s 2i2 7-
NATURAL HISTORY
ivlUSRUM LIBRARY
Journal of the *
Entomological Society
of British Columbia
Volume 110 Issued December 2013 ISSN #0071-0733
2015
ESBC
Entomological
©2013 Society of British
Columbia
Natural History Museum Library
00 183628
COVER: Agapostemon sp. (Hymenoptera: Halictidae)
A female Agapostemon (probably texanus) gathers nectar from a diffuse knapweed flowerhead.
Halictine bees run that gamut from true eusociality to solitary nesters and are as such an
excellent system for studying the evolution of hymenopteran social behaviour. Agapostemon
species can be communal nesters, but A. texanus as a species seems to be pretty steadfastly
solitary in its habits. Like other ground nesting bees, it has an annual life cycle where
overwintering females emerge in the warm part of the spring, build vertical burrows in soil and
provision individual eggs with a pollen ball to support larval development all the way through
to pupation. Males become abundant in late summer and fall and mated females will overwinter
in diapause to start the cycle over the following year. Unlike the bee, which is native, diffuse
knapweed is an invasive pest in western rangelands.
Photograph details:
Photograph by Robert Lalonde (UBC Okanagan). Made with a Canon EOS digital rebel T2i
equipped with a Canon 100mm f2.8 macro lens in natural light; ISO 800; f8 at 1/250 sec; on 8
July 2013 at 1557h on the UBC Okanagan campus in Kelowna, British Columbia.
The Journal of the Entomological Society of British Columbia is published
annually in December by the Society
Copyright© 2013 by the Entomological Society of British Columbia
Designed and typeset by Tanya Stemberger
Printed by FotoPrint Ltd., Victoria, B.C.
Printed on Recycled Paper.
J. Entomol. Soc. Br]t. Columbia 110, December 2013
Journal of the
Entomological Society of British Columbia
natural HISTORY
IVIUSEUM LIBRARY
1 8 APR 2015
Volume 110 Issued December 2013 ISSN #0071-0733
Directors of the Entomological Society of British Columbia, 2013-2014,
2
G.R. Pohl and R.A. Cannings. The new checklist of British Columbia Lepidoptera and how it
came to be 3
A. Pantoja, D.S. Sikes, A.M. Hagerty, Susan Y. Emmert, and Silvia Rondon. Ground beetle
(Coleoptera: Carabidae) assemblages in the Conservation Reserve Program crop rotation
systems in interior Alaska 6
S. Mathur, D.A. Raworth, K.S. Pike, and S.M. Fitzpatrick. Diagnostic molecular markers to
detect and identify primary parasitoids (Hymenoptera: Braconidae) of Ericaphis Jimbriata on
highbush blueberry 19
A.J. Stock, T.L. Pratt, and J.H. Borden. Seasonal flight pattern of the Western Balsam Bark
Beetle, Dryocoetes confusus Swaine (Coleoptera: Curculionidae), in central British
Columbia 27
SCIENTIFIC NOTES
Chris J.K. MacQuarrie, Daryl J. Williams, and David W. Langor. Update on the establishment
of birch leaffniner parasitoids in western Canada 35
M. Jackson, C. Pyles, S. Breton, T. J. S. McMahon and P. Belton. British Columbia’s 50th
mosquito species, Aedes schizopinax 38
ANNUAL GENERAL MEETING ABSTRACTS
Entomological Society of British Columbia Annual General Meeting Symposium Abstracts: The
Rise and Fall of the Honeybee 40
Entomological Society of British Columbia Annual General Meeting Presentation
Abstracts 44
NOTICE TO CONTRIBUTORS
Inside Back Cover
J. Entomol. Soc. Brit. Columbia 1 10, December 2013
DIRECTORS OF THE ENTOMOLOGICAL SOCIETY
OF BRITISH COLUMBIA FOR 2012-2013
President:
Agriculture and Agri-Food Canada, Summerland
President-Elect:
Steve Perlman
University of Victoria
Past-President:
Ward Strong
B.C. Ministry of Forests, Lands and Natural Resource Operations
Treasurer:
Maxence Salomon (
[email protected])
Secretary:
Tracy Hueppelsheuser (
[email protected])
B.C. Ministry of Agriculture, Abbotsford
Directors:
Renee Prasad (first term), Marla Schwarzfeld (first term). Bob Lalonde (second term), Jenny
Cory (second term), Karen Needham (second term)
Graduate Student Representative:
Ikkei Shikano
Regional Director of National Society:
Bill Riel
Natural Resources Canada, Canadian Forest Service
Editor, Boreus:
Gabriella Zilahi-Balogh (
[email protected])
Canadian Food Inspection Agency
Web Editor:
Natural Resources Canada, Canadian Forest Service
Honorary A uditor:
Rob McGregor
Douglas College
Society homepage: http://entsocbc.ca Journal homepage: http://journal.entsocbc.ca
Editorial Committee of the Journal of the Entomological Society of British Columbia:
Editor-in-Chief:
University of Northern British Columbia
Editorial Board:
Lorraine Maclauchlan, Robert Cannings,
Steve Perlman, Lee Humble, Rob
McGregor, Robert Lalonde
Copy Editor: Monique Keiran
Technical Editor: Tanya Stemberger
J. Entomol. Soc. Brit. Columbia 110, December 20 13
3
FORUM
The new Checklist of British Columbia Lepidoptera and how it
came to be
GREGORY R. POHC and ROBERTA. CANNINGS ^
The Entomological Society of British
Columbia (ESBC) is publishing a new
checklist of the Lepidoptera of British
Columbia as the third volume in the ESBC's
Occasional Papers series (Pohl et al., in press).
Occasional Paper No. 1, published in 1951,
was "An annotated check list of the
macrolepidoptera of British Columbia" by J.
R. J. Llewellyn Jones. Llewellyn Jones was an
active ESBC member who willed some of his
estate to the Society so that insect lists and
other projects might be published for the good
of British Columbia (B.C.) entomology. It is
an appropriate and historic gesture for the
ESBC to publish the next major list of British
Columbia moth and butterfly species more
than 60 years later. The 1951 list proved to be
a significant entomological milestone and we
are convinced that ours will be an influential
one, too. The list’s authors are Greg Pohl
(Natural Resources Canada, Northern Forestry
Centre, Edmonton, AB), Rob Cannings (Royal
British Columbia Museum [RBCM], Victoria,
B.C.), Jean-Fran9ois Landry (Agriculture and
Agri-Food Canada, Canadian National
Collection of Insects, Arachnids and
Nematodes [CNC], Ottawa, ON), David
Holden (Canadian Food Inspection Agency,
Burnaby, B.C.), and Geoff Scudder
(University of British Columbia [UBC],
Vancouver, B.C.).
The list documents 2,757 Lepidoptera
species reported for B.C. The data are based
on literature records and examination of the
major public insect collections in the province
and the CNC. The classification and
nomenclature follow the most recent
phylogenetic hypotheses for the order, and
captures nomenclatural changes to the end of
September 2013. We include records from
relevant literature published since 1950 and
from selected older works, such as previous
B.C. checklists and significant taxonomic
revisions. The list supplies taxonomic,
distributional and biological notes for selected
species; we list an additional 30 species that
probably occur in B.C. and consider 126
species to be introduced from outside North
America. Also included is a list of 294 species
erroneously reported from B.C. in previous
works: this important section of the
manuscript clears up previous
misidentifications and errors, many of which
have persisted in the literature for decades.
Introductory sections give an overview of the
order, review the ecozones of the province,
and discuss the history of lepidopterology in
B.C. and our current state of knowledge. We
review each of the 68 families occurring in
B.C., providing information on distinguishing
features, biology and diversity. An index to the
higher taxonomic names, genera, species and
common names is included.
Species lists such as this answer the
fundamental question: "What lives here?" As a
foundation for other biological research, such
lists are the first step on a continuum of
exploration into what these species do and
how they interact with other species. The new
B.C. Lepidoptera checklist will be a
significant and useful resource for anyone
studying the Lepidoptera of the province,
including resource and conservation
managers, biodiversity researchers,
taxonomists, naturalists and amateur
collectors. Although other lists have been
published on portions of the butterfly and
moth fauna, none is as comprehensive as this
one, which represents a major step forward in
our understanding of the Lepidoptera fauna of
the province.
The list had its beginnings as something
else entirely. In the late 1990s, Geoff Scudder
and Rob and Syd Cannings embarked on a
'Natural Resources Canada, Northern Forestry Centre, 5320-122 Street, Edmonton, AB T6H 3S5.
^Curator Emeritus of Entomology, Royal British Columbia Museum, 675 Belleville Street, Victoria, B.C. V8W
9W2.
4
project to produce online overviews and user-
friendly, illustrated identification keys to
about 505 insect families and 29 insect orders
in B.C. Launi Lucas, Geoff’s assistant at
UBC, coordinated much of the project, drew
illustrations, and prepared the material for the
Internet. For several years, the “Insect
Families of British Columbia” project was
funded by Forest Renewal B.C. and its
subsequent incarnations (Forest Innovation
Investment and the Forest Science Program).
Initially, the project results were posted on a
website hosted by the Zoology Department at
UBC, but by 2007 this had migrated to E-
Fauna BC to form core entomological content
there.
Geoff and Rob created the initial draft of
the Lepidoptera list so that they could write a
brief summary of the diversity of each BC
moth and butterfly family for the "Insect
Families of B.C." Don Lafontaine of the CNC
provided the original species list in 2005. By
2007, the Lepidoptera account was complete
and posted on the Internet (Cannings and
Scudder 2007a, 2007b).
In 2009, Greg Pohl brought his expertise
and experience on Lepidoptera to the list.
Beginning with a submission of additional
micromoth names, Greg's involvement grew
and he eventually became the list’s
coordinator. He delved deeply into literature
and collection records to produce a more
comprehensive treatment, with greater
taxonomic detail and updated nomenclature.
His contribution was critical, as he had
already been amassing species names,
collection details, literature, and other
important data on B.C. moths, especially
micromoths, as part of ongoing research on
the western Canadian fauna. To add more
expertise in micromoths and to link the list
more firmly to the national data, Jean-Franqois
Landry joined the team in 2012. A year later,
David Holden also became an author, bringing
considerable B.C. experience and knowledge
to the project. The additional authority these
participants offered was immense: about 450
species were added to the 2007 list, and the
knowledge of many of their colleagues was
incorporated into the data.
The challenge of compiling the
information was straightforward but daunting:
to extract records of Lepidoptera that may
occur in B.C. from all relevant taxonomic
J. Entomol. Soc. Brit. Columbia 110, December 2013
publications, and from specimens in public
collections with significant B.C. holdings.
Butterfly information was largely based upon
the definitive works by Layberry et al. (1998),
Guppy and Shepard (2001) and Pyle (2002).
For macromoths, we drew upon Troubridge
and Lafontaine's Moths of Canada website
(CBIF 2003) and various fascicles in the
Moths of North America series, but have also
examined virtually all North American
taxonomic works published since 1950 and
many from before. For micromoths, we
checked almost every North American
taxonomic publication since 1900, and a few
earlier ones. All these literature records were
then augmented with previous provincial lists,
regional lists and specimen data from the
RBCM, the Beaty Biodiversity collection at
UBC, the Canadian Forest Service-Pacific
Forestry Centre collection, the CNC in
Ottawa, and several other regional collections
across Canada. Some curators were able to
provide species lists for us; we visited other
collections to extract the records ourselves.
Most of this was done over several years by
Greg, with assistance from summer student
Christi Jaeger. As well, Remi Hebert,
Scientific Project Coordinator for the General
Status of Species in Canada (Environment
Canada), stepped in with critical funds for
contracts to extract records from some large
historical monographs and from specimens in
the UBC collection and the CNC. All these
activities brought together the vast majority of
the required data. To produce the current list,
we compiled all the records organised by a
nomenclatural database built by Greg from the
taxonomic papers examined. We then ground-
truthed the list by flagging questionable
records and by checking the identities of
selected specimens. The resulting list was
examined by a number of experts and then
vetted again by anonymous reviewers for the
Journal of the ESBC.
Greg and Rob wrote an introduction
putting the contents of the list in biological,
geographical, historical and taxonomic
contexts. An overview of the Lepidoptera was
excerpted from the order account that Rob had
prepared for the material now online on E-
Fauna BC. Rob also wrote a summary of the
ecozones of B.C. as an overview of the
province’s environment. Greg summarized the
history and current state of Lepidoptera
J. Entomol. Soc. Br]t. Columbia 110, December 20 13
research in B.C. and described the format and
content of the checklist. He also prepared the
index, the reference section, and the list of
excluded taxa.
As authors of the list, we are primarily
compilers and editors of scattered information;
we owe a huge debt to the curators of our
public collections and the taxonomists who
described and revised all the species listed. We
also acknowledge historical workers such as
George W. Taylor, E. M. Anderson, Ernest H.
Blackmore and James R. J. Llewellyn Jones,
as well as more recent researchers and
collectors such as Libby Avis, Cris Guppy,
Dean Nicholson, Jon Shepard and Jeremy
5
deWaard. This list would not exist without
their efforts.
Our intent is to make a PDF of the
complete list available on the ESBC and
RBCM websites and on E-Fauna BC. We
have a large spreadsheet of literature records
and collection holdings that formed the basis
of the species list, and we also hope to make
that available online. We encourage users of
the list to verify uncertain entries and to look
for gaps and omissions that will motivate them
to survey poorly known habitats and discover
new records. Dave Holden^ will compile
additions and corrections to the list and will
disseminate future updated versions.
REFERENCES
Troubridge, J. T., and J. D. Lafontaine. 2003. The moths of Canada. Canadian Biodiversity Information Facility.
http://www.cbifgc.ca/spp_pages/misc_moths/phps/mothindex_e.php [accessed 21 November 2013],
Cannings, R. A., and G. G. E. Scudder. 2007a. Butterflies, moths and skippers of British Columbia. In: B.
Klinkenberg (ed.), E-Fauna BC: Electronic Atlas of the Fauna of British Columbia. Lab for Advanced Spatial
Analysis, Department of Geography, University of British Columbia, Vancouver, B.C. Available from: http://
www.geog.ubc.ca/biodiversity/efauna/lepidoptera.html [Accessed 15 November 2013].
Cannings, R. A., and G. G, E. Scudder. 2007b. Checklist: Order Lepidoptera in British Columbia. In: B.
Klinkenberg (ed.), E-Fauna BC: Electronic Atlas of the Fauna of British Columbia. Lab for Advanced Spatial
Analysis, Department of Geography, University of British Columbia, Vancouver, B.C. Available from: http://
www.geog.ubc.ca/biodiversity/efauna/documents/Lepidoptera2008Cannings.pdf [Accessed 15 November
2013].
Dominick, R, B., C. R. Edwards, D. C. Ferguson, J. G. Franclemont, R. W. Hodges, and E. G. Munroe (series
editors) 1971 to present. The moths of America North of Mexico. E. W. Classey and R. B. D. Publications,
London, UK.
Guppy, C, S., and J. H. Shepard. 2001. Butterflies of British Columbia. Royal British Columbia Museum,
Victoria, B.C., and University of British Columbia Press, Vancouver, B.C. 414 pp.
Layberry, R. A., P, W. Hall, and J.D. Lafontaine. 1998. The Butterflies of Canada. NRC Research Press, Canada
Institute for Scientific and Technical Information, in association with University of Toronto Press, Toronto, ON.
280 pp.
Llewellyn Jones, J. R. J. 1951. An annotated checklist of the macrolepidoptera of British Columbia.
Entomological Society of British Columbia, Occasional Paper 1. 148 pp.
Pohl, G. R., R. A. Cannings, J.-F. Landry, D, G. Holden, and G. G. E. Scudder. In press. Checklist of the
Lepidoptera of British Columbia, Canada. Entomological Society of British Columbia, Occasional Paper 3.
Pyle, R. M. 2002. The butterflies of Cascadia. Seattle Audubon Society, Seattle, WA. 420 pp.
32116 Audrey Drive, Port Coquitlam, B.C. V3C1H1. email:
[email protected].
6
J. Entomol. Soc. Brit. Columbia 110, December 2013
Ground beetle (Coleoptera: Carabidae) assemblages in the
Conservation Reserve Program crop rotation systems in interior
Alaska
ALBERTO PANTOJA* 2, DEREK S. SIKES 3, AARON M. HAGERTY*,
SUSAN Y. EMMERT*, AND SILVIA RONDON^
ABSTRACT
To improve knowledge of ground beetle communities and the influence of habitat succession
on these communities in Alaska, adult ground beetle (Coleoptera: Carabidae) activity and
diversity were documented on Conservation Research Program (CRP) agricultural lands in
Delta Junction, Alaska (64° N, 145° W). Twenty species, comprising a total sample of 6,116
specimens, were collected during 2006 and 2007 from plots that were in the CRP for 9 years
(young-field plots) and 19 years (old-field plots). Two species, Cymindis cribricollis Dejean
and Amara obesa Say, are reported for the first time for Alaska. Species richness of carabids
for our study plots was estimated, using the Chao 1 and Chao 2 estimators (Chao 1987), to be
22 and 28 species, respectively. Ninety-four percent of the specimens belonged to five species:
Pterostichus adstrictus Eschscholtz (42.9%), Agonum cupreum Dejean (17.9%), Calathus
ingratus Dejean (15%), Amara obesa (11.1%), and Dicheirotrichus cognatus (Gyllenhaal)
(7.1%). Only Ag. cupreum showed significant effects based on plot age, with 7.5 times more
specimens caught on younger plots. The majority of carabid activity occurred late in the
season, from mid-September to early October. A comparison of our findings with historical
data (1943-1956) from the collection of the Matanuska Experiment Station, in Palmer,
Alaska, indicates that only three of the 44 carabid species from the historic Palmer collection
are among the CRP fauna sampled.
Key Words: Alaska, beneficial, Carabidae, CRP, diversity
INTRODUCTION
Little is known about the beneficial insect
fauna associated with Alaska’s agricultural or
natural systems (Hagerty et al. 2009). Given
anticipated expansion of agriculture in Alaska
and current trends in climate change, which is
most pronounced in northern latitudes
(Serreze et al. 2000; Chapin et al. 2006; Chen
et al. 2011), it is important to establish
baseline knowledge of the state’s insect fauna
from which subsequent comparisons can be
made. Ground beetles (Coleoptera: Carabidae)
have been used as ecological indicators for
many years (Pearce and Venier 2006;
Menalled et al. 2007; Work et al. 2008) and
are also known predators of agricultural pests
and seeds of weed plants (Lovei and
Sunderland 1996; Kromp 1999; Harrison and
Regnier 2003; O’Neal et al. 2005; Harrison
and Gallandt 2012). Alaskan farmers have
enrolled more than 10,000 hectares under the
National Resources Conservation Service
(NRCS 2003), Conservation Reserve Program
(CRP), most of which is located near the city
of Delta Junction to control erosion by wind
(Schoephorster 1973; Lewis et al. 1979).
Conservation Reserve Program land in other
states has been positively correlated with
wildlife diversity, including butterflies
'United States Department of Agriculture, Agricultural Research Service, Subarctic Agricultural Research Unit,
Fairbanks, AK 99775 USA
-Current address of corresponding author, United Nations, Food and Agriculture Organization, Regional Office for
Latin America and the Caribbean, Av. Dag Hammarskjdld 3241, Vitacura, Santiago, Chile. Email:
^Curator of Insects, University of Alaska Museum, 907 Yukon Drive, Fairbanks, AK 99775-6960 USA
''Extension Entomologist Specialist, Oregon State University, Hermiston Agricultural Research and Extension
Center, 2121 South First Street, Hermiston, OR 97838 USA
J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3
7
(Davros et al. 2006), birds (Johnson and
Schwartz 1993; Millenbah et al 1996; Best et
al 1997; Delisle and Savidge 1997),
mammals (Chapman and Ribic 2002), and
herptiles (Semlitsch and Bodie 2003).
The Conservation Reserve Program
promotes the conservation of habitats
beneficial to wildlife (NRCS 2003). However,
participation in the CRP programs requires
that CRP fields be mown every two to three
years to slow succession to shrubs and trees
(Seefeldt et al 2010). Agricultural practices
are known to affect the presence, activity, and
abundance of ground beetles in agricultural
settings (O’Rourke et al 2008; Ward et al
2011). However, despite the long history of
CRP in Alaska (Seefeldt et al 2010), little is
known about the effects of CRP-management
practices on ground beetles in the state.
Additionally, due to the state’s large size,
remoteness, vast regions of roadless lands, and
historic dearth of in-state entomological
professionals, the insect fauna of Alaska is one
of the most poorly documented in the US
(Sailer 1954).
Few detailed descriptions of entire, extant
carabid assemblages in Alaska exist. These
include Lindroth's (1963) description of the
carabids of the Aleutian Islands and studies on
the carabid fauna of Kodiak Island (Ball 1969;
Lindroth 1969b; Lindroth and Ball 1969).
Most of the detailed assemblage descriptions
are checklists, often lacking within-state
locality or ecological data. The earliest
Alaskan records are known from Russian
coleopterist Mannerheim (1843, 1846, 1852,
1853). When Hamilton (1894) summarized
the beetle fauna of Alaska, he reported 43
carabid species now considered valid.
Schwarz (1900) of the Harriman Expedition
reported 28 now-valid species. As part of an
environmental impact statement prior to the
planned, but later aborted, detonation of a
multi-megatonne nuclear device, Watson et al
(1966) documented 19 species of carabids
from the Cape Thompson region of Alaska.
The most thorough treatments of the family
for Alaska, including Canada, is the classic
six-volume work by Lindroth (1969a).
Bousquet (1991) listed 231 Alaskan species,
and Bousquet and Larochelle (1993), listed
234 species. An excellent summary of the
carabidae of the Yukon, which lists 209
species and includes syntheses of
biogeographic and habitat data, was prepared
by Ball and Currie (1997). However, these
more recent synthetic works, from Lindroth
(1969a) to Ball and Currie (1997), summarize
data across vast regions rather than describe
restricted assemblages as we do here.
This research was initiated to study the
species composition, seasonal activity, and
effects of plot age on dominant carabid
species in CRP lands in Delta Junction,
Alaska, and to aid state-wide efforts to
document Alaska’s entomofauna.
MATERIALS AND METHODS
Study Site. Land registered under the
CRP near Delta Junction, Alaska, (64° N, 145°
W) was surveyed for ground beetles. Eight
plots were selected based on their time under
the CRP program (Table 1). Plots were
assigned to two age groups, with four plots per
group according to the plot history under CRP
management that Seefeldt et al (2010)
describe. Plots with nine years under the CRP
program were grouped as young plots, while
plots with 19 years under CRP management
were considered old plots. Older plots have
more disturbance events over time (mowing
and weed control): this was expected to reduce
the relative abundance of carabids.
The Seefeldt et al (2010) report was also
used to assign a litter cover to each plot (Table
1) and compare those parameters to relative
ground beetle species’ frequencies. Plots are
located in the Interior Bottomlands Ecoregion
of the Alaska boreal forest (Gallant et al
1995), adjacent to the outwash plain of the
Tanana River. The area ranges in elevation
from 330 to 385 m; soils are silt loam (NRCS
2013). Surrounding forest vegetation is a mix
of white and black spruce [Picea glauca
(Moench) Voss and P. mariana (Mill.) Britton,
Sterns & Poggenburg], balsam poplar
{Populus balsamifera L.), quaking aspen
{Populus tremuloides Michx.), and paper birch
(Betula papyrifera Marsh.), with associated
understorey species (Hulten 1968). Average
winter temperature are between -2 and -A °C,
with frost-free periods typically lasting 80 to
120 days. The average July temperature is
about 16 °C. Annual precipitation varies from
8
J. Entomol. Soc. Brit. Columbia 110, December 20 13
Table 1
Eight study plots near Delta Junction, Alaska, USA, on Conservation Research Program land.
® Geo-coordinates have a precision of +/- 150 m (WGS84 datum); elevation of all plots: 330-350
m.
Years under CRP: old = 19 years; young = 9 years.
Litter depts. As per Seefeldt et al. (2010).
250 to 300 mm. The study area was cleared
from 1979 to 1982 as part of Delta
Agricultural Projects (Lewis et al. 1979).
Fields are farmed on a three-year rotation,
with two years of spring barley or oats
followed with one year of tilled fallow
(Seefeldt et al. 2010).
Trap Methods. Insects were collected
using pitfall traps, which are a standard
method used to measure ground beetle activity
density in both agricultural and natural
systems (Southwood 1978; O’Rourke et al.
2008; Ward et al. 2011). Although often
interpreted as measures of relative abundance,
pitfall trap catches more accurately measure
activity density and have been criticized for
their demonstrable limitations and biases (e.g..
Topping and Sunderland 1992; Melbourne
1999). Pitfall traps consisted of two plastic
480 ml containers (10.5 cm diameter X 7.5 cm
deep), one inside the other. Holes were dug
with a standard hand-held post-hole digger,
and containers were placed in each hole so
that the rim of the inner container was flush
with the ground. The outer container had holes
in the bottom to allow drainage. The inner
container was filled approximately one-
quarter full with a solution of 25 % propylene
glycol. Each trap was covered with a white
23-cm-diametre plastic plate. Plates were held
in place by three landscaping staples pushed
through the top. The traps were placed in the
field in a diamond pattern (approx. 1 m
between each trap), using five traps within
each of the eight plots, for a total of 40 traps.
Traps were deployed as early as holes could
be dug to set traps.
Insect counts from the five traps per site
and sampling date were combined and
considered as a sample for statistical analysis.
Based on relative plant density, traps were
placed in plot areas that seemed representative
of the overall plot. Traps were emptied and
reset on a weekly basis in 2006 and 2007.
Sampling dates were 6 June to 20 October
2006 and 8 May to 28 September 2007. At
times, voles were caught in traps.
Sample Processing. Samples were
transported to the US Department of
Agriculture (USDA), Agricultural Research
Service (ARS) laboratory on the University of
Alaska-Fairbanks campus and processed.
Ground beetles were pinned and identified
primarily by the third author, using methods
described by Lindroth (1969a), Bousquet and
Larochelle (1993), and Ball and Bousquet
(2001). Most identifications were confirmed
by George E. Ball (University of Alberta,
J . Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3
9
Canada), Robert Davidson (Carnegie Museum
of Natural History, Pittsburg, Pennsylvania),
and Christopher J. Marshall (Oregon State
Arthropod Collection, Corvallis, Oregon).
Voucher specimens were deposited in the
insect collection of the University of Alaska
Museum (UAM), Fairbanks, Alaska. Records
of these specimens are available online via the
UAM database (Arctos 2013a). Species names
follow the classification of Bousquet and
Larochelle (1993), and Ball and Bousquet
(2001).
Species Richness. Estimates v8.2
(Colwell 2009) was used to calculate
estimated species richness using nine
estimators. Species-richness estimators allow
one to extrapolate beyond one’s data to infer
the total number of species in these plots if
sampling were continued using the same
methods, thus providing an estimate of
completeness. The results over the combined
two-year sample for two of the most
frequently used estimators, Chao 1 and Chao
2, were calculated (Chao 1987). Chao 1 is an
abundance-based estimator, in that it uses the
number of species represented by one or two
individuals, whereas Chao 2 is an incidence-
based estimator, in that it relies on the number
of species found in only one or two sample
units, regardless of the number of individuals
(Chazdon et al. 1998).
Data Analysis. The number of insects per
trap per 14-day period was calculated by
combining weekly captures and used to
present seasonal variation. Insect counts from
the five traps per site were pooled for
statistical analysis. Insect counts for species
for which at least 50 specimens were collected
during the two-year sampling period
(O’Rourke et al. 2008) were analyzed using
PROC GLIMIX (SAS 2008), and means were
compared with the LSMEANS statement with
the ILINK option. The Poisson distribution
was used to model the counts, the Generalized
Chi-square/DF was used to test fitness, and
the Type III Tests of Fixed Effects were used
to test significance for time under CRP.
Historic Data. The University of Alaska
Museum Insect Collection (UAM) was
examined to provide additional information on
ground beetle species in Alaska. This
collection, formerly housed at the Matanuska
Experiment Station of the University of
Alaska Agricultural and Forestry Experiment
Station in Palmer, Alaska, is the only large
agricultural insect collection maintained in the
state (Washburn 1972). Some of the carabid
records of the collection were published
previously (Lindroth 1969a) and all of the
species have been reported from the state by
other workers. However, because this
collection was assembled as part of early
agricultural research in Alaska, we report the
Alaskan records here for comparative
purposes. Specimen data for these records are
available via UAM’s online database (Arctos
2013b). The majority of specimens housed in
the UAM Insect Collection were previously
identified by J. M. Valentine and C. H.
Lindroth in the 1940s and 1960s, respectively.
RESULTS
Species Richness. A total of 6,116
specimens representing 20 species from 14
genera were collected (Table 2). The full set of
estimators (±1 SD) yielded estimates that
ranged from 19.7 to 28 species (Fig. 1): 22.8
(ACE); 23.8 ± 0.01 (ICE); 22.3 ± 3.4 (Chao
1); 28 ± 11.7 (Chao 2 ); 23.9 ± 1.9 (Jack 1);
26.8 (Jack 2); 21.7 (Bootstrap mean); 19.7
(MMRuns Mean); 20 (Cole Rarefaction;
Colwell, 2009).
Activity Density. The total number of
specimens from CRP plots was almost equal
between years, with 3,099 and 3,017
specimens for 2006 and 2007, respectively
(Table 2). However, A. cupreum specimens
were 3.2 times more abundant in 2007
(n=828) than in 2006 (n=256), and A. obesa
activity was 15.3 times higher in 2006
(n=644) than in 2007 (n=42). Ninety-four
percent of the specimens belong to five
species: P. adstrictus (42.9%), A. cupreum
(17.9%), C. ingratus (15%), A. obesa (11.1%),
and D. cognatus (7.1%). Two species, A.
obesa and C. cribricoUis, represent new
records for Alaska.
A single species, P. adstrictus, was the
predominant species in both years,
representing 39.3% and 46.4% of total
specimens collected during 2006 and 2007,
respectively (Table 2). This species was
captured equally in all plots, regardless of
time under CRP management or litter depth
10
J. Entomol. Soc. Brit. Columbia 110, December 2013
(Table 1). P. adstrictus was also the most
abundant species in the historic data (Arctos,
2013b), with 58 specimens (Table 3).
Ground beetle activity density differed by
the amount of time the plot had been under the
CRP program, but was not affected by the
depth of the litter cover on plots. However, the
response varied by species (Table 1 and 4). All
species with at least 50 specimens in each year
in the total dataset were found in both old and
young plots, but not in equal proportions. A
significantly lower number (7.5 times less) of
A. cupreum was recorded for plots with a long
history (19 years) under the CRP
Table 2
Activity densities of 20 ground beetle species, for which at least 50 specimens were collected
during the two-year sampling period from CRP land, sorted from most to least abundant. Percent
within yearly totals and sums across both years are presented. Delta Junction, Alaska, USA, 2006-
2007.
n = 3099 and 3017 individuals for 2006 and 2007, respectively.
® New record for Alaska
Amara sp(p.) confirmed as not Amara obesa
J. Entomol. Soc. Brit. Columbia 1 10, December 2013
11
Figure 1. Carabid species richness estimates calculated using the Chao 1 and 2 estimators (Chao
1987) for combined 2006 and 2007 samples, from Delta Junction, AK, CRP land. At Sample 40,
the means of each estimator were 22, 25, and 28, respectively. The observed species richness was
20 species obtained by Sample 27. Estimates were made using Estimates v8.2 (Colwell 2009).
management, compared to plots with a mean
of nine years under CRP (Table 4). However,
frequencies of A. obesa, C. ingratus, D.
cognatus, and P. adstrictus were not
significantly affected by time under CRP
management.
The maximum activity density observed
was 32.9 P. adstrictus per 14-day sampling
period for October 15, 2007. Pterostichus
adstrictus was collected after first snowfall
and can be active until early October. In 2006,
snow/rain was registered as early as
September 25, snow was registered by
September 30, and insects were collected up
to October 30 (Fig. 2).
Activity was observed from May to
October (Fig 2). Traps were deployed as early
as holes could be dug to set traps. During both
years, ground beetles were active during the
first week after traps were deployed, before
the soils thawed. Depending on the year and
species, ground beetle activity, as measured by
the mean number of adults per 14-day period,
started increasing rapidly in late September
(2006) or late August (2007).
Historic Data. The UAM holdings from
the Experiment Station, in Palmer, Alaska,
which were assembled as an agricultural
research collection, includes 44 confidently
identified carabid species (Table 3). Three
species occur in both the historic data and the
CRP findings {P. adstrictus, C. ingratus, and
D. cognatus). Phenology data from the
historic sampling shows three peaks of
activity, with both early (April 3) and late
(November 17) records (Fig. 3).
DISCUSSION
Species Richness. The majority of
estimators predict species richness close to our
observation of 20, although some estimators,
like the Chao2, indicate the fauna could be
much richer than we sampled. The species-
accumulation curve (Fig. 1) does not reach an
asymptote, suggesting additional species in
the community remain unsampled. The large
12
J. Entomol. Soc. Brit. Columbia 1 10, December 2013
Table 3
Forty-four carabid species, based on 254 Alaskan specimens with confident determinations collected
primarily by R. H. Washburn, G. W. Gasser, and J. C. Chamberlin between 1943 and 1956, held in the
UAM Insect Collection, and formerly housed at the Matanuska Experiment Station of the University of
Alaska Agricultural and Forestry Experiment Station, in Palmer, Alaska, USA. Specimen
determinations were made primarily by C. H. Lindroth and J. M. Valentine. Specimen data available
online via the UAM database (Arctos 2013b). Species sorted by number of specimens.
® Also collected from CPR field studies
J. Entomol. Soc. Brit. Columbia 1 10, December 20 13
13
Table 4
Mean number of ground beetles (±SE) with at least 50 specimens per year, in plots with different time
under CRP management (years under CRP: old = 19 years; young = 9 years). Delta Junction, Alaska,
USA, 2006-2007.
number of species with small counts (Table 2)
also indicates sampling of this fauna is
incomplete. Because these plots are not
isolated habitats, a low number of “tourist”
species, which pass through but do not breed
or spend much time in the sampled habitats,
are expected. However, the intent of this study
was to document the dominant carabid
species, which these estimators indicate we
have done.
New State Records. Both of the two
species, A. obesa and C. cribricollis, that are
new records for Alaska are reported from all
three major northwestern Canadian
jurisdictions (YK, NT, BC) by Bousquet
(1991), so their presence in interior Alaska is
not surprising. Bousquet and Larochelle
(1993) list C. cribricollis, but not A. obesa, as
previously reported from Alaska, but based on
doubtful record(s) that need verification.
Amara obesa is reported to prefer dry,
usually sandy, soil with sparse vegetation
(Larochelle and Lariviere 2003). This species
was the fourth most abundant, with 686
specimens eolleeted. Ninety-four percent of
these specimens were collected in 2006.
Cymindis cribricollis is a similarly
xerophilous species eolleeted mainly from dry,
sandy moraines with sparse or absent plant
cover (Lindroth 1969a; Ball and Currie 1997;
Larochelle and Lariviere 2003). In our study,
36 C. cribricollis specimens were collected,
75% of which were from two sandy plots
where little vegetation other than moss was
present; the other 25% of the specimens
collected were from a plot with sandy soils
and sparse bushes, mostly covered by grass.
Our results agree with previously published
accounts of this species’ habitat associations.
It is unknown how widespread this species is
distributed in the state. Given that the
agriculture-associated collecting done in
interior Alaska by the USDA station in Palmer
during the mid- 1900s sampled less than 20%
of the state’s carabid fauna (Table 3), these
two speeies’ status as new records for Alaska
is probably an artifact of past under-sampling
rather than natural range expansions or human
introductions. Nevertheless, it is perplexing
that A. obesa was so common in our 2006
samples in a region of the state easily aceessed
by collectors, and yet had remained previously
undetected.
Trophic Classifications. The top five most
active species (Table 4) are all exclusively
predators, with the exception of D. cognatus,
which is also known to feed on seeds (Calluna
in Europe), and is thus also granivorous
(Larochelle and Lariviere 2003). These
species are recorded as known predators of
flies (Ag. cupreum), lepidopteran larvae (Ag.
cupreum, C. ingrains, and P. adstrictus),
lepidopteran eggs {D. cognatus and P.
adstrictus), sawfly pupae, dipteran eggs, and
elaterids {P. adstidctus), and grasshopper eggs
and nymphs {Am. obesa) (Larochelle and
Lariviere 2003).
Activity Density. The high capture rate of
one species, P. adstrictus, is not uncommon.
O’Rourke et al. (2008) and Hajeck et al.
(2007) reported dominant carabid species in
studies from Iowa and New York, respectively.
Pterostichus adstrictus is a habitat generalist,
and is found from lowlands to alpine zones.
14
J. Entomol. Soc. Brit. Columbia 110, December 2013
-^Pterostrichus adstrictus
•^Agonum cupreum
-h-Amara obesa
Figure 2. Mean number of P. adstrictus, Ag. cupreum. Am. obesa, C. ingratus, and D. cognatus
per 14-day period, CRP land, Delta Junction, Alaska, USA, 2006 (A) and 2007 (B).
interior forests, grasslands, and coastal zones
(Larochelle and Lariviere 2003).
Conservation Reserve Program plots were
mowed in 2006 (Seefeldt et al. 2010), which
might have affected insect relative densities
such as the observation that more than three
times more A. cupreum specimens were
collected in 2007 than in 2006. O’Rourke et
al. (2008) and Hajek et al. (2007) reported
strong yearly variation in ground beetle
populations from disturbed areas in Iowa and
New York, respectively. French et al. (1998)
reported large differences in ground beetle
abundances between years, most likely due to
differences in rainfall. However, this year- to-
year variation is not unusual in Alaska:
leafhoppers (Pantoja et al. 2009), moths
(Landolt et al. 2007), click beetles (Pantoja et
al. 2010a, b), and aphids (Pantoja et al. 2010c)
displayed significant year-to-year variation in
different areas of Alaska, including Delta
Junction. The differences in ground beetles’
adult-activity densities could not be explained
with current knowledge of the biology of this
group in the state, but might be associated
with relative plant types in the plots. Some
carabids are known to consume weed seed
(Toft and Bilde 2002; Ward et al. 2011), and
population size and presence is affected by
agronomic practices and the seed bank in
natural and managed ecosystems (Menalled et
al. 2007). Seefeldt et al. (2010) reported an
increase in plant diversity and increased
density of shrubs with increased time in the
CRP in Alaska. Ground beetle activity might
be affected by reduced grass seed as the shrub
densities increase in the plots. However, plant
diversity increased at a rate of about two
species per 1 000 m2 per year (Seefeldt et al.
2010), and effects of plant successions on seed
bank will not immediately be seen in insect
densities. Research is needed to study the
possible effects of mowing, plant density, and
seed bank on carabid relative densities in
subarctic Alaska. Additional research is also
needed to understand the components of
ground beetles’ diets in Alaska CRP lands and
to elucidate the possible influence of CRP
management practices on their abundance.
Effects on ground beetle abundance by plot
variables such as time in the CRP program
(Table 4) varied by species. Gobbi and
Fontaneto (2008) suggest that the effects of
human intervention on ground beetle species’
richness are species dependent. O’Rourke et
al. (2008) elaborated on the possibility of
manipulating habitat for carabid diversity and
preservation.
J. Entomol. Soc. Brit. Columbia 110, December 2013
15
a,
<
o
2
o
t7>
3
<
O
5
s
Z
o
Figure 3. Phenology of Palmer, Alaska, carabidae. Total counts of all carabid species from
historic sample (Table 3), with date data (n = 231 specimens) aggregated into 14-day periods from
the earliest date across all years.
Late-seasonal adult activity, as we have
found for the most abundant species of the
CRT sites (Fig. 2) and the historic data (Fig.
3), has been associated with carabid species
that overwinter as adults (Hajek ei al. 2007;
Ward et al. 2011). In Iowa, carabids were
captured until late September, but peak
activity was recorded from early June to late
July (O’Rourke et al. 2008). Our data suggest
that mowing CRP plots should occur early in
the season, when carabids are less active (Fig.
2).
Historic Data. Only three of the 44
carabid species from the historic Palmer
collection are among the sampled CRP fauna.
This may seem surprising; however, the entire
state’s fauna includes more than 240 carabid
species, making the lack of shared species
among these small samples less remarkable.
Not surprisingly, these three species are
among the eight most abundant species of the
historic dataset. At least Am. laevipennis and
Sc. marginatus, which were also among the
top eight most abundant in the historic data.
are understandably absent from the CRP data,
because these species are known only from
south of the Alaska Range. The CRP study site
is north of the Alaska Range. Scaphinotus
marginatus is abundantly collected along the
Alaskan coast from the southeast of the state
through the Aleutian chain.
To our knowledge, this is the first report on
species composition and population dynamics
of ground beetles in interior Alaska, and
specifically from CRP lands. Information on
ground beetles’ geographic distribution,
population dynamics, dispersal, and biology is
needed to understand their roles as predators
and seed consumers in natural systems. This
study provides some of the information
necessary to guide future research in subjects
such as species composition, seasonality, a
framework for sampling, and time to mow
fields. Additional research is needed to study
the ecology of the dominant species and their
relationships with soil type and CRP
management practices, including the pest
species on which they are assumed to prey.
ACKNOWLEDGEMENTS
We thank Alaska growers H. Olson and the Kaspari, University of Alaska Extension
Schultz Brothers for use of their farms. P. Agent, provided invaluable assistance in
16
J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3
gaining access to producers’ fields. Technical
assistance in the field laboratory was provided
by B. Sweet, B. Torgerson, C. Flint, C. Curlee,
N. Jenkins, B. Fleshman, D. Fleming, and R.
Ranft. S. Seefeldt and E. Carr, USDA, ARS
Alaska, provided information on CRP land.
Critical comments on an earlier draft of this
manuscript were provided by USDA, ARS
entomologists J. Munyaneza, D. Fielding, and
D. Horton. The authors are indebted to B.
Mackey (ARS) and V. Boero (FAO) for
statistical guidance and analysis.
REFERENCES
Arctos, 2013a. http://arctos. database. museum/saved/CRP-Carabidae (accessed Feb 6, 2013).
Arctos, 2013b. http://arctos.database.museum/saved/Palmer-Carabidae (accessed Feb 6, 2013).
Ball, G. E. 1969. The species of the subgenus Cryobius of the Kodiak Island Archipelago {Pterostichus, Carabidae,
Coleoptera). Pages 156-194 in T. N. V. Karlstrom and G. E. Ball (Eds.), The Kodiak Island Refugium: its
geology, flora, fauna, and history. Ryerson Press, Toronto.
Ball, G. E., and D. C. Currie. 1997. Ground beetles (Coleoptera: Trachypachidae and Carabidae) of the Yukon:
Geographical distribution, ecological aspects, and the origin of the extant fauna. Pages 445^89 in H. V. Danks
and J. A. Downes (eds.). Insects of the Yukon. Biological Survey of Canada (Terrestrial Arthropods), Ottawa.
1034 pp.
Ball, G. E., and Y. Bousquet. 2001. Carabidae Latreill, 1810. Pages 32-132 in Arnett, R. H. , Thomas, M. C.
(eds.), American Beetles, volume 1: Archostemata, Myxophaga, Adephaga, Polyphaga: Staphyliniformia. CRC
Press, Boca Raton, London, New York, Washington, D.C.
Best, L. B., H. Campa 111, K. E, Kemp, R. J. Robel, M. R. Ryan, J. A. Savidge, H. P. Weeks, and S. R.
Winterstein. 1997. Bird abundance and nesting CRP fields and cropland in the Midwest: a regional approach.
Wildlife Society Bulletin 25:864-877.
Bousquet, Y. 1991. Checklist of beetles of Canada and Alaska. Research Branch, Agriculture Canada. Publication
1861/E. Ottawa. 430 pp.
Bousquet, Y., and A, Larochelle. 1993. Catalogue of the Geadaphaga (Coleoptera: Trachypachidae, Rhysodidae,
Carabidae including Cicindelini) of America north of Mexico. Mem. Entomol. Soc. Can. 167:1-397.
Chapman, E. W., and C. A. Ribic. 2002. The impact of buffer strips and stream-side grazing on small mammals in
southwestern Wisconsin. Agriculture, Ecosystems and Environment 88:49-59.
Chapin, F. S. Ill, M. W. Oswood, K. Van Cleve, L. A. Viereck, and D. L. Verbyla (eds). 2006. Alaska’s
Changing Boreal Forest. Oxford University Press, New York, xiv + 354 pp.
Chao, A. 1987. Estimating the population size for capture-recapture data with unequal catchability. Biometrics
43:783-791.
Chazdon, R. L., R. K. Colwell, J. S. Denslow, and M. R. Guariguata. 1998. Statistical methods for estimating
species richness of woody regeneration in primary and secondary rain forests of northeastern Costa Rica. Pages
285-309 in Dallmeier, F. & Comiskey, J. A. (eds.). Forest Biodiversity Research, Monitoring and Modeling.
Conceptual Background and Old World Case Studies. UNESCO Paris and The Parthenon Publishing Group,
Carnforth, UK.
Chen, I. C., J. K. Hill, R. Ohlemuller, D. B. Roy, and C. D. Thomas. (2011) Rapid range shifts of species
associated with high levels of climate warming. Science 333:1024-1026.
Colwell, R. K. 2009. Estimates: Statistical estimation of species richness and shared species from samples. Version
8.2. User's Guide and application published at: http://purl.oclc.org/estimates.
Davros, N. M., D. M. Debinski, K. F. Reeder, and W. L. Hohman. 2006. Butterflies and continuous conservation
reserve program filter strips: Landscape considerations. Wildlife Society Bulletin 34:936-943.
Delisle, J. M., and J. A. Savidge. 1997. Avian use and vegetation characteristics of Conservation Reserve Program
fields. Journal of Wildlife Management 61:318-325.
French, B. W., N C. Elliott, and R. C. Berberet. 1998. Reverting conservation reserve program lands to wheat
and livestock production: effects on ground beetle (Coleoptera: Carabidae) assemblages. Environmental
Entomology 27:1323-1335.
Gallant, A. L., R. F. Binnian, J. N. Omernik, and M. B. Shasby. 1995. Ecoregions of Alaska: U. S. Geological
Survey Professional Paper 1567. United States Government Printing Office, Washington, DC, USA.
Gobbi, M., and D. Fontaneto. 2008. Biodiversity of ground beetles (Coleoptera: Carabidae) in different habitats
of the Italian Po lowland. Agriculture, Ecosystems and Environment 127:273-276.
Hagerty, A. M., A. Pantoja, and S. Y. Emmert. 2009. Lady beetles (Coleoptera: Coccinellidae: Coccinellini)
associated with Alaskan agricultural crops. Journal of the Entomological Society of British Columbia 106:39-
45.
J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3
17
Hajek, A. E., J. J. Hannam, C. Nielsen, A. J. Bell, and J. K. Liebherr. 2007. Distribution and Abundance of
Carabidae (Coleoptera) Associated with Soybean Aphid (Hemiptera: Aphididae) Populations in Central New
York. Ann. Entomol. Soc. Am. 100:876-886.
Hamilton, J. 1894. Catalogue of the Coleoptera of Alaska. With the synonymy and distribution. Transactions of the
American Entomological Society, vol. XXI. pp. 1-38.
Harrison, S. K., and E. E. Regnier. 2003. Postdispersal predation of giant ragweed {Ambrosia trifida) seed in no-
tillage corn. Weed Sci. 51:955-964.
Harrison, S., and E. R. Gallandt. 2012. Behavioural studies of Harpalus rufipes De Geer: an important weed seed
predator in northeastern US agroecosystems. International Journal of Ecology 2012:1-6. doi:
10.1155/2012/846546
Hulten, E. 1968. Flora of Alaska and Neighboring Territories. Stanford University Press, Stanford, California,
USA.
Johnson, D. H., and M. D. Schwartz. 1993. The Conservation Reserve Program and grassland birds.
Conservation Biology 7:934-937.
Kromp, B. 1999. Carabid beetles in sustainable agriculture: a review on pest control efficacy, cultivation impacts
and enhancement. Agriculture, Ecosystems and Environment 74:187-228.
Landolt, P, J., A. Pantoja, A, Hagerty, L. Crabo, and D. Green. 2007. Moths trapped in Alaska with feeding
attractant lures and the seasonality of potential agricultural pests. Canadian Entomol. 139: 278-291.
Larochelle, A., and M. C. Lariviere. 2003. A natural history of the ground-beetles (Coleoptera: Carabidae) of
America north of Mexico. Pensoft, Sofia-Moscow, pp. 1-583.
Lewis, C. E., G. D. Franklin, and D. M. Quarberg. 1979. Delta-Clearwater lands opened for agriculture use —
2000 acre clearing — trial project. Agroborealis 1 1 :32-34.
Lindroth, C. H. 1963. The Aleutian Islands as a route for dispersal across the North Pacific. Zoological Institute,
University, Lund, Sweden, pp. 121-131.
Lindroth, C. H, 1969a. The ground-beetles (Carabidae, Excl. Cicindelinae) of Canada and Alaska. Opuscula
Entomologica Supplementum, Series 1963-1969. Entomologiska Sallskapet, Lund, Sweden.
Lindroth, C. H. 1969b. An analysis of the carabid beetle fauna of the refugium. Pages 195-210 in: T. N. V.
Karlstrom and G. E. Ball (Eds.), The Kodiak Island refugium: Its geology, flora, fauna, and history. Ryerson
Press; Toronto. 262 p.
Lindroth, C. H., and G. E. Ball. 1969. An annotated list of invertebrates of the Kodiak Island Refugium. Pages
122-153 in T. N. V. Karlstrom and G. E. Ball (Eds.), The Kodiak Island Refugium: Its geology, flora, fauna,
and history. Ryerson Press; Toronto. 262 p.
Lovei, G. L., and K. D. Sunderland. 1996. Ecology and behavior of ground beetles (Coleoptera: Carabidae).
Annual Review of Entomology 41 :23 1-256.
Mannerheim, C. G. 1843. Beitrag zur Kaefer-Fauna der Aleutischen Inseln, der Insel Sitkha und Neu-Californiens.
Bulletin de la Societe Imperiale Des Naturalistes Moscou 16:175-314.
Mannerheim, C. G. 1846. Nachtragzur Kaefer-Fauna der Aleutischen Inseln, und der Insel Sitkha. Bulletin de la
Societe Imperiale Des Naturalistes Moscou 19:501-16.
Mannerheim, C. G. 1852. Zweiter Nachtrag zur Kaefer-Fauna der Nord-Amerikanischen Laender des Russischen
Reiches. Bulletin de la Societe Imperiale Des Naturalistes Moscou 25:283-387.
Mannerheim, C. G. 1853. Drifter Nachtrag zur Kaefer-Fauna der Nord-Amerikanischen Laender des Russischen
Reiches. Bulletin de la Societe Imperiale Des Naturalistes Moscou 26:95-273.
Menalled, F. D., R. G. Smith, J. T. Dauer, and T. B. Fox, 2007. Impact of agricultural management on carabid
communities and weed seed predation. Agriculture, Ecosystems and Environment 1 1 8:49—54.
Melbourne, B. A. 1999. Bias in the effect of habitat structure on pitfall traps: An experimental evaluation.
Australian Journal of Ecology 24:228-239.
Millenbah, K. F., S. R. Winterstein, H. Campa, L. T. Furrow, and R. B. Minnis. 1996. Effects of Conservation
Reserve Program field age on avian relative abundance, diversity, and productivity. Wilson Bulletin 108:760-
770.
NRCS (Natural Resource Conservation Service). 2003. National handbook of conservation practices:
conservation practice standard, filter strip. Natural Resource Conservation Service Code 393, Washington,
D.C., USA.
NRCS (Natural Resource Conservation Service). 2013. Alaska Soil Survey Information. Available at http://
www.ak.nrcs.usda.gov/soils/index.html (accessed March 2013)
O’Neal, M. E., J. R. Prasifka, N. P. Schmidt, J. W. Singer, R. L. Hellmich, and K. A. Kohler. 2005. Assessing
Carabid Contribution to Ecosystem Services: Does It Matter If There Are More Beetles? American
Entomologist 51(4):231-233.
O’Rourke, E. M., M. Liebman, and M. E. Rice. 2008. Ground beetle (Coleoptera: Carabidae) in conventional
and diversified crop rotation systems. Environ. Entomol. 37:121—130.
18
J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3
Pantoja, A., A. Hagerty, S. Y. Emmert, and J. Munyaneza. 2009. Leafhoppers (Homoptera: Cicadellidae)
associated with potatoes in Alaska: species composition, seasonal abundance, and potential phytoplasma
vectors. American Journal of Potato Research 86:68-75.
Pantoja, A., A. Haggerty, and S. Y. Emmert. 2010a. A seasonal survey of click beetles in a potato production area
near Palmer, Alaska. American Journal of Potato Research 87:188-194.
Pantoja, A., A. M. Hagerty, and S. E. Emmert. 2010b. A seasonal survey of click beetles in two potato
production areas in interior Alaska. American Journal of Potato Research 87:531-536.
Pantoja, A., A. M. Hagerty, S. Y. Emmert, J-C. Kuhl, K. Pike, J. M. Alvarez, and A. Jensen. 2010c. Aphids
(Hemiptera: Aphididae) associated with rhubarb in the Matanuska Valley, Alaska: Species composition,
seasonal abundance, and potential virus vectors. Journal of Entomology Society of British Columbia 107:75-
81.
Pearce, J. L., and L. A. Venier. 2006. The use of ground beetles (Coleoptera: Carabidae) and spiders (Araneae) as
bioindicators of sustainable forest management: A review. Ecological Indicators 6:780-793.
Sailer, R. I. 1954. Invertebrate research in Alaska. Arctic 7:266-274.
SAS. 2008. Statistical Analysis System Ver. 9. 2. SAS Institute, Cary North Carolina, USA
Schoephorster, D. B. 1973. Soil survey of Salcha-Big Delta area, Alaska. USDA Soil Conservation Service, U. S.
Government Printing Office, Washington, D. C.
Schwarz, E. A. 1900. Papers from the Harriman Alaska expedition. XVIII. Entomological Results (12):
Coleoptera. Proceedings of the Washington Academy of Sciences 2:523-537.
Seefeldt, S., J. Conn, M. Zhang, and P. Kaspari. 2010. Vegetation changes in Conservation Reserve Program
Lands in Interior Alaska. Agriculture Ecosystems and Environment 135:119-126.
Serreze, M. C., J. E. Walsh, F. S. Chapin III, T. Osterkamp, M. Dyurgerov, V. Romanovsky, W. C. Oechel, J.
Morison, T. Zhang, and R. G. Barry. 2000. Observational evidence of recent change in the northern high-
latitude environment. Climatic Change 46:159-207.
Semlitsch, R. D., and J. R. Bodie. 2003. Biological criteria for buffer zones around wetlands and riparian habitats
for amphibians and reptiles. Conservation Biology 17:1219-1228.
Southwood, T. R. E. 1978. Ecological methods with particular reference to the study of insect populations.
Chapman and Hall, New York.
Toft, S., and T. Bilde. 2002. Carabid diets and food value. Pages 81-110 in J. M. Holland (Ed.), the agroecology of
Carabid beetles. Intercept, Androver, UK.
Topping, C. J., and K. D. Sunderland. 1992. Limitations to the use of pitfall traps in ecological studies
exemplified by a study of spiders in a field of winter wheat. Journal of Applied Ecology 29:485^91 .
Washburn, R. H. 1972. The research insect collection. Agroborealis 4:6-7.
Ward, M. J. Ward, M. R. Ryan, W. S. Curran, M. E. Barbercheck, and D. A. Mortensen, 2011. Cover Crops
and Disturbance Influence Activity-Density of Weed Seed Predators Amara aenea and Harpalus pensylvanicus
(Coleoptera: Carabidae). Weed Science 59:76-81.
Watson, D. G., J. J. Davis, and W. C. Hanson. 1966. Terrestrial Invertebrates. Pages 565-584 in N. J.
Wilimovsky and J. N. Wolfe (Eds.), Environment of the Cape Thompson Region, Alaska. United States Atomic
Energy Commission, Division of Technical Information.
Work, T., T. Kolvula, M. Klimaszewski, J. Langor, D. W. Spence, J. R. Sweeney, and J. D. Hebert. 2008.
Evaluation of carabid beetles as indicators of forest change in Canada. Canadian Entomologist 140(4):393— 414.
J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3
19
Diagnostic molecular markers to detect and identify primary
parasitoids (Hymenoptera: Braconidae) of Ericaphis fimbriata on
highbush blueberry
S. MATHURS D.A. RAWORTH^ ^ K.S. PIKE^ 3, AND S.M. FITZPATRICK*
ABSTRACT
The objective of this research was to develop diagnostic molecular markers for detecting and
identifying the most common primary parasitoids of Ericaphis fimbriata (Richards)
(Hemiptera: Aphididae), which is an important vector of Blueberry scorch virus (BlScV) on
highbush blueberry Vaccinium corymbosum L. (Ericales: Ericaceae) in southwestern British
Columbia. Mitochondrial cytochrome c oxidase subunit I gene (COl) sequences and specific
reverse primers for the parasitoids Aphidius ericaphidis Pike and Stary, Ephedrus incompletus
Provencher, and Praon unicum Smith (Hymenoptera: Braconidae) were developed. The
combination of three primers in a multiplex polymerase chain reaction (PCR) assay detected
and differentiated DNA from adults of all three parasitoid species. When individual field-
collected aphids were challenged with the multiplex PCR assay, immatures of the two
numerically dominant parasitoid species, A. ericaphidis and P. unicum, were readily detected,
as was multiparasitism by these two species. The uncommon parasitoid species, E.
incompletus, was detected less frequently by multiplex PCR assay than by rearing from the
aphid hosts.
The diagnostic molecular markers are useful tools for estimating of rates of parasitism and for
identifying immatures of parasitoid species within aphid hosts, particularly if used in
combination with rearing and dissection assays of field-collected aphids.
Key Words: aphids; parasitoids; mtDNA; COI; multiplex PCR; multiparasitism
INTRODUCTION
Hymenopteran parasitoids attack the
dominant colonizing aphid, Ericaphis
fimbriata (Richards) (Hemiptera: Aphididae),
on highbush blueberry, Vaccinium
corymbosum L. (Ericales: Ericaceae) in the
Pacific Northwest (Raworth et al. 2008). The
two primary parasitoid species most
frequently reared from E. fimbriata on
highbush blueberry in British Columbia (B.C.)
are Praon unicum Smith and a recently
described species previously known as
Aphidius n. sp. (Raworth et al. 2008), now
identified as Aphidius ericaphidis Pike and
Stary (Pike et al. 2011). Other primary
parasitoids in the genera Aphidius, Praon, and
Ephedrus were less frequently reared from E.
fimbriata in B.C. (Raworth et al. 2008); those
in the latter genus have since been identified
as E. incompletus Provencher (Mathur and
Pike, unpublished data). All these parasitoids
are in the family Braconidae.
Ericaphis fimbriata transmits Blueberry
scorch virus (BlScV), which causes
substantial crop loss (Bristow et al. 2000). The
primary parasitoids by themselves do not
significantly reduce E. fimbriata populations
on highbush blueberry, but they are part of a
broader community of predators and
pathogens (Mathur et al. unpublished data),
which, if conserved, might slow the
transmission of BlScV by reducing
populations of its main vector. Future studies
of the role and impact of primary parasitoids
within the community of natural enemies
would be facilitated by diagnostic molecular
markers that detect parasitoid DNA within
'Agriculture and Agri-Food Canada, Pacific Agri-Food Research Centre, PO Box 1000, Agassiz, B.C., Canada
VOM lAO
^Irrigated Agriculture Research and Extension Center, Washington State University, 24106 N. Bunn Road, Prosser,
WA, USA 99350
^Retired
20
J. Entomol. Soc. Brit. Columbia 110, December 2013
aphids collected from the field. As noted by
Gariepy et al. (2007), molecular methods
supplement but do not replace traditional
rearing and dissection techniques for detecting
parasitoids in hosts.
Here we report the development of
diagnostic molecular markers that can be used
to detect and identify the most common
primary parasitoids of E. fimbriata on
highbush blueberry. Sequence diversity in the
mitochondrial cytochrome c oxidase subunit I
gene (COI; Hebert et al. 2003) was used to
develop specific primers for A. ericaphidis, E.
incompletus, and P. unicum. Primers for each
species were combined in a specific multiplex
PCR assay capable of detecting
simultaneously the three species of
parasitoids. The accuracy of the multiplex
assay was validated by sampling a local
population of E. fimbriata on highbush
blueberry and comparing the percentage of
collected aphids from which primary
parasitoids emerged with the percentage of
parasitized aphids detected by PCR.
MATERIALS AND METHODS
Development of specific primers for
singleplex and multiplex PCR assays
Adult A. ericaphidis, E. incompletus, and
P. unicum that were preserved in 95% ethanol
were obtained during field surveys in the
Pacific Northwest during 2005 and 2006
(Raworth et al. 2008). Genomic DNA was
isolated from individual parasitoids with a
DNeasy tissue kit® (QIAGEN Inc.,
Mississauga, ON) using the manufacturer’s
protocol. Individuals were air-dried to remove
ethanol and then homogenized using a
disposable microtube pestle (Mandel
Scientific Company Inc., Guelph, ON) in the
extraction buffer provided with the kit. DNA
was eluted in 50 pi of buffer and stored at -80
°C for further use.
The COI region of mitochondrial DNA
from individuals was amplified by PCR using
the universal insect primer set, LCO 1490
(5’GGTCAACAAATCATAAAGATATTGG)
and HCO 2198
(5’TAAACTTCAGGGTGACCAAAAAATC
A) (Folmer et al. 1994). The PCR mixture (50
pi) contained lx PCR buffer solution
(GeneSys Ltd., Medicorp Inc., Montreal, QC),
0.2 mM of dNTPs, 0.2 pM of each universal
primer, 1.25 U of Taq DNA polymerase
(GeneSys Ltd., Medicorp Inc., Montreal, QC)
and 30-50 ng of DNA template. DNA
amplification was performed using a thermal
cycler (iCycler, Bio-Rad Laboratories,
Mississauga, ON). The temperature regime for
all PCR reactions was 94°C for 2 min,
followed by 35 cycles of 94°C for 30 s, 50°C
for 45 s, 72°C for 60 s, and a final extension
step of 72°C for 7 min. PCR products were
visualized on 1.5% agarose gels stained with
GelRed (Biotium Inc., Hayward, CA, USA)
and purified with the QIAquick® PCR
purification kit (Qiagen Inc., Mississauga,
ON). Sequencing of the COI regions was done
by the Nucleic Acid and Protein Synthesis
Unit (NAPS) at the University of British
Columbia (Vancouver, B.C.) using an Applied
Biosystem sequencer and the universal
primers described above. Polymerase chain
reaction products from 13-37 individuals of
each parasitoid species were sequenced to
check for sequence variability. All sequences
were confirmed by sequencing in both
directions.
Specific reverse primers were designed for
A. ericaphidis, E. incompletus and P. unicum
from the regions of the COI gene that were
conserved within species but variable among
species (Table 1). These primer sequences
were evaluated for suitable base composition.
Table 1
Primers used in singleplex and multiplex PCR assays
J. Entomol. Soc. Brit. Columbia 110, December 2013
annealing temperature, and self-compatibility
using the on-line software, Primer3 (Rozen
and Skaletsky 2000). Primers were
synthesized by Integrated DNA Technologies
(Coralville, lA, USA). These primers were
evaluated for PCR specificity using DNA
from 13-37 individuals from A. ericaphidis,
E. incompletus and P. unicum. Polymerase
chain reaction conditions and visualization of
PCR product were as described previously.
To develop the multiplex PCR assay, the
reverse primers for the parasitoids (Table 1)
were mixed with universal forward primer
LCO in a single reaction tube, and then
parasitoid DNA from eight individuals of each
of the three species was challenged with the
combined primers. Polymerase chain reaction
conditions and visualization of the PCR
product were as described previously, except
that the annealing temperature used in the
multiplex assay was 54°C. Extracts of DNA
from healthy, unparasitized E. fimbriata were
included in the assay to check for cross-
reactivity.
Validation of the multiplex PCR assay
In 2011, E. fimbriata (green and red
morphs, alatae and aperterae, immatures
except first instars) were collected weekly
during May through early September from a
0.15-ha research trial of 6-year-old highbush
blueberry ‘Duke’ plants at the Pacific Agri-
Food Research Centre in Agassiz, B.C. (study
site reported by Ehret et al. 2012). Mature and
immature aphids were collected by detaching
the leaves on which they were feeding. All
aphids were later transferred with a fine
paintbrush to the blueberry terminals in
buckets described below. The aphid
population varied according to trends
RESULTS AND
Development of specific primers for
singleplex and multiplex PCR assays
The extracted mitochondrial DNA from all
parasitoid specimens amplified successfully
with the universal primers and produced
distinct bands on agarose gel. The COI
sequences (649 bp) showed high A— T content
with an average of 74% of either A or T. The
consensus COI sequences for A. ericaphidis,
E. incompletus, and P. unicum (and for A. ervi
Haliday, A. matricariae Haliday, P. gallicum
21
described by Raworth (2004), therefore the
number of aphids collected each week ranged
from 65 to 500. About half of the weekly total
number of collected aphids were reared to
allow parasitoids to develop and emerge
(except for the first week, when all collected
aphids were reared). The numbers of aphids in
rearing were 62, 173, 50, 146, 174, 160, 174,
155, 250, 220, 225, 225, 232, 215, 225, 259,
157, 95 and 51, respectively, for each of the
19 weeks. In the rearing assay, aphids were
placed on blueberry terminals cut from plants
in the field then washed to ensure they were
insect-free. The blueberry terminals stood in a
small volume of water in 1.9-litre buckets
with mesh lids under natural light at 21 ± 2°C
for 30 d. Each week, aphids to be reared were
placed in one bucket. The age structure of the
sample of aphids was not estimated.
Parasitoids that emerged from the group of
reared aphids were identified to species (as per
Pike et al. 2011) and preserved in 70%
ethanol. Voucher specimens are stored by K.
Pike. Aphids not used in the rearing assay
were preserved in 95% ethanol. A subset of
these preserved aphids was used for DNA
analysis. The multiplex PCR assay was
validated by comparing the percentage of
aphids that hosted primary parasitoids in the
rearing assay with the percentage of preserved
aphids that revealed parasitoid DNA.
Statistical support for this comparison was
generated by calculating the chi-square
statistic (Yates’ corrected where appropriate;
SYSTAT 2007) on the numbers of primary
parasitoids that emerged from groups of
reared aphids versus the numbers of preserved
aphids in which parasitoid DNA was detected
by PCR.
DISCUSSION
Stary, P. humulaphidis Ashmead, and P.
occidentale Baker from an unpublished study
by Mathur et al.) were deposited in the
National Center for Biotechnology
Information GenBank under accession
numbers EU574902-EU574906, GU237I29-
GU237131 and KC2 11 020-2 1 1032.
All sequences in the sample population of
33 A. ericaphidis were identical; therefore,
there was only one haplotype (KC21 1024) and
no intraspecific divergence. Within the sample
22
J. Entomol. Soc. Brit. Columbia 110, December 2013
Figure 1. Specificity of multiplex PCR assay. Specific reverse primers for A. ericaphidis, E.
incompletus and P. unicum were combined and tested with DNA from: P. unicum. Lanes 1-3; £.
incompletus. Lanes 4-6; A. ericaphidis. Lanes 7-9. Lane 10 is a water control and Lanes M are
100-bp markers.
population of 13 £. incompletus, the average
intraspecific divergence was 1.31% (range
0.3-2. 4%), and seven haplotypes were
identified: haplotype 1 (KC211027) was
represented by six sequences, haplotype 2
(GU237131) was represented by two
sequences, and haplotypes 3 (KC2 11028), 4
(KC211029), 5 (KC211030), 6 (KC 211031),
and 7 (KC211032) were represented by one
sequence each. Within the sample population
of 31 P. unicum, the average intraspecific
divergence was 0.42% (range 0.2-0.6%), and
five haplotypes were identified: haplotype 1
(KC21 1020) was represented by 3 1 sequences,
and haplotypes 2 (KC211021), 3 (KC211022),
4 (KC211023), and 5 (EU574904) were
represented by 1, 1, 2, and 2 sequences,
respectively.
The specific reverse primers designed for
A. ericaphidis, E. incompletus and P. unicum
(Table 1), when used individually with
forward universal primer LCO, selectively
amplified the DNA of the species for which
they were designed. In the multiplex PCR
assay, the combination of universal forward
primer and all three specific reverse primers
differentiated adults of A. ericaphidis, E.
incompletus and P. unicum, and amplified the
appropriate specific fragments: 130 bp for A.
ericaphidis, 261 bp for E. incompletus and
404 bp for/! unicum (Fig. 1).
Validation of the multiplex PCR assay
Only three species of braconid primary
parasitoids emerged from E. fimbriata
collected from the Agassiz site (Fig. 2).
Although other species of Aphidius and Praon
have previously been reared from field-
collected aphids in southwestern B.C.
(Raworth et al. 2008), no additional species of
these two genera were recovered in our study.
As such, the primers we have developed can
be used to identify the species of primary
parasitoids from this site. Praon unicum
emerged from the earliest collections of E.
fimbriata in May, and was present in hosts
throughout the collection period. Aphidius
ericaphidis first emerged from hosts collected
in late June, and was present throughout the
rest of the collection period. A very small
number of E. incompletus emerged from hosts
collected in July, August and early September.
A total of 10 hymenopteran parasitoid
individuals (not shown in Fig. 2) that could
not be identified by morphological
characteristics emerged from aphids collected
in May, June and early July. Secondary
(hyper-) parasitoids {Alloxysta sp., as noted by
Raworth et al. 2008) first emerged in late
June, and were present every week (1-20 per
week) until early September.
Peak numbers of one or both of the two
dominant species, A. ericaphidis and P.
unicum, emerged from hosts collected on 28
June, 20 July, 10 and 23 August, and 1 and 9
September (Fig. 2). To validate the multiplex
PCR assay, DNA from 24^0 preserved E.
fimbriata collected on each of 28 June, 20
July, 10 August and 1 September was
challenged with the combined specific reverse
primers (e.g.. Fig. 3). On all four dates,
multiplex PCR detection of percentage
parasitism by either A. ericaphidis or P.
J. Entomol. Soc. Brjt. Columbia 110, December 2013
23
Figure 2. Percentage of field-collected E. fimbriata from which parasitoids emerged. Numbers of
field-collected E. fimbriata reared from highbush blueberry were 62, 173, 50, 146, 174, 160, 174,
155, 250, 220, 225, 225, 232, 215, 225, 259, 157, 95 and 51, respectively, for each of the 19
weeks in 20 1 1 .
unicum was statistically similar to detection of
parasitism by rearing field-collected E.
fimbriata (P>0.05 in 8 individual
comparisons; Table 2). The numbers of E.
incompletus were too small for valid chi-
square analysis (Fig. 2, Table 2). The
multiplex PCR assay detected E. incompletus
DNA on two of the four dates, whereas E.
incompletus individuals were reared from
aphids collected on each of the four dates. It is
possible that primers in the multiplex assay
did not detect some of the earliest, tiniest life
stages (e.g., eggs) of E. incompletus or of the
other two parasitoids. To establish detection
limits of the primers, a third method of
detection — dissection — should be compared
with the multiplex PCR assay and the rearing
methods (as per methods described by
Gariepy et al. 2007 and Weathersbee et al.
2004). Additionally, sensitivity analysis of the
multiplex PCR assay might help to explain
some of the differences between the two
detection techniques in our study.
The multiplex PCR assay detected DNA
from both A. ericaphidis and P. unicum in a
small percentage of E. fimbriata collected on
20 July, 10 August and 1 September (Table 2;
Fig. 3, Lane 6), indicating multiparasitism by
these two species. Stage-specific information
about this competitive interaction between
primary parasitoids could be obtained by
dissecting the immature stages out of aphid
hosts and challenging their DNA with the
multiplex assay. More dynamic information
about the outcomes of multiparasitism in
field-collected E. fimbriata could be gathered
by comparing a single-aphid rearing assay
with dissection followed by the multiplex
PCR assay. Rearing assays of multiparasitism
by A. smithi and P. pequodorum on pea aphid,
Acyrthosiphon pisum, showed that the
survivor of competition between a first-instar
P pequodorum and any stage of A. smithi was
P. pequodorum', but if P. pequodorum was
killed in the egg stage, A. smithi survived
(Chow and Mackauer 1984, 1985).
The trend toward increased multiparasitism
between 20 July and 10 August suggests that
fewer hosts were available because the E.
fimbriata population was in decline due to
seasonal changes in host-plant quality
(Raworth 2004; Raworth and Schade 2006)
and might indicate that parasitoid populations
were increasing at that time.
Conclusions
The molecular diagnostics developed in
this study can be used, in conjunction with
rearing and dissection techniques, to conduct
24
J. Entomol. Soc. Brit. Columbia 110, December 20 13
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 M
Figure 3. Use of the multiplex PCR assay to detect parasitoid DNA in E. fimbriata collected on
20 July 2011 from highbush blueberry. Of 24 E. fimbriata analysed, 17 are represented in this
figure. Results from one aphid are shown in each of Lanes 1-17. Lanes 1, 2, 5, 10, 11, 15, 16 and
17 show no parasitism (Lane 17 shows as a negative control: one E. fimbriata that was known to
be unparasitized). Lanes 3, 7 and 13 show parasitism by A. ericaphidis (130 bp); Lane 9 shows
parasitism by E. incompletus (261 bp); Lanes 4, 8, 12 and 14 show parasitism by P. unicum (404
bp); and Lane 6 shows multiparasitism by A. ericaphidis and P. unicum. Lane 18 is a water control
and Lanes M are markers. At the bottom of most lanes is a faint band (80 bp) from leftover PCR
ingredients.
detailed studies of the population dynamics of
the primary parasitoids of E. fimbriata in
southwestern B.C., with or without the
augmentative releases of P. unicum proposed
by Raworth et al. (2008; and see Vafaie et al.
2013). In particular, it will be possible to track
the immature stages of A. ericaphidis, E.
incompletus and P. unicum in a single reaction
using the multiplex PCR assay.
The diagnostic accuracy of the multiplex
PCR could likely be improved by: sensitivity
analysis of the PCR; analyses to determine if
DNA from one species inhibits the PCR
reaction to DNA of other species; and analysis
of DNA from parasitoids congeneric to A.
ericaphidis, E. incompletus and P. unicum.
Once these improvements have been made,
the multiplex PCR would be useful on a larger
geographical scale. Aphidius ericaphidis has
been discovered in large numbers east and
west of the Cascades, USA, as well as in
southwestern B.C. (Raworth et al. 2008; Pike
et al. 2011). Praon unicum has been reported
from more than 30 different aphid hosts (see
Smith 1944; Carroll and Hoyt 1986; Johnson
1987; Pike et al. 1997, 2000; Acheampong et
al. 2012) besides E. fimbriata. The primers
developed for P. unicum will, therefore,
facilitate population studies in other systems.
Table 2
Number (%) of E. fimbriata from which a parasitoid emerged during rearing (R) compared to number
(%) of E. fimbriata in which parasitoid DNA was detected by multiplex PCR assay (M).
Species of parasitoid detected
Date (2011) of
a Multiparasitism by A. ericaphidis and P. unicum.
b Ericaphis fimbriata was reared in groups, therefore the number of parasitoids emerging from one
aphid could not be determined.
J. Entomol. Soc. Brit. Columbia 110, December 2013
25
ACKNOWLEDGEMENTS
This research was funded primarily by and the Washington State Blueberry
Agriculture and Agri-Food Canada, in Commission,
cooperation with Washington State University
REFERENCES
Acheampong, S., D. R. Gillespie, and D. J. M. Quiring. 2012. Survey of parasitoids (Hymenoptera) of the green
peach aphids, Myzus persicae and foxglove aphid, Aulacorthum solani (Hemiptera: Aphididae) in British
Columbia. Journal of the Entomological Society of British Columbia 109: 12-23.
Bristow, P. R., R. R. Martin, and G. E, Windom. 2000. Transmission, field spread, cultivar response, and impact
on yield in high bush blueberry infected with Blueberry scorch virus. Phytopathology 90: 474-^79.
Carroll, D, P,, and S. C. Hoyt. 1986. Hosts and habitats of parasitoids (Hymenoptera: Aphidiidae) implicated in
biological control of apple aphid (Homoptera: Aphididae). Environmental Entomology 15: 1171-1178.
Chow, F. J., and M. Mackauer. 1984. Inter- and intraspecific larval competition in Aphidius smithi and Praon
pequodorum (Hymenoptera: Aphidiidae). The Canadian Entomologist 116: 1097-1107.
Chow, F. J., and M. Mackauer. 1985. Multiple parasitism of the pea aphid: stage of development of parasite
determines survival of Aphidius smithi and Praon pequodorum (Hymenoptera: Aphidiidae). The Canadian
Entomologist 117: 133-134.
Ehret, D. L., B. Frey, T. Forge, T. Helmer, and D. R. Bryla. 2012. Effects of drip irrigation configuration and rate
on yield and fruit quality of young highbush blueberry plants. Hortscience 47: 414-421.
Folmer, O., M. Black, W. Hoeh, R. Lutz, and R. Vrijenhoek. 1994. DNA primers for amplification of
mitochondrial cytochrome c oxidase subunit 1 from diverse metazoan invertebrates. Molecular Marine Biology
and Biotechnology 3: 294-299.
Gariepy, T. D., U. Kuhlmann, C. Gillott, and M. Erlandson. 2007. Parasitoids, predators and PCR: the use of
diagnostic molecular markers in biological control of arthropods. Journal of Applied Entomology 131:
225-240.
Hebert, P. D. N., S. Ratnasingham, and J. R. deWaard, 2003. Barcoding animal life: cytochome oxydase subunit
1 divergences among closely related species. Proceedings of the Royal Society of London, Series B 270
(supplement 1): 96-99.
Johnson, J. W. 1987. A revision of the species of Praon Haliday in North America north of Mexico (Hymenoptera:
Aphidiidae). The Canadian Entomologist 119: 999-1025.
Pike, K. S., P. Stary, T. Miller, D. Allison, L. Boydston, G. Graf, and R. Gillespie. 1997. Small-grain aphid
parasitoids (Hymenoptera: Aphelinidae and Aphidiidae) of Washington: distribution, relative abundance,
seasonal occurrence, and key to known North American species. Environmental Entomology 26: 1299-1311 .
Pike, K. S., P. Stary, T. Miller, G. Graf, D. Allison, L. Boydston, and R. Miller. 2000. Aphid parasitoids
(Hymenoptera, Braconidae, Aphidiinae) of Northwest USA. Proceedings of the Entomological Society of
Washington 102: 688-740.
Pike, K. S., P. Stary, G. Graf, D. A. Raworth, S. Mathur, L. K. Tanigoshi, and T. Murray. 2011. A new
Aphidius Nees (Hymenoptera, Braconidae, Aphidiinae) of Ericaphis fmbriata (Richards) (Hemiptera,
Aphidiidae) and key to parasitoids of blueberry aphid in the Pacific Northwest. Zootaxa 2802: 58-62.
Raworth, D. A. 2004. Ecology and management of Ericaphis fimbriata (Hemiptera: Aphidiidae) in relation to the
potential for spread of Blueberry scorch virus. The Canadian Entomologist 136: 711—718.
Raworth, D. A., and D. Schade. 2006. Life history parameters and population dynamics of Ericaphis fimbriata
(Hemiptera: Aphididae) on blueberry, Vaccinium coiymbosum. The Canadian Entomologist 138: 205-217.
Raworth, D. A., K. S. Pike, L. K. Tanigoshi, S. Mathur, and G, Graf. 2008. Primary and secondary parasitoids
(Hymenoptera) of aphids (Hemiptera: Aphididae) on blueberry and other Vaccinium in the Pacific Northwest.
Environmental Entomology 37: 472-477.
Rozen, S., and H. J. Skaletsky. 2000. Primer3 on the WWW for general users and for biologist programmers, pp.
365-386. In S. Krawetz and S. Misener, Bioinformatics Methods and Protocols: Methods in Molecular
Biology. Humana Press. New Jersey.
Smith, C. F. 1944. The Aphidiinae of North America (Hymenoptera: Braconidae). Ohio State University
Contributions in Zoology and Entomology 6: 1-154.
SYSTAT Software Inc. 2007. SYSTAT® 13. 1735 Technology Dr., Ste. 430, San Jose, CA 951 10 USA.
Vafaie, E. K., S. M. Fitzpatrick, and J. S. Cory. 2013. Does rearing an aphid parasitoid on one host affect its
ability to parasitize another species? Agricultural and Forest Entomology 15: 366-374.
26
J. Entomol. Soc. Brit. Columbia 110, December 20 13
Weathersbee A. A., K. A, Shufran, T. D. Panchal, P. M. Dang, and G.A. Evans. 2004. Detection and
differentiation of parasitoids (Hymenoptera: Aphidiidae and Aphelinidae) of the brown citrus aphid
(Homoptera; Aphididae): species-specific polymerase chain reaction amplification of 18S rDNA. Annals of the
Entomological Society of America 97: 286-292.
J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3
27
Seasonal Flight Pattern of the Western Balsam Bark Beetle,
Dryocoetes confusus Swaine (Coleoptera: Curculionidae), in
Central British Columbia
A.J. STOCKI, T.L. PRATT2, AND J.H. BORDEN^
ABSTRACT
Seasonal flight pattern of the western balsam bark beetle, Dryocoetes confusus Swaine, in
stands of subalpine fir, Abies lasiocarpa (Hook) Nutt., in north-central British Columbia was
monitored for three years using multiple-funnel traps baited with (±)-exo-brevicomin. Two
major flight periods occurred per year, the first commencing in mid- to late June, and the
second occurring in mid- to late August. The first flight was predominantly males, while the
second flight was composed primarily of females, probably re-emerged parent adults. Little
flight occurred until within-stand temperatures exceeded 15°C. Traps placed 6 m above the
ground caught four times as many beetles as traps placed 2 m above the ground. Our results
indicate that semiochemical-based manipulation of the western balsam bark beetle should be
implemented by early May.
Key Words: Coleoptera: Curculionidae, Scolytinae
INTRODUCTION
The western balsam bark beetle,
Dryocoetes confusus Swaine, occurs
throughout the range of its host, subalpine fir,
Abies lasiocarpa (Hook) Nutt., from British
Columbia to New Mexico (Bright 1963). The
beetle is the most destructive insect pest of
mature and overmature subalpine fir in British
Columbia (Garbutt 1992).
Mathers (1931) described a two-year life
cycle for D. confusus in central B.C. First
emergence of new adults occurs in late June,
and continues throughout July. These adults
attack fresh host material, with the attacking
males excavating nuptial chambers. Male D.
confusus are polygamous, and mate with up to
four females (Bright 1976). Females excavate
brood tunnels and lay eggs until "well into
August" (Mathers 1931). After egg laying is
completed, the parent adults extend brood
tunnels by feeding, creating tunnels in which
they overwinter. The following spring,
females lay a second brood in a continuation
of these same tunnels. Parent adults then re-
emerge in mid-July to attack fresh material.
and lay a third brood. Eggs of the first brood
hatch in late August, overwinter as small
larvae, develop to teneral adults, and
overwinter again. Progeny of the second
brood, beginning early the second summer,
develop in a similar way. The third brood,
beginning late in the second summer, begins
to hatch by the third week in August (Mathers
1931). Thus, Mathers (1931) identified two
clearly defined flight periods, of which the
second had re-emerging adults.
Baited multiple-funnel traps have been
used to monitor D. confusus flight periods for
three years in Utah, USA (Hansen 1996), and
for three years in northern Idaho and western
Montana, USA (Gibson et al. 1997). Both
studies identified two flight peaks, with the
main part of the first peak occurring from
mid-June to early July, and the second
variably in August to September. In Utah, the
relative size of the two flight peaks varied
across elevations, with a trend towards larger
first peaks at higher elevations, and larger
second peaks at lower elevations. Both studies
'Corresponding author. Regional Entomologist, B.C. Ministry of Forests, Lands, and Natural Resource Operations,
401-333 Victoria St. Nelson, BC Canada VIL 4K3
2B.C. Ministry of Forests, Lands, and Natural Resource Operations, #510, 175-2nd Ave, Kamloops, B.C. Canada
V2C 5W1
^Contech Inc., 7572 Progress Way, Delta, B.C. Canada V4G 1E9
28
J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3
noted a larger pereentage of male beetles in
the early-season flight, and a trend towards
more females in the later season flight.
Hansen (1996) noted that very little flight
oecurred when ambient temperatures were less
than 15°C, although low temperatures were
not a factor separating the two seasonal flight
peaks.
Our objectives were to describe the
seasonal flight patterns of D. confusus and to
assess the vertical distribution of within-stand
flight in central British Columbia.
MATERIALS AND METHODS
Eight-unit multiple-fiinnel traps (Lindgren
1983) were set in the Bulkley Valley, central
British Columbia, in the Engelmann Spruce-
Subalpine Fir or Sub-Boreal Spruce
biogeoclimatic zones (Banner et al. 1993),
annually in 1985, 1986, and 1987. Trapping
periods and locations for monitoring seasonal
flight were 19 June-22 August 1985 (10 traps)
at McKendrick Pass, 13 June-27 August 1986
(6 traps), at Gramophone Creek, and 28 May-
27 August 1987 (10 traps) at Kwun Creek.
Traps were suspended on ropes between two
trees in stands with active beetle infestations,
and were placed at least 50 m apart. The top of
each trap was hung approximately 2 m above
ground in 1985 and 1986. Based on results
from 1986 of vertical distribution of within-
stand flights, the top of each trap was raised to
3 m in 1987. Attractive baits used in each trap
were the aggregation pheromone (±)-exo-
brevicomin (Albany International, Columbus,
Ohio) 99.7% purity (Borden et al. 1987), in
two glass capillary tubes, collectively
releasing 0.4 mg/24 h in 1985 and 1986.
Based on results from experiments in 1986
(Stock et al. 1995), the release rate of trap
baits was increased to four capillary tubes,
collectively releasing 0.8 mg/24 h ({±)-exo-
brevicomin, 98.0% purity, Contech Inc., Delta,
B.C.) in 1987. Captured D. confusus were
counted and sexed daily in 1985, and on
Mondays, Wednesdays, and Fridays in 1986
and 1987. Within-stand temperature and
relative humidity patterns were monitored
with a hygrothermc graph (C.F. Casella and
Co., London, UK, Model 3083/TT) placed in a
Stevens box located under the canopy on the
ground near the funnel traps.
In a separate experiment in 1986, 10 exo-
brevicomin-baited 8-unit multiple-funnel
traps spaced 50 m apart were set out at
Gramophone Creek. Five traps were selected
randomly to be suspended approximately 2 m
above ground, and five to be suspended
approximately 6 m above ground. The
experiment was established on 19 June, and
ended on 1 1 July.
Data from the trap height experiment were
compared using a t-test (Number Cruncher
Statistical System 1988).
RESULTS
Seasonal flight patterns (Fig. 1) indicated
that D. confusus has at least two flight periods
each summer. The first (main) flight period
occurred in mid- to late June, and the second
in mid-August. Flight had probably started
prior to trap placement in 1985 and 1986, as
evidenced by catches in the first collection
period. Peaks in flight activity generally
occurred when maximum daily ambient
temperature was 15°C or warmer (Fig. 1).
Relatively little flight occurred in the interval
between flight peaks, despite apparently
adequate maximum temperatures. The trends
for cumulative captures were roughly similar
each year, showing a slow rise followed by a
sharp increase, with the pattern then repeating
itself (Fig. 2). By assuming a separation of the
two flights on 1 August, the second flight
represented 19% of total flight in 1985, 17%
of total flight in 1986, and 26% of total flight
in 1987. Small numbers of beetles flew in
September in all years after the traps had been
taken down (pers. observations).
Cumulatively, for the three years of study,
less than 5% of total trap catch occurred when
daily maximum temperatures within stands
were less than 15°C.
The overall proportion of captured males
was 0.46 in 1985, 0.67 in 1986, and 0.44 in
1987 (Fig. 3). However, males predominated
early in the season, and the sex ratio became
progressively female-biased over time. The
J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3
29
■ 15
30
u
o
0^
25 2
cd
u
D
a-
20 I
15 -o
e
3
E
10
cd
30
25
20
Figure 1. Seasonal flight patterns and maximum daily temperatures for Dryocoetes confusus
caught in exo-brevicom in-baited multiple funnel traps at Gramophone Creek, B.C., 1985-1986,
and Kwun Creek, B.C., 1987.
30
J. Entomol. Soc. Brit. Columbia 110, December 20 13
28 May-3 1 August
Figure 2. Cumulative trap catch as percent of annual total trap catch for Dryocoetes confusus
caught in exo-brevicomin-baited multiple funnel traps at Gramophone Creek, B.C., 1985-1986,
and Kwun Creek, B.C., 1987.
less well-defined trend in 1986 could be due
to the generally cooler weather early in the
summer, which may have affected the
emergence of one of the sexes. Also, there
were relatively few beetles caught in 1986
(Fig. 1), which may have increased variation,
resulting in weaker trends (see also Fig. 2).
Approximately four times more beetles
were captured in traps at the 6 m height than
at 2 m (Table 1).
DISCUSSION
The evidence that the main flight period of
the western balsam bark beetle occurs
primarily in mid- to late June corresponds well
with Mathers' (1931) data on life history.
Some caution may be needed when
interpreting results of pheromone-baited
funnel traps for monitoring scolytid flight
periods (Bentz 2006). Pheromone-baited traps
within stands may catch disproportionately
more beetles during periods of reduced beetle
flight, and disproportionately fewer beetles
during peak beetle flight, producing an
“elongated” flight period that may not
coincide well with actual beetle emergence
from trees (Bentz 2006). However, for
semiochemical-based management, it is
necessary to know when beetle flight actually
commences in stands, and we are confident
our results indicate that D. confusus flight can
begin in early June or late May (Fig. 1), when
ambient temperatures are higher than 15°C.
This temperature threshold is consistent with
Hansen (1996) and Negr6n and Popp (2009).
Hansen (1996) noted that snow was mostly
gone before flight commenced. The
occurrence of the second peak in mid-August
in central BC, however, was one month later
than the mid-July re-emergence described by
Mathers (1931). This may have been due to
weather. Temperature-driven variation in
development is common in other scolytid
species: it can shorten their life cycles when
warm weather pennits, or lengthen them to
endure periods of cold (Amman 1973; Schmid
and Frye 1977; Langor 1987; Wermelinger
and Seifert 1999). Flight peaks of the western
balsam bark beetle appear to be variable
across the landscape and highly weather
dependent (Hansen 1996; Gibson et al. 1997;
Negron and Popp 2009). This information
should prompt further investigations to
discover if D. confusus can indeed develop on
J. Entomol. Soc. Brit. Columbia 110, December 2013
31
28 May-3 1 August
Figure 3. Seasonal variation in the male component of flying Dryocoetes confusus populations,
Gramophone Creek, B.C., 1985-1986, and Kwun Creek, B.C., 1987.
a one-year cycle, as suggested by Bright
(1963), and which does occur in Dryocoetes
autographus (Johansson et al. 1994) and the
spruce beetle, Dendroctonus rufipennis
(Schmid and Frye 1977). Such a life cycle
may become more prevalent under conditions
of global warming. Further work is also
necessary to assess efficacy of baited funnel
traps for monitoring beetle flight, as per Bentz
(2006). It is essential to understand variability
in life-cycle duration and flight periods in
order to implement pest management tactics,
e.g., semiochemical-based population
manipulation, effectively.
The period between flight peaks
corresponds to when females in galleries are
laying a second brood (Mathers 1931) and/or
feeding to regenerate their flight muscles
(Chapman 1957; Borden and Slater 1969;
Bhakthan et al. 1970; Bhakthan et al. 1971).
Exact information on when first-, second-, or
third- brood beetles are represented in flying
populations at higher latitudes awaits further
study.
The overall proportions of captured males
conformed well to the 0.43 proportion of
males in emerging beetle broods (Stock 1981).
There was no evidence for an early emergence
of the responding sex (females; Fig. 3),
considered to be an outbreeding mechanism in
other scolytids (Cameron and Borden 1967;
Billings and Gara 1975; Borden 1982). Rather,
there is evidence for early emergence of the
pioneering sex (males; Fig. 3), which is
consistent with Hansen (1996) and Negron
and Popp (2009). Early emergence of the
pioneering sex has been shown for summer
brood Ips typographus L. (Botterweg 1983)
and I. perturbatus (Graves 2008). It is possible
that in uneven-aged multi-storied old-growth
subalpine forests, the patchy and temporary
nature of the host resource (newly susceptible
or freshly downed trees; Bleiker et al. 2003,
2005) may force beetle populations to search
over large areas. Early emerging males could
establish new attraction centres, resulting in
multiple matings with local females and
enhanced population genetic heterogeneity
(Flamm et al. 1987). If the responding sex
were to emerge first in such a harsh
environment, the uncertainty of initial attack
success, establishment of secondary attraction,
and ultimately mass-aggregation (Borden et
al. 1986) could be increased, resulting in high
mortality of the responding sex during
dispersal. Subsequent re-emergence of
females late in the summer may further
enhance genetic heterogeneity (Cameron and
Borden 1967).
We hypothesize that a significant
proportion of the second flight is comprised of
re-emerging adults. Flamm et al. (1987) found
that 75% and 64% of attacking Ips avulsus
Eichoff and I. calligraphus Germar,
respectively, re-emerged from original host
trees, and that males represented only 27.8%
of reemerging /. avulsus, compared to 46.7%
of re-emerging I. calligraphus. Anderbrandt et
32
J. Entomol. Soc. Brjt. Columbia 110, December 2013
Table 1
Catch of D. confusus in a five-replicate experiment with 8-unit (±)-exo-brevicomin-baited funnel traps
set at 2 and 6 m above ground, 19 June-1 1 July 1986, Gramophone Creek, B.C.
a Means within columns followed by the same number are not significantly different, t-test, p < 0.0250.
al. (1985) found that about 84% of /.
typographus reemerged, of which about 36%
were males. It is possible that those females fit
enough to re-emerge gain an adaptive
advantage by exploiting unused bark in
previously attacked, but not fully utilized trees
(Flamm et al. 1987). A portion of the second
flight peak may also be generated by broods
originating in downed materials (Negron and
Popp 2009), if development were delayed
because of snow cover.
Our results indicate that pest management
tactics such as semiochemical-based
management (Stock et al. 1990, 1993, and
1995; Maclauchlan et al. 2003; Jeans-
Williams and Borden 2006) need to be
implemented by early May. Finer-scale
silvicultural approaches such as group
selection or small patch harvesting (Veblen et
al. 1991; Stock et al. 1993; Maclauchlan et al.
2003) would need to account for the period
when re-emerged, and presumably gravid,
females are active; e.g., delay implementation
until September.
The tendency of D. confusus to fly well
above ground within stands has been shown
for other scolytid species. Beetles with such
flight patterns presumably avoid the
impediments of understorey vegetation and
dense tree crowns, and are positioned to
intercept pheromone plumes (Ashraf and
Berryman 1969; Schmitz et al. 1980; Amman
and Cole 1983; Bartos and Amman 1989).
Understorey vegetation can be 3 or 4 m high
in subalpine forests. Waters and Stock (1995)
counted attack densities at 1.3, 4 and 8 m
height, and found that beetle attacks per
square metre were greatest at 4 m above
ground, although the difference between
heights was not significant. Flight height may
not be correlated to attack success, although
Maclauchlan et al. (2003) hypothesize that
cool nighttime temperatures near the ground
or wetness and non-vectored fungal
development under the bark may limit gallery
success in the lower two metres of the bole.
It would be useful to know, for
semiochemical-based manipulation of D.
confusus populations, what relationship this
flight pattern might have to the initial attack
height and vertical distribution of attack
density by D. confusus on standing trees.
ACKNOWLEDGEMENTS
We thank management and staff of D. Groot
Logging Ltd., Houston Forest Products Ltd.,
Pacific Inland Resources Ltd., Northwood Pulp
and Timber Ltd., West Fraser Mills Ltd., Phero
Tech Inc., and Regional and District Offices of
the B.C. Forest Service in Smithers and Houston,
B.C., C. Klassen for field assistance, the Science
Council of B.C. Grant No. 1 (RC 12-16) and
GREAT Award to the senior author, and the
Natural Sciences and Engineering Research
Council, Canada Operating Grant No. A3881
and Strategic Grant No. G1611 for their support
of this research. We also thank L. Safranyik, R.
C. Brooke, and two anonymous reviewers for
thoughtful suggestions that improved the
manuscript.
REFERENCES
Amman, G. D. 1973. Population changes of the mountain pine beetle in relation to elevation. Environmental
Entomology 2:541-547.
Amman, G. D., and W, E. Cole. 1983. Mountain pine beetle dynamics in lodgepole pine forests Part II: Population
J. Entomol. Soc. Brit. Columbia 110, December 201 3
33
dynamics. USDA Forest Service Inteimountain Forest and Range Experiment Station, Ogden, Utah. General
Technical Report INT-145. 59 p.
Anderbrandt, O., F. Schlyter, and G. Birgersson. 1985. Intraspecific competition affecting parents and offspring
in the bark beetle Ips typographus. Oikos 45:89-98.
Ashraf, M., and A. A. Berryman. 1969. Biology of Scolytus ventralis (Coleoptera: Scolytidae) attacking Abies
grandis in northern Idaho. Melanderia 2:1-23.
Banner, A., W. MacKenzie, S. Haeussler, S. Thomson, J. Pojar, and R. Trowbridge. 1993. A field guide to site
identification and interpretation for the Prince Rupert Forest Region. B.C. Ministry of Forests, Research
Branch, Victoria, B.C., Land Management Handbook No. 26. 152 pages.
Bartos, D. L., and G. D. Amman. 1989. Microclimate: an alternative to tree vigor as a basis for mountain pine
beetle infestations. USDA Forest Service Res. Pap. Int-400. Ogden, Utah. 10 p.
Bentz, B. J. 2006. Mountain pine beetle population sampling: inferences from Lindgren pheromone traps and tree
emergence cages. Canadian Journal of Forest Research 36:351-360.
Bhakthan, N. M. G., J. H. Borden, and K. K. Nair. 1970. Fine structure of degenerating and regenerating flight
muscles in a bark beetle, Ips confusus. I. Degeneration. Journal of Cell Sciences 6:807-819.
Bhakthan, N. M. G., K. K. Nair, and J. H. Borden. 1971. Fine structure of degenerating and regenerating flight
muscles in a bark beetle, Ips confusus. II. Regeneration. Canadian Journal of Zoology 49:85-89.
Billings, R. F., and R. I. Gara. 1975. Rhythmic emergence of Dendroctonus ponderosae (Coleoptera: Scolytidae)
from two host species. Annals of the Entomological Society of America 68:1033-1036.
Bleiker, K. P., B. S. Lindgren, and L. E. Maclauchlan. 2003. Characteristics of subalpine fir susceptible to attack
by western balsam bark beetle (Coleoptera: Scolytidae). Canadian Journal of Forest Research 33(8): 1538-
1543.
Bleiker, K. P., B. S. Lindgren, and L. E. Maclauchlan. 2005. Resistance of fast- and slow-growing subalpine fir
to pheromone- induced attack by western balsam bark beetle (Coleoptera: Scolytinae). Agricultural and Forest
Entomology 7(3):237-244.
Borden, J. H. 1982. Aggregation pheromones, pp. 74-139. In J. B. Mitton and K. B. Sturgeon (Eds.). Bark beetles
in North American conifers: A system for the study of evolutionary biology. University of Texas Press, Austin,
TX. 527 p.
Borden, J. H., and C. E. Slater. 1969. Flight muscle volume change in Ips confusus (Coleoptera: Scolytidae).
Canadian Journal of Zoology 47:29-32.
Borden, J. H., D. W. A. Hunt, D. R. Miller, K. N. Slessor. 1986. Orientation in forest Coleoptera: an uncertain
outcome of responses by individual beetles to variable stimuli, pp. 97-109. In T. L. Payne, M. C. Birch, and C.
E. J. Kennedy (eds.). Mechanisms in insect olfaction. Clarendon Press, Oxford. .
Borden, J. H., A. M. Pierce, H. D. Pierce, Jr., L. J. Chong, A. J. Stock, and A. C. Oehlschlager. 1987.
Semiochemicals produced by the western balsam bark beetle, Dryocoetes confusus Swaine (Coleoptera:
Scolytidae). Journal of Chemical Ecology 13:823-836.
Botterweg, P. F. 1983. The effect of attack density on size, fat content, and emergence of the spruce bark beetle Ips
typographus L. Z. ang. Entomology 96:47-55.
Bright, D. R., Jr. 1963. Bark beetles of the genus Dtyocoetes (Coleoptera: Scolytidae) in North America. Annals of
the Entomological Society of America 56:103-115.
Bright, D.R., Jr. 1976. The insects and arachnids of Canada and Alaska. 2. Coleoptera: Scolytidae. Canadian
Department of Agriculture Publication No. 1576. 241 p.
Cameron, E. A., and J. H. Borden. 1967. Emergence patterns of Ips confusus (Coleoptera: Scolytidae) from
ponderosa pine. The Canadian Entomologist 99:236-244.
Chapman, J. A. 1957. Flight muscle change during adult life in the Scolytidae. Canadian Department of Forestry,
Division of Forest Biology. Bi-monthly Progress Report 13:3^.
Flamm, R. O., S. P. Cook, T. L. Wagner, P. E. Pulley, and R. N. Coulson. 1987. Reemergence and emergence of
Ips avulsus and Ips calligraphus (Coleoptera: Scolytidae). Environmental Entomologist 16:869-876.
Garbutt, R. 1992. Western balsam bark beetle. Forest Pest Leaflet 64. Canadian Forest Service, Pacific Forestry
Centre, Victoria, BC. 4 p.
Gibson, K., S. Kegley, and B. Oakes. 1997. Western balsam bark beetle activity and flight periodicity in the
Northern Region. USDA Forest Service Cooperative Forestry and Forest Health Protection, Missoula, MT.
Report 97-3. 5 p.
Graves, A. D. 2008. The chemical ecology of the northern spruce engraver, Ips perturbatus (Eichoff) (Coleoptera:
Scolytidae), and associated insects in spruce forests of Alaska. Doctoral Dissertation, University of Minnesota,
St. Paul, MN. 296 pages. (Cited in Negron and Popp 2009).
Hansen, E. M. 1996. Western balsam bark beetle, Dtyocoetes confusus Swaine, flight periodicity in northern Utah.
Great Basin Naturalist 56:348-359.
Jeans- Williams, N. L., and J. H. Borden. 2006. Evaluation of Two Pheromone Baits for Containment and
34
J. Entomol. Soc. Brit. Columbia 110, December 2013
Concentration of Attack by the Western Balsam Bark Beetle, Dryocoetes confusus (Coleoptera: Curculionidae).
Western Journal of Applied Forestry 21 ;27-32.
Johansson, L., J. Andersen, and A. C. Nilssen. 1994. Flexible generation time in Dryocoetes autographus (Ratz.)
(Col., Scolytidae): a key to its success as colonist in subarctic regions? Journal of Applied Entomology 1 17:21-
30.
Langor, D. W. 1987. Emergence, host attack, and overwintering behaviour of the eastern larch beetle,
Dendroctonus simplex Leconte (Coleoptera: Scolytidae), in Newfoundland. The Canadian Entomologist 119:
975-983.
Lindgren, B. S. 1983. A multiple-funnel trap for scolytid bark beetles. The Canadian Entomologist 1 15:299-302.
Maclauchlan, L. E., L. Harder, J. H. Borden, and J. E. Brooks. 2003. Impact of the western balsam bark beetle,
Dryocoetes confusus Swaine (Coleoptera: Scolytidae), at the Sicamous Research site, and the potential for
semiochemical based management in alternative silviculture systems. Journal of the Entomological Society of
British Columbia 100:27-41.
Mathers, W. G. 1931. The biology of Canadian bark beetles. The seasonal history of Dryocoetes confusus Sw. The
Canadian Entomologist 68:247-248.
Negr6n, J. F., and J. B. Popp. 2009. The flight periodicity, attack patterns, and life history of Dryocoetes confusus
Swaine (Coleoptera: Curculionidae: Scolytinae), the western balsam bark beetle, in north central Colorado.
Western North American Naturalist 69(4):447^58.
Number Cruncher Statistical System. 1988. Kaysville, Utah, USA.
Schmid, J. M., and R. H. Frye. 1977. Spruce beetle in the Rockies. USDA Forest Service General Technical
Report RM-49. Fort Collins, Colorado.
Schmitz, R. F., M. D. McGregor, and G. D, Amman. 1980. Mountain pine beetle response to lodgepole stands of
different characteristics, pp. 234-243. In A. A. Berryman and L. Safranyik (Eds.) Proceedings of the second
lUFRO conference on dispersal of forest insects: Evaluation, theory, and management implications. Sandpoint,
Idaho. 27-31 August 1979. Cooperative Extension Service, Washington State University, Pullman, WA.
Stock, A. J., J. H. Borden, T. L. Pratt, H. D. Pierce, Jr., and B. D. Johnston. 1995. Enantiomeric composition
and release rates of exo-brevicomin influence aggregation of the western balsam bark beetle, Dryocoetes
confusus Swaine (Coleoptera: Scolytidae). The Canadian Entomologist 127:449-456.
Stock, A. J., J. H. Borden, and T. L. Pratt. 1993. Containment and concentration of western balsam bark beetle,
Dryocoetes confusus Swaine (Coleoptera: Scolytidae), populations by application of exo-brevicomin. Canadian
Journal Forest Research 24:483-492.
Stock, A.J., J.H. Borden, T.L. Pratt, H.D. Pierce, Jr., and B.D. Johnston. 1990. enJo-Brevicomin: an
antiaggregation pheromone for the western balsam bark beetle, Dryocoetes confusus Swaine (Coleoptera:
Scolytidae). The Canadian Entomologist 122:935-940.
Stock, A. J. 1981. The western balsam bark beetle, Dryocoetes confusus Swaine: secondary attraction and
biological notes. M.Sc. Thesis, Simon Fraser University, B.C.
Veblen, T. T., K. S. Hadley, and M. S. Reid. 1991. Disturbance and stand development of a Colorado subalpine
forest. Journal of Biogeography 18:707-716
Waters, H. J., and A. J. Stock. 1995. Application of MSMAto control western balsam bark beetle in subalpine fir
— B.C. Ministry of Environment special use permit 103-414-92* Research File 48090-2 June 12 1992. Final
report to B.C. Ministry of Environment, Pesticide Control Branch, January 1995. 13 p.
Wermelinger, B., and M, Seifert. 1999. Temperature-dependent reproduction of the spruce bark beetle Ips
typographus, and analysis of the potential population growth. Ecological Entomology 24:103-1 10.
J. Entomol. Soc. Brit. Columbia 110, December 20 13
35
SCIENTIFIC NOTE
Update on the establishment of birch leafminer parasitoids in
western Canada
Chris J.K. MacQuarrie\ Daryl J. Williams^, and David W. Langor^
Five species of birch (Betula) leaf-mining
sawfly have been introduced to Canada. The
two most damaging species, Profenusa
thomsoni (Konow) and Fenusa pumila Leach
(previously known as F pusilla), have wide
distributions in western Canada (Digweed et
al. 2009) and can be significant pests of birch
in the region. The larvae of both species feed
inside the leaf and cause brown blotch-shaped
mines that are characteristic for each species.
When outbreaks of these species occur, the
large numbers of larvae create multiple mines
within individual leaves. This damage causes
trees to take on a burnt appearance, which is
often considered undesirable in urban settings
where birch is a popular ornamental tree. Over
the last 20 years, we have studied the
distribution and impact of these birch leaf-
mining sawflies and their biological control
using parasitoids in the Ichneumonid genus
Lathrolestes Foerster (Digweed et al. 2009,
MacQuarrie et al. 2013).
In Canada, outbreaks of F pumila and P.
thomsoni have been controlled by the
introduction and redistribution of two species
of Lathrolestes that attack the larvae as they
feed within the leaf (Quednau 1 984, Langor et
al. 2002, Digweed et al. 2003, MacQuarrie et
al., 2013). Outbreaks of both sawfly species
have been noted in western Canada, but since
the 1 990s P. thomsoni has been responsible for
most of the observed damage. The sawfly is
controlled by Lathrolestes thomsoni
Reshchikov (previously known as L.
luteolator), an endoparasitoid that was first
observed attacking P. thomsoni during the late
1990s in Edmonton, Alberta (Digweed et al.
2003). In the early 2000s, other populations of
the parasitoid were found attacking the sawfly
in Hay River and Fort Smith, Northwest
Territories, as well as in Edson, Alberta
(MacQuarrie 2008). These parasitoid
populations were later exploited for a
biological control project against an outbreak
of P. thomsoni in Alaska. This project
successfully established L. thomsoni in at least
one site in the state (MacQuarrie 2008, Soper
2012), and demonstrated that relocating free-
living adult L. thomsoni is a feasible way to
establish the parasitoid within an outbreak
population of P. thomsoni.
In the early 2000s, outbreaks of P.
thomsoni were reported in the Northwest
Territories and northern British Columbia. To
help suppress these populations, we collected
adult L. thomsoni from Edson, Edmonton, Hay
River and Fort Smith, and released them in
Prince George, British Columbia, and
Yellowknife, Northwest Territories
(MacQuarrie 2008). We surveyed these
populations in 2012 to determine: 1) if L.
thomsoni had established; and, 2) how
abundant it was. A survey in 2003 found that
P. thomsoni was also present throughout much
of the southern Yukon but not at outbreak
levels (Digweed and Langor 2004). Therefore,
we also surveyed in the Yukon to determine if
P. thomsoni had changed in abundance and if
L. thomsoni was present.
In the summer of 2012, we surveyed for L.
thomsoni in Prince George, Yellowknife and
Whitehorse, Yukon, using traps (7.5 cm x 12.5
cm yellow sticky cards; Contech Inc.,
Victoria, BC) set out at two or three sites in
each city. In both Prince George and
Yellowknife, one site was situated near the
original release site and another site was
established elsewhere. The two Prince George
sites were located in a wooded area and in the
yard of a private home, and were
approximately 1.1 km apart. The two
Yellowknife sites were both located in the
'Natural Resources Canada, Canadian Forest Service, Great Lakes Forestry Centre, 1219 Queen Street East. Sault
Ste Marie, Ontario, Canada. P6A 2E5
^Natural Resources Canada, Canadian Forest Service, Northern Forestry Centre, 5320 122 street NW, Edmonton,
Alberta, Canada. T6H 3S5
J. Entomol. Soc. Brit. Columbia 1 1 0, December 2013
yards of private homes and were
approximately 2.5 km apart. In Whitehorse,
the sites were located in wooded areas near a
major road (two sites) and along a walking
trail (one site). These sites were approximately
0. 5-3.0 km apart.
At each site, three birch trees were selected
by local volunteers, and a trap was hung at
head height (approx. 2 m) in each tree. Traps
were placed in early or mid-June, depending
on the advancement of the season, and
replaced weekly until early or mid-July,
depending on the duration of P. thomsoni adult
flight (Table 1). This study was intended for
detection and not for population assessment.
Volunteers were therefore allowed to carry out
surveys according to their own local
conditions rather than according to a
prescribed method. This meant the number of
traps hung in each city and at each site varied
depending on how frequently the traps were
changed. We report the total number of traps
hung at each site over the trapping period
(Table 1). The volunteers returned the traps at
the end of the season, at which time we
examined the traps’ contents. Identification of
all material on the traps was done by one of
the authors (D. J. Williams).
We found L. thomsoni to be established in
Prince George, and established and abundant
in Yellowknife (Table 1). Populations of the
sawfly at both release sites appear to be large
relative to the size of the parasitoid
populations. Parasitism rates (percent of the
total catch that was adult parasitoids) ranged
from 11-17% in Yellowknife and 6-8% in
Prince George. In contrast, the R thomsoni
population in Whitehorse appeared to be
small, and a parasitoid population was not
detected (Table 1 ).
Our survey indicates L. thomsoni has
established in Prince George and Yellowknife.
Suppression of either population was not
tested, but anecdotal evidence suggests that
damage by P. thomsoni has been less evident
in recent years (MacQuarrie et al. 2013).
However, even when populations are large,
the appearance of damage caused by P.
thomsoni can vary from year to year
(MacQuarrie 2008), and a decrease in visible
damage may not indicate a sawfly population
Table 1
Summary of trap catches for adult Profenusa thomsoni (Konow) and adult Lathrolestes thomsoni
Reshchikov for three cities in 2012.
J. Entomol. Soc. Brit. Columbia 110, December 2013
experiencing suppression by the parasitoid.
Repeated observations of both populations,
including an assessment of parasitism rates,
would be necessary to confirm if L. thomsoni
is controlling P. thomsoni.
The population of P. thomsoni in
Whitehorse is small, and L. thomsoni does not
appear to be present. We suggest that
Whitehorse be monitored at regular intervals
to assess the status of the P. thomsoni
population. Should an outbreak occur, the
established L. thomsoni populations in
Yellowknife and Prince George could serve as
sources of parasitoids for release in
Whitehorse.
Determining the true impact of L. thomsoni
on the dynamics of the Prince George and
Yellowknife P. thomsoni populations requires
collecting and rearing large numbers of
leafminers to obtain an estimate of the percent
37
parasitism. Such estimates have been done for
other P. thomsoni populations, but the work
requires significant time, effort, and financial
resources to make an accurate assessment
(MacQuarrie 2008). These resources are hard
to obtain for species, like P. thomsoni, that are
considered minor, aesthetic pests. In contrast,
sampling adult parasitoids, while a less precise
estimate than rearing, is a simple and
inexpensive way to determine the presence
and relative abundance of a parasitoid.
We are optimistic that control of the sawfly
will be achieved at Prince George and
Yellowknife, based on the observation that L.
thomsoni has persisted at both sites for at least
five years without any assistance or
augmentation. This suggests that the L.
thomsoni populations at these sites are
resilient and should be able to maintain their
presence into the future.
ACKNOWLEDGEMENTS
We thank S. Lindgren, University of
Northern British Columbia, Prince George; S.
Carriere and D. Taylor, Government of the
Northwest Territories, Yellowknife; and B.
Godin, Environment Canada, Whitehorse, for
their assistance in placing and monitoring
sticky traps; and R. Johns and three
anonymous reviewers for their comments on
an earlier version of this manuscript.
REFERENCES
Digweed, S. C., and D. W. Langor. 2004. Distributions of leafrnining sawflies (Hymenoptera: Tenthredinidae) on
birch and alder in northwestern Canada. Can. Entomol. 136: 727-731.
Digweed, S. C., C. J. K. MacQuarrie, D. W. Langor, D. J, M. Williams, J. R. Spence, K. L. Nystrom, and L.
Morneau. 2009. Current status of exotic birch-leafmining sawflies (Hymenoptera: Tenthredinidae) in Canada,
with keys to species. Can. Entomol. 141: 201-235.
Digweed, S. C., R. L. McQueen, J. R. Spence, and D. W. Langor. 2003, Biological control of the ambermarked
birch leafminer, Profenusa thomsoni (Hymenoptera: Tenthredinidae), in Alberta. Information Report NOR-
X-389, NRCan CFS, Northern Forestry Centre, Edmonton, AB.
Langor, D. W., S. C. Digweed, and J. R. Spence. 2002. Fenusa pusilla (Lepeltier), birch leafminer, and Profenusa
thomsoni (Konow) ambermarked birch leafminer (Hymenoptera: Tenthredinidae), pp. 123-127. In Mason,
RG., Huber, J.T. (eds.). Biological Control Programs in Canada, 1981-2000. CABI Publishing, Wellingford,
UK.
MacQuarrie, C. J. K, 2008. Distribution, Biological Control and Population dynamics of Profenusa thomsoni
(Konow) in Alaska. Ph.D. thesis. University of Alberta, Edmonton, AB.
MacQuarrie, C. J. K., D. W. Langor, S. C. Digweed, and J. R. Spence. 2013. Fenusa pumila Leach, birch leaf
miner, Profenusa thomsoni (Konow), Ambermarked birch leaf miner (Hymenoptera: Tenthredinidae), pp. 175-
181. In Mason, P.G., Gillespie, D. (eds.). Biological Control Programmes in Canada 2001-2012. CABI
Publishing, Wellingford, UK.
Quednau, F. W. 1984. Fenusa pusilla (Lepeletier), birch leaf-miner (Hymenoptera: Tenthredinidae), pp. 291-294.
In Kelleher, J.S., Hulme, M.A. (eds.), Biological Control Programmes Against Insects and Weeds in Canada
1969-1980. Commonwealth Agricultural Bureaux, Famham Royal, Slough, UK.
Soper, A, 2012, Biological control of the ambermarked birch leafminer {Profenusa thomsoni) in Alaska. Ph.D.
thesis University of Massachusetts, Amherst, MA.
38
J. Entomol. Soc. Brit. Columbia 1 10, December 2013
SCIENTIFIC NOTE
British Columbia’s 50th mosquito species, Aedes schizopinax
M. Jackson^ C. Pyles^ S. Breton^ T. J. S. McMahon^ and P. Belton^
Larvae of Aedes {Ochlerotatus)
schizopinax Dyar, 1929 (Diptera; Culicidae)
were collected in a survey by Culex
Environmental for the District of Sparwood by
Sylvia Breton on 12 May 2013. The site (Fig.
1 ) was a roadside pool near Sparwood, British
Columbia (B.C.), approximately 20 km west
of the Alberta border. Vegetation around the
pool was mostly pine grass {Calamagrostis
rubescens Buckley) with wild rose {Rosa
acicularis Lindl.) in front of willow {Salix
sp.), cottonwood {Populus sp.) and lodgepole
pine (Pinus contorta Douglas). Representative
specimens will be deposited in the Beaty
Biodiversity Museum, University of British
Columbia. In the 30 years since the
publication of the Provincial Museum
handbook on the mosquitoes of British
Columbia (Belton 1983), four additional
species have been collected in the province.
They all have been examined by Dr. Peter
Belton. The identities of two of these species,
Culex boharti Brookman and Reeves and
Culex restuans Theobald, are being confirmed.
Culiseta particeps (Adams) was reported by
Jackson et al. (2013), while the fourth species,
Aedes schizopinax, is documented here.
Aedes schizopinax was described by Dyar,
(1929) from larvae collected at Story Creek
railway crossing in central Montana. The
specific name (Greek: divided disc) derives
ffom the sclerotised tergite, the saddle or disc
on the terminal abdominal segment X of the
larva. In contrast to the larvae of the sympatric
and related Aedes hexodontus Dyar, Ae.
nevadensis Chapman & Barr, and Ae. punctor
(Kirby), the saddle does not completely
surround the segment, leaving a noticeable
gap ventrally. The species has since been
collected from other subalpine regions of
Montana and from similar habitats in Idaho,
Oregon, California, Wyoming, Utah, Nevada
and New Mexico (Darsie and Ward 2005). In
Canada, the only other collections are of
larvae from Morleyville Settlement and
Calgary, Alberta, 36 years ago (Enfield 1977).
We retain the generic names used in Wood et
al. (1979), noting that some authors have
replaced Aedes with the subgeneric name
Ochlerotatus for all the Aedes species named
here.
The five larvae (preserved in 80% ethanol)
that we examined match the description in
Wood et al. (1979). No adults were reared.
The symmetrically arranged head setae 7 and
5C had two and three branches, respectively,
and all branches of the prothoracic setae 2 and
3P were as sturdy as setae IP. The
mesothoracic setae IM had three strong
branches, and these, with the more obvious
evenly spaced teeth on the pecten and twenty-
five or more pointed comb scales, clearly
identify the species as Ae. schizopinax.
The four anal papillae of the larva are
drawn in Plate 45 of Wood et al. (1979), with
the dorsal pair slightly longer than the ventral
ones. In the fourth and final instar larva that
we measured, the anal segment AX was
0.61mm long and the dorsal two papillae were
slightly longer than the ventral pair (0.38:
0.33mm) and about the same length as the
saddle. Carpenter and LaCasse (1955) in Fig.
188 and Darsie and Ward (2005) in Fig. 772
show the dorsal and ventral papillae to be the
same length. The reason for the difference in
lengths is not known, but it occurs in species
in several genera, always with the dorsal
longer than the ventral pair. The unequal
length of the dorsal and ventral papillae is
used by Wood et al. (Fig. 199) to separate
Aedes increpitus Dyar from Ae. stimulans
(Walker). However, the size of the papillae is
known to vary inversely with the salinity of
the environment (Phillips and Meredith 1969),
so the consistency of the difference in length
of the papillae deserves further study. The seta
on the side of the saddle differed from that
illustrated in Plate 45 of Wood et al. (1979)
'Culex Environmental Ltd., 4^075 Kingsway, Burnaby, B.C. V5H IY9
^Biological Sciences, Simon Fraser University, Burnaby, B.C. V5A 1S6.
J. Entomol. Soc. Brjt. Columbia 110, December 2013
39
Figure 1. Grassy pool near Sparwood (49° 44' 10.28"N, 114° 53' 5.45"W; elevation: 1124m), the
first known site for Aec/es schizopinax in British Columbia.
being bifid rather than unbranched, but this
matches the description of the Californian
specimen in Fig. 772 of Darsie and Ward
(2005).
Sparwood is in the Montane Spruce
biogeoclimatic zone (B.C. Ministry of Forests
2013). It is approximately 160 km southwest
of Morleyville settlement, Alberta, and 400km
northwest of Story Creek, Montana, but all
three localities are at elevations over 1000m.
We expect that Ae. schizopinax will be found
in similar habitats in other parts of
southeastern B.C.
There are at least 82 species of mosquitoes
in Canada (Thielman and Hunter 2007).
Because of the biogeographical history of
B.C. and its rich diversity of habitats, more
than half of these species occur in the
province. We are confident that several more
species will be identified, and in the
meantime, we hope to collect and rear adult
Ae. schizopinax in Sparwood; Adults are
seldom observed, and little is known of their
biology.
REFERENCES
B.C. Ministry of Forests and Range. 2013. Biogeoclimatic Ecosystem Classification Program. Research Branch,
Victoria, BC. http://www.for.gov.bc.ca/hre/becweb/.
Belton, P. 1983. The Mosquitoes of British Columbia. Provincial Museum Handbook #41 Queen’s Printer for
British Columbia, Victoria, BC.
Carpenter, S. J., and W. J. LaCasse 1955. Mosquitoes of North America (north of Mexico). University of
California Press, Berkeley, CA.
Darsie, R. F., and R. A.Ward 2005. Identification and Geographical Distribution of the Mosquitoes of North
America, North of Mexico. University Press of Florida, Gainesville, FL.
Dyar, H. G. 1929. A new species of mosquito from Montana with annotated list of mosquiitoes known from the
state. Proceedings of the United States National Museum 75 (2794): 1-8.
Enfield, M. A. 1977. Additions and corrections to the records of Aedes mosquitoes in Alberta. Mosquito News
37:82-85.
Jackson M., T. Howay, and P. Belton. 2013. The first record of Culiseta particeps (Diptera: Culicidae) in Canada.
The Canadian Entomologist 145:115-116.
Phillips, J. E.. and J. Meredith 1969. Active sodium and chloride transport by anal papillae of a salt water
mosquito larva {Aedes campesths) Nature 222:168-169.
Thielman, A. C., and F. F. Hunter. 2007. Photographic Key to the Adult Female Mosquitoes (Diptera: Culicidae)
of Canada. Canadian Journal of Arthropod Identification. No. 4, 14 December 2007, available online at http://
www.biology.ualberta.ca/bsc/ejournal/th_04/th_04.html, doi: 10.3752/cjai.2007.04
Wood D. M., P. T. Dang, and R. A. Ellis. 1979. The Insects and Arachnids of Canada 6. The Mosquitoes of
Canada (Diptera: Culicidae). Agriculture Canada, Ottawa, ON.
40
J. Entomol. Soc. Brit. Columbia 110, December 201 3
Symposium Abstracts: The Rise and Fall of the Honeybee
Entomological Society of British Columbia
Annual General Meeting,
PacificForestry Centre, Victoria, B.C., Nov. 1-2, 2013
Note: There was a total of eight papers presented in this symposium. We were able to obtain
abstracts from six of the authors.
SuperBoost
H. Borden, Contech Enterprises Inc., Delta,
B. C. WWW. contech-inc. com
SuperBoost is a commercial product based
on the 10-component fatty-acid ester
honeybee brood pheromone. One hundred
eighty milligrams of the non-volatile synthetic
pheromone are deployed in a small plastic
pouch held at the level of the brood comb in a
rigid plastic holder. The pheromone exudes
through a permeable plastic membrane at the
rate of 0. 5-2.0 mg/d. When SuperBoost was
placed in colonies, the ratio of pollen to non-
pollen foragers changed significantly in favour
of the former for five weeks, and foragers
returned to the hive with significantly heavier
pollen loads than did bees returning to
untreated control colonies. Compared to
untreated control colonies, colonies treated for
two consecutive five-week periods during
spring build-up consumed more pollen-
substitute diet, had more brood comb and
more bees, and produced more splits.
In three studies in which colonies were
treated with SuperBoost near the beginning of
nectar flow, treated colonies produced 24-
87% more honey than untreated control
colonies. The effect is hypothesized to be
caused by higher numbers of bees in treated
colonies. In a fourth study, in which colonies
were treated at the beginning of July, there
was no significant increase in honey
production. When colonies were treated
during fall feeding, the results were similar to
those obtained during spring build-
up. Package bee colonies treated six times in
the year starting on 30 April, when colonies
were established, had 2.7-times greater
survival than untreated colonies.
Although SuperBoost is sold elsewhere in
the world, it is not available in Canada, where
it has been declared an unregistered veterinary
drug.
Re-opening Pandora's hive: The risks of
importing honeybee packages from the U.S.
to Canada
C. Culley, Capital Region Beekeepers ‘
Association, Victoria, B.C.
In 1987, in response to the outbreak in the
U.S. of two parasitic mites (honeybee tracheal
mite, Acarapis woodi, and varroa mite, Varroa
destructor). Agriculture and Agri-Food
Canada closed the border to the importation of
honeybees {Apis mellifera) from the
continental U.S. Importations of honeybee
queens were allowed from Hawaii in 1993.
Following the Canadian Food Inspection
Agency’s (CFIA) 2003 risk assessment, the
Agency maintained the import ban on
honeybee packages, but in 2004 allowed the
importation of honeybee queens from the U.S.
In 2013, because requests for import
permits continue to be received, the Animal
Health Risk Assessment (AHRA) unit of the
CFIA conducted a risk assessment to provide
scientific information and advice in support of
the Canadian National Animal Health Program
for the development of import policy. The
CFIA’s Animal Import/Export Division asked
the AHRA to update and assess the likelihood
of biological hazards spreading or becoming
established in Canada, and their likely
consequences as a result of the importation of
honeybee packages from the U.S.
The Capital Region Beekeepers'
Association (CRBA) sent a letter to the
Minister of Agriculture and Agri-Food
requesting that the border remain closed to
honeybee packages due to many disease risks.
Of the risks identified by the CRBA, only four
were recognized by the CFIA: Africanized
honeybee (AHB), antibiotic-resistant
American foulbrood (AFB, resistant to
oxytetracycline [rAFB]), small hive beetle
(SHB), and amitraz-resistant Varroa mite
(acaricide-resistant [rVAR]). The CFIA
considered the following disease agents "not
J. Entomol. Soc. Brit. Columbia 110, December 2013
hazards": Tropilaelaps (not currently found in
U.S., but could appear at any time and be
spread with industrial movements of bees),
Apocephalus borealis (insufficient researeh),
and a wide variety of viruses, also thoroughly
distributed by industrial movements. Several
disease agents could also infect our native
pollinators.
The CRBA does not aeeept the levels of
risk established in the report, due to many
uncertainties that were faetored in. Lack of
research is not a good reason for lower risk.
This risk-assessment document was a
literature review, which is useful; however, it
makes it only more elear that more research
needs to be done before risks can be properly
assessed.
Trends in managed pollinators and
resurgence of urban beekeeping
H. Clay, Urban Bee Network, B. C.
Honey has been a sought-after natural
sweetener for eenturies. Sinee the advent of
the modem movable-frame hive, large-scale
beekeeping for honey production has become
an important sector of rural Canadian
agriculture. Throughout the past eentury,
whenever war or recession has posed a threat
to food supply, urban beekeeping has
increased. The highest number of beekeepers
ever recorded in Canadian history was during
the sugar rationing period of the Second
World War.
Fluctuations have occurred according to
whether beekeeping was profitable (good
honey priees, opportunities for pollination
service rental) or not profitable (low honey
prices, honeybee colony losses, high cost of
replacement bees). Honeybees are also
important pollinators of agricultural crops, and
colony numbers increased after research
showed the importance of bees for improving
erop production. Colony increase occurred in
two eycles: from 1960 to 1985, pollination
service expansion was for tree fruit and berry
crops, and since 1991 the demand for
pollination services has been driven by the
canola seed industry. Other managed
pollinators such as alfalfa leafcutter bees,
bumble bees and mason bees offer some
potential for greenhouse-crop pollination and
as complementary pollinators, but their
availability and short flight range have been
limiting factors for large-scale crops.
41
Canada's beekeeping industry was
significantly affected by the arrival of a new
parasite, Varroa mite, in 1989. Beekeeper
numbers dropped steadily for two decades
from their peak in 1985. Reeently, there has
been a measurable upward trend of urban
beekeepers and colony numbers following the
Global Financial Crisis (2008-2010) and its
accompanying recession. This period also
corresponded with a surge in media interest
and public awareness of honeybee colony
losses. Many consumers are concerned about
the plight of pollinators and want to obtain
food loeally, so demand for urban bees is high.
With recent changes in city bylaws, it is clear
that the trend to urban agriculture and urban
beekeeping is here to stay.
Native pollinators and the diversity of bees
C. S. Sheffield, Royal Saskatchewan Museum,
Regina, SK
The last decade has revealed that we are so
reliant on one species, the European honeybee
{Apis mellifera L.), for crop production via
pollination that we now face a possible food-
security issue with its continuing decline. Our
best hopes may not lie in putting all our
research efforts and resources into helping this
eharismatic species, but in also including other
native bee species into the crop-pollination
equation.
Canada has over 800 species of bees, and
many show much potential as managed and
encouraged pollinators. Wild bees can be
encouraged to live in many terrestrial habitats,
including agricultural ones, by conserving and
providing ample pollen and nectar resources
and nesting sites and habitats. Cavity-nesting
bees, primarily the family Megachilidae, show
great potential as alternative managed
pollinators, because many speeies aeeept
artificial nesting sites (i.e., nesting blocks) and
show strong preferences for some crop plants.
As well, combinations of crop and non-crop
plants that flower in sequence can be used to
promote bee-population growth in crop
systems. By considering what bees need, and
then providing it, we ean supplement
pollination ser\'ices. In addition, most of the
things that we do to help native bees will also
benefit honeybees, which allows us to meet
concerns for all pollinators.
42
Colony collapse disorder, farm chemicals,
and pollinator declines
P. van Westendorp, British Columbia Ministry
of Agriculture, Abbotsford, B.C.
Since 2000, pollinator declines have been
reported in many parts of the world. This
decline has not been limited to honeybees
{Apis mellifera), but also to other
Hymenoptera pollinators. French beekeepers
first reported high losses of apparently healthy
colonies near com and potato plantings.
Neither of these crops is of interest to bees as
forage sources. Similar losses were reported
by beekeepers in other European countries,
which led to the suspicion of a link between
colony losses and the insecticides used on
these crops.
In the late 1980s, the neonicotinoid
insecticides were introduced in Europe; since
then, formulations have been registered in
more than 120 countries. The neonicotinoids
mimic the natural plant derivative of nicotine,
which is characterized by its rapid knock-
down effect, short efficacy period, and rapid
breakdown. On the other hand, neonicotinoids
have proven highly effective at disrupting an
insects central nervous system, as well as for
their systemic action and high persistence in
the soil. Furthermore, neonicotinoids display
low to moderate toxicity to mammals,
affecting only their peripheral nervous
systems.
In the fall of 2006, U.S. beekeepers
reported catastrophic losses of apparently
healthy colonies without the identification of
the causal agent(s). The phenomenon was
dubbed “colony collapse disorder” (CCD).
The extent of the losses was so significant that
it seriously jeopardized the production of a
range of pollinator-dependent crops, most
notably almonds. Despite intense research
efforts, no definitive causal agent of CCD has
been identified. It is generally accepted that
CCD is caused by various biotic and abiotic
factors. In particular, mite parasitism of the
obligate, host-specific Varroa destructor has
had a highly destmctive impact on honeybees.
The situation has been exacerbated by bee
vimses vectored by the Varroa mite. Other
factors include management, bee genetics,
dietary deficiencies, and exposure to fann
chemicals. However, until now, there has been
no scientific evidence of a direct link between
CCD and neonicotinoid insecticides.
J. Entomol. Soc. Brit. Columbia 110, December 2013
Since the initial introduction of
neonicotinoids, a wide range of systemic
formulations have been developed for use in
numerous crops. Acute toxicity to insects has
never been in dispute, but due to their
persistence in the environment, it is believed
that neonicotinoids may cause pollinator
declines due to their chronic exposure at sub-
lethal levels, resulting in irreparable nerve
damage. An increasing body of evidence
shows that chronic exposure at sub-lethal
levels results in memory loss, changes in
foraging and reproductive behavior, and a
suppression of the insect’s immune response
system.
While unequivocal scientific evidence of
the impact of neonicotinoids on pollinators
has not yet been produced, the environmental
consequences of the constant application of
farm chemicals are highlighted by the way
these products are marketed and promoted.
From the 1960s onwards, integrated pest
management (IPM) programs were developed
for most crops and considered the use of any
chemical or drug only when monitoring data
support the need for the chemical or drug.
However, today, many farm chemicals are
applied prophylactically, regardless of need.
Neonicotinoid insecticides are applied to
100% of com seed and 50% of soy seeds.
Until recently, farmers had to pay a higher
price for untreated com seed. The departure
from IPM principles is of great concern,
because they are replaced by a management
system that incorporates the indiscriminate
and chronic use of chemicals into the
environment, without clear evidence on the
long-term impact these chemicals have on
non-target organisms.
Decision-making by the Canadian Food
Inspection Agency
H. Higo, Canadian Food Inspection Agency,
Surrey, B.C.
The 2013 risk analysis on the importation
of bulk honeybees from the continental U.S.
was released by the Canadian Food Inspection
Agency (CFIA) on 25 October 2013. The
CFIA uses a standard protocol for evaluating
potential risks of imports from other countries.
This presentation outlines the general risk
assessment protocol and details how this
protocol was applied in the recent honeybee
risk assessment.
J. Entomol. Soc. Brit. Columbia 110, December 20 13
The CFIA considered four disease and pest
issues to be hazards: the Africanized
honeybee, antibiotic-resistant American
foulbrood, small hive beetle, and acaricide-
resistant Varroa mites. These hazards were all
estimated to be moderate or low-to-moderate
risks. Because the risks had not changed
significantly since the last risk assessment in
2003, no change in the importation status of
bulk honeybees from the continental U.S. was
recommended.
Bee integrated pest management
H. Higo, Canadian Food Inspection Agency,
Surrey, B.C.
Honeybee colony losses have increased
significantly in recent years, from an average
loss of 10-15% prior to 2006 to 30% or more
since then. The causes of these elevated
colony losses appear to be multi-factorial,
including diseases and pests (such as the
Varroa mite, Nosema disease, and viruses
transmitted by Varroa mites), reduced pollen
and nectar availability with habitat loss and
mono-cropping agriculture systems, and
exposure to pesticides or other environmental
factors in the field and in the hive. Integrated
pest management (IPM) of Varroa mites and
other diseases in the hive without relying
heavily on harsh chemicals may help to reduce
the honeybee decline.
This presentation outlines a novel project
using proteomics — a potential new weapon in
the IPM toolbox — to select for specific
honeybee behaviours that combat Varroa
mites and other diseases. Several honeybee
antennal proteins were shown in a previous
43
project to be closely associated with worker
hygienic behaviour, in which workers
selectively remove diseased or infested pupae
from the colony before the disease or mite has
a chance to reproduce. Beginning in 2011, we
sampled and tested commercial colonies
across western Canada for hygienic behaviour.
Cooperating beekeepers allowed us to remove
selected queens, and going forward we used a
two-pronged selection protocol to breed three
generations of bees, either using proteomics or
traditional, laborious field tests for disease-
resistance.
Early results appear promising, but final
results from the 2013 mite and bacterial
challenges of the F3 generation are still being
evaluated. As well, economic evaluations are
underway in Manitoba and Alberta, as are
practical evaluations of F3 queens by
commercial cooperators across western
Canada. Results will be released in the
summer of 2014, and proteomic testing could
soon be a new IPM tool available to
beekeepers.
This project involved researchers from the
University of British Columbia (Leonard
Foster, Marta Guama, Amanda van Haga,
Miriam Bixby), University of Manitoba (Rob
Currie), Agriculture and Agri-Food Canada
(Stephen Pemal, Abdullah Ibrahim, Shelley
Hoover, Adony Melathopoulos) and bee
breeders Liz Huxter and Heather Higo.
Funding was provided by Genome Canada,
Genome BC, Genome Alberta, Agriculture
and Agri-Food Canada, University of British
Columbia, University of Manitoba, and the
B.C. Honey Producers Association.
44
J. Entomol. Soc. Br]t. Columbia 110, December 2013
Presentation Abstracts
Entomological Society of British Columbia
Annual General Meeting,
PacificForestry Centre, Victoria, B.C., Nov. 1-2, 2013
Phylogenetics and natural history of the
subfamily Tryphoninae (Hymenoptera:
Ichneumonidae)
A. Bennett, Canadian National Collection of
Insects, Agriculture & Agri-Food Canada,
Ottawa, Ontario
The Tryphoninae are a group of
ectoparasitoid wasps that parasitize sawfly and
Lepidoptera larvae. There are 1252 species in
59 genera worldwide. A morphological
phylogenetic analysis was performed to
examine their relationships. This analysis
permits discussion of the evolution of adaptive
characters and host associations.
Bee talk: Do honeybees use the Earth
magnetic field as a reference to align their
waggle dance?
V. Lambinet, M. Hayden, M. Bieri and G.
Gries, Departments of Biological Sciences and
Physics, Simon Fraser University, Burnaby,
B. C
Waggle-dancing honeybees recruit hive
mates to a food source. Directional
information is encoded in the angle between
the waggle run line of the dancer and a
reference line, predicted to be gravity or the
geomagnetic field (GMF). Canceling the GMF
around hives revealed no effect on the dancer's
recruiting success.
De novo transcriptome of Megastigmus
spermotrophus: Hunting for mechanisms of
host manipulation
A. Paulson, S. Perlman, P. von Aderkas,
Department of Biology, University of Victoria,
Victoria, B.C.
Megastigmus spermotrophus
(Hymenoptera; Torymidae) is a seed parasite
of Douglas-fir, Pseudotsuga menziesii. Three
highly expressed venom transcripts from
females were identified in the transcriptome.
One of these venoms,
aspartylglucosaminidase, has been identified
as a major venom constituent of two parasitoid
wasps.
Cyberbugs: Military and non-military
research and applications
A. Behennah, 1829 Laval Avenue, Victoria,
B. C.
Within the past 20 years, a series of
experiments have attempted to hybridize
insects with technology for military or
security purposes. Hymenoptera were applied
to the detection of explosives and land-mines,
and electronics implanted into muscle and
nerve tissues remade cockroaches, moths, and
beetles into remote-controlled bio-robots.
Drosophila suzukii in the D. suzukii world:
Humidity decreases density-dependent
competition
C. Hodson, S. Dhanani, A. Hoi, A. Chubaty
and F. Simon, Department of Biological
Sciences, Simon Fraser University, Burnaby,
B.C.
Humidity has been suggested to be
important for Drosophila suzukii
development; However, how it mediates
competition has not been described
previously. An examination of density-
dependent competition under variation in
humidity of D. suzukii suggests that high
humidity reduces the consequences of
competition at high densities.
Transgenerational Effects on Disease
Resistance in an Insect Herbivore
G. Olson and J. Cory, Department of
Biological Sciences, Simon Fraser University,
Burnaby, B.C.
The western tent caterpillar undergoes
dramatic population cycles that coincide with
viral epizootics. Our research investigates how
changes in dietary factors related to density
altered disease resistance over two
generations. Contrary to expectations, our
findings indicate that dietary stressors may
enhance disease resistance, leading to more
disease-resistant populations.
J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3
Web-reduction behaviour in black widows:
A story of attraction, courtship,
manipulation, and rivalry
C. Scott, D. Kirk, S. McCann and G. Gries,
Department of Biological Sciences, Simon
Fraser University, Burnaby, B.C.
Western black widow females attract males
with a silk-borne sex pheromone. During
courtship, males often engage in ‘web-
reduction’ — dismantling and bundling up
parts of the female’s web. We present data
from a field experiment demonstrating that
web-reduction functions to decrease web
attractiveness, thereby limiting the arrival of
male competitors.
How to kill a parasite: Transcriptional
responses in a Drosophila defensive
symbiosis
P. Hamilton, J. Leong, B. Koop and S.
Perlman, Department of Biology, University of
Victoria, Victoria, B.C.
Symbioses of insects can be critical to host
defense. Drosophila neotestacea is defended
against a nematode parasite by the bacterium
Spiroplasma, but the mechanism of this
defense is unknown. Transcriptome
sequencing in this system shows that the
production of toxins by Spiroplasma is the
most likely cause of defense.
Population dynamics of a tritrophic food
chain in a warming world: A modeling
approach
M. Orobko, F. Simon and B. Roitberg,
Department of Biological Sciences, Simon
Fraser University, Burnaby, B.C.
We simulated varying levels of heat waves,
along with predicted mean temperature
increases, in a model of a tritrophic food chain
with organisms whose performances were
temperature-dependent. We found that heat
waves could lead to an increased risk of
extinetion in these communities.
Exploring the temporal and dose-
dependent immune response to baculovirus
in an insect
J. Scholefield, I. Shikano, V. Fung, and J.
Cory, Department of Biological Sciences,
Simon Fraser University, Burnaby, B. C.
We exposed the cabbage looper,
Trichoplusia ni, to different doses of a
baculovirus, and measured the haemocyte
45
response at different time periods following
exposure. Changes in haemocyte type and
density could affect within-host competition
with other pathogens. The changes have
important evolutionary consequenees for the
evolution of virulenee and insect population
management.
How do entomopathogenic fungi and
parasitoids interact over a long term to
control aphids in greenhouses?
Y. Norouzi, J. Cory and D. Gillespie,
Department of Biological Sciences, Simon
Fraser University, Burnaby, B.C., and
Agriculture & Agri-Food Canada, Agassiz,
B. C.
Beauveria bassiana (strain GHA) in the
commercialized form, BotaniGard, had a
positive interaction with a parasitoid Aphidius
matricariae. In the six- week period, the use of
both biocontrol agents together resulted in
fewer aphids and more parasitoid mummies
on the plants than any of those biocontrol
agents alone.
A social raptor exploits the absconding
response of Neotropical social wasps in
order to prey on their nests
S. McCann, O. Moeri, T. Jones, C. Seott, G.
Khaskin, R. Gries, S. O’Donnell and G. Gries,
Department of Biological Sciences, Simon
Fraser University, Burnaby, B.C. and
Department of Biodiversity, Earth and
Environmental Science, Drexel University,
Philadelphia, PA, USA.
Red-throated Caraearas are faleonid
raptors that speeialize in the brood of social
wasps. We tested the hypothesis that they use
repellents to fend off wasps by chemically
analyzing the birds’ feather and feet and
video-recording nest attacks. We conelude that
caraearas use behavioural manipulation to
subdue their prey.
Anopheles gambiae alters blood-feeding
behavior in response to a host protected
with the new repellent 3c(3,6)
C. Hudson and B. Roitberg, Department of
Biological Sciences, Simon Fraser University,
Burnaby, B.C.
Anopheles gambiae is a vector of
Plasmodium spp., which cause malaria. We
evaluated bloodhost-seeking behaviour of A.
gambiae when the host is protected by the
46
chemical 3c(3,6). We compared our results
with DEET and found that 3c(3,6) may be an
effective new chemical to repel A. gambiae.
We can't be friends: Interspecific
aggressive competitive behaviour of
Drosophila suzukii and Drosophila
melanogaster females when forced to share
a common resource
T. Dancau, T.L.M. Stemberger, B. Roitberg,
Department of Biological Sciences, Simon
Fraser University, Burnaby, B.C.
Drosophila suzukii differs from all other
Drosophila by ovipositing in fresh rather than
rotting fruits (Hauser 2011). When forced to
utilize the same resources as D. melanogaster,
D. suzukii performs poorly (Stemberger, pers
comm). This study explores one aspect of
competitive behaviours between these two
species.
Insect community dynamics in a high-
Arctic ecosystem
S. Robinson and G. Henry, University of
British Columbia, Vancouver, B.C.
Climate change is expected to alter the
dynamics of high-Arctic ecosystems. Plant
communities have been studied in many high-
Arctic ecosystems, but there are relatively few
studies of insect communities, and even fewer
on how these communities change throughout
the short snow-free season. Having this
information is important in the context of
pollination services to flowering plants.
During the summer of 2012, we eonducted
bowl trapping and hand-netting every two
days, in order to survey the overall insect
community as well as important floral visitors,
at Alexandra Fiord, Ellesmere Island,
Nunavut. The dominant floral visitors were
primarily dipterans: Syrphidae of the genus
Eupeodes, Muscidae of the genera Phaonia
and Drymeia. Arctic bumblebees (Bombus
polaris) were also found, but at nowhere near
the frequency of the dipterans. Both families
of dipterans were also found to visit during
distinctly different times of the snow-free
season. We present some of our preliminary
findings on how this community changes
throughout the season, and what changes in
visitation may mean for a warming arctic.
J. Entomol. Soc. Brit. Columbia 110, December 2013
Pheromone-mediated defensive behaviour
of Dolichvespula maculata.
S. Ibarra, S. McCann, R. Gries, H. Zhai, and
G. Gries, Department of Biological Sciences,
Simon Fraser University, Burnaby, B. C.
We tested pheromone-mediated defensive
behavior by Dolichovespula maculata hornets
in response to venom-gland extracts from
conspecifics. In venom-gland extracts of D.
maculata, we identified seven components
that, when tested as a synthetic blend, induced
defensive behavior similar to venom-gland
extracts.
Patch-size and temperature-interaction
effects on the predation of pea aphids
{Acrythosiphon pisum) by the Asian
Ladybird beetle, Harmonia axyridis
D. Quach, J. McKenzie and D. Gillespie,
Department of Biological Sciences, Simon
Fraser University, Burnaby, B.C. and
Agriculture & Agri-Food Canada, Agassiz,
B.C.
In order to study the combined effects of
rearing temperature, foraging patch size, and
foraging temperature on the predation rate of
pea aphids by the Asian Ladybird beetle, a
2x2x2 factorial design experiment was done
using rearing temperature, foraging
temperature, and arena size as variables.
Exposure temperature had the strongest effect
on predation rate, whereas a strong interaction
between exposure temperature and arena size
was observed.
Effects of poplar phenolics on the fitness
and behaviour of Chaitophorus aphids
A. Wong, P. Constabel and S. Perlman,
Department of Biology, University of Victoria,
Victoria, B.C.
Effects of phenolic secondary metabolites
on phloem feeders was investigated using
transgenic poplar with high tannins and low
phenolic glycosides in bioassays with
specialist Chaitophorus aphids. Aphids had
higher fecundity on transgenic plants, but
preferred wild-type tissue. Phenolic glycosides
were identified in aphid extracts providing
support for their presence in phloem and
ingestion during aphid feeding.
*■
I
-V>|
NOTICE TO CONTRIBUTORS
The Journal of the Entomological Society of British Columbia is published once a year in December and
articles are also published online as they are accepted. The JESBC provides immediate open access to its
content on the principle that making research freely available to the public supports a greater global
exchange of knowledge. Manuscripts dealing with all facets of the study of arthropods will be considered for
publication. Submissions may be from regions beyond British Columbia and the surrounding jurisdictions
provided that content is applicable or of interest to a regional audience. Review and forum articles are
encouraged. Authors need not be members of the Society. Manuscripts are peer-reviewed, a process that
takes about six weeks. This journal utilizes the LOCKSS system to create a distributed archiving system
among participating libraries and permits those libraries to create permanent archives of the journal for
purposes of preservation and restoration.
Submissions. The JESBC accepts only electronic submissions via the journal homepage: http://
journal.entsocbc.ca/. Style and format guidelines, open access fees, and other information for authors can be
found at the journal homepage.
Scientific notes. Scientific notes are an acceptable format for short reports. They must be two journal pages
maximum, about four manuscript pages. Scientific Notes do not use traditional section headings, and the
term "Scientific Note" precedes the title. A short abstract may be included if desired. Notes are peer-
reviewed in the same manner as regular submissions.
Review and forum articles - Please submit ideas for review or forum articles for consideration to the editor
at
[email protected]. Reviews should provide comprehensive, referenced coverage of current and
emerging scientific thought on entomological subjects. Forum articles of about 1000 words in length should
provide opinions, backed by fact, on topics of interest to entomologists and to the general public. Both
review and forum submissions are only published in the journal following full and rigorous peer review.
Electronic reprints. As an open access journal, article reprints from all issues of the journal can be
downloaded as PDFs from the journal homepage.
Back issues. Electronic back issues are available online free-of-charge. Print back issues of many volumes of
the journal are available at $15 each.
Membership in the Society is open to anyone with an interest in entomology. Dues are $20 per year for
domestic memberships, $10 for students, and $25 for international memberships. Members receive electronic
copies of Boreus (the newsletter of the Society), and when published, occasional papers. There is a further
$10 (domestic) or $15 (international) fee for members interested in receiving a print copy of the journal.
Membership and membership renewals can be purchased at: http://blogs.sfu.ca/groups/esbc/membership/.
Journal of the
Entomological Society of British Columbia
Volume 1 1 0 Issued December 2013 ISSN #007 1 -0733
Directors of the Entomological Society of British Columbia, 2013-2014 2
G.R. Pohl and R.A. Cannings. The new checklist of British Columbia Lepidoptera and
how it came to be 3
A. Pantoja, D.S. Sikes, A.M. Hagerty, Susan Y. Emmert, and Silvia Rondon. Ground
beetle (Coleoptera: Carabidae) assemblages in the Conservation Reserve Program crop
rotation systems in interior Alaska 6
S. Mathur, D.A. Raworth, K.S. Pike, and S.M. Fitzpatrick. Diagnostic molecular markers
to detect and identify primary parasitoids (Hymenoptera: Braconidae) of Ericaphis
fimbriata on highbush blueberry 19
A.J. Stock, T.L. Pratt, and J.H. Borden. Seasonal flight pattern of the Western Balsam Bark
Beetle, Dryocoetes confusus Swaine (Coleoptera: Curculionidae), in central British
Columbia 27
SCIENTIFIC NOTES
Chris J.K. MacQuarrie, Daryl J. Williams, and David W. Langor. Update on the
establishment of birch leafminer parasitoids in western Canada 35
M. Jackson, C. Pyles, S. Breton, T. J. S. McMahon and P. Belton. British Columbia’s 50th
mosquito species, Aedes schizopinax 38
ANNUAL GENERAL MEETfNG ABSTRACTS
Entomological Society of British Columbia Annual General Meeting Symposium Abstracts:
The Rise and Fall of the Honeybee 40
Entomological Society of British Columbia Annual General Meeting Presentation
Abstracts 44
NOTICE TO CONTRIBUTORS Inside Back Cover