of the Department of Biology, University of
Western Ontario, London, Ontario; to Dr Jason J. Dombroskie
(CUIC), for his help and assistance when the authors visited the
Cornell University Insect Collection Cornell University, Ithaca,
New York, and further helpful comments; to Suzanne Fauteux
for her constant support, the reading of the manuscript and her
helpful comments; to Norman Handfield (Mont-Saint-Hilaire)
for his support and providing Herpetogramma data from his
collection; to Alain Charpentier (Saint-Hyacinthe and Maria),
to Léo-Paul Landry (Saint-Mathieu-du-Parc), to Normand
Juneau (Saint-Maurice), to Claudette Cormier (Canton-Trem-
blay), to Eric Rassart (Brossard), to Kenneth (Ken) Stead
(Port Franks, Ontario), to Tommy Thouin (Joliette), to Carle
Bélanger (Havre-Saint-Pierre), to Daniel Abraham and Nath-
alie Michel (St-Pierre, Iles-St-Pierre-et-Miquelon, France),
all for providing data and specimens; to Lucie d’Amours and
Sandrine Papageorges (Havre-aux-Maisons, Iles-de-la-Made-
leine, Québec) for collecting Herpetogramma on the Magdalen
Islands; to Louise Cloutier (UdeM) for permitting access to the
Ouellet-Robert Collection (Université de Montréal); to Dr Ter-
ry Wheeler (7) and Dr Stéphanie Boucher (LEM) for permit-
ting access to the Lyman Entomological Museum (McGill Uni-
versity, Sainte-Anne-de-Bellevue); and also to Dr Stéphanie
Boucher who searched for and found the specimen identified as
H. fluctuosalis and for taking photographs and notes; to Diane
Lepage (St. Albert, Ontario) for permitting to use her photo-
graphs of living specimens and for her search for H. sphingealis
in Forét Larose and around in the Ottawa area; to Danny Shpe-
ley (UASM), assistant curator (E. H. Strickland Entomological
Museum, University of Alberta, Edmonton), for taking pho-
tographs of the Herpetogramma specimens in the Strickland
Entomological Museum, University of Alberta, Edmonton; to
Laurent Le Sage (7) (Aylmer) for transmitting the story about
the little nymphs haunting at night the top of King Mountain, in
Bonn zoological Bulletin 70 (1): 173-199
Gatineau Park; and to Théo Léger and one anonymous reviewer
for their helpful comments to improve the manuscript.
REFERENCES
Adams SA, Morse DH (2014) Condition-dependent mate
choice of a parasitoid wasp in the field. Animal Behaviour
88: 225-232
Allyson S (1984) Description of last-instar larvae of 22 spe-
cies of North American Spilomelini (Lepidoptera: Pyralidae:
Pyraustinae) with a key to species. The Canadian Entomolo-
gist 116 (10): 1301-1334
Bae Y-S, Byun B-K, Paek M-K (2008) Pyralid Moths of Ko-
rea (Lepidoptera: Pyraloidea). Korea National Arboretum,
Seoul, Korea
Covell CV jr (1984) A Field Guide to the Moths of Eastern
North America. Houghton Mifflin Company, Boston
Forbes WTM (1923) The Lepidoptera of New York and Neigh-
boring States. Cornell University Agricultural Experiment
Station, Mem 68, Ithaca, New York
Gannon M (2013) History of Florida. University Press of Flor-
ida, Gainesville, Florida
Grote AR (1873) XI. Kleiner Beitrag zur Kenntniss einiger
Nordamerikanischer Lepidoptera. Bulletin of the Buffalo So-
ciety of Natural Sciences 1: 168-174
Grote AR (1882) North American moths, with a preliminary
catalogue of the species of Hadena and Polia. Bulletin of
the Geological and Geographic Survey of the Territories 6
(QE 25 7=277
Guillermet Ch (2009) Les Hétéroceéres ou papillons de nuit de
Vile de La Réunion vol 3 Famille des Pyralidae et Crambi-
dae. La Réunion
Handfield L, Handfield D (2011) A new species of Herpeto-
gramma (Lepidoptera, Crambidae, Spilomelinae) from east-
ern North America. ZooKeys 149: 5-15
Handfield L (1997) Liste des Lépidopteres du Québec et du La-
brador. Fabreries Suppl 7: 1-155
Heppner JB (2003) Lepidoptera of Florida. Part 1. Introduc-
tion and Catalog. Arthropods of Florida and Neighboring
Land Areas vol. 17. Florida Department of Agriculture and
Consumer Services, Division of Plant Industry, Gainesville,
Florida
Hinds HH (2000) Flora of New Brunswick. University of New
Brunswick, Fredericton, New Brunswick
Holland WJ (1903) The Moth Book. Doubleday, Page & Com-
pany, New York
Judd WW (1954) Four species of leaf-tying moths and their
dipterous parasites reared from mayapple, Podophyllum pel-
tatum L. Transactions of the American Microscopical Soci-
ety 73 (4): 401-404
Kimball CP (1965) The Lepidoptera of Florida an annotated
checklist. Arthropods of Florida and Neighboring Land Ar-
eas, vol. 1. Florida Department of Agriculture, Division of
Plant Industry, Gainesville, Florida
Kristensen NP (2003) Skeleton and muscles: adults. Pp. 39-131
in: Kristensen, Niels P. (ed.) Lepidoptera, moths and butter-
flies. Vol. 2: Morphology, physiology, and development. M.
Fischer, Handbook of Zoology IV (36). Walter de Gruyter,
Berlin and New York
Lafontaine JD (2004). Noctuoidea, Noctuidae (part) Noctuinae,
Agrotini in: Hodges RW. (ed.) The Moths of North America,
fasc. 27.1
©ZFMK
198 Louis Handfield & Daniel Handfield
Landry B (1993) La Pédiculaire du Canada (Pedicularis
canadensis L., Scrophulariacées) comme plante-hdte de Lé-
pidopteres dans |’Outaouais. Fabreries 18 (1): 1-10
Landry B (2016) Taxonomic revision of the Spilomelinae (Lep-
idoptera, Pyralidae s. 1.) of the Galapagos Islands, Ecuador.
Revue Suisse de Zoologie 123 (2): 315-399
Lara-Villalon M, Mora-Olivo A, Sanchez-Ramos JG,
Martinez-Avalos JG (2014) Registro de Herpetogramma
bipunctalis (Lepidoptera: Pyralidae: Crambidae) sobre la
invasora Alternanthera philoxeroides (Amaranthaceae) en
Tamaulipas, México. Revista Mexicana de Biodiversidad 85
(2): 621-623
Marie-Victorin Frere (1995) Flore Laurentienne, 3° éd. Les
Presses de |’ Université de Montréal, Montréal, Canada
Marineau K, Dion M-E (2008) Inventaire de la végétation ter-
restre du Mont Royal. Ville de Montréal, Montréal, Canada
Munroe EG (1983) Pyralidae (except Crambinae). In: Hodges
RW et al.(eds). Check List of the Lepidoptera of America
north of Mexico including Greenland. E.W. Classey Limited
and The Wedge Entomological Research Foundation. Lon-
don, England Munroe EG (1995a) Crambidae (Crambinae,
Schoenobiinae, Cybalomiinae, Linostinae, Glaphyriinae,
Dichogaminae, Scopariinae, Musotiminae, Midilinae, Nym-
phulinae, Odontiinae, Evergestinae, Pyraustinae). Pp. 60-
79 in: Heppner JB (ed.) Atlas of Neotropical Lepidoptera.
Checklist: Part 2. Hyblaeoidea — Pyraloidea — Tortricoidea 3.
Association for Tropical Lepidoptera & Scientific Publishers,
Gainesville, Florida
Munroe EG (1995b) Galleriinae. In: Heppner JB (ed.) Atlas
of Neotropical Lepidoptera Checklist: Part 2. Hyblaeoidea
— Pyraloidea — Tortricoidea 3. Association for Tropical Lepi-
doptera & Scientific Publishers, Gainesville, Florida
O’Neill JJ (1914) St. Hilaire (Beloeil) and Rougemont Moun-
tains, Quebec. Mem 43, Geological Survey, Department of
Mines. Ottawa, Canada
Pohl GR, Cannings RA, Landry J-F, Holden DG, Scudder GGE
(2015) Checklist of the Lepidoptera of British Columbia,
Canada. Entomological Society of British Columbia, Occa-
sional Paper No. 3
Pohl GR, Landry J-F, Schmidt BC, Lafontaine JD, Troubridge
JT, Macaulay AD, van Nieukerken EJ, DeWaard J, Dom-
broskie JJ, Klymko J, Nazari V, Stead K (2018) Annotated
Checklist of the Moths and Butterflies (Lepidoptera) of Can-
ada and Alaska. Pensoft, Series Faunistica 118, Sofia, Bul-
garia
Bonn zoological Bulletin 70 (1): 173-199
Powell JA, Opler PA (2009) Moths of Western North America.
University of California Press, Berkeley and Los Angeles,
California
Rousseau C (1968) Histoire, habitat et distribution de 220
plantes introduites au Québec. Le Naturaliste Canadien 95:
49-169
Rousseau C (1974) Géographie floristique du Québec — Labra-
dor. Les Presses de |’ Université Laval, Québec
Ruehlmann TE, Matthews RW, Matthews JR (1988) Roles for
structural and temporal shelter-changing by fern-feeding lep-
idopteran larvae. Oecologia (Berlin) 75: 228—232
Schaffer JC, Munroe E (2003) (2007) Crambidae of Aldabra
Atoll (Lepidoptera: Pyraloidea). Tropical Lepidoptera Re-
search 14 (1-2): 1-114
Scholtens BG, Solis MA (2015) Annotated checklist of the
Pyraloidea (Lepidoptera) of America North of Mexico. Zoo-
Keys 535: 1-136. https://doi.org/10.3897/zookeys.535.6086
Scoggan HJ (1957) Flora of Manitoba. National Museum of
Canada, Bull. 141. Ottawa, Canada
Solis MA (2010) North American Herpetogramma Lederer,
1863 (Lepidoptera: Crambidae: Spilomelinae): Type speci-
mens and identity of species in the United States and Cana-
da. Proceedings of the Entomological Society of Washington
112 (3): 451-463
Tietz HM (1972) An Index to the Described Life Histories, Ear-
ly Stages and Hosts of the Macrolepidoptera of the Continen-
tal United States and Canada, vol.1, The Allyn Museum of
Entomology, Sarasota, Florida
Tofangsazi N, Arthurs SP, Cherry R (2012 rev. 2015) Tropi-
cal Sod Webworm Herpetogramma phaeopteralis Guenée
(Insecta: Lepidoptera: Crambidae). Publ. EENY-541-Ento-
mology and Nematology Department, UF/IFAS Extension,
University of Florida, Gainesville, Florida
Walker F (1858-1866) List of the specimens of lepidopterous
insects in the collection of the British Museum, Parts 16-19,
27, 31, 33-35. Edward Newman, London, 1—253; 254-508;
509-798: 799-1036; 1-286; 1-706; 707-1120; 1121-1533;
1536-2040
Wilbur RL, Hespenheide HA (1967) The Genus Clethra (Cle-
thraceae) in the United States. The Journal of the Elisha
Mitchell Scientific Society 83 (2): 82-88
Winn AF (1912) A preliminary list of the insects of the Province
of Quebec, Part 1 — Lepidoptera. Supplement to Report of
the Quebec Society for the Protection of Plants, Montréal,
Québec
©ZFMK
A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 199
APPENDIX I
Barcode Tree (according to BOLD as of 30.1x.2020).
BIOUG20646-B08|Ontario Phaeopteralis BOLD:ABY 7602
CNCLEP00119992|Ontario
CNCLEP00119991|Ontario bipunctalis BOLD:AAC4123
DH005997|Quebec
MDH006457|Quebec
MDH005843|Quebec
MDH006113|Quebec
MDH006046|Quebec
MDH008775|Quebec
MDH013988|Quebec
MDH006048|Quebec
MDH006045|Quebec
MDH006027|Quebec
MDH004726|Quebec
CNCLEP00089828|Quebec
MDH002657|Quebec
MDH006479|Quebec
ICNCLEP00041082|Manitoba
MDH002335|Quebec
CNCLEP00027593|Quebec
— CNCLEP00040473|Manitoba
CNCLEP00089827|Quebec
CNCLEP00089826|Quebec
MDH013867|Quebec
UBC-2006-0451|British Columbia
UBC-2006-0452)British Columbia
UBC-2006-0453)British Columbia
UBC-2006-0948|British Columbia
CNCLEP0002757 1|Quebec
MDH002175|Quebec
MDH010174|Quebec
CNCLEP 00116358|Quebec
CNCLEP00138847|Quebec
DH006034|Quebec
CNCLEP 00119650|Quebec
CNCLEP 00119649)|Ontario
CNCLEP 00119648/Ontario fraxinalis BOLD:AAA2323
CNCLEP 00116357|Quebec
CNCLEP00138877|Quebec
CNCLEP00138845|Quebec
CNCLEP00138842|Quebec
CNCLEP00138841|Quebec
MDH006036|Quebec
CNCLEP00138844|Quebec
| [yj CNCLEP00089829|Quebec
DH005739|Quebec
LH2015-06|Quebec
LH2015-04|Quebec
LH2015-02|Quebec
LH2015-01|Quebec
CNCLEP00121457|Quebec
——.MDH001737|Quebec
MDH003649|Quebec
aquilonalis BOLD:AAA2323
thestealis BOLD:AAA2323
BIOUG26008-D05|Ontario
CNCLEP00119993|Ontario
4 CNCLEP00121794|Ontario
MDH009784|Quebec
CNCLEP00040836|Manitoba
CNCLEP00040834|Manitaba
ICNCLEP00040835|Manitoba
CNCLEP00089831|Quebec
jCNCLEP00089832|Quebec
‘CNCLEP00089833|Quebec
pertextalis BOLD:AAA2323
nymphalis BOLD:ABY4315
DH005925|Quebec
MDH006030|Quebec
DH005925.2|Quebec
CNCLEP00224870|Ontario
MDH006040|Quebec
MDH006041|Quebec
CNCLEP00075074|Ontario
yCNCLEP00075073)|Ontario
'MDH006044|Quebec
MDH006033|Quebec
MDH006034|Quebec
MDH006459|Quebec
MDH004788|Quebec theseusalis BOLD:AAH4936
sphingealis BOLD:AAA2324
aeglealis BOLD:AAA2324
0.5%
Bonn zoological Bulletin 70 (1): 173-199 ©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 70 (1): 201-219
2021 Le. Dil -etale
https://do1.org/10.20363/BZB-2021.70.1.201
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org:pub: 1 DF3ECBF-A4B1-4C05-BC76-1E3C772B4637
New records and an updated checklist of amphibians and snakes
from Tuyen Quang Province, Vietnam
Dzung Trung Le’, Anh Mai Luong’, Cuong The Pham’, Tien Quang Phan‘, Son Lan Hung Nguyen’,
Thomas Ziegler® & Truong Quang Nguyen”
' Ministry of Education and Training, 35 Dai Co Viet Road, Hanoi, Vietnam
2° Hanoi National University of Education, 136 Xuan Thuy Road, Hanoi, Vietnam
237 Institute of Ecology and Biological Resources, Graduate University of Science and Technology, Vietnam Academy of Science
and Technology, 18 Hoang Quoc Viet Road, Hanoi, Vietnam
°AG Zoologischer Garten K6In, Riehler Strasse 173, D-50735 Kéln, Germany
° Institut fiir Zoologie, Universitat K6éln, Ziilpicher Strasse 47b, D-50674 KéIn, Germany
“Corresponding author: Email: [email protected]
'urn:|sid:zoobank.org:author:2C2D01BA-E10E-48C5-AE7B-FB8170B2C7D1
> urn:Isid:zoobank.org: author: 8F25F198-AOF3-4F30-BE42-9A F3A44E890A
3urn:|sid:zoobank.org:author:24C 187A9-8D67-4DOE-A 171-1885A25B62D7
*urn:lsid:zoobank.org:author:555 DF82E-F461-4EBC-82FA-FFDABE3BFFF2
>urn:|sid:zoobank.org:author:7 163A A50-6253-46B7-9536-DE7F8D81A14C
°urn:|sid:zoobank.org:author:5716DB92-5FF8-4776-ACC5-BF6FA8C2E1 BB
7urn:lsid:zoobank. org:author:822872A6-1C40-461F-AAOB-6A20EEQN6ADBA
Abstract. We provide a checklist of 57 species of amphibians and 42 species of snakes from Tuyen Quang Province,
northern Vietnam. Ten species of amphibians and five species of snakes were recorded for the first time from Tuyen Quang
Province. Based on the new herpetological collection from this province we provide the descriptions of newly recorded
species. The herpetofauna of Tuyen Quang Province contains a high level of conservation concern with four species
endemic to Vietnam, eight species listed in the IUCN Red List, 16 species listed in the Red Data Book of Vietnam, three
species listed in the Vietnam Governmental Decree No 06/2019/ND-CP, and three species listed in the CITES appendices.
Key words. Amphibians, morphology, new records, snakes, taxonomy, Tuyen Quang Province.
INTRODUCTION
Limestone karst forests in Southeast Asia harbor an ex-
tremely rich biodiversity, which includes various site-en-
demic taxa (Clements et al. 2006), and species commu-
nities on different karst formations in the same overall
region can differ from each other considerably (Clements
et al. 2006; Sterling et al. 2006; Webb et al. 2010). Re-
cent new discoveries of snakes from northern Vietnam
showed the high potential of species diversity from lime-
stone karst forests, for instance Achalinus timi Ziegler,
Nguyen, Pham, Nguyen, Pham, van Schingen, Nguyen &
Le, 2019 from Son La Province, Parafimbrios vietna-
mensis Ziegler, Ngo, Pham, Nguyen, Le & Nguyen, 2018
from Lai Chau Province, and Achalinus juliani Ziegler,
Nguyen, Pham, Nguyen, Pham, van Schingen, Nguyen &
Le, 2019, Lycodon pictus Janssen, Pham, Ngo, Le, Nguy-
en & Ziegler, 2019 and Sinomicrurus peinani Liu, Yan,
Hou, Wang, Nguyen, Murphy, Che & Guo, 2020 from
Received: 14.12.2020
Accepted: 05.05.2021
Cao Bang Province (Ziegler et al. 2007, 2018a, 2018b,
2019a, 2019b; Nguyen et al. 2018; Janssen et al. 2019;
Liu et al. 2020).
Tuyen Quang Province is located in northeastern
Vietnam with a complex terrain of limestone karst and
lowland areas with elevations of 200-600 m above sea
level (Sterling et al. 2006). In terms of the herpetofau-
nal diversity, Tuyen Quang Province is one of the most
poorly studied provinces in northern Vietnam. Le et al.
(2007) documented a list of 43 species of reptiles and
amphibians from three districts of Chiem Hoa, Na Hang
and Son Duong. Nguyen et al. (2009) recorded 41 species
of reptiles and amphibians from Tuyen Quang Province.
Phan et al. (2018) recently provided a list of 40 species of
snakes from this province.
As a result of our recent field surveys in Tuyen Quang
Province between 2017 and 2018, we herein provide a
checklist of 57 species of amphibians and 42 species of
snakes, including 15 new records from this province.
Corresponding editor: W. Bohme
Published: 26.05.2021
202 Dzung Trung Le et al.
MATERIAL AND METHODS
Sampling. Field surveys were conducted by Cuong The
Pham, Truong Quang Nguyen, Anh Mai Luong, Tien
Quang Phan, Dzung Trung Le, and Hoa Thi Ninh (here-
after Pham et al.) from 22 August to 2 September 2017
and from 13 to 24 June 2018 in Lam Binh and Na Hang
districts of Tuyen Quang Province (Fig. 1). The coor-
dinates (WGS 84) were determined by using the GPS
Garmin ver. 60CX.
Specimens were collected between 19:00 and 24:00
hours. After photographing in life, specimens were eu-
thanized in a closed vessel with a piece of cotton wool
containing ethyl acetate (Simmons 2002), fixed in 80%
ethanol for five hours, and then later transferred to 70%
ethanol for permanent storage. Tissue samples (muscles
from thigh) were preserved separately in 70% ethanol
prior to fixation. Specimens referred to in this paper are
deposited in the collections of the Institute of Ecology
and Biological Resources (IEBR) and the Vietnam Na-
tional Museum of Nature (VNMN), Hanoi, Vietnam.
Morphological examination. Measurements were taken
in preserved specimens with a digital caliper to the near-
est 0.1 mm.
For amphibian specimens, the following Abbrevia-
tions used in the text
SVL = Snout-vent length
HL = = Head length (from the back of mandible to
tip of snout)
HW = Maximum head width (across angles of jaws)
SL = Snout length or rostral length (from anterior
corner of orbit to the tip of snout)
NS = Distance from nostril to the tip of snout
EN — = Distance from anterior corner of orbit to nostril
IND = Internarial distance
IOD- = Interorbital distance
ED = Eye diameter
UEW = Maximum width of upper eyelid
DAE = Distance between anterior corners of orbits
MN~ = Posterior margin of mandible to nostril
MFE = Posterior margin of mandible to anterior
corner of orbit
MBE = Posterior margin of mandible to posterior
corner of orbit
DPE = Distance between posterior corners of orbits
TD = = Tympanum diameter
TYE = Distance from anterior margin of tympanum
to posterior corner of orbit
FLL = forearm length, from elbow to base of outer
palmar tubercle
HAL = hand length, from base of outer palmar
tubercle to tip of third finger
FL1 = Finger length I-IV
Bonn zoological Bulletin 70 (1): 201-219
Fig. 1. Map of sampling locations (black circle) in Tuyen
Quang Province, northern Vietnam.
OPT = Outer palmar tubercle length
IPT = Inner palmar tubercle length
NPL = Nuptial pad length
FeL = Femur length (from vent to knee)
TbL = Tibia length (from knee to tarsus)
TbW = Maximum tibia width
FoL = Foot length (from tarsus to the tip of 4" toe)
TL1—5 = Toe length I-V
IMT = Inner metatarsal tubercle length
For webbing formula we followed Glaw & Vences
(2007). Sex was determined by the presence of nuptial
pads and based on gonadal inspection.
For snake specimens, measurements were taken after
preservation with a measuring tape. The number of ven-
tral scales was counted according to Dowling (1951). The
dorsal scale rows were given at one head length behind
head, at midbody, and at one head length before vent,
respectively. Scalation was studied by using a stereo mi-
croscope (Leica M80). Bilateral scale counts were given
as left/right. Identification of sex was made by inspection
of presence of hemipenes.
Specimen identification. For taxonomic identifica-
tion, we referred to Bourret (1936, 1942), Smith (1943),
Liu (1950), Taylor (1962), Manthey & Grossmann
(1997), Dubois & Ohler (1998), Lathrop et al. (1998),
©ZFMK
New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 203
Ziegler & Kohler (2001), Ziegler (2002), Leviton et al.
(2003), Bain et al. (2004), Ohler (2003), Ohler & Delo-
rme (2006), Nguyen (2007), Fei et al. (2008), Stuart &
Heatwole (2008), Fei et al. (2009), Vogel et al. (2009),
Inger & Stuart (2010), Nguyen et al. (2011), Chen et al.
(2013), Hecht et al. (2013), Luu et al. (2013), Nemes
et al. (2013), Ostroshabov et al. (2013), Le et al. (2014a,
b), Neang et al. (2014), Nguyen et al. (2016a, b), Pham
et al. (2016, 2017), Nguyen et al. (2018), Janssen et al.
(2019), and Yu et al. (2019). Species names follow Nguy-
en et al. (2009), Frost (2020), and Uetz et al. (2020).
RESULTS
Taxonomic accounts
Family Megophryidae
Leptobrachella sungi (Lathrop, Murphy, Orlov & Ho,
1998)
Sung’s Toad / Coc may sung (Fig. 2a)
Specimens examined (n = 4). One adult male IEBR
4583 (Field number TQ.2017.50) collected by Pham
et al. on 27 August 2017, near Trung Phin Village
(22°29.584' N/105°23.586' E, at an elevation of
844 m asl.), one adult male IEBR 4584 (Field number
TQ.2017.80) collected by Pham et al. on 29 August 2017,
near Trung Phin Village (22°30.634' N/105°24.304' E,
at an elevation of 926 m asl.), Sinh Long Commune,
Na Hang District, two adult males IEBR 4585, 4586
(Field numbers TQ.2017.123, 126) collected by Pham
et al. on 1* September 2017, near Na Phuong Vil-
lage (22°31.574' N/105°16.966' E, at an elevation of
147 m asl.), Thuong Lam Commune, Lam Binh District.
Description. Morphological characters of the speci-
mens from Tuyen Quang Province agreed well with the
descriptions of Lathrop et al. (1998) and Luong et al.
(2019): SVL 47.6-59.0 mm; head longer than wide
(HL 22.4—-26.0 mm, HW 19.0-22.6 mm); snout dis-
tinctly pointed in dorsal view, longer than eye diameter
(SL 8.3-9.6 mm, ED 7.5—8.0 mm); nostril oval, lateral-
ly positioned, closer to the tip of snout than to eye (NS
3.0-4.0 mm, EN 4.8—5.5 mm); canthus rostralis distinct,
loreal region concave; eye large, approximately twice
diameter of tympanum (TD 2.7—3.8 mm), tympanum
round, indistinct; supratympanic fold distinct, extending
from posterior corner of the eye to a point behind artic-
ulation of jaw; vomerine teeth absent; tongue notched
posteriorly.
Forelimbs: FLL 11.6—15.4 mm, relative finger lengths
I=II<IV<III, tips of fingers not enlarged into discs; web-
bing absent; subarticular tubercles indistinct; palmar tu-
bercles round, inner one very large.
Bonn zoological Bulletin 70 (1): 201-219
Hindlimbs: Thigh short (FL 23.0—27.3 mm); tibia four
times longer than wide (TbL 22.9-27.9 mm, TbW 5.2—
7.5 mm); relative toe lengths I<II<V<HI<IV; webbing
rudimentary between toes I-IV and absent between IV
and V; subarticular tubercles indistinct; inner metatarsal
tubercle oval; outer metatarsal tubercle absent.
Skin: Dorsal surface of head and body, upper part of
flanks with dispersed tubercles; upper eyelid granular;
dorsolateral fold absent; ventral surface smooth.
Coloration in life. Dorsal surface of head and body
brown-copper with a dark bar marking between eyes;
canthus and supratympanic fold brown; upper lip with
dark bars; flanks light brown with dark point, transverse
bars on limbs dark brown; ventral surface opaque white.
Ecological notes. Specimens were found between
19:00 and 21:00 hours on stream shore. The surrounding
habitat was secondary forest of medium and small hard-
woods and shrub.
Distribution. This species is currently known only
from northern Vietnam: Dien Bien, Lao Cai, Yen Bai, and
Vinh Phuc provinces (Nguyen et al. 2009; Luong et al.
2019). Elsewhere, the species is known from southern
China (Frost 2020).
Leptobrachium chapaense (Bourret, 1937)
Chapa Spadefoot Toad / Coc may sa pa (Fig. 2b)
Specimens examined (n = 2). One adult female
IEBR 4587 (Field number TQ.2017.90) collected by
Pham et al. on 30 August 2017, near Na Phuong Vil-
lage (22°28.347' N, 105°21.454' E, at an elevation of
117 m asl.), Thuong Lam Commune, Lam Binh Dis-
trict and one adult female IEBR 4588 (Field number
TQ.2018.89) collected by Pham et al. on 17 June 2018,
near Nam Duong Village (22°36.721' N, 105°20.094' E,
at an elevation of 779 m asl.), Sinh Long Commune, Na
Hang District.
Description. Morphological characters of the spec-
imens from Tuyen Quang Province agreed with the
descriptions of Dubois & Ohler (1998); Lathrop et al.
(1998); and Luong et al. (2019): SVL 40.5—57.2 mm;
head longer than wide (HL 19. 8—26.3 mm, HW 18.2—
27.4 mm); snout round, longer than eye diameter (SL
7.2-10.2 mm, ED 6.4—7.5 mm); nostrils oval, laterally
positioned, closer to the tip of snout than to eye (NS
4.6—-5.7 mm, EN 4.0—5.0 mm); canthus rostralis distinct,
loreal region flattened; eye large, approximately twice
diameter of tympanum (TD 2.6—-3.9 mm); tympanum
round, distinct; supratympanic fold distinct, vomerine
teeth absent; tongue notched posteriorly.
Forelimbs: FLL 11.8-16.9 mm, hand length (HAL
24.2—32.4 mm); relative finger lengths I<II<IV<III, tips
of fingers round; webbing absent; subarticular tubercles
distinct; two palmar tubercles round, inner palmar tuber-
cles larger than outer palmar tubercles.
©ZFMK
204 Dzung Trung Le et al.
|
Fig. 2. Dorsolateral view of six newly recorded amphibian species from Tuyen Quang Province. a. Leptobrachella sungi (IEBR
4583). b. Leptobrachium chapaense (IEBR 4587). ¢. Leptobrachium guangxiense (IEBR 4589). d. Megophrys microstoma (IEBR
4590) e. Limnonectes limborgi (IEBR 4593) f. Quasipaa boulengeri (IEBR 4597).
Hindlimbs: Thigh short (FL 17.8—24.8 mm); tibia five
times longer than wide (TbL 15.5—22.24 mm, TbW 3.1—
5.7 mm); relative toe lengths I<II<IH<V<IV; webbing
formula [1—211’4—-21111—31V3-—1V; subarticular tubercles
distinct; inner metatarsal tubercle oval.
Skin: Dorsal surface of head and body, upper part of
flanks smooth; ventral surface smooth.
Bonn zoological Bulletin 70 (1): 201-219
Coloration in life. Dorsal pattern brown with small,
diffuse orange blotches on the sacral region, flanks, and
limbs; ventral surface of limbs black with white reticu-
lations, thigh and knee with dark bars; groin and flanks
black with white pustules.
Ecological notes. Specimens were found between 20:00
and 21:00 hours on the ground. The surrounding habitat
©ZFMK
New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam
was mixed secondary forest composed of small to medi-
um hardwoods and shrubs.
Distribution. In Vietnam, L. chapaensis was known
from Lao Cai and Ha Giang provinces in the North south-
wards to Thua Thien Hue Province (Nguyen et al. 2009;
Luong et al. 2019). Elsewhere, this species 1s known
from China, Laos, Myanmar, and Thailand (Frost 2020).
Leptobrachium guangxiense Fei, Mo, Ye & Yang, 2009
Guangxi Pseudomoustache Toad / Coc may quang tay
(Fig. 2c)
Specimen examined (n= 1). One adult male IEBR 4589
(Field number TQ.2018.151) collected by Pham et al. on
26 June 2018, near Na Phuong Village (22°29.653' N,
105°23.574' E, at an elevation of 857 m asl.), Thuong
Lam Commune, Lam Binh District.
Description. Morphological characters of the spec-
imen from Tuyen Quang Province agreed with the de-
scription of Chen et al. (2013): SVL 60.3 mm. Head wid-
er than long (HL 25.3 mm, HW 25.7 mm); snout round,
longer than eye diameter (SL 10.3 mm, ED 8.7 mm); nos-
trils oval, laterally positioned, closer to the tip of snout
than to eye (NS 5.7 mm, EN 5.5 mm); canthus rostralis
distinct, loreal region concave; eye large, approximately
twice diameter of tympanum (TD 3.8 mm), tympanum
indistinct; supratympanic fold distinct, vomerine teeth
absent; tongue notched.
Forelimbs: FLL 16.1 mm, hand length (HAL 30.8 mm);
relative finger lengths II<I<IV<III, tips of fingers round;
webbing absent; subarticular tubercles distinct; two pal-
mar tubercles round, inner one larger than outer one.
Hindlimbs: Thigh short (FbL 24.9 mm); tibia four
times longer than wide (TbL 22.1 mm, TW 6.2 mm); rel-
ative toe lengths I<H<V<HI<IV; toes with rudiment of
webbing; subarticular tubercles distinct; inner metatarsal
tubercle oval.
Skin: Dorsal surface of head and body, upper part of
flanks smooth; ventral surface smooth.
Coloration in life. Dorsal pattern dark grey with small,
diffused white blotches on the sacral region, flanks, and
limbs; upper surface of limbs with transverse bars; ven-
tral surface dark with white spots.
Ecological notes. Specimen was found at 19:30 hours
on the ground near a small stream. The surrounding hab-
itat was mixed secondary forest composed of small hard-
woods and shrubs.
Distribution. In Vietnam, L. guangxiense was known
from Tam Dao National Park, Vinh Phuc Province. Else-
where, this species is known from China (Frost 2020).
Megophrys microstoma Boulenger, 1903
Asian Mountain Toad / Coc nui mieng nho (Fig. 2d)
Specimens examined (n= 3). One adult male IEBR 4590
(Field number TQ.2017.8) collected by Pham et al. on
Bonn zoological Bulletin 70 (1): 201-219
205
25 August 2017, near Giang Chi Village (22°34.370' N,
105°20.138' E, at an elevation of 802 m asl.), Sinh Long
Commune, Na Hang District and two adult males IEBR
4591, 4592 (Field numbers TQ.2017.111, 112) collect-
ed by Pham et al. on 31 August 2017, near Na Phuong
Village (22°29.221' N, 105°20.830' E, at an elevation of
312 masl.), Thuong Lam Commune, Lam Binh District.
Description. Morphological characters of the speci-
mens from Tuyen Quang Province agreed with the de-
scriptions of Ohler (2003) and Luong et al. (2019): SVL
33.5—-38.4 mm; head wider than long (HL 9.8-11.7 mm,
HW 9.9-11.1 mm); snout truncate, protruding, shorter
than horizontal diameter of eye (SL 2.1-3.2 mm, ED
3.6-3.9 mm); loreal region vertical, concave; nostril
closer to the tip of snout than to eye (NS 1.0—1.2 mm,
EN 1.4—2.1 mm); conical dermal appendix on upper eye-
lid present; eye larger than tympanum (TD 3.0—3.3 mm);
tympanum distinct.
Forelimbs: FLL 6.2—7.3 mm; hand length (HAL 18.2—
20.4 mm), relative finger lengths I<I=IV<III, tips of
fingers round, not enlarged into discs; webbing absent;
subarticular tubercles absent; palmar tubercles indistinct.
Hindlimbs: Thigh short (FeL 17.9-18.3 mm); tibia four
times longer than wide (TbL 17.7—19.0 mm, TbW 3.2—
3.5 mm); relative toe lengths I<IT<V<IHK<IV; tibio-tarsal
articulation reaching eye; webbing rudimentary; subar-
ticular tubercles indistinct; metatarsal tubercle indistinct.
Skin: Dorsal surface shagreened, with symmetric glan-
dular ridges; flank shagreened, covered with granules;
ventral surface smooth.
Coloration in life. Dorsum reddish brown, upper sur-
face of limbs with transverse bars; a light bar present be-
low the eye; flanks with some small black spots; ventral
surface cream with dark marbling.
Ecological notes. Specimens were found between
20:00 and 22:00 hours on tree branches or stones near
rocky streams. The surrounding habitat was secondary
forest of small hardwoods and shrubs.
Distribution. In Vietnam, this species was known
from Lao Cai and Ha Giang provinces in the North south-
wards to Dak Lak and Lam Dong provinces (Nguyen
et al. 2009). Elsewhere, the species is known from China,
Laos, Thailand, and Cambodia (Frost 2020).
Family Dicroglossidae
Limnonectes limborgi (Sclater, 1892)
Limborg’s Frog / Ech lim-boc (Fig. 2e)
Specimens examined (n = 4). Two adult males IEBR
4593, 4594 (Field numbers TQ.2018.137, 138) by
Pham et al. on 20 June 2018, near Na Phuong Vil-
lage (22°30.169' N, 105°23.864' E, at an elevation of
973 m asl.), Thuong Lam Commune, Lam Binh Dis-
trict and two adult females IEBR 4595, 4596 (Field
numbers TQ.2017.2, 47) collected by Pham et al. on 25
©ZFMK
206
August 2017, near Giang Chi Village (22°34.370' N,
105°20.138' E, at an elevation of 802 m asl.), Sinh Long
Commune, Na Hang District.
Description. Morphological characters of the speci-
mens from Tuyen Quang Province agreed with the de-
scriptions of Bourret (1942) and Inger & Stuart (2010):
SVL 24.7—27.1 mm in males and 29.3—30.75 mm in fe-
males; head as long as wide (HL 11.4—11.9 mm in males
and 10.7-12.0 mm in females, HW 10.2—12.1 mm in
males and 10.8—11.7 mm in females); snout short, round,
longer than horizontal diameter of eye (SL 3.9-4.5 mm
in males and 4.3-4.6 mm in females, ED 2.5—2.8 mm
in males and 3.7-4.3 mm in females); nostril equidis-
tant from the orbit and the snout tip; closer to the tip of
snout than to eye (NS 1.6—1.8 mm in males and 1.7 mm
in females, EN 2.2—2.5 mm in males and 2.2—2.5 mm in
females); canthus rostralis obtuse, loreal region slight-
ly concave; tympanum distinct, round, approximate-
ly two third of eye diameter (TD 1.7 mm in males and
1.7—2.4 mm in females); vomerine teeth present, in two
oblique ridges, equal in distance from each other as to
choanae; tongue notched posteriorly.
Forelimbs rather short (FLL 5.4-6.1 mm in males
and 7.2-9.1 mm in females), hand length (HAL 11.0-
12.1 mm in males and 12.8—14.0 mm in females) rela-
tive finger lengths IT<I<IV<III; the tips dilated into small
disks; fingers without dermal fringe, free of webbing:
subarticular tubercle distinct, oval, formula 1,1,2,1; sub-
articular tubercles moderate; a large, very prominent,
compressed, blunt-edged inner metatarsal tubercle.
Hindlimbs slender, thigh shorter than tibia (FeL 12.8—
14.1 mm in males and 15.6—16.2 mm in females); tib-
ia five times longer than wide (TbL 13.4—15.2 mm in
males and 15.7—-17.1 mm in females, TbW 2.9-4.1 mm
in males and 4.0—-4.1 mm in females); relative toe lengths
I<II<V<II<IV; tips of toes swollen; webbing formula
114-2111 2-32-31 V3-2V; inner metatarsal tubercle
distinct, oval; subarticular tubercles indistinct.
Skin: Dorsal surface of head and body smooth with
faint traces of a glandular lateral fold; a strong fold ex-
tending from the eye to the shoulder; ventral surface
smooth.
Coloration in life. Dorsal surface brown; with small
dark-grey spots; a dark cross-bar between the eyes and
a A-Shaped mark between the shoulders; thighs and tibia
with dark-brown cross bars; ventral surface cream; throat
cream with dark pattern.
Ecological notes. Specimens were found on the ground
between 19:30 and 22:30 hours on a forest path. The sur-
rounding habitat was mixed secondary forest of small to
medium hardwoods and shrubs.
Distribution. In Vietnam, this species was known
from Lao Cai and Son La provinces in the North south-
wards to Dong Nai and Kien Giang provinces (Nguyen
et al. 2009). Elsewhere, the species is known from Laos,
Bonn zoological Bulletin 70 (1): 201-219
Dzung Trung Le et al.
Cambodia, Malaysia, Myanmar, and Thailand (Inger &
Stuart 2010).
Quasipaa boulengeri (Gunther, 1889)
Boulenger’s Spiny Frog / Ech gai san bau-len-go (Fig. 2f)
Specimens examined (n = 5). One adult male IEBR
4597 (Field number TQ.2017.14) by Pham et al. on 25
August 2017, near Giang Chi Village (22°30.075' N,
105°23.555' E, at an elevation of 889 m asl.), Sinh Long
Commune, Na Hang District, one adult male IEBR
4598 (Field number TQ.2017.45) by Pham et al. on 27
August 2017, near Giang Chi Village (22°30.075' N,
105°23.555' E, at an elevation of 889 m asl.), Sinh Long
Commune, Na Hang District, and three adult females
IEBR 4599, 4600, 4601 (Field numbers TQ.2017.28, 32,
33) by Pham et al. on 26 August 2017, near Giang Chi
Village (22°34.128' N, 105°20.225' E, at an elevation of
799 m asl.), Sinh Long Commune, Na Hang District.
Description. Morphological characters of the spec-
imens from Tuyen Quang Province agreed with the
descriptions of Liu (1950) and Fei et al. (2009): SVL
115.8—118.5 mm in males, 90.9-101.7 mm in females;
head wider than long (HL 42.9-47.1 mm, HW 50.4—
54.8 mm in males, 34.5-38.0 mm, 40.4-43.6 mm in
females); snout obtusely pointed in dorsal view, longer
than horizontal diameter of eye (SL 17.3—18.1 mm, ED
12.13—12.46 mm in males, 13.4—15.4 mm, 10.5—11.8 mm
in females); nostril lateral, round, closer to the tip of
snout than to eye (NS 9.6—10.0 mm, EN 7.7—8.5 mm in
males, 6.8—9.6 mm, 6.9—7.0 mm in females); canthus ros-
tralis short but distinct, loreal region oblique, shallow-
ly concave; tympanum indistinct, approximately half of
eye diameter (TD 4.8—7.0 mm in males, 5.4—5.6 mm in
females); vomerine teeth in two oblique ridges; tongue
notched posteriorly.
Forelimbs short (FLL 23.6—28.1 mm in males, 19.6—
22.3 mm in females), relative finger lengths H<I<IV<III;
tips of all four fingers swollen; fingers without dermal
fringe, free of webbing; subarticular tubercle distinct,
round, formula 1,1,2,2; palmar tubercles one, oval; males
with nuptial pad on finger I and II.
Hindlimbs long, thigh shorter than tibia (FeL 63.4—
64.9 mm in males, 45.8-52.4 mm in females); tibia
three times longer than wide (TbL 60.8-62.8mm, TbW
20.8—24.5 mm in males, 49.5—53.4 mm, 16.5—20.1 mm
in femals); relative toe lengths I<II<III<V<IV in males
and relative toe lengths I<IT<V<II<IV in females; tips
of toes swollen; full webbing; inner metatarsal tubercle
distinct, outer metatarsal tubercle distinct, round; subar-
ticular tubercles oval, formula 1,1,2,3,2.
Skin: Skin of the upper parts covered with large elon-
gated warts and small oval tubercles; upper surface of
limbs with transverse dark bars; flanks with small round
tubercles; males vetral with nuptial pad on chest and bel-
ly.
©ZFMK
New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 207
Coloration in life. Dorsal surface of head and body
dark-grey; dorsum with black large elongated warts;
flanks with small tubercles, more dense near dorsolateral
folds; dorsal surface of forelimbs, thighs and tibia with
dark cross bars; ventral surface cream, males with nuptial
pad on chest.
Ecological notes. Specimens were found between
19:00 and 22:00 hours on stones or on the ground in
rocky streams. The surrounding habitat was mixed sec-
ondary forest of small to medium hardwoods and shrubs.
Distribution. In Vietnam, this species was known
from Cao Bang, Son La and Nghe An provinces (Nguyen
et al. 2009). Elsewhere, the species is known from China
(Frost 2020).
Remarks. This species is similar to Quasipaa spinosa
and Nanorana yunnanensis (Liu 1950). The specimens
of Quasipaa boulengeri from Tuyen Quang differ from
those of Q. spinosa in having large elongated warts ver-
sus small warts (see Tran et al. 2010) and also differ from
those of N. yunnanensis in having ventral side with one
patch of nuptial pad on chest and belly of the males (ver-
sus with two patches of nuptial pad on both sides of the
chest, see Fei et al. 2009).
Family Rhacophoridae
Raorchestes parvulus (Boulenger, 1893)
Karin Bubble-nest Frog / Nhai cay ti hon (Fig. 3a)
Specimens examined (n = 5). Three adult males IEBR
4602, 4603, 4604 (Field numbers TQ.2018.98, 101,
102) and two adult females IEBR 4605, 4606 (Field
numbers TQ.2018.103, 129) collected by Pham et al. on
18 June 2018, near Trung Phin Village (22°31.577' N,
105°22.504' E, at an elevation of 1047 m asl.), Sinh Long
Commune, Na Hang District.
Description. Morphological characters of the spec-
imens from Tuyen Quang Province agreed well with
the description of Taylor (1962): SVL 18.6—20.3 mm in
males and 20.5—23.1 mm in females; head shorter than
wide (HL 7.3—8 mm in males and 7.8—8.9 mm in females,
HW 6.6—7.8 mm in males and 6.2—8.6 mm in females):
snout round, shorter than eye diameter (SL 2.8-3.7 mm
in males and 3.0—3.5 mm in females, ED 1.9-3.7 mm in
males and 2.3—3.7 mm and in females); nostrils oval, lat-
erally positioned, closer to the tip of snout than to eye
(NS 1.1-1.6 mm in males and 1.2—1.7 mm in females,
EN 1.3—2.0 mm in males and 2.1—2.2 mm in females):
canthus rostralis indistinct, loreal region concave; eye
large, approximately twice diameter of tympanum (TD
1.44.3 mm in males and 0.7—1.48 mm in females), tym-
panum indistinct; supratympanic fold distinct, vomerine
teeth absent; tongue notched posteriorly.
Forelimbs: Forearm short (FLL 4.6—5.5 mm in males
and 5.0-5.9 mm in females), hand length (HAL 9.8—
10.2 mm in males and 9.3—10.1 in females); relative
Bonn zoological Bulletin 70 (1): 201-219
finger lengths I<I<IV<III, tips of fingers enlarged into
discs; webbing absent; subarticular tubercles distinct,
formula 1,1,2,2; inner palmar tubercles small.
Hindlimbs: Thigh short (FeL 9.4-10.4 mm in males
and 9.6—11.5 mm in females); tibia five times longer than
wide (TbL 9.0-10.1 mm in males and 9.5—11.0 mm in
females, TbW 1.9-2.5 mm in males and 2.0—2.1 mm in
females); relative toe lengths I<H<HI<V<IV; toes with
rudiment of webbing; subarticular tubercles distinct; for-
mula 1,1,2,3,2; inner metatarsal tubercle oval.
Skin: Dorsal surface smooth or with small, scattered,
conical warts; ventral surface granular.
Coloration in life. Dorsal greyish, uniform or with
a dark bar or triangular blotch between the eyes, and a
curved dark band along each side of the back; ventral
surface darkly pigmented.
Ecological notes. Specimens were found on the leaves
along the trail, between 19:30 and 21:30 hours. The sur-
rounding habitat consisted of mixed secondary forest
composed of small hardwoods and shrubs.
Distribution. In Vietnam, R. parvulus was known from
Lao Cai and Lai Chau provinces in the North southwards
to Quang Tri Province (Nguyen et al. 2009; Nguyen et al.
2015). Elsewhere, this species is known from Myanmar,
Laos, Thailand, Cambodia and Malaysia (Frost 2020).
Rhacophorus kio Ohler & Delorme, 2006
Black-webbed Treefrog / Ech cay ki-o (Fig. 3b)
Specimen examined (n = 1). One adult male IEBR
4607 (TQ.2018.55) collected by Pham et al. on 15
June 2018, near Nam Duong Village (22°35.644' N,
105°22.056' E, at an elevation of 750 m asl.), Sinh Long
Commune, Na Hang District.
Description. Morphological characters of the speci-
men from Tuyen Quang Province agreed well with the
description of Ohler & Delorme (2006): SVL 72.8 mm;
head longer than wide (HL 25.0 mm, HW 24.1 mm);
snout round, longer than eye diameter (SL 11.6 mm, ED
7.2 mm); nostrils round, without flap of skin, closer to
the tip of snout than to eye (NS 5.0 mm, EN 6.7 mm);
canthus rostralis distinct, loreal region concave; eye
large, approximately twice diameter of tympanum (TD
4.1 mm), tympanum round, distinct; supratympanic fold
distinct, vomerine teeth distinct; tongue notched.
Forelimbs: Forearm slender (FLL 12.1 mm),
hand length (HAL 33.9 mm); relative finger lengths
I<II<IV<III, tips of fingers enlarged into discs; webbing
formula I1’2—-1M0—ONIO—O1V; subarticular tubercles dis-
tinct, formula 1,1,2,1; inner palmar tubercle indistinct.
Hindlimbs: Thigh short (FeL 32.8 mm); tibia five times
longer than wide (TbL 35.6 mm, TbW 7.4 mm); relative
toe lengths I<H<HI<V<IV; toes fully webbed; subarticu-
lar tubercles distinct, formula 1,1,2,3,2; inner metatarsal
tubercle oval.
©ZFMK
208
Dzung Trung Le et al.
Fig. 3. Dorsolateral view of four newly recorded amphibian species from Tuyen Quang Province. a. Raorchestes parvulus (IEBR
4602). b. Rhacophorus kio (IEBR 4607). ¢. Rhacophorus orlovi (IEBR 4608). d. Zhangixalus pachyprotus (VNMN.06923).
Skin: Dorsal surface of head and body, upper part of
flanks smooth; dorsal parts of limbs finely shagreened;
ventral surface smooth.
Coloration in life. Dorsal parts of head and body in-
cluding upper part of flanks green with white spots, lower
part of flanks dark brown with yellow spots correspond-
ing to glandular verrucae; a distinct ink black spot in
armpit; chest, belly and lower part of thigh lemon yellow,
webbing orange yellow with an ink black spot at base
between toes.
Ecological notes. The specimen was found on the
bough along the trail, at 19:00 hours. The surrounding
habitat consisted of mixed secondary forest composed of
small hardwoods and shrubs.
Distribution. In Vietnam, R. kio was known from Lao
Cai and Cao Bang provinces in the North southwards to
Kon Tum and Gia Lai provinces in the Centre (Nguyen
et al. 2009; Nguyen et al. 2015). Elsewhere, this species
is known from India, China, Laos, Thailand, and Cambo-
dia (Nguyen et al. 2009; Frost 2020).
Bonn zoological Bulletin 70 (1): 201-219
Rhacophorus orlovi Ziegler & Kohler, 2001
Orlov’s Treefrog / Ech cay ooc-lop (Fig. 3c)
Specimens examined (n = 5). One adult male IEBR
4608 (Field number TQ.2018.20) and two adult females
IEBR 4609, 4610 (Field numbers TQ.2018.3, 5) collect-
ed by Pham et al. on 13 June 2018, near Nam Duong
Village (22°34.626' N, 105°21.616' E, at an elevation
of 565 m asl.), Sinh Long Commune, Na Hang District,
one adult male IEBR 4611 (Field number TQ.2018.106)
collected by Pham et al. on 18 June 2018, near Trung
Phin Village (22°31.428' N, 105°22.751' E, at an ele-
vation of 994 m asl.), Sinh Long Commune, Na Hang
District, and one adult female IEBR 4612 (Field number
TQ.2018.56) collected by Pham et al. on 15 June 2018,
near Nam Duong Village (22°35.839' N, 105°20.621' E,
at an elevation of 643 m asl.), Sinh Long Commune, Na
Hang District.
Description. Morphological characters of the spec-
imens from Tuyen Quang Province agreed well with
the descriptions of Ziegler & Kohler (2001) and Ostro-
shabov et al. (2013): SVL 39.6-43.8 mm in males and
43.8—52.4 mm in females; head shorter than wide (HL
©ZFMK
New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 209
14.8-16.8 mm in males and 16.3—19.3 mm in females,
HW 15.4—16.3 mm in males and 16.1—19.1 mm in fe-
males); snout slightly pointed, longer than eye diameter
(SL 7.1-7.7 mm in males and 6.8—7.7 mm in femlaes,
ED 4.5—5.1 mm in males and 5.0—-5.8 mm in females);
nostrils oval, closer to the tip of snout than to eye (NS
4.6 mm, EN 4.0 mm); canthus rostralis well developed,
slightly round constricted; loreal region concave; eye
large, approximately twice diameter of tympanum (TD
2.4—3.2 mm in males and 3.0-3.7 mm in females), tym-
panum round, distinct; supratympanic fold distinct, vom-
erine teeth distinct; tongue notched posteriorly.
Forelimbs: Forearm slender (FLL 7.4—7.9 mm in males
and 7.7-9.4 mm in famales), hand length (HAL 20.8—
20.9 mm in males and 20.9-27.2 mm in females); rela-
tive finger lengths I<H<IV<lIII, tips of fingers enlarged
into discs; webbing formula [12/3—12/311—2N11-1IV;
subarticular tubercles distinct, formula 1,1,2,2; inner pal-
mar tubercles round.
Hindlimbs: Thigh slender (FeL 21.3-21.9 mm in
males and FeL 23.0-27.4 mm in females); tibia four
times longer than wide in males (TbL 22.2—22.4 mm,
TbW 5.3—5.4 mm) tibia five times longer than wide in
females (TbL 24.2—29.4 mm, TbW 4.7—5.8 mm); relative
toe lengths I<I<HI<V<IV; webbing formula [3/4—11I’Z2—
1WIY%-1IV1—'AV; subarticular tubercles distinct; formula
1,1,2,3,2; inner metatarsal tubercle oval. Skin: Dorsal
surface of head and body, upper part of flanks smooth;
limbs without distinct dermal flads and folds except for a
weakly developed fold along outer edge of 4" finger and
5" toe; weak tubercles and protuberances on outer edge
of tarsus; ventral surface smooth.
Coloration in life. Dorsal surface reddish brown, with
some darker markings, flanks light brown with dark
brown reticulation and yellow spots; venter whitish to
light brownish with some indistinct small dark spots.
Ecological notes. Specimens were found on the bough
around small puddles, between 19:30 and 23:00 hours.
The surrounding habitat consisted secondary forest com-
posed of small hardwoods.
Distribution. In Vietnam, R. orlovi was known from
Dien Bien and Son La provinces in the North southwards
to Gia Lai Province in the Centre (Nguyen et al. 2009,
2015). Elsewhere, this species is known from Laos (Frost
2020).
Zhangixalus pachyproctus Yu, Hui, Hou, Wu, Rao &
Yang, 2019
Protruded-vent Treefrog / Ech cay hau mon loi (Fig. 3d)
Specimen examined (n = 1). One adult female
VNMN.06923 collected by Pham et al. on 21 June 2018,
near Na Phuong Village (22°29.432' N, 105°23.437' E,
at an elevation of 812 m asl.), Thuong Lam Commune,
Lam Binh District.
Bonn zoological Bulletin 70 (1): 201-219
Description. Morphological characters of the speci-
men from Tuyen Quang Province agreed well with the
description of Yu et al. (2019): SVL 93.9 mm; head lon-
ger than wide (HL 34.1 mm, HW 33.6 mm); snout round,
longer than eye diameter (SL 13.8 mm, ED 6.5 mm);
nostrils oval, closer to the tip of snout than to eye (NS
6.9 mm, EN 7.5 mm); canthus rostralis distinct, loreal
region concave; eye large, approximately diameter of
tympanum (TD 5.1 mm), tympanum indistinct; supra-
tympanic fold distinct, vomerine teeth distinct; tongue
notched posteriorly.
Forelimbs: Forearm slender (FLL 16.3 mm),
hand length (HAL 52.3 mm); relative finger lengths
I<II<IV<III, tips of fingers enlarged into discs; webbing
formula I1—2/3111—'AIII1-O1V; subarticular tubercles dis-
tinct; formula 1,1,2,1; inner palmar tubercles larger.
Hindlimbs: Thigh slender (FeL 50.2 mm); tibia five
times longer than wide (TbL 48.2 mm, TbW 8.7 mm); rel-
ative toe lengths I<II<HI<V<IV; full webbed; subarticu-
lar tubercles distinct; formula 1,2,2,3,2; inner metatarsal
tubercle oval. Skin: Dorsal surface of head and body, up-
per part of flanks smooth; ventral surface smooth.
Coloration in life. Dorsal surface of head and body
uniformly green, a narrow white stripe present along the
flanks; ventral surface cream.
Ecological notes. The specimen was found at 19:30
hours on the bough along a stream. The surrounding hab-
itat consisted of mixed secondary forest composed of
small hardwoods and shrubs.
Distribution. In Vietnam, Z. pachyproctus was known
from Dien Bien, Son La, Cao Bang, Bac Giang, Thanh
Hoa, Nghe An and Quang Binh provinces (as Rhacopho-
rus maximus, see discussion below) (Nguyen et al. 2009,
2015; Pham AV et al. 2017; Pham CT et al. 2017). Else-
where, this species is known from northeastern India,
Nepal, China, Laos, and Thailand (Nguyen et al. 2009;
Luu et al. 2014; Frost 2020).
Family Colubridae
Lycodon futsingensis (Pope, 1928)
Futsing Wolf Snake / Ran khuyet fut-sing (Fig. 4a)
Specimens examined (n= 2). IEBR 4754 and IEBR 4755
(adult females) collected by Pham et al. on 14 June 2018,
near Nam Duong Village (22°36.283' N, 105°20.367' E,
at an elevation of 850 m asl.), Sinh Long Commune, Na
Hang District.
Description. Morphological characters of the speci-
mens agreed with the descriptions of Hecht et al. (2013),
Le et al. (2014), and Nguyen et al. (2018): Body robust,
subcylindrical; head longer than wide, distinct from
neck; snout obtuse; nostril lateral; eye large, pupil verti-
cal; head scalation complete: internasals 2, prefrontals 2,
parietals 2, supraocular 1, and frontal 1; supralabials 8/8,
35" in contact with eye; infralabials 9/9, 1s\W-4" border-
©ZFMK
210
a4
as
Dzung Trung Le et al.
Fig. 4. a. Lycodon futsingensis, adult female (IEBR 4755). b. Lycodon pictus, adult female (IEBR 4756). ¢. Lycodon subcinctus,
adult female (IEBR 4757). d. Protobothrops mucrosquamatus, adult male JEBR 4758) from Tuyen Quang Province, Vietnam.
ing chin shields; dorsal scale rows 17—17—15, smooth;
scales of the outer dorsal scale row slightly enlarged;
ventrals 180-211; subcaudals 81-90, paired; cloacal un-
divided.
Coloration in life. Dorsal surface of body and tail
grayish brown to dark brown with 24—26 light brownish
streaks, 12-14 crossbands on dorsal surface of tail; body
bands in Y-shaped at the mid-body; dorsal head grey with
cream bands from eye to neck; belly white; the underside
of the tail dark brown.
Ecology notes. The specimens were collected between
20:00 and 23:00 hours, in rocky streams. The surround-
ing habitat was mixed secondary forest consisting of
small hardwoods and shrubs. Air temperature was 23-
29°C and relative humidity was 70-75%.
Distribution. In Vietnam, Lycodon futsingensis was
known from Dien Bien Province in the north southwards
to Quang Binh and Quang Tri provinces in central Viet-
nam. Elsewhere, this species 1s known from China and
Laos (Nguyen et al. 2009; Uetz et al. 2020).
Remarks. The specimens in Tuyen Quang differ from
those in the description of Le et al. (2014) in having few-
er crossbands on tail (12-14 vs. 17).
Bonn zoological Bulletin 70 (1): 201-219
Lycodon pictus Janssen, Pham, Ngo, Le, Nguyen &
Ziegler, 2019
Pictus Wolf Snake / Ran khuyet pic-tus (Fig. 4b)
Specimen examined (n = 1). IEBR 4756 (adult fe-
male) collected by Pham et al. on 1 September 2017, near
Na Phuong Village (22°29.750' N, 105°18.650' E, at an
elevation of 252 m asl.), Thuong Lam Commune, Lam
Binh District.
Description. Morphological characters of the speci-
men agreed with the description of Janssen et al. (2019):
Body robust, subcylindrical; head longer than wide, dis-
tinct from neck; snout obtuse; nostril lateral; eye large,
pupil vertical; head scalation complete: internasals 2,
prefrontals 2, parietals 2, supraoculars 2, frontal 1; su-
pralabials 8/8, 3-5" in contact with eye; infralabials
10/10, 1s-5 bordering chin shields; dorsal scale rows
17-17-15, smooth; scales of the outer dorsal scale row
slightly enlarged; ventrals 213; subcaudals 90, paired;
cloacal single.
Coloration in life. The body and tail surfaces alter-
nating light brown and cream bands with 25 light bands
on the body; 13 light bands on the tail; ventral surface
mostly cream with dark bands 1n part extending towards
the venter.
Ecology notes. The specimen was found at 22:00 hours
while foraging near a small stream. The surrounding hab-
itat was mixed primary forest consisting of large hard-
©ZFMK
New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 21
woods and shrubs. Air temperature was 26°C and relative
humidity was 80%.
Distribution. Lycodon pictus was originally discov-
ered from Cao Bang Province in northern Vietnam (Jans-
sen et al. 2019). The species was recently recorded from
Guangxi Zhuang Autonomous Region, China, approxi-
mately 60 km apart from the type locality (Janssen et al.
2020).
Remarks. The specimen from Tuyen Quang differed
from those in the description of Janssen et al. (2019) by
having a greater ratio of tail length/total length (TAL/TL
0.224 vs. 0.211—0.215) and fewer light bands on the body
(25 vs. 28 or 29).
Lycodon subcinctus Boie, 1827
Malayan Banded Wolf Snake / Ran khuyet dai (Fig. 4c)
Specimen examined (n = 1). IEBR 4757 (adult female)
collected by Pham et al. on 26 August 2017 near Nam
Duong Village (22°35.100' N, 105°22.083' E, at an el-
evation of 350 m asl.), Sinh Long Commune, Na Hang
District.
Description. Morphological characters of the speci-
men agreed with the descriptions of Smith (1943) and
Nguyen (2007): Body robust, subcylindrical; head longer
than wide, distinct from neck; snout obtuse; nostril lat-
eral; eye large, pupil vertical.; head scalation complete:
internasals 2, prefrontals 2, parietals 2, supraocular 1,
frontal 1; supralabials 8/8, 3-5" in contact with eye;
infralabials 9/9; dorsal scale rows 17—17—15, keeded;
scales of the outer dorsal scale row slightly enlarged;
ventrals 197; subcaudals 78, paired; cloacal divided.
Coloration in life. Black upper body and tail surface
with white markings on the body extending to the outer-
most scales; creamy yellow abdomen with dark obscure
spots.
Ecology notes. The specimen was found at 21:00 hours
while hiding in a small hole along the bank of a stream.
The surrounding habitat was mixed secondary forest con-
sisting of small hardwoods and shrubs. Air temperature
was 30°C and relative humidity was 82%.
Distribution. In Vietnam, this species was known
from Lai Chau and Bac Kan provinces in the north south-
wards to Lam Dong and Binh Phuoc provinces in central
Vietnam (Nguyen et al. 2009). Elsewhere, this species
is known from China, Thailand, Laos Cambodia, Malay-
sia, Brunei, Indonesia and the Philippines (Nguyen et al.
2009; Uetz et al. 2020).
Family Viperidae
Protobothrops mucrosquamatus (Cantor, 1839)
Brown Spotted Pit Viper / Ran luc cuom (Fig. 4d)
Specimen examined (n = 1). IEBR 4758 (adult male)
collected by Pham et al. on 14 June 2018 near Nam
Bonn zoological Bulletin 70 (1): 201-219
Duong Village (22°36.283' N, 105°20.367' E, at an el-
evation of 850 m asl.), Sinh Long Commune, Na Hang
District.
Description. Morphological characters of the spec-
imen agreed with the descriptions of Bourret (1936),
Smith (1943), Leviton et al. (2003), Nguyen (2007), Stu-
art & Heatwole (2008), Nguyen et al. (2011), Luu et al.
(2013), and Nemes et al. (2013): Head longer than wide,
triangle shaped, distinct from neck; snout obtuse; nos-
tril dorsolateral; eye large; upper head scales, irregular,
scarcely increasing in size anteriorly, no loreal; preocular
1; postocular 1; no temporal; supralabials 10/10; infral-
abials 14/14, 1°~3™ bordering chin shields; dorsal scale
rows 31-25-19, feebly keeled; ventrals 241; cloacal sin-
gle; subcaudals 56+, paired.
Coloration in life. Dorsal head brown, paler below;
dorsum greyish brown, with a series of large brown, dark
edged spots; a dark brown line from eye to the angle of
the mouth, edged in black; ventral surface brownish with
white blotches; dorsal tail light brown, with a series of
conspicuous black spots.
Ecology notes. The specimen was found at 20:30
hours while crawling near the waterfall. The surrounding
habitat was mixed secondary forest consisting of small
hardwood and shrub. Air temperature was 28°C and rela-
tive humidity was 90%.
Distribution. In Vietnam, this species was known
from Ha Giang and Cao Bang provinces in the north
southwards to Kon Tum and Gia Lai provinces in central
Vietnam (Nguyen et al. 2009). Elsewhere, this species
is known from Russia, China, Myanmar, Taiwan, Myan-
mar, Thailand, Laos, and Malaysia (Uetz et al. 2020).
Trimeresurus stejnegeri Schmidt, 1925
Bamboo Pit Viper / Ran luc xanh (Fig. 5)
Specimen examined (n = 1). IEBR 4759 (adult male)
collected by Pham et al. on 18 June 2018 near Trung Phin
Village (22°31.433' N, 105°22.750!' E, at an elevation of
555 m asl.), Sinh Long Commune, Na Hang District.
Description. Morphological characters of the speci-
men agreed with the descriptions of David et al. (2001,
2002), Bain & Nguyen (2004), and Hecht et al. (2013):
Head longer than wide, triangle shape, distinct from neck;
snout obtuse; nostril dorsolateral; eye large; upper head
scales, irregular, scarcely increasing in size anteriorly, no
loreal; preocular 1; postocular 1; no temporal; supralabi-
als 9/10; infralabials 13/14, 1‘W-3™ bordering chin shields;
dorsal scale rows 23—21—15, feebly keeled; ventrals 160;
cloacal single; subcaudals 55+, paired.
Coloration in life. Dorsum green above, venter lighter
than dorsum; a distinct whitish-yellow stripe down the
side of the body; no postocular stripe; tip of tail pale red-
dish.
Ecology notes. The specimen was found at 22:00
hours, while resting on a tree branch near a small pool
©ZFMK
212 Dzung Trung Le et al.
Fig. 5. Trimeresurus stejnegeri, adult male (IEBR 4759) from Tuyen Quang Province, Vietnam.
in a forest. The surrounding habitat was mixed second-
ary forest consisting of small hardwoods and shrubs. Air
temperature was 30°C and relative humidity was 82%.
Distribution. In Vietnam, this species was known
from Lao Cai Province in the north southwards to Quang
Binh Province and Da Nang City in the south (Nguy-
en et al. 2009). Elsewhere, this species is known from
China, Taiwan, and Myanmar (Nguyen et al. 2009; Uetz
et al. 2020).
DISCUSSION
Our new records bring the total number of amphibian
species to 57 and that of snakes to 42 in Tuyen Quang
Province (Table 1). Some taxonomic changes of amphib-
ians were made by recent studies, for example, Nguy-
en et al. (2009) documented the distribution of Lepto-
brachella pelodytoides (Boulenger, 1893) from Lao Cai
Province in the North southwards to Gia Lai Province,
however, Ohler et al. (2011) indicated that L. pelodyto-
ides has a restricted distribution in Myanmar and records
of L. pelodytoides in Vietnam should be assigned to the
L. ventripunctata (Fei, Ye & Li, 1990) group. Matsui
et al. (2010) and McLeod (2010) stated that the previous
record of Limnonectes kuhlii (Tschudi, 1838) in Vietnam
(Nguyen et al. 2009) should be re-identified as L. banan-
ensis Ye, Fei, Xie & Jiang, 2007. Kuraishi et al. (2012)
Bonn zoological Bulletin 70 (1): 201-219
re-identified the records of Polypedates leucomystax
(Gravenhorst, 1829) from Vietnam (Nguyen et al. 2009)
as P. mutus (Smith, 1940) and P. megacephalus Hallow-
ell, 1861. Jiang et al. (2019) resurrected the genus Lepto-
mantis and described a new genus Zhangixalus. Based on
morphological and molecular evidences Yu et al. (2019)
suggested that previous records of R. maximus in Viet-
nam, Laos and Thailand (Nguyen et al. 2009) should be
provisionally assigned to Zhangixalus pachyproctus Yu,
Hui, Hou, Wu, Rao & Yang, 2019. In this study, we fur-
ther extend the distribution of a recently described snake
(Lycodon pictus) in northern Vietnam, including color
pattern variation. The new record of the species in Tuyen
Quang Province is approximately 70 km distant from the
type locality in Cao Bang Province.
Tuyen Quang Province also harbors a high number
of species of conservation concern. Four species are
currently only known from Vietnam, eight species are
listed in the IUCN Red List (2020), three species listed
in the Vietnam Governmental Decree No 06/2019/ND-
CP, three species listed in the CITES appendices (2020),
and 16 species listed in the Red Data Book of Vietnam
(2007).
©ZFMK
New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 213
Table 1. List of amphibian and snake species recorded from Tuyen Quang Province, Vietnam. Asterisks (*) denote new provin-
cial records. References include: 1 = Le et al. (2007); 2 = Nguyen et al. (2009); 3 = Phan et al. (2018); 4 = Pham et al. (2019a);
5 = Pham et al. (2019b); 6 = this study. IUCN = IUCN Red List of Threatened species, Decree 061 = Decree No 06/2019/ND-CP of
the Government of Vietnam on management of threatened and rare wild plants and animals, CITES = CITES appendices.
No Species name Common name Reference Red Data IUCN Decree CITES
Book (2020) 06(2019) (2020)
(2007)
ANURA FROGS
Bufonidae Toads
1... Duttaphrynus melanostictus (Schnei- Asian Common Toad 1, 2,6
der, 1799)
2. Ingerophrynus galeatus Gunther, Cambodia Toad 1 VU
1864
Hylidae Treefrogs
3. Ayla simplex Boettger, 1901 Annam Treefrog 1
Megophryidae Spadefoot frogs
4. Leptobrachella nahangensis (Lath- Nahang Asian Toad 1/-2.6
rop, Murphy, Orlov & Ho, 1998)
5. __L. sungi (Lathrop, Murphy, Orlov & Sung’s Toad 6
Ho, 1998)
6. _L. ventripunctatus (Fei, Ye & Li, Yunnan Asian Toad 1, 2,6
1990)
7. Leptobrachium chapaense (Bourret, | Chapa Spadefoot Toad 6
1937)
8. L. guangxiense Fei, Mo, Ye & Yang, | Guangxi Pseudomous- 6
2009° tache Toad
9. | Megophrys maosonensis Bourret, Mauson Mountain 1,6
1937 Toad
10. M. microstoma Boulenger, 1903° Asian Mountain Toad 1,6
11. M. pachyprotus Kou, 1985 Huang’s Spadefoot 1
Toad
Microhylidae Narrow-mouthed
frogs
12. Kalophrynus interlineatus (Blyth, Bubble-nest Frog l
1855)
13. Kaloula pulchra Gray, 1831 Malaysian Narrow- 1
mouth Toad
14. Microhyla butleri Boulenger, 1900 Butler’s Pigmy Frog 1.2
15. M. fissipes Boulenger, 1884 Ornate Pigmy Frog i ees
16. M. heymonsi Vogt, 1911 Taiwan Rice Frog 1, 2,6
17. M. pulchra (Hallowell, 1861) Guangdong Rice Frog 12.26
18. Micryletta inornata (Boulenger, 1890) Deli Paddy Frog l
Dicroglossidae True frogs
19. Fejervarya limnocharis (Gravenhorst, Rice-paddy Frog 1, 2.6
1829)
20. Hoplobatrachus rugulosus (Wieg- Common Lowland 1, 2,6
mann, 1834) Frog
21. Limnonectes bannaensis Ye, Fei & Banna Large-headed 12,6
Jiang, 2007 Frog
Bonn zoological Bulletin 70 (1): 201-219
©ZFMK
214 Dzung Trung Le et al.
Table 1. Continued.
No Species name Common name Reference Red Data TIUCN Decree CITES
Book (2020) 06(2019) (2020)
(2007)
ANURA FROGS
22. L. limborgi (Sclater, 1892) Taylor’s Frog 6
23. L. nguyenorum McLeod, Kurlbaum Neguyen’s Wart Frog S)
& Hoang, 2015
24. Quasipaa boulengeri (Ginther, 1889) Boulenge’s Spiny 6 EN
Frog
25. @Q. delacouri (Angel, 1928) Tonkin Asian Frog 1 EN
26. Q. spinosa (Davis, 1875) Chinese Spiny Frog l VU
27. @Q. verrucospinosa (Bourret, 1937) Verrucose Spiny Frog 12
28. Occidozyga lima (Gravenhorst, 1829) Green Puddle Frog 1.256
29. O. martensii (Peter, 1867) Marten’s Frog 1
Ranidae Ranids
30. Amolops ricketti (Roulenger, 1899) Chinese Sucker Frog I
31. Hylarana macrodactyla (Gunther, Guangdong Frog 1
1859 ”1858”)
32. H. taipehensis Van Denburgh, 1909 Taipei Frog l
33. Odorrana andersonii (Boulenger, Anderson’s Frog 1,2 VU
1882)
34. O. bacboensis (Bain, Lathrop, Mur- Tonkin Frog 1,2
phy, Orlov & Ho, 2003)
35. O. chloronota (Ginther, 1875) Green Cascade Frog 1,2, 6
36. O. geminata Bain, Stuart, Nguyen, Geminated Cascade 4 VU
Che & Rao, 2009 Frog
37. O. lipuensis Mo, Chen, Wu, Zhang & —Lipu Cascade Frog 4
Zhou, 2015
38. O. nasica (Boulenger, 1903) Long-snout Torrent 6
Frog
39. O. tiannanensis (Yang & Li, 1980) Tiannan Odorous Frog 1,2
40. Rana johnsi Smith, 1921 John’s Frog 1,2,6
41. Sylvirana guentheri (Boulenger, Gunther’s Amoy Frog 1, 2,6
1882)
42. §. maosonensis (Bourret, 1937 Mauson Frog 128
43. S. nigrovittata (Blyth, 1855) Black-striped Frog l
Rhacophoridae Treefrogs
44. Chiromantis doriae (Boulenger, 1893) Doria’s Asian Treefrog Led
45. Kurixalus bisacculus (Taylor, 1962) Taylor’s Tree Frog 1,2
46. Polypedates megacephalus Hallowell, Hong Kong Whipping 1,6
1861 Frog
47. P. mutus (Smith, 1940) Burmese Whipping 1, 2,6
Frog
48. Raorchestes gryllus (Smith, 1924) Langbian Bubble-nest 122 VU
Frog
Bonn zoological Bulletin 70 (1): 201-219 ©ZFMK
New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam
Table 1. Continued.
No
49.
50.
51.
52.
53.
54.
3:
56.
its
58.
De.
60.
61.
62.
63.
64.
65.
66.
67.
68.
Species name
ANURA
R. parvulus (Boulenger, 1893)
Rhacophorus kio Ohler & Delorme,
2006°
R. orlovi Ziegler & Kohler, 2001°
Theloderma albopunctatum (Liu &
Hu, 1962)
T. corticale (Boulenger, 1903)
Zhangixalus dennysii (Blanford,
1881)
Z. pachyproctus Yu, Hui, Hou, Wu,
Rao & Yang, 2019"
CAUDATA
Salamandridae
Paramesotrion deloustali (Bourret,
1934)
GYMNOPHIONA
Ichthyophiidae
Ichthyophis bannanicus Yang, 1984
SERPENTES
Typhlopidae
Indotyphlops braminus (Daudin,
1803)
Xenopeltidae
Xenopeltis unicolor Reinwardt, 1827
Boidae
Python molurus (Linnaeus, 1758)
Colubridae
Ahaetulla prasina (Bote, 1827)
Amphiesma stolatum (Linnaeus,
1758)
Boiga guangxiensis Wen, 1998
B. kraepelini Stejneger, 1902
B. multomaculata (Boie, 1827)
Calamaria septentrionalis Boulenger,
1890
Coelognathus radiatus (Boie, 1827)
Dendrelaphis pictus (Gmelin, 1789)
Bonn zoological Bulletin 70 (1): 201-219
Common name
FROGS
Karin Bubble-nest
Frog
Black-webbed
Treefrog
Orlov’s Treefrog
Dotted Bubble-nest
Frog
Tonkin Bug-eyed Frog
Denny’s Whipping
Frog
Protruded-vent
Treefrog
SALAMANDERS
Salamanders
Vietnamese Salaman-
der
CAECILIANS
Asian Tailed Caeci-
lians
Banna Caecilian
SNAKES
Blind snakes
Common blind snake
Sunbeam snakes
Sunbeam snake
Pythons
Indian rock python
Colubrines
Oriental whip snake
Buff striped keelback
Guangxi cat snake
Kraepelin’s cat snake
Many-spotted cat
snake
Hongkong dwarf
snake
Copperhead racer
Common bronzeback
215
CITES
II
Reference Red Data IUCN Decree
Book (2020) 06(2019) (2020)
(2007)
6
6 EN
6
1,6
1,2 EN
1
6
1,2 EN
| ee VU
1
Ie
1 CR VU IIB
1
1
3
3
1
1
1 VU
©ZFMK
216
Table 1. Continued.
Dzung Trung Le et al.
No _ Species name Common name Reference Red Data IUCN Decree CITES
Book (2020) 06(2019) (2020)
(2007)
SERPENTES SNAKES
69. Elaphe moellendorffi (Boettger, 1886) Moellendorf’s rat 1 VU VU
snake
70. Euprepiophis mandarinus (Cantor, Mandarin rat snake [2 VU
1842)
71. Lycodon futsingensis (Pope, 1928)* Futsing wolf snake 6
72. L. meridionalis (Bourret, 1935) Southern big-tooth l
snake
73. LL. pictus Janssen, Pham, Ngo, Le, Pictus wolf snake 6
Nguyen & Ziegler, 2019*
74. L. subcinctus (Boie,1827)* Malayan banded wolf 6
snake
75. L. rufozonatus Cantor, 1842 Red-banded snake [2
76. O. cinereus (Gunther, 1864) Gunther’s kukri snake 1
77. O. eberhardti Pellegrin, 1910 Eberhardt’s kukri 1
snake
78. O. taeniatus (Gunther, 1861) Striped kukri snake 1
79. Ptyas korros (Schlegel, 1837) Indo-chinese rat snake P2 EN
80. P mucosa (Linnaeus, 1758) Oriental rat snake l EN
81. P multicinctus (Roux, 1907) Many-banded green 3
snake
Homalopsidae Muds snakes
82. Hypsiscopus plumbea (Boie, 1827) Boie’s mud snake 1
83. Myrrophis chinensis (Gray, 1842) Chinese mud snake 1
Lamprophiidae Mock vipers
84. Psammodynastes pulverulentus Common mock viper 3
(Boie, 1827)
Natricidae Keelback snakes
85. Fowlea flavipunctatus (Hallowell, Yellow-spotted keel- 1
1860) back
86. Hebius boulengeri (Gressit, 1937) Tai-yong keelback 3
87. H. deschauenseei (Taylor, 1934) Deschauensee’s keel- 2
back
88. Opisthotropis jacobi Angel & Bour- Chapa mountain keel- 2
ret, 1933 back
89. Rhabdophis subminiatus (Schlegel, Red-necked keelback 1
1837)
90. Sinonatrix percarinata (Boulenger, Eastern water snake 1
1899)
Pareatidae Slug snakes
91. Pareas hamptoni (Boulenger, 1905) Hampton’s slug snake 3
92. P margaritophorus (Jan, 1866) Mountain slug snake 3
Bonn zoological Bulletin 70 (1): 201-219
©ZFMK
New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 217
Table 1. Continued.
No Species name Common name Reference Red Data IUCN Decree CITES
Book (2020) 06(2019) (2020)
(2007)
SERPENTES SNAKES
Pseudoxenodontidae Bamboo snake
93. Pseudoxenodon bambusicola Vogt, Bamboo snake 1
1922
Elapidae Kraits
94. Bungarus fasciatus (Schneider, 1801) Banded krait 1 EN
95. B. multicinctus Blyth, 1861 Many-banded krait 1
96. Naja atra Cantor, 1842 Chinese cobra 2 EN VU IIB II
97. Ophiophagus hannah (Cantor, 1836) King cobra l CR VU IB II
Viperidae Vipers
98. Protobothrops mucrosquamatus Brown spotted pit 6
(Cantor, 1839)* viper
99. Trimeresurus stejnegeri Schmidt, Bamboo pit viper 6
19257
Acknowledgements. We are grateful to the directorate of the
Forest Protection Department of Tuyen Quang Province for
support of our field work. We thank Potess F, Nguyen NQ, and
Uong HS (PRCF) for support of our field work in Lam Binh/
Na Hang, Nguyen T and Nguyen T (Sinh Long Commune) for
their assistance in the field. For the fruitful cooperation within
joint research projects we cordially thank Nguyen SV (IEBR,
Hanoi), as well as Pagel T and Landsberg C (Cologne Zoo).
This research was supported by the Vietnam Academy of Sci-
ence and Technology (Project Code: DLSD00.01/20-23). Field
surveys in Lam Binh/Na Hang were partially supported by the
People Resources and Conservation Foundation (PRCF) and
Cologne Zoo.
REFERENCES
Bain RH, Nguyen TQ (2004) Herpetofaunal diversity of Ha
Giang Province in northeastern Vietnam, with description of
two new species. American Museum Novitates 3453: 1-42
Bourret R (1936) Les serpents de | Indochine. I. Etudes sur la
faune. Henry Basuyau et Cie, Toulouse
Bourret R (1942) Les batraciens de I’Indochine. Institut
Océanographique de I’Indochine: 1-547
Chen W, Zhang W, Zhou S, Li N, Huang Y, Mo Y (2013) Ins-
inght into validity of Leptobrachium guangxiense (Anura:
Megophryidae): evidence from mitochondrial DNA sequenc-
es and morphological charaters. Zootaxa 3641: 31-40
CITES (2020) CITES appendices. Online at http://www.cites.
org [last accessed Mar. 2020]
Clements R, Sodhi NS, Schilthuizen M, Peter KLN (2006)
Limestone karsts of Southeast Asia: Imperiled arks of biodi-
versity. BioScience 56 (9): 733-742
David P, Ashok C, Bharat BB (2001) On the occurrence of
Trimeresurus medoensis Djao in: Djao & Jaing, 1977 (Ser-
pentes, Viperidae, Crotalinae) in India, with a redescription
Bonn zoological Bulletin 70 (1): 201-219
of the species and notes on its biology. Hamadryad 26 (2):
210-226
David P, Vogel G, Pauwels OSG, Vidal N (2002) Description
of a new species of the genus 7rimeresurus from Thailand,
related to Trimeresurus stejnegeri Schmidt, 1925 (Serpentes,
Crotalidae). Natural History Journal of Chulalongkorn Uni-
versity 2 (1): 5-19
Dowling GH (1951) A proposed standard system of counting
ventrals in snakes. British Journal of Herpetology 1 (5):
97-99
Dubois A, Ohler A (1998) A new species of Leptobrachium
(Vibrissaphora) from northern Vietnam, with a review of the
taxonomy of the genus Leptobrachium (Pelobatidae, Mego-
phyinae). Dumerilia 4: 1-32
Fei L, Hu S, Ye C, Huang Y (2009) Fauna Sinica. Amphibia.
Volume 3. Anura. Science Press, Beijing: 1-887
Fei L, Ye C, Jiang J, Xie F (2008) Two new species of the Ra-
nidae from China, with phylogenetic relationships of Hylar-
ana (Sylvirana) nigrovittata group (Amphibia, Anura). Acta
Zootaxonomica Sinica 33: 199-206 (in Chinese with English
abstract)
Frost DR (2020) Amphibian Species of the World: an online
reference. Version 6.0. Online at http://research.amnh.org/
herpetology/amphibia/index.html [last accessed Jan. 2020].
American Museum of Natural History, New York, USA
Glaw F, Vences M (2007) A field guide to the amphibians and
reptiles of Madagascar. Third Edition, Frosch Verlag, Co-
logne
Hecht V, Pham CT, Nguyen TT, Nguyen TQ, Bonkowski M,
Ziegler T (2013) First report on the herpetofauna of Tay Yen
Tu Nature Reserve, northeastern Vietnam. Biodiversity Jour-
nal 4 (4): 507-552
Inger R, Stuart B (2010) Sysmatics of Limnonectes (Taylorana)
Dubois. Currens herpetology 29 (2): 51-58
IUCN (2020) The IUCN Red List of Threatened Species. Ver-
sion 2020.1. Online at http://www.iucnredlist.org [last ac-
cessed 6 Nov. 2020]
©ZFMK
218 Dzung Trung Le et al.
Janssen HY, Ren J-L, Li J-T, Wang Z, Nguyen TT, Nguyen
TQ, Bui QTT, Ngo HT, Le MD & Ziegler T (2020) Range
extension and extended diagnosis of Lycodon pictus: First
country record from China. Revue suisse de Zoologie 127
(2): 413-422
Janssen HY, Pham CT, No HT, Le MD, Nguyen TQ, Ziegler
T (2019) A new species of Lycodon Boie, 1826 (Serpentes,
Colubridae) from northern Vietnam. ZooKeys 875: 1—29
Jiang D, Jiang K, Ren J, Wu J, Li J (2019) Resurretion of the
genus Leptomantis, with Description of a New Genus to the
Family Rhacophoridae (Amphibia: Anura). Asian Herpeto-
logical Research 10 (1): 1-12
Kuraishi N, Matsui M, Hamidy A, Belabus D, Ahmad N, Banha
S, Sudin A, Yong H, Jiang J, Ota H, Thong H, Nishikawa
K (2012) Phylogennetic and taxonomic relationships of the
Polypedates leucomystax complex (Amphibia). Zoological
Sripta 42: 54—70
Lathrop A, Murphy RW, Orlov LN, Ho CT (1998) Two new
species of Leptolalax (Anura: Megophryidae) from northern
Vietnam. Amphibia-Reptilia 19: 253-267
Le DT, Nguyen SLH, Pham CT, Nguyen TQ (2014) New re-
cords of snakes (Squamata: Serpentes) from Dien Bien Prov-
ince. Journal of Biology 36 (4): 460-470
Le DT, Pham AV, Nguyen SLH, Ziegler T, Nguyen TQ (2014)
Babina lini (Chou, 1999) and Hylarana menglaensis Fei,
Ye et Xie, 2008, two additional anuran species for the her-
petofauna of Vietnam. Russian Journal of Herpetology 21:
315-321
Le NN, Nguyen HD, Can TTT, Hoang NV (2007) A survey
on amphibians and reptiles in Son Duong, Chiem Hoa and
Na Hang districts, Tuyen Quang Province. Hanoi National
university of Education Journal of Science 1: 100-106 (in
Vietnamese)
Leviton AE, Wogan GOU, Koo MS, Zug GR, Lucas RS, Vin-
dum JV (2003) The dangerously venomous snakes of Myan-
mar. Illustrated checklist with keys. Proceedings of the Cali-
fornia Academy of Sciences, ser. 4 (54): 407-460
Liu CC (1950) Amphibians of western China. Fieldiana. Zool-
ogy Memoires 2: 1-397
Liu Q, Yan JW, Hou SB, Wang P, Nguyen SN, Murphy RW,
Che J, Guo P (2020) A new species of the genus Sinomicru-
rus (Serpentes: Elapidae) from China and Vietnam. Zoologi-
cal Research 41 (2): 194-198
Luong AM, Nguyen HQ, Le DT, Nguyen SHL, Nguyen TQ
(2019) New records of amphibians (Anura: Megophryidae,
Ranidae) from Dien Bien Province, Vietnam. Herpetology
Notes 12: 375-387
Luu VQ, Calame T, Nguyen TQ, Ohler A, Bonkowski M,
Ziegler T (2014) First records of Gracixalus supercornutus
(Orlov, Ho & Nguyen, 2004) and Rhacophorus maximus
Gunther, 1858 from Laos. Herpetology Notes 7: 419-423
Luu VQ, Nguyen TQ, Pham CT, Dang NK, Vu TN, Miskovic
S, Bonkowski M, Ziegler T (2013) No end in sight? Further
new records of amphibians and reptiles from Phong Nha-Ke
Bang National Park, Quang Binh Province, Vietnam. Biodi-
versity Journal 4: 285-300
Manthey U, Grossmann W (1997) Amphibien und Reptilien
Stdostasiens. Natur und Tier-Verlag, Munster
Matsui M, Kuraushi N, Jiang JP, Ota H, Hamidy A, Orlov N.,
Nishikawa K (2010) Systematics reassessment of fanged
frogs from China and adjacent regions (Anura: Dicroglossi-
dae). Zootaxa 2345: 33-42
McLeod DS (2010) Of least concern? Systematics of a cryp-
tic species complex: Limnonectes kuhlii (Amphibia: Anura:
Bonn zoological Bulletin 70 (1): 201-219
Dicroglossidae). Molecuar Phylogenetics and Evolution 56:
991-1000
Neang T, Hartmann T, Seiha H, Nicholas JS, Neil MF (2014)
A new species of wolf snake (Colubridae: Lycodon Fitzinger,
1826) from Phnom Samkos Wildlife Sanctuary, Cardamom
Mountains, southwest Cambodia. Zootaxa 3814 (1): 68-80
Nemes L, Babb R, Devender WV, Nguyen KV, Le QK, Vu TN,
Rauhaus A, Nguyen TQ, Ziegler T (2013) First contribution
to the reptile fauna of Quang Ngai Province, central Vietnam.
Biodiversity Journal 4 (2): 301-326
Nguyen SV (2007) Fauna of Vietnam: Serpentes. Science and
Technics Publishing House, Hanoi
Nguyen LT, Hoang HV, Nguyen TT, McCormack TEM, Nguy-
en SN (2016) A collection of amphibians and reptilies from
Bac Huong Hoa Nature reserve, Quang Tri Province, Viet-
nam. Proceedings of the 3 National Scientific Conference
on Amphibians and Reptiles in Vietnam: 92-110
Nguyen TQ, Nguyen TV, Pham CT, Ong AV, Ziegler T (2018)
New records of snakes (Squamata: Serpentes) from Hoa
Binh Province, northwestern Vietnam. Bonn zoological Bul-
letin 67 (1): 15-24
Nguyen TQ, Pham CT, Le DT, Nguyen BV, Nguyen SLH
(2015) Diversity of tree frogs (Amphibia: Anura: Rhacopho-
ridae) from Dien Bien provice. Procceding of the 6" National
Scientific conference on Ecology and Biological Resources:
954-959
Nguyen TQ, Stenke R, Nguyen HX, Ziegler T (2011) The ter-
restrial reptile fauna of the biosphere Reserve Cat Ba Archi-
pelago, Hai Phong, Vietnam. Bonner zoologische Monogra-
phien 57: 99-115
Nguyen VS, Ho TC, Nguyen TQ (2009) Herpetofauna of Viet-
nam Edition Chimaira, Frankfurt am Main
Nguyen TV, Pham CT, Nguyen TQ (2016) New records and an
updated list of snakes (Squamata: Serpentes) from Xuan Lien
Nature Reserve, Thanh Hoa Province, Vietnam. Journal of
Biology 38 (3): 324-332
Ohler A (2003) Revision of the genus Ophryophryne Bouleng-
er, 1903 (Megophryidae) with description of two new spe-
cies. Alytes 21 (1-2): 23-44
Ohler A, Delorme M (2006) Well known does not mean well
studie: morphological and molecular support for existence
of sibling species in the Javanese gliding frog Rhacophorus
reinwardtii (Amphibia, Anura). Comptes Rendus Biologies
329: 86-97
Ohler A, Wollenberg KC, Grosjean S, Hendrix R, Vences M,
Ziegler T, Dubois A (2011) Sorting out Lalos: description of
new species and additional taxonomic data on Megophryid
frogs from northern Indochina (genus Leptolalax, Mego-
phryidae, Anura). Zootaxa 3147: 1-83
Ostroshabov A, Orlov N, Nguyen TT (2013) Taxonomy of frogs
of genus Rhacophorus of “hoanglienensis—orlovi” complex.
Russian Jounral of Herpetology 20 (4): 301-324
Pham AV, Nguyen TQ, Ziegler T, Nguyen TT (2017) New re-
cords of tree frogs (Anura: Rhacophoridae: Rhacophorus)
from Son La Province, Vietnam. Herpetology Notes 10: 376—
386
Pham AV, Pham CT, Hoang NV, Ziegler T, Nguyen TQ (2017)
New records of amphibians and reptiles from Ha Giang Prov-
ince, Vietnam. Herpetology Notes 10: 183-191
Pham AV, Tu HV, Nguyen TQ, Pham CT, Song NB, Bui QT,
Hoang TLQ (2016) Species diversity of the family Dicro-
glossidae (Amphibia: Anura) from Son La Province. Pro-
ceedings of the 3% National Scientific Conference on Am-
phibians and Reptiles in Vietnam: 133—139 (in Vietnamese)
©ZFMK
New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 219
Pham CT, An HT, Herbst S, Bonkowski M, Ziegler T, Nguyen
TQ (2017) First report on the amphibian fauna of Ha Lang
karst forest, Cao Bang Province, Vietnam. Bonn zoological
Bulletin 66: 37-53
Pham CT, Nguyen TQ, Luong AM, Phan TQ, Le DT (2019a)
New records of cascade frogs (Amphibia: Anura: Ranidae:
Odorrana) from Tuyen Quang Province. Procceding of the
4" National Scientific conference on Amphibians and Rep-
tiles in Vietnam: 173-177
Pham CT, Phan TQ, Do DT, Nguyen TQ (2019b) New pro-
vincial records of the genus Limnonectes (Amphibia: An-
ura: Dicroglossidae) from Vietnam. Journal of Biology
41 (2se1&2se2): 169-176
Phan TQ, Hoang NV, Pham AV, Pham CT, Nguyen TQ, Le DT
(2018) New records of reptiles from Tuyen Quang Province,
Vietnam. Proceeding of the 3% National Scienctific Con-
ference on Biological Research and Teaching in Vietnam:
371-381
Simmons JE (2002) Herpetological collecting and collections
management. Revised edition. Society for the Study of Am-
phibians and Reptiles. Herpetological Circular 31: 1-153
Smith MA (1943) The fauna of British India, Ceylon and Bur-
ma, including the whole of the Indo-Chinese Subregion.
Reptilia and Amphibia. Vol. HI. Serpentes. Taylor and Fran-
cis, London
Sterling EJ, Hurley MM, Le MD (2006) Vietnam: A Natural
History. Yale University Press, New Haven and London
Stuart LB, Heatwole H (2008) Country records of snakes from
Laos. Hamadryad 33 (1): 97-106
Taylor EH (1962) The Amphibian fauna of Thailand. Universi-
ty of Kanas Science Bulletin 63: 65-599
The Goverment of Vietnam (2019) Decree No 06/2019/ND-CP
of the Government of Vietnam on management of threatened
and rare wild plants and animals, dated on 22 January 2019.
Hanoi
Tran DTA, Le QK, Le KV, Vu TN, Nguyen TQ, Bo6hme W,
Ziegler T (2010) First and preliminary frog records (Amphib-
ia: Anura) from Quang Ngai Province, Vietnam. Herpetology
Notes 3: 111-119
Tran K, Ho CT, Nguyen SV, Pham T (2007) Reptiles and Am-
phibians. In: Dang TN, Tran K, Dang HH, Nguyen C, Nguy-
en TN, Nguyen YH, Dang DT, (Eds.). Vietnam Red Data
Book, Part 1. Animals. Science and Technology Publishing
House, Hanoi
Bonn zoological Bulletin 70 (1): 201-219
Webb CO, Slik JWE, Triono T (2010) Biodiversity inventory and
informatics in Southeast Asia. Biodiversity Conservation 19:
955-972
Uetz P, Freed T, HoSek J (2020) The Reptile Database. Online
at http://reptile-database.reptarium.cz/search.php [last ac-
cessed Mar. 2020]
Vogel G, David P, Pauwels OSG, Sumontha M, Norval G, Hen-
drix R, Vu TN, Ziegler T (2009) A revision of Lycodon ruh-
strati (Fischer 1886) auctorum (Squamata: Colubridae), with
the description of a new species from Thailand and a new
subspecies from the Asian mainland. Tropical Zoology 22:
131-182
Yu G, Hui H, Hou M, Wu Z, Rao D, Yang J (2019) A new spe-
cies of Zhangixalus (Anura: Rhacophoridae), previously
confused with Zhangixalus smaragdinus (Blyth, 1852). Zoo-
taxa 4711 (2): 275-292
Ziegler T, David P, Ziegler TN, Pham CT, Nguyen TQ, Le MD
(2018a) Morphological and molecular review of Jacob’s
Mountain Stream Keelback Opisthotropis jacobi Angel &
Bourret, 1933 (Squamata: Natricidae) with description of a
sibling species from northern Vietnam. Zootaxa 4374 (4):
476-496
Ziegler T, Hendrix R, Vu TN, Vogt M, Forster B, Dang KN
(2007) The diversity of a snake community in a karst forest
ecosystem in the central Truong Son, Vietnam, with an iden-
tification key. Zootaxa 1493: 1—40
Ziegler T, Kohler J (2001) Rhacophorus orlovi sp. N., ein neuer
Ruderfrosch aus Vietnam (Amphibia: Anura: Rhacophori-
dae). Sauria 23: 37-46
Ziegler T, Ngo HN, Pham AV, Nguyen TT, Le MD, Nguyen
TQ (2018b) A new species of Parafimbrios from northern
Vietnam (Squamata: Xenodermatidae). Zootaxa 4527 (2):
269-276
Ziegler T, Nguyen TQ, Pham CT, Nguyen TT, Pham AV, van
Schingen M, Nguyen TT, Le MD (2019a) Three new species
of the snake genus Achalinus from Vietnam (Squamata: Xe-
nodermatidae). Zootaxa 4590: 249-269
Ziegler T, Pham CT, Nguyen TV, Nguyen TQ, Wang J, Wang
Y-Y, Stuart BL, Le MD (2019b) A new species of Opistho-
tropis from northern Vietnam previously misidentified as
the Yellow-spotted Mountain Stream Keelback O. maculosa
Stuart & Chuaynkern, 2007 (Squamata: Natricidae). Zootaxa
4613: 579-586
©ZFMK
BHL
i
Blank Page Digitally Inserted
Bonn zoological Bulletin 70 (1): 221-225
2021 - Mengual X. & Ssymank A.
https://do1.org/10.20363/BZB-2021.70.1.221
ISSN 2190-7307
http://www.zoologicalbulletin.de
Research article
urn:|sid:zoobank.org:pub:508524B5-F680-4244-9749-E584F32CC1D1
Psilota exilistyla Smit & Vujié, 2008 (Diptera: Syrphidae),
a new Species for the German fauna
Ximo Mengual'* & Axel Ssymank’
'Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany
?Falkenweg 6, D-53343 Wachtberg, Germany
* Corresponding author: Email: [email protected]
'urn:Isid:zoobank.org:author:A5093 1 OD-B567-4830-B8A4-BCB139BB8768
2urn:|sid:zoobank.org:author:58B9D453-586C-4B08-BA D6-BCC606E3D654
Abstract. A new flower fly species for Germany is reported. Psilota exilistyla Smit & Vujic, 2008 (Diptera: Syrphidae)
is recorded from the Black Forest (Schwarzwald, Baden-Wiurttemberg, south-west Germany). Published records of P.
exilistyla are given in a distribution map.
Key words. New record, hover fly, hoverfly, flower fly, Germany, Schwebfliegen.
INTRODUCTION
The genus Psi/ota Meigen, 1822 (Diptera, Syrphidae,
Eristalinae) is a relatively small group of rarely collected
flower flies, with the exception of a few relatively com-
mon Australian species (Smit & Vuji¢ 2008; Young et al.
2020). The genus is widely distributed, present in the Ne-
arctic (three species), Palaearctic (nine species), Austra-
lian (34 species) and Indomalayan (five species) regions
(Thompson 2013; Young et al. 2020; Radenkovic et al.
2020). In Europe, a total of six species are known: Psi-
lota aegeae Vujic, Stahls & Smit, 2020, Psilota anthra-
cina Meigen, 1822, Psilota atra (Fallén, 1817), Psilota
exilistyla Smit & Vujic, 2008, Psilota innupta Rondani,
1857, and Psilota nana Smit & Vuji¢c, 2008. Adults of Eu-
ropean species of Psi/ota are found in forested areas, in
habitats with mature Quercus, Carpinus, Ulmus, and/or
with coniferous trees (Picea and Pinus) depending on the
particular species (Speight 2020a). Psilota can be diag-
nosed by their densely pilose eye, the presence of a tuft of
pile on the meron anteroventral to the posterior spiracle,
and a pilose, concave to straight face with a projecting
epistoma. All European species are morphologically very
similar: medium-sized, compact-build, and with a gener-
al dark coloration. Their overall morphological similarity
and the incomplete information on the types contribute to
the confusion about the identity of the different taxa and
their names (Smit & Vujic 2008; Speight 2020a; but see
Radenkovié et al. 2020). Known larvae are short-tailed
maggots found in decaying liquid media ranging from
sap flows to waste dumps in termite nests (Kassebeer
et al. 1998; Thompson 2013).
Received: 04.03.2021
Accepted: 18.05.2021
The German syrphid fauna is well known (Schumann
et al. 1999; Schumann 2002, 2005, 2010, Ssymank et al.
2011) and so far, three Psi/ota species have been recorded
from Germany, 1.e., P. anthracina, P. atra, and P. innupta
(Flugel 2001; Smit & Vuji¢ 2008). Here a fourth species
is reported for the first time from Germany, P. exilistyla.
MATERIAL AND METHODS
Locality
During a field expedition in early July, 2014 two Psilota
specimens were collected using a hand net in Baden-Wurt-
temberg, southwest Germany. The male specimen here
reported (Fig. 1) was collected along the path to the Zas-
tler Hutte. Located in the Black Forest (Schwarzwald),
the Feldberg (1,493 m asl) is the highest mountain in Ger-
many outside the Alps, and northwest of Feldberg sum-
mit is the Zastler Hutte, a low-mountain managed hut.
The Feldberg just surpasses the altitude of natural tree
growth and has extended high-mountain grasslands of
the Leontodonto-Nardetum community. The slopes have
seminatural forests of Picea abies (L.) H.Karst. and Abies
alba Mill. The collection site along the path had abundant
subalpine flowering tall herb vegetation adjacent to the
coniferous forest. The specimen was collected into 96%
ethanol and later dried in a Critical-Point Dryer.
The female specimen was collected approximate-
ly 8 km south of this point, along the path to the Berg-
gasthof Prager Boden, in the Gletscherkessel Prag Na-
ture Reserve, and kept in 96% ethanol. The path crosses
high-mountain Nardion-grasslands, and extensive pas-
Corresponding editor: R. Peters
Published: 22.05.2021
Ze
Ximo Mengual & Axel Ssymank
Fig. 1. Male specimen of Psilota exilistyla (ZFMK-DIP-00075145). A. Habitus, dorsal view. B. Habitus, lateral view. C. Head,
frontal view. D. Male genitalia: hypandrium, epandrium, cerci and surstyli in lateral view. Scale=1 mm.
tures of the Festuco-Genistetum sagittalis community,
with montane tall herb stands with Chaerophyllum hirsu-
tum L. and adjacent semi-natural Picea abies and mixed
Abies alba forests of the Abieti-Fagetum community.
The Prager Boden and Gletscherkessel Prag is an old
glacial valley where six different glaciers met during the
Wurm-glaciation period. It is well known due to the cold
stenotherm fauna including relicts and endemic beetles in
the huge siliceous screes and block fields (LUBW 1986;
Regierungsprasidium Freiburg 2011).
Taxonomy and photography
Identification was conducted using the species key of
Smit & Vuyic (2008) and Radenkovicé et al. (2020) af-
Bonn zoological Bulletin 70 (1): 221-225
ter using Speight (2020b) to identify the genus. The
male specimen is deposited at the Zoologisches For-
schungsmuseum Alexander Koenig, Bonn, Germany
(ZFMK) and the female specimen is housed at the pri-
vate collection of Axel Ssymank, Wachtberg, Germany
(PCAS).
Focus stacked images were created using the soft-
ware Zerene Stacker® ver. 1.04 (Richland, Washington,
USA), based on photographs of pinned specimens taken
with a Canon EOS 7D® mounted on a P—51 Cam-Lift
(Dun Inc., VA, USA) and with the help of Adobe Light-
room® ver. 5.6. Figure 2 was created with the help of
SimpleMappr (Shorthouse 2010).
©ZFMK
Psilota exilistyla new for Germany 223
Fig. 2. Known records of P. exilistyla. Green= published records; red=new records from Germany.
DNA barcoding
The 5'-end of the mitochondrial cytochrome c oxidase
subunit I (COI) gene, the so called DNA barcode (He-
bert et al. 2003a, 2003b), was obtained from the female
specimen using a metaleg for the DNA extraction. We
used the extraction protocol by Mengual et al. (2018) and
the specimen was labelled as DNA voucher for the pur-
pose of morphological studies. DNA primers and PCR
amplification protocols follow Rozo-Lopez & Mengual
(2015).
The sequences were edited for base-calling errors and
assembled using Geneious R7 (ver. 7.1.9, Biomatters
Ltd). From Smit et al. (2015) we included all the COI
sequences they used in their analysis. The alignment of
the COI sequences was done using Geneious Alignment
and a Neighbour-Joining (NJ) tree was inferred using the
Jukes-Cantor model as implemented in Geneious R7.
Bootstrap support values were estimated from 1,000 rep-
licates as spawned in Geneious R7.
RESULTS
Material examine
GERMANY — 1 8; ZFMK-DIP-00067465, ZFMK
DNA voucher D502; PCAS; Baden-Wirttemberg,
Schwarzwald, Prag/ Geschwend, Prager Boden, Wegab-
stieg von der [Htitte zum Parkplatz]; alt. 930-1050 m;
47°48°28.5” N, 07°59°38.5” E; 10.vi.2014; A. Ssymank
leg. — 1 4; ZFMK-DIP-00075145, ZFMK; Schwar-
zwald, Zastler Tal, Feldberg, Weg zur Zastler Hutte:
alt. 960-1060 m.; 47°53’24.8” N, 08°00°55.5” E to
Bonn zoological Bulletin 70 (1): 221-225
47°53°15.9” N, 08°00’29” E; 09.v1.2014; X. Mengual
and MLS. Peiro leg.
The two specimens collected in the Schwarzwald be-
long to Psilota exilistyla and represent the first records
of this species from Germany. The identification was
confirmed with morphological and molecular characters.
This species belongs to the P. atra species group as de-
fined by Smit & Vuji¢ (2008) with face shiny, at most
only slightly pruinose beneath antennae, and thorax and
abdomen bluish-black coloured, entirely shiny (Fig. 1).
Among the taxa of the P. atra species group, males of P.
exilistyla can be distinguished by having the face about
2.5 x longer than frons (Fig. 1C) and characters of the
male genitalia: epandrium not elongated, broader than
long in lateral view; and surstylus very long and slen-
der, inner surstyle lobe about twice as long as the max-
imum length of the epandrium, and outer surstyle lobe
extremely narrow, often not curved but folded backwards
(Fig. 1D). The females of P. exi/istyla can be identified
by the short black pile at the posterior margin of tergite
4, metafemur not swollen, and postpedicel (basoflagel-
lomere) about 1.5 times as long as broad.
The COI sequence obtained for the female specimen
(GenBank accession number MW703674) is a bit short-
er (651 bp) than the COI sequences used by Smit et al.
(2015), which are 658 bp long. Nevertheless, our speci-
men is placed in the NJ tree (Fig. 3) within the exilisty-
la cluster, together with specimens from Greece and the
Netherlands.
©ZFMK
224 Ximo Mengual & Axel Ssymank
e4007596253|RMNH.INS.556461|Myolepta_vara
100
65
0.01
e4007598853|RMNH.INS.557239|Psilota_kroshka
e4000483018|/RMNH.INS.553966|Psilota_anthracina
€4003830138|RMNH.INS.551599|Psilota_anthracina
100 | e4003830291|RMNH.INS.551276|Psilota_anthracina
e4003832977|RMNH.INS.553174|Psilota_anthracina
e4003832975|RMNH.INS.553172|Psilota_spec.
ZFMK-DIP-00067465|Psilota_exilistyla_DE
e4003830290|RMNH.INS.551275|Psilota_exilistyla_NL
100
e4003832955|RMNH.INS.553152|Psilota_exilistyla_GR
e4003832956|RMNH.INS.553153|Psilota_exilistyla_GR
e4003830249|RMNH.INS.551234|Psilota_atra
100
e4003832927|RMNH.INS.553124|Psilota_atra
e4003832928|RMNH.INS.553125|Psilota_atra
e4003832943|RMNH.INS.553140|Psilota_atra
e4003832959|/RMNH.INS.553156|Psilota_atra
e4003832960|/RMNH.INS.553157|Psilota_atra
Fig. 3. Neighbour-Joining tree using Jukes-Cantor model of several Psilota species based on COI sequences, with Myolepta vara
(Panzer, 1797) constrained as outgroup. For metadata of the voucher specimens see Smit et al. (2015), except for the female spec-
imen ZFMK-DIP-00067465. GR=Greece; NL=the Netherlands, DE=Germany. Bootstrap support values are given at the nodes.
DISCUSSION
Psilota exilistyla was originally described based on male
and female specimens from Greece and France (Smit &
Vuyic 2008). Since then, new records across Europe have
been published from Belgium, Netherlands and Poland
(Van de Meutter & Reemer 2012; Smit et al. 2015; Van
der Ent 2017; Z6ralski 2018; Bot & Van de Meutter 2019),
but these records were overlooked by Vuji¢ et al. (2020).
Moreover, field observations are graphically documented
in online databases, such as Waarneming (https://waar-
neming.nl/), and incorporated in the Global Biodiversity
Information Facility (www.gbif.org). All these records
plus online published records (Gilg & Mazuez 2019;
Waarnemingen 2020) were summarized in Fig. 2.
The Syrphidae Red List for Germany (Ssymank &
Doczkal 2008; Ssymank et al. 2011) lists P innupta
as extremely rare in this country. Ssymank & Doczkal
(1998) listed P. anthracina as endangered based on lim-
ited data, but later Ssymank et al. (2011) listed P. an-
thracina and P. atra as data deficient. Van de Meutter &
Reemer (2012) stated that due to their scarcity and the
Bonn zoological Bulletin 70 (1): 221-225
fact that are infrequently encountered and sampled, the
distribution and taxonomy of Psi/ota species may still
change when more records become available. After the
revision by Smit & Vuji¢ (2008) and good discriminating
characters for females found by Bot & Van der Meutter
(2019) the European Psi/ota species are better defined.
As an example, published records from Belgium were
restudied by Opdekamp & Van de Meutter (2019) and
now P. exilistyla is the most common Psi/ota species in
Belgium. More revisionary work is needed since the pub-
lications of the last decade to assess precisely the con-
servation status, distribution and taxonomy of Psi/ota in
Europe. More records of P. exilistyla are expected from
Central Europe in the near future.
Acknowledgments. We thank Marissa S. Peiré for collecting
the male specimen of P. exilistyla. We also thank Frank van de
Meutter for sharing their locality data of P. exilistyla in Belgium
and for confirming the identification of the female specimen.
Claudia Etzbauer is acknowledged for obtaining the molecular
sequence for the female specimen and Sander Bot for sharing
data on Psilota. We are very thankful to John Smit for sharing
with us the COI sequences he used in Smit et al. (2015). We
©ZFMK
Psilota exilistyla new for Germany 225
thank Andrew D. Young and John Smit for their helpful com-
ments.
The Regierungsprasidium Freiburg kindly issued the neces-
sary permits for insect research in the two Nature Reserves (AZ
55-8841.06.0, issued on 11.04.2014).
This is a contribution to the German Barcode of Life (Geiger
et al. 2016; http://www.bolgermany.de).
REFERENCES
Bot S, van de Meutter F (2019) Veldgids Zweefvliegen. KNNV
Uitgevertj, Zeist.
Fluigel HJ (2001) Schwebfliegenfunde aus Berlin und Branden-
burg (Diptera: Syrphidae). Markische Entomologische Nach-
richten 3 (2): 33-54
Regierungsprasidium Freiburg (2011) Die Naturschutzgebiete
im Regierungsbezirk Freiburg. 3 ed. Thorbecke: Ostfildern.
Geiger MF, Astrin JJ, Borsch T, Burkhardt U, Grobe P, Hand R,
Hausmann A, Hohberg K, Krogmann L, Lutz M, Monje C,
Misof B, Moriniére J, Muller K, Pietsch S, Quandt D, Rulik
B, Scholler M, Traunspurger W, Haszprunar G, Wagele W
(2016) How to tackle the molecular species inventory for an
industrialized nation — lessons from the first phase of the
German Barcode of Life initiative GBOL (2012-2015) 1.
Genome 59 (9): 661-670. https://do1.org/10.1139/gen-2015-
0185
Gilg ON, Mazuez CN (2019) Inventaire National du Patri-
moine Naturel. RNF - Données de l’association de la RN du
lac de Remoray. Version 1.1. UMS PatriNat (OFB-CNRS-
MNHN), Paris. Online at https://www.gbif.org/occur-
rence/2472536276 [last accessed 21 Aug. 2020]. https://doi.
org/10.15468/3hjtgz
Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003a) Bio-
logical identifications through DNA barcodes. Proceedings
of the Royal Society of London B 270: 313-321. https://doi.
org/10.1098/rspb.2002.2218
Hebert PDN, Ratnasingham S, DeWaard JR (2003b) Barcod-
ing animal life: cytochrome C oxidase subunit 1 divergences
among closely related species. Proceedings of the Royal So-
ciety of London B 270: S96-S99. https://doi.org/10.1098/
rsbl.2003.0025
Kassebeer C, Maibach A, Rotheray GE (1998) The third (final)
stage larva of Psilota anthracina Meigen and Psilota deces-
sa (Hutton) (Dipt., Syrphidae). The Entomologist*‘s Monthly
Magazine 134: 39-43
LUBW (Landesanstalt fiir Umwelt Banden-Wirttemberg)
(1986) Schutzgebietsverzeichnis — Steckbriefe ,,3.2.01 Glet-
scherkessel Prag“ (Schutzgebietsgutachten). Online at http://
wwwz2.lubw.baden-wuerttemberg.de/public/abt2/dokablage/
oac_12/wuerdigung/3/3201.htm [last accessed 04 Mar. 2021]
Opdekamp W, Van de Meutter F (2019) First observations of
Psilota atra (Fallén, 1817) in Belgium (Diptera: Syrphidae).
Bulletin de la Société royale belge d’Entomologie 155: 101—
104
Radenkovi¢ S, Likov L, Stahls G, Rojo S, Pérez-Bafion C,
Smit J, Petanidou T, Van Steenis W, Vuji¢ A (2020) Three
new hoverfly species from Greece (Diptera: Syrphidae)
Zootaxa 4830 (1): 103-124. https://doi.org/10.11646/zoot-
axa.4830.1.4
Rozo-Lopez P, Mengual X (2015) Mosquito species (Diptera,
Culicidae) in three ecosystems from the Colombian Andes:
identification through DNA barcoding and adult morphol-
ogy. ZooKeys 513: 39-64. https://doi.org/10.3897/zook-
eys.513.9561
Bonn zoological Bulletin 70 (1): 221-225
Schumann H (2002) Erster Nachtrag zur ,,Checkliste der Dip-
teren Deutschlands“. Studia dipterologica 9: 437-445
Schumann H (2005) Zweiter Nachtrag zur ,,Checkliste der Dip-
teren Deutschlands“. Studia dipterologica 11 [2004]: 17—27
Schumann H (2010) Dritter Nachtrag zur Checkliste der Dip-
teren Deutschlands. Studia dipterologica 16 [2009]: 619-630
Schumann H, Bahrmann R, Stark A (eds) (1999) Checkliste der
Dipteren Deutschlands. Studia dipterologica, Supplement 2:
1-354
Shorthouse DP (2010) SimpleMappr, an online tool to produce
publication-quality point maps. Online at http://www.simple-
mappr.net [last accessed 21 Aug. 2020]
Smit J, de Bree E, van Steenis J, van der Ent L-J (2015) De
Spichtige Spitsbek Psilota exilistyla, een derde soort Psilota
in Nederland (Diptera : Syrphidae). Nederlandse faunistische
Mededelingen 45: 25-31
Smit J, Vujic A (2008) The Palaearctic species of the genus Psi-
lota Meigen (Diptera, Syrphidae) with the description of two
new species. Studia dipterologica 14 [2007]: 345-364
Speight MCD (2020a) Species accounts of European Syrphidae
2020, vol. 104. 314 pp. in: Speight MCD, Castella E, Sarthou
J-P, Vanappelghem C (eds) Syrph the Net, the database of
European Syrphidae (Diptera). Syrph the Net publications,
Dublin
Speight MCD (2020b) StN key for the identification of the
genera of European Syrphidae (Diptera) 2020, vol. 105. 46
pp. in: Speight MCD, Castella E, Sarthou J-P, Vanappelghem
C (eds) Syrph the Net, the database of European Syrphidae
(Diptera). Syrph the Net publications, Dublin
Ssymank A, Doczkal D (1998) Rote Liste der Schwebfliegen
(Diptera, Syrphidae). Pp. 65—72 in: Binot M, Bless R, Boe
P, Gruttke H, Pretscher P (eds) Rote Liste gefahrdeter Tiere
Deutschlands. Schriftenreihe ftir Landschaftspflege und Na-
turschutz 55. Landwirtschaftsverlag, Munster
Ssymank A, Doczkal D, Rennwald K, Dziock F (2011) Rote
Liste und Gesamtartenliste der Schwebfliegen (Diptera: Syr-
phidae) Deutschlands. Pp. 13-83 in: Binot-Hafke M, Balzer
S, Becker N, Gruttke H, Haupt H, Hofbauer N, Ludwig G,
Matzke-Hajek G, Strauch M (eds) Rote Liste gefahrdeter
Tiere, Pflanzen und Pilze Deutschlands. Band 3: Wirbellose
Tiere (Teil 1). Naturschutz und Biologische Vielfalt 70 (3).
Landwirtschaftsverlag, Munster
Thompson FC (2013) A new Psilota flower fly (Diptera: Syr-
phidae) from Vietnam. The Entomologist’s Monthly Maga-
zine 149: 181-185
Van de Meutter F, Reemer M (2012) The genus Psilota (Dip-
tera: Syrphidae) in Belgium: a tale of three new species to
our fauna in a handful of years. Bulletin van de Koninklike
Belgische Vereniging voor Entomologie 148: 23—26
Van der Ent L-J (2017) Determinatiesleutel tot de soorten van
het genus Psilota in de Benelux op basis van veldkenmerken
(Syrphidae). Vliegenmepper 26 (1): 3—5
Vujic¢ A, Speight MCD, Williams MC, Rojo S, Stahls G, Ra-
denkovic S, Likov L, Milici¢ M, Pérez-Bafion C, Falk S,
Petanidou T (2020) Atlas of the Hoverflies of Greece (Dip-
tera: Syrphidae). Koninklijke Brill NV, Leiden.
Waarnemingen (2020) Online at https://waarnemingen.be/spe-
cies/187051/observations/? [last accessed 21 Aug. 2020]
Young AD, Skevington JH, Van Steenis W (2020) Revision of
the Psilota Meigen, 1822 flower flies (Diptera: Syrphidae) of
Australia. Zootaxa 4737 (1): 1-126 https://doi.org/10.11646/
zootaxa.4737.1.1
Zoralski R (2018) Review of the genus Psilota (Diptera, Syr-
phidae) in Poland. Dipteron 34: 4-14. Online at https://zeno-
do.org/record/1450939 [last accessed 18 May 2021]
©ZFMK
BHL
i
Blank Page Digitally Inserted